List database


# MySQL hash MySQL password
622,000,001 *400A04E3E6A3F1DB76CEE62AD7164618ADA51152 Arutujig8
622,000,002 *400542A96A4E119814D98A25230631128D7BB3C0 Aruu%
622,000,003 *400C190E9A8EF56A8A0FFE77F2A7D613F93457AC Aru-v
622,000,004 *4008ED3C5FC403A9740BE9A2699258513C37BE3A ARUXa
622,000,005 *400F934725E874317077A5596E3FC34680EA6526 ARuZ1
622,000,006 *400A2640F773873C045BF46F784F3B0FF5C220BF AR.v
622,000,007 *4003A32ACCCF60825B9DCD1DD17FA8055E02714F ArV".
622,000,008 *40079214DFE2BB0E941FF1F1D006878E36D0B955 ARv6
622,000,009 *400954439DEB2315BBF123DA82CDE0B31C05FF01 ARv8$
622,000,010 *400D3497E84851F17CC7D7A9964D2A960EE01CFC Ar=V8
622,000,011 *400D713AF4493893F0560213C9EA8CEB67AAFD02 arvatute
622,000,012 *400BE2B589F43B969D079E57DBCDFA3FF965C98C A"rvb
622,000,013 *400AA4448C72DD1F7171DEFA5959CC1536209E31 ArVBb
622,000,014 *400A9782AA08952E75EC2D3CDF39698BD1FDC2CF Arvelod
622,000,015 *40077351953BC03F080E91903C19A3316BBA9FFF árverésein
622,000,016 *400FB7D85A8D4677CE56C213419D11F804351693 [email protected]
622,000,017 *40005E7FD665F1F5C85BCCD01473AE36762782FB Ar
622,000,018 *400C2E2AAAFBECB1DF45DC1A0FCA6A7635FFC111 arvibsw2
622,000,019 *4004D43CE57260FFA20EEE16818E92D206D84003 ARVIDBSW
622,000,020 *400C21A273AE0284158B7501489E19E8DBA3D233 arvind vignesh
622,000,021 *400EE91C01DD47BDE190760672DDA9050A8EC87A arvioisin1
622,000,022 *400251ECA6B3851B5A8D1D3C0E6616AAD37FC4FB Arv(o
622,000,023 *400D0075E32E95AF854369C01B5D8C2D4FC725BF ArvoPartandLouHarrison:BerlinerMesse/MassToSt.Anthony
622,000,024 *400E5B9D27DE50833797121B47B4554C62A7B4B4 A&rvp
622,000,025 *4006B666265DF8927941EEF3C4EF1DC9F44D1D7B AR.Vr
622,000,026 *4001B3724C97E18504CAAABD45D680345DC73ECA [email protected]
622,000,027 *4008F6434601FEAC1C1C4334960E4E8E86099418 ARV--THERE'S
622,000,028 *400A7CD267F2F40439E88DC44242E43294AD4F0A AR(VX
622,000,029 *40007A2ED88CE399C32DCF1D82E72C807A632075 A"RW#
622,000,030 *400E685125730F78B3400ED6C2DC5A5A66626C5F A&R_W
622,000,031 *40080EC49837BF6A2E0D31431DDFC638F2CB3343 AR!;W
622,000,032 *40046E819010597C6A2DEE5E89BE30B1A5F8A5B6 A#rW_
622,000,033 *400DD48B254C925A1E130DE49E009118CB976547 A;r)w
622,000,034 *4004D32AB8399492A2C1EF41E012AA53AAED10A1 Arw;,
622,000,035 *40080356F0A9B7CC4736B2CD26436226E592308B Arw%7
622,000,036 *40030073AEC007D103229AB8CAC9FA9ADC12DF33 Ar(wa
622,000,037 *400B8167E7405A06D3388B747DEEB76B394CE393 arwastabygd
622,000,038 *400A2B8835C2080F1C92A2B1CFE997F1D166864A ArweO
622,000,039 *400054FA420ACE39A0DADCAEB9A28328A22BC424 Ar!wf
622,000,040 *40027B1FC1011A82FCB529101B69369BED68E6B9 ArWfH
622,000,041 *4000343D183EE77F71F6FB6FF2AEED600D056046 A%rWG
622,000,042 *4003701F4939DB9E4DB6ABBBE411386F0D359CB6 ARWH;
622,000,043 *40000AA35BA888F6F2B52BAF39008645F84C9E4D ArWNZ
622,000,044 *400DCE86CBC9044E37D291270D8E936E384D4E44 ArWO
622,000,045 *4003FF39066BF52907A27F3E325CE5C89CF2877A A$rWT
622,000,046 *400D016DB131A09328405DCB3F1B5232782E7956 ArWVl
622,000,047 *4006E5EF0579B3C380B6AFF6062AF3634B83082C arwyc
622,000,048 *40096091B1B3D3A49DF05995842700A213535A79 A#,rX
622,000,049 *400D72DB63FC6B571C5CEC6037C07A940F6576D6 ArX5(
622,000,050 *40000E483D87FA64BF15FB5344B6EAF706961E52 AR!Xg
622,000,051 *4002EE07F412832BB92DE4EAD69FE3CADC547C47 [email protected]
622,000,052 *400DA0B1C1F47FF9CC93D50D7D2B8FD590D19D21 A,R)Y
622,000,053 *400DBDB3D1B47C1D4944D2D58E616287C7748BF4 aryadewasteaua1234
622,000,054 *4007745D7D00AAD615C347C5A547A54762643FE2 aryanna375
622,000,055 *400F692968217FD58F865ADE3EC2EC367398B854 Aryanna45
622,000,056 *4003266377CAD305FBDBEF58D11B948D62A496BF arye6672
622,000,057 *4007CF0F4F39EE4E0E7B622144A9547A8A80B22F Aryhpmes0
622,000,058 *400B6419AF2210382292266CF6D5AAF965EB5352 [email protected]
622,000,059 *400CF4B02F95D3CF3BD9C72462312F0ACD54AF4D A$RYK
622,000,060 *4003A3C6CFB73F2EE997F5C6D4594E67964159B0 A$RYt
622,000,061 *40023A94967D9DF307F6FD2594DDFA920537CCE3 A,rYT
622,000,062 *400DEEE1AF89F3B2E69E329FCC5C6EC5EC0C9D66 ArYTi
622,000,063 *4004018722EBC015E33D7DBC30BB0A93613EEF07 A++rZ
622,000,064 *400BEEF14B4EC7DDF07E1704A70D9C2EFF510483 Ar)Z)
622,000,065 *4005046012209E533F41734CA58B1159AEBB87E7 Aržanovista
622,000,066 *4002ABFE5F904B74AEE3AD088238E41BADA35859 AR"Zk
622,000,067 *400DA8D914A7CBA7B6C51BFD5499DB211924CCC3 ARZKN
622,000,068 *400B1E7B14BF60FFCB21C72148FD09C1907CA1ED arzneimittelwirkungen“
622,000,069 *400F8689011895F2E36A02ED19538FB8B364312A arzoohassan
622,000,070 *40060696204ECD96736D66B0722D7E7ECEB34B9C arzullas
622,000,071 *400A1637458082F06D6444F2C66CA64036BD480A arzuza1
622,000,072 *400B5DAAC41A909F967683B8B3D0D1C023D1DC91 A~=S
622,000,073 *400680C03CE0B8B96D771568EFD5F26FAE1B8863 A,!.S
622,000,074 *4001FC755F00F8DAF9542DDBA1DD2AFDEAC9FE33 A,&S=
622,000,075 *4002B50D3D681A5B7F59768491A5D13A13A1297C A:S.;
622,000,076 *40071BDEB91452669766B5DCB1A8E1E2EC784999 A!)S)
622,000,077 *4007354241F71E51AC69A715AA91A0C692F5967F A?S";
622,000,078 *4006A07793BD0DA7BB37B3973ECF2EBE0E08CD22 A+!S)
622,000,079 *400C6CA094888FD9D7B7ADFB5645D5BC0FB1F281 A+)S&
622,000,080 *400E3574EA16F46FE9C4BF44C74526563BC204CD A+S+$
622,000,081 *4006073DC50FA22FBD9D9019B369BC0B307E7EFC AS:$%
622,000,082 *400B9CEB6072AE23AB9256613CDED3AAD9D830A0 AS"-$
622,000,083 *4001405F8E37F03ABE01BD4DA3A2C1C796494FB0 AS
622,000,084 *400A037A75EFFAC1934237578E8EA333115A35FC AS
622,000,085 *4009637BC055C7D8FAE7BD8B283080A8414282DD A=)?s
622,000,086 *400219DB82ED0A3A74C0D3A874DF4835C5E3320F A_(-s
622,000,087 *400287B653A20545F4281DF1BBE40F4DF3BD12E3 A.(s.
622,000,088 *400115B819300D46AF351373C50E1200A87014BB A&s-:
622,000,089 *400D351AF9B06397496FB1E7C45FC36C79781019 As=\
622,000,090 *4004C2BE7F53762F601B452E6B465A8DBB7F24FE AS0RD
622,000,091 *400F3188375D2F2D6278A236A69BB187049FF83F A"s0W
622,000,092 *400136CC3D3330DFF96A87479D4475A442EC59BF AS)0Y
622,000,093 *4002079AFD58069108C966BA07798B5F3050E789 As1-.
622,000,094 *400EBE8E5AC7FFB292C6E8B268A40731377CE353 As1&4
622,000,095 *400B6E5ADA5F28946680716D98EBDBA5F5CA6461 As14Z
622,000,096 *4009D914DAC886966519317F47F3DBE773EA2F98 As1g%
622,000,097 *400931D8E8A0305C42029BBCA0F3E237820E70E0 As1o+
622,000,098 *4004C09AFE20F5BBBB77D8CA976D4E2440708A2C As1r
622,000,099 *400AA018AD2CAA8B067BF38537723309FCB67376 AS1t(
622,000,100 *4005F468CAC1AB808FE675CD548A63A780654347 A!s2#
622,000,101 *400FE54CD1AD8AFA1AE3FC6DB698F249F9922C68 As2?,
622,000,102 *400F7C6294BCACCC1C1BB2941F13B3A2392926AB [email protected]
622,000,103 *4004EA57060AC988469F9E569F08CEB3797E901C AS2b0
622,000,104 *4004F0F2CCF09074DF5C5E9CE7E8EF2062C43E4A As2i7
622,000,105 *400BB7F875E34106D385FB68A0D2036B9152152F AS2kR
622,000,106 *40029AD96092A26C5F6E05834208FCF0A4D98D73 As2N+
622,000,107 *400375B7C5BD1EFD700D7BC42CFCD6864DE65BED As2oK
622,000,108 *400E9E4A64AB012689AB801700F96B6CF7FB4FE9 As2Pu
622,000,109 *400201C5CD636DD9F87C44ACF7812378F3DA6908 AS2U%
622,000,110 *400364259AEDB6327E1D56C187DF22F06014DEB9 As2WI
622,000,111 *400A6476A91DEE27FE31AC6EFB5E1AE9DD623280 AS-&3
622,000,112 *400080180ACB727D5A51EB2C83874DF2A80C2C6F AS.3.
622,000,113 *400C64EE8A40B895858A35AB3045C8634FED1CB8 As3fD
622,000,114 *400327689B182EB61D2164B6F07BC4A4E5B74DB5 As3$K
622,000,115 *4000BE8B61F156A6DCAF36D4054153292DEB6AE4 as3uehus
622,000,116 *4009EB7EF379CBF1BFC66F0259FACB9499AE54FB AS
622,000,117 *400FB2BFDB738BD1F2062F4D8B21304B35F51210 As408
622,000,118 *4002BF22784634C91DEEE4EC8B7D79F8C844EFB6 As4#d
622,000,119 *400FB3578522E0DD12E3FC83FB76EEF9C8AA4916 As4D7
622,000,120 *400ED4CC8DE24131D8728C3862908DFA809F75B9 As4FQ
622,000,121 *40008EADE3DEC096C8D1714CB23A97BDA0788D70 A;S4I
622,000,122 *40055E82463143A3817CCA382F13F9DDD4D20B0F As58p
622,000,123 *400F82E8B82169D25586B2D045EA416C47F815CA As5Ib
622,000,124 *400BF6458CF93675001EC2D65C6BF8FB5F4785B3 AS5R;
622,000,125 *400EA21B4F2FC4EA9705A6F96597CD718DA7EC38 A_S,6
622,000,126 *400903BF837992BB87DCBCA3EE37316FB0EDB4B2 As,6/
622,000,127 *400105B46F4615623CAF0A9B9D7FB7EA25CEEA1B As++6
622,000,128 *4000C56F0918F9A2F3F396E3A0B3A9CC8ED98F7D As632
622,000,129 *400908627364DE2B950E17EBB3BB7805019AF201 A+s6b
622,000,130 *40026E5E9BA5AD201D1169A6B071B5081E892D31 AS7#,
622,000,131 *40056A7C6F43E436B36537EAEB650A34B4A53E26 AS7
622,000,132 *400AF52F41EB64EBB10E8F2854CB0927CD15B1AB A_+s7
622,000,133 *400FFD947E25D09E985BD5E7907108FF17D6D4EC as7er11dae
622,000,134 *4004F7DA4EE0DA82700FFD1646A6B89B88FB7E2D AS7?G
622,000,135 *4000742A713EC478387E7DF09B84D506DB4224AA As7LF
622,000,136 *400F8483314D593808AFE23A375222F4E4C5F6BF As7N?
622,000,137 *4009120E60BCB83D07F9A326EB85923287F66A3A A;S8"
622,000,138 *400D13A8564255244F8AA9A9C8FEB1A637D922CC As8
622,000,139 *4003D19FA5E52FB17218803818BE9C777B6D6748 AS%82
622,000,140 *400CE80635D6A7C056086F3377D831C329DD95AF As8CE
622,000,141 *4002DA8BB89FA56C2358AC5C1777DDA808E8488D As8qF
622,000,142 *40046098AE1A010B61D363743E7AE06A0FEAA499 As?8U
622,000,143 *400D94F1CF1A314AF72945F59705BE9A11A31D37 As8$V
622,000,144 *400C1899FD5BF4DCEA3232045E9401FFAC9FD443 As;8v
622,000,145 *400C9E9F20025AF79354E0DA4643E4DD5C411FC9 A:S/9
622,000,146 *40042BD1B8A8BC7B2002FDE7858F760F5C42BB62 A,$s9
622,000,147 *40062787F3C4F7C1CAAE0DF5994C681F154DD502 As?
622,000,148 *400B018B42E37CBB29D0DF2ED386686F7DA3644D Asa48
622,000,149 *400E19F5F3D74446222D6ABB16E7B3858097B52C Asabamok4
622,000,150 *400564934F32D0AEF27F5581AE1EFDB6F2874459 asa.beldon
622,000,151 *4003229240DC6C6C6487CE6C744BC1C4939E086F asa.belmonte
622,000,152 *4002861FFAB68B3FBC5E7869FF707A605F758418 asa.bombardier
622,000,153 *4005AF0F1F01490C1684B487E24BCA613F95AD48 Asacabsw0
622,000,154 *400A6AC2F0FBACFB7A77213BF0BDD2B7F8884715 asa.callister
622,000,155 *400C3EF4F56E7CA607887DF3484231FACEA6DCEE asa.colston
622,000,156 *40058F14F58FD1DDE12E4C1B2F6B1CA1007D27C1 asa.coomey
622,000,157 *40008DC3FA0CDE2B3613DD8207F1569FC11E2A06 asa.coyt
622,000,158 *400CCF4168845576F34970E0BB57DB0CD123577F asa.fooks
622,000,159 *40017A0DA7CDD3F7F505A8D6EE200E892FCD1174 Asagaered
622,000,160 *4002C9848DA17DF3AA5A3406671F7F40512D5359 asagiigawa
622,000,161 *400BD0C90F14A48EE6C0AA7DBE44D074F90769C8 asa.goepel
622,000,162 *4000E7F3940F15C663821130AD98B22EEA4497C0 Asaguán
622,000,163 *400A4930239B8A7A4445858EAEC3D6BB606260E8 asa.guilfoos
622,000,164 *400501874A2847E2D38D1F13EA7B518BC920BAD4 asa.haas
622,000,165 *40025BBE2A09C9DB075623A8DE702E106418E2D8 asa.haddad
622,000,166 *40033FFDECDB44373BDD34AFF0287C55F74029FC asa.hamiltan
622,000,167 *400D235069869E297F6E85E532378CAB503414D2 [email protected]
622,000,168 *4008FB03FCC81AD483C0BB269F22033C37DAA97C asahib 1 0
622,000,169 *40069F1976D5C52FA72FFE7E0CA0CE52EC5349A0 asa.kager
622,000,170 *400BD2E2BA30F1BE0C17B7327F06EC11CA337269 asako yamamoto
622,000,171 *400CA11D10A7B1BE1C50D72DF09DC65F395A86F9 asa.linscomb
622,000,172 *4005BD5FC75C80F85669DE22F5BD5E2644359F8C [email protected]
622,000,173 *40039FEB96E19B517A6CB5166E3500F6C3E67457 asa.mugrage
622,000,174 *4006F06FDD82B0B24ED673B6AA0DCE179B1CAB0B asanawa1
622,000,175 *4007333EF61631DB97CAB33DB3DF9B9F7311839E àsandiko
622,000,176 *4000A9D019EF090A520F352428A39327139DFDC6 asa.neang
622,000,177 *400DCD6766AA244721FEC2B736BF1624E3A04B91 asa.nolton
622,000,178 *400E00E6876BBE2E51D6CAB2263DB1B6E5BB5631 asanx.25communityof
622,000,179 *4001A2FED10C81FDC3565602D72AB28D94B0FB0B ASaoM
622,000,180 *4009280A41B993392605F46F8A120E9651A3952D asa.otwell
622,000,181 *400552D891F0C906BB69CB72C40E115A2A8A7EAB asa.pals
622,000,182 *4006319CCC1B058D7055CE2765D66CAC09BDFD62 asa.polak
622,000,183 *400072EDCB84881602CEAE7FAB6C34E86E6B410D ASaqF
622,000,184 *400E777BC069B0A01A61C7CF58641A6C498217FD aşarken
622,000,185 *400EDDCC045D269210056441DCBB7B7210EFFAEB [email protected]
622,000,186 *4009F356C549BBE47CE89A171BB9B3AA2CEFCC39 asa.saitta
622,000,187 *40084C9EE77F9344AAA1D39EEF3E15E72C283F87 asa.shorkey
622,000,188 *400A5F34381570BC4272B7033F5E2D7FE90E154E asashoryu-yokozuna
622,000,189 *40003BD507EC40F6F29CC25FEBFC7C146625B7CD asaside6
622,000,190 *40046ABB109875EECCAAFFD8A088F3E715755475 asa.stephensen
622,000,191 *4002EBD8ED3E7FE6D734DC835ED2F9220AD3BA6A asa.swire
622,000,192 *400EBE7B88F7E70134106380E7DF8EDAA5697097 asa.thibadeau
622,000,193 *400B73148F946ED9C6BD7BD47B376E7DC4372E81 asa.tweedle
622,000,194 *400FE6A3076D0C3C9932FD6B147E8635F1E908A9 asa.ugolini
622,000,195 *400D9F5FBD0F1F64F225054C5B9B4DBC2E63D2FB asa.vanslyke
622,000,196 *4007C30E51AFE9D426A4BB6E11A3B6971F88F5C3 asa.wanker
622,000,197 *400A9AFBD791F8CCC4C3C40B4C497EC905BD70D1 asa.waye
622,000,198 *400935FE8C7343196A6F97D4EF93BC13079A86B1 A,saZ
622,000,199 *400B8720B7695D81AE639A8748BC6E06596D710F A/Sb,
622,000,200 *40005A6DD59EF16F9B2DD97B66C7BBE644FED23A AS/b$
622,000,201 *4005BB1E3D3B78582E08E629E5F2B3FDEE0524DF ASb"$
622,000,202 *4000A657D31C6CF73638F480A648DBF50B70315E A"sB:
622,000,203 *400B9C5901EC2B1AF18878A25BB8633BE0736447 A-sb=
622,000,204 *40058CF94A9AA79CF8BE70A704E84281CCB87DB0 As"b
622,000,205 *4006FE4F8C38E1B48D5893F7C0E90187D31D6258 ASbaA
622,000,206 *400A37149D9186F832C7BB26D576E124BDABB2DC Asb"B
622,000,207 *40072CBADE44F95B61D413D67540319D52C05479 ASBbQ
622,000,208 *400C01D6DBDFD08EA06AC9416F85B5FD192F2EFF A:Sbd
622,000,209 *4004ACDB1BBAC169158D42F24FE2E139B6E27AC3 [email protected]
622,000,210 *400AB7A0680EC9430420ABDBB31643609FFFBF0F Asbestered
622,000,211 *40091514FCC77435670A1618D824CD1F3BBD47FE AS,bm
622,000,212 *400DC85B40DC873B5F8AE7B4B37C039667DC1212 AsbN(
622,000,213 *400DAB40C2368AB260B22AF1D5FB03777D917477 As bring me to the sight of Isabella,
622,000,214 *400D6CC2E87F0B87431DD8C2F698BB297CF9E053 A:SbS
622,000,215 *400FC8511A44506CCC41D9200113DA0A9FAD88D5 [email protected]
622,000,216 *4003889302009306718888874F670E1245785544 ASC"
622,000,217 *4007A2BCF0438D88764E33F50327C0BB6E2C6835 AS_#c
622,000,218 *4007A54C7A001A21EEC353F6EB989DC0DF055AB0 As%C!
622,000,219 *40002CCF455C327075F6CA488683DB3B0C41A265 ASC#1
622,000,220 *400B5ECB1B4E290F4568766FF0FC2D7057752884 AsC5j
622,000,221 *4009E2E650241F072E79030852822D7077E261C6 Ascanio in Alba, K. 111: Act I, Scene IV. No. 14 Aria "Come
622,000,222 *4007A86EC4E5875C3B9C80081C64183300A085CA Ascanusing
622,000,223 *400639E8C2B3A4CD679ED8F0C41C673F5C16CE26 ascaridoL
622,000,224 *400742F7D597E3A896F8559883F869AAA3576A68 A,SCc
622,000,225 *4005B2EB5A934C9B9DE1C8388557AF2C43057772 Asce+!cs
622,000,226 *400C890BF52847BF4B869811B7B1A0ECB08AB269 “Ascending
622,000,227 *400F6202D15D520D1A7481B6C5640BCFB55EB400 Ascending”
622,000,228 *4002D04F4F25EEF4F737D8674B31176753B088B3 ascensiontide3
622,000,229 *40094BB0F4A528BCAA6CA7C4FFA1E9B4D895CB5D ascensor4
622,000,230 *400BB5772B66A6F5AF60E042A9E1F3C03A5F16BA AsCg
622,000,231 *400E445C215C8352F4B8570DD4950DBDC96D2E96 AscgE
622,000,232 *400F439B5A0C75C4EF10B3D269AF28390224138B Aschasting
622,000,233 *4006B1E643A66E34F49EC036416E1CE0312F4BAF as.cheesedreams
622,000,234 *4006DC507EB646CE649D2C8842BEF6DB700AC599 Aschetto
622,000,235 *4002C4AD4385D07853F4B4A53C786850642C0BF4 Aschlei3
622,000,236 *4007619BFE5DAF56E94E128D8F4FC9B87CF63BC2 Ascho
622,000,237 *40000538871B759CF6A0247F2CAAE25F2D269E09 aschschatir
622,000,238 *400BA606F3C8AAC2649132361AC5ED089A793EED AscHT
622,000,239 *400744FB8BA462C4489F516CC3D65362253DD3F0 asciied8
622,000,240 *400A98DA37A58384955853A3C63E1603FEDBC3AF asciutto2
622,000,241 *4007CC39C0EBDA1509C06B484184A34863CFE799 asclepiadaceaing
622,000,242 *400A8FFF7E964AFE05F41ABAA343C00DE549A8D3 AsCLK
622,000,243 *400516906A3234C6A814A8F27E0F85CCD1374BC8 ASc#M
622,000,244 *400B75638F1721B14FDBA59FEC2D6BC552227805 Ascoltal'infinita
622,000,245 *4006A5EEE6485E95AE9A962F6070E73FAC4BA6BB Ascondimiento
622,000,246 *400FBE02E3FA1457989F3342211A8F9BBF22FF38 As Contas de Deus
622,000,247 *4006DA52A6DC93C08018FE34DBE34A02013EB0DA Ascorbinsyre?
622,000,248 *400F88492DCE878F2B01BDF2F04BBAFD8C2971AB AsCR(
622,000,249 *400BF78A73A42DC6EEFFABEC003F90C01938D468 Asc
622,000,250 *40030DE15CD497188F2CD33E4EE0039D1253ECE6 AS;Cu
622,000,251 *4008D3F9AF72C82C3CFF50A003A083A4FC7129D2 Ascuncioning
622,000,252 *4005E2C1004ADA30518A4AE7926144B97462B4AF ascuth
622,000,253 *40068AE624EF936CDA5521F2F2CF2F84F04F1E7B As)CX
622,000,254 *40081E258DA1845E78D1AD6E86755CDF8B6B1ECF A;&SD
622,000,255 *400B7EC123B3C0F19C3F9D7A232C4C6EDF3FC522 ASD;%
622,000,256 *400D95AE21CAFFA67AB64322C6E233BA3BA72989 A/Sd,
622,000,257 *4002412C356F3CEDA4F2B2AFED34BF5F0E1422F1 A!sd%
622,000,258 *400524AE2CF0511D2E3ACF3F8E6A97EB1186DB7F A#%sd
622,000,259 *400E11873D45906BC260F4859224E98BFE0D7EFD asd08259
622,000,260 *400B22B92582D0B7E021C8378EA05D3C4739A357 asd229
622,000,261 *40059BFC7472BBCA313CF0D22F57B65DB04A66B5 asd33693369
622,000,262 *4005F45F549A798EFA38C9B28FBCCF57949FBE1D ASD7X
622,000,263 *400E230931EE10C219D69F4F2A58911BAEDA604F AsdA?
622,000,264 *40026D83EC226C13CC1C703CEF203C76A01BBF61 asdcluster
622,000,265 *400BCA03A279ED2B3315AB7EC449CF09038F11FB asdcvbiu
622,000,266 *40035445912A8DF3C6E3F077DCDEE9958A7488DA asdewq.bbs
622,000,267 *400FEDDE791E52809E0CDFC47483133B17F6F337 asdf1478
622,000,268 *400B66D68A1251A94AB96A1DB4A4B24DD86BA38C asdf8692
622,000,269 *400251B0A960B3E0B6365E3EBF248EC584749261 Asdfbfied
622,000,270 *400696D449AFCD78BD36D922AD08817BE981FB5A asdfg375
622,000,271 *40004050140DBA1F7D3C672B1220D47B3C0710AA asdfg41489
622,000,272 *400D099B63424F978E3887C7B50C9AC3F672864B asdfg441
622,000,273 *4002F43F32B33A4481EC404B1E8F8F4254B38E9E ASDFGHFISH1
622,000,274 *400D8E68E5356DA94A80256044481AC1651E4D8F Asdfghjkbarney
622,000,275 *400D865FDB92241EAB709D0EB221CA7DB2309D60 asdfghjkchucky
622,000,276 *4006FA48CB3BDD7511446CF36189E4D208A843BC Asdfghjkd1
622,000,277 *4008AC048A6EA24359B6839A29BF0E489EAE6031 ASDFGHJKGOLFER
622,000,278 *400DA32DB7EE43097AA2B79ACF8B14A63146FBE4 Asdfghjkl257
622,000,279 *400DCB46D22BA941F38E522D885F65FCC55218BA Asdfghjkl453
622,000,280 *400D9B0C26028B7B0A88AB172B5C688C5487B334 Asdfghjkl949
622,000,281 *4000FB36FFE43EB4B8736A85AB53D581BFE1E5F7 ASDFGHJKzxcvbnm
622,000,282 *400C1852701062B237B05D657F78B3FA1E848B7A Asdfghljf7
622,000,283 *4002648BF75B4A49D0E2D1AF45432F4DD4CEA9C0 Asdfghppp4
622,000,284 *400870A32C9C0F09354FB86A918B4ABF4B45CB5C Asdfjkl1907
622,000,285 *400D145195067185DE9A5088D7F5BBF01DDF95AB Asdfjklariane
622,000,286 *400F79F56F84D877444D23AE2B316A4E3A383FAF ASDFJKLSHARON
622,000,287 *400D64A0490AE7301C41E045423C1298B33DFD37 Asdfjklsylvia
622,000,288 *40034001608708C0D1BCB75E43A0BF76A9F1E613 Asdfjkl;T
622,000,289 *40005FD1325373286D5E34334E3338D3CBFA0983 asdfkhang
622,000,290 *400AE29E15718012D51CD04D4DA4CC5242E533B3 asdfking1160talk160
622,000,291 *4005E9113DE7A04BD586013A8FAD0739F98A0E62 Asdfpaula9
622,000,292 *400FFBF2F32029921B7FD6F439C42857AA38FDC4 ASDFSUPERMAN
622,000,293 *4002EDD62D157B6F0E12B693652E9E1A495F1C1A asdf_zp
622,000,294 *400AC86C6A8B306C2312F2D6445FE34E750FA856 AsdHO
622,000,295 *4006B1049E386D710D99EEF38179D5D0489FD956 ASdk+
622,000,296 *400031838102829F7EB7BCC8AD44ACFA2344618C Asdl-
622,000,297 *4009C57B6AD71148B6EA36E174D24C2A3BE8A289 Asdrsbsw3
622,000,298 *4001E009D7B8DB49C1DB1863A8469508108AE27A [email protected]
622,000,299 *4006F5632476E8496F7361E6383D1A209BD58EFF As#-e
622,000,300 *4007CE71A4279624A7A98C52A1141742C6696CBE Aseab
622,000,301 *4002CD02488A97173DE697D0252585F8CBED690E ASEASTA
622,000,302 *400CED218B1D9F2C9AC3EBF7B59276DBA7FA5181 asechire7
622,000,303 *4000B2F601868D2800439C34DAF0F609EEED85FA aseemchaturvedi
622,000,304 *400DE7F143B390575E43A5CF50FA85AD77EE602D ASEESSEMENT
622,000,305 *400AB5641C3933C5A18B406EAB2E411D016A8D5C ASEEU
622,000,306 *400094589FC0354D762925CDA0DE3E491A88DCB8 asegura5
622,000,307 *4004CB92B03AD53D31EF854431F10ABC399774DF aseistariisuntasopimus
622,000,308 *400606C97A0E8D1EEB498460C4EF7D24C78795C5 aseluokituksissaan
622,000,309 *4000535434652D329055AB8108A371F2D17CE2E7 ASemagram
622,000,310 *400A63840A028B1D9ADCA57F4224F0B73831AFE8 asemarebogale
622,000,311 *400083F100F4085685403D6CCE8B03770B836B4C asemic.net
622,000,312 *400E93C65541C74DB9375C5D1C7199716AD5B632 ašen
622,000,313 *400E6479B181E02AE8970A3C99D7B5D92F3611A5 Asentaja3
622,000,314 *4003AEC2B2C5EC0B39EAA5287BD835593BE9CC08 [email protected]
622,000,315 *4005BFFF789BC92E27AB1D020E311100740B2C15 asephikmat
622,000,316 *400F29532D85DC7203658732468411F475F6EF49 Asepsised
622,000,317 *400BDA1E5628E30C5A1A9484F284FD474DFD69BC A+Seq
622,000,318 *4009896F9BB674E57A8BDFBC9927368E480F3DEF A,seR
622,000,319 *4008F275C0FAC69FA5062178A7FD87F383B037CE Aserasiva
622,000,320 *400CA5491B79C8C47F4A259F9065B7F61F0BA1B7 aSERIE
622,000,321 *40057B48FC92B3C050CEE582B7F2889E7A6B753C Aserradased
622,000,322 *40011D1982CDB4A896038DA5FA7C19A31107B2A4 asescin1
622,000,323 *4000546EECF2F98E04A4204781DCBDDD2BF16B6E asesinen7
622,000,324 *400201D011B507737541406BDFABF097843678AD AsesinosDeNovela
622,000,325 *40072DAB3E361A23759E6AC2C1967467325657FE asesinosson
622,000,326 *400489DC2577507911ECB322EAFB65EEB88831C3 Asettuu8
622,000,327 *400877F361B82B338A3B487F797F30E307A722DF As
622,000,328 *4002E64EE26E753F1C294D9E3B6D0BCF49BB70E8 ASEVELIHINNAT
622,000,329 *4009D6A02BE023AB2DBAC4B1EDCA37D566C25AED Asf_;
622,000,330 *400CFB7FED995FA7C670D48D460AE51DA5A80F76 AS,F0
622,000,331 *4002287BE819757525ADC951614420710CA5EA78 Asf7j
622,000,332 *4005E7F0E5F860D57F0BE4A143CBB608695E74CD asfahawoldemichael
622,000,333 *400698EA30B8D5A294BF1FEA8AC8A303B78C578D asfaltes5
622,000,334 *4008FAAC43A3B5F06EFB7CFC950172E4C439BC86 as far as law enforcement was concerned, the issues
622,000,335 *40015E9FB743E7E54964D1B7B5B5DB3F1FF5B8DC A.sFb
622,000,336 *4003CDDFC1BA9F71C7D803071F4B67EC354C1FFC As"Ff
622,000,337 *40066CBFF1419B5668FCC5FB17C89B6F41D8EEB3 AS)fm
622,000,338 *400BB7B30927AB9CC1D0B3D7DFA507A6E6BA54CF A,SfN
622,000,339 *4009C989CA99133A337C857A912F2FA6D6A31BE3 AsfOF
622,000,340 *400D062AB16ED8DB44CF9637E22B634E37055235 asfso
622,000,341 *40021013D7D30A060A751B1752E1D37C52CD98F9 AsFuC
622,000,342 *400DB9335FF84294D0D92FFA6269DF04EDB7A861 asfvm
622,000,343 *400FCF1A0E10A117BFE8DD8AE0B41F1C440F99B2 A$S"g
622,000,344 *4006B08A0DEEDC637CE873149CA7C5C95639FCC8 A_s:G
622,000,345 *4004CD878A9735102730134DD238198CFE888C7F As:.g
622,000,346 *4000CB3FD119410AFD9C09DD7C2D53A79E51E7CC AsG.2
622,000,347 *400C80983A8492C24CADE7A6C001C825589FFF38 Asg5#
622,000,348 *40012542C4B6E09256D88C9953E39AE8CCDB75F9 as-gen-malaysia-britain-us-protest
622,000,349 *4002C38F09E65A8464F85E185D398AB5F4B38B39 AsgFi
622,000,350 *4009F31A0C3680BCC419427331FAFBD888CEBE85 [email protected]
622,000,351 *400CEC60218ACC502559F5BE7589C9CA73B50CED AsgjT
622,000,352 *4006718D6DD0974BEED8BE01570CFAF2ADE6A48D [email protected]
622,000,353 *4002C9CB873DFBD18EE710364BD0B590ECEDAD34 asglu
622,000,354 *400943A1DDDE759921600FFF3526AB9F0D19B26F A#Sgn
622,000,355 *40075A3164C1321190D90BE6AF7A3F7EB0EEFA67 As:gN
622,000,356 *4003B7A6F958FE0FE6C6F3C73F2322C8DEEE13A9 [email protected]
622,000,357 *400F599BDA1C82C972D29ECE0B3F060C6B449278 asgo.bbs
622,000,358 *400F213BF058996B822DE5CCDF27D696A7ABF46B Asgredx
622,000,359 *400D66EE93E31B394EDCCE7E8B3A03E9D1A2873B A"sH+
622,000,360 *4001DC608E3B97CAC16C341AF4332242FB3D7659 ASH1EE
622,000,361 *400B9D902FAE699A6F06E7D5C65C0D44DB121A91 ash46jt
622,000,362 *400B7E7C633605D6F705092AD7B4F2DABA93B386 ASH8125
622,000,363 *400C0FC5A0E0E0822590A007C223F7A076FC9644 ASh8F
622,000,364 *40025B10D29D659FADBAC83725198016A19A2540 ashagate
622,000,365 *400F8C0C5D3C893626D2926B1CAE79AF158D0E35 ashakaas098
622,000,366 *4005EC446C355AF7AFEE0EBB4D81E8EC8188BA7C Ashanaing
622,000,367 *4009B346BFE88A2B8BF02A98E620FD85074F3FD0 Ashander4
622,000,368 *400655E83C150048D5BE776D83A704A036043582 Ashante5
622,000,369 *40024511349E9BF1D26A61755369A31BCAA1EB97 ashantikriget
622,000,370 *400862338FF0A98DDCE95A9D5AB5CACF2B11EE2C ashanti_roberto
622,000,371 *400E478A4FCDB0A176D69FD952B4A2E9BC0E6D7E Asharjaa6
622,000,372 *400100B4C6FE203E95FC62D2448E5F01A28AE3BC AsH-C
622,000,373 *40077DA8C55D42AB4E34D5B640E785124D326164 ASHCLUB
622,000,374 *4008886D76C7CDBBB38D7CC863ED21F78DE44EF4 asheerlove
622,000,375 *400C2E063B74134C5DCE0B758147B1CF80E1A9F4 ashenafiakalu
622,000,376 *400CE01B937CCD1A1EA2E71F0F2445356AACC3C1 asher884
622,000,377 *4009EFAA0BC5014BEEBEE7ED4EB964140424FD13 asher_hunt
622,000,378 *40064FFB0C22D11AC149841AA62B7299A756A9FB Ashette6
622,000,379 *400B8D5B60A2ABC4ED22FA98CB8A6C482DEC15EF asheville3727
622,000,380 *4004FFEF4F0017AE8C6CDD4A3E83CA60F4CEA924 ashgad
622,000,381 *400B3994CCADA806AA51015EB3FEBC9F07B55957 AShgw
622,000,382 *400DF65CC4648F6FFFDA84C03BC8E77AB34D4843 ashidowes
622,000,383 *4000CD73205123907F179DE8ECC03085ED476095 ashieras
622,000,384 *400FA7960AFA9524A4D5D6F73C7FAEBBBE3468A8 Ashiiryata
622,000,385 *4009D6A25E94B3317523A58AE9ECADBF4D5CC5C7 ASHI-NADZUCHI
622,000,386 *40082D824704D0F957F798F83499E753F6799CDF Ashingsmed
622,000,387 *4005E7B80D37BC4F9716D643CE500BBCE8DDF6CB ASHIOUS
622,000,388 *400A1943093FCC1E18409D2677A940334E1AC3EB ashishkhattar
622,000,389 *4005D72B83B4899CDD5A1C55B782D93C548948C8 ashishshuklawj
622,000,390 *4008A72FFADB7BE99E4DA411F72780CCCE3EE818 ASHITEI
622,000,391 *4003EC1E9D87DCFE076CDEFD560C7F27BA0EC39B Ashitugi
622,000,392 *400C3DB271E7745A240165989DFCE4046F4CF11D ashlan derousselle
622,000,393 *4002D5F15C497C7835FC883333AD90A9A353A698 ashlandhayes
622,000,394 *400A5203D2C7E94E5C3A90D7ECE55596375F6F5E ASHLE1GH
622,000,395 *400C37E5255A52BAB81B25FC558BF1781FAFD929 ashleehousewiki
622,000,396 *400E274C916A72B18EB964689D7ADDD47443659D ashlee mcarthur
622,000,397 *40000B88AA80CEF7DD9E658A96D15ADD32008478 Ashless5
622,000,398 *400851FE1945D04C98530DB69BFE6CD1C14A4DD0 [email protected]
622,000,399 *40056F37E6A1AD10E453AF6A233D5AAAC2C3413E ASHLEY-BALLARD
622,000,400 *400A59F3D04CAC56DF789D3714828925C036FF99 ashley.barratt
622,000,401 *400A924DDA2E6ECC0100AB0145F661291990A2AA ashley.bergdorf
622,000,402 *4005C57D340C7DA217B1B2985EEEDAFFB7100A09 ashley.birkenhead
622,000,403 *4008BA44BF5DAD36E5FBC0C66BA964256CFF28E6 ashley blaser
622,000,404 *400A01817FE064CE9BFE8D422FB74B79A1E04CD5 ASHLEYBOBCAT
622,000,405 *400A17EF11BAAC34EF255AB8DF7CAF18ED0195AF ashleycarner
622,000,406 *400B597A87B543E20E8AF63F4B2FA3E7C2AA9276 ashley.cipolloni
622,000,407 *4002C5AEC4C8821517A85275522F2B502CE7FD51 [email protected]
622,000,408 *4004A2B3F9F039AE17553F4D42AE7F50C748AB83 ashley.derusha
622,000,409 *400A37138B365BE9BA8388CAE490E8550B0B38B3 ashley.desgroseillie
622,000,410 *4005CAAF091DC042C4D63E191F7A61563F1B4C29 ashley dilcher
622,000,411 *4003BA5D2177D0887D85F771696DA87031E66567 ashley.diseth
622,000,412 *400C524E4D805F8782966D72E98DA176C0EF7DE3 ashley.farina
622,000,413 *400648D4029BC7FDA156B397246A2E34A7761321 ashley finlayson
622,000,414 *400207115C0D9AC64A5C320736FACF1F9BD4493B ashleygokhool
622,000,415 *40067CABE65DADA314FFC6CF24771C4E847EB8F5 ashley.greydanus
622,000,416 *40098D4FE56C3C9D9C9D70F01341A0DED33FAEC7 ashley haberkorn
622,000,417 *4002A00FCA2D26C616F56577DF6146DEA8D00C8E ashley hon
622,000,418 *4001C6D670B61B94AF1A4B001CA7325082F96650 ashley.katzmann
622,000,419 *40008AAD7129B3E97E3D8CE6AE49C5DA2F9F0647 ashley kitzman
622,000,420 *40057CB3AA7CCBE2BA4EBF7F667262AA8A3DEDA1 ashley lapointe
622,000,421 *40027AC12A65095166EA873EACA8DADBA092E68F ashley metzner
622,000,422 *4004D883F430C059B669D6711ECCD42A6610265D ashley.moreles
622,000,423 *4007A06BC173150091E58AD817667C3476DF4A37 ashleynorton
622,000,424 *40053EDBA408105C62198BA579E8D28063F783DE ashleypenton
622,000,425 *400F928A18D5CE93FA62DC1A86112D17ABBA6F13 ashleyqing
622,000,426 *400A82F8C5D5A8465B17AE4254A991B5C3E9E19D ashley.salls
622,000,427 *400F79C51D14DB3B375538690A18B630AEE2A411 ashley shildt
622,000,428 *4008DD9261155801E39DA2EF9C3EAEC5B0847623 ashley.sholl
622,000,429 *4007D8C10F932353D772413E979A0F4A9879286F ashleyspecht
622,000,430 *400D233D55816F06AD8D087B93F3837F99DF2A89 ashley.tarski
622,000,431 *400DDA28023F95BD40AF6ACF6D716214F25C4E78 ashley.wahba
622,000,432 *4006DD71631BFAD733C183D63AE0E136523081FF ashley warmack
622,000,433 *4003537CFD42192F7CCF91234FEF9C9EE0A422F2 ashley yancey
622,000,434 *4004AD75A204F3FD72A63E29CB163D8727D91364 Ashlynn873
622,000,435 *4001761F705AF95D44B740E35FE38B7A23114123 ashmodais
622,000,436 *400B762B86D257C6A82A48FF8F60A268AF7F3378 ash morris
622,000,437 *400C47B448E0823383E082A5BC40EC57211AF2ED Ashmundshowe
622,000,438 *40092B10271FBC20D45172FA1224D262184BE6AD ASH
622,000,439 *40009A90457FFE8564A2F53C6C464175030C4D57 AsHN3
622,000,440 *40057C2F705CD6D112A0C48846F1AB34EE5543B2 [email protected]
622,000,441 *400990DC5FA245510FA75007983B67AF4077A537 Ashochyo0
622,000,442 *4004F50823B9F6A7D4050EE0402C210ABAF1CACE Ashokaah4
622,000,443 *4002D8A5A8F6F52F9B500EA4E704A3D868997A3D AShortHistoryoftheHumanRace
622,000,444 *40015CD68B2C97EB9D93BFEBA55AA0028EF5E9D0 Ash!r
622,000,445 *400BE3E64F9150615F7771DC623AAFBBDA8947FA ashroman
622,000,446 *400B5F0D576936162794C07D47211F1C1B7837C4 AsHSN
622,000,447 *4008A912B9F7D9EF30F42DCF7349D4AE2CB4FB3C ashtamoorti
622,000,448 *400A0BF0994AAD7BBBB4B3B87E2A27F5E18913FA ashtonhubert
622,000,449 *40069F31EE111C4B61BEB7845868A1EB61FD6D71 ashtrey17
622,000,450 *40041B82E4A89E5E7F7CDDB8649ABC4A9AA538B2 Ashubaar
622,000,451 *4001A51ADE836C4891648F3A7E95B7F983738214 ashur-nadin-shum700-
622,000,452 *4007FB55885C25CDCADBA9877EB3E05BED94B244 [email protected]
622,000,453 *40072B82D6FA0205BA6F4DA35739A6079B08CE18 ashutosh singh
622,000,454 *400A360F62792E070DF2C26310F96869F211CCA8 Ashwells0
622,000,455 *4002D3A2A157DABF0463E60A9DE4FE84F2A2351A AsHwG
622,000,456 *400D5B0A379B402CD389CA1561D686C9DF169958 [email protected]
622,000,457 *400A4C1B33D76E1DCBAE80B644A060341F900DF8 As:&I
622,000,458 *4004EDDA630939E5A3373A01B0D4E844DF86B2C1 Asi_!
622,000,459 *400BAB4E4E10D4B28123DA6A49CA3F1EA08534C7 asia-baseball-team-stub
622,000,460 *400872216DD2BA75CB019CD942719B21832521A2 [email protected]
622,000,461 *400454692274D4AE2CB45541EBE1B265BCD7C1A1 AsianFairyBlueBirdMale
622,000,462 *4004E2D99E067649C4D9818EEBD22941798CAF15 ASIANGUYZ
622,000,463 *400EF2FA12AB53E6191A027CF19A254F174587F7 asiapapereista
622,000,464 *4001C4CE79CCDE1FA2689486141F1FFFB4C729F8 Asiapuh4
622,000,465 *4003360838780776739C779AC843892534F53EE7 asiaunited
622,000,466 *40017D73EF511AB988539E84DB24C9DC27675F8E [email protected]
622,000,467 *400327E4A9C5D5128F3D945E2DA6B458409263EA asiegbu2
622,000,468 *40014C4415CED98E9256909F36B26713887D93BE Asiende8
622,000,469 *4004E49A8752AAE65A43C1D29EB53101A9F0CCE9 asif akand
622,000,470 *400CE17B79D4A26F5612C499EC347CA41E3447ED asifbin
622,000,471 *40093F4F9384FFD5416026A6C18576B7E1E69355 asifbsw6
622,000,472 *400C18E71188F55CC7947B1F6AB0640F8620E8A0 as if to nothing
622,000,473 *400E18C3C5DBC575E0161738647FA1C880E33525 ASIKIJAT
622,000,474 *400383B0A57AAB6EAC980ABEAA2101F450E115E5 Asikow
622,000,475 *400A0B612AF6206D715F167586666DD1DFF054AD Asilatos3
622,000,476 *40046E03D979D1BA0220D71442AE965F87AD0692 [email protected]
622,000,477 *400DB10C53A8C279E68640E7F0CA5FDE2F034FF2 ASIMAS
622,000,478 *4004AF7F7BE8C8E6F20E6C354E28C6C285C8D99C asimired
622,000,479 *400ED50BC7DFFA374850E6B1B79D36F58BD14241 asim nouman
622,000,480 *400E36E11C6920825C4D6F0CF4AEC336B007DD81 Asims019
622,000,481 *400D8999ACB9F0F263F0E38290599176D3A62A0F asimsdp9
622,000,482 *400D3769F8E65E5B55886B690451292065E77FD4 asimsdpcb1234
622,000,483 *40017D5BF3266445258E601C258163D0B674A614 Asineggia0
622,000,484 *400A401EDDB93CEB40FE5CAB6D3751490AC31035 ASinq
622,000,485 *400D13A486237606C6F1D42878BD73183BA818AA (ASIOS公式ブログ 2009年7月4日)
622,000,486 *4006D35A5C74553CF772559DD57F4C68E82090D0 Asirje
622,000,487 *400072DF38ADBC525EE116F18AC851129C3B4033 AŞIROĞULLARINDAN
622,000,488 *400D17C6F6E2049302B3A399C140389E366B973F AsIs:
622,000,489 *4009D62DC8031945E725FEB58AB7F62C3ECE9823 as.is
622,000,490 *40092DDA190C2D7961265B36643C9DF5DEB0C4FB AsIst
622,000,491 *400D9678E7CC8DBD6B34D4AFF39909935FE69AF9 Asistenţele
622,000,492 *400B02658347CE8FF59855AAC1D6220857348D3B Asistirao
622,000,493 *400378C6B32D7E00CEC82F703042BDF6BCF249A2 A;siw
622,000,494 *400632862BDD2F81FD6D9F9D2C17391C15D85C25 AsiZZ
622,000,495 *4001652D890338E42381AAB028ED5FD6E0FA0239 a/sj
622,000,496 *400F1808CF30130C532921FDC3F85D0F2B1F41F4 ASj2E
622,000,497 *40003E76708B831799A580434F384E26BD9347A6 ASj9F
622,000,498 *4003EB61584B380CA0693A265E51338246077755 A.sjA
622,000,499 *400204037AB4672EFC3AFE22B6BA3CC7A828E2F1 asjad:
622,000,500 *4003A9C4AEDEC9389649A0997131EEE2BED0673F Asjagjled
622,000,501 *4001D3C6E037CE7375586CB3433594171DBEB021 AS&#K
622,000,502 *4005B91944F4EBEAE3AE1AB1D197DA55A9508929 ASk%,
622,000,503 *40074DD1B5B3DE147FAF728FC542E6CFB753320E A-_sk
622,000,504 *4003DF61ACD5A4040F0FB223C4EA8040A7EF1704 A"s?k
622,000,505 *4005D2A28B48BE0A3A2F0920AF3C343222A34687 As%k(
622,000,506 *4002A1EA2F3668733337F257C760484E49ECBA2D AsK+C
622,000,507 *40043C0160004EF53767F158C00831819682422C askdirect
622,000,508 *40084583D1CFE2BA9A4239C1FA54A9291D332300 Askemiin0
622,000,509 *40016F9221728E943E25EBA6301860AB9955FB7C Askeneet0
622,000,510 *4008CBB91A224D6A54AE48CC7D852B0FEED3080F Askennaning
622,000,511 *4004E632B00FB08794DDF8F9971934A675AD3A1A askerleşmesi
622,000,512 *40052B51FF5FC68945AD18CB45D0BF793631F5E9 askewfrank
622,000,513 *400BF7225485F510D8593F9545101DFA800E4629 [email protected]
622,000,514 *4008FBDE07CB9A6C1D32DC2C72047C4630AFD9DF askheragain
622,000,515 *40055482013BA5C483D2C2A90ED94D0560F027DA AsKjF
622,000,516 *400D1F79EA91DB38420EABEF3FA9627B9154038D ASk?N
622,000,517 *400CF0B2F18B8D9A1E4FA621888137D99B5B6C4F AsKnU
622,000,518 *400470318C8AF47B00D454580E06D6701A79037D Askohund0
622,000,519 *400026D290EDCC3FB0697067D8B90E9E3AAA22DD ask-questions-later
622,000,520 *400C5DC857B7C12D2F40D671E13BB4F06EF4D1AE AsK%r
622,000,521 *40060836AC1D4C15CB1789DED85FC67A907A1424 AsK/u
622,000,522 *40077E693E996B05379F1673714B405F8E1EA64F AS&KY
622,000,523 *400DA75ECC8332AB32645E6D5DE4C68D3EDEBFFE ASkZl
622,000,524 *400C6A9D886AAC8AAE45C2DCC648F043227F9E64 AS"l)
622,000,525 *4007E83A057085ACD0B866D877C235486459DB9D A&s?l
622,000,526 *4006129A73775C5F2003F152709AF110FD779524 aslango
622,000,527 *400CDD9A1B55C56F163815BBC7C326333012FCE0 [email protected]
622,000,528 *400E9EFA19DFFCD9FC63FDD55FD58A708C63078C Asliesk
622,000,529 *4001A1403D73EAEB2B61B34848902D01E0F7DE60 ASLN.
622,000,530 *400914484081B25EAC5F43BAF2D2311406AA502F ASLNq
622,000,531 *40071020A9281D4F494ABA5BD0D02047C1A0293A aslnyagu1
622,000,532 *40088A6788EB9E3278F26EDF7AA8AC3056DE6808 AsLO%
622,000,533 *400EB844555021CCCB6E961A64BF446857D5F8A7 ASlq(
622,000,534 *400D915883C38531AB8A5972ED457EC7B6FEF686 aslts.cawww
622,000,535 *4000C605832D2A7EB7A09B9FDCFDB2DE44E10892 A.SlX
622,000,536 *400EC5BE0921DC2F15FB6EA16B8A46612E2ED6A1 ASM"_
622,000,537 *4006A7E867E739F00440CAA4EDFB4FB64476FFC2 A-sm,
622,000,538 *4000ECD69A5B990E8F18C859131742314963BC99 Asm)2
622,000,539 *400F7763352A1533292C24499B9A2A0652332509 AsM7p
622,000,540 *40091BA7D586375BFD660207FE4CA15756E1ECD1 ASM8e
622,000,541 *4005E800A105AB6CECA78F5F024F4BB4798AC972 Asmahan,VolumeIII:Archivesdesann
622,000,542 *4002D9F9D25A18DB10DDB555C51835537A066279 AsMAw
622,000,543 *40094E6DE162860F1F9EC643D47DF518FEEAD2E8 asmeniškas
622,000,544 *400BD9EC82F8A13E2EAD7EED687A89E8B5242654 As!mH
622,000,545 *400866083D96845A240465E0E3CA6E106478E15D Asmijnen6
622,000,546 *400D25C66982CA8301D1AF0E2EF138DA7871EEFB asmitabhide
622,000,547 *400DFD36DC4348A2947966B7A5D8C448782B0539 ASmkX
622,000,548 *400C27488E5A91BDB3F6A6662C2605B7BEEEAE92 AS"Mm
622,000,549 *400964805A91CC84DD5894F2CF3FACD88CF891C0 asmovsky
622,000,550 *40033184A302D7ECB539D9DC1DEE0CFD49C4DA9E Asm#Q
622,000,551 *400833E28F055E0FF3C38F0102862D01E52EBBBF Asmwr
622,000,552 *40020733E1877BC1BC321CAEBE03FD39C7217619 AsMZT
622,000,553 *400F15917444A7B0E126D98615D238664449BA1E ASN160809
622,000,554 *400CCD3582E73498EC682692DDFF4051112C31DD As#N6
622,000,555 *40097E386766F7F29DC4F9159918AC74FAF50591 asnah123
622,000,556 *40069D7840808ED33538F15B7A76461C7EDC204E Asnaimle9
622,000,557 *40080D2EFD2130D22A19C351D8189302A9BFAA15 As?nC
622,000,558 *400BDE9E12560D765B4AAFB1F66BEC98D1DFF5EF Asneennos
622,000,559 *400D8AA6E3E915811AEB866B8B694A1410EC5D0C Asnhair2
622,000,560 *40018708D2D16F21745951579BFA6BEB76957E17 [email protected]
622,000,561 *400842C0E7F5C44CA25B33DAB507636C3BF1D293 ASNOKSN
622,000,562 *40018969170109572FEB53FAFB554BD927CA7AB4 asnorek8
622,000,563 *400520250CD3F8CD506250BF741F3BAE5CD22562 ASNsl
622,000,564 *40086508D729CF7DA5994AF33FBB9AC159135B5B As.nT
622,000,565 *400ACAB84D3353D9A15EF7CE86454FBEC8A74A14 Asnuylop2
622,000,566 *4004D242845AD2F1A5A5E8A089165AD9FBB02037 [email protected]
622,000,567 *400FCA1C0B626B06EC920B6020D1B7EDAE49DC0D A$S)O
622,000,568 *4009C31F6B4BFBE4FA64A1AFBC0E3E7ED17CF94B A+S.O
622,000,569 *400EC03188D4F9B82DC21CDE9E3B5727761A3B1D A"So/
622,000,570 *400F78C5F468B18161EEE32CA37EC4966E186459 As;/o
622,000,571 *400AD985D81446D33AF38A64D3439106DE6146C4 ||a||soag|iea|okoosoamgt
622,000,572 *40084F00A361D6C621CE95356CC4FEE3915B79D0 asobrock.com
622,000,573 *4005EA0513B1A599C3F32873A2DCDC2F2DA502BB Aso(C
622,000,574 *4001593D9CE1CFADAD7CEFE8BAB1E5F46EA61E72 [email protected]
622,000,575 *400D6E3F2912DF142C92B3C8AD44669FBE8FB811 AS/oe
622,000,576 *400AC47D9AF695684726C9BD63AA48E32344CDD9 Asoealyh2
622,000,577 *4009A155A025288E705B4C2780B4A226135A1F54 [email protected]
622,000,578 *400E7DB6A3499858F811C8020382761A4F0C6634 ASOi-
622,000,579 *400A723838A185858FF991B3723BB8B527B325B2 Asoladnaed
622,000,580 *400E5C4D87BD20FB282465573DD33EA80601E8FE asomares1
622,000,581 *40080B6B6A001F20F4B55B72D1109E9F6F1ED976 Asonera 1
622,000,582 *40027BA0D8531F0B08E8EC63920CE079C8404C90 A Song for You (alternate version)
622,000,583 *400773954D24C46F79A2CC8DE5C3267D7839BAE4 Asoolakses
622,000,584 *4007F309E3326C2D25A81B773EA41396A3BC81AC As_Op
622,000,585 *4002EF37716BC4CFF0D3B8BB3A170E392E3C1058 Asopatxujs
622,000,586 *400E1D6962776088682867BD2B0FE62F5F1EF22A ASOqM
622,000,587 *4007552F1018FE7EEC39AEC94B4A6333352638C5 asoredised
622,000,588 *400CFB908F841416F6B8B3402428C2459796141D asotins5
622,000,589 *4009A4A8F2B525C900BDCF602107195B7FFB3D50 asoundmapofthedanube(disc3)
622,000,590 *400316F4F62EB6FE502E065CCAFA2F9D1F9FBC36 A Sound to Spite the Silence
622,000,591 *400EA5D7D633200B2CE6B6F82F0E5BD57B2EF07B AsOY
622,000,592 *400E79350B458522D532670A98D6F9AEE98DBC6F AS/P)
622,000,593 *4000FC65D96EEE1F7D3E78A5ADB5F2EF9D90D6B5 A
622,000,594 *400DDDA6CDB229653DCE5EFD6E12658A797370A6 As+=p
622,000,595 *400260FA0AC3F32673116DEB490A6087186BC209 ASP_1
622,000,596 *400299821F2DAAC649B7FDCB985ED2FBDB317433 asp27.bbs
622,000,597 *4009B7D3C65B7BA5576D974048E4C8DBD435C729 Aspace8
622,000,598 *4002626488AA6925EF363BFF33471E8817D36687 aspacebelowtheearth
622,000,599 *400596954CE3BD57833EC561D57BD11783F08995 asparaguseses
622,000,600 *400D32C7DA1CAD9F92CE52AA8FC07A642E46B47A ASPARTIC!
622,000,601 *400A3D7EC3C79624B840874359E5711C3D2AB5A0 Asparuchov
622,000,602 *400AB75694D4DA620D817FF68DF10D885E407E61 Aspatrici1
622,000,603 *400C97E3BD0EEEC75C56D82E27E81EB7CDBAE161 aspa.zai
622,000,604 *400E65EDE54D61E4483F6EFDA782E6E74F16AED4 AsP=B
622,000,605 *4009B256652ED4B3BEDD5AE1A35807420889233A asp_comics
622,000,606 *4007AB3FEC78B0CF2311D292B438DEB805B25691 ASPCQ
622,000,607 *400316E6C7A510A4584D0A7FEBFBEF5A0DFCFDDE ASPD1984
622,000,608 *4009B5FB1AD2691F5DB3F1B35393DC30A07BDC76 AspDC
622,000,609 *400963CF2F8D6795199E9CA497837E9BE0D95A85 AsP:E
622,000,610 *400686E5F442AF4380996DB91CD6838AB1F0ED26 Aspenaç
622,000,611 *4003268872A150C5572E00E7B4C4332069B3AA10 Aspengoat
622,000,612 *400F10A086D381C7F4C96E9CE032F1361A59F2D7 Aspennicking
622,000,613 *400C08D6DAAB344A36FFB8577E34D3323F850C39 aspergs5
622,000,614 *4002FD49967D92D78712924A1FCDA6CE5E9CF15F Asperrima3
622,000,615 *400EBA43402F23F05597C02C14538F2C8E60DAA1 Aspettasse1
622,000,616 *4000F0BAB3EC2D426A2A43D2EF5102EC62E1A1D4 Aspf7
622,000,617 *400A69A56881011939341D16B23DF43F7A2996EF ASpg4
622,000,618 *400EF19E4D48E6F6F47B3423EB248966BC6BA93D ASpH,
622,000,619 *400E0C5D5D18767C09B9880315E25818917EF051 asphtmlopen08
622,000,620 *400916FD8C961ECB8968C9502B989A2924D445CA asphyxiate098
622,000,621 *400224A03008BF48A8FB36E3F40E569C25B5550A asphyxiation3
622,000,622 *4007B9CAA351E1B9F9DF22C935F3924F413DA0DB ASPHYXIATIVE1
622,000,623 *4000721CB49B77FD7D604164FF40F99F3B89A158 AsPi&
622,000,624 *400F244BD22E553087087A355DC6FE456DFB99A2 aspicat6
622,000,625 *40067756155DA3D43BBC968D66EDC825DD58B41E aspidosperma7
622,000,626 *4005E986349FD9ED1F1D3AF8B10F5BFDAA702DD9 aspiona3
622,000,627 *400EAB180FEA3139DAC97EA716C17FFFBC579D61 aspir2t
622,000,628 *40040EB231A54784A1A704AF8A3BF6FDFE9F4BAF Aspirares4
622,000,629 *40036242E9CBAB29C24349B74169362AEA8D88F8 aspirava1
622,000,630 *4004780B07E805A9205B4E8FD94ECEB7B199813F Aspireren8
622,000,631 *40030A6A02BFF5BDD907188B30FD4B58B719C999 aspireriez1234
622,000,632 *4000BF1428EC9504E604058376347B8B618427B2 Aspirions!
622,000,633 *400C8DE566818353DC681FF2CF49FE63B71C4A92 aspirvamos1
622,000,634 *4006C80FD118DF576100E5AA9AE8E2E73BB55F0A A?Spk
622,000,635 *400C494F5AB33F7E9D60D510593BB156B391CA26 AspK3
622,000,636 *4003A1E956CCFB9378C6A34D28CCE4FD10DFD952 A?SpL
622,000,637 *400202BD57E08F5192F49D55DB7161D76656266E AsPlc
622,000,638 *4006F1BA1EC54FDFDFAB4DD59279A350C7672DA4 AsPLV
622,000,639 *400B5F95D569D64520E61BF3B41619814CD96CA1 Asporoge3
622,000,640 *4007F573F9D87775A863E09189CFAC66A57264F6 ASpTm
622,000,641 *400C5BA8DE75298CAC1AFA0BCCA44BE1FCBE7EAB ASPYk
622,000,642 *4004717BB8D51C9FAF94F776830DAF2E50BE3177 ASp_Z
622,000,643 *40082B3B132A64EA4EE7CFD92F9351B10C47E8AF A=SQ&
622,000,644 *40061B9784E3FC1471CD529EBAF09A2629BB8818 As&Q
622,000,645 *400E9D3F9A05AFC917EACCB478709F2A0FB75822 Asq2F
622,000,646 *400EE87A86EB9F68B5981A7383DF4AA02395BE4F ASQaT
622,000,647 *400B8AC60BDF3A3D2E880EEB139EF9A2BFAF4D16 ASQIp
622,000,648 *400CDE3A2919AAFCA466088119E3198EA09E3B7B ASQIU
622,000,649 *4007BD53B78616D41E07791273701969575F225C As?qL
622,000,650 *400D9C2DDFA5F7A77BEAFDBAD0C961F42CE1C6C7 AsQM6
622,000,651 *4000C2ADA566664F5D6ECA8102911E43EAB87DA4 AsqMa
622,000,652 *400E97ACD5E4F1E8A25A7B6EAA80AE1E50F103D2 Asqmain6
622,000,653 *400EB1C61A65C273FAB7FBCBC68E1974488B6FDC A&sqo
622,000,654 *400627E9F4441BA4C495A631E7142B086EBC87F9 AsqqC
622,000,655 *400288F7D14373E9E23C7C403016DCF3CFB2ACC8 AS#QT
622,000,656 *4004A5CA7C0D2697F593C7DC6E88EC7462FF7ED7 Asq.Z
622,000,657 *4009BD537BA5BFEA7EEEF7E439ED891FE8AE4A99 A.S+r
622,000,658 *40024CD1145390AEE028479B140ABDA947DEC67B A+"sR
622,000,659 *4008947E791E5F7E5215E057932E00430677E9EF A&?sr
622,000,660 *40058B0564E2837BBFDCA15C37B3BD0F0CFBF710 Asr/,
622,000,661 *4006118B097D1420E8C763610BC07AE09C2DB5DC A)SR0
622,000,662 *400DC9B696D4B47D339C10B00BAA4A8DBECE7C6C asrar khan bangash
622,000,663 *400C2CD0880A4C988F6D7C287B7985E1B0201FC8 Asravad7
622,000,664 *4007038871FFB374628F9F6F8AA30E1A1626E725 asreeahmad
622,000,665 *400497297773FAD79041325D65B77F2D1633E4C1 asreise2
622,000,666 *400235D6F3B627886BC093691AC189B212E604D5 Asremmi5
622,000,667 *400D91A3758236E43965772DED5105C8EB6F013A ASriu
622,000,668 *400172474B02FE0D84E7DBF84D554134E5C79D8F ASrW.
622,000,669 *4007C9A1F89746C345BFC29866DC838058AD5282 ASRZ,
622,000,670 *400FB91D46FA26FF6DCA65CC1C03AA61364DACCA ASS!!!!
622,000,671 *400253151FD5336192D29B39608882D68368696C As."s
622,000,672 *400454802E3E26F78649C144C978D1F447053832 Ass0rtm3nts
622,000,673 *40009271961775CF14938206846CFF6027679857 Ass18
622,000,674 *4009C349CE520C41BF3FB0E328D2F91BACE1EE22 Ass1G
622,000,675 *400821FB06C790E540CDE64003D952701C29DA38 ASS3SSING
622,000,676 *40094F29F61B759ED622B56DD1C49DD510155953 ASS%6
622,000,677 *4009DA248D4F5FFC95B7B42A9CDA353F61DC2EAF Assaavia7
622,000,678 *4002C986CD5DA5E7055176662382F7D193C244C0 Assagiil2
622,000,679 *4009FC3503DD13EC333F0F2159D95C5BDA9157F6 assahrij
622,000,680 *400E6E2E7BA9F7B54514F9DFBE29EC25F31C0B93 assakemed
622,000,681 *40022F5863952985CBE48721AB48ABCC23934C25 Assalots5
622,000,682 *400D3DB6B03D1C7F42899FBEC4F2CFF218852B9D assam111
622,000,683 *40022AE0921884F3D14590359372958280308452 Assamotr7
622,000,684 *400855B4B3352EBB15F07A56F78152F82190FB8E ASSANAM
622,000,685 *400FAAE4371BA763E87793D4500F26708E66446E ASSAULTSEXUAL
622,000,686 *4007A8E8A6377FAFEED24EB83CAE0C9399556C5B Assavask7
622,000,687 *40092CD9658F2DE99DD8BAF55EDCAE24DA024B85 assayG
622,000,688 *4002D5A8D9B8D993DBD04FD95C890929D3A8103A Assbailey9
622,000,689 *400213160DD9BA0EB87B26F72764DEA882A1EA79 AssBs
622,000,690 *400A980A42C7D6545C7BC6CE8DE38E711627B455 Asscooper
622,000,691 *400AD6EC6D9BA2F1E0A0DD31B9C391724D53BF4E asseche0
622,000,692 *400BE74E925F51D8B24ED1EE5AE1892BC3DECA8D assecheraient.
622,000,693 *4009401E18912D317CBA744C1884D64DA35D3138 Asseettu7
622,000,694 *400607F4AFF390606D3795FA67CDD621AD4A9233 asseguir
622,000,695 *400BD8C58D7C61F823910E89354792AD04469DE7 assembleia1234
622,000,696 *4003FCE5F5E8AEFDC9C92F54D059109A25ADDA61 assembling1234
622,000,697 *400D90F572815EABFE347E3A3A9B61D8C7D3E385 assemblylidadssalino
622,000,698 *400FBC6848005DD094BBA1EDFE7F991BDCDDE9BF assemcet8
622,000,699 *400AD468B3DA9EA7073F36E57126C9594F59B7E8 Assenste5
622,000,700 *400D484D5B8BB32CFEE8B0AEB6474F0543A2FF4E assentarlhe1234
622,000,701 *4002C74146D06F919DC643F7DE29B3F15AE940E6 assertaro1
622,000,702 *400C53B874C0D2F4C113B65DA291A26491E4495B asseruere
622,000,703 *4002ACDD4CA3355DD5CD463784E907BAF385415E asservitore
622,000,704 *400C5DD82607189B990C136D2DEA226A9E86B70E assessibiliy
622,000,705 *400BBC67334DDE335600ED7C0C718F6F1FAF4C2C ASSETATO3
622,000,706 *40031C276F5BB46F82887552BB8E244BE924B4D0 Asseteted
622,000,707 *4007262655445EF4E823C3B9C81CE34E6DD577AE Asseyent5
622,000,708 *400769AF65A3ACBF308B39427B603D0E42A41959 Assfareting
622,000,709 *40067ACB5730D99CD9FBA6EE4B38738561D0776B Assfiber2
622,000,710 *400590BC81B25B86CAE54ED410A895537D5055F0 Assflash3
622,000,711 *400ECBFC9A24580B6F8EF114D8630B4910A31FED AsSi&
622,000,712 *40098B81F71286816E7FAE2C4F4E25E64242A1AB ASSI9N3D
622,000,713 *400DC2232FEE30D70E11D76CB2575623477234F9 ASSIDERAVI?
622,000,714 *400BB3007D50F1AA30C84A6A2B0CBC584B6A17E3 ASSIETT
622,000,715 *400B084811FC3F835642D5B499421F1FED273E29 Assigiez7
622,000,716 *400C40FEB29A42500917160A1E06711A47E61549 assignatassignat
622,000,717 *400B78474AAD8AB3CB0282DAF9F8BFEF42DD298C ASSIGNMENTSES
622,000,718 *40061EB1019F1FB7AE1EECC207B29101CE9719B6 ASSILLIATE3
622,000,719 *4004503E3BAC07DD54D40FF29EEF1954E8B77572 ASSIMILERA01
622,000,720 *400613EC7A95B525170C33CD4BEFCE97AD49F358 assimlilated
622,000,721 *400898B0EE2BE7FFCC263B4AE4AF99D5B60D9D3F Assinariaed
622,000,722 *40096802D8CB0D902E821CE05BF7D792284EEAF3 assineimprensa
622,000,723 *400F3FC9FB80F203DEF7207C7E8DA3A362FB3026 Assinyta2
622,000,724 *4003118E914A2179614A1EEDBACF29670B5B7CCC Assipaak5
622,000,725 *400CBFD49AA13D1441CC7DD94B5D0CB659C7EDC1 Assirusi3
622,000,726 *400F41ABBE86CFFFE010C8DFEAB6C205AC9C08B9 assisas5
622,000,727 *4006A35E352399448D056B57B1697918D59987F1 Assisitts
622,000,728 *400468FAD8167F999F47363D003B7C3DC2858EA0 assistance.bigscaryg
622,000,729 *400FA1A5BE076EF7A0CA4D49A78138FDE16377EB Assistentdommarar
622,000,730 *400BC0B4C7176AF8B8606549C79F7357F9837C8F assistezs
622,000,731 *40090643ECAF391F86F98FC3051D6EBE89977832 Assivert6
622,000,732 *4009B628F27EE15D0CEAAB725C594B054E715807 Assjosie8
622,000,733 *40090605B55DDAF7D5ACAFCE06F8F9F75D709C1E Ašský
622,000,734 *400991DFDBF6B41AF7C1F9677464392D55C75CEC Asslikea1
622,000,735 *400F21013271FE2B1C3731469F714F052CD224C7 asso1997
622,000,736 *4003301E48A4320B0FC7642AD7E729AF67E2B865 assobiarias1
622,000,737 *400AB93AC044BB766C8A87F0CBBFB4D17108EF13 associationbirmingha
622,000,738 *40050AAE126143E8C130D1DEC8B512FE30DB46CF associationtest1
622,000,739 *40096FAE055CB2EB5FAE3B2EC1D428EB14820274 associationの略
622,000,740 *400C93E9F694F277E19877E53EBBF90BF10C4087 association)等商会则反驳这一点,并认为圣诞树中使用的pvc具有出色的可循环属性。
622,000,741 *400AAC828FF66A9BC6DB818493C30A319ADD2A01 Association,簡稱ÍSF)負責統籌,而法羅群島足球協會在
622,000,742 *400BEE0C9594FE8B3C8C485C24A2D6C06F70579F associazione_guide_e
622,000,743 *400F94F419D98ACCEECB6CB723F211C1FA2DEB7A Assoderei?
622,000,744 *40071AA6945C0A8FD1338D1FBEBE27DAF19C86F2 Assoirez8
622,000,745 *400DD35405F277D759689B27733DA6081651EDAD Assokal9
622,000,746 *400E13455CE2CB72ED91F68AFDF46DBB3A406102 Assomatu2
622,000,747 *4008524E36F485E32B86483B82BE81385AFC4036 Assopiate2
622,000,748 *400BEB547A5860D36F8F7CF442C95192750CC0F2 Assorouk5
622,000,749 *400E59D6E12BE7DCAE8140525C68B06555EAB518 [email protected]
622,000,750 *4004A4EE9CDE469396FF48584CE01FD63BD87C6B assotation
622,000,751 *4005F00EF985EBFEC11EF2B4A692B2101E594079 Assouplirait2
622,000,752 *400B04F0078A7072976E90F18C5FF65A360AEB4C Assoziiert/a
622,000,753 *4008B63C46A82E502A1DD26D21185D9367B3E6D4 Asspeanuts
622,000,754 *400FFB61E633DD1408B4CA04D51CCFE541DF5ADC ASSSURE
622,000,755 *400D5109C329DB8AAA0CFB75FBFD8D5163091451 asstexas9
622,000,756 *40060E659BE0B965F73338240D087FCC318D6AD9 ass'tsougudd?
622,000,757 *400D04B5EF0D283AE0DC7713ABC495CBDA868FE9 ASSUJETTISSEMENTS
622,000,758 *40088EA4DAAE3F6489AFE355418264F9C05F9200 assume.bad
622,000,759 *4002E77C8D7E3E87F97B5CD00BD1FD1D45560992 Assumeren5
622,000,760 *40087C7CCB1459AD9C563797ED22D6345884F424 Assuo
622,000,761 *4008DC2D8CD90C14B05BF5DE1490B81DE7616585 Assusail4
622,000,762 *40059B76C940D3D928269E94BAB32CE702068EA6 ASSWm
622,000,763 *400EF7CF26124E847383DB7ADF689DDAC3A64924 Assylum1
622,000,764 *400126955DB773592625229F4CA6C13CC511BD92 assyriafrom
622,000,765 *400A12BF9F7A2DE899029166C7F80555680EDB28 assyrianbatteringram
622,000,766 *400BE0354B4243F621FBEEE03083F49F89F521D1 Assyriology4you
622,000,767 *400076B2457550CE59E7F9502CEA66D3BC98FA6A assythesing
622,000,768 *400B65FF8BD1DF0F740CB335850FCFC4C0FE85FF As.$T
622,000,769 *400D8170978E26D3C0C368B1468594C90EE0AF86 A,St0
622,000,770 *400E3103ED2811B5AF673EAB25604AED8237E66E AsT8w
622,000,771 *400873CB8FE699FAF09EB61685D532CC9413306C ASTADOS
622,000,772 *400868AF760E126B5CDF7F09CA3D4C62181AB709 asta-ihoramare
622,000,773 *4000C8EFE0B0D0E646CD4160D40AA9336CD72C44 astapovi7
622,000,774 *40035BE612E32916EDB4ED7870B699891DA55D93 Astatets5
622,000,775 *40082A7EC247A447CDEE6F3297F6B84B9AF18148 Astatingged
622,000,776 *40085A85EBD2BF4BC07FE61E4FF0E7FAA06F3AF8 Astatis2
622,000,777 *4005506BF2F3DEE0500FCF215A173BACE2182BC2 A+STB
622,000,778 *40080DBEF745F7219A1F0DB44E52F3E58718B31C Astbaktes
622,000,779 *400BC8C0A771D66CC5DE03EF10090D2F0511B592 A%stc
622,000,780 *400E2968BB1C2E42F8BF95934FB7C2FAFEA5FA0E ASTELEN
622,000,781 *400F3990BF0EAF23E9968BDBAF8354475CE5B57D Astenada4
622,000,782 *4001989EB2CAE3D21E1C3BDA11842A05A28DD745 ASTERIASTIGMA
622,000,783 *400EFFDBABEA4B5A0C2D926B9DE43A1E29A5EF8A asteriscuses2
622,000,784 *4003FC3F3CA6908B899C7AB92AF50A28DC1B0C4C ASTERIX1980
622,000,785 *400BC3684052B7AA606A07B99DF223E89EF7C20B Asterixidefix
622,000,786 *4002424395CEDFF9EB13ABDE92B24F8EB146A053 Asterranno
622,000,787 *400E7326B984DF55186EE37980FF2D76302DDC3B ASTFK
622,000,788 *40008BE72BA8E83201EC75AD7EED7112F1FBB4BE Astgebers
622,000,789 *400E55DA53B15AE382EC62B6C0E6CC068666AEA7 ASt+H
622,000,790 *400D7975A49064B9568A218FA71F2F6D56DA1BB3 As the Ends Draws Near (feat. Sarah McLachlan)
622,000,791 *4002D0B682722E58BA61052048CB8BA27941367E Astiera4
622,000,792 *4000CD2094FC3AB9B92A205F29DEEA9A709CEF2A astigmatical9
622,000,793 *400B2F96C299AD38833BDC4B664050A5B202A705 ASTIGMATICALLY0
622,000,794 *400329B0F9C51CE4E9AB88B97EBA9DA5B1EE192B astigmism!
622,000,795 *400DF15853CA91BC0E9FCCF2BDCDEC5AA4D20085 ASTILIEN
622,000,796 *400ED87F9A9291B2CE4C1A742F6526E1DCCBB2CA Astinkpot
622,000,797 *400995AA8DF5DC27731B97EDE8FBBAE8F189C09F Astipak3
622,000,798 *400B25B3177445F030C39976318709AC378B377A Astkever5
622,000,799 *400AC7F6BA5A922BBF4AC3442F0190602844185F ASTM4you
622,000,800 *400378DF9253948B9487E3CCB29099D77222E171 Astnickm0
622,000,801 *400D44D011C4995493062D8E796060813442CB1B A(Sto
622,000,802 *4001088C1D7D6F20F4794121DDA9B74EEF9ACAC4 AStOf
622,000,803 *4004CACF7946BC244EFF578B72CD5D116D979FC5 ASTONILLA
622,000,804 *4004CB603BFFB18B40DC5A5C360A165A93E406AC ASTOUNDI
622,000,805 *400EE9C50A2258507CE839ED58A5B166CD11BA64 AsTpi
622,000,806 *4008F9DE976A1EEDBBB4E208E426961E5079FD74 A-stQ
622,000,807 *40095E3D0307ABD16579018F21EFA75ED76D9215 ASTR0BI0L09ISTS
622,000,808 *40010BD136B564372BB426FB7EC998FCE71DEED1 astra“
622,000,809 *400889E228D4D11A15CAD5E2AFB5EEC912973330 astrachanite
622,000,810 *400C9FB473E2AD4CD5AC4576B5B46A34FDDEDD3E Astragali0
622,000,811 *4008880DB8F0DA9BDEB2D767DB5D3F87E925F108 astragalisme
622,000,812 *4007D7D1FE16251191FB3D014807179E2DF84759 astrahan”
622,000,813 *400FA64418600EA9832F9ADD5F47439146E152A1 astralimaailmaksi
622,000,814 *400CA4CBF281C2C13AFA22C46A2D9C510BE4E69A Astralpippo
622,000,815 *4005C4823CCB743F41FE0052C63BA1BD251D0F97 astral tribe
622,000,816 *4004070908C2CCF83A51B41F66BB4E6CA6A75C12 astrata9
622,000,817 *4004A923D93544A3B09151A4CCFDDCCF7A08C044 astrava3
622,000,818 *40089CF192E698B02C230E36421B70D6FA89D171 A'STRAYIN
622,000,819 *4008E4EE36EE9E7AC6971E0970ADCA7F4349F327 Astreinte1
622,000,820 *400E96961C1A72C34E37C4CB65EDE116FDEC7DD4 astringing?
622,000,821 *400ECFF7E0C63196FD401A97363864ED35B225C9 ASTR
622,000,822 *4009A7D8ABAEB26E6FAAC39C3F3FDD2B18EF3F45 astrobiology-field-lab
622,000,823 *4001F4DB0D6E2A73D59DD055F480263175123721 astrocam3
622,000,824 *400AB8BE14A1CB0B0C67D4AC383CEC10CCF4171F astrocosmos.comwww
622,000,825 *400127BF9062532977D96F439D0FB8D0A6802A2E Astrodynamic.
622,000,826 *4007436B0896EDA59104943E7169E1806FD3D944 ASTROFF1234
622,000,827 *4001BA76F39B5451FD4CFEC77ED05DA1436E9A2A ASTROITAE
622,000,828 *4004EE1574690F48FA697F45FBC0994784DEB66A ASTROLABON
622,000,829 *40014007F577B44A230019EF85710774D04D0214 astronautenhelmkameras
622,000,830 *4007F3B2CA0E2B203E950CB53AF10B3604D3AD79 astronauticii
622,000,831 *400A4AD204F04AE93962865EDC50F2109EF5E8B0 Astronoo1
622,000,832 *400893A727285B064F7091020765752311C98EA2 astronuezauta
622,000,833 *4001B0A27EDFBB4809A2F26C75C0BE94FA5D7DF1 astrospectrals
622,000,834 *40001489961AA350FDEDA844EC219489BDF5C56D Astryman5
622,000,835 *4009DCA73DD6742CEB9DF5B8D2048E10BD1A2781 ASt/U
622,000,836 *400A646CD9547F047233FEE3952F41F6180CEAD8 ASTUDH
622,000,837 *400E2DD1E7EF7E1B73C29584788ECD9CC446F2FD astuigh4
622,000,838 *4002932F43C2318DE78EDABBA264D3D1CB028259 Aštuntokus
622,000,839 *400D6A8A4F36525ECD6927F599F523B313E37B5A Astvrouw2
622,000,840 *400A76790F4F16CF7B95471CFF68D992C4C17661 Astw+
622,000,841 *400D05E1710E89C48B34D81C6A4BB3D023AF80A2 ASTWRIEG
622,000,842 *400B672A1BDDAAD7998DD611D529CBEA8E6CC5AD AStwV
622,000,843 *400CBE5877A4D4480DDF6E7982B485C62B7F1CA5 A"stY
622,000,844 *4004A92290E7A16BC9280FA1DC3AC94F31ADE017 ASTYv
622,000,845 *400365583CAE6627F81CDC55406C4C60978A372A A.s(U
622,000,846 *4007D0A4DB9452623D7C6F12C30E1F2F3CBDF193 AsU=2
622,000,847 *400A328F2673546B2BED0C2E8DA6225E6D00B84D AsU+C
622,000,848 *400A761F2530FE4D2B474C4EA649F93998375729 AsUC-
622,000,849 *400EEDA583B020A3221202A4949FF1D3CADA608A ASUe0
622,000,850 *400CF13CC199C1088579F73B0BC9E5E0F0CFF086 Asukosir9
622,000,851 *400D64C9B91564EE1F839AD75E4E395C835B8AED Asunsjona
622,000,852 *4001ED719D3871E64219509E0FB9A89D7CBDF251 ASup2
622,000,853 *400423707F6503F14C5142A27CDFC90F7B01DBC5 A Surfeit of Lampreys
622,000,854 *400224B43198EBD3029C12897669E4E9B7AB0AC7 asuroziworpaleinad
622,000,855 *400F597CDF2288260957A2C8BEA48ADFC9098911 Asuuyakam5
622,000,856 *40019A725A042695A41566B8E21BA83EFA0CBA84 A&sUV
622,000,857 *40084AE538C9314A038EA45D0FDADBBCA6D4DA5D ASuwF
622,000,858 *4003F79DD93DA7D54F9641F79F396254937174AD A!s+V
622,000,859 *4004597A614DF5CAA74A8098022AA56A299AE43C As?:V
622,000,860 *400CB7A18DB10E3E853417B750EE04C9E7EC8AAE A(sv5
622,000,861 *4009A95D7B878F0670C21984CFE5C94C1A755C77 ASV"6
622,000,862 *400ED5758091952F6B6D4CD4613634914161A3E6 AsV8L
622,000,863 *4008C13C6A8B6651E6275436BC59214CF1F8E81A AS(VA
622,000,864 *40046F44E51307E624300A544C3B917D817CC677 aśvapṛṣṭha
622,000,865 *40089106D456832EA2B27E4ADB87410B8932B310 asvataa6
622,000,866 *4009BAD984F47388CED2E67462FB704BC1937EEC ASv)d
622,000,867 *400778963BF0A05B997A811A1758FEAC9C1B8B25 ASvDb
622,000,868 *400B1484D62B57A6C42CF7B1170953F8C70169D3 ASVDX
622,000,869 *4004E4FD41212F5CF0DF0EC646702387DD5E8AE6 Asveroth
622,000,870 *4000FF8247A5CD5947A376DD2893DDD2BC0859A0 AsV/f
622,000,871 *4006EA1B62900324ADDF8D97859CDE69877C52CE AsVh.
622,000,872 *400C6F85BCF860A3AC0D7D23DDA6FB0E272C097B ASVREASAFIUOLACRIMA
622,000,873 *4001D69A2BC7C77D68881920DB4DE105C024DD0E AS!VT
622,000,874 *400021B3E8536B30236114B0440C868677D264AF [email protected]
622,000,875 *400AC871E57316195A6451647FA99CC0DB278BDB AS/w0
622,000,876 *400F22BFB156FDCF82C154887570AE6101BB360E Aswamukhi
622,000,877 *400FCFFC26D38B6CF1D79C1D07FC359377C6CA93 Asweilling
622,000,878 *40047E6834AA3218504613C0E2FC21CAA6A86C0E [email protected]
622,000,879 *4004688560210437841AA1DDEC724C8DD465C2E9 ASWwX
622,000,880 *400700BFDADE93232D4746F6AD138E7F07802658 AS+X4
622,000,881 *400F41EE71C039CA2AD2A33B1B5D5F22E8FDB111 ASX4B
622,000,882 *4005163AAB49DC29A6A290BC91675C3CADAB21C9 ASXHw
622,000,883 *400EB4C57DAB1420D897EA4A82A9EB2A5E55675E [email protected]
622,000,884 *4006BFABD1C3B873B942D09498EE340803C811EE AsYDH
622,000,885 *400D2317E007F373923585C71CE903F4BA05D9A3 AsYI4
622,000,886 *4009236BC20195FF210355B05F6A560307A46F2B AsYIi
622,000,887 *400708ABAE688A0C2EE430F960AC76BAD6C4473B AsylumTrackListing
622,000,888 *400463566828A80486B9A34213108A5B1DD00746 Asymbolical4
622,000,889 *400902C6571CEC798EAC199C06B7E4739FE150DD ASYMP70MA7IC
622,000,890 *400796AE1CD29D2A041B9EC42C0655B50164810D async4
622,000,891 *4003FED3C0A865F40260009EAF9CF4D37B2D1CA3 asynchrone counter, part xxi
622,000,892 *40064C1749607A2738BF94BF5170D1211104A32A asynetos
622,000,893 *400F381280EE63E5E19F838CF14DEC7CA0667C7F Asynvat4
622,000,894 *400985598B4CB2E6D9C43DA076C49305D1FD555B AsYouKnow(AnythingCouldHappen)
622,000,895 *40044CA91834E98460BC2F11B9815231EBBAB56A A_SZ$
622,000,896 *4003761B7AC91BAA3E822449CBAFC631A76192E4 A,sZ,
622,000,897 *4005FEB1641C4F8D6BEF07B5E85AC840F9EE9F41 A#sZ$
622,000,898 *4001D3C98A3E08EC2B54DCC0D0F7CEC46E74E0DE ASzavazás
622,000,899 *400C987AB592BD5BF08FDCA30C920DB849D85D3C AS+ZB
622,000,900 *400F8C62FCEEB18CC87093B21B15138B539D0244 AsZGO
622,000,901 *40035F17E5A504E7322211CB863EFEAB2C8818EF ASZ;k
622,000,902 *4001DF9F0618547801A22E60F1210A5CB451D99F ASZ
622,000,903 *400C21F9332DE6D43428A36D1EFB950EEB797D05 AsZnY
622,000,904 *400C201C2BBDED64592ACF833A7E8D9F5122DF74 aszonni
622,000,905 *4001DEE394A9114F159F2B6EFE050DDE87FD6ED3 aszrp
622,000,906 *400F6B4365C4E6124440EA09C14503BD188F3B79 ASZW=
622,000,907 *4006A4C05A047EFB4CD2CEB408977EB741142C87 ではなく、AT
622,000,908 *4000030A17A746AA4AC56BB65E27CD2148CA62B6 A;(.T
622,000,909 *400383755D47D89A13F63059EA187DB61A658CF3 A!!T-
622,000,910 *400BE610E40AC8D44E4E220178DE2D7A89C75B8D A//T/
622,000,911 *40063990A1FB5BF20C5C2EED33B93F352670BEB6 A.T#+
622,000,912 *4002DCD168631A03B0D67FD1D286E28C93C9E093 A}^T
622,000,913 *40072736443BC8B2F036F1565F9AF290DDBBFFA9 AT,?_
622,000,914 *4000F96E28D4FF4C67DCD1B2297C29FEBCA2CDAD AT?=&
622,000,915 *40093C244DBB267B1316F5075ADD59D89451D93D AT)%"
622,000,916 *400CBE5D67CDCE6FF0D89967FA4ADA0506C36306 A?,:t
622,000,917 *400B0EA7482AE84F9A1BEEB95FC43137CB130F95 A/
622,000,918 *400EC7DF97BB433BA155AD9078833C52C43FC4DE A&&/t
622,000,919 *4003A2BF5DE214B41C2E83FC33ABFC6FB9E859BD A#/%t
622,000,920 *400ABF22D1329BEDF8C55D00ADCB4806FAC65D28 A#t)!
622,000,921 *400F34ACB2274AB9E1BDED4806BD2BB65DED4730 At;/)
622,000,922 *400F5CFD818C2ACDA63BE3B60DAD57971D288C56 At"
622,000,923 *400710013F05DCFC2A7D2C5C7C59C102EC4DE37E a?T[
622,000,924 *40033BAB6505FAD872B319E434BB4C44E3C2F4CC at03270
622,000,925 *400D3FE5767F32574DA3A910E2AE02590F7A4BFC AT=07
622,000,926 *4007B870A0ECCDE74467841566BD3B6D32D42A19 at0701as
622,000,927 *400BC99A859F488947C983A2849D1FE15732429D A
622,000,928 *40098F0E73C5ABF7FBE31AC1FB33097D999BD6A7 At0A
622,000,929 *4001793366B7DB689661C9E4D1B0FB8DF49CBD3E A
622,000,930 *400EA58BC88BE5D78BDD7597DF832015ABDCA212 A!_T1
622,000,931 *4007ECAFEDBF9F892C474C764DC421AAFE951107 AT1./
622,000,932 *400B45C0E4F71108F2D40A098432A094F63183B3 at160up
622,000,933 *4004FFB7A1BADE8CE3FF298ABD34162411562842 A,T1i
622,000,934 *400C5FFA39DC1C4D88C31DFD7AC2358EE0F7D0FB A)t&2
622,000,935 *400AAA2EE9D386ED00AC588A7858E40FAFE84DFB At:2
622,000,936 *400158EB12E2D8752175544316CB6160ECBC2850 At2,6
622,000,937 *4002D82ED54EA3E1B053FB53AB62201F0B285A81 AT2bn
622,000,938 *4006A36EF9ECCC5ABE42170C2F9260BCAED41248 at2g44940.1
622,000,939 *4004BBB9F1DE7784FA7B5D6CF8CC410563E50BED At2jO
622,000,940 *40004BF7EE6A2363926A234BE8C3F23D27DBB612 AT3cH
622,000,941 *40072A956F749BDCFDF96DE3967268F05AB7B757 AT/3U
622,000,942 *40064E36EDF6F78C8EF2102BD4B868AED53AE959 A,T4"
622,000,943 *40024A4922B6BDBAA93AB1A7F76B0AB11F2266EA A%t4?
622,000,944 *4003BE9A7147CC09F0FF95870602E081A11C4E06 At4?;
622,000,945 *400E3FFB86D48453C495F9A92BFA748546DFCC76 At4aV
622,000,946 *400B91F06D6289DFA3B037DCB79EB31CBF344F86 AT4:g
622,000,947 *40073DFEF79A17967CEDCB2C4218659C18B9C8DB At4g)
622,000,948 *40076EC7C951ED773AAF36941859299CD76C2201 at4g10620_draft
622,000,949 *40065195F351067F5AF2D2461E7F0EDE6AA09DA3 at4g274401
622,000,950 *4005E212BE6E9E53D9DEE9E556039748AF2256C3 At4NS
622,000,951 *4000F61FBDCF994C950F1E545E42C94608EA2C7D A,t4r
622,000,952 *4007C9E80089A65E90A02A2FDD1428B95BA6DD68 AT4Uo
622,000,953 *400C1FDEC085A223D108E3EAC6A78A00BC03BE25 AT4wL
622,000,954 *400C7BCDF69A889ED7C8010FB972DE67E5C41CA5 At56M
622,000,955 *4000651E83F24D5D47F8712AA7673893C7E7B258 at5g166302
622,000,956 *400DE1A390024A5529B7A2AA88928EAFD0941E44 At5L9
622,000,957 *400A0A62F96C409F6D656AD849AB732E6A9CC3C3 AT5r0
622,000,958 *400235FA1986A8C45BB0439720D6815D6C886BD0 AT5TN
622,000,959 *4004CF7355DD0E8AEBC7A0CC82152277DB5B5C7E A,:T6
622,000,960 *400E2CB5AFB7E74612FD441B5794D327250E8C05 A"&T6
622,000,961 *4002B283A0D0E45B01F4B2E9D8E5AEF6AA35FAFA A-t6b
622,000,962 *4002A2DEEC2E8BCB3593A1A350A5693987876E68 At6bl
622,000,963 *4007E51A6332DDC93675066933556C4C7B2F84EA AT6h&
622,000,964 *4005EF08686290B36F115ACB60C905C2A5277C69 At6l,
622,000,965 *4001C0BBE5230E8AC6B2E1DB49946AD6067FBAC3 AT6p(
622,000,966 *4005E9A7DB8DE92D83618C9B6DC4D183854DE944 AT6P1
622,000,967 *400BD8B0763E5F14A3CCA173D8A77650EA01A24A At6s"
622,000,968 *400E71304FA92034DAD716F8F964FBFF05FE9B9C At6sO
622,000,969 *4003DF9EAF7220226D226A3FCDA40888F7829593 At75A
622,000,970 *40018BDAD28D688816EA692662B0A728D4AFADF5 A)t7A
622,000,971 *400AD200ADA55D6C1376A1CFFA55E28109EB4411 AT7G/
622,000,972 *4008ED64B105C3CA3A6A0BA03BD6B69B1E2452BD At7KP
622,000,973 *40058BDBA59B612FF53A2FD6E1238D193CADC928 AT8.(
622,000,974 *40022D7DA82C4278D7125542D12524B2590FA9FE At;.8
622,000,975 *400E32B50CC53D52228D08250F74E1AD02F10444 At%8"
622,000,976 *400AC8D291F4CF13BD8C4A7F94FD1DABC0231950 AT8hc
622,000,977 *40017BC531D91EF2BB6782B4926E1F2E78ECFEAA At-8i
622,000,978 *400D18194C7AFB836EC3E7E244F85E26457AED8F At8jC
622,000,979 *400AEBF3D94CB7C39D92BD373405922E6E4C37F4 At8mW
622,000,980 *4008B36F29F18BDF8D2F8FBDC535E4744934846A At8p.
622,000,981 *4005E8F3320FBA4FC95F4AEB9670FD33F08EE501 AT8qP
622,000,982 *4003DFE2519BDCBA52DAA7BEB1D944532AAACFF6 AT9.f
622,000,983 *400A583B1D1B0112074F85525152BB69680DAC00 AT9=l
622,000,984 *400EB76F5C4528D07FB632C288DAA8D7812085D2 At9tB
622,000,985 *4003400ABAFF48DFB789C373E56FBAD5B94E8412 A#T&A
622,000,986 *4003699AE7B39DBA1818EF11D78E6FC7D9910322 A#T?a
622,000,987 *400DC3DAE7DD01EBB20AD2C1E810FC849C0AD890 Ata_a
622,000,988 *40095D7E59786228487B0EBCF0A3FFFD6DCBF195 ataahgiV
622,000,989 *4005FF6092EFB810262D66FC6219C788535F90FA Atachiered
622,000,990 *40085559F228B7AE0A15C630BB9B40A3C6951AB4 Atacifit8
622,000,991 *400EA3721881CB4B29CDD4168EAB660BCB486257 atacl
622,000,992 *4005DB31D68D5D2C8B9134218DEE5AB403EA964B ATACTIC8
622,000,993 *400E291084093A4BB55A7C56AEE35923799671FB Atadgnos
622,000,994 *4005DA446F21A96DC7DEFE72C818847F4D67F449 ATAEMYR
622,000,995 *4008E41B5CCCB3EBE585CC6E1D5563B7E5FC2B5C atageated
622,000,996 *4007EAFE716C547FB2F2E8095654C648ABBCD961 Atagirot2
622,000,997 *400D72E78E01CE14DA9B24FA2D5FAF5F1A72C0AD atagnav8
622,000,998 *4009E8E3D823DF06E7719E87ACD67B58EB6FF02C ATAj_
622,000,999 *400D7837DDBCF7493DC143CC5CEA3348F1A2AB7A atajador3
622,001,000 *400E87CDA9360048166B5C6DEE2814425C322FFA atakanaydin
622,001,001 *40042648168C872C5E93761DD94E5F0F4305C8DC Atakirak2
622,001,002 *40053B2A0499333A8B0BDB4A8C2DEECB5F434615 Atalahens
622,001,003 *400B4AAAB30160637EFDD92A931EA458756A6C1A ATalT
622,001,004 *4000CEA6E14DC4027FBF65225C464541620B1D8E Ataluzar4
622,001,005 *400B7D884CCA6713D33C41E6AAAB8AB3D4950200 atamakab1
622,001,006 *400497B646B2D8BB2E22625BBBD2ACB2C0474ACD atamancarseiam123
622,001,007 *4003F93769A0892C8E4516F60FD2C1BF73C590D0 atamancmos123
622,001,008 *400151BA891AAC468F3DF276AE5BF4A117CCD678 Atamgire3
622,001,009 *400E317ECEAF50B37F77FA7B796BA9269A95A884 atamotua123
622,001,010 *400E1361B9F0DB7E806150247FC154378E764884 Atanecs7
622,001,011 *4006E347EB6CD58E01F6797F4F117DB88A53352A atangips
622,001,012 *400F8FFE576C62822582780D7BB58FC8BA87F346 Atanigan7
622,001,013 *40081982167FD0A3CD1F1BE41B6583A47E20F7CC ATao/
622,001,014 *4008F336946C4BB5FE71E632BBD2F64BB1B3F9B6 ATAPPARGGA
622,001,015 *40074AC67D703D5B52DE85934CECEFE5354D030A A-TaQ
622,001,016 *4002A6D87E58BDAB0932C7DEDB2F2EEB2F1D9FB3 ATaqw
622,001,017 *4000C75C59DB601986EFAD9F2C76FCCFC09E3CE2 Ataremos3
622,001,018 *400AC2C7E1BD9686E674EF740D6570357EF7DCE4 atariandiarekin
622,001,019 *4008E100122D7C6CA880C56585D4CDE40262692C at arm's length
622,001,020 *4008A456B4551E0DA66C0097B1CC3129A50924CA ATASCNDOLES
622,001,021 *400298BEE25187D387FD0D6827402ACBDDFE48E1 atatnav3
622,001,022 *400F4097BBE8BCC006BF3C6DB6B9DF7005247CA9 Atatnup8
622,001,023 *400E52583D7822F7DA70BDF2908F26C8DE73833E atattaggtgttagttatcaaacatcacatcacctagacagccctggccttagaaatgtt
622,001,024 *400D31EE8E18BBE1C5E54F306E1D5490A2CE2C0D Atattobmi
622,001,025 *40008759EA052FE2309A7329C99240EDFA83D2AE ATaua
622,001,026 *400308B6B2FE21DCCEDEA81E1CCE0219B6B26D54 Ataviccivata
622,001,027 *400CECA05BCB65684F3EB71691F1B50C8497C038 Atawdrily
622,001,028 *4004F0E0FA95816369345F99935C05E059BCFF70 Atawitus
622,001,029 *4000D775E6F985E4D094BDFA738314218EA06FFB Ataxicses8
622,001,030 *4001EB1B2F2DC0BB309475EC94F7178C778C79C4 ataxinom0
622,001,031 *4007903EC794680B244DBC9AD0D13E107A96FFE0 ataxra
622,001,032 *40085742845EFC646170F3028B6C10698E57677A atazanando1
622,001,033 *400D748DDE799F703A269F77E76D502F25699A95 atazanavas1
622,001,034 *400572ED4D9CA70BB83548099FE033FF3B4891D7 AT?b0
622,001,035 *400A26E1B6A55CBFBB782012A42AF9A30AC18F2E AtB0(
622,001,036 *400BF273F6346C77C7F1DD47A10338FCFEBAEA3A Atb0
622,001,037 *4007EE5C74125D02DE07714B8B234FD37EC88522 At_b7
622,001,038 *400AAF75550D5C81EDA6C810E0EE1E8CB6D437EF ATbGh
622,001,039 *4003EBC1605CDC1994F6BC5131B64536496F7E4E A=tBp
622,001,040 *400DEA2D6A05DA0C5CAAFAF9A01D01F1A9F30CA7 Atbtf
622,001,041 *400DA478A0F3FD409491E088FE71241AB4E97A37 ATbTY
622,001,042 *400D57DC494B6DCB60B6D9CB38199E6247DAAF94 ATb"v
622,001,043 *400749A80FFD98BF6BBEFF338490B1D86B8C67DF At+bV
622,001,044 *4002827B05F42B7B8998C7C8036D0C3A144A6886 AtbXg
622,001,045 *40058D4001A35AD8F517DC3F48B8CD9870CCD2D2 At(C)
622,001,046 *400135B0493B1AC69C3D0C5FC1B9D17264B9E6D4 At?c+
622,001,047 *400AB0EE7B30300480EAB01573D58B09DD03C9B7 A;tCA
622,001,048 *400679F63C702AF87431E1AADD48921027131959 Atcartni3
622,001,049 *4003238500FFE4171A237C0DE4078FFD1224F982 atccaaaaaggtcactgaagacattggaagcccttctgcgattgcctttcaagtggtccc
622,001,050 *400FACC8C2BFCB5DB260B2927285793BAE571B67 A_TcD
622,001,051 *400994C6AC2E386BBC6B69A458200C03E17C39E0 Atcetbus9
622,001,052 *400FCDEBA08C88D0192E8543617AD983E439F1B2 AtCEUXX42
622,001,053 *4002A09F11B3BB8F09279DE2DE79C3918201FA7D atchazo2
622,001,054 *4001B942E25DB9F0464C5D0F1199C2E05D838362 atcjzbush
622,001,055 *4007D1AC474B8ED165977FD01394B85CE2475CEC Atcl1
622,001,056 *400EFF30634F7BBB505706438817D2274D8EC4C9 At=CN
622,001,057 *400460A6F623B68C48950E3095782F8F1E8E2E42 Atcreep1
622,001,058 *400A61BE82BAAFC2ED34781A5A872285C88B7E8E atctttaaaaatataatttaaagctgggcacggtggctcatgcctgtaatcccagcactt
622,001,059 *4008E5F01BD500DABA33397ACBF4C70220E43CAE AtcUP
622,001,060 *4001EF372CA3A3DB2D5245D783CD63BE79358C15 A)-TD
622,001,061 *4009715D0CC4270DF2F21F4A40F09DF487CA8D25 A+td(
622,001,062 *400E2CE1950A2C6E01017838A34A403FF121CF5E Atd3
622,001,063 *400ED9B734636CEDE609C070D52386EDC9BB707B Atd5=
622,001,064 *4002E47040B3337BFFA95DBCDC1BF574D5C49C1E A-TD6
622,001,065 *40058E85E02EB479C79DE64A59256002F25EC7A3 Atdaatda
622,001,066 *4001DB5861DBC89CC214633BB068DD2039B590EB atdag
622,001,067 *400D38633FFE260FEF5B949874A8BF1A5B0E8715 Atdeletes
622,001,068 *400AD94617008015194F9694D94A8DA085803C00 Atd=f
622,001,069 *400B67E1B471184127CAAB603E8D71A13BDC80E3 AtDLu
622,001,070 *40063FF89D5B526265C073E913DFFC1439112A5D [email protected]
622,001,071 *40039AA58BB39B856735F30A252634CD51FC820C [email protected]
622,001,072 *40071A1972434C00846ABC6ED2DE4C0E26EB4CCF ATd;V
622,001,073 *400193A6E6C6F005FD354BE450335F8232D0C093 A_tdW
622,001,074 *40012347D5AC3AEDD43729D77D058999223FDADF AT,.e
622,001,075 *400280FE64AACFBAE9BD46478C30C5689F73D633 A,
622,001,076 *400677AF92F6E247FAEB4081E9F5421C6593E52E At+E%
622,001,077 *400FBE66DA619A87A1E5D82D90BEF6A16A725526 Ate#7
622,001,078 *400BF6A842DB82BEDDB160E6CB61F4B05170DFAB AtE9E
622,001,079 *400FEE0E5FA0FB7A78A8E1B51130FFC9941EA2EB [email protected]
622,001,080 *4008366933B94EA2DF00280A245D61714B900FA1 AtEC1
622,001,081 *400E0FB8AB52CA7D9DA27171B43B8AC41C38FCB0 ateeb khan
622,001,082 *4008AE3CCCCAF0AEF01D9E9198CC006CFF7D690E A?teg
622,001,083 *4004F3E905EEC75898365CA9B04781F41AF11221 AteI9
622,001,084 *400EC842ABCC1C278EDEDC332FE720323C6A4686 ateismema
622,001,085 *4009C3D3DDB2BA66E82146581E08527D1C952947 ateismoko
622,001,086 *400A3121394D79541753FBA00A13951F1A29AC43 ATEjk
622,001,087 *400BC9BA2915D7C5556EE42CCE98E9C5053388B4 ATel%
622,001,088 *4003011A8EA05F039E82C81C67C8004F62113839 atelecom0
622,001,089 *40040AB82A393F51C40E2386546C16183B6AFE3C Ateliern3
622,001,090 *400E55082E3FAF24A692D79ABCEB49FF64E95AAD Atelleen4
622,001,091 *400F0F7935DFA8778CA26F4790DF5F663FB6FE1E Atemperoses
622,001,092 *400475A9B655C4750FAB2BB9E9136A368ADB8B24 a temple sacred by birth
622,001,093 *400FED2D3EF63264D1D9FE7E352CED60A63903D5 Atenaip1
622,001,094 *40051F80C6DB00E98037F9E39FCE521DD8D53D94 Ateńczykom
622,001,095 *400F8D13FE3AD14A2E6645C96546428DED0275BD Ateniate7
622,001,096 *400756DA600E267D57C2FBA81B234920A0D0EB7D atentloemos1234
622,001,097 *400434138F00FB871EE714DA1568A2B78B53C38C ATePU
622,001,098 *40099DB32554918B66772D879CB7D296567DDA0B ATeQR
622,001,099 *4008C966FFA5F2F72E26DEC81ABAD3D5258CE000 Ater3
622,001,100 *4005D25862ED2F12D6D30DBDDCB90F70D93F877D Ateremmos
622,001,101 *400897D8F14CB89A9BC366F194B55C7BA1600A43 Aterfjad3
622,001,102 *400B51ED9BFEB055277371823FEC8BEF2DF20093 återskapelsekreationism
622,001,103 *4005B06237CD9637F1DD6C352309D00AE58F9B5D Ateseite9
622,001,104 *400735389FBCA4B6E2A585CAB1AB008E08678746 atessane
622,001,105 *4005B29C6A7061A14E70D91B68068E6D489A7906 AT/eT
622,001,106 *40014446C6B74CD822E3F9DFE9ABF7FE464526AC [email protected]
622,001,107 *400734FAD90AEC4EC553CC52A833D78AFAC4B584 AtEYm
622,001,108 *4009D77426FC73FDA934B502DA4B5D855E8BA4A9 ATEZH
622,001,109 *40056455F6B1BCE5649DC67B8B4602959CF023AB A-
622,001,110 *400BB5F8BB01F81BD85FEB1E4896D5B72B5898BD A)T+F
622,001,111 *400A067A623C863AE97EEEAD2DF055DE0ED1315B A!_Tf
622,001,112 *400638465B85435861BDE5064D3F411AC824BEB9 At.F=
622,001,113 *400D944C803FB69CC041FEAFE4B1E02F191E1C16 At?%f
622,001,114 *400840DC1CCC0AB9EE387016806800825E1B7B48 A=Tf0
622,001,115 *400ADDC27942F5511E91BD35DC60909273E15BFC ATf2A
622,001,116 *400463088CEF607217EA6B3DB46A496DB987007A AtF
622,001,117 *400C5537A978E3501E2AB5AF7A7A95378A4FDF16 átfedés
622,001,118 *40081E5ECED36D8C4FABD3FC1E9E910B1ED3FC62 ATfFs
622,001,119 *400409DB63B0E8CAC0901D77A6BD8AB525A2DE8A ATfkK
622,001,120 *400AA04A192572DE8DB0B9B93061F6B990432250 AtFnZ
622,001,121 *400A45E7B649403AE3B2C8C5C73A0425FA8FD2B9 ATFOOTBSW
622,001,122 *400426CACF48677A272C4D1C168D3A61E9894D42 atfpalmer
622,001,123 *4005CA6373354D632CB6FE87120C086DEB880231 Atf/r
622,001,124 *400557DD3F04F9F0C797E8233A8549B13DCCA2F7 A$$TG
622,001,125 *4008CF191A900442C9C90247D6CD01B1140CD25E A(t(G
622,001,126 *400F707E8440DD9C3283817FB7E0DA4B1AB5E578 ATGARDSPLAN
622,001,127 *400DDB8266D1407765C09A7A466D9EFCD8E3C6F6 atgctgtgccttagttacaaggaggggctggatcgtggagattctgctattttaaaactt
622,001,128 *400F26A15D4664610FB2EFE4F63E983A95219C5A A,Tgg
622,001,129 *400553C0F7D5C6B65F9104AC9F20F23065063137 A_tgg
622,001,130 *400366F861B9334C1FA40B6A2D9EECF30E9E3D52 atggttcagagactctgtttcacagcatcatgtcttgttcttataattcatcccgaattt
622,001,131 *4005FEF3594B91C31D225D0603433BE36CD4E194 AT:GK
622,001,132 *4006EB11976F1EC20115657169DFBF08112EE214 AtGkW
622,001,133 *40048E18AE796DE18307D2D99E05FBA4A216D897 ATGn&
622,001,134 *4002B0661BB93B8344E81E889EAFA6F18D52CAF6 Atg-Q
622,001,135 *400E226B07C388C5FADE134D5E576F7F2F4F16AB atgrppam
622,001,136 *4003522E64652FDE2B53587EBF5E522CBE37454F ATGUF
622,001,137 *4001E8FA5868B1B70BBE593FC0C482A9ED6E1B32 [email protected]
622,001,138 *4009D9B9B1ADB5729E224A162D95B7BFA5D335D5 A_T%H
622,001,139 *4009CBD6C74E4A80C5A234E3371094450A27F089 A+)TH
622,001,140 *400739E9F5A22E8A2879C8A26D5A5C3018FEFF68 A$th0re
622,001,141 *40074C16952C35B1F192224886A63A96FABB6C15 AtHA:
622,001,142 *40032CAC8DF0FFBCB69DCD09D427FAC6821A90A9 athandela
622,001,143 *40007EBD81FED170E2B8BAFC29B59B0A6A48AE01 AThb!
622,001,144 *4000F6A6ACD1FB31E1CD9D9EF3C9ACB1028F4384 ATHbd
622,001,145 *40095038D45660C218F2850EA18971BA906149FA ATHCURTIS
622,001,146 *40095F454CAC8F1179193AF9B3162996249D4FD8 atheiste7
622,001,147 *4008BE4DC136E656F733D31528BDA96E3DBD7B05 Atheisti9
622,001,148 *400E2A1B23D11B1A52F7B02751D721217D1D480D Atheletica
622,001,149 *4005C9FC77E08AD36CCBC5298663344E54846153 Athelst9
622,001,150 *4005247C6983BFC55DBC887E6A3440EE1257C3D9 athemc.t
622,001,151 *400B0F9D12F93AA434D4ABC91311E56D809E7E06 ATHENA1974
622,001,152 *40003AB0D75D5C2078761994948F75D23735277B Athenafroggy
622,001,153 *4004D23A1B0F48C9C851E46CB90855C92846539A athenago2
622,001,154 *4008FCD35BC4637F6C5A116A8449BA55808D5159 athenaterminal
622,001,155 *400DD7D22D69158EDD51426CD1139BCF7ECEC355 athene1221
622,001,156 *40085E84C9B9574FD043F19C0CE79758A8B1EEAF athenshed
622,001,157 *4003277BCB65A5ACC4F4B61284875D05CA49FE68 athergvist
622,001,158 *400744CA55E82CB158A8E81CA6C1A3E6EBCFDE1B Atherlee
622,001,159 *40049AB4F93498ED115162AE2210FE79795E3DEB athfrass
622,001,160 *4007ED88C3127516262FA59C21BFEC223DBF4CEE A Thicker Plot
622,001,161 *400D5CD33CB76E6334EFB4B3F360802E457C2F46 [email protected]
622,001,162 *400EF87C1CFA3D9F25699660326E0D1FCD719DD2 athlans6
622,001,163 *4006CC7A12340775B46C970C7D9AEB95126186D2 ATHLETE01
622,001,164 *400B454F6A156B7FB2C6F33AC18CAEF9E1D4BB51 [email protected]
622,001,165 *4003BA30882AC3BC59D2ABF53F171670792D933C athletechampion
622,001,166 *400094E67E7A5AC851880B293C43CD66F145C872 Athmicheling
622,001,167 *4005A03C7658BF592EC68E4B2DA6816E011C55A4 Athnicole6
622,001,168 *400871346A06F936656D5EAF5E89D99563D94ABF atholtoning
622,001,169 *40044FE7F5E49A82B86074EC1336A2ACA287F230 Athpaula5
622,001,170 *400D501822B8136FF33E4AF9868F2B5AD4E33156 At%Hq
622,001,171 *400A01054273C29749B2CDC2054A6327FF329F09 Athq)
622,001,172 *4006C13709954C749EE1015F13D6B81CC2BBFD22 AtHRDxTg64
622,001,173 *4007C49A036FECE0560C2171F9E7B94816CA9A5E athrong5
622,001,174 *400E41C3251B32C21B51FC8971603A6D63C42E37 Athw.
622,001,175 *40047514756442B72FE00BE86ED935CCEED15975 AT?=I
622,001,176 *40009845033FEF1AA66CE3D83F053F3BB81FFD71 A(.Ti
622,001,177 *400993389565CE943BF9E9FB388B2DF6B7476512 A$Ti&
622,001,178 *40049DB7953E8BFE4713C896FAE15F3DDEFE5347 AT
622,001,179 *4004B3FD7FA910A3E6E6CEE9CACD6B1D6E27671A At.I:
622,001,180 *4003A5B12CF1619D7DAC4C53159FD01E1C7B8217 A$ti#
622,001,181 *40066F1C6CBB4B4D884FDF639FC277F321B1C181 ATi06
622,001,182 *4002B6F5B18A61E547DD67EA16EC076F80ED3A94 At
622,001,183 *400F4CB8182E1021CAC41A2BF47B28A918C14416 At;ia
622,001,184 *40056D151A8BD509BAE8731A7D6B64ECE2FEF12A ATIANAATIANA
622,001,185 *400012CBFA6E400AE7BE0F1873171CD2AF5B5DA1 Atiating1
622,001,186 *400A443F59AB7381171D5420604214AE62ECC56D ATIEKKUV
622,001,187 *400F21B2C1630D69FB93EA1E86F9D692F8AF90FC Atienask9
622,001,188 *4005B8047AC0A0BBEB2D09F5B9302845D8ABAAFC Atieravla
622,001,189 *400A2A947945CCF3AB1EA98B119D946AAA69CB68 ATIGv
622,001,190 *4004B7FA4FCB24C365C59CD4D69982177107E03A ATIkI
622,001,191 *4001292981C86C887993E94DCFCB55B43ED68FE1 Atikisin5
622,001,192 *400FA75D0195F85D9ACC227F6CABCA4015A7593A atilla kocaman
622,001,193 *4000058B51CDECBBC67F503769D61AD3338A00D4 Atimitti
622,001,194 *400B0B9C38C52EED5655778AAFE50F105E4BA3BE [email protected]
622,001,195 *40011ACCFEB47900D234593D6B9E86AA83F46745 ATimScotland
622,001,196 *40037A3DAD19619E4F791AE928CF93C22BCBC7A3 Atinales7
622,001,197 *4000DD2A072119B396459EC5DB70B0325A2BDD8E AtiNF
622,001,198 *40016EC0B0B1A7764EF9E7EB9631E5F79F79573D [email protected]
622,001,199 *4009D11B5D64721E7F74E1AB1372D8EBDDA9D20C Atinidae5
622,001,200 *400E5C4A4CFB9E59E6656451DE14FE4837ADBDE3 AtInK
622,001,201 *400166A613D5700C5E0E5D6BC686283D001A3533 ATINTYTR
622,001,202 *4000E20A69A83B268D1C4F4A7E55FD4CFA10C328 A)tiO
622,001,203 *4000D41F43A070CD0E85225540FD7E43CB8AA227 Ationuki0
622,001,204 *400BBDD835AF4C6CC86BF5725EE5FB69FC81C5CB atiplada6
622,001,205 *4003E4C626371DFB634D20C73B5BE4F364EB1FFA atiqah mokhtar
622,001,206 *400E29BF34DFA5AB2266566F58B238CA3FD9FEA4 AtiR)
622,001,207 *400938508CE0D68DFAAE7D1F336DC990A57EF0FA A"TIV
622,001,208 *400DD4A443EBE3473887947D5107043F620CAC72 [email protected]
622,001,209 *400E19D9498598F80F86FC7A3BB00E38F2186B13 atiwhatever
622,001,210 *40077EF11BB7B84EFCAE5BC7B5693C5C3E891E2F AtIX
622,001,211 *4003BD0D320016F5895B0C49F5BB31A70521D230 ATI-Z
622,001,212 *4005187FA345470A48B8AC957FAD995094023480 atizados7
622,001,213 *400A9B8797E2A0EC5FD0EBB152D81A68DB2550AE ATiZl
622,001,214 *40053EC1CBA36F20B36237714059714398DE9FA3 Atj_0
622,001,215 *4002E82594249F46B46D2A3D02C3BF90C6A4E7C0 ATjdP
622,001,216 *400B18A77092730767D9B46D86388BF5E1C96C82 AtjGA
622,001,217 *400D35109B11E38EA6DDC0CD8649F6A662D3862C Atji_
622,001,218 *400F05D7844D9D3968428294108205563C7F4B37 Atj;n
622,001,219 *4000B81A263F58A4F4234EF989439665250613E2 Atj#o
622,001,220 *4009B18B1C37966FB9B33C44AD9DF41095D9D895 Atk""
622,001,221 *400BFEDAE3B397D337EC43E5F4318F7B58F8488B Atk(
622,001,222 *400F2657BA08D2F98CA7BA9BB3EB56CFC64D9175 Atk79
622,001,223 *400CBA69A7929659754B5C5F93557B0BC0AF7376 ATKCARTS
622,001,224 *4007CE9BDC6029F50F69C2A564AA6969C85E398D ATkf;
622,001,225 *400D1F3522FF2C0EF4D2D3FEC002AB9F30D12E92 AtKfo
622,001,226 *400617083609A0029F720B01AC6457054352EF9C ATkHW
622,001,227 *4005709055DDEEF8991F8E3E66F3A5C3E31C860A [email protected]
622,001,228 *40089C2EA647A35BFE749E255C00CEEE8487CA97 A&tKN
622,001,229 *400DC390ADF61E27A0CB89DF279DCE208B5481F0 Atkomsten4
622,001,230 *400A67B3FFCD40CBD923FB76098E12BF31DD4B87 Atk!q
622,001,231 *400F27CFDB4E4E822D1136F6447B60221CAA2CCA AT:KR
622,001,232 *4002A5574D3CA7DA74FFBC76C6B2D9E7C6A9C75F AtK-v
622,001,233 *400D2C9786D68192E6FFBBE8DC047662B554B0AD ATkwf
622,001,234 *400FAADF1F4C76E7F842443AB12602EA558A0A42 AtkZw
622,001,235 *400C3B39FC11F156B0E111B431B0E0EBEF7FAC1E A&T!L
622,001,236 *40000351FD123F4B2E4EBCC4FC4BF41C6CB7F50E A?&tl
622,001,237 *400A8C93F0047F1E9CEAB89AC13FA6101CB6BD37 Atl+_
622,001,238 *400D520B8B5446CAB2F203D2DA949CF6DDDCDFD4 A
622,001,239 *400A1B13A307D4BC9CB489674B0B83843A69A02F Atlajaus1
622,001,240 *400B17287851A81451A4B0D02FF3B1B6576D9AA8 Atlakior6
622,001,241 *4000D35C7A75F675A0B232B2254D832A8C6DE1E3 atlaltis
622,001,242 *400DA51B284BA64C488F6AA5EB9994B7FBEEA003 Atlammaved
622,001,243 *400D855A8E13B37C5288F125709AE4DF75C62B6A Atlampa
622,001,244 *4009BDC6F11364C80E4FE489CD9AD04F664FCD14 Atlanilo5
622,001,245 *40010BC24B975FE226417DC7A9173CF9E2B75661 ATLANTASKYRISEBLOG
622,001,246 *4001747E15296ACB7C611B993209B0E0FA50C25F atlantatalkanime
622,001,247 *400CA51F1FE15075326F69043434E53250ADCDE0 atlanticocean,fuerteventura
622,001,248 *40044DE972F9155EDD656B122DFA879F50711AFA Atlantiko6
622,001,249 *400698DACCF08DED20D8123548B4DD6D27A5BD26 atlantis9393
622,001,250 *400723D20AF29AFC26445D69B39C4E01F76A3F0D Atlantisu
622,001,251 *400D67924BBB3F1F91CCB118089F0B381A83A5BF Atlantsidan
622,001,252 *4007DA8B9D68878E5610F24E61CB49CB90AC71F6 AtlasHistory
622,001,253 *400C4C8669FCD34A9B38B62EDC9C2C3360F1E6A1 ATLASKESKJOLER
622,001,254 *400EFDA4F66DE432941C1AF2FFD4A786EEE4E4E6 Atlasvlinder?
622,001,255 *400BB2BBDB1D734925916FF32EF4A96FB7485434 atlatılır
622,001,256 *4004F349388ACD1CB76442C1D18994F35E537320 ATL)B
622,001,257 *400C07D21DF905532BBD3602C97D9B9C7FE6A040 ATlCm
622,001,258 *400FC203FB1210554D4D02C96A501E97FEE62103 ATLCUTIE1
622,001,259 *400E4FB932DE304BBD1FBEEAD6E6CC24BCBB1B55 At;Ld
622,001,260 *4004A283FADB91ABE23987128D6A3B8A34E61C5E atletiekevenementen
622,001,261 *4003FF456FE382C06185BB93DFA271741E2BAE01 atletsko6
622,001,262 *400943629358C8CC62457F0AE1EE5D020367E3B0 AtL?G
622,001,263 *40085C053D4C1986F3592FB56DF4ED51454BA166 AtLIA
622,001,264 *4002C04365EBE0509675CC0E0B2D582FD8CE2AD4 [email protected]
622,001,265 *4001E8B9A8ECA0BD9C74029C2378A5A51F08006E Atliekio5
622,001,266 *40040A34617E8019FD8FFD975C2430A098AD0DD2 Atlisiok2
622,001,267 *40052975865F0A58FB2D9F66650B92DAA07808DB Atlonnuk8
622,001,268 *40020134A097D0C63A9B7670FDE0531BA4ED0831 atlotsi5
622,001,269 *400D2E69931E69D1BB6C8AB6DBAB8F3B5191E024 atloved1
622,001,270 *400464FE62F8DA1B830DB8FF8D806BBDA843D7E9 At=lR
622,001,271 *4003ECFAA31D3F53027DC26332EF0BCE11D9BFD2 atlukvodijaci
622,001,272 *40042F540DF102D3A5A8AF2CDDB9C8957C3E82D3 A=TLw
622,001,273 *400E2EB59E3AB9462148282609C54E576A59FD7F AtLwG
622,001,274 *400567AFEC8DD1945A469313F36C4E458106AC57 がATLを発症する。
622,001,275 *4002F84C99A4128E57B0C2B4CEFC73F8912F2058 AT"(M
622,001,276 *4000A3BDA680C173D6931CD36624FB8B61249775 A_tm.
622,001,277 *400E93D181C54E8BA6023AD751F3C30FAD3312D6 At"?m
622,001,278 *40095FD7CECD34C2715247AC13A25070745ED9AB ATM111906
622,001,279 *4000FC5F164476ADE7FE316D53CFCDD398ED243E A,TM4
622,001,280 *400AEF8BAA2E45B9952F2BF61F82B67021A973F5 Atmakers4
622,001,281 *400E3006F127EC7D2818A0C4BFE8E7A2EA33AC97 ATmC%
622,001,282 *400775276DB4F9A19048D06F90B6DB9BBE1D5992 Atmeidens
622,001,283 *400B763061CA80B4EEDD313591C1EBEBE34A19CF atmenden2
622,001,284 *4008EDCC7D8F077427C69A460A711EBB907602E0 [email protected]
622,001,285 *400F8AE32A2ABF113793B3420D927BCDA2B0B3B0 AT:mh
622,001,286 *4000C706E9D810950AF3FA0B9BAAF2D78EF867CF atmnoszférikus
622,001,287 *4005B5DEB520E104388A46AE627BA26EC56C10AE A%tmo
622,001,288 *400BE6253D601E0B42E8DF5CACD3A13DDD068F60 Atmological7
622,001,289 *400159F2245A8C2538C2DBD88C42B7739CA9199F Atmosphere92
622,001,290 *400349A8E34285CF23664C84C1626E12DFA85101 AtmS!
622,001,291 *400DFA40FC2E2E52200E4AF1B7835A2A17F4C6C7 AtM%u
622,001,292 *4000EF3EB927A6FBC99C4B493780D428F31F4DAC AtMvh
622,001,293 *4004F18BCD83C68A193780776314F709F30A7557 AT:n:
622,001,294 *400453F3C124AD561DB596069594E28B9A668D74 A|tn
622,001,295 *40080F8A4C7230DEFD36DCBFFC23AB19F2EE143A A&;tn
622,001,296 *400267E5F8489C721723BA5280CF3F3441AB824E At=N3
622,001,297 *40050C9BAD5229B8D9A331F9B65FFBE0C13EC827 ATn/7
622,001,298 *4001445FDC351EA10F8105E61045F7BE0095D556 Atnakamu1
622,001,299 *400E105A2F471E314CE295ACAD98A18B188B7D7E AtNAY
622,001,300 *400929BAB8D49290DBD7DC0C40081464E63AC665 Atnayaj4
622,001,301 *4001C5B3ACB570F7B2E8ABA284C6D5709FB9CF7F AT/Nb
622,001,302 *400FB889BFB7EBC58C4B4F94B3878010AF6C2F88 Atneppoms
622,001,303 *400C158F03A9C973165903B863AB3E6A7029A377 Atnepreses
622,001,304 *4002E71112F9229E7821FE6594332A6AF983243D A(TnG
622,001,305 *4005A3D1ECF96AEC5540B43B2567E315C4C9375F At#Nh
622,001,306 *40090559E12EF3598383336BD4E86B2D883057A4 AtnOH
622,001,307 *400AD6478438732A9AF7B5FF3D67BF5AE7C33CDD At
622,001,308 *400CB3C81335F52B21AB21DEA6097BB2137E5308 Atnuksud8
622,001,309 *400B84DC86034EE9D506BA4EDE0F622AD5077B05 ATnv9
622,001,310 *400B394B83DEB96C092E439F6B64D088484377FB AT"O$
622,001,311 *400C0D9BD8E9B951ECF4184CE98179BE22A712D2 ATo=
622,001,312 *4006F8EB15FB5E2C6C237C267F00D81214C666E0 ATo;-
622,001,313 *40007CD259F3C7AA030CA3C5C0C464345BC3DFC6 A+TO2
622,001,314 *400C4B0A4B69E5BD448B1592D8B233A698345C4F AtO5i
622,001,315 *4003B13C1DC148AA2D2580FB200EA6A325374BC9 atoapem
622,001,316 *40062FE523229ED1FD1C2E879166A39C4F26C997 Atocirt1
622,001,317 *4004171D7CFC62070FA9D342AA9D907DAD6A3D0B Atoisuuf6
622,001,318 *40068BEC9E93430B26B91A521EA004E588ABAC5F átokjáték
622,001,319 *400810A09D9DF9072F61753FA49334CFC5167E02 ATokr
622,001,320 *4009F87B54F4325B0F6A27924785EDAA18D98F47 ATOKUPO
622,001,321 *400B4AD40922A9893508D2FFD032D8DB52D44403 atollota8
622,001,322 *400073280D34272A792CE312A475BCA00D53033E [email protected]
622,001,323 *40048B47DDB9B6977B3C39A0BDAC25340E16E75B atomboy3085276
622,001,324 *400207118DE84B4B1AAAD2682659D093FF7AC1E2 ATOMNoize
622,001,325 *40000EF68A9F213BC11A308B72FD023AA06E1271 Atompowered
622,001,326 *400F0AA62D11F840853AFED2680EE089C2C58BF7 Atomskoj1
622,001,327 *400AB68303E96FEE156FFF3110F644DDC67FC517 ATOMSMASH
622,001,328 *400442512C6F0A5514C9B5281FFCB480DD16316E at/one/fell/swoop
622,001,329 *400AA212C465F004DEC958A74F11F64A3337036A aton[email protected]
622,001,330 *400F34A34F82C8B3039C03DDC957E0638C9013FE A TOOL-MAKING ANIMAL
622,001,331 *400DE4A2A22E27A6FE0EFC7885FC2E166CFEDFD2 ATOOMFYSICI
622,001,332 *40080B15CA2C7DB5C5E49870BDCDF764931651F6 Atopowo
622,001,333 *400051D14B6DEC7CBBE97059C5CABA03CBFAF63F Atoquina0
622,001,334 *400F27092F3E2ABCCD8C5B449564A32F5003EB1A [email protected]
622,001,335 *400CC4B980ACD0FE734134920C37F5FEC1389E0F AtOud
622,001,336 *400C99FCB05FA225A5DAC6793B55D13CB66F78F4 AtOWh
622,001,337 *4002C73B2A2F3CFFBDD070895F9BEA0B999086F9 atowncalledamen
622,001,338 *40018DD6A532F142DA8F2E34E06680845C5D0BA0 ATOX:
622,001,339 *400C911C715077BE9E1927D267C0953C6767A594 atoyebidamilola
622,001,340 *4007DAD02A93264082AE8029E01BEFFB996412EB ATOYm
622,001,341 *400F2243ADFCF93453E4D9441DB3BC4FE1F36787 A
622,001,342 *400CF8894801CE90F02855918B76DA46B4418899 A"tp.
622,001,343 *4004D4E04A8EBB22843AC937B99C43A13A40DDC5 ATp2)
622,001,344 *400F82A5CDED0FDF114CAFEAF96E9160D9923620 AT-p6
622,001,345 *4001FDA511FFE83178DBBAB7C875D0E376E02B0C A-Tp8
622,001,346 *400A719A01245027BF69FD6C492AF31BCC4C1D68 A+TPb
622,001,347 *400BBBF323A5E46667AB6D29397B1CF4B45A1B95 AtpD)
622,001,348 *40017E31EC8B2520404815C266198BFA131C5DAD ATp$l
622,001,349 *400C9A976F1BF909B92EEE5A9E75DF22AC93E7A0 ATpSm
622,001,350 *40037E7EFA498DE80C5710AE178699A83C25C957 ATpv
622,001,351 *4003A323A51622C3275374EAE97602E4C8E1A896 AtPWq
622,001,352 *4006857270C0D22CECD353460049D67058A8060D ATQ#)
622,001,353 *400733C3C044C58801436CF74DEF9A83454A0DC8 A&/tq
622,001,354 *400950A4A25D19412BDB9C690EA6F188ADF4D0F1 AtqT+
622,001,355 *4009899CC4F4EEF662DD3B1EC79F2B930F848A6E A(Tr-
622,001,356 *4005C2E3D0A54283274237E5D9A38DD10E0439E3 A_tR)
622,001,357 *4000ECD0B5D1795448B62C460A0F4B3615468137 A;t
622,001,358 *400C51B82D5157D3FCDBD509608834A44A434D17 At,&r
622,001,359 *400628F26C756F6BDB734683668AA09396AA4F65 aṯr
622,001,360 *40040EEF7ED47D7BD1E4843E20FC3BBC808A0729 ATR2!
622,001,361 *400C0A545DA880F994CF641902923ED79A02B568 Atrabancndolo
622,001,362 *400379FD334D96D15D867CDF38B7058AE8D80058 atracarías
622,001,363 *4000A03D5ACB1FA14C4BC1AE7AB6DB7EDA0CEDAA Atractomorphinae
622,001,364 *4006D902DF23B9364A2D6A07E8F39542F5E63250 Atraflam0
622,001,365 *400F157D7FCC2BE64342DC566717A44188D94A94 ATRAMENTIFERA
622,001,366 *400C4BEA3EE9BD7D1007D3B72AC0EB2A315562ED atrapante
622,001,367 *400FD55BD337DD00E178228A51AD97CDC130A369 Atraparan0
622,001,368 *4008F12ACC366B9D673A6A1CC1B45ABD3520AD6B atraumatischem
622,001,369 *40036366FE7971873C58635A52CF74D12AA3182A ATrB&
622,001,370 *400F322D6121F6855225AE5C16C9FEA64243465B Atreidean
622,001,371 *400CAB9A21B70D6FEEA557624D3F53590A0D6469 ATRERONT
622,001,372 *400349EEFCC227D4A646956F97FE54A68843FA91 Atresiak9
622,001,373 *400167A111264C907941824315CDBE1AA5017D59 ATr#I
622,001,374 *4001A223D7B54A6E19AD06C8D0ACB1C14C7E42B4 atriaal
622,001,375 *4000D82B04113EEB3DC5978AA051C941BDED57E6 atribraty
622,001,376 *400E7104AF219627BAA4C77F396E6240D4427A19 [email protected]
622,001,377 *40052DC56C50D15A90E39C450A2F26D4A1B7B2CF Atridden2
622,001,378 *4006615147A90EC73C8CA16112FE00B3A732B5FC Atriliny9
622,001,379 *40083B9F0909B2E5CB99E4BF849B00B21D6F5110 atriribut
622,001,380 *4006B2153E0D62B39A0D0ED06900A2A18A30CA0D A=trK
622,001,381 *4008BDFEC5D98888E77559280B8FD19F53E91758 AT:RM
622,001,382 *400F04E5EAD362D38FB349427CB0C3EBC7B9E54B AtRm!
622,001,383 *400AF4676B195E442579F15CBA758CEFF9C8C095 A$TR!NG3$
622,001,384 *400EF80405FEA5B65B6149F9595B2C20918DD774 atroante1234
622,001,385 *4000A0F2091D652DB7E5EADB7C19D876746D1EF5 atrophied?
622,001,386 *4002BEE137B9A03F4CE1CC58FFB698A1A65FDD20 atrophoderma0
622,001,387 *400668F81A77841A047B9674433FF9B0EBD7E23A atropoisomérie
622,001,388 *400B59EF5160793E1655FFC04C57B1816075212A atroxque1
622,001,389 *400D7F5231E60F181055710A6C4141CF11E31AC6 Atr_U
622,001,390 *4007F7CF2071729DDB2AA73A6E3295CDCBD06480 [email protected]
622,001,391 *400D4C87BACA1818B06C5C21CED595494567A303 AT_=s
622,001,392 *400807FDC398348C42E311CB96A4000B56770E66 AT!s:
622,001,393 *400F832AEE1A8F97AC0AA623FD74136ACECEC2BE Atsaaar7
622,001,394 *40023F97FBF0AA994A46EC437FFC521C8AAD37C8 Atsaalip
622,001,395 *4001E9960CC408DEE014428EE7F2EE4AAAD2357D Atsakaso6
622,001,396 *4006E6D8F405A889A35337EC87ED9CF669464BD1 atsakik5
622,001,397 *400FA3F61BF93E1C315E3143383FAD9D6B72B53E Atsamotr7
622,001,398 *4003BE0A081F2C6CE8AA355F8C240DFAC99CF14F Atsamotted
622,001,399 *400946B45C4D4DEF08C6994074CCC0FADE8E9A03 Atsasuik7
622,001,400 *40042DE96592B54132AE3D1C3DF6357AD32AA509 Atsaugar0
622,001,401 *40058088FF69F351063DAFBE2FCEF2F601F3D6E8 A"Tsc
622,001,402 *400A9C50D5ACDED85CC1934E22B262C3FBAA8BBE AtS!C
622,001,403 *400DD13A29A63386DED4FD2100F01A72C8D3B062 atsch20080725brz019
622,001,404 *40069E28A45EE5410F69E6DEE4A6AB436A7D18C1 Atschade0
622,001,405 *40025FCD1A2233FED160340889A9D69EDAA44813 Atsedop3
622,001,406 *40088B2B37329580D619166F652BB89DBC226F93 Atserppa6
622,001,407 *400BDE49EACAC1DB51554C02153F060716083A7A ATSESIAS
622,001,408 *400E2DD87607E101480F646C50905AB494D2C7D8 Atsetni
622,001,409 *4000465DD1297E1711A7DC08F9DE6C46E89B145C ATsF#
622,001,410 *4001BAFD16DEED9A453CCFC249362E9F1C38C7AD ATSgI
622,001,411 *4003851C7CDF5B21820F4C5C9E7ED17194E48F8F AtSI9
622,001,412 *400C7CEEAB646495B5CBE79DF0F7AFC93F83F187 Atsiakni5
622,001,413 *4001ED858265E2714A6FBE6FDB3909CCD1EE1C6D Atsianoked
622,001,414 *400AA2484B03517A446B82784E7277A6D57CF9A2 Atsiarak3
622,001,415 *4001CECEB2A400BB42B97DBE906636EDD40D8529 Atsiedul5
622,001,416 *4004CB42FF14DD96728A322959118E6ABCB6B19B Atsikrut8
622,001,417 *4008AE6E0CEC825AEE0FB84C76B24AF142F9DD76 Atsilhujed
622,001,418 *4001A28583C719C7E9073B8CE96730E806EFD29F atsim1234
622,001,419 *400FFBAE8F7754B3F24A253829B67DEC77BAFA22 Atsimmes9
622,001,420 *400ECDBEC221EC3BAFBCC912E664FF790A640750 Atsimusa8
622,001,421 *40019E18F6D930700C753360DE9DCC3F27EE3D05 Atsinaj2
622,001,422 *40090FAF18B0D5F2C48658EA92361A2E820F6045 Atsinajing
622,001,423 *4004EDA0590E0A36B9D878564F333A7E2F40D185 atsirhc5
622,001,424 *400092CE329BB7E8DE642A5FD9C9BDC4BB3F8A0C atsiskleisdavo
622,001,425 *400436A62DDC61BA8F91A6930BCAAF3BAD195EEC Atsitkej2
622,001,426 *400B450FBF47BD60F2F1F3319F774B8A235A3B49 Atsitsep1
622,001,427 *4009B1214C4EDE9764B414FBB1864C7553265F61 atsiuling
622,001,428 *40013831FBFB00270B7739C1E63835B5C799B2A3 atsjo
622,001,429 *40027A9BA0B849BB53780CAB6C95D925D5C117E8 atsoajn8
622,001,430 *40017D6B55D8ED2D6D9C5017AEBA31D73F3CEE67 Atsodipped
622,001,431 *400C663D71EAE1328FFB22DD14AA186D15368789 Atsopats4
622,001,432 *400E539E46F33A029B6C6C79315A3324F2E82E1D atstarojošās
622,001,433 *40093267EE2B334A10D380FE0E3A99FDE068A8BE Atstuotsing
622,001,434 *4007A3FAE1B58EB75685FCB4BBF4EF16481C0F6A atsunobu5
622,001,435 *40019227AA9209ABD08D340C654392EBBE2276F2 Atsuoyab
622,001,436 *400A5BFBDD404813E21E0DF150FE0B1A7CA93213 Atsupiling
622,001,437 *40074555C92C5911F4F547D30AC8BB10B73AE464 Atsutann6
622,001,438 *400908A0B00DAB0931F50339C4043AE2BD122C78 [email protected]
622,001,439 *40016D71E745E0EDB841231047844BF4320B3A94 At)SZ
622,001,440 *4007252376C6BF97A72A313F781C5A8BF634001A A%&TT
622,001,441 *400EBE57D3F0A16F6101E2E41E4B67BBD50B8916 AT,t;
622,001,442 *400ABFC98645F4B1B3BEE6F78FF264334914280B A?$tT
622,001,443 *400E413038EBDDBD517ACB10A7E1AA3E2DAB7E75 Att!!
622,001,444 *400DBCF82BFECD1FF1592678D0A8CA761DCB2204 attabah4
622,001,445 *40029597D2CBD1A85C60FEF0F2EF2DA4C4A39E5E [email protected]
622,001,446 *40056CF7B95CFF9D019786C5370929BAD476CB3C attackheadon
622,001,447 *4008DFABF61724C9F0180BDFFCC0131E80519C05 attacks32144
622,001,448 *400408CBBAEA492C6191EFCFC4DFDC26D46C234E attacks6
622,001,449 *4002CC928FA43C36019D25C7C9A0BAE2DE6969F2 attaehantes
622,001,450 *400F63FE0E5438A5BE6191ED14F255A7100FFB20 attafda123
622,001,451 *4009894AD19E997C619385440AB30ED4F7F66268 attagal4
622,001,452 *40016769B40C46B38ABE7CE0422DF92DE4155860 Attamina6
622,001,453 *4007714F2967D2C02B8379DBB9A515F2344D37D9 Attasting3
622,001,454 *400D9561EF9D0BE195E7FF46C5E9CEEF486E8C3C Atteasva6
622,001,455 *40049788616927F4F2DC0A6767435D7F151BD6FC atteddus9
622,001,456 *40035CCCCA688F3DF3F5AEEC2542D8B2DDF0524B Attegri
622,001,457 *40049322F1F35A43799BD9E0316DE5F9EB167738 ATTEIGNIT1
622,001,458 *400BBF54F063615D6740AAD340BCB86844A49543 atteignons8
622,001,459 *4006E6B690572C389895C55B5960340CD923061F Attelser2
622,001,460 *400B47DB7D1D998FF967A6D64A1316AEF7A87645 Attemsheiligenkreuz
622,001,461 *4007A26C4EED6365D1DD914526BD682CB1D34316 attenboroughrichard
622,001,462 *400D459352B707BA5C2D78AB8B5DD66CEB8711FF at
622,001,463 *4006E7F83D4853C5DA68F4B41E2E8A3FCEB95789 ATTENDANCE22
622,001,464 *400E09D1889794092AF2ED770F45123B8B029344 attendit0
622,001,465 *400C7423A7D650F375BF23C2EF59D9A3D4258C63 Attennaw4
622,001,466 *400CD96445E39BBF06068A5CC3B582C810497B4D Attensity5
622,001,467 *4009A1FBC2AFEE1E137D0D14FEDB83461D6B70B9 Attentaient5
622,001,468 *40062476A10B30C5F672334C23B3F483028F765C ATTENTINO2
622,001,469 *40038AC9125BD147B104674D86BFF19ADB93686E attention43
622,001,470 *4000BD3A1F7988BDDF5ACC0F2EFC426F81D280A1 ATTer
622,001,471 *400A4E20F939635341B704DD88B61A276623633A Atterbming
622,001,472 *400A3A9043059EAB096266E15058F34FAFE2C39C Atterkin4
622,001,473 *4007466648CB10C66E03B711916F2BE4C118C3DE ATTERRISSEZ!
622,001,474 *4006A7C964200D071D416FF27B6956EA29A74426 atterrs5
622,001,475 *40093A7621FAA01211F0F3F106ABC674C56FB542 Atteruams
622,001,476 *4002277D172E742796D4D60ECA802DD70E5BA0F3 Attevelds
622,001,477 *400326DF8ABCCDAD9B078A25E62E9E8736E12E2C attfoert3
622,001,478 *400E6B324A911703B16E2BDC6B47FE3879415FA0 attgeuehnt
622,001,479 *400D4F04EBAF78ADA7BB1679B5F0B431A7A2263C ATTGYSF71
622,001,480 *40074E536308E67E2B7496BE3B394D1A2A7D5DDC at the ball
622,001,481 *400039B8E8E3CA64FEEC0465FC41DA4482EF43C2 AT THE PITCH OF YOUR BREATH
622,001,482 *4006561BC35124F0F09023F0782BFDD1DD4782EC Atticisso1
622,001,483 *4009DA25EF769AD7ADD588F7E1DF9848FAB5F59B atticus414
622,001,484 *4008EC9BF8CBB8F2AF00BDC88AA72522D2D4E348 attila.citation
622,001,485 *40094A48A70C0DCD400170C922F409449ECBC290 attilajanos
622,001,486 *4009458E686AB8B0185E673C6867D1CA0180EB2D attila lakatos
622,001,487 *400E87AF842B1FB2C876005D7CCCBCDACE44C49A Attilamario
622,001,488 *400D6F55091C68055FECDBEA1E60203D64EBAB28 [email protected]
622,001,489 *400356188EE82288B8775110E6783156645A4863 ATTITUDINISED6
622,001,490 *4009AF734AD2A9D2B59B3B40A3786B8B8F60DDBA At$tj
622,001,491 *400446F3C9C69CBF4490847077D95CA6E9BE7C1F attmariska
622,001,492 *4009A6CE23A817BBE635E40CEEF05EA9F16BDAFB attmen
622,001,493 *400F5518A644CE0AAA49056CC182B77BFC5CF34E A$Ttn
622,001,494 *400AE7D760C3196842D831FDE716B1C0C2BA20FB attobels0
622,001,495 *4003ADA122E4A0BD3B99264638ABEC9332DB5171 Atto IV - Scena 1 / Giustizia, giustizia, Sire!
622,001,496 *400703B59E76960E24130C01D9D55106A129F58E atto secondo: aroldo: ah no!
622,001,497 *40051206BD04062778C5315C2FD3F28C97E14DB0 attourist
622,001,498 *400EC1A54168EC70DAB07E283A40C83BAEB1E21B At#Tp
622,001,499 *400E9CD4A7785236333E7B88FF807A903596C000 «Attraksjonar
622,001,500 *400BC0E3D3BFF1FE22DB499C43E0C7D0C50E9C3E Attribueront0
622,001,501 *40054623A5F370E0229CF57E11A6EC233F1CB0F1 Att(s
622,001,502 *400028272087EA9CD2144D258C971EE9F75D46EC A <TT>|</TT> CHARACTER AFTER THE FILENAME. FOR EXAMPLE:
622,001,503 *40038CA1D41E31607CC60A583AE0177578DC18D0 “Attualità
622,001,504 *4009A1EB766DC13EC19C482A6A5FEC406CAF2BF7 Attuumuu8
622,001,505 *4003F06FF6CC5620F49D2A8809B63C21A573B33E A=T_u
622,001,506 *4004027B94F0B3C6450FBCC5C08A21FF28D610FF AT+&u
622,001,507 *400D4956B66ED3B04BBAA5E7401A90072CACD3B0 AtU&
622,001,508 *4001CDEB9588BE4FFB4131692803B177DA341116 Atu0B
622,001,509 *4006FF1C7317B228645D3038BBB92C3090675119 atubokikiopuene123
622,001,510 *400875B44602142CB48B47B5FB3E89737B544238 AtUi;
622,001,511 *4005F2C9A064E8F4355754D2DE9FAB8A9651657B atulaih8
622,001,512 *400A1BF412AAFF86BD26A1B6CB543FEC6D3A78AD Atulvien3
622,001,513 *40094D98792080F325F4B6FF1F0BC3EBB77D10E1 atumble0
622,001,514 *400D1071D6D3F90F351D0434660B8F2BF90C0EC9 atuneroses
622,001,515 *400F37A38A9A987B875BE738B7E7A70F44CAD72F Atunyuu4
622,001,516 *400CA6D09535C43A7B998810122D049DFDEF8E1D A:tUP
622,001,517 *400ED1A96A7C6FF99991B9BC11A7B06DAEE4EEB5 ATUQTUARVIK
622,001,518 *4001E471BD476394CFB6DEF99712F7911053DF38 Aturaeltemps
622,001,519 *400BEBBB8F396F9D85366BAC36EDE8D670B3BEF1 ATUrE
622,001,520 *400B5793DBB580C1F1C250B89F009A0D50D379A4 aturnaetha
622,001,521 *400F2293047CE4DAA66B6908F85BF81EA18960FE aturu temitope
622,001,522 *4004F97729F058EFDE7E64AB112ED88EE175ABE3 アッツ(Atus
622,001,523 *400E3611F2967DBBAB1DA1517F49CC90A03838B4 Atuskato3
622,001,524 *400AA88F17845E36DB046FE1066A9168425A7743 ATUUPUKU
622,001,525 *400BB2D5FD7F71AAE62B25D65D8588B1418122D5 ATU%v
622,001,526 *400A724C134BEEC58BE15097BEC20E08A4777975 AT:uv
622,001,527 *400C7FD842823C52805F71AA2A4740FF682CADE5 ATuvk
622,001,528 *40047440CB208809083147184B8473F8765E1B64 Atuypnoking
622,001,529 *40079CF02410B57CDA6BEBFAF507D9B306BE9B1B AT:
622,001,530 *40066DF35E5740E3908382450869DF1927241962 Atv#&
622,001,531 *400B16306121A0D6648238B7B80FB465484F4E30 AtV4-
622,001,532 *40034E0304A708DABCADC255E775F9EBE9159C9F Atvarma0
622,001,533 *4005A15B67B4C2BA05C9A755B86A9B49303725D2 Atvaw
622,001,534 *400E78DD7D970903E03A291FBECAC37DF25F3F06 ATVdI
622,001,535 *400B329F9D98FAB30C060AD83F5C41FC9B0C6A63 ATvIe
622,001,536 *40066F4AF20C3995F7EFEEDB2C743DBD71DC3504 At_Vj
622,001,537 *400AE9D868303BEAA5D1741D8FD9D0E4872444DE A?twA
622,001,538 *400D0E1985B15D93C5B73239186D8B7799017A3C Atwfq
622,001,539 *4007EBB058CCDE821C282A816871905F73748C3B A+TWL
622,001,540 *40074266E429D98BD127AC27DE2EE3D0CAD611C9 A"TWo
622,001,541 *4000A3CE43801B586993FC15C20E7C4D23D59738 AtW.o
622,001,542 *400522026D4FD4DDFBE97BB6C20418D2520DA7D0 Atwoodska
622,001,543 *4009CA1829EA3D17588376CF7F292B78A36F064B Atw+T
622,001,544 *40037DB16C138AB5111E01D2B319623C4AF06C9D Atwv
622,001,545 *400B2A2ABA4A6826B828FF0F6FCB721257905A29 aT WWW.LPaGe.CoM You CaN GeT a FRee GueSTBooK.
622,001,546 *40064BCD569748670CE8AACE4D8E62194432AC3E A,$TX
622,001,547 *40040AF366A033F6AC4B4142455AA995072603AC At&X+
622,001,548 *4003DCEDA23DB15B5270320BD2E417AEB87CE409 At#_X
622,001,549 *400B33FE9B6FE3A25E8C202BBECB1DFBD2EFCEE7 AT_X4
622,001,550 *40032E4AE020F19BF20D1F10967C97B10A5B771A A.TXN
622,001,551 *40036002D7523F6ED7EE00617CDDA89009DEC614 ATXW?
622,001,552 *40058FDD3476205F199996930D5ABCE55D0E6870 AT"Y-
622,001,553 *400A05C89E06D62C9F69D1EF371C3C07BFDA96D3 AT
622,001,554 *400F7EA27D344DB4746BD19A03485D9F5FC51CF1 Atyádhoz
622,001,555 *4006837475D493A5B95FADEABC69A21311496A4B atyhpoyrB
622,001,556 *40061DABE9083F315FC86A872365F2B89299E42E atypadco
622,001,557 *4007F3262D2A283C4FA60149EFB246E5E2BE44F3 A"TYw
622,001,558 *40059D1BCC3FD256FC7DBED07B95358F771DBB13 A(T,Z
622,001,559 *400F32268C99F14EA3DF1936753DEC4157262C71 ATZ=8
622,001,560 *40014D348C501D28800AAA2DF6005B2821D22334 atzaroller
622,001,561 *40042CE2EFD410122F3554B1E9A55F1F662957DA ATZHV
622,001,562 *40093B2668A4AE7278B32513775C968A74017C45 ATZOo
622,001,563 *400915E9FD253117BD506182A9F63638FB07C596 AtZ;r
622,001,564 *4001CA49BA9618725C348FB6C46B217C3E6E7D69 AtZRk
622,001,565 *4007C7F4C84499BE87C71C6FFD9E1678CE647423 A,;U+
622,001,566 *400ED6FE4588B2F8F6EF9EEB656AE04A8AF927BB A/.U%
622,001,567 *4005D7C3D34FA7DF33396A0BEE8C02875666C06C A/#U
622,001,568 *40019B259B42CCEC59812C7FCC46E8DEC318E0EC A(\U
622,001,569 *400B9C49DB7B90E15D6E43377D67885AD92ED105 A)))U
622,001,570 *40035336BEECC535501A61E082DA98E16B5DC212 A*U&
622,001,571 *4006E9265ECA2CCBBAB679506B38DBAB280C16D0 A++#U
622,001,572 *400E0D9C49F61B5FF444E423F748A422E4592702 A
622,001,573 *400F0CF748905575A7FBB383A154737A0625C6F7 A-u/#
622,001,574 *4004C887E581A85C10A3F783EFF81D9F8FC7806E A,u.+
622,001,575 *40074D132416E83D3DC14F0834B7AE008082AD30 A;.u$
622,001,576 *40001CE40AE8B729A99D7D619979976000B0E14D A:*u
622,001,577 *40068432D331DD7555E54DBBF1CA776AC8B7BEEE A$u,-
622,001,578 *400D665EADC6C481AF3B7415FEF71CC1345807C9 A#,u=
622,001,579 *4007573A124ED765DE6B6B25AC80A844CA63BC2F A%?u
622,001,580 *40070CCCF5CBEB12EFD29E1EA01A2AA4D2F754D1 A_u0-
622,001,581 *400B82A761636AE4CCBFED58B5415443A9AD7AD3 Au0DH
622,001,582 *400DCB770A7D7B94DDAA15996E9AB130ADCE9E4D A+u0L
622,001,583 *40021A76565C206275378897F2CCD1749F214B6F A)U0R
622,001,584 *400D5A4707560689DE3F86FADBABE2561B659F45 A#U:1
622,001,585 *400699BA3C29F89D8FDB73476C974D0047A3EC10 A=u1&
622,001,586 *4008E2495588E16C8993F3B0C7828CF394F77C19 AU1MO
622,001,587 *400624ACEACF9765884B8F21CF78375DCBDB1253 Au1$O
622,001,588 *400F0F34E5C089CB58EFC6F90D691977F045E441 Au1p1
622,001,589 *400B30820A174DB36F1D98958987E5CE99FED73A AU1Rc
622,001,590 *400131DBF1E9052670F24AB3EE47B8AE63C07FA0 Au#
622,001,591 *400F8EDE195899032E5979E7E5BFF0EA217F3684 Au2bg
622,001,592 *4001CE8353540DA19D4878E04CB4ECE8075AE0C0 AU(2C
622,001,593 *40020D1556A56A880551EF151D0AD3347211AEEA AU2/g
622,001,594 *4005F2B0714792650B9A108AED0C370E84B0B5F6 Au2H#
622,001,595 *4004F0B7A8CF5D7DEDB4405444AC629DAB7E19DE Au2K2
622,001,596 *40050D1D3A08E8FA6185D882480360123920E226 A:u39
622,001,597 *4000ABEE8CD08EA55ECDF9F1796F810663F01033 Au3G=
622,001,598 *400397EBD030080D75256A0744A45763EBDF17FE A/u3o
622,001,599 *4000B2BF37EB860F790242C4133D65035C749DF1 AU3(T
622,001,600 *400B9C2D5EACF988C3F8D0D82BA67AE7FAF351FC AU=4?
622,001,601 *4000D27A6F104866F5766A08D425A0B20A6A7136 A&u4%
622,001,602 *400792A9DF7ED657E1308B9498F45F2CC564933D Au:)4
622,001,603 *400E44BC52DED5F3C5B724D16D22255670F9D6A2 AU)4G
622,001,604 *40054D205A52466C37E198FEFB5BC35116458C5B Au4Nm
622,001,605 *40079C84E6353650F99BD2AA4CB0E54069AA713C Au
622,001,606 *400BC3E6FFB40AFAE9ADE60E222CAA8A63141E2A Au5aT
622,001,607 *400DD029644A84F0BB0E7B72D50102F624BA7CDF Au5Op
622,001,608 *400B739ABDBFCA4356A7EACC6EEDF45526A5FC49 A_u5R
622,001,609 *400E81CD8772DED93D540AEC3FB5960FDAC6698C Au6a1
622,001,610 *4003AA50EAB79F5C80FC6769CDF5BA8CEE9D39FB Au6d
622,001,611 *40066CE85F23BF885D5F3F6723088F76BCBB507C A/U:7
622,001,612 *400D75C333A1039E084BB4584778B77B4332C6DA AU/"7
622,001,613 *4008D8D11250BFC948AA4C69E24863D75FAE669A Au70m081le5
622,001,614 *40096DB9D24D72BC63AAA905E11ED2BDECDAAC1B Au78X
622,001,615 *400F294143BA76D122D72F3661F392257C486A76 AU7Bv
622,001,616 *4009CD0054A2C2D3AB4752EE661D1C2E9FFB6C1B A(u7N
622,001,617 *400E71CF6E4D3580E821B10BCEFFC30030B4F4CA Au7Q
622,001,618 *40050DED2DD53F25F6EEF3D1C3C84C672CE82330 A&u7s
622,001,619 *400232C36A5DDE420CF55CBCDAC9601A6466A9E6 A/U7T
622,001,620 *40041009703B3BC76524D435908C31D5D276531A AU7Va
622,001,621 *4003D8779684CC9608E2E862AE8F990D3AD02B31 A/u8)
622,001,622 *40011E7BEABE64A5FF168756B6FD3D05AC74CE27 Au80r
622,001,623 *400BC0E117454F6743083E14E443D221A95342EE Au85=
622,001,624 *400F91A8D9A833F4826E11A1196496C90388981D AU8:n
622,001,625 *400A491A4DC47C91786E108BC4D16C0C23FFF023 AU8o0
622,001,626 *400EC9AAF4B0C72E525A655F8ECCBF9C3835E892 A)U8T
622,001,627 *40037D7EDA91BF85EF82E8609276332A24FF8744 Au9)$
622,001,628 *4007141ED0911DC90FD82971BDD533B676FB624A AU98)
622,001,629 *400B596FD7C64C2568BDE6CAF323A3F7B04B449F AU"9R
622,001,630 *4007E2B701CAFBAF11E20D53473C2EF64BEE84B2 A.u9r
622,001,631 *400270277B19EEEEBA2B97B1C0833B05223DA498 Au9wG
622,001,632 *400D6F581B63907BB3DB9E4D990AA21563245F48 A-;UA
622,001,633 *4007D9C4B6D7566F98EFE289EFAC8A6F0C11D900 Aua:)
622,001,634 *4000CE9D3C15E5FBD7C2520A9BEA931217925C21 Aua5W
622,001,635 *400CEF3886AB622C570874BA496D3212F95D4EDA AUA7w
622,001,636 *400204A40AD673706927FE2A71A5EAF5C36C288A AuA8A
622,001,637 *40018D7E89B85B9735C3A3A28870E077187740C6 AuA$B
622,001,638 *400C71732D79A3FDE772EE108F0A8C717E74B014 AuAi
622,001,639 *400BE518238674A9303932F289D754E189F9DFFA Auajp
622,001,640 *400AE1EC80C151034A93EC0B111B79D9CDE2BF2A AuAlu
622,001,641 *4004D70210FB2074FFC33F33627686FF068FEB5F AuanZ
622,001,642 *40097469541A21B10496CB51CEB67709FD5B75BC AUarj
622,001,643 *4006A833D78567F753B8061788CF20D1AEF0B4B1 AUAX:
622,001,644 *4004A29BD9F1A79AAD2D49A98EB5076C14FB57E2 A?U;b
622,001,645 *400403436555FC6E181EAD1C53EC3B5DCA5376B7 AU)=b
622,001,646 *40007A830875E6F81A5C42CF057DADF7BAFE1841 A_?uB
622,001,647 *4005C8E025B7F5C4DCBFC69774C5F2B47865D7F5 Aubagues
622,001,648 *4007AEEA858130BE6CA481AB1BF57C6E59321924 Au=Bb
622,001,649 *400253A1B19A453C75A5F0B9254B86C9C2FDEF4A AUB/C
622,001,650 *4009DF7D5914773056FC91E18A67C9B5CCF5645A aubenque2
622,001,651 *400615CAEEA1DC8097AF99DC226AD81B27123C8C Aubinin
622,001,652 *4005057045633DBE2E543575213A4036C76EF93C aubin-thierry-goporo
622,001,653 *400D9B50030A05EE4DED726F8DAD8720AE960269 AuBIu
622,001,654 *4004D9A4AE48AAD89FAE3250CB3BA9E7ED243226 AUBLY
622,001,655 *400117E758CFF193F43360B62D43B996F112A1AD [email protected]
622,001,656 *4002ACF0EEB7C4E22404230B20116106FF284C1C AUb:Q
622,001,657 *400DB795D23237E7F9D7033EFA9AE2B85F0F7557 aubrey.bacchi
622,001,658 *4008AA07E57EA0D33881188F7AA4D0B5E70F1587 aubrey.betancourth
622,001,659 *40049D642135C2CE5BB596BB7CA891D01E77A56E aubrey.burgoon
622,001,660 *40021DBB8D8D562D73CB8EB31DDB7F47A52EFC90 aubrey.buse
622,001,661 *4003E81A9EBF4DC8A0F5E2FA1166DF2C38FB0CE2 aubrey.cadriel
622,001,662 *4004ED6A58A3A08943F6225B6401F1D5B14E30A2 aubrey.casolary
622,001,663 *40018B6A090B6F9936E0C79E6A919588D4B3481A aubrey.castile
622,001,664 *400A4DA2068123B8C3B2B866B62DC8006609E5EE aubrey.drappo
622,001,665 *400A14340B0D190EF9229C5191D65C988122AA56 aubrey.forth
622,001,666 *400CFE381CF5457B0FC851D64EBAB8F1E62F1DC2 aubrey.guerrera
622,001,667 *400F8AE3E4FD65F939B4100DE7805DD6399549DC aubrey.hershberg
622,001,668 *400B52FCB5B64353EE67338FA3B170F3A407AF7A aubrey.luman
622,001,669 *400F6E4FFDAA3633BA9040CF8C8F9F0C18D3C903 aubrey.maontesano
622,001,670 *400275822C564FD9072840F8ABCD518C6CE35338 aubrey.maready
622,001,671 *400360BFD3484DE3126863B055C33341B888310F aubrey.mcmicheal
622,001,672 *400C75D2423605FF6073CDD7558E76550FA824FA aubrey.mleczynski
622,001,673 *400FC78D3AE6822435C6E2FD9068B2C9DEE974B9 aubrey.njie
622,001,674 *400D22412EB0ABC976BE94615EE761C37D22AD71 aubrey.otar
622,001,675 *400DD9526FB8FA821B2183C93B269CE4F52C994B aubrey.prysock
622,001,676 *4000420E4FBBA3199B7CD11DC57035967D07FB92 aubrey.rhoton
622,001,677 *400924225F0F7A426CFA9D6118BBFF1ADB4AA8DD aubrey.richey
622,001,678 *40083CB3902624514E02EA10230A7B99C686CED0 aubrey.seifert
622,001,679 *400B3FED9B1BD8542F046B56334C5499EBFB0170 aubrey.stenman
622,001,680 *400FB838299D222C2C3EC64020B98EEB419D254D aubrey.stiner
622,001,681 *400295BCD4C36D33906772BC8BDDBBA3D8DF2285 aubrey.westrope
622,001,682 *400F57F92A4F30CBD6553B7CDFFC902DDCA30796 aubrey.wubben
622,001,683 *400726462E7C2A378D81B1067A7224A723735CB4 aubrey.zampaglione
622,001,684 *40037DC211B25D780EF9BA0F97A7C8402B7BBC18 aubrey.zollars
622,001,685 *400C599F6C6CB363C6E7176FD9A9E0F35C2F9646 Aubrie486
622,001,686 *4002501A32AE1248FC056EADBFAB439A22CE0E89 aubrie53
622,001,687 *4009E6A4CE806A9B0CC3685F54B0C043DE1E7842 Au./C
622,001,688 *40081FEC79455BD1B352E8AB5B2DD14BEE1D5E67 AuCA;
622,001,689 *40055D68B0A5663CCB7C97AFFF2846584ABC29DA AUc!b
622,001,690 *400439F7C33AF91A85645981CD2D91E83E114740 AUcCX
622,001,691 *40088E3D2C2FBC32888DEEF53C96EC5C40EA2413 Aucd9
622,001,692 *4005A6A8E34A27EA89C68E2C136787FBC6E80E4C AucdM
622,001,693 *400E122258848EF648335E20BE5B4C579FF70DA9 A&uCh
622,001,694 *4005CB079CE6FF0BAC832D81E1236A26AD371C9C auchdafür
622,001,695 *400E2973DACBBDFF12DE56554688235430F982C2 Auch Matrosen haben Heimweh
622,001,696 *40092B6812934586F4A85D77D6C600E045C98CE7 AucHs
622,001,697 *400F49434BE496F3ED26E0B3C5D155CC05220F0C AUciQ
622,001,698 *40062E6F9B30B5C19512DB606C703831B2573684 Aucirist5
622,001,699 *4005686BDA0FA008EB5854BAE27BC5A59D790910 Aucklandom
622,001,700 *40079FF896BC4A24F697F6F598704EA7E405634C AuCLv
622,001,701 *400DC2C16FA2F1D9126454A305CEBE8858FD00E9 [email protected]
622,001,702 *40059C34BBD15B6C3969943D1EDAFF7AFFE57A65 A%UCP
622,001,703 *400F571C626D50EA6678FF57D86353F6116AAB76 Aucreman
622,001,704 *400BDCF171161AD41451813919C1ADDFA04B2057 AuCS+
622,001,705 *4002026C36895C3EBC2C4A246C064F53C8E3626A auctionme
622,001,706 *4007214C860B6184931962545835D6B94DF8E9DB «AuctionWeb»
622,001,707 *400AC445C11F7E16EFAF325E40076E2DED91324E auctos
622,001,708 *400C19794465DE34914320021790AE2A2A336586 AU.cu
622,001,709 *400EECF1A9AFE8C063099A923CED489A536D5B28 AUD"?
622,001,710 *400D4A605AC0CF124F113A77AD33EAC80E4DC749 Au
622,001,711 *400E5B8D89630A7760FBDD428FA140BA4FBFD533 AuD\
622,001,712 *400EA70068DCDBDA18E191696573B23E64F10061 AuD0,
622,001,713 *400190E91126AA66BFE8CAB35094426120FC2383 Aud!010g!e5
622,001,714 *400947C2E68864F9B8BDF160A8FE98D9E657E9A3 Aud!0m373r
622,001,715 *400B9E3A9AB7CB707A0A650DE9EC040861763041 AUd4e
622,001,716 *40023D7382350FDCFC7060F8E0E426DCA5D7A12B AUD5b
622,001,717 *400DE24BDC36A0EA2E90CB95A4222E72CDE425D7 AUD5N
622,001,718 *4005E7A5B53B592E00884E656AB9B401D39E840C AuD8Q
622,001,719 *40056E27801ED08A9FD8987B9897BB468A9445F8 Audangsi2
622,001,720 *4001C987F612298B1525940B06581C55F8510F44 AuDC5
622,001,721 *40052F4FD0E5DE429A655165AC08D46D907B3E6E Audibertia?
622,001,722 *4003AB995E8759CCD53F46F3868AA414D3A001BF Audibertia9
622,001,723 *400AC246B34C6E629DFFFACC9D9AEF37655B092F audicksteve
622,001,724 *400FBBE0F9BF8601484894737EB5B363923073C9 AUDIENCE-MEMBER-WINS
622,001,725 *40002EB18CC68F361CDE5E7BFFE08451C42FABA1 [email protected]
622,001,726 *400856947EB2722C9C571713E668D12239CDEE3F audioimpedance5
622,001,727 *40000E872C50ED1B1F215A94C7C5D44C9569F471 AudioMicro
622,001,728 *4007E7FE8014F9EA575D3692D797A09F461E877F audiosalaf
622,001,729 *400A114073514CC33B9B2E7012C2212E57210753 AUDIOSLAP-PROPERTY
622,001,730 *400841896489A1AF04E8D725DB1BADC3FDD88B82 auditionnerait4
622,001,731 *4001EF067995E41BF260E861AE415BA49260BC04 A!uDk
622,001,732 *40040A2087B61FB609FFE574C8A4A678ABA6AC56 «Audrey
622,001,733 *40072E491B21E4DA78AC536F71B0872806B2AA79 Audrey192
622,001,734 *400CC23E2139CCEC443769FAB2739C1FCBF9F3A5 audrey hepburn in pill form
622,001,735 *400550B5EBE38CA0034287C03155BF068108CDA6 audreymasson
622,001,736 *400F21A5FE4B730FA0E4C6368252335038AA85DD audrey patten
622,001,737 *400BA1EE7173A2E686F04173F190FE43FA2F5ABE audrey slo
622,001,738 *4001B63FAD418248E4185F43CFABB3D677ED0E02 auDrie
622,001,739 *400A59B2E4D77F14C158F1F91049C418AC32AB12 [email protected]
622,001,740 *400B58F8E18A9FF48FB10A782D1C54AEA2B12974 audryetmathys1234
622,001,741 *4006887DAEB011BE3EAC74F1EE02D4452A25DCF4 AUDt;
622,001,742 *400A7A7F547A28DFCD6F048993240F5803DC3EB8 Audubonistic?
622,001,743 *400D6F25EC47C3985601D382C83FEF190C6358F3 audvxdug22
622,001,744 *4009B6330E6B9AE6174BB5D2CCAFE094959129A3 audwens6
622,001,745 *4005EF49A2422ED3C0B5655A4FF086AD8534D14D A!UE+
622,001,746 *400C763E0C4BB0B4B9DB747F9EAE0A11587C2C2A A/)UE
622,001,747 *40089F7B632AFAFB900426BEB5A778D9482A6629 A
622,001,748 *40081F9EA71C7B8C77B5B2C37216579C7E4541BE Aue!;
622,001,749 *400A57B269E68BECA6FA4A0D46BEA2AA6EDCBE30 AuE#0
622,001,750 *400A0B3E5B73C959C140EC1711396CFC54379FE6 Aue1?
622,001,751 *400DAEE387F4A17DD5DC1DF5269DF57893311A76 A.ue5
622,001,752 *400B4D4A5EFC79B6D052CBEEDFC5D027ADD9752F aue911
622,001,753 *40084D9231164EE52E18352C9FE865E517BA139C Aue,d
622,001,754 *400C5AEAAF7526201A6E1DE56D1FC6F4C05E6F3C AU#Eg
622,001,755 *400302FF97B4705866C2A4123F38BA5DD7CF1B52 AUEH#
622,001,756 *4007196360A4FBD363B64227ED7F1A5E5A641386 AuE,k
622,001,757 *4004B4EFEC3F260E382B4C71EEB7F108DDE9C75C AuElk
622,001,758 *4001852FCFF958B9319E8FE5A86C5E99216AD424 AuENG
622,001,759 *400CFDFE673CC1796A670BD7DD46DFB631066B8E Auentyngging
622,001,760 *4005A6CCC85D6F28615BA156112BD2DEF2C61FCB A
622,001,761 *400527064F6823F7B7E9349323D71A31424A9A62 AUEx
622,001,762 *400BDE9C1614EFD1E1104B3C2D4F186F3D962DE7 AU;F6
622,001,763 *4008723C474F60EEBA50757293ACEC02B35F62AA AuFB=
622,001,764 *400F3D0BB3E4919200C1056112BA1F4C5BBB68C0 AUFBEREITETE!
622,001,765 *4002EF393C5EEB0C8816B868CF6BA7B4B5530B45 Aufbewahrungskästen
622,001,766 *400D645C6B9089A4812E3DBC37C1FB5B77A1F1CE AU(Fc
622,001,767 *40040AC94764BADF0BD1ACF884838980219FDB9C A$ufD
622,001,768 *4003AF30EE9A899B642921A82AA16C846D763DAC AuFEZ
622,001,769 *400112AD524D38C742EB6E6F52D49A212CC66B63 Auffasse4
622,001,770 *4006A5B904A20D835DB8F8D638811E2564E4501E aufforstungstätigkeit
622,001,771 *400AA68EC2275146DAD4DF9FE6DB4766ACE70DED AUF_g
622,001,772 *40037144B94C86B10A72C275756D9AB622928F16 aufgabenbereich0
622,001,773 *40009074EFAABCDFE377732A74CB2E9599BF3F01 Aufgeboc0
622,001,774 *4002A81C7DD6EAB25686E4E154D3ABCF6186117C „aufgelegten“
622,001,775 *400A9BBC8EE0108E1843484A96094E6A1BDFADD7 Aufgelst
622,001,776 *400C379944E9FEF27139DEBB8F72E9643A70949B aufgezeied
622,001,777 *400BBBD3A86C2206ECC83A22F198394FC4839963 Aufgusses6
622,001,778 *400DA6C610DAC65333367324E664F5CF51ABEAB3 A)ufH
622,001,779 *400157FCE3A9E894599CAF22A26DED3CB9443DA4 AufH#
622,001,780 *400957A330737B809C8E6814DDB5846127CC40DE AufH
622,001,781 *4007BAC3BAC8EB70583A8A4D45912F16D6883988 Aufhauser)
622,001,782 *400B3F9455C34123D625AFECAF767824E668C0E8 „aufklärererischer“
622,001,783 *400C1110212DD90744A1E40704AD614800A49956 aufklarungspanzer
622,001,784 *400280B29EA0606184EB8E3740DCD67561EF20F6 Aufklärungsschriftsteller
622,001,785 *40022503728414DFCCDABA9EA9D72F18821E4595 Auflegten2
622,001,786 *4005528FB14ACF3CABE826B233C2E45DC12CA11A aufmachertitten
622,001,787 *40007E8D3BE7CBE9B1D7140BB1249B0FB4530DA8 AufN,
622,001,788 *400EAC0B9891A80F960027924D1AA637769BEC68 aufpasasen
622,001,789 *400A2BD7CEBC69515EA5093E2B1DFC48520182B5 Aufrechtsteht
622,001,790 *4000A37CC339BFC8CCC93ECE15738EF4FEC4E6E3 A=UfS
622,001,791 *4008722D184AE5DFB128D5E897B9760363DC7827 AUFSCHNITT/ET
622,001,792 *40090C9F497EEC7BCC02E5588B7F169F862C1D8C aufsichtsratssitzung
622,001,793 *400B8DF27F00B6FE0419348DBFD9C690A1D6EC6A Aufstecknetzteil1
622,001,794 *4002508B5A48EE3B112DEE1D27E61134825F6B5F aufziehpuppe
622,001,795 *40043355292B932F3D549EC75F2DAEA6FACE7373 A:UG$
622,001,796 *40077D60BA564E0C5C31BBF09D78297B88FFA1DC AUG1526
622,001,797 *4001B0B8C74C0DEFDF124142E40B72F75D0BC78B AUG1605
622,001,798 *400420AA69D7B39DCBCDEF8A7853176530689394 Aug1789
622,001,799 *40075153D6488EFEC44E37F8DCEE362AC1922083 aug24th2006
622,001,800 *4007CEDEBC24B43B1AF2CA9C998ED79AAE08DCF2 A)UG6
622,001,801 *4002513A5BC5056FDC130E3C1844ADA766D58DAE AU?G6
622,001,802 *4009D0F51FEC3B85281F9F17905508E637091505 AUGa+
622,001,803 *400DE176AD5B0DC4E1BD4C3FC7A61B0BB34C58E6 [email protected]
622,001,804 *4004A509B25B6DE33FA2C4297A879EC053FEC90C Augacnoc0
622,001,805 *4009B1FDBAE52D126164E566135A64938D90DE88 AUGcG
622,001,806 *40022808487C7099AD50257410B6935DE138E956 augeas5
622,001,807 *400FB66F1F24D85AECBE6E236182F9A05AFE339F augenrettungsdienste
622,001,808 *40053D70C840750B4E7439C1C362227FD71EBEFC [email protected]
622,001,809 *400E9AC96B6543FBDD575868A7272636407D1AC6 AUg+f
622,001,810 *400556975AC2A58E0F5ECEDEF4FDB357C65CC5EC AUGFg
622,001,811 *40000ABC965F2C09096E9C042BBF58066B448F27 AUG&g
622,001,812 *400B6D36C896648859188D6DB7C7577FEDD3F334 AUGh%
622,001,813 *4001BC678E4484E6F2502FE484E2500F99FD59FE augimo1234
622,001,814 *400BECE9CCEBFDD5734A9F44D909BF90888A5F42 AUG.l
622,001,815 *4003A51D47DE7063047B657E1065F315E2647663 Augmentee1
622,001,816 *400C5DD9FA90C7F6CD36C5B3FB89AAAE2C2FE14A AUgO+
622,001,817 *4006FA9E06C81A54E896DA8AAF6751D8C0B82EDA AUGrD
622,001,818 *40094F0D9A1ECB95AC5F4EFBE6104A04ABC9E160 A.UGS
622,001,819 *40060DF105102D9403A3F91F387F320D3D6753A4 AUGURA8
622,001,820 *40087F0A0BB9533C482A670ECDF2D6860B55893A augurees.
622,001,821 *400E429737A6AA4C6EA64B58FBAE64BE24224A94 auguryo
622,001,822 *400C3DD96C7118B997F8787534FFFE9FE4893D8D august928
622,001,823 *400B03A8E08452C1AAFC6FF162C0EE5F1D553D12 Augusta–East
622,001,824 *40087B7D272022B3A59B295FC0CB19043A1A7AFE august.bartels
622,001,825 *4000128B8A80C37BD5020EC36B107B6B6819BC4B august.boid
622,001,826 *400C45499EDE210001A247B0E3D49E219FE53C1F august.coolbaugh
622,001,827 *40012384B548A61724E2E9E179A42C24A8477D1B august.coraham
622,001,828 *4006034965BE0BAC192DE2649E30BCE092BFCE3E august.daill
622,001,829 *4006DD4E0714B17BDC75BF0997AB6D177BEEBFC5 august.degrella
622,001,830 *40055DE87ACD9EEA0AB39956EED7FDA54D8BFE19 AUGUST-DEWILDE
622,001,831 *4000E35BA9C877603AD3AA6F436A33AE3DF2BD32 auguste-am
622,001,832 *400AD8241B834A6F9E385291B486E89378CBBB74 AUGUSTE-JEAN-GABRIEL
622,001,833 *400D5056F456AD53414797AC379D7918D98CEDCB august.ferentz
622,001,834 *400E0597D12196825C632CBF51219D738A8038C2 august.fritzinger
622,001,835 *40010933F17478AF4E418F41E2779DAD77673685 august.golom
622,001,836 *400A4CA969438A4CE596D84E37F0486602F1DE56 august.hinckle
622,001,837 *4004DECE22842FE750FE63B5117AB1D2F613E941 augusthotrod
622,001,838 *400670DE71F6B6F4CF01F5E9D5BF1ACC32E3A5BE AUGUSTINA0
622,001,839 *4002C623F1CDB2532491097A770097E7C95D17F6 augustin dumay
622,001,840 *4009FB0679D5AA0046C8464424DB7BD00C07F22E augustine.adkinson
622,001,841 *4002211BC73CDD59175073334AECF5EBCF41B4C9 augustine.amoe
622,001,842 *400F0A29838C6AE083093E777CE1E2CBB18B6FB7 augustine.brigman
622,001,843 *400EC14A5777069ABCDAD058D76FDCA7E7C74DD1 augustine.clemence
622,001,844 *40063D94518AB189FC73F2A3BDBC5DAED5375EB6 augustine.dollen
622,001,845 *40009262E07367E7958076405FDD8C1A5CA74BC9 augustine.genich
622,001,846 *400E51A7B240438E70A241003F01287D734B069E augustine.golias
622,001,847 *400FA308359CE889121C07737B14D5448B08CEBC augustine.hannay
622,001,848 *4002A201C3EEE8EEC5608F9B474DFEA950AFEB7B augustine.hilderman
622,001,849 *4006221B17DC87EEEE69AE0F1104A0E5FF206497 augustine.jimerson
622,001,850 *4003C7D52E8D45708DEEC2C4763774C4611FE3D9 augustine.kulka
622,001,851 *4009CA934612F7C2895B31BF6344E8DC4B8FC85F augustine.meinhart
622,001,852 *400A67459F0E53972DFC6BFCEE619F18251C5A68 augustine.peckinpaugh
622,001,853 *400099BF1C551D7FF7E725E227215F59BC5F6590 augustine.roston
622,001,854 *4005F91D93A225037D280EAC925ACBEC990FC019 augustine.sanocki
622,001,855 *4003F547C83CC2004B8129ED5E7E578C712034AE augustine.scaff
622,001,856 *40036FE4BB40F0452E7E18733EF5669A98C628FC augustine.sefcheck
622,001,857 *40006C6F46D1C4FBFDF3B3E2C5BC256054DEA66B augustine.vandoren
622,001,858 *400E2852029398FABDE81F5826C42708B8092714 augustine.weeks
622,001,859 *40044044D983658E70A667460B6D4DAA46FD13EC august.kailey
622,001,860 *4006F3C3FEC214DDE414BACC98BF45DC89D4E08D august.leverson
622,001,861 *40020FCD56B1BCF48236A5C1A63FD39E16A0D547 august.massenburg
622,001,862 *4004656305604F541161BA21AC15045911BACE5B august.minert
622,001,863 *400CE1EE7CC3790EC0CB02C5B99D6FECBE444D9D augustowskiem
622,001,864 *4001CA0F84BDB21850CF625C75B9A47C014E9BE2 AUGUSTPLAY
622,001,865 *400F81349399E1120A9606E3A3658F93F99451B1 august.pridgen
622,001,866 *400733BF4818CA863A7413129499C11E858651BA august.saini
622,001,867 *4003D5CD30B00237A4ADD7260C3D68B23D5683A1 august.stathopoulos
622,001,868 *400D1BB471862993AB5BB48630C5E35FA559777D Augustus769
622,001,869 *40047C41135344F3C9054DBFDD2ACDB1A6F83339 augustus.adamczak
622,001,870 *400CEF30EDF5AF5233902AE699732E6B6C22D05A augustus.ardinger
622,001,871 *4004FE09922523BB3FF8B5AA883A0E2FE1861C04 augustus.behrns
622,001,872 *400FEB9FADED34CE2A8490C2FBA7591483BFADBE augustus.bucko
622,001,873 *400FFC999D35E450C048E9CDF6C4CCCEC7DBC6D4 augustus.cattrell
622,001,874 *40014B72425075465160B26BA16C3DAF1A571ACA augustus.crawshaw
622,001,875 *4008D330E52A8208796009688E5B4BB567F09992 augustus.diluca
622,001,876 *4001B90F0B414B3390E1CD68D66C9786A0104D66 augustus.fazenbaker
622,001,877 *400BBDD14DF3C3A80BA0495F4BF9A57D84D8FB60 augustus.higuera
622,001,878 *40073B2E27E4D266068829831EDE71B8764697A1 augustus.hildago
622,001,879 *4000A54B6405D41B89158E101EAD3847CDFD1C66 augustus.hornish
622,001,880 *4002D05695F2B42C3BC48091B631474E63F49A5B augustus.lodi
622,001,881 *400CAE353B3E0EE1B391283F95C2740568FC053D augustus.nosacka
622,001,882 *400B2296994C75C61B408B91C97AD8107779F8C5 augustus.pawelk
622,001,883 *4000477D2FBC0885F0E11BBB66EF066CCBC1410F augustus.rater
622,001,884 *400D685B7E9EC9FDF8C1CDD088BDCCDD159B127E augustus.roope
622,001,885 *400606EA1DB09D2F6D15D12B463B95302EAA77C9 augustus.roussell
622,001,886 *40098BAB20AA467C3EB58A8C6AD552046FF3150B augustus.sardo
622,001,887 *40002BF304D52E5F713BA18356CC37E192D89A55 augustus.townson
622,001,888 *40054BDF2DC7337A0536913B06FC1368FF623462 augustus.trio
622,001,889 *400C5916118A491323D8C4028567E95A2A44F959 augustus.virzi
622,001,890 *4007F350FEB0A5EDA0590F4088B555E206445B0B august.vong
622,001,891 *4008F500706D5976CB8D1292696B1F54284A6A0F august.vonseggern
622,001,892 *4006F80410870AE53BAC64942D901B61A5F333EB august.wissinger
622,001,893 *400A8ABF0E3AFB90E7319C5544CD22EA2C9732C3 A)Uh!
622,001,894 *40087411A7604E68FAF99F66A65F1B8C3AA4CB41 AUh.!
622,001,895 *4000D6CC57CD755184C8680F87E237B37A41CA36 A_,uH
622,001,896 *400831A18B0CE2C1E2E2668940CA72719ADFB31F A=_uh
622,001,897 *40033E260D9E75FCC587CCA3784EAFCA89124C45 A$;uh
622,001,898 *40005417F6B99AADD86999975788B827AE9D83A7 AuH?6
622,001,899 *400A2D76DE3DD39EA58F8BE1D06634D7E8BF80E0 Auhav
622,001,900 *400C55327D8825B01B133C113EC9F897A48510B9 A;UhB
622,001,901 *400B7954863BF1C91696EF38042C2D31FC9A4099 auhgnaix
622,001,902 *400F3BB490A7704B112F9FC03137E4125A319C99 A=uHO
622,001,903 *4006291BE9E6B14ECF7EC7FC4BBCCA2A0DBB0C10 A";uI
622,001,904 *4002DAA0E2E6F9C9A1630949E8EB9912A099E57B A)uI,
622,001,905 *400834FBAAF672E5BD38F5A65386B440FACF5A8F Au=I?
622,001,906 *4003B972DC7CBD022DCDA02C2735F1AB4173FFEE A=ui=
622,001,907 *4001433DD6CCD2A91156753CC87EEE01FF5A61DC AuI0n
622,001,908 *40050889B73C0179753E64330CB6025586F5B39F Aui9E
622,001,909 *4006E6BDF9E00EDF72F2E0DF02AC78A33F147236 AU!IA
622,001,910 *4003082BFF3A9EC99B555ECB6A333A75BB9C08FF AuIjs
622,001,911 *400F463D867317D7232F5A4B79A615B5432BA098 AU)IM
622,001,912 *400B06A14752BC269AFE8617E64D71905F009281 auinsmom
622,001,913 *40013F13688B9DBFF4BF20001E52DB5006E3C05E Aui#T
622,001,914 *400EE5C701871C30918AE1ED3FB99D18E2AB1D02 AuiT5
622,001,915 *400E91BA818D148721CE2A6CDDD337BB3BB3658B AUiTc
622,001,916 *4001C10C7B1115391609CB5ED365ADD2DAF84F32 AuiYr
622,001,917 *400383AC9F142A0BFB2DB11D373FE9C07104878F AU,.j
622,001,918 *400088B714F07FDA0B0FC9896BD5ED03C08EAF03 Au=j&
622,001,919 *400E62B652A7C97FA5DD8D6793D1DFD225939B3D AUj,A
622,001,920 *400A19D9439F28828484B7154D47F0CC98AD4206 AujGo
622,001,921 *4008E22D1197EEECB6B61CF1389E52D4E1FCFE57 AUj&H
622,001,922 *4001425524B83E03686BB3DC8F2F64D20EC097AD AU!jh
622,001,923 *400DBF723E9A50268AA91BC81B77AB0414C52BE9 AUjmK
622,001,924 *40007754E164FF2211AE6573A46195D7DA076187 A?ujT
622,001,925 *40099C22B2327E3E56AF2189B129E24627C8A94A AujY&
622,001,926 *400516F4B5602867CA7D9B2F407C42AFEBB752D0 A=u/K
622,001,927 *400221925DD51DAAB122D25057F263915A508FB2 A=u"K
622,001,928 *400CFFDA6C2F11E129F5708D36878B49C0AF2EB4 AuK&+
622,001,929 *400FD742BBB9B235D4D14A964D6E3CCC40C902A7 A,u,k
622,001,930 *40077C7B32310336C778C2A8EA71414F7C3BB1A4 AUK%a
622,001,931 *4007F5D2834E68A1C6D2CDBC197B01853E442000 aukalaginu
622,001,932 *400856DAEEEF2774CC562BC4439BE603585D4F1E AUkb+
622,001,933 *400C2E30C1D7D20DCBA9A4D1C1473877725F7BC7 AUKCIONO
622,001,934 *40009CC9D7238CF3D9D14AED713A551F08C4AC0C AuKfi
622,001,935 *400B493A70892BD2FA74E71E57FAA3BBD7A62ABD AUKP7
622,001,936 *400ACCFCC9534A75C85EA0F03151C92B5D22073F AUKQO
622,001,937 *40029E795586C7A9E62C571EC28D835369163EA7 Au==l
622,001,938 *400D0055888C5148DE89063539E4DC5276D283A1 Au?l)
622,001,939 *400F19636CAA0A0F7C292F9EE387E55B71A1C4C3 AuL_1
622,001,940 *4003910A1EF0C07D35D371426D56AA6652B75FC8 AUL"8
622,001,941 *4002D54BED28C2894BC1545AC31CFAE9D9FE146E A$Ul9
622,001,942 *4005F5D5C86075B977D054186E5B6B58AFFB3985 A?ULc
622,001,943 *400EA398ED736ED9F6D31CC12CEEA963E11A4A42 auldfarr3
622,001,944 *4007F216B2E7ABE89986B955410A67C2E364661F Auleticing
622,001,945 *400E7F205A3EA00D568AD6CB2760D3F06FABBDD2 auletriden
622,001,946 *4006ECE2C9115AB03AA7C42D15073887A12A8B1A auliya123
622,001,947 *40071DB7CDBC54546E95E9929EE24066B70D8A54 AuLk
622,001,948 *4000F054121EF8D9B01EECC8FB135A2756473B1E Aulodont3
622,001,949 *400B4C96A6CDAEAED3CCF721DF0C80FB737E852C AULOLEPIS
622,001,950 *400664325C6A068E48F289AE02F43B93A8E99D5F AULr
622,001,951 *400CBE3EC2D1A5B870D0D5E728D7CE4B77EA9900 aultars6
622,001,952 *400FC3944E06CC83F2B481B7F6EBEAEC5C391F63 AUl=U
622,001,953 *400C5EF74F027B9F64DF3113E13E80C6E6E18D61 A&Um(
622,001,954 *40025BA8BA1F354BF9D4B25AEDF009E333A28E73 Aum-
622,001,955 *4004E9D5C3A6CE7BE2D3A3B8BD6D76D97C6FA395 AuMAW
622,001,956 *400C066EC1C6049331E9A81969AB936923D40CFB [email protected]
622,001,957 *4008854B97B674BD6B02ECF356009D5B61ED3AE9 AUMIt
622,001,958 *40072B5323124828ECB78949714C8B002BBCDECF A
622,001,959 *400506C4D458B76F17096046C20DAE06D7B50728 aumoyne4
622,001,960 *400B430D2DA11C176CD82FCE6A55F8884FDFDE89 AUMq6
622,001,961 *400BDD55F82CCE580DF87A830B29BD30C260E6ED [email protected]
622,001,962 *400A0A530384FD4478F6047031F4C43C638A248A AuMtH
622,001,963 *4008E58B602F5061CE87B4CDAC7941F59DCDF37E AU"MU
622,001,964 *400533486B992F46BF7AB614BB6E8493D111A435 AuN/-
622,001,965 *400F828AA54E58F4C27BB3E14FE92E8279FFC961 A=un,
622,001,966 *40041C57F5F786E072A85AC3059643FE60EAB18F Au!n
622,001,967 *400E85A6F42EFF93E3FC62713FA34A54431ABB2B Au_n5
622,001,968 *40005866ABA3F66F0485C736ECE01FCD8FB63ED8 [email protected]
622,001,969 *4003514B51215AD56ACD28602EDC58D08F54B305 AuN7I
622,001,970 *400A0BEA787612CE1F13E32D95F9BF39CE22D96D AUN_AOM
622,001,971 *400B9F8EB305D6F05241339F2E2C8B1FDB33A123 aunatoises
622,001,972 *4002C6C1C1C6EB2AA739C8514A7C40E31BAD4313 Auncynt3
622,001,973 *400B6A2BDDA5D273D3FD269DB9A9B44A87BE85F4 AunD+
622,001,974 *4004071733BB01243A3980D438F4B8ADCB416986 AU"NE
622,001,975 *400D8292446AC1FDCC91969978D7A9AD55C284A0 AUNF&
622,001,976 *4009A7E3BEDF0663F9EC3CB517CA2E9B00A7C3F8 Aunfatiguing
622,001,977 *4004F719D888D1E9ED0B5F5C0C4AC78B7195E8F1 AUnfL
622,001,978 *400D21BD2EF81F0F658CB2434106012941E94F3D Aunincited
622,001,979 *40094D5AAA15EECE1FB256EE9540486A860DB660 AunMc
622,001,980 *400173055DC71A4CA9530F3E525CC5F34CDADEE5 aunque me falte el aire" (lerele mix)
622,001,981 *400F8666E0001282E9E8A06180B05350CF064DA2 AUNrF
622,001,982 *4006C0C7B151DF04ED40F001DA56334A6785A76D Auntiem0
622,001,983 *40075D076CA66F9A9D0EC02F91A318B50F5C98BF AUNTLIER!
622,001,984 *40016140633182E7F9DD1CD9062F7E2A78CDC180 AunvU
622,001,985 *400D28B43E51680C5CA4BC68B87B7B221ACD32D0 AUNYd
622,001,986 *400943A347624250C90CBDF44361F330824DD236 Au/.O
622,001,987 *40079A7845664C118FCA72F97E39882C42FB54F6 Au(O-
622,001,988 *400D282146B83DF072D870C8CDE0B83E87868BD4 Au%o$
622,001,989 *400B6EC98FC49B83ED115597AE7712F7B88D971F AUo2&
622,001,990 *4001129519F64FBE3EBF06A1F567B8E6E9A8DAC4 AUo4U
622,001,991 *400A7B42B5E3ED13A564670EA0824FA2EB37599E A$UOF
622,001,992 *400C060B99E6D36E72AA56708D14991EEE738012 AU/of
622,001,993 *400920557453CFCC13D3117CA5811E9F2185A170 AU+OMOB11E5
622,001,994 *40003B7C895F8325DD76F7DF719FD3CD04D6FC72 AU;on
622,001,995 *40036CBA7C2D34AA4467C270EF87165EC2E81168 [email protected]
622,001,996 *400C657B78AB4108C3550F7C1C339522A00D28F5 AUoq=
622,001,997 *400B22AA70D89D16B4EEEE9838B0104C8BBC4A16 Auorbsw3
622,001,998 *400F1FDC051646DA2A65737539BC448FDE8D7C43 Au#oS
622,001,999 *400B5B2640D9B74D6819229F71DCFBD17FB7B2EB AU.oU
622,002,000 *4006A00BE3428CD6DA970FCCB31B1766EA93A7C7 Auowtres9
622,002,001 *400EB5FE5ECD391B8098FB7EECD0FB512EB018CE Auoyriaked
622,002,002 *40022BF467CBE4D85C4335934F46D5503FF2038A Auoyruuj4
622,002,003 *400A9F355D4A8379DCF76F11FE4440A2EFFEE836 A_UP-
622,002,004 *400FFD1EB3C7B52171CE49CA73DF428BA6B2AA4A AU)$p
622,002,005 *4000FC9B413ECCB3AF52AC64D0CACD39D01D8626 Au.P(
622,002,006 *400BC5DE5477FBF8006AEC743C730AE8A681B0BB AUP3m
622,002,007 *400D8BF3697A8FCB52D57151C3BD182A6932E76F Aupaisne3
622,002,008 *400114112242C8085258D677DFC220CCA82C1C32 au、pdc方式のプリペイド携帯の販売を終了。
622,002,009 *4009B942836EC74D6DD163219E4785997623B419 A$uPE
622,002,010 *40010F04CC71247C06B4E3B0C841C2D6DC2E527D [email protected]
622,002,011 *400B1EDF3FA7D368B1F55F8BEAB0C6F5405A3403 AuPg(
622,002,012 *4001081999A360E77414730FB61949DB3BB90933 AUPL
622,002,013 *40003F115E3EC7C05F8A7DB21688DAF497FCB106 AUPX;
622,002,014 *400062D78372A748C348399FB7E67550FBAEB21A A?Uq)
622,002,015 *400D5FCBFF419EE66177910E855B0C78C1FDF120 A$u;Q
622,002,016 *4009270DD2795651C96D9DDF6F6874FAFC018F18 Au);Q
622,002,017 *40099944F48691A751E36A8A51D62E4B9ECB6566 AuQ(=
622,002,018 *40067E4E3CE282D8A435DB88E7484897391373FC auqabsw2
622,002,019 *40095E0F576A0BD27FF3C8331F1172A341529C6D AU"Qb
622,002,020 *4004446893D576618866DAEF88B6480FEBC224F6 AuQ(c
622,002,021 *40029E2F0AACF403C3196BDE718F70234DA05DB0 AuQHc
622,002,022 *400F8848A416C32435DF4B7D4532B331C3A4824E AUqKw
622,002,023 *400633983AFE4361EE7FE93FC2FAFC45F0C9CEE4 AuQ$l
622,002,024 *400226A5A8BCA5BED878DAE4ABB09111DF97C11A A(UqO
622,002,025 *400492A02D557512F867FAED5FDEE5E3CC59E67A AuQTd
622,002,026 *40021FBFDB688BDCC58C476C25032D8F16247A13 AuR,:
622,002,027 *400A452123840ACFBF82558374D8F73392C324E7 Au+r9
622,002,028 *400A5281431E836B55E57A258DF79DDBE5DD0554 auraham6
622,002,029 *400033FD6EE6FC3E87DB557687E9BFE4060EBDA5 aurama1
622,002,030 *400139D4466CD085F7098D4C71437903AE4D1C64 aurangabadn.p.uttar
622,002,031 *400B9046BD8324B0ADA3B06F104D03194ED60C21 aurantiaceae6
622,002,032 *40023EAF99564FD6FF5C5B55578B8CE20AE4594F AuR)B
622,002,033 *4007B94228E1DCD2957CF1F40CFB98144D81AD5A aurboda2
622,002,034 *4001D7A59FCBD808858B55E65CBBD8746C5C82DE AU_rd
622,002,035 *4005550870C9AC630BED0AF2D24804912B24922D AuRd!
622,002,036 *400D7A05EC1BC61B92BA3BED4016F81BFB2A7D32 aurea ortiz
622,002,037 *400A352828E944DA20A5917A7402617DDD5AD0C5 aureauno6
622,002,038 *400C9D1974B813FF6C54727396BEF63CE13C1770 aUreLia
622,002,039 *40003F3C0445E36C1BF50754E484328C56C5D10F Aurelião
622,002,040 *40055C7CA6DCC775868213938B8E96A0FAE9732B aurelio.cichon
622,002,041 *4009B2967C5BFCC95954760755728B312D69860D aurelio.corp
622,002,042 *400DDC967AF06B36B11F4015588B5B32663E85FD aurelio.cuaresma
622,002,043 *40083A9DEEAAA8B874DAE172878CC3289E9DDECF aurelio.evanchalk
622,002,044 *40008982F6C095A2B6F8F58B9DD079136F87AF5F aurelio.fiacco
622,002,045 *400FEB748CADBD21B22E9ED9EA7EDF7C789464CD aurelio.fusik
622,002,046 *40099F278E16DB007A548D1C27BEF1B228E49FFC aurelio.gaglia
622,002,047 *40001DC91316AEE0B235C6F15CE78B2949894C28 aurelio.ginkel
622,002,048 *40075336A03B7024EBFED6742C6C00A7F4FAE067 aurelio.glucksman
622,002,049 *400CB19F27D3CAFC8BD85D92FA55071E25A533E9 aurelio.greenhaw
622,002,050 *40095A755791B7CC93CE2C83F7420DEA5072C70D aurelio.hargreaves
622,002,051 *4005853679EEF234E121509463ED7D2EDC69561A aurelio.kover
622,002,052 *40056E16F95EB20F98C3557A8169EBB9FCE84DA7 aurelio.labarbara
622,002,053 *4009D81B29995A8F6B0DAD0F737DB31D9E5A8052 aurelio.loyer
622,002,054 *4008BE7949F1E16894A14861A5F34E21E62F2354 aurelio.sandez
622,002,055 *4000DDC5E6FB8477E1910D5B684ECDE9AB4AB8B3 aurelio.schoon
622,002,056 *40072EAFFD3E40643D8FC82DF4605BE9A56399A1 aurelio.splonskowski
622,002,057 *4003BBE861D8604192EB634618E97C077B926100 aurelio.stars
622,002,058 *4008E32A415E6FC72AB7DBFDF9352EE0EEA62382 aurelio.trabue
622,002,059 *400CC56472A502BCD5BBED2A756A1648200209BE aurelio.tyminski
622,002,060 *4002217CC0738A3B1CCF47F2D021E8E720986BC6 aurelio.walles
622,002,061 *40023582715469292BF2F639ED374FDDA193700B aurelio.waterfield
622,002,062 *400977E8EAC954C77D36B87992F08F7F9DD2F8D5 aurenthology (vocal by anne marie moss)
622,002,063 *4003CFF2AC4C6C31DFF9A95B7CF1F80C8FC30FDC AUREOLA2
622,002,064 *40098226CB1D31F22C732A42EAAF222BAA436412 AuR:f
622,002,065 *40043D439176C1522FA22B5E6415656CEA8318CD Au$rf
622,002,066 *400C9888C8285F79B31B4EAD6C0748E1654F1392 AURi?
622,002,067 *4001DC24054F06279B9A476C1C39F1788F2A5B9F Auri1ia
622,002,068 *4000CE3B933387CEABE9BF142CD6351D207288C0 AURIAZULEZ
622,002,069 *400A2171079B74F374E565C4EB47BA7396D73C86 Auringoita
622,002,070 *400D623C94848755FB6EA0624507029E9F954B2D Aurinkok2
622,002,071 *400A34F6EB8CA37AB0A1A41E879EC40899BF5024 Aurinkom2
622,002,072 *400EB60A900E363ED43C37F8124A275C6E9C6E33 aurismunoz
622,002,073 *4000C869094FF56F4057F15E374E1D97C692DABC AUrL(
622,002,074 *4007308E06C254B0FD0F3B7905DFA562B8CDADDE AU
622,002,075 *400DDFAF71185A629BBA62AEF6FF31E0813E26C3 $a+urnale
622,002,076 *400CAE8345D4BAE8B29578B666A64460826A9B68 AUROCH123
622,002,077 *40012A8513061D2517FB96A699CA10DFFF478DD1 AURONT6
622,002,078 *4003DEB7253E9B30151B1CF67171775607995CFF アウローラ・カールトン(aurora
622,002,079 *4003ED1F7D04666268E6EE73AB80DBCDC94A9204 Aurothiosulphate!
622,002,080 *4008F40D47C64FAB9074AB57DFD8563026E418C2 aurpnet
622,002,081 *40074E7049B29135408B9FB15687E008DA58F077 A)uRs
622,002,082 *40023BA542344DAAB2A8300553871434DAC2A64D aurumit
622,002,083 *4001B3F784F4522FB4B238B082B4002FF02CD69E AU_,S
622,002,084 *4008A7025406F4A4F989EA727FD0993272BDC20D aus1000
622,002,085 *400DDB437143C4BD2C936EFABEA72D987559983C Ausaequing
622,002,086 *400470556422C32C4459A49E1C06B6F38EEE3585 ausbezahlt5
622,002,087 *4005AC4AA6811659202DB1D9E324A6D5B203C5E8 Ausborgte1
622,002,088 *40049F5C4D39EEE9D77F5F21A1E7EBE010FF1F93 ausbruet3
622,002,089 *4001E4BDF42AC3B8E56B307E9ADE8784B6205038 auschickeud
622,002,090 *4006318617B04D5F61A6D48E5E3B48438A9E5688 Auscultateses
622,002,091 *400D47C529B9B214ED59F1FE53911C8AC0D120B4 Auscultative.
622,002,092 *400BB94505AB11C670B0F6AB91F4DB2F8334D746 Ausdehnbarsten
622,002,093 *400455A8CCEF7DD0005ECD825CE6EA3A1AF045BA Ausdehnender
622,002,094 *400858EC8C9BA02921746D12642C16758A97FB8B ausdehung
622,002,095 *400B00AE7327C8DDE9213FF754488FA8AA7E7841 Ausdrucksfülle
622,002,096 *400019B11BBE8991FFAAAD2DCF14DF5BFB2799E5 AUSENTARTE
622,002,097 *400E8B6FF929234C24D6C6CDA717550AE98107B3 Auserwähltheitsglauben
622,002,098 *400DD1FABE3005F03C3C8CBD6B995E8B7F6159D2 AUSeT
622,002,099 *400D98F522C105AE18219C1D9E4D94533A1DCD23 Ausfer
622,002,100 *400D38B3709054310E8EE79EA30285B33BA9A572 Ausflugshefte
622,002,101 *400D9EC275E51B87CF229CA1E092EB0602C186BA ausgangsakkords
622,002,102 *40072E364A3A1268A14FA32276563AF823389EF9 Ausgangsströmen
622,002,103 *40054CED0BC8CE709459670CBF957AAABBE4EF29 Ausgemised
622,002,104 *400A896870707EDF65E1497053D6F71F5F209B65 Ausgewertet8
622,002,105 *4004889FD7A1584B7B737534FB02B0A214466093 ausgrabungsperioden
622,002,106 *400EDEEE71CD73CC574E7169A9891EC8A3293BEA Ausgrabungsplätze
622,002,107 *4006812F57EDC0F41107B35FE4F8768EF731C3F6 ausklapptens
622,002,108 *400A0B7BF47103B7254D7BDC31267160BA0E8917 Ausknftion
622,002,109 *40021A41154075663A1BF7D1BC042C39E9355700 auskouj6
622,002,110 *400EC28B41F7A95ED2227804FF5902F7BFDF84E1 auskunftsfreudig
622,002,111 *4000438CA7902B004023115A5BFAC6D423B2CD94 Auskw
622,002,112 *400687A443739105394F2962CB5CFFDA900A659A Auslagebeträge
622,002,113 *40004399C06D94B6E09EAFAD0CC438B95B83C79D auslandBSW
622,002,114 *400D28AEE331CC5FC2ADACDE74530DEF715B381D auslassvolumens
622,002,115 *40050EB9A926BFDCA51FAF6D89A2492F459BE03E auslaufunterstützung
622,002,116 *40079EF1DF6949C5FDA5FED039BDAF1FCB442476 AU$sM
622,002,117 *400910942AAD021D12FCF0FA638C44FB4D73E49E „Ausnahmegenehmigung“
622,002,118 *4004DDC337770AA3AF13C54D6673B8E36828DB01 Ausnahmekönnern
622,002,119 *400F8A72BD9560AD303708223ACB91B95FA4B8C1 Ausnimmt
622,002,120 *400741445A20905136BDB0D6CF328FD0E9801EA2 auspicià
622,002,121 *4002F0236AAC229F30E45E3599A96166B91E448F auspiciadores1
622,002,122 *400C6B126E68A222406B3762C012D8B1E176A823 Auspicije1
622,002,123 *40095A5E8FEC11E5CAA8940F4467B4CCD57E2EAF Ausport9
622,002,124 *400814E981BABB15DACCAC5BF6C53C73B63CAFBE AUSPUFFG
622,002,125 *400CBE7120D51FF9DD8B8D41CB9B354874F68063 AusRadioStations
622,002,126 *4006F76B29C0BB0632CF26701940C9614D93A096 Ausriefst5
622,002,127 *400D239264EEA7833EAC2F97EB11A900AEA98212 Ausrollen2
622,002,128 *400DC13B0F3D5FD18CDAD1BF412230ADEF0714B6 ausrust6
622,002,129 *4009A457DA20ECCD1188BCDFE7FB04AE19C64C8B außaentwückid
622,002,130 *40097772C69E28A35AE0B417F7720C4AF1CA830E Ausſage
622,002,131 *400A03B8D65285F1ED8D024CCFC25547A6000CC8 AUSSCHALTFUNKTIONS
622,002,132 *4001FB6229E5EF2F64996B47CA5D1ED59CCB96DE Ausschlafende
622,002,133 *400C45E8012C7EE066A716CBEAE70778AC09CBFD außenhandelsdienstes
622,002,134 *400328F3DDE5E0F01EE4EE3646A0879764D16B3A außenhandelsgewinn
622,002,135 *400A4642029F43EEE8FF8D66523BB51D9179F3D1 Außenkomandohäftlinge
622,002,136 *400E6DB40757FDCFE051F28328E6CB42B03D2F25 Außensekretär
622,002,137 *400735D5B30276A562DDE04955BF42022F3D7833 „außenteam“
622,002,138 *4009387C375BDEA6315C71DF35D596AC59C6FDA6 außenverbindern
622,002,139 *4007D1AF9167AD96422E130F58E5017A1845D715 AusserAtem,ausserdir
622,002,140 *4008E0A1B9DB27C9AB753B1885CF8F8206D723FA AUSSGrenadierSS
622,002,141 *4004B5C0169BC05F2559AB7FE413BD1707057822 AUSSIE125
622,002,142 *4000FDA40C290A511418589999C5D53A54258168 Ausslnges
622,002,143 *400D96E0060E86C6A0A1470FFC6B58E0DBAB9C3E aussmalend
622,002,144 *400C76B80801475B4C44ED5858DB0F1BE8FA09B9 Ausspuckende
622,002,145 *400D2DE7B194AEBF6717AAEAE93F308F8F35CF69 Aussrichtung
622,002,146 *400F82E7FB6B54D3D7B283934B83E0C7A84E1F2E AUSSTIEG9
622,002,147 *400560D636542A808A9DBF3EC502FD0495076E82 ausstrahlungsgrundsatz
622,002,148 *400BD4F00DD018F7F356D742AEA6013B2A436F34 austauschrechneR
622,002,149 *4003745F57BAB8CF0BEC841AE0B45E7F7ADD236C [email protected]
622,002,150 *4005236F277D87DAE8390BF85C74494234FF5739 Austehtving
622,002,151 *400AB03097AB05D85D4639CA943BAACBE64BEC9A austij1
622,002,152 *400ECE65F5DDEA3A60D818978B4BDD8FC98F709C AUSTIN1939
622,002,153 *4001B722935BABA573A67D6F25D38C329E365511 austin501:colleen
622,002,154 *400092966E9CD593E49DF80C64D36406A4FDE694 austin.broadhurst
622,002,155 *4004F16AC02FF8E6C2CAFDD72580ADDC20E486B1 Austin C.
622,002,156 *4005F78834407E02BEC00724EF7BA703A4A1D3AF austin.duer
622,002,157 *400853306FC68EEB24F4470C61B05402B3395963 austin.hardigree
622,002,158 *40071A79A5E67DA5CA4075E14B715F80F5796765 austin.hinckson
622,002,159 *400DD6B2BA8B187230AA9BECE4D36B4EE9AEFC15 austin.holck
622,002,160 *4003F947CC273CD3F32869CC0266EDD7B45A33BC austin.huner
622,002,161 *40034F474E7E1E5DB50D400C453588543E58521B Austini3
622,002,162 *400C738918906259FCE17A79B7840C968B86851D austin.jubilee
622,002,163 *40003AA9CD1A3C5E535F325C191DF816129B8BFA austin kimble
622,002,164 *40089BDD499DEA7A877BEA24927F67D67C6B2CB3 austin.liefer
622,002,165 *400AB9A34D76A87613B71627D759F86BF5BACBE6 austin.lista
622,002,166 *40099AC46974E48AE4D805151E3D8B895F7EA59A austin.loss
622,002,167 *40048D8F310B331D201028442B7B9F5DEF48F2FC austin.lovvorn
622,002,168 *400C0E035DC5EFEFE1B19D148A54C3CCFA01B5A6 austin.mccalment
622,002,169 *400087E3546185238BC64B99F76890643BB0E8AE AUSTINMIMI
622,002,170 *4005D71DBBFDE3C57E5762B20F1E210879031891 austin.nicolia
622,002,171 *4004A31CAF0064E62BD179D46F80CE1A3F477CE1 austin.polak
622,002,172 *400CC5F8272D6D5220266B0C297A5F5CFF1ACDAB Austin R.
622,002,173 *400CF51C9D3259BB1AED268FA4043CBC10CC68A4 austin.sansing
622,002,174 *4008945DCCAF4262F42F35F2EA9681CEAC1F375B austin.scerbo
622,002,175 *400E07BFF92DD1BC62F3EDF42F649F6ACEFF3214 austin.schaeffler
622,002,176 *4009EF7B00A9877E690F9EF74C24A64424938F3B austin.serl
622,002,177 *400DFAB427BB57BB3322BE4CF92822F2B1B86E74 austin.simpers
622,002,178 *4009A483E843B1134E8A7B7E047ABCEF9053CEC7 austin smidt
622,002,179 *40021EB191A750F9223A2AE4AEB9879DB8487521 austin.soesbe
622,002,180 *400C1B3DA99F5D2C9309A11BDCE4B3BFE1EE4D71 austin.stilner
622,002,181 *400424B392009603AD9B74308D423DA3B28068E2 austin.ticas
622,002,182 *400AF1B5A07367D92ED586CADAEFB9F41A95C8B8 austin.trueblood
622,002,183 *4005EDFADC0022009C9877A229CC68D08300B37D austin.wahoske
622,002,184 *40004610969671D6DB9B67457ED3F797179A032A austin.yen
622,002,185 *40072C33DFA83C3C2C954E2E41E420F2BF87045A austinyesterdays
622,002,186 *400CB01B48E7E819C520B97DEFA2698E30DA1461 AuSTN
622,002,187 *4002457AEB27683D44B29F7E93AA39B0F3412E1D AusTP
622,002,188 *40099842AB1BE326686A552E4308848832AACD61 austraclear
622,002,189 *400B12D94187A10E4D86BBCED715B5C6645D1FDC australiaavicephalan
622,002,190 *4003ED88A8E133C961B904BF248F9BE22464E6D4 australia don't become america
622,002,191 *40046CC414989679845F996EBD58565AD8B3B4F1 AUSTRALIA-MYTH-STUB
622,002,192 *4007E7505FCDB6542391ABE0DAE6F429DCC49617 australian.i
622,002,193 *400F7A96A5D6CC6A9773E73DF00D746FF3D7F930 AustralianKelpie485
622,002,194 *400FAFD0D686E588CEE424D6B6E5D92B2BA3646B AustralianStamp
622,002,195 *400A330398389FAC9006FEA9B45C0E7C2D303C8A AustralianTerrier469
622,002,196 *40020D51909AA12D248E610D49E1C6EC874EBE2D Australispongia
622,002,197 *4002C6B22D114DBE85712786A0EA34C694546305 austria-hungarycateg
622,002,198 *40005342EC093C29E63B1315BC59054AFA858960 austroalpino
622,002,199 *400E394DD2B3F86382CC6C9886E56426472A80CA austro-amerikaner
622,002,200 *4008C92DE0766BF05251A349CA03065A531609D0 austrogemmula
622,002,201 *400541FCDF206421AD92109550469A73128EE3F3 Austurkirkjurnar
622,002,202 *400AC49C7B8C4E836ED22A961F13D8C969030F81 ausweichk
622,002,203 *40076F0D7D2D1353B750B08D4775A8D71FFF053E Ausweisendes
622,002,204 *4002626A304EB1150E911B5891F2DCC654F1E3B4 AuSX7
622,002,205 *4006B9436BC5AF46DC2BD41450C784ED21E97305 ausxip
622,002,206 *400E352361E0F622BF91D46FD7B1F41867CE31EC AUSZUBAUEN
622,002,207 *40023064FB281C7F05B6D48F75C9578F14F45770 AUSZUGEBENDEN6
622,002,208 *400122F5C74BF924C0487A1E70D8F7A8C5D8FA91 AuT.%
622,002,209 *400F57B1B6FB0016939284F8B2CF0B646DBFDC2D AuT_6
622,002,210 *4006158FE49C05EFCD597603015FB0BE2D9E8D7B Aut81
622,002,211 *4002864B4335F2DAF6105BC7F3AFA501848E535A AUt9!
622,002,212 *400DE7D68216FF8FE7A7059680840A76B475C0CC autalkagropolis
622,002,213 *40082CAA2F7122A0612B1FEB3715516F67178A9D [email protected]
622,002,214 *400BA7BDF49DEC528BF4A2E10BD5211BDB715604 auteon
622,002,215 *4007F627571ADCE19533E69291DE52354E0C14DE autettavat
622,002,216 *400AE78CA15A6DAC9979A28B049F2C9F4AC5FEC1 auth03B5O473012634985
622,002,217 *400A5636B8FFF9B9896AF2BE51BFAFF8F0321DB2 authentifiait.
622,002,218 *400E8D6CB176BEB90783BF83E0FD1C2FA5B3CE8A Authered2
622,002,219 *400705A41F7ECD4CAD6724388B1552F2701D3312 authorautsquier
622,002,220 *4004614451C16DF7EAC3A2F47691369D43E97C02 authorbackonce
622,002,221 *40016D4C8FB017EF402C0C4D122092BAC11BACB7 authorbadner
622,002,222 *40012AAD07B48F729C72DD11ADD6540D6B55663D authorberlanga
622,002,223 *40029A02FC2D284557ECD18F237FC0DF9FF43744 authorbrakeman
622,002,224 *400C92C5DFE42072E711188E9392278D33B05767 authorbruhn
622,002,225 *400DF3C3794EC0449114EBD5841980D02BD9A4CB AUTHORCRAFT0
622,002,226 *400E96F7B7A2C72CFCCAFC796E4C2F4C83BE2A23 authorcsuserzp
622,002,227 *4003E23BAB7ECAB370A1CC2CACB93E0F88D4210A authorduck
622,002,228 *400E66B03D56CC4217D47054C4122FDD8AAB0CC7 authoreminor
622,002,229 *4009C8BB631A30908E8FE6E58D68F6AEDB8453A0 authorgower
622,002,230 *40051FA9C84A7B843162CEC6DECA6D2403D640BA authoriatitve
622,002,231 *400D4CBB4F5CDA439FD6724D2E790791E10202B3 authorities.27
622,002,232 *400869247F044D837894E2E016C90E247CA65E4A authorjfkcom
622,002,233 *400D9837719B7C830FD598AC5F4C7A8C487D7713 AUTHORLINKGUDMUND
622,002,234 *400550B843629D0075356E62D163C0D18804147C authorlpez-fraga
622,002,235 *4002110B236B4BA1D2607AEF3D2A18516B2FBE91 authort4c
622,002,236 *400B8FDE5DBE9DE7C1694DDE4A06806A831587D8 AUTHORTOTALNEWSLIST
622,002,237 *40080DEC5C2457382150BA9A34F827F16E49C598 authoruserirate
622,002,238 *40085F9C382CD99493478DAC1175431B0A2E014C authoruserjamesreyes
622,002,239 *4001BDBB7298CC92F5FC55E0832DA853BD6AF811 autieri5
622,002,240 *400E2C8B37864EA456E6667C64601840C1F0CA01 Autioills
622,002,241 *40054F7F7A419C4977E04411FE20C397861E2AB7 au
622,002,242 *400B880CF219E0CDB2C634B8A5D84C09A24051F3 autóbusnī
622,002,243 *4000AA975D702E5BBCA0B79CF6FD8E542D4E6249 Autocar197211
622,002,244 *400274EF4C499104C238ED19D37A7A14B286249D autochth2
622,002,245 *400EF0CBE1A38FC29AA7756B6596A21B04FCC666 [email protected]
622,002,246 *40086B452F7F8C74014462F03F9CD207FB97AEFC [email protected]
622,002,247 *400C667BF9DAAF9C48A1F6845083DF8D2E1DCD52 autoconvintosi
622,002,248 *400F5DBFFE9A3467C7469812F3B3CF295A9F20F4 autocriou
622,002,249 *4008DDD4BA101B4DEBDC89933CDCE2302922B56F AUTODECREMENTA
622,002,250 *400BBD5B7443D78366C675CF7A168A41EB01E164 autodiagnosis4
622,002,251 *400A85FC97F4137F61D16152B3CEEABBB6FA5D41 Autodiged
622,002,252 *4008CF26F26299F5131C393AC36EB9B84D6B71E5 AUTOGAMOUS.
622,002,253 *400C158CA3BC1C6441DE3C7875842B11519BF92B autografie9
622,002,254 *400E871664691F84597593D12A5BAA4A39111A16 Autografieen6
622,002,255 *4006387F20C5BE2ECCACE8FBDD9BCFBF82897C39 AUTOHEADER9
622,002,256 *400B8B78C7F1B7029F5116C2816E773A31C46718 Autoinhi3
622,002,257 *400807DA534FC2E13F73EC8A0B767C709E6F7AF1 Autoklavs0
622,002,258 *400FBAD6E6F5C83B1A6E759FB55135D948926ACA autoliquidabili
622,002,259 *400213A31DF98244026852FFC0BBD46EBF9E6F81 Autolysate!
622,002,260 *400648E266A915DD3BB109810310325F160D9B7F autolytu0
622,002,261 *400EBF129D2107EDBE36F2FCECE8F980606BFDBD automaattisoitin
622,002,262 *40098652BABD2B9BD9A38B5E180A795ACC8BA65B AUTOMATICA11Y
622,002,263 *400C07447EA1893085D1523243FB208CCFFF93B4 automaticallyself-up
622,002,264 *400445213A49FFA0F912D5BB7B803E8E500B0E26 automatic (extended)
622,002,265 *400ED076E0B9A95E7ED937A4EEC44550BA268863 Automatic (Raufast's indie disco remix)
622,002,266 *40028A3DF1AB29575AD126046BDF8994FD893662 automatiken2
622,002,267 *400E860D936B7AF045EE36F4BE6DA1FBDA51341E automatizara1
622,002,268 *40032F2EE68F34F12E8E544C60B194E694F1A18C AUTOMAZING
622,002,269 *4003822414379CDDFB4034262953FA801C6952EF Automobilproduktionsstätten
622,002,270 *400C8A50685534A14232FC80471B2EADCD6D9EA2 autonòme
622,002,271 *4003B3860823991311F18D50811AB1971FA391FA autonomy--free-will
622,002,272 *400AE0133DBF863D16AB5E3C3F86376F20E671D1 Autonyms4
622,002,273 *4008DCA85476F1315DC435E2A09122280DFFAF7C autopianinterlude
622,002,274 *400D3150B57F2CFCD941104D22594A627B6B02FD autoréformerez
622,002,275 *400C44D930863B2A818A38C2FE6943EDAAE92502 autoret
622,002,276 *400A58078B9C5E75BDC331663CC752A45C7590B5 Autorice3
622,002,277 *40041BC88F11C570353AF7E8B8BF2ED9DEFF6149 Autoscops
622,002,278 *40040EE103ACFDBE04BC4C4B5E97261CFE1E1274 [email protected]
622,002,279 *400E3E2566C78D65BB4C31160054CCCFD2DFC8E2 Autostandardization
622,002,280 *400FAF81FDE832BA11460A8660C799CE8B5536C4 Autotrophically4
622,002,281 *40006237CE7D300AA887B20F00A165E8B0B86114 autrittantu
622,002,282 *400EC7ED65AEB1D1E9AAE138B3AF9E8C7F0F2DF9 Autroungarika
622,002,283 *4006E14B5CD696A1F4A2A706C4FF9BB7F92AB9EC Autsahiv2
622,002,284 *400535AB6BF7A78FF1DAEDDDF482A6A6608047FD auttajaasi
622,002,285 *40072601B984258277F2E39177A5957204518A4A Auttetiv8
622,002,286 *400C8E5FF0C5D85858CE41D7549F6391D0465B46 Autturit3
622,002,287 *400F4927D438A3424E5E13709023E7C3DEB82F5D AUTUM01
622,002,288 *400CBF59C2D1DEE214F6403EB933E10A8228D89D Autumn76
622,002,289 *40091CCD9FB386D18B0AA2360EC80D172D9D8246 autumnfrey
622,002,290 *400D2A9BD1A1CA1FCB9A48D119FCF9CF2B128461 autumn hackworth
622,002,291 *400B89FFC7790816BBAC68D22B4DE79D13B9B427 A"?Uu
622,002,292 *40067DEAA66A39088B144C9A4AA9C0025DE21507 A"U#u
622,002,293 *40023FA87B4627CCF95B878FFC2CDD83A1A5A723 A%uU1
622,002,294 *4000A7CA9BDB3FE723B74D56AFC80CDF92F5F7F6 A$uUa
622,002,295 *4009FD5E3939BAC648B27FD553D76324EE2E15F7 AU;UD
622,002,296 *4003C117D3F5F216C27503EF6F6225BEB0B5BA36 AUUd/
622,002,297 *400373C59DE9534FF76FF2C961D7BCF007D1B0B1 A)UuE
622,002,298 *40069A2CA73E79165BA3A8561076150CC32047D0 AUU:i
622,002,299 *40066305A3B7B7AA9EA7A5BD6F392579F8B64777 A-uUi
622,002,300 *4009B838270F4212114649468D5F92271D787466 AUuL8
622,002,301 *400BE9E8D554E686DC854427FF3E637743478C60 Au#Up
622,002,302 *400BC92A9185434A86F6CA66A12AEA4B17E148F5 AuUq5
622,002,303 *40078B334181757108755009BDCA15F31A5AA793 AUUQb
622,002,304 *400F248F97C893268EC18FF9658F96948A470F57 A,Uuu
622,002,305 *400EC058547CF141783FB5E60160761898B851F3 AUUUGGGHHHHHBSW
622,002,306 *400384C29305A81F7DBDAB4FEDCDE8264097909D AU,uv
622,002,307 *40062C83B3DD19D5526A00E13B7517F49AC0F9F7 AU$_V
622,002,308 *4009B746FC9FF1BBE55B357FDB22FB9BF0B70151 A!!Uv
622,002,309 *400945174E6A06D9ACB0259A44C011DB17FE440A AU?-v
622,002,310 *40019F57F9AE21962449E2B8D32686E4BAF4D587 AŪV
622,002,311 *4009107EDDD3DB11FFD6623A32B224A44AB075AA AUV87
622,002,312 *4005B4DB501644B101F1F325ECE28BF3FC26D284 AuV,c
622,002,313 *4005E8DF4691BFD7D4341AB0BE839F8A02509866 AuVCg
622,002,314 *400EC8577D9CF31143F83BDBFD06E630F193B588 AUvD:
622,002,315 *40059B1A50BD5A2F35D3AAAB2E08A9359D08C436 auvergneus
622,002,316 *4008315A528B2F83E2A0B54339698A67B9FB0503 AUvfG
622,002,317 *400BD7CA5D575B55767F06F6554190C8296C128A AuV#g
622,002,318 *400F637BA64E3C5879F0F6F6F094C5CBF03E7EFA AuvhZ
622,002,319 *400A9F5BF615ACA3B664536745C32B915E018AF8 A%uVm
622,002,320 *400A5D0105DF35F6F9A68DAFA330A43929CB114B auvoleur
622,002,321 *4004E0CBAD0343C598EE5E5E180144CBEDA029AD A$UVS
622,002,322 *400DCC8A53ADD8AB4CDB3CFE3924426F5B67083A AUv.w
622,002,323 *4000D6F477E06DD1A307EB97FD8FBF80C3B5424E AUVZe
622,002,324 *40002D58E57DA98CF2DDBF03EF13C1AFA41C8A76 A"u%W
622,002,325 *400A05EB189F33CF707A5BD2ADDED658910B5CB2 A
622,002,326 *400691D06F4B8C9EB105FA11547FDAC3E90508F6 Au:(W
622,002,327 *400645833B0D185DBA244E5FCC0F8D8EB93C7F0E Au-w.
622,002,328 *4002B2E23880792873E7D3FABCBB700C8CCFB921 Auw3n
622,002,329 *400E641BEEF1C3B5354D61D0B9D4D157683A1850 AuWdS
622,002,330 *400040C1401CF2141C9C181361999C3CC6F2F60E AuWFr
622,002,331 *400D6C0DEA62680B31DD530AB076EE92994C18B7 Auwieren5
622,002,332 *400290F4E5DC8789D702BC74C66FA38FE8926519 AuwIu
622,002,333 *400ADC01E60D0A713DB433D3554A5C8BBBCC3459 AUwL6
622,002,334 *4008D21B568D939B6D85D2EAF9E5B4187ACAFCBD AUWNG
622,002,335 *4003182332D6189EDFC982929BD7FE509CFE7DA0 AUwTc
622,002,336 *400D587D3F9BDB762A7A3A9137D3525FCF086C5B A(UX/
622,002,337 *4000C30F238B2423B3F9F7CF7065CA70ACCF4AE5 Au+X(
622,002,338 *400C39F9485B90A14E81B85A877E9280BB0AE693 aux90
622,002,339 *4000BBF9D297421DAE4B9D104A44E1CED8A869F6 AuXC)
622,002,340 *4007BE28B5277A2EF2EC96FFB4CF41AA46F0C792 aùxco
622,002,341 *40000503B9DC42789EBEFB7952AE4CF5A4FD621F Auxencioed
622,002,342 *400B261216CF1F081C7BF79904B44D2836185AD0 Auxiliums4
622,002,343 *400F61E2817295DC80847BA95EE62E04461EE60F AuX!l
622,002,344 *400B075C5873CAD54D2C2B6F3E9182723EB98D11 AUX)o
622,002,345 *400B74D4532F960B3022451B001C23FA1E04F99C AuXwN
622,002,346 *4002A89493BEF57E02C59205326B07593CCE5AE3 A?UY!
622,002,347 *400EBD76C3FB1283C8D10D02299B5BDF874EA056 A"UY_
622,002,348 *4007B321E069D79B976FF1B9101A261D1F4339A4 AUY.#
622,002,349 *40014C970AB39216937339A5D2D55A137AE6F3A7 Au(Y%
622,002,350 *40028AB1C4687DF78E0F036A2C4028668C962FDA Au&YD
622,002,351 *400A5FF18861AE6EC93A66632356D63D00B38C87 AuYEc
622,002,352 *400EFE319E65AE2E10C62CB52E3D8D7B37974A7E AuYfs
622,002,353 *4004AA1D4B18DAA773CBE2F05921C5FD86AA8117 AUYLOVER12
622,002,354 *400E1A067BFDB77CAB6CFE4E39E93E0F30E569AA A?uYQ
622,002,355 *4005637F58E5F81048057B2F422DE2A4F4FC7AE3 AU+/Z
622,002,356 *400B68F736BE486641DAF08C441D8EA165DAEA84 Auzeugen2
622,002,357 *400216A60DA806B0BBF9A16909774BD7EACDBF36 AUZFw
622,002,358 *40067F9126931EC7E00251A3327AA8CAC8F45561 AUZlV
622,002,359 *400480C16B2E567ADAB18991C01BCB18BC782A1F AU;ZO
622,002,360 *4006A1FC6D4CC9E6C54A4E8C5E5A71C5D5F947CD Auzouvilleauberbosc
622,002,361 *40042CA80CC4C89EF5B1892D1661BEBC2B91126C A:UZr
622,002,362 *4008940BA21B51EB0116FCEBDAE796DA9EC8C7A3 Au
622,002,363 *400B074CDCA261E195E1BC5FBA4A19BD7CE4D64B auzzie1234
622,002,364 *400DB89EA5B8935CB985898575CC75AAEF4B67BD A,V?(
622,002,365 *400DB20429F9CF30712106B30F3B07B1D52ECA02 A?#V/
622,002,366 *400230941AED5EE5CF54CB7DDE0125A3418EA1DA A.V+;
622,002,367 *40072E12F7C36862A40C228C75508F1C44881F0B A"&V&
622,002,368 *400F499F5B94517184788AB7C844B2B11D1184F9 A)!V;
622,002,369 *400EE377B8A1266655B6EFA8B9096EA0FAA7E6D9 A
622,002,370 *4007D9B1B59272D23A8B310D507495BC3B253542 A
622,002,371 *40020EBBAE3226CDF4035F1837324141C0A2DE8E AV=("
622,002,372 *40040DA74F31CBF102EF2951B45013EEDE71CEDB A?/v%
622,002,373 *400896B5E28A570B99342AD1ECCD364448D02EE7 A&/v
622,002,374 *400DEE4F6529ED1E3E28D50CFACCBEC79F5AA6F9 A%=v&
622,002,375 *40092E2E815CEC62B727663BA3A54DB1E04C8A11 A
622,002,376 *400FE14F0B32BF07705EB224E6B892C958946FD4 a#;v
622,002,377 *40098BB155878C5A272B1FD7B7D30E837ADF602B ã¶v
622,002,378 *400E762723C98DC4B3B4519DAD03C4EB0F7DD44D A(-v0
622,002,379 *40031EC5414DCD2F0532D2BE4ED44A2F76D88FCF A%v0;
622,002,380 *400283B066F3CD52A87FE9FF5D7ADB2B796DFCAA A:V01
622,002,381 *4004252BFFC8A95CC389FFFDD1F166D1233766E4 AV03+
622,002,382 *40069376A7B001C4CA2D9075D1D3E976FE9700F0 Av05c
622,002,383 *400F8390D01E295B00641073B0BACC07F6651D77 AV0q$
622,002,384 *4005F04C00E91B87A94582236D6702D15A078D91 AV/0X
622,002,385 *400F6CECBC683CBC725A76567669A94A7FF2D8AD AV0XS
622,002,386 *4001E6DF0AC62810E04E3D0005A32AE314A1351A Av16H
622,002,387 *40019DC69C52E3B03590CFBE07F8DB8F6B485DD0 Av1skr3at
622,002,388 *4008FD95B9C9F7E2B514E5E9B74D762BFFA5F421 Av?2"
622,002,389 *4007D92AAE81DA86FF5FD44AA29472EFCEE75D3D av21831258
622,002,390 *4000C5FEEF0DAA4B8D04A97A3DC3A44230D57455 Av2,a
622,002,391 *40064C26DB140EFB82DF5D65DFEAA92C596E050F AV2mN
622,002,392 *400E9D8835546853DBC8299AD47DD69901A82F70 AV2sp
622,002,393 *4009CEC1E4FEF6937B971A8D74AF8BCEEEB84E58 A%v35
622,002,394 *4007A0E870E1DA07F0F21CCF27DA522E452F9DB5 A(v3d
622,002,395 *400078C328BA2758F998C3376ED2369BE09F8487 Av.3I
622,002,396 *4002B2A4C60176582106873ADC94F9BD17DFFBA4 AV3iM
622,002,397 *400415B0ADCEC81ADA41CED6BEB627904DD01FAF AV3V%
622,002,398 *400A9314F2FF4FF986EFE54D64468F7B12E19FD0 Av4+7
622,002,399 *4009867BF2A382E757AE44AD24D55ECBD850D33C AV49Q
622,002,400 *4005140CBA0F2223A9FCE1E3278C42829341FC36 A%V4g
622,002,401 *40082063D6D9DE2044D8308372FAB314BE3C3963 A+V4L
622,002,402 *400DECEEDB9AF4209EE78F59743B9DFEFD9C07A2 AV4N
622,002,403 *40036CD1902122D0E843439EEC0DAC38CB672B02 Av4pW
622,002,404 *40039C5C2A73848EEF6388BD376D0DBD57FD5EF3 A=V4Q
622,002,405 *4005BB78266731A56AD4E3943DF4113ECBD3D12B AV4W_
622,002,406 *400D91318F63858A87DF3084219845CD0F8893B2 A/v4Y
622,002,407 *400D7C85AE01BDAD502EF67E99AD1AEC6A5916CD AV+56
622,002,408 *400158B6C4508FE9306879C06FC58863D5BBD3F6 AV56$
622,002,409 *400485D7B89B4A837E725A480344F8375FC6E123 Av5#8
622,002,410 *400259D02F919C8851DE8FC39C02D1513749DFE2 AV5a&
622,002,411 *40074F00CB63E343AFE1B309C37206B32E05B671 a=v6
622,002,412 *40023AC0364738E4F47371C80A9D339CBA20E5A4 [email protected]
622,002,413 *400F44916FA245FF584A742C36C7A06B8AFED391 AV6GW
622,002,414 *4009B4D93F17F60AF422D33792F2270A9CB4B5A7 Av6Q?
622,002,415 *400A2166F597F1DE30042CCA9DDBD51473EDEF4C A=V6U
622,002,416 *40018B6C492351C71F2D76760958A118F8ED0B28 AV6wX
622,002,417 *400640506768F08642A451754A6D80EB0738CCD3 A=V7(
622,002,418 *4007666AFCECFD7A22CF3E00E54FA83988203D98 AV
622,002,419 *400D90F70F0804D420A5B8B44889F3E3457F6448 AV$7C
622,002,420 *40090CD99C3EC7B4A1D648B8E29304C23864B740 AV7l0
622,002,421 *4006DCB2FC2C4FCDFD7D1604AD649B380180C110 Av7"p
622,002,422 *400A597E3F06139F784942CA26D613E279131829 A.V7U
622,002,423 *400F6A0217C65FEF9C3F91E2052DCD05FC8C0B2B AV7wr
622,002,424 *400AAD9014F3B1B9397EAEF38890DE1DA6430054 A&v8
622,002,425 *4001E2A43E3C47370FE1010D02D377F02D0E6C77 A
622,002,426 *4007D728851161441B16FD7A6C3EBB169AFE5DD4 AV86c
622,002,427 *4001E3637864CFAF207C3D98906F8A817A358C8B Av86q
622,002,428 *40092CC3A164F25D87A8D99DE3D5561F7A63FBBB AV8b,
622,002,429 *400EEDDE60619EDE15132B1C21F01D2CB1908FF4 AV$8p
622,002,430 *400B2C7FB542426C976A8F13C507248E4F91F1E2 Av8P7
622,002,431 *400D0004152969B7A7BD5540867D6FE0F8CF8B65 Av8S$
622,002,432 *40022DE57ACD267CF301396976BC379A5ADB5823 AV8XP
622,002,433 *400FA2F17384F7F8A53A48D6E67362FFF7A27925 A)V&9
622,002,434 *400CF15F77604628B2179DCFDC90EDDB7514217B AV-.9
622,002,435 *40054A6E431EBE85ACA0D4F8CB0F1E4EB16E287B AV9&2
622,002,436 *40031A416E4EAB6DCACA4462676249EA57807FD6 A/V97
622,002,437 *4003F39C1A3A43EC2FAE77D826A24C06735C2A09 AV972
622,002,438 *400CC2540094CF2860B0FE84317F9FBCA9CAC85E AVA_#
622,002,439 *4009D9499E4B4A13895159BC0688143A76C6E154 av*A
622,002,440 *40049489E6A0414525AD839E34B77CF25EDDE04C Ava836
622,002,441 *400A9338C4A112CDEC8392DD3B2AF0B1CF88D7B1 Avadhuute8
622,002,442 *4002A925D94E589BBDCD416BA35BF66DF0EE396C AVADIAN
622,002,443 *400F042916281166912578C317B17FA2430B8856 avadirect-inc
622,002,444 *40048B34B250BC440E90DC70564331C52F94DE58 avadnap9
622,002,445 *400776124ADBAA21D920E883B574EA67AC699B89 Avadoihc
622,002,446 *400F39FAE26F6D840EFAE06C43A9CF47E8B94FDC avahualinca
622,002,447 *40033116CE6FF9183F9CF68661352AD068F48580 avaimena1
622,002,448 *400FC34DEA7107ADFBAB7E8F9CE3D4F7894061BF Avaintoded
622,002,449 *4005F40BB960F1770B00E833867D4D7F4C619A77 AVAISIVAT
622,002,450 *400BC5F7D7DF86C38806ED1DA492C237A7E014CD Avaitsee
622,002,451 *400BE7E9C06DA1801AF2CC00A06F6D32DFE050FE a va j'm'en fous: une vie
622,002,452 *4002071CA8846114745E3FFE56D7576250058977 Avakalas8
622,002,453 *400CD1CA6C875A39A3E5DE355930C0216FAD95CF Avalagen9
622,002,454 *4005B309B63E37B074E9E9CC8EC68FDEE6A97792 Avalaviu
622,002,455 *4000721E1471E56CE393462D4D7AF73BC8E58247 avalere8
622,002,456 *40085BBE172F9BC99A5BD602ED9E8DB36A624CC1 AVALOCSEM
622,002,457 *40098F897AA62ABCB0D8F89702EB9459A7F6E7F5 AVALONGIBSON
622,002,458 *400DACCCF030D26BCF5BBFA7E55412EA6CA2F425 avalongp
622,002,459 *4009887BC09EFC0B04046A5E38017D24199B01D9 Avalonseven7
622,002,460 *400107DC57246C43A4C0FACA58B7B5A72260A018 avals?
622,002,461 *400454964447B6EA3FBA6F7FC4A238747FC4F850 avalwez
622,002,462 *400DAD3706E07914BE903F844141A7657B1D0D21 Avamr^idya.nte
622,002,463 *4002219442858B7192D763A9D81AFE7170C3AE97 Avamufor8
622,002,464 *40078826DA508883CC4BBCBEB7088C8D1C468F2B AV=an
622,002,465 *400DBFBB411221A303B30C24D11647E27B16ADF6 [email protected]
622,002,466 *400650135B9933D706481766281C213FF6E1A1A6 avaneeshed
622,002,467 *4008C7E4C4FE600214D00D63432FBB021395E043 avans1
622,002,468 *40040A6CDB5D3138CF4C250DE82A43B5AD08A83E Avantageais8
622,002,469 *400814769BB2E82E003CF92F864A824181D5DAE6 avantdarriera
622,002,470 *4009D8E7AAF9E9A36B595DEF34FAA6D0C9B8DA6F AVANZANDO1
622,002,471 *4001837696120434ABCF2B3F661A760CC28EE2AD avanzar4
622,002,472 *40074FD9E44F188C014F1D0B173AFE59F3F4A75B Avaojrat6
622,002,473 *4009B4BFEAE09447D6D474EC16BFBA1F330DFD72 Avarcasn5
622,002,474 *400160507900142F8CE94F388DB3E82B62E57709 Avare Y
622,002,475 *400E55F83F00AD6CE18319D3D5B087EB93E1B0FF avarjaniiyaah
622,002,476 *4007DD82147AD2514FACEDD8D03F64569E557039 AVAROPAVE
622,002,477 *40084C17D4742F5AA997CDBFDEAB1BDEA637DBDA avaruushävittäjän
622,002,478 *400EA64E76191C6072A67CBA2A933EA91D4BC0F3 A)Vas
622,002,479 *400D1A13C3376E4532FB82673A01F8638BF09BAF AV_at
622,002,480 *400D30C2B2E359F15F52ECAFCF182B5D8624DBA8 Avatarses5
622,002,481 *4000CFC92FB3E4441AEFEE76184F5D92E735CBE7 Avatásától
622,002,482 *400270AEC727A1B07DB9196A3A3E387B300771CD avatavates
622,002,483 *4003E9C6A9FFC70830BB371799FAD3A5FA4604E2 Avatnap8
622,002,484 *4002012F7F1F3A4B136886B2E71175B2F3152341 Avatsaka4
622,002,485 *400A2F292EF46773BBC5F803414628B7F275E3D8 Avatsocc8
622,002,486 *40014E038F470353E85CC69160463CEB31F3FD48 Avatteup7
622,002,487 *4006B2325C4612057F56220D3D18858735FD21BF AVaw?
622,002,488 *400F8FF73DA56774FE1A1B6CD3CC91028876CFE1 AvAXo
622,002,489 *40088FB46D7A315F8798BDD65A21DEE3D2EFD820 avazlani6
622,002,490 *40052AA94DDD8B7AED64A2D101532E475050782A Avazlaning
622,002,491 *40040250FF2C39CAE5BD43069823AC70146C86D4 A-VB
622,002,492 *40017F65CA3F5C2E2FDD208F1A84CA4BDA2C6693 A)V$B
622,002,493 *40009BD142DD2899D706460CD0667203904DF3DE AVB:&
622,002,494 *400B8A9874E2FB683D1D9BD4F49F895302B9E006 A?V=b
622,002,495 *40086E26D6E76F30B64D6E08FA529E16266BAF19 AvbC.
622,002,496 *4007BEBBE78FCDD15A8CB65A136474683AF257A6 AvBgv
622,002,497 *4004FF52BBD231F432C10D4E9A796B4E8A8A13AF AvBi
622,002,498 *40056176C0FF7E41449932C116A6250230FAE96D Avblsinga4
622,002,499 *400C87F8F60C604D7E992AA274B960CCE3B584E8 A=Vbm
622,002,500 *40094C444907AFD9D80681A0AD84A2BE36099AA9 A&Vbq
622,002,501 *400F8CBB13C47487B9F30C736057E25157C59DE1 Av&BQ
622,002,502 *4005E5FFF01218125423E8D209DFC8229AE98B83 Avbs!
622,002,503 *40032EA4F3CD30BF810532E8C181C331CC7FD2AB AVC#)
622,002,504 *4004A99B62A59CBB45AAD25C1D079A823CA8DED4 A&Vc&
622,002,505 *40033E54765C1EB64789D036FEE7EF57DDB765D4 AVc;&
622,002,506 *4001552F2DCDD0B2BAB0276E6AA5875D199308C8 AVc#(
622,002,507 *4002494697E19707FE6652DA9E99870FFFC716D6 A%-vC
622,002,508 *4006C035A488EE9DC20384318A09413848FC4675 A._vc
622,002,509 *4009B4BB4E5B761DAF58A1F1478270B70175C307 AvC.A
622,002,510 *400DCAC9474058ED46510C18BB73BFA987E85474 、avcd30805)(
622,002,511 *400A909A3E1F6BF075E613F8C664433B16972C19 AvC;k
622,002,512 *400C06571655F41D02F3BFF7BA884F3F3D97EA85 AvcLo
622,002,513 *4005CA00929A1B3229E7CAD062F56D1F353219BE AvclZ
622,002,514 *4006C3AE5F3E90514C31D7A61803A8D8FA279CBE AVcsp
622,002,515 *4001C6EDE870191D76A1D56009EFA1DB7681C974 AvCX
622,002,516 *4005115C530F289EB473DE992BA76E9757A488C1 AVcZ
622,002,517 *4002EBA244C5A9B4AD94BF04FEB9E280F2A22C61 A:v!d
622,002,518 *40056F8C7B91C708EF59B01C05FDA505855C5385 Av:d!
622,002,519 *40002844944C554D0C095BC45CF92D51AD2A6FAD AvD$4
622,002,520 *4000F797B0E362760C008744ED976590B93BC671 Avd5K
622,002,521 *400CFCCA18FD73841505013FF8CD2883CFC621A9 Avdavid0
622,002,522 *400015E27B8BB5B822C8DB401E4487992D002F21 AvdbY
622,002,523 *4009AA2EEE7462A1FEB27F6F632C029FFD483536 AvdEk
622,002,524 *400240EB2F75BDD1C0335EAD5C8FBB8A0AF7DBF3 avdekkes9
622,002,525 *4007C79F0AD975DEB073DFCC2BE635C79B049C15 Avdellib6
622,002,526 *40027CB00D78BE6633C07081E3C6D895DDEA057A AvD?I
622,002,527 *40021F4571024E03295C86C89725078B05462149 A"Vdm
622,002,528 *400B6B14A70671A4EE99341D96CACDEFCF414EC2 AvDna
622,002,529 *4005136912C1F36025E5B46B34D528CBFAD96F09 avdo huric
622,002,530 *40025E6F36DC1EBFC90FF2C875EFD7D57009E14E Avdotias
622,002,531 *4006E7C548AE51A31A61D3105AFC2C1296FF9E99 AVD%Q
622,002,532 *400DAF06B849B86466A128CD83316814B672F408 AvDr(
622,002,533 *40021D9AE681FB791EFE0A3932479A5790DAE5E4 ĄVĖ
622,002,534 *400193007A8D0F26ACEB19FB33D2C1637C3BC910 AVe0T
622,002,535 *4008BAE6596AA49CAEB87271EE5285DDA89BBEA5 AvE0Y
622,002,536 *400D99117E1B44A942165B518446505266BE59ED Av?E5
622,002,537 *400669E6685A606268510429F17BFC5A76BB0BFE AVEe7
622,002,538 *4002474148956725C7C89D6FB58B82A03ABA27EF A,VeH
622,002,539 *400EA393902ECEDF266FBE2097F0C38235DDAED2 Aveiron5
622,002,540 *400B948DCF5694CC96ED468CD19973D105E11521 A/vej
622,002,541 *400E01E865D977913AF2362DDB1653F5A6460D95 [email protected]
622,002,542 *4006535EF27A10DE507DE14FBCD405C70ECD6476 Avemarie8
622,002,543 *4004B6E493DFF1056F9075055C57757AD7F8DB4D AV;en
622,002,544 *4004FCA4C3E83E97C68CE1044065ADFEBAB59666 avengergirls
622,002,545 *4001FA521C7529D24E81A753593C373EF6179F3D avenied8
622,002,546 *40097F45F7B2D49C2D70675CDA5A6D8232EF35A8 aventurietas
622,002,547 *4004777DC6AFC8C5BE34810D732AB097C482724E avenuewalnut
622,002,548 *400D1236209D7F876E3947EA4F5CC63C8D2D0D1F A.Vep
622,002,549 *4007BC15FF83656FEEE009C03FA930E9BAA31B89 AVE"Q
622,002,550 *400B01C58C8BC95D00898A6C7F988662CDA78D99 AVeQT
622,002,551 *40026920351FFE7FE7AAB8A8D1EA60B95E0EABF6 average.set
622,002,552 *40036FF27398A84EC1759A00092E2FF6CBBCC315 Avere1
622,002,553 *400452CE2A4E2CBE7634F4A293AF50D6EAAC2AE3 averear2
622,002,554 *40083F3A0E07A9B10B7ED166ECFA5E917A3CED5D Averi857
622,002,555 *40094F1320F681DF0C34071FC406C6807EE6B887 averick4
622,002,556 *400A033627F8EDF7E2B6623E332110D1177797E8 AVERITES
622,002,557 *400EAF404FCB86DDA7615C895F253FDBF87E9769 averlyn6
622,002,558 *400A2A8628691D202D8B9A989529EB5D55B99C14 [email protected]
622,002,559 *400B882A8BC7D6C030D2C6709B7085B8FDB424F1 Averment8
622,002,560 *400FBCD8C46FC6AC19744F318744C2041EC9779B AVERRHOA4
622,002,561 *4007D53A8EAB753197078C5511273E0B9D9D7D80 averrumar
622,002,562 *4009BBAF457137972F4E08A372AC1A9C9969003C avervisi
622,002,563 *400746310D2859238B4F3CFB57CD23C3B57A8002 Avery326
622,002,564 *400B3D19D082BFEF6B75BC3F99614610A10BE2EF [email protected]
622,002,565 *40059464F96E7669FDEE7DE27A78B1A76399C7B5 avery.chatterton
622,002,566 *400A1D410FB34271221A705992E6492817211ECE avery.erbach
622,002,567 *400AF9D1CEBF9656F8FAE75AA1B4631B6EFBF6C9 avery.gonsar
622,002,568 *400736F2FE91881939E1A24D5BE9CB781F15C1BA avery.hoegerl
622,002,569 *400094F87ED1B74E8F4F8E37DCD709AF8EF1053B avery.hornick
622,002,570 *400A3632B1F68734B6C4C3E30BE9498A4EB71BB5 avery.ingle
622,002,571 *40008020CE7C8F058CBFA3BD168FBCE3BC18750C avery.kienitz
622,002,572 *400D62765E036F76B68D3AEF5E686DBB3D74BF8F avery.lundby
622,002,573 *400C682BD15ED75C8E0B1BEDC92F587F62D6640B avery.mossbarger
622,002,574 *400D3BEEAED57680D3212842CFC9532CECAAD1CF avery.muzio
622,002,575 *400BDA9DF18E1817ECCA899BD99C2587699F4A3C avery.natalia
622,002,576 *400403B04A7BC1DFCA3432C7D648A1B588A5FD6D avery.oats
622,002,577 *40007A43E9F4F04B1F89E80F6E8CDA00298CCD39 avery.porco
622,002,578 *40019A1159DB09DF8DD8DD11F40D3161E81DEA0A avery.prok
622,002,579 *4000405C96F76584C678FB80A646B7873B1E3424 avery.roesch
622,002,580 *400189039609DBE0F07546460BBED2E559C9CAC4 avery.roseboro
622,002,581 *400E24443440D2FB03A1E1385794D9D7CA46AC19 avery.rosemore
622,002,582 *400F025E1F35267BF01DB1F316FF2B0C0B72BFC1 avery.schmerge
622,002,583 *400EE28721AAB791395E21F3D5571F66B4E4AE50 avery.sible
622,002,584 *400252A209AE34BA9DDA008A21DE69A6E2BAE8EF avery.sitar
622,002,585 *4009C76CDFA6FF0D7076F1A807048EDDD36FE3BA avery.tur
622,002,586 *4005166BDAC51418B41996916162846457F1222E avery.uoy
622,002,587 *400E0FF1AD815D647EFD5D708D32B40FDD343AD3 avery.yaker
622,002,588 *4003885AC58BDC16D65BD53C2A42D780EC9E81BD Avessel8
622,002,589 *4009A93C5620478AC95770137D209F21B9C89483 [email protected]
622,002,590 *4005C064E604C3753468301E4ED012868F82D7DB Avevaia5
622,002,591 *400FD6788A39D51EF5978EEF1CD2CC7A0B8CEA1D avexerating
622,002,592 *400E631757B3F6207A2F5064B2A59E7A26E8D46D AV,EZ
622,002,593 *40047FA764918883212CF88E8561B3DA18096F65 AV%f
622,002,594 *400DB3B6BEBE95E9BE11AF22C8D2364B32C9EBE1 Av#F&
622,002,595 *4009D1DE7A599ABDC598CD5BD5C8B9312BBB39BF A(v%f
622,002,596 *400BB55ED50F307937A43FC29BC96EF225B31B8A avfallsbehandlingscentral
622,002,597 *40026447E3EEE73B159550CBD3BE6A1FB9CD7644 [email protected]
622,002,598 *400A5026A24D8F8CA46637447F64446AD7F3850E AvFDh
622,002,599 *400E943D5D19574842378EBDB08507D36AF7B144 AVFdT
622,002,600 *40085D453F3A0E860E2F92E9DA2139B1A238E358 AvFf%
622,002,601 *40020127C7CD34C478761C84F68EF3B9786C69A9 AVf#l
622,002,602 *40080FA237EF5D0B94DBDBC822E90B27F13D91F8 A;V!g
622,002,603 *4007F29F6C9BD0C8F99399C0E52B1394CD133D1F A/-vG
622,002,604 *400DA2FAE7BCD34D006DFCC6758CE12512ABCA01 Av"-g
622,002,605 *4009CD929EAE57553B60D33DFB6BE90DC20C5587 AVG2d
622,002,606 *4002BECE6F88D48E528452DF5B8860AEEE70447A AvG&8
622,002,607 *400BBF75638BD779802BD5B1ACC57426BDB43900 Avg9H
622,002,608 *400368123AC6464CC346C6BFFCA7482BF897F94F avgÅngars
622,002,609 *400DB61E74534529E3BB13C3FFB74794FD928CCD AVGb1
622,002,610 *400ED2B950C1780529B2B4970F261777811E6AB1 AVgdE
622,002,611 *4009B69EB48361DFE91F469F5BDE1535101FD351 AvGi)
622,002,612 *400157407F8D7F93995983F8E94518D0C5567DBB avgiftsletta
622,002,613 *400F6D88E9C9B8C651469E981DA85B33BA6C32D0 AV:gp
622,002,614 *400DDDF0F7DE8C9139C04055536CEFD3A310B023 AVg/q
622,002,615 *400837366FF3D6C774247EAD0DD85C08FF899A29 Avgrensns
622,002,616 *400CE041AC0DE71CC12630F4F5B48D8F137400D9 Avgrunn8
622,002,617 *4004ABD091FF996977E76C8C6217B2F04AEF4843 Avgudamakarna
622,002,618 *400DD2B7F5322787743DA1DB862A6B141E8F9EC6 Avgust90
622,002,619 *4007B97F6FAD488D76D9D74DEDC64C181A4A5B29 AvGuV
622,002,620 *400DA8EECE7746A53C842DEDA42DE1CE7D8BD69A AvGv2
622,002,621 *4008425998B3C736ECC3F76BB9914D5636C66A1D Av+h?
622,002,622 *4006A7216997A7A63C43EE8F1C86FA21FD329BBD AVH2o
622,002,623 *4003304C5CBD95AD3AB26A4C132F853E9C37104C AVH49
622,002,624 *400A977E99896347AC7CDCF548EA2390BFC2ED5E A
622,002,625 *40031CFC865D0274DAE7F63DCC11A7CD14E2639D AvhBt
622,002,626 *400A67D6ACA38C81522762520097E8C0C9C39E18 Avhelçink
622,002,627 *4004775D33BBA54CECA491D0B3D8958C08BCD816 AVhgS
622,002,628 *40004CEEAACBF8EA148050240CE6BF595EF3F84D A_vHI
622,002,629 *400D6486F8074DE3B5C5C03FAFD95FF75FBA80A1 A!vhP
622,002,630 *4001859D3E8388D28AC4ECEE99FADEF5FEC2DA3D A
622,002,631 *4003B8F97A66C5064E0128B4CB1731BE649CEE9D A;.VI
622,002,632 *4009367DC36C77E72D88AAB5512D1D580E9C214A AV+$i
622,002,633 *4000530699E62E7C0D2C0346425A3F5B4A3B7C31 A_:vI
622,002,634 *4008FD993086DC33675193CD1B140C6695EA5758 A"vI/
622,002,635 *400AE017BE7E868B5F7FAD2FBC658FC8DB681190 Av&&I
622,002,636 *400C8415B1380DDE864CEE6B286F275E84C9CE96 AvI3Z
622,002,637 *400EB5DB7B621BFE9B04D313427BE613A77EC091 AVI4?
622,002,638 *4004A06A2C124BEEDA2FDEF54EEB2005F23E05B4 aviadeing
622,002,639 *400CDD52CABC7278A7C3A9A40CE95F1874B56A20 AVIATEURS5
622,002,640 *4005B4EF7917615317208CEA69B21E092F7BBE8A avidemente
622,002,641 *40001F5F238BD7A805D29FA23C1B2DAECFE69C7A AVIDILFO
622,002,642 *400950F76FFC4A8EBC0A1B4AB23AAE587B7A76B3 Avidite6
622,002,643 *4001F335AEBCEB8086A928293E57C627649AED4E avidsonbassey123
622,002,644 *400DA91D601AC00367578ED0C006F6B2F2192AE9 a view from the bridge (disc 2)
622,002,645 *400C3C6AFF4BDE6A3C99376B7B29D9E05AC12273 aviezer8
622,002,646 *40073C98A98C12A4DD1464179C6DD5DDDBB18741 avignonavignon
622,002,647 *4003AE19D957E5EC6607C3A67BD3E9F8B2FA78B7 avigorarlha
622,002,648 *4008B4612A44BFD194D36E8DDE7ED54623501FB5 AviI9
622,002,649 *40070E353883B19EC757CF7E85E05667E4ED9BC3 AVIKQIQ17
622,002,650 *40048D708494CAD8634047E50460101845E96B9D avilirent1
622,002,651 *4009EE184BC559A20B7B936CAFEEF3CF19FA226B Avimaieks
622,002,652 *400128935BBC3E28590DC006C2AE4B1ED3E9A0CF avinashananth
622,002,653 *400AA2FD86FC94FE12EB4719047F389EDB8A9ABC avindelho1234
622,002,654 *4003A3B857D9FE5DFB23C7DA6B3A17F04D4B2B8F AvIo5
622,002,655 *400A849044F402C990D82A0601EC2D93131F2305 Avionskaed
622,002,656 *400D5E43D4643D46140CAAA59D311D5F85B4C693 aviornis2
622,002,657 *40034E4D6295300DBE8E78925AB04210BCEF5080 AviP
622,002,658 *40028DEBF0D7CC5B2287DD1EF8792FDD7E6E3F5A Avip+
622,002,659 *40079A6C93891A36EF5FAD631DE981B3E82B053B [email protected]
622,002,660 *400DAA6AF4F3439273463366EBF48D22CFFF8C57 avirevuD
622,002,661 *4006380D5138E02B7479B60EC1A537E2B802A87B AVIRGAMI
622,002,662 *400A71F0E17AAFAF49951E59459528CD20FBFFAB âviśat
622,002,663 *400DBF115BB2924A2A0F7594FDCAD1CC54FF34E0 aviseras?
622,002,664 *400DF31794875A4CEAD1C77E6537C17F4009D1DE AVishart
622,002,665 *4003F30712F94743D2A605341D88834D4F0D1EE0 avisleiarane
622,002,666 *4009C1346A605ABD5643830B384EE9C63E29A269 AV$it
622,002,667 *4004E90FD701B6218C10B87D2F70DFD840150BE8 avitsegguS
622,002,668 *4004F01FB70997C2D94722B1A93760108FBA2602 AV/IU
622,002,669 *400D0811BFEE7444F87F595DB205A09952F18CA5 AVj(%
622,002,670 *4003B3C8AC0FC91FB36A98282FB2602BA19C1B3F A%v$j
622,002,671 *400EBD73B1A988E1861C06A1196D1510EC64CF23 AVjfd
622,002,672 *400EE2DC4FEE05B9A2B28930776AE4D942B2EAD6 avjgv
622,002,673 *400E559D1ADE18E062B81A57069B609D60ECEC95 A$VjI
622,002,674 *400DA8D52947F5FE91361678BCF40E2825268CC2 Avjvh
622,002,675 *400F1337FDA687843A4FD7543AABC4799E9927BB AVjWQ
622,002,676 *4003766BF9835ED77C8C1700C194F40CF3830417 AVjZg
622,002,677 *4004A0E9F8D7C823F1F25FB5646FB9EC2D121991 Av
622,002,678 *4003BD0DE3E0773F430993B6891F90A23A200482 avk_
622,002,679 *400BF94C2E5F21658A73796FA1F34AAAE83EBF10 AVK0R
622,002,680 *400D96BFBB2D46995A998F499A2B46D0DEAAD8C8 AVk;A
622,002,681 *40081406FCAC0CA980E794C6AF22C895F92ACD6C avkastni7
622,002,682 *400994EEEFF2AB5E5A469EC2212616B6878E9751 Av
622,002,683 *4008BDB68A5D7AC853EF102E1E35B8E8443F3229 AvkGX
622,002,684 *40066ADBAD970F3349222C3F190FE5B2E7C3D819 AVKHI
622,002,685 *4004348F07E7E26A3748EAC94C9F50C56125E111 AvKIt
622,002,686 *400C78CCCCF2770E90B0EA6A63E75482346F4071 AvKmA
622,002,687 *4006DD33EE183BF18C2AD085E32D6005337C5CDF AvKqj
622,002,688 *400EC8146AF992A5A34A984D81153CC66809CCE9 av
622,002,689 *4007644BFD19D8073D5CCE869F97EE99882D851C A_vKW
622,002,690 *4008ADD5EB7A1BFB17B4E301BB7108C10D00855E Avk%W
622,002,691 *400C60C8B07C5E7B53E4A31E3A5087B182D2E2E4 [email protected]
622,002,692 *400A7BDFE3D1A2A4DA3B0FD495F818E18728606D AVL$!
622,002,693 *40065832527C30AE91A6D3233A865A453989C6E5 A%#vL
622,002,694 *40031EB7E003756A99642FD7D5D0F07442E1A381 AVl3a
622,002,695 *40024F958FC59507129B17B5A2696C4309FE5A12 A&VL8
622,002,696 *4006D9FCE9DFB7BF0267AEE4C78E9EEA49DA9AE1 AVL9q
622,002,697 *400C7BD524164242C3F6E2BC06AE1CED3AE0333C Avlaesa5
622,002,698 *40029AEC3DD78BD9A7CEF81625210B4F15A5E348 Av;lB
622,002,699 *400BEFC1B3DD124A38D7DAE14216E85FC9156AB3 avlcard
622,002,700 *4000074FBB9F2FAD3CD884B451BFD8FEC7A86BB0 A
622,002,701 *400165B607D68AB35AC7AAADFB9E0047B82F53AD AVl#f
622,002,702 *400D9CD1BBB26D4ED373F8EBF9F7BAD784701641 AVlGj
622,002,703 *400E7B323864F2AF0FF6A2ABB1B9E991FB2068E9 AvLMG
622,002,704 *400A40206FE9332DC7CCA7299013F4190609EC37 avltree9
622,002,705 *40095D37FE78A7D5DF42374F3D76C88B7DC84E15 AvLUk
622,002,706 *4009BCE2A7068AC83C7E0D0802B55C841113082D A=Vlv
622,002,707 *4008FE85FDB2DC6EE8E89017D7A4A4B81E224C2B avlysined
622,002,708 *40024472B7C16B4CF27BF408C92CE8B6CC7E0FA9 Avlysta4
622,002,709 *400F162CC2153C5D34DE93952B1673EE22B824A9 Av$;M
622,002,710 *4004CB09DB9F7F83B57697895896897E4773F356 AVM090046
622,002,711 *4008D519B61833CFC41CFAF804860A08849377F0 Av_MF
622,002,712 *4005432EFE07978DE360B3C8D308CC5B004C305C AvMfd
622,002,713 *400212D8D6D79DA23C6834F76095E63ACB1922E6 AvMH,
622,002,714 *400F4E587D18C73C503DA18D6F060B80A985BAF9 AVMNV
622,002,715 *4008C73CAE5BE66BE4150765A623ADABE0F893D0 Avmquz
622,002,716 *4009360DFE0A1ECF0AA6E7EB5847B9F73DE84E57 AV$n+
622,002,717 *40095C048F0D9FE6B74D1EEAC060C71FA6B7650B A!v%N
622,002,718 *4002C07D9FCB8C1D23D767E64EFD5157DDACB62A A)Vn3
622,002,719 *4002BCDEC7A36612177DBA33D5E399749FF8E933 A,VN4
622,002,720 *4009FE7952B983E84DDD462DE625592E224DFD1A AVn4c
622,002,721 *400AEA4EDB4D7C866532701F3E4839760542211F AVN/D
622,002,722 *400FD85961EE370CAA9437BA5FB38F215F2EF376 avneepatel
622,002,723 *4002E3E54CF6B9283829A825BD8390246FAA12CF Avn/g
622,002,724 *4004E710E386ED76835FFB8922A076C662DD29E8 AV&nH
622,002,725 *400E348D91A3A847DF7283740B5DBC332F314D95 avnjuter8
622,002,726 *400AB3DFEA6E3567DA1B0D9058AA4B3435A86382 AVn,q
622,002,727 *400C92DD3F4002A79D21254F7303176817B71456 Avo.)
622,002,728 *4006DF72CE93F777D47A535565D25FC400DC060A AVo31
622,002,729 *400160EBE5C5FA3EEEDF1E79684F568164F86EAA AVo8M
622,002,730 *400400F9FB05EAA3FDB58C23EFA943EEDD9BEC53 Avoautoa8
622,002,731 *4007CE918F567488926CF84442EBE723C5CACF6A Avocetses2
622,002,732 *40061C194C51CDEAC3F6167A22D2D542843BEEDF avoclup1
622,002,733 *4002017EEA05AC8B55ECBC4328A14EC3D9B39A42 avofysiS
622,002,734 *4007AAC73AFA83E8765A93FAA04FA1CD9DA6B671 Avoidaan2
622,002,735 *4008F41DFBF050BACC29E46C75FB4D06DC0785EC avoidanc8
622,002,736 *400D1EF7C5E8C1DEF49F3E188CDEB220BC5D7AB4 avoidvec
622,002,737 *40058B67A0B200B6179C55CA38DA4E1A59B5D642 Avokanava7
622,002,738 *4004AF6902D58538A6C6347F73344D56F0A3B227 [email protected]
622,002,739 *400635530BCA83FB0AB7B8A2638FDD6883478AAE Avondposting
622,002,740 *400994AEA599193082C2519DE1E73FA656E45C2C avondster.
622,002,741 *4006C25BE1646827E17E2FA5C9BDEEE37A5E8198 avonpark8
622,002,742 *400E9CE1DFF9E19A6CE082F079CEEE77C5A72BCC avonsipas
622,002,743 *400777740A268A2792376061E5A5B7E19AC2464F A(vOO
622,002,744 *400BD7113495B538D3C4C9E95719678AD591BE10 A=voP
622,002,745 *400544FDEB0214E0124248EEA600BC8680B4A587 AvoQ4
622,002,746 *4004DF70CF6AFF318564E9D3DFAE060CBA327255 AVOQg
622,002,747 *4002B1E7FA7DA2F179FA59E1022C2979CA5FF442 AvoR2
622,002,748 *40090FF16A020E2BD73592B3B80B5D8864B5A58E avortassions
622,002,749 *4002CA51F3D93F9246A872EF92943846915F09A5 avorteri7
622,002,750 *400C39C3097CCCB66177BA3CD8A83EF78AF5FB21 A Votar!
622,002,751 *400748EDC8A990DAC4FA63FCE44218ECA0068D87 Avotcjas
622,002,752 *400B305FB8A978BC78D8EC0C099CF2D3C1086881 [email protected]
622,002,753 *40057553D17FD8394B1B689DE860545C2E20023B avouere9
622,002,754 *400A57417366C1674ADB2AD72C4B8046A505C836 Avouerez7
622,002,755 *400FC3272F541B0DABE4A2D2B81848AE62BFEDA9 AVouh
622,002,756 *400CF83404BF29424B9590418A772B94F1B02DBA AvOwO
622,002,757 *400F7605EAC1493D08554077800D39A09D949050 avozeteR
622,002,758 *4004E6333886FCA674DEB6A7F785015F733C1857 AV$=P
622,002,759 *400FA2C9DE9C441DFA5807749E7A1BE54DA321BB Avp3E
622,002,760 *4002960DAE56A224DBC694EB35761733B0EC5421 AVp7%
622,002,761 *400A535BAA1E0805E869C052CCBF9CF7704EC76D AvP7M
622,002,762 *40029BFE986A2EA5C6BDDC9896280B2193C98641 AVPr)
622,002,763 *40020C5F1AA7C317701728247A02C7955C6F0128 A/Vpr
622,002,764 *400D2667AF9AFBC74A0C434957FA325C33F74893 AvPUf
622,002,765 *400FFB55EE086E68C0D9987D56CBD9A204E6C722 Avq]
622,002,766 *40066D12110A98EDFA96C0CBCA8E74186D7CCFD0 Av+q6
622,002,767 *40009C867B25873D273D84CE45491A720254E7F9 A#VQj
622,002,768 *4005FC301AEED654B61917A614BA71C8C3B912C2 AVqj/
622,002,769 *400215D2537AF3C7367633B440632432B3FBF353 AVQl"
622,002,770 *400710CADBAF9490848002F64D44A27AA722AE6C [email protected]
622,002,771 *400EEB9AD169A80FD959191BAC9EC02A51C1F767 AVqmW
622,002,772 *4006E2871F971BAD4B8247EC6892B69EB69935F2 AVq;R
622,002,773 *4008FF6F2E73F9CE43474FFACC1330356A6EB316 AVQre
622,002,774 *40039C340693DF36AB7645BF1D6EFA4E67CCC548 Avqu:
622,002,775 *4003E9049B72C900D77285458956192E12B9D321 AVqub
622,002,776 *40090CCE7D3695E5F98790FB1761010660CBB249 AV"qV
622,002,777 *400B3A67B72F20E950179A61CAA686E0AA1576DD A#+Vr
622,002,778 *400148617079AF5B5ACA90B5D57E06B034AF07A0 A-vr.
622,002,779 *4009EC5F48B777BA83AE91325BFC52125DF3A96A Av,
622,002,780 *4009F893048BCFDABCDC19B9E12E835FBF4694F8 AVR4P
622,002,781 *400A6E6E768AD2EAF636BEBBB6D9DC2D6E75DC59 Avrgguying
622,002,782 *40090AA7E11EE3D5DC07E8C925113295FEADE4F8 Avrhi
622,002,783 *400BCD055A8925D142DBAB7462E8349715385DBF AvRi_
622,002,784 *400995C174D8EF088AC1DEEC4B12C4974ED37579 AVrIc
622,002,785 *4000D6A72AB18E3589095AD874725C4282309257 AVRIL-SEPTEMBRE
622,002,786 *400C17431B6D4CD224C4B1857AB7E4D78C49020B A)VRL
622,002,787 *400D794CD1E16FDEA6C887766EE5A03DE0960201 AvRPG
622,002,788 *400482AAB1A189875B9EB4B8BB5A08C96AF8891D av
622,002,789 *400CF525074C1131E94F2D4F43705B06E4FF00E5 AV
622,002,790 *400041DCA717F244BCBF3560DC9365F36E4D202D A,V%s
622,002,791 *4000BA96E414A60FDC1D9D543AFFE01F9B327EFD AVs!.
622,002,792 *400689EB7D391C54FE075F39086096AAA542CC0C A;v(s
622,002,793 *4002607F79E6F61AE7F8F7B795634408BAE51B83 Av;(s
622,002,794 *400B39CD260B606502C1FD4B565FD1556DF4D1AB AVs0R
622,002,795 *4006204691E03AEB0E8D6AE07A0D25959C1E92A4 AVS1q
622,002,796 *40086B99007A259F4772AE3DAEA49675123564EB AVS$4
622,002,797 *4003A38A05A2E4CC2CF71BB479884DAC933D9C84 AvSAX
622,002,798 *40002352A687BCA4B77669B6C867C1CD76ED9181 AVsCf
622,002,799 *400813A00CE381F8EC12A35A0C1408AEDF695636 Avscreate9
622,002,800 *4007367E389E65250571952732BA51CF2349C91A A
622,002,801 *400AEAE525454842DF1D5E199A3464E14A304AAA Avshacoming
622,002,802 *400AAC38774E9E390163287299E9321B3E38A026 AVSIMLAV
622,002,803 *400337BB6FB67999FFBB1360C437FA5A713714BB A?Vsl
622,002,804 *4003C07107FCFC748541B3F2ABDB8FFDDDFDD4C0 avsltsmallgt
622,002,805 *4005767310FEA3F9743539EDD22E90BF8A3C7601 Avsndaras
622,002,806 *40046AB4BBB5C6DB3DC669F305AE5FDCEE343CAF [email protected]
622,002,807 *400FB4A7A578915248CE1125EDCE9C26D0601BD4 avstumpa
622,002,808 *400002693F84EFA630A850D56BB5A4DB2A48BDC6 A)vSX
622,002,809 *40021118AF3DFE23986407B05DAC61A6FDDEAF74 AVsX8
622,002,810 *400977FB519A00D34A53FC956E6E16B7E018368A avSyao
622,002,811 *400CED71433A1661E9B4E86069C5C32E2263CFC2 AVT(?
622,002,812 *4003873231228D34A01D494E01BA814C22ED8C70 A_)Vt
622,002,813 *40031DE65C2E6DD8F7ED2D69D1CD383B0B43F9D0 A;vt:
622,002,814 *4000F0C40E16950A88967182E77FB7CCCA6EE0CB AV+T2
622,002,815 *4002CA07848EE396279D5C0CAA55FC01774D2077 Avtalers3
622,002,816 *40084001F73324123898A50C895558477528A9D9 Avtem
622,002,817 *400A7F41E228FDDB331BC67CA731D8F93EC6E63F Av.TH
622,002,818 *4002908DAF46E421EF0F5D8391F72B6B1EE1B038 Avt-m
622,002,819 *40049197BF2A64E9DB1D7F0791FB44FAB0F62AA7 AVtUA
622,002,820 *4002A884C3C692BB17518C52B0E2632958EA16AF AVtv8
622,002,821 *40072BD3CE32DBB895FD119B6A0B5C3F24267CCD Avt!W
622,002,822 *4006F5B65ED3551DCDD1244442D65DFB34D4608B AV+tX
622,002,823 *400AC7A0205097029D2A03A5FB30E8EDD1C6B2CE AVTY;
622,002,824 *400AC35BEB60F7543EAD68DDC1DC0C5B933CBD49 A&V=u
622,002,825 *400A7258B92D51BEAFC2C2D5DB7189FAE67180A0 AVu()
622,002,826 *4009E2AE3CCD870C436EC886A953A4084DE0BF43 AvU"%
622,002,827 *400669DBFC6CCC939BACD2ADD835681C75AE7C7E Av;u
622,002,828 *4000232D8A809B0368F395B616156CE3D09804D8 A_vu8
622,002,829 *400947D140CC196485F6AC8309AE37F1BE983EE9 A"vua
622,002,830 *400F5ED500D7F4084ED2A81270EDE1BB1A90B605 A;VUb
622,002,831 *4000578282D79E120CD770C6FB951C54AE0ED7D2 AV)ue
622,002,832 *4008583EB19642C35D5759EAA269A0E3E7AF06AA Avuketaing
622,002,833 *40022AC559E34919327851AC32C6FC99AAE6C424 Av-ul
622,002,834 *4003A9763AC46AC3C910299685FBF8F108EE9E4D avundsam6
622,002,835 *400427544842BCCDE14E06C3D366C117B8D65CB6 Av-up
622,002,836 *400A94A161B3F7443CEA1E59587EE7B4AF151875 Avustuspetos
622,002,837 *4000CD266EFA2CC596537AD6DF53C8BA09705B70 Avuttases
622,002,838 *400CD66A6AF2D7AF818F59423C7FF19B7ADCF2D9 AvUvA
622,002,839 *400DBE103735106F6C21B8816DC93F291AF715E2 AV(V$
622,002,840 *400F021F7403942D54C09E9A6D62776513CFAE1A avvalging
622,002,841 *400561A41DB36BD70A9192E46D1E09A8872ADEFC AVVALORAVANO
622,002,842 *400C4E587B906C44C2E79C4E8E9BEE746991EC24 Avvedemmo3
622,002,843 *4003C58DF47526BF07A08CD58A837316CBBBCE23 AVVEG
622,002,844 *400DBA9AC38121218CD1FB4136C48012AA5B6CB8 avvelenatE
622,002,845 *400BA5748C30DB0C51E0143FE3F7F87EEBD279EE Avviserai9
622,002,846 *400C273DD397C666D0B7E2A239C45D31B4BC9ED4 Avvitanding
622,002,847 *4004C753DAA4326DB6F63160BA157C762127466A Avvitasti6
622,002,848 *400FEBD8DF38BEEF79A441A9EF5EC2A556C264A9 AVV/k
622,002,849 *40017A03F442448E16ECFC2D444D2BE478BBB020 AV;Vl
622,002,850 *400B69A111A2E014093550C90025ACD36D87A76A AV$vL
622,002,851 *4001B55F38A75363BFEFF0D4E811585DA7D59863 avvolgim3n7i
622,002,852 *4009E0C3E5D6F6A79DFEC88E2F5FF09DBFB1FFDC Av(vP
622,002,853 *4004087AD4E509AD0F2ECEA327CA37E94E404A91 Avv=P
622,002,854 *400B587D3AD431A7B625DAE07D07C4AA51F05961 Av$Vu
622,002,855 *400A6226D7A2824E7D5B97FA4D1EA63E1C6902DB AVvv
622,002,856 *4005BD84DCCEC2D7488728A2BE75A69CEAE7EA61 AVvw
622,002,857 *400FA0C5ABA050A8A9D717D4EF6071FB0CFFE479 AvVY!
622,002,858 *40035E5FD15769A6F3829AEFD82E3BAF52EA27CC AVVZ+
622,002,859 *400327B4D41CCF5A4E2538689E27D9FF08F19585 AV,
622,002,860 *40029287DC58F11F08F9CF820A68AD9AB584DBC5 AvW1b
622,002,861 *40072F7178DA48B63A32739BFEB88A163D9DD58D Avw3p
622,002,862 *40021D81B2D31968AFA84A261F766D488C8AF962 avwbvlttj
622,002,863 *4007B2DFEF37E23F0218606E6BC0B5EEE50D5C55 AVWcZ
622,002,864 *40048304AC747DCFDF3CC9C65956DCB173BAA7CC AvwKh
622,002,865 *400368895071E62080D513E68819D92122FC4EE0 AVw$M
622,002,866 *400A13F73B36362D800E52973528CDAE15842DAF Avwm
622,002,867 *400665F892DAE25CD3CBC40C0585BD06F035AF0B AVWp2
622,002,868 *400C1249826E4C844C0DB16B940674632C82C386 A"VWR
622,002,869 *40048D653254303C160B019636B8FAF51250572A AVWvn
622,002,870 *40015E16D677EF912A45AD9012411E497732BC1E Av
622,002,871 *4004899D1DA3E18C1F3A72E8545EB16D62595FC7 AVXaS
622,002,872 *40014CAB15D84FA73D9364DDDC6522AA527FF42B avxilium
622,002,873 *400E028DF1BAB44A054531E75050993D066D4F2A avxltigkdsgblafw49chda
622,002,874 *400EC40E9E1D665CF647856F1AFE0E3D78B5B28B AvX&m
622,002,875 *400A1A2BB44F4D0AA6D6E970C05A9775481CC290 AvX!N
622,002,876 *4009AE43A5524060CA486FFDC5C5A6DA271DFBCE AVXpe
622,002,877 *40099783B8082C8090C0FC9D18E51485314E55B8 A!
622,002,878 *40087CF9CDBC4F9629D4C9B48F8ABB94133ED922 AVYI
622,002,879 *400966999D40B1C15D68E57AA510176A35BE43D1 AVYQm
622,002,880 *400C9C8488CD8F7E2CAECB91A526C8E91B4197E4 Av!YR
622,002,881 *400427F0986E82EA3089B6B098624BEA4EB6AE93 AVY?w
622,002,882 *4005E1012A405E5EB5771680CFB26AE8FED99004 AvYWX
622,002,883 *4009D36FC0C7C348EBEABC58A6BAD05294D0AD46 AV(ZA
622,002,884 *4000AEA9BC8CB332D42758630F98D8943B6C729F Av$ZB
622,002,885 *400695ACE505D9E74991C45FDA5645119B4E153A AvZ?c
622,002,886 *400D3F2FE9E7B30F8A6F2229CF18D27941427164 AVアイドル伝説Special
622,002,887 *4003A34ACB43496BB552754B007FB6DA68DE50A1 av女優・面接ファック
622,002,888 *4006E08397066110E1CCECA39064985E1E71BCFF よりAVに復帰。熟女系のAV女優として活動している。
622,002,889 *400934DB475B1869F04A44D40A7CC36E17447A3A AV男優油谷さん
622,002,890 *4001E07220DF6183D7F71B2D100714B6342D30C1 A:W_(
622,002,891 *400A7EB710E817FEFC9CD75AFC3769DEBA596CBA A.(:W
622,002,892 *400616F67AA26046A5A366FD57B0E5DC09CE42DE A)W)!
622,002,893 *400BD6EE9FCE4529843423585190316F8AA0A744 A#(W(
622,002,894 *40043AA7C5056256E83C829661E4FC481C5BE467 AW_",
622,002,895 *4001AFAF66BFDA910DA1AE8515A2B45B72205944 AW(=.
622,002,896 *400F37143C5A8922FC41B3A03BF3CDAE28B9DBB5 A:?w/
622,002,897 *4003D4D19DCFDB797F656E1CB90CE4A179EC7D69 A?w%)
622,002,898 *4004406DE1054314F22126AB7597176DDE6B5D40 A"#w,
622,002,899 *400E022CC8EB6224775011FE6AA1E0D2A45EE204 A"w_$
622,002,900 *4004FFD94D014560D71384100E06DB41EF34C94B A(/&w
622,002,901 *40030F68299B7C4D16901D3775B8E3FDF4C7CAEA A)=:w
622,002,902 *400384862E1221829A67047149820D3DF66E82A3 A$w)"
622,002,903 *400807F9F99707AB39F562C95478C9B6970DDF3A A
622,002,904 *40089551402CD6D636AA799C4711D04C3D30B465 Aw,$_
622,002,905 *4001F24C66ABF7724B0325273755B50B781B2AA3 Aw#&-
622,002,906 *400F9638C2D304D78F5DD127FF3763436F09A1C1 [email protected]#W
622,002,907 *400A903304FC34711D46BA356A8250ACF2553401 Aw
622,002,908 *400A266936AADC7C2F76E1319DBF73FD18943C53 Aw055
622,002,909 *400F8E1E3EF64DEACC1FF59A4D4B9B6352E495D9 Aw0pD
622,002,910 *400340B5366F7E8EDE9F1C749823CC4A428729EB Aw0#s
622,002,911 *400C4F9A57E161F8A9F28D392ABCF158A8387E12 A-:W1
622,002,912 *400B66C859D3D03D77718E2CDE598E96ED250DCC Aw.1R
622,002,913 *400CE540DBA4A1632C0A7116A0B5C6428BE4C290 A+W1T
622,002,914 *400142BC3ECC75747056DE65168F5A1756FAC752 AW$1u
622,002,915 *400612541BC538A7BC7626B9D2508D6C0BE72B2C Aw2u6
622,002,916 *4009FB86221AFC0DEEF64DC8ED47898AF9D9272E Aw2vw
622,002,917 *400CA5B0BB0F929689166309B01193086BDF2BB5 A"?W3
622,002,918 *4005B189BDD6CF4E0E1976C24788A189C9BF2E0D A"w3)
622,002,919 *4001772709994F2CBB6E44BA474C361058152BF8 Aw3{
622,002,920 *4008F96D1575B8B7C284C2188AF8018F4557E690 A,w3L
622,002,921 *400C66B6BED43F7104B75A55CABF21CE398C950C Aw3
622,002,922 *400C81CDDE8AC4A853FB7812A7459AA610DB3E5A A#/W4
622,002,923 *40059E20AC0DA36E5826C011859F4199F76E8F95 A;=w4
622,002,924 *4002F2FF698DFB1B3A1B04DF559CDD7A76B3C161 AW&49
622,002,925 *4003BABDA2008B0FFC4FF714A1FAE8615632FAB9 Aw4e7
622,002,926 *400AFD792AD01EC183C944542008E8C8078E1C40 AW/4G
622,002,927 *400D6E8F0D4777DE47A8405B812B88E555CB0D4C AW_4L
622,002,928 *4008320363BDE6209919C0981DEC4D9808D017A9 Aw4oh
622,002,929 *40082B052678C49848B63361A5E999FFF74DAD03 Aw4#P
622,002,930 *40025E732D891275E1F51AA737DC0029CDF6A833 AW;4s
622,002,931 *4008CE3056CF19832565F3936DC22319BD9600A4 Aw4,X
622,002,932 *400BB065BD840412D6860380B04A01DF546EFB55 AW"4Z
622,002,933 *400FA97EB9F8212E22EC172031082F17B70B7F9B AW(5C
622,002,934 *400E478485509B5EA3C6A111712233B641685248 Aw5i)
622,002,935 *40047A4ACA3B228718C032831DE2907DD0ADF681 Aw5n#
622,002,936 *400505BD3CC7629CE8CBFD9236E51D8079AB881B AW5=Q
622,002,937 *400C2986A37938905E69B7A3303B1C0FAAAA88DB aw5v
622,002,938 *400745F8A8E8A1F843B38BB7AE633A1581C2EBC9 A:
622,002,939 *4002B859CA3DF182F60C3DBE4D92D1B7B8433A8A AW6dQ
622,002,940 *4006E3C3E5D8164F96B4A921DF2EE49665DA911E Aw6Pq
622,002,941 *4002F381D58502A10A415E3D7997374256FA3FAF Aw6s$
622,002,942 *400720A621011FE2065A3061DEB194A2050BB288 Aw6vG
622,002,943 *40076819A2AF0C412A5D2DFEAC5E300CF20DD68F AW7#;
622,002,944 *400FA999971B9B361747CDC18EF04A587535CFD9 A)%w7
622,002,945 *400B40824A3AAF2E39B44DFA871483E455B05CBC A)w7n
622,002,946 *400F594B9090F80D247EDC50BADAB7CA8D7D4747 Aw7t(
622,002,947 *4000E2A640C720DFDE2D1D84ECABFA0CCFD6A7F5 Aw8,+
622,002,948 *4002065290496E1689F08E4F4EC8395293BA4B56 AW8Fv
622,002,949 *4003DCBF5398D2BB0F243B0A630E2384C3B82809 AW8fX
622,002,950 *4006BC87DB103318753E36A73FEE68F7913181DE AW8MV
622,002,951 *4004D00C6C1AB577F2B663E79AFE126C9B82A7CB Aw8u5
622,002,952 *4005B83CF9383A277961397959566FEC72E5ED47 A;w;9
622,002,953 *4000421AF0F828EA516594DE1B89CBDE4A263865 AW9M!
622,002,954 *4008EB54F38DE528A83BF51BCC7681670D99E62B Aw9PE
622,002,955 *40049033B9F2C83C4DF393BA36057C409915AC08 Aw9q+
622,002,956 *4000BFCD88516045BB35F765109DE9E91C713432 A#W9V
622,002,957 *40075C561E6DBDA5A1822ACAC096C3F95518984D AW$9V
622,002,958 *400D1B88F14A0F63789FC0C7DAA6788ACB53C872 A#wa)
622,002,959 *4002D74B25B653DFAF109F8477AA21E7733CDC77 AwA/c
622,002,960 *4004E59641C3BD927D8B2BBA9A3728F278374A06 Aw#Ad
622,002,961 *4002A06E3C998DFC1A2C2DE7D13A458E781C9AC4 Awadaert4
622,002,962 *400239C2811A317A02BD33292A27918F5BAD76CC AWaen
622,002,963 *400A1C0CD51852EB0DA0EC6AFD1B77CF511FFEE9 AWaF?
622,002,964 *400AA1A01EAC58B873F5B81006A9491BCF523D48 [email protected]
622,002,965 *400523E0FCD84F9B25D4C783F2FB6F03CB69C9B0 [email protected]
622,002,966 *400CE3D524AF8C91F26E126C6A6E25060F9F99BE Awake and Dead
622,002,967 *4003C8F486999A78944FEA9D49D8F6295039E35D Awake My Soul, to Joyful Ways
622,002,968 *4006612DE888A3A291BD1529841BB2D4F8959EAD Awakirot1
622,002,969 *400C18E3BC9D2C7EDBAB93E8FDB09286CF9BD858 Awaknen9
622,002,970 *400FA0C0A340D4765D2A304D76721B16C3E99501 Awakusu1
622,002,971 *400016D69F6F7996FE56DD1A0804E3DA276BBA6E [email protected]
622,002,972 *400D2F816A610EF4E26D457644D1529D709AB67F Awanobsw9
622,002,973 *400D850032F8362BA1D500CB174058D01667131C AwaQN
622,002,974 *4000FC0559D84C632617CF6D4F6DC04FBED008F3 awarded.i
622,002,975 *40096D47707C5C5862F5D480A27B20EBF39EB0BB awardssong
622,002,976 *400958B7FDF6E02AB15A0421EAF74811FBEF4D6E awards-type
622,002,977 *40023BC0722AB1690BB904A727A6E9C3944A771D AWARENESS-APPEARANCES
622,002,978 *4005062FE9560EA1D94E4C1018045F0D05610064 [email protected]
622,002,979 *4005D5005131372408BB8765B8855250D379B982 Awashyotirlinga
622,002,980 *400BD9FA7808BA58DF6EEE4A6C301FCF834BAD9C Awatizuf
622,002,981 *400F4DE28BBD6276EBAAFF8138FE61B254D3F102 AWatW
622,002,982 *400634F1CAD90F62BAD3A3A043BAA646BBB1B764 AWa=w
622,002,983 *400A799E1EA60F7115D5EC8336191E2EA969FB97 Awazaret4
622,002,984 *4002BF8D5AADC339733D10BA9D33DD0AC5F166BF A)W)B
622,002,985 *400DB931052EBB98F8C48CA5BF185D6F1871A82A Aw#B;
622,002,986 *400ACED40CEB45680E4805244750C87C0A6EC25F A,wb!
622,002,987 *4009D103F7AB13929F160B226D6AC6BBEDAA6D41 A(wB0
622,002,988 *40065A21E046D785E068D0C2DE040A006AFC0384 awbeling
622,002,989 *40074CC19A3428317F91B2DCA0893B439EB70238 A(wbf
622,002,990 *400447A2F379640CF11239A21892350AEAB2159A AwbIt
622,002,991 *40014F37E56392B23C8C70117E3BE3FAF3DFBE48 AWbjk
622,002,992 *400EAB3FB57B830E3BE1C54693D15E0F5C491FDF AWbK5
622,002,993 *400EC743D8E4CB8D0C9DEE70CDCC9275CD719746 A_wbL
622,002,994 *400ED89B66D750500DFA99706A6186713F9CCF2B [email protected]
622,002,995 *400652D14A6BB6B0B7646445F7B81B65617552D4 AWBwE
622,002,996 *40016C371E50004121EAA1B66329D4F8ABF1A988 AW=?C
622,002,997 *400A4DC2D92B4DDED15311C4BE6E485CA5438E96 AwC!:
622,002,998 *40095A60CE8DD24049DF5733565DF8CFEA24D2DF AwC%_
622,002,999 *40030803F2D330112639353CB6BF220585F57C97 Aw.c+
622,003,000 *400966D31815315DFFF2F944799049CB5EB5118F AWc6A
622,003,001 *4002AC40C935940917F7149D0C1329858B2999DE A:WCa
622,003,002 *40077751069824D69DCB389B8613506CE2434DC0 AWcaO
622,003,003 *4006263F42F98D8C9F89CEA86BFB983B0CDC48C6 AwC%B
622,003,004 *4002653CC901B677A083EB08535CF73C9CE45AA7 AWCH7
622,003,005 *400C7062BF400CE04420D4E301683ACF0F5F1940 Awcq.
622,003,006 *400798AD6BA43484EFB24C4CCCB08C6283585ED5 AwcX0
622,003,007 *4008C23F2C4C51372C671FAA3BF4474FEABBDCF7 AW==D
622,003,008 *40005150086D9A91373684BE34AB7BACB52032C4 Aw)D;
622,003,009 *4006BD973065ABC88424C6AB81482FB402E5F2CC awd226
622,003,010 *40095370FCE48785630A72661163C613BC962E99 Awd$7
622,003,011 *400BA9458E881FBD9DE9FE63A4A809142CBD88F7 AWdH/
622,003,012 *40073FDCB1DCC0EEB90EE03F2A6F56200B1A751F AWdIf
622,003,013 *400F707864ED9DA451F0CD46D0F88316B7A92252 AW$Dn
622,003,014 *4002778018C8C2B74DFB6188A59558945FBFF90D A-wDO
622,003,015 *40070AEC0AE7502F7635C45EAB9E48FBDEE5FF76 awdrgyji054
622,003,016 *400569CB5EAAA131B6F422056AC4BE8654BF99BC awdrgyji844
622,003,017 *400917113C6F2F8CBEC02B4EC6D807D7C8F475CF awdrgyjil33
622,003,018 *4007A05D6B34BAD5F0B022ABB9AA845FB7BF5BE5 awdrgyjilp309
622,003,019 *400893A470258B5A0ED599B6D16F76B8E9723350 AwdST
622,003,020 *40001FB1FCC7E44C79FA9700B743C06836E610CB AwE]
622,003,021 *40029D8BD2E72227F2342F8D027ADE75F52C5B4B AwE+1
622,003,022 *400F829FBA1BF63C5CCB0A20195141D92FDB0D00 AWEF23
622,003,023 *4006826E723CD1073E94AD0A40532BCA0572B09B awefullying
622,003,024 *4000F87963B102DE01C18D14A03A708D9C8FD16D AweGG
622,003,025 *400C4D9B3E116DFA1527F3D46B06EFA066C536EF aweishaupl
622,003,026 *4008F9B94DCF8E959D39527288BAA0B9C2E55705 a.wen
622,003,027 *4009CEBE7BD5412C0C5142F0DC58AFF2476155A7 awendungging
622,003,028 *400FE9F2FA441C46B6EDB2F6229A8A7B1A81DD28 [email protected]
622,003,029 *400CEF6905B4747ECAF483F1313FE561647F0FE9 AWESTTSEWA
622,003,030 *400A7B5B28DB16164E9729BED55CB6392FA20708 Awe!u
622,003,031 *400D99A1F5674ECBACB95E114A5075F37E3A8FDD Awezaje
622,003,032 *40032991791BDDA75B8C809DCF6113AC8550AD27 Aw"F#
622,003,033 *40084A37D9A2971A34FB44E2A60701798FB4ED1D Aw"f;
622,003,034 *400221999B38A88508F6A295222467677C9919FB A?wF5
622,003,035 *4001E5B5D16366C7D3084F9764DA6812FA1A359D AwF6:
622,003,036 *4005CBD6BB1C1FB326EF01CDBE028F21AD70EB70 AWFAN
622,003,037 *40090C74B364B5E7CF729EA1762DFD65BF73D624 AWFAOYKT
622,003,038 *400477FEC0F1319F873A8CFC051EC70734121421 Awfaxel1
622,003,039 *40006CD859D1142DE38E7232A3695A45EB5CA33D A%Wfb
622,003,040 *4000C50F45A9B1BE6E85CCA9E263DD68BA94AFD2 AWfl(
622,003,041 *4000E832048B9B0540657E3B753D13447DF36AA6 AwfMf
622,003,042 *4001FCCB0994CB16FC3CA7AB1CF238132E99F37B Aw#fo
622,003,043 *400542502A89B4712307915F4A98CE543BD81345 AWfoU
622,003,044 *40076D3287DA7099993BFEAA00098E6D6BCF0D99 AwfVE
622,003,045 *400412551709AC7CF7449A50B8AE9013F13F247D AW)fw
622,003,046 *4005D3362FA9D2539801B82E3DD82A6B585B2B3B A$/WG
622,003,047 *40092F0130E1D50E7EFB08F1A9F84A90763890ED A
622,003,048 *400E0E62775F11C825B37AF382E09F4BE51DF071 AWG5p
622,003,049 *40044CA8DAA8315F509B19FF4566BF811827E20F awgazaming
622,003,050 *400EBFFCC9E7BAF61182B70BF14E21EC71D6877E A?WgG
622,003,051 *4000791A865F209F40383884A6B954409315F12C AWgIe
622,003,052 *40064F42BDDB73A94EABCFE609FC7B43690053FC awgnawgN
622,003,053 *400CB0F79F31E24D7B65D8407411078E507C11D6 [email protected]
622,003,054 *400AF7627F3F83924FA0C1D6A2E98C35B381D2C7 A:.wh
622,003,055 *400CE6B01D5A1E4FD5A30DBEABC61EA9626B0ECD A/Wh3
622,003,056 *40041E0085C63BD119C86F6795B5601B9719365F AWh_B
622,003,057 *400FFAAF5B6B2457AAEDA82CBD2C0949399976BB awhcsbing
622,003,058 *40063F51511819801017EA9F3EF301C956A706FA AwhPA
622,003,059 *400A64DC472888C5045A9C0718EFB5982F2E152B awhqu8d54w2dpnau
622,003,060 *40090FC288AF748194DED7375CB33DD0042F1CC6 AWhUP
622,003,061 *400659403EC2DA540A2B62F466B14F45E2B76B46 AWh:Y
622,003,062 *4009ABCCF87EC0F26B69F5406636BE3CC94D6D51 A!wi:
622,003,063 *400E364387655E0F758A65F841646FF229556CC2 Awí
622,003,064 *40092A58BA98DDB3C53B670514F57B8A088A73A0 AW(I9
622,003,065 *4006D31DF51003F741FFEBB8617906D62DD5E45D AwiCe
622,003,066 *400EEE34E2EB8F4B350165AA77F11FC45E0D1B0E AWICKEDCREATURE
622,003,067 *40024C7CBD1E58657847BABE65318F927C05E257 Awielah3
622,003,068 *400B8CE658C4F1B0A1BAEFD175F3B4C1E7FC6F18 Awietuok3
622,003,069 *400283384144D78234781F051F6E266DBC448F2C A-wiF
622,003,070 *40062309B7EDFAFFC2E67B2F981830045E042A3C AwIfp
622,003,071 *4006345BB471F798DEF1ED49C0E20B4F91768DED AwijO
622,003,072 *4003E06EE3175777B74CBA1166FC6C5F87C2F909 awilda herrera
622,003,073 *400821500FD0AF2CAF494AC2AC51A156CEF3935D AWIN15
622,003,074 *400D344BA6A3785C989CCC2E585696896D0DE9CA AWISM
622,003,075 *400F1B30CC5F65F930EB0E0B815BAB997436C697 awitten342
622,003,076 *40015B011D2836F7A36A6616EF793C0608E7B03A AwI=Y
622,003,077 *400528DFBA26F0275CA68B60D3CE2C7270366619 AwIZ2
622,003,078 *400BD01E53C55C4D66E3338DCD1D2ECFA04DDED5 A=Wj0
622,003,079 *4006474D6F9E6DAFD899A91E0A1D1FD36F0AE154 AWj0$
622,003,080 *40084EB2BCCF3DBD47A9F5D355DABFBA231DDAE3 A
622,003,081 *400D7756C25BAE2D650E385937C7FC8CB74675DA A.Wjk
622,003,082 *40069276C1B4F54677B7238A63120A18DBA719F4 AWj$P
622,003,083 *4002E19DF8DF852B43E9A9D4E63B1AC695947B9A AWjpK
622,003,084 *4006EEC570382EEED5AC817E5EDC0A66BF50431A AWjwV
622,003,085 *4000CD11894E9488456CEC99F1185FC2EB4CD80E A(Wk+
622,003,086 *400916F2BDAE6FAE54EF453B9F087ED9E929F81B AW
622,003,087 *40020DAE360E4E1E78AB9796E4469F25F9DD6F43 AWkc+
622,003,088 *400DAE335EB96054E24950CFC4F1DE7C0FDB7532 AwKcL
622,003,089 *400DE62CB4052B218552C0FDBA045510CF427539 AW=kd
622,003,090 *40070F238859C47528CBF719001B831D4E469A58 AwKEv
622,003,091 *400E038DB5126B325DE8EDA31847D2367C3292C6 Awkewards
622,003,092 *400378B3C9CC12B26D811B2E958C094AFEFA6089 Awkihcup5
622,003,093 *400D8CC98E6E4B84F634E1ECA8E7CA5B508FB468 AwKk_
622,003,094 *400C1A42CD1BAFD56E5936C1400EF59E798258B9 AwkL!
622,003,095 *400EC299566C972B0FC58CC5EE974813919DF4BB AwKMD
622,003,096 *400576E6FF489B9CC73863828A80954D2A11D0A8 AWkmo
622,003,097 *4008BA9704ABA97F8A2C9CE67D54E9EE8ACF2C8B AwkMU
622,003,098 *4007C35148DE5FC85372C7A1EAECA3BD1E0AB685 Awknevob4
622,003,099 *4004A95A986773132EC9993ADDECEAC1E2920398 AWKP5
622,003,100 *40032FFF7B826C0C76DCCD1DE482BA7034F8070E AWkVR
622,003,101 *400D1A5063B87352131D09F2E71A4E2056C8F8CE Aw:kX
622,003,102 *4000047993ED07FBDAB38EBE4291068FDEA8DA2A AwK,Z
622,003,103 *400EEE9AA58247E4C165FCBC14DB26838FE224D3 A(Wl#
622,003,104 *4006F00FB4A8EF43D1AB05098322015E99CB2DC1 AW,"l
622,003,105 *400E58FD610624D508F481544EBB2F58A1435B72 A_"wL
622,003,106 *40013EB41E79A7434100C6E4201F8FD520A51FD7 A"WLB
622,003,107 *400D96E071EF81D75DF3312F1D1AAA8376097614 AWLc)
622,003,108 *40084212138053E7BBCD44EC6F04892342DD2638 AW#lG
622,003,109 *400425F1D497626B5376FCFFFAE5AFD512638298 Aw"lj
622,003,110 *400F7B012619A52F5F979B90D54F1BABBA0A692A AWlKL
622,003,111 *400FBD3EA633657D2198BB3FAAC6AD3025035C58 AwlL2
622,003,112 *400B86E906D0EC1D9B0F67821C6008A794E952B3 AWLq,
622,003,113 *400F931A85030F5C351045949223329EB8A3A828 AW%LR
622,003,114 *4000CD6B95D1502486961EE959F0928B8E6089FE [email protected]
622,003,115 *400C851D9433896136D8180DDA37AD27F17C1C14 AWlX&
622,003,116 *4008E099CD6C915C0CD04B1E8F6881AE50D05EAE AWM?=
622,003,117 *4000373CF0C262ACBE84A299E8A6CF5B5EA49507 AWM2Z
622,003,118 *400DD06C50D0B108AAB4ABC42A3FB9C82EAB660E Aw_M3
622,003,119 *4000AF679D010FCFF7577620E396083A64EF20A5 AWm5&
622,003,120 *4005AC8E804539CBB93CBF8C8D257528F44F15C9 AwmjP
622,003,121 *400715BD24E83C59DEC7AB458FD0D8AF8D2F694D AWmNV
622,003,122 *400905A0A192238278A5FC0E94480EF6B20C6111 AW/Mr
622,003,123 *400C7BC6B7288D5FA759A86AEF8AC895DB34368C AwMr4
622,003,124 *40042A19D2166EB0631EA701F41F74A4FD6A15B8 AwMR8
622,003,125 *4009FA50B2854C4C2543A88E6D1B9C800420F6D8 AwMwE
622,003,126 *400DEC50A3FBEDAC2C9CCC465851525FBEFBEC34 A
622,003,127 *40015DE5E2A6DA9E929F771937C733D646B94AC5 AW+!n
622,003,128 *40017FBABF787EFDC4558E70A5E7B535DFF689A3 Aw?N&
622,003,129 *400B3734690211177C63039BE894F6BD95DD9415 Aw/n!
622,003,130 *400264904742B3A3BCB42046803024A212B41341 AWNABGAT
622,003,131 *400E2699E64873B669A7697EEB2896938F92515E Awnagari1
622,003,132 *40084C0410FA5BB7FC9753FF1B69AE8AD3172220 Awned9
622,003,133 *4006FB237AB78547B92378CF14217E614829148A A+wNg
622,003,134 *4006139E84DDC68900862F8B9A83FB20BC381589 AwNuW
622,003,135 *4005F9DB98A390BAE76B4E01D0A07DA5CFDEB4FC A,:Wo
622,003,136 *400FF5EF3991C3638C39C441C362F4301CD1278A AWo&$
622,003,137 *400FEEBCB713B033C4A47333BD1DD89CB61F7EF3 Aw!+O
622,003,138 *400A19E51C3C644285F2E1C53545379EFB9785F6 Aw;%o
622,003,139 *4007C580FB01AA03A729BBBC676E7EBD88CC5F5B AWo8u
622,003,140 *400AF4239608B4366C7F521E9E9BB4530F87C348 AWOai
622,003,141 *40042E46C98F6023D4A7E59F5E51DBEFCA3F5F4C awojciak1234
622,003,142 *400C22E8D508C46A6D2FE79C8C26F0D6A17A845E A:WOk
622,003,143 *4001624E3F1DC77CBA6BCD8A3CAB258D64EEA680 a woman just won't do right
622,003,144 *400D377EC9B568DDD6BC051D96B414A3F1C149D3 A Woman's Song
622,003,145 *400C957BF66A9096257CE848B8EC295C91FF09DC awomlinks
622,003,146 *40097E7711EF8D9A1BAC76BBB29292A9C10D2E68 [email protected]
622,003,147 *400FC33A0E7D4C6D5073FE2C69FDAD0C5B6A6FEE A+WoT
622,003,148 *400BA774402B5E25AC2A4A3C3E9676C72DEB8CC0 AwOvt
622,003,149 *40032BC94C41F5ABF4132958AD11A3D9E4E4FC2C AW
622,003,150 *400AE7117D0C98411F98285D49870514313AFB84 A+wP!
622,003,151 *4002276E3891E2D11324FD98BC4B21A0B2161B2D A-&wp
622,003,152 *400BA94A7B665F133763398E258229296A4539E8 awP
622,003,153 *400B210C27628AB227BBB9DC2C144170B47C1905 AW(P0
622,003,154 *40066ED6FE460F3CF7F774B1C331311F1CAF58EB AWpBl
622,003,155 *40033C99FCF58250803BBB5D3E26F875121C464B AwpG:
622,003,156 *400E6330566E1162AFB00E5ED18E1A78DD6233D0 A-wPQ
622,003,157 *40052C339C354D961648D911EC83266DA12BBE6C AwPSI
622,003,158 *400C918B5526AFF04A891C33DC1AA397AEEE821B [email protected]
622,003,159 *4000E273CA5095F872AB4CBE5BB5D2ED4FCDFC51 AwpZ7
622,003,160 *4006259BF34E7C26E97D8BA0A0A8F76C913A38BE A=Wq&
622,003,161 *400922132268C1A087B34DC5E1185674CD330D2E A_wq
622,003,162 *4003A25B3AE7036A87369B319A8438A53FAB9F06 Aw+Q3
622,003,163 *40076093911382C8AE1E9BCA82C4386C0011DA1A Aw,q3
622,003,164 *4009CE4C5D18DE2E8A1D4173FAA6B35D96A1F2AF Awqcb
622,003,165 *4005073D5B074C69332676C1FF3424CC870CBC10 AwQi7
622,003,166 *400086D4EC6F76CCD12296CFBEBA85BC546AD943 AWqo
622,003,167 *400300DE606CD2E73DF4503FD26217FED2903F0A AwQP:
622,003,168 *400A4B335905175E1A88B0F7C081CC374BEF7494 AwQSL
622,003,169 *400C9C5B272FD3D61426C9DE235F201FBE38FC61 AwQ:Z
622,003,170 *40036764A89D8071985A04D8C17362EDBACD6A1D A;$wR
622,003,171 *400093B58E188D2A9C2D97D1E179DAEA65C5A540 Aw=:R
622,003,172 *4007E554A689D82AC979C195AD6C273B61DCBA85 awraeke6
622,003,173 *400EA7580EEEE31219676F3A3456B855C3A04E78 AwR;B
622,003,174 *40038656DE2DCCAD7CB1AD64E6446E1D7D42AB86 AwrB&
622,003,175 *400E6E333CAA98C1367872999257C093FF250A85 AWRba
622,003,176 *4008657B14C644566B794ACE9FB610C23AAE9BFC AWRcw
622,003,177 *400AEED0F93C839936981059431D4FF492FCF09E AWrdh
622,003,178 *400BC96CD4379A2FBBB068446F6C1FEFA4FD0766 Aw!RF
622,003,179 *40026A75D02CDA819C496064F513B8511C74BAC9 A;wRf
622,003,180 *400B95E9AFB6E6C50ACAE32D175E6024E8A82A61 AwR:k
622,003,181 *40070274A504FF6336BFFE7756AAB26E1DEB3EB9 AW#=S
622,003,182 *40038E2835F4C3600D32334B0D797583668A25D0 AW-,s
622,003,183 *4001A3220BC536697C3837883D7F222ACA158816 Aw_S(
622,003,184 *400C36A8CC823C8AF8CC315DDAEE029EBAAFA965 AWs0,
622,003,185 *4005B6148465D74A6708162B085CD7A005949498 AWs0"
622,003,186 *400E92CE1C41D70F69050CAE60EB8239880E232C Aws!3
622,003,187 *4001DFA37D7664319CA3D6453221A8B1211BBCF8 Aws3w
622,003,188 *4005505560564C8C49E9C316D4FAAC22C37987D0 AwsDB
622,003,189 *4006408FF27C2B930EAD11F3A79DB96C7F498839 aws..just
622,003,190 *400D072CFB4554504CA8C3505101D0F5371E5DDC awslgvia
622,003,191 *400F7EBF7D26EC7198D84E66DA1706BC831EA03A A&WSM
622,003,192 *400FF95FF9B6F2DD8E4F778139C418C65F95D508 AWsp)
622,003,193 *4005B31923B346A418D0695E0B368A38120B02F7 Awspecsed
622,003,194 *400843D805AF6C40AD66144DBEB132DEFB9D4F66 Awstxwnd5
622,003,195 *400226AE9ECF0B205BB79CA2B798053ED8C33BB5 AWSY!
622,003,196 *400A2AA3219D7DCD6268DBEF64094F1FA3602A33 A/Wt#
622,003,197 *40064F5E607AA516522A2F0E7D138A99B2C79088 Awt?9
622,003,198 *40045D506312C078D6C10E327A9B88C8FBA8678F Aw.TB
622,003,199 *4009EB6D89482645C46C67AAAC07DF3D9143F007 AWTMv
622,003,200 *400086132B0C87F54728133A6D006722DD82B37C AWT=o
622,003,201 *400737A7E9ED618A72786A1BBEC8E3A3F5E737BE A?WTq
622,003,202 *400D033D79B2AD7614595426A1DC0B6F07C1CF1B AWtR;
622,003,203 *40003CA0FC89AB2FF10D0145BECD27AD96555B7E AwTRH
622,003,204 *400C4AFFF33199E595F999B6D92D39FB9D20BF9D AWt-s
622,003,205 *4001483A986220DCD93D42DDD30BAB86C3A5733C AWU7
622,003,206 *4001DD355E28756A194DD9646F2EE6FBDDEC912E AWu)8
622,003,207 *400871C60E05654AB01BB19F6B4D7D8C9B5968FA AwU8T
622,003,208 *4008DF1C36A27FFCBB525D78C0FE7CB1ECDD94D7 A.WUc
622,003,209 *400A58878789CBC83131223D20A72594730A43EE AwU_H
622,003,210 *400FB3FBC203178C226153573CA14BEC278E183C AwU;T
622,003,211 *4002F2FC7F8918BA70F74E5534C7DDA925CB3B55 AwV-)
622,003,212 *40089E6363F5844156EEBA815962DB282646465F A
622,003,213 *400FF034F254F817C687E31C2C810F6D1FB5A45F AWv3_
622,003,214 *40024AF06F9D828B2B3A7AA7A23DBD8532CC82F2 A,wV3
622,003,215 *4001D9B6ADA3F0BE3197D2D35E7C71B2DB4F0A46 Awv3N
622,003,216 *400777E74D12FC50329612ACB9A0AF97AB941E63 AwV9h
622,003,217 *4000427616D7D55F079515D4CB2F47A4AF099590 Aw)VA
622,003,218 *400DDB34D2086625781852A8D7840EF6650CC7D5 AWvDY
622,003,219 *400D7E374D6239DC74F94B6634A7C8B5948465B7 A+wvH
622,003,220 *400F3C745C977A818D554763A8C3B3CC9D8ACCE1 AwvK.
622,003,221 *40030E722CA3C4200304DC40CC4DE3EADA428E70 AwVKF
622,003,222 *4007D644C78C386CAF39DCFA36B8C784379BB11C A!wVM
622,003,223 *400C333F521BEB3C5579B4AF7CAC2715A7D9A5AC AWvN)
622,003,224 *40034D73325C9DEEA0AF4D264F9ECB49A99CAD69 AWvnO
622,003,225 *400620E45890B1308C65AC83D61B18C7E7153BC6 AW+%w
622,003,226 *4009E5293FA24EB6C7A0ABEDF84E1D5AB09724C8 AWw=!
622,003,227 *400943F4584BF32B760E06B9770610CBBEA2FE54 AWw:=
622,003,228 *40054E3A5A56B6B9879D2E7AC4DBC9EF1386F19B A(wW;
622,003,229 *40005EA0235BBD1DE719418D63493CE94234D161 AwW=!
622,003,230 *40043F144F4607315E782CA084F933CE7ED01912 AWW9B
622,003,231 *40074FE73B1C080477F2273A09CD4CD7464C72D6 Awwf=
622,003,232 *400EA9D4A9E413168A42837EDD17CDA0D67A82EA AwwuX
622,003,233 *40069B68AFDBA7D0E1229795DFD031A5266A76B4 Awwvd
622,003,234 *400E0F935AB9EFFCC54B3800A8699E2CF4C512F1 AWwwL
622,003,235 *4009156174E57C4FE164C37F8EF4E5FB1105D7AB [email protected]
622,003,236 *4002CC3EC61E47F0809AE575539E44D66D7B2107 AWXjh
622,003,237 *400C69DDC4004C551E5055ED36D9547602FB5A62 AwXKP
622,003,238 *4003441CEBA32A8C97353AF396D97C6262460FC4 A?wXn
622,003,239 *400D8F52D8B9F5628F3E2E204CA1995CD183637F AwXNn
622,003,240 *4003BDA77BD1E5A3CFAC0BC266FEC9B9764192CF AWXXw
622,003,241 *400BC76E7E0462539B410ABFDFFE7048BA0F6E74 A,WXY
622,003,242 *400D0387AD39C8224EBD97F7B55BAE1F314528B4 AW"Y#
622,003,243 *40060F4F153716F34F686F07E4B91F04D3CF522D A"w"Y
622,003,244 *40027ABD922F15D0D8044BF83BD5BD7B63F5110D AwY"-
622,003,245 *4002F19558B9C796579A93C7416B5511E440851A AWY)0
622,003,246 *400D629AA6D659D721D94EAAF31A2EF92891A5A6 awyaavq7
622,003,247 *4008C1D7C26863E05CA74768E318D6BADBA1ACC9 AWY"E
622,003,248 *400E4D269668DC4F2FD85EEB6902F2ED38567296 AWYX!
622,003,249 *400CCB80CC4B5C9F64518F81F5AB933980D3D467 AWZ)2
622,003,250 *4001067BEED4442ACFAF9014C07101F8961E51BC AwZ22
622,003,251 *40051E7E8D85970A9A72643FBCE9C55556C57920 AwZ2F
622,003,252 *400E6E3E5EDD94C4FAD9C97D0A35304C40D61DCA AwZMH
622,003,253 *400ED771845D1A89B8B168F2F54A281ECEEF7B07 AWZ$N
622,003,254 *40005897DF662D71FE3259442AF545B869D7C0E0 AwZvQ
622,003,255 *4009A864F4447058A6FBE3E8FF6AF31EE29F1B77 A;.X=
622,003,256 *40076AD51AF6B0017542C28C63226D7588CDFA51 A("X$
622,003,257 *400BE20A6FAFAB59B721830A21C92E4B8905642B [email protected]_X
622,003,258 *4004AE7B0D312E83D49F7CE3F5AB3945E220BB19 A
622,003,259 *40084978E0F50EC8FC6CC6F9EDB9B4B51F3D7067 AX=$;
622,003,260 *400702B0B1F36F91E7465C315D32A32CE7A82526 A-x&
622,003,261 *400B3694802B2292FA5796358CDEE62FDD9AF3E6 A:>x
622,003,262 *400601D87DF77102A9F0C02BB10109B7AAF64DCE AX058
622,003,263 *400684B7D6674AAF7B8F2B5F14DE21683A539FFD AX0,6
622,003,264 *4000FC2C07179F85D417D4F83DDB97220C97A0E4 A(X0S
622,003,265 *400C34C44AA2EE51BD9DB2D306AA749F026B7A4E AX0tA
622,003,266 *4000A4E199D9B24D1B473B56DF1C329C0E16F859 AX13S
622,003,267 *40048F730C9D73DFF510677E2437665AEB302F72 A(X22
622,003,268 *400E9EC52A70054F58934906C7A41BE122EC886C AX2Ev
622,003,269 *4007EF62D5B0C7380E0D85701F95DD85761CBD50 AX2j4
622,003,270 *40024D9D6BA2D7907B0B492F42DED292BB6848DE AX2?M
622,003,271 *40049EB7864F4AD421F12AA5AAD8DFF438C98BA4 AX332
622,003,272 *4004A581F0C8732F79BC5A01801B0CF93FC2BB61 AX!3p
622,003,273 *40071861A454B43F8C6C13C7701055B34379D4B0 A(;X4
622,003,274 *400191140909174267357FCACC365084B02B5EA2 A&X4$
622,003,275 *4002FA896F8CD00C59987080F2030DEC75A40367 A
622,003,276 *400FE1425572076F97BFEC17B698DA97168426F7 [email protected]
622,003,277 *40043BAB257D94F6334CE90FE4DBCC4ECF8746BE AX+4c
622,003,278 *4008907780506C21C0B9F04DBDC0566646C4000D Ax58
622,003,279 *4007ECBD0FAEEFCD58106652A9D3E38853D1698E AX5rP
622,003,280 *400AC87452BA5CFEDD6FB72160ED23E5C90CCD65 AX.5Y
622,003,281 *400E3C477EAAA5D7A8BD49EC9790F8775D78B122 Ax6C
622,003,282 *400ABA5B9FF2D9D1A059FFE8327B6F18086ECED7 AX6gu
622,003,283 *4002D90968C95DA29D8C367883945FF7BA1A7013 AX75+
622,003,284 *40077F2DB78AA8F34FDCB461EC0CD04A006DDEBA AX7DH
622,003,285 *4000F2419505BD4AB90E37C997FFF76675D1E3AC A.X8!
622,003,286 *400BC49CE4931A7DB8382EDEB2A5E9C1B4622AAE AX8,A
622,003,287 *4003F264F2FF313C28A5A0BC7226F3F0C5995D36 AX(9N
622,003,288 *4005922AAF02BD3AF0FE6A7207AD7869F3E1AD3A A$X"A
622,003,289 *4007608DED38E710E6475E3D83B113BF4E070759 A_X_a
622,003,290 *40033E2DB2DAE4AC28907C7772137C3F1F5FA212 aX*aaa
622,003,291 *400C615F00221CC8F6F71FA9F69806A54DF10299 aXAbaa
622,003,292 *400CE27424A33C6D3FECE44BF6833B01EF417362 AX?aG
622,003,293 *400EB616B54F7CEC5EC5097E1552BC1054A48034 AXAoM
622,003,294 *4000B69091BE64B27BB15C7DB310CD3715661272 [email protected]
622,003,295 *400AEE1ECE6F65C391B8F71D37D42431A645CD72 AXbp
622,003,296 *4009A5670D4A331F322F1A6E35B690FF965459ED AXB%R
622,003,297 *400DC9F373DEFB5E4BB40133647B295CC8EA7EB4 A/X;C
622,003,298 *4001601B76C8A22ACB25C6E086A614B4203D9BE5 axcard44
622,003,299 *4007275E691CCA8719534DFD74B59E9836E04607 AXCN1
622,003,300 *400D9D42C106910DEB29FB82017BC0156F19628C AXcor
622,003,301 *4002517F21A49000B6EB46D4ABB7100F2DA513F6 AXC?T
622,003,302 *400461A26B9CBC4555606CDB15EAFF63E8601D4E AxD|
622,003,303 *400F30E5B54B0553BB17570FCF93F75A2766F9E0 A%XdC
622,003,304 *4002677186EA4AA2EA2EDB4A779EF884D4E835EF A-XDl
622,003,305 *4005517CC876DA77B2D479FF20638D77E4AA4041 AXd
622,003,306 *400A95877566F5E5E5FCC6DE11A42F2AE001C202 AX?dp
622,003,307 *400B1BADAC020F11928B38A3476AD6B2A2F07862 A)Xe$
622,003,308 *4002516C169549D89C43044160554DAC560C71B3 AX=e.
622,003,309 *400C12109F0EF2D0487E3C7D4F940609D3D3A08B A:Xe2
622,003,310 *400E3865A58B4158457E9E5C4F0492E5E7D11B24 AXeEk
622,003,311 *4002D096A48EDBFA23DA4B0D158E5743A8F04203 axejb6tn
622,003,312 *40007C14DD7A2A0BA2B63E25EE76CA2FF6400609 [email protected]
622,003,313 *400AD83A9128C790823F0A1F443378A6C550E1CF AXEL-MEDERIC
622,003,314 *400B33B1E8BCE016CC8782B67705DEE720989FC1 Axelrud9
622,003,315 *4002AA446D0A849D239296BB5670C72942E79C8C [email protected]
622,003,316 *40056277B627B51402364A7CFAFE8A677A2984E3 AXENh
622,003,317 *400BD348AF94E32FAF5F6FCC3EEC6AF80DD7572A Axer972
622,003,318 *400A93AC7E9280F230018B6E02616B5B1FAC7A26 AX;eY
622,003,319 *400255C2C52FA2F24D1D00E86235073DA69AE7B0 AX_F%
622,003,320 *400D954D4B4B1BD020434BD3756FDE6918D1500D axfdutv
622,003,321 *4006937CD433D5F47FD7CDA4D0FB67C9F8A108FA AX&Ff
622,003,322 *40053578A49A3DAB4E7AFA1E7A6748BA561C4F10 AXf.N
622,003,323 *4007B4C95A05B2442F1E0BF62CC60B5593256D98 [email protected]
622,003,324 *4005CF1E4034D0C8AF2C12A12399BDD0F897C4DD axfrxqlgldse
622,003,325 *4006CFC276F6ED9B95AC1D9D65F08334DB7585A6 AXfU%
622,003,326 *40085B13F3355D11F9F7D9FBB9BAE0EDA66CA995 AX"g
622,003,327 *400655D8722B97F551BECD7920684D92DC113567 AX(g
622,003,328 *400F145B26B64EA63B99B931E721856CDEFC4B7D AXGB#
622,003,329 *40020DC9809306521673085AEB0F37021FBC8596 AXgI1
622,003,330 *400764FEC063C293150CE4C3C579ED858E7E997A AXGu_
622,003,331 *4005161ED08F9F596984D3A4C7FDF5895A48DABF AXH!4
622,003,332 *40057BC3B8DE7C5B79271E58B503A3733AC11DA8 A?Xh9
622,003,333 *4001E977CBA676AD3A9F67A1CD122643CCBB6D75 AXh/H
622,003,334 *400311C29C9932A1CDDDE6D2A099F790E6EAA376 axhievements
622,003,335 *40042BE70546FA9BB847D38D4BB30647BE970FDA AXHmD
622,003,336 *40094B74ABB86FDEA85600E7B679F9741FA4E376 AXhsR
622,003,337 *4009BAEFCA841B3C7624100E8FF765F2166E5B74 [email protected]
622,003,338 *400F172E15335951044586B2B8ACAE73059DF350 A_$XI
622,003,339 *400584D786325E2AC027ACAB25B2381CD957BF04 AXi?i
622,003,340 *400F65C92BC598B356F067420C9B2B003891FE9C AXIONMAN
622,003,341 *400B35CA23799E1665DBDEC025A4E4002CFBCC2C Axisofevil76
622,003,342 *4002C1686D5571350CBA493E595FA708F27BB351 AXITIROME
622,003,343 *400A1CE390EC3E298125142012FB8C66654F8DEE AXi;U
622,003,344 *400862903A4A14B90971A4A8E76CC6DC77EFF62E AXIZ9
622,003,345 *400A8D0188CB007CD75656819F0EC93083BCEA86 AXjG"
622,003,346 *40067E7AF0920F4ACF6FAD8ACD449E9AA03F4E2B AXjr_
622,003,347 *400E6CA3D0579F749FFA04E4E70C4CBDA649FD5F A"X?K
622,003,348 *4007B8D1EFA5085CAE329FB8D0C3FD751B44EC4B AX)k
622,003,349 *40075C453C1C59568F403D7ECF954FA1C29915C9 A/Xk1
622,003,350 *400104104D1796B3598AA7992601F56A0EF5DAAE AXkg%
622,003,351 *400A81FBA5F0AADD0859F56899468450F1E9EF86 AXK
622,003,352 *400788397241F1B448582A35B17F84A952F9B8B3 AXkvM
622,003,353 *4004B07120E56DE57AFD5709D276E00513F228CA AX_l_
622,003,354 *40073CCB0ADF0F68A50B8F03F48A3780D85D2554 AXl!$
622,003,355 *4008798F78905B9211364FB2E5F8D58C075550E7 AXL3284
622,003,356 *400069A0DF3077E8B5A13B77FB95B8D1046488F2 Axlanbsw8
622,003,357 *400664CEFCF573ACB21186E92B39A15E4A2D763B [email protected]
622,003,358 *400B44CAD09BB1D45BBACF6E43582977CB928A38 axlhose
622,003,359 *400615603263E87FF5FDB9284ED07B7CCE2E7AB6 AXlY3
622,003,360 *40082C77FBF3D87346DCC6BC8442199D0CE2F3ED A#=XM
622,003,361 *400F78DCB0885D33F9BFA6DCD74AC1CB2CCFE9D2 AXm#a
622,003,362 *4000A79583BB529F19363D25878B70284B1D018F axma2600fkt4c
622,003,363 *400864C07363AF477B6F0A7AC2D0D90BDBE2D8B8 A&XmM
622,003,364 *4009FFDF0A10F70C27B31AEE2305557A67FA7D6A AXMV9
622,003,365 *40030638550A00646A48FA5D5AB85F46366C1083 AX$MZ
622,003,366 *40047567ECA8A0ADB4061E8AA492240B32B12989 A*XN
622,003,367 *4005E35E68B004EF94BDE3F51E8A531E2B5C3042 A&Xng
622,003,368 *400AA27C041C55BA0BFA87FD944A712501CCE599 AXNK21
622,003,369 *40078A5E799545DF9D8D3CA51547B7FC79E99358 A%XNM
622,003,370 *4000B3803030B9E9E9B4689B51589AFF2600C69D AXNvC
622,003,371 *4001E26BFAEA368CBB3C4F8FAAACE8EF6A405FED AX:=O
622,003,372 *40034633BD8FEFBE81FC8369254ACA7BC4013088 Ax%O
622,003,373 *400965C710500B0FDD6887D0E5BED9C3E54D4DB7 AXOB8
622,003,374 *4004F67BFAAB199B86244D9FC01C0794714BAC16 AXObA
622,003,375 *400DBFBBA8494348DEF4C55B50CD04BDD825058B axonol1pou5
622,003,376 *4004620A4E6039B925122707D2C0F2C78C32CF29 axonolip5
622,003,377 *400CB5265824DE8722229302822B7BB464066A1F axopodio
622,003,378 *400F76996127AD1F5FF2C2BCCFDF00C7A751182E AXowi
622,003,379 *400CDD9E54393EAB8B88F774ED93D1AB159325EE A$?XP
622,003,380 *400858E369E2D7F9D782ACBEB8D15666B171D86B Axpayerses
622,003,381 *4009DDB73F577416A697A961EAEBAF6E4F7B6E34 A+XPk
622,003,382 *400242F10F51C29D5D94BA09BA6F6C8900ACCC14 AXpuH
622,003,383 *40071D38ADDCBE1B4AF32F5227D021F17BDA20F0 A_(XQ
622,003,384 *400840A332B550A19588D4B02B60151D7A538289 AXq:
622,003,385 *4004EF0A7811BB0068C0B4762C867901AE8ECCE7 AXQar
622,003,386 *4006D4F575CB5061E75C4490340DCA62DF0E43C8 AXqb4
622,003,387 *400FB5FF60D373A7DC9E53A8A198E992B9973A3A AXQ=F
622,003,388 *400B15F497810440CDA10783057AD157C10BF326 A:XqH
622,003,389 *400EDB93B7A2C67E472B9B99A8D134EDE3883707 AX=Qk
622,003,390 *400E189E4C4FCDF7528DCCF191B21F70419B5A46 AXqtW
622,003,391 *400C177595DEBBA6D9E797CB8B72A05E910DB41A AXR.;
622,003,392 *40059A0DF9C9E2683FCC9C4963B47C55C4FE48ED AXrQ+
622,003,393 *400A9D9C49D4441756C446009EB5E6733DC5CB8A AXruo
622,003,394 *40018017CC40547DDC90B5D4F58D884144F7E740 AXRVI
622,003,395 *40006EB6E94C884E56630FDB852733187B199EBF AXrYF
622,003,396 *400491A1C1FB404AB39CBB8FB1E06E2BC356B7EC A?XS2
622,003,397 *400B46621D5979DA7189454CCCC3D5E750D5D6EE AX)SB
622,003,398 *4009C4C4B27E05AD42628560B579871EF3A5BBEE AXSU?
622,003,399 *400376395F6093DB75E59CC45F18E7B78F02AB1B AXswI
622,003,400 *4002A361F52D37B223D0FBBD3719B0904DDAB7E2 AXSY=
622,003,401 *400538BE0B6302A7FCC37B511ADB3E66A0E21348 axsymev8
622,003,402 *40021DCE4BA884B7F8A575F06EDE7EA8404380DF A#Xt7
622,003,403 *400F38A2D5B8036C64A45D83F4FCF16C96455C6B axtellbois
622,003,404 *400942DF9AE2B6109AC28869E3B29EA9CC284B18 AXTh4
622,003,405 *40093236DBE36260C57E8A7CF2EAA532E5FCAB9F A-Xti
622,003,406 *4001E1FD276EF10A2EE82479565E0B2F8F3884D2 AXU&+
622,003,407 *4007FD98F830BF701B9507C9D03459250C9CA498 Axucan
622,003,408 *40032F1A9639CA547259622E1E4C81F20BF50937 AXuE!
622,003,409 *400996DD48B7CB7B224A1666642DDE887E337E2E AX
622,003,410 *400B5C8FD8FE99E2361F701C9E862A32990B1172 A"XUI
622,003,411 *4007A535CD5EB55E09182037E545FAE783C8DCF0 AXuIA
622,003,412 *4001E2F232A41E0B6638A045874BF44D41F61E9E AXUr%
622,003,413 *400DFE3C575DF873F40B4403FB1623939EFCFEFC AXUrI
622,003,414 *4006CDDC07CB7299A686CA408CE4368648217CEB A.XuS
622,003,415 *400BC7AA408AA00CF53FA6C8A420962C99B8B8AC [email protected]
622,003,416 *40066B84752B8AF3CB682CF3DA53CBC03C90D5A1 AXu%X
622,003,417 *400BF5D3E9585968AAEAF6B977CD2E53C7BF4D67 [email protected]
622,003,418 *4005EAE3BAC1F216D8884B058CEE0EFA03A79F4B AX+Vb
622,003,419 *4007A205B3DBF8EE682AE2C75FAAAE09A766A8BD AX,vj
622,003,420 *4002B61B24EBC9E283B96D71D611D227BA6B45A6 AXVP2
622,003,421 *400FE3DCE8D29D9965C43C69FE2EC700CCF58BF8 AX"vR
622,003,422 *400570B037F21264D7133476136734E19E774108 [email protected]
622,003,423 *400E4C71AA4F1C66EFE91687EFA1BB831CEC9E78 AX:%W
622,003,424 *400815AD3CCD19CA8E57A0A3CFA9C7DCA99A7F1D AX"w%
622,003,425 *400B8287CA91B511BA1AD937744A617136EF07EE AXW.c
622,003,426 *4002C6CFF5340A87D05A9F8F40EC9DF1738C20C1 AXW$k
622,003,427 *40031879AB331410FCCD4C6B6179659EA9BD5B25 AXWNe
622,003,428 *400FFBE536A767CBA0FD1A0D8BCAC36EB5DA6CA4 AX.WT
622,003,429 *40062709E2943596D1699FEB78B661365017CF7F AXwZV
622,003,430 *400C9C7925B3DBACC0B6B67F32A3681D533073CC A;%XX
622,003,431 *40085EAA8C5D476A60DE0CE01DFA9FEBC016594A AX=X6
622,003,432 *4001112BBE2EC940B2C1BEE48BB335FD0EF29B6A AXXnO
622,003,433 *4007A8D9673013DF384069B91ED7DB1547FA6339 A"XY-
622,003,434 *400F4DA04A88E05CC3DC547736B7078A3CAB9155 A/xy
622,003,435 *4004B7D2A450476592346150807339B91B0C5488 AXYaa
622,003,436 *40033E28FFA4F5CA94DDD6D923887BD2FCBC1912 A_!%Y
622,003,437 *4005BD4C23FC7D0D9D077F0B5FD5F255B973E6B6 A:&(Y
622,003,438 *4006B9FF5245C061018B0C50624AF1A4979955C5 A?Y;;
622,003,439 *4006146208CE3D9CD2AC4B975A82E2425339AFF9 A#&#Y
622,003,440 *4002E90780A2BA29355D052FA576B1DCAE022B3C A
622,003,441 *40087B13CE32A19C8ACDBE54703167708F1DD057 A
622,003,442 *400728C50A8EE04293567892A46BE15AF665BE71 AY;?(
622,003,443 *400EB57B1C6F8B8B9A319482D02F09BF601096F2 Ay',
622,003,444 *4007CADB3A33F6F7840ABFC1B8D59F9065D6A1CB Ay",
622,003,445 *400D5CA0332C0C3BD803897103BF6C09CC03B61F a&|Y
622,003,446 *4003EE827EE47DCF17E48626869C4F277A8212C3 a#Y#
622,003,447 *400D92C71E02457A1D3A1B747BA60B579A0FFAB5 a)-y
622,003,448 *4009D9C5220B61048785605BDEF89A8A1EDD5AF9 A%Y0#
622,003,449 *400A0320B7804FC55CFB0DCE4717005249527FC5 AY0=5
622,003,450 *400788156C875E0275CC848491A7D8A9D1DFD290 ay0c
622,003,451 *4003295B4E968CD4C4A6DB4119F3A746BB1D5FF4 AY0LG
622,003,452 *400F29C73B34B4E10F95E3877CF1CB398F860932 A[Y1
622,003,453 *400D0074CF1320A45232344B155FCD69FAFAD790 AY1eD
622,003,454 *400FEFBE6946FB18A55EFA007426460BBFF1E5B5 AY)1V
622,003,455 *400A2F40CA0A6C537B1FCC414F9EC2A3D26D7638 AY?/2
622,003,456 *40029273868DBC35E9C90B22F4F450040A1D69AF AY2eA
622,003,457 *4004A2765B7CB1A78773A55BA6A998F167D44308 AY3_:
622,003,458 *400B4B181EF0014EA16499CE8643182E800D229D ay3-w31c0
622,003,459 *4006BF4B6A0E03383AE316F95B304DECC6B90147 AY4.:
622,003,460 *4001F16A4A7E08E8C478968B35D0874A4C944AE7 AY4/I
622,003,461 *40098DEE8B8BF6ED58F80C68AB348FE679945466 A%Y5Z
622,003,462 *40021E8A4BEF9513619BCFDC63AA29A49C1F0F10 AY6(d
622,003,463 *400B08A5F97AF013FD8EDD732ED222F467612597 AY6QP
622,003,464 *400B72DAF3A853C351C892077F90427069BAC441 AY7_m
622,003,465 *4003720E1901E603CD8560F694C6CB4F7549D01D AY7(R
622,003,466 *400FEA8C447AE706AD6768426DFD140DAD56EF61 A,Y8Y
622,003,467 *400ACD6B2E34940CE19D1B707633CF01B8EB3EEE AY93=
622,003,468 *40031015FFF488697AB7AA5126460D9EAA24929E AYAgS
622,003,469 *4004D7E68C4A3C8B890A6D52F154247F59B84131 AYAHMAMA
622,003,470 *4009745864A2C695D7A9AFB251D9EDBB087DE08B Ayalavadi
622,003,471 *4001B1F1C496CAE5E888C4569C4CAFD1AEA83493 [email protected]
622,003,472 *4005002B162B58F32E0A22C1D53C35CA6E0C3801 Ayanganj
622,003,473 *40075186A888E9C69CCB8648C8D383E0E9D84202 ayannagrice
622,003,474 *4005FA96BEF1FD2439A8C04673587C3D17F42BBD Ayaomets
622,003,475 *40059D877956695FBC9A063F51C7CD961A53B30F AYAP:
622,003,476 *4008B97764F9C8ACC08BD576658148F91AB6C35C Ayarakat7
622,003,477 *400451D95F4B0E6F5A5B801537F43F6225B98D5A āyāsa
622,003,478 *40081B2079FEF1DA66432C28DDB84A708535D0EA Ayashia0
622,003,479 *400CCE3F1824452EB9B809295FE71DA6D2B75E73 Ayatujing
622,003,480 *400F7CAD057DD81F1C782435433FCBA0FBD860DE AYAZ9
622,003,481 *400F02B80896F9D0168AD6CE8FBCC8E1FFEB8B81 A,Y.b
622,003,482 *40040CB22DAB0E24F2F0F0D28DBEBC1E96650FE1 A&Yb(
622,003,483 *400FBB96E3F718B2DAA6DC641AA696284B9AD994 AYB_1
622,003,484 *400EF096276F3573E49DC5F2C5DB1FF8EF683770 AYB2Y
622,003,485 *4000D226A0F20CD4609903070CFBBA5440201394 [email protected]
622,003,486 *400A08DCD1211A1A8D7AB7D564296B8CB5897812 AYC*
622,003,487 *4000E5D80270586A8967AF7AE96466F81B63F8B9 A-Y;c
622,003,488 *400DB5EA788CF0AACBEA3A388537B1282AB16CCD AYc2E
622,003,489 *4009AF33605BA5B05E1FF293191ABEF8A28AF531 AYc9h
622,003,490 *4004F910EF493324BC81E0E30AA07635475F59A8 AYCEK
622,003,491 *4004EC39BFE65214A444FFD8A8C49FBA8EC5CB6F [email protected]
622,003,492 *400B4AA074C58275268AAA2BD147C7B0367E3452 AYC"r
622,003,493 *400D1D2E1A86B9FA640CE8BC5B5A46B7C3EA2B8B A)Yda
622,003,494 *4000E1F7D7D64212D1FF52E92713355EF9483E79 aydan288
622,003,495 *400DF4686430B77D4E5A51733A0774D61B559C0B Aydan301
622,003,496 *400582CAC5860E1BBA594FA105AD636E34FC59CA Aydan585
622,003,497 *4002898509D8F7EE04BDD1FADDCBC9A6EA7BB726 aydan914
622,003,498 *400AB7C5CFF14AF67F9D66C96B299D0D3D39039A aydaodabasi
622,003,499 *4009FA91DD699900CB73D5946FE8291F62D22A32 Aydemirov
622,003,500 *4002F7661A358793D629DFDA0454CD79D5A17390 Ayden293
622,003,501 *400B95F2736FD1498D9F54B666E7360609BAEC68 AYDI8
622,003,502 *4006EC9875439E521C9C880425F79F94F9FB26DA aydin376
622,003,503 *400D7801CA4CACB3FDC6D3307C7C8A510B7D39BC Aydin999
622,003,504 *4000ADE51E85F6ECF87B0F09BA35BCE6DE270E77 aydinapkar
622,003,505 *400744CF8B307057DD55EE9799A22DC90CCC8F76 aydin enver
622,003,506 *40033DF30DDFFE7AE4C559C95FFD59EAAED892F2 Aydinlispor
622,003,507 *400C75129FC3EB93250AAA8693AAF9B639E9087F A&YDt
622,003,508 *4004E47A46C9DCA6BF035EC1043B455581017BF0 AYdum
622,003,509 *4003E84BF75EC99524D4DF7DE96B79CE3F53807F AYEE;
622,003,510 *400593D0A90C44CCF9F1350AD6388081EBD22A7C AYEh(
622,003,511 *400B5FB8CA22BD485391344E84C32A51B50B08A2 AYERSKASERNE
622,003,512 *4007E312C2FDD144D44D976BDCBB82EE3124989F ayeshaamrin
622,003,513 *4009A1173776A276F7711A36138FBE903C014FB3 AYESHABAINS
622,003,514 *400710DF1F1CE26B6AB8CE3C7706C99243A82809 AYEve
622,003,515 *400543A641B9FF1ACDB5F898DCA0D7C70184A651 A$Y=F
622,003,516 *400778899AD3F2BBC77BECEE9C43CCA3DB27A3AF AY?(F
622,003,517 *400BF44F999F3B9669015A6F5E2EBA6E39C989BB AYF))
622,003,518 *400A35C5E9A65FD3452D4CD2B942445E6D1E37F2 ayfgbue46
622,003,519 *400AB49AFD983FE73D97DE3A64921797AA0F8F75 AYF.S
622,003,520 *400653B48B9956C99772C316280EE91308BBF6F1 AYfUn
622,003,521 *400BA766960781E8E796686D0CB029FA905ABB1E AYg_!
622,003,522 *4000CE2C94339BEA12251E9A6551C5716CE1C40C A:Yg2
622,003,523 *4009BD36D4A0AE9EE9E4C2A0DD1D67FA0DB89093 AYg7j
622,003,524 *400D40B076649B8F13462C94C58A5E57AEF0E571 AYG9%
622,003,525 *4003AC4EA1DD0E342FDDD7B7BAB733C8ECC55097 AYgtF
622,003,526 *400FF9AF5EBC16C3AB61B52798DFCCAACE8032A8 AY(_h
622,003,527 *400FC95B9B5B93A575AEB03305D59DB3EC8E9AC4 AY(hc
622,003,528 *400F500F253664255B0799A2CB18A2B3F0B191FE AYHFj
622,003,529 *40086B466176836A5B4FE69D490A00FBB299F04A AYHqF
622,003,530 *400CD68CD0F1985B0E1DFB59EC8CD24939969834 AYHr1
622,003,531 *400B6709ED9C4228AC69CA5858DBD8EA5D3C0308 AY=i?
622,003,532 *4009F2E0737429E359997A81239D7B1292EA72D9 [email protected]
622,003,533 *4002614CD01686A687D5431D6BD76EC5862560DE Ayiatriadaaerial
622,003,534 *400C2AE5021336EE8536A3205CE41CE7319AF6CD Ayibalaj2
622,003,535 *400AA453579C98E153CC308BACED4DC2FC93C8E6 AYiHN
622,003,536 *40020BD9ACEC5BCB77ACE3FA946AEECFBADC3459 [email protected]
622,003,537 *400844BD7B8BF1DE21DDACCE843902C14EE4B270 AYinv
622,003,538 *40046A7AB8210BCF9755E6509B125819BB311CAE AY_iQ
622,003,539 *400F4851AEC7967E9AD288E47B1C4428B1F76B5B Ayisuuyjed
622,003,540 *400632ED4C387B0EF6A4A29DD140F67A5EA75548 AYitC
622,003,541 *4007E0CBCE19481E64DA384FDD40A0599DCDA0CD AY.jk
622,003,542 *400355473B58A3138B305B7FB936DF3A23A2DD34 Ay!Jose
622,003,543 *4003D36FB8CBEB3CAA68D78ECB7D417D419EC224 A.,YK
622,003,544 *400A4FEE8FDA217623575D7326EE9DBAB9280F94 AYK&%
622,003,545 *40001CCAB207461367C7CE701748D53B3CC09E51 AYk.1
622,003,546 *400DAF8073E7F748B4A79C459E103BBCA59E3DE5 ayk2005
622,003,547 *400E34BFD156FC2F1395C92195CC55969710FCAF AYK.B
622,003,548 *4004573528F965F3BE42BD1FD869C74FE4D349AD Aykesha1
622,003,549 *400FD2BB2AD1CA7CD3A929C5CC48304C40B337C6 AYKfm
622,003,550 *40008A13748CE6D001BFA8410237F8C68B24CCFA AYkms
622,003,551 *400D20670ED8509AC50A7C9FD3C9A2836194F874 AY
622,003,552 *4009B0FDF6DD3F93A08DCE6972E917BC6BFCA1F9 AYKU#
622,003,553 *400DBC32D5F297BE2289E12F747C1A1800D5E1B6 Aykulahc7
622,003,554 *400AC6AE3873FDA8AF27107B3ECA8E3A4FC7FE97 A-Y"l
622,003,555 *400419925545BEFACEEB87B2A68AF3CBA2DE7980 AYl)&
622,003,556 *400098E541E28A1998877876AA89053D7EE321C5 AYL5v
622,003,557 *400391A30EA435793D5A0D198F4D67F779EFDD3A Ayla584
622,003,558 *4003AAFCE0EE9E676BF2C2A3BBDE5EF7056F8C39 aylatan7
622,003,559 *4005FBE6BDB9A7DB5213ACF56DC91B4351A67068 AYl+E
622,003,560 *400A22563FCCCF053EEFC4CD66679775EFE7F426 aylin422
622,003,561 *4004ADF5FA4B90D6CA3F273475AD866E6BDFE4B6 aylmerintel
622,003,562 *400C4239FDE9EE8FF04EE63989E7C28AA20CA757 AYLMERSAILING
622,003,563 *40006F291F7C9B421D4231E3FF142C610BD52511 AYLmo
622,003,564 *4001B22ECA692C35FC8D31C6EEF4ACC6E580B36D AYLO5
622,003,565 *400E2B60E4D22F82C891EB81D4A5CD3564E83EC5 aylostera
622,003,566 *4000E0808864867B2D4569C841A912FEF930639E Aylwin123
622,003,567 *40091B0E1615979A5D951B0E1824E392B96DE96D AY.-m
622,003,568 *400ADC0378AA28193E753A3035E729770385D6A2 AYm:&
622,003,569 *40018EC7589ACD85BFDC0A2A7C24864298A00FF9 AYM3983
622,003,570 *400C2A53FE67FC0F4A7ACD503806B8F04E3AAD84 AYm8T
622,003,571 *4006D8EC9B741CB489256865C7971E838E7AFE3F ayman baker
622,003,572 *400300198DFF23A2B09372FE8EE4B8FD4627D6A7 aymanhalabi
622,003,573 *4003935E22BBF719778BEC856F3F5BF65F37573C aymemwl
622,003,574 *400983C796D41406B29C3A2D88BEBC2E914D3DCE Aymixing
622,003,575 *400C5BCB523036C8DF7DF328228D8934CE6CDD0B AYm"l
622,003,576 *400BF675F553D94A068AE373A6FD663B0C576833 AYMLERRR7F1B8CI
622,003,577 *4002523F1BFE0242CE86DCE7621CB3D89612D2D9 AYmO/
622,003,578 *400F3E02DCDA9619AF421D28EA5C7D5A27E914FE aymon's
622,003,579 *40026D4F2AA76906E9FEE82177B0B27E5497E318 AYm
622,003,580 *4004FEC31E38EE7C2769B42D4A5E70DBE236D876 AYn9
622,003,581 *400FB028F952A8EDEC067DE7DA7FC6E25E916ECC aynaouim
622,003,582 *40004D95E5FA17F00A0E9F436B248BFB91F2CD7E Aynisius5
622,003,583 *4007963A9A0414499728BFFF7A7A64F5BC0EB5C6 aynotik8
622,003,584 *40063B57B29EFBE656A7880256B1F90CD98DC459 AY
622,003,585 *4008C3AF234295CD02058A5CE80602A38123CDAC AYnUA
622,003,586 *40080C90546E9AF5347F937EDAB0AA1E16643F53 AYnysdulas
622,003,587 *4006C3AA4C9E1E90ABD8B9DC22A81D3D71781774 AYO,&
622,003,588 *4001F77CF70A8B24C6A5109D7843394871E42D34 A#Y.o
622,003,589 *4002143660C3D21527719133B45A07CB2CB6C1F4 Ayobami3
622,003,590 *400AB3561CDA9F564316F72A2C2CBB7FBAD4C9C2 Ayodelled
622,003,591 *40033067B742FC35A13CCB23E582B00863C6B51E ayoolaolaoye
622,003,592 *4006E6F3B457487C5A8D201C75AD0D3A146111EA ayoompteyempt
622,003,593 *40090E60CF51F7E15B053BBF16616823C217CEA6 AY,OU
622,003,594 *4007056F6B84242B4A2E648DBEC8B35C283D454F AYoX$
622,003,595 *4008A3DFCBBAF054CEE14B2363FFF2626FA32DB0 A
622,003,596 *4002AED900CF2DAE9F9143F3905A8193C5DE670A AYPp4
622,003,597 *4008BC7AFCC92172D0E5A4DE7ADFAEB9EB564C3F AYPW6
622,003,598 *4008139313F3A55901A9F5A78DA5F468FF4E7DDD AYPZj
622,003,599 *4007CF8676DC1CBEE3145C6E216561141892EC8A A=)YQ
622,003,600 *400720105BE1E75508A745C7145A23566EE2AF37 AY;Q#
622,003,601 *4009AA2454A08E15B93345E1C97AC9F18ADE3C58 AYQs9
622,003,602 *40097A8ED2823345DE2D28D6EC3851CBE8B5213C AYr=-
622,003,603 *4004C6D3C2C1FCBFDDBCC24AA45328EC7E855713 AYr#"
622,003,604 *4000A750122FF87133C7EAE2980C2DEA8D4B7DC7 AYr1e
622,003,605 *40087F35391531E754473AB4FA085F404F372CCB A,YRB
622,003,606 *400A4E2A65442EFF0C6399B2446886684FA66852 [email protected]
622,003,607 *4003F791F6673F9563A22FF53C914502E800E5DC AYRbc
622,003,608 *40043DA9D725371E5BE7E7FA16E3622B8962559C Ayriana8
622,003,609 *40003CA1C7D561153BDEFF69A294D3116C28CDB9 AYro&
622,003,610 *4000AE498DDA0947917DC44225B5A5B525598FD6 AY%RQ
622,003,611 *400270DE0C3B653522A543AD9230B77970687B84 AYRS%
622,003,612 *4000CDC1C134B3EE87A987984CD6D2F5F39F3DB3 ayrtolyx7
622,003,613 *400D7CBCFBE9093A787A8F3EAE9238ED9D8D4B9E AY#S!
622,003,614 *400189244897620FE6C092D3FF04FBB110FB244C ays123
622,003,615 *4000D4C0A483C3147563DA1B0FFB5AE423880816 Ayscarth5
622,003,616 *4000D9AC582742754020325C19A980AB573832DD AYseS
622,003,617 *4002AE95DF31D75D90AA0AFEDF75C60BD166D23A ayseyanar
622,003,618 *4003FCB86A83B771E82490F291B90D9F48E46935 ayshwaryaraja
622,003,619 *4008A90D8627BF654246F2EB29D21A5A90736402 Ayssotp0
622,003,620 *4006D88D266FEE8B2054EA4CA19E100493E666FB AY
622,003,621 *400BEA48B8F96A83E4F64820ABF82858653D4158 AY/TD
622,003,622 *400FBAC7F142F0DA4C9ABB561022A149000322B8 Aytekins
622,003,623 *40092D6EFE3CB9C1CA6E5EB115E3C3DAEEF594A9 AYTOCAMALENO
622,003,624 *4001480CEBF3B834AB49D643777B4461B6D9147A aytohuelma
622,003,625 *4002DD59D7F055DE72EB1060C302FEBAEA29379C AY(TS
622,003,626 *400E31BDD9D2E306B7E71767B113918409687B23 Aytunca
622,003,627 *400C829D5EE49B71EE41EC336382EC5A05DAFB2F A,!YU
622,003,628 *40021F1541676DF8F501C7A9615E3A31A2F1D538 A%.YU
622,003,629 *400F5BDB489546F668A491EA04F33526E1388C92 A!Y+u
622,003,630 *400CF3580A630FA4917603DB073525EE078BD533 [email protected]
622,003,631 *4004017DC3B56A2F3BA7BC183BB4819A336663D7 Ayudados5
622,003,632 *4005247DBE545C6BF58EAA65AE3E9C2F7477AF2B AYUG"
622,003,633 *4000C7430287CA1E62EB9EDC5B101B1A478F19D8 AYUMIKOH
622,003,634 *4004221F0511E7F4B6797D73A03A6D85712FC9A4 Ayuozuok3
622,003,635 *4007817578AD86470E26FD11158BE5B7A39D6A29 ayush bisht
622,003,636 *40029264186F6219AE009CCD823844AE81A30AB7 AYu=t
622,003,637 *40055E726006467B0DEA664A4AC7280B3E0D5B22 AYUTHIA9
622,003,638 *4004DB8CEBE16C368349C7EF1A47A6D6160F671B AY;;V
622,003,639 *4007F260F25B5C517472A02DEBBF82890F482A09 AYv0(
622,003,640 *40083B2F3EE545B57B22A5522C4056862AB24A81 AYv9Zmqp
622,003,641 *40010C11E092288AF066ACB2FF3F2CD89CF644B7 AY
622,003,642 *400FDF7B20A83861A0739CD5EC11134208FFB3BF A+YW&
622,003,643 *40094F91D341955DA85A43C47DBB7C36E35AA262 AY.W5
622,003,644 *4005DB738772A30B5B8671388B0A56494D79B3CA AY:wB
622,003,645 *400D8F9F2D8A52E1D6DCB76097B5ACE6674058AA A&YWE
622,003,646 *400C4E5F4A12B3616E3D2333886555B7F2D64E13 AYw%H
622,003,647 *40093624271628D60DA034CC5A8146C05A39D235 AYWQ8
622,003,648 *400009C7761AD38609CFDEAEFC676540F8CBC122 aYXJMXS9
622,003,649 *40064FCCFFFAC8012D4D0E2C34BFE9B15141F8E9 AY?Xw
622,003,650 *4002A0C5697FCEB600A3C7B070296112FC6903D1 AY"Y!
622,003,651 *400EEF175E6347C61CE8FFC84F9635CB832BCF11 Ayyabsw8
622,003,652 *400195129B36BEF591E0C1BA0EA2E1B297C6C2AF AYYr6
622,003,653 *40057BFBA79A2F5287A54A9E47BD653A7705CD13 A[yZ
622,003,654 *400C95C02CCF613AD2AB03D9ADB0C0BBD9ED2175 [email protected]
622,003,655 *400CB1B754FE7873A3B70356B1F96694B9689883 AYZv_
622,003,656 *40082C7CE1903667B65D8EA3A2FA0350D1B3813C A_Z?+
622,003,657 *4007515B6B86D6092135786726259F992359AF6E A,
622,003,658 *40045D0F954E835361E32EA5A10B834081BDE56F A:.?Z
622,003,659 *40006F5F311AF53D192C9E51D21553E5E40E7D1D A"=Z
622,003,660 *400D54CC9788A3E54280DC3ADA952839E80F0E28 A&Z=/
622,003,661 *40019B760D85696341AEE466CC94D2A18DD34D62 AZ!.;
622,003,662 *400A30CCC48CA53D34973259AACDDB184C61222B AZ&+%
622,003,663 *400769E86038E2C66667D49C2992E83B4462C559 A"/z
622,003,664 *40095EE10ECCFCE9D958F2061CBEB42B8EEAB7C9 Az_&
622,003,665 *400171828CACF1245A21C119D0AD99F27704AE3F A[Z0
622,003,666 *400DEDEC4A7E81CD993C22636C34A9BCC3572838 AZ0uo
622,003,667 *4002A824415177C33102ADD21BB72D80F7B175A3 A=Z18
622,003,668 *400CBA13232007EBC3438EC3A11B8B2F35A921B4 a<Z2
622,003,669 *40034AE7AA4920F0CAF687909D5A057F054F90C2 az20100716
622,003,670 *4007B07420095CAFB40FFAE14B3F5D3128911726 AZ:2M
622,003,671 *400A98C9EDA067FC975E416A6504A1D171C4A21E AZ:2O
622,003,672 *400CF32A7F8CC07AB87EA63648C3E2DD91D7130B AZ(2R
622,003,673 *40065B5045C7458F47FEFFCFB463EE4F773A6D8F AZ3$3
622,003,674 *400A5A07CE7BA70FDC7FCD3C56233D27AE24C9C1 A(Z39
622,003,675 *40005B914822E8615F8E3E56941A3811717D070F A"Z.4
622,003,676 *400DBED801183E89E6AAECC347FEB7CB12CD70B1 A,Z5X
622,003,677 *40012B1612CE43297676C1F1A388400A32BD8DF8 AZ6:?
622,003,678 *4003D482601BE292AECB8155884D177C87BC99D4 AZ68T
622,003,679 *400DCD3776C4CFDAEE12B947F9F3DAFE5FC2BEB1 AZ6k(
622,003,680 *4003F2CC629C2E1DD9A838B451F92922FC529F10 A-Z75
622,003,681 *4002250AC922038AD71EE35D99320445B56071E3 AZ7?A
622,003,682 *400DE8918B639214CC00662D2820CA6B29E938D1 AZ,7k
622,003,683 *4003B2BB0198B428B0F50A07EFC2189444E77432 AZ7ni
622,003,684 *4007EA5D323BBA5D4BFD3B5725BFBC99EAA7CE8D AZ8:
622,003,685 *40058E1CD7A0797C6BE8DB1142D33B3644F761BA AZ,8A
622,003,686 *400C4003B879009EAE8D6DA91B2B40AB4585A89D AZ8qG
622,003,687 *400887DB96CE4A3733C7BD019262C5759EBBE1EE AZ8U7
622,003,688 *400271AD7A17FBFBBAC8C96E790866E47FEE93B4 AZ9)+
622,003,689 *400D8B9A3EC4E0D74DE96039075B462AB0176CC1 A:Z9o
622,003,690 *400D44E6466F7114494D53AD1853DF4526C921EA AZ9;p
622,003,691 *40047D105CBA7876A023F2B82C7A262C72E94D20 AZ9QG
622,003,692 *400FB11EE00F13B805FF1C4AD9E97DFC390A9283 A
622,003,693 *400E4F2C13AD7D7B84E80067A0FD64FC2B7D1DF4 AZA6u
622,003,694 *400A1B7CCF10FEB8CF306E5819BD698EA4C3BEC0 Azadillas6
622,003,695 *400546F73841DDA8A90F4B3BAD071D801B6EEBA5 azahararojas
622,003,696 *4006EF4F24B728006388C2D059C039ED3F7EE2B6 AZ=aj
622,003,697 *400C4AD86C8995B75F93743B382B47E80CC4676C AZAKIN
622,003,698 *4002EFFB8EB4B69F4974EFC1A1FF411C1911245C Azalahced
622,003,699 *400B1AE9DDDF5BAC644D18F32F0D72412777395D Azalange
622,003,700 *400D9EFB6AEECB17D0C65F65C12D9D4113D7291F azalmaydı
622,003,701 *4004005BE04C67080DD54E9DD62CDF741F636D4C AZAMAZMI
622,003,702 *40002F153524D9CAD4E722C07D17F22D86FC472B [email protected]
622,003,703 *4009C01FE242DC0A55089A484D9C066789BAC46C A;Zao
622,003,704 *40015EAEF5699927AA0771917ADFD8E58FC99C58 AZAQ!
622,003,705 *400D79F89848B2016662BAB3A95A7809482E991B Azar1234
622,003,706 *40013F359002DA8BBC676827DC07EC2631EC1837 AZARIANI
622,003,707 *4009430FAD0A0A0A46AA877A9D62B733E1629893 AZARINNI
622,003,708 *40005649A1B77EACC30671C59E9F5B62DB21AC6C Azatan
622,003,709 *4002A5CDE47246DCF3BC5B017FF681159DEC9864 Azawaraed
622,003,710 *400E9592A1D029C6D4EE65AB1DAF80A0E1F393CE AZAXa
622,003,711 *4001D9CBD2FF9CFE1B7374625286609B93AA561C Azaziahs
622,003,712 *400E06F4457E97CDBA0EC648F1BC3CCB9D902033 AZB9T
622,003,713 *400E5D9FD28CCFB89CCBFF6B865872A7AEF593E5 AZbc
622,003,714 *40006A53C4A5609AB3F584540748EDE6F9DFB80F AZ$Bd
622,003,715 *40066154FCB0B81E979E8B5E6DFD373C7E4F3908 AZb:R
622,003,716 *400CFE547DE5393FA1CD465676ECD7F862DFD035 AZBSm
622,003,717 *4002A32D83822C7E5CC94EBF490E2A4CD5561B7E AZBZl
622,003,718 *400B8C483984E874BDCFA8985E296A0B929E953F AZc3Y
622,003,719 *4008834ED22E18D1393FF00A75DA2B68E4E7D2E9 AZcB;
622,003,720 *4007BC067BFB29BD9CF42C0C391FEA4FEFB51DB7 [email protected]
622,003,721 *400454FBE25B737C80E0FBAD42B385557D08F77D azcdoug2
622,003,722 *400AD4949D05AE470D94FBF34C2561552CEC9ED1 A/ZCG
622,003,723 *40022D3EB95E124B41F01C894D3E1EDC01099124 [email protected]
622,003,724 *400E04773F2695DA714C72D93ABE746851B62528 azchirvani
622,003,725 *400E7957850AF663F1F1DD19B1206AD95FC13C97 AZcw-
622,003,726 *40063B228CF5EA65D4C00964C4947AB6BFB0C975 AZdf"
622,003,727 *4001A5186FBE625B91EF7E7E7B717163329CB349 azdırırlar
622,003,728 *4005E0FF289CE60B196480143164CEEE76CA080F AZdpS
622,003,729 *4009940166346534FF8B95942694F34920ADA616 AZDUE
622,003,730 *400A61E167755E631328B721E861A347AEAA6EB7 AZDvI
622,003,731 *4007F1460D1DF70C52D41F9839CFB89F71CEFC1F A,Ze%
622,003,732 *400891A9D8198E201CCF6AC38BA663BBB3131094 AZe8B
622,003,733 *400D375319553408C67F0A3B3D178C2DEC6208B1 AZeelandstreekje
622,003,734 *400ADA47FA86989B62B5A18D7E4BA82875EE3EA8 AZEhh
622,003,735 *4007B69B9F168DF12E90D42668F09AF5A26A624C Azelatro7
622,003,736 *400689EA958091D97728C8B177D734C16D60AE03 az els
622,003,737 *400ED7FB3825B70CEACA6DD198CB4134AB392BBE azencott7
622,003,738 *40028AC691A40D660971581E2A048D52556A4DB5 Azeotropisms
622,003,739 *40010DB7D32A4622CCE37837966227BF9EC26C62 azerbaidjanês
622,003,740 *400A2DF4EBA14AA1A377C579FCAB4760704F1A0C AZERBAIDZHAN9
622,003,741 *40016C92BB64A9BEF1091E424993EE5A067E2277 azerbajdžanskem
622,003,742 *400FD88E7713036E93588F48168FE696E55B8176 A)Zet
622,003,743 *400DBC7B65B83572B7DD9F42F56FB6B3D4C24810 A"zF
622,003,744 *40034A8A3FEBA127717457D1BA479E1226D8FA70 AZfBk
622,003,745 *400E94C5F30DCB3F6F24BBC8DD787800F1B3C189 AZFbL
622,003,746 *40097DAFFADA90545BF83A72D34F4EE5F7F6EBC5 azfexqljldfe
622,003,747 *4000716C221FAE01F497360831A9EE8160B35206 AZF=Q
622,003,748 *400878BF835B81C8D05DB565C59CC73CA325440B AZfUa
622,003,749 *4001C3073B75BFFA73A91A406DB76897A263984F AZGfB
622,003,750 *40061A4468AE34FF37650F2F8A0C90CBA488B569 AZGg-
622,003,751 *40022F9B522A2C389D02F99ADBB1DC95B5E12D11 azgınlaştırır
622,003,752 *400E82EDB555BC6AFC23699D85D916E7349AC97B AZg;M
622,003,753 *400CEB47CD0F6021B607B9F221861EFD47C0EAE1 AZg(Q
622,003,754 *4002797D985B384193DDDFE906D81ED4857918CC AZh)p
622,003,755 *400F6EE004BE9E77A385DE70DAE6D19DC028CB5E AZHRO
622,003,756 *40085504F67412EA24158143836976388425E725 AZhXU
622,003,757 *4008F3B12632A6B5CA120BD717175534DE1B5879 ázijskú
622,003,758 *4005BEC9357A1771DAD7E28881FAA07559760F6B AZi:O
622,003,759 *400BE239E3FFD5DC29B8B86CABFC9A8266C294B2 AZIQY
622,003,760 *40005F6D9EEB5B138A6D09A80D182266E1CF814D AZiS7
622,003,761 *40098745FDCA25EC681B48101364B9F6C06A807C AZiu2
622,003,762 *40090509B7EBE98E8A256B190965656C0EE3C9CC AZjGQ
622,003,763 *400BF5EF202431F3A57230B1E66EE570DE1C32E7 A"Zjm
622,003,764 *400B864004A8CB6E201EB6C68BDF74983697DF70 AZjP=
622,003,765 *40000EE60AB09184E70DE199CD8A389C057ECA68 A:Z;K
622,003,766 *400BC77F72D42121998CDF72BEEB4EE845D4968F AZK29
622,003,767 *4003DED7844A9AB72A2D2FC7E63B89DBAD1450AE A)Zkk
622,003,768 *400DA22FAA03D746E819C01739DA81321A199DEE Azkodiac0
622,003,769 *400C78E56034036D7E906A8B6D2D3822DADAFF6E AZKT?
622,003,770 *400EC795E60533B21808B3E3D4515B3D0B3BC8F5 AZ,kT
622,003,771 *400771B7BE7E5B45001FE0FE20CAD7C4EAF61916 Azkune
622,003,772 *4000BD44A24DD71FF5F33B86E46B09BF2709C791 A-ZkW
622,003,773 *400D2D61D930B03EF3265A8B33B6A6109379205D A?ZL:
622,003,774 *400E62061E63C6FDCE4A8015B8805253B43BEF9A AZ?,l
622,003,775 *400BE72BDF04C3F3906506218B4A92BD95905E7E [email protected]
622,003,776 *400519D7212245DBD765C99D984934465B4289E7 [email protected]
622,003,777 *4001191FE5B46194BD51F08B6634A92D60247D38 AZ$lS
622,003,778 *4001A221743D4B82761387ACCDF28008EEDC3EE0 AZl%X
622,003,779 *400286A0FC37C277122DC8548A1CBB6B6A606F2F azmin minz
622,003,780 *400649704264F6A60E623A543D334BD825C2ABD6 A(ZMK
622,003,781 *40077DC1B2470BE0B36F37387890BF18739C3B29 Azmodem4
622,003,782 *4004F07165C84E06FD32F5D99F206763A6B91B39 A,ZMU
622,003,783 *40036B9E3AACAC0819C49963E17C8F52FE8048BA AZ"N)
622,003,784 *400F12178A751C18A8FE229D65054B92C9960465 AZ%n+
622,003,785 *400881E8F7A22D2AA51C3EF3B360E56EDD4D4E42 aznarol7
622,003,786 *4003F864D70C1D81D72D991CACFB351885AAB319 AZND%
622,003,787 *400E2BCE366C268E3E6D6E1AF518231A846BC38A azner1
622,003,788 *400757E0EB9E76B1C60CB2452367247FD4B3018B AZN+q
622,003,789 *4002DAE50CCC5577E3BAA059D313A848D390BCA7 aznvietgal
622,003,790 *4002C63BA68BDAC2B65E27A5EAF4248620FA536F AZO$0
622,003,791 *400E0BDAE6E47BD15B4C44994884119A5479BD8B AZO123
622,003,792 *4000CDF4EE7526960E8273A1FD5B3B91E33172EC Azoada
622,003,793 *400C4A6569F6352D2D3F6EC9DF2ABA75AD94B20E AZOBj
622,003,794 *40061941C7A8CB681CF2F25023288A946E90B45F A(ZOE
622,003,795 *4009975DB54466EAE7DA0D9B76016FB423CF77D8 AZOFICATION4
622,003,796 *4004C56F88173453ACD08493A784A9D82482700C Azoimido1
622,003,797 *4006436CB98433477BF263C85D45941480F31832 AZO)l
622,003,798 *400D6FD520E3BC25F0A3FA08880516C67317FA1C [email protected]
622,003,799 *400E43E7D7CA5D017301C7B3A66B04252DD923E5 [email protected]
622,003,800 *40001750C4D14BD6530AEE4A8D21BF90471C7535 AZ.Os
622,003,801 *400B53B454FC1A77349EE5931F219817D1589310 AZo=S
622,003,802 *400C28F018CAD013C00085739F189BAEAF0D01EC azotino9
622,003,803 *400D45EB0F5B21B33B50989B369C723F5133079D AZoW7
622,003,804 *4001D575FA7DC83050317389A0A2BC61CA263BFB Azoxime
622,003,805 *4003F1D61818431A36B323F0B16A65FBB09920D6 Azoz
622,003,806 *40036961CA1AA10EC0F90350E7AC25761D07AB60 A=Z"P
622,003,807 *400DDD348BF19AF337669B724304DC46263EE9E2 AZp$.
622,003,808 *40087D3949F7E72EE3D760E96704D44CF408A83A [email protected]
622,003,809 *40013059FECBB0D250C7EBBFD06C05DF1225B709 A_Z?Q
622,003,810 *4000B28E7357232689E9B28A78B363426E6308DB A(ZQ
622,003,811 *400228D2ADA0BD552D87129509FA5EAF53E817A7 A%Zq
622,003,812 *4006E186EB0C4A5D6C9FA76238D05B3412B9E34B AZq;
622,003,813 *4009104505EDBF3DB9CD8633799091D0E3C8E28D AZ+Qb
622,003,814 *4006BB564D7E20EEA705184AD57E60A28F187824 AZQ&C
622,003,815 *400FDEA61AA9664D29F067BBD73BAB701C533706 AZqE%
622,003,816 *4001B0FF4552740A565EF7A889781B54C6259574 AZqim
622,003,817 *400C683F5AD71EFB4297511229861942A5CC5CF5 AZqM;
622,003,818 *4006A5534F587755A3EA18C57F121CBFBFF327D9 AZ_!r
622,003,819 *4005197AC0A52179927FBF0B1ED91AD0F96D42CE AZ.r&
622,003,820 *4008C12B3ACF88A0219CB9752410ADE2DAF23B89 AZ#_r
622,003,821 *4007DDF8D97DC2EFF46AA4AF644C6464B8E8727D AZ#r_
622,003,822 *4003C794A3C756B8D301937F8D690325033BD2E0 [email protected]
622,003,823 *40034F6CF49CF737999F7A82FA49F5A5C707CDEA azrail911
622,003,824 *40019717CC9CEE29690382569940D3F8E78BAA4F AzrC
622,003,825 *400118CDDB21053DFD409D8C1E5AA8BE4D90AC7C Azrednim2
622,003,826 *400B48E9573810E288911A190EE0BCEB8AA3B9C2 AZRO$
622,003,827 *40059BEB031C42481D9FFA10D07CB4DA6A0607C3 AZrqa
622,003,828 *4009FF71B2CDEB0E629166C1D555C9C7168952F2 AZRVB
622,003,829 *400BF07EDCB41779FC79A3231867156A2B16706C AZr!X
622,003,830 *40054E69B9CD5EE00D6FC08FBE3D4174B0122C7D A%$ZS
622,003,831 *400391C8D5F1319418D170635FD4FE0889163584 A":Zs
622,003,832 *40017FBFD7BE643451378AFBE1B6089D92177606 Ázsia–óceániai
622,003,833 *400F6B5CA31283AA0E149FAACA0D8D08FA9659D3 AZSlN
622,003,834 *40042921C69066F3BC4CBB9EC7A4FD284E3EB49C A&ZsQ
622,003,835 *40083BAAA96318CEE5715AA3E025F81A7A8810BA azsx211
622,003,836 *400554402244555BF4B99B66FBC260694BAE612E azsxd179
622,003,837 *4001A9B0027DDF0B6BE89200FCB10FF7E7BE377F azsxdcfvgb888
622,003,838 *400B1D0C4A972DC84ED8FE2F53CEA74E3B9A95E6 AZ:#t
622,003,839 *400354E3458D7EA883FAF6B6C7DBBBA4434C96D2 AZ
622,003,840 *400FB6D80DE7567028B79FA321150A420EA68E8E aztecmicro
622,003,841 *40064E14B0B4C48FB09897BD62A8ABA49BAB7CA6 aztecota5
622,003,842 *4003BE3EDBAB5A2DCF1A53CB4CEE63D559B01CBC AZtH3
622,003,843 *40094C6634B70E39A679F970F66335F53B55A3A0 [email protected]
622,003,844 *4000CBBDBA98DFB4C9B591C762B3E02B0368D80C azt mondta az anyuk
622,003,845 *400F4FC35A2460EC4385A58544961915EE4117B8 AZtoM
622,003,846 *400A4AD58F43F0241FA827D4A0A2C5A1ACE2D5A4 A=Zu:
622,003,847 *400DAE32166C5D76A399532575611B6F68AED744 A$Zu"
622,003,848 *4004254B38720B5D5CB66E8B5D550EC51B9C5D78 AZU_18
622,003,849 *4004932CF49534734F04DEF4E8326F87320AF8D3 AZu-5
622,003,850 *400A363AC71B6A46A3FA3A331FE72F95DCEB76C8 AZu7F
622,003,851 *4008845BE3F391BF0B7A13913F17DC5EE424BD27 AZu8E
622,003,852 *400805256A9662C7168958CC2DA4CD9E8BD1E841 azuallsteaua
622,003,853 *400D63AEDDD8340384A27DD86B8E030EDBC53BE0 ažubalių
622,003,854 *4008CFCDCAB8D395C9996EFA77C7139067798E4B AZUFEDINE
622,003,855 *400BD81A050B7E80FB974DEB3B08A0697EF4A449 azuicared
622,003,856 *4003D106DA7918E629A20BEBCA73D89D95D23D63 azuli presents: miami 2005 (disc 2)
622,003,857 *400624CC89479F972838C6864628F89DC0094D70 AZum9
622,003,858 *40040777956CF3FBA28B45A8F9C46F106A3E3BC4 azuraah0zuh1rah0
622,003,859 *400BC51AFACE1C0B05DA65F2D31B691AABD57D23 AZURE1910
622,003,860 *400C22E21DB1775A54BC030F72BEB58071090138 AZUREBOND
622,003,861 *40083B7252CCDC13CFFAC2C032215DF247FF6FD2 azuregames
622,003,862 *400681DEB1111C5D1CFA9536B54FEE589727469A azurusezu1234
622,003,863 *4002DED072C897618F746DC1996540A83578864E Azuznih3
622,003,864 *400A4E7AFDFC7EAF782680A91ECB8DC741BC334A A&ZV-
622,003,865 *4003BC4656EE70C1EF14B8EC2F0B602B23830EF9 AZvK
622,003,866 *400888E20D67AEDE241E5E1555B802399E002F97 AZW($
622,003,867 *4009F18520A59548F80D6CAF1D96EF5DBDDD5C24 AZwE&
622,003,868 *40089AE3A4780190D8DA38F1816ACE3607B01E67 AZWO.
622,003,869 *40039692C8DE794D5C55A7784C4D60D14F8D56FB azwqpnas
622,003,870 *400ADF232AB1A6ED7706BC34CD6C6CFE60A07F40 AZwS=
622,003,871 *400536326E5DECDEE99ED5007AF20070A040C261 AZWWj
622,003,872 *40062663354EA1088A05D35A856B937BE903782A AZ=X$
622,003,873 *400B4FC6E7BC62C3041E7EC9963E74003C2109D7 azxeoi
622,003,874 *400FB3EB4E5E4F9E49778D155CEE9F3D84074090 A.ZXg
622,003,875 *4008A5CBF3AC02066274E7D396A220583C4EBFE4 AZY(2
622,003,876 *4006B96CB94EC80FD2D11512B9F7AD58EE9D6724 [email protected]
622,003,877 *400E0CB05EEE8E5BED80330A303839AEB2708211 AZYtf
622,003,878 *400C57325D2ADFBD8A80A0161CC72851CBE2B548 AZYtt
622,003,879 *400509E6E9A58699F53CA26ED96D60D3BEE31C75 AZYXOCE
622,003,880 *40031D387D5B2CA22DA2A94B8E8AB053567C8279 AZZAd
622,003,881 *400F8B59B34E9E1D3A28AE5A98D512F2A6770486 azzarderai9
622,003,882 *400C3F6C4375B960C4913E23014B4F8B4CB3D866 azzeccata.
622,003,883 *4003CC024427D5DADA5359158B5EEB7BC2685AAF AZZERT
622,003,884 *4006C6C502EB659C4BE84E523AEA91006A04A0DF azzshaw
622,003,885 *400586C0A2E2B2CA88E2F5E821C8C268D1E58CFB azzurrihammad
622,003,886 *400BA30D6C86DB6ED268BD5FC39319C68BF0D976 AZZWo
622,003,887 *4007160D1C19749D1E00D00091EF68B60E981A55 AΛHΘHΣ
622,003,888 *400BC7B7A427DAFE06EC8C53E2BEDFD6C24B5A67 ăнтăлни
622,003,889 *400695A4C93A77EDD8978DDD0D74EF4A117B8124 a花粉症(大塚博邦)
622,003,890 *40016F2116213DB86C091000878D6CBF7FA82155 シングルA面曲では数少ない、自身単独での作曲。1番はほぼ
622,003,891 *4002F219BB5BD2616D108E2916D3011444EAD722 &:B
622,003,892 *400CE5CEEE6D34565CD9A51637010883E6CDB1E2 B^',
622,003,893 *400E22F437F59EFD67887DE1074B18D83C00DEB3 B~&/
622,003,894 *4003E1F9AFA421CA0E32B9EF8F4B2B747DC64F00 B=?!&
622,003,895 *400938B74E59E359E7A3FDAB5545C1504B1C6E17 B="_"
622,003,896 *4009AA48E9A009AFD56A4937F964DF0A87C00F80 B_,:(
622,003,897 *4005096198AFE48312A0EB2CC2EE284DBB0B63EB B_!__
622,003,898 *400F9D9865AEA03788FB475F5B022C09CA770933 B_._+
622,003,899 *400DE2605F5C2AE71258BE568512835B55271F3D B_%!#
622,003,900 *4007D9C46A3E575ED06FAC5C28BDD216BCFB25C7 B-:/
622,003,901 *4006E3F26447944055B8F5FEC4C860AB40C23492 B-)_+
622,003,902 *400860C540D4858D65D365C5B17F7970994E615D B,==&
622,003,903 *40074DCF1B47EEA4BE51C92515C5FC96CB8A1600 B,"$.
622,003,904 *40048C67232DBE49B1AB5926EC813932121D6D0C B,(==
622,003,905 *4004E87AC10FCB140E9AB00FE45C192C6EC39A07 B,@{
622,003,906 *400B0985E0B29E48529BA6EA5B55F1EEBB0FDAE3 B;&%-
622,003,907 *400FCAB9125ED042C3E4B1191CDAFC4B025B5F8D B:<>
622,003,908 *4000566F8837827F258B91BE2805B4E9F9720148 B:?/=
622,003,909 *4006F03B2930ECD2469352736CDE2E5869E6EAD2 B:/>
622,003,910 *400E3BBC4345D3FDD59D547C281E0FE101B7685A B:"(+
622,003,911 *400A3A761F75C7E0BC2060619DC01D9EB4B046A1 B:&#!
622,003,912 *4005CD81A63EB2FC74D9F06F56058FE36C5B2BDC B?$:?
622,003,913 *40060E4983A1C4D6E1CB3A41B65BA606C0C1FE3C B.#//
622,003,914 *4000A73D1795F826C72461E5DAC19FC4D82E7AC7 B.%#$
622,003,915 *4000E976138A0B1FEA031A3DCAF7AA8FCE5E1529 B'{$
622,003,916 *4002082F1A477BF4C5B8C6FA01130E73AC216F4D B""$-
622,003,917 *400B5606A3B26E4930EBFC662A8870C3AAD0F581 B"),+
622,003,918 *4007B378CC5C4955378B43F3CD1103FABC535184 B");"
622,003,919 *4001ED3A3526938DE12E9AC55BE1B74AE6A507DC B)=+-
622,003,920 *4007E77948080846414FBC064547CE671A13DEA1 B)/,
622,003,921 *400A450960671A490B732ECF639950CC6039956B B)+-?
622,003,922 *4002809A569D16F80E6C9271B352C05D598F8585 B}$_
622,003,923 *40082B02A3C5BB3544B0A6CC50743FC4EB233885 B$
622,003,924 *400CCB627918C566FF530E2519B016BA482F3EE4 B#=:=
622,003,925 *40001B6110FCD6DF88559D24A36E3A4B1AD11C14 B+$#$
622,003,926 *40024702FB8FBE9BC29DDBBA3C1AFAB6DFF0CBC2 B.?0&
622,003,927 *4001DA7EFC5242C57E9134E73FE3C70A415AEEF8 B(.&0
622,003,928 *4002DACBE41F32C97C607B19E6AF21F25FF146E6 B$_0(
622,003,929 *4009DED67C89E49387FDC2E923AB6135CE8D8066 B0),?
622,003,930 *400FD8F66987198F9D8E9D930A8E29C65B25947B B0!0!
622,003,931 *40098C731C6C4AC1B1D78D6FBB1E1BA55965DCC6 b000009cyj
622,003,932 *4004C5D7C88C9440139F120B16DBB7B51C7AEBB3 B00000I415
622,003,933 *400392082F81FEC7C9FBC347CBA1F57DF406DE05 b000050htl
622,003,934 *400D8D14A0C19A0B1A4AB86354F99829DFFF5BA7 b00005b2ub
622,003,935 *400CE505B2C43EBA6D67A035FF6C6225E8066FBC B00005G78T
622,003,936 *4005CA2C6F8035A9D1A4C8ECBCAE709EA6E3AA5D b00005t7h7
622,003,937 *400DFA03186E8041706FB3AD17499098688C2C82 b00006i0cz
622,003,938 *40076B8BE0D3A022DDCFC31BAB8D6052ECC2A25C B00007LLDF
622,003,939 *400408998AB45BDEA852C0F082CCEF3A2842F909 B0000BP5WR
622,003,940 *400AAAE5843B3B3B1025F4AD5D7B603FA99C47F8 b0007xvet6
622,003,941 *4009E3D5697DE85C6333855843707E3A77BE3824 B000F6YTMY
622,003,942 *40000D001FF576F4AEE58DFB93C042413E04CBFF b000ij7na8
622,003,943 *4006B42C80975CC16F521A30128FD6AA3B864595 b000q6459a
622,003,944 *40069894B47BF7280593FB52389AA860CAC6B044 B000Y7U98W
622,003,945 *4008804E13A2BA65B79D3D9DCE5753C601419B1C b0011fndv6
622,003,946 *4000A018AA840245FB51F9985B711CA2BFE304AC b0012rcmme
622,003,947 *400AE5B3F88D666A0C71774219227263AE6C2273 b00139hqiq
622,003,948 *400D823D2DBE583E5FAB061F680C94F5D8DD7ACE B00190LMBG
622,003,949 *4009C3B94599E67DBBCD80730F6BD5C1036D5550 B002702OPU
622,003,950 *4004EAD52A0BE8A789C314B223902B7CD8E52EA3 b002bw79uo
622,003,951 *4000FD32F1EAA79615D75E8C407A64389C35E10C b002fofx7e
622,003,952 *400CF38002788C3BD4AB04F1C8851E7914ACC9E9 b002g3dtse
622,003,953 *4005CB33E7B5C288D3843ED2D83240494724BF09 B002K3KYY2
622,003,954 *4004AA457FC44ED79344F53BA1336B3B2B9FC6DA B003;
622,003,955 *400DC4881A5D88C8E2D745B616C97C61B9920CD5 B0038AJ4DS
622,003,956 *400E9FBAC77705757858F6FA3E83611D413010D8 B003ELJWD8
622,003,957 *4004D2ED48D32B46F598CDF446A5BD934B9D8281 B003TTZT5K
622,003,958 *4009AD2B20A6F18C8BCB9F13BD50C9FD5A458BAD B005ter
622,003,959 *40066CF1600A732EA115339895CB8BFA9CE8BBBA b007rd0v
622,003,960 *400CA047AC8E8D17682255485D295C506EBEAEA7 [email protected]
622,003,961 *400AFD1164712FCE30C4A93559B027FD5AD6A984 B0_0K
622,003,962 *400CEC1D21BCE95B9F54019537A925F0B6A97844 [email protected]
622,003,963 *40017E9AD92F3FA7558A0B4DEE47BB168F643D15 B00lP
622,003,964 *400024D974FE505781F3FE35E1FDAE2CBC69B4D8 B;00R
622,003,965 *4009E1D96409624115855F5FE230F1C545AA9B74 b012345678901122
622,003,966 *400CEA300BCF6A46D80109D36FE459BB0F34A91C b0148813137
622,003,967 *4004A84571F7EBAF31702FDFF41D776B59D6B1EE b01.500.644.600
622,003,968 *4009A49A69B29E1FF8DA64150ED8021797F947C0 B01j;
622,003,969 *400D2737E4BADD514C40BFC08D451272CE995BB9 B01lS
622,003,970 *4004A65492441FF02FB4771A702C4C0FC453DE6A b035m4nm31d3
622,003,971 *400C46A483572C21B00D681B9CED5AC0B5BDDA83 B03;9
622,003,972 *400B590217861F2E1D40D61B4F72D5D6FD9AF90E b03km4rk
622,003,973 *4007C7D6F9872C7153F11B80A6BB51BD027E7EAD B0#3v
622,003,974 *4006E1F9CDA16063BFDE836BF2E08CA6EA16742E B_,05
622,003,975 *4003C115B3CD4694927FFDD3ADA068F40ABB2C5F B05t0n!an5
622,003,976 *40017635F6140094393E2C4B20D7B5975CA94724 b05t4r5314m
622,003,977 *400F03EBD2C371EC28F4F6FAF8FF860172E3C64B B
622,003,978 *400130DA119CB35E76AD46E9C02B36B62BB8C585 [email protected]
622,003,979 *4009E9331A0A3D5C1E08E927EB9752C38B673366 B075B
622,003,980 *400156C7B741B28FED812C23C9F8EEECBAAFA4D1 b07973
622,003,981 *4007380702A6F17BB1023E8AFA92C1B151E34444 B07L(
622,003,982 *400432C63770255AD03ACA1129E0069AFAA98CE1 B0?7P
622,003,983 *4002F4F3372F5F1252B3E00739FB8D0F4BE5075B B082m
622,003,984 *4000B06DE0B377FA4A5FD649ABD5098DBE869A94 b08827
622,003,985 *400050718216C044A490806D534C693259C9794A B08$e
622,003,986 *4003DABAA2BA0D378E76CE5FA714888B0B66B363 B08L0
622,003,987 *4001C18321EED33D3B14C0D65126D150DE441CAD B"08Y
622,003,988 *4009D3D7D664C7EDAAF5D46DBF3107F5613E67BD B$0)9
622,003,989 *4008C0F02B1E57AC4B03D421D42AE7D003778CEA b09101984
622,003,990 *400925F6CD51A08965DBCAE9277611C94B1B8F1B B09280SFN1958
622,003,991 *400F323E18B066493286A2570BB7CFE66ECC5D61 B%09m
622,003,992 *400D8B04B285A9B7B1082338B9B6511CB80B0BFB B0-9R
622,003,993 *400C282A269BD19B2910AA0D214E27F7308F185A B/09X
622,003,994 *400957AA2E45EF5FABCE3FB41D2D153362112901 B0A5TING
622,003,995 *400DE8DBB1082AED342357F606BA913A3856B1B5 B0A;e
622,003,996 *4005446FA901FB53225C40069BA7BEF98533450A B0a$ter
622,003,997 *4002B42E0B06135FAB8589105C8A4DEDF5390D17 B0awM
622,003,998 *40093524E9F89D4447F5349B867F43278B08EA7F B.0B8
622,003,999 *4007B5CB353265A28F54F4F12670943CF519F642 B0BAw
622,004,000 *4008F6B1A1755392C920C15C10C1493CB528743F B0BdO
622,004,001 *4001E260BF626A8D073D6231FDA16EB4BC067DE3 B0BE
622,004,002 *4008BBE5D55DC2169997D2D3BB2C21ACB7AB9425 B)0Bn
622,004,003 *40059883E6A79027877C887BAD91FC198DB27DB7 B0btn
622,004,004 *40013393AF8C2CC6E1A9D1B77022BFEE9F9D1465 B0B;u
622,004,005 *40000527CAB6971A86A5C0F74DE9C70638003C14 B!0C
622,004,006 *4005AF91C71AF3DEBDB6AEE06B74EAADB8D1A929 B&
622,004,007 *4000167CFC87B2BC11A1BB8956CCFE641640E2D6 b!0c1!m4+0109!es
622,004,008 *400E6E730527A0A5D9FFE6F438E9A5AAE9F92D7E B|0c8
622,004,009 *400B3D3589A9439745EFABBFC7BD82EB301949D5 B&0CC
622,004,010 *4007C3FFC5DDAA6F2E26EFBE16559F81404B72D3 B0c&H
622,004,011 *400BB1AEBE378A6C3A6B4DF7632937E521695229 B!0cO
622,004,012 *400BE0B6EBD2B35A61347D3049CD4ACD03FCB1D4 B0cOa
622,004,013 *40038EE159C383A852ADA89D396D38E7D27084B1 B!0CYCL3S
622,004,014 *4004DE500701345939DE5D9C1EF600CCEF8C7C80 B0)d0
622,004,015 *40057EE665B21A2CB0BCE404C7F203ED47126B25 b0ded951
622,004,016 *400F3720F5EE79991C8A38352BD4071A33DFF5EE b0dych3c
622,004,017 *400CBB7FA289DB77FD2745AA189A7DDF16074BFF B>0e
622,004,018 *40055759AA6A05517BA92DE784706FE7C14493FD B"#0e
622,004,019 *400D08EA1A815122B32785A0E8ADE55ADD892BCA B+0e_
622,004,020 *400A42404E150721469F04DBE0509CCABEA801E2 B0(E8
622,004,021 *400C15FCB8ABAF3E154B75D2B2EF1F5373BFEAF3 B0eAI
622,004,022 *400AE1AD974E919E8F5324AB87974666AC88E1A7 B0ED$
622,004,023 *400F87B90581193EF1D1E8C797862A3F2659A223 B=0EI
622,004,024 *4008DCA9258A8E5CB73371A954CF1D5A56C886CF B0Ejr
622,004,025 *400F2A2C3B8C286FDB6578EBFAD574F0FBB9DDD3 B0E)n
622,004,026 *400D47CFE17A9A7D2DD1B9FC7C7EC35433DA7E35 B0e:Q
622,004,027 *40010DD064B49067047413B7DA2ADAEDBD932758 B0e#w
622,004,028 *40065FC9A113A9ECA073398E50CBF85F20C99558 B$0F
622,004,029 *400D88E3CA20698DC0FEB94343BA416341A3895E B0"fg
622,004,030 *400BE130C4499E280AA040C3F29D4DC6EBB953E2 B0f.P
622,004,031 *40066A3627ED4D0C5E49CE0E4103BD22684C7E73 B0.g=
622,004,032 *400119823E93DA433ECD585804D4F55BEC651434 B0g?)
622,004,033 *400DC387A7D2EDCCABB64D85B33EE95BA5D51241 B0g,C
622,004,034 *40017234E6A2DDC3939CB4884F2331DA709D2137 b0gd4nc0c15cj
622,004,035 *4000C4AB3631CD84CD329635B66C530BA732EBF7 B0GjG
622,004,036 *40006A2E42227E0928D987A7720C0FBB818DF1E0 B+0Gm
622,004,037 *400AE6CA5DC92922A589CE9536572704445280EE B0gOs
622,004,038 *40087D0B1C44BACD5C4D0925F887FEE6FA149135 b0g wi110
622,004,039 *400C55EAB9A8803B0B929EB39B5361E240746997 B0h0#
622,004,040 *400F1C46B615648B7A2CF1FC58BA7F270546D05E B0h01
622,004,041 *4009BC11A01F54586AC3F3F23009C87FEAF5900A B0hn)
622,004,042 *400E157199ABFE64EB516BFC9386ED824C15B6D1 B0!)I
622,004,043 *400C9039ED09E8711FCEE791994B77FF7F13B98B B%0i/
622,004,044 *400FD66C954FDF5281A0CC58AA673A9512BC6052 B0"i
622,004,045 *400D4111B9D2FFE5B99844E28B914C75111AFEA2 B0iC%
622,004,046 *400AC46AB1C806324BBECC4DBA0A81358C2F35B9 B0(If
622,004,047 *400ADAF9200419D097A147680912D2FD2C10D3D3 B0If8
622,004,048 *400BE7589A6602D4055642FD1D83C47D57497BF4 B0IKh
622,004,049 *4008D5CF14B3C7EDEE6EADF7513F2CE53FBF0109 B0IPH
622,004,050 *400B96AAF76E23B7CAA10C83D14334A8D88096DF B0jFR
622,004,051 *400B43CBA95C06FCF1B416C84BF4D109F0552975 B%0$K
622,004,052 *400D2EDBE8F3B2E4DCDC42F43A0DD6099C77DA27 B=#0k
622,004,053 *4004CFF2A9A99696DD515C91DDED9D6D2D050FC4 B%0K1
622,004,054 *400F02AD05069617D0339E9059C56AB18944B2B8 B0Kh:
622,004,055 *400C15E5F8D0BD27F185E12E9D3E3AEB5D147898 B0Kht
622,004,056 *400BBE3F1265C9354DD6EB34C9D5E4FD8F8EC9CA B0=kK
622,004,057 *40039EC0651D38DE8DAEB92D1B326964D3672036 B0&KN
622,004,058 *400D7B7E11E88599C254DFA1B8EAA08230914777 B0KZd
622,004,059 *400F5F7A31AFEF1F87ACB6CB3136EA5D76802EBE B%0l?
622,004,060 *40065C12897789DED4222E48CBB66A5787A2C934 b0l4j0k0
622,004,061 *4009D9DA3B076C039780C3452884EFA11E093B7A B0:l6
622,004,062 *400661D9E3C63D92D0EB92181AD94C31B702D58C B0l=b
622,004,063 *4000C982C829B6ED187E682A4A97883629E15D74 b0ldface$
622,004,064 *400993F3FA55ED77A17645F020C4DEB9ACBE4FC5 b0lt-thr3
622,004,065 *400CE2FB9404763D981DD4DA9CF2006827907A93 B0M=8
622,004,066 *400933954EF2E32D03911BB820102E17ED6E0ACC B0mBn
622,004,067 *4000C8FED779C03C2935D3F41EDF4025CA96791C B0!mO
622,004,068 *400876863C044C43EEFCDC1039C95AC6FACF6366 B0n(
622,004,069 *400DEBA92A38E929C3A2BC265A4AE909F96826A5 B0_nK
622,004,070 *4002CC9F2AA276A47F185037F9C33FD79EA5BE97 b0nq
622,004,071 *400FBB41B8612E7CCC323D13446D6F376C31E531 B0oDo
622,004,072 *400EA0D75CF1739DC2EAA143E922B67BF3FAF2EA B0ol8
622,004,073 *4004978E9DD6647A4DC3E1A8A85375F762F3D8ED B0p1h
622,004,074 *400BCDA9E2D2322ED8CE3F4EEDF97EAFA808B6DB B0p87
622,004,075 *400D4143CBD5D1978A5A8DE521F74DF72C044E60 B0pFP
622,004,076 *400D5052929EB6FFFCEEBB9B5B253682ECB12E47 B0#Q"
622,004,077 *40098185F65971C8D89F70E543698699A6E187E7 B,0qi
622,004,078 *40023C699C4E79D3A92D96915E7151CAF53645CF B0",R
622,004,079 *40046B4C8643F37BE35DBAEFEFF60AF9F08E8B17 B(0.r
622,004,080 *4003E621C90FD43C3F7E5BB5BEF6272C0401C6F9 B0r4t3s
622,004,081 *4005E3B9C8CFD0D27B294A4C4367D7B62548C995 b0rb0t4rlh0
622,004,082 *400F8DA8474B829FF31798CD56E3DED34566DE8D B0R/i
622,004,083 *4008933116721986B69C75EEB8F8F752E4DE8D3C B0Ri!
622,004,084 *40079BB31DC8D106414A191136FF8E32CC362770 B0rmV
622,004,085 *40018D2AFD1B9B0F344D4075435B48C6C5E53880 B0rPU
622,004,086 *4008E8B2CC1E661B021BAF7CEBDA99D75B0B5728 B0rrM
622,004,087 *400104B0E46717CFC471C1CAC7E5DEB2A274E3E0 B0R=t
622,004,088 *40096A5CB432E8E8FF7CF67E0CADBEE437A56095 B0rTr
622,004,089 *4008D4F6C8DC2F09804C772174F01AB00969642F B0RV"
622,004,090 *400FFCCEB6B0FC832365548AD0CF6CB22667CF8D B0
622,004,091 *400AA1A3B131FA48E48E147A14E2138D1F59DCD8 B.0T0
622,004,092 *400D5DAD304C47048B5A8196A90D04BDE87955D5 B0te&
622,004,093 *400DE978984435AA748A1308F8F43AE59DD6F074 B$/0u
622,004,094 *400F734B954A43A8E4F167D06DCD14A0D19D167F b0u!llaba!553
622,004,095 *40042FFB00F65351CEF85DAD76298DE3880703A3 B0u(u
622,004,096 *40096BF17258583A2A4B2078142679645F0E9FAC B//0v
622,004,097 *4004052A751A578DFA3E4F91DF82B6F0DD81F577 b0vl4mmes
622,004,098 *4008839E4C21239F0804AA0BB3CC46CD23CFE0C1 B:0=W
622,004,099 *400BDB5D20B1ABB1805D3C391C8AF3A72C80720D B0w1in95
622,004,100 *4007C969EC806617A27C7F14EB76C750FEB94B56 B0W%6
622,004,101 *400892CE55B8FD97E64EB176EE49DB1AEF6C77E0 B)0wB
622,004,102 *400C765EAAF31BFEAA0D55F5D3AB014FFA3C6731 B0wBX
622,004,103 *4007F55D6FBCBA3A802E90924D8FC14A73B66C1B B0w?D
622,004,104 *40016E05D3B077B6ECD1698DBE92BFC91CAEE16E B=0wi
622,004,105 *400E0BA03DC3D2CD79DBE6A19FC46CF7ADDAEB83 B0wL9
622,004,106 *400A3CCB8A10ECFD958F00F0754399E8D063401F B0,X
622,004,107 *4007C9497483B4CB49588B68D664D64E4376C782 B0x chr0n
622,004,108 *400AFB61DCFBCEC543F60069FA64E18428A70DF5 b0x d011y
622,004,109 *400746AE257E41A2BB7AAEFF3C979F3C4E7AA0FE B0X
622,004,110 *400B31E040988400A0BCF3707ABD1C1131514B26 b0x p14it
622,004,111 *400A40A5AF479FA8945B27C9CC05CD2CFF2A034A b0x t0e
622,004,112 *40092F91FD374CB0650C755CEC4FC7C85B3BF645 B0Y()
622,004,113 *40015E50E2D57041770534C05E11334228DD2D6A B(0Yb
622,004,114 *40051C510CE619C588B1686B68F987FE3CAE9C17 B0YBu
622,004,115 *4005600F37A4BD2C2EBDDB019264320330FEDEA8 B0YL)
622,004,116 *40053568E1B4D148A43041B51E2CC3453DCB1DEC B0Yv6
622,004,117 *4004F94FD7D174E87CAD14787B9AECC97CB10913 B0Zjn
622,004,118 *400222907ABB6F034BB034B285366D22EE808E76 B0Zv0
622,004,119 *400EEDF339F681CFEB460A081D8867645D71B778 B_-;1
622,004,120 *400B39F3DF419A37FB0ECBDCA8D79B81D5D41963 B-1
622,004,121 *4009CA536AF3CA8FB8CBBBD74282C5D9F722A4C7 B.-.1
622,004,122 *400E21436B7C187C8AAC4132CE0BAE6C4948C54E B(?1
622,004,123 *400A488C8EC0DCB5723B310A8136FA4DCD685800 B++1;
622,004,124 *4009374CB3B9DB37A28595F302A6E8A308913797 B1!;#
622,004,125 *4000E6D130FB50D5F0BC309C33DC4EEC92A41E0E B100185
622,004,126 *4000BEDB4520221BCFDEBE9E1B4F1ABE25F1EBAC B100d1377!n9s
622,004,127 *400B6DCE82F03A2174E58979BA4755124EE66E7A B100D7HIR$7I3$7
622,004,128 *4002CFC2F583E67C50D1C98801B77A5E0CD9198F b103412
622,004,129 *400EC6A2363BA6F55AF5D52904C2C009244DDE13 b103674
622,004,130 *4009A39D081C0654027BBCEC0BF423064CD39035 B104v
622,004,131 *4005298597334B1047446C10B76EF72F1271831C B107編成)のいずれかが検査に入った際に代走として中央本線や関西本線の運用に入る。
622,004,132 *4005E5A7F0302A9EFC919F58EC0D0026CFAEC8B9 B10l091$+$
622,004,133 *40021A39AB1DE33B35FE49056DCCB64CB8083C5E B10lI
622,004,134 *4007D3C5908CC3DD2431ED9CDC0DFA40811F0E8D B10;O
622,004,135 *400AC38D4683E2E43CF8C73DAB351FDEC820E93C B10W5!E5T
622,004,136 *400F2E816DB1715536EC08A1868AF6A6BA1BF5FD [email protected]
622,004,137 *400CFC052B4AA4A06058D9D578BD39C1539EE658 b111399
622,004,138 *4004FA2EA7559C2FA8D3CFB108C86B7E9015952F b114743
622,004,139 *40065E9149B2533750F805ECB5F22167B2C50C3E b117624
622,004,140 *40025C36CFD27ED2FBF5CC3F980D2BF031FC8C2D b117721
622,004,141 *40089F2B5B36CDBFA97B6224CE8E8F4C53FC9DB9 [email protected]
622,004,142 *400B2CB509E642D2CAE97835E40068ED46824C25 B11g!
622,004,143 *400A18E8ACC43C43D4A2094FBB05AB7DC3E9CC54 [email protected]
622,004,144 *40098B5677F0BF6E4978408211548CC6FE00A2C7 B1;2$
622,004,145 *4001F376A96A6A4FDA52A88EF250E8E291322265 b120166
622,004,146 *4002B79C5E180ACF65A92AE960F6CBA7D38374C3 b123097
622,004,147 *400815CFB288230209314FA939C7FAD8168C4F53 b12637743
622,004,148 *4009B57A4494DBD2C36254FC398B9BDA082FEF34 B134R!35T
622,004,149 *4004634E1E2F953FB4F6C4E6E15A0F3078DD3279 b135385
622,004,150 *400EB4DCD1E6800AC09E883BF12B8F98B84FEF84 b138615
622,004,151 *400D4E037CA4C43821497D9800C420221764F17D B13eU
622,004,152 *400DE0C9A9ACCB00DE00C4DD89AA0F4593CB1285 B13h,
622,004,153 *400414A1E5F7912AAF4B700E8A78E11A23434D1D b147h3r$
622,004,154 *40040037F01476D341A41E12FDE351A1E0D3A6B2 B14CK1157ED
622,004,155 *4005DD04C55709D1ADF7F66E778E7ACC6C9B6FDC B14co
622,004,156 *400F6CE387272F8EB25EE6A0779EDAB634F8F8BB B14e0
622,004,157 *400DFB6355FBC11E98D768448847F80472A74589 b14erin9
622,004,158 *40021EFA9365D0AF4DE15C45F3D62C010A0CFF88 b14frede
622,004,159 *4001B925CF24ED6419A19C9BAA79A34491B3E3BB b14ngul0u5
622,004,160 *40065A67A5BCA06030B8449986966E296381235A B14wo
622,004,161 *400B6BA2D867DB62103E9030A0763C1D3F0090A9 b150986
622,004,162 *4001D21248A0CE308C69D56DA2687DAA4F1B77C8 b154113
622,004,163 *400C994343181B488E6BFA085EFD046A36AC81F7 B154H
622,004,164 *4000D3D4C6387C8E7A34F52D4697A651961906E2 B15975321B
622,004,165 *400FF7736473107213807830CB0C27C2E618469B B15,C
622,004,166 *400DFA3056F3773F7E01BDC873F38AEEC94DF94D b15london
622,004,167 *400DE7412B0A2E793FFF00061C1C6FE5B6C9DC29 b.160seneciifolia
622,004,168 *400EF3DD1BBF7CFD29693C8382FC3D1D91734AE2 b164226
622,004,169 *4007ABBBE8EDD80282B86337024343244544DADD b166433
622,004,170 *400208733C5BF03BB1891B557A59CCCBFAB40923 b.1680-d.june
622,004,171 *400633847BE89D9643DD296A95C2EB8A9966CE60 B16OC
622,004,172 *40080934858077DACB7EE4E3275FE549BAE0BBD5 B-+17
622,004,173 *400D728993C2E10A5633065125CE53AD741827BC B/1=7
622,004,174 *40095AD5A13C9496C58238839981B00B1D36D539 B17&=
622,004,175 *40082D16833B1008370EC51B7809F9CD60190692 B171180
622,004,176 *400A2B3DB84E10BA4465AC5B4F03F423F867F5CC [email protected]@1!7!3$
622,004,177 *40030F474DBF67E7EB33D456170077590200FBD3 b17869
622,004,178 *4000C9E742C00976386432BDB694D12948065D29 B17E:
622,004,179 *4008134ED2A232A01B00ED167608066EBF038118 B17.w
622,004,180 *400FC7B1C1D8C946A524CDD8727616A257030940 B17Y=
622,004,181 *4001D365C770D06CAF80E61FD95840F83E507598 B1,
622,004,182 *400BCBB2945F5986033B5C4E812D24FFD187A217 b18051974
622,004,183 *40044AC202B9BE4D08990E2941ACEF0A80175FE2 B18E,
622,004,184 *4003ABD4C4E508F2F59AC39C4D237FD318325D85 B19BY
622,004,185 *40034E56360B8CB28275406C5EDE0E695B7158FB B
622,004,186 *4002B66CEBF9725BA218C21033C93B4CA4C2CB66 B1a3C
622,004,187 *40041416D4798F6324E8B66578C6F397B3DB806A B1a;4
622,004,188 *400DCDE26DB0DF9E4BEDF4C4FE3A43BAE5955E0F B1ACKSM!+HS
622,004,189 *4008D5CF264ECA981E1B8EC02F8B3BFB95AC1E89 B1;Ae
622,004,190 *4009F4FDF43F5D8AE53E74A7B26CDA516D8ACE10 B1AK&
622,004,191 *40053CDEF5EEC08B9F551E7360C64BE6CB78DDDD B"1AY
622,004,192 *400C0BAAFB78E418EF81662FD37B5FA85C4AA121 B1azed
622,004,193 *400380EFC430AD6F3A7E506268D80DCEB92A40A5 B/1-B
622,004,194 *400E145B674C9FF43A7404295D11F37C752FDA40 b1b23f51
622,004,195 *400CAAB2465F7C731770F038CB9DA0F854EF0D65 B1B)7
622,004,196 *400F38B31463D88389DDCA0550EB317AD968B561 B1b8G
622,004,197 *400884710EAEA8CB8A817B9CF28C72A01B100D54 B1bE_
622,004,198 *400E96CE33FC7E82C2EA5CD13FC172E954E8E70A B1B%G
622,004,199 *4007AA17C7AF15B615C834A3D553A931DB57B8A8 B1b$K
622,004,200 *4009212EC2705D59A822826DEF4720157F30ADCB B1Bno
622,004,201 *4003737287E5C4DA200E1DD9800A904D016911BD B1C"%
622,004,202 *40024EBD2BB1BF1CE8883D2480D1D3EF5F63C039 B=1)c
622,004,203 *400D90DDC785574DEC7EA424CBBAF4B1A1601E01 [email protected]$
622,004,204 *400ECCD7E51C85364694B72111936F1E2B912FE3 [email protected]!+h5
622,004,205 *400225608C063FA39DECF06406B3ED715EA06E82 [email protected]@!1$
622,004,206 *4007B0B864978F759214FCBB920CBA88FC6EE499 B1(cL
622,004,207 *400939E71552666A2FE27E53687D26E65D9DAE0F B1cQM
622,004,208 *4009362F547C6C155D75FAC311D37904C6A1DE6E B1/_d
622,004,209 *4004474257CE157A1BA8B6A452192646AB7875A9 b1d67a34d8a84565d689793fdee02d66
622,004,210 *400C30E61AF3B770125EAB03D0128F89AC5312D4 B1D?c
622,004,211 *400E6890341DD28D2D34C2F862BEDCEB8A95BA01 B1dj/
622,004,212 *400D8C2E6AC542F0076D326EB4559C62E01100D2 [email protected]$$E$
622,004,213 *4004C403A4BB41F563972DEF85683F72DFC167CD B1EbO
622,004,214 *40047552189F26E0BD19ECC2A2D6A2EAAFCF1999 B1Esv
622,004,215 *400154C433FD905BA28C2C0C1854BE7D20AC75FD B=1EW
622,004,216 *40027502F9EB14904749EC557E80E2BC925E8741 B1f4U
622,004,217 *4009891C32ADD455EE9A353D3F247112EC2E45C2 B1FhU
622,004,218 *4008BAE95BD8BF94162F5116FAB3CF99E33481B9 B1fN5
622,004,219 *40022975614055C54D7AB6E1EE0C3E6B839474C3 B1foQ
622,004,220 *40095E6D95B8B12BD19E4E17D5B6933117B4359D b1fqvggahf9vah7i
622,004,221 *400F2C7AFEF5CD93B1EDE3C55F490AE8A5EE9C6D B("1G
622,004,222 *400122B67CF4B1CB2BE0740EF22332FD5E035C3F B1GaR
622,004,223 *40015F24F02D7CE0A3A6B06D644BB5725A8A9A3F B1%gj
622,004,224 *4003171EEBC41D8E9867A9A000B7E8C47585154A B1GY+
622,004,225 *40018E7BA8F191E589978010B4CF52A911EF1FEF B1g%Y
622,004,226 *4004FCA32B06D47CEF9B1BFEC36FECE87E6B717E B1Hj%
622,004,227 *4009385D7F21462A48753A25FEEDACFC27277DD7 B1hMZ
622,004,228 *400E6A3C2C002854BC06996749C53F7A17D719A1 B1hTo
622,004,229 *400747979331B1B7003EECA8354BDF704B09A442 B1hWI
622,004,230 *40028A98663E41726EB4F66145F0770889EE47B2 B#1I&
622,004,231 *40089CDE3F302965349A8489CD62A22AD1474900 B1i-2
622,004,232 *4006FCE050A232D00E51B3909E027982A8D3FB24 B1+IC
622,004,233 *40029230471423656C09AFDA28C201F6250325B9 B+1If
622,004,234 *400252DB7B18894D7F4A2E1B89993FAD1DB91BF6 B1iHr
622,004,235 *4003F0010C18896D7C0EEFEF2A9F349BCA1C113D B1i)M
622,004,236 *400B8A04054106BA6571EC2213C538195FDC6410 B1Iq,
622,004,237 *4008B404303ABA1ECBF0977269FEF140DE6AAF8A B1Jy
622,004,238 *400B5DC54DBAF5F58099872AFBB65732391B4A24 B1$K(
622,004,239 *400221AECA296694C7F6875533BF6CFFB8F31692 B1-KL
622,004,240 *40058921AD4032827C6FAD66E6719D8DB2899FB3 B1KO0
622,004,241 *4004412B2FC031EBCC14F5AC09D2043CBE2D5BB1 B1kT"
622,004,242 *400DAE877F904CEA9ABFB5A9550EBB304296480D B1L($
622,004,243 *4003FA61A26CD2A8B415DB3D8A29FDF5C68ED90B B=1L3
622,004,244 *400FE6BA85BDC60F07B713A41F9069FE221BF9C4 B1Lmf
622,004,245 *4003E66EB5E2C984575B09A5F39BEFFA883CF6FE B1L_P
622,004,246 *400B5FE36BBAA742F5EB76593FB682B8C1465DA0 B1m
622,004,247 *400FFFB752080CF3F23F29F0A8F078747555ED1E b1m0l3cu
622,004,248 *400EA107FDFC131F7782A83EE08E0A7AC72D674B [email protected]+
622,004,249 *400FF3F5EE0355A22C1338C6144C588B98153682 B1N,%
622,004,250 *40066B919D0B7D3AA8BD049D135DF7113DF6F51A B1n&6
622,004,251 *400E0DCCED15A8D100C489CA1E24C9EC1F3C142B B1N7T
622,004,252 *4006B3A707EBA7019EF2295B89428A524DB00DD3 b1!nd4g3$
622,004,253 *400A7689ECB7BE3A2FB77A4181F5033AB53618E0 B1$NO
622,004,254 *40087CDBD4669ADE4FA8E474C94CC8EA6E7E8111 B,1NQ
622,004,255 *4007970BA1F2EEDC3AACFE4DFFFC74FFAAA41464 B1nu6
622,004,256 *400CB8A4C68304EDDAE1D329097CFF9785E108CF B1:o5
622,004,257 *40087E083798973D22478065EC00A13002C14E83 [email protected]+3LL1+3
622,004,258 *400C1E66AE48DE0A5961D742EC4E6CB301968C26 b1o73chnolog13s
622,004,259 *4007B8AD5F53F4B1217216278A80C556BDEE51A9 B1(o8
622,004,260 *400ECCD3C9846AC163720FB3E752D19B7DAA75E9 B1od4
622,004,261 *400AC8C77715DB6990CD45023FBDE01C272B1079 B1ODE9RAD1N9
622,004,262 *4003D7A18DA9D0618FA708230F6DFE01FCEB1067 B1O,E
622,004,263 *4004D74B26A3911EDA8196B3C55FD84FFA0F3AD2 B1OOM!3S+
622,004,264 *400A48351E01B6F9EE1B56A502727939477A13ED b1otch3
622,004,265 *400D83875F59F33FF44C5865A9985E8166FB77E9 B1oZm
622,004,266 *400586B40873F2CBB2C874E202089EC0DE0EF3A6 B1=p;
622,004,267 *4003683DA92EB8BDD77FAB6A27A58502CAC5ADC5 B1p/#
622,004,268 *400C8839FCA920D8B64CFA6F85F1353831BAAE35 B1"P3
622,004,269 *400AE4C4512241E2F980DE5A9EC0BA9E356FCF8A B1pA
622,004,270 *40087A4C79C5F15B4547571F79B2487D4DC879AA B1PEQ
622,004,271 *400FF92E77FCCABBF95B38593D84DE6D86FF1ECA B1P"f
622,004,272 *4007E08C02E1FA7347488FD8413963BB730EC50C B1PHI
622,004,273 *4000C583A6633D53C3CBE4E0B62D26547BDBC6E4 B1PlB
622,004,274 *400C6E20AA3836D9F64353C09F44801E88F3DDA5 B1pu2
622,004,275 *400D94F545C90BB018B8376CC30C7D21317332C7 B1q-b
622,004,276 *400B6EE23A9D18DB7CC6807E631F7093636D9FF5 B1q%u
622,004,277 *400EB3878F3AFCE8D2EFF7CC489CAB9CB5A313B6 B1#,R
622,004,278 *4001364794E93175B75AB698E941E476CB19E525 B1R="
622,004,279 *4003A6921126C25DE60745D4EDA2738469365BEB B1r%$
622,004,280 *400863E1B387FF6A5972CC8496C00DB81CEB33B4 B1rad
622,004,281 *4002D81F121F0F3C7CAA80939E9BE20B9404D07D b1rklar
622,004,282 *400E6858B4A3F57971E794147A50F3366919907D B1rYn
622,004,283 *400812D5ACA01658D9E234BD72DB5F73A0CCF455 B1rZg
622,004,284 *4005762DF5614CD517B517E91BD92E054BCC442A B1sa_
622,004,285 *400C36E3757032F2E992275CA01784A4BFB647A1 B1scl
622,004,286 *4007C42003FC70B7A36A2513C725B1A9E89CDCD4 B1s;M
622,004,287 *400C92C8ACE4B2D2948E074CA5831409D6DCBC52 B1Sqk
622,004,288 *4001B325A5940B5029A81BBA5EAB4F0CB07D1D98 B1SR&
622,004,289 *4004F93311E84A56C5D993DB28C7DB36A44745D3 B1-T_
622,004,290 *400F5EC686134D7BCADEEA99D4D96C3A49169C41 B=/1u
622,004,291 *40057D4D6FE2AC98158503EA56C8A29D7966DB8F B1).u
622,004,292 *4005BC4F54F4254F0462CB61473EA45958FA35CD b1uep01ns
622,004,293 *400D9642F7256E7AF734049A4BF58191505572AB B1UK#
622,004,294 *4008F4D4812D6B78A7C16E8F8AD1B37BA05050D8 B1$Uk
622,004,295 *400BE0811F19A0BF9CFD6F1016E9C125F915B8FE B1uoR
622,004,296 *400D00B2B766AFD44BEED802B2A128B321809517 B!1v=
622,004,297 *4009C0CE54965D601A8CC7B388AF3DB2FB8815AB B1Vaaa
622,004,298 *400B7AF1B746F3439C161FEE7CAB7E85AF07D20E B1VfA
622,004,299 *400B215CD05B8BABF6037EB3CF1110E77C1641CF B1vfL
622,004,300 *400D1D7642C4FD94245D5C61A7766579541494C1 B1vL)
622,004,301 *40009FCB17CD10069634351E614CC6F3C01F21D4 B1
622,004,302 *400ABFB1EB051DADAC82161D84BC417450DCD319 B1V-w
622,004,303 *400425DFE76F265FDAAD3E7311A2E76DF39388CE B1W1:
622,004,304 *4004C13489C2187561E09C951F51DBDF5938AB12 B1wC!
622,004,305 *400FFFFF5384635DD31ACB3290FCD5E4F6CFACD5 B1wFm
622,004,306 *400B67177A796F4DFD7D4525E0E309DC38F26970 B1wKP
622,004,307 *4008503E84755CF6D6CBB51C5E3C5C2F80F6FD91 B1WtG
622,004,308 *4006491592D54AE34C6C0FD2EEE43CCDBD5A8E1A B1::X
622,004,309 *400589FA433F690A4751A1C492470DD77C290BE1 B1+(X
622,004,310 *400DEE8BC29CD65CC5E67DCFCA9D2A80847210B8 B1XBV
622,004,311 *4002D3C5E64AD6623FDFC2CC57F872DF37DDAF14 B
622,004,312 *4005A3871ADA67B3E9CE947338CAA0E5EA41B03F B1"Y,
622,004,313 *4003F558886D52F280E5856212F2D8BD374E8F6B B;1Ya
622,004,314 *40012B05C85F68FBF0C7879B551A8B00FAA89265 B1Y/d
622,004,315 *40041F509B462824F5C4C000FC00E54BCA2724DB B+1YK
622,004,316 *4009CCA611DA976F7CAFB8CFDC31E153EFFA2564 B1Yw5
622,004,317 *40065347E5C9F2869FACA415F4CCC93B39D7C768 B/1?Z
622,004,318 *400F83021A0F9197E19EFFBC151CB5C65E0DEEAD B1Z3V4L5
622,004,319 *4006FCE5E0E991E52D0F675F95C007DEDDFE7BD2 B1Z9U
622,004,320 *400C58DD6D8B34BAD3595AE1C70A981CF40EE081 B;"(2
622,004,321 *400FCD91D6D6760AFFB7406D3E811FA965CDD640 B2_..
622,004,322 *40093485C60E4C9FDA8B5BBD2CFDEF59AC828479 B2)":
622,004,323 *400977B64BA23BCE052EAA8C22F3CEAC740356EC B2&,
622,004,324 *400A3C0BA76B9ACEB32356B2A161748DFC500CCE B2&;&
622,004,325 *40079B919D6D364CE9CD0BD0E60AA2A0F35F19C3 B200400000000000aaa
622,004,326 *400C985B44ADBE7FA21ED584C7658BB56B3F13E1 b20159ca-2b3e-3b35-becf-bf03a13c87c9
622,004,327 *4004C07DF22922B13B78625DD9BAC34822A68C95 b2087
622,004,328 *400BCA4AF0749AEDAD79921BE241C50FF6AE89EE B20h/
622,004,329 *4005DAD95A5EBC17C726E2E15F73519943DCB21D B20W_
622,004,330 *400E1F1A9028084676A99C6F02CBE51B9F088675 B20wr
622,004,331 *400AB9CE04BFF0C0E5D709E0709AB42C3EF93BB7 b21152812
622,004,332 *400FD66EF24ED220DCA06785CC152705DB532E74 b21487697
622,004,333 *4008BE5259A9B82A79532A7A1E128B1B3C0699C0 B)22T
622,004,334 *4003CC52DFB0172417CA51EDC939C679140C11BB B23)!
622,004,335 *40068FD00CDDC73960E3FA63B524943E68CB0B4F b2358337
622,004,336 *40003F14E9372ABFC98782A50D824EDC8A77C8B7 b23930255
622,004,337 *4007345A9552FA29C0859668018E7ECFA3795974 B23Z%
622,004,338 *400BCA53FC092416B60AC7727DCEAF015B2A127F B?24"
622,004,339 *4001B62435454EE62C8CF31344B3E16A62AA441C b-24_liberator
622,004,340 *400CB0C6D1D92569E7DB67CFE75944CF9C0D6E9A B2"4W
622,004,341 *400F350D395EDF3CE3AE3C98CE924D8E67B85EEC B2505319
622,004,342 *4008261698E182FD888724B744D6E06B25863802 B2:5r
622,004,343 *400278ACBEAA07B9238E6C03BFF85102426FB24A b26267
622,004,344 *40078395A155FCC5A0892D470B66FDDB5D7EF356 B26.V
622,004,345 *4009508AE97BD54DE1723613106DFB5974CFB58F B27&-
622,004,346 *400BACCF1CEF452F056D6F4B65693768CCBDE10E b2702b03
622,004,347 *400101126B39B1CA5FD61434E0040CF5461DC70D B274I
622,004,348 *400FA36CD8B907C9083E5AF603A4148C49B1A11A B!;28
622,004,349 *400DA05A643E1A6F251F8682F48507329CFF5503 B28::
622,004,350 *4002AF2EB23E257F135C2548671ADA990FF5CD65 [email protected]
622,004,351 *400065ED7B9A51989A77825EF1F9DD879828E27B B28;P
622,004,352 *400FB449B8FD15A03EFA7562947B9AF704755533 B,,2A
622,004,353 *4009E544D19967585F9ECA6335B66BB5F0F82B9E B2$A:
622,004,354 *4004AF5825141AED1838DF95376430A46B64A603 B2A.)
622,004,355 *4001F9EDEF6E1D408B3D3148FD8EF1714A86C35C B,(2a
622,004,356 *4009876427F1E180F91F0CFF9E82BCBCAAE93CF6 B2APP
622,004,357 *4006A007DB66ED762C1C83CAFB2DC76FDDA2F6EE B/2:B
622,004,358 *4009B947F3315D522AD8DA6EB3B772F95B570110 B2B\
622,004,359 *400492E3CE0007E0105633155E9E6517CBB02342 B2b30
622,004,360 *40010DF49A3D4DAAE7AA74E01BA1CBB5D8716963 B2,B9
622,004,361 *40096B3DB55C0B5CA03580A752CF13DB7D49AA03 B2bC=
622,004,362 *400AE83AD10CDF1B279EADFB37209B8A23B1D3D5 B2BFh
622,004,363 *4007B69C59CC31DF401EE0C26CC1A0467E7E63D6 B2Bh3
622,004,364 *400AF688C5CA3BB4FC6BCE98FCE1016E11660E52 B2BKB
622,004,365 *40005910F9175E6D587747B18E36EBECC7735444 B2BuA
622,004,366 *400D6C7A56652B03CDA978FD0DBDD78A82FAE5FC B!2bZ
622,004,367 *4005D95463FF87942497CEBCF1B8D746B0A3EF4B B-2c:
622,004,368 *400B7B49D47BF8758E770234D29FDFBA2F5D82FA B2\c
622,004,369 *400ED463FF0B64B6DB60F62BD95AFF6D92C399DE B2c.;
622,004,370 *40036C11499DCB2196242B0B89D2336F7ECAE14E B2cE(
622,004,371 *40018F7E0C862CCB573D0EE750510A693EDBAD09 B2Co,
622,004,372 *400FABE5F8D88735B1AEDAE9510EC46106464BA5 B2CUA
622,004,373 *40002F678313085DC2A73934237AFE7E811D520F B-2
622,004,374 *400492905B867CAEB27E5D082EDD65B4116833EF B2DBQ
622,004,375 *400D3C56EFEA7A637B10695375AA3E77DE54F0EC B=2dH
622,004,376 *400CCAA1B614C3B33A9EB631BEF5A1BAF4BD7F26 B2e29
622,004,377 *400F73C19304693A548916A7403877EBBE612E71 B/2Ed
622,004,378 *400D7295CD59541E81D2C80AF8B727EA24E73477 B2Ej!
622,004,379 *40021CDE8D31CE88FC1C354ABF1A5740573DAAC5 B2eNE
622,004,380 *4005DCAD2E7AF40B2B2784B31D46EBEA56DD90DE B2EOM
622,004,381 *4002ADCC28633D614706C2A99392A2764CE9EB1A B2e"s
622,004,382 *4006FEE5451465D17D45C0C3E335E82AE187EE72 B2fEc
622,004,383 *400188B4869B87F0D9DAC7C9FBF92408F06FB5DC B2FER
622,004,384 *4006D1F97A2030A3C016BBB58C54033FE5E403BF B;2Fo
622,004,385 *400DD19A64C537864D90F6BD7DFBFA583A4DB40D B2(FV
622,004,386 *400A70F9192E6EA2AC8C9B90160CBCFF585999E0 B2fZ4
622,004,387 *4001F6A109BE657FC414D87AADFDBBC986368A57 B2-(G
622,004,388 *4000A64C5C7548916BF21CBB6DD0D789362D7CB1 B2G$A
622,004,389 *4007F73CA763F9DEB6127C73A66DBA0D6D0EDD8B B2gYb
622,004,390 *4009D1E2ACF2D3509062C4A8905FCDD17797DC5E B,2-H
622,004,391 *400877AD6EBF8668A4FFBA532A88A9AA5A049C77 B),2h
622,004,392 *400180DE627A05389C9B59029FB858F3B7B4F869 B2h8g
622,004,393 *4000B7FC82A5BB1369A148FA84C48A3EFC7E1477 B2H_e
622,004,394 *40011CC76611AD6F73E8D09FA2555315CBE4B9F0 B2H=i
622,004,395 *4001581D478096278168A7E1B910DEB5F981B3E8 B2Hva
622,004,396 *40054C2C88130DA56BCC7F0CF4BD533133D24CD8 B2hVm
622,004,397 *400A5DF091488FEEE5B7A6F63FE40D7C2EF4E8EA B2hWS
622,004,398 *4002B01D9E0068D1384A5941D59185E32EA34F66 B/2i_
622,004,399 *400FFD1F304123C04E7C24BD6BEC7D47E714F6A2 B2I0h
622,004,400 *4000150C5DF73934E879DFC47D292573937EABF9 B_2iF
622,004,401 *400D2F4CC20EFA7B20E37ABB826727BE152DF626 B$2j0
622,004,402 *400D4C26DCD825EE1111984FC9D57B3CA16DACC0 B?2jj
622,004,403 *400C71FD37604CAD75604EAEE3DBFEF5AEF8D1DA B2"k/
622,004,404 *400A71377273FCA76D4DDF7CC4F22D2569C3FA53 b-2k
622,004,405 *400CA958D23A51D737B3125F793C13FCDD942726 B2k8M
622,004,406 *400656F626ED64C20CD48EC37E52A37330E4A1F4 B2kCa
622,004,407 *400990183FEC8E2523D87C381AED8FFA1CB73876 B2kDs
622,004,408 *400760D80769A01F4CF0FB8CFE41CBDE7039CD43 B2kGB
622,004,409 *4000A9F4A190B994A397CDC183952213EF21048F B2KjX
622,004,410 *400D52CC81A06F1373B98A60A9D28955B713B12B B2K/M
622,004,411 *40073C67D48A0A54E90BF878EA39892BC2181BDA B?2L4
622,004,412 *400C7CBAF7D1410F9C80D5842AFAF62C9549F22B B2l9C
622,004,413 *4004DECD7FF5625C50896488E6FBED5646A6ABD4 B2&lO
622,004,414 *400F484101657748040D563EA1E7443C49EF64EC B2-ls
622,004,415 *400561CD7E347B51F84F217A65AF7FDD92963184 B2Lt+
622,004,416 *40069A6C6BD4F5446870C09C7198710163FF71AA B
622,004,417 *4009DFA22986778D636349A9360968CEA54C454E B2"NC
622,004,418 *40076965179B386DADAC52015D2F53F2616F8D44 B?2nf
622,004,419 *4002D186E0D2D4B44BEA88903DD3C2715BED89ED b2nq
622,004,420 *400A3E7A7033EEAC334100536A60C85F9DC7C7F3 B2nwb
622,004,421 *400B478DDB03394CC969BF58FD089E9162298AD8 B2O="
622,004,422 *4008A6C5BDA04A8D2E673F5EDB0A38B695DDBD03 B2o5&
622,004,423 *400A90ED23EBDC70804242064167530D9B4CFB8E B2#OE
622,004,424 *40083126D25912BC7319315879C693AC44615698 b2oW
622,004,425 *4000955CF2B4C479D02E50BA1AEEADA508A88EEE B2P#A
622,004,426 *400634AD03A716C33004E850CB5557476236D17F B/2PI
622,004,427 *400C84A88C5484C360E7DE0C875AB64D75C1D245 B2.Pq
622,004,428 *4007848723EE472F89B51F43DA77BFDFA1877D04 B2_pW
622,004,429 *400884F154392E96F81E359D10A58D7BA52D4AC1 B2Q2L
622,004,430 *400602C8BEADAD699E46FBB05CFA07388C08F0A3 B?2qB
622,004,431 *4002B8F047DB97B92C73F8649E79E60027AC54BC B_2r_
622,004,432 *400627D866B48335E337B688F7DE44FEE4013176 B2r.)
622,004,433 *400753FCE2C63CEED2E51DDAB39E4E83AF86460A B2RA=
622,004,434 *40051EE515AF976A88DA7E361A32B14EC6B0FA41 B2Rd=
622,004,435 *400A6B5C1BA5DC7AD1FC199DAAF9C94955EC74AD B2%rd
622,004,436 *400AF4CAD8F5B443A5D43D92484C9BEC09E1E90D B2-rH
622,004,437 *40094041C9B7F2053A43EBF5820E119E2FFD7580 B2rNP
622,004,438 *40091E28812FCA0B6D79B3E947B564D03196D640 B2S)9
622,004,439 *400E2C965D2146D9B0A003F0828B5BBE78F07901 B2S"n
622,004,440 *400B2DA4900EB63FE99403E635C62AAF6F441381 B2$T5
622,004,441 *4003B92A49FEBD66BB836DFE3DA54938970DBBB1 B2t5L
622,004,442 *400CD8027A16A5DD079C8DC99B3151C208A779D2 B2:_U
622,004,443 *40077C18D8F0759723AC849C8B0EC1AF42383D01 B#2v-
622,004,444 *40066AF80BC58E149B654A7121F95F857219E8A5 B2v2W
622,004,445 *4002BAB9AAE612665CAA6F498E9D57B35B93518E B2vkG
622,004,446 *4009ABB3EACCECFCD66569D1859AA20973B9E0FD B2,Vt
622,004,447 *400AFC21406A20157E2B5CAB384CE15192260001 B2+vw
622,004,448 *4008AB3687B52B29034D0A6C3CDAFB6129F0096F B2w4d
622,004,449 *4005CF589E53A6799A01FD64F602D1E1AFD3C1EC B+2wl
622,004,450 *400C813F075AD0C759BC00A53DE30F61AC74C9D9 B2WmG
622,004,451 *40040BDB791949D090C44A39FFB599A4BF1FE47A B2wOp
622,004,452 *400F996D369F01AFD650ECEF31C75833D6D26A52 B2WvS
622,004,453 *40099CC58CA7B3A79FA5814B63EDE0AB046CC6CC B2w"W
622,004,454 *400764537ED2F1CF16A74247022E71DCD4F95793 B2XNW
622,004,455 *4009B0863D6AC7869CDD967EF6DAFA650071ABF6 B2XT7
622,004,456 *4006C273366FD1250DD8C8CA25C56622D08D2875 B(2Xv
622,004,457 *400B811E1D05ECA9DED8E23A42AD436E24AAA70C B2%#Y
622,004,458 *400CF5B2722F439E7402BDC5036FC9D82F2A3768 B2YqK
622,004,459 *400FDEE5C4AA3CAA3CD0C26F48BB9A0795376424 B.2Za
622,004,460 *40085189E894395FAE663975AB940A9EAA982758 B:2Zn
622,004,461 *400A639A13E4436DD7DE388805C70C2C539F6E99 B=%3,
622,004,462 *400B4D1D73CDDAC0A0817B7B49D8BDFA59B8080D B=3/+
622,004,463 *400545A3D3A284D0BDAAE39B147EEEDD53A589DE B/3&_
622,004,464 *400144F0747302BFDBC6D57A237D523178946B14 B.3/
622,004,465 *40036DF2E23E11E881A407F8A37187DD0BCB7766 B";(3
622,004,466 *4002F4F31346CC068AC4F8181BE2FF783EEF8B93 B"3?$
622,004,467 *40013BCFAF20A9F891E7A0F9ADF64A7854BD6264 B(3,=
622,004,468 *4008553EA66091327B36629730E3E1598A0493D0 B#&3=
622,004,469 *400A17AFD55FDE694BAF24296C59FBC721F5E099 B3+1d3d
622,004,470 *400FABE9F3664C7222D5EB037538ED69E65C9090 B31Fb
622,004,471 *40082BB134F3626BB1C6878690C7E98715234620 B31o$
622,004,472 *400AA7D5DAE9F7C3A8DB44C8C0BD91B2929B453F b31y$t3$
622,004,473 *400F4A648CE830822956FDF7EB0C718A4442E27F B=3)3
622,004,474 *400F0AAD60EDE6E6C615A6A6887ED195ADD9F58A B33cM
622,004,475 *400DE1E1ECA90B874EBB584BFD5C4A2FE1875626 B&3
622,004,476 *400A8B24CF15FCDA690F6CB75A1B3EC8106DF793 b3412659
622,004,477 *4007A345DE18FAB66DCF8E5147C1B75207591506 b34346f9-a795-3daf-b4bb-6d5091bb8731
622,004,478 *4008ADA27AD5B0E4031190E5556877FC8A680791 B34l0th
622,004,479 *400008AC220D212AA9D62E090841C5950620C989 B34S+I3S
622,004,480 *400DF700DF16B4C9FBE755098867517E09F93698 [email protected]
622,004,481 *40057425EF580C5F99D4BE42B6A38F70C4735EC0 B35nK
622,004,482 *4008FB763113C23D9A1EB85A2D9031604A86311A B3
622,004,483 *400E54C76705555AE1ED3315557E4B3CA4CB8120 B35rj
622,004,484 *40042C54C5EB77B0002FE82CD0D0022E20F4BBBA b36337
622,004,485 *40082548C285033772D14AA250867DED3B271161 B36f2
622,004,486 *400E151B2D5C7DD416B55E3D7740EA0611600AAA B3!7;
622,004,487 *400630FCF8FB2293B0881C59EFC693E7EC85B4BE b3767
622,004,488 *400FBB712EB73E9B9E2E0E178BC6F977F84375E5 B37Gl
622,004,489 *400F82E40985E53E9A4CB704E02AF97694A780C6 B+37t
622,004,490 *400F76A0634F5C982F39783C51A4A3197FCBDAE2 b37w
622,004,491 *40040552F6019E840041A792C09FFFFA0E671BFC B,38-
622,004,492 *40052275CC352E8AB4A99391B4220FBDFE0314A7 B387r
622,004,493 *4008B4E87E49BACFDD9CB521D0ED2C4B1D9B0F25 B38d
622,004,494 *4004808EEBC07C0A0EF6D31F5313AB41ABD91D26 B38p0
622,004,495 *40097D3C57667016C3A3CA8338C1DBC2E6672B01 B38q
622,004,496 *4007C6DB78B9643463CF27CBA328E587680E60B1 B3#9?
622,004,497 *400C37EFFF16419B95A45FBD967352EC80FBEE33 B+3A$
622,004,498 *400449FADF275DE55452A0A450EFC456FB87B2E1 B3A$:
622,004,499 *40027902E280A42C9CD35F5F17167034B9B9A293 B3a%D
622,004,500 *40093BE1695DD9636C6F082C5DDB38647077F8CE B;3Ar
622,004,501 *400176B081BD12E504AE0C87F4260C03BF42C2FC B3AYo
622,004,502 *40066D829050B3EA2007751C92B87B02C45F18F0 B3"+B
622,004,503 *40094ABD4A8F1785BAEEE3EFC615CDC1076ACC10 b3b3r1c4rlh35
622,004,504 *400A5F0F53F8E2F4F55251256B13C97DFF0AB4F0 B3Bn!
622,004,505 *4002D556551D4DF9C568924B62A61A23D6504A1A b3bytz4mumo4s4
622,004,506 *4002A5FE247D08D3A7ABED9A33715CA8B742E63B B:-3C
622,004,507 *400B1C09927C3DEAA3C8EEA305D7714F82CB3575 B3C331
622,004,508 *400BE65F3449881B3999EBDE0488244B566BCBF1 B=3ce
622,004,509 *400357BA318A0CD6DA39BF351618B3684D1E28C3 B3#CL
622,004,510 *400C99A8023D0381DB9F461C1C0242B6605B5747 B3c+o
622,004,511 *400D0CB4A4FCE1EA857C119AA6BDD3418952A9DA B3c#R
622,004,512 *40069825DF2D4BA620326414DEB68024786CCAC6 B_3d/
622,004,513 *400D1CDEF8D161A7DD99B9AE2DD3718DDEB1F84D B)3di
622,004,514 *40045EB72A9BA59784691075A9F0F5676E3D8E48 B3DIH
622,004,515 *400B055ACAEF8BFBEDF6242B1B8699441A4D4898 b3dman
622,004,516 *4002F0D2E55BF3BA21A0062C6DE2EAB71A9633C7 B3Drl
622,004,517 *400E9B57C4453432DF80CC594822EF7D7CB9AEE3 B,3e5
622,004,518 *400D2BD1347163E4E7D1BB7C115788A40E1099DD B(3EB
622,004,519 *4001EE4B976DCC81A43D26EE201C802502653F79 B3Eo=
622,004,520 *4002D9081B4577B113A34DCE1E46D629CC6563CA B3F:?
622,004,521 *400F254F45106EDBF842B7FE81436D9E0A2E30D4 B3F6P
622,004,522 *40045B90958C4E4FCCC4EA1E5DF2596410C6BF5F b3f72092
622,004,523 *400A067D127E215F1489660D056FA2613A54CEB3 B3feR
622,004,524 *400BCD88A757B9904166ACA0A6A497AE953B016F B.;3G
622,004,525 *40014320E7A647CBCFBD178C3DFACF5A01E48B9B b3g1np41nt
622,004,526 *4008C00D2DBF81D9A483A1BB9148219269E0FED9 B3G3h
622,004,527 *40039C6EDDAA75DE450A3E905FF85A443A3A14A6 B3gi4
622,004,528 *4000D4F187FFB9998ED1E01FB0241D693250CA4E B3gLM
622,004,529 *400D29398DCC4677954CB6013F958E4886E81EDC B3g.m
622,004,530 *40096EE190684A2F2257D93A7013A69DCF93552D B3GU&
622,004,531 *4005426FB2EE747061D2BD4FACB6C0582DCFCA9C B3gvt
622,004,532 *400479E783B491C416FE846BE459CC94918FD3F5 B3gX%
622,004,533 *4007437ADABD4DF46CFD4C820DC924DB525DA39D B3H+?
622,004,534 *400B0C33F0CBF60E4948CCA85AF55C4644830492 B3hnm
622,004,535 *400167623079D643D95ECAF8E9B0905AB4079FBC B3hor
622,004,536 *4000018AB1B367785F2B533FE341270EB4560C83 B3hrZ
622,004,537 *400C73362D00FD25908B781DEDD5E7714276ABB5 B?3ht
622,004,538 *4002EFC47302FD0295FD67CACE5CE9090364AA92 B3Hw
622,004,539 *400439C78E7D9C3257CBDAE05B86FAE13F7F229B B.3!i
622,004,540 *4004B73B747ABE92878F4E7A1E261A4171690824 B3i+,
622,004,541 *400E46FA0D77B909D42784F128CAD41A57618EDE B.3iB
622,004,542 *40037E14EC0F12AC11A9B0B9AF486638F352B294 B3IeX
622,004,543 *40096F6EDB9EDBE33830D568DD9355F76805A22F B&3;j
622,004,544 *4009287A8DB7FDF65FF5E6CA2C7E375E40ACEBD4 B3jM#
622,004,545 *400130FCEA7B9DE5027043B6568F666F5DA60A35 B3/K!
622,004,546 *4001C8AB0134A6696318FD9385BCB8E0316AD71A B3
622,004,547 *400045DF08E6BDC54E62A9FFE2AF9A6B89684CDB B3kQi
622,004,548 *400E6DF0E44E07973C168F7447B60296CA5F763A B3KqQ
622,004,549 *4008031835BF46141C4DB93B643B6872802E64F4 B3$ku3r3$
622,004,550 *400A650FBE35DA4EA9372BE0A384C3C5712773D2 B)3l_
622,004,551 *400F6FEDFB2D21BED6DEB2D748BEAC4AEF08A096 B3L6P
622,004,552 *400AAC94DA1D99DD3406FDED3B8B6B474FB211BD B+3lh
622,004,553 *4009CB23B31EB9D2EC660CBA34AA15C9EA6AD0D3 B3lKr
622,004,554 *400CEB0DC7050AB8DD1C601C80A6787787747C92 B3LT7
622,004,555 *4000FF9A69AC1CDBDADA6557CAB3DDEC9B4580A3 B3L/v
622,004,556 *400B54207E638BCD2DDBA45E4D3811098A67519C B3M1k
622,004,557 *4004A0FBEDD63EA218913B39B59C8A0989B1A8C4 B3mCn
622,004,558 *400A932D224FE06338668D06C1831F61321B2789 B
622,004,559 *400BDEE72D8129C7B96FD22A5669F306FC65CB43 B3n3d!c+!on$
622,004,560 *400FF4689FC97AEE43F91A93787DD5079A171596 B3nEB
622,004,561 *4007BE5299681D10DF756094DADD02D88537EC1C B3New
622,004,562 *4008351EF463734A14806DF91D1432A2283173BD b3nsono
622,004,563 *40008D74AA9B65C997945F430A427124D04959F1 b3nt0nitic
622,004,564 *40047F29A0A80EF8F00DF626AD4E7E65A978A999 B3NwB
622,004,565 *400DD855D6054D3D8B251EA2BF0BE439108719C9 B(3
622,004,566 *4001E1A50E08C4C358036198A2875EB4A98869F8 B3$O#
622,004,567 *400CB70689C34FD53F03B1061A126D0D73D6E27F B3O$,
622,004,568 *400A6E4E797ED48B6521D0B31FF37F4539798986 B3O8I
622,004,569 *40048A253FF08D949368482E1ACD8087D8549DBA B3obW
622,004,570 *400EF00A443DD14EA9E071FB10AF42E790C06969 B+3Oi
622,004,571 *400F535B8C0B7E4AAD0BC79FFFC5FA98CD0F3EB9 B3
622,004,572 *40044D60E62E436F078927945420C4CAEB6A86D8 B#3OM
622,004,573 *400533D0A7448EFAA412B2529CE83789F35B7690 b3on13
622,004,574 *400ECED2DB2C3CBF1B521AEE3A3E7FE757ED09C9 B3O"W
622,004,575 *40064723031A02D819E869BBD87ADBFD2089C95C B3:$p
622,004,576 *400B1D614EA8470E72ADCA20960C506448359967 B3P4VFK8K
622,004,577 *4007A8A7322466889C6EDF4F51B55D7C30380271 B3PIm
622,004,578 *4005F1D8876601134C609CADE878D5FD0804FD94 B3PN-
622,004,579 *4000C9B5F8090C85F46F3A1FE6B4CC5234904CA6 B3pvo
622,004,580 *4005A0578D58F6AC92E86D961D89C366F1AA3C76 B3;Q+
622,004,581 *40021A8490BFCAF66561B716014482D6612EA12A B;#3q
622,004,582 *400B63E5B13C6EDC2EFBFECB553BB165C3CE3C30 B!;3q
622,004,583 *400EEC451DC616059921160CC5F3AF71A0B73104 B3qEH
622,004,584 *4008F3E38E1B2654081408A4408DAC84700A5964 B3Q_g
622,004,585 *400A6705387103A6CA4EC291994A4534141D04DE B3Qim
622,004,586 *400D6A3EA7F6A22DC688E9CE06A2FBEC8AADD609 B3qtN
622,004,587 *400317A5BE42695C0120EDB3F3E34B8B3F06ECEC B)3/R
622,004,588 *400948FCBC21FD78CC07889BD4F09953DB92BE96 b3r1gg13
622,004,589 *4009DDBB62813F967C02125D074DDDEED2C5D7C8 B3R&2
622,004,590 *4007103D4BC7AAEBFE61DC7F6B10C1A1E1C06F09 B3r34vin9
622,004,591 *40083635A0115590368B1CFDE72C8D4DF79804CB B3r3C
622,004,592 *400102CA6316FDD7DEFE8D21D74BC3EE29882742 B3RdH
622,004,593 *4000BDFAE62B2CA1C5F4C3C8455F23B5ADCA67F8 B3rFf
622,004,594 *400CD28C94732A2FB71C6E282B9590B2B65458F1 b3rn4rdckc
622,004,595 *400B89228D2668E3FF52E290F22E767DF7BAB1D5 B3RRl
622,004,596 *400CDD92A1BE5B07B7901375927BD49A90F813FC B3!SB
622,004,597 *4006390BFEDDA5FBDDCC71FAD3516656EB436BAF B3+Sp
622,004,598 *4007F560D2F3F71B97BEB2E40490DF6A3FDDE2B3 B3sv&
622,004,599 *400ABC4466F4C4C943F9682F8858346DF501CA9A B3(T
622,004,600 *4004B8C3E6DC73C4E5E4C5342707D2D8BF587DC5 B+(3t
622,004,601 *4008581F8C60C84361933BDF6C551407FFDB80F6 B3t6
622,004,602 *40079966537C3CAD1F3DF0067A707238B54B6866 B3t6M
622,004,603 *40064D9E2FADDE8DAF69D95FE2788550DEB5B1B3 B3TE3
622,004,604 *400AF8257DC91DF336C019E80CFF7CEA6928AC7B B:3TX
622,004,605 *4006271A0131A888A62846EABB436C598C5BCC53 B;3U2
622,004,606 *400579DD2A3F1612F57DAA7601A5CE2175912DAF B3u+6
622,004,607 *400B5B3383B912DD0F054BD8B48D57F02615EA89 B3U9G
622,004,608 *4007F20D56132EC69E7A72BBA215CD19C5BC83A2 B;3uk
622,004,609 *40020C204560D59BCD7AC24F57F0206CEE9089DD B3V%"
622,004,610 *4001AF6DAE9F7530ECCF748CD6AF0EC1E9763543 B"3v!
622,004,611 *4006250B36959B422CAB88A677BDFD1323617AF7 B
622,004,612 *400C6CCF09684BAD290068B7181A9676F7B87B64 b3$v
622,004,613 *400359CAC844886E8C825C1BA0CE0E3ECF98BEB5 B3v9Q
622,004,614 *40099DC5A7A4D8EA57102FE4EFCA3D5A9A2244AB B3vdc
622,004,615 *4003EE23FDD2751A63ABAB55D4937773070BC312 B3vX(
622,004,616 *4006816AE951FB5120D13E3D662F1BAA795C6859 B3w3l
622,004,617 *40034FB616AB8EB8ED37A38D54BF949B3A719493 B3
622,004,618 *4000EC083B457E7D2DC4C195B927A14CCE68CEF1 b3wray$
622,004,619 *400EDCD48C7AE5B8FFF06DA510D2EB525D6BF92F B3WTb
622,004,620 *400875617EB04FBEF494C2A0F217B6890130166C B,&3X
622,004,621 *400BC4A449BC64DED3F950FC77A05589CEB4B0FD B3Xn
622,004,622 *400E28EA098AC64001295F5F3460881C001D8EF8 B3YBf
622,004,623 *4000AA8410B77F6153982515D8A36DB45B04CBBB B3Ybv
622,004,624 *400F5D96196808A02F5A35C15C6626FC41F3D2B8 B3YF
622,004,625 *40049BF8314E9DE3E5FDD7DF4DDA20E51E7BD307 B3Y&M
622,004,626 *400413F7FE78F70F6C550CF5FB6FCB10CB0E19DE B3Yv4
622,004,627 *400B73E3A5FB01C598DD2D072898B8DC430DD6C7 B3ZZf
622,004,628 *4001C03DB90286F88037F7A8CB6093216E201FB2 B_.(4
622,004,629 *4001474339C2B6D122A39E46FD573AF57546FBC2 B:*4
622,004,630 *40093939C4A3A2BCB860D32CA2EFA7FCB0F192EB B:4_;
622,004,631 *4000575DAAF351407CEDAD7BD295E53FBE5E8E77 B/4,:
622,004,632 *4002605533190D5576D04BB511730DF24B340F56 B.:4?
622,004,633 *4001AC0CB757B26A8A39511CB90AF25706D9427C B#("4
622,004,634 *400AF1B0921D572C335099242BC400BC8B6C06F6 B#%4+
622,004,635 *400E0F76BE56D2E9E6C91481205F6F61FB550D6A B#4%"
622,004,636 *400FE8CC9B59A82486BB49FD36EC471B9E946E83 B%4:
622,004,637 *40083C265949723BAD3747BECF0020CDB19FEBF8 B4,(_
622,004,638 *400E6E5D4300731CB26A8848A681578FFA38D877 B4/?:
622,004,639 *400EECC2D8E1FDD6EA0859E133B229EF54EAF246 b4(
622,004,640 *400911F8E8E9E582D599EB59F7E44ADD6783FB43 B4!&0
622,004,641 *40052F5978478E115E0DA66830CA3E3AED23A761 B4097
622,004,642 *4002BF060150A1C1D809B2EAD05372CE37B0FC2C B40e:
622,004,643 *400B9D258097C8F992DB77B424244E9D6DAF813E b411p01nts
622,004,644 *40017E9CBACB0FA6D4840FC604E2E226FFFB4E7E B41d#
622,004,645 *400242ACE310A63195D839F335DBC0B2A1F74A8B b4++1eship
622,004,646 *40061DBEB9EE0FE69731F64F8FA706A8918A80F6 B4!1EY$
622,004,647 *4002CC13EC7A485273C02A11BACB22161DDF96D2 B4.1F
622,004,648 *400578FEED1DD000CE046E29C9FF45844FCF3445 b41k135+
622,004,649 *400E97BF460F8DD6B8ABCEE2F28907FAFD6B11E9 B41Uk
622,004,650 *400F7AB09A8AEB7E0DCF649192A68445F495FC4D B41Wh
622,004,651 *400C2DBE34E714A5A27583C0A0204928E722DD85 B#42_
622,004,652 *400507BE52A2074805689AB9DB7C29BA86D22C67 B42+"
622,004,653 *400A58A06E352374DC7086559721DB3CBD5B2B6E B;42Q
622,004,654 *400E8B5E5857D0BC692F2FA3293E6AF31F61207A B42U-
622,004,655 *40002BFDFC4906A5BAAE3C9A4283C4E85BE9D4BD B43:b
622,004,656 *400CEDBE66D6FB3E1D3D5668B8EC64248C35D56A B,43f
622,004,657 *40074F6333DDE6D1885300E566F487C88F07F8B3 B44WP
622,004,658 *40056E8384C11151DB93C8BA204AAA8C01D3289F b45208
622,004,659 *400B0A39C686E17D62DBFDCB75BE7B01ED9C0433 b45896419
622,004,660 *400B68DCE61DD486F7EF546FB99C692A559D9E00 B45A5
622,004,661 *4006CAD473BE76561F91CD6E45AE8D507374B9FB b45ifi3r5
622,004,662 *400414F9475E3256C088E56BC0B340D4855CEA1B B:46
622,004,663 *400F90511403628C04F1FB95317578CA88F13EF6 B46NO
622,004,664 *4006D6C3529F64EF131E4EE0D14E49735D12CDA6 B4=8:
622,004,665 *4006959385D661BF0C90F87DB4714176C7C0A24F [email protected]
622,004,666 *4002EE12AA083131092AE9DCBAD7DAC028F318AC B4-8t
622,004,667 *400EE13EEC4972E7FFA04FD3576EA843CE469B77 B4967
622,004,668 *400FE41F4D22FCF02448B6BC78366DEEDE2E2C61 B49aX
622,004,669 *4000908D1775DCD8DD097D47AE9038C0ECAC4C4E B4"9G
622,004,670 *400AA14C2435C32DAFFC493AE9A637285EEA2B20 B49I#
622,004,671 *40054DE594C58B35F5DB09903320095D5AB13B01 B49j8
622,004,672 *400953FB24CE7A50E61D604AF11630A30DE7F0BB B%4+A
622,004,673 *4007D5315548DFC0458ED01ED455F1C84DF478D6 B4#+A
622,004,674 *40036C1C2C017851C425304080D23C50894C0781 B4%A"
622,004,675 *4008FAA2D14FFBE885ABA2050CA4C2917EAC6948 B4A(%
622,004,676 *4000C768628943B247C88511EA34E788BCC11197 B4A5G
622,004,677 *4008CDCD310D70CCDD6340CE497FAE61F8283B56 b4ad2c58-bf74-39b0-9fd9-0fd0fab2e507
622,004,678 *400EA7ABC907980B31FCB24CA7906B6D20E4EA99 B?4Al
622,004,679 *400CF2CB46BFA64DD08A7EB2C5720B1DD5CE3869 B4AM5FMSXVOLBRTK
622,004,680 *40020824EADE9B5699F3B7497305CDB84A6E0940 B:4AU
622,004,681 *4003907BEF352961C2C8354762626D4D1C0D7705 B4?B2
622,004,682 *4004542033C902DE7BDD22B70396FCB7BC095EDC B%4bd
622,004,683 *400475A5E36FD05E3EB418A63B4E29ED0A06AD63 B4bN+
622,004,684 *400DA6315DA03CE20A716595A9EB3F9322CDEE74 B4b"s
622,004,685 *400E41D70077974F48EB02ADDB086A7A39E473AB b4byl0nite
622,004,686 *4007C7C3B07DA64293CDE6BB371BC9F9C5F49824 B4;$C
622,004,687 *400A8440D179C48CB743E951ED68046C03C0C57B B4!c1
622,004,688 *4002D2882B6183E23F2883DDB33C7AC9BEC1DBCC b4c3r1oc1d4l
622,004,689 *4008C46AAB8811C427B38E6570F1B1EB1920065B b4c73r1o1o913$
622,004,690 *400E34BDC923EB121625199D979834EE5EB9C516 B4c73r!oph493
622,004,691 *40018BBBFAA1B593C5E388A2E531E39A6A03E9F2 B4cter1otox1n
622,004,692 *4005EA02EF887D3287D4CC9E704F14F420965D15 B4D(
622,004,693 *40031C533E7CD635475A050F79B93659A4CBD527 B4d#O
622,004,694 *4001E532D7734B09E1EFF6E1FA9FFF9C0D909822 B4=Dq
622,004,695 *40016C1A3247801B7ECC66C71FD1E8E8C8B0FF19 b4DUS
622,004,696 *4004AD0C5614A62B94E35F0314BE5F1C2EC294AC B4e",
622,004,697 *4002C0A06856EFB6FD73AE5A10C79BDA36D72FE0 B,4Ek
622,004,698 *400F458CB64785EE54FC8E40D53A2E2770377FEE B4E
622,004,699 *4005EE4CF2032C30AE14B63790B393A5DB2B498F B%4!f
622,004,700 *400E369C0B5DBA05A0731F74C593BBB38E8983F1 B4GA!
622,004,701 *4003B552C113C9684A6521065C847EAAB5409749 b4ggin355
622,004,702 *40028DD5EA4C2920FA3A402E9D6ACB8E52891B1A B4-Gl
622,004,703 *40095FF3C156FEC62DB9344A3FEFD3234C823F98 B4GN!
622,004,704 *40075B50FD3E13F8869ACB98243BE914EA4701F6 B4GP1PERS
622,004,705 *4002831670D9E5D6F1C11A07B38FEFE802C59CDC B4h1L
622,004,706 *400E08C31956C38389FA1C5D54A29B5AA7C80610 B4h8b
622,004,707 *400B57DC3F15AE9257834D016AE0449BB72B1FF3 B4h#G
622,004,708 *400EB927F40D5A1831241B80D2027B22BE1B190A B4%HO
622,004,709 *40001E1D8C53968AC9AC5AF1EAEF0A896A09475B B!4ho
622,004,710 *40093BACE760D0141840D8B3A1569D7221AFC049 B4HSe
622,004,711 *4004110B439E0B76A1D9DB9DB6301A3E1D3473CE B4I0I
622,004,712 *40003D6AC3AD7B372CF37173AD40E1C0CB5A00E2 B4I3%
622,004,713 *4006FE42498F8C6A106A2938F0C1FD6BB3BCBADD B4I5L
622,004,714 *40083BFFE90EA4D040A54F4C1ED7B9A951843D19 b4ign3t
622,004,715 *400F98546A0F9E25D9ED0523A7366E84F0468D36 B4I:n
622,004,716 *4000A8C5CCA632CD0A976C113FA04792E9863828 B?4in
622,004,717 *4000CC72D49591AB44EC55C33A2866EDF9F8F487 B4Io7
622,004,718 *400CC3C9CDCE1E09B6CEDDAF0AAC970B1982E262 B4itN
622,004,719 *40044C5C6230AC6B35AE40C44459339F21B6EA0D B4j(,
622,004,720 *400BD4D56F6E8FBEE32F5EDBB58AC38BE7796D74 B4J1O1E
622,004,721 *400BD597DBA263841851F2EE1A66ED274AFACF0C B4j3S
622,004,722 *400080506F44426D54A314AE1D7DD214A22614C4 B4jBa
622,004,723 *40050C7DE27193D4511518B036CDC1AB47DF4D66 B4=kk
622,004,724 *400F5CF1FAFA2CB01CE12DC875CEF7E88BA3C415 B4k/L
622,004,725 *4004EA78391F12D67DC7EC705673BFE556AD092E B4KML
622,004,726 *400FB4CCDEED6295F2274DC89DA04CDD80234994 B4K:p
622,004,727 *4009915A70D26AE299CD5921639D915DC0F7757D B4Ks7
622,004,728 *400F8AA2AF463EA29C6AA64951B37D946CC962FD B=#4l
622,004,729 *40036C70D1BE380E48D22589E7AF2918DD94D3C9 B4l_,
622,004,730 *40068773202B4FA4643753DCBE668B491966D5D3 B4l4nced
622,004,731 *400D6508AE85E3F3B8735A98AF4C3B7FF589F95C B4l68
622,004,732 *4007F075085CB7C6DA514B5F3B8236348D3BCB3C B4+lb
622,004,733 *400D4CCF20E8539BE0193963E87AB806558D3855 b4ldp473$
622,004,734 *400D199E50C4CB64B2C3009C4FF6B7C80A6EC50E B4ll9
622,004,735 *4001359D9C03F2D8A34BB14898D6A792F1DD50D5 B4LMIE$7
622,004,736 *40021153541F6DE9BAFF04DBFF67F4D9D7034DC4 B4LZ/
622,004,737 *4003D2477CCD0F308B4A2ADB039F07329576D929 B#/4M
622,004,738 *400A5BEADEB8106065582283B322AC35FE3E16FF B4_m6
622,004,739 *400DD8BF482E3726593FBF3EC77597713C4923CB B4M82
622,004,740 *40036E3AD0AD6F5BB562A5F6138A7DAB906A426E B4.Mf
622,004,741 *400F33BCCE31BFBEB1FBD06235513276C81C43C6 B4MkH
622,004,742 *4002A6F2D8AF6E2A68F2AFE24862EB116277CFBD B4M?L
622,004,743 *4007EEE5E0A429BB85905B9E7EAB35D4DB45D944 B4n..
622,004,744 *40036A617F179F81A052D17A48A6A8F7346C18B4 b4ndn4m3
622,004,745 *400511CF80B12F33322236742265A62E7945C9D6 [email protected]
622,004,746 *4003B9D2170CE3F2A3695A80988CFA51042067EC B4n!$hm3nt$
622,004,747 *400C22A128F2559A421DF54B8DA0002FF8486BBD b4niloi4s
622,004,748 *400499318A03C2CED7BF8C992E8DA9841169F475 B4oCq
622,004,749 *40035E3AAA130CD22A82663AC27595903D54F7CE B4_oE
622,004,750 *400D9A01F2848A8747570A7821C57BC011E8284D B4o:k
622,004,751 *4002059FD388D5C12F4176D4D3FA5CD099EFCD57 B4otM
622,004,752 *4000996B6AAB20328BD9397D805ADFECE3C5ECD0 B
622,004,753 *400A28156E0603424D77403F37EE61BD24B96EF9 B
622,004,754 *40076EF3554AE03B907FE2AE213DCCBD93189DED B%#4p
622,004,755 *40023E783F2646FC51C8C7B08612FB47C2A6EB9E B4?p+
622,004,756 *400BDD9862E09ADDD757E5377F534F318EC1AC12 B4PdN
622,004,757 *40071E275350F54F25D698AEF511BB073459C2F1 B4phq
622,004,758 *400898E87503D0E721647B8396137DD536196774 B4
622,004,759 *40089D29F0402D35CF66A082A8ED3F59E30A8691 B4Pq_
622,004,760 *4007D2EC77DC764999DD1A830CF8F38E308D6CCA b4pt1z1ng
622,004,761 *400B916CED2F68FB1CCE8067AAE67A3554A1FEE0 b4pt1z3s
622,004,762 *400420CCA0961BBB655F71F95CFFA083A6F020E7 B4Q=
622,004,763 *4003DB29EED7774AF53AF6C9081D4CCB682D8433 B4Q"_
622,004,764 *40063A94C2514B44003BAB7ACB54B6933D0F3B42 B4QdQ
622,004,765 *400DBADA69F0C734DE95D4253F1D888D07C98015 B4QKq
622,004,766 *4008EDF41A57AD4AD0EA35ADF9B4D9258655C000 B+4Qo
622,004,767 *400E1058D5870743290D7AD0D2B2AA0B52C0BD69 B4qp&
622,004,768 *400240CB17C3C52391C74F937A010331C7C18CF1 B4QX;
622,004,769 *40066FE4245B52948CBEBF46DC0D5C0C6F3D281F B4/R;
622,004,770 *400DFE66BCC5C3D3D08EBAD22862F97D30A519AF B;4r(
622,004,771 *400A5783BF197B1B1F244CC59358454D7C3793A0 B/4R0
622,004,772 *4008BB6BC660C9463FD1B03BB29A0703A288AAF0 b4r0me+ric4l
622,004,773 *40047443806A58A1AA72B16CADB622E9A9E01866 B4R_2
622,004,774 *40007C55F15CA1F64F66386D0DB9E029120C38C5 B4r2$
622,004,775 *40091624589182C03BF2930A46C1FA66A4B2AEB6 B4rb1+ur4+3s
622,004,776 *400AE83A981D4969714F5E7888F2DA96058DAE9F B4refi+
622,004,777 *400392BA45C949364AA8B7EE446E1C330E2CD10E b4ricool
622,004,778 *40041EA82E369A72FA28CB245103062F49E8DC79 b4rm4l3y
622,004,779 *400CBA24ACE3EC0C3417AEEF1859FDC555CE3CD5 B4RMC
622,004,780 *40079A9FF2EE63D5B4A7EE3E1D95269DFFC59DE2 b4rth0l1n5
622,004,781 *4009B3BBC2D9934532EE2386ACA0025F5F4ABF91 B4rWP
622,004,782 *400D940EC8DB247838239557AB414C535C732F5B B4ry0n5
622,004,783 *400AC272AC741939A8B82122379B7D7175FB8DDF B(4s/
622,004,784 *40033C86DB6A22E981794E0DCC5A392458C94210 b4s74rdizin9
622,004,785 *400CC034CAE96B0A7D290BB4877DEBBBA022B7D1 B4sekonve
622,004,786 *40085DC910C82203C53331EB1A9EBE0A428FE5EF B4s-H
622,004,787 *4007260DFDEAB9110766DF4616E1C37D7C3F9902 B4smd
622,004,788 *400410E591FCE74741139DA7E652046CA2ECBB19 B4S/p
622,004,789 *4002AF66FB340E03CE6C6A919248EE2D30DD0D73 B4.sp
622,004,790 *4007F8910E118DE441900C21201517793DA7E3A8 B4SVm
622,004,791 *4004DF33F53A996C46DB842E00881B325FA0BCD9 B4s&Y
622,004,792 *40049835AF4EE04719DB0814A2B9535C945FA598 B4%T$
622,004,793 *400AB66BCD2BCF4E8C9FF90F6ABD30E930538A26 B4T&;
622,004,794 *400525221A1C92F2F888F2C201E30D21BBE39597 B4T5=
622,004,795 *400A28EFD5B01561AB92A17533EF56859165A6D5 b4TALTOS
622,004,796 *400F201655DB30C138276DF03D1845F2FE081869 B4Tm_
622,004,797 *4003723855D440ACEC02ABBAF8ECD48C856020A2 B4TM5
622,004,798 *4004F62FB0224E9899A1DE1A17043071A86501A4 B4Ttq
622,004,799 *40094BC2FEECA0E2D1A73C1F7BF675CB2A0E6342 B4u$_
622,004,800 *400459596481C438653F035C611B7CD71D9D485A B4"UC
622,004,801 *400D7A34110CC32CE2AE0915288AD1C385E75925 B4udg
622,004,802 *4006BA199E7499706893211CE1EE658BAA28501B B4%Uh
622,004,803 *4002AAE6551B3C0C3E0ADD3E9BE6DC854A7E4A66 B4Ui7
622,004,804 *400413938B536DD2549D2EB08372BC5DB60B4CD5 B4uj:
622,004,805 *4006B9B09D8EDE8AC1EFB6D6232C5B306AA471FE B4u:N
622,004,806 *40038C69F150145347E32C25B75F99AFB895A9DA B4uNA
622,004,807 *400967F7F9DE5221EBAA6BE2966EBC07C2337155 B4UV)
622,004,808 *4007E371C8435872CDC7216FAD9231AD7B7DAED4 B-4V?
622,004,809 *400431665D2C86DC84F6DC382333E0A8768AD792 B4:_V
622,004,810 *4006225F84EB1C9F1A1BEFEA2EE053956C94D979 b4v3r10n5
622,004,811 *400D40CAE4D6FA505803FFC8C980321261B653E9 B4V5
622,004,812 *4009599357CF2FA7B0A9D49A48AD2CAE0647CAD0 B4vD0
622,004,813 *4003CE0110665C809848A1CEB385F415A5E666CA B4,vV
622,004,814 *400B830C846069581F10BBE3A3CAC0CF4C32688C B4W0g
622,004,815 *400299DC0F9E90577949EDB1BD73D15D607BD8D3 B4"W3
622,004,816 *40050B756541D5096429A746B0FAE1C36EC96295 B4WI&
622,004,817 *40040B2870A6E0180553656AC1463A81A6E6BCA4 B4wrU
622,004,818 *400C5F75B8B1EA7C6E5B1ABFA291A56E95B50E7C B%4XQ
622,004,819 *400FDDFA9EFE20864440D6B82BE15F5567C70B36 B4xter'$
622,004,820 *400FC9B2E933E0F998776E6E7AEAA3DA55891962 B("4Y
622,004,821 *400333E893EC13F4EA7B4BB0163DC809F245598C B#4Y(
622,004,822 *400E95BFC94BF7821EA330F83396D706DEF9F8B5 B4ZFE
622,004,823 *4006BA7BA3FAC6C4B97DB24F9AD847F0F2DBAB7A B4ZN/
622,004,824 *4001B8F3B811378D5D7C0CEF55D297D61C3A8062 B-5?(
622,004,825 *4008D56851B17ABA6CCD0D9DD9E138E434DFBF72 B:*5
622,004,826 *400474AFDEFF3E99990BAB3BCA80C1CC89CCB417 B?+5;
622,004,827 *40061A29E6CA59C4374E5FF6E53CBA19A57CAD7B B)5/#
622,004,828 *4004E0F4AAF897E05C784A9D57A318B3D1E32E96 B+5,?
622,004,829 *400B6C944FE11536BC85F0B2EC931DB6E0EADD94 B5_)
622,004,830 *4007CFE00608139B8AF0E12091421504A8DC67AD B5&&;
622,004,831 *40035AC3DE1C0F58F3642ACB3C3395313BDA7BF2 B5:0C
622,004,832 *400FE16AB55F1CC84AF87CD5A5876F2939417108 B50f-
622,004,833 *4000DDCA249AA21C50630AE95A943866CB2D3A55 B50%H
622,004,834 *400C4447427912FE3B168EFBA45085CEA8E64C14 b510619a
622,004,835 *400ADBE3801B7D7549A240E03CA0EB45E5D2B90C B51$1
622,004,836 *400AC503031557F748E2A7ADFAC4BAABDB6856EC B51F1
622,004,837 *40002971FC23A6835B8626E4097583172A9AAA27 B"51k
622,004,838 *400AA6B732E9D767BC947E16A9A839CFD9E5C05C B(-52
622,004,839 *400709A8577F257F09028D2CA050428ACD8FD63C B?52K
622,004,840 *400EFF2E19FFE11A7D4EF3A14D8B00CFC81D51BD B52l%
622,004,841 *4005A15B72708C76589A4A87E59FB9C89AF4CF66 B!53C+!ONA11Y
622,004,842 *400FCC0763E100A0C3F271C802E2EC222F3AB9A1 B5.3h
622,004,843 *400A289B8C79AF968B51C38F0C86ABBC34003C85 B#54:
622,004,844 *400441ECE0584531C01C8BAB370119630A55437A b5413
622,004,845 *400439946CE5C87A018BD41F154F3338FE0B9E86 B54:E
622,004,846 *4001E75BB4A581B62080DA09C217F35B48FBFF6F B:54G
622,004,847 *40099A25D4FB593CEB168BC92A129DB155702D64 B54Iq
622,004,848 *4005B7CDC3ED78F3B8FE28231AADA754B8D643B3 B;54j
622,004,849 *400E66A70C7FB14C1227D6FA40AA1217172595EA B54Kk
622,004,850 *400F41284733DEABE091DFA5690155942B8D22F0 B54O)
622,004,851 *4008A37F6C4D73BA17B7E51AA0259EDFD95D669D B%54o
622,004,852 *400A0A3314292AB05C1DF8DA53C70EFC823526D5 B54R$
622,004,853 *4006C498AD72C685C0C0CCB94F7314D45C31CD9E B;54W
622,004,854 *4007651D343AA0F00AF1226685DF98CA13228AEA B5(5-
622,004,855 *400F49C884F48F001124DE8E5B3E9B71D9EAAC38 B55Xn
622,004,856 *400B2A719202AB8EDCA9CCE40E53A3B870D2B4A0 b567348
622,004,857 *4009ABA29270111874D8951874C143E217356F6D B56KS
622,004,858 *4004705BB0BFFD43579D124A3EE8020D4954B0B6 B56=M
622,004,859 *400891A8622269A5960138F28D2CEA769E16BFB4 B570b
622,004,860 *400F5D188C12FD53109633859534535B4410A12E B57n!
622,004,861 *400F6805EBD6A03C56198F8F996D71FEDCBDE01F B?580
622,004,862 *400C11B482CBEB1786F921B96FE9CB874A9F805E B585"
622,004,863 *400E08A8595460F08E87D7636B821FB010EB1BD2 B5856
622,004,864 *400E28217436B52CA82E4D4EF97392CC1391F497 B58-E
622,004,865 *40034C465B5A75E84065C21CF937864B91ECD5FC B58sv
622,004,866 *4001AB92CA78235FFE714855A0845F8BDA38CBB6 B$59?
622,004,867 *40076D397F5CC48D33C67C40D994C72965CD9912 B59?d
622,004,868 *400E048E9F5B1F6B152260E429665F4FE753753B B59p$
622,004,869 *4004A42EC913EB24F4FC512BA3DD4882A6134536 B5aI)
622,004,870 *4009702B0942557FF3CB223E9693E4053D703C4D B,5aO
622,004,871 *4005C57DC5CDF61091F65250FCA00EABF149979F B5ARH
622,004,872 *4008A87B3A13F78C4459C06B989258BEE36AE2CC B5AZQ
622,004,873 *4002AAD887A92E99A4AB8043C62DE4CC9FE470D1 B"5-B
622,004,874 *4003688248967C25D6D32BDF029ADCF555AA899B B,5bC
622,004,875 *400C92477061C4B089AD6898437F6D038EF90F0D B5+
622,004,876 *4008CA30700E883349C12AD30581977DA447E93D B5CAj
622,004,877 *40069C4EDB12B95A991692FFA369E3B10C98B2C5 B5c;j
622,004,878 *4008A53387675A1E8CE285AF84F454F5B0F40331 B5CtR
622,004,879 *4006F85D6B15ED1912F01F97F2F4DA9C4C7A06AB B5_:D
622,004,880 *400A8919CC275D94E51BBD7746A8038EA8510A19 B5D=b
622,004,881 *400C5E0164538AEEE5D01232C6AC2AABBFBEA944 B5dd5
622,004,882 *4005B2D368B9BD740D0E996731F3F58770069D54 B=5dH
622,004,883 *400E6481F348068A6AD741F35F35F936AC5C9CE8 B5Dhv
622,004,884 *4007A468BBB30A58C796473B2598E3FAB2F9F315 B5du3
622,004,885 *400AC659653A87B091A903A3702A888472313113 B5:E&
622,004,886 *4005A512A83A453FAD6B4CBBD56F2F491B4F5FED b5e8fa50-95dd-3e4c-92a9-84a671e50c87
622,004,887 *40037339318815EE0C01740265989E7E4B69A92E B5Ele
622,004,888 *4009D5D5C552A081A05E8E9F36075682E46D8D00 B5eLH
622,004,889 *400A6EB1AE235B735C9866E86C848280D7FAC4D3 B)5EY
622,004,890 *40096F033253CE217A96C4523B97C87886DB11F4 B5%f"
622,004,891 *400663B04E5DECCB3D86A43E8EDDADFEAC112268 B5G6!
622,004,892 *40041C16D441D6AF765BF31BC6C383869F2FAD9E B5g8a
622,004,893 *4001B8532F3A4C056974EE178025AFB8D13336B3 B5/GH
622,004,894 *400897A1C8A22893F90FB02487E8B15133B29D73 B5gX5
622,004,895 *4003CE706759668DA5BD6E13C8B7434907083720 B5gZ8
622,004,896 *40009624A3FDE6B645FBAF64A8E9A2AB04E94E33 B=5H)
622,004,897 *40024FBEECE524B969C7BBFC179C75488A3D38FB B5H!&
622,004,898 *4006F62EDECAA3624BBE17771DC77A12116AA358 B5=h%
622,004,899 *4008BCF1A657A79D5343CA3CC6E0699A5B0DFD45 B5HC$
622,004,900 *4005B6955B091C52661DF1126071762F6243952D B5Hqm
622,004,901 *400828B422F62454D0DEE1EC1FEF2D1E60607886 B:5HR
622,004,902 *4001C8D0B99B346A9328152AB2EBB3BA1B645938 B?5i.
622,004,903 *400808FF3DB6FD0CAB8971953BAB54FB93F665EB B
622,004,904 *40070044773E43ECF6BF0CC06938B2563A8F58F4 B"5i8
622,004,905 *400BD4616DCB147D8F12044AD6F5293EA1CC6720 B5i
622,004,906 *4000DC8072E064E8EB46990786A14375D4FC831A B5JABKORJMWXD2HF
622,004,907 *400111961A73FFE3718C238E385930D8A272D365 B5jc)
622,004,908 *400C5E110E8B2B1B78722069BBD3D70B39982DFD B5jd4
622,004,909 *400BB3970BF283952230E70458FEA3E60BB9625A B:5Ka
622,004,910 *400A266194EED931811A92B947C6B11C3B32B82E B5Ke;
622,004,911 *400AF6585EAB184D214BFB609CCD28BAA3EA0957 B5K!P
622,004,912 *400D155B52153DEC2E70B92D447C0463FD00249F B.5;l
622,004,913 *4008A0ADB918C8E12B576A31352A863809E39F85 B5L#8
622,004,914 *400E3DDB74F195C37CE2B26AD85E884815F1B546 B5lAN
622,004,915 *40072550E511A2A309F5DE6863CEF1FC8EEBF632 B5l.I
622,004,916 *400D25F6E5261FEEFD9E5B657B0657ACF30B1A71 B5!lN
622,004,917 *4002A091F11E525523BD6A221653D495BED9F666 B5-$M
622,004,918 *400E52F88BDD7A0D78BE23781F428796E1413683 B5M_+
622,004,919 *40096CD878BEA37181C1A6CCC2BE3D3F90B493E5 B5m#%
622,004,920 *4008A3C60A3373A6C45CBDC9B5F51DFE3C326EAF B-5M1
622,004,921 *400E54648EA9FE982A00DDECA3D25E17AFDF74BD B5"M5
622,004,922 *400F83C61626526A184621DF784AC898FB144C31 B5"Ma
622,004,923 *4001C98ECEA3636EE75534943475CA5CE7A89FA6 B%5mh
622,004,924 *400F6A10739339A0C93830FD8C1C69D7F228D35B B5mHW
622,004,925 *400A516B5FD792BF96A1FD12A192EB2A2547D72B B5MlD
622,004,926 *400DB2A04DFEF91A6D3FAA803088D9A683D7674B B5mos
622,004,927 *40076154C58581D07C64451CD2A02D5A8A9E02DD B5((n
622,004,928 *4009B67ECD420CA45983F8A429DCEDB85D4DBE2E B5noi
622,004,929 *400FD50BC8175291FBD6D630E94CA228E3016E3E B5nVs
622,004,930 *4009AEBE6A999CCC5F679A3A55DEE017FDEEE31B B5#o7
622,004,931 *4009F9FD4EB548B58681BB043509C5B111856CD4 B5ocs
622,004,932 *40040BFC1FB049121DDFECE4362EF16AFDE74AEE B5(-P
622,004,933 *4009C00A8E9730DE5EB61E364F5A3B857C9EBD85 B5&,P
622,004,934 *40004F10E1D7A22C4FEB06AA1F3E3894531ECA08 B5p"e
622,004,935 *400A1CAA777308FA84A8F06FAFAB470E7A93FFC7 B5pGe
622,004,936 *400ADB8B1175D472A35E9B0DC37E0E0885867E9F B5p%j
622,004,937 *4006A6ED1675131BC9A8B7B3A4F4E15D6249A8B1 B5PmO
622,004,938 *40011DB62957723E353F338900590404748D4AA4 B5p!u
622,004,939 *40002A1DAB96E2012F05D12BDB07BB7BF0467202 B_(5Q
622,004,940 *400A32A1819BE81F21F4AA11526D629429719CF8 B5q%(
622,004,941 *400A1256ACD94B95BF0BFF1A5B7A1674B82EB5F6 B5Q1l
622,004,942 *400190435D3822913113E9091128168F52E66AEC B5qCO
622,004,943 *400EE44641940213DA5EB10CA6329C84B77380D1 B%5QS
622,004,944 *400220436D81849613877C12F2675DCBB92FB414 B5R00
622,004,945 *4003D5E949D76AE99570EA306D68C1A12B1740F4 B5R0B
622,004,946 *400355DA0B03B1CC362DF71AC764472B7A121D0D B5R3U
622,004,947 *400DBF100E9DE99304891CA48332F663C5F63030 B5RcM
622,004,948 *400B7D5B4E91A697662EC8EC11381A15BDB57278 B5r"v
622,004,949 *400C5D4AEFD3092CEECAF9246CF2793CA278705C B5RX(
622,004,950 *400C3E918CA890E25A748FA82814C029F3BE8751 B5sbT
622,004,951 *400D880266C4C2F19EBACF4816BD094902FBFE99 B5sG$
622,004,952 *40012D5BF2836A61C754BE0F115AAEF02BED7794 B5S,h
622,004,953 *40063BE1B4E1FB680E73575E448D7632C3780C70 B5ssN
622,004,954 *4005CF44982D68030E70DD636DBA5FA6F270A310 B5Suh
622,004,955 *400D88D55BAE91618C70CAD6361180E234E0CD5F B5T,%
622,004,956 *400739C8760235768A20879AD13E874158226C29 B5t24
622,004,957 *40028FC6656E3CDD4FF7C3958CDCF07BB713161E [email protected][email protected]
622,004,958 *4005289E2A183BE87678E26E12432DE004094AA8 B5urr
622,004,959 *40059DEF48BBC5AD6106D44701B98C9E2BD06E9F B5uTB
622,004,960 *40052C7E75AB3A7140A4DAECB1427E1D9058A86A B5&%V
622,004,961 *4001AA58A6E53C37D8A58C56A95998F02749E38B B5v;E
622,004,962 *4007DAE44DD6D52BEE9F82EEE7ED076E804D1AC3 B_5Vk
622,004,963 *400678B45964126B65F4FC27C6F3F23932A178C3 B5Vo.
622,004,964 *400C88A090ED5F04EFED69FE3BFEF1453B39C6E9 B5Vq3
622,004,965 *4000D50888AFA556E56ED800F1726800F4DE2AC6 B5vt=
622,004,966 *4002FA6C5E777F399F3231FBF778F78DC9E431CF B5vUR
622,004,967 *400A299E54CC8098BE814822892EC99C7DD567F1 B5vVh
622,004,968 *40006848CF8FAE85D789ABEA14F321CDEC52F013 B.5W+
622,004,969 *4005EFA7220B5E9456ECC63704823461090CBA1F B5==w
622,004,970 *400142B2F5BA926985E753359CBBAC7EB3E15BC5 B5w?_
622,004,971 *400D00FAD43AABD525DC66842A11B94CC54DD5B5 B/5w2
622,004,972 *4003C849FFBCC4D7C02DF739D27925B5F9339595 B5w;2
622,004,973 *400E03CD93C625E6ED8C0208300A353A2AD4B067 B5w8S
622,004,974 *40029690B72E04FA77A824A6C0CA163818829081 B-5w9
622,004,975 *400BC41B5462642015CDA666DECA6712CCCDB670 B;5wC
622,004,976 *4002E16066F31A360FF71952990D05DC541D6A20 B=5wF
622,004,977 *400EE41AFCD7C80BB16D4884B52F67372483F097 B5wj
622,004,978 *400BB3DA5C88341570C1262631882B7AC9D92B43 B5_Wp
622,004,979 *40026F6B236E58AA4CA2FB3D22874206601C188B B5Wu)
622,004,980 *400AE7C4EA5865352EE669895075A50F715F88A2 B5X04
622,004,981 *4007C6BB23AFAC72311AA6E3D40609674021711C B5!X9
622,004,982 *400CD0FDE481BFD60891965EB2B30280A94B861F B5X.h
622,004,983 *4003883A2B3F63A5ABC6CB6997A3A3D4BEE31760 B"5Y%
622,004,984 *400BB6CE4EBDD18D70C4926872FE66D8868B8537 B5;YH
622,004,985 *400277A38C037818C5946EFC5ED4C27F54421063 B5=YI
622,004,986 *4007E77C333A9DEC2B2DF1ABAC54523233FCA37A B5YjZ
622,004,987 *400897444A019A1263108D5D8F486046BACC5C93 B5Yu2
622,004,988 *400C278AF8F6AA0F5C67C9703A79CA5BD5B388C0 B5Z;Y
622,004,989 *4001CEBFB5F2CAB4CAED75F04B04EE7BA763140D B=
622,004,990 *40026DF09BD23AC61F478CEDAF6413FEDBCA8A07 B?6%!
622,004,991 *4003A9A98309699569A68CD265570C0D4B33DF5A B)$6+
622,004,992 *400CED42BD886468DAA118FE16E10771A0906394 B$6"%
622,004,993 *4005CEE733848A4F7203E3009492D4938810D9E6 B%_6"
622,004,994 *40000A422DF0884B0A6CFEE57B3F45E1BCF3095D B6.
622,004,995 *400C8406710B346E78233A5D43D276C386F74B89 B6(,(
622,004,996 *4005ECDBFBC4A5FB44E423C1249C95FB16C84A71 B=60,
622,004,997 *400E46596415F23317031B0CDC868ABE558865E0 B(60S
622,004,998 *4007D5E537DEB26C23469893C52CE405A92FBB42 b61578
622,004,999 *4004B36EC0931F90E74A4D40BBD88EF8705E2A54 B61C#
622,005,000 *4001C436B8A1A2226CE62406B76BD35E4116E24D B(61n
622,005,001 *400B176D5E00F1BB553F0EAA1BE5262B799BE387 [email protected]
622,005,002 *400F5E9CB01B9DA8B92C4B4D4FA6F0DF27B3351B B$$63
622,005,003 *4009821BF9459EBBEF58FFEC5E47CDDA4837B2D6 B6=%3
622,005,004 *400D65B3D3F906621F3A62A7235646ACAE23943F B6&)3
622,005,005 *400CC22FD6FBF6D13495C01D070918073758CA07 B63)E
622,005,006 *400E73417711B372BD6CB84DD218AF0DE19DBE3D B6%3F
622,005,007 *4005E8D4F25066F948B13AACEA585988EB6A4D0A B63gG
622,005,008 *40083B10AC6046012B7A7668720D04CA5FC6C951 B64Zu
622,005,009 *400900FEEF7C3FE91EF5EF639AC22596D4F893CE [email protected]
622,005,010 *4008E66528FECBB813814C7E0B799850CFF97A94 B65md
622,005,011 *4008B1CA2BB96ACB062B44C12A9D6867831D33E6 B65ng
622,005,012 *4007EC712261A3997A519EF26A13BF02BF6C6E18 B6-6-
622,005,013 *4004555827984A189A2AE7E4E85C2CFC48A0CB22 B6:&6
622,005,014 *4004C4C539D399D9132A7EE57E5EDDF345ADA93E B66<
622,005,015 *400C91D3BE1C2710C1AC3ED2C47BCB11C82A2095 B665
622,005,016 *4000F4CC55334A6620A78379987AABDF958CCCFB B66q+
622,005,017 *4008EDA624C9CBB11BDFF47A93D2A3BCAC5378C6 B6;6s
622,005,018 *400473BBCC6B8C252EE8F1F9286FEA67EF19A0FF B/67_
622,005,019 *4006804AEB5C48133D3292503395AE48839B5A12 B676M
622,005,020 *400580AF320135ABADA2E397B763CDD2BEB936AE B&%68
622,005,021 *4002C3DE1217355AC8FDDB5A0CF08CB8A6CF0973 B68g+
622,005,022 *4003835001DA56590735F8005B3BAD7CBD080D5F B68!i
622,005,023 *4001FB86AEBBEEFB79FB35F00ECC676C530FF0C8 B68N?
622,005,024 *400560FE1ACFA4E5A12E2318B7FDC5703867D8A3 B!6.9
622,005,025 *4001E96D7DBCC358A782B9591F05822A7FBA30FF B69b
622,005,026 *400C3FA9396B72A18FEBBC07DA538693DE352997 B
622,005,027 *4009F25BDAFC48D6E0615F99DA72CF9FF551DC4D [email protected]
622,005,028 *400E534BEEF2F8D96566A268083015215BE7DA02 B69;u
622,005,029 *40093948A3A881B3D06CFB1BD1C09939D046831A B6A+%
622,005,030 *4006C19C813149FD09FB262F084835E309696B56 B-6B"
622,005,031 *400834DC4D0DE359E5A5DB79AF37A68A66461ED4 B6_/B
622,005,032 *4007182A57D6B7728C51EA7C1685BF23D04F72A5 B6&#b
622,005,033 *400F06102E5EE3747519709300E9C91CB67DEDBB B6Bog
622,005,034 *400D361C27476EA6A7C3834FC533E0623F3D83B9 B6
622,005,035 *400364E1F4089527EF52830D93A386535EFC3E3F B6cmm
622,005,036 *400DF4258998052477764A312D26A883E9965AF2 B+6d?
622,005,037 *40080A6627C41EECD522B3E2CB4AD5F2AFF10FEE B%6D3
622,005,038 *400CCBE54107EF6FA8F6423EAFC018E9B3309D9D B6D6p
622,005,039 *400BF57ABE6A3A0F5A8CBCB8F955F572A00B0765 B6D#c
622,005,040 *40038FECB7D6CBC6C71CE56BC7BCCE5D9B0FD429 B6Dl"
622,005,041 *400EDB5CEC42989A014DA467B397E67BDEE89CCB B=6DO
622,005,042 *40098838A5519A286A8257E1A63E4725B49D53A9 B6dsstub
622,005,043 *4007A0413883B184860B0C04F3250FEACFE35C1F B)6E4
622,005,044 *40077FC95942BC5E034E6188969C12E93C9BC824 B-6EA
622,005,045 *4006F76AB70E547457F1A7A7713E0FC30E91753C B:6EB
622,005,046 *400B7B86C467EFBFC89160E7B1FCFDA36259D8CA B6EkO
622,005,047 *4008B9458FEBC7DD50D39FB2FACE8D20697AC4E9 B6e(S
622,005,048 *4007E34C8B6BF8FEC478060D3A397C6252C634FB B6EuU5aV
622,005,049 *4000ABE68018078E48742F3C5D62729C7588FBCB B6fce
622,005,050 *400E38216A1684C2B1649F51E4A776BA2DE1F294 B6fLv
622,005,051 *400BADDFDE8D559790F167BC151BEF9173841F10 B6fn
622,005,052 *400A869A4DD7646113659C839FC202575215AAC2 B6fu!
622,005,053 *4005AF4C00721C64DAD5B1B4488B0126A3602075 B6FUA
622,005,054 *400D586FDDE4F5E475D2852D3A5994C6E0E005A1 B6fX7
622,005,055 *400D92A11F0F343E4A282829E2A9EFC8D513BE1C b6fy
622,005,056 *4004F31A6625155F1E75A3FA6623FC32FDE61A02 B6F;Z
622,005,057 *400DB4E81BEAC30883499EE44B27FD1BAC00EECD b6g5hAV5QPw7p8
622,005,058 *400BD3CC5A63BA96B4D7B1E7AB250E8A909D6B65 B#6GD
622,005,059 *4004C01E8FC1114A0224A8E92FF7C0404D83218E B6GnM
622,005,060 *4005CE7F316E34A91AAB38110A37160BA8FE4445 B6GTv
622,005,061 *400F0138D09F261D9598707D9BE944A82B71C739 B6H#-
622,005,062 *40010BE0FE80A40C808CB1E682671C03B95A66A8 B6#H3
622,005,063 *4003BB7D9533FEF4E63C63C4368BC31D1C622263 B6H4W
622,005,064 *4004C5B6F58FE8F12EA53B730AC6078FF37CB63E B6HBR
622,005,065 *40025AA53531A2271F42357E27324137350F2733 B6HC4
622,005,066 *40013D580D45AAAA504107C8C1A0D2439134102D B6-Hh
622,005,067 *400DB55DAA566697AB4DA24ABAF32CA93E1902B4 B6HT-
622,005,068 *400C63A5720566F0A26FC38E24F2C700D60A0D25 B#6:I
622,005,069 *4006683B31C90828A1543DC1E68CA22A0B6C2B04 B6I4V
622,005,070 *400E881B3C009A845797CDD3F425738B583C7DAF B6IaX
622,005,071 *4005889A4A9B272ADD355B1E2C618E6AB581E9CC B6Icp
622,005,072 *40034EEC7EDB88B0092A456BE893A61BFE6CFA86 B6iNB
622,005,073 *4006B80C022214617BE8BC9C8BF906ACD13D6DDC B)6ip
622,005,074 *4001516F83F1E05A1F8AC1E9BA35741CBBF38663 B_6ir
622,005,075 *4003F07F6F9388940018F5207D4C8DCE7A79C0F9 B6IuS
622,005,076 *400195CFF1A62F691D60F05E3FF1303C5B9803DC B6j-a
622,005,077 *40026C272F14BD4E0E90770BD7A74F75A6308F23 B6jFN
622,005,078 *400DEB8C1EBD17EA4183278DD3B34BC6DD53C693 B6jX7
622,005,079 *400075DFD672BA1504B7DB85617162A7A5F9787D B6,K,
622,005,080 *4001C1810B49DE9C347AC2CC506C081E3A197F0B B6k88
622,005,081 *4004DFF7B907782FBA95A8FC371545C85F4F6901 B#6KC
622,005,082 *40058E1B4B006B4DB59504E2D33E3C235C6EABDD B+6kK
622,005,083 *4007A0B5E84F72E1B53C719A29FEFF290D599420 B6Km5
622,005,084 *40027EA98B50A25664AFA008D1310A9FC5298CC7 B6L6Q
622,005,085 *400897940ACFA4FCBE0B1506EA9A062848653FDA B6L7j
622,005,086 *4000B894191169A6ECD47ED59102329625ADE4D7 B6lbS
622,005,087 *400692C5ED6A8953A58515346426FE3351224AA4 B6LHN
622,005,088 *400311CB4E3D95E4A984D1590DB9D3C35025351C B6--M
622,005,089 *4003CFB5D26AA98E72181CF47F9F5E2A159BC826 B6mK?
622,005,090 *400A17F4A4B59F4488D1754A817D035356A46850 B6mVN
622,005,091 *4007B7B19F4F65F31A8BF4C880DB7933890C2AE1 B6NM4
622,005,092 *4008177DA84D2B30AE0862F2738E9A36A2E9B063 B6nuM
622,005,093 *4009EABE788A2E2D16CE20852BE5EBAD2C3208A8 B6OA7
622,005,094 *400AA60A8D2E89545A311ECF7EF0AB0A23110B12 B6ob6
622,005,095 *400C5990A3D92F43CC5CD670D21BDAF6D6F8D154 B6OZv
622,005,096 *40009734258370ACAADA7CC9F904D51E0D8BCD59 B6P/-
622,005,097 *4003695E0F17917926D8569DB585772BEBFAE60D B6pn
622,005,098 *400A503FA079F14B37CD1026605DD9A04EC6BC96 B$:6Q
622,005,099 *400F8182C14A4F7450D2B5131FEE81729238D05A B6QEA
622,005,100 *40007AD5D6FCE8C89768ACE0103F1B174160EF94 B6qPd
622,005,101 *400E8E96327379182B0B72D48A70A8CB9CE43968 B_6rh
622,005,102 *40065CF675D4EFD9D726679D7E34E17F102C8A2C B6rOB
622,005,103 *40013E66A06F7237855F67245FA099A065106364 B6rspiel
622,005,104 *4000A4C8E3954B940036C5D35BAE150ECC2DC922 B,?6s
622,005,105 *400BA559AE85D2E95367589EA6199AB879ED7C74 B6S6W
622,005,106 *400A5CB6948003BBA6A024003DFB0727BAEFD0B1 B6Sfk
622,005,107 *40031E04889F5FE1554DDA619FAF0C00F9FDAC94 B"6SO
622,005,108 *400EA181CCAC604210EF00475A39EF41125E2139 B6SXR
622,005,109 *4005F3FE630BAB7C8917334C6F0FB9CE689C097F B[6T
622,005,110 *400CDCB4DC2BEA54A4EF58C2041782253506E56E B6tb$
622,005,111 *400722875FF0BD87F576AAF2611E53083D9C763A B
622,005,112 *4008D02CD16C6BDB1193DF88F794F9B58ABC036B B
622,005,113 *4004D610077DF7B2BAACC1865429D248F9FF67DC B6TKL
622,005,114 *400EEB23711558CA3400C3AFB6117531F9970DFE B6tpY
622,005,115 *4008E756B3697A36AD14A8D73620FE6B15E904FA B6-!u
622,005,116 *4003D1895AE9305CCF2EA563C569BC83484F79FB B
622,005,117 *4002B6ED9E65B1F2C696D7860EC4BC2D5DA9DC46 B6
622,005,118 *400FBE42B19355AA22B1882D32438A968C4E753A B;6UM
622,005,119 *400967AADE585020B15B5CC81D83520E4F4644B9 B6U"X
622,005,120 *400981E35814CD47A41A1BE990AD95FA19684E43 B6?v;
622,005,121 *400BECF1D8B216667A0CB06B3CEA6F36E86C9A95 B6Vk:
622,005,122 *40022705C938C5BDA7DA7791ABF39583C03B96ED B6VWC
622,005,123 *4008970BA8A4CDE3055FD108C2037F3B15645C6B B6vXI
622,005,124 *4008BD2001DFB2AD3BA1709BB9B9E5555F57EB5E B6_W"
622,005,125 *400D0AEC86B8846A37453A1888848F0F245A56B5 B6&W=
622,005,126 *400A8E19B1A822BFB80D5E7B9406B4DF7E1FBE13 B6wIT
622,005,127 *400AC1F7567292630FE49941A95FF2F5252F1527 B6Wr-
622,005,128 *400475F45B1AD24F836F3F1E5D811CBA69FF15C9 B_6wW
622,005,129 *4007982F6AC1F50C0414BA09D0C67C06EBC2D3E0 B
622,005,130 *40058DB3860697755F6E1B9DFEA611B2B9F11FF1 B/6Xh
622,005,131 *40070E3DDE4BBC60BC15F709CC320F0A63BDFA73 B6XHRWG5JKAYXYH
622,005,132 *40002C2B3B783113F486A869322F6E2AA895722B B6X+n
622,005,133 *4004570C0B7C1DF6BB6F0162015CB698413FEAA5 B6XV)
622,005,134 *400F4E7E388D48D36F545ED02541AD002989E3A8 B6Ycq
622,005,135 *40034EF38B060BFAD49C615E743265B8BEBF468E B=6,Z
622,005,136 *400793C7922553873687AE215F21F704160E5193 B6Z#1
622,005,137 *400D052A165E3ABFA46553E306EE330877542730 B_/7(
622,005,138 *4001EC22AC1E667AA31A9F025288F5F33BCAFE3B B!=7&
622,005,139 *40053F03016F136E896ABFA11948DB4D404FAA82 B?
622,005,140 *400C3EABBAD139B15F8F5BFBEF10A7193F5AB8BF B/7#$
622,005,141 *4004592E866BE0FC82F8F599C543BB92274C903E B)?7$
622,005,142 *400FD73CF3FB41E220487C56420072C1B40FA7A6 B7!+#
622,005,143 *400AC6A098EAF300C141988EA7A3E49A72F9AA48 B70wB
622,005,144 *400FEB6F550A340AF1CA63EAD315307EDD5670EC B716s
622,005,145 *4004D1EA18CD1C13F1236A871DC63C1B26CC8571 b71982
622,005,146 *400C39251BD7478F9FBDA03CA1781B40851E533A B.71M
622,005,147 *4006572D521B961B18875F69ACC710D264EB56A0 B#7(2
622,005,148 *4008AD98B14F41FF55FB93DEC43F6D0367E0B7CE b72913
622,005,149 *400105B8F0611AA62DD77819186678983F7F111C B72OQ
622,005,150 *4003E0508757FBEE2EB83D2A82FBA4D947273A60 B73EX
622,005,151 *4008AC2BD3700D27F6A52FF750AE867277FEAE3D B74K=
622,005,152 *4001B584C40481FD34415F66FA068C6E6F66BF40 B74MF
622,005,153 *40084B00B810DA0467CDFA42FED3FF86FE79E898 B74Xw
622,005,154 *400E20D07AC0AB41531BD7CCB1888B6932B6E726 B7:5"
622,005,155 *400EA368B2C456AB7D65BD9B2787A43060D00F3A [email protected]
622,005,156 *4006D79DEDAE8B0AE181ED6E33D020E01B516AD3 B75Y4
622,005,157 *400910245EB83186462D8416C023D576F08A7752 B765p
622,005,158 *4000B4798604BBF4A0D0CAFEA4003FE41563E180 b76732
622,005,159 *400A5D65731F7D51C049C0BA1F80E6D888752EBE B77HM
622,005,160 *400CB0343F8AB3161DB5E5CA64B961D1DFDA5E4F b78304
622,005,161 *4003A48364993EBFD3E1FA6EC5A2850C551E3CDE B78L%
622,005,162 *400A95FEFCCEB112936AFF26BCD7F5544704F574 B78;O
622,005,163 *400B1C5013E0F737C3912A4F2C103F3C90BF55E5 B;79,
622,005,164 *400BFF48EE2E0578BC940050E44CC68F7440EE12 B79FC
622,005,165 *40020A278898F8DDCC0E1C10177A1D9D7FF4B75B B.79h
622,005,166 *400B6C76A503ECA149F7260828BE77FDAC5E01CA B79VQ
622,005,167 *4000D211C9A1348F9AC4CA6D32FFA0AEB4790D5D B7!#a
622,005,168 *4004794A9BEC8949EFC4FB8A2CAAAAAB67108467 B7aj;
622,005,169 *40056EF0DC1B9D087DCE5A5D2044925BB101BB14 B7AkU
622,005,170 *40035C567D9B665DB0451D4301B33F9531360609 B7AS.
622,005,171 *400D8DFEFDBA39E78C5AEBCC514ECBFC292FE3F4 B7)B"
622,005,172 *400467F143A87E4BA5AF32058987F7F4A5A34141 B7
622,005,173 *4000B52291390F4E54AB0ADF6918FC87FE41426E B7b1v
622,005,174 *4008A97A18AE4538F1BC956ED9324F88647E0465 [email protected]
622,005,175 *400A47E77E78DB1A676EAFF5627A3B4D1D72F497 B7bv2
622,005,176 *40068B2811A888F842722283FDEA43DDFCC66018 B7b;W
622,005,177 *4005CB2CAAACAD530B9090CAEC5356F41AD502BA B7\C
622,005,178 *400026587F7040CDB5DDF7D283B8DCD7F0EAA746 B7!Cj
622,005,179 *40070864E5C129753B787A51D9211DDF86A93671 B7CqU
622,005,180 *40035ECE77985E5EEA3BF367AAA51750048D63B7 B,7D:
622,005,181 *4001D2A1BFD8C1CD465C1E0BCF81DEA4EF1DC7BB b7D
622,005,182 *4007BAE7514F0CB250B8E3957FF261E85873DE0E B?7D8
622,005,183 *4002E45E4F1ABB198ED7CB52B3B6EA365AF06A91 B7dkt
622,005,184 *40075222548DCF9CE02E4E0E16F55AB84E6BBCA6 B!7dm
622,005,185 *400447602D37CC8D25B4423FAEFD13298C9F664C B7dZW
622,005,186 *400C932BBA1170F5D02CEF08DCEFA3A2A4ADEB12 B=7E#
622,005,187 *400C645ED3B3191A78998ABB766288F0CD6FC4F8 B%7,E
622,005,188 *4001E1EEC9489586BF124E218C0D42207294D8F5 B=7;e
622,005,189 *400FE4B1CE6055A776720431BB45F617ECBEDE5E B7E2:
622,005,190 *4005A9CCCD429879DA27AABCB2C4CF8F46DCBCE9 B7E7(
622,005,191 *40070A647D3C50488CA7888C23199E9247969B39 B%7eg
622,005,192 *4009EE413C3239E28FCDAB8C0D1A01A8796527CF B7Eov
622,005,193 *40082255200AEA7E72A108D450CCE59230B8794A B7Ew,
622,005,194 *40045B724A4835E4307ECFF06B06EE6935C47057 B7,#F
622,005,195 *40033BB398585BDF8DC46728ECC4F4AC935BD0B7 B$7fI
622,005,196 *400ECC90A89EB99E0F419B6BB03C155E854ECA06 B7FW$
622,005,197 *4001378F8D42DD3EED79A7D09753C4DB8917B360 B,=7G
622,005,198 *4008D9BC63958AE504575CBDE403969BAC94C25D B?7G.
622,005,199 *400141CDF2F145D496D940508D205DCA42F1DF95 B/7G_
622,005,200 *400FB9C48E363754741362E63391D8981FEE7CF0 B_7gi
622,005,201 *400B8441FC3E9A1A0E6F41D5F12C755C32905448 B7.gm
622,005,202 *4006E12324B4E0BF27127CC2907700285CB0600F B7GNn
622,005,203 *400BE53B0FE666DF50FEE59AB5DCF106340FF678 B7Gos
622,005,204 *4007D3196A28B5B80793C6F1867EA224402C6C60 B7g)r
622,005,205 *40010CB9190F8F24F2A74863E1E259D9A41CF9CD B:7=H
622,005,206 *400BAA738EF1F0AD64428BB42D38F58328E526F7 B7:h8
622,005,207 *400E2DA05D27252B3EBF10AF709EDDF21DCBB0DE [email protected][email protected]
622,005,208 *400C7712BF2E017C02C37C2ACB00CF9C51B4C2B0 B#!7I
622,005,209 *400A7A5F317384DF698944D9E8D4564C2A5075C4 B7i
622,005,210 *4006ED6596336A44CD66DD6B9E35A870EEF21041 B7ib)
622,005,211 *40032E3E16314A81DA728348F642E4E9BBB7B5D7 B7I/C
622,005,212 *4004A2C89B34943819ECDD8DB45E40ACEAAF2907 B7/id
622,005,213 *400360C5354686D5A0996560D573011AB2F62B18 B7IGh
622,005,214 *400F374C4B35DB741B1BBBB952FCE415040AC4D7 B7iK)
622,005,215 *400B82E67973F25A7B0E19AFA368F32C034580D4 B7iOY
622,005,216 *400E08BAC8CD8B3E4153272C37CAC8B9A582C05B B;7+j
622,005,217 *40099A276B54C07850F9D0A8BB26D70DCD588C59 B7k/d
622,005,218 *4003C61F38B73C01EA1C44E27B99FF1BA45E27AF b7kennwort
622,005,219 *4009D1071C37D5FB62062D0F5238B8F154CD8D14 B!7KO
622,005,220 *4003753CCB8A759E6155236C5F06A1AA3F9F4D30 B7KP.
622,005,221 *400AF45001A0063E69FA65B4C2306F8DBA1B5C0E B:7l/
622,005,222 *4002B3816462176483E64B13DF64414700C8FE12 B7L#8
622,005,223 *4006B81CB122FCFC4D5B0874EA5F5445030AC5A1 B7&l9
622,005,224 *4003F95366F47F6D2684BCF8BB5EA05A8820E3FF B7lm(
622,005,225 *4003C96A3B807926E4BA54313B3B5C3F071BC1F6 B#7lO
622,005,226 *40058F65F617474D4BD8417D7BDFD7DE38658D4C B7l%O
622,005,227 *4009990FEA808999E0D9531A1AAA1F1EF98E182E B7N,
622,005,228 *40026FEA7E10F248BFFB0C4956308632B5634011 B7n0l
622,005,229 *400E177C3E2C098810BFA3C55FD2BA52579D0DD6 B7nID
622,005,230 *400823293EE64CC3501132B698490CE17CD5167D B7nMT
622,005,231 *400E236002D3A6C9E45726E7BB479954BE4F4E4B B7NPW
622,005,232 *400D85ED562E163443A6940A0EC2BBB087FEA13E B7nQ%
622,005,233 *4005AF9C73641A735908EA90516ABB7EAAD3AF0E B&(7o
622,005,234 *400A8A4E620E33393CBD96591EB16ED86355A509 B/7o0
622,005,235 *400FCB0F9482BE69DD81EFCBF5C17EA2CDDA02DD B7O.a
622,005,236 *400A87DE9F3DE69192A1115938142A6740573305 B7oD5
622,005,237 *40061847419FCBF9D44BD2B6EAE2BF6B8EFA9D3E B7%oN
622,005,238 *4000A5151E7A3E76A3495D6BEB733861D3723E1A B7O=u
622,005,239 *400B69A9B1919F2F8E290E7109F2132A2DACC03F B7O+v
622,005,240 *400C661B5F87AC270C584439DA2DFA8F4277E332 B7&p2
622,005,241 *400FF703C488E2BFC59EA88693C795FB3C276EB5 B7p=c
622,005,242 *4008A043AD39350C2C5966D168D88F3C7F8296EA B7+Pm
622,005,243 *400834AE642EFAB272085735EE9B5BB70E533DCA B#7pR
622,005,244 *400114E14A3C609A697AF7AE14345B77676466D8 B?7Qw
622,005,245 *400A4CA078BA1B07EA7D2D7496789050DBF5793A B7QZp
622,005,246 *400222B3B9E1639351058550502A0BD65333E17C B7rg2
622,005,247 *40018719638F6891AB35719C1AC33A3205B4FCE8 B7ro"
622,005,248 *400D786EFEEE33683DE76CB28C709031571FA0EC B7/)s
622,005,249 *400185AF97591F9509EBBB082E7AFBC57C15C2D1 B7S_E
622,005,250 *4008A1ACF26DE88BF32A26D766CAF49F13791569 B7sPu
622,005,251 *400EE9AD254A0144196ABE0AE728514ADFBF9DD5 B7SsY
622,005,252 *400D34B58F19381564B3C6ACAE24A408304CD295 B7T-
622,005,253 *4009BDDDCA44BC1122857BCB33C9E49D1BB0D70C B)(7t
622,005,254 *4003F1C7021604DED4346C1B5B2AB3756ECEECC6 B7.)t
622,005,255 *40063C6F05648ABE2BF2BD90D914114DA7A9F813 B&7t5
622,005,256 *40087A51F0B5E71C94AD98EC785D93C0A330ED18 B7/TA
622,005,257 *400A66D4A301DFF64A446B0CE3F56A2E91BBA6C3 B7t&L
622,005,258 *400E3F5E9935B8EDDEE47C51748C2B3F1CD38764 B7tm0
622,005,259 *400B2C29776C7824027B7FA0CD75EC0815923AD6 B&?7U
622,005,260 *400B3B559A50FD4C6ABF6CCA05688ED10B8352E4 B7UCp
622,005,261 *400C05AD4697A9421B69DCD5F894E2FDA61D9387 B7U
622,005,262 *40054D0F638A85C3946244BC3E0ED08F54721FFE B7uVC
622,005,263 *4004387AD4460B17FC5EC75650A538FE3A8CC737 B7.+v
622,005,264 *4007718CAF5144BA0A4A1DD5DAD5EA944DD89B93 B7v??
622,005,265 *4000A1F1D325E43FFA90550E90E1835D5DA90A55 B7v.K
622,005,266 *400DCC4945DACBB1E25401F1BFDB847E6C8081EA B&7VT
622,005,267 *400BF3D2187BBE8EA89524A17FFC30E09AA3EA9A B7?vU
622,005,268 *4003FC77C3A04FB86629ABC8E6F361062E9C23E3 B7VY2
622,005,269 *400F7D98749883B07E048E7BC0AE50CE243CDCC0 B7vYY
622,005,270 *400B80117ABEB892494A48E2D55B35B96D69F494 B?7w5
622,005,271 *40012E7DA64CA05C25EEB7A78BDED4C93BB56E32 B7WDb
622,005,272 *4006E6EA7CD672BC6EF1F14856F88539CB29DA49 B7Wi&
622,005,273 *4005EAF651E64A9917FB53796BBCD9FFFA648A89 B7WXf
622,005,274 *400E8DC55865E62565BD85A5D84553ED16389ED2 B7$,X
622,005,275 *400ADD1C384B724C6DDFA7958E4D34C7CBE2C680 B7X6H
622,005,276 *40083FE746F6457085D534EA1BC6B8A46C06B26E B7XF2
622,005,277 *400D07F5AC3D0DAE3D3D5AD380A8726AB76518AF B7XY2
622,005,278 *40093B5175FE4A3540C560C245BCC175B1375684 B7Y0P
622,005,279 *400C50EA8F16D68129C8ADC988D4DD1D1FE8ED5E B7Y;P
622,005,280 *400287FFD703115C2A0E347A41CCE684257A9543 B7YpP
622,005,281 *400660FAC520C34AC1D9244C9F8CD1DE741520B8 B7YUh
622,005,282 *4004CEB86F95CF72192EEAA1D7ACE515E38A232B B7Z&b
622,005,283 *400A2726723858FEBC130E0A80AE63BED9410D0E B7ZQ.
622,005,284 *4006E71E72AA7F25803855717917140440450DAA B7ZYR
622,005,285 *4002066DF4C6F3726CC0FA435E31869517D13ABC B-8+-
622,005,286 *4000DE77C35ABF6878F8ED6E74F4D6A5BE470D5A B;8%?
622,005,287 *400C7976BEE7A871F39AD283D066076019CC5914 B"8,%
622,005,288 *400B9BD1363670687F442FC5DDE61FFD14261CF2 B"8+"
622,005,289 *40091DCD4E9DC0D309CA40117E3F5A6F5AD34811 B(:8:
622,005,290 *400E9929F266836F2596A9B2F1544DD26E121CE3 B(8?;
622,005,291 *40067E79A6068C48E67BA98647AA6486ABB5CB99 B%?&8
622,005,292 *400AB43225D74ABA1073D60980D185730F2DC297 B8__!
622,005,293 *4000546E8E5097A5941B690B82F8DDC16D2FC08E B8_,,
622,005,294 *4007455F98BA54C285D1D3FC9323D53873073F50 B8!$#
622,005,295 *400608D499152602823F34D54CFF63BB9109DBD3 B8%+
622,005,296 *400F79E9AFE82D0DE33863E19C67B7A3D0220714 B$80%
622,005,297 *4000BDC0C5AE4827E71AD6A1281B0581FCCCB2BE B8;0,
622,005,298 *4000566E3B235A518CAA10212155868552120CB8 B8)0Y
622,005,299 *400E58FFBF5EDE245B5F08550454717450FF92F7 B8160173
622,005,300 *400AC76223837BC94FDE7DD1AA590792294ABC86 B81K
622,005,301 *400B6C38FCA400228B1C06E8A5A4551C998739EC B82//
622,005,302 *400530C48C5A93BC077A1CC916F84881EE131B4C B82010
622,005,303 *4007B58070E4C0893EE3A5B7DA35BB0C8DC5DABA B82M-
622,005,304 *40023E151D249177E3FA6B89E552227991BBE821 B8-=3
622,005,305 *4004F5542940B74D571252257568B09A6B503D63 B83()
622,005,306 *400680ABB06DC6B8A81B56C1F17814788524CF45 [email protected]
622,005,307 *400F2700F27763AFE493D70A81C493554BCA9AE1 B!84&
622,005,308 *4002270FFADA4F9AE17C20968254159254AD52F6 B842Y
622,005,309 *4008BB717C07C740D93E5990C789DC8AD5EAA2E9 B849GLD50
622,005,310 *4000E0366728244630348797C69BA5759144657C B,84k
622,005,311 *4001D3BD374B8B6B4262F8725A103FB32975AEBC B8+!5
622,005,312 *4004FAF2866922CD083CD13170B7B7063798638F B85
622,005,313 *4008BBBE19E46061ACA4D7F421BC372CD54DD817 B851+
622,005,314 *400E8E9A67B375886582AEF8D6712071FEA04A52 B8%5O
622,005,315 *40078AA8AFE4D7A803B72A091E42D337E77540A2 B8%5o
622,005,316 *40063510AB3334247FB5D2198271AEDBF6F875DB B85Z_
622,005,317 *4002CA17B3B32BE69B3E1608D0A0896722C12077 B8737314
622,005,318 *400BB3F9064C1D95757D359292F3D1C46BF9C7DE B88NF
622,005,319 *400B7779E5BC9CB245086FC2BB0FB884B40BCC8C b89081
622,005,320 *400A1A46EC47799D722441F7F8EB0AF171F6A4A9 B/894
622,005,321 *400762A9AE6F8B6D578A0E944F7A176D1CC327CB B&.8A
622,005,322 *400864F004E62067D8DA8FB90248EE085CE96DE6 B8%A:
622,005,323 *4005DC70F9975A4D342177B8BE8A6864DE4C1F4A B8AB5
622,005,324 *400E751768DDE9579E432F2DFCD8D58F39239E7B B8acg
622,005,325 *400D658D1FE453277E13B838FD80AF7E50F1CD2E B:8Aj
622,005,326 *400685B3134CFE53182A6D70B86ECD234FC6FCE1 B8at7
622,005,327 *40099B662B97ACB4606C4EF28452E4097831C461 B8B49
622,005,328 *400C0854E66012B99F08C99B6417A21BFAB64951 B8buG
622,005,329 *4005214FCEBC305A87C7A290EB1CCCFC7C7DDDE3 B8=C/
622,005,330 *4000207639DF2AFF63BE9BF71710BC0CB15A5546 B8.#C
622,005,331 *40010FE9D1018D50BC495BB31EF0158012CE55F7 B8.=c
622,005,332 *400214BBCB37703D7418B782DE394C84734C7A50 B8C3a
622,005,333 *4003748AA686217098F2BE276749FBDA029AD72D B8C3t
622,005,334 *40037A47A3000C34FF5670FB520F8FC8ABCA8C53 B8c=6
622,005,335 *4001B5DB6AC6FC7239940ED0D19ED3CCDA237841 B8Chr
622,005,336 *400A384C470C3991B14D35A2F53CF90D3F253044 B8c&j
622,005,337 *400C668F32D0406BCA8AA29FF6A44DD42D60CD7D B8=CO
622,005,338 *400DD6959AAA5EA8D917894174B99A67A6F1AE7D B8Cu-
622,005,339 *400678D1AF8627FD12F1EB196DDD3FFA05912082 B8DSW
622,005,340 *40080481DE79D53ECB9077E74912CE698D52D441 B8-E&
622,005,341 *400664507576E4AEFBA8DCEF7A2EFE1D17AAB366 B-8e.
622,005,342 *400EC05689203CEEA3871FB8188F0C9DA40A05CD B8e1:
622,005,343 *4005F8FA7A6B3E13486731F1F92A478838C23124 [email protected]
622,005,344 *4004079287DA8AA7BC8892052763AEC57415807D B8EjU
622,005,345 *400F35A49344743C4A20F3381BC85C9E10C00B67 B%8:F
622,005,346 *4000FB61B08B277C548F222ED36537CE8881A864 B,8)f
622,005,347 *40084E16DBA1425FA1BDDC92F81B201717A550BF B8f3v
622,005,348 *400287202444C683F441BADB8FD806030A4ECBA5 B8+F8
622,005,349 *400824164FCB29615EDD0CBE8B7364CF49EBD753 B8fa-
622,005,350 *400B52A5703B413ABA661976D50E788B3877A02B B8fd+
622,005,351 *400EAF9B08CBA6348134D5B53506C4651A243D69 b8fe07c2c9fc
622,005,352 *400D5E586C46B1E26A21C1FECDA23D7526D98970 B8_fp
622,005,353 *4005DA51B793A4F678183D54EE8D96EF19010CCB B&8FY
622,005,354 *400AA97B42A73C5F1859486009AB3299E0D3E011 B;!8G
622,005,355 *400BCFF42E0E2E32C0390E2696CEB5B87C66CD6D B"8(G
622,005,356 *40071C913C8C4470802BF69F20601E4C60E314F1 B+"8G
622,005,357 *400CBAA67BBFA1A152BC133520E5C7FA7C0EB110 B-8:g
622,005,358 *4000C0D9E640506E8E63ECB5C89359D9D1DA4991 B8G4f
622,005,359 *40002E1088106141C997EAC1580723C2B5433A3A B8;Gf
622,005,360 *400A38C08AB58753C5F94D52D4316F0985F3E257 B8GqK
622,005,361 *4006031F7899963F0753FCDB59222A34C5B893EB B8gUr
622,005,362 *4009DF921BD977598851C992179BD415123425D5 B8Gvm
622,005,363 *400A5B082402CEFBF152F2429A034BA1A65E1979 B8H95
622,005,364 *40044EE32960A14B82949D8C5D12A581EC010F0D B8=hC
622,005,365 *400B522332A624B5AC542D4B20C063DBBFEA4808 [email protected]
622,005,366 *40000BA60B818968F8F9846603F08006E1971CB0 B8HtO
622,005,367 *400C374060294C8661AE8673CF61E36BD481B308 B-8"i
622,005,368 *40018356A7FD1C089E0DE73D986F57E0707795D8 B8iC&
622,005,369 *400DEDF610F4C95458CD3A40CEE48BC10C0C7FF6 B8IGQ
622,005,370 *400FDFF6D51C99C6934BC430BB6C1A65D24A469F B8iH.
622,005,371 *40043C58F9540FC8628F41BB2AB179EAF732E68E B8i_n
622,005,372 *4004D53663CFF291F79846A851CF2ECD8737A6B5 B8/j.
622,005,373 *40041A3AA87D877AED6BF4DE24FC65C334FC65E9 B8jH6
622,005,374 *400D1F7BAA19A66B20602967084D4CA05128C8D5 b8k3sx6
622,005,375 *4003D46B58E2DCAED595571D33BFCE38C1ED9083 B8k4Z
622,005,376 *400C8DB52822E8002DA4C7EA9040F2117D9BFD51 B8$Kc
622,005,377 *4008B531B6FD68C1675408A3364F2AF7C59D823E B8kv/
622,005,378 *400938D23F25DCCAB14082CE567503DB8286653C B!8#l
622,005,379 *4003FF5DAE72D474ABAB1A95B7EB2C8C41119A2E B8&l9
622,005,380 *400868A3A39CF8FA6DB7DD92FD57383FEE13EB57 B8L96
622,005,381 *4005891ED4C6809DA1D08E02DCEE86DAE73C9155 B8LDH
622,005,382 *40048CA45F11D7C064B3964823E2700738973A0C [email protected]
622,005,383 *4000CC193DEDCEE5033FECC513AB024886FDA18F B8l-Q
622,005,384 *4007341BDE3A4ACE5CBDB3326D7B6B41E94A9CCE B8Lqf
622,005,385 *400BD1ACD4B90E138367AE9CAD2A220A7D59E0F3 B8lSw
622,005,386 *4009DFB70FCE2840E9A42EB272954B67AA4999EA B8(?m
622,005,387 *400856F535C8DDF6F7B1826E045F454CD5235DAC B8M5DR62PV
622,005,388 *4005B036B7953D66465790E5FF754CC3C78A1AA1 B8Mc4
622,005,389 *400481563D329F6478DA1E8FDD33149D80E532A5 B8Mfl
622,005,390 *400EC89487787D02FE2F0849AD09E2919474B129 b8mMEeai
622,005,391 *400FCFB6BA3BF0D7E8BFF53758A038BB01F433FA B_8Mp
622,005,392 *400264B3956B2F8BB7A5DC7D107FF9B9DD05A965 B8nBc
622,005,393 *400AB3AA0ABE24F462CA96D58234E4B64AD1B425 B"8nc
622,005,394 *400FF4600A847498D5C03324386B9204B9B8581D B8NER1
622,005,395 *4005FF4204BCB426ABCF74BFBC2D1F0651DDAC08 B8
622,005,396 *400494F0EC76CEDE0A3C38EC44737B7FEAACDC6B B8n-p
622,005,397 *40063E0128EE1AF2B0A078DCEEEE9830A8965F07 B.
622,005,398 *4007F6299BA8D637BD17A9DB0884D11A2B3DBE39 B+8o_
622,005,399 *4006516D6823072FCBAF8F3C03AB3EE97F302E24 B8)o#
622,005,400 *400F7A9F419252E8A3093F99054BB71C49F18AC1 B8O&8
622,005,401 *4007BCA7565E660ADA4E64E028438FA78F10C595 B8oBi
622,005,402 *4001176A82376665C2F80F79207060796534B635 B8o/E
622,005,403 *400311F45CC585840856118E4ACD0FDFCC3396EE B8OHu
622,005,404 *400D2940CA3CDC277700E52B83755BFBDE292B43 B8OO&
622,005,405 *400914597D167B3165D6448C8227680176FA427C B8O#Y
622,005,406 *4000E5581E4EE7BEACBE6ABE1F4C6556C4C42DD1 B8=p;
622,005,407 *400392951A8709F5B868BD34663BA8F09904941F B8_,p
622,005,408 *40078801549EF6F161B00B712AE8B4852013F770 B8PCj
622,005,409 *400551666864A7881189D619F215118398D633C9 B!8PH
622,005,410 *4007CE8433ED2EED32BAA2670037E4B5580021D9 B8PjK
622,005,411 *400FF3820A30E8235148BE887AF382FB667F4BD9 B8puL
622,005,412 *400390F7A1C3A69326206D9D1A8036405EDDD30D B(
622,005,413 *40063A75F2450B60CB82A35D7426FF7EDE405865 B8Q.a
622,005,414 *40007B68CC594F702A0214FD4FA9DB3A95D38232 B)8qa
622,005,415 *4009E9873CBBB8D1BDCAE41C686ED377BA40A4A7 B8qF+
622,005,416 *400DCB69E3E2D56193131D1DD20874337EF34479 B8QV7
622,005,417 *40079C8B8A17AFF633093D79A87A1F32D1D94F8B [email protected]
622,005,418 *4004D9167C09A7E8F8AFB657147DB69321151844 B8QXV
622,005,419 *4009BBD3096099F49382F5C2EB7DABA291BAAD05 B!8R=
622,005,420 *400EBA4C81ABD310574E1A56E3E961C7FF81F2E4 B"8r)
622,005,421 *40058459BA7A1909A700CB6D85D6FC3E0364D91F B8R4f
622,005,422 *4000473BF129DEA13DCE623E9C375D341541C679 B8r!j
622,005,423 *400230C8BBFB4FE1008E5B112C5782FC9AA07A5F B8RP
622,005,424 *400D280D64792BD00EACAB6D6F150C82ACAA83ED B8RR1
622,005,425 *400ABB7BF1A37FB40C24B8D6533EEB43E34EC9CA B8rZA
622,005,426 *40059600A5C2C5BCDF5ACE3A5B7C583DA9B66521 B=8$S
622,005,427 *4003DACBC324D3F0EDDD596A110ADCD109BACA60 B8SOm
622,005,428 *40048E87389E463F3BC0010AD4D303DCE37FB3B1 b8st8rd
622,005,429 *4005636AD0B2891CDB12F99A069B5F7668A2E5C5 B8SuE
622,005,430 *400E52B2BB96B1C8F546A87CC5BFE169FEC58CD5 B8"sY
622,005,431 *40015168679EBB42986D396273735E99C5BFDA7A B,8)T
622,005,432 *400EEE5F6534B8B2FCF788D7CAA8C03941573E87 B%8t:
622,005,433 *4005C4402E5BF050B114F6AD464D381EEE4FFDB7 B8t,/
622,005,434 *4001A142630D5432E2B8C4619E0B19295C1D246D B8T0a
622,005,435 *40009B606D09E3B77814FF5D5835594694C98982 B"8T5
622,005,436 *400EBD1CE0E6FADBCCEF22EF1629504F9375E080 B8t(9
622,005,437 *4000721BD205A7C5670E8FBB6741DF2426AFF2EF B8T&E
622,005,438 *400FECD9CCD12553464E58043C603E4D08970CE2 B8Tll
622,005,439 *400B929CE18AA0B24E66A8D50DE8C9154EF120C9 B8ts3
622,005,440 *400CC1E8B32978C1FDAEF187EF9D0F48DEC12F48 B8T-w
622,005,441 *4002599CAFD251F4590B378314E0988228157846 B8$u
622,005,442 *4007997FD03A0F191AC00BBB283260BD908D1BB8 B_8u1
622,005,443 *40033DC58371252D61CD895496B91C2A7FD25124 B8u#b
622,005,444 *400AEFD4F3C59A3018C67F75B854418F90F996A8 B8ue,
622,005,445 *4001BC5D6675AA2124AEBD872446A39A5FEC42CE B8;uq
622,005,446 *40095D78455844EB4B14AD2BD01D999F14ACFE37 B8us:
622,005,447 *400D3561FE7065684D86B916E85BAF6CEE4F35C8 B?8uw
622,005,448 *400185E03BB68C9E9FA719513AAE582EFE9468BF B8?
622,005,449 *400DA0E0B1175BF01E1569618DA8B00709D2EB50 B$8VB
622,005,450 *40004A8F740FF8B9FCE03D96C45856B08F072A14 B8V_H
622,005,451 *400AB9833159CD4BE99B7F47EDB4A9D3F13ACAE2 B(8Vk
622,005,452 *4008C9565D7E7D75B929B5EE8D1B6263FD5D0A34 B8Vmt
622,005,453 *4001825A8D45B487D408E70D5137E85BB28BE22F B8vn.
622,005,454 *40006E34C0D4F8BAF0C51B6DED17C7C952025607 B8vv:
622,005,455 *4003E918C8BAD6357B4CEBA80E024E8096C73C4C B.8
622,005,456 *400D34027F95547075EA4380E9D32D7A48010F43 B8w3?
622,005,457 *400D94B270E9035BBB49598F43EC2235FC2FD0B0 B8WcI
622,005,458 *400BF3F29C0D0832E55E8F2CFC452A1ED2B18A37 B8Wsg
622,005,459 *400264898DC5D36E0F1CEA17C2B019FAC7539F24 B8XKs
622,005,460 *4002E1E3993A7289DE3EE70E5C42C8C9744ED3B0 B8Xu)
622,005,461 *4004EF4679CB7EFDEEE4D2B051EB7B04EC8BAF61 B8Y(+
622,005,462 *4000A5B1C6CE7AAD4327355924EF8027DE125E6B B8YpB
622,005,463 *400350AF6BDF7FF78FD346BFAA72C49A351709BC B8Yu!
622,005,464 *400C05FE90289721C548A19B928D8C9FFE5C9361 B,+8Z
622,005,465 *4008A68DD478483C91C19D3243C07C0CE898C130 B8ZaF
622,005,466 *4007C691D75B071DA9630BF3BCE516285D60FAA6 B8Z+P
622,005,467 *400AD16A64CFA08F63B27A231996830F9247A658 B_9_?
622,005,468 *400392F36EF4710A18536886EA61C95998B26001 B-%9;
622,005,469 *400BA1DC19EBFD922A5ED3FAEB10F803D10F93A6 B,-9"
622,005,470 *40071F333E0AE42FF16B218EA2B9AE87A3F2DC72 B?9&+
622,005,471 *400A96C86B50C4BFC7956075F011C96E02223D1B B.:&9
622,005,472 *4007C4055B1F9B1363A89D173FE53E389A6B998A B[%9
622,005,473 *400033A042C8317975FEA301BA304213D336618B B%
622,005,474 *4004826FAD847D9543CAAF13CF3C6D293476CA02 B9:02
622,005,475 *400BE89736E6C0EECDFB6ACBC1BBF25D96C7DB5A B907O
622,005,476 *400F5F3B2A3DB213F4E3B4D95C20402C4A006BD4 B90D"
622,005,477 *400723ED0A866D6A48CD7E7EB17BB1CBD0D319F6 B90nK
622,005,478 *4004E3929B1E8590C57A5883996F744EF984E16E B90Wl
622,005,479 *4004E4945A312F56F38382DD60840F2775FE9FF2 b91748
622,005,480 *4006045D914BF49D15F42B491DAC6AA8FB9672D1 B%91K
622,005,481 *4007A42ED386DCD424F499D838C05B969261B627 B92;2
622,005,482 *40035960E514C51AE0184C79AF4C64B942C929CB b9265
622,005,483 *400EAD68F87AD7329EBB0ED0213CFAC57B02D829 B92f,
622,005,484 *4005F18C0F2C0F216C491A90EF9DA7D9C8A139FF B92LT
622,005,485 *40018BB264791B00C295676FAE09B18BC76E2281 b93ccolf
622,005,486 *4000EA51C1E0217AB33547483D27EAACA5710A31 B93P8
622,005,487 *400B70BFE5D5219466DC1DD12A5C752D4B0F4F91 B93vg
622,005,488 *400A4900EDCF538F47F064242B3C295EFF23DCE7 B94cU
622,005,489 *4009CE36149E52794830135B1F4687B8342A1BAD B95+?
622,005,490 *400AC1C41B338FBA10D8782F4F82B56AECC4175B B952Y
622,005,491 *400A12F26D382689055ECB8A6936E22C1A7399B1 B95-A
622,005,492 *400D2F694E743E9E63E1D53AB4328A42D2A00901 B95an
622,005,493 *4003CDC683598A7F8DF3CDAC43694C9CFD88F09F B95QB
622,005,494 *400E23CDF3946C9CFB3A81D69BB5250BADD31E67 B96BE
622,005,495 *4009121BDA38B252B055684C9EA8077E2F210DA9 B96nM
622,005,496 *4007A3E42B6743B6E9F4B1B918C9F145B3F987FB B97gc
622,005,497 *400F8EF03C087B98D5EB6F333CC28F56DC842DD7 B/-98
622,005,498 *400AAC998312808F6DCABE93A26FA36D37BA95DA B
622,005,499 *400D7962B58A8B4CB126EE1CCC7ED587BA81C4B4 B98L"
622,005,500 *4008225D6F8C1C7CD51C48EF6DC13E1C7A070AAC B+98m
622,005,501 *400EC2DC0EE1D914DFD0A539172EA5A81A01E600 B9901087
622,005,502 *400AA8A78CEF80564CBCE4ED52100F8C1F85BF01 B9_92
622,005,503 *4009346B1F3DCAC9676096904B3C75E82A2B19A3 B99E;
622,005,504 *4002825722722FC395B59F0A24FE6CB40E002202 B99f7
622,005,505 *400CCD34FD21831984A60BC7881690CD57BC0391 B99GC
622,005,506 *4009232438D9E0F15E1D6891AE8BEF7FF029CE66 B9)A.
622,005,507 *400D88D7FEDF22DF60A6AE6C78DC25953542B33D B9A0I
622,005,508 *400268A67D47CAF9E7E98BB936EA208F9B261C3B B9A,8
622,005,509 *4002CA29A8B84B60485BC123D7BD02DD177D1647 B9(a8
622,005,510 *400100EE2601158EBA1A0315EA4D05F2172B91D4 B9%aW
622,005,511 *4006D5CCA7977158DA36F66161EE3572C8253090 B9#B"
622,005,512 *4008F91587EB4B2D5B01265EDEE435E352F0DD87 B?9b-
622,005,513 *40089B9E1C687FCA1EF36E9230F7D9F5D1D9F4DC B9bGV
622,005,514 *400203DA894B28F67E3DE6C56439003307899BE7 B9BnB
622,005,515 *400A9A94749FF7FC08C3BFE495DDA7433F8FAC64 B9bQm
622,005,516 *400311C0FDF16A340391472667F28DB73168D5FB B9B&X
622,005,517 *40045C5749351ED14C9EBA7941B20044E62CFD1B B(9C-
622,005,518 *4003CAEFF7B532AD4DCA8819521EA3D66B7E778D B9c85
622,005,519 *4003F11863A286941A74F96B452123E082E0DEEE B9CG2
622,005,520 *400C3D655C13AC4F64A92EC765AEBDD91C445F83 B%9CM
622,005,521 *400DDFB45B7A05E222B084E1119B84463988F1A5 B!9Cp
622,005,522 *400B64DB3B033DDD69B254E787DA204DB5651CFB B9cZF
622,005,523 *400A7B937080ADB1AA8B852EEDD6EE5AEED55E2D B9+.D
622,005,524 *400EB9251A7FE39F929EFC312C64E1A03E2B18B1 B?9db
622,005,525 *400E685086A0B8C0E861955AEC5ECFC4FC72E04E B
622,005,526 *400A94F0B9396BBB68DB7060A528F3605F41A2D1 B9DZg
622,005,527 *4003BA14C0CFD41ABE442EAA390B2E116FFD856C B9E)=
622,005,528 *4000FE673738CA7A0722AD733465DB65430EC445 B9Eei
622,005,529 *400A5920B7D17DF1F06E3466CBE242A37AA5E997 B9EFU
622,005,530 *400629651473C2FEAADA37854018D07009CEBCFF B9EjC
622,005,531 *40081C3B5BA342016F88226DB2AB8942182D5100 B9e&n
622,005,532 *400EBE6F927E338F268B34E3998F5F4B791E5547 B9EqT
622,005,533 *400F402A2C319D9051153E18BC64C23F83485A6F B9erU
622,005,534 *4000A249C38EAB09F589773FFC066B15E9FE6B13 B9etI
622,005,535 *400060FB042E5D732F06EF94C6AD6251D1F7E56D B9&ev
622,005,536 *400B5AEBDCACF9DAA76A1FB6FCDAFC6459BBA16B B/.9F
622,005,537 *4005A3F757A478831023C45186556EC45732EE68 B9F#$
622,005,538 *40092F1376E9CC40284FFDA6404D4ACBEBE42663 B9F0b
622,005,539 *40030C9767DE6541BC141F0A075D3C443650370C B&9fD
622,005,540 *4005954A2272246E3C00E718C772AB7C7AF3B80E B9fE.
622,005,541 *400776E2E5CCBB3B5673F907450F2E9142A47957 B9G0V
622,005,542 *400290E9A4980C82703B8780216B0095762FBD5E B9GEt
622,005,543 *40036E1C6697A91A764619B42B3CDA3FA4B56E2E B9GFU
622,005,544 *400DF8CC673214AB0F657885C2EDBE613B914E4C B,9gv
622,005,545 *4001F38812047A1D6A4D1E145A933CADBD952F57 B+9H6
622,005,546 *4007B4ADAAC75D2C24CD0B3651F0869DB7A69A6A B9Hhu
622,005,547 *400B81E98F5F8CAEB906811CF87E43C9E289005F B9hL6
622,005,548 *400778BF83084A6AE98CD027399F2713B66F3B92 B9HUC
622,005,549 *400721B61015AC47D0385F8B2AA504607C6B8BDC B"9!I
622,005,550 *4008970B530EF653597C79F70148B9777B4803CE B9i3t
622,005,551 *4001B717F419C913A287F8726EF8FA316EF7409D B9idA
622,005,552 *4009BD58D49F637FF8ED10A772CE5F378AAC903F B/9IF
622,005,553 *400C0C0E6F325628491592AD19D7A21D87645590 B9I-g
622,005,554 *400C36725DB8A01E5D8631B40DC530E03CB59ED8 B9!iG
622,005,555 *400832E5C8F1FA4612298C4B5F9D56BF0E729E63 B9,im
622,005,556 *400A1FF5DB801882A5070CFD4417C39DC0F34948 B9It!
622,005,557 *4002C96D8416D4673B9C120B6A712BE0AAB4DA51 B9je
622,005,558 *4002F8B65AB918A2155AE7C791522BD90E68C01E B?9jI
622,005,559 *400B48EF02842CD88B7EDB8EE1B5625758AEAB5A B9jLT
622,005,560 *400C457874CFEACE199DBDF2532E613118C23A97 B_9k
622,005,561 *400A42D019BC2B39A47533B0DAE836FBB555687C B9!Kh
622,005,562 *400F5EC52EDD5A77F58161158FA56E2E85A6A45A B9KNp
622,005,563 *4006C158290A00A9F7D006ADB905B63D03249A92 B9?Kv
622,005,564 *4007D9E1D03F6866FE056998A18B047B88D34BA8 B9M0?
622,005,565 *4000511941610E7A8EA0306FA90B5FA71443F78B B9=MA
622,005,566 *400E6EF467B23A99B5764663FE782D54FF06F367 B9N7
622,005,567 *4009985BDC6AF75D299F2837EB182D9649AA7345 B
622,005,568 *400F17B48225099941A152A988BBE9C04DB9CA4B B9Nef
622,005,569 *4001AC6EFCE7AE8E79871C1ED44F98AB2AC14F28 B9ni,
622,005,570 *4008026F570ACF63BF7DE8030FE1BEF28780A007 B9;&o
622,005,571 *400F8E73293302F1C288928431E6DD415526BCDD B9OLg
622,005,572 *4003AEF2B4B7F7B8BBD3FA9E9E5CD4A15DD60C2A B9Oq6
622,005,573 *4006654A7F9128B2094BAA38FF4D24F34F9BDA83 B-9oU
622,005,574 *400CFEF7CEA8A11EFDD98EA27E9A905D821D8282 B9oXj
622,005,575 *40051BFDBF2826ADE3E9FAB628A2886171E41BD2 B9oYO
622,005,576 *400B4F55426F4EBC5FCC993A9CD6506F6401B945 B"(9P
622,005,577 *400A3B0124B3E35F337FF5BA2D93EA54BA9B1D2F B?9=p
622,005,578 *40051F7D12E8E7753DB2F17B29ADBA5FD34D2D3F B9PaX
622,005,579 *400093B38917235C9F0AA7668ED248AEB74E291F B9pik
622,005,580 *400747292625E48E9C3F86E6A250A771616D4657 B"9PP
622,005,581 *400A77652D8AAF59F2BA489C4D5A6479E0C28652 B9pu$
622,005,582 *40056CAB6BAECAEE73690DC1B9478C90C2B00702 B9PY&
622,005,583 *400B0976F69E30D38E5F678E35C31B3ABD00FFD0 B9",Q
622,005,584 *4001E3972A0263918AC14FC76542AAD1C5DBFA1F B
622,005,585 *40027D47F062C0DDD340DE252126F905007482D2 B9!$q
622,005,586 *400FB96841B2D0B5AEA8C572DAA4AB99EEDC5ABA B9.:q
622,005,587 *400A5BE520B543AFAA0D751534ED2555E931769B B9?QD
622,005,588 *4009C284D23072DC32008AA3589586B0F2763ECF B9q
622,005,589 *4004A80EF206C7DEFBF3D2AB723080ACB8D1BAE4 B9QjC
622,005,590 *40025C360DFFD0E0DC296319033FF0BEA4CA63FD B/9QL
622,005,591 *400E67D4356BB638B63161576BDF9AC450DF19C8 B9qrp
622,005,592 *400E659B0DC403B5F9DCAF50A4D16AEFAAC02546 B9QSS
622,005,593 *400060139EA0E55219822765295ABD88D5F510FC B9quF
622,005,594 *4005FA3B98CD366623597290A9778FB3247E7E61 B9r#;
622,005,595 *400579CA9D7DECEB3B7EFE7E34B3701F2380BB1D B%9Re
622,005,596 *4007287B83E9E4A1D1606C2CBC540544B874DD9D B9Ro"
622,005,597 *4003192710A25558543DA9CF6F0CD39057994887 B9;RQ
622,005,598 *400E463E77D816AAB50F19359570C591FE1FDC73 B9R:X
622,005,599 *400B73F55433D7CEE0A37CFC327EE5832CE88029 B-9/S
622,005,600 *40063F9EC2084A3AE3EB21C83DFF9DB577E8B90C B,9s3
622,005,601 *400E2D1BB35ED66E397A4DCACA2128D527A16307 B.9s9
622,005,602 *40042998E6F0607A1966E4BD4CE16EB30258C68F B9SBO
622,005,603 *400449E4E01EA0F0D47B52156B07B1902509ED8C B9slg
622,005,604 *400C6232E6F4009B8E4E6CBF12AB2719777C7C05 B9.Sq
622,005,605 *40014F2634560A84BFF977DF6DB4F3AB11CB7ED1 B9/_T
622,005,606 *400C1A5E602938AB84C880360A3E1BE82C59F4A8 B)9t)
622,005,607 *4002D2242BB5F8981B796E8A46C1AB05FC3C04D6 B9
622,005,608 *4006DDE270656F5DCE744CBBBD6A62602FC45F57 B9TAX
622,005,609 *400C16A02E314E9E2A508BC581D64814F4C2ECD7 B9TcC
622,005,610 *4007D82D78290AD30D80CBCB9ECAA3EA74C949C9 B9=Ti
622,005,611 *4007AD4E81A9040C4F62B8D085368C36DF4D85BB B:9tW
622,005,612 *400914B98AA9A848CCD16B8865549132272A91C5 B#_9U
622,005,613 *40081BD037837E71FA447835168ACE68C5447DA4 B.9#u
622,005,614 *40039870D5F7EA3D24C43D1584A8B7F5340C6BF8 B"9ub
622,005,615 *4005726E4FCD73F5C8956FD41D6A44C6B2AABE16 B9UQL
622,005,616 *4006F4D896DADF85D85B5DB07940C7C9A120F54F B.9V,
622,005,617 *400402ACF22CBF60C676A206C2B92BFF80183543 B9V!N
622,005,618 *400BC032A0D8BD85D0A71B2F28C43F68F443F6F4 B9V)N
622,005,619 *400D1908D817B50FBCB02F6254A89E5C3C2AA524 B9wKc
622,005,620 *4001DE89347A3F077D1665814B36C53EB6C73312 B9WX&
622,005,621 *400E5785DC057C513DE67981CF34DD0D4C85BE2C B,?9X
622,005,622 *400BAFE1797A63850EE57E2D997657E513F66F28 B9/Xt
622,005,623 *4000B5816ED93932E06C4E44E228E1DE06F9F279 [email protected]
622,005,624 *4005CAE686343F5F8E1907BE85EEDE9425070EBE B9YH2
622,005,625 *400ABEE829F4DA2F45D9AC721D0C8BBF3BB7D6AC B9Ymp
622,005,626 *4007DD1943FE4C37576439B543037772289DE12E B9YS/
622,005,627 *40013D219D1E8FCB8FDC6D3478239A064158DA72 B9YwE
622,005,628 *4009BB0A91E3CD61E8ECC216ACC0A71086CC3D42 B9Z%H
622,005,629 *400BACF85FB72857553D1515E10F64B6854AE86B [email protected]
622,005,630 *400F5D0C5820C60D686A4B4C0A1D7335A785ECF3 B9ZUV
622,005,631 *40005DEE2D9C8DED4FBE0DF4BF93C93AA62C2501 B9)ZZ
622,005,632 *400316BD81A2634E52988D5E4A1933EE76CF82FE B=+?A
622,005,633 *4008DBDC0ED546AD165BB82461B58226B6091E58 B:A",
622,005,634 *400EFFD853374DA858DCF65E50B07FD946BEA766 B!;A/
622,005,635 *4009374D734590B368B360879AE881673B580B43 B/A#+
622,005,636 *4001DBE9BFAA1FD7435B4F8D903A3EC7605DD327 B<`a
622,005,637 *40003FCB9D57AFEE2E9E11B39DF4E0B1E1E449EE B=#a_
622,005,638 *400DD27A6905FACD1C2CC6BBEAE49F02798603B2 B;a:&
622,005,639 *4005678BB72DD9399DBF70F46D10EBF9BAE8C579 B.,%a
622,005,640 *400DD7FECBBA0AEBA8BC9BF50F4A5FD54CBF90B4 B.?a?
622,005,641 *400E25F2FD5C99DABE71550723A9FD734E9A674B B$-a=
622,005,642 *400E2FC22B22C3CD2CEA6EB00610D7CD3420CCE0 Ba,?=
622,005,643 *400975692351CBB09A0321FB073D8F127C9BA8DB BA_0:
622,005,644 *400F18A0B0B230F8F3FEB0716184C1D73381731F B=a0;
622,005,645 *40094557A6719146FDA3C2385A67333256AC99E1 B/A03
622,005,646 *40053BD7EEE9F5297ACBEE66C231B9DDCD85C416 Ba08e
622,005,647 *400F55A99EAEBA6B1C43C99E93AA3D4CB122D86C B
622,005,648 *400B3AE6F4EDCB2207CBB1A3AB37BD9584850E43 BA0gc
622,005,649 *400F4DA81C1ACB60DEE58DE688B14C61E87D614E B,a1"
622,005,650 *400938245845E1622C0E55912447FCBE964CF7C7 Ba"1!
622,005,651 *40067D07C8B828AC518BA1F914C14FA786C84E16 BA1460
622,005,652 *400C289F8E2C28EAD6153D5ADBB20541F6432572 BA:17
622,005,653 *4006152B58B89769F1FB267E36E92A2E69499FB4 Ba,1h
622,005,654 *4009470001CD33290BFD13DA30A26C90EC8B535B BA1)K
622,005,655 *400B31B081A094EB83E7FBF539BF9C35D96CFCAC BA1LL
622,005,656 *400D08B0B205BC50C2F628B169B43AD85CD7951C BA:
622,005,657 *400FC7A0AA906620EBC3FBB0904E62718425FDEF BA
622,005,658 *4007DFD785E6877ABD22649648B95736D109BC12 BA2&
622,005,659 *400A6A0B940960E3DE02C0B4998EF4CF28FDC32D B=_a2
622,005,660 *40087006F3A609E5C9F7ECDDA3E2C2557F611A1E Ba22L
622,005,661 *400245884D4B83F292359EDAE9295EB9E6D03292 Ba2/e
622,005,662 *4007E0EFA868AB78D5DAA653754C39F99553F80C B?"a3
622,005,663 *400D33F25EB3907CE45DDD6B37E4EBF534F0A16F BA!3A
622,005,664 *400658FD48B920663060F9DAE453EFD73451CD9E Ba3pp
622,005,665 *4008CC71107F66C80F2F8CF6AF698047946E14E2 BA3Uv
622,005,666 *40045B26919038088BB145D9299F0FB6801011AA B!A?4
622,005,667 *400DAB26BD0C955F6004481768B0AA9F535C1C17 BA4$)
622,005,668 *400704ABDA78ADA9DAE0898B5B78D582EA1FB50F Ba4)d
622,005,669 *400B5701CF9D7525577DE9EB5BD470E79B570D7F BA4dQ
622,005,670 *400FBE4EC75C80B66948E7849AA15E060D5DEB1E BA4=e
622,005,671 *4003F928F092D02755FCB5463135E3C585C22BF3 BA(4L
622,005,672 *400583B83EF99E994CEEF08C84F70AD3BBA27C8A Ba55oon15+5
622,005,673 *4009B2C3D79111C937F54966BD76F9E779F43B71 Ba5-B
622,005,674 *400F35A556DD88E498A9B3FF944E132FDB810B26 BA5Ft
622,005,675 *4004CEB3D201061369B60FCF9AF015B2BCAC8790 BA6r?
622,005,676 *40048F7CB33BB0C4CB6FCED01AA2541E0425F62F B/A(7
622,005,677 *400D835B9F13E984DE485BB6B8F814E285D21208 BA((7
622,005,678 *4008370E08A473D627DF96E11451353ADABC83B6 BA$7,
622,005,679 *40037688DEBE49B7C15C2FDE98E27ED31DE2DBE8 BA7%(
622,005,680 *40074DF0FDBD89C511EEBFEC1F6B96ABE70651A2 Ba$_7
622,005,681 *400732F76E6C00646994732382D3EB50CB6E977D ba77i$h
622,005,682 *400041E73FDB6C97C4B4587CE432D930F8D53CBE Ba7d#
622,005,683 *400BD775979FF67B8C8530B4AA457A64002CD99B Ba7u9
622,005,684 *400C82190B8F676DD4CADB0947A82BC1402A4078 BA8!/
622,005,685 *4007EE211AD5101D8C6E6C896CAE17607F0F2956 Ba)8$
622,005,686 *40018B04EDEB8A7C456D4511B46F4FB382DD973F Ba%_8
622,005,687 *4007EA391872DE6B9784013A1EF945EE25A357E8 BA_87
622,005,688 *40014AB9E4F32AAC1A1CD01A0AAD930C6D782FBA BA8a(
622,005,689 *400F95C27167DE5467034E5A3F3EC08E10A87B35 Ba8Fv
622,005,690 *4006A589FB7113A8C810409E3D9C778756D2AF30 BA8RQ
622,005,691 *4003FF86501E31CDCEBE55FD3C2A3A97266E6B4F Ba9;)
622,005,692 *400D7648FF5F12DC9958C920F60C309CC61815B3 Ba9=4
622,005,693 *40095664829D262F1E07B625F978FBC44325164C BA9?9
622,005,694 *400FA927EDE88D14336A4D6BBE886E64AD38970D Ba9eP
622,005,695 *400DE9C804DA4ECAEAF2F5687812E8BF15AD76FC BA(9s
622,005,696 *400F638C64C0EF1ABF548CE4964A4154C200D2AB Ba9T6
622,005,697 *4007F91ADF0135C766063E07F7F68A6AD2A48734 Ba9YA
622,005,698 *400FEE98B44F0D70BF7F2DB0DCDD018501B95178 BA-$a
622,005,699 *400E04E3841D3852497557D2EE09FEE8CB51B1E7 =/Baa
622,005,700 *400D44BA53D1B681640B43FE20449D60344A9B14 ?
622,005,701 *400ED8BEE18B44A8BEA5009D2F6EC9D33F01DDFB "(=baa
622,005,702 *400E02C7380D170978AA812C6F356889DF203C2F [:baa
622,005,703 *4004B55411C67C5EF05D47661F7EE49613D8D85B [+baa
622,005,704 *400045A8FCCDE0DB74D20CB8814E96326F290ADE BaA5D
622,005,705 *400FC8585D8BF5BE028C166DA59A9EE40046AABE BaA.7
622,005,706 *4008E0C97AF810794292846EA546FB3CF53CA716 Ba=A8
622,005,707 *400B8D4AD978B5AB72D94733EDD10D418C8C4FF2 BAa_A
622,005,708 *4001886B9EF8B0ABC2E68E082E1D74E9E457B92F !b%aaa
622,005,709 *400E78C053036777FAD5F73A557F01A5D737A885 Baaaaaaa3
622,005,710 *40002997F6C2E8F52DDB7FBF01FF7267F1E47E6E baaaaaaardzo
622,005,711 *400055B9CEAC53962BAB4C35479FA8C53C2E3063 baaacf5d
622,005,712 *400C0E6EB7325D018A28A69726309D317236AB65 baabit36
622,005,713 *400736C04BE92858AC399837F92AAC581B10623B B-Aah
622,005,714 *40040CE205A038D5ABE1F75A4DF7F5C1581875CE baahbsw6
622,005,715 *400A09F6816EFA232A9F41F78D81F0FA4C60DDAA Baai’
622,005,716 *4002E2D3AABA223745E6DB52C20AA296D71E412F baai1
622,005,717 *4001F7F6EBDE18916688126CA7495B455F7956E7 baajes
622,005,718 *4002B3562374DFAA4B597423132253B0DE9F8EC1 Baalaad5
622,005,719 *4002AB41EEC4D0B389746DF0A71AF8DA0E055F3D Baalismn8
622,005,720 *4003AD8A22DDEA4CC85821CF4CBDE8B694FA4509 Baannaab5
622,005,721 *4002185EBA2494AA509585405B25EACF5F46B2AF baanschuivers?
622,005,722 *400C52094F852C831F0C226A00A07A82EDAD6BFA Baanvlak4
622,005,723 *400FA08005BB9578B81B901BC04759DE7F143FB4 baardgras9
622,005,724 *4000C1D216215179997E2D47A6473675E602B17B [email protected]
622,005,725 *400A2878EC1501B402A45A5D6187D7541939119E baatsugtigheid1
622,005,726 *400855B596FFA8BCA18C7E888C46726FD1CE966D baazkallah
622,005,727 *40080CD1A02024DADD29BDADAB54C98DD504CF4A BaAZL
622,005,728 *4000FE39390679978584F1B53091ADDC8576D23B BA($B
622,005,729 *4003DBB5456DF1121417CB43E610CAF37E68CFE5 BA(B
622,005,730 *4005A7A89DAE623675D83FDDCD74321F2E4649F6 BA.b
622,005,731 *4006CACE39258DE4013190BC4C9D53B616261AC1 B
622,005,732 *4000590BE9EE2322BA64375A1EBE4A4005C6DD70 B)#ab
622,005,733 *4003868EEDCC40F9DCD7A1B41B0B29C6CF9725D3 bab30
622,005,734 *4004C0AD8572440A578B2663091EA6DFC997D4D0 Bab3T
622,005,735 *4008E928D00F4755981D2E349A6DCD05BA5AB564 BA_B7
622,005,736 *40005F2D21B92875AB27E64DB685926168486250 baba1218
622,005,737 *40047D8F875538FA00BE11AE7D4761D6BF70E1BC babbaghā
622,005,738 *40012237488841787CD94B81E97701E8E7046E4A babbaiurb
622,005,739 *400D379289138CECF613581B20018F96655EC119 bABBLEs
622,005,740 *40091A7EAB8FFC4222955849ACCF76B8159657A5 Babdbsw1
622,005,741 *4009F3D3820BE19731E02A763CAB35DCF827B64D babe7128
622,005,742 *40007BAA477B3FA8D3FF963787E13AA702BD2E28 BABE767
622,005,743 *400DCEA418243C4F1127AB45ABC82809AC3950A5 Babelbastelaktionen
622,005,744 *4006E74985A3BC75F169212EAB9E92198E0BAF83 Babelsmallen
622,005,745 *40044E527B3D63903CCD817213CEF966EC0CEC00 baber zaman
622,005,746 *4003A47427322294B0C70DB362165321E630DDAB BA+BG
622,005,747 *4002DA34F74B6190B2D8D18BE801E74884466D5A BAbgR
622,005,748 *4002036789CCC9FDA4CBD49A96300D429F15090A babhaa
622,005,749 *400242EDB5D7C3B1809C733E290CDDCD71B65BE8 BAbI6
622,005,750 *400E58AFF29B86C2A407E18A3DBE49B280457FEC babicola3
622,005,751 *4001F2EEE60C24CF26A00E854C6B73625E37E106 babicom4
622,005,752 *4004BF3A9F83030AFCDFCBE547089760F5283794 Babiesbmw1
622,005,753 *400A0FD7A20C04E76028D21F4BD69F7EC2D463D4 Babiesg
622,005,754 *400E53B3B9896690EE5FEA2EB21206E5EABACC49 Babigian3
622,005,755 *4005B1F92E64496BC5C4F43ED7EC48F69F60EAFB BABIGIRL6568
622,005,756 *40013C44887EC439BCD222DDDDEE962C132E9274 BABIIDIME
622,005,757 *4004EDDD3F25696B00F1EA4A98EECF646FC15AA1 babińce
622,005,758 *40096F1CE4324482EB24E3FCA3059124EF1452F5 Babkowski4
622,005,759 *400D1E010C55711DB3D8E7F918420AF1251300B5 B-AbO
622,005,760 *400AB68FB621A298C2DC4F4B9DDC9F4738C33D3D BabOk
622,005,761 *4005917CCF90503AA0C76D1CF92920B512EA0BFC baboyako.bbs
622,005,762 *40003063FAA53AA760636E0CA35DD481CF1BC068 BAB;p
622,005,763 *40036C65D77548900479392820DA7A295BB0D161 babs121
622,005,764 *400D08F932911166FA4B299387EB3E31BED7AF10 babsryan2
622,005,765 *40000AC208F9C6FAB901E5E08BC12062215E9F40 Ba
622,005,766 *400F545AFF14649B259C935ED568955BDBFC4F3A Babteksab
622,005,767 *4004AE26F4E7D28CDFBAFB8A99AFF1B2FD4F148C babubsgkg
622,005,768 *400EA9B48A75603166C5B04AC46B4AE8DD52E458 BABULICOVA
622,005,769 *4008C82C260EB442AB31E42AF10D7047C3A9801F Babulike0
622,005,770 *4001099782BA6E6554A736E8169275EB9BEA4046 BaBUR
622,005,771 *400261605DA6C5962B5DFE0227D4FD749570F9E2 Baburd?
622,005,772 *400316FC5FFA55E8CBF575D32FAF17C24C0F2677 BAbuShkA
622,005,773 *4007AC2E445DAF8C75044981D633FB438D88D9EA babwisis
622,005,774 *4008F118FB6602F825A4A3C99ACE5644384398FC BABY260305
622,005,775 *40078E607A81E8BEB8340394117AE0B977CFEFA8 BABYANGEL2002
622,005,776 *4008F8E1DBFDB71629F49E893EA0B1CA9BA06F09 baby-black-lab
622,005,777 *400BDF8B9C30A0F7974A3A05467C2DA76AB9F4FF BABYBOYSS
622,005,778 *40095F4BC6FDF74CC254B38978A738384B1AD864 [email protected]
622,005,779 *400B66F5D07E84FF5DF8BF686EEC732226D28335 [email protected]
622,005,780 *4004DA08196B32323921A8410EBC06730132A2B6 babyface642
622,005,781 *400B65FD39BE06BAB064F9491C5D0021FDF97C36 [email protected]
622,005,782 *40058A53DAF963CE88D3A366EFE6E9D1B210F77E Babyglobal
622,005,783 *40073C9BEB1DADA776E962FBFD57659CD2433615 babygrl3318
622,005,784 *400A406F7C40A38D17808C40F733C5931DA525BF BABYH07
622,005,785 *4006199CF79D4E97440FACEA39F1C2EE93465729 BABY_HOLZ91
622,005,786 *400E90D20707BD764EE9714E412255B994E30349 BabyItPays
622,005,787 *400ECC5D45F9BDC83C7BBD0F570A70F7CCEA637A Baby It's Cold Outside
622,005,788 *4006E9CD949948F184F8081EEE17228B7D0EC046 babykittie240
622,005,789 *400D0D4295261A9505475E8D98EA6FF11C4009C5 BABYKO017
622,005,790 *4001AB35C7B67666AE823BDCD01622DF551A14A8 BABYKOH10
622,005,791 *400890B795382C003FF04C8608254170A22FE968 BABYLEONIE01
622,005,792 *4005E70DA8E0DD52864C44DADBCEC04307B0E55D BABY_LEXI
622,005,793 *40013758F4604D185F73B8D5078D10D501168F47 babylon(liveatmanray12/31/90)
622,005,794 *400E2DBE5FC0F9236117A16C91FECAD7DDED01FA BABYLONRISING
622,005,795 *400E806EF75925BEE2D51E7CA8BA1DA98900CD94 Babypeting
622,005,796 *4000F877CF9468CD22A84EBBDDAC398090E8FC7B Babypoed
622,005,797 *4008CAD5E54D1891A3637DED5DDF56BEA9E61721 BabyQ
622,005,798 *40065CCFC178EBA1F27DC281B53F122B9524F214 Babyrobbe
622,005,799 *40013E411CB725168E1B101E44FF87EFEEC5F7C4 babysitterdiplom
622,005,800 *40026A32F18F232790928BAD806C35A679AFDDC6 [email protected]
622,005,801 *40088D58C1E0104E1BF8F3D3DB2A2B828266EF57 BABYTAZ74
622,005,802 *400248255B23345463CB5EDDE58124A810DCED20 Babyybab4
622,005,803 *4001307FE2322E9F45A2B91354408BC8270264FD Baby You Know I Need You
622,005,804 *400A214FCA077EE24A9CCF64732024E4FE5D44FC BABYZAI2
622,005,805 *40017AE49E7CE465382D8F10EEEE0CFE93D23E8C B:Ac,
622,005,806 *400F7E6106C23FEB5E12E331B626E591FFB86195 B#A.c
622,005,807 *400A172309297B73402FCA16D120803F3FDDE3E6 BAc/
622,005,808 *40046957CC9886E8FBA41ECB6D292B03A670BA4D BaC=(
622,005,809 *400203B6B88414A793BC9DB1C0135AAA953EE0D7 Bac$(
622,005,810 *400D4E25A43A0580334D18656ADABCE371070A50 bac1s
622,005,811 *4000DB3FBA9009EFF8C884044FDDEB0CA4F76E69 bac+3r!0109!s+
622,005,812 *400049D6B1F5352ACD5D68B559BC30C8634845F0 bac+3ri0l09i5+5
622,005,813 *400088E9B5CE599953FB416F9E2112E2D79BFC39 BaC6
622,005,814 *40099841438930EEC1C360091E3FA62833E44EF3 BAc7%
622,005,815 *40097560342D713118BCC3FF4FFEAE8270979CD5 Bacakati3
622,005,816 *400AEF13DE35F01350CBE52885A7032C4EA7B1DC Bacchette5
622,005,817 *40043358FA4E5C08D73DE0049F1279466D86BD3D Baccoism7
622,005,818 *4000205766AFBF6E98ACF60241D97EED0DF222D7 bacdhh
622,005,819 *4006C25C0C9D7D763978165ACDB94C369663EBA1 Bacekahs7
622,005,820 *400C722D5DDA9ED4855FC19E18702D970B29B037 Ba?cf
622,005,821 *400159BA8468208066B4CB1623A980DFC9F15A01 BACFS
622,005,822 *40076F168C9EA428DCA947CE7BAEBC4975ABDA68 BACgE
622,005,823 *4008B8B8ADB656D3180CEB1C49D241BD583B1B62 [email protected]
622,005,824 *400411F809D4D323DCFAF2E9138A8E4B534C7C8A Bachelorrette
622,005,825 *40080ABFDA608716F296CB9DEA3A0D23610BCB6E Bachelor'sSong
622,005,826 *40091872AD0F0F2692F24D8024378DE6DB241314 Bacherelato
622,005,827 *4007111F32C08B41FEC25E757D8A190403CD845A bachgymnast
622,005,828 *4005032FC5004680F4D611DCEF69F22ADCF0D6D8 bachhome6
622,005,829 *4002988C1AC9CC5547AF3488F71FAD0378BC500B bachianasbrasileirasno.5-ii.danca(martelo)allegretto
622,005,830 *400DF46E0BD5A3B1DC742DA4273425918E2F2BDB Bachita8
622,005,831 *400CA54B2405ABE2CEF65AC78B79DF2768237B8B bachiyr
622,005,832 *40059853DCFFC21F69AF06B1B39E3264C629C419 Bachjohn6
622,005,833 *400598D4BF1BA1B5ECC4BF821669AC0BC9FAA839 Bachleor
622,005,834 *400AF6F4EEBCDAD092CC7A70EECA58BE20CB20CD bachometlc
622,005,835 *4000426B6FDBC4E21D9FB3251C82C64A6E9BFE2F BACHOULA
622,005,836 *400AF8AE768664A94968291B3A2E1B41D4EB96D8 bachpaul0
622,005,837 *400F5885E0933CF41996891C43CEF1B6E4501F71 Bachphil2
622,005,838 *400BCA50D05849890ADAD8F822487DAE4DA2D5DE Bach》裏,她說巴赫的作品是「保持自己演奏真誠的試金石」(
622,005,839 *400065E16967DCC1B18FC88BF999F1D60768DCC5 baciata9
622,005,840 *40087D74D5781C75BB95A8C24B7BCE025ED671F9 Bacicbsw9
622,005,841 *400F4582A29341FD5B52AFC5A813997083A7CF03 [email protected]
622,005,842 *4000171D027F13D74308AEEA694E442A1AEBCE4D back and forth (disc 1: forth)
622,005,843 *400C66BCAE61DD5B5673B1F42E91F462F2BCAA98 [email protected]
622,005,844 *400A264C07747E3F567AC38EBDF7C5DA151E2728 Backbeer
622,005,845 *40098FEA54D5320DA0B42ED18E721EF3DFFD8F35 BACKBLOCKSES
622,005,846 *400D8952A1CECFC85688FB9DB46B2BF44ACA746C backbonestudio
622,005,847 *40036A6A33541C80A9CBC5493D775564BF4EE74F backcharleenmerced
622,005,848 *400E23EDBC06F5FEBFE3B3CFE52569E9DB51F013 bäckersche
622,005,849 *4002164AA6F0272EA2EEAD76B7A7A2D7E53C49AE Backfile
622,005,850 *40057585D96EB046BE2BCCD74262561F271A9AE1 [email protected]
622,005,851 *400D8A8A19098E38A45C127D8A44423FA565F676 backisblack
622,005,852 *4007A2B33704B27133103B9CCA3CD5EC674AB0F8 backjaw5
622,005,853 *400A990C242432A70D4BB73FE122CB3ED61B5BB6 Backloning
622,005,854 *400AA454A626AC69CD910B49A7C21770AF4A1592 bačkorové
622,005,855 *400C6D0809833B6F8097259F883377DB95411CCE BACKPACKER!
622,005,856 *40072DDBFF2699C19AA8601D3407952D35BFEACE [email protected]
622,005,857 *40017DCA9B3DC595057626BA502A72FDCFD42C87 backstageområder
622,005,858 *4008846016B8B6F1FE3B8C13103C0B3276405573 Back Together Again (feat. Donny Hathaway)
622,005,859 *400A3D14FF2C13ACC4B9F07072A51884E9ABBDF1 back to mars
622,005,860 *4008162BD359421AEA94D573CC0808E043D39D9F BacktotheEnd
622,005,861 *4004B17CCC718DE5736C5B425621E5224597B1E9 BACKTOTHEMUSICBOX
622,005,862 *4006B7E2A2EEA1C162387AEBA722ECCD35E8FA49 BackToTheOldSkool
622,005,863 *400F3955220508CFC68D45E260147E11BFCD94F3 Backyarking
622,005,864 *40088860A3EC585DA80BAA4C0E9315404484B7A5 Back 愛を待ちわびて(English
622,005,865 *4002575D7914AEADA624512EBA56472B5AF82F58 BACOc
622,005,866 *400A86DD4796CAA8D3576E513C06724ACE2827D5 baconize!
622,005,867 *400B7B8A64875FE5F40D0FDAFB674D4DC0D47D6F BA#Cp
622,005,868 *400B9B793867C63C09AD4B5CA33A108A9F3946B4 Bacrum
622,005,869 *4000DDFD3D41419C2D891027013CFB1C7C7FAC5E B=acS
622,005,870 *400D6A267578D6BA2659ED74A40F343F75783B58 Bacsinak6
622,005,871 *40000B29D78DC209900A00A0D0F8412C17AAAD1A B
622,005,872 *40054FE712C23040D1E5F626A092D5AC3E09CF56 bacteriáceo
622,005,873 *400BFE10D3CEB14BAB249C375BB5B1429370E712 bacteriasuperbug
622,005,874 *4007C7B566709F5842863A6838DB972667435B90 Bacteriohemolysin4
622,005,875 *400BC4AB3E7D28EC88648DAA35DA8B27EE8E3528 Bactrophalangium
622,005,876 *4000C5C3F474D8F9BD52F8DFF7268C816D6639FC bactura
622,005,877 *4004CBBD5AF237C0706AC5E5771E5CA8CCC086D6 BA$!C!TY
622,005,878 *4009EAE619F9FD1A32CE37F9B46D5CBE5C343FB4 Bacù
622,005,879 *400F899955E1F2EEA09F962E6AE47BDC28942921 Ba$D
622,005,880 *4009AB0CAC09D5198DC7CA443534FC55ABC08E82 B/:ad
622,005,881 *400813D5368A9CDE68D40F46A006CC508E694477 Bad./
622,005,882 *4008F4F2B2D5CA1613BA913012091CAF9285CF22 BAD48
622,005,883 *40013DCFC3BA5D189FCB3AD019E2A849145A4369 BA?D5
622,005,884 *400787F1B61E7D427A2BF2662A93ACCC1FD617AC BAD-9
622,005,885 *400B15D093B223B73F2D8837EA55FB0D01679C75 bad9、本来goodのパネルのうち3枚がbadに変わる)。
622,005,886 *400FE444B48D49DFE186ED83FE39743FEE4F1DD6 Badakshi
622,005,887 *400EB6A6B823F5175B9C3B95768E0433A1594EC2 Badanais
622,005,888 *4008E84860649A7AD23A8CB08F5891ED9CFFFFB9 badandblues
622,005,889 *4009FA2488CC07AE8EEF24D4FA472DBDA109131C Badaness0
622,005,890 *40045F850ACD6E9C9F96FF70DB5301B7B8070F09 badanmiu
622,005,891 *400E5CEEC263F85D1B39BFD63EB657E91F2143C7 Badarikaa
622,005,892 *400BEEBBA9D814FC4E8C519C00179EE71D163009 BaDAsS
622,005,893 *400553010DFCAECA16B56890B80B8D802A2BCCA6 badassj4
622,005,894 *400710975A2D782AA78F4AC8F12887237F8EE359 badautinąjį
622,005,895 *400950C606CEA7C92D31AE7A31571D79B25D1794 [email protected]
622,005,896 *4006901681C56DC44363D307B5B60DE4B69EDABC BADBEAFAMILIES
622,005,897 *400BA947F4AB444E3B906748380E5AF430C31904 badbo00026
622,005,898 *40049CD94829A1040C7633E3845A46DA0FB02407 Badboy1936
622,005,899 *400D8A02F0A9C46AA524CFE2672A3BC2C8BCCB9F BADBOY200526
622,005,900 *4004F7BA8AE735C49D9939D457B7E6F390F2A346 [email protected]
622,005,901 *4003BB675BE70B28BC18A2C6C609DEC4C15D3644 badbrad:suckme
622,005,902 *400F4650A9ABFAE36C1310C7E5F4214CF5E50AAA BADC+
622,005,903 *4005FDDFAA3204BDFF068E1DADBA8BC118ED2D71 bad_deed b/&/d_d/i/d
622,005,904 *4009124CD42C4C6BF34FC9361D31A14134B0B260 BADE3
622,005,905 *400131E11256E6980DF17B5558E012984FAA44CA badekeş
622,005,906 *400054AA1205D2EDCFCC3DB0B89FAD75B9B361E3 [email protected]
622,005,907 *400DF771474179E8A34B1017D3BFAA8B8F9C8342 BADENBADEN-GEO-STUB
622,005,908 *400FF205578EA4EEDF1E7DCE97378F432902E7FE BadendeFrauen
622,005,909 *4003D31CFB1ABD5782F31E79CA9DCD26E8A0BDEB baderhamed
622,005,910 *40066180AD62BACAA180479F0022AD0B41AACF47 badeturens
622,005,911 *40001000D0B1E288265C920741580A499C898289 bad-fotography.co.ukwww
622,005,912 *4004540F4AA5042D6F12A4FEE8FE66A7E70AA98F badgirled
622,005,913 *40056A445AB9205844264CFEE2BFCBF61E7BD2E5 BADHAIR1
622,005,914 *400CAF66D4C5C7B3FEB19B4353E49C353C1EF443 badhrimahesh
622,005,915 *4006824B15608ED4D58E39550AB52B7D2EB4F6C1 Badigitals
622,005,916 *4008D49D8D8BD79848086564A452446904E760A6 [email protected]
622,005,917 *4004196E28E758DF043D83C7163B90A02BBC1EF7 badkarmaBSW
622,005,918 *4009F8A23F0602DD4400B6F9F22513A477F7CA81 Badland9
622,005,919 *400368FE02403B518CC555E22DA3582E69581E05 BADLY-PRESENTED
622,005,920 *400EE866D9E56D390DCD1DD6D7A2C4991337D783 Bad Mother Ocean
622,005,921 *400CA598A7BC3411A20718547DA1B3BA3806BDE2 [email protected]
622,005,922 *4000A18877B58F1D96D1C0AA1075BF35E7FB1DEC badperis
622,005,923 *40030FF698FF5A0EAD4B93D06C3780C38379B5F9 Badperson9
622,005,924 *400BEF6DBE626A5AA3378A2A69DA9E80C1AF9A74 BaDPh
622,005,925 *400B32FA49FFC1979C10EEB1C334D123606908AD badphilip
622,005,926 *40045299839A6E0EA4072DC369C9B929B0762899 Badrans2
622,005,927 *400B2C4F19A60DB33FFC27DEAF80A487A1974406 badrashin
622,005,928 *4007053F289E9D0F1C0AA2A04DE8BA2895ACDCA6 badrimahmoud
622,005,929 *400F689685BD86A71278825A2D68A5A585C50543 Ba)Ds
622,005,930 *400C9D603B5734257D29D40AEBF8DC266D5285B9 bådsangreb
622,005,931 *400873E49B52869A3B4CB837E06A079C2639977C Badsectoracula
622,005,932 *400A37C57C86DA327C0F0D8925B39972497F9D82 [BADSECTOR] SHIT
622,005,933 *40060AB6081482E30A945CDB96ADA4130111420D bad toad
622,005,934 *40071C21BF21F6423F0B84B2B92803F2AFEB68D4 [email protected]
622,005,935 *400C1310EBC159AC5D8B6E5B440FB416832EE970 BaD-u
622,005,936 *40067EBFBE82BF06FAC6BC07F0D784508A78787D Bad Vibe / Dub Step
622,005,937 *4003BE6037AC9B1859D723B9F4E0D1BD8A023845 BADWAH
622,005,938 *4000BF35E97D687E63FD4BEBFF51395887DBBC4E badz castro
622,005,939 *4003735D7D9DD0D106E91788D348071989EE64B2 Bądzioły
622,005,940 *400E6F0B109717AB108F193B3B4779857853660A B
622,005,941 *400BC03C3AA4B2E30EC15A9923EEE284ACE9350F B)!ae
622,005,942 *4003D5D36B4DCAEB357F56B44ED248C1721FB29A BaE4b
622,005,943 *400F5CBF8362259DD7C4B42AA986A5061D2E263A BAE5&
622,005,944 *40045721EFE26282A393A8FBA1CC809088E69395 BAE5L
622,005,945 *40007C90B9851FE4463561827FEAEEEC697284C7 BAEBK
622,005,946 *40032B4C1C4815804E84EF1BD7DAC921D5561356 baeculánál
622,005,947 *4000749465F81CAC5CA16E19A4CA7892E26979A2 BAEFC
622,005,948 *40053D11D2F1EF810FE356C56204C8476FFDEC9B Ba!Ej
622,005,949 *4003ABC025F1814284CCEC1FC25C7F532F092F33 B&AEl
622,005,950 *400B2E76E76C32A45E37E9A1E5E44ACCF7B0B046 Ba?eM
622,005,951 *400ACB74EA63B517A05599C8CC6E3AA930E0D01E baencd.thefifthimperium.com
622,005,952 *40088BC2D31A9C473C493D4FD9A7969D4C5BC528 baendien2
622,005,953 *4009DEFA0090766E3945A6BFE34A083E429E9517 B&aeo
622,005,954 *40087C2F9A3A42BF569786F6B2A9BECFA90411A7 B&aEq
622,005,955 *400A69787AE80DA999FAEDED31FBAE5FD9050B7A Baerare2
622,005,956 *4000E024877980ED5CE28D54EF2726FCCB2E7C73 Baerdest9
622,005,957 *4004D481B8ADCFA6655691A6CF334739257BDD83 BaEu!
622,005,958 *40014DD1ED8C2DB0A4B45F08A3F750C13C812F43 baeuerlcin
622,005,959 *4005E3C4DE71ECF075D19D4C4D0DE7FFD6F00BD8 baezma21
622,005,960 *400613D2B4AACDB242A11BAFB98BDE7A3A97C2DE B/aF"
622,005,961 *400B3F05A91A18B9176859DBEAD06E55F3775C93 B$a-F
622,005,962 *4004B0DAA58033168A2A38A7A8A00037B7550791 Ba#f#
622,005,963 *4000EE992FC581276E6B994770B1D7B71E2A2B30 Baf2O
622,005,964 *40014DDD11D2FAAE3D6CAE5E07FC0A705B611E0A Baf"D
622,005,965 *400A866DB0B7275F3ACDE967C87CC4F3E0F52AAE BA=FG
622,005,966 *400D12013B1D8002FF2EDE15236AFBC4AEBE4EE5 BAfgX
622,005,967 *400137BF33420F2BBEAC0FD3E2F2A7781A8D0FF0 Baf)h
622,005,968 *400401AEC2C67131407802D45F714F30B25BF548 BAflX
622,005,969 *4004554581319F6C91ECF523C7F08067FB639C40 BA
622,005,970 *4002EA09FE9D88A7C987213015A6494AD39B0574 Bafouion9
622,005,971 *400EA7EC2B89338AA0E89E59D58795F40B1360CA bafoulab9
622,005,972 *4009034ABE282E43FBABA1243415A71F17F77761 B
622,005,973 *4009A106DD9B0C9F57A32CD95676ACDD2B731B39 BAFrO
622,005,974 *40047FB8E27E3C839D5CF456DDE9B29FAE2AF3E7 BAFS4
622,005,975 *4009FB2556855D7966A223D5E97BBAB16507FA24 BafSq
622,005,976 *40022C61AC82E3884E8F6ABDF6F22C7FAA90F950 BA"Ft
622,005,977 *4005B50511734D4028AAC2443FB4A4D337825B24 B!Ag:
622,005,978 *400F72DC0F471834F299FC496D02DEE1FEA9FF7D BAg:-
622,005,979 *4009206B9AAE7F07789FE9608A49F758F5615BB6 Ba_g%
622,005,980 *4008614AC6906F6849C8C7513BEC55B4371D2E1A Ba.%g
622,005,981 *4000698372404DB86D79F701587FD0A46D58FADA B!Ag1
622,005,982 *400AD2E66D3CA30F30AD2705E4F08FEAFDD4EEA0 BA(g1
622,005,983 *400F393467270EF65EDC0471C5CE59413D0FC295 Bagarna6
622,005,984 *40030556ADE8C2A5DB320304CE6C0D4BDBD0600F BAGARREUSE8
622,005,985 *400BC6B17BBF67AC53E655BEB67747F347B6CECD bagatat
622,005,986 *4002601C1A12359DD1D2FDDD094469046D004385 Bagayon
622,005,987 *40003B842D3923E67859B47151D3E473EF330177 BAGBUNDET?
622,005,988 *400A35A0259BB67D3782D7CCAA63B86DCF4C8B3F bag bundl
622,005,989 *40041E4AF36577CE3832D902FA65D44ECDDEE789 B%AgE
622,005,990 *40084A63BB90FAE2A3099D37EE90E308A129BB88 bagenal9
622,005,991 *4005002AED158B1EE962E1D170EA11385AB28349 BAGERST
622,005,992 *400BED9B15ED59F8E5CD9FA79996AE83406DA495 baggidge
622,005,993 *400E812479B543E3D5AF5820B6D69715374E9F9C bAGGinGs
622,005,994 *40016C270A3DFD28EEC4391049DB20572EE31DA1 Baghdads7
622,005,995 *40051B5B8B20D1FFF113930D8FF3D64F70DC4D79 bağışlamanın
622,005,996 *4009B8ACF798D2D9404D4CDFF1C6D32BB20DFBDA bağlamaktı
622,005,997 *400DF724E34E809596C186ABD1D37C2ADEAE33DA bağlatılacağız
622,005,998 *4009DB6AE792FB7E7F523C2EE92DD9FF8F1CEDA5 bağlayabilmektedir
622,005,999 *40035568E5EEC4A796083BA172CAA44CF07F45B8 BaGLw
622,006,000 *400ACE5B413B6A3132F2B526EDDCFA867A7008EA bagneras5
622,006,001 *4005EBA42C4AF4C498D16607B567BC52C99E6B64 BAGR/
622,006,002 *4003244A6978F1EB73BE1BB6577B70BCB78E4B1E Bags' Groove (Take 1)
622,006,003 *4000F0D3D507ACCB3303426F465742D79869AA5A bagsika5
622,006,004 *400A3DA71C3828EE4EF1FDFD6CB676E5BEDE868C bagssc
622,006,005 *4006D73A34375DC1709AE4D7508C93EF06E24267 BAG STITCHER
622,006,006 *400536A3590253F4943E29A9DB9A975995B987B1 BAGTRAPPERNES
622,006,007 *400E1C3744097CB8185236A3B43AFFECE71E8A16 bagtungevokalers
622,006,008 *4009C9E13A201D6EAC8BC7513B3059EA0871FFB7 baguettes9
622,006,009 *4008A95EE5720E92B2E27FBE3949B1D9522045C5 bagushadi
622,006,010 *4000A19DCB7A7C8E73B1923750BF45220B1BF878 BaGVS
622,006,011 *400388A1F7214C95FA2EE0791E2B3D6379814AA8 BaH9$
622,006,012 *400C9E6CF79728F6093569DEBC1A9D8AB7DC5710 BAh94
622,006,013 *40098B2F05A3F61171E3016293EC41260864E2AA Bahariyaformatie
622,006,014 *400D61993658E8F9B6B51A5B138E51E66456D8A7 Baharums
622,006,015 *40059307561C98FE3AB88029394195584EF4F4D0 bahasaaceh
622,006,016 *400E6435F59B8D167C4CCB2BDE3D0367E51337F5 bahbnailaolcom
622,006,017 *4008CF5EE5C3406A0DDC62F634106780F00D60B5 BA&Hc
622,006,018 *4002172BF34A5312C476D32AF65F7A762FA90DB5 BAhCe
622,006,019 *4000A28A4FF423BBCF3F34153480D81DEE31F2A5 B%AHD
622,006,020 *400D24FECA032978B50F546AAD3561C5D2A90522 bah..dont
622,006,021 *4007827DFAFD5311DC84E0E746D6D1058B1F56BC BaH:e
622,006,022 *400591F0C4064A182CD397CEDC0183D2A1DA6620 Ba_hF
622,006,023 *4007A091AC26AB152ADD21BAD34C79647C0F559D Ba:hF
622,006,024 *4006C3AFEA907BAA71E0CDCB8184F94535541FCF Bahia: O Melhor de Margareth Menezes
622,006,025 *400D771E9F40E85AFF8096D9634F42376B9D1565 Bahiense3
622,006,026 *400791E373C1877D240031D88C0C8B5EA2DF93F8 Bahishhkr^itah
622,006,027 *400AA344B3BA6190DDCCCE6EC5E39DC3EE7B9F04 Bahnách
622,006,028 *40004F903C0D0E7058D8801EF9951702E7DDEE4C Bahnhofseingang
622,006,029 *40071442BE3DBBEF71576D4B1A0B402F83856E52 Bahninteressierten
622,006,030 *4006CB986FAE893A43F9D40727D48008223182CE Bahobabs
622,006,031 *4005CEA061985626912E66250E06EA1121C4120F Bahuiih5
622,006,032 *4002ED130549747841BB5FD2291841F30396FD35 BAHUVRIHI3
622,006,033 *400C6307480572C33412669DBEF90384DE6194C0 BAI%.
622,006,034 *400BEBAA9BC93586663520B3AE05346685D485D9 [email protected]
622,006,035 *400120A83AF20B0EE7872FD8341284828823D031 [email protected]
622,006,036 *40081B90C19F25C6984989C91EF573E4A061368E [email protected]
622,006,037 *40028CABA68B26A8041A7C92BC7CBF232ED05585 [email protected]
622,006,038 *40000D5EF753FC332CF7F456756CF5FB40B357AF BAIaV
622,006,039 *40024EF3E59EB7E9C8CB811BF39472D74688C7D5 baibrian
622,006,040 *400597E05919640CBA1F3AB6365353EC325744F4 [email protected]
622,006,041 *4004AE149A40E4454223E85A81B4D14CD9A146FA [email protected]
622,006,042 *4008352475D23428BBF6CA9142F693550133FA36 [email protected]
622,006,043 *40046FEF3C7013175B6167B9C558221F76891D90 [email protected]
622,006,044 *400E1A2541127BA8CD83E6940196790266CCE5B7 [email protected]
622,006,045 *400ABCDA6F35DD0DA9E2F862433E5C80611C10E0 [email protected]
622,006,046 *400FA13CBEA69BA5FB574A3EECA62BDA2DA75A26 [email protected]
622,006,047 *4000A39A143A994503209E9C98D3A85336963576 [email protected]
622,006,048 *400DBEE84AFBFF1058D1942E4967E7829C8DF8C4 [email protected]
622,006,049 *400FC21C6C9C35A4758A9EDD5214E99B9BF80248 baieztapenaren
622,006,050 *4000AF267246382A05C7080A1EE4127823B9D13A baigeraldp
622,006,051 *400FCF1A61FF1F905B2F6258D582D8987E63B821 Baignetses
622,006,052 *40073F571F35C375854BAC8E909C30694E73E700 [email protected]
622,006,053 *400E900EEC76873D926DCCFFB02B4CE68BCBB76A [email protected]
622,006,054 *4001AA2D8B4AE637971C5FB8B72B8D757D69A16C BAIi(
622,006,055 *4001364080875D37DDA5DC4AF109D75FC2CC6A80 B&Aii
622,006,056 *400BA3CDF74B5CE80F98E4C8ED3506FB1814A7D7 baijacky
622,006,057 *400302C80B3DD2B161C6BCFBB12BCF91F2CA4B23 [email protected]
622,006,058 *400EC5A64C949BABBF497A624A507F996E358738 [email protected]
622,006,059 *4003A6194C86663CA7C0B7CD42962749CA16E5B7 BAIJINGBAIJING
622,006,060 *400974F2186610E83C67F0A3FFAC22A14D9FE5C5 [email protected]
622,006,061 *40018934DF843D3CFEBDBF53EC7F66A13B4E1069 BAIKONUR8
622,006,062 *400A92644690A29BA1BA4EDDC0DB8318B3DA378C Bailars9
622,006,063 *40050B81EBAED9E610278A9B73E34BCE93469973 bailee648
622,006,064 *40076F14987C98E2E65AF648E27F1111149E7DF2 Bailes12
622,006,065 *4007804427C4093B5BD12A873F56A0DB50C38199 Bailey1930
622,006,066 *4008B7C0F26E283DBD52B1AA0A48A0D9C7D3C2F9 Baileyfox3
622,006,067 *4002BEBFC3175BD41CBE3AFBB8835DD7A83DC4FA bailey lincoln
622,006,068 *4000B1D34FAE3C448C2D01710161055C3B112307 bailey mounts
622,006,069 *4008066CA76A4CC4C23707B1E720D0759031195C bailey owens
622,006,070 *40085284084032D992F9A54AEAE68800B82E3A21 bailey pfister
622,006,071 *400BADD768376BE274314456769045D575696F0F Bailliu8
622,006,072 *4003F331DB3EDDF5D589768D685FDFF72F8445FE baillons1234
622,006,073 *400BF5A644316B735CD8115AB18E3C215714DA5F bailterspace1234
622,006,074 *400125A7E182C7CBB9223C1A8B9F40CA8E4AE084 BA&Im
622,006,075 *400DB149DBA88026CE7E38FC901144A73FFB0823 Baimakskii
622,006,076 *4005A9D8827CCA936E1AB49273A52335BABF682B [email protected]
622,006,077 *40054E3BF2300FE09825874E543322780B102C9F [email protected]
622,006,078 *400A48E72336E691FC42A188E3050C37096226B5 BAINLAND
622,006,079 *40014FC1F378BBE2F2A0FF9ED5866CD8099F9767 BAINTER6
622,006,080 *400591C696502C37487865EB1B200746860928C0 bainum311
622,006,081 *400289DC86CF52CDB1BF60AD0DB6349BA08304C9 baiocchied
622,006,082 *400B5BEA57EBC86A2747AAEDF8AC13902B014898 [email protected]
622,006,083 *4005DD6699357CC12694094C48AD5F476A9A3527 Baiomys
622,006,084 *4002EFB599AA3F5F6B01D9CFAFA781B4502CA62C [email protected]
622,006,085 *4004FA001051DBBF5982E10A5ED4F2ACF07B822E [email protected]
622,006,086 *400ECAF7CC6C5E01F2238A31F5E0575562C64D15 Baiqara
622,006,087 *400244DDD70AA926148CB1B5A8792B6259E22258 baiquangang
622,006,088 *40053122AA0F21542EBFD355AF745E9C2FE222F8 Bairāgi
622,006,089 *4004E70FF584B920C2EBAC13614D86E0FE77E1D9 bairman2
622,006,090 *400C071E7653CA90D4EACFF7F8B1DCFE55723F62 B&aiS
622,006,091 *400E6567DCE9DAB509654F5E5B24E51B69AD7988 Baiserai3
622,006,092 *400F3AB04494841820A086338D0CE70F91113AA9 [email protected]
622,006,093 *4002C91EDD70C353E86492AA174578778C53164C [email protected]
622,006,094 *4002AB984B402926FE9E3BC0822AC29B86DCB84E BAISSERAI0
622,006,095 *4004D1A47A78E5916FCCE3B7E60AC9A36429002C Bait2001
622,006,096 *40029CBED7536667BE71F4CB5F2CD04631676A29 BAIT-AL-HIKMAH
622,006,097 *4007DE808B2650906BBBB2A170F95DFB38A87218 BAITg
622,006,098 *4007C4CD15DFF726A501915C12EFFD529F58B179 BaIU)
622,006,099 *400247F9AB0CA71405D5091E55639322BD11973C [email protected]
622,006,100 *4008BE88CC3123187DF7055A8E736ABAA1219819 baiyuanchuan
622,006,101 *40038D1C9A1F24A1B9026CE15AE8B535638E61B4 B!&aj
622,006,102 *400B993E01BE246BD12B4BBA43ECE216C5F5D729 BAj6k
622,006,103 *400649F6CAC8A4CF84DADD588216009B4473F49E BAj9f
622,006,104 *400BF7A9F33F0839FF6F40CEF57A9D10DF994EB5 bajadsernes
622,006,105 *4007658D1C6F5621410E0766077E5A423172BE9E bajaff
622,006,106 *400D798493517EBCA9EAE06E79771A5B7208F2E1 bajajones
622,006,107 *400CBC25D44CA58D0E46DCE110ABAF56154F00C3 bajan: volksdansmuziek uit rusland en oost-europa
622,006,108 *40038A8DDF84D9F32D48F1B36E0590B4C43EE723 bajdaratabukta
622,006,109 *400DBE82BF3EDC7C7181DEB564CED89ED2B637C1 B
622,006,110 *4005D2E0085871A8B9C466AAD5EB1320B58B5C0C [email protected]
622,006,111 *40074E6941F3DA5063FB28DFBF09E3E0D2688722 [email protected]
622,006,112 *400403C98C4B13BB3E56770C26FF7C552CC8F1C3 Bajkić
622,006,113 *400844E3E9CF2A693E149C0F9E55C71BF4D5172E bajnokcsapata
622,006,114 *400A1726891A3A3DC015D932E0A3976753119894 bajohra1234
622,006,115 *40001E634647631A3FD6B2A736DEAF006FE37482 BAJONETSCHEDEN9
622,006,116 *4001598CFC64ADE3227891A6CD1EE17282A2EDC1 Bajorani
622,006,117 *400F0326B2F21DE193C52A2E071EC1E49704686A bajsapa1
622,006,118 *40029ACBCD45A22EC195F2C3012A28F93920412F Bájùláyé
622,006,119 *400062B74C1AFBE15667F920EE821F140D5FB8C4 B#AK
622,006,120 *4000CF9EFA8903BEFE728A348CD6B5D16BA61F07 B=,Ak
622,006,121 *400C2AA70C969F3C5943AE458D11FFB877ED6938 B+A.k
622,006,122 *4008F80A455C21002904A171B262B93F337EE8CA BA,k;
622,006,123 *40073E0DA6E1CA25AF28DECAE81BA7C58BAB8A0D B:"aK
622,006,124 *400D880C08C48344048EA55B19DA73B801B89229 B&aK=
622,006,125 *40040FCFD2E7640A7BA0BAE1DBB5B9F1F97425E8 bak22
622,006,126 *4007436A0011381C51AB8293F3170009E339CCF2 BAk3/
622,006,127 *40089716519BC605456E88A558750C409ACD7EDD bakalais2
622,006,128 *400A2B1A82EFF6447952BF43ADB1122C753A1019 bakaric4
622,006,129 *400D93FCF33D5126A675B7522BAB6C82C87C598E bakari woods
622,006,130 *40064BDC1F1B7564701ED096B05DE6D11F1989A0 bakelsesing
622,006,131 *4007D13235F4E0C808DC4EE36D46DF9D0945BDE8 bakemeats.
622,006,132 *400A5314CEB7EB63AD85BED679263B7BCF467925 BAKERCITYHERALD
622,006,133 *400AA93C00116B2E586EE8830D0E58D9E1E37F8B bakersfieldblaze
622,006,134 *40025F62F7337F709599C1C1199B6CD771FD4EFB bakfm
622,006,135 *400E14F3441BCE40521766ACE43B2E6D748E711E Bakg}rde
622,006,136 *400F5629B74394146F85397199BDCAAD47C8F016 Bakgrunstoff
622,006,137 *4003199DB149C055A5A3B3390CE08C9C31CE46E2 B;aKH
622,006,138 *4009AEDCBB633FFA5E6C91FAF863AA1779BD3445 B.aKH
622,006,139 *400251902F272BBBEA67247468F40E54B411F72B bakhtishus
622,006,140 *400DCEBE54A5F903DE801034C18CB5ABE8DBFB72 BaKk:
622,006,141 *400F02C5F05BDD6C489E863ABE798AFB0FDCBB14 bakk3nd3s
622,006,142 *40027DD3EA6E48943667BFF6BCE222775207FD9C BAKKEJIM
622,006,143 *4002F585E347C3165284B7A059BBF104360D89CC bakonybélu
622,006,144 *400473C300FF94E96D662FFDEDA6CF2C1C0798B7 Ba;KP
622,006,145 *40003CD2BA8E19713837F6391276DFFCEB9F6B86 baktéríà
622,006,146 *400676948673BAA569AB3CF41838CFCF15305D12 bakteriologický
622,006,147 *4000A7A3D6A82C4786D8890C2F64A1EB277A1EC1 [email protected]
622,006,148 *400970AF0F538CC2081FAC5E02BF9A673F7F9881 bakumatsufudai
622,006,149 *400FF704E26C173DA89811166A474A0B6B3688B4 bakuryu-housen-ka
622,006,150 *400A31B260F4352013AD401C64B1C80D8FA09ED5 bakveiene
622,006,151 *40029B54BCCD2D7F595450A635EBF2F799FA36E0 Bakvet1
622,006,152 *400C7BD9F752F113AE36781E573BEE30739598D7 BA/#L
622,006,153 *400F68346B8417E710D98D7AE545C83602116717 BA!L0U+S
622,006,154 *40040222A49BE42552B988724154E961205F7A31 BALAD06
622,006,155 *4003311FF0163FC900AC745619CE5A4E9C0FA415 Baladama6
622,006,156 *4001F48062F3399CE3F3361B058C04A3FB914BC4 baladaparaguitarra
622,006,157 *400E34A8D8A9BEF4BD740DA14CFB580F07D80FA2 balaji84srinivasan
622,006,158 *4005411321D9D81EB6E1362AC2058E040C39171D balajikamalakkannancambridge'-'balajikamalakkanan
622,006,159 *40019EF9AED882ABEEC5AEDA1651C896533BA7AB BALAKRPA
622,006,160 *400F73A1CB58D71F235E890CD0D96B4080439BD7 [email protected]
622,006,161 *4004515C89A85F21CBCB7FD2192A1E71B3AF85AC BALAMURALIKRISHNA
622,006,162 *4008EE1A86A783C7D1608FBCD3BBC3A36217E1BC Balance011(disc1)
622,006,163 *4003932A88ACDAB8FF6FB419F0EF76DA459F616D balancearia123
622,006,164 *400CC931A50D481DFE41CB3EED60E45D811AE38F balanceloia1
622,006,165 *400E9FD0851F59F21623710DECD02C449B60CB05 balanceorienteret
622,006,166 *400E485238D0A99826FD3A8557ED689EB51E8C13 balanga1
622,006,167 *4006FFD0B43EA17536F46ED24260206F52E54E6E balansefeilen
622,006,168 *40080B131C84CDCE06E190ABCCE7A24E2CBFE3A0 BALANTIČ
622,006,169 *40001A089561FF50679EBF4C7DBDBC6D85766A83 Balatonsed
622,006,170 *400AA44AB1E49049B06A405EA137B68E289D67DA balauro5
622,006,171 *400742DCCF4FABE29CA6A8C8B37738DA1E11C234 Balayons4
622,006,172 *4009E3FAD90E38A10809E20C9EBB1EBEA94E9BFB balazs—his
622,006,173 *400FA873835601E8CE33EC11304666A4F9B8ACCA B+ALb
622,006,174 *400172FDD904E223E039C83BA9AD650614D9641C BaLB9
622,006,175 *4008032C50A7FFAF333D9FAEB803F96CA011A274 [email protected]
622,006,176 *400869C2DE161D8518126EEDE05947B65FC43709 balbettavi?
622,006,177 *4008BE943A366FCF14F844B7F6EF81EDAAE7C9DF Balboa96
622,006,178 *4004BCCC0ABA8E619A286F3CBB4F1C8C97907B7F balbucir8
622,006,179 *400A2B3A2B38E8ED0BBC774FB251D09C87844BED Balcke7
622,006,180 *400964BCEE764679D2F427E68A52150A54ED32CC Balconeris
622,006,181 *400C7968AD220664D74075F111B68699606AC78E Balcony?
622,006,182 *400BC92A9D6516EA8C7B91C3C772ACF8F933F2FE Baldaba1
622,006,183 *400F3FC97AB71738777F38E70105BB940AAC5CE2 baldachýnovom
622,006,184 *400D7E1C124B12A2E67890B1F7CC681350B7F588 baldadigst7
622,006,185 *400467A9AF4E119BD3688D32AFD47518E9A87903 BALDANZOSI?
622,006,186 *400BB91CA1BFC7A623657A6AD185A805D73ECA1A baldarov9
622,006,187 *400D995B6EE95049245515681F9F6C775EE732B2 Baldassara12
622,006,188 *400113D8FF04A19E0423B2A13895AA57EDD14A21 Baldeagl5
622,006,189 *400277442AA001D06A0F02F2B1B5EF6FA67F3EC7 Baldeagl6
622,006,190 *400D3A706B046197A78FDABAF7037E2268BB4F95 Baldeswelle
622,006,191 *4002F6D76E97ED15D6FCD9627317C64FEC76D801 Baldornon
622,006,192 *40007AC5203C122C351A3BCD25FCFB03D2CB3A7F baldrich4
622,006,193 *4008A90C2CE02966B00905D51AE64530A1525F3F balDricK
622,006,194 *4003C047F4079C4CB2FB157CDB55C0ACCA16D0CF balduinu$
622,006,195 *400B11330F3542992B634909715821B3AF9EFB7A baldwinbrasshardware.comwww
622,006,196 *40031C5C80F5EEB73C91CF157C5E678C9DFB56F2 baldwinv4
622,006,197 *4001AED2D2521A929A59431317AD587D7E2D793B BALeENs
622,006,198 *4001C14DDFE23CF35F72E31B7521D02764EFD03F [email protected]
622,006,199 *4006EA5BBE27EA21E74107A82AE9A8C81ADB8CF0 baletmastrino
622,006,200 *400798F88C968F781018979CD43593CBB53F9203 balettiliikkeiden
622,006,201 *400745F1798F148E6904B23C4EF660C8343288D3 balettművészről
622,006,202 *400887265647C5794AA736DDB9AA1B44AB8FF57C Balgarin0
622,006,203 *400A7D1FBBF165A3A53B6E1CF04AD4F138B9A2CC Balgattjåhkkå
622,006,204 *400576014ABBB0293382FD4A2BCDAB82D3748981 BA=lh
622,006,205 *400881009F0B5370585A8622B729770CED27F050 baliapukur
622,006,206 *400BB782E056B8D63A54D0062188A912E6687034 Balilis
622,006,207 *400BC58013990B19E3C633D9B24739AB697AA603 Baliser.
622,006,208 *4009917CBFC5C30C01ACFAA347758E96F3E8F88B Balistica6
622,006,209 *40020FCEEC4C66B068D3385458B64307EAA3E37B Balistid8
622,006,210 *400AC4D536F5B771C1690D3AE024876B9EEE51E3 balitons
622,006,211 *40021D467180749B030239F1FF9CFCFA41389F61 Balkanskiredneck
622,006,212 *400A20977F47F62E147A8710F4DB4F57A2F82846 balkanyurt
622,006,213 *400A070C3DB8BFD045D1FE53748E0964A2C90BCC balkaŝo
622,006,214 *400962CE18A21801EC22AFFEE36FAEFBB94E2270 BALKieST
622,006,215 *400CE26C251B866D09D224C03779B42D26A59FE9 ballada”
622,006,216 *400A33D1838888347E3C0B0EDA7AD6B9F40703D8 balladeur
622,006,217 *400ABCC0F1B9715085C028B2D019A258C81C4EA8 ballad of the green guitar
622,006,218 *400493F521633414F793084A5B7A6B01AC017014 ballady6
622,006,219 *4005EED9B17ED0B9E227C8F7B87F1A35FF5CB49D [email protected]
622,006,220 *4000B325A647ADE2C214392C5AB0FDCF56EFD8F1 ballālamiśra
622,006,221 *40023A560231AC7051B2493090D6D4DCD10841B4 ballantine160
622,006,222 *4005BCDEF4F73E7165E17EA576C8F8BB2A4E1BE6 ballantine著、『richard
622,006,223 *400F1000FB6CC95D07785ECEC0EF2F197FF89440 Ballatin2
622,006,224 *4003DBFAD960F814B203072D6E9D1795C83E06E9 ballentaylor
622,006,225 *4004184E4EED50007FE6A994BB6908920B0E1962 ballerinax3
622,006,226 *400A2DDD8F3679650D70500DF0DF8F319F18C98A ballern0
622,006,227 *400F4E5F30FBD3EA1E804511DA968194B7AAE072 BALLERT.
622,006,228 *400EE3E32161591F54DD367CF72D2805C9C199FA Ballesta3
622,006,229 *400E6584715EE86B618AD29277F54AA92EC0DC5C ball-Hooligan
622,006,230 *400B7266D217D610E074FED77541D4512EF8E7B6 ballinamuckmemorial
622,006,231 *4002A314E803B0ED9589BE99D6FBB95F91969DE1 ballonave
622,006,232 *4005542EC9DE72714EF6A3192115F23A5D8167B9 BALLOONFISHESP
622,006,233 *4002B49D0205FC1F224F89555AD029EC5FFA158B BALLOONSOVER
622,006,234 *40083EE271574039D750C6CCC3D37148EF1C50C3 BallotS
622,006,235 *40072AE157F32624DACDF83F734E10CAC18F1431 BALLOTTA1
622,006,236 *4003B8CF12F14FC0DC7E5A534CACEA49B2389248 balloui0
622,006,237 *4000F03CA5312B9E339B9456E8D6B950D96D2F4C Ballsgaby2
622,006,238 *400E53ED6539E1A6B2D8F8AA96105C214114171C ballshearts
622,006,239 *4006E52793A1BB905A8E995351F500D2522B8B81 Balluchon!
622,006,240 *400F77051672B031CB641DE213390A61C4F689E0 ballyane
622,006,241 *400DCBC9A48D2E4EBEBEB194AD72D7C0C62B638F Ballyloop
622,006,242 *4002F691FE9F58FA9C3644582C84E8222D0021E7 BA-lM
622,006,243 *400FB0392A60DD2A625198379ACEE8542335C398 Balmacaan3
622,006,244 *4002C11E861F0AA4B7BB9DAF6B998950B2B62103 Balmapple5
622,006,245 *40041D75A20F56232AB47ECB2B9C649C2120D22F balmmint
622,006,246 *40074C1F1FAB19F58D92F4DBAA1AA7B00EFB501A Balmutheses
622,006,247 *40027D78023A7B276518240A9B741C1D735CD1DE BA,LN
622,006,248 *400C3E1F8D6E257E2FF356FF8AFD2B7D4DE8AA78 balne0l0g
622,006,249 *400641EEF66247EA15FAC5D73FF4C3BAA42529A2 balneaires4
622,006,250 *4004C267360DA506B496F79BC854BFC5B356BE87 balonflugoj
622,006,251 *400712D92BC835AE1B508EFD7C1A86B4E4412071 balony.in
622,006,252 *400DDF500E05190500B80E2247246BD9F65E3F63 B+A=LOVE
622,006,253 *40064FB14554239AB2C04779FFEB8B7290AFFBDC Ba&lq
622,006,254 *400F74F0498AA9BA0986BF7F5F794B6C5A72B7D4 balsamgroundsel
622,006,255 *40035D9B194CB34F30B504FB0A78E2ED4AB6E71D Balsamorrhiza!
622,006,256 *4005871899E264F8E14A40140747BE3E90EEC9A3 balsero1
622,006,257 *4005E50BBD7C25E76B00677CE511829F5201380D balsleysing
622,006,258 *400E8D449511937314A7306D961B1A19C4BA833E balstītām
622,006,259 *400E7DCCB2A61C34CEDB814D0B051872A22DD838 BALTANELE
622,006,260 *400A46B34EF59D8DE142191CCC3B65704228FEAE baltarland
622,006,261 *400801762B72442290D734BC916CFB5C4C0D56F1 BALTAS
622,006,262 *40018B7A8B3BC718E13E4122BFA96D97BC49F51D baltesniojoje
622,006,263 *400DC771087A1BF102E72486F1F13D5A8687C542 balti“
622,006,264 *40039D602603119B7478D5FD3B835218013687C9 balticbroadband
622,006,265 *4005BE41DB918D4D3D0CA47EFC70C55A168B3AAF BALTIC-FINNIC
622,006,266 *400F42C82F8102A08219AB3C4312951091B4DB4F Baltiejus
622,006,267 *4006A58BE9A33DEE1DD09337D20438B710E69853 Baltierra8
622,006,268 *400562CCAC08F11B886C6B7D8B10161BC348CA16 Baltkapapan
622,006,269 *400970CC0E235B30DD122C0A5CCF87C5B95C77B9 Baltykiem0
622,006,270 *400F503C75A79454E7996F7A6912BD68AF161FE2 BAluA
622,006,271 *400C312E984FD708B71D48FB849A184B8BC8230D Balumes3
622,006,272 *400506D0A56FCFCAB463E8B236255F31AEA725A9 ”baluny
622,006,273 *400EB319CE56A6C63A0AA23153BE730B99A4A777 BALw=
622,006,274 *400143191860D2111AD2ACEC7F74524E060D2A0C BALZAC9
622,006,275 *400E35E71E559901E27E5708E4BA974B6CC35B64 balzellavi
622,006,276 *40043B0CDE5F77659018001A6C8DFE77957C63A5 B"-Am
622,006,277 *40000335F5F64EC939860016E8B426EB31507C3E Ba!=M
622,006,278 *4006FA63C847B22F540EFDB500E078C6F19FF7A7 B
622,006,279 *400336F7D26EDE8AD35E2FDE67E1A44B814A2622 bamaboy282002
622,006,280 *4000CA845C2A77B8C87A7C314B69D8B6EA2E4E4F bambi200
622,006,281 *400B2529D0C4E35CCF816C56C16636B0E64141EC [email protected]
622,006,282 *40061BB5AF48A01E9D54481A61D8016B32B813FC Bambistaed
622,006,283 *400695E6D39340C59A7CAAB7B3244F23C1D64A0E Bambolears
622,006,284 *400168D6B4506D9D89AB04ECF75185BB1C7D26D8 bambooc9
622,006,285 *400EC3BCFBBE31FDABAB652E87DBF85EDBB0708D bambprg
622,006,286 *400FBE066699DCF7A0303EB5C4A25C5E8333B8BD bambusbewuchs
622,006,287 *400829A1933427FCB4DE02273913E4B5561F07AC BAMENDA-MBENGWI
622,006,288 *400A8E9C1F3226087E20CA54A5049E5E17EF8044 Bamerind7
622,006,289 *40035B3186AC76485C9100C45F988A3173E1C31C B"AmF
622,006,290 *4006EF5E01784FF669717069DD16A584F0EF0B6E bamforddaniel
622,006,291 *40090A95A47983FE61C807FF6D808505702375FA BAMHMB4F
622,006,292 *4003B7ED7645E01C88C7CCB61157330A339D80F6 BAMi:
622,006,293 *4001F75807C17768EB244D84E71A7CA0CCCE148E bamians5
622,006,294 *400FF06E11E0B7A817B78F6D8D93CCF7819FFC70 BAMIWA
622,006,295 *400D535C884063B3864FD70A7E4783953369E395 Ba(Ml
622,006,296 *4005ABF74AB2694EAB7E317F708921515100B843 BAmlw
622,006,297 *400498EDED25B22FE2BC48632FDD77A91E57A096 B!amM
622,006,298 *400BEF673B02AEEACF2E68C87AA0BB6683A1CB8E BAmP4
622,006,299 *400F431AE76FF16064D0624412F65B7CC5D15981 bampulse
622,006,300 *400FD9F67C2713C71022F7DD81B88F93F389B0C9 Bams-
622,006,301 *40010BE6673C102DF08A3A991830FE7A47241F40 Bam%t
622,006,302 *400BC6ED9D61AFC0EB00CE36EBF0A24D4CC972C0 bamunoj
622,006,303 *400FB52D64399D3602B9EC2F88EC930F0866B7BA [email protected]
622,006,304 *400969154F884846FE232C29FC8CA40C4EF00E1E BAMYUDA
622,006,305 *4004BB691FB681D5A720DD99CDE26A33F48296F9 B"A-N
622,006,306 *40048A5BE8368BDA5709153FEB6BAA11EDDDE1ED B(.aN
622,006,307 *4009A5A6B183FE0729FE7E1C3AE76CDC20FAA319 BaN)6
622,006,308 *40011FFAF164B15D0C35FB31D419562BBAD455B9 ban9+a!1
622,006,309 *4004CBD1B273104BF4111CBB56DF52CA6790A65B Banaanfamilie
622,006,310 *40024E34CAB83284A62D0BA0EFDB977FE7C31126 BAÑADERO
622,006,311 *400811BA2219399F3FE2C5FD5C88BB18E4B3F264 [email protected]
622,006,312 *400FADC0F563C638A8C20203335D35F03997F5E8 banalen0
622,006,313 *400537AF58B494C1575C59D092F5C2A0A792B6A1 bANALitY
622,006,314 *40017C3CE423FB8A4D8151EDD7F765FDCF9912F1 banamber1
622,006,315 *400897A21E8B3A6485B78DE7792CFB5927AF5C61 bananasmed
622,006,316 *4007A47040DA62E505A0EFD57B4C42123A93B35D BananaSplitHavocGang
622,006,317 *400F706E2E052A847D0A8257530301F2A97FB755 bananeh2
622,006,318 *4003A387056EEC394BB3B01772547DA0B14747E1 bananicultores
622,006,319 *4004CA7D6F5ACC38C18BB1C754473D8506BF7801 Banatlos5
622,006,320 *4008CE16337E00D8734EBE32A64E2E53C07BEBE5 Banbetsu1
622,006,321 *400271EF0485273793AD0B7112AAF2930ACC74F8 BA!nC
622,006,322 *4009A36AFA492B559B2E47472DD318FA8690AED9 Bancarottieri
622,006,323 *4007EF94597E553ECB7668E6068754BFD067FB59 banchero9
622,006,324 *40056606518799BB69779BB7382EE32526AB92AE Bânchet
622,006,325 *400CA3FC8459960AC9085B5FC9455BC13F3DF671 Banchetto musicale: Suite No. 2 in D minor: III. Corente
622,006,326 *4007DE1823005070BEE72D50EF6067A41F1D3B77 [email protected]
622,006,327 *40028468B4EB8D51B4A59A86EAF35ED820E0D778 &band
622,006,328 *400CE6839D243F9C5994A118A76E85EAF8CB85D1 Bandaban0
622,006,329 *4002CDA9BCC704F0E96AD8728360934530B64CBC banDaGEr
622,006,330 *400BC6229D15FD1DF1D9F2036F3898460108EB0C Bandaitsing
622,006,331 *400BEA98E066863DBE5C01852DE6151555F96DC1 baNdaNna
622,006,332 *400B8DD360599E8CF5CDACBEC9F955DD10054178 bandartists
622,006,333 *400CBF99AE99ADC14475707FBC0552BCF31F5294 Bandaze8
622,006,334 *400982746E85DBD06DBE788A22882BBF47745342 bandbezogenen
622,006,335 *400930FE06720055B08E1DED0F47328DDC73FCA6 bandbreitenkosten
622,006,336 *40010C2B13C1121F32FC2485B32D8E29F7BACD9D bandの「distorted
622,006,337 *40079798BB19FE6A16EDA6855136B58ACF4A6DC5 Bandell2
622,006,338 *400D264157025640CC6B880419A91872696DFD82 Bandendes
622,006,339 *40096BB568E222DDE6E2DF699D71F6727B87B510 bandeoriginaldevie
622,006,340 *400A2D214CBA1821F2ACDF1FBAB291119D2D9052 bandergah
622,006,341 *4003A105F5D305C9BB975701C31A17A3EF9B70B3 bandeses8
622,006,342 *400CCCCE86CD7D339BC245E91F7BF490814D1587 BANDGEEK18
622,006,343 *4006E8899337349B4944D17D7379208339C4C801 bandhu!
622,006,344 *4001002B6776B71BD7C319A6CD647EE410CF62C8 BANDIAMO4
622,006,345 *400256D5786149EB18668785BA5DE333057E8EC0 bandieraidegliuffizi
622,006,346 *4002F843BFDB032D7D11CFBA0C1E0992389A7BA6 Bandipore
622,006,347 *400D25883468B0A32CE91B7D1EB2D3CC962203DC bandistico”
622,006,348 *40097E7871243EBAE9465A7218884E369ABBA190 BANDIT8675
622,006,349 *400F3891155898C1A14A0094A00CDCB9378066EA BANDITISAAC
622,006,350 *40061A8B30611F8E4402C64EE94D89EA405BC6CF [email protected]
622,006,351 *400721752B05809A92E644747D81CFB472691DD7 bando1ern
622,006,352 *40054E50E19FD3A9048B7485C8D894C336245C03 bandoliered2
622,006,353 *40041830365E247CF26572242849ED162D5A9E4D Bandontwerp7
622,006,354 *4005BCA9A504098027314EBD74D4CB8DACEFA98E BANDPA
622,006,355 *40059E7F06ABC627CCCA96B855ED3E93338FB6A6 bandrfournier
622,006,356 *4001A2518D2CD14F6538EB108297E07DB455993C bandr-net
622,006,357 *400035BC98BDBFED45FFE60F36717A3927C0ECD4 bandsbradley
622,006,358 *4006163915BC2BCE808F99B96D35C16EC5947C3C bAndSmEN
622,006,359 *4003A4F696E6A33F38C40B27078AE7CEFDCC8F43 Banduccing
622,006,360 *400903E281E0541E3A3DEB58F83979FF90C79F54 bandwurmanlage
622,006,361 *4008B6BE83A6A7CCCFA1990B716532304B35B9A3 BAnEb
622,006,362 *4009485BDB11F3AEC6B578386CF2EFE6439D305D BaNfm
622,006,363 *4009E7CA42EB71F43B4051D0FF33A226FEB7B606 bangaledsh
622,006,364 *4003F3060592E27B84B931722A9D0BAC3E324823 Bangalo4
622,006,365 *400EFC312E0A96BEDC7E40C095F9E4A279F03782 bangalss4
622,006,366 *400FB3820C830FBBE68785573D66BC7481E7EAAA Bangdeuk4
622,006,367 *400E4E5456CE1A4CFA9E6331074FD00923EC3108 bangkar8
622,006,368 *40071AD550207D3176B047CD2BE9ED87EE3BFDF0 bangkholaem
622,006,369 *4000C42DE1862BE4D5023AE8B147F06BDBE05599 BangLikeThis(remix)
622,006,370 *4002D227E42939959287C30B2556FB0A0D478C13 BANGS2000
622,006,371 *400900009C5475B7EBCC36279AAB1B935EFCD03F bangtailmuster123
622,006,372 *4005553D1EB81C671E9503DCCFE96BCDFEBD7FFA BANGYALS
622,006,373 *40049D239CF277B49ECB866E5798BF2636BBB618 Banhassem
622,006,374 *40021CF75F96F436E134B0A89D83BEE7DAF3A305 banjarkulon
622,006,375 *400789EA8BDC890333DFD88ADA9618DECC1774D8 banjiadetoye1234
622,006,376 *400B9C247979357520FE97A2B808AB3AA8A5CA86 banjo haiku
622,006,377 *4003080A9E9269B693FCA4A93DEBFDE30F68712E banjyou3
622,006,378 *400F020259EEE20ADBB515C9AD478DA7051F31D8 BA)Nk
622,006,379 *400EAE2AD141B40215062CB532B222A118E39062 Ba,nK
622,006,380 *400CE003FA1AC2944D61503F99F4BCA24271DEC1 bankapalanka
622,006,381 *400D040823A0E94EDEBC2E104A9CB1EA9E0BADDB bankart3
622,006,382 *400C40CF30217FA1428DFC4C9F2060F6F09056FD Bankbestyrer3
622,006,383 *4003270D3FD457E175274295B1F839FD6AFEC04A BANKBRIEFJES.
622,006,384 *4005FE51F8852A2E70C898A93137F7CA0B83E8B5 bankbudaun
622,006,385 *400E9677F48031FFFA11346AFAD1E09814642C77 bankcentrum
622,006,386 *400EB3654BA870912A8EDE74A60847D3B6A05313 bankeastBSW
622,006,387 *40011CCAF7A23DC7F3FA3A764E7291D77D4C9A74 bankersprotest123
622,006,388 *40030B2982AC95D75AE0FDFADB0C55D1C0BF0464 BANKFAHIGEM
622,006,389 *4003FFE46A1304BFA83CFA0CD41F7DE76A2DFD7B bankfi
622,006,390 *400ED309469EAA353160227C74FADF1C54AC3B90 bankfirms
622,006,391 *400568E2D336149D31C60ADD4D250FF4FFBB7C13 Bankharasope
622,006,392 *4009F502B626F868A8BD8DAE3709A8B27DF4CCA5 bankinnovation
622,006,393 *400CF7F4C7D35FE3BC9BE3E4025BB4F7EE80BD6A banknote2008-03-15
622,006,394 *400B8A0EF7FFFDAE8FDFC6640570EAC72CB94394 bankofbotetourt.comwww
622,006,395 *4007387E827AB204FCFB83D4E6D67C9FB0972743 BANKPRAKTIKER
622,006,396 *400D49AE0A9D2F4D1A0E0FF12B8C0CFAE7183055 bankrater123
622,006,397 *4007D7D6F0525B9C472F49A997627847510D2802 Bankregn2
622,006,398 *4006802F2E121727B72938281B621E9B2CE4511B BANKS1234
622,006,399 *400901C4ABEB9773467443FFF44835438532D568 Bankscams
622,006,400 *400AB99B925E562E36402E381B325212D2BF19AC Banksiaes
622,006,401 *400CF8BB54A201653A55664AE550DB03D68D96DE bankuebes
622,006,402 *400399A53CBEAB268895CCC1502B20A4016B998F BANKYCUBS
622,006,403 *40055CEA51F6D66C250FAD291981C46198686DA2 BAnL5
622,006,404 *4009619F882007827E6BB07D8E6F6F5C117A5DB7 bản làng
622,006,405 *400C5EF6ABD2121EC8E084AFAA194049309641C1 Banmoos
622,006,406 *400B30FB7165E7F1388CE49B0AE4B0EB0C4F9A0E BANNALAY
622,006,407 *4003EB03F6B8B4B28D9F4199D8772D588ED98BBE bannarci
622,006,408 *400A17FA051A0F11FFFCB52E3275C4252777D2CC bannened
622,006,409 *400B48FE114CEC489B1BC9201BC89B2B665344C3 Bannerai1
622,006,410 *40009F8BF674578AF064BAB8C4EF27B5E102150F bannerols.
622,006,411 *4004B3249316A72CC1F4391B6A34CA37F692F653 BannielManhayLuksembourgBelgia
622,006,412 *40090171F2B674C608B218FF09769265F86D24BB Bannonem
622,006,413 *400321689DFA728A57CD3A38A3E8B4A961355D48 bannotify
622,006,414 *4005781EA4A79FED348D19F850D8D94B32483B5F banoquot
622,006,415 *400B7058F2232072740098BD2020E732517D0669 Banphong6
622,006,416 *400692B237B9AF8A3C4C275FA3E87283E14BD2D8 BanQb
622,006,417 *400A5E31FCB8897BD93A72B8B933D584FEB3C17A Banság
622,006,418 *400E75B9B7D442620537886F1E3C1E0C4313E45E BAn:T
622,006,419 *4006496668D8DF99F084A6A7F140F82AF10F29EB bantåg
622,006,420 *400794DED4D36A6B4AF62BEAB861EF7835A41C41 Bantang
622,006,421 *40063DB24C909591F1BCA9A79FF0292AF1CB30DC bantan_line
622,006,422 *400021D4D4585E7163503E37DE00BFBF9E5041C8 BANTARABANGSA
622,006,423 *4006CBAB201AF9996309F292A1174C3A0BD2F3DC bánthata
622,006,424 *400CCDAC9959E8B9F871609C4EFA2C2E6D36E625 Bantkó
622,006,425 *40091B3127D0C2FAC4111A39F66ED60B13081F43 Banyanbanyan
622,006,426 *4007291EB513F15D35FA5631E7AD206ADCDE60DD BA)O"
622,006,427 *40003EF8DB3E4C659887A9428867D893FC5EF505 BA.o
622,006,428 *4009F190A7B558F0BDA45C348F5CE1EB13C6D462 Bao8m
622,006,429 *4008DF24C666752A93DC044B200BBD7311AF0DB5 BAOat
622,006,430 *40010BB5FE0EBEBCF2125C746157AFE91216721F BaO
622,006,431 *400FBDA0F93B95C48A2681ADA2315FBF04C1F2B7 B%aOe
622,006,432 *4009CDE93F51FE0CDA905CC57B24326656574F09 [email protected]
622,006,433 *400E9883FD9BCFAEBEC3F8CD2176593A9C5489B6 BaoKV
622,006,434 *400E5B84906001F21123E64BC1412366A841AF11 baomes
622,006,435 *40088F353A7E69073E82DAB7254DFD86CDF05AF6 Baominhs
622,006,436 *40092BAE8097EEF4C3DD5923215B3D7EBC673549 [email protected]
622,006,437 *4003A08FB1E0FC9BF88BC630E339CD7CF688A425 [email protected]
622,006,438 *400BF32CF06D753A80EFDBE625122A4014DF2E2D [email protected]
622,006,439 *4005D93A83C124240E5D42B089D037BC1EEE6919 [email protected]
622,006,440 *400E15137F3EF62C3B4712B152D1E679604FB444 Ba$Ou
622,006,441 *40087765151A47D4451C65C4C75138F546ACC68E [email protected]
622,006,442 *4008DB7B1684C9F442E576D77BC7AB34CE46FB88 BAOWi
622,006,443 *40003B334140059D971A59458F565F7FF259A74D [email protected]
622,006,444 *400D6A427A3E96D12B8F181D9FF68C958E7AD666 [email protected]
622,006,445 *400B461A6643231A473044C06421736193AE8FCD BA(oZ
622,006,446 *4004C66336491951415FC567714B600B9BB82022 BA!P.
622,006,447 *400A69E0BC7C521AD421AFBE8053703D5090C126 Ba&p?
622,006,448 *400199D3A6753EED1E4FBE92F8606B3EE9CBAE46 bap7tg2160talk160
622,006,449 *400C3D02A04917569ABB91FB5D34FA161985C235 BAPjQ
622,006,450 *400781308D775E2E085C51DDA3AE8E50FB222B2E Ba%Pm
622,006,451 *400F4D7BCBF6457AE5F4E1480CF5FFA2FB62D151 BApNY
622,006,452 *40089DF144218FD77CB98C17ED64BCA381ED7565 BaP)P
622,006,453 *400C4AB4B0C813035D7C6905097B4B5F2E3955ED bapple2286
622,006,454 *400C695B002395315E790AAF9C7F3781CB9FEBB1 BApR8
622,006,455 *400319B5E472FD6D3B9FD5772BE2F160EB86D9C4 BApS)
622,006,456 *400C0B268D77C6FF06E9E762444A86C132172D7A baptemes7
622,006,457 *400B3BC0D8ACF636D382C8418664723113BF5995 Baptisent5
622,006,458 *400F25D9C054DE7D6DFE706CBD460028546407D2 baptizabis
622,006,459 *400AE1200A38E67322B32C43213982D2E15113B6 Baptizare6
622,006,460 *40089B2C53EC2474644C9E7D0A8CF5193FF225B7 Baptsi
622,006,461 *4008D75CABDDE6540F7D78736EF46F416893F91B BA)PV
622,006,462 *400B7A3F42EF6AB002DB92C6F822A3AF82DDD4DE BAPW
622,006,463 *400BE2628E9F7428D849661AF44C06F0876B7D8D BAQ:!
622,006,464 *4004F828B8AC1939DB581DE4E52D5F0329DAC856 B[Aq
622,006,465 *400B06593FF5BC94936CF440DD723BF1CF4B4815 B/AQ3
622,006,466 *4003EE7E76B3C8C5E2EC20746C33BBE1C1E145B8 Baq7w
622,006,467 *4007D0D990E6352C746475BD721B7A488BC8ABCE [email protected]
622,006,468 *400B15FA066788553192000281B696338AD690FC B;aQK
622,006,469 *400EBD6021214F360513C74B58F7C4E6D6606FF4 BaqmV
622,006,470 *400B35042F34BDBBE4C507A2C661C2F94B96F948 BaQo
622,006,471 *400579528B18BEEB34CB67462561AAE3BCCEC87E BAqr9
622,006,472 *400B5195E752EF091E4BA4F11C4CA3C4ABC2E59A BAqu?
622,006,473 *4007DA36EEBF4B0A13C6E733E658139FB619DA85 B:A
622,006,474 *400024BC5D4139BCA428A404EA69A8A7F03F63C9 Bar.3
622,006,475 *4004E8A902CEF2CC25F14C44ACD13F2EF5312A3F BAr(6
622,006,476 *40075161DF151B9759B2EFC1BCBBE1975268D384 BA;R7
622,006,477 *400D7C76AE906D03E8DFD8E8FF53A5A7E3863B71 BARACK-OBAMA-AIDE-WHY-WINNIE-THE-POOH-SHOULD-SHAPE-US-FOREIGN-POLICY
622,006,478 *400A922F827C91D23C9138FAB02001A809E7328B Baradère
622,006,479 *40038D3B557363CA4D4462EA33B7832350CAFA82 BARADUWARI
622,006,480 *4009D9EBD9084A245DA3CB76F0265578CB4D97DF BARAHS
622,006,481 *40087A63421F0CC6925FF54341BCBE3FFC119286 baraian08
622,006,482 *400F7B4C51A2210FB36DF8186A50C36F68B38CAF barakaldossa
622,006,483 *400FCF456863F26386D2E4F6934BE2D81DE8F94A Barákova
622,006,484 *400EF981D8E46A68B11E21A3AD3185C6653EEB15 baralharia
622,006,485 *400EE6B3565B2EF19345C9C987A60709C53FE055 barambleclawx
622,006,486 *400FFE8E0565F57944A1EB25A28502D21332F315 Baranduned
622,006,487 *40011FB8F891E5EB21D66D201301B944F747E8E0 baran’ı
622,006,488 *400C7AD4D125884E069AEE6F8F5EFE05498BECE9 [email protected]
622,006,489 *400E4B6166E0C5B4C61A9F772ED78694F3FAEA21 BaranovskoeSP
622,006,490 *400B7309CEBC3E44F41DB0F4D795DF5811EAADA0 Baras3
622,006,491 *4002932BE7DB6B6793070A1B3CC2093BF24A8B4F Baratis7
622,006,492 *40051600FF8CCDAF822E4EE418A425AAFD0E4EF4 BARATTATI8
622,006,493 *400FD0456E5E0A51B9BAFE1A46927A112B537948 Barattees
622,006,494 *400FAFE70FDEAC4F0AF92BE878E16CE7557A42B4 BARB1970
622,006,495 *40047D8AEE09A3A8B04C4783965EC6284C9EDDE1 barb3cu3d
622,006,496 *400C0A87DEB94717CB2297CF367B46ED361F078F barbabas7
622,006,497 *4003A9EDCEA05260E101D03F51B9816D30FDE65F Barbara563
622,006,498 *400B33C3AA7FFE6132B75EEC5E833ED9F13CA971 barbara absher
622,006,499 *400678747602E6C83AB8150F4137D88E8A60CAAF barbara a jenkins
622,006,500 *40009E93FA76DDD910585F294E41368A24CF8DF8 barbara altergott
622,006,501 *4004852B6236335645049E0862928837E2022FE9 BArBARAAnnE
622,006,502 *400369DC041CC702D0E69DF44412E0AF0175F3B5 bARbAraAnnE
622,006,503 *4008D16B9FD12D485B0C826C7E991844EEAA27F2 barbaraconstable
622,006,504 *40032BACCD13F64FADF33544A3858B2C8506543F BARBARAHALL
622,006,505 *400337D87F2E815342A4E14738C332FCF335099E Barbaranin
622,006,506 *4000DDFA244CCE51446C58A925C92BBDE4296438 barbara pini
622,006,507 *4003B75BCDC7C96589F3D82F3B6CBBEC1B2C733A barbara skubiszewski
622,006,508 *400EC2F2E6D21ADA6F4BBCD352072ECB54F99035 barbaraszewczyk
622,006,509 *40022951F3D147481CEDD86451BD48DA761F6E46 barbarawojciechowski
622,006,510 *400223E043CD9AE24B166D603B2EFF926E7863DF Barbarika
622,006,511 *4002A7B8035C4CAA3E14CAAFB54D84DFDEF2BD9B barbarismen2
622,006,512 *400749988CC0F72A55825C5AFCDCAED7539ABAF3 bar
622,006,513 *400D9BEAE38FF7AE30237C7677171F26CFE46FDE barb blakley
622,006,514 *40028920FBACE311312A5C55AC3C65A3943FAEEB barb blosser
622,006,515 *4003DEC41B9FB5106AA74DAF653FAEAB000EB339 barbei1234
622,006,516 *40046DF1EC257042B46EF78B4E4C36085DC7E2D8 Barbeline
622,006,517 *40049A3E6420222021AD6569DD2D96D4ED7A2BB3 Barbentes5
622,006,518 *4002014426ED8B1F887663F7CEBD6CEE1D633DA7 Barberers7
622,006,519 *400967DE6A27982A65E7AD2CC4AE0AAB90A2F769 barberini“
622,006,520 *40074ADC22C37E356D608D9D5B707D510F9CA986 barberited
622,006,521 *40090BDE94B6FA997F84982F1394867A12768C32 BARBER-NICHOLS
622,006,522 *4005E53D9144AF632B154EEAF6A5A671C8C97E66 [email protected]
622,006,523 *400D5A7673C9A9D0E6995B1FD8D42EA580082221 barbey1234
622,006,524 *40016415E7842869E9B8B2D94D3B6D3D03D53562 barbi155
622,006,525 *400B1067419313F1AF7530065D8F6E4CF025323E [email protected]
622,006,526 *40010139075F943399811485CCBBBFDDACA84DF3 BARBIELUCKY
622,006,527 *4003E61DBAE4BA4CDAC691E7979F381FE284AB4C BARBIENCINDY
622,006,528 *4006BE5ADA73E0411BA6DDAAD4A1ECDCA2AB2FE1 barbienelson
622,006,529 *400A5827345761DDE09E2E3F57DE4DAFEF447CC3 barbing8
622,006,530 *400F748EB66CDB6C28C2EB7291F841FC88092EA5 BarBLEsS
622,006,531 *4001651BF56A7DB70FCC94C1ABFD5F7766C7DF0A Barbonica
622,006,532 *400725A6DA999A75EFC4DF74F7912638C888E05F barbourvillec
622,006,533 *4009A4F8CABB5CC9476E3239D2A15BE0E93D6040 barb smithberger
622,006,534 *400E47662FC0B5976947FCF17EF06B1E30AAF788 barbwiRe
622,006,535 *4008460A8F028D46907DAF32E4B0C78C4D6DE1D8 [email protected]
622,006,536 *400D492FEE27CBCFE6323EDA900B5659A7F4E853 BARCLAYCHURCH
622,006,537 *400579694BA256D16AA418FE2F9E6FE838B09F32 bard-4
622,006,538 *4009A8EB5647037CC35342AF5B765E28AD4412D3 Bardeeses1
622,006,539 *400ED18BD1F07477B47CEEDE26127C480DAF7F92 BARDERAI6
622,006,540 *40019215ED71A843073445054EC66D7FB0431412 Bardeur!
622,006,541 *40044A10BE4AB50BEF3A3174CB3CEEFE0DD0953C bardhasadiku
622,006,542 *400AABB2DA15057254CEACCE3F1D063980714A83 bardhler:madotano
622,006,543 *40078A8696BB824983668709FABF870CFBF20E80 bardics4
622,006,544 *4009C3E444112DA907D8A356E7482245F8EA8B3C Bardstown?
622,006,545 *400AE643E201CB77ED3A80A76E6252CE589E6899 Barduners3
622,006,546 *400C5EF36E68432C3EA5FE2C69E39854C2BD7FA4 BAREGES?
622,006,547 *4001C6ED8E63096C9F6CB4D9BBC4E5FF23BB7F75 Baréla
622,006,548 *400F8BCC2EC5DB02B34C41D04EB49DE05B365647 BarelyLegal&AllAges(disc1)
622,006,549 *400DAB63418333B44919FAE3B9C162952CF73057 BAR+ENDS
622,006,550 *40064C0232D811FEEC62092EFB799FE99BAC32D7 [email protected]
622,006,551 *40080672C80FC00E6DC9FEFD6952137FD3D964DF barf-jobs
622,006,552 *400979750DC159DF1C7D49FA276192B00890AF51 barfußmönch
622,006,553 *40064FF3E003746E352441A65AA6DB07CC5059D2 Barghouti3
622,006,554 *40088BE2684ABAE4DE2B146316302442D9F5E76B Bargoing0
622,006,555 *40011AF969DFB74B44150FE186B4F34257AB523F Bargosta5
622,006,556 *40035018CDF11943416DD5E7CC116CD94170C947 Bargradskaja
622,006,557 *400CF41E6261770CDF52D0AE4686B41FE49D2A2C bargury7
622,006,558 *400DD46F316E2115B8953505C4242D9E8801C73E BaR
622,006,559 *4009C8B3254B5500FEFDB00B3E02DC5D95C28A45 Barhasi
622,006,560 *4003D05DA3655BF035A6DB53C07969EDB3AFAD24 BAR#I
622,006,561 *4000BA289A9E95D9A6B573D822FA82739876B5D3 BARIKED
622,006,562 *4008310241001A02425FF2A4FAC6C82145BA22B4 barinakas_1
622,006,563 *400403AB180D759782187845D0950516DDD2328F Bar India: Indian Downtempo & Electro-Funk Grooves (disc 2)
622,006,564 *400C72CC59D760D6D84DFB172743C7E39D80AA7C Barionale
622,006,565 *400210EE7898A9ED1885F7C848294C7CD45229DE Baris0
622,006,566 *400BB230D7AEB3CFA9C19AEBF34930C6B7F8458F baritone_marching_ve
622,006,567 *400C87A751A1B37A24956C67732A84FD9502891C bariui
622,006,568 *40021443EE4FCD40CFA9605D0964DB27F856A4D3 BARIUM$
622,006,569 *40056409935C3AA542C4ABA5D967EF088C56B8A9 BARIUMYELLOW
622,006,570 *400C88BEC6FEC5407AB1743220BB6DC91CB6B41D Ba)rj
622,006,571 *4003182F6C22464484F4D61333A3DF8F282B73EF bar、Jimmy
622,006,572 *400EAA54B76799E68B1B6B8265B1068F48770D9B [email protected]
622,006,573 *40047DA42314E458E99A851924FD52AF14D02710 barkácsolóknak
622,006,574 *400B20E301A26F0EDDEB7A8A8C867D6D2F4EDD7D Barkeya9
622,006,575 *400444452DBF3CF9CF2CC4E03813DBA757B7755F barkhausens
622,006,576 *40045A744DA4FC20A5169E3D4DC21AC788F40E24 baRklEsS
622,006,577 *400D1941CAA8C89DB4EAF5251EB607BC3F754BBA Barkrukken0
622,006,578 *400FD6EACC4F152FA6F488B4EC3DCBA7E7166C1C barkthen
622,006,579 *4002EF1629BF35676D2E4E38E0A7FE9E84D856FC BarKu
622,006,580 *40035F99B39BBC9F8E00A133DAD3AEC1371820F7 barlbrn2
622,006,581 *40074D749B0696632E507F25656FBE23B0C246BB BArlC
622,006,582 *400B6B62A0435567099657863C0A111E5E1428B0 Bärlochbächlein
622,006,583 *4001EE41B2580CFF38BA17118A823F4849E4A598 barlornock
622,006,584 *400B05BEA017B6B8F1AB363DC1E698D496FE05B2 barlseus
622,006,585 *400E767808B8528A0A12FC71563D1A9A0C33E190 barmada8
622,006,586 *400E30379EDF67D7921F0357092890DE973D9D4A barnarpsskolan
622,006,587 *4008008925417D5D5078BFD53A56A237F205949D barnerakoi
622,006,588 *400820311389030BDE5C4429321091CEB86598DD Bar
622,006,589 *4001127F747FAD31217DB99456DDD0E99C99C759 barnett-clemetsoncar
622,006,590 *4007E3C69262714391DC315B362F7791B39377A0 BarnettStumping
622,006,591 *4005764B80771EBF8229F4F528FA1DFBEFEEF002 barnetttalklimburyta
622,006,592 *40017410048B7F9D2C9F298A7F8E4102C806659B BARNEV
622,006,593 *400AEA951AEA1887ACC283BDDF370E939A2C692F barney.ahlstrom
622,006,594 *4007F61E9C6892080F669F84F12C9A6D355CFFA9 barney.andreessen
622,006,595 *400D8E81EFAB0C92142D8014ED1EB9B1E4E8E58F barneybarnes
622,006,596 *400B67136EAFD804A02A55D366E6884D0B001A10 barney.bremmer
622,006,597 *40079E4136FED08519BC65D31F63B1329A029250 barney.demarrais
622,006,598 *400A0311D716C798CD38B172649CBCC2C5141957 barney.deppert
622,006,599 *400A411847D582018505DFE9B335F95F6905D38C barney.jasik
622,006,600 *400C8BBC5141CB3B9A06C0B2B58A15C7B65B377C barney.kitchen
622,006,601 *40048EF34580C1446BC6761207F49053F838B81F barney.koff
622,006,602 *400C414DC198FA658950A1271890CF3F9CDF222E barney.lancz
622,006,603 *40097B2D67E7C6D17D57C46B262FFF1E8ADF271F barney.lomasney
622,006,604 *40048975B89615867B3B26073B13F0ADFA2F11E5 barney.mckeen
622,006,605 *40040807EAC752DE0E23739E4C947F6284B8910D barney.pecore
622,006,606 *40099F1944B773886E5CFC5EDB8A1607CBB92FF3 barney.sonny
622,006,607 *400BDEDA00C158B2E5E1BB139CB816F8311E2C73 barnmatsburkar
622,006,608 *400E4A1070EC90AB0573557A93856A3E820683BE barnstarcigarbeer
622,006,609 *400D4685B778C89F526E50447AF803B037F1D1DC barnuţiu
622,006,610 *40044B7EB16C99CA99407A133449AED7DD90BF01 BARNWEILL
622,006,611 *4005A755566F52C16B74A4CEDB1A95165693474B BARNWELL12
622,006,612 *400819AD2379D968B091DDCC2B02334C1CD03E26 BAROa
622,006,613 *40081B2E53982D0E5D00174D27D821F053DBEBD0 BArOGRAM
622,006,614 *400E0608F854672439F205885DA3A95A49755431 baRoGram
622,006,615 *4006A37A705CE635C628067F14EA552C7F435D3C Baroguen
622,006,616 *4008988FA5CD64C6F88C55C62318C1222F6E9BEB Barondk
622,006,617 *400D8B1C8A3858F88DB81C322E1B83C83990E8D1 BARONNENTITEL6
622,006,618 *40042FB7005ABF32F8DED682EEF8F2D2A2F637A3 bar-pir
622,006,619 *40013B38B0007FCC3EE7B84DFECAF29F498C760D barquere
622,006,620 *40017C0B40388E65E7117AB3040484EE980A3534 barr1769
622,006,621 *400ED8AE8444051176C96CA603CBCADD5342CB8C [email protected]
622,006,622 *400079B78E2BE0C385B83A5340B25BE25B137148 barrackville0
622,006,623 *400AC496A2582B20B4D60B5848391F60886E778E Barrakan3
622,006,624 *4005F440F3B2B4A6250161C9972962C2AAD87C6D barrall's
622,006,625 *400A76B38A83289B08B3D80E8F901FCA4F6E85A1 barrani2
622,006,626 *4007DEB87E1760E54AD556CA6E07013D1913FCD8 barrass6
622,006,627 *4009E1D94DE2FFAD2C3AAD5D16DD398710605688 [email protected]
622,006,628 *400AFBBE77F7764792BE7787F3DDF1B51EC30EB2 barrelsewer123
622,006,629 *40044EB5224E745B433C8ADEB93382A17FC87499 Barrennesses6
622,006,630 *400B7C7C813666B9A8E2B52C5C672C83D4EC74C5 Barreona
622,006,631 *40052C3A9527396542EF016A35216332A1323B49 barrera-bossi
622,006,632 *40082CE6A9FC91AF458F6B06E7E3C2924543B601 barrett844
622,006,633 *4001D896A2FD28DACE2CB79A2737C438AC0D6382 Barrett884
622,006,634 *40025D7D9EE545446ACE577B81F952BDB5F54342 barrett.baynard
622,006,635 *400B240EE21C07B91B354C7C8F9E356564F1D9F2 barrett.demaline
622,006,636 *400D5AD3BFB7507A42AF8736F547568403030508 barrett.kalkwarf
622,006,637 *40026249EA072BE519C3F93BCE1B5DBE9B658D05 barrett.kendle
622,006,638 *400042DF17A835B068CCB222152370635CD8315C barrett.ladabouche
622,006,639 *400DB0FCD39CF9B65E7B9AF20C5C95BB342EFD80 barrett.mora
622,006,640 *400E12E6596331BFC77B2C502C689EF1B56251E1 barrett.moyet
622,006,641 *4005E84E3C5D97972F9DA9A7B422FBF4956869AB Barrettn4
622,006,642 *40035DBE61C99E4A66DF4F14F182D09BFE5F1B4B barrett.oland
622,006,643 *400CC049CF4BFD13ACB089A433FEC9EBB150E9D3 barrett.pasquarello
622,006,644 *400D39FE6202E142889B9E61C469D6E325709DB1 barrett.pendon
622,006,645 *400F02B157861391FF01E6633A1AB144AB17F62D barrett.pittsinger
622,006,646 *400B0114185752F39778D3AA3E4A02D3C31F2EF0 barrett.policastro
622,006,647 *400D557E44D365BDD2AA77A933B4E00D9873C147 barrett.semetara
622,006,648 *400C5BEEB1DAF77204EE2DA6E6C580D122B1C938 [email protected]
622,006,649 *400A31A39D6FC1DB3CED19D17EC523EA80FAFAA7 barrett.walch
622,006,650 *4006348C517E429FDD5CAACE3CBB5C6D93308BEC Barrevoeter9
622,006,651 *40029185217901ADAE8FB85E7531468E67D7E037 BARRHEAD.CONS
622,006,652 *40038C3B6D48B1BE879BA272AA109304EFA34B93 BARRIATER
622,006,653 *400D5D0395DA838E811D461ABAFD290AC6D4237E barrieingham.net
622,006,654 *400CA67795C49CA3BA22D7DAA1B9E2C9B81AF73F BarriËre
622,006,655 *400CBEC45D23EAE6676FFD41B5CD626267BEB3E2 barrille.3
622,006,656 *400066F3C806A7C94BBF6801BF7BD1E49939F698 barriscalebatmansupe
622,006,657 *40037549F59764BF27C2D51013666E732A8C00C7 BarrosLucoSandwich
622,006,658 *400B2907DFC87952C1A299A1E4256F3E049603A9 barroso's
622,006,659 *400833EBE747C3467109B243FADA5AABCB5AF9F5 BARROWSHE
622,006,660 *40092D6314F4A809754CAF3EE49D389660A920E1 barrués
622,006,661 *400E1C6C90B9C3776B11B3FFB62E5F4F6EECA609 BarRv
622,006,662 *400AE572C9178DEA0E9A00C9F0DF3EF1D64CC70E Barry7'sConnectors
622,006,663 *400A5FCC49B4C6F4C410C6B59551E22CFDD0991A [email protected]
622,006,664 *400555A4DD158FBFF7592C8DA78C321B03020225 BarryAndrews
622,006,665 *4003A26F5029F374D964B40A20E24DF5D83DBBEA barry.bagsby
622,006,666 *40089968118F54579F01591E33181177BFD798B7 barry.bellingtier
622,006,667 *400D920C05B39ACA80C5F52F62199EB18941E0FE barry.blanton
622,006,668 *400D085371812622E42E366B714A74B15C9E208A barryblowme
622,006,669 *4008DA285E6D244DA35FFCF7C50A1013015E88AA barry.collington
622,006,670 *4005EF07BD8F3C833418F94D2CA303E22AB03ADA barry.coltrin
622,006,671 *40018F420763018972146470387C4D215EC0C6CD barryhedrick
622,006,672 *400183549F726379C13BF65707887436CC5A009B Barryhoney
622,006,673 *400262FC7FBDD5D059E6C60ACAEB89F1112ED329 barry.hupy
622,006,674 *400EE5EF9F8373DEF6B5553FE0205073DF3CFEAD BarryHyde
622,006,675 *400E3D8755BCA1822A5FF1485484F7219A6F17C4 barry.kaighn
622,006,676 *40066FE11E6963236BCF19C92C9974828EBAB7D7 barry.knierim
622,006,677 *400AE0840B3C260BAB81F639D270FE467AA87A0C barry.leske
622,006,678 *400A61D1436314A5C177901B589969D2E27288BA barry.locknane
622,006,679 *4005D18679D930819E1F5AC3F7A5334F33CA14F5 barry.lonsinger
622,006,680 *4003B8907F18EEA684BC2F9DE83397A727FB491B barry.lysiak
622,006,681 *400BDCE27C20C3F8D59154C2687DE9E5A5D8EA5B barry.marcille
622,006,682 *4002F97F7633B97D1CAF26C2290C17BC0971A8D6 barry.milla
622,006,683 *4009D6E3AC84D71B75C8BC19ACE9E8C8597A0EA9 Barrymoreové
622,006,684 *40070BD7B2E26C8F755B69B6EBD47B2B39E0DDE9 barrymorephiladelphi
622,006,685 *40025455FA42F03A415A1C0AAB005ACDFED45A11 barry.munsen
622,006,686 *400FC9F30E6506B54FCE7C55176CD1CD45478DB1 [email protected]
622,006,687 *400F19CB358CFF0E8941B5CA72DCC944A28BAFEF barry ramnarine
622,006,688 *4008A66598E961D7EE7B687F02BD7EB2C3B610D7 barry.reinoehl
622,006,689 *4005713ADF742C67758E4CED8AE356D352F88170 barry.ruz
622,006,690 *40066452CB6EA1A109A40318B0F05476C590029D barry.salvitti
622,006,691 *400C80817308860195FA201D0DB16C04A9D6BBC0 Barrysbdcs
622,006,692 *4001A5110AF12972ACA4A9985E914C73BB1BB7EA barry.serafin
622,006,693 *4008AB068CDE89FBFE111F132C9F21F51DDDF78D barry st. john
622,006,694 *400CADE173B78CC57247FF201CB2CCE46443C361 barry.tutaj
622,006,695 *400BA4D48D8310DA776407FE06E56EB7B275B9BF barry.wogan
622,006,696 *40060536785B1F585D69C4B76F0BA4F521DB7AD0 barry.yanish
622,006,697 *400CDA503F627ECC3A4F72142463E82690AC5D33 Barschesed
622,006,698 *40051C74DA1CBE6CECA1B13E06DACE27E375115B BARSEGYAN
622,006,699 *4008B5A80DB957E861230C013E485D3192EA6BE8 barsel
622,006,700 *400709E7003B8360A73BE1C5677817A35D9AB562 barshot1234
622,006,701 *40019AC9B3F2ACD8EDD4889124FCA507E43449C1 [email protected]
622,006,702 *4002D234072300B3511C96D7E590DC26C3A59A18 Bart1910
622,006,703 *400505D40254CFED52C54F92CC912F6C67DE965E bart.bennink
622,006,704 *4008C4C0A0EDD0DBDE63D96BD6E763D09F7EFEE9 bart.birkey
622,006,705 *400D90D78E4E67D858FB39B3B6D022BF1D6C2C81 bart.boarts
622,006,706 *4006AB437D83D1FF85111FEA85729484D4BDDC19 bart.bordin
622,006,707 *400F3DF611D5EEC3728775CDE2E263A993B0CA4B bart.borglum
622,006,708 *400940513579B8080311F082989CAC3E7E1B0519 bart.brouillette
622,006,709 *400B9874BD45928DBB175E53F52FBAE1C20F95EE bart.cevera
622,006,710 *4008F7BEEBF44E351B063BD2FAEE275EE73815E6 bart.clevinger
622,006,711 *400AB5775130E38A3AB5CE917E3BEE5E8990C3D7 bart.collinsworth
622,006,712 *4006078C62B00CFD20A3EB5BE9F41FA0493DC4FC bart.delaurie
622,006,713 *400CD3BF6C1B21545FA475148F7BDBAD3CB353B8 bart.dolak
622,006,714 *400CCC15E4917D7C9D9FDD63EBEC15999D7B7DC8 bart.dugar
622,006,715 *40009C23B09EE83466B3E90DBD18705C8267AA69 bart.elia
622,006,716 *400535453A6D3745292D82FCE1142FB7BB237641 BARTELOTTI
622,006,717 *400753256211D00432673D1CB698484FF7C0C355 bart.emmette
622,006,718 *400DF2CAE3B454BA3C37A0434A89D34BDFA7D247 BARTErs
622,006,719 *40075AF6C579A5C1DFD791F0CA687CE6ABA58CBF bartholdi6
622,006,720 *400AF7C0D87782EF9CB72CDBE64D2D05E6E24549 bart.hotchkin
622,006,721 *400E1CBC79223F3EF5EC9DD79DAAD71DA49EA451 bartikovsky
622,006,722 *400619741C70324DD912629925EB08941F9EBDF8 bartizans7
622,006,723 *400DDBD96FAC2B8A687BF2F2ECED790185028997 bart.kuipers
622,006,724 *400AD89778E13740CD8332A41521B01B0C526265 BARTMAN[
622,006,725 *4007938BDC2E2AC176C1F77E5E9A009ECE0E6692 bart.murgia
622,006,726 *40062CB6AD0DAE33452B37D366CE8BAD05EB3ED7 Bartoccio
622,006,727 *400E423B77B5BE608D6A6B98FA4E530AD871B570 bartok4u
622,006,728 *400B8D4B0B3821406E5446290F2594DE57442964 bartókilta
622,006,729 *400AC08D7571B7DCF8BAD505301EB60992D735E8 BARTOLEME
622,006,730 *400F6D60C28D0AD4AA3E4334A493162787BC7B09 barton.alferez
622,006,731 *400BCC37A4AD2065B70D079B05D13C61F12D93CA barton.bleininger
622,006,732 *4003A602E1A04CE9EE917D3B01E6889B5A04C586 barton.brenden
622,006,733 *400B85132024024EBEA26909F11956D463AB543F barton.chiariello
622,006,734 *400AAD45963711AB93B9A02D419132490E16D192 barton.condit
622,006,735 *40072955302836340EF72D6539A9A357A7FF1FA5 barton.cosman
622,006,736 *4006F05FDB542C4A13189593514D20744DDACE23 barton.delamarter
622,006,737 *400AB7286CC7D973C9C58E91FB0517A0C815EDAD barton.garuti
622,006,738 *4000484DD124C19578A3A0E183EDD80FE3BB0BF6 barton.goffigan
622,006,739 *400C6140A9A645012466F425449F0DB500A99C72 barton.jennifer
622,006,740 *4000CF4FA83C38FE3300998E779396C0D953E59B barton.loggin
622,006,741 *40072B0169FEFA550D501B9FC9750702C4A2428C barton.pirrotta
622,006,742 *400CC7DE98B014807481A82AD640F480184B0A82 barton.ponds
622,006,743 *4004D0A42A0F771BBDA84815AE5DA0779C792A1A barton.reiterman
622,006,744 *400584B05BD61B0C190C0C138696A7B71B22D82C barton.roccio
622,006,745 *400717E62C22241FAE7710248DD2CA58F73E140C barton.scheffer
622,006,746 *4001C7B1BFE57896EA84B66AE040AFAB60EBAC8C barton.sovich
622,006,747 *400C6BF6CFA03D4C1824D75F5788B7DCD5EBA4C4 barton.spolar
622,006,748 *4002B7E154B15DD9AF570AD3C41E504FF021F640 barton.stapelton
622,006,749 *400FFAF60E0F53D068FA4661962D4AABB0F82343 barton.tee
622,006,750 *4008C2F64A065DF86C546027D5F695C6F8861447 [email protected]
622,006,751 *400790AF6C2B84B958E78F735C283753870CFBD1 bart.palmerin
622,006,752 *40098B36D6BE707F4E4B4A1B006A066D945368CC BART-RAGEOUS
622,006,753 *4003F8E42653703790339F6987679C81C138F0AE bart.shu
622,006,754 *4007F8A2BEED690E1EC73019DC0816764793AF79 bart.stamour
622,006,755 *400205376F52EBB007788FBE95FDAA131FB3CBAA bart.tallie
622,006,756 *400917EF9EB53312677F988E9FDD1667510C9E61 bart.tuschhoff
622,006,757 *400CC5051738FFD40B588456E324ED9690FDCB28 bart.vanwormer
622,006,758 *4004D863FD288F4585156F85B01455D97FE0D8D9 Baruch.
622,006,759 *4008C0435CCAB83640C2A55C3C3316F058B3F1CA baruchns
622,006,760 *40031EC8591A8FEDFC92B6A1CFD4D6213D7E8A59 BARVNI
622,006,761 *40052E83DB8CC79E0B575794EAB67F673BAFDEE9 Barwalses
622,006,762 *40099F1D129504D3B82839AEDBABB69F0629B1FD barwbsw5
622,006,763 *40075411302D600474F4DA117F7F73DBB4B27377 baryonyx7
622,006,764 *400FABE240F8DC6EEB28D65A351C1F84DEE597B8 B$AS$
622,006,765 *4005E6F24E185DC6C4E64A3A43E2CC238754F9FC B$As?
622,006,766 *400EDC0EEED62C71D16B48A9A3F317F561671B2E Ba(-S
622,006,767 *400B5CBC965F27C3841AD807F137AAE603FC5801 BaS#,
622,006,768 *400ECA6C440088F50B9BB9BA159D72A532EC5106 bas44
622,006,769 *400AD3EE0978F87A73F7E32823765488C5B55F24 basaasab7
622,006,770 *4007CADB58B0F80C15AE798A5291751A71C06488 Basaltst1
622,006,771 *4007151D06C92068E5D872F67D84952833360A41 Basar5
622,006,772 *400A458D11A0B42FA2E85B22A5E4ADFD1881E719 basaraq
622,006,773 *400DBC76B642B7F39F2CC7784621D8103A8DE9B5 basasuper
622,006,774 *400DB35EF0D7A9EB33695C10641E3018DC3F2B2E BASATBASAT
622,006,775 *4004855847803649ABEF73CAA3AD2BD2AC769E39 Basbhānga
622,006,776 *400BF796E5F7C863F2C51EC51CE0CE8511BA0425 BASBl
622,006,777 *40047E8D99CC6AF78C7D0AAEE9B4F0A5F09D11AB Bascombn8
622,006,778 *4004DECBA24B7B14175FBCBB82F3EA834F70096B Basconied
622,006,779 *400EAA71A8EA1E0C483DA49A59E11C47F9DA073B BASDDRUM33
622,006,780 *40039F8F1C40BD22F1C7E66AA584D1EC7AD6AEEE Baseados7
622,006,781 *400EE361E1F6FA28751E2386A2477EF3442E852E BASEBALLJENNY
622,006,782 *400A217F5CA15C48E0E7CD31C61E206CB0EEFDC7 Basehorses
622,006,783 *4007A58639505E7AFDC14535DECB9B66A33B7366 BASELY0
622,006,784 *400EE9C185B18AC3DDAF922157E8F7CA722E1BC0 băsescua
622,006,785 *40058FF7E45570F7DCAB31089F425123B135651F basetry
622,006,786 *4000E73F2AD9FFA1D82FEAE628E509CF6F1677ED basettas
622,006,787 *400505BA2CAF96C873CE2B2E7EE0A197AF3BA959 basfabriek1234
622,006,788 *400464210F1CC341B99B5EF41D5AF9F7BD4D18C0 Basffun4
622,006,789 *400A3518F935AFFF012B213CA0CE21BD96351245 Basfradio9
622,006,790 *40095F18727B18872A6001795796744D70DCD2B3 Ba=sG
622,006,791 *400EA2219172780438A39CFF9F094F25AC37329C basha109
622,006,792 *4009273483B6F1A912B020E0C93CC5DED264A2DD Bashammakh
622,006,793 *400FAD8925DAAF9461F70871062D8EC207DC0BE0 bashings2
622,006,794 *40047DC3C58BC0F7B933357788F5E713A17111AC bashkësinë
622,006,795 *40086E8E8AB394D4B2FAF61B03183DFAB5406844 Bashohytte
622,006,796 *400A602CE8FF52F4B47AA94492D7878B939335FF bashoku
622,006,797 *40090DC90207970F5DB986B77EA630E553623A25 Basicfuchsin
622,006,798 *400E040A40BCC16EA81BB497DA37E6C44C151E09 [email protected]
622,006,799 *400A9474AF1839A2B3776D564B90D7DA45959C79 BASICの無い機種もある)。
622,006,800 *4007B0D6621692C87BEF89B9B28CD99FF2C82D11 basil.arnhart
622,006,801 *4002CC55A1AC6A908816E5B0F396A3C92DE495B3 basil.baskin
622,006,802 *400547639E3E8FBDD03BEC51DB055C7B9D43FDD7 basil.batko
622,006,803 *400A7A2F6481BB98351ACD5D0FB80E8B128BE072 basil.boaz
622,006,804 *400ADFA0571BF04C0F11B214A2930B028415BB62 basil.bushnell
622,006,805 *4008F2977718E9C3B8334D17BC5E6FF4DD85E8C0 basil.buzard
622,006,806 *400E11FBB063721707D88B169F1116ECA959483E basil.coonfield
622,006,807 *400069BCEA3BCE309C318C164574C7825D8C2AD2 basil.dondero
622,006,808 *400816726D29AC391D6FEF7F360F4C45E02F1B31 basil.gasperini
622,006,809 *40080E55DBCFF03FD050804532E6AA426A20C43A basil.hagee
622,006,810 *400B0EC5A51E05629EAF2237D2AEBE5FF9FD00FE BasilicaofSaintMaryExterior3
622,006,811 *4007F4676C2A294780FB4072BAD42BFD9798D76A Basilio‎
622,006,812 *400E14EB3654F3A2675B81523D566FDC7CA71763 basiliskenmotiv
622,006,813 *400CE3C2B91D5401077F09DC3D5171FB2582DADB basil.jaenke
622,006,814 *400B0606DD74726AECD0C77AF4638C23806E3E7A basil.keye
622,006,815 *400DDACCC6200C5974891F3CDE5A378AC74C365A basil.klaman
622,006,816 *400377C4E56223EE44289E212915E2C2F9DC1D2E basil.laper
622,006,817 *400F4F3D2C650B6371C10BACC382F15CFC13A54B Basilopus4
622,006,818 *40012B8D660E6D6CE8AA26C2E50D774595033CE7 basil.passarella
622,006,819 *400AF1B4CCB9BF3198A3F4C6D4162A14A5237B00 basil.plagman
622,006,820 *40037E6EC04F8AB4E60C7D60D654B83AE02101B7 basil.rattana
622,006,821 *4004F72BE44695115FCF53BBF4BFA683AF0F0B97 basil.rauscher
622,006,822 *4004DF57AD2868F2918F2F34CBBE0F7A7AB46409 basil.trumbo
622,006,823 *40059F27433D6C88FDA08D0114C4C78D0D2CDC9C basil.vandover
622,006,824 *40058453F06DF9875B0380FA4F8C6B7AF5A139D6 baSins
622,006,825 *400C678AE92283193FC81582D1FE2BE297F285D0 Basin Street Blues (feat. Ella Fitzgerald)
622,006,826 *40090937457A0EADFFB7128FB65F5FA6F3EB156B [email protected]
622,006,827 *40089AA98C07A3C1491E91B81E4F12D6852C47FC Başkentiydi
622,006,828 *400443B3FA567D05BDD297393C7C5C3638076850 basketbcolumbia
622,006,829 *4008F92E66BB52ED99DB324B189B8A43B75E47FC BASKETBOLISTA_13
622,006,830 *400E5EAD729B00C076DD6B20D5BD6FEA94670C7D basketbtintin
622,006,831 *4008E593CC2AA5A9437B8C0000901DA147832B4F Basket Case 2: Granny at Freak Tent
622,006,832 *400B3C5209BED89FF7CFDB713011720FCEC7C984 basketpersonstub
622,006,833 *4000FBF413F16D55FA33B9B1F9F20454BCDB704D basks5
622,006,834 *40024F93BEF2F84F57982E5DBAAB0DC75F9BF16F baskuyl
622,006,835 *4001E84A27474A3286B7BF96EC7D3083611E359F Basl7
622,006,836 *4001488AE563516D789564A167CC99E095F2992C BASl9
622,006,837 *4005A6142000FC621B3BF1A1E7C43F8E9477297C başlamlar
622,006,838 *400296F567C6653751FF4C775DAF6ADB2F146DD8 Basnatee5
622,006,839 *4003E8CC55D3E8F0395DF858EFCC01BF7FFDD021 Basons2
622,006,840 *4008733AAE2ACE2F320D998D02EB37CF1D0D29F0 BAsqI
622,006,841 *4002DA27AE56741E6C498D0CD19EA13FFEC511F8 BASqq
622,006,842 *400CFD460387646F31D8CB44DB2AB7B0DC3CCBFF bassam saba
622,006,843 *400E55A062C2EFBA25B9C301EC95700010E02B55 bassaniO
622,006,844 *4009CBE4776A8E4CD8FDB03FF761F4DF160B89A3 BassbindSunblind
622,006,845 *400EF628FBC0930C99C6BF34B54EF24953EA21D3 basscliff
622,006,846 *4002204C0D8715148081634E4A1E6C9872602719 b.a.s.s.!!!!!(direktklopfenrmx)
622,006,847 *400141F046813A4EB80C7D62601D7616F0E28A7A bassel borkhoch
622,006,848 *400CC473C91D90AF56A0A46BCAE9F25002A56681 basselkhayat
622,006,849 *40053452DB6337BA00E0F004537FC14557EA4E61 Basseys0
622,006,850 *400F9FE8BC88ACCF4C0210D533159955F558C614 [email protected]
622,006,851 *400BF07B077C7A388D2A4C41B8DEAF478D90275A Bassinses3
622,006,852 *400C53FB7DA3A6408B67720B8F806A678324A6D6 bassistlyricist
622,006,853 *40040DCD5E6B9F0756BE7EEF621F50BB8F538D6D basskating
622,006,854 *4005C849057C1147273A26566CA6ED745B18668E Basskopat
622,006,855 *400B694DF82726099967385B037D8C4F70F2ECE5 bassoondeluge
622,006,856 *400B2A64E83A4960A33D839A50E2E6B6D9AE247A Bassooner or Later
622,006,857 *40070BB064F279BED2D0C1CBDCF46386748DC2FA bassoontheresa
622,006,858 *40079D56556DB85008DA8EEEC7E63303EFF140DB bassora1
622,006,859 *400FC7271B065F295582CCBD4F4E7298B3814A46 bast1de
622,006,860 *400A2479527F08519B12ED3B4E1390FCE2A38DD4 BaSt7
622,006,861 *400F71495F58E6621192EB9523F9FC7082DF8929 BASTAARDERING3
622,006,862 *400D85BC1CE24B2730E9DC0B3A406E4C543D4523 bastadases
622,006,863 *40075ADC797E05FF84F3C8772C50C2705FBDFDEC bastapb3
622,006,864 *4005A12FAA2E7229A9855F60B55D2884A63C0FC1 bastardsprog
622,006,865 *40064798AB880CBBB73FF3632278249DE81B69EB BASTARDSWORD
622,006,866 *40025726F160945EA76B3350B8CC8AF38B1A9BBA Bastiahed
622,006,867 *4002DBC2CCEA28F493881A773B7260250D5DF5FA bastionil
622,006,868 *400BC20303A1BAE0A783264A07C0FB6D02DA8297 BAsTIoNs
622,006,869 *4007B5391547E5DE416D83D11B0CBAC58D7FD7F6 bastissi
622,006,870 *400829F55EFFDDE21E37685C4850CF36DDE4F754 Bastomsky0
622,006,871 *400ED2B4F15452A2967B7AA069349671F85E46EC Bastū́nais
622,006,872 *400E7D30859136B5554BB4BB616B20EF40274AB5 basudeb saha
622,006,873 *40056C3A18CC7E580899FFF37FF0022AB24007EF BAsuU
622,006,874 *4005B79ADE18C166590F4BB0B098A38DF898E8E5 basvädermeddelanden
622,006,875 *400551B42835BD5C89BC698263E99B330DD99359 BASVIOOL.
622,006,876 *400A2661AF6B72AFB487D04827E845069A154B4B basylous3
622,006,877 *4001BF9C851DD2E5FF43CD2E689C500EDF3DE659 baszkra
622,006,878 *400308350234CD8108B9724BE82DA9943CF38DDF BA(_T
622,006,879 *400A7D91AC0649B6C4D64836BCC9566C9878708A BA$T$
622,006,880 *400457D257E1692D463CC85A8AA564820BBD5BFE bat7183
622,006,881 *40062BE8443057D1A1CFD9A6F5A1BDCE70D8D460 bataman42
622,006,882 *4006DE8A92091030E1462241715B38582156CF10 Batandpitch
622,006,883 *40042444E47B4870CB2164E3CB76175B4BD925D3 „Batanstorf“
622,006,884 *400D7CEAD8AA4401878E0D96A21E5096E98B7AE7 batapata
622,006,885 *40084870017E3FFD30E0CCFDE2320AF718895CCE Batavum4
622,006,886 *40006334846685A4256A066ED9430A853A92C813 BaTBD
622,006,887 *400D7CD8442F0979BDE3BEB37F425894C731B529 batchW
622,006,888 *400E995B85D3E728ACA83647C3A818EFDB56BAF2 Batehcaring
622,006,889 *400BD9FAB779063C167DBBFA72D09C9072729E5F BATELOV
622,006,890 *4001B4EBB876D47229BDD5F0799D3AC15A56DE1B baten1
622,006,891 *40036A37B4FB80C228C50E4109F2BE9BC32B588E Batevraf4
622,006,892 *4007085DDFF583FD889E28548A09CA6364D56818 BatF%
622,006,893 *400253A2927D56C40938A057EEB11558E739991D bathbmd.org.ukwww
622,006,894 *400A0E9FC7E7DAD4C70E5AB2C2B5194B80280591 Bathelyi9
622,006,895 *40032302368D3E2C4C38830D458EEA018AE29599 bathshebA
622,006,896 *4007B1F556E7191BF3B85C944A3AB78166D5332C batigrafia
622,006,897 *400367726A2AED1F5F1BE2FC1AC92B3E0347F4D9 Batimbo5
622,006,898 *400ABDEDC46BD78BDBC91BCD1805DF56530C60DD batiphonehome
622,006,899 *4009F084DAED31227BEF20C7EA8112604B457574 batiriing
622,006,900 *4008B20F0D4379D439E11A71446544ECE61BD235 batishtcheff
622,006,901 *4003330C2A0399BBA3F31D90587F0C81190BA9C6 Batistense
622,006,902 *4006DC12F65CB7BB6E6B6BC7FAFC1772B3C5FBAB batistutafrank
622,006,903 *400564909A53862AAB9B6492618BD1CE1EF780D2 [email protected]
622,006,904 *400447B88ED899627155BA72B783E3473E9638C3 batjocuresc
622,006,905 *400CFB652E0E7CF51EEA6428BB77B2F6BE2EFAEC BAT$K
622,006,906 *4002ABAE6C3669C37959DC7B63A5EE194962666C BATMAN1296
622,006,907 *4005D90A1AB808156B675EE3141464D6C2C25BE8 batman1900
622,006,908 *400CC151502BBD2F972D7E5B47FB18277ABC2812 batmancw
622,006,909 *40029CA5D1891AD59C000A10717398B90A14C944 [email protected]
622,006,910 *4005782E93C1E45441E8BB273A31480F7810CFA2 batmazian
622,006,911 *40095CAA0862261E6F4E03CE6FC77B66E1E74423 BATNAP
622,006,912 *40033F0A89ACE54A504410D2CD91055692098F68 batovski7
622,006,913 *400D0B0EAE9291205ABE34165E2E94772E1810BF Batrachoididae?
622,006,914 *400CFB3AF56D560F790AF51CEDF8CD938DE7AC6A batrachoidiformes
622,006,915 *4007A266654DBD9AE18C5C18AD57665CC65C6549 B,ATs
622,006,916 *4001B0557DC5BD4DA337E64790FAFF9539EDD166 Batsatnu9
622,006,917 *4007BA25E98A1D5393D7B4601465F527C0F53B92 båtseglareterminologi
622,006,918 *400452C291C3A3BEA206C8C7CD04E7A806B4FB47 „Batsford“
622,006,919 *4004FD5942E43786992F0A731DD2E506924515E0 baTSMEn
622,006,920 *400FF7B0D4D8994293A643120DFCBA06244514AC battalkangolan
622,006,921 *4003DE182E540FF20EB5F28B88AA3A6CECA02290 BATTAYEV
622,006,922 *4002226D79005630B27A1ECCC7653F4E0C0C33C0 bATTeaU
622,006,923 *400396BF1D1B9FB4CA7CD32E51C1343879319087 battens5
622,006,924 *400A12ED0532358EBB8ABCFFB46B087071EA1307 Batteran5
622,006,925 *4009A2E55F980047A768395D0881511E43F07E44 batterne5
622,006,926 *40016E2A7B7720B97BA0EAD3AD9D83BD6093FDEC Battery EP
622,006,927 *400A53D592D3FEAC6D86BB30D8462F0281DE4327 Battigahed
622,006,928 *400D2BD7E7AE4EF85E547BC6E0FE9B551EDDABF3 Battilano9
622,006,929 *400251BB5B58AF56E0B063E2C9BAC5EF45FE86E1 Battima2
622,006,930 *400BA7070271966005DAE4DE490FF77FBFD30972 battle (ready for war)
622,006,931 *4002B17B2CBD80BF3B0B672D4E0AE25E831DC143 battlertalkalitalkal
622,006,932 *4002930F873496146F2EFBAFC3A73A365273ACEB Battoa
622,006,933 *400BBBBB5311C7BD358BF3944C0639103E3A7B91 Battus1
622,006,934 *400DEDABD2FCFD2417226087E12B6B20AA2AF4C4 Batujala
622,006,935 *400B91BF2FFA7C6FD408EC4D4A53B02411D16B9A Baturadža
622,006,936 *40096A7606A61E501BA79CCD397D4940DCF8CC8E B-a!U
622,006,937 *40005B6F356A4B9E5743DAE76BB1B3102D3585E3 Bau“
622,006,938 *40093523077E92D6771422825D042AD1B7C80D87 bau1k!357
622,006,939 *400A40FF19FD92834AF1C7A58A9460BF322F7778 BA#u3
622,006,940 *400044FE78E73C13E174B4D69D52644FA8BB71B1 Bau5K
622,006,941 *400EA24392F4E7067976FBDDD55174A53D6BF795 Bau(6
622,006,942 *4003AD028D10E862EB0DB992646EAFE7B1AABD2D BAUAk
622,006,943 *400227074132D1CF2E7B3F2673A28F3A9FB5FBCA Bauantra2
622,006,944 *4003A6D4039946F4E2F70645D49BF6858DAD5EC7 bauble12
622,006,945 *400D6D86B3993B4DEB008761D53D4039CAA2D5CA Baudotbetical
622,006,946 *40076B2222CF34E46E560BAB2BA3109B7092412E bauergymnasene
622,006,947 *400AF22E12576A7240B03220990785487BE8BEA7 bauernvolkes
622,006,948 *400D707B0FF03949FC38E1B1A84E569D1F10BED6 Baugestalt“
622,006,949 *400A434E7EC80F1D8491E8FFA30E48272B100F45 Bau:H
622,006,950 *400C955B99ACA534CBE88A3E20646F0D1B65CD2E Bauhas
622,006,951 *400245410BE97FDDB8221221DF1664FBD2A658E9 bauhaus555
622,006,952 *400451E9D59239949FC89F9E483911342BF80393 bauhern
622,006,953 *40058038B1E733E1D4F1AC5016630DBD86D0D0D4 bauherrenpreis
622,006,954 *400FAB8D1D1B708506C45EF848F749BF41C8F039 bauhinia 2 0
622,006,955 *400362BEC99B2033E8724E6CE927040EE2F0D6EF BAUJOHN
622,006,956 *40092198C7956889DA5B07A96568B16813B5743F B$auL
622,006,957 *4007DE2143CD7B94AC3EE01D43462780C247B260 BAuL5
622,006,958 *40038BB0DFAE4AA55783901B8CC2E8F2490C48D7 [email protected]
622,006,959 *4008ADE549E18B0A53027CD6B571172FE5D03F83 Baumeisterstr
622,006,960 *400EA9F1CECAB84C9A6D2591F31D21602DBC1416 baumen1234
622,006,961 *40020F7895D87227F167CDF0030D9BC3D261ED85 Bauplaeting
622,006,962 *4004432BFE8FF1DD170B0470DC768290899F1A84 [email protected]
622,006,963 *40082A1F6CB5D35D7F8D242A51F5EAF1380E33BC Baurdörffer
622,006,964 *40082E036A2D8D57B18F4DD58870BD369B1179C4 baustinist.com
622,006,965 *400B7DF574BAD4F5FD998920D04D4645BFAFD402 Bautismal6
622,006,966 *40035C8BEB0C8AB3EC3C3E476AB0D487A6E02F58 BA"uu
622,006,967 *400402853E8DCB084AF137A59410D4A88393615E bauwbauw3
622,006,968 *400E6FC49A374613C1B316D9AAB645426AE33CBA [email protected]
622,006,969 *4003BE97905032D08FDB888C92B260980A4F3728 BAv&%
622,006,970 *4000260D937C19A163F44EC6F9E01F68F608D6D4 BAv
622,006,971 *4006C9DE1FD7B7CE7C59A8ED79691221C895C314 Bav/"
622,006,972 *4005FE806C07D4231444BA426C3849B6919A7026 Ba/V4
622,006,973 *40095FF093189821C297EA7871C2E2C3E0460D81 BaV8;
622,006,974 *400301438DF2A6AE4A49A126252BD3A914A04C8D bavagl
622,006,975 *400F1736DA6AD1A9B9C610A1FF11AE660CC39B49 bavariae0
622,006,976 *400AB0BDAED42DECE557D556E96F3542C3474C25 Bavariyanı
622,006,977 *400CD3A2BD96877CAF4A955C252B056E637822DA ba
622,006,978 *400E55F5257C5F92A0DD5418DA42E4C17EAA1038 BA+Vb
622,006,979 *400816BE917B620F1A89EBF973B0B14005D312BB bavenimi0
622,006,980 *400A95DCDFC93E18736F032E11EE78B69205C75F baveuxes8
622,006,981 *400865974D5ED16A1D5E7EEA61DD70B72F74D555 BAvif
622,006,982 *400894E9C727CEADF2651375EE45101AC2B47899 BA:VK
622,006,983 *4000B35EC3E7314CF44CCAD92E813EF7B7FB130E bavks
622,006,984 *400317FC742932DE2EFF786A5C31A2404A2BEEC8 B(avM
622,006,985 *400D2343ECE246E12561469A61596F813A67CE3D bavocher.
622,006,986 *4004477A5D119B7636C716E9DE7ED29C47B00FC4 BaVoe
622,006,987 *400E2050EAAF1A7D904A8B6FC44A83F9E0C3E071 [email protected]
622,006,988 *400683FFFA8B84BF944FF340E9D8079EB83305DA BAvtT
622,006,989 *4009F08D4F8B7CFC64C8ECBF3B24710CD9686EC6 Ba,;W
622,006,990 *400C768B971C020419CAE511968C80DDCED63654 BAw6U
622,006,991 *400E4416349A85CE947F2F4A737B0CA33450A5FF Baw/B
622,006,992 *400D8B55F6127B97604B3274A1546DF10ACDD351 BAwdIes
622,006,993 *40094AF0ABCF7F8C8B5A4281891B927DF6BA1393 bawdytalkcom
622,006,994 *4000BE76D6F7BE27A0FCA255BD3F40A988226EEF B,AwI
622,006,995 *4007647648D5A5714A8D847FAFE8E5A8E05A9508 BAw-j
622,006,996 *400E2CE09E61EE4C735C6E20357C7D0CB790B1DF bawlla50
622,006,997 *4006643ABA8D17054575A835DF95327528E2D8E7 BaWqK
622,006,998 *4001E2D8E48C64277AD7F414FD382415CF1F5059 bawrel5
622,006,999 *40024E62537195322D6031C53622EF9FC552F806 BAWSEKO
622,007,000 *400D27D58C38D37CBE7E13353C6A0E802AE29FFE [email protected]
622,007,001 *40010919DE4A6EA24D9AEB5A81BF97113B57C0C7 Baw%V
622,007,002 *40083D89FB0C6FA3A0E8E2EEA49E868D68419C76 BAwv3
622,007,003 *4007CABE33F6A0C6A559607DF06D0F68527DCC62 B;AWW
622,007,004 *4008D7146FA74260B97ED40CBFC345E535D56290 BAX3&
622,007,005 *400D3C0ED267CA30FA9CFD362FBFBC6F938310DA BAXDBHIQJWW
622,007,006 *40053AEE8DD081C10C163CDCCF82E1CEF3BB3750 baxtermoore
622,007,007 *400D3FE02B4765228D2CDADE3FDCD9D03F663A42 BAY9c
622,007,008 *4005E3DF395E1BC563BE75C57F7B9AE9E5900EF6 (バヤトゥ、Bayat)
622,007,009 *400C35FA4FFC7BC2997E21D2694BFEA7D528082A BAYATI-I-KURD
622,007,010 *400FEB50B59EC8EC7D29D13FBB4D9A1B85BB7022 Bayatto9
622,007,011 *4000EF9389707CAD0F31EB3E6FE222CFC829B067 BAYBIMQi48
622,007,012 *400D11CB1B248F9F14A109D7266EE681CE83F5A2 bay—chorus
622,007,013 *4009F909B9D8C4B3022A9F8F2F8290C325510134 Baycuring
622,007,014 *400A4798CF10927285A9304301AE8A1860CEC1D7 BAYhI
622,007,015 *400D1FDE8D9C8365F2F345B97A8C36E791A41F7A Baylee589
622,007,016 *400905233A73F9E1CC04C6667E7E521575DB7A21 baylee984
622,007,017 *4000B59B297FAF7B60B09AE45498CA0BBFF79BD8 baylorbowling
622,007,018 *400C43339D7F84622CD27F4044E3260FB2739685 [email protected]
622,007,019 *400F53A46BE226DC056D74B94B18808AB57FCF33 bayonetted!
622,007,020 *40064793C153377A151FD3C1998E5434DCF33543 baYoPedO
622,007,021 *4007A315C36AECEBBE69CE4DD6E99A5ADB4CCB75 BAYRAMOĞLU
622,007,022 *4000C3D869744BE34BBEC817660102029877D290 Bayramova
622,007,023 *400987435C12958B9B26C3BDB87604EEEEA76A13 baysbays0
622,007,024 *40009273679999568AB3CF6575CB937694F3A51F Baysche0
622,007,025 *40094A10FEEB6AE677297175EB45DED777DA0362 BAZ#;
622,007,026 *40067DC7A0224AE54656762CE437B15A7C19BAC7 B#a.Z
622,007,027 *400B86B9575F1662037D7A3A27E77AF2A101656E BAZA5
622,007,028 *4001E4A6D0C03345444DACB7A6AB72E68B6FECD9 bazahng
622,007,029 *400B356D08465A066657A910D766F976F2AEA395 Bazaines5
622,007,030 *400D8C8949E591931ECEDA894673D01E8EA20D02 bazalarının
622,007,031 *4008D2FDE23B014CC7C4CD3C3E6D81FF8290EC7A bazalnoj2
622,007,032 *40024EB37DEBC5DF4F3EDB121D4547B31949B43A BaZi2
622,007,033 *4005542CB7E1F2B42B81280B46BBFD8725329275 bazicourt
622,007,034 *400AEB8C1C17D9819A6A3CEA0703C9EC5C85E5AA bazilebustamante
622,007,035 *400AFE794AAE4A9011E52BA2FAB6336A4DBFBE46 bazillen8
622,007,036 *40072342E2DF79FCF618F605EE668BD1A04AB4E7 bazírozik
622,007,037 *400D21F7ED727FDA252E6ACC684BA6C21ED0B602 bazoches1
622,007,038 *400D9CC60A5D93D773B319135E73E323B5AC4301 BAZs8
622,007,039 *400D4A8DC98B37D7E74891AC1CEBA552D462957C [email protected]
622,007,040 *400DE2E91DBA6A373CB042C6348837213EA8FCC5 [email protected]
622,007,041 *40068422CA02560330FD84F84447174DBF8195C6 Bazzacing
622,007,042 *400A488FD492A917C9F10AF900AA876F2DAEBAD2 Bazzzmaning
622,007,043 *4000438897A985673C40B76F8D7D715FC9A1B631 B:-+B
622,007,044 *400E3CAC7DA4312FF4FAA1CB3DAD329D6F9F6A4F B:
622,007,045 *40036B932936F9D5CE64E8530F7053B6EDC8B326 B?:B(
622,007,046 *400BF9087E4757E8F6B6D44EA9DA1C44F8FD0C1E B??,B
622,007,047 *4009D2096EB864D9B35510350DC73B64E9C51258 B"B==
622,007,048 *4008D7920603C34A660E537BBBFD5222C205CD3B B"B+
622,007,049 *400AADD6657FA6BC6810314C6B831803F9EC2A1F B)B,
622,007,050 *40055BD9B9B2F5FC3B8AF390CBCFC8D5273BD0D8 B&B;,
622,007,051 *400883476F2EE105655EC10945CE3354A8EC4707 B%+_B
622,007,052 *4009925F7A745695C9076B14693650AAE44C7B54 BB>.
622,007,053 *400E5E8367C2410B07662495419CC21B03FE4F5D BB_:=
622,007,054 *4002F96C8FD4D00DEFF785E73CE39C3A7B636F30 BB)$?
622,007,055 *400F1C623443EE0680FE49E5E7236AFA8E98FD27 B=b`
622,007,056 *4005E4DA0CF6C9DB16DDF479728021D771B58CD1 B!_b$
622,007,057 *400B3F6B676564D1699CE73CBBFC2428751184EC B#b.=
622,007,058 *400DBA22453C31B9CB2F0D2F0C2EA731BD05079D B#b+$
622,007,059 *4005724A0721A0920F779149DCC02B2A6EF34E13 B+)b&
622,007,060 *40074EDA186AEEE18F91ECCA3E7522A825D3532D B+b-
622,007,061 *4002CE0536A6BFEB2149272C88357CFCAB03212E B
622,007,062 *400D3865ED7A1688569BDDC920E2513A5529C7D1 Bb_$_
622,007,063 *400BCF546FB67998E930A9C95D2ACCFBA6156443 Bb#)
622,007,064 *400A16A8B1BCBF20720D54BB92E19F9651839BED Bb
622,007,065 *4004D084C083F7B4265BC16551435685EA5AA3BE B,/b0
622,007,066 *40048E2D48A930F6D19FB98C6D29DFB914D1BA05 Bb_,0
622,007,067 *40009C6FC3364937B7D838409276FF2F37AC7646 BB09t
622,007,068 *40073C8D00F3D621D15BD80EEEC00930171A3CC9 BB0$F
622,007,069 *4003756DCF94ECD4D2F2FF133D45CD18BB558996 B,b0n
622,007,070 *4008B59ADD4C884C4515D5A89C26355D08154592 BB0#Q
622,007,071 *400618D4C13B31E2E7A974CB25F8B42E21FCC9AD BB0q"
622,007,072 *40030AE03989B3002A507D28C191AE3F453D8A9C bB0RAQAAIAAJ
622,007,073 *400867B92600715C7E23BDA916AE8353441FD879 BB$0T
622,007,074 *400FA4F0049BA1B80B03699E8501D0248AF31C1F BB/0W
622,007,075 *40091389317CD5B1AD7A80BBC78542A6E75F8F15 BB0=w
622,007,076 *4004FA290B4EBBD9D9A77C09892725B3378ABE58 B_&b1
622,007,077 *40071D75DEAF367508999029C88D7CFFF4CC8746 B_b;1
622,007,078 *400655745C29CAEF00FE933B40BD266414A06E0D B$b%1
622,007,079 *4008DD12C8302AAD08550D69627CC0AFA2E79E4E [email protected]
622,007,080 *4009C0DF4B0F48172F1AC752C8E21FFA49A134A0 BB17B
622,007,081 *40023BFF5794B2D98E7222CBFA4FD1C91445CEA5 BB1a:
622,007,082 *400E25B60BD7BCDDEFE34FA11329AB432CC27F7E B:b1D
622,007,083 *400878DDE0DE315414C1A289A0081455EF8FC707 B:B1j
622,007,084 *400212ED8FC097FC0E7C258F13CC615275E4A363 BB1Za
622,007,085 *400F3F8D5B1CB8A0CC1C2675800D741CBAC1696C B:B25
622,007,086 *40082E627081734E27028F2B6749B513E5A5C207 Bb2%9
622,007,087 *4005F0F07784906C580F9BBDE4E09E94039BB9D5 BB2I/
622,007,088 *4003CE9789A5D578F3A56A4FD0D8AFE323111497 Bb2lp
622,007,089 *400BA784793A8CDEEAA07C17D35C1CF23444FD4A B!B3=
622,007,090 *4002D1362B64286B99A5A2F3A1984E86112F9588 Bb3.(
622,007,091 *400D8FEDB9D09B757937D87206E2432C5CC69C61 Bb3?c
622,007,092 *400F63C86C1890E7B01563AE1C4E4D55B0376ADA BB3l!
622,007,093 *4006EE14B70E4A016C75AD14F86DB9183FA1667D BB3q4
622,007,094 *40038F873A8D63D1863A36BEA46037A59662E703 B)b3X
622,007,095 *400BFAEDD784E6162DFB58DE2C5D52ED2FB32EFD BB_40
622,007,096 *400142F6489EABA5ABAF390B1AC6DCD2BE80C233 BB4DM
622,007,097 *400CC39ECB7994BD7B2A534BD9347CA13D244284 Bb4g:
622,007,098 *4006E5725ABD816A10071DBA4E86C89576B4F26C BB4.Q
622,007,099 *400234ACB423520E6C63E8FF360C88BF7C2C2C3B BB4vn
622,007,100 *400C0ED88E8B7A4C69AC61A311E11FB1C4D3C145 B,$b5
622,007,101 *400A62A5B03F5C63B6541355D49AEC131042A463 BB5kO
622,007,102 *400AD9724467073D0CCB3DFA3B2A6917F2B5416A B$B5Q
622,007,103 *4000C66BD87DD534B02F12E9084C3D24C6607D79 BB.-6
622,007,104 *4008901643A0C6CED87881B7BD2F4396A737E654 B;b6%
622,007,105 *40088658DAE322ABDF4F345102E2EF7BE73679DF Bb64I
622,007,106 *400AA224B2D91571F15C95F5DC74DA2550E77783 Bb%66
622,007,107 *400326663798AA4A0A4D9C3F7434C8CF4F4555B7 Bb6&6
622,007,108 *400A42C67C51A083951A52B0327C89C15A85B9C6 bb6772
622,007,109 *400ECFB286978E47B386E862B39A0ECB9B03C7BA Bb6-j
622,007,110 *400DD391CC2D1FD5BB90BCB041B1559D5753F838 BB6j1
622,007,111 *4002B81D2F5AA6F7CC51974396F45F058219655B B/b6P
622,007,112 *4003E40C2DBE2F89DF7DECEA57DBD3F090450B44 Bb6p!
622,007,113 *400F3DF6202B8F9C5C5A43D11907202A30629822 Bb6r4
622,007,114 *400990B9D519A97E20D4CE015C9518B606531AD8 BB6Vg
622,007,115 *40054FB964C32DD023D4956B2F0F92A70BC2710A BB6;X
622,007,116 *400C39FB87F19EACCE9232FBBCB8AFECA9E55506 BB!_7
622,007,117 *400FBB8F19C402421B9D1F80C30A65172A529BA4 BB.?7
622,007,118 *400FD8ABB72845A3A037F744D1041D209024BB36 BB7dc
622,007,119 *400BC2432F0E9E5BAF8F0393DE7E14E543961997 BB7-j
622,007,120 *400E456085FFFDCFC4D7F3B3B2746D92C16C1D4F BB7"Q
622,007,121 *400A70B3994F48E6B0BE819086323D3279D9C748 Bb7UU
622,007,122 *40057F5740CA105E4B6AB947E123CF63005AF8B1 Bb&&8
622,007,123 *400F13DD69BDA2B18AF24F25486ED6605A8887F4 Bb8Cc
622,007,124 *400E10C7A82804B41349DEAF1E1FCB75D61899CE BB9%
622,007,125 *40022A2317DCAC861190BFCC9C48370AA4DB818B Bb?-9
622,007,126 *400B9C1C48591C316B7CDB763AB1E075A4C27B2C Bb/(9
622,007,127 *4001D68D6FB8E568492E218688E301692111D1C4 Bb93M
622,007,128 *400B983CCB9A1306D52FFC01796CE32B2197C478 Bb95H
622,007,129 *40035F84D3AF77E85126DFC37F728BA902986995 BB96N
622,007,130 *400E208D08E251701EECF7EF8D47C20FACE4076A BB9A,
622,007,131 *400AB3560C99155C9112837DA7A132B3165FBCB1 Bb9Yl
622,007,132 *40046DD6A99160406926A5520688C60B455A12C1 B=ba#
622,007,133 *40060FE1E16E8A1FF10E9C714E77951ACAF46ABB BBa2-
622,007,134 *4001AB123B6257D4C126B2272B26765884F78BB1 BBa4?
622,007,135 *4008E778ADE76AE4238A39E785E8224A748CCD4A Bba7S
622,007,136 *4003D09BCAE65D373A1F94144581E193B4120788 bba91c0e
622,007,137 *400A1FF21ABC94CF4B6532B72C7264F6CA9D1460 Bba9i
622,007,138 *400EBEBE61D59D1539F5BC6D943B2D1B5C1DA6C7 (,Bbaa
622,007,139 *400801EB72CFCF14F3A75FFD16C77D34978DBF60 B
622,007,140 *4001F85B7F7910137D85A3DC704A5C874EB75CD7 *>bbaa
622,007,141 *4009D7802C7C9BEB8F562A497B5FE2E903A0406A bb-ade
622,007,142 *400ED8B95D585C81E3581F202FF2B6B087E4F105 B&bAe
622,007,143 *4001B142D5C87200D362BC9853CD4CE553110F2C BbAF
622,007,144 *4008251EE8623A72D3D492401F62672EEFEE5557 BbAhV
622,007,145 *400B817B7AC55EF11BDBCCC9BCAC8A6024B46205 [email protected]
622,007,146 *400833CA46ED3BA9AEF7179E10F6C81AADC92BC7 Bba&q
622,007,147 *400B4A3F23C877A13D99AC33DB3FA031C7AB0E68 bbarbeta123
622,007,148 *4007D7B6AE1AAAC386C1408D70DB9555A9490AEA Bbasketb
622,007,149 *400D5BB3A5017A46D93CE90F4EA0C552209142C8 BBaT.
622,007,150 *400ACCA947A210FC65F75415405E8717CDCBD028 BbA-t
622,007,151 *400D08908DF00DE65A2B272CC42B57958D6A81D6 B%=Bb
622,007,152 *400203A2A86C5309D8A56B9E380F606550E03AB0 BBb+!
622,007,153 *400F384F3F9AF86C8E1986F6A75C9A72A509A121 Bb:=b
622,007,154 *40008CD6E430569EE5C4283935B77501925B02E4 BBB6C
622,007,155 *400E10654BC36EA7622DEFD2D762C0C1667B6B0E B:bBD
622,007,156 *40058E0CCED56A03FA29E9F80BD2253F885F62CE BbBFk
622,007,157 *4004225E5BF40369D7FE6B26691D517292FF831B BBbh5
622,007,158 *40040360BA32F87366EB8D5FA630B7D984514039 [email protected]
622,007,159 *40069BD411ECC8E875F2D177238111F2DEAC45C1 B#BBT
622,007,160 *400C9FA2273C16522B9691E80C2CD15D96C76F9E BbbT,
622,007,161 *4004FBBA112CFAD0D3C05FB133CDFCF4C1452074 Bb#bY
622,007,162 *40085B756F5FB962718CE86717B56FCD2C973340 BBC$&
622,007,163 *40024F9F3CC40222F8486F7B9C034688B78CCF5D B;#bC
622,007,164 *400B5A444DB9921909CC5D76019E1A0B9C2001AD bbc020109
622,007,165 *400FFDDAD041F2094159848D270C28B9C01863F9 bbc2k
622,007,166 *40066EE36FBF5B591E85DA00568196FA19AFB882 BBC5309934
622,007,167 *400DC80A35E0477E080E0CF73E423BA6DA19DCF1 bbc5july2010cleggannouncesdate
622,007,168 *400FAFF51914755BDBA8BD374F9325BB3346B532 BbCc#
622,007,169 *4005F339AAE7CA8DA65B623DAA7775A4BA7EA3FE [email protected]
622,007,170 *4006114C16EDA65A963710C2B756EF8C2AD7573E bbchtr4481
622,007,171 *4004D2173645DD5AFB712BAA68C6E44B7781B722 BBC-MARCH
622,007,172 *400F238E280343EE6F491D5232C8E9B8893C553E B%BcS
622,007,173 *400D9152E59CF5A9D1544B5C665025F3BDFB98F5 BBC"T
622,007,174 *4005CF5E54518485341D6BD7DE2BA13870B1BA0D B
622,007,175 *40082847AE86B2C580CDC915F41C4FAD63CF1349 BB!cW
622,007,176 *400ACD28496DB8538F8199CED05105BB539C09A5 B"B$d
622,007,177 *4009571F8C24A8EABDA4FEE14DEF5A7DE8CAAB11 Bb?d4
622,007,178 *4000ADCD1E525CCC5D0B18AEC075C765A19B157B BBD6u
622,007,179 *400D2143E86614D3939687CD822E7E7F74EFCC4A BBddl
622,007,180 *4009C244457DEF014774A627760BB3F27942AFA5 BBDDP
622,007,181 *40095A9853EAC72E8F47A1C80F208007B96A69CC BBd:H
622,007,182 *400FF399B56DEBA5194EBDF068226CFA78F3870E BbDi!
622,007,183 *4005236639F3058E94CE4E4564ADC8A4F6646141 Bb:dI
622,007,184 *40003528297A98774D678F7B9B13124E9B6C87CE BBD(k
622,007,185 *400F2B2D52E4B0887D821344904F266003EE7558 BBdYh
622,007,186 *4008B6F80EFFC59214EF0C0EB3BA1B8FD5B038E2 BbE;?
622,007,187 *4002B3CDCCEE2D8B0846B776D4CCAE847979B01F B(:be
622,007,188 *4009C8D09A9026639DD0AEFD6536DDB6E2BD0729 BBe0M
622,007,189 *400357B883DDF0BB7B6D523189AC2A22B25A839B B:BE7
622,007,190 *400C1CDCCF4C4B57C9B242E6AFA7E638CD544109 B#BEe
622,007,191 *400A191BE3556A0D915B1ECFA58E33F61461D697 BBE-EMILY
622,007,192 *400CAADB01DE4D756C8B96F8286FF0BCCDD5DA7A BbEhK
622,007,193 *4002DEFBCBC35926E4A3D56D3C8D710EF5CF0B13 BBEHRMANN
622,007,194 *40020F41396C5696D6BA0D395C54794BA3D64CBA Bbelliro0
622,007,195 *400322CF650DF1AA0C5AFB0C6565076784EF74CC Bbeltraning
622,007,196 *4005F05ED30247A04E7A2DF429F2E7F15D769250 BBEmO
622,007,197 *4000038C7322A39336619F91E6EE373F8194DA21 BbeR;
622,007,198 *400D87C10B75E9689F8C0076DCB061067BFEE418 Bberizes7
622,007,199 *400BE80D6B9C5DBB17DCD835D4D94FEE5476FD6E bberoniczki
622,007,200 *4008C39C49FF55703C1E79B575A7DF63A5CC1090 BbERQ
622,007,201 *400D944E519DA741513BF182AC779B24EBCFA2B0 BbEU6
622,007,202 *400D77F1EE60C92BE940DDB3DB2E51F7829A3FFA BbEUZ
622,007,203 *400833933F99AC0681D79AB85810C7230624DFDF BbeVI
622,007,204 *4004C1767BCFA1BE84563D4B5DE790E02877745F bbe-wols
622,007,205 *400A5E0659907663AB0A4166B6058F4B17B5101F B;Bf(
622,007,206 *400B0BB02744EEA190F34BF500C599F8C4692F99 Bb_F,
622,007,207 *40085CAF20319A4282740BEEC2B2398361D45141 BBfEq
622,007,208 *400477FF1F50F63FF0311262914D631B291BCEA4 bbfffa8fbe
622,007,209 *4009A5FAC22A8B68DABF2C47367B420CF159503F BbfG
622,007,210 *400CF83BCF3820F9F8DF1E28F1B3D11F206BE897 Bbfiddle5
622,007,211 *4004C184C03CD08ED8ED2676216BED102B7B7BF4 BbFR6
622,007,212 *400A0E4F9A7E78CEBB24A96A60E9179DFC041F73 BbFt)
622,007,213 *4004D09120D1B4C9C5221C4DD7280AF16992BB93 BbfU%
622,007,214 *400588DEDC2AD26C97ED5AA70F973EF210FE66FC BBfw8
622,007,215 *4009CB7EB631849A5421BDD273C4D3615118D3FF B.=BG
622,007,216 *400022D20BEDD2E4944862FF9281A1229E87A34D B":bg
622,007,217 *400B1655AFE4EF580B1AAE03012676F694CE03C4 B$(bg
622,007,218 *400017AB31CBEB05C57E1C326C277EC9BA23D59C BbG0:
622,007,219 *400B569428F078CDDF3BA9F81882FBB8C44F54AE BBGBu
622,007,220 *40051D20F36FD50E2F9AC6FD2B55833ED836DFD4 BB=Gd
622,007,221 *400FB428A1428FD3EF67B282A839362DE855148B BbGEM
622,007,222 *40030C189DB69590BA5D9AA0AE98C1B6DC1DEA49 Bb+gH
622,007,223 *400E89F8F1168814E18FCE2F71FEBAF4FD7F0555 B
622,007,224 *4006ADCE6A1C93D028F59BC957F55D5C63F8B6D7 BBg"o
622,007,225 *4007C18662E5188B2DC92559CAD3685262492DCF BbGpQ
622,007,226 *4001BD31254C1A201393D921E95430A59469486A BBgQ8
622,007,227 *400F02B1822E479BBBA85FB612F332C512595E3C BBg$r
622,007,228 *400BC972FB6F69FED413EFE3F4CFAB0954E34B24 B
622,007,229 *4000B63AAB7CAC54D2C1EA48702167A473E50F58 BbG_s
622,007,230 *400958908DC88C935953A6434654959DF04B96FC Bbgtn
622,007,231 *400866F31F4AA4CAC649377D8D18645B4E0CAE92 B_Bgu
622,007,232 *4001A79BF7C73F2AD7AA45F76DBDB8A3CEBFC53F BB,gX
622,007,233 *4003907A63EB08C2A7A63BEE6B81FA2BD941257B [email protected]
622,007,234 *400084A6DA642E6FE1884C379E06AE5F3F05368C B+$BH
622,007,235 *400D614FD9AB2AB752497B4ADFE00052905C2A5C BB:?H
622,007,236 *4005A16BBF7556C1CF20C21E354DADA747566C6F BbH_/
622,007,237 *4004789317203D0F47D0F62067DFB6964298FBA5 B;bHC
622,007,238 *400BBA43B3F5FC46687E4899F04E691020218BA0 BBH&E
622,007,239 *400024855EEDBE28EFEA7C7F9321F2B253A35643 B!BHe
622,007,240 *400BD79C8FC152B70FA2C773D08AFD5591A98062 B)bHH
622,007,241 *400523C39E9045FC89A9A71D877BE475943AACF1 BbHLg
622,007,242 *4001A8F80BCACD3F9F54E00C3E148C3EC525DCFF B-bHN
622,007,243 *4000201F1E51CC9C79FB39CBA27CC37F2A6B13BA B)bhR
622,007,244 *4008F705EC545119326B531AEDD2E07B0501F0A0 B:bHs
622,007,245 *400DCEC0656D1AA5B8DB839CE1C4E203399E95B9 B#BI.
622,007,246 *4003A3B37F38F0C17F9544416A31CFE5BA4782C9 BB.:I
622,007,247 *4001CE64C32886F328DF6E7905484BF2ED227E92 BB"(i
622,007,248 *400CD49C1BB10D03EB56CC0FDAC9E3745279685F BBI"A
622,007,249 *400860F5F3E4F31D3B21E52F03EFA2D0334DB3F4 [email protected]
622,007,250 *4000DF5ECFFA58A2D9262EFF872013DE51C8F323 Bbimq
622,007,251 *400CB4DB60CE66D6635DB21C99D397AA190EA665 [email protected]
622,007,252 *4000B29738F983FB5977D8C4B2701BAB7B8C146C BBinR
622,007,253 *400AA2311C387EC41519F34918F486B9621D124F BB#Is
622,007,254 *400315A333BB7EBA444DC6EEC345AD8E4A1B68A3 BBi;u
622,007,255 *40056794C832285D1A54E4BB97BC450AAAB6DA82 BbiW;
622,007,256 *4007A5BCDF7588127B1286795B5AE5E407A820CF BBiZL
622,007,257 *400B7566217361282EA39191A874528C240098BA B(bj
622,007,258 *400507C3B4533D48C3B836E69BBD9ACCEF88141A Bbj1P
622,007,259 *400A4E9EB3570801CEDC160BAD28272E905DEEE3 BBJABA88
622,007,260 *40087A154562D1DFE7083A4F9BE20F1DB4166A73 BbjH=
622,007,261 *40035DACE9457B544E5319EA88D7A83D549D681D BBjHb
622,007,262 *400B26F94B67FD4D2A73274739E0418B761B3617 B:bjl
622,007,263 *400278C5773C14FE7A69723FDAE4682AB4CDF580 BBjPX
622,007,264 *4000AF0B00C37DC59B8C3BC7EC756BD841FD48F8 B=;Bk
622,007,265 *4001DD46E1158FF768ED87460D3EBF41D872D78C B-b.K
622,007,266 *400DAFDD5D74EDC9779EE6C7F7D6A700A872F49A BBK3a
622,007,267 *4001798CFDDF77F556B3F669B34309D46ECD9BA9 BBkF&
622,007,268 *400CAFFCA3768F440504525CA02E24A69DEF4350 Bbkk4
622,007,269 *4000672056E223B99CE44C09F8369EF886C7D76A BBkq0
622,007,270 *4006E0DCAC683723369A96E14B92CECC6F35D6AB B#bkT
622,007,271 *400A5F1C3DC077DBACD2327E9003669D686B1317 B((BL
622,007,272 *400F61037C0378D1A321BB4953259A8658A1E8AB B#B=L
622,007,273 *400BA68B2EE04E2D8D83340BDA1856C8C219C3C2 Bbl%"
622,007,274 *400349FFE7E418A089AD96B33E1C6D3BBFB0B063 BbL04
622,007,275 *40094832B31FB02735389C7F0E422FA821B33DDF Bbl43
622,007,276 *400B87ABC341B68D4138616DEB92C209EED4037F BBl46
622,007,277 *400AF0D333174FB568FDFC94B5790B49ADACA0FC BBL8V
622,007,278 *400FDF7463A2E733E1EC8B15C58397B8035540E6 B,BLa
622,007,279 *400FB9A9D8FDC8F5131C3E207E204ED0F51BF0BD Bblc7
622,007,280 *4005FEFF3493B3ADB462B71F207A09813D53003D [email protected]
622,007,281 *400EC3814B6C89350C4BEE14989933AA80D305DC BbLeW
622,007,282 *4005DB426EA671198A165DC51EDF965D91364633 BblIY
622,007,283 *400EAFF265C34D67A15FEFA2EA2A6B51E07AD071 B/blj
622,007,284 *4008DD64231F01892DB17413D45CF4CA6321958E BBLVp
622,007,285 *40032BC6D815EAAFB5B2B69CBDD7E79A846555C1 B=bLX
622,007,286 *40009E81C487CAF799040012CE188A441C50AD69 B?B+M
622,007,287 *4005C79298D2A0980F7F10BB9D88C96164C1D7F1 bbm40040010100001eng
622,007,288 *4005F658A5ADE79AA5228C0A318295B242E72056 BbM5.
622,007,289 *400F605E834AD6B6BC7073417105E1B4696DFEA2 BBmi/
622,007,290 *40071AF40437B14755AB3C67B48A28D4368C855B [email protected]
622,007,291 *400A9A0677A6E5EB6A9149E658391F34A99E1DC6 BBmjB
622,007,292 *400CFF15EC302F31A406AE823C0C3E978AAA5095 Bb$MP
622,007,293 *40087766F52DCFC12CE0B90AEEC0470F7046F42D BB$mU
622,007,294 *400A217981711CD7780BEA106A286AF7B359AC3A BbmUb
622,007,295 *400D09726F6D8A25B7F243C36B7B01F4912619DC bbmujicar1000
622,007,296 *400016EF32BE6EFED9B538F683224C696331BF78 BbMuN
622,007,297 *400FCBAE8B40AA90D13ABA42BB7CC34DC47EF55C BB:
622,007,298 *400F1DBF45C0D484A7BCC2EF7529893CC7F3CAA4 BBN9L
622,007,299 *4002DFAD50818DF7FA39D003BD62498FB5D8ECFC B!BNf
622,007,300 *400BBD14E90FB15A9A7C6D87045E40EC0843C8F0 Bb+Nf
622,007,301 *400EF50257F9C538D073DFAD51DE03146E847066 [email protected]
622,007,302 *4003EEAED50E29AA535C3807E022AFE69A662E78 BBN-METS-OJEDA
622,007,303 *4007B22D00B067A92015A30E713E9E99F774D747 BBN"N
622,007,304 *40039CFC60048100F35AD02CDE7028544BB7B66E BB=nn
622,007,305 *4009858E48FBEAA72DB495461BFDA44DCBB5A2C5 BBnot
622,007,306 *400017581008B1E5C00B5A169FF5A540EE19F76D BbnRb
622,007,307 *40085C9F4809CC03B6A8099A86187C83D38490B6 Bbnzbsw8
622,007,308 *400E5948CFB958E110ECD851F4E208E5DFC3F26E B?bo/
622,007,309 *40099A184EBAA954AC103E063313D3265C2C9E33 BB:O2
622,007,310 *4007B51CF58519F7D977669B18C63FF84E66AF31 B:boF
622,007,311 *400344CA81C65030322D97763CF453BFBC46D299 BbOG:
622,007,312 *400B0C3EFDD03318734D12B3FD09BFC82A720A0A BBOi_
622,007,313 *4007ABA3DCE72FC0B89D68C76298A5974E7F9788 B;BoO
622,007,314 *400C42A91D6DB2A03471AEBB64F2F41F1442EF3C Bboof
622,007,315 *40050F3C0D643676FBF8468824D4E72229DC5FF8 BBoUn
622,007,316 *400386BE79CD474168C42912B715DFE1FA125F6F B$B,p
622,007,317 *400E9C6E2D24B922F840996CD42500B4D0AB86F3 BB;:p
622,007,318 *40010EB423A3D7C4CE3AAFE6998458D48C53E291 B"
622,007,319 *400E3D7E800F18F40BFD84FD82A36E7504D0C82B B(.bP
622,007,320 *4008F6E6F96EAB2E97082012644CA0DB086B0F4A B%bP-
622,007,321 *400CAF269D7E6C5BC971E4F23102BCE6DCEC1C2D BBP7U
622,007,322 *40000C2F4F9B666FB8262A7F665DD4936003856D BbpiA
622,007,323 *400F6EA3F2A2DB353D435326582216AD58AC0513 BBPPH
622,007,324 *4003B36326B1CEE97BB413472E2636546C2BFAD5 BBp.q
622,007,325 *40052396904407B5FE859B3A6B5CA1D0C51F1738 BBPR%
622,007,326 *400CFC7CB5A755418896BDFC9C8655A32EDD2355 bbprop
622,007,327 *400E0F14BC110028208C3B6A64D88D9C6379019C BB$Q"
622,007,328 *400A5CB0EAF2678E60EDFF6F944CB3198C9D6F88 Bb-Q.
622,007,329 *4004F4699A43293E44E2237204B98A46E4B1E39D Bbq1%
622,007,330 *4005D675D7D57D0DC3107DC42A608172F9494F9B BB;qa
622,007,331 *400EED99A202182BDD8C7A8F9FBB7B68A1E3FE2F Bbq%a
622,007,332 *40009A6B72DD4AD7D9B090E9D0AECDE4DEE06B84 bbQaaa
622,007,333 *40004A888714CD4A41316C5687CD9C5ED3A2EEC6 Bbql(
622,007,334 *4009600F6E5018A39D07C87928DFCAF16D783091 B+Bqw
622,007,335 *4007D2C55F1671C0648F9A260CB0468AD4A25582 BB/,R
622,007,336 *400BFC696EFC740C84C4163D1DA4B41FC0FFC5A0 BBR-?
622,007,337 *400A1D0312F25265BF78384DCD677BB28013158D B.bR#
622,007,338 *400B7BDCF58ABD809C9D95DBF7CE7E558FA97D96 B-br$
622,007,339 *40075BB02332A7B6BA97BFC1C9261523A5D0011E BbR0(
622,007,340 *4009B43F4E4746F1D11CDA3EB02B46EB75235A5F Bbrae
622,007,341 *400BEDE1BE7B269934D166028F0D8BCF3F888626 [email protected]
622,007,342 *40060D7C9444035715CB1123FBFC05F73C1EF59D BBREPFAQMDRSFEG
622,007,343 *400A90EB0861B5581C3F674C29566EE523ADE03B Bbribsw9
622,007,344 *400631F45C4A578595068498FF439A2B8AFB0032 bbriggs458
622,007,345 *40056F05FDF3C0504A313F1018C8033DFA6BE214 BB
622,007,346 *400FCD8633CA68A877641FDCA5E9587265A12755 BbRkV
622,007,347 *400C39E852499AD0EDF223FBAF58B244F3845F1F BBr:n
622,007,348 *4002F8765C87159E084961C0ED006D55061C9B87 BbRn#
622,007,349 *400EEEF42A534B484DE2539A776D92CC876391CA [email protected]
622,007,350 *4002BFA808165ABE3644C49CAC75BC298EC3625B Bb
622,007,351 *400FBEC42BAD25FD5D30D24655457D585B095190 B:bS5
622,007,352 *400819B96E4645EB33B998F13360094A001E81AC BBsF;
622,007,353 *4005DC9B7AFF4ADBE5E1A459E5DDF36AA3748DA6 [email protected]
622,007,354 *40009E32775088B5ECADB85A34210B544CDC639D BBSFh
622,007,355 *400998F0BE390B71E6F7F6F030120D6426FF2AEB BbsHc
622,007,356 *40083A59067008FF2C3A2A1E6C1F12376B6496D2 bbsjim
622,007,357 *400FECEEE0575B9CAEA7F66259A902ABB9E18DCB BBslF
622,007,358 *4005B3225365E7ED2456205BCA4003F3E405A35E BBsr
622,007,359 *400710870412C73F5A9EE4456AF797815440E36B Bbstohtmed
622,007,360 *400DFD6E5F9D7CD52579D26B08DACD7AC45D8A89 BbSv9
622,007,361 *4001D5ECE5B985F6681B060F21BD1ACD3E65FDD7 BB_T?
622,007,362 *4009F10B450EF8EE27FDAA74D951B3A48CAA0B71 B"bT?
622,007,363 *400424E7F8BA75E6BBB0D8C57FD999CEF3F1182A B:-bt
622,007,364 *400BE90C4AAE14F9DEEB53B30DC9FE301038D4C5 BBt5a
622,007,365 *4004E5CFF88274A1567C02DA1E833B16F296E5F7 BbT;a
622,007,366 *4008178D78BA70E72B67EB7B0AECCC125555C3CB BBTDY
622,007,367 *40076B2DDBAD1B940A14A99B5B72EA31BB6DC96D Bbt/n
622,007,368 *4008C32997DC5686ED4C16559EF023BC38DD46D9 BBtnP
622,007,369 *4009BCB98456E47AF5EFBEF163A4D82AEF64FFC2 [email protected]
622,007,370 *4006DC332C435728D2B44BD2576073D1C6A49697 Bb?tT
622,007,371 *4008F175616B784E17915A1CE8B5BC1710503152 BbTv(
622,007,372 *40033082E2E3DC4BEC539BD171F7891B58335C05 BBTwK
622,007,373 *4003C26AA3BEC90ED229BBC66B11A4C653B4663D BBu2F
622,007,374 *400094EAD9EC404A79483491B6F10ACE26D8CE4F BbuFf
622,007,375 *400C0B91F9938600B1C921F21AFF0628B90D6E70 B#buT
622,007,376 *400D6A3C395B362308EF1CC835F70B46D0F94356 BB!Uw
622,007,377 *40015F869D971494AC50D1A9211D22526F9E2671 BBUWU
622,007,378 *4009E0C0BBF6F15D7259AA0F4176CDB468C88155 B-B:V
622,007,379 *400EE1AA4A728C4BC4832E07B0A191238DD97F9B B?)Bv
622,007,380 *40007CB82B3990CA7851C03AB6D7C23FB8CBE889 B!BV1
622,007,381 *40040C8A201A1B7A9CAD1BABD982896E1444CC97 BBvc=
622,007,382 *400885DA911A2FCBEE31C3E00237BD20A0BD3CA7 BbVdH
622,007,383 *4008E52ABDA4B63BF26E8611102FA08100799674 Bbv/g
622,007,384 *4000AD0FF4F3ED56732610C80ECC965BDC8517AC BBvlc
622,007,385 *400106C08C085DCE6F2FDB1DBEB7ABFE695C256D BBVns
622,007,386 *4005E777272DC5063BEB6BE43B30A78B0C22A529 BbVRf
622,007,387 *400EFB4B894FFE4298524A796296C1F1848A219B Bb#vS
622,007,388 *40089384E7BD6A1CF7328F6E9EC53BE3D32BBD54 Bb%vS
622,007,389 *4001ACBFC5FBC1214C6C1057BF36F8E91553E1B8 BBVua
622,007,390 *400BD17C0FE870A8902DBD933B5D1081977B329E BBvZ4
622,007,391 *40068EF7E0C0AB3E23AEBCB8CC726FA38DC2CF6D BBW
622,007,392 *40050BC5472DDDA7AB38CF94B93154CC83B5DF5E B.bW+
622,007,393 *40089F43DFD6D23BC2C8FD9CD2C110C4945C1FC0 bbw51356
622,007,394 *400666ECB368D5F941E7E77F8B3DD12D9FF3EAA4 BBwcE
622,007,395 *400185C314E92C9FB9B9976224290376A4621F5E Bbwd-
622,007,396 *4004EAF24B867DE90E60539D849A0051E0654772 bbwdawning
622,007,397 *4009DB8E663781C3A1236D09F0D3499D6CD00268 BBWdr
622,007,398 *40000BFA1872F0D8C2C488EA7807E2EA588A5E7E BB&wf
622,007,399 *4007C572D40FB6B022673C4385046C9ABA8F5C48 [email protected]
622,007,400 *40006AB81E962A5A075BC3EA6FAE2AB116B67F89 B;bwL
622,007,401 *4007E108B55F4338DB5CBBC4A2361FD166F46AD4 [email protected]
622,007,402 *4008397E55DAF4A8997DFC55C94861FB5CB7E322 B)b,X
622,007,403 *400D5969A5CB3D215A9F7603341DE5E9ABD86143 Bb+?X
622,007,404 *4004D64B5C668E8C4EB432A97B7C3C7E57108E7C BB,X3
622,007,405 *40008743F1564AACBD93F766E66D77FDA4FF3683 BBXCX
622,007,406 *4004F59796E81035F04A46BE93142C9AEF836EEB bbxdjnx66
622,007,407 *400CC0489A3CE1ED99DA370CB74DDDAF1F487519 [email protected]
622,007,408 *40036B33BAF9501E6E1274EC5EBA0C7960919F34 BBY&0
622,007,409 *400EA8B31DEB4D9D8679458DFE89DB8D09C3A7F7 BB/Y5
622,007,410 *4009BF92179AE33C661F6313B301B48D5714230E BBY GRL
622,007,411 *400372293FE503198076A071EF3E96FED612310D Bb"YI
622,007,412 *400F9B450CB12CABBA070C67606DA60135AA1591 bbyl123
622,007,413 *400BEAB0482C8F20B2331FC2DDDDAA4299A8D979 bbylewski
622,007,414 *4008E6897CD869AEF6A6C5A2B3001B0BCD630812 B#bYp
622,007,415 *400429881553EC599FA3A8D59F36BFF11F443652 B;B=Z
622,007,416 *4007DD5B8472882D08B04150A0C7C9179B8B6D8B BB+$Z
622,007,417 *40083D0CBBD044861BB48D5CB13B6AE41D57A4F7 BbZ04
622,007,418 *40039C90FEF14D788583A3CC0BAC6FC296C1B052 BBZ8e
622,007,419 *4005B48F90C3E09A338F273BFD36AFD82E70228C BbZiF
622,007,420 *400810C7C096F37D79176447ADEDA766E5260122 [email protected]
622,007,421 *400CD845FB416BE12406EDDC616E7D3E23871214 B,$:C
622,007,422 *4007324C19FABD0E909570989B3DE7CDD7A24735 B(=C,
622,007,423 *400CCF6F4D13130BF34ED0E6F4990FCBD696BEFC B)C$%
622,007,424 *40073BB6CCD11C827861DF06D6EE98C6CC4951E8 B+C%&
622,007,425 *400DCA76ED1F23EEB6D0487739816470B7E3A622 BC:,)
622,007,426 *400B0DCA50050D369DF3FAD9B9105F616E6BDABC BC!/&
622,007,427 *400F4A39069642DF816A2B3F8AF981E4628DB4A4 BC$##
622,007,428 *400323240BFA8D1EE40E4812D81E2EC1E7B36DD1 BC#:,
622,007,429 *400A0F1D32F4A7ECB0E7E86C76C03CC6910A2DE4 B-)c.
622,007,430 *4002DB4B3ACD0102EC8ED1A42B5ECF8915C84EC4 B;$c.
622,007,431 *40027756B45C4D875B4070F8E42D1756897F4BFE B$c,!
622,007,432 *400492187826BB77DD6FB6D2B0AF59421A1B09EB B&c,,
622,007,433 *40092B59ACC9B92908690BACB70CDDDEFA261F52 Bc&=%
622,007,434 *400CBC9DEDF1B2C97CD90D6FA4A38F19A6BC63DA BC#0/
622,007,435 *4009A0C990155AA8F30B50AAD6BC29393E5BEE21 B-C0B
622,007,436 *400F196B0F5B7F96AC60794F711D9E7DD1594E65 BC0D2
622,007,437 *40073DC540811CBE7C301FED8C5B6DC12E1390A0 Bc0_e
622,007,438 *4005FED4C381711BE3A4465AC40B0A6839714052 B+C0I
622,007,439 *400B2ECDC14319DA5D7D62FCFB432130A08888CB BC0Id
622,007,440 *4001FACD0C22927E1F9316364AABCFE84BDBE61A Bc0P#
622,007,441 *4005C738A03CF62AF31CA8C0E47121BDF65098F9 Bc0Xp
622,007,442 *4001D4F616C8DEED0B47177CD0A3F40D24FC2AAB B_+C1
622,007,443 *4001A9F2EC0AB78F98D4ED3AFD88D9C61DA41E82 B+"C1
622,007,444 *400997EF88702410F82798A09040A0150871C2D3 Bc_&1
622,007,445 *40074488721A2EA3D44FB35FD7C7D2BAB8A90CA4 BC10VLS
622,007,446 *4001DB3FB8F749475404B4533017D0C6ED5D053D Bc1c=
622,007,447 *400E720D8F44AE7C08BA038D2BE46700C7CF333F Bc1O:
622,007,448 *4000F438259546CE3F15D46A6ED941AD71A9EB66 bc1u
622,007,449 *400BDDFC600EF3A1A72EBEA5F28394AB7FC7A712 B/C2)
622,007,450 *4001ECE152692A1239A821EA2E85C410FF33CD02 B),C2
622,007,451 *4006F88E44CCCE3FA73E079A316C94B5CC488919 Bc)2(
622,007,452 *400F3C18A7ED6513F40ACFA5D45C26485AAA6BED Bc22N
622,007,453 *400D7D8C8C560C062B260A4979132BB1E323ED93 BC2Aq
622,007,454 *400057C8D4616E017EF5D9D125A09680B0214294 Bc.33
622,007,455 *4007D82C8037AD6D40BD750A66B04E8C88536EF3 B#c37
622,007,456 *400A6493236F41F501ED1B70E6A6057B1BC49748 Bc
622,007,457 *400E47D8F22F164FB42B8C81B4FAFA14A9C6A6F2 Bc/3g
622,007,458 *4008D4C3AF34A007F54FB1305478D8FA807FF962 Bc3lA
622,007,459 *400766D745B96285AD8AA17260B6E20203B26E2E Bc3M-
622,007,460 *40071F7D0534214ADE16A4AE1DAE3B210B8B0609 BC_=4
622,007,461 *40022DEA683099CDFCFB6BEC867F83E38601F1B7 Bc4!;
622,007,462 *4006C1C14DA6119DF9A2FD2DD84830D5B2C65BC6 bc4647
622,007,463 *400B1E22A8DA5487AD9101C2719E728345899B3B BC46K
622,007,464 *400DBFA39895946683249708AE9DFEA1789E08A6 B$c4f
622,007,465 *400AB4FDB0251CB646CF3497C8BA0E7FC462B205 BC_4G
622,007,466 *40051CF6930A67E3446D09E9D62D21098F47FD9C Bc4j"
622,007,467 *400A453A0006DDDAF8A497FEB835DA83391CB107 BC?4m
622,007,468 *400AE3D507004E656734E83C7B8DDDF6FBBE6A59 Bc4Ns
622,007,469 *400A2B480D2CB4624552F070E745AE6E932857B3 Bc4+P
622,007,470 *400871EEBAE571FC0EF847236490FB6E1B1716A8 B.%C5
622,007,471 *4006DC6AF748DC4984C5F7E30E2A59140697B7A6 BC5_
622,007,472 *400C8D45EC972A2A443F862AC67129B5FFE3E1C9 BC5
622,007,473 *4005575CAA29AC301C205440D6BE9F510F08A7EA Bc5CZ
622,007,474 *4002B38234D305F5AEDC698B9A79D441827CFA7E B)(C6
622,007,475 *400303F096A92B47CEEBB5E1CD1A3AAA98EDCD47 BC6%)
622,007,476 *400D48FB1FCA21E4B7D4A825E796102C259790E5 B_c:6
622,007,477 *40074CE8C0338E5D2622CA112E49A569508D2EE7 Bc"6(
622,007,478 *400AD9B88C19FF6FFBCF10813CFCC88C2B8BAD34 BC658年
622,007,479 *400FA1CD6DF47E7DDD8290BB560D6D34DE2C0D03 BC660
622,007,480 *4009CCF7A6C5D1E8DA4C26D4EC11219A6F623794 BC6;8
622,007,481 *4007D2C58768FE494E41535D0D9B6F949BD054DC [email protected]@g3s
622,007,482 *4008D6D808327A07284AEEF1C78F19FDE31A0C4C Bc7eM
622,007,483 *4009C1A0FAC904448428E010502D3D613505D2D8 Bc7Lt
622,007,484 *400AF33811F52AD6D15F23D339DBBF66B2E325B4 BC7n_
622,007,485 *400FE1F931A4C04FBE6C267F9CD0496961AC59C2 Bc7N2
622,007,486 *4009D25FE00DE58781F0687D6003CC9375733B59 BC7vA
622,007,487 *4005677314288795195925A3ADD6B28DEBF382BA Bc7Yu
622,007,488 *400E643F28ECE229E0F9BB1DB97ADFDD3DE332D2 BC+8)
622,007,489 *400360A14333E6146C0CEE080B9DA8F90F296BA1 B$(c8
622,007,490 *400D51C2D17961233E6BDBF04DF34B5EE1B3C810 bc83514e-8d19-3997-9baf-7b585850848d
622,007,491 *4004894057C04FEE174B126BF49F2CB5BEA00E93 BC86S
622,007,492 *400A62C1C1E7562B6BA2E2F9105D3847D5265101 BC8a1
622,007,493 *40010D8C6B785DCB8E10C1F339A165721D28A6AA Bc8Qs
622,007,494 *4000035307D0E21247D20283BD1F3EEF7546BEC8 BC9&D
622,007,495 *400E9486F80C1853AFEF01665DF8643950B4204A BC_9g
622,007,496 *400C0AE8DB8F76D185B4EF5C5C92636C513257B3 BC9vU
622,007,497 *4006817B71A8DE6535858FA078419E3052DC42BB BC=&a
622,007,498 *40069B2E92B0F559140AD67320FDA27AD369ED50 BcA5E
622,007,499 *4005DE346C0C5FE98A11E13C1F77442D38562B08 Bca5R
622,007,500 *40063A521618D0B72FD161C26254C1CCDF6CED79 BC+ak
622,007,501 *4008EB5E4214773C34D6D889EFE518372F30B0C9 Bcamh
622,007,502 *400DE0E811CF3009FE369C609334FB9839F58DA6 BCa-p
622,007,503 *4003AF9DAF341C2CFE4BC1268B1C9669D2B8A26A Bc(AP
622,007,504 *4005E130DE3FEB182431F186DE194515F8EDBE7E BcAPZ
622,007,505 *4000C6131EA58993F73136E9EE4B7641B6F511B2 BCavY
622,007,506 *400674218EF6FEF5F34BA4EA011CFFAC9B623A52 Bcaw0
622,007,507 *4007D4DFDC823682424F3DDEF7E98D1D690F2DC3 Bcazadpic3
622,007,508 *40042F508C379C5D380D873623506C431229DE84 B=cb"
622,007,509 *40019753C873E4AAD1CB0C953D04A1965E80F2A5 BCb3/
622,007,510 *400BD6D637ED65F7A5FD02B1338018F2586F89A3 B(Cb6
622,007,511 *400D74E03B53EE4D270508B6C2CC2C7F67589DCF BC$bA
622,007,512 *400131B4EBE39D33A237E5B1BA89DE94B36BF23D Bcba"
622,007,513 *400E2ECA9538E3D074B535646BC38F091E2E12BA Bcba6
622,007,514 *400BA88DC9DD71D2FFF5AE35A5604778ACBB6DF7 [email protected]
622,007,515 *4005F48020320C97E58698E0D5AFEBAAAE682CA8 BcbcV
622,007,516 *400F6459E5DE9967F3418A16725EC8CEFFA1345B BCb/F
622,007,517 *400609548ADE710250BE7015A011F608188CF2EF BCBFaq
622,007,518 *40035ACADC665E6F3F8ABE2AC4CD1F42984622C9 Bc/bH
622,007,519 *4006EE9B5C76C909EBA8897FC986B7A2864098E5 BCBHf
622,007,520 *400FE234D20B871276E84CBCFF445E1CB087FDF2 BCb&L
622,007,521 *40014DAC51107EEE5E20160DA862A29E6C73F1C4 bcblawtoncom
622,007,522 *400AD480CF8273F6F87FD15276A4F6C36CF5A6CA Bcbp&
622,007,523 *40002AC359587F61ACA1723B78DB33404602706E BCBUFFY1
622,007,524 *400F5F39F7F09FC30253AF4BC96668CBFC8AA2EA B"C$C
622,007,525 *400DFCA18BD3500C1345D135E6E883C9A0967537 BCC11F173DA21764
622,007,526 *40017A54BC03503D4860EB4A2ADBE62050173CAD BcCAS
622,007,527 *400CC80060D2C8879F60DC6E58CB5087F3A8B412 BcchB
622,007,528 *400A8F5FD5BE0B3A5E0F5E4CDA18BD4CEE7D6385 bccklichsein
622,007,529 *400C77FB0CBA870E22176E0D050C6DCD067909A6 B+cCl
622,007,530 *40065EB4D27796EA60A7F83FE3753BF0AB7DD82C BcCM_
622,007,531 *400D1AD25FE3E6A35C0B0CF90C8808D5AFB4FCEA Bc!Cm
622,007,532 *40033BA4528BC2F2ADD2548ED4B6D37257A0D18C BCCV/
622,007,533 *400C308F027DF2D9977698A776D2AB1EF1C7D3F4 Bc!CV
622,007,534 *400C091213DCCE937733E1637D045B9FC4CEC24F B=C)d
622,007,535 *400611B22C3B67FD84E4E76C0F8EB34F37E29A7A B?c
622,007,536 *4006E09591BE79A073B9FEA7D9BBDA60158D20EB [email protected]
622,007,537 *40079A63CEAA2F71EA8B9EFA061CAD88FADE017E BcDaD
622,007,538 *400C75AF57026662D63019D8270DBFD71A06D007 BcDaI
622,007,539 *400C184390F2A961C99C187EE86700C48D3901E4 BCdFR
622,007,540 *40044513B30AC00F8D5C53D49F564398DA2CCB66 BcDhl
622,007,541 *40037DC22BF41B90BC61B910A29493917D22B176 BcDm#
622,007,542 *40000A483CEF741508CE57B7240BD3620EDEA3D9 BCdNj
622,007,543 *40043BD23880F960843585AF3C7A71883A08EC4D BcDOB
622,007,544 *400ABCC448F508B5928DDB43E823BB94DBAA4A1C BCdq1
622,007,545 *400953A7D419B2551FA85D3C69DCC596AF3976C9 B;cDY
622,007,546 *400AB49F96975A28369A58283528BF9556336550 Bce2T
622,007,547 *400D996302604A96B0B474BD4D290F67E1127CE2 BCec8
622,007,548 *400538273B82C0548B7F2923FF412898ACE5BB92 BC.EI
622,007,549 *4006AB0C1EF4B29C5893AC6E909D81C2ED92F330 bceo.orgwww
622,007,550 *400831DD460AC4509A38DEC778347B6837414BF9 bCERAAAAIBAJ
622,007,551 *4002FEDF6E7E558A0C1CF6B158271ED6823B0A01 bcesteg
622,007,552 *400C879D5E6E8AAA0BEF3B02FCE20203E1E281A5 BcevG
622,007,553 *400A4602FC38F10A6ED4500C36DF83C1E1E1FBD9 BC,f(
622,007,554 *400EDD1ED1EAA735761A0800F132362C531ADEB1 Bc-%F
622,007,555 *400A6C5C6EBAB970DE22689DE75ACF44E2207860 B%cf(
622,007,556 *4009E5A85A711CA9F4BFBD44D9152CB98A1F0D54 BcF1N
622,007,557 *4004684A586C9D18715BA34195D3333D0BDECA13 BCF4H
622,007,558 *400D86615CD4B8E9C00E449B89FAA41D077CC797 bcff2b
622,007,559 *400FF91EA429A7FC2765C69AC55A095A46A810C6 B!CFK
622,007,560 *4008D283CCF8EEFAE937DB7E8811AABE93CF125F BCF"L
622,007,561 *40028F88090A0DE8EFDF11C7C46A492571FA4F17 B/cfo
622,007,562 *4009C5669ADA4D601DD827E42AE4ED91F5DEF447 BcFoC
622,007,563 *400B63FC8D2920B427DF44D004B168646D95DE06 Bc,Fp
622,007,564 *400F59BA37B6BEB798061CA4EEB6736B7FDD43B9 BCF?U
622,007,565 *400D29E6FCA1C47F61EE35412B2C525AA8F62038 Bcf)V
622,007,566 *40084DDF7B39C8646F0CDA3CA358F007220FFE3A BcfV2
622,007,567 *40019102844D0FBD2F5EE05A90658D8665BD0243 BcFVb
622,007,568 *4004F8827D18260F63425EFB3D26245E604216F2 BC
622,007,569 *4000A10699E48BBF605839FC08E6BE8CE5734985 BCg8d
622,007,570 *400483AD7225B0D1993C82BD4A3C16C1FE6D233E BCgB4
622,007,571 *400911760CF1EF18404B611E548445B7193F83CB BCgBQ
622,007,572 *400E4574C901BF8411370B49B818CD7C61C6E7EB B+Cgd
622,007,573 *400A99D252BC6805C78AF0F58BD3408327264E91 BCG%h
622,007,574 *400B5A124250C6EBDB947ADB408972E1F7834A7F BCGIN
622,007,575 *4005AE419183107BB849EB0740A24DFBB89F6FF2 BC(Gk
622,007,576 *4002A4BD139EE2BDE3A3D41FABC1DD56EF9BD05B BCg/N
622,007,577 *400EAFB84197E5E67B026C2F2A112C7C4F1ABE56 BCg,n
622,007,578 *4008A9BB08CCE5E60293BB27F4CD9839F5479770 BCgVo
622,007,579 *4007A26910269FB90F46ABD7D4F6E4B4AD372BC6 Bc/!H
622,007,580 *40084CA3F567A3CC5B967761A5AD4273755B7A47 bch1995
622,007,581 *400DC3FB3089132B52F789595608C55972C71EF1 [email protected]
622,007,582 *400229C4F1357B2D5BAD7080FD05B345DA3280E8 BCh:5
622,007,583 *400C20771080A9A0873323B0C62B39E26273347A [email protected]
622,007,584 *400F041FC1BCC0260D1CA0DEC08CC66A7BB6A4D1 Bchek
622,007,585 *4008238F8AFB0C017F9198C4112889180A6AA1AA [email protected]
622,007,586 *40048E7C89C54F6BF8F64B4FC245C6E956431C92 BchFashion
622,007,587 *4007A5943FD0DF362D651B20B42ED406E9FE7205 BchfG
622,007,588 *400CAD37C6DFB36774D7B6E611EB68C415006C05 BChHf
622,007,589 *4000683FD1CDFDF5CAF21C5C9392A3C60EC7DC1A BChi?
622,007,590 *4005976D31784E3D0AA66C525E9EB43518E3DE13 [email protected]
622,007,591 *400D814F1109C432DDB9DCD2D3C33556F603CA86 BCH;l
622,007,592 *4006BD7A043F531DB18B38BEA6ECB86B2D3EB7B5 Bchorky6
622,007,593 *400B1A79E73715FE9A695B3B534989B7727B78E2 BCHQU
622,007,594 *40026CFC2B28C9919E4B72B0597489F8278DD216 Bc%hs
622,007,595 *40076AB708A3DB17764C48F94481EDBBC26A44AE BC-&I
622,007,596 *400F6FAA3CB81CBD84B469F69E8813207EF67F4C BC:I9
622,007,597 *400623429807608A04BD9719C4B879CC21BC84C5 B=cic
622,007,598 *4007BB5498EA4B80786382F5461A871F799E1CFA Bc"IF
622,007,599 *400411DC6A523DFB4DFD2969032EA8AAD2AB821D B
622,007,600 *400A86394F3390DD2CBED7A1DAFF52DC1161FBAD BCign
622,007,601 *4001148CEE97D563605657DFBE1DDCB50DF69844 Bcih=
622,007,602 *400727BE9575A41E15F6632BB2680E9C30A36C5F Bciju
622,007,603 *400155EE0AD77140B0B2EC629056CFA45E3EF1B4 [email protected]
622,007,604 *40026B6E7FE0F1593A5E6AD7E921F2911E1A282B Bcin%
622,007,605 *40087A6D10B0A9C4C393E00BBE7FFC90219ECB1F BCiWC
622,007,606 *4004A666CD29572E69BB75B0086056ABA72E88EB BCIYV
622,007,607 *400FA4390089EE5B81263ADA89B2985F332B5906 Bcj7,
622,007,608 *400CCF5E1E31A311B8B35EAC3F1D9577729D43D1 B#Cjs
622,007,609 *4003B49AA612137ED42ACBF2CB594746628F9DC9 BCjtG
622,007,610 *400F50D65494F4359892653D4262DBBC7FE852A9 BCjV$
622,007,611 *400322D6F855C1A85C6976611CA2A234193A89EE BCK%/
622,007,612 *40034554C0238EB3743AEF4EF405F9622250FFAC B!C+k
622,007,613 *40067D8E7FBFF43F42C55900E088B89A5950061F Bck4
622,007,614 *4003105DEAF688CD513872B65052AB4C8D746DB7 BcK6n
622,007,615 *4009F508196110D40F2117CB43E01D6B2EFC35F0 [email protected]!ter$
622,007,616 *400E229F8D2D8C7D36A1138505244253C67247C3 BCk=j
622,007,617 *400A36ABC28DEAE26F8F0D65F867DEED207C2E74 BcKk/
622,007,618 *400051184BA93D086406A533FB6859774360C6E3 BckKE
622,007,619 *4000A12895C1CEAB7C9A216B3A91CAF85DE52A87 [email protected]!5+5
622,007,620 *400C7BFA04FD7CE5F8D8099B196E07562CA64EBE BckQ"
622,007,621 *400EBD93435FFD1727EDBDEE4478763415D19EF2 BCkR6
622,007,622 *400653A29F331AB30B9CD7D7F203BAA781A6CBC4 BCkSN
622,007,623 *4000490CA3FEE02CB3EE7876031B3FCF7BA51D48 BcKZG
622,007,624 *4003732ABD4B7A17688D26F56D0A778D9F6AE6BA BcL_;
622,007,625 *400EE877019BCD7323304B0DBB1448C3A31261F9 BCL!a
622,007,626 *400B52B67E5A7DCC44BC6365673DF4B71B7C0F34 bclaudiing
622,007,627 *4003411B21FC678E814FB7EA6F35CA6929BE8316 Bclavian9
622,007,628 *40004AA4C2868FC27617FC1E4EF31E73AA9F0030 BClpd
622,007,629 *400DF02064141DE82D9B94E1DAAD3B5A9433FB3F B)CLU
622,007,630 *4006E27DF2498F51162BC3D4257546185F75789A B--cM
622,007,631 *400E33D322BCE1B441E5FF0461C115E911B005B5 bcmanuuk18
622,007,632 *4007D4A4E387F36EE10B481DA83AF8FD52AB5EC8 bcmenik
622,007,633 *400B88F9781C71FA6797080F0034F5F15D65B746 BCmF5
622,007,634 *400E31C2F0CA7C7B6C0BF1BA6C29F052B9A65E0D BC=Mh
622,007,635 *400EB7A856D76A6B30979D8F4B21791734C998FD BC"MM
622,007,636 *400911EDC63C8C71F19A745B5B5C8D45A89ED5FF BCmnC
622,007,637 *40070F46F0371EDD2E0DAAD80C99449B0F557C73 BCmt;
622,007,638 *40091DF2FD70305A2BEF69C323102FEAEDCF6AF6 B%cmt
622,007,639 *40013610BF3021D3F22E3F0FCF10AAD168ABE70F bcmte
622,007,640 *40060767D4A160AF2CA6E067204677687ABC2841 B(c-n
622,007,641 *400327A7688CC66345143E275A0BB718939ED981 BC$n5
622,007,642 *4005373ED24495D36378F3D174963473C3C1F200 B(CnF
622,007,643 *400D9C05BCA718D0726F8CF85264BB0D141BC520 Bcn?k
622,007,644 *400A8539A1B84A716E175B13E25C27FC808FF321 BCnVN
622,007,645 *4003F39C84B4131576545C039219832521416789 B_(Co
622,007,646 *40007A5B88AC914ED4A908201FC75E60CB3F11F1 B$C)o
622,007,647 *400BB30C4F64EF86B25AE938ECE96FC97DAEE850 BC+o=
622,007,648 *4005B78CF4A28246E0CCCD18AAFE894162C5F336 BcO\
622,007,649 *400F02459123FAF414B53C2787E0DD47F4B38C70 B,c:o
622,007,650 *400FFAA6B6A901BA0E9282F219E27655A4BDC73D Bc.:o
622,007,651 *400F4DA35457F0DAA7D1434A3DC3A14AD24DE35B BcO3R
622,007,652 *400DCD7530F4D6D68A7F3947A2B774FBBA1E93DB B_cO8
622,007,653 *400B306F35C1526D80061D791E2978965D9A0174 BCoAG
622,007,654 *400D5035738507E34441AEB775FEA07C6A7B20AE BcOch
622,007,655 *4006B643F6B79584195C1A48A32B15ECD5AB2914 BCoe9
622,007,656 *4005009338DC52F4813825A2D81288C2278F2D9D BcoL#
622,007,657 *400E17A1DE82C622D8A64957A4A72430EF838576 BCOMj
622,007,658 *40081695021E436301C293AF184C957C9905629C BCoPH
622,007,659 *400B6F248917D92B8ADAB3F12557190A5E3DC90B BcO
622,007,660 *400E85355A4BCADF3175C499F6EC48F30380FA9B BC
622,007,661 *40053AC5A59987669DD076B9AD55859A23935D0B B(+cP
622,007,662 *40092B0B91A5508421C12875677191AE89AB123C Bc($p
622,007,663 *400FEA3212CEA97D7E1D7C704472CBA2DA247902 BCp5S
622,007,664 *4004637E028DADA7CF6C35F97C48D2454A68AB19 [email protected]
622,007,665 *40056B6E098080E3F70A6A811EFEA4BCA26925EE BcP8Q
622,007,666 *4003A04A62EDE36B7B28C866998FF03BD1482723 BCpEW
622,007,667 *400C691E566FDED1FFDC14D14D2ACABA5CB30990 BCPjL
622,007,668 *400B47531C9E918448E586E65FCC7D5DB7F5C889 [email protected]
622,007,669 *400BAC44261E4041C08EA3FC196ACC1B97647200 BCPO
622,007,670 *40088954694C0D92EAE661452386EAA81DA5AF46 BCP?P
622,007,671 *400E9674E3A13348047963C4E5FAD04ED619D8D2 [email protected]
622,007,672 *4004991E14D21DBC2CFF132A67A38E6ED52146D0 B%cpT
622,007,673 *400288D772487A970F554C6B50B21534425702BE BcpWw
622,007,674 *40076A88DDEBDF08243FC69CD717AFA3F3F45A22 B_%cQ
622,007,675 *40072E1D3A9DA91FCC94FBAC8DBE205AF8F60A7B B!c&Q
622,007,676 *4007FF680B99E66BD55EEE17A4E2E08B7BE616A3 B/CQ6
622,007,677 *400B3A0915EA2490E7327F44B7E9B696B02ECCBA BCQ/c
622,007,678 *40069B5E8BA6234665D08DA867D399EF80454F55 BCq?F
622,007,679 *400324298D91A64D46DC1D7177928B03F847A7D1 B$cQl
622,007,680 *4008549000B417A69B98132B9E0DE7DA9939DFEB BcQmR
622,007,681 *400275A1DB774EE8D44AFD8342D01FBB7A43DF0A BC&qv
622,007,682 *400BFAEC525F4DFFE9FFEABD2F9720344E6DE7C0 BCq
622,007,683 *4002AD1B4AA8D61B7CA6B5F33179465385464160 B
622,007,684 *40007D499CE9B0AE735EB844FA1E567E6B0E55BC BCr=/
622,007,685 *4008042132DC60E505E7D3EFFE7DAB4ED7C2566B B.cR-
622,007,686 *400C700FC8A537976635352D1D9796B0B1A4A683 Bcr
622,007,687 *40032A66EAA76E614E73BB49AF88962FA74271BE BCRb"
622,007,688 *400D3C9999D2D6EB0DD5C3D1BEC1E3A133AFCEC4 BCRE.
622,007,689 *4004CF6DFAFE7730BE3CA7FD781A147E160A0F4A Bcr;E
622,007,690 *4000C95D895E1B1D901B1137D13BFBDD89C3B928 bcrelief2
622,007,691 *40015FA59B417AFBCA67BE3735EC7FC52CF74DE4 BCRi9
622,007,692 *4006C17FC7491716C7FB3375003639A5BD563FA4 bcristiandelreal.com
622,007,693 *400ACD4159221A86199EF728E38BA0B53CB39A0C [email protected]
622,007,694 *400845A80D00E9517751AA6CF4F90804522286C1 Bcrliclningen
622,007,695 *40078AD9F7D83733E1C7389A4E779F214FBA0C13 BcRo
622,007,696 *40054F4AA44FF05E8D593E4A3D2B76EDA16F5EDE BcRQB
622,007,697 *400DE5AA7B3152E1F6749F9230C72F717306ADD3 B"C=s
622,007,698 *400829F764AEA9170E714B7B3F1FB36B9E87FAE8 B#C,s
622,007,699 *4009361BD011188BF8AB92217D1DDB8E406DEFCB BCs=)
622,007,700 *400B7925CAE34AD55DC2E4A9393A75995A2A3753 B+cS
622,007,701 *400626DB4165DC383062EEB0EA2635E1DF9F305B BCS;0
622,007,702 *400DACBC3BC23BF390301290E949A7F80595E56A Bcs&9
622,007,703 *4007B32BC21E41DFD784B6CDE862E52B10C185C9 BCSAT
622,007,704 *4008DC8B3D2A98BDD945930BAF01E48ABC454FF5 BCS-c
622,007,705 *4002BD8083054641D473B86A18458948F8A5B74D BCsE$
622,007,706 *400E4E5C4F311810EF2D386D1DFD675C5C712077 bcshl
622,007,707 *400E2DC486BAE9279A54757FC9B932B471E50986 BcsSe
622,007,708 *4009E5E4BA59364471D866288489BA29C2371CED BcsvX
622,007,709 *4000B3087BAF102FBC86F38C9CFCABACB7337774 BcT_/
622,007,710 *400E34182BB2C027A24D80074717EE60F058FF33 Bc
622,007,711 *400A5309ED4C6EF52243FDA9A3961400A11855DE [email protected]$T
622,007,712 *40030496CB7C801313A4992F74858A3F61FC29C8 BCT5m
622,007,713 *40080691C451DA32C51D2503EFFC4634FC8E0C5E BcT=a
622,007,714 *4004A202CFE3752300B8C55B75B5D0847A38586D BCTCOLTS2
622,007,715 *400413FDC51818594D42224C57D8C52273BB8701 [email protected][email protected]
622,007,716 *40037D18688460A2D9C66C955AB2A4AE31714867 [email protected]
622,007,717 *40043EE29A50E0988FE2B4C81646327F37C6A0BF BCTQ=
622,007,718 *40085726C661612292380DDC4FBDAEA9DC7C2696 BCTVA
622,007,719 *400D6D09D33E0B4DE1AD6E11FD22E47D156DFC26 BCtW6
622,007,720 *400F2B92867BE477FE83770029EA8ECB13232A30 BCTYg
622,007,721 *400FB1ABE6F408E03C46FAABF3BBC97CBDB470CE BCU:#
622,007,722 *40094CB197B006E248A2C87175E015BBFBB660DE Bc(u:
622,007,723 *400172B4E62196B847AF0E718E6878B95605D385 BCu2D
622,007,724 *4007F12B8DADC092997C63202A2DC478CBDB9D1E Bcubbsw3
622,007,725 *4002D3C5AE8AF11ED412873762E17F30E3346294 bcuchargers.comwww
622,007,726 *400C052119B14C8869922BD07803708C27BA4C0C BCugS
622,007,727 *4000136226F910D01DF82B7C0E200ECE6DC18580 B/cuU
622,007,728 *4002305299B48F3BEDD992035B3224635F14288E BcUwE
622,007,729 *4003394ABC1A985CB345D99AD84842055D29E197 BCV)=
622,007,730 *400D9011859FA219382ADD2184B6DF53A56AB73C Bcv7%
622,007,731 *4006C57218FC5ED6AAFF6ADC022D3AE810AE373D BCVb-
622,007,732 *400A2EE2458B7E991B488AC848EB3E4DC2DE788A bcvey
622,007,733 *4002202BE7EADB86AAB822C906F8AFCED3CE99C5 BcVS"
622,007,734 *4002627C2F87715A620E86C158CB5A8B69B5527E BCVv.
622,007,735 *400D15028B317E4A3021AF06A6AC884264EB52EC BcvwQ
622,007,736 *4001777F33584E393F078A6DFB556F97B5799133 Bcwauxiiubf43m
622,007,737 *4001251F0790682DDC7B5D9C108D8F28737D2F8F BcWHO
622,007,738 *400700E5638DC09C98603927430878032BCC5B1C [email protected]
622,007,739 *40011FFAACF481A84C88C1E8B829E1AA3CEE4AF6 bcx3RMis0
622,007,740 *4007FE0074E6B85BE7EC47995A8E360D36CF128C BCY0M
622,007,741 *400A1833B578DA98A679BAB91C42F04A9990343E BcYnh
622,007,742 *4000EE418B1172B444FBA921811DFA6BCE622190 BCYQ#
622,007,743 *400C6C4E148B817ED643DE7652939F600E426EF8 B%CZ,
622,007,744 *400E51860E127B8C4E1EE969563A33B5DFA6C34F BCzelbah
622,007,745 *4000A5EE9C1FBF50DFF430463576478A1B361043 BCZO7
622,007,746 *4005941BC4EF0EC37424CFF7A6D2263E2EB2B3A9 BC/Zs
622,007,747 *4002D49BC51DAB4FA25888A5B8677B5D46137916 B(D/?
622,007,748 *400753F53F2E6885CF38A7B57AE33136B609CE4D B$;D+
622,007,749 *400DA981D22B3301B9A1854A0821C5B448DEA63A B&:(D
622,007,750 *400F153D5655704DA539304FD08360E32D54C0AB B%-D)
622,007,751 *4005EFD277D884B6027ECEAE919EAFEEC742929C B
622,007,752 *400AE56EE0C48DAD951CAA522AE18721F897D010 BD:_:
622,007,753 *400FC6A00FE8C6EB9C696FFF2D5ECCAEF6E98BE5 BD'`
622,007,754 *40091966B7FD7E862FB507055C900C5E074B724C B,%=d
622,007,755 *400A581B8A9C9D226C80E845C08A54A7E30F589A B;d/+
622,007,756 *400DECC4F285435EDCEE79828DAF8D06C31B371D B!d"%
622,007,757 *4008F56D4BB3A3A99615783B3636E1D57769BC6A B?d/%
622,007,758 *40056A2D3611AE92171A119D3AE929E96094A820 B(-d%
622,007,759 *40088DB086598E93C0DF20EEDA09E899B4923146 B)d+,
622,007,760 *400C300BAA1524A89870EB8BE545B7185F948DB9 Bd=,!
622,007,761 *4001DC06D8B09C38737CA7CB79B300D0DC5FB5D3 BD?&0
622,007,762 *400EEE370DE4E298D1C8AACE37F92270AAB463D2 B(d0,
622,007,763 *4005F0661D215DD03B11DE47167CCB1E40E2B0B2 BD03p
622,007,764 *400D231074975174BE4863E79C41D052C112F7C3 BD0?s
622,007,765 *400D4E015A373FFA047D7CD4D09C4AFB22B2D6F3 BD0Vb
622,007,766 *400239B5029CF02AB2C2BAA8DAA1D780E973566B Bd=16
622,007,767 *400B332AB27F3750E400627C8809F2C6DE3B512F Bd%1F
622,007,768 *400AD20F65C4CD20E5BDF34BB4177E66ED41FD19 BD1HY
622,007,769 *40097C48D7ED3CCCD9E3A49FFFFD56A505C1C8B7 Bd1L%
622,007,770 *40033EC1E02D8B8A0CCCD0B4444FBB3DC52CBC88 Bd1L3
622,007,771 *400838DC529BCC784DE0999CCEF40D60C15A3C88 Bd+:2
622,007,772 *40071369038102D8A26602D9AADEBC61D68C1052 Bd25A
622,007,773 *4009AF2EC70A0CEA1E5E7449422B8D80A1100679 BD2C%
622,007,774 *400B9DB60340218C223FE7EC10A6968CA321B4B9 Bd$2F
622,007,775 *4005CE6D50EED1B195D6029F9C7064FAED0D8901 Bd2H+
622,007,776 *400F21780242804E7F4C5B916010664098D9F3FD Bd2wU
622,007,777 *400EF723F656C9101093A1F44D4ED26FCB7F8947 BD31w
622,007,778 *400557B3C95E2DB9550AB9B1F3A1D97CD835CF33 [email protected]
622,007,779 *4009BDE9512FFF4F285C336D1005134A030F492A Bd3h&
622,007,780 *40082214B36E39C2A707825EDEA19FD692B186C6 B(D3S
622,007,781 *400E8E3BEE45AD26D45A92C6ADEB7301AE7EC6B0 Bd41T
622,007,782 *40052E78FF6956480B8EDA92396C47C87C2230B3 bd46146
622,007,783 *400069DF6A483552D89F59FFC0B81B9B798F044B B+d47
622,007,784 *400B847A0877A41DFA174DBE03136F30691D7542 Bd4e4
622,007,785 *4003EA661D8C8A0727E24D627E2FAAC42D5FA87A bd4eku
622,007,786 *400BC4ECE1469DDCD05F5FE30A1BDFDAFFC0A624 B?d4f
622,007,787 *400D34D934DB80C871BB6B9FB8E5B6785C735819 B(d4k
622,007,788 *4000BBFBEF742A67793B8F688CB29FA8A12AF66C BD%4P
622,007,789 *400417D4A9143E6B14B89DF311B87641C014ABBE Bd4.Q
622,007,790 *40090E77FA217ACB1CDBCE0A5A3E6423C34C99EB Bd4V)
622,007,791 *4001CD2CDB788EB11708647C6DCB2905067F593F BD"5
622,007,792 *400C2E0CE705EBCFDE8F5DAF6DC851C6D7BB13B8 B%
622,007,793 *40077E33D69075B41B05CE2C4664A577E5CD7BB8 BD5319491
622,007,794 *400A9D9EF7721C51ADB85063896C77A89D22979C [email protected]
622,007,795 *4002F67B224D6EEADF1C2757DE82635D054E5A1D Bd5Y+
622,007,796 *40051AB078BEE08273038CB8E9F805E1394C77ED BD)6/
622,007,797 *400F580D54F18CAF36286D088F5C2FBE26E5659D B.d6%
622,007,798 *400F8C38F16996DB061B268A95468465C94F84FC BD6B2
622,007,799 *400AD1C92BD0D4C50C8B0773F6C7E10CE9DA6133 BD6Ck
622,007,800 *400237127A5DDC56DA7095844BAD424C813D542E Bd6h5
622,007,801 *4003DF1752AA5AEB4A1D18BFC1604CBF3CE87018 B&d76
622,007,802 *4002BDB4C581DFAD4C69DE7B96B8131D7A9CF84A Bd7Uc
622,007,803 *40097A91315C6DB534006CBC585D7D5EC9D4AE5C Bd(8)
622,007,804 *4007E0A7454D96FA6B10AEF0AB7482F214A6F08C Bd8Lh
622,007,805 *400E55C513145036DD3C155D04FE5346A2CA45AA BD8+Q
622,007,806 *400BD3E559217747C5C47D47B61C971473AD4CED BDA=%
622,007,807 *40034D27EE4066BE0C2F90D98E29D159329256DB Bd;"A
622,007,808 *400D00ED355AF9C4887EBAB1003133CA4F226654 BDA721
622,007,809 *400C0FC4669BEFF4134283EE53E068708FB2E599 BDaC9
622,007,810 *400F370AC88D8423334C9D2CE33A876CF9C6EBF2 BDafm
622,007,811 *4006AA5266B6640A3CCC03043ECD6A152233D0CB BdAkR
622,007,812 *4008C55CAD65D8BBCC71897B41B8ADF350FB0E7C b-daplayers
622,007,813 *4008DC97BF8120A4CEF284896D5135640497DE5E [email protected]
622,007,814 *400A225C63D64EF200F6DAEEE35E00A0202FAAA4 B.Darvill'sWildWestShow
622,007,815 *400FF0EC96E85DF5B062F1DF118FC0A6D5BCDE7C BdAXS
622,007,816 *4001D2E1669CAB6A005BCBDDD078810B0A5AEF85 B$D)b
622,007,817 *4008CB7BAFF3F1879734258F8E0AEE6421B2ECBF BDb7w
622,007,818 *4000DBA748B24734DCE3C33FA73CD92C7D0AB9FC BDB/9
622,007,819 *4005389DA20D649490EA4BF30DE96A0A6192F92D bD&baa
622,007,820 *400AB70059083B9412D7147A3561BBCD120FE50B bdbarca6
622,007,821 *400C31362A9A2D8AC1D1DA5C04E91509FEFE0C8C BdBCd
622,007,822 *400A55A9031A912E685BB349A8C963897E0BA43F B
622,007,823 *400AB19B52427562C0F752576FAA1D8F9DF27066 BdBI7
622,007,824 *40016F8680C8D5207B569E25FFBBC19A67667E74 BDBLn
622,007,825 *4005FD8471802D5F968F24C70D5829D50CB2535D B.DbP
622,007,826 *4009F898A05AD17E6FE2CD068E7B5C318AAB6EF1 BDBPV
622,007,827 *4007011054A83641ACBB613100EA088540B91FFF Bdbs(
622,007,828 *400CA2844E316EB1ACDCCD036D6BBD3713F2E3F1 bdbuilder2
622,007,829 *40072BC8CD43874FD3F16386E014B57F69A45AD5 BDBv!
622,007,830 *400C0B085B7FE029580C526BC55ED3D2628F6D0A BDb&W
622,007,831 *40040E94AD5C68AAE8B41833EF7B1A64746A5779 B+dCD
622,007,832 *400E0CED27A6CE3627CA749F6853A093F7326F8D BdCG%
622,007,833 *400B8CFB53F4CE4799C7BB9C3F530FE453BBDE50 [email protected]
622,007,834 *400ED59075E78F6F7AD5C19ECDF557D064649844 BdcI:
622,007,835 *40004287DF98BBB216DDE794C29C7ECE0CCF4A3B BdCj$
622,007,836 *400914CFDBD20D76F810F7EAC7FE0E75821D6608 BDCwb
622,007,837 *4008A70209D5FF419926D2B0E5647E75D2D66983 BDCYd
622,007,838 *400C56169BCA49444A78E5DB8EC0ADB08C47766B Bdd($
622,007,839 *400E6B6980D6332991646C69A02FC14554C9C6E9 BdD1n
622,007,840 *400501AF3B58893D6528047D3D6F934C83C58777 BdD!3
622,007,841 *40080D3AB3B277CFC8334601901FC8BA598467A9 Bdd41
622,007,842 *400681C1FF3FA7F71E59C8659EED26F5EDE8A8FE BDdfu
622,007,843 *40036944FB4635C392E4BA20C5CE291956E3EA04 BDDs.
622,007,844 *400CEED19427E332CEA776C814C95347B741DD5C Bd;ds
622,007,845 *400CCAD6177EEB1EB76EF55909D54A6B72E6E180 Bdds.
622,007,846 *400070F4D83B6D8BCD017EE347CE5781FA10874A Bddsp
622,007,847 *40001E497A7D911106FB02AEA89D1A88554068B2 BddT.
622,007,848 *400A06E296301655AD31CCFF0911B944CEB9168E BDdvT
622,007,849 *4005650C66DEDAE1A690C9ED4AF9014FD5EE3241 B=D_e
622,007,850 *4006C5683D949BC56772577AB8258D6AB58BB124 BDe=?
622,007,851 *40048A6580B3B7FD94770880077D2C48B238C04E BdE3k
622,007,852 *400593FEDF63526645D82C98F8672792C32C44BF BDE6,
622,007,853 *400054817B8572122A0E69A7062A853C9E12D2A6 bdeathcrosstrader
622,007,854 *400C2FC6C951AB9CD1163CC2293C296695FCFA67 Bdeba
622,007,855 *400BD556ED148522AE7AF35A0C6ADE298DDEE768 BDEFCD
622,007,856 *400ABCEEA521BFFB83625BFA77A5C6436BD7AB66 BDEfL
622,007,857 *4004E3405E2093B1AA24F931B68DC2D62823372D B
622,007,858 *4009B3AAFE872D840F96659B04F21650F9EBBDE0 B&dEg
622,007,859 *400364E560016AE2256A2B28B9F2038D32AFEC25 BDEHEAP
622,007,860 *400CCD066A57F77F70881A7CB6A5F11E5B549019 B=dEK
622,007,861 *400C2A4F68A11B4C870FFDAE7D0241CF8ACA5C00 BdE/L
622,007,862 *400EEDB1795D721EEBF6F227900E12D2A33A778F Bd?EN
622,007,863 *4004D8B02B46C7FE24F2BF20D550B07BD576B8AC bdenised
622,007,864 *400EFAF47BC74148125F19AA24056AE3D15AC4B0 bdenp217
622,007,865 *400BF8EF488E0ECCD63542DF81E80D28F06BA326 B#DEo
622,007,866 *400B55E8130F39F06F2B42F3DE161456FEF5394F BDEq=
622,007,867 *400E478934D25D0B98C7245C8C9F9D89B05D2EC3 BDESIRE
622,007,868 *400F1B55B1C51D10460522C4CE4DE7F05817C6D4 BDeUB
622,007,869 *400147E3516857F6CD37E0E7CA2836D55FC0D128 BDF)A
622,007,870 *40058F4BA2039C1F6792456154A57EF21FF97130 b
622,007,871 *400C0F7D12B997C719355E3904AE0E8BACB1B548 BdfCP
622,007,872 *400DF2D63B425C2ABE3217ABE8718FF2281EB19A BDfPD
622,007,873 *400B60061C3DAD1624A412CF32E631DAD8E0E2C1 BD!fS
622,007,874 *400DEBD0F5C5A37B1FA5BFA090AE87E8EC3BB1FD BdFtA
622,007,875 *4003C42D87FF1EF83B8B6B4E50F314DE651D73A1 BDg?.
622,007,876 *4002FA384DA56F222D643B7CE8B8A970868AF90D B,d%G
622,007,877 *400F842A64B21D2DF78F17F4328A47EF75781473 Bd?
622,007,878 *400EA46DAD4EF9C396677E8E91F68555E91BB016 Bd(g-
622,007,879 *400015C6C8869554B6990E1F9F4F200854A2AAF5 Bd+g=
622,007,880 *400FF888495F06E2FD9EAAF276EEFE6A7E9A02D8 BdG0V
622,007,881 *400C0378EF37D7E0A6107AE54C208DB6D95DA766 bdgame
622,007,882 *4007849558EDA91B7E0F0D22EC9599B08B259FAC BDgcw
622,007,883 *4007BE64E8F30E726F49B7F1E8BB7B8CEC4CAA1D [email protected]
622,007,884 *4004CC7D73B40308DB774AC85B91CC68B26CDD03 BdgfK
622,007,885 *400AE6CEBE923154D6CE42D313C15F0FA368EF12 BDGk-
622,007,886 *400643EB5F367E2DD76BEC4028D8E11F2A423BC6 BdgK0
622,007,887 *400EE02AE117B0B195CC553545BB4FC0B6FF6C9A BDGp_
622,007,888 *40062954231D9123E29F44E0E74A4FBE6693EFC5 BDgPN
622,007,889 *400E5C56A142CA06FB3B0F306872AB0837ED05D6 Bdg%r
622,007,890 *4002503A67011B311B904475309CA63757BB9D11 Bd:gS
622,007,891 *400DF488F4E48C175E72F001F32851EBBC16775B BdgS6
622,007,892 *40096B814FD63ED89AD1758F754C98A6A97FB454 BdgSV
622,007,893 *40020CADE680C569037BFC93EA1EAA44032F2695 BDGW#
622,007,894 *400476962CEAA84FF4B6729D620051A945B1E75B BD,GY
622,007,895 *4003E9618DECADC9410D72F3DD6E88F1647D4281 B&DH&
622,007,896 *400B5AE7735DE2597BE7D7A3ACE4FE7C9101524B Bd&h-
622,007,897 *400DE4A18AAAD8A61BA6D27F3805523DE24ED5F1 Bdh6#
622,007,898 *400C61326A7F4619478413C6C0B8EE8F27AF058E B=dHD
622,007,899 *40093AF23560C4E3213C42BC0E6CACB264E81476 BDHDEYO28
622,007,900 *400C4E88AC9C6F6E00778019644A1634E8B99A7B bdhjbb
622,007,901 *400448DD63DA2D4575984BD2D2113F320C4091AE BDHK
622,007,902 *4003CD0D6ACEFFD6881BD1FDDDC94039E46FA999 Bdhp
622,007,903 *40062DAAB82FE405616A40BB9E33BC1860FFC824 BDh!R
622,007,904 *400DB768AA7B2F18CE93DDBF90FD97E38563AEC9 BDhs%
622,007,905 *400CCF511130C931BD3ADD8ECD07E15FBC54B576 BDH+U
622,007,906 *400178F115B647E2FCE4A7C8B1705E673604F526 Bdhwi
622,007,907 *4007E38B1DF2420479B25F98E9DDBB7ACCE07948 BdhX%
622,007,908 *400794D39C8041E61C00B800C65A0654E27C793B BDI#)
622,007,909 *4001AD92FFF0C8D8216071C60CCE688CC840B78E Bdi8?
622,007,910 *400DE9253147325C455FDD5786D4C2C1A3085833 Bdichter9
622,007,911 *4007059FD09F8A1CAE2F8D62437D1788DAF677FC bdicoface
622,007,912 *400C4CCB50971389C19D2FE95C393D9807C5E9D1 BdIl$
622,007,913 *4001B12A6A0F86EB850CA9D471FFB67B53A340AD [email protected]
622,007,914 *4008F2855D82D918908ABFF0DCE67F62D2906C53 BDip7
622,007,915 *40036022F35509772D9C9AD95FDE09CDA1630F48 BDipm
622,007,916 *400FEAAD671C01E87F575E96B659D732EB6A488D BdI,u
622,007,917 *40008F4F0727C76A6FA340BB02D7042F82A88B2A BdiZU
622,007,918 *400BAB5DDEF66BE01E8776082847D1C44B00FB54 B:d
622,007,919 *40088928CF88435C8693552385ADBC953E8A3816 BD$jC
622,007,920 *400E5884D06E96CABDDDC9D0E35B29A8E7E87367 Bd/jj
622,007,921 *40010ED2F99E78A94C01C2D90F1DAF66395F6A79 B!Djo
622,007,922 *4001E170EC703080045C8AC203D4E4310BA6DEF1 BdjU#
622,007,923 *400922A3DABC54B86C75A7DE918E6F6762FC141A BdjWl
622,007,924 *4000B55073A9A3FAAD234017F8D2C65C5D14C624 Bd;K.
622,007,925 *40034F2F43E17AF3CA1D4DDCD8CEBA959E9227FA BDK4#
622,007,926 *4004DDCA6F212574BB7BBE063BEA19B0A2A81C57 BDK8Q
622,007,927 *400308DE54AAE705B6B8A19015725385C6C6347B Bd+k9
622,007,928 *400BA015A4193C969620ED71ECBE659520B2B8FF BdkGQ
622,007,929 *400A168EA751AF393F40EE13C4F2F48AF8AB5950 BDk&j
622,007,930 *4008D0B931EF63E7DFE5B4BF09C37DE27EFB00E6 BDkmV
622,007,931 *4005F122EDE71A63454F25A92E4307E759B80B05 BDKQi
622,007,932 *400BF87096208022F46BB386BE40752ABF35D6D7 BdL-3
622,007,933 *400A8BCC1310BF1CA764229FADA227F4D5B7D889 B)dL6
622,007,934 *400EB7F892C5DD23D80D515C12A3C29CA90DF671 BdL(7
622,007,935 *400BC41CE1F55EE60345A5D4F57327308725A544 BDLa%
622,007,936 *4004D64E0136AB033F98C7FB6C69F78F0598E625 [email protected]
622,007,937 *400456839393BA43024C349041839997A8F74D44 BdlAT
622,007,938 *4009C15B3327EE1B3C98E87C94723B15957FB5B4 Bd(LB
622,007,939 *400895117BAF67EB21525F57F9DB52F0EDD52883 Bdlcbsw2
622,007,940 *4002CF24B96B5C8328E85767F7EE1A479DFC8EED BdL;f
622,007,941 *400C9FB076091A6F1C9E3C96E6CC898D5F0A1A04 Bdlljstn4
622,007,942 *400FF07841DAAF03C92A97C5F3B9B985F23C09C1 BdlMh
622,007,943 *400BE7C58ADE67962D33B25CA8EC940C8707F061 BdLmo
622,007,944 *400DC32AE4467CA56FCA1CA39B72D9BEAE615E78 BdLoZ
622,007,945 *400039171C523D3076E2B97DBDEBCDAABB419A58 B#dLQ
622,007,946 *400DA6C091608905195A388611342E997FE14282 Bdlrp
622,007,947 *400CC99A13DB88E39A95DEA6998E3EB1FE73820C BDl.S
622,007,948 *400F13FC428CF55CA503387EE4894916B616037D Bdl)T
622,007,949 *4006ECBBB9D1EBE84A5E10DFC989C17EF785C483 BD+lv
622,007,950 *40017B75779C829E3D0C2695A5EE4B276CE03AE4 BDm3m
622,007,951 *4005C5D634EAAEB85B0BEE79CCFAFEB579A00778 B!DM9
622,007,952 *4006D96556FEAA40F8474C9013364B53668C6FB8 B=dMI
622,007,953 *400AB9A84DB2A506D9E470331876132E3192EE85 bdmkalisz
622,007,954 *40031F303FC537D78BCF93E56E3D6F0C7134113D BdmM"
622,007,955 *400D0BBCFA9FB3C11347D390972DA79272F895E3 B_DMp
622,007,956 *400F18AE522B7FF4238AFC97AE5FC16A07E7D634 BDM&p
622,007,957 *400899744D4A1B42FAE00F845B0A03247877A78F Bd,Mu
622,007,958 *400EFFBD6A3306DA8D01760C718D28BD36BDA6AA BdmW;
622,007,959 *400D479F8E86FF138FA27523CE9CE1693D28A59D BD.n,
622,007,960 *400E2A7FBCDF20EA54E5226A3BAD4C4D8F717DE3 Bd_N
622,007,961 *400D436978D00FA7EABDD2E96D34755F026D10F8 Bdn%/
622,007,962 *40088E45AF727CC4CE2EC245C9A21E9697153828 BDn0h
622,007,963 *4006D4953F501BCE785D80A6170D52052D6E2248 Bdn6r
622,007,964 *4004B620192C076E957701A64463E2FA8A1D81D2 B_dn9
622,007,965 *40004F7C214037AC6D4545BA728E5123F38465BE BDNn)
622,007,966 *400567BF4D99832F2CFCD0711A3B30492D7EA45A Bdnnvsk1
622,007,967 *400AD7E91F9D722DDC0C582D7DC6F03143514EA0 BdN$q
622,007,968 *400D8351A635AC805F005F52EE980A990D3B33E5 BDnQp
622,007,969 *40075E6F7F9A2B04253815B625B68711D714A874 BDn$Z
622,007,970 *400AB0967F9CC3E2291F9E8764B8A3DD5908B545 BdN:Z
622,007,971 *40076FEC70C43F4A7E21BCDCFADB0CA5F187112F [email protected]
622,007,972 *400BBB4D94D7BE3537B9077124557D66DC583B39 B%&DO
622,007,973 *4006E41E8C45828A54A4727D9E1FF7D04760A0F7 B%D-O
622,007,974 *4009D9AEED79D0690995255532B99949A625C04F B(%Do
622,007,975 *400E1581E27FC49CD5B9B1CBB6B58AEC772A7372 BD?o?
622,007,976 *4003D38691A52F216665C5BE66E9D8DE461E74E4 Bd-O1
622,007,977 *40082684B788F846F5E07155BE68BE09C521EC7B B.DO8
622,007,978 *4001ACAA70DD2D2A0F6E3B0A935FD87DE570F8CE BdO99
622,007,979 *400E071576CB0EB0BD59509DC7635361BA1835DC BdOD3
622,007,980 *4002FC8D6B89BB86C212EF0AE2356F68F7EB6C41 Bd=of
622,007,981 *4004C9C1AC471A3AC124AF3DCB71824ED9685CEF Bd+oL
622,007,982 *4005031266AB459E526E9B764E5D4BE6374A324C BdoNV
622,007,983 *4005A3A32C36782F338073F8896A8AF96B5520A1 BD_oo
622,007,984 *40043AD35A7E7706C93785BEC1BD4F21D7430A44 BD=or
622,007,985 *400FD8C421B7DCCD9C677764FBDD249461E6EF31 bdorting
622,007,986 *400CB22F493D340207CAB2A3A83F6EAEF7CFA744 bdo-s
622,007,987 *400FF3B6BF24CD1AE2A512602D45AA80B1358B8F bdoxnjbc
622,007,988 *4003493F7F01B270B4C889AD8F4E2995333A6D60 BD#,P
622,007,989 *4004669B47528808BDC8D29E70CCFEB173D622D4 B+d)p
622,007,990 *4009B133A84E6165AFEE5FA085A67A8FD674FADD BdPD9
622,007,991 *4003CBF9F316709F3E25235D38B94195FCB6ABE4 B)DpN
622,007,992 *400006DC2FAEFB5774339C6E03B66B6B78AA65E9 Bdprickly0
622,007,993 *40029AB154A68A848C422037AA6A7FC8297F128E B_D:Q
622,007,994 *4009118EE7CE376C3F6BEEC0F6EC0BCCD780A33F B..DQ
622,007,995 *4004435C869807E7CB1A46D79CDC3AA03512C0C5 B$D
622,007,996 *400EF2ABE87006A2E3C28A638D3CE87143B3EC69 B)"dQ
622,007,997 *400042D30046E7A5670BBEB0F2808F849CACC4D0 B"d-q
622,007,998 *400AE2B0BE565ABBAD7079B740CBF5A08ED6E282 [email protected]
622,007,999 *40006F33A6753B49A30A2B17FE8FDB626D32693C Bdq-_
622,008,000 *400AB4371E126FC51276AEA8816604C9C18D68DD Bdq!?
622,008,001 *40095EEAB3B21CD0E7A09EF59A0A81440848B54B BDq0j
622,008,002 *40058FA355AD1817B4670D0486FFDD4BB5E8CFA0 B)Dq8
622,008,003 *40098623BE8836E63E58A0CB9D08425A4E8E6063 BDqaw
622,008,004 *400D425914B2AC7AFF8125ED1A0952A39005795E BDR(?
622,008,005 *40053D866FE7DAAD0744CFDFC0C0521621628BCD B(DR1
622,008,006 *4008F5208B0E9743E56A4DBE4B3A9F4A57BEDA87 Bdr4W
622,008,007 *40093778FE262A280DC8979233523A43CE5A25FD BdR9L
622,008,008 *400DC91C640E65D08C7250FF01EFA940B6857F10 BdrAX
622,008,009 *400873557ED74B521C4B8B6764586E9BF7E79B10 BDRB
622,008,010 *4006018D18A6A4A971E4F71DD261EC47F985665F BD=RF
622,008,011 *4000754898662AB4A8F3BD561A5282580F4C2BED BDR%f
622,008,012 *4001204C0F0A2CFA7E04B144C4D8ECFD87B2CC11 BDriq
622,008,013 *4003A2889BB297C5B269A5932EE01A3BB13C0138 BDRK;
622,008,014 *400D4B4DA62EA863B36B989466C499BA7CCE3778 B_DRL
622,008,015 *4000AF433AE4A3169D75ED61051D061FC7C852E0 BdR.L
622,008,016 *4007E4CAFA3FA64DBD4E3AEBF06AD6D442387FFE BD.Rm
622,008,017 *400A14CEEF4A1AAC7B76BD044E5A342BBBEC3D08 [email protected]
622,008,018 *400642991121D7D24C67C7D2797078897537AE88 BDrW
622,008,019 *4004C69C509EFB2DC8AEF7B2BF7C5607921768DF B.)dS
622,008,020 *400418DAEB15512E00986CD1EDA62CF1C1CD1611 Bds$a
622,008,021 *4001926CB4674CDBB01AB531D0F70256143F83EA Bdsgc
622,008,022 *4007B35283535EDD11B9865F2FF5C1488686FB93 BdSl8
622,008,023 *400985D09127AAED793E22899D21B68EBFD43270 Bd!sm
622,008,024 *400E4CD909A874A5D7ED5D3299B744684B78C91D Bds%m
622,008,025 *40036369C5D52E6954C1E925B550ADD264EF97E3 bdsm2021
622,008,026 *400C42B01FD028900D24A2966F338CA54D4F772B Bd=sP
622,008,027 *400E83F215A5D4B67ED7FB024D16A1C1788C1D76 bdstanly1
622,008,028 *4008EB2CCDEFEA5765669AE6462305D2F1C3DB54 Bdstreak3
622,008,029 *400C8E609C15992528E2BD1804B23D2F7C113440 BdS,w
622,008,030 *4002EF84638A6158C612B34F8C9A830C1A8B7AB8 BDSYF
622,008,031 *400A855930F58522A1804A060CBC3942A9D4DD04 B:Dt(
622,008,032 *400CDB1CA9BAB4F8DB1FB185664936D136E61A2C Bd
622,008,033 *4000BB54776CB46A455602B7D866F5BA20EE5550 B%d$t
622,008,034 *4002B90DCDDB942C92F97A6FFE3EC5EB9DDECFE3 Bd(T2
622,008,035 *400B9D0E274F7961776DC642734D37D5B4B1FAD6 B?Dt4
622,008,036 *40052C7868B68DD1C9C03DA2BC549AA0DB135A4F B?DTC
622,008,037 *4006B444B4A0A70707FAE3F101932C6CB98B905B BDt"K
622,008,038 *400529455D9D5AFCE2DFF7BD2A34E955DBA5D426 B&dTk
622,008,039 *400E98EBFF38E7E8B48BA47AEE86B2CA5AD2DACA B?dTr
622,008,040 *400694A91262C7DBB8932FEB571DE98B9A5618DE BD)tT
622,008,041 *40008D58BD2D48053F18969B6C1F70B724FFD991 BDTU?
622,008,042 *4005A8A98AB9B249E1EFCE4138FB00AEA3F9A5A5 BDT_W
622,008,043 *4005F8A5F2FA507A423DE435A124FF0CA56EE77C BdtWv
622,008,044 *4003AE6025167F0B8076202A94EE8D69CEB4C7FB B:dU,
622,008,045 *4003E47B6B74E9D678F0F6AC1665370DB4AF74A9 BdU)$
622,008,046 *4003F64439111505EE3E7096E9F8714F11FCE7BC Bdu
622,008,047 *4001F49DC8F588A21919E809425FE325399A08A2 B=du+
622,008,048 *400AD3D1D3707478C9375BFE847687FEB3508761 B"duD
622,008,049 *4005A3ADA13B0E69730FD05484BF88F676B56F38 [email protected]
622,008,050 *400DA375609BBF727BAEB87205273D0081311085 BDUG5
622,008,051 *4009468D95FAF9F7B48301C1B7863A9DE9D4B964 BDuRC
622,008,052 *40042C1EC4A58F774238C22B3D5C4AB6D7CEF5D3 B;Duv
622,008,053 *400DDB8202ABF3F15FF315AB48F60436424CC110 BD,Vf
622,008,054 *400280F0EC3091ECF00E4D86E3606C1779191D29 [email protected]
622,008,055 *400F9D7C995194A3D7708330227DDEB2389115B9 BdVns
622,008,056 *400A33E624937DC91D74BD123E341A314DAF04FF Bdvp3
622,008,057 *40083401CE43AB7F425B57FA8F56A9A2F4642CE2 B&dvQ
622,008,058 *400A84BCE42A8AF7E8A9D972FA480661815119C7 BD(Vr
622,008,059 *400F0BA86A327B935AF0C85A4F22421C64787004 BDvWN
622,008,060 *40012C7F394C22CA2806DCAD028C0872DCDD8423 Bd.W1
622,008,061 *40082B61EE2AEC0ADE21A722489E5DBA5D9CF34A Bdw4G
622,008,062 *400EFE0060A4CDCF54B31AC5351F057F4B5719B8 BDwf#
622,008,063 *400AF91AFE9534550E43F5987D47869336CDF119 BDW?i
622,008,064 *4002492B56768F6EE36AF83BB5F7277C0C515B3F Bdw-r
622,008,065 *400AD9EE8C2DEF878E03EAB91B0BB9D6B1FD2D87 Bdw_t
622,008,066 *4001954B6ED75AC7E3353EEEF70C363244849CDA B!DWV
622,008,067 *400FB9428C9614D79EAC39903FEE9BE348812670 B(dww
622,008,068 *4004D7696AC5127FD13B215E480FCC0881C1F9F9 B"d:X
622,008,069 *40054CA902AFCC1057700F95B4D076F6ADB52912 bdx8381
622,008,070 *4001A258E1AED7FCB33E10E87523A100D3BD763F BdXYG
622,008,071 *4003A1054DFE63AF45E0AB6BE9409B4786C937D4 bdyesk
622,008,072 *4009172EA8AB426640A7E0AED64BC2867D0B6C39 BDYh#
622,008,073 *400A533B636D444F59528914F987FD726C97E0A6 BDYWg
622,008,074 *40079020D3CFAB2F774B0B40E8998687114D3FCA B-DZ(
622,008,075 *4008CBD9E14338E2D37FFAF2161A7AA254386FB1 B!dZb
622,008,076 *400934B1F1D721DF22726FA55010831121601C95 BD;Zh
622,008,077 *4005C71EBBA63032C8BC54A9CD8D8E8BE2BD677C BdZ"U
622,008,078 *4005FE00222B01BEE08B27AAFA60A3D88EB01F1D B-E/+
622,008,079 *400DF6EBF12581FA5D1162BC9708222A3ED878D7 B,E#(
622,008,080 *4005C41A316361637ACBDAEFD1AE4877A0F9E206 B.E:
622,008,081 *400688F22CA4304BD9B8DA1454D8A9F220FEB4BB B$&E
622,008,082 *4007AFFE5D7B7CE36D0B8EF3A2563690A96DE8FD B$%$E
622,008,083 *400DAF0E8BC8EFBB38537E0431621E34DE0FCF40 B#E\
622,008,084 *40064FF569E13B5B04BE12326644E9A1B94B1735 B%E"#
622,008,085 *400EF22B6F5C3B026505D425CCDFE3ED1F3B4CF9 B
622,008,086 *40049A08110DA03561D282294D45CE7F24AFB5E7 BE;??
622,008,087 *4009D4A1EA43F7DE6C9D34FC6C6A12E5918A9CAB BE+!:
622,008,088 *4007092C6B2EF0D0BD74044D8A1090C7B15515C4 B=.e!
622,008,089 *4007E26AF0ACE50C85032650A32E01EDA6A42F27 B/&e;
622,008,090 *400EEF2CEE544EC12F27277DE7D592B4B886EBDA B("_e
622,008,091 *4003761B18108D5B819C2F8DA443DBDC69A6F503 B$?,e
622,008,092 *4007E76731D601B0B8237F2399D4DDBA3AD3738E B$e&$
622,008,093 *4004E1146581A066332ECFC789E84498282118D1 Be__;
622,008,094 *4006C2F58BE31996ED8D4B7A857B151DFF99E6E0 BE:0(
622,008,095 *4005FBCF42058A100E903307AE3E508DDBCAEAEF [email protected]
622,008,096 *400D3218241DB9758DD96BAB5B49241B750C998C B)E0v
622,008,097 *400E4241DFC19ED3E8498F504238A9B9BC0D5DAB B-e.1
622,008,098 *400B214FAF4930A88DF3D9D74CCE1A056F81F2E5 Be11y-b1i
622,008,099 *4001D99B515EC8660D76C6F08C77CE2472E4A0E9 BE"1q
622,008,100 *4000E9EA2F16A5F68AFA5BC845731ACED76F263F B#E1u
622,008,101 *4007C79F729280E7367EB5131F7462C8AD2F023B be1v0ir-a
622,008,102 *4003CA988483E1E7AAD15AA2B2F89B1740BF81A9 BE2)(
622,008,103 *400B504D365A75DAD4905A97BC29C11FC2AD89A5 BE2w6
622,008,104 *400C94A3C4BB63CAE423F0D96BB40301EC171416 B!E+3
622,008,105 *400B580EC75442DF408049757F1501F7CE2140B2 be3af67112
622,008,106 *400259628B7B725CD09A131455DE5727558990CC BE=3c
622,008,107 *400E59DEB05D894D503630285CF10C4C311103BF Be3/u
622,008,108 *400CD4089B0F1E4617130DEFCCF0EFA0D3628D0F BE(=4
622,008,109 *4008BE490A7FC4692E03125BDE7C1E87E33150D2 Be4#B
622,008,110 *400EA29F75CBD05D3F94141E5F4008D75A26BA2F Be4d5
622,008,111 *400C87899364BFF5219E0EA94D46B5C9599CCAEB be4dle'$
622,008,112 *400EC76C00995BA858BD4DC025682E304C458A9D BE4G"
622,008,113 *400267CACBFA350619C2CB48F1E6D15EF39868A9 B"E.5
622,008,114 *4004D7FED8B5F2F32C98A0D6113F4DEE44ABF576 Be(5=
622,008,115 *400B2940EA27E3FAAB221506C342CBBEA4ADE19C BE5Lr
622,008,116 *400917893642B0A54C0EBEC5B070D2D23A5A1692 BE5Ys
622,008,117 *400A79A6FDC5BC369CC650AD91B2244B7199BDFD B/E6;
622,008,118 *400937A20B9FD19E17A69CC1782A5B8B77458A88 Be6;#
622,008,119 *40070CAB9F6E1B443C3E6E9147632FD7BCA59808 BE6_2
622,008,120 *40098E8D21834A09949C469B5E9A92C478C98AB3 be6b8crko
622,008,121 *40080EC09F6DEE2CE6854CFE2D95B4ABD9593DB2 Be6R4
622,008,122 *4007AF1114558D827C13B26A8E2F81E5D9B084C7 Be6Ve
622,008,123 *400508FA6F92849CF5D6CEAC3F8F9A937B44ACE3 B:E$7
622,008,124 *40059DAAB4D650FA89D09A0F747DFA6958C492E1 Be.!7
622,008,125 *40077D6EAD6F0D7E8A59816EE555E76FC7BC1DFD BE7KX
622,008,126 *400316A929441054EAE8057D1C8136EF97D9A578 Be7m7
622,008,127 *400913F0A8A8748734EEE553E4DA32D3F6BBB38D Be7SP
622,008,128 *400922BAB8791A043A49EB93286F6200931AADEA B.=E8
622,008,129 *40030EEA9846A1BD0BEC3A85E07C8A242E6451DC Be8$2
622,008,130 *4007322145E4CB4AFABA855540136D3AE4091278 be831b3998f42d28497c3bbe45179e1e
622,008,131 *4004AD628E829086A178E2331E4B948D880112AB BE8LQ
622,008,132 *400F47C34D81DF91D1D2B56B5B79EA03D3C6F9FE BE8qH
622,008,133 *400AFCEAACC6A16BFDCA20849F8D08626468F76B BE"8t
622,008,134 *4001F92D92ADD6D806203ED4A10A1A89B73B78AE BE8W"
622,008,135 *4000EA728EE4BE3DC1AC6E65890A3505773313F7 Be:9j
622,008,136 *400F7BAB4D8DDFD6B8AFC24581A5C4C03B98A618 Be9s5
622,008,137 *400A9FC5867DFEA1B68A18EE5876E7414E044FCF B#Ea-
622,008,138 *400632408C6B37B2944A336BD45A7F1562CC6285 BE-a#
622,008,139 *40001D33E1043A195267413A9FD9233CC849A971 BEa
622,008,140 *400CC7128A17D35501D579D950F7B22B277A888D B;,eA
622,008,141 *400099FBF4C8914A57FF53C046B4A8B7EA7EAEF8 B&$ea
622,008,142 *40003978D94FCD0974BC3AEB64C62C4B340B9654 Be&a?
622,008,143 *4009D36AAAE0D8D2FAECAA427D36B44BF0BC170E BEA56
622,008,144 *40015DCB49A02A89D6D76042B3BDC2FCD91992A9 Beab3
622,008,145 *400637332A3573C5A6994B664151B95A85FEA0E9 BEACH (07
622,008,146 *400996F694B934A62B585504D182C3DCA7A8CDFB beachaztecs
622,008,147 *400BA36ECCC11C73F4675C2492D54D2EB58CFC9E Beachin3
622,008,148 *4006DE7450951C1FF5319782477EFE1A3AE0D8F4 BEACH-JFK
622,008,149 *400F59F01B68B17592260B5587575916315DD853 BeachLos
622,008,150 *4008D137B97E12445A7B460EE97ED4CF707AC327 BEADEd
622,008,151 *4000E4D63E2D0CAFF2F95FFC9A73B8EACE959C94 beadlesbeadshop.comwww
622,008,152 *40088AEBC5D1E23CD54CC674CFC49C70C604332A BEADR0LL5
622,008,153 *400362CBD3E8A01C1888FC8183ED01FE43FE9D52 BEAel
622,008,154 *400290E77D388457E12164FCD6C25522141BE431 beagle1974
622,008,155 *4005FBA7388E2EE4D7C07676C104977D283090F2 Beagle1p2o3i
622,008,156 *400CB45997F2E8B6B1A2454481FC8DD9CEC97C81 BEAGLEALEXANDE
622,008,157 *40057CC52F8CBB336FA20C75D914C2885CA3D3B0 BEAGLEME
622,008,158 *40003586CB30B10FB02626E594C5B70DBAA0B733 BEA
622,008,159 *4002A8C041EF529273E855C22549F62317C55812 beajamin2
622,008,160 *400F8142717CC01F31E468219CAB0FCF6BE76208 beakdays
622,008,161 *4009C72CCEF246F7D4B198CE0F7F762DDC31FCC3 beakliou
622,008,162 *400391EB7A38B7D439965A8830C0CFE0FEA816CF BEALACH
622,008,163 *4003E9C2E81CF437FE42BFBFE0C10015FA1D6FA0 bealgenealogy
622,008,164 *400D93E469F77EED83EDCCB53F4D4608E79D2D89 [email protected]
622,008,165 *4006EED4C3BFC75998011BF7EC6991F527E83DB1 [email protected]
622,008,166 *400CDDB9186239F398FD7B9412EFC10B18CD0E78 B/eAn
622,008,167 *400778AB228A382B176AAE89D024C9482666EF12 beaneball
622,008,168 *400C21533BFDD58779EC3809E3BE079C68CB8F51 BEANER24
622,008,169 *40096822F27ABC0870274EC3A076DBAB1D9BF0AF Beaniepat
622,008,170 *400D448143EEC11B0889A235A8E1FA441C00A390 BEANS'
622,008,171 *40084BB9024996D66ABB8666235345A7BF76423D beans—and
622,008,172 *40014C589B885B02FB38FB56FA01378CF3D250CD bearance?
622,008,173 *40015BA3694F60446855A5F152F424DC8F47F947 Bearbeide0
622,008,174 *4007F51D2EE02096791C15A929DF5AFDAC727CA1 Bearcatn6
622,008,175 *400871FFBD15D71E68F474A00FDF7D5A20529D3E bear-crawl
622,008,176 *4003730F0CC3B9581C5F3B82C46B365B4AB61EB7 BEARCUB8
622,008,177 *400B151556FCE75E9F38A5225EE81FBE677BEF6D bearded heart
622,008,178 *400556F1FA5A9D6D2519EAA056AD9F8D374EC97B BEARDEDMOUSTACHEDWISE-FACE-OH
622,008,179 *4004C587B0A365C9F1CAE25D2364DD7411D924E6 [email protected]
622,008,180 *400E9F2E33E73DD423C3BA9EC91378435E6EE81D Beardtons
622,008,181 *400C6411F4A6FE8308DAD82980D0CAE6AF2116E7 bearfans
622,008,182 *400CE35E18AAF50C7DFB38D7DFF3C98205C312A2 bearhunting
622,008,183 *400DE5AA2E79D99902FF38D8CC3BE6E698BD1638 Bearlarry1
622,008,184 *40008885ABE7F365ADCCAE7E4771B80924B5E83D [email protected]
622,008,185 *400352C7A16B7D78227C6E9E7E00E77BB92AA9BB Bearmoney1
622,008,186 *400B1E6DAC92387AE3F36A40CCDB306EED02C76B Bearnards8
622,008,187 *4001C724BF70F521C1D78970CDF665FE6C113D74 bearpit-sexist-says-new-mp
622,008,188 *4000FA16C754D6E7662455250F4B6847CE97716F BEARS01
622,008,189 *40098A7229221C258F3F5F41B17ADCE75EA6A3EE [email protected]
622,008,190 *4001A4DB1B4B025F2482E344A2D1FB8248B1C43D Bearsgrumpy
622,008,191 *400F722F8DDF6D9DA6A094DB73F21B67EC63FFDC Bearslucy4
622,008,192 *400BB12E066BA613D85AD04F526B0F044E774295 beaselys
622,008,193 *4009EB390756E45C205E7FAEE8ABACC642346166 Beasemdes8
622,008,194 *400E66BFF9483CBE7EFCA54AD97B9DB5E652ED82 beashya2
622,008,195 *40080A3BF50FA874A90881D2BA7855F5FC713536 beasley1951
622,008,196 *400B885D86EB687A5491E183CF79CC7654B7B0DF beasleyian
622,008,197 *4007D4A1FF515A4BFBB334E7C29EA3E816C6E387 Beasporting
622,008,198 *4000E2FB72129BEE101561EE87F6CAA04C5B7518 Beastio8:TheDog
622,008,199 *40042CE12252B9B18ABAD99527667C8352F3A2FB BEAT2』に登場した超大型MA。(型式番号:MAN
622,008,200 *40039ABA76C4F80D7A0B4250CEAE803B5BB1FB17 beataegerter
622,008,201 *4005B37F43E1C70C59C412AC0897456ABB48D46A Beata te, te dormi
622,008,202 *40063B6FD819D60353817367F61035424577199C beat-bohemene
622,008,203 *40056213C14507B0CB23C564E6697CC5696497A5 BeatCastTV
622,008,204 *4009B96BFFD59BFBB8FFA5481D2CFF1644E09EFD beate johnsen
622,008,205 *400C50A3604D13CC645D3A4148CA558B561C5FC9 [email protected]
622,008,206 *400F51DDF62D65533595A5464E4237989340E414 Beathite8
622,008,207 *40064B892E5B63EC815C27E7FAD6D537EDDBBFCB BEATIFIC-BULGARIA
622,008,208 *400631E1CB2977D5CD6F9213226FD50DAEDD962C beatifuluser
622,008,209 *400AD39D125DB63CCFC9BBEF164322B32798EB7C beatlesman
622,008,210 *400F9268141D5BDBDD60523459E2403E6C81FDC3 beatljuice
622,008,211 *4004F1331033B819BD2136BEBCE1C5E58D132E30 Beatrice234
622,008,212 *400F643451E4E0240D5F5CAF741B3AD966BE260C beatriz wilson
622,008,213 *400B0588850B2836541D08AE8DC93E944F493E93 beatrizzaldivar
622,008,214 *400757689D96EEF167BA1AB50A7DE3F80667E7ED BeatsPerMinute
622,008,215 *4001883C310493DEE20074C8D439732BCAB44073 Beatthats
622,008,216 *400EDF0BE4D7B0B64DBDDD115D94614F4544A224 Beat, Twist & Rock 'n' Roll (disc 2)
622,008,217 *4006D91FD7C557CEFEA4CB78C26C699B6BDD1BCE BEATYFIKACJA
622,008,218 *400ACB921ED4F1FC92E84AC3C2EB6A52AEFB96FA BeatzandRhymes(TheFinalAnthem)
622,008,219 *4004A86C40BC01BB870DE6EA881859402234995B beat」収録)のレコーディングで高山と意見が割れた時も、高山が家に帰ってしまう事態に陥るほど自己の主張を曲げなかった。
622,008,220 *400668C200FB721E8CD7334079BBF159291471EB beau.aull
622,008,221 *400F70719B84862E6D2CF0523B79D856D8B97C9C beau.bahde
622,008,222 *4005FA3D1B2E816EB2EF474AE1B4D52981B7D14A beau.banther
622,008,223 *40094F5BAAE7270D3640E028B60DA7190BB52B66 beau.bartlet
622,008,224 *400C9CDAA20752102074B0831FB43772793F193C beau.beumer
622,008,225 *40054DC32165793D4A9F622E0E4BECF8BCB743AD beau.bevel
622,008,226 *400B067DD11227EE6157AE68B2B736100C051CC9 beau.bredeweg
622,008,227 *400278C395BC2F8FA2A5114D281DDFC30427A1FD beau.capulong
622,008,228 *400AD5D5D4F4C09A0618CCC135C8FB287A23966E beau.cassiano
622,008,229 *40027A4A90DDD2F1B031EE027E1215E778B3805D beau.deese
622,008,230 *4004834E84A8A2840573EF1E0E13C33E4BF4EE59 beau.dryden
622,008,231 *400D61ED7DFA35BEA15DE44B841DF8A6EA800042 beau.faubert
622,008,232 *400506D5E9139C734ABF4BD4F619175D90FDD0BF beau.feinen
622,008,233 *400BAD7ED3C9483B4E35DFB5B71348DB93B055E9 beau.frazell
622,008,234 *4008DEF47DECA30260FB8DCDB23D4316B63BF336 Beaugarde1
622,008,235 *400370D87DAC8F68AF5B9D27CCC137B510163A0A beau.hockenbury
622,008,236 *4008C298193C562B6A66ABB6D20DB6274B90D043 beau.klinefelter
622,008,237 *400688E53033FE06D2472543A1E66604688A6A3E beaulieu-bourgaultma
622,008,238 *400A5CFB43BAD28E9FA626CCC9317D7287C6B315 beau.loeurm
622,008,239 *4000E3B6BAA4A298B2216D86B061A6777D2489AC beau.luhring
622,008,240 *400CE204F8946756DA3E8C8E6A3B98684CBDD4F0 beau.mcconico
622,008,241 *40031A930D4FC2BAE80E67D276F4F37AB58E093B beau.mcnamee
622,008,242 *400CF1A415D60F6DB27E9B9F3BF5F8F0C6453358 beau.millison
622,008,243 *400A05848795075DFE7ACF7F15EA42428B30C4F4 [email protected]
622,008,244 *40059CF5DE5A53B6380550B83BE6373166F83F5E beau.muhn
622,008,245 *4002A5ADA684E9A1849B89C4EF35A5A7BEC60CAD beau.quilty
622,008,246 *4007AB75A31415EA12506BBA020F1B438171D190 beau.scordino
622,008,247 *400F577CE38097E2BD85D3C09D367A006FA60D41 beau.steinhauer
622,008,248 *400FE939E98FD227C1E0933DBB5691B6393E202C [email protected]
622,008,249 *400AB3C762FC20D450831ACA989FAE0CDF97D662 Beautiful Bossa Nova (disc 2)
622,008,250 *400C58A0769FFA1F4418C980395FB3B498379979 Beautiful Freak
622,008,251 *400D62D81DBAC5BBF94EF7539E4E37E8BC09AF61 BEAUTIFUL」(第266話
622,008,252 *400EC016330E414D660397036E3DB4B2F0D17A2A beautworteteu
622,008,253 *400897A6320E706D694645EBE1532784F9E3EF4E [email protected]
622,008,254 *400CA0EA6A8521EABE35FA5DE8EC3515928E7393 beauty in the eyes
622,008,255 *400E0E8061566E26EA9D872B643E680B09C403D6 beauvais!
622,008,256 *400ADC99E445CCE08AF93FA96AD6C67C22D9630F beau.vanegdom
622,008,257 *400CDEB3B46062E96F9206A81DD9BCDFFC7E5BAF beau.wamble
622,008,258 *4003F200CDDE503A8A94CA3FE97A236F6324AB71 beau.whiston
622,008,259 *400976DEB06686010688CA85FAE149FB53DD54FA Beaver9
622,008,260 *4002798DD54FFBA026F2C3391AAF76B24E462A0B beaverqs
622,008,261 *4004426B663A105E0C1BD382CFA8AF159BA78887 BEAVERTURTLE
622,008,262 *400B24C66611FF363458ADCD15116E427DF69F24 Beavis1977
622,008,263 *40024ACA9C0FCA1A493219867B64BD2E62FBA62B BEAVIS-ISM
622,008,264 *400CC6BA891B2BFD467565DA6D3A88B321E26EC8 BEAVISQUALITY
622,008,265 *400A49B30E692314ED51D8BA25FC0207D2EDA1F6 BEaw8
622,008,266 *4009863CDDB11B4EF95D9A920512485E47EF41C7 B?EB(
622,008,267 *4009A290DD60DC3A99F5AD3F340AA9FC8A1D79E1 BEb
622,008,268 *400F75B89FDBC3FB6F14A3E9813F202DE4A4F887 B(eb4
622,008,269 *40081E178D64B0960E7EE35058F4963D645C78CC BEbb4
622,008,270 *4000BDC3AF9EAE2454010F1B26CE6755294E6B98 BEBC=
622,008,271 *400800941F72B0099709677DA8D9BF42C2CF54FB Bebd
622,008,272 *4000353AE5D3E7DAEB3C8C68B8937B6F9D8907A4 bebe028
622,008,273 *400F4F2CAFDFDB0186CD6037757DA1429A20ADD2 bebe1004)
622,008,274 *4006A5770C4AAF2DC30C6B4BF7981B33CD2F1EA8 bebechko
622,008,275 *400E4DC5EBD7EFF123C38F863AC17914412F3678 BEBEEHXGIGGLES
622,008,276 *400C22503507B8261222E9AFF0AA009D7C754F64 bebeluta4
622,008,277 *40066765080D82E2B1C626782B5AB034466E0C8B Bebenek7
622,008,278 *400BFB9BE43E1A1107AE1C43A50C1C9FD0CE5EE2 bebingtonwestbourne
622,008,279 *4004B6F0F33AB17C3D371627E088C2D7E741B0BE BEBKDXNW84
622,008,280 *400CC46153F9FCD2274F56F441784E8330B70011 bébó
622,008,281 *400895AC5FE13F7F2177CA180997C4DA8B4965D4 Be-Bog-A-Lula
622,008,282 *400C851DE34D4FB7112EE5AE36899AC38FCE3D21 bebop.5
622,008,283 *400BC02307336F99B97B11F04EE381253FD6B078 bebopper5
622,008,284 *400456AB9C7522E4D6939A78055B436FD981C523 BeBqu
622,008,285 *40063DDE3594B97530DF673AEDFA84D5A81B4093 bebubn123
622,008,286 *400188E8941182800A00CC1CC250643EADED62B2 BeBVa
622,008,287 *40064E45216B862F321D9B5B53251CF48F8B5FD4 B
622,008,288 *4000A7D9E116586DA53EE85DED30252C6615E3E4 b.e.c.
622,008,289 *40005792F2E5D20EBF432769F3C4DB5C3CD3D85F becaleld
622,008,290 *400E1468D5EF84919C47C036AF19A6F3BAB4E4F6 BECAME6
622,008,291 *400FD172EEF1264D1A2CC41FA07D5660A858B735 Becanj
622,008,292 *4007D29F50D95D7015FA3F3EA287D891A0CB3A9E because i love you (alex butcher remix)
622,008,293 *400D20AFAB366401713DD121FD95A9B6E18F5F1E because i should
622,008,294 *400B7CAD36FEF16D559C48C20475C6769EA7ED13 because_you_loved_me
622,008,295 *400D8F5AB5B01115E081E72DF105168CFAFD23C7 BecauseYou'reSoSweet
622,008,296 *400B705BE8314E2E23492B130CECE3CEEDE85446 becca bear
622,008,297 *400539FD2F1E39031F3FB3AB8EFB46552948E4D8 BECCHI9
622,008,298 *400F86DF46166003473B7A9CA5F752CBE1C90AD5 Be)CD
622,008,299 *400BECADC449BE5DE1ACB1173D032D61FA7EF348 BECEEM
622,008,300 *40025E37C8E2EF8FAB5550C665ABB33201D364A1 bécherand
622,008,301 *4004223F63046CC6E8B5C116819A9909AB716E6E Becherling
622,008,302 *4002EF765F1A6424E0483B1023F2A91FC5B99656 bechesne
622,008,303 *4005E5D2F8E1B613808F565EF4DD37E678A86A57 BEcHV
622,008,304 *40082FA1614A856723E221019BCD91FBC926F350 bécitál
622,008,305 *400CA9BF6D0EB8DDFF05ED37CFB09A6CBEE53679 BECK009
622,008,306 *40038EA0DFBE90678BBC0F52105EAF6F4DFC8D7E beckenlagen
622,008,307 *400839DAC514831F09D329B0804336B09B5A4299 BECKERHOF
622,008,308 *400A05F9ED726678D351F3D8D4EB116CA793FF39 beckett970
622,008,309 *4007AF00CE03E0F661B0039C3E1CD63DC6716376 [email protected]
622,008,310 *400D6AAE32CD9608D8A41A1B3646A90FC7FC8861 beck-movie.jpwww
622,008,311 *4001FE6913C0ACC5EE81C860FCB501798AEB249C becky braddock
622,008,312 *400A14CC01D7559D6022B245C52FA32A2038DD6F beckyisaac
622,008,313 *4001ED2D764B4B1E26F232A7040D7171C3100653 becky kim
622,008,314 *40018D80F18CB9D8A9BF641A35A05E39C017E65E becky