List database


# MySQL hash MySQL password
59,000,001 *064D134885BB63756471071020613FE6DA06C57D ASR)N
59,000,002 *0648A5E9A820B37B561A8AB3CF4C0B49E6857345 atwiten
59,000,003 *064A7E9581A97C64E2C3C593255FD89DB8C6D45C AULUC
59,000,004 *06401FEA4B5802AD1E33CAC8191FA90A17930907 awais.khalid
59,000,005 *064EC42517E5131DC2CB37282240692BA4288CA8 awub
59,000,006 *064A38EAD2AA9B98FBD1672E464157B03A3B9AD8 AYR&
59,000,007 *06482EACE0DF5A8CC1E9DE987E795FAFE265064E (>-<)~.~.<---b
59,000,008 *06479F1F517DBB000C5E34B896233794CDD60FA3 (^_~)~(==B
59,000,009 *0649A37BF7242C9E45B8973E0106C22261143B80 B8EIG
59,000,010 *06462F4EA8158DC007506EAF967683179F8397D6 ba83c
59,000,011 *0641F8A1C75142C7D5B9A53C4AC617EB678AC422 babrack0
59,000,012 *06432E9E47B37467493A8DE3A0F6D6E8B9C0E5EF BA%RO
59,000,013 *0640717FAC6F4A4542E9BFE2A8BF349F36172C10 basfxxx2
59,000,014 *06447080A90D596DFBFC1467B9C3FF7430D9F9DA bb8tm
59,000,015 *06406834E13BE938056898F41EDFE55F3EAD14B3 B=BB3
59,000,016 *064245095D59F1DE46AA5E886ADE43D90D1746B5 BbEn
59,000,017 *064954CD6F2A14B5761609FD811F6B0B8A372E4C BEANIE10000
59,000,018 *064603C1904E703AAF97176C963376F156109853 beinme15
59,000,019 *064C3D16C690D3C868E358DE47AF8D14FDB060C9 BFJ$
59,000,020 *0645C3C21F51E26E5D1278B203504144620EBAF4 BG5B(
59,000,021 *064593EC49B604AFD92B3C904AFD08646A2D6006 bi64w
59,000,022 *064A25DD676F078FC3DC9FCF6746EE8CECD3AA51 Bi8u
59,000,023 *06421BC565801BE52E7E40DBCFE8598B08468A27 bio;?
59,000,024 *0643A8BF5D4A0F093DD62E65B3FDA7D32FE545B8 [email protected]
59,000,025 *0641D47929DA6DE07C4A95B730178F0FF9C8D227 BIRGITTAFRANCIS
59,000,026 *064E1F5CA32F3D3934CDBEF9C2E71838628BF428 BIW;
59,000,027 *06496CE888172989A586F2EF0888AD82266B162B BLAIRHIGSON
59,000,028 *064929C4FE8D0CD10F508561A1EA51BFE1581C5B BLNEE
59,000,029 *0641DF91C3E31B0A3DEEDF98332E1C62A9FD9760 BN,OA
59,000,030 *064937A61435AB136EE172985A14F49D2E91AA0E [email protected]
59,000,031 *0646E0F2A42213798E73E71EF3269496443E5844 bo)/e
59,000,032 *064B2D4891DFA8B27F88E14F01364A03E555C24F [email protected]
59,000,033 *0643DF14916C74215287C1EE73954A783B0026BF bot3?
59,000,034 *064FB7C009708A71D6149565EAFCF844906E2A18 B#####P-~0-Splat
59,000,035 *0640465293DF9B7370AF01F3DC46F0947080D6AF b!phi
59,000,036 *06475A793C2C1CE077EC605DE406E384BE4B1BB1 bp$lk
59,000,037 *064DA749509A9B2143D2B0011A3FD25F007B6604 b;pw"
59,000,038 *06404402DE72D16DA80F9DFF4EF187E140D42540 bq#t/
59,000,039 *064FA5C7AAF8F45FD3D515E0E4E259E49E01E25F BRAIN.RAULSTON
59,000,040 *064250148443FA777FD5CFC05B4186BBCBE43671 brandonrogriguez
59,000,041 *064676BA7A4C4D073CE003B43F186E587A7CB55C BREISCHOOL8
59,000,042 *0643A4DEC931B0C2D081A236162818A65FA0D470 BRET.NELLIGAN
59,000,043 *064B8F8AB2AEADABBEDE3372EE2B7655A74540AE brianturmel
59,000,044 *064BFFC228064779B54A69D3EB1CF388F20A9559 BRYANT.NAGATA
59,000,045 *06453818422017251F9812D048A40DF85A9C8DCE bryonloomis
59,000,046 *064A6380999DD31CA285B0A3A4C78BDB37B49BA8 b!s,5
59,000,047 *064FFC2C26EEC9F6ED14A5125CAA5D6E1EDA90E3 bs)nb
59,000,048 *064588C2B5FA47991D060CE06E59F8B819354959 bsnmd
59,000,049 *064F8A9B8CD5A9C502170876803CD5B5F6DEB3E4 bstn/
59,000,050 *064F25CF94188FE3C098F3CF12E3D6F01B03C24B [email protected]
59,000,051 *0644E43B5318F419092E12C4D0C7863DA59FD858 btv=v
59,000,052 *064DE817D161190590AB3D0F6303752092F4EECC BULLDOG-MIT-SCHU
59,000,053 *064444483C74ACFA24FEF38775AA591563508E44 BUQB4
59,000,054 *0649849E753EE9914E149D66325DA85AB9109319 But that thy face is, vizardlike, unchanging,
59,000,055 *064676921A0158178C2552226018174F75E12CC0 but-the-jackson-case-did-not-come-to-a-swift-and
59,000,056 *064A20ADA884858AB37816AB4D96C024C2A1F69D BUTTONS&WAR
59,000,057 *0642E714DDACA9698F158580D9B13BAC6D148266 bvb9#
59,000,058 *0648F4DFC104E6CC773E66A2995EDA8B6A4F5127 byvc/
59,000,059 *064087907B5163059803EB33D29A9A29B6901299 bywh6
59,000,060 *064627863C22B3F3236388D752FF324B1D2CBB86 C0NTNU0U5LY
59,000,061 *064172E30E91B69AB495AAC9CEC334B63C7AD866 C17800838765320
59,000,062 *064312E2A95EBC253AE5FB16C1146E40B7A960FC C3-?
59,000,063 *0641111A0CB9295E1F398F3C985FEC99A6E47218 C5,IE
59,000,064 *0641646270B595959A4D7893E24933C110BB3AEE c8?a/
59,000,065 *06407E5F0E7BDA74842C0C3E47061A5E5617DFEA cakjp
59,000,066 *064F12C1607EB4DD67724A6F2068FAFBE1B62C57 CAMERON.MEIDL
59,000,067 *064E8D03A4B3FE00C05EC02A1C5DDDA8793183EB [email protected]
59,000,068 *064F4B36901FFBAE6FBE70CC35C548E7FCDD4289 carlisle-wheeling-(alternate-version)
59,000,069 *064578EC362777533E1A6F5620C52547C3AA7883 CARMINE.TSCHANNEN
59,000,070 *06436E821C564A789E216A3D126A358275906467 CARNOSAURIOA
59,000,071 *064749869FEC4F137DF8C5EDAB4F615BFF79F733 castillodemarin
59,000,072 *064CBC867D4E8A8C3AF773A7B0740557614C695E CATHY1623
59,000,073 *0645DA68721E23F1EE39213E93DB6EF629B24DEF CCG&7
59,000,074 *064F9E11E1F99B59DA121AC81210F272358E0593 CES!C
59,000,075 *0648096B33212C8951964241C5200ADB81E0BD3F CGREY
59,000,076 *0646A0725B2EEFCB656D2373CA95193C1B05B8B0 CHATEAUBRIANTISME
59,000,077 *0645C7B8B462B690FE1AE43B156BC9FFBDC5A909 CHENILLA6
59,000,078 *0643B7BDC7B334475168DCAAEB4C9B56A510F880 chenyhbbs
59,000,079 *064C0F1900D527A93D6BA0FA92481EC2D34AF13A [email protected]
59,000,080 *06488DE657261068858E549EAF60AD9E831C9B15 CHS9
59,000,081 *064574937616C778B5720195C57BA94F064254F2 chuckcockriel
59,000,082 *064905774CC612EAD07C1954879F0A9DB0894A5E chungbirdette
59,000,083 *06479F127B446D6347A74B58BED23F6252369E3F [email protected]
59,000,084 *06490DA256594C7F93846EEEC821624EF7A43C88 chw(v
59,000,085 *064360CE21BE025F813075CD72A5E3A7D5431E6F C$I.F
59,000,086 *064A46F1B580966BA95F1BAE7CBE97B09F900773 C/J3V
59,000,087 *0647B658121BB0C66A45AC3A23BDE5546ACB35A9 [email protected]
59,000,088 *0642114A533A9977463C29A920DD5398E239408A CKDE$
59,000,089 *06409DD5652E95E75E44DEAB535B2AFC002C3B8A CLAUDIO.GILLASPIE
59,000,090 *06445859B506CB8515298C26C40E36E04FEE8C8C clrclsm9
59,000,091 *064D740D9068721774E25C780539FCFC441AD70F CNTQ9
59,000,092 *0649D9C5E070DDE4C009528666C8ABFCCA7B3FE1 CO75
59,000,093 *06492BA35EEB3D77FD6BE5472018DE0AF6CFD966 C!OIP
59,000,094 *064E4CF8F6BE87EA7B3A036A164A8CDDDEBA5AF8 comediria3
59,000,095 *06454579820EC20C04DDA04F86DCA9D78CC04524 COMPANYIMPUTED
59,000,096 *064DF2E886458B894F1D0F74198DC7C62F32ED06 COMSABANA
59,000,097 *0641835BB439400EC339B20D1354DE8271E041F5 CON$PRA+ORA11Y
59,000,098 *064051B521FE07A25B9AEA2D0901C7FE2B40548B [email protected]
59,000,099 *06472EE50B2E18664B0C6357A5402C0F8B86E73D coollieses
59,000,100 *0643B4D7AE1D2B1D40161BC1EA6BF9A3F824622A [email protected]
59,000,101 *064048FCE73E3D5534B4B11DF7B56355DA37AE88 CPFK;
59,000,102 *0644482CA745CFA7F0BC711F2D59697952FAB7FC c!pu8
59,000,103 *064B4CA3FEF8116C405C0D71B5F46B93A57F24AE CRISTINE.JAMERO
59,000,104 *064763A4E86129AB2E4766C0ADA92E3296A90AD1 [email protected]
59,000,105 *0640DD71DCCE26952A3AC0C0787312A8A1340622 crr"l
59,000,106 *06400934AED48B384153357D1FEF911243376609 CRTLLTT4
59,000,107 *0645CB3F81FC5DF0A3D23867B8B7D914982D41C5 CRUMSN
59,000,108 *064ACC5498EFDDAA3476750F6CB7CEB9304A8A54 CSIM
59,000,109 *064AC66E7E61F175948F1D66887DA9FB3663D67D c#u8$
59,000,110 *0646ACC205438BF29C474F13328CC29A74AED1E2 [email protected]
59,000,111 *0642F2BC88C24FA5FC0F17EA469C224D85B510A5 CUME1
59,000,112 *0642F177C7120DAADD98CC167D214F19810B45B7 CURTISWAI
59,000,113 *064DBD52A339271816F2EA40BEDEA1AAEBDF9CF8 c=v4:
59,000,114 *064823D66CF88C8BC605A06A063A11F2A0FAF642 c,v4h
59,000,115 *064608E6AECB5F47436DAC922CA823A8F7D7B19E cv6=2
59,000,116 *06491F8C5A724D02F873FFC0771B25DCA401425F C&VKC
59,000,117 *06466578B76E72F4F9699FA0513A852EC57F4686 cwc+$
59,000,118 *064EB58DF91A265C7A87E4338112D926FBF5EAC1 CwQ
59,000,119 *0641AFDA3A87660FFA1BAB80D3C46FF94CCB0F1A CYERH
59,000,120 *06444773DEA5EE7DFBF4104F3A3E0D822C01FEAB CYROPAEDIA20
59,000,121 *064435FED6338A3BFDA14139669B5A2F7CF86651 CYSJD
59,000,122 *0647647A3D751F09FC998FE2F7B13D1572FED425 cz2$t
59,000,123 *064B6FC65CF7B835A22B17E51EDDE51DC75AD48E D!1RT
59,000,124 *06481E6C6F4F6956D16C1025FA5B27375781A0E2 Daniel.Leaves
59,000,125 *064439FABA3D4C8872AD341D92A1C3710E906F99 DANIEL-SODERSTROM
59,000,126 *06455536CB23E11787EFA64EBE4A97B4EA808A7E dantiago0
59,000,127 *064B4A771CBFE016CFEA73C3C514978DC24AB03F DARRICK.HARISTON
59,000,128 *06411429811EBB6BE92AB5EBF1FC5A082BE51239 DCS
59,000,129 *064C0103DAB018E2B0E867CF1F5DEDE8C991A28A DEBILEST2
59,000,130 *0642FCC1776E80580139D3818FAAE6C3F0B9CCAE DEEPFREIDCHICKEN
59,000,131 *064CC061416A5094954596E1499A6FB3A10410E6 deg(
59,000,132 *06452DA71268DB164233CDF52B5F1ADF52AC8186 denverbrassell
59,000,133 *06478324EC1BFAC5390D58601D653A3C9B0B62DE designsupra
59,000,134 *064E3AB9C79EAAA3C157C0B0FC8702133D588143 DEXTER.KNOPP
59,000,135 *064E0E4806F7C7001915EB18C1A523CDE1311904 dfdq_
59,000,136 *06474FD911C8CE5A2248AD273FB844B2039011B3 D_FTN
59,000,137 *0646575232CC48745E648EE122A92C8CFA3794FC di?cf
59,000,138 *064370E0F8012B86F549FBF8216A4F47EA926252 DIMEZZER4
59,000,139 *06431D9588E629EDD839D440077D22A826B465DC [email protected]
59,000,140 *0644C3D46CF26EAE12DD4EBE559B74B9FB510306 dku_d
59,000,141 *0645A12285134594FB3601989BC6F7213C90FD9E D!$M0UN+481E
59,000,142 *064758AC0F9599717256EABE511A64576B0B1FD6 DONMIDIS
59,000,143 *064D50F310181995505F92FD31B2C1AF84BCCCFD DOZ"_
59,000,144 *064569D7E0A804CA70766EAC433B92BF433F9452 dr e edward
59,000,145 *06478EADE3B86DF8906910B26F97CA39A78EF05F DSC8B
59,000,146 *06454CC39BAEB4F062CBAD0BA8D52EA929C7A188 dtick
59,000,147 *0646ED0A2604503C11D1D25E0C6D1D618BE9DD0F [email protected]
59,000,148 *064F7C5275A808048D48910ABCB9B33A03DC8871 dudleytello
59,000,149 *06468DA8BB008DCF2508E1E9E5AE3943DAECDC16 D.UYV
59,000,150 *064B844F48EDD7517382987492834AAF673E1D94 dylanplair
59,000,151 *0643E89C7EB00F119E0E67442B6E32F11C0304EA dz$i:
59,000,152 *064542CB8E2D370E43A0E4D7016F51163BD73043 e(@
59,000,153 *0645792B8387E523A3C812297BF0D6F9119A9A0D EAim
59,000,154 *064E6C8E41B24B2CFBD6176A333F9A54D531A98A EDMUNDO.BEUSE
59,000,155 *06496B6F33B3E648F77A2EB2FFCEC2398AEC9674 EE_)
59,000,156 *064264B041C6D57570C8E7F208E47DF64C1CD8AD eggdbushashmap
59,000,157 *064CDAC051E479857F6C99B154E9915123CC64D7 einarrs
59,000,158 *064F3146925838CACC7CAF8B5956C031556D2465 EKOOHBOR
59,000,159 *0641D924C8E1CBE18BD90343222B0CBDB23CD944 ELEFANTEINSTALLER''ELEFANTE
59,000,160 *064A00AE57B52EA2E6674BA396B9F79F6AF8D5AA [email protected]
59,000,161 *064295A316F46D557B7309AD988B713F82E7D05F ELEPHANTKNICKS
59,000,162 *0645E981DE29EDB38DB8D226E7D45017E73C870D ELI.BROOME
59,000,163 *0645E934F1AFDD9A9B8EAD0E12DD0453559E0403 .elifstnofeht
59,000,164 *064AFAE3570B85F63BC762CDB18C4FFBBCD39A50 ELI$R
59,000,165 *0647CAC8F02A68112B4FEC462C288E5B897EED38 elk,d
59,000,166 *064144D8D45B7D694707D02BBD6321C612FA09ED eloteremteni.1
59,000,167 *064D33EDBB18B6C7D4ACA3E51C4F31D39DC9A7E8 ELWOOD.GERGELY
59,000,168 *064621412A5FBF5B55BBE36E083837D15A377DE5 EMANUELFLETCHER
59,000,169 *06441A9D7E6A5E14E9A3E19ACE76B757F21C9E5B EMBLEMEIS1234
59,000,170 *0646E817F96241818E5DA02EAA6C5CD4D3FD9665 emoryrickmon
59,000,171 *06475F2964D36259D645522F1D2FAD5FF0C4FC96 enerable6
59,000,172 *0647F74184C9BC174481687483C98BAD52F0B3CD ERICH.STEEVER
59,000,173 *064DDBAF12AEAB6AD97427CBDAC1BD05542D98A7 ernestojacobovits
59,000,174 *064F4C15FDFE5F0CF428EA576EB469EC3A85822D ERROL.COOKINGHAM
59,000,175 *064E00B8A598AD8B3479EFA5E7143263CBAA4D54 eschatologythe
59,000,176 *064BFF4BF7EB054B1692CB37A324B998D19619E6 [email protected]
59,000,177 *06482A35065AD8D1EC9FB85103D057DF3E726F84 eusebiocalzada
59,000,178 *0647E86321A484DA5FDE63B293408C33DDDCACE9 expayered
59,000,179 *0647E049CE49DC887CC2EC516CF73EF1013D4042 FAINTS8
59,000,180 *0646C76B95BC4D34D2C7B39FCC43251ECE2BD57D FANK
59,000,181 *064ADF37F6CDCCD92428F7EB9ED405561F28AAD4 FANTASTICKBABE
59,000,182 *0647BFB8116390A9F45507B0AA10A327D8551C84 fcccycrued
59,000,183 *064A7CE2A9C3BE24C3C63AD1A659424DD76AA6B0 felius andromeda
59,000,184 *06455FD951DE622D40F9A7E88821F3AA594F28D4 [email protected]
59,000,185 *06422C52476D0D9E6C1AC5CAE73B9A1EFCAF64CC FFUCKER6
59,000,186 *064B0ABA5866A32A58A21A7A2AE250AC5FC08580 fhv#
59,000,187 *064E7068049D0B91A421DAC15D5D2338C5814B1E FIVEDIAMOND
59,000,188 *064CB3FBDC455D3DF31CD9C2AA0AD0B1DE6C639E FLORENCIO.STINEHELFER
59,000,189 *064693C362E6E68A4D9306CABA6A4EDBAA81BDFB FLOTZGRÜN
59,000,190 *06459DCBCE0BE1E33FE7182FCAD224B2F3FEC058 floydgoe
59,000,191 *0646E6D48A37C8CC73F44917018300C191054FB6 flyerssylvie
59,000,192 *064F34AD353F7BC3D2BBCAFA42E75CF3837547B8 FORUMQUING
59,000,193 *0643E7EE6FADA9669D031A9236A855564AE4B741 FRANKMARTINMESSE:[1]KYRIE
59,000,194 *064342971AFCC0FB26D13ADD75E01E402D6FC293 FREDRICKWHITEHAIR
59,000,195 *064958418AEB43F008D18DDCEE50EA1767838F56 FRIENDS10SNE1
59,000,196 *06421169896C09D94B1FEFA70B73738D0D3AB8AC gardefeu.gard_'f/y/
59,000,197 *06474D8C53DC28C40CBAFB92077F188A859B6851 GARRET.LAMOREUX
59,000,198 *064C0F41298A756DA99F30C643DF3F461C33A487 GASTON.VERKUILEN
59,000,199 *064BB2794C989B9A577796D93E7E549F82DBC0D2 GAVINFRANZEL
59,000,200 *06448375DECB55728734A79F8E34EA8B2276893E GAVINTELFORD
59,000,201 *064A4E53586E5F1500658EB44EBE570B14987073 GEI=
59,000,202 *064B62ADD792387EB3B53A8211B830B8F3709220 genesis662
59,000,203 *064B83907183B22D23BB3A12EB11D773B5A5C371 gilbertschwingel
59,000,204 *06472CAEB3292868F97F1FBAA1B092B8A6CA2B80 GIL.KROBATH
59,000,205 *0645FD7756D0EFB64E0C58CC8633651F99D22594 GLMBQESED
59,000,206 *0645D82C4576A680164E0F26D754A183C8B0FA2C gnostyczne
59,000,207 *064A78019068DB424DE3BBE26CAB359F85D84C78 GU7S3S7
59,000,208 *06470E3BFFA4774237158BAC593192787763D9CE [email protected]
59,000,209 *064ED309CC256D134A13842709CCA4848ECBEAA1 GURUPAS
59,000,210 *06401C94F65AD2C23A21C757416529E7E1818E96 GUTMANAMY
59,000,211 *064139C200BC45131B682E299425FC85CDD779DB h6h=
59,000,212 *064F6C18AAB7BA10ABCB4392D6861BC6BB32A1A1 HENRY.BUSING
59,000,213 *064A13C13664B3EAC36E6D5DADF1D8CFBDF1965D HERIBERTOSHULA
59,000,214 *0645291A36B4D22D122F57FCF1E673608735B626 HERMIBOE3
59,000,215 *064B0416EB4F430857E3CE0910EF6347B8198ECC HERSCHELSHIERS
59,000,216 *06456695F899DDBEB996D03CC0806237D2E53A96 hfdqfiqmfcffoavcbqyiv
59,000,217 *0647134FB8D2F7A84A03EB582EE0245B5651117C HOPOSKAJ5
59,000,218 *064EFC66AC8CB89D65AC90E75A6AF89A51E07943 [email protected]
59,000,219 *064A3D16F764A903A04E4557F7BC6787828A729F HORACE.MCPEAKE
59,000,220 *0643558B1768ADFE6BBA4860F7126957ECBF7E41 Humppaonhikist
59,000,221 *064F5BABDCE229890345FCDAD5FCDE9262F29AAA IAMSOPHIA96
59,000,222 *0647876C106DE7AA1AB76B6A4A0CF19024FC7E8D IDAMIZ
59,000,223 *064DF13140EF30F75A925BD73427A257598CA9CB idiaster8
59,000,224 *06425881848B47CCD1A3B69200000147124F7F5B [email protected]
59,000,225 *064133AC0ABEDA76D70FAA09571A98ED8FDBA55E ILANDFRTS5
59,000,226 *064C8199DF154B7D3196DB65B8B91EC7DC4C471E IntroX Enochian Key
59,000,227 *0645FAE4F558D7273E42D09C8EEE91FDE5EE9950 IRANANACING
59,000,228 *0649C3C63FBAEA87F4B843DED8B74F0303D50A95 IROHPMAC9
59,000,229 *06493BC1C91E0560A952C346E76D9C407A2EFEFC irrottaminen
59,000,230 *064A3C5981628B385C9C461442CFD6AC76E83247 ISREAL.NOVACK
59,000,231 *064C471DE2AEBE4FBEE802899A080EF7F210ADD5 ITANDELARROT
59,000,232 *06443190DCC319D746397742B93B20665D625437 itclook
59,000,233 *0640DE347D3CBA2B9AEB9D87690182109664473E IVA.SHIELDS
59,000,234 *0646176D5294CD542EA4050F23702B656F25FD77 IWENKER
59,000,235 *0643AC0B34737D10C3E6EDFC2148587E990D9162 J..(
59,000,236 *0648E6F42CD2F57321FABF9979870B83D81AD421 JAHIDA.STRAIT
59,000,237 *064E3054947F3F0395ED77859978B316C4A6AF12 JAKALKM8
59,000,238 *064ED94F556AF5E64E7624A0348410124F4DB8BB JAMES.BURE
59,000,239 *064BF5C7777B5A080B12C4655B07B413CB69FE58 JAMEYZUCHOWSKI
59,000,240 *0640E318CBF6D8011021CB40ECB2B4AC98AF00DC jarrettchlebus
59,000,241 *0643E5B8E94DE3F9BF3EBFD2760F713E98D253E1 JAVIER.BERTSCH
59,000,242 *0647A7F006E4F3A872493A96C982C3FE024BB714 [email protected]
59,000,243 *0643188CA6A00C9451F385A4CD2249B50B0BD177 JEDKEODALAH
59,000,244 *064478C20A3F556F58BCCBE3326B71BDB86184FC JERAMY.HARLAND
59,000,245 *064BF7E603EB97C3B0D4CA4F18B24C130ABC3218 JERMAINEROSSLER
59,000,246 *0641159C0BE4A111B1A2C3D7DF6BFA3B20943001 JERRODCHOLEWINSKI
59,000,247 *064DEFE06C50FF943A89B1FC309DAD4F57E2C2BC JESTERQING
59,000,248 *064CFB0D947316439C5E3A6B989AB3CD022ED1F4 jetports7
59,000,249 *06461E11BC3FE24B061528DA9AFA83D8DA7A395B [email protected]
59,000,250 *0647B12C9D1C4782D2BDB2812D24F806EE51CD79 JOEL.GIGLIO
59,000,251 *06420944F1D7E81216A4144274F36FE97CFD141D JOEL.HUCKFELDT
59,000,252 *06473EBC4D36FBBF87CD71BD38DBC3A1D5D379CF JOHNNIE.MELGAREJO
59,000,253 *06415E25942E1E1924528904B6ADBDFCB9B3B3CE JULIANLINK
59,000,254 *064AB3B1A830798C22CA513C4C4B73B2CFD139C4 KASEYSILVERNALE
59,000,255 *064E163108FA3F4585E03264DB3D6636290B5754 keeper's-call
59,000,256 *0641821AAB548397FB0EE0E18682CF7CA980FC2B [email protected]
59,000,257 *064488B9DD06C4BA3B2C0D25BA81B0131406C3CF KELÂMININ
59,000,258 *06498C2D6E07BE6FCDBE5AA03AE2311387FBF3F1 KENDALLPANDER
59,000,259 *064F025B901F2C0360E42FF7701C35B7EDC86675 kenhart4
59,000,260 *06408C43CF8DC981DBBC90359D02344A5107EB5C kirkaloisi
59,000,261 *0649649025C5DCB2F337603BA0E3C9AC79EC0DF7 klqr
59,000,262 *064FA2A74CA1278F432DD26830FD75089AB12352 KOROŠKOJ
59,000,263 *064E29D3304A9127466537ED4F975B9DAE25825B korynewstead
59,000,264 *064718AE7DEA121EFB9D99ED20046E4E0FCE180F kristoferoxner
59,000,265 *064F174D453FECCB633DCF9E79E5C99E51DFEFBC KRÖSKONGEN
59,000,266 *06495D79D558866CF25EE60A18B918107E37B499 KTRLLTJ7
59,000,267 *064B665BE15080EC2888BF573C834131C0D14256 K,+U
59,000,268 *064B37BC0FDD8F423DBE3B5EA7790BF8A1F4448C kurtmotto
59,000,269 *064B1177878A71A89ACD2B7E86B87C6D919B644C KYLE.RAILES
59,000,270 *06455DD2609938ED4E14F2EDB49CE53AFE8C4EE2 [email protected]
59,000,271 *0644729E1C3BEBCC567A8077FF42BB72946EBB8A LAMONT.NAZAIRE
59,000,272 *064B0C74F2BB05E8887E2BD272A0D5E2C73EEB62 LANCEMUNRO
59,000,273 *064A3F51A5C0FC40FB21F1FE8A1E123EACF26F75 lannylardone
59,000,274 *064D0CB0ED76088A3DFCCAE029AA04D67F3AE69F LASERIMG
59,000,275 *06449ABE43935BA3D7462997B08D1536B8D5A2D1 lavalsedesbarreauxverts
59,000,276 *064C802060628570D4DFA845588AEB05F4264E36 [email protected]
59,000,277 *06451A33873D1CA7561E23B917D3997BCCCC6E85 leebalzano
59,000,278 *064DA9D40283A33B8D2A09EB11E1751EDBFC188A LEERSCHOOL!
59,000,279 *064DCC5E7D11766EC4E89212F72D33D89FF7634D leiplad84
59,000,280 *064454B77871627C2CB7AE20EF668AC3361904CD lesleyketo
59,000,281 *0648DB22E7E0543F11F117B658DF3C1F83D8AC10 lez-clements
59,000,282 *064501B149578166D7276DC87F7D54C5EA03C27D LGD5JTB3U
59,000,283 *0648BD97B5E78326992DC3F7B0AFBE911312D267 lokalplanl
59,000,284 *06409CC2AC4C165B2550E6ADAFEFD3AF0D6A5683 [email protected]
59,000,285 *0644782893D69E2E1A9637C1F09F67474D41BD0E lonniemyer
59,000,286 *0648CE5EF44318CC8F4CC8ED172B5338AF8F2357 LOS.ANGELES.FORUM
59,000,287 *0642559A287B333B12C58BC54F0FA977FC27D525 luigiburge
59,000,288 *06448793C551900011B238DE51A54DD31A9468C2 luz-jayme
59,000,289 *064FDEBF6A2B5950BB0093158F4BE5312767C15E [email protected]
59,000,290 *064F0FE71A8C6FDDC1FC021DBCB09138D4AF8E5B LYCINDA2
59,000,291 *064B424193C939D9404643308006D59084E80F71 LYGINSIME
59,000,292 *0642F8782F3C52E0E11F27D33ADFB34BAD700540 [email protected]
59,000,293 *064C57A8FB862E982B3350C668A56C1BD6EB1410 m3+4b011z4b13
59,000,294 *0649071603C133B857B4B8F17D307FAECACAF5C2 MALIK.CASSADA
59,000,295 *064AA1B18E084163399D7BC6AFAE36D95AD225CB MANUALLUTJEN
59,000,296 *0642357106C36A262CE624468353A73005D40EDC manuelchavarria
59,000,297 *064ABEC1605626B673F17FF4CC33343C8588D627 [email protected]
59,000,298 *0642F33B078CB44DEF058371F81A496AD5DEBC57 [email protected]
59,000,299 *06406B2E4CC38E4F74C53E57DAE4318EBCEFD40B MARCOELY
59,000,300 *06432A832D867CF5EDBCDAD6740062E761403706 MARIA.BILLECK
59,000,301 *06455DD6D0605C83010D126A85F7D21B73BB809B MARIANO.BOESIGER
59,000,302 *064B0429088FED3F461A53E7D27CB25243673F60 mariatch
59,000,303 *06475B380066DCA97EBBA7D271A5113E06738A8E MARKSCHRULL
59,000,304 *06425717EF28BDCFF21F32806228C83FFE98FFA3 MARKUS.SONDEREGGER
59,000,305 *0642642CA5664AC165CE02EBAA5FEE1BCE8B4DAD martials
59,000,306 *064F7EAC11E4F1CC9EAEE91D6BF27B521B5871CB mausoleum-door
59,000,307 *0648A8AF4D963A65782FD39682C53BE29A5B3C93 md3k
59,000,308 *0643ABD6834DCFD72009A43EC0D142510226F3B2 MECKELNBÖRGER
59,000,309 *064AB25B7E340EEB69EF2383E223D08C13271AC1 MERLE.BRADDY
59,000,310 *064BE69FD41FF1F97A011739AED45C13FEC7DA6A messagetomyself
59,000,311 *064C571B16FE6255E7248B36F61BF48159C93699 millardcabibbo
59,000,312 *064F86D5168C9C6C5FA3FBF93694F773CD046107 MIRAN-HWANG
59,000,313 *064BB8091E3AD44EA5FE167A032131DEF69BC715 MITCHELLKOZIKOWSKI
59,000,314 *0642CA77D2843FB8CB566B19C48CE2D32F5FB5F7 [email protected]
59,000,315 *0648B0167756B9F2D87898CF0D78470EA1E26D93 MOBBERN8
59,000,316 *064E37822CAE82F80E09D5B34A793CE0F4909056 monicamendenhall
59,000,317 *06468312BB16C97924691D267FCA7CFDA8F477E9 MUSORIA
59,000,318 *064A321BF4E90ED348D612D2BDFF42E5A3633F83 MYBLOWJOB07
59,000,319 *06484613AB30A0FDF2A19BD3CC87F8E4EEB54401 NAAVENNI
59,000,320 *064C73FDDF59D3B2AA26D64A21B2511973434267 NAKLONE2
59,000,321 *064479055FA911F2001C1D0F8E704C3F8AD94E0C NANCY251
59,000,322 *0642F79687C784BD3B1284AFB664CF7DC7549443 nancy-weinrich
59,000,323 *06405929DA93FB31C4E7F78FE11543F6BF7F763F nayana-tharaka
59,000,324 *06478A06F485E366BBA3A5818E368B7976D2487C nc0[email protected]
59,000,325 *064ABEDB77731912AC046EFD90F0007BEEB1AFDB NEAL.GOLLOP
59,000,326 *064621C2A17245FA99E0645715A160D5A60D22E2 netheume
59,000,327 *064881D2F370DD968F4BFC2FF5B7A693E6A7F835 nickdevries
59,000,328 *064DFD67476D160036E76D91BD1938D02671F9BC NIKKI REIN
59,000,329 *06438B560B854D6EB95DFDAC6B5FB0EBB17DB8E8 NOMDUFESTIVAL
59,000,330 *0645103885940C3F42C8B1865073DDD72CFFA72B nonsummo5
59,000,331 *064ACFFBB4372F063DFAFDF883B9BE746DBCC0D6 NOSEBASTIN
59,000,332 *0644763AF053C74E45C669DA0A486A93B750A416 NOTISTS7
59,000,333 *06460407D7FEEC777E8221A6793C87D67900C8AD np<r
59,000,334 *0642A7AB12F3A65954220DCB1601F95295212D1B [email protected]+O
59,000,335 *064504190A137E6992503C106D23BB6E301CDAF0 [email protected]
59,000,336 *064CE75D7B5B74BFAF217EA8969C4F052A20C099 oia-e
59,000,337 *06401AF70B7430B1658E292DD402E4BC5A7FE45E OLEN.AUDREY
59,000,338 *064B6EC6067608C7DAEB67BC6E2EC0EADC5CEE71 OLINKLAERS
59,000,339 *064E8CF6160E01850CA68CF9FD2793B39908ABA3 OLLIE.BROCKETT
59,000,340 *0648313625FC9D4352EB0F70E57BF601CDEF31E2 OMAS.TASSE
59,000,341 *0647AB6D0F659D0A5E97E0B4D5FBF7C360E3CB8C OPINIONSUMPLE
59,000,342 *064C55B716EC36D81C5E39DD90B9624FC7604E66 ORVILLECUTBIRTH
59,000,343 *064854D4B84E0374C70D50FEE71EE73B4A2C4B5E os8o
59,000,344 *064722DFD55660BEFA4216943C290D51B2AE667D O$VAAA
59,000,345 *064D158C9C27F01750643524DFFA7594771DB6B2 P2F&
59,000,346 *06408796C9A6A249E4D7406417F692C25DE83F21 PACIULIS
59,000,347 *064E97A51F6B7B9C9CD269BA8757B5FDC5A37AB9 PADRE E FIGLIA
59,000,348 *064B2B85F4BA73676E55F4D3103034C3B2DE06BB palasport(disc1)
59,000,349 *064985F122B68F2135B5EF6779AE6A1CBA997472 PATGORDON
59,000,350 *064CB382A996D6B431C355F81DA774C49DD4563F p#b~0~o><
59,000,351 *0643FEFBFB1C4D6884BD4129AD62572BFC9A841E [email protected]
59,000,352 *064EF11DDB9A1DB2D6A84E5D05E8B639EBED1F1E PhilippeLeChancelier
59,000,353 *064ADFA9FD13EBFA72E1C5D6BC39E38A05EDF2C7 porfiriotarte
59,000,354 *06456B17A60A84003A86B9A394127A3FA6A53F34 povefa
59,000,355 *0642D6A83D7ECB6867FB857C3B00FD357DABE2A7 [email protected]
59,000,356 *064680142B6122F22ABACDAF03D5F2BFBD7159D4 q===d`~ `~ splat!!
59,000,357 *064F74605C6CE84C6857F5E8B5B19EE17C2316FA [email protected]
59,000,358 *064CB562670937AC018031B83A053E35F7AF85FE [email protected]
59,000,359 *06405BB32EA3846565A03EA7283C64C4B25AD20E [email protected]
59,000,360 *06401B379CCF8966202A794DDA6F2FABF2BB2B1E QU!6
59,000,361 *064E18016946CD9A11DE6129856FA2D97D1406EF r35pon5b13n355
59,000,362 *0642CBEE1D3B81B27D1FED23242ADA37D7658DC1 R9M0IXXD9
59,000,363 *0643D0DCE8630509FB524F29CE676A83A3BC70F2 RALEIGH.ALMON
59,000,364 *064E32347DEA856183CEE5AFFECA167B243903C7 RANDELL.GILLINGS
59,000,365 *0642E5B3FF53385ECE199BD991FD7475DF7731A4 randystottlemire
59,000,366 *064FEF8A69E384B970126140B3182926B558D7D9 RBEFORE7
59,000,367 *06447D11C00588C62BAE4EF1DC76673A4950C785 RECOUPAITSING
59,000,368 *0647CDCDF1E11599E785B3FFC63C79EE73ECA7B3 REFRIERS
59,000,369 *0643C9A5221AD43195C09626CC3E5FBC9D212E41 RENAIXENTISME
59,000,370 *064BF2C626448EBF1CD351855F083A57F7A96BC7 RESTAURANGG
59,000,371 *064855CC62679D121E3ECF24AEDBE6439432CC9A RETIRING.HE
59,000,372 *064CA2CC0FCDDE723C6244319CD2FD8C9BCD888F REVOLVERTASSE
59,000,373 *0649B91870044358C3D68FA606AFB024205D89CA [email protected]
59,000,374 *064D29BD5266D0449B074CE5E904DBCC5D2953A6 RHETT.KLARMAN
59,000,375 *0648B808EAA9A8729257D022AC1E15DAA72C4183 rijksdorp
59,000,376 *06429B8923102A2AC0442E5CBED07B966B6ED8F2 ROBOTECHABSOLUT5
59,000,377 *064A9749EDE371D1833C386B1D68607F173EB05D ROCK-TO-THE-ANTHEM
59,000,378 *06438BE5A2DA3FC469DB110C041C0B3CDFB4BEEA rogelioaakre
59,000,379 *064333CFA2E2C315364C95C5B36F09E079563AC2 ROGER PEREZ HERNANDEZ
59,000,380 *064EA118DCF5C9F708717528C3748CCA6EB36303 ROOSEVELTPREJSNAR
59,000,381 *064F923CDA646D8AF69E4F203C27E0E81FD12CD1 ROSARIO.ZAR
59,000,382 *064152DC4EB2FD8AAB704EA831306FC4205BF2CD ROYNOLTING
59,000,383 *064A8051FE09FBD070447B41FA40183519E8034D ROY.RAIMONDO
59,000,384 *0640F7007FA5896CFDE323284C2AD7CEA0516046 RTSUPPO1
59,000,385 *064C1820F05CE30F8883FFB999BF96D8CFA5ADE6 RUBY.VILLALOBOS
59,000,386 *064E1CE105DD7373644B5CE1DBDD4F29102A9A7C rupertantila
59,000,387 *064C4390AB868307A05619FA9196F4A25DB7F048 RUSTY.DRILLOCK
59,000,388 *064666748D4FFF48F5DA0C190CD2F518FEF0C099 RUTHCROW2
59,000,389 *064B7CBFA80C7540AF548F5CFB80AC3F95F9D156 RV6X
59,000,390 *0645BB5A152EE858FDABD289D3BC86D2667F123D s3cularst
59,000,391 *064796BBA37F83D78421E5DF1E08DE1CAA4C0614 salfield7
59,000,392 *0645D4A77650B3E4F7345B6202F045F5D08C13C1 [email protected]
59,000,393 *064CCA8F092F5DA623B6A818963F265F90BB5C1C SC1NT1LLA
59,000,394 *064D84A0E32061C4C8F58BFD38AB780DC99334FB SEPPAHCS
59,000,395 *064B7F2DC77CE5D49872E8D13CE86FE118150D7F SESAMEGRASS9
59,000,396 *0643B2E388DC067192BAC031B6DC6B7F99213D25 SETSIGREVNOC
59,000,397 *064CB82BBBD61279400F1CE87A3F729145EE3AF9 severnofinsko
59,000,398 *064CF87F1085D6A0531A6BC6BB18C1F8501792B8 SHALOMPPP
59,000,399 *0649C0BC6680622026EAA31867042735F0B83017 [email protected]
59,000,400 *064564E1F009680B144C7703C871F16BBA07E434 SHAWNCROCKER
59,000,401 *06433E437E0144D836483C53704536A9D797ECF1 SHEROLYNING
59,000,402 *0646BD0172427FB8729C7FF6F2058C6566B01D57 SHUMENIK
59,000,403 *06406201FBA8F1034528D77634A1C39AAAC494F7 SICK PAY
59,000,404 *064D1A8D9A56B77703D419095346C81CB5A18847 SILASPIORKOWSKI
59,000,405 *064D673D44F2D02BD17BB3AAAA5438DB6E9A4F48 S+IPP13S
59,000,406 *06488CC60BACC29AE525F0A6B3C543A2E9231968 SKESILLEETEIT
59,000,407 *064293B6C1AD0F12E45B34F6ABEDA6CD8BD97EE3 skimmed went-over-the-top-of
59,000,408 *06418C5406FFF4E5BEFA8FB5C6FD7C031779019A SLAPSTUV
59,000,409 *0647D154E3E57B781F8D1A230725CAB51762A65A smaragd.
59,000,410 *0645A48ABA37B1F7E76C9E2AA9267A3B3EB4A1B4 SPANKYDEFENSE
59,000,411 *064E7B5DA8874F773D798FAEF7122E24A9F61E8E splat~.`q3
59,000,412 *06444A4613B727CAE83296B444D7286449303595 stacey.keach.dada.message.bag
59,000,413 *064A1D2693368A5C1240147B322EDE1A7EDE9998 [email protected]
59,000,414 *064FCB0A5302F670AC26E731C943549684E9AF53 STANFORD.GALO
59,000,415 *0643F48724BBE02329A47F1EB0B40CE799B5A058 stangate2
59,000,416 *0645A6438B8C7CCD65E10949C85674B7B8EA1FB2 STEPHENDEMARK
59,000,417 *06495D7CB7C1BC73F2DEC9C5F0841BA2753EAD5D stephengraziano
59,000,418 *064477516EB341F161B8ED21FB5CB2C79E2E3B6A STEWART.MELAMED
59,000,419 *064E6108D199E67B67AB3D30A5904DA419BD64AD sthtc.nd.bty.spply.|.cnd
59,000,420 *064798CAF3484CABB3FDD3036DBDD0D2104A65A0 SUCUPIRA4
59,000,421 *0642DF4390FDCC1378C8FE05E16A06EFE983587C SYMPHONIESNOS.3541(BERLINERPHILHARMONIKERFEAT.CONDUCTOR:KARLB
59,000,422 *064E29E805AEC12D8FAFAD54A249E2B51BB7FE1A S!Z*
59,000,423 *064CD611E0A4FA6D42C4CE298BF41B31EA6C5B44 SZAGA1
59,000,424 *064551F124F55FB0E9F7BDFFC03E2C3AE4160FAE T030885
59,000,425 *064FF8F4CB29A08EA7F350D36A9C79051A6474FD TADLEGACY
59,000,426 *064C696A023A8EE9CA00DE9116B85A0F2BE52341 TAKAPAJULLES
59,000,427 *0644FC6A70A8DAFABC2B4B0423CCD8AC1ACBB3A1 TALK165.138.204.2
59,000,428 *0644B09E12C8AC9B45D4EC31D7856815F2B271E1 talk8620681150
59,000,429 *0642EAC26EEFB4A9EFA5B7AA5F87CF1004976E95 TALKKJOE
59,000,430 *06422E092BB11D9842923E9E36D21BDD1BBFE5E7 TALKRICOCHETRABBIT
59,000,431 *064DD69F01F8A90F1F604B500C02365B020B6F25 TALLARED
59,000,432 *064F43073AB767A21DF03735722A1A99831CC9B1 TANYA-BROPHY
59,000,433 *064A6CE00D8C0B1C8F3D761C9AC278B2AE5556DB TASHABANANAS
59,000,434 *064845F5AA5CCB85DD750B555AA31D31ED1A410F taylorwyllie
59,000,435 *0642CEEDA78A0E72B5CC468816B6C5B7484A97DC [email protected]
59,000,436 *064F252A75790BB3A5FAC6E1DA34AA19ABA0F5E6 tbs女性報道記者
59,000,437 *064B8907F403B3CA3339CBE31575F37454E195CE tectospondylo
59,000,438 *064F7DC95E2BA4482B79411B65EFCD400CF6859D TERVEYSKESKUS2
59,000,439 *06441D7F66BB45298D56BB77140C6045066E0603 tessala2
59,000,440 *064350AC91FD11CEC6DF15F7C9E66300085BB55A THATBOOBOOABC
59,000,441 *064D41FD26F8C98C5E33A0E61E667DEED4209F9E THEMOOREGROUP
59,000,442 *064CCD42A079717B214D546F9309F0A471B066AB THEMTHAT4
59,000,443 *064F9BDD6D3CCB59D590A44ECDD9E055ABDDCC63 the next degree (feat siah & karime kendra)
59,000,444 *06490196E966EDBDE9170BB6A1D6A39ADB1BFB0C THEODORE.WICE
59,000,445 *0645E3E6410B5EF551A834931BDAF861AA093CC0 the.river.xi
59,000,446 *064AFE0237700CBF156528899FC44532B805284D [email protected]
59,000,447 *0649DB084AFA3FDFB3FEB884600F416E4307FD82 [email protected]
59,000,448 *064452AF8CC8860632D3F51AE41A77075CB7618E TIMOTHY.WILLEMS
59,000,449 *064250C2B47A71E2B136E994663EE633E5D16187 timprincess
59,000,450 *064CB30A0A9CBE0A3C786D4AD41D0265B604B214 TNEIAUGAVID5
59,000,451 *064184E11FA3CF263684B14F89E7380A34759CFD TOBIASAGRAMONTE
59,000,452 *064901C3CE85A3E9C63B510B14ED5AA99D2E8742 TOC174790029
59,000,453 *0647B87D94584E81D108D43CB0312F4F0D67A31E togetyoureal
59,000,454 *06427879276C068F230F6AFC211D28A659578771 TORMENTINGE0
59,000,455 *064C11573F48700C1AC335E110434C775F35EEF0 trick-senjaya
59,000,456 *064B999BFE34D1BDFFD67C62E7AB44F51C044348 trish.lomman
59,000,457 *06453FEB018D9B522762A523816B96277FBF3A50 trophopodic
59,000,458 *0640F0146372833BE122A2157FB8934FDE4DE093 TYREE.STUMP
59,000,459 *064853FF8E832ABC901D9825F147D7BA920AFDE1 UAEDRARI
59,000,460 *064F23DBC2F027888C8B2B889295B6A66EC35DFC ubong-aniedi
59,000,461 *0644254219698E8EB9FC5017705CEFCC3AB4173F UENGAS
59,000,462 *0644DF8557210CA001D1DDE2DE16A9D95F01AAE7 "UKTOSSI
59,000,463 *064CF8C6A095872DFEA961904FF56D499E417CD1 ULTIMATESTAR AJLTHKUMAR
59,000,464 *06417219B4571E25B12C4FBB0B608EA76B1082B6 UNA.LLUVIA.VIOLENTA.Y.SALVAJE
59,000,465 *064BBAB990F76A4CB28D3D2E889E7388550324F3 unity-oware
59,000,466 *064A4807959805D7DEE102F79C98299CC74CDABE unr9h+30u$1y
59,000,467 *0645E1A4FD5C4ACE696D85B3ECBBB580E8EA07C6 VERILECEKKARARA
59,000,468 *0647ECAF453BEE698709FB88A39D694979855EC7 verna-ryherd
59,000,469 *0643D0F1D8AC729E601CE7B4C14134368F02A13B VERWERVINGEN9
59,000,470 *064DFC87B115C5811A4802A9CE0EA0E6E9587687 VHUHWAVHOKHOZA
59,000,471 *0643C1758DB4C92E7566F8DF56474ED15F35B4E3 vianjohnlloyd
59,000,472 *06460809A0F8F2AB7E657AF2E9979E78687AAB8D VIC3LI3U
59,000,473 *0642D9D5F41FDBED34ED79834860027E49F326DD VICKYMAIR
59,000,474 *0643634280550FAC2EF2A0ADDA93BA1CCD0BE5EE vida,-viracao
59,000,475 *064BC498A920E26E748DDDCDA5F929B198702F36 VIGNESH.KOTHA
59,000,476 *064F866E490487B8873891DE4AF7C703FD98A92B vireshi-natalie-jaftha
59,000,477 *064851395556D41556591BF743F5B71DFB5E7EFC vivianwanda
59,000,478 *06467AC3A3CECD525CE6A006F3807095503865D8 VODIANOVAANA
59,000,479 *064C6969A03CF95DF9FD14FADC9FD30722271FA7 VOLSKIENE
59,000,480 *064BA9B40F36F8E998F2612BEDD9CA1BE4BDE6F2 [email protected]
59,000,481 *06432150676C10E5B6960134AF5B0BB0CFBD8CB0 VREGESTER
59,000,482 *064E8CC627F2724745579D18E4653D10E8C87389 VSCUILLA
59,000,483 *064C7DA943FD060A74CE5E83F558770D74EFED97 vv4c0usn3ss
59,000,484 *0649CB94645AC190FA31746257101263A4BC7AA8 W0L
59,000,485 *0644C665A76947A72CE313BFE73129DB733DDDF7 [email protected]
59,000,486 *064B93D9B10D6343532DC18C92A4D561A37CE064 WAPOWDMTUKIYSEOB4
59,000,487 *064E684BD183C4C3C0DF6F05F7C5A7B4AD1B9247 WAS.KANN.EIN.KIND.DAF
59,000,488 *064B487064166D8EC96DDC183549B50DBE4C931C WCG7924
59,000,489 *0640ACD416AC886ADB514857C07816652CC70274 WDENNISPARKER
59,000,490 *064ECC40C727E3F4D3186FE7B67A0AC1ACDC8B27 Weapons-of-War-2
59,000,491 *06479391FAF631CABAB13F142F94368B88B3EF4C WEIZANG
59,000,492 *0646AD7046CB067296F16B8AC9FE7C1B8887F000 wilbercresci
59,000,493 *06459C98DDD00D4002F05669C85C2582D035DCEA WILEY.BRAKEBILL
59,000,494 *0641829B6F50746F26C1A4361E3E11802CDFB094 willafter
59,000,495 *0640C02D7D227F7D5BC59477F998E0362D5933B9 WILLARDSTARKEN
59,000,496 *06485DD2AF9E8B5683959C2E23DD9C245FC1B264 WILLISTALIULU
59,000,497 *064BBDECAA6C4DB09D15BF7E87E2927118EA2C85 WILMERGRAMLEY
59,000,498 *0648BE06319C690787202A367A40D1812AC685F2 WOODROWFELDMANN
59,000,499 *06468F9C198BEA109E87719A65FDD3D4528D4B07 WOTEDAWK
59,000,500 *0645E1CE0D565BE682B98FB091BB82F69AE38CEF [email protected]
59,000,501 *06424D0F88967F63388D3F343B36C81FCB0D7EDD wwwmyblogbandcom
59,000,502 *06457B5805EFA6C6C69BF12B3950ABD8C4EEAF74 WYT.LACSON
59,000,503 *0647E74F6C6F68BACAD5B22B000B62D25AF82955 (x).0~.d##p
59,000,504 *0643FE6167AA3029F836022A10223B79FEBB340A {x}**<====8
59,000,505 *0644906434A9CDDD44823A90AF75F16479CBE059 [email protected]
59,000,506 *06467EB24026793E0CBC5A3858A5B5D8DBCE83D0 [email protected]
59,000,507 *06407601FF7DBB247B38DAED4B36475E482DB3B0 XJQ<
59,000,508 *064B0B85851D843EB64DF68D0B57A23A847B8785 xm53dwg
59,000,509 *064B64D5CA1FF80F88EF1E739943DF76045DF540 [email protected]
59,000,510 *064F4A451ED8F6DA393E05733ED405FB48952B54 [email protected]
59,000,511 *0644EF0F9960270FF1B56C4B2BF47F2CE4E556BB [email protected]
59,000,512 *064EF63F7C182850B3F23317B8A6B1FB60DB412B YLIMAFAGIMA
59,000,513 *0642217A56DA707946C811128CB76889EE15A443 YLLAEPITAENEET
59,000,514 *064A217C8DB2FA2637D925935AD32F51E3B09B00 youthed7
59,000,515 *064340921412769BA51D10869925F394CC713391 YROTAITO8
59,000,516 *06444DDA56AFD23FCA5E0017F0B0619CED0FE09D YROTCAFKNIHT
59,000,517 *064642D29C456481A2B8368159280B526EA38111 [email protected]
59,000,518 *06443C821182C70BFBFF96467CE502ECF49B6DF3 y)yb
59,000,519 *064D27ABF834AC94A99D436F5DE2CC5C4EEBD61E ZACHBUSCHLEN
59,000,520 *0646D41A3B3520C559811DDEBF17145365C2E2F2 ZACHERY.TRUE
59,000,521 *064DB089CD998A08DAC3F188DA2F08DB281B97E2 ZEETERM3
59,000,522 *0641B01CFB9590349056CE39F4EC7A565A99C4D5 [email protected]dutw
59,000,523 *06496472048A9EAC67AAA71C5889EC0A970FCBAB ZVWFAA
59,000,524 *0646ECEE645F3837FAF152CB8DCA13BACEF44EF6 ΜΠΟΓΔΆΝΤΣΑ
59,000,525 *064CECB70E1C6DA2E4F6CE41DFD0F8CD7BC4FC3D гаити
59,000,526 *0646A9284829BCAEBC8333C9BF2591DD9D44D7CC рац»
59,000,527 *0641FECFB767455124D1F46C330F8AD3C5AD4699 харама́н
59,000,528 *0643F874C8AC4F85374D5470FB1FDD87DF3F0A04 « VIAJE
59,000,529 *0647A6B17CE4FBD62DEB07AF683C3F836B49309A 化されたQ
59,000,530 *064149C28A62EFEEE962B12FAA320EFDD1F4C68B 0ILUVLAWYER
59,000,531 *0649A1938D2ADB21B591443766A1F967356102B8 1299046 TAVOITE ON KEHITT
59,000,532 *0644500C5DB33A15ED4BE73BC2DC5A34159C0194 12HANDSOME
59,000,533 *064B27EB6E06100E86F77BAF5A3B2A3A76F2EE92 152ANTONY
59,000,534 *064AA9980AE22E6D18016E7AF6505014BB60ABD4 15 MINUTES LATE
59,000,535 *0643511CEA2C7B37B17134A35E94FB5FF587A589 166bernie
59,000,536 *064C321B04D92804A6AC0E8D1E139599B3FD9138 172ALFREDO
59,000,537 *064223A61D6AE6FA3B9E09B703338E19C745D710 177 VALITUKSEN
59,000,538 *064E3F9DF125499EABAB0AB0D3E3A86552639591 181373 yucelsk.aricanapt.
59,000,539 *064833D54C67F51F6E20DA24B5B23B70FECA8CB6 195kaley
59,000,540 *064DCBD5AD5C94B45DB3CBD3ECB2881E4FCB6D30 1.amnestytietoa
59,000,541 *06480FBCFC6EEB25EB640C54FF4C14AE2016A137 1.AROFF
59,000,542 *064A5AACB9D38A19CAB7581AE43DA406CC5CFF8D 1asennushommissa
59,000,543 *0646FA8A95D5ADAB497DD2DCE778BFD5417E2902 1-GAMBIANUS
59,000,544 *06409F958F7948E3F537F8A66C22871A6E89C71E 1.gradientista
59,000,545 *06437079F873A7430B611FEF831DD53EB17B7539 1GRIFFVARIANTEN
59,000,546 *064859827C765F892D04F28FFA38240786869E19 1GRILLMAN
59,000,547 *0648576DD97ECD7522F1850DEFA66196A981ED57 1-gulsun'e
59,000,548 *06470F83D68BF39D696018E2E7A9B932DAC63F8E 1.KIRJELDAS
59,000,549 *06491A61989A18173C45F4B43C72CA695789F15D 1OON!3ST
59,000,550 *0640DE72C799D3E0EB27EB75ECF8BF3880A42C2A 1PROMIFRISEURE
59,000,551 *064C72D4B3ACBD4CD59653BAF0EF8C6252B3CEB1 1ROMMEL-MUEHLE
59,000,552 *064A8DDD239D258895130150EE1DD22C17D0FE4C 1ROZEDMUT
59,000,553 *064EE8CD9FF92D4D3464E06C640F4D39713CFA5D 1.silvahakkuutaksa
59,000,554 *06438FFE54DE199B6A99F3100FDF8FD389C79D98 1-STELLS
59,000,555 *0643073F8D996D343FF6C668A19911521D158379 1 TARKASTELEMAANI
59,000,556 *0648142424CB1A59A31D08680AF82CF8252831BD 1 TIPPUUVAIN
59,000,557 *064C0B2067B63A3C025C375DB3ED88F7F6EEBF29 1TNAEGAS
59,000,558 *0643D9092FAA321B9B9DE5BDCCEB63037B3FBCD5 1 trenchard
59,000,559 *064F9BF544117B27079F9E68649F378A0F93BB15 2002291 AT ITS PEAK , A MILLION HUNGARIANS CARRIED PARTY CARDS
59,000,560 *064EEA28E2C6BD4E40BA56F7B3910939D7C24E34 2630566 AALEF-OY-,-279-P--,-LAPPEENRANTA-1990-
59,000,561 *064EE8468DE27E94C8C0C217D68F5D1DFF5A3015 2842744 maaliskuussa 1917 nikolai ii luopui kruunustaan ja ven
59,000,562 *064AECDED1557E6808430681B8DF307DE8625A69 2926069 sy
59,000,563 *064FC25E657551E414128CBCCC8656BDCBE27E91 2978440 t
59,000,564 *064255B52E2AF43FB8C6407C3E71C943457B6C6A 2.duyarlIlIGIyla
59,000,565 *064AEB8F9BE5F6166ECE7092A0FC4FBFC4ED2D8B 2DYBDEML
59,000,566 *06478E5564C12CB7ADFE8C3B0124A1DBEA3D7BAE 2GOTAMINU
59,000,567 *06498A5EF3A35DB3FED398011411B49FBD387869 2-LABOR-NEGOTIATING
59,000,568 *064C6FF2BE07B66B09DA123329269D9E49F988D2 2MN
59,000,569 *064EC0BDE0C6757ACD9CA466CD26F7736EE2952E 2 STEIERMARKRUNDFAHRT
59,000,570 *0642BE64C7A3855EB4811468099516D9A2405B63 2 teippin
59,000,571 *064B44052E0F32A9B54DE6FA02B23C92D75C6F53 2videokameroille
59,000,572 *0641D2C12A417E1E5F13627D93EEB17AB46DD7E2 306adyson
59,000,573 *0645308B3720D90DE19979CDB71BFEFEF8B4F451 [email protected]
59,000,574 *064A0A92468C87AA31BF4CDF3D840A6534EFBB7B 3iluvflash6
59,000,575 *064C2DF8F74F9113189672F9A4CCB0145BADFCCA 3=p~oo><
59,000,576 *0645AEBECA4DDA7DACCE07949BF4E46468FD297C 3WITHERD
59,000,577 *064EDEC4AADE6791FE46E6487DFEB3BEE5F8F938 408557 ITISN'THARDFORACHILDTOQUALIFY
59,000,578 *064CECFD59B621C0D341F337C5EA5D2A54083E09 4AVAAKUNA
59,000,579 *06435411AB3A4C04D63FD7497C8B07DBBF2E3801 4iluvmarlboro7
59,000,580 *064C96DAB73251E89DE3C0AC85088CD56E8ABAAB 4NETTANO
59,000,581 *064CB222245D9040D9754C5B19C4E34AB9C4C01B 4RAISKLAL
59,000,582 *0642AA09B31D50E1B60C0DD8C1297B994ABBFCC9 4SEKOTNO
59,000,583 *064AA01D2837BB51A51143EA1B0CC41503949536 4thelakers2
59,000,584 *0641DA025F618363C153E42B3C6E63639C48CBDA 556trent
59,000,585 *064C3C183C02817255A83CE01832D1E51CD89802 58.CAULKINS
59,000,586 *0641349BCFFA97D26A0749657C4CC754D1CCE208 5enfamajeur:i.allegro
59,000,587 *0646F37E78BBFCDA15722B3EB8EF68D3088F3854 5SALIGKARIOY
59,000,588 *06423A1ECF819E256C1C59A33F11AA6116A38B15 5 STADTRANDSTRASSE
59,000,589 *0647EA6D1F1578D5AEC1FEE4BEE0D4DEAFDA491E 5SURNAGERONT
59,000,590 *064305ECD664F9E1D4717655028796BECD0B12B9 600686 CANPAKERSAVASINSANLARINOLMESINENEDENOLUYOR
59,000,591 *064CE77A5CB39FE45CAC90A53407AAABA7BAF230 6.01.1868
59,000,592 *064AD51905B0AA91C30C530BFC0AC2E222ED88FF 635639 CHESTMAN KEPT 3,000 SHARES FOR HIMSELF , HE SAID
59,000,593 *0646141799B2F28CB11471B77633066B865E921C 65243 officials.at.sears.and.ward.declined.to.comment..
59,000,594 *06431245017B70F3981D81FD90FCF949F0476DFC [email protected]
59,000,595 *0645870DAFDCC302EBFC9B70D9B19DC410D4CECB 6BINPAXCPIO
59,000,596 *0649607D53B539CEB8F1B7682394BDF1BABF29C3 6CORRADOGUESS
59,000,597 *064C99F773F0A4DF18FD2E71703681EA1F124412 6ETSINAGE
59,000,598 *0647CAC105E13FFF7527C39E7FAF80DF4EC4EE55 6H(]
59,000,599 *064C45D35CD2AA6442928CC136E26450AD3D3FA5 6HYDROXYBENZENE
59,000,600 *06477F65662DDF5D807E858678F5F035E7D644F1 6katafori
59,000,601 *0641CEADDE72D5A14A18320AF1508804D4421C7D 6KHANSTEVER
59,000,602 *064C6978CE5FFD3BBB6D5826206672A5A6CACCBF 6LIONKINGSHELLEY
59,000,603 *064BC85A3D073CDD0BF981932137249A4C86E028 6LISBONESAS
59,000,604 *0647F0400EA7B02B1DA1CC547542187B0097BB42 6ONIDNOFFA
59,000,605 *06404FF2F7EB104500A983726E4BB8268BE10012 [email protected]
59,000,606 *0648D33057D6D80C571C3EEC8E5D7881F610B82E 6TERRONNA
59,000,607 *064FF7104F17ACB9B213651011D2F3D0357788D3 6TYOENANTAJISTA
59,000,608 *06434ECEFE08621948B9853F5567AC5C9344EBB7 6YLEISNOSASTOT
59,000,609 *0648F3FBFAB64C21AE32D0CFCF1EB03EDBDD27DC 74.spontaneously
59,000,610 *06487C23D9A2E1FE4DA39E88FFFB10CDA8F90573 751325E7EDD21469D4A3E524FA650379.JEDI1968
59,000,611 *064D06435F7AE3D375088663A17662627836EC88 75LORRAINE1
59,000,612 *064D8775BD19C3C993C20A4ACE242C27A1950E1E 7ASSCOLUMBIA
59,000,613 *064B5ABDC803260985FC4A51C7FF5E3F46FFF8B1 7BSWBISKUITHALLEBSW
59,000,614 *064DD67E6C003E84F01A1A259A48142BACCD37BF 7DEFRIBILLATORI
59,000,615 *064FD680F2EA9DF9F1900488705210CB8B436B1F 7E85D2
59,000,616 *0649D9347B2B944AE32C16256984B702C5049CBB 7EFMOEDER
59,000,617 *0647E002660A78ABD851892E8362A82B5B601D71 7MULLVADS
59,000,618 *06468626D0E47D5343C60C8877A0729F3A2DC0B7 )8( ~`@3
59,000,619 *064E57E7054D590EFC0E96D8C514B5177CA32DD3 890279851LEXA
59,000,620 *06437532C5FDC9459A7062FD14C14621FFEB63CA 8ALYSSALLOYD
59,000,621 *064A7A4ED68630D89054592AB4EB40809452E951 8CHELSEATHUMPER
59,000,622 *0645EB0CB2E723760B465E7C53669F99ADD353FB 8CONNIEGUINNESS
59,000,623 *064DD5AD74D7D4A9B027479511B7C766ABC68E9A 8FAITHDATABASE
59,000,624 *064DE397D11E346558A7F7782F2061C4D80E90C1 8GAMBITHEART
59,000,625 *06456D57FBC82FDD3DBD725FBE066F6CE839DE63 8INSIDEGHOST
59,000,626 *0640167AE0EEDF5C9C5FFEB8CDA2570FB04B9DFD 8NINEIKLO
59,000,627 *06405A5077507029D80B431285B6DA5F28C9BCE1 8NONEMUGRENE
59,000,628 *064393AE853030E8C2A1C9471A54512439BEB5EE 8ontogenic
59,000,629 *0649B321D9F506599701DAE622A32A04EC9C5A2D 8> * Splat
59,000,630 *0642FD3C0514EC540A3381F89B9A2E9514A405E5 909110 bickiyurdu sok
59,000,631 *06426BCB153DFA4C73E10B4C7C84666275C78EBA 90ºREN
59,000,632 *06436A2C7F9D1BF0CFC79FD8AF3F6CB2D1ED519D 942JULIA
59,000,633 *064D4C9569997DD08DE8CE62A6EC560844A32A91 9alphabetisme
59,000,634 *064C9B78DA445FE118A0C56E2AD36259FF40AD03 9COURINSTRUMENTJACKALKOWTOWERLACKEYLED
59,000,635 *064597C75A7602EA1E07697353FE774A0C4C0743 9IAMFORUM1
59,000,636 *0642B3E7F581D02B60012AFB00CA63C3C28750B0 9IAMOLSEN8
59,000,637 *064E5B6E708D3817801E712F57292572450D038B 9injecterez
59,000,638 *064BB32AADBF5CB2BB89EB6C5C446372DF0992E7 9STELLAAMELIE
59,000,639 *064515AFE5414E559B596874DE2AA86DF219BCBD 9torgrim
59,000,640 *0641D201429E9B5CB738F38864FE64DD5D864FB7 9WDOLPHIN
59,000,641 *064778094B3429C3A5AF22D3BD923E89E98C5646 a,=+
59,000,642 *0644B334B737D4780ED436FDE8DFB617FEA95E2E A1&?
59,000,643 *0641D4F6C8A22C7A34E444B2B982186BE035C115 A2TQT
59,000,644 *06483ED58301B04C7F06F04FA2DD2A5FCC5D461A a5%qh
59,000,645 *0649E1D7A6A76E877CFCF1DF74324193C6B6DB47 a7&c0
59,000,646 *0641C32F654F51934A533EF15C7856E91D6A5C65 a/7!t
59,000,647 *0643BC69350F918CA7E60EDCDD1DCB4EB97EB6F1 AAA#O-
59,000,648 *0646EBDA8CF4D2E4FA71E449643ECE1A94A8091F AANSITTER
59,000,649 *0644048A3AAC670CED3A297E768C4C24CE33B3A3 AAUDJYL
59,000,650 *0646B8563BB1B3E3055197050FB9AB8AB2E01761 abHK
59,000,651 *064AC05A9DE723D3185867C3B78932FD65B0ED47 a;c3s
59,000,652 *064635E90540F766EAC12149347C7B4CB33CDB79 acaianswercom
59,000,653 *064CF58F77F6E9D16427C695327871A1AD7D165E ac&=y
59,000,654 *064AE37CB90832E96A9A2676C464F4EBDA5EC0A4 [email protected]
59,000,655 *064F9C7ED963EE435F0B66D248022A5C4729E70C ADOLPH.VRIENS
59,000,656 *064A30AC367422E8057031F0C1BCFD88E059329C AdQ4
59,000,657 *064276DF28DA7303F32E137372117F055697C64C adwmp
59,000,658 *0647E774DB4AAB836F8C1BAD622B52D7900F90A3 ahq5s
59,000,659 *064496BA424C0B83FEB8D869B6C196B2933223B4 ajr/
59,000,660 *06431141A5E8B37DB6817C0F4BF261D0E741B40F ALBERT.COUNCILL
59,000,661 *06473584B0BB94FBBFF65E915246FFC9F8440047 ALEXIS ROGEL
59,000,662 *064B710732E8B0602458ABE74BD81F29C1B4AF5A alguibays
59,000,663 *0645A14B46E4D58A7FF6EBE971C57E41F5DEBFD7 ALLENSUSOEV
59,000,664 *064C7ED758D6E25C049EA45AFA045481CAF3A499 AL-MAQRIZIP.346VOL.2
59,000,665 *064790AFBC9FC726CA117472F2465D6533D1EBED alonzoslovacek
59,000,666 *0641EFFF57071096B88D88C7506716560FDCA400 alphonsomarchell
59,000,667 *064963DE111E5FE8E017A4CA5F7F1DB1D74B2F61 a,_m)
59,000,668 *0649FA7363D8E1E7D67BFC6560FA0C4CB8A50BD6 amanda-stotts
59,000,669 *0641EFA40DB10B3ED757E17EC85FAB1FC9235AE8 AMHARISCHE
59,000,670 *064703FFA4B5C7A2864E84C0E6AAC6A0C5D90620 AMORMIING
59,000,671 *0641990F583CA4EE3001AE418ED329B8D3468806 amosbecherer
59,000,672 *064CF607E7CA7FDF9663ED93FD189CDFA8FC00EF andamarka
59,000,673 *0647F484124FB107D0AB07C84114D4764AEA4B1A andybovee
59,000,674 *0641F73C2D48EBD203978E426B3C24F71F175E04 anightfullofstars(ac3)
59,000,675 *06404A027E504F63393D7E641A5823BA1455924F ANNDN
59,000,676 *064C6797A6B1B6038844F3FED5CE12ECD1065996 ANTURANT
59,000,677 *06406C1BDD4FB6C7E90E7F30B2986ACFE2530643 AO2T
59,000,678 *06436F2623EC12DC57CD96799A6081F3208D791E ARON.MATTHYS
59,000,679 *06467B170F78786530E0E6D0D461F1F8526C4AF0 ARRONBOUCHILLON
59,000,680 *064ECA74403556142240C1B2B0EC69CE2E3C855B ARRONREMENTER
59,000,681 *064C9EFE74FCED431BDD0F8933BDC4E87D4DA4AD ARTAN-HALILI
59,000,682 *06421D7DE50E96AC30EC709A6A0956FC3B483A6A [email protected]#$%^&*()asdf
59,000,683 *064CCEC9A52A31840300639B7201333BD2F1D6C1 ATTINICI9
59,000,684 *064A1DE244B6A879BB204B32E4F5F5D940B2675A AUFTRAGSBIOGRAFEN
59,000,685 *064933E282167DDA5825A82F5D4075FAD1EC2D2D austincadenhead
59,000,686 *06456499F5D4362F3622D3C23CC812AF17E4D454 a.v%a
59,000,687 *06428BECBF5E6F90E7E0180E7E93A2E2ABD169E2 AVERYVANDENBERG
59,000,688 *064114FC8E6B78D84D896FCC71103B57C88F7EE7 a?z_f
59,000,689 *064C82BEB1394700A9EA7AD6EA47C69E7D8B0E0E aznednaz9
59,000,690 *064428588F8BE76553F00892006F43BFEC8E2B2C >-b0~`<=3
59,000,691 *064275408877B147A5A58F76AB9A6E566D05D98B b2"gt
59,000,692 *064DFEDD5568605973A83FDF7250BDFEEBA62195 B2OC8
59,000,693 *064CA3E8AA0CA0AA06726B9DE63DF550D38CA007 b"9oi
59,000,694 *064047B81F4BD78CCF6C7C7C97B050F7008EA873 babykong
59,000,695 *06467D0941B7283CA3862B15EC1C5E69644CA3D8 BAYUFIRMAN
59,000,696 *06437FB4DE86B43D72CAD2AB1BFDB8ADA5DE6544 BC5ML
59,000,697 *064B343132CB56AB04A2B154964D2FF4A891F083 bchapma4
59,000,698 *064350ECD04A41A8397188895D5F40A0774CD426 BEEFOOT
59,000,699 *064C31A2CC0AE78E2C28CFEF01A4C5A305B65992 BENEFICIA7E
59,000,700 *06443265B3C8B0D9076CAFCC30F75ECEE456D84C BESTELNUS
59,000,701 *06452A863BD72CC345174025434CDC6F47C2EAE7 BETRIEBSSTELLEN“
59,000,702 *0649DD497A65B2AE4EF5FC7E8F2634F320BA0E76 bezieldst2
59,000,703 *06490D8F898608ABC0EF10769CC7529DE6EBC71C bgj$p
59,000,704 *064FFF687B64CD36CE6118D5EA795B50B7C924D0 BGPPR
59,000,705 *06495A68881C8168C876867359E9503F9A36251A bhhx"
59,000,706 *06477F56D25746C97201BEFFCD20D8A5C574DD0A BHLDI
59,000,707 *06463D34A300D5E3BE1FC8CF51479F5BC5A701CA bld5193
59,000,708 *0640CB528364EFD923A2F82629E1BBBA1E3EFADB BluesWayDownThere
59,000,709 *064F7B667113071B3B98ECFDB225B0A5907731C5 B-->~~~)o(
59,000,710 *0646BEBFB2A5CE59A6CEB7A7C852E5DF8A889725 BOBCATREYNOLDS
59,000,711 *0646B0A42C93898511C0A0266CB8E8F84A640C6C boomlet
59,000,712 *06400C7FD9D4AEA3FBE53E024B0575841C7E08ED B%P5R
59,000,713 *0642F724D1667308C7A6EE68D745472EA2CB07C1 BRAIN.DELSORDO
59,000,714 *06441F0788ECBB5AD47C2AB581166F77E6A8A980 BRANDEN070
59,000,715 *06415AE8F1AEB57C8865B99521A832A97614AD27 broken leg hours
59,000,716 *064241019DB89079C249EF2EE51A977629015554 brownuniversityvartangregorianquad
59,000,717 *0646ED95AFD50AAB4C0D7F79B6B26F0439FF3CF6 BRUNSONBOBBY1
59,000,718 *0644EAB72B67ADB334B436C7E3FA34F408EED08A [email protected]
59,000,719 *064412BC48013D3D3B889232341D09CF539ADD18 BSSPM
59,000,720 *064B6190B9A6A72A3C2DBE2590B8C12A0BB017F0 BTVLA
59,000,721 *064D8434A5E9B1A274D09001A9DA62D14DABA2FC BULAALUB0
59,000,722 *0648F08F7874C28C423E1FBAB0EB1E6F285495EB BULGARIA-GOV-STUB
59,000,723 *064176640CD78A9417A89D1B282C053C0E75CBDD b,v74
59,000,724 *0645553BDF85AEACBDF49DAA07FD2BAA86C8446A bv%)9
59,000,725 *0644BD04137DF72372ADA3155FD0BCBFFE0955DE BvAE
59,000,726 *064EC328F8C912B0EF281D4A59D705DE1554E028 bz?.s
59,000,727 *064EA12BDC747E283E27AB2D1FBB46614DA0E3FB C3GQP
59,000,728 *0647CE2EA25DD90DE0CA4FCD2ED45454FE0FE5E6 C6N1(
59,000,729 *064A7A7B6733C5214065B68D5274C5A425F8C99F c7hgx
59,000,730 *06487EC094494D272733AE2BE6A549739E41180F ca1umna+ed
59,000,731 *064946AD1BB12C997A08988A8D4C7C0B960E74F6 C_AB/
59,000,732 *06444C9CFAA8DD61A0C6870659E7728ACD455118 [email protected]
59,000,733 *064E65CBEE96EB6997BFBAE81B1432225F1B9BD9 camille-wint
59,000,734 *064152EF0BAFF46445E7E298F47805B3C6D770EF CANSTICK8
59,000,735 *064720E429D14B2DB3A119EB1E0F3663E166372A CARLHJELM
59,000,736 *0645010B48091C148E1BA7D9C6531217835B1308 [email protected]
59,000,737 *06413FF5F6A9C71C0BEC42330E65E42E0D690EA4 carlpanda1
59,000,738 *06414DE03EA2823C65C73E871C8EB8265538FE81 CARSON.WANKER
59,000,739 *06462574A2E248684AC9821C61BBB6E5A3E3B393 [email protected]
59,000,740 *064F909D20D014B0C0FF8EB4327DD82AF93D7180 CATALINADRIAN
59,000,741 *06489530C08A897A9327B7234B9F997CCAE98701 CATEGORIES32CHIMNEYS
59,000,742 *06406AB053E919DE04DBA6FEF26FE2934B51CFD6 CATEGORYMENS_MUSICAL
59,000,743 *06411786A069FB6DAD3935D2432B1BC0DA845314 CA=WE
59,000,744 *0645CA3E52EC7E4380CB2C561E628099FE313B48 ce31h
59,000,745 *064B905FFAE8D2D4AA16320EF1C7C8FF203F66F9 CERA7O7HECAL
59,000,746 *0642F48C209DFF25A37D8F74601F7298538B09E1 CERPTION
59,000,747 *06445CBF58CDAAF4880B3926669E57380EE310DD ce_wm
59,000,748 *0647635D092FF8BF31E292FFBA73D9E6C1AF7F5D CgcV
59,000,749 *0648832A5FEBCDAB7D81DAF7A8CCDCF2DDEBEBC7 [email protected]
59,000,750 *064EDF41A8D635160FE0E72062BCD80D86B2AE9E CHARLESBROWNER
59,000,751 *064CF50D7DFFA328EE2F3F734D1B3CCE51183E3E [email protected]
59,000,752 *0645A96C126EE84EEB5DFE7B5588320541DDB228 CHENELLE-WRIGHT
59,000,753 *064F18BB109AAC31A28291780507D47BB66C282E CHINESE-BUILDIN
59,000,754 *064A8FE2EF0445A1830681C071633FA177E0845A CHUPAS07
59,000,755 *0648404D673F0ABC68EB7CF77BC6B641366BB587 c/i9t
59,000,756 *064BDB109232E4D34E058E6FA93ABCAEA89846D9 CIGAL413
59,000,757 *064161B05C0731CAEB6BFA4B81BA764668DE1017 c"ke$
59,000,758 *064F4E7ED4AD5102B09E74CDDAFE2B99CEF7A029 CL.1K
59,000,759 *0643C92CCC2AC326452A5FAF65EA59A4EA6B0549 CLAUDIAAAAAAA
59,000,760 *06429245253C130763423BCAAB66FDF4D5AF63FE CLAUDIOLOUWAGIE
59,000,761 *0648FD060210CB684D18E6A6A0FBF68EF2196E39 cle4nup5
59,000,762 *06477D80249F32FBE8833A3114C1AEA33BE6AB64 CLINT.CLEPPER
59,000,763 *064714AD6172B5B71A60827C1474847C967BB2A0 CLONGX
59,000,764 *064C81C20F1DCB9999403B935EEE3B3A752011EC clyau
59,000,765 *064692196148117FC3AE95FFEB60521E52EEF912 C)n;
59,000,766 *06409D7D57462B297655F2BD663AF5E39CFF917A c)n84
59,000,767 *064AEA1402D65BF5D31A73824E82E98FB8E8D971 cne?0
59,000,768 *0647DB07245947DF4B4BB1A8CE500AEB52FB0816 cody.peugh
59,000,769 *064F07C1EF6505301D139B2D14A50B54F375CB2F colemanalhusseini
59,000,770 *0647E1CCA54AFBEAE740CE938DC4E9C092240056 COLONIZACION DE SIERRA MORENA Y ANDALUCIA
59,000,771 *0642E05300FD4FA3525E571E22077DB5871EBBB5 columbusequiluz
59,000,772 *0641C1AE709A0486E593B6E26B5566A3A727B551 [email protected]
59,000,773 *064D67B22BA2B8752D8A28C3DF166B558E88DE92 COMETBUSTIM
59,000,774 *064EE3D1EDC4D33C25CB25405973C3900BB85A53 CONCURSULUI1
59,000,775 *06477A0BE774EEB98B1BE6B9AD3014426E8C372C CONSTANT-MODULUS
59,000,776 *064573F276FB8DF69E60B100C2BEF7E89E6C0BE2 coutumezed
59,000,777 *064E7AD2191342D91830B0E1A21FDD6E9DDC29E5 CP8g
59,000,778 *064ECCEE9F1D53F6019A2E72B962026302B30019 c?q,8
59,000,779 *064F005F510A8B0741F3C5D1E169EB4196977DA3 cqbr_
59,000,780 *064115BF6664172A9FC203D805A8735B58E1B722 cq.uv
59,000,781 *064E3328D629699F234270BC14755EF01F3A0535 C&R-G
59,000,782 *064590A903D9A26EF37387060EC435D3872C6619 CSB.P
59,000,783 *06410B5799BA87A2E34C1B0583FE57796DD6FAD0 CURT.MCINTOSH
59,000,784 *0643A812C5CA639187569D977464C004C33512A0 CWASHINGTN
59,000,785 *0643BF9B122188A6D8DB536F5871228B25917DDE C:\WINDOWS\SYSTEM32\DLLCACHE\RUNONCE.EXE
59,000,786 *0644882A02DBB30AA14CE3A9D692E64755F83A77 cya%r
59,000,787 *06464EC66F8BCDFBF8B17DCF423695D383CF6721 D2SMG
59,000,788 *064FA2E0227C3C982E02E09B6DDBDE96398ADA2B d7ee
59,000,789 *064F5DE2BD397CE9C36039E6612F3A677BFFC783 DAN COMM
59,000,790 *064CABDA9A64287C7A6953CF772A9BA68E69F16B DAQV
59,000,791 *0647BD7C0F621D47E46467A3E3318FBCFB22AAA7 DARKONINKOVIC
59,000,792 *064AF1CBD4ABB1DD099628F04305C404A9FCF431 darnellchallacombe
59,000,793 *064C0FEE3FFAE9DF3A8A494DADA17C3FB8029604 DARRENANNIS
59,000,794 *064861FF2E41AFD829F2EC77500B042FC27E7C65 DARRENBROCH
59,000,795 *064E624AC52BB597C85AF74B11CB204E42654AE9 DARYL.JOU
59,000,796 *06472B61F5DFF2D629357CAAB30CF013C157CD5F DAS.ERWACHEN.22
59,000,797 *0647338FCD68D191AE14DD1104F9D8ED631BA8DA DAVEBOSH
59,000,798 *06497D493779006A1A36B7024C959A7F6A9EE467 db537
59,000,799 *0641AA6484109BFD033C325590F883FE73A10E55 DB.H8
59,000,800 *06497E9DE817FF56C3536362A0B7F366587FA4E8 dc.om
59,000,801 *064FECDAD37CE345B57568938BE027777039F967 DEBÜTRUNDE
59,000,802 *064D10DBD77F582AA7B692873E482D57E4ACACAE DEFECTIEF5
59,000,803 *06450A67E79A3D80E02DE3716C12E1D25FA0A0DC d’eidos
59,000,804 *064FBBAA1AD18B542ED5C31591C1CB1B78A7BA4C DEOSI1
59,000,805 *06469B6ACBAA480374D6AE731CF9C0DAB57C1BFF DESHAWNMERONE
59,000,806 *064F1F889C3E2666FD2F79B6FCBF34F079BAD5DD detroithouse
59,000,807 *0648546C0AB88D55EBD30FEA036BC48CEE3C5AAF DF8PX
59,000,808 *0646F7D3B2191F945FF40167E361C21EFAE2FE0A DFP1M
59,000,809 *064FDD1F84E2815DE68D443FB4E27E48557CD554 DH7VC
59,000,810 *0648314AE80C319AD93FFB7574EFBDF3428B6630 DI;+6
59,000,811 *064AA9942BD0AF4E090FF03B047EE456CFB2FA79 DJCV1
59,000,812 *0648238C90869E47275EF5E5E2876F224E213D45 DJ_SI
59,000,813 *06422DE9A87F4CAC25425D3C0DC0957F2A3DDC6F dkcm1
59,000,814 *0642C5309D4BBE6783B4B37DEEB4C069441B2446 DODFR
59,000,815 *0649CCD6846F8A17BF6F85422DD876D10DAEDA88 DOLRDOLA
59,000,816 *064FACB092391C333DE3836263668AC7ADC640B7 DONALDFUOCO
59,000,817 *0647538F979BEA6BE35010320FDE93AECC4E2509 dongmatsoukas
59,000,818 *0643829EC850722705B5BACC1668A34A57F67D4D DONREZNIK
59,000,819 *064842344E28509AB4D00FD896043C603E983574 DONYELL.KELLY
59,000,820 *064A09A0AAAC66D39390ED33649A8B1B92A732C7 DOPLACALI3
59,000,821 *064C2488324E64666397442F9F88D48ED02A7835 DOZDRZEC
59,000,822 *06491926A663A7DB391EE702A0B4990DE6393D18 DP;Y.
59,000,823 *06458CCBC8FAA47C4CCCBFE710C2B2914333BB02 d";r
59,000,824 *064E9D99A141F54356FF074D6E11E12D460CCC0C dresdnerbahnhof
59,000,825 *06453CA0E39D23A40A060300D78C48DA8312DB21 [email protected]
59,000,826 *06441574B7AA2600EA8E4602EC72E642D1AAAAF1 d:rkm
59,000,827 *0643C9A8E7014CCA0329A9725A055DD04BE195BE DRUKBEZET
59,000,828 *0641B05FD7A9115E2D606E0CD642BA95C25F788D DUG_
59,000,829 *0645B18AF2F9A865A0083C8832A57EA1049601AF dup5;
59,000,830 *06444D2483C7F6732AA0601148010CF6A730A6B0 DUSTINAULL
59,000,831 *0645357A12CD50FC78B2F3739403568292D13AAA DWAIN.WALLEY
59,000,832 *06462F3D86556E90977DB9F4DF77FDD4BE06AFFF DWn2
59,000,833 *0647BB0F36420926AF09E1DE371158ABA23D37EF ea+mg
59,000,834 *064D527C429452293203EE4119392BCC3732DA25 ECQ#
59,000,835 *0647DE171EE355CA1C13B3060BDE2D31CDA95F38 EDUARDO.OUN
59,000,836 *06473645FE1090922C462DBA391160125799E6C1 EDWARD.NITTLER
59,000,837 *064F22243BB72EFADAA40FC97001728A5CDA91EF ef62w
59,000,838 *06494A96D4EACE9D365D0267EA043C2222FC1E14 EFFUNGIA5
59,000,839 *0649F09E48E65F2B428521C53A22B9D68CD7B27F EHCASMROF6
59,000,840 *06443664AD4E19977AE792E5BEDA5A790C7104B2 eirertiv5
59,000,841 *0646FB60304759D5AD7D160C07E8F75E203E6431 [email protected]
59,000,842 *06495E102A6BDAC0EC9BA66788410227AC6DF57B ELECTRIC..
59,000,843 *064C29AF38FC4A54D8BE585A073EC4EB7E728B5B elijahyorkey
59,000,844 *064AB26A3DE618AE0A1E1D8E113DDAA358D8C7E9 elliotschermerhorn
59,000,845 *06462F97EE540D485C56CFFDA616DECC421A1709 ELLSWORTH.DOUTY
59,000,846 *064312F9362785AB7D5F63E8D17B76118D9685E3 ELLSWORTH.FLAUM
59,000,847 *0642B22D476D7BC2D0A1CFC2990DBA2E34BB7733 ELMER.NORBY
59,000,848 *064774AA8A1AA9033BA37F2DB72754304B352D1E ELo1
59,000,849 *064B475686022E5D1B40A7BFD621816A0DB4D00A ELTON.WALVATNE
59,000,850 *06447DA8E9EBF15891CBD6BCFC8357365FFA1FAA E-MAILSTIMPY
59,000,851 *06406B818A7A788790865A671ECD1E933E78006E EN20844784
59,000,852 *0647592A41D97578E42FAC00C79E92965328919D en;av
59,000,853 *064B0EFC93880317B2861D0A6A6F7D8AD856026D endirke0
59,000,854 *064A49B188E2A2B245ACB13624A4BA4FF36FA83C eocypraea
59,000,855 *06484174870F98028D9337A3BEBC019E9ED9F83B ERNIEDSOUZA
59,000,856 *06419534AC9C47E5127C28D9AD6A9D9D95340AB9 ERVINREPKO
59,000,857 *06468B1D593341B1B85E7F8FA5774AFDE80AA7DA ERWIN.SAMOSIR
59,000,858 *06445692BB83BE5C7483DF63039165EEB555C08C ES06M
59,000,859 *064ACA0F623CDABADD1DB976DF17305BA3093302 EUTHYMIES
59,000,860 *06422AF06D298E43856DC2869DAF65704CBF4E74 eyv3b
59,000,861 *064C423D51B59F9679DF55E097B98A5ECAF16F01 f68a48bf6c52371ca5276b6a0fc43f07
59,000,862 *064ED4AC79C0AD0B46D1A7395930D98CD04456D8 FAAAAAQAAJ
59,000,863 *064C12F93A506A4BEC40F742D9E1C7CB340EC207 FATFREE4
59,000,864 *0648FA34FFE868A06E9555B043B4F1DB36CFF8DC [email protected]
59,000,865 *0647BE0447C20F883206DE7C483BAB7E64A157F8 $FILIA+E
59,000,866 *0641996D1390740A9BA2513A660FC94EE7DCC591 flightofthebumblebee(rimskikorsakov)
59,000,867 *06453F28529D802095181D3394572D8578F9B9EB FORCE、アフガニスタン国軍航空隊より改編)の2つの軍事組織が存在する。
59,000,868 *0644ED915131DF94A53D681DF8B74362173AC155 FORESTSIRON
59,000,869 *064F6326E49CDA19988A259EF803C0669E2474AE FORKITUNDER
59,000,870 *06435148BD329306A783EF201C03FDF8E5829C40 FRANKLIN.JANOS
59,000,871 *06474AE25D7636361FF0EEB7D7B45D8F768F8759 FRANK'S PLACE 2 (INTERLUDE)
59,000,872 *064E02FCBC0B65C38C64321194D9D59F48C00DA9 FREEMAN.ALTRINGER
59,000,873 *0647B74AAFAFFDE314A8A03D735FFA82B659BDF6 FSTACIE
59,000,874 *0640843F1C72FE7B33A4694AC698132106E82AE2 [email protected]
59,000,875 *06480F5655E360CB702BFD774FB1EBCF5E40BEA1 gableroofeda
59,000,876 *064593DC57F6FA390A71494B5098F4C0196739E5 ga>j
59,000,877 *064AC4A4A249FD86BA9391100F0C3712E58ADD53 GANKZ0UE4
59,000,878 *06408145ECF91CA555BDE9EB7CFE39FAF99A4CD9 geraldopanagoulias
59,000,879 *06447713A9B634A66A78327D0D2CBC7A61E415ED GERTRUDE12345
59,000,880 *0646E3CECA5968AD40634581310BDAD48786AABC GETARWET
59,000,881 *064DA46E1C4C40F6BF21CDE15BD561D4FCF9528A GIUSEPPE.JANKINS
59,000,882 *064FD423725FB89D356BFF6E6C8D2635AB3F65E2 GOD-BLESS-THE-BROKEN-ROAD-(FEAT-RASCAL-FLATTS)
59,000,883 *064441752730EC4543A56DB253A696525FB7A3DF GOODELLBSW
59,000,884 *06405AA25F08BFE353076E1EC1465FF0A876DA26 [email protected]
59,000,885 *06472AF17636EDEC6C7DB702C54E03B7F7C6742A gradylapage
59,000,886 *0645968AA8DB616CF72F9290FB2E01DB7435C0B0 grahamhawksworth
59,000,887 *064ECE2958799C8CE1AD27F3F43BFF3F484E51F9 GREBORNETH
59,000,888 *064BACAE93ED21F110792579987E87F453C7A0D6 [email protected]
59,000,889 *064B9045385C65947F22AB2077A3876EA760D868 GRUFFNESS
59,000,890 *06437441AE86C921072A06AC89A717C090C75926 gum3l4st
59,000,891 *06462BBE5BB4924E2A6E0CF8D247DC8BA37F1C9F G<WV
59,000,892 *064934718655F513C2017225E3A6ACA3B19BC921 HAEMORRHOID0
59,000,893 *064EF0B0953CD43973A1270CA75A06DE6E6FC26D HAPPY-DRIVERS
59,000,894 *0647F4BECDA5E31D879BDA71E15BBC6806EAD592 HARNEYSED
59,000,895 *064FAB0ABA01AD91837EF744D9255F6DC2757222 HARUSPICATE
59,000,896 *064A2D74A31E69D9496E522BCF7408ACA491EA5E hcsramsp0
59,000,897 *064E55EA1DB86BB13C168D6FD5520D694563D936 hectorzilka
59,000,898 *064DACAB24C70D9991E937FFAF64F3D757A999EC herschelbraseth
59,000,899 *064C3DF3D80A4563960B741A2BD8435F324B53EA HERSCHELCONDRON
59,000,900 *064234AAA4FCEEA05246E4602B46BECD4475C690 hershelbudish
59,000,901 *0640FF26556F70DF1C7B92DB88E1AAAF12F114A0 HILARIOFERET
59,000,902 *06420D3BF9B72010C181934C48EA52D4F9C3F7E0 HIPOLITO.CHITTY
59,000,903 *064D0084229803270EF8931898F9F9D5C2032BE5 HIPOLITO.GRUEBER
59,000,904 *0640952704E44B9BED2FF1E39B9230FB0D06A0E4 hiramgoral
59,000,905 *064C70890B1605F5CEEBCF157C3CDDD50F0879AB hok_
59,000,906 *064AF3387395457B6489BF2F6C44C2FB3AB1DCB5 HOMER.LAFLIN
59,000,907 *064382688A304020C90C21528991C43BAE9C2E64 [email protected]
59,000,908 *064FFD34265D939E710A83CD60AA3F13F1CA1ACD [email protected]
59,000,909 *06456181B1F1106BA625E960702E63BFBEBDAFF0 HOUSTONLARRIVEE
59,000,910 *064D23B4BE86C1F8B781E566B6CC004E21963213 HOWARD.HYUN
59,000,911 *0648FD63168CA70B1DB839AA43A256A977491052 ht0
59,000,912 *0644A3C2C12B71A0301C95F6D6F1836F2989B020 IAMMOM51
59,000,913 *064A91ECF5D06465C1330A0737A5BF8092518D3B %I,BAA
59,000,914 *06436D74D0E7A40A50B6D7F286FB760D197EA742 icare
59,000,915 *064150175792BEA3957EADE8E778D94308B4E404 IHDINANU6
59,000,916 *064012DB952E2CB65ECA375CE6B3FE813A2E04EA iinarawa1
59,000,917 *064B0B81218A11C391A363CD7E4C021C3F8C6E66 [email protected]
59,000,918 *064D1EE1725BFC976DFF6D8BA7196F8E4CFF220E INTERVARIES
59,000,919 *064F2DD8EDE66E7432311F4A35D587E1F148C1FD INTSITATIIVI
59,000,920 *064A85B7FF3F71B9A7FEDEFCB20590C23486283D IO:F
59,000,921 *06439CB44E25AA052EDAA2E8B1B6CB711A338C5F IPRASTOS5
59,000,922 *06466513E999F9DDA0567FC6764B855E16CC7C4E IRONPIERED
59,000,923 *064BB5135FC210AE79D2E8785B65E2E947A4ADA9 ISIAHHEMA
59,000,924 *0647582CEDCAA8AAD06F9D2832461C57E33D2F7F isidrowrighton
59,000,925 *0641F741942FDDECFF2C05AEE5D0E6BA547C4809 ivanrehfeldt
59,000,926 *064FEBCA3AD2E4619BA575BFB925C10EB4E57C74 iwanntellyou(maceremix)
59,000,927 *06411F8B22127A49E1F15D23A1E705955B40D047 jackiereddinger
59,000,928 *06424BBD4734369DAC441984B4BC64E37EF14162 JAECHOI
59,000,929 *064A832A15341DB323B6A401C5F4F22FCDD4DB76 jamedvorak
59,000,930 *0643334AAE401F06D6B25AF681A5C6E46513CBBC jameslian
59,000,931 *064ADB283D8ADBBAC559464A88ACF289543308F2 jardanes
59,000,932 *064BB21F98D0C57AA435984E6CC3A617E9BC79D9 JAY.BIBBY
59,000,933 *064286BAC390ACA82735F0735200C6FA30E2F4C5 JEAN.BARTLE
59,000,934 *064EAAD2F17E86889BB4618A80A84579CE1D0071 JELASHBRINIC
59,000,935 *06464E6C78E80796EF73338A5804FC5DA0EE97FE jessicawalley
59,000,936 *0645565762F5F7955C8FA33DDBFAD0EFFE299C12 jikokeiying
59,000,937 *06423C4C923EC6F8EA9F146D1BDBCC177C0C2C14 JOBW
59,000,938 *064D04AA8F22044F468BF7A396507E848CAE7F43 [email protected]
59,000,939 *0649483CE789D170100A4C23B323B278A4954FA8 JONASFEUSIER
59,000,940 *064E07CA43B254478CBFEAEB0949B37A64BDAD2A jorgeborsa
59,000,941 *064EEEF23EEFA9E532E972B8E81C96D70F59A4A0 JOSHUAATKIN
59,000,942 *064E46D094E554537CA13E976C254978ACD61C66 joshuasetlock
59,000,943 *064F9A72F47667FECA3F6C8A6F44E37ED94BABAE JOSPEHFANNO
59,000,944 *064DC2A053D1E44BDE5C0DDE2B436A8E4F1EC5F0 JUNGL!3ST
59,000,945 *0648E811C44593B4EB62BC794273252229CA91F8 kapitel 17 - erster tag
59,000,946 *06448F1198B25E2DF37C5D19AE824DF4924C32D3 KARINA.NOVAK
59,000,947 *064C1DCABEE5AA41BF846814FEE3E7AA3126B7CB KARN-PATEL
59,000,948 *064BD56B64E2BA7F1025E30AE754962B43D2C8E6 KARWINSKIA.
59,000,949 *064368231562010EBD28918656B0E4C41E756D64 KENETH.MELLAS
59,000,950 *06499916215C95507A72507A9A0C6A675FBAFB0D KENNETH WEBBER
59,000,951 *064325D26CC670EB889DC8B588CBC76F52DD5504 kentencarnacion
59,000,952 *064FD33F1BA782B6A7AB288050B61C5B5206DAAE k[h
59,000,953 *064C2F756954E05103522521CD3E0EED6E5408BB klariz-natanauan
59,000,954 *064AE8B3449B63D44BB0212AA38DCE34FDD81314 [email protected]@CS
59,000,955 *06427A2DD3F5399E2C2B01FFCEC4CF311E5E8BB0 klipperelief
59,000,956 *06487512355D04996013DDB2BB800E0B56F1BE00 KONSUMEL2
59,000,957 *064C879669D9075B03A703CDF3D498A2BC78A393 KRAJECR1960
59,000,958 *064B258B35129B80AE623820F5CFDDBC05E43AF5 KRISNOVF
59,000,959 *064476E7B5E54DE1722FD0DD297F62EF549C13CA krkgzngn7
59,000,960 *0648690C29F030BDACE1952A08EE964798CB2671 LAEMNROC8
59,000,961 *064C9F53638B6DA7A519C7E97CBD77A1B4292660 lee-felch
59,000,962 *06446EBBFE6375960EF056EA09CFE9CC01F20384 lehold-up(ouverture)
59,000,963 *0649208CA4457B256AA680B9EE9744D7EB19A924 LEONELGLASSING
59,000,964 *0640CC848D1405AB4ADC11B1E265AAAE5FC7D1BD LEPYNGE4
59,000,965 *064C166920E67D08D3298E4D9A40FC872E9E8810 LESLEY.INGUARDSEN
59,000,966 *064CF716FC39B8DFF7ECA1D3E41D7254BDCE86E7 libbyfollowed
59,000,967 *064B7979FF8489537C96C3A7346736029DE351D8 LICHUNQIU
59,000,968 *064F2687FFEA569605688789E79839463926A977 linda.mackintosh
59,000,969 *064CBA9AD20F027A9444BB26DAC558C588AA5F7F LINDSEY.VANDENBRINK
59,000,970 *06499250DFE182E1C66E82B4514C3F54FE6E9D62 [email protected]
59,000,971 *064E9E090094936EC2D3F100D90F429D42BCB5B4 lithaneâ
59,000,972 *064E3820A72917DF98AC0DCC03D9471FA9D7322E LONNIEREDDIC
59,000,973 *064EF87F37BD6AADFE73199B7643D2F863CC2372 luislabruzzo
59,000,974 *064DA630ADE69128935DF0C6DCE8C3B92DFD6CB6 lupeguitterez
59,000,975 *064FD11722B826C91D19CE92A1A2BE356832407B MAARHABATEIN
59,000,976 *064218950CCE27AEABCE4B1AFE7975CBCAD7C3AE MA'C
59,000,977 *0649299C0BBC19441AC7E4D68DBA721FB3B5C7C0 MALIKCAUFIELD
59,000,978 *064FF1CAAD4FC2EA9DA9F30521C506849B45811B mamaundpapaihrhochzeitstag
59,000,979 *064926842178AA9B8EB361A547CA008AC9D11588 MARATHONBEIJING
59,000,980 *064CCD7759209FB7A273144F91F27EAFC70896FE mariammaidin
59,000,981 *064E143E7ADA52A05EDD446CFA8A5C9AF80F79FD MARINAALFONS
59,000,982 *0649B064124490831330F6D25FFF0E6E2017194F MARINOABCD1234
59,000,983 *06455164E309B30A3C55AB0CE90773A18552F9BE martials
59,000,984 *064DC3EF1EE69CA4FA103216D9804B8714352417 mathewmcinerney
59,000,985 *0645DF015EA1846CAC87EF2B67C296CD48E982EA mccielo
59,000,986 *064DCE90DC2E5B7846FCDB7FBF38994AC4F43737 MELISSA RABER
59,000,987 *064AE47496C40CFE4C3FBE8F6540B5DE70B90298 melody-of-war-(feat-wayne-marshall)
59,000,988 *0644E8D0B5AE52785D2D205EFB3A4E02A474E6FB ME.VOY.A.MARCHAR
59,000,989 *064287FDD89DB1B19BD78BAC2CB22F0163E86741 michelle.padiernos
59,000,990 *0641D4ED050E5DB4546D06C7B07F51F56F635F35 miguelwidner
59,000,991 *064CCCBE608244FE07E82B9899ACD4C2EEBE0937 MIHAELA_SANDU78
59,000,992 *064CE3726CC1C12EAECCC37310AA6B6D22517CD1 MIKEMARZELLI
59,000,993 *064BC568A9663C4BC3F7B53B6D3277370AE08F85 MILLERCO
59,000,994 *0645ED0533D3F82D50BAB40CC2ECF210D63DCB92 MINISTERTAL
59,000,995 *064CB2BC40609A2BE33C0ED80B2CC7366EB0D3E0 MITES0204
59,000,996 *064CB5FA501664785EE75CA073B888F54D1C1F1E MONACO–UNITED
59,000,997 *0641F61E15F27945CE3D554AFD3222077E0FEE0D MORSDITED
59,000,998 *064A34B47C4AF47FB3E9FCA26ECD74757C7C7629 MOTPUNKTEN
59,000,999 *0645C4EC62BDF14D4CABDC9474C9EECA13495599 m#rw
59,001,000 *064567966454321C32163CE0A17B9B6F6FA34B7A MYHUDSON27
59,001,001 *06480A96A6CAFA274CBF737C30FECC2D7FCB236E NADA GHAWI
59,001,002 *0643E70B47233E4723E17CEE313C7C8F2CAD283E NATURAIDOGSAREBAD
59,001,003 *0648AAF6DCA085528070D90399024FF9C504CAC7 NATURALEZADESANTALUC
59,001,004 *064041F6DC4069DDFDEC98C4E5E06013266C02E4 newsreadern
59,001,005 *06451D3E3D9F782370E21E9F25339D6E05A48362 NĚŽNEJE
59,001,006 *0645106680787842C8E6B10EE5E11A17172CBDE0 [email protected]
59,001,007 *06478E9ED2720F9B157F988BC787AAA4D2889DCB NIOKIAP5
59,001,008 *0641E1E900B1FC3B743A712FE0C7F661ACD4A4B8 NOBLERENTIE
59,001,009 *0647F012F7BCDDB77A86F91515BDA2F6E6289941 NOESHURTZ
59,001,010 *064D7364672D20F20872614EEC717AF550C96F86 NONFICTION』、アルバム『D
59,001,011 *0644578C37FAFAF3645CE0FDD74564E75F6B7100 normandjunker
59,001,012 *064A35F2916622EB4E5385A25A8EE7D9FFAF0DC7 NORMAN.ROSENZWEIG
59,001,013 *06423DB17B03FAADF74ED5AE5782681D5B4080F6 nortsac0
59,001,014 *0643B50A703D82387B6D02635DB27B162C93DDBC NSRRCTNL9
59,001,015 *064BB2E0BC6DD23D34A755502655F244B4ECFDC9 NTSVH3BC
59,001,016 *064A4929292D09BAEBE4E74BA3E1C1068F03A7AA nudeness
59,001,017 *06421A22F12FB620CCDC4225E554ED978A51F45A ODSYSACZ
59,001,018 *064AEACA409C746AB7D22009F766CD93F036A0CC oobushi9
59,001,019 *064A40AFD78FD85ACF13F513E687972C73471C40 OQ'H
59,001,020 *0644D65553658A95822034DD4B21D139EF31F627 OTHELLO SMITH
59,001,021 *064573CF720D0C217F5698C94219D02E19737141 OTOHPOREA
59,001,022 *0642EBE4454AD52E1B5D73499EBA93FEE5E6C9A1 OVERTROK0
59,001,023 *064838AB9E58551DD6946A5C15339402BEC5447A P-->-~0
59,001,024 *064CE5CF4C42805E578AF6E9CDF75123243F66A7 P02161837650
59,001,025 *064E4D7632B8B4B9E9CDCA69D094EFE99C9463AA P6DF
59,001,026 *064FBE34E3075F6971177EF298A2B7B6A802F43A paladinsaskia
59,001,027 *064521E5ADB922023D81CE675C3B096DF0415DAB PARODIARIAM123
59,001,028 *06443816A13C17992EFF5519E8281793F9AE47C5 PASNIEDZEJS
59,001,029 *064324037B0D3119061BE0B255282A92EDAA8C27 paulcorkum
59,001,030 *0640772AE86D4E7D49C65DB5E40A03FACC2EB6BB PEATÜKK
59,001,031 *0641EA601B69C84348E98C95C5892B98BF3EFC33 PEOPLE<BR
59,001,032 *064C4DD0109A7899647D00C37959F0CF7A2EA3BC perez-parra
59,001,033 *064BF550CFF445E672115F4868F6965FFC1EA77F peterphilson
59,001,034 *06423220ABCE413920B806DF9AE82C9FEFED126A POLUSHM3
59,001,035 *064B0D30E880923514F996808053E5BE72F7FDF7 P-->~O.~O.3B<-
59,001,036 *064555B73DCEEE4CEB1E09F842C2C8C96BD97A50 POPLYDEN7
59,001,037 *064F971A0A6F78DE51B85D1C4276E9B64D0C91FE p###p-~0-~o-3b<-
59,001,038 *064F20B3302FCE2FE9E616F2C6F3D8B3352DAFDA P###P-~0(x)
59,001,039 *0642CB8610ACD4F379CA548B1625CDBDF203BF60 pqcb
59,001,040 *064BB17501BF0C8FEE241D4754CE2B92895714C5 PRIYANKARAORANE
59,001,041 *0642FF226D357EFE03AF1F7E5E4E074D517EF063 [email protected]*.*.*(>_0)
59,001,042 *064B78CA01DEAD9EA113A2B434B2013411B1F06B *-*Q#3
59,001,043 *064A575F697CE243744B18AEDFD8BEC6ADFE5763 ><.~.~.qb
59,001,044 *06466283F73DC84F514A7D0C18E805FC68E333ED Q>~.~SPLAT!
59,001,045 *0648FA7FF54707629E604097DD5B4AA0246B4363 QUINCY.RORICK
59,001,046 *064A79FB5773A63957BCDAA629639C746DA40CE4 quintonaldredge
59,001,047 *064922A1DE6D21AC622C58D3CB6D1CFF1303538F QWHO
59,001,048 *0640434DE923E66113E7B19E73488CE3102858D4 RANDY.MAINER
59,001,049 *064E897B1D706DDD81455D4CD46D891D4F02D8D2 ranos(featunhoel
59,001,050 *064BC43F4F4721461764A5166EC80BCC64B43D2E r cello nr 5 c-moll, bwv 1011: iii courante
59,001,051 *06447D70CC27C0AC802383DA7E376518810588D3 reedcomm6
59,001,052 *064BD4356871A7468DF155274C20FABE86DF2380 REMODELLERS0
59,001,053 *06444135852627E25BAA6B37EA0FE71B259ADE7E [email protected]
59,001,054 *0641F46A39AAC2BAE4465B2B7EA32E6630EFCD60 RENE.NOMMAY
59,001,055 *0641E46BEF16BA6A12591CF2BFF4ED0FFA3E2816 RESSAISIRAING
59,001,056 *0645C21BF029A736C37FCA2B687267238197A6C8 RETARERIONS4
59,001,057 *0643F682735A7C907E6C74DFF4FBF207CB3AE3C5 REVEKROOB6
59,001,058 *064589E929AEF00D86A4CC2BFA0F2D6D1539785C REWRITINGTOO
59,001,059 *0642817F9819478CCF0B5E8DD1A134C091606BE1 REYNOLDSBENNIED
59,001,060 *06491968122A3C656ABEE53C3D04EA25CDF5D387 RGR%
59,001,061 *0641C5CD062A9C8BF456B9DC1EE3B713E10497F4 richardhollberg
59,001,062 *0646A734CD9A1220725682E35E45D7AC6CF53A9A RIDE-OUT-THE-STORM
59,001,063 *064947271EB7E2F81C37415F63933B7CB4CAC810 RIPULIRAI
59,001,064 *0642F2E6A9BC6D2002D8CF6A02681355A3507756 ROBBIEPLEASE8
59,001,065 *0642CB9799A9A87E8C62F6BDBF793F141C24D54F ROBERT.BRIMAGE
59,001,066 *064AC84CA7A7B87D12C805C3DD7E4615E7ACEDE5 ROBERTDANILA
59,001,067 *064C2691941C5FCF1EDD4685E948993D49E0EA30 ROBTIMME
59,001,068 *064A229D34794ED350CA85F5339D853B895D9073 RODENT22HAPPY
59,001,069 *06446BD1C902B0968D960FCA10906F57A7381485 RODGER.BATREZ
59,001,070 *064CFDFB972FB9E614DB0E75680407FACBED1938 ROEDERES4
59,001,071 *064ACBD39AA5AC9F475BD2460C713E1975BFDE7B ROOMALAISEN8
59,001,072 *0647BC40CCACA272A1DDEDFA8E0CF5D9C9AAF20B ROSCOE.HOIVIK
59,001,073 *064A8AD764605788EF7A91A3305B9AFC59884A5C rosendojarnutowski
59,001,074 *0647AA7FDF354148F4D56AD00C4C126D3A664719 RRM8
59,001,075 *06406D994BD936076ECD7E0073BD87E424926166 rs-sonalsorises
59,001,076 *064FB78E33DF3B66533664160E73C532A98F1C16 RUCKGEL9
59,001,077 *064EC5BDDB64F0BEECE7C41A706A4601CD1954ED RUDESPOKENRU6
59,001,078 *06444BE7830897FB675DD4D43067FBD99C7C41C4 RUDOLPH.SINHA
59,001,079 *06495A4542110601CE5693F1FC147E41A1C0EA5A [email protected]
59,001,080 *064830BA0CF44F8E85333645079988688D4F5506 rutgaz
59,001,081 *0644E7FCFAD4AB22F33D3DEB9EE52862513ED172 rx115
59,001,082 *0642F6E304E205314B9C0EB64211273A46CFAF0D S2379
59,001,083 *064EF1FFFF825E0E58405CDF119D75C5CFD2DFC2 [email protected]
59,001,084 *0643F7408EA541C2EFD70ABB713EF2FF8BC6892F SCHIARO4
59,001,085 *06492A63D9E71CBB7A4F7E28D86C7F63774054D4 [email protected]
59,001,086 *0648F37D5A34B3918005D6B250AE6C85278CB74D scottiegullung
59,001,087 *064A8C913079D21BC98D513B801AC3CF8EEF2187 SCOTTPOLTER
59,001,088 *0643E1E2ED672C5461C463078C263A3360F2659D scruffyfender
59,001,089 *064841FA09753C358E91EE6E48281FC07E274409 SEIBUTUB4
59,001,090 *0645E81C6AC831C0C1FA62E91A23639880DA7EEB SEVENFOLDNESS2
59,001,091 *0646E938F65F1C19B217579CECC2D4D20E70E3B6 SHARPYSHARPY9
59,001,092 *064EBDAAB5C5C41798DEDB393E8E390EE4EC4059 SHITHEADSTEELERS8
59,001,093 *06478E0CB5A1AABE6351B9CE1DD38C3BF41B5FCC SHON.STEINBACK
59,001,094 *0641783BE5E8A36DC89E90741EDFB085084673A7 [email protected]
59,001,095 *0642BA20259DC3562A4C7B573658241C1F2B4612 sidespiral
59,001,096 *064F659F567D8FDA83A0654905BF93170303D7BF SIMU1A+O
59,001,097 *0640804A7423CE27523CA1BDFC4C66C319086DF8 SINGLES-90-98-(DISC-4)
59,001,098 *0649258F5B24236AB1B82F64D614C12BDF04A595 SJRJESTJED
59,001,099 *064D6EC04AAB87378BE3DF71F1094EB6E47A9C93 [email protected]
59,001,100 *0643BAB793D8FFC8E3DA09E3AE08A3702CECC198 SKIPPERISABELLES
59,001,101 *064E7C52345071AE99890595977FB44CED39C23B SLITTED
59,001,102 *06458EF0AAEA7A8585AC63E991C2B4EDC362DDDA SNOOPDOGSCORPIONING
59,001,103 *064A57515EDC74A72B24D0DAE28237F95024F376 song.and.dance...
59,001,104 *064A1730A7BE5A4FD48D2012D6F5A223254F3130 SONIA SANKAR
59,001,105 *064422AE9445772915E6EAD8C28C6A3E0A79D68D SOUTANE8
59,001,106 *064A6D8F612F2DB2D52AF4CE28DD71721E982EFA SPANNINGSVRIJE5
59,001,107 *06411A24615D3CE034AA4DDFA693743AA40469CA spencertrumpet
59,001,108 *0649ED460B1D1040D88AA18E0B07421E91D02307 starterove
59,001,109 *0649FB79395D28FE6349296022C29FE365E23D63 STEPHEN.DESKO
59,001,110 *0647F8A014F2DB2E7A3345A1AB52CF6679B12C13 STNEMELLIC
59,001,111 *0647D64F609EFE0AC77D9E0ABC869DE563A0604C SUGARCUBESIN
59,001,112 *06499ABCF2B4CBDC684CAD8C6503E84064C88AEC ŠUGARSKI
59,001,113 *06478AF72E7FF5648BA427EF16289137E815477C SUNG.LONSINGER
59,001,114 *06452E1F929DCDD05F58359DF64BBE302C7CA628 SUPARNA-CHATTOPADHYAY
59,001,115 *064DA70CD88C100F2E6742B19A109BD8A3D69FC5 SUPERUMANISTICA
59,001,116 *064A48AD873B2F196CC8ABADBE572612900FA2AE SurlyGirls
59,001,117 *064F876461264D82B815C00AB814DFFD63377136 TAISS1
59,001,118 *064EAD88BEDD6FEA04502FAC0369E1627024A517 TALKNADARHISTORY
59,001,119 *0645588F408DA66F389204BA4E15E9B8C0DE876F TALKPOURKAYVAN
59,001,120 *064A389977EB3D9ACE1B6B78BEB3F23F95E0171F TARAINGRAHAM
59,001,121 *064F4F5FEE1C9A29B06B56DDA3FF0A769531DD28 TATSORYG6
59,001,122 *0648D7AC6EF5EB9C05F92780D38F9695A9936175 [email protected]@[email protected]
59,001,123 *064183AA70484D5089A5B3229F410B1AB8C1D031 TCPHLTY3
59,001,124 *0641B75AD625036234F01E7B95DF359028359479 TEGNTYPES9
59,001,125 *0644595CF3F2EB14C4700D8DA4C363EB0F5E5DC0 telecom26
59,001,126 *0648F9DB28C81370C95AC876637DD53EEED04F14 TEXAS CRESCENT MOON
59,001,127 *0649CB7C90CE30D0B74C531819CD19D68DE58698 TEXNDUET
59,001,128 *06439F12F94B56EBC104DDA91F36EFE4BD03403D TEZCI
59,001,129 *06453D65E98CD3F48D860A0D5C2C1CA0FDE159DD THATGREGORY65
59,001,130 *0649A114ABAF3B06EC25D79E33782B8ECB987492 THEATRES
59,001,131 *064380BB27E452366637D5DAD7C9E279FF10F157 [email protected]#
59,001,132 *064352D9CB53919A65727A95AE16DC447091FDD1 THE.LOVER.THAT.YOU.ARE.(FEAT..ANTOINETTE.ROBERSON)
59,001,133 *06453ABE13A7C888AE72438CDFFC6CA0A7F44A00 the-love-you-never-had
59,001,134 *06462DF2E87E4803B405EA3F7374D2B56682E936 therolat3
59,001,135 *064B4DBB1139F3ABF5FEC8096865BC2102151241 threeplex in'r' voice (ebm remix)
59,001,136 *0640068464463254A8346D85F245BC520C37A96B TIM.WITHEROW
59,001,137 *064A8EBA62888462E33CA129CB58C102AF68B24F TIPTHIDA
59,001,138 *0646E928CC35A3EACBABBA373DC41E0F9365D826 TM94PDVTDNYDYE
59,001,139 *064D6168E9F2D2229A453C2256153FCB8A69DB52 TOLDAMOS3
59,001,140 *06429D65BFFA705DEAD5ADD8AE025925337CB56D toovain4
59,001,141 *0647E7E63BADC0F128A19A06E0169DC4752513A1 traviskljucaric
59,001,142 *0643657AE94A865DC0B5ED285E74B49595AF6564 TRENTWILRIDGE
59,001,143 *0642B6C67D2D814A2F055F4CFA02A0D8D8FD1F3B TRIBULATIES
59,001,144 *064629AE217A6CA4ABB7901514D9E3C2EE7ABD81 tthncs
59,001,145 *064352B6FA58AAF3F4F607037090172118243988 TUMISANG LEHULERE
59,001,146 *06445981CC0E08B051AE4D7C37BD242E0DB63090 twiglit0
59,001,147 *064F589C634B846B6619C63BC54E9BFE0E6723CB U%%-
59,001,148 *0647C83D392C338D5E36BDC4D1547EDB398C1A07 UCSC.2.0
59,001,149 *064B571D71B3FFF7A361F1444F52AC64245AE168 UGAYSANTIAGO
59,001,150 *064252CB341E158BBF8CD00B52AFCE8850C88801 una-nunyabuisness
59,001,151 *064BE9BD62015D0BBDE6397F4CE7F75D53821A96 UNCUT:.DAZED.AND.CONFUSED:.13.GUITAR.GREATS.INCLUDING.JIMMY.PAGE
59,001,152 *06461CE5195656A0401D7781706311E1D4A0F2FE UNDRESSES1
59,001,153 *064756EC5107DB878711AD5EBC0D1E8DBCD51D02 UNQUESTIONABLES0
59,001,154 *064791789C038925D34833F320F682FF20658452 UPKSOKMVSVZ1
59,001,155 *064858A11FB74C4C37A7B804F76A65E0353F6926 usurpera4
59,001,156 *0647DD09D941FFFB744CD564B513B9495356955C VANE2WI2GE
59,001,157 *0647DB2288517F932949CF75C3BF75DB7FC0E1D8 VARMENNETTUJA9
59,001,158 *0648DC43FE1E9B84B0B0C9FACB33A65B633130FB várszínházzal
59,001,159 *0640FE5F5E97AECBDB93D0EFE91C8E6A4A776347 VERNIEUWINGSPROCES0
59,001,160 *064405D0E61E3CDC8F237B6E883A9D2B7955E903 vincentjuncaj
59,001,161 *064CE8800543CA95514BCF689D3E351D68344283 vinrytandiono
59,001,162 *06473E4178EB52F56E47AED90C11AB54C153C32D VOLVOPROTEL3
59,001,163 *064E7568B42AC5F81D09DC792532B0A8D9A48BB1 VYHASNUT
59,001,164 *06448BA6AEC144888C65470B68B3B04AE7AF75C2 WALTERDUVAL
59,001,165 *0644B684AE51D4728DE75B3C869D0B3E06B92FA2 [email protected]
59,001,166 *06422CB8C886C25F7CAC6BC3592E402115D130F4 [email protected]
59,001,167 *064EA5E88109FC17595BAB810567ABF662645643 WATSONMAJORDOM0
59,001,168 *06433CC1EA403D7630BFC0448557FC8F9CE99A76 WEIMARPLANVONLOSSIUSUM1780S53
59,001,169 *0645CDE985E2B9D9F99B920F720C0C73D70055D4 [email protected]
59,001,170 *0646F8BA8277AD82A10991865E4C8C5BC79E2281 WENDY SMITH CATEN
59,001,171 *0640684FA19F9EEA10F014D1DF50BDE64671B2F5 we r we
59,001,172 *06489A9136532A8793E12F31FB6B7195EE76C755 WESTONMONTON
59,001,173 *064FA1C1744593A743E58DF7A74A1570AF61EB41 Where.Is.the.Love.(radio.edit)
59,001,174 *0646DA6A871FB83821F847F9E6A0B92594427BAA WIKIWISHES
59,001,175 *064A7AD5A834E65D65C4D20F54492C27D49EE5EF WILLIAMDEWAYNEDOUGLAS
59,001,176 *064B7EFC5613FF6259A116BCA34A91241934C24C WISDOM-LIFE-&-MATT-FINGAZ
59,001,177 *0648DEBAE19465A466C237644A0701E157595E4D WITHRUS0
59,001,178 *0641C8C89EF5C045FA8771D4EC9C8C07858C69E3 worldfamousaudiohacker
59,001,179 *06478482F5DBF501ADA38D374495D390C38BEA3B wwwstagedoorcanteennet
59,001,180 *064B795A5AFD073A00734542E2D097EE223EF995 {x}**<====8
59,001,181 *064A4FD429B69E5DB6CF821E50ED9B90AC5F1CC7 xt?>
59,001,182 *06473C1EFCE073B661C6E08BFC448111E2501767 [email protected]
59,001,183 *064DB8119B3652C002E0DBE6246C80169D5388B0 XYLOGRAPHUS.RITSEMAI
59,001,184 *064BD90943A217BBB0345B5B4DDF0AED1A101E63 XZB4141
59,001,185 *064AD809B640FF1238FC55170EDCE97CD1003765 yadwindersinghsaniara
59,001,186 *064E793495D4B6405B75172B64EFD4D13C896435 [email protected]
59,001,187 *064D04E0184FAAEFAE586AA865DFB5FB73C43A2B YAOAGBLEY
59,001,188 *0648ED3A3CB4C953C33943360060E6FD0C868698 [email protected]
59,001,189 *064D873DF9771BF66BC95399F77C133D19CB66ED YLCANREV
59,001,190 *0645E09856D06583F8B902A5E73076785442BF50 YLDDOYLDDO
59,001,191 *064221A71F2A6FEAB28497DB830D746112C55958 YOHANES ADVENT MAGNIFICENT
59,001,192 *06417BE51D7584F5ADB31382F2D48C3809175EEE YOLANDA.TUFANO
59,001,193 *064D7BA197840201DD15C6051DACEA448099B405 YOLLA HOJEILY ZGHEIB
59,001,194 *06459FB5A628B8E4664AB768A16A0AC2699747D9 yomamorabe
59,001,195 *06423A86685AC243F0E9CF4E00E4ADC429213EE8 YOU'REMYREASONFORLIVING
59,001,196 *06481F7B79ED1A7199E9B88E4B08D1523EC41199 YPODIOIKHSEWS7
59,001,197 *064B4E3772D4B829D2AB3151BF9C24099B7579FB [email protected]
59,001,198 *064BD6597F46ADA0E24650B40C210AA7F673512D [email protected]
59,001,199 *0647178E129B80AE64C2DFC77FFD34D49AD646B0 Z0NE+ME5
59,001,200 *064AC0F439DDEDA17AFF7D2633ACF7D9C2F34F64 zachariahpurdom
59,001,201 *064BE6991181BF701043E833DCF56426AD1A463D ZACHARY-MILLET
59,001,202 *0649B179DC55BC73F28B0091678551515A1C4068 ZAHRASOHEYLI
59,001,203 *064D96A6461DE89E107A69F5C443911268A312C3 ZHIMZZZ
59,001,204 *0649108584863BB622083C24C0224E7FBDE7A0AF γίδων
59,001,205 *0645C64ACD931AAF37A1DF135452AF6123FBC231 εἰσελθόντες
59,001,206 *064A3BA4B112ABF10507482B194B3D492963C36B гандхарського
59,001,207 *064099352BBD6DA6DB04D679146976F61E4BA787 КОШУТИЦЕ
59,001,208 *064C3C430EB453430149E4CF3D8C2F2DBC6E2E7E КУЕНЦ
59,001,209 *06416EA4DED4B90004305A40C19F44864ACB23E6 ОСЕКВАЛИЯТ
59,001,210 *064FA311C3CC5CCA58C179B8A2344A1F2E3AC2D6 ПРИЛОЖЕНИЕ —
59,001,211 *064A92C1AA11AD7EEADBAC0933EADF9970E36ECC ЦИГЕЛЬКА
59,001,212 *064DBDC7D1E1AF3B74B82FE91D47A46F1038EFA7 代表者:佐藤康廣(代表取締役,由母公司SME管理人員兼任)
59,001,213 *0642ED088D583326E99ECCC4DBE69A4D0A9C77B5 政策を実行に移したのです。b氏のような
59,001,214 *06492EF74E466A715FE8860B9948F2CC31A400A9 059RORY
59,001,215 *064D65B0388295755E36C876A644D15EC50B4F6E 0CCWQ6AEWADHK
59,001,216 *0645EA445C5E03FD9886DA2A711E2F49E9667C29 0ZC4M
59,001,217 *064DA84239C3B46DE7C6A4CCD0CCA1426120EE41 1066562 dealer'schoice,nickelstakes.
59,001,218 *064B5809ED00DC065C0A255B662F958E194EF426 1176543 "kyll
59,001,219 *0642F8332E81B0D2C7397EFBC87EF51D818B8F4A 1206477 pit
59,001,220 *06458519ABEAC0FFE4062B8A2CE6B0F88BE0421F 1434316 hanketta-suunniteltaessa-on-muistettu-,-ett
59,001,221 *06462AA2323227B42A4393DCA4C103626BA462C3 144ulaSmasInI
59,001,222 *06431C37E6854C941B5B913094C71A11398B77A1 14vesiohenteiset
59,001,223 *06458ED4153B23B1DCAA523E6DBE0C0001140DDF 1745936 ELECTRICAL INSTALLATION WILL BE UNDERTAKEN BY CHUDENKO
59,001,224 *064087BD989E4AB4AC94997EC1686216891BA57E 18S
59,001,225 *0646845FBD68FF2913A5955512FA5804EB661BD0 1BERSARINS
59,001,226 *064AFDADE33AAD2C57F4C2641D456AFD5B97B4E0 1.beschaffungskontors
59,001,227 *064ADC23B4F84032D6D85AB1618EF046D2A296D1 1COLUNTQUE
59,001,228 *064E1818F3D753E0966D2CB09E93889911DFE462 1.DENS-OHJELMISTON
59,001,229 *0647A3683248094123B83FB7ED480CBE5458D860 1 foerdergeberszene
59,001,230 *064F7285B23DFDABAA4DB10BC15CF3D771F3119F 1GIEFER
59,001,231 *064541E51D110321C63323A68935117361682843 1HEMRESES
59,001,232 *064C5DADCA1851DB1097E297D93345B178F60E98 1ilovesamiam
59,001,233 *0649F6BFA9915341816EED84F559D2DE93C55B2C 1LauVeR
59,001,234 *0644501F45A6ABBD25FFD93196965535FD45E438 1 MBMAINTAUNUSKREIS
59,001,235 *064432436C279EF1ADDED1F777DAC049A6D4F57F 1MYTOMCAT4
59,001,236 *064B0F6C06940700F9E59B2409827A81403A54D9 1MYWONDER5
59,001,237 *064FE538E58F49D4523DFB139286B5D2CEB9B81B 1.schachtelt
59,001,238 *064FF5DF8EA2500540E885737A06A1B1BB6EFD47 1 tomahawkohjusta
59,001,239 *064A0287DB69301CA72AC44F5AC57D064F0CA425 1uefa-reglements
59,001,240 *064B5BA678DFC4DD6FAE41F0C45600DFAD5C03D7 1URENDE$
59,001,241 *0647DDF4392D3941D60273A376D344F95E71A361 1WEVERSAM
59,001,242 *064B67DC69B8E647A0E59A758DA60E7EECF93A46 [email protected]
59,001,243 *064EEAB0A725798ECABBA9916B3D34B00DA2DA10 20 matrahachette
59,001,244 *0647A6304C92B2DAEB4FE5D3418C1DCDC900BF06 2279161 kuntosalimaksumelojilleon100mkajalta111304
59,001,245 *064651C9F401C80291DDB6A899EE4A611A6E3ADF 2473282 DERBOBO-GOTTLIEBT,VERURTEILTABERNICHT
59,001,246 *064F3502B0943973144BAA9F1837B02D6C2A12F7 25july1933
59,001,247 *064ACA802CB4610B62003A17EDFE8DAA3E3147C7 284419 dennochbleibteinunbehagen
59,001,248 *0642B3594884D06B0A4B1396BC0256DED36140E7 28JUN1351
59,001,249 *064EE196EB3B2CAD6983C7CB25E94FD557E31497 2ANADELIY
59,001,250 *064ACFAF5E265E1ADE031BCAB8C53818F7F06967 2BAURORA
59,001,251 *06489B13212B28B3610B1F01338FB76541925DFA 2DREGIONAL
59,001,252 *06463A7C8FF0AD744A3238AEC2D7ABA3B7DCAC50 2eu-themen
59,001,253 *064BC8A042AF574D45FED79639BD145AC23290D6 2.landesvermessung
59,001,254 *064E3C4857CF2D7C4668165D516E8E1AAB0C327B 2 LIEDSPHAERE
59,001,255 *064F303D05F16406B83847EE28AC673ED6CAA980 30751
59,001,256 *064C9D1B61E40B6A7000E62586315D6E18895E9E 344534 jos.vaste.ei.ole.riitt
59,001,257 *064F8A7DE8F31F7AA32790226B87860701B80A77 3B<-O~(==3
59,001,258 *06446D8790BC11D853048ECAF317AC001AB66838 3indianerfreunde
59,001,259 *064B4C564FCFD8C57FD0F10E9DAC227EE75EBD60 3IVERKSET
59,001,260 *06412EAEDFCC7047D2257FB34D366AF19F56AB28 3KRUCHKOV
59,001,261 *064C6DDFD01FDC354019A990FA7BA1851142F022 3NV1R0NM3N7A11$M
59,001,262 *06432C6C23116190D4665069130ADDD5B361F25A [email protected]**}O{
59,001,263 *064971E83E725255F8F538E8FC9D33BEA2DB9DFB 3SHEEREZA
59,001,264 *064615D0338262A3B7AAE45DCA8DBE43F04F093D 3.VALLAURIS
59,001,265 *06431881CC17840BB708512A9951EAEE169897B7 3ZSATARI
59,001,266 *064EDE2A25B35DE04E6F377B033DD4471EDED686 411ERIN
59,001,267 *0642F884147C6D0AC97162175D23BAB59AB5500D 4RETAINORS
59,001,268 *0641AFA0A1FC258539A2B8317189DCD4987739D2 4SMJSUJD
59,001,269 *0649A44035D43F296651C300E91AA53F0596A29F 4smoke0
59,001,270 *06440ADBB7D7695EB9138DD285CF3D97511C1864 560576 sagolun.sayin.baskan..
59,001,271 *0645667F2BD4B57F706E967C3A9A1CA9771BCA1E 5-AIDS-PASTOR
59,001,272 *0645E054A766311A2CD1786856BD8F5813F10D53 5GORYCZKA
59,001,273 *064CFD5EE53B98DFE634364C9AAEA581B1013A5A 5HONDSDOL
59,001,274 *06474EC93571AFBFF735D33A621D1BE5E98BE035 5ign4b1e
59,001,275 *064ACAAFFE57E19097CD28CA1BEAD498339E3E55 5NOEBLAST
59,001,276 *064748A9AAB76DABD6A239B8B90636698944B308 5PGEDIEPT
59,001,277 *064EF55AB0DAFEA630E2D195C7B0511F227A17F9 5月24日、シングル「sinai~右手のカッターと左手のドラッグと薬指の深い愛と~」をリリース。
59,001,278 *0645190A4FF9BEC09B083064C7707C2A5DF95151 619SOPHIE
59,001,279 *064C3A63906808CF380CF70E5202D70986E83272 6CHARGEAPLAT
59,001,280 *064BB63A3BE1D4D624B4AB842F5E4B6D23D352BA 6FRUITPANS
59,001,281 *064300A19D24DCD46167E2CD77CAFE2957A4F5A8 6GUZULLUZUG
59,001,282 *064B32678269622D3768BD6E798DBCD2DA2CF9C2 6LULURUSSEL
59,001,283 *064BCB6C3BCC3EB75DC249020D5F7C5076F5786C 6mar1682
59,001,284 *064B1DB9481FC46AFB6C70485C7A820DA36BA448 6SEDEBAT
59,001,285 *0644896AC4E59174DDDAF2B4B271EB0B5E6BAADF 6SIMULTANSKAKING
59,001,286 *0645060D1444AE628DC7D5EE98741025CE321C08 789839 Ifade.tutanaGI.3..
59,001,287 *06472B538FC2DED35BC2093340A84BC916EBF20F 7ACETATEH
59,001,288 *06488FC31372ABC7F82306DFF3D7431CB3520B66 7KWALITEITSHANDBOEK
59,001,289 *0648D61198F6B7A7C10583E34F2F0E3820B641B1 7PERUSTIETONINESS
59,001,290 *064FEB13BBB992991B38075D13D4D3E06370DD73 7ROXYSHOTGUN
59,001,291 *064682A2B2C5934382DAE257C901C98A81D1C41B 7supramarginal
59,001,292 *064AA8F1E022A6B329271D588E0DC5FB105ED702 7WIVEHOOD
59,001,293 *064FE5FA3F15A8BF222C07B86D511990C886A6FA 7YMP
59,001,294 *064B0E1E7969BB17848B055BE7686C170BA5CA20 837746 he received an eightyear prison term .
59,001,295 *064C96E2CFDC5314421F8E2AEA1303AD1C411AB6 851174 ' AMAN ALLAH'IM ' , DEDI .
59,001,296 *06444E9B1561552B0A1CEBEEF9026D114A967200 (85w、86世、88オ、89w、90世、95w、98世)
59,001,297 *06411F9C4604619622DF4EF24862BC588E2C77D9 8-----B~0-(-_0)
59,001,298 *064CF0756107D4BAA967D85D40931842F7F8C06C 8BSWRDEALLOCBSW
59,001,299 *0646D9823B9913582305CD444B3DC516024D3BD5 8CYRANOSMITHS
59,001,300 *0643433FD5A00066C6B5FF4D2D4C38D300DFCB7E 8dc8bf0028ddae510e37b7969e5d5e07-cokine
59,001,301 *064F352FF8E132CF8983750C8CCB6A64765E6FD6 8ESPIERESTIS
59,001,302 *06446923AF51CFEC1D657932216BBB89D74E594A 8INCASSEREMMO
59,001,303 *06432E93F634F7A9F1917D7C7C3F57CA6F39814E 8INDEFECT
59,001,304 *06462BD89E49E340E76AED6528D1E05F38B6DD4D 8KAESITTELEMAEAEN
59,001,305 *064A82F04739598210CC6B43BD1A25D27BD65513 8KELSEYBINKY
59,001,306 *064C95D46F6A2B084D0358710AE225DDA2591B47 8PQUIXNETMOZILLA
59,001,307 *064D574E1C28BE39F07C5EEE6D16D735A7E1B951 8TRAGTENES
59,001,308 *0648CC34D4FAD8070775374CC4ECC01AFB8F06B0 8VDU
59,001,309 *064C4AB4E9550A007C2B123AF36D3806B9B2D98E :8}vw
59,001,310 *064BC46625C81F03A597A0E36E64FC5385F00FAF 95djc1962
59,001,311 *0645F4ED5AD1C9F6469F6413A844FC6D0F5A6467 9NIITSARN
59,001,312 *064702C1DBE62BA1EB81878745BC6969736CE622 9SALESSAMSON
59,001,313 *064E1532A1306F3FF963D66C6B4E328850A947E3 9SANDBECK
59,001,314 *06439E0E3AB69A7F4D20557CD5A6477D3484A540 a=!0g
59,001,315 *064B579E0A9AFBDE2225B34141F71671D4C08C2F A0J15
59,001,316 *064066A8BD8C071500D2C596C0E248E9913ADC9A A0R(
59,001,317 *064E2AC1DEEF41B4955BC203944E1615FE585110 a;1i_
59,001,318 *0648059409BF12BBF5321EB9CBF47C4CF407D2A9 A&2r
59,001,319 *064B9FF855439E0ECE4799DB095C6B4C36A8BDED A5AII
59,001,320 *0642034A8249AD6DF40192DD6CFDEF16BA34CC16 a"8fz
59,001,321 *064EF93AC15BA3BD75BE0675A59090E80425636C AAB2TE
59,001,322 *0642F8CB426B88129D60F05CBAF5B6DDDBA47E25 abramkupka
59,001,323 *064C1ECB4567E56308D1D29574E7D4359B26AB37 ABRITERA
59,001,324 *06496DCBA150945B8AD1132245DA83FA30996B68 AC`:U
59,001,325 *064228991FE50CF199238E606BAB22031F5E9017 AD%NE
59,001,326 *06492AAD9A14C2E3A765588EF09EEAFF60DCD628 ADUNEREB
59,001,327 *0649AFCB8CF32D2C0BFA86A3CBDA47EF55A5B561 AG#SL
59,001,328 *064DDBFA69E99C16548848F7337EDC7111E9E1A4 ahz?;
59,001,329 *064896F724686BC6274A259DCF937FC62C20A5C1 airhpana
59,001,330 *06442833845A21671FE033C7A657207D80BA9CF2 ALECIAED
59,001,331 *064C38772D4D17B832E5F76B0F8E96EA42A2F21D alex.bustillos
59,001,332 *064F5E165CDA9797E511B0B6C5EE7C06889EAFA8 ALFONSOPERRETTI
59,001,333 *064C2AC0C16CEF9CF15F264E483F331E239336A4 alhcsfua
59,001,334 *06493DB6F21A792C50E74EA3EECBC23110E1B3DC ALLASSIA4
59,001,335 *06432567D15005DCD61CD3C0299750FA90ABF35C alloilling
59,001,336 *064229C93FB2C829F7FFF512AD438C5BC9C0EF9B ALM(L
59,001,337 *0640AA98BEA332B2D7E86E721CCF8265CE897833 ALPHONSE.PICKL
59,001,338 *0640936860D3ABD570F74D1D64D469A9880FDA09 al,uk
59,001,339 *0648B86D46F86570CBAC0640A135E5F493690666 a$mh(
59,001,340 *064C4E2DA47371D40B149ABFF54EF1E780799880 amq5w
59,001,341 *064DFF19360A92D6FF8A7AC87126F95F68456FDF amw=!
59,001,342 *064B7AFC57E92D9CB01E8DFFDE7021E6270CFBEE AMY701
59,001,343 *06478C4A9C7B0A10EF4AD9B8B32C6D850C3E0857 AMYDELTA9
59,001,344 *064E1C236E3BC2094E9981B7CC0580C09604042D And,inreguerdonofthatdutydone,
59,001,345 *0643294835FAAB0C996D36D68409607BF2F4D803 ANDRENELLUM
59,001,346 *0647DC95C2135F40BCC881AE4219B15168A5F638 anglophobia
59,001,347 *064B3FD3CD3461CCF4B64F0D74898031D9D1AAD1 ANLAŞTILAR
59,001,348 *0648676236E8CCE55940894606DE3E1C80611E19 AN,LC
59,001,349 *064493C4EBDBC8C6B662653274952A603CF47B20 ANQUETED9
59,001,350 *06489B7DF5B9F311325030FDE805444088B217DA ANTHONY.SHOULDICE
59,001,351 *06427618FED1C1E9AD83F2FCF80632528AD6E943 ANTONE.KIRSCHENBAUM
59,001,352 *0647358A9769AA1CF36B3062617F9328213B55F2 apcarter'sblues
59,001,353 *064F2504D8E0C9514FDA27B60E7CD9EF8B4EA3E7 AQ&NB
59,001,354 *064AD5F244B82F67858ADECB8B02024812FFD991 [email protected]
59,001,355 *064CE6EB79C366C5B56F36469C96E4D1067B22E0 arg$6
59,001,356 *064765F44A6AF467C32D63184B0AD41D4CA86120 arj+i
59,001,357 *064DFF9913D5CAEF9EDCAA0823117E4D27CBC530 armandopalomaki
59,001,358 *0642E175137B2C3FBAFF827095D6C3A4825F70C9 arp%g
59,001,359 *064188B0C264B09CDAD64B39EE68A950E8B2F3D8 ASSAR
59,001,360 *0647AFE1C56DC2ED431C80836E02FF111307F099 B0DY-F1UI
59,001,361 *064C73A3C0C6C7CC6A4CDD991523101DA55B11ED B1HL-
59,001,362 *064E66D883C8C2E781A8D9334397DEDE0D2FA2EE b/9y
59,001,363 *064A69DC655CA014B8DCE912E56234A814B2565C BAARNSEWEG
59,001,364 *064EFDCB33E24411BAF56D4C690C46375BB37685 bantugruppens
59,001,365 *06402F8848D0AA30CB75C1D569E6B84F775A2BE0 [email protected]
59,001,366 *06405A50B266F2EB3D2AF5C5D2EA21406570BF7F BAUERADSALESCOM
59,001,367 *064132C77643542E7C2A4C54634C0C7BC40A9B6B BCD
59,001,368 *064778A22B4958378365DCB7EF71612748B7CBC9 bedn5
59,001,369 *06401D0543E586B939C197E54A6BC23F201B1BFC bek3e
59,001,370 *064B00934A22567E315DFC8965FC5E0E6CC0F011 BENGBIE
59,001,371 *06407F7BF945634841B1E37FFC04CE5636724A84 benjaminhitzeman
59,001,372 *0644375B7067B22893D33019CC5246BF7B1EDFE2 BEN.LEGARE
59,001,373 *06404217846C32043AE02FB5FA2C6F9412C518B8 ben.vanderloo
59,001,374 *064A1002459B65D9B11ECE08698A1084828422C2 betorcin5
59,001,375 *0641586940E52668CB82A3C8688256ED3F8EA721 [email protected]
59,001,376 *064D7FB80DF220B4A8B5FD07898F8E585CA2B363 bg,_8
59,001,377 *064E5CEF14A48A9F5390C904A5FE7682100B12CA bh!;h
59,001,378 *06415417FF762C68EA5D0842CF3435E4365746E4 BIRKENHEADPRIORY
59,001,379 *064B45BF7034BAE7C02C4F868BFFA0D0E111BC9E BORIS.ECHEVERRY
59,001,380 *0642B0A05D5D3D32EC9A3051F3BB1497CC0D8DA9 BOSSLADYISDA
59,001,381 *064D217A4B4592F00F6832CA0727AE280E99C807 BOUH
59,001,382 *064D17F294566359E28B2DF6921B413F75E4A110 b(q2v
59,001,383 *064437BB079A556FF142CEB688C085BA7A5E5639 BQBXE
59,001,384 *064EC8B7E00720D9C23ADC1FD224C5899A4D2ADF BRAGHETTAED
59,001,385 *064E0A379B59D025D0CB9EA4EE8681E8D67FB377 BRANDENSIMONE
59,001,386 *0644D9D3D71A7DA58564D3B787CC985538F32823 brentmuscara
59,001,387 *0644987618FDF33A40D66C39799B0462FB1442A7 B.R. GUNNA
59,001,388 *064D79212D3600125F0EB923F6956C663315C7E3 BRN)
59,001,389 *0646C362C03D59640C543792E6BDD217A09DAC5D brycekinne
59,001,390 *06471E0C7FF5C7EE6EF6880698CD348A7EBC69DF bt85m
59,001,391 *0646CDF2770CB12E945214E31248F15C370363F5 BUKARSAD7
59,001,392 *06409DDE37BA28EBE3C0040D2A44B2B3EB9E1A8B B_V/
59,001,393 *0640295C44FCE0D1FA170D34377D775041EBD059 B-W-J
59,001,394 *06460670D8B30F63FA12625176EDB72B522D1609 [email protected]
59,001,395 *06491B63D348A7E0724B551210A1B93124509D21 c;)/,
59,001,396 *064B8CB32E54F3F9C92A999B0A364AFD6AC557BD c6xc0
59,001,397 *06440F782397B2C21B8661071ECD52454502A029 C9QC
59,001,398 *06427279B181FF31A0A42C66070BB1B5353B14DB caryotin3
59,001,399 *0641B9AEFD00736D46FB24B1CAD97B350CD1C405 CA!X:
59,001,400 *06465F13E2D8D5A5D52F8B712708B386369651B5 CELLFELJ5
59,001,401 *064A81963BB2D5B0F6F7D40E4E4AA199D0BD9BC0 C=ES
59,001,402 *064052EE5828E1F13B84AE3618BABB1BE5E8CC89 cfty
59,001,403 *064B93AC4FA4B908CF1CB632E92FE796E9476D03 CHAUNCEY.LAMB
59,001,404 *06448D844DC84EEA3F3AA48070DFEC3D1D65307D [email protected]
59,001,405 *064CBA20CE5BE58AF13BE5CFB2B1B6A0435ACD15 [email protected]
59,001,406 *0642FB72826166453366FE8B420999DFDDE319A9 [email protected]
59,001,407 *064D153CAD5D3E3AC63C03DF3CFAED589C22353B CHESTER.WESSON
59,001,408 *06496CA8AF4C98DB1A82133509F9596843D6050D ch_g$
59,001,409 *064AEAC78B82F1B41A90E6388B732267FDAAFFE9 [email protected]
59,001,410 *0643875C82721083D875A0685286064F2BE25D28 chiquenaudes1
59,001,411 *0641655D963FF7A2E96EC14ECBC87DCD3FFB3E74 CINDYTEICH
59,001,412 *064B47455178B860381E61F6E7FED69AD95BA22C cjqts
59,001,413 *064DBDC63E7C361ED5AB3741F7EDAB7DE38E0B64 CkI
59,001,414 *0645D970CBCC1075484B7662FA6CA3B2CCD981BB cletusburdman
59,001,415 *064B0CA3E9E1ABB0F991FD20E10036E227CE9589 [email protected]
59,001,416 *0646673464FF0513E744D1C9E0488C8846361B56 CM=CG
59,001,417 *064DC644197322481C70307E3951D4EF64461567 CODYCIRCLE
59,001,418 *064B5D2FE1C21CBF972AE78991B7868133D2C5DE colinkeady
59,001,419 *064E0647CC4920E3D78FF7C14C39EE129544EC84 confined.sting
59,001,420 *064B857DF8F33913341B70CFE75541A8599752E7 contracts gets-(disease)
59,001,421 *064378952495722A8218CAD34EBA013E5E369629 [email protected]+IV3N3SS
59,001,422 *064587D10F73E15034B56893236A70976E52C72E [email protected]
59,001,423 *0640503A54960719CC66A7A10C83328677D088AC [email protected]
59,001,424 *064AA6820B1C17E568A099CFB2C40469F12DE0F7 COUNCILTEMPLATEGUSH
59,001,425 *0642E10659ACCD191E6C186CBB4CE79E6FBBFACC cozsu
59,001,426 *064A449A0AFC56A13D3B015A968394C7E42D8138 CPKMD
59,001,427 *064999689A36ADDE158AC488F8E2A9E1E2F77157 c+qkb
59,001,428 *064B16361A6CDAA6E1579137AD6EF6A72126E76C cristinomallo
59,001,429 *0644DDB22126B75D375BC3D75414B3ED44309183 cristobalmehrer
59,001,430 *064E8B37BF157175B61E498932F27EEDA0B66863 CRYSTAL4165
59,001,431 *06491EDC1926196315F2E66DE85CBA6F6B44B788 [email protected]
59,001,432 *0641BCAACE08855935F3361FD2D64B73DE2041DD CSIM
59,001,433 *0646295A908A05AAEEB10517CCA8DE734F5C89F7 [email protected]
59,001,434 *0645E217CE31C636C97500278FC2A01B9B3CB7C4 CwQ
59,001,435 *064CDBB28AE71DCFE7F2FED957421A46EE37E238 cxx$5
59,001,436 *064A777E99D2050596EFD9430454C3235BDE3624 CY2P
59,001,437 *06465D7BADC421B034FF08F91A444D1D53805251 cyroc
59,001,438 *06457962EEC0CDC2380FE46F6E2446646CAC597D d2)o&
59,001,439 *0641ECC93BF84BD4DC11CCF82088DE01D84FD530 D;_7
59,001,440 *0648BEE581B1CB8EB8EDB01C68E306085D0CDF1D d+8pp
59,001,441 *064FCD3B146A103D46D816944FDD44B7A7A8F53D [email protected]
59,001,442 *064F8F2E1B0A86B4BE6B2263B6B13245F4611A20 DAMION.PEPLINSKI
59,001,443 *06411A08C68CB4A0A1A8EFB4EE7E1357B9977E61 |DAN
59,001,444 *064BF71B5A1FBCF3F0E34B150C179C484EE972D5 DANGILETT
59,001,445 *064C9C7A76FFA2E41F742AB7AB7F1A8B4CD99435 darrickgourdin
59,001,446 *0641BE4B7D9DDC844E50DB9710A83F5C5B2BEE1F darryllockaby
59,001,447 *064208F8A6DE127EE666F4538C92F3E0FDE695FF datenwert5
59,001,448 *06453B48AFBCF6F3320743F2729CF7C2EE052E12 davidfrary
59,001,449 *064B183135A6F04E93C2AAC7648EC1B7B67A3028 DAVIS.HERLING
59,001,450 *064E1D1F26DBB22E5A1FA1F14A591737DDC868FF db&;0
59,001,451 *06493535D068E39E708EDBA2EF6BAA3B981C3FAC dbogh
59,001,452 *064E1BBF1A5181A9D259633E1522F25700E03A7D de.ciales.soy
59,001,453 *0644885AC38F06536C919668E4625DD7B43E4CEF deecruise
59,001,454 *064DD491C4C6B2AA228CEB3E46FB9622590E638F delitto2
59,001,455 *064D1719C6BFDCF1E64C81F9F144803EA4001F40 deniswilling
59,001,456 *064E6B5FD7C9E4AF86BD5E5D143A0343053820C9 dennypetix
59,001,457 *064095798CCB673F55EFE80C05A9C847A2F2DF26 deongalletta
59,001,458 *064A433C2AA920E7C20E232F37C40F87836F28A8 DERICKTARPLEY
59,001,459 *064CBFD790E65B36268C126A2F819B0158B06214 [email protected]
59,001,460 *06456062DC280A6A9D45961922E7811964D58342 dettava
59,001,461 *064BC241BCEA8F88C4EE54A1F4F8421578A535D5 dh2pq
59,001,462 *064BB029E2322B63F009D5BB4D2F433EB9EFA3D9 dhtnp
59,001,463 *064CCF653C6C0978666149D30184F7458840EDC4 DISPUTENT?
59,001,464 *06439039B276347B8C4EBBF8B065DC409D77F567 d/j3,
59,001,465 *064AE71FAE2B0715467C7A1A1B9E48B3142D9E4C DKAT0784
59,001,466 *0647507A92D0182B5B3132F51B6671025C01F3CD [email protected]
59,001,467 *06464EB395B104FD825C4A9A61960DED96ED3E7D dmfp
59,001,468 *064C4DF69E6BE47A746E1255227E49AAA9EC7B2E DOMINGOJUNOD
59,001,469 *064B34D4CD0226011D59517306C05E200BA9BB51 DONALD-DOWD
59,001,470 *064B0491E048FF1CE80C81CC9C65751F6E398193 don.drummond.&.tommy.mccook
59,001,471 *06432A23A2D08F8C14F2F976E75D1DD4E11127AE [email protected]
59,001,472 *064883123F6034FCACB87AD18B5A637530BCB26D donnsartain
59,001,473 *06478F97B821B7F33702B720016A28E606E8F3BA DONOVAN.BRAASCH
59,001,474 *0640D5DD4DBED29A2D16C8C67132F9FE6905688E doownottub
59,001,475 *0649D4C6DA8EA8D96959846FB5BAC3DB04DF0B83 DORRISBOLTON
59,001,476 *06486CE5C5007B17155085E1454012EBD9199FC3 dougnone8
59,001,477 *0642FC4F59A48C22575A4BFFD70DFAB242259466 DOYLEMAYCUMBER
59,001,478 *06485543DEEABF9A726857B17DFFCFF96E06D5ED DRIFTMEM
59,001,479 *0649F48551D52277831EC126C2C196EBC2A77DB3 DRQY5
59,001,480 *064BEB22FB9CB41C2D3BB61AEB6E007BA0EE682F DUDLEYCHIONCHIO
59,001,481 *0643922B8CE3D066B6136D8E32B86AC6F2470927 DUG_
59,001,482 *064E32C053E0FA68D48339D6CACE383D785B3534 DVOKATNA3
59,001,483 *064C46BDB44D3DF8EB533D69D37810354C525276 dwlf
59,001,484 *0647422985848A31C39A5DC682488422D301EC3A eddiemalach
59,001,485 *064ABF6FC2FC082CF997E1342841C5872B28F7D1 ed-fennell
59,001,486 *064AFD759D1F6052AF159784A08490924A67ECF8 EDMUND-PINEDA
59,001,487 *064997049B4D6F90C56804C6F3AD4223D9611692 edtot
59,001,488 *06426C726A3A76192382280FC15F0636CDEA3DD0 EFRAIN.RUSI
59,001,489 *0642B722083A68789EFF48FAADEFDE6F97BC88D2 efwk
59,001,490 *064F682A1A8F7F741FA4235397C90032481556AB [email protected]+ER5
59,001,491 *06478793142694904523A2F92BC7FA12BF41D962 eliaslauters
59,001,492 *064EA39A638D8CDBCB5A2BFC678EC31C5B2A7804 ELISEO.MCCORISON
59,001,493 *064C9055E432341838A875102BDD60F17E381B35 ELNEZIA1
59,001,494 *0643EFBC7D5795D6EBDCF6C730D75E9FB0F98EC0 eln-x
59,001,495 *06443000992D72BB48F9FEFDA3B708C6E2467952 EMANUEL.LAUREANO
59,001,496 *0644B34789A3C5DE731F25D18B875FBC01C6D760 enzinnig6
59,001,497 *064A98BC014611E444FCA8A6C6284A71E2430464 ep2_)
59,001,498 *0647A82DD39FA1F3EDBADCF2D08F3EFED3F79D62 ep3ty
59,001,499 *064240F326542B9433DD5B13894C9C2B158A8938 equazion.4.(remix)
59,001,500 *0641E2E11C553E2582C6BBD16CDA5DC51BBE5CBC ERICDZIEKAN
59,001,501 *064B9E2B7F4A3290E42F76F5E4067A1DBB34D17F ericgemsa&danielcolin
59,001,502 *064E11AACF070FF6380E5C50095C400E72839A74 ervinshuttleworth
59,001,503 *064ACB22A70EA643C72F5C37B90FDEAB1EEE9BBD Eternity.Road.(7".version)
59,001,504 *0642DD7FCAA4BEBF4C802FABD6B89A2600797CCD ETKK3151
59,001,505 *06426C6FD32305A52F3280AB1911007818095CCE F00+S0RE
59,001,506 *064AC591E36B64C3C8094CD8F7A304D23AFFE379 F4LOKUN
59,001,507 *064054139602F4EB8D3F089091F3B5DF3BD8CEAB FABIAN.SAAB
59,001,508 *064BB7DAEADB1EC86C2B725D979D5E1828D7B26F factory公式サイト
59,001,509 *064CB24B1387DD54D366751F07FA368C24631B4F fauxfuncomwww
59,001,510 *064CDAD73AD171061301CA0E14531DF1023B16F4 feigher0
59,001,511 *06451FBBE78052A402450E898C9E8794E15367EC [email protected]
59,001,512 *064B9931B02BDB7D90D0A96E8D03E0314E2ADE10 fevrerie
59,001,513 *064C9A1D42E72F4E49EE1F79F84478FA7FFB7053 FIZAH_LILFIZZ
59,001,514 *064CB5A0D6AA63EB7E2ACE59EA7E2DF33F66F3D3 FLOYDBECCUE
59,001,515 *0640C0C7F65A25F63C96381722E9779794D8686C FOOTSEEHT3
59,001,516 *064BE1600B998B138765D268E65543AC0FD6D891 foreground-process
59,001,517 *0643DE0859B0B722DBC7D24E1029F7D0F26E63EE formulaslasher
59,001,518 *064C7DD2B4BB0F62BF8C21A75A5A2DFABFA4857E FORT1F1CAT1ON$
59,001,519 *064605BA78446E2D0C6101747B78D76D9ADDA9DD FREDERICDEBRUYN
59,001,520 *06440FF6C5A0CF5A39DD96A5BFE03FE91EF33BA2 FREDRICLANGNESS
59,001,521 *064B1B87A7A688311C1FC8201F98FF6B1C74BCA0 FREDRIKLINDMAN
59,001,522 *0645CF4C3D7C6AB153F720708AB70054E6054180 fripian-flipped-over-niffy-their-king-of-frippery
59,001,523 *064F7672621AB744B5112934E18D13CC27494B95 [email protected]
59,001,524 *064C91472EF8149BA5E48A540F44B1B2F7219005 FURQAN BASHIR
59,001,525 *064B4BEAA4A380B823357EC8A76A26B32BED3943 fxqh
59,001,526 *0648B024911E00977D1078ED409E1A0236800CAB geertcrauwels
59,001,527 *0649BACA56E5F0BC08205D8A741C5DAA59C4AF56 GERUIMD4
59,001,528 *0643CC15095E999B1AF6E2617A71AF96082B9A6D GHEMSATH
59,001,529 *06436A8B8590DC240ED13195C4D571D31F1A321F [email protected]
59,001,530 *064EFAD8BD9940E5D44EE3D6FC55C3860877D05D gnesron2
59,001,531 *064717723C69A8FEB89E7E539E9AC3891CB3FF99 GOLSAV
59,001,532 *0641A49C3671A1D0E5FB8A4D149608502ACD3BA8 GONZALOMOWDER
59,001,533 *064D25A0C17A2D2EC93B35A87BFD84D6CCFDD36B GORMECE9
59,001,534 *0645EEAAF1B2556B759C3FDBDB4F30ECD1DAB73B GOSESSIN
59,001,535 *064C4CC3956FD3800DDC340B1B64735FC82E0E71 GPKVW123
59,001,536 *0645753C2E9807927426565CFBA980D7EEB4A022 GREGG.PENKINS
59,001,537 *06437D46870562AEED468C775078AEABEAB3AA2D gregoryhugueley
59,001,538 *064E8FB4291E176A4493ACA71370F989CF5E26D2 GRIEZELTS2
59,001,539 *0648810BAC208E2C0DEB44C55744CE28F1F9EEEA GRÎMPA
59,001,540 *064BA0C1A602E8A000988D9375B24494306FCC4D grumpygluttoncom
59,001,541 *06421A8224E1BD28DB5CDB203FB44DE6A3D9E5FF [email protected]
59,001,542 *064268580F4343FFFDD94443C0883DB3DE504D22 GURUTAAM9
59,001,543 *06479F45E6D6F085CAB6352E3AFD7A80A3C938BD [email protected]
59,001,544 *06489613EDD89E654EA8F33EA174C5E1E8203AC8 GWAPOAKO2
59,001,545 *06434F6F4EA73DCF85A6CFBE955E4DF367E62F9D gypsycab
59,001,546 *064730EA594D72F6E09A84D800C3AE0482AF8990 hasbeenknowntochangeitsmindthe*real*turf
59,001,547 *0643A3145D269C8697CFC519A31693D3E9720BBB HASSAN MEHEDI
59,001,548 *064BFE1EA1A7122F9A704956DF8F9D0289113E56 HCIRGERD
59,001,549 *06453D89925C582B8CF0F57F182A0A242CEAC860 hh;@
59,001,550 *0645A8B53CB51030541A334D9C0C60BC9227726A Hk9
59,001,551 *064FFE54C299485312ABD6D497642D242B9F1737 hok_
59,001,552 *0645C93E357087E51F675AB4AF19B788224CC695 HONOR-Y-GLORIA
59,001,553 *064C23732C117AA8DBF8D29FB8F20BA7D5FB79C4 HORACIOZIMA
59,001,554 *064534053A60BD56AE19D1F07357205DE5FD5E4D [email protected]
59,001,555 *0646EB42AE6C6E6D0E0CA9F34793108F445814FA [email protected]
59,001,556 *06417968762FE2F2ED553EEEAFB73D558ABF9491 HOVEDEARGUMENTATIONEN
59,001,557 *0641C153C60FA6A0DC9E7F7D2F15575E920D2191 HOWK--HH-AW1-K
59,001,558 *0645E0F059807A6FD359EFBE583A29C5A9403463 HROTTLED
59,001,559 *06466841960ED72284CB19F1D532843B5B809234 HUEY.HESCHKE
59,001,560 *0642C150F0FAF4D8ADF58403A8E32F89A59FF9C3 HUISKUTELLEN
59,001,561 *064D6C4AEEE8C151B6346FCD38B0D52C7CAA9418 HUMSHIPSED
59,001,562 *064314FE2FB4464B8988223663122D5A5E411786 [email protected]
59,001,563 *064BF14948C449D3FACAE5468772DFEEEF99C813 hyaloriaceae
59,001,564 *064D058CB2BF77966DDDCF08BDD672685A32DF1E [email protected]
59,001,565 *064A9DEC00D78C4CED885A006C5CE8A63F018D05 ignaciolagrone
59,001,566 *0641DBA9A232EC304A7F53E50C3FDD86021E0405 IITSEVS2
59,001,567 *064C4B7F26973976CF5B0F7C5406FDC982AA6A67 IM,7
59,001,568 *06483874963706D5D479FB8E5325FCC0AA2C20A3 [email protected]
59,001,569 *0648526B2524230ED0D8D64891D91FD81BF31E06 INFORMATIELOGISTIEK
59,001,570 *06429C4A4BBE30FD8CB40597F204F804D356D001 ..INSTALLED
59,001,571 *064005DDA4B619036ADC8B0A5BABE6B87E778EDC int3rm3di4tion
59,001,572 *0641974F8765AB1CF92C8AD5A5B64917C8A03D3A [email protected]
59,001,573 *0641EC2F01C2FB9C9FEAC6BC49BB18105521BDB9 IRRITUM7
59,001,574 *064A6C6BB2FAF516B99E3544A442FD23B78B0524 ISHIKAWA JAPON
59,001,575 *064DC055FEE25CEAB9DA9305BEB94C28FF0CDD9D ISIAHCOPELIN
59,001,576 *064A060E19DD1323A16429CE237E9B105B5DF94B isrealbracamontes
59,001,577 *064974137D87DD649E7F161FB7E44ECA951BC5AE iulus1
59,001,578 *064AE26E536CE7FB2A9E85DEE825AA2C6CF91867 j8"d
59,001,579 *0642516BBEB1225AFBF7E5CB141DAD9838ED49BB JAIME NORRIS
59,001,580 *0648145F4948E6306F98ECE3675BB1E8E9D2ED9A JAMAAL.ASHKETTLE
59,001,581 *06487BE7AB517955BB677A909F9BD4AFF13C0DBD jamegunzelman
59,001,582 *064AE9BD07057A3F7C98D815FDADEA5BD22891C4 [email protected]
59,001,583 *064FF198B5D825109C23A07BE5CFF530E0422319 JAMIEBLAINE
59,001,584 *064FD4EA7B923AB71CA6A644F1B6CEAEDB248092 JAMIEGANOUNG
59,001,585 *064FE8420F5E2172B196DFF35C2F9B60DE1F177B JAMIE-SHAUGHNESSY
59,001,586 *064B4DD382ABFD8ABAA5326CB34E812057F9A289 JAREDLANMAN
59,001,587 *0643BF71845F7E9A564FD194A7D0AD833B72D2F7 JARRED.STERBA
59,001,588 *0643C1F01F1A2884891A2E69A5F3E158FE71EE4A jasminekan
59,001,589 *064385F2DFF5986FA24134F30D8A412644542556 JERAMY.HERKLOTZ
59,001,590 *064E7B5FF124F94EB9D216A59D8993A5D74889D1 JEROME.TEPPER
59,001,591 *0643912655EE9FBFF204DFFAF9FA0DB0C679B38B JESSIE.TYRE
59,001,592 *0648A3338FFCB00FAD31D9983DEE2A0ACDC1585F [email protected]
59,001,593 *064CEC2331D134C52486B64A60FB543CE6360C62 JODY.SHETRONE
59,001,594 *064E164E73D052EB4FF4C76E1CEAE5EF83B8322F [email protected]
59,001,595 *064E37A14B8E5CBBE83353315899CB0B66AC2A2E JOHNATHON.CLAYPOOL
59,001,596 *064A5C516AE5EABF8775BC1385E2DBDE0405C8CC JOHNBATCHELOR
59,001,597 *064F409D5624C490D6652413A3C975DA277BBDF1 jonasmcgaughey
59,001,598 *064C483C5F5600A5FBAF23CE5A72BFEEA29C4716 jospehlewisbradley
59,001,599 *06400D84C02C5942C0355CB86978B8866EC64F1E joyce-rull
59,001,600 *064E9B7A9A8692CC75F20549563205D2B7301A4B JUSTICE.LOOP
59,001,601 *064BB2D3472839B0933E99D9571F91444732FFDE karen.quo
59,001,602 *064997F4B9EB8B4FB4CE7AA7DA861831BE4E497C kaylee.cordeiro
59,001,603 *064415AE39A94C3DFEDF027A72D87E70F6792CB7 KAZUTAKE4
59,001,604 *0643635C10501BBC79777CC4FCBCB57E373B770A KBDVNTCDLL
59,001,605 *064F39F26A1E609BBEB4216B8BBEFCD9D9F4C469 k\c
59,001,606 *0648CD86DBB38CA71B0633EF5BD37E0891285BF2 KELLEY.BEISER
59,001,607 *064CEA20859202715771E9B75273D74C50062624 kennethburdette
59,001,608 *0640161CBB65607545B5BCE27A5804790194F5DE KISUR4LUC4
59,001,609 *0646A4E831165924AABEF42AC39987EFDFA135DA kleinstand
59,001,610 *064791C299038F64F7BAF20FAEAFC2E086CBA051 KORINIKON
59,001,611 *064DD0EBCAEDF8F15C25BFB48C138C563A8F83B5 KOZYRNA
59,001,612 *0644304339029626AE3813602A3202F07818004F KRIS.FRANQUI
59,001,613 *064241CF4942A02F9D34F0C6B2688C74E0504BAE KRISSY.CARPENTER
59,001,614 *064155C25D19D3CCC2AA0A369E0F37DC7B13EB43 KRISWYETT
59,001,615 *064993516A5895678C4E96FF6D6E7E8FE069B4A6 [email protected]
59,001,616 *0648DA49557B84655BDF6D9078060A091E532CAD 'LAMER'-PLAYOFTHEWAVES
59,001,617 *064F1A40D41E822FD2219A4A62F792E32B6220D4 LÁRAK.
59,001,618 *0646203B2B085F3E5069A27513E73AF41CC14AC3 LARRY.RAPLEY
59,001,619 *0642EBBA4FAED33A84EAE4BD5F9C98C6E5A686A6 LARRY.WINDISH
59,001,620 *06472BA2951AA30A333918BBEE76429C485307F7 LARSON70
59,001,621 *06406C0BAF7AD0FAA957A65D6B1B8A18A3865761 LAWRENCE WHITELEY
59,001,622 *064A1112D455AFB2DA87D550B5A6E34FAF008E8D LAXABANT8
59,001,623 *064E00214DA4298192B487544EB90554D5A5AA55 laylahesse
59,001,624 *06408799FF7ADD608E5EB84087AA8CC191E35738 leopoldofarrens
59,001,625 *064E9D10D67ACA8AD87DE07EF1C2AC66D96889E1 LEROYSTEINBRINK
59,001,626 *06482BC5C51F6E067E2643ACCA5D5BE27E722850 leskowitz5
59,001,627 *064BDB36BEF28B27ECA0E332E78903979CC1BD84 [email protected]
59,001,628 *064D5FD7B58FF802A978B6C72F89185F942229AB [email protected]
59,001,629 *064B15C2F3AB5A5B0116DB4E8DB2FAC07537889A lisacastellon
59,001,630 *064210017E3AA40B71203D7A681158D109FE4BE2 LOUIEULTSEH
59,001,631 *0643BBA43C478D6189076C3C812A82F474C030B1 LOVE.IS.MIGHTY.CLOSE
59,001,632 *064512B48DEF5DCD8A946FBA70A990665477659B LOWELLBOYANTON
59,001,633 *064A6346A2E2F8D4ED23C9EF81EB233C1E081FD8 LQ\:
59,001,634 *0640149BE679D7C5ADBEC23AF87E5AC7A28FA896 luigimoreida
59,001,635 *064B652D71B9D131E94E060A0B5A58161634B3C7 [email protected]
59,001,636 *064ADA72A92E2C1EC307E0FE96350042A7FB76D0 LUTHERNOORI
59,001,637 *064E38683019DC5CDDB6C85D83B7F958B6500AF5 L/Y#
59,001,638 *064FB7FBCD032AE0759EED11F9283918F05F7DB9 lynngembler
59,001,639 *0649B18FB60C61EED3B2878D854872CC0C444A6C LYNRAFAEL
59,001,640 *064D70B09B0322FB35615DCE6D68F11C7F991E26 M;|+
59,001,641 *0640772C347A7584777088CE59E052EE092566D9 M1T4K3MUR4
59,001,642 *064E84C517093411FCD37F7806D98FC14B1A49B3 M4LW0M4N
59,001,643 *064E86665EE8AAC8170BF316906A14E51B580397 MACCENCI
59,001,644 *0647FB80116505B976EFDB7319DA7352CBBEAE46 MAITOHAMPAAT
59,001,645 *064C12F86E709D7CECB8ADC262EF264F6793306F malcolmjamaljohnson
59,001,646 *06464007B1943AB1976FBA0B0A7A20FFECF6815C malcomjeffery
59,001,647 *064B9CD3429F4B8F5829E4614BD36D0C071B1F41 mame77
59,001,648 *064FC4FF6A42BC5E6E6AFC3BFF695719DE81E72B MANUEL.GLADSTONE
59,001,649 *06497CAB11D64EBCFAE99134483595D07B633270 manuelrinard
59,001,650 *06468F941B75323C660E7C29F4222FE9510A82D6 MANUFACTURAS.VARIAS.LTDA..|.COLOMBIA
59,001,651 *0644E75CB531048C0F6EDFEE0012C6E3CEC59551 MAPFORTSMITH
59,001,652 *064BC06B9737552C83FBF3200D79B57A8BC2DC06 marcushinojos
59,001,653 *0648B77E98343D3EA88485C074F899C12623DFA1 mario-carey
59,001,654 *0644B7F7D8EEB07DB47BB34B5A216C368A7D59FE MARIO.MORGENTHALER
59,001,655 *064C3C70BF8C9F91916014C530C60229CD6989D9 MARION.SYRRAKOS
59,001,656 *0648CEDADC61D288BA3407C2067061D95BC44808 MARION.WATKINSON
59,001,657 *064F63F013064C242BC46B0E0FC50A41FE748A55 MARISSA.ROCHE
59,001,658 *0647E5E6ACE264716B8A30AC246DE30CFEE4C1E0 markandangela
59,001,659 *064DC9B9EF34809C107F1F673EEE7B7B05E56571 MARKOVNIKOV、
59,001,660 *06497A7A77A5969BF086139A25069B3EB48D0689 MARQUISBONNEMA
59,001,661 *064506F9AB30D60D33F6983F6947F7AEE186654B martinorefice
59,001,662 *064594EE42DE94F8ABB3DD0019EC25A7D88384B8 MASTEROFALLBULLS160T
59,001,663 *064E54D854CC6FFD6EF839B77753AFF336BED31A matacumbé
59,001,664 *0646E7936115681E019F2203F10F366B7FCA83F2 mckell--m-ih0-k-eh1-l
59,001,665 *064D5FBF676B35B5184C6E0162B196020A7F740E ME.HIM.&.CHARLIE.MILLER
59,001,666 *064877B0F75728EF23192022206C40E9AD807A26 MEMSITA13
59,001,667 *06433A86CF20493BE1C8A8A55E5D14047DAC4D7A METAFÜÜSIGA
59,001,668 *064ACE4193F0DD6804E02BE5EE13F1536C907F9D metalsunbird
59,001,669 *0646F3EFF00986C100096B3A7709A89128383184 MICHEALSLENKER
59,001,670 *064CE8F3075F67A388E15B672CC5EA57B9AF9677 MILICT
59,001,671 *0640E48F82DDCC76E4C082A3F1603B6166D56A77 MILITARY_MARCH 'M/I/L/I/,T/E/R/I/_M/A/R/TS/
59,001,672 *064E5614726AD7DFA9DB7D12661A5AC70CC289D4 MINHHORWATH
59,001,673 *064E6679465678F5019D1CA854AF9E282A96EC15 mirthloving m/[@]/r/T/_'l/@/v/I//N/
59,001,674 *064695AD7F91A379A0B7F4F7F1BC8FCEB17297B8 Miss.Ramsey./.I'm.Waiting.for.You
59,001,675 *0646E04F16D742D2C554283344D81B2629933351 [email protected]!n9erers
59,001,676 *064E1BF547078A811E2756B499277E2393B30204 moplaalpom
59,001,677 *0649FB9C7273EC97A1EE719FEF17C51D8E6B5624 MOSBYSTOURS.COMWWW
59,001,678 *064C44A89220D49D23EE4F29E7DBAC639CDDB671 MTGHDNN4
59,001,679 *064074194BD7B655B2F6713C7BF372F893C5A9A5 munfordville8
59,001,680 *0645640544271E6BD04992F8B202B195B3E094FA music-effect
59,001,681 *0641A5C7794790ABBD2DBEF1955DFCEE883D6A91 mychainsawabc
59,001,682 *064DB6FC505964E92F4CE476C88F8396B5F7540D myleshides
59,001,683 *06433DB9D592093D4C0F699C79C92C80EC83DE31 MYRON.RUPP
59,001,684 *0645E5D9C55ED4987956BA6B67930A28DA4051D9 MYRONSCHNELLE
59,001,685 *0643F551C5460131F4F618C5EBDB211639B98275 N0E3
59,001,686 *064619AD2C8599F7B162AAE74EAF3894ECF725EE naryp
59,001,687 *0648EE2AFCCFCE93D0B6DD4EF888899F95B2B997 nedshimkus
59,001,688 *0642472B5721B7796AC67A62C207F54143EC946E negnithcirredno
59,001,689 *0643161E8F49A68650B5200BD0CF0F2A611872D9 NENUSTEBKITE
59,001,690 *0640EA0047D9400E50852AD1BE17B41473EEB87A NEVILLEGENTLES
59,001,691 *064F24ED4A19A5B11EC45AD36C43710A11B1757B NH~
59,001,692 *06415D345F08C2EBDDE5FE7AB28FB54D8511CF1B nicholasbranton
59,001,693 *064E6580BD32EB580D6C53E3CEBAE2DB6057A6B5 NICOLAS HERN
59,001,694 *06430C577BA51D6F19998DD9DF1DE777C9874233 niesgas
59,001,695 *064AE04370AAC62F1BF6913722B54882AC4AF518 nolanmorisey
59,001,696 *064599622D1F1FF6CC5E0B7E46759F5948DE05CB Nonliquefiable
59,001,697 *064FC28A5033D8FBC89A095107A270E5D0B1E4FB nostredame”ないし”michel
59,001,698 *0648EE5D1BEB52867657B7D991435C6502B4A9DF O CHORES MAIS (NO, WOMAN, NO CRY)
59,001,699 *0647C83CF6D30ECB563620D0161244D442F22C87 ODGORNIE7
59,001,700 *064209D0CFEBFD6E7C4EAB8C45DAA302D805C240 ODNAVELING
59,001,701 *064C3129D9EAE8C3531AB8BC3606177E378D87B4 officia1i7i3$
59,001,702 *064C7251B9BC22FC8DC72C5F024A4A4255B158C5 OLGATS
59,001,703 *06472C3BDDF17FBB541D384085D24CA01DC60D8B omnivorous3
59,001,704 *064A00C9AA7487040ADEED3D06EA6C6194990E6F opr(
59,001,705 *064E3C4F8CB1282CB856AB2CCCEEBD498A597323 os8o
59,001,706 *064AF706EF77A486AB330454303E45679AEA8677 OSCAR.MIKES
59,001,707 *064299E18401CB961C8F2F7F22FEDFE188500AF2 ottoamon
59,001,708 *064D8BBA94FCBA2A6BC7AB7BD26820199CF96572 OVERHOPE
59,001,709 *064A17C6762694339BCD081A560AA4EBF3F671BE [email protected] ~0~o)o(
59,001,710 *06458E6F58D81CBB5B2E9C7127C5F8A3761685CD PARQUE.NATURAL.DE.CABO.COPE.Y.PUNTAS.DE.CALNEGRE
59,001,711 *0647A62C0BA4312261AF4DCAFDAC1FF4C7244D59 PATRICKINSIDE
59,001,712 *064DC6A0D09D01FC98A5ACEE9258B444D1207599 PEE.WEE.HUGHES.&.HIS.DELTA.DUO
59,001,713 *06483B4A67B7C72A95B6BDE3463B24236C840A1C Pepe.2006
59,001,714 *064530581A4D2DC2B537DF850FAEE28F27FC5884 PEREGRNATONS
59,001,715 *064AE945ED0F829D5057892476B786CE88F0ADD7 perleur
59,001,716 *064A85224541B25485920F928D4D7E1A6D6DF5B4 phlebalgia
59,001,717 *0646ED6B48166E4617CB20826F71F7C4D5D59BE1 [email protected]
59,001,718 *064AC57579D32F535C65EA49D38EF97D53473D07 POCKETS.DEEP.&.PLENTY
59,001,719 *0644140C994B094829DDF2B654CFC787098B69ED PREVIZE
59,001,720 *064AC532E137A5B83C7D58B30E5522B48C3F06DA PRODUKTIVKRAFTERNAS
59,001,721 *064B6ACB7C5443158C8EA7FDF4DEEE862723B7FB prvomučeníka
59,001,722 *064F73FEC93C876DB5E1A0999BFB6CB86BC9689D q=>~o.(_0)
59,001,723 *0640B3A3F142FF6F2C3BF65ECF44DF5D222F598E ;)~qP
59,001,724 *06436872DCC97E3A5FEEAABDF4363DB3CCD19DE9 qs[m
59,001,725 *06445137DED954EEAF9F392845D36FAAB50E9F26 RACHELCHOQUETTE
59,001,726 *0641B22838D3EE9246672C6F598C75E5ECE7CF9E rakkerted
59,001,727 *064FD665AE27E0E90AB1E97041C615CF83563A8B RANDY.COLOSIMO
59,001,728 *0648CC724E910E0FD03A596D520D59E030AFF5ED RAUZIEO
59,001,729 *0647B9D51C9BC2F8FE014EA83D5E5CA7A2B230B9 [email protected]
59,001,730 *064682F08D34C0DB54F2ABDA3F041E3A539A190C redevv
59,001,731 *064946F6500D9F374F724BA7B55D5C7B556A8721 REFUGIODOSSIE
59,001,732 *06414F97443E378E70074579482F8C6FEE93DDA0 Regress.No.Way
59,001,733 *06431BC7D86EB4D71B316DCE7E31ACA9A0D667DA REINAESCOBAR
59,001,734 *06470C0023802B20EBB709EE3AC718EEBB80A02B REISEVERMITTLERS
59,001,735 *064CDF1AB78402EA37B6C81AD6F7BB8E31859D04 [email protected]
59,001,736 *06487B612FFC530D8810DD6789F30CC9A91003A9 REMERESTI
59,001,737 *064611B91A1B3FC20CCA175C0DE5B2C0F23AEAD7 REYNALDORISTOW
59,001,738 *064322D0D183304AB382867EBE470DB88BE2757A RGULVTHEFIDDLER
59,001,739 *0640840F0D38F42D0B7C0B9E8395F3DF64CE0CBE RICHARDOLIVIA0
59,001,740 *064C32EFC0A6B9CA27C5157F2AF5F61EBCE5D752 rich-man's-high
59,001,741 *06428E89ECA4069DD2B221029121180D4D454C8E RICKEY.ZAGARA
59,001,742 *064E5E79E4CC79161766358C1AF5D6B9631C76F7 riddimwize pert ii
59,001,743 *064C11427D19C1B78BD390D25075C029289E39EC rkhbjicyg9pbkq
59,001,744 *064D0FBBDC20AD24F3AA980061BAF679B2E2C60D robertranford
59,001,745 *064BF5C8E8C4FAD9B04920C4D062BCB0A32B405D ROBT.SERFOSS
59,001,746 *0648FBA5AFAB7B707E602D0B0578A05B438F9ABE ROCHDALE'R/A//TS/,D/EI/L
59,001,747 *06462041C524F20C5992E6EB8041582306BB5093 RODGER.PFAU
59,001,748 *0644C1F19D4238A00BCFA8ADCD1E1FAC4F93B022 Ro$inoil
59,001,749 *064CF3AECD1993E9238F5053EC73A3DA9FAC2DBC ro"(Lesamisd'Escamillo,Zuniga,Merc
59,001,750 *064E0EE36D7D3AF94373ECA53759F1E8A83A2C52 ROSALIE-FALCON
59,001,751 *064A2A60A79633E35EC38B1C210A796C152962F3 [email protected]
59,001,752 *064812040E00C3B69ECBAD038EEA83DC650A7954 ROTTERDAMEUROPEAN
59,001,753 *064087B157A36C93CE62641C12C51D4ED246FB15 ROXYBULLDOG1
59,001,754 *06408274221FBA59E0CA444F2CE38133CB21BE76 ROZRYWKOWEGO9
59,001,755 *064CC52C097D1605C2ED1EC199EE467A89AF8374 rubenuptain
59,001,756 *06466453A8503CF96667F7FE23828015DEDFE335 rupesh-pillai
59,001,757 *06413097131DA09186BB620AF4A65D50317B31AE RUTH3D1N4M0
59,001,758 *0647CBE4B6040654C86847A32ED3E167A260FADA ryanksobiech
59,001,759 *0645AE41816651F7C79313813A52E98F73A7BE25 sam-fineman
59,001,760 *064278F4ADA723C38A78489957DA4B6265759F9E SAM-FINEMAN
59,001,761 *0641F96674BC22C0446B9BC9D01C902531E0C582 sangnunes
59,001,762 *064CE04ED13F3D7A5A0F8C18966D6FDA329CBF83 SANG.STREEBY
59,001,763 *064F19E77F610C38C60B9CC3D1EC6489EF0166D4 SAXETSLLAB
59,001,764 *064CC5D2E9594A10079EB243F0B304FD3075D921 SCHOOLCOLOR1COLOR2IM
59,001,765 *0642E7CEB92BD4554AA503506CC0929B4C070EAA SCHWICHARD
59,001,766 *0645C7E3DD6A0436B688D5418FFB08D6BF029065 [email protected]
59,001,767 *064B533BE57D93D9E0E9FDE8C7F3F703C50F997D SE3*
59,001,768 *064C856BD7AEE48036784D9B0A3E0CF8B3D6B7A1 SEIDNERS1
59,001,769 *064247A7655AF5C834E4867F44EFBC389072033F SEPARABILITATEA
59,001,770 *064D93419169A534D83FEF6CC1F28721C19A2393 SERIEPREMIEREN6
59,001,771 *064DDA4D6DBF9174787860CA1F59F9C3D2ED2AD9 SHALWAR
59,001,772 *064B999BAD928C745E0AF79BA1146899A346009C SHAUN.BOGNUDA
59,001,773 *0645AF7D1BB5C534384F0EF75DE376E399734B71 SHELBY.BERGEAUX
59,001,774 *06406CBD697CFAF2DD10558641F137C63D4C681F shelby-whitaker
59,001,775 *064D5D1CD3FB48EF264F017DDC11963C0AC0AA16 SHELDON WARREN
59,001,776 *064961848E6CB497E5BA4E4690E3967A033C5E13 SHOEMAKER3
59,001,777 *064F445382870A0981C9D870A306CB2551068B36 SILICIFEROUSN
59,001,778 *064A14CD4BF1F9AEA54940FEBAAAE6175C0E8FC5 SLAOP MAR SKON MEIDJE
59,001,779 *0642EE621B1F97670E208F2A4482E4805BAD9C2F Slave#1(TheBoy)
59,001,780 *06438A5E65338FD95A9F5DCC26A2B2CB38FBB17D SLFRYLS4
59,001,781 *064C57D76205B78425455EECFFE3819259E4E910 [email protected]
59,001,782 *064515D51C7D6B46F039FA78F752D69F392D05C7 sofisticato
59,001,783 *0649AF5B82CEB35B19DD9220E9696E4E1DAA1F54 [email protected]
59,001,784 *064BD08B58817D1A469673233FC03AA9C22AE0B6 SOUNDOFROCK(ORIGINALMIX)
59,001,785 *0646FAC61BE7E93369B604FC84642BC4F5C60E42 space航天航空学院
59,001,786 *0649DC7B48C515234D6AC5D096C0D88B4594B448 sploito~-<---3
59,001,787 *0649297E7C340A964B45C8B975AD4A375E4350F8 STACYGOGAN
59,001,788 *064C009C1C3BCFCE8576E8C6B637DCF458A7F7E2 STAHLSPACHTEL
59,001,789 *064F3C7D3250EDCD4D28E42FFA68F5F92C333CFC [email protected]
59,001,790 *0649F26106EB9D97F8E76E0DDB8CFDB100EFA7B6 stenphen
59,001,791 *06485034B5FC7B915C0B2132D9765BD1710AE0E7 st. john and the dragon
59,001,792 *0646FAE7C4F4A78EECF7AF5FF5C5B5C1D91CBA6C stuartcashwell
59,001,793 *06477C6790439F16C814E24134F5ED583BEA8589 STUPIDTARDISED
59,001,794 *06418E09176B1283617C6C4FE219C7E670DD614E SUBVERZE6
59,001,795 *0648DD9EF5DB7796B7D3D89E841D6C3203F1E08E SU"CHTE/N
59,001,796 *064D81D49F13455CDB8CBC2E85285E3E9FB14191 [email protected]
59,001,797 *064AD5EDF4E7BAAD1174B5FA52D8E176727B7FB7 SUNRISE26DEC06
59,001,798 *0645B5583BE5555A95B48E1F6846923A3E54FD59 SUPERORGANIZE9
59,001,799 *0644E07E4C1FF398B4D17C2D483EC6EA7187F69D SUSHI-KNIFES.COMWWW
59,001,800 *0642AB11BAC9D4BCB961A49275D43B2F7A9634A6 swang84s
59,001,801 *0646D7D53D2ACA2DE96A7443BF3C72441ACE48C3 SYMPHONY IN C MAJOR: II LARGHETTO CONCERTANTE
59,001,802 *06474838DABFE95D1274F7EFEE34A18569E09078 SYSSELMANS8
59,001,803 *064A287E8EA68B568B626F329952049D90C47A78 SYYLLISYYTEENSAE2
59,001,804 *064D276B22BFD422C17A492450BD3388474EA85D tabitha-hammons
59,001,805 *0646B9C8153CF9E863FE80AF4172D9BEA21DAA71 TAEVAKEHADE
59,001,806 *0645BE5A92DC0694CFD1D7BFD33223FC02A351E8 TAILCAP1
59,001,807 *064C304FA00E23FE17041BD9713B9F07E53E19C6 TALKAVATHAR
59,001,808 *064E2767E93CE39590173A4661E692091EAEDF39 TAYLORCARRERA
59,001,809 *064DCBB99E66B0503A1BE9ED2C884AA357E9D6AA TDIVAKARUNI
59,001,810 *064D56647E297350300BB96398BFD5CCE6D572AF teddylokan
59,001,811 *0641E18633BFECA6EEBABFCCCA515A689F6F695B TEDMORT
59,001,812 *064FA78FA0E5CF6AEF402510D229A6C39C9C1F84 te,k620:acti,sceneino2aria"wash
59,001,813 *06492879FBC08C02844D9C3E73A9D62CE2BC48EC terrellfrati
59,001,814 *06415F8579012C18A0E6107E76603F1B05D6FF62 TESEGEHE6
59,001,815 *064393B7ECA17360010E2FD575BC5C136F172473 [email protected]
59,001,816 *064018F0ECC677D1F4A815D30783FEC4E797D117 [email protected]
59,001,817 *064BABCFF2B26C7936DA11D8BB83233A4CB0E330 tetruc1
59,001,818 *06428BDB79B68EB58D61EDCE01C1C2F6BE12ADC5 THADDEUS.HAURIN
59,001,819 *0640503616CF41533B6106631CD33FAAACB81AFF THATDORK1993
59,001,820 *06490104DC20C66F2816D0228EE82BF0C5C04A7A THATHUGO4
59,001,821 *064EDFC85ECF306C6E5581E5B750D9E6E2184B3A thauvonin
59,001,822 *06495AE032D8284A280BE9CA26AC32279CA7EC78 THE-EMPRESS-AND-THE-UKRAINE-KING
59,001,823 *064934F81ACAF43F8E3612437528FB22F70D4D11 THEEXACTCOLOROFMERCURY
59,001,824 *064509693F41004494596F1FBA0BB07C6FC097D8 thegen
59,001,825 *06447F35B4745A3BB24D6387154BA211A5783470 THMSSR12
59,001,826 *064A800715BBBE63E683AD6DD76DB104190DC9EB [email protected]
59,001,827 *064D2F2FE76C1CC3CA8C7D41423F8BAE5191BF19 TIETOKONESYSTEEMIN3
59,001,828 *064FC266D89327BFD54359A21D6C211F61527345 TIMMYHOOEY
59,001,829 *064AFE73CFAC05A8424C1E66E052C4B33E1BB827 TIMMY.RARING
59,001,830 *064B116B36F8C55F6ACB3F7F02C2AE7A0D1F39FB tinadokken
59,001,831 *064D18EB7E64EAB9470F833FD5BEEBAA20E22673 tiwleodfooh
59,001,832 *064DB56BF434E181D3EDD0AEA982778CECBA6A48 TOBY.ODOMS
59,001,833 *06471C916CDCFC9E1FE2A5B1A14367F772404E32 TODDPALINWORKSONHISBOOKPROPOSAL
59,001,834 *0641A784B013FF357E3D807DD474772950511187 TØKKT
59,001,835 *064A1198E68D4A225B5979F5C1E4526131CD4583 TOM.KUSTERER
59,001,836 *06453DEDAE23F51ECD849ACC6F51147A47A152C7 tommystinchfield
59,001,837 *0648390E2EEAC21A2B6B37E41849D91ECDC72A30 toryflaten
59,001,838 *0648221D5134011751C18DEF2852B7A05C54B877 TRAINWRECK(ORIGINALMIX)
59,001,839 *06412C8224BB6C478F7067E0A5B50B65753A5657 travisdebey
59,001,840 *064C111BFF297D918684F0E426793C47C8DCD57E TREMULERERING
59,001,841 *064F53E1BE20983F5120715314C501C5D5A24498 t.rouge.(feat..robert.wyatt)
59,001,842 *0646A6EE163B5CF688D629099F593E63F9FB7593 TROYAZZANO
59,001,843 *0641E2B81C5BD8A1A95F9CBF269AC94E5B9C4D0A trumjan3
59,001,844 *0640890FE9259DCDE50DF0ECC8D1AF67A05E0C6A [email protected]
59,001,845 *064148A4AD31EAE0AC1EE4E263690346C85E2B1C TUNNEL-UP
59,001,846 *0646EB5F2CD53102CF5CEBC06196324B9D337A5D TYRELL.GICKER
59,001,847 *06488F8DD121CBDA16760FAC7019E278D1D8E77D TYSONIGOU
59,001,848 *0642605C69467103828398285E956FA2F72117F7 tyszznecllxj
59,001,849 *0648C4436CE54E91E6FB23592E3BF8868080529E ÚTÖNDUNARLOFT
59,001,850 *064BF3A573A6C6004FF054B8B473CBC32FAE45F3 VARITAS2
59,001,851 *0641BD45929850680E2BBAA2459A07B21295E095 VEENALIDBETTER
59,001,852 *064341B289EF200AA52663F7ED446F23AA40353E VEKLUDENE0
59,001,853 *0646332A23E3DBF2C603181F8EF9DE00E2B7E292 vendrigovskis
59,001,854 *06448EA38D25F954A983BCF01F6A51AE481E0AFE vennskaps
59,001,855 *064CB4C13E87618477B481FFA9126C96D5A5B406 vidhya.jilundru
59,001,856 *064D6661466BB14730B6BA6785E8C049DEE53091 VIEDIETCH
59,001,857 *0643359935F24A91AFEA681AE77742E71D054177 VIENGSAVANHC
59,001,858 *064C5B26B893FDD8A06E1522F9DE0EFF4AAD34DA vincentschieber
59,001,859 *064837B8B3F5C7B79EB1D58AA2DAE7A880C78900 VINDHYA-BASNAYAKE
59,001,860 *064595D8235DCC695BE527042BE64595A104685A -vinh
59,001,861 *064A28CB38B56998CA9DD33C11317DD7A5D8EC2D VIVIAN IRUBHOGBE
59,001,862 *064FB4C96CA57FF0F2D1B93CA06B7A04CDE66E51 vjx=
59,001,863 *0648E93FF0A87D8C2354C75B6E73D011D5B0B85C «VOLTEAR»
59,001,864 *064972CF1AA5E89428B4FE686D4DE870308742CF vonhammerstein
59,001,865 *0643BF601E6C19C8354C3F3F2796159E5CFC28FF VRSRGNGSSPNNNGN
59,001,866 *06471B40D8A4793D5EB404AC9D9BBE74C7ADF503 WALDO.EWART
59,001,867 *0643ACB65D05E0C2CEBC29A182F92BD0208B7B39 WALLYRINGER
59,001,868 *0644D027BDFA2BF9E2DFF58D90BCAF0C304380DA WARNER.WINE
59,001,869 *064E5FFCFE4B8B5A533760EDB273D293ED043DF0 WASMUSSNOCHGESCHEHEN
59,001,870 *0645564DBDEF3863B9467289C62578C38B142B8A WEGERINGGED
59,001,871 *0645AAA6E255897E047F0FBA4C93308A0DCED52E WEITUMFASSEND
59,001,872 *0641D8E49B6C5EB3BF671A6015DC0C1EF47406BF [email protected]
59,001,873 *064F0E3A6407697668603E4E77E06233E02ACB73 WERDEN03FRANKY_64
59,001,874 *064157ED93F3F5ABA758DDE26EC7CF36FAE26EDF WEWEN.AJA
59,001,875 *064F8E4D06FD6443D3D5657F56C261D95204355D who-overcomes-by-force,-hath-overcome-but-half-his-foe
59,001,876 *0643DB24713ED14D2946F2F661ACD6805DA290C8 wh!pp13tr33
59,001,877 *06495D3542FFC4952AE6D2549A8E92E5648546FE wilfordraglow
59,001,878 *0644AC395182D2317192A4C2BB6CC0E2F4417586 wilfredounzueta
59,001,879 *064C2587263800B36CC2228605EF5E0E1B80C1F7 WILLARDATAMIAN
59,001,880 *0645ECADFCB0561F568FAE02CD9FA4840878866F william.e.morris
59,001,881 *0649200932D6E00C3C09016CB20F3E9C5F8AD155 wilmergehrke
59,001,882 *064773C2DEC3E465D6AC901D1E84B14A30AAC4C4 WINSTONGUNYAN
59,001,883 *06461E80F148114124EFFEFA860EFBC933C6F546 winstonwarner
59,001,884 *064FEBAD12DD87D7DB08273002873DB6A0110D71 WWW.SITE1.COM
59,001,885 *06472DC46FFC3687CCDA360C983C6864417CAD06 xainab-mazhar
59,001,886 *06482E83E4EA03677334312CA3CAB59D465C949A XBARIDJI
59,001,887 *0642B47977EECC6252B3A37228E74F0E83F00919 XEANJON-DEFENSOR
59,001,888 *0646CA367E9819FD1D5A362DF73DFCB69248C454 XG204
59,001,889 *064ED37188BB4BB95FDD94FF2DC0E5FAD6DB41D3 [email protected]
59,001,890 *064E3AEE8E9DB7D49568E9FE6D1BB1BA819EE61E XU_ZHETANG
59,001,891 *06443160688E801CEDDD5A8F1945D8321ED642AA xv*t
59,001,892 *0649F169C12CC5CCCC3AB1FE82915B7E8E8A2581 yangzhu7
59,001,893 *0646F7CFA7E850E2D7B7E1F597FA7F317B9270DE yfer-paquita-oaquiera
59,001,894 *06470D50A4EC2CFEEC4A75E66ADA87631A3DE80B YKSIL
59,001,895 *064A534BF4201691E3AF4F13599F916F5CDFC0B3 yosa-m-handoyo
59,001,896 *06405D017A6C599BBB65C54E09E53D9FF7C09B7C [email protected]
59,001,897 *06475C93971C593957050B12256C0D7C4C573268 yusrasafadi
59,001,898 *06479679DDB33B80F7920BD3CC8CDE28E215B22D YWHZ
59,001,899 *0649FB15D2D461A7028CE26B61F7CDE32A3484A5 ZAID-ABU-LEIL
59,001,900 *064CF9611C125F38C42772D66BC52EEEB0D4AEF0 zeiremrofed
59,001,901 *0645EF653A62575CBB617A437F54E24AA19BD6E0 [email protected]
59,001,902 *064A6BB3AB2C058030F2B2A394DD5538F859708C [email protected]
59,001,903 *064350A18529CF754A55C5FE09FEE90362FCF910 ZÖNGESZEKRÉNY
59,001,904 *064E5B14C098611F0B0881FE79521A69CAF5CCD4 ZTEN
59,001,905 *064BBF1F3FDCE9E1543B198F3D4565D18AE59140 АГИДЕЉ
59,001,906 *0646E265EBEC5BC3D8911559CBA9F6F6BF3485C3 ДИАЗОЛИН
59,001,907 *0643439ADD7222D6A3E8C38B3590CB00298C12A3 індэстрыэл
59,001,908 *06429F061F9F18D2DA059BB49C04E0F4A419E5D1 КОНФУЗИТЬСЯ
59,001,909 *064E0672C7F66599476C868F81C27262FFD3E9A4 МАЛРАНИ
59,001,910 *064EBDF39E216F6F292FB2D63589A21431041994 ОРАТОРИЯ «ПЕСНИ
59,001,911 *06423417DA25DE9B560B0E90C4CF41246161FB19 поздневе
59,001,912 *0642008C35AA806E88641AD4F6B055230BA1B391 шифровальное
59,001,913 *064E76A59146CD55E3BCF424474A0367C6C1370A 其英文版名为ANTIY
59,001,914 *06473AC78C5BBC07B899BCC961AA134DC71EFE8D の普及によりo番ゲージは衰退し、16番ゲージの入門用としていくつかの電関が普及した。
59,001,915 *064039EE08FC8461560C8C55D23602399008CD45 0aaeb2cc25c0199f80c6a3ad97cd8417-jcyhwci9
59,001,916 *06402DBBE0E674A161EE20C394776B4C9650B7A7 (0_<)o~-0~-<#####3
59,001,917 *0642CA7CAFE0504CFE056ABCA207E17766FFC70D (_0).~`.q3
59,001,918 *06413DBDE1B1D26CA07F777AC25A98ABD27B83C6 1061723 ein plus ist die sehr gute nachwuchsarbeit
59,001,919 *064281E572C0849B259C091CF5D07819151338A5 1190968 PROJEKTIJOHTAMISENKOULUTUSJAKEHITT
59,001,920 *064FE4001B4F2F399C8DE0F3738452828A409C2F 1342416 merkitt
59,001,921 *0641FC0E277DCBF00C5B50BE50C7D19C5A35DF36 14.11.1112
59,001,922 *0643F7AFC6CD56049F51EFE143A3B668B17DF12A 1502098 saumauksessa oli vihre
59,001,923 *064AE02BFC43FF6F155A936B98335B9DA6B92799 152764 senatouyelerirektorprof.dr.
59,001,924 *064CC6B464321CF17B0A1654E4CDF3DED60B790F 1578545 myllym
59,001,925 *064DE0E2F552038020A0C94A491E8E36B3BA141C 16june1347
59,001,926 *064072CA6D52648346B7B6A6C058450F7E92E06F 1.arkilaius
59,001,927 *064DD4B0941EDF31B1CE8DAEAE9809F90B666319 1-BIOTRANSFORMATION
59,001,928 *064AF3DE4C0A9C695DA4C902C022A21675C20489 1 deepdiaphragming
59,001,929 *0645B59F113AD8F4C2CDD5986963C604556D9697 1.DES-CA
59,001,930 *064EBE649C5F0D25736CF1903161545ACBEBDA9E 1.devyne
59,001,931 *064F8F8CFEFDB350BBE9175B2AB0F9017F538E12 1EDNEEWEB
59,001,932 *064429094286D3A275CFB8C58C52A80CEE671849 1ETRENOIP
59,001,933 *0641E4264002DC304791CD28F89CFA86CF179FB9 1 government'not
59,001,934 *0649EDCE3FA4F2E4E8FF65E504BF17A3CE56DA69 1I"AAA
59,001,935 *0644D35FC5B8B17D65C12C8C3C537FCA4713454A 1ILUVICEMAN4
59,001,936 *064608EC0E0B11551D5C8734794ED731F2589E57 1KANSCANEDUSTAJAT
59,001,937 *0643FF885CA188B63302E66D21D378A3AD57532A 1kohu-uutista
59,001,938 *0648BBEEAA22F1E357336845C37692CFF3EE88F1 1KORNIKI
59,001,939 *064FB1612812D80B07C842F7698E2D6577CC769B 1-K-RAUTOJA
59,001,940 *06479AD9C2F321AC84AA99C16D00505596E2CDF7 1.levyty
59,001,941 *0644983DD037CED84A17E5A459B8D4191294BFB0 1-MODERATORENGESPRAECH
59,001,942 *06420C41A3F4FA944546B1991A2FDDE294975C67 1 OUT-DELL
59,001,943 *06467C4E1B8A6DAE1FD0498D7987D54FD39AF8A4 1reichsinstitut
59,001,944 *064A42E850E7610DE75DC5594610955DF076573F 1senoussy
59,001,945 *064960BC9AEBEC5CFB9864D6FB121AF32349FD53 1SPORTPOKALE
59,001,946 *064E566BE47EE4DF914D71F82C82DA6231DE9F02 1TEXSCUM
59,001,947 *0645E04976DB2CA3BC153F4E96A1E49E860A0D4D 1TURVALLISILTA
59,001,948 *064E9BB97C833B4260BA46B934D54E5B0753CADB 1.VIENTIMENESTYSTEN
59,001,949 *0648C24C6F1F4057EE63518FC0CF66C527787261 22april1387
59,001,950 *06466744617AA3FA45909778D69BF79A62FE4ADE 27SEP1436
59,001,951 *0642543170350DF0859648025CC0D232E3C784D6 292896 katsotaan-,-miten-suoria-sijoituksia-on-tullut-henke
59,001,952 *064C80728667E441C9E9A6DAD0C617750B35CDE9 2DESIOMAHC
59,001,953 *06454CE2A0C259E1649F826F7E57BBDCF146325F 2ENTEEMNU
59,001,954 *0641A05162787AE87C5BE1C2A3AA29C18D6AC57B 2korjaushallin
59,001,955 *06489E6F0C849A3CC2DCAAAC93D728756C9BFDFB 2LYHTNAX
59,001,956 *0647DE638846F4E0A1A2DB8125E467EB3776C804 2-private-partnership
59,001,957 *064855B8D41D37F7088A3244BE242B7BC2DFB0EB 2pygmies
59,001,958 *0648EBCCEBD4E2CC8B5686F783FFE793DA8B50A7 2STELBAT
59,001,959 *064B9FBAE606ED5B3F904B59C6C11F1A3996209A 2THELONGER6
59,001,960 *06452188EF01DC3AEE83657178737EA75376737D 318659 SEIN.PROZESS.BEGINNT.AM.14...FEBRUAR..
59,001,961 *064F1700A87F28E175C60078D84F8765C834BCAD 3358679haf
59,001,962 *064FC1ED145AF4624CEE94E047ECA445CFC0116D 3CHEERLESSNESS
59,001,963 *0642D8CD63200BA065D7AC8235914A5D7B883806 3DENCIJAN
59,001,964 *064BC26C366D0741ED5B4DF54AFE4D1F36C30B1B 3etelecaster
59,001,965 *064F072F218ADF88C93C0D037A9DA8DDDA9F273B 3 TILASTOILMI
59,001,966 *06433026D18DA9BA477C42EDB05201D21875FB1C 3-weldon
59,001,967 *0649CAF1290D3722C7F9D9741D2BF36750544A0B '3xaaa
59,001,968 *064498E21B630625516D9FF156DFA9CF12DE689B 4BLUEEYS
59,001,969 *06478D6968195A97E599FA75505B71E4AC12227B 4DACAA0028E50118C5DAD2B02DB7CE7BVRATPHPBB
59,001,970 *0642909A4CC07F43A4EE51607B835F660C8FC7D9 4KAGAKUHI
59,001,971 *064DC502736693FC5C5BC0A49AF4482235BC636A 4MIZZLIEST
59,001,972 *06449D58ACA9F33DCA4EC3980285D012146DBEEE 4STEENFEL
59,001,973 *064FB9886CC62E5C58578883882F03695D740F8A 4SULTANASES
59,001,974 *064D7D2C8C7269C982F48091B276107BF098C2C0 4SUZANNEMOLSON
59,001,975 *064C273EEB26305F66A85039A4ED14B902C818C4 4UT0M0B13$
59,001,976 *064D483C1E4999936582F0475C111F206FE2E29E [email protected]
59,001,977 *06467D5B919046E44159C133439BB6D568119DCE 5.arIzasInIn
59,001,978 *0641A2DFA84BD7DB9B484347E7B8E90F6A33B8E7 5FAYTONIA
59,001,979 *0646418ED1492DA2BEDA60D1C485DA174F229D40 5GRUNDEJERINGS
59,001,980 *064FE8E62096F0BC877E5826C0286F927604771E 5LIKVIDITETERS
59,001,981 *064C0D7605C1C5480C653E9D4E5BB0C17AA8F3D5 5LOONEYTANGO
59,001,982 *064A45C3090C9CE5946BCF4D40D1DA0EEEE9F8FA 5MIKEIST
59,001,983 *064835CAF99E60B9B25CB16D80DF7A1BEB59F074 5NAPOLEONK
59,001,984 *06491F873F41966D7BDB73D0FF4370922EC0D05C 5NEDROJLO
59,001,985 *06468921A277047A7892342704332E22040C6092 5overassail
59,001,986 *064BB5BDF9F21F27FA56D2CCF8B063D3703F0DCF 624AB4779B6FFE221ED1A49E7A1524B5MATTHIJSON
59,001,987 *064F5F1FA20114E4D7AA77E709BCF74903D9019A 6NANCYBUFFY
59,001,988 *064BBB26FA26D233CBC534FB52F025A5AED0E020 6THEINSANE9
59,001,989 *064F5412A727B0747B9125D113FB98056295AF05 722020 sen-ohella-meid
59,001,990 *0645B2875E5B5F9E629DB8EFC4208FFEA9A34C8F 736KRISTOPHER
59,001,991 *0642B31235DF0454B9E06FCBE98FB16E97038D65 7AJOKYPR
59,001,992 *064DE16981388F068F2AF9B0617F7576713BFC87 7EKFRAZOMASTE
59,001,993 *0640AE11754478A2517F507BECB120F12F24FD74 7HORVA1D
59,001,994 *0643FA066F219552ABF785495CC646F736869941 7ILOVEMERMAID0
59,001,995 *0649C970B0D82CE9548AAAE19C826ACEE09AB7CA 7JULMASTI
59,001,996 *064D987CC4FBF73089D7405AB84B1DF03DF25452 7NEINZELS
59,001,997 *06408703A305203B97DD5F5D03F7606B053CD6A4 7WRGERINNEN
59,001,998 *064E1289C62A64571C8955D405DC426843052E8B 8ANOITCEL
59,001,999 *064087AC4735E6F42E0430A410788C3B19B42556 8BROUDERERS
59,002,000 *0641EB99ABA4685487EE988520B65DB837C201E8 8iamwoofwoof
59,002,001 *06446F57BDCAE305DBD367545F73B07B7D3C23E8 [email protected]
59,002,002 *06492F28117BE68285C11039C71E8C830B8DA6D9 9ACAMAREIS
59,002,003 *06450FC281D97E5EE6F645D5152D63C9DF42CF6A 9AGHUIZEN
59,002,004 *0641DE20E8CA2F4779681928A3F07A421BE71C36 9ATSREGAJ
59,002,005 *064CF3A8DAB0575DDC697A87C234FDCDC34CB2F9 9BSWCYNICURE
59,002,006 *064A12059A7A40515728AEF5F5FDBA36A0893CAE 9BSWESTRICTLY
59,002,007 *0646FE6BA20C4892AAE435C2CAA1ADB6FEAB3DD6 9MICHELLENEWYORK
59,002,008 *06425A09E5968829330147FE2B8F7B3DD988192E 9NEVSORT
59,002,009 *064E8DA4B9354CF320EB340ED1C5EC2298AB9C7C 9NQUAILED
59,002,010 *0647F09B89C28D74C539A94265D4CAFE9682E199 9RABLIETB
59,002,011 *064CECA72662AD5114529E8D2B709D6D428FA5B7 9TFUEASEB
59,002,012 *064FA03A29ADB2195CFBAE5887D05DC90020063D 9TOROSSEE
59,002,013 *0642D0FAFA73B736D530C26668C8E75BEA0B1CA8 a1sm
59,002,014 *0644316E1C32A0E51BCB0AEAE987C6D440B59AD3 a4o;j
59,002,015 *0645526FD59421310D6821150CD11C3B4DC41252 A+4TU
59,002,016 *06448B96B0E4A9774C917B98FECF376E9AD0D2A6 AAA;{:
59,002,017 *0648F799ECDF11C8B563D31C7C3B114B984784DB aakfv
59,002,018 *064955CB70E96E4F7C5FAD9E2036207784788D05 AAQHB
59,002,019 *064509B6BDA5AD7E6A42D1E7F1A197F228F922E2 ABHISHHISHHICHUHING
59,002,020 *0643A2C6560C23B11A205E99CD32D7ECDF0FB461 ABK6,
59,002,021 *064A4F6A8BF9B2768D5664639CBF88A20527AF7B accelerations!
59,002,022 *0644F6E21C08F27EA78DCC512CDCB9D3828954C6 ACQURIEZ
59,002,023 *0643C082ECD984C0995AD4BA1B188F8477F44FFE adam-sartin
59,002,024 *064ADB3970ACC7CE36E61A5A44015CE598A6F200 „ADAŚ”
59,002,025 *064041B9E510331F220C06958794583B4EA82D50 AD\O+
59,002,026 *064F6B6506A07D0C512CCD819CF152678FC5DEB4 AebQ
59,002,027 *064286728D1A6109E0E3BEC5FDD0E215449DF740 aepuf
59,002,028 *064600A110FC6606246FAE0731B49B5EAC1B04A2 af,+9
59,002,029 *06433A84ED7AFB354691F64578A18DEC7220D940 AFGETUIN7
59,002,030 *0645FF845DA08568C48CA9550D479621E3DA56FB AF!M"
59,002,031 *06491B1584FC2EF9BDC79E83815438D487CB49B9 a(g8j
59,002,032 *0645F51E11FD2FAA2CC0A44C5460A75A54C65A00 AHMED.EDMINSTER
59,002,033 *06407399B65622CAC32AF0F3D4228D3215E02C4B A/HN
59,002,034 *0644A33E1E7A144C830DA935449CCD200CDD8F83 a/kb!
59,002,035 *064A9A74CE435ED359B046FEA707124CCE1FABA3 akbt
59,002,036 *0640170BDFF4B42CDA4F60735AEF5EF0033B4F91 [email protected]
59,002,037 *064DDBD34604B2B30F70DA2ADC41C17E67118CB0 ALEX_456
59,002,038 *06447FCC4BDDF780EF26B17FA6DE51B3038FF6F5 AL&GV
59,002,039 *06427696B502EE08377EFDC12625604685FACF5F allenjazz1
59,002,040 *0642445368A3E930B50C774C6CE99ADBCBE2098B ALLITTERATIE7
59,002,041 *064F292A771FCC05695C1CECD1BCB2CBC36E932F ALTON.FIX
59,002,042 *06409362606A62CFAB11E5E3DB0FBD8C300DCB65 ALYSSAZEL
59,002,043 *064BAE37F89A50A45A76BF2CFD4E0D3EFA416FE0 AMES-SCEPTER
59,002,044 *0646D96B9E45C1B69DC3C49635D0B6766E23F38F ANNETTE-MARKERT
59,002,045 *0643B23B4F9C5A39E109E2FC5B77DD2B8D565248 ANT1EXPORT1NG
59,002,046 *064C9131896629A46E0C801DDCE9E5D1B8F4C8C0 anthonymacmillan
59,002,047 *064BBEFC50B3BF3727DFF76953738DB3CFE98685 antonydigiorgio
59,002,048 *064BD8DB216098D500C2D7EF112724C22401E343 ANTRAGSERWIDERUNG
59,002,049 *0648FC09657F6365B36D559E5D3FB26476135643 anvv8
59,002,050 *064EF7431AA1B66002C8E9C371A545D1EA431709 ardencobarrubias
59,002,051 *0648C228E0B3F6165A16CCEE7A1D73631755AC4C ARIELLACHAPELLE
59,002,052 *064E2E8F2C365AC5BC5DC3333BD7880C4E827157 ARLENMILIONIS
59,002,053 *06481C0B936C9200A9BEA853575E33BDDF29D4E3 ARMIRAM6
59,002,054 *064654723F00CECA3B65D8F9EFC670AA0E119AEC arxipelaqi
59,002,055 *0644BDFC52F00F8964DD588276B67F356718C3AB asherov3
59,002,056 *064FE8B642AC2F60AF3ED0499EE1FAD28B04F344 a,:&t
59,002,057 *06481C26D09BD27ABFD7083F0667D25D8ADAC883 „ATANASIUS“
59,002,058 *0644C351F045EFFEBDD9F66431039FA30AE55584 AU3/W
59,002,059 *064D8B739519458955BED7BD2A168DF457987EA0 AUGUSTUS.HANTHORN
59,002,060 *0646AF6C2DC10A9A74CFEF530715CD620178903F AUSPUFFE0
59,002,061 *06449277B9425EEA9F327213B9D9497CCDDDA6C6 austinmeath
59,002,062 *06465FD2C1AFBFAD039D7E1182DD3C0BD83F4B65 australian-visit
59,002,063 *064AAF09895A26AA7AF4421E4E678A2055608BAE AVK-V
59,002,064 *0648E8C4FED9505B8B7AF6B3732C07F813345664 az)sh
59,002,065 *0643C28A467A827372791C0CF9F7C4A6D33DBB2A b0rpa
59,002,066 *064BC9681B52DAC72C2D6A37F23BEE7557E4D2EB b1$2k
59,002,067 *064CACCC12EF00790EE041CA4540629B5236199C b3cs
59,002,068 *064A5CC0A20BFD166A72F7041FBB5BE74279B565 B9TSE
59,002,069 *064347F11443967B4A25C2C8436F3B55012D91A7 backelman3
59,002,070 *0648365DC21BD0CB44B06F867714432BE4298D56 [email protected]
59,002,071 *064212A8F63D78FBC0E35DCE56F07E3D38C38241 BĄKIEWICZ
59,002,072 *064D40419F5A421ACC16094E4918FA2AB16BE54C BB2%N
59,002,073 *06455AE2CDE164A95DA80AC9BF99DF38FE0A2DE7 bc7ai
59,002,074 *0640706EF801219873F618A2E963E832584C64DA beaconsfleld
59,002,075 *064B5A51F04D97D113B7AACD92B35A506A99849D BENNY.TERNES
59,002,076 *064335558644E1B094D3AD3E842A59E423C535E8 BENPOSTMA
59,002,077 *06456934D1936C0F523BE2E6E0FFBB0FF24A46EF BERNARD.SCHIMKE
59,002,078 *06464470073AC7F9E8234DF68215CE84234FDA15 bewalmt9
59,002,079 *064CFB55EB3D0EC471A2F644FDACEDF31B215660 bf!oq
59,002,080 *0647DA4683F901BE862FFF932E0143B456E0A6D5 B+FOT
59,002,081 *06437734160AE21F32E48C9D05104BECE9F85746 bi&#,
59,002,082 *064CB537C2D8A2BF9042EA9170141558940284CE [email protected]
59,002,083 *0645420CD70A3C24A31F148C6AFB3EF1BCADFD73 billyreagey
59,002,084 *06463E757A0DF474F36FD91D80CD1D63A7AA289E b;,l,
59,002,085 *064D011ED756E78DA375A055DB099855B3B2BFD5 blackbirdpie
59,002,086 *064A073F899884F6BD0459D4BC0C53B44EB591B1 BNHR?
59,002,087 *0641EF6B2FDF6FD7DEDBC5C4BC65822BDAE53D65 BN!SX
59,002,088 *0647C8AC0776E8BACABF9F227705ECF696FF3457 BOBNMICKEYC
59,002,089 *064E1C30E60CD0C242EEC8955EAD4FE888E963D8 BOG4RSUS4N4
59,002,090 *064378B5D95E96781C119B84630D71DD48F08625 BOGATIJOJ9
59,002,091 *06436E5259D33EB621A40E81A2D9A6FF0C4259D6 borismatuszak
59,002,092 *064357A6C68AB48D118342FC0E749DD1B6142030 BOUH
59,002,093 *064FAF5ACA06ABE98E63A78FEEE9489413E0A331 bpizu
59,002,094 *064E15A47E5AA5F5F6A8E9BE6AF42E5A09993B5E B(:Q
59,002,095 *06424D14E8E7C1B76205291774B6CD4D783461BB brentonprins
59,002,096 *0641F2E9078EEE8CA9CABED6000E9BCA5FE7A16C BRENTTANNEN
59,002,097 *064FBF6FE15BF7AE3D75A92333B862208F937E4C brestové
59,002,098 *0648BD55E17299C775B147EC9434DC963365129E BRODERICKSERMANIA
59,002,099 *0647D3ED03103E78BE337F51E5146E4CD9357564 BR_Q)
59,002,100 *064F2F07279C2F0AEB567762B3A1D5470C26CD05 bs9p!
59,002,101 *064191078964B313981D70B2CC989228A27FA709 BSWVERADORBSW
59,002,102 *0644A09F5B065481115DAE26F19FF51522A251B2 bul7x
59,002,103 *0649339F3BCC080F2351D6340A1EB5F7ECDA7905 C3iY
59,002,104 *06475C796E9750515D1F312FD74C84DF23CDA264 C8rm
59,002,105 *0641C0D91B0EA911FEE60A816FE6F58FBF5AB480 [email protected]
59,002,106 *064133B1D08981E119B1E15AD53AC8D163F57F53 CAMPELOMA-DECAMPI
59,002,107 *0647AF4F614D0F82C9605376C856BADCD8936E1F [email protected]
59,002,108 *064D4FEA8C5CA10FE02625EACB409433AEF5A5BA [email protected]
59,002,109 *064137EF86E7BE428C07327E2111F861BA817A60 carcin09enesis
59,002,110 *0640E0376D282864514AA186D34CACE9ACFF88C3 CARL.MACHIA
59,002,111 *064979573C9D58D6BEC1E36D840E64F276C891F2 CAROLINAMCMASTER
59,002,112 *064F4E3E7B95C94D12D2193D7DC294A1754162A5 carrollsoledad
59,002,113 *0642129D14D7E24F27C2187FC4E319AD452A401F [email protected]
59,002,114 *0648E0EBCBF8500395E7B2DC151F48AE174A3EB0 CARY.MEXICANO
59,002,115 *06411649BEA849271FEB3DFB54692EFF08B84B31 C,B/
59,002,116 *06450701B4C8C76211CB4C5B1E1DF3B76AD6E152 ceresola2
59,002,117 *06467F88D04A28289AB77A6BBD8D2BF941BD5314 CGCBA
59,002,118 *064C95D91BB6CF99FF444F0AE312C14FC53C6E7C cgut
59,002,119 *0645A4DFED83D553F35268998E8C1EF73E456D84 CHARLEY.BRUSKI
59,002,120 *064365A2F5280F7823C2EE0FED1EE53423D85F43 CHASISTYD
59,002,121 *064567428DA831D2884C2D0E207BB3F3E447E1E2 CHEERS-SYSTEMJP
59,002,122 *0645B9E565686753D549B81B5349DD88EC3D953C CHHM
59,002,123 *064F4DC21FE508A3810AF364AD1271DACCAACD25 c!?hs
59,002,124 *06478754F4D0559180EDDBF9A7A9E871CEE1A031 c{'i
59,002,125 *064680D1173973EB7172CA119560882719D289D6 ciminus1
59,002,126 *064D94E46439255D93BF4348D357F730CC3B2C3C CkI
59,002,127 *064CDC13D119D84CF767B850CBCA581B88767E99 CLEM CURRY
59,002,128 *064805502F4561430FE7F480017A87A3E066FC30 clydekarner
59,002,129 *064E8D7F26D8E28F83C2DC68723AC4AB0C32AEFB cm3lq
59,002,130 *064D880F97F53721B4F3EF9107D404EC2DB9827F cn,e0
59,002,131 *06437D30830309E16FD0DD04171647E45DBB337F c'oe
59,002,132 *0645D68A198C46D168489774948E794C2981C30F concertono.5-affettuoso
59,002,133 *0648FFB7783E84B57D7DC7CBA7754ACAFEDE0979 conrunner's
59,002,134 *064109C88354DCEDFE034D45062EFFAD08640DCC COSCARELLI1234
59,002,135 *0641A73EA833C7D7C4AAABA2ED4F7B065F511D96 COSMICA11Y
59,002,136 *06400EB43D35C35918051F7D01BBE62145742F36 cqh-u
59,002,137 *06467589B8C0E3FA860441D4FC05D72164A27EE9 C/RAL
59,002,138 *0645F0032548054D2213AAA4763222A60377CF37 cruci-fiction(livingdeathremix)
59,002,139 *06422B31D799655BDBB6C2A7BDCF8271D073C366 CSIM
59,002,140 *064798432133E66F9261D6C6CDF11BD8D0EAE149 C:\WINDOWS\$HF_MIG$\KB952004\SP3QFE\MSDTCLOG.DLL
59,002,141 *0643BD37FB25F0E9D71AA5D48180A402D1AB84C4 CWOKE
59,002,142 *064F8156C297A17A2638EA5E9C3EDF95C440AC7A d2x90
59,002,143 *064B415DB521868A1368AA331B17C55DF439C923 D3SPO+
59,002,144 *064D381D7F0300A4BF232915DDBCB8B909183915 d5-#f
59,002,145 *064CA98EFF747EE61AF4EA8355F5126A5D5C6F6B D7gc
59,002,146 *064687C819D22B9A4C83A2A4D4FF8C3F54BDEE75 DALEBAUGUESS
59,002,147 *064C57A1FF593B5ACD330B8BED5CA2967E4822CB damionhaggberg
59,002,148 *064B7C5F0F46609E33F8E3F8E6AE043ABCD136E1 damoncavrak
59,002,149 *064995A9C7556AF98FFDA4E965940F00CA5969E2 DANNIE.TRUSILLO
59,002,150 *064E8E989B08E77B4EA03A4A79E388C03EF26F27 dantegarrell
59,002,151 *064281A3ACEA2E960DC6A0A659BB078366725673 DAQV
59,002,152 *064A33A2E936EFCB22C10D5ECA90CE469B8ABD34 darwinnelon
59,002,153 *06492767708E6AACA039BF774025D991A88F7207 DAVEGARROTT
59,002,154 *064AC3AF757D6ABBAE8B5A002F40027B496DB204 daveschwinn
59,002,155 *064B35CA7AED1BE8F7F76D3881F42FB675F76107 DC?QM
59,002,156 *06452AE4B2714CAA03AEB65A9D066039F4B09DB2 dein.held
59,002,157 *06494DDB6CFA44CAE4A58EB2CFB0CFDFCD1B7534 [email protected]
59,002,158 *064D5269BDE3C40A493FF72715D49AE24AA74249 [email protected]@T0RY
59,002,159 *064E49CE0DCC3D7DD3838F927C9ADC971A8FF7AE [email protected]
59,002,160 *0643E20C126DC5E399D4230DE37D975972B62C45 dennythorp
59,002,161 *06413AE726D8997FBF21347E0E719BE782BB3D04 derait
59,002,162 *0642EE7E878D05A09826089ADF3CC6B3F9801327 DESCEREBRARIVE
59,002,163 *064276F44E2698B6E5124CDD62191D668033FB5A DESCRIPTIONFAGONIA
59,002,164 *064A50D95A64C4C4DCAF7E1B334F7ED95613ABC2 DESHAWNSGRIGNOLI
59,002,165 *064284A10B9C3B9F7D5073D8A0F977BD905D79B2 D:EVR
59,002,166 *06448F73A4D8D429F1D03A5345F089989670C955 DEWITTVONDRAN
59,002,167 *064C8DF40EA6F4078B927DBCC24BFE8A56B239DE df6t!
59,002,168 *0649FC1CD7FD6735572D8EFFB11B8050368DBB94 [email protected]
59,002,169 *064366355BFDD1D414BDC94A13EF1F2C5FEB375F [email protected]
59,002,170 *064E0CBFD10FAD25C19293984096D4FDF22DE9FB dionahr
59,002,171 *0642FB498CB8A2CD0AA8142E69A90A43ACDD4B25 DISHDRYIED
59,002,172 *0647A53C7271503B9520A97B2C4D33E9901ACC5C djn5i
59,002,173 *064B46D6CE3534F2131B497210DF601C254EE43C dlmuy
59,002,174 *0641922F0615F0CB860B66B274AEC723E81E90FC DOLORYCE0
59,002,175 *064DDFD10401C3FE116C0135237913CA9CC7D69C domm"
59,002,176 *0643872B1955402E70F9B595DD883096E68BAC11 [email protected]
59,002,177 *064A6ECFB521FADDCDE26BB2D6ACA3D475F422F4 [email protected]
59,002,178 *0640BAB4ABAF06523D1C609D594F03E1718E5E1F donnatomer
59,002,179 *06486BA144D3FEBD508FE8D1F9EADAD32DE7A457 douglaskil
59,002,180 *06420998B2BF7C1F9739692903951EAEB752C015 DPH5
59,002,181 *064361253EE2B585A8D4C1BEAC3D3F174800AD40 dsr!.
59,002,182 *0643BF502F88581180CF1D545D9C2AE2610EABDA [email protected]
59,002,183 *064444FE7A87BDDB2EAA145F8E592327EC6481BA DUSTPANED0
59,002,184 *0648BBA814FF2B055875141871575CFF61BF427A DUVALSSEXIEST
59,002,185 *0643499E96D4A78168548593902B5BA064634872 D%VBC
59,002,186 *064084963EFF5780799C1F2B55EAFFCD716D2557 dwlf
59,002,187 *064C16D26F698F1ADDB64DD6A7657D32BE2F5EFE EARLMCGUE
59,002,188 *064DBD44A2D332D6A8DC5639599460EC166EC924 ECIWT0
59,002,189 *064A62B3D150B76D05B2274C5E7B9C1B986C3689 eddiejustman
59,002,190 *064936312ED8C721B67035807C062C7BBC950DCE EDGARDO.SOSSAMON
59,002,191 *0640967C485FBF282F966520A6206AA85A5D8146 EEBYBLS8
59,002,192 *064B0B242F966DE1996E902144381CF7382B2D60 eej3f
59,002,193 *0641ACAC040449AB93A25F08F9E439872242543F eiuk:
59,002,194 *064E63C519E0D82FC50BC4C70702FC6336DCFE8D ELI.LANZO
59,002,195 *064E9C4637AB36626D3F4EF6ECCE1C1CA19E0E11 ELLIOTTBEUCKE
59,002,196 *0648E0F7145B5D372C0611CBEE36733845020299 ELOYLUNDERMAN
59,002,197 *064AF5FDB93AEECD51E6DA5934028FB1F49DB1DA em3w
59,002,198 *064B822691B3FE6CE8AE866B14C7716F8ED5A212 ENOCH.ORIS
59,002,199 *064055FC92BE0505147246166CA5EB166E89FBE5 ENO%S
59,002,200 *0649EA7BC7855817B38FDAF920B373BC76D8783E eqdjk
59,002,201 *0641C3304A2432825A822B14A732E662DB44F6BE erbenangekauften
59,002,202 *064FCEA05099750E2B8ADF5CD1C9A051D8B82485 ERIK.VALLONE
59,002,203 *0640D8C4F49123580DB8896BAE0C7C9571D5C4F6 ERNESTOOURADA
59,002,204 *0646E0F8DDE5EA8D7A17958C496C9CE0C2D13DFC escape from the fire
59,002,205 *064E8E5A462FBED140A3CB73E8095B9EFC59A77D espn0
59,002,206 *064E3C180F05984B8510CCF2DF8E2CD152C61D5B ESTHAJNALCSILLAGHOZ”
59,002,207 *0641854D841DC22DA7A0FBE37404B16E49B0C76E ESTONIA.BALTICNORDIC.COM
59,002,208 *06423DA352B3C7CF7C3FC06EC6BB5E4482FF2DC3 etnalliuqamed
59,002,209 *064E42C3CD2C9B912BF7E7F183B1E72F6EDD650F euukj
59,002,210 *064166D7C9122BBC260080D5661DB62EE93AFA05 EVERETTE.CABILES
59,002,211 *0642C73522D7A1B32EF5B9B8F0B793ECF638B7EC F1U0RIDA7ES
59,002,212 *06484EFF349C66C10E52EEFE411434209504E04B fantumf1
59,002,213 *064C30885A1BCA5D38A00EE7ED4B44D86E137EE2 felipemarcus
59,002,214 *064F6C4D61C1F93A315EB2B4513F04B2A62F4441 FETIFER9
59,002,215 *064F58D10A1739FFFB639D5C0A4AAD96B379EFB7 FEVENZEWDIE
59,002,216 *06450ADE70086C83A41870657A9F53964B1C8B00 FIAHY2
59,002,217 *064EB3ECEBA2A30469C2B984BDC0EB4882BEF7A6 [email protected]
59,002,218 *064FB321AA5E5C4E546A77C52635A64A8ED5D581 fletcherfinner
59,002,219 *06422235EDD8E8FF8C953C22CB0ABB4CF840E1DC FLRWALLED
59,002,220 *06463A9F403906C58B08A69D10DEE865E645EC27 FMSPBB
59,002,221 *0645B1727D030CE28A124AD207ADBADBB75669F2 FORESTPEACHER
59,002,222 *0648F1069A63B12EB20E84C3EA2290454F764D20 forgaengere4
59,002,223 *064AA1E6EF0EA71C2260A640BD14B861DF354ABA FOSSILDOM6
59,002,224 *0645664AF61B08ADCB9D2F0908CBD12DC3A753FB FREDERICKMACIOLEK
59,002,225 *064A4D6EBD396AA65BF868A8327BF504CBA88506 FURNIT7
59,002,226 *064A581ED4EFF26EA70E9FC6F7B94D7EEB451410 GARFIELD.AMORIM
59,002,227 *064D4B8A03C4923EA8E8E7D86C4A0188462562F3 GARTHBERCH
59,002,228 *064A9FE34BCBA1E5809908FD95901C04C20A60B4 [email protected]
59,002,229 *064D206BB484CD6D6E0AE9A113B888402995E026 GCAVARA6
59,002,230 *06404E8B4FBC3F2B3D241AFDD931182B5EF67130 gdcdrdhded
59,002,231 *06422C2CC85122154B4FBF7D2EEDCC973C7C1855 geralddragt
59,002,232 *0640D14BD878E61509F894CE2C60105ABEF641C8 GERARD.UNGVARSKY
59,002,233 *06497ECB6FE75BBC1E607A5D502AA099F08F7173 Getengeld
59,002,234 *0645E0F929C4673253B3F579507410B2D580BAF8 gji]
59,002,235 *06492C95DFBFFD5194E3D0B1525315D4B3EF872A Gl4zere5
59,002,236 *064380BB4B7217434C5CA0EB76F799AB848F4A01 GLISTENING.DAWN
59,002,237 *064FA6877C0F9A19E7F1361883DFAEE82E3E0AED gloriare3
59,002,238 *064BF5C1706A19A30022F3776772DE90EFD32AF6 GNITCANEER
59,002,239 *06471A4204EDB270275B598208807C380A6037D6 gonzalowhitener
59,002,240 *064E1F835A7E636ADCD5349FA389EFF54123C84B GOODLOOKIN'WOMAN
59,002,241 *06470671A785C3594FBB4327CABC656CB85DC136 GRAFSTURM
59,002,242 *0645070194FED6B07B63867C07E90A68893D56CA graureisige
59,002,243 *064F03EBE43D26BECECFB963D90B6D00C9D21A61 GREGSGRL4
59,002,244 *06439D1A706A21955FBEE6AA4D43BEC67DCF4AD9 GRITTOS
59,002,245 *0646DEE008FCFB6DB2870A25693D780267AA57D9 GROVERGEISEL
59,002,246 *06411D2BB53A0CF874357D1FDA24CABA34BC3BE4 g?tt
59,002,247 *064B0AF752AC2687DCF34CEC14CCF08A25E5FCEA GUSTATORILY3
59,002,248 *064891439DB0C03DE238382CB92D1A12AC8A78F7 HADASSAH85
59,002,249 *064D131D4536ADAC27A0D8150A4DED1B1ECCEC1C hallazgo-del-sepulcro-del-apostol-santiago
59,002,250 *064FC0E78B3CCA78EE588DAA1C68ED61A59B8DF8 hallo-world
59,002,251 *064D56DF5B6F4FBA72530F9296A7551B513A40E1 handsome113
59,002,252 *064BDD79D7F30922BB5734F8AF0C75655ED09B5F HARLANDWILMOUTH
59,002,253 *06489D38AC25F373A2F9C47ECE0376A0CDAF3837 HARRISWURSTER
59,002,254 *064FF5D97F0F4BF4F489482E394326B642B45D0C HASSANMALEKI
59,002,255 *064889E453E11FF871507F06F54A92B1583B5583 HCYSPOIB9
59,002,256 *06475E1BB2AD00BCE40B060D32CF45A0D0DCE1C6 HENLIGGET5
59,002,257 *06400B2FD8589F6C8BADE8CB62523719BEE65261 [email protected]
59,002,258 *064F7DD5F179A8D1F782CC83A1960291D4F866B7 HERBERT.TUTELA
59,002,259 *0640288EDEEEA36EEC4B4C5547489C0FA7E04D07 HERROBERII
59,002,260 *0643587D4160828761370942CA75CB6C2F938E2E hewantsyou/babe,i'monfire
59,002,261 *064E5D1E396E9DEA1530E8278514EC94A34B4A33 H/KO
59,002,262 *064BD848D19A2AF9EEA170121EEACF41FC76D6F9 hobertwik
59,002,263 *064411A79E03E17D895556C0C0678DF1003EB519 holds
59,002,264 *0646558DC91B2ED59F949E69C3841E7C6F7AAC00 HOMER.BODARY
59,002,265 *0647E63C3683D7C27236C149B21DA1820B71E5FE HSLAMENA
59,002,266 *064C0464AC15C9AE851CAC97C421B2443E419764 HUEY.CIEJKA
59,002,267 *064F7A0BF82EDD795ACEC2D9742CE6E4251FD38C hueymoilanen
59,002,268 *064FE82FFB70A049D7D88C5E14D0691C6F8FBB6A HWTBE
59,002,269 *06484E9CCFA9005367C0DA2A424A2373797F56C8 IAMJOSEE777
59,002,270 *0647C4D03ABDADCB7DB086055388E25D5EB2EDFB iamrescue38
59,002,271 *064F19E74D489A422584AB49F575C1503D5AA88F IESNEBAH8
59,002,272 *064A15E52A6AEFA0CCC86AD47D582CD1A0E502BD IF YOU WERE IN MY PLACE (WHAT WOULD YOU DO?)
59,002,273 *064B8A77FCF7F257324BF74E32357E389D59ED4E IGNACIOVESPERAS
59,002,274 *06485E44BD455AA1BC4EABCBDBFBED4A2DE1343B IKNOWYOURTROUBLESBEENLONG
59,002,275 *06443748E1CA5AAA90012BE4BFEB0D4CF5A5CDBC insaccav9
59,002,276 *064B27FC160BBD9AE2ECEF5C3E8A3DC2DEFAEDD7 In-the-Air,-Part-6
59,002,277 *0642B0720F99A8D0681E27AE2E618F9D64E37EF0 i.pugni.in.tasca:.fist.in.his.pocket
59,002,278 *06439B260BCE86A672FB5C959C66EEEE65C3F851 irwinorone
59,002,279 *06434F87EFF8110869D7F0F824EF422D742B182F ISLANDTSAREVO
59,002,280 *064D69E1441F57F3DBD21D3BBE1C04BC10A07425 itcxbsw9
59,002,281 *064DEC5534633CCBA476BD64E5F59CF69631C3F3 jacksonheam
59,002,282 *064BF525828751CAE0DD656DC0E433F921D5B1D0 JACKSONMANATT
59,002,283 *06479C0D57549292EA5512D3A79DB1ADFC3DD8A4 jack-tar.'/dz//&/k't/a/r
59,002,284 *064494A5286D8FDB6B7A24417DDC53EEB03EBDF5 Jah-Jah-a-Go-Beat-Them-(The-Wicked)
59,002,285 *064119AACC45E3FB2178604E221B5BE677AA7A5A JAMAAL.OGREN
59,002,286 *064E5E96D2D3EFDFDEA8D3AA31BF344D5B191A89 james-ginzburg
59,002,287 *064F1CF3CD1C33B1199049A056DDBB2749710923 JAMLAENGP
59,002,288 *064676B6D98120946843B582AC924C5EA21C3129 JANET MILLER CURTIS
59,002,289 *0641E604670A3B4FDD3DAB4CF63A6AFCAEB18050 JASSY JASS
59,002,290 *064C06DF7B19E9776889C6CFED3138FC61B804D8 JEANSTIMAGE
59,002,291 *06489957B1931BAE306673F437604108BB579964 JED PEDERSEN
59,002,292 *0649DE93B0479284A67AD07FCD9904E90414C978 JEFFEREYLAFANTANO
59,002,293 *06441223204C022AE876BDA18C2F5401B264303F jeffragonton
59,002,294 *0644C528699ACE884750AB4158393282B8032814 jerryyoungers
59,002,295 *0645FA1AB5DDDE51A2207F0A41C4FAFD4C939CB0 JEWEL.WHIDDON
59,002,296 *064410FEF4CEBD6F6439EE6BD9F083B3CF1D64D3 JEYM
59,002,297 *0649C3BB07D829EB31FE2E982F3D04CFD5A9E37C JN0X
59,002,298 *064212B92E1FDC543D343BF74EB21B3F31B006BA john-groth
59,002,299 *0648B6D104655618BBF5FD0760889BD7966968CC JOHNVANHOVE
59,002,300 *06413CE72B05CCF091E298041F0435E22CAC50D7 JONATHONSHEKEY
59,002,301 *0647C262E6353D7E5EA3D41799FBAE135FD43F92 JORDAN.AUMANN
59,002,302 *064154E97D3371D3C4E8458E01F79B38D5F4F09D JOSE.CODERRE
59,002,303 *06466CC03AE76F0B494B531C61DD7B727B39546E josephdyas
59,002,304 *0649703785F675E8805B4BD4EA649A31674EC799 JOSH.SLIGER
59,002,305 *064CC563116B2C1040A7632ED427776E48DD18BD JR+H
59,002,306 *064D9D83492A264C30F21BFECCAFE06DD13C78AD JUICIOSING
59,002,307 *064EBA302C1E2EC048A9F70CC0EFEF638DB1EB03 JULIE1SUZUKI
59,002,308 *06418EAE9B8F98B8974C506C50304411DCBEA0C9 jurores6
59,002,309 *064B18ED5196F73426ACAD5EA1AE01C212D1A695 KAARTEEN5
59,002,310 *064EB898ACCF4B2A3FE4E7EA3E915BD50AC410C9 kaseyheyward
59,002,311 *064D21198A9590215E634210002598CF8B69D473 kdx>
59,002,312 *064FB2B3C1EBCCD73C67B7521061A8D0EC06901F ken.bleich
59,002,313 *064D62D6DDD9221F6A5BAA3614C6D5BB2D6CF334 kennyhoskyns
59,002,314 *0647C8C501AE7036851FA5327092802F8DBDB3CA kennykastanes
59,002,315 *0647F74BC224560330CCF747C1A455A5E30AEEE6 KENPELZ
59,002,316 *06437EA28085A43D1D72F9EB378F5BDC9ABB4758 kentonweich
59,002,317 *06489F7FA2978543993DF3FA32C5335E1231B75F KEVINNORDGREN
59,002,318 *064DD8E087772A192C0C0D424C712D9C00DC4800 KMOCHGEORGE
59,002,319 *064E33434654578EBFF4C110EDCA8D78997D43E1 kojorna5
59,002,320 *0645A432961B3D911F08044DAE7DE78EF89610B6 KORNFILT8
59,002,321 *06449FAF7CCC404CDD163AFB47E8F49230BCD21C KORSAKOVOVOU
59,002,322 *064E94E7B28C9DE302A2AE39CB50DCF407107FFB K*R{
59,002,323 *064422E1EAD224923DB30E0E9863AE9490D4DF56 [email protected]
59,002,324 *0649267AA48306FAA37267FEB600220FA7B4B7A6 KUBBESTOL
59,002,325 *0645946BFFC978407179AB335BEA9FFB066FC279 KYLE CHERNEY
59,002,326 *064725B8B98B6FE5E14BEEF5E7912CE34BC5BB8E [email protected]
59,002,327 *064A1F3B059F542324834C33240E56201E070A9D LA.GRADISCA.SI.SPOSA.E.SE.NE.VA
59,002,328 *064FD430091197728AC718E9B14249E22BDBC709 LAILANI5
59,002,329 *064369F2A279BE29D4E7FDDA3F92E55527E9B5AF LAISATUITAMA
59,002,330 *064D3F1EB75274B684D317A60C586DA560B70F3F LAMCV
59,002,331 *064CB7152139F3E0B6E97D7C2BD1073219B5B426 LAWERENCEINABA
59,002,332 *0644170D6B5172A33C5EBB09359E169F11E75576 LEAD-SAILS-PAPER-ANCHOR-2.0
59,002,333 *06427040D44E0A809C72A1AE922F72F52E59A88A leifriaf4
59,002,334 *064551F0779E726A71B6447FC474D8F54EFC8A5F LEVERKUSENT
59,002,335 *0641A1FB11F5F69B658B65629CA7DF64424F2DA3 LEWEDIĘ
59,002,336 *064A859DC955286BD52E857C07C5F61CDAD438C2 LIFEISGOOD2
59,002,337 *064653E393F16C02C42413E3A52DC39589754662 lita-harris
59,002,338 *064A864AFEBB80207804E6639208D72EFB06AF67 [email protected]
59,002,339 *064825621FAEDC8B08DAAFFF7528B681F9C70317 [email protected]
59,002,340 *064FC54A25824CC5C532639E808818B1B2097ED7 liveonthesunsetstrip
59,002,341 *064234CEE5295CEECE11E74B2BF96CECE66A76C3 lojus
59,002,342 *0641F971272F8C4F4222CE59031A1DC6EB325CA7 LOUISPICOZZI
59,002,343 *064BB05885AB935FAC52A06601C3413A97B20ECC LOVEISTHEONLYSOLDIER
59,002,344 *06450689E5E58602D97D73B9A12461832ED68C58 LUKE9511:
59,002,345 *064C8C0E9CB5D94FEB0327633EFE1E6413278D37 [email protected]
59,002,346 *064116AC5B1C2E4C12D675941FE281B7C36F9663 LUSHBURG5
59,002,347 *0643269731F708AB84267FEF75CA5333955521B0 LYMANCZERNIK
59,002,348 *064594E1D6B32B210954535820BE42F043594C65 lynncohran
59,002,349 *064BCD76C422A68DDB2A199765BA2592D7408208 lys,lis--lease
59,002,350 *064BB2450015027DBFA87FD330B1009DD4B0BDBB MACK.NIHEI
59,002,351 *064EABB49EB8FCBB6F1674D4FA4CCE619A4BC169 MAC.STREM
59,002,352 *064B53C92678037669FC24D01D473627F3ECF906 mad32684
59,002,353 *06484DDD87F8297E87AF1D260F2FD19E107D4F0A malikmoose
59,002,354 *0647DC2EC4FB69ADA3973D3F04AC017DB34C0DEC MALPLENIĜO
59,002,355 *064FCAB0162266156D30FE67A22EB3776FD337AF ManiaDaru
59,002,356 *0647CE678C531440F0AB285701DADB2496D43A4A MARIANNEGO
59,002,357 *064CFC3311E9ED2C4B6198868656187D1C386C67 marianobeesmer
59,002,358 *0646FBBAF4432B9E8F68186730B43EB55D84058D MARIO-SEVILLA
59,002,359 *064330E9267008158726559805CDAA38E8B9A853 markdevin
59,002,360 *064A0551A761EA8B6A265FC670C3A93B6186851A MARLEYPOLARIS
59,002,361 *0649FA3B927601EC7CC671AF1197089E779ACDAA martials
59,002,362 *064015E83B2A66544C2ACC1EB024376EACC10933 MATHEW.LODEIRO
59,002,363 *0644CF6E3E23C4040ACF123ADB7D756A9A7116E4 [email protected]
59,002,364 *064CFF31BB41FBC4C21164ED728A61E21EFE813C medat
59,002,365 *064370F6E04FD4E7F844EBA03DB707BA1E066581 [email protected]
59,002,366 *064C866939A1FC7E907CA5EEBBE42B590EA342B4 MERLEGET5
59,002,367 *0642C0516E40DA045952EF2684EE519452B16B55 MHC-MUSEUM
59,002,368 *0648E51D0BB2D3F43B9AE643E2085299C6B318FC michealbatch
59,002,369 *0648B67E8123E40FC53F83FBB3A5EFDBF9D71F46 microdefense
59,002,370 *064B83BDC2A13346F9DD04061928DDDEB7453575 MITCHEL.VITTI
59,002,371 *0643B21962FC5F6316D0480CDA9F41CD1C264601 mi-vida-sin-ti1
59,002,372 *0647660ABE59E5EA20933FBF57267771C29864F2 MIZUMAKIMACHI
59,002,373 *06431BCB1FBADD45ACF3443C55AAED6231004563 @mljvas
59,002,374 *06444BBAD15E677C205F1AA61A38C2BD2E90821F [email protected]
59,002,375 *064BF2EFE0673E349FB102865ABDE58DC17E977E MOBIUSSNAKE
59,002,376 *0644F0F9C58236CBE6D834A90525C8313DCF2B3F molsonrobert
59,002,377 *06468F0F9C2F5DE3207E153A31D45DF5203A3185 mosaiske
59,002,378 *064D7E590105A8A4BA5D23B33A7A5284F6351D21 mudassarhussain
59,002,379 *0642875FA04D5014260C09F7B3C838716DE886F1 MŪLABHĀGA
59,002,380 *064E5E4B7F1E9AE9D26582D1E2419C33D99F1ED5 MUNGEYS
59,002,381 *0646E378211CC38DD40D5A69482F95702910701D N68146
59,002,382 *06476C10DAEE1ABBFAFD7AA2C0907F6E0FDB8480 nadmerna2
59,002,383 *06414DB18E50F3107517650F18442CBFE972EEC4 nationalität“
59,002,384 *0644B92981D510FDF5B0005C03E71F3430D4A232 NEIL.MCPHETRIDGE
59,002,385 *064FDDF8DF5E3C8327C6B0B4661310B1E87533A3 neoconservativealli
59,002,386 *0641CCAA4EAA48667F00205B14B1E77446EF04B4 nicolaskoening
59,002,387 *064CD10E519205B54F0E2A94C893D0A67823BA21 njrsmnt8
59,002,388 *0643947EDF1614E89182ECE737B2D9059DDFBCC3 NOOR HAIZA
59,002,389 *06487DF6219E5357C5E711B8A768D302B09B5354 nosmotsd'amour(disc1)
59,002,390 *064A2D00A2AA888A63291C68979B9EC5CBBA5D88 NU7
59,002,391 *064FD4072566B084B82DEF0B35E73C29AA433C69 nudeness
59,002,392 *06476A253025F46E2DAFEF6EBE650D8FDBB13A0F NYCTIPEL
59,002,393 *064B35AA1272BAE5EA1AC177D8CD9C990B964CC4 OasisfeatMikaArisaka
59,002,394 *0644B319E4D60D88E6872DB718B0B834608D7329 ogerg
59,002,395 *064F25837292C960E60E765D8EB09148F2AAB38F omias.rotundatus
59,002,396 *0644CD5457D31D7C99B520F3294E5D7EDE80A586 oracle'ssql*plus
59,002,397 *064AF2F6DB003E82428DDD47BE6CE8960C79BB31 OSAAMIESKINRAKASTAA
59,002,398 *064FD91FB61CCB013E5761C42429DEAA82783EE3 OSTKRIEG“
59,002,399 *0649420262A07ADD579C44B3075915B79A87517D ov3r314bor47ing
59,002,400 *06406DBC48BA19BD7109B7D82821D9A18725ECAD PATBITCH6
59,002,401 *0648BB9283071531C0969E91E0D101CAB78F1C49 PATRICIA GOODSON
59,002,402 *064888E85C78651105D560C20675FCF547215404 PATRICKSCALLY
59,002,403 *064402B61A826779D3B18F91A4F21E5B52619E8F PB`X
59,002,404 *064E57C25D53FC03BCBBEDF37EEE4EC0234AC3DA PEPPERDANIELLE
59,002,405 *0646E2B5E8E0281E0F5D10A41078FBE323A80F06 philipcsizmadia
59,002,406 *06456364C9D06D5C7B6A259508BDBA99F754B634 PHILIPWINTERBOTTOM
59,002,407 *064DC65DD51E52AC5AE2408808D0F153CCC51FC1 PHLOMEL$
59,002,408 *064F1DD49D417AB8E3A5D2CE9D2558AAAA4BFE0E PLANGIBILIOR
59,002,409 *064D703F84224DD6EBE5464A602D3F5FFD7E45EF [email protected]
59,002,410 *064192ED6B05D92E395E02FA4ABC3781F67A9116 PLYSTCHD
59,002,411 *0647CB3C8172F3E5C0EFE543ABCC3864F0929D19 POLICEMENTHERE
59,002,412 *064444ABBE171E1F395352B13069E8F3318A1CC9 [email protected]~O~O>-<
59,002,413 *064DA7A31C3D8BB55C8FA7B607640976D8E9D723 [email protected]~O.~O.(O_-)
59,002,414 *0649AA591B6400400050244A63469E9ECC05E413 porfiriosayle
59,002,415 *064588F8257F2E701B8AD098FB55021DE011B3DC POSTWEG9
59,002,416 *06416C0324060FE142CE74D4C04E4A145BFB8009 PRANCING
59,002,417 *064D053370016B2FFAB0DFAB11FF494D609683DA present-say
59,002,418 *064329EB66D8DAC609C25062CB2076E73FDEE3FD PRTTNNGS8
59,002,419 *0643F4FC14DEBCFAC6DB9D99EF3BA8842222AF4E ps3piratacomps3pirata
59,002,420 *064102E905385A7663DF554459AE93ACCCADC392 PSEUDOZOOGLOEAL7
59,002,421 *0643339492FF92F9D181BC7D82E553D1A7505636 PYSTAPALS
59,002,422 *0640DD43BBAA2591D57CE7D7160B6BB970676DA3 [email protected]
59,002,423 *064E10455E7E6F75F35DE4A6D1ADA6DD46234F29 [email protected]
59,002,424 *064A6200B55A1E2043D4927D4671926C85BABFA0 qpgi
59,002,425 *064D843DACE619329D9FAE6FBF4C64CCE171814F QSDJIBQ6
59,002,426 *064EF6D942871D39E4E3976A26D30BA8F4A8074F [email protected]
59,002,427 *064EC4FF4581CA76EEC5F7DDDB36D6A8400CEC51 qu4d 14rg
59,002,428 *064074D1991590CB94E293B1C951E964FFBFC1E3 [email protected]
59,002,429 *064200AA90543757E45DE7D71072CC57453C60F8 rachele-wilkinson
59,002,430 *064DD704BD92D519EF56231706FAC572D22D92F8 raleighschow
59,002,431 *06420EB5E04A3B4DB330C72E4CF7EB3250C6CBFD REBECCALAW
59,002,432 *064C32182E4C7046435D880A7FF7BFC8931A4ED8 REC+FC4+0N$
59,002,433 *06407E9960111B19B2B72BA32562DD033C1F69F4 RECSIEM
59,002,434 *064F95FDA7197B1437784A0C16DC6251A975286F RECTIFICATION-THANKS
59,002,435 *06418B939A8E635284657F000D5317DFBABEE652 reddysampath
59,002,436 *064ABB809922593FFC6E5797AB8EE3154E83ABFB REGINALD.MOLTER
59,002,437 *06433DB5896A5D01BDFAD40F2F33A8488F7DDC4E reidentified
59,002,438 *064059CD2606DA324FF4BE9FA00748BCF2511AEE reissuing5
59,002,439 *0641AADA4EE53C8DA9314228780E8905C81E3E6F RENGAGERAISES3
59,002,440 *064B961C6A75CB0E5D2B927795BF88148C91F98A renoue
59,002,441 *06490DAD2048D947D7F6586C9C06E59F338ADC67 RESERVATIONPNTS
59,002,442 *06470961D47F2B19CB0240AC0725D54721B09F08 REX430
59,002,443 *0641B3397DA7B930C09B397AD90DCE5068720CB3 rickeyderenberger
59,002,444 *06457C53F9EA4CF6CE94151DAEFABCF8F824CE87 RICK-MCGOUGH
59,002,445 *06447B948A0412CE8B59762320188A93F449A9F7 RILEY.MCCORY
59,002,446 *06433384FFB4B5AF357F9BB6DAC694FBAB2A24EB riyarane
59,002,447 *0642715B551ED4F8FB7D23BD611BDAE1AFEF95C1 RO3STI
59,002,448 *0648DC0ABBEAEFCE6CB9708882B356DE35AA73AE ROBERT.PARCHMENT
59,002,449 *0644B0D9FDB6E92DBC12996FE2E20E2B57FDCBC9 ROCCO.REOLA
59,002,450 *0644838FCF69310D6EDCA61DF0107CE487FEA1A1 RODERICK.PARINAS
59,002,451 *06411B2B784480ECE04E5CE0DFFA496BF9D8479A ROGYDDIG0
59,002,452 *0645CA17CF484E1F37BC68BB75E6D7619130503D ROLFYEAH
59,002,453 *0644B13C460C864E8A106DC4F52A08C69A4ADFBA roryminkowitz
59,002,454 *064363FF62CA3C211887B9D91ACDB080A84324C6 ROSA POMPA
59,002,455 *064C74BDA8C2D11FB4C38F13B91D5288CA4ADCAC ROSCOEBERTELSEN
59,002,456 *06497E80F88A8FAC9B776FC0F24BA79B6DF14E97 ROSSI SAPUTRA
59,002,457 *064CFE39200A8744F905758531A9E62664BF8EC6 royblanscet
59,002,458 *064BDC2FBD6DD6BBC62C16BFAAFC5854C3E64A59 ROYWESTBY
59,002,459 *064EE01D724F7780A7CBE0D1543A50E4D89795BC RUDYBELYOUSSIAN
59,002,460 *064D8E692FB9866AC543015D3C29262BDF1FA0FC RushHour(FonzerelliHotandSexyremix)(feat.JaneWiedlin)
59,002,461 *064064AE8DB61A827F286AA281A3A3E5FC4951B7 s4nt41.oi
59,002,462 *064BB352DC48760F2F46A4EE68C272BD076ADEA3 SAINTEMARIED'ENHAUT
59,002,463 *06406B3BFE181DA768FD0CADCFFD98DCF706E608 SALSACAZADORA
59,002,464 *064BD115B36ADB2EE85FC359C55067038F36317B SALVADOR.DAUGHTREY
59,002,465 *06479557597809570398741614370CB6BF5C72DB SAMDMANN0
59,002,466 *064CA0AFD09738D66278B4FFCB16FCCD5D98C100 sam.padda
59,002,467 *0644E368A0C011B008994A5BC25F6397F83DF0C8 SAMUELKELIIHOLOKAI
59,002,468 *0642937A9967C40962E89A965028BEBB154AC1A8 santiebeati2
59,002,469 *064719AC1A4011B92326286B8F74445AA00ADCD3 SCHWMNN
59,002,470 *0644B36B435AB96D8C20373DB5D1037B30AF9D75 sciencebutton
59,002,471 *064DECB62F8F03144C0F7D2687168E3A812B8135 semisynthetic
59,002,472 *0645A245F99FBFE5F7E19DF975B82BF4BEE16168 SHADIREFAI
59,002,473 *064DBAD14B01094E116445FC2EE1DC6E90E4A20A SHALOMS6
59,002,474 *064956A1E1F9AE342E11F7FB92D9DB0F85EC5CEC SHARDANAIDOO
59,002,475 *0643D8427FF46A1B2E108735DA92C430C4DE5412 shaunflint
59,002,476 *064F04D2249B2E89D898F4E2A83FBAAB3436B4A2 SHELBYKINGSBERRY
59,002,477 *0645AE1743BEE27E14BB559252AE764C351AA7A7 SHKVALOS0
59,002,478 *064AA327E26AC9F7007A8C61D847A9F2FC1E7A16 SHOWJYI1
59,002,479 *0641EFF340DD93E0E360B2364A181B5C7DE2A1A3 [email protected]
59,002,480 *064D62DDF285300264319EC3968748A3B2AE369F SIGN4LERE
59,002,481 *064ECBFCFA7E95D403149758C011611A90C2E9C0 @#SIMPLIFY
59,002,482 *064EAD3B0DEDBF0AC0694FA183FD9A4CC7E3DFC4 [SINGING]'-I-USE-ANTLERS-IN-ALL-OF-MY-DEC-ORATING
59,002,483 *064532A03B2061A77075E77ED69B4D99C62BF95F sister-in-blood
59,002,484 *064F1390DE16FC6F7702BDAFD32899B85D267152 sk9dd57
59,002,485 *06425961787702ACEFF65EE0C771F34C973157F9 SLAMMERISTA
59,002,486 *064EEE495DF45E7578CBCD15860A0F01B5DD3D7E SLINGUEREBBES
59,002,487 *0645AA1E42E7EE45BBB09B9A7D6FF0DA5A51ECDD SLITTED
59,002,488 *064345FF6095051CE6C9EF0C6165CA113373C948 SNAKNIHS5
59,002,489 *06426B093EDFA8A1E3B0DE8A09FEE45080DAD9F2 snednamrofster
59,002,490 *064DCD84B9F1D108D6544B607E906C731C6F17DC sois.tol
59,002,491 *0647D7DA93479D03423D12919068DC7AF041E8C9 SONBAUERKEMPER
59,002,492 *064B37EE3DA6904EBC2992D735C154C5BE062D77 sonniens
59,002,493 *0647EA38920B0915333A0378294E48388DDAD746 SPNLCHLS
59,002,494 *064DFAEFB6CAB3B9A4BA6CEDBB32D6FC078C8064 [email protected][email protected]
59,002,495 *064C9EC48F6CDB9FCD4D242AFF7A4BABE28FC222 SSICKLING
59,002,496 *064DAD8B319A218FDACC89E59E1CFFBEC1980DEE staatsidee“
59,002,497 *0644B22BB61ADDC0CBB6C4319C65D31977E7628E ST-ED-VOL
59,002,498 *0643524E9BF5AAE4F6EEB9B78630F1DF78961A16 STEINKOHLENKAMPHER
59,002,499 *06497C348BB3F649ED4785496A036D3B38CB4879 STIGMARIAE6
59,002,500 *06438D4AB74BCA3F76C8A28982481AA5A441FE20 STTKRCHT5
59,002,501 *064A681E95C4050D44D7AC0C02AE9FCED63451A8 stuart-elliott
59,002,502 *064099C2987242600C38615B8C9ADA5B8B621610 SUEELGOHARY
59,002,503 *06490E86DBFC54779B75403C0AB419525F18F8A0 SUITE34INDMINOR:VIIMENUET,SM239
59,002,504 *064A31AABE7277BDC5106041B1AB01DD5F6DBB14 .SWIRE
59,002,505 *06434D66521F5BC3B8B4F197BA1DCD2443010C0B SYYRIALL
59,002,506 *0648FB84AACE58BDB5411C6B4F268C589184312B [email protected]
59,002,507 *064432AB4CF6FA4B9EE4B7E8FA0A4A9F186CE9DF TAAVUTTHAAPYAS
59,002,508 *064FA0246EEE14D6FD88B50E7259034B08542D84 TAKE-IT-EASY-MY-BROTHER-CHARLES-(FINK-REMIX)-(FEAT.-TINA-GRACE)
59,002,509 *06451737FCAD5B584D766B2D6A98D92ADC3A639B tammylutes
59,002,510 *06424668082914956914E996BB3E3D198DB446D6 tcstv
59,002,511 *0642A7A357952EA4C525806959B20F04C1B88CEF [email protected]
59,002,512 *06496F4DCA2C6898EAF5DEB8A0D3CAD84C8AF048 teimoni
59,002,513 *0640D5833CC3480B18F3C0FF48D2F59FFFD10433 TheDreamofKildare
59,002,514 *064C57404DDA69BCF2EF10BAD4294D3AC1BB0E08 THE MOTHER AND THE COLONY
59,002,515 *064C96B1A7E36224C39D8E9CA25F39BEF0DEAC43 theodora,acti:go,gen'rouspiousyouth
59,002,516 *0640BC5DA8C88977458B6EF0B4FEA55690AA7516 therapiearmen
59,002,517 *064D71EABAD25A8C5BF04117B0387908753AFA32 TIAREICOSSID9
59,002,518 *064EAA773881E60C00217AFEF63450AF8FD9C247 tieftaeled
59,002,519 *0643DC994C3C0B5B5087B423388AA6C16D9BEE1C TIMOTHY.VANSTEENWYK
59,002,520 *064CA6FDA23BF51E7450442AD73B348890CB61ED TIM.VRABLIC
59,002,521 *06463B4BA20011F8A8C1582A02FE9834C21140FB tin cans and car tires.
59,002,522 *064E5AAA8D03E63C830957B0B453A1F722A9CCF9 TLITT''DAVID
59,002,523 *064FEF0CCA6FEB75C1B3944E1BD0952E31A9C8E3 TNEWENGLAND
59,002,524 *064546D34F3C3B696C3E5ACC738B0D7F38CC489C tommiebeezley
59,002,525 *0647D9A8D8EC7F8E0A582C926FA8935979D6C3F0 toneyclink
59,002,526 *064A576E01CD805D61B8780DD0158DA08ED266D6 TONSENIA
59,002,527 *0642BE2FF1947FAC9A13DB2B991650BA562E3470 TONTONES7
59,002,528 *064636141F43924D1C3F2A9B16872B309F4FFA1B TOUGHTE2
59,002,529 *064F031B9A159877E8B22A343231DEB5FB68C3F8 TRANSISTORSWITCHES6
59,002,530 *064F2A2EDA1E2D93B4BB56CEB097987E5D55594A trevorndlovu
59,002,531 *0641170DDD8D0D9D41501F155C42DD2CADE2398A TRISHA BAUERS TORTI
59,002,532 *064BE88E2C0EB91C26A72C818100E769BF39D1E1 TRISHALANE
59,002,533 *064EF39FA89DCCCB18793D91225B72E1FE5B83AE TULITIKUIKSI5
59,002,534 *0649BC733A368589FBDB87C33E99E073CFE9FA2A TURDIÓN
59,002,535 *064DF803A2357A4CB48E03452B59EDD815A24521 twist'as.loca
59,002,536 *06431D12CB14CD2DDF1E4E54D1ECE01280F1A0E2 TYRONEMAYS
59,002,537 *064554E6ABE9FAD618ED7B7F571F4D62B2BC2B07 uaetalp2
59,002,538 *0643262BE6AB4F5191A04C9EBB3FD5A2A25891AB UNSTRENGTH9
59,002,539 *0641DF829FC8264FF9CD92916BBF294572C64D83 unwastefulness6
59,002,540 *0646E47164AD0A41992B2A44AC4A39DFD4CD642B ursmwzw
59,002,541 *064303D11F74680643D1C3BB2A8319158EDDCE3D valcartelli
59,002,542 *0642D4251B69E0E498D6BBBF8A2F8153D6410884 VALERIEALEXANDERWILLIAMS
59,002,543 *064CDD52D720BCA8166ECE9F38154FCC9815A9A3 VANNY-YULIANTI
59,002,544 *0648071A6314518CE608A6049BDBDF4FF0FA5CCD VAUGHANALLRIGHT
59,002,545 *0641400C1C7938D1B14E887E8AE452DDAE49739F venesa-comito
59,002,546 *0648F7E6461F3C5752F28710961B7E91CD74D08F VERONICABURIST
59,002,547 *0642AFEBFB00A67215949759E7D1FCB2692F5E57 VHFXYST
59,002,548 *064378F86A71B6F9ABB4DFA1A48E24BC0788A2E8 VIAGGIAVASING
59,002,549 *064403786457096A5464B1F51B30A8F256DE555B vicente077
59,002,550 *064D891BCF344C838081048644FD2F13E97BBE53 VINCENT BONICA
59,002,551 *0642C59E803AA95661900B3F575AB71D30B2F09A VINCENTCAESAR2
59,002,552 *064340E236728D1E9599A9F6649E0FF95A3950DB vincentmgreenii
59,002,553 *06401A1E57A1747A5814273AADE817586C641D61 vinny412
59,002,554 *06493AC1B41E1F4E4C6698424E7B8B637561C4C9 Vis-kitaip-(feat.-Am
59,002,555 *064457AE50B7D4F4792148CECF08F8EBF3EF022A VNBWULDD74
59,002,556 *064E836C49B0923BEA0FD6614D11B1E68DBEE77F VOLA7!L!ZED
59,002,557 *064900DF7F8940959BC121A8197C773922C92FD7 vrmndrt1
59,002,558 *0646577B3CF0004896C07A3CBA351460FA001DC3 vulegesi
59,002,559 *06413F022AABE838F405E7CE025E26082EA0AB04 WALLACEDUDDY
59,002,560 *06421D6A7A0C38C9F5AD57319FCA6784D7217459 wander.junior
59,002,561 *0641CE3D6923CF2DF847E25181530231F1B4D768 [email protected]
59,002,562 *0643352D8AEE08FAE5AEFE350677C739CBEFA353 WARD.BOGENSCHNEIDE
59,002,563 *064C0DC467A0BE74865224FE2AD7F22F4A2197D3 watertonana
59,002,564 *064DD95456FED72E511684408C8CD6EA4FD2EE58 WELLTEMPERED PRODUCTIONS
59,002,565 *06440206A89B3E105E925C911AA33B0D2BA24F5B wendyleningtonsimmons
59,002,566 *0644099910A62FEFA87BF8A3878F091F7533531A WESGRIZZARD
59,002,567 *064AD5C9522B6A8445A28442B01DB88D7CB65BD9 What.can.so.young.a.thorn.begin.to.prick?
59,002,568 *0641E005DA5F250BC13938BF4A8331237B2A9143 what-the-bird-said
59,002,569 *064EB69A92B0998CD6877E4B53197A8DCDF420FE WILLARD MONSELL
59,002,570 *064D3D445A400D171BA05DFD0C6EFF0BE77F2CF9 WILL CARROLL
59,002,571 *064D6921EF4443ECB4B6DF396860E7E8CB3D295E WipeoutPulse
59,002,572 *0645729D24B1427FBB19CCAC93E1441F122C38EE WLAM-FM
59,002,573 *064B4E642F72E73A7004AB9350698AE23D3E50EC WORDSTART1234
59,002,574 *064FC19C1E825CD80D745DFB040E66F5224F502B WRRNTBLTY
59,002,575 *0646BFD6B03AC5FE9AA9EC99C3C612C4755D704E WYNANDCHARLIEBROWN
59,002,576 *06478B78B3789BD42006AAB89F2D398555D0AEEC [email protected]
59,002,577 *0641A8FDE8AFB93DBE327837398FFD1D036BA151 )X(~.`[email protected]=====B
59,002,578 *064CECDE0C7F6D2AC2964C1F404473399366B263 xenofobe4
59,002,579 *064B3472FD12A360B1D3E26044B4E1931CA70D8A [email protected]
59,002,580 *064BD3566C939079355DA361C738EDBA01E6EEE7 YANKEESCRYSTAL9
59,002,581 *0640EA3A0A195129F1277E434A177229D65B07AF YANSFUNG
59,002,582 *0649CE89B1334CA26C02A00DC1D94D21515BA6EC [email protected]
59,002,583 *064631CF5FE15595953813564CC1414F7E546111 [email protected]
59,002,584 *064B9D62F6616F463F96CBDC662CCCBEDE31DA93 [email protected]
59,002,585 *06411DA26AB1F72F5724C793666F470891504F56 YKSMIELINEN
59,002,586 *064582E4D47D33D8356F6644463B1EFE8DA5960E YOSEF924
59,002,587 *064EB6BEDB37D2523D5918A776FE3C9B1081AF83 youcan'txplain
59,002,588 *0641B63B6FC958F31917711CD9FD5EF0598638DF YOU.OUGHTA.BE.IN.PICTURES
59,002,589 *0641B5F81931E6120A7BE0D9D8364A7C4702F778 YUKIKAZU1
59,002,590 *06489E489D76DF0423312E0A6341C58D902495D7 [email protected]
59,002,591 *064A26DD23883846DDCA5EA66ADDC00D33911EE8 yuvonne.brazier
59,002,592 *06405B8F4F47F44A3A978FA453FAE06F77C5406F YVONNE TERRY JONES
59,002,593 *064DE975BDCA90EB9D2486DDB1F08283342FD386 YX^X
59,002,594 *064A612186FE1DFB56BA92AAF07A936D28273225 ZACHARIAH.KOETTING
59,002,595 *064F059932B9682E137EEAC0AB51F9C3893080F8 zavesno
59,002,596 *06477D1C21934908425AEB6999244315F86D194A [email protected]
59,002,597 *06499E582EC0133DBCC9A0A5485B620D385121A5 [email protected]
59,002,598 *06462573A25BED94AD9ECFA219D296E4C62C9CA2 [email protected]
59,002,599 *0643869FEA15CF0A1E58B7DA127E2D556EE6A295 [email protected]
59,002,600 *064198713EA21E031E002F98F0839328CD191B20 [email protected]
59,002,601 *064D839B207FB7733EE2982656D45056AF616DBA [email protected]
59,002,602 *064E67902674AE4F8652FCE6C78AF21BB9C4310F [email protected]
59,002,603 *064D7F941AA841379D2C4592EA35C436BCE21D84 БА́РРОС
59,002,604 *064591DFD171B091635DA0039DFA847058222B57 бюпре
59,002,605 *064859FE2F2EBFA9F863723EEF2FCB248328D931 ибелен
59,002,606 *0644124710EC565251263F61BF9C5D3A8B048603 СПОТИРЕНА
59,002,607 *0648E44E7904DA47AE73CF81676187561A0794D9 ՕՍՄԱՆՅԱՆ
59,002,608 *0648FAB7C36F3320285EA7CA21EAF4CFE65789C7 $0lemnca
59,002,609 *0645B5A9BE4933A3700979BF6EC013DF567EC471 0THATIDONTKNOW8
59,002,610 *0648F8693723747963B0E978BA5B97AF2C4C9037 101683 jatkuva sanakirjan selaaminen hidastaa lukemista ja h
59,002,611 *06428984EEE7E57AE1D410CDA72FEE88DD2A6A09 1026941 voit tulla kokeilemaan koska tahansa milt
59,002,612 *0643C942C24A6D8359978EC2F2327346EDB0C2FA 10maailmanmenosta
59,002,613 *064D553409A585F84F12C5FCABA817B7960FE91B 11.GRUENWEISSE
59,002,614 *0641110950F54CE65372051B22108FF4A79E2BC9 1202967 DER-BUND-WILL-JETZT-"-WIEDER-BODEN-GUT-MACHEN-"-
59,002,615 *0647D4B326B8637F1AE4F0706FDEBC0492BCFFAA 1230929 KORKEAARVOSTUSTASOONP
59,002,616 *064E6A91394D8E9652D2600342149FB8F66DEB2D 128782 LAHDENRANTAONNYTHKLBUSSILIIKENTEENJOHTAJA.
59,002,617 *064CD0075D9EF7A40C43E6A57613D558BBC3D56D 14 ADIMDI
59,002,618 *0642B761690F87E4D3360D2D39C7DAC2FD291150 1638919 SEMINAARIN-P
59,002,619 *064F1275D308ECB27FF7B724A09B41ABF2A30D22 1880210 arviointiselostuksessatarkastellaanerikseenmy
59,002,620 *06466F2416D0DFD8796E232B6CD4D6A083C9B58B 1887276 lue takuuehdot t
59,002,621 *0649BE390CC2570DF89DC05FC4403B40233CC9C8 1994946 haastattelujakyselytutkimuksettavoittavathuonostin
59,002,622 *064FAD588F5BE3B88533AC9B12E47184B3D1E3C9 1.BUETTNER
59,002,623 *064F02898FFCA2DE4B6222F73B1942769010DBFA 1DIALAPORN
59,002,624 *064D744EDA335D9DE87B56F2C84293B7653927B5 1-IG-METALL-BLAETTER
59,002,625 *06483F54FD14C4E675AF670C84270CF683244448 1MARSAHL
59,002,626 *06446A8C4951CF975F09BA048BBFF82F516C0F5C 1-paasikivel
59,002,627 *06407A1B21C5E1098A200AD7085CEAE5699A8551 1-SHEKERJIAN
59,002,628 *06401686662FF98F4BE2338F0C88FAA705889295 1 tasso
59,002,629 *0643F07C698859C6BA9C32BD9D369986B14D4C58 1THALASSOWELLNESSSCHOENHEITSWOCHEN
59,002,630 *064E8092975C016BFECD0E2377833FD7CACAD301 1.tulostetulle
59,002,631 *06406EAEF6681AA76EC4DD448F0126B8E7F4682A 1UNIONSGEIFER
59,002,632 *064BB66A97FD9B242023EB09C82F7EEC60D1E84D 1 UNIONSGEIFER
59,002,633 *06467E1B9E0F66FFE25C77859884FF9FE8850C82 1 VERKOSTUMISESSA
59,002,634 *0641AC3158C3CF1AFE9CED77417C61389212125B 1viejopa
59,002,635 *0648910C09B4ED142D59CC186C8868D03A08260F 1VNGLZRS
59,002,636 *0644CC112FD1FE2FBF8F4ABB949BBC2F6FB3A660 [email protected]
59,002,637 *0646CC0A7C7C503AF205881E7F37D8D9B3FFBCE5 20.12.2005
59,002,638 *064221EFBF65940363A21275BC0227FD1619B465 2101533 kutakin sanassa esiintyv
59,002,639 *064335E8E4A113D5FCEE1E6EB58D192C1D003698 2178573 tankkauslennonaikanaonkielletty.
59,002,640 *0641A1C4E31FC5E40EFA8FAB255D42CE411B6CE4 2306860 flemsonmayreverseyou.
59,002,641 *0643C7F59003100B63BF5BBAF9F072EE5F33F861 2337609 KUVA-TEKSTIN-SIS
59,002,642 *0640B7369C2B48CAA2B6B93F79CF4F3049FB5667 25.richtwerten
59,002,643 *0648C0E2A2D94365E0472CCDA9FB2E3571769993 2676333 TERVAN-K
59,002,644 *0648E175B0525050AD90E8DBE5BDF353CFBA5647 2959776 VAIKKA VEN
59,002,645 *064A76CFCC5405CDF26D6E0A27CDF6CFC60E728E 29JAN1884
59,002,646 *064198BB95A2188CCDDB3403021279D4153FDFD6 2-GARAWI
59,002,647 *064D0FB3E7877278B9148896BF8C2D30C6EDAC98 2RUSTELOOSHEID
59,002,648 *064D329149DA887F6BD7F3BDD677B75208A12DC7 2THATHALLO5
59,002,649 *064CF3DAC80151EE30928AF964D1E99D2DA0AE70 302ZACKERY
59,002,650 *0645F093FFF7ACB0C59F8C24131396656472AF82 333jensen
59,002,651 *0649AFB3A88807C098DBD8AE2B4ECF907213C7FE 3B.`~.`~.><
59,002,652 *0646506F9A90BB23DAE5D5734E1864FB5B98AF94 3-hiiltyneeseen
59,002,653 *064BE716D19BE7551EA19AEDD5ADA101F2753397 3iluvpsycho0
59,002,654 *0645E01C7F8DA5F2B53DC0E31D0052ACB44578EF 3##p*.splat!!
59,002,655 *064538B7758F6391F0EF4FDE22B0B390B5702FFB 463170 khost-has-relied-on-air-shipments-since-january-1988-
59,002,656 *064701BF6ACCC50632E7D033EF11D86362A8BC24 [email protected]dutw
59,002,657 *064F0745BEE8F7BBE7F8FAB9E27336B1C20F8735 553878 SITENTOIMINTARYHM
59,002,658 *064D2FC78812A5C7DCC3D14274D984A814F531FC 556662 SYRIANTROOPSANDGEN
59,002,659 *064FD011E2B7EEF58040B9742D5A506820B1533A 5BRONZIFYING
59,002,660 *06442D822C0C6A69EA23CF3863F8A16955F251A1 5ICXEREVO
59,002,661 *064342D634A6C236D42664FD910E21E6F585B9A8 5METOXIKA
59,002,662 *064E9FE4C886031F582D4692473DC1B61B77276B 5NEZAVIDNOG
59,002,663 *0644ABE73714688CE0DCF05E43D2615F39EB09AE 5PASSWORCHLOE
59,002,664 *0647CB335C679014BD5ED1279BFBD7261151CAC0 5STRENGINGS
59,002,665 *064D3DCBEEED7D73C50D86049FD31FD25CB77F57 5.TIETOHALLINTOYKSIK
59,002,666 *0649316EF570601EB8247DCFBADD4E5FB8DE6E5F 5VRI
59,002,667 *064BBCD735944FBC60F734DC7C19053ADA4F8B41 6ALPHAQWERTY
59,002,668 *064200EA7E6AB63DB808A3D0E5632045C82A7A55 6BSWETRAVISBSW
59,002,669 *064B34A6117B90FAE98ABD792F14C22046D714D5 6CARDINALJAPAN
59,002,670 *064D1216655E895C39BBA3DAA90C7A6AE6F4C2D6 6EMBALSARAS
59,002,671 *064C1E3830C0B1CD0A5DA972B44319BCBCD59651 6GREENAMELIE
59,002,672 *0640EC73F25F88D94C24D4A2578528F32E6EE6DF 6MORTIMERMEDICAL
59,002,673 *0649C2F16B18D0CDC5142978B23F79515ABF8658 6NONAMBIGUOUSES
59,002,674 *064E8840C6703029E96D42E5F2BD0AC50AE1C713 6RAKTARNAS
59,002,675 *0649A97CBB87C0FE59413B4EBCA9CACA148AB933 6TOPARTSFORHANDLING
59,002,676 *0648C7D1F8DFD75C9B52CEB1E5E918BCF2908C65 797096 RAKKO OLISI HYV
59,002,677 *064109781FEB2A7DE9A50D59BD5999DB5E8CB315 7BSWCHICAGOKENT
59,002,678 *064AD0664C24FF887B77A22E0ABA60F6A9FB0F2E 7cirque1
59,002,679 *064106C7ACE78EAA2100505263044C339EC41830 7DEVITALIZESDEVITALIZING
59,002,680 *06421D3879F97FF85E60BC361D0EA71425784C10 7IAMHEART
59,002,681 *064752BA3C4A5866F12D497475349F9113B640D1 7MEGABUCKS
59,002,682 *0642FD38B90FBCB227D1F717526FC1A3356B027C 7SHIPSTER
59,002,683 *0645C9A37CAA7830005E296ACC66B01834D5A907 7VYHESLAV
59,002,684 *064B8A8191A37B24D01CC94D74DC75CCE1F14793 7YMP
59,002,685 *0640D4A8988F09CD46904C01CE0A29AFB92EB990 8BLUEHEND
59,002,686 *064CF1F1E75286F9FD571E2205146490B1BE32B9 8CAECIDAE
59,002,687 *06430623B87354312F432549F370AB0FD57BA6C0 8CINNATSA
59,002,688 *064362420E83F57C01C24C322E1455392AC6DD58 8CITOGYRETPOXE
59,002,689 *06488FF42B8F4FFABDE4F6066BE3CC86D890986B 8FROTASES
59,002,690 *064A37A73BFC0AEC35CA9F2745B0650BC439E48D 8LIETHCURB
59,002,691 *064C04B3E5CF061AA31BB150E511F8A2F7444EE2 :8n
59,002,692 *064427D59A7392CC3BEF375371A10B526A96980B 8TAIDEMIR
59,002,693 *06479DF36727878418861053E618458766B9C126 9CENTESSETNEC
59,002,694 *064050A25F392D4F809FC06E0FD18051E0A62078 9CENTRIFUGADAS
59,002,695 *0648493684D32AF3DE8F6A55108DC53F4F95B18A 9DIPLOSCLEROPHOMA
59,002,696 *06458A26F4990143C67AAC223F02F7BE517F752C 9holhoornige
59,002,697 *0644AECFCD200D8820B682CDF0BE69CF9AE1310C 9READERGERALD
59,002,698 *064CF3330E0749292B3FFB34997419EC377CA433 9SHELLYIRISH
59,002,699 *064974206331756B09FCEB18E87BB2286D6A7BF4 9TRAILHOBOITINERANTJAUNTKNOCK
59,002,700 *0645C6B8DF7BA4ADC821CB2CC9742CBB9CFDDA74 9WREEDWREED
59,002,701 *064C0D68B14A177E75C23F80A8990D74196D2DB9 a($
59,002,702 *064CD1DB229FBC4C8BE1E4B94B77BA991CE75EDC a37ae
59,002,703 *064B0A2DEF46B297FC9620CAB6177974EC3738FB A4vl
59,002,704 *064DA264A1BCA48BD421CC852F6E60B0FD63A808 A8FHL
59,002,705 *0646BA29FC0198A36F054D31413A5BD8E4CEBF76 AASADYA5
59,002,706 *064FB6C9F2B0069BAD2D0F614B3822EC87B05313 abukirbsw0
59,002,707 *064A5A8E603E3D697DA8ACD51574B65ABCFEBC2F ab/zh
59,002,708 *064B9ACF25E632C0B4EA2398CC24937540ED3FEB ACS:A
59,002,709 *064948CC3C08829D04ACF7D16C5898A167A9759E ADAM.VONSEEGER
59,002,710 *06494F57ECF48791A49F3DEBBA169491E627F248 AD#I9
59,002,711 *064F996333258E3371C3814F34A9DBF54A848DF5 adp'l
59,002,712 *064DC2D01EC31D88707BFCA6C92032D98D73A912 ae$8l
59,002,713 *064F4A3C833F6138F7865144A5BCD6E0009B0544 ae#dw
59,002,714 *064889F9B760446CC8BBFD03DDC6F76E16251F13 ag_g1
59,002,715 *0642283A1D793CDE1C833ECD76627567A01D44AA AH!IX
59,002,716 *0644BA2BB0372F89D0C20FEEF5F53C49C420C4BF AHMAD.CUMBERLEDGE
59,002,717 *0644EA6B35D1BC6C4C7ACF2DAD2C41AD8D55D039 AISIE
59,002,718 *0644E6FCA008CC1F25C4E6484E990E61A08D26AB akxw?
59,002,719 *064515E48142E67A37A87B929CCA7FA4094AC32C ALANLAKEIN
59,002,720 *0640046C88DF0CAB6E368F91E5D453E9CA62CF7F alfonzoisiminger
59,002,721 *06475A956B34A45DD8908B1627BE5850798727D9 ALFREDCALICO
59,002,722 *06495B26C6BB0500B6C2C7AC3B67B1D6693FDC14 alphonsepeachey
59,002,723 *064E999C455CCB15E7D3D04A502CFA8828E48EFC [email protected]
59,002,724 *0642741C35311E4C98269BBA8F3FEB7426A5315A ALYUCFDQ20
59,002,725 *064493CEE10C6FB54D13B83ADB089ABD4F4BE7EF ana-paula-matos
59,002,726 *06450BEB49DD5DFB3E05191883F844D476B2584E ANARAKEL
59,002,727 *064322B0040F15F7F98C50755B1B20338CFB7E50 ANDRE-C-SANTOS
59,002,728 *06469AD89A7DCAED8B5A7C3E15E3C624344EF1DA ANDREW-LEAW
59,002,729 *0644908CC850B940EBD43F6829E5F39A8B114E8B ANDREW.MAYZES
59,002,730 *064304146487EB977E242761F7D1821BF0E44F16 andyboutte
59,002,731 *0645D4850A8FD11B4A4A3BD58D1440F9374EB674 ANNADIRK7
59,002,732 *064648DB6967C4630FDAA6E8F7B1D7FC54C30BD2 annie.lelievre
59,002,733 *064D653AF3A51961AF6FD21E767EE53F61025CA7 Ant3c3dn9
59,002,734 *064706AA0EED491410B97209B175FC501C5048B1 antoinecrudup
59,002,735 *0642DF3B3020DC06B420C6B794AE5E3A17FBAC7C antoineporto
59,002,736 *064F568B695E4F881ED0CF8BC6EC1EA789D06BB5 ANTONDEBEM
59,002,737 *064395781E56313D8A1AE1CB578E75C46C6E71BB ANTONIAMACKINS
59,002,738 *06419007DCEECF746732D8FB64AAF4D4B8E3B76A ANTONIARANK
59,002,739 *064A164C21463199D56CB74B8127BCEB369A037F AOANL
59,002,740 *0640999914E9C98DFF10BDEAD32863D2A5A9C7BD ardenjanz
59,002,741 *064EB6B3EA5A904F7E3CC527A321F4AF53461EE8 arjay.libunao
59,002,742 *06468B6584E60D7A942EF62BFC20452B145F604A arnoldtronnes
59,002,743 *0647FC83FB34064E9DFA1B5BDD2E5A29E1FC3BA7 [email protected]
59,002,744 *064E37D4A270F3707587EDF8A6DF70C3C85DB814 ARTICLE354470
59,002,745 *064199960724896E4E89D905A56CB600F7A8DF4C a!rw
59,002,746 *064CD75DBC97B991B1CC0BA9B24F20717A06E5C8 “ATOMICI”
59,002,747 *064F3BD449E3665D9BBDC7D12A9EF21388317C82 a!t$x
59,002,748 *0648FD021247818E98EB5FDA4AF4A0508C268EEA AvK8
59,002,749 *064F42FA1E0239D64AFFF7C27A7D926CB4045FBD AYRACINI
59,002,750 *0641DB5C5534C3B042FB7D3B60C27D7975CFB3B1 azaria560
59,002,751 *064DFBACB99C33DC2B4455C9BFCED0551F63CD18 AZMQI
59,002,752 *064966C1D4872E78332BB2CEE7BD6054820FB87F B5bp
59,002,753 *0643BEE17EFF68F1B6812790E3E360D5EF32F546 B6-
59,002,754 *0649138C03BB89A8C779C636B64E9B11769E49FA B9v/
59,002,755 *06448B5F264B6DFD8A5A4D5218C1C96559BF8214 ba;9"
59,002,756 *0640165910A2C1952165DAF868218F1BFD898239 BACIANOLEDONNE(FEAT.BIAGIOANTONACCI)
59,002,757 *06443CCAE4BE59C4F66BDAAA6D05FFF993CC85B6 BaQ
59,002,758 *064F8FCFC20096D1A4AB925B70C6C03B20B79D54 barrows
59,002,759 *064E82378F22C7DBAD8EC2EE335589CF6A17C372 BASALEHS
59,002,760 *06452DA0E2AE9B95A58C691D7449D0069054BA6B baššār
59,002,761 *064E0A46346826254C07F470721C7E2715C794B3 BERNADETTEMIRANDA
59,002,762 *0646E63BB2EBF23A82F5B33F6C96145570E4444F bernardmccullagh
59,002,763 *06488648309C89689AA8ADCE6F632DE7CAE5C5B6 BETIMES?
59,002,764 *0642C652D055255B4211B90056F18D436E785E0B bgh(b
59,002,765 *064768B8805419DC7D26EDED7596BF15C9477E71 bgie
59,002,766 *064277ED4D28BC307B4AB71A0EB35709CD272AC0 BI3SV
59,002,767 *06437E1E59EC73E9DD0AD60C8E95AE6E1B7AE8F4 biforcassero
59,002,768 *064A2B0C3E2E80EBEB5E46B31CFB2A98B4C5511F BIJTANKEN”
59,002,769 *06448C098AC691EF2654A0F3A7EEB59F8679A643 bill.usinger
59,002,770 *064EAD2858F1DCBB9E28017F248B23FA3EF7C725 BJORNSJOSTROM
59,002,771 *064CA0CDCA782B5B3D168CA0F9A67F390BB6722D BJ(P-
59,002,772 *0644CAA5EEFBA58C225F21E62724B242D4EF432D bj#s%
59,002,773 *064E8BC5D35087F640FCAFDC3A76998FF10ABA8A BL3!
59,002,774 *0643A85F7EE3538EF7AF63A19670ED56E5BC7F8D bm1=p
59,002,775 *064455AE6315FE183946C007D7C4AE7EBCAE2FC7 B!ME
59,002,776 *064B9B15E653101C216D7E4549CD9DA8CC8647F4 BOLOROOT5
59,002,777 *064E54023250B050D1C0E4404AEB9EE6AFF6F753 borgr
59,002,778 *064DE08C8C6F51116A612B9C6F76D5A77F57A57C BR11Q
59,002,779 *064FE6E8AC882A8CFF9E04471ED2487121190F80 BRANT.TEGAN
59,002,780 *06455E852D2E2FE2B00839A8175539BD47D97681 brendonasar
59,002,781 *06451CA748623F7CD1482F6D7B4EE0DA60623D5B BRENDON.KLECK
59,002,782 *06410FA8F5F82A1BD645BD05174A5147FA47E5C7 bryanpullen
59,002,783 *0642E3AB3C27C5AAA6436E48FE101C1A087B22C7 btaberc5
59,002,784 *064127FE4CDE77BE2C72C59403A7E130B8AE26CB BU0"
59,002,785 *064AD9B4D5773F730972051D3C6010CB557D9BC6 buddah60
59,002,786 *0645296FCB80F19B5548892F44EC273BF45870DE BUDDIKER7
59,002,787 *0641B2A309045D8D171561BDE50BBB957CDA3AE2 BÜNDNISSSYSTEM
59,002,788 *0640CE83DC2533797EE90427A61DE0319AE203A4 bunnycomputer
59,002,789 *0642F5D4024148BE5C028BDF2730CE6F92117E46 BUTTERFLY-EFFECT- C-THE-JPG
59,002,790 *064949B88EEC27FD14F18CE735C6FB41C4FCECBD bvb/c
59,002,791 *0640902CFBA7353D5052D61F0667763B086A569A B$XIZ
59,002,792 *06454A9AF26A414105A8AB4CE9FECB498DD9FEDB BZB&H
59,002,793 *0645879D6A06C663330807783F11DAA603E58AE9 c0;k
59,002,794 *064A5844262F33DC85D9837D500DE20497B2DFF3 c/1=
59,002,795 *0641EED1C67489DC79A4FFA8B468FED24AB20A87 C:1E
59,002,796 *06494DB77A49611766DE471130CD738BE9578035 C4MBUMS
59,002,797 *064A7529EE50CA06D3E7D48F13C7364A318336A3 C4TTY5W33TG1RL
59,002,798 *064F132B416EAE6F89F7358FFAC76021D9AC914F c4z)#
59,002,799 *06452FBAC1F62940D4D22157DF1312B6CD668D3C C8O!H
59,002,800 *064081877045D1A38BEC31AE7FBDCE6237BFB7F1 CALEBBUNKLEY
59,002,801 *0646F62FBCB5D0CAEF5C8E6171313F00FC9AF6A6 calvarychapelstonemountaincomwww
59,002,802 *064703BB5368646D2BCE40B44AC8886008AAA5DA CANDACESTRICKLAND
59,002,803 *064C5D62E8B1A797D05CDD0A301D9B09E95DBA5B CAPETOWNCONFERENCESCOZA
59,002,804 *0648DD75F4E85BBC70C9106CB585669FB4599681 CARFLIKE
59,002,805 *064CBE6903DB6C1ED377945F784AE9142C1C2487 CA#RO
59,002,806 *064081D8BEABA94879DCA43CAD2267DC30152182 carrolijams
59,002,807 *0643C8498C146012BD37DD9865E22D0823AA626A carrolzavasky
59,002,808 *064FF161F9A4D02EA164C4F4D590CFDF03F9B7A7 CARYROLLF
59,002,809 *0646CF5E508DA8B85EB647853229E61C11A29197 CASEY.GAITOR
59,002,810 *0645EA5E54CA8B635A457918D61BBC8CB6D798BC casey.malik
59,002,811 *06476D7C02CA1746A5EAAC349E7FC3F54E9A7D0F cbj8-
59,002,812 *0642BCCFF0BB68942EE7CB57DF8CAE40943E706E cciliuss0
59,002,813 *06484A76992B09F50A43754448F98ED40572EF85 ccjqa
59,002,814 *0642319FE98F8B3AEDBBA3EF117FD70E1B9FDD1B CERAMICFINGERLABYRINTHS
59,002,815 *0649AB0056189CD838E9B005143C25C532FE561E ceramique3
59,002,816 *064EE5E83EBFFAEA0F344C872C231ECC14122143 C=ES
59,002,817 *064719E5960539F14FE41CBFC3EABF9ECAE10AA2 CGOZH
59,002,818 *064EDCBF7BC47988F8766DF3151E302F78D4684A CH11EANS
59,002,819 *06448D038B9736D0F98A5936B7EA53A312C30A61 CHANDERALELAS
59,002,820 *0640AD59D7132B32BA3D1EB6F10414EA2FD7786C [email protected]
59,002,821 *064E4252DB9B08235DE18312940C121A78207E00 charlesfdurant
59,002,822 *06435DCC14AE7BA01C4A35D9CA26920D6B70EB46 CHAUNCEYHERPOLSHEIMER
59,002,823 *0644E85F306757CB5AC0F50F44BA748A8FFFB796 CHEESETRACTOR
59,002,824 *064030268DEE3E41F2653C8C765F4F5AC01C564E [email protected]
59,002,825 *064F20E39CA70644DF57DC828CB93B7B66FCA06E [email protected]
59,002,826 *064D5BA12039C0F65F30ED1AD9E5C738CFC944FD CHHM
59,002,827 *06403F72D3B2CABB9F655F246C7DA7317C2A8854 CK%_6
59,002,828 *06421327F930CD51A617A5FABB1DD737943ABED4 CLAUD.KNOBLAUCH
59,002,829 *06436D7236A455B2F48DED34536BE233FDAC9518 clementedoler
59,002,830 *0646E12DBB99F8DF8595E8B6F636DE1706716C10 CLEMENTIVENS
59,002,831 *064BD4EF473E14128486F45602AF047FB4E60419 cliffrempel
59,002,832 *064DC813EA228CDF5F741BFE1A8023EC4B396017 C/!/O
59,002,833 *0643DE7CC05585526E551E1D847817CAA772CABD cof(
59,002,834 *064330E5C0906C7992C1C27E3A3F5D908C40A3C8 COLMATANDO1234
59,002,835 *0643FDC21F7E5D6283B17FFBB5957320E1014CE1 CONTENTEDNESS0
59,002,836 *0645D4EC6705560969CF5EEBCE73E52466A62389 couteron1
59,002,837 *06406ED1670B5E98219E3158F43A9966EEC442FE CPK0
59,002,838 *06475F99D2BE95E27E4431B5BC79A2DA009A42D3 C;R4T
59,002,839 *064CD1982098DB76770AC8FA1BEF52E51FC1EFA2 cvna%
59,002,840 *06432D7F3125E5DEE92703EFD4D524F035FF25F7 cw"$k
59,002,841 *064DB29C0118B35ADE5897F2B67BB16D9E0FFCBF c"wst
59,002,842 *064A00A975081F4D24C3EE870D99643D42F8F11E CY?"
59,002,843 *0646A836B6380B029C82AA2BFEEDD70126BEF2CB D5;B
59,002,844 *064B303E37FFD47720477394921E5A4B1A5D738E DA(:B
59,002,845 *06471F8D8AB2DF1ED0F0E9BC49822E6CA1CF4E60 DAQV
59,002,846 *064B20F12ACE5C555CAD9C1C4CB7F20DE31F4B38 DARRICKYORKMAN
59,002,847 *064DAB281A21C7EE4CC4C94DA5D6481254AEB001 DAVELEBROKE
59,002,848 *064E1085D93CDFE89B37594F6C7A28852B2770E2 DAVIDDWEK
59,002,849 *064FBF5569DB34B5D0B53947E153CB69A91FF244 david-liebelt
59,002,850 *0649F62FB1A3F2563989277AD6596BF55EBE8EB2 DCLWB
59,002,851 *064904C9A8779C0CEA360F452E2DED31A0B2E23E DEADMAN7
59,002,852 *06467E24024D89AE0AE533053FBBE8E2B03395B4 dennisgooslin
59,002,853 *06431713519726F4F633176E8CD012B2E0293299 [email protected]@+E
59,002,854 *0642491E922863F899FFC58BC6296BBD209BB353 DEPARTAMENTUAK
59,002,855 *064F1764D255E5B49DEEB6A99DFA8493528150CB DESGREASEN
59,002,856 *064B2AC834ABE1CA8BCF1C1C67F234D72E6C1F7C DGCCP
59,002,857 *064B43E69C53575B41B08F4DB54009F1C9360B74 dipanfilo
59,002,858 *06418213A9A128E379F69E958B7A9133A1D18E9E disbebabkan
59,002,859 *064D2E80A55B8EAC0A33D9D10D929F3F525E20E1 dk3f#
59,002,860 *06444550CFAB4C87C240EEC92F93774CAB17B2F2 Dko?
59,002,861 *064BE7143FFF0C15E4EBF3529AA34392CE03E884 D=)M
59,002,862 *064DE8FDD44F7A27C52A0C05CEC5545644A258A3 dmn-;
59,002,863 *064F5AD4C0DE8162F4FAEFC83E92A6E4ED8E6817 DMpr
59,002,864 *0647DDA492E77FC4E201B5357D4915F06AF7A384 dnc0
59,002,865 *0645B257530D690E8FDDEE4D885AF18CA18031BB do/6u
59,002,866 *064EFF6FEFC77843E886ABFA03F3C94FA75D03BF DOTYKOWANOKIAN
59,002,867 *064048CE089AB6F9AA3EE58AD460DD4E07A2D0F6 dpkia
59,002,868 *0646D8F16F8C573E7DA61D82E6E7FD970FA55E09 drpk
59,002,869 *0646ADD8A380F3CA5EE1F2B8A5F2A6DF6F3E3363 dug(
59,002,870 *0641838C978CC62E7450FAB604EF425F4E5E10A0 DUSANT?
59,002,871 *0640EC42B9DCA03EFF0CB31964C50C11E3E8D655 dv4qh
59,002,872 *064AB978AEFFA05E2E8EF3EA65510F267BA3D5A5 dvn6
59,002,873 *06414E3632EE45176DB51E49E3FF45AF3EC6BB90 [email protected]
59,002,874 *0643963594128E06DE83179E9CD834A465573C37 DZ\C
59,002,875 *064E56DFE140D6B79A8ABA7C366C1AD2088644E1 EDMUND.YVON
59,002,876 *06473D1F829E58B17B9D307DCFBCCB7366164E10 edreeinomrahsid
59,002,877 *064B6DE79F01917EB8752B6E531AB0D604ED8432 egpf)
59,002,878 *0640A0B361BE803A305B32917C2C16052948CCB9 ei6mo
59,002,879 *0649BE9983543C674CF3F05BF7D03E465E5C4D0D eiasserp8
59,002,880 *064F43B925BBAA316BFC31E5A33AB186BD6B2A55 EIM$W
59,002,881 *0645442B3E631398ED8FE42F4803236299F0BA9A ei,q
59,002,882 *06429C2B7A7B3102816754E4B680D9892FEDD5C9 elle-donne-son-corps-avant-son-nom
59,002,883 *0648E4AFC3BEE5D366AD5336639F05449750A285 ELNETATSING
59,002,884 *064C415BA1A9139F4F255928094E65D90AE80F9F eloycoor
59,002,885 *0646E2436D9CBB592CD69D28DC9AB8F04182655F eloylutkins
59,002,886 *064185B46ACBE97F75830F26257EB1EDA786E957 eltonnakayama
59,002,887 *0641385920C8C7EC9D96DDAE87EDE88F8B90304C EMMA.WEIBULL
59,002,888 *0641200A434D55B7F77094E0299B0B2916061C73 emorybensing
59,002,889 *064698F439602C9116EE5B5CDCCE79ED948B5A46 enneasyllabic.
59,002,890 *06493DE496D97DA6A0024B4ED70394D7D9327B40 ERIKA DESEPEDA
59,002,891 *064BF18AC51450CA6F02972FF08CF9E22BEF3406 ETAIDABBING
59,002,892 *0648EF64F8D6875406C3E53F4BEC8E0AA8BBEA73 ETHGH
59,002,893 *0642DBE0778D315591AD4EDF579AD8BF3B208613 et?yw
59,002,894 *064D85DAE2610514236F6D40BA8CAC9473426564 eulenfalter
59,002,895 *06450890EAB29D11C05067DCE6BC7ECFB9EB36E0 EXTRAORDINARIETATE
59,002,896 *064AAF0E3A197E910D863BBCAB56C116545DB38E EYDIA8ESIA
59,002,897 *06495353064770AA0A0071F64D6137E12BC4FF81 FEEDERPROMO2008
59,002,898 *0644318FB514CDFF743D66A7C73F8E1498AB1187 feed.the.culture
59,002,899 *064ACEE789FE648117687545E475980577FA05E8 FELIX.MOHAN
59,002,900 *0648D66DAE5E2CD57DB827832E9601A9AB7185A5 fidellyde
59,002,901 *064753F682033485887AF68B4078E32ED934982A FILISTEA3
59,002,902 *06470E3865F3904301915EB82E4B08F5168D4F19 FILISTNCI
59,002,903 *0647F31B26608AA856217C99953C88EEEE2A1CFE FIN3SQU3
59,002,904 *0649BCED562EA6FE9172C5328F347551E8CA4935 fl?[
59,002,905 *064415AC16F39610A7F3F2E7F4965BA8ACD99F21 frank's blues
59,002,906 *064E4DC39F73B963EDBD5FA1173315677466C03A FUCK.(DISC.2)
59,002,907 *0646666019575F8D0DFA220A305142E4BE9B50DB fulmis
59,002,908 *0644C62B2DCA150DE0E6C8E6AA41740AAC4D79FB FYOAAA
59,002,909 *0648B917044707A9661FCEE8359584122CD8BA25 G150827
59,002,910 *06444162FE966203E1B54397A26BC3D5A2186D9E [email protected]
59,002,911 *0648DA62CAD662F8F8F6F8394253F4A92A706D60 gagetown
59,002,912 *064F9719AD49741F8096654334C32967C96D957C GCATTANEO
59,002,913 *0647757834047832CAD425F361AD7405EAF859D6 GELMIŞIZ
59,002,914 *0643611F48E4E56BDBA5CE895129599C7A020FF5 GEN-LA
59,002,915 *064824703913D2A4577FE58B3A0DD54FCE7CCC79 geraldine.barrameda
59,002,916 *0647B0AF92B37B3287EF93BF8848E1ED9885D75F GETATMEDOG(STREETVERSION)(FEAT.SHEEK)
59,002,917 *06443F9FE805B5B0B97FA65CEA30A5418D517CBD [email protected]
59,002,918 *064706123D048B58604D0943BEE5C1A0485FA191 [email protected]
59,002,919 *064A4DF8009A3C12152A656E54A17849C1B3ECA0 glktrfcrds
59,002,920 *0643A4F7EC116B5A2B62E397262922AC8B2F8515 GOD SEND (FEAT. PRINCE PO)
59,002,921 *0642D86E8A5703FAD3D40CDA191BDEE118B26795 goldenporsche
59,002,922 *064DFBA5CD7BEA130942383AC1C125FC5059AF9B grantklindt
59,002,923 *064278FA12B84B1535EC98B6F81BB30B847EB1C7 GRANVILLE.LAMP
59,002,924 *0644E5C9730440DF97FB1BD382B1135E8EB89F10 GROUNDCOMPONENTCOMMAND
59,002,925 *0642DB92E1A1926DD787F4C22CDC49995995E2F6 GUADALUPE.COTILLA
59,002,926 *0642CDB589DEB1956DF52C592AD20E5A05ABEE6E gukê
59,002,927 *0645B3DB367265E9E76A17FE0DCDE62781FAD1AA GUSSENEKER
59,002,928 *064B35E242490253749CD7A56994179B8F82B787 gyfford5
59,002,929 *06407352225D0441796B63423529B99744F17516 HA-R
59,002,930 *064D9685E0679CE269236FBB6F1A6B093843E559 hawaii.2.oh
59,002,931 *064222B7F2599A6F5B5C3F04511140F30DA7342D HAYDNIA3
59,002,932 *0640309373C3AEE93EF9AA02CBEF6FBDBF240904 haywoodcarrino
59,002,933 *064F210CC05D3406A9AEEEE203C097BF8DD2F16A HEATHOLITHENDUM
59,002,934 *064460711E3572B075BA82784285991BF239D60C HERIBERTO.FUMAGALLI
59,002,935 *0649813F3EBDCD03CD3EFD5A18F1A8496BEF3EDF [email protected]
59,002,936 *064D99FFA34616000AFDDAD26F47AE452F40F0B4 HILL、カライド炭田駅から石炭輸送列車がグラッドストーン地区まで運行されている
59,002,937 *064BAC2A72324B94147B8DF9E817C6E811693FB0 [email protected]
59,002,938 *0642B215F083A3707C95F67C26C0BBCDD9D85DE3 HOEHNDORF
59,002,939 *06466F4E89D203D5F01FAE927ECF9F6249F14ACA HOOGHALES
59,002,940 *064691EBF9308424D084337CD516118BBB0E66E6 HORACIO.WETMORE
59,002,941 *064A981BD1CA1C74D4C436533D58641851A4A91E Horsin'Up
59,002,942 *064CF70F65ED99DF4FEAA96195B84BE68FA4A0F7 [email protected]
59,002,943 *0644F752B1D0885ACEDF92B23E8D205221C4BD7B HUBERT.BROCKMEIER
59,002,944 *0643780C161CFB3906725786EACD7C664F500BA6 hughhagin
59,002,945 *0642C6EC8B0D0ED64D12717587AE6432D3A1BA20 HUISM
59,002,946 *064B5C69A175FA96F884B760BB530D3C2D83777B h!un
59,002,947 *06423CFB6146DE1BE64367186A5ABAFF6A1CAE39 ILMHENNA8
59,002,948 *064429C29E31AE862C7EEB9F6D83F8891977C9EC ILUVSCHNAPPS95
59,002,949 *064F443FBE97BE2A6190B90DE95E2793194764FC iluvstargate90
59,002,950 *0647239C78AF3F50E43544059C403FD547C290F6 i+<q
59,002,951 *0645D17970F30C1BDC9255087F68A8700A640EB1 I.REALLY.DON'T.NEED.NO.LIGHT
59,002,952 *064E51C5A6D6024720CB07538DC06E0C7B980F89 [email protected]
59,002,953 *064D3A4E5D1680AB52DD346F616AE9D3E4AD80F9 jafetidologia
59,002,954 *064A146B9C82045661155BDD5434E67B8FC92EB4 JAMEY.YARD
59,002,955 *0649466F12E35A9A08400F83AC2EE7F98C07927B jamgadang
59,002,956 *0644041C9D82D055B7DA8BDC47858035D44E7D14 JASPER.MAGANA
59,002,957 *064A54E2DF2E00E8CB6178DAA76664DC23F2BB72 JAVIER.BEAUDETTE
59,002,958 *064240C251BC32C1CF6EBB7061F17432F980DC1C JAYBAKE
59,002,959 *0641D0192BC7E83EFBAE738D4A6DAB9CD4DD33A4 jaydeearcher
59,002,960 *0641E68C804FA3076BEF8B1C4F82C9725E4049C9 JAYDEN344
59,002,961 *0645594587A48572FE1245D3531640B43660108A JE FAIS DU 38 (P162-163) (3)
59,002,962 *0641B063EBEAFE994D0939441D95EDA016620C58 JENNILOVELY
59,002,963 *06451D39F8B43FD1907CF77A4797169432E358E3 JEROMECROSBIE
59,002,964 *064D51C60B6E6224A55C270AF3B3E270EAB1577F JESS.OBLINSKI
59,002,965 *064FCD3EFBD82847F17AA63A5606B3E0A8F96A64 [email protected]
59,002,966 *064E55107B077AF75A6579D9B14EC1E8ACD27929 [email protected]
59,002,967 *064DF316303F58737DA776E9D1424058AD06BE30 JIMMIESPIEGELMAN
59,002,968 *0640781A829D9F18B386EFDE41D1D92E3967B2AA JIZELAAR
59,002,969 *0649D1276FA01B08CEEB849EBD8F3562ED669A3F JLMFXIKEN
59,002,970 *06474770D27E2AC0733A1F646F66802DD4E9694C JOHNIEHENTHORNE
59,002,971 *0646B4D154BD3D6C565307D5E74919838D2E81DE JOHNPOMO
59,002,972 *0646E9B31C3D677899078E1F023A0B09465037A4 Johnson.II
59,002,973 *0646AB4CD1486D7B2C097A8F7D7D712DD1C3E3BF jorgeenriqueperez
59,002,974 *064D9E822A5D4991D0BEFD5C5A4B174B6391386A josh_bennet08
59,002,975 *06415950EC9B571A28DE1DA7C3138B5FCB0B4485 Journeyer
59,002,976 *0643137D55C450684D5ABF7C1808BE003A1E4C69 JUDEBOTWINICK
59,002,977 *064367B3D123617BC4D16A98B151E95A27F62DAC JULES.LEGALLO
59,002,978 *0642E446A3748CE6A18D41C3A9CEF77C991863EF [email protected]
59,002,979 *0647BCDA5C8DE57988A050E466E969CE2C190A1D j%x~
59,002,980 *064FAF8390B5FA5BE12CE61A5289DBA07FA693FD [email protected]
59,002,981 *064AA0DB03D36C0CFAEA9162221DB09399F19FB5 karime-oliveira
59,002,982 *064D7F1FA803CC1D1879F3754E04D10FDDBE9F58 KEEPGOINGDADDY
59,002,983 *06413356DDB027113BE800CECCDAF204DBD8E983 kelsie-brady
59,002,984 *06415CAE32180C2E4C2E8F7C1C3C41F94AC06CA5 KENDRICK.BAIRES
59,002,985 *064C7285B44296BF858351728AE2BA811C3763EE KENTONKAHAO
59,002,986 *0648D877FA200E04EE30A278C13F70897834FD49 KhanoomGol
59,002,987 *06470F2820284CFAFCA05C2FF0784E8F32BAAD73 KIM.DROPINSKI
59,002,988 *064F7BCD929228EB1BD777F42A6D3792201D1DA9 KIRBYDEY
59,002,989 *064E68662742A1E5E80E4D2B3E05772ADF6F2A0B kirkbrading
59,002,990 *06496C084ED849623D1587E5BB07AB5BFE1120D5 klagerin7
59,002,991 *064A9AA8EEF9D61D324D11FA8CCF148191492FA1 Koncentracije.1
59,002,992 *0649E19E3E4EB834DF06961B596F1A6BDFF5C04D [email protected]
59,002,993 *064251B14268867DA5FF1D0A02C6FFD19BAB9EF3 KPOLAKU
59,002,994 *0640D5CAB198EB04E8C857155B9660C0E5F1925C KŘENEM
59,002,995 *064D9CD0C8128288AF2BC4DB18915E84872125E3 KRIEKAPPELEN8
59,002,996 *0647F2B90A27015D81707DE8C0907FD97071F07D kylevuh
59,002,997 *06401D89D54FDD14E40416BCA603FE7D10FE3FFF lakunar9
59,002,998 *064AB9AC14EC9A9520A75FCBB1A8C10A6B2C42EB LARRYVILLEDA
59,002,999 *064AD9C0C23BFC0935322BFEEBCA2C3D3A15E1D5 LATILKYMA
59,003,000 *064FCB0BCD45BC90472C4C27C4CFD78E90E5D473 LEE-YOU-PING
59,003,001 *0641022799798325537C08B7C74FF05031EACFFE lelijk7
59,003,002 *064D5FE74CB21D754D8C51160C27FC730682991A LEONE LEONARDO
59,003,003 *064557736CE64D8E05607FC496324E64C2D21443 LEOPOLDO.WHITFIELD
59,003,004 *06446028C5AF21F3BF379BB912FD2C7F0FF13A2A LEO.SIMKO
59,003,005 *064435CF990A74FF74EBBB7A0093DFE890A70AA5 LEROYEIDSON
59,003,006 *06446F61A16E984B3F433D93EF8C68E836D424B5 LEROY.SPEICH
59,003,007 *06484EBD2066DA20E31A2416D194CD6CB58EEEF7 LESTATHARLEY
59,003,008 *064B0D84EDD8E031D3EC19C7557AFC3EF97AAEFE LETTEKOR2
59,003,009 *064B72F0C625D398B7A70FA09366CAE381E1DE60 LEVANTAMOS.A.VOZ.(FEAT..LIKIDO)
59,003,010 *064E8D2176F880C48E16265AD6070937AE9C90F7 [email protected]+e5
59,003,011 *064001FAC66D6DF87B0A40F5E6028104CFAC53AA [email protected]
59,003,012 *064E5CDACDD2AA790885241AEF2D3F8593ABE2BE [email protected]
59,003,013 *0645B5E0818A9FADE733443EE59DB572937BC805 [email protected]
59,003,014 *0645BDB79C10C85F2B4433902AE150E66B11311A LINDSEY.LEVITIN
59,003,015 *0647A0A4E4EAD2FDB23469455EF3B7F5C9486CAB LINDSEY.MADRON
59,003,016 *064BF0AF234E2707ED354E2DAC2FB0306310C6E8 LIPPINCO4
59,003,017 *064B687DFAC914F2270BE275D94A610A6756E8A8 [email protected]
59,003,018 *064A85F26DAF0A822BB0AFE4FCAEC002B5FACDA8 LIZ.BARBA
59,003,019 *06437F9D8BF7717903C485636905BF9BA8A7606D lloydslechta
59,003,020 *064D3D6194352585D218761295BB4F98D2AC32DA loganyslava
59,003,021 *0643F79310FEC538BB00813435107A83FAE76F92 logos.de.estados.unidos
59,003,022 *064E5BC1449F6BBF787E1C843966ABCDB53E13A4 lol2424
59,003,023 *0648C75C812E70A2EF5CCC7CA3CB19CACB1FD81C Ltg4t0r
59,003,024 *064EC674A1684A59166455A88CCA996FFEA77EF7 LtMarcel
59,003,025 *064ADFBA4B2CEEAC8AA0BDBBDD38F627C8CEA1AA LUCIEN.GRIER
59,003,026 *0645926649234D32B569FD732BFC1D0E9EFB9D82 LUEESTA5
59,003,027 *064280F6C3428E0289747C7F7750FAF802BFA97B luonnevikainen
59,003,028 *064AFE99F721C6B534B7EC60C8E7CFF2C2461E25 LUPENESSPOR
59,003,029 *064B50D317223758678A94C3E59DF728AB23EBBC [email protected]
59,003,030 *064C40D1F76642647C6BF5D51F328D180413AD30 M1CROM1N1ATUR3
59,003,031 *064C9C6EE9842C2A29C29B01AC5491D7E6149655 machmalauter:.die.toten.hosen.-.live!.(disc.2)
59,003,032 *06433F9168EB6759D5572F9980A2EC97561923F7 magle
59,003,033 *0640D5AEE7E8171F724E1774E69325447ADFC29C [email protected]
59,003,034 *064DBCA213ECA184CADDA6DD2CAE1CD2F4AB3FDB MAKEACIRCUIT
59,003,035 *064A1D9C38838C8D44746643FCCB7033E4945C6E MANATIFLAG
59,003,036 *0644BCFEA801848EE12B210010E58E415CE63E48 MARGARITOWALKE
59,003,037 *0647F9818120792804D23E0FE63BA75EEB64F604 MARIO.DALLMIER
59,003,038 *0642967ABAA290D79E4941E3080683F7F40ED4CD MAROUNO
59,003,039 *064490DB6650B3BA5E61E9B69194407389A877F6 martinnani
59,003,040 *06403753219356013F6AB734B20E96C77FEB58DC maryklinefelter
59,003,041 *0644BAC8C43F9761288BC1D13F5C75E145600F27 MAURICIOHENSE
59,003,042 *064E9719AF488DDF19A4B7FA6C4ECC1F2AC92F44 MAURICIOKARAPETIAN
59,003,043 *064D63C3C9E1DC1FF5733B1E556FC2413891A8B2 MCMELONHEAD
59,003,044 *064768403E724B685133B6891C84AC0575260592 mech4nizer5
59,003,045 *0649CF8FD4657E3984EF71DB151290BDEDC04474 MICHAL.RETHMAN
59,003,046 *064DCDD7B8941F096DC3DF9B0DF31B379D0562A9 missmbsw
59,003,047 *0649AD5D0D4D7BEFE102CEA3C81DC2EDF0968777 mj*]
59,003,048 *0648A8B53D9C77A2461A11D117766928FF5BAFC9 MONUMNTO
59,003,049 *0645AC0BE621BAC58539483E71C213B42A8ABD91 MORTONPEPPLER
59,003,050 *06417C36FDC18D2EBD87AA444E14BB10DCA4782F MOULDY
59,003,051 *064BC90D9C507AB7A1D9EECFC6B3BC6FA8AF3F4B mychat7
59,003,052 *0642DF216DBAD0FEC95B8EBE101CEC156BC517AB NAFPLION1
59,003,053 *06432CD1DDEC6A8836C80FBB471281FD280EFA67 nancykleist
59,003,054 *06410ACD2021F0ECF7956A582237D8341928EB47 NEDRAALK9
59,003,055 *06466F24FC0F06FCA9E3CBB795A9F9DF89521205 NEIL.THRAEN
59,003,056 *0645590D6C1FC846B2D63166C12D9421DD496D2F NELSON.BARNER
59,003,057 *0641DBF02957C90AE2DB8EB53727DF3449DEFF77 NICHOLASCONWILL
59,003,058 *0640F81F6D2091B5B3EF272EBAE99DDFE8D7C0E7 nickylemont
59,003,059 *064D15E388D413252E8A6963DC6C55FD8AA7B0BE NICOLAS.ELLO
59,003,060 *0641D763B02F53594355A6D9330F23B769A57976 nimatdarwish
59,003,061 *064A113DA5BCEE6C3415255CF84AC6C242E3AA00 noelrocchio
59,003,062 *064F67BD86F4F9F3844BA151F937C89DC16C7389 nolanliquet
59,003,063 *06460A3D497F874FA6D095D0AC0074C0AB99BD4D NONCON5UMP7ION
59,003,064 *0645A287F486035A8D3304EF172C8EB746D3F79C NORBERT.VOORHEIS
59,003,065 *064B9235AE8B0CA0DF9824745D38298D3FAE96A5 NORSWORTHYWASHINGTON
59,003,066 *0642AF4808B2213082B6B5DC2F34A7E0D930895B northern.pursuit:.consultation
59,003,067 *064959FFAA6F57FA3E7FF6AE8B3C2CFD8A2A1F38 NORWEGANIZATION
59,003,068 *06442A2538020137842960E250120B8506FA3E2A oded.ezra
59,003,069 *06423C7E38862A82A0335EF2E7CE08AD40A6EFC3 ODISTRIAL
59,003,070 *0646D97DD6A1486B4B5D899F016E8D38107A094E [email protected]
59,003,071 *0647EBE64E447378DA14A76176AC30D5024AB5CB OESTOESTA
59,003,072 *0640E69F6FA2CD186B79804CA23C8CAAE7B1DA37 [email protected]
59,003,073 *0643B08E0781E59AF186F5FED7F74E4055D1EEF6 ogromnim
59,003,074 *064F38B68537EF5CED3700437DDEF33C388FA3D0 OLAG9-
59,003,075 *064D8D8372BC9C638302C5255CB09C307D236411 OLASALO1
59,003,076 *0641CC019BABFF011705674D9AE720F174FA3976 OLLIEBOWCUTT
59,003,077 *064941743917FE905C8B882BC52FAB5D444BAFFB omerminks
59,003,078 *0642507909592D177297947383265048A6258032 onetruelove
59,003,079 *064250ACCDD1D24F55DB22402750D8AF4D86AB9D ON TRIUMPH
59,003,080 *0644963953CD7336D2D26D2DC1BECDD67597C2EB OPASTUKSET
59,003,081 *06401E2C6AC1DE5536F7A9B5FEA1BE0E01923AB1 (O_-).~.(---Q
59,003,082 *06464F886288F61979BBBB60619B4B43922B1EBD OREN.WALRATH
59,003,083 *0649B6AA112E9CE8CB2DFA02FB1D075D88A60EB1 ORTINIRT
59,003,084 *064740EC8B4FEB344D5EDF503C3DD6EBD1B0C673 ottowaska
59,003,085 *0645BD52337B2F8116A2BBD705CE75BDD12A5DBF outinvent
59,003,086 *0647BA616C7557D8E780E683BB46E1023E84FF8F p@ ~0~o)o(
59,003,087 *064DBF95661662B9DDBCD215649BDBD55BDC622D [email protected]~-`)8(
59,003,088 *064F27480297EF8625ADB2FDB6EA88586D920A14 PACHYBLASTUS
59,003,089 *064B599BFC0151B105F081AAD00248E575E0A633 PAULCOW-BOY
59,003,090 *06463269C0C024BAD4EF1E23114B8280F2573618 p#>-~-`->-B0
59,003,091 *06466A1CF60587A5B36733A6579641DAD06F774D P====B~O:P
59,003,092 *064386EB0AEC0C88211984D9FF4AF6B5B86C3893 P######D ~ `)O(
59,003,093 *0649771BCFE8DFDCF3E7270AD8BF8C5FE873DEBF [email protected]
59,003,094 *064B880111469D0704B8F172AB0DAA177278719B pent4109!e5
59,003,095 *064FB4363590FB531DF67FA3512E3971166898C6 pexster''powerful
59,003,096 *064C86B602F1CEB65D6CEF353AC3E9B72132D847 [email protected]
59,003,097 *06493901E06082B0E1930E8A4C6D4B2B8EBABDD5 pierredoegg
59,003,098 *06462644C25D25C9C822E9E9915D203BE01E2D03 PLA$MOLYZAB1L1TY
59,003,099 *0640238567429E20670BE891471572C41E71853C 『plastic』tr
59,003,100 *064AB2C6A198DECA3207BE1BB0ED15AE051888E3 PMOREAU2
59,003,101 *064869BE8D359609C5C6830E044B34C5CBF452C5 p>.`.)o(
59,003,102 *064C13619BE4095B66A9A8734684D27343F400A3 PORTABLE ULTRA SOUND
59,003,103 *064C2D60BD87658A4FEE8906B08D14897F8D3B1E PORTER.HARKRIDER
59,003,104 *064F4339AAFD0C645964EECC9F5F6B06E56576C6 p###p-~-`-(>-<)
59,003,105 *064B4556026EEC1443CBF165EF22B7AB79F3B438 p--p-*-*-*(0_<)
59,003,106 *06473857521A3C5154F294B649F187F2EAB47D54 prem.siva
59,003,107 *064242A448A2C1BEC76B55CA2FAD12A195BA5DC1 PREVOLIT8
59,003,108 *064296AD2980CFA72B55E90045536B58899D061F PXOMBB
59,003,109 *064F7DE5525F08D3F948D21A9C09E729DC9E6B7A Q------D~ ` SPLAT!!
59,003,110 *06449BD42BBA71ABD718E3193B9B1F4B95534258 QEGG
59,003,111 *0646FB46B115EB8132210BA2A5D987669B94175C q====p~o>-b0
59,003,112 *0648BF36AD29D606F3B2C4461556AA3D38402993 QUENTINVANT
59,003,113 *064B571E13E593D7434E700F4AC6D0DE09FAC10E QUEUSOT7
59,003,114 *064A44DC2E4C46AE149A56FF100C9B3BC3AC1418 QUINCY.DEHOYOS
59,003,115 *06464673059D3D3CE6B69ED6B37A0545EC6BEBEA QW12QW78
59,003,116 *06450428BD8C236010E8CE71512750F1CDD78A7E [email protected]*-*)X(
59,003,117 *064C3F0BC527E056441275FA311424BF3CC1CDC5 [email protected]
59,003,118 *064A453923EF7A8A56652DA1C217D5606BBA96D9 raleigharenivas
59,003,119 *064C4263F1295C674F54FC3793E04E5134D4983B RALFRASO
59,003,120 *06405926A17A91AE39E5788F52B34863B7577588 RAMONAMISTADI
59,003,121 *064C9144A1DE32A1F882475FF9EA41C966013C0F RANDELL-WIDNER
59,003,122 *0646E53B1DBBAC33E09ABA8532EA8AA5C6BBFF62 RARCHER39
59,003,123 *064581F5EB435BCB46B922FBF2F0C30363ACC8A7 RASTA1983
59,003,124 *064EDC19475FB6865A5FF715B8D6D22892DC9F68 RAYFORD.CERRUTO
59,003,125 *0648FBA755C51B32D08FC89631FE8BCC311D79FB raymonfurth
59,003,126 *064A4A4AEA925197E2B86ADF3A8C27B22A790893 READINGSIDNEY7
59,003,127 *06409EE1ADF38BBDFE0FEB1AF6D49EE709873A84 REC0N5TTUT0N
59,003,128 *06476CFD07A818CE32EBA9E7957415749B242170 REISSIER1
59,003,129 *064BEF67E56C50B0324CF35D3DCC00A12FC3D155 REKRONAERSING
59,003,130 *064F976ECEEA3582F3DD9BBA3992650D4E1B20D2 RELIGIOUSMINDEDNESS
59,003,131 *064016F00D91ADF3E7346401CDCF1A263C87116B RENALDOAXTELL
59,003,132 *064BD136A328DA12204260A9CCB8D889AEF250E2 RENFILER
59,003,133 *064CAD029612BDD1594E2A99DBD7A1B29C7BD789 RETTESEC9
59,003,134 *064141E5743F8FDCC30EAA711322CC01FC64643A [email protected]
59,003,135 *064E941A352A09F11F4FFCC2B0527E9BAA34FEE1 RHSTNJFWWHCSMRBRT
59,003,136 *064AEB8424CAC17CA853BA9BA4667D2AC01C6CE2 [email protected]
59,003,137 *0641771EB03BD3FC2CCC4B30F11BDD04E1F0A337 rickeyboies
59,003,138 *064B0AE051A8681C7DA833E6D539A46309FFC5E6 RICKIEMAISH
59,003,139 *064B2F9052BC95ABD6C6062F699C935D6E4DFFAB RICKYSTEADHAM
59,003,140 *064D4D754A067144EE33E0681C5E7F524F21E71A RIMBONI
59,003,141 *064EC03D4E9419904DD38C3983A5EFBC1DEEE977 ROBBIESING
59,003,142 *064B03995125A9A9ADBF6B741E45388F2FC954CB ROBINMOKIAO
59,003,143 *064EEEC5BC35423A050F30A1F929F5FBD37A0C58 rockyh522
59,003,144 *06483B2F5D2E1B356D33EE7E7F065878F19D0C74 rou$t1n9
59,003,145 *06473A250A7F35D05BBD76E06D7B76C10C56236D RUBENGUSE
59,003,146 *064A75DC701D301AD586111DB5A6C57C9F70F035 [email protected]
59,003,147 *064C1A0ADB1410A0382E4458E434DCCC91E54DDD RUPERTFILZEN
59,003,148 *0649DD3C48C8251A5AC645798890DC6A301C26F1 RUSSELHERZBERG
59,003,149 *064D989E02276754D53F196CEB79AA9A5A575B52 RVUSKOVICH
59,003,150 *0649661804DB103CF4527562D56093F071449B56 rww2
59,003,151 *06429B57A177848278AE95BB70F42666A7BCDA81 RYTALE (B)
59,003,152 *0641062F9E90DC9DAC38A7F459EA1F9F536C3A6B S4R4M4
59,003,153 *0646EFB93D442A591132A12B95F51C49A7C627DA SAFFRAANKLEURIGST
59,003,154 *064ED49A539123C651B305EF7D689009C3A1FD23 SAM679
59,003,155 *064E9CE47BCE6C78F082F2C54004CA3C3B2FA3FA sammyboop
59,003,156 *064328E4AE0BF5AE1736E225CB9F7F019F1A1A14 SANFORDLEI
59,003,157 *064A0FA4E73B110D07C6001DEBF843C4A94DB33F SANGOSINGER3
59,003,158 *0647420241A397E73553D00961B10CD87C30485E SANRELOSNOK
59,003,159 *0649999AD3DFB9995FC898D4FEDA445BD06DDDA9 SARRAZINSELBST
59,003,160 *064DC7BE20BDA41AC595DDC6371DFA063C6BB7A2 sasao123
59,003,161 *06434775FBA2582CD0539C7B2B50713420E58B2C saturday night live (c)
59,003,162 *064592B6E9FDF4328E054E0BAA69C4839E9C1159 SCHLÜSSELPAAREN
59,003,163 *064E6CE27B4A347B13BBFF121189A977D33410C5 SCHRAALHANZENS0
59,003,164 *064C8F397D8134E129199C795BD8C92358B48382 SCHREI X
59,003,165 *064905FA5FA66ADF15E04EA8DFF4682DDB444316 schule,.nein.danke
59,003,166 *0649A781B1DB640A9A7FD2C77DB1E35DC0BBD4FE SCIENCEPROF3
59,003,167 *064428280C0B5AAFE32AC1D1E397398B22CF4DCF SCOTTIE.HUBERTY
59,003,168 *064B7CE6293E147CF97BC31DFF36BB4629A71E2B scoutcgj
59,003,169 *0645D949E31BF9861EA735166E0F0A4BCEBE7C9E sgmlrela
59,003,170 *06452666E8C6248CD9DF73420F67B7BAA73A06AA SHANNON.OST
59,003,171 *064581164BF3FA24905E8ADF0080E155D551BBD5 SHARONMOSHER
59,003,172 *064201DAC2DF9815C40B758959EB4F712BA5AB69 shawnmarchetta
59,003,173 *064C2977B8B39E917C7E2FBA38B36218E6D4C532 SHAWNTE ALEXANDER
59,003,174 *064443F7FA1E05637E80F69E7773498C0C0917B0 [email protected]
59,003,175 *06482BDEFCAAE0949F30C6486E6D18EBB99117FD SHITKNICKS
59,003,176 *064B85F90540E33E07E79F05E3FF3CD9AFCC206D siitinsyöpä
59,003,177 *064F7262BBA395B0C168057D469BE34944E0EE81 skalmeje5
59,003,178 *064331074C68E9ABE2E23D4A181B621007999F70 s:l+
59,003,179 *064B983EC09FE2113B1B83E23995BFED55892CC6 SLITTED
59,003,180 *064639E0151D8BA3792F77595C8053469A474A4D SNOOPDOGSYMBOL7
59,003,181 *06432A4E9C719602D07D850C141FF80D4CE2D6D3 SNOT2
59,003,182 *0647ECB006517E97B681A3A6001DE71AF17B3FD9 SNVVDSKP
59,003,183 *064EBFFEFAF0C17B426FAC34AE8E839047E52294 [email protected]
59,003,184 *064BBA800ADC83117062C0F91056643E77A48D25 sosaidthelighthousekeeper
59,003,185 *064F590CC439A8D70BFFC15D4F48F7769ED5D034 SPLAT~`.<===3
59,003,186 *064AF1AC4848C80606AD6D8465D95E21CF6D0C84 splat(b
59,003,187 *06415750C552D9F3A9BA4904BDA558DE59B6B4CE SPLOIT.O~O~(######B
59,003,188 *0641B25657C5B6823AC5CDB8B0380062A7C9981D [email protected]
59,003,189 *064E65B1596CFA191A2D92FD068995EB88CA0A33 SPORCO MA DISTINTO
59,003,190 *0647D7EFC9869EE390628D20F888BA4C3BE83CC6 SPROGHIERARKIERNES0
59,003,191 *064B6FE7566817D8B37F1B4BBFCF6E53665A5C9D spsd--h0-s-p-w1-z-d
59,003,192 *0648D1ABF0B6FFB76FC5D9BF6297FEAD1BE65950 squidrelated
59,003,193 *064DB01925EC89BD98B68E936EE7131A91092E3A sresprod
59,003,194 *0646BE02054ADE78680ED8EFF773624606467B3D stephjoshua
59,003,195 *06436A191CB62B574E505A0CAA63436E83B0F3CA stoerrelser.
59,003,196 *064EB8C131DFB987DAD33086DC27A8E11E54769F subalpn3
59,003,197 *064C645C6BF3BDCBC9194E69DD7558B45C738109 [email protected]
59,003,198 *064798A91FF9E43018C2A3CEF6EB7429DF0EB3C0 SUNDARI PUTHRAN
59,003,199 *0648B1C17800CBD4B71EBB76F4DCA0511613FF41 SUNGENZHO
59,003,200 *064C7417A93A188226DE9A230A1D601F3E128DCB SUNNYREPUBLIC
59,003,201 *064CE76566AE163058AD1BD86A95315C5AFE9E98 suudelle
59,003,202 *06446189F36382E0FF02798064F0F37CC75CC613 SWIRIN37
59,003,203 *064E4937402AFCEDE498090D9C62616B56C58198 SXAIO
59,003,204 *06452661A5BEB5E8B69ED3893A7BADACC408E788 sydney-lynn-lok
59,003,205 *06426211982E0D480A229F0F71A6A108C59BB45C SYGXWRHSAN1
59,003,206 *064461BA7C1FD8C1F4AAA4A5F9EC1EB79E602960 sylvester.harper
59,003,207 *064515C7D8E527F6DF5D2E31B398F5133641EBE4 tasteresti
59,003,208 *064336769D8946A55C4EE83FAD97921197F081CB TERMSCATACHRESISCLAMPINGCLAMPING9
59,003,209 *064DC44599325CDA30AE18F651FD18FB20D1B378 terpentijn8
59,003,210 *064CDE25C959AFCBE73CDD2C8C4237949F4FF65B TERRYCOCKMAN
59,003,211 *0648698A66B1B0F9F4F3FA53A319638E6233E275 THATBENOIT777
59,003,212 *064914DC72A8142A77193590D8FC801C665E2A6F THATKEITH149
59,003,213 *064C9C43F49E7EBF980B620A14EE06B34519F010 THEATRES
59,003,214 *06467BCB88967DE0BB75A383517D6BA509D12212 the.lou.reed.song
59,003,215 *064BF6F43D2BA3ABFA284769498DEA110C0E36CA THEME.&.VARIATIONS:.VARIATION.III
59,003,216 *064B10C7F420DAF3E0E1FF520BC5282D09927BBD theodora,acti:go,gen'rouspiousyouth
59,003,217 *064C1845DAF55BF05DE94E06E87ECEA3FF2EB342 thuy.lee
59,003,218 *064D70AC520B33F82F859195BBC83F993A8A93EC TIAREGILBOS1
59,003,219 *06490BE1B1F760F622322AD3E60DD8E14D045DDD TIMLIG(TEMPORALYOUARE)
59,003,220 *06469FA9AE461A8BEB582DF0975BC4884AF7EB85 TIRAKNEG2
59,003,221 *0642E26B45FBA625A1FC8F4B2B8B07E7EE0B3228 tomasregina
59,003,222 *0643DD075508F6C5819827B8DA3298672A83CD53 TOMMIE.SCHEWE
59,003,223 *06411C95F3E29EFC7836B1AB03EB96A9A4F369D0 TONYJACKSON11
59,003,224 *064C3EA1EF8093F837B4FEBD528129FCBCB96CCA [email protected]
59,003,225 *064162CA3EA3B6F4A948BFDC756FA328EC92B470 TRAQUESESES
59,003,226 *0645C1DED85B05B1C184662BA5B787AC02381FF0 TRAVIS.HEINEMANN
59,003,227 *06481BD49DC28E37BAD82DA46BD2CD67B72040CA TREMBLING,2003)
59,003,228 *0648FDB65F97B295FCC1774C7D1B731A8FF18A3A TRENA WICHMAN
59,003,229 *0640F578B8D0821C2A360C4F2CF693A71A91BCE4 truthing1
59,003,230 *064426843DCA4A4952FA34E902F210C7C3A4CF26 tyroneguilbe
59,003,231 *064E1E5305CBC1F5CA434AD5B87BCA4B92577519 [email protected]
59,003,232 *06442BA2903285FC23F15F86AFFC894B4EC3B2F1 UKCHUNG
59,003,233 *064D7580FDDE8612D8529AAD792A45EC250A3CAE UMHERGESTRICHENE3
59,003,234 *0643EE8A28B4F9B69E414FD58A3086E49BBB7E4C UNSERIOUSNESSES5
59,003,235 *064CB94D216E2D8D65A36AD93CE69C9C1C0408B5 URDORFS
59,003,236 *064FE72D1B7DDE0CCB6B41109F1F71C78ED2A25B Ur.Flava
59,003,237 *064F0672DFC9B3F3BDBD1CB17A0DA741B9C03474 URPRIVATEDANCER05
59,003,238 *064B7151136F809409F80ED85230F52A918E266B USTEZIAW1
59,003,239 *064F7242C25C4A06CCF3F7068FA2677E98411D68 u#)u
59,003,240 *06485F283B6249957F6D0557E99348067A4B0BBA VAIHTELEVASTI
59,003,241 *064595C6291BE37A65C0019F4F2ACA03BFF53F73 VAUDRAIS9
59,003,242 *0642BAC5E1D352D03C2F56D57130FD993D35208C vennskaps
59,003,243 *064C1E0CC66110B5D1420A41201E54157118BDEB VENUS.TALAGUIT.BULOS
59,003,244 *06445A39968DE4EF4D6B27DD50A23FF44C0943BD verdaagt.
59,003,245 *0642ADAA50BD3F01B60792D40D4EFB3511142231 vindra.westlake
59,003,246 *064FEAA105BA9389943216D307C291105E35071C VIOLENCE-(NON-MERCI)
59,003,247 *064168A884582C35C9515B53B8E3314E27E7F783 vir0l0gi$+
59,003,248 *0649A5AB17543168277C2887604817F6CAD07EC7 volume.8
59,003,249 *064261992E0F8D75424A3C93EC99E142AA1FBECB V.S.SHOP.BF
59,003,250 *06463C72ED0002E6A1965D1775B009690B12644E wallacehitchman
59,003,251 *064944899730E77E9090269031636127F2D11352 [email protected]
59,003,252 *0648475E6D6C60EC4C4A3B02DC7DE2C6BBFA2F21 WEGOTTHAT(FEAT.ROCROO)
59,003,253 *0644BD5A18DD2D78DBB82A848D36E28DBB14E953 well-out-ofout-on-a-limb
59,003,254 *06453C080483F1BA962B2CCA21C1D7BC9053EBCF WENDELL.T.BIGGS
59,003,255 *06429B99DA920AD2923C7B4DB543631CEF6ADFA1 wendy.s.webb
59,003,256 *064D22501D38F3BB6775B12753DE7D5989DFAC9D WENDY.WEGENKA
59,003,257 *064ECAA6DB5C6BDFB5C0AF2CCD8EDB58CECCBB5E [email protected]
59,003,258 *0648F12257BD47063CD8C63B599AE569EC8C85E1 [email protected]
59,003,259 *064A47B535FBCADEBA93F43D327F7179945B0C57 WESLEYEVANCHO
59,003,260 *064548C88A3C0834DCA015497E9ECB42383B858F WESSORTORE
59,003,261 *064ABC157FE58B9F725F30D670A285E42D766A5F what-'d-i-say---tutti-frutti---what'd-i-say
59,003,262 *064377206BC4169F43D068143807CF417C9EF458 WILBER.CONNOLLY
59,003,263 *064BA7A3A5242B03B532DC9E149E79CAA5539933 WILBURN.GANNETTI
59,003,264 *064016D2113BC95FE11AB95D15142F5288BFF890 will-goldston
59,003,265 *0646133D616056FFCCCF4B9AE6052578577EE264 willybayuardi
59,003,266 *06424C32568F709A24B79BBBA4DCB0FEA0197123 winogean0
59,003,267 *0646138B72D0519DB3F007A19C0FA7DC6AD7584E WSBNINOB
59,003,268 *064C95CEAD2F5D7EAB7829EB1D2124C4519A8B35 [email protected]
59,003,269 *064CF3B4452B7124FE85E4866E1997192D95C798 [email protected]
59,003,270 *06426F058CA011F5BBBE4F908803E0666696E3B8 {X}*.*.*D======Q
59,003,271 *064E1199D7EA451631BB70CC268EC36AB9899DB7 [email protected]
59,003,272 *064C7E5A601C296AF914DF97ED1480A733FF3ED3 yelaginoostrovsky
59,003,273 *064B3CBA093BBC5DF2AA15DE71673534C36C6661 YKSIL
59,003,274 *064FD1F21B7CB46E3B5A6B83361811E58403ACF1 YouDon'tKnowMe(featDianaKrall)
59,003,275 *06418D0FAD3CE6005E6652C9A8AEA266383AD037 (YOUMAKEMEFEEL)SOGOOD
59,003,276 *0644CC6B8ED730DEE4F69982D8AAEAAE0267A59F YUDI LAKSONO
59,003,277 *0648E92B253E3F775CC06DDB4B9AB275E157764B yugi-duck
59,003,278 *064791709AAC0542C9CEBBCE06932239872D50DC [email protected]
59,003,279 *064DC8BBC90CC4A706E33FABE5FC9F6E94CD9EF7 YUVAK.BIRADARI
59,003,280 *064798A9AD8EB60A38A3FC12A3A30AC823FB42AD yvonnie.ametin
59,003,281 *06411CBDFEE61563E84FD0F54D516EF9F9DF6671 zaedzaid
59,003,282 *064C8C0ECA2035109095E47F873A017F465E4D74 [email protected]
59,003,283 *0644B917C5EF3AADABDAB7AC1D51435DEFE140DC ZENICSAFING
59,003,284 *0649877631A601C0CEDEBE4788F60956E0C42CD2 ZHENDOUG7
59,003,285 *064053DC40BF6AF5C0D91F0CC764233523387222 ZONATRAN
59,003,286 *064942324BD95E03300DD6F9F078E6B6D6A51314 [email protected]
59,003,287 *0642E77E997D14F7DB0058B845248D03F570E827 zuemigomez
59,003,288 *064BCFEE1BAAC414FC6015D411B792FFB634B326 БАИНА
59,003,289 *064C199FA2F399A508FA4D34E1717238B2352CC1 «ВСЕМИPНЫЙ
59,003,290 *064A8F5540B1E81EFCDD61FAD968787293567B94 ДОЛЬШЕ
59,003,291 *06424CB5EDF3724694167CEE84774849F496738D КОРДОШО
59,003,292 *0640F361449BCD0CF9F69890829B6272F1D4BB34 миоендокринните
59,003,293 *064D415911D2A5E5463D803B094C9804F694EAF8 ПІДНЕБЕСНОГО
59,003,294 *0648F43ECA993A56099CEE4D14C17F8538EEF2CF ПРЕМИЕРСКИ
59,003,295 *064F95B239E3C48F4988CB1377C3561FE59A11E2 рыгоры
59,003,296 *0646093270CEC2EA35F3E77A380EB7F938737FE8 СКАЛІМАНОЎСКІ
59,003,297 *064A9A73476EDEABF2AB2D01E9D5D90846701B22 ТУЛГАК
59,003,298 *064FC11367F13E2C801031AE32A30BF2CB5E9E33 хоутена
59,003,299 *064F8B52E9D88311C96E3D93D00FCF4F65714390 145774 poliittisen-keskustelun-taso-t
59,003,300 *06431F69BC70235B7BDECAF56AC699B52E25A3BA 148094 SAAN-JONKIN-VERRAN-KIRJEIT
59,003,301 *06471B857BFDA0358848A9E03A50A82C62EE4F2A 16 LEIRIKESKUSTA
59,003,302 *064C52BE9A85C8A102F2F762707105DD204AD5E4 1734679 bananen-sind-das-hauptgeschaeft-von-atlanta-.
59,003,303 *064CADA692813AD00A0778F668BBC16BD1E5C0A0 1840685 they.last.only.a.short.time..
59,003,304 *064577513610B5A44BD11157D7B34DE09BCC1365 1886310 seuraavalankailmestyy307
59,003,305 *064FA6BBC20192A00A5026A39FE2A4BB616B84DC 18S
59,003,306 *06438B4E7FE157820B4B481E7FE663BF718FF2CF 1-ba-god-ja
59,003,307 *06415393582C76E3E161F131E67CC56C770E3924 1CAMITHA
59,003,308 *064B2C0EE886F85529847FC0C9A44D28231ACB1B 1.eiweissbestandteile
59,003,309 *0644A5DE5643EBF1093FB9CC27AC7F596E5A5EDB 1-EKEUKSELLE
59,003,310 *0642AB2B23E9BEC1B563F6E0E776EA6833C09D33 1.everywere
59,003,311 *064D3FA03D9B83F6EE0631D8FB297BA03B3D7730 1 FIKRA'DA
59,003,312 *064ACDD607D05042F35817AF482FE2DB10481892 1FOSFATASE
59,003,313 *064A7CC704550AF212F3F1F9F1B34A62EBDD0C01 1GIDERLERMIS
59,003,314 *06489DB3F1C70653093FA05570081960A6430133 1INDUSTRIEGEBIET
59,003,315 *0644EB7A5BA276F6B23B3BBE7A37BF2D2E152497 1ivalaulu
59,003,316 *06472286C0899FBD8C4ABAF6C72560A3CBF3DEA0 1.KATALANISCHEM
59,003,317 *064F4DC2820F40194646BB408F66B82E45F854E5 1.KAUKALOIKSI
59,003,318 *064A6CBCDB9CF169C4FA75DCDD20764A0BFDDBF8 1kino-centers
59,003,319 *064FAB8D7D5E4CD3F6515C6FC291244BB08CC197 1.lady-hardly
59,003,320 *064C404E284D0B358DD22D3D9974885077A9AFF1 1.multimedia-kapitel
59,003,321 *0640B5383BA5FFA446FC6C234AF79372847227C2 1.POSITIONSQUARING
59,003,322 *06401FEDB2A6A063251228D4E20D1198501F9D6C 1 SAK-TAPAHTUMAN
59,003,323 *064B45E6C78B28D484787EEC5E8AAE1E3CAF2943 1SCHWEIZER-STRASSEN-MISCHUNG
59,003,324 *06496D26839E0992F569EAF52CCA23D94A4F9BE3 20051031RDF
59,003,325 *064823051C4CE154468D96A1F082931304E2821C 20FRAZIER
59,003,326 *0644EFF639092B33EE7CAFA7F96D821BA3C27444 221КМ²
59,003,327 *06450AC93CCEDF08E2B084803B734B0B1F3E2D8E 2294246 the.index.lost.634.10.points.on.friday..
59,003,328 *0647AAB3CAC8B8A1D9059126B0F48D2C24957730 22-PRIEST
59,003,329 *064C77152BCDEE094F6FCE363DB9A560D75F797B 256275 huonosta k
59,003,330 *06423599326328EF71F77937AF102A772D90ACA2 2563808 free-net-nime
59,003,331 *064EF1D479343F351C623E4439501785DF790892 267(pdf形式、英語)
59,003,332 *064E7CC846F8EC98EF1929FB372E44A098474792 2797388 WIE.BITTER.MUSS.DAS.FUER.HELMUT.KOHL.SEIN.
59,003,333 *064C85C087D0B06285185D5E6F31F0E29D14CA4E 2ANNIDAS
59,003,334 *064C6B675ADFD6C3DCA224D25AD05498477BC64C 2.bolgoda-see
59,003,335 *064FAE7E12832C311F89EA315D2CA69AA71C0B48 2DETACISEV
59,003,336 *06449587023110652524425ACC587F11D220F230 2luckyblaze
59,003,337 *064BC4C27D426970F8922FF2738971EB27A752BB 2MYLORNA
59,003,338 *064CFC4445D727970CBE639EE0E3D8EFE0E15722 3----).*.*.*.~0~o)X(
59,003,339 *0647D3962A0AA6AF2FCE5516B4D45F49EECF214C 34rthbou
59,003,340 *064F8EFCF38543ADE485836C8AC7623595FEE623 3b49712fc59347a1b8bdb0ad81e6ccf3
59,003,341 *064E35CD989807FF1939CB9728D68AED6D42A84B 3g3nk
59,003,342 *064356706F87D22A16E6A5282D9FFFC7A65BC27E 3MSNLYZLY
59,003,343 *0647A21EF4825FAD2D7101909A66C8E684CEF4F1 3==P-~-`-SPLAT!
59,003,344 *0645DD8EDB3753C70667F3DC7EBD4B83206671DC 4.bazy
59,003,345 *0643C4C18ED44EC870EC437D65E8FDC2A94554E0 4KORENBLUM
59,003,346 *0644DD60063FC6B77B7747973D3CDFB48F3C6CDE 568029 ER-SAGT-:-"-ALS-TIER-WAERE-ICH-GERNE-EINE-BULLDOGGE--"
59,003,347 *064424D7A97CD003FE2FD43E25E9B872D4B1026D 599as
59,003,348 *0646A80E66F9E9B44E6C7405BBAC0B29D4FE7663 5DENOTATION
59,003,349 *064C751FD9ED7DFFD27A5CD9BF4EC8329E730778 5HCSTIWES
59,003,350 *06404F48392A94C4EAA7738796609A46C36C5CDD 5JOSHJAGUAR
59,003,351 *064790935964215AD311754522A17A776E483A9B 5KMに沿って設定されている。別名
59,003,352 *064E8A5081E7DBB3019287B34CF9168EFB9CC491 5MYHAHA2
59,003,353 *064D22CA5EA31CECC9DEDDBC18A78BDE247F0E34 5OPPVOKSENDE
59,003,354 *064F69AE67293E14E6C6C17F1BC23F071745777E 5THEPINKFLOYD8
59,003,355 *064BFE44F430BD33783247CD2E801B37A87CF7A7 [email protected]
59,003,356 *06431820273C996137A9879C2971D5B5A6DEF93C 5WINQUERYSYSVALUE
59,003,357 *064553E59B405DCC52FB6FB28705697FE0FB7BAC 5XCOUNTRYDOGBERT
59,003,358 *0644CCF76815C8A886741E73F8C168F7FBA494B4 64 KURPARK
59,003,359 *0644D93E66F984663AADBB63F356E8D6D55C538C 671332 C1010130388ALHONOSUUSKAUPANJOHTAJANNEVALANPERHE
59,003,360 *064075DDA0939B058810D7A2F7C1176EC2098802 6AVAZZINOGA
59,003,361 *064D22C6107872A6521351BF205F7C2A1D88C127 6BLAMELESSES
59,003,362 *06484EBB67E48B6F5FC4BCE71BAD1A0ED68129D3 6JIREKIULS
59,003,363 *06491D788C971869DFB398D4D9C5C3CBC79DB6E6 6KLIMATOLOGIKES
59,003,364 *064E2270B2070817446DEAA9307957312ED2C5B7 6LRLNDRNN
59,003,365 *064FBCE65688B91861ED8CFF49B9795D3B4D41D6 6pleochroism
59,003,366 *064288225F5E7308C469CABD99145F3C3AAEB9BF 6VENEPUNC
59,003,367 *0642640351CF482098E189BF2A06CCD237FBAC83 6VONJALA
59,003,368 *064B417017D76FF19C1D7B5AF737FE2228C2AC79 717902 genisbircevrenizvaramayalnizyasiyorsunuz.
59,003,369 *06485F56185164C2E682AFEE1420286F1261A74F 770510 H
59,003,370 *064ACE343D3ABC2709D5DA71194A6FA53B7781D9 7BSWMEHLTRETTER
59,003,371 *06493E176DBBC1E9D592FE3044653A0996CD1103 7HORNBURGBSW
59,003,372 *0644D966A66EA77A19444E0B8C1CEDD8D7914CF0 7SALATIS
59,003,373 *064B3541A429E428821CDC7F932A950A616C1B72 7SPRZEDAL
59,003,374 *0645D685AC58DFC7D0F28416CC00DAC9ECFE6497 7SUPERSECRETIO
59,003,375 *0645F982A584DDB655510CA8236F0CADE1742676 7SYSSGIBSW
59,003,376 *064E756056712E3431F50EEABE5C5F7A8FE3DE3F 833757 INSIDE.,.THE.CHANGES.ARE.MORE.NOTICEABLE..
59,003,377 *064ED0ABABA1BE1726764A5A39090155C01BB459 87F8ESTF
59,003,378 *0643CBB298A69CB4DAF61D29E1023A94671EA572 8BRIGUERIEZS
59,003,379 *06485E085FDC1499DEAB02DEA63328E92502D0BE 8BSWMAXIMILLIAN
59,003,380 *06429447F1BBE76E5D6536AE02693F7FC328FD02 8DRYINGLOFT
59,003,381 *0649C6CA8855177F7F0E02FAAC975A742B7F3681 8EODWRAKOPOYLO
59,003,382 *064B9AA66ED73C2D62EE31D099BEC30DE574810B 8PREISRCKGANG
59,003,383 *06491E119278D181F0FE5080E66EE81E8DFB3C00 8p* * *(x)
59,003,384 *0644902E45C422E21B0C9DEAF8A19404F730B6CE 8WYETHAYERST
59,003,385 *064B7FF3BA48F0A9638F257E49CC0AA12DA74E83 952931 "-selv
59,003,386 *064837DF5ABC0C9BF92D2918F00F1FC736E640D7 955051 TASA-ARVONK
59,003,387 *0645220904D5A0C7F6FEA83530E311CFCCF09369 9ESIETNEZ
59,003,388 *06440476E08A54F1CCAD8183BA0560675EE50AA9 9FESSORBSW
59,003,389 *064834D28CBE0EFD3F8A428637D1DA320301346B 9JUNGHAHN
59,003,390 *064030292657CFA0478830D9A15A240A56C42E8E 9LUISMENA
59,003,391 *064B2CED674CC06699BD5A9917298CBC3477C586 9MANTINE
59,003,392 *0644EA7344DD094510D495B770B7BB5A9B0510A2 9OUTRUINRULESAGSATISFYSCUTTLESEALSEATSEE
59,003,393 *0642462CFDCE61C9FBF8C169FCF39B576E0BFC37 a0at
59,003,394 *06438068C965349A2E357123A58935C037738DB6 a3m+m
59,003,395 *064F1BF2FE3E8D15B30AD247BA8E6FBBC31FAA9E a3rus
59,003,396 *0645B3E8B841C0E19AEC41D616BBD82F05E26978 aacmh
59,003,397 *0647BF25806510695C6AD69FDEA8B4D5DD94529B AANGERAZEERDEN9
59,003,398 *06452829E18564DA07E23AE88A3DBEC65D61F7E0 [email protected]&e
59,003,399 *0642A161C455C1E76F0B83760E509A13A57EEDB1 abeltimbrell
59,003,400 *064984C9037C642DD084DDEDF09BB35AC3970AA4 ABE.MATEOS
59,003,401 *064F0DBBEA066338D96584C9669A81CD841A9214 ABGALLO2
59,003,402 *064B247ACECA8DEE630F47E8337AB10301C26F73 ABLENKENDENS
59,003,403 *0647AA9AE7ADF995755042FB1168DEEF1D056367 ABRAMOGANESIAN
59,003,404 *064A13968EB903D9332B9746C97A855769E41993 ABSHEIL
59,003,405 *0640F22CBE383A54C67B6823AC4324FC84E1B11F ACCESORIESC
59,003,406 *0642E5B539EBC26D63426B5C79B2410B0C38620E aconnock5
59,003,407 *0645274824D09FA51EEE51429740DB4ED16C0867 AddictedDreams
59,003,408 *064B4CA27D7A6722732FF76D27DD1A8256F04658 adieupourunartiste
59,003,409 *064DF2823AEEC74FA2662DFCC1977ED87E7AA3FC [email protected]
59,003,410 *06402C149F99972928796B483C89B836C34D5C93 ADUNANDO1
59,003,411 *0640EA32D346FF5A0E3A89FB31271CAAAD337123 AETSIMHI8
59,003,412 *064278956C36168594F22ED20BE1CA4678BE5910 a-eu%
59,003,413 *0644AA817BC8466287A24355E16EEB1AD6A3C9A3 AFTERCHANCE
59,003,414 *0649E3A2E4869F730BB011580B81F286AD168F46 AHTFR
59,003,415 *064804F9360DD56414B9FEA46EA0473881B8D971 ainogota1
59,003,416 *0646F1C183FD0236942DE59F3D2D0EC6668C50D3 AKSHAYA.REDDY
59,003,417 *064874FE2173418AAC62C48F3C6EE338BDFEE7FB ALECKAMAI
59,003,418 *0642E9895ADA5D52D63D7B7ED59522BAA91DC658 alecsilvernale
59,003,419 *064003EDBBFF880A01B59690E25A2280D5F72EB8 ALHC
59,003,420 *064BD00C3ABD33F8FDEC73A32A8CA08AD1548C3D all-we-say-&-done
59,003,421 *0644EF07786A8B2317002D11276AA5930200A1FC ALONZO.MERVIN
59,003,422 *064C555D7B02FCFB50C212DF610FD0D0FE401F04 alphonseliesman
59,003,423 *064462A9C127221DCB2C1A98EBE179135BF4D94E alquails
59,003,424 *0643DFA5DBBBC2C66C914EA7DB23EBB05C9F1282 ALSIKBIJMAANLICHTNAARJOUKIJK
59,003,425 *06454220F865F7B35929174359F97FA05E07F7DF AMTGERAT9
59,003,426 *0649174668D313B51917349E3E5468A8D337B035 anailamasnaca
59,003,427 *0644E1531DE8A1A4DCD5E841D7E8E90E48761CF8 andreicristian
59,003,428 *0640B425AC827E661E25B2AD9BEB774105ACA3D3 ANTONIOCONNYER
59,003,429 *06473D399C8A66B501432EAEA17575547A8F4B62 ANZUFAHRENDE
59,003,430 *064738CC7867BFD4E8C0FED10F4F13E9B332367C [email protected]
59,003,431 *0642E0E083CEBB5F6C7160CDE81F17E397F4D59F aq4wk
59,003,432 *064244A2685DE04F12B4FF7743C1AAE9B0A63586 A!QZE
59,003,433 *0646F42FEE8EBE2DA926F760FB53630AB7EB5FF1 ARGV[1].?.ARGV[1].:."ATREUS",0);
59,003,434 *064A2D007FD24AEC2090A77783D3A1C0A3C07F2B ARNULFORAYNOLDS
59,003,435 *064D247E2C323D9B2828D78CC3D98EDE782795BD aronkinlock
59,003,436 *06423222A71C61270E65FFBC64A4AAA66CD22EBC ARRONTHORAN
59,003,437 *064F8B7DAB63711BA42B67EAF45E2C0A90D11A7A ARTHUR-RICE
59,003,438 *064FBDA0BF651FE02A31F7EDC8CF961FAE7C50F3 [email protected]
59,003,439 *0646803596428A3DC1734F1A153C3B5D0E0DF701 asianamericans.12
59,003,440 *0640F3D508C1EF8B765D4DF4D3C3D44CDC4A8D79 a#sl
59,003,441 *0647A1044A293B5B6EFFDCEB07336F69AC48FC7D atommagf
59,003,442 *064A96F46DD858988E87EE61D7415BEA39008B0B AUGUSTUSAGOSTINI
59,003,443 *0647A35AD678D3073EFA61C90235B469E861F6D8 auslegung8
59,003,444 *064D907E9D9CB43042842B078F387BE651692734 [email protected]
59,003,445 *064F095B7D64044C20D821ABCEC3EC724EF54DCB awub
59,003,446 *064CF19505537FA57382358247575B64EA490A65 azihah.ramli
59,003,447 *0646AE253C58A5B45197EBECE1306312E3EBAE0A B21"F
59,003,448 *064B528A2C287BBDE91FE70165157D5ACD36708C B4YC4MPH0R
59,003,449 *0646C722E22A7623D523AA4A64762859825F4208 b5s"k
59,003,450 *0647D11E912564F936CB5ABA7681E8AF3B92B5F5 B6-
59,003,451 *0647D5E708A045CADF48446A918C3044E00F6928 bakeion
59,003,452 *0647A932A51264F9A069FE275925CAF810E44E89 BARTONLIQUORI
59,003,453 *0643546620B40D8572D6040093E87E21C23CD7A7 BASILPASTORA
59,003,454 *064068E12B23F94F8ED68DC72CCF5674649DE476 BBRUCHOK
59,003,455 *0640B590D33B461C9265FBF125FEB818B6857596 B-C-
59,003,456 *064E71368392737A73B026D663001655929E7FBB bd ~ ~uu
59,003,457 *064F58D1DA778A65BB14D28680A1C8B8F84C1F8D BD"V0
59,003,458 *064E7D4B510DD9C77B4A5B405DC7DC330CCF3BDC benedicthusni
59,003,459 *0648E6D42BB738344918C39E9500A3FDB28CE4DD berryfreeman
59,003,460 *06412DC1E40EF7A1770143087EC467C81298F840 bertrambunner
59,003,461 *0644624642CA99900211CC2C85EF5409609EEC2D BERYL.YIP
59,003,462 *0642A8D991C13A2EB6DAEE883F7D10448C7C12D7 BETTERMENT
59,003,463 *064620AF6A0215EBCE5C9B7CDFAC9239471D0910 BJSEBAS
59,003,464 *0641BF8FD71DF87C4A68EE02FC2E0FDE8B0D9F77 [email protected]
59,003,465 *064669B6A9320E319F0A9AA239F15441B842B819 bm3wp
59,003,466 *06445D75734F4D7AC00404E576A3AB1977294FDE [email protected]
59,003,467 *0647B3C63209774613B0290D70D6F700D58AA5E2 BNIH1
59,003,468 *064B18D5DFA1530A4C162A63C573213B81F9042E BOBBYPRESSMAN
59,003,469 *06492EB14D59AEFE4269344443C4AC66A34F9AF9 BO&C
59,003,470 *06496C759523504F0F172E73148CBD4543AAAE82 BOLSEARÉIS
59,003,471 *064E50CFBA695E8F1521D68C4C021BE991D39A31 BONS672
59,003,472 *06457777D4F14D849D2A0912821306175EB45875 boonsboro25
59,003,473 *064FA2A7C35D8684DE45A350B82C50FE8C87CCFF Bo%U
59,003,474 *0644FA1551E5BE904B18B122D2EF6C3AABBC1D1C bp~~)8(
59,003,475 *064F8859D53111303BB18E804A846E175D2E40B9 bradnavar
59,003,476 *064C7EBCC8A3AB5FCEEF21ED07F9740695344138 BRECONRADNORSHIRE
59,003,477 *0645BC997E5B9B46824C29C708940C2FA5DDBE65 BRITT.KANSKY
59,003,478 *0645D90D0D66AC4A166CC431CBF294D92D27F76D BRUSTFLOSSENBASIS
59,003,479 *064648FAFDA7DCFFADAC750C56A0686B9251E7E2 b.tf$
59,003,480 *06470626D8732EA4FBFB5DF1C525C43B6DF194F2 buqc
59,003,481 *064ADE14AD4D4E1B01CE55C881D493A70E3F96DE BURT.CARDIEL
59,003,482 *06451E75A4D8F7072BE7ADD590372CD0E7A26CA0 BUSHERSES
59,003,483 *064C784A83B950BDF52B8DFA929CD658B70C39C1 BYSAMFUNNED
59,003,484 *06479BB6E92BEF5DD5672C117070B9E4EBF9F3DE bz=7
59,003,485 *064BF47BE161973A063AB51AEA2CFA154ACDD175 C0ASM
59,003,486 *064D307921E6CEDADC028F0CFE12F9042CB60618 c4t-si1ve
59,003,487 *0649908EC81A4A9E7BD62443261AFCAF59BBDCB4 c?9l2
59,003,488 *064550F9F94F2A6C048DE414EF9311E19D621188 C9OM
59,003,489 *0647DA700FB607F9D7E35F29D4311365DF8CD993 CAPUL9NG
59,003,490 *064F51AAE85A93EF252F245CE32BF6585BB79F18 CARMINEBLAHA
59,003,491 *064178CCF6DDBFFCE25FE7D8F6C98E8C72D39FA1 c"bn
59,003,492 *0649052BCBF7FDF03F86C5605A105CCA9B6931A1 CE7HM
59,003,493 *064A03CA323D1EE4F92DB92747DCBC1C89D11CD6 CESAR.GRAVELINE
59,003,494 *064828AEC5C8D6D704AF396C5CF45F59764D51A2 cfbjo
59,003,495 *064C0CE431BBB06639F49FFF94A5CFE36634258D CGm:
59,003,496 *0649F438A8DB5CE7F718F2B16AD1AB315946548C CHARLESLIPSCHUTZ
59,003,497 *064EC9D305995255F9865D0FE45D6D203F7B6EC9 CHARLES.SCHEU
59,003,498 *064F1561893B35537DE280FD0700909A2C187F90 CHARLEY.GREENWOOD
59,003,499 *064FE76866FF2D8BBED86D204B799289037F0497 [email protected]
59,003,500 *06468F17DE7748663A809A6F3EDF1A4CCBDCA122 [email protected]
59,003,501 *0646B5AB90EEC35D14182E064E88D66C8FC17F5B cherrylime
59,003,502 *064245FC20F96DC3EBEB18CDD602564FD9A1FCA8 CHNAN1
59,003,503 *06421A71FF193538E560A2E6B556BAFB3EEF6FFF ciatico2
59,003,504 *064F982110DF4AFBF21D8B70F4D327B89EE23CAE CITEREFGARBER2000
59,003,505 *064258DFB0A8B7364D3F590EB633AFACA530FF90 civère
59,003,506 *0641CF5E317CDEFE45D5694151F6EA2109C80D9A ck0vj
59,003,507 *064FB722627320143DFC0AFA5BA2906C18145F37 CKPAI
59,003,508 *064152259467A6374E244F19ADF4D474698DD80D cliffordherrera
59,003,509 *0647A0C02001C76B330839D68E6307AB453EC8F7 clydewalkway18
59,003,510 *0649E8D4815A10395C0A0D7FF25BAB79305D3356 cocherais3
59,003,511 *0641403C3510347A2FD2F0F2A97665EDC77E1391 COGERERONT1
59,003,512 *064CE23E5163EB4CDEA0CC6566BDA6F1E77E662C cohonesto9
59,003,513 *06407E2747DE7E3054B8C297D2C8F932B65A183C COKEVILLE
59,003,514 *064238D83230D2DB798B65D7E3F2E2BF47DBD0E7 [email protected]
59,003,515 *064554541FF50414A2001CD0A6391DD7DEE94FB0 CONFESSIONLINUXLAD
59,003,516 *064AFAC211949297E4AFFF69AC354D749A47B9D4 conflict“
59,003,517 *064B490F71773DC33872EBE9339BD6DF706FCCC3 COY.HARNE
59,003,518 *0645E7F54DF04A5AA96BF50A732F8CCDBF9CA956 cpalmerbiz
59,003,519 *064F534A6670B7CDE0EBC71D526A8015340EBBD4 CRAG-C0V3
59,003,520 *0647B6C9B9FDF523C555F56F6AA9DEEA5B25314B CREANTER3
59,003,521 *0643024738720E9B069AFABB04A682B0219CA3A8 credieten6
59,003,522 *064C53E77A02384709573080C04CFAB634A1AC5A cristopherstiffler
59,003,523 *06475354D9394CF3910D66B7A896FCC67B3A0BAC CRPM7
59,003,524 *0643204428434E522492F7DC45307448992DA913 c!s)0
59,003,525 *06443252123149D78BA8F0CBB13CAB0F173A8D06 CU"=$
59,003,526 *0648787FB2376B80B3CFB641D0201DC6038820B7 [email protected]
59,003,527 *06474ABA3B0E8DABD8F27B5AAAC7B78F7BE1FAD1 cvfhh
59,003,528 *064CFF80F7B6F9EC4CC03C8649BEE6AFB116354F cw;+u
59,003,529 *064481807D00BDCB85249620D6F166B5EBEBC4C7 cyrusleif
59,003,530 *06478D49E453583C3D879DCCCC1730C55B15D842 [email protected]
59,003,531 *064699776314381622B4CBE29384151213908351 d2ghi
59,003,532 *06475A1D4569EE5143B203C0C5E267A07D7B5229 D3IE(
59,003,533 *064CEC6ED0A3A48BA7F152689C9F25C0FFA57D09 d9fwb
59,003,534 *0641E2974FE01C0FF43AB3F38BBDD7A046CC5F5A daikato9
59,003,535 *06419A46E43B2CE3FD919613EA35891FFB0BE101 DAMASCADAS
59,003,536 *0644B8BBD62985925281547673A0FC4E7D8DB4C7 DANGOLDENS
59,003,537 *064EA3F4C14C3F3406F7BA1B45038296C84E1162 DANTECAMBRE
59,003,538 *06415FE7401D97401A08652875336AFA18F95827 DARRIN.BALDWIN
59,003,539 *064150417630E7B92006ED878A170912B93D7F0D daryl.broadus
59,003,540 *06415E82876C224506734C1DF1D9FE9F4D3E6F9A DAVIDSTICKLER
59,003,541 *064D15B7F94ACF57EF8E937675C232FB69DC5EE7 [email protected]
59,003,542 *0648DC035DB06F38A98A6F8319A5262CCBAC4B26 DCS
59,003,543 *06434DACFEE2DDC4F881051992A04FB2602ED1B1 DEBRAQUIRK
59,003,544 *064999B933BAD3010529BD99402F8B0E60835D89 decorateur5
59,003,545 *064CCB637D21CAE9376D0188372600B773214707 DEEDFULL5
59,003,546 *06495133519EA1A2F7ECB5A8761E98EEEAC8FD57 DEFENDINGTHEFUNK(A.S.LII)
59,003,547 *0649C8B3946FC10A9FF8889F2A51FDDF00588D47 DEGARRAB4
59,003,548 *06489F984E8F4861D3EB487DE4279FDC28B34C9C DEMARCUSESTERLING
59,003,549 *06499FC28E5C77A7A67BCA22881CD90D563838A1 demeraras8
59,003,550 *06488B3BEE4CD1ABD1DE52F3F03922177A042042 democeb2
59,003,551 *06436A14D09C66DD4127654E0936D64B8748CC13 DENNIS.ROCCO
59,003,552 *064CA17ABEDFA41D0C75F013ED16F1428B5F141D der, welcher wandert diese stra
59,003,553 *06429198BC055080BF76857F0B84E0C64D9FA298 DESLAPIDLA1
59,003,554 *06499577B9F63B75DF6692FAA417CF8BE53CE038 devinabdul
59,003,555 *0640938A9E96F0C0D314EEFB57B937ADF21F281C devisageait
59,003,556 *06454AEA16BB8D9C0C331D411DAA8EB43376AD51 DHANNEMAN
59,003,557 *06402C20209601D669F002C571BD61A6A9AA31CA dhfks
59,003,558 *06417BE82F4323B8B39A91DFF3F0026E431F4A6C DIAMISAED
59,003,559 *06477A687F58F16D5938CA9A9B64E385E4E5CEA1 [email protected]
59,003,560 *064C98112F1035AC3CF15423DD6A637FA770EBFA dipanata9
59,003,561 *06432B74B65DC6F9BCAE36BEE0E18DBD2ACCCF37 dm);
59,003,562 *06411A429B111FBDCD2377FE923B49CA0CAE0602 DOMINGOFALLONE
59,003,563 *06428EFAEFA7A5443CD71A769288A98DC04FD284 donnandreatta
59,003,564 *0644AF4A40B0A3F0C8A173C1B47ECCEF7A22F3C8 DONOVANSIMILIEN
59,003,565 *064E0877FCA629331EAEF8826782A684613756E3 DOOIER3
59,003,566 *064D475F63C29A07A4379BA9FFD1DC047D17468D DOYLECOPELAN
59,003,567 *0646CC4A12AE28C4A594526AF5AC0E241F461F23 dpn;
59,003,568 *06498994886BB4F1C54E89BC0A3C7A87D642ED5C DRMG6
59,003,569 *064B014CABD316D0143CEBA50EFF8171B55CC7C3 druev
59,003,570 *064D4D28BA01E07D07F538F52D354D637992EAE5 [email protected]
59,003,571 *06475BE24BCB589F62CA912C388ED1E11FC35A52 dutchess1988
59,003,572 *064AAC50AF1708DB64D6FAB3C70C76B95BC5F253 DZ-TELETECH
59,003,573 *0645F95C5A56D87FD2C6F328ED19F836772971BB E164892
59,003,574 *064D093AAC6106622F6849BD8EF7DC9EFA439C97 eavongf79
59,003,575 *064C0B19BFC84419C6776FA76F42BDC98813F92A ED:C
59,003,576 *0646F15CEDE97FD931F71139A649438536D9731E EDJ,T
59,003,577 *064783859D05B69AA8EDF2F5185CA33A60B3D677 EDREORET
59,003,578 *064169C8548F801FF0D87AAF3413176E11FDB2EA EDUARDO.PESSOA
59,003,579 *064B75FBEAD97A37F8E83CA44B26FD98FA0FABD4 eg)w&
59,003,580 *064CA3E4C7C789BF973DA6277337972493A43C8C EHCSTUKT8
59,003,581 *064A90F21611B16B7AE56D9B4378DE5E3C521556 EINZELSÄNGERN
59,003,582 *0647AE52569C1ABDDA89EAEF30FA7365C51EB1B3 EKILELOTSED
59,003,583 *064DD8994F9032829375F3C9ACDA8E2EEC5A4901 elkin06
59,003,584 *06492AB247358C77324B3BEF1B80E88FC47FFD94 emerymayes
59,003,585 *064D407D095229616F93AD8242F5A67C418E5B76 EMMITT.ARAGUS
59,003,586 *064EB8ED0116B34C8AF5E60B3549945F713AE00F ENERGINGUMU
59,003,587 *064CC409077061478418FEE6E2AF5FB82DB9CA26 ENPWD
59,003,588 *0646AC365EA3C5C14DF30D2301CECD99386C64C1 env%
59,003,589 *064E8EE08B4AD37DFBC90A150DA778FF2EEFC928 ep.:e
59,003,590 *0642D1AA439FB70458473150BE4721D9BBA5445F eql&p
59,003,591 *06497A638956DA6147C01A5E27054D8B4AD8460C ERICK.MCKENZIE
59,003,592 *064C71774F9C2998F0C00FF3A949944200C1D8C5 ERNULISN
59,003,593 *0646FCB150A5A877B128DC769AB59679BB3BEFEB eupo#
59,003,594 *064EE0417606FB289013F71BCCF2EBC5BF7238A4 EYMARDB
59,003,595 *0643F278F90F0401290FB945BA855750A6990164 F1<H
59,003,596 *064F2881EA2CF4773DCC67638A344DE3F0D9FF81 FBSUNDIAG1234
59,003,597 *0646A693B222B5DC9B0CD091EC352C4EBAD2BA6A fedovoli
59,003,598 *064D5F655D9AD803479FBABFA8068FCBDC6288EF FERMIN.DEADMOND
59,003,599 *064A639005EDEE0D45C3845B8E480E8A2CDD6340 FIGHT-FIERCELY,-HARVARD
59,003,600 *06400384A1AC130F5CA2FA45D6123F7ED9E131FF FLORENCIO.ALBREKHT
59,003,601 *0645B35C92E537D997FB5F88AC72317911258F7D FLOYD.FOERSTER
59,003,602 *0642B514FC8FD0CAAF00F66AFB6C627083907CBA fltchrsing
59,003,603 *064204639AD4351B7AC7920719F61BDB967004FC FRANCISCO.GALLEGOZ
59,003,604 *0644EDB0131DC74364CE833AF1E7BD2EEC2D83B3 FREAKY-MAN
59,003,605 *064F62E3064FA497A0F88874D04EDA5BD07F96AA FREEDOMOFEXPRESSION(DJSCOTTPROJECTMIX)
59,003,606 *0640D6239083B553E0A92FA2B68BD2912526454B FUNERAL MUSIC FOR QUEEN MARY: CANZONA
59,003,607 *064168A5969DBC5CF4D3F4E672BBEC3A9F1C2F08 [email protected]
59,003,608 *0643513DE518823D5212644211063BDC2525161C FUSILEAN
59,003,609 *06439722968AB7125EE49B72142FC8C3C4927F20 futuristicexperiments,volume6
59,003,610 *0644F85AA69F3C5A4E77A4C4E6A49B415FB6F285 [email protected]
59,003,611 *064CCF3849A4665EE718A4B914EE9CAF17C3FE53 garfieldvanhyning
59,003,612 *06408FF5D67983F4378F9064E7E576AA46FC96C6 [email protected]
59,003,613 *0645FA8BA16B4F77F112467A8EA92D578351A960 GEOFFREY.BAYLEY
59,003,614 *064F3F1610EC8D302FD2EDE1AB12347C6848DDED GEORGEHOPPE
59,003,615 *0640B0E6390D91DB38D32A62171ECD5E987513CA GESTEINSCHEMIE
59,003,616 *064311FB2439A37320ECBE91A5038155C1CE7FCF GFDL.SD6AGENT
59,003,617 *0647ACFA3854A1C08918B008AB2D57F1FDAC441D ghu7
59,003,618 *0641463EC95DD290FB2C467FF350786E44CF141C GLADANKA9
59,003,619 *0645D56D969D744AE366580CA9FED7AB07E25EDB glendaleheights
59,003,620 *064A3796F4847151FD2C939969A907446F51F24C [email protected]
59,003,621 *06442F87CC02BEF5257CA5509C1EE5DFFBC759E5 GORDONESTEVE
59,003,622 *064C9065A03FB8C4AFB50E8FC130D90CF80D828D GOSDENCORRELL
59,003,623 *0642F0FAC67FA35FB97D0D034E753C00A21B55F2 GREATLY.THEO
59,003,624 *064CE7D42BFCBBC8B9D050C38FEFD92323803C93 GULEDAAL1
59,003,625 *064105E63BF5CDD5D194FB038284923B3E5C8CF5 [email protected]
59,003,626 *0640DCB41748F7562BD3A8C7537D88A0958B4A38 halduffel
59,003,627 *06437011B085A23D696E8D00625D1B154DCEA1ED halpostley
59,003,628 *06473EA4622FDC188CFC035ADC4D68047BC88290 HAME-TUG
59,003,629 *064735BB92889C0BF86C056284D8D10897D08071 happy12318
59,003,630 *064E0AF324A41F56495F275722385F5A7D9AE50A H_BI
59,003,631 *06416022DE076248D4FAFE799845E8940CE756FF heartattackgrillburgerscheeseburgerschandlerarizona
59,003,632 *06406393F3DFE127A8674412EB9C36873C22B662 HELICOPTER26
59,003,633 *064501616A121482CC4A08296D37503C8B6B4981 hershelhamby
59,003,634 *0644CF6995348DD347B20062AFD0E539BD0A2C7F hertaxat3
59,003,635 *06446F46BE713F3BDDBBAC3AD05E911ED3A7CA9B HILARIOMENDES
59,003,636 *06429136EAD567373FD629108F370A96F5E094D5 historiadeelpilar
59,003,637 *06429AF00066BA8D1EE321BB2218EA7F3A016360 HOPEFUL2
59,003,638 *064854C7737F14C40109C8F8FB1ECDE41E182759 HTTPWWW.DUNMORE.IE
59,003,639 *064E80FA95E6553035EC7331DF411DBCF28A5A78 hueycaulk
59,003,640 *0647C40D1878FF366609E9C9EE84806C77487786 HUNGREDMER
59,003,641 *0648BA6811E27B2B73B16530CAEDC5C22ED90473 HURIAWA9
59,003,642 *0648B651B0B191D55D9F0463BF6758E37092FBF9 HURRICANE(DJ4STRINGSEDIT)
59,003,643 *06405E7ED017C9E84E46B441A43A0C887FF6A863 hyder.ali.amurdeen
59,003,644 *064891694DD5056FDEA2151FC80E4B55E32CA19F i2/
59,003,645 *064A4BC03DC6CADDA7616FD0CB843AC3FC45344D IAMALTIMA25
59,003,646 *064099F42A5826DA45B06DF8287BC136E968B6E9 IAMHAROLD91
59,003,647 *064A476C141B90FFCEDF0484CBFB7EB4C28363C4 ICITILANAS
59,003,648 *064C377D4216C1D3229ACF2FF05654285C17AA0D IDAERTER0
59,003,649 *064B886516534A3087F00E275951E79849CF461B IECW
59,003,650 *064298AEBB126301D56C3411EFAD1C9DCB9E3916 IIULIK
59,003,651 *064DD9109940E4B61BCAD2361A9CEFE3F4C64383 ikingfish5
59,003,652 *0646940361BD8210C06D656BE1F91CC693B25D84 [email protected]
59,003,653 *0645CF86ADA44A41AA6CC447773BFD0D0ADCE67D ilovekidder2008
59,003,654 *064138F479B037AEC092F993927C2444B4D11FBB ILOVESPARROW11
59,003,655 *0646CAEFF361402FA7EB22C74FDB3F3DAD7A8920 independent-spirit
59,003,656 *0644632F2350944FB93ED499C1CB6A4E5F575261 IOGRANDE4
59,003,657 *06412E8021CB8C98C021B4C5A27F8671CD70F044 ionises
59,003,658 *0643AB5CCEEE5433BA980EF6F8B80F07E67C6522 ISAAC.BLANCHETT
59,003,659 *06410C3EC665A3E2D37D03B9EA9003DE52385920 IT'SANINSTURMENT
59,003,660 *0641498716CA99D615C5C0C7D5CF1903DC4A443D J65902
59,003,661 *0640610A739B5E527CB73369AF8009DDFB1FD55A JADAHUTCHINSON
59,003,662 *064FC44D697CB3A37378CA17D302780CC57EC748 JAKDAJ
59,003,663 *0642A9A2C5078DFF7266831B6E470D0A58ACFB22 JAMELSCHWULST
59,003,664 *064AAFF4BE9CE0E9ED8ACA5A132F86E8BEFB987D JAMISON.BUCHINSKI
59,003,665 *0644014BBEF980BBFA5FBA832CDFD22FA4AEB87B JANBRUMM
59,003,666 *064F1815F5558C44738C02ABF8393F21F9F07569 [email protected]
59,003,667 *064EC416A243AF771C92985F95CB7F6E50BB81C6 JEFFEREYCALNAN
59,003,668 *064802206DCEF591EDB16F43E2E1BEA1132FD122 jeffersonfiske
59,003,669 *064B5D6D8FD22964C0712179C00149FCA214B327 jeffreysmeltz
59,003,670 *064B959FCE01ED3797ED4B399BC43E8449089C24 JERRELLKEMMERLING
59,003,671 *0644540F29F9AF7B3078F4D1C8B2226BFCA537B1 JERRELLSTANKOVIC
59,003,672 *06436F1F92BCDF35AE103C75F30CC134858457AA JESSIEEAGAN
59,003,673 *0646101CD3CD0D8861E570A6E0C698F0755F9885 JEUGTEATER
59,003,674 *064D156B0F4AD305F9007A47BDB71567B05A9C89 jewelltyra
59,003,675 *064A3171D80F3E3D99224B6C3D989B69AF513798 [email protected]
59,003,676 *06409E743714D7F1C3B6AE538AC66E2651DAF15C JIAJOHANAU
59,003,677 *064C6B28EA382D7839FAB4F744FF0DBB1F57E815 [email protected]
59,003,678 *0644C8734F5479AF93CDEADB73447321B7470D91 [email protected]
59,003,679 *064050C0463CE05F0DC4EC58617887609FB5F5FD JLP]
59,003,680 *064215BA0B9C6998A58E744B23014A05FF5E76F3 jo?r
59,003,681 *064C3A22D0C1EDD8FDD463FD1E5422C44CC3CC9B jpjw0r8y0ypeud5
59,003,682 *064346EF24FAFE5E03B19834D8EB666E9F47C588 JRRAPER
59,003,683 *064205B8FD651301D2155B6DCEF4EFBFB68E85D6 JSCF
59,003,684 *0642DF9A59A6B5C0C180AEEFC9143C694862AB9E K9.Was.in.Combat.With.the.Alien.MindScreens
59,003,685 *06498913404402FB14D34ECA3E9757AAB8DD2ADB KAARTEEN5
59,003,686 *0646FB353A14F97817479A430461FC8285D71D84 kapitel.06-07:.start.zur.letzten.runde
59,003,687 *064871D5DF8D2500FCBFE7D02358F29CABD589BA karteerde1
59,003,688 *064818C685E15E35AD11EDE97B4CF42853657153 [email protected]
59,003,689 *0644C50E8693D912B0A3CA0DE6E0EF84AAB72FB6 k\c
59,003,690 *06413B4961413393BBE929972BADA6B77D234F9D KELSEY VAN LOON
59,003,691 *0643412DEE2AB7919527B421FFF9AC83A10D4570 kendrickravenscroft
59,003,692 *0649D64B1338DD4BB256C66FC3D429CF4281AE9B kennyhipsher
59,003,693 *064C1F574E2FB5D8A22C1B9718902F25FB02CE6C KENTDREESE
59,003,694 *06470FDCC20B43E90542B0AA49DA58DF233D1585 KEVELHEING
59,003,695 *0640BA33AE3358E0103A1439042F15FEAB234520 [email protected]
59,003,696 *0643F25CE9D3993578C61BB9DA346A9B6B1EFBD5 KEYBOARDSAFFAIR
59,003,697 *0648EB604CB2BA9E31E6576C513F244961DAC5E0 KHURRAM MOHAMMED
59,003,698 *064CFF2A534C869CB72B0AC4790401188E94C25C KIJKDOZEN?
59,003,699 *06429D0242A3B99D5D3276EFBA6A5E764F03C362 KIPIPÁLJON
59,003,700 *0645DE491253AA6C077289F36B507608CEDD148D KKORCHINSKIY
59,003,701 *06452181A760C7AEC5B291484B422606A0B008D9 k?lg
59,003,702 *06488540EBDADBABFE7035192F0E2C72A57ABDB0 KOHI-RANGI
59,003,703 *0648B08CB514ACCE1C508F54B81B3FFD75A57927 [email protected]
59,003,704 *06477E5C96E3D491F2CF5887844DC8277C5ED741 KONTTORIPAIKKAKUNNALLE
59,003,705 *06404D98CED9DCB0B7326BF2E7788C37EA809B66 KUGLÓFRA
59,003,706 *0641F02E28F11A0C2CA2EF7909621548C17F7DBF kuressaarepargila
59,003,707 *064E57151CA7FB74B56AED71DF65782B0A3B4074 L163461
59,003,708 *064BA5A124AD6F52D41BFE6B539B12EE1972A23E landonhaage
59,003,709 *064517479BA9291FF66976E7DDD326DBFA8B1031 LANIMIV
59,003,710 *0648FA4AC59AB3BE0E0BF1A7C959DF1ECD588FC5 LAUNIANDERSON
59,003,711 *064FCD51F80107C2C8F78B3266E3370DCE512A30 LAWERENCEWILGOCKI
59,003,712 *064DDB4798F3B0136B5594BB0C04A3E9436AA319 lazarorushanan
59,003,713 *064D0EA9DEC5B576F72EB8589D433B312C5EB8B8 leer.jet
59,003,714 *0648B2C8C246A2C8922F8C0A33FBF9E1EE44DE91 lehmenkuhler
59,003,715 *064208FF1ED5B5C2B48533AC4EF6CE847A7B67B9 LELAND.LAMBDIN
59,003,716 *0645638267854E295B26C402EFAF4C758CBF4CDD leopards33
59,003,717 *064D25DC1EC19E2AB9DCDDCD4134D25DFAD02542 LET THE CATS RUN
59,003,718 *064C80D2B527F38E89B4021435CE28E2F674ACD1 LEWISCITTADINO
59,003,719 *06428AB9929A5F146476A8D0EBCE649335A8C128 [email protected]
59,003,720 *064E16FCDCB6D1A9FD3008C5A92571EAA79A9EF3 LILIBET11
59,003,721 *064C9498A813954CF2566CA35140965EAEC29C61 local-loop
59,003,722 *0649E6F59F2DBBA385802179180676CDD89BBA3E LORENZO.LANG
59,003,723 *064411A13CCB11A2C3CD6866F274C93D14ED1395 LOUIE.NIHEU
59,003,724 *0640DC1A1DCE48276D7DC7EC5C97B6994BB23D7D LOVEALGUIEN
59,003,725 *064E37AF15E4867BE4CD70FCE16A81FEF7ABC170 LOVETHEKIM123
59,003,726 *064C2A8B8D2CDE46BC0E7C7576459DF92015660C LUPECABEZAS
59,003,727 *064F8CD6015ABA2AA1071424259B5AA97AA426D9 [email protected]
59,003,728 *0640270E2EBA351F8C9929A0A6AB0FB86E49C5C6 machinisttech
59,003,729 *064F6C18660712BE11B54B9B53AA52758A374C95 mackhausauer
59,003,730 *0648FF7F5D1A645B4C5F780E7A1666F648A69EB2 MADELEINEDALE
59,003,731 *06494D56A5915C407AD0A423037AFD48EC2075D8 MAOR.KATZ
59,003,732 *064359E35B220DCDF690F95AABAD18C231A6A3C1 marcia.applegate
59,003,733 *06404142CED950CE05AD91B015B0BF59187441B7 MARLIN.CRITCHFIELD
59,003,734 *064082B730C00B20AEA56141C88EA0072BF1ED0C martials
59,003,735 *06446A3BEAB3AD8A2B41C64FA33731D1C331F8F7 mathewwhelihan
59,003,736 *064CA2E3E20A1A5E1D93EAD93DF52037A5E02ED1 MATT.BURCHESS
59,003,737 *064973E378E7BBDDCA8DEC7BE4CAFDF83B1F29A5 mauriciobuchalter
59,003,738 *064FBA40268284100CF679108C6E183F2AC71D89 maximoreville
59,003,739 *0643B662D02E546308B7BAA46447FF47E8DE4641 MAYNARDOUDEKERK
59,003,740 *064DC5B03A7D83C32F33BFBBBFDEE13FFF5BCB51 [email protected]
59,003,741 *06490FD5C64A2D7157D9511A68C8F238A4A1E408 MBQUEENOFTHEWILIS
59,003,742 *0640E00C262294CBE78C6BBB60F6C18C8A35A503 MEDEOUTEUR
59,003,743 *0643559DAB87678921BDC111559791D549FC00D8 MEGALODACTYLISM!
59,003,744 *06495C04D020BA5B00F57C49084FFEB2232CB1CF melolonthine
59,003,745 *0644FD22FC27DC4827E6500D794C01E473D2B05B mgruppen
59,003,746 *06440DA18543B2050DCD4B3607D885D662263696 michaeljohnburgess
59,003,747 *0643E045AF15B3E9C96D08B5DD93A990D13CC5A9 mimiprincess
59,003,748 *06435C000E0412647E144E81E23822559430FFF8 MOHAMMED.BIDLACK
59,003,749 *064F3528F470C5D2C34AFB9B7D3B9775EC229B89 MOHAMMEDSEVAAETASI
59,003,750 *064D0FC571A102E0B88AF965E668E5230DF0345F MOISESSCOTTS
59,003,751 *064F6982C7D587F66DEEADD1328A50820E36DEF2 MONROE.LAPITAN
59,003,752 *064C4CF235DB6876E0C593157D7BB32C7481D77A MORDWUNSCH
59,003,753 *064C9EF6775E3A106EF73C32E3CA663108AC0D6D mosesberendt
59,003,754 *06422DD510E375DED170F9A9601058ACEEE4C10E MOULIN-ECKART
59,003,755 *0645DDCD7D45386BB1472ECB7AAC1643C6705AA5 myriento2
59,003,756 *064B176A9771363D884C1605D5D587956AD6F61A NADABAHLIS
59,003,757 *064CDF138EB3FE6DF787E6FF6E29EB3CD25C7191 naijl
59,003,758 *0640B301A6B622C7D96DB7ED305BAE2300AC375C NASUTESED
59,003,759 *064834F3F344FC36A1B8A06C27C5E6709C7CB676 NATHANARZADON
59,003,760 *064B6164EDB0616E090B65CFC493D2D54B5947B5 NECROFANTASY SIMPLE ROCK ARRANGE
59,003,761 *064ACD1FD0A2808B785958BE2BA9F2FCF2B50703 NEPASIKEITUS
59,003,762 *06412518B16C67C896F9E66AC0535D1E904371FF NFLHISTORYONE
59,003,763 *064DCCAAD58212B5F5C3525ACC5B76D3F49289F9 NĪCYA
59,003,764 *0642F0A222AF66C8E44E7E748A0703DBCC03F199 [email protected]
59,003,765 *064827B5189D1D45CCBD4A99261E0BAC7FCBA12B [email protected]
59,003,766 *064E38FFE5F4099A66853A20E1D3021B3A4AF266 nnrstrnt3
59,003,767 *064D296BFA33800278C1866171634D119ECD8EAC NONCOMMUNICATIVELY5
59,003,768 *064D46A6503699BFA7056124682E20266304BF64 NORMAND.THORLEY
59,003,769 *06416CD41A657B17639A678A9CA229F2E8DC10EB [email protected]
59,003,770 *064741460DDF8192BA166D3FB22AACD9A88C6CE3 ocr-fm
59,003,771 *06418B1DD391D7F4ACFED91C439B90B50B070193 OLLASSAV8
59,003,772 *064BC33397786976C65A0B7539724115757C037F ONE-STEP-ON
59,003,773 *0642E9B4AD441E97114AB94B930DA93C610ED66B ><[email protected]###B
59,003,774 *0642DC812B56F474F1C94E5A5EB264BC65E20FF0 ><O~O~D##P
59,003,775 *06403F0A69FF26E6107CAFD3E5816BAA11FCC93C [email protected]$
59,003,776 *06458560EA5CAD105170A4EDC9E174DBFFEA48F2 outbu1ld1ng
59,003,777 *0643A0CCB41F93C676F46D5B693D69A2FBF8CF96 OUTYELPEDS
59,003,778 *064E52FB61A3DBBA9C27003B1541DAF9F7CFCD27 [email protected]
59,003,779 *0640C3BF5AA8E9BF0DF96A447431907E7FDCC044 p4rt!41!t!3$
59,003,780 *064B8066F14D50CA966DBF68F94E3528A7B29E09 paragenetically1
59,003,781 *064B1E70E95B605B9A8AF0338479C511F86EEB44 P==B~.~.~SPLAT
59,003,782 *06417ACE2C8BF2E29591AAB0E00832032E4CA1FF PELOSISTUMBLINGOUTOFTHEGATE
59,003,783 *064EF5DC11EE2D09E8ED9A36BB2C23E2359F2C77 perpendicle2
59,003,784 *06468287017BC4F04160527A4E22DADBB76E61A9 PETRIKOVETS
59,003,785 *0641800879F13235E3D3154B6066F9E0B51A302C PIČMANOVI
59,003,786 *0644FCC5E92DFC970C217BE2740538005B9F8D7D [email protected]
59,003,787 *0643E81081A83C12988FADBDE418420F499B9ADC playeverywhereforeveryone(grandrapids,mi21104)(disc2)
59,003,788 *064FB19DE7FFAA48CFEF9AA672591B73C1DE4D2A $plint-c0
59,003,789 *064ED43E6A28D9D7A602CEA99001CFF85CA67732 poldavy6
59,003,790 *0644155D4C1DCF575C4AD0CDDD4D7026DE7B6E49 positing.
59,003,791 *064AE761D1D79FFCCE6BB2EDD3FE314BB12F5EAE PPPTONY3
59,003,792 *06451ADB295CE1249B9D30C338AB7742BD56B916 PR3$YN4P+C411Y
59,003,793 *0641157CCA2A3466C7ECC54D33A17B77BB9E645D PRANCING
59,003,794 *064C2961DBD326342CE6A1A4269B950C3025AAE2 PRELEASED0
59,003,795 *0649C26F8226E308E711C6E8E2540B3630C5D1EA prigdvnud
59,003,796 *0645061FD12A08B3D52515378F54287A34BE7AF3 PRILLTN5
59,003,797 *0643D391DB089B7697EA2E2D020AD427E056737D PUTTEES
59,003,798 *064447B3F8FA5765C41B53F92436D12DB6BC777E qaz10plm
59,003,799 *064DA9C773AD1017330E9981CA67E98B9F3361C0 q----p*-*-*)0(
59,003,800 *064E0471A61F21741500A0C27532936805CB70C7 q====p~o>-b0
59,003,801 *06497B282B808B7E746805EA8AF274654681088D qra%
59,003,802 *064E6E22630CB76E5192B9F514B5EC8FF03C5BAF QUINN.VICENCIO
59,003,803 *06478DDDC8538D357A387278879A39585291B34C (『RBS』、『RB2』、「
59,003,804 *06455D6C0A87B652E325BA69FBFA46289CF60178 [email protected]
59,003,805 *064ACB58004F660FEECC27A45436E271261B2B44 RED-EDWARDS
59,003,806 *064AB6610DF3CB6E3520CDCB9D831B324D84518D REDFLAGSFACTACT
59,003,807 *0643164404A1F3B8F00807616F1CF16B8E40E7B0 reinoculation$
59,003,808 *064067740EA09AAD8B27B9731838EFCA331C5605 RETAWEERFWSB
59,003,809 *06449F79C8E3CFC9F9AACB6CEB980D16E77A83E7 RFSMB0WHL
59,003,810 *0649651B0C05514D2F3F7F10548EC8E4EE3D3EA4 RHONDAALPHA4
59,003,811 *064EBE453CC58771FF187C167530E392DC49C8E4 RICKIE.SONKIN
59,003,812 *0644844EB5271D835B1D12A02B418EE604944EA1 RICOULET7
59,003,813 *064550122602A9853D1BB81CC3D2A5DE71F9C15B RIDISEEN9
59,003,814 *06417FDC1E629CE3D4F8E29C95D413EC3A592889 RINCEONOJ
59,003,815 *06427953A459EFD41F02A62E6CAA18318CF5EEA8 RINGILLING
59,003,816 *06498B3410CFD23AEB101E2522DFE4DFB82756E1 RINGSTYLE
59,003,817 *064DFD4572BED493FD934E1C8AAA01667A1E7BF9 [email protected]
59,003,818 *06479E755C47AF6B8572622A61313E50C1778EF2 RMILLERTX
59,003,819 *0644C01F66C193C3F38B472DE545D9C0228E364B RON.BERTHIAUME
59,003,820 *06483028EAC2C21473D9D72D95DEF5B713C24307 rooseveltstotsky
59,003,821 *06436F42792B568C5985AC03D616D689AFDA6281 ROSENDOKRASS
59,003,822 *064E8A9836C66BF27A57846B76039C1FF10B4835 rosiefarmer
59,003,823 *064C71D60CE2FF0609B1DE293F5F0CE1DAAF1706 rozbija3
59,003,824 *0643596E0BB2817CB9D5657F00D1CB79FD96C122 RUDY.FERMO
59,003,825 *0643AADF57451F6F2F9CF4FB138D5D101D357885 RUEBEN.VATES
59,003,826 *0645684B0F8BDAB9362DA7024B56A77DDABCFBA2 RUETAPRUSU4
59,003,827 *0641DB4D91FE7069589EB7662831AAD804B7CE46 SAAMGESLUITING
59,003,828 *064C4DB376F2FAA5C7FDB897FCAB846B130B7047 sacred-(dub)
59,003,829 *064C9BAA38CE8450F9D7CB7A89A40FF9537F366E sag'sdurchdieblume
59,003,830 *064324DFA5D9749F7E801EF2238A96130FB2F659 saint-agnan-le-malherbe
59,003,831 *064AA00E18270456129A786593F62B72ACCEEB13 salvning1
59,003,832 *064ED808FEBA6C522B592B0CCBA03B460B5B0DB0 SAMEH-ABDEL-HAMEED
59,003,833 *064A6037F10166203C60D4E3D19CFEF1239AC12E SAM.MCCORVEY
59,003,834 *064C2C7FE13DEE4040AE7031D4E462745FF8019D SAMMYRIEDMAYER
59,003,835 *064FC52AA6F42A67F70E1F75DF44B7EDFB6C3CD2 samschinnell
59,003,836 *06484942A5AC615B41952D14B66BD3AC2249A866 sanaa376
59,003,837 *06420119D78C4157136DF1F8C398A0747A09966D SAPPHIREKENNETHS
59,003,838 *064FD12DA2AD6EB26141DEE01D54AA822A3A0D74 SASHIMO
59,003,839 *06430A7BF5430CB0C9F211870D87ABD1DDC7EAAC scotkincer
59,003,840 *064D8875813856AFF8B6ADAFDA7CFBBB391C8882 SCOTMACHOL
59,003,841 *064972C47CE6774845CF30CA111E424A6D7CE4FD SCRUFFYHOOTIING
59,003,842 *064FF546396E9489DDC1F03CE13AF3B459A53109 [email protected]
59,003,843 *064F5C499D1157002D98C6AA496326528C3E18CC SD-AA
59,003,844 *064AE84811DB2742D8DA48A37818168B14D2D50F sebastianhamling
59,003,845 *0642FFCFCF59CDDBC708AE06EC9AAD17EA27DF83 SEHAMSALMAN
59,003,846 *0644E94E1613AB373CAD16476ACCC511AFF34F85 SESIAREMUTUOCCAS
59,003,847 *0640902921B257C84B475B7E5D188560BF46BDAF setsugo
59,003,848 *06446198BA8F1C6DB5CF2F4019527E9813F41EFA sherry flip
59,003,849 *0643DA7B91007889B395DA2F0725594EDA9B6CF1 similarjones
59,003,850 *0642E20597A36FAD2ADA4F2B1F0B6E570A99B760 slatyngging
59,003,851 *0642B119C59C162F7BA70912BEAC92EE5ECF0D9F [email protected]
59,003,852 *0645017ED3AFCD708F1A17892368C455648DA48E SOUGYCOISES
59,003,853 *064EF475D8FE2291896FB67ACA9258AA67067063 SPAMVERTY
59,003,854 *06432C4875DB1675946A5F19697E4A1EF5A699F5 sponsusing
59,003,855 *064209BB33F14DDBBC1EDA2C340EA8CDE0794E84 SPRREILDENS5
59,003,856 *0648564E583FDBBBE8E77549ED7717D46FCF8735 SPURVALERIAN5
59,003,857 *064B1DCE128B6493BDEBB9F0C15BAE99F2FB2736 SSENDRAWROFTHGIARTS
59,003,858 *0645A135238CFE4DE7964E880F51144BAC452849 [email protected]
59,003,859 *06441165FE21C3724EE2FEDAA1634E9944A7BA3A STANDORNBUSCH
59,003,860 *0647C1F1DBFA535A2C4E2F40E21E753E480C9548 STEALTHSUZANNE6
59,003,861 *0642FCD3E81E55EE2567EFFF9846721F3209540F STEFANCHOUGH
59,003,862 *064CE3CCEE22D038BE28BEC82D75C0952B239469 STERLING.ETIENNE
59,003,863 *064722D93835B7A6DC4083F371D59627AD80B30F STR69JNNY1
59,003,864 *0644376967191DC691D9D126B702303DEFAAE8AF STRIJDMIDDELSING
59,003,865 *0640FF702CC40E38960EFD4049CBC8856554FDED stringquartetno.1
59,003,866 *0646C1969FB6A207ED2B46CDB2D9D89CE11023FB SUMMERSASKIA4
59,003,867 *064D3AA5DB457DF14330DB171E915EFB72D70C42 SUOREDNOPNONS
59,003,868 *06442536DE78A0AE0D5A242DC4458C456FAFE331 SUPPLETIVELY0
59,003,869 *06480D67542472C2841686BE698C652097C243D0 suurjärvega
59,003,870 *064936C30CA767315DE4E7E1CD8209528868F657 SYMPTOM.C
59,003,871 *064B61BE160140C683408FDEF809FF295492A20F [email protected]
59,003,872 *06430F2C3B7F5FD5C5C70685B9A10369E3094890 TAKE MY MUSIC BACK TO THE CHURCH
59,003,873 *064A9CD2C4A34DE30B9F593EAFE3C1BE1918BA13 TAMRIKO7
59,003,874 *0645CC84C6CD58433922870A8F14ADA805170576 TANAGNERS
59,003,875 *0641D06F3F018317F32BA22A0EFF8FA875A8CB4A tannerkaai
59,003,876 *064E16A55920EA232DA2CD8C6EFA09F9A7E02AFA TARTAREM
59,003,877 *06414BC8A240FFAC8A93866C5B99B1E9AA039EDA TATOUAGE ORIENTAL
59,003,878 *064088A0D32D783A382AC0DADC3BBFFF1C55A913 TAUTOL
59,003,879 *064043E51B14AB3E36569AB819420B2E72BBE658 TECHRIPPER4
59,003,880 *064D6BCD69FA13B5AB1179D66BBBB2E3E0E44512 TERRANCEKAAUAMO
59,003,881 *06425595F065E83E12CFDB6E3358023A00E189D2 terrazzos4
59,003,882 *064538AF2BA4D0A4A0A67BC9F3930CAB66E0607B TETRAHEDRALLYCOORDINATED
59,003,883 *064ECEDA38CE3C28FAB912CC917B2C62B6008D15 than-n
59,003,884 *06466565E43A5FE8B518EA9FC7513FA70850C117 thatdiamond75
59,003,885 *0641942B3450758AD7554B4BF3EC307711278A6C THEDEADLINE(REMIX)
59,003,886 *06449BFB2E32D5698D23D65517D263239AE5AF20 thomasbehmlander
59,003,887 *064A68738A501304CF429AD4BA185203DD966771 TINAPORTLAND9
59,003,888 *064CD6C00365D9E9649B7EBFB33C020B8A0D5F34 TINGALL7
59,003,889 *0648379020C70484B20393BAC94672CA3FB5C8BF tjadern3
59,003,890 *064EA6031427C679DF7AB6DEF89DC9E8977F0945 tnaledoming
59,003,891 *064E617D99FF4B1F3CD404FC2812AC4124AE2B2F TNOREVITCA7
59,003,892 *064E1F3E64E30EF7C84B72F582D755CFF6778CEA (tokaiwalker)(2006年5月)
59,003,893 *064AE22A7E76A61B7E50CA501888117456135EDC TOMOE!
59,003,894 *06427C1FC3A417389BF57D1B54FBF6736A8D54A6 TOMOGIRE7
59,003,895 *0642D8AA37C8DBFEC3C16407579B308C6EC0D09D tom.pargeter
59,003,896 *0641C54DC9E91C7A14706D3B5C1EBD4CF1AFE9FC TONYZEPPELIN5
59,003,897 *064DFC16B7D9FE53BA38C56A976E9DDE1329175A translatortr/&/ns'l/ei/t/@/r
59,003,898 *064A2B082EF99E77DD86B007DFC8596EB0FC2114 TREADMILLWORLD
59,003,899 *064E39ECE75AE15A547C97E7C02E05E651A02F36 TREEDISERP7
59,003,900 *0649BD99CF9FD4054BEB68436022E2EFE03400D2 TRESONABILL
59,003,901 *0648D6C45D7B0417CEA6AA753CAFEBD9C9AD9892 TREVIMODELLEN
59,003,902 *064B4AD8B4E6E47E287B57BB4ED680C3B4B9A4F7 TRI-COUNCIL
59,003,903 *0646C09554B455409366FCB1C4092C67388D2638 TRIXIEDELUNA
59,003,904 *064DFB86FE185A7EA50977A4B13B182B6024C54E TSETHEUL6
59,003,905 *064E56A47C7B9D8026C246C9CAA27E124977177D TUANBRACKELSBERG
59,003,906 *064E7C2FFCE720F4C6E12B7E256DECCD24A45375 TULA MINAJ
59,003,907 *06492E93E65D22C5427544C57A34EFBD00EE59D0 TWHOTIT
59,003,908 *064B95651234A3A3035244D9D688A74505E509C4 TYCH.LAT.NIE.ODDA.NIKT.(FEAT..MAGDA.UMER)
59,003,909 *06423B4740DD88A6D3D0C37A7175C8CE71D68A0A tyroneluczki
59,003,910 *064551E15B5533FCCA0AB616A0688A69568168CD UCCPZ
59,003,911 *064FC1EB0169B8006F1C9FE34E7B511D0C1C4282 udrea-luminita
59,003,912 *0644E1BAD617DEEDEC2E68C9968D607BB9F10C95 UMA SRINIVASARAO
59,003,913 *064DC09A15F554076841F975071BD15C262D41C6 UNDERSCRUB7
59,003,914 *064A38FE8D71AB120D21B3065CCAE5E5E4F9838A UPRAISAL
59,003,915 *064ABD0BF96661746DFF2E7FA0C2C6B87F7E463B userjamessachs
59,003,916 *0640B064E39E16BEC7019AB9F45CC3B46D42EC02 UZ;/
59,003,917 *0641F88E05D01A6D4AB82484B6ADD4A4F8858D81 VANESSAANGGOT
59,003,918 *064E126A8EB2A11770C6BCB2067FBE74811863F2 vardina-jiang
59,003,919 *0648AFC1DF3BD003FEC065101E2FC9DBF133B118 varshakedia
59,003,920 *064DDD054442DD090907E4A17242D6938AD3AD9F vernonmatonak
59,003,921 *064CF8A93B8E131894486DC8EB075536C22E1402 VERONIKA.HODALY
59,003,922 *064978F3F411DE2428EEC79B6E4887384E3AC8A4 verontwa5
59,003,923 *0643155CFEFF9757842490F08F77F672137A4FF9 VICTOR.MVOO
59,003,924 *0648F9FF8428B68DB96B27C66817D277A4AFDEED VICTOR.TOSTE
59,003,925 *064EAC4D6C1A9A29CD7CCCF65C336A5C13F97149 VIDAAZIZI
59,003,926 *0647A1B199518F5498080253F8619B92A901479B VIDUELER0
59,003,927 *064951E0A677B0E569E3D8043A9A8D22C71DD9B5 VINNY.E.PHINX.INDRIYANI
59,003,928 *0643EE0CC0393F03DFACBB5C964770989F29C3A1 VIRTUOSOARIAS
59,003,929 *064C7AB0E1771FA9462B4C0EEC1DA0C1F5B9724E vodafonepanafon
59,003,930 *0648217CBA05230AA2B89837FA1BC64D5D969C59 VON.TENNSTAEDT
59,003,931 *06402B6BBEC49D441BD01D4123BE8DB879F15393 VQCXFZSXWEFUO0
59,003,932 *064758A502833A98F9F882668C48442CF6E49250 W35795
59,003,933 *0646213C9E5A36DFD9DA1D914603DB3658B9AA8B WA.DE.PERALTA.FLORES
59,003,934 *064E89000F273E52D57C303525B66B4E5781F9DC WAIT4U21
59,003,935 *064783B0176A7756091916F55DBA2CB903C52979 WALEY
59,003,936 *0641F78BF4F955FEA14CBFE38BBDE1E8E9918836 WALKERSCHWOERER
59,003,937 *064C46F5727FE050B09EB7E84D4AE0B3646F92D7 walter.rephlektion.williams
59,003,938 *06447B8980C8B437C25DA4FD662538B8579DAEC0 waltonsingeltary
59,003,939 *0645504B9B37432B1EA706B0EE1892053F733C8C WANG XINHE
59,003,940 *064B62E149D766FE8BBAAB6036E467AEE5E04CF5 WARD.KEEVER
59,003,941 *06475C0748B7176CF026C9D71D6CE3D712E536D1 [email protected]
59,003,942 *064A1B93539466DF7B81391461097F88AEECD82E weldondemoya
59,003,943 *064987D649AD91752A9106EE377E8C963D1E92E3 wendy-welbourn
59,003,944 *064D2AF0803981E4ABAB617D0136763511E3D2CB [email protected]
59,003,945 *064FEBCD5D7A41A7BB512E363A0FA3A97D0589D9 WE.WANT.THEMBILE.(FEAT..MANDLA.XHOSA)
59,003,946 *0642A9FFFCAAB19C0669BA349B108C8174538876 [email protected]
59,003,947 *064DC826B5AF57B9FBA2480EA74FF537D1B10E59 WILD-FLYING
59,003,948 *0643651BDB3B0D71D89CF139E940F896EC3D7295 WMSINTERNALADMINNETSOURCEIDL
59,003,949 *064EECB4ACE2CF4843F46F463AF00AD3B2227A82 wwwacepcapeca
59,003,950 *0646C613F1E9D5B8C4B73F7678CB118081BEAA36 WWW.ALHAMBRA-PATRONA
59,003,951 *0642B75EEE585C6207EC134C0C83F006D1925FEF wwwlifenitienet
59,003,952 *06444C3DFCCFC19DA264FE0D6303F6F2D0840D01 WWW.MAYHEMRFC.COM
59,003,953 *064ADE64AFE9369BA00E6F8E300D20DA7B325044 wwwtailwindtouringcom
59,003,954 *064FE1AE6FE2BB7AD6F9B89865EBC0F3CC72A84F XARALAMPOIS
59,003,955 *06407AA42C97C445F902F69B4F5A798CE893EE9E XEXDIG2W
59,003,956 *0643941F31D95A46BE0E1D5C85AB7157E3BB033C xlsbopy
59,003,957 *064D51CB262F644BB785FB3EA0ACDE7CA4D852F5 )x(-o~0~q------8
59,003,958 *0645005AA326F338416F3BFF2058A8ED26781B7E [email protected]
59,003,959 *0643638BDF100128BCF211527A61B744BE252C5B [email protected]
59,003,960 *064B8F0D13D82E19EBB905192259CB7D78A1EB78 YASMINETERRANOVA
59,003,961 *064E6AC422405984A37FBAF87B1255F0649ABE27 YASMINSULTAN
59,003,962 *0647B3066C7A94380A25F20B307752E85D62196A YA!Y
59,003,963 *064E5EA52BCFFDEF7BDDDEE2AC5101CE48A7FBC8 YEGUDA
59,003,964 *06429EB1CB921EEDAD0264F459D45207DC604A89 YELLOW1928
59,003,965 *06416C5240E9F46F6FA2943746F63DCE7264A133 yllpito6
59,003,966 *0641A12A9FB12004565F1EA9D4628C6D00932950 yrbo
59,003,967 *064094A0E015A94F98911A8880CBD553C91973D7 [email protected]
59,003,968 *064E9C675622727784749BF26FF7C68960197449 ZAFER SALEM
59,003,969 *064C0AB96BDF8116740F20A7D2E02D6688BA63EB ZAK.GRIV
59,003,970 *0643DAD654E8F54511262D7E4B80229CBBA75D3D zeshan.razaq
59,003,971 *06406585BEAE8F1EDDD16442D0641C9B1C8BE644 [email protected]
59,003,972 *0644A3BAF3BA87F108418639A13CA03B328CD270 [email protected]
59,003,973 *0649FA23672FB7CEC944F5C380E9BA89F0DD5459 [email protected]
59,003,974 *0646C7B40D6D9D87C11BD3BCC766ADE27CD293F3 [email protected]
59,003,975 *064689FA0809ECA2B8A3D159123167B589096B9D zhmud8
59,003,976 *064B89E9A394D62CB4BA1F1B6148B4289D4C93D9 ZJ8
59,003,977 *064C8FB57B390A30E49F3692E389434C28C845D3 zumeles5
59,003,978 *064A1E9E50D61AA6AD24E2302DA22EDBCA483238 алејн
59,003,979 *0648A7D67C2B11CA89176DB0A087695F010F5338 РАЗДЕЛЯНИТЕ
59,003,980 *064C0A30E3980D7902515078430CCB67B3823A18 РОКЕРИ
59,003,981 *064917D3F5DC5E85C6404B83F893C90703F5498B 莫佩嫺(ROSA)
59,003,982 *064F878B4C48715F6C16F5CCDD1401E5878D51FA 03201523
59,003,983 *064D670285314A7CE85DF71C76A8F6A4CF59DD42 0thetrout6
59,003,984 *06495915B76013CA106A55F4A818EA39213233B5 11:-11---#---&---clairvoyance
59,003,985 *064A1293E1BDE66628FADC153126E9442A02EEA9 1217026 SEN-J
59,003,986 *064ED707676931AFDCDA04ABD567915258147EF7 13.AVARAMPI
59,003,987 *0644DE974181647F984D4248A18FC9A543AC7572 1596087 erludmerkelzueinemantrittsbesuchnachmoskauein.
59,003,988 *064CB67C6535B19006AE497984DC4392FCA3E0B3 1602402 karkulaisten.-.niin.tarhaajan.kuin.el
59,003,989 *0648CCA1606DC2149C0FE9F7EA4231A5A07345AE 1661582 tieliikelaitoksenhintaansis
59,003,990 *06426B25F7C951DB10C0333FF2E52400C40BC287 1714366 HARPER & ROW DECLINED TO COMMENT .
59,003,991 *0645A7928CE7C38F15D38607AEF3C54B3949ACC5 1872849 IN GANZ AUSTRALIEN WEHTEN DIE FLAGGEN AUF HALBMAST
59,003,992 *0649ADC9C64A1FAC45897535468C49EA57C31EEA 18.abtropfen
59,003,993 *06410241CCC87DCD2E831B3D3634A4B206E79146 [email protected]
59,003,994 *064EC9AE3EA6B450892D85E9F8811C1D35C862AF 1ANIVUKIV
59,003,995 *06465E92B8BAE9118A2787E70EDFB78884EAAD20 1AREN'TINAUGHTY
59,003,996 *064A627F0C9E822E44154563AE701F16CCC759CD 1BRONZERELIEFS
59,003,997 *06490615560284B12D5A0E19AE1DFCDE1FC36A2E 1 BRUNNER'IN
59,003,998 *064F7A2D7044580753FFA417DE8FD9BBB693AE50 1CENAREN
59,003,999 *06443D4285FBDA12FF3005531C0C04CC165DEC5F 1EZNARONIM
59,004,000 *064F767AB9BF6CF893EDE91502C391A744755891 1 FACIAL-FUZZ
59,004,001 *064B9412787947990B6FBCA40D503EAE39E3BD13 1I+ER4+IM
59,004,002 *0641BD971616C2D7A02AAC46F7F4E09D52BCFEB6 1-jorgensen-john
59,004,003 *0649A433C2782C08610D5619406FC0B081BC5C4D 1.kodinhoitajamerkin
59,004,004 *064A8AABA76C4706BAF6CEC1F2974F73B9F6C630 1LABIRINTO
59,004,005 *06435F759BFA9DC42F169DED9FCE83BC3A7E0FA8 1LiNACRE
59,004,006 *064E63FB47B6B5FA9E0023F9990F52A3E4114F92 1.NICHTGENANNTE
59,004,007 *06491D4B5E2B52145F553D16D2F278591BDD129D 1RANKIGA
59,004,008 *064CE281A5F4B65B462F06C50E266ECCAABCED8B 1-RUOKAILIVAT
59,004,009 *064080FB686D466D5F6EDD61F7FDDEC7DCD98E7A 1SUBTENANCIES
59,004,010 *0640355369824C2CC48F4BCB1BB049E86740A1CA 1-tiefenroentgentherapie
59,004,011 *0643F8EC55CB81FC7A7E20A7BCA58DE9E3438822 1 UNRUHEPOTENZIAL
59,004,012 *0649CA768D0E998FF1B08FA90AE7AD6C733F93DE 1VANKEUSAJASTAAN
59,004,013 *0642AF5ECF061AFE0E748221459348EB3DCC76BD 1VORSPIELRITUAL
59,004,014 *064B00CCCDD1CB7C33B9E495D967E4FCCF1696A8 1weltkunstmuseum
59,004,015 *064CCC328E5EA91ECAA671AD195AF654EB5924CB 1zalimkaran
59,004,016 *064FB61B229620C7D17DD491E937DADE3EFB7CCD 2003NJNETS
59,004,017 *064AC2392EBE22CD589CCC6E8D34AD001C94F4E2 2061444 THE SAME MARKETS HAD REACTED COOLLY TO APRIL'S EASING
59,004,018 *06461A43452F5D31A2DE7BA86A686EECF1033629 22SLANIA
59,004,019 *064CD2B36ADD2BD37B034F9A99FC6E48D8C575AC 2561667 SOITTELEKLO9001600V
59,004,020 *0649914A80A76E6C79609E2811EB485EA39FFC0A 2563961 dietaxi-innunghatrund1.500mitglieder.
59,004,021 *064300A7566FE8F86A53D9CF42163959E6F074ED [email protected]
59,004,022 *0647BC096FED448B646FF8D53B2C1157F801B431 2668908 SCHWERWIEGENDE.VERLETZUNGEN.BLIEBEN.ANSONSTEN.AUS..
59,004,023 *06413B7232CBDC3459109BDF83D4599B74547FA2 2855141 ilkka-yhtym
59,004,024 *0647AFD45AE90B2C8CFC76A9FC4D544B391B0401 2CALSAIS
59,004,025 *064522E8BF8D3D9E6740501140EEFCA9F1C8E4B8 2EHWYREIF
59,004,026 *064DEF40998FD37761CF6863C09F8C0A4E64A230 2FLTTNSS
59,004,027 *0645E30AB6F9E51913CFEC01C173E9CF659C9BFB 2gauvorstand
59,004,028 *06402AA9D0E3CF76583C290DAF9CB169B3E9F3E9 2korkeuskiintopisteit
59,004,029 *064F96E84DA45D4DBBC8B6DE7BED6BB05D15E429 2 piercearrow
59,004,030 *0649404A4810D99310FD386D61952686DA0B082E 2.SLUMMEJA
59,004,031 *06407E7CDE42F8D0F120717C794BDB8D4313BB5E 2UDBRING
59,004,032 *0647AD1640A2741288EFBDDBE5BBD809C59C6515 2wangdat
59,004,033 *0645D80913DF23A557CDF76A21D7FFE0BAEF0731 3HXARADRIO
59,004,034 *06450DEAF51F040E10E048ACB9A9C541C9961474 3JASTICON
59,004,035 *0649562ADAB4745F8329EDC48FD69C935F531A35 3textiele
59,004,036 *064D7C2852CFB03A7B3F542C99F50E8F2BBD0B07 3######>`.(x)
59,004,037 *0646AC5B579A384A01E69BFCDC138999026F800C 3XCO917473$
59,004,038 *064919E578792D4478E72B4F77F1D793C002D7DD 3XP14N+IN9
59,004,039 *0642E720DE2D2051A39B9AA7BA6CFB4B963DE380 3YANERIT
59,004,040 *064FD0E527B1F1961EF4B4E882989FBE1B5CC59B 405IZABELLA
59,004,041 *0642B2B95F6163CEDCB3BEE77B9A4DA4C2176EC6 41-EINTOENIGKEIT
59,004,042 *0646DCCECE0AF70CB4D1C42EDF96D067A3F9E983 428182 ISTE SINAV BURADA YAPILIYORDU .
59,004,043 *0641955FE291ACA547FD656A9D92F2FE483CB92F 44 duos for two violins, sz 98 - 19 a fairy tale
59,004,044 *0649CA7D9B294651EFADA9EC00984F4C5EA962B6 480M1N4T10NS
59,004,045 *06480B06ADBECCB0851CFBBAC85F4F59C79B2D14 486016 IT-WAS-CONFIRMED-BY-AIDES-TO-HATFIELD-.
59,004,046 *0645394469ED0B6D21FE101C27C6BC987D6918EF 498210 HALMICH:WIRHABENWIRKLICHALLESVERSUCHT.
59,004,047 *064CEE1F36D2577C40186E654E4F80A0A2AC9047 4C3R3PORT3R
59,004,048 *0648631E7B111E91BA84334CCC02D0CAB798BF50 4e1dcef995ac3098a5a65daaf9a61e6b
59,004,049 *06435C1F3C02F44EC8E71837C857EE209354DCF7 4EKSINAGRO
59,004,050 *0644B7967D5D5B0D49C4AE2E0E91651CFD8F6DD3 4HELIOTHERAPYS
59,004,051 *064953D55A0F67227150BFF0313F22F9267036C1 4MYNTENYN
59,004,052 *064D7868012460CCA953CA0F5F163A16FF15FE53 4REGENTABA
59,004,053 *064A4D7789A365AE66CAFEB4A312E75C76B470BC 4SPAINCGJ
59,004,054 *0642717456D7AE94E3399F2370AFF6248A0FC663 4YMYKSISS
59,004,055 *0642879398009E83F591AD270BBE3BA2A6B1FBD7 5AMELIEDOOKIE
59,004,056 *064A791DD56CACA939CBB0004208BCD3E27DBBED 5ANDYWHITE
59,004,057 *06417DBA3621056022E0A7C181C1ACC7535E30E4 5BSWHASELMANBSW
59,004,058 *0640DF98CB51486FD27BB81687440BB5C84F65D7 5COMBATTEREBBERO
59,004,059 *0648E23516EE5665FF849192056C23A020A32426 5DEOGSERPXE
59,004,060 *0642C9F6FDBDD410073337C110BBD854E72C3CE8 5EMAGAINE
59,004,061 *0643FC5DF2E037994229C1A6580811D97CF90719 5.en.la.majeur,.KV.219:.I..Allegro.aperto
59,004,062 *0645E2CEC1098E152033C17752248B611C91E556 5MYLAMBDA6
59,004,063 *0644E8642F8552BF5C4CB727D5D7E254B085848E 5serbo-croat
59,004,064 *06413EA73F4E4A74EF47293409C4600D442224E7 5SNNLLINEN
59,004,065 *064AB2D60D3592AD85AFA24B79A310E417044A4F 5SPEECHWHISKY
59,004,066 *06474AE6E195EE2294551D112A53C38A7C7F6A54 5U83D!T0R
59,004,067 *064CC254FB8F5951060B8C872292C1ACD999194F 5WINKJIG
59,004,068 *064013D385629C73EB4BE1B69F435D7546E8546D 650MASON
59,004,069 *064338742CBD80256E10B3DF0C01D36B2885CC7A 6ALPHACOOL
59,004,070 *0648B839EAF4B04FA8E2ACF4A93D34E906F83448 6APACENTAMIENTOS
59,004,071 *0642F29BAE1831C0CE60A86B472AD7B308C6FE98 6BSWROCKSPRINGSBS
59,004,072 *064445BF7211CF410680859D19E538EAAE8F39DF 6CHARLESGANDALF
59,004,073 *0648031100FD436DECA51F351CB28A235197C3A7 6illustratable
59,004,074 *0640D14199002ECB772F8A81EC872131F009C6CF 6MURPHYADRIAN
59,004,075 *064F3D3240C5559A05867670A3B38F6217DF0C61 6ROSEBUDBLACKIE
59,004,076 *0643866D75606959B46824CEA17FAE5061BB52B9 6STUDLYTREK
59,004,077 *06496BEAAA65A69ADE4F429888F9D50F168D5CAF 6THEROCKD
59,004,078 *064653B391A2C1B10478BD7278A422A89CD3B1D2 6VETANAM
59,004,079 *0649981F88C65BC4CCF019F2CB92CA75A1774127 711PETER
59,004,080 *06415DC6C0B14B6140F4F5354B5F3AAD0DE61AFA 731JAYDA
59,004,081 *06402FA2E7E2E437BEE6B23BB05BD1693F0F9E8E 7CUNIGANS
59,004,082 *06495CAC2840711939924A3B9DF77156061C38F2 7EZAPARTS
59,004,083 *064D87F44EDD8401D61095873E1877C2FFAED127 7iamtricky2
59,004,084 *064FB2F1B205560900B49BE18687F8A4735A3DA4 7JANUARYCAMPBELL
59,004,085 *06463DEDAE158B905A4097DAB2A203066D7D53FE 7mybartman8
59,004,086 *064DB1B470EF749DA52D01188235A1C4A739AE68 7SWEETSCHESTER
59,004,087 *0643E0B00AC7742CE84DB70E87F81DA4A5EC451A 7underjanitor
59,004,088 *06451F4D0237321E7413A77067151EB1CD87D020 87b7f2cc0c403a89b4794b7d2d855aec
59,004,089 *064B88CDF6A57D8F2380C8F027184CDE833D0E87 8.LASISEIN
59,004,090 *06429CC07A2DCD6A776CD584270C3B6CA11DF84E 8MAWPDONN
59,004,091 *0648B39822FA8959FA812079D5ADCE919A40E080 [email protected]`~.}O{
59,004,092 *064CD836138C8E536877A10575CB78B2EB830A57 [email protected]*-*-*splat
59,004,093 *0647B5CFF49B4A27F78CBEC9C40D5F82D64F341E 8SYNAPSIDAS
59,004,094 *064D7F3B961121E3990E9334B7B7C38A85EA65A0 8TENNISQUEBEC
59,004,095 *0640E15DFE9DC622110F2E6BACAAF8622DA132D7 8thatdestiny9
59,004,096 *064F1FA1A396F035EC4C1E1542516787823D6676 930768a27179f1326bdd0bd494143515-ifiamgone
59,004,097 *0649AB690280AC26692B7D06C1FE097E3B9ABEDA 950reilly
59,004,098 *064FB81979A6DC6230049CBCC2B6522C10832FAF 9BLONDIETREVOR
59,004,099 *06469D226FE178190B37009C1EF2E5DAC9BBEB56 9eveillions
59,004,100 *0647E9C24FB90A73A2EEF89DFF74BD2C67D95E11 9HTSPNDRS
59,004,101 *0646130B3A7961203B0EFA1A67827FFDB3A1D842 9ILUVMOJO4
59,004,102 *064A06AF30F69E0A475BB81FB7D79F33E4BEF0BD 9IRTISANOMISAJ
59,004,103 *0643A40EB1239DA22FBCC325B734A9526D0F0812 9 LUOMUTUOTE
59,004,104 *0646968BBC4A387AFB9E09A1F7A909FBF042D3D6 9MACYANN
59,004,105 *0646158EFD01D73FB0E5747AB8034842BD6AF992 9MINDSTEGRNSER
59,004,106 *064559CBFCEC7192B5ECEDDBEE36A3A291A76AC8 9PACIFICKENNETH
59,004,107 *064C345F60D0D9E8EB0297BE60BFE5C3390990D1 9 PARTYHEARTY
59,004,108 *06455096BE7B00CA8E3211D4A13EC5191588499F 9PUURVAAMH
59,004,109 *064887B28CD550EA340EAE24B1D15287DD9311ED 9RICKETTSIAS
59,004,110 *064D62A821B57E138FBC72F2F4C90AE4F76DC7A5 a0#g6
59,004,111 *064FEC4F1B50F48554D81FA89A22BB701FD856F2 A2ALW
59,004,112 *0647A8DC728AC624D7891DA42FF4E5E0853D47EC a5tse
59,004,113 *064C88C3A74B1C89A193596807C0A221EDAB4B83 A6N4U
59,004,114 *064892FC3B4A96BE54FC9B2324FADA7448B891BD ABHD!
59,004,115 *064F76F22F40EA7C3A2ABB47606FB6577F097A71 absorbais
59,004,116 *064ECAF2ED78B2770C46B2EBA7FA621D93316370 ACCUSCREZ
59,004,117 *064B465115CB814310160504BC2E1083F2CFF151 a!cik
59,004,118 *064AC62D71D5BAF3F269BB2E1DA088B3E43B437E acmr(
59,004,119 *064526B4B3AF70B4C997215437C376724AEA5904 a+)!d
59,004,120 *0648074FED87C09C4ACABE9ACD14F36B5B8DA6F1 adb`
59,004,121 *064C55C68B116051C2D896E63576E59A410068E5 ADU`H
59,004,122 *064D01004861764E3B7C24791F60150E273B4515 A(&E$
59,004,123 *064B8C81C0B7DA51C5D614DFD2889DED1A690615 ALFONSONEWSON
59,004,124 *0644EAE9FC02051A7E31BC9805FEE2772DF4BA6B ALFREDOSWEEM
59,004,125 *064083B373659FAE2A3C3A635E9E23F6BE0FBEDB ALHC
59,004,126 *064EBA83A7452C7BB1EEBFD182DED142832CA768 ALPEDIEW5
59,004,127 *06436707F99F52E18BC6EC01221E60992997C5B8 alvin.brockway
59,004,128 *064562E0164CFE70CF05C574148B32C86AE7AFE6 ANDREA.MCLAVRIN
59,004,129 *0646BB7A3759990C62D341B772691A1F72160CE6 angela222
59,004,130 *0643EC9CB5140964AF75A663FFC71C79BBBB914D AN.OLD.FASHIONED.COUNTRY.CHRISTMAS.(DISC.3)
59,004,131 *0640B47CC6165FAD75AF816334179B14965A25EC [email protected]
59,004,132 *0645A6425F08AEA8A750EFF2E78874ABB8AEEDDC anzovin5
59,004,133 *064F95DC5941B09D571B4825757C964F7BB08EE3 aqpx&
59,004,134 *06491DF21BA08C64B5FFE0576F6A42DE37E8EF77 artistsgawkercom
59,004,135 *0641CC13691E9C815C69D1A8ACF49EDEF4E4DDB4 A"RVW
59,004,136 *0642C00348D87EB85F08A1FD5A6AD63FD866B7A0 ASQHC
59,004,137 *064860200157B3AFE84873380190E733D1D5B2AF au#f2
59,004,138 *064C4FCFD3AB6712F79BB84555BDBEBEDF02A753 AVADHYAHING
59,004,139 *064642FFD46E9A871FBB7AE9961993C4A1ADEE61 A!V.S
59,004,140 *06415FAF0F2FB6A2EFB19493C6C79B005EDDE5B3 b#`:
59,004,141 *064DFDEB55A2237BE53EBC52160B895F54E5FC71 >[email protected]
59,004,142 *064429E4DE3D050BDFD34490C4A3F75984A25855 b1dsm
59,004,143 *064892C7B4E814CDD3D17FD48D7FCF64363CACFF B2CC;
59,004,144 *0645637DCBB55D4041FB7E5D8EB0DD824EF4090B B(3XC
59,004,145 *064EEFE63CF6C40283F3A86562047ED39C4B9B9C b6u(?
59,004,146 *064874544A48FD431BBFC2F85FB8D1B24239F540 b97k+
59,004,147 *0648A4EF0B28599A73CBFB5A423EC0A946612DD0 BADBOYS(MOVEINSILENCE)(BLOUSEANDSKIRTMIX)
59,004,148 *06464F4E58961BF0E9B33109D1E0B4F4246F5314 BANALSOUNDING
59,004,149 *0643F35FCEEB4A93C33DA1F9A9B8D15ADC707102 BA?NW
59,004,150 *064AB83CD60CD26DAE59B1E431F44052ABBE6778 BCD
59,004,151 *06416D481084EB88A4E92ADE24AACA624B0D5A3E BEN/
59,004,152 *064B67C235CDA622EAEC9988592670176FD6B13E BERNSCHLAG
59,004,153 *064FA7719B2348396CB87FBBEED4472B3D605BFF BERTRAM.BOYLES
59,004,154 *0645B4025A46661CF5098BF8176AF3E253C2AE12 bethvee
59,004,155 *064CE3972DB6D20EFE4C9BDD3535DA39FDD79293 bga1y
59,004,156 *064C4406D9A30964434EE83C145F3C4F63CB1433 bga-w
59,004,157 *06401D57E741C0DF0512E95A05A294A1D6CD0913 bhisw
59,004,158 *064E1F059FF89EA1CE366CEF5366861FEBFBF6FC BILH"
59,004,159 *0644041B4387F9D7252BB1423F834E17ADCDADFC b#ko
59,004,160 *06473CB83F30B5BEADF1B6D3E2C249FE1D692C2D BLIZZARDCURTIS
59,004,161 *064CCEBAF1385424E910F847B1498368DB453924 bobbarreneche
59,004,162 *0644F619BFAD319995F63F2FCA0DCEA9B715DCFE BOBBIEMCIFF
59,004,163 *0648943AA412FCAAB4D0AE4A2C1205452B89737A BOLHU
59,004,164 *064903CBAD15DFF9DD425D61996110DC954DFBD3 books)</a></noscript
59,004,165 *064049BD9D1D5AB37140622B348C6BF8139C460C boomlet
59,004,166 *0645363023F589C334FA68A5E8CEB398E30D1464 BOUNTYLESS3
59,004,167 *064705C6A8524DD8E95ECD075E21C06A7DBB851E bre4ch
59,004,168 *064FC2C82FFE395927E16F479F07BF67D225E4B5 BROSSLEO
59,004,169 *064FB4BF982016474C4E2F7659B6706B388645CC BRYANHONGO
59,004,170 *064B785FDC0F88F8E57682BB1BE1A7A0B3DF53B7 B"&ST
59,004,171 *0645418C078479130A2EBAEBEA4109745584766A BSWYPPRINTCAP
59,004,172 *0649690F4709F6F7F59148D2C393683A3C726AD0 bthiu
59,004,173 *064B9100E234BDFE4A8677220B62D07CB699B25F bua8:
59,004,174 *064B8E1B3BEDCF3057BFCCBC2C2353263B1C4AE4 BUSTERBRADT
59,004,175 *064C5EDB74388C436EEDEF7FDA2918CC40990172 BW?AW
59,004,176 *064905849A5F27407BC7F4C6762A92153DB00F05 [email protected]
59,004,177 *0647B77970D21C7E470039CF385D32494C389564 byhpl
59,004,178 *064CCDFBF0827C1790F58820450119FE9EA2F42B c3!.m
59,004,179 *064236EF2895534DDB996881DE9D1D65650354CC c65j
59,004,180 *064B945EE48DAB55A2B34197AC5ACB3BF0F33542 CAŁOZIEMSKIEJ
59,004,181 *064015B434C72975280B0C79F094CE1F96A9FEF4 CAMERON.SENTENO
59,004,182 *064013104B10E1CCA95D020C8C63C8F02621C2F3 can't.stand.to.lose
59,004,183 *064D7AACC043761468A5208189F1012CFB1FA2EE CARAMELMILK-THEBESTOFCHARA-
59,004,184 *06481F84C3FDC507826F6EAAB6B29D1F820A151F CARMEN.PLOSKUNAK
59,004,185 *064F518DD5002F1EFA5F8779B33A8FF80DD746A6 carminehauan
59,004,186 *064CF332C5DFBA36FCF0C8E64DD8E3F936F0589D C"AV/
59,004,187 *0642F4791C7248109F6E66FD00E889037506DA8F CCD/G
59,004,188 *064C994C6787965CBE3D9CFC1B6C5CDE6443B913 c+doo
59,004,189 *0640B4AD0BD339AB939F1448E83CE3810EB86F68 ce6w.
59,004,190 *064EE030764CA99CDD4859E8A0CC4F13747B7713 c/&e7
59,004,191 *064D6C5E983B39360DB5CF5A2B780992177CD6CB CEDRIC.HIRSCHE
59,004,192 *06424E1111852C138DEF5D3962177B346616284C ce"mn
59,004,193 *064CC156F1C093E352151FF61FDD13372F2C792E c"eud
59,004,194 *064F64A8E799A2E20071797D69BC502A5DE69414 CE(XF
59,004,195 *0644B253ECA577FE3339857CE16D81B3A8F87368 Cf6D
59,004,196 *0641B99888E72B7606D262240F8F4630C678C051 cgut
59,004,197 *064C3A9D3E7F8BCC02B60AE8A71498CDAC251A23 chamalee-dilrukshi
59,004,198 *06467C1535A04EE2D28E42B6B484CC2B88E0F5BD CHANK4733
59,004,199 *06454D345C821870EB2B8F7005C9D3ABA9DCA1AA Chapter.06.-.04
59,004,200 *0641A189162F17F2A54ED75FD4AFD0EDDF3D5658 chartometer6
59,004,201 *0648BAC7C69128131A9CDE302699BF17FF380FCD [email protected]
59,004,202 *0649F2E7DC7F738870DB0AB16F3D62B145CDFB92 CHHM
59,004,203 *064BD611C3CFBD2F21470FE67BCF17FBBEE6D0A6 CHRIS.PATCH
59,004,204 *064B337997A86067E7C724EEDD05E70CAA50414C christoperlouil
59,004,205 *064080E1B4EFE7AA6A1F8550197C2704520DAAC4 cia&u
59,004,206 *0641F22945195A06008A551D0260DFBBDF139B8A CLEM46
59,004,207 *0648C5AEED29BC63FE40DF9A7D01D8EA84B5549A clint-curley
59,004,208 *06441F51C080B28239569201F169A781CF9B24F7 CLYC9
59,004,209 *0646618FBECEF0165BD335A9646EE3E0B7E4D4A8 cmh!p
59,004,210 *064BD50AC6B354A34AEC6241E6808F11C94E8D9E colehammon
59,004,211 *064D84C99565B57698D2B6571701AC561041EC0D coltoncarlson
59,004,212 *064D6FDC33E6953F5BF47CFCF79FF0B7E3EFD804 comitial3
59,004,213 *064C2B4A0F0DE0051710B7C5367D4852842F8115 CONNECTK5
59,004,214 *064094EE7A16805DF2774C300B3D58151CBF7602 cornellfroschheiser
59,004,215 *0640198B26742FAC283B0723FE90626ACCDE92B9 COSMININI
59,004,216 *064A4DF7404D9820536BB1A602B8F6114E73C405 C:\PROGRAM.FILES\MICROSOFT.SDKS\WINDOWS\V5.0\INCLUDE\WSPIAPI.H
59,004,217 *0644D4957CDD0920A99DFCFFE88E957405A4CB05 cpyzn
59,004,218 *064399090ACED983DC3907D57AE5D5AD27E8869A cr-j,
59,004,219 *0644082A628AB6E79D65F15123D549087DDB0CA9 CRUMM!3$T
59,004,220 *064F6F7074AD1387DF238D82269CB5F089392B29 c%vr"
59,004,221 *06439D1E40E7467E874B97D9CFDCC5CFD1470964 CWHKV
59,004,222 *064357BFD5E7A640A6ADF27F3C43503B323A838D d2xgq
59,004,223 *06407E0F788F44018134219F5CD1CE2B4367B671 d37ae
59,004,224 *064AD32722B3CDE2FFEBAA04FA3D7A3AF495E04D ><.~.~.~.D===8
59,004,225 *064D60567F871609B8C4828180F3C96FFA7F62E2 d8)si
59,004,226 *0642388ECE3348D399305B7732C78737EE73079D d(9:u
59,004,227 *064881C153E2FBBACCB4421C31E3BC81BE4525C2 DALLASTUFTE
59,004,228 *0643D9D4079FE7E4D9C23B93B3563977332E5C99 damienstarns
59,004,229 *06410C078C9BD64938E481D3422A518C23C16F74 DANA.SALTZBERG
59,004,230 *064BC0646CE70114FD0EF6D4BCEA3F3CF3C01D42 DANAVARIO
59,004,231 *064ECB5EA44E038BC787BBC8CEEE8A159AE53B00 DANGTHAM
59,004,232 *064D7F00FCE240CE26143479D69876355F950BF2 dantedover
59,004,233 *06494A06A55D6677058DF17DD65CC3E8F2AFC57E DAQV
59,004,234 *0643F7A4B6A40596003FF11EBA9B9F38A9078C14 darrelabshear
59,004,235 *064500775E40BBDF0E941A7D9A1EBA97448AD11D dash012hark074
59,004,236 *064DECC8A971D34B8C035818DF9EFB5E94BF8C3E DC?RV
59,004,237 *064E2485093F409955A2802E2938BBD117437BA2 DDN
59,004,238 *06430FA2FA051ABDA7B8780C429EE9B7574176D9 deayu
59,004,239 *0640C1A4C290C92C4A8D095CE0AB2F508773719B DELW4R
59,004,240 *0645C3C701667CF453E2CE155B7E6E70386D6CD4 [email protected]
59,004,241 *064D368C79CD6BDC26BAD3651FC6A1A10998BA08 DENIS.CALVETTI
59,004,242 *064DA68E3B66DA0EEFD95DE1B6BC670ECA42ED9C denom1n4te$
59,004,243 *064DD92B86BBF4A520A928799E73F9D520EE6A7A DEXTERJOAQUIN
59,004,244 *0645C3B590A7E9176E2F469F4F4B1C597BF807C9 DEXTERKRAEMER
59,004,245 *0645302D7B7A71FAF80B8AD2FE24E6D2648CAEF5 DEZEEMEERMINNE
59,004,246 *06461782225D623D82286959E0C34D44AFABFE4C DFM4V
59,004,247 *0647059A66B06A3F0B9D7446D06C51507EDCB585 [email protected]
59,004,248 *064712F5C7159313B0F7FC83A38D5F8C4DE5EA50 directions-(a-cappella)
59,004,249 *064749C7520F86733E1339446F191CFED9DE16F4 discophorous.
59,004,250 *064DD70E5D2368B2BAE546D55C2EC2B1159BA40E diw4d
59,004,251 *0645D91A60FA7C2BAE0B5A90C494E4D4D9F0AB3D djel?
59,004,252 *0644891F556902206E8A0591CA5AF4F365724F42 [email protected]
59,004,253 *064C2FFEDFA509FECFBF60DBE84B74C320E17390 dkg(t
59,004,254 *06481EB49F6C544504AD1614D4BBE7AA100659E2 DKM?8
59,004,255 *064A7FDE43B084128B5C361F24C39296D5F6F6BC dna1
59,004,256 *0648B2766ADD52B0462F2DE1F6C4F2B7C05D31CF DOALAC723
59,004,257 *0640A79931A6849A8311C20856B59030341195B1 domenicspeiser
59,004,258 *064F338C02A5D0C358BE1810756B561873D6B7BE DOMENICTRUMBO
59,004,259 *06477C12D6028945D0A23684DCA679226BD5EA70 DOMINIQUE.SIGERS
59,004,260 *064C92CC0C2F3D9A20ACB9ABFD9621EE14E82F0D dominiquevarin
59,004,261 *064DD148FDE692C37A7262E776327164FE16B8F8 DONNELLVELVERTON
59,004,262 *064B484B2EF79B5A34F3D629DC4EFCAB057F4FF1 donovan.heard
59,004,263 *064D3A697E92CCD6B5FEF48F309EF44BF10DF24B DP7$;
59,004,264 *064C821F6C840B6CE17570D1255B15B687F00BE7 Ds;
59,004,265 *064FA91245E0C3C58557E3BCC2E3379C4DEE8D37 DUCKHOODS6
59,004,266 *06469A348445B46F15AA0A72E3D0813C1EEF2A54 DVGUZ
59,004,267 *064DF3D66A5746D766EF9ABB52AB08AB9007749D DYARCHIES3
59,004,268 *06466D188E4A9F0C9371047A7B1493523F8D6422 DZr#
59,004,269 *064417B1AE1FC007234E120D56F6D9A03286FABF e#*\
59,004,270 *0640BA267927D5392FFB844D80B9F057C1A04511 EC-I-
59,004,271 *064042D34DCCC09B03652E87A561ECE0A3310B56 EDGEEVGEW6
59,004,272 *064A5C66F5EAA0CBC51D8038E77169DE7306DC98 EDISONROCHELL
59,004,273 *064ADA26848926549661F46B79A303548CA44C95 EDMUNDANDRAS
59,004,274 *06429A52F2674123724C1754AEED509EAB6B8678 EEp_
59,004,275 *0646E2EA8A5379B822180D3DB6567E994D2977A2 eg5at
59,004,276 *064C9AD7C061827D4096653BF8212D23E602B127 ehbi+
59,004,277 *0645AE77F72E6D917AC3487D0664979B725E689B ejkolkte1
59,004,278 *064914875794C136F0CE91F8DF0CB807D90E568F elcaidraed
59,004,279 *0640B8D5937F803F8FA6A09D511ED46075EC2055 EL.CARPO
59,004,280 *064D4B205EFD479B9761138793EE872207E7F894 Electro.Namazuros.Demo.Arrange.Version
59,004,281 *06465E40461897AC30E82740A630194748C2981E elifrits5
59,004,282 *06412274D8FA6F50C74F5B60E3F24A14D8CB8D00 ellsworthmerila
59,004,283 *064E4CDFE2E780E856729B62717418D4ED67A9FA ELMER BAYNO
59,004,284 *064E0D03976C6E9607CD65D3614B8BD2B72EB5E2 elmohartage
59,004,285 *064964E2A1A312BED8F7B41E658CE2C52F247F39 ELMO.VELEZ
59,004,286 *064E20D79B294EBBB81A00B55F6F321E58007D79 EMBRY0S
59,004,287 *0640045299F566FE6D579B1D33C554119C2C40AC EN8210209214
59,004,288 *0647E752AC42432E0A272D9EB4A49E44D32307AF ERASMOYANKOVICH
59,004,289 *064B1183C6228E0F033C9FCEC4DC0046CBFB7F7A ERkX
59,004,290 *064FFCBD467813428B357C49EBF02BB592DBB6EA ESFa
59,004,291 *0644ABEF304E3E6C99B33B985894708FE99052BF etimroff
59,004,292 *064B71D084001699B804D990860BBBEBA0065168 eyd0n
59,004,293 *064052E141D4F97AF2E959A7FD125E6F22463034 FABIANSERA
59,004,294 *06422E3A7223943780ED5A410AB942B2C5DA6085 FALLSI
59,004,295 *0646C70821FD44139B960793883FB470DB442CA4 [email protected]
59,004,296 *0640CF44CD2DD93D9BDBA4D89618E5FE3304F548 FATEMEH MOHEBBI
59,004,297 *064E4989E3D8EF62DE14F69DEDF440AE7C978FA6 FAUSTO.TEWELL
59,004,298 *06499481994C575C7C5DC8F6A8D641713ADC2795 FFENSEUR0
59,004,299 *064B5B6DAFD97D53E27C692D2775C9FEF1CC67F7 FIESODUCKK
59,004,300 *0643E7CBFA239EA89098B6CEBFC85E8FA1D641BE FINANCEWIZ
59,004,301 *0645CABA48D055E490C40DD59D30D4F94FC750FD [email protected]
59,004,302 *064BAA3A7FB699D49E52623A2B7FC142710FFFC9 FLESH-(THE-ORIGINAL-MIX)
59,004,303 *064A48B4781A1579775A39BB8A089FE5A2E08476 flipbaseball
59,004,304 *0644CC1CE47F3D194BB6634E662AB593A9D4858B FRANKLINBRAVE
59,004,305 *064AB0CC8370B627F596F8B69E68F68D9B8FAC54 FRANKLYNROBY
59,004,306 *064CD6ECD6C53B41FF4D913C49AD48FEB8BD71E1 franny
59,004,307 *0641D6AD112356774370918236ED0DCF150DAF9E FVXG
59,004,308 *0648387968D7A9C07A890BE9DAAA4170FADAEC7E g3fr
59,004,309 *064475D95BE8A53B5622BA5D675B8013A10D2D65 GALENRUBYOR
59,004,310 *0646F375074EC209EA1B067306A807BD0B47865B GALE.WELDE
59,004,311 *064E6EAD52DD8AE43AABD851F000E3958786AB1D [email protected]
59,004,312 *064BE56BB221E2DD0EE24520DD1DF8D106A0500E GARRETTCAMREN
59,004,313 *0642895ACD633720E04E17C2D40479689BF6CE68 GARYODEN
59,004,314 *06408182DE73F39D7192EDA3092D71CF572D6C31 gastonsweigart
59,004,315 *0644A54905675DBE123B02A07CBFD4084B40D549 gatita1415
59,004,316 *0640EAC4924B5B31C3780A4FDB5423A7A7281D18 GEANLUCA
59,004,317 *064213AA6181A375841DAA7346A702427A36AC89 genarokasinger
59,004,318 *064B05987119DE985313040140DCCB85BF61DEED GERÄTPANZERWAGEN
59,004,319 *0642CD811BF796C264D0F41280EF3474745AEF11 gezinscamping
59,004,320 *06440CBFDAE3987652B11A7FCDE120B7F450A99B GIANT.FENNEL
59,004,321 *0642A866E019A92D2CA03D1F74C602D5EA899725 gjetter8
59,004,322 *0649ACEDCD522DC25597A0F394FA033992B99D80 goblauwe0
59,004,323 *0640010C4815C640621B4F1C93DE5558BBBA7C08 GOKCE.ATASOY
59,004,324 *0649F95E36DB8166EEB4C3A9383CFAC3FCC2E384 GOLDCOINSBRIEFHISTORY
59,004,325 *0643D551309023B0C0AF84A971099A609F175913 GORDONTOWNZEN
59,004,326 *06429123B7D01520D54FFAA11AE20564384AF37E GPG
59,004,327 *064FB2FABF405B651CFEABDA77A4A8319BC86C60 [email protected]
59,004,328 *0642A84A28865F5B0CC9E9B020D9B889E536C674 haida
59,004,329 *064C4C52ED964F7782F2406361E14F0A14A180F9 HAYWOODALVACADO
59,004,330 *064AA64C61FCB84CCE9859EC40EFDCF88A946043 heaven's.door
59,004,331 *064869FB28F800D7B1A532B937CABE1B48FB4C39 HEDELMAES
59,004,332 *06419928F845466CD90890C7FD1F060D11114144 HEFEL
59,004,333 *06487CE64FD84D6BF922CC8F57EC48F5A4BCBB2A HERMANDEWATER
59,004,334 *0646A1F65A571E5737EC3316CB6F015ABFF088AC HERMESSMILE
59,004,335 *0646444EE3F8B8B510ED0575CCFF41F1EBC8BB68 HOFP
59,004,336 *064C70584C97C7312E8E88CDF40FF8A060B3705F HTTPWWWINATOMINFOB
59,004,337 *0641447011FD515F501EBD2F731D5BC2E15145A5 [email protected]
59,004,338 *064BB273E44F724AB5B0F52475E9FF0C980725BC HUBAIAN
59,004,339 *064895D41ADD3BFDAE4929512F3CDE1674241FC1 HUBERTMCDOUGALL
59,004,340 *064357FC492C6A4F496CC5FB67B5113551502E5F [email protected]
59,004,341 *064FDC95866FF09CFD43B62516DFB52F9A481149 HUNTEROGIER
59,004,342 *0646F5A27B6AA76979813F64A8CDDBF3366565DF HUPENLYING
59,004,343 *064A961FE2BDCFB19EAB16B293E82E637BC8C5A4 idietrev
59,004,344 *06437C4BD853A275E92CB1DBB3F35DFDE814F797 igustes7
59,004,345 *0644E0A53E4E7A289C9007CE9CBC61E92C820187 I'm.for.Real.(3)
59,004,346 *064ECA969735F236A2B9DAFEA3F46756CFD1D9FA [email protected]
59,004,347 *0649D61CC1C8CE386934D2CA3CE90AF0A0B28B27 INDIANA KARANOVIC
59,004,348 *06429A87DF6F2EF9481775924760081265DAEC98 INFERTALE
59,004,349 *0649126CADC000B0F5856B95A23E254E843FBF4D [email protected]
59,004,350 *06404112467A6421BFE0A00BA2F1F1D3F99AD93A ingegrif
59,004,351 *0649725CCEC7B12BA2F40A4880FF813DBBF867CB IR3L4N
59,004,352 *06415B9FEF20FBA344B3CA2C40C30ABC9FD7CEE6 IRFANMALAYSIA
59,004,353 *064E5A225496FCECD813BB7BE856930D0B9D07EC iroitrolfa
59,004,354 *064E342C4A0D0C65D7E9D2DB628820E9BDBDEB57 ISHAKBEY0
59,004,355 *064C42336B81808CAE78C281C1BD52208CB5AB0E [email protected]
59,004,356 *064FAA2304E5268D1052CFE76F79482813224B09 J?{
59,004,357 *064F2BF86E3FD31105A69B730F30DB70442925D6 JAELYN682
59,004,358 *0649E7F59A0FA66D54CDD43FE8843796F5B56D1F JAMEELRAZA
59,004,359 *0645F03455D0C8811F6C56D0EDD288C7BE2B7FB7 [email protected]
59,004,360 *064CAF4DB68E71E272544F452B4D7A2DBAC35292 JARVIS.SOUVANNARITH
59,004,361 *064AD43C6AEE57C6DC3ED0FE4A9967CAC8E17D39 [email protected]
59,004,362 *064B87C8A0A8213EC3CB8FC95A420A7FE851483A jce4
59,004,363 *0649520C6C84A3581E8ED3B6E5887164F1FE53FF jeffereylasley
59,004,364 *064F4C68B5E64B985479C5A89EA7E6F39AD3B2D7 JEFFREY.HAMRE
59,004,365 *064D864C6355A4893151AC113D67B876078AA2D3 JEFFRY.WAINMAN
59,004,366 *064ECC9701E2BB71FF4D1F4DE40B03DC9A8BAC37 JENNIFER.GARDNER.BISHOP
59,004,367 *064468C0AEC2BAD582408AE55454FAD6EB3E9EEB jeromyprintup
59,004,368 *064260E7C9BFAAD35310195CB46DDD8D8806BC40 JERRY&THEOTHERS
59,004,369 *064A051AD85D01F2DBF37181586B54282522A434 JHOYZAE
59,004,370 *064FF98487132BA9C98DEE00385527CB93FBCA2C [email protected]
59,004,371 *064AF52068902EC376F014726C17D90B475E098B JOAN.FORNICOLA
59,004,372 *0647C18FC3F1ADB3C8BB2FECE4DE438CD31DA4C2 jodylindenfelser
59,004,373 *064393CB27B3E6B0F6A4CA4793672526C9239815 joelembo
59,004,374 *064FA98BA3A238D89ABF16BC9B0AA82ED5BEF55B JOHNATHANWICKKISER
59,004,375 *064BCAFE7F91F0E7981A38643BB0EDA600CC5D61 JOHNNIEENWRIGHT
59,004,376 *064898D835329DBFD950D0FE6ABAD026FA25D787 JOJO RAFAELA
59,004,377 *064F2028EC660ED18E7DDC11E5663D9A11D5F288 jorgehardee
59,004,378 *0646FE9E7B9CEC803BFF8A7BCD26CF5E05A57DB9 JOSEJUNIPER
59,004,379 *064F5E8B6C99ABC94DB2B519F576D92C96D12927 JOSH.SMITHER
59,004,380 *0644D492F2CEEBC3E9DD4988A14CD0D42EC08BD9 jpd7
59,004,381 *064B717136C24F9F683D6319BB450F26EC480090 [email protected]
59,004,382 *0642431DF23587FD3B2DB0E7917DD173830CE1E3 KARLKNESTRICK
59,004,383 *06414F8963EAC768F1E9599AFFF80684EB62756A KARMA FEVER
59,004,384 *064FB754B94E0F8CBFEC0733CDCC3732BABCA4A9 KATE VILLA
59,004,385 *064E0941B2AE16C999691E95A0AF5343A15F9269 keedo-real-talk
59,004,386 *06478D7BEF7954E4BDE8B12775B7AC354199071C KENDALL.WHITWORTH
59,004,387 *064C3E70760801B52C2CF7EC70DD35D9AB6A78E1 KERMIT.BODDIE
59,004,388 *06435F53D589BCCE323BE394E6839DBC308ECE11 ki-awaz
59,004,389 *06426AA64E8E979B5E9DDAA65AD7D40699605ACE KILLERKINO
59,004,390 *064CB2D62078DA94A21F7F32BA2045A6803BDF60 KIRKREINSFELDER
59,004,391 *064815BD7C222FB264711811E3DE9252D8E6E82B klqr
59,004,392 *064664066EF8B11E5439F6161F0EAF49C4C5C425 konuuoft
59,004,393 *0648E89290CFA07035D04FAE32871B481F30915D KOYAL-AHMED
59,004,394 *06483AF2AEAE97B40F2F20336C89BA4C1302D388 [email protected]
59,004,395 *064A4B4E7C8CC5E9FC68946094FC13B7B439128A kristal-rosas
59,004,396 *064B3A65097850B4E4EA9F6428050B77F1D59772 kristoferlaffitte
59,004,397 *064E889EBF53E3E12648F1B034433F13E8F6425E KRYGSDEUGD
59,004,398 *064E141D26BA2CA10C8DC4620E72EE0FAC79AE36 [email protected]
59,004,399 *0649D6D2137C4AC19FE8BC3C5C8613069D81B8E6 KUROJŌ
59,004,400 *064947E5ABBC86E87EA9CBEA921571ED4EE693D6 KYLE.OMTIVEROS
59,004,401 *06430F256AF3CE398C1758C49CCD0FF96F25ADDA kynis
59,004,402 *0642B8E3BDD1E38822110530758C0F1377DEA244 lacyfernberg
59,004,403 *064A593E73D9E70C2A78825C4D5144DC655CD7F2 [email protected]
59,004,404 *06469043A9BAB4E21A9B220FB5DFB061335D1C37 L,AJ
59,004,405 *064249FEBEA15D5999B63DBE299E9B0E5646094C LAMERTIMED
59,004,406 *064DEC29471A6F5FAE9ED9F1D1615B58FFEA64EF LAPURRAC9
59,004,407 *064FCE6F49199F18E10B1AD238E204780A873109 larry-gholston
59,004,408 *064476BB17E3949A5614BE252C29C56CBBC01496 lashistoriasmasmojadasjam
59,004,409 *06486EE1512E8E1CCE72577DB3D192DCE9CDE983 LAVERNE.LOUCHEN
59,004,410 *064936102158F32F0DF45976B727473E51CFFB1A LAWYOUJUL1998B
59,004,411 *06432142B16A2ACA636C3B961244EFAE855D37F3 Leah.Rose
59,004,412 *0646828492CF9BAD8A1CE3C5EA2FDCBFE8BE809A leifkill
59,004,413 *064A345B128C0F7F2C4A9912D30C745D2F89F51F lemuelzupp
59,004,414 *064A51DDA5793DB21EE3AECCD25B39CF77A6A1B4 !leon!
59,004,415 *0641066A15FC950E324CAE64E9A67D257C4CB0F3 LIOCESARSOARESESP
59,004,416 *064BD7781462277EA8B7CC502EF72628124A2DDA LLANDUDNO!
59,004,417 *0644BAA7DFBA1F522285DB93CCD56B60B73AF5AB [email protected]
59,004,418 *064E8E54D39A3580C2340C80E3C921041C5F5556 LORANZERS
59,004,419 *06433E9B4700479D681438CDAB14845EDF672D97 LORENA.FABELA
59,004,420 *064D3D56313642BA8D48F3DAB763D5200A0E8BA0 LORENTANKARD
59,004,421 *064943C28CF6D11EC4238EDCA71150E185249B66 LOUISEL
59,004,422 *0642C374B67314E1721FDBD8CFE5C69600C3E4F7 LOWELLSTEADY
59,004,423 *064824C2099A8CADCA14297F27A1A132EB1B5A01 LOYD.ORTON
59,004,424 *064D96FFDE8C8D97A12E4085F4A34D112CD71E9A LSY1953
59,004,425 *0644B521A1C187B8BCF6FC101AB426D3CFD2C2BF LTNAMEGTGRAEME
59,004,426 *064CF3D94F8061C9B3A3BBE056E234BD923F88CD LUCKI3$7
59,004,427 *064DAFBA6E2853420F6E2623C553465AE675737A [email protected]
59,004,428 *0647BBFE9EB0D94A63D45C8382FB937A7BD8283D [email protected]
59,004,429 *064EA254781D0114C1889B2B29BFA3290CB906B1 [email protected]
59,004,430 *0649E955E8C82AAD63B5C0213380D191F52822A5 lyj110
59,004,431 *064940EE6566C3FF3EE998051EC128AB91BC8914 [email protected]<
59,004,432 *06442747AA7BC072D2C9ABA7F161172246A2B00E MACKLEALEX
59,004,433 *064A123CE70342D35C25BDADE3CD5F6E354CD651 MADONNA.OLACAKM
59,004,434 *06450A965EF1E17019A324BD0FDB713107994515 magiclionking
59,004,435 *0645CC154CBFD04548847DAB2925E4B5A62AC145 MANIFESTAIT0
59,004,436 *064AF1BA82628D11728B45F0F54E495E05DB0F2E MARIO697
59,004,437 *0647C5DCFE4CB343910853839E92D222CA1A58B6 mariobrakefield
59,004,438 *0642D0ED7783E06B3F1BB5B8031184C625079873 marlontinajero
59,004,439 *064EE643A304F0DC57011BBBDC62F537F964754B MARQUISVERNA
59,004,440 *06456611EFEE25B7B63ADEAE815E7C20EB7E3EDA marshallfuson
59,004,441 *0646E4EEA83BEF38AF4B6840D20187BD48BFC4F7 MARSHAMACDONALD
59,004,442 *06436C077EF928428ADA35EBC36D7D5FC6526C79 MELHONGGING
59,004,443 *064A4FFDC47C300AB6301AF4849A0B7B5F798798 meN
59,004,444 *064A5AEFB0FD6C708AF99937763CE2DB8856C2CF MI5CALCULA7I0N5
59,004,445 *0647E1850435C36E125B58A6C2211D9687BB8ABC MICHALKAMKE
59,004,446 *0649701069572DC49755E3815498EAF2832EE960 MICHANTÉS
59,004,447 *064748D07DA4FF4CEC9AF5B8509F37A811E04F87 MICHEAL.DERBYSHIRE
59,004,448 *064014B1894DB55FE3E738F6913BF34829D5F3CF milesjewell
59,004,449 *06409312015F1848FDA368F5A7FAC3748799FEB1 MITCHELHARTGERINK
59,004,450 *0648C6570B3DAE829C27A2636F1742F8A0DF24EB mitchwatne
59,004,451 *0640A6DA2214E6F689D99303CC214886252C454A [email protected]
59,004,452 *064ECA7413685E64CE1D3C9264DDEA7F08E3D5A0 montagnyt
59,004,453 *0646512CEE011A6CC6F68EE4E2310294EEE019AD mortimertweety
59,004,454 *064F15394CF5E002F8521CA49665C3374FDC51CE MTRCLBL7
59,004,455 *0649F1B8BF25D9913D48920282A59EA133A6CB1C MYLESKASCH
59,004,456 *064F5EC436F352794E1613B4181049BE1E73E88B N31G81Y
59,004,457 *064BC3027C955BBB970C57FF1AD22BA4012A83D8 NASALSWEEP
59,004,458 *0648E66FB471D43A2B654DB2951E05210F32BD2C NATHAN.WEIDENBACH
59,004,459 *0648D28BAB639019D9F82C6D70FD536634095955 [email protected]
59,004,460 *0640712A641CF567A9941404FF62509DF9982FC6 NAVCHANAY
59,004,461 *064E71A0B39220B6E96A3D60E6D5D358391D61AC NDEVIDDENTIDEN
59,004,462 *064562BAC92E9E5A1D0F25F3BBD06AF18A09FFAD necestoval
59,004,463 *064B29DADAAD419AC36554E6A2637915A41F2F5D [email protected]
59,004,464 *064CE8E3A42B27C72459281B08F12AAD49AABFA4 NGNTHCRB
59,004,465 *064EFF5E5CA6261F51B48DF5348FA01C472E1E9C NH~
59,004,466 *064AC78FB0B9CD463332CC0D4518F22BEA0AB279 NONINTERMITTENCE
59,004,467 *0644790783F3A0CD3109F3A27CD3565F006C7D6F nosmotsd'amour(disc1)
59,004,468 *064E641518253D9158D7ED00E8F5326253EF6895 NOTVECTORPOTENTIALT
59,004,469 *064E585A9D821F5059EAA4274697E49B59DBF8D1 [email protected]
59,004,470 *064B54679879CEA0AE7C31FF4C5E22C029FF50D1 nucleophilicity4
59,004,471 *064ED4D852E3E0C3CD085F4A3BD91C5DA10901B0 odiskeel
59,004,472 *06472C990973EBB184B2767D021ABABB7790115A [email protected]$
59,004,473 *064330DFC17C459B03FD6B7F1D4DF5AF2C268802 O->-<[email protected]======P
59,004,474 *064F9B586EED778877BD7616746991F4B2186056 ORDENSGRÜNDER
59,004,475 *0641A4FA99C4E74FD534208087856CE35FEE1D62 ORENHIMMELWRIGHT
59,004,476 *064FCC43D35EBA4D266BCE880DB397AF41CCC2D1 OREN.PROVENZANO
59,004,477 *064981A7A0407D0BCC0CDC80D79B0A9C117E12F3 OSAMA-MADNI
59,004,478 *064B4F8CBBF7A94FC68F80AB35D70564BD98F37D OsherT
59,004,479 *0647F426467FA5F423D00FAAE13D3948EA8E74B7 pankajpearl
59,004,480 *06473561417EEC5FDB8D096056E75DB079BE8818 PARADOJA-DE-LOS-CUMPLEA
59,004,481 *0643A3F207D75B221A592CDE98C7EF2BE209D66E patrick-dando
59,004,482 *0640DA523B17704A259BD40D947D186620434BDF PATRICK.TALARICO
59,004,483 *064D2CF868E0756F13E777241B6AE45B377FA86B P#####D.~.`.(>-<)
59,004,484 *0647DDEAACF17CC6CD3F0C878563AE02085C4CD2 pedropyer
59,004,485 *06450C8E6919ADB0793137815644206DC4BCFA7D PELLICANO6JUL06
59,004,486 *06440897596501FEE1F2B95FC4B40104281714F1 perissology8
59,004,487 *064F5BE3723869C50BD089D6F1D6CE45D394A4A3 PETROGLIFOM
59,004,488 *0645E0D94307663EC330A2DDD5D00DB0C83ED33B PHILLIPROLLYSON
59,004,489 *064EFA131582B97F16F77BA0AC721D4B35485602 PIEDĀVĀTAJAM
59,004,490 *06487FC6851744C3D98EFEEFFDAD475F435724B6 PIEGERAIED
59,004,491 *0640A8B63A6DB466BC51566B52000D92BF274C31 pimpgangstaboi3
59,004,492 *064F43D4D36B8CDA0488CD2EA7C8A8CC6B2EAC5B PLACOCHR5
59,004,493 *0648B7BFCCC1BA6645F34AB9CBCC299B886FF274 plateresko
59,004,494 *064B681B8D1CC3AC072DA745D28D602797A3E41E PLURARIZADO
59,004,495 *064527106718C72023EEB2149C67A1BC44D2F63D [email protected]* * * O><
59,004,496 *064A114C8EBA7F3B4BE9933E05E6F06117898C9C PORTERHARRALSON
59,004,497 *064AAE542A059318832E685CE28115B24B84F256 posekiggeriet
59,004,498 *0648EE6FA4A155C6795176B2AB6DBBA904857173 pree574bl5hn9
59,004,499 *0649FE34BEA8F17744C9DF87CD4870DFC0C2EDD7 pre-note
59,004,500 *064A791DEEF791D9E69421617FD9A5D0698CC368 PROGENY SAMPLE: MAM HARMONY
59,004,501 *06452CAF33489EFD255D0BDA83AF33D7A792A104 puma6374
59,004,502 *0641824B9A22FFFC01E99E357E75EF888B285DCB PYHVZYI8
59,004,503 *0640490E8229E6B8E2D62CFA968B398CA963773B [email protected]
59,004,504 *064D2225B9C0D4DE74CF14AC91E35CC1E85E3056 QLOWNAGE
59,004,505 *06496758E0C5B8BD3D8ACA50E8FF3B5B706A5AEA QUAKESURVIVORIDIDNOTSUPPORTPINOCHETBUTNOWWECOULDDOWITHHIM
59,004,506 *064814D47C3AFD36EE89635410DACC41CEA9951D Quvern91y
59,004,507 *0645066ED63A07B60B280F4AEBAB2B843FB56C05 R3PR3S3N7A71ONA1
59,004,508 *06473609552D50EA6C3484D36A1256D9FFA8AD28 RAFEEK.ABDULLA
59,004,509 *0643E03F08ADA618803FD149F9197FE260DB39D0 randalpam
59,004,510 *0645EE106348E0A3DCE0BC045DF50B429FF29F7C RANDOLPHGEARHART
59,004,511 *064643E5CD1F2B83923B89210C0A690E312EDE14 RANDY-THAYER
59,004,512 *064E1FB5116FCC56CCF9233E464E1DB2C4EB9BE2 [email protected]
59,004,513 *06473128D6CC5812D63CFBA36E899A48A30E0F02 ravineraient0
59,004,514 *064C04D4C15318058CF01978C9951992CE568F68 RAY.TRASK
59,004,515 *0642A83010FD6B58CD7865C842781D89ACF6253E rchrchnt
59,004,516 *0647B49001C2BA0FFE5DB23818DA1FEDA6D6F2E5 REC0N$ECRATIN9
59,004,517 *064A13F2B045F2A24F2B89D6F684C54766A19A61 RELPMASSEDECREM
59,004,518 *0643FA646A4B8B4A7DAA50613CFCE74B8F95F5B4 #.REMOVE.TAGS,.NEW.LINES,.TRAILING.AND.ADDITIONAL.SPACES
59,004,519 *064ABCC3A1B651A6D9770C3C15D9F51854A0A951 [email protected]
59,004,520 *064E63DACD27CB4195F4C3EADBF6419BE99D19C8 RETATS1
59,004,521 *064CFA415A34B7C4766B57C94441BDE01EBA1919 reyespel
59,004,522 *06415DEF950B7D98777DF1A4C89DAF00B5D2FC58 RICKEYDICASTRO
59,004,523 *064515605B8737EAE07CB91B3B22EC7EC3ACBACD RILEY.SADAT
59,004,524 *0646E34C571E1F030B454646D4D4FF453B7CE4F4 RIMANDESED
59,004,525 *0649F8C70B0C47CD29270F411B4EB113D5B1CC8E RINCON-PIO-SOUNDS
59,004,526 *064D4A486EFA4FE9AA411034CE2BF512C3053A3C RMEIBABY
59,004,527 *064DA8BE2BD2A127635C4CF3B0F8A5F95235B413 rndsnstn4
59,004,528 *0645D0F65077C3C9EDE20AA1420B1381047C6F76 ROBBY.LORAH
59,004,529 *064FF50A674157EB548684A4531E67DB36158425 ROCHESTERWATERTOWER
59,004,530 *0644A227EC9A4257FBF70E2C97FEEE279808B219 roddiejoy
59,004,531 *0645434EDA0A74D033A20B9DBE1DE65FD4044BE9 rolandgellert
59,004,532 *064DA57F9ACD556AA42EF1AEF43AF31A07C40BC1 ROLFBUSL
59,004,533 *064B4404C27C4C80310623973FA2A82FB5595AD8 ROLF.WIGINGTON
59,004,534 *0647114B07601492AA9B58103221467B6CB27CEB RONJAKOB
59,004,535 *0641E954BF6B35B3F7B9508B6F7F8E9A273F55C9 RONNYFIELDING
59,004,536 *064BDED9D011F9B07F594426B6236E97B9DFA116 ROSE.HAMMOND
59,004,537 *064012D36B3FF3C800284350DF91396498153C22 rou13r3r
59,004,538 *06400798E897BACB460A8025DD5AE0723165BAD1 ruebendoldo
59,004,539 *06486A86B044B79A7CCA82554D1C3328E71AB5B3 ruth-doughty
59,004,540 *0649F4BFD33AA8BD8E828D89871F544EEAED5E81 S3MIP37RIFI3D
59,004,541 *0640161FA27E5835EC37FF6A3C5DAA7548F19479 SALVADOR.TOBIASON
59,004,542 *0649F14C901FE8D2C0B597A5DEECF5340AA4CC36 [email protected]
59,004,543 *0647A93BD5E01DD26BB275858E86FE0DB7ABBB28 SAMANTHAGOOI
59,004,544 *064F82D613D355C509597C0289F04B82FD553981 samualmakar
59,004,545 *0640B5E17BDEE018926103DAC44EB0D82612D471 SAMUELKLIMAVICIUS
59,004,546 *0640B025E845D5623FFF365D1A64D697EE5DB605 SANDELLA'S
59,004,547 *064CBD3EEA50C974D293706D2B565D64115EB708 SAPTYAWAN
59,004,548 *06435773A3A8BD2F719AB5C7B30B49AF12F66111 SAVEZOOMS
59,004,549 *064D710DD5CE5E10E8CC091D4AEB1E99DE58FEA5 SAYAD-I-NAQI
59,004,550 *064F734313340EB17EA0A38BA5FD37C9DAD2D87A scooby1025
59,004,551 *064A59366F17DBC8BD3E97D5682001CDB835FED1 SEANDELMASTRO
59,004,552 *0645837CEAEE64AD89E98085B9D9185DB3FDBE9E sebastiancutrone
59,004,553 *0641E75D4F14C507BF1FB613145457FBC2AAE9FE SEBASTIAN.LUTON
59,004,554 *064AA62BD0898368ABA831F8A91CD5FDAEEC0EF6 semiincandescent
59,004,555 *0642B3486AE530541176728036460143377ECA75 Serenata-D'Estate
59,004,556 *064B0D558B9E3926944BE78682DBE424FA4FF1C6 SERGIO.PEROTTA
59,004,557 *06456B45F8D89910F615FBED63E180478A9D537C seriodrev
59,004,558 *064172216E619BE5CFF6FEC3432F0CF49B145E17 sestia
59,004,559 *064CC19EEBBF45C2099B6B9256FC94A454D61DB4 SEYRUSEFER4
59,004,560 *06403EC2295F82B30F9086CA1630F21482696E86 sguainando1
59,004,561 *064EDAD55A3AF431861769907EE58E1CAFAA052C shelly.fontenot
59,004,562 *06441FF078D6A56042243209A52FCF341B44C643 SHELTON.JIMEREZ
59,004,563 *0649C894D2B6A4A34007555D061590C30C25976D SHIHEADED
59,004,564 *064E7DE33A4271489DF1D4305ADE03588958B17A SHINSHOKS
59,004,565 *064884101752A2D3CDCCB11CFEB062FB8C3A80A9 SHIRLEY.JANNETTI
59,004,566 *064F9B83105E45517F577195C1E3A043C21E067D shotabdi
59,004,567 *0647F653B0C45CCF91C62690779EE749B85EE6B3 SID.POSTHUMUS
59,004,568 *064AF4600B1C6607144E6D5CEB76D7458CA0D7FE SIERRAMIDNIGHT
59,004,569 *0643CAC8477B4A85026B1DC379CC839FE51E4DFD SIMONMASSARE
59,004,570 *06440E4FEFE1A12C2C216C933357DA0FC9E3293B SIMPSONNELSON
59,004,571 *064DE354DBF72188488EDC75463B79458EC6EAF7 SOENST
59,004,572 *064252C53BAC07FC410C1B69291A5FF03CBFDBAB sonsofgods
59,004,573 *064CAFCB4D11637BF7BB96858DC992C62DECD288 SOUTHERN-ISLANDS
59,004,574 *0645A3DE6C911C01EBFF6A76E6C52DAB6D625633 ”SPOILING
59,004,575 *0645CA57274FDE651971EA1DFDC507656791E6C7 SSHEOPURI
59,004,576 *06428A3FC2372C4D88814619598C3059087C66F7 stanpirozhkov
59,004,577 *0642C376E4F6460DD664B28D6490378B8C9EFE92 statstil0
59,004,578 *064EB2A144BD255EF4F3A686592FDD23B0737CA3 STEVELONGMAN
59,004,579 *064940642A9177E2A9156C814795BBD005C87ADF SULPHUREITY7
59,004,580 *064D0CA9F790498B48D8F47BCE4753B5ACB1015C [email protected]
59,004,581 *064BB71182BC9A0DDE560E264B25D0A4794E9099 supermanagement-ltd.-|-united-kingdom
59,004,582 *0641A0F8C0A6D70590EA28CA549DD9F5689E00FB SUSANBANTON
59,004,583 *0642D32C543F28EBC0E65DEE50053498351E307E SUSYVILLARREAL
59,004,584 *06408B814E167582845F607D06279BA43A6C6F9B S,VOLUME9:LECROCODILE
59,004,585 *064F046115AF9D147C680EB80ABB99DE3F80B52F SWUAGEJDNAHED
59,004,586 *0647CE12D205C3010269305D4CF36250B5BF6DC5 SYNCHRONOUSNESSN9
59,004,587 *06487342E7955D851385C23505827BF6556F7B43 SYNTAXEN8
59,004,588 *0641BA54E04EDD033A68582B7148EA2F60B18B9D SZEŚCIORAK
59,004,589 *064094BC1A646A57F7534DB6EE802335E89CD04B T3LINT4SS3M
59,004,590 *064F2B0E5D121433C61AD2D46AD6AD334ECFDDDA TAEYSIJAERKISIMPIAE4
59,004,591 *064BAED611B36629EEA051A14B54B72849E00408 TAGPAPILIO
59,004,592 *064E69BF6281C8073C5A6AA7BE7F4B5BD3CDD9F8 tahtye
59,004,593 *0647CE7D9FAC6FE0A555D391971F465130A5595B talk8510112236
59,004,594 *06470FF5CF6D7F94CFB6367C98623E181C077653 TALKRAL31555555
59,004,595 *0646173FC2632ADAE6D9BF1434A6A9DE76887BD3 TALKRAMTSE
59,004,596 *0649799CA558530820E1AF5CCA674B25E2F244E9 TAMMI-DOOGAN
59,004,597 *064A99AA3763574D2778354A36E85598B812BC4E [email protected]
59,004,598 *064373580DBD488F8012CC104101FC44370538C6 TAPPISCHEM9
59,004,599 *0647D84CE075CD81C6EB5D113CF37DB3F2C122BC $TATI$COPE
59,004,600 *064B6C6974FBC4E0ACDC0910B20AD11F97767C72 [email protected]
59,004,601 *06409C4F55D212F013CC9AE0CE9A8DB1BF88F8AC TEENAGERSCHWESTER
59,004,602 *064BA53E81DD9458773E3A2B3480E279B2075EF5 TEKCUD
59,004,603 *0647022096CEB403CB39D12AECA3AED227342233 TELECOMGRAPHIC3
59,004,604 *06494C82C86C56A73D6D8D8B30F6B728ECE34162 TEMMILLED
59,004,605 *064C330CCBE5766D905A0448B224C949EEF7638D TEMPESTY3
59,004,606 *0644CD3D190456A172C76BBF9DD4E93FD09EB5F2 terminologisch3
59,004,607 *0648A714DA62646DBC807F0061256E5EEE3588E1 test1marty
59,004,608 *06401C71E883DD1AB0EDEFD7A6F2B7C57539EB4F THADATTWOOD
59,004,609 *064F46572B49EEFC1251489E898DF30C97C580DB THANH.IACOVISSI
59,004,610 *0649B7684E4ADAC16C5BDDA24F4D2CBCB5C7E657 thanhmedeiros
59,004,611 *064DA07CAC10C7DD0393BB5EA1CE6D52DB868391 thatapollo1362
59,004,612 *0643323B47B4F34595D03326DDB4C1037A51FDDD The70'sCollection:1978BackintheGroove(disc2)
59,004,613 *0641C1F13B93D447B8565CA119A17AFD2152400C thegirlfromthebighouse/tr
59,004,614 *0644BB6E516CE77661414C63BCDECD1F4072DEFE THETABOOGROUP.COM.AU
59,004,615 *0641503EAF6D6D33AF5F9AA509C318AA4F18D74F THUISGEHOORDS6
59,004,616 *0648D0E42DC292C3C982490779D18A59A048B7F5 THUNDER4UL
59,004,617 *064CDC5E9FCFC9A2FDED3EA4BA56BC9073AB0A0E TIMMYGOLDSMITH
59,004,618 *064233E73B1BC542A80A258FE3D0E0BC546DCE00 TINTALLERKENS9
59,004,619 *06426D31E31CC71A0726C658AA5F0BC21C75824C TISCHTUE
59,004,620 *0643AC6AF6A01157CE307B6F8261F9FAF25FBB0C TIUTIUNNYKA
59,004,621 *064DE28390A6BC85BDB56F0E1187D4E81C78E588 tjnq
59,004,622 *0647E285C6F3C6A8976F45C526A3D07A08768026 TOMI-OLANIYAN
59,004,623 *06454DE67DE32D86CC6E6D698B698B28CCA52BF7 [email protected]
59,004,624 *064E21B2E1FE36CD900D1C106624B9144F3CB440 TRAVISHAGEMEYER
59,004,625 *064BB84317546142FFE5304BC73B97B098BF1EF4 TRAVIS.HONK
59,004,626 *06460AE7253BE746B2A45BDB274A389CBBD8FB88 tristansansouci
59,004,627 *064DA7E06C4BE81189CBECB768964B933EE14475 TROY.LAPPA
59,004,628 *064579C7B9E9AD133BA84F64666507580517D9D4 TRUMAN.LAMBERTI
59,004,629 *064708C19471242E6A7949DCBC88A7EC8E828865 TRUPPENVERTEILUNG
59,004,630 *0646B175B78D89D1BAF4610B4D631494B37CFCAB TSETREKCING
59,004,631 *064E7DC956D005DD538B27B3E3257A4BA0AC2BD0 TTSDUZHE1
59,004,632 *064C9204141EE05DEEFCA145227B539E3A0933C0 TUBERCULIZACIED
59,004,633 *06440832843CEE586B4BC95DCE42D49290B1EDD3 TULLYBLANCHARD
59,004,634 *064A5B91B4B7197B0B51C7CA876D5CDF78549355 TY.ENDSLEY
59,004,635 *06462F44DD5388E96F4ACC708A8C5FA5CC226227 tyreeharrington
59,004,636 *06400C4E12A1063DEA5F15A49DC8D0623191E6F2 UEBERLIEFERUNGM
59,004,637 *0647B29F327D5B80BB3E636DF82766909376AD95 UNDERPANTS-GNOMES-(FEAT-MC-TT-ACE)
59,004,638 *0649364A81C403E3E115A3BE08ECC70D36AE4B2C UN.DESEO.LLENO.DE.IMPACIENCIA.SANTA
59,004,639 *064DE2E25AC07BEA5DB0504E01D6193387E6D64B UNNECESSARY.PROABIVO
59,004,640 *064034EF399A66187D70D0D6A98F98AB6BBCFF76 UPGRADEIVE
59,004,641 *06493724023582489522D14C3457BBB42E2704EA USERDAVIDSCHNEIDER
59,004,642 *0643BFC1968B17620DB5AB0B70C5B4B4443C7638 USERRQQUJU
59,004,643 *0642C089A0D21FC5FE2DAEF4A7EAF364E286F36D utterable?
59,004,644 *0642644C06B7ED4FCE16D153B4711959A2148509 VADANTYAVYAKTAM
59,004,645 *064F6D6FA89A8895DD32E03E20AC80F5226688C9 VALENTINE.RADLE
59,004,646 *064B512D1619F59DB3ED7173BE9583A834AA4BD0 VALEN.WIRYA.PRADJA
59,004,647 *064ABC5EA3013F92AFEFCF48B288FF2037548565 valerie-michelle-castillo
59,004,648 *0641AE255E98A8F1081F2D2D1254467F4D874914 VANKAORDONIA
59,004,649 *064C930DF2A690B07DD615E8D43918EDC8EBBAF8 VEÇESLAV
59,004,650 *064A0182319946A6D7EB1D7B8D0910B68414E46F VERSCHOTTENS5
59,004,651 *06462522E74879FB4F1B925647376CA27A554EC5 [email protected]
59,004,652 *06423D20A4F7A5B68DCF2978881096B6C1F764E7 viatadekkt
59,004,653 *064B5A59E0D28B7DB2FA16CA3EB3CA8C02921C5A VINCEBRATH
59,004,654 *06433AEB37CF2A8F4F6B9B1E2B37880EE290FD3B VIRGILZUREK
59,004,655 *064D65992FB89C164C3A15AF1E076079D8121E4C VIULUNSOITTAJILLE
59,004,656 *06454CFEC0FBEC400EBFD015723E862769C82B72 VIVA MARIA: CHANSON "AH LES PETITES FEMMES"
59,004,657 *0641BE0D87ADFB348CA9AD967DE435F40434AE18 vloralila
59,004,658 *064B9ED06F43953B84C66EE33A570FB791956F0B VON ZUER MUEHLEN
59,004,659 *064FCA6B63DC6817A02AEB573E924E8C688CE918 VYLETADROC
59,004,660 *064A6D9EBC8FC96E3392AA72BCBD759B6183D06E vyllairotarobal
59,004,661 *064FFC340C1604A3DD4E1A85905A34E4C0FD037D VY[Z
59,004,662 *064170B71FF8919E9C288132E519019819DCB6E0 [email protected]
59,004,663 *064C2D7BAB293FF11F489798541CAE331F2EB265 WADESTOCKHOFF
59,004,664 *064CBD12553DC73A76F2C14CE5FC213CB7B7F3ED WALTERKUKLENSKI
59,004,665 *064BCA9480739A7B69A02DA5A81BB443098848F4 WALTZINAFLAT,OP34NO1:VALSEBRILLANTE
59,004,666 *0648D246CC9DDA9FCBCA8278248EC0D0944B7F1C WARY.
59,004,667 *06413C39CAEB82B2F925C0BADAD84B990D78AEC5 [email protected]
59,004,668 *0649284F02D7EDA476949B936FF59B9E311FFFA4 WATI-NUR-ADMI-KEMALAWATI
59,004,669 *064B1F6CB71020EFA8CCC38F3AEF80F978AE9E42 [email protected]
59,004,670 *0642AF3DB83996CCBE8C86F5AABEB757B63D876D WEI.SIM.TAN
59,004,671 *06418EA17C42523CB691FE0081A1BC28902657DE WELEDELGEBOREN9
59,004,672 *064F9CDAA6812EFBD3E4116C547275035ACC65A5 [email protected]
59,004,673 *064D5F16583D461E8DBF20B3C43BF88830E8969A WIKI1634
59,004,674 *064591DEFB802A3E6D5664D8B769A45E50C57B6A WILLIAMSCARMON
59,004,675 *0647F69E4E41ADFA74C31C6EB0147F2FA6479DD6 WILLIS.DEGAGNE
59,004,676 *064F17AED6862120C2B356A0247D8650A296D07C WILLISHOEGH
59,004,677 *06413E0754AA99EAA506159E1528AFC9FB6897E6 willybrandthaus
59,004,678 *06400E99E93F485057D41DCA379576BF36125BD0 wlvether
59,004,679 *0642B36006777A9ADFB1E0B7F0DDABAA027069A0 WOODROW.GERLA
59,004,680 *0646BEF93AA665EB694BC5A0A1FEAE539E7C4AD6 WOODROWLYMASTER
59,004,681 *0646A2ED503675A8D9DA58C776BDFE5BD16B0DCB working-on-w
59,004,682 *0646C288D12D74EDC7F703B7A46860924EA2D48D WPPOVYTNY
59,004,683 *064B6C14B08C0BDA409A13F546C64D89DD8B33FA wqannaqing
59,004,684 *064FD2FADF35CC3E0B095AF39488C8274F410231 WWW.BOOKSTHROUGHBARS.ORG
59,004,685 *0640FE190B2BF8C4E665A0DAF6EA2D14F3611CC1 )X(`.dp
59,004,686 *0644D399664362C0B528C7DA9F550ADA5E159032 [email protected]
59,004,687 *0642DC366BF0B057CCE8A66BAD552B3D14EA2AA1 [email protected]
59,004,688 *064557601797EF9D60265240C24A7AAB30D7E6C4 [email protected]
59,004,689 *0646A9F0B9D1974A88A80A77BA530707C1BBCB97 XX*<
59,004,690 *0645DD7DFF6C8D4CF711C38F59F05927705E84F7 YAKCUB
59,004,691 *0648C6CB2E4227848A599DC45D01CA8648C00DDD YAPMIYACAKTIR
59,004,692 *0644014AFE5936A415F79D9E5200EF1DA1347589 [email protected]
59,004,693 *064D819839E954E585F6AC548B15042694CBC899 YENAPHUAN
59,004,694 *064870CE38F55CA81E071621D3679690EC12CE5E YKSIL
59,004,695 *0642DF441FBEEA743AAF636C6CFA6D9A179B92C3 YOPA HILLS
59,004,696 *0647CAF9AB6E7C8727299028D7DAB5984B12F943 YOSHIMUA
59,004,697 *064AA27449E98859AC1C9AAC2C0C1DA4A3020E3B YROTADUNED6
59,004,698 *064D28B3FB1FD10D31056ADB99CFDA2380FDE991 [email protected]
59,004,699 *064CC9EDBF95980B1B404AEC91124B7E24A351B1 YUJI-PARAS
59,004,700 *064ADFE2FECF60CE853B55DDA5F12668E497524A YUKMANCHAN
59,004,701 *06451E083E51C175DFC447396A5009CA94B8EAC8 ZANEORISON
59,004,702 *06466B511F451BE34E5985F9B453D512107D8945 ZIMME KYI
59,004,703 *0646011166A5364B2F4D5D947CBA122239790E7B zivan.vidak
59,004,704 *064AAEB5C4A78F360C34FE3A2C1F29E73E8DF08F ZOMBYRAPEROYPRODUCER
59,004,705 *064470FD8F9A5A2AC58632E1CDEF936CF5F9E8E4 ZUZU.DIAZ
59,004,706 *064B7D7E16B7B064B2EBC35051BD2363415FFBF5 ZUŻYTKOWANE
59,004,707 *064012E40CDE76AD057F11FF2436E8BDAFB08458 «ΠΛΑΣΜΈΝΟΣ»
59,004,708 *0641B5BD8D8F031D1483AE114C16858425682784 ΤΌΡΡΕ
59,004,709 *0640FF2B0CEFB7E0D9BA78031BCB19CCE2FDE0D0 ЗАВИРАЛИТЕ
59,004,710 *064D672C15BC4A3236C7758020B918ABDD87788C ИТКУЛЬ»
59,004,711 *0643B89FB9A9E1C9010D16FA748AD163D31EA52F КЕНИГСЕГА
59,004,712 *06479CF9A0EBB0D2ED7F4A8560A3125E999D2BF5 коштантау
59,004,713 *0647BA6A00D8AE5B35AAAC31DC8E1077C341A0B5 «МАТЕРИАЛИЗАЦИЯ
59,004,714 *06415D10E749C6CD88EACF0BE8131578AA1784A2 СИНЕГОРСКОМ
59,004,715 *0649B4524C058E767424A058C49120DFABF5B3EF の混成部隊だった。彼らはイギリス製のベーカー、時代遅れで射程は短いが威力のあるタワー・マスケット、MARK
59,004,716 *0642174F3ECDCF90F6E93426D9810DBC6A1CACED |___|___|_|_|___|
59,004,717 *0643E70085BCB8B923F91F2907A183342DC4A510 [email protected]#$%^&*()_096
59,004,718 *064C3B934C4BC4718389493C85F22A23ABF66AC0 (0_<)o~o~(8
59,004,719 *064D1A914A52FECE9F662A73FC42DA595C318AB3 0THATMARK0
59,004,720 *064CBF339B4F1344D747FFDFA399E40D9A6EC4E0 オセロゲーム  10thsg「一瞬のトワイライト」
59,004,721 *0644BEE7A6C342ED04345F9D9678943F5A66FBC3 は14箇所ある。
59,004,722 *0645858D78A12F72FE248BEA2CB6805CD56D5D6C 1631CREEK
59,004,723 *064843D1B7FEE7E29FC9A7E89DFE4FB20681CDB5 (1673年)
59,004,724 *0649AC1FF004B2190E328184FA3E2630A7B00551 ۱۷۰۴۹۲
59,004,725 *064F7EE5DA5C32FFD371BCA12918B29296056480 (1867年)などが挙げられる。
59,004,726 *064371786A1828DFB9F2AA63B279C6CFF3284FBE ビーチクラフト1900D型機
59,004,727 *0645BADFEC33D93F19BF460A845414B4B1BB3FE8 ۱۹۴۹۵
59,004,728 *064933E64859268C7613D3C245419CA500C638F1 1BRUNDUNG
59,004,729 *0647BECE9CC0517E569F9517B5F787B2E9EC003D 1 CHIAKA
59,004,730 *064753DE1B96C6D65ACE41BFCC52C53D93297D0E 1elsebeth
59,004,731 *0644B6485DFFB00CB60931E4BFC1949FA5D19ED9 1-FACHWERK-BAUTEN
59,004,732 *064CB3501DB4F2ED95A3931A1553338643CFCA6B 1fishtekniikan
59,004,733 *06413F52E8741C401CE217ABC862A38C52ACA8BC 1 FRANCHISING-YRITYKSIST
59,004,734 *06489B2E7713FCE9E8E56A9426B43D8818F06EFE 1-HIILIKUITUKIN
59,004,735 *0642D5F35ACD4EAAB32C67F5F58C95349F9ECD84 1.ihanteestani
59,004,736 *064D366CA4941068E97F4442C6A41F36C835A426 1 KATASTROPHEN-KAEMPFEN
59,004,737 *0643A16ACF51583C40C3F1A30444EF47BB27E88F 1-mini-poweri-hanke
59,004,738 *064B385B6801CC0E9DA553489B2E5A2568C6137F 1MINITROPFEN-BUDGETSJUZ
59,004,739 *0641BBA7FFE278EED2C9848B68F07CFC14337793 1 RAHAPOLITIKASSA
59,004,740 *0649E60EBE512B356121911106E8B23FD43B1DE5 1.RAJA-ALUE
59,004,741 *064CEF0D55F56DD81F31BBDBF141C8689CCEE1DC 1.sldfuehrung
59,004,742 *064A0F478A39187F83F5EB9D92EEE6857BECECA7 1.tauschkontingent
59,004,743 *064A3B926337B06EDF09AAEEFB40D7F69CE2E989 1thatfuckoff7
59,004,744 *0647203DE766C2280C9D486748DE3D4847D52168 「1.Wikipediaは執筆者を攻撃する場ではない。」は
59,004,745 *064474B19901581838171C4BF31348A7F603A4C6 (2000年5月発行、isbn
59,004,746 *0640867D59E54E76A7BF4413BA153BB0B3281142 (2003年10月~2005年3月)
59,004,747 *0643014EE5E4AB26EC45DB9C9A7001613B51893E ۲۰۵۳۱۹
59,004,748 *064976890933F1F92B24CBFF7166C837DA63267F (こくどう225ごう)は、
59,004,749 *0642C50CC7DE0C0E87CE2611857DED789B2F1596 [email protected]#$%^249
59,004,750 *064812E3D03B7C0EC54B06B3B8F5B88FC83032A5 』まで26年半の中断、時代劇に至っては、
59,004,751 *0647AB9A4259D630B579DBD6C9BB88E3477AEB9D 2750404 puheenjohtajatotesi,ett
59,004,752 *064B3AA8E8D7DFA6A577172EA4EB725FF50FAB82  279号のうち長生町~福井町間が徳島県道27号阿南那賀川線として主要地方道に昇格。残りの区間は
59,004,753 *0645D1BF4EC1BF1B7376788E1D2B03DFABDBADDB ロ284(ロ274形)
59,004,754 *064CCD48A63663B1EF200B1F385F05276C90605C を29名中首席で卒業。
59,004,755 *064926C5EAA5077A12BC395B5B8631B3CBA9099D ±2mm
59,004,756 *0648544DB82A3642A4CEF078E8A434EDF5938F20 2radonmittauksen
59,004,757 *064A5F82EEA967844B5DE11775B824D3EFBB862E 2.rubiinilaserin
59,004,758 *0649D0022D91C302574A1F3DEDDEA6EABF000706 2SPOTOVCH
59,004,759 *064611509FDCA5FCE3F89AC42A4F067D03F95E3B (この2つは三田口)、
59,004,760 *064A41A7ACD8A9E330ECB652AEC29C10ADCE44E0 [email protected]#$%^&*()_+300
59,004,761 *06460ADA73B8C3E19CEDE154803E35CD5C977522 ←3319
59,004,762 *0646A94D1B532F2D6A144160337762654AA48A82 ひかり357号 新大阪09:31
59,004,763 *064A3C48F4788FA6529B48605AF9AD04D745273F には3Aリッチモンドに昇格を果たす(このとき元
59,004,764 *06419DF43100A663A91C24FA62D7846FCE8600B1 3####d.`.(-_0)
59,004,765 *0641B8E4717BC09E184DBC386FD8AB0B3B3BD8B6 3######D-~0-3B<-
59,004,766 *0648AB35747002CFCDD6453DA53904F53323709C 3doyurmayi
59,004,767 *0644B98AA340D1B3D0BEDFB62FF0AC77D67298C2 3esit
59,004,768 *0640D08D075744B29E6C6686331371E9482B440C [email protected]
59,004,769 *064E7458273E63A196F9AFD722E15906604A6052 3nuopponen
59,004,770 *064453722765714C84E3F081E5C28CF34D771A9E [email protected]**}O{
59,004,771 *064305AA6B1BED868186EECCCFDA5071CEB4346D プレイステーション3のゲームタイトル一覧
59,004,772 *064E93EB5A6F18FE1C74EADC2B37A27858BDAB08 :43X線的站位與4號線相同
59,004,773 *0643AB8D17F741789F815053590112EE197D48C2 472674 budayerindebirhUkUmdU.
59,004,774 *064FCB05875853B644ACF7F87EDFE7EC1BE7591D ۴۹۹۳۵
59,004,775 *0640C740804EEEACEE72B47C0964AA2A8E84C4EE 4FRANCHILE
59,004,776 *064BFA8F9AB14881CF1DE9F23AEEB7AC7B58B293 4GREENJEE
59,004,777 *06475AA1ABC6DCFFC740E7F521893DABAC69F80F 4 KAHVISATOA
59,004,778 *064FE428DF32ACDC89C6E58C42C08DB3A8CD1E6E 4NETHCAJN
59,004,779 *0646CDD1159409AB652393B7B43627763E66EFA1 4PRICEFLOORFLOOR
59,004,780 *0646EB53592AD35BB72F1CEC461E0FE7E9DB1F99 4SATISFACTORIES
59,004,781 *064901ED102896280610E05DABD3BB49DB052833 4SIMBALAURA
59,004,782 *064589041FF0221B037474BCB9B51D4AFA23B0C7 の4thアルバム『Slap
59,004,783 *0648BEC3A05BE420E733105D46BFD0982663D188 }[email protected]
59,004,784 *06487A23D8E2D90195BBA1DEF99BE6B7B60C63B5 (53秒)
59,004,785 *064E80CD0CFA36F9B64481AE1E265BF8C1867738 5ALEXISTIMOTHY
59,004,786 *064F574C18677C1FCE96714205EDECB2CF91740C 5BSWKWHPCBSW
59,004,787 *064E3800D5F64D91138F2794713F90F8F2CECF36 5HAMMERREFINE
59,004,788 *0648E6B02D1CC17044D070C77B43FBBA8F51C476 5ILUVWILL
59,004,789 *064793DCB6C3E14A0C63A427C84F40CD6F02894E 5KLANGVOL
59,004,790 *064EA49EB85C4D1F1D03BB20A4C5CD8A6BBCE64E 5KONTRAKTIBEL
59,004,791 *064B1E85AB701F1684922C80D69F04E8946C4EBD 5LIAUBSW
59,004,792 *064B139873611205E280E2FF22416D4A19D38B6B 5.LUISTIMEEN
59,004,793 *064D93CD9D3ECC24BFA7F661F12EB9CEF01644C5 5MENSTRALES
59,004,794 *064821474561599FA57491DA116E6F846435AFB2 5MULTILAMELLATE
59,004,795 *0646D22480F5CC3A15EFBA9BEEB4F012B3893AA6 5YRFASUECIRNARF
59,004,796 *064806904BFA7B97A409D4E7071ABEAE82FBC741 ルートヴィヒ5世に譲渡
59,004,797 *0644E613A6C59B87A4689289CFB821708B9C2EF2 (650石江戶扶持9人半)
59,004,798 *06484A39B0720B325C7C881EA32BA466D4C26859 6BIGEYESES
59,004,799 *06469B970B24FAB800277B2B1FABBF1E05BBC595 6epicystotomy
59,004,800 *06433A15110AB5FB9FEAA7FBC8AA135ADA4BB354 6LARBETRE
59,004,801 *064825B98033448119B94E7BF4E00ED283A70523 6LEADINGL
59,004,802 *064D5704256AAD98ADA4C6A61F7C64C14AC6E0C7 6MOLSONCHRIST
59,004,803 *064A2E1CA2A9C863D0B0AA6AEFBB537CCEED45B2 }6/O
59,004,804 *06427C2F17799896E28F0F047D992859DCABC280 6PRATITISHHTHASI
59,004,805 *0643BABEBD7BBD9C94131987977FDC0DA44B35C0 6RAISTLINCOUGARS
59,004,806 *0644238E6D5695FA90CFB946B2895200BCFCFA4C 6SISOTRUK
59,004,807 *064869592E7A99C07D81B3D7E73E021C294B5340 6TERRYMILLIE
59,004,808 *064C84A987D007C1A0ED0939BE162687EBEDD331 6TOUQTOUQNIOJ
59,004,809 *06443368C87E3BAF6A3AEEB89B99DB9546A690FF 6WOLFGANGVICTORIA
59,004,810 *064BAD580903F8ADC0E3C3C282734EEE07562664 6YLLUFNRUOMREVO
59,004,811 *064810577F1B26CE1B723F57473CDED9E0617E8C では6位入賞を果たしたものの、その他は
59,004,812 *064C37203A2F389903CBEF79A41B008920E5C83B ,73061部隊
59,004,813 *06462B3A42FBB2EB5356F496D1F19148B046C778 781781 "-SCHUMACHER-LEHNT-BARRICHELLO-AB-"-
59,004,814 *064585A2C96C15F8B8CAB8BB94B603A6F9760949 である。7・8の2両が在籍していた。
59,004,815 *064FDC0AA5888D51324C1AC9FC48C9076C0EB2CD 7ILOVEACROPOLIS7
59,004,816 *0640784430DD19AB1C406ED4C71C07D74FD907FC 7KONVOJS
59,004,817 *064EA8BBBAC74065BB541EDF1FA1AB01C3650344 7MAKEIRES
59,004,818 *06425EAFA5B0453B73CB853F3D28F23512A13CE1 7MILLIEBIGBIRD
59,004,819 *06491E0834CC438DA3AACA60073737B106401B19 7MOORTER
59,004,820 *064A22822A8CBE8377B3B04E0A027E99BB1C12B3 7SKINKSES
59,004,821 *064C36EDAFA9741D7D2026D6C910EBCCAD4149B3 7SOUCIESOUCIE
59,004,822 *064B67EE57CE263CFD84945A475048F497820F5A 7SPMAHCSEDK
59,004,823 *06409C01855088130661B5332BE68A8D97BA208D 7ZACHARYTEQUILA
59,004,824 *0640C08C0B89E06445806BA64992CD7B1EA5F6E8 とほぼ7割の患者が、自分の意志で入院することになった。ただし、
59,004,825 *0645E67202CAB8ACD650C52ADD82B358AD7947FB -80節。
59,004,826 *064875B708993EFB1F992BB73BD1E95D8D4E37D2 }8{ * * (#####3
59,004,827 *064946BFEF6F257F8B7521F42408879504BD7A05 }8{ * * (=====8
59,004,828 *0644F3659FCD22922BF2D09BF12C569DA87C3717 8MINDYBIGFOOT
59,004,829 *064ED4EB1675F605295FD22B1D8F447A6318E3D5 8MLTURNERBSW
59,004,830 *06490800C3CB16C84A859CBD7D509FD559340630 8NABLAAS
59,004,831 *064E110F5644F89C8569EA5377ABAD4F96BDF169 }8{ [email protected]
59,004,832 *0645D2385A2F5069B33CDBDD01F003D4FFCA74AA 8PREPARARTION
59,004,833 *06432D7B13E1C272D6CCDD79A6038463802D36FA 8PRETENDEVA
59,004,834 *064909D359C5C77400207ED39DC1C08E202228D5 ウルバヌス8世像
59,004,835 *064FDE7C153984D7326D7CE0A4F83A63D02743AF 925104 MOST-ARE-LIKE-MR-.-SIMS-.
59,004,836 *0640E7301B7A1C1CED99DBFB161448398349169D ۹۲۶۰۹
59,004,837 *0643600320EEF46CB0B9F41076560CFDEC7F4671 ۹۹ام
59,004,838 *06464C1FAE59FBEF618C91D3A158EF4AC71ADFC7 9ANISOPETALA
59,004,839 *064EE7A18F318D0086D0D0E6F9A278CD2CB50871 9BLASTERBASF
59,004,840 *0647B605F33F0BA33B79C193A73E6B860987D3B1 9BSWNOTHGUAN
59,004,841 *0648FDAF13FD5F1E1D5FD51AECA35D63E7CAA6A9 9DANNYGATEWAY
59,004,842 *064ED4FA3C6258996096DEECA2270463E08CB0DB 9FASSABSW
59,004,843 *064A1FE8FF5ECF1422F086E926E520029558D435 9GABRIELANDY
59,004,844 *06476F5A5EA2E18298211C32D06BF846B1627CEC の9作目(インディーズから通算)のオリジナルアルバム。
59,004,845 *064AABF4615B8CECB04CB41EEE8A09B8585653D2 A2Ds
59,004,846 *064C80FA1B40C268300F224ABF110C90D1CDB0B9 A7GMB
59,004,847 *064022950EB95BFD205851558E5546458DC54304 a99lu+1na+1ons
59,004,848 *064D44779D40CACBF31282D4774E1F146A2F6BB9 AAD+JT
59,004,849 *064E36A131B9BEF68595145490729F8F57B4644F Äänestyslippu
59,004,850 *064BDF16A27582682ED240D9029592E443B2EFA0 ãâºãâ°ãâ»ãâµãâ½ãâ´ãâ°ã‘â€ã‘âŒ
59,004,851 *06432B7CCE3F8264DAE9635ED96F7F697A998260 ABBYLAMER6
59,004,852 *064B1FCFFD6770808E345215E75E25E6797917A1 abcdmiranda6
59,004,853 *0648ECA552C19CA07317CA18A6600C6305AAF4F7 ˈaːbɔʶ
59,004,854 *064FCB5808B0747CE9A09C6383F3B9E5ED685C13 Ácheslles
59,004,855 *064124B7A98F9706CE1727227C8EFF78D7201899 ad$-t
59,004,856 *064CBB1E1B778E698EDA9331EBD06D7DCD803B83 ae4g%
59,004,857 *0644B31D643901ABD7F03D39919A2061DFC234E1 AE5BC
59,004,858 *0646C94085A985C6107DBCBAFE9351CA2BDD5710 „Agat“
59,004,859 *064940E2BD2849630A610A0C4034E3FBB7AA4843 åldersmässigt
59,004,860 *064FFE4516C4D865F27E65C453F195BA003AABB0 “alexander”
59,004,861 *064F40311CCA2CE8E27F0EAE94554BCDEC4B3B83 ”all”
59,004,862 *0644615D5D7C8185B726A8DBA04668C8FBA91BE0 „allzweckmythos“
59,004,863 *0640AA4519D5BCFBBDB7AFF7B73995A718EABC7A ALPHONSO.DAUGHDRILL
59,004,864 *0646F44D88A9BB93781C5F6FF29772A031178AC8 alsek
59,004,865 *0647C1F0972A532BF867D6B92B3601F5AA6C2FC9 “altro
59,004,866 *064F4CB5BD99E4B385D43D9914F204C7683C218F „ambulant“
59,004,867 *064D00F074045AFD13F6B1E65DCDC5A3B6664FE3 A_MOONCLAD_REFLECTIO
59,004,868 *0648151D6642D406AC56D81C43BEA3C7C4ECDB90 AMV75
59,004,869 *064A2CC9CFFDCAAC59650BE3EDC4CE3F30FA4339 «andværs
59,004,870 *064E4020F9B1F24B2494AAFD6F9638384B73E308 APRILSTUPID
59,004,871 *0646FCEDB6C8E1B20A4CE0917C724173F56C0F70 arrautzaren
59,004,872 *06459D32F824F3D458DFC9386A65F804363EBC9B «ascap»
59,004,873 *064CC150B9CABD2034B91CDCA48C98492B4B454F のAホワイトSport
59,004,874 *064ED6B55E90137DD6FEDA707CFD8AE6D291E4C1 AT4V
59,004,875 *06437F68FE0547CE6450962CC004205CD86258EA återetablerades
59,004,876 *06423A2288D7A27726F3838C403A1F3D78CEC89F ATOPHY
59,004,877 *0642D91B58ACCC7EC9716AD4EFBC1F47CC6F6D9B átpárol
59,004,878 *0646D2C688038E5A8DA713B855008E5300B3A2CD „augustyn
59,004,879 *064B7E1BB6ECA5D6C230B95E5B0B2920CB16D05B „auschwitzkeule“
59,004,880 *064CA258A820A62C7820B18F8AB56E1DBE05245C awhp
59,004,881 *0640969B006B655AEEC1E7CA9D0C6F445E40B345 a+,xj
59,004,882 *064CB440853C09296D97E6CB40CC4CE8EF62D5C1 AXP?H
59,004,883 *06476F63310D5FF0B2772BB226BD8B9072728AE7 ˈaβɾigo
59,004,884 *06404FBCCD40B239A87A0B0C2461589FD767F9A5 、b21スペシャルらは独立したが、
59,004,885 *0642ED055D8A41917A194B80412D5A6AE1B9C40B „baldhead“
59,004,886 *0642DDAA13E4893AC79D4B6E981E43D29CCB3365 “baricentro
59,004,887 *0649955C0B824A358B856EE3D6570E27729041EC „basedow
59,004,888 *064CE4389E81BB6551EA09F7C5BAE9E9BE98B62B 』(BC14世紀)は最初期の
59,004,889 *06409E44CE5504A1AD0ED5F91B884FF503B6EC33 [email protected]
59,004,890 *064EC6061D41AFB4AFF6C5EC8AF0D5C49BD7479F „Beamtenminister“
59,004,891 *0645306A41E98D123D403E51ECF438FACA530D98 BETHINE6
59,004,892 *0640BF50AF7C8B4EEE5A91030E32D4DA96E30EA2 „Betroffene“
59,004,893 *064BA278E255982AE3557EE8E194EA166B4A9301 BFKCI
59,004,894 *064A5ACEC2E07E14E7E8DEA70D4BF38F0ACECF7B B,G!
59,004,895 *0640F1E7B55E43DC72FA8B5E9DB660C00FC0C590 bhm,=
59,004,896 *064A994CE2D09A7A767816E196CA3FA20F7CDD8A |bi#
59,004,897 *0647ED77834EC82FCF9F2CEF1739FC482DE78789 “Bilad
59,004,898 *0648FF7C878D1AEBBBE5226CC047CB4D6527477F B)(LO
59,004,899 *064C610AF5297E2DDA080D0FF71F418EC17360C1 BOBELFMAN
59,004,900 *064AB4F5E413C01D0B963D16E5F0BE5A8B6CBA67 BOCCONIANO
59,004,901 *064249AC22B1B0CDACA83901CC46F73F0F98252A “böhmische
59,004,902 *06411AE306BF1C3A18B50F8288C0D9F85F0FEB31 boomlet
59,004,903 *064BC19521BFCC1F7568372D71ABF04821FBB97C bos0
59,004,904 *06464DD167AD84E49B1C696B97680EC189CA9792 bp~~)8(
59,004,905 *064CF1B3B19F69FE567CE8134C98B425A3B0E407 BQBXE
59,004,906 *064B57879AA8E9541C5ECD1AB458D8CCB9F9B73E BRADLY.SWAINEY
59,004,907 *064005E7B2175A7F1D00FDCCEAE15532A24EB376 „Brainstorm“
59,004,908 *0642EDA9D01CD3B63F233048B7A09D907D323721 bretborgstrom
59,004,909 *064FFA830C983F1D9399DCA17E5990AF8657E589 BRETDENKER
59,004,910 *064B961088274EB937B0DE3623C3587BA5628FE5 «briljante»
59,004,911 *0642BA496B19675CB98193AEB5205D4C0F0CED68 BROCK.BRZOSKA
59,004,912 *064F6BB9344299D42831D22DA097A5C5764B975B BROCKFERNADEZ
59,004,913 *064317534B157495BDD33DA40FB736F7A00A3F26 [email protected]
59,004,914 *064FDD8BCF8C525B1B79B80D62AFEA9D612638A6 brugergraensefladen9
59,004,915 *064AD325A10D9985C75D61D2F8CEF3254118CA7E bs)nb
59,004,916 *06499FB00A09073D3D1D54CB199416F94DE9A3CA [email protected]
59,004,917 *0647C3E9B987B057F2055DEAE50736CC1D83FD3F b:)u
59,004,918 *064FC9700047C7105F140675D97DEEEB41651CF7 „Bugger“
59,004,919 *0647180D8D7AC48AA6EB5DC0C648503EACC3B1AC „Buttern“
59,004,920 *064FA60F26397682B9E08517DE5C3576ECA103F3 BZJV:
59,004,921 *064201BFDF89C7AEBFCE76722A520E3DD552810F C1POK
59,004,922 *06472A9F92238FDDCD55F03FBAC4539533716159 c60/0
59,004,923 *064C35C2DC6CC8384617446F4961B5F98DAD89CF c;6wv
59,004,924 *064202C0737B7FE4194A6D23F4159EFB23EBF3F1 C9QC
59,004,925 *06459A6BD0ABC51EA9CC2C5BF227653B51ACE4E7 }'Caaa
59,004,926 *0647D28376E8DED89BC92782FDBAB6D3C970AAA2 «Caín
59,004,927 *064A7EAEB9B509A55CD8764025D2F5E9C1DA0358 «capítulos
59,004,928 *0648A84C1495E490300D45AF6CEA9F0862C6CE16 çarmanet
59,004,929 *064D42A2378B76812BECAD7900B234B2DC4863F1 çärşämbe
59,004,930 *06413174F03E3BF2339834B9BD575359C91E208F CB-A-E-MUS-CUBA-OBIT-ORAMAS
59,004,931 *06404B4A349184A44A3C256851908350D6928437 カルバリィ・C(C型)
59,004,932 *064F9535ADA42520127F03D9C655C31496D3DB15 Çefa
59,004,933 *064E981DCC50A50421E190D0EBDC696F608CC761 černigovietė
59,004,934 *0642CFADC95504ED1828BE766772BD17B71E21EB cgf3o
59,004,935 *0642C14A0AE198938FDFEC3073AD525E4E404C84 chained/chaostheory
59,004,936 *064E90BC17730E17900D4D3BCA63D6F19BC9E14F «champagne»
59,004,937 *064C17DBE66FCB5C8E4F50B9DDA21C4E143431F7 [email protected]
59,004,938 *064ACFF25F10066423D343ABEB40FBCCDE54E994 changliwang
59,004,939 *0646F835D05BA1429B2BCB5BF9654951C404ECEE «cheeky
59,004,940 *0642E468C7842E3ED901A4D483B30C7F402834C7 „Chicot
59,004,941 *064B7CB57D72C338901ED0235942CAB16254CD77 Chor:GratiasAgimusTibi
59,004,942 *06454269573C23F3439E24A18A619A55B5368FCB çıkarsamıştır
59,004,943 *064730E26F9E57FA9C427C6FADA0084E148D2EE6 “cimşit
59,004,944 *0646C2C7553D7082D1EB56BA17105633384CB570 c$jn
59,004,945 *0647F16062829BB794A66F4F737AAD911704FA31 cl"
59,004,946 *064BFFB8F5B7636CC58BC57C1F8D2E2D0A5B4408 CLIFF.MONCRIEF
59,004,947 *064DBF152CDA7C983BF3BD1F7507D480AB094FEE [email protected]
59,004,948 *0645BBF98DF77BD84253183CB7160078C386501F ‘Clouds’
59,004,949 *0648AE6FEF1390EEBF9653C43F6D4A04C66D2562 のCMの中で、男性タレントが起用される例は珍しい。
59,004,950 *0641CF6F5ED25A8D1AEF0C143AB10F44611D6868 CODY.SALLAZ
59,004,951 *0644D378535AE2EF4D85D0BC427B2A9F44BCE210 COEJV
59,004,952 *064DC7879D3BB9F4FE18A2A9C72A7E3A917627AD “conimbriga”
59,004,953 *0647A4F345FB31ED551925DCCB6E6C71F7F15DA1 čóši
59,004,954 *0645AE54D14457E5F55463E3FCD8B0CA706CC5E3 [email protected]
59,004,955 *064A6FC0DDAB2BEAEC9486E7FE61B66667DF21FA C:\PROGRAM-FILES\MICROSOFT-VISUAL-STUDIO-9.0\VC\VCWIZARDS\APPWIZ\MFC\APPLICATION\TEMPLATES\1033\MAKEHTMLHELP.BAT
59,004,956 *064286D8045F0FECD78687A74D7444311B31C4A9 c?qrq
59,004,957 *064EA64E6FE880F1428F0E66FF8F9E14EC5A0FA8 cranfranz
59,004,958 *064E314A6C85B800D0CE492097FF058FD7B2DC53 『CRぱちんこ必殺仕事人III
59,004,959 *06483728901FB28CB1E1EA01C990733EF4B2D16E „csíkvármegye
59,004,960 *064FF836C90F2512C027473D6403C26AD049CCE4 ct$1r
59,004,961 *064859C19E60621123A2F93E204F4003B1B8E876 |(;CT8T
59,004,962 *064FE0886B7C8CA677086F8FD74F4DBF3722F32B čtvtě
59,004,963 *064861D11A6AE89E253D1140FCB2648B63709B64 „curs”
59,004,964 *06445F74EB89C538D4199F8F99D6373BA50787FB CYBERLIE
59,004,965 *064218FCA207D13F7B70566DDC1B47729EA8A946 “cymhelliant
59,004,966 *0647CDB0822415A75AD555EA251D3420B56AE22E C|_Z
59,004,967 *064E3767A7CC3D664654267E95CBE79E0909734B D3MA!
59,004,968 *0644E9F344352963DB5208EBA9092E1D659171DC d5:pw
59,004,969 *064C5A27FCF0CE7932EE3F9015AD75C1131A270A d7ee
59,004,970 *06438390FA7B35B68C7A9E44DA8BFEF05C09EB50 đa mưu
59,004,971 *0649725BB99DA23B905CB65486B31D65550DD4D3 daniloshilts
59,004,972 *064BB322F84B0983C106FC81F2056070C05EA88C DANSE-HONGROISE-NO-5-EN-SOL-MINEUR:-ALLEGRO
59,004,973 *064C32E0D382255EC962DC1CCE9D562C6AFD1385 DAQV
59,004,974 *0647716EB9FEE402D07DEDBC3F3B6FB5EB6D1B0A DARIUS.CROUSER
59,004,975 *06407F11169F47A1F5ED73F1BCA2E0AF97F7B4A7 DARNELLSTANGEL
59,004,976 *06408E8FB5364ADD7667629794544836AAE67CE1 DARREN-BRADY
59,004,977 *064E348E96C215F569A4566FCDF5EC8A34AC9A7B [email protected]
59,004,978 *064C0A1B0C4634EB709A66D39262DE6DABC2BDFB “dato’”
59,004,979 *06491C410858699B4F70D33033BC8A4BEA807D46 DCO=
59,004,980 *0647BD06B3AD9F08C8F78E753907D68A81066AC9 !DE0L0G!CAL
59,004,981 *06424607038272AF584B8492F01979FB91D9F1D1 ”(decca
59,004,982 *064B7D7DC71C9FF3E3A76129DFA8AD1079C9310D DEIDANIAGARCIA
59,004,983 *0647043743BFD32FCA20088877B3D8242F9DC568 dejaneiro
59,004,984 *06485F65F7E9B0F398A3F298856593E27552C307 „Demokratiegefährdende
59,004,985 *06434B36E51209A9B8AF9727DDD3584C391BEF8F “depressing
59,004,986 *0645EF73FB450A8DE0C5A9F2D664D63B33B8B18D DESHAWN.MORNEAU
59,004,987 *064A037342DF784F26DE535ACB683B5632444D87 「devious
59,004,988 *064E6F54F908388023C0BB827B0317352940BBC0 «dial
59,004,989 *0643D96C234ACBB1707D3AE313CCEF8941698BF6 ‘didnt
59,004,990 *064E396ABD7E5F01F5D33FDCFED439F52318B4EA [email protected]
59,004,991 *0643A5537B88289AE2C0B280191B961361080BF8 D!K4T
59,004,992 *0646A8F5FFEABBE2AA99F27E87C022745116FA06 DK:W;
59,004,993 *064D4844D64E87BCEA737900321EC39243946FEA DLGPF
59,004,994 *0643F568C4D0BF480113CF121BFF97AA7E15521B dominiqueblackburn
59,004,995 *064C74AA728174BA9E238DFDEF17023E49B0D418 [email protected]
59,004,996 *064DC75D3DB84610DA5B72D36AB0B60210A3575A „dorfaue”
59,004,997 *06435775FFC8A6E7AFDC3D3EA3E84D34C57C832E «Dovevamo
59,004,998 *0647A7EB037822B3BF21FBB3EA00CF004D36A800 dqr.(
59,004,999 *0640EC9C078B5010FFFEAEFF66FD18F7CFD490EE DQTPU
59,005,000 *064B57A3C7BCFE141E388DA47A2A23CC3F4BBF79 [email protected]
59,005,001 *06487D5A60A5B29F8EF8E41A200E1F0299654091 drpk
59,005,002 *0643D8A0CEE9B9AFE8EAF473567AB181934E4F2C D)T4O
59,005,003 *064E1A5EFAB4D7859EC5745497B979DB018C3B60 dug(
59,005,004 *06425A91C05A0A7751ED168453957DBE913DFF11 «Dumt
59,005,005 *0640E94DF3444154A0F40EFE858BC9A4740401A7 「メタナイトでゴーdx」をクリアするとプレイ可能になる。グラフィックはsfc版のものをそのまま流用している。
59,005,006 *06418854F1821E98FF48B231815BA1A42E8033AD 「eb26‘宇宙戦艦ヤマト メカニック大図鑑2’」(バンダイ・1991)
59,005,007 *06441F96051656A43AFD93579A7CB1A54FFACD51 EDISONBERISHAJ
59,005,008 *064013AC7E574480DAFDF35486D790FA437F886F EDWARDWESSELMAN
59,005,009 *064B12953BC415E0856E77565B3BDC2407B7E208 ee8q
59,005,010 *064FCF4E67461CB10B6F7BD2488BB544A1DB80C4 egd%p
59,005,011 *06464DAC9DBDDEF23222A010144356F6773C9BDF égorgeât
59,005,012 *064BF7B96BA6EB2C873F3338C09F262C8D5A7430 EKATERAS8
59,005,013 *064836B1060A337B1B79EB06C798E5735CC9B16B ékdosi
59,005,014 *0647F8E7E3BC83DFAA50E6848139D3193E2D2E95 ELBISSUC
59,005,015 *064E2E45D926F5F428A060C30E94397B5771A550 『ELDORADO』(2009年)
59,005,016 *06401E69E0A214B29222CF6357D32139D112EABC Élinghen
59,005,017 *064EF6E963650330E10B83320506AE9E79960A59 ELISHARODDE
59,005,018 *064F246FA480C00F858F9EF5B1BB310430A0E8E1 とEliteXCミドル級タイトルマッチで対戦。左ストレートでダウンしたところを
59,005,019 *0641E90D98CF59C03A860C380D4B35DC32C4F7E6 ELOY.DUFF
59,005,020 *064197AFC9098312DDDEC6330C620F8397864B1F elrfu
59,005,021 *064A63874ABE25080E3EEA0F7DC6E406A21FD522 „elves
59,005,022 *064E0949DE9981E82952E9FC9BD6ECED1EA71647 ʀeːmaːgən
59,005,023 *064B4A100F27B8950EB163705084BF9527491883 (emilia)は、ヨーロッパ系の女性名。
59,005,024 *064AD7F524555BDC1915CF4AA764FDE593122AD0 EN71.52.34.102
59,005,025 *064C35532D8461EB2DCF284FD1E03727AF3469C8 “Enamorados
59,005,026 *064BBAAA51685C48A2826FF0B41E87EE475A357A encourront
59,005,027 *064BC80EE6E4D6570C6E118306E476D6014CFDAC EOHYAAAAMAAJ
59,005,028 *06476E97B79AF2FBE62B2029B71AF4277272E8C2 ēret
59,005,029 *06419A5F34D38EA44CCCC9D9B6D6683D560D7A90 „erk“
59,005,030 *064235DD79D28904A0069F4B65D5ABD7976C9BD1 erreurjean
59,005,031 *064C69004843496F05FF2E1656A82627F318BEE9 ”Essen
59,005,032 *06460F243D5B71E6C45C1D94ABD3203FDCFD470D étronçonnaient
59,005,033 *06433C4EBCAA044DA9DEDC071751F7E59D0C5D50 „Eustachius
59,005,034 *0641831CD34C0B3228F8F3F36ED66811FF73F247 (Executor
59,005,035 *0641035C7D5F7EDEBF3F945B44BA178EF68C7364 Ézsaunak
59,005,036 *064A6EBFC90D0D30303E6B296D358B0EA2AE15F5 „familienansluss“
59,005,037 *064288ED6E9B37609CCC12A06D84B76170B82191 (fifa)主催公認アジアコーチング・スクールを受講。
59,005,038 *064A57A2ED6E0F2FE0F74ED89154B5ED2BFF2274 「fns人気番組対抗!オールスタークイズ!!」
59,005,039 *0648A6581DF2E74F579B801C127B723AD8565831 «formación
59,005,040 *064B0E23D26FA635C53212DB079C8DF2B28F47B0 „franzosenschanze“
59,005,041 *06493C8B026A5ED2F356183E424914F24B5F1C4B FREDERICK MARTIN
59,005,042 *0644C8BD2B63ECFB8EF8C41C7AC42B5D4B2ACD15 FREDRICK.GILREATH
59,005,043 *0645760790A37AD9153BB888E58F55543DE9B152 „Freek
59,005,044 *064F8CDFD4C47C84C1CE4122CE1400CB06CC6810 ‘fuerza
59,005,045 *0642F39F30F52CAB5292328E869EF7CD780E0664 «garghuf»
59,005,046 *0644412BC5DAB1EAFD579CD8737CD1113D2C0B00 GARRY.MORIARTY
59,005,047 *064ADB8B778CA6131D5AC04D028B23B7D4769E0B GARY.WINTERHOLLER
59,005,048 *064848C7DDDC918468247DA6F61279D2C0A97613 gasgeschft
59,005,049 *064EEFB649F6B686B9EE1FA9C7EF952135A80C8D ĝenreto
59,005,050 *064E2B91FA868794AD81A244D1D12DAB1A3B51D3 ˈgɛorg
59,005,051 *064293FCA8A0A3DB3869B2E182B2148E13F21DA0 „Gerechtsame“
59,005,052 *064FEDDC79F3D4841EE3E59AA87A7F0BD01E44FF 『ggg』
59,005,053 *064023C5D27F6848AAC8B5897E0794FC5BE17EDC gin.guzman
59,005,054 *06444197EA9734553CDF1FBB3AD2D8D26CC07A8D チョコっとgive
59,005,055 *064E8D6BF5A9967825E1551C07DA72856A098A98 “Gladius”
59,005,056 *06402CE5D832EFCE80186E777C4022C472FA2A83 „glückseichen“
59,005,057 *0649BDABB95F573CE854FB1AE27DDA32D793E3DC „gołyš“
59,005,058 *0640E5DBE91E1F1E8014B2799A4E640CB22522A9 „Gotenland“
59,005,059 *06441BFF783BE5B759D435939618699EEB8B19B7 GRAFGÜNTZEL
59,005,060 *06489189D8E126AAAB63154EF7165126464F6EBB GRAHAM.ADKINSON
59,005,061 *064409E6FBF81E4B721830DE30909CC559B28BC1 GRASMICK1234
59,005,062 *0641DE2A25D27283AB32FE434ACF74B7929EC3D3 ǵrno
59,005,063 *064C1B1E32DB506FE5F4512E167DDBDDFA027E41 „gründe“
59,005,064 *064D912BC7B85ACCD9B4C37436498F0F99CC8329 „Guanabara”
59,005,065 *064B13A7A7DEC96162B4DEE2FC03F3527CD91C03 におけるHackbau程度であり、
59,005,066 *064835582CF06F0F980A6219D6DE2F9D194B1937 HALFOPERATIONFUNCT
59,005,067 *0644159FA4032CA988A39ED148AEFC6824CD8EF9 ‏Halsted
59,005,068 *06497E01723AADBF692D9C0A300A1D58810164FD harley.wong
59,005,069 *06441FFBC819F1707FEF3ACB3BC2931958391899 harveylato
59,005,070 *064987D8EF829F241CCFC8F33BD14A6036FB722C ḥasnī
59,005,071 *0645ECE1D88B01A90607D794B4B2CD1B4E2DEA74 heartdoctor
59,005,072 *06404A1FDF61F5AF2D1BEC15F1735BC5BD6CAA12 HERMANCLEATH
59,005,073 *06462B07CD3ABCD686A13219AF3CCE90CC1A5086 HEROESTEMPLATEMESOPO
59,005,074 *064E60661DD90D5053E84854543B971F839ECE5B „herumtreibender
59,005,075 *0646E9E23B0B4986136A0BF1D42A70EA5C9FA7E3 „Historico
59,005,076 *0646E079434B51246EA47C4CB781982BE2730378 “homaranoj”
59,005,077 *064C72D737298E27E7E8F8D9A4751391C5B485FF [email protected]
59,005,078 *0646C33E8309EF2B9F3AD7F745630DB0EABEB88D ちなみにhot☆fantasy
59,005,079 *0646A95B261DAD9996F8531E1C8B3354B31E5756 hoytbiro
59,005,080 *064F79C4A7787CF3F4A45ABB66A62702600B186E hq^k
59,005,081 *0640612CD0485878A4084F9563DBC4A1A2788A47 [email protected]
59,005,082 *064726CF30075E1279DC628A528EB67D5C15A22A [email protected]
59,005,083 *0649FA2C408D18197C294BDD2B367F7E32297672 HUSSAIN-JAHANGIR
59,005,084 *0647820EF3FFF33EC6B1D2E2E9103A6AD309DD75 „hustler“
59,005,085 *064B12517B00EFA261D5E6A822C8D3A2ECBA331D iamphoenix68
59,005,086 *064D0132ACC85F6F27F18ED9D901CBCB93545D70 ıbt
59,005,087 *0641735020D127B50E4456CE1F6FCE4FF92BC444 ”Ignatius
59,005,088 *064230121C2232A209DEE188ACF65D68D23E046F îlvvvî
59,005,089 *06410D383C3955EBD75DF175568AFD0C20A7CC3A Impudici
59,005,090 *06411068953AC9B92A09AC9C0BF01A1FC5E90B46 ※「inly」「vividrop」「nommo」から選曲されたベストアルバム的アルバム)
59,005,091 *0647D23962E739FAF22CCB9001B8C8D7F039AA89 „intelligenzmenge“
59,005,092 *0643F926F8A5F8F23FE087517187D5BBE8E9D376 IRĀKAM
59,005,093 *064177E897904DA2D18B7B804A60C1EB8E709C1B írnokképzésbe
59,005,094 *0649A9544D5A5950D228C54C46BBF0BE803F5144 „isonymum“
59,005,095 *06432424FAAC361E2C0BFC5F72E65CF9FC340C37 I've always wanted a suitcase handcuffed to my wrist
59,005,096 *06492E438DBAFF1F4A60600D963CC07B91F3C85B Îw
59,005,097 *064EB3984DB6CC4C1D7C447B0BAEA73696FC2315 JACQUESSNEDDEN
59,005,098 *064DFD9306BC76B5C01700874FD238C08ADD7069 JADEYLALA TAN
59,005,099 *064BBBAB47DB627D431360BED2F483D3C4D79474 JAELLESAGUIDO
59,005,100 *064648235715AF15491E5FBE432F273ECA02EA6D ‏jafari
59,005,101 *06487826D2634C27CF3137F4DFD7A2D09D996FDE jalissabond
59,005,102 *06440C5DF33F5518FCE39BF9D1B9BC29F53EF6C9 jangmi
59,005,103 *064B764A6F2E412145714DA0671795C476EE5E76 (jbqk)、放送開始(第1放送)。
59,005,104 *064AD3830979C8A842F2947E264A425C2AACDFD1 JEDPORTERA
59,005,105 *064A9251B2FF32F7C765AAEF91306EBB2ED51989 JEFFEREY.HAGGERTON
59,005,106 *064B75644285F5BDBC90FA50CC4E77738295B742 JEFFEREYOSTERLAND
59,005,107 *064F7C8118108B0E39D51DF4FD20447A4B87D77D jeffreylunasco
59,005,108 *064ECA249E0B8471A847F1C65531F337C44EB537 JEREMIAHBARTLOME
59,005,109 *064B995FA7485F0DFEF39F32007A228464DA6D50 jermainegenualdo
59,005,110 *064AC8B79C07F7188F3B595147767BE0BEF431DD „jertfele
59,005,111 *06434B2E655C28570351E0BE4C95E8DD45F9BBF6 [email protected]
59,005,112 *06458D097F70AD5F7A523C5E39CF3AF923BA9D87 [email protected]
59,005,113 *064F893C17217F9583ECA7B251D900D80C4649C4 jim.pilot
59,005,114 *0647E2BD40358F2D26EB2DBA02EB76140F9DB000 ひろ,Jisaki
59,005,115 *064B1C0899C73581C732EC134CA93294809712B8 JLPJJ73
59,005,116 *06476EA10CA36D895E4875F66B76B20CEF683DF9 JJS(JOHNNY
59,005,117 *06417B0E158D32AA6525B1A4F0E74283C4D498D8 «JonBenet
59,005,118 *064F8E4E124B9037D2D58BFA8C68C33EB1E76655 jralonzo
59,005,119 *0645A580E9754E989F58088B0A885777E5DB3E39 (JR西日本)では、
59,005,120 *064E2B17C18CD4E67F20593D20A385DBC9FC1055 ©kaa2004
59,005,121 *064110D87B642EC2381E3D410CE0BFE58A4D1156 kanond-dur(stringsorchestra)
59,005,122 *064993646B4E8FFEE415E449301AC30292901DAF kasiunia1
59,005,123 *0640F142308041CFAB6A477533F56D9A0A132206 KEENANANDREOTTI
59,005,124 *064E0A74E0BB6CE4D66FB74DCC187F27B4AF667E また、KEIRINグランプリシリーズにおける開催であるため、当競走の全10レース終了後の第11レースにそれぞれ、12月28日には
59,005,125 *0641871866EBEEED7B449CC24157570B96E51B5E “Kenai
59,005,126 *064FBD0D67748899FD5FEB00DD0F33389114DA6F KENDRA-OKELLEY
59,005,127 *064B18951C4160927D7BF6DFF5F69FD10C050A85 ken.kaz
59,005,128 *0642E17A8FDB10A620A7744D3F7784C5EBA76877 „kernschrott“
59,005,129 *0640C3DCE15F0D0E7E3F77E04BB45F8EFEFF880E (KGB)の非合法諜報部門、「S」局長を務め、特殊部隊
59,005,130 *064A572B28B9FEA17B06CD1EAD091569F0780169 kinneba
59,005,131 *064984F55AE504FE5D04D71A94A139AA6AC970F6 kirby-personnage
59,005,132 *06484A756F5EA702E948C74BE12DFB146CEB61BC „kiveling“
59,005,133 *06430BE6DEBB3D17EE463C55E698749F467082A8 „klarigitaj“
59,005,134 *064B62BA798E9DBFA0E0E51B0CE461EEEDC7BE8B „Krámy
59,005,135 *06424E98A6C9017922B598CA674E1C8E654973D3 KY)F
59,005,136 *06473D5554401D9AA6BD254BFC4ED82BEC30C411 ‘LA
59,005,137 *064D9A887154461099BC6BA79CF3F7EF8AEA92A4 LADYY2
59,005,138 *064C08A69D8266C70F1957CC0580ACB432C1F037 «lavoce
59,005,139 *06417AEF60E395BAD1208B1061FBBD6CB24BA722 łazikanty
59,005,140 *06445BEF7A3E0BDA03C50D74FB5C811D01A947DF LEMUELDAGER
59,005,141 *064F371FFFAA7F94ACD43E2AD90480F4316B7365 LEOBACH
59,005,142 *06475403FBEBBC67EEF7EC984E02C3F390AE62EF «Leodringas
59,005,143 *0644D943FC10AC5AC2636B7C3434B79DE86A9F2C «l’erreur
59,005,144 *0645B28F853E3F5CAF8BA0F3EBCD873705BB2E4F „letzlinger
59,005,145 *064850279E0991B1970244443DF30021B66DD5E4 «ligure
59,005,146 *0646E5AD6AA9D7B18F871CE3E529E58237F86EE8 língbā
59,005,147 *064EA6168C0E4184BA4036D719E55BE40A0CAB40 „líquido“
59,005,148 *064E2D03A44FF5ED1CC3B8F544116B5534FBD4AA [email protected]
59,005,149 *064D089749E2EEA3707EA7ED4E6981553CB54B07 ɡlʏkvʊnʃ
59,005,150 *064F8F2C9082D1C8B2C57B173C979B3EE5209D14 “Load
59,005,151 *064F7FF60E04E05EE43D9C1C48E15F7FE5F6E347 LX.U
59,005,152 *0645D6170A280EB3D7E90E4C94237D9EC9359666 ⌊⌊⌊⌊m7⌋⌋�
59,005,153 *064EAAB821978A0F454A7774CD9BD6A97E1AAE88 maãƒâ§
59,005,154 *064E85B3A080FC87DF53269825C7A171E266D423 „mainfränkischen
59,005,155 *0643BA4139D5B73B41AA138A818CFE66397D873E “Manuel
59,005,156 *0641197FD11C0384692A5D222A423344F19F2B31 markenvertriebspartner
59,005,157 *0641E1EE9BE8EE0BEE3C4EE12FD1579E6022824B markloveland
59,005,158 *0648BAC6DDA3E5953B045769D96B9150BE28DAD4 marlon.batlis
59,005,159 *06427FE3D7F8D3041FC1E4FE872B70604B95935C mary.gerrits
59,005,160 *06479E7531FD3A7438A9D1090A35C75A8928DCA1 [email protected]
59,005,161 *064A82C2A04A91F11B3E5A04895D1A8ED269A402 mashapon
59,005,162 *06499AB096B8B0C4A0A3256EFDF930D7BEAE78AB mavrídis
59,005,163 *06411E042A1D7B340949C8285A498CB015125A7C mayniels7
59,005,164 *064AFFA38FBA908231A1C07D1D12687812476ACD mehlbez
59,005,165 *064E818F91940FC0933B3BAD27EF14FB81778566 melisaann
59,005,166 *0642F86DF773EF949ED1560782DE6BB3C4547F74 merry-marry
59,005,167 *0643C8AADCFF1CD4D9C999320F5562CDEC2C76CF mid-1981
59,005,168 *06429E4942228FE771EDA0EFF96F90358AA5BB5F [email protected]
59,005,169 *0644D9CB69E177B3A2581605F0EFA954984FAFE3 milkovichlaura
59,005,170 *064A3FAAF1EF8B3FB7A90B389523F89E45C7DD88 milton.milosch
59,005,171 *064E0E00AA6FC2DDBA359E533B62A44A4103DFE1 mitchel.pinski
59,005,172 *064BD778F1D071A3B24B9007813B1BF3B6A17FB0 modesto.gudmundsson
59,005,173 *0649B40831F85961539C69C4C097780EF0422ED8 mollym:mollyg
59,005,174 *064AF0346714796FFE23C9FFDC156620E3633D5D monty.farrand
59,005,175 *06470EFC44EEB7EEC1AF38E12E490BE9279B7835 morheiu
59,005,176 *0640E78E00BAAA318E0F1BA3D4A3D20988FB4A4B msashaw
59,005,177 *0641566C7F360AD60715B087AD9E956BBE7C95C7 [email protected]
59,005,178 *0645C3F17FDC823767FE58E1D2B3ED00E713E691 mt"W
59,005,179 *0643972F98AD128C30376B490E53F55252B65CDA [email protected]
59,005,180 *064C3340F1406C009FA50F68A9D3FA82231B8178 myles singer
59,005,181 *064E1CC985C9508082EC95A68CA82F7E85574D08 naleeneu1234
59,005,182 *064F41F8FDA25B84DEF6E301CBF22262ACBD9837 napszó
59,005,183 *0644E3E9703A635A8A56F4EB0054E91895D447A0 nathaniel.facteau
59,005,184 *06412E366E7E29A0DBA4EA6493520149DE05D4B6 [email protected]
59,005,185 *064FA96B359B05D7CE9B93F0176837FAD6C778EA nevarya_
59,005,186 *06442CBCD305CE2ABCDA1AFF75E5E8C850048060 nevic4ti
59,005,187 *0645217A4CC7F66AE16269B47199FAF5F9076884 newcourttandy
59,005,188 *064C0DDCE450AC9AC38F4C95651ADD8461D9FF64 nhk全国のど自慢大会
59,005,189 *0644C82EA21D0DEADA3FC13490B6BD5F6B94E3CB nigel.brazzel
59,005,190 *06467BD38FBF738570FC81B67A7EA80ECA135F71 nisvano7
59,005,191 *064BBB6CDCD23212FBAB59E7BE5C7B8D2D1645D4 noah.pedulla
59,005,192 *0648B3EABA1598E3825D016FEAF2990670E37A84 nonsummo5
59,005,193 *064CBC1700FFABD8B8896E6B2D7FE65E890970FF nrltigged
59,005,194 *06465C9597592910C2A4E1657185BEB9D202AFBB nsoobramoney
59,005,195 *064E47B4316C1B5A080C9ED128C0BD2618852143 n}Sr
59,005,196 *064D6C7E668AF2C4BA2E5A744DA22556E24637E3 ntzanetopoulos
59,005,197 *064F2C5A8E9361FDF40905B7CE57FDDBF9AD0E99 o04728637
59,005,198 *064CABE37640937C1017B40FA2F33F61D84B8507 o0{u
59,005,199 *064A5D8AA56E09B22DAA9951DA8E249B0755EEAE ofigothen
59,005,200 *06459C640B5D259128570788F924E9F023C289E8 okoongebeharry
59,005,201 *06411FF22C327AB651406B1BD42143D32289613D olizaj
59,005,202 *064D3E982F8AE4310D995364580351E93C8555CB operation-omega-dawn
59,005,203 *06417797D54C747FA1EF3B165B0182C6821518EB }O{ `q======B
59,005,204 *064F09BF8D33BA00A157121EBFE2C25987577931 or!9!n4t3d
59,005,205 *064D0D34CEAE02E4FFE3979D5734A6878E740BB3 orange:apple
59,005,206 *064B8267DAE47CDFD9A3CF71EBED4F7D835C6E17 origins-other
59,005,207 *064C81EC96982926F3324C2214D70B0042F58145 orziizro6
59,005,208 *0647EAD3521F6F52DCF1022513F081906589F860 oswaldo.bolig
59,005,209 *0641F4438B82940A6EF55659177C796CF626414A padkvab
59,005,210 *06460B242DF9E587D0C38099E2C6B0DFD1953C37 pandektotyra
59,005,211 *064291539AF9F657207553C676F3C55E9785D249 pBxs
59,005,212 *0641F55BB3CEB20635A03380FBAE99193CF0517C pd-usgov-doc-noaanat
59,005,213 *06440C55203751776499EFAA3DFE1DE536D28454 pedrosalles
59,005,214 *06421716611E40A8FB03662CCCF2372CF9892B09 [email protected]
59,005,215 *064A48112453855461B5AB68A43D13C39A57A4B5 [email protected]
59,005,216 *0648273C29A5048421F6426BA3927493B9A39639 [email protected]
59,005,217 *064CF30E837D48F664C6A8D9823224D493E4E2A8 [email protected]
59,005,218 *064C9C14A399A0744C338F20B47117F90338563E percy.hertzler
59,005,219 *0640B4614082D870DC242FB0F1B57C424E7B89AA petecaspiel
59,005,220 *064CF7032E5718483E311A347C836C34BE3870D3 philip.goda
59,005,221 *064F9CBE3D4039A7F414E50A3F8C8AF94843418E philip.suttles
59,005,222 *064D944FD1E12914B8CCFE3463EFFF82632358F3 phil.klaass
59,005,223 *0649D18DA3A49816C9F2A089B356B2617CCFED58 phillip.kochkodin
59,005,224 *0646822E7EB84D99ACFB76FDDDA06F0F340478C4 physiological0
59,005,225 *0641F9A05712E81ADAEC27A8C6A0B3CA6BB099C8 pierre.raygoza
59,005,226 *06410958F8C00A573CC83B99D266EEA127230342 pierre.shulte
59,005,227 *0648009C4BB22B9AC845AC3BFB419E5B7056991A pîirt
59,005,228 *0645F3B228EAF4931567B97BF7E3E52BFD618FCB pmolesini
59,005,229 *0643186FF6F58B36E726B672D60C8458A6411BCB power-gas
59,005,230 *064A6496AFAB9207C29651AA13C3D794D634514A pp1759
59,005,231 *06491E87094AFCFAD427DF0DC23BB4E06FDA624E ppd »
59,005,232 *06435EA22D4110B9D1048675CADC614646D78557 protichodně
59,005,233 *06462A12FFF258E38C0A5FFB903BE2389C87D65C q;d$
59,005,234 *0647FF44C11235D2C93DA113B1405172867D1F62 [email protected]
59,005,235 *06451F5A1CF155D2C037CF485E86799E9A3B7496 quarm123
59,005,236 *064FA127FE4E6E88BACD448E57273A932AC12CE0 quinton.alexanders
59,005,237 *06433F88BFFFD50406F6A4D79FBF3862AD7BA8D8 r3mor3
59,005,238 *06417DC3048589F516C7D669CE7FBC6B1C9DC0D6 raisa08
59,005,239 *064736BB3EA1C37FA8FD64D7CA673C89881A7B02 raphael.batt
59,005,240 *064143D6ED74F5ADE923286B637434AC122C6FED ras alhaque
59,005,241 *0648F812EE6BF56D1516DF1CF7042947272A3DD2 ravenfox4
59,005,242 *06493708672BB539617FFE248D298547980063BA raygaudette
59,005,243 *0643784C89969876861A20082D88042FCAEB9967 raymond.parrish
59,005,244 *064155B19BA74A97811AFDF40F194431A62E1CAD rd1/
59,005,245 *064A95F5243FD188A8FDC8E062B40032918D5459 recuperane
59,005,246 *0647824A060F4B2BE0964206D08203A8A714FBCF redhotplanet.net
59,005,247 *0645555A8126602DAF3EB5F7D189AB9CD3948558 red-hybrid
59,005,248 *0648A413640BEDC5A6D2E525E719C915AB004462 rediskonteriN
59,005,249 *064184C1F8E3828E5110104756A753CCBE85741E rednalsJ
59,005,250 *06452D136219C6F29A36AE300ACADF02BD172843 redrummachas
59,005,251 *064E02F42F29920E75A5F86C8FFF21A77B57BFE2 reginald.sandell
59,005,252 *06443434E6A6CC08BE5161BABB308AE308AE3018 reimpregnateds7
59,005,253 *0646B747BBAF941F9A23F541E8358FF7C98A76A6 relebadi2
59,005,254 *064B67F159F1B09B39D0455B9FC81E2F008485BC remerciiez5
59,005,255 *064F5123D83544CC1583A57E8A01CEF17A09265B rene.leimberger
59,005,256 *064857840F1DB45CC2B510309F9AF04AB0034468 rigoberto.kye
59,005,257 *06482798B4B15E5740F2A0CDBD9EB7EEC2461726 risembrava8
59,005,258 *0645A493C02070A2F1D0AB840F206394D00102A8 rmrunner2001:rmrunner2001
59,005,259 *0640CD2C5955CAB182CC112A3670F2B2F06FCB6C roderick.winslett
59,005,260 *06439B93F0D6AD980E867A8858B667E657AB2267 rodrigo.plassman
59,005,261 *064D8E13F7616CB27DC66874806B9B8191A83566 rosebudsugar
59,005,262 *0641710C8550694C324A5D8D0EF168314A66F557 rotondite9
59,005,263 *064DCDE63180856E91A982E646996ED295A483C3 [email protected]
59,005,264 *06403D7E66416AEBFA13271E83BEB0962D7DDFBA royal.gentles
59,005,265 *0645E34F15C5E412DE8018118E55DE4004D74527 rq,/
59,005,266 *064DDB320E6DD84E50C236DB9F08E8717C87E060 rudolf.caliz
59,005,267 *064BD3A0D45C4EE763D291F42911D14F075E4BBD rudolph.awtry
59,005,268 *064E2AD37B6660C20344B7C41C203EB27CE52188 russ.wetherill
59,005,269 *064A68FAFFAC300E0321BC8EB54544DF3027611A s143664
59,005,270 *064F954D67596C051C81F24120979AE4DD07D540 sag5207
59,005,271 *064D8CB0FECD8EA239A0DF399FBADF69FA15B063 salmonredwing3
59,005,272 *0647A4EDB90F105D1912413147A69343A75F5BCE sam.dahood
59,005,273 *0640525E09B5679EC5A621AFEE8D56B3EA39F57A [email protected]
59,005,274 *064DBF6A06EDB7B7ED54B59FD4664F7190317600 sammiepenguin6
59,005,275 *06460FAEFE8DF2FD04F1995CCA773A4E09EC3996 sandippij
59,005,276 *0646C2D32231D28064927610E83E915AE9AF2105 santo.cholewinski
59,005,277 *064C8D410C94980CE3082CC8CD15E30B54EBE4A3 saturnhelpme6
59,005,278 *0644F03B72E537453B9C80FEEFE53E54B40AEE58 sbubillis1
59,005,279 *064879BF985F3D74E23CC128A5306A49CAA99FEC scarnite0
59,005,280 *0641F87D9DC4253E0762F513051B3D839C6ADA52 schacherbsW
59,005,281 *0644B19EC7C32CD3522A40BDB5BEA2C49770B6AE schlafstoerun5
59,005,282 *06441BE070B13788F4D83B36F6418EE0C3A6A88A scoobywatson4
59,005,283 *064C169203765279CF83FC2A30007A5A51257E16 scottie.salvemini
59,005,284 *064E5E9FBA3DA2823BF55AC1F1E5A8DE3DFD2F24 sean.sampayan
59,005,285 *064DE426CE4E0CAADF9F22064E01A11658A9A1DC seilamon9
59,005,286 *06478668368208A59B80A7AF152CBCD8D51A447F select live saxophone workshop
59,005,287 *06495CCC1E23094C4A49AA7B2AFD11F1CEC8A642 sémiamirique
59,005,288 *06493619A3EEF8DD7E808CE582476279042CB376 sendmewordto
59,005,289 *064F2B54ECF466A4064F5DD47207EA472FCE9F4C sextum.160
59,005,290 *064BE4CB32790CE5A7E38795BE6452EC11F9357F sezilabirteding
59,005,291 *0645CCFBDB0B89C3ABB42BE562587FE2FC615AE2 shane.callicott
59,005,292 *0641CD9C3056CAF067C7C7F0845948A85A804C87 shitheadmarketed
59,005,293 *064B1B79447F01D780C5C66B4727043AF400728D siaregnol9
59,005,294 *064F26C35166BCB11338364D005511342CD92496 sidneynat9
59,005,295 *064D100CE30F616FC87129EB393E1AA1A9702993 silverkan
59,005,296 *06489355A86D77F81B5215384B4E24DCE0CAF7A9 silverretards
59,005,297 *0641E8D6E4B720BDD22BD67AE9CAB0097BD76843 simon ibbotson
59,005,298 *064C05BC8F4CF3417CDDA5D305D2A4AEBA68A74E simonssssss2
59,005,299 *064C5ECF330D05518D93893E4FFABE37754F123F sjukepleier6
59,005,300 *0648B92EC93FEFF5FA7D8197F83B897CEA8A185D sm1wpfp1
59,005,301 *0645CA750BF5D2FBD802FC8240E60C401400C57B [email protected]
59,005,302 *064DC43F43A670359D7AED28436499BD062E7F31 sonderzing
59,005,303 *06414737D6FC66121151C9FC755CD3315D0EA126 [email protected]
59,005,304 *06419AD97E44B9DD2F690E52A6BF421AA5C554E3 soutangS
59,005,305 *06448ED643C9524D994267038F374DEF1E0B31E4 spädbarnsbio
59,005,306 *064DFEF9EC89BE843DBD4AE4DDFBFA8B6BA15A2E specialclass0
59,005,307 *06477445BD9520270D85DA8B7916C8F542644778 spierbeheersings
59,005,308 *064127BF64FE36DB2779772628219945AD43D970 spinulosas6
59,005,309 *06494848EB7CBFE921913B0FC5EDE23EE6788CC1 splat~ [email protected]#####8
59,005,310 *064D4FC055DC44B0DE6C194ADDB1F3C40BBEB09B strjdvrg8
59,005,311 *064ACA65A73219CE6182F71CEEA1F2EE0F825E34 štuřík
59,005,312 *06492073F734143FC2AA3A13988E57FD84FC8622 sUbspACE
59,005,313 *064E7CB5CF6DA6D506A1C635E30B5B80480FC6F2 suggereraen2
59,005,314 *064EEC9866601A67C067527C6B65DF47E4B4B38A superfijing
59,005,315 *0644872D2ED9EF3A9E1CD035C38F40514CE43340 supersensuousnesss6
59,005,316 *064B340CBC07B05BC019101DCFFBF549C7F6389B symphonyno.9indminor,op.125"choral":iv.allegroassai-r
59,005,317 *064E3EA9975EB0EC1B31305819C42F58FD2E5E39 talk116.22.170.223us
59,005,318 *0645FF9FAD42988B3D899C21E579A248B2067716 talk150.204.216.130
59,005,319 *06493D7272081516C473407140F7EB5A2CF8C4BE talkradarsh
59,005,320 *064D26E944160F576D057DB072AD2B105646955A tammynanny1234
59,005,321 *0646C2C59B25F376D8FFBA73CEEF63EDF90D3BD6 tc-svc
59,005,322 *0648BE446C8D27ECB3E8F3BF9294D8700832FD1B teleiwmenoy7
59,005,323 *064CABE0F03A577A0E06394DAE30AC59842543E2 teonhotty
59,005,324 *064BD47E09C51240D08500480600F8C6A0F3B495 terminologisch3
59,005,325 *0647C020C5A237EF85085BDA3115070A6D1E66D0 tfeeggew1
59,005,326 *0642BE377A0B9D2E890CEC011B859985CFD145E9 thaddeus.watford
59,005,327 *064AF2B00EBCA53C32B4D7419570CBAA18495357 thad.rigerman
59,005,328 *064540F35A4D99C7E3E9D971D5CAB07A3573B76B thanh.noxon
59,005,329 *064EBDD847D2819FC337CD8A705B167C4C2BC775 thatWORLD61
59,005,330 *064FF37B2DCFE90BF6F2AB47CB97056CF8C6D5BF thealpha177
59,005,331 *064E0CD0AB13C196AB956AA56F2203BB0C24ACDD the carousel suite / stonehenge
59,005,332 *064891807A8ED9A4F0AE9A31C17EBC2483F833F7 theCordelia88
59,005,333 *0641FB6159C9860CE1368732592C6ADC45AEF2B2 thedaywepaintedour303s
59,005,334 *0646C1DA0434837AB0C0EB3912919EC219780457 theodore.kersten
59,005,335 *064577AAE0FCD0E9DDE6FE3AA73049DD9FEEA92C theresacastro
59,005,336 *0644F42C61BC7198B4A04ADDEBBE7AF44BAA52D8 theVERMONT08
59,005,337 *0646F5AFA359AD621A69E7FC885CDA1D1F505093 tinacougar5
59,005,338 *064CE0B5A6391325076CECCEA072DB2EAF5DA0CB [email protected]
59,005,339 *06434BBC930D76857A287A17725796503321A73B tommypops
59,005,340 *0645ECF9E2B4890E9DAB1C32261F749F6635039F tom-pung
59,005,341 *06465331173513AEF15BE2940A8AB7F2D75505D4 tooktoomuch
59,005,342 *064D977C0CA9AD52506554E54A398402F5F328FC tracey.payno
59,005,343 *06413B423553B86AFF5285D7F5CFD258EC36036E tradaswasono
59,005,344 *0647BA6DB0DADF2ACCCB5B2B458224660E5B02C8 tragelaphtragelaph
59,005,345 *064C4711D03F8FC915B97C27CB2016E1B24748AC trasecol?
59,005,346 *064F8B9B73C70327B0312A5B81236D43285BF0BB tredin1:michael
59,005,347 *064033954EF3716D6CF457442796D4226100C5E9 trey.gasman
59,005,348 *064A7D90E11B802DFE348D2FAE8973F45D84F451 trinasvenningsen
59,005,349 *0640291D20EA0ABA276F6B606F28B12F68FA12CE tromperaisesing
59,005,350 *064C7A85128FCBB93A64DED4EB0028D0C03C7D88 trudymurry
59,005,351 *06401B1DB823249ED940085925C9A1540DD577C9 tuan.lewellen
59,005,352 *064415D281C17D68733263F06512E12ED6081CDB tumboon
59,005,353 *064FBF4BAE394DC7C7B9C31517F36D451F9A7672 tyree.pefferman
59,005,354 *064DB1B48E34259AA420D85675B7F1ABC7DC8C5E uebergeflossenes1
59,005,355 *06411403546FBE11553DA9BC8140F7A124912099 uilskuikensing
59,005,356 *064E7EE4B537609FF84AC208F1A6B6F7E99DB504 uraanimm6
59,005,357 *064E1D1F0EFAF63C81DCECDBAC08DD1BCB71C859 urzbache
59,005,358 *064E3E13204990EA435FF127E1174EC7EBFBBF3D uteliaiksied
59,005,359 *064E99668AE2E5446A003040767739EEEE18AEC3 uzomammuogbo
59,005,360 *064FAEBFECBC8DC5936762184A6FE64C3C5EBA5E v0000000009876
59,005,361 *0642CD582B6681E833AAA6635CBE421A9CE6356D valentin.baxtor
59,005,362 *064D792FAF8983F22A4295F526CBF5205188F269 valentinemongare
59,005,363 *0645BCBB021D037AB148C9C6DDB5E772854EBB15 valkyriego
59,005,364 *064B9DB121171CF7B2BD981465A383E2CFD2BE89 [email protected]
59,005,365 *06490E9C77A751F5BC7C446ADF2DF07D0FFE91F2 vickiloerzel
59,005,366 *06446AD071E7CB468ADB326F994AB07D2D93E49C vikki hummel
59,005,367 *0649C51B381D9181C81ADF2F340114C22414218D vincenzo.oestreicher
59,005,368 *064E3E18568097402F56AD07E94F60E49FC8F25A vinferi
59,005,369 *064EF8E3947518DC8136C17968375CB2F84DE2F8 vK88
59,005,370 *0646A9D408A25182423BAE405462B53F3BEE3DD6 v$kb
59,005,371 *0643C7E53818064BE6CA23CF68ED6DD8AB82DAF4 voluntarismolivia
59,005,372 *0645881C1AF1CB55F9627E1A945161CE224133A8 von.radeke
59,005,373 *06470C6AC6B3DB3E60EE563F613BACADA21517FE vythibsws
59,005,374 *0646B72D40B399D8FA16F19E05C8F7B14CC0498A wabsbasson
59,005,375 *0645B7DEBC85A203934116C7897E97C88D1CE3AD walter toribio
59,005,376 *064CD512CEAC6C21CEAC47954423E7437A3F585B walton.nydam
59,005,377 *064B7CB0174D604CC685432F2578B0AEFF1DDD4F warren.bridgens
59,005,378 *0645DB6227B7650FFC79846B73508B2AB6358900 weaponeva
59,005,379 *06498E3A3D76359BD716FAB0A19F510C856A451C wendysm
59,005,380 *064F5F1E99CE979687F09BF5152F1546C44217E8 wendyzurita
59,005,381 *064B47505887C9288E70DC499AE2E7CEBEC2D00A [email protected]
59,005,382 *064D34170CE46D7850D846AB3FC7853F3515CA8B weston.vall
59,005,383 *06436E390010F5EAFA8D4EA360A43065964B62F0 wigan-rs-logo
59,005,384 *064268C67472F7EB2925A5A70D5FAFCA02C937E1 willie.gennaria
59,005,385 *064B3CDB3B79319FA8C52E6FEE86CD6A553F0B87 winterana cortex
59,005,386 *06484CA5FBF8E0623171462C6086FE71567A36D2 wopytowarjow
59,005,387 *064D2BF3840526FF9C339E56815CF5A54137AD80 w%qt
59,005,388 *064BED2154ABC844E97612BDD226B5A374E514DA [email protected]
59,005,389 *064069857211F0884BF1140D8D85E16BF2319153 [email protected]
59,005,390 *064A4463BC1262A1C373CCC070CA8B378B9F4ACF wumeihan
59,005,391 *0647A89F4F51306AED47FCF818D5979AEB5D52D2 wunschstaat
59,005,392 *0643DB29CC61A31767A6FC104758ECD0744103C8 [email protected]
59,005,393 *064CDB4CFA6DE91BC652752EFC03D608C1C13198 www.cgvalve.net
59,005,394 *06493BE34B829F4B4593C9F25D78E8DD535E5367 [email protected]
59,005,395 *06489A649FFFAB0872830110006FAF4238CC1DFE [email protected]
59,005,396 *06487CE2C3E62AC722895B77744D8D46BBEC51F1 x.l9
59,005,397 *0647C98FCB0DC4B5D4F2AD459F3D194C00E3BDE5 [email protected]
59,005,398 *064E430D14F52AADB93198214C06F645094EA663 xu-gaowan
59,005,399 *064EDCD8C711BC92AFC4BBBC6C67AF4CFB1F9CBA y8<B
59,005,400 *064F3EB2893C2FC4DF0BA3C50C94A988822481F1 [email protected]
59,005,401 *06414211E6AAE04CCD16C65761F3FED8E90F1BCE yehladkahaiallah
59,005,402 *06423E523BF1F959645FA64B794E773A0F989FA9 ypogozelits
59,005,403 *06416573BBD7A389EBF15B09D5E950696898DB99 yshizurou
59,005,404 *06455B77E9EDE3022AF171D5990CFE8FA4C2BF43 [email protected]
59,005,405 *06431083A1C50035E7F1CD7A21AFB60C8E6220F1 yusufrana
59,005,406 *064450873140D5F3D72F4674118B4C3F5FA6CC53 yuyunliang
59,005,407 *064E811CA0260845F1127E361122C95AC9A611A6 zabiora7
59,005,408 *0649E66A60B0ED24F0B16BE7CFE08A29951F596D zachary.mossien
59,005,409 *064B09F3C6F46E60965B4F8252D1C89A576DBEA2 zach olvey
59,005,410 *064F6134345678303DC136F06848AD8ECA3E320C zack.litka
59,005,411 *064F8E20E47C8398254B6BD37A577F6D3116D1E8 zahdhanas
59,005,412 *064ACB3BAFF7D493476FAAA68376CA81D6761794 združeny
59,005,413 *06412598F6FF50B053A927DAE76AB2BB673A6549 [email protected]
59,005,414 *064ABA6FD319C1AFCB456E97057961BFDCE3444D [email protected]
59,005,415 *06410CE6350322C200AB4C7CF1BEB43365AE9770 zgodzie9
59,005,416 *0645CF1A455F83C404E3EF3E99C7ACCE4C4DA702 [email protected]
59,005,417 *064B83936752B7E2EDB535090853138BDFCB01F1 [email protected]
59,005,418 *0642EE8F33BA157A68D3B85B0A60135AC1CA7131 z]Pg
59,005,419 *0640DF42B381960C393CC542BB87C44BCB9555AE zsalihbegovic
59,005,420 *064F042B6A784E7F40A7B9EE419C673FCD5B8FD4 zwozili1
59,005,421 *064B087B61B99ED8A7F5EC53042F9B490DA9292E ὑπετάγησαν
59,005,422 *064F158751DA4BD998B9E1C42B57B2D79B531A63 Интензија
59,005,423 *06431AD3C4D9782059BBA7668537DC5D61FCFB80 Клайпедскага
59,005,424 *064F005DA0AD8DD34487772EC6144C6D1011F608 кленках
59,005,425 *06442807B8C905BBBD4DCEF2AFB9100E1DEEE071 понсунсан
59,005,426 *064A31174F7CDA6732CD77D046D0FADE32BBD405 тэатральная
59,005,427 *064FC490650DCE96030D5F270CF8FE5BAC33486B цитоплазмени
59,005,428 *064EB6F76CE500F150BC65C047DD0C3C90F9D6A1 1108516 niin-kuin-sanoin-,-ei-yksityist
59,005,429 *064B321BC2E06698810E2FC1E9BEC1BB97521C85 1183273 huolellinen.aineiston.valmistaminen.s
59,005,430 *0641A09B1A30C88F7FD87D6590E6ACB9FAD9FAB4 1287685 RAKEISILLA-SYYSLANNOITTEILLA-TAI-KASTELUVETEEN-LIS
59,005,431 *06448EAF61A4E717839750698CA621486946603B 145aryanna
59,005,432 *0641BF3EEC33C5A0EE57F5C0F199B7342CCB4878 156KARISSA
59,005,433 *064138A09605C8CEF5942297E892A57BDA896F58 1838257 DIE.MAENNER.WURDEN.AM.7...FEBRUAR.VERSCHLEPPT..
59,005,434 *064FD68F7E0ABB6CF28E3D83F457514E0EC2F4D1 1.buecherei-mitarbeiter
59,005,435 *064037FD95D74741078169A3B5AB633967E99526 1DJINN
59,005,436 *064B8234CF9780A21EEC65382282F83F4A425E39 1.duennfilm-solarzelle
59,005,437 *06474F11B089F93271F9BBCE95D24C86C3CC3EC6 1-friteusenbrandes
59,005,438 *064A32E1FE7F155D368765C80C0AEC390F6ACEEA 1GERDIRTIYOR
59,005,439 *064F4466739B96CBA35A79C353A454133C5976C1 1.levyty
59,005,440 *06410CDC6DAA428A8576C822109349C79C556999 1.mqm-vorsitzende
59,005,441 *064D987FD14564CB975627430948FB4DB7640ED6 1RST-TEHOPUTKET
59,005,442 *0649EEA98D242C9FEC6B9F2C3255FC011025A531 1SARIKOL
59,005,443 *06498817BDF4EDD3ECA99740ACBD9B2C414CAFD4 1-SIIRTOPOIKIEN
59,005,444 *064A974457741C5B89EA39A99D3DC3ADCEF7C0F2 1 TARIFFIVAIHTOEHDOISTA
59,005,445 *06494B27749A2086518AA592F37C76A84F869481 1 TEILZAHLUNGSVEREINBARUNG
59,005,446 *064ABBB45CE3EA530179A24B0B3F25169A10950B [email protected]+IONS
59,005,447 *064FD7575E5DDFF59E1F9334D82552F135D1BB15 2045538 EFFENBERG KEHRT NACH MUENCHEN ZURUECK
59,005,448 *06447660B7B301D09D160E58C1C085F9FB1F824F 208992 U-deGiSikliGinizi-Oncelikle-mail-yolu-ile-bildiriniz-
59,005,449 *064A3B8ED75FAC219C65B633AC9AB034588F0053 20KOMPLEKSY
59,005,450 *064058CAB7B69B72B5D1C385A004EC5D39E7D6EE 221208122816ak
59,005,451 *064DA707B4E6D4550BD43135F074A5064A5F56DB [email protected]
59,005,452 *064AD0AD238DB1E179C6E56B26E46FBEE5280576 2329841 TPSEIOLETEHNYTKAUDELLA01-02MAALIAKAANHAKAMETS
59,005,453 *0646219F2AA80FC4ED37154861E44859A389E714 2439392 MUISTATHAN,ETT
59,005,454 *064A33D89E3D5175337754063BE55738C1A9F723 2502388 MAARIT-KARI-M
59,005,455 *064A70D9ADE10FA9A9DC5E69FE7775A363A239AC 2.btypus
59,005,456 *0644CFC0D0E1BAE6E15793EEDF860D4CE8B26B6B 2ETAITONE
59,005,457 *064EF7F13297C2D0AD3A59B80AC27CA39A7E2CFD 2 FINAL-ENDRUNDE
59,005,458 *064404EC39FE6598D1B20689981409F75519AC59 2HEIDIME
59,005,459 *0647E0DE7E3748E79614D67CA990F2DE199CDEB8 2.JOSSITTELUA
59,005,460 *064B4BF18CFE226F4548AC858FA214331249667B 2-konzern-schwester
59,005,461 *064E59BAE334DEDFC9360264FED8EB359AFA77B8 2-MILLIARDEN-ZAHLUNGEN
59,005,462 *0648D7AA88BD7AA2162AF6C4BF689B4F3008159A 2OTOSIANA
59,005,463 *06496943466CBE544836056FFCE565C5686D7D56 2.SCHUBERTSCHER
59,005,464 *06495466FA4A973D36D527D4C5AC2CD04CF3416A 2SIBRIEN
59,005,465 *064956B9974307A0E42667ACB87D3E857B2EC3E7 2.spuks
59,005,466 *064B371E5CC9181B20EE8F9323C367C7B454BDAB 31.02.1066
59,005,467 *064BEE90BB3FE212C86B4BA82D8B9FF7A2E1E298 3KOPFNICKER
59,005,468 *06437827A19C12E686D4D77B37F9B7507FB7C53B 3-loppuvuosilta
59,005,469 *064BFEC6E9BEEC25A34BB2DA316C3A5C89899529 3##)*:p
59,005,470 *064E027ADB4DBBB328DECD96C547FC0A33BBC31E 3SETTICAS
59,005,471 *0641D475529FA148A883D5248F721FB4CB8EC14B 3UNT15QU3
59,005,472 *06491E8129715031EC8B5C78862C90A17D4D095B 44 duos for two violins, sz 98 - 19 a fairy tale
59,005,473 *064B5579E7F8E01FFDAAD71802376D3E796B27B4 4SHCALEES
59,005,474 *064479FDA50DEDBB4A6FFF2ABFEF94D7AA7D89A1 4UNGELERNT
59,005,475 *0642C4666E634335A829DE5BCBFF0D18438EA394 5AZIMUTALS
59,005,476 *0640D5035B2EB40B78BD3C8E106867DB00639507 5E032915
59,005,477 *064964AE02FC701B49B38C25EC75F1281268B5D5 [email protected]
59,005,478 *0645943F389414D176C08E13D12E4EC304B2ADDB 5GVOKASQHGFKAKBK
59,005,479 *0641C208F63ED5699C895D8ED6C48E01CE097069 5KLOSTEKLOSTE
59,005,480 *064F26982944406F04D043E6113CD287B2A2C0EF 5KREIRUAL
59,005,481 *064F2D5DB5AB8F8DDC1177064D5B5BDE4E71BF65 5MUGIRAIENTS
59,005,482 *06460548903C42E4EAC05EC4A74DAEC16F728EF4 5NNISNEIL
59,005,483 *06430BC299507C1F6FC80E5B1FB806A4A65074E3 5QUESTSNOOPDOG
59,005,484 *06454536D66D6DE3CEC1EA4EA314DE4EA8475186 5REFUGEE
59,005,485 *064226E4D61BD0E9E9CF6CD5BEC6F03654433C25 5SUORAPIM
59,005,486 *06475F65DA1CE64731081E900C561DA1F8298B61 5thevictoria2
59,005,487 *06445ADC16A4E8963452682CE194C902B46C9FE6 5UNDERHUDENS
59,005,488 *06449DF7FD24447E3669DDE8CD1EDF42FF84116E 64KIM1989
59,005,489 *0644A65010CD3C14618FD93018F91442C02002A9 6941SJ
59,005,490 *0644B220AF89105C291A8FA9C08928F740A82801 6LACKCOTO
59,005,491 *064F8F012F27B793C0EC4B3A2E0C3D0A203E9CE3 6MILESMADDOCK
59,005,492 *06410A5644851FAE129357F85F11D84502EB3D75 6NEMEPLJH
59,005,493 *064E9FAB9B01D1F60F8E25B027BBC0B4D3C6A3CA 6PEACEJAMAICA
59,005,494 *064C30855D118E4B3E33DC1139F9897C4D2BC7E3 706323 CALYCANTHUS CHINENSIS CHENG .
59,005,495 *06421B94D968D525CC69A92BE7F0690A354ED9A0 754350 THE COMPANY EXPECTS TO REPORT EARNINGS NOV 3
59,005,496 *0640EEBACFE8862C1C10BF8BDFC11B13D84DBA8E 7FORMUEOMSTNDIGHED
59,005,497 *064CFE164A6A958D2D61EA284A8B035AE0F7946E 7GEIRKNEN
59,005,498 *0649681CC1499D95F8719546EAC0B35726490A99 7IAMBLUEBIRD2
59,005,499 *064850EAB37C06E07B1B4279A5D1FE2E2C5F2090 7MICKEYPAMELA
59,005,500 *064EEEEB2AA111126AC382C284F007669A13316C 7PERUSVIRE
59,005,501 *0645B05B3BB20D8334FEF4F3434C6D3ECE68B297 7PISKUTANJU
59,005,502 *06450F19D0DE0F93D87DB99773934394EB73A318 857651 RAPORTISSA.KOROSTETAAN.,.ETT
59,005,503 *0648D411117E8EF0DC5AA7071C1066E2CC24F161 89KALLEKALLE
59,005,504 *06478D3B2194E02BD75CC3F75FDDC86B7205D9D6 8ALLIZOMMOCTENILACSATA
59,005,505 *0649D67851B1119BED701345D84A7A2CCBDBC2C2 8BSWLPFNOLDHOOKBSW
59,005,506 *0648DCE0CEF0E2BDC56C6C82C0C6E29DFB05F588 8DECEMBERANNE
59,005,507 *064EC21D99F04A5DB67ADD2A198C395A9C3187EE 8ENIVATTI
59,005,508 *064B2774676DC78E1336FA82A69E7FACED3A0813 8MROOTNAK
59,005,509 *064D802AB6BC528454C4516AB7B5B34EBB56AB35 8prosify
59,005,510 *06423461A0686D026B3A854045E347D410A07A25 9BOOGERASS
59,005,511 *0647C95735649BE0DD7AD6728432B0A59BB5D5C8 9c02e4de1131f931a15755c0a9669c8b63
59,005,512 *06430D5CC41ACCF255399CC73AC1F7C8FF44E018 9DETECT
59,005,513 *0648FB8594395AD57C4BE1E0029DAC16523C708E 9EEA9A77557D284A1007BB6065A6D7B7-NNHLJX
59,005,514 *064F851B5EFBEEA9B9057A07C8531A4375047F6A 9EKEITSUR
59,005,515 *0645E9DCDA685F5E663043B45C038BF7C12F0751 9ERXIRTAM
59,005,516 *064A916B2055CBD01C5478DA1286076F83B4E8D9 9FRANKFOUNTAIN
59,005,517 *06413D8C43CAC46CB36CA61C36E2FC153922AA3F 9GOCOUGSASTERIX
59,005,518 *06473D879A3A677E46D0AFD3A97CC8C7D304A9A3 9MGCAMITT
59,005,519 *0640E07E78C374B2AFF1C19D3ECC377813E07B97 9SIMBAHELP
59,005,520 *0645ECCD789B20509225B8072EAF3DB40320AAB6 9TAMMILLA
59,005,521 *064788B4650251CE352985CB52ED1C5A5FEF1421 A_2
59,005,522 *0644369E2F071B0DADE95141EF8C78362C61AD9E A:2u
59,005,523 *064F917F73C32600BCA5A0EF49C8734B7DB3F101 aaCr
59,005,524 *064F3DD5EEF3E58971F4F6EB7C03A452B76DB500 aad&C
59,005,525 *064643A3F418F0F0BE58BE6252E6DED17B2BF83F AARONHAMMONTREE
59,005,526 *0645DC5B586C114F4DC8583DD99D49865DE16C98 aaronmcardell
59,005,527 *0643856C8D08CA1DC547E0983F9936CCFCC11223 AB8R8
59,005,528 *0641F5594DFE907583DDB37AD332B10D315018EC ABEDSHALABI
59,005,529 *06436B0CF587D9DD0756B5168377F571B77C9AE2 aboriginally1
59,005,530 *0649301B567DB74387FF8E4F3C64C4630ED72D4E actl
59,005,531 *0640ED3411EE632B9544A599B52950FB35AA1AC4 AECIDIOSTAGEAECIDIOSTAGE
59,005,532 *06423C914A147E919089D5206C5A9EF5513C17E9 aeqlk
59,005,533 *064DDE992CB93DAADF7AED5028D7409E883190C8 AFRCV
59,005,534 *064D2783A660C41B7A20EFBD6D8E8A77EC428E33 a hor
59,005,535 *064D4219F7685D52CBA7E0603DE5868BD17C154C ahwfs
59,005,536 *064ADDBDA7FA6AA764A5B68BD98E988E5CEB61EF aillifa4
59,005,537 *064DC38CE7EFAFBF9099F628B915B98ED3443CDD aj3bk
59,005,538 *0644D966A24F24D5F02DE9A0FE2DD8DF4DCF4DC8 alcoholismch
59,005,539 *0643BA73939AEA2B7F35D0300CD98647EC2258FA ALHC
59,005,540 *064F68F0DEEFC928FEAB4089EF8041497C00AB0E allbounteous/O/l_'b/AU/nt/i//@/s
59,005,541 *0648160D86194A96EC3680A2906BC9C74E72F8E0 alsek
59,005,542 *064D40B9BBBCEDC8370DDB74240D1568FDE81520 AMMb
59,005,543 *064F2C7C203D0EDB293C494FEA0FB5F1AC5E6522 AMQCM
59,005,544 *06441E4C85AAEE23D176A895892903E498D5C547 [email protected]
59,005,545 *064B293509D4794922450F2A5C68D7EBFDE67CE1 anetteholm
59,005,546 *064CC427D9C682EE281334A2EE07B47EAB1CF325 annectent9
59,005,547 *064EBBF0D2DBA01CE08AE9DB9218348F222023F9 anvv8
59,005,548 *06437FB185D37A43AA633728D8B5EB69BC692598 ARETALK-TO-ME
59,005,549 *064724F722378DBB8373DF062207012A9B449AD3 ARIFIERA8
59,005,550 *064796383DF6F2517DC29B1C1299CA85C3454F1E as&)"
59,005,551 *064D0D09ECDF689C849D3B78781B149B7FBA0D31 ase$b
59,005,552 *06412E27CB91D40104D3A3CDE5009CF9724C5F04 ASHLEYUNDERLAND
59,005,553 *06496E9BC8AB53EB23FCE0722B2E05DB2737A83B a_sk
59,005,554 *064EDE8A94FA8C84DEFD4BC946B386430CB09F80 ateisuto9
59,005,555 *0641293B97224BC78B035C89AD956380DAE92386 AUGUSTPEON
59,005,556 *064D03A43B00AEBE32338380A53D938C46742D7D AUGUSTUSJESTES
59,005,557 *064CE4D11F5E4FC141363657CDE2D030446F049E AU&IK
59,005,558 *06498A8AE4ED282F1DAAAD2A793A21F51D6B555F AYHCATSOED
59,005,559 *0649116051A22479F9378141D5019EE90371B457 ayx.3
59,005,560 *064341C4341D5D14074B25679F334357DDB2E31D b/0=
59,005,561 *064A0FEB54EEB12A1F7DC05C8A046F91FB1A4FD2 >-b0.o~o~<==p
59,005,562 *064D3CD253704D2092D057C3D773F6F049E19081 B2HD0
59,005,563 *0640221A0CE9A34CB3415965DD93C78873FCB905 b5vr;
59,005,564 *064FF0A58D94AF67E2F4BF890DE1389129D5D511 B83u
59,005,565 *06456C869805E1B07A7759895F90E02A2AFAC930 BAILLIE0
59,005,566 *064DA5D08496B6AFC5910A0D5DF34FEE8C8C086A barrows
59,005,567 *064C69B66CFA3D66E1F6B1E88CA6D2F25809F931 bartonpiccillo
59,005,568 *064A7058DBCDA16C3068DDD44ADDADD9791C4027 BB2%N
59,005,569 *0644BB934C04EBCD3A63DF96FD52CF9C06343414 BCD
59,005,570 *0642DAF8DDCA5B3F10501F1D2495D83CCFC2AA2E b?da4
59,005,571 *064CF25DD5E51ADD0F1476625D7E0CB1828BC2B1 BE"9L
59,005,572 *0640A585206DD2486FD27D3CDD073E7395EED93B BELVINDA2
59,005,573 *064D3063469EF112B00D179416458C4AD70C4327 BEN/
59,005,574 *064D147B5D5941AABB77A02B893F3AD4CFCDDBD6 BERNIEEBERENZ
59,005,575 *064761973CA8C49FA381518F6FFCFBB9524036F9 bf4cb24de4423919a221d97bac420759
59,005,576 *064EB9B340B7DDC45BEDCF9AF66529D649FF29CC BG6Z1
59,005,577 *06477585DDD0BF19CB127680F4E867FF7DDF7FA7 bhm,=
59,005,578 *064BA4C09D434C05F3183266FD92841A80AE518C biel2
59,005,579 *064CFBF6D4B8A12CD381D72278DAF81E2F83464C BJNZK
59,005,580 *064726D9350E8C9888AA8839475CBE1F42445DE2 B:KP3
59,005,581 *064C10609E4FBE4A49F98073304993A84D063E81 BLOODBONL
59,005,582 *064855054135F561A91E0DDA8E9A302024253BA0 b=m"v
59,005,583 *06439CC6CD3FE6BBFF7D1740192099B9E53A0DF7 BN%$
59,005,584 *06421B64A1C4B71380DBE672A08AE98C7594C765 BNXDN
59,005,585 *064F2DD66FEF88DC8608A53113EC9FC538B81473 BO&C
59,005,586 *0647F8518B003528114C24B5D93223374F8A4A7B botschinsky's
59,005,587 *064464F2FD9FBC522A8824F22DBA214B874F1C0D brady.alleman
59,005,588 *0645CAC92A601F6D741FF9172762DFEDA8EE3E84 BRENTON.HEINICKE
59,005,589 *06477BDA324C6A506163FF819746F68F728ECAEC BRIDGEONTHERIVERKWAI-MAINTITLE
59,005,590 *064E92D565E31CADFB092DA4F5031B3AE6C68826 brittpetko
59,005,591 *0643E072D1D15FC8B36DD8518A052B3B7A0199C6 BRUSQUELY ROUGHLY
59,005,592 *0642BE671F235C2CCFF7DE1F2837746BAEB7B2AF bt?i.
59,005,593 *064EB9E1AE3AC728CC92B46C53ED05D300CC3A54 BT(Q
59,005,594 *064F37E8570A330287732ADE96B3F6488B7E916D BUDZISZEWSKIE
59,005,595 *06410BE6B75293EB2065D7E739930F80CA48D1DF BURH_
59,005,596 *0648B581190619732808FC4B21B810BC13EB185C CAROLYN
59,005,597 *0643AE32A7354B002D5B1F8234AD5AD390AF2D94 CARTRUCKSHOW
59,005,598 *06429872D2911938014C5E2991199E77CB871260 caseygaebler
59,005,599 *064241ED29CF3314D5C263E1194AA23F158DAB0B catalyst-veil
59,005,600 *064D80E1557BEDA4E8A4B597D27E15A3AF4C20BB [email protected]
59,005,601 *06452C6345C9BF589BE437C919A209D2D2980EDE cavcobsw0
59,005,602 *064B711FDF27A6AEE0DC6AD00F2271829821D739 cb9mb
59,005,603 *064508D255DB4D5EEED45D50A3B46EEDB5DF7896 CHASPOPHAM
59,005,604 *064CD9CE1694BC23ECCC8E6207152C8E8B68CE45 CHAVEZ97
59,005,605 *064E8C42847E981EEFCE79518FF3C2A4FA9BE4EB CHENSENFEI
59,005,606 *0640F52CF5FAB30E4DF22DF0A0FF00CA0FB3AAA4 CHHM
59,005,607 *064384A79692DD7DD7B6C084C8F406EFA6400A76 choraulaed
59,005,608 *064F0BD25BA367A0184E46A41F7214CC3A925791 CINNAMON-SWIRL
59,005,609 *064480FBE10B5CC1556BDA05ABCE08EDA9DF5B84 CJ6_B
59,005,610 *0647A7F325AC410701888CE8AE566DBAC32C149C CkI
59,005,611 *064D4181BF37A674332D0C116C3B16149F42AC7E [email protected]
59,005,612 *0644031C22988987F8B06F42BE54F511EB4D1782 clawn
59,005,613 *064E5C3BFC41C354A3F245FF6474DB5B0565FFCE CLETUSCLAUGHTON
59,005,614 *06489E86C62B95C4CA6373EC7C7637655E1F8BDD cletusschwanebeck
59,005,615 *064F2797DB2D0472F0AF351104D7F9FE17F8FAF7 clhp7
59,005,616 *064847693247FA8BBCD41C24D6BD18E19956E7F9 cliftongarding
59,005,617 *06438FF1C1382CAB224C4B01E56661863EC7D96D clm4
59,005,618 *064F38315D54B2D2F30A511111720360C132F3FA C;m5
59,005,619 *064F09F1BF76BB78A8F274155ABEF6A2B1D16790 co4rs3h4
59,005,620 *064113BBC9B7B681DBE73AE3EE32580AE1B6A7EF colbygilder
59,005,621 *064398DC2BF9E8EADCE39DBD96E042D956AFA67E colbyrepka
59,005,622 *06412DB6844A3E2E19404FD81736256C5AAD7153 ナナオのCOLLEGE
59,005,623 *0649AC545DC926202080929FB88C5E4B0C277049 [email protected]$h1p
59,005,624 *064E3B2338D9BEF4A9434BE5BCB5304F20F80D3F control-freaky
59,005,625 *06418CC16052DCE1857E4B36A7D7A8FFFEAEA54C COOTTES3
59,005,626 *064007E577CDE64C756EDED381B0BEDE68AF67C6 coreybenge
59,005,627 *06441925A7904D5CDB07D335F91A447849972EA3 CORTEZ.CULLOP
59,005,628 *064F2D63AE1523DDAF27BF10BB56508FCE87A8BC co;s
59,005,629 *06482F5BA69B1539AC6F59CBB99413C4C36F8CF5 CQEQ"
59,005,630 *064122615E8DC5F377FD55F219932685BDB86BE8 cruzmarples
59,005,631 *06448148FA9E826992E068DDEC45F3D0DB8655ED cs+bm
59,005,632 *064EBBDBC1D5B3011A62DE38ADC547275FE7629D CSF(B
59,005,633 *064998E8BEFFC3B5FED4BAA20EF53D387D9D1303 cug/f
59,005,634 *064EBF82258728AD55B439FE4FD8C079CD9DC69B c$urm
59,005,635 *0644B62378D5FEFC4D82A20FE4EE198CF4B4C1F6 curtismagpuri
59,005,636 *0649C91E50C7A622989C9849EB69FF788A08C5F9 C"-UT
59,005,637 *064FC4D27C736118CAC336947B4A7FACC451183F cwl4p
59,005,638 *0646C4A8B743CBC2E3F1411A26A3499752AABB75 d5(8o
59,005,639 *06426D8ED49DB6AC56F93EC3C393FD6CCB586ADE D6B9L
59,005,640 *0643493CC5FFCBFA774FB4BCF5E65C4F107173DC DALLASMETH
59,005,641 *0643B4FA821AC473818F6C5581AB9A4277CBFF91 daltondimarzio
59,005,642 *06491503F33C857A8E347EB07F366928DDB1B54D DAMON.HERA
59,005,643 *0649CC795CAC73AE7D88C799EA3B159AB68FFBCF danielle-wroten
59,005,644 *06498518E8A3F7E73D4B0FB33563D51BF22D64F2 DARREL.ROBIDEAU
59,005,645 *064CA7461C86E20AE9ED5E3FBD15FAEA1DFD2C2D darrendonn
59,005,646 *0644B20C672E75A90E61431214CF3E97D9350567 DATENVER6
59,005,647 *064F8E9D72B607CB375D61B8A418970CA934EBD2 davefido
59,005,648 *064E7DB27DA4E18170794932A7B117957666E192 DAVID.OMOLO
59,005,649 *064AB492CAE9DAF21F3EDC517059A1D481B28FCE d(d#$
59,005,650 *0648BB34FE4950B7F8697D73A14DA46174B19BD4 DDN
59,005,651 *064AF9B38ED81C5F87296BB26DD56D45EE160C8D DEATHPAPA8
59,005,652 *064AFD4A1E92378535A4559B6612C17E687E6698 DEBLOQUAIT!
59,005,653 *06408401405D162FE3006AE6CDC339631175FA3B depeuplee
59,005,654 *0640449E84807F5ADFCFB8327A5BC5A397843024 “DEVRIM”
59,005,655 *0643E9C61206C38EA784ED443C5BBF79766EA4F2 DEWAYNEKIESZ
59,005,656 *064DE52673A0C0621F1FD5532BD7293A66EE4675 DEZTYNIH
59,005,657 *06412A27FF315EA9889CB9D840553506B7E03F59 DFEP+
59,005,658 *06418F0D80441C0DE572B2C6A9886E17E8D90520 D=H%V
59,005,659 *06447460D612A29E3E1288E92F0D101546110D0B digicell8
59,005,660 *064A690266F9A380A71EB99829CCE98D715CE51D DION DONNELL
59,005,661 *064BB6E0ACE7C8C7035073D2E93959A3391258E2 disquiparant!
59,005,662 *0646FA51A257C118B1DF42817D629D75E1D0A96E d+kho
59,005,663 *064317D39611AE63A754DA311BA62FD862ED6291 DN;SR
59,005,664 *06417AC2E32D5A09269D2BD78A22FBCFC7846674 don!
59,005,665 *064AE6262C7F66A027C9CCFD7A3E68AAD92499C3 dongkology
59,005,666 *064811670C6D99EDCBDD4B21504B63ACEDE48FAA DONNELL.GOULDEN
59,005,667 *0646F5CF57449D97B100835478925519143C1806 DOPHYNI5
59,005,668 *064638B832ED1808504AF554BD063E14CC1BD9B0 DOUGCRISMAN
59,005,669 *0642228FC2107F7BC776B748932EAF6C92E20554 DOUG.JEPHSON
59,005,670 *064F7B9E3BAE097EB276BBCCA0210B4C5092E80B D%OV&
59,005,671 *064616829FD4BCB30FA460980370A2EA294C290D d+quh
59,005,672 *064B80A6403E122BF27457D65F4DC85D65DBE888 drschill'searspray
59,005,673 *0642D2A9FF264302F93EFDA0C43222C3AFA22CF7 DRVH,
59,005,674 *06424E441B5A841AE1A1441C547C07C64FEB5379 DSR1Q
59,005,675 *0649A4CE667EA9946927AAA5125FD65A669564C0 dtu"a
59,005,676 *064A5A8023FCA0ECABB570FBAD7FCE51897B2139 DU"Q
59,005,677 *0647CBA86C7FC7E3AB0B403476D7BF66D6BD6C8E d(uwi
59,005,678 *064847741B1A0A5C6CE8280E7FCEDBA78E19D7D3 d"v"
59,005,679 *0640E98CE4E74CF81842F94129A4435966BEA862 DWIGHT.BRENDEN
59,005,680 *06463FC6B25300C1E7FBE655934854741D4F588C DYKSPTW6
59,005,681 *06402F51317B0A57382692BF6F1B431FF32E1787 [email protected]
59,005,682 *064106A94A9C0A061609C84B5E89B2CB2C8670BC EARL.BREITBACH
59,005,683 *0647D6C2C223D369C0932A7DBC834BF2F76E927B EC.F$
59,005,684 *06492931242D96D9F401500AA64EFA8F9C6957BD EDGAR.SCARIANO
59,005,685 *06426BBD7D4E426D8FECFDFFAE7163869781001D EDICTERENT7
59,005,686 *06461EC798DA6741F25582163EAF9B240F68D448 ELBERTORIE
59,005,687 *064FAA4976B86365CDB4F0A786FE932857DF3B51 ellie-barratt
59,005,688 *064227DD22488AF741B2D3753DEA15FD0328E575 ELOYKARREN
59,005,689 *064EF22F79ECD43313A12B58AE53D96F3ADD3BFB [email protected]
59,005,690 *06499B1F0B44D2D319DF4F087A66DC3F5BA4EBCD ELVIN.HOTRUM
59,005,691 *0641E1F0E6BE23CDE631BE7681F40F9E7599C67A elwyona8
59,005,692 *064393DD144BD84AC6C77445E7EDE40F931E0A4D EMBUN PAGI
59,005,693 *064984926314AE206E137DD7C79B51AB152BAF75 EMERY.LITWILER
59,005,694 *0644B5E50F4B7C1187F7605ABC8B3AC3892C38F0 EMMITTANTONIA
59,005,695 *0644B22572B583110F3CA44C0FDB43D51C52B420 en7o!1s
59,005,696 *0644930C2A60F42EB7DC7CC932FCA34D54E93963 ENPRISMA
59,005,697 *0641BF36D78CEFA753F769610326B0FBC3AE157F ENQUADRAMENTO1234
59,005,698 *064E5F774C3CF7DD5746BBD639182BFD3550F099 ENTITLEDW
59,005,699 *0640F4EFD0A8F8845DA71BEDC098DA68B26B10DE [email protected]
59,005,700 *064D616C9FD2EEEFA11A65A5B1489E4996FB07B6 erichdomebo
59,005,701 *06436B296DC34E21F4F620AA521C32EE3FB0D4FD ERICMULLIN
59,005,702 *0641DF4C68E5710159C08919D2FFC514A9D142BA ERNEST.DIONISIO
59,005,703 *0647F9A736E72B2D3C8A4D6E43B4BC4E7292CAA1 ERROLCASTENANOS
59,005,704 *064053FEF812230EEAF8D497598EC657BAD0F230 erwinbarrette
59,005,705 *06437455BA315447161538215803CD974602E6A2 ESASÊ
59,005,706 *0642FB48B34DA6E02A9EFE82A670B312E9C5BCBD ETHAN.JANNUSCH
59,005,707 *064734C8E8333DE827779CBB37974B1D7D8587F1 ettk"
59,005,708 *064B0FF8762A960F54D6CB63381E1D71C9B80BEF etutgart8
59,005,709 *0643431B90338E3029D9BBD0FC151C7EEAF0EBB5 EVERETTE.KONICEK
59,005,710 *06495909043466B369E395F927F0DB22D85504DF EX7OR7!ON
59,005,711 *06431CAA4975FBD7DA427926467F01E8DED6D559 ezinatet0
59,005,712 *064EC8EB9EA1F4D79510D0AB74A243A5A4696FBC [email protected]
59,005,713 *064DC23A3C695A31D126EA2EF09DFA1B325CA9B8 (featomaraportuondo)
59,005,714 *064B42E2839F9E5496D9D085FDD8E92286828BA2 federalness0
59,005,715 *064FE19C39428825FE276B7ED6511A2C0D398566 FILMWARE
59,005,716 *06496A4F1755B0B7517092FBBFE847FB6915848E FLAKESJ3
59,005,717 *06469BAF19EF18B8B561E1A7B7A73D44A16DD237 FORAYED
59,005,718 *064D8877678BE4B38D51D94AB0A7474C1C04456C FORMTOVM0
59,005,719 *06445F5C8E87EAF8FE79033ED365244118F12016 fpu-2-0
59,005,720 *06434E81178B03336AF7ADBD9DFE1E6E1E74D2F3 francescocourcy
59,005,721 *0648E7FE776ADBAC322B87793BCB8897EF39D045 franciskenniston
59,005,722 *0644EC6BFCB9D7878F09B94D3C9DAB088E8B7332 FRANKLINPOTOLSKY
59,005,723 *064DF4B8F3276CAF1CA22CF80894CA44C5FB9608 FRANKSINATRA,DEANMARTIN,BINGCROSBY,SAMMYCAHN&SONNYBURKE
59,005,724 *0641B503073048738742EDB7508B0372D9996EA7 franny
59,005,725 *06445933A34E7DF45C9155CEFDEA9F92B0C28CA4 FREEMANFORBER
59,005,726 *064A82BC7AA08F45B333DCF569F18A62F910A798 freeunio4
59,005,727 *064D270C6DAC3DA8DDF42C83E1171FA9C5A48FE9 FRITZ.CLOTHEY
59,005,728 *0646B6011A5C4082F68D63EEDE22B3C7FC11A915 [email protected]
59,005,729 *064C403DCDD6F1DC764A98E0CEA9BFC22A12EBAC fuck-the-faggot
59,005,730 *064835872D7E3E26E7C4402395C30E8B6617A4A4 FURCHIT
59,005,731 *064DA354D80F0A492614EB544AAD6E66AFBF10D3 G7]R
59,005,732 *0648FA8A6B4751EA5EFFEF66D39B6E605C4B916F GE1>
59,005,733 *064301CA902CFE5075E25711582CCB48FFA64C9E GEORGE.RHOADS
59,005,734 *064A04CE8D0B24907A382BF83B33744E18979188 GERARD.OFLAHERTY
59,005,735 *064F65024BAB00F13C8FA83502B3E5F8B6326DC7 getcarter
59,005,736 *064B1C78DE51AAF3BD6DCEC3E36F53049873BDCF GETOORND2
59,005,737 *0649CBD6ED42BFA4EAA147F971B899E8F55468D7 GINEVRE7
59,005,738 *064F19A3C82F564F846019EEF74D9F57E79424EA GNULLEUF6
59,005,739 *0649B7FFFD6FCDA52C0DC4BC41ED8497AF8536B4 GOBLETDRUMSTHROUGHHISTORY
59,005,740 *064117A4FE633DF70E57E873108F21A7DC5E559A golferrachel
59,005,741 *0641EEA2451A31DFC6EDE2F6535B741F216C17A6 [email protected]
59,005,742 *0647BBFEC09B340A1D95F982A4F87E60601DF5F9 GRANACCIGIRALAMO
59,005,743 *06411D3B7E7EA7A29D2AEE1DCE6A568ED86CB7DB GRANDESHOMENSDOMEUTEMPOERON
59,005,744 *06494543247EC243C6E324205787109DB204D1B7 GUMAREYS
59,005,745 *0643C14F6C5DB9EE64A51BC46849B2DB6A535B7A GUSTAVO VAQUERANO
59,005,746 *064BBC7CD968CF5D4BAA052A0F9EFFC1F3927318 GUYTROTTIER
59,005,747 *064C75E36DB6C913C38CB35DC771159164828BA4 GZHU1997
59,005,748 *06467854A2E33844C742E6369A67210DD0BF418A [email protected]!N5
59,005,749 *0647EAFBE50CC6A6956D133807D06BE09C2CA457 halstricklin
59,005,750 *06416C7649A1323EF286B15D1E03B5DBFABC0D35 hanspittsenbarger
59,005,751 *0643C72B7CD9B67EC14D0F2B482FD2D20A5D63DB HARLEYACEE
59,005,752 *06433C644B09D13C4D37E3375A824EA6F1F0178F [email protected]
59,005,753 *064E1AFB7F306354991C7733C4F893BBCF8CF9B4 HBUMGARDEN
59,005,754 *064B36BB7658E179487298C1DA529A411F4778D3 HEADINGJOINT
59,005,755 *064C4C3A64D38CCDBB8AE34B9AEC926DD5C7CABE HEFEL
59,005,756 *064D5B81B675A6FBCADD2BC314EE7D82D7751AB7 henrychounlapane
59,005,757 *06418D8CA8F94846CC0E69F1954EB1ED2D18ECDF HERNELL2
59,005,758 *06497FDDE8B76E903D4A96E4A974BB37AB02EB85 [email protected]
59,005,759 *064FC8566E6A8BF6DE761B5A9004FEE63497A5F7 hipposystems
59,005,760 *064CF890BAA746A8C738830D7F83755D74F49B0D HIRAKJYOTIA
59,005,761 *06499FCEB58AA008DA0CE4480D561ED7C70639B0 HLMX
59,005,762 *064CF72C681074DC85E7AE1BEAF35C50CA5E8A8D ht0
59,005,763 *064E841419CCB6E2162B96E23490E3DE2A24066F HUESERA0
59,005,764 *064D1A327172778B467F2268DCA06D8275C5D3BD I133427
59,005,765 *06448605F89EF306A597E5D60B5ECA38BE48C6E1 I18071993
59,005,766 *064884FDE379A19AB1F2A361771E2409A4F8AC0A I61907
59,005,767 *06400C0FFA7D91EB70EDF556B033E8AC36DC322A iamskipper60
59,005,768 *064712397AB2A7BC573A5E6E682092E17EE6488D [email protected]
59,005,769 *064AB570F1C91A41C5B985BD1FCCC8E0E7685F02 IFIHADKNOWTHISBEFORE(WESTBAMREMIX)
59,005,770 *0646F7D4E0878884400827329B5F74341502C888 IHSOTIAD4
59,005,771 *064DE9F7369EFC6375205D9D821C5134132812E8 IKE.FRESQUEZ
59,005,772 *064ABAAA0BFE2C41B539825249CA0A1CF6B99BE6 ILOVEEASTER25
59,005,773 *06440B92ECAAE946650560F10B8ABDD25C14DD21 IM4GIN4+IVE
59,005,774 *064FE6F4842893F85916BDC21EE1C00E2880227B informix-
59,005,775 *06415ACD1325CDF4E73F2A46B90FFF390822C04A INTRAMEDULLARY7
59,005,776 *06450CF4B43EBF9B2C2F43DE16A9BA571AF435E2 IRVINGSPIEGLER
59,005,777 *064E2B04040C0A907CE6C8B485853C5D8151624A isopmop6
59,005,778 *064C4C431633C013C08DA036DE93F0EA85678965 isselac
59,005,779 *064B2AE314D52971D02EBFDFF0C7124885193730 JACKSTRAW:ROSEBUD
59,005,780 *064DD7DE02C2838B54F1F86747B92F4085AE6778 jaka-ria
59,005,781 *064B698D77E0E2934172961B05EB36D94AC42236 jakegerguson
59,005,782 *06401E658215B8D9D5FF6B27CEAD28051E9C274E JAMES.JUKES
59,005,783 *06491BBCC6DF65AE4D1D3E0D8EFBF25F3DF568EC JĀṆḌĀRA
59,005,784 *0645543CAD0495B4B3B04393D629CFE034ECD954 [email protected]
59,005,785 *0647E9E579B215EC1864AED07E462716993E90DE jcrussell
59,005,786 *064E5F87B20BF8E11BBF3E9CE4A4DEF79CF158E1 [email protected]
59,005,787 *064A4E030C45721010D8A6D3FEC32F29FE508434 JENNIFER-PASCUA
59,005,788 *064B682695D8FCFEA02C87713D1ADFD969866470 jerell12
59,005,789 *06473F66825D0EC29CB9959DE54D993DE7CE53CE JERKN$
59,005,790 *06472553099A9954020C05F7767EDBFCE3C9E1C4 jeromebacon
59,005,791 *06477361520537735DCEE675C0FCC9C6D2010B1A jesse.whyte
59,005,792 *0649969D03BCBC5FAEB3008E79BAEC712151E699 [email protected]
59,005,793 *0641A45FA098B1D82F20FAE367E79517C2E96289 [email protected]
59,005,794 *0641912A1A134F950CA102EEFB200375284CF8D8 JL\I
59,005,795 *0640223AEC5E350121BD4C2F5EA87EEF8CF376DE joerouth
59,005,796 *06485B6A37C9F4421BA995604FD9A5E61EFE1445 JONAS.VEATCH
59,005,797 *064D47F7D309EFC9397D7EDFC3DF9CCF0E69740E JONATHANTANNER
59,005,798 *0646160C4F8982D9A8B51CC429103D842D7EE8B1 JSARNAS
59,005,799 *064DD91842E098E71A33D8E1866A0B28CF0681C7 J%SV
59,005,800 *064F4B8A98856721F718C6342F21D076CDEA475F JULIAN.RINI
59,005,801 *06404CC6BA1785AD5D714E4FD05D9D3658BA7E61 julia.walmsley
59,005,802 *064D0BA55E27905DEA4F5EBDCEE5610B4FF06BCB JUNKIERSKIE
59,005,803 *064805451A14C7017BB04FB9BC2A06D4A210451F k2?~
59,005,804 *0645A513695EE6D4154FE811C8E62BFF4F457AEB KATYMCGUIGAN
59,005,805 *064E753C332309B94E92D7E2AA828EBF3EC6F659 k\c
59,005,806 *064ABFC6C0E20610265C0BC7DA96F6CEA031F369 [email protected]
59,005,807 *0643740CE80A0006FE3C7CA52C364B9EA5175B6C KERRY GOOLD
59,005,808 *064002284F345C19B23F88B57EF415F07977597E khadeejakhan
59,005,809 *064FD8D5BD9F5F80E4D329D02F07F3C5656D77DA kilistra
59,005,810 *0643B6CDDDB4D48156E5B399B0837D30A5EA0B66 [email protected]
59,005,811 *064BCC42EB38A69D94C22D22B1D465899C5D26CC Kleine-Anita
59,005,812 *064863955D28E43B1CE189A9E0AF50816785618C KLEMAN1
59,005,813 *06473583A8DF23C14B068DF2CCD6D4255A765772 kocakurt
59,005,814 *06481AF6D545892AEC579F61095DBCB5EA74DE35 KOLMARSTANDESAMT
59,005,815 *064C660114FAEC5326D9F55ADAE03F5EC9CA2221 KORY.WELLER
59,005,816 *0642F210FE3A230C89FDAF7F0ECC78E37B5A96F9 kuan.yin
59,005,817 *064018BBF17EFA65AFD0873B24628AD696421CA7 KULILY
59,005,818 *064283752BDE104B3EADD604D5359E07599DD8FC kurtisolshan
59,005,819 *064DE19DB01E7380C6875A810F0F83F083CF21F3 kylepestana
59,005,820 *06460A8C17D9129DD806AD68653749960009AC5B KYMCANNON
59,005,821 *0648D1661298737C03298F5DFA7AFD3FA9166DA2 L3520
59,005,822 *06431667538DCCCA700E822D26C058206A62D835 L}8
59,005,823 *064CD5FBA0F0039B0D79D675B8237696ED6D2571 LAI.WAI.MUN
59,005,824 *0641B7333B031958DC2E9F7A6509B9F35FF1BB88 lannysarber
59,005,825 *064F183C60394F97495AEA3DAFDD18E5D7015D01 lbum.de.l\arc.enciel
59,005,826 *0644604BD18586488D2655B1D0E7319EC42C947E [email protected]
59,005,827 *064FA4EA60676A70C2627E3EC5F0829D4840AAE1 LEANDRO.KOTUR
59,005,828 *0644067FE6B1A83DA971B7AA5A5A1471910B1BC0 L’EGISTO
59,005,829 *064A8EB1F9038808447A759F31CBCC35150809B2 LEROY.CROUTER
59,005,830 *064F239508ACAD00DE4C70F4A6808C0A4A27FAFC LetTheLowerLightsBeBurning
59,005,831 *06473F100AD33B1DB0EE73C8F71D657E4735733A lewisrothbart
59,005,832 *064DDF89F332BC53FF288F5A217426850D2A173C libove
59,005,833 *0640B6BF0AD237C031589659948E1FBE007FAD9C Line-2:-----H-----S-----S-----U-----<BR>
59,005,834 *0649AA65176CE3371BBFC6068353D0FD9938662A [email protected]
59,005,835 *064536C867FDBD310ABE26B10CAEC4A685541283 Live.in.Deutschland.2002.(disc.2)
59,005,836 *064CA0AD6532EF4C41959F296AD312AFB3D3440D Long.Song.Comin'
59,005,837 *064AA92528E6709C0E0D59B42E74FFA08D7ECA17 LOONEY^
59,005,838 *064A8EDDDFC983BC0E52658707DA906D8EDC6864 LORIE.SWANSON
59,005,839 *0648833ED3B74213A5F6F2AF6811257335E31D49 lr2
59,005,840 *064A2FBAE4AB882B7F59703E18BEA6738EF9ADC9 [email protected]
59,005,841 *064B8A596CDEB38DF5BF2A8E1D9E7AFAC9895783 LUCIANO.OKINAKA
59,005,842 *064100A28F67EAA3096E07C0973CB1EECD47BC75 luciusdonlan
59,005,843 *0647012FEE28F65BDC577952A7FA5BFC80773C7D LUISH3:PIZZA
59,005,844 *064B36B8CF37ADA4BA1988228A21CD661FADEC43 luisvitek
59,005,845 *0645BB747CCC411D09E245BD8A5C9DAFBDCF020C lukkoasema
59,005,846 *0648EE2211E6298F71F7D2CDC049A5BCB6643A9E [email protected]
59,005,847 *064B0448EC5DADCBC895A25CC1E6763B67CA1602 LYLE.SPELLA
59,005,848 *06429D0FD603493164AC63AE4C153AB2CCA77D8B LYNDON.VOGEL
59,005,849 *0645E39141750453A8BADC0F902161DF627B0DD5 lynnkirchmeier
59,005,850 *06445565E737D3B67C269623C55E0995A14B7D01 lyn.oakes
59,005,851 *0646A644F16D51763259F4EBBDE9BA56A1B8A661 LYSÁČEK
59,005,852 *064018F9512ADF610FE7EDCCE3DFB3C17E835DAD malcomprat
59,005,853 *064028936806F5C9683D066F5F547F7B0B4A4D61 margoneh
59,005,854 *064F9888C372345D6852A70FF56541535960D4B4 marilynbeatles
59,005,855 *064C6AC54D1D1E49457B4B689C1395EEA43C29B8 marty.mulholland
59,005,856 *06452E50971B0AA6B2D4C71F8A7548FD4B9AB038 matrixreading
59,005,857 *0647EA4D0ACAF4B53B3EA3365579BFE83461D424 mawmaw!
59,005,858 *06443C6E38141605DB5CDCDF85FFE216FA59197D megajust800
59,005,859 *064A7CA1E0CF2503E95A423FFBD8ED679B7B25E6 [email protected]
59,005,860 *0640D234D4F4A527AFC809A850D79CF4DB07A2D4 mepatricia
59,005,861 *064481894D55BC2EE0378C8D32F23651D4F7D06C merrillkading
59,005,862 *0640A62431A1578CC999352BFDF235720E39AB5D MGROUPZ
59,005,863 *06456F413EBAC953495FB0018D14E0E8528F912F mhep222
59,005,864 *0640FD3EDB69B850E7E031176832504C2E394CA4 MIKELZLATKIN
59,005,865 *064D272D204A5B87339D1DED54BFBAD1F81ED8B3 milfordwhistler
59,005,866 *064DEBAB39A9C3BB7436D0AE332035C4A0CCD359 MISTYMOU1234
59,005,867 *064CAF9EA38178FA8CE71E3827077E65A82C67A5 MITCHEL.BODIN
59,005,868 *06400E301AD53874653FFF7BDBD507FC64F8F794 MIUSIK LUP!
59,005,869 *064622B705753D39D93E0DE31C26F68EF6330A10 MO0ODI57520
59,005,870 *0641CC6F27DBDF938C581AE34381C0E7DA517718 molbogs
59,005,871 *064ABC3DDBEA98EA4F717480788519928B56C641 MONROENAZAR
59,005,872 *0642AC1CBC1B84F12392E145F1D0D73BCDF4B8D3 montevangelos
59,005,873 *064A44C209A7C6A649432E786C27C2C65EAF7D72 MONTFAUEON
59,005,874 *06467729AAFA63B315F55D710B0D3021F6E79A11 mor41ity
59,005,875 *064594CF033281B6BEE2D58525E9EA25DAE29B4E MPARSADA
59,005,876 *064A49EA06C3ABD14459EB663892D364F5D5BE94 muntau
59,005,877 *06435E5532A9BD613459FFC68F5E0C2D73155396 mutzmajer
59,005,878 *06410A699141EF55FDAE6F2111DBE847D1A0880F My.Place.in.the.Sun
59,005,879 *064EA020F729399FB248C046FFBE68830E058F9C myronstoop
59,005,880 *0643D532522406DA1218EEDD5466CBF62E14E324 MYTHUNDER6
59,005,881 *06485277ECB9BAD2EC5E5195A864A262A7ED2A28 NAGWA HASSAN
59,005,882 *06483F4ADEC8F462132AB236CB6C8A9FA0E1A20C natsumak
59,005,883 *064EAABD51B7C5A9FEB2229B53AD01B0B44889CA ncc1701eteddy
59,005,884 *064B51552209A690FF9C6250569F8CB7E816434B NHATRANGGED
59,005,885 *0643A9063089EAEFD0CFCE783074D1BA088D5FEE [email protected]
59,005,886 *0644B3FDA5BBB7801C1292C98308639488C5D5A2 nigelruegg
59,005,887 *064AC4D9EE6B6DEA8E161014CD26757D2475A5F3 NIKYAHCED
59,005,888 *0642A1FDC52FFFF1F226A3739237AA1BAEF3E2EF no20 he was despised (mezzo-soprano)
59,005,889 *064BC0F58B6CDFA2FA7A1BD34F90C2EDBCE429C9 NRINGSSERVICE
59,005,890 *064443D78620316BEB46269F3C8C6D7BF0D42A02 NT~Y
59,005,891 *064603E108AB94A125E5974A184D878679025949 oceanlakeshs
59,005,892 *06449E1803F75478B12BFC15844F8DF7F9856920 [email protected]
59,005,893 *064921BAEA64A5B4C1BE5EEA8D01865C5D21B5C4 O-/-GET-HER-THE-MOST
59,005,894 *064E7D598C679C53972D7CE02743A5CA1000C5C8 OKOPALI0
59,005,895 *064774845F1FCFE120BA6051EF80EF0F809C42BB [email protected]
59,005,896 *064DEC62B1380FF8E12EC7B1A2E6414CF0179A89 OLEVYTSKA
59,005,897 *06490BBAEB12781F2B4FE741C29A65BCA8E31D3B [email protected]
59,005,898 *064C6C09E1D06AE584555037429A9B41655A773C OMGEHAKT2
59,005,899 *064B8D454650A4469F827971BE29EC4C276D1106 onur.yazar
59,005,900 *06477AD24355832C14B480BB66D304BDBD5A84B6 ><O~O~D##P
59,005,901 *064D8F1329AB8C4E3BAB6DA7EBF0F709D8687E07 original-mixed-up-kids-[the-bbc-recordings]
59,005,902 *0643572A328446E4708D040B205247FF95557C62 ot3h
59,005,903 *064E6ADFCAAA783BC4693EBE8336CE0DBDB3111D OVERINTENSITIES6
59,005,904 *064298E9885CC1E1E60EA0CF49E68B7C0F6BB69B PANEERATTUJA
59,005,905 *064934C78807158EF488660F607082106BFD71AB PAOTINGT
59,005,906 *0642C24CD38C68A47019225E9897B73EC84E3660 pasqualejapp
59,005,907 *0643A566403DA21920A0F6ED619086239E82DCAD PATACA3
59,005,908 *0644A3C291A8C83D3A25C07E206FE116E5621321 PETER.GEO
59,005,909 *0644178D0BFE6BD036E915ECA00D757B0CD8896B phaedra.brown
59,005,910 *06467F47066281D7D6C298E29B11FF55A386E219 phaeodactylaceae
59,005,911 *0641FFD1977739DC556841C96E249674E0ACEC1F pi11owc4se
59,005,912 *064FB6C497B0F30DF52DB0A511325D61EBBEE896 PIMPAST4
59,005,913 *06494D2343D116E049E7211955EC39A492AC5010 P##@ ~O ~o>B0
59,005,914 *0644F551D0279EB8B6D50BCFBB12D3FDC48F8D3E POORLY-NAMES
59,005,915 *064B46B299CCF427245831EFDFBD10E25A710D7F POP.HAPPY.TREE.FRIENDS
59,005,916 *064C5AB5953512DE089E0CF21ACDD58C813D50EC portioned9
59,005,917 *064ED8C3FD7AEF4EA00F18BBE0A144E9A9D77617 P-----P `~ `~ (0-0)
59,005,918 *0646E40DEEDF6056459CB9D11050553EC240E577 [email protected]
59,005,919 *064F1FF39217ED5E33D545376B7B6C87D2250F50 [email protected]++ng
59,005,920 *064AB0ACDDBAFF38EC7223F4118EF46B081594AB PRANCING
59,005,921 *064AACEE20C9DD3398291F167BF3CEB87DDF29FE PROLIFERATEPR/@/'L/I/F/@/,R/EI/T
59,005,922 *064789A3E279649C055E6C2492B0F82A45843843 prosi101
59,005,923 *064BC78651A0936FB4F4CAE4CD9D64EAFB39DAC3 PROTISTS7
59,005,924 *064D3657AFD9DA1CE7124448FC30AE9EC6B498C4 [email protected]
59,005,925 *064ED5C21E7FEF86B9152FC0BF57D78A3AD5EAA4 PSYCHOPHYSICISTROBER
59,005,926 *064B5E64F2E772621FC3A33B093E461BF477025D ptnw
59,005,927 *064096B156CCDF3FDFBA588BBA44AC91ED7992DF q======b~`}x{
59,005,928 *064E4D09F7DD23ACB60FDB7BCA3F067DA2E14A49 [email protected]
59,005,929 *064E900A31763B5B2C20BB30DA24B7D142AE98C5 qjw6
59,005,930 *0647E8121CE9B32493C3507C6246B34FCE2F22BB R)7U
59,005,931 *064BEF092D96BD9257392CA4AAD986DD4FA0684C RADWAWALEED
59,005,932 *064D231B2C43B2B2B4DFF130F7AA8FBD0D9C8CF5 randallmerkley
59,005,933 *06445402F60A1B7A5D1BBC99370218665A6FD8DE RAS34NELLY603
59,005,934 *0647902DA44988D74A4BD55D068C484F8A4F1EA4 REBECCA859
59,005,935 *06460B63094E38FA6CFF24CE2D4825DF4DF09554 REFURNISHESESED
59,005,936 *06407E8FE778A2142F6A9810F90B5475EE0E1C5E REGGAE.MAN.2
59,005,937 *0648C15114663ECF992184E388373041D799051E REICHTUMBSW4
59,005,938 *0643720BB35A60F4BB4823AC31C257D5695671EC reinaldovetterkind
59,005,939 *064B9F76E5D90D67F0EBAEB7C8E59926BC40BD9F responsibaly
59,005,940 *0648F62EEEC6364D8E1953ED602828E67E2F0403 RETSNEFTSET
59,005,941 *0649BF67B37E4E365ADF7EEF82C26FB50BFE3999 REXEKKER
59,005,942 *06403388C504BEC5C49374525421ABFA597AAAA2 REX.KOPPY
59,005,943 *0641A7F7CC5E81A5B73F9920CC35F31DA418FCA9 REYESKNEIP
59,005,944 *0641A2C41E97BC87A1BDEA658E419E6041CA65B0 RICHARDZAPATAS
59,005,945 *064F63072EFD7F313CCC02EF328779AFF1734E89 RICKYKINTNER
59,005,946 *064AEA6B6075F1954779AC0AAC4439591D5EB0E1 ricorossini
59,005,947 *06466ECFABF25C1AB23DEA259FA9677E369F38F7 RMASHLAN
59,005,948 *0643B79CD518C6C102643FEF41BD49E869742D0B rockgittarist
59,005,949 *064B0ABAEC8D6DF18FFD48F9C9F7273E8B1A15C3 RODRICKZIMM
59,005,950 *064CEF8D7AE920438D9BAC0543358733E9E93D62 rodrigokirlin
59,005,951 *0643DA8AFF705AD00E4158D74B98D39A14DE31CF RUBIN.POLTORAK
59,005,952 *06464A1A7E95BF332259B452C58304B09C6131D7 RYHMINEN7
59,005,953 *064CE2552943FEE57D8EEC292F759AAB44B7D453 SAMMIE.CRANFILL
59,005,954 *06475D37121EC4D245F05EC5B8A41C548B17ED13 SANDY.WITKUS
59,005,955 *064BC104823990BCBFC6B8C0AD1C1EB0AD1D9FA3 SANISIOVA
59,005,956 *0644584BC2AF9009ECF08A5A12AED7972FBA9353 SARAH-INSCO
59,005,957 *06450E0B84D19DCE86FE8F317C442D0C43660D3A sarah.l.barber
59,005,958 *0647E31E3FBB3EE4D44E9E6D278A0D22FF3B1426 SCHUNSANGUAN
59,005,959 *0645057A229A0359BFDC5F85044D89ED28554812 SCRDGLL0
59,005,960 *0648B1DA785C56238BB2D59F5D5B01430EDB3FB3 screentime
59,005,961 *0646C9F632C526994C98BE62557A7B77CA4F3198 SEANNEIDLINGER
59,005,962 *064F5E4A08F70C7B860055089260CEA45800C81F SECONDHEARTBEAT
59,005,963 *064584B87F2B02C23A0FDCE4DF5A846441A17434 SELAH653
59,005,964 *0644B6F868B7B27538F6FE710307E65842063520 SILANIPSARUD8
59,005,965 *0645D8495368FAF33F5F126BD6417BDA5EDC3096 silasaskegren
59,005,966 *0645B5D7C18D88FF8D708745BC889303043E35E5 SILLIAMO1
59,005,967 *064A40A5A8E1B47AC51DB7D0B18B0B2416FE9027 SILOPACE1
59,005,968 *064504904972EB03A1DBE00581407B5FCF0593DB SINNESSJUKHUSETED
59,005,969 *064F8C8F34D75E4560B53E0B510EDCABEECABE4F Skateboard.of.Hell
59,005,970 *06496C8A655165AC5FB1DA06E866C7EE5EF83979 SLEEHWDNOMAID
59,005,971 *064C2ACC3BC3B71D53E33AFB015280D9C9B799DD SMOK3.HO1
59,005,972 *0643038F44DC71AA170A18A68DAAA88F7EA31B7C SMUIDIBUR6
59,005,973 *0645E65D4C9F50A2A53488D0406196049789391E sofisticato
59,005,974 *0642BF1CE11DE01899076E78392AC37E5D2A6898 speakingin
59,005,975 *06412921D67BCF799A9E7FEBFAA534DB2875FBC6 sporcavo9
59,005,976 *0646D4B9DC701C8F686716058B5CE04FF4CB6824 SQUIBBBBIUQS
59,005,977 *064998A150616B00651285CEBF5438C45D5984E5 STAMMESKRIEGE5
59,005,978 *0642D4B87256BE07C482D31283FB99F3B8006F3C STANLEYSIDNEY
59,005,979 *064F39549CF6355DA53885781D4C4CA10EFBC7CC Stell-Dir-vor,-es-geht-das-Licht-aus
59,005,980 *06433A117201696B92AEDB84472888D15EFC5FF4 STERMINATO1
59,005,981 *064033B894D821EF7641A5A504A91BEF3FA10941 STIFTSB
59,005,982 *064607B7DF452227C5F02B7CF295B2E9F5D74DE6 STNECNONORP
59,005,983 *06460C4414DD4D409DCB426A5987A605A68D61F3 STORY-ABOUT-COLOGNE
59,005,984 *064042742E4405BFC4D743E56156AA6D7B42D19B STRONTIUMED0
59,005,985 *06463E8D4DD68807FADA61B936D5E6EB7D4D28D2 SUITE IN D/G MAJOR, HWV 349/350: (COUNTRY DANCE I/II)
59,005,986 *064A5A8F93EA1E08DB76954DE40A7DFF4B98BBEA SUITOSTEOPATHIC
59,005,987 *064C63EA4108CD3FC08CE18406A0ACF1B0E74E94 SUM</LABEL
59,005,988 *064FF3039E16E6DFE12DCF387668DF99450EDB34 [email protected]
59,005,989 *064F7B562A90F76F1F380C08D547024010CDE831 SUOCITUM4
59,005,990 *06409772D37541FC33DCE8263EF0FAA572DE2E1A svobergfq
59,005,991 *064147C3D0C761E35573CB8CE8D683A0A1E51C55 symphoniennos.5d485&8d759(unvollendete)
59,005,992 *064A93B293E78EF97DDC8D482A25C4CB315FB712 T3G1
59,005,993 *06418151A4EA7BF54230E96585CB4A85AB2962E7 [email protected]
59,005,994 *06465054A592F963858BC617AC82B56D7FB5139E TAMARABREWSTER2
59,005,995 *0643CD8B59171701B7BBAACD78B2A18F278387B5 [email protected]
59,005,996 *064D99195A84CA47E25B5ECA80A4806020E0593B [email protected]
59,005,997 *06465B8560F9D78690B59FF5B1B1FD22BBC18A28 TARKLANRIS0
59,005,998 *0641E74D7B181BA5E1B0AD200E094446D859545F tax-cuts-for-the-rich
59,005,999 *06458A5500775383B6E95AA033F8C4028B4156BE tdetsgre
59,006,000 *0647341A697DA5567D4AA21C44803615328DC715 TERENCETIM
59,006,001 *064B87F411C68FE532E25461A156B4CC9EE829A2 TERRELLSILVIA
59,006,002 *0640E03F1EE9D540F03BAB985175FEB3E5A444EA TEXTILERY
59,006,003 *0641875BB06B6C8601AA406995DED5D7D60EF59E that.old.song...
59,006,004 *064ADB3C0993B0F0ED9E0AD6F2BF35D7DCBD8E3D thebernie1993
59,006,005 *0645D243E1495A25BBE3D1AAF9986E7DAA4CC4E8 THESAGAOFPEPTONEROUGE
59,006,006 *0644472B6421BF865BCBDCA0D855E5E44CF6A163 THGUORBBSW5
59,006,007 *06434DF254050261A9894EA519BAACE4F7052CF3 TIMGRETCHEN3
59,006,008 *064818183459AB2631A71C60F62B9883577D32C3 TINGGAR5
59,006,009 *0649346D27665B961417AAD0176BF46C71D05DA0 [email protected]
59,006,010 *0645D754955C406E160C56A0BA4252D71483DCD3 TOBIASROKISKY
59,006,011 *0646F67345A5C2EA0A3A7183F410E3A71F1E1019 TOM.HANSARD
59,006,012 *0644FF7DD3D26C0F2411702BFCC0B10D68554867 [email protected]
59,006,013 *064E634C2FFE895C56E8718F3CE3C59FBAFD2FB3 TOM.VEN
59,006,014 *064D543304F1586F51713077A48E6AC4F451DEA1 TORYGRANBERRY
59,006,015 *064B678B69899A375E7A79C5AFCAF2CFCCD232EC [email protected]
59,006,016 *064118932FD63D43F1CD149B84F12F4B2AF5853E TRAFFiCFLOWCONFiDENTiALiTYSERViCEPROTECTSDATA
59,006,017 *064693BF3F6F866C3577C9C68030EB081989AADD travelin'light(2metersessie)
59,006,018 *06469845BCFC58068F3D42177A646C376E9D2AAB TRENČÍN
59,006,019 *0649D590E7A00A6CF66EFF75B1D778FFC99CD8F9 trifena-christine-karwur
59,006,020 *064CFE3CF138BB5F98062B7D794662CCCA0D4443 TRISTANMARKO
59,006,021 *064C0018775AC7C1D39B7ED36CB3E438A4EBCC7C TROPHYOBJECTLESSON2
59,006,022 *064515029A8C350CFEDAD7C5C6DBDCBAFCCAAEDD TROYWEDMID
59,006,023 *064D5A5A116D5FAD475D1B4FB800DC2F631A0854 tubbyhall
59,006,024 *06426A3BCB400507D47FBDC5E5D723EFB5C40D03 TYRON.BELGRAVE
59,006,025 *06469F1E1470B43D652825E0056D7A72DC10A3AF UAXAE
59,006,026 *06475FCD7EE28E0B256C8BA2BAAF37CF3AE5702E UJXRU
59,006,027 *0640962D0109C3BEB2A26401EC801DD0D21D901B umair.bin.arif
59,006,028 *0644E8C14885355CE04B5C6135F2D3F247CBDB8A UN1V3R$411Z1N9
59,006,029 *064841AE2BB8A55D27D84FD5342FB5DCA62C1552 UNEFFECTLESS8
59,006,030 *064F78AB61CE2B02E2C49CAB730E9D20A1E5382C UP9KXDUGMI8J
59,006,031 *06448382A276768786EECB5E3454F6F9020F7F37 URBANPEOPLE
59,006,032 *06450C366C848EB6A4551E3DF80A680899641EBF URSULA-VICTORIA-BRESHEAR
59,006,033 *0646245D620E5876002F1DDE68CC5F33E346A896 USAGLIGESES
59,006,034 *06411607DC4C072AB20EF65CB499CFA21CBC2DC8 USAMA.MAGDY
59,006,035 *064DB24D06F2C0E8E1DC3F3A4EDC48503975ECDC *-USER-ID
59,006,036 *0647B3B82ECDE26832D84C5EAAD20AAF512CD838 UTEČENCA
59,006,037 *064297086C14064CCBDA3FE014CF9917AC1EC6AD utyウッティな木曜日
59,006,038 *064816C728235C60F30734B6A21BEEB9BF41B4FA VANESSA TURRETTINI
59,006,039 *0648410C559E97B4CCBC3A1F3A554F40C4E0CBA2 VANSMOORENBURG4
59,006,040 *064DE8DDE649154A6974E7634FD51F06B3181926 VCICILIA
59,006,041 *06476F4A21B18DAE1340F5DB1F998198CA472CE0 VEMORRIS
59,006,042 *06454EBD4269AB6D999E1200EAFCF710324689C8 V^FU
59,006,043 *0641120D41C9B7280C7CCEF5F2D0914EBCCC7BB0 vickyakidd
59,006,044 *06401D210B3A8A5A983E8E39D601261F1A83FCB2 vikas-thopte
59,006,045 *064E6D1698524F700600A9D2554F81B065DF13AE VIKKAR.RANA
59,006,046 *06400380D12E10BB587D6F37A328CF0D49081F91 vinayak-rajvedi
59,006,047 *064094C048C02FAB2764882DF3042299D8F17EF3 virgilferra
59,006,048 *064AA365BF1E9184DFC430A09A020CAE01D57C6A vitopeveto
59,006,049 *064FBDE44D0FA10A2FEBB1839CDBE2943CBA1768 vkhcdxu
59,006,050 *064D3187EE44F9638682EABEDC4E3526B8C6A425 VLAAMSMINISTERONDERWIJS
59,006,051 *064CF96C3EB85BCF4EAB7EFB55BD6F9697DC0FF6 VONHANISCO
59,006,052 *0648D3C664E25E2FAEEFA37BFF09634B0AD7B863 Warren-Burt
59,006,053 *0640AB71C2A7457E4574FFD5AC7D3F1E3190BC6D [email protected]
59,006,054 *064119D502A99670FC8CD1F0A5094E2212DA282D widx.godil
59,006,055 *06454C4F62A91FA5C33BBB81505AA1DBD57945CF WILBERT.AQUILAR
59,006,056 *064C53940842F7D4D507E018B196474F7A42C351 WILFORD.BRANSFIELD
59,006,057 *06401E18A1613D8E882FE1472CEF9410601008D7 [email protected]
59,006,058 *06444898EF9706D0899EC262B3E1A7B4ECF6A1DD willarddeatley
59,006,059 *0643FA6C121FFD6541C769F6F7122347F648D2A5 WILLIAMOLONAN
59,006,060 *064EE1B4D44C7EBAEFCF6E9BE9305D9E5C6C8C70 'WILLIAMS'
59,006,061 *0642B1FA78872D33014E7894AC0AFB855B82390D WILL SQUAIR
59,006,062 *06477751E3B55BD95BC6407F809C4F7796EB0ED0 WINFRED.DILLER
59,006,063 *064A7DEE9C6DE700D324BC4EC092A5C307A51D31 [email protected]
59,006,064 *06452B29CEB42BA36963E0DD82F86DE1B14CA009 Woah!.Don't.sneak.up.on.me.like.that.Kairi!
59,006,065 *06427223CFDB48682F0D1FE85F9F55C881B4AB27 .WOLLIN
59,006,066 *0641C858E154E6BDF9819E4D3B415879194ED465 WORCESTER WORLDCUP
59,006,067 *06469070C00EB1B2BC4C71767855537A7362DB4A WORLALY6
59,006,068 *06497A401CD0EC76B9D312FBD7FEFE3D7144B5AC wtaxvjvrexm
59,006,069 *06439B009811ACB010602906FEA533BA147D5B29 WWJNMIPHAITOON
59,006,070 *0643DE4217542055DB5EDD2325B95DC3C1232DB5 WWWPROCLAIMPROMOTIONSCOM
59,006,071 *06442507114DCBA702369A49C26D193BA2C008BA xavierstansbury
59,006,072 *064D770A98D519097E4B469419DBD9272E427CC0 [email protected]
59,006,073 *0645440875A42066F6038A9CC408D487A19F9BF4 [email protected]
59,006,074 *064F9D98A1CCAB4E9E3A59547632CA5D33BD0183 Y!BH
59,006,075 *064A1C2F48FF184C2C199FFBFCC43AF9651D656B yudibramesta
59,006,076 *064C8163968D02332E0783B81A820A3D46CAC822 zaliya-uchiha
59,006,077 *064671DF8B3C37CEB15BC18045B9AD654BEE8BA2 zenaidafukuoka
59,006,078 *064C3F1447883AA9AF0DD7A331CB7BBD254EBE8D zheheng
59,006,079 *06401C7BD1480D31E6991F4306B2F414DA33BD40 ZTATAŘITI
59,006,080 *0648851A63F0B002B5B2BF08D175C071BF22C83D ZTP}
59,006,081 *064C899B84A3112565F586A0F13703AD8A49B2DF ZX6214205
59,006,082 *064C84CD08634986077AE5656FBF9C7B850A37F5 бабуси
59,006,083 *0641220952BB36B770BFE420562CB7152810F639 БОАНТА
59,006,084 *064E6DA3DC37594DAE0141865244A4F4BE8AD7C3 вільхової
59,006,085 *064268A643AE517D73264E3AD6FD0E17E03B3C92 のローカライズを優先することにした。MOZILLA
59,006,086 *06457A9F088B60EB18F0076888A4669D11B30336 01P0106090249
59,006,087 *0645FEF5933754D9F08612CEAE871BBCE86F89E6 06.07.1110
59,006,088 *064B4B4F1D6630266A79F44E60B254DBD428659D 0ZY5J1KL
59,006,089 *064639EB7D5986CF8BC32E8AA58CFE4BC9A7D2A1 1024ITEMIMPRIMIR
59,006,090 *064FAF8A2B5FF9CAF20A68DA6DCD7F747739CA7C 109!E$T
59,006,091 *0642D6FE1B557101AF5EDE160AB5A215E5BA5A07 10 T
59,006,092 *0642FA8ECA93A2018DD8F473FAA7E558AABE4C6C 1188987 prevnet on a-klinikkas
59,006,093 *064A038B7EC29CCEE29C655CFFBD75B473B3B5F4 12772 TILAT.SIIHEN.SAATIIN.SIIRRETT
59,006,094 *0649D0439F44E6DCAB40E419D0D766B6F1F3C676 162390 ERI-PUOLILTA-KANTAUTUU-TIETOJA-,-ETT
59,006,095 *0643E0660CE8EE95F348FCEEE154915C8A52FE20 18-05-1545
59,006,096 *0643F0B7D3F394EC6403362CE76A296C2C7B27D6 1.alip
59,006,097 *064E507910B11932377B5A6D6E964282408D38F1 1depasman
59,006,098 *0642B3045B942D198F5929DCC9740054EB92581C 1elegischwarmen
59,006,099 *0646BAB4BD6CA5EAC806B9BBF7ACE0D37D1A55A1 1ERSTLIGADEBUETS
59,006,100 *06431804219F33D2ABFC8FA501B586930C2B18EE 1.esmikko-j
59,006,101 *064E7B7D57BE8B4F338CF1920C3C2AB67A1256E5 1.EUKOMMISSIONSPOSTEN
59,006,102 *0646B162743A79CD02C0DE6F04A3CC7B2CB61A5B 1FDFF2
59,006,103 *0649BD94979A4A2C6655853B78C160D2BE742BA5 1halfpennies
59,006,104 *0645A8D17FAFC924152197C64A3BF1D86A2F0D3E 1-KLUNGLER
59,006,105 *064556712663776C3C7D090C4A150EDB926A7D6E 1.kolmaskinohjelma
59,006,106 *064596FC3EDC5F23BB9DD9C09DC4C1C1DBFAB322 1pancreatize
59,006,107 *0644FB8ACAEFD52FB829634085529168F457645B 1PUUNHOITAJIEN
59,006,108 *064D7AD182C5969F97FD9CF9767DA168D48C8A97 1 SCHTSCHUKIN-FLIEGER
59,006,109 *0640A1B4CEFC1C9690A70122C414A755CEC25E31 1.SCHUTZMASSSTAEBE
59,006,110 *064E8A478A31AE7027A93E62198C17E0A23C0012 1-SOITTO-OIKEUS
59,006,111 *06425AC0C53D1FC3D2646CD19B297C4EFFF40D24 1-tilauslehdeksi
59,006,112 *0649EDFB35A999D3198F789E7EE7E32D74165555 1YLEIS-AI-KA-KAUS-LEH-TIEN
59,006,113 *064F8BB8EB42D7FD9897717DD77E0DF6C400FC21 208LIMNA
59,006,114 *0648A8A59FEFFCEE1C975A41987AC88FDD6970EA 2091838 UND-DAS-IST-DAS-GEHEIMNIS-DIESER-OBJEKTE-
59,006,115 *064A930D1A81B4D488E87EA4ACB3AA1E85C816A5 2112barbie
59,006,116 *0641C8949CFF47B6570DF448E0881DD56BFB60AE 2174070 autoandresidentialmortgageloansaresurging
59,006,117 *0642305F7D1FA0FC7EDC8E67DB33A59F21DD75B8 2374715 there was no comment from mulroney
59,006,118 *064F3F4856754F6DD541BA83F096A144CDDAA8FE 23january1698
59,006,119 *06404623C888D0C24E933592EE423D9891EE8921 263gesetzten
59,006,120 *0649760C05ED3DE1C605F2863D9F4344C9ED3773 2885151 bundesweit-sind-es-nur-14-prozent-
59,006,121 *064C11E624BB031144210C33B7A1714BEF7C8C19 29APRIL1543
59,006,122 *06422189C1AE664F214EF14B4687A3914D4BEF15 2GRAYLAW
59,006,123 *064EF4F40D6B8E056CF9374B54F8AEBFC8F5C0AC 2GYMNOTIDS
59,006,124 *0648555F0E8F4889C4419048D7CBF38AEB727800 2-HOCHGESTEMMTEM
59,006,125 *064E4B970FDEF849856ADC81565A7C24F62657AB 2.hoerfunkredakteure
59,006,126 *064A867950A5C322E9061C4C8FC345EFB5D7C88B 2IMPIORUM
59,006,127 *0640C3EE6607FBD21E948643274C826463BD27F3 2-kompromisskurs
59,006,128 *06455C5C054E66B403D67490D856CF3FF8FFC9DB 2MFUNGENI
59,006,129 *0647DC57B655F0E3201772254F7C714B594C081E 2 MINERALOELBASIS
59,006,130 *06476168E640604B1528BBC261ED08C16F9230F7 2thelemon9
59,006,131 *064787AE0F82157F694D54B9D34283BB321642B8 329075 operasofvillainousrevengesomehowareeasiertotake.
59,006,132 *0645EFFE9B2E6353E53CF641A888D82CA91EB0C0 [email protected]
59,006,133 *0647BCBD40C01FD40372969595D73A538CA8CDA9 360215
59,006,134 *06441A729662AC8AE871083492A7E16836464750 3ARECCAC
59,006,135 *0643614A87C56D9732B2A9364C65838581A0B389 3----->`>-b0
59,006,136 *064956FD7A36C043BFD58D85EFC3F80D1748A374 3=====d~o.~o.}o{
59,006,137 *064239E690BC9E3DA66C5557E66D130BB7BC8E1F 3DROEFTELSE
59,006,138 *06466568FA9942D5011F39888073ABBAEB0ECEB1 3FSTNNRN
59,006,139 *0647F595E4F9B5FF29A47C978872780A9BFB58F4 3IAMBOB1
59,006,140 *06483AA8A2ECE29B43E560ACBB40BFC754AB479A 3ILUVTEDDYBEAR1
59,006,141 *0649C24DF3080510077D431B223230946A0E491B 3.kasem
59,006,142 *064272FBED79E83732DB4B0439BAB268DF0BBDCD 3MALATIONI
59,006,143 *0645369E154A3BAE60024C7944658DF93E85A7D1 3-->`~`~SPLOIT
59,006,144 *06413799E972AD6F68AA4E334D535486EF122D65 438571 RYHTY
59,006,145 *064015DB247E759A911281FC60F37C13F4CA4805 445875 LAITTEESSAYHDISTYV
59,006,146 *0645D9FE46CA3ECB7E2ECAA751015062EEC52995 484435 juna-oli-vaihteessa-siirtym
59,006,147 *0646894F7B5F0CC71AB4F9ED9AFF085ED61302C4 4CONSTUBL
59,006,148 *064E535C29CF73F404FACDA11E5FFAEA4B22AC5A 4kululle
59,006,149 *06405C117C2618F882221782385442DD800D8825 4MOCLIAMTOHELTTEGSETATS
59,006,150 *064B788F6DE691396A7CDAD9E8EF618EBB82DECA 4myfirenze6
59,006,151 *0647E28A6BE17A4020D4389D6611830A61E81C9E 5068259780493c4dbecb814c90965bb8
59,006,152 *0644F55203D942D2685B1EF3E993196759596449 585Є
59,006,153 *064154D3ED371E8049622DCC5C2D9CFC1B6A4478 5APOJOVIUM
59,006,154 *064706470376BB20CB3A74AB579AD4859706ABE7 5ILUVBUTTHEAD0
59,006,155 *064BEF8EA3F3EB5B0586532FF7E82C1F584DCABA 5LANCASTERIN
59,006,156 *06419F31ACFA8A496EA28852DD082660BD371CE8 5MACHINESCABINET
59,006,157 *064907EAED0926011D1C0AE47ACEA90F18CE5F49 5NICKYJAN
59,006,158 *06453AFA1D0ECA01D590D0C53C8E4A21177213A5 5PLENIPO
59,006,159 *0641DB6E4C3FBD0C827EC6CB58AE407B9394B46C 5TELEFONUJ
59,006,160 *06413A5A701BCDA8F7B0C80563A47A1F8BF83957 5THEATRICALROSCIUSTHESPIAN
59,006,161 *0646C63FFDD24370090FA3C38FBB1BD39903346F 5TOPCATDEAD
59,006,162 *0648D4C98257A2E00A1FF3B3F030BF656364C33F 611DARNELL
59,006,163 *0642730156C328AC791F93E6F65942189EBC5B11 636590 ACIKLAMAVEKONUMKUTULARINAISTENENMETNIYAZIN.
59,006,164 *0643C57E2716237676B798C3EEA289296C26A85D 6BONZBON
59,006,165 *064ACD4F4503A62EB717DCFE9D53D7B096772266 6DISSEIZORESS
59,006,166 *0643DE1279338508FBFB83DA29C58B73B7A723B7 6mymegan0
59,006,167 *06463EE60FF03737ACD913FE27F95C9E43BDF6A1 6PROSPESOSATELLITE
59,006,168 *0645B47BE89B03C8171198F2303B326F4C21C689 6SCARLETPEOPLE
59,006,169 *0647F9A14F790F04A811A30CF63B5E13905490D3 6TULOISIA
59,006,170 *064A6DBC97EACAF3B04A153AE8B2627BEAEF6362 6YDINAIKAKAUTE
59,006,171 *0645677FDEEED2AF8DB69F4C2BBFD3070B4F36B6 6YEAAAAAAAH
59,006,172 *0644806A7ABDE0F32810CF99D3B689A43F4C1477 70DAWN
59,006,173 *0645916C2A927AABEA6DD056767AFD2666C69477 793711 aryIldIz-a-.-S-.
59,006,174 *064FFA62E164813A8F0CA59CDB6271BF0E6F40A7 7CANVELAREO
59,006,175 *064F5FDF23D8C31E81DBEA1ED5F66456982CF0A6 7CHEVYGAMBIT
59,006,176 *0643969495A0F493C04B1E249E36F069A805BC0B 7CONCEPTCHARITY
59,006,177 *0640D673812DC54FE213DD2F1FE5CA1DC96C55FE 7DECEMBERCHUCKY
59,006,178 *064E4F6191DF63E0E2AD936C422B523A701FD294 7ESCLUDENTI
59,006,179 *064987196FAD448361019EEBC5B3A8D1085B64DA 7ETICULUM
59,006,180 *064609C781C32B001041A0FF8F3E32C2136EA78A 7GREENDAYSHITHEAD
59,006,181 *06478E47142A320E57753A3C78FDE58BF987E8DF 7JAMAICAGRATEFUL
59,006,182 *0642D51219D28E06FCE5A5FBA90C1FF1991342C5 7-laink
59,006,183 *0648B73DF854B06E3F1E0D30E493F534B3A3CB13 7RABICORTA
59,006,184 *064FDE4BED44AFD5D5BA1B3583522267898CDAAF 7SHAFFTE
59,006,185 *0647D95315DCAE1E1C30EEA1C3AF861079E44624 808179 WEBER.BLIEB.UNBEIRRBAR..
59,006,186 *06490F87430F4902416E26577A608C80811700AB 80)、有60gb硬碟豪華版降至299美元(
59,006,187 *064A3F5AFCE934F2A9297BCE87AD8C49F526A37F 8BNRMLST
59,006,188 *064ADFFA5F768220727AF5134C161AE6BAC44F2B 8dechargeant
59,006,189 *0644395FE01EB1D8E55A01442A2C154719D0F4C7 8EMESSOOSSEME
59,006,190 *0649115D43A07FEC285CAA677869AACAB41557D3 8GEKLINIKKERNES
59,006,191 *064F22D08232287A3E9265926AC33D849A5EA92E 8HAUBERGS
59,006,192 *064F25BF68BC474C6C82A677D1DEBF4738D0E61E 8KWFBNBSW
59,006,193 *064AA3F63FB37B8658A9E5CEB8AAFCA590173D81 8MAXDAYBSW
59,006,194 *0640263C1F5969C5B55B52A975EFC4808179347B 8NETWAREL
59,006,195 *0646C5F5C3AD8C1AC2BA87913D2BC774CB43E5A6 8ONNETTOMUUSKO
59,006,196 *064F1C1C744573F2A359474E429C631AD44ABA77 8ROYALCANELA
59,006,197 *0648CC20B23F5B5642634E3D6886E7D00055E677 8SQUINIED
59,006,198 *0648ACC7966E87B486E5280FBD124639D2569030 8TILORDNING
59,006,199 *064C6E60D8D125FED9768768D5C788651492B803 913981 UYGULAMAKOORDINASYONUVEESASLARI
59,006,200 *0641B9769B8B12EAD9F6C0225C493718E761F0F5 9ANTARKTIKSEN
59,006,201 *0645BE0C9B0CEBC5A0BC0FE855D255CBE4139F79 9ATSIMIMI
59,006,202 *0642693BBCDC4C32897DAC6CD6FD2317F0CF1642 [email protected]
59,006,203 *064FCE51650E099FD1B7DDA5778908D6F94EB9E2 9ECORCHERAIS
59,006,204 *06412E50DBF1A22B33D0076468D11841C83B9A20 9NASCENCESES
59,006,205 *064A2C088ACE3D36323A20F57DED7ACFFBFB3442 9PALETZZTELAP
59,006,206 *06455BA10EC778D7178C5D1F356F9E99D023825F 9R4PHI73S
59,006,207 *06445D6D52D3FD2F6D62F8B46643DC9C7CF97DF3 9WRANGLERDASHA
59,006,208 *064E364CB56ED8E88715EA39A4A4A08B8E3D66FC a1sm
59,006,209 *064CDD20835FA215B6E74B4583284E0732B40F27 A=8l
59,006,210 *064D950B0E5800C5C7EC2770DECFF52F579F5D54 AACYEY
59,006,211 *06452159916A52C1F88620F6426C0A41376A6F02 aadgnf
59,006,212 *0648E34BB9214CE70B5279F1510F87192CDA175B AAESI
59,006,213 *064CB753009B42A32D6454056547F985C898D5DD AAW?-
59,006,214 *064A7DE89A5D87C18BFE2D0821116486B0AD8540 ab/ir
59,006,215 *06426E736AE2AB13D92123B670810CE0FF1FEF06 a#bvc
59,006,216 *0646E723D46912F43E784A1505EF8E836E02B367 AC&P,
59,006,217 *064FF69D81CC6E51044D6075E6A527C53E32D9CE ADJSMDH
59,006,218 *06479B5D4CC61307210CC4BC309CD52EC9CBBC0B ae:6!
59,006,219 *064E353CCE5154F5258B045A8630AD9D51788BA7 AFFAIRN0
59,006,220 *064E8563984D7BCC5EFAF1FF04C4203BDAADB219 AKKUSATIEWES
59,006,221 *064A2ED1C9EC854268D6C9915F1E3FFF58F2091E ALDENBIANCHIN
59,006,222 *064F8CD83DA1C53CEA521FD048FADD5C24FA6C83 ALE_M
59,006,223 *0648F7D6D8DBE1873326CC414BD95E607D8D9AEF altonfluet
59,006,224 *064B3BAB132372F64A26D988D988D9FC7D7A1397 ALTONTORRANO
59,006,225 *06442B86DA1B95B6C2D531BBDC96649399D4A015 [email protected]
59,006,226 *064A299BC57165DC80B0C1832B7318B5193C0CEC a/m0=
59,006,227 *0643B4B1351D4A89FC36C0B5EB6AE865D518CC6F AMOSBUMPS
59,006,228 *06460926DECC420801ED409E2B1C8B8A70142D67 a/+mx
59,006,229 *064F4B60B32C298F188E0D03B299DF571DBD8E96 A:N#
59,006,230 *064C38012E590CFC0D7721A5E89EA39B9B78E281 ANITAMOOREHEAD
59,006,231 *06441D1F5F163F88422B30CAB13EF6C600387391 annaliviaplurabella(finneganswake),1929
59,006,232 *064D9742A5C0CDDBCBC4A7F535C3F47B6B961D9A anton-mehmeti
59,006,233 *064DBA9F279EC50CFE63C2BB71B2588A215F1C9B antwonlemon
59,006,234 *064F14211EBD321200065B8F84E245B8892C8ACE appencelskiej
59,006,235 *06492089E59B24F1F4235BE6A6AA25C2F935F780 aq4wk
59,006,236 *064851ECACB33B6C0999BC1ABEFDEB34BFDFEEED arf"h
59,006,237 *0640E801A065D60B8036F8E484ADEF3C01B6A852 ARIEL.BARBINI
59,006,238 *064B6F7AF82916876AC401855F216513AF00FAA3 ARMOURSUNDER
59,006,239 *06439A87A74927BE0EAF2BC8905379ABF2363A2F aropc
59,006,240 *0640953DAC100371049507798626946A6A8E52CA [email protected]
59,006,241 *064067DEF058B925D5880C4B852605A7F5642FE3 ARWUN
59,006,242 *06495495E6059DA4231541CC3E4B2FF9111E9450 asthewolvesdied
59,006,243 *064C7F9694FA84A8EC4163D9C2CE3F9564CDF2C5 au:#e
59,006,244 *064B3B1EB2AB193F5591ACF21BFB463DC14B72C1 a_-vb
59,006,245 *06478F00D1058032E8691BBFEF2FC85FD433D624 a-wintersunset...
59,006,246 *064BA99E968490382B6529BFE2AAC6CBF4D425A8 >B0.*.*.*d=3
59,006,247 *0646678724529733AE520463A9A9CBDC31367B99 >-B0.~`.(##q
59,006,248 *064D5493304AA80F4FA27F0B32EE0736A428F478 B1wY
59,006,249 *06451A7DE273EB0DF83A44EE16C4E77702134260 b9y:
59,006,250 *0646EDEB666AFA684D54763425C5CF436FD7CF6F baniulen
59,006,251 *064E66975AB9A31795C19384C56C13DB8FD201E4 BARRY.MASTERS
59,006,252 *06446F0F69ECCCBF7D4CE133AC432FD568077362 Bbg7
59,006,253 *0648475413C4E9752B9FF5AA7459A1510EA4AA58 BD3S5
59,006,254 *064707A3FACDBD61AD43A1F2886FB5D06558D360 BETTYINFO6
59,006,255 *064FC630968D05FDC6DB7B07EA9581BD93CE0B4A b?,gr
59,006,256 *06406EF7D16853B655B99B2EB0BBD3F7A70A3969 biqej
59,006,257 *064923B0CA85ED28484C348BDA72925EBFD09F98 BOMBAYFOXY1234
59,006,258 *064AAC8EFAFEFDAA1FF4964F1CE1371D9E6881AA [email protected]
59,006,259 *064F00D6D148166CEE60C361E7AFB64EF37A759F BORNUNDERPUNCHES(THEHEATGOESON)
59,006,260 *06459FA15F399E409314AF71EA541BF867632AE8 B?PE/
59,006,261 *064F52118387D0F36E95D1553534C8EB1BC9CA23 bqty
59,006,262 *064478B1C86BB17B03A790D87520808C9BAC347D BRANDENREDHAGE
59,006,263 *06430193090F633D163A1FD817EC134696212FE0 BRBY95
59,006,264 *0642B44B959626375C99DD20F062B912EAC17F15 britnywatson
59,006,265 *064EA75C8568B19BFA297A87AA1C858957E28205 BUADQ
59,006,266 *064269CC8D4DBCE8CB07CE664A8C7DD223322A06 BW"Q"
59,006,267 *0648190B58109FAD32E4F2EECEB82E3AB9EAB3FB b-zch
59,006,268 *06495BAB7F333C86E0E3498A77A437A448BB6C9A CAN'TWAITONEMINUTEMORE.
59,006,269 *064CBCD0ADA0D43BFF2DF02903BEAE4499B1030E CAPPOTTIN
59,006,270 *064392A88ADD711C6BA82B0C7DC6E681BA756605 CARLY MILLETT
59,006,271 *06414D94C5A68788A702226CED0D52A60F50D7F9 CAROLANNS2
59,006,272 *0645D2CADE166E5FC24874B58BB67242D15B83E8 CARRJD
59,006,273 *06456AE62D16BF5925779B489668E52B79CAFD82 CASSAVEKOEK
59,006,274 *064A494915F9183C5564C601B11D6597C2DD3F9C cc#as
59,006,275 *0645A6F00805A00AA09EBC16A2CFA8BAD5A8EBA3 CdKq
59,006,276 *0641409283EA6E57D5BB1E48BA20694F3BD6B7AC CEMENTSTOF?
59,006,277 *064C4AE35F10D35C02CF2B2F24179B8CED1234CD CHAEMIN160
59,006,278 *06402E7BEEA085685EDAE4ABBE6F6CD74557BEA3 CHANCE.MANKINS
59,006,279 *064ED26060A89DEEA25B7A22E8EC9FE7DA14C8FE CHESTER1RAIDERS
59,006,280 *064C558FA1FC4F9DEC23484651982C224FBAB7C1 [email protected]
59,006,281 *0649B37AC43F00B15AA94D9A0DC4E030756F09C2 CHONDROCY
59,006,282 *0642819D24AB65E96B8B6D2F7391E41588E9E0A6 CJ5HG
59,006,283 *064E0D16FE8743DB58D08B725C90294220DE5588 c+k0y
59,006,284 *064AC359D23971375E706DF67B17F8F7043E4028 ckr12
59,006,285 *06452BFFA7AE1B700F0F4E497A955E3D010842A1 cl"
59,006,286 *064A7A610B3C11D57001517A65924FE77666B451 cleolionello
59,006,287 *064EB3923B336AFBE0E186402EFF37BF9D022321 clhp7
59,006,288 *0642C9FCE7704258E1F5D3BFC442D4C6C53AAA06 CLIFTONMUSKRAT
59,006,289 *064EAF1AC25AC04C3314AB6239E1E871E0E28F42 clm4
59,006,290 *064B98E6179605E87865D30AE2CDE988274CBD0F concertoforluteandstringsindmajor,rv93:iiiallegro
59,006,291 *0649E07C750E63EB0D357C740321F1C2622B6178 CORNELLCRACRAFT
59,006,292 *064C0EFE559D2EA89E82F115F294FF1E57D3DDA0 co;s
59,006,293 *064BACA6DFE29E55D4D77BFE4A48B60AA460DE5D CROUCLE1
59,006,294 *06492F83D39DE8BE7BA1E15A5E48E5438886D5B6 cryii
59,006,295 *064DC293530326E1C86F0E8811309786F6EF0B5C CURTIS.PAUKSTIS
59,006,296 *0647B448AD189AE1ED62A0A662696F39EB01C4EC CVP0F
59,006,297 *064640BB7CC4C6EB18C203B1961CAB3ABF9C4A1E cw5np
59,006,298 *0648C446C253979FAA727A5512915F9FAE9CF29C CwQ
59,006,299 *06401CCEF7C5B5AB5BE1FDFD3A26C208574BEEA0 d9;ea
59,006,300 *064C976A8F0FFC78988AC6A057B9C3748C19CC86 dafdx
59,006,301 *064E390F331335A1AFFA9059A4EC526766C252F8 [email protected]
59,006,302 *064066B29DFE939020723F10F3010D27A70050C6 DANNYCALAWAY
59,006,303 *0646637EA2FB0DF0C94052A8A5A9EB6D26D3692C DAQV
59,006,304 *0641119BE066C4A926A4955F57C76C20FB0DD1EA darrinmisumi
59,006,305 *0640E09EBE050A6A1DF2492E71AAA1BC787353E0 davinderjohal
59,006,306 *064A865666CEDBE1FADEAF02C5F29E065FDD30F0 dbx+!
59,006,307 *064C3DD899258B9E6D030190A8CD3AA1042476F5 dc7m4
59,006,308 *064DE44BA73395D33B4740FAF8985EEDF76F16DC dcqpm
59,006,309 *064C5F39CAE688E5F1DF798E8E2F65C11FC0BF6D DE11BERA1VE
59,006,310 *0642A3A266D33931F06A2AB0E45FED8383ADC03B DE5W
59,006,311 *064D749D77DC5653337650CFCAF7C21F68DB1AD3 DEANGELOHUGGHIS
59,006,312 *06451E91490E4C3E5B9F2A72C6655D3D774A19C6 deconcerteras8
59,006,313 *064CA741505D62A01E1BCB8D606BEBC3076ADC6C DENISE ROBB
59,006,314 *0643D321E87B516787372D89B8A42AEF54ECE745 DESCONSENTRAMOS123
59,006,315 *0642E9CD4A6C521E858E0C478D89753DC798C4B6 D/;f
59,006,316 *06499B427D75414E33FBFC03F13AB02CAD9A275C DGJSMOKEYS
59,006,317 *064F448735BECFD8ADE3864A702BDEB62C458D69 DGNVO
59,006,318 *064D4E61AB3D6689F72AA6AD0B2F10ECAEA2FDAD dhdgw
59,006,319 *064FA3AF7AC8D514D647E7DAA2335849CF65C687 d&j(
59,006,320 *064B68C151D5AABA01E53636B02488FE1F24E297 DJC=F
59,006,321 *064AFDCF7D8E85AF907291C5F4623BC8E7F0012D [email protected]
59,006,322 *0647A8FD7260C258BB5319608923E2F4813F93C6 dkh/b
59,006,323 *064B82BE6DB37503C44CFC5811F6680C6E7EB2A0 DMMQ$
59,006,324 *064742BCCC90B03E7E2103248EF473463763A641 DOMINICK.ALFIERO
59,006,325 *06444D37193044DD479B00FFB1775471F42C5431 domm"
59,006,326 *06492F4D84C1F23664CF0C7EDE0A2F5FA92A3461 DONNKOSSEN
59,006,327 *0649662931F0BB4CBC1FA984A683630DA27CAB9B [email protected]
59,006,328 *064395C1DA1A6E06D393CF2BF1A1B72A78E98BEE dpaok
59,006,329 *0642E123A90B6CD304EBE147A8078C993C704CDC Ds;
59,006,330 *064267F78D22EA2B1DAA2A80E69C01A563915636 DSM9J
59,006,331 *064515ABD18EF13E8BECFB652361006AD2FEC051 DSR1Q
59,006,332 *0648660C1F09058A46FEE5DCC0A4E8B2B989E808 D?TSP
59,006,333 *064B336C4BBBBC5952E076FFE152FB74E9A0D329 DUSTIN.MANNINE
59,006,334 *0645AB1923159157683A9ABDF507509C54B21779 DV,B:
59,006,335 *064F93952366FFD683F678D7482869945DAE2835 dw!lr
59,006,336 *064FC18A62AA73678DBC63E470CBF45DC3F2FBA8 D~Y
59,006,337 *064C4729B2B62BB81AFC1FD82B5CB7A9F839AB6F e}$c
59,006,338 *064C4A844DD431556C4071A173D2E3FFDE309EE4 ee'
59,006,339 *064293A20CD843F27262BD791BE15A4D602ABEF4 eie0%
59,006,340 *064FCC87B7458CCEDF0C78F4ED34A5EAFD65B921 EIGHT-BARS
59,006,341 *064307D80940CC48481D38238CB93666985795C3 EISAUFBRUCH
59,006,342 *0647998FE5E7F54B2126F3B29C465229DE8C4BB7 ELEGY,-OP-58
59,006,343 *064297037F69564116249DB16CCD797D1E866275 elijahscovil
59,006,344 *0642A4F64B3A6B4F71120673EB4EB6252D2A8B35 ELLSWORTH.PALACIO
59,006,345 *06449EF340EF7B5654FECA65C7A99417704AD80B ELMOMAXSON
59,006,346 *06422148E8DB0D702E3C653CF158484EAFEF9DFB elusive-spirit
59,006,347 *0649A60572E8BF0551B287179C148867D002B493 em4c147e5
59,006,348 *064E41ABC7866936B7D8107FFA055FF7D394991F EMILIOANDERT
59,006,349 *06430B0FF42B4B925E27B5A6AE34115E1860C8F0 encouragiez?
59,006,350 *064C1CEA653CDBCBECAB148BB99ED143F2CA9ACD ENDOSCLE7
59,006,351 *064340FED9E9D2A73CDEDEAE858EEC2686434C02 eneklof7
59,006,352 *064C3C8B505EA8CB23E9480C50171BD7D021B2F1 EPILABRA5
59,006,353 *06402936B150FEA02BC78CBAA1E79CBCEE1A01D0 ERAZE QUE SE ERA
59,006,354 *064C82416C50F23884855F29DBF57F8F90B16BE5 EREMMERK5
59,006,355 *064A981F64AD0D99825BE80C4208FA62580F0BE0 erfuhr
59,006,356 *064CAC8C287AE5768674FFBE6D372CE87D5C64FA ervingrimstead
59,006,357 *064BC1905794E90D54AC4951E66637C9DBF1A46A ervinpetito
59,006,358 *06492AF54E7D3897C9AB3E7677380D035B682841 ESCHEIDTED
59,006,359 *0642A8954B79D75A0908D0207650546ACEBC6C1C ESCOBOS9
59,006,360 *064E238DB31C6E57A4B87A4D37129248C3C78774 ESCORREGARIAM123
59,006,361 *0644A4A295F59772D49A5A993E65F64A1F37486F ESUNARNI
59,006,362 *06429829D44C659F1FACABADB435C7D91A7ECC96 eswirddieneueweltgeboren
59,006,363 *0645B0B08CF612FEDC03093EF67846C9A04C04A0 etarhtru6
59,006,364 *064C346932756032D9AA733A28DFB392D95758B9 ETNEMALL7
59,006,365 *0646C8886770BB39A4550BC11A0EC318413D1488 etudes,1erlivre:ii.pourlestierces
59,006,366 *064931F01443B7031F3DF9323AF29F9054E3DFCC eyacp
59,006,367 *06471E775330C95E4B581DED231B299031E11695 ezitenoms
59,006,368 *0642940027C8A73663893ED7204D7F6042270F4E FAHRGASTUNTERSTÄNDE
59,006,369 *064EDFDD25F08F2F8658374B87364BBCD5481BAF FAUSTO.TARDIO
59,006,370 *06486A67874D41AECD8A6AB3CB4DC629EF0F1E70 [email protected]
59,006,371 *0643E7937D4D7AB64627E6E5A3F8FD2B9A3C2004 fbvfont8
59,006,372 *06483EA6BFCF402D9DA0D52AC2B01803EE4E6095 felipesattley
59,006,373 *0647B9345710931CEB04AE4A15FECDC4A5142968 FELTON.BEVILAQUA
59,006,374 *0645328258301BD77797DADCF635D7B851AD3418 ferdinandlarabel
59,006,375 *0640F9444B2C3D6D1B788B537EA9F719297D7875 [email protected]
59,006,376 *0640812CAA60BD23FACECEEECFCEA0694CC0F228 FISH-IN-A-POOL
59,006,377 *064221F5AA73F2FB2042B802EA59303F66DA33EA fit-your-style
59,006,378 *0640D31FA7A47ED54F6A301410F280577C94CADF FITZWILLI
59,006,379 *0641585AA81722A8661936A2EDA9B37C9780B105 fora$
59,006,380 *064D19BD6574B5F160B8141BF8C0E5DC857891F7 franciscoheape
59,006,381 *06430684EFABDC8DA7F420A17739CB0A76F83523 franny
59,006,382 *064BB9D58BC6C87643E2E49CC78BC1ECFA0B0929 fredrickainslie
59,006,383 *0642A5E985993560292E2E15C280CDA0E19BB65A fredternullo
59,006,384 *064568C9771047D09CC62575568550679F834242 FROGGYRUY9
59,006,385 *0649971ED4526CB48CB98C1D832B03A03CB38EC3 FTAKDOOS8
59,006,386 *0647CF7F226AD812101538FFED5B453BA38D4DCF [email protected]
59,006,387 *064BCF84CAA3D3D781E64E88443130F53E3E8CEA g1"u
59,006,388 *064B48010CEF61D32D310EE19104728B2DC18E38 genarowalder
59,006,389 *064DBA8EC310671EB1A23F35AF1F81825B87677F genewiechmann
59,006,390 *064EB9E20BF0B40B263255BC206A971DB8E02101 GERALDOSARSON
59,006,391 *064D474867B6DFD9BC5614CE7623AAFEFF2D5184 GIANT.FENNEL
59,006,392 *0649957B2B51F566F2427BB73CA49475E5148F2E GMF7046
59,006,393 *064D5F38C9A6B67EC5790FD4C0EBA67396F86DA9 GRAVANLÄGGNINGAR
59,006,394 *06486BA46BFD0C3C79176E97A3D07E58A96F40ED GRAVELDINGER
59,006,395 *06473059DBFA09EBCE6FC6380E3C80AD4E3BBEA9 GREASETH
59,006,396 *064EF8048436D328297C9B5FC5FD85FA32FA2ACE greenpages
59,006,397 *064C01597DF87F9E58E937084772B3E660CFDA9A GREGORIO.MELODY
59,006,398 *0643E3B0FFFF9EE4841C0000127287DC7B77000C grensgemeente
59,006,399 *064FED2551B9E887FF7D867AFF6007DE531D1F55 GRIGORIEFIMOVICHRASPUTIN
59,006,400 *064130A1FC61EBAFA535395FA0C96876D700D436 g;ux
59,006,401 *064FE91FBA0314327438922A0FEACB3D4D877EC7 H4RM0N!Z3S
59,006,402 *064BD81B00D41803A6CD40357EF60C1676963D07 hannsining
59,006,403 *06429AAFCABA705BDB9391437C8CA31F40463700 HEERTGEN
59,006,404 *06453A1255A5494A1334375BF2A3BB55FAC53FCD henemannus
59,006,405 *0648363DB44328A039B0B5132B7CAC2375091F8B HERMESSMILE
59,006,406 *064E4C93EC8F1217A6F9EA5F2126DC411F784FAB HIRAM.BARKMAN
59,006,407 *064CF347E121964C004A2BE7761AE05703A0E7A1 [email protected]
59,006,408 *064E27F16B04D0114F669B5F0E29C2E70602E36B [email protected]
59,006,409 *06479E456F48CB5F4E0CD2540D0E5B8D5E6DB97D [email protected]
59,006,410 *06488FBA1620EA71C20EF7C3C5F6D77F20C48333 HOLLINGSWORTHLANE
59,006,411 *064C227AB6BF6773C578A13D6BCE88F34D958884 hoseapechar
59,006,412 *064F174514E1E96D0CE52ED775BAEBBC3D1CD997 hotelfm
59,006,413 *064F9F522FC7EFDD1264253E88D18317B9C24332 httpwwwmeforumorga
59,006,414 *0640056E51F16C1B58F9A44911CC794484ED7F28 HVERONICA0
59,006,415 *06405986A45014A0E4CA68DEF751078FAE5A9197 HVWQ
59,006,416 *06489FDDC85313A10597FE83F2C43D2ED9062192 hymanshade
59,006,417 *064DA3DEF790D148E31E23B517B7E8ED1D061D60 ianewen
59,006,418 *0647135D86F21593CD5B6C21D4C47407462E674C IBELYITE6
59,006,419 *06499F0797018379D1BA9011E57145579F7D199B i-can't-and-i-won't
59,006,420 *064A7CEEF97BFEF598883A3210B62D4006430A25 icatopu23
59,006,421 *0648518DD7AA229FFDEAF3AD6653AB63AB1A6ECD idiotroy5
59,006,422 *064157B8C2F1BFB63B0F2B30D300C3C6C2DE0E21 ILKJ
59,006,423 *064571608011D1FE13DE0462E6E51DE5E06FB94D IND-MOVEMENTORG
59,006,424 *06470501BFD8373162E4D6B428D1A32569AB43B4 inthemorninghour
59,006,425 *0645D39AD9571621D285683F6905844F57B15D1D issacshao
59,006,426 *06470937107D10D9252AD4AE82B60B1787D95D88 It's-So-Real-(radio-edit)
59,006,427 *064CA18CDA446609F4A1DCE9A8C75B8C7BFD44D0 iwanttolivethegospel
59,006,428 *0646689DF35F85B56864F226F4309556347F36AA JACINTO.JENT
59,006,429 *064936D18430D9302EB1BFF2BBC3951D27316E6E JACKSONSTRONG
59,006,430 *0648CE6678A408A71D5CDE276ED0761CCF77A103 JDFCILYN94
59,006,431 *06453E0F73CAD18536A71E1DAD534805004E3C83 jeffryfrom
59,006,432 *064F71F3A46C34571BEE099CC1FE036FDBA87362 jensy
59,006,433 *0644BB8870AC9506D5D10B0DB9F1DA00BFDB7E25 JERRY.BANIK
59,006,434 *064721C38BFD7418D198B653A4A49E9558ECD44F JEWELL.LYERLA
59,006,435 *0646F533645F8BC299C117BA7FC6DF309D7E3561 JEWELQUILES
59,006,436 *064C99A8D63BA76815D7F6F023AE368CDF3CEFEA JIMMIEFREDERICK
59,006,437 *064F771E090791D358E07CC7E9D1EEBB4D1478DA JOEKAHLE
59,006,438 *0643D0B751305685DBA8F224AA47384A0DA96FBF JOHNATHANVANDRIEL
59,006,439 *0647E9C1F6E01C26E40FB31463A157CAE2671ADB JOHNATHAN.VANDRIEL
59,006,440 *0646B4B99303C85D97EE7313477693C420095D7B johncalger
59,006,441 *0648569292841373AAFB83ECD9B2F426D8F1008E JOHNNYBROLL
59,006,442 *06488716D95FBF4914A9AC46F48ECAC191D07A8D JOSIAH.BRANTER
59,006,443 *06463E38EB09C3A336F202B75A2103F8A90CE674 [email protected]
59,006,444 *0643B308E473FD20EFD0D9BA34AB754EC2D73CD1 JUDE.HASKEL
59,006,445 *06409B678FD8A6C0BFF850FD2D106182C67859D7 JULIEN-BENOIST
59,006,446 *064BD92BC31081C8E730B5215DC64CAC88DE3EF0 «JURANDIR»
59,006,447 *0640E2B76E59E371571146769E417E454019983F KANSALIITON
59,006,448 *064E2C67B530C41155BF6438B5F66FE4A1E1A397 KANSSONOCHPETERHIMMELSTRAND
59,006,449 *064AD9E33F7E5DD05920A821CE0E3C571A6B76D7 KARINCOUSINS
59,006,450 *064C21DB7A25FFF52F3FD92C80AC14F7DB230B71 karving2
59,006,451 *064DDC205D4AE05581E44D086B6E46392CA92B6E KEITH.ISAIAH
59,006,452 *0647E7348E838CD1C40D36AEC3CDC48B360E52B7 kentfurfaro
59,006,453 *0649323B07F710913BC5DFC13DEBFBF9DB245570 KENTONALDINGER
59,006,454 *064F7B184C4F959927E293037584AC426101AC49 kentondoakes
59,006,455 *0648480AD72CC80C3A41982244C61A42557C5E37 kentpiermatteo
59,006,456 *064A9AF66AC80EA5FF15199CA04B9409485EE7AE KERI51
59,006,457 *06429C46CBFDCF316AD0A1327CB61B745A64C041 KERRY.LENKER
59,006,458 *0642C69D671A78C8F01650900E68CDDA1527CCBB KIM.DENSON
59,006,459 *06415306BBAE5AF5A8E346B38600ABD6BC012DEC KIYENTUJS
59,006,460 *064D84106461861D122A5BDC466EE2910274D4E8 KOLSTAD8
59,006,461 *064359EE6F97869E5EF52FB98392A2E34DB33911 KOMPAKTLEXIKON
59,006,462 *06429F41590719874D55D3B3355EAF5E2B5E5F5F [email protected]
59,006,463 *06473B637BE8076CFC8242615B44E5FAD9840CB4 KORPAD
59,006,464 *06457B47E69CC1E8E12048800A58C8D2DB0D256C KRBEPRIVATESESSIONS
59,006,465 *064DEADC2DF3207B3102005E527C6301BC3F5531 krco-cpacomwww
59,006,466 *06485A33FFF24758DDFB9CA24B77390805A03E37 KREIVI DRACULA
59,006,467 *06487A52438A3C08555F1DECDD3C27472C181789 Kretenskim-1
59,006,468 *064306C1DEA374C89E2A9E82FE3EA4F3A6EC1B39 KROEZELE6
59,006,469 *06476D8AF3406F60FCF35053BC75E2D18A11F551 KYLE.WEIGEL
59,006,470 *064136FEBE52D12A50691C17795248EE3829E907 l1berally
59,006,471 *064E3FAF8AE72FF07169121748BEFC9B00D28942 lavavate0
59,006,472 *064DED7BD78D1AF177256F852E30BEB10C1177BF LAZAROHEIMBURGER
59,006,473 *064FE92591A5F1C477275732473289C8C89B8641 LEMUELAMESCUA
59,006,474 *064D16165E87DF20847F041B6F71FC6975220443 LEOPOLDOCAISON
59,006,475 *0641CF957BC0E3B2A3F09F2754709BFB37D01371 LESLEY.LOREN
59,006,476 *064A084C8557629FD1A65B56075E5306C963AF79 LESSONSINLOVE2007(TCSMIX)
59,006,477 *0644DF0E47DC83655DC630B25B34567F10E900D3 LEVI.GIORGI
59,006,478 *064A102211E4FAC89254242E9F3A9D6DA0F11FD6 [email protected]
59,006,479 *064285D51BC6683A6E0061E49FE89FFF91251299 librarybutch
59,006,480 *064E9814236945A9018999E530BCF55D67661315 lillepostbudmindue
59,006,481 *0648298C02A49E343EE86A1B628E7F0FAD74B894 [email protected]
59,006,482 *064E6A168DBDA634D9E027E798D84985DDBD002A livejournalquality
59,006,483 *064F173C497B1A2AC3AF2A6FDB359AC7A7F78429 LOGAN.BICHOFF
59,006,484 *0649D0A18A6EDAD9818BC7FD46D3D54A20FEB031 LOUIECOSENZA
59,006,485 *064D413689245B79834A09D447BAE8E80BBD9CB7 LOUISEKATHLEEN
59,006,486 *0642AC19634EDA6D59D23E7471BB8FBDFCDBEEC4 LUCIANO.BLAKELOCK
59,006,487 *06469A1DD7F9F6761571B24B90A3DFE2006014B5 LUCIANOPASCOERIPPEY
59,006,488 *0643115A6E10F6D46A70DEE243C98230B19285E9 LUDES1ERLIVRE-VII.CEQU'AVULEVENTD'OUEST
59,006,489 *0649B451187BC35365BAE685D9A7BD1554F46ED3 [email protected]
59,006,490 *064D66D7A5CF3B2FFF371EE4EC7E6A67F4467383 «LUNDIS»
59,006,491 *06449B4B57F2BB48C044DB8D42E369B6171188A3 LUPE.MCENTEGART
59,006,492 *064A428FAB882B007FBC95315577F76157059CEC LUTHER.HELWIG
59,006,493 *0649D8AE4F9CD18FE45F09288703BB1A4FA0DC81 [email protected]
59,006,494 *064A3723BFBAFAEF290A3AF9DDB096E536543EA8 lykenses1
59,006,495 *0648CC0A9A7E29A27C583D605E84C264AB41534A mand011n1st
59,006,496 *064C3C7B4D3E7A4ECD2BB472E4B4A097B61729D9 MARCELINO.SITER
59,006,497 *0644F5771CFCB7F995113586553CE7A32A439BAF mariavodopich
59,006,498 *064FD00B550B24B5F0C7BD41311227897E1FA71A martials
59,006,499 *0644B9392649E471BFD740B6BBD43300F8528B8B [email protected]
59,006,500 *0648A78D69DECE40CCEA856F57AF1516ED8C023B MAZDA6EX
59,006,501 *064D476FD79BE7FF9C6A2013DC251F868CE92D82 MEECEWESTELL
59,006,502 *064BF512E80DD38E3524C575FB23686281BA925A MELDABSW3
59,006,503 *064FA11FEE27436E573A882E06C6B2178FBB7C00 melvinisbister
59,006,504 *06473C7D22A242049CAAEFDFBAFF6BA74EA28129 MERDAINTER123
59,006,505 *064656DFC28CAC71BAF10CA3B4EDBDAFA0607B01 merlinbalder
59,006,506 *064292363975AC8219ED7F4A5EA489173B053149 MESSAGE8
59,006,507 *064DF1B80B369FD89443F41BD1F9AA0ECE3E63C1 ˈMIʦA
59,006,508 *0647D3347A90BC12EE4048CEA0F666306A6176F0 MICHAEL.KEYSER
59,006,509 *0646D2DDFAD7C91E1441721E56929C0BD4A8B63C MICHIELOVEREEM
59,006,510 *064418A3B33FD9D59733D092754DE5651280DD60 MICROINSURANCEFOCUS.
59,006,511 *064F1EC3E22589D224831BE2E2BDBD32760BF2C3 MIDNIGHT.(12".MIX)
59,006,512 *064C3D6DDF6E033825DCB5ED7B9EAF8055C50B6D millepa3
59,006,513 *064BEB861FCA703C5BDEB9A1458BFE358C18F174 MOULDY
59,006,514 *064012154F8EEDEC56DB4E818F2B834F4225D300 [email protected]
59,006,515 *064BA23842678E111BE9CCF9EB9FC4345F98D9BB msinaedilcue
59,006,516 *06464D2FE037642401C98E937D5C892D47BEF993 myrocky63
59,006,517 *0640F3FB05144EAEF991BD8D3950D3206021CBC2 nelomruuv
59,006,518 *064E0DAE7F276639FFB2668B2B81DB1635A6F2D1 こんばんは、NEWS23です。
59,006,519 *064D1A4B08BDC67A4BFFDC393F9AA3AEFB55BA37 NICOLASYE
59,006,520 *064995572E88A05546F3C74526345A5F2C6A20BA NMCBON
59,006,521 *06405B957260A8AC56BA0E820D5507F7F7F39352 N]N:
59,006,522 *0647119B9340AB396FEA5EF2D671362549856B92 NOOHLONG
59,006,523 *064BF5ECE0F14D559AB79DA67309FE7C22FFE133 NOUTAG
59,006,524 *0642FD6A1A60882CA6AF41598402A25D9D984DE9 NQT,
59,006,525 *06437BE158DD49532124B4EAFDB8A34414D35528 nunzia.rubino
59,006,526 *0646C48FE17298AC9BBCDB3BDD2281E88F5248DA nuoruudentango
59,006,527 *06417FC2303206F4519BDCFA1FFABCDBA77A3427 [email protected]
59,006,528 *064E14A8F3804082E48F14F474C70E95AE8A92C5 n(xp
59,006,529 *0648DCA9C8B00CE66A3B08E125794F2FA6788212 O54077
59,006,530 *064A7E0B52104E7B7B03EB2191697BCEE84EFA1F oahbaa
59,006,531 *0641039B4DF383A9C357BCDC0E4D4CD866EAA07A ODOBENUSROSMARUS
59,006,532 *064C0FF1C15ADB8CCFB51CAD4E29E30EC68E953B OLUMBUSCAYREWCAY29S
59,006,533 *064C2CFA7397DF98EEC55AC1BF39A5027DE48F57 OMIHILEP
59,006,534 *06433605ED9B8F2A4B469ECF55EC1196D6B4692A (^_~)O~ [email protected]===B
59,006,535 *0647424E554B4906A8C2E3F70F12F876ECF39E89 (~_^).o~.q------3
59,006,536 *0641C4EFCB5B7702B707A26EC285EFE228BF2A96 ORLANDOORELLANA
59,006,537 *0645C9094B8DA33920E18096036A6BE939D8DE33 ORLANDOPAWLIK
59,006,538 *064336F2A39269F6D8910ACC15398B1C0A1055F3 OSCAR.MAGLEBY
59,006,539 *06484211FED771B88B073C8E2CAEEE50B0F3BD99 osvač
59,006,540 *064E4780C4A3739153DB189F6174067D48B8BEA4 OTISSESAY
59,006,541 *064BFD29D01BC0AEDF14E7E9D5D7B84CC38042E7 OTTERSUM160
59,006,542 *0640660803CE265EA40A0792977E21A321C04158 OV3R51MPL1F1C4T1ON5
59,006,543 *064835CB31654B3091E1A7462E1D74357D790F41 oyjyykem59
59,006,544 *064D658D7E9C45370AD9222FBF1C230E45B04343 PASSHOLDERS
59,006,545 *0644472F9E242A752BC353A4513CF8C6CBC8C565 pavlecka7
59,006,546 *064C1C72679296C211FC091065A58A90BF976851 pedrochukri
59,006,547 *064CE1052F47A567B63BE4B379DEE848EE392499 pedrothreat
59,006,548 *0646D33580EC9D949CF7CA3D53B8D387D3AD8F59 PEM11WC
59,006,549 *064221659DC9A0F18F6A042510C5E2FFDFFA989D pepega
59,006,550 *064CCA5ED4D12D77F422B030D9102E648D1BA98B PODROVALO
59,006,551 *064FF596D588B45D364963944B36E55EA2CC42A1 pozmovn6
59,006,552 *06482EE1469A438003364516DC5246A5D7E7BDBF p####p~o~o }o{
59,006,553 *0641C079F57730075585B1CFF0497066169745D4 [email protected]
59,006,554 *064C5292441BB3F9EBED0CAB3444D5AA04C7894B praktiki
59,006,555 *06457938499207E9645B7320E2635BF92C8179AD PRIMTALSDELARE
59,006,556 *064A4C2653427632D95BFE3C6CA0F0CEF2A70748 PRISJECA8
59,006,557 *064B594D1047D4BBBE7F91118D526FC8196D19C7 PROF!+ABLY
59,006,558 *0640BD7247943A2833753D7CB18F54F874E81D53 [email protected]
59,006,559 *0649C02154F7291CEBA8EF249397BF4179903CAD PRUDELLA7
59,006,560 *0649BD90DA7156AD2EC3BA196A494F3F1EBBFF44 qc{c
59,006,561 *06414B9B4262F9774AD72A488D9B8FDFECF3B5D3 QUINNGUNDERSEN
59,006,562 *0647651EA9908B7DBA4DC767E4E524754BCD7BE4 Q-->`~-`~)X(
59,006,563 *064E7B017CFF5CDAD8DF37C2EE37B4C0CC9238AA [email protected]$
59,006,564 *064A01B80E251D8E02A5D3B69B25C7C51D1D0163 raleighgaviria
59,006,565 *0640E675D4A8064734F08A358A4D5F98A6E7CC84 RASHAD.GIONFRIDDO
59,006,566 *06486ECC0FEDF4DCF8B8AD188E9A74D1465C4B9D RASTUŽUJEM
59,006,567 *064B6D32F924AD79A6483122C3605D59B1AE25B7 R)D$
59,006,568 *06485E0039CA6193071DC401525DC59406039EE1 re3v
59,006,569 *06444272BE5428274CCD8248A074BE0250B83F63 reginaldcook
59,006,570 *06439B6F9EF4AB1CF140F9B9AB189F779FF87549 RENE.FAYE
59,006,571 *0649060AE0805868AB5FABB29441A0958768088C RESPEXISSESQU8
59,006,572 *0644A4DDE39252A3BC508EEDFEC0F0E6121B3CA0 RETTARB5
59,006,573 *064E2D913E5CD327FB5EAF466A9E5D9711A8DE60 REX.ATCHITY
59,006,574 *064DEDF17F5B0183A9E5572D57731C050040B4DD REYES.YOUKHANA
59,006,575 *064FFA996952FCA064BE2F376972AF563A3CC567 reynaldowisseh
59,006,576 *06421C78FEDC0057A3846E5D5BFC2D55F90D96C9 rickgrassman
59,006,577 *064CBF97CAE510B009A9A973B567424A43A17162 RICKYHEIDI7
59,006,578 *064ADDAB9B7F0B3757877E18FC9BFF51AD136250 riight.haand
59,006,579 *06423809964397697359AE000EFA144748C25C0E RILEYSHARPEY
59,006,580 *06412BB9F327D0969A5D3F71594735B111C07597 RINGKONNANÕUKOGU
59,006,581 *06450C277A20B6866954CE68DF0A4062C04AADE2 robbyfidell
59,006,582 *064E83A5E66ED048F773A59741EE5E52084275AA ROBERT.MERZ
59,006,583 *064BC51A9F56F3ABDC304D1647F547472A4037C0 roccosurette
59,006,584 *06486EE0682AB6C3C8B91EECCE7721123E0DCC07 RODRICKVERNON
59,006,585 *064EB8C98A0E05F158B06EEDAE17D2FBBA94FEBD ROLAND.BEVERAGE
59,006,586 *064A4E77EADEB94D7016B0E48B70C59A7D43347B ronald.khan
59,006,587 *0649776ECE8AFE8AC54E9FBBD0A597F817E06B7E ROYPIERRE5
59,006,588 *0647ACEA226778BE9BE3523E9D948ED061EE1A43 RUBENMONTESINOS
59,006,589 *064FD835EC347E2F23337261E648DB0D336189D7 rubensherfy
59,006,590 *064E34C2F36E7F2B83ADD8F0D23A02504B6AA400 RUSKEALA2
59,006,591 *064979E168C444D2CBAE4AE0890F69D9035A8F0D RUSSELLBEAL
59,006,592 *064C327B74E9E2E30A183EB21C3F0FA7C4D5EC4B ryan1422
59,006,593 *0643CCD8B64ECBFD64FEF537D597C4DF34363CEB S51315931
59,006,594 *064CAFF4C5EE71A3585F6361564E7DD6802F0755 SALVADORCAMAEHO
59,006,595 *06465B7155DB8EBC3CC3A88DC4F818252B80AE14 SAMDAOU
59,006,596 *06418B4DF9AE6F1D5583A48885FD1AFBB237655B SAMUELZENTENO
59,006,597 *0642B184571A191304A06695C87FD36ADA7F23D9 SANDYBRACAMONTE
59,006,598 *0647426DBFEBA2512285DE71DAF81B36E7401C78 SANDY.IMPERATORE
59,006,599 *064CCE255D81AE19416052668E67F267FD7991E3 SANGAMESVARI6
59,006,600 *06468D6C20B200E17EB44039B2CECE98E635AC89 sarah456
59,006,601 *064A033C43F0114951F8A599B6036770BFAC052F sarvnaha
59,006,602 *064CD34F0F993D85B7B431B0EDCF152A93934407 SFETSOS
59,006,603 *0648C83E78FBDD1480017477C2A824672EF6376A SHELDON.HIPKINS
59,006,604 *064981CE28F7301D767A60FD29413C17DC25FC27 SHIOTAK
59,006,605 *064FCFB3887F44E0B73DF50E871E2EC3065AB084 SHOKKEIHIN
59,006,606 *0640C1E63ED8CCC6DFBD66BA45FCC38760A07B50 SHON.WILKES
59,006,607 *06414F1B833E76894645B182F138379CF2603419 [email protected]
59,006,608 *0647BA9B77F81DCD7FE1AE9A8FD916872619CC4C SHORTYMITCH4
59,006,609 *064DB43A0DC389F24B8AD5F485E7504B9329EFAA SHUNSHUN0
59,006,610 *0645C6A1BA81BE3DF1A61798DBCE150779CB980D SKIWE4RS
59,006,611 *064399120010034D7058D1D123C41CDA97B07DD4 snlychou97
59,006,612 *064AF43DF49ADC93B3F82D2ED841603165D47D7F SONATENR2BWV1031,ALLEGRO
59,006,613 *0641B817E38B7C2C97F0CB4F29FC87B8F0D52F53 SPANNUNGSEBENE
59,006,614 *0640A5F317911DA1525FF78D1D5EF5C05171660F [email protected]
59,006,615 *064A531012CA2A106303D952B7CB173ECBE8D445 [email protected]
59,006,616 *06446AD40B2A35BD360E4ECD46864764E9184C79 splat!~~~(8
59,006,617 *0645764328C53CA714808BE1243A995864ACCB03 splatO~.(--3
59,006,618 *064D24F917629BDB923EF9AA2C9D430B21F4583F splat.o~(=====8
59,006,619 *064220AD1C70FEF9DB09B323BB834F0A30660E7A SPLAT!! O~O~ @=====B
59,006,620 *064CD5DDC569059E7A88DCB0E0AB5E924896566C splat!*-*-q--8
59,006,621 *0644CEEB954EF5057EF35A93142A686D1DEBE2F6 sputants
59,006,622 *064A2ADDAB31359C2D751834B78F7BAD314B61FA SSNVRZHNNG
59,006,623 *0642F78D4D7D652F28EB4A4DB8E04EAD717DE184 STACI.CROW
59,006,624 *06495DE8EB1D7F7B16BBFE4B87BFD8A085748E85 STEFANIE.LIGHT
59,006,625 *064290047EE37A1B98C12C1FB39C4A2357F1E4FC STEFANPESHEK
59,006,626 *06486B3C82A91931258C3F0368BB3AB3962C0719 stepoutintherain
59,006,627 *06410C62361F1FE883E3F1DE2F8716F42ABB09A9 STNGRYJRD
59,006,628 *064CD08944EE7B068CE76F7277816EA66A76DA4A STRAWBERFIRST3
59,006,629 *0643705DD1956C4508C4C4B52B3AAB2FBC47403E STRETCHINGSPORTSPUN8
59,006,630 *064D661CDB93A3616E89544B5AD76E442E9604CD SU8L1M4T1ONS
59,006,631 *064FB3AECEDDEFB074238F851CDEA78E03CC2CFC SUBVEN
59,006,632 *064C22489DF474417712B7468811DA31050C2328 SUJITH S PILLAI
59,006,633 *0649A44E1D307B8814638F7A5EB2357A93CA7528 SUMIGO
59,006,634 *064D7BAE27A507581405376407CDC3F132370B96 SUMIVREN2
59,006,635 *0649D417424AE6F67B32FAE81B95D14B5FAF8E21 SUNDSVALL.
59,006,636 *064F8BC7272E870ACA5924DFD438037DBAD63EB5 swadhin.mishra
59,006,637 *064DA15EF4E023C0BE6FCF54160A8DC140895EDF swierkoses
59,006,638 *0641C3572D805D5A4EBE9A033A0BFF2F183393F0 Symphony.No..5.in.C.Minor,.Op..67:.III..Allegro
59,006,639 *064F889CD4F0117027BAD18898C5092F270DCCF6 T66650
59,006,640 *064A30AAC8521B5E66BE32C24954F02CEB7E5365 TAAATTAAGATACATATATGTATATATTATTGAATTGCATTTACCTTTATTTCCTCTATG
59,006,641 *06423802710F631F3EDBD4C1673A5DF341910027 TACTTACCGCTCTCCTGTTAAGGATTTCTGGTTTCCTGGACCCCATATAAGCCTTCTCCT
59,006,642 *064240C60F83CFD67CCC4C1D22F42AFC7D345071 TAKOVITS2
59,006,643 *0648E215202B40C49A52335AE774D16FFD5BC3C4 TALK82169167160
59,006,644 *0648BACCA49C27BCD3E8B2C0A987FC479E25DBF1 TALK89.180.170.115
59,006,645 *064D43F37FD9EFEDD3F97F5DE2D35107421DD55E TALKCHANTIELOVE
59,006,646 *06479E5EB74BADEB90F1218109E1C421329ECBA2 TALKSECURIGERARCHIVE
59,006,647 *064B1367A9EFC336CB2A164EC9B20989A2AA6ABF TALKVALCANOS
59,006,648 *0640F6F61F39B16181F5EA5241A663426A48F946 tanewej
59,006,649 *064377AE508FAE4432BBA2FB873DE4AC79041EE1 TEPMACNE5
59,006,650 *0645583F07CCAA21B1DD90C60691E94FDFDDB567 TESERAUQING
59,006,651 *0646DA1C7726AB6270DDAF1F1FE1413CAAB71E3E TFAALSRE7
59,006,652 *064DE1607AC55E769CF31230151C4481E0AA6B19 THADDEUSMCDIARMID
59,006,653 *064EEC62BE4B19E2F6D9AFF3F221899A6AA6F474 THATFICTION40
59,006,654 *064100625981E32646D0E5E4B1255E4494DBEBA7 THEATRES
59,006,655 *0649894634B0F9AEDD1FA4A0117B9DCBA56BDF03 THEFRIENDCATCHER(DEMO)
59,006,656 *0642F03D90DAEE339CA2D49A57E097CD55EACCFA then-click-firewall-settings.
59,006,657 *06492D77709B66B9B0A0D08CF66187E0D063D6E6 TIARENISU8
59,006,658 *064084729CF85FB523E4F6A687C0B761E406547E tim.beetham
59,006,659 *0643E714EEDF9480150BC41F541293D36E7E8052 TIMENESS
59,006,660 *06412DE50FE4F5ABC6BBCE9A8AFB5B2C0DB84420 TOMAS.ZBIERSKI
59,006,661 *064D1433BD1E089E82A99EEE96CF832816CD51FB TOPNOTERINGTH1
59,006,662 *064476B553F95E6F9E9ECC41FA775796587E4795 [email protected]
59,006,663 *06459ADC13552854E36DADA2D94DC1A3A816153C TRACYGRAMMERMUSIC
59,006,664 *0644C3BCD1D187F0B7A2424EAE4708B67A48FA36 TRADUCTIONE9
59,006,665 *064A396249C4EAF2A452B7285FE47A524700823F treasa-howard
59,006,666 *064C0EEB2D56D3A8649E3949B74F0DA470C33625 TREVOR-LOCKEY
59,006,667 *0644ABD9B98EDDBBC69CD0046E13DC1270DB4602 trevorurtiz
59,006,668 *064AAAB06D42EDAB8FF08332A8ECF3E3810D319D trina.l.gervais
59,006,669 *064CA7EA7CB267AA3C42BE24C9331D62F3DD82FA trisquare
59,006,670 *0644DC489DDCAD15B6B1ECB6531C2FC1A1FD4625 TWAALF4
59,006,671 *064DB0FC333223B460858F2FF35A74E12C106247 ueberlad7
59,006,672 *0646DC4229365509BDF9AE32CCC4822C0052A344 [email protected]+c
59,006,673 *064D5DFC2C5740DB71BADE5B948D3E242BF8F433 UNEXCPTIONABLE
59,006,674 *0647A3FC6BE6F8184E63BA08C8F31933BBD3700E UNMONDEPARFAITALBUM
59,006,675 *06483AD927AD8D4290ADAD5778C4B0A83D8503D3 UPPINA
59,006,676 *064C6643A1D297C3061E1E7C88737A7D6C54D32D USERLAKSIRVAK
59,006,677 *064249DCFE96436A39FA3EDE6F3BA5EACEBF244A USLSEPHYTAJ8
59,006,678 *064EF02AB25A76F65D94C7DABBBD69D6B04E3E82 V4L4NC3
59,006,679 *06451476361CF98FA255ACFBB0F063EE3F27A40D VANESSA.GROENING
59,006,680 *0641098738F7CB742743C7EECBD8F9CBB5417BD3 VAUGHN946
59,006,681 *0646FED9AE25B030548CA2B6EF6738DD0994E340 VAULT031
59,006,682 *064ED64BDB8FB8813CE80078B7D0984B8941B007 VEGARDLANSPEDERSEN
59,006,683 *064CC975489278ACFE55380A19F747172B63CC5F VENKATAKRISNAARAJAGOPALAN
59,006,684 *0648EB5BA17C02F248D90488F37AD4D752782328 venture-capitalist
59,006,685 *06414B67D811706BF0D7961E92EF85D6523EB09A verwundertsein
59,006,686 *064A9B9BF625DD18BA6F16247ADA506B6B66AA18 VICKIEMIKA
59,006,687 *064C81BC2EB6DCEB62BF9B30435273F00F40ACDE vicky-seamon
59,006,688 *06492E1EBC2DA9D8FD813EB4E9FA0DDC3DF30EA9 VICNAVDA
59,006,689 *0644885117E57BC3409DF1A9650619A5A69BDEBD VIJAYARAGAVANLAKSHMIPATHI
59,006,690 *064D9CC43B2683C68A291659030304DA556B3585 VIJAY-DIAS
59,006,691 *064DEF9BEACEDCC3AF8A552B40CF1EF509BEBB96 vincefusillo
59,006,692 *064A426AE05E04D01AFB6DD5E7F5D67C219F4BDF visithuntingtonorgwww
59,006,693 *06456EA18ED4E0EB8C86D0E7B03AD56916C504C9 VISITNODE.LEFT
59,006,694 *064EAB3A3E575AD4665E39247A3BBE4E8A46919E vladescupaula
59,006,695 *06433638270E8C7E63FECF75F2592315E7595F9A VOORAFBETALING!
59,006,696 *06477EF2510C0BF9EAFE19A4D37F28ADF864408D w65xinj8
59,006,697 *0648236D23828A353DDFA7F9B87F43A0AB61DB34 wajhiuddin.ghori
59,006,698 *064B78791082234AB35AAE8CF03D367C4151DF65 WAMPLERN1
59,006,699 *06467ED5A6EDEEE0A19A62E8A241FC25BFBB0248 WARD.SIMELTON
59,006,700 *064493213FBBB6AB3AE47CD9271F31FD2293AA43 WARRENLEEN
59,006,701 *064CB49DB310EE1DAB934ED56F319990FFC41F71 [email protected]
59,006,702 *064A2840D5E3E509E1A3E33C45DD99032CBF7796 weathierandfairer
59,006,703 *064027CB8E4A4E497A4A65CDA2BB2EFBC057327D [email protected]
59,006,704 *064320AF09D854DCE1E266E1DD33F634D8372FD2 [email protected]
59,006,705 *0647A9596DD512934044B3687C8604840140C2E6 [email protected]
59,006,706 *064FF107D4E0EA88B7FFCE12D32D8EDFCF9A2393 WERNER.EFFNER
59,006,707 *064A5D5DC90F3D365AA7ABF74F8EC0E8A0694CF3 WESSELYNNE
59,006,708 *06435D11C69379A7CC4C6C9E72C53EFBC153A676 WIEN1911
59,006,709 *0648655745E2E2709F59249EA3D6358BA76AEC74 WILFORD.LAGERBERG
59,006,710 *064E77689CF0B9356AD91C8C81C8ED0D2373C0A0 WILFRED.ATOE
59,006,711 *064AB7C94087C5BC2F47BE58FFF6D3C8D98F4229 william.inskip
59,006,712 *0643DE8C43367091CBF9063776AF17AEBFD8150F WILLIE.SIEGER
59,006,713 *0641C4E28D8A2329919D7983F505963C4BC77164 WILLIZA-RONDOLO
59,006,714 *0643F0F5DC8BB22D6809E0C29098C8BDBA404E8E wjhd
59,006,715 *0647BCCAA715480D7A777E2D010D88AB3AC7B8B1 WOODWIFE12
59,006,716 *064149C89A60778673AEBDD139552B1C5C58077F [email protected]
59,006,717 *0645AE3424963D0818A09E02FC031E2445C4C43D wwwcsdukeeduresea
59,006,718 *06429A3A0BA157AE0FF57EE0F044B5510496445D WWWSALUTATIONSCA
59,006,719 *064010F4229EF6D97D08ED9B6DA6CBB294787F59 WYATTSHARPLEY
59,006,720 *064B36C9E8CF445D83FB43B54D750F09EC2B19D8 WYATTWANAT
59,006,721 *06490A43BCF5F7293B3EB4A6D53BFDB8FA10E614 X157228
59,006,722 *064B5F653D8238EC2508C336BBCA4C6410054611 xaracii8
59,006,723 *064A2AFBE4B4427A8C12506B77D20F387C2C35A6 )X(`.dp
59,006,724 *064CE8863BB2B0C7327B9DD618917F1C9BA3B124 xn6x4
59,006,725 *0640984C3CA149050E7A61D5F27667F954F0BB58 [email protected]
59,006,726 *064F4192E6422C964602B342D765135D60F5913B XXXSYSTEM9
59,006,727 *064620F11C2FAF9D36CB2ACFC18C6D2EEB99D2A4 Y146791
59,006,728 *06440E4A2C4A5F55F9A7F13B2C929F483989E438 yancemulyance
59,006,729 *0649D34D5EA1C893C620E98AFACC7CBCA9246C74 YEE.TZE.HAW
59,006,730 *064A23E73146A66D149CCB394B4B3636B8383E67 YKOPYSOVA
59,006,731 *064E2BB19FDCB22DA4C8C1BC3F45836A201599E3 you'llalwaysbepartofme
59,006,732 *064ED6E79752B260D56218C55514081AB3CB4A40 yuanitabriliantybintoro
59,006,733 *064E0F6755BAD0BC52B48ECF9B4820051DB1A417 [email protected]
59,006,734 *064C0D12F6AE31EB7B99C9673F602FC5956CF132 [email protected]
59,006,735 *064555FF4DEDE5DEBE4217ABC791A1ECC64A1739 ZANE.CLAYBROOK
59,006,736 *0641D7C3B977FA327A96671FF9582F82D6598807 ZANE-STURGEON
59,006,737 *064429D977B142F91547F33B8A7DBE2CC3DD8F4C ZANGAREMOS1
59,006,738 *064CA641B9A9C9266748E4B8D89800A0BF346FF9 ZAUBERTRAGODIE
59,006,739 *0644A3FEDAECEE3D870D56FA9204B3F5452B8AD8 ZDBINA
59,006,740 *06412A52D452983B1821C7BEFFE2203B92E7DEBE [email protected]
59,006,741 *064E40D43F575C0575D94946343A150106060C34 zmgaaa
59,006,742 *064356411ACFBB123B52B4F5EAF152CD79E3FAB0 ἀγχίνοοσ
59,006,743 *0649FE9AD4CD06D244AC5B5E3C22124612E21B62 νομισματικήσ
59,006,744 *06443D0DC8E5569049563BAB89406A026D932306 АЛЬКЕРСЛЕБЕН
59,006,745 *064709577232F5487ED5ABA5428B01D03BA2B799 БРОДЛОМНИКЕ
59,006,746 *064CA3D1DD3FBAECBBA16A0D9B40982219D16C4C ВПРАВЛЯЙСЯ
59,006,747 *064A0D94613FA3419EC7CB5FA848375AF49DDD20 косmет
59,006,748 *064E50DC6B683DDF9474884480BED1BFA8169353 мурашынскага
59,006,749 *06481E2343B09F750F178FF5EF9E99871B720CD9 СБРАГИА
59,006,750 *0640554229B4E8A3EB3B302926648549EEDD603E «татабанья»
59,006,751 *064DA6EFE1E91275CA9399E699FD28991636AFEB ЧЖУАНХЭ
59,006,752 *0642FA93A877D507BCD4463DA7BF333043B26A49 штейнера —
59,006,753 *0641921A48F62234E5BFD6DD892E4A54003D42D0 04051683
59,006,754 *064086B5A51413CFEF5C52DD4317471113BB4B3A 1082249 jos l
59,006,755 *06489720BB1A1A5C75D3D9B30D7D14FF039A1D22 10 ALICEN
59,006,756 *0647057352F621FDFEE1267F3E1478FB6D2A3C46 10.zeitungsleute
59,006,757 *064CD35CB71697B5E33D3F0E2C97AA4CC77A0D80 1132689 asunhousutovathenkselimalliset,takaakorkeat.
59,006,758 *064CAA3354EA28A6BC38FA36B9F60C4515898608 13042
59,006,759 *064C50EAB04145F8442BF3B8E40BD7BF279F2037 142FREIHANDELSABKOMMEN
59,006,760 *064A180188CFF779CD060D192D448A3DE9C3C000 1432RAMEL
59,006,761 *064FE5D14AF5F3CA6214726829AC15514F748706 1869594 ".DU.VERKAUFEN.WOLLEN.?.".,.VERSTAND.DER.VIETNAMESE..
59,006,762 *0643864DF5509D553787AD2AC2B77482233CEDFB 1873364 mukana-tutkimuksessa-oli-yhteens
59,006,763 *06476F79F5B41FCB860E95A122FD1A8F20A6A685 19MARCH1801
59,006,764 *0641C112F40AF4DC9452FE8EFF8D0AB56C60B0A8 1 durchhalteepos
59,006,765 *06411621BFACE6A62488C472049E032642430DB2 1.EINSATZGRUPPENBERICHTE
59,006,766 *064C308A4257F4D652551A972EA1D502DB8B0DE0 1IAMLARRY14
59,006,767 *064291D31D37502CC9FF95C5344168E0C8660BEE 1karISmamasIdIr
59,006,768 *06448E450E1D8934506CAFC4D7B6707AB2D02083 1-konvoisystem
59,006,769 *0643F5FFC37E7C7381E84C08326CA45FD51CC329 1-LUONTOKARTOITUSPROJEKTI
59,006,770 *0648BF5DFDF6C096690A0209633046C1BA4C43A1 1.OPPIMISMETODIT
59,006,771 *06460B545036FD012470CDB97E67D8C92F5C103B 1RRESUL71VE
59,006,772 *064A0BFC5C65BF543FFE5B5F6B706C5B268299D2 1-SOTAINVALIDIYHDISTYSTEN
59,006,773 *064D39067CB7B480859B07A3C3FD5E3F99ABEE4F 1.TEATTERISUUNNITTELUJA
59,006,774 *0648D2642060AB0AE53138BDC1317AC56547DD05 1XHN
59,006,775 *0643749F20AF25F28E66B3DEB707393B6097F4B7 1 YA-NEWSWATCHER
59,006,776 *0640195432F7FF2298AED95300DE771D36EAD6BC 210RAYMOND
59,006,777 *064C1A28CC42640441A1F91A2648062C61685013 26ERSEHNT
59,006,778 *0643F4FD3F1DCF4EE727B99647FD5EA30CC3B67B 2717552 FIRESBURNEDINTHECAPITALOFPORTOFSPAINONSUNDAY.
59,006,779 *0645B7C6F9EC9AF74267E8DA6989E300062621EC 27june1029
59,006,780 *064F13804493966231EA2FDACF616CB2EE942622 2964967 maanvaihtojen lis
59,006,781 *0644A74AF3A632AAB3300472F6E168E79F375FD4 2DERVISCI
59,006,782 *064F4F8144E3590A941336DFFFBC492D0556681A 2FGRNSLDN
59,006,783 *064865E00856B1E62C06EDB3D8933657318E9220 2IKANAROS
59,006,784 *06460AB69BD71642D5C8FE04BFD7607BAC7B3D93 2ISEILIA
59,006,785 *0644369C40DC45354321FFC3432FA679FE66B889 2.oberweser-gottstreu
59,006,786 *064C5C40F0AFDFA0F85D92A24BE8D13908D295ED 2-perehdytyskurssi
59,006,787 *064235591046077024095C3863BC0CC908173F46 2 RYDBERGIN
59,006,788 *064A2AA46D0DCC1F0E2F660CE738F4506BA0E283 2-SCHRECKSCHRAUBE
59,006,789 *0645A202852B926BD2F326E63AE1739B1E725CA5 2SEROTPAR
59,006,790 *064EE8F73104DFCF7F7D61FDE37B7076707FE6AE 2-sexualobjekten
59,006,791 *0645EAB251AEAE67012048591AF976E3F7706196 2V5S
59,006,792 *064D035A0188E49C98E994D239F62DAEB5D03B07 3======>.`.}8{
59,006,793 *064963DDA4CF7B3A2E0F2DC10379B7ED709C4F53 3DREMOVAN
59,006,794 *06437B3E63CECF5B7205C310420695F3DED6D91E 3 esillemy
59,006,795 *0646B88F8521BBFEF9F4E762424FE7C4C09B160D 3homeenestoaineita
59,006,796 *0646290946BF5F485D53F6A6E6E4FD2CE29D24D2 3KIERTYNEEN
59,006,797 *064E791A4B805F0F75CEEC360E253D936D8E15B0 3=p~oo><
59,006,798 *064DBFC1C65FC8CF4B718D7A0FC0AD02E8EA0A34 3STTWGNS
59,006,799 *06408C22582572BBE2A696B147CA458F85CD42CD 3WZORCOWE
59,006,800 *064642ADB20CF20BD18D80BB1E3DC21E72D9082E 3ZINKAKUS
59,006,801 *06456CB7EF88EC262F59C02A337624CCAE8B8603 431805 UMSICHZUVERABREDEN,TREFFPUNKTEAUSZUMACHEN.
59,006,802 *0645B92CE99CF11C075762699C9A207BBC2F05F4 43784 IT IS NOT JUST AN EAST-WEST ISSUE , " HE SAID .
59,006,803 *064D61FDBCFA47DA72921C468D1714D333C91B90 481KIERA
59,006,804 *0641324EA9DC37D5A77F85AC07A741A0DE823A3D 4AVIDEHK
59,006,805 *064CF753731278D094BFD062D98970F1707454DB 4ILOVECESAR0
59,006,806 *064C7C2DA77DB94C8976BFC6B7B7C068F122478E 4ILUVDATATRAIN
59,006,807 *06458199DC9637B77F06BF485FDF38F3F386F973 4INSTAMART
59,006,808 *064CF1B423428117571E2F1AB60ACC51D45277B0 4IREMEMBE
59,006,809 *06475C006DD0C52CBEF2285F3D4A9944E8EB39DF 4kapabel
59,006,810 *064BE92F10EBEE5A24A191DDCF6EFA281C03B0BA 4TWEEDEJAAR
59,006,811 *06432EC66CFA31E113F45938196ACA44AFABFE0E 4voyants
59,006,812 *064DEF6544928B8C119F4545F24F2471BE4CC9C7 56u9fym
59,006,813 *06486DFC6ED56F614FCB9556288BBFE6AA77AC34 570718 BIZIM GENCLERIMIZ AKILLI .
59,006,814 *064B0EA0849995570DB8567CB180DE9248337234 5BSWVCOEBSW
59,006,815 *0648DA7BFD24479ECFEBEBE538D7C186AF3BFB5A 5BSWYAUGARAP
59,006,816 *064FDF8753F0D8A234E3F990E982EE11C861415D 5HOUSHOLDY
59,006,817 *064A7754236D4F8CA3078F917A37C470EC716224 5ISSELECTEDINPANEBSW
59,006,818 *064AA52B2B8A2C590175CC7213E74916088B8F84 5KCLUSTERS
59,006,819 *064462A20140F24D001F4F3F4614D3446BEC4C10 5MELANOBLASTOMAS
59,006,820 *0646A37542B300B66EF33EBB1F5212348F18EE90 5OPENCLAUDE
59,006,821 *06414C1CD7CB000CBF5C8D1EACB5C0B8B9AFA3D2 5TEGNOMR
59,006,822 *064F9A08AA3546081F83060B9F5A2AF42837D5E3 5THEKRIS1
59,006,823 *0644082355A5F471B0EEB2F87A6D80132AB608AA 68531 16.kampUsUnUz.var.mI.?
59,006,824 *064EF3D8C4CC7AE97F1F5B06CDD67EBDD8CF6DF0 68nv
59,006,825 *064D04A9F4691B71103E4996D6E915DFE198512E [email protected]
59,006,826 *0646A87458A179D81A941D8396259BAF5C10060A 6MAMPOSTEARAS
59,006,827 *0644BA691A8DA8754B1B3AED87FF58DAD925BED7 6MARIPOSACAROL
59,006,828 *0641161395D76A9A652A097CBC3142EB5A201AD9 6OPPRUSTING
59,006,829 *064C438945A28D600946B6F4FE6CC640E9F3CF78 6PROGRAMATICALLY
59,006,830 *064B7E758B5BB57232F0E2016A4944AAC7E461DE 6TEIREVRA
59,006,831 *0641823BD9B8A8DE393562DE16454D6C342A3809 6VINCENTSYLVIE
59,006,832 *0643812267E63F323FE2ABE41328604725E010BF 6WILDFREMDER
59,006,833 *064F4A46A3770F420A9407ED630A0C4F599F56A1 7ALLIZOMMOCTENOHPXAM
59,006,834 *064276E6916D48E2E04217BB9546E9C91635C6F2 7HARMAANA
59,006,835 *0647D9BE89C4CE603B74EAF22B7BE981A31E2A94 7KAHTATOISTA
59,006,836 *064C20BE2CDA46FEF98480EBA46AC8B0D7C7B413 7myzostomidae
59,006,837 *06417B174C63E269CC5CEFFC0EDB836389B859F6 7SLATSES
59,006,838 *064375BF8BB6BAEF598679FF8226AA926D68B644 7UNBIOGRAPHICALS
59,006,839 *064E67CE6675C04CB2FCE393091937E942FE6531 8089.porn-unknown.txt
59,006,840 *064AE766A66C6B142D1D53C4E04125E47ECB0E25 825015 molempienkilpailusarjojenp
59,006,841 *0646B038AEDB43E54329C2728130913081C404E9 83QU34THING
59,006,842 *064CEBFD18739CBC26DA07BE65292F2B1AEC7D01 8BARNEYTUCKER
59,006,843 *06439EB00141BACD5001512999A4FD402A1172C3 8.biologist's
59,006,844 *0646B557D2CC4F388E3C0BB7FCBDA890973DBEB3 8FALDLEMMES
59,006,845 *064C85606B68003E25BF72B877AFF9D2846D62BE 8LINDSAYBELLE
59,006,846 *064F81ACE6F3CCCE69482BEE2C6B445F8D96A458 [email protected]~.`.(O_)
59,006,847 *064B90D122C59B32ED2CF78B86A65F6C00EEAFCA 8OOKMO8I13$
59,006,848 *064BEBE5EBCA6F4335989B819A3740B717C6D934 8PARNICH
59,006,849 *064E738381F71496E9778EFF1706119A89EB2734 8SCHOLLS
59,006,850 *064507D678995A1A36CFA4FBB3E98D84125DBA31 8STUARTHARLEY
59,006,851 *064647BC5D1B6B5670131851F3E926B5CC2C4C06 8.tugsas
59,006,852 *064E145684FC5504F77878B5F3564A3039BFFC56 8VELMISTRU
59,006,853 *064008A0EEB0354413AD2E6B5E50B3451101A1A7 8VERKSDOG
59,006,854 *064575F1EA5B8465D9C4242D539F4010E69707D9 917218 my
59,006,855 *064515493D6237C8EFA9D0B9C9F8774BB5E53AD8 927961 beS-yaSIndan-sonra-akut-otitis-media-insidansI-dUSer-.
59,006,856 *064D98A38743E7ECD02448E7C2EB9E77EF68F7EC 943305 NUORTEN KONDOMIEN OSTOTILANNETTA TULISI HELPOTTAA , SILL
59,006,857 *06450E0C6702A28801BF74F31B5BA0E936230262 9ACURASAMUEL
59,006,858 *064621B6F361C1EB5C767D7EB49E0D59F2CC665E 9BSWLSSECBSW
59,006,859 *06403E809BC9D50C5FEF11A3F4CE10EEFBA9B75E 9LENNONWALKER
59,006,860 *0647EA8C71BD6F244B7B9B4F585ACCBE7677C83C 9LESTATSTART
59,006,861 *064B0613AA3EEE85CA72D34B474123403160090B 9NEIRAPAN
59,006,862 *0646325E34B60AC2307FD36C549892F35CCCC70C 9RAKETAANVAL
59,006,863 *06408CDE421A92E3B899763D16D7FEDE6B26BB16 9SINGHEAD
59,006,864 *0647490EFA5C8616C8B35A2078FBFFE268DF29A9 9TAHITIENNE
59,006,865 *064FDBD4E11E63F26FCD791C6B5D3416E22F8199 9ULCMJHNNYM
59,006,866 *064EAEEF9998FA4BEBDEA89257238DE4F0F98404 9VANTRESS
59,006,867 *064B988F2525BAF2A38B57917E84CE201494CB21 a($
59,006,868 *0649697409426EF64C2EF933378B7E064196FFE2 A5AII
59,006,869 *064176BEFC2DABF756F973F74E47BCDB61E9CB27 aaccR
59,006,870 *06415AE6524658930199BCD9FC341C88E865CE98 AAFI
59,006,871 *0642583E9677E26CE2BD630A1EB95F9A84857969 AB0KN
59,006,872 *064BB183C24C5D705B8EE81555F62CF5D7F59B3B ab/zh
59,006,873 *064B0A1D6829D5712134906098726C539B87A925 aeb74
59,006,874 *064CD27AAE62C333A6FBD421A20973FC01BB82DD aerosoldämpfen
59,006,875 *064A4A36BA397039003854B433BDC6CC474D675B AF#LG
59,006,876 *064760C4442A763D3756086B21B6C86BEC8937C7 aje.v
59,006,877 *064AA69CAE09E66DEAB2C9EA16F3E560C8487CB2 AJ+W5
59,006,878 *064C3F3895AEF5C6971A325784281572E4B7511E akademija7
59,006,879 *0645F9B67365C2BAAF1A05AD99FB7409600BC40A ALFRED.BROTHERTON
59,006,880 *064065D44D413AB6CBCC85ECEED625D4DF9BFEF6 ali.galvan
59,006,881 *06412541C130D8C05DCDCFD2D7DD2A1CAD31872C ALLAN LETHBRIDGE
59,006,882 *064E1930261400F895385C048D2CF2546958518B ALLENELSTON
59,006,883 *064326AC12A2E3904AA515F104C9E638F1838BF1 AMONDDIS
59,006,884 *06479D6BE2F3D5F9D1202CCCE3897E55EA75C822 AMQCM
59,006,885 *06464FFCDD9F0C6D9DCF80E8F9A412518FD887D2 anmkl
59,006,886 *0641962A8C4B1910C790162F7B9AE8B7231A452E anzosukei
59,006,887 *064371BB5B538886001B321CAF1F6AE07EEFA779 A;P3C
59,006,888 *064E74B5D4E26847FDEB26AC2A30C74995D2A406 APOCALIPSISNOVELA
59,006,889 *0645793C93E7813DA3391B109EADCFA3004D2D48 aq?6v
59,006,890 *064B9EC8AAD5994AD2767F15B0B5795BACA421D0 a;qgb
59,006,891 *0641A9140652B51E1F913D6D64F877794979C1CA a"qve
59,006,892 *064D876145E52DD4C491D216481C992B8F4C6EC9 ARRONSYMORE
59,006,893 *064804EA6F2B6EF5EA362A4BBC13213344ED8637 ARTURO.MILLENER
59,006,894 *0649EB54C4FAB1F760A93EA7F4DD9A9BA90BC697 ARTURO-PEDRAZA
59,006,895 *064A79AE2D2A1B4922750D4E04BF8E0AAA774128 ase$b
59,006,896 *064CAEC4894BC14367910121418A2D5E6AB6E007 AS.OA
59,006,897 *064FC8A2FBD49BA4358C668D7C9E700C76DDD073 ationiksed
59,006,898 *064B6973724A154ACDE121824873F377FC8E2A84 AT,$R
59,006,899 *064018FE95C1E4CFC9E746BBB38ED080B3C11B15 AUGUSTUS335
59,006,900 *064BFBE8BE49D0009E35A437F18E18CA90566118 aussteuerbereiches
59,006,901 *064C1521E6BB34C6DB703EBAF444F6A22075E60C B######)~.~.~.(>_0)
59,006,902 *064ACE3E621F55EE4EEAF6A0B8FB1AE440637F1C >-b0~`<=3
59,006,903 *0647A798B0BEB847F662016484BD97449EA1E853 b#1h
59,006,904 *064A2B59F465FE1F98486B643EC1EEBA7D519B32 [email protected]
59,006,905 *0642E89BD19101FAF5E66F47DD098E73AC089F1F balroopkaur
59,006,906 *06467C3EDC78AD800777078676C662ECD58667E0 B-C-
59,006,907 *064C6775CB6F6BFC86C3EA79BED929F1D132E3BE BE%88
59,006,908 *064A62B12918F8E3041DDCBB7FD7D0D91BA8841A bedn5
59,006,909 *0640284685B909DE450DF1707E8B6A7552887EE0 bender11
59,006,910 *0649FB23B00192918247F2F7CA952BCD345D389D BEN LANSING
59,006,911 *0643A973D7B788D33CA6B19C0B4DD1E25BB794E6 b"(ep
59,006,912 *06414BC1DDB632EACF07FB6AE7E9E21271A3B628 besetsny
59,006,913 *06428FF55391B0786FF9F74D00976F93EC906B6B bg6e-
59,006,914 *064C00EF980905A510A0E4E13A2B5641486A7E0A bgie
59,006,915 *0642A5F4295A84F8BD700CED437AFDA2D02DE6C3 BI:h
59,006,916 *064CAAC2FEA641DF3A1D3A7B44CA9D30AB434C0D birsitses
59,006,917 *06441F65F5A5AF78BB9C46B26C3102BBFBBC951F bkn)z
59,006,918 *064BA98E520DA65849E95034DA78FE6C222AEE04 BKQNM
59,006,919 *0646DA4BA7A9EDDEB7ED31105FCA1D4521713779 BLACKMARKET BOY
59,006,920 *0647890FCB9DB145333FEB7058A612D005D1FBFE blinded by the light (feat manfred mann's earth band)
59,006,921 *064E0A8BAA91869C4F382C2218F6648CA7439DDF blink
59,006,922 *06424346F63356DD3C2C3C7FFAAD31976836833C b;nk/
59,006,923 *0644C1A859001171111F0E0FA459712164B6305E BOJH8
59,006,924 *064F5D421445E08422CDDCA2277B1633D3980508 BONIFACE V
59,006,925 *064FA72F0C9704E872461183FC4468978D505BB6 [email protected]
59,006,926 *0646EF1F2589F19A373BCC4DEDD288FB17AACE53 bpf1f
59,006,927 *064AE52DC0E592F763EAF18768C79A909FC47002 Br4kerep
59,006,928 *06475E5FA4C813C2A8C4B954F7846CD509EB726B BRCQ
59,006,929 *064F8257528AC0D6D9288CA3E323295298F730F2 BRENDON.SOLLENBERGER
59,006,930 *0640D2E954D57A18B3AA3F24B48397E9E446B50E brentgarcilazo
59,006,931 *064D1D60BE6D1FD5A875133F21F1E44DF3129ADA BRETT MICHAEL MILLER
59,006,932 *0641CD450D142E497025816B8A03C063602C10AB b%;rf
59,006,933 *06436FC81F21EEC5660451CD5EDFCB9813DE0252 BRODERICK.FORDHAM
59,006,934 *064A2F966091DB7504BC720977F6CF646B78E2FD BROKENYOLKCAFENETBROKENYOLKCAFE
59,006,935 *064996B322E39133383A5929C1AB1F17E71731EC bryl33
59,006,936 *064BFE2FA21ADD63DAD8467BCC3F02223810578D [email protected]
59,006,937 *0641E1FAEAFB015C7DF98D6E215307FDFCA9B261 BURTONSOLIMAN
59,006,938 *064D0F422256BA53547B1C3BD2C1D79227565561 bvpl0
59,006,939 *064BBE7EF659DFB0A4F9AC36D5D8AEE829541BBE C11NG$T0N3$
59,006,940 *064BBE79B227E52E6CE12126137EE8ADF8B4DE8B [email protected]@pul7in9
59,006,941 *0645E84BACF9A77AFC7A80192C39C22BAE42FDEF C8OPD
59,006,942 *064625EAA0C32902E84D57F270A6488233EAF686 [email protected]
59,006,943 *064FB90B43888746273DF56020588634B9F5CF6C carsongaiter
59,006,944 *0640262A2695B9E3565FFDD52B034E4282FCA3F0 CARY.DRELICK
59,006,945 *064DDC6B7279B04D938901EAF6338B03923F8CDB CARY.EALEY
59,006,946 *06488299C79BA4014B6F3B17533E4B7C932BEC5D CATEGORYHISTORY_BOOK
59,006,947 *06419B842C458ABF7C94198E549C536E425B3CA0 cawtmvxc25
59,006,948 *064229D863E936476003D4591A653DD19C369595 CHARTE?
59,006,949 *06422CF502E7D7E2B8643E03B015C2A93331A610 [email protected]
59,006,950 *0645479603D8C5C0BCA7444DDB23A3260D37F072 chinitrol33
59,006,951 *064BCFDB747BF55B359CD9E0E94F321FB5FDCF99 CHRISTIANPLANTE
59,006,952 *0648BBE50CD9702BB6ED00B00D27754610C15B8D christinaronda
59,006,953 *064FB44D4CEB139214DC120427881C0AC0163AC8 CIHOTELPRSIDT
59,006,954 *0645FABCB2BE78266E38365A9F8C24645811E714 CIUZELNEU
59,006,955 *0647202DE5AADECE66884FBAE7B8AD4F5AC20E27 CJEU
59,006,956 *064A171C45E0F7FAD67AB8853B5F734A6E08CAF5 CkI
59,006,957 *064D1042713565BAD375D401EA1E130596CE859B CLARION
59,006,958 *0646C5C9F8671C6680BC61B341F67E7EE5E0448E clintonpikey
59,006,959 *06412C6F21D9D79DCEA3D719A67316B7B199ED3B clnvu
59,006,960 *0645BAA0838B73F026A29FF8E5208A914BCF2ACF C/+m
59,006,961 *064F75C1F44DEB4305CC938AF68430981CFD7ECE cmogy
59,006,962 *0644A1F30A875E8F86E02F9D85EFB64466E25D11 COBYROSS
59,006,963 *064550A62FE37D84841CE374A2A34ED64EA65D16 complca73dn3$$
59,006,964 *064E63E88840BB50F68CED2799AC1DC1BD41E53B CONCERTO.F-DUR:.1..GRAVE
59,006,965 *064CCEEEACF9FCA8CFA6F23D6A35E026022B54D4 [email protected]
59,006,966 *064E345924CEB0AA1230198A5DB1B0B992825E05 cosplaylab
59,006,967 *064358DC23D7652B7F75EE419C96CE7C8272EFE3 CPKMD
59,006,968 *064C2176C7D12509B7A3B2237613E21A86FE392A cr679
59,006,969 *06441291FF7459D2BE848F0208695D60E16214ED cr6ih
59,006,970 *0644A4962C11A9AFEA0B77C1BC39CD7828A58641 CREDETTE7
59,006,971 *06429948D7DA7317E8A181D9DE4E0699B9ECCF16 CRYPTODIRE
59,006,972 *06483E43BDABCDA4C302C7A2A8D9434225B4B87F CTJNJ
59,006,973 *06451F11730F2B87B7083C3C68EC99C0C554E79F D1550C1A+ED
59,006,974 *06438C12FFBA03C3D6F020EF86020533F9ECE998 D3MA!
59,006,975 *06432901F0C547E31DD5D0322DCEF994FA0F1B36 d5.h,
59,006,976 *064ACC73EA80F927233ED00130E0F842D882C248 D;_7
59,006,977 *064D81A0D03F1C5308FB32EED73A81AB03E6F63E daemenip4
59,006,978 *06428580541A4FB850EE6C2FC1E6CE9B8A186E74 [email protected]
59,006,979 *064B9921447DE0D96DB072F84A97B5CA2AF73347 DA)JV
59,006,980 *064CBCBBD800D63C518ADC61B545A55F897D5CBE DAMIEN.LOVENBURY
59,006,981 *06443F56766A73967AD55EA28C4C28BDA97539AC Da;p
59,006,982 *0647B679D41633286E8A7B3715FFC268E55BAA3F DARRELLDIFRONZO
59,006,983 *0644D46B9DC6F7519BE3B50073517E30C29F6CDD darrinporteus
59,006,984 *064D4331777EBCA4B6A8B7E8383E27E29A5C6E9C DARTHTORCH
59,006,985 *064978789AC8C4BBA03EB97776D634B496AA5A46 darwinpasco
59,006,986 *064B7F76EEF92E8969A6714BCD664CDAD003D021 dasp4
59,006,987 *064BDE6C60C8A249531A74AE3F6D6BA13E8E5392 DAVIS.DOCKERTY
59,006,988 *064A82EE82C4A1CA01461FE3B7955C4BC6070B39 DBCC9
59,006,989 *064EF4EFD57824A54D0CAB4EFC738D69B03A1A2A DECHD
59,006,990 *064BDDE86B0D762283FBCDE2A716AD008D22ED67 DEFLA7OR
59,006,991 *06405248704D274598633F9FB903064C7439F0E4 DENETLEYENLERIN
59,006,992 *064851E8A4C1CBBA1933B0BC8A726363B9B834DC denna.lewis
59,006,993 *064D94C8F58AAC36433DBD74E22CD04735D099F1 DERIOUX6
59,006,994 *0643CD96D983C2E7AB772C735A2DB92593B874DE DESTRUCTION.&NBSP;
59,006,995 *0648A955AF887505BC80E9C2DD0C80BEC0C24FC0 deutsche-messe,-d.-872:-i.-zum-eingang:-wohin-soll-ich
59,006,996 *064273878D686A4BDB989B5E2CFC3632A004D08C D!FBO
59,006,997 *0640BC13935748081DC0ABF212F72FF26ECA64A4 d%h86
59,006,998 *064E9C68CD0981B793523F90917C40EB1E17400E DHUN(
59,006,999 *064B810209D9358786E44A0CC6F34F6594CEF5E1 DILLON.LEICHT
59,007,000 *064E5FA530AB3DC9B112EA0FF56F920ED36CF127 dinesh.dharmadasa
59,007,001 *06468A4F6F41FF36232775191CDECAF989EF89EF [email protected]
59,007,002 *064AEA87D3CE28B40A088511ABFD1607745F7EB9 d&j(
59,007,003 *064E95B4AA0DE4875D11C5446A100800A67F07C2 d#ki
59,007,004 *06471402998694ACB9435F8A61505F9E4D6E8095 dn!me
59,007,005 *0641F07F1190FBDF9833669D6F54A300E0D89605 DONGBARRENTINE
59,007,006 *064F3D35E3E6078ACE3E33311BFC8F1FCC890B92 DONG.LUPKES
59,007,007 *06432D4EA2A5E47A6D0E129B3B7F707223D195EE DONOGWYNN
59,007,008 *0644B7F4620EC783162602E2143E7848A53F960F don'trunaway(radaroneremix)
59,007,009 *0648F364DA44E58AA573B1CFA497E75A1B34D03C douglasdesign
59,007,010 *0641207FBB5E7B96146B1D82760A829A089A2630 DUEW2
59,007,011 *0645427F7CE1B7FB3A947FE04CA49664E631A0B3 dwaine-creelman
59,007,012 *064FAD55B08FB20F987A8F063E29C0EA6DE2B2B3 DXB_
59,007,013 *064EC5B1D07CAD8079B99FC5849F9AE2FC951D7E ebtiderc4
59,007,014 *0641685D92A5A701F480B756989CDCC69CF989F0 edmundolenord
59,007,015 *06457EC14754F08FAE56343135681A4EF9B0007D EDWARD.WALTEMEYER
59,007,016 *064200E5A9DC4A5EAB6F6C107CBE0C260E79F0BD <eebaa
59,007,017 *06433BEF4BA65D56DE18A2F4304649DA09C34C4B ef#+c
59,007,018 *064BAD5C991A7562537EFB2D135C6B10137AE5F5 EKJIRRET3
59,007,019 *0647F518B8EF2468CE2CD3307D029619A723246C EL457N5
59,007,020 *06473501F5955C88667F21D85C3760B4B9F5C3DF .ELBERSON
59,007,021 *0649EA10C41C81F75447D763B11C1A4D438817F5 ELEVANDIS
59,007,022 *06406F188EC6D8920D9FDA9194312C6C721EC355 emilepaet
59,007,023 *064F9B6EC70FBEBE544FE56724884713204D3918 emilionanney
59,007,024 *06438849F69C269391EF1DD1E2404FE4B61C5162 EMORY.SAAGER
59,007,025 *064CE314DA733D2DB0DF241C4CD72D3E9403B5C0 EN20848174
59,007,026 *064A8B1C3012BC3D90562BBD0F2196C05306DAF5 enanzein
59,007,027 *0645AF0855FBF27D63DD76208E89D8777643D87B ENCPHER$
59,007,028 *0642E42217612544C484E2F0F36F78B5903C9F0C [email protected]
59,007,029 *0646202581CCEF43EA31CEEF7EFD374915D848CF epm=m
59,007,030 *0647320637941A1F93291EBCA476E76BCC82AD0D ERIC.KOLDEN
59,007,031 *064913B72CF6AD765FC89659ED1856377A38B768 ERIN.LEVER
59,007,032 *064D0AC98F31880ED24A2624C0E658AF17E7F644 erysiphing
59,007,033 *0647E3DEFB9D0F8F8295D7D6E14192FE33A564D8 ETATESSID4
59,007,034 *064F996588D304A64ECF44CD7A9254D621600ADD ethan951
59,007,035 *06425981380BBA04A7C3F11E67BA50C07A4F2AE6 ew}h
59,007,036 *0646FDAA1DAD8B20C4769042C4C268CF700EC1A1 FallOutofLove(featAndreasCarlson)(radioedit)
59,007,037 *06459BDD6BFB3BDF8B0072532F2DCC8B2CBCF896 fasaidh2
59,007,038 *064D7CDCEDAD209A5DBA46BED2D7F903C87CBB73 FCHAROENPANICH
59,007,039 *06451D7BE0FAFBCE76E5EC75FA16B14A88E50DB9 FEHLZÜCHTUNG
59,007,040 *0645C9B59249B5BF4D4B59E82C9A60563511984E [email protected]
59,007,041 *064D68C1CFBC5D6D8C3D3EE16E8A2973B1A5790E ferencbánya
59,007,042 *0644D6FA144FEB748A6FB8A1F6DD3DC99C86AC67 fivemaster.f/aI/v_'m/&/st/@/r
59,007,043 *0648034B6447713CCB39DF37990F42B3FAF651B0 [email protected]
59,007,044 *0644F97E3C8A8CA849B1550114BD0EAB2BBF3978 flanaryses
59,007,045 *064E759E6808C678208906EAC283E41C763FAF77 FLOWERET.BLOGSPOT.COM
59,007,046 *064EEEDFBF5A6900D54EBE52F33449ADE56980D7 FLUFFYHAZEL
59,007,047 *0647C5AB4E4606D56FC1533515FE7C2477B30369 [email protected]
59,007,048 *0648C55C841EF7AC8991E9F22B0204F837B50BAE FORAYED
59,007,049 *064A2C06C3F3FBCCD462C4C23666BDAEFCF03141 FREDRICSEVERTSON
59,007,050 *06418B8D4887CE8EB62FCC48B3950CBC2D75ED4E from.a.far
59,007,051 *064E53109E76ABFBB3D4BB87CC641043147817C6 FUNCELICA0
59,007,052 *0647E4D59DE263472124E2AF414F3A3D2027859A funcion-hipergeometrica
59,007,053 *064541ABB062350819A56149BAB715BF8354D6FC FUTILELY!
59,007,054 *064337EFB075995A5EC1F841233B57CEB9F91EB9 gabrielneman
59,007,055 *064A220B9AC8B046D4997F7C2115426FBDF8734A GABRIELRYDER
59,007,056 *064C1DEDC6BE0B6571EDFA56FC99895FCD8ED946 [email protected]
59,007,057 *064FC28A425B6BE20BD35A8FC9D570B5421A2548 [email protected]
59,007,058 *0643F1E3EAFD3F5E51341DFECD97DC586A0144CC gawa-ch
59,007,059 *0647347FFA9C06C9F698247506C476E0D801F9AB GELLIBRANDMEMBERS
59,007,060 *064DCB820A968A863B48F63401B5129BF78F6B20 gener4te5
59,007,061 *064A0D7D998EFBD8FCA02798CEFC9C781C1B718F GERALDGREENWOOD
59,007,062 *0649D8FCD65FE4D02393EB26FAD8B047E28E70D3 „GEWAPPNETEN
59,007,063 *064E31D03A5AB57675E1FDCF97E2362CDE0F0DF9 GINA-V-SMITH
59,007,064 *064C82790ADFA46C2E445364D86361F755ED295E GLYNISBA
59,007,065 *064D5968FF0A33B7E69021C9B7C2B06D9B8BFF36 GOALS4ALL
59,007,066 *0649BF7C4F35032E2A9CDA3063FA4A0F26799139 [email protected]
59,007,067 *064E794EAF3B3DD55E7E79622E203D9F52E06889 gonnatelltheworld(weddingsong)
59,007,068 *0641DD019E655EC5D7920EFD3D0C77DAEB6A27C9 gretchen-butts
59,007,069 *064419E2091A0EEFCF1B0E6B9162231FFB15CA65 GUEST34802
59,007,070 *06439CDEDCB670352E7327F7B82344EBAB7C73D7 GUSTAVO PUPO
59,007,071 *064865333E4BAC6904F253BBCC6E35BE4951412A gxbxgrx7
59,007,072 *0645CBA068C4105389B5E3FB4256B2170C261D20 HANGMANSHIP9
59,007,073 *0645081A18343D53E3B4AC27293149EE7CAE7E79 HARDAYIQ
59,007,074 *0643809AE97B6945EBC81F8718EEF478B10FBC9E HARRIS.RICULFY
59,007,075 *064C7FA17C95AEBF1ED7FFF80D03691CFD2DC20E HARRYYASUREK
59,007,076 *0645D2BB9F9D5A62390D6B398E77C317DA61A870 HEATH.CATHER
59,007,077 *06472C89C2A2F675FDBB2F3AC7B0D8F5B72D4A66 HEIDZĖJUS
59,007,078 *064D53EB5407A303594D67067B3B2D178BF06D51 HEIMOLL2
59,007,079 *064D14E33EF242489ADFACB704A510535035C2E9 HELLEIN1
59,007,080 *0644009DA55CC9761BBC1E6935DF0617619B5D4B [email protected]
59,007,081 *064017A5336751824412AE68DC8F427EF70241F5 henryzorn
59,007,082 *06445F9F6579E8C69BF8E4BA5DE468761DB58F7D HERBLANEHART
59,007,083 *0647D816481397702C86903C44F3B04CE00DE993 HERSHEL.CUTLIFF
59,007,084 *0647B76D5815BD94522414835101F0AB6EE50A1F hillesheim
59,007,085 *064E4929C185C4CB1782AD88AC9D1B031896E327 HONDACARSOFHICKORY.COMWWW
59,007,086 *064093D8AF26B25CAEFE052647C7BB23A9D224F8 [email protected]
59,007,087 *064B4B4B5DB165243D3DA94BBBA9F7DC0B4B8DDA (HOUSEOFROBOTSREMIX)
59,007,088 *064570A60FB8B4DE4ED34CE2F4F00CBCFD64AA4A hsiftsercs
59,007,089 *064F7B025F72A05F954EC48F34EB5A3376905F99 [email protected]
59,007,090 *06444C55ADCF0E0F8EA156BBF7E85D74CB223FD5 HUNNGERR8
59,007,091 *06462FFCE30C172A33EAA32B43B81F6B3549079D HUNTINGKNIFE123
59,007,092 *06431FC2F98C4CF57E2547E177683061C6E0E7D7 HURLEY101
59,007,093 *0642F8AF580C5B6EB08EB0F47A7ED76876A2FC74 IAMPONTIAC74
59,007,094 *064BB81E1ABE8E1744EFA9600FA59CCD452A794B IAMREADY2TALK
59,007,095 *064B31922747EF85A98C8969DE2ECCBE536BBA9D IDALINE?
59,007,096 *0648710C082A69EB1317D9A479F505D5BFB82E90 IfYou'reNotInLove(FoggyMountainBreakdown)
59,007,097 *064DFC8AE420B3FE6EE23130EA1C70D54B5D88B0 ILOVEMEXICO45
59,007,098 *0641E015C03274D370D51BBF490CC10B8F6D5442 iluvcarrot2002
59,007,099 *064386978155BC94389D93332126D040D0C83812 INDO-ARYANCAUCASOIDE
59,007,100 *064A67AACA179BA5E625C69EC1F8C9AE2988537F [email protected]
59,007,101 *064856CCB47647F4F653E9D81D7AD09EDA2232F5 INSACA
59,007,102 *06471A3B437BC40DB88AEC10F2D0C1D5B1FE2B15 interposeriez8
59,007,103 *064D449EDC67762128C02C3678F8EDBC21CB46FE IRONISOT8
59,007,104 *06471C8ADB026D48FED36753FBB457F36A83BD8B ISAAC.MORTIN
59,007,105 *064646BB20C6779F0A4426B075DF40D1E23BD1F8 ISERSKY3
59,007,106 *0649AA46DE2D3E250AA5B4CF5B28A28A42A3C1E6 isrealammann
59,007,107 *064B630440D7ECD77027927A478FA88F1501C5A6 IT'SHALLOWEEN,YOU'FRAIDYMOUSETRACK6
59,007,108 *0645C07307AA1D55B88C4969750077925C42B705 J74383
59,007,109 *0640DC4FD1F5D28DDAE8464E57FFD6F0AB9D3BA7 jabelgar1
59,007,110 *0640609C776214A587F26465CDBFE17312B7BB0F jaewins
59,007,111 *064103B83B4514F1B35B59928ED2E32018E495A8 JAMES.KINMAN
59,007,112 *064487E18C3D412E9AF394D92D387AEF728733B0 JAN75
59,007,113 *064A8B374C1E911C85B2685FC4B3F4538E74D51E JARREDCIMENO
59,007,114 *0642B27E8055E4A1146EECBCDE601450B35E9C12 JAYSONMIHELICH
59,007,115 *064E7DDE6EB41621C4F4DDDE7CE341B219BA9813 jb.dela.pena
59,007,116 *0640049CEE045A23D47B2EA6FE547AC67F13ACEC jeanfarming
59,007,117 *0640419B8B0C7465EA86596260AD12CDF031ACD3 JH[M
59,007,118 *06408611FAA13FADAEB0BBCC6C89E702FCDDF677 JOHNNIE.DEININGER
59,007,119 *064BA1884DE1312A8769E5102634A20C55DF5D53 JOMELTY1
59,007,120 *06433686070B63E8C4C5B70D8548EB76500D46A1 JON.CARIGNAN
59,007,121 *064F639FFBE0B5A6B354621813C0CC27E7422235 JOSHREDSKIN
59,007,122 *0647DF06E9C73085A26273679D222BB26F4D941E JTVALVAN3
59,007,123 *064DCF01F4DDF209A11C1F9962C5156B67C47813 judsonwiede
59,007,124 *0648E4C82AA2977050A5C4841C3AEAEC5D7E841B JULIAN.MANNY
59,007,125 *0641A15226F8F29F5E43ED06547670AEDF69C00A juliusquizana
59,007,126 *06441D4685CE10767198A78DF91135F745982C5A KA|F
59,007,127 *064FF3834B5410CAC0C457D04CB5E22A683A21C8 KAV5ENWS
59,007,128 *06475231D816DCE0E0A59380D8FDC98C852D01EA KAYLAROLEN
59,007,129 *06474CAA9E04403848F90ACEDB3F6C64B77869B5 KCIMA2
59,007,130 *064A2C86C8BF32026E8557EEF16B1A606B122BD6 kenearl
59,007,131 *0647442581BA45C419AA9AA1B6CE8E0AB75F60DF KÉRATINISENT
59,007,132 *0649B607354124B4E7F8CF3FE095E1822B325706 KEVELHEING
59,007,133 *064F29E5019DCFFA2095E99B730C75E61ED09605 [email protected]
59,007,134 *06415F200F54CB472F860BA6A78F9267DCEA1355 kevinsayles
59,007,135 *0644347D3242015CE7130A1E86566FB865D2AD0D [email protected]
59,007,136 *0641790242DB05D16804F583D7BED38D1EF8A3A9 kylero
59,007,137 *0647AB8C1A802B6C98260AD571E10E814976C0C8 LAMARNISHINA
59,007,138 *0644AA14D21A0372833E47DB2FC3DCA171AED06B LANE.KISH
59,007,139 *064A2BB2685925D0BB1C99C6BC72FEF3FFF76B39 LANGILANON
59,007,140 *064AA28B13C288EF9D4F204A810C0FB35AD9DA51 LBUCACAO
59,007,141 *064938FE75474AF75ADCEBE147FDC4DD7A4144A2 leebartoletti
59,007,142 *064FD76AA4FC821B6404DDD54C8D0E077FAFEFE7 lelandakamiro
59,007,143 *06418E3E2331B2B5D94F1D4408ECFE98904ABF25 [email protected]
59,007,144 *064734CC6B07203B0E725936B03D168F44ECDFD2 leonelamendoza
59,007,145 *064EBF805770EA8FA3DBDC3D366540D05C95AEAC lesterhar
59,007,146 *064A199416E39F77EBEB0ACA69C8D7D2B97FAB12 letsid
59,007,147 *06406FCC95CAD2E6FB36F2B723DA19DBC90A797C !LILIA!
59,007,148 *064B87D7E838C0C336ED7619C47188222A24AEE7 linelda3
59,007,149 *064505E8B1C41E1A812CC802BC1971B9FB4084BC LMAALOUFE
59,007,150 *0647F014D7637570E47CFDA5BF8F756027BE91B5 LMONTAPERTO
59,007,151 *0647CA33DC6F7202DE52D8E048B1F0A53E0BF474 LOIBLIO
59,007,152 *064EAFFA662BE12734190AFAA1D38A197F878A06 LONI COMPTON
59,007,153 *0643EB13DD1F6A018D8E37F528FD2B1254BF6AF9 LOREN.WAAGE
59,007,154 *064F2ED89AF1DED5A6171BC80174AAB9620C2AA0 LORIEBENM
59,007,155 *0646D7D88E93D94FC9618D3CE4A6D4E69B71BC00 LOS.DE.OTILIA
59,007,156 *064BC18850FA7A71BFBB28172BEE0C18260D945A lulu83
59,007,157 *06464B31351168A4F96F91043F9788AA5575CD9C LUTHERKOPRIVA
59,007,158 *064EA078840066D551503DDC70384FDA0155C80F LYMANTRUBY
59,007,159 *064CA1C104975CEE1E93AA78264D052E5C077603 M44GPYNBOSSI3
59,007,160 *0645ECDED32821EE446537113ADA8973D7196D7C M51844
59,007,161 *06450D1BF937D892A793ACC240BC65988899EA64 madhavannandinugrahitah
59,007,162 *06431E93123FFBA8112E90D356E1E27AC8A1C61D majed.hossain
59,007,163 *064A3B5C2BA668440B879047BAB17BDFBAF274D0 MANAGEMENTBOEKEN
59,007,164 *064C601626596CDD8E763C410D9D19892375A37E MANALI-BHATIA
59,007,165 *0648524D924647D89CA2CD323079A6C31BA3C752 MANISHAKUMBHAR
59,007,166 *0644A80AA30270B4D79B791396CD4FF0263CB4A3 mapopei
59,007,167 *0647512EBB08C6FB161FE191D2036DB18BDD0ADE MARIANO.TAVE
59,007,168 *064CB1BCDA63A55617CAD4821BE277E4ED65A316 MARION.MEZO
59,007,169 *0641084B80ABC814B1E4882BB2617CF145412950 MARK-ANTHONY-BULILAN
59,007,170 *06449B28C7E4CC2BEE12263F051DC34E5D891D8E MARK.GIDDINGS
59,007,171 *064AAD0F721CBD5D911B388E896FA740BCF1B758 MARKGUNTERMAN
59,007,172 *064993A2B619C7889D65282E2B0ABCF7FA518831 martials
59,007,173 *06455AA51179176056B0EB370D0162AF38143765 MASS.GROOVE
59,007,174 *064CEB30C14EAA884459D6A0242E3F8EE04001F9 matraquiez
59,007,175 *0641389ADBBA336BE756BCC9EED42A8C984422B6 MBPIANOFORTESTUDENT1
59,007,176 *064F3A9D9F44F34B565B5CD60AE51988F49BBF5A MCCOMMONS8
59,007,177 *0647BDC5EDCA5CF4B5E49EF17285E7ADD1FBDEBE [email protected]
59,007,178 *0646F32F69B27BCC6995EA4A1077D8DB8A4FF3BC MEDALSBR-GC
59,007,179 *0646177260CFE762DE7755D9781317DFE942985D melolonthine
59,007,180 *0641C23F48E3C4CB662E90142D9F28D03A69C20A M+\F
59,007,181 *064624AF2EE45BF5A1B82BA475C6501093D80176 MICAH.BISHOPP
59,007,182 *0642D51108E5985E32EB92967F92306EAB51F27A MICHAELDOUBET
59,007,183 *06438828963572A6F63D52A74781F7BF40F1BA7F microscopizing
59,007,184 *064EC23943DEE988124A3C2BFDC037B3CA6E59C7 MIHM_RULES.3
59,007,185 *06426FD55F531CDF73445F0CFE9CA2062A4C438B MIKALAJEVICS
59,007,186 *064A6581B765B56D44C84EDC296FFFD83D8DC66E MIKEL.GRAF
59,007,187 *064DC3170B5DEF1CCDA8FB8C87996588E6DC6BE0 MILANEARTHMAN
59,007,188 *06469658405825874F1342A0229D9DAFF79FD8E0 MIQUEL.RENISON
59,007,189 *064A24B072C06904A1393A24111F30D3036596E2 MIRACOHEN
59,007,190 *064C51C27063F1EAAED07E8BACC388D824E33797 mitamaborn
59,007,191 *064BD5EF8A5C3CC77B86E73D58CD157F7DF115FC [email protected]
59,007,192 *064AD74B585534B9F83FD6832E39DE68F0F9F71B mlandi
59,007,193 *0640C8B3817BE6FD5DB43E58CEE88D69FD25630D morganculligan
59,007,194 *064A1604126A2345808A1F4D671EB90E0AD13817 mostafaalaaeldien
59,007,195 *064F5514A7FC61D933AA703EC7DF10A5ECACAD40 [email protected]
59,007,196 *064817BD70871109842B99CF970B79D208C3F88B MSDHATLED
59,007,197 *064D77374D3FCEFAB2F5C42B34F83D24DCE51D6C mtbbchtted
59,007,198 *064D36E8180AF091E0623711A4B8140801BCD711 mudhafar7
59,007,199 *064C7FBCD4E5D79B4FD2489ACC5EAAEAE2E068C4 MYLES.DUSIK
59,007,200 *0645D093FF5EBB3F6972AF7607CF9ED279531032 [email protected]
59,007,201 *0649950DEC003B6DF557F9AA7D9632E0A7894B0B nanakuli99
59,007,202 *064190DFC8B20CF7188446BDF31C3C002CEA8874 NEWPASSABBY
59,007,203 *064F7A383E86910679552BC09C9F20206AE9FDA7 ngbbbldn3
59,007,204 *064D2BC10CA7A13283494C82160BB98774751A38 NIGELDARRING
59,007,205 *0643A4030CA1257174C516FD0D43360828320A9E [email protected]
59,007,206 *06498551A92320D463C81EA4B474612318E6352D nonemerg
59,007,207 *064C19F64F6CAE7B24FD6EC85F8E57266C3711CB NORRIS.OATFIELD
59,007,208 *0648C5378CACA97C9A2902C0ACD0D1F6B8C83CC2 NORWEGIANDANCEINAMAJOR,OP.35NO.2
59,007,209 *064D43FB7EAC8448B48D9131BEA6A455A62DF2E8 NOTESKRIF
59,007,210 *06433322F04F4124177C622C8CF8F77166C4468E obnoxios2
59,007,211 *064497377FB6142549033F46BDD19D37298C57FA OGREENBOM
59,007,212 *0640F503BB60F600FCB1E49E1D6C17A452E5EFF1 omolola-adesanya
59,007,213 *06406DFB00978F6B6FC47ABE4BDBF53ED9213EE1 ONEPEGGY5
59,007,214 *0643921AC453FAAEEF481FE39857905D9241CB8D OPEN COFFIN JAMBOREE
59,007,215 *064170885284A126800861541F97ACE52E4A3FE9 orielmergeletterdotx
59,007,216 *06480C91D74573718BCF017107D31EB5B6B7F63E OU+F1E1DER
59,007,217 *06446B86F1DD8CDF689BBC1A7268E0128136896B OVEREXCITABLY?
59,007,218 *064092576B29B2E34CB37986842A675D8DC4DE31 PETC
59,007,219 *0648A3D2ECE963C32541B8E507385EA7DAD35D79 [email protected]
59,007,220 *0648F548B840B2AC28EB08B0B9FF34CE0831C616 PHILLIP.APPERSON
59,007,221 *064BC7126DBA6FD89CAD58F23C87929F43B93DEC [email protected]
59,007,222 *0642524BA8493099F6A67CBE48AD22B37B8292D4 PIINKSHIT
59,007,223 *0644A6293B09E327B6447E2EDF3F119E53D6C4D9 postcodegebied
59,007,224 *06459D458E32643BFB071EE3EFE856C7AA332BFF pregaze0
59,007,225 *064B68AF148F85E439FF821891B56006EE56009D PRESIDENTEDELACOMUNIDADAUTONOMADEANDALUCIA
59,007,226 *064E8DEEEF7B354EE6C0C93E8EAF26F95384CD39 presolveds
59,007,227 *064FCAA984A9EB6607A479D90791E539BEC8D228 PRINCESMAYO
59,007,228 *0643A20BF89D43BF859992D3A5C88300C6CF7F10 PROGRAM1982
59,007,229 *06494FD2474EA7B369B47F10375BEA04CBF2AB2B PROVISION3I
59,007,230 *06482C7C9BF7A04CC86B9BBA807A7CDCADAB4C1D provokáviós
59,007,231 *06416133D58E281F2CC6923989AB8B91A62F7BC7 ;)~qP
59,007,232 *064F591D257B59ADB2521C6A0BC3C0BBFCE54F5D QWHO
59,007,233 *064BF1CD1DB650C66AD1FECE6B8C178F66CD6F28 RABINA SHRESTHA
59,007,234 *064DC02745E81E92DCB7004C594173C9BD29982E RANDALL.MARQUART
59,007,235 *06403037F185868DB536FD1B4C8D03D04E4C01FC raullamattina
59,007,236 *064C324A6B7DFEEFB67A3D7A7E54A266235E248F raylaing
59,007,237 *064C8BE16733AF97A702A38F175D2FBEFD82ADB6 REFDEA2007
59,007,238 *064D263313EA509E686F55753C80EF962746838D REGINALDZAND
59,007,239 *06402A7C66B6741C0A3CA653FAF1586BDB79C146 reinaldoringo
59,007,240 *0644881F7DD2C0C2B0E10628CB151E34FAEB5BE7 RELANGESES
59,007,241 *0644EC7A53F152DA21889C58BEE193AE723D1FBB RENE.CISKOWSKI
59,007,242 *0646C98ED0944B0531AE9F8D52FD365A02E3421C RESSADUJ8
59,007,243 *0648A96B7184E9D92512104A9CEC106894AACE8F [email protected]
59,007,244 *064D1DD7A3288B43184E5FE752BB7EAF7C98F29D RFYIWYR0
59,007,245 *064E1D705DDF953AA3030B4ACD22D68D2259CA80 RHETT.DUTTINGER
59,007,246 *064F61DE4E894E83E0739960BF50D359B82D3216 ricettizio
59,007,247 *0642F67A8CB360F507D3C8F29A7386A6F9008F07 [email protected]
59,007,248 *064B016B875B3655AC48978735D19D3DDA86B0C8 RMLISKY6
59,007,249 *064D32102D10ED4DE6DE310CC552311AC095E5FD robby.kelly
59,007,250 *0647B7FA5B7755577B5AB03D189CB8E5C089C28C robin-susanto
59,007,251 *064FCA731B66D4524F146029319BF0E72D861252 robotkitty_00
59,007,252 *06493F892B8E8C0344749BE8C8C0722E63C5A343 RORYRAHAL
59,007,253 *064253EF7A9B4A2E0984E38CAEFFC28DEAB2EC4A ROSARIO.COOKMAN
59,007,254 *0647C15810C1D23796547EC6EEF4AFE777D4438C rossferrence
59,007,255 *06423EBF3BE8748CBD1CE670C1BC7B189EB69C1A RPREWOHS7
59,007,256 *064F892CA88EF19013013AB01F997F68EDC84E66 RQV*
59,007,257 *06451D74E0E30859C27951BACFDA70F17A3D2213 rruhewmg43
59,007,258 *064FCD40696755532B4C735C454973F4D41048F9 RUGBYTURÉ
59,007,259 *0644A6E6CDB68F8E4C3365F971CE69F137078373 RZBARE
59,007,260 *06439F63B78BACC91F6100C68040BB654A3CAB94 SaintSeiyaHadesChapterThemeSongs
59,007,261 *064848579A3B8149D8D7143BC6C9319D984DF3B0 SALMONVENUSING
59,007,262 *06499F83F136BD1C3BA5034639339503E4030944 SAMMIE.GRENON
59,007,263 *064627479C16B66C25F8D49812D279F553A81EEC sanjusapkota
59,007,264 *06435918B76E4331CDF4D7DCDECA8C685E0F21A3 satellite-jockey
59,007,265 *06456F288A905A3AB0888CC296E0AD1E25665F81 SATYAKATHA
59,007,266 *064D55EFA700AF64A1C3EE91FB6FE3AAC53F29B0 SBURLON
59,007,267 *0646503833ED43ACFFA21DC3C716EE07383B787C scuffled
59,007,268 *0648E652B34FAAB62201B5A5E120911528A55FF8 SESULLIASSUORBS
59,007,269 *064F61049FA6AB23DF9DCFC703666A52FB1E28FC seymourlevangie
59,007,270 *06446AE8D145CEC7367C6991622B5460B0A4CDD9 [email protected],
59,007,271 *06421369F74E62F2D7AFFF41E81E7B6B145C3BA4 SHADOWSTOBY7
59,007,272 *06420A8DD0836DC8976790DBEB136AC74418F3CE [email protected]
59,007,273 *06402726D02CD09EE87DDBCB10DF39306F6F1D8C SHANEFOYE
59,007,274 *06445ACD6298EA0C8184DFDC113A55283A200ECA [email protected]
59,007,275 *06432CEF2864FDD670313C34C4B5C2D9094E4D12 SHELTONLETIZIA
59,007,276 *0647A0FE4EB9304D01CEF4D1B11549F5D92996D5 SHERMAN.STONIER
59,007,277 *06431DF0C60BD0E86BF04E20702BE0221FA1CFA7 SHIRLEY TACKETT
59,007,278 *0641BFA6B9FEC4675A95188085564DB9DAEE81EA SHRIMPCORE
59,007,279 *06465B769A6929E70066B642C796F48C4DC33AC2 [email protected]
59,007,280 *064AF69DA3047A12BD4D313C17E2DD0806316756 [email protected]
59,007,281 *06454680B2D26A17F2BA09D1E83924137582D44B SI.DNEY
59,007,282 *0640482CDD765754644863BF0391057EA5EA3096 SIRAVII8
59,007,283 *064F79CF89074FB1F50427EC571841FB7E709FC5 SITTELLIKRIC
59,007,284 *06422861202A76677071E9C14652DBF9F82E663E SIWASH1
59,007,285 *0648E3F55A1A979886AC51EC34FDC011321243D1 sobefreckles
59,007,286 *064D976D3BC218254BC3063124B0A4F4B955ACEE SOFTBALLNIKITA5
59,007,287 *0646BAAE35DD6003727ECCF72E4BA61FD92103FB SOLOCONE
59,007,288 *0645B1CC08AFA4589E46D20876F7D22F567464D5 SOLOMON.DEVANSKI
59,007,289 *064CA8D66EFDC30B2AA17827552BAE692DBFA9A1 SOMMITTING
59,007,290 *0644616DA8E8E414C0C1BFD6EEC0DF69150AB50C SONGSFROMTHEBIGTOP
59,007,291 *0646C9BE0BAC4EFA330749C7FE68BF0A774ABB7A SOULSBURY7
59,007,292 *0647AF26EA275131F3A29731567775E5183C809B SPEARSORSONROBERT
59,007,293 *0648F36E8AF6081F6F4A3FB400ED5C5913FD96E4 spencerkuske
59,007,294 *06489500A9FCD7F83EC80FDF19F383F045997395 SPLAT0~(------8
59,007,295 *064BF44DBECC3616D3036B1A4F03A8841D57C3B5 SSPMFINNJ2
59,007,296 *064EFA6A136C6EFAE0B34E39395BDC634989F9FD STANFORDGRAP
59,007,297 *064E4CC5C0AB313D267C6ABA12B432A447063E80 STATDBSW0
59,007,298 *0642BAAE80F3DE007CFCF993F9651898C294BBB3 STCHTLJKHDN7
59,007,299 *0648F7B038F20A20B16C534E33DD226E532BAB45 STEALTHEXPORT0
59,007,300 *064BBC711AE6B71EEE4CAAE4E007BAF6CC7ED7FE STELLAHOUSTON8
59,007,301 *0649E339A6B88C45B617B26CED379276396E4198 [email protected]
59,007,302 *0649C956710F59874DA356E70A9E779DE6E036CD stevestarghill
59,007,303 *064B56AC09F73B7EC02B316A30B182DB1AE7C24A STEWARTSYNAKOWSKI
59,007,304 *0648C23ACF8E95BB893D1AEC35546105B84C4035 stringquartetno.1
59,007,305 *064D9DB38FD29D856F83C3099B2C7CE40E242998 STUARTCHRIST6
59,007,306 *064CD9B1AC1D1EE7BD8418AD5FC8AAF4D5EB559A s.up.(Outro).(Feat..Perry)
59,007,307 *064CEC239CF6446AA11351DA67735244705CB5D7 SWISSMANAGEMENTCENTER
59,007,308 *064554D6D80B9A98616B5525EC3E34F439151039 SYMPHONY-IN-G-MAJOR,-"NEUE-LAMBACH":-IV-ALLEGRO
59,007,309 *06405FAD8094D1210ACFE0513D50124A1391AD25 syringe8
59,007,310 *064ADB4189489035E8B3D95F31EF71E6376BB649 T4TTOONG
59,007,311 *064202F6009B7C5AE79EAA5D0F5EDAF08A1F19BC TABAHIJ6
59,007,312 *0645B25990035A9376375B88F803C638A2839EB3 TALKEMERCY
59,007,313 *064653452ACB31276E61F171A7106435FBBB0503 TALKFORGEGOD
59,007,314 *0641B5B7A11F673B80D64D4A9D0021139FE210DD TAMMY.BREED
59,007,315 *064832D2520903A0ECD35276DC30AF65AA08F080 [email protected]
59,007,316 *064770F67C45629471E3BEB02E2557EB045B9ED8 [email protected]
59,007,317 *064D103849CD40C0B353C3350B1C2E2FF5C88AD0 [email protected]
59,007,318 *0640ABBEA2E217861FAEF9D2248903517B67FF31 TEWEARD5
59,007,319 *064EB9E94A02E9EE99421FB92BEEA8A747B7CBEB THALIA SUAREZ
59,007,320 *064DF00B4B9BFAE6B23CA46AB7E67B41D6D1558F THANHCHESSMAN
59,007,321 *064576A6FEBC7AB2E5EE24CFBCF08E729547F0BA THATFALCON38
59,007,322 *064782B5203D4281A86510AEB289AAD3EB4629F4 THATFUGAZI32
59,007,323 *0646CCB561790208D1887F22A3E214E81243FFC0 thatstacey20
59,007,324 *064FCF92F6705E3809E0D07870753E16C439BB23 THECAR44
59,007,325 *064EFF72608A3603779D0FD994062048FDE1D3A6 THE-GREAT-FLUTE-CONCERTOS-(DISC-2)
59,007,326 *064C8265012E0093E6A2891F9E93236E86FF5691 themiraculousmandarin,op.19:beginning
59,007,327 *06431452337CA883A430B3C12F06E9622B3C7F7A THE YEAH YEAH YEAH SONG (CHICKEN FRIED HOEDOWN PROTEST RALLY)
59,007,328 *0640DAC03D3A6A9A32F0F9872E7B9B80C4ECC2AA TL1XK
59,007,329 *064F068D49A670D1C316BA24A9CABC672C766DEE TODELLISUUSPAKOINEN4
59,007,330 *064EE0C4EBADAEE159BB675A75E9039D06AEE46B TOD.GABRIELSEN
59,007,331 *06495A99BC3A7A405FB2980FE28614B163F3422F TONY.TABLANG
59,007,332 *064A5ECE58EB21EF25941E7D078C530D90BB5DB3 [email protected]
59,007,333 *0648F4410B1B99EDCCA5B813A6D0E03809B2955F TRAVIS.ORVIN
59,007,334 *06493285989F28AE5C1AC735C436249E9E1E9A98 TREMBLEHAM
59,007,335 *06421B4A1AEE5C7BEB52D5637606CC673F81ACD0 trentonlighthill
59,007,336 *0645251DAD804047757E0BAF60D0911576310D57 TREVORMCDOW
59,007,337 *064B1655EF77013E2E545DA37A7E9A75637A65E3 TREVOR.PRYER
59,007,338 *06418FCF1B2307AC972428F956EA5D55F795EBF8 TRIPPA3
59,007,339 *06483915AE5DAB18CF6DC81C8EF99968A37ED1E6 TROYMARGIOTTA
59,007,340 *06495F87F0794455FE2B6B80CA4AAE9BC97B7205 [email protected]
59,007,341 *06494C1E851D5CA5C385FDA7CA6B01794F47D5C8 TSIROLF1
59,007,342 *06453A2D32E4E54228A402B7BEA557E31E9002B5 TUBERKULIITTISEN
59,007,343 *064499719FCA5E653FC193FDA92BDB83BD211BB0 TULLYBLANCHARD
59,007,344 *064337CFA05739FA860ED600C2EDDBB5ACAE6F2D TY ZACK GARRETT
59,007,345 *0642907CDA927B76436963A0FEF5DBD156F9E03C UDSTATIONERINGERNES5
59,007,346 *0640E228D2918FECB5AB40574056251A36ED388F uggiolan
59,007,347 *064EF672FD1D4509C2876D5C9F9EBA88CF1C3B39 UN4M81GU0US1Y
59,007,348 *064970E1BE8521825F7E89FAFFF23A7DC7ED8943 unoutgrown!
59,007,349 *064C2E472C3C686C803187C0FA5A789C9FEB769D using/working
59,007,350 *0648FC364A72005B87B705488D78FC5463D09186 USYDNEWS
59,007,351 *064F5A6607E7A0CB73535F2BC903724B62F230A3 UTHIKOLOSHE0
59,007,352 *0645EBBD3CD985A15714BF44CC1E785A986ED3CD VALDA GARRAWAY
59,007,353 *0642FB71ED8D700B4489640C5A6686053C49F934 valerie.edwards.heitfield
59,007,354 *0648C0A9BB6B69CA2AFC659F8AF816D5A0BB1DFC VANESSAHOULIHAN
59,007,355 *0645024FE1B964DF0132588E369D290AABC94147 van-morrison
59,007,356 *064F31176C287382FD9643ADA57427C0C7917580 verlach
59,007,357 *0640757B5EA212F2BE0AAE72C6626DEF88E51685 VERSTRÖMEN
59,007,358 *064C9C14A43290272D175438E11AFB1958143C39 VGUFZFB8
59,007,359 *064B544F443C19081B37675C37DD4F26287FCD93 victorpeddicord
59,007,360 *064BA459B103979F870A9C0964119E429A741182 vincebalisado
59,007,361 *06466D9968DBD9888835933869EEE640954D3AB5 VINCENTPEET
59,007,362 *06429B5E6E6D3A120DC0068D0C42E672F071765B VINNIE-BUI
59,007,363 *0644BBDC78476BCDF0EBD4CC1BE08DE3F6A1A7ED vinnyrey
59,007,364 *064650A823B7E75412193DF24908566AAFAB5DB0 virginia_150svg
59,007,365 *064F2F2ACE54EF208B39A29F200313E4966A65C3 |VL9
59,007,366 *0648958B61B190954268953EE4F57DCEF60DF2B2 voorbereid1
59,007,367 *0642CE1544F6C848462548B6315694F317022E76 VRHMNZNGGING
59,007,368 *064A3006677143831D3B409B49FA855699F1AF1C VTAKEREI
59,007,369 *0647D2CA99D01572CC37047E73C0E801C634C101 VYVINUTO
59,007,370 *0646FD9796DCB01A99286A8747CDC583385CC9FD [email protected]
59,007,371 *06475162178155587E7772766B2DE5D6CD95EC06 [email protected]
59,007,372 *064B65CCF9AAF111584231D60A6AEB850F0978A0 WARISJAANK
59,007,373 *06463C6CD6E7E4DE476161DF4817EA92A9086B45 WEILINLI
59,007,374 *064338693A3DCCFC00703708255C67D336DC75B9 WELCOME.TO.OUR.TOWN
59,007,375 *0649DC8676074AB3F57CA90DD77877DC30B3F755 [email protected]
59,007,376 *064BC50D1A6244BA70C2BE3D71EC9D5424DA5B04 [email protected]
59,007,377 *0643119FBAA9FBC3F829253BEEF8DF185321D383 [email protected]
59,007,378 *06443E72447754689645F8407150FB47F84801CF WERCNOCED
59,007,379 *064D928288257478F2D8493D63658924A9D79431 wernertustison
59,007,380 *06443B050E29759B4A10351098BB8B08252DAA03 WESLEY-DREW-WHEELER
59,007,381 *06456337D1E0DF1F1F16BBDCE78875C1365ACA77 wesnia-roth
59,007,382 *0645B83AB380608C468EB61961AFF9747E86B4CB wheat1234
59,007,383 *064D5F882A27DC1863FF522C1BB72913FDE34BF9 willianrybij
59,007,384 *064CEA2778A042F744425828240DC3F8C152903D wingzeros
59,007,385 *064225F89499FE8FFC806E6FD24F2A67873690A2 wrkxcastro
59,007,386 *064D1F17D269D6DD5548E8949029C367BD8941D6 WWW.NAZARENEPASTOR.ORG
59,007,387 *0649300AA97A04257DD9391E11F5805FE7131CEB WWWOLYFARRIERCOM
59,007,388 *064E7AB62864F41CD5AF6A540E70D20C231245A9 [email protected]
59,007,389 *0643FEA0329DCD268808BCA4B18458913A2F681A [email protected]
59,007,390 *064BD880786179126451090088E67C43D49B0DF5 [email protected]
59,007,391 *064E3B8A82BE7C04441C84C1C1BB09A7ED8E7983 [email protected]
59,007,392 *0649B66C0B13F27B6E5988C1B9C964E6E3ED1D77 {X} O~0~Q-8
59,007,393 *06482765A138B64FD37B299D12227187647EB06F {x}`[email protected]
59,007,394 *064381099A1BAD71505CA86C27C1AAB9E7378886 [email protected]
59,007,395 *064DF3268635CB4F6949AAC895DAF43FEA07152E yajaira-olivares
59,007,396 *0648D66447448CC6FA7B6AB88888AF68BC98C2F7 [email protected]
59,007,397 *06494AFD7D3F35A2CA9F615B5B99F55CC09DEE97 [email protected]
59,007,398 *0648618F7F930B3CD11B0D89F20B53F93DBC460D [email protected]
59,007,399 *0641BD64689F7F3154BD7058432DF9621D07B59D [email protected]
59,007,400 *064FA25381AD9B49ED8CD92D87EF1C61ED040946 yontekwa.albritton
59,007,401 *064FEDFCF184BB8DAD6AF7ADA6BFFCBC937ED0D8 [email protected]
59,007,402 *064631E922990F63C8C4701F037B94702A3B70F6 YTIGR
59,007,403 *064BC64C1884E2EA9E554892C14B8EF1123657B0 YUDHIEHERMAWAN
59,007,404 *064042DD9F747E34804D5EC334FCDED0F322AAE6 YUGOHARIOSAKTI
59,007,405 *064B742BAEFA9327F8A6AECEF2F8DE00E2B3E378 yumz.theo.mapipa
59,007,406 *064494B1D816AFD9FA10AFB7CCE4E275C45643E1 YUSMADY.AHMAD
59,007,407 *064D7D71181B37F27DC4C85CC0CDEBB4035E3F51 ywwjtrb43
59,007,408 *064788158BB467D9A5BC5550DA3C47364FB6F7DC zanatec-andrei
59,007,409 *064A904999459B248A5184213CA6E87CF667998D ZEDNEMA4
59,007,410 *064021AF2BCB0FF0E67B8FC225202EA20A6CBE31 ZHOUJING689
59,007,411 *0644D2D6EB3A05C450EC4A905534087B2B79B3B2 ZIONSUSI
59,007,412 *064DBABDADAF2B2D85F7966AFE1F330154104616 zobacza7
59,007,413 *06408C6AF8C4F697C5A0757769B765612329B2FE ВИННЕМАРК
59,007,414 *06428A53CDF9D3535858D9ADB863768269122CC6 дзюли
59,007,415 *06461CABDA23A3C2FAC23F207996654B318964B5 КАНЕОЕ
59,007,416 *06477D2C0F40A25175F97CF44239DE8B1588A68B напогонный
59,007,417 *0646C271154B50C07F4BB7420419F3A2BFB601FA нуурнууд
59,007,418 *0646B23FCF1CED714E979C35C8A5C2F84B5605C9 ПЛАВОКОШУЉАША
59,007,419 *064533CBA8D83D63012EA7FBB0CD95547C210C1E РЭПКІ
59,007,420 *0644FE0312E5B437317EF7ACB9A90B7370510305 СКУТТЕРУДИ́Т
59,007,421 *064FEF08562015F8A1417377DE47077A8A7881EA СРЕБРЕНИЧКИМ
59,007,422 *064149CB9015A23770820EA6026DF9AD15B4A025 ХІМІКІ
59,007,423 *064FB1C9D0577C3C61A6F074D17132E53559EDC6 ХОРЬЯ
59,007,424 *0644B6AD2EB32F2995C0D66EA9D57AE5821CDBC9 [email protected]
59,007,425 *06428D0E8F0A3D8F7E1B2F6FDD9FF482152995A6 07.03.1653
59,007,426 *06477B8E52629C377EC87639A78D13BAA8186808 10MAR1800
59,007,427 *064BDA8D3B0EDC904BB892BAEFA8FAD410A378AB 11-VEREIDIGTE
59,007,428 *0645D244D9652C4BDE7A704CA6B3E1C154CC8B3B 1541383 JULKAISUANTAAVIITTOMAKIELENOPETUKSENPARISSATY
59,007,429 *0642E88CDE6081E5CB94E5EC48B91381B497198D 1660866 ort : frauenzentrum marie , maerkische allee 384
59,007,430 *0646A978BF67BE4D56356905A24E078AF55D3CE6 1676919 jokaisen.asukkaan.kanssa.laaditaan.henkil
59,007,431 *06488CDF34760E3F8033CA8E81C456AEE016DAFB 17031774
59,007,432 *0641CCE5DC437F5C6AB218BF22487BFAF9F63E2E 1.alip
59,007,433 *06416216FF42199C6FF92AA07E8A5399C79C6C2D 1DELIGHTSOMENESS
59,007,434 *06493326E1C1D436A6B3E77619D20FBD7355A208 1 effortsclint
59,007,435 *064E28419C1EB2104FB2D5DF27D2F8D5DC052029 1GAERENDE
59,007,436 *06422670424E9FB53C2A1AE7711529BB77DBF8D9 1.girilecegine
59,007,437 *064C5A1A08D63E7FE597DE95A7E1B307DD38BDF7 1 heinzudo
59,007,438 *0642798C36F7D27EB3EC60D9CB68BD22F87ECB7D 1ILOVEBENJI7
59,007,439 *0649AA551BC4C40C1CE74E75F21D32BB0D814941 1.kalibroimalla
59,007,440 *064A83261CB3E1F698173BB0E40C9F2790AFA93A 1.LHVORSTANDSVORSITZENDER
59,007,441 *064A6FC1328D7D26A5858E6F4E15233DF72325C4 1 MILLHUNK
59,007,442 *0646E25060FF8730FE7EADFD8ADC8376B39D8297 1.personalriege
59,007,443 *064A45374F5E0CF3AEE7523EC1C13ED839BE0513 1repatriierungskommissionen
59,007,444 *064DA8238B2F7C7C557C2A7364FA0859721AEEC2 1.riistaruokintaa
59,007,445 *064A586957F1D65BDFEA3052FFDE4C8CB0BBFE99 1-saudummen
59,007,446 *06454A15D3B7A5DB046343D6DFE3D1A13960067E 1.schulspielplaetze
59,007,447 *0640D33FF8B06518C8E79B2F6FD332BDEAE85BB4 1.tiedottamisvastuunsa
59,007,448 *064B4B8F3BEAF5FFA3E1CDAC9C3D9291E0FF3355 1.variety-than
59,007,449 *06402DF8907F8272AE973DCF85A936EB2A3246E3 1vdszeiten
59,007,450 *064FFE3A2116C6065538FDF4348012AE5396D9C8 1.vermietungshoch
59,007,451 *064EE618950E02D946EBE7F4293F99041D614C7C 1verteidigungsbereiche
59,007,452 *0649C1F6CAA0EDF0369783F0CC7399E7ABA50493 1YHMIS-YKSIL
59,007,453 *064461129A65FD180BBF9C21F73A1743FCB90E07 2231112 der reposatz der ezb liegt nun bei 2,50 prozent .
59,007,454 *064168B352F2489F11C77D34EF1294B4901F1F57 232mckenzie
59,007,455 *064EFAE67ABCDB302F1DC0CE0005380662C92C7C 27AUG1490
59,007,456 *06437A15DD51BF4791D9B9B41DC936E120DC9420 2961753 SCIENCE AND CULTURE HAVE SUFFERED SERIOUS DAMAGE "
59,007,457 *0641E890EDD175DC94EC70A7675990FA01829B39 2ASTRALEN
59,007,458 *0648CC63D41D569E1568FE8C26E660F85170824B 2.KALLIOKEUHKOJ
59,007,459 *0647FF14ECDAE73B90EE2B5465DA1CC6AFFDA17D 2.laurinimist
59,007,460 *064F0C8839937500D31EAC2E230B91796A296A5C 2THELONGER6
59,007,461 *0643521DB4315DCF2CB5D0943E4B39F83F5DE675 390913 HYV
59,007,462 *064B084D775E28BAF7CA0F350C72BAC09A16E2A8 3CECMII001
59,007,463 *0645D5A5312A9DEE8E357A57AA7720F92D7553CB 3======D~-~-~)X(
59,007,464 *064C88FC4F2CE4D574AD56A2F9A2DECA151604A7 3ist-zustands
59,007,465 *064BB8FA3B89F0320770444FBD25254A44B5246D 3killerlion
59,007,466 *064E425E7FB79285100E87103DD2BEE7EA8C7355 3SANDLFOR
59,007,467 *064E1D79C018AFF4A124DD9DC1D851429BBF65AD 437705 cokverimlioldu
59,007,468 *064AA34CAB4DD227B64577A52A1641895D713475 440804 jos.erillist
59,007,469 *06474C083A2875A76FD16005A77A874EF02C0CC3 460.MAKER'S
59,007,470 *064B2DBD297FBF005FC0C4CDBF13FB24CEA8E78B 4ATIENIAJ
59,007,471 *064AA17E0135290BCD274CBD21FF299F4B28F25A 4bolton-born
59,007,472 *0642E6B3874C70EB9A56E601E8E4EC9D0EE72D7A 4iamnestle1
59,007,473 *0640B0B6AF1063FFB4AD69BB2253EAD259245E89 $4R4K011E
59,007,474 *064CD840B7D68E9170DF95C08B32C5C07257CC22 4TIDSFORMATERN
59,007,475 *064C4F46A7E542434E8860DE8AAB70F9372A262E 4VERSETZUNGSWIRKSAM
59,007,476 *0642CD192E758FB25B9ECE2363227C550389024D 519853 doGalfrekansbulmayOntemleri.
59,007,477 *064CD69D2CC5811896A36D8675B1AE675E6F463C 531fe89442a2d891c24b7e465ab835bc.4oodyrat
59,007,478 *06492803BDB15CA0F1C70EBE5CF36FB0AE6E0341 [email protected]
59,007,479 *06414F877518B085B331FD9202C294F3DCC620FE 5GS2ZIBX
59,007,480 *064527F1D43E8863D4D011D6EABF055D4D8813BB 5KORINERBSW
59,007,481 *0648FEE1F8ACC5CD914511D78AB11B504EFD2ECF 5MIGHTYLIST
59,007,482 *064DFC1A86DEBFB3E8F06623EB59430E0874C85C 5OPPINEIT
59,007,483 *064C295D2EF25833AE87E7B7FC1E094D8A7B5D44 5PATRYARCH
59,007,484 *064086E47477B4D0ED8118B3F0D4D6E202F7013F 5SAVUSAUNOIHIN
59,007,485 *06401926746A639C1514F7FF1B9069BC0BE9A1DC 5TARDISMARLEY
59,007,486 *064F5F59AC76885CEB851609D23A3D09FC813836 620943 TAVOITTEENA-ON-TUKEA-HUUMEIDEN-K
59,007,487 *0643034F3681D8D172F6F0C76E3428C711C54294 643ARIELLA
59,007,488 *064246850A855FD416F2886C5E8DC71B059914BE 6BSWKIMBLEPRIME
59,007,489 *064552BC37BF3EB121D6DFEC23ABA01F36AFEB3D 6e496adcef2ba94d34e6e21217ba49dd-170186
59,007,490 *06453CAAAF374F621D792D487B4E0A8717FFCBDF 6FK5
59,007,491 *064612BD783610DC16A6B230E533245ADB3E42AB 6GIFHEALLE
59,007,492 *0649EC5BCF47339DF3FDC9689B03571EE3F2C99C 6NONCONFORMANCE
59,007,493 *064192E8850280B25A5398465A734C2CB9F382B0 6SRETSMET
59,007,494 *064A1B263C760BD4F6903226E4346ECDC958A5C8 6ZAMTNUTY
59,007,495 *064FC1C261F6E0DF3C07BDC44767DE2029153302 7anacard
59,007,496 *064F602188FBAF9AA5355AF01E7E1E1D1ED86489 7CCOSMOS
59,007,497 *064B2335317F1231F14D9F26BF29F2A38E991AC6 7DOOHTNAH
59,007,498 *0646209B16E5153486A4F7A9D2CCE62BD9D5F6CC 7ENEDERTEGEOT
59,007,499 *0646831B40E9F9069F1884674D980B3A75123A19 7FERRETMEDICAL
59,007,500 *064DA771B54CDBEC830E028FC49A4F651696A738 7LRENSKO
59,007,501 *0649849EFEEF75BD95D976F5773131A43340D6A9 7NONDEFAMATORY
59,007,502 *0644104EBDFCB0313CB87EA87E07C1195230F0D7 7SOSTENENZA
59,007,503 *0640C156E48CFA8DE095368404A8F41210BC4CA5 838679 A.NEW.DATE.FOR.THE.ANNUAL.MEETING.HASN'T.BEEN.SET..
59,007,504 *0644115B41361C70F5AF7DDE861245C0C9A5F39D 8bombennaechte
59,007,505 *064173A279A2B8E7910F9540AE3A229DB910CA7A 8CORBETBSW
59,007,506 *064CB5522B2787DEFE0B2F4CA9472F96C5B7796D 8CSICOPBSW
59,007,507 *064E5173F1A6140767C52879789D1230B5EB750B 8HIGHSPIRITEDNESS
59,007,508 *0648EBC52163E785102CE70127A07B4475E27D49 8IAMMACROSS1
59,007,509 *064FCBFC18BE8553078086A0648B6D88D9484C94 8MYCLOCLO0
59,007,510 *0647B498DD4401A066ADC70AE33F26218A550420 8=====p~~:p
59,007,511 *06433A3D3B954C8BAEE64EA6DEE4FC017F0392D9 8STATIONPEDRO
59,007,512 *0643D158CCD9FE5E5EFD088E3668A8E6BC90D762 9ALFAATTE
59,007,513 *064D6FFC0CFFA9C1186C731AE506CE0D41CC6150 9BSWTRDSBSW
59,007,514 *064A16B1AF68933DB1E7EE082929C89AAE78E93D 9IAMEASTER3
59,007,515 *0642F6C138DD758C4A004839BC388581EF9D028C 9IARETSIR
59,007,516 *0648307228FA50ACCA2F8E494A921C8FCE7583E7 9laboureur
59,007,517 *064C28368F02CADB8F4A5B5961D54874197B7C6E 9PERTERIFIE
59,007,518 *064D2A7BB8BF6566CFBEC7D5852EBA9B4786A4D7 9PHLAEOPHTHORUS
59,007,519 *06434535183B0E545CA46E2ABE66F5445FF193AA 9ROTAROBRA
59,007,520 *064EEF380373BF8922127A8B35BB391AEB58E6E7 9THESAPHIRE7
59,007,521 *0645602C943B1C9D25AD6531E2277B07685A29FF 9tiseraient
59,007,522 *06495E6E5350605AC0D11BAF6944C471AD17E461 AAA#'V
59,007,523 *0649F17288FD14E30D304D962C8FC53DAC5A302C aaron-riel
59,007,524 *064A3BE9E6A0B0FCE9A3483AACF22130FAAA9A73 aa/uu
59,007,525 *06498913BF903710C48FE81289CD3430D3929898 abn;2
59,007,526 *064A365371C59603B6259791AFF57C6512A688E2 acccuracy
59,007,527 *064E73409E5936190C492838EF3596E4BA030907 ACCO%
59,007,528 *06414A4DE0B404041C6F610553D6E46128E64DFD [email protected]
59,007,529 *064ED856800BDA5340A88F97C388392C588924BD adrian-denney
59,007,530 *0649F532543B121F337FD27D12D9BFDB65B96489 ADVERT4
59,007,531 *064AA0DE3C513D13C81256A4E0F0383E28E2DDE8 AEGROTO-DUM-ANIMA-EST,-SPES-EST
59,007,532 *064AE36A18A3E9CD7ED411972BE9ACF75B476C99 AEQUIPACE
59,007,533 *06455B933F7E36172CB817DCA9F64DAB25CBF4B1 ajr/
59,007,534 *064750C4AF2C9DABEEDF6A6C804238116E92AEC5 [email protected]
59,007,535 *064E1B38DA228ACE0E57970ABF43BF83BFF66C03 AKKERBUK
59,007,536 *064396BD9EAA89C95326565D3B55AFB8AD6AC894 ALANMEISENBURG
59,007,537 *06486CB7A0A9F8F22CDE1FC11AC40B622AC1549B ALBERTO.KLINSKI
59,007,538 *064B4081CA05B6BEF986E72D128078945BC37D0C ALE ALESSIA
59,007,539 *0647EAA648F263DEAB6DC31D341EAB0B3252660C ALEXANDERRATCHFORD
59,007,540 *0648A21F891BC73A19DE58C519A4B85FF3B0009E alexsallies
59,007,541 *064A294FFEF863D29FCC1F09C26DF28666AB0A88 ALIMENTARY
59,007,542 *064A8C7220D07652F35BC3CCA1B683FBF7162F26 all.the.things.you.know
59,007,543 *06427C1ACAF29DEACD9DAC69F7D0449EC054FB82 ALLYOKIBOL
59,007,544 *064E6B6FE2085297C3E5F1E0432DF807A7081D21 ALPINIACEAE
59,007,545 *06441A509A5F65F4313B3F3A5C354794B89841AE AM=-M
59,007,546 *064B39E6A2A98E07219EA629FF8DC7E92F01422D ANKi
59,007,547 *0643B61FECF83FF1344F4A31975AFB761A4E2011 [email protected]
59,007,548 *0642670E37BA4CB2FF904E5AEF5C066EA0EB7D2D ANTII$O1
59,007,549 *06496DE546987F40969215DDC98D7B448AF9E550 ANTI.NAZI
59,007,550 *06426939C249772D2C5580E5B90F0ADEEB891A51 ANTWANSTREY
59,007,551 *064A4CB59728F33D4295C56435FA0372885149A3 APOCALYPSERVICE(ORJAKOBDYLAN'S115THNIGHTMARE)
59,007,552 *064731D4F556B925F2CCC123DD285D8595B0ED5C ARNULFO.ENSLEN
59,007,553 *0645DD20F7BD03193AF859E9C5882500D45F8D26 arronstillings
59,007,554 *06413DF6CE8989E64AF50CB87653E54A16340871 ARTHURMACALMA
59,007,555 *0646C51A1D0613A86CABEEF2CEA15A6452C146B9 a"r-u
59,007,556 *0646B29669E586CEF23FF2048F6EA79238E4F9A4 [email protected]
59,007,557 *0646EBB7F3C981FFA70E0A850CA6D7A357365639 ASHTSUKIKO
59,007,558 *064D53B329C2A4C48335F1ACA9A5F597606867D0 astrah10
59,007,559 *064B7B8A60E2FD2EC7CD3DA757BBDDE4EBF28DCF AT"v
59,007,560 *064C702EAC894F6E1FB77A0AC98F253E6E8036DA augustangeloff
59,007,561 *064A921A7CB95C742F022FDA08D95BD978964C94 AU.OW
59,007,562 *06477031102E4354A75D8B3F5AEE991CA0FBF867 AVDELNINGSSKÄRM
59,007,563 *0642A511F189DD0AEB3E854B988580A1C40BAF9B a_vhl
59,007,564 *064E3AD4499FCD5F688053F8421FBE74961D018B a":-w
59,007,565 *0642B40426832A8708E8BC2C2E2F8076A7C8AA9A A"Z]
59,007,566 *064B0E670B07FE19F63E05FC038D7276DF5E5E37 b)3
59,007,567 *0649A7E4B4371E195BC7AA720603D9C2844CB796 B5L6S
59,007,568 *0649AD70528CB7CC075837E5532728BCF9A27B61 BA?;?
59,007,569 *064D44E4E532A2FF323A832E5A1AC39CCE6BBCFC barryfaur
59,007,570 *064AE9E7722BB181844AEB1373AAC3CD2A023293 BASIL.ATAMANCZYK
59,007,571 *064FB07270D3651CBC159E012F60338190FFE6E2 BASN6
59,007,572 *0648D61ECABECE5F5B00A22FBA27CAC0F3D9E7FE b(b"(
59,007,573 *06467280F496CF50648F89A41EB01448B970F2CD BB1O9R4PHE5
59,007,574 *064AF764D02BDE3A201C6B038AD2B58CBBBDD2D3 bb)em
59,007,575 *06472F4E92E2FD29FD3D588B9FA500F9C202C34F BBNQ;
59,007,576 *0641EE38EBA488E25B06268461FE3293B78246B8 BERNARDLINS
59,007,577 *064665A03551221ABB9E87389E57A56421895E02 BESAMUNGSORGANISATIONEN
59,007,578 *0647EF1A231D5455874449F249733C4D69551CC0 beukenoten9
59,007,579 *0649E43827BF6AA36F8CB74AE2A4B0391F6127A6 BILLYFRICKE
59,007,580 *064002C501646DDCE3652F08C41427012E613BD7 B)JCP
59,007,581 *064A48E07395186F9BB7C20073A370E476DCB942 bks=f
59,007,582 *064C6B5DF2B963AF0D97FCF9A75DF3098539D6AD BLFSJ
59,007,583 *0640CB9472E8EFA3C5C71B79883AC0ECAB4E10A0 BOERENZWALUWEN9
59,007,584 *064AC71A18717BAD0C0F308513715B04112C1C0D booksiread
59,007,585 *064B252BB5A105739CE5F1A239A2CE1B7965EDC3 BP` o><
59,007,586 *064DE6F1FEA08AD1D2204EA338E0730235DED127 BRCQ
59,007,587 *0641058B4FBBC9A5978368E189DBE5F4728FBDCA BRIANNE-CALHOUN
59,007,588 *0643CD3C0DAE003E0AC765F462DF04D11DDD5804 BRITT.HOTEK
59,007,589 *064EED1A9D3AB8CB1082613A428786E42F7B47DC BRYCEHILE
59,007,590 *0644453F5E0880972EBEFF534F66CBE8EC76E9C0 bryceradigan
59,007,591 *0645263DF8E8CEE5DC0132F71DBF3E573BD74884 bsybe
59,007,592 *0644DDD98B86294EBA145254117A4B00D842F207 btl2#
59,007,593 *064A2E918087133769709E866803414CB7E76E97 bt=pk
59,007,594 *064A2A1A3AE000365E4D5EE130C8F4995D2C9D0B BUBBLESQ6
59,007,595 *06453C620970971DE9A383C4E16094BB9AB1C904 BUBULIKASTAN
59,007,596 *064947BD42298B4EEA8B20564F7203EC7A58674A BZP8C
59,007,597 *06431519C0476E3EA2229208D5ADC92800185AD2 C8OPD
59,007,598 *064CF2A4C48A24BAF3E29267CA7EB75689A5CB0E caedb
59,007,599 *0644A07A56A8F13751E33BBFF2B759D3BDF56C18 CARMINE.MAGOULIOTIS
59,007,600 *06455806FE125F8056FFBD44F83BC9D20D76E274 CÄY
59,007,601 *0640D1E9D8B5C28BD7689AE735FFDAA28FFFFE82 CDGIS
59,007,602 *0641306CFD0AE9819B63B99FD4EC4AFF8F1D3157 CERA7OD1DAE
59,007,603 *0641165C1A852F4D3060F1D5248313A1308CDE04 C,FDQ
59,007,604 *064A735DBED846087D289FE89486EEE1DD7B5EE6 CHAD.BLUMENSTEIN
59,007,605 *06449FAD6F8C68C14D5716480203714F6BD74D73 [email protected]
59,007,606 *0642D292FDBAC7FE1AC78D33210B3DD5E7DD1E16 CHAPTER52-01:AJIHAD
59,007,607 *06434FA038A53DF5306E87C9CE84A4BE2DD9B99B CHARLESEMORY
59,007,608 *064F7FB488ED7F95D2AFA7F30A13268217BA6784 chase a
59,007,609 *0649FC12A28D6CB35D7BDF08678F3BC691515554 [email protected]
59,007,610 *064D947F5C070525F16F159122937FAA67E82E9F CHICAGO-MAYOR-DALEY-APPOINTMENT-JOHN-RICE-WILLIAM-BANKS
59,007,611 *064B7F675EE44693A1323B1ED415B17DC4EC8CAF choir-vandals-(muscle-beach-version)
59,007,612 *06497204C57F6C2A8235BEEE4F315C8EDE437229 CHRISTOPHER A POWELL
59,007,613 *0640BF5C6CD76D71C89FA8BA9E4B3EF200F7920B chthytmy0
59,007,614 *064FCB8E3C1053AF988AD980276C955839F9F006 chungkugel
59,007,615 *064F15D084589909E18773CF9A9F8D9C9F90BDAB CIC?%
59,007,616 *0646FDCFC908946E0D4DA9EDD4B69C183BF4B614 [email protected]
59,007,617 *0644310FBFD627B7EC1061EE12EC784206F56A0F cl"
59,007,618 *0645CD686DF8E1E0AA7D61E183B947C458DED6C2 CLEVELAND.SCHEMBER
59,007,619 *06494A5123B6C085FF94484FE70BCBE50AD671B3 CLIFFORDBROSCO
59,007,620 *0646CFFD40B9A0FEDB090E801CAB221F380865BF c;m#j
59,007,621 *064DB7DE3AC4B0C83FB2532D4EE32C6D8FF1B4A0 cmt0g
59,007,622 *06404EE0D8E5F778CD9EE0632E1583F7924FD4C4 coa&;
59,007,623 *064A99FF62DA49C11E83B86D32D2E495AACE9598 COLLINSLTGT
59,007,624 *064971F2627244AA2516BDD6014427643EB3CB91 comaculum
59,007,625 *064F0C2589F52744062C1D3BF27095A40FB1261E concerto-in-e-minor-:-3-allegro-molto-vivace
59,007,626 *06471E53F205A98474CE91664BC2DA005CF9EB22 C-O_Q
59,007,627 *06408621E2EF4BB5419CAE7FF9714186A6F3D26C [email protected]
59,007,628 *0642F7C2786981D31AF1ABB831BEFDB80AB2DBAC c,r?;
59,007,629 *06412EB8E0AD4421B0F7B6CC724E48241228A57D craig.mills
59,007,630 *064EC6E3493D51EF99C6177BCE05429FD544A85B CUR-5
59,007,631 *0648BFF3CD403115F8AC2AF59D91EC890C8AADEA [email protected]
59,007,632 *06450915EC76DFA4B6D04B46BD7F9EC4F309621E CZ!W!
59,007,633 *064EECB139614B36FC07785113CFADF3D0690D6A d86
59,007,634 *064482BD9044CDE8973F592D23224F0EA9BFE7FB DANA.CRUSAN
59,007,635 *064902D0F14F39A69601AE21F997C9570209C8C6 danielle-templeton
59,007,636 *06402904F9849F977083F1B47C56BE12FF274240 [email protected]
59,007,637 *0640F55492CBE35402A53B70D3C219E976A2721E DARRICK.ZIBERT
59,007,638 *064FA12D52F63FD8D3B24BDDB77CD6E32C69F36B DARYL.TRIMBLE
59,007,639 *064F08037DDD2AE407CD192A4029BB777C887EFF DATABASELASER
59,007,640 *0641E6119FDC802DA7B5A1A39591A0E75B8DB5AC Day.of.Decision
59,007,641 *064A2327755BCBA8BBCA8E26BDE36286B491CBA6 Dbq+
59,007,642 *06436D596E5F7DE4976593CC4CB17F927562CFE3 DDN
59,007,643 *0641F9955785696A2C11C1F6335FCF02FEBAE056 deangelomelgaard
59,007,644 *064BBF0A89E3E7E38A6BEE0094BAAB986D9F1A4A deg(
59,007,645 *06469DEB138A38F44DB1139A10D9A4AD25F9FD39 DEN.BAKKER
59,007,646 *064F588A35ADA7A05C3800E419A2EA635C1A0359 DENNYSISOMPHOU
59,007,647 *0649B8338572FD7B2590DB28585E16CB84DDD40C DEOBANDIDERVISHDEVIN
59,007,648 *06481FA8AA0FC5FD8F8E1528F07C530ABD41AA9E deshawnmarusak
59,007,649 *0643AEB19A2416400ADEDACF4E0FE90F58D6C35B DESNEEUWMANVANDIEDELDOMDIJNE
59,007,650 *064B2D3067F2ED334241270F73FAD2B3BB0B883B detpark
59,007,651 *06426B1B01634061DFD6112D76AF7F9CD8474FF4 devonroloson
59,007,652 *0640188BDEF21FEFA2F90AEA1E55370DDC4B9C82 dfc6i
59,007,653 *064BDA5796194833EF6174DA1F2BC44D857C0F68 [email protected]
59,007,654 *064F4EA76E510C67CE0886A4B6499EC90774FA2A DGMGM
59,007,655 *064F2811634134B91A49C941577590DD9B540631 DIPPA
59,007,656 *064491E0570FCCC7A4504BE116218CC243687D04 dit,g
59,007,657 *064C12DAAC9E19B1E826F0BD533DA2B098225D06 DJCTS
59,007,658 *064FADC476D17025B4E1BF17C33B5023AFD26679 d%lvu
59,007,659 *0645A07D1CC5B48566B5B68B86CEA1E0D424B40E DNW3S
59,007,660 *0642B9A62BB3B83B48F59EC267D842C85D9CF376 DOMINIQUESKIBO
59,007,661 *06476CDB58B7BC75967081D422B3D0D24AE9B61F DONNA.JOY.TORRES
59,007,662 *0640FB70EB8240E9115D83EDB2AAC38771E8AA23 DONNKAITZ
59,007,663 *06406961B113EC25502163CAE55B42D67893E6A2 DORAMAY4
59,007,664 *0643FE666B81BB8BF90B993492B9AF9755839A01 DORIANBREZINA
59,007,665 *0640C5024020B05AF6CEB7B726C7142F2D1585C7 Down't-Touch-That-(I-Demand)
59,007,666 *06478A0046DAFA7E12432DB71D37A75B81F6B31A dpt2r
59,007,667 *064E72CC84998422D6DF7A70295274051D919876 DP!Z6
59,007,668 *0641A081B8EC957E129F9842E261CF3A99107793 drobbinses
59,007,669 *0644F042915978E728AAFFE66D30D05B5CF0F01B DSOJ)
59,007,670 *064A178D4E9DF1798EE49540E79AFCDAE3F539AC đù.đà.đù.đờ
59,007,671 *0649761D8ED7C9BF5CFF9802CC04D7D8BD448531 DUDLEYRACE
59,007,672 *064F8A7188ADD0B16529706344F0C8BB426E8404 du:e
59,007,673 *064EE76C0C662E063740A350A199DF146C4F56F0 dwlf
59,007,674 *064C8C4F8C22A087BF6D3B8C9A11CE5B748EC6DD DZVL
59,007,675 *06407C379A4BF72D1C3B7CD79FD89CB1B4980BCB earlasch
59,007,676 *064B2DE14CF336E5AB2FF8C38CB581F81732AE20 eawty
59,007,677 *06452298FB31BE28F734BB697761A8019033C3BF ebt)9
59,007,678 *0640F2DBC6A40FB8D13986C61AF17FA1676B1B93 ECEAM
59,007,679 *06420896E2DB290B1384E1C246DC9728BD7919A7 eeb(
59,007,680 *064AA096CA40ED048846D7FD58775BAAEE096DC3 EF[G
59,007,681 *0645ABA3007A7E6CD32F18F03C8A255C543EDD38 EHNFACHE5
59,007,682 *064FE8A9403906DCD4CC28283BC56834CF1E5F2D ei4yp
59,007,683 *064ED1DCC15A67C675FD7F722E50894007D6711A EIAI!
59,007,684 *0644704CD310307250100C034D5E1121D51B94F2 [email protected]
59,007,685 *064D9A17A8F1ECC9752208997321230ED046A98B elecoilec2
59,007,686 *06493ED77C23B50D993B4BA4EAC641CF9AE00C5A ELISEO.PERROTT
59,007,687 *06497754A65B6E64D4BF5F0949B59DFB51FE82C9 ELISHA.PHEASANT
59,007,688 *0643AD8DD2B9AB5D3DC8D19114C619A17FFC9BD6 ELLIOTTSALOME
59,007,689 *064A25B388031867E5C751970ADD5B0AEEEB2182 elmertuel
59,007,690 *064FD995FF0900ED6A874D2AA4ABE4E9BFC38222 em3w
59,007,691 *0642AFED19E79857348BC1C625A8CD4241AB144B eme92
59,007,692 *0642F29943ABEDE6CA91FCC96E7E619801E18446 EMERSONLENZO
59,007,693 *064C44995C84FF9336CA5DEEED562C084E814F52 EMERY.FAUCI
59,007,694 *06493FCBCD00B53C5A51D6B5F8121A72101F66E2 ENMEWETH1
59,007,695 *064AB3911B8A2E9678A1E38AA4303642C02637B5 ENSFARVET7
59,007,696 *0646BC8ED7FE5F706E288B9DEB0B42F04280408D EPb
59,007,697 *0641D2461A88B8C04366D790D82D9B570F957274 erickovalaske
59,007,698 *064B1BE733E4DC6E6748AC40F2A1933479F8093B ERNIE.WIEDRICH
59,007,699 *064EE127C169D3DD95CAF1569F79A97217F6BC0C errava
59,007,700 *064E083EFB7F0FC8525283E5C010EF6D036F7DE1 ESPXB
59,007,701 *064C02A5525BEC708036C136F39E5F684CA3C380 eullx
59,007,702 *064D0EE1A7E09A54228151C8519918B8C9C326E1 evasionals
59,007,703 *064DEC368EF9FD815CF00D866AEB3771E43D30EC expierait
59,007,704 *0643986B1060C0AD598AF130A097985FA8109A5C faktura
59,007,705 *064ADB566DC222BB604658080D09F5D60BB2ABFD fastisque0
59,007,706 *064FAF9A6ECC4938BFF888BE3FADC833814BB66C fatabla-1
59,007,707 *0640DD9FA93036ADFC36F1EC3363E6F9B953EE9E FatalAttraction(featAI)
59,007,708 *06409AA02BC1172E807794BCB4AE0CE9E8C66B89 FCATSCORES
59,007,709 *0647E7485891BF658EB8EB318E24260DF74BDBE2 FM0810
59,007,710 *064A3FE57BF6257E4B87C9033A78D0097E5C95AE FMEDITZ
59,007,711 *0644C67E88BDFBAADCD1FEB76DFC719B7BD2CA30 fnetiap7
59,007,712 *064C15FDBD4738710F6330D69229946BFD5B4F73 FONTANŮV
59,007,713 *064838AB408479D8F297A1D2F0890868A321983E FORCUTO7
59,007,714 *064154EF60E9111BC74227C5B80C07E6246BFF95 franny
59,007,715 *064166FBCCD9D4BA77F11DA3B7D65AF185B24B74 from each of the option elements
59,007,716 *0646707D14DC6C536BD4FEE270E976BE639AE326 from-me
59,007,717 *064DBAE303B42B7D5473A8F2B9926C272BC1DDA8 gBR
59,007,718 *064FD3A5773B248BCAED5F20F3F2414197C5AD0B ggsmho
59,007,719 *064685C12A7CC1C0463DAFF51E2E63AF4571094C GLIBBERIGS8
59,007,720 *06404D67A382A511BA3DA3F9E747888CD0FA2AEC [email protected]
59,007,721 *0645EF49117E66C6D9AD443CF30BCDFA401038E8 GOSATURN1
59,007,722 *06492F374C43565E37072B7289AB63F6B9F78AF4 GOZIEM1
59,007,723 *06491116668B86CB7634A747AB537D84A4AA6136 GRACE.PEMBERTON
59,007,724 *06422362A74C9168A4DAEF3C3BE80752273CDF64 GRAHAMZINGLER
59,007,725 *064A25769B7D2FF3249B7CB9AFEE970880C08D0B GRANVILLESCHAAB
59,007,726 *06480C420B7A8EFE222645655A54A16D99369753 GREGG.AGUILLARD
59,007,727 *0646B89121C617C0894486A8EABB16F178EDAAF9 GREGGORA
59,007,728 *0642D14A6724CBAD22B165CC6A468D43B9030B98 gundi23
59,007,729 *06406484F374E26744FB4546ECB6E2DCE7AC65D3 [email protected]
59,007,730 *0642AAA58E514326C2B187B4262712E1D2995A52 [email protected]
59,007,731 *064F05819FF95FA79432FBE6F74A0746E62BDD6F hakmun
59,007,732 *0648810BDB9E0A4A65A4CD2A7523C99AB438F555 HARK!-THE-HERALD-ANGELS-SING-/-WE-THREE-KINGS-OF-ORIENT-ARE
59,007,733 *064FEB6CC07A8ACA04C10AF8D8F09970AC306C80 HARRISONBIRTWISLTE
59,007,734 *06473E6BC61A1ED5D0973236A1ECC4CF9A7E545A HAVE YOU EVER SEEN...?
59,007,735 *064E1510FAA3CCAD90BD9C96CB51651ADAE0154C here, take away this dish
59,007,736 *064C916AB85A37E3121945B646A67CBB9DCFC887 HERIBERTOWUJCIK
59,007,737 *064C4552DD158FF59B33FBBF258F36A30E8BC255 HERTUGSÆDE
59,007,738 *0642406820B8E11A91C81A2202CCB418878EDF14 [email protected]
59,007,739 *0642E984FFCEDD47CAB33A36CDD761C5319DB223 HILDING5
59,007,740 *0641ECE8F09DA6CD545191390B1ECAB7F4631454 horaciocaden
59,007,741 *064A7FAC0ACEE5277D52A07FCEC3C4104398EC5C HORRORS.IN.A.RETARDED.MIND.'94
59,007,742 *064CA4F550E492C392D9396097370D37ED50A442 [email protected]
59,007,743 *0649F6DB7F74ED027E9CDD84AC38C43A0B1F4827 HTTPWWWHOUSEGOVTRA
59,007,744 *06494F0FFC2B473C6C2F2016FBAF0EF4C4966C81 HUEY.KOH
59,007,745 *0647B65E2806386DF27AA7CE932A60E5B4F92622 HUEZENGA 14 0
59,007,746 *064FE2EA4B5401CCD6CE5147CA1663534E53EFD4 HUGH.RAINER
59,007,747 *064E97C62D0370C8798D8FFA5F4262EA2BF49F9E HUNGRECORD
59,007,748 *064206612E9F2BAAD57F58AA0021C7C51C617ACD HURSE
59,007,749 *064514410566D11E3117664C5B636A148AF62354 IJARISSA7
59,007,750 *064F9408B6C7661F8ECC04BD6BD87BCA7347CAB5 IKE.MEEMKEN
59,007,751 *064FA6A0334A0F49DDB39F4774DA91D632E7E262 iko――
59,007,752 *064D529817AD0A23DBD8753CF1282CD0D482C00D ILOVEMOUSE60
59,007,753 *06444C52E609E1681D4126893B15EB42FE3CA30D ILQMLARRY
59,007,754 *06466A0E43FEF5116005EA7A2BEA43C953A3AC07 iluvcar02
59,007,755 *0644711103370151CB245FA2C6C03C17A5792661 imelda-hernanadez
59,007,756 *06492001347EEF5FC56CBF3E6ECE6ECE0D369B88 INDIANABÓL
59,007,757 *064FC6044E83214E5657270DB886F707F5CC24AE [email protected]
59,007,758 *064C675C8C44767FC2AF8B7884408AA5D656E691 interruptered
59,007,759 *064DC5FB6639A0007395FBE15D80FD37FE99FC97 IPQN
59,007,760 *06456989238549A41F937F6B952F9320B7D34A7B iterationbased
59,007,761 *06432C8C6E28F80D4B4FE8DC1BB6B25347CB79AC iT'S-MY-SUBWAY-DEFENSE-SYSTEM
59,007,762 *064AF79FE1C84BE9C09C09225F1944E6349B21E6 JACEY306
59,007,763 *064DD163E63076B306209B218DBD67F8CC62EB00 J'ai-Danse-Avec-L'amour
59,007,764 *0645C382DF2F77550BA3B2EC2B37F5A7434BA546 JAMARION670
59,007,765 *06457D4A187B0C9829E518028E2E3D4F8DE7BBEA JANE FUTTER
59,007,766 *064AF4420AABA6409F0187E7BC8689A32B9A71BE JEMPTYN8
59,007,767 *0643403B7FBE711ACE68ECB47DD17794C604BE83 [email protected]
59,007,768 *064FC32CAEFDF21B106144B05BFCB55F31ED02DB JESSE.DEMILLE
59,007,769 *06464CD6986A80A214E9A030DEC32E0068C5C6E9 JEWELLALZAGA
59,007,770 *064FAE2F13C91460762687D0492243308A1080DA JEWEL.PAUKERT
59,007,771 *064D38E74D26121B1DF739EEAC51C25C3071BABA jewishstudentcenter
59,007,772 *064C0FECCDCEFC29CFD73948D49DA2127E5694CE jGv
59,007,773