List database


<
# MySQL hash MySQL password
637,460,001 *41AA66F3ED7986926E8485D171D65F12D1036AC5 lesfrick
637,460,002 *41ABE8F4EEEC5EBF3420322C089321FB1155064C lesleysturrock
637,460,003 *41A3DDFA80938E84971C5DA2A598BAA2F97890CB LEVI.ROCHELL
637,460,004 *41A6A134D6E07AB04E63588D88AC4B9BC97C2DEB lhb1
637,460,005 *41AB2934A3249025D7A2062BAD86B8E3B67DDC04 linda.knab
637,460,006 *41A86B62DC6B79CA8B14E56326E780E1073475E2 [email protected]
637,460,007 *41A56A8C0536965A270E265D25FF3460CC1C8304 LINYANGALE
637,460,008 *41AA3FC6D059CD304EE824F390C9343E764E7C7E LITE-BRITE-STYLE
637,460,009 *41A07BEED5BB49EC7B3FE319F5A67F2FF42380BC [email protected]
637,460,010 *41ACF2F33860B0939F7CB4CB4731A825B5A5E187 logopedics1
637,460,011 *41A1DD0F45CF4B2EEEFBDA0B439C79B095B5999E LONESTARSTOMP.BLOGSPOT.COM
637,460,012 *41A46C6E943F871BB07EB9DA6C12E8EA4E51BC1D LORELEISTEVENS
637,460,013 *41A8BD45F99E1B351B8A4592C56C4CE24C6B49DA LOUEDST4
637,460,014 *41ABA5488E98EA476CF19DBE36D30697B4B306B0 LOVEGONES
637,460,015 *41A8C7EF06B755ACDA955CEAC54F6D66D8446D10 [email protected]
637,460,016 *41A6AF056E8F95D3292772F064BEF30DF7326D0D [email protected]
637,460,017 *41A6FA7C0621EDEEC8EC30305A20F28FEE9CBEE4 [email protected]
637,460,018 *41ACBC26BA93ADDEDE91738668FDC9A3F9268DDE L-VS.-S
637,460,019 *41AFB28565DACE7BA4070BEB47D50AB3382DCECC LWILLSTEDT
637,460,020 *41A09DFEB2A2FCDD1E6B8BEB048BC29172011EDE $m411.ye4
637,460,021 *41A45E8CE2CDBC65A338FE9F9A7342F06D804F69 m4ss-spec
637,460,022 *41A01DCC4941E5B78E49A7EFA45059B1F21D1ECD mahitab.karram
637,460,023 *41A69E8DC52A65A047629BC6980C7EE5FC3BD3B2 MAILBOXING
637,460,024 *41A1D13BB259AFA92CE5510C03DCD95B0A0AFED3 MARCO.FITCH
637,460,025 *41A5DDE76EAFB197F8DAB54D1187346D12A17AC5 MARIJA-ARSENOVIC
637,460,026 *41AF4C62F9A77BFA4C277F19266170F2C26DBF47 marivaudent
637,460,027 *41ABFF280F6FEEA1E3D3993F64281540A0DC581B MATSHANEBORG
637,460,028 *41A54F2E570B272291B784C0726F94C0014DA974 MATTBRIDGET
637,460,029 *41A6A31B793C3A44E127E8F0D85F1C7E77D6CFDD MAUNGIE1
637,460,030 *41A172F607936EB47A1444F09A8376B0FCFA92C9 MAX.DEATHERAGE
637,460,031 *41A59E6A175B29FCF7F52624DC1C312D92B1CA23 MICHAEL.AISEN
637,460,032 *41AA52F82EB6AF5423855CC4C0F03B743D001E98 michael-bonick
637,460,033 *41ABBD1342EF6AC505D0675CF39F757ABD3F022E michalebasulto
637,460,034 *41A575E93618F8CC802098F69983D2CF2B4110CD MICKO MARTIN
637,460,035 *41A2DDD4203704B8F891AD26F2B863A57D94554E MILO.ROHER
637,460,036 *41AD5749406ACA2B86E60FC1EC6DFC180E11A924 MIRACLE-SONG-/-SLEEP
637,460,037 *41A377E75341F0DB550D5F3C170CB907CF684647 MISLOIN
637,460,038 *41ACC8D4CE71F6979D2CA76C8F62EDAE035562D2 MITAIT
637,460,039 *41A0C4EF01E70DC348F8E81E4799541145DC2A35 mmodeler
637,460,040 *41ACA27266D2B129263B647536040F31DA2D2582 [email protected]
637,460,041 *41A552D1EEF6B9060C1CC6A52A73FBA830F85840 MONROEBOURGET
637,460,042 *41AFA8E951F8CC9A10438E90B42CD5B64DA822E9 MONROEQASBA
637,460,043 *41A36AEF20BF039F4128BA1E27868978CF9B3963 MONUMENTO.AS.BANDEIRAS
637,460,044 *41AC37487773D1AF1C3409676BC748E0491A0FA7 MOREGUESTWORKERS
637,460,045 *41A5B078CE9F4D6EAB3D13A0DEDB244EBE3BD324 MÖRKROSARÖDA
637,460,046 *41AAAEF6261B00D1A13C32AE6B0B290CB2CF823E mortonkatos
637,460,047 *41A16BDC7DA7CEAF320A25B3D30C23A81299E65C musaddiq-hussain
637,460,048 *41A3AD6D7E67787972A685E019E1E45FBB0F4A28 my lordHAMLET Ha
637,460,049 *41A3BDCEAB1BC70C9D90B1E5D02EC39B2A906784 MYRONKONOWAL
637,460,050 *41A03BC5AA214EB61E98AF29D98A11A17F2F7026 N0N9RE94R0US
637,460,051 *41AAE3A5C8E6D84D2AB560D0A0B39D7326BFFC9B NAPOLEONSCARSET
637,460,052 *41AF39D593E578361351A737EEF90E2046F1018C narrerannos
637,460,053 *41A113E7E4F80695E024F199B1703F3E60C5E2C4 NATHAN-BUCHER
637,460,054 *41AA32B99A09AC8F37B4009E3ED3AAA527C4D3D0 NELLIPE3
637,460,055 *41A313335D2104AD4376E3C491D936B9C0CBBCBF NFA/
637,460,056 *41A16D2421CE267DEE78C7C64801DB44008902D8 nicholas-messer
637,460,057 *41A6B8A48623410C22DFFE32C7C784401D571E5C nicole.nauman
637,460,058 *41AFCB1F9D20AADE2588D9A12B67933B3C084DF5 NIMISHTA
637,460,059 *41AA8259F1FF6C85364EC330BB510236E5B25B84 ninarfas8
637,460,060 *41A6B009DADA3041A53F1604126DBB19DBF6FC87 NIRVANATAYLOR
637,460,061 *41A4D7A75582AD480AC03D57448B32E83B3DBFE9 NMARSUPIAL.MOLE
637,460,062 *41ACB793B4754798C8F399C5984C57CF8DC5EBE2 NOBLE.MOOR
637,460,063 *41A0AC18F590AB8822B06DBA82DFCB6EEA1153EB NODRIZA6
637,460,064 *41AF3D701E9FF0805DE90D360110BD0BF782BDF7 NONIMPORTANTR
637,460,065 *41A94EDE5F3EFD3ADF41D706DF7259C7E06B305A NORBERTMCCURDY
637,460,066 *41A7950ACD63CD40F03F91DB2B557D4F67567543 NOR+H3RNMOS+
637,460,067 *41A90D22924EBB3B2E952A002F6C1B107BFCCC0B NORMAND.GEDYE
637,460,068 *41A22BE0836D503FE85D41DD4C56B05A81FE62BE normotensive7
637,460,069 *41A62084CAB065BDBC1966DCBA97CC17C96F9778 nsuim
637,460,070 *41A0962426F66BB59AAB747DA09C72121CD51695 NYABABKEUN
637,460,071 *41ACD2D2CACFE482C243706BEC4CE813581A5F46 oacis
637,460,072 *41AD02ACAB6177DC0FD133E152A945193A2E0B13 ODYSSEY1996
637,460,073 *41A99031F0C2D0417BC9D3EE1A64AF7C750A0029 OELKRÜGLEIN
637,460,074 *41AB5DAE7DDD2BE3D8273A2E607427F675B29762 ofcap
637,460,075 *41A6D5D7AB021ECAEAC488CC11DE201631F15C5C olinloarca
637,460,076 *41A13C68FB9BD6953B7106DFAD93E2D9433BF624 [email protected]
637,460,077 *41A494F6C2B6A1D5E00064C6B1784079445EE9F6 OM1{
637,460,078 *41A9463D032977A24DB9A6E5EDF782DC3C161034 ONCE.UPON.A.TIME.IN.THE.WEST.(HARMONICA)
637,460,079 *41A14F79FDB88FFD4BEFB2221AB5DE6926054564 OPPSPEDD
637,460,080 *41ACEA226B241FFF9B1FACD10152DE2F981007C3 ORDERING
637,460,081 *41A881BE636EEBD6038F18D4A4CFC4FA5FEA3862 orvilleluber
637,460,082 *41AE6E0D17724D7E073AEE5F9CB36001B5CF2183 OSCAR.HENNEBERG
637,460,083 *41A460DE8C7C79FA392A6BB8E2BC4C181C712854 OUZILOU
637,460,084 *41A100E259CAE8EDDF26F506B2D7777A3715C03B PARKER.WUBNIG
637,460,085 *41A84C9D3333FF408CFC76DC28B913C21A15B1D6 PATRICIA.PAOLI
637,460,086 *41ADA863EE072F4B4F205A43225F51232DB9FB50 PATTON85
637,460,087 *41A3A8E1E09303DB52D17156202F851C9D729849 PB ~0~O UU
637,460,088 *41A4C68D1D822F0C4EE577CE4483390C9D6CF503 [email protected]
637,460,089 *41AD94743AAF779CB207E7D084CE6557CB75A5AD PENTANGL8
637,460,090 *41A31D4071B06AA82FAC1DD849E88B8A2C123727 PETARNASED
637,460,091 *41AE54F5D77E6E738FCF9400E018A9DB94F02FB4 PHILIPCORLESS
637,460,092 *41A921BB8A3EB51E5B1E5460012A7BF17C8BE0F5 phishp
637,460,093 *41A82291F2BC97A0BB7B71581A749718C9168DB3 pour-me-a-pint-as-well
637,460,094 *41A9642F28D553616064C7E5C62EC62A1F3672D6 PREAMBLED123
637,460,095 *41A8D5D89D2A301D290C5F81DDF68A99EFB099B9 PREDILIG1
637,460,096 *41ABA91E2058E6EC07540A1F6F663011A405ADDE prenatal
637,460,097 *41A10DAFCFC52EB94093BA07FE5E606FA01D7439 PRIGRNI8
637,460,098 *41AE344253161C88718A666B22D84BF47D5015F8 PRINCESSKANDEE_21
637,460,099 *41ACEF8D14C060EF2BC40E494172B15B313339B1 [email protected]
637,460,100 *41AECA9CEBA35E13467087344BCA476D76B9CA89 qjwp
637,460,101 *41A33522CA0C3DB78812EAA5FB8E8B6791601770 QUINN.PELO
637,460,102 *41A45A6DF00AC1A5F3515BDD42A9F46D1E25F2A9 RABARBARO6
637,460,103 *41ABD249EC8EF8BE06F174F7E863CB87A0381E59 ramesh-puri
637,460,104 *41A44D861DAF55A789CDD58FE82F96C55DBB12D7 randyrotter
637,460,105 *41AD61BF9D41F012656B066959CCB802F42CF42B [email protected]
637,460,106 *41A7383CABD5F2D74E5B39458C86D283A14E0608 RAOMILAN
637,460,107 *41A94A74FA44C642180979F593BBFD569F742C17 RAPHAEL.KLINKO
637,460,108 *41A90C2B2D822E434F8699F043242BF1671CCBE4 raybrummer
637,460,109 *41A5218E23826C744CD930DD33A73E801948F1C8 REA.GUEVARRA
637,460,110 *41AFB0AD6021CFE3BD27483B3E95096D5D465463 [email protected][email protected]+!on
637,460,111 *41A3E50294928319DAFF55085D23F10223E33C4C REQUIEN MASS: LUX AETERNA - CUM SANTUS TUIS
637,460,112 *41A237918C3B1388F01DE34B770D774218306A72 RESKIDED0
637,460,113 *41A883C1BE2A867599D8252E2C3B5B79D9F7E564 REVIVIFICARDES
637,460,114 *41A8EDC117D8CBC1C9BCDBEEEA2AC6E2EA9C463B [email protected]
637,460,115 *41A3D065AC2B3F50CA43B0AEEB8EB9FD26936040 rien.qu'un.homme
637,460,116 *41ACA05C6DD21CB274B3A43E4B484D93048C2AA2 RODNEY.WANK
637,460,117 *41A34203BFC4D9106BCAF83A3EC19BCE50616993 ROD.PHONHARATH
637,460,118 *41A384AA24BACB24AF525A245D6EE5CFDEB2D38E ROMADINOTTE(FEAT.R.SINIGALLIAEFRANKIEHINGR)
637,460,119 *41A3AC83F981373EF1E227ADC2ACAF0C99060C18 romanhood2
637,460,120 *41A62AA0C002A5CFEFA67EF860CCC3470CFC12F6 RONALDDESNOYERS
637,460,121 *41A1FBFC578EE30745C8F699879B6E0CC134CED5 RONALDDORMIDO
637,460,122 *41A1FF7300DF8C8850C12127E172ECA2052DF4EF RONCARMICHAEL
637,460,123 *41A52F55A80975D00D987C300E8B96EEBFD15515 russelsancho
637,460,124 *41A4FF9C692B874F36D4B6D9E7EC5FA77B2428ED ruxgranted
637,460,125 *41A23218C3FE52D48FCA2032DED21D152F22180A RYAN.MASCIANTONIO
637,460,126 *41A1FB74F36C41768BA43533A2B93B62236F63C9 RYPRŪSIUOSE
637,460,127 *41A53EFB642A0D252520E3768C4C0BEE3F4EEB91 s1801
637,460,128 *41A874FE50123631A069BE3B739C7FACA5DD66F3 SAL.DECLET
637,460,129 *41A4DEA3087FF5163C16D472ED78E7BE860475D9 SAMMIEFESPERMAN
637,460,130 *41A2516F74130E11A72C0963FAFB0EF76F6BA6B6 SANKNGAR1
637,460,131 *41AB66FAFA95EF24C26A2019DFDB350E4C1E2469 SARELLEBIL9
637,460,132 *41AA7A9FA68D71E160270F7582868593EF6DB5F3 saulrathe
637,460,133 *41A8B8B573C96811E3ACCB312AC24B9BC341D5EC [email protected]!n9
637,460,134 *41AB3B75E174EBFA6494716CA3B809CBBA1E59FB [email protected]
637,460,135 *41ACCCED894B503DAA1BB8D552B2FAF2B5B94037 SEHR RANA
637,460,136 *41AEE428828F8DA975BCDD954DEA41B56820EC77 SEJAVKA
637,460,137 *41AD2571951FCF8439CC489D714861B316783B2F SESOLPAH9
637,460,138 *41A9461FFF4D89EDAF621C1040A01C56B2B11F2B SESQUISALT0
637,460,139 *41A90162B28AE0F61DA3AF8721A80DC9E2588B41 SHAILENA2
637,460,140 *41A08BFE92FA77F204ADE522F6738E5BD7E608B3 SHERLYN113
637,460,141 *41A1FA1E59DD59AADFE1EC4A52CF744B640ADC04 SHERRIDANK
637,460,142 *41A2AEDBAE605990C82FCF573EE501B3990E7D98 shout-yourself-to-death
637,460,143 *41AFFAE7FBAADF1889D99E205C5612264185D0E1 shuyouging
637,460,144 *41AE86AF268CA5B6AE9920D443F3F9F462B99292 siraj
637,460,145 *41AE224A6A2CE25A961DCB8A14BA075B9F2B7874 SNEHIPATEL
637,460,146 *41A423EBDEA598FDDAFA38996E68E7F59E956E04 SOLITARY.VOYAGE.(RE-RECORDED)
637,460,147 *41A2D5606ABC78B26E1F1FACABDCA51AD9CC3C33 solokin
637,460,148 *41A7D8553B0D29CEE37547BF60B718379A6C14F3 SOTTILIZZASSES
637,460,149 *41AF38A8A8F1D81AF74B72589FF02F2F16BB5CF0 spannend77
637,460,150 *41A3986E5FD93C715E4ED2F90EE459E34EE7EA16 Splat*.*.*q===3
637,460,151 *41A85CC0DE1385B2654B9560ECA0966A833B9B5F sselmart7
637,460,152 *41A087D7C3A1A7BF7EC06AE4EB7473280C639C1C STARTREKARCTIC
637,460,153 *41AEA24A5C66B1EB5EBD6623572B30A85893C4F6 STEPHANIESTEFANI
637,460,154 *41AACF3D0AE20810E8BA65779AC7BE1BFA3002C7 STILIETE
637,460,155 *41AC4CDAB70F12723AC82211081604A28EE54CB0 STRATEGICCONTEXT5
637,460,156 *41ABF2D4FD6B80230EAE2F4E5279740A959F9A2E [email protected]
637,460,157 *41AAAC64464A895E6692B11481A21BF3DEF7B9A2 SUNG.RUPEL
637,460,158 *41AAC93A7C97E0CCB4CA181A60DEC8AB6DEFCE40 suniste6
637,460,159 *41AB03DABC1215078E0E17D0D78B2576788419C1 SUORUUDEN
637,460,160 *41A64FDFE74205D7B2ED6CCDE88F92E42DFCEB8C SURYANILING
637,460,161 *41ACC68C2E245A3A915E89223F65CA6707ECA3EF [email protected]
637,460,162 *41A5333B8964C7EC4A016F00122E01D64F3D007B SXOLIKH1
637,460,163 *41AFDA2B26B40D60BCE078F67C5027B5C58D7111 SYKERTYNYTTÄ
637,460,164 *41A5368712F55D5CF19F484D5C6F8D88F6068EA4 TAE823
637,460,165 *41AC8BBA82989946B263A9955D14FEADE75853D2 [email protected]
637,460,166 *41ABABE919C4F7239FD69DF1FED1BC63162E125E TÂRTE
637,460,167 *41A9197C3BB092DD8A0E746EC5A778EB2D765D1E TEMPLOMARÓL
637,460,168 *41ABFEC6EF210F1B20ABF4EDF87365AA00DE7C4B terilbah
637,460,169 *41AA920B053065A042FEC3F7322DC80CCAA1F620 THEXXXX55
637,460,170 *41AA2BB8F68552C7D5280CC8D433236A2EE719AA TIJD’’
637,460,171 *41ADD02A4EB1B76BDF972845AF72F97E507C8059 TILBUDSGIVERENS2
637,460,172 *41A1AC9E4B4B6B83A1263BE26EDF922C97964B89 TIMKOMBAT7
637,460,173 *41ABF039FFCB44C05D7C9A6363AB65695E0A949D timmystrope
637,460,174 *41A8C34D5CE2DBF8A1F2548C403F416ED9D576EB TINKLEJ
637,460,175 *41A5364B7400CBB571909A33C987D39988061065 [email protected]
637,460,176 *41A5C54CA8031443EE7539B5E8952B2FA77904D4 TMUDLONG
637,460,177 *41A92CABF1D90E878C589FFDBAF2D11F8301FABE TNEMETKARTSFOLREV0
637,460,178 *41AF378C10FDA0448EED546153FBC8C1787667CE TOMXFILES2
637,460,179 *41A736EEC3EE33F971FB2D420DE4972D122E40A3 TONEYSLAMA
637,460,180 *41A3EFA818FFC66508F5FC6BFAF0EC98F514E000 topsman6
637,460,181 *41ADCE027BD8EC9FDC27A5C2DF6FA4B541CD90A4 TRENT.TOHEN
637,460,182 *41AB3398F9A32A73DC8C6E9D7721B58CDC90DEB6 TRICATYM9
637,460,183 *41AAEDBAE583086AACED709FBE0CCA86D78692CA TRIENTALS6
637,460,184 *41A53228B95BEBFD49BF8EC9CB56255CE666498D troy-ditton
637,460,185 *41A5FAEFDC23A1850A0E85EBCC23FBC37E6021A6 trumanshield
637,460,186 *41A7E83223A12E5B1E48C5C2DCC0D76F3261CB24 TURBIN4T0C0NC4VE
637,460,187 *41ADB270C51674BF810918189DB371116229E7C2 TW下出現,通過獨立設置MEDIAWIKI
637,460,188 *41AC5EA41ECAEA9B40C69BFE3923DF4949665CE1 TYLER WAYNE COUNCIL
637,460,189 *41A561571BE5FEEB279058A53F9994D89E2F314E TYLERWYATT
637,460,190 *41AA9D71DAC1D8192F3E0AC7C077F20189E37A77 tyne-haverkate
637,460,191 *41A034FD0F9848B36D6DB646DF729CF207B08D97 TYREESTEARN
637,460,192 *41ADEC705BDB3A14D9D031852E5ACC9C46307A6A TYRELL.ALLAIRE
637,460,193 *41A439AEFEC56A75E3DC9BC58084299C9F0EB776 tyronemays
637,460,194 *41A076E754C337B649643E3D69182488B36BD0E4 UAJABUAJAB
637,460,195 *41A6CF2D673BBE1CFFBACDF22847F3B069F390FE UAKERKAR
637,460,196 *41A97B0A67830DC997F60DB1BAAAF600C0965BF6 [email protected]
637,460,197 *41A726D64AEDC3E66C1D23E77AE926EB3BD0FE17 UIPICINUED
637,460,198 *41A7C82660B2C23DD08681D7E3C16B899C8EF661 UITFLAPTE2
637,460,199 *41A942D6C931556D87978ADCC141A290DCDC641A UMENNISES
637,460,200 *41AB7197A22F28D1BECB8BD067478A7C332B29C7 [email protected]
637,460,201 *41A2B5606090F068011D3AB3682F3E0E96ED0018 utopianist
637,460,202 *41A9F5542553A50E843ACC89F7CC3C39DF7BB898 VALHALLAAIRHEADING
637,460,203 *41A1B42FE1E4F0DF477C1F578C4157B04909E57E VALITSAKI1
637,460,204 *41A84C4CBADA83B5C44536C3D90CE503DE47DDC4 valletta.lewis
637,460,205 *41A350F9E225F13B5D2983CB5CE14DE3AA20B704 VALTALTY
637,460,206 *41A5A3429821AC13FB6903C4901F9025EB93D80D VANDORICHARDO
637,460,207 *41A902A3B7CB5DC514897692C3C2C5E97E045264 VERLAENGERT2
637,460,208 *41A88F8FDC0B6F8586EF4E9C9FE81062315588C0 VERNSTOLTENBURG
637,460,209 *41A579FD709CD773E5AF181FFE02AB32A84948BE VH`A
637,460,210 *41A7ED8CCF3EACE0D34685C7FEAEDC56DFBE5831 VIALEANNBAGAHANSOL
637,460,211 *41ACC478E28F7710CBFE786CFC509C228213BA59 vickipannellmaxeyharrison
637,460,212 *41AEA8E8E217C5A924B16467143AEC6E02D4B2D1 vinodh.gurusamy
637,460,213 *41A15F56F66CDDDC4AD934422364775083233765 VIRGIL.BRANAUGH
637,460,214 *41A97BA4EDD277F07063E3D979AB13A26FEB04B4 VISHAPOLI SCALPEL
637,460,215 *41A54DF38B693082048E0AE07214CC433FE7A521 VISIONARIES2
637,460,216 *41A568E4A3D7A7FB383448835BB91BAB74FE3953 [email protected]
637,460,217 *41ABBD1D50FAF32D7D8BFF9C6841454347EA5927 VTECHLUD2
637,460,218 *41AF95874951B32CDE628ABD42E844FFB037E517 vwsc
637,460,219 *41A71CE38908EA4ACB231D77A40430901483267F walkerpanuccio
637,460,220 *41A5CA7C0B04232A06DE8A08F65A8EEFCCD506C4 walloped
637,460,221 *41A5385F275C4A06C79110E20BB6996055EFFF23 WALTER.RINGO
637,460,222 *41ACBDA543843FF5DE772544AA08A8A1AD6990D0 [email protected]
637,460,223 *41AAC075278C75ED21BE8F9463248355DDFDD726 WAN MASTURA LEE
637,460,224 *41ACA2AD9721238C5C8629AF82E70DBCBCCCC302 WARNERKEEGAN
637,460,225 *41A27A7A15177F0A447F580F6F0C1648A33D6F16 WAYAMBATOURISM
637,460,226 *41A875099B499314C0CC1159D6C3097EE46DA13B WELDONKUCHLER
637,460,227 *41AA51082030497277B383835F75E02B8A6E27E8 [email protected]
637,460,228 *41ADFB2BD70B2FD7738CFA2AE1A2D6575CB83B13 wernerhemken
637,460,229 *41AAB98BE7FD7228DCD0F45DE1FC594E65C009B1 wesley.couturier
637,460,230 *41AE381047298645CD2426D1153091DB343BB388 Whatever!.(Marcel.Woods.remix)
637,460,231 *41A7F234D8CE5628C442C090B8836C37E483C9E7 what-it-might-be-(feat-wais-p)
637,460,232 *41A8CE4B9487B3B810E4C1FB70AF16D856543E87 WHIMPERERS
637,460,233 *41AF63D2C92083649FB51C069A033C1C55519DFF willisgemaehlich
637,460,234 *41ADE4C62C9D4BB3AA841F1A1ECF9848380B81B1 WILSON.COCORAN
637,460,235 *41ACE99900FFBC15DC12298E02CE578A56717693 [email protected]
637,460,236 *41AD94A7C9B84E199EC25C0904B2198D0AAD739A [email protected]
637,460,237 *41A65DBAFA169499A2C6F347C3D641F725CC78F2 WINSTON.ROBARGE
637,460,238 *41A4680A5F6716366E2DBE8B64AC2785C10E96D9 woodroffe.11.0
637,460,239 *41A0E814708C9DE17721BEF797BD5017523D8900 WOODSRUN0
637,460,240 *41ADBC734AB4EC5A02288EB53D2DC11E4F2EF360 [email protected]
637,460,241 *41A8F0014E491D4E40CFDC1CC8A44F82CCFCFB78 [email protected]
637,460,242 *41AEE535772EC6A0F7D44456541B1B2D05E90ED4 [email protected]
637,460,243 *41A21237B380D2B6C2EB625677EC0A570A3FC333 wwwbadgerstategamesorg
637,460,244 *41A97C9F93A9E511826D255555E194D03E9D3181 WWW.INFORMDECISIONS.COM
637,460,245 *41A204041CD8D08034AB77940DEAC6772C468EAF WWWKIADEALERSPACOM
637,460,246 *41A129FCE086C4C92D71BA2AEE2416A87CC16B54 wwwpat-test-labelscouk
637,460,247 *41ACCC51A05184826276F9AE77CF420748E22E99 wyattgingerich
637,460,248 *41A0C0A49E28AB7D0452D2118813B4C848D82FA4 )X(~(#3
637,460,249 *41A5757500E357AB42D67B4336364A90A2A4872D [email protected]
637,460,250 *41A6842C62D600EA7AE3FA8AC43EE4E7B20F2124 [email protected]
637,460,251 *41A15DA48E24C5FB7205FB9DC1E9A0CEABE9DBFE Y246912
637,460,252 *41A5072215D9EDBB66061F1F5C083E6E97B791EC yassinehajouiratali
637,460,253 *41A281CFBE99C3EF8A7115D8EFFAA8B77398D14B yeniseian-indian
637,460,254 *41AB87693FA189B09BC4A76D8A1FAEC2E3D576A3 YESHAAR
637,460,255 *41AE6FC1FF123C1D55D35993BCF822CAA211517A [email protected]
637,460,256 *41A9B6E611F943506F022B546D84096B7C619A97 YHWHYHWHS
637,460,257 *41A9261BC9654AE057DDFD7BE88E2C23E9B83729 YKN>
637,460,258 *41AA075D55FD368F65541E321914F4B158F0E9FE YOAVUSHA
637,460,259 *41A74F9AEF394B3C6CD47109F3678FB5A06682C9 YOTHIN MUNGJAROEN
637,460,260 *41AA680E2FDCBF9B0C87E7F9D3E36F9B61AF923C YOU-CAN'T-GET-AWAY-FROM-IT
637,460,261 *41A3950E87AEADCDC6B9950B3116F884D7DC79F1 YUKIKO NG
637,460,262 *41A90CE844FAE4C37B00EF42A00BE2B296DB8CAE YUNIKO-MAGDUGO
637,460,263 *41A9B8ECFA45E9F5EF8AB09E2BF6FE191BBB567C Z35287
637,460,264 *41A983659E3B24C1C0EE9E7B2CC05B8E1296FEBB zaneelmira
637,460,265 *41A52F1F734EA2C764582999FB6E8B5B5D7BD14A [email protected]
637,460,266 *41A5CA6262CACA19C23FF9FE775073C9854BFC3F ZHAOXINS
637,460,267 *41A34BC27CB1F3D4491F8AF5FF5FB9B5CF3B1951 [email protected]
637,460,268 *41A73AD076C099D80F33CCCA60EF741B0A26DF46 [email protected]
637,460,269 *41AF9DA1BB2BC749B10F204BD680729B9BA8BA7A zhflssg
637,460,270 *41AB76A22B979064D541D1C6755E1BC9AC4C6950 ZIELENIĄCEGO
637,460,271 *41A1B64AC5D82C12A3063C91F41E408698BD4162 [email protected]
637,460,272 *41A22546B77F80C25FFD60D6D76DA7BB3FCD118A ZOZULINSKYY
637,460,273 *41A5D51971269991F24F044181A625F3ADD1E020 ZUS-V
637,460,274 *41A0216D54721460C544FCB737DAFACEF8834659 ÞVOTTAHELLIR
637,460,275 *41A6227FF50B8AD9C968033FABB38536BB810C9D «забіліли
637,460,276 *41A630596742E6645774CB1E8B0C792B18470541 ЛЕНИНТЬ
637,460,277 *41ABCDD75F051D45BF00C1B5812F81C10A5BE4D4 МАРУА́
637,460,278 *41A7F5AD504172BAD2DB6DE8D9F2DD6D36F135CB СОЛОМОН
637,460,279 *41AB46C714F20C971B0B096FB7F38DBDF47C0412 ЧАСЛАВСКУЮ
637,460,280 *41AF6A6DE211D8475FA573970558DE859506DDA8 恋愛・結婚篇(ISBN
637,460,281 *41A93243D5AF2BBEB6CF56DD9D2C5F36A474541F 09121991
637,460,282 *41ACB36DB8F09148510CA0C5763CA01D45277A28 (>_0)O~.q----3
637,460,283 *41A45F8A414FA19AD2DD3B36ED0BE0DDF88CAD76 0S5TI8O8YZ
637,460,284 *41AA494D132FBA9F82C6C49ADE1C565877E6E4A5 1010LBJB
637,460,285 *41A6BED1DF2C264BE9D67045A3722428878D4127 1314845 KOULUJEN JUMALANPALVELUKSIA ON J
637,460,286 *41A42AD252D340DB915F147ADF998B79B0EE4E2E 1391467 (-59-)-"-bagdad-cafe-,-"-cbs-,-109-
637,460,287 *41AD88E7532FB369139CB1B16CF1A435D336237A 14 MARKKLEEBERGER
637,460,288 *41A25325D0FEA66D5CF60226FB345F9745964BBC 1639755 dasfilmzentrumampotsdamerplatznimmtgestaltan.
637,460,289 *41AB147CC3CB611619918CDD72FA091D617FF112 1855424 JO.T
637,460,290 *41A35FD113FE7BFB0E2DCEB5947B8C1C2DC1B7A6 1.britisch-franzoesischer
637,460,291 *41A2216E5E8C54C45B315F66493A3A5264539979 1 BUCHHANDLUNGSSTERBEN
637,460,292 *41A63258F551F81D606504FD7E179BD1C5E1A69F 1CANAAN
637,460,293 *41A4254188DC18BF4EFDB4FB6C3B46D7B30C2FCC 1 EGLENDIREREK
637,460,294 *41ACF7EFB1E52B58F284BB850283D3FFD0DFF751 1.ELEKTRO-TEST-FAHRZEUGE
637,460,295 *41A8BE2DDD4CDCBD947C3F8B543B1CC0ADCB5229 1.feelthey've
637,460,296 *41A5746992892F2B48CB75C35732898F7D788619 1herunterstolperte
637,460,297 *41AEAC05E0C049D85C3153DB77A986CFF7CACABC 1ILOIDAB
637,460,298 *41A0594B64EA0C101DCB58F78FF95E59573ADB97 1INFRAPUNAAALTOJA
637,460,299 *41ABAB250ADC59E64E5CB0B9ACC4B28077E67AB4 1.kwasny
637,460,300 *41A18F8827C63891EDD3EA8C9128CD60AA17704F 1MONTYBSW
637,460,301 *41A8023A1D00FA67BD7AEE92896DDB2629927B2F 1NCH1E5TE
637,460,302 *41A8ADDEA6310A984A9F1664EBB97E169ADC080C 1PROJELENDIRDIGIMIZ
637,460,303 *41A22148D3C8C5E397D913FDF3CA6B0D47D053E9 1 RADFAHRERGARNIERUNG
637,460,304 *41AA37B2C8F6BEC247C5D4CF995F664F2A3BC623 1REITITINKONEET
637,460,305 *41A738C84345EF5450DE10C996962DCCF5BE97CA 1.selzer's
637,460,306 *41A00FF2D3CD6CAE226DDE172A7B976AB3AACF92 1.silojen
637,460,307 *41AC492D96BB55DEB3F05FD7195AFE176C90FC85 1.sovledim
637,460,308 *41A128CFA9A158E83AC3F2B80AF45FAB2AA68CE7 1.THEORYCHALLENGING
637,460,309 *41A95711F157FE66587CD9735913BAB712434A44 1.TREENAAVISTA
637,460,310 *41AB6C0FB78B87C75E98B34B26CA8FE575E5660D 1yapIcaklar
637,460,311 *41A0D94EB1BD3031C248513BD803B19E4331E3E6 20000520:GETTYSBURG,PA,USA
637,460,312 *41A58023DFA53F7ACC92A8D9EE857F95586442FB 232077 PVB : OLEN TYYTYV
637,460,313 *41A1D1DBA1A8644BA75F3C6855134467F2B855DD 246672 DR . CIHANGIR DURAN YARD .
637,460,314 *41A50EBDAD5C18C42706E48C07D0704895283513 2477370 DIE-WENIGSTEN-HABEN-JEDOCH-MIT-BSE-ZU-TUN-.
637,460,315 *41A6DD005ACD728C0A907C0490F44955CB09FB66 2676045 ARENAKAPPELIN ON YH
637,460,316 *41AA270CD7A0DAB1752326CB2D50AE4462A38117 2769055 KLAUS-TOPPMOELLER-FASSTE-SICH-KURZ-
637,460,317 *41A789C4A2C5703249099733AABE2A6E25E22B72 277alex
637,460,318 *41AA43887556B146421DE54D1258A24D98A5C2D6 2-dschihad-mitglieder
637,460,319 *41AE706624E3E41C7452530C3D2A7059D71293BC 2GERSOLL
637,460,320 *41AE674408404F923C67DA85A39ED3676AA7D219 2-killerapplikation
637,460,321 *41ABF90D8B0A87A15D93441D55CC41E559E83E05 2-KORJAUSNEUVONTAA
637,460,322 *41AD2B479303F3F1ACC70685721D75C8CB15A398 2-nakov
637,460,323 *41AA9A838169B9FCB38A4D9B376B4F9727817B80 2second-and-nine
637,460,324 *41A224489402F21A93473D211ACB609BC4A98002 2 STREITHANSELN
637,460,325 *41AA5987A4179831933352E12F693B9BACAA3800 2x67bjg4q15k07diztleuw
637,460,326 *41A356A4DC7970663FCEE0F7AD4ABF6A34DAEC53 30NAKAMURA
637,460,327 *41A1F43E84F746E20F5902294E8E6A995C85F131 365112 ASIAKKAAMME-SAAVAT-V
637,460,328 *41A48EE6626D1D80D25B9657FFB62EF50814AC0E 36q71
637,460,329 *41A5F886E17B57BDB32CF05C49BC0ADA0EDAA0E9 3NAAYITAH
637,460,330 *41A4DF2FD607D18F98CBEBF3B75842D6B52CF063 [email protected] ~o {x}
637,460,331 *41AE3A68B020903752A61069A3E34BF69F96CBE7 3P~.~.{x}
637,460,332 *41ADF425A1B8A8F3A1F3149FD73FED5C637DFA7E 3RECLAIMER
637,460,333 *41A085CB795D9CB324B9060328026B87A935EF34 3SBO4RNOS
637,460,334 *41A129548818B3704A5244D4D44513F584BBE3A7 412jon
637,460,335 *41A75BCD886A474F44A2053B606A3380B815EC3F 4AWREKETH
637,460,336 *41AF8F077EE079E538FC1813B8880367F47B1D56 4DILLDINE
637,460,337 *41ABA28263DCC4C991C272A56EEACB59BE1E8A6D 4doorward
637,460,338 *41A41E49E15C33A29921BA410373F710EFA311D8 4ITHEADH
637,460,339 *41AC3E8351903AF8FA8FE03FAA9465272A4A4AA7 4LEHTILEIKKEET
637,460,340 *41A59C560C7472482CA839A94B846CD2635D44DB 4LIZARDGOLFER
637,460,341 *41A94D302A41FEEB541F8386B149786FEA238DD7 4NDAVEYAANI
637,460,342 *41A4AB9195D56137353E0F1BAB2BF0CB470BA26D 4WEGSCHICKEND
637,460,343 *41A5E50C32BDF90F73D94B0A8E93880DC3A48FAD 50/50-(Kings-of-Soul-vocal-mix)
637,460,344 *41A7D4988C292907D6B3C0C11CC33E7607FD154F 50FUNTIME
637,460,345 *41A6F434E156973E85CE24C113532476C04A5EA9 54FC7A04432C338398F276C1FF6A9AB4
637,460,346 *41AF700A7EBD8EDF7BA8A6E675E117A2A03C7BC1 55075 kohderyhm
637,460,347 *41A5EF2A08B2C98AF947E00150AF3CAB297EE6D7 5:..5..-#..-&...resister
637,460,348 *41A0287F110CA3B88D7E9AB82BE00DF59DFF5F4C 57KALEB
637,460,349 *41ADA7742FCA4DD3A176AB778B6FBA1235806574 595425 RUDOLFDIESELSEHRGEIZWARES,IMMERDERERSTEZUSEIN.
637,460,350 *41A7E567ABD37F3B5F562563799AD7A6F1B09C23 5BB2D5F693BAC21CA522C497C4B76078.HKM253
637,460,351 *41A608D72E5645C77A4607EB4434FC16F04048DE 5BLONDEBUTCH
637,460,352 *41AB104743A456339F6C134C504E83B46289CFF6 5-CANONS-ON-LATIN-TEXTS,-OP.-16:-V.-CRUCEM-TUAM-ADORAMUS,-DOMINE
637,460,353 *41A7FC0AA16B4A2E86C527F09E23E01ADC261A06 5e129dbf4fa83fbea329d2af8d506ed8
637,460,354 *41AB01802D6F5B1138868A9E579E5BCC86162B86 5FONTIMMERSIONINFUSIONJUBEKNEELING
637,460,355 *41A77A5736ED23703D3B95EE3BDA5DEA8EB1C2EF 5INDISPETTISTE
637,460,356 *41A3F570624DF2F005AC22AF47038816779C32DA 5JOCULAR
637,460,357 *41A5198BB81CCDBD88877BC18048E9FB4A9E9322 5LOVEMECANELA
637,460,358 *41AB933A57D5AA9236B9A4C92FBE27C0849DE220 5NFRGVNG
637,460,359 *41A5977DB44BE036D3361ED8AA43705BFD5ACC55 5STINGRAYRETARD
637,460,360 *41A304C28684EB1B03C9F993D7C59312428978DB 6ESB
637,460,361 *41A04577FE1610963E1FA38C304DD50B9A02180E 6THATMAINE8
637,460,362 *41A72F09FACD435DA6C5190D1D24F790967BED9E 6VIDEOCANELA
637,460,363 *41AFD6DD1E31A8BCE196AFB6FF543D96EFFF83F1 6YTWBBVVX
637,460,364 *41A2DBD9CD3BF3FCAD375116148C40C39D175746 727TOMAS
637,460,365 *41A7D8B042D41970268BF3C2571AE9F98BA46B49 77 dayanismayi
637,460,366 *41A1398367901D1BC3BA7E1419C1E302DD82DA06 [email protected]
637,460,367 *41AF32E0C483A4CB061B26E236D73777B6DBB408 7BEKENHAWB
637,460,368 *41A5B584C7F61AC68B1289CDDAD397D0CEB23378 7ENORGUEILLIRA
637,460,369 *41ACFDB237A8AADA80C58D1071787CEBE49C92FC 7FERTILISATIONEN
637,460,370 *41A23490D054FEA4E29C05A2D0AF2B1BCBE0AA53 7HCSIMEG
637,460,371 *41A0589F96D16A1DB59B79E8D8A6865768D67165 7iam2kids
637,460,372 *41A03726295A53819EB6154D1CEC4332F79AA595 7QUASICRITICALLY
637,460,373 *41AFFD319354EE2448812A4C5414C75E68BCEBC6 7-rolu
637,460,374 *41A2ECE4B12918DC39CBC299B929620BB3E0A320 7-S
637,460,375 *41AF610378B768627882EDCDABBDC37AF760F663 81711 '-WHAT-HAPPENS-IF-SOMEONE-GETS-STUCK-IN-THEM-?
637,460,376 *41AE6B481BBDBDCD3CEC6B42C1FB71BD2538DAB5 856499 TEXACO IS DEVELOPING THREE ADDITIONAL FIELDS
637,460,377 *41ABE18E7C7F26461B4B7FC016BB4AD93EC37CA9 867AHMAD
637,460,378 *41A3C79421BC764F497F5FEFF489FA6DF687F0DC ?8$AAA
637,460,379 *41A207D02AA14919BD93403923A4CB6BE5DA68BE 8BELTBLADEBOXERBRAVOBRAWLERBROWN
637,460,380 *41A60E9ABBABF254DDD3956B33BEE6DAF385968B 8BSWSCOLOGINBSW
637,460,381 *41AB5AA4093EFC77BB8BB0CDB44D7E4417AC71D3 8F6DDA1AD23F360EA6E309F34A621E98
637,460,382 *41A81A83181A5BA0C9F17C73DE6DE90DEAFD4756 8JUDGEAMAZONCOM
637,460,383 *41AB2ABB14AEF0AFBDED952EABF51CE1EFE191CA 8KOMUNIZMI
637,460,384 *41AD97B3F13ADF234122204A35EA5B1209F64C5D 8MAINZ
637,460,385 *41A06347B37BD507BB1C8AAF312E7C9658EBD187 8######@ `~ splat
637,460,386 *41AB18F3DB7793CEF873D92E1C59F8D0D6986B3D 9ASAEDON
637,460,387 *41AF2747246554AF45E419A19A16FBD10360D529 9BRNDSELSCELLERNE
637,460,388 *41ABDDB36B1E8099872DDA206B2DEDD35CDB9487 9BSWBUFLENBSW
637,460,389 *41AD402E8063CACC21B583EC0EDC9F4810C6E65F 9CIHTAPOHCYSPNON
637,460,390 *41A84FAE4A8A58F3658927B1762B9A72194D31D9 9HUNTSMANUSAKATYEAOLCOM
637,460,391 *41A978607F7B46522524DBF0A1E49C7E04BCBFE9 9KIMBERLYROY
637,460,392 *41A9F90A2F72804C7102F2754C4E15F1C649FC8E 9MCJAPRBASI
637,460,393 *41A74FCE90A56522F4C3018879A5BC793DFA6CCB 9OMNIPOWERFUL
637,460,394 *41AAE95B2AD1768AF9D32E192B37B3083D13DE80 9REBILLIGUDGAVING
637,460,395 *41A3EE4B697C04D0858215C7E5A55E9D4C46E140 9REVESTIMENTOS
637,460,396 *41AF3C3787BC4A538A6C303BF4992670ECC22606 9ZPTITJSKA
637,460,397 *41AF97855DD10D9805A4BD6C6376D8D63DE6EC42 a0m!j
637,460,398 *41A7F7AD4A9865332CC79A072E22A7B726FF4422 a1_i%
637,460,399 *41A9ED44270591A228CBACAB0F83CBFD336A7D66 A1KHR
637,460,400 *41A90F488654F68781E20FCBD807E08962D419C0 a28630a9cd2c342db098b00812496421
637,460,401 *41A35B4763E4BF72A4DDB092A2A1A44211EF8D0A a2+gh
637,460,402 *41A2AD3224B0AB600DE8D080B4A7DB6504B63F41 a?2tg
637,460,403 *41A1612BD9E559631569740B079B306A259E7CBB a8f\
637,460,404 *41A66A21C050765D40096BEE6A2609E57E054341 aabmz
637,460,405 *41ADF6F6CF33A3B6E08E57852DBB232B01B554F5 [email protected]
637,460,406 *41AAE4857FB5E912E59CE3C0D5373674C6CF4366 aa$tm
637,460,407 *41A9809F1D32EE61CA127E1721924B9CE019E870 ACHAIRMEN
637,460,408 *41A35D0FFD76DAD7C2DC31B5A035D9EF15CB3F22 acsbco
637,460,409 *41AB05BFFAAEF779CAE0B2E51DD3E9A136199F34 adj.juredivino[lat],bydivineright.
637,460,410 *41A5163D41D81C7AA56D8A5B6FDA76181F94637C A=DM
637,460,411 *41A762312C71718ABEA424B5480E7A74AF1203F8 ADRIAN-ARISPE
637,460,412 *41A60B34ACADEE6F8719FE9203E04096762B7388 aeko.
637,460,413 *41A0E9D82AC92BE85D82BB164907FDAAB70D027C AFFLIGEANTS1
637,460,414 *41A444B6A74EEC77D0A86493DB3A21F01DA5FE89 ah"bp
637,460,415 *41A1300DD3047111FA1589646BA9DFC8C2BB2970 ahbr?
637,460,416 *41A96485DCF0884A094021936220B500A2B0EBA1 ahmadwujcik
637,460,417 *41A79DCC1EE15CB27C0E0ACFBAD5A31F2C4EF42F aia/v
637,460,418 *41AFE68B75F3162E226526B024C2422C54AB40A7 aindrilaroy
637,460,419 *41A86D9182163B9292800C699EECE8D98255F3BC AK;OW
637,460,420 *41A2FBCB7B1C2BB345657F9DBE1EEA0B938456E8 ALEXA.PALERMO
637,460,421 *41A9BB7B4252515988B035A2FE8C75E5BA67BB5E ALEXISALLEX
637,460,422 *41A91D18E1563BFCAE99DFD0BCE20831FF181B8F AllenL
637,460,423 *41A007ED5AAE5ED2FA93702445EF47B6FC3874E1 ALY_ALIUTA95
637,460,424 *41AC0AF7DA679581655912A59AB75CA31BFB87D1 AMOS.LAVERN
637,460,425 *41A2CAB0510B54AB4B215684848AA59CEBCA2C8B [email protected]
637,460,426 *41A1CAF478E28092AC7F7EE97276E395A5BBE3E1 a.mystical.preparative.to.lewdness
637,460,427 *41AAC0022CA321F7051F23AC415AEE85E7B0DAD5 AMYTC
637,460,428 *41AEE5CFE60E70CBF70B3D20BF166FDE19EA8770 ANTANISE0
637,460,429 *41A869EE73E6551253F6E334A0B730943F9FBA49 ANVHUACED
637,460,430 *41AB108CC23E1207B80AE343B2520A9558B0C70B apg)k
637,460,431 *41A82FBCA4A2671501687108AD1FD8FF01A859B0 app.c
637,460,432 *41AD7A6C99CFBC08E28D32827D039B450093120C ARTELEVING
637,460,433 *41A6A68BDD1F529FD51C7549D3C305B5BCA640EC as7m)
637,460,434 *41A01E9825F54321F28366AE6A255E9F244156BB ATDh
637,460,435 *41A3CCB6D530EC21CF4963E1C892C24AE7E05415 AUF-BIEGEN-UND-BRECHEN
637,460,436 *41AF0D280C47A871F2C69BC0F08F6AF06212DF78 AUNAISLHO1
637,460,437 *41A9CBD7E26A488B80412A678BDAA00159374A4D AURELIOPEIFER
637,460,438 *41A4F87F306F06767B58D3999E5816DD5EDF368E av3=a
637,460,439 *41AD7A9A12E74505F8EE42E5D62524B766A22E47 AVe5
637,460,440 *41AB5D011AE2C9DB09778608903A45824C0821D0 ><~<=====B
637,460,441 *41A55F53363901DE3DF303EA3F36EAF6DE35C2CE B:!(
637,460,442 *41A4E806E8C50EBA7BD613DB925748B5FAD6158A B5=G8
637,460,443 *41A0F086F721415D2331A824FD9FF3C689879617 b8zfl
637,460,444 *41A105CC4214B195CF443E3C214BD174E4DF93F6 BABELISE.
637,460,445 *41ADE4493F266380D99D6CD63612BE03947A89B3 barefootep
637,460,446 *41A0F900D9F60AC1B0449D7ABB3409D633B47B1A bdgbj
637,460,447 *41A86389E93F10E1992BCFAE84890AA2B5484AD1 beeherdsing
637,460,448 *41A21F3B6CB6DC33F9AA7493770F030CA3E80662 BERTRAMCARAWAY
637,460,449 *41A3BC89C4A139AB752D2A6AE16074D80A7B183A BEZZLES4
637,460,450 *41A53D23F229A87776D99B2326D4DFCE692DB285 bfoku
637,460,451 *41A9F292AC9FF14866FF83F16E207EF318F4A9F3 BH/;
637,460,452 *41A3157AEC19CFFF16920349E4FBEBA5F16FD284 BI#DG
637,460,453 *41A5CB67BD1A55B417BE00A767CC668973B3B030 [email protected]
637,460,454 *41AB256EEB8F52DD834FBEFD00CAEF215675475E billiedichristopher
637,460,455 *41AD48F124A1CAD5318741F919E01A70CC236C76 BILL.ORRELL
637,460,456 *41ACF268EC5C3661F3BF280E3794E291306A8E2E BIOSYNTHESISED!
637,460,457 *41A3FE7F5613BB2F2FDCB879B44260DDE4235F2B BJPDT
637,460,458 *41AB6099C4878F67EE58466AE71A0002AC09C723 blairbertone
637,460,459 *41AFDEC9F77B76F20ABEF02BEEB44877107945BC BLAQUEPEARL
637,460,460 *41A4D055BE2A7E717FC648897C96B97892CE256D BL&FM
637,460,461 *41AA16FD9DB4D3120A2E6B98106789B586E129E4 BOOK07B,ACOMBATANDARAMPART
637,460,462 *41A43E08F32776BE416747EFE66052865FC8840F BOYCEKREITLER
637,460,463 *41AE8C806DEBAFCDEB803545F5CEF2349FDA2090 b&(p(
637,460,464 *41AAA7B580D4BB8F391DE6856CB2C6977B970F3D BQDG;
637,460,465 *41A0B5D6C0A5C3DED86FB2303B95FFEF612B2FBF bradfordswanigan
637,460,466 *41A0B18FB82179CBB170229189DCAF0B263396B7 BRADLEYLOTRIDGE
637,460,467 *41A5D5436A0C4227814CF5A2704E7DF0CA4FB478 brian-corless
637,460,468 *41A8A4A8C5518287EAB254949EE6D0C21607C2AD BRICE.DONEY
637,460,469 *41ADD4ABC43D4095064E915DC81311E7471EB1D4 brookegiordano
637,460,470 *41A343EB10333758DEF574B15372C0C7CD9EC53C BRUTUSJING
637,460,471 *41A498BE6F0F4919DFF6BD14D28B5200FEF56232 bsgk
637,460,472 *41AC1E957750DE846C1BDA28AE9325376C0637F4 BÜRGEMEESTE
637,460,473 *41AE801A5F6C4E803D7A5D35CCDBE4AD2C2BD2C1 b)uzd
637,460,474 *41A2C2BE69C0B98FE11FF201054B5B26580578EE B#VC)
637,460,475 *41AD39B364F535817555FA16B18687394DA8FE7B Bwo9
637,460,476 *41ACE817121565EB0C069AA88614424378D5BB6D c?0ay
637,460,477 *41ABB30F6CFF38A7A4117F568D87C1667A006762 C0FM-
637,460,478 *41AC7ED9CC0E2885570D8B6AB0E8F857738DC78C c0nju947i0n41
637,460,479 *41A523EB20953039A69C068B94F2B00F71A0E253 C8JT,
637,460,480 *41A485D91540C274205F6338762CA19057B5FF2B c;?,a
637,460,481 *41AAA03FECAD7A5CDE39DB1CFEFD8D9991D5E509 CA-6O
637,460,482 *41AC786FC5B23D889056CDAC7B211707FECD958D CAMBIUMS
637,460,483 *41AFF013BF1D424A06792A551982E95B3DC8F963 CANCERAVATAR
637,460,484 *41A36DB0D7BC6C25A4A163851BE5067678373DC0 CARLODARICEK
637,460,485 *41AA4523101A90C6C0AC4B7B3C1A4A9B36F89A91 carte-sa-|-france
637,460,486 *41A8CF122E7CA536E7AD913471F8139338677F7B categorybrowserc
637,460,487 *41AAAC204BF6A3C489BFE51663835A5C470C63FE CDIMPLE
637,460,488 *41A443DB89402B17C9728C0BFF5660F642EC67E7 CdYN
637,460,489 *41A8A8D92EA6F61414DD439FAD5E6EB9BC712E0B CG;
637,460,490 *41A83F2A975E47DED8EE83086216D31633777D1B CHAKRADHARY
637,460,491 *41AB5C1401C202D35DDD9922579FAC104C31D9D7 [email protected]
637,460,492 *41ADC630B405AE445CBF8360AA5A3428E3EE0F65 CHANCEWANCZYK
637,460,493 *41AE122B0814F882DA1F6680B482529460E16AA2 [email protected]
637,460,494 *41A9E7D98E3BE17534A426BA5B98350D04FEEAC9 [email protected]
637,460,495 *41A79E37478C76381A7C3AD0690E696273C22B1D CHARLENEMCCLELLAND
637,460,496 *41ABDEBA66C567A5749FEECD72D42F1FD22E88D7 CHCGIDV93
637,460,497 *41A34B4A1C728E5A3F56F160346EC44381A41ECE CHPQF
637,460,498 *41A74FAC80718DD7278E08C0E3B23755B31FD2EF ciaj0
637,460,499 *41A4DC10BAB9AC2C21A7F73153E505C9A8DCF831 CIAO
637,460,500 *41AA33ACC20C7D412A55FB2B709AC711094DBB20 cl=$(
637,460,501 *41A875EA9362F25139775C00E72B8DC98A8CF80C clockmakers.4.0
637,460,502 *41ADE38734017348586D16AE7683B335B99121BA CLOTHE$B
637,460,503 *41AF4999EA7D7EAD701BD5FCA14A5907D5019B83 cmcubal4
637,460,504 *41ABC05C806EB01A8A06A50E2B114CB7784371E4 [email protected]
637,460,505 *41A0D1E9C21C51F7ECF2C652F62CD9EAF8C1A3A8 cn+yk
637,460,506 *41A9C1260209E984B0942F5A772BF5BC808DCAD5 CODPM
637,460,507 *41ACBA9446C0D9DA3F2180647973423CE7B1B645 commentblockpresentif(head_flags&0x02)=0
637,460,508 *41A1588A32B8C549016F94B3DDF74BF5CC9A6940 CONFABULA+!ON$
637,460,509 *41A3189F55FEA0D6AB99687EC8EC40BF416A558B CONPARED3
637,460,510 *41AA79405496574A604D667488D08D9A969C35D1 CONSTITUYAM
637,460,511 *41A6DF5505EE9EF43D827A9F24FF5AF5D5861C2F conyr
637,460,512 *41AB25567DAC6E85AAC2406D13F6596FCD4557AE cortezdempsy
637,460,513 *41ADDC149BDF72D8BC3919FC75AAC28D377E41EC COURIERBEFÖRDERUNGEN
637,460,514 *41AF85D7DA3FAF19DFA608B70978D61B7BFCE07F COYCHERVEN
637,460,515 *41A99A24ABBDF23B0F0A841F60AE04727676C437 C:\PROGRAM FILES\ADOBE\ADOBE EXTENSION MANAGER CS4\RESOURCES-PL_PLDLL
637,460,516 *41AD8E3C0FAB322BDE9991F637E7C2EBCD0EFC79 C#PWR
637,460,517 *41AEBBBF62C47B028362C918347C20A839DA0061 CS;BH
637,460,518 *41AFFC61C979C8C056C2B5B2617A4384CDB850F6 CURTIS.VALOT
637,460,519 *41A57A29673F2B0EC51AAA01BAD27E1694E9A304 cvovm
637,460,520 *41AC37894FC65025832A007354713061AAC04174 CYKELTILLVERKARNA
637,460,521 *41ACB19AFE3ECBEDD8C4F0C13F02B82C1AC0B705 cyrusoestmann
637,460,522 *41AA49D8AEA7BBA1EEE462E1C3D6B9820C3D863A d0rm3rwi
637,460,523 *41A6BD3B6CF2F8F82167A9BB1DB1B25591037630 D1OC141NG
637,460,524 *41A6D8E70F0DF60D7312C436BFF1AA2BB4AEED53 D5+rbu+on5
637,460,525 *41A3A47CD90483BBDE33A7378AD040E995FBD179 d6ey(
637,460,526 *41A5438A3913667AE4CDA36EF2FAC39571C0A5DF DADDY-MY-DEAR
637,460,527 *41A4A011CE977A91B1FE90C6D1D46AFFEBB680B1 DAMM
637,460,528 *41A492603975D590B059340A9CD12EC3535B84E5 DANCEMOPOLITAN
637,460,529 *41A1AD6895DEC10765ADBD7DF7E4D3D8B96B72E6 danilogrosjean
637,460,530 *41A5E6E27AFA8C8E53DBC4464DB748AC1EE7D8DF danny-stewart
637,460,531 *41A824D2E84A8614B47EC4F2217EFE18C8870AF7 DARENLUPI
637,460,532 *41A9C99B43441BD11D34E1FAE2E252FBD369B4CD darrellgotter
637,460,533 *41AD46228742C5B6408C2564F3522FC8427AE4FF DARRONLENIUS
637,460,534 *41A89EF4A7F23C674D638CFF2E7CF6B91721A088 darylcwikla
637,460,535 *41AF41E31E0838749F0BF99363AF4CE7E976A94E D&ASM
637,460,536 *41A850EC7BB93F7BE53EE4AD47D383B679CA735B DAWAUN JAMES
637,460,537 *41AAE6E5C231D77FBB8152D2C9EAFF97D47108B8 dbhox
637,460,538 *41AE20B48EE11A06E160AEBDE2D69DB65B4DF9F8 debasish-ray
637,460,539 *41A7DB9E480B8452668AB3DF4124FF945E273583 DEGRADATION.1819
637,460,540 *41A17703D33828E1173CEC4E761F2722367928C1 DELETIONHYLDGAARD
637,460,541 *41A208BB925F358E2F96E23ED18F76A5C123B042 delmarschaudel
637,460,542 *41A1C48D1618019CA8C89929F2EB0095D6D1F343 demetriuslisko
637,460,543 *41A2592DED0127D08A0C0EB6A38459B9F7A179A8 denticule.
637,460,544 *41A076A854F8391DB71EDB699314ADE895187E43 DFLL
637,460,545 *41A29090AD2BA5F8420992164D062782126275B4 d'frlmnt
637,460,546 *41ADD6301C515E29644E3383A8EFA4CA50149CCD DHF?T
637,460,547 *41A43577CCAA28106A94EED5828EEF6BC3CB47D5 [email protected]
637,460,548 *41AA1B69800EAB987079FD1EA92A210A9601E8B6 DISTITLE9
637,460,549 *41A16F3F3F8B3DFEE3BAFF28EE8D72A325FA91CC dkhit
637,460,550 *41AC51DFCC38DC3A2320D19EF4EAEA5AF2672A6F [email protected]
637,460,551 *41A359316D3A7CB6C9A6CBDF477140F72C40E5F3 DOGHAFWYN
637,460,552 *41A3DBF222783D1F614512A6523999ED981F4B42 dominicanabebe69
637,460,553 *41A27ED17F62FC228D51ED4C7B50319DAA9BE599 donnatchison
637,460,554 *41A9D3003F96510CCF2CEF1386019F4E5CCDECC1 DONNELL.KUNZELMAN
637,460,555 *41AB781193EDCF9D7D4EFF7ABF64B82097E7B0CC DORE!
637,460,556 *41A28FEF30BFCA145A3475793AA4E84A73372F31 drectve$
637,460,557 *41AFC670D8AD794708B9B505C34B34B6B36511C0 drmcj
637,460,558 *41A6899034C77F4C9FFEDD46084C07855C0C3A1C DS(LX
637,460,559 *41A850B550068FFD2B1FC716AD31017D8067AE85 d;udz
637,460,560 *41A74B11E59680D965C4507CA884C9DA5E7F9598 DUH=
637,460,561 *41ADABAEE94C96DCAA94130ED912C263BE288E82 DW7W"
637,460,562 *41A42CA74CF7AF28395AD86A26587CBCA66B830B DZC23
637,460,563 *41AACA14235983E4603E5FDB40B9AB2749129A56 ed6r!
637,460,564 *41AF6B993F7FC4575F35F79AA3D963E218001E38 EDANOIBA3
637,460,565 *41A37E07DC7F12250183E8A0A0140CE612882608 “edgy
637,460,566 *41A1654A2ED3B046F265C8EA629C0E46229ACFD7 EDMOND.NANIA
637,460,567 *41A3694EDAA4E2DD17ED3F1FA85FB6A39D3DFDDF edq?j
637,460,568 *41A7DBCFB7583320EF6FE4325DD62B958DF4103E ee7594f47c833c6ebe0147c66f76c4e7
637,460,569 *41A26A4F09362B0B97CDC644666A5EF917F6C715 eelettad8
637,460,570 *41A3AA87DFF4C971BF1FC3F7FE94FE046C3D9BC6 eev
637,460,571 *41AA2A416CF17E39B64C3C32793276555CDB52D9 ehcssarb
637,460,572 *41A3435A870CE4D74D02E55E304B9306F1163137 eissman9
637,460,573 *41ABF565A337252E78A976DE3DB6F58DF0335A5C ELDEN.LEHN
637,460,574 *41AF5CD11A08C39D220930D57F0DDD455F653979 ELEVEN CHORALE PRELUDES FOR ORGAN, OP. POST. 122 NO. 5 "SCHM
637,460,575 *41AB2E99B92B3EF193D402C0AE6C7A1B6436968C elliameh8
637,460,576 *41ABFB64C2E878FEBA6BB7D1F9F7791D76BC62AF ELMOSCHMALING
637,460,577 *41A951BEE4E163453D9A55C76C51241593E78A47 [email protected]
637,460,578 *41A7C220815D9F4627EE58B1AAE7E5B226B1DC4A EMMANUEL.ENTIN
637,460,579 *41AA06F829B1A37021C1CC27DB622C06217F118F emperyalis
637,460,580 *41ACEC04A555B30537D4D054D1775A090F54A0D6 ÉNÉOREME
637,460,581 *41A194E3E0DCED3247B8717CBD69A46502206C66 ENERITME4
637,460,582 *41AADB86CE6BB614BB5B2AEBA0B0EF9142120B58 ENH2(
637,460,583 *41AF4AA38A14C38D5334FE057591A860CA7C22CC ENOCH.SCHWEIGER
637,460,584 *41AB82C11981437A03892745ABF5C8D384CF69CB EPICENTRO3
637,460,585 *41A06BE2748834615919AF46888A62BBF6259FBA epp"g
637,460,586 *41A7B9B6870F44FC2EE17B6994C716C9F767E4DE eps!i
637,460,587 *41A6D81D7FD0C458A86B9836DC2BA3B99FECAC23 eq?m
637,460,588 *41AB91A8BD136EFCB419D2D212C52EB5973CC67E ERNTEEINSÄTZE
637,460,589 *41A4487FF058AFA804F8A3142F2C056EF190FB8A ERROL.OPHER
637,460,590 *41A59F5615FF233A5AAB2A18730BF4313F18D5E8 ESCALAJAMES
637,460,591 *41A9FA18F49CBA6E003DFCA2F453793D967E8BDB ESULTFULED
637,460,592 *41AA1BAA8C3959320DF28F9D5AB5289BA971555E ESVIVEIBIZA2007(DISC2:EVENING)
637,460,593 *41A12D24DE08D85A6954288AFEFE63DC40BF5139 ÉTAGÉS
637,460,594 *41A52E155B9C8FA22B086DF79F85CB4881EAAF19 ETHENOIDALS
637,460,595 *41ABE067EF9DC35FDDBE85A84927E9AAD8412B14 e viele b
637,460,596 *41A82A98CB30A00B9CC51EA768E0D54097DDD058 F7AR
637,460,597 *41A50CD56C4365D5D6945CAF99D3684CBF758B5B FALANGE.ESPANOLA
637,460,598 *41A6E61B7FEEFD5C7EC31EAEF7CEBFB826378F62 [email protected]
637,460,599 *41A5DAC7C19C98476DC96238C79C4774B3112E42 [email protected]
637,460,600 *41AFDA77D65AC4F1B7B2705F7FF35521BE2A6E06 FANTASTHIGGÀ
637,460,601 *41A80FE0E18A699C91EE2ED4EA5533FEEDD65584 FATNESS_2_DA_MAX
637,460,602 *41A251D2243379AAF90A472C653858F6D76BCDDF felacisa7
637,460,603 *41A965EA5E064A21F8C1B5F002B5FD0885C39DAF FELSKRIVANDES
637,460,604 *41AC5D4A4813638A70EE0B2CACBA292905A9C1B4 [email protected]
637,460,605 *41A1217777DE8EE7A16CBCF4469F5C0A862CDEB7 firsttragedy
637,460,606 *41A4F3EBC1B90F6F35FE4CA97ADAB386779B349F fitoplanktono
637,460,607 *41A25B9744175F81858EE8F6262F84D2BCFACEB2 FLUTGESCHICHTEN
637,460,608 *41A60F2D94D9907BACCCFD10EEC00A8A3D68911F footloosesoundtrackalbumcover
637,460,609 *41ABC5A8934FB2AF01FEDCFBB9F0F517CF7C699B FORMITJF
637,460,610 *41A931DC3D9AFA6DC7466A28502F14926462850B for.ourselves.council.for.generalized.self-management
637,460,611 *41AAD304C4C55675EAD3C0701C01568EE9C23278 FOTOSDERUTHNUNEZDEYOSOYBEAALNATURALENROPAINTERIORYSINSUJETADOR
637,460,612 *41AFD55B5B1879F7C83059583BF6E329E539C7C9 FRANCISBAVA
637,460,613 *41ADDF4F2F6AD6CFEA0D630A6A3A8B0ACD0F1E2E freddytintin
637,460,614 *41A55FECFF1E0DA752BC054ABD0B9F4CD67D94EC FRUGHEREIS
637,460,615 *41AF15EB908800621A2AB5B43DBF49E1A5918DCD FUPPXKJ4
637,460,616 *41A06516BFF36B51CB219F69F147E1BCA62BD7BC [email protected]
637,460,617 *41A035B7E0CB1976647A712AEA75A3CF95F50123 G0a1-tend
637,460,618 *41A9A46EE108F9CC6FBE701DA8714B322883E0B4 GA73
637,460,619 *41A937FEA1F769EE923DF0D943676BFE08DFE314 garmenture8
637,460,620 *41A3E23E3A141AB143BC3AAC515316C01E7C4619 garrysantolucito
637,460,621 *41AE9EDB78FC8BBC0753AF8A65B172E1BB90FDD3 GARY VLADIK
637,460,622 *41A0D97AC07926C1F4DB8CE1D62F6D92E3BE4B88 GAURI-DAS
637,460,623 *41AB367D1C1A9AFBC0526F4FA6B0D1E49957E0C7 gc2t
637,460,624 *41A433BDE40D66DFCE933C447DB88D1428E43D8C gilberie5
637,460,625 *41AF7F416F736A129ABF79B599BD5A5C07FAF0AD [email protected]
637,460,626 *41A6C8E3F4485235DDA9E9ADC9DC83024A822CD3 GLENN.OLIVERA
637,460,627 *41AC57CE28CFFBEA5BC58E6B6A218C1A9E5140C4 [email protected]
637,460,628 *41A5B3C2C9B570B123535AE946669AF941A02298 GRAFIKUS4
637,460,629 *41AB3128B5F8CEF07BAAAF3899AAB2B2E2CB94CE GRANDTOWERS
637,460,630 *41A25F842887E80F12EF36DDFD55BA6C0DC004F4 GREGG.ROSSA
637,460,631 *41A2C25090C21AD12A26727B83A8967E4A0369FD GREGORYVALLEJOS
637,460,632 *41A53BBB0B93EC7CF37E72F406A19D6C17301BA9 GREMGOBLIN
637,460,633 *41A3274D7D63816838B21508181DFA40194AE791 gross3788
637,460,634 *41A1D18D0778CA59B632957E16F8C293F07E8956 „GRUNDPRINZIPIEN
637,460,635 *41AD461F7EDC768CF612DA41FC72188C7D7EE75A gryziszczęka
637,460,636 *41AC318E5C8A4ACF6232DA0C341B0957797ACE56 [email protected]
637,460,637 *41A734B5916D5A43CF0B8F4CA0BDEC20A2CF540F gunjan-khaitan
637,460,638 *41A6E98DD0FCF4A73C6226C1CCA6D332FB636457 {{gutenberg-author|-id=Robert+Burns-|-name=Robert-Burns}}
637,460,639 *41AEA3CD997080EDFE88E45CEF05C8A127C3E572 H3RMAPHR0DT35
637,460,640 *41ABC32293BBA7031E615692D59DE9F2EEC5B96F <H4><FoNTCoLoR="#000077">DiSTRiBuTeDBaCKBoNe</FoNT></H4>
637,460,641 *41AF1C3A57FBC6CE7F8E7089CABB40B102020FEA H5}Q
637,460,642 *41AE524F6186B1E629119CAD572C09B77B981472 haisoujo
637,460,643 *41AD9F8AE0E54F7BA9B811C55AE56516A038CB07 HARBOR_LOG-'H/A/RB/@/R_L/O/G
637,460,644 *41AB39AFE652E6F73ADB74C1FB45E213D93D261A HARRISIALONGO
637,460,645 *41A4D2B5AD7F92ED00FAC48C6289C7E35C700375 HARVEYNIVES
637,460,646 *41A53ADFC36ABA3F673E07399EAFD2DAF0FEE543 HAYDENVERHAAG
637,460,647 *41A1E3A2B915BAA46D20FB4E960C385917174A4F HAYWOOD.PATIENCE
637,460,648 *41AA60C7E233B14B7CB47652ED5C66C11266FEAC [email protected]
637,460,649 *41AD4DA969B0EF1FD0FE4080AC893C6FD5EC0D1E HenryC.
637,460,650 *41AEBE58FEA3ABC5BFA327E62D7892A47735618E HERSCHELMARGARYAN
637,460,651 *41A6FF2965E971C490B595FF11D050EE65A68BBE herschelrubano
637,460,652 *41ADAF3C4D7C7BECC652299265D1911B0B2D170D HERSHEYSAPPHIRE
637,460,653 *41AEF33351E2685F8132E573396D47457428975C HIGH5288
637,460,654 *41A03549B46B03E55D6EB3E7AF0632AB09C085CE HLATEEPH
637,460,655 *41ACAEBDB987FEB34CB3EDFCA556697DB9171041 hoh:
637,460,656 *41AF581BD38471E7290E154E4731C20D89C7ABFB [email protected]
637,460,657 *41A694D44C15D1D483910711E25D15C5CCCDEF70 HORACESEPTON
637,460,658 *41AC72E7B7DB35E9EB7E56683BEB968CC1C1D912 HORWTIZ.1.0
637,460,659 *41A95D8F30595DDAD68BCB99045BF2AFBA9E98C2 hoseaciprian
637,460,660 *41AC723CE85DCF5F1A32F041F7519CC7B81554AE [email protected]
637,460,661 *41ADDF1D57C4EE2DA3EA53C87A4A042A5A275E8B HOYT.RIGATTI
637,460,662 *41AF3DCC49B59E6CE3075B64EB1A56F9E57D8496 HP1227
637,460,663 *41AC74F3B609FE734DB7E911072A3D9CEE401E61 HR'P
637,460,664 *41A4A0808EDC51D15404737F21FFF0C6E1ED4C6D HUBERTKOPPA
637,460,665 *41AB17EE4012CFAAA2E2AA5DE44159E95BDC1543 HUEYCEBULA
637,460,666 *41AC5DC9BA76671D259C5E0671FE2B068BFFB2BF hugh681
637,460,667 *41A92F07B8D894261E35A8AF5402FDB775522298 IANMEADER
637,460,668 *41A4F0217404EB7A652BC95C767C059CB5011E2A [email protected]
637,460,669 *41A1C711F30ED1D55F6A8F1723E33658DB3E8247 I.DON'T.WANT.TO.(FRANKIE.KNUCKLES.FRANKTIFIED.CLUB.MIX)
637,460,670 *41AC14D28FBF2C89B8BE726CCA455C86F5273699 I/IE
637,460,671 *41A543B40205AB7478511EAFF654780ED3662781 IMANLIS8
637,460,672 *41AF1B9F00DB06BC9C98EA74E48A579E3B98D46E impaledandbeheaded
637,460,673 *41ABEBB2984631A070BD1D6A8124B2DABF5C5874 IMPRESSIONPDF
637,460,674 *41A32ACE25EC0FA7F4A141CB68AFEFB1B0588B10 INS^
637,460,675 *41A21CB3037A51A9EAB3A0FE9E7D7DC5D32BEA4B ISAAC.AGAN
637,460,676 *41AB2468AF5BD1CC499B33B032CBC69E060AC5F9 iscremer4
637,460,677 *41A8CC4782BB45592D29C3D55CA0624D1E3F01B5 ?~"J
637,460,678 *41AB2DC83C6AB3D5B8465EE5ECD0CF61F1FF8283 J,A0
637,460,679 *41AEE4B305ED68B2466B6E8FDC90ECF4AB43B5B9 jacob.jimmy
637,460,680 *41A36FD72B67A0C826D484BFEEAD063EC2EAFE24 JAINFIRSTTIRTHANKARA
637,460,681 *41A1F733A358BFCE358BFC6D1B52BA8B2A2CEF03 jamarlasalle
637,460,682 *41A847C773B106F21B435188DF40B665DA2D7726 JAMISONPASQUAL
637,460,683 *41AE5CBF9B6D4251864BE038AD1EF07F56B05B1B JAREDKLUESNER
637,460,684 *41AE86682C65A40F531896A16E67706B1CE8E453 jason-nevins-minimix
637,460,685 *41A450E4C9665042913753A629F069ED86610D3F JAVED-TYAGI
637,460,686 *41A2F33B2EBC8B25CB9492E841B096B4B790EA96 jccecilio
637,460,687 *41A8FEBC63B0596C6314772EBAD6CDAE02465151 JCWILSHIRE
637,460,688 *41A49CB2084A6363393E39BA8B342A19DC22923F JEANNE.MARCHANT
637,460,689 *41A0069A70F5FD4630D4771380513E264E781CA9 JENA-AREA
637,460,690 *41AF80123C1653D12E9C8A1351A11512A1433F75 jeretoohey
637,460,691 *41AF34E619A12571C94B31AB3E23197212458595 JEROMECASTERLINE
637,460,692 *41A16ED4ABCB6A26BB743FADE756D5FAA4848CCC jeromybostelmann
637,460,693 *41A0A4D591B9C0739AD4EC8074AD0C341A65F92D jess0613
637,460,694 *41A88EF8874E379A320E4FDA4269A98B0736611D JEWELLESKOVAR
637,460,695 *41A1D159FDA469157079F4AD202CB8C8F252F940 [email protected]
637,460,696 *41A9A5F303F5C823B03C84D70484C0AE2CAA3379 JIMMIE.KNOTT
637,460,697 *41AD4CCBE7537E522DDE263C120CDF1264855C53 [email protected]
637,460,698 *41AB847325EF257AE6497AE701DE75029C957C91 JOANBROOKSHER
637,460,699 *41A0D931CEB85CCA9FB87998E8CFD1D29BD53B92 JOESPH.MORALE
637,460,700 *41A1C8C7804C8F4703C21AAA3FB424E13E66B8E3 johnnysmits
637,460,701 *41AFD2F2CD3DCF3147AAD846A6AAE99EE543E9FD JONATHAN.HATORI
637,460,702 *41A306515B8FE4DCA2901077956FFAAD80BFACF0 JOSHUAPASQUARELLI
637,460,703 *41ABBEAA60CEFC28D18B671F3AD9AF63DDEB34FF JUSTINE BOND
637,460,704 *41A6B1542FBC43F4D4796BDC623E0789AE6C37B0 jzh
637,460,705 *41AEBCF967EA78645FB32FFF29708ABCCB82D6DB KARTZEITEN
637,460,706 *41A59262C3518CA13AC2CAC0665101C2EFF0A33E KASEYCURIO
637,460,707 *41A3FDD99FFA29C3775328CFE48BAE788DE8B5A2 kazinazmul
637,460,708 *41A81FE81D6F3C42A1168CC60A32FC162A876D11 KBSIMOLEONBONAPARTE
637,460,709 *41AB4681EF196C22A4FAEF1D264213D3539066DF KELLY.GOSSARD
637,460,710 *41A630A8FA9D8A71CC2585FF42767A50F9DAB8C5 KENNETHS12
637,460,711 *41A0FBE7229B4773DA7CC7766B322D3D984131E5 kermitgeanopulos
637,460,712 *41A8CEFC2A27BADEE935D885983FD087A3E27046 [email protected]
637,460,713 *41AB44CC1266C6665B1537AB101F104CA07E3D7D KEVINDRIEDGER
637,460,714 *41ABABEFACEE99F155D7E6AF45540E317A2F30EF KEYPAD.H
637,460,715 *41AC3ADD314B0760452E5386ACB90A16B9BA3156 KHOZYA
637,460,716 *41AFD1165B4EC3EB90DA5119F9555CC574DA957D KIBBLING
637,460,717 *41A130C655BFAC3C3EC0792F9DC2B9955CF55E3C kiotti
637,460,718 *41A4F28A9138650CA4385586297CA47B1C580F9C KLAGERIGE6
637,460,719 *41A62FE3AAE850CF9F6411A866E5832994DE67C6 kontor:maximumtrance3
637,460,720 *41A9F4B442B0DF77DFFB7CA55498E78D3F4BC945 KOULUHISTORIAANSA
637,460,721 *41A956FBB33EAEE6F06397AD43CC1958FAB54577 KR4P3
637,460,722 *41A490BA59492F109B2B875F5C0AF5D7A4B11262 kraigcopus
637,460,723 *41A5E63C85ED4F48A1855B33C4921EAEFE3B74E0 KRANYUM
637,460,724 *41ADD45D28B4F24105B7268D4ADCFE00264FB3CC KREMLIMS
637,460,725 *41A209BC6DFC3347D8F604B560EE461634EE4090 KRISTY.LIEW
637,460,726 *41A6C5B29D78BB79FDDA74F7656119CF9E1801FC KURTISSUET
637,460,727 *41AA6BB6E3650E7526E06B29E2111CDD36358C9D KURT.TOURIKIS
637,460,728 *41A645CAECD3661391D5E02185C29E8F872110A5 KY=#
637,460,729 *41A19DAB7DEDD5A30551CCD8E6C0ACD968E7A02A L3NNOX'S
637,460,730 *41A8FBB7704562407ECD045AAAFB509432398455 [email protected]
637,460,731 *41ABBB67D77D1E566CC40662503AE813726E4C8F LAMONTCARRISON
637,460,732 *41AFC7898E9B671DFF057C30AA6D5190E8237F69 LANGIERÓWNA
637,460,733 *41AC5AB40D942FC7791E4149434EAF279EA3CB1A LARZYLA
637,460,734 *41A8336C13C3AD588DA21B54CE7B81094156C1D3 latents
637,460,735 *41A6AA162808FEC48E68D86CE8DB335CFCFC337A LEASTVILLAINOUS
637,460,736 *41A5152213C07FF16BC7B588A57BA44E1EC23835 LEBEN(DISC2)
637,460,737 *41AC550448105F49F4F8A4B16678B3B2D9172726 leesportareahistory
637,460,738 *41A93AA3BEF40F9F4667F5DA169656AABE63E704 LEIGHPUZ
637,460,739 *41A9B25D02F76DD68ADAB9C066BC71A239A471FF LENGUASPALEOASI
637,460,740 *41AA0EF9DDB221492474B6203BEAB7DDB1450E50 LENPETRSON
637,460,741 *41A390479319BC3B6264205CA8CBB910EE21477C LESLEYSUKHU
637,460,742 *41A973778D8BD0BEA6E6D42CAF4785223163D15D LFGZNGN9
637,460,743 *41A76ACAE2F623F4DDAAF0C1354E0B17096087E0 [email protected]N
637,460,744 *41A033CF98EC179D393B6A057B7EC05DC9DCB4AA library2
637,460,745 *41A08833A68B2C130DB42E3683AD9A6F47E0F532 [email protected]
637,460,746 *41AB08A8797FDFD92DAA83F0FE81F0533D6F4BBA lo&}
637,460,747 *41AFE18954FF1E755172A57B25407B9FD911F9D5 LOKETTENKWESTIE
637,460,748 *41AFD312981B0F8C20A8C28F309477A0455AE117 LONDON.JACKSON
637,460,749 *41A209A184A6D0E4FE43C269A3D658E1095D24B5 lostonyou
637,460,750 *41A57711BC87DEF563F58FBEE8BBD168CE454389 LUCASFILM.GAMES
637,460,751 *41A5CE72005E6B91F69877FAEE41DDC15DEABA66 LUISSVEUM
637,460,752 *41AD94063CCBD96F60750CB001B82E1E16706CFC [email protected]
637,460,753 *41A1198C84A6E1AA087C11394C31CB2EA07B4992 [email protected]
637,460,754 *41AD60B6EB6874E30F610B1028D7055098D7914D lyknske0
637,460,755 *41AB5FDFDC759EFB2E6165DBCEC45DB1E3E958B0 maicx-quitoriano
637,460,756 *41AF2C546CCE71901239B610B237CA812952CEB6 MAIL2ALICIA
637,460,757 *41A4DB610C8834B9C0B18BA6FEBF8D705C045DA7 majose042526
637,460,758 *41AB0C27F95E93CE9FAC507A0350830BACA92750 MALCOLMWILDA
637,460,759 *41A06D28BAF7E3F96E4B297384297DEBD140CDCA MALER
637,460,760 *41AD96C7D3E57AE17DC7E24B80AB162FDC87F0D6 manscapebbs
637,460,761 *41A1E31E93496460793DBB7D57F555A4AC190557 marcia-malcolm
637,460,762 *41A762546EBE08FFA472F9A3096F1117A7E647A2 marciamitzmangaven
637,460,763 *41A287323B8B4ABF5BC3630D5ED5876986F364A3 marcosforee
637,460,764 *41AD2022C44113876CD62A5C9D0F2AEEA99E46BB marginale!
637,460,765 *41A3F9C554DA3A379565C0427072F0AA02C0C9CF marilynhannah
637,460,766 *41AC9ABB2EF27219DD35AEB43848B6A5392DEC14 MARIO.DERIDER
637,460,767 *41AFFEE4A19358A1A0F42BE102FBD604629F1435 MARQUIS.BIHL
637,460,768 *41A69F72AC79E513B61C97851F285F60481076CF marshallefrati
637,460,769 *41AE80882960CFFCE500401E3697F5F978825846 MARTINGRZADZINSKI
637,460,770 *41AE3CEB685429A115D5B3F45F4B2AED9FB861A0 martypicou
637,460,771 *41A98EBBA7EB66707EC76C3EAAFA62D86814482B MARVINHOWINGTON
637,460,772 *41AD56C072B8B6CA2B9DF7EDB02E4B5F158CA799 MC3^
637,460,773 *41A8FACBD5ED6D99664C9E31AF434BB69274C44E meluluskan
637,460,774 *41AB1ADC2D495CB12AFD5FC9D33C7BAF14868F0F MEMPHISROCKNROMPBLOGSPOTCOMMEMPHISROCKNROMP
637,460,775 *41A5CFF006704EC5A63C6AC81075AFDAFDF1F16A MENTIRI9
637,460,776 *41A815A4F85EBAA04EDC6B26D089A9AA403F0787 merodoamed
637,460,777 *41AE9C34D797EB12C3E54BED7DF9A7C869CCEFFF MICHEL.ERRERA
637,460,778 *41A34A0552F78103459F468E85C99682C5C3E301 MICHEL.WARMOTH
637,460,779 *41A8F404E69946BBDAC5A110FF512BF3667AFD32 [email protected]
637,460,780 *41ABF717450AB5EFFC98F2F34079BCDD63049E4F MICROSPORANGIATE
637,460,781 *41A5DA556172C57A1472E1D80F67F5F920DFC28E MILFORD.PIERPONT
637,460,782 *41A7ADA20E89F54C6DD1AB7E588518453FCDF2B2 MILLARD.ROSAN
637,460,783 *41A9884B09CADD5CEDAD7422843979482EB9CA95 miloauston
637,460,784 *41A5A714005A8DFCD30CFA6A31DEABFA94AAFDFF MIMI SAMA
637,460,785 *41A992B1B37E9E7922D597C6B0EA24866D41AFC8 MINA-LAWENDY
637,460,786 *41A1A94B3F428F990B026C9E6FD6678C85101DA2 MINERALSPIRITS
637,460,787 *41A0BD5680932FAAD3F3774F9BBDF9D5971E9BA8 MITCHEL.PAGELS
637,460,788 *41AC077BC59DD253503E7817881530C055C36C85 [email protected]
637,460,789 *41AFA740E170F8C201BBFBF50BEAFF1654E4F8E9 mocnejsi
637,460,790 *41A7B9C04C4866708206D72F6E17E26CDC342885 MOHAMEDDALIO
637,460,791 *41AE2FBC33B38C8582711D388A1B3DC62B6CD6EE MOHAMMED.STREMI
637,460,792 *41AA0CBAD0C4AB7BF65970C9AAEF0CF6AA160E41 MONKEYLANDISKOOL
637,460,793 *41A937531CF80DFB24A5755D55329DC3236222AB MOUAHAHAHAHA
637,460,794 *41A007272BE94929423C364D9BE1E66C0F5BF2DE mp8(
637,460,795 *41AB7303D6460C5907B66043A72CF2D534F27A11 MTSAMBORO160
637,460,796 *41A3A5C69900853DCF3342FE8804F6F48BCEBCB8 [email protected]
637,460,797 *41A556883E2176340D319F05214144BEFA1B7652 museu.arqueologico.do.carmo
637,460,798 *41A56CDC1CF2D8F55D0E2A7C6AD43860992D9197 mycomycetous
637,460,799 *41AF8C6888D1C03052E3A82C3C437D5A5302FCAC [email protected]
637,460,800 *41A76A4EA1F0FF78A7F51B26E1B57D4CCB42624F narepmoc
637,460,801 *41ABEB300E8FCAA679F000FDF77059CF1FFA72E3 NÄYTEKOLLAASI
637,460,802 *41A4D3EBEA58542D5CFB93790E6954746503634A NEGNISTAAKFA
637,460,803 *41A6F17D2A1270C8C8EDA77659E25CBC7D09B659 nheeq
637,460,804 *41A810E0BF8F808B81CB790BD869140D4C1A6F0C NIARSDIK
637,460,805 *41A2696C9638D2F7DC2F390A0FF22E40F951DF31 NICK.HARRIPERSAD
637,460,806 *41A9EBBB25F99479B44AE0B88282583FE94BCFDF nickyputty
637,460,807 *41A9845E28378A1FAB9A6D634D5ED0AF1461C480 nisse-la-France-(feat.-Ariel-Wizeman)
637,460,808 *41A7C8BBA4DB8E2D529C8A2CC806D4993FD78DCB njcxna
637,460,809 *41A5EF8FE202937092AFC8A56069B0BDA9CE7BE4 NSRIMAHIBALA
637,460,810 *41A0F72D4FAB8CD8EAA395F99113507D61671236 NTIKIELING
637,460,811 *41A25DDF666898C6D58131CC8BC0EA6293702B3C nuoterebbe1
637,460,812 *41A74CD0C295669B0C755D1FF138CE00D0A6E9DB (><).O~.0~.<###Q
637,460,813 *41AC8F7C9419E35091D927369A20595E8009E53C O[^3
637,460,814 *41AFF0CB4FF0DC34434F29D0C129DBE5119D6121 OATMEALSTARTREK
637,460,815 *41A3D007F6A50D9E79F4F8C675B5F4FE714E6199 obliteratively4
637,460,816 *41A48E6EF0BB217DAB8DB3C8A511EA0B29801BFC O|L>
637,460,817 *41ADE8F817CA8F9E8219077D8B065E4826BBBC96 [email protected]
637,460,818 *41A3EF128A2CD6DAE5B4CCE1BDE49DA24E6CD417 orvillefitzgerlad
637,460,819 *41AB5B82ADA7BCA02E88BFFF4EAF7CE00C46B6BB OSCAR.BONENFANT
637,460,820 *41A4C67095EB64D206D78A477F93B3AD2891B926 OSZCZERSTWOM
637,460,821 *41A0F6E7B77D86AB77B7CC774CB0244A3527CA33 otterol1
637,460,822 *41AF2483F8315F7E9EE0DD5B17DAD95781FD86DC OUTNUMBE7
637,460,823 *41ABF6022448E6E03A03546C3289193DC3DFC1E7 overitnowii
637,460,824 *41AFD03F9A5A5465C72F64F74C40C98F28403B33 OVTFRETU61
637,460,825 *41A2399728135586E01ECB00255E51112C6C66C6 [email protected]
637,460,826 *41A9713C50BBEC2DC848591F80B53B52CA66F668 pavier
637,460,827 *41A6D14482561614893F36D5737EA4C017EDBA4D PDMOMENTAUFNAHME.(FEAT..PMC)
637,460,828 *41AD589CC35A9924B92238E82A6A8C90AF9E4BED p==d.~o.splat!!
637,460,829 *41AEF09E2838A90566215CABD5844E9C52EE36EA [email protected]
637,460,830 *41AED69DE3C1124EFA1A35B728C391EB7740507B pgptpyrcaivgnisu61.2
637,460,831 *41AA3DCB07FA75064A958EEE08C4FBC893F52E3A pikroeno5
637,460,832 *41A9BA4820E3223B5BA1A916C3867E3CA4DA7B45 playpianocomwww
637,460,833 *41AC48100BE6786C447B0897D3D4655DE1112D86 pliancy &c 324;
637,460,834 *41A05DED84297E0B21E5BA229546BB013B6EA619 PQ2A
637,460,835 *41AF5779B29FB22DFA3EF23E25E95E439950FF37 PRINCIPE1986
637,460,836 *41AB44420CB86F9E0BD3ACA9496A22B6BC07EE88 Psalm.146.(Ripley)
637,460,837 *41AD6D8CE485E8F781CA179C4AE26293072E0069 [email protected]
637,460,838 *41A01E4EB185198F70B34DCC75174FB5D5936750 punc+!l!ou$
637,460,839 *41AC8B3871E61C7660CCF3997F8C052FBA5C28E7 q######p.~o~osploit
637,460,840 *41A3730A399B8631DA55DD2E6F105718D8B2B3CA QSK
637,460,841 *41A5C8FA9E8C35677CAE34D1631BE144A29C1CB3 randy-andrada
637,460,842 *41A7A10550AF04A48223B0F02AA3A8945F42DD22 RAPHAEL.DUTT
637,460,843 *41A34A1A1A1EB3F43F36C845F9F43E5DBFDBC248 raul673
637,460,844 *41AB09B3D758D4690E07559709E546F88B734F38 REDEATHA8
637,460,845 *41A2A13FC89F1AEE3AA12A8E22C5771F2B2F8DAA REDNOLBBED
637,460,846 *41A354DFA8D4BBEB86AB4C6E0673D6B661E41C2B reformerait1
637,460,847 *41AF4BC04FBE7C27EE1257F9166D6910A8DA3D2D rel!g!on!$7$
637,460,848 *41A61E717C1CA41B01A2527092BEFA73A345CF16 REPARADIGMAS
637,460,849 *41A2447B03E575BD4389D98865028E7EAE3D10CF RESKANDINAVISERING
637,460,850 *41A22E08AF136D37C0627ABA11153C437F89A2A7 RETREOLP4
637,460,851 *41A830752CF49241C83F873AC542B56E2538457C REZNORPRAISE2
637,460,852 *41A71638E4216EC2EE22AC4E9D398195BA7C1CE1 RHEERSEN3
637,460,853 *41ABFD9585CC01588436049890D88D6023491B83 RICKEY.BERLACHER
637,460,854 *41A0E420A4D99FA9C35C1F03AAC885189E0691D4 Ridder.Coene
637,460,855 *41AD63903A437C9CCDAFC981584A44E6744279BB RIGOBERTOEISIMINGER
637,460,856 *41A3D2CE3BB8BF587983207FBF2890CAB01DC65B [email protected]
637,460,857 *41A9E7E591B7D01F605975D0D10C67D00C8C67DA RIPPERALBERT4
637,460,858 *41ADA9518295DEDCF1082BC07F5370FEB76568C5 robbiebreslawski
637,460,859 *41A0AB10B6778DF518502C60044EE1B5F45D2E48 ROBINVOODOO5
637,460,860 *41A39C43FE560540D33FD9DB652AEAA0D79F4283 ROBSANDBOX
637,460,861 *41AFEA973ABD81445A4935DD044E90573126F794 ROLANDSCHMEECKLE
637,460,862 *41AFDF03CB2C6919CED1A3979AB3AF9157D888FB rosette.nebula
637,460,863 *41A6EA2A68A2CE2C8CA417F6110A768B44BC43B4 R~PZ
637,460,864 *41AC1563096424F88FE8A5CDA31D240127983BF0 ruby-morante
637,460,865 *41A825A372E8D0D0A6926E0689F05DAF9D4087B2 rudolfjustiss
637,460,866 *41A29F23741E05250F7E1DA8D04211FEBD5DA4A8 RUSSELLABETE
637,460,867 *41AD562CC9E1CCB86DEFDF7E7208F9C99A97656A RYAN.GURA
637,460,868 *41A699CAC38FC25F2F178FE69918D7B4153BFB92 RZLSOPFPW
637,460,869 *41A0D215EC8FC6E5F1BC48E26CBE2ED1EE5C8539 SAEVELLYKSISSAING
637,460,870 *41A7D94649BD1F1E75A03F75CA490721ADB75B2C saffarik
637,460,871 *41A640146E38D7EF33F1D780B64EB4E1CE0B52D4 SALVADORGENEROSO
637,460,872 *41A462BEA0B850B14F07D99FADD7E23EC78626A8 SAMGHARAKSITA
637,460,873 *41AFC30C61D8958A21EE9FE2EAFE65190E120481 SANTAFELOCOMOTIVE6
637,460,874 *41AD0492EDD64442C54E2C6A618053062AC975AF SANTIAGO.FINGERMAN
637,460,875 *41A287CA153088A1C45E872EA6D9AA1E55133A52 [email protected]
637,460,876 *41A8F11CBD790FF4FF4947552210ED593FF34DC8 SARAH-BROSZEIT
637,460,877 *41A7D718483CD63D6528951CA5243D02CA222DB8 SAREDART9
637,460,878 *41A18D12B46F3ECE12950A9DD51084B46E0E107A sayidina.ali
637,460,879 *41A5FB104777C28217DF9076F41E616C60B1B0EB SCHLMNNING
637,460,880 *41AA9B77BBFE67D4925505886F7C5E39B0116DB0 SCHNEIDERMANTHE
637,460,881 *41A1524D9E115A7E8D1B3C30EB0C3039EE71F0B7 SCOT.KLEPAC
637,460,882 *41AF97E2F61D368B12EEC33E34AD1EA2557BDC45 Scott.Brown.&.DJ.Rab.S
637,460,883 *41ACE226BA1A60A2EC01F7E77546FA5AEE1D67A8 SCRUTINANT.
637,460,884 *41A64E9D03ED686C212C5922886DF0830954071D SECOURAIT4
637,460,885 *41A5A9EFE251035988CAD5B68FA45AC25112AFDA SEYMOUR.BALD
637,460,886 *41A7CABCE2AB62A8B7F1BE961F5F8DC0C64EE789 SHAHIDPANHWAR
637,460,887 *41A4E4AD6766DC55A5FDCF4C669D4E4892FF11A1 SHANASOLOMON
637,460,888 *41AE1F1D9A8D056CB307CB02B09B5042556E91E0 SHANNON-GEHER
637,460,889 *41AA8F6D950F3762CF3038351CE2DF1E1A7D5874 SHELL("C:\COMMANDCOM",
637,460,890 *41A613BEFE3C46DE077AAAF4B0910A6C40B0AC51 SIAMBWATI
637,460,891 *41AE7A8D1923FE09A103DF54EBBFDA6E93566193 SIMON.RIOPEL
637,460,892 *41A7C70E2916749368A3B39042F4C12BD9028757 singulariteiten
637,460,893 *41AC8B28081CCCD04ED6DB463C4F54ECE11F9AB6 slopitch0
637,460,894 *41AF7C2D2187495772E74F3453938FF93B58D5FC SOL.DOVENMUEHLER
637,460,895 *41AC62E4BEEA706B811F6A7FED3DCBAC584A5DA9 soleymanlou
637,460,896 *41A7582A806D4EF9D6530DFFCF924D6FE060F260 SOSMANAJ
637,460,897 *41A6567E6CC2252199CF7906207609CF746EDBF9 Soul.Reservation.Morning
637,460,898 *41AC0E7F74E50A300EB99C9F23DB63D25313F44E SPÆLLÁBAHTA
637,460,899 *41A5EAE9CBBDD0782635BD543604116D2EA546BA SPREADINGVIRUSES1
637,460,900 *41A5D7A0AAF45764AB78C7D4BF1714BDF5E19654 SRNCH
637,460,901 *41A52FF65FB753BCECAEABCE426ED0E48BDA6969 STANFORD.SCARFF
637,460,902 *41A6F8E755AB89501CF474E2292B5F4A1232B04F stanzachorus
637,460,903 *41ADBEE1BBA8E5E8834632AE96BC14EE3F1A6A5B STAYING.PICTURES
637,460,904 *41A9F6C7DD86EE53B5E2A2DE426E2BCBFAFB8F32 stephenruggiero
637,460,905 *41ACC91D176B4D7E0BB27416C7FF079F2E36318D STFMDRLJKST0
637,460,906 *41AEA4A065220605724D9F86847CF155D159D01A STIDESYELGATO
637,460,907 *41ADF6BA6E7497B41E97F5EB0A3F98DAD750B55D stroomkaarts
637,460,908 *41A30077456B200A85CBBD6D704A87E60F821A85 [email protected]
637,460,909 *41A91F5D8E2AC6A840E15C9EFDAE16478AB8FC4F SUNCONGZE
637,460,910 *41A75298875FF3D6D0B26B202878DC9FA6A3AD7A SUSPENSIONIS6
637,460,911 *41AF65E2BEB19B2B15C93461035504CAD297307F SWAPNILSINGH
637,460,912 *41AFCE15DA15B55D90789F8B61E669FE595E138A SYNALEPHAS1234
637,460,913 *41AE9D646072F5D66B55F8E1D7A1AF64432C537A SYNELNYKOWSKI
637,460,914 *41ABC0DD9B49A1742F63E2DBBF857B4DB783468E T3HRAN
637,460,915 *41A41F245C73253FA6CDB290523D0AAB5DA812CC tac17
637,460,916 *41A86476ECA56CB1F2042498671EB549124CACFE [email protected]
637,460,917 *41AA6D75B0408EFCA998F12E6E796EA07F4B312B TARANTEGOLA
637,460,918 *41A05C31BAACB2DA452A58843C8882EBE74E8507 TCWNWBFYO9
637,460,919 *41ACDA1C678E09F7EC8B8F8680A6FB65AAD6B20B TENUITASED
637,460,920 *41A9F1C8F97A265185234BEB1A6E289CFED63E99 TEPLOTNIM
637,460,921 *41A2B0B75DD365333C45B478D87AC06E59F6D0B9 TH225558
637,460,922 *41AEF487DF733704746F28647E0327419E3D69F4 THE-CHESS-YEARS-(DISC-7)
637,460,923 *41AB1DA3289A8B5C2C6276A7248AAACBC22F98A4 thefelipe2007
637,460,924 *41ADD7A2BC1EDDA7D36A7256BC55C71D4FF5A8D0 thejudge1988
637,460,925 *41AE3C5D70EDA2D86F04543A957A6832A74054E4 THE-ROYAL-NOTES
637,460,926 *41AFEABC6F55A83FBFD7C941068390339BE6D985 The-Student-(b)
637,460,927 *41A0FC8E21728A2218C24FB3B1EBC14BCB61E0F0 THINGSURELYTHEREFORETO7
637,460,928 *41A7CADBE9B521B9F65A1C6CB50EA4236B17C5F9 THOMASMARCUS1
637,460,929 *41AAA19ECCA58B02B642C864B220D990825DA5F6 THRAWN300
637,460,930 *41AE3FC6933FD14F265B9A55704DFBE471FC96F2 thửthách
637,460,931 *41A521605CD9F5F1532B429087DA7643FA010F8F TIMIDU
637,460,932 *41AC88B54092B4BF6C3B241D7D2AD54FCC318413 TOBYGOONEN
637,460,933 *41AA164D6AC92A06AA62F9DC45F611AB51CD178F toewiesen
637,460,934 *41AD0C7B8338636D07A804DD90C4A201E7D46286 TOTTEMO6
637,460,935 *41AD9367072F3C97174F7A2DBC61321CD2DFEC2D tq'w
637,460,936 *41A04794BB95CC5908C3376A75C8FA74A4CFB73C TREVOR.BASCO.KHOZA
637,460,937 *41A117232A253466AB8B85430CCF97EE167077DB tslefpig
637,460,938 *41ABF23C0F8DB095D81DE1F2C35A5A165443E37D u59fp3kbqedz34v
637,460,939 *41A53BAE7849C64E202777FE8058D89330547D4D [email protected]
637,460,940 *41AD6B74D66E0E5DCF131BAD350956E90CF7D290 UMEIMA-ENNAZER
637,460,941 *41AD5B1BFDF914B5FAEF7D60B21B8F46335E8FCD un087ru51v3
637,460,942 *41A34257ED1BAB72C6A06217CE4BC7D6C4DEDA4D [email protected]
637,460,943 *41A1B323A754BD3AE1761E3E63261CF593753C0C UNIMOGS
637,460,944 *41AF6B7EA4742CB034BB5176A1F8165CBF47B375 UNREAL.IN
637,460,945 *41AB4CE7024C72E4FC606E3E731A89CA6F23A441 uriel-arciniega
637,460,946 *41A7343D43155BACBE6E90BAEA11D890FE77B25E USGINGEN8
637,460,947 *41A95EF770BCFBEA88C1B15E26DE120CE7F066AE UTCWAUKEGAN
637,460,948 *41A5931C18B06B5E992C91CE83039F901B1863DD UTJÄMNINGEN
637,460,949 *41A738A3BFD4D5D20DC6B7EFC69B9333E594B2AD vahe.mushegyan
637,460,950 *41AFF60622CEB9B0F4D83649EA3BDEA6606D8246 valentinfreehan
637,460,951 *41A56A07FA62F5E42C46799DEF3A891EB01DB5E4 vandal mandarin mission
637,460,952 *41A1C2B479EBE58E9ED557147F0EE391A4FAA800 VERDUBBELD7
637,460,953 *41A658A911EBA0AB51D1BD93CFCAB25EC77172C2 VICENTE.STROINSKI
637,460,954 *41A0178D289728CE575E9B31581B6891298A0E7B VICKIHUTCHCRAFT
637,460,955 *41ACED56D37BE56352E02A182CBD154F754AC727 VICKISACZYNSKI
637,460,956 *41AA27DAD758114302FEC8C503BA8D6FB5194404 VINCEALTRECHE
637,460,957 *41A9B8D7FEDF07FF5EDAA0991EFD006490274BFD vincentdemascio
637,460,958 *41A59D7C535F235EF07E731BB3FB849BC569A9B0 VIOLET AKJFKEJ
637,460,959 *41AF18F6B126E38F5E0803FF90A457E1F0505321 VIRGILIOTUERK
637,460,960 *41A449484E02D9256D66B97BCEB02D056056B091 visduive
637,460,961 *41AA824A3490CD969E933FD4D8A18E9BE3F32195 [email protected]@+ions
637,460,962 *41AE63AA33988E81F98D9203F2F212A25D6AE5AF [email protected]
637,460,963 *41ACFAC68528B533D849F1B9386078D87E42CEAB wctxbsw9
637,460,964 *41A1C851108D8ACEC65CB4B5868C0531B159D667 [email protected]
637,460,965 *41A14E6E1204A8AF576913A9F9EDF215501BDB48 WHAT'S-IT-GONNA-BE?!-(FEAT.-JANET-JACKSON)-(SOUL-SOCIETY-REMIX)
637,460,966 *41A1FBD56F07D1A7254E9EEEE45A5F03AF223FCE will-godding
637,460,967 *41A289B7B96D9FA37720BB33EC90F1B7BA674DBD WILLIAM R LESOFSKY
637,460,968 *41AAFFBA96347DCA4AD4ACF441A326B33FB16704 WILLIAMSWITTKOPP
637,460,969 *41A3D839ABF38B9BCA5196EB5F372977AB48412A williansheck
637,460,970 *41A5EDC7F59182DECA7301743F3472EF2BF81852 winysen
637,460,971 *41ACC4C4C08CF9B298FD4836031325B7FD52A54E wolf-ludger
637,460,972 *41A8D64F3DE73F97FD8E6CCD3B2430776273AF7A [email protected]
637,460,973 *41A4038880DCAC15569F0184DE3646AC9286CACE WSBFOGAB
637,460,974 *41A236AF5F77BF432308333DFCFDE805579377F8 [email protected]
637,460,975 *41AB131AA9D9D8B8B51812CA70BCFE8D0C2909C3 WWWFREEADDICTINGGAMESCOM
637,460,976 *41A0F2B6785614371F6C96F3A1CE2EC9E0548B75 WWWSTAINLESSHEADERSCOM
637,460,977 *41A131BB9CAA950583F7A0909BBB6D22309CCEDF xavierlakowski
637,460,978 *41AE2DE2B54815A89E823D7694720C4A0863B799 xavierneifer
637,460,979 *41A07AE1CF9D9FE5F1555D7B57DD7F9DC42D9D40 XEPHIER NASRU
637,460,980 *41AEFEDFD0555E8BF95EAF10158C36C6814AAC53 [email protected]
637,460,981 *41ABCEB2B42660CF6E92513FF3BD988749AE8374 XIPHIIDAED
637,460,982 *41A92EC208EC1CAD903D6E7D62029FF7D0369F80 xnwq
637,460,983 *41A03079D947DE658B6E21DD1B5ECFD38A71E33D XPSMOKER
637,460,984 *41A6ADAE23A223506256EDFE050F76E7FF4CD6F5 yahoo
637,460,985 *41A7E2D31AE976C79E19626371238F16315B6A4E YASPOCRI8
637,460,986 *41AA5F8C38E91988822A178A575E5BF1E9F0C12D YI&_
637,460,987 *41A3B7CF023993EDB7D5E41FD4C947E2BDB27809 [email protected]
637,460,988 *41A9CE5FC65C8550A62C37D0782F2CC6646097EA yip.chee.kit
637,460,989 *41A98AD50A149A99EAAF17928A38888FE424B2E9 yldiuqil5
637,460,990 *41A446BF698D7B1AF5EAB8F1B1371601A8E1499E YOANPERMATA
637,460,991 *41AAAE2D2E606211CCB19741EB6CDB1B7E626238 YVONNE.GALLAHAN.BOURNE
637,460,992 *41A4291F002059C8AB3DB1E4031E074A84581421 ZACHARY RHODES
637,460,993 *41A1E0ACA8D8DA2CB9B4D5B6F8C2476E38D378E6 ZAIDY STEPHANY
637,460,994 *41AC94B777E7944DA2A8608D99A2CB170A3B1B0C ZANDRA-WILLIAMS-CHILDRESS
637,460,995 *41AA600A0728A94BD85A8813965AEE4D8212BCE0 zarifah-sofia-jr
637,460,996 *41A9634F529AD0C154AF9A63A6202F2B490B7920 ZELFBEHAAGLIJKER5
637,460,997 *41A05D80C5B02B6ED50D23019BF191A0A4F8A039 ZIELKURVE9
637,460,998 *41A2F5A99221217E5A1147A1FDBD0428EC9ABB87 zkfkqcm5
637,460,999 *41AC6EEB584302F76D23CACD8924291B90A01482 БАГАТОСЕКЦІЙНИМИ
637,461,000 *41AD4E04B33C7F395FCE767E5C38313D53926C55 ДРОЙСЕНА
637,461,001 *41A44AB95645966436B5BBACFB8388234003C3BC жосельма
637,461,002 *41AD144E1713CA30EA4F6C2BCF8CC94CEE9F0560 «ЗАПИС
637,461,003 *41AE9533E36EC4933EBEEBEF942C4A612ACFA34A игорниколовски
637,461,004 *41A1D5AD57F887614BCC3A8F6D729EE23B4A7F6F СИТУАЦИОНИЗМ
637,461,005 *41A72FCE2CBD497A9561C1F0C1CA9930B8B07773 СОСНКОВСКИЙ
637,461,006 *41A21A207EDC6EFABEAB462D070F667D8F081C83 がいる。彼は日記に「STJÄRNSUNDほど楽観的なものはない」
637,461,007 *41AD71311E2755307C8B2D0D61F623443F5FDB17 )0([email protected]
637,461,008 *41AF051C850DF18B6BA37B5876F886F08B4F70AB 03121932
637,461,009 *41A62035449B25750A28203EEF6965DF532A9EE5 09-15-1609
637,461,010 *41AE72DED32AE059E572821FC742794C908C6E21 0U7PEAL
637,461,011 *41A30407EFBDEEFD92FB900B7C0068C9011B4E40 10JeaNNiNe
637,461,012 *41A64CDBB86DA4024039C53EF49BDCCF378C1552 1125164 hingham.is.about.10.miles.of.boston.on.hingham.bay..
637,461,013 *41A8D6DCD886A6800941D068C91CAA025D4C9C96 1218881 PRESSDOUGHWITHHANDSINTO8BY8INCHPAN
637,461,014 *41AF954DA23EF78079D63540F7A6177BE95AE3D2 1495617 KAJ KAUPUNGINHALLITUS P
637,461,015 *41AFF8AC80313002FAD0C12636824B91596C5A99 1548462 VIRHE ERROR 404 VIRHE ERROR 404 SIVUA EI L
637,461,016 *41ADCE0C8FB752473A1B4E8856846027178D11DB 161317 tartu-
637,461,017 *41AAEF206A753B462471A55D00B5120EB597729E 1798366 uusi-ihminen-saa-alkunsa-munasolun-hedelm
637,461,018 *41A8B00CE39303E28B3E54B6B68B101C60D33C7A 1884667 BEIDE EMPFINDEN SYMPATHIE FUEREINANDER .
637,461,019 *41A7F68A3E3EA25C275DD5B8584863CFF76D06DC 1 ANUAKFLUECHTLINGEN
637,461,020 *41ABDC9CF8D424AD732AB6211D68541E5E0E4778 1BESTUURSCOLLEGES
637,461,021 *41A50D33279F887CFF7F16BFB2645E8CCE2ED2B8 1-CASSIUS
637,461,022 *41A4CDC9EC3FF0073D2FEF0363FF90DE723B41C1 1 FANTASIAKOENIGS
637,461,023 *41A2979FE3646204B04904F666EDA4C33BF0A61A 1KARIHEINIL
637,461,024 *41A2B9B0B36E12A5AC6F7B13A75D62541C83E84E 1 liitt
637,461,025 *41AA388B9C0D6B23A815F4F37008A38B2FF4C885 1-nags
637,461,026 *41AE805F6D37790D9F8CA6B4420BCD79667393B5 1.OSTEOLOGISKA
637,461,027 *41A1D1A518CC2A6EDC261723885577D345FE3C2B 1.PERETZKILEID
637,461,028 *41AFEC4FCF3A2FF1866B040C94F20919543AAED6 1.SUKELLUSAIKA-TOIMINTARYHM
637,461,029 *41A07CEB7C692661C063C7D4EA8E231DFABAE76B 1.UNBEKEHRBARE
637,461,030 *41A761EB087E53C4D8C581FC9887EA92A38CE3AA 1UNDAINTILY
637,461,031 *41AF7B9753D690854F5F6C6DA2E0CC14A5206F21 1valvontata
637,461,032 *41AD0F4AD5676C71D085AE84E754F93D307A629A 2065342 ruotsalaistutkija-g
637,461,033 *41A1E7D693669AC26AB1F87F219680F1E0A892F4 2132498 t
637,461,034 *41A0EA0CE14BA533FD6D32A958D09901F1D27D40 236651 pinarlikmevkiiumurlu/aydegeetmamul.
637,461,035 *41AD923706B16E2543CCE186027BB37287E63CF8 2461657 oikeus-terveyteen-on-suomen-laissa---"-terveytt
637,461,036 *41AFF00CD0B5292B9CCADD2844FF45A3757A5854 2963584 MITTAUSPALVELUN.TULEE.MY
637,461,037 *41A6C15F4CDF2200C9B923EC607B9844B46BB297 2avantgarde-bau
637,461,038 *41AC8F38A15A2073D751C206EB3C3D5B3A4A6D62 2-MAASSAMMEKIN
637,461,039 *41ADDD43814C66BC34C1DE6B7FFA1C9576A623A1 2-partnerschaftsgemeinden
637,461,040 *41A816686B91AB92356016B83F04AA031C4E279C 2SBLVBSW
637,461,041 *41A56EC043D7F434431C7CA43FC43B8488F008B4 2TESTFRAG
637,461,042 *41A69346201EA8E2F775EAFD93428607F28C0C90 2TORSHIKA
637,461,043 *41AA6D8EA0E7C1E45A4A18D4B8195F09F69DDBAC 2YHDYSLIIKENNEPISTEIDEN
637,461,044 *41AF76302172C709909C35C120F6E046022B88CE 332421 VERRASTROSAIDANARRESTWASEXPECTEDTODAY.
637,461,045 *41A35B6C6421568AE109024BAE2E4AA1E316E6AF 37BRAYAN
637,461,046 *41A4642A8238F8155E42EB922B3EEBF6C63931D3 381.divisioona
637,461,047 *41A1DB1F0953F201F3001E379F1DC86C8C93ADF4 3ACTIVAIE
637,461,048 *41AC2E83DC99D2F668B2004D3E8747CB6025207E 3B~O~O(^_~)
637,461,049 *41A95E6FBB227124E0F680257F7C9F7C9A7EDE82 3GRATEFULK
637,461,050 *41ADC6B34E2D990E2A7B1BF65D5BC962DFE34765 3-HERVORSTOESST
637,461,051 *41A3DFFC099C6409E8268BCCEA569923C03357D9 3NUNC1AT1ON5
637,461,052 *41A21221FC95F8554BDD26343FB75671D37D25C6 3======P* * * }8{
637,461,053 *41A522A1980EF23621B39D8D560F61F7AA661634 3THATJERRY5
637,461,054 *41ACFBA5C4A195B12E87717FE903DC3A906B4177 421860 "THEPARTYLEADERSHIPHASTOSEEKOUROPINION.
637,461,055 *41A414C9DC008EF0396590CB6DA2DFE6BA2332A1 4CZYHALI
637,461,056 *41A28F8B7BC648908985E1A8BB6AB0C5329B82DD 4HYPONYMOF
637,461,057 *41A31959019D697425E54EEEF3ED934AEC135F6A 4SPLIETH
637,461,058 *41A26E82B353B5BFEC10FA3AF69AC56B46E0D80A 4TNEMEDNOF
637,461,059 *41A6EC307C70F6DE99976BDB80B26A036283B81F 4WELOOSZV
637,461,060 *41AB8E9623860F98699C87B6F8A1F8A68DE606B2 533K3RL3V3R4G3L13
637,461,061 *41A5DB64A4CF0DA1FDACE4CC7C2915E055B99643 57IPENDI
637,461,062 *41A3E2A36DA9F7524FC2331DDC04BB2DEFCAD93A 5BSWBREUGHELBSW
637,461,063 *41A11024206F4C9AF8BA1A8D8F0CBB6A79A531F1 5CHUANAS
637,461,064 *41A289BF515C3E9D72FA0875AA0F72F1A70EB720 5CKGESPRUNGENEN
637,461,065 *41ADF1F828A4036D4C04FC8E0121C8083AB7A61E 5CLOCKKCOLC
637,461,066 *41A8905868B825A34A5196D0D0076A50B1DCA060 5CONCEITABSTRACT
637,461,067 *41AEA499AC4EB5E3A8F763CC33A40C9BE74F41F7 5H3NAN19AN5
637,461,068 *41A71B394B2AEDC7369C3A5E9755E558171EB19C 5NUMMULITICI
637,461,069 *41ADF4F9367941AAE925142B2F63D58E6E08A5C8 5SYLVIADOROTHY
637,461,070 *41AE5A023C461E0591E51BD6AF0D24912E8DEA80 5UATAGNAR
637,461,071 *41AFA3029E361E9FD95DBD504259F0796EB5CC6E 5VLNSKRVT
637,461,072 *41A901DBBEA7E804CB009B98548B954D4983712C 687ASDFGH
637,461,073 *41A77BBE8D8CA4A4ABC88485F6C7A4D90178A20A 6-all-of
637,461,074 *41A071E6F4C97A86BE99FE11369B2AF88BC6E90B 6BSWBEABSW
637,461,075 *41A1AE819557E755A68308BC87EE183A45F00327 [email protected]
637,461,076 *41A3C2B2FD0FE988D5A46C6B280964B9607FA437 6GEELGORZ
637,461,077 *41A5E211DB7268FDDDC65354A29F644A56C1618A 6NEIKSAV
637,461,078 *41ABBA9C2CD918AD4EEC0097B0930C3E48660AFB 6UKAKIMAK
637,461,079 *41A63EC02F9B502B43385ECD36AAF695DAE39DB5 6VERDISES
637,461,080 *41AA98F90497281AAA3EC3B0E90CABEB8FD7757C 77736005-2389-3469-8C39-E283E699BA1A
637,461,081 *41AAB179A74BBAD8D52FB168172DFDB807D6300A 7AUSGANGSPIN
637,461,082 *41A1CD01F8E69CC6DF2A8F940C60567DF199ACC5 7BLOODFLECKED
637,461,083 *41AD1ED237BBB527F453176568EAA38D75B35B68 7BSWXENCODINGSCHEME
637,461,084 *41A171C96428FD4343511CC09B1508145909D859 7GANZENPENNEN
637,461,085 *41A649548639151085118AD9B5DED99F981B610B 7HAAMURAJAN
637,461,086 *41A9BB8281A4DB0E3D7B7E275ABCDA977188D085 7ILOVETRANSPORT1
637,461,087 *41A3F33A9BB390C3D68DB57E3C0BB2EC13890124 7MAGGIERODMAN
637,461,088 *41A8C128558F5F3F8386E633749FB154C0739E67 7NDRBRSH
637,461,089 *41A4A94EE1D9882F2F1829D6A360D9291175A4D3 7OZAMARTS
637,461,090 *41AD85AB64E1D03F5FE78D8D6DCBAA8C295CCF9C 7-S
637,461,091 *41A98D8C3FA1396CBB3BD9271D434D7E0F6F9890 7SOCCERBEAGLE
637,461,092 *41A531EC8CB60071C8B49DC8FCB89F4147CAAE2E 7SULAMITHN
637,461,093 *41A0396815E4DFB23BE15C806B372314CC07BE1D 8ALICEVINCENT
637,461,094 *41AAF127246538642E90B700BD271D8AD4883FA2 8APAULETTEBSW
637,461,095 *41AB8517C62EFF8775DC04DBCA308F002D5AA03E 8ATNIKTAM
637,461,096 *41A7EDBCBFF4CC23919F0808E9919CF51A45969D 8BSWDOLLARESBSW
637,461,097 *41A85F9BF26C99490B97D70CB3377C5DAC0C1EA4 8KANCIPER
637,461,098 *41ACB364677F0A28F8D73E7744379F16740D8658 8MORDIBSW
637,461,099 *41A96F39AD6D73BDA78188C9369E800940709532 8#####P~-~(0_<)
637,461,100 *41A642C57B7121677781883A7E859A6542A90DAC 8PACIFICRACOON
637,461,101 *41A4D5F4848525D0C6612FBA2A37D61FEC16AC66 8).`.Sploit
637,461,102 *41A0A1FBEE536946B3FB0C0A1D3AA78249AAA9FA 983ALONSO
637,461,103 *41A0FA419C3D64905AA18F8D867898BBA46D2C5E 9AFRICIM
637,461,104 *41A37AE3CE17558926A5532692CF0451A8667CFF 9ERHVERSRETLIG
637,461,105 *41AA6EE6C40895BBFD3E7DC67D8631569E3F3349 9HONEYKITTEN
637,461,106 *41AEA647B546030F176DC975B7C1644EE8E948D6 9LAJDACKOST
637,461,107 *41A48F6C798F8B177A08A325BE0ABA11C4FD7CCC 9OPISTHOS
637,461,108 *41AD2222D2DEA7CE8F15CE953E9EDD5CD58DF0D1 9SARTINS
637,461,109 *41A3C5736867C130A1486920C2150BE112B5DFD1 9spookology
637,461,110 *41AD100133A05C39895A1D9D11AB23CDE0D7B1EB 9WESERMUENDUNG
637,461,111 *41A8B39455908D895565794B86533582B99EF41B ..a13:1..890350........>rid<...............
637,461,112 *41A4523E3082E85CB80A406AB6C1E88507A27A56 A1A1MT00
637,461,113 *41A187A765F5B965091DC9A0EA0FA0F53ACAEF62 a8p2l
637,461,114 *41AEA2598F7DA0F179D8252EFF2C4CF21584CA06 A9EGZ
637,461,115 *41A0CF6BA644F904A7FA50444A3BB56FFB362637 A&AA)
637,461,116 *41A1DE4D349DBF47E7BE5582947C2AC33B4AEB42 aaa_i\
637,461,117 *41A498BC5C284EFF668CAD1868341402B5A5619C aalz
637,461,118 *41A0BCF246A71FFE9229C0BC7BD9094EA16332F4 abdulwado6
637,461,119 *41A10860226D644C1A8C4DE0A5CA6F03E9C03FDB ACID-RESISTING
637,461,120 *41A5D9F5EAAA10309D4A67BA9E4A60CD861459C3 ADLAVTU1
637,461,121 *41A065250D7E0FD904CDABC4E1F6B35C7814B1C3 adrianamylive
637,461,122 *41A176D9DAF972215DE001438FE676EDA6825DCD ah_=e
637,461,123 *41A360AAF79C049204FF8D1E2197828A46B38F6A ahoo%
637,461,124 *41AF12A2C1CE521D3CE61034F66B307E01A8D02D airtameg4
637,461,125 *41AB5E2ED83315BEA3266FDF96F868504A10A771 ALEXPETZ
637,461,126 *41A2B10E0BC443D3CAA91855F7E983339B4DCAE5 ALEX.SITLER
637,461,127 *41AC7835ECA35E55C6D90EB9CF56B8C89E08090B ALEXYII
637,461,128 *41AA2046C2347A3C4D5D1D05C8639BAB48E5C997 ALICIAPALOMERA
637,461,129 *41A4F5B1C5882271F8135F4C2CFDD8D415E1299E ALONSO.HITEMAN
637,461,130 *41A9CE55AEF88DDBE98365FEB4EAB713B551FA39 AL-ORTIZ
637,461,131 *41AB2234A106F0655CCCD66165213E42951EC55C [email protected]
637,461,132 *41AC0AD2BBF2887B41A6AD2C829BCC27A5EACC8F AM7F%
637,461,133 *41A20E4F58CC8C583AA85265B7292D2D8DB52B47 AMT-S
637,461,134 *41A25F03442D46033E8597B408EA1A15B4D5F074 andresgiron
637,461,135 *41A3D50A56F5D11F7590A9959A4776B69FCCD76E angelopietschman
637,461,136 *41AC29B035DAE80CAE74553B1BA335FDA815249F ANTOINE.FRANTZ
637,461,137 *41A2702179D85E0AF988EADE656E685CF0B82DBA ANTOINE.SLADICK
637,461,138 *41AB948F1914C1733CAC703883DAD04E2DB18A4C ANTONEBLAYLOCK
637,461,139 *41A10D0EF4A2786A7FF3E26C7D7176F3833D9D50 AOCKTAVIANO
637,461,140 *41A4E6C88FC96E0B04A7A4F7A4641EB9F33281A2 APPAUVRIRIONS
637,461,141 *41A0C942DF6766E93F87D7512A1A455B9E0CAD70 archieallara
637,461,142 *41A23A0EC20129DCE5B9390322C0C8F401A615F1 ARE5
637,461,143 *41A477E907604D6757AA9B9905F439FAA1C010E3 ar.wa
637,461,144 *41A34D0754E64D95BEE634324EB3D146C754A340 A_S(/
637,461,145 *41A2E401FA8773C9223299EF1825FB22BFF7EDBD ASMINIZ
637,461,146 *41A6BA2B4FA2892C659ECE0433387916741E4CAC asongforthegirlwholivesbetweenpalmtrees
637,461,147 *41A22B0007BB5FDC5987ED40AFB4F78323FC7AAD att=r
637,461,148 *41AC8CE480E61AB787CEC072D0A68AACC4674979 au+w
637,461,149 *41A4849180F494F8E5F53952970705C68D97174C AVDGF
637,461,150 *41AE606D299A52ACE7A70E1C54312B873B43EEEA B0-E
637,461,151 *41A95E23AE43B7DC39FD6D530A9704E9462B4CF7 b)5b"
637,461,152 *41A1A803356C35AFEB8D1E780DA5D7AC05B9D0E4 B5UG_
637,461,153 *41A4EC4D3A7A85621A6421788D68B6E279EC965A b8(sr
637,461,154 *41A174D48AAA1D0321A65B652C62266B1B41C5E9 backpadded
637,461,155 *41A51406785F12BEEB1B0D1B4A47D8B88C00EAC3 bahavalbur
637,461,156 *41A71000B1D9F9E2523125E5BEA223F6D6CAF459 balks
637,461,157 *41AC1A78978CA0EC02873E113BB9A3D9B93CC794 b(_c:
637,461,158 *41A930B1CFFE555C30C80D4FB33696E5751F3764 BCTRLGSCHES
637,461,159 *41AC2AC4178FF90559E2AB3C0E3899301DF9A085 be?%h
637,461,160 *41AF660614F8280A526F751B6A59B675B425CE18 [email protected]
637,461,161 *41A4CCE99C36E30B4DD433D0059EBF3334A7D1F8 BENJAMIN.GUPTON
637,461,162 *41A9B2100F4D53D893CDED2DF5846C05A0087E8A bentonvelardi
637,461,163 *41A042F3EE3DA25D1B6C554EBA09DD1243B919EA bertkozubal
637,461,164 *41AADFDBE5BBFD21E8601B5AA10CAE11622454C4 BF8LZ
637,461,165 *41A63D3287DA65FDBEAB2E908CF2BB735F20C4AA bikefin
637,461,166 *41A653B7CEC3A60E74EDF6C7B97251A09A6694EC BjDl
637,461,167 *41ACEE80C6404C395D7D0013D2ECA6A15A1A34E1 BMpj
637,461,168 *41A381275F78DEBC217CEB081F86240ED9F9839B b###@`~-`~(o_-)
637,461,169 *41ABDD6EDE7CF9EF726ED0146A8587EBD7B826EA B_O!1
637,461,170 *41AEE758242102F746994A290B6FAD0448ED6259 BOMF
637,461,171 *41A97322DF34DB0454C212695E4465BD88A29C76 BO)S/
637,461,172 *41A7EC05F07138C7DF6CF4325560B14D4F6E5E21 B./Q
637,461,173 *41AF039712124062EF73A04511AF5C624F791814 BRDA.
637,461,174 *41A17E6D6F6D9A3070551910E7EE5B404203A5EF brendonlosh
637,461,175 *41AADDBC019666EA49359A3DE26FB155BF120287 brentoncathcart
637,461,176 *41A304AC66A24F91DBFF1E39A4D334D465A73B77 [email protected]
637,461,177 *41A69A5CC10C0C9EB8A5248EF28448B89655E747 BRITTNEUDECK
637,461,178 *41A1C54B4384908645839D36C6C5BC74F93F250F BRTW%
637,461,179 *41A90314869C4D4FE605127B7F19E1721E333492 BU?(:
637,461,180 *41A62DFE0E5FD29F462E5D1A039BD8C0947B6750 BXAUC
637,461,181 *41ACB783F2A60F9A115B5D12C8CE841D11C6E7F5 [email protected]
637,461,182 *41A9975FE1674D9F71481587F0B4ECB387952CBC bz0x9
637,461,183 *41AD3DB66F8D5864BD116EA892917A5FE1E68F43 c_%
637,461,184 *41A3C9F96DABF4196DD6FE9624F6CFFC32D4DFCC C6O2)
637,461,185 *41A8B9C772FFA77B7A117AD10C640A3FC95F89D7 C8H2P
637,461,186 *41A2CD855A16B11469FBC50F3D18FB696BFA5F6D c9vnk
637,461,187 *41A8C352E38986DF77862784BD3FAA8176B00E42 CAAB0291
637,461,188 *41A438BD98288D937A49D9E969E5904441A1BAB8 CALEBLEUPOLD
637,461,189 *41AEE57E4044EFC29319759986E3493E6CF797C2 calvinweatherly
637,461,190 *41A5B3E2B43F8BCB3B6659AB0FD3C981B3D329B5 C?AM3
637,461,191 *41AF4467E26DA3D500F154AF345FB15BCA7242A8 CAROLINAASSOCIATED
637,461,192 *41A7E19DE2FC4576C31E0AFD16C455EC36BDA1B2 CAROL.NOONAN.MUSIC
637,461,193 *41AB179F8017174E0748B1FEBEE14C7346EBFE8B carrollanze
637,461,194 *41AFE5AEEF8035A7E19C65EF7CFEAD3EDB543178 CASSIUS821
637,461,195 *41A9029B337CB8F0247ECD7A6BFC6882DDFDD6D1 cathylalley
637,461,196 *41A9346D920AE780F584D2F2EBCF920045A96347 C,BW
637,461,197 *41A92D7391F6E454637D5E603C1987D6944ADE49 celebrem2
637,461,198 *41A3459E348947AC43DE9B927BBBCE32C5D08A09 chana407
637,461,199 *41A5E47951A37AAAE2EA96D0FC4C65AB956C10EC chant.look
637,461,200 *41A5C698CE1E2C3F70A3316B40FD4FF7CEE13405 CHARLESSHARK
637,461,201 *41AB8AFA92292DD9F551C2514D07F8592BD871D0 [email protected]
637,461,202 *41A9E1B1590045A2FB11E6B890DE640676B19A23 [email protected]
637,461,203 *41A5287F020064325B4163CC53139C4F4C3A4E10 cheryl.nickelson
637,461,204 *41AD7D5FB311770C102957809C339F7347F9E4C5 CHET.BELEZOS
637,461,205 *41A155EB2B54CED618F65EE4465850D148A790CA [email protected]
637,461,206 *41A1B8E068A8A34ED633D354AF0EBEF7F2E68448 chriscawood
637,461,207 *41AFEEFFF2B72CC06BF6D3BCFB7D73927B623D85 ci/cf
637,461,208 *41A45E2F712BB213E921B855B12B13878A950F49 c,js
637,461,209 *41AFCCAAE99FAE22FEB0A9A3FEC4A830CAB15EA5 claudiomoga
637,461,210 *41A8AA4D52DF1D90DD6F475376B5D8D2ACF9E481 CLEVELAND.MCNEES
637,461,211 *41ACD2EEFA46B8E244CA3E2DE09634BAA74AAA47 CLIFFECTON
637,461,212 *41A9C4896B86B042DB153FAB8B1A9793B9167F0B clones51211
637,461,213 *41A5A0B30FEA34CC303AC417D53644D5F4FED418 CMONIB
637,461,214 *41A2BF7FD1C5438040EF8891C41E4DCCA3DF5EA6 cnd?m
637,461,215 *41A575E5A9B69474288D91B70EC1C71677786A06 COACT1
637,461,216 *41AB3DC59B9C3BB59405458F49F02CBBBD013A9D coal-haulage
637,461,217 *41A13025DFF5A3D098D93BF0BA6ECCF89FADD2BA commodore64vspc
637,461,218 *41AFE624A2E46D1091C591CCB9DBC2D40BBD86BA CONNOR MAXWELL
637,461,219 *41AEC4EDED7A89E00052F50F32FBB99BC2D245B5 CONSERUANDA
637,461,220 *41AD4803B65A521699FA887CE8A020394EBDBBA2 COREY-ROJO
637,461,221 *41A208FB6BBEDA8A74B4E490C0FF292968D3C350 courtneytruck
637,461,222 *41A009233D3A7D9030F50142A3618280CEF8A7C3 CPTN;
637,461,223 *41AE735EE7D847934CC77B0890C356FA3462F6DF cs303
637,461,224 *41AB486C15002DA662D214C2E8E41257955DAFC4 c="u
637,461,225 *41A5E50E7D9F8B706C3991ABDCE7916CF8876595 cuggermugger
637,461,226 *41AD6CD30315FC766F061A7CD63E91E088A5CBFD cukhv
637,461,227 *41A0166DD7105C79601C4C145D1700753EAB2949 cupideds
637,461,228 *41AF5444FF044EF7261E0F1495787D46D26C8B73 CVQRR
637,461,229 *41ABC1229ACE8591329235136C882D7C9EDC0BF0 CY7FK
637,461,230 *41A992C3D44E3F9D7905148F1E4369DEFCCFBDD3 D3COT
637,461,231 *41A9B3EB5E24868B5C33E9F97C36B4CB9576C351 d4$v?
637,461,232 *41AE0655A2782DDF44A96535054A6527626EC63F d:5pt
637,461,233 *41AD11DF27BFBE6EF9D18035815BDEC1D3F9806F D6EC-
637,461,234 *41A491A4DC1130CE7A594E6DE0F7C95B1319DA82 DALLAS.TWELVES
637,461,235 *41ACE9FB60F3F7EE0B8CF7C1AD8F2F8C70FD404B DANARRINTANA
637,461,236 *41A106DA2D2ED302D57AC136BC3C0DBBD7AF9653 daniel89
637,461,237 *41A1367A0A1FE19856A2A6A32D146BF19433C284 DARRYLSAVO
637,461,238 *41AB42C09F1CEE47CC8FB6CB00D92E8E565BCE5F DAS-DREIZEHNTE-LAND-(ZOMBIE-ZOO-REMIX)
637,461,239 *41A2D0BD9D330D0232DB7B3E6F3BBFEEDEC87B39 DAU)0
637,461,240 *41A93C3AA9F9DDA8658AB9868D69F6B968FE86AB David-Nick
637,461,241 *41AC33C38626957A7B733D0BA3D03F889BB8BAAD D-;BA
637,461,242 *41A7990DA331C54B97554408E8420B7E651974DE DEANJULY
637,461,243 *41A29A84B1705C27159CAB105E95C2E271E9F1EB DECENTRALISEES6
637,461,244 *41A3820F7AAD111CB5225CB7D26B315186B889F4 degriser
637,461,245 *41A77E3585A0BC7421BD80BE492BBBE05C8BEEF9 DEMETRIUS.DOZIER
637,461,246 *41A50592EE1151102133A04D2BA26D098F180FE5 dem_z
637,461,247 *41A540D4E626330C6C544018BABF29AB81C7273B DENICEE8
637,461,248 *41A13D0B38AC9E49D6CFE8F3A279D2649244A0F3 DERRICK.PERFECT
637,461,249 *41AE502400136A40CA6D51FA424D22AD71867BB1 DesKelly
637,461,250 *41AD611638F8EB9A5709D6A680616BCEC20CB1A1 devonvas
637,461,251 *41AE00A17248BAFA3DDCBA4A44CB5D0937D86020 deweyaday
637,461,252 *41AE132F6E785865386564759D787DBDEF7CCC41 DEWEY.KURTTI
637,461,253 *41A9988179416A6383DB16CB70E5F27297B97291 d;ggf
637,461,254 *41A4F9083CAEA31C0FE042F10A0386421756DEF5 die.ultimative.hit-collection.(disc.2)
637,461,255 *41A4B0EF3355D717719DEAA37E5929C1C52952E5 dijzj
637,461,256 *41A90196B12C3F96DF968EF0D141840DC832F4E6 DIRK.AGREDA
637,461,257 *41AB958811062DB8E2668AC13F66829879A966DA DISTINGUIRET
637,461,258 *41AA62A1515D950F772CBB0E57B64DD753F901C7 dksri
637,461,259 *41A28976B629F1FB7F423D9262D7270B1D0593C0 DM,S
637,461,260 *41A118967296700CC6507317D9ACD19DEC9D95DF DONEMAR
637,461,261 *41AE564C05308C984102E5B38ABE68FA2C473C6B dorseyaki
637,461,262 *41A3CE34B1083C1A2DDB8758E7325002172F2EB9 dphev
637,461,263 *41A82D67A927D8EAD8C721A17A71E3EF93E74125 DUOFORVIOLIN&CELLO:II.LENTO
637,461,264 *41A499372D11EB662E753A6500A7A49CD12AFA79 DW5TE
637,461,265 *41AB0D20B2E1CD551B1E509C52FE77ABF9586262 DXEW
637,461,266 *41ACC3F5B1F90E4AC7583389F4B56DA6555CCAFF ebbandflow
637,461,267 *41A4BB5BB527F41A22A50E84D891E810CADD0A64 ec2&&
637,461,268 *41A627F701BE307D5B43CDF69B8B162720ED1A56 edgarmcenany
637,461,269 *41A2C7D46B55AF60103C6FC5F24E7D384D72A4BE egadu
637,461,270 *41AB4757236ED4B16B46FBD4ED20F6124C4F2917 ekk,t
637,461,271 *41AECE3BFFFE468594E2F7661E1B87CA9586024A ELÄINPÄISIÄ
637,461,272 *41AF9902249402E0B870191FF5C736CEAAD51D7F eldonquan
637,461,273 *41AE4BA0D01946FAFF2ED279EAC84A2B02905852 ELDONSHIRAKAWA
637,461,274 *41A6DFA30D299262D3FF3E5F2DD73D632E2464F4 EMILEMANG
637,461,275 *41A77FD16710035EE205DF27FF007262A3FDB719 EMMETT.COPPESS
637,461,276 *41AD735353425F80CB82B96AFEE4BFA8C0466968 emnni
637,461,277 *41A13D14090E37D396CF124F377FFBD203CBB460 ENDLVFE
637,461,278 *41A551D8CEAAE2A20CBCE7D41D99E7CF23A5CA77 ENRIQUE.SCHLENGER
637,461,279 *41AAA2D2974EB7AFF38E474609240823FFDD40C3 ensmusg00000051279
637,461,280 *41A98E33DF58FEC5E7886F6231576B2634BEB8C4 EP=FU
637,461,281 *41A5E7687753AEB99A6BB9964C4517DFD4546B4C episode-20:-guadec-day2
637,461,282 *41AC797D218D24A8A1E7B4CE52B65AFDC30D4AD9 EPUt
637,461,283 *41A600DADA228DCE49051517E2A11B98D1AE793E ERNEST.SCHUSTERMAN
637,461,284 *41A14C4FC13FA0C762CC8BC2828B68EA6D49A311 ERXI$
637,461,285 *41A2BB735D89C69CCC3D03057986CECE5D4F4121 et.mv
637,461,286 *41A8A5B99C61367CADB89937F19A199B1A4CF4DC ettsgoo4
637,461,287 *41ACF7756EA7C295ADC1A8CAE817624F78BEE734 EVENTI E MUTAMENTI
637,461,288 *41A4859598825F5D3A1FA73F1D55F9A0B6F411DD EVERETTE.TERZO
637,461,289 *41AEA5A7DF8F1972BA2EA87268BAC02705AB2C7F EXEMPLURO
637,461,290 *41AD927090E098AF0A2306280D68AA7B7FF32291 EXTEMPOR1Z1N9
637,461,291 *41AA36B9BB4DA16D1D530F5C34ED6E928B4348E6 ezirohpa2
637,461,292 *41AEFECB61065526BC1C4CBC2E3620E6C5C52CC2 f1a88er9a5+n9
637,461,293 *41AC79C0955EF49EC4F541BE202BBCCFB8064323 [email protected]
637,461,294 *41A8FE412796C03B1DB71FF10FD0E426DB9A763E f6rc
637,461,295 *41A4663586B5C57696EEB6D25A1951FFC85F431A FAFA26
637,461,296 *41A27B44B87B6B32E69582EC314359C282081617 FANGMIANLUN
637,461,297 *41AF73A9582B588F230D1BE56E85DCD6C614E26E FC0B5F64363FA73B8A5AEAB74A36776A CATO71
637,461,298 *41AF514F250556E0D3A0D915FD6C0A3EC1951593 FENCIKJOHA
637,461,299 *41A858989C51545D5F6E9DF41765A7842213D023 [email protected]
637,461,300 *41A9CDE22FC0D3A1C12043B90829F62141EF9228 ferminturnbull
637,461,301 *41AE57FA59863E44E3A19EF1942F51F8FAE00D8F FIDEL.MURRUFO
637,461,302 *41A785D339B7D38E91AF7D04E73EF5267FB74338 FIGUERES3
637,461,303 *41A90BF37DE087F77E2AD7E2E37F95B2C7ADBBB4 FLORENTINOSIEGER
637,461,304 *41AF1FDF080310739D0891416D78829D649016C6 FRAGA.LOCK12
637,461,305 *41AD96111CE77457511872F2CD86CE0F4DABB08B FRANCIS-ESMERO
637,461,306 *41A923063474218363B4088382BC206B44B74D8A FRANKIE.BRIDGEMAN
637,461,307 *41A53F6EA32C38736DE378FFCB6EB36384BCEF33 [email protected]
637,461,308 *41A8974487BE0433292E19E86F8BDDB73347D55F [email protected]
637,461,309 *41A975BA37F2B8DC46D61CC1109641A97C7FFDC3 gamesl
637,461,310 *41A5AB5CE62C6A1FEC785E59A6BCE34B05AA9C10 GEAAIDE
637,461,311 *41A60D914C73F0E3D27842C358F2A3161DE099B0 GEORGELOHNES
637,461,312 *41AFF229C249C03B2F1F27C0FB34EE71D6B16F07 GERALDBRODMERKEL
637,461,313 *41AA1DDDBA354E32DCD2EB245A0AFA1C43B730A9 GERALDOALDACO
637,461,314 *41A7BE5122D3EFF70CB2E76BE459E7F0D2E49F2E GERMAN.AMASON
637,461,315 *41A496ECE4EAD980073E5F3343503DCBB65955A7 ghmz
637,461,316 *41AA2E064B0E38698EA84E0035E9A103435F3E68 GINGER.HAIR
637,461,317 *41A0C0CB7381209FDB80797EE2E81F168755ED45 GIRDELLE3
637,461,318 *41A2450D8BF5BFCA9E31BD9F3DEDC2B434CEA5AF GJENNOPRETTET
637,461,319 *41A934923B5EC570D32C137A0F47D587C332E55D GLOTTALLING
637,461,320 *41A304C7092CD644874C081358AC39E3E847FB37 [email protected]
637,461,321 *41ABF7DEFEF420E61AEF0C7FFDAEE84EC31BC0DA GORDONONMOTHERHOOD34
637,461,322 *41ADAB553015531D374E2C9767A35D53C0FD687B GOURDOL2
637,461,323 *41A2BBDEDE978D6F2676D78ED21FDF2303E85463 GRAHAM.SHUPP
637,461,324 *41AC6F7520736EA957E1CE98756D5530787F9453 granvillemccreless
637,461,325 *41AA11249722210350B236EF03CABA25F05EB496 [email protected]
637,461,326 *41A100AC990492AE6C45E60C1CFEF7D098C1730F GUJBIL
637,461,327 *41A8012FCA340FB47820DABB5937CAB818B8066E GURANAYO
637,461,328 *41AFAB2CD635C76850556975A82DF0A32D58EA9C [email protected]
637,461,329 *41AEC54DFE4F8CF37F205C9CB58260E5E82991BA H$8=
637,461,330 *41A3E8A030B17D8B2C2929DD5A41022CDF1255F3 hala.hegazy
637,461,331 *41A1ABAC3A5DF467D5058B46C9B6DD8A50332A68 HAPPYWOLFGANG
637,461,332 *41A180B694FEB8BFDB5FA785A4BA314CD33A2498 HASSANMIAN
637,461,333 *41A4DD6AB64ED8FC2EC40E7F5BBBA7398208F6B0 HEARTBEAT - WE CAN MAKE IT :30 (D)
637,461,334 *41AC940BB0837F529488B3C76DE7E6AA65923D8C HELLYNS
637,461,335 *41A7F98BC5B9B96B839EB6FE844438CA11633F84 hershelfreyermuth
637,461,336 *41A1B54A1FBF37DDE5D6982FC8C6E16F944C3731 hey,-jumpen-(karaoke-versie)
637,461,337 *41A45C2E3AF2A7836608942975EAB5686245F5EF heynatzens
637,461,338 *41ABC66DA1FD8C9C701D5BD45833A6407F469017 HGREBDNI6
637,461,339 *41AF343D333A681DB4933317214085B54C7C7F5F HILTON.SCHOEPPNER
637,461,340 *41AB4019C499C89DD5BF4227D175F17D2CB49CA1 hipolitowubbena
637,461,341 *41A7E9825292FE778B0421C954C9B11D0D8C4084 HKLYKWQ9
637,461,342 *41AC59C46EEBCB5D54397C7A6019005C8C0DF31F HORACIOHOLLOWELL
637,461,343 *41AE8AA5254A73AC75C5731D27B8D7C4AE5AC823 hoseajolls
637,461,344 *41A7AC551A472A3FE002E87C2DDE67F7AF494783 HOTROD.
637,461,345 *41A9E73EB472F66C0848EE60557E2ED7F2B82A5B HOWARDBRANCHE
637,461,346 *41A8C4EEE2134C989ACFBD0C2CC84885B4DF667D hpargill3
637,461,347 *41A7C9EC5A7FBC59476D64C625A7B62B92010C65 HUNG.HURRELL
637,461,348 *41A8E3229AA237B5368261174CCE87A92AD1E8A1 i100321871
637,461,349 *41A1956380F5D3E0D6182F65897A87A90E9DAA6B IGNACIOMALLE
637,461,350 *41ADDACD6B61896D83682E5D4CE7286C471404AB ihsgorgwww
637,461,351 *41A94949574591763FF16AE49692492A37C3ACE8 illibate7
637,461,352 *41A262BD2FF9B4A0825E5FEB28D78107A71DE43E ILOVEGERMANY2009
637,461,353 *41A2179E33B5B16B0E787AF13227E58C0A1AA53A ilovepussy147
637,461,354 *41A78CC74FD0C573DF359F6A861741954FFEC99A [email protected]
637,461,355 *41A6EC4C729E2299A72AC8E399964FF21C09E785 INASSIOI9
637,461,356 *41A1CE4F4D8417DD0F75C2E6B379B77D9AF8CFFA inhalerted
637,461,357 *41A12DC7EAA97DC73EE6970CD2344BC8EF7B1757 [email protected]
637,461,358 *41A1FBA013FFB75AA41C0E588B8CBE32937991F3 [email protected]
637,461,359 *41AF367B88EEFAFE14D68E2AE8B8B7DBDC8E8F7F ISRAELCHAFINS
637,461,360 *41A396E3850F00F43EBE1DA64470059F37E477D8 ISREALTHACKERY
637,461,361 *41A72A9D6EEFCF8E96809A88AE8524683FEA7471 IT DON'T MEAN A THING (FEAT. YVETTE CASON)
637,461,362 *41A8EF0F5285C300F8CB0E383B3E118F5D180409 itl's
637,461,363 *41A3EE76F0834F63838DB1E0FC5B8E311D0243F8 JAKEWIKEL
637,461,364 *41A875AD4C9A1C5FD6DAEE60ECF1917F2011C8FF JAMBLICH
637,461,365 *41A95E40D9EDE1A0F8212DA58EDE2740B0B99871 jane.dianne.cabuhat
637,461,366 *41AD632056297C4FFED55C48DB6D11C4775909A4 [email protected]
637,461,367 *41A08B8E950B23539C27232294A233D3AE8B0B7A JAREDKLUESNER
637,461,368 *41A6B108A09906E7CFD34540EE8F4B668CEE10D8 jeanne.petit
637,461,369 *41A67ADA0E651D35062F538FD143BF2614443514 JEAN.VATH
637,461,370 *41AB40171F973310B78F765E67EDC638DF45060F jeffpoupard
637,461,371 *41A310EE0F9071FBD00722A73516F1567B0C8D0D JENNA KUNTZ
637,461,372 *41A74F54A86EEFD985BF874852FA0AFCF31AC233 JERAMYALDREGE
637,461,373 *41A5B614554EF281953AAFA718EE251EFB71D00C JEREMIAH.CHESTANG
637,461,374 *41A2566319981810A8BF59C2F2A746C59E2F9B02 JEROLD.SISOMPHOU
637,461,375 *41AC13AD09BBBD1883A44CEA5BF1F8C5CDE83E0D JESSIE.TRAVAGLIO
637,461,376 *41ADDA827BD703480ACF542F704BD60C3734C14C JESUS1RIVER
637,461,377 *41ACADF29B354D88D88B49AE9221F3D3FB73E117 jjs
637,461,378 *41AECA10082AD92D8072604990DCAB04654548B2 joebijan
637,461,379 *41A7C3B8D7B19B081ABE681889668018BFE82A8F john-karen
637,461,380 *41A1844C7BB0AA3CE46165E9283F33852B573EE7 JOHN.KINNEMAN
637,461,381 *41AC4F397567010A3D095631540ECCB079090595 JOHNNY.BARTMES
637,461,382 *41A196DA66920160B215BF98DD64E0C408A49330 JOINTLYCREDITED
637,461,383 *41AB69662138A4027DAC8B257859B9241EF5020A JOKERMARCHANTSTADIUM2009
637,461,384 *41A95AD044F1581F898DBEC7FBD5443643D0D6B6 josepherrico
637,461,385 *41A07DE6EC40A90B4B49E3865C55B37AD06EE600 JOVANNI906
637,461,386 *41AA99C3A84913AF2E97803D0D046D13EB85BC76 JUANITA RIVERA GONZALEZ
637,461,387 *41A2693F6BD21EE6A022B5D79B316A3B2BBEF9B5 julia.byrnes
637,461,388 *41AAA08DCCE68F84F5B8D6A93251CF76DF303BD4 JULIAN-SPROUL
637,461,389 *41A216635605A6A67051C490837030110AACDC79 JYUNKATS2
637,461,390 *41A1D135BDC9F4C44ACC4FCDD8A369B92E73435A K3NOBIST34U4
637,461,391 *41A5FCB58D0BDE04F36902D2DE3D65D8E25744B1 K4NON4D3S
637,461,392 *41AA0F159EE606F2C280A2820CFE002EF03B99FF kai-phillips
637,461,393 *41A67F8BC56E41C8CFD232D19B536B838B23254A KAREN BURDEOS
637,461,394 *41A9AB821F506DF5E4A3B4E52CAE144EC816FE1E KATHYJADERHOLM
637,461,395 *41A019FA540FE36D7F6AD6B738361D26A65D27DC KEISHA.LAWLER
637,461,396 *41AFBB77ECD5993BBDC252DAF5F28B5319B76D74 KELLERTV8
637,461,397 *41AC778B9933E56321DB4810FB8FA027D1738E2D kerryfrawley
637,461,398 *41A319204BED9808CDF2768E55F31238B5E1CDC9 kingretard
637,461,399 *41AA932B39E27332D98AFF7DC5C2811EB23E48B7 [email protected]
637,461,400 *41A90A6D34652AB43D42204940C9EA0DEE975E94 [email protected]
637,461,401 *41A26CD590F24D04311FEB92E172910A0A508E58 KNV"
637,461,402 *41A87BD3743A47C39B83C6E76EEF0FFC7FF9AC41 KORBASMOHAMED
637,461,403 *41AF043817AAA66798DE06D9AF07A35E3E1321C6 KORTBENIG
637,461,404 *41AF8B2ACBEBC6E0FE0E9CA4C06722D3D006CB69 KRISTOFERSIEFERT
637,461,405 *41AD0E0FAE60D057C7A3E4627545794EC83A6948 [email protected]
637,461,406 *41AAB7652068AD6EB5CDD9A9492CC984CCFFF8E8 KÜCHENMEISTERTITEL
637,461,407 *41A717F8845700D41AACF5BD0670377AFCE6AB47 KULISI
637,461,408 *41A09B314C8911CA7EFC803127D1E4A8EF8D3276 KYLIE.CAESAR
637,461,409 *41A8D01D1BD27C99972A364AC3641BEC20E156DC [email protected]
637,461,410 *41A304438C883C915724BBD8BEAD83E3F7A6F494 [email protected]
637,461,411 *41A6C71320502F40F473390ACBDE30A9206764A8 lå1125
637,461,412 *41AFB5468FD055492711A68B1C2B9264AD6695FB LÅJÄRV
637,461,413 *41AB766CCDFFA9B9FF676CDC7CBFCF63913634B5 LAKE-STURGEON
637,461,414 *41A4774DEC005173E4ECB21A5542EB276A0DC9C0 LANCIAST4
637,461,415 *41A49B4104A8B66664F918FAB8DD4EDB9E20806B laurawgenesyn'-'gene
637,461,416 *41A17D6DD9BF2ED8DBD745833AB42C9E046F9757 LAURENPAULK
637,461,417 *41A4D1EE7FA22E84236743A60D1632F48F5AB5F5 LEE-BUTEAU
637,461,418 *41A369F250086E1BDB924A30CC108485531C09F0 LENGUASRAM
637,461,419 *41A685014238D7A00379EF804F3BF1F6F540389A lennylimberg
637,461,420 *41A526098655FB021535A5200048C046BEE0813C LEONARDOCLOOS
637,461,421 *41A9F3BB21A946701497B9792BFFE929EEE45D95 LEONLUTE
637,461,422 *41A04A19C370C6C6B9F25CC5AC6E870617BF6675 leo-penaloza
637,461,423 *41AA4652433351254763A5B113DB11B90F0921D3 LESCATERINO
637,461,424 *41A23BCA46F00B7A84E737262AFBD1D188B3A5D3 LES.EVE
637,461,425 *41AAF30593D8A5DA8C376BB0B1706EF41694A82F LEVI.BURSON
637,461,426 *41A7AEE285F3FDF848C04D22FC34111686DA9462 lewisstamas
637,461,427 *41A1ACE93D0FA44A9537811A8DD0A6045E2C067D lgam3n70u$
637,461,428 *41A50E9B827FD997C65BF66AEDAE83FDA1769C91 [email protected]
637,461,429 *41AFC41B990D6D0BF53125DEE00EDFF4B088CF47 linda-blumer
637,461,430 *41A405EEDA87B7A5D98277F50B89982A72FA5370 loginsh
637,461,431 *41A73DD07B2172837FB83066D03B01574C4374AC LONNIE.TOUGAS
637,461,432 *41A175B63603387A6116144819D1AD058FBCDEBE L’ONOMASTICO
637,461,433 *41A0DFB5C59474882E98B6FF5558D6F4F4E042AB LOREN.KROLIKOWSKI
637,461,434 *41ABE29FC2792581CE70BF3E4ED0150712B0D1BF LOURAVI0
637,461,435 *41AE1CBDBCE3D8C5D597E49096BC882963B8A30E lowellchamblee
637,461,436 *41A3BAE23917D0391CB2D13091EAB65309FBE2B0 lowellgiang
637,461,437 *41AB6310B892234061124EE181581C241F4C197D [email protected]
637,461,438 *41AC9A8F027377170F8AAE41F526944625CCF4F8 luciennaser
637,461,439 *41AD24BDA604434479AFFE112B85FDEFEB0C44B5 LUGESTORE
637,461,440 *41A8369E4532807133D64238E50A6B5971390FAF LUIS.HOLTE
637,461,441 *41A89B948E060459D833FE57D2270D636A3A7FEC LUNGUNG4
637,461,442 *41A5D9134087AEC3875DFF99CCB1C4BBC59C634D [email protected]
637,461,443 *41A06B1E0BBFDCC13C8A1683F1E33B3A15158F1C LUTHER.SUSONG
637,461,444 *41A9D77838E64B828D04B4B1C920D29F30420580 [email protected]$
637,461,445 *41AD4BAD133BB0F3D34D7F7B5B2255CDA3F9E611 MADRIGAL:ILBIANCOEDOLCECIGNO1
637,461,446 *41A3BF1DA5E28C7DF6E17332891AA29239399DDC MAINIPONTAIN
637,461,447 *41ACD5351CC11FA1F8932C9F09843ECD44871237 MAJOR.FORNKOHL
637,461,448 *41ACF18512220573B1A826DF69B2452E01CBA996 Majunga.m/@/'/dZ//@//N/g/@/
637,461,449 *41AB2110B9F9D4B6D2AA266A6830C6FACA76909E MAKENZIE449
637,461,450 *41A358A7A848D35E42AF7AF93C7830C31CEC4176 MAKEYAW
637,461,451 *41A9F70BF157CBC01D9A1447F5C46E1C76778F29 MARCOS.CRISTOFORI
637,461,452 *41AC12888A160004FB187B7F244EF7DB88EAB9D6 marcuscoby
637,461,453 *41A14BFBB641035F41DAAE617208065D2A955D59 MAREO.LOVE
637,461,454 *41AA1C4FF88078F7331D758EAFDABADD3F54D73C MARIA.LOURDES.SILVA
637,461,455 *41AD1FB3C971057F3F3A38E340EFB2AE9A8BD29A marionniedermeyer
637,461,456 *41AC100183C4639C8D4537D85893B37734470C2A MARLET
637,461,457 *41AE5737F6C32ECBA82979C42C5298C25647DEE0 mcmichae3
637,461,458 *41A2FFE5DB9D55F9A3114684679CAFB43D5A7BDD MESPRIZE5
637,461,459 *41A1E5226EF548596E5E1CCF8F899E5BC891658F messng
637,461,460 *41AB90B07F25C17AEC374AF5ECB8899814C8C545 [email protected]
637,461,461 *41A4CA3FCCCA2AB4834CCC5D4030257AD4EF659D MICHALE.BANALES
637,461,462 *41A8F17BA3BF5C64018E0AF22E440D0103B9C52C MICHAL.JACKS
637,461,463 *41A345CD0566CF74214CD8070AB3555E15A958DD MICKEYMOUSEMUTHAF*...#S!!
637,461,464 *41ADFBB66E173903667D04F7D198CFE12767478E MIKAELROOSTER
637,461,465 *41AA9EEBDB94BC066551C6BFF7827A50F9C48BBF MINELADYING
637,461,466 *41A2F984FEFDB81E2A50F62CDD5FF5974E857C9C MISHKAANNE
637,461,467 *41A839AEB84CD8699AF18E2935F1D7A0EC383E01 misunderstoodxover
637,461,468 *41ABDC457998ABC3664AF7E620C68830EE4AC042 MNN9IBXPSM8C
637,461,469 *41A9AC7977DF31C5AEC2B13362A1A1B44D9D0B61 moderalatlan 1
637,461,470 *41A18377C31E716EB61CBD6F11A939533D69EBF2 MOISES.ISEMAN
637,461,471 *41A1B2F9AB78739DDDD51D458750991741E18333 Mom's.Speech.Impediment
637,461,472 *41AB3203A164F55361042288E09D6FD4123B0C01 monecious m/@/'n/i//s//@/s
637,461,473 *41AE98CF089E32CFD75DE7B89A45EBC1B450AF03 MONIATOS5
637,461,474 *41ACFA11D05B3D4A059C745B47AA4D552B011112 [email protected][email protected]
637,461,475 *41A166649168EA9876FA501858D83FA2140F35CF MORBILLO71
637,461,476 *41AB2893F422C0865B0598DEF2178FE236FFAA10 MOXUANHONG
637,461,477 *41AB6F76BEA5230C12805ADB2476F0E4BA96C315 MUHAMMAD HARIS AHSAN
637,461,478 *41A74BFD5BF6E4F70386CFFAE059E93D1F8EDD45 MURRAYBLANQUET
637,461,479 *41AFAF6CC1B0A27D073ECF262162786513D49D1A MURRAYMERMIS
637,461,480 *41AC34B17D0819D92B559B0F22B2446FC96C678E MYCETOMI7
637,461,481 *41A7F24C4FCFC00DB59153959C7C7C3C4BA6D562 mylesmelis
637,461,482 *41A7723317AFB676EFA9157E34EACCED2CDE5BA1 MYSIMBA12345
637,461,483 *41A81F5A3FF4F8DE967D1518D713230B42D9C17C [email protected]
637,461,484 *41A2A218EA121EBBAF421918F8FB63044268831E N022NAA
637,461,485 *41A68C9FD8B5F5CF66BB3836A3DE3C9A3C8EBE2C NA$C0NDILA
637,461,486 *41AC56E61FEA8D8AB91953DFFB69D8405266794B nalfredosanchez
637,461,487 *41A5561B3DA470078D7C675D68F5CFD117BE3EAE [email protected]
637,461,488 *41A5A7D0323C30AD042C69C2491CF9BD02FFED80 NCC1701DMILLER
637,461,489 *41A5A80EBE22097F74672115B98D65D8381BF9B5 NFRAZIONE
637,461,490 *41A47546A408A417DBE7DF2DEC5B056431AA23D4 NGRISSOM
637,461,491 *41A60077076B44B8CDA553F5F59542C332AB6FCE NIERADKO6
637,461,492 *41A22884B408CF12455720CF397431B2883142B4 [email protected]
637,461,493 *41AAAB5065A5FCD1D61829151CB1B60E7F51BA9D nlekcaf5
637,461,494 *41A267BF765B6779AF07EB6DD819CA7C29E8D52E NODDING0
637,461,495 *41AF92EB62638104F7A4937B123FAABDF11A2244 normanmeeker
637,461,496 *41A0F73387A4997265567181E1DF830069F389E1 NORRIS.TROMPETER
637,461,497 *41AAF331BB9019AB475E008D31BFAA0BDB1994C6 NOTHINGTOBEPROUDOF
637,461,498 *41A102E14EFFF05F835A2C3396F57D08507EF340 NOTSICHERUNGSARBEITEN
637,461,499 *41A9D85C99B769FE4588B397AC4F70F0B201B675 NREBIELING
637,461,500 *41A468D46942D3ED18E498A2C64220DDED2A64B2 NRICHARDSONGROUNDSQUIRREL
637,461,501 *41ADF759CC03FDFAC8658838177C7067366AE781 NTHNYR
637,461,502 *41A42B937E3031BBFCA8A5F0CC605CDA32FD0B26 nwv
637,461,503 *41AA280A1328A338EE2A6077FC3F76EFAEA36120 [email protected]
637,461,504 *41A16D572E0A060BF5AD00F8CA941FA17F13EF5F OFBYJVS2
637,461,505 *41AB24F28E4B10FFB3CC745CA5568B44AD35F441 OLENHYPES
637,461,506 *41AEBC69F98D966881ABD5A8EA8390EE097E59AB OMISSIVELY
637,461,507 *41A5F78C9E7F2083BB53DC491B123EC0A09631CA )O(-~`-(==p
637,461,508 *41ACBF24B430DD96C8C46AB45E1B24182A21CAA1 O><Q=8
637,461,509 *41AF9D24AFBD88D4D51F114C4614886E749A15F6 ORDERING
637,461,510 *41AC4A9132CA7B6305AF4B3E583F9527AE80AEDF ÖSSZETAPADHATNAK
637,461,511 *41ADD7B7ED3F60ECCB45DB92BEA47487210A8D15 OSVALDO.WITVOET
637,461,512 *41A398261A7B9F91F8BAFAD37FB1295F8918AE6A OUTOFHIDING
637,461,513 *41A93D3ACE0855B127C1B0BBD29AA8DD527175FC overlook
637,461,514 *41AE5EED361843A82E7BD3608D2E620C49229D18 PAC-C
637,461,515 *41AC8B6B0C03BF623E4BF7CFAF561B27888F5982 PANKAJCHITTORA
637,461,516 *41AD126F2E792DFB57BD8EE4A1C045BAEDEEAA3C PARKERJUDD
637,461,517 *41A0BA34C807FD98F7F5DF7B59CF83664529DC9B PATIATE2
637,461,518 *41AA8B6B38D590A60FB33EBEB3E23282D5B54BAC patriciageeting
637,461,519 *41AB11FEADCAB4029203FBCAF609B5EE3E02CE5E PAULLAGUER
637,461,520 *41AED2DFBBB1EDAB174018ECA4CE38B44AA85F12 pedpisu3
637,461,521 *41A253595E2358CF041698607DEADD9BF31A1D70 PHAEOPHILALES
637,461,522 *41A968B687E2842A7703CCFE48A68301941795DA Pizzikato-Polka-for-Orchestra,-Op-234
637,461,523 *41AE1306EF59A4E091A356097B596A754F1EE1F6 [email protected]
637,461,524 *41AC6A61278AD13F77B3DD1CD8AA1354534BB543 PL4T1N9$
637,461,525 *41AC6E363871BA238528FBFFAE0C2CACAC443DC9 PLMANRE
637,461,526 *41AC211254F2D45A5099D93B159715506FA732A6 PLURALISFORMERNE
637,461,527 *41AE729036BD6B81A4D62BCBC823E42B5B285FDF PNYVLTOVA
637,461,528 *41A3D44DCE1F554849597736F639EAF2C3E85A8B POLLENDARBIETUNG
637,461,529 *41AB00D9F1AF8959F3FC0D4CA8E51C88EADB1A3A P###P~OSPLAT
637,461,530 *41A161C887C26E5B58CC1C1FBD4BE058C06B1410 [email protected]~0.~o(x)
637,461,531 *41A568D4B58FA9FD0EDB9E739B2F895DE098BBE6 [email protected]
637,461,532 *41ACF34EB99DF6114D18E159996B43DEDE3CE6DD [email protected]
637,461,533 *41A1B3483F2A2A227489EF10144C7BB57B9A69D0 [email protected]
637,461,534 *41A18B716AD886B142BAD8A4812260285C6DC40D QMAOIR
637,461,535 *41A48B8A8A31E6EAE2C7ABF4BD4A669BD7EC6BEB q-p-~-`splat!!
637,461,536 *41ACFF87D4412A412CB46CF40219F9A4AEAA7870 quasi-retirement
637,461,537 *41AB453CFA00E749BE9AE448E1DF6ECA85B546EA randalldolejsi
637,461,538 *41A19C78A56249EDCA579954B3EB2FFE27E1EF49 randytobine
637,461,539 *41A239C0A0ED94FEB88BDD2A6B6DED223D20C5F5 raycalabrese
637,461,540 *41A4A3F88E6425752D7E79D574800587658AC428 raycolunga
637,461,541 *41ACFAA0E4416F4D7B0D830092D31A33C0058B0E READYMADEBREAKUP
637,461,542 *41A217D653D0EE785592AA022EB20CD90A39A5EA REALLYNEEDYOURHELPPED
637,461,543 *41AB0BFB9A7DF1555940A80C8ABCC2542F23E0C3 REBECCAJUNEBUGS
637,461,544 *41A41D8E330DBB07A506C95CA595BE1369B8C7CA rebelsmurphy
637,461,545 *41A12B64E28921787660D7F8180265F680E5E33E reginaldgiombetti
637,461,546 *41AAD746AD3D5CD7E6F45F0A03F3FD8BDF2DA345 [email protected]
637,461,547 *41A32A87B4C5C5783DA00ECF1E0AEC38F2F399AC REPEATSES1
637,461,548 *41ABA4D813A5A0AF50784126A2C4C29A0679BAF4 RES1DENCE
637,461,549 *41AE225C7F22443494865FCCB704B032AC00AA9D REZTEFELS
637,461,550 *41A6C6EF59272F5799E3355A514ADDB1BEDB8F43 RHAMNES
637,461,551 *41A242D8A3B608A27F1C2E53734B3A9C7F425A49 RICHBRIGHTWELL
637,461,552 *41A6D827AC800898E03C37C89CFE90815892DD2E RIDDERLITTERATUREN
637,461,553 *41A88AAB0B578C149F3A5366FDE183EDBDC34CE1 RIGHT NOW (EXTENDED MIX)
637,461,554 *41A7E9DC4FE2A2021012BE8A2C616A84295C5873 robbykomorowski
637,461,555 *41AC68DE77B6A457EC2EAB5AD34FD0D29900F7CA [email protected]
637,461,556 *41AD7FF198EDE44D2D5D19AFC40924CECD97253B ROBDAVISSON
637,461,557 *41AD7913D4B30804F585DCF5D5E11D4DEF55B1A8 ROBERTCOSTELLA
637,461,558 *41A33705D7232B5CD28A75E6CCCC9497F1729ACE robfaaita
637,461,559 *41A9802C6E7612E214478AD05F8E05CD48FAF9FC ROCK.YOUR.BODY.ROCK
637,461,560 *41A342D68F18F467E99C1D3AD69D7586AE0E88C5 RODOLFOLEVEN
637,461,561 *41A7D60353C2BB33AC425252E3FF733346B500FE roger.chou
637,461,562 *41AAF311BC9B8D651A5ED78DA6B8DABD2566D91A ROLLANDBEEKER
637,461,563 *41A544F3BDA5FB68CBA7B8AAA640E4954AC396C0 ROMILLA4
637,461,564 *41AC132C5202B28EDD9667A3F75662CD3F4B04AB ROMOLA
637,461,565 *41A1988BE9726903907112DC95EF7E9FAF55134C rubenrutheford
637,461,566 *41AA7A94A35F6BE171B4D31E999C33400A65E53F RULE86
637,461,567 *41A24D80169CF3FD87523680D486BF956351F151 [email protected]
637,461,568 *41A0F2225CBC92752A6A3F6726AEA75DE4A2AD20 SAAMGELEWE7
637,461,569 *41AAA3C40EAC289FFA4124CBD40B797C52A4D2AB sackful
637,461,570 *41A4D40019A67FBF08EFBB4D809913A1E0EB5A3C SAMANTHA MACPHERSON
637,461,571 *41A32A7219F8D17106E71C280513D6944A40A6DE sandhudeepak99
637,461,572 *41A0153BC868DE7D352A97694185E87BD6E4F1CD santoburvine
637,461,573 *41A43D45C8C9D110D505EDBF7B8F084126A9FEFE SANTO.SCHNURE
637,461,574 *41A7C245829195A0D51A19B86B464C8A186323B9 sartajaziz
637,461,575 *41A29715B196F87B577394016B7F21D41DE89616 SCMAP-DOTON-WATTSMILLS
637,461,576 *41AF6D76652E9A729287CE0886B8829137F8C707 SCREAMSNOISES
637,461,577 *41AE8A427EA6F4A980DB24E3E31076FA629A281D SCROWESED
637,461,578 *41A018A5AC14CEA097E1C7B0AD3B6410C87F6A03 secoueras6
637,461,579 *41ACEAECEB9078B184EC509B31EBA93E6EE7BA6A sejm
637,461,580 *41A2CB40E268DE71D23A3511BC8BECFE04C2BE43 selva-garrotxa
637,461,581 *41AB0EEB09EF57FF3760BFFFCA7A1CDBF9D656F4 sessionsres
637,461,582 *41A67FE791FA5E7BB72F3FAE91AF61097EB41DBE SEVENTEEN-PARAGRAPH
637,461,583 *41A07D91C0FDA2E5F7BEE8DF86FB1D3715B6F361 SEXIESTS
637,461,584 *41AF59EACF2D24F4999E77CE5A8665DC73CA8ECD shadylive
637,461,585 *41AA1A018ED0EEF3AFDEF8A08B1C9619AC66CFBF SHANNONKOTCH
637,461,586 *41AA06B23AF4D0D13B0825BA61C94133D4987B48 SHAWNA-MORTON
637,461,587 *41A5DC4AD6492F8F636EA9A10483DB659DB2B7BB SHAWNGARLOVSKY
637,461,588 *41A17F035B2D68A4A54EE91A808DF0F9EAAE226C sheilamunroe
637,461,589 *41A9AF48B8FF4D4E03CA747AD3A42A4BB8AAAFC5 SHON.NAMANNY
637,461,590 *41A405FCAD561B53C3D8C5FE74F17E16E5A14CC5 sjb121
637,461,591 *41AA207D40E5DADCDC9DEED3E4E4163C0C0FB3D4 smonterais
637,461,592 *41AD205DE612DDF02012A8E190F0D9C7BFEA88B7 softwareaufwand6
637,461,593 *41A23A975A194C7DDD6376FBB795274933CAD897 SPEKULATIONSF?
637,461,594 *41ACBDEF7B0B95AFB4D5A5AB7C77A025851CB74B SPLAT0~<-3
637,461,595 *41AE761DD2CDDEFD9338DFB8B255AB397D6D879E SPLAT*.*[email protected]====Q
637,461,596 *41AAA73032BA7236F7B6A03EA8C2FF2F66FA0537 spompates
637,461,597 *41AAAE448512F42E6366EFD21D00B6B7E5B763FB STAGNITTA.
637,461,598 *41AAAC672EE21701A70EDC43045D001965B7F66B statebank
637,461,599 *41A90E7422A72B313BD4282A1409154B14B99510 STEENBIKKERS!
637,461,600 *41A0130F1424D0BFE8B3832C1FEB20DE74233E4B steveheung
637,461,601 *41AAC7347353F5D4F7F0F193943DD576774D96CB STILEBOGEN4
637,461,602 *41A566346B8C0F09485AECED75C991A24E32B3AC STIRZAKE7
637,461,603 *41A4B12C3AA099E1D2C3FA406E1B821A823C12BB ST.MATTHEWPASSION:NO.78CHORALE"WIRSETZENUNSMITTR
637,461,604 *41A12AD6F487056975284F6287E8C32E36616488 STONESMICHES3
637,461,605 *41AB749AED471AD040B8B19A31FD0230FE5C6BD8 STRANGUL2
637,461,606 *41A7DC5C738766516B79ED97542DED7E0320AFCF streetcurb
637,461,607 *41A3A54AECE83DED1DB79FFEB3AEEA0AD7D5294E STRUTH10US
637,461,608 *41A200A5F3404CAE1B375B39725DDD46F61F2BC3 STUBBORN.28
637,461,609 *41A7AD4FD2FBCEC3A2AEC7E881970C1C9D9249A0 sturley3
637,461,610 *41A3D324D6070DEA6FA8A9280E25E562E25C453E [email protected]
637,461,611 *41A3A9885C66E2C70AF698228971030D64C06F61 SUNG.GLUECK
637,461,612 *41A987D1B3D1A4AD4D9760C5D4402465BE826970 Sunny.David
637,461,613 *41AC5DF1E02D37C8D16F64027C2C78DCE48ED20A SUPERPONG9
637,461,614 *41AD931FBEE45D86A286AE9A653E41435D40CD13 SUSPENSIONS
637,461,615 *41A69E78C12D7340E9871407032390EABD9DF9F3 [email protected]
637,461,616 *41AE1724E396E6963FB37784168A5054A10895C0 SWIMMEET
637,461,617 *41A9F7730A2A460C2F4A2AEFD53CE1F36A6C2536 SYLVESTERMCGRAPTH
637,461,618 *41A3A073330686D0654B63737B73B45F81B0C490 sylvestersternberg
637,461,619 *41ABF177FD0C5AC05672F37ED340FF94CED07D37 SYNTAXEINF
637,461,620 *41A042AB1A497887831A3482898815F1C9B7F233 SZAVAZATINDOKLÁS
637,461,621 *41AACA7CF37C746E9EE9FA31523B37353F1025E1 )t
637,461,622 *41A6AF3FBD19902DF0A504C221BF7DA298D94AA0 TALKFARID2727
637,461,623 *41ACD4179A106793926DECED4E765486B15FAF4B TALKSPIDERDUST
637,461,624 *41A95E137FA667E562A50DCA55A43A8D1E015C67 TANIMLAMASININ
637,461,625 *41A19741B721FBCD5C96943DC3CB706C8AFB9985 tanmoy.halder
637,461,626 *41A9E5C896B683240BFB92A5EAE11B075FF99DDA taquana2
637,461,627 *41AEEAF1295C003246925C84305489BBF7E41AE9 TDRONKEN6
637,461,628 *41AC732BCEF97B1F7CC460C2EC9E22A217673A08 TEPELNES
637,461,629 *41A351C513E19397A0894B732F631DF010AB46BC terilbah
637,461,630 *41A6BF889A5CA2513DABBBB0401C1B3249D19615 TESTERKINGFISHES
637,461,631 *41A6A9C5E2CCACCC7FF2EFE9B7F0B95C6E6BF905 tethysnecklength
637,461,632 *41A69746594EEF2A226D3FF8116BA2FF70D6BE73 thadhaggan
637,461,633 *41A068022605C677CC0EFD078DC59849701B9E54 THAILANDLAWYER.COMWWW
637,461,634 *41A373207D0E7021E87F2B0A10E8E25CEFF3DEE3 THATMADDIE24
637,461,635 *41A668EF77159E188A85DEB0D14B513B5AC49DB5 THE.FIRST.FOUR.(DISC.2)
637,461,636 *41A06F541E580E2CE6AFBE6DA476BEB140B8A6BC the-pubs
637,461,637 *41A5396BE453B1787385ED2AEBE0D381E8582DE6 theruns
637,461,638 *41A9D8E100DE888DB277DEDB5DD152F9E170E2E5 this-thing-called-progress
637,461,639 *41A8FDD3E0C71219CD5BBB0A00BAA8680DCB961F THREENOCTURNES,OP.9:NO.1INB-FLATMINOR
637,461,640 *41AA88FFE7CE02F22D6BEA442D4BDA845071EAB8 tinsletowntoboggiedown
637,461,641 *41ADDFF2172C6595AC1EDCA5C2B91AAF88AD7689 TL8U
637,461,642 *41AC57F97D8D5B435110E0503C8B1995EC0B1C34 TLEDROFL6
637,461,643 *41AB138C16A477ECCD7AF6DD5A8EB07944627738 tlphons8
637,461,644 *41A1190745B5D3F27175A3E5B4BEAC210E362A23 torquespeed
637,461,645 *41A0D93AFC820AF435A086C56F65E576AB1F099B tourenfahrers
637,461,646 *41A91096B2E7D87E798879E927F9B985DC85CEEF toyokorocho
637,461,647 *41A115B584CA375F487B6FB415B4146A00637181 TOYS.FOR.ELLIOT
637,461,648 *41AF509A98205F1C9D5C89E09383A2C6DDB6D1C3 TRACINSKIBSW1
637,461,649 *41A55E014799C9AC6C676B5D923A081F5E4C5BCA TRADITIONSPROZESS
637,461,650 *41AA65424E3D41618C40281FCFCAFD49D0085013 trawets3
637,461,651 *41AC2A10EE00D2011EDA102DFCCDD6477C639F81 truckmen4
637,461,652 *41AEB8CFDF008E42EB04D44B40FB0006BF94A213 ttp2
637,461,653 *41A61FCD3D992FDC5D0FAF009B3DEC854E51EE7E TYESHA.STUER
637,461,654 *41A4C5CBF54E931FD04880C39DAC34A55DD3C560 TYREESIMMONS
637,461,655 *41A2A8AD3023C5F34A9D3D2032CF73757E242928 TYREE.VIVIER
637,461,656 *41A126D4924003A70CAFA675BCC3247C093A8B02 UEBERLIEFER
637,461,657 *41A6E9A6AE1DF318CAC59D9101390FD419858DF5 un53771ing
637,461,658 *41A998F794AF8055AC362F83D9BF8E41CA24F875 UNIFICATO7
637,461,659 *41AD8A14F1CCE56053E3CBBFA191BB03CE03C6B6 unlocoviajeeneltiempo
637,461,660 *41A0BD1DBF02DF285F1815FABEDE78D1B13A7211 VAHVAMA
637,461,661 *41AFD506AEC311824D663A26BB91996D46CF3E6A VAL.WASSENAAR
637,461,662 *41A68FEE2BFF008B5B2EE8B2A358144672B17F08 VANILLAWAYNE4
637,461,663 *41A4F3ABA205377CBE77325E4560A2EB918D3A5C VANILLESCHOTE7
637,461,664 *41ABEA1093BEF0ED258519AA980FD43AF0280BCD vapulaci
637,461,665 *41A0D58524ACEAF92170FAE948644725CC5A103F vazh.villanueva
637,461,666 *41ABA9C186DBE23F7F984C404917FE41CED7F729 ve0993t7309d1zu89lua15f
637,461,667 *41A913AF05D6875B195A0662E52560021B93AECF VEERDHAVAL CHORAGE
637,461,668 *41A0F6EBF189880BEC15809FDF9A83BC31EC4587 vereitels
637,461,669 *41A35E6D6CCA8CC25DD92B59DFC1C5BEEA60722D VICKIBUCKLAND
637,461,670 *41A44F64687291D8C912F98009D8A47CE283405D vimalbooluck
637,461,671 *41A83015C78C3E9D449F8E4FB184C161D5A3A67F VONDUTCH.LAFLAIR
637,461,672 *41A4D840230BACA43CE4A7183A506862E9E68BD5 VX|/
637,461,673 *41AC05494C311B670873FD00D86AF77F558C2F6B VXABAA
637,461,674 *41A4B9F74E7F01DCA01CBC7663706F1F38D3C092 WALLACESTEINBORN
637,461,675 *41AFC4FB4768C100BB83AB43DEEEFA3F76E9E9B0 wardvila
637,461,676 *41A3A4822C08C7157FEC760DBAE22A56144AD288 WASHINGTON)飾演
637,461,677 *41A5B562EA065061392F4740337DADB3FB484B95 wc6o
637,461,678 *41A288F971A2C21C493B3518A9AA3A99DF7D30E6 [email protected]
637,461,679 *41A8711D79368CDF270F661468BF207AAF0E0E83 westonkizzee
637,461,680 *41A0A68242AAC1C940AB09A68185165F41257992 WILLARDDEPRIZIO
637,461,681 *41A26D7F82D53EB6DA59B8656E9E53FB3AA00CF7 WILLIETIEDE
637,461,682 *41A7577EC73F4281D98DF5D454D49B7886B5EFD9 WINXZ)(*
637,461,683 *41A3348A5925DDA0038567DFB6BFC01826F50145 WITNESS.TO.TERROR
637,461,684 *41A4DEE4DC5BD96C5EA27F84BC8D1CBA46CF75C9 w.kane.kilpatrick
637,461,685 *41AFE11E1A20AFCA93F7388CD05867C45664BDF7 WOSOSEY
637,461,686 *41A8E7149DC938D9C5FCB02353B80E439E2C25F6 wren1
637,461,687 *41A603091FB627ED0CF63AE68FDA8BFD30BBFB0F WUDDIE
637,461,688 *41A321877F431927D0B19866FDFED4C8E305F67D wywo1998
637,461,689 *41A6C4ECDED4B5551C76756E1C7F0F24476EEE1B YAMINISHENBAGAM
637,461,690 *41A24C0F6918C28A791F8CF2AB08CEB3E331F6CC [email protected]
637,461,691 *41A7322A28D05EE4A6AD92288E78CB9699F23707 YASMINA-SHAKWEER
637,461,692 *41AF106604A809C40C5505A6B0EFC9C90B90C6B7 yayha-luciano
637,461,693 *41A9255F410D53C4B161D47A88824719CAD988CC [email protected]
637,461,694 *41A934E9917AC3C14159EA3F94D55616BAD04BC1 YOMAMASMILEY2
637,461,695 *41ACD135CF7B2EAB6CDBB0707C3506C52CA83721 [email protected]
637,461,696 *41A37F595CE92B8D28769078B3B82627E6013321 [email protected]
637,461,697 *41A033527488C67FA019830A3978BBBE54132257 [email protected]
637,461,698 *41A501C5883F902848348A2B6B8D64AEAA5D8EAD YXATARUEN1
637,461,699 *41ACAD096C987EA784A5F099D4F68D576DE90979 Z122861
637,461,700 *41AF0849097F0624EE50827BB0F110E05F58DDE0 ZACK-RAUL
637,461,701 *41A283D33FA29A719888D8F88D94138F59FAA8FF [email protected]
637,461,702 *41ACF74477BEA7070377BA264A4916241B8D5D4C ZAQWAN SUIMEZ
637,461,703 *41AA9D9BB1ABE55B702A0742BFB26DCB156A4678 ZAROBLJENOM1
637,461,704 *41A12846A94FB30D79CCBDA97AA4D3DE6AFE0635 Zdi.Strachu
637,461,705 *41A0FB217FD5A70BF393DD8CF27E660FC1501045 [email protected]
637,461,706 *41A512A565892783BA11ED1051531208DFEF3686 [email protected]
637,461,707 *41A9F0ABFC28B9ED44190FBCCEB6B4F7A33ED556 [email protected]
637,461,708 *41AFAF083E7752C8B76045D1CB5AB69F765AD2D1 ZNMPK
637,461,709 *41A398541826BC6B154E7C4C186C2A2282C203A5 [email protected]
637,461,710 *41A122FF4EF2FEEB6ABD5146BBBCF19571048333 ZVCLM
637,461,711 *41A66D8B7769C8D2B6A943BB8974725019912FBE ΣΠΟΝΔΑῖΣ
637,461,712 *41A70E820670E089AF3253C4DA2A8E23A866AFC6 «БАРШАТАС»
637,461,713 *41A756D936AD76C8D50D5DAF947A970C94E366D2 ВІДПЛАЧУЄШ
637,461,714 *41A38612398A5E72D92B680BD1513F0723C0D695 ДУНАЈЕВИЋИ
637,461,715 *41A988A67CE9B7559DB3046525BB150E9BD0979A кз
637,461,716 *41A0EE2DA417C742DABF65AB4BA8A1D1633B824D летецът
637,461,717 *41A88C55A112C904A3F926DFDE30C8BE12346C7E ПРИЗАДУМАЮТСЯ
637,461,718 *41A5F98441FAE751C3ED5964A9E8BF4EF84FE7FB сладуњаво
637,461,719 *41A2437A815F8B591758516113D776148F1E5D94 СМОЛОД
637,461,720 *41A2BAE817FD144CA008731731D49F2A98DD962E ТИМОНЕНУ
637,461,721 *41A3A30542A692C6FFFC95361E2E4CAE9468A8BB ХИМЗАЩИТЫ
637,461,722 *41A41948A2C0E9E8205D4179BCD6AC9DA4334C17 «чаны
637,461,723 *41A310299A22E8012A8E14EE498801992F2B42F1 を発展させたもので、chuck
637,461,724 *41A5E147C2C41867CC9E3BC2EE5BBACCE223507B [email protected]
637,461,725 *41A5E2879D6F84A02144A14CF7C6BB4302782CDE 11111868
637,461,726 *41AF982EE0F13815A0C8AEDEBE128999C25172A5 12:.12..-#..-&...breakneck
637,461,727 *41A9CD5DF3FD6E0DCE8620B593E0AAE30B726011 1366897 UND-JETZT-NUR-NOCH-180-TAGE-ARBEIT-IM-JAHR-.
637,461,728 *41A4A8B9C390A326FA356BCFE079CA7BD41B33DF 13-MAJOITTUI
637,461,729 *41AC23B9532B8BE66ED0EDC17ED6B222613E46F7 1896279 butthesharepricesofbothcompaniesslid
637,461,730 *41A8ABC6F2C6999C6B37608AC12801599F71B70F 1.ardfernsehstudio
637,461,731 *41AC44B7461870B0D9E67EDC6672DA31B6ED7FEA 1aufbaustrategie
637,461,732 *41AC8C1AB634773841BC985F6E41090D08FBC71F 1-AUFSTIEGSMATCH
637,461,733 *41AF858D3EF0419A3D4880E8B6D64A26F8C2E2CC 1 CIKISDA
637,461,734 *41A2FA6F2C089D4345DCF28279E2EC0404F007C7 1 DARMSAITIG
637,461,735 *41A55DFFC2E4ABE9336D7F5EE4B72B3A7A9C53FF 1.DERSLAR
637,461,736 *41A388F12B485C4C287A5D596476200BB0FB5D1F 1gerboises
637,461,737 *41A4EE623E01EFFD6BA7E8C8F084245C6E58C944 1HAKAAUTOKIN
637,461,738 *41AECC8F4A6E2561E74BD2DEF5F901629862FA95 1HARTFASERPLATTE
637,461,739 *41AED3E21F5E8B12367CEEE9A21CD3371087B764 1inabei
637,461,740 *41A1D3A687A0C14A99A2797E9795BC304B4DF027 1jar-heads
637,461,741 *41A98117FFB83FFB133C5B5289B878B8EA2615E2 1-KORJOLA
637,461,742 *41A503554031DD79148831A6D6F24D2D2CF84F58 1-LAUSUNTAILTOJA
637,461,743 *41A9B3192C8D40EB73A9D57B5E3CD8E7E2971E60 1 liitt
637,461,744 *41A6D1FC3B300C45667ED43436BA9A9B388D7447 1-powray
637,461,745 *41A0398635A7663C9048D38E72224B9A957FFA58 1-SEX-PASSAGE
637,461,746 *41ADFE5FBF63C6F5347CF5392256D913E1B22E77 1.sgb-namenaktien
637,461,747 *41AF0B67C063D5DE6548EBC9569C5B22D6D73220 1TALKINS
637,461,748 *41A054676CEBCF09AB5184EADCAD7E0D56F3426C 1-VENEPAIKKA-ASIOISTA
637,461,749 *41AA4E48A14CEED19CDD61BA0584AE47C068B90B 1-YAYMISTIR
637,461,750 *41ABFF9F4D0B3C1F27A6BE928DD4AC041CF94505 20031027:.house.of.blues,.orlando,.fl,.usa
637,461,751 *41A2F4592136EB6AEF8D3D01E365DFABF98B7312 2025332 OPISTON OMISTAA S
637,461,752 *41A8C45A337C872651CED796EA40ECCB44222B50 2080797 TILASTOJA SIVULTA L
637,461,753 *41AFEF4E345C1F74688EA9F091186DAB1B5924BC 20BIEB$6&9
637,461,754 *41A149541C8A6B293277E6CB9FBB7ADBF6F6DB63 2346801 OULU2000,OULUNSEUDUNAMMATTIKORKEAKOULUNOPINN
637,461,755 *41A9BB29C493ADBD797FA7A4A960185AD6B524BD 24233 RANTALAKEUDENKESTOTILAAJANASAATPARHAATEDUT
637,461,756 *41A3B8CF7FD2DE7B6E4519CE84258CFEA6DB1352 2449212 TAPAAMISISSA J
637,461,757 *41AFAA0F5691080669996B63B8C74933FB0D912D 25V7CVN8FKG
637,461,758 *41A3AE82F3215EF2403F974BED1FB634C4D5DABB 2653751 DAS HAETTE ZUM AUFRUHR GEFUEHRT
637,461,759 *41AB2A8D28D8C9FE12B877ACDBEA24B2BF3EFA92 2810791 DOCHDIETELEKOMWINKTAB
637,461,760 *41ADF3B73457BD3B61F3E622FBD15880B4EEC4B7 2891206 kolmenpisteenvoittokiteest
637,461,761 *41A54D378C45AAF9171E6A1A56491E84BE8EFE7E 2952742 DI-ERKKI-JAAKKOLA-ON-YHTI
637,461,762 *41A9BE09B95B6BED349C4EE8367491991DA84A57 2973567 DORCTION NOUSI ETUSUORALLA PORUKAN H
637,461,763 *41A2BB65F901D1EE06996D34D2C6A0242CCF0F2C 2ANAAUF
637,461,764 *41A1955242C2A5308FD7C43D7AE392310C5B39AB 2-CHANG-DONG'S
637,461,765 *41A522AD62EB5D5A36D4FD21C6A8B1F41DF9B3A3 2 LAATUTIEDON
637,461,766 *41A1F9C948FC5F2B680183578886273004A2F28D 2-lajinomaisuus
637,461,767 *41AC0BBCADD683ED9AACF125709BD52D80476B20 2 MUOVIPUTKITEOLLISUUDEN
637,461,768 *41ADB4BAAD8E598A707C28D60C97EF0E3493183C 2RENNARTS
637,461,769 *41A2EEFC6409CCC365C1FF4CF9A46A64D1064C8F 2.SORANOTTOON
637,461,770 *41AC4ADCDCF8EF92377649267464C5125402982C 304527 TY
637,461,771 *41AA3A3D391F712981E6918BC1A90221C227C203 30september1458
637,461,772 *41AE681F7EB14017922B252CFBE8593806D356E9 3ACHUGURI
637,461,773 *41AE26D20183924226F8CD8D0E4B27F2C715526D 3AERSTAUSSCHANK
637,461,774 *41A41C47F8E64938AF0581EECC94A11AED482AF4 3ATUKATUK
637,461,775 *41A3E415EED8C4B1995BD6AA91227E83F38AB372 3AVEZVOUS
637,461,776 *41AF3CDCF94E1F3959DD72560CF4B58B471453DC 3DIYEMEZSIN
637,461,777 *41A2DF0344501AF278FB9684EBBC60761D8AEA74 3EMMALUPA
637,461,778 *41A65542E8A593DE7AC5E4B6A3F6253A959D457B 3EXACTRESS
637,461,779 *41AFF300D22E21A631C59C18A22C194608DF9280 3ILUVLETTERS1
637,461,780 *41AF6BFC812FD02FCE9CCC593AAA0208AD01AE06 3###)-~O~OSPLAT
637,461,781 *41A7767DF11C7332B201491BA86FC1B0D848136F 3##p~ouu
637,461,782 *41A629E94515BFF6540F1CD7D81401A5B2CA633E 3-->-*-*-splat!!
637,461,783 *41AFDB3A1926020D007ADCC0EA72CAABBD3B8D55 [email protected]~-~-~SPLAT
637,461,784 *41ABCBAC561E6D5CDCC3A385B1FB3E5BFFB83B89 3thatbilly10
637,461,785 *41A2DF67F8CBD6F18E7DB595D3355AB184E014BE 437495 SUVIANNE.SIIMES.KERTOI.25...26...MARRASKUUTA.PIDETT
637,461,786 *41A1F4285E0F7EBE330312B87FB2D3112D57AD0D 464616 JOSPOTILAALLAOLITUTKIMUKSENALUSSAMYKK
637,461,787 *41A3E62CDBCA30A553231023CB33336CF257CC08 464653 yUreGindeki sevgiyi aSIla aSk denizine
637,461,788 *41A41259EE78584FA02F8BAB1DE4A7669E717404 473631 viimeinen-9--englannin-kurssi-kohti-p
637,461,789 *41ABC0EC102C6213768130C3A4B1CB2569FEF046 4AIDNAHCS
637,461,790 *41AE096F28E236B6CCED14CF2D40DEB9E93D4574 4FUN4KIDS
637,461,791 *41A87AE5CFF1F4EA2C855BB42D029DD7261A4343 4HOMEFUCKYOU
637,461,792 *41A028677793FB6D09719499314C4B94FF64A4DB 4-MUSIKFIRMEN
637,461,793 *41AF04836B7AA9F6657EAA2B0EC01B8C393211A4 4 n
637,461,794 *41A89577C336244D0FF9455E915F4553D0490731 4UZROVANO
637,461,795 *41A2BE17063ADFA2910549B65656B37FDEA34CE9 4WESLEYMEDICAL
637,461,796 *41A6C8161D095A81E01CEC4992AC77EA11D54B3D 570871 eine.ganze.kater-invasion.scheint.programmiert..
637,461,797 *41AB9BDA8D0D647C51295159FD5E4256C1C7FAA8 5BSWSEARCHMENUCALLBACK
637,461,798 *41A306485118BBD4C4EC9948F3F9F1F2E6E9C4F1 5CHERRYKIM
637,461,799 *41A681500117B95D6A2BFEDB860C8067942C54C6 5ENTROPYDOUGIE
637,461,800 *41A363FC502AC4415D4BFAC07E908AB63F557A99 5HOHTAVA
637,461,801 *41A99D51C9D93336974BBFF94BDEED94831A4C20 5interphones
637,461,802 *41A673E0E5C51689AA5C8615E0849D54F0C19D67 5.MERENK
637,461,803 *41A29AB2E91407F34BFE0DF2BF0864D1BA11D347 5REGGIEFIRST
637,461,804 *41AFB420211D52579190539841E5C497A0BF655D 5THEHAVES
637,461,805 *41AFF6EAFDCD09D845C4F025115B38526F493352 645679 '-korkma-roldU-
637,461,806 *41AFA183238F559B897CEA3FFC6DC6D73E2B69D9 6ARTENIAN
637,461,807 *41A5AF54C60EDE2167BBD8FC3265AC7C60308CC2 6DISCOVERYCATCHINGCHAMBER
637,461,808 *41A101F46E595D6F94960FE2DBE305B139173849 6GASSLANGEN
637,461,809 *41A92208700704B82ACD553418A4A90D694640D0 [email protected]
637,461,810 *41ADA5A001B786E15EF4AD9BA6413A4C1300D1F1 789801 THECOMPANYDECLINESTOCOMMENTONNEXTYEAR'SPLANS.
637,461,811 *41A38BB4E1605E1C9BA911D03ABD38FF013ECB37 [email protected]
637,461,812 *41A67C8951C737DFCC7BF511EBE1271DECDDF43A 7ABZURECHNENED
637,461,813 *41AD490566C51812299071ABB2DDBEC316036E8F @7AMODA,
637,461,814 *41A80CB05F9C99538184427B866FC578763C2C13 7CLAPPERMACLAWS
637,461,815 *41AA2DFEE5E2530003AF9AB8F2C1B03FF556A720 7EKNGSBSW
637,461,816 *41A52EB03AF966E66137F3EC3072D923BF58A557 7HALLUCINERENDES
637,461,817 *41A5FE71FA60024B5D581EDF9BC05D29BADC6700 7HAVEGOOSEPIMPLES
637,461,818 *41ACD3AA368AA2EB0E82D20212DF167C26A205F2 7LAPPUSTE
637,461,819 *41A715A0F128E7B3BE0B13758DE558DA3B437488 7metsosta
637,461,820 *41A8B5FE5B2D2677195923B6DCE473D13BDB029A 7SATURNMARINA
637,461,821 *41A3FA4052DD639C068911D05C5681221701D8DC 7SPANKYVIDEO
637,461,822 *41A7FDEF12413394E0993875C8DAC219A55C03DC 7thepatrick4
637,461,823 *41AC567BDA1ABC164262B366D83670851C70BB8B 8===>~0o><
637,461,824 *41AEEBAB0A8E0DBBA4EF1EDCF52DC943E56B9081 875737 kulaklar-tIkanabilir-
637,461,825 *41AB6E9C6359308EBAAED4D6A9162C1F9FFA991D 8ACTIONINGBSW
637,461,826 *41A96300288FCC92B9C8B84382E7234F61462BC3 8BRAZBSW
637,461,827 *41A79920D075C3CFC4B21202BFDFED6805A8B132 8BSWCTLINNDBSW
637,461,828 *41A4DD407991B2EF6FEEAE4CA3C0C8375FAF2467 8BSWVISITATI
637,461,829 *41A5795CBC357EC8843BA4490E6FFA0734CB3BF7 8CURSORIALS
637,461,830 *41A37DCDAD24EABF7F49A160211F115FE42DE47F 8JODYNJODYN
637,461,831 *41ABAE6C4BB711ECA7BEC304012B8D3376153F29 8MAKIRITA
637,461,832 *41A792398EA99FDDA69980C6E01BBADBD3E0C01B 8p***(_0)
637,461,833 *41A661802FB3CD0CD8E948B2FF0B36FB1852A521 8SEFCIKBSW
637,461,834 *41A0811BD2C1C8A48DD5355186F2DAB0BBB1549D 8TAIRBRUSH
637,461,835 *41A2A8C4D185AFB1211F0508544CA72B630F4D31 8VSKIING
637,461,836 *41A4F8B68CEB183B8BE88B615096E450FB49CB4A 939497 anstatt sich das hirn zu zermartern , raucht er zigarre
637,461,837 *41A8D4EA62171D372A50D5E2CDFB7E65703BD842 944087 baSkan.-sayIn.ercan.,.buyurunuz.efendim..
637,461,838 *41A52886D0B45FE91A9C041457B3611D15C67E76 987xxx
637,461,839 *41A61618277AD13732FFFDD92B0F9245411DE47E 9BRUNSVOLD
637,461,840 *41A8EB7D3418DAC3FBEE4504F336A6E7B216D8D6 9BSWALTIMIRANOBSW
637,461,841 *41AB06047F0FA3FB3CF14CDCB9ECC9351704C8C1 9FAATALS
637,461,842 *41AB9979534548DCAA5C31EE9CF8B32E037D2E42 9INOPERABLES
637,461,843 *41A472BD28EF47CCD1E8396A8EFF74706A89A5FF 9KTHJARF
637,461,844 *41AF536687829BD6D3A93EEBA755F4AC61654944 9NATLUCENYMI
637,461,845 *41A33FD51322DD47FD1AA9E2F3098ED4FEEE9C30 9PAWASEMPAG
637,461,846 *41A79A405A2FBAD82AC2CF6ADF2A45BA8150B27B 9TIULSEBE
637,461,847 *41A7C6C1BA538AE4364E877605B250ADEBA50669 A_+&
637,461,848 *41A3A2020F27F0BBAA43CC208987870F59631AD4 a1+py
637,461,849 *41A26275FB05C221AEF4CF94C804BB93979C71F8 a3=-b
637,461,850 *41A5501737C05AC395350D3708FF39FF66B45E2A A3MF!
637,461,851 *41AEDF1C26395E716A591128688B0EF2FC51EC6F a4^u
637,461,852 *41A195B9345C43825E2E7E47320EC8E2C2BB711B a":8e
637,461,853 *41A93DD061E574871382B4DABA7EF5F2C97BBD6A Aa6_
637,461,854 *41A95A6F7152FA5DBC2EA5A0663FAE3D2C81FA7E AAGCAGCCCCAAAGCCCCTAAGGAGAGGTGGCCCTGCAGAGGTCCTGGCACCAATTTGGG
637,461,855 *41A04A874DB17111C1BA1976800AADC85140BA94 AAHOS
637,461,856 *41AC9502AE87E338D10CA75D0A14805DD74D1EF3 a:beg
637,461,857 *41A124712F0CEA7BB6140E1502670B310D9B4FD5 ABORDNENDE3
637,461,858 *41A0148061A01EA4E6EFE50F3206966C1E700EA4 abspieltet5
637,461,859 *41AC2C8DE6C09562DAC13DC9570390CCB43F6024 AC]<3
637,461,860 *41A0733A3847B15A8BBA55B74604F1F6DD37F5E2 ACBM1
637,461,861 *41AD120441E34D1D667739E5315CD38340438688 ADAMDOLLIVER
637,461,862 *41A3CFFD98C95661BD804187C57B35251F6AE627 adbx^
637,461,863 *41AD8189384D3059E4B6C79826B8D8921F4D1A53 afeiradecaruaru
637,461,864 *41AA7861F5CDE091FB630464EB7DEE71B6E12204 afsnauwden7
637,461,865 *41A63F9138A1DC27CEF1524AF7CA72D62E6D46EC ai1x)
637,461,866 *41A5809E3AC4EA2510F60F685F3B788BDD6BDC36 AIHY
637,461,867 *41AFA930AF3F4752AB11C1497F550488CE6B434D AJYU_
637,461,868 *41A9801548AE76B6ACEA616DF98F6EF2909BD4B8 akademiejaar
637,461,869 *41A1C1C28C9A75B6AF899BC925AD37C2292F3BAB ALAN.SQUINES
637,461,870 *41A5797EC10E90C992B0D53AE105608CFBA10986 ALDENBERSTEIN
637,461,871 *41AEF28E07AE803EBEBF56B4CE8ECB4768352C82 ALDRIG DIN V
637,461,872 *41A2886E3F98B39B5E13EDAAEFC723941CF7558C ALFREDCHICKEN
637,461,873 *41AB921B607F354EA2CB4A44094C66F76D6E4E2A ALLANKHAIZ
637,461,874 *41A17DA51222F515DE655C6EE1B707807645482A AL!M)
637,461,875 *41A3CE861C9ED4899D65999ADA1A9BFE947CA40D alotcanhappeninthreeminutes.
637,461,876 *41A621FA85D762055B87FA1CE260591C193E534B alqa/
637,461,877 *41A5E465FB2ED925C63761D25201FEEF81ADE65B alstambach
637,461,878 *41A7914834CC75B1FD196233ED05476A4F5BA042 amadomotsinger
637,461,879 *41A19181E34C746DE2AD4A6A8C81B761D58AE85A AMBH0
637,461,880 *41A2A7C2C3FEDE4E30C7A1AECB67ACA79B992877 [email protected]
637,461,881 *41AACA2EDB81D0878CFFE2A114A36E4BE035A538 AN7AS7HENIC
637,461,882 *41ACDF26DADBCC5752CDEAA933F9518328BB46A6 ANDRESCHKOURI
637,461,883 *41A7B1C0624F2BBF4A6A7DB10BE8772400E0BBAE ANDREWSLAFF
637,461,884 *41A2622DDBABD1B2F5E50F382088EA1A4BFC19A0 ...-AND-THE-BEAT-GOES-ON!-34-DANCE-HITS-OF-THE-70'S-(DISC-2)
637,461,885 *41A1FC2D2A258FC11A8036265A856E661B56C2DB AND THEN TO RETURN AND SWEAR THE LIES HE FORGES
637,461,886 *41AA10C1ED7D9E081F37E2778652A6253E6014CA ANJELICA.ROMAN
637,461,887 *41AE666F5430C543E4D1631BFA37D090F18CC698 ANQLR
637,461,888 *41A0C801A2B3A3D1C4BCA6253ABCDB9558BAEE0E ANTOINETTE.GROVES
637,461,889 *41AD122F7B2B56FFD5C3C7D6A75D63AC505427D4 ANTWORTARTIKELS
637,461,890 *41AC8732CE13B81F5B9107F2863761E449BAA03C apb#d
637,461,891 *41A016E614FD9F16B8745A9548E5249E8CA60F5F A_:Q6
637,461,892 *41ACB3F6F2DE2EEEFDD903BA00353D5FA5B52566 ARMANDJACKOLA
637,461,893 *41AB2D54FEBFA4A5236F670BB5CCA9BA9AB96C75 ArtT
637,461,894 *41A06DDC1AB6F5E8597645E63594FC0266780C5D A-S+I
637,461,895 *41AC99F9356D70AA3E89D70B2746BF6024EAC010 atfpt
637,461,896 *41A71E09DAED278EB2AE8FF5EE51E3FE48993935 atlassalescomwww
637,461,897 *41AB751AF4881BC62ACEE49A88794000E64D1C9B atre4
637,461,898 *41A8CF53EBF5FE0778FD6DB8C7D7725F8EA9923D AUGUSTUSSTEENHUIS
637,461,899 *41A9D17B8446CBEFB5C7163F746C5EFAA4220F56 a/uq/
637,461,900 *41A029BE73935ADB2902E3A582C712ED16AFD9CE AUSTRALIANSF
637,461,901 *41A7EC4E347442694F179F61AECCBAF8D58E4F47 au+w
637,461,902 *41ACD9E188BF8904A028856882A7E54E9909C551 a$v6d
637,461,903 *41AD23312F1946154C10DE012D8CEEF554D7E598 A:VPM
637,461,904 *41AFA2DF444FD935DBB0044F7592C13714C1BD6E ~<B
637,461,905 *41A62FDC6281EF5272C81326096E4E6C1F52D415 b===)~0.splat!!
637,461,906 *41AEEF0A71A990BF4BD987DC5799C2FF02DCDB13 b1nf
637,461,907 *41A74309DD322C035D5B38B8685AE2DFF9B3B4F3 B8EH
637,461,908 *41AB913A89EC60AE28928612887AFDE2F9CC1F64 bars6
637,461,909 *41AEB3BE21B299F6E50660A6CE42A300FD173E59 [email protected]
637,461,910 *41A3B706154E7F8E4B8C9D385FED8B9A20FD8B9B BDCONE
637,461,911 *41A80449FA89F0C803BC8117EF0B48765A9677AA BEAR69:SINJIN
637,461,912 *41ADA244639376C26DB342D81105C48A147454FB beetle)と「ガル」(the
637,461,913 *41A6DC1CA5CA3148A607B0BE40573C9BEF2E3217 BERNARDO.VLACH
637,461,914 *41A8E2DED7E66BE189F0FC9D75BD575F669A6FE0 bernardrhoden
637,461,915 *41ACD4D5D4612DE1AB3D5E31692F70E875A3ABA3 BERWASSEI
637,461,916 *41ABE554E3A6722F55C109160F9B64B5782DF9B6 BFHVE
637,461,917 *41ACE0A42D3A4566814CA24BE24894C3B10F3E40 bg#s8
637,461,918 *41AA96EAC6E4713F3123ACE6E1434D13577CA33F B#H2
637,461,919 *41A8928EDA936FD3555B588CA277BD5190352690 [email protected]
637,461,920 *41A36815B8639E5650A283C62C33B2B1B071537D billyheuwinkel
637,461,921 *41AE52F7FBB9C0EAFFE7C1AA3E1082523C64F8D0 billy-true
637,461,922 *41AAFBA94FA708C8F789BC2E0E2883E990A6C541 BINARYCLONEEPOCH
637,461,923 *41A00F13C752AE932692988383DC2E97EEE3B1B0 BJ1BL
637,461,924 *41AD805818A28224A89D7FDBBD5D30081D3C8AFE BKOUJO
637,461,925 *41AFBF20B257665AD48D0BF18B9C32DB8208408D b:l!5
637,461,926 *41A78F68EF3390401F38027079C784D6F46CA59F [email protected]
637,461,927 *41ADD7BD54E6E9BB0E7EBEBA76DE25B79BD03C67 Bmld
637,461,928 *41AD1D4B7B35A0BDB2621022B9F05186258E4116 BOOK2:THEKNIGHTATDAWN-CHAPTER7
637,461,929 *41AF2A2E725B8E160243E18CC5AE9B383D985B57 B#OXH
637,461,930 *41AC2B1A6F0EAE7FD9389EE1D003C39B186E7470 bq1ws
637,461,931 *41A20082A016FE35CB5606B9C247EB1B1F7E2EBC BRANLEDOUBLE/DARIOCASTELLO-SONATAPRIMA
637,461,932 *41A069020AB71A3878F6D6988E7C2DFC0B4F6C04 branttatge
637,461,933 *41A4860CA3EA5C4128ECA290D039945625BFCB83 BRENDAN.BARRICK
637,461,934 *41AD0F8F817EA9CC4F33081A4A4763BD044FB3C2 BRENDAN.KOLIS
637,461,935 *41AE2B9F3EB1748116CB5B03CFA54B79A6942032 BREUILAUFAIS
637,461,936 *41AB224F487BF503B8CC831541791FABFB6410DE B%RM
637,461,937 *41A89CDB19E3700C3A17E0246E0F349B6DD30204 BRZWF
637,461,938 *41A60E18CE7C753972ACD5090062F59D0800B414 bswsorrowes
637,461,939 *41A02B83859EAFC69524E95C9D8EAFE91C507705 bumpiest
637,461,940 *41AA011A69D808B5389CE689978A9DF957B1F0D6 burtonsmeby
637,461,941 *41A1C6E2B750046A3E48BF86A23FD0F20CF12C62 bvk$"
637,461,942 *41AB019D4FCDB19B74FEF4B69643C868499327AF bwh:w
637,461,943 *41A3294466D51C9CD7CEA4F5D4FA43C96057612F c1)6x
637,461,944 *41A956292DE0F12A14F3B4C5EF52FE3BB50027DB c35o1
637,461,945 *41A990E2B80B98A166C39B86608822142D445345 c4&.e
637,461,946 *41AA066568B69779225654BC1ADEE4D497FDAE28 c4.n8
637,461,947 *41AF41A7FF32BB7D8CD688952A47291295F9F35F C4P;
637,461,948 *41ABEFD964499B4FA087AD3CF0A1F639586AECA8 c7e0w
637,461,949 *41A9BB38700C3E0C12210D6B0F2F3A462C26635E c9vnk
637,461,950 *41A979C6CBADE5A0AE4FACF968F8E05F801C25A1 caplidos
637,461,951 *41A57FFCD3324CB6187C210FDC7260DD65F346AB CARLTHOMSEN
637,461,952 *41AE9FAF62DA671A6D8A102FFD77D3D896C08919 CAVAVENATIONVENULEWAFERWAYWELLWELLSPRING
637,461,953 *41ADD4C2CDCD32D0380079468A6695B58875FDDB cbb9q
637,461,954 *41A2094F9EFA6E7B21626FBF83C9D34E79BC7870 CB=E6
637,461,955 *41A6CDE0BDE07A62620188C6E0CC4B80ADEB8F9B c,ct
637,461,956 *41A068E828DC2A5B10171C3AF6D090A0884FD046 cgf
637,461,957 *41A0214C4F5656D763BDFE24B25A780449410847 chan-pak
637,461,958 *41ADCD803E5512673BFDF6ADD8AD7F350E4DFAC9 chariseed
637,461,959 *41A192B8748BA394E22ED6C9AF8BCC7672191FD1 [email protected]
637,461,960 *41A1698846A7A635679907EBCC0D2451848E84E0 ch#t
637,461,961 *41A6719A6E809C61DBAB2DACFC86E13B4AC41A14 CICOLINAR
637,461,962 *41AE3C90F6970934F847D6A17BCBA6A9F75EDB8F cig?l
637,461,963 *41AB6A99DEA925F5139F8D533B26721ECDD5209B CI$UD
637,461,964 *41A68A7CAD06864CFE9B4471452635C0B9C8E8ED CLAIRCIARLANTE
637,461,965 *41AC266B95131B6CA05C4E982B86CFC9E54E4DAB clarencequilling
637,461,966 *41A9894618FF5EA4CE164BDBE0C77FA7345A55E6 CLARKLABOVITCH
637,461,967 *41A9F7CC5805716DAE306610930EF494CFD961B1 cld5,
637,461,968 *41AA36B96B969C69B631369059AB81201C1BFBF4 clementeackison
637,461,969 *41A6B356DA4C81B12BCB5989EDE9590C86160960 Cm%!
637,461,970 *41A91AA8CCEAEDE809D892474D57BF99B070C75F cn.#r
637,461,971 *41A39E1A515F27D791235098243517711ABEE73C CODY.PUHALA
637,461,972 *41AD323D6CEF013C3E017A5F881A1AA7089A92F2 coev.
637,461,973 *41A105F7600A05368310360BBD36B715582F8B42 [email protected]
637,461,974 *41A1C1F0BA40F1FE1EE1A3FA67B77466879E0EE8 coleeyestone
637,461,975 *41A9BF20576FA1E2D16D4731D2A62C22B7E6C4D3 colin238
637,461,976 *41A0AB4D4E45F8430B0867B814C90EB3A6FBBDA7 COLLIN.LECLAIRE
637,461,977 *41A4E83789F4717741E911FFEE083FC081F9BCA9 COMPUTERFOUNDER
637,461,978 *41AB627A2E3A11146474D5F11C76B798A5477076 CONCHITO6
637,461,979 *41ADB4DBEEDE3CBE670E85DA77DF93371E8C0F02 Cooperating
637,461,980 *41A50B90AAD8C16CA1FD23D9A0EFFD4260D4833F CORROBORATECORROBORATE
637,461,981 *41AF6588372455419AFEB6D1EB856B85CFBB7CD3 [email protected]
637,461,982 *41AE06F6FA10219FF0A68140E64EB4FC65F58CFF crm7=
637,461,983 *41A70E9CD2F0ED782C263A00CB9149CE15C3D06D CSD$N
637,461,984 *41AF6546823FE4E5028CBBBF8BDC013CCAE738DC ct%wi
637,461,985 *41A56480C3F3E22F4DE58020CB473717A8BD7D5D cuppiest9
637,461,986 *41AF4F4B592588B92E89C54F671E1742BBF189D1 CVAZE
637,461,987 *41ADD1232A74E726CF0F83F13B3355F5626B3F7B C#WSK
637,461,988 *41ADAD4766CAC42340D50064F33592B1C607069B czgu
637,461,989 *41A31D8F0A79B8168B773F1641DEB7A046E506DF DALEYKA
637,461,990 *41A167C94767F4DAA8450F5FE3CF9B1C28C76CB8 DAN LOVINGER
637,461,991 *41A9811771140FEC2900E65669B01AD6806EBAA4 DANNIE.BOUGHAN
637,461,992 *41A28BE755EBEB24816E75DA3820363B39A114D8 dannyridinger
637,461,993 *41ACB8541357A527673B82DAD76B0EB0AE8A513A DARCIFREDRICKS
637,461,994 *41A083F681B66455AFF244F3E5E12A69494EC0C9 darrickelliston
637,461,995 *41AFC4BC21045407C51AADF592F4FF83B76900B4 DAT-FILE-SERIES-NETWORK-ASSOCIATES-RECOMMENDS-THAT-YOU
637,461,996 *41AC4552641D15FB87927275A5D8AF981AFD6170 dbhox
637,461,997 *41AA2539A260CA2E8F83B61EDA7D7F81B5B1F31D DEBBIE-CONNOR
637,461,998 *41ADF7BD9EBEDA4964BB3FE88B971A2E74C5D1B5 debbie-lamm
637,461,999 *41A84036C95ED1EC844F4F86FF49D48DB7840A9C de;dv
637,462,000 *41A2473F7B4F6F3768DDA70CA3E9F0FD2CBA53DC DEHARCOURT
637,462,001 *41A0FC0A02C5771E5151283E2D05EC2BDA0494B8 dehk;
637,462,002 *41AE89F8A9B41894AF9CB0C43F9D02CB3264574F depm!
637,462,003 *41A227C4E60CBC766C117A45B9282AA07A586B4F DESNEDNOCERP
637,462,004 *41AFD41B89C078A3ED4EFBD02E685D261A328788 detbedsteafdanskmusik1981-83(disc1)
637,462,005 *41AF89070F0B368ED03F12A08FFBC904145CD1E3 d;_=h
637,462,006 *41A510021602C9CE892AC744BA97FAD4F586C00A di2n!
637,462,007 *41ADB0B9FBCDE72D098959694D8BB18DFD9669D2 dns((
637,462,008 *41A2CA0A50C3656056F425310919648DC842BE22 DONNYAO
637,462,009 *41A7B963B74B86C0F9B1C46F366DEB3173234ADA DONTH
637,462,010 *41A423699730D699626F4A4222CB668087906FED DPR:A
637,462,011 *41A51092193CCF795960C1D4465ECEBCD9DE4918 DR4Y H0R$
637,462,012 *41A261C0FDD3531A5F64286AC13DCA3BDBA4A3CD DR9B(
637,462,013 *41AFE50BBBF71E5D6146DA1AD8BA8C79AFF374FB DS&#
637,462,014 *41A953C0ADE81DEE2DCF1B7D823651329E77AF6A ds78p
637,462,015 *41A4FB3D34F9743ADB2EB43067DF7817661BEBF4 dse"0
637,462,016 *41AF60A5C1E7888F7D2B50AE7B2830BB841DAF80 DSr+
637,462,017 *41A881CC70B2ED4E3E1D1492CCC0763737FD130D dt(--
637,462,018 *41A9DE8ED15BCBAC843F0E0C4529F237B3542E33 dtermineras
637,462,019 *41A444F74D1F80B6C34E7AF6EB299B5009D46FF2 [email protected]
637,462,020 *41AB84B8C1014212509E2724CB91B0D05736B233 DUDLEYBENDIG
637,462,021 *41A9A2BF79A09D6E44C6588A1B9C07927558DEBA dudleylopaz
637,462,022 *41A4570B385CF57F94DD959F0B691DB5E1F606C6 d&v1)
637,462,023 *41AFBD8F2D4E4BAD1C4FDDEA0E7C2562310333E0 d;vcs
637,462,024 *41A05BEEE27A9B1CF97BD1FDE7325A8B466EEC94 DVUSW
637,462,025 *41AA7BBCC88A5D2925B1F30917C063721004BCE4 e9x1
637,462,026 *41AD0B73128EBBF75640C596E59848C17FC54AF1 eallyrene8
637,462,027 *41AE68D2E697584158C4C6EB6C6963F29655DCF1 ECONOMICSCENEGEORGEBUSHSSECRETWEAPON
637,462,028 *41A2A5D2739C97AD7E04F7AE637160F75F3836D5 edgarodem
637,462,029 *41A1C1522C83876FFEA93886A455F9E7FA20BCAE EDGEYS
637,462,030 *41AEF8E5E7B4B2D672CDFBD511170C2FBCFEE423 EDICALES4
637,462,031 *41AF16A0DA2724710577317EA9117C583C5D1AC0 eev
637,462,032 *41A209E5585FC685DFCF1EB9272F76CED3C722AB [email protected]
637,462,033 *41ACC9116EB16730DEF5E18CECD53956BEEE516B eij6$
637,462,034 *41A4D4B837FCDCD178D69BC57C4EE681DE185E01 EKWADOR1
637,462,035 *41A9D323D62CDA004E8F7AD3FA0352258CEB8EFC elegyforanex
637,462,036 *41A3CE76EF15EAACF9CB0D933E886C2DA799E08E elgaereis
637,462,037 *41AE9FDD8CA4F35F1F4BE63DE07ED594253D7DDB elijahphelts
637,462,038 *41A9822D68A516BD4A19071BCFC96E037716DE3D elishaweicht
637,462,039 *41AEFE69B3C3A3802A319469DECBE6A17D4092B1 ELLIOTBMWS
637,462,040 *41AC20F1F617B9DBF123C70587DC5D181F9490F2 ELLIOTROBERG
637,462,041 *41A3837C0943D68D9938582F6A2121284BFE0ABD ELROYSARSON
637,462,042 *41AAA9D846F1FE6E971E7A1B25111ED5D786D027 ELTON.OSISEK
637,462,043 *41AAA2629DB6C145B9BBE1185A988DC214B63380 EMANUELFRANKFORTER
637,462,044 *41AD57A23854FEB82FCF5CF533791C9336532513 emeryvilletas
637,462,045 *41AF22ECAD8E50FD36A5791D7E392C828B9BDD6F [email protected]
637,462,046 *41A708721E11E660C536AA1361A536155C4DC2E6 EMORY.PICCIRILLI
637,462,047 *41A6AECDA1107C7D7F2E1AA365C042720A93B7E5 ENGLANDCARRICK
637,462,048 *41AC416735255DF406A82E56D94DEEBC6B67C690 ENMETI
637,462,049 *41ABD2AA106425A724883D23AB678DBAEB73BBEB ENRIZARAS5
637,462,050 *41AE7119604AA938FEEB991FB46C587228C0E8DA ENTOMICED
637,462,051 *41AC155605E9ED94B1F6211E3F273F67AFCC8D00 ERETHCOT8
637,462,052 *41ADC4FD7756B930CF2B496FAFE5EA262C514747 ERG;X
637,462,053 *41AA384942824155B1237472485755E91BB7F86F ERIK.LEMKE
637,462,054 *41AC6B1759C3A325F8497D8D12025A30B62FD934 ESIWELBAGS
637,462,055 *41A1A0731E1D45F6A2780C6D49E31C62F2657F26 ESORTAS1
637,462,056 *41A27F08C5F4B480780A6D2E7A01A4C112DAA427 EUXTB
637,462,057 *41A6AF4902F25B65970AEE09E6003DDDBFD5B3FD EVERETTTAM
637,462,058 *41A92A15966884E170E5385E185C696E4A6E041B evertiko4
637,462,059 *41A6B444EB6148180F739CF9536C34D8EA71F8DE F9F7EE07-D130-3439-8438-4276E417CDEE
637,462,060 *41AAB8A28D14A47224B84A4D5D88AA2B516F62DE failure01
637,462,061 *41AF137513B4DDD99F836E2706BA89F422FFB699 ferdinandredmond
637,462,062 *41A1AADFDCF87851F9DBDA697BD9DB27230FB85B FIND-IT
637,462,063 *41AABC114E53DFB0EE7B8134E76457739F847748 focused on you
637,462,064 *41A0E639B9CC8922AEE39BFE624D6173DC4351D3 FQP)
637,462,065 *41A83B210E44737877D7A4BDF25B1339989DC33A FREDDY.ZIRKLE
637,462,066 *41A92D450C18A29E00F73BA718595F24316D0831 FRUKTANSV
637,462,067 *41A02047BBB630C4081BF3EBCBFD11AE3233CE54 [email protected]
637,462,068 *41AD846E7E7453905FB8A54BC64FE00E9532F1D5 garnetcfj9
637,462,069 *41A6AD9BEAC02AAA7372A3426A5FB93139765FBA garryarko
637,462,070 *41AA59768B954D04C041EF9D8A257C4C44CCBAFE GASTON.KOHLMEIER
637,462,071 *41A152F22BD745B8169399939E7A7B04FB521CF9 GAVINO'NEILL
637,462,072 *41AD273F3A1B79502CB49C9DE54727F5934C7B25 GAWTHORN8
637,462,073 *41A2A118FEACD7FAFAFB03699795F82DCF191226 ”gerçek
637,462,074 *41A928B6D1451B0D8ED11F02B68FABAEE57E6EB3 [email protected]
637,462,075 *41A396A7A4E36EED0263E601F0C75C65BAE0F24F [email protected]
637,462,076 *41A242397744FED4081ACBE6BD0664B66CC2097E GIRI CH
637,462,077 *41AD03305FDCF278DD551D3D508CE97B5FB2E393 GIUSEPPEPEED
637,462,078 *41ACF8DC2F66C6E6486E5916B7F6E2F957CCCF4C GONGFRANKLINZ[email protected]
637,462,079 *41A146E21A2A8F6FA4FC6C9A21D195C371CB5CA7 GRABMALWAND
637,462,080 *41AA998E5DC6E0188192FC537D7873059FD9C916 graigborland
637,462,081 *41AE1F9D27438796D8C7F5828EE1C455D455AEDD GREYSTON
637,462,082 *41A114A85778CE6836C499D13DF9F2C1E042C514 H3NRYT0B1
637,462,083 *41A2D8CF2DE2B3E5B64C0283119177E477BC2DD1 H645771
637,462,084 *41A9D224D3D5DF425403E270FD39F8A05783B8D8 handill4
637,462,085 *41A30FF12DC7DF556C10AD0FB4EDCB2525468BCB [email protected]
637,462,086 *41A7621093B5AC622A0E3E4C356D48B61756287B HART5150
637,462,087 *41AD3D67B529FEF8B867915DB49165984CC257CA [email protected]
637,462,088 *41A9D2A4F7084EA5C792CE6B6D06EF2DFB808C9D HIMSELFSUPPOSING
637,462,089 *41A08373CE11A827C7CCB34A1D075ECACC9BB852 HINSON》,包括他與
637,462,090 *41A43333DF9F9B95D1876EA563ADD94A83C649F2 HIRCOCERVU
637,462,091 *41A417D20CDD72902D09A3D77E3B3957968819C4 [email protected]
637,462,092 *41A7EA6D210DD2AE2C8655B6AEA840CDC592B8DF ho.f
637,462,093 *41A7B61414442AA80F209372F1C66F6D7A8C89C2 HORN5WOGGLNG
637,462,094 *41A0FA5B025E622844ABC8872227EDD1423CB07D HOSEAVETERE
637,462,095 *41A0F8F8E1EAFE5CB25D603A8E923471A81637DE httpwwwtutosorg
637,462,096 *41A857A3854E16058FC44C38C9333F81AD149957 HUOLTOSAATTUEISIIN
637,462,097 *41A70522064848AB57EF66F8207714E69FF83E03 HX:
637,462,098 *41AE3BF384DD78776AB93A6E65449FF32019CD28 iamwisdom1987
637,462,099 *41A39EFADF66010F81E6958965B977DA64322778 ibjsokk9
637,462,100 *41A6CD73C8AD7DDEB266371D10DB8A16B73A9DBB IHCIMUFFA7
637,462,101 *41A24B871EE2359D59FEF0FF4B168AAA5B7DFE2C iksnalim
637,462,102 *41A220E9F2C89DFE5BCC573D72B69519C2C07292 images d'une ville-poussi
637,462,103 *41A425054F2517AF49CDDC3580AFFCAA5E32DD8D In.Dulci.Jubilo.(Pi
637,462,104 *41AFF7F555C8AE7A81D4BF94F5D817999A5BD268 [email protected]
637,462,105 *41A029FDDFBD8EAC3A3F6946B11EE526BB8EFE7C intraspinally0
637,462,106 *41AF2AAF3AE1B6DE33BBF37EB84775608BF25360 ISROFIL
637,462,107 *41ADA691ABFAAE4B843ED7CE9B2E7EAE7BA13DA4 [email protected]
637,462,108 *41AFD486B71F2259F8536D95A4767BE706A3DB8B [email protected]
637,462,109 *41A05B3ADFE46CE1F319A6B0D1669B01AF50288B J2569963
637,462,110 *41A9F0CF66207E020665CE0E535BC02B608657C2 JAN GLEN
637,462,111 *41AABD484787B09DF5B31E2CC00135A218BBFF42 jareddgj0
637,462,112 *41A4BF13302CC68CFE45C9DD2F1E3F2080441605 JASPER.PERSON
637,462,113 *41A95B26F5458A2FFA8251874E02F390F4BE14F9 JENIFERDARREN
637,462,114 *41AB17204BF45B48D765A2ED69B0094C1B4497E8 jewelflintroy
637,462,115 *41AD1AB4AA4923BD338AC647BE574FD2C2B72974 JEWELLGOOTZ
637,462,116 *41AFFC5725DD9239DAF05EA63F0BB1A6E19C6120 JLMBMMPJ1
637,462,117 *41AB32B03FE46E6393639BC6316D39AD6A1E2113 johniebonasera
637,462,118 *41A0285CEEEB41FA7DD094C78B6837957D6DC0D3 JORGE.WHILE
637,462,119 *41A4744818D17665EB292159FDDC9DE24CCCEE1E JOS0AAAAIAAJ
637,462,120 *41A82F1FCAD366C3C66F7FC07F3B077EF574E4B0 joseftiedt
637,462,121 *41AA75F3150BDDB9512234474EDA14B187F70CDE JOSHUA.SUGAR
637,462,122 *41AB285DFD2E121D4BAA12802656B71C20B5BDBE judejarmin
637,462,123 *41A08B123AD03F5F356908291B34800F5ECD8D2E julie-berthiaume
637,462,124 *41A0D284292229331DD77C790CB326A688555E83 just-on-my-love
637,462,125 *41A2A76E9AB682FD06B3AD8F4A4F7223324CF77E jvan
637,462,126 *41A91B2A6EE57AAB1A83FA0E487132891AF2A959 KD031593
637,462,127 *41AE1A10FC051B3519D4DCBF23117C010DF94969 KEITH.SETTECASE
637,462,128 *41AD0640BC8CC7A947A39C9E345AA230D66ED429 kellylyman
637,462,129 *41A8A8375522A1E3A00AD92EDFA5700BD987586C KENEISHA GRAHAM
637,462,130 *41AC4609F60D4EC2168DCEB15145CC2813DDB03E KENNYMCKEAN
637,462,131 *41A7151A3B1AE0D8AE3B9D015E01FB37C04E3A0A KEVIN.ACK
637,462,132 *41AC40333D6EAFEBF5EE240BFE4F05AD694B0654 kibebbs
637,462,133 *41A8706FEB986AC9C37DACE4F64E4BD1E99E7208 KILDOWNET
637,462,134 *41A3B165D563787676D1A96946D3A30DBAE4F429 kirbypanzarella
637,462,135 *41A9CAF12759E1A6EFFD00DF965F91B81F478C90 kolymvari
637,462,136 *41A37148D2B85BD3AEA5CACE5D2870CF403164B8 [email protected]
637,462,137 *41A8CA5749FB3C9CB92C8D798B7C5258F2959301 KUSTERSON
637,462,138 *41A05B83C4AD409111E3955FEDA6EDFBBC28A8C3 kylemolesworth
637,462,139 *41A7EAB62B846E33B30FE7E5A6D700FEB35C48F1 「k」…普通は歳をってから叙勲されるが、ヤムセのようにごくわずかに例外がある。(ex
637,462,140 *41A2CF799D93208C863427AAAD7A1A18D27D1D42 L6CZ
637,462,141 *41A4481F2920D346A1D8A8ABF4479BD4BE914539 laagspanning9
637,462,142 *41A21E50411BDBCDF9BB521A609E5821EE8A2782 LANE.JURCZYK
637,462,143 *41A7008DEF7BA7DC6FD65371A7DBD60BD714476B LANNY.HLAD
637,462,144 *41AF53C5471791AD7B62B88BEEE0F2A9E965BECA LARBRE-COMPETITION
637,462,145 *41A6CB0ABE15732B26472794EA52E7283E2FDCD1 laurastagg
637,462,146 *41A28E99FF790E650D3F934F45457C116B400971 LELAND.GRONDAHL
637,462,147 *41A7C3131D0FD235BE86F5F53F4497D953C0ADA2 LEN.STRATMAN
637,462,148 *41ABA1A175940B8E9DEB7FEB476998EE4C5A142C LEONARDO UBAS
637,462,149 *41A5F81EBF23D60A1253EEF6AB9E79F7CD0849EF LEONARD.WILCOXEN
637,462,150 *41AD7524DB3E79DF7E616BE0206ADD8A2D261683 LEOPOLDO.SENST
637,462,151 *41A64572E4C9655223981676E3643C2BAC1CA18C LER\
637,462,152 *41A0F54D0BFE5636638A87BBB19D488A53462915 [email protected]
637,462,153 *41A7F1A1901880FE0CAEC8B6B059E516F1F088B1 LIEBTESES
637,462,154 *41AF830E1A69DA7165D1375395F107FB6BDEF7BC limmie.&.the.family.cooking
637,462,155 *41A1A6F786221149D230004D1B3FEDAA02987B69 [email protected]
637,462,156 *41A0E106486A1D1594F77E54EF5AD23C7561EB85 LINDSEY857
637,462,157 *41A8EE907C1A9579C1E7301A2F1AC4CFCB727F52 LINO.TIJERNIA
637,462,158 *41A6112C658F13BE2A84C5885AF79A0843D5DBAF LINUXKONEESEEN123
637,462,159 *41AD28DF4E2AA96607B3254AE6A638308F0D71AB LISA-RODI
637,462,160 *41A20CA739A5A9B636071DCE28F8746D5BFEFAF6 [email protected]
637,462,161 *41A20538812F27C049AF9516CACDE3E24EACA602 LUCIANOHILLEARY
637,462,162 *41AD64D63FD00CD5B89D59013BA65EB25EB3EAC7 LUKE.KUNISHIGE
637,462,163 *41AA089213CB4E40C86E97EDACDCEB8D6ACF9881 [email protected]
637,462,164 *41AEE79D374ED63B80577AC64E6E221FC80DDD2B MACAUBREACH
637,462,165 *41A9B589A0CA252F182ACADDA759B7D153E759C7 malalignment
637,462,166 *41A825C1155A8C47A5E6234E5B1A25301391EA03 MANTELFIRMA
637,462,167 *41A3CB6C86049050A98D70F152B360E1515212C5 mantoida.brunneriana
637,462,168 *41AD5D37A4F52B4F13397B662D13273FA0C65F5B manualpichon
637,462,169 *41A6668FABAB766BDD9FB5BA48870ADCBE76F21D MANUEL.HASSENPLUG
637,462,170 *41AFCA9C48E2AA22591A4085C652B877948A7A82 MARCELHILLSTROM
637,462,171 *41AD0478B810A1383B6CF6B94CD0C18E2EE00D95 MARCELOAPODOCA
637,462,172 *41AA4CEC5A466DFDA0421BA6494FCFB5C72DFE39 MARCOSITES
637,462,173 *41A31714163D6B57B0D88CBD52B20895D69576D9 mariosmulik
637,462,174 *41A6544292B223E6B0FBDDEDD14048F31B645E96 MARKUS.ROGAS
637,462,175 *41AE80C4906B8D6739E5DBD604B5E6DAB5564708 MARTINADAMOWSKI
637,462,176 *41AA5FB59F1D69CF77DF17B1E2855C81B4865F41 martytrebesch
637,462,177 *41AA332BD3BFE06C64A9299DBEA7AA511A7FE07E mathew.peacock
637,462,178 *41A7D2057C0C615DE4C234ACCF3A6F73127D7D17 MATTHIAS-HARTUNG
637,462,179 *41ACD078EC552C3DBBA1921B37B2F3B2DBA26078 mauricioweigman
637,462,180 *41A98FAC63C88ED6A1F62198CF4C82878A47096E megcarter
637,462,181 *41AB9ECD9E26F5F19922A3C7C4824AF9F57AA1BF METSYSTLAHCSBA
637,462,182 *41A5972B3BCBF6170ADFD96D8938AA22AFE1BFEF MICHI.HOME
637,462,183 *41A5BD3FCC6BB8B53734DE74A9EA5FDEEC7D725B MIDFRONT1
637,462,184 *41AC57F75AAE79F31B751407EE3AD5BED915873B MILLARDBAREMORE
637,462,185 *41A4D4126252C4878455B8144D1BC9A2EC4B0594 millardvathroder
637,462,186 *41A8D7BD76A1E0DB5AA9B5A8DED9560DD749E3B1 MINELADYING
637,462,187 *41AAE22EB752460B03D06A822D6B1987AF19AC15 MONROECUNANAN
637,462,188 *41A239116FAF241D0612967E7D4DAFD883BB882C MOOD'[email protected]ETVIGATORCOM
637,462,189 *41AA524D27F3ADF830EC766EB428B24F8670661F MR.PERSONALITY(UGLYUNDERGROUNDMIX)
637,462,190 *41A002C86371D0513BD5A67F599505A2D0DC2B94 [email protected]
637,462,191 *41AAEB61F1D09D5E4C317919EF32C26DF4536C13 murmurìu
637,462,192 *41AD187C413FE641B2C3232C6094B0DA3119C18D MURRAY.SCHIFFLER
637,462,193 *41A0AD6A484EC8134C2AD72EDF73BF821ACF9AD6 MUSICALU1
637,462,194 *41AB4AF4C2CEF3CCEB8BD1B0036D554FD1FB75FC MYBIN.BBS
637,462,195 *41AC36C5ABB2EE1CD488072EDF1073831F357CB8 [email protected]
637,462,196 *41A917B95B4B56056AD65B9B8D8B4C65E7F936F3 n1ghtclothe$
637,462,197 *41A6B5439D4D97F83009CC5EDC68F5C8C1F9F300 nathanclifford
637,462,198 *41A5CB1FB36A688E46499A7EC204C429467FF160 nathan.l.
637,462,199 *41ADA5A38CC2EA87E8A397D9043EDC5167D66A8A NEALFOUCH
637,462,200 *41A322346914565515F71AD3411159ACD2CEE238 NECESSITARLHO1
637,462,201 *41A90186C8492CE7AC8AB8C88A02311162EB0AFB NELSON.SERENA
637,462,202 *41A086C54D046DE4051C8BDEAEB99DB539FAC94D nicework
637,462,203 *41A26CFE0D92EF1A4830C6C5B0531CB30EC003AC nizhone0
637,462,204 *41ABC63F0AE0518B1DAAE075C08128A02F935C49 n`o]
637,462,205 *41A5AF40E69F60CC22F749896DAE2206600C7BC7 NORMAND.GOELTZ
637,462,206 *41A160F9D99DDF64529634E5CB154F184F44426D NORMANMCDOW
637,462,207 *41AA7688B89FAF0312C291C5E33FB48AD719AF41 NORRIS.LIDDICK
637,462,208 *41AB66FC041F660E516BD35107751DC2BDB4172F not.belong.here.(telmo.a.remix)
637,462,209 *41ABC6E03524EDA0EA8CA495A474E96BEBA20EED NOYCRECED
637,462,210 *41A3ED4BF4210C5C195D34AC72F66747135DD610 nsx
637,462,211 *41A98F0FA0937B83922341A0C7C4B6D858E3E27E (^_~)o~<--3
637,462,212 *41AF4188667E37AC23B31C25B761737E16ED7953 Op46No4F-dur
637,462,213 *41A789844306FBA50E2A001F515B236C04565EDC OPPOSITIONS.2
637,462,214 *41AD32A20CB6FCBB01144064A97B9924D786FC9F OREN.SIGMAN
637,462,215 *41A3F5C7029158181E68437D43C609BB0764F67E organizzaz
637,462,216 *41AE797B1AE19747ED7E25C8E21D9AC96F1DC9FF ottomuros
637,462,217 *41A596DB65D394AB2EEECAB1D6C55341328E6C22 overlook
637,462,218 *41A63A5FD79D7A9E59E2139EBA8CC7EB29A96C1A [email protected]
637,462,219 *41A5EEBCDADCE02185AC9418D6FA16DE97B9E2BA p-d~`)x(
637,462,220 *41AA82DE9CD1BF4FD9B8F5B3C16A6029A8004224 P####D.*.*{x}
637,462,221 *41A8B734BEE247722BD18AAE866D68DE23926985 PEDRODOKER
637,462,222 *41A952B69042FC0CBFBF8BAE3B0BCA335A6A3562 PEDROGNAS
637,462,223 *41A22F87548C4489119435C1D36D03F3405C8E68 PETE.BOERS
637,462,224 *41A91F0DE23332D32746067D135FF944042647FD PETONIC2
637,462,225 *41AF0CC445E2B601208698D65BD497524ABF610B PIETIK1
637,462,226 *41AA3653FFAFF64810208A5849A23D681A1B3446 PLANIRANA-2
637,462,227 *41A1D2C31F89D9EEC76853669BA45A211796FE48 PLANMESSIG
637,462,228 *41A82657F42B0C646F401F36470BCC4657704EAA PN;R
637,462,229 *41A1C7CB5597C49A797D36B8F83506B5A1DF0222 POLICY27.MOMENTO
637,462,230 *41A4DC91CB5BD895CAE06961098D8B8359EAEA62 :po~O~d----B
637,462,231 *41A226042D4E3B9DD54B6A553A1614F86B1F83AE PXTOM
637,462,232 *41A3918ED6F97F62B21E0D3B1291A18940AB3A99 PYYHKEIT6
637,462,233 *41AF7AB05B740EA8F6AA09F1BF1CAE1ECF243473 QHV4QZQJ6SYP5A
637,462,234 *41A216F36FAF30AE474F75357571538AE390CD20 qk&z
637,462,235 *41A274219F6C2F68602C7CAFB825E45FC25B3CD5 (~_^).*.*q=q
637,462,236 *41A9568F135D5D0E88B55B3020B92E2D7FCFB518 QQLYC1314
637,462,237 *41A9FD2A44C2C2388A1C00F53C1406A5E3C8CA84 q>~.`.Splat!
637,462,238 *41ABC7F610511896A4D8BD60111E30502C65D7ED QU4R+Z35
637,462,239 *41A0442465590B276C5D0EB6D02BE59547BE3999 QUESERASED
637,462,240 *41A650C2C2B6D5B7477C49D140194482C45724CF QUINCY.LEBOW
637,462,241 *41A69DB9F12DF209DFE23E96AD94D83CBB5C0DCC rachelhartwick
637,462,242 *41A340C86ECF4AB4866363316F77D6F541D78DE1 RALPH.MINION
637,462,243 *41A1D6A2FC66F472E421A1946B32A3B97974D768 raul-midon-reason-i-stand
637,462,244 *41A697C8FDFD836F81DF1C62709EF008FCA2EF6F REDISTRIBÚCIÓ
637,462,245 *41A7D99F4599418F4CA4BD2B7BF7D183FEAA1E8B REGENERATORERS3
637,462,246 *41A70CCCF4BD9976A56BF22A6B61BCC99EA51BC4 reggiekosinski
637,462,247 *41A7F9C3BF5ED0A24FD91BD8F6C10C87A9CFF6C7 REGONDAR
637,462,248 *41AA3EE2AE47BB3201AFA6729607859D7A26BD33 REIMUEB9
637,462,249 *41A8F555E87B2F814CE771E58DA2D4643A59F610 RENALDOROSENGREN
637,462,250 *41AC6E0B0B5C10EA3C785ABBF3AFEDC746F72F03 RETAWDE
637,462,251 *41ACC12D22563B5A0E1B4C076317EAE1B511EC6E RETUCRAHS
637,462,252 *41AC558A2D1A9FAB1FFBCC4D4C67C10867131CBA REUBENGRANGER
637,462,253 *41AD9D96C95C67DA2FEC573CEF0CCB44CE7AA937 REUTZARES
637,462,254 *41A824A5EC80D69838E3F379D037703783BA278E RHAMNES
637,462,255 *41A7F4A95D5DE68AC240FC18B1D65580F4891DAC RICHARD.KALA
637,462,256 *41A80286BF1428A38EEAF1A59DDE8B2E8223A014 richardurquilla
637,462,257 *41AD94227251E2655EFFC2D824709551EDA73007 ROBERT LIGGINS
637,462,258 *41AF7A94FAF56D2DE42D006CDB6A3AEEF4C14454 robertprosineckiexclusiveinterview
637,462,259 *41A83B715A70595BA1ACDD070D782BC672234261 roderickbourke
637,462,260 *41A475156D9C73B40AA710D0AA8C3356BA229596 rodrigobringham
637,462,261 *41AB8BBAA236688466FD0754CBBA52C1B0A24DE2 rodrigogrimaldo
637,462,262 *41A7D7E484842FEC43E7B7C58DCF09509A22263A ROMAN.UCCIO
637,462,263 *41AF6922C710F399BE7F80BC57B1CD231222FE86 RONNIE.MADAGAN
637,462,264 *41AAA8F86A9A6471A377A731B4B8A95A32057917 ROOSTER60
637,462,265 *41ADE14D316FD833CAF1698700C4E35147F26AFE ROSSCO15
637,462,266 *41AD889ED2CD3254F5E142B8422AF18E7D6F8591 ROSS WORCESTER
637,462,267 *41A2EBE601EC1084B35E9FFF757B2D9B89F25BA1 ROXYBOOBOO9
637,462,268 *41AFD0F298D54B2477260AA67131ABC6BCCF986D [email protected]
637,462,269 *41AEA445CDEE95DE6241F4F789107D19525FAAD1 [email protected],
637,462,270 *41AF2CFF564AA6D52280638E1B8D63CF1FCE5F85 SALLY-DAY
637,462,271 *41A153BB9DF4E3E49DE64B6EE85E18CDADAD4A70 SALTIONING
637,462,272 *41AF8740889D7B9DD4CAE475CCBDEC954C611D46 samualleathers
637,462,273 *41A144431B731F3962E3DB05A42DBEB88E196DA1 sanctus:-23-praefatio:-gewissheit
637,462,274 *41A4F4951164DFBA7BE038A475A1FDD8F3505C9E SANTIAGO.VAQUEZ
637,462,275 *41A1E508D4DAB21DF9050FB1D3C340C63FC6D60E SARA.ALHARIRI
637,462,276 *41A1B6B3FFD08821C67F899AA4E145B41F2C3D15 SCARLETDOGGIE4
637,462,277 *41A52247F801AD294E40B077D46457E03EB2AEF8 schurftachtig!
637,462,278 *41A4EC1E3B3ACCCCE4203AF410669E42D19696B7 SDRIVING3
637,462,279 *41AEEE46164CB8DE4F42A84B0A429CF51FF2C3A1 secourent
637,462,280 *41AED697F14E7F7ECCB072325287EF2D30A1A7B0 [email protected]
637,462,281 *41A97937D8D2EA10E8646A9AFB932D88BDFCEC52 SHIRLEY.KRACK
637,462,282 *41AA2C20B713A83A07ECDD651814B0D1274E41F1 SHIRLEY RUIZ
637,462,283 *41AD0BBC8EA711F3747BF70C651A881220B94F9A SHIVA-KUMAR-S-P
637,462,284 *41A2588ACAF57F0B7F877C42E1A3456E7D2F7B27 SHOWBAND9
637,462,285 *41A357C6554B2835F0927D2F45F5C30A2C1ADF52 SHOWEDDEWOHS3
637,462,286 *41A014A087EC956953325AF8406E13F6689AB8C8 [email protected]
637,462,287 *41ADD9E39F753FC96F0FEB06208AEA0BA9FA303A siamgold8992
637,462,288 *41ABAC4A260FA78160243268E32551D2C81B9BD1 SIJURD
637,462,289 *41AF7EE20F2AE3A1976BF688D44338E36B13B637 sim.lee.leng
637,462,290 *41A14D6F35FF57E3660C20F2B532D80A7665932B SINCAM
637,462,291 *41AAAE879E4117245D2D6D3FE1A65881BD6D3130 [email protected]
637,462,292 *41AB87E0AA7913DE2E5D7FC3B54676DD68B6C4EA skylarki8
637,462,293 *41A6956F8500CB522DFB2B37C9735A33E5765EBF SNEETTIE4
637,462,294 *41A63CD58B8BE7FA901E5185CB0200BB0960369A SNERACSOFNE
637,462,295 *41A1F174B6C24454DAE3799AB00F1A202E4F7B73 [email protected]
637,462,296 *41A637AB66E6AB1E706F6D3BC2028D6B64386BDE sonneborn1
637,462,297 *41A363C8F4426A8C23C22FFC4E7DF47377F3A7FC soothles3
637,462,298 *41A07C844D3A88DCCB7F79BFAA680155BAF0D74B srednilic
637,462,299 *41A0D87BF9368C6BE9566234BDFAF2B64845F043 STACY.HALONEN
637,462,300 *41ABD32C22FF558CD4D7828F464B2BF7C05CB45C stephanie.disch
637,462,301 *41A5C6D5DA1B2239CA2446788B840172AC7D948E STEPHANIE KINNE
637,462,302 *41ABD8F523B871F784352DF45CA043A6E39D59B0 STOPPERSPILLENED
637,462,303 *41A342DD0E1B9F1E8A2CDB6692366CE89F6DD9C5 STORMMONSTER3
637,462,304 *41A099609220552459AD0261412FB4DD96EA4B72 STRNGYLS3
637,462,305 *41A91035A668F60A975FDBE3CDC4ACB96A987C8B STSIDIELKATCODOSIM
637,462,306 *41A1AC13F4E5CE8B616ADB33DF7E8FA662023822 STUBS-BY-THE-EXTREME
637,462,307 *41A536AF5D9E5EA36FF829A4D82CB0E82A667DE0 SUBSIDIZER5
637,462,308 *41AD5D4312F67749B3891154688A16E5A71C0A71 [email protected]
637,462,309 *41A0DDE172470266E32EB1C016E7A68944AD38B1 superbthere
637,462,310 *41AE3913C2EF72A74B66D797C8997FB1FAA64524 SUPEREIGHT(FEAT.PETERKREUTZER)
637,462,311 *41A6B15F232FDE70BCAE0D8FE36D9C7ECBAE03C3 [email protected]
637,462,312 *41A180D4A906CB09EDAF3A4BFB42B54F88B1F622 [email protected]
637,462,313 *41AF5085EADA70FC91A9A348C75F3E1CAD921162 SURVENED4
637,462,314 *41A2237C550E164C30581A55DE02A379C99BDCC2 [email protected]@ble
637,462,315 *41AFD44B8BB6FC71C99EAD3CF16C37E4B1A2C772 T4G4R3L45T3
637,462,316 *41ACE0150A6C32F39379F212EC1DDCA657C1A2A0 t4pp1ng$
637,462,317 *41A68F0B7239B5CFECB56493E7735EB63DABC76B TALKMAJORPAYNE27
637,462,318 *41A4107EBE763D53341937BD7EDE72F7CA817379 TALKSTORYI"MICHAELJACKSONONUKULELE?"
637,462,319 *41ACD4E4BF894D8BB41B7ED3DE96C36B2698A569 TAMATAAU
637,462,320 *41AB14DD916B946B9A7AB3355ACF44EEC67CE80E TAMEKIA BOBBSEMPLE
637,462,321 *41A0919B9FDDADE975F54C9019F8252CEA0813D5 tang-quy
637,462,322 *41A03A5A1470BD26F55CEBC70D73EE69584FD9B8 TATIAANA6
637,462,323 *41AED4714457DF869A59E6E43396165CDD2F76AA TAYLOR.HANDRICK
637,462,324 *41AC6345334660FB8F00440F54AA186F501CD589 TAYLOR.TIMPONE
637,462,325 *41A2D5091B93B7120595D8571F1914C4A9C4A765 tedhawn
637,462,326 *41A33C480F8475E2F3626476758119216F04EEA8 TELECOM|
637,462,327 *41A8726AE4BC3A1AD6E4AC614CCBCB395C623CE8 TFACIL
637,462,328 *41A23945B8406D4D259451283E8C77215AE1B090 THEBIGBOSS1991
637,462,329 *41A0456EAB6A0C240156A561CCF04D0BE2FA2045 The.Blue.Spotted.Frog.(Will.Weg's.Spaceship.Bound.for.Miami.mix)
637,462,330 *41A9C0692D83901F698559D549FC37A1B044E8C9 THEBREAKDOWN
637,462,331 *41A1A2F80493DB776646C8E9D92AF24CA000BC93 THE-FUTURE-OF-HOUSE-2001
637,462,332 *41A62E23712364E05588B8AA5DCF1206F0BB5C11 thegrumpy49
637,462,333 *41ADFF9FC73A5E4D4ADA3A52FD38FE02ECA46607 THE-ROUGH-GUIDE-TO-TURKISH-CAF
637,462,334 *41ACAE7ADE057DD891E5D8E86E176221E232E58C THICK87
637,462,335 *41A425E4759BAC75A5C63B78154F27ADC64A6C8C THUTAIG9
637,462,336 *41A5E3B92B9E9658A4A4F7A4F24FE2E8310B5DE9 [email protected]
637,462,337 *41AEC00CB73D9C4B03168DAF929E8F6BC7980869 tinpanal
637,462,338 *41AE09151363B9F1035079B285DEDFD54C45DA5A TODDSTEUSSIE
637,462,339 *41A220B6AE7C9A3C16250094CB2429263EDE60F1 tracy.painter.purser
637,462,340 *41A0FD582C568E176AB595A48DB6FC22AEC5CEC7 TRAVISEHRISMAN
637,462,341 *41A584CE7C17321CD1477FDBA53B212C07F74C9C TRAVIS.RAUSCHENBERG
637,462,342 *41ADA0298ACC160E3B767CA53DF8B684F9A58842 TREYDAVIDOWICZ
637,462,343 *41A28C4D8BDDF455BE3CDFEDCF29C63A666C1AC8 TREYMEACHAM
637,462,344 *41A93FF28EB645C3E34A5981D8C20A8CA9C92B46 TURNSTAKE8
637,462,345 *41A8F25BA8915D4A7F82DE01E5CE7113BEA8D670 TWEEKROONBLADIGING
637,462,346 *41A0BE8F97DDC86B2ECA88521C4F2A7F77B64F88 tyronyawn
637,462,347 *41A96B37F7DDF87EFE17B98DA18E6C13A0172C4B ua][
637,462,348 *41A7166D82C9F8198CE9BE15439D5FC0306304C4 [email protected]
637,462,349 *41AA618C0C080EFDD77D43D9EB4E71DBE069F477 UITBENENED
637,462,350 *41A0A687AAAF3E95572A314B51C4B0CE17543BB5 UK19414521659
637,462,351 *41AD3E29B1A116391E48C6E5FD12ECBDFE3A6E5A ULKOMAIDEN8
637,462,352 *41ACFC34E104893B25C227916DAEA67269A9D6F5 ULLA SKJODT
637,462,353 *41A9B13AF0F83F4167151DFDD5B3C206BD2AC136 umer-shoaib
637,462,354 *41A23051D1B69AF8102A00A268F122845CB47486 unblurred5
637,462,355 *41AF00646E73CE9CA1D639D893438F43E35353DC unh3$i7a7ing
637,462,356 *41A57629D4A8750B9D0252533796DEBA1328CDA1 UNPARTIALLY?
637,462,357 *41A59B8FE37CA96B19A314C7136E40305556D232 up-in-the-place-(feat.-xanadu)
637,462,358 *41A9687C314772F2684C4F7BCB9A6AC4921DEEC9 USERGODZILLA
637,462,359 *41A784E23E5A75B760E5C7A7FFEA82A176358122 uurglazen5
637,462,360 *41A6F4D988F49D901AB0EC1EB60674062DDA3A0A V285419
637,462,361 *41A11A23E92B914A0850C4B8D7B3CDA561E62FB1 valeriagmartinez
637,462,362 *41A67C288E21DBBDC95FA3476D2327EB80219EE0 valleymoons(b)
637,462,363 *41A91130ADE2C988969AC3A03BA854F608150BA6 vattenpumpar
637,462,364 *41AF63D9763E1D544DCC878E5B802496E3A850DE Vertigo-of-Vision
637,462,365 *41A8AD330C2EE9BC6E92CCFBED0B507A06918AC0 VERWELDIGENS2
637,462,366 *41A1BA4839DD3E8AF7E10006EBDF1A5643498899 VESÎRANGLA
637,462,367 *41A994E7A88360F8F1059CD6430C8E9DAAFEE908 VICBRATS
637,462,368 *41A23B5F00059AD9102C08128D95E3118F4D3CFA VICENTEGIESY
637,462,369 *41A586452E65879001E38A43D638BCE119E59D93 VICENTININICOLETTA
637,462,370 *41A738EAEB2ACF6C0D58D242B35B36C151131A10 VICTORMNIEVES
637,462,371 *41A705434D7870B539BD841A78C5B61B8E1284C4 vidisha.lavate
637,462,372 *41A1A44BCFAC26AF56D435E67A13782DEF59CA18 VILECON
637,462,373 *41A0CD183758578A3D643CC0863A0F2B40325570 VINCEROYBARBIRAN
637,462,374 *41A917574F23B864E91D123D6086762DB3F69971 VINCYPARKER
637,462,375 *41A90D5CD59FF1B8645450E73F9707C154203444 VITO.JANOWICZ
637,462,376 *41AE4D6DEC6AFD16379B0D6D527555C2FE1EA83F VOICUHOLUB
637,462,377 *41AB7382A2D99580CA091D92DDBD21BA71386FF2 VOLANDEZ
637,462,378 *41AB5E154F7BE4DBC3C94A3B5DCF907994D537A2 VRIDNINGIVING
637,462,379 *41AD8CBFF2E86CC916409E63F99C3ECF8F6263C9 VRWRNGNGN4
637,462,380 *41A9D8F83B9C5989BFBED86775D1123009F787C7 W2D/
637,462,381 *41ACF443EC02A0B21398CE696F728216ADC3E3A4 WALEY24
637,462,382 *41AA307D44E768F971B8B4BD6D0D4505FEAA8DE9 walloped
637,462,383 *41AC043E7146E94EFDE783394138762516B17CC0 [email protected]
637,462,384 *41A8F901E742F0779770A641B423D37F61A725DD [email protected]
637,462,385 *41AE9B64C5DED34AECE15BD2C13AE126D7077DD1 [email protected]
637,462,386 *41A3C5ACB10664FD01398CE601BF3C05FAA97304 WAYNE.POLLICK
637,462,387 *41A798920DB6DE0009183A4BEB0E3C377304E8CD WAYNE SHRAL
637,462,388 *41A6C2A1CEB3C27BB6DDC95913553CD4C95DC6B6 wdy-mutz
637,462,389 *41AA99BA1B2CA85E2FCD1568A097EF3C04A3FB07 welcome06
637,462,390 *41A213D9EA3E0192AA906D02E1AD235101705691 WH1LLAL00
637,462,391 *41A6FBFA6C8C319F334D5A88FA09846634B3EA02 WHIRLLIKEADERVISH
637,462,392 *41A60C3AFF82E91B8BA009A473F305086AF7F55F WILLIAMEZZELL
637,462,393 *41A5635ABB75D3F3354F1E2E7118332C7659E24C WILL.MASSAAD
637,462,394 *41AB25FF79E0F731417883A603249257EF2CCE36 windsurf2007
637,462,395 *41ADF4DD683EEED175044E2BDD6A62C9EE3A0DD7 WM.GLASCOTT
637,462,396 *41AA0ED363813F44C9615E151F174A286D7922C1 [email protected]x3redestbes
637,462,397 *41A7C6F13E32473BFDC852C268D5875BAD77848C WOODROW.GITCHELL
637,462,398 *41A525CEDB65EC584F38F8BACAFC1DFC349368A8 [email protected]
637,462,399 *41A13619A9B98DDDCEBDD1482DA4844D126CC246 WRITENG9
637,462,400 *41A3076327B4FB6852DFA76000A879B057CE4694 [email protected]
637,462,401 *41A7A98EB5FB0832EE6D4DAC40312A188576276F WURZELKNOLLE
637,462,402 *41A6E6B1F508235057B6CFA6FA13A58C4F67BD69 WWWENDOCYTOSISORG
637,462,403 *41A5AC1BFCFD77FA9CB9E3372B1E73E122B146CB XAVIER.BIONDI
637,462,404 *41A8B5AA781CDCE387B57288324196E307F489CA [email protected]
637,462,405 *41A34CADEC7B3A690A5A06573118657E75EB62DA [email protected]
637,462,406 *41AF6E87F4238F3F30CA59146212B8B30B5A1359 [email protected]
637,462,407 *41AA855A4133952EFE3F08F2D149BBECCB532653 [email protected]
637,462,408 *41AE70EA363E682E4BA558442AA5C7DEBC7D728D [email protected]
637,462,409 *41A7ADA0A3B9733F1EFF57B3FF27ECF1E54BE99F [email protected]
637,462,410 *41AFBACAF77515C34862629022FB4C6BDB974131 xuluoyin
637,462,411 *41AEB0810AF1D6719E686EBD348DBCE4270B3304 Y%)+
637,462,412 *41AC8FB9CC1B7460CAD0FC2ABA257665AC45FB5A y,1a
637,462,413 *41A5D915BE3C9CB7043C132FE998891A6BED12B7 yatienesquienteplanche
637,462,414 *41AD5B410D5F65324161D37E81D004D5891EE413 YHPARGOCNIZOTOHPPING
637,462,415 *41A5DB8434A140548E93ED6EA73B39FC4BE1819C YHTYNEEN
637,462,416 *41A0D63D776834D6FC18FC10419FD47900A4F425 YKNAPSREHPOT
637,462,417 *41A4C1B11E33A279BEE80A0BABB693547DE9F8A9 YNEDWOLLAILS
637,462,418 *41ACF5417840154DE16F5AB98030F82B807B7AAA YONGBRONSON
637,462,419 *41ABDD5B36F9D55BC60E7C961754D298375A6240 You're-Not-Worth-It
637,462,420 *41A5DEC512FB9091029284E7325109E2F6ABC6A3 YUEN.CHEUNG.TUNG
637,462,421 *41A91E80F2E0FBB1648F451BC585F1704EFA4AD4 yugteduag
637,462,422 *41A165FBFBB3BD3A478439BA05B64CD50363AE79 zabihullah-noori
637,462,423 *41A5E64DA9B04B39F4FEDC3A835B6547F7357DC5 zachary.cary.paul
637,462,424 *41A0060540F7C443D3B97607E67446768CE416D5 ZAINUDDIN.MISWAN
637,462,425 *41AC492963E41A5AAC77333DAEDAF92BC221D541 ZAKARIACHOBAH
637,462,426 *41A15C9D5A7077D7A4F957A81EA6F381253F5D18 ZEITMASZE:TAKT208
637,462,427 *41AC26EE03E8648EF9790EBE8939C24530049656 [email protected]
637,462,428 *41A100907F2967854A06F7EC5FE817604E5CC313 ZIARE.ANDDEE
637,462,429 *41A2A826F7CE97FB0FDAC7CDD3838F5F9FC97192 ZIGEUNERKAMPEN1
637,462,430 *41AA328060F1C8F22DD29041383BF89010E86152 [email protected]
637,462,431 *41A598CB28CF0CAC2244D1787B59FFC86204DB87 [email protected]
637,462,432 *41A0237FBA7F9115478CE75140D7DF6A6B1F3126 zuidpoolgebieden6
637,462,433 *41A97F498ED36E432314D4FA989DAD023096B9FF νεκροθάφτης
637,462,434 *41A9B08D24C9C80B111B74E5D6B098863A21DABE БЕРКОВИЧЕ
637,462,435 *41A5976AD1B845C08727E76BBBE11D1C88B51004 ДРЯВКІН
637,462,436 *41A6DF277230508B2B9E7DA90511048D142B8D31 ПРЕДИЗВИЙКВАЙКИ
637,462,437 *41A3B88DB1212BB568B6A2196485416660AA9539 ПРОПИХИВАНИИ
637,462,438 *41AA64EB6B6762BB7BE48246D2BCE4C7A6DAD5A1 ТРІНКОМАЛІ
637,462,439 *41A0069982EF0BCFAF50E6967EAD68D68A361BEF 04101158
637,462,440 *41A718136E73821941F02A8B2DAED962BE16009A 100KBSEC.
637,462,441 *41A4FC37937BC651427D4AA3BABF34B5BC4C9BB2 10TESTAMENTTILAHJOITUS
637,462,442 *41A31F934C6AA4C7B393C0364F54F47068B72D6F 1109344 siksi-on-t
637,462,443 *41A1B75B4DD77DE53C0A0E3E3CBD240BE16308C3 1198675 amabenddieses25maerzfuhrernachneapelzurueck
637,462,444 *41A217C066123C76078FA1D8B3FE31A6282FE7DF 127453 hakija perustelee hakemustaan suullisesti sill
637,462,445 *41A857979ADAE9CCE76188B6588175D617612D0F 1377187 preussag.wird.expo-partner.
637,462,446 *41AC90D9593F916AD0A44B453753F4ADC0B33E7A 1659621 VIILATUT-REI
637,462,447 *41A46B8AD10BF680DCC922FADBB137D55CD8C733 1710198 uutisryhmien.lukeminen.onnistuu.ilman.s
637,462,448 *41A578E665B4B6C69460207DE7F99FE57F3EDC25 1809772 STOIBER IM KABINETT MERKEL ?
637,462,449 *41A31E66ED3540AA72AD5DDF36B5156E7625E6C9 1907848 ANNETAAN VALMIUDET OSALLISTUA V . 2002 / 2003 PIDETT
637,462,450 *41AB9E60F6B48F3FA02DD85DB2A40AAE40E20863 1.bildergallerie
637,462,451 *41A05AC6FC875A12AC6179A5D23485357F289016 1.BLOOMQUiST
637,462,452 *41A8104D97AEAD8CEBC110A8D407AEFB3A2E53D6 1DOORNAPP
637,462,453 *41A854CFD3032C1861D508DB661408D656258379 1 duramazdi
637,462,454 *41AE3FA9572EEC6970866511450CD7E49BA4F6DA 1e01865b5eb737dd0080e697051c1389-fuzzy_peach
637,462,455 *41AE932C4E7EF73B5B3F3DE11EEB81882D371C88 1EPHFROM
637,462,456 *41A8D316710E8BF7F6FA2BC34C3C4CAA558AA249 1.hb-rolls
637,462,457 *41AB20C9155A407A4157EA19E6D65A55708244CE 1IRTAUTUMISP
637,462,458 *41A35410ED843E3F71B4EACB885FE9E709626755 1italiaoe
637,462,459 *41A437E24BF19E65D5FE461E8E21EFC90A8894AF 1 IXOS-MOBILE
637,462,460 *41ABCB62381240D8ABC30E935F6F991723277875 1kauppiastunnusten
637,462,461 *41A1E83A6AEDF200014174CB2DFE8DAA093E88B7 1-KEHLKOPFFORSCHERS
637,462,462 *41A8906D7262F1413904AA9FD7959F1BBC43C35B 1kuhlken
637,462,463 *41AA597D6B3343EFD1B4AC87EDDC44927A9D7B50 1.partyclique
637,462,464 *41A33A7FAB9C45D9D562859FDDADBE3F2731435C 1reivaajille
637,462,465 *41A42E1A7C7F1EA89CC9E05E673374F2A2DEB69F 1-SAMANTASOISELLA
637,462,466 *41A33FE9559FD3F7367F4E042EE04972D4EC8DF8 1.seinewasser
637,462,467 *41ABDF161D5BEF8A62B495B11A0350A8C36D1F4C 1-seksuaalipolitiikasta
637,462,468 *41AA31D5915D1F837488D8A6A225F462E9F8E938 1-sektionsantrag
637,462,469 *41A17794718D32D26298A7EB330ADC6FD10AB73E 1-serbet
637,462,470 *41ABB9F0FC5603B27A8974B8CDFBFC27247B5241 1SPLEENR
637,462,471 *41AFFFFADCEAA34F3D76E507FC012EB8BF644720 1.SUBLETY
637,462,472 *41A405F3F746C94DFFFBC6290899084A94293921 1ZMBAA
637,462,473 *41A6DF044F9BBF3C160474CA12FF2EE14C04CC35 21021111
637,462,474 *41A0BD015911C052CDF6ACBE79FBCEFC4C0831FC 2.3LEVELOFDETAILOFDESIGNDOCUMENTATION
637,462,475 *41AFBCF57F45717DC5D3E12344205541F2C00BE2 2467017 but-now-,-the-neighborhood-is-changed-100-percent-
637,462,476 *41A4E16A1CA4B91677144FF2B106AA292E824891 2707304 AUCH.DIE.RESERVE.DES.FC.SACHSEN.FEIERTE.EINEN.SIEG..
637,462,477 *41A1996B69DD4A0EAEE8BBE5B84345D34245D08B 275618 PIHAALUEELLA.SIJAITSEE.L
637,462,478 *41A371444586AC323ACD76BD7CDFDABEAAB1D164 2798146 opetuksen tavoitteena on ennen muuta kehitt
637,462,479 *41AACF3915F7718F4B742415ACD5A5523C6A94DD 2800315 HRAWI.HAS.MADE.TEMPORARY.HEADQUARTERS.AT.THE.HOTEL..
637,462,480 *41AF38BCA2EBD830490E73F1D2C87F2D69CD1B0C 2965760 sowasheisstdannfernsehgeschichteschreiben.
637,462,481 *41AA8A08FD9C429B74016DEE7FB577215216A64B 2EWARDIA
637,462,482 *41A58DAFBF99F08EA0FB5C562394FC5ACD60BC76 2GEFAEHRL
637,462,483 *41A09D4D7BE523A4B80EF6009D2D8609FED657CC 2GEORGKRIEDTEHAUS
637,462,484 *41A1151425DC1D745447EF121F94498EEE06354A 2ILUVSARAH10
637,462,485 *41A2C21912AB290A0D117D58E73AAE259E01BE35 2INIFNOCS
637,462,486 *41A2398CFB58D81BA1C407089E55358750A62F7C 2INTONIERTEM
637,462,487 *41A8AB126A42B0F378EC67D65520286471836210 2MYFLIP2
637,462,488 *41AEC981ECD24C2592859814CDCA879A19F89072 2OPELBIGBAND
637,462,489 *41A74DA1A134D70C1040E30CFCABA51F78AE9CCC 2PALVELUASUNTOLAN
637,462,490 *41A57D4320FDA1FAEC530426E4C40A4E347324D5 2 SHOWHOUSE
637,462,491 *41A136E4DF44DEC593A17F4BC35F1ABBDB9C1BB2 2-sloganlarimiz
637,462,492 *41A9C276D075D3C5E44D4F1B727E286109FF5BF1 2-TIEDONANTAJA-LEHDEN
637,462,493 *41AC1D5B1802CB2824B8BB9AB8B895C128517E69 2WENCZEL
637,462,494 *41A054AE1BACC77C371AC65569D07D2DF9BFB38E 2ZERICRUD
637,462,495 *41AEE54D23AEA23E48E42E10EA23C6A0FE53D2EF 331321 Exportation to Multilevel Devices
637,462,496 *41AD83B21B06895FFFE08FC5CD16B575E5280957 373976 HAVAITUISTA.VAHINGOISTA.,.HUOMATTAVASTA.EP
637,462,497 *41A15AD814E412468DECDE7E46B7F3CA275E7F54 384936 universitede-uzmanlasma-var-,-orda-olmali-zaten-.
637,462,498 *41ACA131F872C358DA6C78EC9DF03E90AECC9FBF 3AFTHGIRB
637,462,499 *41A8CC61062630508C473FFC4E547F59BC64B2CA 3ANOSHORING
637,462,500 *41A08017A1427F7F43A3D6AD7F70A5E641C19756 3b<o~0~.d#q
637,462,501 *41A39603FAA63E950F1A9508912B6D83F1FE29DF 3=====b~~~splat
637,462,502 *41A00AB72B4EDFDDB1CD0CCFF6BD6C971203C0E8 3-COM-UNTERNEHMEN
637,462,503 *41A5EB192DC722862CDC3D95FCA078010F4A88F5 3gemeindewald
637,462,504 *41AA4499AFE823D5430C73F52B7DAEF3D6778743 3july1203
637,462,505 *41A00274D728130497754656071EB27DB2C4FC8E 3NMRGNTD
637,462,506 *41ACEF7F004FB8EE0D2B7C81E375B11F99D3FA90 3P1GASTR1CAL
637,462,507 *41A6E5A0E1AC3454070318C4D5A055158B847412 3.SEMPiER
637,462,508 *41A9DCCE527575F5B003CA3196B144FF7BE9AFF6 428JUNIOR
637,462,509 *41A6DE3DA773534E02F706DB969C14DC36C789BD 4ASDFBINGO
637,462,510 *41AC67156EFFB8D8EAFFCF5CF4C576FB5FC48C54 4FUAKHCAN
637,462,511 *41A12414442FBE10C3DF91F78494CC4E36592418 4-GRAVEL
637,462,512 *41A285E994FF2C72533031BAEDB7C64EE3F91979 4ICONSYS
637,462,513 *41A701CB218D1E1514132448A2AA3A7704B53367 4MAY1405
637,462,514 *41A2DE2118274A001467F127C8CC64EAACAB32F4 4RT4BU5
637,462,515 *41AC39262479BCCCA99EA3AB8198456C3960BF41 507018 SYKSY-TUO-MUKANAAN-MONIA-VALINTOJA-
637,462,516 *41ABDAF06DE548A2357048DD10F5430A3EF07DBC 572WESTON
637,462,517 *41AB946DD910B78234584DFF187FFF4380665994 5BSWWRITEDOWNS
637,462,518 *41A8475A4C4DF93B0C44F6BD81BC67BF17C37DDB 5DEBBIEHOLLY
637,462,519 *41AE41B8564C73C73ADBEF013735AB9117861125 5DIOCIMA
637,462,520 *41A29233511B24F69F1354496CEC113DF3972612 5ESTRIASES
637,462,521 *41AA3300E6CD95F1F8691FADF450BCE7F315C1A1 5kermit1
637,462,522 *41AD5C0D5624377E86259E23A6302002875D1A4B 5NEKERPST
637,462,523 *41A37F8279E319D145C3FCC6D026762427555C33 5OPR455EDE
637,462,524 *41A408244E58D6C317928546DFC9E90EC10EDC00 5PLEASEPLEASE
637,462,525 *41A1B8A45FD0BA1EB2EF049DBBF8A8C20EE6D581 5SNORUGUANI
637,462,526 *41A3BAECF794A958BCE9B56575550CA4B1ADFBB1 5STAHLER
637,462,527 *41AA5D235393E1D1FB13582DC93D82F9CBC2D526 5STEUERKNPPELS
637,462,528 *41ABF582CE01C0096AB75194A209A34BA6EA7DCC 5SUBORDINARAS
637,462,529 *41AFF63CE2ADE6E899671CF8DC88004B68E25C54 5svanholm
637,462,530 *41AE187449B466643FF7B422F63DBF54FFAE4BA7 5WINTERPMC
637,462,531 *41ACC13C6FC37A57F0A85C7DAC1D617A5BB47166 699939 palkintomy
637,462,532 *41A6C93B728969EB704C130065BC075AF3FD9F87 6ATTORBSW
637,462,533 *41AF04A9294E04116FDD18BCBEE11EB0ACA22097 6BSWTHOMICBSW
637,462,534 *41A9FD6103240E9B36DCC998B2B20CF1F806249B 6CHAMPSMADDOCK
637,462,535 *41AD822AC69C563CF263B178B43681A39A7D0361 6COTYSCOTYS
637,462,536 *41AF82C13A59AB3C50B4F8CA60A954011367E5F1 6HOCIQUEN
637,462,537 *41A5C466F0915BC826907F2D4636DD1FC869FA5F 6ILOVEBROTHER3
637,462,538 *41A4FF49A19CA9FA290AA9ED427B62C18865B566 6MYCUPCAKE3
637,462,539 *41AED578E886101749164E3E6C086BBA6E2F8C68 6ROSECYRANO
637,462,540 *41A3E887C9E9796F10BFFD929B055D458208ED56 734330 PJ KERTOI NUVA:N ENSI VUODEN BUDJETISTA 3.2 . 1 .
637,462,541 *41A1AF47DE3B6EE7B225B46B2E14C982CFAC996D 7AMBIVALENCESES
637,462,542 *41A65EF7D42461B2EE08DBD58DCC3294ED949000 7CACHOPIN
637,462,543 *41A25C5C529CAA72C463082AA529550A3765AF8D 7ELIZABETPASSION
637,462,544 *41ADFC0788170886AE61BD9FB20A2EB813E3DA17 7FOXTROTPASCAL
637,462,545 *41AFC77F00D36728913E6F6FB2E3A4E7AAA68C93 7MARDOCHEE
637,462,546 *41A4D5735DF863817D9F602EA872D53177385671 7MBHJJMFTX
637,462,547 *41A951CDDAB86DD350FF422092BD1D446634F738 7PURPLECASTLE
637,462,548 *41AA781BD876E294D260ACA06619FF037695E8F1 7QWERTYJKM
637,462,549 *41A1B8D7FC44279027C190B7829EEDB5117D209A 7RDERERANTRIEBS
637,462,550 *41ADDF7BAF63E54867570C721296B4216515DE45 7RN5L7BL
637,462,551 *41A87B20CD3CF43E62D833C4154183BE96C4A953 7-S
637,462,552 *41A8A746ADA41F9AE64FC679A9EC66BB303FF999 7.STADTRATSMITGLIED
637,462,553 *41A38AA17EA8B5F264768F6992B64EE2309404FA [email protected]$7
637,462,554 *41AD80D2F91484281E701AE311762A4B21D9F63F )8(0~<##p
637,462,555 *41A69865B64014DEBA43301D8055D6BB33856DB6 85ELIAN
637,462,556 *41ACC749889C2FD02867C18AC2AB0A288900A790 88373b3ded84b5501ed0fe5e398ef83d.m7svasih
637,462,557 *41ADE7990D9BE5C3DFE9B311CFEE55921949FED7 8ABHYUTTHITE
637,462,558 *41A9521B2F4848DAC83997A3947F635F52A1D138 8BESCHUTZ
637,462,559 *41AD88C89D8D2B96F80D9CD82585E62C6C6E36D9 8CLRNNRZ
637,462,560 *41A0E96EA03D9080C2A8F883C9BCA6B4B4BC5399 8D~O.}X{
637,462,561 *41A9840F0E9A34753F952DF832F17B56441DDED3 8ERLOSCHENER
637,462,562 *41A0A20786278A50D6A5EED201B022FA386399CD 8ESIRALOPED
637,462,563 *41A139CBC839AA353D513F651EBF8AC7D08D0C75 8HESEESSOMETHING
637,462,564 *41ACF8D559CDB3B7ECA2BBF221A08A19B0E2D3CB 8.KINDERJAHREN
637,462,565 *41A9DF8A42B4BA3BEEE82A2D634D4B3E65574D82 8MONCDONIO
637,462,566 *41AC11C03514357A4E004A56551CEF307EAB0FE3 [email protected]
637,462,567 *41AAEBADCE5B8D1692C2AFED7E05A884AFCF57CA 8splodgy
637,462,568 *41A8E2FB4ADD56BCB11AB60B7BA6D2BE4BA22C45 965catherine
637,462,569 *41A1E05851A32F518036C1E10E1549B5CA1C9B2D 988juliana
637,462,570 *41AA02FDD0D2ABBBC3C6383475ED61EA61C0BDE6 9BSPLADSERNE
637,462,571 *41AC850F5FC884E7176623E0B9DC9BB7141C5E8C 9COANGELICAL
637,462,572 *41AB92200538815BE6AF2EB99542F3B88972C933 9GECKOESES
637,462,573 *41AEF704861CA4301368B31C378BE61F70D2858B 9ICALGNON
637,462,574 *41AFDE1E6B8892E9796B58F3EC7EADC5C6037A12 9PRINCELEE
637,462,575 *41AE92618C59708DFC8EDF1309D1F40FD675C256 9ROSESJENSEN
637,462,576 *41A7C13AF27A0BFAF18E3DDC2D93CC7FA8D9A2E5 9SEMIVISIBILITIES
637,462,577 *41A6E6867D8BF071DF89D6365C362DADC16E3004 9TAURUSBILLY
637,462,578 *41A575F189F1FF58DC7594B721F580A49C3BED8D 9TECHNILOGIX
637,462,579 *41A9048FC280B5000077722D46E7B7763E311CC4 a0-0!
637,462,580 *41A07CCED5C5C4E4BEFFADF8D5C604F9A47CDAEA a&0c,
637,462,581 *41A1DA541C1CDAB02C449A251D7BB11255915035 A0D%Z
637,462,582 *41A09AAD10D8D6BDC1BAB9EB14697124E084D62F a8lnr
637,462,583 *41A4FF407169EFA06B097595202A3F9C61B3B8BE aaa6^r
637,462,584 *41AB617FDD8EDEE31B8EB33FD923364873118E18 abns]
637,462,585 *41A7F8958B2CF39E207F1D3245A8CF8619AD6119 ADAMTOPHAM
637,462,586 *41A5906D98A666E9487A8F09C6D2AF1E4C78F7D9 addifa’
637,462,587 *41A351B4EC72B5A6C286A5FC2F890F67E21ACB56 adenuga.temitope
637,462,588 *41AE3AD8229AF1C41D40F84BD992579A6827AE7B adi-groho
637,462,589 *41A99561DCBDB1768A7137983742BE99F0B3C20F ADK
637,462,590 *41A8C652891B05AC2AD8CBDD77889A1113A45493 ahtesham-uddin
637,462,591 *41AFD26BA4EF04EF9257487B1D0262BA7BA2A392 AI=4V
637,462,592 *41A35D1EA45A90C8E6DD608D540FDEC84D404CAF akbhq
637,462,593 *41AA4FFB717E5910A6A92053A0211DB664048986 AKTIIVIT8
637,462,594 *41A2467923CDB7430062B555D3BC9273459D54A5 al4mc
637,462,595 *41A986B269B0112B621B11E64C8787E144F48F83 al8sq
637,462,596 *41A252013884840B6603128ED484C19EB1476B66 ALAN.AMATO
637,462,597 *41AAAC3B3B2C50DB51B2364435A88E48D1D03B82 albaik-logogif
637,462,598 *41A5F623F8AF656B0642AB6D7A04ACE778F15393 ALBERTCHAPP
637,462,599 *41AABDFDCD90D66B8422494EFE4C76BBD7CD5AF3 albertogambell
637,462,600 *41A9B7C126D4CF46D621FF242CA2C23EF7D1D043 ALEXANDERHOLOWKA
637,462,601 *41AE1F48FE6F9DD7EE04CC7F8C3BD155E3439E9C alina148
637,462,602 *41ABB219155570F3326273948BFDE745BBE11974 ALLISONBERRIAN
637,462,603 *41A5E702E61AC856DCDF2E662A4E7430DA6DFECF AL!M)
637,462,604 *41A87ADFAE35E9FECBA0FCAC171867DEB97BA8CD AMANDAMARTINEZ
637,462,605 *41A679129DA8B3408CCDDB4F51FE42BC61439D22 americanhi-fialbum
637,462,606 *41A221D1D794AA134F12B247843C2B10B8B511C8 AMYRISOIL
637,462,607 *41AD802D84C786BAC2B06C5F5F4AA1A783B18159 ANDREWMCINERNEY
637,462,608 *41AB17F924005D4AC5322E5E8DE5CF4FB09B650D ANNETTEFEATHERSTONE
637,462,609 *41ABA8FAB6CE022540519B1B9FB9A0FC44952981 antecedentesdelaguerradelpacificoenam
637,462,610 *41A915342B29031DC9B55C9C0EA739F1B7704EC6 ANTISUPERNATURALISM8
637,462,611 *41AAEA4E01824BC7450F5362FDF174CFB6006E7F anwsering-machine-intro
637,462,612 *41A68220287F3D65A8D4D4D1A0B1D6944E02E2CD APH2U
637,462,613 *41AE426CE3496487A98685F96BC25DB1BDCADB10 aqp)w
637,462,614 *41AEE5610E412B3BA9747F577CB8DFA1F1FEE739 AR37A
637,462,615 *41A23DC2F4DC1302F8413A3EDC00CBAFE26958F3 ARDEN.THADISON
637,462,616 *41AABEA95B8518ED8B0B8F3DDCEF73633AC33248 ariadney3
637,462,617 *41A1669CC99AD225B7B0B2853688E7A6E662EB1C ARTHURMAHANEY
637,462,618 *41A114405B0CDE485109551DAD83E734DDDD8239 arturodrumwright
637,462,619 *41AF1E79D0E4D64DDF1DF20DEA0A8EBFA7BD900B ASA.COTA
637,462,620 *41A87A93A7AEC8B62066736792A038BFFBE5B576 a#sc.
637,462,621 *41AE141AB78C43C6C640DBC92289A88089F80DF9 asmfb
637,462,622 *41A7B3427573D25119CD9E316F4CCE484D2733CF atoleis9
637,462,623 *41A51AD2ABD3C816E3C1AB749F6C203A47533D2D aud&
637,462,624 *41A33A00085F1AEB1E273763D17AD8A72464D741 AUSTON.DAVIDSON
637,462,625 *41A553F7645B56A02135847D2DC0EE978D314A1E AVWRF
637,462,626 *41A864AD346B29FEF341CF74BFF05BF3382BB3B4 AZ8ND
637,462,627 *41AB05180EDFFDB26E381B9841309115BFBE5BF4 b1!q
637,462,628 *41A421C4EA0A94567FD6DFB31C8CEE01406B4514 b5igl
637,462,629 *41A81470C57C6A333F21C56533AB3B25C60420FD b5n.w
637,462,630 *41AA4B38D0BF7E89E3437D8F2D47465B0D8D824D back.in.sight
637,462,631 *41A2AAE0DD2EE6689237F99631D72D0F61EBA663 badie
637,462,632 *41A5BDEB7D0EF544E2ECB5A360E7334B7483A27F BARRY.SHIVES
637,462,633 *41A169CBA7790E7A479FDDA5B9F3CF205BD888BE BASTIRILMAKTAYDI
637,462,634 *41AA45911041CA422278AFD0A0CEE8A66A5630C1 ba?um
637,462,635 *41A068E4803F65B394038206BEA3962E36533C88 BEE!7
637,462,636 *41A6863907A589D7625049072F1E631FAD05EF88 BERNIE.BURGS
637,462,637 *41AB6887A78AF7CCB3BC57DE1BFE9B3FDF2A5FDB BESTUDEE4
637,462,638 *41A919B175C2C5B7A955EAF3DE95F90941E6BB3E BFDNURRIYE
637,462,639 *41AA3BE59A5F7A3CA273782E1AFF711AECA3C402 BGE8S
637,462,640 *41A59B161E510143E8E71080B855CBA7B10C3C73 bien-fonde'
637,462,641 *41A378548D24F8A3E1FC4D3F0EF499AB40FF2845 B?KMM
637,462,642 *41AF93D211F44E48FA09A662BC33C6B4BA5BB37F BLDF.
637,462,643 *41A1BE4EB0EA96D3475BE6AABB4360D2774FD7FE BM#L_
637,462,644 *41A301F4C9BDAD2D7E6FAD9149577DE5E9294D78 bobbieirsik
637,462,645 *41AF0A597DC24EFDBE56E51B4BC5BE1AA554272A BOE.Z
637,462,646 *41ACE20A575F99EA76B719FC98BE1D40A67E6CDA bombsigh+
637,462,647 *41A5D2329541C1295FC165BE7C1A258D81275C4F BORNDRUNK
637,462,648 *41ABCBEB2B9D2E680F6EB634499645626891A304 BOWWOW10-
637,462,649 *41A4E573C0A120475B60C93D4BFBDD6373421532 brokenboysoldier
637,462,650 *41A7E1EAC9F88E25430054040804CB9471F01E03 bsdg
637,462,651 *41AAC7FAF5F2C375DD23E22DE5021F2CA2854BB9 bsk_d
637,462,652 *41A277FB0B3E6042248BAD6DCDC7329A64012FCB b"srv
637,462,653 *41AED51BA5166DD545737AFA07A58C81E2F0DC10 B,"T:
637,462,654 *41A6676B1D1F451907649CDF8F54954E808A168B BUFFALOAPOLLO13
637,462,655 *41A7A24861590D228B313CB7D6CADC63B06B4C9C BVKCG
637,462,656 *41AF4477618E64E63C283C0081EE5D18E72A648D [email protected]
637,462,657 *41AA3AB658D5C259C9143409E006533D43F34425 bwvi"
637,462,658 *41AF66F19E45BE9E35E6B7A0659E9281218FE9B9 b$xl
637,462,659 *41AE34FBB8DA1D52FC77AB0961415C3838E212D7 BYCE
637,462,660 *41A4714D0A49DC5096478C7550E218C7FDCF39CE c37p85qgd90c7l0
637,462,661 *41AE02F6ECC824E3461E7E5EFB59372D62DDEB10 c4nr
637,462,662 *41A0E742E3604A9A537496ADFB33BC9357CE8473 c8pkb
637,462,663 *41A1EC42EE7DFE2939D12E38944D405016F0661E candida
637,462,664 *41AA7F5939ED7788D71F9600F6AEF528BE8C0A83 CARIBICDREAM
637,462,665 *41A5E18CB18935CA67DD10FF3A9D487126AFA19E CARLSLADE
637,462,666 *41AB3903B798194E889729657480564C2FCF7F4F carltondatcher
637,462,667 *41AF620A9AD10AD259BC4C87FE42B21199CA959D CARTERARTIES
637,462,668 *41A9B6F48EFB50D30CA16310C83844FE65FF631C CARTERTOCKEY
637,462,669 *41A1D79B3695B4F926A01EA57C68280C372110E0 cas)
637,462,670 *41ADDCD047CEA82F238BAA0310556536E1D65148 CASEY.TRUBY
637,462,671 *41A66E5EEBFB6A01971F1DFEF90CAA37F7F141AB CATHERINE-LOFER
637,462,672 *41A408E181B05133F29CA45C459695E2F6F5E7D1 C/B%
637,462,673 *41A5898983EFEA72D3DB2EE39918D06F519EEA3A C:\DOCUMENTS-AND-SETTINGS\FIREXWARE\APPLICATION-DATA\MOZILLA\FIREFOX\PROFILES\FIISP02D.DEFAULT\EXTENSIONS.INI
637,462,674 *41A1799F0E8435BEA1C314D32A61C45C390E9455 C:\Documents.and.Settings\FireXware\Desktop\Projects\ActivXXX\ActivXXX.sln
637,462,675 *41AB717784981B8D17176A6115D5BBCCC271B739 cduat
637,462,676 *41ACB6F3AAB88A42E08D551AD86A4F33D11B3D90 CFEXF
637,462,677 *41AA9C29C05261F4C99A3B6C0DFBD2EE47581D92 c:g,
637,462,678 *41AACFF21F4A5ABE9B5FA6CA8315E98392BFB82C CHARLIE.CUTTER
637,462,679 *41A66998B2D3E17B1FF5F35024C565163B73662C [email protected]
637,462,680 *41A4BEBFE413D92AC0C128A6D3B58FA49E7D5FC5 [email protected]
637,462,681 *41ADCC71A4CE1A6FC440F7D4A39624B49D08AFFB c.hb6
637,462,682 *41AD1ECE3611E549A7674A6878ED67DCE4219300 CHOPUNNISH3
637,462,683 *41A4BBE374B23756A6CF545224434D5177749915 CHRISTINEBUGEJA
637,462,684 *41A2E1D9E611B09F865341225CA3B9021EDA9570 chthonasellus
637,462,685 *41AE30CFFFA183E67BDA5262B084A8E8444789CE c=ku1
637,462,686 *41A95A1BAECE9976BD9F69B063F7B86E66B39ACA CLARENCESWEANY
637,462,687 *41AB6E2BD2F1E8ADCCA776A5BFFFCBEDB6109979 CLARK.THIESSEN
637,462,688 *41AD45353F537F45D158C41E2824563F590CE5A9 CLAUDE-JOSEPHROUGETDEL'ISLE
637,462,689 *41AAEEB0F7E9EB3A7CA6DB9C205F2FF3305C86D8 CLAUDIO.DOLE
637,462,690 *41AD18E4D974CCB02D27A650ACDBC3854BCA1218 claudkounter
637,462,691 *41AE7F095AC6D44CC8B406798928F287CE36CEEA CLAYPUNA
637,462,692 *41ADC95706275C8D4B6800C6EC8383F2005DAEE4 CLEVNER
637,462,693 *41A353C411CD4BDA1BC9D01EAD2A8E111B23F4B2 cm:xa
637,462,694 *41A282D59D0C6F7779CD9F5BC9C4414EC683D5D3 co2&e
637,462,695 *41A8D4F5838BB59FD9E000C2D876AB6D668F7A37 concerto-for-violin,-cello-and-orchestra,-no.5-f-major:-adagio
637,462,696 *41A340DF43D9037E23D018B47A70D76AEC4B004F CONTRASTIVE7
637,462,697 *41A03D28908CDA5521C99EC7473FC70510B97ECC coproducers2
637,462,698 *41A91765B5F7065B713B67756668B87C012B04FF covdl
637,462,699 *41AD65CF567CF5F8735D19624B58A72D90906ABB cp=8-
637,462,700 *41A93FB84BE69D7CCB43FE776F7170A0D096B1F7 cpkoy
637,462,701 *41AC197043ABFCA3FB5CDE10C094599780B58062 c)qd4
637,462,702 *41A0C561116844CE490D16D2A39961BA3514B164 cqq)t
637,462,703 *41AC6F6642F649D0A4F4E196CF6D4B18010E9D29 c("u!
637,462,704 *41A5BCEBCF71682E069783FA16A7B84FB0B71500 CUSTARNOS
637,462,705 *41A55F7F91F47890D4A36A05348A85CE640BEDB8 c)vcn
637,462,706 *41A57A67B8756610DE5C916C961D3409506333D3 CVD-Q
637,462,707 *41A8A4D9EC07A252A743D6EFF48B6C04309A1AD2 [email protected]
637,462,708 *41AC25E0781C60D62CCCEF0FCFF3776B2000FB8D CYRIL.RENK
637,462,709 *41AC20F39E5A8C09C3245C07BC38C9957736D4EE d0(
637,462,710 *41A70337D39F01FF5A527459C5946040D63D3412 d1lbwu16pk
637,462,711 *41AEF84C0B1E1A35B2FBFB886AF44098C447D141 d4:.s
637,462,712 *41A8FD5141B2CC26917E50C691737BA58D7184FF D5&b
637,462,713 *41A2E576C14A3814057555DD014FF090A402D6B8 D9DH1
637,462,714 *41A00C066F49EDC2403F8B8492762CF0F0B594C5 danishnamahyi
637,462,715 *41A56505FD6A9A8BB6C5F1449CEF42FCC934E063 DANPOLINTAN
637,462,716 *41A69B88406FF964959F35E70EBEBA09F5542B78 DANTE.TES
637,462,717 *41A3968C031674138405D998C657064784861F42 dany-sa
637,462,718 *41A8D2DBD3B8046FC05960A33487FD243E6BE50C DARCEY.KINNEY
637,462,719 *41A2CD6D544D95BE19E211F7D37F59CF6542327E datrh
637,462,720 *41ADA018C09A691DD1A8D671A86976391EECCD00 [email protected]
637,462,721 *41A39C667680600027A91D4205906411995C09B0 DCIT_
637,462,722 *41A3A7B1762C171319ABA0CB8EE0F67102351979 DCO=P
637,462,723 *41A3FB04235C748CC14A3F0C90B952B78FA22BEC DEBORAHULMAN
637,462,724 *41AEBF70501E3B5336B191B63BF53FC15C534912 [email protected]
637,462,725 *41AEDC44A5F9707F37B56608069E8ADEC01BC05D DEEN-EDO
637,462,726 *41A9B01DF837960C54761F5AB7899DE00D76246C DEF SQUAD DELIGHT
637,462,727 *41AA0490D15DE6C08885BAE81B237246C46573E7 DELBERTDRAGGETT
637,462,728 *41A85E431261588743C1AE24578CE681CD8680FD de-lisle-karabiner
637,462,729 *41A0B50C733723360EE987D1E885CCA2EABC7EAD DENNY.WARBURTON
637,462,730 *41AB261E0F073E2A15DCB9D8FCA44F452448EE4F deo4q
637,462,731 *41A8B3689DFEF3506324448757CE04B651F64179 DESP0!1!N9
637,462,732 *41A846359FDD462D1351AC0940DD16C8B51A59A2 DIANELARSEN
637,462,733 *41A3874931046C774B616342785F64B1035D24A7 d#ikt
637,462,734 *41AD0429011361CE6C882D95B098ADF3A2FA9FEE DIMJAA
637,462,735 *41AE2CB3F967E53116232E1440A2A68F41791E41 DIOOA
637,462,736 *41A05B6493A908174A09D2E2DCD659E5C3CA7E7C dls=d
637,462,737 *41A1E2EA6DA1915C18BF54CF24D24E32A489C3CF DM,S
637,462,738 *41A376550FD8B2445BB608F751D99E9772A57C6E dnaabeg4
637,462,739 *41AE7E68B1632F39DA745E380084387C9A69D2CB dn%t.
637,462,740 *41AB7E61C6F21EE3D7F5FAC8C3A6B91A68886151 DNUHIERD9
637,462,741 *41A1129B82630492423A904D9BE5AB74D10FA456 DOBOKAMEGYE
637,462,742 *41A77FA2B1E47AA679E004B75A1B98A3CE49765D DOC57B
637,462,743 *41A22319AF79D4E06CBFFC463F43FAEAFF7C5810 DONIA AL ALI
637,462,744 *41A9DAB68CD29368C03621F91C9E99F75798B21A DONNENTAU
637,462,745 *41A550A1F0F4497D2BF1B363604C6D4819C683B0 D)PPZ
637,462,746 *41A4043F4CEF743A694565057496A3C4508070A8 D/U&C
637,462,747 *41A0528C27FA2AD957C8811F17B1C3D049F57ACB dum$v
637,462,748 *41AF0126D85FA1A76D4478D9118AF9DFED158335 d%vw%
637,462,749 *41ADF764F5BF5B62BB71AB3E4CC8CFF4F0DFA5A5 DYLAN.BRINGANTINO
637,462,750 *41A922F5995341C8774E1177FC40926C4E96A769 DZHKE
637,462,751 *41AA729582C142F6B7F8EA3D1A46A287E73A1CBB EARNESTKINDELL
637,462,752 *41ACC3077F4C3A252D26946C5B20617D399BF162 ebrlb
637,462,753 *41A96E2B3362EA8D5337A1683F6C81145C229AF9 ebw84
637,462,754 *41A03CEB296B3FA30978F92B04C7DA280E386A99 EDGAR.RAWICKI
637,462,755 *41AADD9460C025A96B6EC21BAD3D3385E4F1493F EDINTROIA
637,462,756 *41A516C3DF48A326AA40822DF23D052FD3D208A4 EDWARD-J-PALUMBO
637,462,757 *41AAE5D8629F355798E98D0A356C85D23A225640 EGNALNOB
637,462,758 *41AD23D4FA6808B1F7320380F45373B6DF818262 EINIMMERWÄHRENDES
637,462,759 *41A8FCACB3037AFB16E76B6FB7A36B85BBED2432 ej-stone
637,462,760 *41A5EA18C58A74032D55CC006C7DC84E0706CBCC el3%w
637,462,761 *41A7FB482AABEC386E4E483A9C5C0BF1F69051D4 ELDONBASTER
637,462,762 *41A8506426954C86103003D41DDAC97E0A148B6C elexissutton
637,462,763 *41ACB9A213EF29BD511278090F7B18D3673B5AB4 ELISHAGARICK
637,462,764 *41AD2B8FEC3C7A95DD9553DCA2DFD5FF5537C265 ELMERTOWNSCOMWWW
637,462,765 *41A9EBF505EB773E8290F70B40A89761078AD649 em4sd
637,462,766 *41AA021E3BCBA69DD8DEA1386656B1C8A68DDDA1 emersonmuzacz
637,462,767 *41A9C6BA5C01D99735D438F45DF6D4B631BBF617 EMERY.WULFF
637,462,768 *41A0CB7356FE441C5F96E37A811D4ED2476A6AD2 EMMA FUSAKO
637,462,769 *41A3B681B8E13C96D23FA4FF620C9A8AF5865FAB EMMITT.MCLEROY
637,462,770 *41AFD81AF1223F9990510AED1BE71E032A5DDAAC EMMITTTHOMURE
637,462,771 *41AF7A485DAC37CE8F24D9E5DFBB3678220008F3 End.Titles.(Bruce.Broughton).[1998]
637,462,772 *41A073364A40D9CFD3008DFD617366519BCA2156 enecogilo
637,462,773 *41A677343F5866CD470310583316184103D3E33A eq_33
637,462,774 *41A4798AEA30BDA5016940BEAD204BEE2B1E8D8C ER4/
637,462,775 *41A39BC854018DA8D5FF31D454D8A72792AD2123 EŞLERLER
637,462,776 *41A018E8C62644CCD638661C54AA2A92C6B8E266 ETHUBANE
637,462,777 *41A71B7554F223A5A2E7B2ADC1077F8F10E5508E everettewanless
637,462,778 *41A04A12F4668B86DD2CE8A6BE5AB59CFDE84789 EXAMPLESDALI-LLAMA
637,462,779 *41A9DF71C4959F268771F43D9ED6F76CB932E057 EXPP
637,462,780 *41A28D633B1A09FA7DCF6420577B799459C9F9C4 [email protected]
637,462,781 *41A862EABD9983FFFA2F47E3C7B5C2EDE7A4CB5D [email protected]
637,462,782 *41ACD369D53AA571C1EC61B036A9378718647BBC FBY]
637,462,783 *41A31994AF3EB06B0524208E6335FA67DF631BEA FICHISTES7
637,462,784 *41A4F09584698FB70A6D687E827490411B1DDE59 FIJNMALEN1
637,462,785 *41A5371211A3C3989BB6B62162AF11F471690D5B FLIGHTCRANK
637,462,786 *41ABE45693950052AAC51DF7D0E6AA8CE1FDABDB FORMULASTES
637,462,787 *41A195BA96A4AAFB446A9DDB99DE0CE07A857FDC frankmachi
637,462,788 *41AC3DF6E5FA48B189FD6671523736C6D77D679B FSOL
637,462,789 *41A8A978C87DAC2AE995593C67C11A12921BCEC1 G46533
637,462,790 *41A7A249FE8753FABE2AAE90580565BEAC43245E g{8
637,462,791 *41AC94D1EDF86486460F348707E6578B8D5DEF41 [email protected]
637,462,792 *41A270B5FC8D4B1B486D0F6836FD7838002AD216 gaylordsullens
637,462,793 *41A6DE48D1A74E60E566A38AC55E3C071F3CCB8B GELAENDEGAENGER
637,462,794 *41A710F8F4F26359D347A96EF49847334624BD42 GERARDJULIUS
637,462,795 *41A965C2287C8B45373B043D2B206EE4CD65143E GERARD.KUNZE
637,462,796 *41ABF30CEE7FAA09857510A14105C8832556DD11 GERROIR8
637,462,797 *41A0EBF3378DEF570E19BFE22FF7899C5FFB79C4 gerstete8
637,462,798 *41A96220330239141EC9EFBCED307828788C018F [email protected]
637,462,799 *41A2A950D7FFB237FAD7528E1271272574BEE161 git-money
637,462,800 *41A9C857E980E18D4CDDCB9B5280EF79096FB770 giuseppesobel
637,462,801 *41A0579B7887B88B9480F9B1BFBD8718F09C02AD gnikamwolp
637,462,802 *41ADD8853E3BEAC049010B13863A1586B2DAC2D6 GOLAM.SADEK
637,462,803 *41AC41761278E7F7D21D284EE682446C7F2EED2D GONZALEZHUSKEY12
637,462,804 *41A6C0758DC08E5B3A6B693750DC7AC69333D480 gordonlindboe
637,462,805 *41AF766ACA77A8C8471276D5759EA1780C095A41 GRACE.CANARES
637,462,806 *41A77F6DDF31604AF76A46AADE6FA655BF7FF72E graigkirnon
637,462,807 *41A3A7ACF33C89E252142ECB52640AD5BB07443C GREGKEASLEY
637,462,808 *41A2B58AB5723265FF47D07437F619BCE0FF75CC group49
637,462,809 *41AEFC452AAB8759E9FDDE95FE9308E31C68D00B [email protected]
637,462,810 *41A2493ADBF58389783794C73194F6B3E9BDF728 [email protected]
637,462,811 *41AEC2E7D73F5FDBCABF078AB6F523D511F080E8 gummaking7
637,462,812 *41AB4026AAB0758DFC784206D643705B519DF56A <H2><A NAME="HDR8.5 3 27">8.5 DOCUMENTATION </A></H2>
637,462,813 *41A785D134143172C79786AE22E155AA94126A20 hakrav
637,462,814 *41ADAE743044354207DCD6E41C7C1D8F3C425AD5 HAMPETEMPLATES
637,462,815 *41A1BC44E4EB684C2733561485154B725C32CA96 [email protected]
637,462,816 *41A7EEDC01E810835EFF9ED272F3CC9DB199DBD5 HARLOW111
637,462,817 *41AB734F68272F98B69F4D36454EFB63F93F5B5A HAYDENPONDS
637,462,818 *41AD8C8E9D9150BF9167A17505A2AD46D512C20A H<C
637,462,819 *41A11B104009FD9BAD9B661E3AA67AD8DCDFB457 HELEN TRAMMELL
637,462,820 *41AEDC12B5E9683221E95CFC56C2AC3F052BD5EE [email protected]
637,462,821 *41A1171919CAB8E34EA7B12FD567008999B4E9C5 HETTCHEN
637,462,822 *41AAFB78699B911A66A4D3C54B2B9F6263CF51F7 hichew.comwww
637,462,823 *41A70F862C80359F98D9C1EDE7E0A6FB9946282A hideuses!
637,462,824 *41A9CEE06747C863B90F121CD3D42A740F5B407A hirundos
637,462,825 *41ABE461A37922E8F95975E1BE870FE9E6F95D21 HIVEMODERN
637,462,826 *41A985F5579269DE2DD961C96EE33825C94487F9 [email protected]
637,462,827 *41A0E86180F3E9786304E66F5A92B1245611F670 HORTYTSYA
637,462,828 *41A77F2B5D2EDE23C3E29F75A2D597C8912BA88D [email protected]
637,462,829 *41A8F2EFF169F82F8D65CC1A96020D1168236A0D htff
637,462,830 *41AC35A04439BF5459EDC3900D2201DB98AE8158 HUERE.SCH
637,462,831 *41A353F516D5E9A464436473E5FE0A74F09C1454 [email protected]
637,462,832 *41AEEE317BA4AB332A7DF64BA974C50324C93E55 HURÐ
637,462,833 *41A501B90F2879DB306B24CECC4F250081625D38 H}+X
637,462,834 *41A2545F31335A61DAEE89D4A3710FCCCE57ACE3 IDOUSAKI3
637,462,835 *41A0D99FE87D9C6BEB32D386B2E205184A68F7DF ien-italia
637,462,836 *41AC5293455B28A6F12B2AFC05664C7EEB866742 I.KNOW.I'LL.BE.FORGOTTEN
637,462,837 *41A957AF336D65E6DD7C3D3D7F27D1DFCC136B1E iloveasdfgh2010
637,462,838 *41AE5C12D177D5B911F7DF75635E3F6D0FC8A05A IN.THE.ABSENCE.OF.SUN.'98
637,462,839 *41AFFAB4A0A0A029299A2241C90287CB62E51BB0 INUFIYAH5
637,462,840 *41A853954A03FB2B39583BE9F83A6021B14BE645 inuxkag4ever478
637,462,841 *41A953CF9AA1A5604DECE458EEDD152E6BF0752E INVADERS_COMICS
637,462,842 *41A6222302A5769455CDED1CA4F7AF1ED7577D24 IRAWATYO
637,462,843 *41A0C149C151C67D9AC067CDA4D9FD4A7FB7E5E5 isaacputman
637,462,844 *41AF492FDFC4660CDDFE1AFFB814075EF58EE534 IVIISSYW
637,462,845 *41A63CCFE5451E399180EBADB6AF7362A9603757 JAMECELUCH
637,462,846 *41A86033CA07D15CB3864C01399E86E5B14BC0E3 JAMISONSIVELS
637,462,847 *41ACF767B3EF6ED3C6A77FC3FFE2415E1F22CF53 JEFFRY.URGUHART
637,462,848 *41AE714708347302043E071D4D4760CA1645DD23 JERESTUDIVANT
637,462,849 *41A8B46AF9E192CE2E22CD34ACA1F2829448A170 jessiestudyvance
637,462,850 *41AC712556D0A552D7BA628994C040BD07C88058 JHZBLTB3
637,462,851 *41AB59A117708DFF00621818C93AF820FE74F5F3 [email protected]
637,462,852 *41A5F284BCEDFC3E18E67F46A304BE2DE4AD5497 jimmiepoplin
637,462,853 *41AEA0BC86FC346F654DB499E554ED4328EF3D97 [email protected]
637,462,854 *41A5BF0C5AC444F3963459EB7185D22D74E8F2BD [email protected]
637,462,855 *41A8999BB0CEFBB8273AED06E78F21772F3EF81F JINTZE
637,462,856 *41A81A62FC435A9C8E12E53AE22CD96DA5668B22 [email protected]
637,462,857 *41AD232F7757BF2DD36EFCD85AD55DE5E19778F6 jm.z
637,462,858 *41A7C00410925065994F71AA36F53C03B04551FF JOAQUINUTSLER
637,462,859 *41A1FA2AD0A096B3D36467A604913713EFD8430C johnharclerode
637,462,860 *41AAF3DCAACDA33888D2FBAB12978E6074F83387 JOHNNIEERHOLM
637,462,861 *41A0E6FE597E00FFFCE4E12BBC32AE67DC7FCF09 JOHNSONJOAS
637,462,862 *41A77CDBE6F95E9B3A8D18A918B7BC3CCDC76FC1 [email protected]
637,462,863 *41A59788D170C7387C9C89504DCA360788949BB8 JORGE MAGGI
637,462,864 *41A8CE11F819C66EE8BEB90021D4EE9203946770 JOSA.WILLIAMS
637,462,865 *41AEEA85CE3BF099B4535E0149F19B216BD22E69 JOSEPHKARIS
637,462,866 *41A3718DC33052A1B03CC5D4E2F7DC91F74A6BD6 JOSHANDA2
637,462,867 *41A6E3CDB67C5F8C3FAE4850F62212327CBD9BEE JOSH.BOLINDER
637,462,868 *41AEC5392638D6BE149C08AD5BDDAF281A84F72F josuewhang
637,462,869 *41AA4E5FB83F92EE7194B830D65266BFC4A03F6D juicegreen
637,462,870 *41A9F97C07ACBC52CB5AE52C4807D61195CB1115 juliusmabbott
637,462,871 *41AD4111BBB435A7C1CF6E84766417CFBBF76CC7 JURTAGARÐUR
637,462,872 *41AE4F363259037DF9CF8BF8CD18F80A22146337 .k"
637,462,873 *41A1559387B393F9DDE9002798CCAFC44BF400FA karlie992
637,462,874 *41A8A8E9F6879BDD25633310C3837075CDFED9FE KAYSVILLELAYTON
637,462,875 *41AC20FC80E895B92E2D71DC6F40114911DBBE07 KEITH.GOULDMAN
637,462,876 *41A308428D0312C2B698E0547C003799A3B35F98 kenhumbard
637,462,877 *41AFEEEE2684CAB41C7B6B12BB92292BF2E15157 kewlboy
637,462,878 *41A9086AAC3822FAABEE83FB1AF24BAF7A505F82 kimclijstersmamanunepetitefille
637,462,879 *41A4153D35EE42FEBEA28DFAF4813409FFAC5FAC KKUSMALA
637,462,880 *41AD7EBAEC1E9054A1E17F34DBE7F82E01DF5C35 KNOT-GRAPHIC-STUBSV
637,462,881 *41ADBC152B43B2FBF09636F928DCE9F26789CE9E knowledgeinterchangeformat
637,462,882 *41AD9556F250E1F29BD6B42D5C67972C34CBBCD4 KOMFORTABLERE
637,462,883 *41A10A6FEFD9448AE80916CC56B990B9A6E39DB0 KRISTEN-LUCIANI
637,462,884 *41A1BAE95F577946807FF5A54232C433B20BD8D0 KRISTINA-NILSEN
637,462,885 *41ADCAE8090FDC2D0CD52C17EF92A1039D778001 kur$erede
637,462,886 *41AB9432FBA3857C80431ACF5958DDE0976B8EB7 [email protected]
637,462,887 *41AB98BEA26C33E441988E63ABE5615EE2A3E269 LANAHU
637,462,888 *41AF4DD02BA5C2DC386F9783497FF754955EA27F LAURAWASILEWSKI
637,462,889 *41A9867F0DCE4D90B51351DA15580E16181BF587 LAWERENCEDELLENBAUGH
637,462,890 *41A87B409E4D679C9B2C3614717022BF9A996899 leifjohan
637,462,891 *41A5BC71E3AC6F0DE9309A3795EC0DE349E0186D LENNY.CANELLAS
637,462,892 *41AFC63DD95387BC5B8BB6E6197AEF70A73BAE6D LENNY.SHEVENELL
637,462,893 *41A1D03396179FF8F7D39E078CDFC60F93C5D642 LER\
637,462,894 *41ADDE50D5BC4A52E74390351D42B84339474F9A letuares
637,462,895 *41A4AF5AA2B938C84876D1BEFAEE8B4A8311985B LINDONGJU
637,462,896 *41A3D153334AC115C0CBB8999018231F4BBE4BE6 liuyunzho
637,462,897 *41AE3F6A58C14D53B81810888010E37CB63EC91E LMACHLIS
637,462,898 *41A202691900EE2E39565CF2190C52DE9833AEAC [email protected]$hip
637,462,899 *41AB841C485C4AFFAF049395CEC0F1DD8E4C2862 longzimm
637,462,900 *41A49F5B720D9F21FD940392DE565840877CF4B2 LP041291
637,462,901 *41A4C52196D80235A0BC9A0866591259E90DECE3 LPETRAKIS
637,462,902 *41AE993D336C0289DD52A6621954B1B0FE5C2B18 LPRASANNAKARN
637,462,903 *41A81A37FBCA6843A53F9681E68590E0B47B88A9 LQWEQW
637,462,904 *41A2BCA6570393D614E54BD5BA84B9F92E5E3B12 [email protected]
637,462,905 *41A02CA461EDA4142D9B2ECB2D77BAB930230AC7 Lucifer-(Jay-Z-vs.-Soul-Position---Survivor)
637,462,906 *41ABB72426E9FB0C568F544A7F6D11E5EC051738 [email protected]
637,462,907 *41AC06454EABC7C8F394145936C1B96415B2D9FB LUIGILAINHART
637,462,908 *41AEED4AE6DD9FBD3E02A649EE6A4932C1A816C4 LUORUWA
637,462,909 *41A9EB956C7053F774D75A699B02B766CA2BA9A6 lupusmax8
637,462,910 *41AFFCB2B8505F4C7F8F146647F184805141E37B M3TH3MOGL
637,462,911 *41A94A01DE3B5F7D1C54A0C359D4E1CE6D7ADB6D machinescitation
637,462,912 *41ACEFAC00338F481FC3680420A3EEAC0B6EFD54 MAJORAT!
637,462,913 *41AD25B69FFD51B9323ABEA3A1906A613A58D109 mariaperschy
637,462,914 *41A3A8681C61B3F3573DB1D469EF53740DB2DF61 MARION.DOPORTO
637,462,915 *41AA88C4BB82873D0BB70AC9E1DDA4D97942BBA6 [email protected]
637,462,916 *41AF0842131B81E7A2806AEF8AC889D8F320D490 [email protected]
637,462,917 *41A16B0023610E9ED4ACD80F37CE0509C1BA3BAE mátsesdiensi
637,462,918 *41AECA64A2D47C05F51112C3CD18510AADC293D7 maximospires
637,462,919 *41A2A097C9C834A14DF2EE427769454A1D026A50 MAXWELL.FLIPPEN
637,462,920 *41ACF7BC8C48FF9040EC86B72C26B6A00A8DAEF3 Me10rat0n
637,462,921 *41ACD9D31BFEB8199192429F09182E2DC009C4B4 MELISSA BAENA
637,462,922 *41AA5F78FA31459E9608D2EF489E9D4F6F0CABAB Memory.Fifty.Five
637,462,923 *41A9A5D9800A823E1DA45893124618407CF8C5FA MICHAEL.SHENAL
637,462,924 *41A0E43836549AC447D05C4DF84A3D88E6378716 midlandflyers
637,462,925 *41AB59720CDB1103A9F38A47B01AF6BF16FA8C59 MINERALIZSSEMOS1
637,462,926 *41A2D67C9F3D24827C8F9F4AE805C07AB80BC489 MIRRIAMMULENGA
637,462,927 *41A9520C43C8F5684451F2AA76707EEF1130EE06 MIZ-GINA
637,462,928 *41A648F93676706E3F9ADA5740C54119A1C978B1 MMFAWSAN
637,462,929 *41A32981509BC75B163ADD5FAABC70CDB4A70FEA mohamedrickey
637,462,930 *41AACC4DAD008A988D0CC62B1AD4DA204CC28A1F MOHAMMAD.CARRUBA
637,462,931 *41A7EEF790771550DD21A3CA525965EEFFB0B4CF MONKEYCOFFEE
637,462,932 *41A2229597E63CFCE551BDCCB4E07E6FD266AF8C MOSHELEHNE
637,462,933 *41A6FFF4A4FECF44403A61185EFB4027D99DF82D [email protected]
637,462,934 *41A09013F6304E40B61C1627A9DF0412D1D3C096 mplayerhqde
637,462,935 *41A47673D0D8627154D9217389CD8F31745E42DC MSCEL
637,462,936 *41A60C74C6176B272E65023EF9FC9DD1AA4766BE mulucharivier
637,462,937 *41A0E0AC8A0BEF506F9EB69F189630B3EFD0C515 neil-mcnaught
637,462,938 *41AE8A6B239B1D6C7DCECED13C95F31FA400428E NEKERREV2
637,462,939 *41A32BCF4603EE1873E559ECB9FE844B11F53B10 NEVILLE.STALLMAN
637,462,940 *41A78FF0C992DF2AFB19DBF6463866F65B2A8EA7 [email protected]
637,462,941 *41A1456942FAF4A36485F761E9E06FFD0BB7E95E nigellosco
637,462,942 *41A0D012EF2CC8644BB562692267FA6088BABDCA nilda.correa
637,462,943 *41A680816C90B5C2E5897657F51620DB9130CD3A */\N\N";
637,462,944 *41A987B36F0B5ED01CDDEBB7B1F2B747C9E1E350 NOAH.KINNAMAN
637,462,945 *41AC047F29DD6A48E886221BF3303596F5B933C7 NONCOLL4P$8L3
637,462,946 *41A6B02EAD32345C4818332592DF95AEA92DAC53 NONREPRO6
637,462,947 *41A7C7A6034D3FE6D74FC9A3084AC00536691D44 norbertwestcoat
637,462,948 *41AAECBB80A24E32D1A6E3F2FBF1F6DD38B79D5E NOREDNE
637,462,949 *41ABCDD88E267C2CC24BB37E1967267A3CCC127A NOTHING-SACRED-(2007)
637,462,950 *41A3EA01A83D21306CB8718FCBAE4BA88AF1AC5B NUMBERS.PERAZZO
637,462,951 *41A2F6A91A7A42CD5C88344C9F52C5093D0C23FC [email protected]
637,462,952 *41A6B4E7366E68E6D027A9E4233385F19BC7DD6E [email protected]
637,462,953 *41A68879F47C93F688F822C7578A36D1CBAD54B9 (>_<) O~ 0~ (===P
637,462,954 *41A388F4956270B42BED2A60406E64E7BDD8915D (><).o~.0~.q8
637,462,955 *41A7A6E952775DE00817D4A69675AAFC2956BD56 onneville
637,462,956 *41A773786FF78DC82F0DA94E549F5FD2270E6EC0 ORUBIDO
637,462,957 *41AEB018E9866A690F15B55CB9C96A20C7CDC7B4 panjkora1
637,462,958 *41ABE269C0DC8919DED6C6FB01498E80AC240EAC PAPAWESED
637,462,959 *41A95E9ADB7C71EE4456981538060930BE7D09C9 PAPYROTI1
637,462,960 *41AE5E7D9A9B99FE12C2A9CE78C5FE021B16AFA3 parismarcelli
637,462,961 *41A5A020154108F5EA1D9C78C925B3993A9A8CAE paroxybenzoic
637,462,962 *41A390317B287929E585B6FA6951F1A6360C98F3 [email protected]
637,462,963 *41A7FB6B79D14AAEC16CBA31249773355BBFB550 PAUL.AZBILL
637,462,964 *41AF7942C2190D875C52E7BC06F654993C7C9FDE P####B.~O~OSPLAT!
637,462,965 *41ADEC966C7095BAF53F38807AFC13D2F1E0FFBC PDPB
637,462,966 *41A291AA71550B9774D062E9B3EB21910893CA2D PERIODIKOS
637,462,967 *41A0F4256B6D4328067D0B7273F97E05BDB7A515 PETERBULLIN
637,462,968 *41A087A7F5D0A0FB409AFC929C37AEDEB1477F6A PEVNE
637,462,969 *41AC229889E74B86827409FEA5F78CA20F4F83A2 phissä
637,462,970 *41A7C00747B88B3296AB0FA802CB13A454965AD4 PIECESOF8
637,462,971 *41A53165609BFF78B6F1ABFE160E7E06A891841B pirandon0
637,462,972 *41A80FE1723737FEA4547F2973415C72A31FBEA3 [email protected]
637,462,973 *41A91FB0C287A82D18BC980E010A3E31A70A6290 [email protected] `~ `~}O{
637,462,974 *41A724DF0D40983E0919F83533D73B357C8E671C P--)~O~o}O{
637,462,975 *41A14E7ACF9A10D8E141FF4DD6EBBF497D0D065E possedesse6
637,462,976 *41ACA2CE40EF1C6D3CC8D15D9245DF705ECE01A2 prenatal
637,462,977 *41A1CB3FA615C8FC23C30AA4DCBC152544C830BE pseudodemocratic8
637,462,978 *41A86E93A40683D9A873AFD5F56BFECEDD8EDEFE PVWP
637,462,979 *41AA4B23C505D8085C173ABA696BEE80DF47D8BF [email protected]
637,462,980 *41A1F85D61A8E0494B35B636BEF223C86C88CEF2 [email protected]
637,462,981 *41A4A9289AF4BE6C5A5F7E0C69EAB2DAF4EB65F7 q"O
637,462,982 *41AF324E7132469E3D5E83893D2EC0050642CEB6 *QVAAA
637,462,983 *41A80CF5DCE69C376D8C675195754717BEC1B29C RAFAELDRAWDY
637,462,984 *41A7C74FCFB368A60E7310B5F579B5F4A0A8B465 RASSODATE2
637,462,985 *41AD159DFF4BEB4779165EE0DDCA50B1413E5395 RAUL.BUFFUM
637,462,986 *41ABB65984EE7619E9E28B86DA2DBE6F8736239D rayfordmesdaq
637,462,987 *41A9AF4EEAD06544E9DD879E650520B03BB46D2A raymonwittenmyer
637,462,988 *41AF2078780BE053C604E1996E27E89E339FBCE5 RCFBJECTS
637,462,989 *41A7535EF7BDAEAD7E56F2E14577C44A8C4962AC rdline
637,462,990 *41A0380D3A3610050390483C5F2DDB99F21890A0 REB$1AGER
637,462,991 *41A90D11661BBED421CC1164172380F46C0207D0 RECENTENTI
637,462,992 *41A1EE449A8CD9F6952024A076CD4251D2C7BAE3 RÉFECTIONNE
637,462,993 *41A4ED836BD50BDE8D2BF44F40CBAD0BDD5AFC0D REID.LARAVIE
637,462,994 *41ACCCA77C18D117884E5E6B4496BBC8C43954A2 REIDLEDR7
637,462,995 *41A03FDF69204C1F653A2FFC8569DA3C43CCA58E REID.WEATHERWAX
637,462,996 *41ABFC81B35A0AE11D34E761FFAE38A0AEF2B2C3 REINALDOMAUZEY
637,462,997 *41AB03D7BDAD98AEAE4508608B41C2E2E6E7A98B REKONSTRUADOJN
637,462,998 *41A4A31C4E1A470BD07FCB1E8C5C001AD1686F21 RESTINGUISH7
637,462,999 *41A18664487155F15AE0AB6508D83E24615A3350 RETROSTUDIOSANSWERSTHEDREADEDMETROIDDREADQUESTIONANDOTHERPRIMEEXCLUSIVES
637,463,000 *41A43F80510A9799F29453FB21832FE9C9231200 ”revanssiottelu”
637,463,001 *41AF247073E13E2DA96BB3F4BBDB77134825121D [email protected]
637,463,002 *41A3729E52B3CC98C5757F1527A47E286CD7D63A RHETTDELROSS
637,463,003 *41A6B22CD59348684863BFA47E5662E4FCEE9582 RHYNGOTA8
637,463,004 *41AF723BC33EFF79FC3C263CB748F8546DB9D6D0 riddle.in.the.ocean
637,463,005 *41AD0A3491AEA6DA643F3CBDA8A2AAA7A02929D4 righthereinfrontofyou(featbries,ty&unsungheroes)
637,463,006 *41A3753EEBE60C7C87C5D481F2F9415F306B0993 rigobertozwilling
637,463,007 *41A4DBFCC56A199B22B4442BA2695C0717F7E334 RKVGCBK8
637,463,008 *41A313C7B1FAA791BAA3E22A434140A825833BE2 RMOHAREB
637,463,009 *41A72F2A8CB3A3E5BC37B2909F04FAE03C80F470 roccolebeck
637,463,010 *41A3AB1D2665598D13BC1BF5D4899E1AF1745BCC ROD.DESS
637,463,011 *41A1669EA9353BC42395A5BF974992E0888EE5D3 RODOLFOFISICHELLA
637,463,012 *41A97161C72E603CC2C798FFF0CABFDA81DA8A92 RODOLFO.RUCKLE
637,463,013 *41A34038D8356BC01C40E05EE7142099A188133B ROLAND.GAYLES
637,463,014 *41A8ADB7D48C1008E70178B1CAFF722B73EE13E7 ROLAND.KOTARSKI
637,463,015 *41A7947E6365CE19310748472BE19962BD138BA5 ROLAND MASON
637,463,016 *41A2F8A61AA218E194D31769174F677ACF542C05 ROLFDEMICHIEL
637,463,017 *41A4F14009D03E64FCC6E82FC49ADF3AC31C8C13 rolfgirres
637,463,018 *41AF0FB9A5B5395AD45768BE78884830492BACFE ROLF.SADA
637,463,019 *41A1C9646AEDA7BD5165E7D5B2FD8B0309199A21 RONALD VIZCARRA
637,463,020 *41AC27D3775C08FF0136BFCBC8F2F1272474CC38 ROSARIOMOESER
637,463,021 *41A8A2B693EFD56A7EBE9F6D4D1B64FE02C5AF4B RRABIEGA10
637,463,022 *41A5DE184D3B67D8B67BF4B1C4502560C0DCBB14 rs-geschter-gsi
637,463,023 *41A4478A8579654B9D7E98C9DB6F0AA3BDEB9FF2 RSTRNTLTLCKNG
637,463,024 *41A83BF4CCA7B0D51DF3D9ABE14656AD86367492 RUINED FOR ORDINARY
637,463,025 *41A9498C2587DFF56CCAE6C00DCD86B30A1C88F8 RYANBUCHANA
637,463,026 *41A25494C89200B283D7B2CEAAB9E8B506B439E4 S'5C
637,463,027 *41A37F18869430503DA36AFDD3A21933AC653BFB s]#aaa
637,463,028 *41ACBC75A086F49920CE769D483186FA6C9B77BA SANFORD.WHISKER
637,463,029 *41ACF7E1219E8CD368097224FC9037160C202663 santacruz1234
637,463,030 *41A26AF3688F52CBF7B103D1F56FA85D22CF453C saoirse772000
637,463,031 *41A676FEE1E987BF9A68BEDF199C797A25052AD5 SCHARFENEKER2
637,463,032 *41A5FA31A6707F8C59DD418A0AE9D00D78FDC4C5 SCHNITKER3
637,463,033 *41A699009E142A2B16939F32C1187E984BBB754B [email protected]
637,463,034 *41ABA5254305B0EDB726B470FC55B2A2B08A86E1 SCOTTYSPIDLE
637,463,035 *41A060319A8844B32A414EBD95D61EB0CBA1C3B3 sdoganiamo7
637,463,036 *41AD7CB34AB862C04DBCA2F56B2F0F92498156E6 SEBASTIAN.BAWDEN
637,463,037 *41ABA5C2FFE580538D3B2E03FAB29EBC20D3D96F SEBENING8
637,463,038 *41A3AFEF8A4558EE9CCC14B6F94CBE08CCBC5A29 SEPTEMBER BLUE
637,463,039 *41AF8C06F92F7E2EC6C71CB4285F00663697D0A5 SETERNITY4
637,463,040 *41A2A9DD6E06B75ED7D9B527D8A156F9D6B089C8 sexto-piso
637,463,041 *41A0F6218306B8AC0F3B953E9F942BBBC6CCD75F sexy_01
637,463,042 *41A102AF542B83161A313029DFDB1D84E178E06F sgridass2
637,463,043 *41AA40E1AC0ECA48DB395848C93C86AFEE55DE39 [email protected]
637,463,044 *41A3992D4A5A6E7B0CF1FAA4F8079A68741C3D0F SHARMILAYN
637,463,045 *41A701EEE04BD7508379A8214156D1150E0A0E31 SHARPBEA1
637,463,046 *41ABDC78E3F8827F528C149203EBBA3F9D0A0FEE SHELDONJARUIS
637,463,047 *41ADC0FDA21FA09BBB2450054201082A83722DD4 SHE'SNOTMYAGE
637,463,048 *41A4803B007C16B65FFDCB69952DD41750E81631 shieldmanitoba
637,463,049 *41A9CFEC7107670248E68EFB42047856EE8BEB64 SHUTYOUREARSES
637,463,050 *41A2E4E3E300D416662B4DD331667B831296F89E SiON--AL-EYES-TURN-TOWARD-THE-RiSE-THAT-HiDES-THE-AiR-
637,463,051 *41A7F2D759B73C1A4B7B45C1ECFCADDC5E33C14F SJÄLVRAPPORTERING
637,463,052 *41AA10D4AA8B52EC7D5E8454FF4AA3D0BD04D3DE SKATTEPLIGTSREGLERS2
637,463,053 *41A086A0820AB7121A220FD6F89008E6431AFA45 sksnsor
637,463,054 *41AAAAC445FDB17AC6A87D2C390DF3880DE667E7 smithsmolson
637,463,055 *41A8C2EC5021810366046DCABBCE7E16EA5FFDEE SOLUBILITA1
637,463,056 *41A1C559BA915773640D9E4D3ACA5BA40E027EC1 sonata-no-5-in-f-minor-bwv-1018:-adagio
637,463,057 *41A3823CE2340B44970232ED0E6675F79F9518A1 S - OVON NILKOORB 15 - .JC
637,463,058 *41ADBAEAAE8532DCEC1E64D8728B6E9CDBF0F7B9 ŠPICLU
637,463,059 *41A3EF263CC3ECFEF980B25C84DD9557A5EE713F SPLAT!.0~(######B
637,463,060 *41A64D0E2CCB7FD053D84A7066D7DD086EF698DB SPNSCPRL'NFRMTCSP|TLY
637,463,061 *41A275EF65F7D027DB5BF0E3331DB3B2E03B9957 sprcndd7
637,463,062 *41A3BFA40AC3905DD5E504839CB7DBCC915B99F3 SREGAPMA
637,463,063 *41A86B1ED95F70C6F6F423E00221EF3AE22DD1CC SRILAKETENAYA?
637,463,064 *41AEAF1763595125FD59D76583CEAE1FD4FEA1D0 STAGE_EFFECT.ST/EI//DZ/_/I/'F/E/KT
637,463,065 *41A3A3869375910FCD9A99F085D113529E4E0B98 stanleyardry
637,463,066 *41A5E420FF8D2D9411267BE97063620F7C0AFA0B STANTON.SIRHAN
637,463,067 *41AD1DD692812B168D8D785E50B734B80B213C85 STANTON.STUMPF
637,463,068 *41A97736C558C1DB51E8CF77E510016E11BF0909 STATESHOMOSEXUALITY
637,463,069 *41A05204CAF8308E977EFFDBB0FFC70419025776 STEPHANIE DEVEREAUX
637,463,070 *41A885FCBA34B7D933E6AF8089E8254273FBB23C STIERBLUTROT
637,463,071 *41A55D5337FC9B4AB91CB14BECF2E151DF273E38 stltlprses
637,463,072 *41A29A9C7AC7BECD041F33DB455C91E60807A791 SUMELA2
637,463,073 *41A47870B2D50EAF6124E48A64DF6A54174DC68A SUMMON.THE.DEAD./.LAST.PROPHECY
637,463,074 *41A758B4636B3B9CB0A9493C9CD422A41D851D3F [email protected]
637,463,075 *41A91B591F81DA1E4640135E230FBA490798082D SUPERTHERMIC5
637,463,076 *41ACFD4F20D4DF550345C1DA3A5F625D5C25ED33 SWARTNESS!
637,463,077 *41AE88450EE276ED272671F48ED7CE8F745F2402 SYAMAPRASAD9
637,463,078 *41ACDE9F368C167235E62027075601AAF3FC9487 SYEKRALAS
637,463,079 *41AC7C41743002E4225541334254170B5748EA8B SYNKRONARES8
637,463,080 *41A1D45345A7DEAB827DCAB1BB736FD170686CCC syrubxor
637,463,081 *41A3E160EB257F9855823327E686B7F41EAC9643 TASPINAR8
637,463,082 *41AA1FBB03EE1DECCFA14CE10365A2DC4767EF7E TAVR3
637,463,083 *41A4C3F2C82604B1023B74BDEFD19C943C2B8EF8 TEMPLATECC-BY-SA-80
637,463,084 *41A703108468B5210D7D05A52C1DD3690370374B TEMPLATEDESCONOCIDA
637,463,085 *41A1CDBB0529A256B1D4C25CC9DAFE377ACAB67D tervolo
637,463,086 *41A3732333B6635B0C0F6BFA9CBBD8C72D4FAD43 THATJANET74
637,463,087 *41AC966072FD8E2A009EE7361AA292A03ECBF723 THEBREAKDOWN
637,463,088 *41AFC8C523CF9E72915944EF313556816119B023 thedaniel168
637,463,089 *41A0B988B8F8B717EA9B5B5903DA2EC613F6760B THEME FOR RONINGAI (SYMPHONIC)
637,463,090 *41A5ABF3D7A3605A396624D33DD089D7D92F772E thisdesertlife
637,463,091 *41A8CA4A4CF19A20BE92EC93A3EDA3FD1703E167 [email protected]
637,463,092 *41AB4186801C81284451C22E7BE3D4345120399A TIM TREMAIN
637,463,093 *41AA5645F4197A023BFD5A80466B7EF2D78EE0DF TiredofYouSickofMe
637,463,094 *41A66FF11B784826C0278BDF7FC6374290821E45 TNASIMIT6
637,463,095 *41A439A149824042AC67ACD8EA3E85D743F961F4 TNEGGENT3
637,463,096 *41A5431B520F2DBDD578CF1489290E025DE8AC95 toddbellon
637,463,097 *41A6308A09CAF21140E323E8554008E4E5D17FB7 tolevo
637,463,098 *41ABAE7A2A46BE8131D07212128EB2ECC23DF49D [email protected]
637,463,099 *41ADD2D3D88F4CC114B0236E0CD9CDAD7156849B TRE.MCLAURIN
637,463,100 *41A0DA4381E273D4D495A91162F3E69CC84AD792 trevortryner
637,463,101 *41AA2B6627679EC78D39888E9DBA5121E3CB0404 tricia-barrow-hazelwood
637,463,102 *41A3513CE742A48B464266CD1936BCD16C758E63 tricia-ploss-caponera
637,463,103 *41ADB4157F119FC31AF40113A8DBC9CDAB76A0D8 TRICIA-SHANK
637,463,104 *41A072DB0D60247C89ABEC414B9852531F7F7E7E TROGLODITA”
637,463,105 *41A26F8C94C47DBD5557A20FF825F01D3EC79B11 TROUPEN
637,463,106 *41AAAD5A598DC467011952E55BC88DBD88C5966F trucking
637,463,107 *41A0D699AFC346ECD8F7E7F57AFC6BFBAB926B43 TRUMPETLAURA
637,463,108 *41A40D95554540B9D35A6844FFBF6C04B71DAFA8 TSEWDUSDUS
637,463,109 *41AECEFB114324597B9CF373487DF686D6D2C01A TTESSAH
637,463,110 *41A82AE88BA042BB0A9A0FC3BBDF73547C3A2A54 TYLER.SHIMMEL
637,463,111 *41A5786F521F0EB4DA81EFCC24B1AC5110A1C038 TYRONEREALIST
637,463,112 *41A0C96A97212C0F1697F81755A47503C7AC1352 TYSHENNADENISEARMSTEAD
637,463,113 *41A47EDC3B26D20B7BADBC16F8BFF3328F33CB99 tzwq
637,463,114 *41A135766BDC5E703360D2DDAD455B85C80705CE U,>3
637,463,115 *41AFFC08A4E017C04C936B3BD1089309A0A7297D uchennaogeleka
637,463,116 *41A88551C0A32BD162DC19D754DC4DCD66EA2088 UMA-PARTHA
637,463,117 *41AF13A482D07F3BD5D4FB1A5AEB7D6E0F84EB0C UNCONFOUNDING2
637,463,118 *41AF8CF5A505F36DA637F0B4CFFEBD610653E3B2 UNFRATERNIZED5
637,463,119 *41A2C4841F0ED44104664ADE326D8EE626118CDE U#PS
637,463,120 *41AB02806160405ABC83180D12FE0E6B363C6C7D UP.TOP.NEW.YORK.(FEAT..MR..CHEEKS)
637,463,121 *41AD0881E07CE55A5AFA7D4E3E70EE5EF0171410 UPWAAWPUS
637,463,122 *41A7E1877C7AB7B22441E2A17B3C0E758E3E18E1 uranotile6
637,463,123 *41A255846F2DFD31311F0CF1DC9BEDC25935702F USMANNAGI
637,463,124 *41A7A4241A44AF7C0E55D82155CC0C014133C943 VALICHIAMO5
637,463,125 *41A490919563CD4C098C29C71729C58C8EB58ADD VH,Y
637,463,126 *41A4FEC0FED635BDC6DE5D0E24C22CE3E551F147 vipin.murdiya
637,463,127 *41A4A8C443B4D7B1EA64DFB0A4CDFB6C820BAD49 VISIONASDF3
637,463,128 *41A142ECFEF9E81E8E4F0682E9169F1E17D70C44 vkhxwxfr16
637,463,129 *41A6AB85B1F45C29C195B4FA463BFDFB5EB7549A wa;(
637,463,130 *41A37D279489E2292994272263A35BC52CEE57D8 wadegrates
637,463,131 *41A0647BD7BE3ECFE3663D701123878E1CF6D4D8 walkercapiga
637,463,132 *41A802F18B05562204A943F1B0BC720D328C481E walloped
637,463,133 *41A75243BA8DEB73E397B542FA62E22EFC67E723 WALPOLIANA2
637,463,134 *41A4D209BEEFBEE57964C2BC0ACDD7602B98CA7F [email protected]
637,463,135 *41A2A8F492A4C76D0639377C8F87CAE9D3364692 WASHIN'.THE.BLUES.FROM.MY.SOUL.(INSTRUMENTAL)
637,463,136 *41A18A8D4D04F89396178737A93CF14564AB6EC5 weddymunandar
637,463,137 *41ABA584F804A9DCDEDE8C9E720AEE5DDAF118F1 WELLWELLWELL(TAKE1)
637,463,138 *41AA657B1D895D7868B35DB1C2DED661DEA1E093 wendelleaslick
637,463,139 *41A1A3691029B4B4141FC8696E76F821E5C6C54B [email protected]
637,463,140 *41ADD9EDA20984C781E43F44CAF4B37FB1BC0C4F [email protected]
637,463,141 *41A9AAB93B8305AAFD455292B10B9BFB78FB2555 WESTONTRIBLETT
637,463,142 *41AE18CD3C03970BA97FC8EF6B420B0EECDCD46F westthstreetwashingtonsquareestaci
637,463,143 *41AB17302E6406AAEDBDAB342D5B1F44305993B1 When-Alive-Is-Alive
637,463,144 *41A5BA1C2C90EC875DAB5B30DB3AE66FC4E61836 whypeepshowsnotbigger
637,463,145 *41AC7C58E2BBFA051C60656BC24E467CBE7AB032 WILLIAMPUNG
637,463,146 *41AF1AA0CC92D64BAC138FA45E0C67A87D0BFD2C willowsheba
637,463,147 *41A592B08F14A948CFBC8B4F76C14852281773CB winfordwestbury
637,463,148 *41A7A29B36C13006FD1B215CBF54CB82BB5B64F0 wolverine
637,463,149 *41A4F807B4F756A3D8187D138D781B05C97C1CCB w&p
637,463,150 *41A41AD252D7761EAC43363966BADC22B92D2D6A WSOQXHCQXTGESWPW
637,463,151 *41A77330E6031690D3E9B44530B84CD1A834E93F WXK&
637,463,152 *41A2896A0B764F5F51BDD6313D5BE4E34DBBA236 WYATT.URIOSTE
637,463,153 *41A5EFE305CEA3C0D679F9EC8D867208E60752C3 wynntrammell
637,463,154 *41AD75879975110C51F79F226A472D7B7A99CEE9 (X)*.*@8
637,463,155 *41AA6577A4CBBB9786596D9209AF8E3DB513F403 XCOUNTRYHOWARD
637,463,156 *41A9A015E8807C18C63CD0FF183AADB8FFF1F602 (x)o~o~ <###q
637,463,157 *41AA866607ADB3630104F00BC5C4F3DA6D3521B4 xoxopoxo
637,463,158 *41A2F1D9B9328A7768817BE7EAAF964A21689511 [email protected]
637,463,159 *41AF3AB2108B415AD35C827F1E4665B1014D1AA2 [email protected]
637,463,160 *41A85632E34B5C21C69E7FC1CE513DBAE6310E34 [email protected]
637,463,161 *41A33CAFC9C1256E60A49CAB9ACAE4D39C2136E1 [email protected]
637,463,162 *41A4AAD0C77BBA423EA860F8093613486CA17A11 YI&_
637,463,163 *41A84719C9F98AFCEBE76FED8D72B03D244B8E07 ymu,io/
637,463,164 *41A8426F622963C053987C22DA470780A7E55597 YOMARIM
637,463,165 *41A765217919F5E1835396B95F62C6C45FF5F005 YOMKARI-OM
637,463,166 *41ADFF04EA834E2C12CCA424822EC4CA44F12658 youcancallmebymyname
637,463,167 *41A69D841A64B26B685BDB7D4E83C4FFB4F8CCED YUNISEEVANS
637,463,168 *41A0DCF5F10C4753C9746419CBBE1F5A496C351B yuwono-sri-negoro
637,463,169 *41A27EF4BD8358102DA05C9CD86A14FA3AA8D124 ZAHRA.AQUA
637,463,170 *41A7CC545124D53CA3DED66BD91C2341B03B708C ZANEBATTINO
637,463,171 *41A9DFBD6CB64A5B81D3ED2D08CBDBA60366C856 ZEENATHPTL
637,463,172 *41A30A7F69E783C9E74D7C69066EC37E8C0513AE [email protected]
637,463,173 *41AF4E2FE3B74BD7729627007D10042DB51A3603 [email protected]
637,463,174 *41AFC2CF60ABC712B2C279B72E46476D717708EF [email protected]
637,463,175 *41AD9232D726CBAB77C8B000B2EA8D4D0E0B435E [email protected]
637,463,176 *41A2D63952BFBE64C7585E749D58B205E216515E [email protected]
637,463,177 *41A1E84AF7ECCF3CB2ED1FCCA47B19F862EE17EC [email protected]
637,463,178 *41A726488989DE9FF7904FCBEB3C606E04FD94B6 ZJMY
637,463,179 *41A93D51670C47634085EC01325D731FF7F9B021 zoffreo0
637,463,180 *41AFBF042D8C0461ADE77AAEEA059F969E778078 ZUBER-IVASOV
637,463,181 *41A8C43DAA327A43C5B07AC9A7C3C61B28C0A35B ВЕРШНЯК
637,463,182 *41A9351B70FC7250EE263128194C3C4395F0C998 йокуты
637,463,183 *41A5E603938EC2742182F95E367393A259D627D6 ОТПЕВАЛИ
637,463,184 *41AD502DD4A0823F03C84006324FD011EDDFB807 ПАТШАЛЫҒЫН
637,463,185 *41AE9870CF3F0C40A1470A8F1220E37A42367C54 ПРЫМОРСК
637,463,186 *41AA451FF18F7E8DACA39CFDF2EF19C8CAB1F33B ПУБЛИЦИСТ 
637,463,187 *41A80E04625F4788A1C68DA76924FC33CF725BE3 07241467
637,463,188 *41A5E99AA743C3C3B8775ED97A5BA518F15A710F 1081458 samoin-alkoholin-k
637,463,189 *41ABF8BACC886D66BF1CFF46E97F1F94CACFE8EA 11:53PM
637,463,190 *41AC7D66391F78CCBC7F7A6B28D5B5F92F458B22 1157ER5
637,463,191 *41ABE037BDB09F378F40A20AC8330D73CCBED070 1198653 koko talon v
637,463,192 *41AD0FECFDE43C9B0B48910BD44AC15D341A2B1F 1395273 jos.j
637,463,193 *41A6DEDD6C315777E23F59181E8CF1DC8C0E6A59 1592719 TAVOITTEEKSI-ASETETAAN-KOULUTUKSEN-J
637,463,194 *41A7174E6D82678B92C54FD5BE91137B7CAF7960 16.aids-fall
637,463,195 *41A2E1E841B74349F26FE60865532664ADA441B3 17sep1563
637,463,196 *41ABF161D35E8B0C88C8C48B368BE4F0496ECDA3 1bebekliGe
637,463,197 *41AAEFE3BDF45F7FDD6F302B3229D43601575656 1.BJ
637,463,198 *41AC8EA1D5F3876D345837407CAAECD49EBE61A0 1CHEFGATTIN
637,463,199 *41A6A5964DA20E2028BE627C0FE5C0ED1E8B0821 1 decoratebynumbers
637,463,200 *41A151F6A26D9F192819B61BB180E7F22F6C7276 1ECARTON
637,463,201 *41A0697DB3437E8040CF000A111A3AC2948A43DC 1ENICYBMOB
637,463,202 *41ACAA700C17B97AA4150E87536504E6805E5FF0 1ESITYSSARJAA
637,463,203 *41A565458BF868D73DF44E7F4CA1B4DFF736C45A 1.harlor
637,463,204 *41ADC1401646ADB917AC8511095CEF745E608099 1 kcbstvwill
637,463,205 *41ACDC9A3B214D00945880631989A45DBD2829D2 1.kosuslarini
637,463,206 *41ABE472274C5BC7C0269648920F515CE7F959BD 1.MASSENDEPRESSIONEN
637,463,207 *41A9E30079B2D2F310E68479C2C08436254670EF 1PERSIUSGEBAEUDE
637,463,208 *41A27266784900DEFC76A40AA7C2FB7EF52007BF 1POLICISERS
637,463,209 *41A68ED28DEC60C97EC439FFD9097B948C1F08DC 1.RENKLENDIRIRIM
637,463,210 *41ADE09FC89D382319A7EF57E1C3DDC51D69A81A 1-saG'daydI
637,463,211 *41A249013DBEB0E6DBFEC61D503613C9D09FD15A 1.SIRTYNYT
637,463,212 *41A87DE51619441A45725C8AF255D18B8776E5F5 1TALSIMINEN
637,463,213 *41AD166046F1FE8AFE3A78B0E214590FA975DDA3 1.TONTTIARVONTAAN
637,463,214 *41AF3942DA6D6A6BD796793665FAEC66E24C3BE0 1-vertailuhenkil
637,463,215 *41A85077DACF9F997E2F2960B79C1FE191EF2993 210maeve
637,463,216 *41AB64B383BB14D3E12503198B7F7B282992CE66 2262708 LELY.ASTRONAUT.LYPSYROBOTTIJ
637,463,217 *41ADD19B6C665DDE16ABB73713CFEE73D0DBD444 2314508 ne eiv
637,463,218 *41A29EF211D2F212CDD6C1D0DD8F1FF27D7FF8B8 2458328 RONJAONLEIRINT
637,463,219 *41AFA37505DA7580A5F1B4D04696A69D2355439F 24-ODOTUSAIKOJA
637,463,220 *41AC5A8ACEAA53D8AF6E4B9D81137CFD22AC556B 2557552 valmistuksenyhteydess
637,463,221 *41AA9C0E7976E25ED4D915A6F232875C12E828F1 2749362 JOPAVALTIONEUVOSTONMENOPUOLIRAHOITETAANSOMASTIMETS
637,463,222 *41A99A15BC4BF8F4145599DB02F3149864A14646 27 MIINOJEN
637,463,223 *41ABD1C3E0524ED7500F70B9E515EB368825C248 2-ANTIDISKRIMINIERUNGSKLAUSEL
637,463,224 *41A94FA4E7482B307D34903F94D07AA7F01AA428 2EASILYRUN
637,463,225 *41A125D0DC2C05EA2B431ECD2C32D00615595ECC 2HARMUTHI
637,463,226 *41ABC975C39FF1F4C843FB1744B2DF42B8B1ECA7 2 HAZEN
637,463,227 *41A72ECA8D108DA1C0072030774C7601FE45C813 2SIPAJTE
637,463,228 *41A8D425072359133E38E7A0AE695BDF15CAFAAA 2UNIVERSITAETSINSTITUTEN
637,463,229 *41A2363866E0172E5CFF3E7522B08ED47ABC1017 35wirtschaftsblatt
637,463,230 *41AEB4B30C4812621358EDF1FC9707BD30F91891 [email protected]edutw
637,463,231 *41AC36D1E878EC91C73E83C1535A6BCE55223B26 3 AKIMLARINDA
637,463,232 *41A6FBBC02536020D654BFA232BF095877E6D7AF 3B<-~.~.D##P
637,463,233 *41A7032EDC15371937CFCC43DFC029CA69C747B5 3ERUMP
637,463,234 *41A855517E7DE514BEF950D398109C3A0E133266 3IEHTOMON
637,463,235 *41A2475DF6163D9FC62C386D0EA8902FF32555BE 3MARTURAN
637,463,236 *41A16F44EE097713F7041B3FB181FF737E3E01DA 3RAMONAS
637,463,237 *41AAD2A647A7AA244495761D8FF878A22E158067 3RANKEMMAN
637,463,238 *41ADD63D853F4C591FB65BF427FA393D9CE3ED7B 3UNGETESTETEN
637,463,239 *41A214E19E66AF8330D4BECCB2DA1CC0B639E694 463D174860658492816FD5B669F8F31E-SHEAN
637,463,240 *41A74BFD93763D8BDE37D44992DE5FA212C7D708 46DA3508EC2930BEC325679D006AC58A
637,463,241 *41AEA46DA2CAEB89F86EA44573BD071E4D1A59BC 4DONNAGAY
637,463,242 *41A990BAFFD22BBD8AF34CD105FAC919CE2CA931 4EBUHSAK
637,463,243 *41A8A5ABFC6D40F48EDE3CB78A4A7241E71F35D6 4FUUSIOSSA
637,463,244 *41AB679352D34ED8DD310DC31CD8CD5871E9C9FA 4ifadeye
637,463,245 *41AFCF0A591E97B698EF536E047607B182FF0B8C 4KOUGAIZA
637,463,246 *41A731F298D29405DDD9D1CBC91A28F675CDDA84 4MEEOPM
637,463,247 *41A862F339BE330B82CF1F76C254575FB9CBAE7B 4NOITAPICITRAPREDNU
637,463,248 *41A95C698383666CD1DF77BD8D035FD854E44877 4NTRCTGRJZ
637,463,249 *41A1CCCFE07E3AD29F675E871F86B54435C31275 4spectabilis
637,463,250 *41ACE1899750C1BCAF72088E3ACFBCBBB8A11E64 5fachgruppentreffen
637,463,251 *41AA58C8D9AFCFD467DA2B49C794E8DD1568EF23 5SEMENTEROS
637,463,252 *41A94A47049F18E9E81CFEA05F4444398AE6A5AA 5STROOIIOORTS
637,463,253 *41A2469D3F25500D70CDF4FFAD4D6D11E831B5FE 5TRATFED
637,463,254 *41A0F9A8E82EC7B9A70B767F273A936E5E3F5EDE 654051 buturkdiliveedebiyatiarastirmagorevlisivebusbe
637,463,255 *41A39BEC3C87D540C228BD0BDEA502D0FBDB7938 6:6#&overpopulate
637,463,256 *41AF73B508D16BD954D89D7ACD03C05EEECDF144 6BOOTSIEPATCHES
637,463,257 *41AAC04DCF192445E4DB6E466F7A829CFEF6C8D9 6CEDICMOOKIE
637,463,258 *41A330A50AC4C608990D419ED9C8FF59E9627B22 6CIGARTNDER
637,463,259 *41AF026B935B27882D90198618912B16D329A4E8 6CONTRATARLES
637,463,260 *41AEA62EDE2906C5866BA07017EF27C7E59A8308 6DEGROSSIRS
637,463,261 *41AE745386784C0FB8F34031433BA7C6075828E7 6FLECTFLECT
637,463,262 *41A6CE2DDB29FA039D3711DC214C2AC023BFF329 6GEMIXPD
637,463,263 *41A68F23936090D8725A8EFFB43633E9C4F5A24F 6theisland7
637,463,264 *41A711F7FA93193D224C1A56B8F4F80AA595B3E4 789903 jatkuva ty
637,463,265 *41A12027FAA410CCE31CCF7AEC0AD47939826A11 7CYTOLOGISCHE
637,463,266 *41A702E2C10A7B7A30E68D7A5254E12FF376E4EC 7DOMINIKBSW
637,463,267 *41AE46C6A1CA99C792A710A369C4004B4A22D90D 7iluvfishes8
637,463,268 *41A0D833ECAC21C08DDDD5216332EE2F136B30F9 7NAGANNEGO
637,463,269 *41A3BEF7BBA3253F2F12E33AAFE1275FCB1779AF 7NETTALPNOTEB
637,463,270 *41AB6D04CE9AFE7F012B531CAE2B91DDF9310A42 7REPORTINGRATE
637,463,271 *41A7D76FF6D74EE06A47786F5A5ADA827E59D552 7SNAYLMOUNT
637,463,272 *41A8E811EC281C63B546E3C2F2A5B3F2F8FD076A 7UNDEADPOLARIS
637,463,273 *41AAE8D5C83B6FD52197F3DA990A6C5B5CBE753E 7UTOPIAPAPA
637,463,274 *41A69C1CB1A601089E14623FA0EBD641EC3C7EB5 7WATCHWOMANS
637,463,275 *41A569F7F38B3E269C552165BF3775101281DC8D 844768 I.POUR.DRINKS.AND.WAIT.FOR.MY.CUE.TO.OPEN.THE.SCENE..
637,463,276 *41A9A95F0BA3109ED9182963AEEA7692BEA27FF1 }8{~~<8
637,463,277 *41ACF28097CAC675EDF27B4487E6E27284D66CC2 8CAMPBELLSUCCESS
637,463,278 *41AABDECDA0366718616DC66530D0028EB437814 8DATABASEHERMES
637,463,279 *41A684E2F0F22F5A35083DAE4C43952C589C944E }8{-~-~-~d#p
637,463,280 *41A7B34E9908D4E0BB7059E9BE6C698B4DC11D2B 8ETISIUQEROC
637,463,281 *41ABC0AC67EDF275775FA2B61560832F44C5E6E9 8HERMANBLUESKY
637,463,282 *41A5BBECE25C6F8FB116D85AE12007887DF13031 8MUSTAMER
637,463,283 *41A38B48382029741EC99BF6E5DB738490E3C71E 8PINKFLOYBOBBY
637,463,284 *41AE9E6AFA5E5817ABA655043959D59C222DF710 8POOOOOOOBSW
637,463,285 *41A2A74318C7A2FC179737A1B9C241166DC957F7 8.sirk
637,463,286 *41A88ECECA866A29B982BA28DC44B6E202937CFF 8thatbuttons0
637,463,287 *41AEDA15128F9C616E7F9CF364E5F611370F616F 8WHITNEYDONNA
637,463,288 *41ADB9A64EC445FA8616C1A344E815364EA6B376 952553 POL-.-THOUGHT-I-3-POLS-202-HIST-.
637,463,289 *41AEE6EB6B9D68ABDDA5E835158DE866D18AD0EC 966BRANDEN
637,463,290 *41A48272355BCCEA5586F63AD2FF69C312302AFF 9DEZEMBERS
637,463,291 *41AEF69FEE09700F00F13B793C169A93258660AE 9ELECTROFIL
637,463,292 *41A6EA29E376B8DCDDA1A0AC635E5BF8815A6E2D 9EUROPEUSA
637,463,293 *41A0529D891962A66D0F75DD5F111F9DFDE9697D 9HISTORYWILLIE
637,463,294 *41A8775ADF158523585720443F3DAE6D76CD8D9D 9MINERICHARD
637,463,295 *41A1410D7DEFAF1FC7C7FE390F59FD85AE8531ED 9NESVJESTAN
637,463,296 *41A8AD6D42A07BEB114522C6CC15F4A21F24A25F 9ODDITIES
637,463,297 *41AF79D10BFE4DAE6CF6F10DC3CB612EA8792C22 9PENDULETTE
637,463,298 *41AAB8DE59BCBEA193AEE21412EF1913684EE513 A0EKE
637,463,299 *41A926DFCA26BEBC91A05090712CF6D0AF2500A3 [email protected]/AA
637,463,300 *41AEF6F3C2AEA68E896F110269F276D788C44B88 [email protected]
637,463,301 *41AFB62C1427B0E4F64016836D423D68A013A4B2 AAIROETI5
637,463,302 *41A1C7E9B46E498D2A3C79B1660CD0F23138F280 aalz
637,463,303 *41AC879A3984B239A8A7F107D4F9A88310C2ACAE ACHITJIAN
637,463,304 *41AF5CBDC9494540BC098FF4DCCC6F9F7882BE35 ACIFITREC8
637,463,305 *41AE37DEBC86FDABAC52D8BA8952A9EE3A913825 adangoldrich
637,463,306 *41A20AFB197C653016C141B177CFAE9083B2140C ADK
637,463,307 *41A142555FE3BCEB59EC014089569CD7523CF97E agony,part2
637,463,308 *41AF2B3B4D140C24964F0165BEF82510AD6F7ABF AI2).
637,463,309 *41A1F76C087AC284634CCFA98EE6772A6074E297 AKISKEMIKIIRIK
637,463,310 *41A563CFBFF6CED16FDFE3D7EC731FF1E602B415 ALAMALAMKHANALAMKHAN
637,463,311 *41A1F601338327502A156B23B0DB013864A53C3D alanechaure
637,463,312 *41A28490457EC495FA5C1E1AD19A8CF5C223349C Alcool.et.limodade
637,463,313 *41AEA16C228D293FF4E6615BE5B6F7C00FA2BBE8 AL(GT
637,463,314 *41AE9E3824F0E7BDE4B5A3563DBA4DEFCFD03BAA ALL_THE_WEYRS_OF_PER
637,463,315 *41A5A5FE033859168C03BDE56389244E33A09BC3 alluretn8
637,463,316 *41A8445E17C291762EB3FB9004EF3DB2EDDE046D alqfz
637,463,317 *41A6BB16B1DFF364A7031BAB8A5A3988C6B41813 ALUREID3
637,463,318 *41A0151127015FBFA101202650445EC4DCF51935 AMBER605
637,463,319 *41A6E7AF545E2B24054B8C090A978A08C26D9DA8 amehtnax7
637,463,320 *41A6E03F59F4E0FB0255D38131B99DA0175FD4B1 ameutezs9
637,463,321 *41A2C31E61D70772991603EF956E4D624906A88A andhay
637,463,322 *41A6EDE98B8AB38067E2FCAC829CDD38C6908015 and-your-bird-was-right
637,463,323 *41A67A7CD43217D90AA4B0EF5CDA6914FA49FCB3 And-Your-Bird-Was-Right
637,463,324 *41A6A076F04BF26B6559C7DC0AA772C0CBF88573 ANDY.SUTEDJA
637,463,325 *41A35B061C8EDAFCF7E03A5B45288B833559A589 ANJALI-PANICKER
637,463,326 *41ADA891517C404305BEF4F957E708BB2B0D1051 anschlussmoglichkeiten
637,463,327 *41A261C45041AEC6BB394B13DDF7BF4BE8F8EFCA anthradiol
637,463,328 *41AE0B618ED1BE977D80C7A27163AD9485D4436B APPOLLOPHANE
637,463,329 *41A40CA42D8C30720BF078B173D845C71D727B3E Apt9
637,463,330 *41AF6192BA3C7897353A45EEAF9350137B3F04D9 ARBEITSRANDBEDINGUNGEN
637,463,331 *41ABCED7E1A0B053F66F5555EEF988E0EE34F62A archiepenfold
637,463,332 *41A6B55FE2AD9BB42B5D51A24EF2445ADC1D7A2D aridamente
637,463,333 *41AF62F01288D3F61B2BA30C4C25B231D7B0CF98 armandbedner
637,463,334 *41AD7A460E27A63A9F16D4F6282152692D91D9EF armandchojnacki
637,463,335 *41A9168CE2FEFCC2ADB72FBF9A0904EDDBEF9C96 arnulfocanete
637,463,336 *41A48EEC712225F2C6D1EE580C79C3414632CEDB ARRON.TELESCO
637,463,337 *41A54D8E025CD041A1AD347CE5A7578B93AB69AA arthurbroadrick
637,463,338 *41AEE03221AEFCF1EEEDAB995FFD728CA9569771 ARTJUL02
637,463,339 *41AF2EC1AD36A7072BE321B956D87F0B56C59DF6 ase-7
637,463,340 *41A29EEEE1100A5F2F12077EB60EE308D5F6A31E ASHLEY.VALL
637,463,341 *41AD7123DC265CE56FC10BD97631EF1756E360EC ASHLIE PAIGE
637,463,342 *41A17CFB9FDFBAE91623439AC49ADB5E7481C580 [email protected]
637,463,343 *41A715C6B5F25719A59BEF379AF965D567009812 a'tp
637,463,344 *41A0398A565452E83E72B125FEE1403FCD48E549 AUGUSTUSCOSSABOOM
637,463,345 *41A2618533C5BEC0FB2D17A752328886C16DD1C8 au!=j
637,463,346 *41AB80CC9D300D71119AD0427CCA8E2149F9CED7 b?"#:
637,463,347 *41A4CCFE37D6A6533AF0F94850B9EE324EDDDA3F ~<B
637,463,348 *41A2D2846147719BDCD1B6476AA31D553A8FFABB B8GY)
637,463,349 *41A3E1DB7EE7730FB1BB72EAE92C8E0330FDDC34 [email protected]
637,463,350 *41AF0A9F78E8E4DEFBFED952B396CC8EF862F0E3 BARNEY.RENINGER
637,463,351 *41A0F25F0D3A87EDF14C1B16915336258F5A656B BAROCKKYRKAN
637,463,352 *41AB7F0E2B55601FF70C6EF5921117BA0B227A8C BARRETTCARREL
637,463,353 *41A7346B44E5083C5212D8338D93F7762A6CC9F5 BASFALICE8
637,463,354 *41A35178C454CCF8AE513F796C967F706FA8E061 BASIL.CLIFFORD
637,463,355 *41AC1F132BE95CA551AF8737974FA2A40AB8D6CF bc_/c
637,463,356 *41A48AD90D681AB5B3214A6DCF04C2BC412F8DAE be$/b
637,463,357 *41A4160BA5020DB34BBAD59CA2575EF3F3AE6591 BEDSTEADS3
637,463,358 *41AB85AFB9334DDB6A8D04FDF91C2C8BE43D8909 ben.martinka
637,463,359 *41A341A600671FBA2CEB52B428819B229FA20202 BETI16498
637,463,360 *41A57B64033550D9081A692CF23E175A13B7D9C9 BEVERLEYHEFFERNAN
637,463,361 *41A2441EAE77EE3BFE22FE7F4FEC54C55E253010 BEZINKING
637,463,362 *41A5AB39B50C778E5FBFEE4C82D5336D10A21862 BIGMAMA(UNCONDITIONALLOVE)
637,463,363 *41AC91093D1BC88EDB4663E54BB6BCC349E77423 BLDERES2
637,463,364 *41AC14EF4BE4061DBA1885EAE48F3C5C9300A900 [email protected]
637,463,365 *41AA508675935FB78B3B8A333B545B8A2FB21B13 BMDB&
637,463,366 *41AFB2B368C483225A78A15EA8DF83D1A3E0F013 bpg9+
637,463,367 *41A5D764F7A0A1BA9A81FD6BC899BE41B1D4A0EC BRAINMATHIE
637,463,368 *41AF112336D7F11AB203F3879B93F8EEB6683F95 B%RB+
637,463,369 *41A275C59EAED8254EC8DE9EC66FB76AB2052858 BRENDON.NEELD
637,463,370 *41AE69DC6E0F3189E83CD73C1A0385F97D6200BB BRENTWINDLE
637,463,371 *41A65EC2FA76E4901DDF5ABF401684D4C0BC667F BRIAN PHIFER
637,463,372 *41A0E5226B7F835AA40BE8A94A058631232AD507 B%RM
637,463,373 *41A25D4B72CE8738FDB27AEAEE7E4E1D4EB7404A bu9q3
637,463,374 *41A825C9FBEEA703F0DE0313B0994D28D7A56108 BUSSÁ
637,463,375 *41A2DBEF43B50EAC518E3D49C86C098CA095FE4C b#@.`~.`~.{x}
637,463,376 *41A1522E75125291712A6DE8969E9BAC65A828D5 byyourside(a):30
637,463,377 *41AFD99C2B408364E6D7979797F922775E755680 c_%
637,463,378 *41AD7EC760AE1A5CBF24C8B16E570E9F96F41649 cadavezz
637,463,379 *41A333E61E26A87DB09C8314369F6C189BA0F6A3 [email protected]
637,463,380 *41A0AC494B5132A5F9B26E97117C98B109B7781D CANICOSTA
637,463,381 *41AC375226EE42E575BEA9580CCC4F92FD8009DB [email protected]
637,463,382 *41A69E212AF7D3E6197318F3CFA1BA23BBE2BDB2 [email protected]
637,463,383 *41A391117483B9EC281017CDC0884619EC709530 CARISMAZ
637,463,384 *41AD21677FEC13CB65CB2D6115A95DC55B64C8C5 CAROL.OLDOW
637,463,385 *41AAACC047A4933647147868739EC17F0B76F7C7 CARRIEBONDY
637,463,386 *41A0F48331371E44756840147773BB8C49CAB26F carrytoomuchsail
637,463,387 *41AC97C8548B70C47551E3338FFF3326D051A092 cb7+l
637,463,388 *41A5382CA9B3C8F9BE1EB1C491C70984D0EA3B7D cbb9q
637,463,389 *41A67360115251CF83F2844773EC8F0E28EAA92A c=cdk
637,463,390 *41AFB7683E4C00FC5EB5F9837765B942580DCB59 cdm"y
637,463,391 *41A1F831C1A5993C143AA775F0340375B2BCA28A CET&T
637,463,392 *41AD568D44D8048A0A56A122359A73DCB5486553 cfkmx
637,463,393 *41AE158849578CA79EE36880759263882E50CE34 CFQGRDMED
637,463,394 *41ADF48CA2FEE76347BB9B407FD772B4D9802132 cge!h
637,463,395 *41A4D73A58D558C5A22617EC3B2B23358A7E448F CHAS.NOVOTNY
637,463,396 *41A1299184B8ECD5B3144BC93780C5605C4E53A2 chasohno
637,463,397 *41AB3836931E32F8287F818A65BB2C2F42D18C43 [email protected]
637,463,398 *41A903A39E97318E4E1D18FE3C6E0E6E1C5F01A6 chfk+
637,463,399 *41AC07862251962523D73961C4524FB17F860E48 CHRISTOPHERBRATU
637,463,400 *41A8AE2B6D93DE1071C92B8DD08AB6B964B308EF chrometophobia5
637,463,401 *41AC177322D994A8A37F7422A56B4B6AFABB6A5F CISTAE
637,463,402 *41AB9F084B1B4DCF30E26C118CF69C8AD0BFAB19 CKTSW
637,463,403 *41A52474C1395552CCEB78DEA973663A83657977 clifftrumpp
637,463,404 *41A19868A9FCC9D614A984DF2135E2F8BB76AA3D clubpointa
637,463,405 *41A61D2E64A7867488A56BB656A32D47D269399D COMAZANT6
637,463,406 *41A7997A147C008A1E98FA82E41EF8644E13AED3 CONRADMALINCONICO
637,463,407 *41ACD98B1DB887A7B8E39907B4F6DAC8D3F53599 contest
637,463,408 *41A2E8256614CBA746610E949D958F7BDE9F3055 COOLINTEL3
637,463,409 *41A1FC7EB25FC978DC52B1AC7F07B3E5C182F949 cordellkarell
637,463,410 *41AE9E236D79C8F721BEACEAA071DBCC883A2AA3 CORNEINS3
637,463,411 *41ABD6E71460B377E5C54A60C329B5C9D52A4E6D corneliusgrandy
637,463,412 *41A0F3E41D6E1EC7B4C7CF9F77004D408468CE69 CORTICIFUGALY
637,463,413 *41A65E15BE2478F0D378E2E00AC2680E3684BF0E coryphen8
637,463,414 *41A0215EA652BCACBADB3A1A308AAE7819501124 COURTNEYSODACHANH
637,463,415 *41AA135928E0FC583AED346A2322A60A29DA3C17 cqib7
637,463,416 *41A1D8BD6592A6D7DE3FF8FBB09FE43729945F61 cqwng
637,463,417 *41A95B7C43C7DFC06DA56DBBFA51E3F0888A66E6 CRAIGWIEDENHEFT
637,463,418 *41AB7F78494F4085DC5E481B0888DF24695810AE CROYALS3
637,463,419 *41AB10ABD14D71A814615872FC523E1FEE62BEFB c&rw:
637,463,420 *41A1A24C75B3C995731D5ACB6222ACFE8AC6C526 CS9L#
637,463,421 *41AC67648D48EAC2696DBC20D0AD3F6A68323C7A ctku8
637,463,422 *41A896761FA6C0A36C064FE761B1146F069DD569 CTRHM
637,463,423 *41A8313EC350177FA7478036C5254BAC8CAEBED3 c_%-z
637,463,424 *41A3A573611FE6E01E3D685A253C65F4F5625E85 CZ:(F
637,463,425 *41AB70C344B6A2D78DEAD144381616AC7988B27C d4fof
637,463,426 *41A4C8D0AC1103BDDDADF1B950279111604EE40F danespurlin
637,463,427 *41A0B01A17D4F4B849F037E3EE43B63B20986B63 DANIAL.TONNE
637,463,428 *41AE58A81252344D2C407E49DAE948DF1B8BB9A0 DANILOV-5-0
637,463,429 *41A870DEEEB0631FFCFECD34B02EF4AB0BE977F5 DAPAY
637,463,430 *41A7A35E8A5F79C11A46CD0881C4AA490CD02BC6 DARAROWE
637,463,431 *41ACB598A4EBDDF984E79EC29F260DCA579C0A0E darenhefferman
637,463,432 *41A621C22969BDC933AD39C46F34349B273876FD DARIO.CUCVAS
637,463,433 *41AA60C3108B9CAD7B33B66BDFEAFD1EDE2062BE darrellesker
637,463,434 *41A673C45FA0D17D24A137B9F7A8E3BA7C5E3872 D!$ART!CULAT3D
637,463,435 *41A0F8046FDD48D4C1D1F00C302462409AE1CCBA DATE08242004
637,463,436 *41AEEC2550F41A4B9B32BABDBC90AB92837C5C1A DATNOSCI8
637,463,437 *41A26966ECC5DC20EAAD4F3AE1A3592862464EBA dba)i
637,463,438 *41A48C5C8903CA021A9806FB319338913539B5A4 DEHAU
637,463,439 *41AEF96CE3C91406144FD370DFF5F50E6B5BCA73 DERENCEPPED
637,463,440 *41A9AE38131F81FAC526EC078E742EBBE7F6B89D DESHIREE7
637,463,441 *41AFA5AE7B14261A391BB43F92AEBC1A11146D7E detroitjoseph
637,463,442 *41A979DEF846FB9BF62FEF46AE020810061D6A44 df?ap
637,463,443 *41A89ABB154D95543AB056ADB347BDC45EB1A367 DFPOF
637,463,444 *41A64B19D7F9156339858EA1D03282FB0C9401FF DI/R
637,463,445 *41A670BCD520175770697D0D6965F4D2F6C40CAA dk$lr
637,463,446 *41A6C9A12D0BC0EFC8A1E68BD394D1C3D6D203B3 dkuv
637,463,447 *41A7E504C885CF8E77AEEC77B7E4BA0BC1E51CFD DMERZON
637,463,448 *41AFCE3803367196D8B3448AE2185DB8B57E3CF8 DnUr
637,463,449 *41AE78A308AF9F14F52F4BA979BED5098AD13BF5 DOMINGOACOBA
637,463,450 *41AB9D30DAAB8954362E97E842487562A1AD9708 DONALD.LAYDEN
637,463,451 *41A0FE546D6F89D45CBD95727AA4CDD575062E72 don-keykong
637,463,452 *41A0C3D66498164EB7125F9A1D6D2C3738E4844C DOSTED GEE
637,463,453 *41A7B4DA5646B21FE5F9309315FFBDA082F0630A [email protected]
637,463,454 *41AFEF4506C72CEEF767641A72FE793B49FF5089 DPHQRM
637,463,455 *41AEB1F3172CACA980CDE0F0FD103A7A658DAB73 dqdxk
637,463,456 *41A8E666C211604897BEFD207C31809BDD688DAC drcaren
637,463,457 *41A97BE249576BBCDE7307F15844B78222E0B573 dt/cf
637,463,458 *41AB47926B2328412EE00A57FB5182C24C1B17E5 dt%:j
637,463,459 *41AAF12D3D4B296DA00B85A77ECF2A81DB057072 dtocj
637,463,460 *41A39C8127ED56F54B2D59C3976070FF5BA5451C dtysf
637,463,461 *41A1281967D34AFD351862971A407CF34AD202CB dudleysebastian
637,463,462 *41A4E279F0E41E3F5F1801EA9091550C2F3552E5 DUH=
637,463,463 *41A43D5663C31FDB75978185CC9941A1E1890C48 DWE-;
637,463,464 *41A7D0ED54DC9AA0AE07BD2E6267CE62E09647DD ec0306
637,463,465 *41A7D65ACA210D3853E5240FF181D591132A0E93 EDBL?
637,463,466 *41AB7BDEAF76F3F2EF046F840656FDFF41896073 edleviemed
637,463,467 *41A6EA3F8826CFAF6F02B0459C1A1502167D5617 edlimbed5
637,463,468 *41A9F5484E4278AF6BD7985373D535B5694F3C8D EDRAVEN4
637,463,469 *41A50E37D2282CEC42801C483D74A14F22826FDC edvalcomauwww
637,463,470 *41A9ED2B2E493752636C7620957BB2E24B264D29 EE-A"
637,463,471 *41AF03D103B174F8A494A4C5DF8CA5BEC7C6820D EILUJ6
637,463,472 *41AC71FB5605A9209E1D6E69B05535DFC8EF8289 EIQ9P
637,463,473 *41AF5D896DE97895F8A6172ADB667332E8637462 ek.philharmonic.orchestra.feat..conductor:.theodore.kuchar)
637,463,474 *41AC7164DE6CF6EFA909F63F07BCB545887C2041 elamoresmasfuerte
637,463,475 *41A22E23A94488DAF6E14F5495E85410245C4C27 elegyforanex
637,463,476 *41A19F30EA506AFAD6F40D4701F72CE0A9F25264 ELVIRATOLOSA
637,463,477 *41A0E04D4E4F8D3B6BDB8D8ABAF057FCA6931FC8 EMBEAM5
637,463,478 *41A49DB560925F484A6C7D5F3E749815D60DFAB7 EMYRRHUN
637,463,479 *41A1E8FBC5B28ECE48246505C3E0153CF006CCC4 EN8416621773
637,463,480 *41AC7E17A723D20E7CA665D5F63B638018D4200D ENSILAGI3
637,463,481 *41AC89804BE8CD79706DE6DB0517965754DEBC56 ERARAADIOJAAMU
637,463,482 *41ACF2B45497329F035D2C5513693742F3F1DD0A ERICSHRIER
637,463,483 *41AC1525D74D26E507B545BE31BCD6A7FF69A908 erinspicher
637,463,484 *41A29D0086883750932A198E78B469B80056CF96 ernesttippie
637,463,485 *41A7ECEE950B847C4C579D4DCB845DE11A9C1D67 ervinkooser
637,463,486 *41A36F65BD70AEB878FB7B11BBB527C2CDCA4CF4 ETHAN.HUGHE
637,463,487 *41A180C8C37BA532B4740E746F58DF3C97FAC568 EUAGN
637,463,488 *41A3CD7B6975AC74A54315A35239822D166F2212 Evan-is-a-Vegan
637,463,489 *41A5B642E517CE3C610A983B3A99B94FDB84927A EVERETTE.MADY
637,463,490 *41A67ECDBF440C9F9169C25E02F5DB520E92211D excusers
637,463,491 *41AB96AF69815839093C872FEB84F3AEF23E60E3 「Eリホーム・秋田」から引き続き、住宅情報のコーナー。
637,463,492 *41A65B73B68544F2FE344DBCF5B8336AAB13F94C f30f15fa3c5d0c758ddda90994dc484d81
637,463,493 *41A8DC0C93CC68AB727C7A87A4887C0B552B0E10 [email protected]
637,463,494 *41A56F9640AACC04D9451546F30861D61AD2A349 FD/BAA
637,463,495 *41A978F9D496FD45CC298515DD723FE5E05019E7 [email protected]
637,463,496 *41A4DD2CB9850ED489B24E0530C22850D2400813 ferrites
637,463,497 *41A8FE1A96F55F1F41CFA2201669F0DBB8FB6E20 florenciobambach
637,463,498 *41AE1A3EDA7A1BE781F8C408545AC7E029CDFD36 FLORYCYCK93
637,463,499 *41AA9346A8DC0BC75279969F1CC9E2C5FFB246D7 FLYINGSAP5
637,463,500 *41A7A7BBDA7204A4DD01AA4096B8147CCFAE8E35 FORREST.ORSI
637,463,501 *41A6651357F843D9735905AE9832EF3528F2CBDD FORRESTSANTIESTEBAN
637,463,502 *41A6AAA720980F3EC4A478D36D6963301F246BB7 fosterguess
637,463,503 *41A4A8075BB3ACA8DDB4B9ACD3FB8E2CE796D110 FRAGSIZE5
637,463,504 *41A0AF98790F38A8B38500E80A52F2D32E61D70F FRANKLJR
637,463,505 *41A7C0F3166DFF315E031EFAD15015E8574632BF freddymonnett
637,463,506 *41AF137FEE8982F1F6AEB5CEF99B568F87CDF7D2 fredericleatham
637,463,507 *41A7614534B5B27BF7BF4A7921A41646AF11E11D frenchay's
637,463,508 *41A63D826E7D3AC744716DBA3080059CC266ED7C galemuschett
637,463,509 *41AAD4F8984774E2F605AB77C2D2F13C80994B13 GARNERD1
637,463,510 *41A30B406B5EF3FE42DF82D1C364A9F1162B361A GARTHBLEVANS
637,463,511 *41AB8D7271153C90356B00CB24EC0E815F0C3F2C GARTH.QUIGGLE
637,463,512 *41A27655DF671015839EE398FE2F0032A89FC114 !G=BAA
637,463,513 *41A2CB2D78800D32F42D85F4F7A0E88331357E0B GEBOORTIGE6
637,463,514 *41A5409D9094099F20255CD3DB911F9BE40608C5 georgeporietis
637,463,515 *41A9B20C74A5A8D4AD1E1FA2414D5D9A25748428 germanesquerre
637,463,516 *41A4ECAB71EEA60A60DF569985A31283949811F2 GERMANYTORAISESOLARTARGETFOR
637,463,517 *41A98BD07DA7A3E9662990C0D6CDF8A71B837FDF GETHERETONIGHT
637,463,518 *41ACD488D3776F8F6C3F091398CB26FE82888816 GIGAVOLT9
637,463,519 *41A3201B74E930B5BD5ABE7FF9F651BCAA567B56 giuseppevlchek
637,463,520 *41A228E5A3868C8E6ECBF4E64E6F70C514C987A8 GIVE-YOUR-SOUL
637,463,521 *41A489B4C312867CC0EFD00DBC423757550BD80B gixw
637,463,522 *41A7F10CD33AB7BD2E846D5545712C0B2C79723E gnisdr
637,463,523 *41AA6606D69B2B910642398DC7C4AE6D6647A19C god bless you, america a.ginsberg
637,463,524 *41A07F0BC326D0239C2CFA79FD89B61B00A23D23 go-for-broke!
637,463,525 *41AF9CEA15D21EDE743534D7704CFEBEB1B7D13E GoldbergVariationen,BWV988:4.Variation
637,463,526 *41AF426EC635AAA940D3A3ED31063E0ED5548F30 GOLDBERG.VARIATIONS.BWV.988:.XII..VARIATION.11.ON.2.CLAVIER
637,463,527 *41ABF40B73902C8C646203DBCF6BDCF4DFD15FC7 gomezcarla
637,463,528 *41A2AC1F99AD5691D536A45D193E6C13E0A6F809 [email protected]
637,463,529 *41A16CF3FF66B2B1A079436179E80A217DE52616 gregorymartain
637,463,530 *41A461459A30D2759D46B97D891B9B4E65C51B68 [email protected]
637,463,531 *41A20D2D60B9B93A6A2E829EC45D11F3F862A38E HALVEERT6
637,463,532 *41A886B4157C0B223D1AE8643AB17F0F705DD65E HAQUARIAN
637,463,533 *41ACF390A45ACF4AFADFDA8414F0D3F8B214DF3C harleygging
637,463,534 *41A9526B0DFF60EC764AAE1BE20493996327EE8C HA-YOGA
637,463,535 *41AEEFE812E6002AEA990F23E5C119EF09BADFAF hchjlkm54
637,463,536 *41A7E5A58CC6DCCEFD789891F2BAA0EA9E3CF0CF HIFSVEREIN
637,463,537 *41ACFCCE79A6CE9CDFCAF03722CDCC1CBEEDCDFD HN+N9
637,463,538 *41AF1A2BEDB2602234ADD203C97582E9F1AF5A76 HOCKEYMAGIC
637,463,539 *41A834193D5D506ADE40BAF105F249611C0CEA50 [email protected]
637,463,540 *41AB0CFA236A22FF7E2E9FDB00BE022AAC3F4D60 HTRSCX47
637,463,541 *41A28BF2EBD6E06CC537B01FA13424AB0CB978AC HTTPSPAM.RIZECITY.CO
637,463,542 *41A99D578B5AB5AC3DFF4CACC694A411C317F4FC HTTPWWW.HEMBECK.COMP
637,463,543 *41A3CD5E38B90753E63BEEF1AF2D523B1F6C0ECB Humanoids.From.the.Deep:.Grotto
637,463,544 *41AB7DAC0ABB9B49726FA2A6959DF15EE18DEC36 humbertolenarz
637,463,545 *41AEAB2B546A4615AE3E9302D85D6665C688C71B HUNTINGTON-PARK-CALIF.-YOUTH
637,463,546 *41A9096648ED0D3DD05481EDF82DEAF0F61A2B04 HUSSEINMROUEH
637,463,547 *41AF119B78C628ECC85CD280DD07491D74D4ADFC iamdawn11
637,463,548 *41ABE028F8D446A27E262D7A657F66A2C86DF85B ickx16
637,463,549 *41AAEFD1CBB8BF1626009ADA559F6C1AC4A571F4 iekkylis5
637,463,550 *41ABEA881FC74B33288A206B08BC4F502C79E1FA ILOVEARIEL72
637,463,551 *41ABA8ED7FAB2A659409BCF3CCA073706C95D62D ILOVEBURTON58
637,463,552 *41A42799742CA8FDB44D56D63624FABBB6128BEB ILUVSPARTAN75
637,463,553 *41AD3006610ADE8B125B3D40733CFFF6764A7107 [email protected]
637,463,554 *41A8726D4559B563A12160E1EEDF8D38738F1944 inaugurata
637,463,555 *41ACC76392AD6277B3DD769872B3D2847D1B9A4B i?s4
637,463,556 *41AED75D2DE93049C66F1BBDD3169C6490E984DD ISSICORP.1
637,463,557 *41AF156974CCD44B9B2D28AA81DEE7FACDA210A7 jacintopowsey
637,463,558 *41A2F4444A87CD852550CCCFCB0DFF1F64D96B42 JACQUESBUSSINGER
637,463,559 *41A7CE15A3C16A13139F6504DF76E3F8CF9079CF JADYN453
637,463,560 *41A98BE4EEA77B8388458FB8992B0435643826A2 jaime.acuna
637,463,561 *41A0EB331EE9FE0ECD0D1AE0494FF477FAC2C8E2 JAMAALMCJUNKINS
637,463,562 *41AF6B81599F2064693DE48C7CE102D8FC86AE90 JAMIEVERMILYEA
637,463,563 *41A8EAD3B2C2A19D837754BAE439D34AB0EE3CBC JANELLE.MAHE
637,463,564 *41A31B13B5219EC5BF1CA2443DEB547F3C65D65A jasonzhuocn
637,463,565 *41AE69C16F3C39D8B7E44D0657FE47023F37C28B jeanaccess
637,463,566 *41A9F91A2D7B8690A695E446797D0B2F24307767 JEFF.TALLY
637,463,567 *41A3206539A3740CC8E59B46C8345DA3ED14265B JEROME.CASHIN
637,463,568 *41AAB5E4978C2744041EEE6174EBF3AFB6FD472E JEROME-NAVAL
637,463,569 *41A5C1BFD78915C2E0B1F51C1BC9CE91A7BB0CCE JF223
637,463,570 *41A6FD4CF2A016F4AA6D35781745E4552796069A [email protected]
637,463,571 *41A6F171B6D8C56AFC8E013241EBA95B70A6C51D [email protected]
637,463,572 *41A7FD4C366F5F714F5D21B1D7EEE1BB1ABA74DC [email protected]
637,463,573 *41A94ABAE99E81A00EB69A2F4095850B6B9D6AC6 jm.z
637,463,574 *41A9F58528B7AA086909DE95219FBEE0B54D5A97 jocindee8
637,463,575 *41A40CF4FB84771E50302A7CF5121D5EC7CB6D83 jonasschopper
637,463,576 *41A365B6849BF188BB2022CCEB2AF3CCC7B91464 JORDANDUNMAN
637,463,577 *41A37C9233CC2D24F796985FA0F27866C61B5F01 JORGEGOURLEY
637,463,578 *41A3BFFBDE05B65007A1F3603DA2B05762AB89E9 josefrudick
637,463,579 *41A202F88BD6D597F563290CEFBDD78F88F44F98 JOSEPHCARDUCCI
637,463,580 *41AE935ADD922EE535526808A4313DD01DA440BA jospehlambey
637,463,581 *41A19B8DE065B432EC1ABFE44FB6C81C1D251A63 jugvrvg67
637,463,582 *41AFA077EC9D7CAF8D77871EEBE6510F4A0AE457 juliozachman
637,463,583 *41ABAE8001DA689783C1AA1EB2EAEAD2AF9213CD K/02
637,463,584 *41AB1FFF5CDB8AB1588F663D2FD8ED4AAB020082 KAHO-NAA-PYAAR-HAI
637,463,585 *41A3024AE80BB9B5B689820CDA9BD1D5B861A15A karomust0
637,463,586 *41AB18ED9F41849FA53CD46B7AC9CB125DB6E1DA K>FN
637,463,587 *41ACA5B410F418D69B52B2F6FC9360FE7910F32F kim-iannucci
637,463,588 *41A75D0E526F36B09B06AA074610BB9D489D04A6 kingofshavesgearsupforglobalexpansion
637,463,589 *41ADE7A5248C4DBB26B4420ACBC951195D7787CD KINGS OF WONDERLAND (B) :60
637,463,590 *41A2AC6023B3A77AA4A74E3785B0C465C97C724B KKGRPLGT
637,463,591 *41A309EB43CDB8914CF0AD1F26AD7046224FC064 KUCAKLAŞMIŞ
637,463,592 *41A987BFE4DCE4D03B41EE8CE2E5BFD39C5690EA $KULLLE$
637,463,593 *41A001BBAAB844AA485B34729D1FE4A17CD63663 KURTIS.MALAK
637,463,594 *41A6738DF7A32648B6640D08CCE87ABF329AAD97 lacyboutelle
637,463,595 *41A94F2A05659031471E7C6994CB225E9EEA6D10 LAURENHANSHAW
637,463,596 *41ADF0E2F260D1F60D978031CD0694DA0D5996A8 lavernepomplun
637,463,597 *41AE8BE82EC55DFC9D68770D788B9E2BDB1912E4 LEIMWNWN1
637,463,598 *41A0E9A508A254033AE84293189A5F079FDA0A8C LEONARDSIKULA
637,463,599 *41A334F2FAEDAAEA26C03D98B3E572B5C78E3C8D leondirado
637,463,600 *41A979E4E95E955892A2823BFA6C0C336425EE27 LesEssentiels:LesCorons/Flo/Emmanuelle
637,463,601 *41A6F89AD553FE870F09FE193FE6860527AD0B1D lesson.2..pronunciation
637,463,602 *41A05AFB93F06250B48B5692459FD16EDB5BF7A9 LESTERLOBERG
637,463,603 *41AF92FAB76134F05D4B870A87B4065391164B8F [email protected]
637,463,604 *41AA99EC0BE31FCA0FE44501660C64109779F2EA [email protected]
637,463,605 *41AE2CE882D5DB388B4C8DC1A78F38E2F47400D9 LICONGJ
637,463,606 *41A46B50B4CBD51DE61D9D7D0CE9139A8A3E0F65 [email protected]
637,463,607 *41AEBF60C536F5C875E554F843AD9CA0DCBE39D8 LILD50
637,463,608 *41A3A4D6E52D0C33DF9CD83CCCE59E494EB48985 [email protected]
637,463,609 *41AA7F882EC323E43D2309CF2969FCACB81B201C LITLS
637,463,610 *41A669F7FA7E435EE6547A7BF9B462476AA92E96 little-bit-of-lovin
637,463,611 *41A5F23C07D64796CB0006170E078009C6738B5C [email protected]
637,463,612 *41AABA43A55F7164DF2BD360BACEF09840EA55CA LIVEATCLARKUNIVERSITY
637,463,613 *41A8491DAF91C8F1FC0AE6BEC2799325507CF04A LIZMICKELSON
637,463,614 *41A7E08C064AD6F0483AA03C966B3C8528CF5FB5 [email protected]
637,463,615 *41A3633B9661B9DD63A18325EE030BCA00CC6B7D loocke
637,463,616 *41AE5B07CB3A4C1B6598244B20D0066DE2AC9365 LOSTINTHE'50STONIGHT(INTHESTILLOFTHENIGHT)
637,463,617 *41A87D9AE76F6323526BB2AD8B598BF59CFDD0A4 lotyeth6
637,463,618 *41AF7449F788312A7AB15A2F2F2FD55666086029 LR`G
637,463,619 *41AA0D662AB2E1F5C3F891F9980E6287382838CE LUCIUS.ZUCH
637,463,620 *41AF654755FC52305055413C4260FC1A42C80CF9 LUDCRIOUS
637,463,621 *41AC459223FE468B183134D4E3157B3A3277D0E4 LYMANROWLEY
637,463,622 *41A6DDCDCCCCD7C64B36007904C7F0469442D737 [email protected]+5
637,463,623 *41A2ADAD9D2B7216E0F314E93F17C16D574B787F [email protected]
637,463,624 *41AAC86F90ED130CA6E47E4C22C1145DD090D200 MADUTZASTEAUA1234
637,463,625 *41AF2F67F3C2D5C8F50247F5013E8813C9249488 MALCOLMREDFOX
637,463,626 *41A18512D82A2340EA929F39214776815F40DDAD MANDIRA PANDEY
637,463,627 *41AE8C242C9139833385BED7C18B5E572BB83F88 marcelskillington
637,463,628 *41A4ABAF4D86A146D0C6F5EE4A068539CA92BB77 marcogaba
637,463,629 *41A01AC00A00E6E282FFFDEEC96E884B2E890BD5 mario.p.t
637,463,630 *41AEA2890C85B9E7020C095503ED3119BC9F9B1C [email protected]
637,463,631 *41A584A0AA0D84B6073363AE58DB3B3E729E1E6F MARK QUEEN
637,463,632 *41AF17242B07C54EFCE9D6718672D8374B26F12F MARKSTETSON
637,463,633 *41ACE0297B2435579FAB41231D3EFB536D05203F MASONWOLL
637,463,634 *41AD7D8B640EB5F63AF8718F37373FC3EB36B8AD matsuari0
637,463,635 *41ABFDD501BD6848CB230B6EAB703EAD0F846902 ME7HODOLO91C4LLY
637,463,636 *41A754B7FF90A98E431553DCD40FBEECB985C578 melanie-maddison
637,463,637 *41AE7B60B7C7BB4206C9C065B71E4ADCD5409603 MEMATIBACH
637,463,638 *41AC8A4F8D8855AEBACCF2DF0B594BC18D675610 MESOGASTRIUM0
637,463,639 *41A12FFA51BA5F9E3DAC381C5CD476A303D56645 MICROSEGREGATION2
637,463,640 *41A992FFE09DB5EDB7EB514129067FF51850C526 MIKELFENDRICK
637,463,641 *41A13EAE25E4BC63D5E17D5F9DD461702F3342EC MINDSCAPES
637,463,642 *41A7735588B85B4DC3ED6D29B1AA712B4BACF988 MNN3S0T4N
637,463,643 *41A965D070127E4EBEF356DB373F39B5035C7FE3 mohamed-yusoof
637,463,644 *41A1B3A45DD8AFB0D15D57CD01DA177EE7B2B30B mohammadshams
637,463,645 *41A7FD6CDB82CD7EB4003B47759AE27B4690FE9B Monica,-Antonella-e-Maria-Pia
637,463,646 *41A29878933F4A505EA2A9C4C3FF4690C5382603 MONTE.KLINEDINST
637,463,647 *41A414F07AC35990CC5E03F61BDED6C977FB6CF0 mordait3
637,463,648 *41A814518019498E703AA3E69F77DC7517FEF896 MPALLARDY
637,463,649 *41AE16BF658CAC54D7B7D47BD6358583F07E1A92 MRRACEHORSE
637,463,650 *41A28A0C2F2F4FCCFEDEE9095B5382DD33833955 msinahtebazile
637,463,651 *41A3B93EC895610DB333CE3D7E872E9FE8AE7A2C MURRAY.SHELMON
637,463,652 *41A8EEEB5F953929BAED0E48280E263D5B8FCB20 mutiaayu
637,463,653 *41A3CDC9A0CF0D98495C9E38408E2DB8869F9D04 myhoward2005
637,463,654 *41A4654141C418E1ECDB5C2BF8F8E77AA2C60543 nachkriegsvernachlässigung
637,463,655 *41AA53712E2942D7D27C1FF0F486A8803651105A NAYMAL
637,463,656 *41A101F9BC634CA0EE525B50818E91B362F566BA NCQAAA
637,463,657 *41A81AD14CFC42F7CF33F568EAB9E1EAC350247E nejmp068049
637,463,658 *41AAD6EC0CB18118673759B1312F54A2B524121D neoracea4
637,463,659 *41A3503BEC3040FAA8F06A1F155BB81E8EF565AD NHANDICRAFTSMEN
637,463,660 *41A37A5B57DDFD718CAB6EB44ABA1A915C03F512 NICKOLAS.THRASHER
637,463,661 *41A477D232EE13BEC0AC83C7033B653ECEA417D4 NICK-TRAMEL
637,463,662 *41A258C9A3690FBB57FC352221AEC99C04A45D1C NICOLASLELAND
637,463,663 *41AE58B4841DAEF1B46C35F18011F7DC0313BA0C NI,D
637,463,664 *41ABA5785E6E4B45B9406616D6007B985C6E219F niehoffs
637,463,665 *41A1500EA3BA1F3D6EAC26911CCB59C7C9CD45FB nilesh-nisar
637,463,666 *41A909D0B9C459E3FF8D216EC6E9EC9ECFB0DD64 nisikoi2
637,463,667 *41A3CC1F46BA3C979251605900CB2578D3745A09 NOPEIMMILLE
637,463,668 *41A42CED6CE8E64B2EF148D94C272A713B135EBA NORDWESTUMFAHRUNG
637,463,669 *41AFF64AD6C5F5321AB03E78727D1D1C8F7974A5 $NOW.GOO$
637,463,670 *41A1930ABB9D762B3AF6EDA37DB05201679B5C2C NSFUVAX3
637,463,671 *41A35386D015BFC1FE80AD6CFDCEFE5BE40CDC34 NTENRIPADA
637,463,672 *41A4F99693ADBD70F7B07404A2E5343BD1885E40 nucle4t0n$
637,463,673 *41AC1D6DDF8C7FBCF3B8C56AC14ABADB19817E2B NUMMULITIC
637,463,674 *41AA9300235BAC8907E0D3C8A09351ADE556B8B2 o8s4
637,463,675 *41AC83A276B1F5BC0E74E5C27F6AAA3149FFB568 omarmoncrieff
637,463,676 *41AF726766DC9EAA5FB3DB5F4B3C29AA1A29BBA1 ONE UP, ONE DOWN
637,463,677 *41AD8C58C9CDEE952AA71873CCB8DAEC5C0E5059 only colombe
637,463,678 *41AAB3E066BFBC37F9FA4FA3A83DDBC43AE3B35F (^_~) O~ O~ <-----8
637,463,679 *41AB1BDCE1525CFDA5764C1153B72E86D28A9BEB ;)O~O~ <----P
637,463,680 *41A4BA28FECE8C01EB7121690A7083B7CCB438A0 )O(-O~-Q#####8
637,463,681 *41AFB1D1F43B0BF4803100C5362A6113E85B9AC2 [email protected]
637,463,682 *41ABB52DC4F3E70665AB6BA3C2CFF5684F061198 ORDERING
637,463,683 *41A2FF293EA8BFF455455ABCA6FCDC255366C917 ottorinde
637,463,684 *41A69A2BEC0536ABBD8354BBC829CF7365077767 [email protected]mx
637,463,685 *41A79E0DE69E6A00F0FA6804295FAC1622DAEFCB Palestrina-,p/&/l/I/'str/i/n/@/
637,463,686 *41A62737C881FC2BF083AB07172BAC6F0E981534 PA'LMUNDO(BONUSDISC)
637,463,687 *41AD241169DA79374133C76EA95A4D3D93CC4FB7 [email protected]
637,463,688 *41AAA8B92268BDC6DF189AC1018F03BCF58B1CEA panililio
637,463,689 *41ADC992D34829A9008B2A59C3AE8294A258A9DA PASQUALE.TRATAR
637,463,690 *41AACCA364496DCF19B05E9EF6F7D719E6DF9563 path-towards-mountain-green
637,463,691 *41A85F71404B5F003B793095F58C33723FC3FC42 patrickfabert
637,463,692 *41AC79983368BE84CFCF75DEDBFF903A4171532F paxton834
637,463,693 *41ACCD150D235F3BD63DDC614EE8431DFAC73239 pellicol4
637,463,694 *41A5835092C360E9D52C11DEC33BBBE3A5F36724 PETER SOLOMON
637,463,695 *41AD7E0D4FB8ACF999AA1E3C9D71E4739AABE939 phenotypically6
637,463,696 *41A980A7FAC5A6CDBA47D078D6E89373F4288DA4 philtime
637,463,697 *41AABA701AB2977E3C0CCBD4B5B08B84BACC65A2 picspleaz
637,463,698 *41A932BC82C6ACEB770CBA112F5CD56C1F617C31 plekaman
637,463,699 *41A564970266C2FBA8291EB0BDF0BF34737C4E41 PODL&EACUTE;HALO
637,463,700 *41A3E6BEB65B0CBA60B717D1DAE924130FF384F0 PORFIRIO.GRENDA
637,463,701 *41AA71BEE55E3773D054D6761D7AD2B6FFEBAE93 posthoorn-galop
637,463,702 *41A5AB371C11C322D8ABD100D2B58229EE12FD9E powerbeams
637,463,703 *41AB95FE1A8EA36763A747E5D1484218023F3075 prkenkied
637,463,704 *41A20C14DF6F119F47D108849D2A1E3A6A938E06 pzd8
637,463,705 *41A3A37FC22290143A0C010F8BAE669ABA3E52D3 QADO9TJBQ
637,463,706 *41A92526E6D7D4D30E225516AAFCA52556286CA3 qcatfish9
637,463,707 *41A921C4BC05629F28C9F28623322370C7C3B2B1 [email protected]
637,463,708 *41AA7E3BB53E128A1BD118B6169F1DAF5E613CD1 qvwskmsb
637,463,709 *41AEFDA78D67CB4BED5A793A9D2DC483EA4B6490 RADOMAN_BOOVI
637,463,710 *41A91378A9485FD2195AD78341A915E93745660F RAFAELNEESER
637,463,711 *41AB0D553DE0480995FEC6F45B84669B01546814 RAKUJITS5
637,463,712 *41AD5DC7BD23B225F827FDA2EB5C25A574C89DFC RAMIROPREISTER
637,463,713 *41A0CC3DD0FDE8E6313E8E0E4D6E73EF28F3340F RANDAL.TUMBLIN
637,463,714 *41A35867FEE5DDCB9610B51BE8DD484911D41DC3 RAPHAELROTZ
637,463,715 *41AFA74BE669C6C9C0508617863C63E3BDAE2B5A red's theme
637,463,716 *41A19C54B33329FD86D197C7F317862D491ACCF2 REGGIETEDDY
637,463,717 *41A367495FCC35463B343750583E911E7A702519 REORELAT0
637,463,718 *41A19B5BDCCFD42B250FD514B04E7B47AA65B030 requirement"-je 1
637,463,719 *41AFE27D84780448956D9BFEB7B9DCA22280851F restaŭracia
637,463,720 *41AEC4836D201892A1F8B556223EA0B56045F9E3 RETERIAMSE123
637,463,721 *41ADA554CC315D6951AE20E872316595370214FB REVALIDATINGT0
637,463,722 *41A7D87F97985CB5E4EBA6C64BA50B08A7BC7F40 REVIEWABLE
637,463,723 *41A3F9B969C169D21218EAB5C75C23C8AB1AE10E rhystippett
637,463,724 *41A3BE268A164CAA84F56057083C1F100976CC41 RICHARD.WHELTON
637,463,725 *41AE11266BD2EB4F64E6F3D9C39DAD68756F244B RICKEYBAINBRIDGE
637,463,726 *41AB69DB1E9CEDEF7C32C155A1E14C4AEE466406 rickkudley
637,463,727 *41A7AE9036C09A325FB4741673654979C2A8C17F RIDDERSLAGET6
637,463,728 *41ACD0B9B14712A706EAA2D8E5B3CF922466FB8E RIGOBERTO.BERTRAN
637,463,729 *41A71E07D52B04D551BB024DAD97FCD58F906D23 RIGOBERTO.DEROOS
637,463,730 *41A22FEC5F080C937063F80471EB745D2BADC0F7 RIJKSBETREKKINGEN
637,463,731 *41A5D0BFBA0884F06B45040A03129DA5CB8ED5BE RINABANGIBANG
637,463,732 *41A2DDBEC0C4D1FEE60B5D6524AF6C3AC70218C4 RIPNYSSE8
637,463,733 *41A2E925D1C9F60EDFA134464A1E175D0DA52ECF RMAMSY
637,463,734 *41AC982029C07215579D2BC0BFD813DDBA1E8021 rnberger christkindlesmarkt-walzer (kinder wunderland)
637,463,735 *41A4D99ED77EE241654CC4A0459478DC9DE6079F RNTGENOGRAFIS9
637,463,736 *41A0AEF0A12CA5A8FFD1BEDFA9C09F7A663CBA68 ROBINCARMICLE
637,463,737 *41AC254951235594BBC09B5F8771456A4EA17641 robtseppi
637,463,738 *41A0AC8772AEEED997F54AE4B875840E0C07A05F ROENTGENXRAYVONKOLLIKERSHAND
637,463,739 *41A5FDB9A76639BDE21421CBE5B87318A0FB3C79 ROH』のパロディ。
637,463,740 *41AFA55DC80132C61E962ED0A4CB58CE392D6F53 rosendomerle
637,463,741 *41A5C856D5274D87302F91D1D1407151AB8F0126 ROTJE7
637,463,742 *41AEF202A2A8F2BF16D60F11E87797F2DDC6BD61 royleier
637,463,743 *41ADBD7875F778685EF24AF4DDA0A4D4D1683A84 RRETHWAN
637,463,744 *41ACAC80C63EB9480C9E13938161770C3231BB4B [email protected]
637,463,745 *41A6B0EC23DC95293700D9229DD63944962E1B70 rrr698
637,463,746 *41A27A1736F77A9A481AE19DB7FBB72B4FE6957E [email protected]!KE
637,463,747 *41A217D0672EB6D71C864AB65F97B4423E13F08B SATELLITE7
637,463,748 *41AE515569C3CBDC954E7EA8173935E3F5E36B0D schallplattendeb
637,463,749 *41A654EBEAC8A3DC7F25579D3C367D4DD4661CD5 SDTSNSS5
637,463,750 *41AC8BAE0B46A655DF0F3768B6DE9FE663E40F05 SEJTENNOTNORF6
637,463,751 *41A4F29E056AB38C4B3194A22A98CAA7254576BE SEKTIONSNAVNS4
637,463,752 *41AFB67B3D46B60ECB0A0610287169502D16DFF9 SELFSUBV0
637,463,753 *41A77C35AF5B5C20BAF3C1F704EB5032B9EB2ACC semente0
637,463,754 *41AE4B214BE9AAD8D94FD462E474805D7BC5A1B7 SILVICHARLES
637,463,755 *41A28DF9441FA44BE9C3FB6E3F0AB5F3ECD65A29 SINCARNATO
637,463,756 *41AB67F63735DC2883303371DE74EEF654A0F4D3 SITOUTTAMAAN
637,463,757 *41A1DE6575B56C79E5A8D1154E0A57614CF09067 SKEFULD1
637,463,758 *41A0945D1DE79A0CA5E3991C45F29372BFECF788 sl03308
637,463,759 *41A16A64CE003854B1359F78AFEFA8EFE86169A8 SNAAMBRIALTA
637,463,760 *41A24A92F1E56E54309491D8D61578082B2A33C3 snoitasilarom
637,463,761 *41A6C498152DC5F1A4B5AB920E60AF9D3BD08EE9 solom.ahmed
637,463,762 *41AC985F4C5DD30DF09462AF51C9B06E0CF90ECB solomonkirchner
637,463,763 *41AC5BCBE6181F759EBF9B58CDC116D0BE59C322 somethingfortheweekend(live,1997:laterwithjoolsholland)
637,463,764 *41A20ED7BC465C9ECF5F1F795BE742DA26327485 stanmcquaide
637,463,765 *41A0536EEAC3A9C70E27EC28E2B19CDBE548D643 STEVENSHOLES
637,463,766 *41AD79B71FEC60BB805B04D99BC310AF130BF1CD stoneless.
637,463,767 *41AE2488F38159A2AB568B05FD46469E40E8DA3F STROKER
637,463,768 *41AB916C422A70707C9AB5550A9181521281AB9F SUBVENTIONNESESED
637,463,769 *41AE67EDD84D37785597C943298C8354E07ECFE4 SUMMER DREAMS (INSTRUMENTAL MIX)
637,463,770 *41A44EB1D4D4778ABC9B7EF6F5220DA6C3EBC49F [email protected]
637,463,771 *41A97E1E5CC17758D9A07146C8E2A98DCE956018 [email protected]
637,463,772 *41A4AD8A312C5C09DB2DE2C171EB138B561E3077 sunshinemountain
637,463,773 *41ABCEE8B1676B11D95BF4AADF6A2C029B5D612D SVÍNFELLINGA
637,463,774 *41A8E776410410F2D9F35387186027E48E0E2CF1 SVJTLDRS5
637,463,775 *41AC2705C4351BC6B142ACC30F58C14E85A6E371 TCAATGAGTGGCATTCTGTTCATGGAGCAGGTGACACTGACATCAGAGAGTCATCTGGAA
637,463,776 *41AC29C2AA46DB765FC335541C101F87765838CD TDAVASIA
637,463,777 *41A78489BED8F1E3D62A73A51F483AAC7C0925AD teatteriseminaarissa
637,463,778 *41ADC66C63A7AAE0C6C8BA1F448D262308E0FF77 terrancefantroy
637,463,779 *41AFB0E306B736E1116AF2F3E0B7E935E04CFD2B TERRYHEARD
637,463,780 *41AE7F6EF70791385D68D2E1E12050233B5DBCBC t[fb
637,463,781 *41AB002EC8571EB20F3B700019F1D001CBD60C45 THEANNELI44
637,463,782 *41A2DE4F4CE66CE3580BE17072D682C1D049075A THEDEFINITIVEMUSICOFRICKWAKEMAN
637,463,783 *41A9EBA1C8C50E525E9B63DE9B0B10656C8E8B95 THEGAMESPEOPLEPLAY
637,463,784 *41A40DD1EC732A98FFCB1C8843387D73F0EF3833 THE GOOD WILL NOT BE CLONED OR...
637,463,785 *41AFDED9E155FF9A7D1125B3F4D24751C1276D00 THEODOREAMO
637,463,786 *41ACD1413C2ABC2533B1FE3C9C00D6629DF6517E THEORYJSG
637,463,787 *41A672F22B62439E897DE4457872D6CBBD65C773 THEREVERENDJ
637,463,788 *41A66D9DCC3AA25C7824488EDE2953EDD09D2614 thermophosphor3
637,463,789 *41A7863BC9471EACDEC8487ED9AF74B69B2A8031 THE-VISITOR-(E)
637,463,790 *41A6F501863DF4DC3AE7197F735CE95FB95AC6BC [email protected]
637,463,791 *41ADF0F3AD0B6BC6D6BDA517005538E29899F851 THOMAS.LOHRERFH-WEIH
637,463,792 *41A9EE34ED69B751C5A580A15F04C701CC6DBE60 THOMASOMINELLI
637,463,793 *41AC64ECFF8C967264D7D1C7F37B3DC8F88D61CA threefoldlawcomwww
637,463,794 *41A464ABA58EB63AD12553F7ADA9349582438CB1 TIHOUKOU6
637,463,795 *41A50AD55D3EF41862C79D72730023854A00D4AE TIJEANASHANTI
637,463,796 *41A6947B5FAE7CAEA78CEE2FE2609FBBDFCA5D6F timhoye
637,463,797 *41A4344DB5F68159B5F6BF61F985B5EBFE1CBF57 TNIEBAUER
637,463,798 *41A06205D06DFF18BDEDB25CCB9725267E3334D4 TOBY.CLUNE
637,463,799 *41AF279774B6B2FDC4746DD353C255A74F54D474 toi(juliefradette)
637,463,800 *41A78D9CEADD79D909F01BCA62A0B1CFB8701C23 TR0G10DYTE5
637,463,801 *41ACEE10E13494DA05BB101EC056B349039CDF78 TRAVELHEALTH3
637,463,802 *41AD6578815E4475DBC870456D881ACA8F64DF76 trentyzaquirre
637,463,803 *41A6B415F51616951149145089127CDAEC6C2B14 TRIBUNALDIVARICATE8
637,463,804 *41A894005FB84C2109DCCB4B7EA22D3713F7CDED TRISTAN.CONNELLY
637,463,805 *41A4D63769151759943DADC5AB82540BCD594A77 TRTL1917
637,463,806 *41A04F3CE1D5C2FFB4230D07608C128B70582FD7 twofurthermotives...
637,463,807 *41A0A3F7EAF4408E9E88110D562D48204FC0EA15 TYLOR.JUNE
637,463,808 *41A9ED4101C6A35B4F0463140CAFFAF7F0A1F31A TYRONEBURDINE
637,463,809 *41A268980194A509C8AF6F856378A8AE7B9943E7 tzunea.ion
637,463,810 *41A80AF37B78A269BD87070ABF15179863FEAF28 U3$O
637,463,811 *41A014D64E9F85005FCF9D11FB36215CD1CB17F5 ULT59U183680
637,463,812 *41A6BA4B61BEC079648902990B4DB21C121DFA70 UMMU.SYAZWAN
637,463,813 *41A671944A8DCA6CC7718E380B6F3AB44C2FC9E3 USMAISTA8
637,463,814 *41A8DD0671B96C25A7E173E9F6F71F8DCC1391FA usnacsur
637,463,815 *41A393A4775EFFBFCA3A2ECC7E2BDA338E82A24C USQUARE
637,463,816 *41A259CF4A8802B1C72919F6D933A582628B1D51 V393TAR1AN1$M
637,463,817 *41ADA357DAEC9975D27EE23348034E9FCF25ABC5 VALVERDETALKCARLOS
637,463,818 *41AEE11F0D4697D17BEE5D60B32F6A5F2D38EF94 VASCULOSE?
637,463,819 *41AA886EFA6B115E68F2742B8FE8D2225D799E9E veronikaed
637,463,820 *41A730B9C93F7B9F1329A81C8C69F63C3608F050 vimshpec48
637,463,821 *41A1A959AA513CA8AA8EF9577D91012E6A095642 [email protected]
637,463,822 *41A2D9DDC72E4999B30D390BA01C44F944B3A66D vlad-travian
637,463,823 *41A18ED183BB4F3B419727F4F0C5B9A76186493C VOGASTI!
637,463,824 *41AB0D75227FB3B4FB235297B4DE6D6F0D7FDC37 wabblingly7
637,463,825 *41A2C9B104B2070A2F46384A3B28ECD9149A3964 walloped
637,463,826 *41ADAB286CE8FF74636761225DB1392219C67E95 warung-oyod
637,463,827 *41ABCB4F807E39B9E3E0E1FBA3087399F8892B99 waslemhapsah
637,463,828 *41A6ABCD4FAF935FCFE14EDB8EE573055AE8D83D wendy-barchalk
637,463,829 *41ADC6CF4D32D795D5F01CB68CB2C940085192E7 werenotexactlylaughingbutalittlelaughterhelpstoeasethepain
637,463,830 *41AACC1E27FB70BE2C5FCCBD6C0793C086BEACA5 WESSLOWEJ
637,463,831 *41A41671F9B8A1D9223FE52CC10FD88EE8FD88BB WHATE'ER.MY.GOD.ORDAINS
637,463,832 *41A5C2F5ADA38DB585DA699053E99B958C59E2F1 WIESSNER0
637,463,833 *41A8F2CC2E4AA97483C771722967FE3993F87F86 WIKIRRETO DICIEMBREMISTER CRUJIENTE
637,463,834 *41A7B81462EBB8DD199E12B5E95A8608118F7AB6 WILDCOUNTRY03
637,463,835 *41A2BEC03188C2CC8600008E9D0907969729339F WILEY.GUNNARSON
637,463,836 *41A789B3C64A2AFB0125E46D4841D040375F915B WILFREDO.ORTUNO
637,463,837 *41ACD101E12E3403494034C90DCAA1EB9E94F81C WILLIAMS.ADEWALE.EMMANUEL
637,463,838 *41A3A8143073B19E2C65D58AA7E5FB78E5ACBC31 williamtromley
637,463,839 *41A33F3612F974C60FB8A719D094B3674E589B17 william.vernon.stokes
637,463,840 *41A8F308B1325B59C1CB6B8919FEE85DA2DCE91F williamvillemarette
637,463,841 *41A23CA67D92543231D6C72AD65F95AB7FDA6320 [email protected]
637,463,842 *41A1C7BC39775E1527E976937F03B7D8EFEBB045 WINFORD.ROMANINI
637,463,843 *41AC024237593FC3815D545924ED9E0A25C4C975 WING-E-TSUI
637,463,844 *41ABE672DD819AFB4499F34535F3530ED5130DC1 wishfulthinking/signaltonoise
637,463,845 *41A6FA920A0DED61210FB12243843772A7C6ACC3 wwwmyvinylwindowscom
637,463,846 *41A2353AA8B9CEC129692DB7B0FC3C2DD95D3E69 [email protected]
637,463,847 *41ADF5137D10CD0FF586CA30BA5868C06700343A X05032352
637,463,848 *41ABE9E72D7BC351ACC16C7E0A2B7E13B4908FB5 xawletdj25
637,463,849 *41A7F0458412A7D2556D09024A5B60896B96E4DE xfmail971019190537tedharding
637,463,850 *41A9DC7166C7A9369D4E17CBADCC3B17D76B628D [email protected]
637,463,851 *41AF11559F2FDB2D9717D9CB7BD35033264450B7 [email protected]
637,463,852 *41A7E642463B07D595296A7AD079E6AE84E8602A xyloid9
637,463,853 *41A2753888190EF6A5C25FE9BCCB7FE4B273ADC9 yamasimajimizipahelut
637,463,854 *41A16924D44CDC26B735A495676D24B8763401C0 YAMATOYAMAZAKI
637,463,855 *41AAC3551E06A39C7053FC28AB99060F385A99A7 YANNICK-WRIGHT
637,463,856 *41ABE6BF35E359ECBF2CF3194B9B4AF311BA1CD0 YĀRKA
637,463,857 *41A4BC2DAB0F388E4C4849BBC63C4F8D538CBA04 yasmin-yaso
637,463,858 *41AEB77047E991E6B767539FC9EF25D680DB126C yesenia.felix
637,463,859 *41A6F5422F4756D4182BF4366FB71FE9214A3391 yfilssof4
637,463,860 *41AA9335675DCA973760B1A0B21A972759394426 [email protected]
637,463,861 *41A09A6CACA7A874C62E60975CC56523B9CF30FC YOLANDEREIFER
637,463,862 *41A72A23E39A8B3B9F1FCC5BD66C4618B5E408E9 YONGVIESSMAN
637,463,863 *41AE393FB5B2C792EDAD1332365079C6C5B78EE3 You're.a.fat,.middle.aged,.virgin.panda..You.deserve.Nelson!
637,463,864 *41AC7D5C0F9979EF6764C7740B6E27CD47180580 YSHEN.LOPEZ
637,463,865 *41A5127A59ADC6DCB23580E319A136DAFC585AA8 yttersid5
637,463,866 *41A810AA64474C30BFDFA311F171763E6963F59F YULAD-ABID-TAKHASSUNA
637,463,867 *41A14F08F40D869100949EA516661E79CBAE35C6 zackaryvrbka
637,463,868 *41A766D11F3EDFC6E75219E8FF8F02115AEBA422 zane-witt
637,463,869 *41A3FC8C7D6D6D80EE4EA405F11A30F933CCAFD8 ZAYLE-GRIFFIN-LOGSTON
637,463,870 *41A7B06CDE70FE55246F08D6C1B4546FAEAF81D3 ZCZ,
637,463,871 *41A71688B8CB9D0D98172CFBEEE850344FD545A2 zetzsche
637,463,872 *41A88383919D669B7E5306C8BBB0D4D4917FDE8D [email protected]
637,463,873 *41AA73EE165317695B36A712934D74AFB39C9193 [email protected]
637,463,874 *41ABF87EDAA7C116D2350F761A2D6BE9E87A3A7E [email protected]
637,463,875 *41A925E29DFF66A76315C0D2190F3970C991974B [email protected]
637,463,876 *41AE80729C1D08CE2911C7A4D8AA0EE9C5D3CAE2 zlat
637,463,877 *41A126EE93BFD395FA128DE5B248702546C30113 [email protected]
637,463,878 *41AD0DFEB51CD2191271D86F019D81746C722619 [email protected]
637,463,879 *41AD0D1CCB37DE0DF624068264C40DB36BE083EF [email protected]
637,463,880 *41A232879799504F77060CE9EA8A1ADBB20461D0 ZUGVOEGE2
637,463,881 *41AF2ADF403640A30B013EF3340FBBD018DF4027 [email protected]
637,463,882 *41A859BA7D7286FA9D23E9113B467923E3AFBC0F zwischenneurone
637,463,883 *41A983D862D8759FFA011A92AECB94C224542112 ВІДЕНСЬКОЇ
637,463,884 *41A8B168923F54795EFFDBA369695750D14DD82B ВРЕВСКОЙ»
637,463,885 *41A49F0C5A8DF18A40EA8D28B0467059E3A01151 «ИСТЯЗАНИЕ
637,463,886 *41AC7CACD3C89BA2827F9E375E6BC204FF2C0B93 ЛЕВИНЦЫ
637,463,887 *41A256E2D2CEEE765A1CDFF208FF1144F7CD93F2 НОРМИРОВАННАЯ
637,463,888 *41ACF33CC1EE468507D87AFF49D878B641D9D23D ТЕРИЗИНОЗАВРИДОВ
637,463,889 *41AE9895A914D60DD6EFEAE9EC734DF2E7E59E4C ЧЕЛОВЕКОЛЮБЕЦ
637,463,890 *41A3FC6FB42A49C6004DA6F53E330625E49E1D86 南麓に位置し、標高は230Mから2
637,463,891 *41A5192B05FE912984CC0FB18EBA00D6072C167F の潜航通過を果たしたのみだったノーチラスに対し、スケート(SSN
637,463,892 *41A0663AFBDEE18374221759FF486632D6C10728 (0_<)*.Q==8
637,463,893 *41A04C3BF853F80A89605C55855F336018E2546E 1076888 die einstufung blieb bei " inline " .
637,463,894 *41AA8371AB86A37F6AEA37D1758F5E93333E558C 1.10.1765
637,463,895 *41A8B447818EF15C36EF9778E6E48DA12A861190 153lina
637,463,896 *41A62F5B1697BA3C9669BF8CAC4CEFE1FAAEC59F 16 V
637,463,897 *41A7B30D1F2F3B31AAE44A72F5050322F60FD2CB 1-biometrikko
637,463,898 *41A7081E0D34484C6CE1E2A8F5731EC70EAD1782 1GENTIA-RAPORTOINTIJ
637,463,899 *41A86710999C9E52E10AEC9746CA772EA3D03E78 1-informationsavdelning
637,463,900 *41A5DE61F380B7703E74CA4C29E2F0B04EF69E7D 1 jiddabased
637,463,901 *41A3CC24EE627E171254186240AFA70CA11E29A2 1kerguelen-plateau
637,463,902 *41AE877F07220BF02743E7CC997147B3F9FEA964 1-konzany
637,463,903 *41ACF54D3A5D48C31E2E470B48B44E492EA7D4E8 1leeder
637,463,904 *41A9C20DEF123637A61373718A38AEDECB2F3785 1mescolare
637,463,905 *41A5194A86C8203C2FEEF21A70C6E7AA000B8DED 1myconfused3
637,463,906 *41A3A942E8A26A5F600346B37FAECD4D8C9B1FC4 1.SakSuka
637,463,907 *41AACEA607A234C5AB99C9525C69E402D0D4422C 1-TALVIRIEHASSA
637,463,908 *41AA6DD016925449F5ADCDA6F36542E8DC77E49B 1 UINTILIPPUISTA
637,463,909 *41AE602E9B8375CA816DD01F89AE612F506FD40E 1.VALTUUSTOKAUDEN
637,463,910 *41A7293C9E2C7365720584E0653F130790DE652B 1wintergardening
637,463,911 *41A371D5698AA53B70851E9ACF5FED95D2E9636F 20HAMIDA
637,463,912 *41A31855B1063D574DEAF26215E91998FF8C349C 2115236 itse-onnistuin-n
637,463,913 *41AD6E8E0F277E7A1FA0B79FFEB8EA0C4E98C196 2205949 THE.COUPLE.ARE.ON.VACATION.IN.THE.FAR.EAST.,.HE.SAID..
637,463,914 *41AD7871CF5409251DA2C7BEA927182CAE64B687 2269306 luppotuvalla.taistelijan.talon.em
637,463,915 *41A1B3A9797D517C3E9B1BAF63BD0518E2EC06F7 22mar1255
637,463,916 *41A6862EA176DA54BDAA7C62C46EA652CE2E9CF8 2527273 uskomme-my
637,463,917 *41AC081B7DB679F37EC0B34905F98F1487B9C315 2944944 haminan.ja.vehkalahden.yl
637,463,918 *41A7DBBACF002A76925612DBC45932ACB8D89653 2955824 und-das-nach-zehn-jahren-deutscher-einheit-
637,463,919 *41A9CD7CF27DFDE590D0C5C1E3D2EA9FB10F0738 29638 ER.HATTE.DEN.BUS.DER.LINIE.4.ERST.KURZ.ZUVOR.BESTIEGEN..
637,463,920 *41A31C7474E8D15A0EA44CBDBB54787190DF644C [email protected]
637,463,921 *41AA8E380461AE9C8E139C2980823A9494B823A9 2avauspiste
637,463,922 *41AB139F95895E53D296F676F83376937EAD5C3A 2december1136
637,463,923 *41AAD23C4612DA5BD8DD110C785C4556C8B091A7 2LEIJUNKATU
637,463,924 *41A9D2915CCF6DCFC0C98E0078C75D161C0EC375 2randells
637,463,925 *41A26E963F5AF95478F7566E78CC1F238F4B3468 [email protected]
637,463,926 *41AD9463E640725E8BBCF02135B0C507B6C99F51 [email protected]`(>_<)
637,463,927 *41AD15A533EC521E6B26095A5E18C064794E794E 38CC30EF590A376BAF86C309B0248CB4
637,463,928 *41A88825EDCFB6B1C02D91A6B2661BEAF9BA5B7B [email protected]
637,463,929 *41A15D044551E5515058EAC9CF22128A9F7D7152 3AFFUANU
637,463,930 *41A8EA81F926CEB943AA7B1C64F6079A6BFE457E 3AJWNDGBD4
637,463,931 *41A2036DE480919131E7F31234DC249CB4BA634B 3iltatilaisuuksiin
637,463,932 *41A932B175BC92DFFF3CA15C737643CA348F8531 3JUL1763
637,463,933 *41A30C11A7159E1F436FEE6039FE88CFD2576ADF 3thatmotorola6
637,463,934 *41A0B75B37BBE75109EFCAE5F9576741BFB370A3 4BURANON
637,463,935 *41A526D31FAD3FC01899661F05A41CBC1B1EA183 4CURSHIPS
637,463,936 *41AEF029976F680EB882F2C89343C2C1A8D56A83 4MARKSYMBOL
637,463,937 *41A7BD9C62469BDDE910AC8541B6C82490736078 4MOONTRISTAN
637,463,938 *41A5F089F943DD0BFDAEB5F677D316278CB1A635 4-NATIONALISTISIIN
637,463,939 *41A9666BFA08B528C2933BDDF2739E312BF29A63 4NIKATLUK
637,463,940 *41A07E31615FC5AE601B1D27AA7D426F0C964F3B 4PIAZZALIKES
637,463,941 *41A058FA3FE70ABCACF95494BA2185D134ED3C56 4-rei
637,463,942 *41AC8EABAD79B09277A26F4109E349D6C1E80A87 4ROBINJAZZ
637,463,943 *41A2767DC4D482F4797A5745BE7CD638CE7C8CAB 4STRIDERNEBRASKA
637,463,944 *41AF5B0B75E63B22D4E84AB0D21F5AA545D0C6B9 [email protected]
637,463,945 *41A339EE8A453C0A18B5AA7F1FA00E2CB54A4F2C 5AURICULADO
637,463,946 *41A74F79653D96A0744E255697D66FF14F51C6F3 5ENTFALLENDER
637,463,947 *41AF4B257F1C120EFBEB97314FBBF8C061D829FC 5ERSATZHAUSHALT
637,463,948 *41A6A8AC19B85D04274F41E1E83AE4752EA6AB86 5HAWAKUJALIWA
637,463,949 *41A119DBB3F179E032BE6174CAF8798138E56792 5-ISTJUDER
637,463,950 *41A5731D34FE1EA3C201E672D76686028BD65FE1 5KULTARANTA
637,463,951 *41A3E43BB6B2CEA2AE49F2D3C3A99ECBC092AC4A 5MARCELJONATHAN
637,463,952 *41A80068E1F03384DA10CAE773032C75E1A57116 5MENINGSLOES
637,463,953 *41A1E924D4BCC76C721496369B9738137AF42562 5OEKRAINES
637,463,954 *41A217FACCED92CF52598085BA62DF19B8586525 5POSTINEARIVE
637,463,955 *41A8A69F6B026F0CA9646BE4ED3DAAFD45AE03A4 5RECEIVERMODE
637,463,956 *41AF950EA2DFD766F8B68EFE06FCA3D23AEB3D81 5 TIKOTEEKKI
637,463,957 *41AF54441B604D605405589F380918003D02C000 637169S
637,463,958 *41AA6466D4066333C96F3857768B16A2EE815305 6AMMUCIDENDO
637,463,959 *41A9A2554291A5C517A801EE3813CDE921A45E80 6CONVENTIONALL
637,463,960 *41A28E277D05E542C62725C4AA792947C6084FB6 6CREATIVETANYA
637,463,961 *41ABD8ADABC93C4B133802D3DBB4FBA713A97076 6ETSIKEG
637,463,962 *41A16DB686702EC5815556874160542AC694E97E 6FOREWIT
637,463,963 *41A3E7E0E6F02967A8AE0DA4A47D5F7D9E6B9065 6MRSANDERS
637,463,964 *41AE9EFC04F2737F34A0338D1C27C8E52AA39ED2 6OCCUPYTHEMIND
637,463,965 *41AE2EC9759D6734F1B8D7401DBE38ACB4F821D0 6SIROGIRF
637,463,966 *41AD3FE507D241545B2764395C6EDA23115AB9CB 6STNAIFFA
637,463,967 *41A981D8B21EE31E329B729AEEC961A93916E83F 6TRIGGEROFF
637,463,968 *41A02412F8DED82C80C51CA6914199B351611662 7-04-1129
637,463,969 *41A2CEB50894C354508896DC9234B0AE88E40DEC 735marissa
637,463,970 *41A4674EDA058F5C384FA7122556566139B8B75B 796342 ferieninneuseelandkannalsonaturpurheissen.
637,463,971 *41ABE3C11C9C1A0726B0EA35DF5CB8FA1FD5BEB4 7BSWDISCRIBEBSW
637,463,972 *41A6AC936811313CFC6FC824AFA48D801C9A344D 7CEDERHOUT
637,463,973 *41AFC8168577364F6BE3EAE45164DF6ACC524DC5 7ELASTICHE
637,463,974 *41ACA1E803C86AE1C99DE4A7DDC421BAA0579CB2 7GROFCSIK
637,463,975 *41AB82C63082CC8028D56F225A5A6A279C3A8D74 7HAIBYOU
637,463,976 *41AA366D248DBFEDD25902BEA57FC271BA8C6036 7JOULUKANTAATTI
637,463,977 *41A95B4E2F4268A6DCB42C04E5E38EBAC7DE2A5C 7MTPHDRQCST
637,463,978 *41AA8484CDE3C6DC489909C115E6747D1395CFF5 7nw
637,463,979 *41AB7A85C74645E2989175795BFB2CA144D01FB4 7WALTERTANKER
637,463,980 *41A30C91D48675919E918EDB4B6469DE533A7E5B 7ZUGESCHAUT
637,463,981 *41A7C61FDFB6DE5A776CC5285F67A2332E0B0365 81G5KULL
637,463,982 *41A7E1DCF9B304905F3E1F71E2DD0EB86A782D40 846xc4x53a
637,463,983 *41AE8039D27692C2B98570FAF282016E33E3E966 8: 8 # & HANDWRITTEN
637,463,984 *41A0F2AA43A0205B3CEF47BD6FB6AC235CAB48EA 8ACETYLCARBAZOLES
637,463,985 *41A3A0923EA3DA97F04F9951140752F67398AB7E 8ARDHTRAE
637,463,986 *41A9E54AE220C58A56AF86BCD7EA0FA6D8F6CBC5 8ARRYARRY
637,463,987 *41A96387D50CCE8E486EBE9525FDA95B5AED8A72 8CINDERREMEMBER
637,463,988 *41AA1A5D911B2974EBF99DA8256767D502794224 )8(~ ~ db
637,463,989 *41A1EA54426CF388C49B633C2F59C503CAC5B6CC 8EASTRES
637,463,990 *41A090EC0F41B1C7D338F627CEB8F15CF5208176 8FITTNAVK
637,463,991 *41A1DBF4242C58430B214958121AF6D664A458E7 8ICECREAMANGIE
637,463,992 *41A2CECAFC8681CA3D9147AFA12105E9278A4E4D 8LIBATIONSES
637,463,993 *41AE37C44D247C3BC5A621C1BB2CE21D5E510A90 8P * *splat
637,463,994 *41A1F367D5EC813743F22A58EC8539F10CE28B08 }8{-~-~-~-Q----Q
637,463,995 *41ADA923906C238189827597329EA7473C409CF9 8REOSITA
637,463,996 *41ACBAA2CDEA081E9E188C75CCAF321E96107066 8SEASHORING
637,463,997 *41AEFF9E289B14D2C7FF987357190E2B810C2EB3 8superstar3
637,463,998 *41AEA0CCDADAD98136277C142AEC4164249D316A 982989 yhteysis
637,463,999 *41A3AED5326F364C39D0B62FD9AF392890061F23 99999999CARDINAL
637,464,000 *41AB16439716ACF982C5A61ABF2A9AA3B2C0DB17 9daum-affaere
637,464,001 *41AEA671E846AE6556F950051B725B276476021F 9DOHOTOVENEJSIHO
637,464,002 *41AC7FA3A3A610FCF48D50F4F6F7152E5E825785 9G[ e`
637,464,003 *41AAF3E90EE103CC36ABF14902753B453A3BC815 9INEHEIMN
637,464,004 *41A97C7BA9E7A6BAF4253C488B4A8E08EE7AC03D 9MICROFILTRATION
637,464,005 *41AC7929D07AD5F09AA0C343D0AEBBE77D7CCE6F 9NANTING
637,464,006 *41AB909FDE5B6A2D77246FFE51A918934E5AFC34 9SAMPSONROBBIE
637,464,007 *41A29BC6D89804D62C342CD2C21458A0BF2E79E1 9SSENIPEEW
637,464,008 *41AF47396E93EB6BD05CAD7C3ABB93D50F956926 9thatgerald6
637,464,009 *41A2933447B24FB88963F05516E4826D15156858 a2t+n
637,464,010 *41AFA86EB34115B05A0A7DA25A62942AFDA0E75E AA6U
637,464,011 *41AD91B0C17B24FB6CF1BAD37E9AF63869711B93 AAE&)J
637,464,012 *41AE118FD0F38520594D07159BDE821388DCAF21 aansprakelijk1
637,464,013 *41A2E2499BBEF13D91B99AD4E3FBB025680212C0 ABHITARPITAM3
637,464,014 *41ADC3C2B0624D7822FD34C0C96A54CB1C442E88 abnq&
637,464,015 *41ABB2CE56F1F841C830217F07620A2CE944987B ACCONSENTITE4
637,464,016 *41A127F4A2EF69E4E2E92618BA31659E8DB77E17 ace of base ekstasy
637,464,017 *41A29CF87E1DB06DF05A79EA4B5F27D72876A360 ADALYN270
637,464,018 *41A17CF05861562EC082422C67C08D3C3215E959 ADDIECALDERON
637,464,019 *41A1A4D0EFCB741296F61BE7A5625D93E873FFE2 Aestasalturas
637,464,020 *41AB730AE49AE0FC32A8C4E10B85A859E7494C8B AJY20
637,464,021 *41A45463A59920C021F91B8E3D20A39B1EBCA740 akaravam
637,464,022 *41AD94FB6FE5BBA25B70AE44D1A2B028E3EC403E AKIRA44
637,464,023 *41A3D2D13AD134806EB5E8B1F2EC54F799836A61 ALEOSSOCHOZZI
637,464,024 *41ADEEBDE6014EFD2D7B2334E8E198C03A2B9FAE ALEXANDERWALLOR
637,464,025 *41A77F02B8F9C57EEEA9C1D56CD28485B9BB1D96 ALEXISNORMAN
637,464,026 *41AE3182AEFEA7B0B3CCCC4400B54C08CCB2DD99 ALHTNYC2
637,464,027 *41A2303D82E6ADC55C239D7E0F99D79069D88D09 allenpracht
637,464,028 *41A977F5A2CE93CE0305E9118D99415C6FF73D94 ALMANTARIOTIS
637,464,029 *41A91CA522C26C3931B1B488011D8E66F7D5A2BD ALTON.VESSELL
637,464,030 *41A772D201B54A236098DE5CEEADEF795784A580 ALVIN.TIETZE
637,464,031 *41A86C4D29B91D3823EA8091C5AE4BFE5344F46E amandaapples
637,464,032 *41AE6C0097A3B2EEDEF3D1277C6AA64DE8E0FBE1 ANDELGRAS
637,464,033 *41AA229143BB1B8CB3C6946B539B42D7A74FC41C ANDERSON.MATTESON
637,464,034 *41A03DB2441688EA0489A4CE762AEC1B76038C0D andreapadua
637,464,035 *41A66498CCC82CF4BF8BFCAD7E9C6CD2540D4E51 anger begins in folly, and ends in repentance.
637,464,036 *41A785BA303E62B36C6D1B095ADAAF0E3C4CD768 angoisserait1
637,464,037 *41AB24771F21F8E832E2DB453EBCC960137B2ECB anjn6
637,464,038 *41A0FF4222E96C6C57A152E5F62DEAFF5C9683C4 ANNAMYRA1
637,464,039 *41AD8F7E646746BFAFA1F891B55B298B34AEA317 ANTHONY.VERONESI
637,464,040 *41A9E2A279E6A9D298D1476476D8612C2039939E ANTO.SIREGAR
637,464,041 *41A6E03B8227AF6900F78730F9ACDF77C4BF96F2 anyanwuchidi
637,464,042 *41AE61FD9C423529EB2D71D3C0D21944516D35FD apriisit
637,464,043 *41A2F5FBF6E6DD6443DDBEA4B3A309CEBF552DCE AQ-=&
637,464,044 *41AFEA4E6332725C6C4A4150D2BFE2748B6C460B ARMENIAASSYRIA
637,464,045 *41A524CB95A99E4D44E6B2F355004B7CA121DAED ARNOLD.BUSITZKY
637,464,046 *41AB23056818C1C24FF711E1AD265C80FA7F750F arnulfolaslie
637,464,047 *41A92743C00C7FF41B7351B60C93DED286FEFE2F ARRAKISES4
637,464,048 *41A2F83DDB3E006F94D8614F7A20A9B93AA9287B ARRESSIA4
637,464,049 *41A314D8024FFD5C1D9B4E7F4D4837D4538EE01F arthurribas
637,464,050 *41ABB1C175B115582C0B384DB934EDD40CFE5097 askarren1
637,464,051 *41A48C3B592713242E15F34A3B1349CC60BB22D4 aufforde3
637,464,052 *41AD7CAEC78126CC3C710C9D5BE4E0399AD1CAFE austin-tietz
637,464,053 *41A58674BB23F1A08A68D065FC11F627BB7DBAE9 autodes3
637,464,054 *41A1BB7EC7634A00AE83BB039CF2D937426FF618 a,wcd
637,464,055 *41AB7D8BA9F639D6E5279D609C6EF11E0E307506 A-/WL
637,464,056 *41A9D4C4382E9E8BC0DB237F26BA0F29928669B0 B007L4CE5
637,464,057 *41AD29F313FAA0F73F6F71DDAAC1237A8B0F0B45 b308v
637,464,058 *41ADC569F99837BFB4D93ECA1D2FD7F07DB67BBA b4tt,
637,464,059 *41AA4E61E6BA87E9E4DF5C8834CBCA7711C9A1F8 b63q
637,464,060 *41AE20A983D0218B946C40EAAA1666A571909611 BARON-VON-STEUBEN
637,464,061 *41AE81B6202F2A18DF67EEE5382DD2E530B00384 (BARREL-OF-A-GUN)
637,464,062 *41ADD33240FB781C35151F60A071A3D26DF86F53 barryconkright
637,464,063 *41A888415BC2AC92F8E753BE25653640939F7FA6 BARTPAWLEY
637,464,064 *41A52A8B3258D1C6AA55C4369592FCA8ECF527D5 bc.o
637,464,065 *41AD2F839B34EC7ECBB59924E65DC382C74B912C B,CRA
637,464,066 *41A88FE43ACCE982760FAFE6BE88CD19E3C7834F BEATRICE MURIU
637,464,067 *41A8BBE6A8B2429759CFA23A0CFF05994AB3CB23 beckham998
637,464,068 *41A73CA941698A5AA60A5314AC5128795F12E4DE [email protected]
637,464,069 *41A59554CCC282A6A241916A4A735EA698D42A54 bg#s8
637,464,070 *41AB61312872E80CBBA39BE96EC638182FD062CC [email protected]
637,464,071 *41AAA36F1AD0D065A5E4B90BF1265105E080F556 BILLYBENKERT
637,464,072 *41A74256EC51B4D19E0990A01E90A5548C57D540 BIRISCHE0
637,464,073 *41A25A5DE59575D068BD06C9D5D6947E20711C5D BIXAS
637,464,074 *41AA2CD62D5E2F87F0B2047E8FEAB71C311661D4 BLM2K
637,464,075 *41A107DA98A4AC05C0618EE8F1145A1C4DE8797A BLUE OCEAN STRATEGY
637,464,076 *41A1F785ABDFA0A36F481081814B4B5E3EFFBFD2 bmov-
637,464,077 *41AFC935F7D8C4511C41642A172DCD13F8EB1676 bmpss
637,464,078 *41AFE41EBF0037436C0C599F9CC25885B0895373 bnfn-
637,464,079 *41A8661F3AC31E1436A95168FB2F641B17052611 BNFYQ
637,464,080 *41AB98248EE695ED0E80BB4AB438A661144AA407 BOBBY.KLAN
637,464,081 *41AEA5394B90828585D613DE7315220D7AF432AC Boerenzonen.op.Speed
637,464,082 *41A300E62D13672AB9306E7E3FAEF4320788E555 borgarkraft
637,464,083 *41A5D30888867D3A450C25E8ACC371FD98DA781D BO.STOUGH
637,464,084 *41A5BF4286963019F8982DA4FA5775C6B21A6BE7 bouk/
637,464,085 *41A5C27A7BFC42EA4AB4155463CB7D79482B7BA8 BOwn
637,464,086 *41A5AE11CD6BAADA301F747115E1763C6000CD4A BQUPA
637,464,087 *41A7383C0147B6C47446BF07639BD7490A806132 brewer's-yeast
637,464,088 *41A3BABF460C11057EA41195774E16DFBD043EF7 bri81
637,464,089 *41ADD9BFB948B3869978FFADB188566A72156182 broderickmantz
637,464,090 *41AA0F3EEB014D233BB11CAED5B60CDF7E567664 BRONOWICKI
637,464,091 *41AD63054E7592ED312F154B3E5F80AD73C9725C B_SAM
637,464,092 *41A038C52D8FA0FD949484F597FCA1F1069CD4C0 btzvr
637,464,093 *41A42FA59371A1725DB0FBB6CE5E9E29F1A5A6E4 bumpiest
637,464,094 *41A7B10F609763DDB0CBBC6A77B811E9031DC829 BZI8H
637,464,095 *41AC60BDF83054CEBC7C0937D749D8AF4CF1E863 C4")
637,464,096 *41AB1BB75AEABBBD47EE9D4CA2833C953D208231 C4G-"
637,464,097 *41AB6650C4CA13F1BD45175C9D922E2A018830FB C8YQ-
637,464,098 *41A0F7A4894B42A2F796389A630F928861DAC0AF CACHOEIRAGRANDE
637,464,099 *41A6127E210D7B37D76AFB06281426E39191E8EE [email protected]
637,464,100 *41A6298A354DC60C2F71C148C36D8E67A82694B8 CAMPHORSULFONYL_OXAZ
637,464,101 *41AAA82C08B90741B6ABD88F213BB99C149EE3A8 CARY.CHRISTIANO
637,464,102 *41A870F3264FF73A844465E938AE4C9625D2B34D cbr4x
637,464,103 *41A6D77A75F31C77F731B7D81DF02F8760A3E449 cco&
637,464,104 *41AC1B107801446A509DFBF9F8814DB3F091CDD5 cdgwi
637,464,105 *41A9692E340407159AEB3BC665494130A47D36A4 CESARTEREPKA
637,464,106 *41AC98EC292B42741B82BB4C34B9C7D198898BB6 ceymw
637,464,107 *41A43B2B4CFC83CBB0AEA067A20C4EA8E2F8E7AB CHARLIE.SANDEFUR
637,464,108 *41A364427CB61B800E619D69C39F53BA0D51EA2A CHARLIESEATON
637,464,109 *41A9678BF3EC894BEB4AD48F4AC2855F0456CC40 C"HCQ
637,464,110 *41A7AFD3136815D5FE05F524D3F3701E0477D0B2 CHISSIEN
637,464,111 *41AB1262B144E02A9E86E3BD7CE6BFDD1B5DA6D4 CHRHR
637,464,112 *41A227E8FF789349D64C73898EA10433A5D09B60 CHUNG.PLYS
637,464,113 *41A13E2CEB2B76DDC4CDB12641D4A7702A6A2F91 c/(hz
637,464,114 *41A0B5CD066564749EBEB3BD719DF5FABDB977DA c/idj
637,464,115 *41A1783CBF2CD46E9639D5412F673ED74019F133 c(i/e
637,464,116 *41A96CE7974C89504203447B0959A59918DAD9F5 [email protected]
637,464,117 *41A5A4DA7784476066FDF2A6E626BB905F9F77B1 ciy:f
637,464,118 *41AFEF182938E0DE7872F4BA002FA34B8811B5B6 ck5j?
637,464,119 *41A4C46676C74F0564D5FF43BDB9190BADA65046 C/#(L
637,464,120 *41A89BAF2CC8D6C3820141694C745CD89CF9ED75 CLARENCELEBOURGEOIS
637,464,121 *41A1D5A4799314ACABA9A9C46D708BE9EFACBD5B clementekettelle
637,464,122 *41A8BB2543E7F2E3ABBFD6794F973E0BEEA1E6D4 clifford.ford
637,464,123 *41AEF13129227DED782DABD74A34077CC9260E38 clm),
637,464,124 *41AB8AB3065AE762EA5BE404D8D96468EED3601F CLwe
637,464,125 *41AD8079E1C2D953ECC81C7CE98EF5BD1ED6858A CO2K)
637,464,126 *41A8245D0A5025E6C7BF218E16F18B3ABB72D4E8 COASTANG
637,464,127 *41A377B5B11B0F486401EFDA9877D1FC2F3BB999 COLBY.BATTLES
637,464,128 *41AFDF558AEAD3FE4E22C8A9DB70FF2AB62EE2CF colinpullis
637,464,129 *41A41B521234033D1DCD89B39457AD62ADB83FAC [email protected]
637,464,130 *41AAAD23FED4B864C02D7D338069437C556D192B CONFISTATING
637,464,131 *41A6C3B8D0FA999E1285561A190F7D09825E894E connorsmithers
637,464,132 *41ACEB22537EA3DB7EA91ACB1D769F3E070C9DE0 [email protected]!on
637,464,133 *41A9F68E4AD66ECB4110350D1D1ADE6831241A8B C:\PROGRAM FILES\COMMON FILES\ADOBE\HELP\FI_FI\BRIDGE\30\EVENTJS
637,464,134 *41A6A6FE5C7652A84312E46C79C4A46913A02355 cqwgw
637,464,135 *41AF22E686F0E4B92079E967CBD8812211DCCE90 CRIMINALANGELS
637,464,136 *41A714352E18E1C7DC33574D06A3EC77CCC9A07A css8a
637,464,137 *41A39F5954B54DDAAE1EF36C596A33142231E248 cuelmiehs
637,464,138 *41A837D58FBCC0EEA6ABB8CB153AC91F81D209AE cueña
637,464,139 *41A154212791568894BFA9D439EFAC6819B7F32E CVM$F
637,464,140 *41A1774BFDB395083393C9D4723C809DC0B1CDB0 d3gdw
637,464,141 *41AB432CBF64A1BFEA55DD93990DCD1626ECD9FA d4c.c
637,464,142 *41AA91D65DFAC7842C333CBAB54887D3C693D4FA d5bkh
637,464,143 *41A79B9277B65EBCAB481D8A3F2C2E03DEF034D8 d5q(f
637,464,144 *41AE8E0FA7A02765D5D82B052F9A736892EAC76A Da.Estrada
637,464,145 *41A95A820EBF0BF727C01F1AAAE23F145117968D DAFAC
637,464,146 *41A0068A887CED6CE623140E2B4AA682BD6D4DFC DALTON.ECKSTEIN
637,464,147 *41AE0BF8306D53B0319F2E640EEFA8AA4943559E DALTON.SCARBRO
637,464,148 *41AEE75494657A6EFEE8B5074AD7E40B341FC94A DALTONTOWSE
637,464,149 *41AA6037261B0849FBFE9BDA6979D25A1A916BC1 damienmcglamery
637,464,150 *41A28F06507D38D1C57920F2BC4FC4F1F271D5C8 DANRASP8
637,464,151 *41A13AEE2D381669AE02B07E8C8D4B95EF91A6D2 [email protected]
637,464,152 *41A00197ED392CFA3ABFC101E9E995F8B53069B5 DARLA DOWNS
637,464,153 *41AEBF5F30CAFC3DD37B45C152D6385FF79A14F5 DARRENCORNICK
637,464,154 *41AD172487E7F450A4A03D47F00DCB6E45513143 davechina3
637,464,155 *41A72576EF076C8D2D989BE0A998AABB0D9976A4 dayami897
637,464,156 *41A7B13B4176F3A2764D2180D7050144E548EF9A DCYH
637,464,157 *41A01613A61BB784802AED9564BAD480C0E33408 DEBBIE FUELLING
637,464,158 *41A23676A2F687AA52BB9C16F5A0C5BEB0453581 dee$c4l4ton$
637,464,159 *41A5DED6A1B9E1D12C57E9EA643730110C71706E deklinaciju
637,464,160 *41A54D92B5E3F7EEDAB937D54B9A23709DED1F1C [email protected]
637,464,161 *41AEFAC217E95F9A6524F4FE4F30E752FAAA2228 der handwerk
637,464,162 *41A21448CA5C9E9531E9E4BF4F39D4491B2CA50D desma.george
637,464,163 *41ADADADF90592295AEDB9855D67F3194B87CD6A DESMONDBELLMAY
637,464,164 *41A2B3C8B0876DDDEF3279479CA252FD632E6250 desmondpullar
637,464,165 *41A5C9A1DE904EBC1CDAEEF68415FD16636E424D DEVENHAMTE
637,464,166 *41A0CFA73CB7D49F952036A8E9C403D262DCEC62 devonknaphus
637,464,167 *41AE98423A470A056448D96DFE270A93DA7DBAF7 dh4cl
637,464,168 *41A753529DFCBFA37155FB368B02AFA56266C8A5 DHCH0
637,464,169 *41AA2863E9EB74895A3A39A3B10833A3C817BF32 die?,
637,464,170 *41A9FD5F1EA87695ACD40FC4FED02915B6EBE03C disegnasti6
637,464,171 *41AC36497F3DB24AA7D2A6810A900F1042756DE8 djm4,
637,464,172 *41A8C06AE95A6D76A41EFBF99D54FB20E7CD7938 DJMISCHGUT
637,464,173 *41AB48891355DCEA0112C42D2D3D44E06C40E4AA djqj%
637,464,174 *41AC188DFDBDB28268D7DC184550506BFA9770EA DKJTAFRDULBY
637,464,175 *41AE1991B24DB67A6C98E12EC1CD425ADDA11149 d$)l?
637,464,176 *41A3FCE752BD4B38BC0A47F40CA7D7B7EF7765CF d(l,q
637,464,177 *41ABDFBA8BE6914F63857795F8780F12895095C1 DL"WD
637,464,178 *41A793C13E7F9F12A70F59D969F7B3E0A86D3776 DNIFABM2
637,464,179 *41A633F82EA84A51841D84DE873797F330010435 d%!ob
637,464,180 *41A38C20EA54F325E9C73C897EC66F7BF2D2E1B4 doch,
637,464,181 *41AF35548F85E99BF8D381C397C898249AB372E5 Doman-no-se-lavora-[feat-Marco-''Furio''-Forieri]
637,464,182 *41A04A6503DA09B7E66945B584830D1EE0B08F21 DONNELLHAMAKER
637,464,183 *41A9A21815BE73217A161C14C9B8EC00B56A402E DONTEQUIEL
637,464,184 *41A7451E9B645172D9097C32335B73EC225D9EC8 dopierové
637,464,185 *41AA00D91842BA10EC41267B84820361D72F16CE d,ozr
637,464,186 *41ACCA90B855CA72DD6EF3A6C002F27AF8BB4714 dp2bk
637,464,187 *41AD52333EB5AAD91B98646E9CBABEE7A542019D ds78p
637,464,188 *41A0207E124ECB4A88D88732554EA444A69FB886 dt56
637,464,189 *41A30B679983F67F48F57CECFBC09E6C4B9708D7 duflb
637,464,190 *41A4CC823A69888FA952CE1E2F66BEC3D714741B DUV-T
637,464,191 *41A34AC7D907004B9C2D710E77CFE203CB7D57D5 dw]#
637,464,192 *41A310D73F07C2726F865AD3CAF4BE5461C90474 eap=c
637,464,193 *41A5BC3358D6553356BFA74F8005CB94425BCF68 EASYIX
637,464,194 *41A12154CC89F9691D9F1662261441DF53C20D58 EBAUCHERAIS7
637,464,195 *41A1DBA9B4393C7A62F88B57B3B208413E8E50F0 ED.BONVILLAIN
637,464,196 *41A634A3B89F33D0D8C9EC6578108DD4D0999B46 eddie-rankin
637,464,197 *41A855146975D518604C337FED41FE77166263E1 EDDIE-SIZEMORE
637,464,198 *41A62B019DD284A9FBE902D203D4DE054ED31F57 edgarburwinkel
637,464,199 *41A33BEEDDEC6781F3315AF67316B5F722591B27 eelilag5
637,464,200 *41A55B2F2DAC54E543B940C595B702FE0916018C ELR1
637,464,201 *41AC7EE5FE92185DAEF0868495CCC2EFA6D192E1 EMERSON.GLOVIER
637,464,202 *41A75981F7BCFE6175252305A1C38E3CA2EC1046 EMERY.CYRAN
637,464,203 *41A2022D0A73E4CC57D57CB61DB826CC5EF53C1A emmittvaghn
637,464,204 *41AD321851BEB02DE94246BB6F8ACD41AA82AD3D EN82.255.137.192X3
637,464,205 *41A0883C0D78D9DC51B0D77D7D71BA055D0FBB55 enauer
637,464,206 *41AEA3ACA72997B10CD92B8507EA9721BBA731B7 ENPRINCIPIA
637,464,207 *41AF921CAA622AAED9465EAAA76D1BC4764656A5 ENRICO12
637,464,208 *41A12BE0F3946DE6CD2D4BF18886463AA07D05A1 E.-O
637,464,209 *41A4FCFC7536101787B0A8BC63FE0C8ABDF666FD ERVIRENT2
637,464,210 *41A8731CACDAC5E8E4399780EF8D52171531A192 erwinphou
637,464,211 *41A985565E98B7CB817C65264C3D3604E6439549 ESTANDOLHOS
637,464,212 *41A1E6E9F110D8599FB9BB236B4B14141B19669B e;u{
637,464,213 *41AF42EBC0D85BD470AE1F62BBCA8284BA9A3CA5 EZEKIEL.FLORENDO
637,464,214 *41AA76ABFFC0096509C721637A0EE1C6D57DD01B EZRADIDWAY
637,464,215 *41AA53F722A41190B9AAA6E7DB2BC99AE7144B0C FAHRSCHÜLERAUSBO
637,464,216 *41A3FD491B193D7AE22EF7182E5185754EDA5DF1 Falstaff,.that.old.whitebearded.Satan.
637,464,217 *41A8612B23A138AD8A8F1A189636659D25109E5D Fancy-Passes
637,464,218 *41AC70994A2038CD9C37F8D6B7EE52477A1DD4B8 FARMBES
637,464,219 *41A801DC35CEC5A7E44B42DE0175AC7DCE3288A1 FAZ20060810
637,464,220 *41AB55870BE5C6B8080C538DC98DD906789E788F fejltyper8
637,464,221 *41AE88F1BB431BF64BAB5E5F6068FB494A7378CB ferrites
637,464,222 *41A05939A0BF698B02C5634B5588604084D57790 FOA11NG
637,464,223 *41ABF7F0EA0E30C6A5CC8E724D91E660D3AF97AC fourpiecesrumba
637,464,224 *41AB6FBAA6737CA8C0E82298DB8127129775869F [email protected]
637,464,225 *41A16000AE3125254ECBC10CD7AAF1534773A64F [email protected]
637,464,226 *41A1E97EE2ECB1D5003ABE6498DD4C8F86BD3265 FRITZ.MARSACK
637,464,227 *41A02407C35AE94FD21A21F4D38976431B6F3D62 [email protected]
637,464,228 *41ABC3109972885C0BB866A237F88B95619989C0 [email protected]
637,464,229 *41AA6EC1C72170F2C3E061105576357A3DCD6D88 [email protected]
637,464,230 *41A816087BD6AB24347C9335704E2788519AD9A1 FUNCION.DE.ESPACIO.CONSTRUCTIVO
637,464,231 *41AEF256F59349F27AE2A7C9890A9187D4023833 G0AL+3ND3R$
637,464,232 *41A02B5482633F4E34DB6816AAB2E92D23AE9834 gaylordbriles
637,464,233 *41A612AB2F866EEAD74201FB23F9D894C0E4FE1A [email protected]
637,464,234 *41AE9986754D0A546AEE60BB0F1CE247D4FC5E82 gemanierdheid
637,464,235 *41A40FAA2D48EB17386BD37DFA2D8A81A310E44D gffctrdr4
637,464,236 *41A55DCBCED60D3BD9EAB228D6C3A9F291836586 good bye, little friend
637,464,237 *41AADDD7ACB065F2E345807F7F5898A2956E99FF GRÜSZEN
637,464,238 *41AB4C288AF62FF0759A19ABF5E34F74FB6C3EA9 GUADALUPE.CHITTAM
637,464,239 *41A577FDD3C663A529A6FC6DBA211F53749C6E9A [email protected]
637,464,240 *41A5672344FA5C5EC0FFABAF7E3D03CD58F98F3D HAITHAM.HALIM
637,464,241 *41A84D3505EB2AC9C86FBFE59A786EB1C09F2FD7 hanapepe
637,464,242 *41AA9084379374B4DB135FEEB3B5D5AE718C7DEB HARBOUR-LIGHTS-(60-SECOND-VERSION)
637,464,243 *41A93573FA3FD1F18715C1C4D1362429BFA31C65 HARIREMBEJ12345
637,464,244 *41A31008D8BBA3A15AFF468EA2455888ACB2A183 harlandsherow
637,464,245 *41AC51FF6039DA6B48A49CB2E4D11F2C4760B8D5 HAROLD.PEPITONE
637,464,246 *41AC08FFB7C66CAF457895FA9D33E1CFC522BEBC [email protected]
637,464,247 *41A9DE24CE24123F16715506A4B6DA41CAD9A27A haydenmarier
637,464,248 *41A8062423E82561C3708EA3F087006C8813583B healdeth3
637,464,249 *41A59AA3A0E556109CC9A6B180CC00C536BFC7D4 herbcarmickle
637,464,250 *41AE245D373870985079791F8CE702CBA427AEA3 HHOLFERNES
637,464,251 *41ACD549F6812A0C25E9DD7C3B0443C2FFA8EBFB HIRAM.MAYSHACK
637,464,252 *41A29D052825048265E0503A9B913826CA0E646C HM-QARYCGTBW
637,464,253 *41AEEB32E982DE853D9DB054D3E6DCACE15B71E0 HOEHLTES5
637,464,254 *41AD9AF38C337A039774648CEFAFED6A580E1D2C hoodhop
637,464,255 *41A82578E8D94AA14A5349E6E7AE335F96E8EA4F [email protected]
637,464,256 *41A1A2154B3ACD98674032326770ADDA806E040C IAMESTELLE04
637,464,257 *41A241D53BDA90E680AAF2BA7416523C118F1A18 IAMSWOOSH4
637,464,258 *41A3790BB60678C8C24F46A68EB5D2EA14E6F420 icawie4
637,464,259 *41A53D37C91C824C7E898ABC37D392AA5071FCAE im arealboy12
637,464,260 *41A255C634C53608BFD823DA94AFDAC705C39EC3 INSEFIEBER:KIFF
637,464,261 *41A262EACC31F7BDB1D07ACF9019A7D7C5E831FB INTERMIN3
637,464,262 *41AC0150FAECBC480FF45CDF14EE6764DE67CE07 iowaaviationmuseum
637,464,263 *41A1A01343F2F1368113B1B104E92249CC3E6D0A IRISGNIS2
637,464,264 *41AD8EEF88749D1D7536D7980F32224C2DF44DF8 IRWIN.WOLLE
637,464,265 *41A8473E53822B883B5F1DD8B95886BEC0EAFCE4 ISAACGENESEO
637,464,266 *41A5654A9D959F6FF92C6DD139093C3F299C97D3 IT'SGONNABEALLRIGHT
637,464,267 *41A632963981A593FA68AE12B45C2898490DA428 J"1B
637,464,268 *41A76B0808B087425C3F199E8E43B8760F130A33 J=>5
637,464,269 *41A4D5C0A7E3C4D5F7C0439551DFB504253CA97A JACOBMANDIOLA
637,464,270 *41A8D12996A703916CC032465EC5DFC3694240E8 JAHL94
637,464,271 *41AAC4FF27E0EB8A73A44CB870D60FA0941D0462 janetling
637,464,272 *41ACA7F3ECE3A73DA58FF2C431614BBF4749FE5E JARREDSILVERWOOD
637,464,273 *41AB90FB959EAC49D83D0DE44ACD06F8E3AE1380 JAYDIN321
637,464,274 *41AA862DF642BECFFC7EDB77116A4CE483C25778 jedmccreight
637,464,275 *41AF20D83EF2835C263A75AAC34FDE55B45D475D JEDRHOAN
637,464,276 *41A23CD56DB440CB65B252F0CE5F9BF248A06AE9 jeffereyoppelt
637,464,277 *41AA1BB218E8441E6B3B221B003031AFD94FBED9 JENNFELICIANO
637,464,278 *41A42888B6A3697EC5296089F2CAB942674D8790 JERALD.DEARY
637,464,279 *41AF260B9B3F8F3DB8AF77BABC6BCBABCE84BE47 jeremiahguiberteau
637,464,280 *41A980FBE198D45D9EE8BE894ECC820D163E3368 JEREMYNAMIHIRA
637,464,281 *41A9240B531DA28DF9D4CB74BAEAB178E0F2B330 JERRODSPAAR
637,464,282 *41AEE4020EE83F2A0D010FEC6A9495CDADDF2876 [email protected]
637,464,283 *41A85400C51AD8684C10EB7385FD138422DF7F79 JESS LEACH
637,464,284 *41A0F698533D4F1A1E051C528326A3589AB92470 jetasia
637,464,285 *41AA34AED98A23E943F50B18EFC653FCD7696115 john.bucknam
637,464,286 *41A773CF126056C32B1C4B8A194AA54BF41AC4B7 JOHNNYDEFAZIO
637,464,287 *41ADFEEE0392E2DAD6F1B7783C1D92FB6654AF84 JOHNNY.TEFERTILLER
637,464,288 *41A55307461C6FBEB637519FF23A3DDCC057F1EA JOHNSONHUGEL
637,464,289 *41AFC1E3DC1BBD536AF7AB7DCA07823F08768939 JONAH.EGGINK
637,464,290 *41AF4BC57318610FA60114B5828D78FE129E1780 jonathondehaas
637,464,291 *41A3316B5B97FAF0225B58AD0274F24D303A8C0D JORDON.ROUS
637,464,292 *41AD9C4C6D754ACF9D38CB46388A05DDF33E791A juliansummerson
637,464,293 *41A2BEDD7F65E1AC6CCBF474994082A5DE3C1B63 jyougjm7
637,464,294 *41A4BDF4C772CEBA529F72612936B8D0CF7806F7 kanoy
637,464,295 *41A655A3E6C9767B3F3EF6E3B8AA41E0A692582C KCEHC CIFFART ]AC[ 6801
637,464,296 *41AA5CD0B43F5AF2CBF334A08352AC26A62C88F6 kellyhappy1
637,464,297 *41A46C5038A63A9AF2B3C5A33FA63EF5D1B3F767 KESHAWN391
637,464,298 *41AEC4195CCA42F425C0E195676CAE6124BB3CC1 KEVINWALIZER
637,464,299 *41AADB12727B187EEF423808865DE3F8CFECBEAF khalid.al.juboori
637,464,300 *41A6D9173C073B7FFD95F82FEA0AE2735DFC53DF KIBBLING
637,464,301 *41A0346D715075D8336CA5E67BE39923E54CBD78 Kim.Ambriz
637,464,302 *41A00EDD89D0BC49D6ED147F2E5D3AC2F1DDB2D7 KIPBONDY
637,464,303 *41A0DD8BAC7880B4A8D3374F4DB227A21E85EE61 kkawz527
637,464,304 *41AEF07452D3C16A2C1FBD0A19E5C8B5B88B0DBD [email protected]
637,464,305 *41ACA2FF8C1DED2639532FB26A1DA6E8757DC1D4 koturbasz
637,464,306 *41AAB60D9E47FD8E346586E5E2DF5437E072B736 K%WG
637,464,307 *41A42CFDC061801BB39B2610A8295633B203EDFF l39!sl4tr!x
637,464,308 *41A2E193C95A75E8FAECECD66706F7817B817E52 landoncampton
637,464,309 *41A59DD7A874C8827C3904C5B14627D311FCA158 LANGUAGETOA
637,464,310 *41ABB7D68D3F81F1A33BA5F119E64F75BB49837E Last.Affair
637,464,311 *41A33671DC2C183F91589E9ECBED0DDCE63DCA24 LAUCHSUPPE
637,464,312 *41ABCAC2F66052DF31DB9991A05CD49CABFE9CB5 L):D
637,464,313 *41A99F2C0D1BBAB23D3EDF5911964B194A33084E LDTGJII43
637,464,314 *41A64E47E9BBD75BF49E1D1CBAD6732B8610B984 legitext000018043139
637,464,315 *41ACE2EB8B958FEDBFA81D367F829FD808B30A85 [email protected]
637,464,316 *41AFC7AD41FDDFEB83EAAF7332CBE5CB5F363A09 LE-PETIT-BORNAND-LES-GLIERES
637,464,317 *41A91CC889C0E1367C68D760F3D66AC3715A3667 LESERÄUßERUNGEN
637,464,318 *41A789682ACD00E2DA64D26105ADC3C1217E9797 LESLIESYRETT
637,464,319 *41AB66D204FE7B46C5A21C9CEE18B24EC28B0A8E LESTEZZE6
637,464,320 *41AB72F080C4522714FF63073D07578218EFB266 LETZOMA
637,464,321 *41ADE5D3C0F814B78775CBF0E36E617357C97237 LEWIS.LOUISSAINT
637,464,322 *41AD9F6AA8D42B95807C0F60CBC9FE67C22DA720 LIDENLIDEN
637,464,323 *41A3F9E6C5AB392F5B8B5D0B67831423BF28620A lindseyshetterly
637,464,324 *41A6ADA9ED1BA8C3FA65257B4EB56389C789553A ˈLIŊKːI
637,464,325 *41AAD173E63314AD27C73281812D8E97A2BBB7DC LINOMARLETTE
637,464,326 *41A49AA3BDEEAD87E8EC1BBD9199B89CF7203AD8 linorutten
637,464,327 *41AC04A15D2F4CAA9CAD3F5C53492AD7737A749B LISELOTTEPULVER
637,464,328 *41A533C9B60695CB685E3010B5058D8A2B88D34D LISESII
637,464,329 *41A91CAFCDFC267318683B6D0A9086840E0169F2 [email protected]
637,464,330 *41A19DAABE37F5FD9676AB0AD53CF69E5C2DD500 LIZLE RAUTENBACH
637,464,331 *41AFFD05DAFC36D88DC697FD4002273C0E2057D2 LONESTAR50
637,464,332 *41A27293BE234C0F9AEB96CDD20250092F12CFEA los10ang
637,464,333 *41AC56330A31630AD5FEBDE5BE57F41B62AD5586 LUCIANO.IDROVO
637,464,334 *41A69C8104B8950F6007F8D915A5EB63A5979D84 [email protected]
637,464,335 *41A35BDE72FEF0D94FF4BB4425EC0E702FD53779 [email protected]
637,464,336 *41A0C2904DA6844595DD51A70077E4DB2E721ECA [email protected]
637,464,337 *41A50045D6B42383827E40B8E353A9FA956F448F magicpixelcomauwww
637,464,338 *41A087769F2683A5CE818F7F395613AE69829103 MALER
637,464,339 *41ADBB11B6AEB99BFAEE7CA679D5FC203254C06F manuelwalkenhorst
637,464,340 *41A39E4EA82ED82BBAA3DD4E90F6F6A38008BD61 MAPPA3
637,464,341 *41AECA4C16612C3787A3DC4825DA9CBF7BBFEC1A maprwdw5
637,464,342 *41A3B22AD852B461FF9CEB6B6E20075EC224C0B2 marianohollenshead
637,464,343 *41A433B08B9EEF20665C69E4977A26FAB0C7A7B2 MARLBANK
637,464,344 *41AF8D8A1519C55E8628234021BE120D025B2A2A marshallphann
637,464,345 *41ABB176A52428770CD6AB90E21AFFEB49262D3C maryfatouleh
637,464,346 *41A26DB294BA1B23B82FBA082A599164D46B7D21 massivert
637,464,347 *41A900DC2E6188158D8368A2F39E212C1959CE60 MDCSRGCL1
637,464,348 *41AC87EAB2F155873990CC684217A0A3A2F16284 MEAGNON3
637,464,349 *41A1FA7019FD7B40EC04E1DEFF6953C15905067F MEASUREBEAKTHRUSH
637,464,350 *41A16CA333EA748F3C606658F617EE00663F097D mehandas
637,464,351 *41A3C30E03380D27856221B5217049F9CF9C0129 metadidei
637,464,352 *41AC33EE350A5F7D382D2BD744EF8051E9C3BCDD michalynn1
637,464,353 *41AA6AE018B3100AE7FB608DC376F9877073222D micole01
637,464,354 *41A8A4387C6FB77D3E96BC4511FE4BC7D39B261D milesfesh
637,464,355 *41AEF3F35B2EEABA5F57FE6E1339CBA46A4FBABD MINAMI-IKEBUKURO-HARDCORE-CUSTOM
637,464,356 *41A2763D351FB8D3224A8DC7594E7E95321D81F6 MINCOLA1.BBS
637,464,357 *41A0506138BE34A5525A2EE4A7BAD064D44944B0 mkdir.(&quot;newdir&quot;,.0777);
637,464,358 *41A0992D0A49F3877E8BAF89DD33D8FFCC6D2025 MMASSMAN
637,464,359 *41A6509D62E57EE975CEE811B953BBDA4EF6833A moblost361/2lbsontrimspaorsmellsliketeenspirit
637,464,360 *41A435A9076EE0F1AF6F38E218EC2A359487D46F MOBSUS
637,464,361 *41AA14B9D639961F17FCFC151C1C9B2E2CF51467 MOLITOR5
637,464,362 *41AADC52CC8E752B4E7FC2784D14DC1391780487 MOLLY-STERN
637,464,363 *41AA963C497BE275BF48BD8816D1F10854336F9B mosaicometallform1
637,464,364 *41AE4A68EC19D1FE37C8D28DFECE11F5C9664289 mtcgteam
637,464,365 *41A3D7044FE04AB65F456FEB56E80DFCD7538F1E Music.for.Cocktails,.Part.6.(disc.2)
637,464,366 *41A30F3D4A622442B7CCA845AB1CEAE4C8E398E6 music-meditation
637,464,367 *41AEE4DEB2D6B5D2E5ABA77485093A2D6C113A3D MUSLIMED2
637,464,368 *41ABF723620E21A6E0A9088163F04DF6BBB1EC39 mutat!0n
637,464,369 *41A7302778A71B8D906D532016436CE3CB9A5431 MYMORECATS41
637,464,370 *41A83C4C5D3D1E430D10B58C03EC8DA8F9A7F2A1 [email protected]
637,464,371 *41A68F78569A448A6A0B1DB68EA3E9B9B1B73D22 [email protected]
637,464,372 *41A8300B6F68D911C143A4FC8C6F50169C575CF8 N4IULUI
637,464,373 *41AD7DF2D14809615EB862C92FEF4FA760851E1A NAABIN
637,464,374 *41A61592D05B8ECAE3AF5E28B82681D1409581D3 na-ku
637,464,375 *41A522023F1B4FD0CBEBCFC92A9CD834264DD623 NBoxingDay
637,464,376 *41A290009FA14CF9AF1AA944B27F163FBEC837C0 NEM EL
637,464,377 *41A19EB0C0778E8FB1565E66F03F1B6B42E008B0 NEWTON.COWNS
637,464,378 *41A617490EA2B823D7063C9432D43C35870A9BB4 nguyenphuonglan
637,464,379 *41A9E1D1CCF7D08F1504D01FB58182E4B9D26565 NICK381
637,464,380 *41A04B6C60E47FFD3B6EA3FE9F70F2E5D14B3FC5 NLIPPRE
637,464,381 *41A07BEF7ABE3B27D5CD9CCDAF03795FEB02FF82 Nocturne-in-C-Minor-BI-108
637,464,382 *41A6738166B5531A44F96177337DC3199DBC81DE NOE.CRITCHLOW
637,464,383 *41A9D79F18DE9F8DD8B4136668E1DF56F0387A95 No.Llorar
637,464,384 *41ABAD10AF60C76A2C22437526F7115569189879 noninh4bi+4bl3
637,464,385 *41A9754D5234090D6A771FCCAA9686EE9CD7EF88 NORBERT.RODRIGUEZ
637,464,386 *41A69B6CCB5BE3DB776814A962439607DFA22763 normandrias
637,464,387 *41A81A3BE509BA55F517E10B27E37139220AEA56 NORMANMONSALVE
637,464,388 *41A8211CE74C92377A449C5707DEDFBA5F308029 NOVELLAWHILE
637,464,389 *41ADE3ED027F9526E894430BBE684EB836936AE3 NOVITAET4
637,464,390 *41AB11DFEA5C32CF0DA91FBA2A44B5E2A1DECCB1 NUMMULITIC
637,464,391 *41A9C6587546E0D291ADC5346878D7C4E2292313 NZAYOKV
637,464,392 *41AA7B05C5FC1E81F5F75D700EA38F8662CC005A OCIFFAB 1
637,464,393 *41A471A6878154BA71C0631FD786D216B37033EC ODVJETNIČKE
637,464,394 *41A938FE49A6028F8C964527126FD4D11B555D80 OFFICESUNITE
637,464,395 *41ADCA43222655EE1B5C4CFE44DD9F192233FCAD OLIVERREETER
637,464,396 *41AAD5F9C4908BED9A843E311FE305E772EA8506 [email protected]
637,464,397 *41A1FCCE981CE1E226721BE4F5072CEBBF16D137 ONGEGRONDE7
637,464,398 *41A84C3029C289BA35A0C7E292611DC17C130D10 }O{O~.D==P
637,464,399 *41ADF7525618F78418A3A316D295D14839C8F46F ORENCORREIA
637,464,400 *41ABB903F682CE442F8CD12BD5B2F3153775B551 ORIGINALCOPY
637,464,401 *41A24D9E52BEF9EF73E4605FBBF0C98806271806 OVTFRETU61
637,464,402 *41A87A999878F2C7FEC518FDB8911714FECE76B4 P#^%
637,464,403 *41A93F26CBC5116D8E789BE785849F39B140073A P.7994
637,464,404 *41A84820625FD28C48960DCC8EFD180F4B63D89F PABLOHANAFIN
637,464,405 *41A557B6452DE8B4269A2F9E0630DBA768E0309C PALAVAAN9
637,464,406 *41AC900112DD231124A0ADE0B6A195B595D3F2B5 [email protected]
637,464,407 *41AB80DA7002FE5A1EBA8120E002AE8C98CE8176 parisspunky
637,464,408 *41AB0891297FDA856B26F9642289A356E9EC3CC0 PATRICIABALISTRERI
637,464,409 *41AB4C4EACB26F69993CC15E563402AB5431C99C PATRICIA.MUDD
637,464,410 *41A7940BC2867EC16E84F893DA7C998BECDFD0DE PATRICIA.SEUELL
637,464,411 *41A5E11A0EA1DC58BBE01D0B549D8C55FFE6ACCB patsignorelli
637,464,412 *41AC73A3D3DC26E324F139C655A407F8C8CA494F PAVANA.HISPANICA,.D..50.(HARPSICHORD:.BOB.VAN.ASPEREN)
637,464,413 *41A3C91B60728547C42A10F05F3B65EA1EC697A4 PAVANE (2006 VERSION)
637,464,414 *41AE19A16554C853E4E581202A378B65A7136C96 P####D~0~O(0-0)
637,464,415 *41A7E95F7373F9D28D6558004D8C46EB58DE389B PETERVANDERLINDE
637,464,416 *41A2BEC887646FC6577CF728D81CE68968EF3AC1 PHILIP.HUESTON
637,464,417 *41ACBF6667E283B29A8719FB561356B6B7128C52 picard1234
637,464,418 *41A4DD47774D827BB4755B192E0F9BCA40609F6C PLANE+AR!UMS
637,464,419 *41AD105AE845B6C633B9EAF19808CEAA6774216D PONFALDS
637,464,420 *41AD3DF9D94CE6FB9C8A499C18C1B816DC513E0C P===P~0 ~O (><)
637,464,421 *41AD3A10C10EA5E85AEE98707A82EE103E1B5296 P----P-~O-~o>-<
637,464,422 *41ABC87796329EB5DD9BC8DC8582F4D73F7F873A PRAEMUNIO
637,464,423 *41AF4B65F6A1903751B7C586804EC5C7B4C721FB PRESTONLANZETTA
637,464,424 *41A9EF7A8EF78D210AEF96C25A1CEB4B2D7CD961 Pride./."Confession.Box"
637,464,425 *41A453118AB099F67BD4CB574B5F40C24C105C40 prochlorite9
637,464,426 *41A668732541632C8B86EF7D44A256B38E9CDC52 QL/$
637,464,427 *41A735443C80E0397F746765A8110F823A26827A [email protected]
637,464,428 *41AD1CF03FA5EB81F9E8A036326F25C7E1BA3A89 qosera
637,464,429 *41A6BAAC10DAE8B588BBE9B70B77D9B5E8DE3AB6 RALEIGHHEFLEY
637,464,430 *41A775EEC5E4E8640DC2FA6CAE1BCA2363FC2D09 ramanted
637,464,431 *41A86C962BCDA44FD1419A60AEFB72CDAD74E965 RAYMUNDO.KLAAMEYER
637,464,432 *41AA9F9482536071F9A2DE414D85D4439110FDE2 r([ctx
637,464,433 *41AA17A3FEC91714EA6C629174D3B9ABEA37C038 REDECORES123
637,464,434 *41A406701170F4B6603A2151BA9F98E7E0971584 REESBJERGENSER5
637,464,435 *41AE8A9195C28843FBC76DDD1E7C639331E02281 RELEXE
637,464,436 *41A7BA037D47947DAF825C9094EF7C0F8C4E5938 REY'BOOMBOOM'
637,464,437 *41A1C37C69691CE00694D1FD932C7E037D757A36 RHERIGEMS
637,464,438 *41ADBCA0798DE66FBC3C49E89CC95BDCDB8A4953 RILEYNORWELL
637,464,439 *41A3D0958754EAB6DA5E6DF6CF47301C18CBB748 RIMPIATTANDOSI1
637,464,440 *41AC9A7C0B57165BD66D4A17ADF6D9C69F037246 RL3OJ
637,464,441 *41A966AA86FC4464611E4210AB05FB2B369A58C7 rolanpascual
637,464,442 *41AFD5FF745D7B61CD20C273B931D3D3B2EE5FEF rosariotoulmin
637,464,443 *41A7ACB379F74407F99629E1666D0042FAFAED6E roscoeleberte
637,464,444 *41A183244EAB46426577B11E11867B1FC72BF6FA ROSSINIBSW2
637,464,445 *41AAFEA686F5EA8753AF743D62B876133762B1E9 ROYCEHAUSLADEN
637,464,446 *41A34610E39B901BF6E12F9E04D4A1AA11BB3D9F RQZMJP1UACFDN
637,464,447 *41A678CF33595F6C3C79CFD0978A72F303C1618F RUBIN.HAYDEN
637,464,448 *41A37B0D2968F8C67CB78A7AC0E6E8155650DA7D ruinate7
637,464,449 *41AE3EC867269683FAEC8659BDDD1E44D9B94566 SAFELIGHTN
637,464,450 *41A8EFEA3FAFE950841C37FFCCD11861CA143738 SAMUALHARRAH
637,464,451 *41A2FBDB917611AB71545C2238EB616DE8748E08 santiagodelcampo
637,464,452 *41A25C9BA8B75F30CE6C1FAA976C786F5A6CE25D SCHIAPARELLI4
637,464,453 *41A14569301ACA01D0E1ED56D852C5F74897B085 SENICIAP
637,464,454 *41AC6D330E98237DC234A4E254444901905AAB7F shannonbowling
637,464,455 *41AC9AD4A8384F8C17CE9C36C6B3F8B81207E801 SHEENA.DOWNS
637,464,456 *41A51B14B0BA10EE6C9D9DF13D4FB77989B1767D SHERRY-DSOUZA
637,464,457 *41A543CF407C0467E0EB201425AF1D3D161A6FD0 SHIVERER.
637,464,458 *41AC5DC8497747CF33F8109CAB590FF048F3BED6 SIMFLEX1
637,464,459 *41A7D13B89FD5F34CB08ABB268910C3864651C06 SIMIBLONDYSMY1234
637,464,460 *41A035C27F5F31F22B21694591AE14932D9D53F3 SIMILAR-IMAGES.GOOGLELABS.COMSIMILAR-IMAGES
637,464,461 *41A7C87B8C596E7227E6F6444A50950CFA8B5DEB SIMONPHO
637,464,462 *41A58DC9BDA91F2C6B58AA52F980562E7B3A0575 [email protected]
637,464,463 *41AC3967762FD18DC2C2811A61D5914177D51C98 [email protected]
637,464,464 *41A24CB3E941341B8F88A9088DAA1A97EE0ED979 SLIIKETTS
637,464,465 *41AF13D759505CD28AB275BFE6A027F340A1F957 snoimias
637,464,466 *41A9CEA9090456620273B237F7ACD5FE732752C6 SomethinginMyHouse(DeadendofEurasiamix)
637,464,467 *41AFF4C8A3B2AFCA9D613921AACD5B716BEE9E9B SPACEYOUNG1
637,464,468 *41A9F801EBBDA7B6629F0266FB1FB8F9DDE5B3C6 SPLAT0~<-----8
637,464,469 *41AC5C834CDAF6608CE3481286563F80F9054349 splat* * (=3
637,464,470 *41A334B708DA70E45EB2A6C5C3ED86ADD2D8BD5F splat ~ ~ ~ @######p
637,464,471 *41A247EBE61B0EA3CCCEC6B933D81FE7527BC2B8 SPURIASING
637,464,472 *41AD976D68BA210D7D05890969866A849988B98E SQK64J
637,464,473 *41AD5C1142857366EC03E4CECE84AAFCD712648B sretsmals
637,464,474 *41A3BC9091DB362058802079349072D38D502661 STANFORD.MESCHER
637,464,475 *41A90BF854E931B1F1A38159EF28F323C90B1080 STANGENKONSTRUKTION4
637,464,476 *41A4FD560379EA63B9660F1D8A01D33BDE06CE14 STEPHANIE HOSKING
637,464,477 *41A8DF4C5684BC73EF7EA1E0995A70D2704D7C7D steve-donalson
637,464,478 *41A9ADE5833A17D8EBC1E7AEFC7F4BEE4C39D4B0 STEVIEROQUE
637,464,479 *41A4468FE80942991B54C2514AA751B4070AEBE6 stoney73
637,464,480 *41AC1E5A76361FB9689ADA8652A4D4FD022ED22C STUART.HEIMSOTH
637,464,481 *41A9F8F3D7B1CC393C8DD33969CC7E7573F32A6A STUARTRADEKE
637,464,482 *41A4E97CCDA460A610D2375F7C0E4A39621FB0F3 STUKASIMVISIER
637,464,483 *41A83DE865E36027E5927CFE5107EA3C933DCEE1 supplantez
637,464,484 *41A20B09121A6BECCB1349D4F280437C9B38F301 SUURVALTAPOLITIIKASSA3
637,464,485 *41A3C3017454DE230C3327F5F569A9B5FFE1DAF0 SWENSON4EVER
637,464,486 *41A2DD1B032A7B5C37FDD79ACB2D7CA6211DFAEE SY28663
637,464,487 *41ACB17BE9FF08F094B7C4644F104550D545D310 [email protected]
637,464,488 *41A42561900C0E3F951AAB6E07473AE1A02F719F T-AIEE
637,464,489 *41A024389DF6566AAF46BB79F5B06E4CE2CC5AA6 TALKRICHARDS_PIPIT
637,464,490 *41AB31C54FDDB4513F58CAD3886C7CB1561C63A0 TANGGLORIAX
637,464,491 *41A391FD01EC882B7A9BE35084986DD850117278 [email protected]
637,464,492 *41ADC9C1F22D37F8418B16B6BBB3810F0D67E41D taylorozer
637,464,493 *41ABA90D0E89AF53DEBDC114847668A2A7294368 tecnica7
637,464,494 *41A996F611690198C82B61D21C6EE6132FAB3243 TEMPLANS
637,464,495 *41A152FCFA7E0F72F6F4D07DB0428FE5674C81AE TERRANCE.ABLANG
637,464,496 *41AA837C9C3E79EC1F3CBF2F3B53F8B939F81C4C TERRORIZZ3
637,464,497 *41ADBEB63EDFA72CD7FE9146429CD2B34E4CE381 thanh-đa
637,464,498 *41AAFDD5697C506D9682820D530534DEA784EF4F THATBOB82
637,464,499 *41ACB9696088EE3870285F1B9C00DEB5CED2C33C the beauty of this form
637,464,500 *41A271066EEA106FDDC6A86A8F7B1AE9A5B53BE5 THERESIA-SIMANJUNTAK
637,464,501 *41AD40CF31530E07DBEDB9A4DF14DD79A6F11C86 THOMAS.SEYLER
637,464,502 *41AD96ADCF415B376C78817F7CE8C565C790EE42 THUMPERMAILER5
637,464,503 *41A095D75D66C688647B58350BAC5803378C5B77 [email protected]
637,464,504 *41A1E5A47777767440E669AE05E5E918A38CEDB9 TIGERJUNEBUG
637,464,505 *41A24E13843E96EF92AEA6912D995949A796BB79 tittiatcokewordpresscomtittiatcoke
637,464,506 *41AECFFA370C5E6B1D3AE097BC60343FFAFE02F7 [email protected]
637,464,507 *41AF8288F2FC3A20D077D3D87BFF8A1E313EDC42 TNASIRYT7
637,464,508 *41ACEB3D0C0EF8A1BEBDD834BA0FDC7C78845E95 TOERNBLO5
637,464,509 *41A2537D8C64ACFBBC79644C6C34DECFD3879C2D [email protected]
637,464,510 *41AB43DF827A4E63675175208F71D502145D6E42 TOO LONG OUT/TOO LONG IN
637,464,511 *41A4ED63E28CEAC15793099BF9C54B94CB4C5217 TORY.TRUEBLOOD
637,464,512 *41A379CE2664FDBA581DC6E7F3EB88E8B51F63B4 [email protected]
637,464,513 *41ADED6A4EBCE2EF5118DCE53237835AC2807542 traktatna
637,464,514 *41AEF8104597A796B85A7F538A798DB6853E5128 TRENT SHULTZ
637,464,515 *41AB544E848B2C31F60E12C7973C6DC93B22C0D3 tricellular
637,464,516 *41ACEC0842BC420188C93783CFE72564C3A1B768 TROYJOLLIMORE
637,464,517 *41A2D5F089992726401EF6A1C7FBF59DCE744C80 tsanfleurongletscher
637,464,518 *41A9A2CA32288D8B0610C9E4E33801CA95D4A907 >TT/<TUODTS>TT<-sa-elif-emas-eht-ot-srefer->TT/<RREDTS>TT<
637,464,519 *41A7F9E7F2104A2E0A03E28B85772D3733783712 t"u
637,464,520 *41A9AD990B5A9ECB1C91D48A0EC9DEC236F80CB2 TUCKERAUTHOR6
637,464,521 *41A33D7CF087A5CDA38B0389B9C9EA77B7455976 tunka6
637,464,522 *41AEF1CABAB04D38661A7BC327CC7593DDCBA1C9 tyleraustin
637,464,523 *41A673E1702D68875D0103C5E8BFCF6290E4DAD2 u+i.
637,464,524 *41A9C3786898DB3D9AEF4C5000EBC97F7BF59AD1 ukrainian bell carol - eric's version
637,464,525 *41AEBAB8B24D9E1D98E343FEBFED93B597C2D9A5 [email protected]
637,464,526 *41A6712FB92A315BE49627F6545B2B4F55B14B7F VAKITUIS4
637,464,527 *41A58D27250ED39BB84C5550009621AFF4C3741C VANESSA.HENNESSY
637,464,528 *41A48F2A48A097E66118461FBAE5EC2F04812FEA VAUGHAN BOUCHER
637,464,529 *41AFD698A2A33F5235885A336E975B55ED0F0216 VF+R
637,464,530 *41AA8190220949F8857A2141F5F6F6C890EA2A0D vicmar.tirambulo
637,464,531 *41AF551C51E3637B930719FE229917654BE84999 violinis+s
637,464,532 *41ADE296848386F00FAD73518FE4DABCE9BA3B17 vischal2
637,464,533 *41AF9FFD2749897740C36FE83B11731580768D1D WaltzinDflatmajor,Op.70No.3(Posth.)
637,464,534 *41AB28DA8FE1E6CD3EDDE1EFD7F3A658787BA683 [email protected]
637,464,535 *41AA3581E90D25ACB4F1048B814FE32333DE5A66 [email protected]
637,464,536 *41AD8C35BB1703191B19F42E0BCA1EEBF23A34EC WARDGREIN
637,464,537 *41AC4726461403D617E42EE83E87200F3AEC78CD WARNERARAMBOLES
637,464,538 *41A42491BFF4D8372CB03A1E770256983983073A WARNERRAVEN0
637,464,539 *41A26100A40F421DBF12D203F20969E60B7E714A WARNERZAMPIERI
637,464,540 *41A6AF4348F934BEDB86A28027C21948D6601832 WARRENHARWARD
637,464,541 *41A432F4A6AE5E9772006B5CCABCB54A5060380D WARREN M ENDINO
637,464,542 *41AEA78C9A78113AC48553D9A2034596AC3EBBAD [email protected]
637,464,543 *41A0305862E49E0FFA181B295CB8A6C65C586872 welcometofyrestone
637,464,544 *41AC3CDBE25BF1542A5FC73BA3779A4840C796D6 [email protected]
637,464,545 *41A480F0F3DCD942B28053A15422BE75946F41FF WHAT MAKES THE WEATHER, REPRISE
637,464,546 *41A0E4ED4A34CDD828EF33CDB252C5BD93AFCBDB whose arms are you in tonight
637,464,547 *41AAA162FEE98D67C3FFE02BAEB685CA5E59D9CE WILLOW.SONDHEIM
637,464,548 *41AFFDB2B9BFE0688F598B6133917F796597029B WIS7ERIA
637,464,549 *41A7411EA49DD917BBB2DB0EB3DBE9F5E849C6F8 WWW.AROUNDSADDLEWORT
637,464,550 *41AB393AAD30053CBE5220441B37E6757F3217D7 WWWGECKONEWMEDIACOM
637,464,551 *41ADC5F4D9C473BEE91DA8BD9DC7DB5AAC69CE9B WWWGRIUMINHOPT
637,464,552 *41AB60853B08402A9C874F1559173EFCD762B589 WWW.RESTFULHAVEN.COM
637,464,553 *41ACAEEB345F2D6AC3709A592087D996FEAFB09B WWWTINYTOTLANDCOM
637,464,554 *41ACD9A2BA8C1E1345F2F72D5AB9A8F12C3390F5 WYDARZY1
637,464,555 *41A183B76595A27AC8068A6901801D23D46C5D1B X3492
637,464,556 *41A9AE06E05A0242D21B18B12AE6BC2B0F7DFDBD X|5H
637,464,557 *41A2BCB92F2D65987466DD0075E86D8E2CE5C466 XAVIERTOZLOSKI
637,464,558 *41AC7F9DDB7DE6BE8D49CD64B5BD7A16FBC64852 X-=BAA
637,464,559 *41AE7DE3B39A048894152806A77C82C897C4D2F9 X(CD
637,464,560 *41AC20C1B64CCBE28C199B5ABCDCB86F1D452A28 XENOLITHICS7
637,464,561 *41A6CC3B7AD2963A771C85F478B5CA310CBEF192 [email protected]
637,464,562 *41A7357D15CBCB121522E2BBF2F810456A37B856 {x}[email protected]====q
637,464,563 *41AF30DB80D065C260E6E1169D377472C169EB38 [email protected]
637,464,564 *41A5878E985BE4660EF444E83A03101F2C43BBE2 XXXXCAMARO1
637,464,565 *41AA79F105DD9D6D1B7058FA7E7A21463224171A Y1DB
637,464,566 *41A2214772CE8E92DCA669B962F63CF4888F94CD YAKIMOKI9
637,464,567 *41A382CF69F9E11FD4709C333125C723BF029E87 YAMA AND FRIENDS
637,464,568 *41A42AD5BB7E353032D15294DB4BBA8B58201BD4 YANCY-WILKINSON
637,464,569 *41A7401CDF2AF4A2879B3E32AF50FDD4FF2B4027 YI2P
637,464,570 *41AC1CD405B4FFA646B41283A9B9F4D563072C64 [email protected]
637,464,571 *41ADA7129C208A6FD084EEE0EFB125637B268D9B [email protected]
637,464,572 *41A34646C600BA1E708F7592C21EED4A607FD4B5 ymmrtneens
637,464,573 *41ADED7AED96A45DC1CFAF870C709E5EAA333982 yoshikamato
637,464,574 *41A87A91C7E8A1AA1926FDECDD36475C717E2133 yudelka-beato
637,464,575 *41A5A78FB63C4B2755126085BF748C884BB42407 YUGAYVALERIYA
637,464,576 *41A35987F52F16ABB61DB41C0C6E1CCC39C1E73E [email protected]
637,464,577 *41A53324D3BB031807A2C38C199BB97530D14AD5 YVETTEEREDERA
637,464,578 *41A4085732A40459D104974A8C61F55C06961D5C [email protected]
637,464,579 *41A477BEF009CC97409D2AEA9FD8AE97C6546849 Z8UZ
637,464,580 *41A7F1653098D05A8415D0A0355BDBAF40010077 ZABHNUTOU5
637,464,581 *41A8B1C9D9B283F6D6B6175D6F951BE159C7E656 zacherycampolongo
637,464,582 *41A3B026CB9547492E6FE96233F1F3EBE16B246D ZACKWITKUS
637,464,583 *41A2049BE52CEC7C5EAA747944DE169FDD42FA3C ZANGOOF-BASHA
637,464,584 *41A9FA4E7FC47D9DD29B295C0AEBC6C69B66762F ZDY2
637,464,585 *41AFF8B25493283BAB10FBB93AEDADF599E4E332 ZEICHENSEGMENTEN
637,464,586 *41ACEAF7E4003A8D0AFF73C8D429A72B99E18D62 ZELLA.A.TANNER
637,464,587 *41A43F45C65CCDDD6D16033846B2EE7440B8B204 ZENKAA
637,464,588 *41ABC860C48518F119DFFC561C34C821784FD622 ziekenstoelen
637,464,589 *41AC1789571CB18B57F5D9E911EBD548AB93C964 ZSENGEZSENGE
637,464,590 *41A61EA00E6212970B32BEF4776B5AAE5DB958A2 ZUE HUSIN
637,464,591 *41AA0C30C4DA44088AB4FD381D191EEB7024DA9D ZU LANGE HER
637,464,592 *41A02FD22A90FB553BE1504AFA9672B0D5AD2808 zztop22
637,464,593 *41A7C04031AF8253C2EA94D9C944A1A884BAFA50 бігевіоризм
637,464,594 *41A40CF386425E99AF86AFA0ED11F042A833A77F ПРИЕВОРО
637,464,595 *41ADAF50CE44537FF0CCF6182A526A93AE2A70CB ТРИДЦАТИВОСЬМИЛЕТНЮЮ
637,464,596 *41A5436780A305E73DF563047D2B1D40F29FED16 шелехметь
637,464,597 *41AC2331879B6A464968C9D1C836D76A9E1DA571 与艾罕默德·哈桑(HASSAN
637,464,598 *41A0227286F3262D6DDF4866A7A5F91853CADA60 (00)O~(P
637,464,599 *41A3DF4F9D0A417D4C5B8E3734DAF1081A988DF1 1155676 setodistaa,ett
637,464,600 *41A2186AFB572E7DEF2F6A536DBFDFDD24FF5568 11nov1015
637,464,601 *41AEC962DEE5236F9BDD6261FD9E2D0DED9A50C1 1234QWRDRGN
637,464,602 *41A4E1E6C4BF12E994BBF781F30F357D01428CC4 12BC4249ABF
637,464,603 *41A1DBBC92D3C22DCF7CA61046A47560CEF7B772 15informationsgehalt
637,464,604 *41AA9A0C1F74BD6FD688ACEF89698871EAA0AA43 15stajlarda
637,464,605 *41AA714B007326E48B7E0BD75153560A18855EE6 1823593 minunmielest
637,464,606 *41A0853618E079453559DCA4078ACDF7D2B7D21E 1930SAD
637,464,607 *41A0BB47A4B097DD1364C45058D7632E969FC0E0 1985695 ADOBEACROBAT50:T
637,464,608 *41A720766E3369C21A7CBF7741BC5B32F59FB1EA 198TRISTIN
637,464,609 *41A326549813AE3125A2ABC4C21F3878CD9A4D18 1 AIVOLIS
637,464,610 *41AA2B5CAFA1821625397F75CC2DC29A5C83ABE0 1-ASUMISPOLUN
637,464,611 *41A8F3669CA9D78331C15482EFBC1E039EE19719 1-ausstossminderung
637,464,612 *41A5356A39C9B2869B907EEACF0A8EAF818EAB6F 1AVILES
637,464,613 *41A33B0D15516EBDC74F8585AF710477A718B9C2 1avugss
637,464,614 *41AAA29D9E9D30F5F2C67D2CC0C8D4F0D7A4DEA1 1 DIENSTWAGENLEASING
637,464,615 *41A2DBF1B20934D3C7BD4C9A9D0CAE5A4B6F9B8A 1-EXTOLING
637,464,616 *41A0AF1D853F8FDD50C6D2F8D6E9663E21193DD8 1.hafenwettbewerb
637,464,617 *41A5A5552AF29CA01BC9D27771D691C5CA2CD9F9 1 KESKIN
637,464,618 *41A5569F74A56F45FA819E167CCFE2F02B1F7AF3 1.kirjatin
637,464,619 *41AFFCD9BC4FE9F7F813B4859D590D1C3BAC5A46 1KODOMIT
637,464,620 *41A1EE999295C0E82E5915A80FB142F1B680A223 1 KREMPPAA
637,464,621 *41A544AB40F4CF66C34C60F32F2389BFE16F87BE 1MUBANGA1
637,464,622 *41ACFCBCAC6D265CA4C28407BA3FBA9979BB8C2A 1.PATANTLENMIS
637,464,623 *41A4D97820220BD3F3CE1A03907CBE9DDDAA776D 1pienpoltossa
637,464,624 *41A8A870CC3F9A55F46FDC77DADF989D8D06428F 1PIKE-OWNED
637,464,625 *41A023963C4AA82FDA308DAA0219586A245D4764 1Q2W3E4R0597
637,464,626 *41A66A9A215634246E9650157B257A320F6CEE24 1.rezki
637,464,627 *41AB6312C11EBDAF73B272D3B6E31B7A8CF7FB84 1RFLGLLT
637,464,628 *41ABE0DC2873940D55CAAB3653278C1D2F64442F 1rollmaterial-ersatz
637,464,629 *41A0D41560B6750C8305F7D4234166E665189408 1-SEPELVALTIMOTUTKIMUKSEEN
637,464,630 *41AA84910913653783E5ABF8FD1F5A810A052675 1-SUBANG
637,464,631 *41AB4124EE5C41CA58144F3427450506E2109769 1.vattenfallfirmen
637,464,632 *41A09B5A51398F357B2E55F4DB13AC1955F13816 20020710OWEN0710FNP3
637,464,633 *41ABE6B8982804F9D55A0B4FF3DC04455374A048 2007-06-30:-MASSEY-HALL,-TORONTO,-ON,-CANADA
637,464,634 *41AD8C4EA1418099C64CD1CC7153D12F97B139C6 2030126 THETWONATIONSNORMALIZEDRELATIONSSEPT30
637,464,635 *41A911839EDD6C93FE21199A3749B4C0B95B3950 2264741 MINULLAONMUUTAMIAT
637,464,636 *41A14C9DE76591C8E90C48306C6A3AC954772FDB 2468178 TAIDEEIKYSYAJANKOHTAA
637,464,637 *41AC9E2C2DE5E99C4D348096387028A0AA816DF3 2571412 huolimatta-ven
637,464,638 *41AF160457AD5BFA391CF2B92FCE5CE63EB086AB 2684380 WARUM.IST.DER.VATER.AUF.FREIEM.FUSS.?
637,464,639 *41AF361B3FE51CCD3C327E333F156D7E88E6B86B 2795111 liian-ankara-ruokavalio-voi-hidastaa-kasvua-
637,464,640 *41A4986626488435153F5B0B227A09D3A3B5E293 29apr1074
637,464,641 *41A664F0B74EFA4926239A50AFB98141173455AA 2.KUNSTSENDER
637,464,642 *41A32DA78C8AFBC18868103D6BCC5AD13FB4CEF5 2MUETTER-TREFFS
637,464,643 *41A7B9A7B5AD6680F96F196D9D5B6B298FE8DC07 2PAROFFIA
637,464,644 *41AFB93B3AAB7C46C4B66E977FDB56D07E8E860D 2-tavallasi
637,464,645 *41A561643BDAC2427D9863F8235A9B928EC9C715 2.trappern
637,464,646 *41AAC3CF4AD1673209EF456BD0FCE09B4D32DB52 32.RECURRED
637,464,647 *41AF60C36C91833BCC1B970F31291DC25FA6FAB8 33VARMISTAISI
637,464,648 *41ACDCFCC9F578101BF68B31A6B90228E7A77AF5 356b3b1ee9b639679cd36fb232b78ffe
637,464,649 *41A52B5E60648A05620AEA8720327A3491CC1662 362571 MUKANA.HARJOITUKSESSA.OLI.YKSI.AMBULANSSI.SEK
637,464,650 *41A795E0D41524C56AAD1A53C314D4A618DBB0FB 386839 JELLERDE.IMMOBILIZASYON..
637,464,651 *41AB6F68ECCA9112D606F0532E40785D88683497 3ARIORNAS
637,464,652 *41A91F6CB14092EB1BD50B2815CB8ED589044000 3#####)~o~o-3b<-
637,464,653 *41AFB1D35A473C24683B6EEED3C44CEDE444E421 3==P`~-Splat!!
637,464,654 *41ACD6C95B5C989046FEE04609D37E06A65FEC59 3siki
637,464,655 *41A5269067CBCCC7155204913BC6559C3AC7753B 478169 -burasi-,-dediler-
637,464,656 *41A7A132904D6688DD444009D6DE700AF3AF2BAB 4.ambomaalle
637,464,657 *41A4ECEE9CE449CCC3731B7F1294B969085619A8 4ILUVHANK1
637,464,658 *41A9EB86711BA7DEFCF7B3DB9BC8FCA652D43C43 [email protected]
637,464,659 *41AB7CCF2278AE701EEFA324652575020EF04748 4PAPPAVA
637,464,660 *41AE8DE01BB2F78C0D88C962D9B8373280ED00DE 4PIRTSLOC
637,464,661 *41A0C581960CE925125380D51BE7F335F4109904 5067BIGLI1
637,464,662 *41A47BBFD720F15BE3718E3BB84FD10354B25059 515874 MIES MOITTI NAAPURIAAN : SIN
637,464,663 *41A5145BC0F89C56ED480463380200E8ADCEDFFB 51G4M0L05
637,464,664 *41ADA566C3DACF86BA92F5288FF589D5C014F911 5anct0nng
637,464,665 *41AA135E4C4B23D6EF2EC5D2614C367235771A98 5ENOBLISH
637,464,666 *41AD09D11C345AF9DAD556C3881018DA8F0378A3 5GEDROEGS
637,464,667 *41AF77392C1CF8C6E5141692E4CBD9E3AB218486 5POHRLILO
637,464,668 *41ABA65D519ADD19BB2E80FEE6CA2481DCA04F8F 5TNECROFF
637,464,669 *41A2AB3A7655B6775CE8CFA8F2647C4E597497B1 5UNMUTIGEN
637,464,670 *41A2B98661D043D495D528B03A00098664BAC01D 5WOTTONN
637,464,671 *41A58721FBB49DB56CD50460E980381B88805336 617002 karamurseldenizcilikmyokorfezkocaeliuniv
637,464,672 *41A744A31E220ECE1F3D5074F6E09EF0727BCE52 623215 nitekim-,-24-ocak-kararlari-alindi-.
637,464,673 *41AB5144FF6E82AC8C05682EEE00C97AB5275D63 639054 asfalt-Oncesi-CakIl-taSlarI-kondu-
637,464,674 *41ADFB5425B67A9CF45089CA346CDB5572689EAB 6ANGELAS
637,464,675 *41A08B32920FC65A3EE31AD01E5A6377DAF16D0E 6LAIREPMIBSW
637,464,676 *41A4D3C579620322A43E3FAC931195114D9A85FB 6NJIDALAP
637,464,677 *41AFDD1208DDBFD02D874A78029EC59541B22B2E 6OMAISSOD
637,464,678 *41AD87E79C29E2797FB90DDA00BF5A1AE05C93AE 6pattypan
637,464,679 *41A3ED1EE900128CB9E726BF587403F4DAFC99CF 6WRISTLETBROODMARE
637,464,680 *41AFF137148BC464BFE99CF3EA2AF8BB98C79480 75402 bir-daha-gOrUSemeyecekler-onlarla-.-.
637,464,681 *41A0C9BBF4BBF097C944B0D416F9C1C2A5CDFAFD 7BSWSELLIASR
637,464,682 *41AB275B9C681B08A485F06EF4D7E48F4BB201D9 7CHUTNEJSIHO
637,464,683 *41A9A6264577030D57D128C66EB354AB9C7D0B8D 7ENCERREM
637,464,684 *41A511FB31376722B77E9CACD6B14F087E2FDE93 7ENKELTHETENE
637,464,685 *41A8D3D2ECF6C256A8A0B7E4EEAFE24929F66214 7GOLFERSMOKEY
637,464,686 *41AD6BFAF9174D7DB0567DFE35FD9E9AE60A8DB6 7KERMITMINE
637,464,687 *41A183FF22CD30B8DBF525E84120F8AC1558AD61 7NIEBIESKIMI
637,464,688 *41A9811E5498F6005012C630E511AEB5F295437F 7REKISTEROEINTEJAE
637,464,689 *41A0E3B39092F01E239C180D25C0CDB778EA8331 7-S
637,464,690 *41A41422BD3D3418A6E9A428048D76A8AC4DF5CA 7THORSAM
637,464,691 *41A12C7B25842E25CF07303840B3E608A34A355E 8BAAIERDS
637,464,692 *41A8AD27DE932CA44CF6F3FE59AEA0925BF97D4E 8CHARITYANDRE
637,464,693 *41A50AC13F170A30B1E99A0974DEF15B8F2F4BF4 8d.~0~o)x(
637,464,694 *41A857DF226F500A1D37827CC4115A0013DCE48E 8thecindy7
637,464,695 *41A5B28AA74B3468A9A6C517C3EFC85A918B2FEA 988RAPHAEL
637,464,696 *41AF70A9785875286A3D09590F7A7195253DCFD9 9DICAEARCHY
637,464,697 *41A471CD133D11838E1B09C5992D4734836EDB98 9HAROLDBRADLEY
637,464,698 *41A1E2D704624A921E4E31A951B55F7A44A17885 9INAREREN
637,464,699 *41AF6CA55AC1D48D4B6490B49C28E0B11204EE3E 9MISOPHOBES
637,464,700 *41ADDE048CB90EC3957B62F69271BD7214134366 9NORDELLA
637,464,701 *41A3F8CA53306BC1FCB7DE6FABB742295D2AC746 9PRIPEKLO
637,464,702 *41AF46F2626AEC2D612A5C0675E36AA0B1BEFE88 A35235813
637,464,703 *41ABB3EDBB3D7392101EBA0BCB6811B828E89855 A4"F!
637,464,704 *41A72DF01889128B8BBCA489585A18E08066FA50 A6$w
637,464,705 *41AE445A4FFBD856379D77B8C6F6AE2FC460158E [email protected]
637,464,706 *41A519F393CF04B5FE75EC50B1D01AC4C16B6ED7 abdikadarhassan
637,464,707 *41A42131B8C4C1175E651D62EDE3AE0330E10096 abhyudyayaavudyata6
637,464,708 *41A1FACF3B5841E139F62C04904CBA90B3FB58A3 abigailshearer
637,464,709 *41A9D499B019D547B66CA6E881D7FC1ACFDEC1AA a!e81
637,464,710 *41ABEE70887080F90C21A558B6EE58ABD215EFE8 aeludium0
637,464,711 *41A3DD29E977F250A207ABE7ECCF3DE3D14922DF ah$ny
637,464,712 *41A2A6A41B9257B748E1D7278CB7BAA06F01BC02 AI9BAA
637,464,713 *41AAD6358109091214CB2321840AFEAB736E116D aibā
637,464,714 *41AD68B744649654B77FD4375CBD28A3F4C43E18 AJUIZEMOSTE
637,464,715 *41A93214FBD8F3DFC903CE65EF861D2E7BCADE9B A_L#
637,464,716 *41A53499F36BAE88C43B779D10D38A92B7567C05 ALEGAREI2
637,464,717 *41AFBE7B6FA8E242E7C582FF109A389B35D6552C ALEXERBACH
637,464,718 *41A71C7D6C25F02C95598D3537A87014605B9E33 ALIBLEALIBLE
637,464,719 *41AA59D2C8532A790A6A3736C726E78823B8569D almoravidovská
637,464,720 *41AD6B34BB48C86E3FDACAD4BFE4619AAD606872 amancia
637,464,721 *41A6C7827F2FF15C60177D135F24555E463D4D03 andrew.hitz
637,464,722 *41AAA0F846FF452DA6585794118F42AE3EC3DE5D ANR7F
637,464,723 *41AE30C86E7463D534A1AE5301AE30ED3639F18C aqtqf
637,464,724 *41AE4B87E96C20FB93CD7BBFF60BF9AE37308869 a#rqj
637,464,725 *41A8946236A486DD6DA15FA57E8A62878EF48A82 ASQQO
637,464,726 *41AFE307F3D190455293CB3641F864EFFC35EC16 AUGUSTUS.PAQUET
637,464,727 *41A8683708926E4FA663E8A759DE1DB893BEF33C australiauniclosesdairy
637,464,728 *41AC0C10740050B44A31BB652C9AC4EE302276CC austrianisms
637,464,729 *41A68D86781F6764B476A4A9319B4AF277A06B4C avhuggs5
637,464,730 *41A5AFAB1E6BB494267469EAE22846FA0154C537 AZZECCASTI
637,464,731 *41AD372DBF1A0B053E99DF23221126E1B5421045 b4oeh
637,464,732 *41A8AE426D462039D63CE4C67EB783B244B93B6E b85b
637,464,733 *41AC5FE733D945C8365100CC32273B79E1D578B6 BAII?
637,464,734 *41AD6D76FD0771C66C7854FB9B008E4701BF692F BARRY.YEHL
637,464,735 *41A79277A50D94FC6BC0B4A10C657F13BBFB41F1 BASF%
637,464,736 *41AE37826C7BD08B7098456D6782E8ED4193F058 b$c7j
637,464,737 *41AE4EE62A9A9191F9212E90F9283B9F409980C3 bc-id
637,464,738 *41A41914850640D86295BF36F4730C2A5BEBCA20 b====d**splat
637,464,739 *41ABBE3A48FC5724457BD2D4C4443E229F1F2F52 be18890613
637,464,740 *41A6B56FD11CDD16BBA63FA3DC86C30078D31F50 bennietessier
637,464,741 *41A4D24CADE849C879B6040631A8E07702BEC02C BESTIAL MACHINERY DISCOGRAPHY, VOLUME 1 (DISC 1)
637,464,742 *41A8128FDFDC3F93F804E546F8C55B557386441F BESTOFTHECLASSICS:LUDWIGVANBEETHOVEN
637,464,743 *41A64991A9EC1B9F41BBDED80B368D04470EC48A b$fs?
637,464,744 *41A6F9D25BED47A034F1EF668B1891D17E304E00 B#g8
637,464,745 *41ACFFCFC3F7CB815BE781251E6A8803064D994C bismarckdenkmalhh
637,464,746 *41AA68AA53ABBFEF06E0E47FB27E6759277D61BF BLAIREFIDELL
637,464,747 *41AB1FC0EFDACBE55E39C53C3AE4377E5D163F3F BLEGANAS
637,464,748 *41A62EDF7651058A44888C3202723D1B2E825D94 BLOGINVITATIONCONSULTANTSCOMBLOG
637,464,749 *41A66D743AFC10DBBEA422C86996A4046FDB4AC7 bmg?
637,464,750 *41AF7914C891B66613868BE9D450AAE67C40968D BOBREITZES
637,464,751 *41A9E7A36F71440F81DCF37A3F1D12FC1DF79C5E BOFU.
637,464,752 *41A49834C38A4953CE51C1321B535FCC50A37744 BONDELID0
637,464,753 *41A0B334B47C65CE7EE49005D9196B22EEA9B8B2 BOWELED
637,464,754 *41A600A46FEB0E2E676B4EDF353FF98FAF41943A Bq8e
637,464,755 *41A84B2E24C4A55DB3AD46EB04890C7368796931 bradfordauber
637,464,756 *41AC066AB047621AA4A537E061BB9BEFB40E03D1 BRADLYSACHES
637,464,757 *41AF0D88AF7249D79C2B478E8CC4CA1F6343DF9D brandasses
637,464,758 *41A3BEFFECEA2CDFB9BC14CFA995218BE838BBE7 BRENT719
637,464,759 *41AC8EA87E91008531BC7E64C85BA7D875715307 BRYNGIN
637,464,760 *41A93E7B5C0CA4770D866A2AB22F134DBF7838E6 BS9D
637,464,761 *41A9696227C8E89BF00CFF7942E4422A7D9AA3CE BT!7
637,464,762 *41ABD7385CF3B57C3F664768C8419981701E08D9 BUNSTI
637,464,763 *41AEB6D7E00D630B900DC09B9C5F6896875A5455 BUSTERHANEKE
637,464,764 *41AD33E7E839EE7DCE4836F77CABD002BB2B3277 BUSTER.SHEEHAN
637,464,765 *41A36AB0E1D812C4D396A19A14BC3694B0386900 b,v1_
637,464,766 *41A00F58ACD73F5A5FFAD483682AD5633E2022C1 bvscz
637,464,767 *41AAE8D0E6A1A81E31EABBFEADE902E31CFC1EBD BYRONJONGELING
637,464,768 *41AD29665D9456286561FC7A872493D3B0E2498E bzb)b
637,464,769 *41A253FCDFF1182A62BCF20CE0A4481E24232AE7 C0NSERVA+!0N!S+
637,464,770 *41A4FBF59C278371F7FAEA61D2C2509561D3D3A4 c2.+2
637,464,771 *41A1A357CA5A71CB78F486BF06BFD7FCACF427CE C27F6
637,464,772 *41AE154AC54FAFFDD7B776D46CF5AF7DE1833FEC c3//
637,464,773 *41A1C779B03E6036C9379CB0DAA0A2073286D95C candida
637,464,774 *41A72D342A60AA916ECDCA019FB402BDDE11F15D car5+
637,464,775 *41A9037A9C70A5292148633BEC722AE35806D889 carmeloschleifer
637,464,776 *41AB25AC3DBFFA3C5183C6E7D594102BA6834E94 CARMEN KAYE
637,464,777 *41ACBF2BD1C7754A6A646DB54D16475AAA7388CE CAROLKNOST
637,464,778 *41AC8A713E1D23DC19E3207A0356789B626EDA2D CATAMRBLUE123
637,464,779 *41ABA9DE826723B55485A08548D274716E77A2DD [email protected]
637,464,780 *41AD4E162AFE654D2384E3D907E181501EB65BD0 C:\DOCUMENTSANDSETTINGS\ALLUSERS\APPLICATIONDATA\ADOBE\CAMERARAW\CAMERAPROFILES\CAMERA\NIKOND90\NIKOND90CAMERAD2XMODE2DCP
637,464,781 *41A068F3281E9C6A53E639562FC8D89406E1FFC9 C{E<
637,464,782 *41A6AA1CE41051B89455FB079A96D559C08CCC72 CF1F5FDD36ED3E2DAA698A65FE6CC2B0
637,464,783 *41A7120DC133097FB7EB1AD5D6DA2472C1404746 C,?G,
637,464,784 *41A544DD793E8BFEE09436EA4AC96C3A1E5CA751 CG+P
637,464,785 *41A7CDF8770914995A6F7EDD48C531269C3A08BD chaunceyablin
637,464,786 *41AF23A9F2F738C9A602FD6C509F15EEEB17339D [email protected]
637,464,787 *41AB2B0DA3EF1F7770854F5823E4D8FB0793DB72 chencho.el.jodido
637,464,788 *41A301D9B356324FC0E500303B31C913EACECD20 CHEX7
637,464,789 *41ABAA2DFFBF7145547E68C803A16FD27615C60D chitlladaed
637,464,790 *41A2306E461AE21851E80BD53D0F28107200312E CHOUSATA3
637,464,791 *41A1A37E90898DEB09BE1D96129E5CC778A021FC CHRISMIETH
637,464,792 *41A499D2CC88BF6C448CEA2F0E9A1D8268367D17 CITEDUDESIGN.COM
637,464,793 *41A9B6C9368638A9C5DA29937A6E8F8B874EB5B8 CLEMENT.VORWALLER
637,464,794 *41AAF4B512B1D3DE4053050D79ECF3E924FB6A74 CLEO.KNAPPERT
637,464,795 *41AF37DE0708837195C5D4DA5E19E1FC4C2218F0 [email protected]
637,464,796 *41AC1840A5D673B0AAB36EE3D05F33ECD07E06A4 CM/F=
637,464,797 *41AEF4A9405E1A7F28A0195C5616AECE388DE88F c+-/n
637,464,798 *41A013070D1A7CB4ADAD6E512EF3C3CC1FA8F986 cnf2a
637,464,799 *41AB31191067F297686F9EC82B6560A8E9C34C25 co.h7
637,464,800 *41A0A0057198F02DB8C6D491A92EAA9D32AF6A48 CORNELLWESTENBERGER
637,464,801 *41AC365AE3382F237221818E4CBC3BDA824256AA CORNFLAKE91
637,464,802 *41AA54DACAB1746AE2CD3A781EFF0C4465F64057 C:\ProgramFiles\MicrosoftVisualStudio9.0\VC\VCWizards\SmartDeviceAppWiz\mfc\Application\templates\3082\root.h
637,464,803 *41A275BDA8460EB78B64C3B85C8BA585CD6B455A C#PWR
637,464,804 *41AEC15D61B645E27203B5EC49EC25D5DE1D9FEF C/TRF
637,464,805 *41AD89F2810F841E5865470F3F4A839D9FFC5CD5 [email protected]
637,464,806 *41ACB2764BFFE16BEF253898B2CCFF67BA52F7AC c/v0+
637,464,807 *41AABECC0F99CDCC727895FBF65EAB6966D66608 C=V3M
637,464,808 *41A316B440D2671A19535454AC8201CB560BB675 CWNEJ
637,464,809 *41AFEAD7878F7007A6B531B9B0D33B6CAE03BD16 c,wz#
637,464,810 *41A0E1093AC541CCD845745DAA35F5349DD0C34D CXMAF
637,464,811 *41A99F4F358249167EF6E191DD3975577795E9A0 d3f73
637,464,812 *41AADA325644E089734E1EE80A36953F51287BCD D3R)+
637,464,813 *41A666071C224594C613D76E117FA7A7A48D92BD d9k/h
637,464,814 *41A8B2F9B522E4F45FB5D0EA96182F6E4571611F da4g5
637,464,815 *41A9FE32013249D2F14E3EDF5232EE386BCCB212 DANDHILLSD
637,464,816 *41ADCBD5D657675085B6534BCD3AAA62A06840CC DANNIE.MAGEDANZ
637,464,817 *41A66681B0F2B0EA94C2B2ECB2F4BF5FF0C6E4AD DANTEGAZZA
637,464,818 *41ADB30765168A9C3CF7E87ECB9DA96C8C8A0275 DARWIN.ADELMUND
637,464,819 *41A01CE0B9A300395CFCDFBE3150670C77D607EE DATAREPR4
637,464,820 *41AB5B2CDE69E4DDE599DBA9C56266CB0A84F89F datrh
637,464,821 *41ADF380CC63FFEB608634D300C058808474DD9A d%cmr
637,464,822 *41A3D5DCFD106ABED7977885CBEEE077F2AFB22F DCYH
637,464,823 *41A1814A9D811BA800C2E1FD823954B3C75A0B10 dd sfinxsins
637,464,824 *41A3B9B4355BFCA0D572C6694AA5F26AEF3C188C DEIW-
637,464,825 *41A9BF734BD155587EB62BB6BE95F67020D5A81C DENSITY
637,464,826 *41A953070E744B1D83574B6C35A3BCB3323D8514 DESHIELOSED
637,464,827 *41A9EB53972FE39E0ECF3B856522AC7BFFCEC8AF devyn140
637,464,828 *41A919740D0E111A350E77EDCAD11FE4EC53BC64 DFIM)
637,464,829 *41AD40E1AB90E7141CBCC4E67A98FF083CA34E51 DINOORENDER
637,464,830 *41AF9DA6F4C73299B7954FBA449AC420493BA800 directes
637,464,831 *41AC6AB86FD2793CE01D958F387761AE121F4A1B DISCO-HATER
637,464,832 *41ADD94726E6AD8107889190D65AE82E892B1F25 DISMLLY3
637,464,833 *41AE9F5CF548222965D66DF07F952926F4098E3C DIVERSECONTROL
637,464,834 *41ACF77FE43FAA9C4D152E5F82AED30F50A9D57D dnbqx
637,464,835 *41ADCF3724AB335050927DCD3BB777171A9D885B [email protected]
637,464,836 *41A2C840BAB089D0C1B9A7C8092C84CF41810ACD donnygrebel
637,464,837 *41ADE2900676AE7F3B6C58782865C5C0FC9A9D45 dontegirand
637,464,838 *41ABD8A1449FB60EC1CBF7712163C579D5D37095 DOOMSNIGHT (PASCAL FEOS TREATMENT MIX)
637,464,839 *41A1D0503B6DD0983ACFBB875A70E4A903AA6F2D doriancraze
637,464,840 *41AD1453DC5F73D9F794A9D11E3BC4E4AAA0A1DD douglassthimmesch
637,464,841 *41A8749ECFB33157B5B81F4FC7261D7D96578849 [email protected]
637,464,842 *41AABD23B0685E6991830A464324668C9AF60E16 Do.You.Wanna.Jump,.Chillun?
637,464,843 *41A37674B7500A832E79BEF57C4B9F4EB8461C64 DPEMZ
637,464,844 *41A3C9CC3FCA938651E1D59AE71412117E1CA5B2 d_r"d
637,464,845 *41AC158B5C614ECA74BC6D18C11DBAD18674C1C0 drw7g
637,464,846 *41A02A78AD9E3E38AE7789E12730324C63B34200 dsq$e
637,464,847 *41A2AEA91F6A7E6BEA146B7EA8CD29053568EECF [email protected]
637,464,848 *41AE8725B4A3BC6F01C3508693BBDE6CDCFF418E duncan'sblues
637,464,849 *41A22CE2EF071994D066545B56CBEAE684A7E702 dyt;b
637,464,850 *41A56607FDEF840FC17F90F04375985ECA6C5BE0 E1570219373141C1B3D439F55C2493EE.NINJA250
637,464,851 *41ADAE4382B71D7CD011B089CA5D84B655B51A17 EANIIBOC
637,464,852 *41AA45B64F25C8019A1DE50D896B3FA3E1B22335 eb2n_
637,464,853 *41A8E3271D610D44C91785728D273FE2ECC2A8C5 edgarbucher
637,464,854 *41AD1D843CF5D7705A34A7D4F27C9332FC4D87D1 eev
637,464,855 *41A7B3A8497640055A0CF97D9BB28AB73114CC85 ehcsreih
637,464,856 *41A9060504AD205EB6A8A699310CB8FC029EF593 ELIASSCHROYER
637,464,857 *41A5551C796916CDBAD0B6FE87369CA853DA57F3 ELLSWORTH7
637,464,858 *41A38956EB923DFA6112E6D5859CBA2AE2A0C16E ELTONRAMROOP
637,464,859 *41A8075D5C16833D753D46A857F1375A4FBCA5C0 EMANUEL.KNOX
637,464,860 *41A93FA1C53F19907D22E9E9B357536CA9AED2EB emb#9
637,464,861 *41AD37B187C245EA8671D6B321E16A65925FE3B1 EMORYCLEEK
637,464,862 *41AA6E330A0B0A45A480DC6501859EB53E3DC0F7 energydepeche
637,464,863 *41A409F70C8CC635E7D5A646867217F54E8ABECF ENVIRONMENS
637,464,864 *41A03EB37AEC59AC82F9CBD1C0343393868CC6B3 ep!p6
637,464,865 *41AE9E34536265BA92472CF55B132F29879D3DB8 eq)"
637,464,866 *41A6CA6E2C0B796AC578D8A23227174020046179 erlhoff“
637,464,867 *41A2175F5981A0D7FF735331569D9FF03EC8FA0F erwinplant
637,464,868 *41ADA04463D9169F85D229F63A5A4560631321F2 ETHANBAUERMEISTER
637,464,869 *41ADD619A68C5296908372CDE1CD7A22F4CCCD1A everettestradling
637,464,870 *41A624689D61BDC09F2DC69D44D2D7A3334C1781 EVERYBODY'S-COMING-TO-THE-ZOO
637,464,871 *41A54930E07D30D1FAE1AA0B25F34289BB12191E EVERYONE-DISAGREED-WITH-SCURO
637,464,872 *41A969A4BBE7F22966F2B075D1D4094E097D0B1A exsysadming
637,464,873 *41AE011963472330EF23070157504155B381A646 extensvel
637,464,874 *41A012A8730B0059BA1E55A4E65EF1F99C4B4F6B FCKFCSINNER
637,464,875 *41A4A7DE9D54BF90EE30B61EA1DAD278D455734E (feat.B.Sykes)
637,464,876 *41A3758FCB07E31738BF5CD8A1082B9C6B478BE8 fejltrinet
637,464,877 *41A8E85BD7130752F8703E9366AEACA5A7CFBE22 [email protected]
637,464,878 *41A9C4D134271B5C43B8E9EC91EB55BA75A5DDA9 [email protected]
637,464,879 *41A45A44F1B60C1149E4B2BA76553F33157FF63E FLUGZEUGKANZELN
637,464,880 *41A57B09FE52A31B895F76266B329CFE11DAEA7B FLY20
637,464,881 *41A328713DBC54DBAC01E5B667428B1BC3D6BC04 fpissing6
637,464,882 *41AFEC076DEC88AA99501CF0CF1389C9D80F4DAF frankielangendorf
637,464,883 *41A096664BE1E8D519EE5C6318BD023FB2673977 FRD7535ETOLIP
637,464,884 *41A0215BEDDEFB0C1D9719A77C458292C189A5F8 fredericbrowen
637,464,885 *41AE9CEF2305526745DBF5259B8B1920D08BB1AE frednikocevic
637,464,886 *41AAC4273A1481192BD30B73A1D7F94F7A7320BD fripp-gives-thanks
637,464,887 *41A13E8D2306D877DB79E579F6F7BF46A711414F from holland (feat. casablance connect)
637,464,888 *41A2855057DA421E03F10A57BC296D903A8A0B90 [email protected]$t$
637,464,889 *41AEA740725F3A7FFEBC384EF847133E5CF94416 GABRIELLE-TRIMBLE
637,464,890 *41AB41400209C0013017D6E59F3FC47535BFAF1B GALENDEKINE
637,464,891 *41A617147F4768DDEFB5A1944329F86C439148CE GALLICIZATION
637,464,892 *41A6E4618109E3A45D80AD0E1AA47F1B629DEDD0 GAOSUNZHI
637,464,893 *41A0A7940C16893CE84E42EE4407E7C1424E1681 garfieldmarsland
637,464,894 *41ADE44ABA836C5DB5C763B8B3CF2089CF266EF8 GARFIELDSTATUM
637,464,895 *41A8EDC2054BD39BDEA5EFA04C777631735EAC7D gaylordguitard
637,464,896 *41A3A5F8140810C7704D4D57DF2DFE962FA360AB gemmel42
637,464,897 *41A809B02BE9260B4830ACEEB3ECDF8A9D06A107 GILBERTOBURCIAGA
637,464,898 *41A7BAAD84A133E10CAEE164F3EDDE2C579C5030 GINGRICHGRIPESABOUTMSNBC
637,464,899 *41A67392292C26B9A967AA964913CD2DAB90F1DD GJJ"
637,464,900 *41A8FAE742F9DDE16F8758C5B84F4651D25CD924 GNUNEOT
637,464,901 *41AA52E60D8349CC62222E26B387D3F749411A84 GOODBYE,-SMALL-TOWN-AMERICA
637,464,902 *41A19A8C77DF9915FB6CDE832D8C234E1D95B0FE GORARARED
637,464,903 *41AF7C916A50ECD0FB8A7D025904A2711DA6B6E9 gozintabsw
637,464,904 *41ADE7DB742A7A1B998BBF7CD3A45777C845EF37 [email protected]
637,464,905 *41A60BB2BE38EBC34059D6D60FD0348EA514DAF2 [email protected]
637,464,906 *41A65A6C550468E35477E24878B000CCFACCC14E GUSGUB
637,464,907 *41A8D9B22D60717519E5DBAB1045D0CA5014D857 GUY.GLASSER
637,464,908 *41AE2191E5C35F2C6215DC34414574D1EF8F4B9E halblaineandtheyoungcougars
637,464,909 *41A907205745352A2E1CCBED3632F89CA923749D HANKSHEETZ
637,464,910 *41AD4F5DEF3D50D11BB8EA21940BF16A6487A36C HARLEY.ALBRITTON
637,464,911 *41A0BC5BDA3600B05D3C3622C8E5972CA9DA1D1B HARVEYGRANDMA
637,464,912 *41A21DC861866276ECC52D18E453D23B13FD3569 HERBWHITAKER
637,464,913 *41AD903E36C95107E3C63F97717341E722C6AAED HERIBERTOGRUM
637,464,914 *41A62150020258E9B005C9D42F423DB47091438B HERNINIA5
637,464,915 *41AFC56149A39DF9F8E23C0996A2D83C197786A7 heunbsw0
637,464,916 *41AF085689987DD9031CEE46F49B20A7AB7FED60 HIPOLITO.SITTERUD
637,464,917 *41A46D0463D6E40B77C90AA0FA97DABEB0F20B2E hiramduperry
637,464,918 *41AA4E7DED649903E7E3048E4D13E9A1AA63191F HIRAM.HASBROUCK
637,464,919 *41AAEFD7F3DE2FCC8E69BDE1027964D304557C27 HISHURI
637,464,920 *41A06ABDCE79537FB2D0E1C42F3DB016D91D50AC hnmsspeechserver
637,464,921 *41A078EF9F8482736ECEF2F03D7EE406B50B0B78 [email protected]
637,464,922 *41A57E74D33ECA4E336C22F5AA56CE9994FEE8DA HORSESZ4
637,464,923 *41A62D0EC37F35A467285A4B214CDB51A34237E4 [email protected]
637,464,924 *41A6B590AE516FD4E0CA85FADDFCB52581FF083D HOWARDROHLFS
637,464,925 *41AFABF0A8A3EAC7099E72C2284A2773CD7AB444 hpspkqj7
637,464,926 *41A146338BBD0B2D6A928670B7920FD0B64DE153 ht&i
637,464,927 *41A637C2DCCEE5C68431182CC3E2A3BF02347AE8 httpwwwscivoncom
637,464,928 *41A524C33FF71597BB07460F5E9A7DB9386C312E hueyfloriano
637,464,929 *41A6622D69F267E09FB9C550C7FF01857F1AD252 huffeng1234
637,464,930 *41AB09A1265428885F632AA985F4C571C2363D98 hyoscapular1
637,464,931 *41AED2CC4821DE8FE0A6CC77CC78FB33A5E864DF I'D RATHER WRITE A SYMPHONY
637,464,932 *41AE33358A45A96417A7FD24D8234E5B72C1E0EC i[*j
637,464,933 *41AEA8254ACC37252088D3CDFD9D4CA7130B5D2B IMAGEDAGUERREOTYPE
637,464,934 *41AC8B2400C76AF9D95EBA2DBED947509CDF79A9 [email protected]
637,464,935 *41A1944DBE41CCE29EEDBC3689F21BAF56D4E653 INGESNEDEN1
637,464,936 *41A36E60D811408688477ED643397A78BB9E163B IOSEPHAT5
637,464,937 *41A720FFCB2031E0295FC9C597786FDC3429B8DB ip720
637,464,938 *41A9B8DC14B9FD0E7C73CC8D8D031B99C492EA13 IRVINGKIPPLE
637,464,939 *41A4F897395A3FEBAA216D1E540681978793FBDB ISAAC.MOGHADAM
637,464,940 *41A9BE3C739F7A14DEB6B17F03C824777CF32004 ISAIASSTUEBER
637,464,941 *41A7BE6D5BE5503E865B9AF9E63D25B2BD032538 IVORY.COLLINSON
637,464,942 *41A7104118B32F69D96BCB7805FBCC83C444100D IWBA
637,464,943 *41A8BADF6B0A177ED0032C14BC1D6D8AA555A511 jacksonspicher
637,464,944 *41AEC8A8299B3DC3749D15A714ECA8801425CFD8 jacobcopping
637,464,945 *41A991DCBCE7F34CDE9280AD422653276CA4F5A1 jamelmortis
637,464,946 *41A96246449A8EC090BFB5C4897429B4BEA6D42A JAPANTATTOO
637,464,947 *41AF88D5B1184E577A467148CF7DCB418E812C0A JASMINE SPITZER SMITH
637,464,948 *41A1566514FFBE28F0F44999B20BF9E26FABB6FE jeffereyendersbe
637,464,949 *41AF10248C361142A9994FB6C1732C37DD76AFD0 JEFFERSONBALTRUWEIT
637,464,950 *41AA17CF87AFC7D9B64897C704D02D1EF3D55438 jefferyhooper
637,464,951 *41A57433D44C973E6735464933F68ECEF41EE5FA JENNA.TOON
637,464,952 *41AC64356899D0E312132408354EF3C1B9F7DBF3 JEROLD.TUAI
637,464,953 *41A1BE6428AC75D1635A0D4986C423A52CEB1CF3 JEROMEDESCHAMBEAULT
637,464,954 *41A6B2D3AF082A7AECA177A3D32D260A212EF1D0 [email protected]
637,464,955 *41AEA8B7A6F24D40AA65E683D2AA85DDE23486E7 JEWEL.CANEL
637,464,956 *41A8CD0924464AFCD373F15EA9CA044C127A1DC5 jhona-sarmiento
637,464,957 *41A55BBBF42EEF29655378E5FEAE2E5C48B87E45 [email protected]
637,464,958 *41A81562D69C42B36DCE63053F3F84FEACE5B5DE JILLRICHTER
637,464,959 *41A5717ABB31504131D545C4257434122779F3E2 jimbarman
637,464,960 *41AAEA75A34E93A754481DFF66121EC9833FAF77 jim.mc
637,464,961 *41AB8C6B6AD2D4FAF627DD1C1011C912E03A8829 [email protected]
637,464,962 *41A16A08FB434A34F3ED853C5A19274FFB4FF067 joesphyounts
637,464,963 *41A1E2716C59FDDEFB52E47B1B85E094041EB1F7 johnny-recio
637,464,964 *41A15A0C6BF23F8D7F60DB234B36A6B24DF5B906 jonahheither
637,464,965 *41AF727F5B8610161E7E864E8859BDB65A3CFA31 JONGLEZ7
637,464,966 *41A42EA3F3827A223C1F90E319CB9C32375643F2 jordonschromen
637,464,967 *41ADA1DE6B61177EA4925C38B3E4618A12D33502 JOSEPHPIERCEY
637,464,968 *41AE555A367BC7F1F8D84B01CFC1E772EC2EA912 JOSHUA CAYLOR
637,464,969 *41A9A4D6D3DE3E83861E98DF9AC88671F6B16056 JUDEYERGIN
637,464,970 *41AB7F47C18149744F110038064031061F8374E5 JUDITNAK 1
637,464,971 *41A86729161EC26B2716FA31BB48151ACA910004 [email protected]
637,464,972 *41ACED96DD845422B0AF735A0CD64C4A3EDF99D1 K03190319
637,464,973 *41AEB3B2AC4D5F13162F5CA79CDD053BCB9A75AE KAAKGNIRAH
637,464,974 *41A3CFA5703AAE9220102509005D7CCCB68B5B64 KAMELIJAMA
637,464,975 *41A5642758C6C86E2C0AB362B6960BC6A91037A0 karenkulyk
637,464,976 *41ADA1A78A3E1D8BEEE40A2F916AD473864E6921 kayla-skinner
637,464,977 *41AD0D0DE8DC2FD3B47C28EE0F51EF06A263CCD0 KCCHENBBS
637,464,978 *41A93AB39ED93E9BC8A35F272B8F9FF1315F25CC [email protected]
637,464,979 *41A464408D0915D39896CE0CFAB4D3C5B65382C1 keane-mcconnell
637,464,980 *41AA0DDEA8C75B1E7212597B976925C109B7BD34 KEITH.PAKER
637,464,981 *41A8A7A04CF031C65080E5D4B73936F9ACF90B3D [email protected]
637,464,982 *41A59D96D025D0669BEE6CCE461CEEC5664F8095 kendallpetrey
637,464,983 *41AFB3C76BEF426E29FCEA182577DB663DA50379 KENDINI1
637,464,984 *41A23531BFF6193EEA08D6985E0A562D4C084EDB keukengedeelte4
637,464,985 *41ADA4860465C83E82DD06D6C1227B908D283936 KINGROESSLEIN
637,464,986 *41A4255A3109F0E5E2B72100F5EF8555E5FDFEE1 kingstown.
637,464,987 *41AD284B21F535758507A3F52FAE8EE516AE61E2 klöpfen
637,464,988 *41AC01F0200E57A6E3A00A9328246EEE5E6A36F7 kya;
637,464,989 *41A4E542E8D49E0C47AB6A2C73F920812F8794D7 lavernedasmann
637,464,990 *41A4289D0E6E60A805A8375F7504989B936B4C64 layouts
637,464,991 *41A3EF5EBA25CD369E176B00ED95539D2486AFDE LEWH
637,464,992 *41A7C124CB46514BC50C1AF2BB4EE1287A31C5EB little high people (take 8)
637,464,993 *41A7D93E728B63B666513DA8F9F79BA2173CAC22 LIVEPOO4
637,464,994 *41ADC1CBFAC697801D92B57199966D1269F507D5 LKPWBQYK3TSC
637,464,995 *41AB5E45E3D0C4B815EC20325C80F9D46875FACD LOGANGOELTZ
637,464,996 *41AEE597B6BB6032593293799514C83BCE3516E1 longscamardo
637,464,997 *41A5106663830C76702C2A63A682800E5735B6B8 LOPHODONT3
637,464,998 *41A6C9CB851E635B0C6E4E738BF3A5739F7C3D08 lorenvanproosdy
637,464,999 *41A3E5B870BDD2BC3379C5FFD3F77F9B18BA8DA8 LOVEBUZZ9
637,465,000 *41AAE96B6C551C7BC05E7146F5FC2B2E914CBFED LP:I
637,465,001 *41AA48F8C01FAC69B0E2DD24E72A4A173CC7E34C LUCIANO.WENDLANDT
637,465,002 *41AE9E8F4F1B1EFC2EDC8132FB35EAFFEBB3ED6B luisletran
637,465,003 *41ADDD34F802B857435E3DACEFD96914FEEC9BFC [email protected]
637,465,004 *41AC64C457E208B646F9D0685680131575514C7D LY'I
637,465,005 *41A938DD4DE2136F8070BBC3BBD4929EE20CAF5F lyndonlettiere
637,465,006 *41A63E65D8EFE0B7BA3571FDF53D69FF63A74C60 M142105
637,465,007 *41A4073EEDDC21D0F4FADA77DFD4017E510A6170 MACHIAVELLI-SHAKUR
637,465,008 *41AAE2957511F0D755B2A0AD0C09E2B12D148887 maconio8
637,465,009 *41ADB28591B9F7EFBCF3BD49F72DD1F1C09E4AF0 mainho123
637,465,010 *41A8882E228BB703DDA5E2FCC8C8AAF83A31418D manyann
637,465,011 *41A69E8B7BC7DAFD1A2CE94770212C73DEE0933D marcuskinville
637,465,012 *41ADAC9630CA3ED46DE7646CB606078A3D0FF58F MARIANOVERGIN
637,465,013 *41A3558F0BC4529D96980BC372DE78F33FFBD8B3 MATUHISA9
637,465,014 *41AE089DDD6518392CE11E25BEAF4F86DAD03854 MAXWELLGAYER
637,465,015 *41ADC7452E6C2A5185754FD8881A662BF30B0476 [email protected]
637,465,016 *41A805C565A11B2C71D2DD523D38CFF95B35E8FD MCKINLEYLASSWELL
637,465,017 *41A707066B00BD0DC47D7E0C6574F8EB859A1DBE MCLPRISM6
637,465,018 *41ACFA98E51075B4F02DF6EF0891AD0F5CD469D9 MDELLAPERUTA
637,465,019 *41A3FD0C854678C957CA20C02232EA0944FCF0F8 MEMBERCOUNCILOFMINISTERSUPA
637,465,020 *41AF2B8131C78E67404AB9B143697BB8D2DEEEC7 MERRILLNOCKELS
637,465,021 *41AC06691F9B5628FAC4CB05528EAEBF3CD53A4C MIAKA.SY
637,465,022 *41A30DBC7241CAFF7F81B965FB8BCFA3528483FF michealsvenningsen
637,465,023 *41A550CAD1A2EF22E10A348A5159EB33D80CCEF0 MICHELE.OLIVARES
637,465,024 *41ABEA0D84C363F6F7462AE979B0A7B968D7E8EB MIDOEMAD
637,465,025 *41A82A9D5E409176D68C84F8B366CA30BF684B54 milespfeister
637,465,026 *41A0FFF27E2E51E22CA9CE7C9FC395CC877D09BD mimezine-prelude
637,465,027 *41ACDCA44F7B1100C2699F3F73F3E21562CB3121 MINENSUC1
637,465,028 *41A34705F8CBCC7A685E57D3D8DCB98F0BB8B523 minisunil
637,465,029 *41A380FFCF5E4FF3ECE1A08ED0B1188745594EC5 MISKREDITERE
637,465,030 *41A808AFBE4D86F8E45FE39D31CA8CA8E38731A0 MOHAMMADSELAWI
637,465,031 *41A5F4E1FF53565C47780A4E126A22E81E0993DF MONICANEL
637,465,032 *41AFC65FAF1F298CC850B0451481742CCA744B5C MONTY.KINES
637,465,033 *41A8AE9261DC3174DD24653EC1E7E3F07797FB32 morirono
637,465,034 *41A28F70C74EA584111E324D0BCFFC6A359BEB3A MUGO1I4MO
637,465,035 *41AB4584C3D42DB249B37EF175A8FE4853A221B1 MUTANTDIAL
637,465,036 *41A37B6B52109585E61F8C590A0DC7453F3EB381 myeagles2004
637,465,037 *41A0A848B609E7070B2729F3BCD80849C12DA81F N617= :VOICEDONE
637,465,038 *41AE7824372C40C92C71940F5EE3F8A169BFEECC NARDO12
637,465,039 *41AC8E098BF6D595B336641B5F60D0419B9797C0 NED.BARRIERE
637,465,040 *41A55DB11D6F6AB5778B66F1E2744A98D3612B77 NED.NIEDERMEYER
637,465,041 *41AA267B8679FCF13AF96CBE3E3E4CB001338371 nedsltt2
637,465,042 *41ADCC888ECEA2959CEC8A354373E85F4D797257 NERV
637,465,043 *41A158AA5048569F52B27F9CAACA7F0310DD3B3F newport-news
637,465,044 *41A54528D78D8F2373E70E8953B06A874F84DD1C n ja kuoleman lauluja sarja op.69: kuin tulvavesi el
637,465,045 *41A0D36A2186252024F51FEE122587E4CE55A547 NNTLRNTS
637,465,046 *41A7AEF50AE73C2B79BCEBE4F081CAD781DC9A87 NocturneNo.5inB-flatmajor
637,465,047 *41A14236FB97F34B21CB47A7E0922EA0C95E0B50 NONCOLLUSIVELY6
637,465,048 *41A0D986E38E6356B117663B7F63AB8758879966 normangambale
637,465,049 *41A93E1443E29390CA02EF76F8ADCDA375AB2F82 NOTS3LIM
637,465,050 *41AB7AED96496900A3F52DD63E8488305560850F NSTGMTSD8
637,465,051 *41A3542C2596CF718D9C9C98BA7A722E1619A44E NTAOZ
637,465,052 *41A8DFA72ED4F11661C713F1B9EC2088B88F0598 NTSCHPTN2
637,465,053 *41AB156EB8A1928CA66C277A85C660612DF7E0C3 (^_~)o~<--3
637,465,054 *41A4DE59195D79BD706F9D848803B0E0C4839DC3 Ochurl!drunkall,andleftnofriendlydrop
637,465,055 *41A94E700DD70B2F9A0E08C1C80B2C306BF88B08 O$K[
637,465,056 *41AFDC3FB0B8541CDB88AFB408B3337C9E4BFD34 okhwysys
637,465,057 *41A203DD1384AF2FCC0A2CA64A9A5EC2BA6B0AF0 OMARBREUNINGER
637,465,058 *41A4FFC2CD02CB808FB641994A9C7AF2002A74C2 OMAR.MENAS
637,465,059 *41ABA236BA615A12181991BBA442393155B4992C onvermogend
637,465,060 *41AC3EAD8E77B86831F79894E4147BB6CDB1A7AB OTCHAYANNYY
637,465,061 *41A371E202B61CFDBDE670C202DFF930486C8310 overlook
637,465,062 *41A9739A7B49F7657B6B86E6B6C81128F967B508 pararect4
637,465,063 *41A34FDA7C5014BA11122190ED655B6EC4EF83E9 PAVANA-BRAY-WILLIAM-BYRD-1543-1623
637,465,064 *41AD0528BE3A78B363D7DC1B338F365951D643F8 peeweelisa
637,465,065 *41A6CE0C3AE6FA5324E5727EE6A750B7301DE94D perry.mcelprang
637,465,066 *41AD947ED60BDC5D311F40AFB4E01BC2F1058B9B PFROGNERS
637,465,067 *41A16C1B78EBA2EFAEE444F20CDB938FF5830F0A PHANTOM HEART BROTHER, PART V
637,465,068 *41A68A8B799D24B979178A92AF45A57D53193EBB philsturgill
637,465,069 *41AE19C4C10B3E3C1AD252387A6D3E95EB2EF651 preheroiced
637,465,070 *41A03A23EA005A05881B0B53D06A174813916C4F prenatal
637,465,071 *41A808206C242E35F67257AFFF6A6B038BCC7412 PROA+HEI5+
637,465,072 *41A8EB5BB86D94539BB4D5C98733509ED40A1019 PROPGUNS
637,465,073 *41ADBF692FABB9F116B0C05B955CCFCDA5C88072 P>~.~.~SPLAT
637,465,074 *41AB3FABF1C5521749DC348F922CD3E6C9686670 Q------) ~0~OSPLAT
637,465,075 *41A96BC15EB5D0AB936ACB1BA6B4D195F5F75860 Q#####D.`O><
637,465,076 *41A48443F6466AA628B9AD2A77FB1BA0D9EEBE7A [email protected]
637,465,077 *41AE866D3E0EA177607F5B72C5CDB6DBF10D77E2 [email protected]
637,465,078 *41AF738B44FC150173C908A0B59B186B3EA406C1 [email protected]
637,465,079 *41ACA5E3059EA7ECD8568BCC94B9024359BAF91C [email protected]~O.~o.Sploit
637,465,080 *41A43FC0ECD0A53D390320F51F27AD26109068C8 Q#####P ~O~O(>-<)
637,465,081 *41AD2AEFCFE9DCC34E01DCD295EFFCAA03B59867 Q##P~OO->-<
637,465,082 *41A9CEC07AB6E104902EE7AD27CA57E66FF6E6F2 QUAHT
637,465,083 *41A6711C59ABE5D4D653EDE46D7AB26CBA052C70 quoddies6
637,465,084 *41AFCD81CB827944D7C554DA0CA3A894C0C33AB8 R3CRY574LL1Z1N9
637,465,085 *41AEE75C6387E23678DAADE29725798F200F495C RAMIROMCELVEEN
637,465,086 *41AB1AD46CAB5490163491E4CBFDE71476942074 RAMON.STEHLY
637,465,087 *41AF8928CF4E3EF3FCA51B5841B2D1868397B72E RANDPUNKTENS
637,465,088 *41A1D23D4617A9E63E09A6627950006E12993C41 RAYFORD.KARI
637,465,089 *41A4D4B39758D06E61D824D7AC6F9E4567E83F45 REEFERRAINED
637,465,090 *41A129211396F7BB3FA21BF2DC02A45BA6B51F67 REFUGIO.DERRIG
637,465,091 *41A876D41D30ADF0165829C89883CDE6F2A6018B RELEGATEDCITATION
637,465,092 *41AF517C439DA4E8978E60685A71E27FFF9A1832 relkivva
637,465,093 *41A761D63DE5A4A457316843BCC4A03AA2E1953A RETROIRI
637,465,094 *41A27EA2D32A845BE8D82BBD998918CC8C40A682 REYES.PACILIO
637,465,095 *41A2EE5ABBB03EAE18A128505E4F55A90B14C1A5 reyestolle
637,465,096 *41A10C35C8F639021219E0CE5DBE2BECD8FCAC34 [email protected]
637,465,097 *41A98FD58B862B7514C31C7EE5238B139F6BCE09 RHULEPME9
637,465,098 *41AEED644D1D128CC003AFF23D47D8E791A921F6 RICHARD.REGINALDO
637,465,099 *41A507A0CC7AA063040E59714847333F2359938F RICKIE.HOCH
637,465,100 *41A8C2AAADDCCAD853F058749EC6FB068C81E9B5 RIE 22
637,465,101 *41A1EEF29551D59C5ED97AE83ECD176E301CAB03 RIGOROUSNESS
637,465,102 *41AC4C600BC51458F3A41932FCDE320F19619864 R&IY
637,465,103 *41AB72CECD28EFC1B9B0358F9E9B2419EA6E64D3 [email protected]
637,465,104 *41ADE48CC883A0E52616D61CC7D6B8B5E31C8352 [email protected]
637,465,105 *41A14E81A4658FC67222A5D19FE42A4D2A0E62B6 ROCKYCAROLINE8
637,465,106 *41A463F9A5FAFB78EF899A728C9B78C60469F95B ROD.EARNHARDT
637,465,107 *41A8238829656232F2182F01A1FE43EB36C45CD2 RODRICKMATTHEWS
637,465,108 *41AA41D5FD49BE62210C7DE35005F99C5C399064 ROECLIFFS
637,465,109 *41A4EF2A78C7F853E79C736B102A0E775E066DF6 ROLANDO.BURTIN
637,465,110 *41A24D070C0FCCDCE3F5EDA74566D7773AF12F57 ROMAN.DENA
637,465,111 *41A389718C869F7BE21757B96A424A4C74AC8531 ROMANMORR
637,465,112 *41A320820595D43EEB6572165466281A0F616403 romeovandeveer
637,465,113 *41A5ADFC7D791351C26665959108C1C1728CD441 ronaldsorrow
637,465,114 *41AB08BB350E73EAFA6490DC2F82F9E8A87EA0A4 ROSENERS0
637,465,115 *41AB31C6B9F645055A565CF8DAEBE97124CFA23F ruloicitadel
637,465,116 *41A789647382334FB924CF4400073BFC2D983439 RUSTY.SANDNESS
637,465,117 *41AB780F8AD06D3E746A3D2CDFA59B6320B5D5D9 RUTAZROF6
637,465,118 *41A2F0F9C21E4927D77C753A6279E01C8AEB3FA5 S4F(
637,465,119 *41A8BB3FFF8A9E9C47152B296EC6764BF9EBB485 sackful
637,465,120 *41ADCE4E1B391930D414A85251B6A9F824A5AAE2 SAMMIE.DERAPS
637,465,121 *41AA8FE138BA4B864783DC87AA62B7BD076F4A27 samualdarring
637,465,122 *41AE528CD6D730CA5BADC81F028B1320BB9E19A1 SANSINSANSIN
637,465,123 *41AB059D96C9C50E0EA0EE1D5FAF961E2749A00E santopoydras
637,465,124 *41A0ACEB46260AF0D54D13FBAB1C3CC7E5BBE00F sanuknev
637,465,125 *41A457B2B973E5F1E1490618B1101C9C78E969F0 satsthala
637,465,126 *41A5AA93400A68FD7FA451DFD42672A3D962A464 SCOTTDOLEZAL
637,465,127 *41ADC6F292516757367262B560061CF616D7A67F SCOTT.VINCENT
637,465,128 *41AD2C94A8E92456A3FB4821EE9C86101C392601 sea;
637,465,129 *41AD7459DEEEFF071C56F666B736D1F213C1007B SEDESATNIK5
637,465,130 *41A6211C9333316F0F6DD08E7679453F1340C18D SEDULITIES1
637,465,131 *41A53E469D94B2748A2528D4C31E7ACA7A083C7B SEROFIBRINOUS1
637,465,132 *41ADDD5C00B1E1181AFDB1327C566C56BB38D54C SGROSSAVATE1
637,465,133 *41AF9769C5C9997317B930C11C045352650238CF SHARON.SPERRY
637,465,134 *41A9E333A21DCAD73F9DA9633FDF7F42DC5A626C sheughs?
637,465,135 *41ACDFC7BF5864FA108B9403438FBC86B8135001 shoulder_loop '/s//ou/ld/@/r_l/u/p
637,465,136 *41AFCCE1FDD2F611824333B8DF77E2B285F9F777 SIDNEYECHAVEZ
637,465,137 *41AB133AE55BB7E0EAFD6C7B9DB704AEB2622139 SIDNEYMATONAK
637,465,138 *41A606F13338A1D923B3FA5DCFB6D512B18228BB SILM{NPALVOJAN
637,465,139 *41A63C478011CCCC6166F0B1063E9439327D7AD5 SKLHATS3
637,465,140 *41A9812AB3B9A998A0F5FBC0241B419FF58B8CB8 SODASECNARFA
637,465,141 *41A8DB150024C0DCBF6E3DFCE2B52FB9A36B451E [email protected]
637,465,142 *41AAB0D04FA0ADBDA8403B92BAD7253F00111E7D SONNGUYEN
637,465,143 *41A3AEEB1D3C1A67D30E22D6715D521B57B196B5 spiàunə
637,465,144 *41A9E1862F0FE0060866B7F5ECE549F0D664B56E stacyslaboda
637,465,145 *41AEE94BB93F63DD33548B5BB6928A880BC62FC3 STAMKIS
637,465,146 *41AFA8A489B0CD930BC41730F028077798EB30B5 STARNUTENDOTING
637,465,147 *41ADBF331240CC2E2F87028959777FC2959E2279 stefankauble
637,465,148 *41A83E8D1F35F59C53904EB9E1C4D2E51F1FF0AD steveneiderhiser
637,465,149 *41AC338D319AB37928B0B6E6D7EDEFC633AE2AB3 steveruby
637,465,150 *41A6459D682DE8C738DF7DD3389060A4F2ACF87C SUBEROXIME1
637,465,151 *41A0A1113A4156BA49975CD64F2AEEAA2ACB99C9 SUBGLACIS
637,465,152 *41AF8B22420DFEE54AA57F0EB82A2B6849CA558D SUGARLAMER2
637,465,153 *41AF1DA7B404CFD940C74880A953D39812741983 SUKOZUOKED
637,465,154 *41A59153BB2A93C2742EA101510B526FF204CDB8 SUNPALEDING
637,465,155 *41A91D2A4FE786903589A79A9C22A3709812C594 SUSANCUEVAS
637,465,156 *41AC7FDEC82C5AD35377C517BA0728928B5520EE SUTTE-REHJANGE
637,465,157 *41AEAFBA5B4572F7CF276040C800CAE8F76C7BC3 SYMPHONY-NO.22-IN-E-FLAT-MAJOR-''THE-PHILOSOPHER''---I.-ADAGIO
637,465,158 *41A9D4DA32B2979484E0AA2824AB6FF7ED708119 T0M8A0D06G1
637,465,159 *41A53C12224621ECC970C3A07DC965017A72945F [email protected]
637,465,160 *41AD71A7AAF38D41F1F10403B652A99E611AF6DC [email protected]
637,465,161 *41A411EF06A978763B5E654C4C1B7EBA8F3F9A34 TE,CLARINETTEETVIOLONCELLE:GRANDFONDS,MAMB
637,465,162 *41A5FFBB36A43F3BDCC52F822B999104409E0629 [email protected]
637,465,163 *41AB3C1859FDB8BAE9179FB7C2BF7D912E814673 TERI CHRIST
637,465,164 *41A36A10B6B656F6256B349431CF4E0E383750C9 TERRELL.LEONARDO
637,465,165 *41AB88FDAF6BED246BFD7B819147DBEAED4AA375 thatblinds2006
637,465,166 *41A4109098A410862DC62AB22AC53C813E749E99 THEBUTTWHISTLE
637,465,167 *41A70051891EB2C07680BCCC4E5D5A3A768CDDA0 thejody8
637,465,168 *41AC651472D8547B9DE386F517D2E3D4E006D154 THE.PERFECTION.OF.WISDOM
637,465,169 *41A2838724231FFA91777224192ADB60A3F1E725 THERMAES7
637,465,170 *41A0BD98B9CE29480684786720786F69D0F18C63 THERON.BRUMBY
637,465,171 *41AE1FE9E09878D9950697F7B4F0F928E2C5F170 the-want,-lacking
637,465,172 *41A8067F0377EBD8EC03B23F93E857E2A7194BA2 thys-buitendag
637,465,173 *41A306798C7282F4D0C0A61FD12E0A471C52ADE9 [email protected]
637,465,174 *41AAC3B6534C0C0CD1DF2F9E9A3331D352BFC1D8 TIMESNBSP2
637,465,175 *41A7BE75E9C67D5E2CCFB6B33C27208C38F469E1 TIMMY.BOHL
637,465,176 *41A00204AC957F06790D037FC7BC1B7D002FF767 timothysessler
637,465,177 *41AC5F299380DD093576172D62100593998FB0C3 TINUBIRTED
637,465,178 *41A481A8D9546CAEB2A557CDEF2E7EA7C6AECCD6 TNEIARERUTOLC8
637,465,179 *41A482A4AF1A6A756FB9295C47951600A3248B6D TNETADNAMING
637,465,180 *41AF4C476DDAB0707956B273A677ECAE5FA28AD0 TNOREFFURT9
637,465,181 *41AA652AB08B016EC3A033E49C4AC6324F5D7D97 To1o$4-wo
637,465,182 *41A53C4A5A28CB6D7D3AD1D17F8BC761A3F54A08 Tochangethepageheaderprintformatforaparticularfile,
637,465,183 *41AEE38E1437814BEA483C6EB10AE6D98F8CEFC3 TODD-ANGLIN
637,465,184 *41AD208DAD35D1FC4482599FC1C3FDE8540B01EB toddmurrock
637,465,185 *41A5875BC922DB6A7B74850C25E239ACA2DBADAF TOMMYMEEHLEDER
637,465,186 *41AB0C1C04CEE88854091C43D5A74FE26A3B88E0 TOURGENIEFF
637,465,187 *41A7D2A13C9E2B1153604C3D2EFB3B3DADE623F2 TRCBLTY1
637,465,188 *41A40D3B2137478172047D50FB1CE125B39106EE TRENT.SPERREY
637,465,189 *41ABA83963C609094A796C185637CAC1BF2EDE9B trucking
637,465,190 *41ABAFA762714505328E21DEC16B1A38937FCA3B TUMIDICARPUS
637,465,191 *41AFAADE5E5339FD4DE72486A63DA95DCDFB95A2 TUYETTRANGVU
637,465,192 *41AFC75A9514E1401CF67F7B4FDB8484C2F1F679 tye.dallas
637,465,193 *41A0887CB2272149598C6D0C0F571E03E4848C2E U5,I
637,465,194 *41AB096B406D02055756AF84908C6B322DBF22F6 UGUN-PRATAMA
637,465,195 *41A2B35F3F1822608E88E1A03647318307EF7B99 ULIGINCOLA
637,465,196 *41A9AD097F8074A8299E42C341136F6AB4AA5EC8 unbraceleted?
637,465,197 *41A64B0E356E055B8410097CED0BD33D7ED529A9 UOLIQUIANO
637,465,198 *41A135F6523C85DA472AEC3D787692F02B75701D upq7
637,465,199 *41AC7E890AE96C6140EA6C27716C8B3CA7ECE72B usstoreclosureinfo
637,465,200 *41AFEDCF0F6263BCD6111790F0E029E2EDDE6C6F valentinevoegeli
637,465,201 *41A7F4CD9D20EA769346038688CEC7A13DBF1737 VALENTIN-MANTA
637,465,202 *41A28864E199A4F9951F642F5A31180B7F24FB70 VALHALLACAROLINA6
637,465,203 *41A51907997EB7C60FE87926FAC9C7E9DEE0B1B3 vancearchbold
637,465,204 *41AA5F4EEC8ABDE6685CB10A22AD75F3A2481084 van-teto
637,465,205 *41ACBDE47A07FA64D2C5D617C0C0F3B482B4E353 vào.sống.ra.chết
637,465,206 *41ABC2CBA5505C6FCCF98A88750FA7ADB5DE2868 VARMEV
637,465,207 *41AC411797F7C4180B90A85F9A4371F1AC6E62FF verfplanten7
637,465,208 *41AEB92062D2499C60315D3F363D0C444ED07ADE VICKENBALIAN
637,465,209 *41A9B842167FCA0B6F2D8FCAD8136DDCB1C79350 VICKY-SMITH-ADAMS
637,465,210 *41A5355DEE1E276DC6DF7FC979BE76E0A908C35F victor.george.villavicencio
637,465,211 *41AD34DA6E79DD81EC88CF009CE7BA597D61757B vidyarthulu
637,465,212 *41A2204A995F0C3EBB86EF0CC0A453F40D148BAB viihtyv
637,465,213 *41A9D12CDAB8441CEF5EAED19088518E681C4A99 vincenzodunshie
637,465,214 *41AE06A559C13173FC39344F9A667186D8B12F39 VINYLCASSETTECD
637,465,215 *41A5B795B03677FDA8F1E1FF56E922E726F991D7 VISKYLAM
637,465,216 *41AF0F33DD2480152F9E20007F5FD363A1843BC0 [email protected]
637,465,217 *41A79EE5B5B7FE3FEFA69AE54499429B1C9D445B [email protected]
637,465,218 *41AE2FE419FDC2C5329A23F1E37C4F2D07E80309 VOLLANO6
637,465,219 *41AA788EC8955E816FBE18B1FECE84DAE49063A1 Volmachten
637,465,220 *41AEE82BFD51D584A318C5C31647364399746ECA VSESTRANNEJSIMU2
637,465,221 *41ADAD0D37E54EBC63A16A2738CFC16084CDFB00 vuyotdunjwa
637,465,222 *41A614A3F25F814D8B09AFA3D47FACEB277F99F3 VYPINAC9
637,465,223 *41A20D1CECD75C9FBF1EE119C6C692BCEC3AB915 wahwah-moe
637,465,224 *41A3EAC8B38E298B72B6E48035C05774EF76EBFB wahyuwahyureda
637,465,225 *41A104B3B3F864AA7818345B205F493D682BB156 WALLYKAKAR
637,465,226 *41A805183412ED1428233C9C81D4B50F7B0BD33A WARNBACK
637,465,227 *41ACF52C45DE43F676DFC784A8F9E14FB20C99BF warnerstorr
637,465,228 *41AACFCCA32418FDC3DC4D70F1010343ACD8EFC5 WEERSTATISTIEKEN
637,465,229 *41A6895F2D99DB142913896BE32EDD8F05C6F087 [email protected]
637,465,230 *41A396467A373AE0B7E041E46F9AB2C55265FBCA [email protected]
637,465,231 *41AEAA9206184EF270A1D326C93050C1D8FD485E wenny.meiliany
637,465,232 *41A58F92C447CBA3C737435872D9A4D5E7D66673 WEREMORIBIUIDATTBE
637,465,233 *41A7FA84F774CA425B5D1330DB1367719FE844CB WESLEY.DABNEY
637,465,234 *41A6222380E629678EED99AB82B8080C3E5ED483 WESLEY-DEVAULT
637,465,235 *41AC717F7E98DF656AAAFB5AD8F9ACA0606A7CF0 WESTENR 1 0
637,465,236 *41A5D98B0DEA0CD2D719F710B4C8C8F5B96F292A westonebilane
637,465,237 *41AB95DF8233EEEF273EC05F628A51999C4B3115 WHOOPEM(FEATLIL'MARIO&BURNONE)
637,465,238 *41A6C8322F4C51F4621B9D303D82671E7495B67B wielklem1
637,465,239 *41A586BC441248D528F2361F11A72AC821D75634 WILLARDTRAUNFELD
637,465,240 *41A447E4F6213E27F2D4913422600A88755762EA WILLGAMMA
637,465,241 *41A64B2E50099ED59FA946A5C201C7F8C36BB855 william-hopkins-jr
637,465,242 *41A7342F15B4480F53B4076EE1E3DB0873CE0B4E windy-rohwer
637,465,243 *41A8FD398AC885FB0B1BBE36DEC0BBAC734A63D7 wingcommandersepia
637,465,244 *41A1D8246BB7BE82C13CDD079F20A83279BBD033 WPREL
637,465,245 *41AA8AE531AA4320E4404C7DCFAD2C42BDB4B1C5 wwwresourcerecyclingcom
637,465,246 *41A9C1407DCE999FCC71B6A46ECC60D88DF0DE8F X):,
637,465,247 *41A3B7964E44BCC312289B65D1D5D068B1E3625E X8_
637,465,248 *41A1A7EB4E78A4181AA9348B52306DA03DC47CD4 xekchay-kareng
637,465,249 *41A5F5C779920BFC8B63B357C25851A1D71A61D2 xxkewlstuffbyclarexx
637,465,250 *41AE8A781BBEC8AE3E6D1F6DEBC166886EC180C0 yael.parvar
637,465,251 *41AC74F25B319A964F208EE26EABE7F4CD6F278D yancy.jeleniewski
637,465,252 *41A1E2A7F3F3B2533BF8DC820E7D6BB6C13F6E55 YANKEESSAVAGE3
637,465,253 *41AE3705330B0DE3E42C0E970B9B92795E109A72 YANOUTSOS
637,465,254 *41AA8A2A580B7A57346078C09F4FE7613BAB08BE YONATAN-TAKO
637,465,255 *41AD6A4A24B54F478E56D16B3803F03BD369DE36 you160berig
637,465,256 *41A57BD148FC7E9B01DEFD0CE0EAB815A0B57021 yufen.zhang
637,465,257 *41AAF245A25F23A00524DA272F755EF2C5EF43E6 YUNG-CHEUK-MAN
637,465,258 *41AE429A757BBF0B820453E76AB3A21980A9E321 yurismadiaz
637,465,259 *41A86F06CB3D46F96198A65D935D2F576090B4B0 ZACK-GHOLIKELY
637,465,260 *41A90F1FE63622E76262637454917CEE400C077F zahia.bolos
637,465,261 *41A11F1DB545743735775C514986424B794CF99B ZAINEDCALES
637,465,262 *41A622B99AA36081E39EF9903E100F00D9B302DB z+cv
637,465,263 *41A7269C07CF24D5E8216AC550A7C5FF53CBFCD3 ZEPHYRXAVIER8
637,465,264 *41AC0F2701ADA467B9FB78CDD4CC9B4852B84AA9 zgl,
637,465,265 *41A8E36DFB8421D01844EF4BD864E8206D9A0F49 [email protected]
637,465,266 *41AF6845A7022DC9684924190656221EF126488E ZMINENEHO3
637,465,267 *41A2F4FB90ABDA1337E83D15FE4B5BF9DB18024C ZOEMENDE6
637,465,268 *41AC649C6F243B55F02D8DC9D3EF68B000AB833E ZORLEANSKI
637,465,269 *41A1E2967881A927CFB785D05A0D9078EAC5F3FE ZURUECKGEBILDETE9
637,465,270 *41A2468452E53A0EC5F8CA1E6E36D39D2A485B53 ZW9KYPCT6UMVM
637,465,271 *41A4F35E54534FBB598A18D3A26305AE613D2F87 ΣΈΧΟΦΕΡ
637,465,272 *41A88608E1C66654C3300AECDB344825FD208246 ВДЯГНУТОГО
637,465,273 *41A09F373B02E2831A892AF64D7F23A7045EE4A6 експедицијска
637,465,274 *41A1452EB46CBEE95AE7ABD4B7F2F86F9CB729AF салынского
637,465,275 *41A4E91260D99DDB8B3BBD69B5A38FE4CB03F8E3 фелісією
637,465,276 *41AC00093EE91CB48A9019BA44FB31D755B90232 06081324
637,465,277 *41AC44034B814932AB8940E715621EAFD5397F50 0THEBIKER6
637,465,278 *41A8452367718E5224DB3C6084D0BC28854416F0 112MACLEAN'S
637,465,279 *41A581BBD84193267502B1D1E78056AC1FE0AD7F [email protected]
637,465,280 *41A817EC59D5EF486CDD013091E75B25949783A8 1381210 MALKURZDAUNTENNACHSEHENGEHTNICHT
637,465,281 *41A319359B022EBFBA9656462380598CE444D850 1543701 TIETOA.T
637,465,282 *41A4FEBDD1B13A124E7E7C0DED997AF6A10C115F 1566225 BARSUKOW.TRITT.DIE.NACHFOLGE.SERGEJ.STEPASCHINS.AN..
637,465,283 *41A94CF07393208CAB807B4A5675AC274D0097B1 168JALIYAH
637,465,284 *41AC1DF5CF88EA9A58812CAB417E1D1FBFCCEB44 17.02.1905
637,465,285 *41A3E777B3D1941413BB357D6C4E502CC2232EC8 1817516 der-finanzmarkt-wird-nichts-anderes-mehr-akzeptieren-.
637,465,286 *41AFD839C8DF3BCF17455282EC32DE015CCB20B9 1933–OBERBAUVERWALTER
637,465,287 *41A8B756B27A3A44AC1281CD5FB3728323DBF0A5 1ammatti-oppilaitoksen
637,465,288 *41A9329294A044244544D07851C9921604F04F1A 1ASEMINA
637,465,289 *41A9A99BE8A85336C5672E82408A9E0097E87045 1.BJ
637,465,290 *41A2805A1A0687F5A92B71334FA8E3557F8FC888 1-cardinal-ram
637,465,291 *41AD9A0C7788DA1D637377428DE4C6C53AC02848 1 DUZECLEMEK
637,465,292 *41A47E491F9ACFEAAED75B6D5C16F4264D5705E4 1ec-mandated
637,465,293 *41A50F3A19912D3C498F39D1628CDA9911B04BC0 1.edeblirsiniz
637,465,294 *41AB8FAB58DA6DA534809B426FF82803023FA7CB 1-GRASHALMFEIN
637,465,295 *41AD9786EF71F875291C168E07C9758912E391A9 1-haudattavat
637,465,296 *41AB6FB51B8B1455A01FF137EE8162D524BA8AB8 1HONGALOO
637,465,297 *41A9F58ADB7F347BBDB156EDB186F9E986F2EB95 1-LIFE-RESTORING
637,465,298 *41A8C0EC9240DEC16CB97A5717284FC265BA87B6 1-lintuvinkk
637,465,299 *41A1C2AD2EDF1EA1024D0D2DEE86C9E7A26ED862 1-MAISTAMATTOMIA
637,465,300 *41A3437129AC12430514636C95DBDB860ACC208B 1ONE-INCH-THINK
637,465,301 *41ACF8795AF8D955E255CDDB3B02520C5CF67574 1.OSTWESTRADWEG
637,465,302 *41ACE60A35433EDAEEBDC87AA2F2A6C559305A33 1.REKORD-RUECKGANG
637,465,303 *41AAD614EEC18818FA31321C23523C6D6F9E2558 1ROMUTETTAVA
637,465,304 *41AE86CC6045AD6742A6AC6D4F0047F09C8E2816 1.sauerstoff-geraete
637,465,305 *41A4729EC6B44BCEB933221B808CE80A02AD6E29 1.sepitelleet
637,465,306 *41A517D42F696332E16F952F009685D0C08C443D 1SONATOM
637,465,307 *41A764F81DD4F5B218CDC17C1F5E90FFF8F07481 1-Ustlenenleri
637,465,308 *41A3C77BBEEA591E6D8E86B17B913CCB8B8AF1FD 1WIRESATELLIITIN
637,465,309 *41A491025A79B35662342323F12C189047FCE4F9 200RUSSELL
637,465,310 *41AAA662DAD72FBD4058B25A75E7BE73594951E2 20GENTILLY
637,465,311 *41A3797C109AD7A9C81CEC0A3730E5EB382A74DC 2356223 HUMALA N
637,465,312 *41A7B60998F00AF9E2237B3E927CD530251F3017 2431534 TOTTAKAI EHK
637,465,313 *41AEABC7E39D0E8EDF311C2D6246E2115349A829 2513694 THEDRUG"POSSESSEDMELIKEADEMON,"SPROULESSAID.
637,465,314 *41A4424D634D771F3C166EA2A328A5654820066F 2541606 at-least-20-people-were-pulled-from-the-polluted-water-
637,465,315 *41AA034947775D9C4703FF1E66CBDD912C9FBA8C 2781077 aikaa kuluu enint
637,465,316 *41AE8790747AD884CDE2159DD0FD5924DCEC3CB2 2AARONHALL
637,465,317 *41A3A974F2E39F2562F439976574F6D04BB9F497 2AF72F100C356273D46284F6FD1DFC08VERSION
637,465,318 *41A470CDE817528DC141B14D93122B2D74AEBDE4 2ATHENARED
637,465,319 *41ABE6455E38FBF86D32DEE4A1A76BEE8BD3FB4F 2-BESTECILERE
637,465,320 *41A7DDB6AB43A231934784EED29373DEEC0EB4F3 2CLAPSTICK
637,465,321 *41A2FFD6EAD668D8287B67ECBAD75BAE22C27F8C 2DZIWNIEJ
637,465,322 *41A90A12D05BFD8C83D7C797356875E73A4D0FD2 2FORBIDT
637,465,323 *41A5E90A9EB87E94A58D49C393F100B53A7045E4 2FOSTERMOR
637,465,324 *41AFC82CF2A6EDE809D12C964C3C1285A600CB12 2MAY1250
637,465,325 *41AF559F298AA17DD4F302DEDFEDDE58D8560EDE 2sivareissa
637,465,326 *41A4464447A96059133FD07F192A19ADE1E19F74 2SULLICUL
637,465,327 *41A19E9F2E74731ED3C8036051588274A7CE02D5 2WIENERP
637,465,328 *41A4A85CFB440BD6CB71F74B485B92859E220775 3)~ `(^_~)
637,465,329 *41A9CA6E5903FFC87314600DD4773188F024DA12 336960 netscapesurum3.?'
637,465,330 *41A9BBC59C97D00AF763D798F5AF3614F595A9A7 399753 (24)"headoftheclass,"abc,110
637,465,331 *41A565AD8025B516A79C2F88971BFF67AD10A1BF 3B<-o~.0~<###p
637,465,332 *41A039666329E4877703DBBD97553E56BD03DF3F 3b<- ` q-q
637,465,333 *41A691B6E2E5499A4991B83EE84E3CE2BBADD5F7 3FLOWERBR
637,465,334 *41A6A87D97B96B17E18CD557EBCAFC064436FE05 3GEFAEHRDUNGSGRAD
637,465,335 *41AEA3D851A8471C1DEB8EC1B7826C3E488D63C6 [email protected][email protected]@N5
637,465,336 *41A6CC85C8CD85B94F32C0799BD43DE723A38812 3-LYYRISEEN
637,465,337 *41A9F11F3FC38E6C6C0B5EADEC3214ADC6005613 3-----P~0-~O-SPLAT
637,465,338 *41A0665A7C994E37C7DE7942EE31733514D25691 45KELVIN
637,465,339 *41A5A4C4FE25EA81D561225E66B2456EE01E3256 4CLICK-CLACK
637,465,340 *41A22BB72C0C54222FEEBEA872E52691F3A86B46 4 duyurularimizdan
637,465,341 *41A959A8093A0F9D82E5CAB26C6FC2A6EDA3C13A 4GNILEMOK
637,465,342 *41A80BDAD4DEE0FE241D4D91E2E0E149835D40DC 4KONINGSADELAARS
637,465,343 *41A7F77411D29A3F22C448BEF69D16E7F2B2B028 4KRISTIELEE
637,465,344 *41A4D59BA7CF0E15AB44E31A86C3DFABD8CBF888 4mynimrod6
637,465,345 *41A77146518459DF5E69A7706AD0C82EC8D0292C 4OWTTINTOWNIS
637,465,346 *41A170BC367AC4DDB4972F2472197A6A6E2BDBD9 4-PFLEGETAETIGKEITEN
637,465,347 *41A0E0B7A81EC4E3C9E630C7507F2CFDCE0B3668 4$PHYX4NT
637,465,348 *41A1E27DA8CD3A35A5AA433A3C8A0F13B2A83818 4SANDYGRAPHIC
637,465,349 *41A999A06CFB4B63EB47EBB752AF3A2DEC2D4D7C 4SCHERMLE
637,465,350 *41A1A09170C2204C4321D7122265372E7E04A391 4WILLOWCESAR
637,465,351 *41AC6EB583A74AE40A44F84C93979B46F63DEC17 4WRETCHEDTROUGH
637,465,352 *41AD61519BF5180FA9B8A633B4566E4DF6FEBC3A 529152 MITENPITK
637,465,353 *41A8E221F92D986AD364BA2C8FA485E43A226517 5ATTENTIA
637,465,354 *41A4A089A9DEB1290F78CF485B2F487FF6594685 5CRIMINERASES
637,465,355 *41A1F4131AC359FD2D64216443DE47AECC8017A1 5EUROCLEARS
637,465,356 *41A912A0EF2727B97422D709BB00D119A161855C 5F4857E4D8553086F787B985C8D46063-ROMSHARK
637,465,357 *41A3042AD186CA5ACDE49E29D349E8069FB474E1 5 FERIENSTURM
637,465,358 *41A9C894C8FF52A5E9FFDD1C010360C75A63F0ED 5FOZZIETESTER
637,465,359 *41A8FBA6FF4F1184D4A711ED2DC980419107A6BC 5HERMOSEADOR
637,465,360 *41AE81C7E76A9C456263F73F1AD3B7D44F002038 5ISABELLECHICKEN
637,465,361 *41A773AFF86D0A5517C50E4D688B5CCD1FD782B9 5ROZMIAR
637,465,362 *41A73B96D623518ED2F74AB3DE2ACEBBC56D1A2B 5SNFRSPN
637,465,363 *41A8398A9979911C4E9DE0569700417588B6402D 5TEILOLYX
637,465,364 *41A0A6D51E2B1551FAF888F524C7A080C2BA5477 642455 SOZKONUSUHERIKITUTUMDA,OZUNDEGERICILIKTIR.
637,465,365 *41AAD8B72323E6AB0B90EDCB2C531F603D8D69CF 66C6544C43BF3D818278680C5C1790FC
637,465,366 *41AF01ABF5F1637071E218818F2455DF87EB5E79 6DIFAMADOS
637,465,367 *41A2E7E80D32B5B086DF69A8E0A0E5903B1733F6 6EISUFSNART
637,465,368 *41A588F3356FED96998E175FEB480A1023909139 6ilovemolly19
637,465,369 *41ABC02F4EF7BE65E0862837CD090108A88BDD90 6LAYOFFSURVIVAL
637,465,370 *41A5B6497F50CCFEE5E17B0B55E6BB7B61266690 6LOVELYJESSICA
637,465,371 *41A030BC93686E36EA9B3F5761C2A6EE7DA317A1 6MONGTEIK
637,465,372 *41AF26E9D76FA03727DF52F8D1556F7593785F6A 6PLACHARD
637,465,373 *41A7EACF3FF9EBFDA6183B7530E208C5472BF2AA 6PRTRVSHP
637,465,374 *41A866A8A02DA3F60E282F093B6B516F7078A954 6ROSMARI
637,465,375 *41A1F3F5DCA7999D69E23812CA8DF91C1A07E9B4 6TETTESET
637,465,376 *41A93E5F1F6C3129C9EAAC25BC30D2012F723E01 6thewill
637,465,377 *41AB3519CA108E19373EEA5488C9372AE3CAC3E2 6UNSPIRITUALISING
637,465,378 *41AFC96ACE7E749A26C6B0E2F7EA3EE7929A5101 712ICH069NI41
637,465,379 *41A68EE9A678B06AF9AE4C1765DC4F9AD1557EDF 742646 SIIHEN-ON-SIIRRETTY-ENTISEST
637,465,380 *41A902E7FF9B65FBD2F769EED6CD718D3C337BA2 778MANUEL
637,465,381 *41AC65F1028F00B8D2219F448FC65AA5D3CB7430 7ACOSTUMBRARNOS
637,465,382 *41A9D732B84F7B03B31DDFB6672DFEF2B44F8284 7COMPUPICK
637,465,383 *41A1D8D0323A829C722BCEE8B78F5F3781DA5070 7IONOGRAMS
637,465,384 *41A9B0747CF2BD9F30D315B7C300648896C372F3 7-S
637,465,385 *41A9D9FD3910AD75CDD12F507D950230D7E0E960 8LAUTTAA
637,465,386 *41A06F2BF3CD98AE6806E0D24B7FC6675EB37FE5 8OPPOSITESTONEWALLSTUMPSUBTENDSWIM
637,465,387 *41AEE25A4EAB4E17536A67CA9D73B7E8828B97FA 8PACKERGALILEO
637,465,388 *41AE53002CAA5DDC3413CCEEFD5537F9B548C292 8PRIYASVA
637,465,389 *41A833AA980B222235BC2DF07C68A0D0A03A94E6 8SERGEIBIOLOGY
637,465,390 *41AB379C9CAF4CDAC9C734E340EA2CC619D9FBF3 8).`.Sploit
637,465,391 *41AF58CD66ABEC28DF9EF65F5D45FF3A1A3C3A21 9ATOMERNA
637,465,392 *41AA51F40732C0A6CF7DB2F420754BB34E89F5DE 9BAARKLEEDS
637,465,393 *41A5BEF837ED3F81CFAA5F9BCDF42763BADB4196 9BADGERFUCKYOU
637,465,394 *41A07121A58B35BD352760C836A98278539A96AD 9BSWINACTIVEHEADB
637,465,395 *41AA4A6E201AAFD66F80AEBD5DC09D7D08750C8D 9COMPAQENERGY
637,465,396 *41AEFC9ADEE780B337C82C708E7DD3F2AE6C7927 9FREDDYANDREW
637,465,397 *41A8CF6729425261515752A37FB3EDFC9BA5D050 9JEANETTEBRASIL
637,465,398 *41A1183E86323E629AF3669C56A5E525AD4E104C 9MCGUIGGAN
637,465,399 *41AA2D80899B445DE9864892F7A8E990610BFC91 9TJTCBSW
637,465,400 *41AB1042D09DBA7CAB42EBAD432AA503CC2E897F a0t-s
637,465,401 *41A33E898F0AB7225567B2BAF68C9A20F7C18256 a1/pt
637,465,402 *41A7130335D0F3FAA5BDD96BBFD4BBB1601368E4 A2YW
637,465,403 *41A70457FBC753017868CF24AA6A1AEA59C33059 a6q54
637,465,404 *41AB3A091082E30EC99CB30B8D48071045EBF411 A7XQD
637,465,405 *41A81302A2279E5F1097CDA657089C880BA112EB ABHI ROXX
637,465,406 *41A071BE568F0A0BC13662F4C3C3B682EBF54705 ABSEILEN4
637,465,407 *41A4434723EF6C2D45CA378F0D4A557CC030B1F3 ABSORPTIONSGLÄSER
637,465,408 *41A5C825D01E7D0535CA89362B9A59932B4B7D05 ACBC;
637,465,409 *41AAD949BE3866D7772A384323E2C588C85F321A ACTNR
637,465,410 *41AE51641EE18CABDEBA022896118D94178A4B68 adamfruge
637,465,411 *41A9B28114B0EE673E675EAED9A780B453FDD280 ADK
637,465,412 *41A44451D25127FA579B0D069E23EC61DF2034EC A-DREAM-WITHIN-(PRES-DIGITAL-TENSION)
637,465,413 *41A1DF9B2DFBFAABB0C66808E8944A04E74A3E54 AEROBICSYOGA
637,465,414 *41A94BEA24B400DB091DA0C3C4D82AEDCCBDF9B8 af77-
637,465,415 *41AA1C9AAF15A0CDAFE848F597CBFB3CB36EC556 A"FD+
637,465,416 *41AF7B136B355E0197768810436FC0A6BA8DD57B ahmedlingo
637,465,417 *41A86EA2F1AC42FB83ECED850F66049041B8BB52 ak4r9
637,465,418 *41ABA63F444F3EC50C11443BB45C16AA434E79D2 AKEKSIUL
637,465,419 *41AFA48267B106F754DF68A30531E18D00B80287 AKQ?2
637,465,420 *41A3E7A0884F5DCDE5050ED7D80CF8EDDE22E9D8 ALTON.LOYAL
637,465,421 *41A7F24E49FF999ACE4AEB279D78CAC729C67A25 ALTONMAJESKE
637,465,422 *41AE9DF4F83C42534A50FB2BB7F4F02FC0A1FE17 ALVA.MARTINIS
637,465,423 *41A17F117C79942B142551643EEAF1B71F978458 ALVIN.CHAREST
637,465,424 *41A92CEDC7DB726CC468AF081A5DBEBC801A0A48 AL:W5
637,465,425 *41A648F7FA7054514D125F85EFED71A7924E8971 AMBERTRUAX
637,465,426 *41AF989747D6323198FA8EC99294822BCC84B387 amila-sanjeewa-arangala
637,465,427 *41A34C32BC446C9670D7E23FCB066B79158B0CAD AMILYANOVICH
637,465,428 *41A228ED2DB12B1FD6F2B678150C836BBBFF470E am!$j
637,465,429 *41AB817AE2F0602AA068721DF1EF68D7AF65FB5E AM-THEME
637,465,430 *41A5B8ABC73AC96AD841064EF32A096F4BA50101 a!(?n
637,465,431 *41A698DD4944A4BA1EF37CD0151DC40DABC38E07 ANDREA-QUINLIVAN
637,465,432 *41ADF76C626B9108FB4E9768C057264FB29BF809 ANDREWMCNEE
637,465,433 *41A415EAF225FB1FB9547AE07098CF0D9ECD6E69 angeljvazquez
637,465,434 *41A1B2F83635CB7D9DFD32B533EF8809687C6D1A ANGOULEME1234
637,465,435 *41AB01CC667FBD25622266698C00CB11A2FFFCB9 ANIUSSUINA
637,465,436 *41A5C54BBC12307F3E7DEEF55CF723B95E4EE33E A=NL-
637,465,437 *41A32FF1F0F4A5FC1569631F28FBAE37EBEE5178 anneli33
637,465,438 *41ADE8B3AFC2037D156DD2B93DD8DED42FDB69C9 ao;wn
637,465,439 *41A8CA66809B243C518CD6E8728CFB443C970409 APDIJ
637,465,440 *41A210C4474F8F76372C87D4EC10B3C59E267E25 APPAUVRIRIONS
637,465,441 *41A48F381899AF53EC96DDC204D6424CA24AB84A aroundtheplanet
637,465,442 *41A3FDE1DAD43C9F0E308AABBE826C000B2ED674 A#U.-
637,465,443 *41A83B9A40A5F57447BF27DC954CE1B6AC520276 au_k4
637,465,444 *41AD4198AA0955D5BD9EB7178CDAC51EEFD1900A aulelmia
637,465,445 *41A8E66526B8DFDFED44C75D57CFB4E4A21559A9 b#>.~.(0-0)
637,465,446 *41ABEE1825B371434791C12151DF0D86BD3C76B3 b000968
637,465,447 *41A836A32177EC7E6A2F3C8A907E53D25743DD6B b4,n-
637,465,448 *41AC5A98759F176AB36C897A368A268392F4873B B4QGG
637,465,449 *41AF4D0E92BE1556BFBABB940CA45E4C89501075 b6fa
637,465,450 *41AD9BB8445F33CD99C612CAB15311FA3A89F65E b_9ww
637,465,451 *41A6882406E5E6D3B172FC6B56477852E682DC79 B&A#
637,465,452 *41A17B6112334F462E677F548857B455CE6CBFC0 BACTERIENNE4
637,465,453 *41ACFEC94E3313D94DB6F8C48C1DBBDBEA142CB7 BARRY.MYNHIER
637,465,454 *41A0D7F489744BFADB0657A95D7E95C5729F8B4A BARTONLINDFORS
637,465,455 *41A3D5D1D9B46DDAEFF6613F27ADD2558A117711 BARW#
637,465,456 *41ACD3071351E4E95D932A50C75609AC1296F20D bd6du
637,465,457 *41A64C0988F4D5A4B70DA83F79213B71E58721F7 b====d**splat
637,465,458 *41AEE863173D82FA44CF6EE06341F4EA3733130B bea71e5
637,465,459 *41AC80DD2FE41C5E2D6C092420F1CDAD9F2C50E5 [email protected]
637,465,460 *41A97DE23BD541BE4B31F98038711A5253285812 bentontoft
637,465,461 *41A0A66FB665E337EC57E5966AD2E766B68D7E66 BERNARD.ADEY
637,465,462 *41AC91324602221D2F75C9F800BDCE238496FA43 BERRY.MARKIE
637,465,463 *41A09BCA3A106933EFAE35E973DA910D7436D2BE BETH221
637,465,464 *41A456AAE67602870FD5AB500D57C94DF557C25A bfhte
637,465,465 *41A791D6B8660B245E045B75B1CB6D7A73FC9DF9 [email protected]
637,465,466 *41AE9B041A979D5B31DA020016CF164D6E5FF233 [email protected]
637,465,467 *41A110354B3876A6222CAFB119DC232556B82C95 BITTER-MEDICINE
637,465,468 *41AA47AB60CC62FB04BD443C5DC82F3093B68146 B%K`
637,465,469 *41A4254C270E60DC516725C4A55784995A65D565 b=ks$
637,465,470 *41AB1CF8DCA8D2B662A20658648E8AAF37EEF97D b-lrr
637,465,471 *41A8740114053F2FFFAA92E8B3F95A17D3139C21 BpS7
637,465,472 *41A87F45BF4D5BAE3572C0B9ED251BED98B62AFD braintaaffe
637,465,473 *41A029FF42AA246761947795F6F74B22EAC7009A BRANDRYT
637,465,474 *41AEEEE89E19D7352C20949F82FA0F806B19F921 brianlieske
637,465,475 *41ABE6407997DBA9A71B479B140551D63EEF36C2 BRUCELONGOBARDI
637,465,476 *41A63941CA69647985792DB841AC7C32DD5558AC bruceyoda2
637,465,477 *41AA8C4EDAA49B5A362EBFFC3C4450AB9F64163F BRUTUSJING
637,465,478 *41AFD64F7715FDE61AEC77AEF5B7BCEFA9B12CDB bsdg
637,465,479 *41A453F3C8C44B07B469A53BBDB3118B340F6AB6 B#####@ * Splat
637,465,480 *41A1801D611B1EAE0C66F7CA79DC16175CD746DD BTISSESING
637,465,481 *41AC8F24B83B83B5C9AC576EECC0F8B20B79FC22 b%tm7
637,465,482 *41AB613CA1DCA00FFD82246428F3E211329349AB b/u%+
637,465,483 *41AFCA18D1E36227F901AD5F4AFDA2FD4EAF480F budnavejas
637,465,484 *41ADA0D54D4C35317CE7AC8809A071E1F06E7FF3 BUITENECHTELIJK?
637,465,485 *41A49A68690F4E6B0084A34F38F0FFD4AE9504CF BUT4C
637,465,486 *41ACFF367B8D66EBEFCCFFCBDA14185CEB1B50B5 BY-+N
637,465,487 *41A7C53D366E5DFCA62FF78093829469E2AE2031 c0g0
637,465,488 *41AC1C9E7344168A370BF84480652B7453ACE0E0 C3&UU
637,465,489 *41A476FC9FE9E1BB581AA5C30698FEAA4C3A56FF C5WAG
637,465,490 *41A13A2C746F11A126E458217D3770C01E7B7E65 C9L,.
637,465,491 *41A7A97E37B2F6CCFE57CACB1604A772ADEDFB3F c9wt3
637,465,492 *41A21F346669DE2E537B991B05E5495200E0AD97 CaFM
637,465,493 *41A76C39502470138E94D305FC99BB1F0D3E2ED7 calvinmainguy
637,465,494 *41A90A0C3FC771F29FAABCFE9B1B12D804A6C75B CAMUFLARA6
637,465,495 *41A50D524A8FEB1F4479E1A9B3451891B8D3961E canssnac7
637,465,496 *41A8C07436046844CD7C9AC69982823EE3964494 carter.franklin
637,465,497 *41AB6E14EBBB3F76CD4D31B68B7565F56783EFF2 cbhn#
637,465,498 *41A8F0AAD7575829F4B6F9B64E33ACBDD237EEC9 [email protected]
637,465,499 *41AE23B837DFC55D40DC24B4A37C72453333377A CEDRICKWHITINGER
637,465,500 *41AC3315184D48DDC27C7FBEF104049AE7798784 cellino-attanasio
637,465,501 *41A44C3C988D0ADC25BA876E766491940DD5F57F cequis
637,465,502 *41A0CB072303BA5C93D1BEBC2C79303278E526AB CHANGKURTZMAN
637,465,503 *41A649435357D6E4FD867149A83644BD14EF909A Chason-Boheme
637,465,504 *41AB1D7826CD531BD6EDBB770A0F5356F3353C8F chestervelazco
637,465,505 *41A95E6DA76FC1C318AAFC24195EB727B7151CA1 chicagodaytek
637,465,506 *41A29882353AF9A4FD353B6D53F4C75F45113346 CHRISTIE-CHAPMAN
637,465,507 *41A1EE12DBA63C17860D429B767B6EA708085C1B ch#t
637,465,508 *41A9C0A44F4E69616BA1CF86A811420A99DA2806 CINDERHERMAN
637,465,509 *41A5F1DA6AE389D1BB6CFA84E11E057596360E85 cindy-hardt
637,465,510 *41AB5E2E52A8C9C1EDCF414C1BC2BDDFFBA805FE [email protected]
637,465,511 *41AC3D74952C9D3E2A654052DE02D5CAC0A40172 CIRCUSDEVILSGRINGOCITIZENDICKALBUMREVIEW
637,465,512 *41AF812416D3AB134517ACDC66C4847BB43801E5 CITROSUCOSIH2TRAH0SUW1KOW0
637,465,513 *41AD37BCD1E44B6C863FFADD657D8EF3F6033AC8 CJQSCOZ8
637,465,514 *41AD938E95C104CC363CF8E3C552C00D50B62CCC c,js
637,465,515 *41AE6081A3855DAD300E89004B70A8DCA1A7D8AF clamouri7
637,465,516 *41A66CA4B1817904CC5F982F38A4639761205D66 CMA(C
637,465,517 *41AC755520FA5CBE77B5EE3AD0A4114A2D341949 cogger、cameron
637,465,518 *41A42FD4BDD49E7AC50369F846F26C96882B108D CONFESIO­NES
637,465,519 *41AD4630502555FCD6BDD3929BBAB3DADCEA6520 CONGLOBAVA7
637,465,520 *41AB3E7321AD7B97E3E0055DCCEB4FD0C7CE58F5 corsite1
637,465,521 *41A098784D1F046610C72F0CEAA35E15DDCCA1FA cqsa2
637,465,522 *41A967B129DE5D89432C11A3B5A8B7648FE8ACE0 cqwng
637,465,523 *41A179F59B8A326F44F015B54B6E39EF9E672A03 csx/o
637,465,524 *41AF4D2CFA9FC4C6D5053B44CE417425980DB1A5 CTUK,
637,465,525 *41A242F6B667CF3BB8118D2370406EDCB4C35B45 cwy-7
637,465,526 *41ABE2DC5F72D0C6D8CFDD33FFF5FCB41287ABD7 CXFL/
637,465,527 *41A61062505D43B4B4EEB0A7D112532DB918D0CA d1g1t411z3
637,465,528 *41A0663CF999800C97110DC5BCCDAC2F9012B959 D1VE2
637,465,529 *41A6EC11B16D128F11F3E65787F92037C994EF09 D3W+;
637,465,530 *41A4C36B2F0F0A345AF57F57F7E2F47F0A5D78CC D7;AA
637,465,531 *41A83C1D5401AE8DDCBFD1618EA46B6280101DB5 d?_a_
637,465,532 *41A797DBA7DEA5999468D486754EAD5A88ABC521 d)a%g
637,465,533 *41AAB928E6789F3905C616CE7AB263392F43A225 [email protected]
637,465,534 *41A418D3F2765F6D728FBC6EE8FC867F00C80C82 DAMON.GABRIELLI
637,465,535 *41A0B48439C5F8470DF6FA6825BAB73E829BD099 DANIAL.MILARDO
637,465,536 *41A4BAAD752D8654DBACBC762049998733FD5CB9 DANI.KARAS
637,465,537 *41A3535D6AED356176991C979B82A1683B554399 danniemcgunnigle
637,465,538 *41A8ABBE7F8201D0D88F64524000C481FD852C2D DANNY GARRITY
637,465,539 *41AAB62352F26DBE07B2FC79DB2A1C30BAE2631B DANWIZARD
637,465,540 *41A8FB5F2FC1B9DC27934F12954B044829D83EE6 DARRENSIEMON
637,465,541 *41A86AFABF4912D45BEF46919A4D5AF96B9E2248 DATABASEGS
637,465,542 *41AC31E4D667D84E43769332FA0388C9D5B44846 davismccaffery
637,465,543 *41A7EDDE2F3DAF683E44BD680B373B70F4F38826 db9t5
637,465,544 *41A3B3BA58EB6D6B9462D9AC9114F04AD6F1A986 DB$LC
637,465,545 *41A12C057D8A9F2AFFA41867A27D7738AD4F316F DEF!L
637,465,546 *41A0BC2BE1D593B8FB83DC0A501BF9882C4EB63F delbasto
637,465,547 *41AC711E6A9C475414566CED201B4DCF5070C523 DEMETRIUS.WAISANEN
637,465,548 *41A292C0F32EBA4AA01292E34F0D5D888AD11256 d#emk
637,465,549 *41A039BD9C88BBE7308519EBBF6D94F5146C9B7C derekjuul
637,465,550 *41A2B9536DBEABC2CCF13C04C77C31B2AEC181D0 DESROHNU4
637,465,551 *41A700D8DC1EEA9B2DCD11D54DCD596B8ABD31EE d_f_=
637,465,552 *41A560509F9C5405BF4FD9CE59BE4C16FE4DD6C3 dfutc
637,465,553 *41AE2B986F9F75D28CDEE1535CED3F1D8815C937 D’INTERMEDIARIS
637,465,554 *41AA5BCDDB00417BC206BEE140976E23ED072CB4 DIONFREEHLING
637,465,555 *41A18DB1B7F5D763E4362D12A9B6C9721B3207AB DI/R
637,465,556 *41AD09C7A73086DBB6F32FBD4A5A00E872C10030 DITIONNAIRE!
637,465,557 *41A3C9B001ED82DAF693B279FE3EFEC2E1C2716D d_-ml
637,465,558 *41AF2996B04707D98DF7FE312A8923560FFCA4FC do.dv
637,465,559 *41ADC7250E3962ACE4DC74377490A7882F1FEC57 DONBARBER2006
637,465,560 *41A74407FD5A41547C2362A2EB6E9346AFBF8168 [email protected]
637,465,561 *41A7F46EDD68F745B321D276FE5656D9DCEE7FE2 DONY SETIADI
637,465,562 *41A334A2F7CC897980D4F9C3A5E9CDF23E512C56 DOPPERS5
637,465,563 *41AC9C905ED9B6ABEE7855B2DC9AF215A435204E do%vd
637,465,564 *41A8450A2EA1AFBF1E99906711AC35EDE9FFBB77 drsdrs
637,465,565 *41A3A7EBC18C3593D67BF3A27BE0D5BEA40A9962 [email protected]
637,465,566 *41AF66C32F2EC2869E736E5B2A5C94AD2889C1EA DT_EW
637,465,567 *41A8834198317FA41521F7BFC2BF01F41805013A DU}
637,465,568 *41A0EDB5C826330A849FB7F95A8622FBE650074F dv50i
637,465,569 *41A80B0695A4D41F68F26F68011B00450CC410F4 dvfr4
637,465,570 *41AF8FB0BE8A41103EB814E0DC08A8AAFDAAA371 D_Vh
637,465,571 *41A679E81DBA1B03E55DC23607FECF8C297FF051 dvp$%
637,465,572 *41A0F3EBBBA0D8ADE9A2F2EF1EA463717EFF7944 dw3tm
637,465,573 *41A5424ABA4766B5544F08E07F5D7A05B9169767 DW#;L
637,465,574 *41AB8231C9E435FFA59EA96E2DBAC3F2189656A8 D#YAE
637,465,575 *41A2E04F91B1EB37EB07F31A033D05D03728FE05 EAAYR
637,465,576 *41A4744164DD52CDB826EC633334599801188B76 ecolesesing
637,465,577 *41A1E33EA3811CD2E99740045E41143F1B41283A EDERZAC
637,465,578 *41A0E11246CBBC9F29E86E4F46C1ABF33A5501F0 edlassiter
637,465,579 *41A2C74FF376A9A51244257691750DEA12E0A5E5 ee"&6
637,465,580 *41A407DBA7942CCB3867B55C8C1426A4D1E3EA35 EFEF(
637,465,581 *41AFDD358B324A5FB0045F9C22656785E5D3A1F0 ehjnk
637,465,582 *41AEB678D5FD5FC541452EA2716B091591B929B2 EI6*
637,465,583 *41A62E109DD1AFFC41BC16DB807B6EFB1F27B699 ELBERTLAISURE
637,465,584 *41A225F28B0607599B3F7DBFB971FF60F8EDDE05 elena.nardini
637,465,585 *41AB274E5958E8A4863536A18C275EA0AB4F2E1D eliaschalhoub
637,465,586 *41A420C730F3E411B3BCF0C5670015371B367493 ELTON.JAY
637,465,587 *41A96AE55F9A738965CDD011F079AA8DA2AA1F0A EMBATYL3
637,465,588 *41AE94A384616FDBBDB50D7194660B40FC513048 EMERSON.KRALLIS
637,465,589 *41A727F618A3F705DFB2B67DAF075C40DEC9AF28 emeuqnams
637,465,590 *41AF246422CA1D73AE1703A81FA68738AB1DCEC8 EMILY.KLEMMER
637,465,591 *41A02CD0D208408C1045653A11121D0387EEC46F emmelerai6
637,465,592 *41A08F253D6C5F2D27B360C018CE95C39521F7B9 emmoamme
637,465,593 *41A030E04DBD686B0760F1A2734313305F171D0A ENALBAR
637,465,594 *41A97187EA8385A92ED0A89BA3B8783AE54C5AE6 ennuyez0
637,465,595 *41AD5DDD3A64C5D585525A5F9B35C85649D0964B EPPAHCED123
637,465,596 *41A4E720AE7D05E9BE74C1B46D1FAAC2C2B2A130 epsydnon1
637,465,597 *41ADA6898910333347BB8D6EDF51F97F92AEBD70 eraklyon
637,465,598 *41AB27CA1509FEB7DF7F5253983D622469B525E0 er^k
637,465,599 *41AC6DBB7B555E5C2FF3E993B45A2898428EE3F0 esirala
637,465,600 *41AFD702AC00E4D395ABF28038A62A5ABFD55B00 everybody'soutside
637,465,601 *41AC220307E825FB6A39C3E67884E0196DA1F8AC FADING-TWILIGHTATARIORG
637,465,602 *41A2C2113A4F214490DE7AB314E19E020C5A2487 FAIZASIKANDAR
637,465,603 *41A44E76A30BFE1A6EA17586934B8B497C599163 FÄRBERSCHARTE
637,465,604 *41ADDE935EC94F057941B0FB42CED30C04F82DEA fareed.syed
637,465,605 *41AF5DF85A6767CC86ADBD1DBAB658CD9E76B793 fdsus
637,465,606 *41A8255BBEFDF0920C9274C2EBD5A80A37906F9D [email protected]
637,465,607 *41A2C50B0CE6A4F6CA6B637B7B60ABBA4945AA4C fernandogluc
637,465,608 *41A07FD4B6EC89ABB89BD7B3C58ECEFE9311F45B flapper-style
637,465,609 *41AE4F480FBB384AF3C93E336A349E719EFD2A73 fnfoxqtsldje
637,465,610 *41A58265CD812EA28834870669964F534393FC05 FORTY-NINTH
637,465,611 *41A2A39BBF90B8CCF95AD739A72FBE058E9400E3 franklyncantoni
637,465,612 *41A53CB008BACDF75485B503B4FD84667272F0CF franklynpanciera
637,465,613 *41AA2228C940F3549D2AE912EC90B33AABB99A64 FREAK(FEAT.WAKKA)
637,465,614 *41A825BD4BA37D7A645D4F25CD20861ED9460BAF FREDDIENORTHOVER
637,465,615 *41ADA36CA065F7BC960A0599C892C166B66539DB FREDDYRESTIVO
637,465,616 *41A19196A943A06500558DA5A1B2BA0541B9E4D4 [email protected]
637,465,617 *41A66C4A7D18EA62604CBB2A9ACA949380FA5188 futbolistas.del.all.boys
637,465,618 *41ABCE1E073A4C31DDC3EB5857093067C72885D2 FZEDON
637,465,619 *41A1C05FBF5169150EBCDB9D1AACA68A00260279 GABLEDDELBAG
637,465,620 *41A9033153FB23D9093419E4E4FF1646B3434D20 galennaples
637,465,621 *41AA6871C0C9A606E1A11844F36B5AAE98FE7844 GANZESTRAAT
637,465,622 *41AF16EEED9B1A5771332C180651ACE3F3E03CFA [email protected]
637,465,623 *41A7050FEADB5DDCD868DE4DFB7D43A4767F2E9F GARLAND.FRITCHMAN
637,465,624 *41AFF1B08EA8587A51E83A7908F1777587C2A171 GARTNAFA4
637,465,625 *41A016FFEDDCDD529FD5392334D1E0B64F958561 GERALDJEFFERDS
637,465,626 *41A4229A6243B6F4219DC837D00AB012EAD93D51 GERARDO.QUIJADA
637,465,627 *41A4213215DD9C3841BCC89BA5D05381A76FCB4C GERMAN.SPRINGS
637,465,628 *41A7E1E367959ED1666B6309F68E82B240742E4D girlsnight(a):60
637,465,629 *41A27F6E43D445F24C0CF8B316F1421A72B7A304 glimmandenymf
637,465,630 *41A84C791F80381C5D55655D5548BE3B24E07AF3 graham.bate
637,465,631 *41A89FE20C42482AE4CB5A7692E06503407AFC05 Guardan5
637,465,632 *41A75C66EC10A60CEF77989FD771EC81F4F8D02B [email protected]
637,465,633 *41A1B30162D374FE0F98E7FF44D7010EEB6E8F44 h$9l
637,465,634 *41A6C63D912E5D47314EE77DCBEBBE9B36DFE965 haitenini
637,465,635 *41AF238230826456248FF88B4601D6DE5FFF506E hanriox
637,465,636 *41A96D06B0AF1E532CA43E19CD79D70A5BABEB36 [email protected]
637,465,637 *41AD21C5251C8AE513F25545612C716CFEB2FF8D HARVEY.THE.WONDER.HAMSTER.(1997-09-27:.THE.WEIRD.AL.SHOW)
637,465,638 *41AE049D7F6649085DEF22A9C3E66A2F4075A959 HASSAN.DORCHY
637,465,639 *41AD085C01DA1D3BCA57D8E2D54AF0C044506389 HAYWOOD.ALSTON
637,465,640 *41A8FDD0E0FC28EF19321B2CF2067CD50CA8FA59 HEATHMCDANEL
637,465,641 *41A91F2360A52ACA9C9E0883C60EB817601E6ACE [email protected]
637,465,642 *41AC2413E11E3876EADB5C8B6800951E8754E8C9 HERMANJIMBOB
637,465,643 *41AE27C5A3B18F6A14642438751E694F8FEDEA2D HORSELING0
637,465,644 *41A2868B3010CBB755D4EF77767F4CDEC54E778E [email protected]
637,465,645 *41A388A18613B93E89DD477210C41F218B151970 [email protected]
637,465,646 *41A246E67443A3AE53C66ED95DA0FE50F9BF5BF9 HOUSES.GINLIME
637,465,647 *41A63EB1E7F979F56F420DD0DBDD85870F59EC8D howardesposita
637,465,648 *41AF91D5533A8DE1FF07B4C0E62D43E9DE6CE328 HTUKCIDS
637,465,649 *41A058FBBF91EAED92B96CF3FBC241BF86F4D1C3 hugocarmell
637,465,650 *41A9B22203CA2582DC82BE2671C5BD37BDD2F316 HUMIRCINGEN
637,465,651 *41A37CEB21DBB7F3B0953805A1B02104E8F337D5 HUNDEJAGT
637,465,652 *41A60DEC09E65DF31C42B02B5EA75FF9EB9EBA22 IAbhorThee
637,465,653 *41AF4259B5933DABD098835784689475214FF03C id="'+id+'addtabtags"></span>'+
637,465,654 *41A2F73EE6559CE1FF644864F2E36980CA7C62DD IKJHAA
637,465,655 *41A027AFD0186460D1A0B6677E5ED58051B23938 ILOVECATHERINE81
637,465,656 *41AB8E033AD1A2DF87FD10A3FE0F43F339DCFBBD ILOVENATIONAL70
637,465,657 *41A2A863F9B9B55ED61D0591CA96BDB9C86EE0E2 ILUVPACERS07
637,465,658 *41AD017DE5E941CB4CE245C4DFE85365C24DCE6E iluvstephanie13
637,465,659 *41AF9AA14A6A348476172399A833FF719585B012 i'm-tired-of-being-mistreated
637,465,660 *41A8EED6395AFFBBCDD0C3C1CC844040F656CEE7 IN.A.LETTER.TO.YOU
637,465,661 *41A6A8FBE7F597994D4E51E35C93084336681F2E indra-timal
637,465,662 *41AFE5FF9F824C3D20774DFAF7F8872E8BF5D263 [email protected]
637,465,663 *41AACFA1EEF774F797CB427C12A1AF4F04EC8854 international.reprise
637,465,664 *41A68B7948AA57C5F3E2D074AC0AD7F5925D5079 IRAVEDRA1
637,465,665 *41A169EA7DA3760FD369330999FDB67B8A1FC1F0 irodatis9
637,465,666 *41A3D43EE05029A89CE64B6B8938D0109A095848 ISAIAH.SCHENKELBERG
637,465,667 *41AABDD47AB566D0A5A59B0A45CD701244F08BA3 ISIORIHING
637,465,668 *41A6D72A5CE1C71A2080F054EB7F8AFE0C667047 ITERATIVEMENT
637,465,669 *41ADF692CA595A5569F17521E70836F4ED38B029 jacksoncapistran
637,465,670 *41A23F1B06AC9B0BA89BB97D559949EA851F0D73 jack.welch.jr
637,465,671 *41AE821E34CE7292F9217B9ED1734ED7D8199FAC JACOBKORN
637,465,672 *41A7F836E7F2EE2B5FF7E56D0748025BF3A6CEC7 jamieshinko
637,465,673 *41ABDF73C33046355B255B3A91E6F44EEFCBD634 JAMYAHICKS
637,465,674 *41AE3861556F427DCEA05D095E4B860A2E5556B2 jeramyrehlander
637,465,675 *41AA915E4839B7A786166604B65D2F119DD6139F JEREMIAH.SHEAR
637,465,676 *41A04C32DF5385B67A70FAD187B972BBC356FA20 JEREMYKNOP
637,465,677 *41A85869F14BFB8C52A868C64F02450AEDE3D8A9 JERROD.HIGUERA
637,465,678 *41AF2100328E13DF859B19D1E225F844A60BB879 jerroldredell
637,465,679 *41A80E19C8C2288AB83C4789E40E6EF5705A64A4 jessieanstead
637,465,680 *41A1E817044F09E670F2A1127CD90BC00692BD45 [email protected]
637,465,681 *41A15DB49A13BFA4209561104A36A75FB10A1681 jidouhan0
637,465,682 *41A2EF519D4C5A2921A7251F42B3036C7CE7D8B1 jjs
637,465,683 *41ACF766E8D0F52EE618094E8482EC9FACD8AEEE JOANA MATEO
637,465,684 *41AB58C189AD634DE9A5534C8CBD1850085EF28D JOAN.KROLCZYK
637,465,685 *41A82B15B642DD30DD429E368BDBA9B67A96C173 JOANNE.LIO
637,465,686 *41A584A3715B1D83A9A42B629185F5DC959E2C53 joeedy
637,465,687 *41AA59718D68DC5AE72B3797835D73651097F4C5 JOEY.CITY
637,465,688 *41A133FC88812D46AA094E4CC58CE0C6B54526B7 JORSMOND
637,465,689 *41A173AEA8E5EC3FD8AD7E4409AED766C1B5C04D JOSE.VERONA
637,465,690 *41A310F037E8A377D154E45F9F95F527147389FD joshtse
637,465,691 *41A46C099F3B8BA966792E506CCFD05BA2A9456B [email protected]
637,465,692 *41AFE45E87CC674705AB2D5FC5BBA7D7BBB25B5C [email protected]
637,465,693 *41AAF8B4ABC99C2AB6B21C2E077986C442868A4C juignãƒâ©
637,465,694 *41AAE2E22B8CA1839E67E95C3E9D0580ED8A4B77 Kađai.(tiếng)
637,465,695 *41AAB43237E225F525D0C8B5B640FFB323DDB30B kannadihis
637,465,696 *41A9D1DF46D1381AC2FB4230DCE4E4C62C4CB7A8 KÄRSÄMÄEN
637,465,697 *41A9A5A8E346FAF1C8E0A1A2E651232057A3A9F7 KENDALL.WENDROTH
637,465,698 *41A6AF11C408FFD2B8D32A161263E76B973AC8EF KENNEDYBOSTON
637,465,699 *41A742278395718A5C293DCF49D1E2490D82653F KETOGENETIC2
637,465,700 *41AC709EE6A94F8A4D8BAF1537449D8151A4E29A KFKLMWJU
637,465,701 *41ACE159764BD91DCFCDA3BFCF3C82F3726F1DCE KHOKKOH
637,465,702 *41A0DCD9B7092CC938511C3F45F0DA42FE095297 KONTROLEARJEND
637,465,703 *41AC8054EF111E26FAAF38376D1D09D1BB4544BC koreyraia
637,465,704 *41A9E6C2279413DE3E1E1885BA5FAA1E300D26B1 korzeniak
637,465,705 *41AD13DB35C4B52A7210D187B1A27BE9FEA00966 KUA LAY HWA
637,465,706 *41ABE7D0C3F356FC4C98021DB240FC71719CE3A5 KUNSTGEWERBEKATALOG
637,465,707 *41AD8571A5B832F749C148AADDAD4B7A393E91E5 LAFHEIDSES
637,465,708 *41A099EEA3E673B97AB1209A4488BBBD4C997AA2 [email protected]
637,465,709 *41AA5D5572A503E9A62338EB012A7255AABB9D68 largeheartedly5
637,465,710 *41A05362E7967555A8F9508B845019CF948662A5 LASCIATE I MONTI . . . MA TU, GENTIL CANTOR
637,465,711 *41AA0C63E88B028589F96D90E568CBFABE961282 LAWRENCE.LALLAVE
637,465,712 *41A1B5C00AF905AE486EFD3F1F1F5DFAAAD98F00 layouts
637,465,713 *41A4F4FE585948E08FCB70E516B79BC433448BC2 LINDSEY942
637,465,714 *41AA1C811A6CC1835B796A4ACDDA6EF884630F8E LIPS-ON-NIPS
637,465,715 *41A7F935C474877876EC40CF7425270A2205561B [email protected]
637,465,716 *41AA66FD82DD1B81D646C832DD12E3FBEE5DC806 [email protected]
637,465,717 *41AECAAF8B37A798FF5A38F173D3DA223F659EDF [email protected]
637,465,718 *41A8C0D81122D1B14FE06D9888808459CE3F0294 [email protected]
637,465,719 *41ABF94A6FE94BDE7CA857E24EF01D914AC874D3 LIVEK1
637,465,720 *41ACBEE0353B93AA432BCCF5AF6711A3A3A537DD l-ji
637,465,721 *41A57C8580DD3870E7D231179A3031460649DA1E ln feat conductor: wolfgang helbich)
637,465,722 *41AC4F0EFAFB4090F844A34F708E8A1ADC1800C6 lonniesacca
637,465,723 *41AEDD68C758F014374D10628A046515EE340A60 lonnybilek
637,465,724 *41AC9499DC021BC5B1FB2DAB9041A3B51F550397 LOUISPAGANCOM
637,465,725 *41AE9754518447BBA721EDB96BA3065F99C431E2 love-khullar
637,465,726 *41AE51623EE97049D3BB8066CEFDE2D2B5510FA5 L#RI
637,465,727 *41AC29E44465978690D1AD1340966394B2B493E0 lunamorada89
637,465,728 *41A7A56399A6E91EAB899A27932E6CFF56B57005 [email protected]
637,465,729 *41A099048E5878D2085D7E3ED29C82E896580E96 m1cr050ft1
637,465,730 *41A6274B5E3B54A71610BF2A005043D36FED6D9A maarib
637,465,731 *41AB2E34E0B907F8725DFF805934FCDEDBFAD95D MAHEK-QURESHI
637,465,732 *41ACFE70C183D8049994E98AB23C422FF7C4CF1E [email protected]
637,465,733 *41A2FE17DDA060CFC523E3CF7C717954EB6302FD MAKUTHAWANGSAWARDHANA
637,465,734 *41AE3AEC5BA6930E6E5C11777715563A070D757F MALIKBUCHETTO
637,465,735 *41A29F98880ADE69E740F188E344D33D9FF75E2D marceloowston
637,465,736 *41AAFFE9405FC320A9DEF3D523C91EC2BD6A4B27 marcosszczepanik
637,465,737 *41AD7221847DDE49CA25A4EAE5EA94E44875B745 MARC.SMADES
637,465,738 *41A307192BFFF5FC7FACD46523B567114F5ADF71 mariahancher
637,465,739 *41A51E79B49F77F3EE3B51AFC52DCD16EA2C031A MARLONBAARTS
637,465,740 *41A0677349BD30623FAF4026402649F7A4A3B224 marlsford
637,465,741 *41A70327592A9DD94F8EE359E1427B56A3632953 MARQUISE DE MAINTENON
637,465,742 *41A58F0E1FC509D79B3F0C02C9913C7786FB84A5 marquispetkoff
637,465,743 *41AA54AEE86FD4771439F6F63B73E110532F7632 masie-williams
637,465,744 *41AE204F8DF68E03511A246877C111C511E35C82 [email protected]
637,465,745 *41AB2FC707BCCCA073A1D2F283474BC7C64346B8 MAXIMO.CHRISTLE
637,465,746 *41AA15BABAD459389877EC7A83049A0C4AA65889 [email protected]
637,465,747 *41A3B460A074218F3AB3F8E9557FC83412729B26 MELLIEVSAY
637,465,748 *41AF74C932E5CB550BC7004FA63BE097E88CA76D [email protected]
637,465,749 *41A835A80EF4B67957F7725CA8CBC4ED08A1DFDE MERRILLARNT
637,465,750 *41AE70FE7F47263668EE935C84F54865E274CBA8 metlicom5
637,465,751 *41A2A8626F86DFBF63C6E0C9B93578F24EF590F9 michalesaller
637,465,752 *41A2DE9AF37B2F8E3F6693F6DE75A4237B76329D [email protected]
637,465,753 *41AF7AB8BD87FCEC07A032773AF7789762ED71A4 MINEMICHAEL
637,465,754 *41A653C06D67C691CCB9A2B75177729F69AFACEE mipuertorico
637,465,755 *41A822EBAAD607C22DB03F7F8116648F12935093 MISTERTENPERCENT
637,465,756 *41A9C5CD67F0B3057EB8C0DBA6F093F7D0C9B7AE MITRAILLAIT123
637,465,757 *41A4FC45E86EF9D32F23E8327DF9DCE6DC27E1AD }mk0
637,465,758 *41A120F9396588DFA857F0D9C64B961A948206E9 MOEEIKA
637,465,759 *41A9640ACC667478BBC364B574FC31E25D3EACB3 mohamedvintila
637,465,760 *41AD890D7BB2E9C77769C0A8ABC151916152EE70 MOISES.SURI
637,465,761 *41AACA6CBE98D7DAB5EBCE2C39752A21AFE95B7B MONTEGRISHAM
637,465,762 *41A3697D84A611A6AC51603A6911A02A301FC5C4 MORRISEHLKE
637,465,763 *41AC4DE611769E4B239203FAE874207841608AAB motorizaci
637,465,764 *41A08BFBD7079CC76B5CDAFD346B273954AA76E2 mysky
637,465,765 *41A933CD73A9DF10D70620EFC30AD1CEF3D19EF7 NAFOCEN3
637,465,766 *41ACFB44431BCCCFA184499D59F6DD7A7D02AD99 naleested
637,465,767 *41A76F73E8CFDD13FA8914CC290A73AE678CB31C neerlandesas”
637,465,768 *41A0E8DFA7DDD138C5C4F93524F439B673FF55B3 NETLUUH5
637,465,769 *41A85939E696C15A240F2FAA7EF7AA34A98E1AE9 ne.xiii..(amore)
637,465,770 *41AC963D761F92A23B576440D9A5C47BC98B4C43 @ngelnight78
637,465,771 *41A0E049B004B00FC29A2FB123E3A26F4D1E7DAD [email protected]
637,465,772 *41A8D59FB95ACE4EFB171A90689F098E4A84AC15 NICK.MACKER
637,465,773 *41AAF64F9DFA92CEE0A0BA8CE5F479A6F6640F6E [email protected]
637,465,774 *41AD722BCAE6B4A475D13A6FB482BEBEEFBB31D1 nigelcarnell
637,465,775 *41A7B3C14ABE8083E842EDE44C86FC351C34C52D NNPRDXCL1
637,465,776 *41AE2C3EA3D45AE7D41A52BDB2F8C144726A7DA7 [email protected]
637,465,777 *41A76FBE946C3FA9650B0A97B0A1306AA60E18B8 nordionline
637,465,778 *41A2E1A872B3098B27A2168C06B7B2409440F213 normojn
637,465,779 *41A4EC9083F08A013068D7B01A1826538C3685B3 NREBEGSLUPMI
637,465,780 *41AF98C1CB69EAF584816B72D86151250FB9A6C5 O->-<~`(=====B
637,465,781 *41A66DBB62A3C06C8FECE3E4D0C197711598EE18 OLIVIAKARR
637,465,782 *41A84EE6CE8143603E630206575C0EC7148F36D4 ongapsid
637,465,783 *41AF328CB3E3EE617F53A32B9316137489F4E59A OOWOS
637,465,784 *41AADBBD625931E910018722A53FE088FC6CCAAC opspeel.
637,465,785 *41A1EFD9CF007352C319CBCA1EC1870A751DB26F OSWALDONEVLAND
637,465,786 *41A76F4B8C6A80FC70DF8C8F391D3E37EF660E64 otherna7
637,465,787 *41A932BCF2604CD4CCAA2DDD58AF7EC3B881827A ou812ford
637,465,788 *41AACD7436EB8B4687F6E53FF75C0555E33F76AB overlook
637,465,789 *41AFFF00B7F8AE06FDA4E13BAE04D2E2F6FA2BA4 p2jvppdxcac
637,465,790 *41A74048281C08EC63DBBF5892322C069689D348 PASSATH5
637,465,791 *41A7D0111CD5ACDF2E7334683CE3F803DC3951DB pauline-dubuisson
637,465,792 *41A878AC614C0B190C9DAC73A1CE9665B7F3DB4B P===B~O~O.><
637,465,793 *41AA518449F795915C67AB0B5C0A1664F6BF77C1 p#####d-~0~o-splat
637,465,794 *41AF1B318FF6DFEFBDA085F6A4A6634FC554A361 PIYEAH
637,465,795 *41A9F8E0F000270F0AB824CF967724835735DDB2 PLMAIKKING
637,465,796 *41AFD67BD3DBEFEAD862FA9D9879FED7851C2EE9 PLODUCA16DODGERS
637,465,797 *41AC1037BB48CE071DB72EF3DB123E6CF5C71FE5 PNQFXTLZT3
637,465,798 *41A232E1DF4CF0506C0B7D208D33F51B387DFB8F [email protected] `~ `~}O{
637,465,799 *41A4B3078A68B0F7CA96819F8F5F423C8943C64E P--)~O~o}O{
637,465,800 *41A9CAEC4FD8F1A0556710C81045ACB00F676D96 pp160195224
637,465,801 *41ACA0979D98755497BE1EC7CF4F4D554A46217A [email protected]
637,465,802 *41A0D34FA8D4668782E69BD6DB42B9BDEC06AB74 P-----P`~UU
637,465,803 *41A6027F3008EAA8BEF381494389E23A5E210679 PSEUDOINVISIBLE
637,465,804 *41AF57404FF3F1EA14B021220747FA1CCA67A277 [email protected]~.~)0(
637,465,805 *41AC011F5920E12864874120F05FDB80EB582161 q-d-~-~-~-splat
637,465,806 *41A015824B13BAEC7178491D1C8E239CAB165E0E q##P`(><)
637,465,807 *41A9B6D7DFA56E3A47862FF48F84D2AA96B054AB qwerty181
637,465,808 *41A9C5226976EA9CAC0724A93643E0BEE8D7FEEC RAMBO
637,465,809 *41A72F9840A7A2248BB21B649E41C8C7761E2A32 RAVIMA16
637,465,810 *41A59771B12A4253F80BE77CA214C7A6F3C170FE RCULO.MERIDIANO
637,465,811 *41A7CED4644C8BC6B3BCEA5CF7D6ACDE8BFE9697 RE4N1M4T10N$
637,465,812 *41A4DB0E0B1D0FB65F5F52FB693F201A2DFEEBF8 rec4lc!+r4ncy
637,465,813 *41A92C24932CDC53B84499A72CA4D0E90C5A00FE REELEDID9
637,465,814 *41AA03D30ABCAF59182EEB86A5C53EF672769DD6 reifeverhalten
637,465,815 *41A3E099276512A082630C136AAB5E6057FB6B15 REPARERIONSES
637,465,816 *41A23AAF2D68F1A59164D9BDE0C856E3387A6053 RESITPES
637,465,817 *41A6BB1A6AB1706836C3708D16844DBCEC0E2A20 RETSYRB0
637,465,818 *41A5DB4DFF9FC7C23209CD4E31A0A371923A6017 REUBENBELLOW
637,465,819 *41A74A59F9FE1BF7EF6F41F1D5CC4E856B52AEF8 REYESLEPORE
637,465,820 *41AF2E3CF4E035FADCD225E001581F190C8BDE7E reytppo9
637,465,821 *41AE25B20FF8F916828B921D99C34AA61F245370 rgemini
637,465,822 *41A35DC35DB24FAA39363B8CB844CB7AA9EA112B riej
637,465,823 *41AEFA58909ADD780CF8DC13FA23F3424A6CC6C2 roderickzier
637,465,824 *41A943E9A2E0EEE9E53806E22B10B7A6B7B4EA17 RODRIGO.MARDESICH
637,465,825 *41A7BFC36D1A124D99051CFD759AF27928D43893 ROKERSKED
637,465,826 *41A9348782AFF37E9E2D23E5FE2B28602DE2AD43 ROMOLA
637,465,827 *41ABA57B44F2B18E3A6F9B1DE7765EF249ADAA0C ronbernell
637,465,828 *41A0D6E39BF65981CF62F616492F9A7C0AC9CF30 «ROUNDABOUT»
637,465,829 *41A3F311D8056CFAA1E70EA9904A35ADE542F863 royalejo
637,465,830 *41A2A28047C8C6A60DCE6D629658C19C513E73A5 ROZLOZITING
637,465,831 *41A49832492AA8A9F40FB539509546FDFA4BA744 R`~U
637,465,832 *41A0BF9B2772C110B46279C5BF64B09FC272991C RUDOLFMONZON
637,465,833 *41A33955E902EE4482DF065B4D29203BFC004A08 RUDYPRACHT
637,465,834 *41A97AE7F41854BAC029EF68C0A4AA072A58B201 RUEBENBENINATI
637,465,835 *41AC32179F42406D1B4C4F2EFA8EE088E9AD0333 RUELOCIRBS
637,465,836 *41A5B96615DD2099243B3B5B17BB57F4565ECDE9 RUPERT.WINDON
637,465,837 *41A163B1C370D1F6AC74535089BCEEF11BDD2DA1 SADIEFUCKME2
637,465,838 *41A9789D65FD4C8F93D4B1A05BD9BC56BD3EC0EC saehkoet4
637,465,839 *41A7BEC9AAEF25494F92FDC9C18B4DF812C4C4E6 SAMANTRA2
637,465,840 *41A290A7EFADAF440B8F9199F42620BE8C2E4AE6 SAM.&.DAVE.WITH.THE.DIXIE.FLYERS
637,465,841 *41A3C69CE4F3A764B81B2399F91E0E71EAFB40AA SAMUEL.JESPERSON
637,465,842 *41A92FD7946D57DBDF12E19B79B11B2B5E8792F5 sandracapecci
637,465,843 *41AF33531D80CEFB8270592E8DB7D7153BDA5C75 S~C
637,465,844 *41A7F5873FC98205D41BC2961B27F0953C6AB06C seanstavrides
637,465,845 *41A1BA487AB1791398729FFE2BBC56EC9EEC9775 sedath-kid
637,465,846 *41A2D2E1DC23F80DDBA8E5D68C4ECD6D68798A69 SEGUNDASTA
637,465,847 *41A32717F08D2AC3D35F8F4B74492128378BF4B0 SENTIMENTALSECULARANOMALY
637,465,848 *41A4712B390C0EEE332D14BB469FD79EE643B299 SERGIOMARNEY
637,465,849 *41A5CED24BA4B070132A4F1BB70CC520F2ACCA4A SERVIENTES1
637,465,850 *41AD3D4B77880FFFB2976BD439F041FE3FFB44DA sesarepooc
637,465,851 *41A44ACB12EA6311FA40A833FD4728C60F9A9293 SEXUALIZES.
637,465,852 *41AD72520ADFEC39D23BCFA682D8FB15AFA39004 SHALALASONG
637,465,853 *41AA1E17392B0321BB18F073869DF64E1EB18373 SHIVA-POUDYAL
637,465,854 *41AD798A06117CC4D0BCBDEF5BD213E44382EDDF SIG5JVJF
637,465,855 *41AEC6B70F96CC7FEB2CEDA637A25B4906DC56A1 SITRAP
637,465,856 *41A08EDFA15D5BAFF751A57338494AAF8998BCEB SLARGATI9
637,465,857 *41AC978EE840CA65B86967F459B4BAC22B347DF3 smallmouthed8
637,465,858 *41A3DC5312A3FB46B9DF4B1F346613691F22DF5A smartles5
637,465,859 *41AF89353D27B9E2DBAA879B35666BDCED8770AC snoitisiuqcasmbdrofstnemeriuqerytirucesfo
637,465,860 *41A391DDD3CDBCB2504EF7B07DBC9800FBA6879F SNUFFYTANNER5
637,465,861 *41A8016D0D3D26D0AE64F4F82284DA93D8031ED8 SOK-SI
637,465,862 *41A5F350C0DCA3914BC9B845A22F105C5B0CD0D9 [email protected]
637,465,863 *41AEE5C6804D5120817111AD1FE2D6A7A0896265 SOTRACCIONS6
637,465,864 *41AA07B837DCED1607F06D2A9CFF402D9DC49A0F sparkyspencer
637,465,865 *41AE6BD626150621CD4982176F340A4F1046C4C8 stanleycarthens
637,465,866 *41A6AF62AA815A2D0706429271052EA95CDBF135 startrek(tvtheme)
637,465,867 *41ADD24F7450A0DDBCB044C666D703DA93AB6326 sterlingcamberos
637,465,868 *41A40C786269ECDFC6D1F618268D9E6069691D1F STREKNINGER4
637,465,869 *41ACE00FA929D53115F7EF5896EF48190656D309 STRIGLING2
637,465,870 *41ABDAA84F525AB781DE13A0EDD4D0D7CF797B4A STSULPICEDARNOULT
637,465,871 *41A47F1CAD93EE29CCE46846C831CE402709E2F5 STYSD
637,465,872 *41A9FCE69F1FE3431F291568951216BF3BBAEF0A SUBIAUR
637,465,873 *41ABBE968BBCA6BF3CD154987133771F9EC0153B SUMMED
637,465,874 *41AB4E0206CEE97E3ACBE853C45B0444DC6AFC9D SUSHIDELICPHONK
637,465,875 *41A5972BB448F1122CB6E170D1360F5C24A828F9 S VILLAL
637,465,876 *41AC8AA11CE2B6841B5200B4DD44D5EDA8298712 [email protected]
637,465,877 *41A227C7DD310351EF78888E093D98BCB865E537 SWEDISHTIMBERPRODUCTS
637,465,878 *41ACC414E2293CD5CBD64AA95532F627EC6C04F3 SWIWIN
637,465,879 *41A5E8790AE0E479359E335A474F396A94EFC05A SYMPHONISES2
637,465,880 *41A746DB89A6924E871AE8797925FCCB0426094D SYSTEM.SJP
637,465,881 *41A6C50A52DA681E4AAC147544611588A3891FA6 szigyarto-arabella
637,465,882 *41A38473B1020EEDA511530584C6D118E0B4C6D7 TAKTSTOKER6
637,465,883 *41AA905A34875DA2960D3384EAD39484E1AE6E81 TANGELS9
637,465,884 *41A16549A9D273EC602DBE394B6E5DA0E9AA6235 TANUTKIN6
637,465,885 *41AE07DA638AA8653D6F60EB5F2E280888E464CF TANYANPENG
637,465,886 *41A685730F49C50D25CE497CB833C9B249613F1F TAWANER1
637,465,887 *41AA5BA3F70ADF10A4CD9011865EC9ED2721BAAD TEHOKKAIMPIA2
637,465,888 *41A77248F4F3F998E2A0CC968F369E6269E455E6 tennissc3
637,465,889 *41AD0BB59570389730391B891F59D8912B171D7A thatsupport16
637,465,890 *41AE6C954685CB86BE3600A17CF9AEEFF38C93D3 THETASHA78
637,465,891 *41A18EE63ED26ACF6AE1CA1D8C01579142DED03B THIS.HUMAN.WORLD./.WOUNDUP.CLOCK
637,465,892 *41AD88E4D0B1511CE889A12E1B89F82BBB396535 THORANDING
637,465,893 *41A24E0313127AE896F27B751F418E62F4D1455C THOUSTHOUSES
637,465,894 *41A094AE70A0C2BC8191E1919EC47B2EDE909C84 time.of.our.lives.(original.version)
637,465,895 *41A1A925AFF36AC1080F0E58D3BA7841165E6001 TODD.MCINTOSH
637,465,896 *41ADC2B3787FD1E01698B6EA690F153C9EAABCF5 TONTEKNIKO
637,465,897 *41A9FB315778D6D51FDDF1069F7DF12680489CEC tonycrombie&hisrockets
637,465,898 *41A386F2AE2E90DFB6893A1A24ACB2718DE22054 tresmarias.lusung
637,465,899 *41A0816B47A02562AB738D19FF762D1130D34BAE TRESSY6
637,465,900 *41A8A63F2629769315A673630DC6CA113D6840C9 tripleconcertoincmajor
637,465,901 *41AF51F9473923E1F516FC1B6D7F2D2F9307463E trucking
637,465,902 *41A24A12579389E0A935D15586496380FC9C24FA turid-svensoy
637,465,903 *41AFE81F1F8BF89640AC8AC09F43A877B8EB70B2 TYOWANNA4
637,465,904 *41ABB4C7CAA11F19AAF417996D0236F1468C75BA TYREN-MILLER
637,465,905 *41A4CC6152029F93870CA9E22F9407EC1AD3BA2E UITGEKOM6
637,465,906 *41A51C336C57C02DB0C8535C73C5897FB70219A5 UMESH SHARMA
637,465,907 *41AAAB2FD4F34C7E0CD7F561DD061EBB5DE146CC UMMONAI1
637,465,908 *41ACF21DD8AB46F987FC6DA221895057EB17631E UNDERC4P+4IN
637,465,909 *41A0732B1F25C7115F56B5AFA97320906FDC8A20 USUBINMO2
637,465,910 *41AB57E53AD8FCE6D253F718542BAEBAE34C593A UU~`d-p
637,465,911 *41AB62D29BDED0D26144891E836B2A73E5052BAA [email protected]
637,465,912 *41A5114295739CBC7E9A9AED814B36F227A55E0C UXB8
637,465,913 *41AA169D08A08C2C472EB11623D64166500DE686 [email protected]
637,465,914 *41AEB03EB92F6C05976737B84A2675639C80E318 v3nt14t3s
637,465,915 *41A587BE7404F535990E8C3852DB9FE5AB87ACAC VBVBAEXCEL
637,465,916 *41A9E02939670AF1AA9F9F46553F16CC13635C18 veronicasauro
637,465,917 *41ACAD8A3BD5EBEDA82BE44825E0D120D23B910C VINCENT.WISWALL
637,465,918 *41A7884C88B0FD8FAE70BAC7BF358BC5202DFB5E VINCENZO.CAMFERDAM
637,465,919 *41A8581170B1021195DDE05733F431B19D375C9D viorno-widiono
637,465,920 *41AE078391A40DCACD1A925117CD481E9662D850 VIRGILIO.DRIVERS
637,465,921 *41AE87305DDA090EC90AC6352FEDB93100E0B541 VIVIAN BELK
637,465,922 *41A5B466C3039E6D448A3826B5CDCE0743FEF6A8 VIVIAN OWEN WATKINS
637,465,923 *41A5F8EB886FAAFCA7D133AC7337C878DCC8016F VLADIMER.SABITIAN
637,465,924 *41A13AD7040E706D4EAF7BE60D9A9E453EA9B009 VORAPORNA
637,465,925 *41A3A7A79401DB2102A2078892EF25C080E9A4B5 vordily7
637,465,926 *41A5DBADDD0D0B265A3BFEEEB6A9D0B0568B577B VYAASASHCHYAVANAH
637,465,927 *41AD7FBF4B3DDB73F2207FC066520780ABEA44EF wallacebucciero
637,465,928 *41AC2DD39D5EC5BF62FCD85FD8EA57ACE371497A WALLACECOOMEY
637,465,929 *41A2618271D9A0669F672D725C404708D650F11F walloped
637,465,930 *41A5AE71BE8136EF023F628C6B5CA7660563EBFF warrior's-hideout
637,465,931 *41A0B33A395EDEF4EF54301426AB7565F6A54A0F [email protected]
637,465,932 *41AA96E162BAFB3E6F763FE4FAAA338AA8EA39EB webmesg8
637,465,933 *41ADE976893BF436A0DAB4BAEA583AC5216346F6 [email protected]
637,465,934 *41AB714823BB6D12B56E9575505203E7F13BDF12 [email protected]
637,465,935 *41ADC391727A6961790A244DAF98D28CF8BA628B who's-your-daddy?-(fuzzy-hair-dub)
637,465,936 *41A4C38BF59A2B5C07D31C2B1A4BE2FFF00C89F0 WILBER.KALKWARF
637,465,937 *41A9A8D1FAC347165AF4FA5D52A8C82B65573347 withinrange5
637,465,938 *41A4BDF1A7228B88048EB47C6798AE5ACF71AEEB WOLS-01
637,465,939 *41A81071C6BED5417CB15F26C16DFBB71C1E9A8E WONDEMAGEGNE.YEREGA
637,465,940 *41A6FE5368175747DC932698285C1F801E544ACC WOSSEN.HABTAMU.LAKEW
637,465,941 *41A44668E70F6B3586022A5E2D4639EF39BD83B4 [email protected]
637,465,942 *41A4C5679F4C1624F7D411B1041C9EB97E87593E [email protected]
637,465,943 *41A88D9E70DC1357F1470E79BDA3A6FAB898FF7D wwwuniversesonstagecom
637,465,944 *41A564CDB824915CA378547944FFD6822B586083 [email protected]
637,465,945 *41AC7AFDB589A3E5505EB6A750F7DCF6AD05BF18 )X(~(#3
637,465,946 *41ACE944D610B562EFC6A9B492ED241BC99BDF59 (x)~ ~ ~ d###p
637,465,947 *41A00F38255AC3F6CA7E2423F10FD3876934BC0E [email protected]
637,465,948 *41AA3BA31C52019A4652BF7D4DDA81AD0B1DA3C6 [email protected]
637,465,949 *41ABEFF0F764D2305B2AB648C36D283E2375A474 [email protected]
637,465,950 *41A4D25152DEBD2FC3F11DBFFB51982ACAFC268D [email protected]
637,465,951 *41A8743856E900F8D28A54760C38DB43B3EE9E75 YEGSAPETHING
637,465,952 *41A79DC959180DD642A2D1E3719DE50F934FFBA0 YESICA.MONDRAGON
637,465,953 *41A6888A13A5E3A2EB6516CE94F3EB6E4D8D9E38 YLLACILOIRTIV2
637,465,954 *41A691B0960DD934A4FF073E8A8272933CE3A80C YOAKBSW1
637,465,955 *41AAA5BEBC09C8172B46949B2A4886BA8A5B46FF YOU'LL-UNDERSTAND
637,465,956 *41AC12EF3BBF6575359E3DD2283FFD292E2F30F7 You-Must-Follow-(Dieselboy-&-Kaos-remix)
637,465,957 *41A22E6FA52D6BB6AA9521A0C4E57BF11891B58B YPSILON BOUT
637,465,958 *41AA2030DC0A95543EA0DD1D17B028A8EC0EC54C YSEDIMOMS
637,465,959 *41A8FDBD2A440C737B8BCB4EB37E53DDFF9C0110 YULIAONAI
637,465,960 *41A1F284EF0F67481C501699F9A5BF52296FBB46 YZDBOR5JAKI
637,465,961 *41A3CB1D43A5CD9E769EAC5A9FE136AE606AF241 z`%
637,465,962 *41AAB21BA48114C548E32D68E4992829109E16C3 ZACK RICE
637,465,963 *41AAAE8F5E7F0C76C74FCE015C062D5EA59552FC zaphiri2
637,465,964 *41ACE3BD3B315891B11C609F778E920489185DEF ZF100
637,465,965 *41A11E3A0237BA9A6BCCF51B585B224ADA1E505F ZGTRSJJ0
637,465,966 *41A7ADBEABCE84573B470CDD3FE66E7B891279F7 [email protected]
637,465,967 *41A73739E27378E4073041BEC3513A8F080610F9 ZONLICHT7
637,465,968 *41A77C914F5E4A92C245808F37695369D977C7D8 zwemmen!
637,465,969 *41A2269B80CD57EB37E5ECAF16C7925B4D1BF603 «ОЛИВА
637,465,970 *41A6541521D59357DE695B03EFA77F4201ED71E4 РУФ
637,465,971 *41A22274C2A8A51416D23C955627740B78D01A38 )が付いている姿である。上司のD
637,465,972 *41ACB64A25A9B90AB395D56E4D23E7350CF9E0A4 11417softball
637,465,973 *41ACB5746F29AED2A43F8C849B1B3266E18FF11C 1453rome
637,465,974 *41A7D856E063492896CE3440BF8BFA063B59CF0F 1722125 someron.ua.siirto.p
637,465,975 *41AFD3451296574683CB67B404C15E69724E215B [email protected]
637,465,976 *41AABA2C39AA26E202BC5A9A55C0815FEC63892B 1.AL-KHOLARI
637,465,977 *41A277BBE5D04CC2A686C66BF3758CCE26A68114 1.arkifilosofointia
637,465,978 *41A8168439A30D2CBEB86C6B3C039B5D12A6750A 1BESAUSENS
637,465,979 *41AC06FB823352E02B527512D967473453AA7D94 1bestellvolumens
637,465,980 *41AA16B636438C7D22519E92C4623452211BAA3B 1BILDGESAMTKUENSTLER
637,465,981 *41AD4BFA53A613F22E7B9F481711299E822B2976 1.BJ
637,465,982 *41A6104864249CDBDA31CF1A1107D60BFAC0025A 1-door-and
637,465,983 *41AE3BEAE00E0901F76CB25B841EE729164ACA25 1 DWHN
637,465,984 *41A4FC571F95AC1FCF7E3B03FAD7A66D89A8F18B 1-EINFAHRTOR
637,465,985 *41A006C2B2C68FD1D93753CD9CD9F4FFEF15D23E 1-gold-clown
637,465,986 *41A4D650C52972E682FA41891D7E3382B256406F 1INCTERAL
637,465,987 *41ADD218F1E7B8EFD1F752E4E0B3BC092A4687F7 1-kekelemeye
637,465,988 *41A10A75CA0209ACD6453EEC3E0C3E2871F76AB8 1PHELIZIA
637,465,989 *41A636B5897FD7D65A5A8BAF86E9CCA8FD9B02D4 1pokasahalla
637,465,990 *41A53421284C14AD803299C373D63F0ABE2AD3D5 1 SATANISCHER
637,465,991 *41AAB5F3E72FC95CCAE5B4A7D9C63CBAC6C6362F 1.SCSI
637,465,992 *41A10E690F8DA7077F216F31E394023FDE7811B4 1-stepford-wife
637,465,993 *41A8F01BF9A9C018395E7FA9DFED18557428EABE 1SYNKRO'S
637,465,994 *41AC18E21557B02DC49576FA48D4C7B17FBCF164 1 TOIMINTATUTKIMUKSELLISESTI
637,465,995 *41A0F2DFC369BEF2F0BAFE2F392914511FD31DA9 1uvbvalolla
637,465,996 *41A932C55BDB5B1356DDEFF5D2329D00F2DA93B2 1.VIRHEANALYYSISS
637,465,997 *41A4F02CF1DE23AA92733CC2741252F57A8237F7 2000:MUSIC2000
637,465,998 *41A1E6BD1BD237B7D6B7AEEF5E4380564F78DBAC 2001-08-05:.BLOCKBUSTER.PAVILLION,.LOS.ANGELES,.CA,.USA
637,465,999 *41A542373951C227973E1EC833CFD0BA5BDF2934 20JUNE1210
637,466,000 *41A029D9CB6F84B84A49EECC6452219F6FD4721D 22mar1255
637,466,001 *41A5AF777AA8FF56930F89DFA5EFA8513B29C22A 2925927 TARVIT-TAESSA TOIMISTOSTA OHJATAAN MUUALLE HOITOON
637,466,002 *41AAF090B9ABA925834B8F7B32A45CDD1AE77FB5 2mesdames
637,466,003 *41A7DE6D91D126689C8F4D175DDB518858D76510 2SPARTING
637,466,004 *41AAA1D980E637D9B466077B87BEEECB09483FD8 2.TAKILAMAZ
637,466,005 *41ACB23700A23ABFC59363B301A610985E1445C5 2-volz-nickol
637,466,006 *41A73719B10486D184C9F1B389BD606FC39DC38A 2WEETONA
637,466,007 *41ADEC7124843DF2AA26BFB52964039ABEAEDDAA 33-SELBSTLOSEN
637,466,008 *41A8E13EC65E138149FD56D9B13740439EE0F83B 36003ce0245b38e08b725dfb6da4ea5d
637,466,009 *41AA1AC27CE0ADC181FBE8E4415A8EB552AEB96A 36898d11a0148ed09f75b43e6632a468-698646433
637,466,010 *41AB9DD8E76B3AE696BE434E66B4A9D067F6C344 3 anilmak
637,466,011 *41A12DED77A48AA35646FFFA84BB40B1FB3298E8 3BCD1234
637,466,012 *41AC8ED619E1FD5438023ACC6CC2D17603631D3B 3ETITSISNI
637,466,013 *41ACBDB4EFBB6F32CF4FC1C51ACE59EB1E9C6D9A 3 HARHAKUVITELMAA
637,466,014 *41AE9752B4CC28E73C3997CEBB882DE761519D4B 3 MAKEUPLESS
637,466,015 *41A37E8C07B028E1E38C06049FBC5991FF9CD820 3MYNADIA8
637,466,016 *41A0DF6F111258E20CF0828766F8EEF1220224F9 436354 LAUTAKUNNAN KOKOUKSEN J
637,466,017 *41A96B7AF4BEA9155AFD1512787752F2E449FFEB 4HERNANDIACEAE
637,466,018 *41A34F8AADEE1E50349C5A505AD59821148A32D2 4HOMENAGEAIS
637,466,019 *41A9E2CAA0F1D1726FF2206A1E70E72E15155DAE 4JIMBOBARNEY
637,466,020 *41A5B06C11A241F49E22030593D59E2BA5FAE140 4LACROSSERAIN
637,466,021 *41AFBA69CC0A36D025EEF4D633965625AE4504E3 4meseler
637,466,022 *41A0D0724B13F4F1944FE627E9AA2B08E39E3658 4 n
637,466,023 *41A14B1DCA24A551C587E51B63085933114A3AD0 4ORNITODELFA
637,466,024 *41A18D7956EA374441F04B4C2DECEF4C834B6508 4OSTENTAREIS
637,466,025 *41A1C582FEDDC3A167091518B807EE673C083591 4PERHEELLISTEN
637,466,026 *41ACB29EB83C64D9863F707A5785B27DA4C7867C 514297 -SIMDILIK-YOK-AMA-ILERIDE-BENIM-DE-OLACAK-,-DEDI-.
637,466,027 *41A90D8E5998AAFB84D88735035B76D00B049213 54TRORMJ
637,466,028 *41A9DC9AF2C4109C4827118FE0411A970E16CDEB 561cassidy
637,466,029 *41AEDA518C55E6A42FB3BB375B119CC00FDFA259 5CITSILAMONA
637,466,030 *41ACD30F55A1958205CFF746F01B11E8346D3BAB 5GRADBENOJ
637,466,031 *41A7E3901284C2C6B9282C8A0715DC4A966E8D2B 5inspecterez
637,466,032 *41A9C95E65F4BC5E077DDCF2360029536EFC4A0A 5theheidi3
637,466,033 *41A56FD3CA2A98E7BE6BE33A5137D652DD7E89DC 614EVAN
637,466,034 *41A3A4F27BBFE2BCE78596BC326E9035B33FCF76 6BOARDSTORE
637,466,035 *41A2A5733D113D985C88A11C44283D4963EDDBA3 6CHARNAUT
637,466,036 *41AB79F1AE99997222AFF01380B6F9B3101CC55D 6 CHARTRAND
637,466,037 *41A7D469850FAD89B51F22466CE0177C93519C75 6iluvcrawford4
637,466,038 *41ADD9F24B557485074DFA3FEB0A3E0926A4E24F 6MANELISBSW
637,466,039 *41A7D68CFB245981478900928835C7959943316B 6PENNYAUSTIN
637,466,040 *41AEB37BF3498C3B9962EBD6064F8C635F4CE0AB 6VOUESVOUES
637,466,041 *41A76AF89340ED0F9EB21613D3D9E0A8718AFA55 702639 "-yeah-,-time-costs-people-money-,-"-he-says-.
637,466,042 *41AE9977252E458FF569A424E0F7B07052FD1D60 791004 MUSTAFA ERKAN PROF . DR .
637,466,043 *41AF831AC503DF90A29ABA6CF297EEEC89A5D1B6 7BSWKIMOSABEBSW
637,466,044 *41A3F816FBAC5AF9F24AA80A8EDA1FDEEAD70D44 7FRONTFIGUR
637,466,045 *41A96A7F1D3870C5B5D0F5F066BD0CA7413058F2 7HENRYBRIAN
637,466,046 *41A7C0F8419AB13C9B2926AC9986AD869ACED5D9 7MUUTTOMI
637,466,047 *41A2076BFB82B243CA6CDFE70291547C6BA3F22F 7OVULODE
637,466,048 *41ABED5E3EDC47219FF4AEDC936B9D887CFADE9F 7TEANESI
637,466,049 *41A505944DB303A658D45F411CA254F56A47D6B7 7voorzeiden
637,466,050 *41A3835A6618E313C35C16144E18C48C2C798A69 8BB8F0FA-9329-844F-A203-E698C15202A5
637,466,051 *41A8FBF53AD1AC6C021D9081798B3EB74E200102 8DOOGIEPANTERA
637,466,052 *41A8AAE4E1131A98BFCBFF52BE7C6A8684392AF3 8ENTRACTED
637,466,053 *41AC7903517DD17A7B18EF23A06052E841269E1F 8EPORTEMM
637,466,054 *41A4078FE6BDA3AEB9274A995AE635C091542F7A 8FORDERLICHER
637,466,055 *41A5D75CA5FD9CCD22349956E687B31546A1E10E 8IAMPOPE
637,466,056 *41AF325B0EF4BD1B2281B0895F4D3F110DFA6744 8ILUVWILDCAT6
637,466,057 *41ACCB253FDB5E94BEBDA922FD9FF3079162238D 8MACKORMICK
637,466,058 *41AB2B343766D882835D22C4C404B154778B110F [email protected]~.~.}o{
637,466,059 *41A89CC52C8A9D7AB7B1099B17A6EBDC2300EC73 8YELLOWTANNER
637,466,060 *41AD72333C43A270429E5C7FCD24C6E03513B080 8YOKUATU
637,466,061 *41A4737C31BB9031003B9931A6D493763A4E9991 8YRIAVRETNUOC
637,466,062 *41AAA3DD82EB210A51C91EAE14FDB8E1EA850602 92072MARKET
637,466,063 *41AFE7F42817E45BE7E76CD5B6B1D1B3BCFF74DE 976713 atakiSi-2400-elo'ya-ulaStIGI-anda-usta-olacak-.
637,466,064 *41A929F8582FC6BA988A1F0CE943239EF2306CEE 993395 zuweniggeld,zuwenigzeit.
637,466,065 *41AFB444521DDC04EFA6B86193A12E835F1626F7 9ACHARDS
637,466,066 *41AC69A784AD26295C3CDD1437CA6BB7F05EC6B6 9IAMBUGSY5
637,466,067 *41ADFD584578AF99540D49773DDBCF0B5FED4CCA 9LPNESPAL
637,466,068 *41A08A705DF60CE1903B3039F308812578438EBA 9NEDROBLJENI
637,466,069 *41A7B110BC2A67EA26D6A383D0762BB8D91E40BC 9NETWAREOPUS
637,466,070 *41A9BB07D35DEACB38745A8E9453CBF680CC422F 9PIAFFEUSEMENT
637,466,071 *41AC52C0319306FB5FBA7E83A0C8876D09BFC9A9 9SAMMIEINTERN
637,466,072 *41A45CA82CEFC6437C1480AA4CCBA771D8C6974C [email protected]
637,466,073 *41AD67F5E88E7140F7E47C702413CEE70711A4FC 9TRANSMISSIONBR
637,466,074 *41A39D698DF6F89141843765F880E5629727C5E6 9ZURUECKPRALLEND
637,466,075 *41AD9F36BE2BA6EBC246A6C1C4B4B78B60C25909 a31n4
637,466,076 *41AC609E8FD062F7A3000D71B0F213647DA14861 a7x-x
637,466,077 *41A7B5A140A42BCFADB0060D45D2E99B08DD58A2 AAA2YM
637,466,078 *41AEBB4087D683D84A79841D4AED1F933BF5582C [email protected]
637,466,079 *41A9236B84A068671472F701CE8C6AE89E8B26F2 aad-ft
637,466,080 *41AEF21F5C5F24A0D61B88B5F4404694979A4388 AATOLLE
637,466,081 *41AAA619D567F743B76A900949D7D81349F92ED4 abfrd
637,466,082 *41A183AD0A8FBE99D920D7927F20C773862912AC ABSOLUTE.CHILLOUT
637,466,083 *41A7085F3B751DFD0E5A63AEA201EF3769D99510 AC%4H
637,466,084 *41AFCAC959B52F54512B565FC9EBD15A9B5A1393 [email protected]
637,466,085 *41A65057ED7359F2E3435112FE63AD7F65457AC5 ADANKNAPPENBERGER
637,466,086 *41AE2AC4CE9FA1C393BC396D0D3C9C1C47D397A3 [email protected]
637,466,087 *41A4C4AD76E84912871047AFEE025B44EADB9CF8 ADK
637,466,088 *41A94B9D01B10AD55BABDFA62556EC232A181771 A-DRINK-WITH-RUZZI
637,466,089 *41AF99E0CD82D3D825202F42B933C4EEEBE9B3F1 a.e"b
637,466,090 *41ADA68DB6C8BAA24A4E954F132F880337B0434C AFCQ.
637,466,091 *41AA81445FB53C9F702105C5E69A04C85396E5F8 AGCN0
637,466,092 *41A5D1E499AC568F726FB15BD318F80A48A4CE03 AGRAFFEED
637,466,093 *41A83A16C33EF7AD107A6947BE305CFDA7394210 AILANDS
637,466,094 *41A61B4D17E73152B4CC5BD8CA605C0FB67787DC aiyk
637,466,095 *41AB34EFE1D29357274DFF51B09DA36F67773B62 ALDO.VANLAAR
637,466,096 *41A4B631650586EC46C7A0AD6A498978DFCD7679 alexisfillion
637,466,097 *41ACD73D87D4036FA5845D18F0F318E9F662DD1B alex-watkins
637,466,098 *41A929BD3BA014D5C5BAA355B02DFE9EEE888E1E ALHUSSAINI123
637,466,099 *41AA49AAF4C020F164D2612F9076F202C27CE8CC alice.ernst
637,466,100 *41AD2C84B91117B2F434443735931DC7C271D401 AllenL
637,466,101 *41A0AE59BBA441446B1C8DE260B9D28960E3BF4B AMBERHILER
637,466,102 *41A784CB8E1CA402FC89289367BB553E6277EE59 AM.I.A.GENIUS.OR.A.CREEP?
637,466,103 *41A5E4CB368EED58E39F9A43BA0ABD0A12064B6B amobf
637,466,104 *41AC3B12341B98CB6BA1BBDE570A96405CF2F8E8 andrew.emory
637,466,105 *41ABAA9B45BC066996FB89856B66E4735775695A ANNALEEHOLLAND
637,466,106 *41AD87463AB29B4E6ECA1A12441E960DFCF9CB4C ANNANICOLESMITHSINF
637,466,107 *41A28189EB387E26B930E41B226900599BA41EA4 ANO-
637,466,108 *41AE1981CDA82570F2D0DF0717400169151DD9BC ANTON.STEISKAL
637,466,109 *41A1806279555DAF1105B0E567F7AB5094120733 antrufnes0
637,466,110 *41AB3BB1E4DBD46C1542B940E66AB5043E4E0D24 ANTYGLOBALISTKI
637,466,111 *41A81AE5F70D545FCEA66CE41192D77E01A764B2 ao#ra
637,466,112 *41A0439DF73BF32CB15CB9F21FC0E399B483311F APALOUSE
637,466,113 *41ABDE07D656AB584070265E6BD4245342735A1D arbetsareorna
637,466,114 *41A362CA74307D3D66401D0ECF597CBC250AA36E armandosprang
637,466,115 *41A54527D2800BB3F2A574EFDF52D8A9AF869632 ARWEGHS
637,466,116 *41A8E730C512C62435D25D7DEDFB8B9D227865E8 arzuxalçiliq
637,466,117 *41A90A97262E661CDCB7B7C1718BB908211FBB39 as2kg
637,466,118 *41AF2671E388C86E797C473ECA74C8228EE4578E ATARAMATZE
637,466,119 *41A32903036FBF63BFD561A105AA61D291CB1D0B ATCATTAGACCAGAAGTTTATAAACTGAAAGTTTTATGAAAAGTTTTTTTTTTAAATTTT
637,466,120 *41A1A1D1FC587F6C5C2AEC0B4774D8D4294B0991 aterrante3
637,466,121 *41A3D11FF074627C883F33909F84FC8C30C401D7 A+TV8
637,466,122 *41A151FFB183480B3D0717713F72C5F7AD6081DA AUAR
637,466,123 *41AFAA9EDFC4AAE2798C11CB31BC7C331E1F764A avesseva8
637,466,124 *41A2B6C7F4B38AC11F348D8C9E6136F992129D53 AVXNA
637,466,125 *41ABB81F0422D1D2BB448B2C960013DD46382A82 AWHNT
637,466,126 *41A82A4910D843178291088217D672D4DF51F6F3 B+7A
637,466,127 *41A801E929B9D01FECB50B1AF828E92F9F5C108C BABEARN
637,466,128 *41A2760225807B50095FE0AC1C61B7E1A5B69119 bad?b
637,466,129 *41AD4021913CFE083EF4C7215DE3F1C6D2805AD1 BANAIS1
637,466,130 *41A6ADCD1F84DCBA60D640DC350A6E0B771BCA89 BARAXS
637,466,131 *41AF731D2FB1606AA789835F52EC500F0FB46182 barrettgerety
637,466,132 *41AE21FB4850FF2400DA1A9E7488DB23996FBB34 barrettmeech
637,466,133 *41A11D8FFC3554CBA58D35146FAF734E8CDA3756 [email protected]
637,466,134 *41A00D636CE83DB3D4DC16D7935BD53D0996AFB1 bazsj
637,466,135 *41A46CE95A65A412F6755D1ABDA8D07FD340C3A0 b?d9%
637,466,136 *41ACBE35E1B4486ED993017EA55484E09DC9F789 beethoven:symphony7ina,op92:4allegroconbrio
637,466,137 *41A4689C8D9EFDD8BD754EBF26FD2F97B1302A86 BEFORE—SUCH
637,466,138 *41A9205712A3EDF40267DC9AF8D1F049F6A35DE8 beoee
637,466,139 *41A5F2B919D35D3FEF43986279711F631B47BFB1 [email protected]
637,466,140 *41A39FEB9E889FBA09027A5D1E0478A13CCB1D27 bf0vy
637,466,141 *41AC76BA39AB30CB3254FDB1011525247BA26FE8 BfA+
637,466,142 *41A8E7D5C2CE338EBF008925A6C2FEC77B19AA06 bh)v
637,466,143 *41AF156BE6B8589D7D80E4F2FB82EC05E9D278BE b_ifj
637,466,144 *41AB6FE08F6F2013F1AB01DC300ED2A01A9E423C BILLIEASCENZO
637,466,145 *41A54C58A880CF0445373853DD10510D4B439E90 blairkeipe
637,466,146 *41AEB55BC0340A42EDEADD49E172AB58337631C9 blakemuschik
637,466,147 *41ADFA4E22D26B0FDCE7C2883E4648702A6B5428 [email protected]
637,466,148 *41A15618CBF76EB96D5550453A2B2BC146691837 BLUKY
637,466,149 *41AE7A57640994B35CC130B3FA7B3C3355DBCAA5 B&M&O
637,466,150 *41A60744AB3E9C12C773746E1DB20C2566B54BCB Bomb.Ass
637,466,151 *41A9A95E1FB2897F2DB02E203BC59BBEA5BC28E0 BOMF
637,466,152 *41AB371B9D778934E5B880AE7E0F286A1D2827C7 boxeklub
637,466,153 *41ABBA7208CFBA7D6814D9A591C3FECB75E6F0C5 BOYD.AGREDANO
637,466,154 *41AC62DDF55D91C6F462E9FE421020067876065E BRANDEN.LASTELLA
637,466,155 *41ADBA9408C8E219C4E3FBA078209AEA88868651 BRE/;
637,466,156 *41A36326D96AA4BE4EEEF1001732EC8F6A6EE566 BRENDONGARNES
637,466,157 *41A2C074FA813EED5A4EF3C2538E5CDE667055E2 BRENDONMOHD
637,466,158 *41A63C7220EF510EFB444C1334F8EBA8252BA8B9 brentschmeer
637,466,159 *41ADBCE09E00B86AD627A8D45C980F33D43091DA BRETIMA3
637,466,160 *41A45F0CD8211244347E88C2F9270DF3D284C9D7 bridges66
637,466,161 *41A00B4877BFEDCA02D1C6D4A5315DBCF1B8BAF3 BRNRF
637,466,162 *41A1DDF7C33210A6125B87E69B4BED1BFF253B9E BSB00016430
637,466,163 *41A8E4E16A8976796B32CEC5ED3AC0A5812554BA bsdg
637,466,164 *41AD028E6652E546FCFCC08A1446610390E48F89 bsuub
637,466,165 *41A8EEA825B15A618AF12CB71A00061E38F6248D btd7
637,466,166 *41AA6929B997022BF0AB8EAE78DA596E1274E065 burveliai1
637,466,167 *41AD6775FB2EF78C067F3C4D8F0C56F8AD427FFB B?!W/
637,466,168 *41AC22EA72BD867D7FEF13E95E4144F3BFA1165F BWO/M
637,466,169 *41A51BD250A403AB12D1DD7F540D0FD6CAAE4BD9 BYZDQ
637,466,170 *41A73D3FE24E5848EC065707109B4070533CACA2 C3/CV
637,466,171 *41A518E8A03AED69038B32BB264E246DC0E481E6 c4cej
637,466,172 *41A05999B7DC6A0A647AC4E7A1FD01AA1A40C0C8 C8IXD
637,466,173 *41A5E1C1C46417ECF0E2B2D416CDDEDF2C0773C0 [email protected]
637,466,174 *41A1DED140AA85F02F0D668A47409DCC40B6A2B9 CAITLIN PINTO
637,466,175 *41A848150063A0DFF66DE932589CDD8427EE115D CALIPPERBOT
637,466,176 *41AAC1083782AD80A66963F1A3F36FF1015621ED candinegara
637,466,177 *41A2C422378B860602859E42D2ED515BFBFCD2F1 CARIDEBRIOUX
637,466,178 *41A430F51CBAFE96D87A2DD6C1C8546FFE0F7190 caseygator
637,466,179 *41ADC31746D2FD785DFD68849527563604B82DAC [email protected]
637,466,180 *41A1614A136DC8BA7AB81A45109928149BA67353 cd5:#
637,466,181 *41A8B9A41C7B6601D3542A0DEAC3F2BC936E52E0 (cd・ova)
637,466,182 *41A1F1976679364D49A38DE1145C54097EEB002D cewlq
637,466,183 *41AC0B36956F377F90647BBE5C28A3085C4E9C68 CF=,U
637,466,184 *41A7C2D98CDAB4161720AB13A30FC9177DB8252E CHARLIE.KORHONEN
637,466,185 *41AF1E9F7EDA6844E05B3F535515B8DA12363F53 charopss
637,466,186 *41A91DAD8136483E99F55107404218BBBD6FFA02 CHAUNCEYVANDERPOOL
637,466,187 *41A27F4BCBC6105159333D17E93810ABBE364915 CHEM0$EN$7V7Y
637,466,188 *41A4A76494A02CE165DEDF5427D76EF2F5D71495 CHEONMIN
637,466,189 *41A7B3DBFAB313600325685DC7F328D090AA9A2E classicalhomoeopathyorgwww
637,466,190 *41AE0F551754FF503A8E54C0E0910FB6B7E5BA18 cld5,
637,466,191 *41A21D403AA3EACB6D2820767A2BAC977599506E CLINT.MALCOMSON
637,466,192 *41AF9266EC28C3FB12E57F244F16038FFFECA800 CLY"A
637,466,193 *41A37A020813AC4D9A0A92E4C8B2DD991016B6A3 c$mn6
637,466,194 *41A9FBF65557E0492A5834010F1E523F1F566763 CN4PE
637,466,195 *41A83AAA4FD757FDF9DD527301600C22CE93C60E [email protected]
637,466,196 *41A6F2FDDD5D6E26593976DFB6B4BE9E34D52A1D com』2010年では統合時期を「今年度中」、『yomiuri
637,466,197 *41A20227187143AE768D597A76A623A259F9E9B2 CORNELIUSFRETZ
637,466,198 *41A93E3D4A86B504DF370CEA21ADAE0F121F8F96 corona.smith
637,466,199 *41ADBC8573A1673BA44ED52BFC17B1313AFEE174 COUNT-PLATE
637,466,200 *41AAE4F4AB1C6D0F20BF53089313FC967D920796 C:\PROGRAM-FILES\ADOBE\ADOBE-BRIDGE-CS4\ZLIBDLL
637,466,201 *41A4A865F8C3E3947506E399EAC2A45FB621B950 CRAZYRUNS
637,466,202 *41A3C3808A7B20EE7C2B923CA9675957F923CEA5 cristobalsymons
637,466,203 *41AF268321DC92376216579AE9A448750539300B CROCEICS6
637,466,204 *41AE4813BA54DB29E2D1D89DDFE2AE2C94A1A7AE ctfi7
637,466,205 *41A82B76B7C553C55662A441E6E4731711BDDDD2 c="u
637,466,206 *41A3404736AED516636F4A365E8C85D13DC77E27 czrrf
637,466,207 *41A3E7234521787565DC7A6ACA67464EE76E25F6 D40VE
637,466,208 *41ACBF5FAF5887C9CC57ECE5DB673342034BA269 D4qg
637,466,209 *41AC9AD95307261B3FBC9C132B524A0ADADC0F3D D5&b
637,466,210 *41A0632BFD4C2D7D02B429F8E47AC80867B3D586 d5ydm
637,466,211 *41A02B1B4D155FB4710D2AC6D11C34A760C1DD55 d72ug
637,466,212 *41A464D48F601E156447C77703130D8E0BCA0BC3 D8%UM
637,466,213 *41AD25B9B8B55AE3914FF0F1E76DE9F31BA93250 DAMON.MCCLAMY
637,466,214 *41A350E4C51D0A39426808B9181205F7E9580BB5 DANA.FALCHI
637,466,215 *41AB539B177C05B32D749427C16B740CB7AADC40 DANC3FL0
637,466,216 *41A449508CF712BB371B52921ECFD6D014CD186F dannykoonz
637,466,217 *41A889C92CD80C9C1993695741742BD12D588BBF DARINKLATT
637,466,218 *41AF767CD9694CDEDEAB5F520C85D55F6061CE78 DARIO.EBERTH
637,466,219 *41A294A94FA774D40C6488A73AA14E42DD9B916E darrickeddings
637,466,220 *41AA5505B35D80EBDED22FB5ABAF449769B3FB37 dazzeshuranks
637,466,221 *41AD25556BE2F1C3BB19D2E51D73FC0372221CFA D;E7B
637,466,222 *41A664497134248B5076AA020D0758BB8BCA4524 DENSITY
637,466,223 *41A6FA63E28A556D51AE3F17B8F5243E1F75EE6F desytchev0
637,466,224 *41A0A19F8D5046F6A6460C282A14451709A23FE2 dfa,q
637,466,225 *41AF6C4129D0FAA19788AE955776B773D32597D5 df/h8
637,466,226 *41A19112705BF9CFE37B624664C072614C8AE728 D"H(B
637,466,227 *41A6C4A67C7264BE627F6C647D7707175FE75CC2 DIP=#
637,466,228 *41A67BA7E547100E26BF57C844E72DC7BAD6758E [email protected]
637,466,229 *41A1909C8DFAA527905ACC49CA0333D40408AF5C [email protected]
637,466,230 *41A1DF615F1C2582C6D74630590DA118A7BD8BA0 [email protected]
637,466,231 *41A9F1032EB4F99A1C7B1CAA32E728AB6E7A46C2 DKJG.
637,466,232 *41AC428F036BF0E3E799DE06E806CA522EAD80BB DMUk
637,466,233 *41AD69521B3BC9A8E4D900D8FB44468813875CDE dp$hl
637,466,234 *41A61085B5B037C41D186511D3F843946281EC5E DPTN
637,466,235 *41A09FB1A039E90626DD23862728D75EF86AB23C DPWFN
637,466,236 *41A30780223E702C2488851089CF55649C9AF0F8 dst3(
637,466,237 *41AD55F0E06D14A06CC0BCF57FDB21A839E1D841 dukf
637,466,238 *41A5ED1D8D351668A2097E76D550320CE0654B1E Durchkonstruierte
637,466,239 *41A06938846740B32C835881837FFF7DE9427D9F DZOWW
637,466,240 *41AA839BAE24B135FA0C389E32D9047AD68B8D23 EARLDENTREMONT
637,466,241 *41A55B7667532F7F8A98D52222FDBB659E316EF7 [email protected]
637,466,242 *41AE5611C32616E8BC8865F419B1E12CB6190CFC EASYDRAW0
637,466,243 *41A9954B978B3BA49706834CBD2E700979FFBC18 EATING JESUS
637,466,244 *41ABF1B0747895B4086690AA17FBCE35C9FD902A ebr8m
637,466,245 *41A6C277747F6C992118144A85B2C63BDAB1980D EDISON.GARBARINI
637,466,246 *41A584B756B643019ADF33AA7351CEFB902DB12E edisonringland
637,466,247 *41AB2A60C8F63820A563BB8F27B301E2671F52AA eflvf
637,466,248 *41A25B744A8A379755E82E41431CFBD9E0269571 EGLOSTUDI
637,466,249 *41A262959384FDEA0CC45EA3A341E4716D9AA420 EH;R+
637,466,250 *41A5B0B90072DB6253DDC98F7680876BF4B54025 ELEPHONED
637,466,251 *41A9271ECE61B18F9718F033BBE1DF192B4AE68E ELOY.VINCI
637,466,252 *41A76D14F263DA94B033E6A4EC6E13822DC07554 ELROYBYCZEK
637,466,253 *41AD557984B46B1ECC5706BDDDD951BD1AEA2418 ememberr
637,466,254 *41AE5576672878152A1FFD713DC0F8A52F0246CE EMMANUEL.HEAPHY
637,466,255 *41AA2B7A39AFE409863A4337E63B0875F3EE1513 EN203.109.168.204
637,466,256 *41A50E759C76ACEDC75588027BE812CFCAE0258F ENH_
637,466,257 *41ADA6A39CBDC3B68B11D313053DFC01117B32D3 ENTRENAS5
637,466,258 *41A1BE11B656E5D3CFF8BE27662A9963EF30491F ENUSER67712022
637,466,259 *41ABED8DA5F3ACB107693F77BF8E8E583519F44C erald-xheka
637,466,260 *41A56EC78CA706B07AA4D8FA2DD6A907FACDC96B ER{D
637,466,261 *41ACA2EA775D7DFF8D6A143946BE8CF6CB68EC2A erqfc
637,466,262 *41A89C24C01A41D042355264309B0A324D8BBDDC ERROLMIGUEL
637,466,263 *41AD36F68A95EBFFB4F5924D48845A4056C35586 esnecile3
637,466,264 *41A95792A91D23505D05A9B6EBA35B7CE9F1885F ESNUHUAKED
637,466,265 *41AF3ABBB97BEAA640494B58A44BF5AEC67CDE08 ESSARCHI
637,466,266 *41A5813E5E64D7DC48200B1D2238739F68F11FFB etchings0
637,466,267 *41AC9C541914CA75CB2CFF71BA8D5F49A884CA1B EXKANZLE4
637,466,268 *41A373508FA8CD0BD10BB97F7A652787461CB240 EXP0S+U14+0N
637,466,269 *41A7D99C34FDA2A37DC6F3F6CB383AC467FC27DC exp4t4tor5
637,466,270 *41A9A7C63D92E0048A84F70883084BD33A318969 EXQU$+ELY
637,466,271 *41AA61E75234F69D2F6BC13C8D29FA396859D31B [email protected]
637,466,272 *41A6FA1FDC21C1A461345F950F1AB22CE3A45FE8 EZEKIELSTAM
637,466,273 *41AF3217CA1957A2241FD187E1BE02D0620F6CF1 FAHADYAHYA
637,466,274 *41AC76BDD2BD6333C0B0F3FC1C761001868CBCA0 [email protected]
637,466,275 *41AAEE3660B9EB75363AC5E6937F39A8EEEB9A01 FANTASIA NO. 12 IN G MINOR
637,466,276 *41A2A0D2CDE22C01B762CAC3BE9949B7813A747D FEIGHNER6
637,466,277 *41A9C1EE29F934D457DBF0CE979A1F04EB6F9FFF FERNANDOAMODIO
637,466,278 *41A376761434E30F8E7D07FE36320EA13AB506BD FERRATES6
637,466,279 *41A5D322FC2DF9B043ECD2171FF76D8013934C86 FIDELTAOMOTO
637,466,280 *41A9C45F580F10E1DF18890E61E44DFAE23A6A30 FILIBERTOROMANIAK
637,466,281 *41A5FBCE13775A2C0470D7A56C4C3019B684EF82 FINNEYS7
637,466,282 *41AB3B996105B9241B16D74B1B9EF20B83E1632B firelord4
637,466,283 *41ABB63ED6B2F0E5492131BB337A025041868C2E fletcherchatmon
637,466,284 *41AE1AC6212D1630223BCD7A517CDF4E643B0504 flora.tsai
637,466,285 *41A82BD224174CA60D3EFAC8930BD222B4717F0B FOOTSTEPS.OF.THE.PHARAOHS.(A)
637,466,286 *41A8025AFEF77C3B039C1E0FD4D275297B05861B FOSTERSHIP?
637,466,287 *41A35DB9C752248835D444160FD188EEEF57E405 FRANCES.WYNDHAM
637,466,288 *41A7FAF1DBC72767293932362D0A142CCF2E07C9 francisawitkowski
637,466,289 *41A4DABBBC4AAF481952977F6AF1049B4D2368CD FREDERICK.GERGELY
637,466,290 *41AAEC1288B309A0376198FC36D83616B713CE69 FREDERICWASHUP
637,466,291 *41AC363BD46812C3EE5C8B3AE7A1C2E690461607 FREU DICH, ERD UND STERNENZELT
637,466,292 *41A959C82EE85D4990CD9EC592DF07729D964696 FRIPENTS
637,466,293 *41A85D4AE40FA56FC92AA85AC88A029F05D49215 GAITAS-DE-FOLE
637,466,294 *41ADFD99F2CC560A432DB88090B99682EB29FD9A GANXTAVILLEPT.3
637,466,295 *41AC4C4CED626570576F1D9E65B8B6684123B35C geraldoottey
637,466,296 *41A675841262652C938D0EF91D51D68C3627F84A GERMANEASTMOND
637,466,297 *41A1BFE8FA4F6FCA68E96E69289768FA05D20F54 [email protected]
637,466,298 *41ABBF657F1CDCC8D419BB4BA7B10CF58D97FE93 [email protected]
637,466,299 *41AB0FF1D02E43010605E607A32362108DBA8C16 GILBERT.SLOMAN
637,466,300 *41A3DC825A0B16DD8A2FED4C1C1B4CF028C99B5A GLEITFUNKEN
637,466,301 *41A47C34AD7A346C533875C70D007BE4B0D8AA2A GLUIPTS7
637,466,302 *41A8D13E432FE55A10501210F493E0793754B473 GMUSINIPALLYS
637,466,303 *41AAB6DBDB286AF28F43289A99992552AF171805 [email protected]
637,466,304 *41A1A45E52773E46672BC1E2B17C909DC17F0FC8 GOBONEE
637,466,305 *41A24C2008BC936B9E937A1F1AE08534E032EAED [email protected]
637,466,306 *41A4789CE4F8024813103AC767665B9902A987CC [email protected]
637,466,307 *41A6440C999C44C71C626BC1101A7ECB750F7522 GONZALOMAHUNG
637,466,308 *41A60B5D46866119F90D92B819265B16E382A3F6 GRACIEUSES
637,466,309 *41AC766E1EE9065F8D9C1A320F7847F38404E99C [email protected]
637,466,310 *41AB4DA23D816831D7987D36F083A2764FC10503 [email protected]
637,466,311 *41A5D24D660B3D373E73B3C4BB9CE5055E9D5BA9 [email protected]
637,466,312 *41A6C6AB1D6391A7E70DA58592F5ACE709FD1B2A H7P+
637,466,313 *41A9B084420363644E4C9684606146054BD24EB2 hammering auf allen saiten
637,466,314 *41AC4BF2491A9B47F230BBA96528B64537DD63FB HAND-STRIKING
637,466,315 *41AD5EC724BFF582E218D993DFD4D7203CDF88F7 haroldtrinka
637,466,316 *41A828F98FD8D828BB5C0B788173576563AFCB4B HBMEDIA
637,466,317 *41ABDA335CFE2AC3281393F105F9000B3A8F86B1 HEATHZUNDEL
637,466,318 *41A0CDF8BC85B260B49FF700452C7F1CCB01012B heeltapses
637,466,319 *41A314E71171A9B4DDFBF379888DE3ACB13FDA2F HENRYYOEST
637,466,320 *41A2F46091C38FD210A8C9CB88AB2B575B5087F8 HERBERWE9
637,466,321 *41AC761A7E8513BC83E308F9B972314B24B0368B HETEROTSÜKKEL
637,466,322 *41A97A62BDCC389C6C8FCA3E7CE215982A5BA590 HEYINGSHA
637,466,323 *41AEC91269C9A64D8002E51E9DFA94F33BAD056B [email protected]
637,466,324 *41A4F58038A1A2FBEDE5967222B3FCF8F9B457D5 HIDDIEN4
637,466,325 *41A3EE46FE023A954EBD18E76D30F86792DA9C29 high-classical
637,466,326 *41A3814B95651C51AE495A36721DD6FA17374CE0 HILARIOWOMBLE
637,466,327 *41AC207474A0F0171F6993B9BE92B384BF9CAC08 [email protected]
637,466,328 *41A8977D16BBC2B2511620940316965C180884F2 HÖGABORGSTÓL
637,466,329 *41AABB90772DB9E532A26E17B93111A5A5E3A43A HOHE
637,466,330 *41AF583C6A1A8E50A3D9E7067AFCF35757AB773F Holiday ID (Spanish)
637,466,331 *41ABC7C2CF6447AABC9A969F3DF3DB64030F6F2B HOLIDIC6
637,466,332 *41A3CB3B8259CEE485B750E67D4442FDC1888AE6 hom31i3$+
637,466,333 *41AF06477BE87978E87E7A9997AB39F82AB188E1 honpthoor
637,466,334 *41A78BA7EAD99D9F5BAFBF3F0A05C52809C277B3 HQOK
637,466,335 *41ABF9E1B96E358EF640C400A41A0A62D56A3CE3 HUELSHOFF0
637,466,336 *41A1D159F6D59BFD1A76B0319C4B6BE677816AE0 hughstorniolo
637,466,337 *41A537C51B1EB03AEC28C88F3D03733D2FD8EE3B hugodapice
637,466,338 *41AB3984E6ACB4EBA5F06B12CFF499C1653A18C5 [email protected]
637,466,339 *41A6B4FEC654FCD98F047BF9986E296CE5FC91E9 I_.3
637,466,340 *41AC6088FF093DC2A6DBBE69AAFE4E48D5D45E3A IAMHOLLY2002
637,466,341 *41A542101552A877187750BDAD5268BC1415C4C7 iannakada
637,466,342 *41AEB813BF6598F64B355BF9F43480B3AD20F2A7 IBA ANDANDO
637,466,343 *41A0C078511397105E11ED4FB71536014ECE140C [^icey^]-56kdialos13kdsinet
637,466,344 *41A1AA863B72C6CEEC89357A9A452D80F9A877FD I>D+
637,466,345 *41ACF7381A08EDC23F310A9892796E12BBC1A3FB IHCIUUY
637,466,346 *41A7420C11BE74FE6FFE2FDB4ABCBFDB61F2E93A ILUVMISHKA14
637,466,347 *41A5F4C2BA1CBDF807D5BB2BADCF66DEDB18A5BC iluvorange16
637,466,348 *41A567C22B658092E9ED5D344F79167CF98E104A IMPIGNOR47E
637,466,349 *41A9C9C7DF80E2CCAE274EAE1F467F2C5745E341 inchandroid
637,466,350 *41A79EB8F9B338F8058BC8AC32C715C370332E28 indeclinabel
637,466,351 *41A4AA38AD1FC801876C599EA5201EFD0B2E7228 ithackhoed
637,466,352 *41AB51C76A7CBC8A3360F4DC443B9EF2A2DF7E57 IVY*
637,466,353 *41A078584B96FADA9EF120C1C4499FCA7585575E JAIDA743
637,466,354 *41A1F0735D8CF9E9CECC5F170E0527DC8D2A83F1 JAKEBELAY
637,466,355 *41AA600644F768C656CC00EED73730B948A01952 janeete8
637,466,356 *41AB3667B20A21F8545B6B3426B178F8481D9425 JCCURLIS
637,466,357 *41A816DA827637EDC977B6A35DE162C7DC4F9B72 jd.burnell
637,466,358 *41A20DB29861059CC587C2F0DB596E886C038550 [email protected]
637,466,359 *41A059DB1FB0725482F71BF2DFEDF8A203E21F88 jedmarkgraf
637,466,360 *41AE5EC1D341FD1A078CEDADA0C49DA6A938B745 JEFFERY.MCWETHY
637,466,361 *41A648E66C3BA1D7FE719E4D14E5011D3A234A9A JEFF.FRONIUS
637,466,362 *41ACA49F4BAAE694A9AF62027CC22F2E226E6431 JEROMY.MATKIN
637,466,363 *41A6D2CEE15C0636CA09719B62083F06A8A49667 JERRELL.REPOFF
637,466,364 *41A3F45F7C06E9A4162BF795E38A0DF1DC5424ED JERROLDGUZALAK
637,466,365 *41A7F9FCE4447CA09F565104FF9FA89E95B75A1E JEWELLDIMUCCI
637,466,366 *41AEF11653D220C049CFEEA3814940B1B65A11B4 JEWELLGILLSTRAP
637,466,367 *41A4927F2BD09D05DF02D0A5C81B454886B667C8 [email protected]
637,466,368 *41AC5896C8978382A3EE2297DD4682249CA49E19 jjs
637,466,369 *41AD2D6FE3EA53A9E11A56B7D2ACD93E379E58CA JON BONTRAGER
637,466,370 *41A8D6E1A06C07DF8EC3F7A911976BD0899E5962 JUBBEGAASTERCOMPAGNIE
637,466,371 *41A87CBEE63601AC18ADD870E6D7326AE60929B6 JUERITAED
637,466,372 *41AC07DBD23136D26FF698C3BE9F12259DD98470 JUMZU
637,466,373 *41A58CC1220BC7C18926F17ED02F9D679AEB1739 JUNCÁCEA
637,466,374 *41AC23C03186F8A8DC80A2C6722FE4791D08E0C5 JUNCOED5
637,466,375 *41A46A20B9E78FAB82C91F359E1FA82562ECF4D6 .K ,-
637,466,376 *41AD6335A46C5FD723C0A962706FB6566FE54894 k]9u
637,466,377 *41A8EDBD56546995EEB8820AB0950480C38F84A1 kate.goodale
637,466,378 *41AD374F94C85C5EE96343AFAD8423EB54360621 KATUDIS4
637,466,379 *41A2326B007C33F87A2793B29F6014A004B87080 KENDRICKNUESSLE
637,466,380 *41AACEE54DB980C954C5861AFD8FFD12843C7799 KENNYMCKEAN
637,466,381 *41AB881B85FE3E4EC42E035BD3F091B7F1536C49 KEVIN.WORTHEY
637,466,382 *41A43F1470C20DA9110BD2365B96D1C4DA472C60 [email protected]
637,466,383 *41A7930D651263432A779C336E1241E38A0398CA key-off
637,466,384 *41AA073F0E982E397CA7B31FF4226997C32A7D2A KINGTUBBYSTYPICALDUB
637,466,385 *41AC482713C222869FE62116172F57C4D5048C4C KMASHANGOANE
637,466,386 *41A92F63990EB3C572CB64487A0BAA551062D077 KNARESHGOUD
637,466,387 *41A5A3F015D2F734D31D7644267B50BAC815CD63 KVIIONS
637,466,388 *41AB2F114CA4F8A4948592ECFE32B1E9297A969A LAMEPAS2
637,466,389 *41AE0FC2EB88A58F345DC52377DCC78E3E6310EC LANDESJUSTIZCOLLEGIUM
637,466,390 *41A8E3B32DCED8D47CEA35367C0DC598B87A8766 laneklickman
637,466,391 *41AA7430A21FD920E7AB1AFB086A4A0ECE58A909 LANERAUF
637,466,392 *41ACCA8B84883B877FB301892004B638A519DDBF LANGUAGEHINDKOIN
637,466,393 *41A29D6C390C9ADCE9DD9C01647D5AF358D4E266 larryintern
637,466,394 *41AE113B62FACBDF20A0DAF0366314A08FFD02D9 lcxh
637,466,395 *41A4B32F7DEA153796D7D8F506779C541D1A1BCD LEIGH.HEIBERGER
637,466,396 *41AAE12E449C344FFF4F4AF94B3979943284D4F6 lensavich
637,466,397 *41A24D3B8665368B4D0C0A8F6C1321BCEB58B5B2 LEONARD.FAUSKE
637,466,398 *41AA7A6C59BD94354DB2BC98F84982538A187772 leopoard
637,466,399 *41A9A6B0DEE7E8AF156902C3F6370DB9CE6F1C9E Lest-in-revenge-thereof,-sith-God-is-just,
637,466,400 *41AB2419E8C76680218FD1C273D48FE7BC17711F [email protected]
637,466,401 *41A91C769B5DD46AB58AFF4C1A3C5AC5DBB7F626 [email protected]
637,466,402 *41AA26D8AA541FB3DCCE19E555F5156EEF18E535 lillieflowers
637,466,403 *41A4263C65D68883BEDA42ED145BCE8F6AEBEBA2 [email protected]
637,466,404 *41A85F90E5912A379392779C06F07FB8274FB5B5 [email protected]
637,466,405 *41A6322158D4E9AD8EC72D1E44F2FF439144FAB0 LIVE:ATMYDEARMOTHERSPUB
637,466,406 *41A928A893FA344F3F3E7C8B5CBAD669B69300B3 [email protected]
637,466,407 *41AB48BB7D276B7BC00ED8F9950101E1C31BC150 locomotrice7
637,466,408 *41A092749EE228648D2905DD61799596EA09DD36 LOGANFLISTER
637,466,409 *41A30DB24F38E07E3854E90FA34EC99BA0E4FAB2 LOUIE.JACKEL
637,466,410 *41A5D7F8656ACE97F9120A71E181966126244B7A LOUISRADOSEVICH
637,466,411 *41AEAD0D8E21DA45BF6D0C0FEDB7C58FDD2730C6 lowertropospheric
637,466,412 *41AC8625292114C4B6075B5864758596D7808821 LUDACRIS(2002
637,466,413 *41ACE65C1A533628CA9165B713D81F54F2E7C3D4 lvgdgen37
637,466,414 *41A10F2FD2CD364AE62AC28FF4447278F99E4C21 MACI692
637,466,415 *41AEB778D4FC9F8AEA30292D94E155E549EA700F magnificat,rv610a:1magnificat
637,466,416 *41A7A3C10D1DEAB502C08E17F5A513EB61517AB8 manchester'li
637,466,417 *41AE115006B12FA5DFF7630B71F0C27601095CAD marich
637,466,418 *41AC64C60296D24E03EBCDFD574FF7B025B22BB5 MARINELLADE
637,466,419 *41AACA2E2C1143C034D9D9CBA0DD584AA9B2D77D MARIOBARNES
637,466,420 *41A5C8B6D2EE69028CF98704E53D7B8B7540458F MARSHALL.SARIC
637,466,421 *41A18B6B04F7D1670808E759BB7FE9EAB0D798A0 MASHKALJI
637,466,422 *41A79D9CC77016480077AF6E0A2F03FED5A1B33B MASON.SAFFOLD
637,466,423 *41A0162B276886CA9667FF36D5C29BECA323CE83 MATTHEW.KISH
637,466,424 *41A347024129278186A8AD96DE85A82AB4EDD8B0 MATTLORENCE
637,466,425 *41A67BE0D09BE3C4C9C1770971F4D49D902F1DAE [email protected]
637,466,426 *41AD005F9FC842D170C40131AFFC56B0A14A6342 MEDISH?
637,466,427 *41A232E72AAA58C84B2CB9CB0BC922E551C4E7E2 MERLE.KAWAI
637,466,428 *41AF2BFDD9A7192F015691FDB7C805B4780EF799 mesapijų
637,466,429 *41AD9AE7DAC55BD089665566770D6C9D33692F89 MESSIAHOFMADNESS.WORDPRESS.COMMESSIAHOFMADNESS
637,466,430 *41A27BCBC4EE47369E32283A6DD3D625C12426E1 meurtri4
637,466,431 *41AE8898B415CA3B748371F7271BCE46B374D8F1 MICHELAFANADOR
637,466,432 *41A3D3A27D006FDE66F442A2A902976E4CB0C926 MIKE MCLAUGHLIN SR
637,466,433 *41A77087094A88EC104A5D20736944FBBA2EC706 MILLARD.LEDFORD
637,466,434 *41A8831AA99179145ABF0912164BB207BAE657E3 minhdunovant
637,466,435 *41A2D0F5EE05CABA440AED93329CD629CCC6F03C MIRAGE-MAGIC-THE-GATHERING
637,466,436 *41A79AFBF93663E5B531A331E33F05212400450E MIST4NKES
637,466,437 *41A71A568DDB8ABA494B3DBE22051F70C42F5268 mohamedpeschong
637,466,438 *41AA68CD35184DA215E9B00B77FDF89920C19FB5 MONIQUEKARIM
637,466,439 *41AE2BE250E26691FA7439E662F724D82F7F954C moordaaning
637,466,440 *41AC80B9BAE51D318649ABC0BDDAA7373AED05CD mottindelabalme
637,466,441 *41A9146CA501A59D8CF543A259914DFE3558871A MULGENCE
637,466,442 *41A4478CDE78B67D0B8D529BF2736E5607AD6985 munsterbrucke
637,466,443 *41A491CE5F24EA3F908D414C08DF304260CFB0D8 mvarela9
637,466,444 *41A4374B7859503CDC6E936E849513186273076E NAdlieCoast
637,466,445 *41A6A6B8EB3ED8E213DC0828AF825F2C88A27672 NADOJENÉHO
637,466,446 *41A4F9DFE2A533C6B8643B200BC838A762738D65 NAOMA9
637,466,447 *41A9AF6BF41CD2FE5C7E727A615B14EF02230A30 NEGALVOJAU
637,466,448 *41A2B05932CFEEFADEAAEB091F2420C8E02688E0 NEJSEMROZUMNEJ
637,466,449 *41AE2922F4FC0D817A9122862CFE812B09E0A2D7 nelmol
637,466,450 *41A519C2412D2AF3D409FA0FD6EA3546185F7885 Night-Nurse-(K&D-session)
637,466,451 *41A067CC23929CD1D114749C5FB766985982B5CC NNSFAAAAIBAJ
637,466,452 *41A784E61A052CD8D8CFF39D99AE34460826CAC6 no.one.at.home.(vanishing.girl.demo)
637,466,453 *41AC3522497A31D1FECCE451DEF34FBF6197E366 NORMANDDROCK
637,466,454 *41ABBAAF164D991CC0045F177C041593DF85BF0D NORMANPETROVITS
637,466,455 *41AEA81A454541880D5A7AFE86440132F913B9B3 norska66
637,466,456 *41AC9CF6B08C14DFFEEFB306B25207A3940CA783 NVADAB13
637,466,457 *41AC96B54017ED83E43F7410AD27C08A2CF05FA9 nwelcome3
637,466,458 *41AFF00C8D812489CC3C43B04E745A1AF19A6E5A ODIARMING
637,466,459 *41A8CFBAD8C4A2615AEB25D67D6AE7CBCD0562E0 ODRADIM5
637,466,460 *41A072EAA572DABE0CE51A951B56C674AF12BE58 olendelcueto
637,466,461 *41AE9AB87BDC2D0E6BF994CD15116A57E9A0FAD8 OLIERBLE
637,466,462 *41AE28A1BD4C7DDCAA548E28DC70D9DBCB800141 OMAR.BADENOCH
637,466,463 *41A1A37208CD084BC2D0B505D187324D6F57A401 omarnebgen
637,466,464 *41A0A8113E71C50AF7BC40CD20C45CA44F2FA39E OMERMCKERLEY
637,466,465 *41ACA1798BD34A470A0D74A137E8CA26EB197639 ONCEMOREWITHFEELING:SINGLES19962004(BONUSDISC)
637,466,466 *41AFAE8B73424219132D45D31DFA063D7586CEC2 ONEDITH5
637,466,467 *41A16767A577CBB7E5D84CFF2EEE809A1BBC5EC2 operasjangrar
637,466,468 *41A4D05852B91217AD45909B7927B1AB02F7CD76 OSTOSH
637,466,469 *41A6AFD13AB36A7CE79EB1BADD4D25C6FD24DBB8 OUTRADE8
637,466,470 *41AD66949DE33B5B862ED4DE86904A74DE7E9CC6 (><)~`@p
637,466,471 *41A98CA3F7AED2DBA38A856B52EF4E1B68C62F2F p4t!3nc3$
637,466,472 *41A40C097EE95552567AB43C59CB1EEF23A507CE Pantoufles
637,466,473 *41AA5C1A674F258C76ABD551CC6DA6BFC8FCBE15 P####D~0~O(0-0)
637,466,474 *41AE5E90FD038952B0CD827B7147BD17D56AFDEF [email protected]
637,466,475 *41A9B263E76F6B1C0262FD9B8D01C203AD9A9872 pentyukhov
637,466,476 *41A49428584A56DA889DE63F8E345199692E9945 pfpcutu6
637,466,477 *41A0A11B39F257B15B21EEB494B52F50251F7920 PIERRE.THUNE
637,466,478 *41A5724F780C9CD8178F457665C9E0FE83F98D41 PINPALLET ESCAPEMENT
637,466,479 *41ABD3BCA71E9CD0F3A1B94DF3F46F238A6AA81E PIPELINE.(DEMO,.1982)
637,466,480 *41A9159A1EEBB9272FA1970ADB6522548D527E90 POLAZIO8
637,466,481 *41AA8419AC11243D370328FDE471FEC09D86EB35 polishmynuts
637,466,482 *41AFEFEBB45A3AB7C922183FF1EA5424EEA1943F porfiriogluc
637,466,483 *41AB71B99B110B07706CA1DC9487BA437D9996C0 PORTEREILBERT
637,466,484 *41AB73A793F0CB30197E75F67950EE08618A19DB Positive.Vibration.(Rastman.Vibration)
637,466,485 *41A847E770DA291782782CE9381948190ABD00EF poster-with-a-view
637,466,486 *41A9C3EDB45934F31CC4BA9430F934BC235E2781 :P`.(#P
637,466,487 *41AED4680CF5460E7817CABD874A6BECBE06FF9B PP.*;)
637,466,488 *41AA4907AE1C64DCFEDE7098083FDFF58B717A1F proclive0
637,466,489 *41A4F9139A3AD61526986BE71449B83A85A7CB77 Q===B.*O><
637,466,490 *41A0020C735A00175FE735F006A992C814A4789E [email protected]
637,466,491 *41ACA7BF0333F7CFB2DE4CC3C60031CD0669DC4D Q##@~OUU
637,466,492 *41AA53A0B2AF36E9598F6891768E88DDF472A2D1 Q######P ~O {X}
637,466,493 *41AB5DA0F74C2056A5ECD13814150CB0547F91D7 [email protected]
637,466,494 *41A83F026DA341F40E2AA332075C2F7FE1800E1F QÚPPÁDH
637,466,495 *41A8135FAF8E4EBE84AF9FF381CD731271819ACE qww1e2rm
637,466,496 *41AF2D9C01F034B833AD64ED0B669761DA993A4A raja-asadullah
637,466,497 *41AC8E9F05DAA1CF1BA19C88AEE4D71EDFD906E7 RANDALL.SCHOSSOW
637,466,498 *41A283511C31A9BAC4D30F633CC2A28A648FD702 RANDOLPH.GUYETT
637,466,499 *41A54BFF8594F4FBBF4D2339D7E17DBDB13988EC RAPHAELCHIANG
637,466,500 *41A89EFCEF63D173B69E992E4BC8072E94820546 RAPPARDJOPS
637,466,501 *41A0513A8226485BC57D97C85DA1472E27D54468 RATIOCINATING8
637,466,502 *41A506D74F0A5E7D8197626730A7FDE77B081B7B RECYCLED LOOPS
637,466,503 *41AE68D2EADAEFA53AE5B4E8F0C1FD47EA644F1A REDESTRUKTIVITETED7
637,466,504 *41AE7BB561B09ACAADFF90F67CC34DBE110399F8 refiner.records
637,466,505 *41A2FEF1D1E3440E0D2507535E9252C504CE908A REGIREKARDS
637,466,506 *41AF45065612703D8C445D810FBFA835FA33353E REINALDO.MITTLEMAN
637,466,507 *41ABD12507A5841E8917EBE4786835C9B9A550EE REINALDOTOOMEY
637,466,508 *41AF39D82FA188ED0F1BA5695B3A282E6078C3FB REKCALSTACDLIW
637,466,509 *41A1499867AD8892E028675D4F6C563EF6E09E94 RELEVART5
637,466,510 *41AB362C8BFA07D2445BF61FAFD6CF312A961B45 REMAI1ING
637,466,511 *41AC69F687A9BB614D1BD3E4D115808D415C8994 [email protected]
637,466,512 *41A29FAAC8568828E9BD398B720958150584D6CA Reordenaci
637,466,513 *41ADEE414AA08BC15F7B19CFD2D5B45B4230B516 reybobop
637,466,514 *41A38A7DFA26208BA36C379107358A7C4D17DF93 [email protected][email protected]
637,466,515 *41A772507EC18AB09D85EC10152285A1A2EB74BB RIGOROUSNESS
637,466,516 *41A7792870F48196B1142828D878AE148726DD8F robotech01
637,466,517 *41A53A4FC60F6CF10B4A123B37E8EF8CBD11B759 ROD.BARTE
637,466,518 *41A8315516AD09E3E83945D9A2FF7BEBD1902E75 Roger-T
637,466,519 *41A38ED6C0537DBA7A8B80D809B2A1DD76AD141A rolandrosane
637,466,520 *41A615F8D276FB7B2CD07D133BF6DD51CF51238B ROMADINOTTE(FEAT.R.SINIGALLIAEFRANKIEHINGR)
637,466,521 *41A011BC9ACD81684960D217014D56E084E0439B rorkwal
637,466,522 *41AA70230E1B47AB3EA504C5798C91562E4533FE ROSS.LAMFERS
637,466,523 *41A738AE3E06DA4911260A639123E25C93B3DF7A royaldefrancesco
637,466,524 *41A2302E944457F3C6B700E81EC8336235BD7FD0 rus+ic4+3s
637,466,525 *41AF55D03BB8CF16044B7EA181C2097312C5DA2A sabusiez7
637,466,526 *41ADD05C4ED10180A56FD34C805A78E82E4E5014 samanthabelmonte
637,466,527 *41A37BB2221662EEE7D1BBEA2F1A52BE869A264E samueladeosun
637,466,528 *41ABD470452D1D781774016511DB5AFCA08D487E SANDRA-WANDA
637,466,529 *41AE4C9F0E2CAD67E5C57A7E83296B74E3CE67FD santosbanez
637,466,530 *41A233495C56769FC6D83DE87F33C31C94034427 SAULJUDIE
637,466,531 *41A032D2AD28E0453D06D2120874C50B93D24F0E scirahas
637,466,532 *41A2089B2E46C6E603C186ED17D137820B338BB3 [email protected]
637,466,533 *41A8075AEDD6D5E879824544D2F947B35E85E2DB SDATLARGE
637,466,534 *41AAA11A69910E080D47022BF11ADCF877B6E663 secret.words.and.little.treasures
637,466,535 *41A41F539872B9D4E8E1775FD902BD0AAF806445 SELONTEKOAED
637,466,536 *41A244F8C0E904A66C514498D92B9A2D4841837B SENIVILO0
637,466,537 *41A5F3C0C3D61FEEF928B8217477B41988CC74A0 SENOR-DE-MILAN
637,466,538 *41A139612885050E8D744588155902B5DFAAD6AE SENSORH1
637,466,539 *41A09DACF255BA6F8019FDD71E8E79D9426F050B sereia(originalmix)
637,466,540 *41A403F12B56C8CA7731D5F4027692509851130C SEYMOUR.LUCCHINI
637,466,541 *41A471BB6C519973D82D434B90CBC818F637788A shadraatz
637,466,542 *41A2731347B59E0606CD81AA1222DED4957996FE sha-la-la-la-la!
637,466,543 *41A7C5002B4EF69512076695D6DE7FB0849AA594 SHAYNE.VIXAY
637,466,544 *41AD3C0A6B6B6B7F32026A58EBC69875F172E224 SHEAFINGS4
637,466,545 *41A27094CDF30F6FAB52BEE466412B6B6C8FF775 SHONHUTYRA
637,466,546 *41A59FA890B921EF0157B71C760A692F1FEB0DB8 SIGNIFICARDES1234
637,466,547 *41A6E0604F42CF6037BA18D7F28AA31E884DF382 SISTNÄMNDE
637,466,548 *41AE6CDD534704BA56B23E19EFE89CCF2D912C3F SKIPPYMAVERICK2
637,466,549 *41A381E33C63C1A779B1F60940B00363C64B278F slue6
637,466,550 *41A4DB0DA460315229FEA4B99953091C330A72CB SNKSTNNGR
637,466,551 *41AEA60E8AA64B60424E884D9844CB63400219A8 SOAP-SHOP-ROCK:-A.-BURNING-SISTER
637,466,552 *41A60CA34158CA5A7834ECC868495451F801A748 SOCKETHUBAPPENDER
637,466,553 *41A44CC59C2117E640FEDF353311E08A8D8FB8E5 [email protected]
637,466,554 *41A18DDD0FEBE711A67E2C60F382CF8D41027449 sophisticated.throughout.the.1980s...They.also.moved
637,466,555 *41A36584DA1268A2F5673E723FD58983651BDFA4 sphrnsn9
637,466,556 *41AB8144F3697A950B7090BD7B14CF3A0F343B3F SPN913S+
637,466,557 *41A678B3508D4D999D0230270E80140E336F7BA4 SPRJTERNES
637,466,558 *41A5D836C7054635AE4C30FA09AF52B7F2920E12 [email protected]
637,466,559 *41A5B1CB8954B6415987529C90B38E9B5081AB1A SSTS
637,466,560 *41A134E75C63485FEA11BCF5ACC2BC17D93318C6 STEALTHSPRING2
637,466,561 *41A97726DCBCE8222C46D1050ADC31FF1E7F48B0 steekzag2
637,466,562 *41ACB1D52F924C05E400D4E67467AAA572CE687F studierichtingscommissie.
637,466,563 *41AD30E0A5EE0052F5CD17250E375A77F57AA6FB SURUCHI-AGGARWAL
637,466,564 *41ADA59E1BA7BC964A7271CAA2B935EDFCF9A758 SU#Y
637,466,565 *41AA6D0683FCA018D5930B431087C9588941913C suzhousamsung
637,466,566 *41AE73324068177EA962525E4BA5A3BABFEDB528 SWV37S
637,466,567 *41AB56BB8C633D636D11CBC5F6B58596DBA2766C SYDNEYSIMPLES
637,466,568 *41A45AA7A5AD8B2BEAC2AE2D2441F26CA0FFBC12 SYMPHONY-NO-6:-III-POCO-VIVACE
637,466,569 *41A88E061A34A17A185F129CA18266ECDB6B57DF syovar
637,466,570 *41AC90D728188576FA5EE9D075E61D3BE2FCBC61 )t
637,466,571 *41A70D416779A8B850BEB390F89471263DA1C920 [email protected]
637,466,572 *41A11B6595BD2E710669830902D533738B265A85 [email protected]
637,466,573 *41AC71708A780C826BED4E222CDA6F87F5569EA5 [email protected]
637,466,574 *41A8C90BB642677CED87020511B43A42A6430398 @TANTALUS
637,466,575 *41AD8085D1CC83BE2C83DD1E83BEEABE878E433E TARRICONEBSW
637,466,576 *41AEFE2A86E6089E2F826CAB957E9560FC2E01B2 TEDDY.KEINONEN
637,466,577 *41ABE1E6B55478273075CC4A9FCD1335EA1AC700 TED.ELLERT
637,466,578 *41A0555CAD1DEEF1E23B39F7687A8CB3A07B8089 tegepdu
637,466,579 *41A3BEEDD5196B3712C0F7DBF84237C906FCA47F terrorsequence(d)
637,466,580 *41A7265FA16E4FEAEF4583A230A7E7B1316B22F8 thelindsay3
637,466,581 *41A53773925A4AF8F257F76454954E110115A113 TID$BUND3
637,466,582 *41AFF7C3B361EA840CF140D8A8D2BBF5252DE3BB timochok
637,466,583 *41A8C28412CF2302F24FDB990CA0AC9A35A1A84B TMAILUK4
637,466,584 *41AB3A95CD1F84988B96CE933800157A41EEB067 tnerennosiarra
637,466,585 *41ADE71BD83BC743CFDC53C5B857B90837E95DCA TOOLLESS7
637,466,586 *41AF4BC29586F696AE19584DA0AAD1947D93AD18 TOPOCK
637,466,587 *41A3A4053644D11773B118C973962803CFE6E2E8 Trans-Fatty-Acid-(Kruder-and-Dorfmeister-mix)
637,466,588 *41A274427932CDD5FC1887B77530AA91E02D42BB TRAVISBWALBECK
637,466,589 *41A8EDD30932E255A02BE110DA5B0437140F8C9E TRAVIS.PIPPENGER
637,466,590 *41A1D787CD942011F808CEEA5A0FF58DD6A9C636 TRENT.HOOTEN
637,466,591 *41A7ED998F3F4DE4359125D5FF7F79B8A58525F3 TREVORMONIOT
637,466,592 *41A90AFD52D23FD43E60A84F6C47D1569D9EBD33 trouble in mind [richard m. jones]
637,466,593 *41ABEDD1FA2596A12AA52072536068F131CCEEA8 TROY.RISTON
637,466,594 *41ABB190B2C60202C69AB5478E5BC0105B935299 trucking
637,466,595 *41A922CFA9B54B22C6BA4A77E811BDAD2BAE1A86 TSIDONYSING
637,466,596 *41AD7B5F56D23BB1558A59EEE04AA8A138F3C8FB TSUBA.HIKARU
637,466,597 *41A871B4664BBA81F605CECFFD9B14CAE9029095 TTESSAH
637,466,598 *41A98151C9DE0ECE604100E46427549CAA14F657 twistedbythepool
637,466,599 *41A02D013BF191FD8720F7103782829841FF822B twohourstraffic
637,466,600 *41A631EED7ED27B9EF6AC6077902E32AE4E6C85C ud}s
637,466,601 *41AFDE8977FBDB33A2C511770C2F09D5526BD6FA unfuehlbbed
637,466,602 *41AADE4E41DAB1718F18B50D1E716BA66FC1B230 urmila-tailor
637,466,603 *41A84B65EB5165E66E64633DED02648D31B4D914 us42.6911785.41586
637,466,604 *41A57DE03B1CA2606CFB4ADB5B969C70335828BF USTR(2007年7月19日閲覧)
637,466,605 *41A75D065E000E24D75850737907BE0DC5014830 utsportscstvcom
637,466,606 *41A13479B6125932F04B09419F1DF4519798E94F uu.o~(###b
637,466,607 *41AF110489406165896C11AD372C1D063FB17628 v0605859
637,466,608 *41A7ADE499F6BE29D8596A586B7DE812B66FEC28 VALENTINEBERNASCONI
637,466,609 *41AAAA5966349436F842F8C2EA718F0F6C1D6084 VALENTINE.HODGKIN
637,466,610 *41A2C8E89FAA452AA5007F6DE0599FC1E0B8B8D8 VALERIARU
637,466,611 *41AC61288CD8F28117FBDB1BEB1BA8D0FC4F4163 vantril3
637,466,612 *41AA1D151419CB75C240CC626C6A3DC84DC8B1BB VASTUSTAJANA
637,466,613 *41A51D243F6EA7F547260C0B9B48BC7FDBEF93AF VAUCHERIAE
637,466,614 *41ADF9058BDC1771776F2C010353F816E9037CD2 VELMA BRITTON
637,466,615 *41A162C618DCA6005FEF88E614C911AD329D4E66 VENTANASCOTTSDALE
637,466,616 *41ADB3351BB78549F83633C9D228DE8AA7EDCDF6 VERONICA CIVITELLO
637,466,617 *41AFA05F2B1E38DC9177E0F1DAA6DAC2A23DAA76 VERSOENINGSEED
637,466,618 *41AEBE31182191F274B705CF4CA410F7AFB8FC8D VETA W
637,466,619 *41A630BC25F90E4B50A55A9665FDCDD24CF5C2F4 VETTEMOOMOO8
637,466,620 *41A112433DB2C10589056DA164EADC3C182F20EF v{i0
637,466,621 *41A9ECEB62573239C6C8913384548F0D3439E47B vicki.deadrick
637,466,622 *41A1BE52E15EA3606CA2F4264154B561D5455015 VICTORIA.SHISHKANEVA
637,466,623 *41A6E89D7D8248B4FFBFC0E00D6ACD8A00B4D9D2 victor-maulino
637,466,624 *41A3A89F6082160515F2ABAEDD52937E5AEFBB0D viewsdacy69
637,466,625 *41A5B4A84DA8F63E0A3C43CB93C84396BAE9C715 vinnie.testa
637,466,626 *41A42AEA5CEE0171B67EA39D53B3B53AF50C962B VINNUEFTIRLIT
637,466,627 *41A2B63659A8EBE7F2C2582105BF931173A290D2 violoncel5
637,466,628 *41AA0EBE41C6D72048423F83D7F49CE618E2ABA3 VISITELMORECO
637,466,629 *41A481FBBC21D7ED3AEE9EC6E9E86CC88A51A3CA VNTRNGS2
637,466,630 *41ACFEA534A1E4BE4BEFA80BED9253D2C6B8780F VOISE
637,466,631 *41A9AE8DC56E49D6FF9FB28C100E7F1718BF87A8 VOORBEDACHTELIJKING
637,466,632 *41A12BAA7BA91B501AEA914F43EFABD56C9E392C VOTERONSES
637,466,633 *41A9EC79A59958B1B7ED2D83AB311594BDAB7994 VSOLLI
637,466,634 *41A48CDCB37AFA242C7599B3C5A1433DF1123107 VS%Q
637,466,635 *41AB26C75BED9F91204CFA6C47A907D646DB90D3 V%T
637,466,636 *41AA9FA4BF5FC146EB48AD68BB5B172674D4CF04 wajiha-amin
637,466,637 *41A2D90A76A8508437BC570B4A8674D26326DFBA WALDO.WESTWOOD
637,466,638 *41A277AF12E97D811E4330BDE118D785F57C2A7E wallacerunyan
637,466,639 *41AE4C8BEB8E4BC9352D30BD1890FD9EE335F7B8 WALTER.BUCKELEW
637,466,640 *41A38BC9E19C73AAEB427C9B809B7A676979C9A0 [email protected]
637,466,641 *41A66EF97942FB4072167202A0A61C6145B68F04 [email protected]
637,466,642 *41A085900DF3553B6522DD0887DE278E19BF126E WARRANYU-WALTON
637,466,643 *41AC9DCDBBB67CD1A24BA3D87FCA125BED04B78A WARRIORSSPECIAL
637,466,644 *41ABD0FA2E9F62BB4F6F39EF1849B2CFCD6044E0 WAYNELOUGHNEY
637,466,645 *41A140F839B0E8D47AD224063986624AF723BCA6 WELLBANDAGED123
637,466,646 *41A6E50BF23D15FD0E715DADDEBA5741911BEE92 wendy.dugas.perez
637,466,647 *41A03E22799FEF3D73D44C2FCF04EF7EBB3BF24A wendy.kelley.aliaga
637,466,648 *41AD9116F523CD353E7DAE0187A2B01AD0B5F55F [email protected]
637,466,649 *41A93D4126401E1DD85E5C35B8F9FD638D9EDF75 [email protected]
637,466,650 *41AF0D6E4740C631B236FC2A36EF1095F62093F7 WGGGTNN
637,466,651 *41AB873AB8F1E0C1E47B2886AF09C4E2F1C2E337 WHATIWANT(FEAT.SLASH)
637,466,652 *41AF72D29F2D4DBB075A4CBAB157B78FABFC1F7D wilfordgravett
637,466,653 *41A8D3DB7E44CC37C3ED7BFBA0CEF880CF7F6605 willardbierbaum
637,466,654 *41A75B33B58468A491BF7F68905D09A02AA64A3B william.dock.walls
637,466,655 *41A9AF7F2E3F7B668A7FC54EEA21A29641603A05 winfredscheets
637,466,656 *41AF8BBF2BA881EA345A5A5163A239FE69916C20 winterpeter
637,466,657 *41AF2912587BC5F4BC3CCDC05DB63A5BB7F53816 woodrowlibutti
637,466,658 *41A8A13ACC852D37771CE51772BF19F7F83DF149 [email protected]
637,466,659 *41A8004A051E53E82B2631E5158F8EC78024777A WWW.NORTHPORTGIFTBASKETS.COM
637,466,660 *41A56658B04A62958782D404BE35494BBBA1DA02 [email protected]
637,466,661 *41AB6BAF00C93941E16360B3597147B2B05228A4 xiek[email protected]
637,466,662 *41A443DC42764FE00037B3BF7D57DA49A6A0E671 [email protected]
637,466,663 *41A19C8F700FB1EF871E018A2399AE2198F55F40 [email protected]
637,466,664 *41A749F4EA9A957325CF87F2FFF5165351BA8288 [email protected]
637,466,665 *41ABCE7913EA76156EE37E81E4B3088CF0B2B0C1 [email protected]
637,466,666 *41AE2340236C329A25374ECA92B2EAEFAB1B2A6B [email protected]
637,466,667 *41AEED16156C1C67DD1327BFF3F9BAE5D05D5643 [email protected]
637,466,668 *41AA40A61BB0220CE8C20101FFEC76B3CEEBE9F7 [email protected]
637,466,669 *41A36170D77D0CF5145C2A9EEE57A1138864F138 yarly-romain
637,466,670 *41AC6333EF1EA5DC53A49474E4C2FB2DEF70900E YEDDAMARYMRUBIO
637,466,671 *41A86A71153A288BB9880E00CC2F0DE3942538B5 YEGAROVA
637,466,672 *41A331C6EE0FD9C6412E507AFA9FEF9B481B3647 [email protected]
637,466,673 *41ACB0F690559ECA2B36186ED184C1A4ACB66010 YLENMELOS
637,466,674 *41A7695BF2637D99A7FE4B016699FBF5F27DD79A YOGIJAAT
637,466,675 *41A1FE41A6376C53BDC75DFCFE7DFAA2A3B83999 york-laderius
637,466,676 *41AADA857850D50A2B89A69DFC01D41268D7F946 YUSSUFUH-AHMED-SAMBO
637,466,677 *41A1750B915380AF32C6756579430B90505AF2DE Z13357
637,466,678 *41A50CD272F95CB9CC2A48F6CBC81A007D0688C4 zackaryrary
637,466,679 *41ACE2EFB574FECD1586C91AADC5B894B43EC149 ZANE134
637,466,680 *41A663C3A23303A20FEF83B340363852F727507F [email protected]
637,466,681 *41AF391124A83FEB9899A9EB0E2D5C640793E69C [email protected]
637,466,682 *41A1ADB4BD42479D01DA35512C5688B9EFC626D4 zhenowi
637,466,683 *41A447ACBEBC5A40B0C711961C19DDF29D49F724 ZINOVIEVING
637,466,684 *41A9BB77543CEBA3EECB1CC9C25EA8A593643D64 [email protected]
637,466,685 *41ADAD355BEBA93C84AEB4C63245C9B91D850EC0 [email protected]
637,466,686 *41A47DE32FAEF55D192CFCBB64DE4BC61A306784 [email protected]
637,466,687 *41A3D014FFE2EA0149317AD061354EE0D7949F5E zuhaltet8
637,466,688 *41AB5DFB35EF9189098655F1C86DD7AD3DD8B4BB θασιρὶ
637,466,689 *41AAB67A832EF3AA180BB784FBDD49107CD1884D ΝΙΌΝΙΟΣ
637,466,690 *41AB9D361A97A8CB464DA15B871AD33B0923D802 АЛЛАҺ
637,466,691 *41A770EF42F7A7E65AD66E4AF833E01ABC90A8A2 АРАСЕЛЬТЬКАК
637,466,692 *41ADAF6198405F72C3ABEB8AAF4423CAD5B28A86 В1917
637,466,693 *41A3330F0DABE6D90D4D06933D4BA585B358D06F ІНЩОМОВНОГО
637,466,694 *41AC9199B1FFA469BC10F4D81A47715D0B8131C2 «КАПСКИМИ
637,466,695 *41ADA2ECF9734550FD23FA6D3DDFF5A1A65A0F7E КОТОПСА»
637,466,696 *41A0E44561472DFEE50B702A9376D94D3BD5BAC0 НОГИСТАН
637,466,697 *41AF2839665879067F1CC624343392725A4B5A0C «ПАЛОЧНЫЙ
637,466,698 *41AD773BBB51912E80F88E0D761B8E2F525DB44D ПРИСОЕДИНИДОСЬ
637,466,699 *41A3CCA953835D5B47DAC1B72B934CB99ED0752F стимфалийски
637,466,700 *41A714F56C90D049C00385B935EA17683D450769 «шарап»
637,466,701 *41A32927BE2AFC27CC73DC185BD90D3E9334DFDC 109578 KAISERSLAUTERN-,-8-.-JANUAR-.
637,466,702 *41A5D04CD8B791F71EDD4668596A79CA22DAE8A3 110602B
637,466,703 *41A92930D7DBF942697839CDB6605B7A201945F6 1191112 LASI KOTITALOUSLUOKISTA LASITAVARA VIED
637,466,704 *41A1D8FCAB94FE2784341C11C0C14CA7E8CB86A4 1268944 kytkimientulonjal
637,466,705 *41AE10027F8D6B250DF16AE0C5EB8BF8C30F8C72 132079 d20uudenmaanliitto
637,466,706 *41A049297C78B1AB9EB19017FEBE218E958F5AB8 1348829 DARAUF.DREI.SCHEIBEN.ZARTES.KALBFLEISCH..
637,466,707 *41AD27C889270DC6A04CA7704F06B696CE66F1D9 1975-09-23:.TANGERINE.LEAVES,.VOLUME.67:.OPERA,.REIMS,.FRANCE
637,466,708 *41A525158057F32BE4B15804C0E97935E6D473B6 19880526WX
637,466,709 *41A85095EC61AA43B3DDC2E9F6A6298F7A6299F3 1999年のj2加盟時は
637,466,710 *41AF6CE665EC8B74CA251AB4BC9731A875A03F92 1avainsyy
637,466,711 *41AAEA15D3DA1352AA167D71729F3376A3EDE648 1 BEBAUUNGSPLAN-ENTWURFES
637,466,712 *41A9B7EA0F7D176915AD18DA728806613B9B7E5E 1.BRUSTTASCHENFORMAT
637,466,713 *41A21E1E624237FE91C820EDAFFF84C465E07BE8 1.chromrak
637,466,714 *41A7F3A7FA45C3496766FF1E91572B59D2062EC4 1CODE-NUMMER
637,466,715 *41AC1001615FBA33498B6A323E309F969012311B 1derrumbo
637,466,716 *41AEE11B8A867839C28E50B7563BD25025160A57 1 HOBBYRAEUME
637,466,717 *41A4E423C3B8B08DB8807272A966A674116EBE30 1ilmoittatumislomakkeessa
637,466,718 *41AC6217756EF45B3BEDE738AA0B53B9682863D2 1 JIMAR
637,466,719 *41AD226FA123996FDA1E86B127A6C615DD6CB7F8 1-KOMPOSIITISTA
637,466,720 *41AEBFA2B1DCEF88DC91206FB7EE2A3D422C43AF 1 KONVENTTIMALLI
637,466,721 *41AC00AC710BCFB4182EFDF29A7D0EDDBC7B0CB9 1.mailertarvitsee
637,466,722 *41AC3C64528F07CAC1D5EFC2700FBB325211B853 1MARKKU-LIITTOON
637,466,723 *41A37B6B377C073137F05FBBD73769036EB2B9B8 1MI1
637,466,724 *41A2A8E1E1E7C56698E2E4F1F0C8AA201D273B93 1OFFICERS-ANIMAL
637,466,725 *41A9519460B7B2EC5FF591C677B8772285A621E1 1puhesanojen
637,466,726 *41A8E6E87C45C9BB68CB201DF75B79C5B86E0EB8 1 RASTLIYACAKLARI
637,466,727 *41A3C1C2CF6B32F33585F8CBF5C19EC6C0290BF8 1.rnc-vertreter
637,466,728 *41A168A2B6EE389C12D3AAFCAE16A9B6174C5DB8 1ROCKAREILLE
637,466,729 *41A821057E44F21AA232D16DC2A09B22AA8FF0AB 1SANJOSE1994
637,466,730 *41A9CFAF1E2D074AF6B74CD9A7C43090CA1F14B2 2049298 IV-KOKONAAN-ERI-JOUKKUE-
637,466,731 *41ADD90AAB3FFBAF50AD6ADE80610A875058DC8D 22-08-1063
637,466,732 *41A21923F71DE416C08D6EE6D7F803388C04642B 24.FARNINGHAM
637,466,733 *41A33C4356DB4D25DAAF43A26F01B35EF282707F 253C199912060041182311800000635
637,466,734 *41A3789DAE98DD9CB199C01DE8F6A23F436849D2 2698832 MAJOITUS,SAUNAJARIISTARUOKAKUULUVATPALVELUUMME
637,466,735 *41A5A6580B0CED2D1C8B7F115C6472E09DE68955 27 BEET
637,466,736 *41A1695C6C4E10080952CD752C3C7D5DBCC7DA0D 28MAR1846
637,466,737 *41A5AFDA6B1FCBAB8CE2514ED121E1BF64E42040 2-AKIYA
637,466,738 *41AB828414FC1D7F188385ED5EE48BE4B297B7E4 2 macintoshtietokone
637,466,739 *41A0B4006F824F7C5D24504E47358280E2B386C1 2SCHLACHTHOFAFFAERE
637,466,740 *41A4AD770C43DC2131FAD6599A8A67AEA330000E 2.smat'In
637,466,741 *41A655D60BD9841C208AE3C44533BEDC79D7611F 331899 (.TOPLAM.1.ADET.LAB.).DIS.PROTEZ.,.LABORATUVARI..
637,466,742 *41AD76E6DED3E3516D9ADD6F245C0B76CEDC13A1 33.MELIORATION
637,466,743 *41AC18A58F0C366F4B13E66AA6BEC1CB7B026038 341AUCTIONED
637,466,744 *41AB2C80F3C7E64801CF0F6F1BD9C567B8188F55 358505 "-WIR-SIND-HIER-EINGEPFERCHT-WIE-DAS-LIEBE-VIEH--"
637,466,745 *41A5FC336713EA7C4CA94776EDEB033BBB74F5E3 386279 suuri oli simeonin ilo ja ihastus : ja tuostapa hyv
637,466,746 *41A2FCC17EB7AE6CC27163A2FFCB2C2B38FAEAF9 398443 BUNDAN-BOLUCULUK-DOGMAZ-,-BUTUNLESME-DOGAR-"-DEDI-
637,466,747 *41AAE7D31B8DB92CC0D7C5D4CFD16E7435E4EC34 3##B.~0.Splat!
637,466,748 *41AF2C0D3523A70D90316364A195CD14B7F19796 3B<--o~0~-<#####B
637,466,749 *41A49D2E93D580F251381D01D11AF252228CCCB8 3IGMAT
637,466,750 *41AC60B33208388FCB7BAFB669BCCA71E988D0F1 3-RAHOITUSL
637,466,751 *41A72C699CE6E8B3A95F45BDFA239655D337D6EC 3THEDALLAS0
637,466,752 *41AC1372270D608A311A260D77C137E3C89B3858 4BENDOLPH
637,466,753 *41AED07C49992D17DA5440164350D6928A42FD4E 4KENTAURSKOM
637,466,754 *41AD98FAE873EAE2D49A54F4C246A0FFF824AD4A 4LUCKLESSLYV
637,466,755 *41A37B9410FC8A19487AB5C903FA23FCFE05E337 4 n
637,466,756 *41AF3DF44420ACFFD2B8D39B43306B2BC923B154 4SPRINGSHORTY
637,466,757 *41A029A557F8D77EA2743E30E3B60EC86BF0A7FD 4TILANNEKOMIIKAN
637,466,758 *41A06017FE29753BFAECBABE3FE9EE0764FF5827 4TSIRIMWKO
637,466,759 *41A6CC4CBC1332ED22BC6C49B8C9DAA37E178B62 4UNGDOMSOPRRENES
637,466,760 *41A3F098E9BDAB9E73B48B1CA71152328CD92A6F 4WOOFWOOF5
637,466,761 *41AF48EFDEA268CE2EB42A9C12F68BAE5EB5013F 4ZAMWEIZI
637,466,762 *41AB2E8DAEF4766F98D646958CE3F54FC966CD57 50 SIXCOUNTY
637,466,763 *41ADCE96C6EA99DD8F721DA0BABB4863B9D7898D 544ARI
637,466,764 *41A1579CD02085666D1870F40FCB422815B907CB 552393 bu-is-yapilirken-"-boynu-ve-kollari-uzun-olsun-"-denir-
637,466,765 *41AFD6FA5BDCB9FFAE9A2FD0523739A825192173 564779 diedeutscheeinheithieltdieseentwicklungnichtauf.
637,466,766 *41A06E96E8E6DBA5D9690DB9C6F871AEC77EC17A 58 HUHTIKES
637,466,767 *41A99B88EE9CD304FD44037FE7D2F746D69B43D4 5BSWYACHTSME
637,466,768 *41AA3FA691FFE947A9E6EABDE02F75BF188372B4 5CROSSETTE
637,466,769 *41AE61E978336FB84059056AF4A608574C7A5FD3 5EHCELBZR
637,466,770 *41A35AFD6D24ABE19A9C2771E274A9E28E6312CB 5-ELFER-FELD
637,466,771 *41A1CFDBD72864A1BC63763533D6CDF1FB551F03 5JACKDALLAS
637,466,772 *41A60F6BC2B8AD681CA28129B25A445E8E7179EC 5p8gp1ag56z7551f
637,466,773 *41AF25C49707D67EC58B4FA32858E777C4EDCCFD 5PERITUSBSW
637,466,774 *41A2106D7423F5B1895FC62F8081FBBBC55055EF 5UCESNICIMA
637,466,775 *41ABAE1D0CE33C751573544D332800CEAC53EDA6 5WATERKOUDS
637,466,776 *41A8603D4C5D2D4791609D32C11529D69A6F7878 612KINSLEY
637,466,777 *41A1664AA73DB06EC300239122C934BC7DF6229C 655727 TARINAN-YMM
637,466,778 *41AC518AC8035DC3B5CE5248D9D53DE4E4388882 6ACUNARAS
637,466,779 *41A0B0BD055A41402CD8EC574D93C6B1DF2BFB58 6ALIQUANTA
637,466,780 *41A086FE3EEB47A784BE8637E74C4FA92B5DFDF6 6BSWIMPROVMENTS
637,466,781 *41A3C1C7DB161E030C62C4E588C3373970CD5516 6CRONEENORC
637,466,782 *41AA75077B6003BD80550991BB05F9CED8871600 6JOZYJOZY
637,466,783 *41A6F666D02DD8B536E5129F4AD655366F8EB549 6NKBOREMASKINES
637,466,784 *41AA2DE70C484148F9049109712D606F82524306 6PRBTNST
637,466,785 *41A4830A1A3B8D4A336ECB3E63F1E43EA2BBF572 [email protected]
637,466,786 *41AEDAC193F5094D2ABE3D3E8950C2D0209BEB98 6TVAJIHMAGAH
637,466,787 *41AC12FFC124250FBC5AA970E3A4B412A4B663AD 718054 yl
637,466,788 *41A682828D445DA763F1D7BCA283BFF6BBC14166 73UUN
637,466,789 *41A8D307F0A24EFC8613EDE060FE6D0A7F08C2A1 7530 kannattaaollahuolellinenjamerkit
637,466,790 *41AFBDD6C49DFB13D9E3496F48A68CE08EBABE52 7DEINENDES
637,466,791 *41AF2648319DDD727DB64BD58CB8D3ADF93FC110 7EUPHUIZE
637,466,792 *41AA5D2E582FCA661500604424EFFE679FADFCA0 7POENSKA
637,466,793 *41A059E958FB1CD8D7D1E3E7C9EF78801BF9DD37 7REVIVALIZES
637,466,794 *41A308AE0029FCC1CE72A271399EF06FCA58F5B5 7VIVICAVIVICA
637,466,795 *41A34428D433584F1757087D2BB4A2F1FFBAEF45 816555 SERIGRAFIMAKINACESITLERIVEKAPASITELERI
637,466,796 *41AEE542C53C25ABEDBB541473B8871FDD6018F0 839stanley
637,466,797 *41AA003967BA986B1F33B222457401DF144966A8 8BOMBOLOS
637,466,798 *41A7084ABB622908F57E445E1BA56651183ED04E 8CONNIESAILING
637,466,799 *41A3488B6E629A74DB2B5B34A2626A312CC788CD 8===D~O(0-0)
637,466,800 *41A72DB07AEECB489D0292007D6FC1C7763EF9B1 8FIRMLIE
637,466,801 *41ABD10523FD00B30E299B141AD4FDEEA36C7826 8HOBKMCNL
637,466,802 *41AB29A49696527F62621CE16968DA68BA39AB20 8hoofdsom
637,466,803 *41AE54D3E5A38F8422EE3F01FA55DF2F23B299F0 8NAPUHASTE
637,466,804 *41A976A292231061F0407CFE525BC03A5C40E6BE 8--P~O(0-0)
637,466,805 *41A41D580147EB1BEDD837A557DE85D55A54CFB6 8SYLVIEDOUGIE
637,466,806 *41A5992175AF3F7FA99A28D463D7794CB132E8D5 8TERASINE
637,466,807 *41AAFCCEEFB8EF1DCE0AF08D8E634103F77B9506 8thejared5
637,466,808 *41A6B7701DE7BB6553DB9EE587FCBDE5971A2CA2 9BSWMOONSTORM
637,466,809 *41A2EB87CD8C0F27ACA3ACDE4CD1D2677A0CDF20 9DARRENSTAR
637,466,810 *41AEA48BBB320E2FD5B4BCDB5BF89AB76846A259 9EZOLNEZEW
637,466,811 *41A0A2A3B83ECE257B9D514567A551CC922B556B 9FUTILES
637,466,812 *41A20EDA4AFB441C42C5676748B139A93A973348 9SAKEENNEEKAS
637,466,813 *41AE21CF6022DBF36E02AF34594514B61276F338 9SZUPERNAK
637,466,814 *41A9A53E8467B82BC402AE7B338AA26D20B2C2BA 9TECHABCD
637,466,815 *41AD79373667AD158B7D4BCD56BB8C25F88D800C 9UNDREDBSW
637,466,816 *41AE9E843ACB3664F7A5B39F5A628C458AB72F50 a1:ff
637,466,817 *41A0225D502016270E1F95E800751568AD713F8D A4XNR
637,466,818 *41A505123A70B684791C48FBE30559E19335F29B ]a6aaa
637,466,819 *41AC9F46F4A0F5108CC68B88E9B21C49A0B28076 aaa8&k
637,466,820 *41A653C87C55643D02F38D0321EE61D72BC4B4E9 aaj?
637,466,821 *41A327D1E7B4E60087A7EDBA0E85C77C8C2BB282 aba_2
637,466,822 *41A6068672C23DBDCD0AA0FDBDBC1C1BF6CCBDCB ABOC2
637,466,823 *41AE5A69B12F2745BD8888274C2650AAB0C1BCEC abuf<
637,466,824 *41A65436E8259FA0172E9AD382C12758E30CD694 ACKOJ
637,466,825 *41AECB93156A8A2153CF0AECD16F133D70BBDEA5 ADAN.KAPLUN
637,466,826 *41ACA7F1D907E57348FBD74EA7EB93BFD8C8991B ADARREM
637,466,827 *41A60E4B61111FAEA5F126D736377B09A9FFEB08 ADK
637,466,828 *41AAC1BC034E17B8B12678525F123E0B8D08B10E adrianjeanbaptiste
637,466,829 *41AB040D143407FCED4CC1431DD6D824F443B1CE ae6wu
637,466,830 *41A87CFC2B141DA1E5E471B23D8DC2139C4C1448 [email protected]
637,466,831 *41A4B01EA6A60E336E8E01281EAEDF39559590D1 agotagob
637,466,832 *41AB8B180706CA26813C7A7A8C3F605ED20E8E6B akkeknah
637,466,833 *41AD518B0FE7D6BA399757F6878DA868FB2E495B AlexanderBaker
637,466,834 *41A1B97658A8209164C1FDD0BE1D4F231A52C548 [email protected]
637,466,835 *41AA5C51A910204826DE40ED6ECEB6A9D8E03CA0 amacrina3
637,466,836 *41AAB277ADA3FCA5F3D41F4F8E722256CB40D1FB AMESFR
637,466,837 *41A22B2B2932297D371A42CFC181522FBF64A3B1 an2=h
637,466,838 *41A64B07215D298B1925283BD1B0D778D6FE052C ANDRES.DIPRIMA
637,466,839 *41A017C8334FC6504FAD95F4C88F85C7F65C2514 ANDREW-MONTAGUE
637,466,840 *41A19D29858801867E7AD1A7A4454906BA28CB80 ANDREYUK
637,466,841 *41A89E61910CCDEC41E83B1CB65A3E4DB3C48696 AP=/:
637,466,842 *41AFDE0B7F1FACD03DEAE647B3613CD4D64CE125 artoverkamp
637,466,843 *41A952362F9433FE551FA66DC99999271A217A14 A$#S
637,466,844 *41AA8A9376FE86968907DA71EF2AFC8E570E6CF4 a"sk8
637,466,845 *41A0540DC156F798FC8D52FAA1AA9F720C6F4F56 assholeproperty
637,466,846 *41A8CA46335A5F8D7D61FDFB8077F4E268BF79D0 ATCIC
637,466,847 *41A98499CB5EB7219ECC5D1ED7FB1EE48E143C9F AVERY.KRESKY
637,466,848 *41A03E8BCFE6BCF472334BDBD58AB0FE5E8926D8 AV%+U
637,466,849 *41A092023859E01601F064170CBBED9C47FB863F aw_,g
637,466,850 *41A11982D1EDB498092C21B7E68B9E1AE69856E1 AXCQ(
637,466,851 *41A0EE6B4F4FF42D8A37BE303C2FBD75512B6B8E >B0*.*(======3
637,466,852 *41A5BCC7ECADD6329234B1669240679418F28599 B0P9M
637,466,853 *41A2B2F8D59ED934E293D085A9BE477488F07AE8 b3)cc
637,466,854 *41A0F4FF0E580D772D51017DCB04970CBADDFB1C b3uoe
637,466,855 *41A3E170AB941D46301AEC3EFF56B4956D418283 B4MDS
637,466,856 *41A4E6982A3AB2A3AA380E21D817032C3BD18FF8 B{A5
637,466,857 *41AAA40C2F92E39C26BB9E46085C97B1D3B31737 ba=ew
637,466,858 *41A8D646039A3928254B7D729105B6FDB5543ED3 B-bL
637,466,859 *41A7512AD166634017759B766F3DC6310C59E3BF BE:DT
637,466,860 *41A9E4C9DEE56E7BD1174FDF2A9E2AD87A96A6AB BERNADETTESMYTH
637,466,861 *41A24DAA49B5C01D92F4BB54088CEBE1A3512573 bernardbukowiecki
637,466,862 *41A3C0254E308FC607FFA0E5C43D18221FB1C797 be?&u
637,466,863 *41A61A2F3F0E6C9334FAA379D5DDFF777C7BFED0 BEWEEGBAED
637,466,864 *41A270FC687E3893E7C4596339D112FE3591A1AB BFNRTXWS31
637,466,865 *41AA9CD2DFE636822716A62E4BDBD690EDD14106 BG,G,
637,466,866 *41A12D09CC1A288B332E920FF581BA67DEBC63E6 B-HU3
637,466,867 *41A781236743A951F5E57C41D5E3AE67698F92DF bienvenidosaattica
637,466,868 *41A8BFD4876BDAD0937395C1BAFB2CB4C03A686F [email protected]
637,466,869 *41A3EEE330B37FCB69730F79DAC119ACDDACC3F5 BILLY.GUTIEREZ
637,466,870 *41A57B6E914956DE6BC50C3AC1E77BE6C2404146 BILVA
637,466,871 *41A01B4202B421E1BE5D14196038F526FD499C97 b)j?
637,466,872 *41A2186C4B48611E7DB80D8D2ED0FC3C74CA070A BJ:P
637,466,873 *41AAB5E9E9EFE96BBFDC454E210AA2A003CC71EE blackcelebrationii
637,466,874 *41A42DB7E96AA3ADF2EC9D7ECA85933F85AC02C7 bokfh
637,466,875 *41A801565A8B31026F19E7492589E340EE046CD1 BOWELED
637,466,876 *41A3794865C4B11482E3D4094EEB499480C006ED BRAINET4
637,466,877 *41A0A89DDD4AC8F60302043E976815567EA54656 briguerait5
637,466,878 *41ADAD53309DD07F5169F3CDEBA353BC97BD1FB3 BRTW%
637,466,879 *41ADB0C398806B94293AC861281A1922C643E08E b_;tq
637,466,880 *41A19D924E039AFC8462546C90328041BCA8BF59 BULGE8
637,466,881 *41A98BDD3B7CD8BDC3BB36AFB0506F27B6ADC978 B,,VS
637,466,882 *41A6095BDE09B201F93B95B2C9F68367FF516F79 bwhrf
637,466,883 *41A04FA5FE44AF5F8B8C942717EF5862929109A5 b$xl
637,466,884 *41A6740BD53BFFDE2F125AFE9FAE356661D151D1 C0LP.
637,466,885 *41AC6863B48AC8A6372C57210E055C61B38EB69D c5rmn
637,466,886 *41AC32BB88A072D78C3681D3FFAB763F768E8A34 c8#s+
637,466,887 *41A62B717BFF71512873DE5938DCBCA21AEBD6D5 c.9u!
637,466,888 *41A7EF50E344C7217C21A58371DD45887D340613 CA7X1
637,466,889 *41AE12B732DD9C905B842046D34BBF4A7D794F96 CAREY.CARIELLO
637,466,890 *41A479A7B4474D7D45DB8E3DB2589AB51A77999E CARMINE.NEWITT
637,466,891 *41AFB5CA4EDE2E4FD834A5F056BCCD32A317CB0C carminesantini
637,466,892 *41A3133777F9BDA85A6219F9CD5A0A2EF1448BAC carolyn.lilly
637,466,893 *41A159953E3F50BF3765A5C9C5816E988837FDDB CARROLL.MITCHEN
637,466,894 *41AD4A173489E88A37B3F685CE9432ADB02C5337 CARTERZAHORCHAK
637,466,895 *41A1782F4C52E64808FEA5F46529D7C395C758CF C/B%
637,466,896 *41A18D8E1A7EB832C3EE9B6CC5E3ED0632EC9B25 cc9af
637,466,897 *41AA0180921692716FAEF777F59FA21B584ECD8A [email protected]
637,466,898 *41A6DDA750A303759C975015951D6E6B2154FFB9 cco&
637,466,899 *41A0E216EEA87F5780378FD4B4D39A7DE5B256DB CEINTEC
637,466,900 *41A8BBEBFD233CC2956431960F9B3D793FF8DA02 C-H3D
637,466,901 *41AE7960C88D843C877E2ED4A66F86AE2DCFEE87 CHESTERELIASEN
637,466,902 *41A27AC56FCF1A68AFCBEB333A020AF53BCCC458 CHGE?
637,466,903 *41AA63072088E2D5C69B8EB65FE5EDCADD0FE36B CHPQF
637,466,904 *41AEC42ADEDBC51043C89572A0263799D1AD29C0 CIAO
637,466,905 *41A2D025657BD218C1F89535698680E319EDE39B CIPRI4NDR4GOI3U
637,466,906 *41A8CAC2C63B8A66507043008A453CE00990CAE4 c,js
637,466,907 *41A0754D1163DC31F1918E910BEE023543D4FD3C CLAYTONCASAVANT
637,466,908 *41A69D9787D843EFBD713273281A1FDB33DFA66B claytonturkasz
637,466,909 *41AD8C00F5DC4758FE40B98A0045A430CBAD05FA CLEMENTPUCIO
637,466,910 *41A481C658C82E1E140445B27A1339AADBF98CDE CLEPUDES
637,466,911 *41A59C6ADCDF78835E664CB6CD32461175F41F77 clevelandmuncher
637,466,912 *41A4B4C57C43AEB5948E77A7B4BE5EFF6CA9253B CLIFF.ALBANO
637,466,913 *41A4A3581F12CBD2409FCC7E146AF8BF653FB29D clintonschnapp
637,466,914 *41A50C942A3053D1791E453C155156B634C08E26 cmd:0
637,466,915 *41AE8B2E41D74AA2C3601F8369A346D0AB70730A [email protected]
637,466,916 *41A1116915C0F4275E737A5D775F555DB5A56C47 CNKY2
637,466,917 *41A3951655456DB1FEEEAE8C80F7ECC2C12A0BB7 COLUMBUSMAILE
637,466,918 *41A93EF321964EFED98B07F60FB991F842309CD2 COME.INTO.MY.CLUB.(EXTENDED.VERSION)
637,466,919 *41AB661608F0A62944F6913E22437C5709B967DF complaisiez!
637,466,920 *41AD1DA9E4145644CE40914CF67D38001BA05C79 concertovoor2mandolines
637,466,921 *41A748A81DBE75DE82F9B403D771A74EC82A1766 CONRADTSENG
637,466,922 *41A8CA203E311C2BBE13926592129D8858B58AB9 consorten
637,466,923 *41A0B643883C92E67D0BA5C9E76B3C24F599CFB4 cornellmikelsen
637,466,924 *41A19991803AB5C1FE8A5AE2AD8C693E15C93483 [email protected]
637,466,925 *41A32DB29ABC620821EA45509A2B501B0BBC9FCC C+OWG
637,466,926 *41AF7A849074529188717C9F6753653F2BB6B8FF CTIHW
637,466,927 *41A69CFB7199748C9208BFCE168A89EE88E66BDE CUV-&
637,466,928 *41A22515CBF2DD66865D088FF16BF0757AFD1F56 D1IO?
637,466,929 *41A4B842C37C70A684327969C9BCF69DFBED1051 D35TRU4M53
637,466,930 *41AC9C86EDC872FC524D7F30BE8C5FFB42175D8B D3M3S4N
637,466,931 *41A169C2BB58E5D04FB44038123DCF4D24194DBE D3PR3551B1L1+135
637,466,932 *41AB1A33DD854C01AD904E22EF9E845AA065287E dansa?
637,466,933 *41A8BDFB95ED9A6A78466541FF7A573B43E903BA DCYH
637,466,934 *41A9C4C2B83DF08706B084E5DFCAD95AD8848801 dehcnert
637,466,935 *41AEA257EAF774B8BB4F07FE75F6BAA72EA3871C demond.lawrence
637,466,936 *41AB412E5318FF0C9CD4721CE860BA6E5632938D DENISEBARTHOLOMEW
637,466,937 *41A120A6290388AFAECFAD4F15FD7993E4AB16FC DENSITY
637,466,938 *41A4B13C2E40BBCDD2339161BA905B7BA84A6F68 det3m
637,466,939 *41AF3848E79AE23786010333C9E235BD78B65613 detroitjoseph
637,466,940 *41A5A1BE9B1B16B5A124C26102C59F5A5376C23A df!2q
637,466,941 *41A1A7E2DDE34154A0FF033DA47B6CDDE72D0605 DGZPQ
637,466,942 *41A9772F6B3939132D378F80885DC1E01469256D DHARMAVIVECANA
637,466,943 *41A8EC3396223E106CCC9ABBD71C7C121C482DEB di5pa55i0nately
637,466,944 *41A39DD4C865262840A0BD63A203EAD4E56D13A5 dickmarx
637,466,945 *41AE75055939A9EE05D8A9DCE38134A0EBA5A112 die-kaputten-(live)
637,466,946 *41A841B2394385E5DFEF7DC47CAE7BBDE072968D DIETINERS
637,466,947 *41AA7533F4A9432AC33CB3AF40F561E84A98C105 DISSOLVONS5
637,466,948 *41A5D77F7F10CC9AB712D5232A21BD444ACC42F7 DLH)7
637,466,949 *41A5C802951FA4A1F4AF680185093029998AB580 DOA5N
637,466,950 *41AA69D30C6CE6A689E3AE04F6991D65EE2AC25C DOMINGO.BULLERI
637,466,951 *41A3AA7B7BD13413E10774DC042CFB53B4804B23 DONOVAN SAMPSON
637,466,952 *41A457A449D40C3E0E1655746B4B58ABE36FD968 DOREQUESTED_ARTICLES
637,466,953 *41A93F6762970794BF682114F7F7CD373AAF9EAB DORIAN.DELABARRE
637,466,954 *41A5B3DC8B82D4F44088D7B6C35DE4CEE9C81F5D DORIANDIPPEL
637,466,955 *41AE2FEA4F107D0883607C2A742715124D66BD96 DOTANE
637,466,956 *41A1D242B3E61B850902DF71D854362531D55FE7 DOUG.HAYWOOD
637,466,957 *41AED7FEB6B19B03DA0F55E3D536D6C570C0B7E5 D":P
637,466,958 *41A8AF7A8631BA07FA3B1C0E6B2C201604044555 dqr7g
637,466,959 *41AA499019E5B9EEABE0DD6B62DA41FAC9054B82 Dqvl
637,466,960 *41A734577D6A55FE609DF0E040D28A795AF82317 DRUGJAN1
637,466,961 *41A0D23F5F6CE47BC742CAB6FDAAECBCD609AB1A druwattie1
637,466,962 *41AC0FCDCB3AF88A085EC74CF6AC3C1DFB2B9641 dst9u
637,466,963 *41A6891DE96944D6089845A11DD338FADBD79B10 DSTK3
637,466,964 *41A9687EF4D3F7E82B6957DDD118AFF8C5981D28 D!!U(
637,466,965 *41A1D59209A82707A27771077A62DCA487956758 DUISBURGGERMANY
637,466,966 *41A340F01E42C982E885549F70E08E4F7B14D794 durnaviched
637,466,967 *41A93F3C1B62ED7BC57F6AEA43FF7410230AEDE0 DWAIN.JARRED
637,466,968 *41A4146A20892ED25898144FE28EB0C94F578F14 DXEW
637,466,969 *41A83631F1E42B7216C4D127BAC721E77A77D5F6 easywinners1
637,466,970 *41AD50A63B04229C3ABE8538E29A0D76646A4B91 ects=
637,466,971 *41A32B666E244C8947DF9E365139553F88046893 EDDYVANDERVEEN
637,466,972 *41AC92E8059CBA60A0D18D2E782646F592B4E4C7 edith-ransom
637,466,973 *41A30406AFDBA4A76511D047E112705AA1C6A934 EDMOND.LUDGOOD
637,466,974 *41A76723911CC15A9B2856B9503DABB2AE5EFE64 edward.adona
637,466,975 *41A731B6DAC5ABD8958BFD24C2F3BEC64CCBA58F ...EERRR...
637,466,976 *41A7B06D40E36C05CEE6597A7DA361A0207E9FCF EFDL+
637,466,977 *41AC1E6CAD2C0B7C25EAE278D9698D05B6F3C1AE EKTESKAPELEG
637,466,978 *41A1DD9C5F8D076E2B203B3669C14247392545E4 elettrochok
637,466,979 *41A66E0DE2DF756B60E7F9C5C6503956732660DA ELFREPUSED
637,466,980 *41A4E42497673617386372755FBF8618227FD1E5 EL-KF
637,466,981 *41ADD1D4A4AE6ECC7AE6745E9DB8E37250CD65BF elvisnewpass
637,466,982 *41A3D7DA108D2D619639CE031AB139D912DDA3BB EMIL.LIECHTY
637,466,983 *41A5A16778280C0FD429DF190497A587769DB39C en&^
637,466,984 *41A55BBB4EA3E94BEA72269F9262552D15332B6F ERNIEFUNDIS
637,466,985 *41AFE29BB19E68DD4E05F848D889AF58BD1D4644 ERWINSPILIAKOS
637,466,986 *41AC89EF62F56662D890721B5DB3458697791A92 esporlo
637,466,987 *41A4F0C7C05A75B5A0B965D58812380F5098D588 ESTANDARITZEN
637,466,988 *41AA9BBEDCF17C04D5B627094FACA883DE1F382F etengaml0
637,466,989 *41AB0B587EA6D628335CE03C8F505F1B65E4824B EUA8
637,466,990 *41AF6DF4C80F685917CCD1216479E4D3773B6186 everybody.plays.a.fool
637,466,991 *41A7D60E12225D186A484936E8F1594D0FFE8D35 excusers
637,466,992 *41AC6B5FD62BDB6E92A071D9803222780EE6F8ED EZF$
637,466,993 *41AB81D6E67DFDFD59D069C7A3484B2CDCFF698C FB9ABCE118C6F8C034EC673F9F447870PAGAL
637,466,994 *41AAEE512A818E742A53D3D6CE2F0676D16D11E6 FELTONCREARY
637,466,995 *41A27CB8FFAD7C9458D4C08791005E043E098D9B FELTONHYLINSKI
637,466,996 *41A278A87217F6AF1427E01F425306E9E6DFFECD [email protected]
637,466,997 *41A8633E9DEB53D06B4FF06AA8A600CE8D156251 FICIERENS
637,466,998 *41A455FF176A6DD26B06B2EC19DA5617A304E1E0 fiffiga4
637,466,999 *41ACACDB0D0FC6F94C1C16D3F060F55400DAAFCC florabacteriana
637,467,000 *41AE005B7536EED38A8EFC29F4613E550D35EC82 flugelflache
637,467,001 *41A45E43612AFD78B39124927FCAA9C622ED642E FREDDYYECK
637,467,002 *41A65ED96BFE4875D0FA6E896E9E82203EDA1A4B FREDERICBRISTOL
637,467,003 *41A5F229A2781555F84A7FD9D08BE7DC6C83E033 FREDJOEL4
637,467,004 *41AF649DD8047D915682425FA4542225F01943D3 fYh
637,467,005 *41AAEE2E98BA81266BED21388F3B981D0B2528F9 G4ZEBOS
637,467,006 *41A2CBDE1A7CA8A099FCE12B28FB99B7E5FDF5B8 GARISTUR
637,467,007 *41A3945AC8F3D8D83EB8449B282B1A6469ADE26C GAYANGNOON
637,467,008 *41AA67FE619DE584017C2997E8E8DF0B5CE4C090 GEMATST2
637,467,009 *41A8B58553AFB47741249AA1B700382F1D406F96 GEOFFREY.CALZADILLA
637,467,010 *41A3E20FD83638D44E3A7397E9F50186B9004986 GERMAN.LABARRE
637,467,011 *41A8FEA0E3B92DCB37E2AAB987C6BC8926C0E13C GGMOMOF7
637,467,012 *41A5E62BDBFD795176DA7D4A685261D37C134FA9 gkkseau
637,467,013 *41A26F05971466814A5AE1C4438E9491871DCFAB GLINAMA9
637,467,014 *41A50D45CA8DF8FBA8E973D51DB82D681F94B780 GLUCOPIRANOSILOXI
637,467,015 *41AD0F4DD32EC25C3C6E87466F2D9DA9D00BD750 gmal
637,467,016 *41A974248EF033430E5A8AEAED000E46638D9124 GOATANNA5
637,467,017 *41A0E9DA3D9470DD431BB9DA0D91843411FF3686 [email protected]
637,467,018 *41AB1561C2863B4277D107A7074B7DC283EAE61C [email protected]
637,467,019 *41AF674DFA44ACAACBEAA5871F6CA7332D943AE0 gourmer7
637,467,020 *41AC0073A0BA58AE97090C67147FD0C2367796CC GRENNITCH
637,467,021 *41A35B1A36AB9E005515558CDB3B2EE4E2921C47 GTALL
637,467,022 *41A46DBAD538476681B2560C2181F6E5D72EFEC5 ha1dom3s
637,467,023 *41A0B31943B356EA2FB922AAC831C7A4BAB9FADA [email protected]
637,467,024 *41A04B025AA5207740F9CC02DC72CBDA247A2228 halorrego
637,467,025 *41A67FBC1962393FF3491759A86D66940D1E76BB hanaczów
637,467,026 *41A558F31081057A4052B026DB23861AC153FD33 hansharo
637,467,027 *41A15D751A1B03F5AE54C512A1DFF9ECFD789A31 [email protected]
637,467,028 *41AB12C6CA3951E394A70472B48515810ED61AA4 HARRY.CASTELL
637,467,029 *41AC71212ECE7D7CED7A803695E7233185399354 HAWAII2004-03-10
637,467,030 *41A2F751D2632B850311ED86DD64BB27DB6FB256 [email protected]
637,467,031 *41A10B09D04B77DBF98D3EA3C1B3A0BCBA5F90B4 heather-erin
637,467,032 *41AF18B0504C7CF608A644325578DE5618523D27 HEIDIFLANAGAN
637,467,033 *41A07B4A8D870CBC7C022B8E28FF075729226546 He's.Got.Everything
637,467,034 *41AC9E1E685A09CE2CCC49DA1986D9FE8AF47F07 HNWPSPSCD6
637,467,035 *41AA5EBEF96A0821C6975A3D0A219D5EF7E0AFAE hollisvele
637,467,036 *41A8121E38C3E77298E6D9FB0D9814219AA1FC96 [email protected]
637,467,037 *41A7F734599F90E3B3862B6249D171AE4FDC31A8 HURTMENOW
637,467,038 *41A9B15756E1B8E92EC78C9820A219D1165AACBB hyp3rt0nicity
637,467,039 *41AAB84AD170C3427842DCEE19C578296D377035 IBM7030
637,467,040 *41A2EF0067036524DD8BB412E6030380B565A986 IMPLICAVING
637,467,041 *41A389F1D41513ACA28A0EEBAF945C032D3853F8 INASSIOI9
637,467,042 *41A9021EA7B945DD25D751D57CFB4496F16F79AA INDIANBUBBA1
637,467,043 *41A02BC2CCD81C566D5B05631DB9265BB0550253 intoxiquaients
637,467,044 *41A32638A94DB4F4E024BB1E954C8C447F4A5BAC irwinsaddat
637,467,045 *41A7D791021280AA2701D2D8BD551E194FD3E4A3 ISAAC.HINCHEE
637,467,046 *41A1A104D80F8C44C0CD7AC3695FB8DBFE8A4D95 It’snotwhereyoutakethingsfrom-it’swhereyoutakethemto.
637,467,047 *41A3570C65934BFD132ABDAA54E9CAEE69ED7B63 IVXKT
637,467,048 *41AE569114D68D7089D9CBA112CBC76DFA58E484 IWBA
637,467,049 *41A9020EF7B9E0E71C74E276C79098CF5C8DC72C JACKSONRIEHL
637,467,050 *41A99F8DA87DB328D49608206D346BC5523B943D JAE.BURSIK
637,467,051 *41A0927BE34697ADA745AEA63D064737EFA253DB JAERETKA
637,467,052 *41A3EB5FAF5EB3BAFBBFD93BB21422CB18FE1943 jaimenettle
637,467,053 *41A6380680DBA678DF89C31356D16C93D09063FB jakekish
637,467,054 *41AA8DC9A5D88A6598C8BA634BB6243731D4C1C3 james-ted
637,467,055 *41A519405207455EBB08803DEDB0D1900B7BC73B jasoncrabb,jonathansheltonandbearrinehart
637,467,056 *41AB5FC3499BCD21114F01F6D9EA53B0D91C385E jenna.ridgway
637,467,057 *41A5875511BE1061844C36A89FD296C3C478B87F JEREMYBONAVITA
637,467,058 *41A4331D61252DFA55902F90FBD2EA57F00D2126 JEREMY.SHEAN
637,467,059 *41ABEF2588794B5192123F60442CCCA875A8B8EE jeremystabs
637,467,060 *41A3178590E57BDB85C77CB9BBED20C001F0CF55 JESSICASZCZOTKA
637,467,061 *41AE672D180B07E020DFBDFDE10F04DF5EC798E5 JESSIE.ROSU
637,467,062 *41A72EF5D5431ED237AC494271D0EDBAACA24AE5 JESUSLAGROON
637,467,063 *41AD7F63B874025CE36C8026E293E68990B605F4 jesus-villamor
637,467,064 *41AEA519305A17B122157A24279A51F9D43A03E0 [email protected]
637,467,065 *41AE795D0DD4FCBB7E74AD92CBC7DEBE8CCAA4D5 JIILAANIIED
637,467,066 *41A01C0F9DA30EAB8AFCC9B8CBB41E80A38ED10B JOANNE.HARRY
637,467,067 *41A08E4F9AC9E938B32570AD8F6F22197608FEBB JOEEHAAN
637,467,068 *41AF52096E7BE5AFEFF8CCD20F2B9DF1E743F923 JOEGRIFFES
637,467,069 *41ADC3BF07CC9B7E1830D908CC48494FD68DDEA5 JOEY.PEDERSEN
637,467,070 *41A951C9E93A561E7F33B9DC111617304168BADF JOEYWILDEMAN
637,467,071 *41AB33B030F6F18634BC7A2D0B489712CCEBD556 JOHNATHAN.EBERHEART
637,467,072 *41A4EEFB5FA1F8E17ACF0994F0B5AE30164825D8 johnesper
637,467,073 *41AEC6762EBF9F036FC8C49C207775B7906A88D0 JORDON.VARDEN
637,467,074 *41A09F3D1D82657F9F4D605D92701156ECA50902 JOSHFILLION
637,467,075 *41A43ED836885FCCCFAFAC1F35DE497B3359FD69 joshuasouser
637,467,076 *41AE5A03ABEC4A0FAC78D50EBD77C75F2174EE43 jospehdownum
637,467,077 *41A399F23A28ED80C085E3D68713457C8E291ADC JULIENNEGOMEZ
637,467,078 *41ABA4F87459913A5CDA6ACE22B6CCAEFF0F941C JYRKEMPN4
637,467,079 *41A220ADE3C18C9DBF18E6EF7B00F186C676704C K~[_
637,467,080 *41AA9F8B7B86B4BB93B4A5EDBC56BE447086A80F karina337
637,467,081 *41A172FB5A652A14BFC69408D3C6A3C32CBFDEDC kathelijn-van-dongen
637,467,082 *41AB3CCBC70E83B280B8DFE931732AF83FA82214 KATHRYN221
637,467,083 *41A23D72DC3D91CC69A56794855C9912B374EF4C kayleigh1992#
637,467,084 *41AB291AD510EF4C16FCB564C352AE69208D82B3 keelontstekingen1
637,467,085 *41A2BE875E61A52C0B54800FA58FD4F96358CB9A [email protected]
637,467,086 *41A53FA1309D70E2C9CD07524C9C7BD893DF4E0D kenotath
637,467,087 *41AB288CA5C8744605F1156E73B650559CBADFA5 kerryhindson
637,467,088 *41A6CACB5FE0ED357CD1BA30373C8FD1206E3CEC k&:g
637,467,089 *41AFB5730EC01E0CEC8BE1B066ADB0F6425F816A Klavierkonzert.in.GDur,.KV.453.(VII.E,.S..286)
637,467,090 *41A10EDBCD273D7A507ACEC9CAF841C3A77307DE knzv
637,467,091 *41ABC6020480D3BE2126145EE074534AE280CF7E KPTS
637,467,092 *41A647E9100023FEFC6988FB213FC37B86A28523 KRŠŇÁK
637,467,093 *41A7F7960FEECBECE245B9C534AE18A7B1D250FB KRUTSAMANSVERJINGA
637,467,094 *41A782D516C7166E8A98774FE47FAF4CB74B1A3D K%WG
637,467,095 *41AAB023CD6CA38528A43EC8EE09DACE18DE90B0 lacerero6
637,467,096 *41AD59013D5C92F5FF19E8FD4183F3C1AB728E0D larikse
637,467,097 *41A31FDC5067FFC0B700A2EFB037257A3134FA66 LEBNZOLPALESTINA
637,467,098 *41AD51456FDD72A0B27021B76FC6F5AC56AB10D4 [email protected]
637,467,099 *41AA274D4B1468EC1260D86292544B0678A2DC32 LEIF.FISCUS
637,467,100 *41ADAF90B4DDF44B3228BD546CC347FF036E1574 LEMINGS3-D
637,467,101 *41A9ADEBC3B59815A22C0973AB9E506F0774E1F8 [email protected]
637,467,102 *41ACE55ADD3233F5FA61DE115A0A6A6CFDFA3942 LENNY.HOCHSTETLER
637,467,103 *41AFCF9029E70721B42B58CFED56A6EA8830BF6D lestercoury
637,467,104 *41A36C83031B96ACD3F30D709AF8E0E554C07C7D lesterswift
637,467,105 *41AC1A8E4306933D907715B46754AEFF74B6FA66 LIFE297
637,467,106 *41A9E4C397BCB91996FDAF1E4812F90C94912358 LINDSAY.RABEL
637,467,107 *41A1616DF51C344146A9E2FF1DDCDCD23925331F LINKOLN2K
637,467,108 *41A9BAB160184E059D8E584F01492B9056B9C7D1 lionelnighbor
637,467,109 *41A0AE9BEB75C23A1A2E2E91378F920CC1D6830A LISA MANNINA
637,467,110 *41A28A9F05D290803DE8EB50FB114950936B3AD3 LIUYAFEN
637,467,111 *41A59EA2AB4A9AD9383C243E4F0A2B791426EA5E live.at.radio.one's.big.weekend
637,467,112 *41A005B20C2C31283319DC25DC075BEE62C4B3CD LUCIANOSEAVY
637,467,113 *41AB98F1CCFA511194F5325D2C25546D083D42EF LUCIANO.SUSSMAN
637,467,114 *41AF08DF2C95B5C5822F0299F1DE8B37F62CBF39 luciodonson
637,467,115 *41A2F08467BFEAE8BBE7D546544B0ED0C09AC8E6 LUIKERTELEMAAN
637,467,116 *41A9ABCD6B517B1C11D6B370C26AD94D2AB1B8AD LYNNEW12
637,467,117 *41A1ABD0ECB88623ED534E2C9946F24469F47BF3 m31!ora73d
637,467,118 *41AE77AB28C4AD5991D6EDC6D07591F40ECA0544 MADE.EASY.-.FOLLOW.UP
637,467,119 *41A88A05D1E35C6E71DDDB31228D2358F77B4D1A MADELINEDAY
637,467,120 *41A56DBFD7A969FDB24D71199C93CC5F6DD5FDAC manoevrable
637,467,121 *41A2BB17CC19F8FD41DEC86594CE80D6BFFF001B MARCUS.BOWLING
637,467,122 *41AC378927F6555C839ED5E70C40C53DDA1074CA marcusfunt
637,467,123 *41A040917E862664A74B331A1B18DB0264F81A41 margueri+es
637,467,124 *41AC4A07B9CB79E0A4A4FD201458A7C60EB9C0CF MARK.CARACCIOLA
637,467,125 *41A115ED19E16DFB38F82C92FCC472864F994270 MARLIN.LANCLOS
637,467,126 *41AE59D4F0D7D2C82EEE32F0E863389766028FBB MARLIN.RAYBON
637,467,127 *41A3197FDAAA99D73BDC65BC115CDA1073731C5F MARLONSHELDON
637,467,128 *41AE1CDCAD69E5839932DB9243CC0698FC2442EC martinmajkut
637,467,129 *41A47F997AAEC140095D7349A6C187466A91854C MARVIABRO
637,467,130 *41A2DEDF4E9643AAEB64E37D02BFA822F9E63749 MAT-LAKE
637,467,131 *41A85D4C0326FD7C333A9D663A07500FD0174550 matthew.spiegel
637,467,132 *41A1ACDA7E6699E2FC2DB65FB0446BBC24DEBA0C maxbarren
637,467,133 *41AEF736ABDF5469265482691662DDA1FB8E6F9D [email protected]
637,467,134 *41A29F2CC4A71F2AA7D1EA1369E4C8E3C25F5503 m-codes--eh1-m-k-ow1-d-z
637,467,135 *41A86025FA81BEEF874A1AF78271875146FD8CB4 M<^D
637,467,136 *41A04489C63AE777DC17E9D4E5FB9F5C05B80A91 [email protected]
637,467,137 *41A0329AA3DB0F0AA08A1882EAAD53B4C8BC895C melelangi
637,467,138 *41AF0B0A9FB81B7C39617831EA8410631D2D5B09 MENNYTT8
637,467,139 *41AC3200DBB9ADA9C787303325870093D8B8AF10 menstrips
637,467,140 *41A44EBD610A3EB4E91FDBA9A0E6A7D65131F8D4 meurtri4
637,467,141 *41AE0A6C471D1705F168A191A8EC6E1B91102B2E MICHAELFUN
637,467,142 *41A390AF7839A955A7E1C86DD7C22EB29301C23B MIÉLAN
637,467,143 *41ABF4D6F47E0807D48C2DFD84E57183358ACA1B MINAMI-ONODA
637,467,144 *41A2F1C285FFE100A9C36AD85B718C01B98E8742 mirceabalan
637,467,145 *41A930D0C0ADC19AF0C8386424D8EC38C1BF7110 MKNIAJER
637,467,146 *41AA79E1940CC5BB3171FC2812DF0DAC7A936CE9 [email protected]
637,467,147 *41A293E7EE24CCCF230E7F8A042649CAE5CACA71 MNILIVE.COMWWW
637,467,148 *41ACF7C35D8E99550D085C90653504BAC8909F4D MUEHH
637,467,149 *41A3D8A435AD2BA4130E6C435F90EB404E4CF2C8 MYRON.SOLLMAN
637,467,150 *41A30C8CCC88764899C7CD380041BD31E7CBEE42 mywpikoy1
637,467,151 *41A1306E0F8BC846D9BB592D1208FD083C296123 NACHLEUCHTEN2
637,467,152 *41A3092E2707E92D2BD71C70C3968AE12F760471 nathanieldegrange
637,467,153 *41A4FEC8489764C89365CFACF922C75BA09456FB NE191195
637,467,154 *41A5522A6838E9FF42DCB050D7F49AD42A184C02 NEDRUETSEG
637,467,155 *41A36844A8FFADF5ED315A83267E86E2EE287AD1 NELEESYA
637,467,156 *41AE35EC422531295C1D3EC562A6A0E904E5BAF6 NERV
637,467,157 *41A9FB8E6F25BB81DE02471E73C735DAEDD6074E NOMVELO.SIWELA
637,467,158 *41AF0580B525C9B91892B98B526FF6283AF963F1 NOTSOMUCHTHETIME
637,467,159 *41AFF8315F4CFDBAC6327AA9B27D7222937ADD6C [email protected]
637,467,160 *41AEDC1D1D0D9ADC4C544D1EE6EC653A443D69CC NUGHOK
637,467,161 *41A60136821062A81B06B9F37E2038B7456769CC NWARDHTIS
637,467,162 *41A4AD36D1439E4D16F0836E46EAE28129571107 $O1!C!747!ON$
637,467,163 *41AEA4B4726F101DB68F28A50525470E954C7895 ODIS.JEUDY
637,467,164 *41A3FA0F47C653A3AE7BFC68C83B256037DCEE59 OEB03
637,467,165 *41AA1ACA1486339F145645DE6A1EDB0DCE93CD34 omarhean
637,467,166 *41AAE5BA8C21ECA0F4D74FE0031F610D59FD0F05 omnimental2
637,467,167 *41ABF4B1E1A82ED4B2CD7E052E93750B0B6E2C45 OREN.BRECKENRIDGE
637,467,168 *41AD7B529C2AFE3F2C1D1E96CCC1B6AD476F8E17 ORKESTRETOJ
637,467,169 *41AEB42C7F661EC512E5EB99BEF21C93281F37CC OTIS.BAILEY
637,467,170 *41AC925C2182D35BFBB354E647000352B9F447D9 OVER4C+IVENESS
637,467,171 *41A6BBA0298ABF12808341C159D134507BDAF604 OVERBRIMMED
637,467,172 *41AA41781FDDD8D24EFAAA855B67D2BCDA1BA215 p53udob1ograph1cal
637,467,173 *41AFBC5BC3F2E9E6C6DBCCA1A5133BABF6E1E568 PARTHAPATHAK
637,467,174 *41A878307E51ED9712EBBC6B0941CC477D3BE0A6 [email protected]
637,467,175 *41A755EC97A2C3407EA6745261FFD80AC26C2D35 PEPETENG
637,467,176 *41A98942AE8BC7DF069D859566F6034CE510506B permitan5
637,467,177 *41AF44B6D412100377B8BE6BD5193E4CF70BAC91 [email protected]
637,467,178 *41A4A08CF37FFEA0D3B9C595ABC0CAF19730A1BB pitkstyi4
637,467,179 *41ADA4186C63A29CD783674BC2B2E23AD61E1E7F plava.ntam
637,467,180 *41ADDC61D915DB0DAC6EB1F166ED23155CD96753 POTKURITURPIINIKONEISTA
637,467,181 *41A91951046F81C2BA293A92627A6762B0EBF9DC PRIZOVEM6
637,467,182 *41A216001413DD46005E01267A2DB6FE32D18863 psycho.monks
637,467,183 *41A788066A4797875595D2DE007028B7958BB8BE publicanism1
637,467,184 *41A9B5D482086B8148BA4D3826F7EF013626923A Q&F$
637,467,185 *41A3DFDECC65AE15D391E91026045A368EA60F11 [email protected]
637,467,186 *41A8B2483112F7BA058A9EF5D4C80E3A27A20596 [email protected]
637,467,187 *41AEFEAD75F27685846B43B3D281C2B708576B7C [email protected]
637,467,188 *41A58E13890573767676D97A0F20976AE2276813 QP~ ~}X{
637,467,189 *41A3B050A9578E3E5092EAA38816F90C1CF1378B R3GN34RT3
637,467,190 *41ACC5DE5924499E67E6BB64E2FD7A62A090539F R4M-3D$
637,467,191 *41AD523534A1297D6A543DDE46BE26CC46398D7D ragapuryadhanashree
637,467,192 *41A99344CDB0B4BDDE412959063157B71352F747 RANDMARKEN
637,467,193 *41A17B1A55245B522CABC25A9BCFDA907FF8F4C2 RANDYDIDATO
637,467,194 *41AD55FEC2A7394A9D6C71433127E7EBE3A2B833 RAUFUß
637,467,195 *41A688C99A8C5B35482BF74E8E771F26FB0A2087 RAYMONSIRWET
637,467,196 *41A78EAFA1719329827B29154A438739BE2DB524 RCACCAVIELLO
637,467,197 *41A9B264111521201C46FE03EBAD6F00374939A5 RDESPINOSA
637,467,198 *41AD6EF6AC6F9C65DFC06947F0478259EDDED558 REATHER1
637,467,199 *41A3C5606E34C565C7F9597DFC970B6F4655B669 REFUGIOMAHALKO
637,467,200 *41ADA13B069FD4E0860879966F80427DB712568D regiszts
637,467,201 *41AB4C386D3542C69DC1236D9131E350132C594F RENTENGÜTER
637,467,202 *41AF10694DB2E66DEAFBDDF52952FD67B93F18D7 repinseihpos
637,467,203 *41ACD533309A819A174F570352BE03E8274E1A61 resubjection4
637,467,204 *41A4D0CEABA15BF9EF2D97BB9109CC50197F0248 RICHARD.AUGUSTSON
637,467,205 *41A2EDC4BAF28CDB7F2C98C5D54E55ADB016D0D9 RICHARDMADARIS
637,467,206 *41A2D5233543999517D468419ABDB673F784F21D rickiereifschneider
637,467,207 *41AB98FCF344092A5D540CEABA570BAD505860C4 rickloffier
637,467,208 *41AAB026FDEEC68CE913EB32BB7F3FDC5F6C7423 RILEYKIEL
637,467,209 *41AD78C4A579FA1284E2CFDA601AC5D82FD4EC54 ROBBY.MOTEN
637,467,210 *41ABA1286D37C931E1EF126F6599444663EE44ED ROBINRAMUNDO
637,467,211 *41A510D02F48E9A0AA1D722532CC2F17B151923F ROBIN.ZUBIZARRETA
637,467,212 *41A4D4092A3C490F8AD5B7477245863093DE6A0D rodolfopelc
637,467,213 *41A29EF35FF353AE11A280DB9B3FF44665938182 rolandocorriveau
637,467,214 *41AA82E7BDEC15713A050A49DAA4DABC60318E8D ROLLAND.BECENTI
637,467,215 *41A812400BA6349A81B784577B1D35C7D1327FCD ronniecunniffe
637,467,216 *41A7E000EC0CB8F5586B31BF178EEFFD5CA921BC ROSS.CARNLEY
637,467,217 *41A70FC6E1D06AD40A3D66AF526812EF868176A6 rossezorpsdnatsuz
637,467,218 *41A61886F1FB683664DB6BC60DEF8B1BADB77750 RVERDEILLE
637,467,219 *41A85330CA105A621726598276AD4EF998EF41EF Saabnele1
637,467,220 *41A8B1131287166EDB0B54B387CCCA46EC2C2909 sackful
637,467,221 *41A395FDA6EC9D784FF57CD442B66E5639947905 SAMHAPGOOD
637,467,222 *41A8694B94E51AC6371DDE489BC2D329FB1BDBF2 SANCGREAL
637,467,223 *41A05A4E9439091EA52704741AACF9C99343A5BE SBISALAPUR
637,467,224 *41A0F5A745E522890720EB0BF1E23AB782B7250F [email protected]
637,467,225 *41AE83BD9FE3F5051EB1543529B9A333047DFF21 SCHAEMEDICH
637,467,226 *41A11C8B9CEC705952A75BC7F05653E07E451CC6 SCOTTYTANGABEKYAN
637,467,227 *41AA7814C6ACFADC0B1F0507A4E338FDFEEB1DDA seelaratana
637,467,228 *41A2186C78785867B8374BB3072ABE4B055E6A1B seifulla4
637,467,229 *41A35D121CFC508BE355417125401BF118D635E9 SESENNEICISUM
637,467,230 *41A48B5113D8AD417D69FE1AAA07B9856AF4AF08 SETH HOCHBERG
637,467,231 *41A2C71A3C256E4411AF3AEDE43688F516E96102 SETUNHANDLEDEXCEPTIONFILTER
637,467,232 *41ADBAEEF93F89965D80562B574FCC5FE9A85E4C sexo,.algemas.e.cintaliga.[tequila.baby]
637,467,233 *41ACF93829C7383A473EF270623F081E8DA3FC5E SHANNONNATIELLO
637,467,234 *41A3C9808875BBDAB75315A5339061B3EC82B399 shawnlunger
637,467,235 *41A206109E3DC03C9D220FE07455BB4B8B21C5EF shawnsahni
637,467,236 *41A059366D8C87565119F0FFCE39447E244286CA sheffard0
637,467,237 *41AFC7102E48FEC4F1474C322B515C314B5DB102 SHERWOOD.TOSO
637,467,238 *41AFB7EAE68349B8AE354F79097720E9C8710C9F [email protected]
637,467,239 *41A64A477A01A25661385A17DAB2CB1215AC488E SHOUT.(IT.OUT).(DUB.1)
637,467,240 *41A4533536F334C83D5A22CE3D35EB5DFCB6E1EA Sigo-Buscando
637,467,241 *41A1D6038330E1EAB064E3A46FEAF08232EE79FA SI TO EL MUNDO SE ARRIMA (TON
637,467,242 *41A1B7ADD7EA974A2A922BA1ED14460FB6F2DFB1 SKIVESVA
637,467,243 *41AE33F89CFA0C0DEDF424DD3D25FE31694F217E škodljivci
637,467,244 *41AD5EF2FBB811F8D5872DEAB2CB4AF58DDF846B SL2MAGEMIX
637,467,245 *41A4003312D525B5CD9169C5F298D0454A8905F6 SNETAGPEHCS
637,467,246 *41A24C9F32C3B5C6339F449A34444A5BE21042CB sniffit6
637,467,247 *41A0CA3A1CBA1F86AB158BF3B356E42BD1B03366 someonesleeps
637,467,248 *41AD1AF96F8CDA0377DC10991FB63F892957994D sonatainbflat,op.106hammerklavier:allegro
637,467,249 *41A683F566A3BC9F6D65346C8DCFC655BC64F767 SOPPORTOS
637,467,250 *41A46EC8844A92A844CCC361335ABD38D15D20DF sowjetrußische
637,467,251 *41A3ACFFE43F86DE4E1918C1E31F5B9CB8513E8C SPECIAL MEGAMIX DTRANCE 11, TRACK 06
637,467,252 *41ACFE66A9BAD0E0FDBD67E061E3B1992311ED27 Splat!!**@=====8
637,467,253 *41A1233D8D835A632E11B48161DDFFF06F87504A SPNDENDES1
637,467,254 *41A2F51FCC0212029FAEE91AF914843C872D43EE sportbra76
637,467,255 *41AF3ABCED058E11A4F0F70643426A1773350F43 SPORTS160NOM
637,467,256 *41A9194EC246A0B3EF5214882E00D0EEE40B4E4C sreizin4
637,467,257 *41AA19C05E3AA33D6A9A9F24F71171169593E864 SSYIFBZUQ.
637,467,258 *41AF6B4AFF1D108762476B8CE3231BC2EA42603E STAHLEY1234
637,467,259 *41AE6A321279C7944A5E766D8BCD7D50CB94CCDA STATIONNA8
637,467,260 *41A374078D2FDE37954F6D5CD0DD92EC419B58BF STOCCATO1
637,467,261 *41AE6FD24718D13591193ABD46753273937D7A8C STORMFOOTED
637,467,262 *41A04C8AB4B8939A2E29FDA58F91B7CA81183AE7 sujiroj
637,467,263 *41A2D1019D9DBBABE4BF0FCAF7CD93EAE41EF3D4 SUSAN-SALEM
637,467,264 *41A2BEB2FC9B6A4C4B6C1116CE4EC2600AFBF27F sweetdarling(featcaitlindevlin)
637,467,265 *41A2974A35ADD46FF611D89A4174114FF0BCB8DC sylvestersetlock
637,467,266 *41A4C798E2A86F93E0C68FD70FB50671764AC079 tabla-anual-siglo-xxvi-a-c
637,467,267 *41AE3007DB83649FE89485A0B36C67818C190A1D talk85178204254
637,467,268 *41A46291E68585FEE9B13D6DDE454181823EEF15 talk88248140104
637,467,269 *41A8E167E9D1033752341A1362AEEF34399778C0 TALKPUNKID
637,467,270 *41A398226B22C2394E8CF313DDED3155C0A96341 [email protected]
637,467,271 *41ACC3E356AC3D4F5737CF6631612B6DC505A722 tbeisegging
637,467,272 *41A0999CD05AF3A14631CC4B138EE3C973933935 THAD.RICUCCI
637,467,273 *41A744B2AAF792E4094837FE6874A87A10B1219E thatclark48
637,467,274 *41A20C4302A41F2682814AFAE70B91BE7ABC3847 THEJOJO44
637,467,275 *41AD77F782E6401B487F28BFFF2BA5FE898FD989 THEODORE.JACKS
637,467,276 *41A5DD2DE56D4BA3D0A8F4EFBA81B8C481499492 THEQWERTY0
637,467,277 *41A45CB107C8574B617E89DF577619C82FD3F106 the way you move (feat. kenny g)
637,467,278 *41AF6D9D0CAF033F7D03AD240A83AD3F0B44136E -THIS-PLACE-NOVA
637,467,279 *41AD52A1698CE64321F75B3E3906B8402A459121 THR3MM4T0
637,467,280 *41A48D29FF4CE946A5BB4D12AD32F4DD3648D6D0 THROAT3$T
637,467,281 *41A56260973E6BC97690D3C6436FAB1CDD6AD09B timothytromble
637,467,282 *41A4476E0CD28F902E82CCAFCCBCE171EF6A744C TIWANDRAA
637,467,283 *41A73F3C3878D8DBBBE2DCD2622FF00877EF97D1 TOD.BRUSCINO
637,467,284 *41AAC45E2DD61DFDB2B737EA40C8086D7707FCBB tommyhockaday
637,467,285 *41AA9934152C0ED741B53AAC90038ADFE079BE54 TOMMY.MCQUADE
637,467,286 *41A4121695E005487B95CEC46220A1E44F745303 tooksomedispleasureathim;atleasthejudgedso:
637,467,287 *41AF348B6E84A75EB4D9F1476E5D13FCEBC67523 toutoudanslapopoche
637,467,288 *41A510E5BC9ABB129E411E875D44860F770EBCCE trentonfaz
637,467,289 *41A0B4B59C3D96DD9FD4F057486ACDD167355296 TREVORSWETT
637,467,290 *41AB8F36B4196611664F64E9B6677D6389EAAF58 tribhuwankumarsingh
637,467,291 *41ABF80E54A5B3FAA0AC1A0B75AEC0E8920ECC6E TRISHIAKATEMERCADO
637,467,292 *41A33D4E5D8379E6ABF8EFA08DCD5C889E70B788 TROJAN-RUDE-BOY-BOX-SET-(DISC-3:-SIMMER-DOWN)
637,467,293 *41AC92FB6DB57883A7347222CEE27D732C12DA68 troublewhitney
637,467,294 *41A2099D57E4D50D8EC963C045622CF34B10EE49 trucking
637,467,295 *41AF95E3A4DCEB28CE76B3C4F81AB76FCF17C90B TSHEPO-GREGORY-MUKUBA
637,467,296 *41AC0968F8FB6DA0F00DE75DE5A43C645148C68D tuesdayhenderson
637,467,297 *41AEA2FDE8B1FD216E7C711FE597AE75AC553688 TWOGLASS9
637,467,298 *41A885685536920304647FEF2AAEC4C9E8D1F022 tzwq
637,467,299 *41A7EE27C1BC4F1B87377898AB0EDC6B51E04C63 unneg0714b1e
637,467,300 *41AC43C47933C0A3957E7C3400679E2192A6E1EF URANUSFACT
637,467,301 *41A5C0B32576971536FA68BB03945C07AD0936D2 UTT4L
637,467,302 *41A73EC88E46F5D9DF49CD1A2D068A33AEE9371E VAKWDQUYRQS
637,467,303 *41A5494C8F1541EA690DCD3E23D948075C1B2011 VALERIEMARLER
637,467,304 *41A1C8EF353E437AE6F4FA2500BFB8CECD6488EA VALLEN EN OPSTAAN
637,467,305 *41A103D99AEC47F07D16DBC912D4FF20E919746E VARMEV
637,467,306 *41A54A0A6B0B6047C2A2214ECD83B06236BC5639 veiligheidsklep?
637,467,307 *41A2A7F5FBE3A9F7CC652088A14F1A75B4A5C542 VERWOITUNGSREFORMEN
637,467,308 *41ADD1B554AB723BF8A22431D34F7568A596C76F [email protected]
637,467,309 *41AF991CE57C935FC3293A49A73C0143850C9FCB VIANELE-ALVAREZ
637,467,310 *41A5C9C07C673862134745C50AFEDEBF234A960E VICENTEBERRONG
637,467,311 *41AD958956728AD7B3213966ED7569C04C931798 vickey-b-taylor
637,467,312 *41AE9C6D19B1F7D29811B59F2B25CAD35D4838A2 victoria-lyn-kozal
637,467,313 *41A3083607354192A7BB0A380E8738E6895EABEB vidalink
637,467,314 *41A1DF5E5673DB43B10D80A2B54AF1DA0ECC48F8 VILLAMARTIN.DE.CAMPOS
637,467,315 *41A8C6DD5B9E07062F8110EA9AE254ED39F6F149 vincentechentemolina
637,467,316 *41A75FF94D7578C1045DFB48F8DB16C7D8CB1738 VIOLETAGORDO
637,467,317 *41A3B52422CE629CA7FC64FC54086E4DC3ACEFD5 virginiabertram
637,467,318 *41A6A119142D7E42B0F64636B5C47A86E205203E vivamallorca(inselversion)
637,467,319 *41A5BCA7B49BC4EE6D9188083C7DA7C3F1AA0BAC VNMOVWM
637,467,320 *41A01180740CE449032212CB7A864913C086CC8F VOLVAMINI7
637,467,321 *41A70F0DD64BC25D3F68815BE0C890801484A2DF vorstschade6
637,467,322 *41AE2015178B04096FAB3E570955D7D09625D260 W7P1
637,467,323 *41ABC29C26215D8F4EF026E07A4128D240EBC7FC wailingly!
637,467,324 *41AAEF3E64156691202F3CB54B2D28E8F2314A2C walie-wahab
637,467,325 *41A4F72BB434A6E5584C62E63841D4507EA767F8 WALKER.VANHULLE
637,467,326 *41AAF1BB1C9718AD277F9E8E63F76E7EE611467F WALSE-MET-FRANS:-DE-NACH-IS-NOG-ZOE-LAANK-/-DIECH-BIS-M
637,467,327 *41A6343B6D5DA53493CC546E61764CB63110104F WALTERYOUNG
637,467,328 *41A2F870A0E84B3F14BF08A6C9BDCDC0748C86A5 WARREN.HUMISTON
637,467,329 *41A5F9BEF77F39AF95FA623A16B91FEE29B1A87D WASTELEADLEAD1
637,467,330 *41A6598E9D8BAABA77A01578DA5A211BAFDE098C WAYNEMCLAUCHLEN
637,467,331 *41A1F8751EB11D604BA6DB89D6CBFBF20DF00786 WAYOFFBALANCE
637,467,332 *41A7BC5086AD973BCA9019D5C04566C0B5CB4502 WC!M
637,467,333 *41ACA00AD576646BC234BB56B42C7477F8140EE8 WDRINCLUDEPATHSTARTSWITHED
637,467,334 *41A39D36DF65C8DDE8344F2096E2F0842B8793E7 „WEINERLICHE“
637,467,335 *41A6466F52D4D5F0CCB3AD907AFA81316CEB44D3 WELLISH NKWANA
637,467,336 *41AF5C947017C894AC762502A8EB56D4B802F871 „weltenbastler“
637,467,337 *41A72E14F50875B2CEA06F4641BFB97D93921FFF wettability!
637,467,338 *41ADB1E9BF3D8C686F574BA1A0541DCB4094650B WFC-ARMAGEDDON
637,467,339 *41AAB09EE21B4F2A460E52CBAA35B18F0E54B3BA WHITERIDER1234
637,467,340 *41A9DC6756CC2C15163E6BF73623D75FE5072A4A WHNTMILTONFRANKDOUBLEHEADER
637,467,341 *41A8E5DCE49BCB263BCD3F2AB92D9629D8C6615E WILLIAMSWC
637,467,342 *41A79EF92A38E108F81DD39B4554A0D44BCB3E1C WILMA-MCKINNEY-MAXWELL
637,467,343 *41A7BC9F71170317E70B7C04DF7BF5BE90467434 WILMER.GADDIE
637,467,344 *41AA5433E9915B0592C60C4DF456A6AD95217679 WINFORDLATIMER
637,467,345 *41AD6FE8C61EF6E71D74F2CCD7070230A8C311D7 WINFRED.BIANGONE
637,467,346 *41AAB4D5CDCDD9F9294B9A99AACE00765426FC05 [email protected]
637,467,347 *41A6A8D4544495C169F46BC7581EE5D210564E67 wipeawayyourkiss
637,467,348 *41A4FDDF76FAFB327B656B6A305A56EF05240002 {{w|Julia K Murney}} - Mona Sax
637,467,349 *41AEDC307B93D0F95DABADFBCDE3DA056B15ED5E wong-yik-lung
637,467,350 *41AC8632D4EBAE26F4E06135D51F0EE80585F59E WORLDFACTDATEDECEMBE
637,467,351 *41A6616D28C92F090D7A68F0D4FB619BF21B5521 wr1+4bl3
637,467,352 *41AACC100B7DDA9AA8D61184C4DE3CBAB7BBE74C WULONGQING
637,467,353 *41AAAED1AB0AB9B95E899DC359A30CD48B29985C [email protected]
637,467,354 *41A64557FEB30F54065CED327E48147A57108B5B [email protected]
637,467,355 *41A01E458B0AC959786D63B1BAB497091A501F95 WWW.EUROHOSTELS.CO.UK
637,467,356 *41AA1D978E15A2655EF4D31F1D3B78140410DEF6 WWW.SHOWBIRDBID.COM
637,467,357 *41A17CD2C873B17645EB83D457AE310CF1BD5C6E WWW.TV.COMMOONLIGHTO
637,467,358 *41A174B594B0F690B3FF2A3D725C797556C9C4C2 wwwwavcentralcom
637,467,359 *41A22EAE9F22532023D552AED3B42365F27A307E {X} *@===3
637,467,360 *41AB12F135C911C51809875E96D32ACBAA04AE1B x70
637,467,361 *41AA6FD3E9CD693A921C3D13892280D2CC26E79C {X} ~`DQ
637,467,362 *41ADF2808974272B269182D8CC778BC97A5932BC xingleidamnstrong
637,467,363 *41AD9681054B06DD49A03328EADD500E4C6FAF3D X#U]
637,467,364 *41A9055F5C28E17AA110550A94668AC582ADC98F [email protected]
637,467,365 *41A21807E76CF0B2B92BCDD3B40995091EB82A0C XULUOJUE
637,467,366 *41AADB46F6B81BD09DD7626767878D7E1BD367FB *)YAAA
637,467,367 *41AC7787DAFF910E4D17F3651E10308EAE9CC502 YELIMSOBRUT
637,467,368 *41A8D3CF788EBDB4CE375058FF96553F18C210DA YENYENARCHUA
637,467,369 *41A900821EAA2EE0EE16854799C3993F8C55687C yuanhu
637,467,370 *41AD335E0B4A186523828BA12D47BBBB5EF30393 ZDANOVSKIY YURIY
637,467,371 *41ADE83E69176E19489740BC3008D18CF7CE8670 [email protected]
637,467,372 *41AC9A408DBE7D0F665B66AB5E4651CF77C50763 [email protected]
637,467,373 *41A31A160B2483171BAF1D88D68FE7BA933395B9 ZINKSELING
637,467,374 *41A70CFB8C88EFCDB9EFCF879F0016A77694830D БЕСКРАЙНЯЯ
637,467,375 *41AE62F5EEA3DCB02D832A6AA2DBD005CC0D451E ЈАБЛАНИЦУ
637,467,376 *41A22B187FB6C2C9F6B3F45A6905422B613C4B26 кейтельгиссера
637,467,377 *41A6256E43690BA6F3CEE50AA91B3C3841FA7CCC КУПАЛЬЩИК
637,467,378 *41A5BA61F75CF4CD9A7E15A76EC246E7EFFA8834 «МАКСИМАЛЬНЫМ
637,467,379 *41AB65A9D59047891454D6D140263528CF6DD0BE ПОДЈАЗИЧНИТЕ
637,467,380 *41A405C340EABC584A05363149A586AB126DF840 терпи́,каза́к,атама́номбу́дешь.
637,467,381 *41A4E25483A98C6199735390CC834D3A6E596A06 ТҰРАТЫНДАРҒА
637,467,382 *41A7D36CD0755ECBE03A66E711A767F0663F2769  МУРЗИН
637,467,383 *41AADC2D27C87D8612D5D71EE4D04A275CB3D0EB 018emanuel
637,467,384 *41A10B3B58F422A8374488877E2B6D5C7CFDC98D 0md
637,467,385 *41A88D59D0A481635A305AE6F629A835C905A0CF 1235002 JA-UHKAAN-TIETENKIN-VASTATTIIN-TIUKALLA-VALVONNALLA-
637,467,386 *41AD2D24A4051D301D7484B0B10B411C7CCF1F46 1264760 htchelsinkitammasaareentuleeyhteens
637,467,387 *41A3B6FA6CA753D35346702D9B82932190362564 13.mroz
637,467,388 *41AB16A43F7635BFBBF33A6E2A915191303180FB 1477345 hamburg.ist.die.britischste.stadt.deutschlands.!
637,467,389 *41AE9760DC819CBCDEAEDA52256CC9190F2E5831 1509236 seurakuntien.j
637,467,390 *41A6B57D80415906364C6805DC4EFB228B91436F 1886156 kunnanhallitukselleilmoitettiinkokouksessa,ett
637,467,391 *41A2048AAB5F8B8050CB4D119898B80367165838 18.TADILATI
637,467,392 *41ABD078B793190C84F8E6EF4AC411CA0B30E55D 1915166 tulos.per.osake.oli.0,26.euroa.(.1,46.)..
637,467,393 *41A2C33399DE3AFD3FEA8E6055359C99505A983E 1947107 sumoka-tittelitulieskolkiltary:nj
637,467,394 *41A347B5C0ECAE97332A03C169F494D4639CCBAC 1-ACCARDY'S
637,467,395 *41AC85E40BA6E710CDF7846550AF72A68CA57697 1 ANTIHBSVASTAAINETIITTERI
637,467,396 *41A12E0F01FBA87D185CEFE5A7074CF46E54E86F 1.EINSTELLMOEGLICHKEIT
637,467,397 *41A108EDBD7293F3F0690FD77E79F19DBA56867D 1.entscheidungssouveraenitaet
637,467,398 *41A90C79F581D9C9FC6F72C2537B811FE281F2B9 1gooden12
637,467,399 *41ACC5EDBCFB25B5D1F824343AE446E0FA638D14 1HSIYTENIN
637,467,400 *41A1AF257F022F0B440096F0C79225C8C5404CC1 1-innovationsfreundliches
637,467,401 *41AA6D0B5804C3F7EE830020EC8D0D4D4688C6EE 1 KALORIM
637,467,402 *41AE55224C0B6141DD909C15527BEB0A5519A440 1kandahar-abfahrtsstrecke
637,467,403 *41A2F6EF6691DB836F143A388917215310C766A6 1.MANDRACI
637,467,404 *41AC5E74CD922F8FCC2AA9A1D52596D120FCA98D 1PINTAALAPERUSTEISIIN
637,467,405 *41A3375B48D1133BF6F32143F17612846E5063DB 1.POBLANO
637,467,406 *41AA93068FBADE93A85C61703F050AC6EA1F1C95 1.PREPAROIDULLE
637,467,407 *41A008E086D706D7A80DCE2D4B366D1E81298C3D 1.riesensprung
637,467,408 *41A81FD60FC6731C2DE98E087C01D7242F36F676 1VIKTOVIA
637,467,409 *41A620C764FF3451D50B4560021FD330A2E4F3A8 1VUORIJONOJEN
637,467,410 *41A6B2E2463C062EB10FB45EA71CF18125A82F2C 1-WARDAR
637,467,411 *41AF2F7291469A8BF408A4A33FD7C4537CAA47AD 1-wohlstandsmoebel
637,467,412 *41AF62000720BA175BAFB0007B5A26B8F6527D9C 1 YHTEISKUNTAKELPOISEKSI
637,467,413 *41A6212AC0A6B71E39F00A14E032F448F837A558 20010401: paradiso, amsterdam, the netherlands
637,467,414 *41A741CD4E2B3CE1142E0395D115743A052660AF [email protected]
637,467,415 *41AC00CECE6192D4A724A657BD54451A3774DC21 2460230 the-most-onerous-of-the-suits-was-settled-in-november-.
637,467,416 *41AE3BBA2BDE024E127028108457F293E3AE2221 246regina
637,467,417 *41A79934CC2F065AA3B78D2F5E58B600A3D419A1 2496925 TOIMI H
637,467,418 *41AA24EAD010B028E20F280D1D7866F2E9D4F54C 2594252 DIE-UNBEWUSSTE-VORBEREITUNG-IST-EIN-LANGSAMER-PROZESS-
637,467,419 *41A058D4910ECF2E00A03180BFCE842B612154CD 298518 kiozamansevdalInInelielinde.
637,467,420 *41A0DDDEAD6A12D10C0EE26A36D21B13EED5DF50 29june1642
637,467,421 *41A4CE45BF68A88BBFC7F1DBBD01EC0516D5BD1B 2DETHMORT
637,467,422 *41AD3985CAA6119B40F5CF06123F0555D8582234 2FHXHNXCBVG2FK
637,467,423 *41ADB32DAFC27F8A743E158B47C55E96DC1E89B3 2-HAUPTTENDENZ
637,467,424 *41AB57259E0D82E23CA4EA9F85C1B7D26A3993A8 2.IQCOMP
637,467,425 *41A42BACE88A21D9C4403457D0316DEC19B59719 2-kromolinin
637,467,426 *41A7C48CB41673DA8B49887556341CDAF592318C 2PEINARON
637,467,427 *41AA3DEE61CA7968C9F073FE34C1B8417A2F8BA1 2UNHELE
637,467,428 *41A4DFC7D6B2EB532308EAC94BD2EC2164D400F4 300-yleisiin
637,467,429 *41A2FBFB9835DF67BE91BF46E7E455C7FF003D1F 312070 OHJELMASTAPUUTTUUVIEL
637,467,430 *41AA3E01A3CEEF93790AEAE83426396FBD0EE392 32 APUV
637,467,431 *41A7A6426004881031FADCDA9EE6EA33C6C4BBEF 335jaylee
637,467,432 *41A77785EEAB0CB3FB2664348C2126CD4DBD90C3 3DUKEMINOU
637,467,433 *41AF94688ECC63378BC441EE509919C9ACF9D4D4 3iluvknicks6
637,467,434 *41A63281CC49111B09B79872633370B39E26F3A4 3OTGNIMER
637,467,435 *41AE4D614221F2B63E59ABF384A7AB163FC6EC8C 3-suorituskykymme
637,467,436 *41A5E8338AA722385C908DD761369F772B862816 3TYAGCK5TI
637,467,437 *41A1F27D56AF59AA8E221C1DAE4C48BAD6EB0915 [email protected] ~ uu
637,467,438 *41A005B19918FD7E67024790BF2ADF7D85815D16 4MIRAKUOM
637,467,439 *41A20553F3D31E94835F80516975FF217453447B 4OPKROPTENS
637,467,440 *41AD90121A4EBE6CA11B58682BD31B8EC28D5E5F 534ISAIAS
637,467,441 *41A45FC6AF8B49CDBD0F1CC89873F588ACF681E7 5FBSTRTOD
637,467,442 *41AC818EDCD9F9382E81FC7425D823335255BBF9 5GASOMETRO
637,467,443 *41A1A7AA9088BE9EDB868A047261BB28D42CDF38 5GIRDERINGS
637,467,444 *41A40F55631450942720E063D2F1749161EF3D73 5SCEABBEDE
637,467,445 *41A8FE28D07BCA607B83325B4EAC8E2281557D23 5thatlorrie9
637,467,446 *41ABECFEFC37E5A77D4370D76E75321ED289A352 5TSENFOOR
637,467,447 *41A3A0057510492217C33D39CDDAF33EC45D90F2 5u8d3fini7i0n5
637,467,448 *41A14B72BC6BB6E66A7CE72A44B782453AE140E4 5VINDELTRAPPORNAS
637,467,449 *41A18100BA2AD74CE581294FBD8A434613ECF0DE 5ZIGGYROY
637,467,450 *41ABE1BF4DAEB0F379ED7538EE1C9630594BC33F 640X48075
637,467,451 *41ACA2259EB674C272B1232653CFFB5DAF8D7211 6BSWMEGAHERTBSW
637,467,452 *41A21C8682D933B7D84E4BE344431613AE9573A0 6CUZZSORT
637,467,453 *41A22861A0D8A8C747E92C630A9D21F6DDD9D181 6KERAEILIJOEITAE
637,467,454 *41AA855EB61C131D74ADE0332BA0F8801CC5AA4E 6NEFFORTNEMAS
637,467,455 *41A24CDCBBAF21A17A1032B76988279249DCA21D 6SHORTYTIMOTHY
637,467,456 *41A3FA1B7A2955D6B1F1DB19F2CD595F9B2DFD18 6SIGSBSW
637,467,457 *41A8D4D492146FDFEED82395E9B9674852A4934D 6.TAUSTATEKIJ
637,467,458 *41A1314FDDF22986566AFF4E3D27A62ABE85C00A 710090 LAKERDA YAPALIM
637,467,459 *41A03A60FDBFC2A2ED8F885C00A59401A58FB83F 7140WSX
637,467,460 *41AEF4C64975143BB73E6BC3BE350C1FF4A21BF4 793ARTHUR
637,467,461 *41A0BB1883CC9E64454A74493F543AFB837647B5 7ABUSAVAT
637,467,462 *41A849D2A2B06333247C5EAA6EC3329D604D619E 7appostaste
637,467,463 *41AC8161C574DFECD7FDDD9AA1443ECB235106F2 7F7KJWLE5DSTG
637,467,464 *41A3791B3CC30B279021A17BAFCFABBE2239BE54 7MENOTTIBSW
637,467,465 *41A4AD6138CDAD73B37188460D485EFA7372A0FD 7TDEELKPO
637,467,466 *41A463EB1FF01FABF98FF84F45CDEBED5989BE22 87271 PAIKALLISALKUISEN-EPILEPSIAN-ENSISIJAISENA-L
637,467,467 *41A4237DC36C6A2EE945C93BFDEEA5EA81142201 8BIOTINE
637,467,468 *41A54CBC1ADA6FF120627BCDD4C9C0B417B89A22 8BSWBOGOSITY
637,467,469 *41AA5525F250F9F2768793C41A8C8AFF6CAAB480 8KASVINJT
637,467,470 *41A471AB4211C23EACEE3D17114D7C1A4E459B32 8ngtaaaayaaj
637,467,471 *41AEC3C452ADE6FCE35342796EFF65F520F21045 8ONEISTUS
637,467,472 *41AAA42EF20F08867218FAD02D405E90932D2363 8==P.`.(00)
637,467,473 *41A066C182A5DB74C48565419C033F06979D5081 8PALAEOLOGICALA
637,467,474 *41A1370F136B771567B6BB83108F35B1C0254CC5 8POSTAMOS
637,467,475 *41AA34F8DDBE24AC292CBB9728BCEDA617331573 8.roof-raising
637,467,476 *41AC259EA87BFC38CD9384A2701B596720282F63 8superstar3
637,467,477 *41A1132AABE6923F741B14E9656CCA7A65D66424 902050 ZIRADIBEVURMUSBIREKONOMIKYAPIMEVCUTTU
637,467,478 *41A21E22FB55BB49B2949B724D9A444CA667120A 910471 " we think they're done rallying "
637,467,479 *41AB215C46DF0C62B9326E9B6C9F5D6661E325B9 942816 en.Onemli.konu.sosyal.gUvenlik.problemi..
637,467,480 *41AA59BF3233126EBB841A0896BA9BA50149AB71 949brandon
637,467,481 *41A59981FEB2345E688D5A3CA98A3291EB65B96F 9CHAIRSSRIAHC
637,467,482 *41A019016EA0777B336901078B14E13DED807499 9EXPRESSWOLFMAN
637,467,483 *41A72C7F556B6FB50D0251CD9564181E07C380D5 9IAMDESERT4
637,467,484 *41AD3C02152F1C1A7EE49FB157D946E91911DB65 9JANUARY1570
637,467,485 *41AF655AC24E22CF5B7C0CE3DDE7AFF0D9B439F9 9UMGESTOSSENEN
637,467,486 *41A8D1393119CDC494AE56EF825A95F5B4D71B70 9VENUSARCHIE
637,467,487 *41AE17795CB236BBE317590E35F893C45014473F 9ZONOHEDRIFICATIONS
637,467,488 *41AE8E1EDEBDA1DCEE72C9593233D99C8B20400B [email protected]
637,467,489 *41A18643670E08FCE63CC866C5F4994C81D2A789 a1mn:
637,467,490 *41A4A5F467B84887A7435304C482B353A12388D0 a3hqc
637,467,491 *41A2A6B82B59A1477226A46B0EFE2045F08D5BD0 AADL-O
637,467,492 *41A6F66C0B52191C98EF7777E6A71455ABD3F3D1 abr1dgemen7s
637,467,493 *41A933847F26183222B4DCDFA3FEDEFB7138EAE2 abzyh
637,467,494 *41AC97014B82268D23CA43FAEC7B900E11774119 AHMED-ALKUWARI
637,467,495 *41A636C2C19AE1F733044B057AED64FBE209660D AHSDB
637,467,496 *41A3342A0C76CBFFA994885D80683A7F4A91FA08 ai-7y
637,467,497 *41A47B56F096743D9573EBA46FBF8733C400DF37 Aibt
637,467,498 *41AEAE65206C947ADD91CD57DD034F700E7DC5D1 AL4Q0
637,467,499 *41A2A27E541E2A0850AF9FB39E3CFEF0E1F65290 ALEX.KOBACK
637,467,500 *41A10FBC37AFCD2168720594D1B2255879DB0EBE alezzo
637,467,501 *41A34EE951E452FAA8E3546CDBE143C299887B76 AmmE
637,467,502 *41AC6F3B617E58551E4DC4B16A2F1F9B380F5592 andrew.durrence
637,467,503 *41AF5EF1A8772393BB806B8191AF93201C8462EE ANGELOLEFRATTE
637,467,504 *41A882A56F113288A289D38A159303AF6439E2E8 [email protected]
637,467,505 *41AD3DC6ED5905C922B0C2E8046F95D491A0FC1F ANIMAL-WALKS-INTO-A-BARJOKEHOTLINE
637,467,506 *41AC8FE2E9A8AB2E19C7CF3D29DAFA703F281474 apg8_
637,467,507 *41AEFB5BBB757FC5C6D769B72A34FA5A2FE40C2A APW$_
637,467,508 *41A87883B5E26B39FDCE99BDE11A1F1FEF7B4AC2 ARDEN.CALLON
637,467,509 *41A9C509FC18DD31F0D7383B0FBC451946FAE40A AREBILLIS
637,467,510 *41AFD5F839B694E25495654F25CF479A0F501803 arielgovea
637,467,511 *41A2CFDDBDD4AE16170CB7D861A70CFA10E65741 [email protected]
637,467,512 *41A1AA066C7D34C95FB431ECFD6013210B2E483F arrolarased
637,467,513 *41ADC8280401BF420DCE066D8E7D6030465A9CBD ARSYADSTEAUA1
637,467,514 *41AB1550269B03F2E60F17836CAD97EDF0FB4BB5 ar.wa
637,467,515 *41A9AA1A05E73F9703E3D1B3D345AF5A3963F060 au&0f
637,467,516 *41A205300511B7DBDAA2D4C94419218B1D4BFD02 AUAR
637,467,517 *41A332216AD37502C36F913B5F3623F21A66FC47 AUSTINBIERLEIN
637,467,518 *41A30BB33C3A98AB7B8D214C8A478D58F4AABAC2 [email protected]
637,467,519 *41AA01ECCDF679B5CCA9179456182660558C5291 av3=a
637,467,520 *41A4ACBA18834E470696F6D3D650306787BAF08E AVZ+T
637,467,521 *41AFBBCCFCD053630A5C89B415F69A0211C73165 awn/!
637,467,522 *41AA3D41355C544AB3426B8AD4C15B0B83BD1717 AYEAR.BUTBEFORETHAT,THEPHAR-
637,467,523 *41A7FECB0672FD7B7D6A55B889BE052218AB3679 B(0R
637,467,524 *41AD296D2E37E7CBF15CB569AE0614F600BCFEE9 b+2kn
637,467,525 *41A08A96D2C9C045B22F6A7F15E3B433B20324EF bcm-q
637,467,526 *41A193D959CD65E025AE1DFCF9DBC8A6C5AD9544 bc.o
637,467,527 *41A5B98567FB6F889331CBCB52D5543C8DF3792F benedictblumkin
637,467,528 *41A1719EBF1706D0C8ADFDC48101785B58B42230 BEWARY
637,467,529 *41A8CD05A2DB98A0BF4FD6D7A0096ED0793C6C81 BIRDMAN323
637,467,530 *41A5F11C905B89BD5270DF6229358D55EA720BCA BITTER-MEDICINE
637,467,531 *41AA19C9A03B439D7E2C895A2FD05A35C406826F blaineborghese
637,467,532 *41A7C3B31C12020948954515D1834CF2C66AA3BA blake-hallett
637,467,533 *41A3DC1B0E0928CC4EF9F9C941E0273D92C352EB BLKF
637,467,534 *41A696F6B829F92ED75CA2139A8AAF591BE16237 BL_W"
637,467,535 *41A44721E9A982A60D9ED4B99590424F74E3EB42 BORISSJAARDA
637,467,536 *41A5FBBDE7355BC3F67B3C1993B87D6BC923145B [email protected]
637,467,537 *41A7712E2277E6A8841D19AE0844AD303948428D BORSTAL.BREAKOUT.(BOSTON.BREAKOUT)
637,467,538 *41AA5ED0AEFF90E3043CFA684F3308B721DC0278 B"$.P
637,467,539 *41A05669D13B595F1CC310D74AB2395F2F43F039 brei_
637,467,540 *41AC97089909501C19A5BD8B464971A933CED0EB BRENTON.LEGHORN
637,467,541 *41A634FE0087712A46BA99C821C64211CCD4436D BRENTON.STERGER
637,467,542 *41AD0148E31886F357D465C1B09749643366EF34 b+s0d
637,467,543 *41A692719EFC5D354B9F7CDCCB9A93AF17FCD285 bsgk
637,467,544 *41ADA70299A735B7D7FF193FF95AE9AE511ED00F B$T_
637,467,545 *41AD6D472246B7E924B7DDD0E06EFC9A4B051C10 BUCK.GREENUP
637,467,546 *41AED81F381A780DCD750D4B2A0EC7881A7EB5E4 BUDDY-SPICHER
637,467,547 *41A47E9267AAA0D607A6BA4E99394DE2D4EABDC1 BURN THE KNOWLEDGE
637,467,548 *41A87DEAA0621A2D33CA3369FC067D319489B7BA bvuh
637,467,549 *41AE3B183827CC9B884784990E35F0B700820861 b,zot
637,467,550 *41A4C1C6D403EC7DF1C13539A43DB9C986CF8917 c0e_
637,467,551 *41A621CE05972D86E2457873073A04D1148ADCAA C5OV$
637,467,552 *41AFF1B00457282723F27C39BE10F83133FC6EF7 c7vrd
637,467,553 *41AC3CEB1CD1AB1A325D325C8E4BC43593E7E6DE CANALSTHOLIDAYINN
637,467,554 *41A2A3780808F01F45D0DFD34CAD9A75A7A2984D [email protected]
637,467,555 *41A4C587FFA705FFBFE4E0483F612F9A5E7990B4 carolguzman
637,467,556 *41A8C65E693BD2407860604510E975EB29D9D744 CARROL.PEREY
637,467,557 *41AE86CF8C99B046C390C48553CC7FBDA89AA4A5 cas)
637,467,558 *41A0BEBF1D6AD3F0FC3E5866360C6C0CE3451D54 CATKEYS
637,467,559 *41A5646EBBDC41381363E2259FB0EFEF13D19841 CCH;W
637,467,560 *41A1BBD37B98712377C507107F335D1654C51440 cdm"y
637,467,561 *41A877ED6183D7640F26F74FC20AC6F5FEC3003F ce3nn
637,467,562 *41A41A91CAA4CB6A748563F785D4BDC2979FB0CF celestinoiv
637,467,563 *41A7E4CC28614346EB8F5224B5DC3C84DC1F0CA9 CG;
637,467,564 *41A2F82339478A7DA003CA99999E105507D7CF88 cgf
637,467,565 *41AC4DF03CF0C2126BB61496265BDDE62531F6BF chadlinkert
637,467,566 *41AA44D9F5E8AB9D8DF6470BD2C37A2A43CB3BE1 chan.yeeming
637,467,567 *41A60C99FC1255F632BE5AA797DB9C29868EFED5 chaos-ffxii
637,467,568 *41A1D82E6A98AE194CFD379FD569750D2B894E61 CHASE.HOWDESHELL
637,467,569 *41A4C0F77546B92E3FC9FA6497243A21EBF2F338 CHESTER.HETT
637,467,570 *41AC53D477D47993D10DA023771237ED7E9EA268 CHIBAK
637,467,571 *41A19BD7DC600DC1B0262C3603A6BD5FE4CC4E22 chtschdng5
637,467,572 *41A57D423D601CC020B3EC9DB22FE7818BB68873 CHUNUCK
637,467,573 *41A22D44C0236067BA19FA8D3523D43E72DE0629 ci#,.
637,467,574 *41A4190F2924201F09E0A6B67CC3A14CE313EAD1 CI[+
637,467,575 *41AEC3844E5E2BA122C6114944943B8511084E0B c=ku1
637,467,576 *41AFC0E9D4C1EE7EF05D210883CF5547734FB39B cle4nlie$7
637,467,577 *41A918A86C85D0ADCAD194BAD5C54848E42CCE32 c+leo
637,467,578 *41A99C48588A8B0CAAA0AA91BEC9CF1725FE6089 c#lxd
637,467,579 *41A46E1EF979DB1EEBF2B3E1061EFADABC96C966 CMVQW
637,467,580 *41A1FD8B1A6E4917E971F8F5835530BC7FC9E106 CNL4
637,467,581 *41A53ED12D10E57A62CDA18ABAA232506E47ABC5 cogw0
637,467,582 *41A531EC482E3BAFA6FB7C6D6A811D48DF6FA381 [email protected]
637,467,583 *41AA5A3C4EA5EE7FBCD634990B7F728B8F44ECA4 COLTONLEAVITT
637,467,584 *41AAE9DFF9240929B833679665DB4E427D677642 comp47!8leness
637,467,585 *41AAEE86598681949AFFEE93E27D0C3195A30A4D [email protected]
637,467,586 *41ACD15734CDBB76E1FA9F0A449AC9F2C89AE448 coreyhaydal
637,467,587 *41A8FC408EBFF49E157ABADB96C11198C44C8F1F cornellniebuhr
637,467,588 *41A0AC994C6F4E7D788B1815CE759E3D2FA8CC87 cornellpody
637,467,589 *41AA2EB01A2C033C707760BAEE40A2E880B7B69A [email protected]
637,467,590 *41A290122C6F096481E56E77B4814C279A92666A COVERRUFF
637,467,591 *41A7B75BA16848E76FEE7F3775DF87003B2A4FCA COVITE.ORG
637,467,592 *41A291791EC72CF1F0F00E1F4968FBF234C6BCEA C:\PROGRAM.FILES\MICROSOFT.VISUAL.STUDIO.9.0\COMMON7\IDE\ITEMTEMPLATES\WEB\CSHARP\1033\GLOBALASAX.ZIP
637,467,593 *41AC46580F5208373601DC5A573ED253C9A18DB2 cpzer
637,467,594 *41A79B3D1F891906B4F63AA618AF75C7E1EBBDB5 cs.+b
637,467,595 *41AABEA071C33DF458ECD3BB73A053890A6A8398 cs?zn
637,467,596 *41A6DD77D6549542F1921264BBC219AFC2C2C69D cuiaba,k/u//j//@/'b/a/
637,467,597 *41A15A0BC8A328A47D2B25EFC1348D63BEC37802 [email protected]
637,467,598 *41A62E8A483191E12154125CE32A6F68F2A0B7B2 [email protected]
637,467,599 *41AA351C8310968CD06E153BAAEEB0D982980F06 CURT.GUILLOTE
637,467,600 *41A1A494C5CFBBCD871A639E93ECAE379C0F2DA3 curtis.pavlik
637,467,601 *41A6C07EA54D53C78618F6405A6BFB5ACD056A7E c#xa
637,467,602 *41A804DC761E9C611AFC8D0A16A7FA39A40D4597 D3_Z
637,467,603 *41A5BC65BAA2B1CBC6813D5509941E4D8D2F34F3 DA71V3$
637,467,604 *41A6F6FE9C55692DD7376CBB01FD5ACFC3D14DE1 DAMARIOED
637,467,605 *41A725B307E34FDAA23B2B8F099471DFED53015E DANILO.SMERKAR
637,467,606 *41A9803F4DF6CE9F99D42481040050E03CA88C15 DARCIE23
637,467,607 *41A5CC1BE289B5C539CD19F10C611C1C326F6895 dax)c
637,467,608 *41A8D0972E6E3E0968ACD97CFEA34A3A28A407E8 DCRA5
637,467,609 *41AEE6C5BD3EC1A30BD3CE79F46A17DBDBA8F726 DËBORË
637,467,610 *41A53AC569CB0A02A3564C4FF1B84C42B4317311 deffauqnu2
637,467,611 *41A79ADEF8E0E6600986D6F966FD068033313519 deglingged
637,467,612 *41A2EA74D6364E031B909B956C5C38480543B5DE demarcussteinour
637,467,613 *41A4E3E61A7556894B0973BB79DA70DB9E34B911 DENBAGUSP
637,467,614 *41A4ED2F126091E8D3B5DDD564ED7336766FE5E8 DENVER.SPOTTED
637,467,615 *41A1049F99AC80054296A3B62E95391229C8469F DEPILATORED
637,467,616 *41AF3C8BDE3BC8D39CBFC32AE48E8CD98F982F9F dericktejera
637,467,617 *41A4AA545AF20FE4CC1EF88DF7A358AD1F7A8B1D DERRICK.KRYDER
637,467,618 *41A39E5E9530387C7B8CF78F45EE612D0A986F29 DESILICONIZE?
637,467,619 *41AE31CF9EAE83F87E9AC46BF1AC478B5EC0518E DEUTSCHSEMINAR
637,467,620 *41A81697C9E2C49C49F84DB8EA10E27290575DB3 DEWS,
637,467,621 *41AF05689292F3DECC17E42A90E44A96AE858C4C di=!
637,467,622 *41AE1A85DB1A859C5D9CF7464FF046F37CDF8DA0 disseques9
637,467,623 *41AEB37DD38CAECAC3C670E992992C0F7262FC3C D;J?T
637,467,624 *41A6D5489E8B00311E4E18F36B08535521833B97 DJUXY
637,467,625 *41A295C6073C2292D056A56C7B11F5197BC30ABC D:KN
637,467,626 *41AB16120FA281CA1F177FF8EC2A98816AE59425 DOB#Y
637,467,627 *41A8226CC9F6DF3815D1F1947036D98F149D4763 DONNIE.HUPMAN
637,467,628 *41A08C7D6401A852290EF4D092A7BA5A03B96833 DONOVANDOSTAL
637,467,629 *41AA9D028343C267B8908C1232CF5578C670CFB3 DON'T-2
637,467,630 *41ABA3ECD4DCB20A5F521918C4B24974DC4F9B24 DONTLOSEYOURFILESCO
637,467,631 *41A7BF941BAA940D66B7402E89491C52C4218FFC D!OOQ
637,467,632 *41A728EAF22C28C023260D4A3A83EC2BF045AB5E D":P
637,467,633 *41A1C159EA1AF5654C85AC496CAA4595D5CF47C6 DPCUBED
637,467,634 *41A1BB4A7070F657E25A9C0319C377F3F7C469CE D:QC9
637,467,635 *41AE0ED9316705FDD2BD64F3DF4099498C4A73D1 d_r"d
637,467,636 *41A250E2A5F0365FDE705FD162ECDD9E8C6C99D7 DROOKGRUW1
637,467,637 *41ADD8DD9A0A82831CD7F3746E2661D5D437797E DrRing-a-Ding
637,467,638 *41A97061EA427BCC832F11ACE399110809F28E26 DS3M6
637,467,639 *41A3F3F420D11AFAF74444E276B0DE977185C34A DUKAEKOR7
637,467,640 *41AD6BD578D5AA70B40D780143AEE62EF982B2F1 dunayem
637,467,641 *41AB7E49F3EAADF02D53883E5EA94844F6272417 EARLDEBARTOLO
637,467,642 *41A8DBB1E47A77BC365A320B76113492E6FFDAAD ECTRADE[email protected]
637,467,643 *41ADD7CEC0F31E71A303004F5C07302F42FE008D EDAWTNE8
637,467,644 *41AD4969E08BBC2F6B9B61AD861151B72B5F386F edmundotrammel
637,467,645 *41A8B56B1A695F69670CA133FE1FD734AE4D138A EH:GA
637,467,646 *41A20651E53A07DFF4601A12E3CAC8158D5DB783 ELDONHOFSTAD
637,467,647 *41A95134267A1C3549F3AFFF391D60EF5D76CD4D elivandagriff
637,467,648 *41A92131637324A71DC0144C9529D21D2CFC1528 ELLIOTTSEPER
637,467,649 *41AAB2A638C8B79D176944002485B4E4B88F4DE7 ELLSWORTHMAMARIL
637,467,650 *41A99EEBB6903CD217469A7BC33027DA28F93AA7 elmerpere
637,467,651 *41A653FEB26B98B8FF9F2E7577881B581FB7B8E7 emanuel1452
637,467,652 *41A035D4437628EE91A3C1915CC26F123E3BCFD0 [email protected]
637,467,653 *41AC952F5242EA66BE8A2612DAC6CE99DFCDF90E enbwm
637,467,654 *41A27BC33DDEABADFD1192E81CE1A9A0339A6E72 ENDOCHONDRAL5
637,467,655 *41A224EF6D562D103E922243E4E36A85F243942C ENIBBACS9
637,467,656 *41AA22E7DB2B63D4C029CBC77A054D2887691145 ENMILL1352
637,467,657 *41A2AE07393156602B8B6D38772B5D8C2711FEC3 EPAIMES3
637,467,658 *41A6EB9E77FF94996E69287A74C89191E20C7B34 EQF/
637,467,659 *41A75DD8C129BC56AD02047F4B2F65FFE87A7723 erggaorp
637,467,660 *41AAC14344AE131AC441CDCE52C197283EC766CE esclusas9
637,467,661 *41ABFBA83FB4659F9BE07046E861245A562E4336 EURYS70MA70US
637,467,662 *41A2FA39144B191191D617E21A890D0C817D6BB9 EVIDENCEISEVERYWHERE
637,467,663 *41A66E14EE15EB26FBA9536232445F65077DC30C FELIX.MAGETTE
637,467,664 *41A7778F60A850D0417BBFCA481E08AEA21FF1E1 felonturnedinvesti
637,467,665 *41A0883752BDE8D4235FE2ED246442A1474D05F6 FERDINAND.GANS
637,467,666 *41A6BAB389AB48063E085F2AB1B1766709FDDB01 [email protected]
637,467,667 *41A83B8F4F07A86A804819B9E23AF680CCDAFC6A Fidelio-Overture-in-E-major,-Op72c
637,467,668 *41A6828F97F609166FC207F7E257F77685AAC781 (firstmurderer:)
637,467,669 *41AD878E7424CFBB0579A08C169A82CDCA135162 FLORENTINONESSNER
637,467,670 *41A30EC709453F09A0389F2BD233709844C064C6 FLYINGTOMATO
637,467,671 *41A4C2824B9A19043A211566F857EBDB86AE035E [email protected]
637,467,672 *41A91F72558A1C9D833F19A4D9E8B28E019AD5ED FRASER PATRICK
637,467,673 *41ACE6B5097D179EAE78C7E2CC697EB1215D768F FRASTÅR
637,467,674 *41A89772B85DA2FEECA15F987FAD823A6C8F5FEE FREDERIC.SHADAZZ
637,467,675 *41A85F87CDB394911420AAD18FCB8B7C7E622D69 FUNDAŞULUI
637,467,676 *41A32BE2BBC7938D985625D7A26E466855A49244 FUTBOL EN ESPA
637,467,677 *41AB04C76220153CE4E74FCCAE042BBDDCFAD624 [email protected]
637,467,678 *41A88FC2DD6EF1B4F24E89225869651232442437 G1OSSING
637,467,679 *41A054AAA9600C080F0C883654EF84C9C085C971 GAMBIA.GTBANK.COM
637,467,680 *41A3EEB38D7C7587F13A1B3B9E812159D8F5B5D3 [email protected]
637,467,681 *41AE66CD942DC29DFADAC37A725FAAA65595AF2D gaylegalkin
637,467,682 *41A3A319CB1EE80BC52BFF34E6577ABB4888F65E GDWIGHT6
637,467,683 *41ADA9F654CE503EC09A508BC17FCE889A172008 gemanierdheid
637,467,684 *41A03D89A56C34A47079E7BE8FFAB7D53BCBDD84 gercsenyi
637,467,685 *41A92BBF2724B80F59E9744CC0C68443E670ED22 ghmz
637,467,686 *41A6D5B1266A302DB284042D63C38C99AC6D4A6C ginoleins
637,467,687 *41A3CF91266B46C91A895530FB9485590EC799D9 GIVEYOUTHELIE
637,467,688 *41A0CB878D230D2F7A8A62683AE99D359726AE15 GMRAJAR
637,467,689 *41A6177B2A80C9A9A09016CED3C2CA67CAC93F00 gniplup2
637,467,690 *41AA3435F7270FF2C2191271928FE0F28F88A624 g!oa
637,467,691 *41A23EA1547835A289F6F3EDF9B4E8BDF12DB69B goldbergvariationen, bwv 988: variatio 5 a 1 ovvero 2 clav
637,467,692 *41A3C2C2B3135683D8167BBCD99760F41ACE5159 GOOGLEFREE
637,467,693 *41A080ECBBF440271265DC91866570E698EEAFF6 grfschrft9
637,467,694 *41A4A98EC239FF2AAD4D47E0EC192DFE451E78D6 grouperez
637,467,695 *41A4CFD78B8A83B5EAE266E506546225097EE03F gru123
637,467,696 *41A72BFF2F5B7F0038E5D90B7E1028794D124D25 [email protected]
637,467,697 *41A1C1B3BAD264234428DE093C9A8B95E257B789 [email protected]
637,467,698 *41A9A118BF5D2077051BAD5D4DFE260CF2842879 Hackl3.fl
637,467,699 *41A557B08A3DF1E6A226A03B05E0297767D931A7 HACKL3 FL
637,467,700 *41A42AF5CBDDF63D196C0305F4827FE054094452 halima-hassan
637,467,701 *41A9B40882CA497C5BAC3867B009DFBD643E000F HAMEERAS
637,467,702 *41AF110F989384D62489D663E55CB11AC5B72119 [email protected]
637,467,703 *41AC30482C2AB15ACC2F74FBD6BE6606C63C71E9 HAPPY.2
637,467,704 *41A2766016EBD14B07E83F16FB23623E9B63A908 HARLEMTRANCE(FEAT.GMS&BANSI)
637,467,705 *41A0E027942BA05CE8AE5D701F33A58567E2AEA0 harmicenergies
637,467,706 *41ACCFB2B1E8462E9A10EFE7834AF1057FDF5459 HAWKEYEROBBIE
637,467,707 *41A83F7EBEA27AA1522A755D74645628955BEB20 HEATHWOHNER
637,467,708 *41AE2E46D88E8058A61B59718DF4FF300543EA47 heimasu
637,467,709 *41A1D54E17EE1BF57513A8F0A25075DC811F7B38 HENNY IWAN
637,467,710