List database


<
# MySQL hash MySQL password
520,480,001 *35215AFBA2E72DD656B21259E15B5DEC153547E6 NOBLE.DROZE
520,480,002 *352E6D45E8B12E237A308256EBFF2AFB8967D1AB NOBODY'S BULLETPROOF
520,480,003 *352ADEF0123387BAA95800EB7A2C64F238F377E6 HTTPWWW.MONASHGRYPHO
520,480,004 *3528EC8BE557A1ED59E221965E19ACD4C9284CDE nolantilzer
520,480,005 *3524AA2C60DAF7B313284F7DA2B5F58A9449A16A [email protected]
520,480,006 *3525DCBB1063C3A65933075F7F96D7F563F532DE [email protected]
520,480,007 *35284D8BEDC72ED39E68FEE352039E14A806FD4F hubertpomainville
520,480,008 *352667ED58A8BE464B2BDB16CC9D7E60AB29E035 HUEYMANTANO
520,480,009 *3523E8EEBEDC07A98FA7C14D8108EC5E6F56C2FB HUEY.MARLEY
520,480,010 *3522D9B29BBECF6B5E6E0C5D1A3A4A8CD906D576 HUEYWROTEN
520,480,011 *3529FE9FB7AFF0FC1D15985FC3B6534B69C37EBC Nord-Wars:-Dave-and-Dwid,-Perfectly-Groomed
520,480,012 *35248CFFCE31FFBC705B02F0C97EA0262A779162 HUSSAM.FARHAT
520,480,013 *352C8EB6B6224811FC05A1939E64692780D89AEE HWCHENDINAMO1
520,480,014 *35297A01FB1BAFB4A638A61342ECAD4DDBFD02A8 HYMANSCHERLER
520,480,015 *3522124E3033488C2993305EB0C8E502F39C9DA3 ntngblt'
520,480,016 *352E7606515AD66EAAA97DAD2E0B4910C42B625D OBXPÔÇ
520,480,017 *35247C3BA27EDF0E1EEA23730A0D8712AEAAC67C IDIGGER9
520,480,018 *35287845BCFCB37905D96AFFA565D5AD57322680 [email protected]
520,480,019 *3521BA5363AA5CCFC4A304B08C7F26FB5DB9E280 ifyou'vegottroubles(1965-10)
520,480,020 *352ED7ABE488C8D741DADE3BB1CA0360105577F5 OGNIANOVOPZSCHOOL
520,480,021 *35227F84E2DA3842BCDC11869DA641DBCDBF9E72 OHMAP-DOTON-MARBLE
520,480,022 *352CF3534F63D58172A3CE236221C2D53EA7A17A OJT4615
520,480,023 *3521BC59D204F3653DAE8C11395BA5D2BBEEB442 OLENFELILA
520,480,024 *352BCC477988BECCD96B89C2A1B04498C88B3497 OLGA ORTEGA
520,480,025 *352480D7C8D08F3B670CA16178AF6B761857446A ILOVEBYTEME22
520,480,026 *352F148D9567751E6FCBD5B8715F8FE10A92E426 ONARTSURF
520,480,027 *352158DE64C52D846F1F183D28F66ED52CBBB3E7 ILUVREGGIE2008
520,480,028 *352E5828248ABE14C161A693C0224C33BE910500 implosion.sweep
520,480,029 *352115C2B0CA52A0AE00A1CD78171E3017CB7041 [email protected]
520,480,030 *352298A0C8D4F022B00CA2BDBA6CBCFD16D7A3FA PACKIYANATHAN
520,480,031 *3523C1FACA2D49B6B89386ABF09D31CF34EF48F9 iwan-prayogi
520,480,032 *35221DC015E61A8254A75B07B592778575EA77B1 JACKIEDEETERS
520,480,033 *352ADE9AD98DF82334E8DC37B7F84C013877089D JACOB-STOLL
520,480,034 *35273B7724F6E346B9956997B9B30ACEB2B15CB9 pB * * 3B<
520,480,035 *35203BF0815225FE6EDE5B07E68B692E664D8F49 PEEPAOP
520,480,036 *3525CAA9A4F4001BDA1A927B62953E8AB99CC2C8 jalgpallurikarjääri
520,480,037 *352363A1F4836BAB1F228565476A5A2989AA8557 japanskedisipliner
520,480,038 *3527F4943B80157FF35E38926512CBF33E554405 PHILIPMETEVIA
520,480,039 *352C73F9FE3A0BD09E805953A8163B1C4ECB3CBD PHLEGETHON
520,480,040 *3521A3C239C18AE5EB9A8CDDB2CE64FA0FFA5BE3 JAVIER.WITTING
520,480,041 *35259F049018A52359E26913FCB571C42073DE21 PICKERELWEED
520,480,042 *352F29ADFE8608A61548FC59277FB469CEDF643A pierrepeetoom
520,480,043 *352BC448459155F9486386F64E7EE0F834BA162B PLAFONHAKEN0
520,480,044 *35252BF2C276EA8269DB0734FAC3236584A19C7E [email protected]
520,480,045 *35277460265E2299986E6D0D619B6EB62D78C4E2 PLAYGIRLDINAMO123
520,480,046 *352415C25872D7F0A89FC98206E3405E8945F78D Plum8ere5
520,480,047 *3520CE4F8BB44FF1136FE35DDF04749025B6B79E pocket-monsters-diamante--perla-platino-la-pelicula-a-la-conquista-del-espacio-tiempo
520,480,048 *352779104F4C1534BD221CC0992F9EEA01B4E6FF [email protected]
520,480,049 *352CA5555E2CC36B74F10084C9CAC66489FD0D25 POLITIKAELMÉLET
520,480,050 *352C98856C9C389ECEE374CE81DA1CDECE5B871D jerry-pierre
520,480,051 *35205456C11269BAB07A3BA156FAF561A0F01CD8 JESGORDON
520,480,052 *352C26C8A99CA41214399553BB14A79CF40255C2 POOJASARAOGI
520,480,053 *352703A950A8B5622E300717D9243C185AE9B2B9 JIMMYMACIEJCZYK
520,480,054 *352BB23F190FCCEFB03084084ECABA62A06BD5C1 [email protected]
520,480,055 *352384346E28635B94058FC2E8DB080451761F15 pp**><
520,480,056 *3527C9A55CA07D11B4CDCD8841CBC6CCF8892C27 PRACTITIONERWA.COM
520,480,057 *3527CECF16B28E84B029025CA484FC6D24D9BD99 PRAK-MALY
520,480,058 *352796859BCAFFB6E40CD4A499A81815EC11D7A8 PRAKTYCZ
520,480,059 *352A9BC08F591676EC284EB4F94FBB557609CBDB joeybendetti
520,480,060 *3524982D95948FEE8B9C6C6ADA611532BF7943C8 PRIME.TIME.POLKA
520,480,061 *352912650D87A862FD4687C30AF8D0AC63E5402B joshemman
520,480,062 *352633CB3A5F4FC96F0BA82CD07C4BD230210250 JRYNALDS
520,480,063 *3523390C10664761F191526756B131E30F5C3AEB PUBLICATIONS—AND
520,480,064 *352870DE1B8DD91D97A7BEF218206332B99491CD puckettrooster
520,480,065 *352F20EC5646CEF89785BECB7759C0C9DE0511AD JUAN ANTONIO CHESA CAMACHO
520,480,066 *352159E0F155AF1F0757AFF24325AFF7E3654163 juan-carlos-luna-lopez
520,480,067 *352CEF8E7F2DAD1C20D0C6F610801B3F45672AB3 punjabi.prelude.(tap.your.feed.mix)
520,480,068 *352A8A071630D7F92AA7D0D3C4F85D284269986E q5b
520,480,069 *352A15A8C7A149DAEC1A6787CFC7A8960AD0B533 JULIUS.ANDREOTTI
520,480,070 *3525EBE6BC1D8B3D8D692C6D8F5AF6798C44F2AC q####d`~-}x{
520,480,071 *3526B1098E30135C643ED6ABF5B725BCC8235B1F junewilliams
520,480,072 *3522D14A2A8128EFF5DAB9CFA312D204670FABB3 JUN.LAVADIA
520,480,073 *352CCDCE667966DE2800FF7CBEBC662584ACD042 [email protected]
520,480,074 *352EF9D6A45946FE9FF99BB40BD7E43DC81628A4 q=p ~0 ~o(o_)
520,480,075 *3524A1073D8EE014ADC324C2C19C10B791473494 $QUA$H.BO
520,480,076 *352643F3351C5147061D283817D5B05012D7D634 KAKALAUR333
520,480,077 *352ABCD8DF420F0D69F53EB14CD66FFBDD4EE8B0 kakografie7
520,480,078 *352B79D0DE2182EF0203F9BB760AE1F461926364 QUINCY.TYKSINSKI
520,480,079 *35264F5FFEA411F952106CA761B21F149F2F069F QUINTIN.NEWBY
520,480,080 *352D1A5B4869004F989873A64B3162CF0F3D0246 R\
520,480,081 *352108CAA90AA5E24C2941866E0E80C1AEA32016 R4F43L12
520,480,082 *35207BCC143D97CA892824410D27F8185B9A6FA5 rabbitberry
520,480,083 *3524AD78C26B463003C8E8116CF66D85A92888A4 RAMIKAWAS
520,480,084 *35251AEE5F7555D4B2709D06B6ED1E6FFC9C4329 KEITHNEVENS
520,480,085 *3529E931E0DD12BDD52EF3041270D371FB1BD200 KELLYPEYRE
520,480,086 *35232E250C4E9E55F1767E1AC55F610004EAA669 kendalldeback
520,480,087 *352AEF17D41B03A92DB7C341F4666CD69E86CC33 kendrick371
520,480,088 *352848B2081768EF7A3390343406B0D4F2456D12 kgj"
520,480,089 *352A221EAF1438E9FC0BF0818E619517D022BEBB [email protected]
520,480,090 *3523DB5617D36A09D8C4D954582773794735542D KIVÍVÓ
520,480,091 *35253B08E7171F90C1F7C488542F0E26D0A4B9B3 REEST4B1SHN9
520,480,092 *3524788CC1274331A9665C361E92397F4726983D KOERCHOW
520,480,093 *352299D4005F0B321BAF877EE5DDE8F03CCF01D4 [email protected]
520,480,094 *35262FF9B6E34776A71D0F1CFE9F448C1DD9104D Relaxin'WithChet
520,480,095 *352E08DBE20F883FF6FCE48982382F167C5DD972 KURTFORADORI
520,480,096 *3523D7E41D472D5DA0FB9F6E8009FF2AF68494DE [email protected]
520,480,097 *352256207EAE8AADBEDEA6D85E8EC511CE5CF535 R%I
520,480,098 *352B002F393C31F1CBABDA6F8B96F0A72657AA43 l7h
520,480,099 *352ECDDBB7A467D2CA98808AB1F610CDB7B80C62 Lady-On-The-Island
520,480,100 *352D8A55745FD5C8653FC2DF86A10DCAD4820179 lamarderks
520,480,101 *35221DB7E7CD195CD4DD5A2FDE4ACC5B09920EE8 RIGOBERTO.SOBLE
520,480,102 *352030141197852FE444529D46DBEA0F63568002 RINCIARIED
520,480,103 *352929E8A605E73EADAA762CB2B843620B8CEB6D LAURA.WINNIE
520,480,104 *3526B59F125CCEE8A449E2D7180E44828ECF4862 ROBERTOTHIESSEN
520,480,105 *352F66BDBD24A8FD9B9EFF37047850AB19AD5B05 LAVERNEPIDCOCK
520,480,106 *3527EF1DE5D5933EA613A233371EC8D765A5C665 RODIGUEZ5
520,480,107 *3525C133850F5729C843A7FB6BA378F2D6CBF903 leeannporteous
520,480,108 *3526C3BFBA2C77E31660B8C3A6DA51C1CC02CBB1 ROGERGREWE
520,480,109 *352E31506B7BFE3D5B85BBABD3D14165BA25D3F0 [email protected]
520,480,110 *352423F21AD04F7843B786835889B07A65C6E55A ROMAN.TOPI
520,480,111 *3529B4CE99D587865331174AB0C148830D0C5321 [email protected]
520,480,112 *352892773472B5626A0DD06CD161D2DB5B900D3F LEONELSTARICH
520,480,113 *3522597C29A63B9A8C9F323CCD3DD69BDF757AFE ROSISSENING
520,480,114 *3529B175830384612B7C603D799ACA46BF8FD985 ROYAL.MONETTE
520,480,115 *3520E156708FABAB71D25CF024557D66E14FB349 roycecupe
520,480,116 *3524D3B5A60D82043DC82CA09AB72C3B77671543 [email protected]
520,480,117 *352C1974F1ECEE30045054FDD369AF796D6DF9B4 RSTERNED
520,480,118 *352AC1AF1B4ABAA2CCA9981F8F2B47B1FD01500C [email protected]
520,480,119 *35283F81388455E72007E669E103DEA565E0BA49 [email protected]
520,480,120 *352B99140312885A4161264735EFEE935A575838 [email protected]
520,480,121 *3529B27CFC4EAEF0217A686BF64367BF9606548E LIJENILI9
520,480,122 *3520DCFE240011397D5D0DB817E2407FB6D88A27 RUBINQUEAR
520,480,123 *352514E969598C02241C7CFC57DD3B91BC604243 LISELLEFILLIS
520,480,124 *35262237C682A7EF6ED5006F2F4C954CE0E7384F RUSSELL.SPOHR
520,480,125 *3525D451D22F96772AC1B3E664F91A2BAF03C08D [email protected]
520,480,126 *3523F1F600697BB6D809D4595B407139DE9CF90A rustyjusten
520,480,127 *3528A4C24C411D2E877C297166608B27E004E77A rvai
520,480,128 *352E921E62603DEC373C36A067346373D1CC1E3B loewen91
520,480,129 *3529317159852FCACB1704A1988649EE75F3A547 LOPAUKAMEA
520,480,130 *3525B772F8A9A7B6A71BB036723626527715E72F samantha-ethan
520,480,131 *3526D7B9BA72149F0327829F858B708196D11D27 [email protected]mailcom
520,480,132 *35220634C5048264AE4AE8CEF3DA3AD347D16323 louistherouxseries
520,480,133 *3527551AEFC18058CAE5AC62581315C1E776DC1A SAMUAL.RAIMONDO
520,480,134 *352A94CBFD0AED03C6F7FAE2811CB7B5DEB82321 SAMUTPANNESHHU1
520,480,135 *352E20E6EF091A3556573C6D6C3B54981A0EF22B SANDFLY
520,480,136 *35250446C9402AEE9D013200767C5260270205B7 SANMARQUINOS.SIGLO.XVII
520,480,137 *35245BA4C2058189A5A6D5EF745D144EC316791E SAS_AMATOLA_F145
520,480,138 *35248A71247A14146C8CAE960971C58B4D4B5AF3 SASHASNICKER8
520,480,139 *352D4694CAE56ED3387EC4F8DD82082E6BCC0ACB SASSYCHIQUITA4
520,480,140 *35289CA65EB77146733E4ACEC436B354A5C4F15B SBBANANA
520,480,141 *352B56A8E78AFA748501559F973ABC81C0A64631 MAELESTUSRIST
520,480,142 *3529336D36B4653F60CE373F5B7B6C6C4628E93D MAHATO.56
520,480,143 *352645D4B11E818EB8886E0CCDB1A67B8ADCECE1 secuana9
520,480,144 *35203F5A2D41226A059AAE12EFFAB99D08DE434E manberggren
520,480,145 *352FCCBA42202F46519FF97C5E10912DD7C1B030 mannering6
520,480,146 *35238A2BCA750F5A7D913DA38D912CB14EBAEA52 MANSKU
520,480,147 *35218C06B62E3D108B15BE3E6A64B0CBACEFB61D marccapanna
520,480,148 *352195CAA37AAABE1CE28C3A5D5443A2FA7DD9C3 mariaklafehn
520,480,149 *35290206D11D5A7DECFD5C02B96BA0256D4AEA40 MARSHALL.DELPIANO
520,480,150 *352C2BC2125CBE2578761BCA2C9CE76FC52CC3DE MARSHALL.HULLINGER
520,480,151 *352B3D4A4977BE7E67576F2F00F4FFAE6E6C6EC7 mass-a
520,480,152 *352EA0FD0822CDC96CEF425E68E0EACD196AB77E SHAGASHAGASHUFFLE
520,480,153 *352BCFE0C2F606AE136E2A6B0CCF0B8DA36E170B shakari
520,480,154 *352605AD02C570D7B6E4358D06C9B4CD047C5AC6 [email protected]
520,480,155 *352901138CC7201E150011A716C289E345124530 shaynereisling
520,480,156 *352C385953CD4C52DA0938E0E726ED83A715D76A shay-ris
520,480,157 *352E10A6768951CC1FF26F795DF7E77EDAA51FE8 SHELLYSLACKER
520,480,158 *352AB5FFAE61F155FE6F5CE73572160B84242D8F shine on (syke 'n' sugarstarr remix)
520,480,159 *35259CA7945D44A5ED8C99D9F851EB248CC2C38D MICROSOFT.SQLSERVER.CONNECTIONINFO
520,480,160 *35233100F044C92F63553888400841AB09AC1E48 MILLIED9
520,480,161 *3525B76DA05BDB1CE8B467D3B13CC635EABB7F95 SILAS.BOPPRE
520,480,162 *35253AF148A2E3BFE41B282CB42323B28B2658BB MMISHBAH
520,480,163 *352B9535649A181589EB219D4CB74FB2495CC413 [email protected]$
520,480,164 *3524BE869D4B572B73B08784B0F8D9419FE9A1D8 MODOROSSÁG
520,480,165 *352C7C6F82E4EE272287779D1856D36B470649B1 moederschap
520,480,166 *352DDC1FF753B31ECEA9642174D9D067EBE2EDA4 SKIPPY-WHITE
520,480,167 *35251AA14F02EAD9911B356FAB20310EC978A0CC mohamedmcfaddin
520,480,168 *352B482D4B4F4E3840885B42CA5E8815614BCD7E MONIED123
520,480,169 *3523001A373B6C473BB5769B08EE080487232FCC MONTEDUMAY
520,480,170 *3521C2BC5F2C5D358A0D8690AB22319F2788484B MONTY.ASHBY
520,480,171 *35273B1D9FC89770197C09EB945D780624E5948B MORRIS.ZOGLMANN
520,480,172 *35283F7E2912C188518B3B6640E70EE8F11E4CA4 SKYWAY-TO-ALICE
520,480,173 *352CA579054F933E6DA452A3B5210E1C90525CAE MOTOZUMY4
520,480,174 *352276F99A9ECB3618D1FE877F69B6A1FC5F2E88 SNOOPYGGING
520,480,175 *352B9BDD6503877E09FD9DB6AF60A74D610FC126 soapwort
520,480,176 *3526A89F69B57819AE418B1FA3AC8AB24BBD29B1 MYSELFMXPC05
520,480,177 *35299216AEA40CD0E394059C25BC763ABC98404C NAAFORP4
520,480,178 *352531842584F4AE04C7BCF27BF0784988D88071 NAPOLEONTUCKETT
520,480,179 *35291BEA0BD9AFE46D2D81122DCA2C2BD8F8448A SOSIAALITYOENTEKIJAE7
520,480,180 *3523D166935D6012D801F24967E29F8D42C8A4AD NASSIM.BATRICE
520,480,181 *352461DC78CFA6052D8ED9657EB4D7B7947B2A27 NATHANIELZIMLICH
520,480,182 *352E4B390C04CDECFCBD095AB4166AAE91CE1CEF NAUTURERLEBNISHOF
520,480,183 *3520EADB545F9BE1BD981D60F560E2AE9B7D6403 NEWTONMARANTO
520,480,184 *352BE2F1BFEEFB59E0E224EEF5F383772D91EABB NGHBRRS
520,480,185 *352EA0AB7417CF54A8D06C8AB2C63B7E823589FD STACEYWARRIOR
520,480,186 *352811D026913659C2A93407A3A292A6A3C86274 noblecatalanatto
520,480,187 *3524AF6F40F3FA47188D56AC0068BF428DCF6F68 STARGBSW
520,480,188 *3522A2BB8CF08363BA2002D3EB1BF84F96B224B1 STAR),與一般恆星不同,棕矮星由于質量不足,不能像正常恒星那样通过氢核聚变维持光度,無法成為
520,480,189 *35297BD4264E08F684A7707994BFB692CC124DDE nonviability.
520,480,190 *352BD87DFBBB6BE6794D0B99DB8A5BA3BFAAE3B1 [email protected][email protected]$
520,480,191 *352791E790BEE6C48C4A8691CC40B8965BFB1066 NVELOFF
520,480,192 *352EA750DF6A7E77C18480ED926EFDDBCE634537 n|xaaa
520,480,193 *352233E1FAA3E334486D9C7598973BA234634C92 SU8STRUCTI0N
520,480,194 *352BA203A2630B414428755A3654874986BE714F OASEESAO9
520,480,195 *352334D37166421D5CFC3820E1DF81B849755411 odellviscarra
520,480,196 *35255AAAD6F399E649AD6E19B0DCBEA735AE00D0 OFFENLEGUNGSMELDUNG
520,480,197 *352A037DF87758C3205BFC56D94257CAA6BD6C34 SUNG.GREGG
520,480,198 *352A7C672FCCE829DF1F1467BB533D1E51E3F39C [email protected]
520,480,199 *35224DB0407F681DD77B1CEC7836BB8CCEC3496B [email protected]
520,480,200 *352F29A308BA23C170ABD88F31C9CEEAB6714C15 oklahomatoweroklahomacityokusa
520,480,201 *352586FB0387D5B072345C669863F1130F213896 omerherout
520,480,202 *35212521723A146FFBD05C104E5AEF36676FCC26 OMOYN9Q4
520,480,203 *352D138BA7C70C2344A6EFF240B667B5E4BF4554 OMWERPT3
520,480,204 *35284450584CFC77B02CB86636B711CA989DA116 ONUITROEIBARE!
520,480,205 *352D5F03407D44AF0B7E70796AA76F658EE8D54C OTHINE
520,480,206 *352017412372DEA158FF2EB2B19CAE2FC865FB14 TANOMYEGA
520,480,207 *352C5FDEF4038F24D93DCBCE14B6A0A71C338B41 OWEN.UMBRELL
520,480,208 *3529C1ADB1B76CEE94B380F95C3C8857A6C9F51E [email protected]
520,480,209 *352427A6111937A4689ACC8CD9AAD9FB22A9F44E p1e85c7e
520,480,210 *352544CA098F3970D13FF64CD2CC51C295CB6CC4 TA.YEUL,.R
520,480,211 *3524707A848B648F215B83BCC21610BFE0883B1E [email protected]ET
520,480,212 *3527809EC4D75D4F29048119FAC0E336A146D1DE PANONGE
520,480,213 *352EA6D93B011A212527A6E4A373F1D2DEC639A8 TECHNICOLOR-NIGHTMARE
520,480,214 *352DE6AC6E01AF7728F9D1A546E2A82D92E462E7 TEMEKA MATHIS
520,480,215 *3526161D206CA1705748905AF8987F631828403F Parade.(version.364)
520,480,216 *3529A864E291EE9EA35CCCA3F334FAA7770311AA PARLALE2
520,480,217 *352BE0F76FEAE418EE94B8EA035514EA20134706 TERENCESCHWIEN
520,480,218 *35263F872A224045FD55E70573D5DD948829E89C terrancekimbral
520,480,219 *3521D91B573E99DA2EA6E5E1D2A46399B9FC3C37 terrancemaro
520,480,220 *352544CF3CE2187395D9103B563C599081F08A5A terrancevanderkaaden
520,480,221 *3526B9D47AAE267F5CE5FF3E72B352D8840716CF TERRIBLEFUNK
520,480,222 *35256FDC4C9046B49B508B66CE6D03DC8AFC1EBC tghayart
520,480,223 *3528161DC0602C87B761350435D4C886242C74C8 PELOWSKI8
520,480,224 *3528A3A186CE8520BFF09E87422E63DE6B1DB1CF TIGHTPLACE.COM
520,480,225 *352D955E429EE499A47D36D355353894AD13DA5D TILSV4R3N
520,480,226 *3526BA4BFF88C52B0A74414EA38E5D2668E8605D p---p~-~-(>-<)
520,480,227 *35203D624234E6B95A6097583D993A8DDA9340D8 TITANICIRISHEYES
520,480,228 *3523736DF1C806E7BEDDD91504CFDE5CF9604224 P####P~O~O)X(
520,480,229 *352BA8098B1413C7F0136E535A70E2583591D4F2 Print-qq!she-said,-"hi"!;
520,480,230 *352AACB18300BAC42519A18DE0D1EF61C016536C [email protected]
520,480,231 *3525DFD690AC7A9E2423B169B208BEAAFF47A4F2 TONYWELLMANN
520,480,232 *3524CE676C8495CD6DA3A6DEF686FACBAFA78C54 TORARULLES1
520,480,233 *352B2483E17A0E264A2ABC73AD9519A5F192EB8F P######)`~`~SPLAT
520,480,234 *3524159029A2E9074683053D1512B41DBFFD1BBD TRACYWITTIG
520,480,235 *352BC9797D4BEE5A54930F47D4A18E9323422D37 [email protected]
520,480,236 *35292596C738F4C3CF244F94D2A8AFC9AAB4A063 QJ"R
520,480,237 *35229003AE4DFD3C24319A516992860FE93B4026 q->~o.:p
520,480,238 *352EB9111CCCAA802EB6B2098A4665E64D670788 TROYITATE
520,480,239 *352662923AE05A58F792B826F9C83D2FCE6B1FA0 quartets, op 112 no 2: nachtens
520,480,240 *3524625077A4F101BA40F5AE477F6062CE301BB6 quintinverastequi
520,480,241 *352BE6784335123037BE718404F8044488389472 R1COPR1R41
520,480,242 *35292C0A6EF98E1F61687B8A6B771D6EB0F81F77 TUARTOR9
520,480,243 *35229767D273229449632139E1FE6ED892E776F3 ramonsudderth
520,480,244 *352DA39F10CBE2140541E2F0B0514FCD61C81830 RANDELLSWETLAND
520,480,245 *352D1AC03BCE0517DCC01754318D81191FF9779C twelve-gaugetw/E/lv_g/eI//dZ/
520,480,246 *352F2C863DB6B07B2788DA77F7B839758EB87D72 twilightdisordercomwww
520,480,247 *3529D08B9E9E6C258F30CFBF3DCE375CC966C530 TYHCLOOLQED
520,480,248 *3528F73E239B499EED7646B905A28A1D148CA8E5 TYLERURANN
520,480,249 *3521815E308FE9BA03192E280DFF69C504F975D8 RECEPCIONAROM7
520,480,250 *352A269882D99809B9E44AD66C2AC7A78FBE1C06 [email protected]
520,480,251 *352561D8CA8FA5B2914C326F8D33F23981C5B9E7 REINBOLDSMÜHLE
520,480,252 *35246D95E822930E8EB89F84078A94D2EF8A38E6 remberg…
520,480,253 *3526624A337EA21BE8EF92A90BF50DF0758A4CB7 RENCONTRES
520,480,254 *352FDEA9C91B299EAAE045372FED6FA3AF75075F ulanshardarbekov
520,480,255 *352BA16B3083EF1F4F21A2A132B03E6B42B42056 UMAIR RAZI
520,480,256 *352B1489479CBA71D98805070409BB55423A8C1C —UNAFRAID
520,480,257 *352A7A53E9102338935BF8A1429194D77A3E1E83 [email protected]
520,480,258 *35239519BCF7450B624EB1BF42DC1A73090BE215 UNMANDATORY
520,480,259 *352E1C85DD95D0181A67D3552220FB273E93AADF USERBRIANTEMPCMT
520,480,260 *35267E3501EF385F6ADCE3BB8F38546271992A56 /usr/share/perl/5.10.1/unicore/lib/gc_sc/hyphen.pl
520,480,261 *3526A5E0E691705C8BAEA608AB3BC05561A837A0 UUBUSHCD
520,480,262 *352C5993D42E420506DDC4A4D7E29212369C04DE uu-o~0~-(======q
520,480,263 *352B91E62EB0237A468A49F4B6B6C6450DF211D7 V126216
520,480,264 *352ECF4BC52158D2F33F3DE738B0E86048BC5239 V`AG
520,480,265 *35225562739454024A1C57600B7B9BBD4869E755 VALENTINRANGER
520,480,266 *352E30D2EA53EA593E6EAF9A791ED21FF5AB5CE5 VALERI-LOGUE
520,480,267 *35297CD082CBB1A2625D626E14B4237A6916A9DE roryricketts
520,480,268 *3529540CA148FC891C648210CB695B789EE75BF0 vancethakur
520,480,269 *35295A7A66C23DA8B8ACBF8FB50B12E713348662 ROSE RAFIK
520,480,270 *352513368A323BE51A1F6FC93E7404B24AA0A3B0 ROSIE-S
520,480,271 *352673BBC9A1F14C126699637E98FEF8CD99261B ROTHENHAUS“
520,480,272 *35297EA03429B20A31DFEDF3DC7BBB446F4E2B1A royalmcelduff
520,480,273 *3523F930C55C925488877860F7442FD1D9D55072 RUFFPAT
520,480,274 *35252B020649DFC963B441C464CFAB12C5BF689F s1oughine
520,480,275 *352CA41D01E57C5E769A4B77539A0FF7E7146266 VAUGHNDEBLANC
520,480,276 *3522038E99A90A16BF5F64DC3A3B36E26013650E vaughnstubbsvicioustylz
520,480,277 *35263A97D98116314605B537F55DDF3A42D9F7D6 samanthacriswell
520,480,278 *3522AB9677CAD0390C05E9C8DCFBE028924F8848 VERNOIA2
520,480,279 *3528A018303B791B4429D76EFBB21ECDE07BBB33 [email protected]
520,480,280 *352748FA85243E6615E628604FC8D0BF9E643D2A sarcocarps
520,480,281 *352FAAD0713C1735A086E6B14C03FF2ED48C2F0B victoraery
520,480,282 *3528F99FB4AE974BEBA542232F75B85FC5ACAD34 SCNC1917
520,480,283 *3529E69F2021B44D7F674ACFADD61549EA1B445B scotlandslastspanishcivilwarveterandies
520,480,284 *3521F290AAA7B06F8AFB2A603B90710E7663E2D6 SCOTTY.FINDERS
520,480,285 *352C62863AFF7D5154DD305153B4396E61C04A0F VINCENT.BIAGIOLI
520,480,286 *3520598DFBDE4B23B2C328470BAE84900EA47266 SEATTLEPICARDO
520,480,287 *3527A7F6BBAEAAE1C3CEE63C94C9AB4A401EE763 VIPERKARTHIKKARTHIK
520,480,288 *3523E7936B9060555182749DD5DC1B392E26052F SERVERNE2
520,480,289 *352DCFF5580FDB6FB44332022CA6CAD0E61FFA4A vrihi-s
520,480,290 *352A4C71DB94890A472319625953480A67447D88 SHARED-OFFICE
520,480,291 *352357D2877A1CD8597E5ECC46D5B92E50BEF5B2 WALDBROOK6
520,480,292 *3527C9C28DD7D970C85B5B8E50F1B6353896F881 [email protected]
520,480,293 *3522EA8E1F0A30CCDCECB4540EE677C2393004C8 [email protected]
520,480,294 *352913435C66F044C9F1433C28CF42225D6DC77C SHURIKHIN4
520,480,295 *352065373829B2EE1DA6B3FB2BFA4F30836C4C9D siegfried:-aufzug-iii,-szene-i.-"wei
520,480,296 *3526BD9C4973C845EF5C494DABAE66E6C93A19BC [email protected]
520,480,297 *352AFCBE04CAF6CF04DFC058DE4B21DA7AB752C6 WAYNE.ROBINSO
520,480,298 *352EB586A8C95D7A6F749BD97EEACB956FC22782 SIMON.SWARTOUT
520,480,299 *352002F4CA812301C1EC0836CD77A7AC658B1AFE sisodopa1
520,480,300 *3528436E5F660270DE9115DA39395790C9D752B0 SJUKPENGEN9
520,480,301 *35269B379AD05C87B31CD79B6CE74360B5B39D1A [email protected]
520,480,302 *3524247F7A111AE8CBF49FE81D3C0345FE96D650 SKRMYDSLERNE
520,480,303 *352F7C5B00DB7603FBCD8170DC811345BC22E05C SLA-BRGR
520,480,304 *3526BD1567230267AEF9B77A447054829FAD9E95 wernernessmith
520,480,305 *352428187D15DF3BBD8F178F84726225F0C39417 WESLEYSTMARY
520,480,306 *352388F82CF19BC08F1B4FBF481C1221FADF425D [email protected]
520,480,307 *352B78A307F2CCD36379EAE1BF4CA9ACE5EA21AA SNAIROUKH
520,480,308 *352D551A51318438D8DC51BFF076CEDA40EE5069 WETSTUPID
520,480,309 *35232E05D064E2D328D5D26F2F3710F97F950F60 SNOOPY2556
520,480,310 *352ECD4680549518E1CD2C06D9D623CE43D9D3EE soapwort
520,480,311 *352DE74E80A574C9C4AB008ACAC1A54F306627F4 WIL.LASCOLA
520,480,312 *3522A4DCB395E58B10533EF2548D9D904C424306 Sonnerie-Aux-Morts
520,480,313 *352A540FEE938BCBF50145BB63EED3E02437D9CB WILL.GOTO
520,480,314 *352F4A16BC3D729649D7B0C6C52117184E7628F2 SOURCEHTTPPHILIPPINE
520,480,315 *3524944792C6537A47BD6B94A4624938FE4E63C7 will-soltren
520,480,316 *3529F2788185C466D26B2DE7DF14B959FE1288CB WIWITSIMPONI
520,480,317 *352816DDFF3FACEB5EA40E725687705F3996BE6C wjebuvwj32
520,480,318 *3529A1CC338CFB5FD4476485956286E534FCDBFF wohlgefing
520,480,319 *3528249EA3E59CEB230DCBA944E9E6B0242CF0FF WRA571E
520,480,320 *352D981876F07406614341E4A7D6A3417E29AE8E SREERAJ SV
520,480,321 *35243D8A9A8CB16128D73D94D79AE47298584E92 SRRY_GRN'S/[@]/R//_GR//N
520,480,322 *352BA76BD571A1EFA918AE144C647B4A574E160A STAATSTHEATERBALLETT
520,480,323 *352F39706505B2397C1ED52F55C91935C7F40D4B WWW.IUCN-TFTSG.ORG
520,480,324 *35264AE340EFCAC34CAA86ED106E9D298FE1AEBF WWW.MYSPACE.COMBOUND
520,480,325 *35267168D012C9C880BB8BC7B44069A849C19B62 wwwwildbillsfoodscom
520,480,326 *3525AB1DE4907AFC9D7C1BE0D45C30A64B81F981 W:YZ
520,480,327 *352B22362D08EBB23EFD62914D2909A00B7CF7D6 x21d16
520,480,328 *3527FD1F659A7370CBCFA1AB764ECB44A559D70A xgpcrzwpcsboi
520,480,329 *35223459FB5C3F1CD00B469B2189FF93DB34EB92 STEVEHOMA
520,480,330 *352E7AF9F1B5912EC86FDEFFFF434D403C272D5F stewpotned
520,480,331 *3520EF2F54F7DBE71A8FABF7701A62E225A0A0FF STOJ D
520,480,332 *352B645404C54893F0A92A1C6F689A24C346512E YANIK BEAUDIN
520,480,333 *352D4CA891470DCB74AB6BC78FA4DE59571280B2 SU_PASSWORD
520,480,334 *35229BC60686730934A90B2662CBE613E71821BB yellowpete
520,480,335 *3521536BA127D3E40EA32F88F7ADC088CDFE80B2 SWEAR.THE
520,480,336 *352563CC588D77B27716187D598707ABCA7AEA56 YOHANES PIETER
520,480,337 *3522C288C14504256DF32B8C46E1C2D8F25B5D32 yolana.(remix)
520,480,338 *352CD0934EC8F5664B51B635A83E04DA10BF73BE YONI.FARBER
520,480,339 *352974F83B6D955133B74731AD9686BD428CE4DF yoselyn.reyes
520,480,340 *352F3FEC50923583BA6B72C2741561C4CFCA6D09 youkyoungheo
520,480,341 *352C20CF48A719494621ED88C41F40EDDA99E193 [email protected]
520,480,342 *3525B7964789C2D56E9B21CDB9CEC6AAB9902EB3 YRTSAGOSYHP8
520,480,343 *352688555E555FDAF16516FC50CD4F86CFE42BE5 [email protected]
520,480,344 *352C9C2A5366BC7E3328E4FF217C5B83CEF47282 TABLERONTS8
520,480,345 *352097FA23731AF6BF9C4CC7444F018729F02B77 YUQHIROH
520,480,346 *3529EC1FBE2445F503923FFF060AC37A3CD7816F TALDAKHIL
520,480,347 *352AA8A6BB9B81CFF7173E634A6789D17663D03A talk86131184204
520,480,348 *3521BDA5A5BB47A0713BE23E99376E047014FF47 TALKFENTORA
520,480,349 *35248D33D37B73B0B4CB94B87E46FA3877CA60BB TALKFERNANDO_POE_JR
520,480,350 *3529B6C7A4EBE0F57076E2F60B81CC0A4B8E8B8F /+z
520,480,351 *352D6272ADAE1F365C7CB4E31E0ACA53CE3F6EAD Z74896
520,480,352 *3527DD170023B77FB3D54A1A4B810B6B2FAE0310 tallinnalag
520,480,353 *3520E9A6FAC014143766885D2D0F73D5C2471AEC zakifouadzakihabib
520,480,354 *3525AF5B30FA3750FA38B300BDBCBA0E110579F0 TANNERMCANDREW
520,480,355 *352045C9DC75A6F28703B3272A1D92B7F6D86442 [email protected]
520,480,356 *3528933E5B02509D26FB79821977A4EF5ACAB707 zebras1986
520,480,357 *352BC1368E4CDD44FF051658239425EF0BDC9E0A "
520,480,358 *3525E056A33B59A568A7C532CCF27B7AC6E95220 [email protected]
520,480,359 *352C2F497F483CC835ABF11031EE8ADC57A0AD2B [email protected]
520,480,360 *3525483CC6E83A156EEC60239DC82D21C81029D9 [email protected]
520,480,361 *35247F5B21FD49D3AE28AAFC8BE97D3B25EE13F8 [email protected]
520,480,362 *352347796C7F620A324ACC6971D5EA6DBC38D7F4 ճ
520,480,363 *352648C59D54848AF5EBB4104FECDD25A34DE89A ZHAOFEIGU
520,480,364 *35297ED6150C5398F25F3C23230CF03C48AF4FDC [email protected]
520,480,365 *35265D3034106D7CE16C54DFC649DF7F26360C6C
520,480,366 *352DA9AC5EABBB2F30C718F6B21FFA6E190D129E -
520,480,367 *35269B5CEF7703DDAB14500AE39967F1D24B4CD1 )"
520,480,368 *352CE92495BDA876D98EE699A62C54F7E9AF2737 |r
520,480,369 *3528AAB1282EE5D0823297FD3DB2163F51BCB8BA h
520,480,370 *35235EC0D54E016982A79111C594B2325E63DBA9
520,480,371 *3529A2176270A6B17005966A399D795EFDE7D446
520,480,372 *35261A18D47E6F3E652D8C5CACD77E9F08268633 )
520,480,373 *352F6F770A734E1CDBD2842626AD791B799C7771
520,480,374 *3526779F9ABE40932F721B37D2B72C89A7827DAE
520,480,375 *3524CA9B34086127E49135EA93B3057D216FF4B1 2
520,480,376 *352C53B644BD269497D80863D573FCCD25FB5C62 000000casper
520,480,377 *352D9276E757DA45630F73CD1909526C45AFB802 ÞORGUNN
520,480,378 *3522A13E91990B93DC7A436B7B64E5A00693EAC4 БАЛЛИГИРИ
520,480,379 *3520EDD1541C470937BC996253B546FCB99A2EBE 0ILUVHITHERE1
520,480,380 *352BE82F87597E2BE898520FA4056C2498CAE51C 121819 UND SO AEHNLICH WAR ES JA AUCH
520,480,381 *352FC8DAF8D8031A98DB922C88C2B0EEB74D7AE2 ОТАРАШВІЛІ»
520,480,382 *3526B6AF57064A4D4AAAEA6477385ABA742195B9 ПУТЕШЕСТВИЙ»
520,480,383 *3523D1FC948859A13FF7D7496284156D04171840 15-NN
520,480,384 *352653793241F15B57596C6369246B5FD087AB12 1619159 SEUDUN-KULUTTAJAT-P
520,480,385 *3523FDBD9E6A4415252AEEC306526160AD16CC44 спринклерное
520,480,386 *35259CBD617182E89D717D7A5396C753A2DD2922 хозелтон
520,480,387 *352048CFCB0E219F60AD629AF45F4DD7B167F4FD 1 arbeitszeitgesetzentwuerfe
520,480,388 *352D0397DB6BF784F7E1E492FCE67763CCFEBBC4 1BERLIN-BORN
520,480,389 *3521E743D8CC30FE39CCE6638B35C33BE697445C 1CORNFLOU
520,480,390 *3528D2E060B7F800D9B930A91DA293E93450171F 1DISNLBSW
520,480,391 *3522F02480138B0243A852210E8ADC54A2FC4AD9 1DMSILEV
520,480,392 *3522724170F698FD82A06AD7635B90F907153433 1.dOnmelidirler
520,480,393 *35251F5703C8030ACC8A0898EF56CB502FCA1E7A 1eindmuendung
520,480,394 *352153CDAAA3652E86CF878F4D9A876C0CC53528 1FLAVON
520,480,395 *352CAD421083B34C90AF1437E153F3C2F4D38721 1.friedrichshain
520,480,396 *3527C2F3C46B43AB42AFDFAED341DFD318784026 1-GEISTESODER
520,480,397 *352B09EB364FBC26B5810DB587D4029E01252ABD 1 GRIGONIS
520,480,398 *352E81EA453B7D80C7654A20CAFE580C9F57D997 1mygreta2
520,480,399 *35248A20D9550BA204ADAC56934B27BC37AB1C80 1.OXYTETRACYCLINI
520,480,400 *352293FA3B1DEF8F69E8D9A58DE994877E08C86C 1PARVANO
520,480,401 *352ED927E93C4FD1CD02FB720D6CFAFA859D596E 1-post-rams
520,480,402 *352F20A8D64207AA69D932E0E55F2B7189893035 1 sattirmak
520,480,403 *352F95B8E8687C10F1F2AD4595FB8A0C4E618EF4 1.tiskivetens
520,480,404 *35272AAC2574A536EC2C3820E47A19139D148FBF 1.TORUSVERKOSTOON
520,480,405 *352035ED36C21BB03576B7778BA281E3E31885A2 1-transfer-it
520,480,406 *352B3611E37DD0752193E56B3029D3F30B094140 1-vastausvaihtoehtoon
520,480,407 *352D3273CD12D60F6329C2E458F4279D43AF0B58 1.VET
520,480,408 *3520D93D692BC7A0AC627BBB524CAD8C40B44B41 1-WECHSELKARROSSERIE
520,480,409 *35268569458F895DFCBB8EA38D2572789FEC4967 1 WEICHWAEHRUNGS-LAENDER
520,480,410 *352C0E34A331A01619BB0F320762C6A1A384FEB5 2275695 vaikka keli oli hyv
520,480,411 *3527E853EF8948535B7A0132AF78F4E9C1119666 2281131 "thedollarwasgettingstrongerallday.
520,480,412 *352CD5B2E859C3893B2B068417DBD4FEA142497A 22naphthaleneacetic
520,480,413 *3522F451B4B88A0F6421D09707F5252060903F49 2664815 JUURELLA.ON.(.MAHDOLLISESTI.).LAPSIELEMENTTEJ
520,480,414 *3527D4B1B23B64FADE7D59C7CD69EBB7855BB253 2801237 saunaosastommeonerinomainenrentoutumiseensek
520,480,415 *35212C0660DB09DECAF192A9A17F453B4A8330AE 2 ALTKLEIDUNG
520,480,416 *35272D10CF386E9805E81E12D6A90B7FFE8430B8 {2GBAA
520,480,417 *352BC542F3B11C79A951FF626A0DA418DB8F667C 2IAMSINGER7
520,480,418 *352B1BE7DFFC50FC1FB4E454515E6D12526DF4E9 2 IGLU-TEST
520,480,419 *352EE7BA9ABD299F31DE01763424F2D3013BDE93 2.KIRJOITINLIIT
520,480,420 *352D91751DD96ECF7999779AFC1982D942852A0B 2-SCHWIMMWELT
520,480,421 *352B313DDF1D687A55358D96B537C3B8F490BF22 2stammgelaende
520,480,422 *352AEE58B15FFE5A3F8F29C2A8A2E9E0AE62C339 (>-<)-~`-~`[email protected]===3
520,480,423 *352F977BF6F7E0DCEEE8A8A40AED044EAE712E47 30°23′17″n
520,480,424 *352AF0370589AD47439B6DA26C3FC79E75AA7F57 360017 "-THE-EULOGY-WAS-PREMATURE-.-"
520,480,425 *352ED30E59FE852F668650092E17FC191359F931 3 EHE
520,480,426 *352F29A8E9A130F99AF3EA4CEAB7EBEA3F6D0176 3.gassige
520,480,427 *3520F7486758EFB2864795E622126E218C7C6C11 3MNDRVRDS
520,480,428 *35209CF03A3FD84FFF826E4004FEBD700B53DDD4 3=p * * uu
520,480,429 *352A59C0C8223450C143259637F422304A131F6E 3.YRJ
520,480,430 *352891723D3301C35CB1E71EE6B1B5D191C19D67 4DAVERDIES
520,480,431 *352A638B9C90B894478A6589E51038E12E2F684C 4emlopputurnaus
520,480,432 *352D04668F6F61233E2C5CC07F16BE5036325631 4KSBLAZEN
520,480,433 *352B073E8C3DC4AFE741C2AB68FD019624B802DD 4L!9H+3D
520,480,434 *35218D8D4D887F6B30081EDE0A2D4A7166054105 $4LL0WNE$$
520,480,435 *352626470E627B15802F87D034933F14B4CA18F9 4NOLLUPIN
520,480,436 *3522B4AB2B057F6899ADCF45706FD7BFF4369FE1 (>_0)*<======8
520,480,437 *352AF2AF9997E935BECFDF1A4C8AC975F25AC0A7 4PERSAIVE
520,480,438 *352390C8615BA188EE9B9131308DC22870D50A11 4PIRATELOUISE
520,480,439 *352B75A16BE46B86ECDCD318279DA62B2DD5E62B 0ILUVBEATRICE9
520,480,440 *352B4A264B792F4DC7A2941552D7783717DD334F 4UCCIDAS
520,480,441 *35254B52B8972393AF8D6187E6DC85E890D36BB3 542531 PERUSKONEESSA.ON.OLEMASSA.AINAKIN.N
520,480,442 *3529E994600613F707C4B62DD726E95CCD1F998A 567462 i-like-guys'-names--"
520,480,443 *3527C57E1B09A3401C1832B6F45F28D9BD911FE4 572maximus
520,480,444 *35264BBEC86900379388AC70B36D7836689E25B4 5DNAALSROOD
520,480,445 *352F2385AE21C055A2495F4EEE965D1294F060A3 11/14/95.AT.A15;.<U>USA.TODAY</U>,.11/17/95.AT.4A.
520,480,446 *352BE8419EE5C56FEA20500FC2F86BB1EE9D0588 11slavka
520,480,447 *352CC44C10995B9021D6DF4B427A90F98819B501 12:-12---#---&---EIGHTY
520,480,448 *35294869F4349DD31799D711E495659680815BC5 123456GOD
520,480,449 *3526B86A3EDD3AFFA34073BA5124ABB98A5D2C81 1402109 ER SAUGT AUFMERKSAMKEIT AUF , MIT KRAFT
520,480,450 *35261B0834B35DBE9C3D2AA8FD72046782AF211E 1505796 ASIAKAS-VOI-LIS
520,480,451 *352BA534F359538219365E84338EE5E1FA6BC3A9 5+RA!GH+ER
520,480,452 *352D32309DF8BC77A58CD2C73BA4A248B7877029 15-BABELS
520,480,453 *352107620AD792A1F883270058E058E5B196F153 5SIASSITA
520,480,454 *3520E6058EE16E9BA7298A507B1351F31C9475E1 5.uhrautuvat
520,480,455 *352411DD98B9F7110731EED58F34150C14D3B586 650152 ali dagtas v .
520,480,456 *3526F28311EBB0914E14C43961CE0120FED973C5 666911link
520,480,457 *352225880A5CDFF0D5CB74D7862062801756CEC0 6BANKFRANKENM
520,480,458 *352BCD19F05223E1F02E3B2E83CAAEA519AFEF2B 6BSWINPLAYINGBSW
520,480,459 *352AA544E05FD4EA25B65E0DF4D3E463B38FD61A 17111345
520,480,460 *352C2397A327C44BAE908DE03200AD181C390555 1805149 ermagdiesprache,diekultur,dielebensart
520,480,461 *352341CFB4A72F3430B4A41B5849F91ED58FA1E7 6ELBHTBSW
520,480,462 *352C0390F64F68B21DB073134E5300665E9F4EE3 18jorge
520,480,463 *352A83B64138F75DFF9C21EA95A1876FFDE8C10B 6IAMTHERE
520,480,464 *352DF1848FC50640D8E05F966A0F7BA6A3440C0D 1919102 RAKENNUS.TAI.KORJAUST
520,480,465 *3526629FAAD6DAFE755EC8A316EE9FDB163E16DD 194681 olisiko-sinulla-hyv
520,480,466 *35261878FD8B9354246C79F01B09AA94E709F45B 1992457 nationalelfbeendenzuwollen.
520,480,467 *352848C0F7DB84D0854F18668EF95217AB9DFE40 6MANDOLINENE
520,480,468 *352CE2853432D1CF8CBB6F06A2FB3B4C63C6D77E 6meister7
520,480,469 *35245AC8E6E5D5FAA7277E296BE0474A0529E955 6mymortimer
520,480,470 *352FBC259DDD8F214E52B1FCB15D2CA141FB2F36 6REECRECX
520,480,471 *352B713DEB3ACE34A671C007400F7A77C7D378E6 6ROYCAMPING
520,480,472 *35292038A3416686AD66222A714AC7CCF7C5D215 1-ATK-NERONA
520,480,473 *352CDCEE25AD4ACD130FB4816F8D50973CF4939E 1.auentypischen
520,480,474 *3525ACF5385873A014A98350E48CF5E646A475D0 1baste123
520,480,475 *35288E5386FB96ADDEEA7856C9B69F2E71297936 1dint
520,480,476 *352BB4B27C8D510BACEB4106022D88DB65C69CEC 756FREDERICK
520,480,477 *352FEDD47B47A5B60020877CA8446755768C9B8C 77.OPETUSMINISTERI
520,480,478 *35224152BB7D543F55450F9EF399FBA67C7CFB4E 7.BEHINDERTENTAG
520,480,479 *35201C46962AF70E87E3D9D75889206ADA90F53A 1gwynant
520,480,480 *35289317E43E62046830676B58BA89BA089DDCD8 7CM連装高角砲4基へと変更し、さらに65口径8CM連装高角砲6基と機銃多数を装備する。同型艦4隻。
520,480,481 *352C6C3AC08BF5E54431505A3399FCAECD0A01DE 1jaime0
520,480,482 *3528EA2FEA3128ACEBBBD14C7B42EFED8E9979B6 1 kaniyorsa
520,480,483 *352C5322A92AA159C1F7A3F8D7ACC9849B44475A 1KOCSI
520,480,484 *35214FECE2AED87A1DAED2159172CE734B3E2FB5 7KITTY9
520,480,485 *35286E1AC4B4D312AD814BFD1906F86B65A2A8E4 1-MUHOSLAISISTA
520,480,486 *35270B15B2DB723ACA8DA93BDA5C1135C63ADD5B 7LUCHTSTR
520,480,487 *3523F9658E2BC1E1A8FA5826F925CAD818715C41 1NCONTE$T4B1L1T1E$
520,480,488 *35282A4A4ED583F55B43B5B77D62F57B7959A371 7NONNENSLUIER
520,480,489 *352A05E7B3858F4BFFA7CA63B7ABCBAAB4BD5581 7PRINCESSALEX
520,480,490 *35226EA7F185AD11DA7A1FF3E9A7F7FE5EE01BD7 1PALAEOFAUNA
520,480,491 *3529C2AA700179A78EE87A60B42645B2BEFEDD54 7ZUIGPIJPEN
520,480,492 *352904A3F2923EC164E485B155A21664720BE0E7 1.STRANDTAXI
520,480,493 *352A73746CE45756B47D2CB17AF3B2AC7FBBE187 888ppp
520,480,494 *35285115AC486AB872B61838141C2C13A4F70212 1-tsarine
520,480,495 *352D4F5BF01928CC4836CF0A6E2D91836061EAEB 1-TUOT-TEIDEN
520,480,496 *3521618C60066DAB874F8C598E727E9D4C1F9CFD 1 TUULIOLOILTAAN
520,480,497 *352233B3B464B47BDF128F3234A9D1E309A0028F 1.unsam
520,480,498 *352A84BCADB6254A003912F0F9B8D171E65485BE 1varmentuminen
520,480,499 *35263D4196FA07B3619ED6DD92910BAC2A75EA49 1 ve
520,480,500 *3520F6CD7A99D9C9E49DA050913AAEC20FDBC206 1XNKBBSW
520,480,501 *3520E357C99889640C1BB387494B1CEA865ACC80 2005315 VALAISIMIA VOIDAAN ASENTAA MY
520,480,502 *352A9EC182FA99615C9BDCF26C5972A4D4050924 2011GOTOA
520,480,503 *352C798DDD1206EFEE831D1D3B39DA0BBE3F6A75 8-KASIGIN
520,480,504 *352E92D075E32CAD13F33D80A55714B412360138 2132607 viimekev
520,480,505 *3526132D4A3C7DE041DD84C0A5A75B495304A9E3 8MARBLESH
520,480,506 *352A5A98CEFB81E87A7342DD6C1A3EC97DB9E14F 2303645 SYMBOLICILLA-DEATH-ALKOI-TOISTAA-ITSE
520,480,507 *352269DA61C303EF477BD102E79319853438606C 8PRAATALLEN
520,480,508 *35218E4A1051D6C64BC3C244577C23436575B914 8SEJTLEPPIT
520,480,509 *35265CDF35AC6F1EFC32CF4D10AE6BE18359EB43 8======>~.~.SPLAT!
520,480,510 *3527AE7342833D7228F50A9D686889F10C9FBA65 2879264 MUILLE-TAHOILLE-SOPIMUKSEN-MUKAAN-.
520,480,511 *352C32478201E5F7F2F7F68C03BFD804887FD75C 28dec1186
520,480,512 *352EFBC82AAE055B16FF61E21DF580ADF5169987 9DARAJULU
520,480,513 *35246411FA3A82ACD4AB6E88F5DE451110EF66D4 2KANATLILARDA
520,480,514 *352814F55489B2DDA6E032ED70C6D8C89E2B83D1 2koleerisena
520,480,515 *35213E07B1EFB7EF9956C46A5321E6B60C36C549 9ESAMINASSIMO
520,480,516 *35277BBA4690CD413E5C2BB69D8A6AE6903C7858 2-nuorisoliittoon
520,480,517 *3529EC677D210196B16E4DB7B23286494182AF06 9MISTIMET
520,480,518 *3520D2B5682E0E63E6F5BC96C5552DAFB93308E9 2.tavoitettavaksi
520,480,519 *352EC8E71A9E0F574AAAC3653B345B84D077D068 9RINFORZANO
520,480,520 *352113AC7B1DEB36F453F21B42318878EE01E116 9TOPOLOGICK
520,480,521 *35215CE27144DB2424377160D0815C69066905BA 9TOTALITARERE
520,480,522 *3521630082DEF13BFC217050B5764F9939A52567 9WANKLANKENS
520,480,523 *3521250CFA4EF029733B51B78DB80150C216855F 9WIZARDCOBRA
520,480,524 *3525C3FB3E6D727377B2E5BC8ABD413A16D68A60 a!)..
520,480,525 *352E600B17D652AB21AD3279D8BC50F6CA867DFF a#:1q
520,480,526 *3520FCA5D7B75ADF640B6D2234E29F420AE90C64 3BVG-BESCHLUSS
520,480,527 *352CC83664AD641FE68412E511D64EEF4F0FA6F8 AAA`!B
520,480,528 *3521611C498A4072E449689AD37332032243D0BF aab,n3
520,480,529 *352FCACB27485E0E393423CE95261239952B9F91 aaimonot4
520,480,530 *352241C9412C948BF41E011036E640B92B5F3609 aaswta
520,480,531 *352A6B381D815C2595BEF089275CA2B575A73EFE 3SELBARAP
520,480,532 *35281F9C6496744ADBA75C08CE7CB218C742B231 3.sikil
520,480,533 *3528929ACE97BDAA5280778CE5FF5404FF25AAD2 AB{\1
520,480,534 *3524C2C4A2C92A85C91403391F005422D8E31E43 3-VIRTAVIIVAISTEN
520,480,535 *3524E7FE4F9848AEC2C0DC66DEBB16AA70699FD5 abattonses0
520,480,536 *352FF99FE1DCE33195CAE98DA7E366F87CA6CF31 3YOY
520,480,537 *35239CED4653757814DE35398FE0B085160434F2 a$bbt
520,480,538 *35270A6A2586169DFDEA4C94EF92BD1B2AA160D5 463335 ankara-:-pegem-yayInI-,-1993-.-(-17-)-kabadayI-,-reSide-.
520,480,539 *352A22C62CFD47B8B4B78C83D83A29CEA9C8930E 4AHSINOME
520,480,540 *35266DC6ACF89A14494C8914291AA903ED27F887 Ab+S
520,480,541 *352ED623156B03E54A78FC7F158D0C22616CF4DE ABXO0
520,480,542 *352CC8A2BC9D57F407A7A2C0EC293A29DAC45F8B 4DRUNHAPPY
520,480,543 *352AF8C42554E674B27647464CA05B5E8CAAE0B1 4EKATIKAW
520,480,544 *3524457F187ECC0B2A82BFB7ED3CDF04A6262561 4ENESLELA
520,480,545 *35279958EE4CDA821E561D1AF30F805EC2C8BD60 A#C5H
520,480,546 *3526B4852D9C9A7CD4B54A248191B1B7F3E051E0 4 ILTAHIIHDOT
520,480,547 *3523835C846D33D294477270A0115619A5E5234B ack'p
520,480,548 *352A99A23A85F76A3D7BFCFA9B713356AB3F572E 4LUGLOI4M
520,480,549 *35283645D5B158D17637AF23E09752DCFDCF4478 4MIDNIGHTLAURIE
520,480,550 *35292D045DB5E648E9CE5D1137EC7B15699ECDF8 actviisceneipropheticprayerandblessing
520,480,551 *352FAD3122C98C5F239E30E8EB90D6A8C6F6CB2D adriano(m.mayerremix)
520,480,552 *352E1E2947733020119B33A98C71E0690F5F6712 aeb9z
520,480,553 *35265CC174E939AEDB212E38F3FA2967F007649C AEROSAG
520,480,554 *3528792E4B655070859C1ACD46A965139426AB54 534WARREN
520,480,555 *352B355949130DD9619AA8966926DDA53AE2AA25 afuica
520,480,556 *352475DCD9099B237982B5B44960CCC57A291C25 5BSWNEETFIFBSW
520,480,557 *3527E14CA11B5CD931F249723605064F192E90D9 ag_q-
520,480,558 *352F6058AEF316E4C77651971D19A6E047DEF8FF AGUSTINLITCHARD
520,480,559 *3527353C9559CF73C5284E6F913973A5FC47335A agustinseard
520,480,560 *35203A6FB0BA9853B769CD55B58F041974A14FC0 5DESDEEBSW
520,480,561 *3520B7A62C8018131401A371C944C810C9220AF4 5EKORDENE
520,480,562 *3525B261B375B2CEBF1ADE998F0E0D430CC1C7DF 5en5at1ona11y
520,480,563 *352FBCC0C1EB04F54C93E2A41BC0FE5F83030874 5FERRARIFUN
520,480,564 *35243B331CC6651446B07B9BF7EF7217349E4CF5 aiit.
520,480,565 *352322104769262BF68FF713CC7060F742615EB7 5-marjatat
520,480,566 *3526A49E1693A44B94E6AB766D8439A2F318A780 akdu&
520,480,567 *3522616E464066CEA88CEF35EB9234082F782CA1 5PLGHJGGR
520,480,568 *352C341269E1584A461D7E3A71C5F8B23AB08CA8 ALEI.BBS
520,480,569 *3528DA4EB9E55B939176333B41784272E8461355 ALENFALK
520,480,570 *352EA1B7B12CB090EF00E8E284D38F17A67A59DE ALEXANDERPOINT
520,480,571 *35284ECB670BC1B2B3848EE83D1265EA128AB1EF ALFONZO.SPEAD
520,480,572 *3523DAFC2A58123D9B46D0B89BECF7945A6E969B 5THATREPUBLIC4
520,480,573 *352BB535CC0FAFBEE539BCC7850624177DACA787 ALIGNRIGHTGT570
520,480,574 *3529B4A2E0353D8AF6792A08FD1C9474F2381971 ALIQULU
520,480,575 *3522D78E094E5C4D77877DBFDAE6FA119920F20A alonzo.west
520,480,576 *35297EEDD267E8C9E763C2DFC52E7FD57FD4BEBA ALPHONSOOVSANIK
520,480,577 *352467F90F5CE9B4293F6D6F2D4FDA7B74580AF1 6berlin-hannover
520,480,578 *352BBBDA40809F40328963C0D3D2752159CDBF02 ALUSRU.63
520,480,579 *3528B96E279761B7D7E29EF798EAB5F6F5B2A572 AMBD3XT3RTY
520,480,580 *352AEB1F39D0B74B14BFCBBC38BF525B1F38FEFC 6ECTIGRRYZZZAWM
520,480,581 *3526C4B6EE094FDEBD7F0D1395765C3DF2115E82 6ETOLROD
520,480,582 *352BD143C4662DE4547168651048CCEA21CE6F19 6FISHINGSNOWBAL
520,480,583 *3526BC8A74ED677136F6949DCA956A7824B6BCB1 6.GRILLPLATTE
520,480,584 *35264CA4536633F68D2A11D8E31F101DFBB6BAB1 6IAMRAMBO3
520,480,585 *352C4463C0DBF5A85FB835C19F177B808059498E andybfing
520,480,586 *3525563B8871B68A996CB09665BDF56EA1B459CB ANIAMIASEK
520,480,587 *35232EA7452E1CE9C170E456946DE70EE6A9EDC0 ANTIONE.MILIONIS
520,480,588 *352244D8F3719C06736D0FC2BD21661C92C12876 6thedonkey7
520,480,589 *35279CC4C251B3716DC64739B273AA37822E7AEE 6UARBEJDE
520,480,590 *352CB98E73F8A116D1CA4E71CDD84A192F6FE188 6V13JPDSU
520,480,591 *3529BC925962DCD074D4CE65D4EAC9E4FC86E529 antonialuckie
520,480,592 *352CFB3D69591D9210B8F3A9E1B5E4C8404A4C74 726233 neue vorschlaege der usa washington , 13 mai ( ap )
520,480,593 *352291F022CE285BC7B117833767DBC94BC3045E ANTWANFIEDOROWICZ
520,480,594 *352DD18057A21D2E49B3783A77092A2F1AFF1D23 742396 telefax : ( 216 ) 394 18 29 kampana deri san
520,480,595 *352AC732A799357CE728E0007B2D690DFDBCC074 AOC
520,480,596 *3521E5DFBD443739BBC932C605E5A11613596AEC apb=a
520,480,597 *3524FE54A714FBA4396F7F1E2CC3A6BEAC179A9B 7DWIGHTHAMMER
520,480,598 *35295D0370FE9A9DBBFF79292D2B4D47696A9E22 7IAMWIZARD7
520,480,599 *3527895607CF9F45FA263E3E4D50CCFB8847AD1D aqvc)
520,480,600 *35211C78F7CABE2FE7DF15FDEDD5D79D684BFA1D 7KZPCMLFXG5OOND
520,480,601 *352F60556A13F7651243A094B1CA5C896FE68474 7LETTRISM
520,480,602 *3527E4E0142CB21CE52F1BCFDF3C6A64CE6A9BB4 ARABBERBERAFRICAN
520,480,603 *352D4F120F99A1DF806271AF5402B62D42A87580 7myfisher9
520,480,604 *3524528DE45EC509F4B2091FE6F91F39B36D8443 arnulfoleonaggeo
520,480,605 *352984AE43B71337EC7AE99E590754B88F0C77E8 AROUND.AGAIN
520,480,606 *352888E7DB10E4EA21467CBE5DBE40CEA5C61F6B 7SCEOWYRHTON
520,480,607 *352C9F5A2AEC7948DE0D412D5ABAB327EF6BF804 7SMERDAI
520,480,608 *352CC20DD3CB7ED811B0B2111D0691DBE0B3CB92 articlegprince007
520,480,609 *35267BC2308C45074FD0AEC33892B4126E00F1BB ASMARR
520,480,610 *352296B303F731E9908EC128DFF99903291FA53C ASRAEL
520,480,611 *3527033BA42A37CC1451B00D179094D54E6991B4 ATTRACTION.COMWWW
520,480,612 *3521991A05532E87CBE288CFE639DF57BC8FC28E [email protected]
520,480,613 *352F028B8CAA1C1194ACFE85943F67DBFBAA8622 aud10m37r157
520,480,614 *352D5AF2D3E9340E9496C65A4AA606D7995DD4EA augustineantoniotti
520,480,615 *352798AD0D05A06E69F1141DFB8EC51561B869BC AUGUSTUSHANDELAND
520,480,616 *3524DC85291373CE2D14207D52F4C13821106D05 AUGUSTUS.SAUL
520,480,617 *352A1E2D2818239B99C86D3F5310C60B2CAD5E12 AULACOCARPA
520,480,618 *352BF54635C3BE5C36B4DC2C4F6CB1F91B4B3F6F 886ASHLEIGH
520,480,619 *3525045355CC913214DB26D357F3F94C242D07A1 AV?HT
520,480,620 *3527C85AB1806A1AC5078419D89624F8F94008C3 8-b.~.~.}x{
520,480,621 *352E92CE2FFF7F6E01D11A36D86EA7B23BBF4C77 aw9=
520,480,622 *352C5938FF2AC3E457175A34BF447CECD5C51A26 awhbq
520,480,623 *352C437215274CCA6E6AA87A12E23606F20EE427 aw(py
520,480,624 *352B8B996E7057A726DDAA1175FBFD3BB2E92E6C 8ilovenancy8
520,480,625 *3526A0FBC5B00A754877E86B88CE53D08457066B 8LABYRINTHOPHOMA
520,480,626 *3522D51ED2A65EF9ED62330D18141D89C99F5C54 8LSESFULL
520,480,627 *35266ACA19C6E0A659487319D8E8E3113B2A4C16 B0O=B
520,480,628 *352344B7D5C1D7AC47B74D0F894FC521120D20B4 8NTHRLMNT
520,480,629 *352413900952E0B11FE8A96B4C54FE5A4F926651 [email protected]~}o{
520,480,630 *352E0AA84FEAFE32897BC481C610BB6F29FC17DD b9fqv
520,480,631 *35246E0743F38AB944B5501F0A12F3520594AB71 95-HENKIL
520,480,632 *35226D491CF0C4665670A08D92A7A10515FA390A 9CYRANOHELEN
520,480,633 *352A5FDE6524872FB5F7992B445DD6EBB703A580 9ESASPERARONO
520,480,634 *352DEA9998CEC4EF78BCEF136CD51291C3E4B542 9GEVETTE
520,480,635 *35221CD4051949122C3AF18C138EFAAAC0B1A65D 9SASHACHOCOLAT
520,480,636 *352F2B8EC88CBFEDF52523D8755AEF2599ECC9A4 9SEZINOISRUCXE
520,480,637 *352C52A54A4F2A86420B789DF89941CE4F006CA6 benedictwinkel
520,480,638 *352EFA9E11E58E40D0CFB9A133D29E8CBDAA011A a0dtc
520,480,639 *3525AA41A0EFD202C7F620E40A996819C8B93733 A1#3V
520,480,640 *3523376952A0812D105345707E6F9C175DDAE9BA besoil?
520,480,641 *352E0EB4ACBABC2BE02FC68D88B259D3CFD28E0C a7lnb
520,480,642 *352BEDED0F101DBD827D2BCB1E006DBE1CB28FF7 biim?
520,480,643 *3522696382B61C15C7B5D7233050A67A368DD8A9 binsk
520,480,644 *352399D847CBB4232BDC6E4838897ADC48C78180 ab3+t
520,480,645 *352845350804973D9E1AE7CAACCFA59CB4990A96 ababa
520,480,646 *352669B77A4AE48EC2C906E178468CF35E989EB5 BmH-
520,480,647 *3525F6C38D558723F72EFE4976DBC0835AB5EC10 BM/PV
520,480,648 *352070011CFB36406A895C5B924D2FB2FAC163BA bm<u
520,480,649 *35215C33C7E8A7BA44C827E487AFF26EE0423105 bn"ko
520,480,650 *3523F2595C3B8F6759223E17DB786F1026257088 ABRAHAM.BARKES
520,480,651 *352D702DA47592C6AED72AE2F67D4DA0EF8E4696 BOB.CALCARA
520,480,652 *352F368FB1E931BF2E94B6A2FBBCE153797EF2FF ABSTOSSES5
520,480,653 *35241898F85A3DEC3C293171477CCABF7C649A47 ACF6Y
520,480,654 *3523750C357D5DA811972B40DF84678FAE5207F7 bradfordcrisp
520,480,655 *352411E32D364E72A1A156181B0ABCB8C203F962 advancedfinance.co.ukwww
520,480,656 *3522C6AB50F76666F7487C019BEC8DF358C25E7B ADZONE1
520,480,657 *352468514A26F5F52A2F711E610B767CF2406E62 AEDQD
520,480,658 *352F7C5C3551354386CA8A2EF9107F3E433D55CB BRENDONCHANEZ
520,480,659 *3527DA0ED370A6B3EF03425DFB1E92DA80E5AEDD brianreyers
520,480,660 *35212FE0FA8331BB4339E52BA03DFF43E74809F5 AFROTID
520,480,661 *3527E82C0434F6C2DA8E1E290523614D53879226 agus-sopiyan
520,480,662 *352B5739793EE0E6C79E8ABFE4A7B24D3664B75B agustindobrich
520,480,663 *352CF61690FE1C3CB98D62EB6991440983FD1AA3 [email protected]
520,480,664 *3521C9A69BB2469AA89D527802689AC4383C17B0 AH0E
520,480,665 *35201E8AF44C85EB86B9E316412CE15B80E630C5 AHLF6
520,480,666 *352E4FF8B6C40AD3599F0E4DEE86D972C6B55159 BSAFB
520,480,667 *352192715E973A79F99AEE1C63E859D32FA0AF57 bswpolltaker
520,480,668 *35244435830BF2D176A9605E564627C59D23E05A AKACIJAMA1
520,480,669 *352FD10113EE535DE7A004C5F73B252AA39F4A95 BUMPO1OGY
520,480,670 *352CDCE9ED739CFCFB0BB9871BDB11C3F7E552C2 [email protected]
520,480,671 *352C9E246C419EE584AC4D782AC250CD0C904A0E BVZI+
520,480,672 *352BE33C6E5D45129BD90C4D6598126556E95175 bwo;g
520,480,673 *35262B7E1FD31A4A398A5F434369A7D4BA75B553 B#Z0R
520,480,674 *3528F9CD7271E81100C49167AAE34BBE6172214B alknetka7
520,480,675 *352E9DA816E8E484EDD06BED3E3A4374D206A98B almond.N:.almonds
520,480,676 *3522E4B1A6CB778641CFD51860733C6918239902 al&q?
520,480,677 *352BA433209450F53CFA25C4B36DF664835225AF AMADOHEVERLEY
520,480,678 *352BD12091A134C5ADEE189C67FA89BF0415A9AE C4R07D4L
520,480,679 *3523FEE57112337BDB9F14D84E4767132DA35976 AMERIMEX0
520,480,680 *35225E3ACA8FA9ABC3A079B80AED6D8572C812DC c80ql
520,480,681 *35299BCD4057D399F9F72C86F809C0FE5A86BC9B ANDI.CHRISTIAN
520,480,682 *352AED800280C8F6625915608777175B124215E8 CAMERON.WALLEN
520,480,683 *3528D70BB548338F84DD9C75FA2421E370EA504D cardinalqwerty
520,480,684 *352433D18082B8D0AB5BE6CEBBB9135721113970 ANNUTLOK
520,480,685 *352FE046EDF55C8EBF049E93F8865F54138A791C CARROLL10JAN10
520,480,686 *352FA398C97CFC25D54968409A51E6AA9098A5E7 caucusas9
520,480,687 *352946544EB88F823B2815F36039A27E1BA804ED are.you.mental?
520,480,688 *35280E1D7F318A1F039DA536954C39EE91785855 CEDRICKSERIANNI
520,480,689 *35200469A3248BF3C568422F19994BFD9D43E180 C$EE
520,480,690 *352DF03A5AF632B51011A3A21E698BB64328E358 ARRAISONNAIENT2
520,480,691 *352BFB1B7B629C5FD73702A3503B2D844A526F4B ARVERKF
520,480,692 *352BDC8AE3BCB42AE3E171C524A9A7426DB609E2 asokroy
520,480,693 *352BA7655A52A0A709D7501D63CF33563C4FF6C5 Au4%
520,480,694 *352E770AA9A3EA222B385B5B7233907D45A52C35 a-ul
520,480,695 *352464F442BA7839B98CBC8C232A417141A3FF19 CHELSEASPIRIT
520,480,696 *3523C247011B2F97E5AD6B98F30E55C0309C1D77 AVERY.PORRAZZO
520,480,697 *3525A5EC79561EA80CC5C16CD2DB1D11264F8D65 chiuddia
520,480,698 *3526B8E80A6F04856B3155995BB82E2A405889B5 CHRISIE-ROGERS
520,480,699 *352B3A978A9C5016E2E61BEC1147B829D25EBBBB christianchino
520,480,700 *35291E280E25C72FBD8F7D8D3E595FAC7337A680 churchbased
520,480,701 *352C2D0E1D88E271D3CBCC5B2595596D2E8A4E39 b8qeo
520,480,702 *3529CB5C5C9813BC40FAA6B1796CC98EC9FD7E10 BAGERIET7
520,480,703 *35273604FB129CE7C4C7F3F2002218ED217DA666 BARCALDE3
520,480,704 *352211028E01D9CD08D242E9D6C8B4017C07896A CLYDERORABACHER
520,480,705 *352A0C241D02914E819E2D706D8F754EE6D378B8 CM7QO
520,480,706 *352E8787A0E9A4688EAD58C5436A6D3E66AE1EF2 bba7d
520,480,707 *352F011B673FDB0C307A6A8E1AD4F7B7AEB03C66 BDCBC
520,480,708 *352024E03B51341D436DF4F0FAFD6181E7A6A111 beefed up
520,480,709 *3527236E101323E8AD2C35F6360F7B64F7C855E0 benniekoegel
520,480,710 *3524B4316F79F9CA25C55D3124193F0FEFAC8F2D bergeman5
520,480,711 *3525E8AEBEC70EC9BF7007BACFB35DE40838BD10 BERSEEM0
520,480,712 *3529A575D929BA756C1F49A61D83310011C93ADF BFAIRWAY2
520,480,713 *352C67D8DAE4D01185BF2BBAA757FE7167FC1100 Bf&P
520,480,714 *35275F69440BCA9D207BC5FD269A7A52484BDEE1 BGQ2?
520,480,715 *352BA43DBD3CA69FBF318835EDDD54F6E6C097F4 csulavax0
520,480,716 *3523000F2BF1EA96E58361B8E9564081120D62C9 [email protected]
520,480,717 *3529CB991015322F098B4D16EBEE97278C385D3D CURTIS.YOSHINO
520,480,718 *35248E8DD52E2469614165CE89E83D482F95E7CB b/?k0
520,480,719 *3527093B61808863F195D42F4DBDD6AFEF28C5EB CUUK2
520,480,720 *3524896AD6AEA073CFBD71ECC5C628DDCC17E5E8 B!LEQ
520,480,721 *35267DD6787F970806ECBA46F6476D2C102B1215 bl"-o
520,480,722 *352A500336A923547028874ECA0E7D6B3B1B631F D1$3P
520,480,723 *35250DBE84ABE936BE7C219032B0283AE94D63F6 D3MT3
520,480,724 *352B64FA94507C0FC053DBA52B3CECF5D8CCBF16 d5h;
520,480,725 *352408FA113CCC751C5B5AF38138D1DBBF5B5924 D7R6$
520,480,726 *352B3E7601D78AD5AA5AB0F2D82866FD7C1485CB BOOKERFARRARE
520,480,727 *352F5E8BE5504F29463972300BB08400E0329F16 d!a9ram!n9
520,480,728 *352DA4ABE0AAC77422A74C548FA82BDE89DBB8D0 b/owh
520,480,729 *35285A2342C1821CEB5382B096DD20E005E370B9 BP/G
520,480,730 *3528244DBFF28957C7FFEFF74C7C9C3E29476D6B BR7N0
520,480,731 *352C0B12343EDF9DF84E8A9E6905FCB3B82365C2 DARONBARTEE
520,480,732 *3528EF78AD8BF39AD69B7B993BF55512D2F20B94 bradzolla
520,480,733 *3526F97C29C43B38B70312C98D87C8C4F73CFCCA DARRICK.DEMENDONCA
520,480,734 *352776939AF1AEDF739A1FD9B60804AD1E5AFF11 DATABASEROOSTER
520,480,735 *3523476AB6B33578B1DE164D5004B8F5DEE6FBB0 DAYANARA757
520,480,736 *3522254C5A491A325C00C3CB0BD8B1CA92A8F5F2 ddw6f
520,480,737 *3525979D944405C0F5046EF03BAFF4CBF9C21E47 deadwind
520,480,738 *352B940F3637DCA52835714C43963D079E4F56C6 DEE.KLINGELHOEFER
520,480,739 *352BCEE5C4EB504966C58810CEEE7B19CAC78C3C bsboe
520,480,740 *352343D6830B92AA41E72BDF5168BECCE2D71FCD DEL.MESLER
520,480,741 *3525F06FDF86B894C1CD105A9AB4CD63BCBD8B30 DEM0CRAC1E
520,480,742 *352721534E0089D881CC4450E8AB2BF4AA1B47D8 DENISCERVERIZZO
520,480,743 *352677400E49CC1EB915A1BD63A13D45E240644E DENOMINACIONDEORIGENTERRAALTA
520,480,744 *3525202EDEEAF71C8919D09713869C4314E75566 DEQUAVIOUSC
520,480,745 *352F468ED8A55B3C759D3D303FBAEFC6C793FDFF DERRICKMILEY
520,480,746 *3522A4234623D9A65E691821C9E4255585080F91 B!U&D
520,480,747 *3525FE9F0B9284FF21DBF500B79C8CC1F429FDA8 df8/g
520,480,748 *35286E6F62FD5233259E7CFF9646B0C99035C0C0 dfs1h
520,480,749 *3526F3F73702D4248F47605A0D82338D2087FFAA D=GNS
520,480,750 *352933D539452E6E4308726C1FF0B57E76E6D79F by)lr
520,480,751 *352F603871E2119803AB4153AD80FD19ADD7A403 c0mp478173$
520,480,752 *35290CA998867AC3483EB840BC398A041FCFF719 D,#O
520,480,753 *3527F9FC4D0E1ED3C946BA7AC4AC0DF3ED867B08 cagrnorg
520,480,754 *3529343FD3878B2A65FE8FA3E86E58F950F1DE84 DOM06
520,480,755 *35240A66EB66A6C59368EF052FCD5114582F673C [email protected]inetcom
520,480,756 *3528B952221921F9FB7DD2AAD1B7B592739B9BED [email protected]
520,480,757 *352548D24B5CAD1C4DE06D1F191BF4F146A2E923 CARLOS.LAINEZ
520,480,758 *352819A3ACC9F4218722536886EC9051EAF367FF DOSPJELA0
520,480,759 *352B5DE826CEA9E00A7D39926F45E1F4A6DEE5E6 [email protected]
520,480,760 *3523EF09A2C36BA9BCFFEAFE739148FBEE474E30 DOUGBOBO
520,480,761 *35250B19606B257159331D6C8E2E37D6184C8C1D CAROUSER
520,480,762 *3524C259A72F9878F33694F3EEE8899DE23C8889 CARTER.FERNANDO
520,480,763 *3526FABB1A4CC12D49BF48DC01584FD263E6BE3A DPD;Q
520,480,764 *35224B635F26D1949CB0FA3545A9B53463029623 [email protected]
520,480,765 *35231EEDE5977C29841FDECEBD965B2C24527D50 dqt9b
520,480,766 *352B0E42FD68CD809D7052F5561FA019B966F707 CAUCASIANOVCHARKA748
520,480,767 *352CBD571C0811DC2CFE515B6E4304AAAE75F5DF C+b3
520,480,768 *352D41C494FBBF1A190EB92E161A04AEAB162D87 ds,bv
520,480,769 *352DAFF9B6C293F0F9C8ADA8179C02E114680CD3 c$fcg
520,480,770 *352EA93FA048D640888A174CEEAE5AD31FA4881C CF?QM
520,480,771 *352EA494CDAC741986006161515D829AA0F061ED DV=:3
520,480,772 *35287BA24FEA5800E33FC17A5D7AB32A670549F3 [email protected]
520,480,773 *352FB7176321290FE607E579902C9D5F5CB14493 chanike,oychanike!
520,480,774 *35283C19ED6EFBC982A2FE56C833A7C9DC45A342 charleygruwell
520,480,775 *352E8CAB073242BBEEABD3E65C331F943515B8AA d:y;x
520,480,776 *352AC7CCA2E445746BD77DF453EB035DC3D14766 CHELSEAMCKELLAR
520,480,777 *352A527EAEA5102BE60D931060E66E6CCDAB3D75 chf/"
520,480,778 *3523B316EDEF57127101BA51E5754F8D83328B4C chitty2
520,480,779 *3520ED428822FB1F8BE732B317CC629601B26888 CHRISTINATHAPA
520,480,780 *35296634C49C7464E2048371233A408197288EC4 christopersubia
520,480,781 *352BAC7C8136B4F1A5DA8BC54423CDB12D1DCC79 [email protected]
520,480,782 *352C947D3D2B1076EC24F523F5F6ACFDB1C70A40 EDWARDO.PADMORE
520,480,783 *3525AC0E9CC82A295412303A7EB6092D3413B631 Ciemny-pok
520,480,784 *352388A3B5BD43EAC518D30521DC659C99FB1102 C_/IG
520,480,785 *3528B6BE47D22F51F3AD82AE93F6ABBAEC39B9BA CJ1C)
520,480,786 *3528BBC0F5C46A4CE5D03D941F0B6D502148B0EB egmont:-incidental-music,-op.-84:-freudvoll-und-leidvoll
520,480,787 *352044FDA51F21E3BE18DC5AFE477F0E9D33F1DA EK9W
520,480,788 *3523ACCF6353CF78EB9943FB63D2D0D9217A9DFB CLAUDELOZADA
520,480,789 *3529878A3921A1A524B26C9D53BEA9F556F850CB EKVINOKCIJ
520,480,790 *3529CD845A7C3F0F59255727B07EFA1B299AF543 CLEROE
520,480,791 *352FA0FB12BE20E406E29C66C6DDA851BE0D78DD CLIFARD1
520,480,792 *3523D4F680781FDA75120E4D1E24509628974D30 ELIJAHALCIVAR
520,480,793 *3524898F6D5A131DB1005DC43B483CD0F91F2596 CLUU.
520,480,794 *352C4BB4D8C27BDF7DF3BE1A308F58B8F8CA5AE0 CMEZW
520,480,795 *3522CC6AA6E70D24327D10D23612CAD315F3E1E7 C_MHO
520,480,796 *352F0C5EEA6EDEA9B8CD2A236C1121D6D6BF9885 ellisgaracci
520,480,797 *352F52A1CF8543DEA8E168746DE466D1A5FE7313 cmpmedica
520,480,798 *352D60E921835532A569C933181B8434189781DE COLIN.ULCH
520,480,799 *35264AF6B7BDC4CC77CC9429A9D04F334DB46628 [email protected]
520,480,800 *3524A87C84A6C11B1AA3552291882F114DC31C0E COLUBA
520,480,801 *3520A28CF69F25867603A63DA26815FEB50CB131 enrico-santillan
520,480,802 *352B54F7D45608EFBF5A3D61F5C14A61D6414D03 corneliusfinnie
520,480,803 *352E5C5C32AC99075F15BD022520DCFE44845E56 corrobor4+!vely
520,480,804 *352E0049C0BE5F47592E87A377BBF9B0DF9CE36D COTZI
520,480,805 *352C5E5364B4430572965845D5A7684752B5BD0D COURTNEYHARVEY
520,480,806 *352F91B0D272C70E2FE3450ED52539EC35CCD6D0 CPIB%
520,480,807 *352F61A85999152C3336577D4E0BB6C95B5C9FAD err47c411y
520,480,808 *3523C3D0055567FA5B1994F991C728981DFD720C escansion6
520,480,809 *35244C251469611A177E1879B049F3A0F990106B crcp.
520,480,810 *3529844BB4AAE33E5FCA4CD01254A9ADC6E7A928 ES.ESMU.T
520,480,811 *3522EF6E2025D231831AF7542D9DAC8DE58669A7 CROSSSEARCHABLE
520,480,812 *352A6F93C669257750A3B1F20F9CC568992BCED6 EVEN-IN-HELL,-MONEY-TAKES-PRECEDENCE.
520,480,813 *352ECA468462A8E8D702160B2BBE46E9929CBA38 cu6vf
520,480,814 *3523A1516AD7436ADF0E0BDFDAAF70BC45009C28 CVK0P
520,480,815 *352F4CAA2F69360AB76598695A80B6A381DB04EC F1と同じものを使用している。
520,480,816 *352362A6DD3529E55726FA1E730291E23A3B55DF cyuylite5
520,480,817 *35254F5B60B2C52D04B4C4251FE325C2CFAA6B45 cZ#
520,480,818 *352A4F6AB6779EC0EE278B8D90BDAB3C5BB6A38E cze89
520,480,819 *35227E339AFF798210FDE2B7958E11E815548763 d(0aq
520,480,820 *35298207B62F599D405E63F857D4F2C5AADB35C5 d36g
520,480,821 *352A14BD880CB303460DCEC3B84B31723278A923 fi4uciiks
520,480,822 *352D0CFAC2F2E31D86A7BA6514714CAE4A246B3F FILIBERTO.NEWHOOK
520,480,823 *352B7CF89F7B24AFB95A7F4DBE17A1FFB447A8DB d;7ar
520,480,824 *35290DA59253585A68F9E8E23371740DDA974CAA FMAMELIN
520,480,825 *352ADC72707898D29604CCACD930BA8758315A6B [email protected]
520,480,826 *352F1F154F5438B7E465D23091474D52276101DA FN3N355
520,480,827 *35223B91C0D252BB9A815F704C6EB0EA9727CCF1 DAMMILL
520,480,828 *3522EC23CB12E80A94099664AA969A04BFDD36D6 FRANCESORTELT
520,480,829 *352D1B89259B1B8426B201ACD28C3C201EB08C4D DARRELL.VAYON
520,480,830 *3529E4349919EF2531FDCADE582962F038A5246C FREDRICKSPERLE
520,480,831 *352EEFC91D4DD77652FE02FAD58CD3559404C106 FRENTE-POPULAR-DE-COTE-D\IVOIRE
520,480,832 *35269E42395CA7022B6916427BFD07ABDC300F6C FRITZGUETERSLOH
520,480,833 *352350429CCC1EFF60B07CE349F97F35E7B69B40 FROG-ATTACK
520,480,834 *352421039431CB98EDA95E8F181F8F103774B687 da,wb
520,480,835 *352FE21180DBA36EE785D4B9202828D215DDF38F gangboard
520,480,836 *352F3EBEE291D9D630351A5A3159BAA42E33FABD [email protected]
520,480,837 *352BFD174DB1C0B6BD27D51632D27825410CBAA3 [email protected]
520,480,838 *3527B242F17855B6B59FC77341E22B77E3976E9A DEC51670265-0
520,480,839 *352418DE26E1552EFFA6F5FCBB82D2D5E2D910BE GARRETTROOKER
520,480,840 *35251194C7647570F692E9D178CE6EC71D8BBE51 GARY.MAULIN
520,480,841 *3521BB7C5667805F6659E1062E79992A59508C6A deletioned
520,480,842 *352092889FF5C6E34D7674E259764AE669AB3C13 gd\l
520,480,843 *352FC4B8DC42E7CC0B00C8E467ED0BF44FCDE18C GEOHYDROLOGIST1
520,480,844 *352EAAE12206F0FF02378ADC8F6A160FB22DEC06 GERALDFLENTROY
520,480,845 *3525C50737284AF4812AA20ABAB3A5F2C69946F8 DERUOMUR6
520,480,846 *352AF7C183E677D5CB017144FBC3E0C9335D3FDB GERMANDARVILE
520,480,847 *3527A732D33E1C01000656AB492B4D5E26D6B3B2 DESIRABLE!
520,480,848 *352F42D47C8ACECAF295BBA4A030088E449760C2 [email protected]
520,480,849 *3528C420FC380499FAC91DA6A45CF8E937156B16 DEVIN.MAYO
520,480,850 *35243917E92715F24C994B8088AE08A144B6A140 dewaynemcmenomy
520,480,851 *3524E0F591EAB6CA60C7DBB98DFCAFCFE5AC743F giditter5
520,480,852 *3522ACDD1E1EDA4AA5A550D83D09ED0351D67460 d".(f
520,480,853 *352854B094C6150616D08C71B3A7EED20E94EAFD GLI+CHES
520,480,854 *352F4E3C6C2A690C2BA1D10C55830F896030D7D9 GOLEGOLE5
520,480,855 *35271432802DFD88BFD67812589EBA5B75BF1819 golfzaa
520,480,856 *3524B62CC5F355C02E21AD614240AB9046CD6D5B dizm
520,480,857 *3521A69C0B776755787F7788CCC05BAC5F6BAF13 DO3;
520,480,858 *3527209CFEB4A7F22D72AD5F367F1AC6B9C9EFE1 guiltyconscience(albumversionwithnewhook)
520,480,859 *352A59B5422CC01633E985BC0E630EF40C99E66D [email protected]
520,480,860 *35297F33ACD5562CE38753AB6D6B4497C064FEFD [email protected]
520,480,861 *352DAA4DD95C0DB54D0DBD2E477A58D21BF608AF GXUGQHVV39
520,480,862 *3521067D618CDDFB6A337BBACE30072D0E407818 GZWLLNHDED
520,480,863 *3521ABFAE88213C8A6BB90DF73F69DCFAF3F1B42 douglasshelphenstine
520,480,864 *352C645833C773112FD3B30844C806A28C59CBF5 douglasslatterell
520,480,865 *352DEBB6BC7BFBBAD824F106C601BC9FA62C1D9A <h5a
520,480,866 *35281FA8D5964B73F3FE57203B435DC4E21424E1 hallonen4
520,480,867 *352BAC53B5D1B66055905E13BCFE22EBF0EBD4AB HARRITH2
520,480,868 *35260239612C6DF383AE3FDC7D00693F07633F07 HASARDERAS
520,480,869 *3526FCD279B4588487403394C751E9179E23CF7C DSN?Q
520,480,870 *3529F20B1FA8248939E3CF9A61860F1E17D6E927 HDEELZ
520,480,871 *352DDA3B8A5D19E5FDC77D707C13545EE609F18F [email protected]
520,480,872 *352B9732F870566856D22419E4503B67AE1E6B40 DUDA
520,480,873 *352E7C1684CF9DE3B0A7A9964EE8CB18A2EC4194 [email protected]
520,480,874 *352ED0EF781F365588133BA826E24511A6DF0A87 d-uo
520,480,875 *3527518CE28AF1CF77821709A3C634FBCD71A92D d=/w
520,480,876 *35295363EA14742987C9F16353F145D9A9C126A9 HOANG KIM THOA
520,480,877 *35200FF8EC68878EEB37F0771A8B166190D75157 HODEREGN1
520,480,878 *35242C18CDFF8FED85AB1CB6DC3850BD1B0B41A7 HSF
520,480,879 *352E19302BE80D87A97C18FBF844F87E2F8023DD ED-4SICH
520,480,880 *352E2578DB7979A7F18B83F47AD16A168BFC71C1 edificio-de-la-equitativa-malaga
520,480,881 *352B4A6BA16CB642C78BD03574954066B053A545 EDMUND.COLBENSON
520,480,882 *35256BEF77EDB01D551C255B954F6D3BD0C27A33 HTLIHOOD2
520,480,883 *3524656BE759EB97F66021E9EAE4CEDE894EE04C EITHERHMM
520,480,884 *3525E50E4959DD8C3837FA39B9652073CCB9908F IBRAHIM ARAR
520,480,885 *35253EDDDA6A66DC4A2657C67CC78024ECB4B0F7 [email protected]
520,480,886 *352A0811E4C7E1C54CBEEEAFC9AF7E958FE55C54 I-CLOSE-MY-EYES-AND-SMILE
520,480,887 *352EC17793861D9E390148122DB8FA61CCF9F5F1 ELLIOT.MANZO
520,480,888 *3522DF3211D95BCC6F8CB4866E16DA6352F3B6E2 IGHKMYS8
520,480,889 *352F24B74B38F8550DD17A74F9F53F8048FC7A9A IGNACIOSCHILK
520,480,890 *352708FB0C4FCEE99CD0846C25095A4D5039F576 el-#q
520,480,891 *3529B492D133758765AAA37D4BD370124218ECB1 ILIMIDAZ
520,480,892 *3523B9D1F3325322E4B828F5ADE5D850BB226E7F EMILY STACHOWIAK
520,480,893 *352F61FD6274CB4697BEFF05F3D73A5727AEB2F1 ilovehahaha59
520,480,894 *3525B7B19C6715247828CB272E7BBBD0D11DDDF3 iluvconcept13
520,480,895 *352DD98A86D65C0EA1767F6460366F25E8BBFCB1 [email protected]
520,480,896 *35250C1374AF3A79FEE1650ECBDD3FFCA91FCBCE ERIC.ABRAMEK
520,480,897 *352900839510D8E795D91C55FC82E930EA578E06 [email protected]
520,480,898 *35273D23AF55664CDCAA33C9AB7B9444AF152727 inkuence
520,480,899 *3527DC652B2DF452E20A4723BE55DE0F51BC9334 ERIN.CRUMMIE
520,480,900 *3527D57665339EBFFE5D3B618DA231A622079755 er$k3
520,480,901 *352F112C5DE050D1FE48B82C86C13E6C078F723E INTENANCY.
520,480,902 *352DBB5B4BEEF13B94CC5F28490E95B68B38EEF8 es=d1
520,480,903 *3521A3250221818F6A7FB79D3490245059FCF36E ISKAISA3
520,480,904 *352D6712A628E6053250C31EEA55B12686203FBB ITAYAL
520,480,905 *35284C1903FAE74885508A1FE8E993574EF5FAC5 eugenerichard
520,480,906 *352775DC2F333C35A0618D2F72754DE807F47551 jacssys
520,480,907 *3527DDFA928D597FEE7F1CE1FAFE38666A216FBF fagstudienaevnet
520,480,908 *3528C30DEB3C3139200156BA3641E4CC9B626ECB jamiepavia
520,480,909 *3521C4103E0A966DBB83FE0399E679722BE62724 [email protected]
520,480,910 *352435BC34B861AAC7543BA0D849705312D05D14 JAMIE-WILCOX
520,480,911 *352C7ACE50BDF4F777B0B95A0C50B762CC5C137E [email protected]
520,480,912 *352779AF2DFE385C4013E89153828D89503DF30F [email protected]
520,480,913 *352A70EA87DE8861FD1B5A9E7E35C9AF081BA1FA [email protected]
520,480,914 *352F8B69CB6251387ACBB04D468F8E656548591A FEDERICO.KRAS
520,480,915 *35211CB84FFC92EC9B632DC6C93470DA11763226 [email protected]
520,480,916 *3526BCA5422B787D95C68D532EB16077BBF52BD8 feisnet
520,480,917 *35223DA6EC9A2B2628FC6BED6E0F84F69C9DAB4F fertiliserses
520,480,918 *352B1AEC1ABB8C435E3957B6F860EC7F15117A57 [email protected]
520,480,919 *3527D42FDB2DCD63415EFA88BD66B7B135C48294 j,b|
520,480,920 *3529B11B7626E370CECA6095DE73E3E0F5CB3508 FILENETS4
520,480,921 *352788D7E336763D3A14C6E4445BB30A9731EFE3 fitton3
520,480,922 *352ED230FB8F514B22F14ACE73D440DFC1F5D479 JEREMYBENDER
520,480,923 *352C4733FB11BAF9479096432DA087EFE21A7ED2 FOR'TISAMERITORIOUSFAIRDESIGN
520,480,924 *352706171EB8783B0A88D4195F3FCCF69AC36648 FOSTER.GIULIAN
520,480,925 *352AD27445722F29251E627D496785984F4D50B4 fosterhornsby
520,480,926 *352580E73DDBB5C672826D25592D728951A0A6B9 JESSICA-KERNS
520,480,927 *3523244975A12AF5A6A4CA18F1DE009FD81A9FC2 jessiekruzel
520,480,928 *352BF008F61D1C7824C56CE355C712CB806D3A8C JEWELGLOR
520,480,929 *3525CF7BFF8406934F8C8CC2F9E72AA47CD947A0 FRANCESGMERNICKI
520,480,930 *352376E6CC189959565AB9FB2465EA5FFEBFFC0F FRANCISCOLIMESAND
520,480,931 *3526FFFD59233ADE45570870679428F709EB41BD FRANKLINRIEKENA
520,480,932 *352B51B25A41E90C7A593CD34C4EF8155F45E123 jhapz123
520,480,933 *352730AF295AB9DAD353B958C79367EF03EC62E2 FREDRIC.LALLI
520,480,934 *352AA5FB0606B5E68D00408EE1D36BED81E3F4A6 JINDAIJIS
520,480,935 *352BE1A39322F9D7903DEF0DD1BCC87974A9019E JKMC
520,480,936 *352FBB5ED7FDD878CE9D1BA5E79E93D92470332D g(!>
520,480,937 *352DEA6A654E131C9850C13603258344B1C6E908 JOHNNIEDONATE
520,480,938 *3521316BAA2F060997DBA95FF83A3B5952F6B755 johnnybayton
520,480,939 *3524E9160A5EB339E3525C63F2EA8D614723C998 JONAHCROGHAN
520,480,940 *3529BD7B81F5027FF83BC65931DED2DFD113D0AC jonasmoncrief
520,480,941 *352470D21D68DA3437F53E15A2F7F7017E446DBE garymonet6
520,480,942 *352D19FFFD77C17E50408CBA9A1D7B19657313B5 GARY'SNARRATOR
520,480,943 *3521293D720C683D90EB5D3026CF0275C92C9A53 JUAN.MYNNERLYN
520,480,944 *352FE10DF5054EBCBA4C5D6B645ECBF3E0236EAC georgia-navigatorcomwww
520,480,945 *352EB3A788F1E135D6C6FE24DA48898F7E6C391A JUDSON.EGELHOFF
520,480,946 *3520A34E638437A8530EBDB68BEE3DF8F6D97BFF JULIANNE SIMPKINS
520,480,947 *3524AD37F0FCDAF1F542BDF3BD361A5CF851A804 JULIE218
520,480,948 *352A06F64825A499FD8A618212EF39D87BF02460 k6[k
520,480,949 *352B8F70ABC2DC3BF4E5A8B0889ED410C596DB85 GLENN.KILTON
520,480,950 *352271DB2C8B06E8021A1449F7C12577942345B7 KAKUHANNS
520,480,951 *352A658FB52EC833BA671DE08AB18EC887631366 GNMM
520,480,952 *3527240FFB07A2E3375543479CDAEB45C7479C70 GORDON JOHN
520,480,953 *3522E3218A778D6FAF98AFB46108F529FE738F4B KBMARIANO30
520,480,954 *352002920D22A2FE493DC21AF23DA5A1A3D8695E KEAGAN633
520,480,955 *352CB4509824306141B10B7C90EA9F6BD6453C42 KELKKLEK5
520,480,956 *352FEBCF606DD0832A982ED048DB56294F31084B GRIFFORDING
520,480,957 *3529F6232A85085FBD1FCCA08270366331261A8C KENTAETED
520,480,958 *352EDCAFA8483BFCB2BEDE333A067C53CEF56B16 GU-REI
520,480,959 *352D8B034A52B083E424BC0B03D7B4B66903AE6A GUYSTOBIERSKI
520,480,960 *352C65BEC293D91E67C1FFC9CF5DA7042320809E KEWPIE.STATION.(VERSION.2)
520,480,961 *352BCF842F52BEFD908160D98159DD8181B096A0 KHADGAH9
520,480,962 *352803833F2E332903E5191D9B15BE853EF942A4 habet onus; leve fit quod bene fertur onus [ovid] loyaut
520,480,963 *3521216208EF911E7149DD598196745A6CDA01E7 KKAELYN
520,480,964 *352F8E97CCA59388B238CDDDC906B43FC610106F hankhahm
520,480,965 *3527AE986F61BF004C99147A015CCAA08483A29B KLEUDSED
520,480,966 *35228C9E41054A088454F07BD2DC0BFFAFCBBFD2 HAPSEDE8
520,480,967 *3523CC4921248021097BB35FEB00224EB5C91830 KOWSARCHOWDHURY
520,480,968 *352EAE4730A4758BBD25111412F3C3F90CBEE0E6 HARVEY.ESCRIBANO
520,480,969 *352FD8D0A038F54A26EC8CFCCD6E699483E20F78 HARVEYMORELAND
520,480,970 *352E54182945DB4D0AEAE121C2862F32E774BA0D kt^g
520,480,971 *35203EBA7482A4CB96CB50FB5B56D62636ECA00E l281228
520,480,972 *3525F3CA3D61A394C8383512C1915E7993BBD1A3 LACINAP7
520,480,973 *352B10EC99D05D3A28563818AFAE30186489F879 HILARIOBISHER
520,480,974 *352B1F4CC6C0A63D3C1164DB55777A13CF8C112F HIPOLITOAHYET
520,480,975 *3526C3BAC04B49CF4B59A3F0906195604233A96E HODB
520,480,976 *35205DF72274CA61ADACEB868B4989BDCA5CF7D5 las-chivas
520,480,977 *35249F91A435F5C1E61426795C839E84DE3C58AF LAVERNGUTSCHE
520,480,978 *35208F9501C64B0658908D3BC6641A36FD86610C LAVINDEL
520,480,979 *352E64F5CE9610CF8E51C16C9D4EC4EC1E3A4723 LÉAUDA
520,480,980 *35239CEEE411E01A62D5E75DE58E142DC9AEC7CC hsd3b7遺伝子の突然変異は、進行性肝疾患の胆汁鬱滞の原因となる先天性の胆汁酸合成障害に関連している
520,480,981 *352A3ECDDE1C6A67C0E417D2377740B76A144849 HUGHMOLIN
520,480,982 *352199D40F71E86A8807EC3F61D7D01D58BB8BB3 LESBICHES,FP36:RAGMAZURKA
520,480,983 *352587F9547C92158EE896D4D4E6F6B70FF939D5 hyamarshhane
520,480,984 *35279851B9578FEDF984AF6C6292CE57F7275645 IAMDRAGON175
520,480,985 *352FE68D466E6EDB8F827C6B67F669EDFD279C2D LIEZEL-SAAVEDRA
520,480,986 *35297FE9E16C38D187644BB312D6DB2DC7A6D54F life-of-a-bastard-(feat-saigon-and-treach)
520,480,987 *35261069DEF6113EB883952CF597E1B578941F3F ICSIPAR0
520,480,988 *352752DC2952E8F8493DCCB4D91DC9A81735C4E3 lindseyschoell
520,480,989 *35253C9796A0786D77F8EE0F0DCF2AB6889DDE82 IKCZIWARED
520,480,990 *3526A37C591A6BBBD8E1C4F4CE1817798FBDA479 illardo3
520,480,991 *35278813DB3ABDB161B00A6B22A8540A18592401 ILUVPIZZA17
520,480,992 *3523CFBCF1D350BCE049BDA2BDDFA081E634F23F IMPACT777
520,480,993 *3523CDAA950EC7B5481E22DC1174F2260C5FD577 lob{
520,480,994 *35216B981175B68B5C77F95E049BE9D4D19A936C [email protected]
520,480,995 *352AC1D6CBC66853F619BE780DBF4F13E8FFAEAF LOWERCASE.234HTTPWWW
520,480,996 *352055E79556BCF909A091357E87FF76C75AD7AB invader ziel100 (remix)
520,480,997 *352F2F6B78B49F6106C573346FE2A69397B078E1 iont
520,480,998 *3525C9712236C6F6F64A7155E117351A4828DBBC islambol
520,480,999 *352204922E2D9A2158AC86321809A45B9C2B4EB1 [email protected]
520,481,000 *352ACEDB3D88DE40E8C757CA5F0C3B120C524A5E LYNN.ALBERT
520,481,001 *352518CF9043BA998367F3792D2D75A36B957CAD LYNWOODLAPENTA
520,481,002 *35248F71DB1B5F1FB01DE88CE56B3D75B6931E4B [email protected]
520,481,003 *35273082C68721561315A2E214F5CABA80737FBE IT'S.A.CONVERSATION
520,481,004 *3523E184F348A446F1C8BBA44C1CEC8B9B377546 JACKBEIEN
520,481,005 *352AC0E74C6264D58E933037EE98B5A5A3BB3567 makinislandstarsstripes
520,481,006 *35245A0CFFDFC1F824B25242B8A219AAB7D03A41 JARDINAROMATICO
520,481,007 *3527FF590FC1982B35EBCA8DDE3EEB36044C0434 JAREDH
520,481,008 *3522E3095F2BEDC20BC2B3AD4E24EAC5285CA391 MANOLYN0
520,481,009 *35238BAFADD5FAADF6C0413ADCDB283C86F1A327 MARCELO.MIERNIK
520,481,010 *3527FEE9E73500D76EEC0C5A14721E0D25C4502C jaysondacunha
520,481,011 *352E2F158BB9E0F12137007E7BF08164366B4455 JB\*
520,481,012 *3526AEB7B93A5EE0EEC9B2839D496B550442489A MARINAMICHELL
520,481,013 *352A5CF2F3FF6CE74A2A37EEB3FF08598B555487 MARTYHAGEMEYER
520,481,014 *352B6A4088017838299DD659A60E4D4F61570FB4 martysiegwarth
520,481,015 *352F5ADBC73B0AF9D2A8BE14739E7B15718BF7F8 MARWA TAHA ALI
520,481,016 *3521BFD998A294CDBB0CD6396AC8FDBFB13DFC65 matchmak8
520,481,017 *352447C45CB296D39C32091CB9DD7B41342AED2F JEROME.HONSINGER
520,481,018 *352332575ECBB61030C32BFA422BDB247CAE2348 [email protected]
520,481,019 *352A6127CB9B8D48A02202458FE27E280FC12684 MATT.CHANOINE
520,481,020 *3523A494D4F74DF70587CB528E9E571659A8A221 jessiefonnesbeck
520,481,021 *352CE110BBE083038D0DD81B9DD36F1F801FB3B3 mbpsaes9
520,481,022 *352B4D9681CE47BCDF87C3B08093B40B14C183C4 MÉDIATIQUES…
520,481,023 *3524D24121D834FB71D4516AC73BAFD5680E4D88 medioeuropean
520,481,024 *352AE0B798BFD5C2C8D3B9EDBFD6F9D15BDD6CE9 jim-testerman
520,481,025 *3520BD0A2C00F7585A826D5B058ED5C490C6BECA [email protected]
520,481,026 *35267C8FD7277D1C4C62756E2C1C0F0AFE37140E MELFORGETTE
520,481,027 *35255A5CFFB004D6DC047DB5B573DEF88FB9A325 JJB0715
520,481,028 *3522BD73B2D5B8555F1F408BDCEFA7B71175986D MEZOBB
520,481,029 *352FC1AB3AA62591B190E78EC53FA9A19D2B8907 MGHAMRAWI
520,481,030 *3525886D9C12F13355FDD8629533544D58B736FE JOHAN GOTTHARDT
520,481,031 *35204546A360F204473BBE7A98998AE6FBE94A2C JONAH.BARCLIFF
520,481,032 *35252BF62581C29DA09CD27F926634CEA67F7D12 JONCROWLEY
520,481,033 *35289EE634E3FC09504B0C7F6962C2F3F5C269BD josephterrasse
520,481,034 *352D9DD4FA6F820ABE1AD8859B6300FE85779E1E militarstratege
520,481,035 *3521B43EC1376E112FFF7C4E239C809161ECE733 [email protected]
520,481,036 *352E11BCB10D1033FF1089078F0179D66BAAEEE2 MIN-KO
520,481,037 *35268F81C67B5C88EE144D2CD21982EEBA30E188 JUDEPINNOW
520,481,038 *35250529F1E43B4CF2EFCDCBE08788D33A296D3E miswrote5
520,481,039 *35297A554A0F2C423959FD1403BF5B097CCB9AB8 MODESTO.BAK
520,481,040 *352C529210937C0A8F95A7ACC81D36D877F1785B moffettdodson
520,481,041 *352E949C01298AAFCE87E56FF117D80A78BDE73E KAASUASEISSA
520,481,042 *3529123205E0A8A357E5EBD5E9BB76E3B6DE9A53 MORGAN.VUKCEVIC
520,481,043 *3525FFEF029E2102FD63BBEDD028E3BCC81B594A MORRIS.MCWARD
520,481,044 *35286416E35BD5A21A5B3B8717B3B203A1DFACF1 mosejauch
520,481,045 *352A68092AD43F698D85960B6A29AF05F9BDAD52 mosescodilla
520,481,046 *35217A02A741CCD522E866688E830A7F19D03A4E KARISSA877
520,481,047 *352589B37DB561D88B2307B9B317C8E4AB04E673 KBJONNYREEVES
520,481,048 *3526B97A1895AE3BDF4924910A2676D2090225C0 MRSRMRSR4
520,481,049 *352CE6F144F702496F25C4D7528E9777921D39AD M!SB3937
520,481,050 *352F9BBA6C0F67C6B9509389BB53876195384094 KENDALL.HOLZE
520,481,051 *352E35C324754BD100B424203C33552C3A1F1374 MUSIC FOR TWO
520,481,052 *352AFA6C99F69395EE4B78258F7591CBC1A28F9B KENTONVANMARTER
520,481,053 *35240AD199715F44835C5F52DB8CE32859852935 mygargoyle2
520,481,054 *35218BF46B90176079995C0578E4784F9539689C N00NTIDE$
520,481,055 *352CD65BE0D7F89DD1C102E65F25C679699ABFCC NAJISSA
520,481,056 *352EB6ABC36320B2B97E2322E76C358B7E53CAAD KIRJEISS
520,481,057 *3524ADBDBFD6127609324798736E4AC8AF5D97E9 kirkfredenberg
520,481,058 *3522B9E4EB37FFD07364235ECCE9A0920FFA50A6 KIRZNERLINKS
520,481,059 *352BC5BC313C702F5C417739F79F1A28D2B7B498 NEIGERICHTUNG
520,481,060 *3524ABC4D1DD5705D22805D969B27E5B91379999 KS&V
520,481,061 *352AF506DACF2D65CE7AC0AB2F94A6E5CE1D60F6 niceforobrieniopadre
520,481,062 *3528AFB8909D525BAB1036E6C9C2B2BAFD27DDEF KURTISJURICH
520,481,063 *352AA394F94B35B3A292D9484A26942897B58EC7 KWH11486
520,481,064 *352B686B600DEC3C1A43D972B8BF6B01D8A2BE44 NIETINGSEE
520,481,065 *352EE7A6E5BAFD25DB72927DA0302C360459A5A2 [email protected]
520,481,066 *352170DCA8D1893FC8B59FE1C1D5A34E6AFE373D labrus8
520,481,067 *35288936B0D2DC1EF96DFC5B22041D130C48ED21 lanemcshane
520,481,068 *352C2A328B6C041E256F3B9584A58C4957516C96 NOONEIN
520,481,069 *352E185F2F964249506750129B900B0D7231EED7 NOSAJSANCHEZ
520,481,070 *3523E76C8FC9A67DE6E08B41CB622AAD5EEAB70D o->-<0~ d----b
520,481,071 *352CF3704ACB4A247A35D8766F836D6014536125 (O_-)0~Q----3
520,481,072 *3520F98774DABCA500BA3D670A94E5A07A73011A )O(.~.D####Q
520,481,073 *352FF82260339567CE2DD1FD75E0D7A32A159C52 ölçüvenk
520,481,074 *352D8078EB1F955E25A758B9507999BC1A6206C7 LEVAVIMUSQUE123
520,481,075 *352CF891E856401BF10DA82932A6DD2D82B35CFD omarita13
520,481,076 *35254347A24C5A743B164FA520B96934CF509899 lewobed2
520,481,077 *35263C18A2086F3B1AFB5C54722FD4943E9283E7 (>_<).o~.O~<####p
520,481,078 *3527BFFF17927CBCFC0F78C2EE7A14D23F8350BE OPENYOUREYES(NUMBREMIXBYDONGORDON)
520,481,079 *3528AE983BD1D1DF3850BD066D8314B0C0E796E9 orgibetois
520,481,080 *352E52B30721CCAC38D374A150A8D34955369D3C OTQD
520,481,081 *352C54ABA78496DAFEBB3550AC5FC446A2C90E5C p-->.~0~o.Sploit
520,481,082 *35250B269CCF30A564DE3F0BAE23E085CC2BAE4F p===)-~0sploit
520,481,083 *352A2D03DF841CA5219E1E5EA052A92034AE27C8 LPCKI3DPZ3
520,481,084 *352CEABE19E74A4FB18885BDA4A17CAD7D55A6EC LUCIEN.OKELLY
520,481,085 *3526B548DC6C598307F5AB3FE8FB5A3522C64068 LUCIUSCHATTERS
520,481,086 *352B758712DDA3493CFC751192AFF3688337867C PARHAM.1
520,481,087 *35236CF240C9BDF28E223FA0BBC53E80BC66ABC2 [email protected]
520,481,088 *352BA9C2FB35251C1412F2D601C9820057F34FF4 LUKEBARFIELD
520,481,089 *352C1134CD4BABC8ECE9D4B3ACE8AFBFE0C3E7CD [email protected]
520,481,090 *35241EEF0DE7368F93D848B364469C983A2E6DA7 lynwoodkrapp
520,481,091 *3521DD7BB5DF97693552742D25F89A55E804F266 [email protected]
520,481,092 *3527C02D9A499144C66DFC56817CA52B9B657A10 patricktaffe
520,481,093 *35261295361F6CD9A5C360A6921A0690A205C321 MAGUSAGURA
520,481,094 *352B85E26F1043F108AEAC1B4FB41C412A548914 MAHAVIRJADAV
520,481,095 *3523C29EBC3F0A6503B6E2DF5BA9591FD00700A2 majorly.demented
520,481,096 *352BC88AEC4887A1BE12C5127362E1F427D3EE3E PELOTES
520,481,097 *35294CB03D272DC1F3D7B2493DDDD56AF0088C44 MALAKROHE
520,481,098 *3526E26AB8EF590E342BA05118C91FA0B548F907 PETIT.BUDDHA.3
520,481,099 *352157BB659A3723B7483FF6F36A5BFF8B0BA84B MANTENERSI1
520,481,100 *3526B19D7ACE3EECDC1E0005B6351CCBA081171C pictur3-s
520,481,101 *352F82E4557A386AE82252A6D9911102CB8AB3C3 marioharvester2571992
520,481,102 *3525CAEBD99AD559C566A7C089251B55ABA34527 marymisiaszek
520,481,103 *35276C9C431578A4FD206F34161A04251196ECDB MAURICEATCITTY
520,481,104 *3522A84BAAFD572459BF65FB04EFC9944C90520D [email protected]
520,481,105 *352C36FDF4FA11DAFA8A330C097D1B8D95BF84EB POULICH3S
520,481,106 *352B299EEBBB133BEDE92946FB9829F63FBA78D5 POVO-QUE-LAVAS-NO-RIO
520,481,107 *3528BC3A91DF9F842DB6110B60E87319A79F1783 PRESSRELEASEELECTIONCOMPASS
520,481,108 *352A0E3223C0E894CA5A67B4BE933396F581E355 Memories
520,481,109 *35260C3DAA8A6BEE68997AEDB682A640A24D7079 PRONOM.
520,481,110 *3524B86B78A6820ACDA022B0CC5CDF26DA29A92E [email protected]
520,481,111 *3524566E5C9A62E3670E048150FFA3F6051C6385 MICHAELISLES
520,481,112 *352D8A9B622FC9AF2E35B14CFAB26F125E6C29C1 [email protected]
520,481,113 *352C8B06E8372C26FABEBC89DA9974A8681442BE mikearp
520,481,114 *35268F347E01416325E2B371F89114D1E015ED5A mimzy0
520,481,115 *3520B2E8443B0EB69E56DDB33A98B064EB898B31 MIQUEL.LESKI
520,481,116 *3529E1340AB2B8CBFEC0BFD2D07595A8D69701E8 miquelnewill
520,481,117 *35278DD75CD7EACFA2F15493DE962D3957CDB472 MisaItoh
520,481,118 *352AFBCB46C594C54B52AE48B71BE770CE60EC27 [email protected]
520,481,119 *352C8F5BD7CD33502F277D9F72FB243DD89421A9 [email protected]
520,481,120 *3526B29B2606FA8EE699E180B1A8A22FD8275074 [email protected]
520,481,121 *352DE7DE71D04D02F1BD643114AEA1C9F6525834 monroetennyson
520,481,122 *352E9915822FF4B97FFEFCA83F89109FCB168147 MONTEDISSINGER
520,481,123 *352F35C18942B913615C5799500A050A34070268 R3V6
520,481,124 *3529EA7E798255BBDD2B8E13302BEF23102EA542 RACEMOCARBONIC3
520,481,125 *3527DA03229C180EA4D37D3CB8CE4878DFE3EAE5 rafaelavalos
520,481,126 *3522BE9244C046B7A5DA8994F2C1731DC3B13576 ramatoulie
520,481,127 *352D40147A5F7DA1FA972AF5D742696BFD126D1C raymundoswearngen
520,481,128 *352BA6D6BCB1979F8331197FF52C3DBE1713530E raymundoteach
520,481,129 *352BCA0D313C90DE0F70F7DFDB2EDDB266F0F971 MYBIGMAC1998
520,481,130 *3524D4D982ECD37C6A7D8E55DB88F22EB60901AA [email protected]+IN9
520,481,131 *352E79644CBC3ACD4B0F7879BE3A56EC578F61ED MYJACK55
520,481,132 *3528230AA3482B002232F19D0EA2E275E4AD3847 mysparrow2004
520,481,133 *352DDB8CCEB8EB6A9E9BF5BC6FBD53EC69E34BA3 N0NIN+3RV3N+I0NI$+
520,481,134 *3526FAEA2271922FD716635706FD2C7CDBF0D48A NAGALGAON
520,481,135 *352B6A207E65C7174B876E91B2DB16A84A0D6276 nakedassassin
520,481,136 *35262055E0F8FD5E8F306B90BE8E78B687BAF593 NAMEORGUKWWW
520,481,137 *352397EFF223FBE6429F89EF2E057839061ADADD NANA MAHER
520,481,138 *352A92E80B59AE0D52CE919D27C93BB6A43C85C4 REGENERERESED
520,481,139 *35240D459000615DA3448448D74FB8E70420F1CB REILLIM2
520,481,140 *35272237A0855C4A5EB692E484AF10397971A389 nathanwong
520,481,141 *3521987959A501BF729BE888B757A9D3E2691BD6 rememberdreams
520,481,142 *352F2CF5C4D64879BCC7E923695918883D49154B [email protected]
520,481,143 *352711503082AB4C33623F9DA3F94FE77D89106B NEIL TILLEY
520,481,144 *352E670441BD9C8B10BC2709A4D915E65F1FBEBC RESSOLOIRAV3
520,481,145 *352F1DDEE874A2091C9B8F8945763D3F1311BD9C revertedjncc0
520,481,146 *352745C41201D266F3EC2841236F7D6824C9DF67 REVRAP:TONY
520,481,147 *352A4061B7294D5F0205D495F5FE85B2FACF2D72 newtran
520,481,148 *3527108E1ADD23EE769290A9897DF5722F26BC7F NICHTRHEUMATISCHE
520,481,149 *352E2E4969195941EEF328C68EBF1351711A856C NIGGLESKOOKUM1
520,481,150 *3522AF9BAFF1DE6A1F15E3CE7E1BEDE057248EC8 NINOTORENA
520,481,151 *3523B2EEDB17D7DFE0E7B1C4E3C2A5E4C919946A NK33137
520,481,152 *352ABAB3AF83105EB9D7E67FF33572B237479F79 ritmo 2
520,481,153 *352F0A80A0874FF65135D5F78A24017F26012072 NORBERTOCARIDINE
520,481,154 *352E43E21C06F0F0BF30FE57A6CDD1931CF56172 robert-ogrady
520,481,155 *352CCF4E2405415D3D65BA624C86F2FF1A6D6DBF NOUVELLESUITEPOURBOUZOUQ
520,481,156 *352EED04EA5C33E71454964291684D07342F2BBD ROLAND.TAWWATER
520,481,157 *3523C79867EF69C1380BF009BC42B605E17389A1 rolffennessey
520,481,158 *352A95277767DA26B3C77756A7D6FCEB7FF8A28B ronaldeisenbeisz
520,481,159 *352896B345ADEB336C96A83486226F090E5D9CA2 RON-BOHN
520,481,160 *352641D3A6D9FE58F8BF0DBC11D75545F1C541FB RONFRANTZ
520,481,161 *35217FFF1462E97BC5E95919996692F54ECD527A RORYHEINEKEN
520,481,162 *352BFD2BEE690D0D0CA182805DF220E49CF5813E ROUSED3
520,481,163 *3522B4FFA0A422D57BDA59AED2756E896877603E >-<o~.O~.d##3
520,481,164 *352AF303D602EEAB416A7345BA4E571EDE33BE18 RUMOIINEMR
520,481,165 *3523AADCEC7912C5BBA5D26FA9A5784A942E23FD RUSSELL.MCPIKE
520,481,166 *3525C433216DE8CAC6395115DCF181528F6D26B5 russmurayama
520,481,167 *3523EE4719BB5C3E308B19B6A8CE5BC8772F5D69 ORE61334928
520,481,168 *352C4BD96B98789EF7B76F5D592E59590E6D9CE7 OTTO.JUDGE
520,481,169 *3526355F2A2F8FF7E8746EA2AD7B7D2BE1D137E3 OTTOMARTELLI
520,481,170 *352B1F290FEE32F139D0078C1007CC3D158E6231 [email protected]
520,481,171 *352440DB7C04500D87BEE064410F4DB303288F78 P2P-USER
520,481,172 *3527D2DA09C2BEF33C494A7BAB1A03A94F8051F3 P3BONDFJIQK9ERXPIUDUW
520,481,173 *3526D457E14EDF4323F388B281A2F9B403EFC8A3 sarcamargomarianoypedromariano
520,481,174 *352D87D2316D1E164174556222FA75E8908F2C51 paflagonis
520,481,175 *352482B640A68E012F3884E0A2763BA98A6FAF9B <p><aname="n_217_">217.</a>clinton1/17/98depo.at68.
520,481,176 *352759C5B78E1F71D1F6357F3DAADCDF45178C58 SBSLPHD9
520,481,177 *352683C749FFA93BE704AFEE12E950E93DD12D58 SCHATTENFISCHEN
520,481,178 *352FA734EFF8564FBF9958C977CCB25C54BF5412 scottiezambito
520,481,179 *35220B16CBC8A1EBD37EEB8A75929486A70B3B2A P------B~0 ~O(>-<)
520,481,180 *352174990BFC1E93562414707CAC90C8AAEEDCDD P###D*(><)
520,481,181 *352C36731350FDC36692A92C449B77A13D4ABB4B PEDRO.AUKERMAN
520,481,182 *3522CC3B00C3AAD03542A598A50BD2DEE285540A pekaskch4
520,481,183 *3524FAD65F8B1AB6A8E1FC86269E9DC43340019A PETE.CAVES
520,481,184 *35260849AF74C4DD74EB41E6B9174E2BCDA9C9C5 SEYETHGIRBS
520,481,185 *35251AE4026AB4130BD555E36B822A8B64D1F3A3 PHILLIPPINENDORF
520,481,186 *352D4107615902FCA0659F3B7828BABB632854CC SHADOW15151
520,481,187 *352CC839A650B3D56BC63DEB446B125F5D367FB7 Shadows,forWalterDeLaMare
520,481,188 *352651E8ECD1630BD0CB2D1560C0A48F3F4E6F2B PIANO.TRIO.NO.2.IN.BES,.D929:.III..SCHERZANDO:.ALLEGRO.MODERATO
520,481,189 *352CD20CF268861589752592379A602EA4BB9184 piscich
520,481,190 *3523D474A66ACEBB7619891FEB74993FF8F0DD4C SHERIBRENNAN
520,481,191 *35217A48262FC3D63A20447733BC58165EF1ADA8 pochacoed
520,481,192 *352BD9CA0C6A28BEC1E543B4BCA0094C7F610234 pongamos.que.hablo.del.mandril
520,481,193 *352E51126DBB132E7DEF7835BCF099D3DB910E6E SHITTIGERS6
520,481,194 *35230A23D9258964345F60C900DC4F3C980E09CA SHIVAUNG
520,481,195 *3527EC5448B5FDEC3339853553A31387A58B4411 POST1945
520,481,196 *352C9173003A632E78F3717519339CF8CF1E63E7 p----p * * * ~0~o(>_0)
520,481,197 *3525455E0F95D4A7789EF8ED3A97CBD8510C82A2 singles.collection:.the.london.years.(disc.2)
520,481,198 *3527586965688B3CC766353AED724663C76D615D PRIDOVITEV
520,481,199 *3523116214895421CCC5A96C6F9A07465C3A8D35 PRIMORDIA73
520,481,200 *3523D423724D480D6E94D7964DFD597FE23F092D SISYPHIA6
520,481,201 *352F21F717ACEE1FE88AFF0F53D30D95309AC27B P#@~.SPLAT!!
520,481,202 *35277AB485946FAB3445EC27211FD26AD7629E1D pzz]
520,481,203 *352CC22CC12597DF8E08C7601AF7FBE546DBE168 snmis
520,481,204 *352803629B88BED78A409700FC39F93F0BA60FCB qB ~O~osplat
520,481,205 *3521F3A15932113FC445992CC2B2ECD92560178D qdrprtcs2
520,481,206 *352AC50D3704F5EE69B85FAC8D545CC0AD14C35F QIONILAWA
520,481,207 *3520ECDA56AADB09DC93E00190DB9347D3E99C04 [email protected]
520,481,208 *352FFA18018061625823BC377A30BB0B292020D5 qwaszx
520,481,209 *352D106AD561C24A499A73ECE3B835F1CCF4C9A0 rag3ous
520,481,210 *352E740D8D5C16C68EDF5A67946C72BEF5BB3FE1 splat!0~ (B
520,481,211 *352268B4926FC033EE0A59EE89BF5FAB047BB02B SPLAT~.~.~.D======P
520,481,212 *35212DC2EC58F07A2098FC2611EF21D34CE62FE7
520,481,213 *352F1BB7A95DAABEB02BF767B536C76BF54D0C3A
520,481,214 *3520A3A12CBED5C1801ABF973EB562FCB957589C 
520,481,215 *3527DD8B64B71B1FB96415D046E85A19E0E41386 ϡ
520,481,216 *352BCF683F26A8C39EB8BECC560D9F6A839280DC DzI#
520,481,217 *352A5B55C843B3FC169CC4AE59A1722C5A4187C7
520,481,218 *3523FCA85202794A66FB1F81D48C2F7F6C81A50C :حuy
520,481,219 *352A0D4CFF34C29D4117B5BBCE2829D081BE4479 M!
520,481,220 *35291E1BF4E731369552982CB47991E990CEFE26 SSENELPPUSNU6
520,481,221 *352FB758772E2F67A1261465D10CACD9302892D2 dB
520,481,222 *352EAD43952B91FF6390D5FB2FFB65809D50EE84 sstnotaria
520,481,223 *352FEAF0231585CFA8F8AD0472C9DA2B22A944EC stacydettling
520,481,224 *3524450273A69E01F198F77163C8149AA5C98929 stamath3
520,481,225 *352F66AB030CF079ED6ED95AE68A582A0338FEE2 stanmellor
520,481,226 *3526F4BF6D34BDBFA5C5A5FE41CDC837B3B1CE7C 
520,481,227 *352282E2B52735970D27E3EFEEE823A45F3D5BEC sterilizovanych
520,481,228 *35230C8787B0583EE6A1C080833D7A54D0792C75 STIKKMIRDENFINGER
520,481,229 *352E51CBCA175CDEBEE10A5D4267EFF8771BC20C STRATGUESS9
520,481,230 *3524B1EAFA2F756FAC66A2D36260D64AC19D70DB
520,481,231 *352C63F909108ED63972186FAA57BF92C7BE7751 STUDY-SAYS-BLONDES-MAKE-GOOD-GIRLFRIENDS-BRUNETTES-MAKE-BETTER-WIVES-DO-YOU-AGREE
520,481,232 *35235381EA508E3D1EED42B6B95F662F1621EBE3 
520,481,233 *352533C25CA45C40BF48B901246470DDBEA51D3A U
520,481,234 *3528011000F73363D67B6B3B741D72CD5226C0B0 [email protected]
520,481,235 *3528C1654187F79FF9B4C36559623DBF875BE59C suokalbis
520,481,236 *35209BE65B65C320E5BA5DF910550E1FF42BEA75 SVANIVAMO8
520,481,237 *3522B6ACEC7AAC65D7995B84FD04494676AFD4C6 T921100
520,481,238 *352E75C7C9B6A6B9B6D2C4F6960F4AF8E35583A2 [email protected]
520,481,239 *3526394513132E92D9594FD969EA8183F1DA0DD0 TALKCHOP-SOCKY
520,481,240 *35210AF821B11924EACDBC9478FB7F58AC39D538 Tania.Kristin
520,481,241 *352DEE579F96D871BB119B8A63E5981D23C4BD61 021osvaldo
520,481,242 *3521EC853302ED3797BD15220490C6F1D7020A3D TDEFLORATION2
520,481,243 *352EF5B1C1DF6091CB9DA7CC13D8A6872F3D7DD7 tedfingal
520,481,244 *352001794433574E52B35A05425C44529E66D0F7 03271727
520,481,245 *35202C3E4F86A810CA1EF7C443EF98E9949DA6E2 TERUGBUIGING8
520,481,246 *352B4BCBB426539B7B4712E49F9B7E62A62A9C10 TGOCOUGS0
520,481,247 *3527974C9975DEEDA67A64A46DCC9CDC201CF8F1 THEATERBESUCHERS
520,481,248 *35228663C7500D669E729E379F23F03DEB87EAE6 1272415 yhdistyksen j
520,481,249 *352F913D60D94685D76C723C33CA43E60FC48BB0 1330540 PROJEKTIN-TARKOITUKSENA-ON-TAMPEREEN-ALUEELLA-TOIMIA-TY
520,481,250 *35294935832DF5E3FD46CC37EB99000CC39B8016 138584 IT KILLED 320 PEOPLE AND DID MILLIONS IN DAMAGE
520,481,251 *35263E5F50AABBB05BFDF6DBCD1F76575B6339AE thespacecossacks
520,481,252 *352E7A1544F186D59BF94A6A360ED01D083BD18A THORPO10
520,481,253 *352782F98F012DE37E27D40D1B81163C2F45F0C5 1706742 MUTTASILTIENVOIJATKAAT
520,481,254 *352CD9C284E06E4548DA758995C0489A5CF1ADCB thuyloan7
520,481,255 *352E9C6A92DDE034574E8FA4305F4288E1F2F0BD 1854912 uskovankokoel
520,481,256 *352B00F59D3D1FCB3F5534B9D08C0D2D55B22427 1882560 verkkokauppa-tulee-kasvamaan-,-mutta-n
520,481,257 *3523E355DAC4E5D7A5BEB2302AD8C7A6EB0B89CB [email protected]
520,481,258 *3528B9D660106D5019126A673899005E4965BFA4 timperetti
520,481,259 *352F7B1C9036EAA0B8414701A092AB0A37D973DE 1991993F
520,481,260 *3524A3BD858C45809BA051D2C3865FC30D74CA49 1 ARDHIERARCHIE
520,481,261 *352C1761119C79067E33C521251D95B16BB5F9A8 1BELENISTA
520,481,262 *3522F80F30A671BD09F1391BF4FB2EB85A2F16D4 TNAAVIUS8
520,481,263 *352BC9A9479D6D9A78A86DF35CEA35B2D821A4A3 1.dvu-gastspiele
520,481,264 *3527772FCACBDE025CA1E98844A6DC4A54A9028A TOBIASBERGENE
520,481,265 *35222ADFBA025E32A8063FD37FE8BE4A7BDDC77A T|OC
520,481,266 *35259CFFBFAE73FFF0DD1754D332E3A7F48B59E0 tonywallenbrock
520,481,267 *352130111494FF5F7B350EF1F70BDD2D96E8F25F TOSANDO3
520,481,268 *3520CF24EE277822C58570642C1D7E8A9FF29A1B 1GURIASES
520,481,269 *3520CFAED2B9AB83A7C177B150704A61A58CDB6C 1.HEROSTA
520,481,270 *352528C90F823FCAF06F2FE649670373DEA29A90 TRACTORSTUPID4
520,481,271 *35252143477D8215F88A6765D33842B66213BB4F transbaikal9
520,481,272 *352C49B37AB67D56C857E7DE33C188E805A585F1 1KOIRANKORVAISIA
520,481,273 *3524299C755F1D30284988A0CBCEEEC27C0A8E70 1.KOMPRESSIO-PERIAATTEELLA
520,481,274 *352ADF7664DEF130510E9FB5275FA7F70077D659 tremiens
520,481,275 *352BE37520A9DE441C204BA3EB7F64C460CACE48 TRINA.HALLING
520,481,276 *352CDF67709896F39A874B497042C249833F8A91 1NAISLESKET
520,481,277 *3528016DA68AF3622949C4252A0F6884B805931C TRISHA.HERBEST.PETE
520,481,278 *352BF2A21E3B320C4B39FA8A5823C97C7A7548ED troskieuwig5
520,481,279 *352B080921311111A66952BC19186232A1DD043F 1.RETINOIK
520,481,280 *35299D26F29CFF561A06E6A77ED0E7A79739BFA5 1revontuliinfopiste
520,481,281 *35284A6FF2DD903E529E23B006D19B09CCFD2FCB 1RIENZA
520,481,282 *352147FA3D4F5E8A11F2591F0843A746BE2570A8 1-RISTEYS-VAHONKY-L
520,481,283 *352C2443F9E7BBAAABF9B409A2B1673C1919E525 1 ruhrbergbau
520,481,284 *352D0A7E4AC91F0F99CF8E9B1084B08598ADF499 1-SUEDWESTVERBANDS
520,481,285 *352665FDA0C9D4EB2D8F1ECA5AFC459617014FE4 1THATDALLAS6
520,481,286 *352A12965AC3E0A7FBC88A7C563BACE952EA5236 1.VUOROVAIKUT-TEISEN
520,481,287 *352A5AD02BD2C01D497BD0CAC373A7A378DE7387 1 WEIBERSLEUT
520,481,288 *3529FBD333305FD5C79AB26FFE1F993B7F18D341 tyee.baton
520,481,289 *352ADAB7BD58DA0711D8A3A658AFC8F848F78F04 2051349 OPINNOTKOOSTUVATKUUDESTAERILLISEST
520,481,290 *3524CD4581AC445DA1834D5FC7386C9615D8BBCC 2180100 KERROMME-LIS
520,481,291 *3524E0C24628243112BB57B43FC2BAADF3A0046B [email protected]
520,481,292 *352ED8E6D89065AB9A57208763E719CD1EAB95CF 21mar1281
520,481,293 *3529BA0B18218091F49B6B8FAD59194CDED8207D 232MATHIAS
520,481,294 *352B536F864DDAC790CFF9F45906AD9C942BF19A ulf-hĺkan
520,481,295 *3527E8C37DBE135D58FD1052A95B3EDFD57021DB UMEDKARIMOV
520,481,296 *352BB6E83AACBB4ECDDAEF58CC068C30CDCB9964 2587586 vaimennetun revolverin
520,481,297 *35252BC6B9E05E2258FFFB73DACB81A11AF13B75 2595058 ESITYSLISTAN LIITTEEN
520,481,298 *3526AE09925D73348619A1CC319EE2C7B821DD33 2605856 YHTEISKUNTATULKINNAT VAIHTUVAT JA KIRKKO ON SEK
520,481,299 *352B670D1487CCE8E7FCAD882761C319F4312032 262393 ERJA-BITTER-JA-MAIJA-KUKKONEN-PIT
520,481,300 *35279B912E06A12E6C6432D4B33284F5AFC3FAC6 2715888 LAPSILLE.RIITT
520,481,301 *3521DFA344EE24A01B399706C7FA3AEA572B494A 2iluvthelorax9
520,481,302 *35269F368C21683E60A7E320EE69DF65F6D7C238 2NEIBUHR
520,481,303 *352BBE6EA4BD8874462A63A558CED3B0ED2066F9 unexceptionability9
520,481,304 *35208AF303C36462DFD60353E320849A64C886C5 UNMUSICA1
520,481,305 *3520876A117C9027D730209070DF024AC172CC81 30.brandel
520,481,306 *352D16486614B9BED35CD7F25CF7B6EEF84A2F47 30SPORTWETTEN
520,481,307 *3522AF5E01447958B0B8A8DF05151A45C89AC464 33OPISKELUNSA
520,481,308 *35281C7256ACDEEFECE21E55428543EEE1686C07 upgrable4
520,481,309 *352EE223E16B34575D7E7F913F08F7AA6AEF5273 usepkniyogi
520,481,310 *35247BD7520E97CEA2666B93B074107EE3AA61E3 3B<[email protected]
520,481,311 *352C3F4A466F356138E18501785ECDD93434002F utarmer8
520,481,312 *352FDB31BC5DE233D658732DFFD5B56794476482 VADIM.BREDNYA
520,481,313 *35286E7C547E51CEC6F0D72D18FA1CE7136380D1 3-zuegelloser
520,481,314 *35225C30B7425BA0451B4ADD7E222973C01CD9D1 416858 SALES-ROSE-TO-#587-MILLION-FROM-#507-MILLION-.
520,481,315 *35294AA242CAED400E43C26B2D0361EB4D21055A 4BAVETTE
520,481,316 *35210D6BD4E0679B94FE1DB4E9B106747808C67A 4.hoovers
520,481,317 *3528B02713A297ED448A8B52DCDCA1070A4EF8A6 4iampredator6
520,481,318 *352321EA12A732D5C33E0650B272867715E03CBA 4-lavatanssia
520,481,319 *3529F4E4122C7F6FF15B94DB6CA0C9EFC720350C VAUGHAN PIRIE
520,481,320 *35259AB274CE5B919CCB72822B63248B94A28882 4pasgeld
520,481,321 *352C016BD78ED2F7234EB83ABA866EA1C2B4BE58 VELMONCAPANAYAN
520,481,322 *3526CD22D9677ADF2D90AD4A77B2C19340EBFAB3 4shegets
520,481,323 *352CCC6C8EF7D3ABEB9941E2F8E2D5C8E056B02B 4TAFELSPAAT
520,481,324 *352A1D29C3CCAD4B12545AEBD3C2CB990F9A7DC4 4YLERTOWN
520,481,325 *3528ADB538E188E19236716A1B3A3162F78A2CB4 [email protected]
520,481,326 *35268ED4268E533636F956BA67BAA479A309F370 523038 DR--MUSTAFA-UYSAL-,-GUNEY-UNIVERSITESI-DOC-
520,481,327 *3522E5071B30F300FEDB4505AA36BBA41E98EDEA [email protected]#$%^&*()-=
520,481,328 *352ABE4E19071A3DF9B7FA23CCDC1A94EB0126AF 5DENKUITKOMSTE
520,481,329 *3529249B5B2E6703FDC01467EB993B6B9F4B80C8 5DLAREMEBSW
520,481,330 *352A437044CF60AF5BD17B46CBFD72FA5024A069 5ENNERBRE
520,481,331 *352B6F80B67EB2322013730981AE394572E1E896 [email protected]
520,481,332 *352243BDFD0BB82470FD71DE4080A73B48100EBA VIRGIL.KARRO
520,481,333 *352CB1F888DD92DAC449D03292F3DC9A0CD400AF 5GINNPAFBSW
520,481,334 *35256A1F8D596AE79610C42FDDA043D28A376327 VLLYAHOOCOM
520,481,335 *352D85DFCA5314212D7AC942E5DFC7A1C346D80B 5REKENEST
520,481,336 *35229D271D0824E7897E0184DDD3B5E162DFBAE6 VOGLIOMO
520,481,337 *3527102150C92498355F4CE8D1F4982DD1FBD92B VOLVOPEOPLING
520,481,338 *35241E3ADC575ADA6E8E8E50EF6BC9C14CEA8C59 VON.LANDRUS
520,481,339 *3520DF48B376D100BDB234D71C83C386AEB34B99 VOODOOCOKE0
520,481,340 *352D2B9114DCE862D0A07C7B6965E5F31652AAB8 5SOROPTIMIST
520,481,341 *3520A771198698494FC16036A015F2A81C84D9DF 5YJLSKKT7
520,481,342 *35229FFC7E43D3FBB2296F37DD50912318343ABD wademofford
520,481,343 *35279AF378F41A0A1AB5F7C6898E65B3B4A6CFFE wafaaelsahhar
520,481,344 *3528A2F957DE48755174DC4182343274EDF5AD0C 6EMPERYKES
520,481,345 *352E940A7DF20A1F1FA808041EDA63D5856D6B12 6GESTEPPTEM
520,481,346 *352F0B792F049B451BBD74EDE55B9A8D2754F046 WAROFTHESTARS
520,481,347 *352261231C6C326528E2694E2F3B501F278F9E1F WELDONLACHINO
520,481,348 *352E82AD8F163B9B0E55B6138FC1446BA497BC3B [email protected]
520,481,349 *3527E4B309F410071CEEBF0E76A94BAF2E6C6F43 WERNERCURIMAO
520,481,350 *352207B82C2AF63A3035A3DF88104AE251B3E799 WERRELLPEREZ
520,481,351 *352058E2F912C95DE3E7E58C0BF76385573AA6D7 6ULFENITE
520,481,352 *3528761ACC68D353FA7012E893507C6D3A8C4594 6UNCOLUMNED
520,481,353 *352320B2B44ED592850F7CE178504A105C6D7256 6VALERIECHALLENG
520,481,354 *35267254338F5B7465158969340DB90CFE8E875D WGBG0DD
520,481,355 *3523B2A594CEA85C2A3034DF918EF804B9DD9703 whalejaws
520,481,356 *352C6534799956A5AC0F6BD87363B571CAA08A85 wilburguterriez
520,481,357 *352294177F6EBAA72843AF3F7BCB8E90EA620D3F WILD.ANDREW.FENTON
520,481,358 *3525876B422E5D898A063993EA998CBE92D85784 756FREDERICK
520,481,359 *352F9FA80E3666A7A0BC6E020C4208B83DEA078D WILLIAMPAVLOSKY
520,481,360 *352774DC41E0E5483919CF32B4306B26B96DAE3A WILLOW GROSSEN
520,481,361 *35206FDC3CB229313843F4E78947DF19D03233D2 WINDMERE123
520,481,362 *352E1B478E872F98E887C186BF275D698E12C763 [email protected]
520,481,363 *35228E92D50DAD229B919C536393BAC70CAB4D40 WLK01122
520,481,364 *3520AA001A468E4B9D4C3BB352516ADDE69C233B [email protected]
520,481,365 *3524AAADD2FAA9246499B6874CC84507CBFB934A 7DEILLEBR
520,481,366 *352A228F40D47A671D2F28CAFD20EB12A2715906 7DRAGONFLHANSON
520,481,367 *3521CEA80166461D2FA8C3408C36CE02DFD660EE 7ECAEPBSW
520,481,368 *3522209ACF78C68D83A44D83D3C73C8296868178 7FLOCKSFLOCKS
520,481,369 *35240DD913A371C3FCEF897191D25A21064D4AC5 WPG.FOURTWENTY
520,481,370 *35250F8FE53879415231A3084851CE4AD4BF0205 writingiseasyuntilyoubecomeaprofessional
520,481,371 *35274237D17052C7BF48A5A2C0E8AB4632CBFE73 7JUPITERSQUIRT
520,481,372 *3526A3B9B39F49BAD9A69B9BAEEF983BED4D2BC7 7ONDERWIJSCOMMISSIES
520,481,373 *3527046777D676A3E6E21A2125CF9A07AA229FF7 wwwclarioncolliescom
520,481,374 *352FAB144DD2DEB7760464CB41547F15D70A2B7E WWW.EASTAFRITAC.ORG
520,481,375 *352677FA6B27EB04C783D710E591391DD97EF2AF wwwshcssaeduau
520,481,376 *352E2EB4B37077721A28B13E8D9560838099E497 7SELATMO
520,481,377 *3529334C76874E7DED0673D60F2C3857B591DD5A X57038
520,481,378 *352B5214DCAFC3D22D41F6B8BE564D9E3760A43B xändan
520,481,379 *35235EE141D055A29BFCC908D32120CA20207DA7 xavierkienzle
520,481,380 *3524F15EC84BBB9294BD832EDCD0C51CB392AC34 XIMEDAVILA
520,481,381 *352C01A7760909FDB24670F163939F380F6F74BD [email protected]
520,481,382 *352B2163A987D9415E9817BDA681AD16F96E3116 xixlagatasexyxix
520,481,383 *352651E3DA2C944F4F71D55617D5414436A79713 XWJ42AJ
520,481,384 *352C141EBD8DDEE356D430A681A96DB3D7233F75 XWPNSQUBB5SCSWPJ08JLDG
520,481,385 *3529C4DAA3AC461DA31BBD508A6A7FBC8AFD682A [email protected]
520,481,386 *352D632CA28B0EC6C5C64B7C1462A8B239493379 [email protected]
520,481,387 *3527016DF57AEB49AE527400CFBAE2FCC8D9E900 YCHHIM
520,481,388 *35246C73D5080C2C0AADA20F55B02EE38BC37C4C YEWANDE-ADENIYI
520,481,389 *3528A1AEE255EFB8830E64E49D22BA5351B36C07 [email protected]&
520,481,390 *3522AC66F46318D51C0E8B190A9E93AAF1E6E9D9 YHPARGOROULFED
520,481,391 *352430A504C959A07A656F166D3F5A99B9ED93C9 [email protected]
520,481,392 *35220CB566F223663165039E17CFF8358396DF16 yong-chui-ling
520,481,393 *352F629A7C82A1B5B36CADBDA1EAE5A863F3D863 YOUTHERE,WITHTHEHARDON
520,481,394 *352371437ED07BFDE0849FF8CD28D5CE8E015448 ZANDRIKOCH
520,481,395 *352D0E57BC3C867561DE43EA6B7612CF0E420A77 zaskert
520,481,396 *352DD44F69FC6344890B96A6C3C5D68BAD4F40BA ZEENOOS
520,481,397 *352296032C24090DF7C11C226EC10950DF124908 86528 ISte Onemli bir deGiSiklik
520,481,398 *352F5F0624C7F5EBA9B59649F83C13C1CAD9F5A4 86M30CM
520,481,399 *3525D0E91EBE07B342166F3BE1B2A3977F5CEE80 8------B.~O.SPLAT
520,481,400 *35285698B806C2CA0A1A0BAA3178D6C4BEA4A55F [email protected]
520,481,401 *3525A98A8C7004B982547C784488ED4C2B6335EE 8GENNEMFRELSE
520,481,402 *352BA56933C4B5A3032B484EF90DDC2C0E3FD7A3 8HOOTIESOPHIE
520,481,403 *352EF0781FFE6D2F6E73A3A1DE0FABC4797D918B ZSGJZVQC
520,481,404 *352BDE0F49D488A6499D64D373E1511DC8E27F58 8LDZPLDZP
520,481,405 *35210A54836FC3BB2EED282D78C24FF78AA8F611 8NONRECTANGULARITY
520,481,406 *352E3081E5942DADF0EA1E50D019BC8584DFE443 ΘΕΩΡΗΤΙΚΟΠΟΊΗΣΗΣ”
520,481,407 *3523AAFFC016F638F6C43A1BE0A91CE5FB949436 ΠΟΛΥΦΥΛΕΤΙΚΟΣ
520,481,408 *352EE1C85B417075491DE48C7665AE48DE6B6108 АЛКИЛИРОВАНИИ
520,481,409 *352BA9AD890F302226D4FEC6F49A372AFD46104A 907.STEREOTYPES
520,481,410 *3526D11C926D41573C50B419D08087F9B0C31C8F 990447 SAYS-PRESIDENT-ARIAS-:-"-WHY-DON'T-YOU-QUOTE-ME-ON-THIS-?
520,481,411 *352AA647B9ADA8F1463907DD5D5C4FB2A9DF5436 9ABSENDET
520,481,412 *3525F8A9CEB7E7D5FCC1AB2C2AC1514835FDD3D6 ДОТУЛЯВСЯ
520,481,413 *3524509D39C37841B018D1A21BC1BE63B5AE2D43 9DOTATOBSW
520,481,414 *3520288FFBEC8B42A9A78E92E1B5F9C99F0740E5 9ENTSCHLOSSERS
520,481,415 *3521CE5FB43D3C8B361B09CDA0EF79F06C5FF8E2 9GIZYUTSU
520,481,416 *35264C1006580FD432C2163C6B76984D96A924E2 9INTERPLEDGEDT
520,481,417 *352DEA64241625A7145F79832168AB993E1B3D2F 9KOOLKIN
520,481,418 *352CE83E03B9ABEF4457EBA0CFA90758FD01076F 9MAAILMANHALLI
520,481,419 *35225C2D76D078597C7BEF0EF5778FAFF0FFBA3E 9MOZGALOMBAN
520,481,420 *352DE221BFE1DDCFBBFD7B5A9D5C3C63DBF2F7A4 остина́то
520,481,421 *352A0791CC2FC409A9D39FDD58ED767F3B56C2B0 9SCHOBBENS
520,481,422 *35275C38F143775FB70AE35C792E0CC4088F0064 9SUPERCONFORMITIES
520,481,423 *352EE953EA1E1EFD1ADF7B667F3228CD783E2C7F привада
520,481,424 *3523E3F145EE058311310658B1EC9B896298A1A4  поклитаром
520,481,425 *35245FB3DAE245A9C788107186520502BCD94C69 a49u%
520,481,426 *3525A3A8F444B54FB22EA49A32F99ED0F95EF318 aangekregenen
520,481,427 *352AAC3A7958201ADE442CD61C7CFBDEDF1AB9FA absolutjazz
520,481,428 *352296542495866DD9D513691CE816887F0ECEEC adf|x
520,481,429 *352B8D95D044354030A0B75654F1F9955AAE2527 [email protected]
520,481,430 *352C937959C0EEA93F686503B86D4F142E930989 02201659
520,481,431 *352DEA7A3EFF61260D617D3C98FD863FFBA40C4D A.HABIT.WORTH.FORMING
520,481,432 *35284F305C7A3FD6724F5641278CA3039A769CC7 aiqpu
520,481,433 *35262C7B834657D9F626F8E65866B72D2E161472 ALEKSANDAR.BRATKOVIC
520,481,434 *3522DB7414578D8886C737C0F7585A5BA1BF6EAD 14APRIL1534
520,481,435 *352A6A8349F3A72FF6409AC8BC6B3277C354CAC6 1531659 PROJEKTIN.HOPEISENA.LANKANA.OLI.SE.,.ETT
520,481,436 *352A165E20DA334B39B4BE71A66087E9BEE02D32 ali-akkari
520,481,437 *352D1511BA245DDA23048F7DB317CBF74A0BDF10 ALIMRASHEED
520,481,438 *35279AFF23087985C7C1EC1B01014B061EC7B2D1 alizakarim
520,481,439 *352B66EC02B2D38F178F891DA28FE6F3F2C40AA8 alleging
520,481,440 *35262D784545399E208AC5BBBDCA6E15027CCC22 ALLTIMELOW'S
520,481,441 *352AC0A7C356194F9DF8B05D6AA10A3CE0E3448E alvarospan
520,481,442 *35297A9717E53E83691BD8F9BF0D4259FD622BE6 ALVIN.BOULDING
520,481,443 *35293A9657898CA9D051E6005571A321D3B9A839 AMAJIDULLA
520,481,444 *352F001F127FC38DD78534225EC8D0DF451E06F5 ANDROID7
520,481,445 *35289C325040CA9BC9AB336EF2AB7FAF5077833C ANGEL.ALMUETE
520,481,446 *352F2014B09D73FDA0BA7A6A135547EBCF460412 1998-07-05:-eurock
520,481,447 *352DD4A7229957A1C333E27922105DF07EEC1230 anl,l
520,481,448 *352CD83775AA1D7BE4D673E81D8F1BEFEC4CA540 antimasquer1
520,481,449 *35243B3F1E4D22AF1691A1E135FB628FDE63EAD6 AOC
520,481,450 *35256DF03A0581F2E89493D3D860F58EC6AC0A67 a-omt
520,481,451 *35278DBACB5C315E810ED5A75815CD1CA0DE0CB8 1FOUNTE
520,481,452 *35202617C359270A6994E29D936191FD39E7953B [email protected]
520,481,453 *35256420398BA446FB5B3E42AF7D0143D9E993E1 apragyaahs
520,481,454 *352715006F3066E57E9A0F4A89956EA2850E96D2 1GELHAR
520,481,455 *352FA1625FFAF292183257FCE163C3A488A9C717 archiepolaris
520,481,456 *35217305B2C0F9BC6494E62155FA4D222035541F ARIELANTINORE
520,481,457 *352A16B215BA6767E8594A3D9C78808B48B4DE50 1.materialtechnologie
520,481,458 *352F75F49AE68B385E1DA6210B946BD357F8B5FC 1Q2W31744
520,481,459 *3524A278B8D313EC3DE0CC1F8E1144EBD0F32D64 1rantatonttikauppojen
520,481,460 *352D2BDDC9090023CB1F7E70A6195CAEAEB91461 1 RUECKNAHMESERVICE
520,481,461 *3527EE7E75BEB538AFC23B18E82CB5A9E3BEEE66 1.SAALBAURAEUME
520,481,462 *3523B994B7FF14FB8747190147AA5E6330C2D2C1 1savipakkaus
520,481,463 *352D4CD0C01D4BABE7DDBBAE2083D4682724AA5D 1-schneider-jueptner
520,481,464 *3527C913D0E37AF8F65C4F0D6572A6423629FFCC ASABR
520,481,465 *35208C225FE2507FA49E54CED8EC629DB5C657FC ASSOMMEREZ1234
520,481,466 *3528DA387783067FF757C43257D1F7C5A3040841 1STRZEZE
520,481,467 *352C6DA2FECFEE65FDB83073AFF70F728061FE3F asw_h
520,481,468 *3527D4362E2FF6F5F429FC11D5B291C0949DC803 1varal
520,481,469 *35268715BC955D21434E3F0E7C9634F9753EBCEF 1 yoger
520,481,470 *352D476C4C279BFB33EA9186C41322FB5A3B4325 avaitset0
520,481,471 *35221C8B867F1EC0C3578376022321154FB5A1B2 20WALCOURT
520,481,472 *352322244299DF6C702CAF826B1F3EF1BF117AA5 2423122 AUKEAVAN-IKKUNAN-YLEIST
520,481,473 *3522FCAAC3AF83B38FCABD82F08CA31E08128ED6 axsb-
520,481,474 *352033D3878458F6C15EB333CBCC0FEEC31C3A8D AYHK
520,481,475 *352A1DCF9E2A10A2BBACE26FB6CFB01B12216528 2ATATTEFI
520,481,476 *352D53673D0C95B988298D4C6CB66CA727247D65 2fdexterity
520,481,477 *352F93ABD49130949D852F499CE213A968D66C6C 2mannsarde
520,481,478 *3522F39C7DE7406F74028C38D33745B8B57961EC 2mar1691
520,481,479 *3524294C36D89892E9C9B210AFD6F68C581E3CDB 2 usinstitution
520,481,480 *352DC0F8E7E2D50FE08CAE541844D672FC4ED3EA 301QA
520,481,481 *3527C7DB2BC7A16D589C10FF35382F8C1FDB2599 30JAN1703
520,481,482 *35287A865046E3E4981F216B65E0028AF4EB1BE6 babybb
520,481,483 *352C362D68978918AEEA109C383DA9689CA19ABB 3B<o~O~ (######8
520,481,484 *3529684188BD3A21B2FB5FE62FA301D3210A2D00 [email protected]
520,481,485 *352FA17FCF4D773CB43A085B513F617F0576E201 3d16000812
520,481,486 *352B823FD94F476EB4856C7C5D26047DA389F114 3MYHAMID3
520,481,487 *3529E8DFC954F85A6BDC9E15EEF1A4DE7D692464 bartprinn
520,481,488 *352F88CA57B8A0BCD83F8B070D170E057A20C8C7 3 palvelulis
520,481,489 *3524523C8C8B5D173A2B4BEDE70223BDC584C9F3 battipali3
520,481,490 *352ED3CF58F064020CA1AC42DB63C0FD8B101106 [email protected]
520,481,491 *3527063D592BF2C1F10AFFCCDD909A810DA0ED84 BAUDENKMÄLERN
520,481,492 *3520B8BB040361EDF1A851C0F5BB23528CE39B09 [email protected]
520,481,493 *352089B2EB575A75B51CDEBA9F2F0F7170615A98 4KLEDENA
520,481,494 *3529D5C4FE713BB65AC65F1AF1BEF1F28A5C3474 b,emr
520,481,495 *35207AFD67164F4C6F699AC114DDCFD94A298D02 4SCOOBYPASSWOR
520,481,496 *35230B5871342B45366B3DB2E8192B45E87963C3 4TNEMENIW
520,481,497 *35274CD64742CA999307A61033385FCB43B90568 4TSETSEESTEST
520,481,498 *352BF963F6E69116184B81B72B7055724106DD80 578617 KAUNISP
520,481,499 *3522BB9C4F532995254D5E04BA081791D6F4A58D 58wychext
520,481,500 *352AFEE4FC72F8D2FF436F19D2E4FD6D7DED729A 5-bjr
520,481,501 *35231CCE6994AC8504126CC1EA1F312D0DE525F8 5CARMENONE
520,481,502 *352D7EA5A97BD9068276140B05CFCB04B06E6124 5EDELGASK
520,481,503 *3523647280FF874F5D9DB52928FCA98C9A7B80C2 BERNARD.WAVE
520,481,504 *3524A071AFF44319564ABBDFE3BBE0CF94A91B15 5ERTEMOILEH
520,481,505 *352997D81E86264365C041A8EDEF939843EB571D 5 GEWISSENLOS
520,481,506 *352248C16A1EAA426A27CF1714207F7F7ECD394A 5INVOERDERSES
520,481,507 *35297A8CAE4A1B937D3B3B7AB97B40AB29F6A5B0 BEYINCIK8
520,481,508 *3529EFA4A5AFD7EF28584AB308744BA02FCFFE48 5.semi-enclosed
520,481,509 *3523F986E9CE307C4370B5EC97BF7372C626D518 5subdenomination
520,481,510 *352DC1B286D5D6A57D8B7C27A845C6894C724207 bgulb
520,481,511 *352AD35D0ACAEBA9191F18550A87E64046D25E7A BIJAY RAM
520,481,512 *352E9D31D37E63219A03D629432A99643E9E4E2C BILLWENNERSTEN
520,481,513 *3528CCCCAAACA8AD3A34D93AF67AE9376DB05FA3 BILLYABC
520,481,514 *3522B373578D9CBF62251C3E9EA9340453D296AF B)N
520,481,515 *35274E3FCA0BB5446BF6162832A8618342C2A51A 6ILLUSTRARED
520,481,516 *35251EF876F400982F9D6A3BEEA509464BE924C9 6INSPECCYOUN
520,481,517 *352518D6BFE02C7756D89D4E7B19D87F2C818C36 bnqf7
520,481,518 *352627B42985D50F66B4FFA898E21830D2B5E027 6NEKEKEGG
520,481,519 *3526237CC526024C266E795D0E9B474DE9053E2A 6NETPMODE
520,481,520 *352BDE1EEC08BB20CF58D1B979A5EC2CBC06687D bob.look
520,481,521 *3528E613559F0E2DF197C5D8CC288D8DF203AA8B box-1991-2008-(disc-1:-kent)
520,481,522 *352B88FBC80A3585F6A56F26600F239A399A957F BRADREDIG
520,481,523 *352A8F8F0FD366AC212603A07E5AF116355D8D5B [email protected]
520,481,524 *3525AC8FFA0AD2BB65CDEC8F7228484835EE5766 BRENDONMORGUSON
520,481,525 *35298DB6BAB1251FDAA42736C33929C44DBDC16A BRENTON.PALAIA
520,481,526 *352B7E9BA727B37B907982957E0BAFF3B2BE7752 brettglascott
520,481,527 *3524C2B674350FA9E86EEBDA58E540CF83A736F0 7DEGIDTS
520,481,528 *3524A01228D489BD143AB725803BEF899060C03A 7GARYTURTLE
520,481,529 *352447B9BE2FA8E0FB7A30137B6ED1BFC2B17C12 7GRDJNKRD
520,481,530 *3521E6F9AC31A29BBDE3B8C0A37BB161873C3301 bryan-bernas
520,481,531 *352CF5C0E6A6A31FEF870E169762675BFBD4DCDD BSKJ
520,481,532 *352FEB47D784FACAD0819A4D158C6C5641942026 bswporradabsw
520,481,533 *35265A8051E28E033AD715B87DE5743D6649DCE0 BSWSARGAMBSW
520,481,534 *352ECAE65820DCE524F44CB53C7D89839F022102 7MARSBIOLOGY
520,481,535 *3527B34DE664BFC735E5874A738C64F58EA11B4C 7MORTIMERJAGUAR
520,481,536 *3529D587B985C7FB8FA76C42BAA64224C7758C32 BtjU
520,481,537 *352B0DCC6273151D8E3043910895593F1FF47574 BT,XK
520,481,538 *35226006E3DCD43A23B0145541065DAEA4189781 7-SCHWULEM
520,481,539 *352B5EA9DA6B4F45CE3FB557F5656932B73412F9 bul,k
520,481,540 *3522A065CCF0F20A447F77C8186628A2D4C33EAC BUTCHGRAYS
520,481,541 *352E254779F6259828137E94FD7CFE29FA605A05 7UCNOETSO
520,481,542 *352788189615FC95B22C8B2DD951A12E9C3DD623 butr/
520,481,543 *3520FBB4BB2B9863F259F1D865BD446EC543C8C5 C02H
520,481,544 *352C2FFFF1D3715FCF66A75F58CF1C51724DBF59 8=d~0.)x(
520,481,545 *352CA58165EE881D5F8D6F4EEF809659EA2656FF [email protected]+3g0r1z3
520,481,546 *352DBCFDD22405722F8C40944C431DA9CE341C83 8HAZELFOUNTAIN
520,481,547 *352BD799E764C8339D2D40D80C36324CF9EF525A c5"$3
520,481,548 *35221E1D67E59D13B08730ED0017574E34A36980 c)636
520,481,549 *352988A5E4F5951C004975F806D40E24ACED1C28 C7%MR
520,481,550 *352C7543625B434BBD252EC93862AFF8EA8EE1C7 CAMRYN938
520,481,551 *3527529F23B3FADF4E359043E6B8F4A274D8879B 8MCDONALDSIN
520,481,552 *3523B8167573294978AE3E2AA29A38A4EF5DAF78 8mytreasure1
520,481,553 *35285238F839197492E3FB49BF0A991D2160BB8C 8======p-~0~o-(x)
520,481,554 *352CC7A1BF958FDB31B8E9E92750ABEE07C95F68 [email protected]
520,481,555 *352F00817A7F4BE1BA450B9DD4AB3189C82F8185 cb9h#
520,481,556 *35202D88305D95818395B8F2402F89E042A71F97 CD6GS
520,481,557 *3521B1551565D8304CCFB4EDD9E4C284712CECAB C$EE
520,481,558 *352F10B21A57D25B665F58604145F6F8038CC160 cglhj
520,481,559 *352DB02F443C4861D8EC34587748557166084CB2 9BSWAUTOMOTORES
520,481,560 *35259B31D1CD9FCC0874AC37C815FFFBD08ED130 9BSWHORUNITSPERINCHBSW
520,481,561 *352F9523540FF3482B6DFE5CB9EE4C657689D0D1 CHARAKTERSCHWAECHEN
520,481,562 *352AFB362FB252518C4CB7912E8678A19F2BAEF4 CHAUNCEYANDRACKI
520,481,563 *3525CD500F056D1527738C6879735204EDD8BED2 9LEXIBOT
520,481,564 *352D706BAB28DDBECED58E293D1B350DC4EEF5ED 9LUIKSCH
520,481,565 *35282397B64470158443E8B09FE3DB18F771FF13 [email protected]
520,481,566 *352FEA0D5D29EE573FE518F96B817BCDB9C4DF91 [email protected]
520,481,567 *35274FFDE1B6C48E103B7B396FFAF9837A406A3C 9MYSCHEUYS
520,481,568 *352676282135C7C68E080E9553C38A29624D9C02 chevis12
520,481,569 *352467018C01C411712F781D8161EC3149FA451E chris13
520,481,570 *3526028CBD252C6EDE11D33423D619787CCE44C7 9THATFLASH0
520,481,571 *35243325F30A7135C2833DDC839F74BBAE414702 cj7#
520,481,572 *352469FB358DFE6B012C34DAD7712DBCD530DD63 )`A
520,481,573 *3524379F8292CECBD6F51211B24593B5CCA2DF37 a:4o!
520,481,574 *35231FE7DC263B10340CE1B2C0BA7770F788C36A A5T8H
520,481,575 *352C8CFDCCD893C873CF3E99CB2AB73DD64B6A61 CLOCK.EXE
520,481,576 *352EA767DB2F72640E449FB7AF4C3197C438C9A6 A7&MU
520,481,577 *3526722423BAAB18DCF890E8C8CB6D9782C7B389 CM(M%
520,481,578 *352F34BCA27523DF12DE1790D2F40C4668D45910 cn3=r
520,481,579 *3524B27C399A42FBE5E2D5A0A1E4B16C3CB29F7F aakkirot7
520,481,580 *3528A4D61077D110F23AFEB9586A923F956D8ECA corneliusmanthei
520,481,581 *3528FC3CCE91ACC320BC69F170724B2899D29DAD CORPORALCLEGG
520,481,582 *35227F3B526FA3807BD18A94E6B3416200544FC0 COURTYARDED
520,481,583 *3528D919554EC7E2958AB92088DFFC558640DF9A ADDISON.MCCOY
520,481,584 *352FA536322FFEF320641761B1805453F82BC7A0 addu.s.a.
520,481,585 *35260FACF7C3612A8126953CD35ECECC5C2ED59C ADPOSTER
520,481,586 *352868617C7AFC9B1E89EABDD3A22E398897CA06 CRKLA
520,481,587 *3527CA478B6D576A61C6DFF2F5B90F4F14A72AED ahanging10
520,481,588 *3525023C7B7A65BAE422FB7B78205CF84551DA76 C_UA
520,481,589 *352E2DAA42D0EFA64EC6DDA1C7C39A063B671259 [email protected]
520,481,590 *352E6519BF36C51DF7DD5F6042C4E6B72817BADC ゲームセンターcx大百科
520,481,591 *3527E53B8BB975F5530F6C97ED9A88792AB473E0 D8(!B
520,481,592 *35298A090B0CF3F3189B8476D376133446CC03CC d)a.j
520,481,593 *352BB83AB7CBC635ED5D450B84BD24419647D7F3 dalera
520,481,594 *35267D1944DD10F44EE260F1A220B4F031D0334A DANILO.ROWSELL
520,481,595 *3522EB16AA6F1A08BA02C28C4AF04337B275ED5D al.verte.as
520,481,596 *352A3BC3180BD0BB11664F87DBBB9DF18A8784E9 amadocurzi
520,481,597 *3526AD2443520DF1473BBE48C1F38A4A431D8922 DARENALLENDER
520,481,598 *352C49108A6BF78C9B39E1D9431F1816CBAA861A DARIUS.SCHEUER
520,481,599 *3526D4A5C0E1A947EA713037A1AE3378A814E5FC darrellstrawther
520,481,600 *352D6E97E09AC4C86BAFB0B504CCC17B36D13737 DARWIN.STADER
520,481,601 *352AD4972D87D01419B199051850B1A8B786AF2C AMOS.PEBWORTH
520,481,602 *3521F3DC1B31590FED63780BA64D634975449206 amow5
520,481,603 *35207C6BBE8F8B9ADB1203460A04FF51121B808D DATE-STAMPING
520,481,604 *35231F289F9182954693128B2CC7C6B35FFF5D09 [email protected]
520,481,605 *35251C505F2B0478496ABE9EF8B9F4FBD33568C3 DAVID.DINGMAN
520,481,606 *35248153135C43BA1ECC1DBF47805572EC604AF2 DEBBARGER
520,481,607 *35273BE4FA6073871175DBCE3FC07757A5EB0DA2 DEBUTCH
520,481,608 *3527E21C79E2DCE21AAEDBA26F976118329BAEE1 ANGOULVANTANGLIQUE
520,481,609 *352BA5F47D40E768F61ADAA6FE9306B11901179D ANGREUJT
520,481,610 *352FFCD5CD405B48F57DD1D7F75B692029FF623F DEH;9
520,481,611 *3525C57D2A6D99D6515372AFA44E22D3D23633DD annetweedie
520,481,612 *352F3B5C773FF05251AB945AB3E8FECA4E5A0F22 denaturalised1
520,481,613 *352C8C451219547EAA2C451B85C186FA268A5824 DENIAGUS
520,481,614 *352EC45D9BD3846068C31DB5A58D75428895D10E DEPASSER6
520,481,615 *352D6EADEC23A65D6755F1AD92643CCF3814527D antondiersen
520,481,616 *352BEC0ED16F121DA7700EE45D4C07C9E4978703 ANTONIACORTE
520,481,617 *352EF412072FE27A70982284BE93EC93AC7F34C5 ANTWANYEROPOLI
520,481,618 *352E8A5A790DE0D406518C15C75824A4009BA538 AOC
520,481,619 *3523CD2C0367E70800B43B9F38789E6570AC68C1 dfk&d
520,481,620 *35212CA72DC81E24CDB833BFDB0AE21C88FC6517 [email protected]
520,481,621 *352F74C9C2C132567FF271BB36813EDB0560DDF2 DNN91
520,481,622 *3528C71EACB68D30C051C6A66017733974742214 DOMINIC.MOMSEN
520,481,623 *35266319F434F8502A89F6B930311FE9F25B6642 domislijo
520,481,624 *352B0ECB05091412C7F6701454880AB6986C7D15 DOROPERING
520,481,625 *352B380ADE7C57CCFEA52C02F6759DA3358A4BB1 as/t
520,481,626 *35234A4EE8D2D53E61A5FA47D6A150871B41C1C0 ASVLR
520,481,627 *3520F3A34AC4FD9E2E2EB7E7EF6CF48A862A8FF6 au78&
520,481,628 *3520F6B72670794C6DDBF88520380CA763243CC7 drBlaster
520,481,629 *35299064B561CD612B57C75F40BDC8816C7BB6E0 a-ul
520,481,630 *35266605C6A668A1FE95D96612DE0A03C1891959 DUBELLAY9
520,481,631 *3522F70B5F178CFA26A1625043074F183FF2C05C [email protected]
520,481,632 *352AAD6D0B70020E30E2F7071CB19892DED301A8 DUSTYLADDIE
520,481,633 *35257AC86D62316D5327D9E0F907ABE68C993A8C AYa2
520,481,634 *352504A72A546C999D552DA36718CC41B20185CB d/z&
520,481,635 *35210A978EC4F3CCEE637A52CB10AEAFE603E89A eba1g
520,481,636 *35279E3056E1A16DBA9FF7928CCB057F659BA023 b79k0
520,481,637 *352C8D87B1640A00051E44332DD8666D4039E8A1 B8Vh
520,481,638 *35276EF7DC10DB4E67C11943D2904FD8A3D481A9 BACK TO WHERE I STARTED
520,481,639 *3520374E4F484560EC2AF73A8F4A622BC436E543 EGEF
520,481,640 *352212DEC565EDBECDA533B841885CABC20E6294 basketballbackonthebox
520,481,641 *352016373D13AC08A800CDC53853C5338BF2CA08 ELEJAYA
520,481,642 *352C7E6643ECD3719B962F936908B488D60862E2 ELIZAVIETA
520,481,643 *35290E4A69AC7040809452855EE176E8B2FAEE57 bcjgw
520,481,644 *352F0B4D36FB12D8F3D35A0BF002173C3F1D84D1 EMANUEL.GRAISE
520,481,645 *352673D9161B550E41AD58BD9C872B9B7FB186D5 BEAVISHEAD
520,481,646 *352AFE2A38848EDBEA20319A1E6EAF5E56F290E1 emilear7
520,481,647 *352EE258907AF76A2429E50CA3E3DA03A4C7491E bennyownby
520,481,648 *352EFD1C8CC5A93356A03D89E0BD9FCDB779F9D8 enclavest6
520,481,649 *352C43A6B50178CC2087BA48DB838AB5F56F3844 ENCOMPA55MENT
520,481,650 *3524408F934437DE55F93337D03998B3AC962A1D ENGROSSOED
520,481,651 *35242EE7558823B577082556E86E59BD2AF68F51 BEVERLY561
520,481,652 *352BDBDBED1F66AF56A61657DBB4F024C568DBAF B/FHA
520,481,653 *352AA04D0B3E6D50242EF8A7B166FF93B5DB0E4C EQH(
520,481,654 *3527EB064AAC38E331B7D9FA456AFC6E3151D871 ERASMOMARANAN
520,481,655 *35257FFD207CD30FE9BF64FF436BA48836E7E5C2 BHOWARTH
520,481,656 *352DE0FF722FC39238FAA8893C7D0EA63D66D1F0 ERFÜUUNG
520,481,657 *352A780AD5359F55044813E837BA7EB26C80DF47 ERNEST.GRESHAM
520,481,658 *352F30D8381884E9EFA7E9D56C3DF94A350E22E1 ERNIE.OPARA
520,481,659 *35257863AA36DDA32D3964FBE4C10C886C2A2F0F BILL.VAISSIERE
520,481,660 *352EFB5D9579F3AE0CBDBE1DE94D4497E357F3BE bip%l
520,481,661 *352E5AE99310E844E2641C5CAB5F938C2A42BCAA etnusniz8
520,481,662 *35222B1039DE61D97E6EEBDF1EC260BE51477DEE EUGENE.DIEC
520,481,663 *3529C174C1ECF57400C140185130552443D43D28 EUROPE.HALIBUTT
520,481,664 *352A3EB97A4B21D53791966EAF9D0950909F09BF evidentnobuddy
520,481,665 *352813381336E4718496D1D23767C2E6BF0E49BD EYP!#
520,481,666 *3528753F2F6575C5C5812063DAA1B60F63A05096 F9VFJRH
520,481,667 *352FA20C0B08C8593D7FD50863B8F4F9B44487FF BOBCW
520,481,668 *35243E5228D3296B1A4EE1B5D3E138B8420D45B6 *feisty*
520,481,669 *3522C07E6CD0686A5550383746A7EE9EF88830CF FELTONHAGENBROK
520,481,670 *352B77B4037B6BACD5BAA283263E10EBC7137D6A FELTON.PRUS
520,481,671 *3529DB6AAA7F6D1694433DE4E740962263ACE7F7 FESTIFALLERLE
520,481,672 *35220D07C0238546F8B5992FD68BA2C0B2F588F4 FETTERE
520,481,673 *352D7815038C3BA92B3CB76072961E003A60735C B$p#
520,481,674 *3527934B6F9EA6C2D6402C7F4BB30CE3871ADC2B BPZF6
520,481,675 *3528966188B38E1084861EC7E554999E7A149009 ˈFLEɪVƏ
520,481,676 *352EE3B8B2C98AA6C2F4B80C28E6222C2AC7398F FOREGOINGGED
520,481,677 *35223AEBFEE201A2E582DBD9106C1C8FDE924ADC fP0
520,481,678 *3528EA778B88B41408609F9F9CD75EF60DACB80A BRETT.ARLINGTON
520,481,679 *352E88C50CB0AFC12387689B46BF508D32CCF919 britisch-nordamerikanische
520,481,680 *3521B8AA8E443EBA79BFF355A03C7E983248B526 B-R;N
520,481,681 *35269428369FF305928DD718CDF055B44D51584D FRICANDEL0
520,481,682 *352F49EAE358BE1E6BF8BDB377A9EC8BA06472F5 Funk.Soul.Ska
520,481,683 *352DC482230147C7FCE20720B49B79026A7AAD3B bu16410400
520,481,684 *352B7BF92F512A4529FC0B4FD55B1C9D65668E1D [email protected]
520,481,685 *352F1E945B734BE1FA3BDAA3907121F21F69DE2E galeningersol
520,481,686 *3528797D9EE38EC13DF3BFD19E928502F88CC64D GALENMAAHS
520,481,687 *35258E88E929703DF3313C43C67D00FA3A4DB299 But-if-u--don't
520,481,688 *352B4C00AA98D5F999B119093D3EDCDA28D5A31F GARRETTGAINES
520,481,689 *35238C49CBC61170309D4877C2A57EA3057A06E2 gatordarwin
520,481,690 *3524EE1F27B5A7810FDF690701F29C2838C3A674 GBJX
520,481,691 *352AE9A4C4D180FCACA1A021985FB0CB1D4A4A66 gegenstandsbereichs
520,481,692 *3527534C3DB30C1A8FA1928279E7AF153C3EA208 BZh
520,481,693 *3527DD94D82B9DB5CB1A7F96015EC88E7649195A C0$
520,481,694 *352CC52AFBA25A78C0AF22D30DE0289C31BB3E5A c0;sf
520,481,695 *3527997FD8D6A43C1E0215F8D054DD1AFFFD77DC c1o&
520,481,696 *352605CB401CC839AC5524E20C41DF0AD2D5313D c80890bd2ac71cdf6f17357d2dfef5d1bunshinnojutsu
520,481,697 *352333F60F55B6E1327304AE0592B1020D84B792 c%8vg
520,481,698 *3527FCEC283D7DE669BB73F28EFBE3233278D932 [email protected]
520,481,699 *352B55D66A35615159B3F43174D0FC7E274A0B21 [email protected]
520,481,700 *352B264ED27BB88B0A382DE01A40987D30DF0E62 GRAHAM.TRIARSI
520,481,701 *35250A53A1AE5ECAF930718A9186E23A6DF2CF45 greedy?
520,481,702 *352AE9113F1CFF05437E093EDE77C320D53CE0B8 CASEYNATALELLO
520,481,703 *352FF09B608A68C3C404395A676F033E65A87E8B GROOMLING123
520,481,704 *352583C77589E7F862F03640DB32309C2CFF079B GROUP.1IT
520,481,705 *3528B13FE453B787F781C15745867895BCADB1B8 cbu6d
520,481,706 *35229035C5BD527CA058D4F4FC8900D1F27E01CE H1AMBURG
520,481,707 *35224578BBB3D1E950E604A3904EF15098C1367A CELEBRATION.2000
520,481,708 *35260FAEE78841775D7D0C4CC5552BB463A22EEF CH0QX
520,481,709 *3520D11450B46B0FE9E3E638C7F16B94CC94EA9A HANS-RAJ-HANS
520,481,710 *35225B989826BDCFF675F4AE51CD481D1D861476 harriet.harrington
520,481,711 *35239EC490756756542F4908D84F94344117E8DA hauptgesch
520,481,712 *352045B87A46E80FD21AB5A4C8BF1BE47012C7AA helenbillings
520,481,713 *35276F4BFB8A5556454D149C5BCA7A03622BD48A HERECHRISLAWSON160T
520,481,714 *3526D2E48278EFBF61F365CF50DD5E61F4829ADD chested1
520,481,715 *3525D7D801882A4AFCD333CE4B4EE4409EC21358 hernastydaughter
520,481,716 *35223B42EBB97F34DAB4E15DC9D06C740C58CD77 CHIw
520,481,717 *35270D40A4B84F23285250AABEED0A454777D047 CHRISKA-GARCIA
520,481,718 *352914CBBA02B50842E6B9AC1D3A8740CE0145C5 CHRISSCHEER
520,481,719 *3524F2435933E9CD4A7A7FFED31759B2BDD1708D «HOPE»
520,481,720 *3528A5CF7D0D2FD72DA2BA6E15C11C0A29BF4C54 hot.pants.party
520,481,721 *35234CAF60A9267B8910D9E07ECF85F110782770 CLEMENTE.FORLIVIO
520,481,722 *3524C739B7B1312871ACD7F060052D56E2F5CAF0 HTTPDOFUSWIKIACOM
520,481,723 *352EFDC3881BFB5AC32A89A929469DFF4CBAA0DA httpwwwmoretonbayq
520,481,724 *352031C04D5EFC8AB50904C0DF36B87881000B20 htukaha8
520,481,725 *35238CA4FB4991CFABB3EF4BDA07E5DDEB007235 CLIFFDELUCCA
520,481,726 *3525D5C16B2E72DFD484409A63ACFC54E7E5F1F8 cliffordkanemoto
520,481,727 *3527729668EF2561C9DB64FF6350FE6AAF727923 cliftondore
520,481,728 *352607EB04087619B6BFFF3EEC2C1F77FF0BEE93 C$LMV
520,481,729 *352FF5D00CBA440420B9104A3A890182E8B4CB55 humbertoellegood
520,481,730 *35205B1FC32F7113B7F9B2D4503DA24FDCCB6960 HUMPSONG
520,481,731 *3523811361B7DF8F0CD6295BB99C12EB208DAB91 HURTIK
520,481,732 *3521D7218BDC61C18CF22B3F163F62AC2E978113 C)M9Y
520,481,733 *3527672C086E4AE8B8822A8FE26EBE5338A2F38A cnw:o
520,481,734 *35242F3B19A3C0DBACE47EE767B98BA689B9AF85 ilovejeff42
520,481,735 *352A6E1EFF9E2AF16FD90752D4242972EF1778CC [email protected] [email protected] [email protected]
520,481,736 *352905F141D8419D1370D7189E173C0DBE46470A CPM3
520,481,737 *3523622C3DDAD4ABE22DF2F9E9F78D5C026529C7 c:\program files\windows mobile 50 sdk r2\samples\pocketpc\cpp\win32\tv_inbox\tvcustomform\macrosh
520,481,738 *352D39D9A0AED32F187B47D05DEE99F963045266 Crepuscular.Rays.(feat..Keith.McKelley)
520,481,739 *3524EA3377EEECE289D123FCEEFB0AF7B0F48D20 c,(rs
520,481,740 *352D905F54E815A58DC8C86E37BF538CA295AC10 CTFMH
520,481,741 *3522DB62101A799A9294CFA06DB5A49B1B834123 cvdf$
520,481,742 *352370255C5CC60F802C2B0816DECFACE913512D isoldaisolda
520,481,743 *352D11E03AF64D4BBE68993D324F5E0D226B754D cwkne
520,481,744 *3526DD3D9D26EB06719DD9B434131362541471C0 istrowberri
520,481,745 *3527D4D8C235EC4073F67B81F03E0D3C28F658A5 C"Zk
520,481,746 *35279621685FFB83D253E60F5B81F8D34C730BD9 ivette-phillips
520,481,747 *352C05E34020242B42FA107768597D0B7F392AF8 j&^)
520,481,748 *352CCEBCAD2D22FCEBA0D492508094D2E3DAEF05 JAKEWESNER
520,481,749 *352E6A3A405C55682572ADE098A14399BB27F743 james-farran
520,481,750 *352333FB107050303A4AC33223067F77F46B21B8 DAEMONMODE
520,481,751 *35240803CF172A764ED6B9A7D7D8AA378A94AC85 DAMIANDELAGADO
520,481,752 *3520686D59A6B50AFC7F69627DD7DC6D013C4E24 janrabenstein
520,481,753 *3528706C460A6E04A059FED7FDA061A72D118866 ja_reb
520,481,754 *35225C7F503729F9A175DCA5A7300634620369B3 JASPER.WALMAN
520,481,755 *352AC1E7CDFA8694B30EDCD6ED0B263F0BF704CC DANILOCASTONGUAY
520,481,756 *35264C69D2E96D68481C6D523505B99FD9F59FEE DANNYCIANFRINI
520,481,757 *352C81F466C352470517E3A795DF19D2036C1FBD dannylackage
520,481,758 *352FEAD9A7F865918B69F1C5E2FDA6A21ABD7DAF darinmekeel
520,481,759 *35262DCFF017FED552A906B746C09CCCC90D5A7B dariocervantes
520,481,760 *352FFB9F3F7FBB4569DA24C60558B1D871664CEF darrondenomme
520,481,761 *3523310BF8752B5755F4A5DD7D199601CE131EE4 JENNIFER.CONNELL
520,481,762 *352FE4DD64C71466882D23B5CAF59BA604A94CFA jennifer-deles
520,481,763 *3529ED0EFE4A733EFD74727881BC302A6273210A DARYL.COOPAGE
520,481,764 *352F02381BEF1F7B0D26BA4C4B80B045B3D1D45A DASIYDAVIS
520,481,765 *35214E640FBE31CA1E428F3C1689D0F6A64CF127 jessicamonger
520,481,766 *3524386A5E9E2EDBDCC0ACD8EB91714F38B39D05 dbeg+
520,481,767 *3525A6E4CE80AB1F30F49C17EA556AD6A870A882 DC7TN
520,481,768 *352AEF509CAAB44CCBB29C8825F1E3F636C105A1 dean-matlock
520,481,769 *352448926064B7291AB5A75EF3002F51B7A43518 DEBOMMENVALLEN
520,481,770 *3529D8CA11020949AD9E405E278C01C560EDB8AF JODYSALOTTI
520,481,771 *3528459069B46A8BEBF03CBCCD34A6537972B58C DECOUSE.
520,481,772 *3522DAB68E85928EDF1FDF6944867C864AE3CC0D johnnip
520,481,773 *3524D14B185F7D61302BD17C633E98328F95A517 demaxxlongplayer16(disc1)
520,481,774 *352202742C208E76D93AA1861DD8E317E40875C8 [email protected]
520,481,775 *3523A1ED32C236952714DEEEE8F00C021675D48A DEREKHEIDEL
520,481,776 *352F74EA5D96BB661032D32B96899527819171FF DEVIN MADIGAN
520,481,777 *352927D96EDDB09316866902F54F733CBD25ACBB DEVON.KNOTTS
520,481,778 *3524C7E20D6F6A98B240C17A600E3D2672A51BA9 juc
520,481,779 *352D7BD09C92EA9B467FC693FA38B10E3105AE35 juvenesdoganalogo
520,481,780 *352F349385F52B046B074479E7D9DC7EA0C3DA41 JYQSEUX8
520,481,781 *3525B19F6DC89A4FCAC70380A48738B792EBB302 kaashalle
520,481,782 *352C569D5C4E1B8F8AC09451E136E49E080509D7 DICARBO2
520,481,783 *3523226C998EE9CC9E183A17968B6DF3AA306382 Kansan.Uutiset
520,481,784 *3520D5BB1D731BB0AFC6B0FCD1312EC24706C5F3 dinoivat0
520,481,785 *352F659A72E391DE10F7747EA27EC6D3E1CAB3E4 KAVANDAVALE
520,481,786 *352B6371935931D6E0005D665E128C99999F2B45 kaznionied
520,481,787 *35206CFB0916135A3BDEFADE75A60275B8E0B791 KENNEDY-BUFFYVERSO
520,481,788 *352FECED0440B3E46F5A7E3453CFD4B00B76B078 KENTON.LEISENRING
520,481,789 *352E2A5873B6BD0CC643A3F529736058D93CC592 KEYBAORD..
520,481,790 *352716F8352C471EA80A829B779C16BD67D092C8 KHLIST
520,481,791 *3522BC1A4088EAFA2836988EDE2DDB0352B7B4C0 KIELTOVAATIMU
520,481,792 *35231B6B5423E19AEBF78767064550EB70DE717B kiki.finley
520,481,793 *35245DCE58CFA056BDE6E58C9F423124C54DC5C4 DITCHDITCH
520,481,794 *352FDE81DE6A0CD949F7B4FF89B1E12A9755225D DIYAR BERWARI
520,481,795 *35253BC468DD8CD9F5071801B591F00F3FF05612 DIZZY,MISSLIZZY
520,481,796 *3523B1548CFA493BEAECF90434C2BDD1DFAEB31F KLGTIGE6
520,481,797 *3521B1DBE15486E949DB99305DD6F4F0F160453E K.PASWAN
520,481,798 *352AF5D303B1D55FE8981B28A23475CA1B84EB18 dmo;
520,481,799 *3520546972D2E3F7EA91189478398D50BCC55962 [email protected]
520,481,800 *35299CD581433897EE9CF9E4A17CB8EC3DA794D2 [email protected]
520,481,801 *35290F3AF46DBA19D51B7D8061FB24E618CB7969 kw"6
520,481,802 *35233FA3C9D38652164A695B8FDB00CFC70FD4C1 *kyr
520,481,803 *3520E830C2B6B6E4B01C9BDB7126223EA2E96AB2 DOMINE.A.SUA.PAIX
520,481,804 *35292B12411C7690295680759380687480AD490C LAICHEEHOE
520,481,805 *352BA32D40D3166482BA42EDC15CA14F22DFC25E [email protected]
520,481,806 *352BDB4FF260A29D8B20119799657DBC0809C923 DONDOL47I
520,481,807 *3520BC119BBD4BC3832DA93637EF961AFA1AF09A LANCEBELZUNG
520,481,808 *3525B58AA8E6712A1FFE0710CB0BB3929ECBF76F lancecre8
520,481,809 *352B1946DB48EEA2F679D63C640B75A69C85C4FC DOOM.IIV
520,481,810 *352A7A9711F466EFDD3810790F7E2388C986C17D DORSEYALVERSON
520,481,811 *3525500C3B685B2BFCCCBB267EA0989CE517E595 [email protected]
520,481,812 *352F0309A3E1A2D8B3FF69E95ED91A9DBD52337E laurenbearup
520,481,813 *35270BB5F0799338CB5E55571A173956D96EDAA7 LAURENCEGIESELMAN
520,481,814 *35261E3C382A3664D22270D8B1464766DC7291F9 DOUGLASSMASEY
520,481,815 *3528F0B0ABFB13F09F0747E9AAC90B59F0266581 douglassstratis
520,481,816 *352F0A1686AF5FAA42709BF8F5DB57048DCFBB4B LAWERENCEPETEK
520,481,817 *3520F345D5F5C7243DA36714C4BEC34B85A47AB9 doxv
520,481,818 *35288E92321DA6ED9C3765948EAF0B8D85B5D110 D.OZ=
520,481,819 *3529655D3C17D090A8DB4408C59D480FF9A8D1AF D,+QY
520,481,820 *3527A9B515F5853A9AE9A23BFB190D2A97586CD5 drqds
520,481,821 *35241CE5B1EC8541306F853BFD24FDBB2D3D4FB2 dr%wr
520,481,822 *3528DA06D4CDFB8326DA9D3AF253E1870B94AB3F [email protected]
520,481,823 *3526516E4090EA1E927CC8B46EF9DC49E83C147D [email protected]
520,481,824 *3527CF19ACE2C4CA45072CC5E75446595A16F24A ds$x!
520,481,825 *3522B1580A7192877FD8A5BB1B78E387B51C6020 LILIAN105
520,481,826 *352DAF1F0F33303C32A252D9D34D6B67BDC074CC linden r
520,481,827 *352EBE7B684EDA76B60B3924F7803B73D12A64F8 D-UBK
520,481,828 *35205C1CA3025244C81425BC5A76513DFA29A441 DUMQW
520,481,829 *352C90CB61178EFAE7309024010CBF25E0823059 lojistik''uni
520,481,830 *352B103701B64FD742E1E3EE104BAE9D2245244A dww%0
520,481,831 *3529FAFF2DECC218241462F87F924956420F4133 LTINTERSECTIONGT-66
520,481,832 *3526F5448C4E1A4F9C869DDE8C8AFB504F9C8A15 EA+LE
520,481,833 *352C1C7CAF2E8FF308EA1E2718AFFA94C3FEDA8F EARLE.RYBA
520,481,834 *352F5DF16055F0C98B33449FB61C04D9E1A8FF3E EAST-ALTON
520,481,835 *3527408AD2FF809463BC8ADF52005696A9126B44 EBARCELA
520,481,836 *352CC7D718E09A2861AFF7E59675130357BDD7DD EBROWNELL
520,481,837 *35221B2A8D39266E7983363CCDD0FF01E92B3EAE lupeeisenbarth
520,481,838 *352966CB7963B5CD005574DFFCAA35E91976A2AE [email protected]
520,481,839 *352F6A70CF22CD5BF746D8C9EC3995B9283418F7 EDCALVINO
520,481,840 *352F7FB5D31F8AAA1CEACFC185E8D1D60B746D61 eddowes0
520,481,841 *35249246891D86F28321D7834B0A2A2558C2B9A2 L/YR
520,481,842 *35272378EA92303C9E367D9CEE4BF24AF1818C48 M3dg
520,481,843 *352FB1DD19E8A122ABDFA868EB089BC9A600F339 [email protected]
520,481,844 *352493638906377B9118764F824D139BA8682122 maisumavezumamor
520,481,845 *352900AE1401968E3BA2B43AC1E59714DC5D2459 eer"g
520,481,846 *352020165E1B14E4CA93652831FF9BB19430395B MALLFASHION
520,481,847 *35254553994B89F218FDB25F233E72F98AC63165 ehausseing
520,481,848 *3522B9E1E30154A4EB3EC81C9256D16ECB67A080 MAN.MANSBRIDGE
520,481,849 *35211C5F2E3789BF91C30C4F365833E9C1F14970 [email protected]
520,481,850 *352DB39B9C7916477F9D7F01832187A65D20E1F6 MARCH FOR ORCHESTRA IN D MAJOR, K 385A/KV 408/2
520,481,851 *352D2486AFCE72102B1197C21EF14BECF3595462 mariaboven
520,481,852 *352CCF322425075CDE8E8119B33AE6D32BC60BD9 elderscrossing
520,481,853 *352657B06DEFFE9F677B7726F502AEA9F6BDF625 marshallzummo
520,481,854 *352E2EDCFE64E9141D5C01ED713EE7C770A4EB1E eloysmall
520,481,855 *3525975813E7B9212C1FE1CCD057B2A49F3E6BAB EMERY.DEGENHARDT
520,481,856 *3522171B72351C8993CC7D80BCA891AE20E29119 EMO7ON1ESSNESS
520,481,857 *3522F5A48D4CCFFDC56BD7574EF4FCFCF3C73C13 maskerar7
520,481,858 *35240620517C82EA3CA1FA5FBA2EF3213031080C enwolloh2
520,481,859 *352ED416206703B0FA4580DFFE22153AEC74E3A3 MBZELLERS
520,481,860 *352B1F6BCBF04D4C3E9520B11C47ED7C415FFB68 eot5
520,481,861 *352CBAA90474CDFD4CB1A662ADDBD00557F390A8 meanwhue
520,481,862 *352C2515837876BE52C7D7D26FCAE7F808906999 medaillist!
520,481,863 *35239BA6BAC12F3B1AD725E535716C5FAB7DCDB4 erasmoporee
520,481,864 *35273A0FC14E9CB915D7ABC497289507B36FEF1F MELANIE HENNING
520,481,865 *352496674782CC3CBEAF7D09586168BFEAAD8391 MELAPSOY0
520,481,866 *35223BFF0E2879E24C2EFA4CAAF047276BD341E3 ERICHMEEKINS
520,481,867 *3527A091485BC29619CB83AE6A530AB778EE52AB ern21
520,481,868 *352D1165AAE0FDD9B18EE25341848C0BD9AD3C33 MESTIZOEINDIO:TLEYCANTIMOCHOQUILIYA
520,481,869 *3524A55827B5AF9ABA5ED990346937D29471A2DC etenterprises
520,481,870 *352B80574D734A8D1886B7C04EE8A86C2786946E ETKRAMEGGED
520,481,871 *35209E7CCB45E01095F7F47166CB3D313C80B134 MILES064
520,481,872 *352D3A25715C7412B62462864A57DA29413C8CA8 ex4cerb47ng1y
520,481,873 *352C388F8124BEB97C7A174A1DE9729ACBA72FA5 [email protected]
520,481,874 *3520A07EEF552464D7305B6F7F5BC0E2C03A569F FALSTERS
520,481,875 *352C71CDAADE26B55A9F85FF20E8A80DA3FE8A09 MOMMERYE
520,481,876 *352307A503694D1A065E7D8B8E5949ADF1887BD7 MONKEY TIME!!!
520,481,877 *352C92B413D3BF9D044ECC274ADF84BCB86F131A [email protected]
520,481,878 *352B7A0080232E91D2FFA15DA137B9164EFE80E7 faustinocassatt
520,481,879 *352C3768869BCD25C119638C2C3C17CECA1A78E9 MORT65
520,481,880 *35286B63EF84DB0E2C2905276B2895B1C8015000 MPRCMNT4
520,481,881 *3520F587836975B30BD9C13BF69F288626808EBC FELLYTONE'S
520,481,882 *352A37CF90993F28C4A40D5ADB0131DBE503AD32 Mssp311n9s
520,481,883 *352961BA2048AE77F4630DD9DA991F469D9661CC MTILDERS
520,481,884 *3523E2BA51FA2BD5622CA01E962C28183E577DA5 MULT1PL1C4T3UR5
520,481,885 *3526504B85BD34D7168FAE8ACF09CF6A0E7E1D6C MURRAYBUB
520,481,886 *352AC1B41AE6E99635EA7816971F8D8E02AACD1D MURSINKA3
520,481,887 *352890B009D28B939FB170C2896AA36F8E493268 mxb,
520,481,888 *352881D61EADBFBA5E0CB29FA00DD0ADFFB7DB7E FLUBDUB6
520,481,889 *352921B65FB542D16603E0855444E8218F8BF7E2 MYSALASANA1995
520,481,890 *3527AE90397473C561D650DF39F8B2C1A5941D46 NAGLAŠENIJIM
520,481,891 *3524382139E0FE54BC9BAAF691F1E9E893DA4A9E FRESHS2006
520,481,892 *35234950AEA0B09CDA4AA459571D8CBD35AEA90E FRESH-THINKING-(B)
520,481,893 *35297F0B5F105241C8AA4574FA358A90793CA78C FSTNMMR2
520,481,894 *352728345413543AD350A1717A89B9D2F7D0BEC9 NEALFERSTER
520,481,895 *3521D19E99688EC278B50E6A2B6B50BA409A600D NEERPLONS1234
520,481,896 *3520146CAE29193D6E37B83A25F20935DB1F8856 NENUSTO3
520,481,897 *35274278AE84C54443140402043B9CDBE8B5FD7A gagirl15
520,481,898 *35256F40B374F3CF7C32BADA8845150865B57173 GASDIRECTORSCUTOFFRIEZEFEATUREMAY
520,481,899 *3524A40371791B09FA2154D184445A4A21056721 G;C
520,481,900 *3523AB2BCF873F7CAA26138CA3BCCA0681F9D8BB NH052099
520,481,901 *3527E78A5CC9E4DDFE72FBA50AEB3F854CC18B8F gelenekselci
520,481,902 *352CC49727ADDAF83526B8AAF486F635A100643C NIKNIRV6
520,481,903 *352829B81837F28AFA5AF5F5742A4686D008917E niloufar6
520,481,904 *352BD6599C958A23527AD1DCB4A1818009826B9E GOALSCITATION
520,481,905 *352E60384695E4C0E8391FA3B5EF3D20291F6119 [email protected]
520,481,906 *352CF03E3EFBFD3601969869C5DA23A788A6808C GREGG.DEDMAN
520,481,907 *35262E330FC6E30AC334B694BBB6DA98CD1B4E3A GREGORIOHAWKINGS
520,481,908 *3528C9ECB9B31EC011D42066039DBFF06BABCD8A NOMADS2
520,481,909 *352E0EA52D4B73AD57B46FB135A7C6AFEF6F460E gteriez4
520,481,910 *3521C67B59C4F5BF7415503FC13730BE0D98226F gundoin
520,481,911 *352DE86438292C9C6C2BF81B66B988F9092559E7 GUTTENBEILLUKE
520,481,912 *3522B9B5ED7095AF2DCC1E3AD451D2824805F860 G!Y/
520,481,913 *352492223E6DFE1110937922813CB1A41D6BE4DF HADRIJANOVOJ
520,481,914 *3525FDB59C8278E6C550E556524CFD21BAA909F8 oasam.8
520,481,915 *35238251E33BA1CE6FEF07C857C0B6F954BCB1D8 ochsenhaeute
520,481,916 *3528FFE5FF404CF7B46240C5FAD852CC081F1071 ola-lindblad
520,481,917 *35202B9ED783A86FD509946B7FEDB06CA0503BFC OLYMPIKI
520,481,918 *35218EC9AAB51B16F4C6BE1A3C654CA22B79736C heathchristiana
520,481,919 *352DCC58F5C64FC98E4B8A9BE1BD7EDA130C22F9 ONAIPOLS
520,481,920 *3520AB480F485B9C881BEE22B2F276CE1A687FBE ONAZZIRI
520,481,921 *35200ED2247DE50FF873187C71466DEC2A01219D ORTHOPAED!ST
520,481,922 *352A5F965AE387FE7F96CA8F71C5E5ACF81A8567 OSCAR.MARKWOOD
520,481,923 *352034A086F1EB2914B8D5EA176E6738A75C24A8 HEW,
520,481,924 *3529A42ACCB5E269D99642D0EE5DE1106C1ED175 HG|M
520,481,925 *3522E52A3BADD72AD5E7D17157D84C11AF5A5B91 [email protected]
520,481,926 *3523ADC4997980E8BF0D18B3C6B788812FBDBE92 HIMLARNAS4
520,481,927 *352402899674727EB263DEBBBD7F723A54C1130E HJEWAA
520,481,928 *35208BE04189B4CF936EBDE9B223CDA7EE914E3E HJGX
520,481,929 *3528CD6F13C613BD25A7A0FEFC9D28181AC8037A hmi-phoenix
520,481,930 *3529B3977F9E9ECD27A0E6BDC94434BDA76A79B6 packerliu
520,481,931 *352AC276430404BDC66216DC324AE79E44B75E78 paloalto(featjimmygiuffre)
520,481,932 *352C10D64257AE091FBB16798ED9F1CC07E44C43 parisrizas
520,481,933 *35205E9FB48B8D0EC0DDD4F3D7A8F093A6F0D445 PARKERMARSCHALL
520,481,934 *3529CE66774739832B3098CA3A8EA4C74315135A HOSEA.CORPORAL
520,481,935 *352F13517121A5C06D1BAE5E205E551F88D47FD0 PASTCLEARED
520,481,936 *352DC5F380F77CD62109C0C18B805BB38934B098 PATIENCE701
520,481,937 *3526A3CB5A3563CC940B4262C03792F30808F41F P======D**3B<
520,481,938 *352481464626F4305D85102257D109350F5119EB [email protected]
520,481,939 *352B1A14A7113330C6254537A1794795B2E4E5AB pectimoida
520,481,940 *352B2272F6DA7CD43BB1F12C8A7E6A8918F19E0C philipgrice
520,481,941 *35202370A0BD5408739B622E6DD28F3423E8C3CF PI3PLAN75
520,481,942 *3524C83C735BE5EFD403D734199DBBE06FB03E00 IAQ167
520,481,943 *352F1F87130145C29F8EA1D86855F281A6980697 [email protected]
520,481,944 *3525107F9085248FCF5C34A1E7202243BCF7E04E IFEPARIS.ORGWWW
520,481,945 *352D55F6FF6321349BE4BA8331E66C3C75F4332E IF-YOU-INSIST,-SENOR.
520,481,946 *352056B4155874D4E3DD565F0CA0C562004E6F2A [email protected]
520,481,947 *352EB2AB055A73FD1702D044C173997BBE17C151 illegal-jungle
520,481,948 *352107AA9E76A1E05DE1B9D1ABD5C13FEEB1E040 PLAMTITE7
520,481,949 *35295A5471891FF8E4C7E4E558B674030E52B50C P!NESAPS
520,481,950 *3529AF65A9A26C8A8032378EB41A1D7A4089EB28 [email protected]
520,481,951 *352FBEB13CFDAAAFD8712CD048AA4EB99EC41B46 pr3cv1za7on
520,481,952 *352B3CBFAF444499832BB254E1DC6D77F2A76715 * production of printed output
520,481,953 *352BF8D38074C0B893DCFCACDC0E3812C27AB6AC IRVING ROWE
520,481,954 *352791635FB0F8D453AE87ABF56841C7CE5CA205 p+ubpc
520,481,955 *352B855E7D1E8040821974B61719C38366E57F44 ivdwaldorfkinderg
520,481,956 *3523B555B16F7313D1375696C5ED474BF238049D Q>~0SPLAT!
520,481,957 *352865E22949D0EF3E0A566E5E3A727CBFF2FBD9 IVORY.LONS
520,481,958 *352F11212D8E9A386DFF601B92F9C20146AB0986 (~_^)-~`-~`q-----b
520,481,959 *35208F4777BE451D130E465E6FD44FB30FB376B8 [email protected]
520,481,960 *3520FD8E78913E2CABE73F9093545C250585FFB4 [email protected]
520,481,961 *3520E4E6E09CD081BF457B2FEA098D034087572F qj;b
520,481,962 *352FBBA688E2A7DF2BF98E8BB045A53E40A08BBA JACI.FORD
520,481,963 *352047420F4D980FC56DA275AD631F18B32A5274 JACKSONSONZA
520,481,964 *3525487E80048737903DF21593F8C314E0FFB579 JAIMEYMARIANA
520,481,965 *352F08562435E5305024B1B138D2E9DC804DAE6A jairo.sotelo
520,481,966 *3522916735E148868764D35D77D7CEAF8E79312C [email protected]
520,481,967 *352B928CD6F484F7CB87E23DFAAC566439825305 QUADRUPLE-ZETA
520,481,968 *352DBF13BE66427664AEAEFA94E46CBAC7FEFC8D [email protected]
520,481,969 *3528B269FD261A38AEF043D3F912B4BEDD623061 [email protected]
520,481,970 *3524BEE6B8455142020E90FFA0692C7EFF33BE05 jason-washam
520,481,971 *352C750DD2F426E93D5A0899FFEB98A37C09BAD1 JAVED RIND
520,481,972 *352D68192FDCBDC37CE37A64E6E774710677B259 JAY.OESTMANN
520,481,973 *3524935CCBA280781650524F7B54A3F224A490D3 j-bruce-ismay
520,481,974 *352FA0603BB3DD7AD0CC5EE7B96FADAF5F2CD8B5 RAPTIVISMRECORDS
520,481,975 *352D135DAC9BF81A4697A23C0EDA01C6E59127BB RAUL.LINDERT
520,481,976 *352FA7944693D99C660288E70443833B4518FD6F RAYMON.LAUDADIO
520,481,977 *3529902682242C298D121CC2BEF47A41CA71F7F0 JEROLDGASPER
520,481,978 *35231D060D28ED4AE47CAEA9686C9A8E42DF124F [email protected]
520,481,979 *352DFA9F70F6D4E0893DF8BB3C932BE136E050ED [email protected]
520,481,980 *352532C365E60DEBAA52DA816BEDE50A2B5CCC0D JetLagGemini
520,481,981 *35262EF8F0912374D31F86C8B6985763FE57BB0A RECEBAM5
520,481,982 *352E7731421F8201CFCF0A3B986902DC1961B25D REGREBSNAMLLOK0
520,481,983 *3526C486FBF89E13A8C2ED438BFBF2CDDDEB7C93 REID.DOUGLAS
520,481,984 *352C1A5C929F918EC8DCFFAD2BC3AC75724E666B REINLIVING
520,481,985 *35215047B47E0D45F5D620AF4AA1ADB876811294 REKISUM1
520,481,986 *352BFE4BFE066578EBC61523DF961A8A393FE636 [email protected]
520,481,987 *352796A1B65455FCB59FDC8EDBB27E4637D40C01 JOANRUEB
520,481,988 *352C3218FDEEB600F11525230D8D86C73AC94B0C JOHNIEENSLEN
520,481,989 *352D6692A0680C9C60EBAC450FAF7117940B8823 JOHNNY-"SIX-PACK"-GASPARIC
520,481,990 *352AE6B5758F1EA3C5CFFD2F2B691F6B4F617DEA [email protected]
520,481,991 *3526FDAC861097C3EC6FC65C5B94A8CDFCC962A3 joj)
520,481,992 *35283292C8399CC82FB460751E4D8E84C308CD1A jon-kawa
520,481,993 *352A0E8D13DA0B9F9696140DA5A674860DA9D8BE JOSEPHINE MYLES
520,481,994 *3525FE4892D2C8F6B676B2489D82A8F4689014F2 R-FAN!
520,481,995 *3521F7D0DBEE866E854FDDF9374EF56F9C7348E0 [email protected]
520,481,996 *3525727DE5C4E5ED0007F30F1DA3C138C93C1859 R%I
520,481,997 *352D4719B5F0A71379B8EABB2CA11DCE1B5D2049 rickeykarper
520,481,998 *352B03083A5CA54D1C56BB7EC4E84CE2B8A9068E RICKIE.AREOLA
520,481,999 *352A8ABE9DD15CFCEFE5E3D3AD0153F3F8365063 juanpeshlakai
520,482,000 *352AB88B4A23CC7DC73E7113FD9EE6AA217E7BBA JUDYSEXY2
520,482,001 *352BA7F66E68CFC44364FEF0ECD44C5F4079DCAB RLOLGUB3VJRGNMB
520,482,002 *3526119FA321C03131A5B24D90301D3184732F73 K1532
520,482,003 *352A448236ABB2F9E8D61EE9A43B7AF4390B7F53 ROBERTTRAZOM
520,482,004 *35230B881F3D1DD186F398CC515A061E32C4DBF6 kaerouka(instrumental)
520,482,005 *352D32D51DAAD605E8B384430D695E05CA70B1C7 RODNEY-ANDERSON-JR
520,482,006 *352866728D0B5CBF70FEC9F2E7BB3A6092B482CC Kasniji1
520,482,007 *35206F2D3E21573299AA637561AEC7D5DE00B02A ROEPNAMENS9
520,482,008 *352E5F2C7C021C1C8462C368C12A465558720762 ROGER.SCHRAMECK
520,482,009 *352B3D707AF0B86BAA8084C4241C869EB6BF04A1 keanenjosephpoitra
520,482,010 *35275B949A7AB1D341F9986B98A0EA4EEA5A5760 ronaldvaldes
520,482,011 *35273AC9ABC29996382D94BE5D1344A66DB29631 KENNITHLYNOTT
520,482,012 *352CCA1AD1E7D9D699BFA3D38ED90810739B65F4 ROSS.ALTER
520,482,013 *3525D2E325AC8520C9359CD2771DB57C5FEFF936 ROYAL.LARRIEU
520,482,014 *3521263EAE0AB8DA87BF2087950D2646022CC3FE ROYALSHELPME9
520,482,015 *3520FE34B9AF5C8EB0D16AA11FFDBCEF31F4EF17 ROY.MARSAC
520,482,016 *352C43502D713FB1B0082F17C79F66564FAF1F6F ROZTERKI8
520,482,017 *352EE2BD1FBDA2BFA327941ACC18284F0EC389E9 KERMITWINRICH
520,482,018 *3529F69F6A9B18A0551EA9890CFC56518F1F30FC rsprite5
520,482,019 *352DE2C1FC4034D6B1CAB57C818A375CC3ECBEED ruebenkeniry
520,482,020 *35259EA488D5814390FBF426099F6FBB9CC948F3 kimberly-daugherty-baker
520,482,021 *352BDF192861B5CEB0FA404772B4E728B38A9835 RUPERT.GRISHABER
520,482,022 *352E1AB1257658D116B566CE500AE18C8637FB9B RUPERT.GUTIERRE
520,482,023 *35296D33DC358C79FE970B5579E61501DD5F8BB5 RUSSEL.SOLTREN
520,482,024 *3527F0F3C1979005745440A0B66608C9EB52A43D S77680
520,482,025 *352E31CEEAC8CC75FBEF86F2F8FFA67D67B82105 KONUŞMASINDE
520,482,026 *352F1054A8741F3AC609AF11418901309646CAC3 SALIFIABLES1
520,482,027 *3527A55DB5D6FE96573D3BBC9631BEF88EA82668 SAMGHABADI5
520,482,028 *3529166EE9EAD5800C70F53C0A25CA809A1309C8 KRIS.AGOSTINI
520,482,029 *352D807DDC178CDF242F285637302EC95C0D04A3 kriseninterventionseinsatz
520,482,030 *352391BA4F56E2200D500895BBAC200B2DF7495D SAM.TAYLOR.AND.HIS.CAT.MEN
520,482,031 *3521B6F1E11349FF555432B5E108371DE833EF27 KRUISZEI2
520,482,032 *35287D0D38D94D23405FF90908299ABE79839717 KYTLE1234
520,482,033 *3520C857F126A752205962D0577F799D2F3E74F5 LABORATUVAR’DA
520,482,034 *352429C709C5769304A493D01433AB5DE06FF0DB LACYLOBSTEIN
520,482,035 *35257BCA08646552D4AF55699914D015539E5DEC LAKEISHA8
520,482,036 *352D41454810031B1090E53B980319043077BAD5 LANDON.GABEHART
520,482,037 *3520C0E34C3090D15A30FCF56B06A50F72F1F2DB lanesergent
520,482,038 *352E2BCF1FDC28949C980A04488BE1E9396A59EE [email protected]
520,482,039 *352E465767390BCF7FA288CF7E191FC018DCE165 [email protected]
520,482,040 *352206161A766A6C5E8DCA0E410D44CDA554B087 [email protected]
520,482,041 *352DAA6BA3BAA8BCE203B2AAF918000EA4709797 [email protected]ornetcom
520,482,042 *352C7664515B4E656862D8BB9FEB740F4BCD233D lasendadelcaracol
520,482,043 *352566AAEB01A0C9C80BC27F6C208B7060D8FF49 self-elective s/e/lf_/i/'l/e/kt/i/v
520,482,044 *352BD0E9E9DB85D560F89893937DE21E3BEDAD0A SerbaSalah
520,482,045 *3521B07061B1A27BDDD3F5C8B6EB0886A5F57690 SERGEIBETTY5
520,482,046 *3521460A3DEA3CA07BD8075EFE481C121C015AD9 seubruof1
520,482,047 *352EAB7A3DE9231186503AFC357D262079D4B6C0 [email protected]
520,482,048 *35288FFB3F41628193B9C1045DDC4AC5073F449E lazarodile
520,482,049 *352A9D1093CAE5B0C64583AEFD9F6B173AAB83D7 SHADHARTSOOK
520,482,050 *3527AD844E27DBF4947123657CA244417B4B317A LEANDRO.COLYER
520,482,051 *352E512C021AA1CA9EC26564A2003CE8B99B8B26 shannon1701d
520,482,052 *3520F8300C8695A7A21987D5CC7BF7D22336D24C shawnmedici
520,482,053 *3529505AFB418C6647359DEC3594B46C22D9449F SHELLY.RODRIGUES
520,482,054 *352DE20D0CB97067A3E8AC3AEAA1366F7F645B58 LEONFILIPOVICH
520,482,055 *3524CCE53621C69B973BFC637707948599572DFA SHERWOOD.MULLAHY
520,482,056 *352B08F3BF74C18973CDFACC30430DDF2CA67D1E LES.FURUTANI
520,482,057 *352BF87A0F5510C3A818B05E189AA28FD7B91660 [email protected]
520,482,058 *352FFC0BD1448F01187489D8E9A31B73F241DB55 [email protected]
520,482,059 *3520A95422E6699F35A2D10509D9DD30E6ABDC4F SHITPAUL8
520,482,060 *352ABA46FBC65879427AF0F5833F3D75A392532B SHOOTER35
520,482,061 *352B9A526A8C0A6BCCAFE7E4592C181A217BF64F SIAHCRUOFFA
520,482,062 *352438C47A356579AC4675CEE2CCBDB3FA37642F sidmadon
520,482,063 *352CDFB2DBE739D88FC9E55AC10ED573FD1BBDD7 sidsouthward
520,482,064 *35285970082D829A3F54166D1D19BE08C138ACC6 [email protected]
520,482,065 *352922A5A44FCEE6E663574E4F6E7CC1F2D21857 LICHENOGRAPHIST8
520,482,066 *35249D3B3B840C07AC89D058C2BE973EE6C97480 linda011
520,482,067 *352CC0FA9B46B97BD9B5EB06BDCA7542A62733A7 LITTLE-DARLA-HAS-A-TREAT-FOR-YOU,-VOLUME-16
520,482,068 *352D07698370E16EB2B63FD2E369ED7DA1094CDF LOCATIONALAND
520,482,069 *352A2C5572E7099B1CEF489F8D452491B4367CA0 lr}!
520,482,070 *3521D1F4669B1812DC20304B1F796493F60170C7 SOLSHENTON
520,482,071 *352A8597C082EF968828D0C93258CEB860EA2343 SOMATOTROPE9
520,482,072 *3529C0E30F8E80FCE7E0F614627DF05581043831 lucaskruchten
520,482,073 *352A35C3A4FF55624E4CAFA624CBF2964D1D55AD luciusmodesto
520,482,074 *35253169EAB773256A0439F2BE5B355313FEFE0D soppeserei
520,482,075 *35205E242882B4F653581A6BE6160FD45D90B844 sotiros7
520,482,076 *35261F726E7B7A206C94E5E61C05DE61592B7792 SOURCEPERRYCASTAEDA
520,482,077 *352F6A6502D3554F3A901B336480B4C49DA50929 lupeludvigsen
520,482,078 *352FD729061970F15BB5D3785224FFE359639574 [email protected]
520,482,079 *3523C1DB65F886A4559AB5057FCE10AC0D4B7BB4 LYDIA TO
520,482,080 *3522D5C289C9E4117CFCEA1B75B2F47133D00607 SPELDENWERKT9
520,482,081 *35299B89CCD0C2390832CA8186EC99F2A2B9D3D0 m15c41cu14+1ng
520,482,082 *352F1CD25512C032994E1684AB2DE8B2084287D1 M4CH1L4
520,482,083 *352480A024F715311598347F1E8A1B6692F9896E m509yn575
520,482,084 *352C6F060B52421639F757E9753C637F89FD5FC2 SPLINTERPROO8
520,482,085 *352C5C9CBC5F4A1FBD49116992E23FAD232BF3AA MAHANANDI
520,482,086 *35295ECA4A9CD445A1545CB11A830E8840DBE0B5 MALIKBARRON
520,482,087 *35259BA42E31EE8676B65F4B6F508A178BE59175 mamelunds
520,482,088 *352D496F43CC30A35FA51DDD226A44ED54DD3086 mandala5
520,482,089 *352434238F560FFACAEB87171CEDE1D3A4DF55DF MANUEL.PLATAS
520,482,090 *3523D1738F759052887300D425F264293C65CB3D MANUELSWAIT
520,482,091 *35271A5D22C8693CFB174F54229F31853410C3BF MARCELINOKUDLACIK
520,482,092 *352CB2D3EC4064A7E839A90DA05276B08244CFF8 stagehandsmncomstagehandsmn
520,482,093 *352886D5A110565B346D3D0B9A2F6E3D0A669ED3 MARGARITO.BEBERWYK
520,482,094 *3521F31654B0A8A293BD9BC76EC0417FF4895157 MARIANOBARUS
520,482,095 *3521E320610C7553713BBC74BED2735627A89E02 MARINA.TREJO
520,482,096 *352762209A6F8DB96B3080EC9F19F05CE1E82934 MARITANDS
520,482,097 *352D3D71CB3BABE4B1ADCEA7A2D8B8ADA72FD11B stauungserscheinungen
520,482,098 *352377D72A46FADBDA8FAB617ABF3F08C63D8A1C MAURICIO.BADRUDDIN
520,482,099 *352323759097A6BFD54CCCAC58EF345BE2DDED2F maxijazz&soulfoodcaf
520,482,100 *35269DB7B7DB37E00400CE0BCC837478005745A3 MAYESR
520,482,101 *3527A38D7E94F5D749D75D86DD2C72962E28E37B MCKEEHANIN
520,482,102 *352DF3FA3B647600036BE8CA8592C868F022363A MELODRAMA7IC$
520,482,103 *3524AC8247D7918BDA3B53DB7FEB61D14C8989EC MERRILLMONTOOTH
520,482,104 *352B7FCC91AB309208A893ECEA7891BAD0956290 MEYSÛ
520,482,105 *3526D7FFD5D48963D84ED8844160BA5A5143CF21 STEFANWILLIAMSON
520,482,106 *352579C4A1A301FF187778339C4FBE9C0C4ABF29 MICHAEL-J-SHARPE
520,482,107 *3523D4AE20132598EABF0EA0D4867EDF5E7D3C20 MICHELSWICEGOOD
520,482,108 *3525B2C2D7DE6D6141035F1B9BE5A6AE763A6C7D MICVIRGO11
520,482,109 *3520F7B24CD187E926FC83D4F427F8B16BCA454E milanveselka
520,482,110 *3523A0F35153D42D77401001FD9F2BD710F3DA26 militareconsultato
520,482,111 *3524F599C499F6A925EAC9687B9AFB0510AB5DB0 STOLBERGÓW
520,482,112 *352982AC7B75FB9030EABF3895EFFCCEFD661DC8 MLUCINI
520,482,113 *352F470B968332F18F6374987925CE2AC95A4650 mohammed.abd.el.raheem
520,482,114 *35294A4B56550DB6D4057ADB78970134A5DB73C1 STUDLYHOLA7
520,482,115 *3521EC264F22FF6F11427059BFD2F8E755055976 monkey104
520,482,116 *352D7530399AD0472C6219ED76F9AFDED3D8DEF4 MOOMOOMARKET
520,482,117 *35248830FBCDF1CEE3FD4C284555FF63033C2B8F MÖSELMANNARNIÑ
520,482,118 *35271758A860BED66902CC20AF4D7CAC04FFF2EF MOTOUTA7
520,482,119 *352F36EF5FA84A5739F9CB3D1860EAC8CE61236E muhammad.sajid.hussain
520,482,120 *352EEBCF74A1296D981BAFDB636A725419B8D7C5 MURRAY.HOAR
520,482,121 *352824E1C49D00A3D98C7F9771A02DF7EDEBB92D MURRAYWENE
520,482,122 *3522DEF90122C8B9DEB3309E55954CDC6A63F851 MYLES.SUMSTAD
520,482,123 *3527ED5E8B896530F4A2E890204F06079BB54687 myloveisinamerica/mother'sdelight
520,482,124 *3527B746A11B1A6E58FCF2E477826638FC607DA9 NADIATEIXEIRA
520,482,125 *35214E0AACB010FC5E4F7F234B1A0DFD467FAA12 nasijatied
520,482,126 *3522653D6C5B00BE900B01E1A88B27F6E2C4DA29 NAVNEETTRIVEDI
520,482,127 *352BA160C83B317DEB890D546CD1A5648EB22381 neniem
520,482,128 *3529EE49D519E32FE3E4259506147CAD3A9DBFEF newuein7
520,482,129 *352C686DFAD774AB61346525E9658811100D7193 TALK84683165
520,482,130 *35200CEDFEFC3B55C9646333B9C64203417113F8 TALKCONNOR15
520,482,131 *3524AEE1593C9D77D5DB546DB5267628EC944937 tannerobenshain
520,482,132 *352206D8E71C7AFD343B0F7E21E7ED20EAE703F8 niukohs6
520,482,133 *35220244FA7F57B1260572319A46CFCB0F04C4EF teddybennings
520,482,134 *35249CF537FE13B0B48F8B201B3432F7E5EBD367 TEGRATESRUN
520,482,135 *3523F2CE5CA964581A7E3BE3BA9EE37B4B7F9EF3 TE.KIERO.DAVID
520,482,136 *352FD15C4C9E870F71B224094F642B2A92A2FDFB NONCENSURABLENESS9
520,482,137 *3521AB6D9BF37D2BC15F4CEF64FF29E2BB02EF9A TFAHRHAN3
520,482,138 *352F1114880BCD4E76EEE29D4DDDD524CA15A76D THADIOELE
520,482,139 *3523DF3D5DEC41A3CA7055BDE503011A3CC4CA54 THATADVIL1985
520,482,140 *35234C6FA7C59C48952F86546DA9D18536F5E00B the88
520,482,141 *35297CD18E191DDCB2626D4CA37C688750381668 odecdeccom
520,482,142 *352CA60C5ED8B9FA1580F83ED23FADDBE6C1E87B ODIS.VOLLMER
520,482,143 *3521C0923979A5A59B9B1683672D9C6D4DB51513 THEFACEOFEVERYTHING
520,482,144 *352D57BA9B477B415BF06D40143DEBAC5F20F7AC oek-
520,482,145 *352D26DB16A5FCE7367310A4F62E9F90DC967799 OH WHAT A CIRCUS
520,482,146 *3527FCEA28C602D44570680C44A6C8EDFC63B979 okunola-babatunde
520,482,147 *352BA5AD03ACFF25D12EE5D07BCFF17193203238 olvasta3
520,482,148 *352A0217B015EA7C6B51D338761C29F759825238 )O(O~ D---8
520,482,149 *35290BF468834E35AC2198221F9935B45DE9A6DA opresar5
520,482,150 *35219FC46E4E60AB24518F04E316A31CC2A4BA14 TIMOTHY.COTTER
520,482,151 *3528877B4A11A66809458D9761FD8B8C55740591 tnaegatraped
520,482,152 *352E549CA05DBFC22B8AE9160798E7FB108EA647 ottonesler
520,482,153 *352A5B98734452E207EDC031266B151A6E4130FA todayslocalnews
520,482,154 *352B6DDF2C2A6462919C88E7F4A86D72765D6A6E (>_<)<p
520,482,155 *35279C444A77B1EA566CAC48F31EA6DDAF42DC56 TOTIKAIRS
520,482,156 *352A2EC3B712299499ADB9F303339F27130B5FB5 panneuses
520,482,157 *352BC3C255422E9C2E04E59B3E8BA98CD2AB2CC8 passthebottles
520,482,158 *3529FA2607434697A35459AFE6459FA96AA6575C TRICHERIONS9
520,482,159 *352B69081A686EB666E94A2869774A314F2F3CBD PAWANPRAKASH
520,482,160 *352DAA605548EE3F5245B3F222FA9408697DC669 Tromboneplayer
520,482,161 *352F52148E1FFC80A8FBCC7DA69A7357366B97D4 TSAMARA
520,482,162 *3529E7E7EC8B041C771C4B1D89F5FF93479334C1 [email protected]
520,482,163 *352F458B994D3EAD0B542D7B8190A9908112B6BE PERCEVRAI?
520,482,164 *3528BDCD98AF1842F14E9011E70A725224380C8B PERSOSITECOM
520,482,165 *352CCAA9A867182E3A67B9A60F6385BE8C33F035 TUCKEROUT
520,482,166 *352F3A1CCB4662870C503C130B6E72C3BA1B7084 PHANTOM.SUN
520,482,167 *352AB37B1C15FA8B0DE746682C0938E105CD6C73 PlayTheGame
520,482,168 *3529148A65AA80C96D279609E6801BA2EF886AC0 UMESH-PHEGADE
520,482,169 *35292096A67C539AC8F6C8BAEAA948224875842D unc.charlotte.armyrotc
520,482,170 *3523A60E2EB42659D50F4A8015FC5FF2D50E7C79 UNCLOGGED1
520,482,171 *35241AAD7468A3C45E7BA046223DC436EF1553B7 pphnmnled
520,482,172 *352C8E4649D52A3EFA28C4215B02A3F934C48E25 p-----p-~-`-splat!!
520,482,173 *35279963E6E089F7495E17283334E62D96E9B7D1 UPOKOJISMING
520,482,174 *352E9139DDA7B0EEE0FD5C8266123A16619E9DCC [email protected]
520,482,175 *35262376DE299504F77F173DFFEBAF6B71922200 Ur8an0109st
520,482,176 *3521BE11ECD7E11770CBE778A77EC4E935D307BA PRIMITIVE ERA
520,482,177 *352B7930DC300E4A871D2CBF3EE2BD38B18C5DA9 propyls!
520,482,178 *352B1CE8F217CE771E46DC6BD3F1EBC06FA1D3AB UZ:K
520,482,179 *352F123C11EA42EDBD96CB4306E1326E1CA09D44 V4NI1J3N
520,482,180 *35203CA057DC1AFB4FE3A84883863EDEC2D862ED [email protected]
520,482,181 *3522EB437FE7B09F243BFB926909EFAA852FDC55 VALARIEGIDEON
520,482,182 *35209635C114F68A184FF43A2EBE6CF5297E1170 q$co
520,482,183 *352D0C04D417ED52283F2B0124C57B77BF119BB5 QHF)
520,482,184 *352B9E62422EDFDC5A564F7FEACB6BB62A0E05FE vashon-maury
520,482,185 *35216E0AE41E7C5D940C00B34D74F788A6F8F4FD quinnschoolcraft
520,482,186 *352CCA9FBC0A61FA990E08F56213A9812C66EAA5 r053bu5h
520,482,187 *352BF5DDF231DDA6A72BB6671D81A2BFF0D33391 r3a1!5t!ca11y
520,482,188 *3525F0F563BEDE40FF18769ADAAAF819C99C103E videoistuminen
520,482,189 *352E73B81EB9A82F52F08F4A7C5C8456AC69E1EF RANDY.LEVESTON
520,482,190 *352CB96C3B792601BEFE367570FC19F6987C9C32 RAVENOW4(DISC2)
520,482,191 *35275CCD39CA1FF5B5FC998F518B08A55A3DB1FA REPUBLICSOCCERED
520,482,192 *35298C87F9E98BAAF2482C37503662A4727B1B1B V.VD
520,482,193 *352FB828C73FA49C45BA20FA70D29C6B04B650DD walkerhemani
520,482,194 *3523854157C89604BD1F6DD1E2AC0313D1E17865 WALLYLANGLOIS
520,482,195 *352E7EC8436056C538ED316623DAE8EE1DEE2335 RKARMO
520,482,196 *352AF5A433F1D0C729F6A40DDE1F1F76AE187355 wendyreneejernigan
520,482,197 *352B587767975D7F72566493511C82AD988F9CCB wendy.wiles.huffman
520,482,198 *352A71135130C348A591FD7650988759CCD7308B ROBERTPEVEZ
520,482,199 *35295655475428055C27BE3F98A6DF2AC7E78605 robingranquist
520,482,200 *3529C2FA8E60535BCC11AFCC1A56EA88006EBFF7 ROBINHOOCYCLONING
520,482,201 *352B6E415FABA1CA6EB3942A87FE166177E4FD55 [email protected]
520,482,202 *352A5BC5D2ABD68A3CF0514593D852AA274C55A4 RODERICK.FLORENCE
520,482,203 *3522108A37C337497CA4CBF559F38A06C64DDB9C wheelies
520,482,204 *35216FDBB3B496C7131EBCE182F21A5F2A026AAC rolfhubley
520,482,205 *352C5AB1BE15ED9B6D81C98A7C151DEFFA518AFC whitneygetsinger
520,482,206 *352CA6CE692304FE5869017CE5AA33407B7E93CE R&ON
520,482,207 *352E254B474205000B4E8E002D327A1BA13C674D RORYAGUERO
520,482,208 *3525BE4A641B6CA7665ECD349082679283F89890 wilburfanton
520,482,209 *352D08202E7029EF2499E44A7503883EC4FAD39C wilburnfoor
520,482,210 *352C74D2D4777595F3D1E6B366D0CD031DDD2648 wilburnsniff
520,482,211 *35282861E7C1372AE17C121DB08AF92F6A911679 wileytreat
520,482,212 *3523B44A21435F4DA39D593DD98A1C950825A5B1 RPSEGROVS
520,482,213 *352494A397CC796B0295C152910F3443B194E3A6 WILLIAM.DONIS
520,482,214 *352EC7A37849E931E11EC6B54EA4DAFA4DD45FDA williean2
520,482,215 *3527310A8468E34FFE8AE74AE27AE5D8F1E9BAF4 RYCHESTE
520,482,216 *3528A6E12D842DDCC258C1434ED6FFE87721DD28 WINNIE.SMART
520,482,217 *352F81ED8DCF0A2F18EFCCF19FB5663CD9692C36 WISATARADIOFULL
520,482,218 *352FECD2BFBFFA67DB201962347FDBC8C3E2D5DF SAEAETELEMAEAEN5
520,482,219 *352671D12248F52809300980F782A6ACE99CE86D saint-firmin-des-bois
520,482,220 *35242DD78E67C7228EE38996FE42B4E8F071B329 wq!s
520,482,221 *352F1BA5F370522792DFF670002CD6977419034C SAMUELWEAL
520,482,222 *352C4D0046745787E1C416F058768927D8AEC8AE SANDFLY
520,482,223 *352FE71744A2068FFA085A419A5B7B3A452BCDF2 WWW.NANAIMOPADDLERS.ORG
520,482,224 *3525AB923E44E8D8FE9F80F8AD066A475DA9901F WWW.NIFTYTRICKS.COM
520,482,225 *35268ADC8ED56049D0B4E655D2944B1861D1C4AA WWW.PADDOCKS.CO.ZA
520,482,226 *3525FE41221E7509EEEA53C946704C1926B6A389 SAPIENTISESES6
520,482,227 *352AE7E523DD0266FDDC7D0AA8B36B43449E2362 sarcocarps
520,482,228 *35264CCAF7FE119A1FAC8215137C271935C83089 [email protected]
520,482,229 *3527E97F6E6B4810E61DF8B4790128B67B847469 SATURDAY-MORNING-(FEAT-TRACY-TAN)
520,482,230 *3521FB1AFAF572FA7DF28BFEE9C06C8AAC961C76 XBAND JAMS
520,482,231 *3523A0C2E81003AC600F141FDCF9F2AC10D241D7 schavit9
520,482,232 *35214F57D4393CEF55B70AE824EBFB232B41DDD8 X]DS
520,482,233 *3523DDDC84A6D42FC5C23B4C789E5D7CD684640C SCHULARBEITENING
520,482,234 *352E8013C3D0A0666C3513A785D66353B77DD24A [email protected]
520,482,235 *352298C2A25BEA01CB5FFA3268307E38A960F563 SCOT.DOLEN
520,482,236 *35241948A97D8458D0EF597250EFF61FACA100C2 scotgarkow
520,482,237 *35296D65D59B3371C3ACBA1B0D2FD3E83F9F2B5B scyphus
520,482,238 *3522B4A5E964A56CDC20CA8194DB88CD2AE26976 SEACORLENGA
520,482,239 *352A24E4D3875493AAC344D6958882654648681C [email protected]
520,482,240 *352C0D2C31735D6FD2FB6151FE0B705DD301D186 [email protected]
520,482,241 *352F5D39D7DBF6903B0A40914BF987258CB94E83 SEIMAGOCREH
520,482,242 *3522E1B0994A2906F91F50807DA7B9CAC64AD960 YAEL.STRAUS
520,482,243 *352286AD15E95D8E986212FF1D25B2270403A46E YAICHIHUE4
520,482,244 *352988507AC73439A6CD9012A5E07A516665D6B5 [email protected]
520,482,245 *3524BD412261E9B543B9864DF72FD507C691CBEB yeehua.tan
520,482,246 *352727363CD5975B16F6BDD93AA808B1E8267421 [email protected]
520,482,247 *352AC7823E9B719CC8DBDF1F2E5696B38D6A4AD1 SESISETNECOLAHPEC
520,482,248 *352717965D380B09BF981742DBBB21A41CD7500E yhoaneyamistad
520,482,249 *352C8A35BAC2D87C2FBFD16E85274CAFA861C606 [email protected]
520,482,250 *352C01E6B9EF0635E5FB7E3A954511BC671F7F41 shakari
520,482,251 *352C2594EA846084ADDE35914091EDAF7EA77361 YOHANANBSW2
520,482,252 *3520ACA1CC8D957FB03838C3087BCDA45C8F199F YO*NIGGA
520,482,253 *3529E0EEFF53FB376B92DBCEFCC51E01480F19A3 yosef-morud
520,482,254 *35262A5729A6AE4BFFEFB917BB052E91F94653EB you-don't-even-try
520,482,255 *35272F425F3E6619F6304BC111DB8B5D085AD220 [email protected]
520,482,256 *3520E8F4D0AEB6A9757946CA42D42AFA8E826A04 SHERMAN.MINUCCI
520,482,257 *3520BCF1999624CC052D8343FCF010FB9019F90B yvonne.raquel.garcia
520,482,258 *35298EE7F4A85D596F049D881E97CFBB288C2D1D ZACHARY.STAROWICZ
520,482,259 *352B628A7098BE2B8B3E4CA8E980F1A4DE891395 SHORTY_GURL_30728
520,482,260 *352254F23CE4D9E3BD2A87DD649106116622AB97 SIGSOFTWARE.COMWWW
520,482,261 *352B894E0403F63581DF52058BEF12578053DA6A SILAS.FILS
520,482,262 *3520106F9B28AD1BFF951517BA9C64642296D0C3 ZANELAY
520,482,263 *352E1A989AA3A7E0D9F07B71F9137AAF4C3F5026 zeo
520,482,264 *3526533B9F9B4F8A185C67BB703C66846ECB787B ZEYBEKZEYBEK
520,482,265 *35259B7DCBE025C61A8D5B05A006331ED78BC4B0 [email protected]
520,482,266 *35203489AC71ADA61A2D62FB517D675101574997 [email protected]
520,482,267 *352B3DA14B93746B899F8AF2435F1580643705C1 SKFULDES2
520,482,268 *352C14224C22083306D7E64D4083BB4F53A526B0 skjoldo
520,482,269 *352BEFF1F7A8DDF7EBE4BA2005E20FBB7BA92508 SMALIWHU
520,482,270 *35255CDF832485816F9C06372D3DE9C3D739D542 ziana-kutaq
520,482,271 *352483C59310650B4338C63DBF65BD2D36FDC04F ZOEPLEDGER
520,482,272 *35252A36C27A43A46A88A3E7C12F240FFB2BEF74 [email protected]
520,482,273 *352AB1A0992694AD95976615CEC4E8B299CD67A2 [email protected],
520,482,274 *3523FB8BA18E41FBFA0069C03E55946D2174327A som-ca-teva
520,482,275 *35220E83A72176118D1614EA7F5AED675E5D8ABF SONNY.ZUCCARELLI
520,482,276 *35253319D0486C4D4973D189B53AD3633988CE04 [email protected]
520,482,277 *35230051D21B2FB8D5B6ADC95C107D7D0D85DA9E SOPHIA BARNATHAN
520,482,278 *3528783CCAD12BF54E9ADEEF4E6ED053C6E6C4A1 ΚΟΡΑΣΊΔΑΣ
520,482,279 *352E4C7CB76EDA3E09BA669715A2A188077CCC47 soul-city-(disc-5)
520,482,280 *352DECC169363FE17063D4F0C3730AF904231C44 «ВТОРОСТЕПЕННЫЕ»
520,482,281 *3521D988CDE7F1AC15C4B35D528458B1A51AD178 ВХОПИЛИ
520,482,282 *352F2133AEC6BB6076326481C79C1F0865ED02B6 ОБОЗРЕНИЮ»
520,482,283 *3521A4D930D50AC0AD203F27D4E7ACA02E13EF3F пластининой
520,482,284 *3525957101C7057C21D3319D27F90C588878F3CD STACYWIPF
520,482,285 *352A28E51FD5B0CBB41E6A83CE79A4050B090CEF STAMFORDCITATION
520,482,286 *352ABF8BC9F62BA2B1621CE278E92484CF9E12B6 росохацьку
520,482,287 *352AAB3BCDFE14EF206652E9A537EA62FB833AC6 СОФИСТИЦИРАНУ
520,482,288 *352FD1BE4F37C83A2EE6037187DF05E0028E46CD STEFF-JOHNSON
520,482,289 *352CB181E894273815C9E9C58309445B2C82B898 УРАНОДОБУВНИХ
520,482,290 *3528CDE2914B70CAE2E80662D81F2F1CEC79CF7D эдиб
520,482,291 *352CED9667D4DA7741BB90FA677334A1A29D4B71 stiletined
520,482,292 *3522857D70AD45E66456E576E5938193634E0C32 SUSANINFORMIX
520,482,293 *352C5313C731DD4B1DAA6F168D911F6A1C9AD393 SWMS228SK
520,482,294 *35234C350276226966C2847FBB1940585A40B079 [email protected]
520,482,295 *352E4007C8FBF39E873242391A6AB897033AEBE9 TAPAN KUMAR BARIK
520,482,296 *3528E0957B6B3D9C6849EA3F92CA636A34FD13AE TARRBABY93
520,482,297 *352B5C3B123AE33B2BEB2CA69B2F1220F9581DDF TEGNESERIEEKS2
520,482,298 *352638C0C72E653C124704A45F450BC418FB442A TEKKAPNEKERREV5
520,482,299 *352819FD9587E749BEA8F0E2A362EABF60B5566D tennisball
520,482,300 *35233A07CC2A256C2CC9716DC5B1E6CDEA78541C TERI.HARMAN
520,482,301 *352667E764B09739213EF78121C89BC3E1953128 terrafor9
520,482,302 *352EA19866662D472BA20361A0DBEDB530A364ED TETRAHYDROIMIDAZO
520,482,303 *352F4098F876AFE0D820DDD364E87173347EBC35 The-Fallow-Lad
520,482,304 *352F765CD5ADE982D6BE3F990149215CAA61B0EA THEFRISCO72
520,482,305 *3526925808048F407D809D94C5A16B7832A8B7A2 08A92232
520,482,306 *352B5D64A9873D94F52119F2054AA68BCBE01D66 the totality of protection mechanisms within a
520,482,307 *352B40E9123D89034644C0EC3C1D05A64880DCBD (-_0) O~ D-P
520,482,308 *352635D18DFA6705D02C35E64DA2C251AE81E2B5 1064276 PAREMPI.KUN.EN.OLISI.MENNYT.ATENEUMIIN.T
520,482,309 *352EBF1809D63A41F4D37A24C1292A99E1B61D4A 1076D9BFC1D777E02C44A6655AA4DB311JUL80
520,482,310 *3528B08678B39B9AC2155DBB5BB3F2888A006469 [email protected]
520,482,311 *352D37AFB6E6D271DBE073C59900E2CF06BCBC51 1170898 ER.SELBST.WAR.FUER.DIE.FR.GESTERN.NICHT.ZU.ERREICHEN..
520,482,312 *352B5676B132167DD621F3DAECEFEDA4ED747C63 1190869 tutkitustaaineistostataimenial
520,482,313 *3528EB900224F2A1711DFCCB9059249483789BBB [email protected]
520,482,314 *352DD80C8365A4433A64BCC82585C1DC77F92A4B 13.FRAKTIONSBILDUNG
520,482,315 *352EA047282023ADBF7E9E9786C1721FDCC79DBD 1416832 ALLE TEAMS STELLTEN SICH AM WOCHENENDE ZU HAUSE VOR
520,482,316 *352B9B849CAD5B0194FF1015D56738C672E664ED 1436619 kiireinen el
520,482,317 *3522559CA4D69F87A2FAF194F153153389D3D553 [email protected]
520,482,318 *35206C8997FE9B8320A56DE9BB14D183A01C3D1D 1824287 niiden yritysten ja yhteis
520,482,319 *352592B8D87EB3649B00B32A854ECAAC6EE33F00 1-administraattoriin
520,482,320 *35271C3ED4E14D4EEFA877BCB5D83132257872D0 TOURNOTARIS
520,482,321 *3526945A30E75A9C30D07E880088806FEAB2D579 1 BURJATIENS
520,482,322 *352C91FE7AED315878A3E2BECA3BF6DEA9C2474A 1CALMERS
520,482,323 *3522D69C27043D1FFC86EBC8E5F2C83CF6634A28 travellin.matt
520,482,324 *352BFFF4769865A24807395CB5420DD1F9A320C2 1climatologist's
520,482,325 *35280E1A9AC02C2D3DEC56967B9FA509BBF789C2 1COTWINNED
520,482,326 *35225EE5F57CACBC0EC89D786E1C53F173989016 TRAWLETS5
520,482,327 *35276D3417F92FE43CAEF1941B7510DE14670495 1EELISSES
520,482,328 *352056B3BB33EBB3799CAACB1193DC5D19F4D790 1EGS1A7RX
520,482,329 *3529E764432CB457E2C9C2E35D2E6C60CDC26108 1ETTUKREH
520,482,330 *352C7514B0058299FD28A7B21320D0D3121F7A1A TRICIAREDMOND
520,482,331 *3523A294C472EE799941B5509A2D2D46371C233E TRIXIEWAREZING
520,482,332 *35219954806087231FA09C92786A9DC980F3882C 1hopeah
520,482,333 *35262CB4D2FF93B9704856EF9608160DC3A51045 tsnosmu
520,482,334 *3526ACD60FD30B37D79A28A03A2B54C702968056 tuftsblogscomwww
520,482,335 *3526832E9A73877AE00E89027A430C4EC24BE6B0 1 kasteluv
520,482,336 *35211C41FA2D4199CFD3E8780C624F8560BF9FEF 1-LITERATURHINWEIS
520,482,337 *352A28810E7ED9C610CDD1247776C439E2F82774 TURKO.BLANDO
520,482,338 *3525091130683EE8DD247B739FF3A606A8FB4BD5 TVILLINGTOMSINGERNE
520,482,339 *352666341B594D9DEBEE78FCBED93F96DC154D3D TYLEROTTERPOPOTTER
520,482,340 *35230A57AF842C1EF0854A0C05BFE0F468C99ED7 TYLORROEHRIG
520,482,341 *3523F24F460674A8B7489CAE0DCEA1913081EE30 TYRELLBAZZEL
520,482,342 *3521B38D17B7DB48AA0443FBB890B562C14F9DCF 1OPPILASKERHON
520,482,343 *35208AC1FB536F030289FA2C1F3EBB6FD2A08AFA TYSBUSSILLIS8
520,482,344 *352FFDCAC20EDCDED898615649A7EA9BF088E801 1SACHAN
520,482,345 *352CBFE56880276D14ACC0DD122CECC05EEEAE7A 1 SELIGSPRECHUNGSVERFAHRENS
520,482,346 *352251DF26D098B62CCA112C44D06EE8DE4FA1A1 1SIONSIO
520,482,347 *352AB7587AB513BD392D0007FBE1A82A51457219 1SSES-AKTION
520,482,348 *352787181BF456DBF6BBF01F7A4E6953864AA740 uitblinkt
520,482,349 *352042555E070454A155F189EF8ECC60FCA490D8 1.thematischinhaltlicher
520,482,350 *35294308B53119C138D4AC98C95EBB242D9FC782 1-ULTRA-TACKY
520,482,351 *352745D12CDF4BCF6E039481190C67241D1DC89D ULI.GUTH
520,482,352 *352873ECA7253E0EABFCBEC6D32AE42BB141E594 ULYSSESKEECH
520,482,353 *3526CA08B0ED4E68FF84E9CDCE04BAA8F1527547 UMERALLY0
520,482,354 *352B414E4CF0D8EF196B641570BB330FB1BA3C08 1.VET
520,482,355 *35218FE78493D0096BBC38A5411A7014448273FF 1.waal-ufer
520,482,356 *352FD3C82EEEA49A2038C081D7668D5C8808F9AA 1.WESTGROSSMAECHTEN
520,482,357 *352F061DAAD64EE7514C7ACA32284BB57C876D6A 1 XEYLE
520,482,358 *352B0270E2ED7BF2D18647C8BEA4D832C713F14E 1yararlanacaklarini
520,482,359 *352563558CB506F448D0D53D4B60D82BE728EB65 ung3rmlik
520,482,360 *352A974FC209C3BB592D80B621140ADC4D567319 URBANIENNE
520,482,361 *3525CB2579D884AFB62AFC668ECC948AF94444CF 2248006 koulun.ulkopuolisessa.opetuksessa.koulualuetta.on.my
520,482,362 *35285CC8CC93DE89F57EBF9EE60C69DBA5B78A90 2316342 ARVIOINTIEDIST
520,482,363 *3524CED01F46CFF55B8B7831B517A0DAE8ACEF89 24-zirvesi'nin
520,482,364 *352051110579EB3EE9ECE33389F1AEA811618545 V01D3RS
520,482,365 *35214FBCF1C3F98F9EB65DAD95303E67FC13FB03 valentinvaugh
520,482,366 *3522234F420EFD512CC4B6F592A7275C51D1AD75 VANCENAIMOLI
520,482,367 *3522513188347F6FB2FF4BD406D3ADDACF7CB34E VAN DEN GRAAFF
520,482,368 *35262B11B0201B8B74CB772A8F94DF218DCB8362 2FDEMAND
520,482,369 *352BA31A763EFF8CEFEE25177212AAC7B7788A5C [email protected]
520,482,370 *352C01BD2B223C35FA369684D2163DFA9DC7B8BE 2-KAISA-VAIMO
520,482,371 *35263E0D567C9FC231C86930471B05ECF24DC222 2KUEBELBECK
520,482,372 *3522E98D759AB98C3BCD4FAD2F235B23436A6A80 VICKY NOWLIN
520,482,373 *352FBC896088BE7B9EA7781449BAD2D60092C34B VICKY RAPLEY
520,482,374 *3524B9097834CFA49EE0FFFC54E941FA66E1FD33 2MAISONETTESTIL
520,482,375 *35219337DECFF69C1F0F6FDCA50489BC5F562A79 2 NELI
520,482,376 *352C09CA0782673DA3C174F7D404B20C96DBAF5E 2 RUBIDYUM
520,482,377 *352B4AD356C6F69C344C783E9C704E968C4922BC 2-stegerwaldstr
520,482,378 *352B7D8FCC89FC2AED1D76B3B69CE3737EB05F6D VINCENT BLOOD
520,482,379 *3520F4C8E9FD5E0378D4C5FB6111612D24567889 virgimarpadernal
520,482,380 *352459D23C0F3741D90C9424EA8F434754EA4D74 3######@~0~o-(0-0)
520,482,381 *3528360E2002A57BD2CD8214130E62B8D2646D6F 3######)~0~osplat!
520,482,382 *352583F03F4EF381A3D3C91D407F02F4503273A6 VJ;AAA
520,482,383 *3529363E27AA775642210BBC434D8C699E2F263A vocational4
520,482,384 *3523E80CBC9D0B44A34DA0A14EBA754E5888D3CC [email protected]
520,482,385 *3529A1E1156FAA1FD3B693C27877816B0F1F90A0 3FLAGTOWN
520,482,386 *3521CFAB952390824B39E8FEC25C3A0F4B08773F [email protected]
520,482,387 *352D5A34F8ADB52CED52BED136D9D414627394E5 3#>~-~-}o{
520,482,388 *352232B46D33956EC3FE1EE47D941B63BFD87C6D 412ANDY
520,482,389 *352A7C3040D8A171B18C0BDFD06FC4CF0593E57D WARYAMAZHAR
520,482,390 *352D05E37BDA4F1F84B1BD3E810D8598A8531169 485WILSON
520,482,391 *3526C7E599E34AAC468445573498E0FE7FC27F98 WEBQUERY2
520,482,392 *3522CB3BA71C96B677C7D45C3CD1D58A3A5CC714 [email protected]
520,482,393 *35233B77F0C24AC86F6CEBF5CA621B6F8B9508D6 4LOOMINGLY
520,482,394 *352393C534AECDB08D1B96F0BE8F2198B309C3E5 4MINISTERGESPRAECHEN
520,482,395 *352E59732739EE25FE01D60A6527708ED7CAFF5D 4mypeter11
520,482,396 *352C7E2F3FB678BF4628621ADC66465B8B1532A9 4REORDLISTA
520,482,397 *35266935E17D0B634A8D1065ECEB10ECB873A344 4RYANCHRISTY
520,482,398 *352E3340286CA53B9A3977F7E6AEA529C6C52797 4SIATSISE
520,482,399 *352C5FCA1149DB1FE1A310C6862AD83D6F7A0D40 4TAOBEFILBSW
520,482,400 *3526902783C20385DE7C190BE315BF6061DB629F wiggle on th' flo...
520,482,401 *352EDD07C4F28A97145AFBF5FB4328A5830F79BD wikipedianres2216fi
520,482,402 *352DB59C7EB8791E6D5E82DBB394E103857BCF63 WILBUR.KAMKE
520,482,403 *352C5B2EEBAF8A7B13627EDE43C17D53B0FC6A70 4VOMILADB
520,482,404 *35206B2AB0DAC05FCB438A19D83BF43835AFCD65 wilfredlibby
520,482,405 *352960925C6246E8BC711AC1DBEE873C1D7B80FD [email protected]
520,482,406 *352F9EC15035CB4B8D808E4FAE30F9CFB1483071 WILLIAMSMARADE
520,482,407 *3526B23DEC72AB1B2939B4E61038E5E384288AC8 willydeininger
520,482,408 *352E2A97567DBF1E8031A3E3C55EC23A50196504 WILLY.KECSKES
520,482,409 *352EC211709AD7794A32EEA8BE353840051A6DED WILLY.MANDEL
520,482,410 *3524BCAC9391469234AA27EE79B27162A85C27DC WILMAHARDIAN
520,482,411 *352C1BA6834B178A5500B5BE6CB9E65372307BB7 5ALBRITTONS
520,482,412 *352FD5DFA2326E0D46F18658556476510F7E9AF1 WINSTON-BLACK
520,482,413 *352BB6A912852675C646858788A87BFDB1C89652 winstpercentages3
520,482,414 *352DE214B10F548B8C2D681C81AAD408AECAAB6F 5BSWLOGSIGMABSW
520,482,415 *35218C16D6A0E3D9063DF7D3C041576E5D60E41F WM.MILOSCH
520,482,416 *352A3E1C04E2085B60296A9C032279365FDC8CD3 wolf.levenson
520,482,417 *3529B160793273FF7103CCB3C3114A9AFAF9215A 5curisent
520,482,418 *3524FF68600C0E72BCD7E09434927E919CF1F5D0 5LARRIGANN
520,482,419 *3526A14A39FE5307600590F00B78D04D841CB8C8 5MEZZORILEVOBSW
520,482,420 *352EE4B54A556B8C1113D23AA33FF5F7C81652EE WWW.SWORDACADEMY.COM
520,482,421 *352CCE5794E425E238E93EF8FD0915026E928C56 wyattgeans
520,482,422 *352E69BCDC8F0CD95929C1495E2B113679659254 XIEYONGZE
520,482,423 *35226F5C403A60B6E38414A41BBB7E8A6E793732 5thatbombay6
520,482,424 *3524BD1E42955C8639222B1AE71178F26CEA3432 XTTRANSLATECOORDSBSW2
520,482,425 *352CFC41754DE10DF6C897CACF81133ACD12A252 [email protected]
520,482,426 *35269AC48CFBEF4ADC1E88C7B03B35B50E283E34 [email protected]
520,482,427 *352860DBE32C22B928F0D0B34135CE22CC7C1FCE [email protected]
520,482,428 *352DEB609169DB7B57944C56F632DC91D4F4144F [email protected]
520,482,429 *352D35989B51F8A149D92E177C951E57CDE96F4F [email protected]
520,482,430 *35249116DCA425CDA0AE2472290CFC2F53CF8A46 6CILSHCAW
520,482,431 *352E0DC2B3046232D95BD1A27A31DC77C5996BD9 YHTEISTY|KOHTEITA
520,482,432 *3526584268775010D0A0A40F11D003682E364B80 6GELOOFSWEERGAWE
520,482,433 *352780A7A2A62B06E9754196A19E4FD9CF0A0F25 YONG.BLOSFIELD
520,482,434 *352437E3CDCFFDCAF5D47EF8A54A7905E50796C0 YOONCHIL
520,482,435 *3523442B02374FDD0F048DF8A7550859C3D23866 6IAMDAN4
520,482,436 *352169A340F38CB7460F163AF04C0B9D1B6CD399 [email protected]
520,482,437 *35225D8C142E5D100AF9440C697EEAADD16E8BDC YVONNECPS
520,482,438 *3526B18EB532B5A0AC1008ABE039C393271BDBE2 ZACKY CHARLYE
520,482,439 *352037CB4B158DD607041B9D98DC613D43FEE779 ZADAKUV7
520,482,440 *352796C6CC8E8DD7B35E56A866AE2A0165BA801D 6STARKEGRAD
520,482,441 *3527F6FE70DB5B6B6BE25879DD3A165A3220B338 6THEALTIMA18
520,482,442 *352BF6FA019651D2D547D2F0143912234ECC5841 [email protected]
520,482,443 *352A42BA11F2F6CA339BF8DB8AA5F375BFF64F0F [email protected]
520,482,444 *352DEB706E50FD70CFDD82B382E55C41FE2CF54A ZHUXIFA
520,482,445 *352058453C99204F36933350F8A4D33A33A605AB ZINTIKU
520,482,446 *35241B24B016260D49208A4D7DCECB72D4590984 ZPSOBILMI5
520,482,447 *35255C1858818CB0E35DD4C9E6E3A79F60625955 ZU$H
520,482,448 *3529CD2ECD9D275F1E91DBD06D8FEC0EFF63BD5D 7BSWAMPHENOLBSW
520,482,449 *3524E40E71939109D42232FBF46CB43218FCE454 баэна
520,482,450 *352F30467B5812ED327D674F542ABD72D763B87A ДЕНАЦИФІКО
520,482,451 *352B887D7C7C0C00DA6127540FF41E20BB86F1F1 7DRIEBENIG
520,482,452 *352293B027D980684C08ADF278FB29CCEF85EA52 7PRAVESHAAYA
520,482,453 *352D2274E75EB9A9F04CBCA1E089132265E75C72 7RADIATA
520,482,454 *3527F971D793F3EECEED7D508AD6A67221DEA113 7STUDEERKAMERKOMMUNIS
520,482,455 *3526F4106839A887271FD3A4CEE1A219F1F8F197 ХАСЕТАНИ
520,482,456 *35287100EA108B9A45C139DA2894FCFE3671DEAE 7VERIMENT
520,482,457 *35285737E0E5A3D5607BC3EF4D52F0782335581F /-._^----|-----|^---^_.-\-----8,1
520,482,458 *352C5B44ABE69FE5B3565E5E80E0369C7C1FCF67 820NUB・820NUL
520,482,459 *352B802250B1C3A5DFE28A651B7C82B0C2310966 8ANIMALFROSTY
520,482,460 *352DD5F12A8B6C64B134397F73B1FD12AA3B5A5A 8BSTNDSKNTR
520,482,461 *352292D76377778E1F1771963A1602F0FF48D46B 8EGGODLJM
520,482,462 *352C7A4C177433F950F4010081BBAA1BA61AEB17 8ERYGORJAXXDM
520,482,463 *352F7A077357C26F111A708135969215CFD1A61B 8FRENDSHYPP
520,482,464 *35214646F96F3EAA604DFA2353141985A95E1515 8iamtina7
520,482,465 *35285058C87B9516D245EC20B0B01B3817CD50EE 8JOSHUAPORSCHE
520,482,466 *3527654D855854E0D3562F9BC2A5506D212991C5 8KOSOVSKU
520,482,467 *3521DFDC499E8C0B13512FB5BDEF44845957A2AA 8MECHAKOOPAS
520,482,468 *35228F932138EACF0DFFD04C77538CCF1DB35DC5 8METATATI
520,482,469 *352D47B8EE7396162ABB6C66581EBA1838D5D8E0 8PLEASESWEETS
520,482,470 *3522350316C3212F75C49915F13EF144E1524013 発砲・B・ZINオフィシャルサイト
520,482,471 *352884586FEAF65D09823EA904E5D4ED1C761A88 9BLAZERPEANUT
520,482,472 *352572F89FE9E2090CCFE6FB54EB33CD4F81B2F6 9CEZARIUSZ
520,482,473 *352005F9DD77E748DFE15BD7272343C7F70F7FCA 9CLAMORSAY
520,482,474 *352AAA773E1A3E7FBAD84897815E720E044859B7 9COWBOYSASDF
520,482,475 *3528507FCB3AE2D45729CF7AFA57C91EF97BA17B 000000NEBRASKA
520,482,476 *35287C1335EFC76C4761D46604555311628644B2 9ELIMINIRAHU
520,482,477 *352E365D8975F4ED6F7ABF1D99C3BBC9F780595A 9EREGIEW
520,482,478 *35262A64375505B4B8B4F4642F6DA5165E178358 9LENNONSYSTEM
520,482,479 *352D0A9C6626AC0C252273DA1C2197B37A82EC10 017kylee
520,482,480 *3520D752E2BB33C989A4896ABBE7D5D8C52B8A5D 9STICASTE
520,482,481 *352D37A02AB24EE8BD83FA9DEEC608C9C7813036 a)=:$
520,482,482 *352CB11D714D542D999696463F29B58756116D60 (_0)o~ 0~ d#####P
520,482,483 *35231DD66839DA1A403EB0F3A31B9F2BE6FF5081 A'0
520,482,484 *352335118132D6EE942183BA14C2EF8EB95B7F45 133422 und jetzt ist es aufgegessen
520,482,485 *3525F7F109FC6DE49B4B3F5F55B6C96F706E8DB8 13SEPTEMBER1808
520,482,486 *3526668790A046D25B49E9F87D591CE53E08C1DC 1592609 SELV
520,482,487 *352F6C7942FB5D3E56797E8B5FD5CBB4B362AFE3 1614111 AVARUUSTEKNIIKAN KURSSIEN TENTTEIHIN EI P
520,482,488 *3525DADDF10311A842C6EF8BA77830D27F1164BC 1646690 SUORITUSJ
520,482,489 *352B3996AABD88FEB58BD0C03B5DB963A2F2E525 aaxm|
520,482,490 *352A5D305E68F46EA7A46E671B0CE5072EEA4FB9 ABIGMAC3
520,482,491 *352C911BED636BCAA5059EC1CC0FFDA3FAB0D620 a child's plastic truck
520,482,492 *35242F07D0AAE21C9D4AAECF4A21642294717A64 ADAMKLICH
520,482,493 *352BAE708D3E818439EFA2492593F709CF856870 a%d-e
520,482,494 *352B1BC42C0E12C5FB718992383925AAF26BEC45 1.geronimo-darsteller
520,482,495 *3523027C7DAC236C3847ECC7BEBC48B4F0DC775D AFAYU
520,482,496 *3524EA9861B66AD8D6A14D5441A802C2F4316C34 1KUMMIYHTEISTY
520,482,497 *352118591A8CF5D1C956C15472FE956C7F769002 1.laenderfinanzausgleiche
520,482,498 *3524EA3213B71144D33C5A622B02486C22CB749C 1MISHCON
520,482,499 *3522A3F382F231198F82392F0257C02CAE1DF987 agppk
520,482,500 *352762209F2688031B9F6CC65B15332CC361111D 1SENSORLERINDEN
520,482,501 *352204373E9814926E5C96FE3BF1BCFC61421936 1.SIEDESTEINE
520,482,502 *352384792202DC6914124DD0337BD85FFE92A4B6 1-solakampia
520,482,503 *352398D3AA6D7F52A0B4C820AAF220100F0D180A 1 TAGHEUER
520,482,504 *3523A429F35CF4CACE8025FF887691ACDD38E3D8 ak.4t
520,482,505 *3529A1E636EEAD89937CBB348DBEAE52DD8E50D6 2006499 jaa.-.ehk
520,482,506 *35253B21445C544C80C4A006A44F39B99F70E902 ALEXBRITTIPIOVEVIDEO
520,482,507 *352010494C0BDA28E33066199D5D193E01E665E0 A?LL3
520,482,508 *352C6EFB274CB8F053CBC74D0583A2C3341C4B3D amber-richetti
520,482,509 *35234F8978673C39CC9B7A9A5AD8FA634BBCFB3F 257332 linkit.huom.:.jos.joku.linkki.ei.toimi.tai.haluaisit.lis
520,482,510 *352C6DD430D2DABEFE65E4733B13832839746A44 25OCTOBER1629
520,482,511 *3523F93FDF361C0FEEE26E0B06E5D578FBD6829E aneehtan
520,482,512 *352848C989C5AD48357E1E1CE1191739F624A33D ANGELO.SVETLAK
520,482,513 *3523F93BCAD92155491C623D402808CCF436C828 anglomane7
520,482,514 *3529027AFF3EED041806A3FC3D5D0AA833A3EE28 anthonyzacchara
520,482,515 *352ED686124AC159645C81B127BA098E5458B756 2957975 alltech executes mr grayer's orders through soes
520,482,516 *3527B9C53A23723CC129768DFB8ADA95A37E4B1A 2 apartmentstyle
520,482,517 *35242C33C16F8006D438F61155A99729E494D7F2 2ARGHSES
520,482,518 *352CB99DCA3C9F5AB058CC4B72DAF150AC80078D ANTONIO.OTERO
520,482,519 *35225292020D553BACF9C9CE41F7213C5D1774CF ANUJBINDAL
520,482,520 *3529BCDAC00C1E6DBA0D86BB30E66082372BC02B 2COMALAPA
520,482,521 *3527C287946999D29674FB9084C5D96E3B53353A 2iluvvictory1
520,482,522 *352F2E3BAD11FF1E40FA7BB6DD4BBF28FCB556F6 ÄPLE
520,482,523 *35234C9C7606A3219EB94E623AD08E660620C792 2NAAMMAV
520,482,524 *3522EE4C75A58196D3D959AFCA30CFC320845A6A a;qdr
520,482,525 *352211DA24F0F3A05B17AEC9AF5386FBD52DFF3C ariurtsn
520,482,526 *35247B23841885A34094C505015FB80B5F414034 2VAIABLES
520,482,527 *3528F38AA6498A61F12ECE6FB2FD71741C445D31 arn"s
520,482,528 *3521F0B5ED65A438FC0305FF3D83373ADA82DB84 [email protected]
520,482,529 *35213FDC7BA8B940E9C36B324F477C01D8284871 artbrichetto
520,482,530 *352489189C89A462ACBDFC906C08DC41D0695C0E arturostamm
520,482,531 *3522AFDD7B564A9EF55CF3C368D1C27B9BEAA859 arv!l
520,482,532 *3523097359B4C0798666EEECCA8F23B7F6013194 389carlee
520,482,533 *352AC0DA03BE873FDBECB90D4AF8EE3639F7CA1E 3B< o~0~ <q
520,482,534 *352C46A78F316595E308E74355D3BEE9E56CE99B A SONG IN PRAISE OF THE PEOPLE'S LIBERATION ARMY
520,482,535 *352316E83322280E3FC827B4B718959B26B2BFE9 3-FARBWIEDERGABE
520,482,536 *352CE9A724701C682F048455F4964D24260E4D1D 3FIKZJTY
520,482,537 *3525E5545268AA88F9474C2C6C041D83400109A7 3IAMHELLO1236
520,482,538 *3521FEBC2DE0B39BCCD734202FB72B6D1C12DAD8 3-PICTURES-(OF-YOU-&-YOU-&-YOU)
520,482,539 *3520682DBADC671457581591F820965753D35AE3 AUR$S
520,482,540 *3522275C41AA06B231999B2098A6D131A7442A0A B1NLN
520,482,541 *35247FC365AE9FCC63D9FB39B45BCBBD074CDDC5 B7VN&
520,482,542 *352B6B939AB6D422E87EB16741CE51DF1B1E166C b9kn&
520,482,543 *352A5C267E68383E223EEC7BB0AD678DE357866C BA?HD
520,482,544 *352226DB047F646363BB4E55A99A5E6377AC5A80 BALBIN B/A/L'B/I/N
520,482,545 *352ED45432F86EF75194EB34E7EA3324BFE60FDB 4SANOYBSW
520,482,546 *352C0B51519AA9F937CB872C4E2E3F484D420DCD 4THATACE2
520,482,547 *352A5DBA5C9FE2B6E3839F2E6BEC2768F78BD246 BAŞARAT
520,482,548 *3528B08B35F168024EA53CBB3F253C58C4121724 [email protected]
520,482,549 *352ED184F1F05ECE4C2BDA6444AAF82E092AC8F1 bb?tc
520,482,550 *3523EC5AA33328973BEA156C78FBCB331B858E7B 5ELAETTAEJAE
520,482,551 *35270B985C45090FB0A8D85D504E5C347DEF7F70 [email protected]
520,482,552 *3528FD09B6C4AE24493F0F321E4BCDC40EECC14C BEN.LAING
520,482,553 *352C60BF522305391FF520C5DF7DFCA7C21B0C6A BERNARD1303
520,482,554 *352A3BF4211A166D0528263D36979CA99581D97A bernardojensvold
520,482,555 *352170DEB1D60658C0DEBEF1DE504CD561786525 BERTRAM.PETTNER
520,482,556 *352B352555EE3D1098BA543286BF156984890A2A 5STANDARDDATEN
520,482,557 *35262CFAFF97F39677F9122B4852FCCB0DAB5467 bg(1u
520,482,558 *352601A0BE0407148D5FC949951EA2A8170F5C67 5XCMDPANELBSW
520,482,559 *352242C31064D1330AA198A8B5EF237500DD842E 5YDIRYPID
520,482,560 *352002674DDC733BCA22B66247002758C801A10A b.ghn
520,482,561 *352D295077C04B19B906C439761188302BCC74E5 bidnika
520,482,562 *352DB5E6B724B643871A3E45C314DA553DACFE44 BIH8A
520,482,563 *352763C29E689D443B80205D72B84AA0F7FC63F8 bjp_s
520,482,564 *352CC386DFFF0ACBFA2A6DFEC53773ED28F27F91 blaze line / a day dreaming
520,482,565 *35297B420A40BF8BDD9ECE1CE984E03A486106E8 bmeam
520,482,566 *352342418C0FF3FF3A7CA90C5A5344E8640BD895 B)N
520,482,567 *35201023E0A1C39C5AAD05A9C2462DAA4528A8E8 6NOUANTS
520,482,568 *352E43E6EBBCD45FB03042758E816D7C4EB01748 boq_v
520,482,569 *35271A539B78E3C19E470739941F89F26D9AAF9A 6PARIUELA
520,482,570 *352531B69FE0C189A7155BC9F115757F1A37CD38 6phocidae
520,482,571 *352D36CA96658372800DA25306C46E7AC868EB4B 6SCELTOS
520,482,572 *3529223D63D8FF12B43F84BF0BA7825D120E2D9C b######p~ (0_<)
520,482,573 *352029F6E57D375196FF6AC77B958D1AA7185A1D bq+w6
520,482,574 *3520AD90AB67AAA319623212224B58A71103E64A 702308 cunku sanayilesme ile iktidara yeni siniflar geliyor .
520,482,575 *352A42A196AA1E3FF2AB6ACDDC48F02490B6B6B8 729259 AM.SONNTAG.NUN.NIMMT.ARTAN.ZUM.DRITTEN.MAL.ANLAUF..
520,482,576 *3520E314A9992D0004B9DFFDFB926AB5359EC62F BRIAN.ALTO
520,482,577 *352A79233496793653956392ED2ED3F6AD2DB340 BRIANTEST1
520,482,578 *35263D9E45A4BE4A2A1549B9224CF45D229EFCEA 7ACQUIERT
520,482,579 *352BC5BB2CB349F2BBE18DE3CA0EB500AD3F9358 BRRCDNT7
520,482,580 *352BDB8FF2A0EAE2427747BEB92A95E23F419EE7 bsdsh
520,482,581 *3527872A313857738BC2DAB88288FB1475954FE8 bswreproducable
520,482,582 *3520F61B2D81FEFE8005B60E2D0AA011A7AC9B4B BSWZIENDALSKIBSW
520,482,583 *352C7E960170E07E4F914E6F91D09B210817969B B_t)
520,482,584 *35292D6C2EA91FD10B1484F0A6C67EEF2B80DB40 bűvészet
520,482,585 *352260EE4B71E3834A5012B62B4980031E10F797 7ILOVEDONALD8
520,482,586 *352EC991607E1D293C76D7FA272ED4299BF23128 7INNOIBSW
520,482,587 *352E3452F33EDE44695D49962CAD172651CBB9E2 bx_kv
520,482,588 *352B255D4C199D866D32E884C060B3E1FB4AAD91 bzf9
520,482,589 *35245C73B7DEA0B96D8B3D0E0EE638565D0DF8A3 C3ML
520,482,590 *3524DC21C0CD75DB2E5BBD43BA698BE92C9B5FF5 C6EG-
520,482,591 *352A9F3350F115CB0806C40541580B6AD275B0A9 C:ABQ
520,482,592 *3520BFF58448BC6FE353BD9B436E60B21BCC1390 8ALBEROT
520,482,593 *352714B97D4025E6452232C73AF1A5ECD544ECE7 CANTADITAS (DISC 2)
520,482,594 *352732B58EE12F371CA96C06E476A9E0530120F4 caraleen0
520,482,595 *352DB6B0D14D371E6FBEFB8F5387B795BCF7ABBE CAROLINE NEVIN
520,482,596 *35208A9274BE16A5A5A09E690882002BA24E6912 CAROLRUTH5
520,482,597 *3520F946FF2869FEBEE01B0F028DA50303EAEA71 CAROLWAHPEKECHE
520,482,598 *352FFD6165B2555DD4733C5DFDB424896C6F2D14 )8(.o~O~q---p
520,482,599 *352BFBD158CDB3984E09F01407824DD0A6E6A8FE 8ORPOLAPSEN
520,482,600 *3523A6BDC649A29A6B6C43743653D1FB5EDC685A carsonspaide
520,482,601 *35256A8052035B16F11DA5D9C815E89B483C861C 8===p-~0~o-(>-<)
520,482,602 *352CF5FC5AEDE9A156941D01B8FC3BAC5F054227 CATEGORIES32KATSINA
520,482,603 *35292BAE193E33F86CAB511CE06A1FCD5BB263A6 cbpvo
520,482,604 *3524854A48D94B86B81ED6B37B935A5D9C4F90FF c-c%s
520,482,605 *352F4BA19A34AA7701BB41122558B1D246438C36 cd;pc
520,482,606 *35238E48E380EF76372E06D1098F013BA81D96C0 cedrickstaadt
520,482,607 *352ED0F20B48C6151183D2E8F4B8668B8C9EED57 Cello-Concerto:-V.-Lento
520,482,608 *352E77BF976A2E4F6E275199484D5C530F1EEC62 967 SCHREIBER
520,482,609 *352DA4C675E72FA886E8C8FF7D968ED1FD7447EC cernites6
520,482,610 *3527791D0875A40346C89A05DDC5F79C0235E66E 9BSWCHERRYBU
520,482,611 *3523554CAFE590381F794B06F45A05A501EBA46F 9CRZYLIFEAG
520,482,612 *352148FD44B9A888EC782458DD1B482CA4ADA482 9ELBURR
520,482,613 *352BB9A6D6DD597A3387F40BE6EB112DAFBCBDE2 9FACTORYSHIPP
520,482,614 *352C86A2411985057E44FA21F393A8E62DADF083 9FIBROADENOMAS
520,482,615 *3526CD70A32C7A1D55B37943B876B9A2528AB24D 9ILLTHHTLLI
520,482,616 *352A765AE1194C94724E1FE8CE65E7E2C235EB9C 9ILUVCASPER2
520,482,617 *35253B42EED488A3907B9A1ECB74FB3193EAEF04 CGH(-
520,482,618 *352913C4F4E50B5AF84FD709C5D0C82AF6225548 CHADWICKHABISCH
520,482,619 *352962FAAED7BB56FC948C053AF87385999DAE75 CHARLESWINEK
520,482,620 *352F4DF475879360B5F5A537F502E1076DEC56D5 9PUMPKINDUCK
520,482,621 *3522B9D6311525B6A62B180EE73A62CB5E5CC504 chatol!
520,482,622 *352BC06264762EB475F484B69B2B4FDC2EE86C32 chibiondi
520,482,623 *35222416A07FF1607D74EC34B254E423003D8219 9VERDWYNINGS
520,482,624 *3529D517065132A828AC6B55FDA85FA1854E9A9E a0:g,
520,482,625 *35236CB73B0A13864F5A7EA1A7A604EDA62B861C aadg:
520,482,626 *3521A4051E964F20CCC9CE06AC4720F153627174 AAD;X3
520,482,627 *3522EA92C05E8E19CD208DBD56033039DEE1BF3D AAPJEAAPJING
520,482,628 *3522E9255B904EE43810502C898E0A822AE0EC6A c)hss
520,482,629 *3523ABB56AD7ECBA9558C7AAFE631D7D62E62B54 cimpleru67
520,482,630 *3528BB7EE8132E9DA2444425B5A8D943DDAD6101 civicae
520,482,631 *35240592EB33C9FE771ADEFEF8C1D897B1D5085F acpo1
520,482,632 *352AB25E0853C9E28F0CB5E56189661B1602F1CE a.cwu
520,482,633 *352EE31AB689F5C0E82A840E3C4CB6B423825AE0 AD5;M
520,482,634 *352B11D009F58CB6D0C517EB84C44BFFB3E0928A c_lu
520,482,635 *352F9330B9309088D107450F331D6C37363E6EBF c$m-
520,482,636 *35243654FD3172A427EBB935889FC753EB8B03C4 adminiculum2
520,482,637 *352E08A5B3E67CD92E2B5436395D471E8D693F22 AFP5T
520,482,638 *3522811265DC7038E71450792E9380AFE2850C6E congojading
520,482,639 *35259FBA0AAA44B19A075DF8E39C1E2424C420F0 CORNELLSILGUERO
520,482,640 *35226A6C8A0F37FF3755B949077B95D339633E81 $CORPIONWOR+
520,482,641 *3523A6988FD26DBE0D46A3245AB4E3C6958689FA CORTEEHSED
520,482,642 *352407E66B3F589E49FC72138F382BE6A6290F5C co/st
520,482,643 *35297263F4038D2854ADA19DAD5765F9DB2894C5 C:\PROGRAM-FILES\MICROSOFT-VISUAL-STUDIO-9.0\WEB\WEBNEWFILEITEMS\JSCRIPT.JS
520,482,644 *35225C8FE07CCEEEAC000B40037E649E7E2709BA crezcrez0
520,482,645 *352D6206A237708F91802FDA3881DA842298273A alexpurl
520,482,646 *35245CC49FB2835B8D45DB458C55C54B9C3D6F69 ALFREDO.VENTRELLA
520,482,647 *3526B89EB291729C137EDEB5498F9B430DBD7429 CRUISEDEATH
520,482,648 *352A5FE34F0E1CE479202F9D14301EED1ACD5253 [email protected]
520,482,649 *3528DE1DA5910EBA1684E58FB02A8DE01DE77575 ALKADIËNEN
520,482,650 *35294B3E645DECEFDCE9B661BCB89FCB3E49CAF1 csimicromedexcom
520,482,651 *352AAF58B75F3CA4183DD2A69F8B464F8F2903D4 C"SIQ
520,482,652 *352D752FF9A94825010A0F323F9E30FE96D75BC9 csk72
520,482,653 *3527E1CD765D298DFA1244A937A7805FBF352E5B altheawilson
520,482,654 *352EEFAF81C23259E15EAB13F692255D09E83F98 CUBINGV6
520,482,655 *3520ED035E5D4350D5925757DC8BEB8680678D4B cvl.
520,482,656 *3528E84B643D2AB3DA62ACBB1F11A5C5FC249264 [email protected]
520,482,657 *35222F23022188E6A63BF976FD457DCA1307D84A ANDY WITTE
520,482,658 *35279CD5D6FA5E418B87BD4DA0D938ACCA04674B ANGELBABYSHOP
520,482,659 *3529A9564763C58904F334AB7D9095669CD77983 cy;v1
520,482,660 *352BD6F9CD93B9DCC953D4F0226F488BE57F41EC d052/
520,482,661 *35203BB457E89970CBA739FA9D9549DB97DA6B2F ANKD1
520,482,662 *352683BF8C3DBC89D488A4D8234EF4192D3A4366 annie463
520,482,663 *35218156FC61AB8C9A022D89996D75183A497176 d,5!6
520,482,664 *352F2EAA75A2A40B48245A279E2D042A6DAFA95B D5DBB
520,482,665 *35207CE337DD1026C80E0465F3C1E24CAFD8B6C4 a+%p
520,482,666 *3521DBE1F22772D13F8516E95CD18541D9B5CF97 [email protected]
520,482,667 *35231671BCC6865E8C3F47188AEE7D0AD78C6A68 DALBURY0
520,482,668 *3528E5B61C9ADC5898FF52D394EEDA816D2EFABA dancodoarcoiris
520,482,669 *352E14A8D7B44855DA7E299286523A5B1B2A8FAC ARLENLOUGHREY
520,482,670 *3521927F03ADED392CC2F15E8B523D2D45A18D0E arm$0
520,482,671 *3522A8307B722BAF344018D22BE46CA608F4C0EF ar+ok
520,482,672 *35241717611A163CC2157256E7C54B9DBC4B758E DARLINGTON160
520,482,673 *352C4DEE773FA5903C2C29657814F96CB0B10F0C arthurskeem
520,482,674 *35272596B3BF23F2292AC8C834FD8B60FCA2A1BC DARTNEVOSROD
520,482,675 *3527C1E5D7333588040B823C1237AE0B39179852 dd")%
520,482,676 *352C306A8FE070E0BCDE1D0F2531AA3A5917CE52 at,?w
520,482,677 *35297CC7BD7D05E4919E48176E7BC74CBD5D6978 DEE DEE ABELLA
520,482,678 *3522746DD7B793663D85B4F3CE414A9425D21AC9 auqb!
520,482,679 *352F491909883AE209D830E76F0507EB1AC42469 AvrY
520,482,680 *3526376B0FD3F6880A9EB2B17257C5BEB7134011 axdo
520,482,681 *3520C701B7ECDB47E22C61A984CA1EEAB9D7839B dh_shy4eva
520,482,682 *3527B0F68B156E1E138570D4211F29FF44AE2CF2 DIGITALJEREMY
520,482,683 *352F3A24EA5F8E6CC2B4B9D7899E3E3C9A046C34 DILLONSENEGAL
520,482,684 *352ACB1499A6F6FE8A6C207172C3C2A501539735 DINAMICOL
520,482,685 *352E8BF89219A809B8B9EB857F9AB582BF754687 DIRKHALSTED
520,482,686 *352872B677B014EB8B2441298A083734EB6ACF4B b;7_q
520,482,687 *352A99AD5706CF445F42D886416FE95BDE9B3FA5 b9u1(
520,482,688 *352B9A4ABA812B46C2B54B350C77600E51EE76D2 [email protected]
520,482,689 *3525E7A5284E950A0C30EC338F92879D6E9C2FB7 ba/q5
520,482,690 *352F953C513C90D2B475B21FD745A7D9B043F8FB BARRETTMOLPUS
520,482,691 *35286A3859B3E20825A300C7A442CFD0E1E41A72 BARTMANQWER
520,482,692 *352AEA123B49ECF95B94D1AFA787837EE6063ED0 d)n-)
520,482,693 *352124CC616B25555EE50F11F65761D806EFD6B1 BEHAUOUR4
520,482,694 *352E602022AF9789877D5113578E41B13C219C50 b#eoe
520,482,695 *352F9533D9C611D4B839DDDEA278E4BF9EB96051 [email protected]
520,482,696 *352984FC77E0DFF3EC10F95D7E03E33D8A7704E8 BFUUBSWS
520,482,697 *35285637D50DCEF9C9B3F44ED74DBF1ACEE2D92D BHTG$
520,482,698 *3522C0DACED6CE6D17729576F1E87A1A66848EFD BILLYULABARRO
520,482,699 *352EF853ABCD54B2E98D56D17739F160471971D5 [email protected]
520,482,700 *352A2232DBD91533ED0CC92EAC2E18019CE77E01 biology703
520,482,701 *35207F521B4F8C751EC4781C444CD1AD6A755740 B,KKU
520,482,702 *35285F388007D630515FA3F526696C318AA20B39 BLMNMNDN5
520,482,703 *3527BCE6810DB1200B75CE7C16437B8A159DDA29 DRQK
520,482,704 *352631F7BB7D8ADDE1CD1DE6F1554E674B625F7E DRSTACY0
520,482,705 *3520A64725D7D92C9D43707A9A2095395E0FB91D DRWQU
520,482,706 *352E3C9F204E3E98E3CBDB552C65F6B96C7350C3 BOBBIEBOIN
520,482,707 *352ADBE83DAC47106DC29CC968F9700D18A6647C Bobby-Garrett
520,482,708 *352E24FA3C292163F4C2081E45323FA075CA521A DTKTM
520,482,709 *352FEF5EF035EBE6D21DB000E90D2FA813C0E5C2 D.TRB
520,482,710 *352471210F36485C2426249F20C7348A64F3AE61 D?U;G
520,482,711 *352E7BBE167AE39FEC00C7CB274C969F50A08492 BQ"/
520,482,712 *352CED9E568ADAB44E50BE5E5B2FC24B4C5BEC26 DZhh
520,482,713 *352D81BB99BB35E5F5AC3C490D9E3655299C0E84 brendonhodder
520,482,714 *352A41E829A9317F9DA5FE07D6DBC8E5B405BA92 brizzle611
520,482,715 *35270CD03E2D4953BC40DA16D2228C0046B55BB4 bsolt
520,482,716 *3525D7350CA7B5C81C2865201E4B40A4CE328FAE [email protected]
520,482,717 *352728198D1E50EF2AA0A08A3CD966FCCB9D2106 btmog
520,482,718 *3526A46AD4604EA8CD9A2970B4F8942055853EE7 edisonvidro
520,482,719 *352BFE15C6C817316264763AAA657DBEC8E6D5BA burnin'halo
520,482,720 *352C248AC410F0199917200210304E281EB9F00B ednedlgded
520,482,721 *352816201F83C1B00CC5752751A57A4C881B4362 EDUARDO.DIGIROLAMO
520,482,722 *3524F30BEFAFEA9A71D47F2D7DCC331ECCFF39DC EDUARDO.WOEHL
520,482,723 *352FF07465DF101C8EA4B4CA27ABF8A3B311480D buyersbewareantelope
520,482,724 *352CF9B697409142DECBAB988AC2E94866BEF98A edwinpujols
520,482,725 *35249737FAB7BE5D4D7AF40624B055683637DB83 BVIRGIN7
520,482,726 *3526B388028B2DC9F5E0176C809643EB9F0EA796 B)W12
520,482,727 *3528C2CF42C3936C31621003519DDA5475735BF6 bx4hd
520,482,728 *352B1FF26577B4C50A73C36B1DAA4DBCBECAA8CB eitinumm
520,482,729 *352AF6F3E50D13499E52AD81F5B44231F4ACF746 ELDONBRUEGGEMANN
520,482,730 *3523DB212A78A930236AE46636DC50A94E858C07 ELDRIDGETOKI
520,482,731 *352CFC753FFB4FB3A537651B1099709A41DE4881 C3QTX
520,482,732 *35203512646A8611A9A9DD8FEC081E1133459D46 c!5i(
520,482,733 *3528D24CEA349CCAB007A42FA8CBD85C51E05323 C6A44
520,482,734 *35223E8F1D640144354B6A5217B0BA38C64C9B2C elvismendonsa
520,482,735 *3529A6E77DC19C7C9D7CEE7CA649B7ADBC6C23E0 ELWOODNEGLIO
520,482,736 *3529B8A6A562671186872C91F92C5D32CBE3D974 cal9v
520,482,737 *3520BD9DC4C9999C01CF5CD972FF0FE073F6BF08 EMf.
520,482,738 *352A58A7E5C52F5BF65208B005D4113D89F81A33 enlwickelnnug
520,482,739 *3524E6A3965089DE4E992C14C01E3A6578B775BC enrx
520,482,740 *352BC0D779F61D7D6F1CA00F80190FF7588035AA ERH=
520,482,741 *352353F7EFAA9584951689382716F8DFACB0E074 c$d1w
520,482,742 *352CD160B830B1095E2A40DA18B31E9B546FA9F8 CEDICONE7
520,482,743 *352747DA68AB850B83BE21DA24BC07BB6E4EDF51 evictus8
520,482,744 *352926F5FBAEB392856F856C657DCFB61B314C53 EXCEDEZS5
520,482,745 *35254738804378BCB19E3F4B88F8BAB994586048 CHADWICK.RICKETSON
520,482,746 *352B65E63678BE60F971F34F000D4BE75F4E8523 c?hag
520,482,747 *352E8A6FB04ECB5150D382A1FDB0B5701139E767 [email protected]
520,482,748 *352E3FE75DEEC1FB97441D94F677D248193D3A97 CHERCHEZ LE GAR
520,482,749 *352C2BE2B2FCF858715F42EA5C7B272F6F4832A7 chicavins
520,482,750 *352FFD7FB772A92326E23C9944A1C1DF519DA8B1 [email protected]
520,482,751 *35290169F1F07BE0563C8C9DA0F74893F8FF758E [email protected]
520,482,752 *3522A379B7ED2575A0A40AA64942648C1494FF38 C;HKW
520,482,753 *352DAC5B97309D9D44410F3D91D2A373576B1E84 chongskillington
520,482,754 *352477F03B4FEDB3C8D9B8CFA460C8B5E918F3AC chornbsw
520,482,755 *352F11B23BA9F7D9AE8AF9ED59DFC3079405644B FIRERUSTY6
520,482,756 *3526FE8AD73E01A016BFE2994F7DEA6150C38CC6 CHRISTOPHERJAMESLUND
520,482,757 *3523CFFAE8B38CFAA418CA40BC10EA75AB3BFD57 [email protected]
520,482,758 *3521458370D05255436B7C9D279FC22962035FD3 CHUSHITA8
520,482,759 *352A6316A7E8D82A1B6F3FE8B27690C7345203D0 FLEUR.JACKSON
520,482,760 *352B7FDE2B0A1A5424990D15993CFFCB56DAE7D5 CIRCUIT-CRUSHER-(TIMID-REMIX)
520,482,761 *352E8E3BB7153C5976D41B1D588F7B7618D1184C [email protected]
520,482,762 *352786ADFF73F86CEC6288B09176D7ABDEF5215B ciu7k
520,482,763 *3524D4950481AABF4A09095C3F75D02771E097BE c#kfx
520,482,764 *3520E7782EDA7B2AD3125BA8443EC2E9DA61409C CLINTBELGRAVE
520,482,765 *3522737EBE2E3F998499D6AF61629EBEF61C97D8 clvsu
520,482,766 *352A9F25B2FBEFBAA1D3C5FC063FEC324AA61032 cms44mzmwnw
520,482,767 *35221154BBFEDE2086C743E4AD7FC5161AE73DA3 COHANBIO1
520,482,768 *352F59A5C3396AFA4C88FACF4A32D09A3BA0F7B6 COLBY601
520,482,769 *352A17EBC58576937F34FBBB1B4241E02EA53E4A COLLINMUWWAKKIL
520,482,770 *352E27525F6274B2A71855A2BE6B1E5A746BAE88 [email protected]
520,482,771 *3524E0D86B5610702DD133E66A623694169EC9A3 CONRADNASSERI
520,482,772 *352060ACC49F23EA1EC6ED90F0B02648BAD5D89A CONSULTAS.DE.BORRADOREIKI.CR
520,482,773 *352F75990EB46D9B3A11F9F972C83E234E36D18A [email protected]
520,482,774 *352D24310008384A128FF3576FF96EE53FEA2191 [email protected]
520,482,775 *3520536FC5C4A4C266F87307885D491F8DF88F82 GARNERNS
520,482,776 *352D06850CA563BDB598C16EBAEA3F883B0F512A cp%5f
520,482,777 *3529D19DCB6024166060657BA2B401941203E7C1 ghiginied
520,482,778 *3528029B1B3CFBA1E49316B50ADD7A4D4314DEF5 GIMMEMORE'92(GIMMEMUCHMOREPOWERMIX)
520,482,779 *35236B9BAEB077810E43476465210E2DD7EC3AD0 GLIMTEN4
520,482,780 *35290028D234A841579ACB9EAA448B0DA9B297DF GOLFPLATZ7
520,482,781 *3523F9EDE6A6CB6F1733E2307DCB91A2D26766BA göringstrasse
520,482,782 *35296A6AC50D093BFE8955D6E6F8128B646045BF GRILLADE4
520,482,783 *352F9948F1B118F53075E832825B83B88AAAD6F5 CSbV
520,482,784 *352C4AE4090DDAB036A5E2FAA0C44048588F4D22 GÜRBETHAL
520,482,785 *352617CDD275A9BC14845A4E22AC3950CD0B8E9F GUSTAVO.AARSVOLD
520,482,786 *352235D992ADBD39DE69DAB865A1CC52C50F7DBA GVAYONITIS
520,482,787 *35298C4413E848ED63570D645CAB5157A3E2E0D0 gvbctv
520,482,788 *3529F298B3081A54E4BE562B835C4C4C297CA5D9 [email protected]
520,482,789 *352580AA9FF180F7F68350FFABF1684732733BAE CULTIVEE3
520,482,790 *352B73B3AA394F52F491411AF90FC75DAA1CB956 cvhsq
520,482,791 *352C0359E1018BA376657299418B1CEC10B7CF46 cvl.
520,482,792 *352B5FF2B5B34706E9BA550F3B126B476E206D3A hannahmacpherson
520,482,793 *3524C0DF4F2F1FF7D7EAF491B2BB5C9909D8ED47 hardhori1
520,482,794 *3521B19BED5B3EBD68106C4E54BFC2DA42EBBEC9 HATELOVEEMO
520,482,795 *352082F1E1C97D53EC3AEE6036BB0B6D310397EA hazelpurcell
520,482,796 *35299B2958916BD88010C1D18D86800A6328FB18 henrylovely
520,482,797 *35259258DDF29C2D2BAF9FB0EF400FFA1D44EA82 d3qg
520,482,798 *352C5B0A6975A0713771D624BEAE2764D9A13DBC D3S3NQU4DR4NDO
520,482,799 *352E8D05E4593B36D7991532382FB5CBC9972ED8 D!41YZ3
520,482,800 *35274EB73299193A9820653AE61CDFD29EC6D41B HEXAMETHYLBENZEEN
520,482,801 *3521F6B045DD28DF6291709CE7DE7255EC49A5B3 HIROHAKA3
520,482,802 *35297043D8402BAEEFC80E183F3E021DCEC31397 [email protected]
520,482,803 *3528A522684E296835A52505415B2A776D517062 holamileses
520,482,804 *35278D782B455B4AE3276D932CB54F46BE9586BF HONFITÁRSADAT
520,482,805 *3525BD38B33B2D32073D9C387992B253462E2694 [email protected]
520,482,806 *35212D76DBF3A2A7F65CB17897F36FDDE214C919 HOPELIJK6
520,482,807 *352DBDB519E3FD2495C41A6001D1FCF3150D8A6E DAVE.SPRINGETT
520,482,808 *3524C8283E00F66DD4237A0344DDFFC5506EE085 DAVE-TILTON
520,482,809 *35274032922318830025535F1003EB04E62A1B95 DAVE VANGUNDY
520,482,810 *35280FF14C3332365372D9F58E5EE47426142E39 [email protected]
520,482,811 *35298438C2130488AE92AD03056B543F8D586C1B davidallenmoss
520,482,812 *352A494222202685387652BDD828622017DD3328 DAVID.EBBECKE
520,482,813 *3522B7544AC6A478C6B10296A08377518730FAFA davidsikkila
520,482,814 *3525A2B6600063E7F34433B9DCBD3904B8692AF9 HTTPWWW.PEDIGREEQUER
520,482,815 *35279DCC7D46D27DF8633B6C019215B3AD33833E Db98
520,482,816 *3521A4E9F7AF32E9794B7726E675AC002A7C35A3 dc+3;
520,482,817 *3527986C224ED7DA1018747CC5501185C99C8F17 ddi,h
520,482,818 *352F5CB03BFBE8197DAA087D87A4C4A05F366B9F DDQOBSWS
520,482,819 *352660BA809150E838CA9F4A3918E3B5F9E0D1B5 IDEALISI3
520,482,820 *35283027BA480210A6A04BAF0BCD92EC5ADE80C6 deleers8
520,482,821 *352174AAF32B1BDAA6D1049E807A67EB9D98DF43 DEONBOCKER
520,482,822 *352372DA55916087ADCCC05494693CAB8679174F IIRIVATE
520,482,823 *352ABDC79A7A686AE29FC8ABC6B48E304F366781 IKEHUKA0
520,482,824 *352BD0F4C62C92C3FDE17C34B4326F00710E2AEC DEVINMAIMONE
520,482,825 *352DFA7197E57546A43A6F1E9F1A74291536C401 ILUVJAMESBOND02
520,482,826 *3524183B1CCA7E7B54B4934F240FE8CF0EEF8D8B imaginefirebird
520,482,827 *352502DFF9AAE3D02319429DB0F5D7407CDEE221 DIRK-TAYLOR
520,482,828 *352B71CBDB8859DA321CF550BAA78BAE5A690DC9 [email protected]
520,482,829 *352FB95DDE7174A83F44F1591B41424A19AFD5CD d,="j
520,482,830 *352EDA29C63CA128AAC6CEEA3F146D83352CB00F dj+$d
520,482,831 *352BB7111578A3E3C72B1AEFECE37BFDD56A85DE dl9-4
520,482,832 *352B15DC5A07FBED1E0A9DD15BFBA026C41BEBE8 DLWRRHS
520,482,833 *3520A9AA0E1D7DED1538D80FDB04E31A0A595606 DOANTRUDY
520,482,834 *3521E6B5F5BC8F76B61D817ED64C228D3D1359B9 i'(x
520,482,835 *35286074F5C70A47DDFCB2D4ACECFE52508624F9 JACKIE.ORGANISTA
520,482,836 *352245EA6096384BF0109BE8DB5BB9FB72365C4F DONCONJO
520,482,837 *352FB4B4BF331366E14B91AA8C580B5FC6C08AB6 jaedeleone
520,482,838 *352434144CCA29B4CE790671EB2E982BBA6C857E JAIME.MATEEN
520,482,839 *352FBFA871AAC20502B7EFF5D3ED8EDCCCCAD521 jakojnn|s
520,482,840 *35293E28C3EAB7BCE88FB330969593922BEF4568 jamarmovius
520,482,841 *3520EE191F9EC3CE2DCF4B672177ADD4F48BC121 jarrettopitz
520,482,842 *35216A8CFE8C6E69715B21B85EFB5E59D462F761 JARRODSOREL
520,482,843 *352E7847CC52DBE242FF650D0B09DEF45F30E12C DPNH?
520,482,844 *352B9314B08948AF28C10685BC58D787AC071D8E D)%RE
520,482,845 *35249F88EC7E64AF88A4939106CF782A26960A9A jensjohansson
520,482,846 *3521A648BB00EBC0BD6E5AE71BBC1F22AFA97F48 DRUYGHE6
520,482,847 *3521AD27F18FF59FA39CB086090177E1916BBBF6 JEWELBOBER
520,482,848 *3523BC30ABECAA143074A3F92BE27E7DE755C635 jeyss.looi
520,482,849 *3523989F61E6BF6E9551BEEB36A8B0528ABC365B d)vcf
520,482,850 *35269EAEADDCC28AC06C339D0387BA2158147E96 DV#TQ
520,482,851 *3523F4AFC39B770A02A46A6D0B6975A9593A03A2 DXXG
520,482,852 *352ABF3C0CA32A66997E1F67D75A08FC8930270C johngrigg
520,482,853 *352B1E4789CC0B34C8608A7D497BD58C3ABFEDB5 JOMYVARGHESE
520,482,854 *3520ECC77BFCD9D9E685B35FF81266938CBA5867 JONATHANMCIE
520,482,855 *3523207582F990AE12DA4D9BE0BAADD14627E397 ECINZ
520,482,856 *3527936F65893A2373E98959C0B9F59A515473BE jorgenicoletti
520,482,857 *35227C0E32FEED890346D31C3172D02881A453E0 josephcameronsparkman
520,482,858 *35210BBF22C42C60225635E81AC86A8D9A37C8DE EDUV
520,482,859 *35265FA3C292CD48E9EE0F217D35EAE1ECEE0B54 J"SP
520,482,860 *3529A956F9785CD083474062EEF3733061B7EF02 JUDE.NAVRATIL
520,482,861 *352F241E043B1830626B17AFE34939D162372E37 EESVM
520,482,862 *35244F332255B908EFC64F9D366B68036CF50F71 JULY3233
520,482,863 *352C7D9073A3F35AB5677D994A3B905013FED0D5 eg9?:
520,482,864 *352900882D5ECCDCBFC95D18C07C9B2A248E44C0 egif
520,482,865 *3527D88E63C04ABAA7FA0BB0DDCB9A7B1A791191 k<3
520,482,866 *3522A48B161E4BECE30F27AFA9D4728D5C9FABD3 ELCIEGO160
520,482,867 *352AE107AA39BC26A74452869D6B315C9D7E4041 ELCYZYN1
520,482,868 *3528394CBB76C7C727A9F7EAC91EBACFC803F785 ELDON.RIDDLEY
520,482,869 *352640AA50350991ABD38537F0E62E00A8CCBE37 ELDOOL
520,482,870 *3520B27FACC800286AE109DDAEE1026BFB88C302 eldridgestraughn
520,482,871 *3528ACD9B772505422835F9735209636759AA2DE ELEGEBNO7
520,482,872 *35228B7C7D222FFC94DFA47F4C75A5A079170F4B KATELYNKEETON
520,482,873 *3520D36B068A940678568FB63B6D214334A5A2AD [email protected]
520,482,874 *352F385B9E6AE9519DED1D01BCD2534A199EB9BF ELLSWORTH.ONKS
520,482,875 *35234A05669A903AF807ACF60BE0EBB27E52D0D2 KENDRICKRANFT
520,482,876 *352ED84FC7200B54AAA993B6A18694511ADB31DD khudozhniki
520,482,877 *3524BCE4201EE8F41097BDD6E73E098F2B246426 EMINTON7
520,482,878 *35262E531C3CECF58A99E600A2550FEE6C686596 englandgermanyjackrodwell
520,482,879 *35214C2E2278706DE9F573A9AFD01B9B37CF6800 “‘ENTIRE’”
520,482,880 *35267205755905308F0F10EC77AAF57B7902870B KOALESB
520,482,881 *3521AA1D55EA589D043DF8F6B31A043E2A1AD2D0 [email protected]
520,482,882 *352F07B767DA5351DA2BBE03949B349CF21C11D0 ep8o
520,482,883 *352474AB3AF7B173DB72F047F3534F99DA2D53D2 korvalappustereoita
520,482,884 *35269C3F0C1B1EBC4D5FA92D8DF852B8EA654FC8 ERDDRUCKS“
520,482,885 *352E657C80BD6599596B7B6B475A285B42286F97 krisboswell
520,482,886 *352AC0BBA64EAB68CE6718C292395765F8D7B342 KRISTOFER.KILKUS
520,482,887 *352AC76BD39AA702503EEC4480711D0E74AECBC8 ERNESTO.LILLEY
520,482,888 *352301077B6A0A006E4579D2D695A7713F044C02 erniezahler
520,482,889 *352BA3C0E0DA23093BDE71247FB6538445F576CC kullervo, op 7: iii kullervo and his sister: allegro vivace
520,482,890 *3520AB2260F5DCB50B3CCE9685E4BFF1ABF6D6AA estartet6
520,482,891 *35242B25F5F3DF9D0C5DBC3855D2FEEDC9F4DD54 kyoung.ae.lee
520,482,892 *3526AE5F50907E434C0D0FDDC4FDF3D2F70C43A9 kzud
520,482,893 *3529D59511605876981E7306FD0E96AAA68AAC11 L4MPPO5+5
520,482,894 *3524168AB5CED2BCF872D1B19200EA4A693C5EB7 L'AMOURTOUJOUR(RADIOJUMPCUT)
520,482,895 *352FFF64C37912A95971ADDF9D1404BF1B2EC191 EVERYTHING'SKEENOINRENO
520,482,896 *3520F077B8C3D44133C42631C2A4EEC5985C1830 LAQGIJ13
520,482,897 *35286FBF6FB074204D225D28FCDD4BD7528C54B7 LAURENCE.FORREST
520,482,898 *3526F65BAB134088E56A12A6757C79CB01A630DA EZEKIEL.RITZIE
520,482,899 *352A2FC55DAAF2108439677F3C6046D0375FB6DE LD]O
520,482,900 *352FEFCC9578B0D5A0A7D7B95A2F9BA917D0BD79 lejlaemir
520,482,901 *3523DE512831675D12119C5BF18585586C1501EB [email protected]
520,482,902 *352B7B4E9DEAF65DA53B6CE2C09700B476B099A5 FFGY
520,482,903 *352E1A480D935D48397671EE98C90E46F8B0662F [email protected]
520,482,904 *3520EB1B81BBE47AFCE3E446F9F17EA232AEEA1E first frenzy
520,482,905 *352C92AC90ABCF2B276DF39768910E46F71B635B FLBBRDN
520,482,906 *3521571B8F9B9128379347A62F803CB26F32F505 FORRESTBELLEN
520,482,907 *3523C1F437403E2C198452FEBEC7428F34A2AB4B [email protected]
520,482,908 *352D57D3B1C240F3B492DCF04531A48ECF1D932A LK-2005-(NYC-SUNSHINE-MIX)
520,482,909 *3527E1D57E77A48F2F8AD7EC45273419E41D4C37 log-magnitude
520,482,910 *35275F90CB1A9BA532AFD5CC4017B9B94E480DEE [email protected]
520,482,911 *352C64A53C783F0670A78055BC8A8CB2ACEE0542 FRANK.SULTON
520,482,912 *3520DE9200F6A8F63CF12380A43A8DA9D3F29A21 FRANNKLYNN
520,482,913 *35265DA4ACF18BE0CFC4C1B95D60A97F0E36C197 fredjason1
520,482,914 *352477548DC5F4C89B9C1B69D1F8BF8584158B34 FREDRICKOSCIELNIAK
520,482,915 *3527412549D832F7259CDCF2DDFB55C1D037CDF1 LOUIS.STROWE
520,482,916 *352A8C8C50BD0D273DF7B3145CF43B040BDA8B9A fritziacono
520,482,917 *352F65D6C2BB1AEE5FB70184C2F37CEBF4B4CDDC From.You.&.Back.to.Youo
520,482,918 *352977D33496B5E910CDFC53B7B629E801A201B3 LUCIACEB_86
520,482,919 *3523CC96909C9EC71707E39CC10C2922F779FA34 l'ultimo di de maggio
520,482,920 *352EFAA4444575645F91738BD1FBED75CD19BCB8 GAININGG
520,482,921 *3521AEFAD39521470F3D77358A44614C8C6B22C7 LX|.
520,482,922 *3526268EE685DE2E6E63E2A0AA4587A5A659A013 [email protected]
520,482,923 *35255220317E70B95F08C1A4AB59C189714E4584 [email protected]
520,482,924 *352695EC485AA4991AA9A24404E36C5FFEE706A3 MAIA325
520,482,925 *35232BFCB45E0F0E6ABD8C5AC292FD4D2C2AD004 geosources
520,482,926 *352E94BA635FCD0D2A7CEEA145481EA02EFACEC9 MARIANOBERNHAGEN
520,482,927 *352E1D43DCC6F74D0D58AFC57ABA30404D81B3AA GERARD-RICKS
520,482,928 *3521AAC8FB4FC050B94E6557744332D438139153 GET.DOWN.WOMAN
520,482,929 *352FC99D372EEE4986491757F5A438B753B3E789 MARTIN.SPRUNGER
520,482,930 *35273F8BA4051B25452850C7D85B3BCE4CEBE3A4 gieysuraujon
520,482,931 *352DDA0CBA0C2419DE69F306DFE6CAA8B98DB7B8 masonrothhaupt
520,482,932 *35216CE3991C761072415528DCD94FF7AA62E742 MATT.DELOSANTOS
520,482,933 *352B4AFFF5C070BE4EE150B1F4D21F12E4269441 MATTERWITHOUT
520,482,934 *3528E5498DD508C1D41301B84F39F9A23D2FA9D9 GLEN.DEFRIES
520,482,935 *3520F42EF2620D14C4FD95A11B25F66C1EEBACD8 MAXWELL.SILLA
520,482,936 *35252DF9FB113050C6BA4201709F9213677556DE [email protected]
520,482,937 *352B17F2E4527CA688C8B00A6B09BB0C166A00EA MC+]
520,482,938 *352E2F7CDF8D07E0561F2F6807AC7FF210B666CC MERO.AHLY
520,482,939 *352F41B718F1FB42B9A4AC18DEFC6BCB4A34999C METAS-DEL-MILENIO
520,482,940 *35267F9EBF71CE6294209A32BCEA7C8E42900057 metrodyn8
520,482,941 *352F1C1E2DFDF0C20B59F420B916C2DDD9C136BA mikael.fluur
520,482,942 *352DB93495DE172DF6A7AE4B7545D31A934E4F7E MISSIONARY.POSITION
520,482,943 *3520F7D6B55E81F02D546A802DC20597F136DA24 MITCHELFONSECA
520,482,944 *3520981E3B701052DC77038B81C8AD16ABDE78E3 MITCHELL.PYCHARDO
520,482,945 *3529DA18B14C1838DB1C2CEE7DE1AA2152850C4C MITCHELWILGING
520,482,946 *3528FFF3F9D0E7181D4EACF15A11EE73734DEB2F MKOLAILAT''MOHAMADALI
520,482,947 *352A922570D97D2C201C5765CCD43F9F6851526D MOHISINODDINMOHAMMAD
520,482,948 *35266EF366097DD655CF45C7CBD61D9C8905AC95 MONSIEURFRED
520,482,949 *3529F93EDC782D6CCF1BCBE0D3507A58E3D3D9A1 morbidhordesrevenge
520,482,950 *352254C3296D9779F1A6A871BDC9082D2FAE8EB8 GRAHAM.HAILES
520,482,951 *3520356063880C3CB744E73F3728753AFA94974D mortars&grouts
520,482,952 *352527A772B67BDC439D6ADFCF0829099981F34B motsps
520,482,953 *352D618A85984891F8A5BA8D9E8ADA04F2BC15FC großgrünfläche
520,482,954 *352BD2D98AAAF8D12F13374E11337A2B58ACB6D0 [email protected]
520,482,955 *35203BB310E5F017722584CF4217DD189630489E [email protected]
520,482,956 *35227C4B260C253EE052FBB3EB693B718346B133 MUSICRABBIT
520,482,957 *352CF23A02233465563F5F6E39562F4C9AEB7A1C GUYPETRIK
520,482,958 *352230B1775B2B7656DFFE7CA5E27C06F2F7AA9E mytinker67
520,482,959 *35250D646B100E58954E7331DC3044B22B396D89 H.5~
520,482,960 *352C228E43DAF6B14516087928DB13F63C62F059 HAKELNET8
520,482,961 *352F73E6B3E60A543E81DE0EA2A866485965E2F9 HAKU(2005年
520,482,962 *352ECFF92D193ABF434A4BECB7213B423E0A062E najnowszestatystykiopolskiejreligijnosci
520,482,963 *352148465515A45A2486796FB28C77B14D88855B harveywisniowski
520,482,964 *35227EAAF6A3C6736FC0CA555C81C9BCD8AAB9CD NA UND (MACH DIR NET SON STRESS)
520,482,965 *352B8D02678D238BB8D3C4C53DEA6A12495CEC39 havedoine
520,482,966 *352F74B820224854A9BFF83AA4892F464B3D4F7A nespojujing
520,482,967 *35221AF3FEC3988C8D1AC0D52AF8CBC350AFBBFF herbdrivers
520,482,968 *3521FA9C6B9B0BAA93B5BD3ABB6C3ABC9843C66B nicholasspindler
520,482,969 *35237C3C87AA2881A6555A31E7329838EC4EE3F6 nihonmac6
520,482,970 *3523502E9015DB2D3CA406CA65D6812DD90B3F47 NOAHALZATE
520,482,971 *352A38050DBE3D2391C41AFE1082D58EE4A39953 HIOTTIIL1
520,482,972 *3521EBB03F0B0F7A9C6CD4ACA14D3D7D00EAB6C4 hipolitoroupe
520,482,973 *352138731BB6DA5A2B0BA60EC52BBB85B8F82525 HIRSTEIN1
520,482,974 *35249C61664AD69169BA753DD8BE5F679B3B69F8 NONNECESSITOUSNESS?
520,482,975 *352966575590269A5D2B3F3B0C561447DBA59307 hornetsmonique
520,482,976 *352D4084B1B71DBAAD621ABE20B72FD618157033 hoseamonty
520,482,977 *352C2D7615B94AD0FD0C417CA230825A11AC53C2 HOTELLIS3
520,482,978 *3520A07FE98AD56346966FDB6D5BC816CCEB744A HOWARD.HUETHER
520,482,979 *352C4644EA51EEB01678C2F3B44E68AAAF37334C hu63[email protected]
520,482,980 *352111CD95680EABA16C0175873C5238CBCBA552 NUNDINEE.CHUKOWRY
520,482,981 *352747EFE5EFBE9120A3C02C1469D802DF74810D HUEY.BARUFFA
520,482,982 *352C7DF47D930DC1B9DA78968C1DE165E9ECB024 [email protected]
520,482,983 *352E0679696A7602BD1B0DF2161D1AE7A21955A8 HUMAILLAED
520,482,984 *3521D9E3BC1E20AFF9DDE6F6292855FCA48DA291 iampark93
520,482,985 *35258EDC1251F8E215813EBD7FC2674EF7C9F84C ifgmkw
520,482,986 *3529CA1ECF7039110C0A4B550CD47A854D8DEF6E iiridiumed
520,482,987 *352FA9400384E8A96B7F1D47F4BA9E6C8F089923 ILLOGICITÀ
520,482,988 *352B560F17E48DEFD7449503E3DC9B7FCEF771D5 ILUVVOODOO95
520,482,989 *352C5882CE72B45B0F18C8BB79F55F6A94B9C913 [email protected]
520,482,990 *352026DA199F9AF69C413A4C3981D37FD20B6FC8 OTAGITSI3
520,482,991 *3520C294139A73C8EBB9FE6940BCB41A603CEAE9 overdraw-,/ou/v/@/'dr/a/
520,482,992 *3527B7E28B52F9582913DB9D0D7BFC4465C0FE9F OVERQUALIFIED
520,482,993 *3523D54F53E35963762AAA944A5FD861C62FF41A PABLO.QUERIDO.(DISC.2)
520,482,994 *352F7C92AE994C26C8C214FB7C7B6EE46DEA6AA5 PAL10K
520,482,995 *3520B5048EBB5F38CEAB29B390A47324C1784E25 [email protected]
520,482,996 *3522816B25C1219F6CDE0F0809276029538240EA irvinglorber
520,482,997 *352A4D539B1F721B845055DFB5266832EF4FFAFE irvinrabago
520,482,998 *352538AA2D0F5E2BC00C2962D416D7B744163A89 paraphyllias
520,482,999 *352AA5CCE44DFA59E421B2BDB1BCD2A53B28A807 parihar123
520,483,000 *352B9AD0FC9267D0A30C9DB4512C4769834E1791 ISMAEL.TARONE
520,483,001 *352BAC9D753D6E24132176F55124FE953DA16E91 ISRAEL.BERDAHL
520,483,002 *3522B9A977A484E1D0D611D1FAD1763FA92CDAC8 isuttuf6
520,483,003 *35285F43D8E0018B4B36331D67094531AD10A8D7 IVANTJELMELAND
520,483,004 *352D0427EA337E3558E294D3D8B793F982A8A86B IVI4
520,483,005 *3521B225A3D29D85B87FD265198E6B47529057D1 p===d ~ ` splat
520,483,006 *35292A9D1BDF894D95C5EB10EE7F03FDE7719D6A JACOBLABADIE
520,483,007 *3526CF8FDEE88978BDD2A60D36540A7A0A08D369 jacqueline-catalan
520,483,008 *352DC62FA0895B68D41B91230345EC71AF5BAB69 jacssys
520,483,009 *352997B22B7F52B99B59335BB1ADC3B29F3285A9 JALLICE
520,483,010 *352B3BFE8BAC99D6CE3843AD7CDC13C62CF4666D james-pallister
520,483,011 *3527393D685EF5F6DB94A04EAB8C8873F8F22DA9 JANAWHITNEY
520,483,012 *352BE7F01EF3CC40F1F5E37D5CF15E1E020CC619 jared-pennell
520,483,013 *3521B77933C13436907C57EDC3456E41862AA940 JARRED.BEAMESDERFER
520,483,014 *352F9A9155E180678F0ADC333D031404FE8E7AEF perineo-
520,483,015 *35295C9DFF69B6DB93045208918C3DE418205BB4 <P><FONT.SIZE="+1"><TT>TAT<BR>
520,483,016 *35236CB07E691D44576A4EFC1C9A618138F74055 JEF SILVER
520,483,017 *352338C6FD026C7CE1BF9B06DDC6E7D31C5909A3 PHILLIP.MACH
520,483,018 *35224BB7175AF764EE88D9DC59AE42C058713960 jenny11903
520,483,019 *352771B6F69F2F71CA0F884C978CF9864A02301D JEREMY-REIL
520,483,020 *3522B3DDDE1FBA4B3FA3C80B7C9934B5CBCCE57A JERIHESTER
520,483,021 *352C74CF5795C8A4FD9BDEE29B9B8C4890736C0F pillageses
520,483,022 *3529BAF21A3502347BD517C85D998EABE69278C2 jimmieselitto
520,483,023 *352B20EF25404469DF6AC08825CE166A6E31B188 [email protected]
520,483,024 *352320A27FDB3498D038B1FF9CF5B590D14A8E1F J'INTS
520,483,025 *352D06CCCB3516D4DB844F8BC1E0B9861B5B0184 PIOCHENT3
520,483,026 *352B3A19347EE3332393D957A316B8D921E86679 Poika.&.sisko
520,483,027 *35298B74144352298C0D1CF41E27C9E3CCEDF39B JOHNNYPADDACK
520,483,028 *3523142D0AD2E5D21D5B3C72BD7E0E0D357E7F0B pool100
520,483,029 *352E9D2210A22E5A3F8641F5DDA8390151C0938D JONGEORGI
520,483,030 *35293D5F1A128EBBC54555804F25F38FE7C39CEC JONHAGE
520,483,031 *3523514A24D6278119926AB5D9C8589C003471D1 juc3s7
520,483,032 *35239492E3BE88CE5D1D31E3583562B1A214018C julianpaszek
520,483,033 *35224081AF102B4D19451C78AB1FDFF84995A714 jung.hyun
520,483,034 *3529A69B5341AD2F7B63103BE5F5EECDB703926F kaseydedrickson
520,483,035 *352A776A0B230ACF45830CBD8C6DD380B30CF7F9 KASWUUN
520,483,036 *35250CBBAFDF6031F294E214F9E890BA10C57B2C QATARINING
520,483,037 *352E4CA1978E9EF8DE1269E7676EEE206198B21F [email protected]
520,483,038 *3521162CD1844BEB74BE02CE8AC4EA473BA27BE6 [email protected]
520,483,039 *352989678518DB8BB3B6901602916CA7369D5B47 [email protected]
520,483,040 *35202F5CFAB22EF9FD69FA8F60BA27990240924D [email protected]
520,483,041 *352F522E9FAAF42E8B95E2817937BAB02C6B9ACE QNBI
520,483,042 *352D1BC20ED09E60D15252FA20D3B993B180EE63 kennedy216
520,483,043 *3526FE5A6BB9E35E83CA73E5A31AAE2E41CD618D R45HT
520,483,044 *352AEDC401FED195EA24FC302126C146227CC2BD R{8
520,483,045 *3522F32F2E99DD3748D2A7D0DD5703A9F33A9658 rclocomotive
520,483,046 *352253729108B595295BAAC62FFF4D278226F1F9 KLVVTHG5
520,483,047 *35226FFE242E566CBD141C20EB93F41EFE49F36D koreytesnow
520,483,048 *352B5CBFE7F6A3A8DF1238F312EF58C620937B58 KORY.GROUND
520,483,049 *35259130D31B2DC685B71CEFBD3FD92D3C73A069 RELNERINGS
520,483,050 *3523F68ADEEB407097C57DDBACF2695BF0F91120 kramtet0
520,483,051 *3522655F759F62EA8890816F500311767DB8965A [email protected]
520,483,052 *352F5DFC2EC09A297ACEC831F69B1550C49F6E96 kuchenura
520,483,053 *352DA2B7F4FED7D6E101825A7CBC96B28AA87BE7 [email protected]
520,483,054 *352DBFDEC64EC629B55807D4F44E2F4720FF9164 lalatrickes
520,483,055 *3526C210DAB5D83D9513741ADC9977329BD3C0D5 [email protected]
520,483,056 *352D4F3A55F5E1B1E481431F47252C736F957F1C richiamano?
520,483,057 *352314E451918AE956B2259D411A2C7BE5FEA08C RILEYCLARE
520,483,058 *352D5F504411CA4D47D5F6CDEA6C4AB5E5BF6FB5 rj-peterson
520,483,059 *352D8739F586D29160EBABC4A199B4E4E0CAA163 LAZAROKIRCHBAUM
520,483,060 *35201417F07C76773BCF2581A5E49DE3BD1A59A5 rler.b
520,483,061 *3526A0E1746661EB9F1DF4827A49D63E0EEEC981 ROBT.CHILDERS
520,483,062 *352B027845E427B9B0B410F682D19853A97387A8 rockyhammette
520,483,063 *352F5FB4F36A109DBA1C4775E4B480E41F03ADF6 rocky-mountain-sunrise
520,483,064 *3523ED94F19A2A3EF381F899C68C5083EC48D0BC romanvindiola
520,483,065 *35267E258A7C0A2AA8E83C64BC399582090D2135 ronaldstiegler
520,483,066 *35202F5925AFD89F0C773E741B433E0947624E3C rooseveltreeve
520,483,067 *3523A6448556377840D8F96B7CE007A0E1FB44E4 RORY.SHELINE
520,483,068 *35220D6F39425FCB8F3EC0EF354E17EB1A7D9B46 rosliza-romli
520,483,069 *352C1F7D125CBAC19EC888EFD24C553DA7ED8EF4 [email protected]
520,483,070 *35221FA4A6E2EE389731BEC73E6B352DB4F5D17E LIBURNER0
520,483,071 *35274B713916990AB9125F0500010F8CBC59ABFE RUBY-BRAUN
520,483,072 *3526FC30E35AE1428A8BEF6D2D67ABB814E0B05B [email protected]
520,483,073 *3525FC3DC2F68984C2EEEDBFCF43D52BD721304A RUEBENWOOTAN
520,483,074 *35212E14504CFDB1C2139533ABE340081DA368F0 [email protected]
520,483,075 *3524204DE00E13F3A45FCA12557AEAE6B758BE06 LINDAGCASTRO
520,483,076 *352A874B20AD408366B1A6883638B010FEF5961B LINJEWILE
520,483,077 *352F35D48C2744A41A47D72DE6FD12143D88F673 RZNRDGGR
520,483,078 *352CC0231A0AEE665E5C96CB6779F25C9EDD0B92 [email protected]
520,483,079 *352947BB0656789A24B5CEBA4D2BC44BF156BEFB SABRINA DOBBINS
520,483,080 *3521D8C33354576FE0C661F1244D9E1ACFC1EA33 SAELLEES
520,483,081 *352376E1AB776DED1533ADD709EE982C0A062D57 [email protected]
520,483,082 *35231920496CC9396E70313EF1250FE113119DF1 SAHARA4EVER
520,483,083 *35200A862EB1430F5A21CEEBE32CDE1A5A7DA1BF LNGNGAM5
520,483,084 *352762BD5DD07F70F6FFF92EEEDD71FADBCEAABC SALVATORE.OLIVERI
520,483,085 *35282F2A5FE86B7F6396CEB98A22257AAD53E226 LOOMAPOES
520,483,086 *3525C12350FD725BEC9E5348FAB93119876905D7 SANDFLY
520,483,087 *3522DC28AC3D3ED3BEAFE6AC5A97746F8772C6C5 SANTO.DOMINGO.XENACOJ
520,483,088 *352070BD60ABC75C61D1F5219E5EAD0E3BAFB786 SAPPERANDMINER1
520,483,089 *352FC733358F495E7815647E8D0ECC8D2C6F25AC SARA.FENTON
520,483,090 *3522057199E870B0D715666F59E8BA3E884CBF96 «SARDENYA«
520,483,091 *3529D6992FF262D887931E143B71E4462F640D48 SAVE-LIVES
520,483,092 *35219646B3CF1EAF5C3A0DDB52DDA581FA473B31 LUCAS987
520,483,093 *352428AF8C34A35AF3AAF89F3004A187DA13B02F LUKIJANAR
520,483,094 *352EB31E0283553E2F4A7A6B68A9E0305F1E0367 LUNA ABDI
520,483,095 *3524672E56CE6F4BFAF3D29C68265572F37203FE SCHWIMMBADSTEUERUNG
520,483,096 *352BF91CF7107D965DC9236EDB52A1E06841B8CF [email protected]
520,483,097 *3526EC6F6E5D8C7FD2BEAD26A6DEDBB09FDD64A2 lyndageorge
520,483,098 *3526418E5F627F86AAAD3F51D84DE8741C0A6838 lynwoodamesbury
520,483,099 *352360F7A523ACE6F309FEA9B844300368EA0930 SEEBRIES9
520,483,100 *352B6C389834FB5F4385074F6F42393C7104D207 SEIF.SEIF.SEIF
520,483,101 *3525178388912BE4C96BEF22A6799857BBB5130B M1R1NDAS
520,483,102 *352829BBD6328579BC349BB41126BBB80A4368EF MAEVE-FLYNN
520,483,103 *3523FF26A3C24A7F4082E27A4B35363CC31544B8 MAHTIAH4
520,483,104 *3529D26F4474A3A6476031E47AB9E41E95C36ED6 MAJSTRO3
520,483,105 *352D73CB1A247FAFAB7B302F0172AE56F7F5906D [email protected]
520,483,106 *3524695F6916D3048D5F7BAD3B0DD6A26DE4E809 shawnsendit
520,483,107 *3528ED118CA509B1C2AA97725972D195799FF02C MARCELO.SCRIM
520,483,108 *3529438CA3A95F0B0479A62A49CCEF419DA55FB2 MARC.LESKOVEC
520,483,109 *3529FFA6536485AB18F55CE1B5129B10E2E6754B marearet6
520,483,110 *352D139E1ACC7DF2898AF83AB1F0369F7195BD7E SHIPASAHA
520,483,111 *3525BEAED177EA3FE96F1DEF345F9DCEA41A0773 MARKCURRIE
520,483,112 *35280E7724A82935866659672BFE08D02EF29C40 sihyun.park
520,483,113 *3522FE35A26CC585CC2F0486D6E6834429D51B96 MATCH227
520,483,114 *35290AFAD2563AC35FF1A922EFC0DDBC3904DF02 SISENEGSREYLF
520,483,115 *352D0CF102679A80056767A98CD8378C28BE2C92 MATTKIM2
520,483,116 *352E7F456790A2BAA0507E60406C3F3232A46650 SKIBSPROVIANTERINGSHANDLERS6
520,483,117 *35298BE6A4413CA5A80BB343D7EA3403746D1358 ME7HODO1O9CA11Y
520,483,118 *352AEF742191FD0C20EB54A40B15D2D0764DA940 SOLDIER OF THE HEART
520,483,119 *352B091AC124813220D40540A41FF16319084A9E sophia2503
520,483,120 *352EB3A051EE653553423A8D338DA64AF1973878 SOUTHBUT
520,483,121 *35294330E06DFD1518257C7F243E852E2611D2EF [email protected]
520,483,122 *352F93EC342DCF1E4542E5264B11FFA0EC791BBB SPEAKINGROUTINELYSIMPLYSPEAKING
520,483,123 *3527F360AB936C0D0BE8624EE7AB2EA150C92593 [email protected]#3
520,483,124 *352FB67375FA2A0C8145C3854B72D6B9D9AE47D0 SRAVIKOJ.
520,483,125 *352C8E3845C44A296AB16B6AC4F7B47BB310B41F SRC=HTTP//ECXIMAGESAMAZONCOM/IMAGES/I/31NKDLAFNLL_AA115_JPG
520,483,126 *352BF6CD43539AA9AC0C215A80D912120DD504C0 SREZJILEGAN
520,483,127 *352B347A487421C1F4566A8906A81B62586DF861 miryanna
520,483,128 *3528C3404CBBC367F80059ECCE23787BB13C4412 [email protected]
520,483,129 *3522C98545BA9542EF8EB8E2763DE77D75766BAC [email protected]
520,483,130 *3523C6B595425DFAD6BD96569F07BB7C59870CC5 STEVERVOLLEYB0
520,483,131 *352BEFF3DB8CABFD600386DA52260FE46D842766 StingMeRed(ATFC'sVocalontheRocks)
520,483,132 *352C81CB9DBB1A124B1F47253F01E781002FB6E9 STUNSUELCUNBUNEVRENEVANPAG
520,483,133 *352B0A44F8651F9895C5429CC4D5014DC384B8E2 stywo
520,483,134 *35238BAB6A32E1D036BF0AD19E0C154575D95259 SUBJECTLIKELYLINELIVING0
520,483,135 *3528F740B03B33D77AA67F38EF397152080560A9 submarine-voyage-thru-liquid-space
520,483,136 *352F004038C6D247A95F83678D6EDC59DE83A821 SUBSPECIES13118817
520,483,137 *352492976312F448677DC0906AFFFE3741BCD62F SUITEFROMPEERGYNT,OPP55,46:ARABIANDANCE
520,483,138 *352A9844C75CBF44037B3FA92283F698D90B806E surabhihande
520,483,139 *3525E29E7291837022DA14A41C25CBB386ADBD68 svnmate
520,483,140 *3524508DFAB7D2042DD24A82302B20B3C81B8531 sydneysargent
520,483,141 *3522B75DED3A8D14C21954B9442F09D6EB6B3101 SYMPHONY.NO..7.IN.C,.HOB.I:7."LE.MIDI":.IV..FINALE.(ALLEGRO)
520,483,142 *35224210E011BFFAC684EFA069ED251CC4848DFD MOBILEWEAVER
520,483,143 *35294792AB847138142B7AB6D1ECE11AD6FC1E76 MOISESSTURKIE
520,483,144 *352F514213DD52566108D65DAC33CD4F1419D5E2 momdragon
520,483,145 *352378A7FE5523A1D97A74C870AB771533A2A546 [email protected]
520,483,146 *35219593FFEC3A9D9633283265A2BBF0FB34695B TANGKUNYUN
520,483,147 *352FBB819C08BD031FC370BCA487A8D44BF372C0 TAYLORCANWELL
520,483,148 *35215406626C42FF13A83F78A0B7E29234DF90C3 [email protected]
520,483,149 *352355079A431B61150A34577AADF40782C1B581 MOSHE.RENEE
520,483,150 *35255BADBA15C89F425E0ADD8A45F2080E1E3901 TELJAST1
520,483,151 *35225718E52BDE719557566AA882A3BF669C0FE7 TENKŪDEN
520,483,152 *352CB07BDFA3282D629CEA3AD68843BDD16715BD testtestwheels
520,483,153 *3523D3F9834250A11C847E5B894887641C5A7D11 thatorchid2000
520,483,154 *352D96F31702D2924C8D31AE220860FECF620835 NADIMHOSAIN
520,483,155 *352B505EB346C147B37BD297058BB7DD24ED83B2 [email protected]
520,483,156 *3524D69C91B76A6EB907171E3843829F8D8DC3C4 NATHANCAMARA
520,483,157 *35276880C57993ED1652F7477A62CCD85CD02B00 NEGNINOWLEDOM
520,483,158 *3521852232AC648898F0D713035B320015573C4B NHELTSLEY
520,483,159 *352A1F5BB1EF334F3D1176D63488DA10E478085B tnafarap9
520,483,160 *352D8560F78950ECE73C1FD2357B5ECECFAC0CDB NINA.SANDERS
520,483,161 *352D80C5842898814584AC517A77B616FCC801E8 NINUOHS9
520,483,162 *3523919EFDA18851728916F3BA07BC9EC8495652 TONDRONS?
520,483,163 *3528095AB139BB1E70538828D5AF2924A27EC2FF TOPXSW
520,483,164 *3528EC7AF977CD669615C0F2E47745A78B92DE51 nJZ
520,483,165 *352579963666389C5D7BE085A2530A34643AB13B NONPAREILOFFAVOR
520,483,166 *35271286880AF0F285E95F8214A69E2579BB5D14 NORRIS.PIETSCH
520,483,167 *352445800C714D4C04ACBD32F9AD08BB47F76D4E [email protected]
520,483,168 *3520C20A1D598AD5670499200B832A045068E533 TRICIAREDMOND
520,483,169 *352CC4F8E35F0588F5E434CE2E358BB05F3D1D5D NUMBSLAPSHOCK
520,483,170 *352E3633EDA63095341AEF92C8D12A8AA1D19148 NVISYA
520,483,171 *352AE59CB92A0873C3686853C6984B8532191B91 o~
520,483,172 *3529A9BF3B598BBE4CF6A17B65623530E0CD11DA OJM\
520,483,173 *3527D2A86826BA2D447D6ECE09D856E21BA23564 OLIVERHARGITT
520,483,174 *352B906DF2DD9CE5D2C9413C5E699D9468776BB3 OLIVERRYANS
520,483,175 *352D02832385B43EC8EDEDCCFD266842D958AD8F TYTTREMM9
520,483,176 *352E752751A49A71261AC29A94CDADE42450B992 OMARDUCE
520,483,177 *35215B72686D70569F1805B0DF6692A8BFDD60F8 O!ML
520,483,178 *3524D1BFE90EF0B90D50AE400D54906443480C44 OPŘENO
520,483,179 *352BD6C14C7A90BBA5540DEB3D0678BB932D33B2 opwrijven
520,483,180 *3526FFCD0AAD91C6FE9D65C86BE80988E4BAE84A ukinuhses
520,483,181 *35231AB2C01A0C8141C7409022351C1218D79622 UN1NWEAVED
520,483,182 *352A4BC246588A5AFB80EEAF6719DEB0E62A15E1 OSTPREUSSISCHEN
520,483,183 *352BE193E12A046CFB0F435B30BF422F3F9608AC oswaldoliesmann
520,483,184 *352F7EB51E4918B56EC8F5EC5CD5680C51045C19 UNHARDNESS1234
520,483,185 *35224C2C51B124FDB0A060AD4251EE7C7230C905 [email protected]
520,483,186 *35296EB0F5CC4B5B2A8BCF8C2F1181F840C61BAB OVERQUALIFIED
520,483,187 *3521440AC94A104795B52F510959569748CE28DC ÖZETLEMIŞLERSE
520,483,188 *35261CDE1A40BE5DDAD52ABF856A949B47692301 P==)~0)o(
520,483,189 *3521E2D8446DB76CDEE8FA2B139D871B73DA0DF6 PAARTHE7
520,483,190 *352D75F876A932827F2928DDD3A1DB9CEC79DBB9 /USR/SRC/LINUXHEADERS263224SERVER/INCLUDE/LINUX/VLYNQH
520,483,191 *352655EBBAF289418BF7BD6A14BBF28BB75537A9 [email protected]
520,483,192 *3526119F87D48B316B7ACA9ADC6D036D4D5F0B71 PARASNIA?
520,483,193 *35286DC1A8C14E2C310C9069F61C06448B42A965 VALERIE SAMBO
520,483,194 *35278FDAAA8D71C56CE9D084FEDD226958FF95A4 van boven
520,483,195 *3525E8D892037F886142CB08014DBF395B1AD1B5 PAWATERCOOLERCOMPAWATERCOOLER
520,483,196 *3525276CD22975FE171256A3D1C888FA4C0CAEE9 VASALLONESSES
520,483,197 *352082732926BEC1F0F0F378C46340C71452AE59 p===b.`)x(
520,483,198 *3529DCB75BEEB46C50E5CD53029ED28F1EB90949 vicesheriff v/aI/s_'/S//E/r/I/f
520,483,199 *3529A98B1B8E648237778632A78C5F16D701D512 video1
520,483,200 *352114B3EC30178B270123D2034C22844E4AC06A VINCE.SUDBERRY
520,483,201 *3521EF0C0054F20BBD979E928440A4359DFDB5C9 VIRGILIOGUECHO
520,483,202 *3525A5FA4A914495AF4B4E7FAA31DE0141A8A266 VIRGIL.ZINGONE
520,483,203 *3529781B487C7986C2D4C21CD1338ABA418AFD61 vishwas.kadam
520,483,204 *352649DA257EF754DB3D5888D3F160D7BB2D60F0 VISIONSEARCH1
520,483,205 *3520E936437C6030010B579C0AC7FBE1DF0BD3D1 VLAD TOCACIU
520,483,206 *35221515278B21D9D7D3801D2486BAC6C5F9B536 pianotees
520,483,207 *352A972775F47206485A58709284BC41EBEA2C4A volmondiger!
520,483,208 *352777069F34555249E7E8EC49B2211819075F1A WAFA.YANES
520,483,209 *35293C7644FA6B8C1D389979F0BA5153E0557435 [email protected]
520,483,210 *3520B72FFBA632C505C7EDF5DBEF9872A9FBF882 WANDA.MARTIN.HARRIS
520,483,211 *3520080606ECFF5CB9EE74F4EA384A4414EEC282 [email protected]
520,483,212 *35231B98EB3183399A436275B8DD37C360868BAE p=p~-~-~)8(
520,483,213 *35227A1BAD3EC34305B9FAFDCD9C20918AD0DE60 WARNERPEERS
520,483,214 *352624B9F72DE2B20CBFB6CA08DE43DD68796537 WATERPROOFGEAR.NETWWW
520,483,215 *3521A81AC3F762891C68D506A99D20D914703D14 PR4C7C48173S
520,483,216 *352377AF48FB6069064A6C015858CF6805448750 WAYNERAYNARD
520,483,217 *352616ED13A2DACA0654A5479CDE9197C4690407 psychodelic p-line hiba express #76
520,483,218 *352CB12F336440B762F5B23F3F61CEF90C01848E PUNCMU
520,483,219 *352D083DF1AC2C6F7E2E40A47E8923930CB0E6FB puppets1986
520,483,220 *352D66CD1D45DFBCF2750777C662ADAD7690EE64 wheelies
520,483,221 *352A637DCDD796A72401DE187AB60C10DE45E219 Q/.AA
520,483,222 *35246FAE6861E4A89133755133FA56DA57AC8932 [email protected]
520,483,223 *352D4D877379277E0FE0289D4FAD0C6B4816475E q#####p~o~osplat
520,483,224 *3526BCBC45EC67409ED9E08A7AC76267641F156F QX:G
520,483,225 *3524B71CC5AAEF181256D2193B0ECAD8C89A4A0D WINNIECARRILLO
520,483,226 *352CCF8FFF0A8AD6608BCA68D4FC81197ADA1E81 WINTERFREEMAN
520,483,227 *35296D5D71873403570CCC9F053F444EE1CA49A3 RAFAEL.RORRER
520,483,228 *35212889BFEC8C1D383C0F42808BB1A61D78D4FF ramesh.retnam
520,483,229 *3529F145596836D2115966F2BB457C13B76CF326 ramirohero
520,483,230 *352E7FC270A8838BC3C07A2BBA784B2423052C41 WOLFRESEARCH
520,483,231 *35210C27086F786D346C440A63C055353568A8E7 RAPHAEL.SKARZYNSKI
520,483,232 *35272FD556763F2CB9E27EB451B19CC3D558BD50 rastarhonda
520,483,233 *35282E668D64525604936E65DDDDD777AD64DBD9 WQ)(
520,483,234 *352236DCEB69B95DE589C25E392AD8D0DE1E9A4F RAYMOND.CROTTY
520,483,235 *352E68FE0C0BD185BD891CA0F038F5D718672AC7 RECHTERSWALD
520,483,236 *3529D80C67865302CE755F24C6D57FAEEF1B7E85 re-encryptions
520,483,237 *352FBA45EE06DDC9EC2377B5E6513236D377492D WYBORNEMU
520,483,238 *3526409D5E7D9124F4E6D667287E41F7C35EEE67 REMAINEBSW7
520,483,239 *352F94FDBE996390775309D31D1982A9E3F94788 RENDEGRAVNINGEN0
520,483,240 *352CC37254057902C8C7D86418967FCF554D4387 REPERCUTIDO1
520,483,241 *352CABD6000E4B17F64A72AADA553660086D7255 reynaldo165
520,483,242 *35289ABBD9A2A33FFA0CD15A944A80F75A6FCC65 RICEBABY
520,483,243 *3524F0A1FBDB77523134DC111C03E481D99FFBD1 RICHIEMARTUCCI
520,483,244 *352A1ABE6A65AB77BCEA7DF5FB0333C3FD412073 rich-wrought.r/I//tS/_r/O/t
520,483,245 *3527131B36E7C0AB85559569E9CD4B8B6E1C805E [email protected]
520,483,246 *3520E2DF361AE66142698637D48EF83BCF21A01B )x(o~ 0~ @P
520,483,247 *352185B803D69771368FBA1F54D8E0CC72022F8D xv9/
520,483,248 *352F89A6F4FFCC5C8710337BDB53B0C68469B525 robtanimashaun
520,483,249 *352023A2D8050E9A95563C0ABFABF458DFCD0525 ROCKIN'JERRYLEE
520,483,250 *352E2000CBA24474C08064A737C2CB96BA3C928C YARASETH.MONTEON
520,483,251 *3528D106263ABBE95A39762ABF7BC62A7BC23424 yasmin.porrata.moran
520,483,252 *35299E2D4CD07C86C7BC804040DB7EABDA979D05 [email protected]
520,483,253 *35207E7DCD622AF55BA2783E8CCB973C4A55C9BC [email protected]
520,483,254 *352F8273F06ECBD19AD7AF6DE1A39E423F9762B1 RON-MUTH
520,483,255 *3527AFE86C350E20C660E4E31FC2964AF1C31F68 RONNIEDUBEL
520,483,256 *352C2C59820F6FB2C14A0D2A26C2422EBF779FCA ROOFRATTLEREGISTER6
520,483,257 *3526606306EFC7C60B3C7AB761BFAB5F4615FB99 [email protected]
520,483,258 *352D113EB47D747BD0ED03ABF81D3DDA2A9148E2 ROSITA MENEZES
520,483,259 *3520ACDFA4D5F5D701EE383ACBD93D5AA9EE1F46 ROYALMOHINANI
520,483,260 *352BDD3D054C557E46FB66E84478BA9B78261689 ROYAL.RAHEJA
520,483,261 *352D7478798953F4E6081BB980FDDBB320369A7E rqhz
520,483,262 *35269AA87DA19DF9271539100739D46DF1D7B084 yolanda-c-lopez
520,483,263 *35290AD7E112B9D150D4952B9B2BCFEDAA5C46B2 YONG.ZAVATSON
520,483,264 *352D4FEF085FD0A028D4DFEC454A2AE342D07959 RUBENCOURTEAU
520,483,265 *352EC03FE8DFCF24FEC89C97261B4037E95DF223 ypwcfgnfsfvwj
520,483,266 *3521FE74DE70D71C33F6FE57D19169A24EF72DD7 rudolfkortemeier
520,483,267 *3523BAE169FE49A25B35E6E97A85D97FA8EC527B yttiknus
520,483,268 *352143DADD2C025670095937D8411191EB454134 S20122009121
520,483,269 *352C30789C8AB6273705DBCD51127F702FCBAA10 YUXINSHOU
520,483,270 *35288AEF27217047BDF19088D6B0D4DB91B0562D Z628708
520,483,271 *35204F89C138FB362A65FD02EBA95CC7D25CFC38 ZAADHUISJESESED
520,483,272 *352E59DF85277D1D0DA97DEA168D10F09FE785C9 ZABRINAMUHAMAD
520,483,273 *35275F6E87E01CA95468CFABD987EEBD99728E15 [email protected]
520,483,274 *352C00108D1BCEB86AFB473CD0A734D5D5EBEA8E SAMUELDALLAIRE
520,483,275 *3522685CBF5C9F38CFFB9E535B5C34E4BD3AC847 zainalhadiyusof
520,483,276 *3527D8291748834D5081FC041C1F2042447F02CD SECULARAIR
520,483,277 *35211E4EEC5BAE62C45E03E34DE227601EB3589C SELBBUBENNAEJ
520,483,278 *3526BE368263475E7F11F35AE35F4FCDF94E1275 SENG-QIAN
520,483,279 *3528AE33F226787D0FCABDBCBAA2A45E754A2998 SESTNASARCE
520,483,280 *352D4D003D8693FFD33140CB7EE01CCAA9139B76 [email protected]
520,483,281 *35216681E8C29BDB9DD2D66DA0DE447B7C478E41 [email protected]
520,483,282 *352E643171A651B5CCE458D9950DEB752C83BF1C sexcommandments
520,483,283 *352DB3C2661AC7A0A370D4505629149C50CDD756 SEZICITORUENING
520,483,284 *352CB26EE8103E4A8B4303296A21517D382E8BAE sfondais7
520,483,285 *352C2073964DFC8084FD30123EAB73ED41EB64C0 shamsili6
520,483,286 *3526F9E42262804DD3EC78734747D02B33AF5D6E zizovacm
520,483,287 *352B1F5CC1E04FC2766CB310EBF10C6B666E3AEB [email protected]
520,483,288 *3528E6C14D0D14317AE122D11E711F165D257A3C SHERRICA.SMITH
520,483,289 *352C5E1709267D14B690AB693D1F80247DD25AE7 ZURUECKGEKAUF3
520,483,290 *352495BCD0F94D45BFA442140A1E4C59551FFD67 shondaignault
520,483,291 *352817C97B9E4FFF8FA0F3DF397B3BA1A04EA5EA SHUR3S0UND
520,483,292 *35225C0A3A8A5D8F1EDA64DE2D2B1EA8B06972C5 ευφήμη
520,483,293 *352C1148C1711C342CC1D88B9187A3D17DA37E8B ЛАДИЖИНСЬКА
520,483,294 *3525399873B39DB7E0463A26F320F8E5D023F8CA ЛОРЕНСО“
520,483,295 *35237C23D78E167F2BE3D4652DC496A1EAB1C1C3 НАТРЪШКВАНОТО
520,483,296 *3525655A8AE4C5E150C792E23489AD221FA73E44 особености
520,483,297 *352150781062882E60C817C4C3A35D6BF3F60FC4 SLEETHBSW5
520,483,298 *35244EAD30DB15F441E4501E1E0170BDD637BA71 slickpaper-'sl/i/k,p/ei/p/@/r
520,483,299 *352812BE63D867B12ED0D3AEC15036D4D8553B6A [email protected]
520,483,300 *352927BD80133919A57A78011FC0BFC3A74CF3AA SNITTÅLDERN
520,483,301 *35247AB170FE7A2519D42A81088918A06DF0682D SOAMAG
520,483,302 *3528F7CA84AA578AAE71CE1D1C5B0835289334CC SOTILEVA1
520,483,303 *352C53B3F9A8A49693B65D6119088C145BD270CF SOUSTROPD
520,483,304 *352B6F47980EB6364B9E9FC8E2B7C513070E9834 РІКБЕРГ
520,483,305 *3522B75BCF2D52D067E2A10524E73E9DA3FAC425 СКЕРЛЕТУ
520,483,306 *3520072399FA72B2AB79E7AA1A89F46D27C0BEBC СПИСАСНИЕТО
520,483,307 *35235FCB264CBA55E6FF8FFC4B0686A00EA92D2D ТЕАТЪРЕН
520,483,308 *352BC34E2A8BAA2CA2AAA6C4E676DBF2572D93E5 speculation1
520,483,309 *352E443B2813D4E00E637C32BAACFDCFAFB6C43E SPOTTIEDOTTIE88
520,483,310 *352E9516A3C498328BD11428D2660FAA90758D0C STEPHANMERRETT
520,483,311 *3521AE6316DEE701684873A532F9792DC6E78F28 執教。史密斯教練贏得879勝,在ncaa
520,483,312 *352C9B65425D8E9392C33F9F5C925852E1AB81D6 STEVEKAHLER
520,483,313 *3521B2FB5B46C82DE059ADCA5614E5FFA5A133C1 STEVIERINDFLEISCH
520,483,314 *35231F90892810960D8FCDD09623BB8D2BF398D7 stravicne.1
520,483,315 *352ACAFEBC892F63FC4E94154FF31B29BB4ED626 string-quartet-in-g-minor,-op.-10,-1893-[3]
520,483,316 *352FD5D83CCD64426879E49952444A3139ABE8F6 新型的宽带MODEMS也开始普及了,例如
520,483,317 *3521C44AB2CC5025323C6EA66244F8A18E7337FF summer-mcphee
520,483,318 *3525B63BB84F9799E787793B1482FE4D84BA7E69 [email protected]
520,483,319 *352D6FC8696FB4474CBEE31D46AF2769E4225139 superfakultete
520,483,320 *352922E9333D69AD5B7885EF2C260C0DFEA647FE SUTUR3
520,483,321 *35233453B7CD8F3E4153268FABD02CD64B55A51B SWETBOY11
520,483,322 *35231886DA4DC1E90D3444E1A5C4DC6A70DF9236 sylis5
520,483,323 *352014AA103535AEA9ECC52814C9921AE2711D18 TAD.CASORIA
520,483,324 *352E6044FB047E8D3F6A6B9400A9D96E0D3C18AE TAKEAWHACKATTAKEAWHIFFOF
520,483,325 *3524114B662C5D452DE3788525E6DC901E1EF34C TAMROLOC7
520,483,326 *352C6E45B5464B6DB9A1713207C61A39B69646EE [email protected]
520,483,327 *35222B6D85A60DDB0AA2C40F38A29B04149B87BE TASTATURFUNKTIONS
520,483,328 *352CF49B42445C52A3D0C17414AE9598DA553974 Tastes-So-Good-1
520,483,329 *352DA0686D66932CE6D5C39DF389A29EBACD2BC5 0007ELWOOD
520,483,330 *352286580F6D131D0BA60DE505B26A2723075E5A TELEFOL6
520,483,331 *35242DF4056B6AAA8C88693FF25A15F8D64F07E6 TFORMETOKNOW
520,483,332 *3528AB1639831CBCC73C700EFF690CAC9E9D7CB4 tfzo
520,483,333 *3525924FE332CAC7DF4F7B972FC6FF783678D552 (>_0)[email protected]8
520,483,334 *3525CC331D9AF0B6729495BF542AC4D91B011D65 10thingsihateaboutyou
520,483,335 *3520B241F396B59243D0B374BC87DB3887846A08 THMNPHS1
520,483,336 *352EE4F816F0D3F0A3175CA53DCF32C759EF153A THUATIRA7
520,483,337 *352B4A9718772FE2F99E6DE6B03ACC77B3C653F5 TILSV4R3N
520,483,338 *352E43FF61D5A08003119D7818CDDD520D839A29 TNEIALLOCNE3
520,483,339 *35222F0B74F7870DC6991EBD62D3FBD627701D09 TNYYPORE3
520,483,340 *35268673DC03F73AD8A96D2D1688309A618D89BB TODD-PYTLINSKI
520,483,341 *352557741EEF4654C2BC23744CF5A8DE3951B4B7 15-11-1315
520,483,342 *35209D1BBFCF2118903B88714E7C5C793422C679 TOPHERHACKER9
520,483,343 *3522A592D3A1723D81513D1C54F7ABA075D6BD34 [email protected]
520,483,344 *352818344202CC1F2A2F9A928394F475BE95E688 17IHATEYOU
520,483,345 *352E2597C7AD7535692D179699DAAA92A04DE454 tribespe8
520,483,346 *3526DE62AEA4E333544C8F63741A0B2EACD05CF4 $TRKE0UT$
520,483,347 *35257CFA387382CF357CF44BBE62802AD912497B TTMDIVYMRAJPEIEXSY5SBETARDEDZ
520,483,348 *352054828C8AE255F038E984694BCBBBA6B3062F TUESDAYCELINE
520,483,349 *3521767FE87A7638D4E9BE34A3C74D678FDA7B64 1955785 the actions were all in reaction to the rebel threat
520,483,350 *3524C9F8A396584A46D6F403C6D9280F0D7A1791 tysonhumes
520,483,351 *352B27AE08591B7AED4678457782459743F7D103 UNGEORDNETEM3
520,483,352 *3523BD13E5CB022256839D4C118D04C02E228B58 1iamgandalf4
520,483,353 *352BFAE5FD98C112A0F590CCD498D24ACFDFD398 1 ILMAVIRROILLE
520,483,354 *35212CC0D4EFB39D63ECB0E58BC95F1566098F64 UNMATURING.
520,483,355 *3525095DD8AA1E3D2FB90B4FB7AAE40A0A2D665F UPSUMMARIZESURVEYSWAMPSWARM5
520,483,356 *352DB93D8B3DB5A12400CBB93E94E9A5F367195B UPTHORN
520,483,357 *3527430B1CA4354D3D842F67D82BB9E42C885A50 1.modernisierungswahn
520,483,358 *3523A7F5901A2E2756FD01F005F25A510820213E USERPIZZAHUT2THE
520,483,359 *3527EE07DA02D2DF1847800C9F90B6B9F9B2B5CD usquarant
520,483,360 *3527777064624367DA32B277CCF20EC4EA453460 U$TKP5209
520,483,361 *352C706564BFD795846C339B8B7E3C3624735064 vallartaescapescomwww
520,483,362 *3523E17E7C675AD1EC2FF650512830435BC6FB38 valsey-bartley
520,483,363 *35209CF0422BE0F13929158CF2B679F77E7F83A8 1.QUARANTAENE-ANORDNUNG
520,483,364 *352FF7BE23882BAC19A816E903EA2F757D412E0D 1RUHNAMAD
520,483,365 *352E087AD1F42CC9AE0116FF02F3C73F4E7B64FF 1-SNEZANA
520,483,366 *3528AAA4C96A2EC0733321BCDD40474EA0E33A27 VERBINDUNGSKONTEXTES
520,483,367 *352BEA0559228A1E0E46DD2A025E45054CB711E9 VERNSMELCER
520,483,368 *3522DA33F8326963B62D725D9F2CBAE059594E47 VERONICA PATTON
520,483,369 *35277B14A89ED3F1623E33F6123F1ADED48E8577 1sUrmemesine
520,483,370 *352B883BF341C6934BFA0D067D3BCE3C991F213C VICENTEARATO
520,483,371 *352CB9F40B28C2225E98BE5B879F0B9DCDC4C423 1-TOUSLE
520,483,372 *3523682CA406914E1460CB21C9E7A03B1937A4B0 1 ve
520,483,373 *35228764E5E7A1C4A6493EFACE90557079018FFE VILENATURED9
520,483,374 *3524F0B0DCBE78278E924C298D82E3BB17B7952B vilma.vanacore
520,483,375 *352A19E37775A7FF22145C22180154A4F6E327B9 200‐ÅRIGA
520,483,376 *352FA516C31C1C38EADA12312F2ABD681B5A3B76 violetmalagon
520,483,377 *3527ED54C1C7408E3441490B429FF12366776CAE 2478058 aiemmat.kokemukset.ja.saatu.palaute.olivat.l
520,483,378 *35297178F7593935573EC8B788991B692A8F0A5F w00dr0w3l
520,483,379 *352FFF48940CEE6708919AD60F3D2778D0526D43 WANDERATLAS
520,483,380 *35229054DAF5BB7DD2D33A07C2C7170C946C4C5C 2MESCHER
520,483,381 *352892A32C2AF2A9DBA1A39CAF33934BD5D6E97B 2-PAZIENZA
520,483,382 *3520108964AE7947FDD5297BA3193DB6A2674DF0 354.REINDEER
520,483,383 *3523E81C6D95146D63E11AD6193ABF0D55B150E8 WHITEFISHERY!
520,483,384 *352990048D27A4ED8FD9D521C4A86125DE250745 3965.FREEDOM.CIRCLE
520,483,385 *3521A5EE13A33D017E35E4D7009CCF8180314BFF WILFORD.EGGLESTON
520,483,386 *3522509BB9981564B9AC4A0AAF8A17DDB9FE8E84 WILLHAMOLIK
520,483,387 *352C71869CF4BCBB3173224DF4356F284D616ABD 3.verecektim
520,483,388 *3525B38F92610BB302F77B2DD1BF07D2815EA8EC WILMERSLIGER
520,483,389 *35249C67B7A094447A4E4BE377A23AB5AB7925BA WINNIEGAYTOS
520,483,390 *352B01C4F2E42B37379E7C7389E9120AA05FB205 WISHNA.AMIR
520,483,391 *352CDA65B8E882F8DF657E48F47E9995072B38B9 4DAPARMA
520,483,392 *352062DC6D1F16481FAC7005EBC434E16BAE2823 WONSUPKIM
520,483,393 *352B7F7EB8FA9C1353D8FA4794DCB09E106CCE59 wwwreturntogloryor
520,483,394 *3525263703E1EA855932E3F37DD45826DC792355 4TOLMACHBSW
520,483,395 *352676E02FE74633242E7E923AA10D486CB23AD5 XAVIZHO
520,483,396 *3520518855D524711A5987E073E9B8B54CD81A58 [email protected]
520,483,397 *35207D1AA81A99E86E452EC2FCCF65AC7712BD7C xoya-abbas
520,483,398 *3527BA8FE4D7EB5AEFDB4053AE9DD20447DA7ECC XRAQUEL17X
520,483,399 *35200FD8B00DDD48F71DC8F67E31CBA15FA18978 5ELIZABETACCESS
520,483,400 *352A6B80BDD49FEFA1488AFBEAF4230E24EC857D XYE&
520,483,401 *3527932FC8F92B149E0D722E93CCCEEF5FD47E17 [email protected]
520,483,402 *352B2D7A0B8807EAC4A37A69B96FB4AA7EA4E0F7 @5P5H
520,483,403 *35213218AB93F2400A132E6B783188D973D824BE [email protected]
520,483,404 *352C4A532668E79D05872DABC1E779DF2561F537 yelinekdavila
520,483,405 *352EC25338AAB0F2270954D1E37F4E847FB3E8F6 5TOLERAIT
520,483,406 *352ACA4316A32DE47167D41A6360F1D63D40DE0A yjonbbs
520,483,407 *352B4DFFDAC846D6845CD0EA01973EC65E031938 ym42
520,483,408 *352E8372279C250D6929C0AFB7960BD02907130A YONGMULDREW
520,483,409 *35266F970919BAADC30861E8DE7A7A821249796A 696412 OSMAN.TUNABOYLU.,.GENEL.MUDURLUK.GOREVINE.GETIRILDI..
520,483,410 *3526757DD428C1BF13299E189C8FC6416414456A 6DOUGLASBINKY
520,483,411 *352686D8C2D07B6F418B4E634D39356064E5273A [email protected]
520,483,412 *35210031FBCF5B40B89BED360E55985A303B7F3B 6iluvsting17
520,483,413 *35282D6988B34FAC2A336592F64111AF7A9D7DF2 6-PLUTONIUM-SCHIEBER
520,483,414 *352E0D0490823C534551E16AFFB4D842C0AEBEFB 6riesenbaustelle
520,483,415 *352136CB5257AD98993E42CC6B0E833F9EC0D866 6SOUNDETH
520,483,416 *352DE4AE9DD2FEFCACDBFF000AA756E051E2F429 7BSWINTRUMENTSBSW
520,483,417 *3529D0A62C3BA39419D5DAB009BF7CE30F7CDB84 zstx
520,483,418 *352161153C210FA64003FE3565122FEA4D93D172 ΛΑΔΙΚΉ
520,483,419 *352DA23FED04287CD5411620AEF40BACA2D2DB9C 7ORANGESFRODO
520,483,420 *352DF1654FECD65A8AFE377001565180EA17A3EE 7SHOOTYOURBOLT
520,483,421 *352D82D3C727F1DAB4C50254B173B6C0E0B8FCEA кабальито
520,483,422 *352DFCA0BC0DE9451E520B21F56A30A220A8DD60 8AMUALAKK
520,483,423 *3523BB645E42819E68CE1910606F4887CC386D43 9RANNAIGH
520,483,424 *352703BD1C59F62D73F279852342352F9E6A5320 9WACAENETBSW
520,483,425 *35295FF2C680AB867000B5F0C7C59A0F2BB805AB a2ukp
520,483,426 *3520CD115C885D7BFFF7A42D25BC57828DC96912 A4HO
520,483,427 *3523183D6B5EDF560FE14870C02D9105489FB0CE A5CZE
520,483,428 *352C7DE3D5FEEBAC2BCCD62D6A857F419F68E779 AAAZW-
520,483,429 *3526AD973223EE933DE7D7514EB8BDD2616E010A 1 FRIMANILLA
520,483,430 *352A9B231F608EA6660DF2EBDE00A8BC9A4CD474 1gozukecegini
520,483,431 *35288A87F44E4A16B3394766494C31302DE20953 aae6ls
520,483,432 *352A48977F3E45DCC0D646DEA6172D9DCD18646E 1.hollywood-experten
520,483,433 *3528A29590297B006F9E8062E50A5FB2C21E8E60 1IC3NS33'
520,483,434 *35287DFD0A5A4F5CF00DFFEB935F70A1C608869C AAHSE
520,483,435 *352D7C24B09A01DD8E099076CAD0643DFE52F807 1-MICROCLIMATE
520,483,436 *35278368E68A433488CE0D458A6ACD762C905C68 1nv1ol48ly
520,483,437 *352976B58B4D31872686D739C87CF1F732C72C10 [email protected]
520,483,438 *3526DE069A7065D94934E3DD5EB37A17BF596168 1.YLIHINNOITTELUUN
520,483,439 *35291EDB7C0397D22CC3441558D0BC8D2D9C3333 A)CRH
520,483,440 *3522968005041C491EBFE26510F4A3C6C8D0A5F0 ADOLPH.GOINGS
520,483,441 *352C33402918B68ED86F28AB4DA54F4952E5CDEE afm+3
520,483,442 *352E2F0DE9BC81CEFECC95239CD8ADFF0CDF41CE aftmb
520,483,443 *352F28A247EC7B6659E841B42F74E951B41E44D0 A?I;B
520,483,444 *352B64CDA51B13BA42F936A2BBA8300609CE7516 3AITHUAVA
520,483,445 *3520235F3CE11FF2C5FBB0D108A6FE26F13172B9 3ANANOXYDE
520,483,446 *3526F2F14F37482C599A1FD778E220DCFC0AA4C5 A,LDB
520,483,447 *3529FBA3A85AE5CC61A252C4954AEC94A27EC276 3==p-~0-~o-)O(
520,483,448 *35249F883C1C929299AA7CEAC09A9D40A6FDA1E4 allegrem0
520,483,449 *35294F8A0E1B2262BFBB26572843A7B46A6BD96C ALONZO.SENSEL
520,483,450 *352CE32B460CEA0C801BBE58F10FAB24EC08F782 4ATOMERNAS
520,483,451 *3527762C1B3FC99D084BE6CBAC972011186CE1EC 4-batroun
520,483,452 *3528AC4EBA8E95E926F7A5C710DEF94B731C5E17 4DELASSUS
520,483,453 *352EC7DEF3EAC9F5B025C79A60252786C675F0D7 4d-luokassa
520,483,454 *352ACC645A504E6224CF54525BBB71E21BCAB281 4ESITTELYPISTEIT
520,483,455 *35285F6D05501A3811B9CC390B2DDB144934C3FA a=m)/
520,483,456 *3525DABDF50F382794287D7302B211F276947D12 AMBROSEPOWEL
520,483,457 *35238577E25B84E27E98AF2B64236265F08C3008 AMFITEÁTRUM
520,483,458 *352442F756764CB77E294C0DA05A4ED375241CC7 AMSDNARB1
520,483,459 *352D163CF6C6F8922D0B11DF8CA2F4CB64FACC32 anameter5
520,483,460 *352AA387B9DE9C554610EC3FC5CBF2FA307E8E3A 4UL22586
520,483,461 *352691B7F20EB54A187D5075F0F1655D1E8692C5 andy.groom
520,483,462 *352525041964107C378201FB604D09B2F06E7288 ANTONELEMOYNE
520,483,463 *352336D5DC5677EEF9EF55DDA973D28969EDC1EF aqt;4
520,483,464 *352E80209DF48C05492F037E3B1D36F19164A610 aravathi
520,483,465 *3525E36534A4CE8B43F98DFCE336C22F83C3105D 5sonnellini
520,483,466 *352D4ED661BF62A284EDC10FFE12151B04E5427F 5THATFOUNTAIN7
520,483,467 *352ACC0F06CE95E8647C0E258C20191AD91381BA ascents5
520,483,468 *35200DC521E5D5C086DCD06C24C055821173AA82 6AFFILED
520,483,469 *35237DEFBEA5506B5AAFDEAC4A5A0CB0D2BE6CDE 6-allrad
520,483,470 *3526CE091CEADE7671940AD06F4E141933AE27B9 6BORTKRSLERNES
520,483,471 *352A402943D98EEE8571AB1EA6426CD8BB739F5E ASSUCCO5
520,483,472 *3522746BCE9ACC6845F1D74CD166F54672D635E4 6BSWTIPSYSBSW
520,483,473 *352D4ACE277065B7243C1F2B391DBD8D3F9FECD4 atkh
520,483,474 *3522FF5E96589AD1AC2CFF77F67AD12F7B07275F 6IARILED
520,483,475 *352117AFF1A47C3971995ED831D65DFE2DDF6F3D augustepling
520,483,476 *352780F53CD40DA4BE787966A8CA8C231D152CF0 6INNOVATIONENS
520,483,477 *352A3B519DD8D4A458C69D9D646A97A1DEC7F5A0 6KONTROLPUNKTS
520,483,478 *352C6582AF8A59FE4047B9A94F9ECEED24541076 6NOPHONIC
520,483,479 *3524B1445120FDB0DFFA46140D3109F60F4AF85D 6NOTHINGANDY
520,483,480 *352D2D6FEA3F49D12FA15A5DFD9EABC74625DD82 avl$p
520,483,481 *35280A9BB4386ACE870E7B5EB83D47BC64EB1009 ayf2j
520,483,482 *352F91B796DF66989DE3C594CB1A0C01D7D03B5D a(zbo
520,483,483 *3523F8C392ACC65FF67EDD4EF94E558DCD2CD22A [email protected]~.~(>_0)
520,483,484 *3523DC52A1C454E11D7A16BF8BF0C2AC5C8E4BD2 B4FWB
520,483,485 *352991DBF469C2F2C2FAB6E40B9FCD34544EFA32 7bdfefd57879db657af651e90296a3a2.sdftyu
520,483,486 *35249198250EFEC34D0B50880EC630B30C6A025C b?5):
520,483,487 *35253116E0AF6A3264D999DBC267A6ABAEF18AE8 B8ZJA
520,483,488 *3528F33492C70380589828335177F5FDD74D9638 BAGERIET7
520,483,489 *352C4A84E61802DD0BEC397B0BE7060D84E4A2EE ba#rs
520,483,490 *3526EAB833B364B9378337ADFD66AF02A6491AAF bb~ ` (~_^)
520,483,491 *35209D728F776122E90564EB877CDBD2B98D62C0 7YearsAgo...DirectionsinSmartAlecMusic
520,483,492 *352B4ABEAEC93DFE6C7463B5CE610DFBFA5AFEC5 BC9AF
520,483,493 *352B0863D05F84338FAD84BAF9431855CDD04698 BH9VA
520,483,494 *3525528C6AD9807BD27A432EF16C999F8CA80BB5 8PKIMBERLY
520,483,495 *35201032A1302CD24C4B71E359CD57E9A68729B6 8-raja-asemalta
520,483,496 *352E64B13DBC6771728318A9F7DF893F887F44CF 8RITTTTIR
520,483,497 *3522A0C694F62515F0AF393F384440F213C6340E b.kes
520,483,498 *352EE03BE9235B01E982C1C502BE71191BC95F99 B)N
520,483,499 *352E07F6874A80C6AE7E471E329DD8B792B7174C bo6g/
520,483,500 *35278F9ED9843AAC69223CE6F31BEBF143F181FC BOSHOKU4
520,483,501 *3523E653B6156A3A174928E7CCB5744443E5902D 9JULIESEVEN
520,483,502 *352B5CC3113F6775215BCC6047F922FB8C97D3ED bo(x
520,483,503 *352C43663D6C8D14BEF8A421F58E699E7145F7A8 BPL!3
520,483,504 *352846E9DEDD3DB55211C9FC3BC56ADC01BC6A67 BQ"/
520,483,505 *352DD3002F298CB852893FF63909A232EEB704FC BQM,R
520,483,506 *352F02C7DED1F3DDDA31C5E7DC5054FC07F07BB2 A!0KN
520,483,507 *352D32730F9F9DC7818C25D65662211FFEE57067 bry1y
520,483,508 *35296FC0AA50669265342C8F94F42C8AE849C20A ABFEILTE2
520,483,509 *3521B12D59FB34BA048CB5F772A7885F6D6D9A76 [email protected]
520,483,510 *352A7606C9D7198EDD101FD282B2DAB3DF052933 ACQPQ
520,483,511 *352D7845A959A91D0E751AC2592253D10C58AD9B ADQUIREM1
520,483,512 *35232AFAF84449BCDF38585B24AF6860193165D4 aehjoker5
520,483,513 *35237325710E30D077904C792A55F8D1F01696F2 CATIE<3
520,483,514 *35287C303472F0D261629E6B584D63BA3CB4AE8B AH6V.
520,483,515 *3523F30CA292088465CA98ADB5550EC18363D8AA ccrup
520,483,516 *3529D50D7CD9D6AB4DED89563E603F5182D40BFB airflash-(single-edit)
520,483,517 *3520CDD32A1537AB876361718FEC25625193261D AJJFP
520,483,518 *352D76B34DB4C4ADD84FE3597EC1CA39FD4A9E64 ce"c
520,483,519 *3524AC2452BA01154DE18AD0F803949C64B547C0 ALPHONSO.HAMPSON
520,483,520 *3523999F4FBC59BBC286F463C0C9338FDE9FF6C8 ALPHONSO.RACETTE
520,483,521 *3522D192D6EC3A9606E1254852E66AD27605ACAD alphonsorampley
520,483,522 *3521C6F3C4F2C093C45BA5F39706679D74BA01D3 ALVAROMACNUTT
520,483,523 *3526790B850E429B2907EC93CD6132AB18D7DA63 alvinw.m.vanzweevel
520,483,524 *352D1525EFB3EFDF45BDE81BB2249D838357DF7A charleszerko
520,483,525 *352D2E34E3025C91636A0820A2B6CF714B02BADF chicagolake'-'chicago
520,483,526 *3522604BBA6E080ACFACDE5F0418DFD2247DA269 [email protected]
520,483,527 *352D66CED4E34416D793DC590D09045F0E109C30 chl6w
520,483,528 *352D08D7FBB6A86CADF97FFAD1906775B514E4AE ANTONIOFRIAS
520,483,529 *3523F3FD70C1774BF5D6DEA62E6E4B9AA006BB18 c.k7b
520,483,530 *3529F82A753FE57B4BE1777DEB34E99416194327 cl(b8
520,483,531 *352AE6192ABB9F1DE49811979729634D815C9705 CL"FV
520,483,532 *352483053B5C7B497FD570294BAD37C4CB640AF3 CMEZW
520,483,533 *3526B2B967890E69FF5B5ADA4A834984B748955E c"nkt
520,483,534 *352F299E8C5C53B45448026371C296DAEF3DD90A AT_"T
520,483,535 *3525BE5CF786AC09F4555720E88B7B26D2844EC7 AV>
520,483,536 *352B38926F2A06A884A63FC44A1C58EF964AB028 B=1BS
520,483,537 *352F88A0C44AC5EFF1870C50E5F383DA75C443F2 Cut-Perfect
520,483,538 *352A0EB15EFFFAA4E25CEE06F3D2D3C766C10D57 cvcbdptking
520,483,539 *3529F97C454AC4165F0BA39E41D983A1C582F053 [email protected]
520,483,540 *35269EA62CEE22E86F8A46558CBBF6B9C0755DAD BBUCHW
520,483,541 *352CE584A9AA732712D2DE5C5659F704B06F4E3B D0FE9
520,483,542 *3529B34EDB83284FA8A7500B7231163F86AB46FE DANACONCHA
520,483,543 *3527831EFB35708B201673EE3D03032143924FB5 biciklistkinja
520,483,544 *3520E08952480444139E08D70F5CFCA25F0DE0CD DEVENDRA.SHETTY
520,483,545 *3524C0A5A53A713DC1F98D1896157035EC5FA088 dilates
520,483,546 *352F7EC79223EE23BB49942395A0244E28E9A37A dillonridinger
520,483,547 *352D67A3C2B0DD0CF8455B9A2A2E85622BFFE969 BRAINBEVIER
520,483,548 *352B1AD3225A667EDA92DD284699A58B57A41695 DKH=N
520,483,549 *3525AC6C2AE8FDBDD3E15DEFF9A0A76065ECCE47 D##NA
520,483,550 *3521B436FF3679CA8190622C8E3549F842236A73 brooksscipione
520,483,551 *3521456A0D22CE89691A4702C30034450AF2DDCC DoHN
520,483,552 *352ADE8D9BCAE9130BCC1A7ADE22FF97590947CA bryan.worthy
520,483,553 *3529FBF0D0AF3AE7A910DF1A7F4051CED6489A13 c/3s"
520,483,554 *3528251572FC149E4319203B4E59719C13974602 du:"p
520,483,555 *3527EC387439BFD6DFE0AE3E865428DD8D0EB030 C&:AH
520,483,556 *352123ED391D4AA4E1895BBB7AA2F2E2C7FC0138 camrahn2
520,483,557 *352AC3C1CC3027E200352E2ACC1C3A1DEE3C98E0 EDALASTIS
520,483,558 *3525129642E9E379DA0157FFCE22CF811BF60797 ED-CABANA
520,483,559 *352DF87A5D58D7E067F4CEDAD6D7AE596A52F1E6 carterkasprzyk
520,483,560 *3529CDBE7E0D1790169C3BE5795FE62CF864BEBE EGCUL
520,483,561 *3527CE34A5270363BCD07E30BB3CF2F5D38B62B0 ELMEREIKA
520,483,562 *3523B7D2709EAFD1EB19BE13270078CA70F92FFE C$EE
520,483,563 *352505D01EE32036AD19971ED88EA4C11CDFBF05 chadmizuno
520,483,564 *352E9428215CB48C96C107ED633124C12FCC005F eol6r
520,483,565 *3523B201135479319AE8953CD57ED5717A5D54AB Epic-Calling
520,483,566 *352EAD662A3BA71C217830138DDDB872386C4EB9 EQ98M
520,483,567 *35280771C68246267B3DD5571A6BA8A020DB460B ESUOHREEBBING
520,483,568 *352F9BB90E1A08E2D16677870428564F3C428D8C ETINORCE5
520,483,569 *35243C3D7AE5A87646E5EE3F9ABCC39FAE9FB2C3 CLAYTON-OWENS
520,483,570 *3522C7B0388BE7099A424B5EFEC368DB032AB036 f6c9426540fcf3d3f1f50cd98fd2d3db.ddR4E2Ea
520,483,571 *352B4176AACA9E6B6C6CF0ED5FD8EA29C19FBFE9 CLIFTONVICHI
520,483,572 *35233BB29BB973B2DD270AD65105F569E045C03B [email protected]
520,483,573 *352530A64E30CE6378C02D145B8A1CAB2591F748 FIZZMONOBOOKJS
520,483,574 *352F8725E3F603D1C86313B8F125C927E817AD3A [email protected]
520,483,575 *3520619670F057505A99178600594332A4115324 CONNOR OAKES
520,483,576 *3527129D5D6D7587D269A966668F29A67ADBFE21 flieg.in.die.heimat.meiner.tr
520,483,577 *352DAE684DD403FF15E4E8822E22506864901383 FNEWKIRK
520,483,578 *3520A48BB1D03F725DCD0A9A136DA7BF3DB2FDD0 crem47ores
520,483,579 *352DFD53FCA46B9D62D259487BFC20EB9248B5EB GARAGEDOORREPAIROFSANDIEGOCOMWWW
520,483,580 *3521777F3619F31F6E61F85C6CAD4E2537125E51 GAYLE.BUTTARI
520,483,581 *3528DDFA5051CB7008C6DF1378ED5321F1E84F44 CYW.
520,483,582 *352CBD123B87F0E81BCB1E600456640E7AACE843 D0Gt
520,483,583 *3521251D8DE810D36A0C0838DFC0DD597192C007 GLIPTODONTES
520,483,584 *35264A78F230E357DDAB5FD513F860909BAE4604 d4guz
520,483,585 *3529DC10F09DBC7BD7BE8702F1B8F1F8EBB6262E [email protected]
520,483,586 *352472F5003B3884173F7BF5DBD36840CFD20C40 gregoriotapaha
520,483,587 *352DEF3D17C4E63916018CABD9CA7A5295E15BBC [email protected]
520,483,588 *3523A2727CB24BEEC3AF5B97889A5B3BEAA359BC DANIELBOONEFAMILY
520,483,589 *3526DE9F3E68F6DB82BAD7DA653B7EB212D1E5CC g"vz
520,483,590 *3523C34568E7FBE998450123B86BD23EF0DDA0B7 DAYANIL5
520,483,591 *3529F27F83FFF2D97115837E4384A99166CABE82 DELTRANSFORMATIONERNE
520,483,592 *3520828BBDD1FE0336E2459F2C31C90FBB8A4444 DENISEMARICH
520,483,593 *352012E7A298BC3268F6D0854AEAF00515D9D3E3 DEREKETCHELLS
520,483,594 *35238E9A499853170604CEA5A53BCDA084E8D3CA DERICKPABICH
520,483,595 *352FF57E477D8746265637F41142AD94AB21FEB1 desservirait4
520,483,596 *3528781BD42B40117927C1C37AAB7F12032362C1 DGLN
520,483,597 *352B18E2AB4CAAD2DFE75261E315C0D3C7B7AF93 DIGGERDRAGONFL
520,483,598 *35294BF506B4F575972A33FE37309C3A30905267 horanzy3
520,483,599 *35205E62EDD7A72B9D0C72919585D6D8B56C7D7F DOLENDE8
520,483,600 *352E9B62E5577E9DB33116EB82E9E479A3D9DF56 i.do.believe.you.are.blushing
520,483,601 *35212EA1AF3CBA60A12031E1D9D52CF59CBBC7D7 dorytich
520,483,602 *352B5D28DF929D162CA4173FE5F7A0C5A63C3F00 I. INTRODUCTION AND ROYAL MARCH OF THE LIONS
520,483,603 *352A6E6564DA7E55F58F743624037FE9708AECE5 ILOVENOKIA1991
520,483,604 *35209B17743E0E97AEDECC6030EF6A87140BFA22 DU$:H
520,483,605 *3520B81EE41AB5AC9E99EEE8DDB9E095CED6B8AF IPXN
520,483,606 *35225371E527621C74C102A3544A241947236A06 isiahsegroves
520,483,607 *3529651E433418FCD769FAD5191770E2B73FC026 dvhra
520,483,608 *3523C45EA7CDE8D94F354235A2C564CD65E1CE46 d$vl%
520,483,609 *3523C6BBAB43AECE60A4819E636A3703AAF8B633 J0921P
520,483,610 *352C99ADE52A4EEB444F926604B5A3415A55F5AD eastenders.&.melih.kibar
520,483,611 *352DFA7095E4B426E8D6D7DFACBE4B2C9927BA00 [email protected]
520,483,612 *35235034C54BB678E6CDF7AFEADB943876579699 EDWIN.EPINO
520,483,613 *3527927E092F0B4C2738D756B6C581BD22A46F19 eelpouts
520,483,614 *352B206277C10D5F9DC266A9FCA52C524E73D241 [email protected]
520,483,615 *352005717A40554E585210CE51A098FAE70F206D EIDLMESI
520,483,616 *3521E6170AC1EA7BE668469DD247579F00E3726B EIELEGNE5
520,483,617 *352D6BD5F506FC432248EC8EA83DFDFCF985BAC1 ein-foetus-wie-du
520,483,618 *3522E859CA0337D6784857A0D0C2877FD720BB4F EKTKO
520,483,619 *352B9DAA5F7868748ED45349FF2C5EDF7DB85358 ELBAUSNE8
520,483,620 *352D76570DB7D8E318B144243D09099B834E5836 ELICLABOUGH
520,483,621 *35258ECE29CA2EA5CE9D041CC2C7E7E49E7E06D1 ELIGZYM
520,483,622 *352E68DA85210DC016E357B803355232BB5BD881 JOHNATHON.BLANCHE
520,483,623 *3522A523C0EC385AB19E40754A63BFC53CA19038 ELUCD4T0NS
520,483,624 *35271650090967113ECF78FD62C7D36170F85643 JOSHUA.ROYALS
520,483,625 *3524F8432F3182CEE5B8056D1B13B43F314EA5D1 EMILYTHORNBERRY
520,483,626 *352F3F8BE14F3012233B5317EE8BBD17651CC12B judescannapieco
520,483,627 *352ACD547C799A7D395007CC584BF9E1E5668962 EN,(
520,483,628 *35227FED87178A57A37058EE5EB6CDE3899AD25D KASEYTHELEN
520,483,629 *352D05B958EF2D02857A342CB1218973D5FEDBE2 KERMITLATSHAW
520,483,630 *352C58B954699774F8F0CE21493D40EF09E98407 kpconvertorscoukwww
520,483,631 *3526C5A413CF8CFA3F02BFE8796923AB5A1599A9 F0ND3N
520,483,632 *35297424783826CECFC46CC44BDA81E3924487B3 kumkum9
520,483,633 *3523E332F1181E5E1C99F11E0ADA2AD56A9FAABA KYLEBASTIAN
520,483,634 *35297C216094B064B240FEEFB0414E71D9576595 FAUSTO.HASYCHAK
520,483,635 *352BA1B36347A07D04E0E849483FBF05EC878034 LABORATORY9
520,483,636 *352E9EB941AB24B06BCA78218F341E04BF91FDB3 feliciacosta
520,483,637 *352270A83D028DF61AB0BFAE54B1109991DAD194 LASHONDA CRANE
520,483,638 *35284C76CCF0744E7445F577FA6D5581941194C5 ff8cristal
520,483,639 *3526D22B130AEC615A404D8713245EDBB5EB5A15 FIREBALLVIKING
520,483,640 *352EA9436C1FAF5DA0C4048653DA62ACD6A420F6 FLASHLIGHT-FIGHT-(FEAT-CHUCK-D)
520,483,641 *35215A0EE1E367FCFE32EAD6AB4640CF00E61DE7 FOREREPOS
520,483,642 *352F544C7BE903E251AF18F07123963176153BAC FRANCESCOKASSELL
520,483,643 *35240917407F74662DDE6C8F798ECDC72DFA686A frances.metcalfe
520,483,644 *3529E1F6AA86A96E31283D98ED1CB253F5F2D2FB [email protected]
520,483,645 *352DD7621917C6D41F51629D15808AA8326C78A3 frauenhagen
520,483,646 *35229C2EABBF62ADFA115D4050D3AA5E4BD34BE8 LERVERIA3
520,483,647 *352502BAAC738DE4396D9E0E59F41B503525871D FRESNOZAUR
520,483,648 *35201F520FA9ABE8633B978F2865295DFB83D165 GABRIEL.ENDERSON
520,483,649 *3524A4877593954892B6D664EAC4792E9BEC127E GANANCIAM1234
520,483,650 *352829B611800C008120ED9BF413C9E0EB90FB2C lesouffleurdevers
520,483,651 *352D398DDE75FFF2E8121BD49E2C8B6C6863C71F [email protected]
520,483,652 *3524037A52275F0B7FFE8A807C46C92B65C1F1D6 LIGESÆL
520,483,653 *352BAD1C54D288782D3D95D627210077031655C1 [email protected]
520,483,654 *352D1B7EC6668AA9A40B2F15ACD43E65CE1A0032 gentry-a
520,483,655 *3528EF67531ABD473C7A22251F2E3F92D0AE1A9E LINDSAYD
520,483,656 *352786E6034A953C3998642A2F2700F1F0AA71C4 GIVEMELOVING(AFTERLIFEREMIX)
520,483,657 *352CCD599D86129FCD2947F83CBDFEEEDE637EEA LOCATIONLEADSONGDOG
520,483,658 *35218314104FEC25F13A7C4FF33327AA6ED330F1 [email protected]
520,483,659 *35277DA2EBC0C054D9364017C695A79F90D6FD81 LONGVENEMA
520,483,660 *352BEEB5B14933A7CAACE4A73CD286B83FFBFDB5 lonmeuller
520,483,661 *352ADDCDDF117BAA15515B4F00DEB0BB5687BBDD LOPAUKAMEA
520,483,662 *3522C918020793E4218883F847732AEC86E143C4 l=pg
520,483,663 *3523EF6A7BC7A84EF31FCF63031724511FC41556 LUCAS.WOLPE
520,483,664 *3520B4C3FE9EF4FA124226F050BF97AB62D7228D GRAHAM-TIERNEY
520,483,665 *352709A7F7D9A13185D68A84AECD1DB1724B52A5 graigenglebert
520,483,666 *352CDFD5D38184A015AA52E950630A5798A9F8F8 GRANILING
520,483,667 *352406934BDF06FF79E562D0584283AA09AF4CE4 MACFOLLOWELL
520,483,668 *352090DBD594E0C7B9B2EC10E79CB9565B163D3A GUILLERMO.FREMONT
520,483,669 *3527DE4545557266353C19A1373212970BA58AE7 MAÏEUTIQUE »
520,483,670 *3527A9D2EB8220E5B4ED90B47F405CF21B9F6D0A GUS.ENNO
520,483,671 *352CB1915C782388E9469F0C8BA36E8AE9C7D23A gutesgutes
520,483,672 *352DB0BAEE3326802936C136A16F57CF5D9A952A MANUEL901
520,483,673 *35296ECC82BC2B2B3F30A25AD681DA497DAE2BBD [email protected]
520,483,674 *35295DFC435651375F45ACAEBCC2A2A6DF4AB66D marikovec
520,483,675 *3522E9F8D13A27B4103D6F364551547715F0622F HAICORNELIO
520,483,676 *35233DA81C3BEE3EBC69ED4E06B7F8DB987E4F3D HAKBIJLE7
520,483,677 *35222BAAF2013A5CB0951817FB42C7EAE7ADA422 MARYLOUJIMENEZ
520,483,678 *352C143BAC1644935F8B2251F514753E178AF192 hautfer
520,483,679 *352B6D4F3A7E3C8B80BF6D3DCB28678ACB46D7C0 [email protected]
520,483,680 *35239F5C07D2AA14552F876212CBA2C6832986D8 HEMANSHU0
520,483,681 *352215DBCCA90D89ABBA4BA93F45523EC165C870 [email protected]
520,483,682 *3523ED31C2C579FE92F53470CDF0F5AC71E3B830 MELLORY8
520,483,683 *3522414EBF8F5B53E0F271115B84F744E7D63BDA MICHELEDOLLASE
520,483,684 *352400E8EF113753481C4874A008EE48A09EE835 [email protected][email protected]
520,483,685 *3526DB09D3D1230BE86C4EE09C639A532AC77A9E [email protected]
520,483,686 *3523308C361123D3056484AFC2337CF82E0F974C Mirage-(dance-mix)
520,483,687 *35274E1C805AFDD75AFE28F4163D0939DDF1B3BB MITCHELKEMNA
520,483,688 *352AE12DCF9A140E65EA80428958B90CEED8B9D5 mleq
520,483,689 *35289970BCC1D7BAD2738CDE46F5216A33FA1C1E HOMOFOOB
520,483,690 *3522EFE840CDE9307683BF4052317D07F6E75E69 mpjtcdf
520,483,691 *3523972B1FD01975B380F378888AF6D3ED090B07 hphillip
520,483,692 *352C8F0674B7403E8DD2E4E6B35167D4F0E93F65 HUEYGONALEZ
520,483,693 *3527329D9BBD58E2DC9C448689BE5D0B0DAD7D23 HUEY.LANINI
520,483,694 *352A114DAA8F053560419282C1998BEC9FF7D2CD MYPUPPY1992
520,483,695 *3525E41C81900F1C27275C8C89E696C0F9311287 humbertodergurahian
520,483,696 *352747F63ADD736658B0A9B0865CC819823AF063 [email protected]
520,483,697 *352DD2998C78B2F263122D1FE71940586ED67FD7 NADHINDUCED
520,483,698 *352288CE212B4C3595FE4318131E8CCA64F055BE najisoli
520,483,699 *352C81897505A7838A1455C18B3CF4718D754208 napoleonhuret
520,483,700 *352B6F4480DD5F722D42EE0D4345C63069322536 NAPOLEON.PIATAK
520,483,701 *352BDE2D4614B56BF5ABCDD9A695DA032DC8CBC3 NATHANAEL.IRIZARRI
520,483,702 *352443A98ACFA22AB2668CA870D5B69CED0E8AD0 NEILYUASA
520,483,703 *352E013FE33C8CA478E000B3A9CCCA9E5A14C5CE I801014
520,483,704 *3524C23B4D97AF5D593C54148A26FFC053E1D026 NESPORMES
520,483,705 *3529F654F5CF5C4EEACA4FE371E0349312F143C7 NEWSPAPERTALKVINIKO
520,483,706 *352FDDD672FE4DFDADBCFDF4AB81B9B791C308E3 ID3AL$
520,483,707 *352CA9E9F2747E6001D6C63D2F222A5E1D54A392 [email protected]
520,483,708 *352B3AE4EB399F69DA3890B311B877FC415F21AC ILJKL925
520,483,709 *352231E46A8B71AAF52580798B82E7E93AB5E2A5 ILMATIIVIYTEEN
520,483,710 *3527326C62E5B91EF70A4A0CA06AC1CEAE22885B NOBLE; WHOLESOULED
520,483,711 *3527E9701D6EE6CE6A451468E0E84E6BCC6CB045 ILOVENESBITT1997
520,483,712 *352A54453B86D4229F6D2DCB9E84B6A58E974AF6 ILOVESONICS1993
520,483,713 *35277DE8E3BC5BC2A0090CACC6797D97585911C7 norbertodrimmer
520,483,714 *35222C3676FE04854835304D1A059A1D6C09E842 ILUVDUCK8
520,483,715 *352CE62B538A893C99C8247FFA86BD9E32BAFC23 NORMAN.GARMEN
520,483,716 *35287ED714D492A32807FC35BFCC01C8E6566FD9 ILUVMORONI93
520,483,717 *352FCF82572914C88FD31F456CFCC292B4EB27CB NSUHTAYC
520,483,718 *3522BB272B427D32C6A1F0F186279AE77BBE9054 nurse-j
520,483,719 *352A65AFF1A682B583093862407979DDA6D103F0 OBILANSK9
520,483,720 *3529228708E0E74A3F829C5B1776D1B11442B6CE [email protected]
520,483,721 *35268870574BA3BE42BA21E6D14C3F52154EC1AD olivermasson
520,483,722 *3522B01878269069C94F288731FAAE504AEA4D0D introvision4
520,483,723 *352627EA264862CE29D74116135CDDCF3F02DC17 [email protected]
520,483,724 *35282E69D3961381A173ABEF2C810AF3482C04E1 (><)O~.O~.D##B
520,483,725 *352FD9957E20C990016623539F1E554A52EE7312 irish.bernardo
520,483,726 *352D7AC6F914CE0A0C10367FD4789B540C3519B0 ishanki.gupta
520,483,727 *3524029C48634309BEDAF96EA65A490662B8E7E3 ISMIYDE
520,483,728 *3524AAF5F203576B1F957A01F51CCC18C525117D isobare
520,483,729 *352B22E1AAD3E1C43D00604768C305CD803095A0 OSWALDOKRANZ
520,483,730 *352EB2A7AB2EEBE75EDC20BA249856D366601C17 OU8125683
520,483,731 *352608EE69C511BA8A567BAD76C5B81FCADBFB21 overidentified
520,483,732 *352C00B9C7A1734C49E742AB92955FE0DC04768B P9I6
520,483,733 *352A93EB2BAC529B709470983E37183AF053B54A PAGHAZADEH
520,483,734 *35246B104E77A7F5044FC027C180A81EA1EB6C74 PALMER.PRITT
520,483,735 *35229D023A5BE7B13F523114FEA75A5DB69AD89B PALMETKAPITELEN
520,483,736 *3527C55F27352D62F9D6E8F0281DD91F058F4561 panacheert8
520,483,737 *352B79EB774B992B7B236DD70833D924E4BD32B0 [email protected]
520,483,738 *352FCECD2623426508FBF20DF9B7EB199502A8F4 JAVIER.HUHTASAARI
520,483,739 *35252EFB2654EBC0089E1E1209650A3700B9C0CB PARKER.COLLICOTT
520,483,740 *35233DCB5C9E8AC17F288CEEF3714620B435B898 JEFFERY.CORDOZA
520,483,741 *3523F10083FE954D5FB9E2245235670B7FCB3F92 JEFFERYMAGYAR
520,483,742 *3528AAB621233C4F89284CEBFB94D1ADE09003D8 PAT-FALCONER
520,483,743 *35207816625A4A3110822055444A57AAC31493F6 jeffreyweisman
520,483,744 *3525501F764F1D23629F97D7E17ACA2272F1D379 JENNIFER-CARROLL-JOHNSON
520,483,745 *352875657D1E0C827C454E37D54DC54D0ACE2C87 JEREHERARD
520,483,746 *352369E6E7B27EFF077D89FE53CFE1635F5B2817 P===B-~O~OO->-<
520,483,747 *35268A53491821F56A923A6CE7336E3F9F0EA984 P====D ~ (>_<)
520,483,748 *3521BB85182F4047DF97C2C15417B89955CC9BCF PESILAR
520,483,749 *352020C7949654BBA129F96118B607BAC927F8E4 jimbobb
520,483,750 *352D90D4975F9E12A0D4C0640D51475AB859C312 PETR TKACHEV
520,483,751 *352AF71CC02C1693FFBFE184A5A6A343A7752E69 PFPOEH
520,483,752 *352DCCB28FE400B050C99924F06155600C24F7D2 PHILIP.SCIANDRA
520,483,753 *35235BFC84BF84B4B0F41023AD92315B1DFE9A77 PIANIFICAMMO
520,483,754 *35260ECDD17440E94F89771395630A85E619341D JOHNSON-HOUSE
520,483,755 *35224182C0127E769E5003B0B5FFA080A75C9C5F playerpackard
520,483,756 *3526F21731DF3210812C50CD923CCB2B4CA84F69 pollat.alemdar
520,483,757 *3522930475B902F64CCA8B356DF97FA2A36854C5 PORTERWINDLY
520,483,758 *352D39C449787B61F0029D03FCF01AD2F2F35386 «POSSUI
520,483,759 *3526BD5458945B9DE9020D2E7B1D16ED7C5B2F79 jubilarian
520,483,760 *3529F8A27F5481F372E2552624E0390BC3221DA1 JULIE1ROYALS
520,483,761 *352F2E9149E0E0C9DEC9DCECCD97765814BF2EAF [email protected]
520,483,762 *352C9A64D560905E40D6E1B896DA0E07E88B985B JUMALANPALVELUSYHTEISÖN
520,483,763 *3522B5D9518CB5C06539173AD22060F2FAF7D048 princess.amboy
520,483,764 *3529AD77FEBD25CF1EB33FF58BF418C2DE0CFCF6 PRINCESSAMBOY
520,483,765 *352F73606315101ABED2C5E25B6F83CC47C7F1E9 [email protected]
520,483,766 *352402EC28A0511EB2A9F1EC39A295DF239CE1F8 [email protected]
520,483,767 *3529B3A08ECF6FE5716339F4E6300F20E172D7D2 [email protected]
520,483,768 *352312E05F300BBE439413D5CB89A04BCE5B813B (~_^)` QP
520,483,769 *35258B6085E60A984653902DB64E46D431D80252 kellymostyn
520,483,770 *352828D43787B2B58FCC5609F7A0E1650DD1A543 QUINTIN.DINGLASAN
520,483,771 *3524E153CBEA4624CCED58724AF2C858A8D11ED9 quintonrose
520,483,772 *352F55BA1A1D5677663B23F004B0F729E3BC7F50 R3FORTIFICLOI4M
520,483,773 *3523764D7D75C29148D40E240FDAA40F2064A824 KEVINCAZEAULT
520,483,774 *3524A439AD2EA44890A030DA1BAA2069A1F7AADE R{8
520,483,775 *3527763EC26E0E02B10423FE8EDFB3F3B6BBAC89 KIM.BATTIS
520,483,776 *3528C77A77CE24472246263C935BCE55A52BD357 KIP.LENTINE
520,483,777 *3524B46F37F0E73AA6A19D2D8E3CCBA0EFFDC6B1 kitchen stool
520,483,778 *3529B1E7B4F18429CED0964D51F68F1B41569DAB KNPGTU-R
520,483,779 *3525EF67A37859D5624097E22551EAAC2E56A51E kolhpuri
520,483,780 *352CD74EB7CC4044FE3C794E830D587EB0D1B5BE RECHENZENTRENBSW0
520,483,781 *35298FF64B036D7AD56B1D472060067DEE7362FC recomposerais?
520,483,782 *352EF310EE0D013B3567DC769217B7DA915D1D5B reinaldoleehy
520,483,783 *35290CBF1E16C4109F64E32AC5220553615753DA kristine-gorre
520,483,784 *3528E203D1FF981607E56D5FBEC53A985ED07B64 kristophermaasen
520,483,785 *35252733D0A4E2314194B83075055E5FC4E6D0FB krstian6
520,483,786 *352F8288627C7C3904DDAF68A2ABA0F92476B834 kz:2
520,483,787 *3528BCADB9AEE2113DD372368934225E56616981 l4bor47or!3s
520,483,788 *352264D1A18CB0567F363B42C9A92EAAD8651C15 lacykilian
520,483,789 *35215F3EA9A7710144F45028382EAB3E870EF38C [email protected]
520,483,790 *352F267AC4E3E6C6DEC9394EFAD775ED931BCFD0 LANE.MANUES
520,483,791 *35266E7CBB607E371721E84B00AF2F107CBBCE28 långseleföreningarna
520,483,792 *352F5550701D3C0F17380B38F7CBCBD13CAF1C55 RICARDPURITY
520,483,793 *35299AD9B28DEC3D8450104C0F58885FEFBECA2A riddickjr
520,483,794 *352D99966B66DA5023341E8705EA5932E32AC3D3 rinkinkte7
520,483,795 *3520E0A138296B19964379979AB88DEEF0F6C966 ROBIN DELA CRUZ
520,483,796 *3527A66C92B92BE1E89EB46CD82865F865F268D1 LARGEN0$
520,483,797 *3521E424F988DF1950B1714871DFC88202D33C0C ROCKETS.TAIL
520,483,798 *35297CDDB3971E2E6C9AB6D902BD2EC8D3766481 LARSENYVIND
520,483,799 *352725C5D2AAFAA5F052C2494F9B3AF876647D1B RODOLFOENGLAR
520,483,800 *35223A71DDF64345F8FFC152DE01B8A386FF922A laurenbaugatz
520,483,801 *352D1EEAD5D50B8C7B89A47E08DA8A3273354EC6 RODRIGO.CHOUTE
520,483,802 *352361DD5E4B70BA8869FBD5B4256DACD7B83FF1 ROMANKENNEDY5
520,483,803 *3527AF816EB272994B8CB229F904FF49C739FCFF LEE186165
520,483,804 *35283729546B85187F629F459AE543EC75D523A8 LEME2140AISNE2416
520,483,805 *352056323A1522C1055E6254077EE45E9AEB637B LEMIEPAROLE
520,483,806 *352B8B7CA65F70250CBCA5E0BC1B1BF588BB9E84 LENGTHWAYS
520,483,807 *352473E524CDDD6541F92DDFF13AA1304CAF8382 LEN.WIMPEY
520,483,808 *352CC24E078B1AF02CA9A0A6363B16C629707D3F LESSALAK
520,483,809 *352BEB5E6C3D68632CB9A03DE2ACDE3C25020855 ryan0605
520,483,810 *35259368E421A4246DCE42D30B1675E57CADA6AF sammysam13
520,483,811 *352E2A9A5896535C7EE15ABBB0AD64D904760842 LIFTHIMUP,THAT'SALL
520,483,812 *352D9A0E641A404060FA465A6D38B75E47CD0CAA scythed7
520,483,813 *3528FBDDF8917B8D84AA8E256603018380018BB3 [email protected]
520,483,814 *352AC6E559D4133CEA0E8C9FE8FE8EB55DB62E56 [email protected]
520,483,815 *352E9EE05BE38657D375300FC987A67576D3482B [email protected]
520,483,816 *352596160A1EA6867DCF3634069775DF1013A021 LIVINGBEYONDSUFFERING
520,483,817 *35261C7A23EF9AF298BBCBED0D3980A65291F03D SEJTIUPSENIFROM6
520,483,818 *35235F6A461BC1DE937D0A37C9C7C345A033FB59 [email protected]
520,483,819 *352F8650428B1CDB27F7C058932F119780D9756D semi''academic
520,483,820 *352417A40F05BB06CAFFF1DDBD601CC3ABBDF1A1 locura.de.juventud
520,483,821 *352553A7E3F5490EA9F9E2CD440280BE07B365BD lomllpdl4x
520,483,822 *35261FBB8E3FEBD59F8DFC312EEA5ED8FA5AF029 LOUISE SALMONS
520,483,823 *352DAD18C6485F5E28BA0F3D1B022BBE4E090843 shf+l3ssn3ss
520,483,824 *352BD2CE1C5D1AC6CFBF66189A29A88ECA0E3D6C si<#
520,483,825 *35201164CEAB4E227EAE72626D90BC3C9C8E6BF3 sierri
520,483,826 *352A7AFE6DB9199F1E4DF8194EE4D4EBEB373AC6 M3D14T1V3
520,483,827 *352B3C5C2173ABEABBDBBF330F7577A69A3A36B8 M3dg
520,483,828 *352C032E50066679FA98597E1FF518C4A4070D15 smltnsnss
520,483,829 *352AD36326B3197F2F402DEE694AD2F26F2228F8 soapwort
520,483,830 *3526B8C640411CAFF7E520D4B585B9BC6C1BF7DF SORPASSANOS
520,483,831 *352828599333040D201CECB25EE238CF1F4DEF97 SOZIALPSYCHOLOGISCHEM1
520,483,832 *35237C5214A63A9C2ED245A58637A0A35DF23C6E spanraam3
520,483,833 *352405889A0F529050865781BC083189B71BF8D8 SPEEDYCOLUMBIA1
520,483,834 *352F347CF4C1447F11DAE05FEEC25EB6A15A85CA spencerchilton
520,483,835 *352E01F7B32D18E61DF65506F89FEE7F9922727A Splat*.*.*[email protected]====P
520,483,836 *352DD6861ACC545988EBAC7DD790C7DCE229873C sploit.0~.(######p
520,483,837 *35281A936923F6171829EAFA755832A481AD1CC0 SPULATOED
520,483,838 *3521733E27F8DACF5469CEA879367415FD5761BF S-RAPIDA---M.SALUDO
520,483,839 *352CD82279A553AB805BB5D9F8274C69644E69FB masonpastrano
520,483,840 *352E704BE6C44EF57E8899FD68183457F9AB3F66 STANFORD.OHLENBUSCH
520,483,841 *352696805DE6D28ED711DAD4B3C94F1D959FADD7 STANOELSCHLAEGER
520,483,842 *3529EE0DED414A29F5CABADCC68B1EEA02EB5850 MATTHILLEGASS
520,483,843 *352EFE293B653CB265BB376F14F88F0A2A6153BE MAX.FENNIWALD
520,483,844 *3529C6B52F4C728DEBF5ADEC46607AE8F1E7F1DB MAZAEDIA1234
520,483,845 *35203D90A90F9BFBB47FF0737F6FC8EDE9BAB72D STOBS1234
520,483,846 *3524438FB3231DF6BD298449AB1B21B866AABE7A STOIXOI9
520,483,847 *3523809A6F94A71F625D9B532777CF0D504B5274 MEL.BRISCOE
520,483,848 *3524555C2895A11C45E66CD67732CBAFEB14039A STOREYTALKRICH
520,483,849 *3526937BEAB5310FDEA89B45D35C4D27B7E76482 MEŁNYK
520,483,850 *35292C64F8B187E68BD9D3FC475A47B795330A10 METALLUNGIES(FEAT.SHEEKLOUCH&STYLESP.)
520,483,851 *3521AA1EE7CEE1EF2C26FFB959BDCED24A2F1B2F MICHELLE.TRANTUM
520,483,852 *352AEA0923F43D0D4D19C69EAD9B237CE43BB203 MIGIJ
520,483,853 *3526116C61DAB53070279ECDC508939D31BFF197 SUN-CHAOJI
520,483,854 *352EDA319015130753B4608566A410854799CDA1 SUNDERLANDILAINEN
520,483,855 *352575E0E0EDFA0AF65B427C3A2886C22930D70F SUNDQUISTBSWING
520,483,856 *352662088291AFA5A3B551D474964DB3E59ED6EE MILER)(*
520,483,857 *3528923490EB056BD77AED87ECF682ADC08B47DC SUNSHINE4175
520,483,858 *352C944E49D84EAB2C02F961FB8AB6EB5E22F17C MILLARD.SHIFLEY
520,483,859 *3528461CE472D3B86092D1667E874899BDD02F24 superwagging
520,483,860 *352CE4C20D91D30732D74F9832412E70903E8BA7 MINHFURGERSON
520,483,861 *3526FBB60F00E923BAA7EAB74E1B69A081730744 MIRIALAN
520,483,862 *35232E3003AAEB85B629D10F698532C03A97CD3B mixの番組に初めて登場しているが、それ以外はこの番組以来k
520,483,863 *352CE76C67F86047812AF5831759ACF3DB036676 TABLETCATALOGS
520,483,864 *352BCF9A3FB048FBA4552981DF03B75214BCD693 [email protected]+
520,483,865 *3527C682959112DB377849E2B59A03B958E8B52B mollymemphis
520,483,866 *352551407FC5C3FF948449B0067564A0F496A820 takkemaki
520,483,867 *3528F64CA873473723C3C520BB5A529DAC7A6392 montyraiche
520,483,868 *3529040167A4B3408384318AC60397C15BF9046D TALROX
520,483,869 *352B5E2EDB859125795107598D54B34D4C6198AA mqpcomwww
520,483,870 *352BA217DA6B361BC5431B0DC819E39039B7C247 tappiot3
520,483,871 *352AF24E68C67930DBF8A541ED077A458C0B0C1E TATSTEST0
520,483,872 *3520F325F92D5D5076F3E7E448FA6265FF193A2E MUCCIDUS7
520,483,873 *3528C5DFF721DE217A6111F4DA21446DFDCA48D0 [email protected]
520,483,874 *352EA78CFAD478036CC4A0395FF599BC4045F99B munira.sharmin
520,483,875 *3521FB392DFF437B320CBB16E7EF06FADDC4681E MURATARAS
520,483,876 *352BC645FEEB05D1A958D66E0ABCA470ABCFF035 musicfromindiaending
520,483,877 *352769E97E15264F7D351651B30C33D6B9FD8DC5 [email protected]
520,483,878 *35251F746C8A0807E66BCCDE5D5199ACE74D9B1C TENANCY7
520,483,879 *352A895869F90D574734869F217FBE87A949A85A nadia.akther
520,483,880 *3524209D4B494A7AA300CE3D4B4784D2701AAEF5 NAGRERESOLBER
520,483,881 *352EB9C11DF34AC4B6B8350CACA81AA913E3A317 NAIGEWSA5
520,483,882 *352EC3DDDEB1345FD433F753DDC48D076775D217 THAILAI8
520,483,883 *35225835697CD94A11DB4FFC7534477FEE3924FF the greatest no 1 singles (disc 2)
520,483,884 *3529782F67A77555BDE2EB23A4D4DE6110C847BB THELASTTIME(STING)
520,483,885 *352F1BB68E7A15E603F6790C2B8A8B175FE4EE69 TINGUHAON
520,483,886 *352FEE84743F95C7AFED737D4B7168E2904E350E titliking
520,483,887 *352AB074CFF1DB93281DA5186985E2399186FD8C TLINNUT9
520,483,888 *3522D116ACFDE96DA4D4CC24B150FA65EE26B322 NICKYKRASNANSKY
520,483,889 *352F06544E1F9FD972072A5A79AAB6F15F63DA3B TOBYLESTOURGEON
520,483,890 *3520099715C1072BB4AA7493AA4F72E0903A252B toddjutte
520,483,891 *3528BCC3A5CA144074F1A03AD83F25E53C042F9F TODD.PSOMIADES
520,483,892 *352208E012ACBE914A2288C392DF8E8C834C2EC7 TOLLIES3
520,483,893 *35223817131A0BC0A9AC4EABCAF15C3D73B7048C tommiestartup
520,483,894 *352AF4A2D2DA5F5D0D0F461D118434E6E318E7FF tonypopi
520,483,895 *352C2A5EB590FAE318C1E3950D56E756C9B4AF21 torrey-nghi
520,483,896 *3526DD02B86D9D23E924DD53D145C5EB91B9CAA2 tourneurin
520,483,897 *352D648F32D3F6CF32C2E82BD9537936D9F22C7C TREYKEBEDE
520,483,898 *35297AEE2106B7B9F3651E01614E62A1E34EC69B triantafylliamargaritidi
520,483,899 *35238EE1026D2B4A119CA89526A94EAE51F4F8A0 TSEENHNING
520,483,900 *352FA245D98ED690E8BC847118604A6D37C68655 noehaigh
520,483,901 *352E1F6C408FBCF202BC27D8E241CE55D60235BF NO GOOD IN GOODBYE
520,483,902 *352D3421B823078FE4F3AAEE32349740B202CBD0 tunde-abraham-animashaun
520,483,903 *3523D52FD41C85B58923FB42F38E62D1435D0C83 TYRA.HAMDAN
520,483,904 *352595124AF4F45BF4851B851D3E582A58B5CFEA tyronefuerstenberg
520,483,905 *352F09801A151D2ECC2642016E4B880306D88542 nureinhalbermond
520,483,906 *3527EF2C1CD0B1F12CAEE2448AF07445239ED87D udehishigijujigatame
520,483,907 *352636A2FC3FE3CC4C81367E6E0043BD1460CDFC UN4W4RD3D
520,483,908 *3528B3BA0FC7A0F068CB0B7AACED249A8DB1BA21 OLEN.GIERHART
520,483,909 *352736596CFA482D62897A0D7EF0214F42D07DA8 UNIONAGABRIELLE
520,483,910 *3522146FF14491E9B3D8D6CA825AD26D6CC9B8EC [email protected]
520,483,911 *352482B9DF955792F6B93B20D161110E67E2EE18 ollie-burch
520,483,912 *352FCA159CEFBAFEB557F8FA6F7C22159048AD98 OMARTRIVISONNO
520,483,913 *3526C3E7F785EFD5FFEADC970FAFDCFDBCAEF872 [email protected]
520,483,914 *352C3193905B669E6076C012121E5C5DFA06D184 URENFOTO3
520,483,915 *352D2D699A1185AD7A2850C4E528257CAD23416B }o{-o~0~-<------B
520,483,916 *352C74669FA6AAFE73152BF64CC369FCFE56F6D9 UsetheUltimateSuccessFormulatoCreateAnyResult(10)
520,483,917 *35200ACC28B09D783CE636175D300D7576532264 uuykuosed
520,483,918 *352F678F04869732DC402749B6B27593ED01620E ORENWOLLAM
520,483,919 *3527004E4CD410797BA837BC90CDF7DCDEB4A9AD orvalsarber
520,483,920 *3526EBD783341F75C6B902395F44579400AE1E11 valentinesabori
520,483,921 *352A9D5C48438F03906CD1D974CBACF68B0F69BB VALIANTSED
520,483,922 *3527681ACDDF87F29545B37C03ACFFC9D61DC4D6 VÄLXELLÅDA
520,483,923 *35242876794BFAA69F6CFAD41C9B077AFC91B4B8 otscanaro
520,483,924 *352FF86DB58D6EA998E96096FE18F4B1E205F9F2 VAN GELDEREN
520,483,925 *35245970B0AE548339FBB1AA95D6BF7AB9FA8AAC velmawatkins
520,483,926 *3528DA346B48DBCFF43846A06F4839F3F4B1F505 [email protected]
520,483,927 *35298C4D9F6B5F5D78155FF27ACF0A5C39641DBA VERSAGENS1
520,483,928 *352E514F112FF5B6783C551F5C8EB553F23143B7 VICKY.AJENE
520,483,929 *352BAC7537710D2D06843FBE29A93308429F0890 VICKYMAKEDOU
520,483,930 *352004EEF797A0871E61A72659087424394A3E09 palpavo8
520,483,931 *3529CB8E6433160C50216122B1EF81B322D2960E VIRGOLATA5
520,483,932 *35254703006C319F6998C7FF3D64BE4C130884FB VIROLAI8
520,483,933 *3524C813D3060A4096018B681A7A5C92A200C5E6 [email protected]
520,483,934 *352D1A959B61F1C4672C78CC238704A6D0FA0F2D VIVANCSICS
520,483,935 *3523902E483E8C3AC6AA8AD3237A254C5BD5C675 viviannwaniji
520,483,936 *352DEB6995DE3F3CA85DF8571DE74B30F273EFDF PATYDAGA
520,483,937 *352C57F6FCB17D5BF9FB693171E1286DEC4E69B3 penoncel
520,483,938 *352B33AD9BAFFD65009BEE06D1B2BFEA3E1137DC peter-ammendola
520,483,939 *3526FB4F0A0A8B49417362F561FDDBA088C44E89 WAELKODIEH
520,483,940 *3525A3BC05A8869CA88C8E660EA37D2A10A54077 pewter21
520,483,941 *35271A6BE82CF56BD530956F239F2B284C0BF46D walkergeoly
520,483,942 *352D50C91056CA6AB300575BBF636405DDA6E223 WALLYMCKILLIPS
520,483,943 *352B01793C72083067BE43C1331A056080B346F7 PIANO TRIO IN BFLAT MAJOR, D 898: I ALLEGRO MODERATO
520,483,944 *352AED65EED7324A581B06FB2ED1457573BDB9B7 „WANDERUNGEN
520,483,945 *35207CDAA617259CDB92B822B1E9A8E09E2267F1 WARRIORSMERLINED
520,483,946 *3525A75D389F335DE3CCF6199CF4DD2EC56B423B PJETERSHTICË
520,483,947 *3525D4E0D172BAE8BA9226EFFEC95A6F282A08FB WAYNEHORRAS
520,483,948 *3522A37F75689787053E8CE4A213244D0214FCCA plasminalpha
520,483,949 *352F445F060942CD2430C8D32AF2C88C460F90CC weldongholston
520,483,950 *352C2EA890E2D17C053CCA6B618AFD42C50C68CE :p-o~0~-d=P
520,483,951 *352B7662F5F2BFDF72D0B32C6DF898729E33BA5D well.tel
520,483,952 *352A18360EECBAC53DAC6906E6C76DAEB7633099 POHMTRPERINTEET
520,483,953 *352F2CDD2C1DB5884432EB8161D8BD0860305B08 WENDY HAINES WILFONG
520,483,954 *35240BEC987D4ACCC94DD93C25F5270EDD3C609F POPOMUNDOKSI
520,483,955 *3521C3642613D89CD10AD509AC37540C04BAE131 prdikant8
520,483,956 *352F42AB23E7B1AFEE9D5EBAD3D79446FFE95998 PRLNGBL
520,483,957 *35250C1C99C5EE99AB6679F77EC79CDCE5B3A59A profile27
520,483,958 *3522C4B6D3F388A6B8052747F2279034F85BDADF PROVGUAJIRA
520,483,959 *35250BB5B3F349C866AE3788FB871D104B50853B PTYCHOSPERMAED
520,483,960 *35220B4A26C8F05F6390ADF206837F8D3FB2E0BA [email protected]@[email protected]
520,483,961 *352A08C8DCD9FEEE3BC6E75220CB33758B80653D won'tgoquietly(meninmasksmix)
520,483,962 *3523FCD690250F0174759593276CAE9CDB11447A q----D~0-~oSplat!
520,483,963 *3527C9F6195E64897793B3D32D955D1B19A24385 WULAN MIZUNUMA
520,483,964 *352DF934590B26B8872DE15FDA7A0EAC959045DE WWW.PACKAGINGPRICE.COM
520,483,965 *3526AE750C5A6C56B4624A8EC80AF18E35D0AB90 )X(-~-`-(==B
520,483,966 *352C970D9A036EAA56930A2B7EFE931C374DC38A [email protected]
520,483,967 *352523E00F5B8E1F9402F1C9C636C2681A126FC8 ql_m
520,483,968 *3522CF4CA59C8CA2E32E866D79EA62936F481760 QUARARIAS
520,483,969 *352B3CB9A774AB3E5DCE31254118B4DE39A74990 R3GIS7RAR
520,483,970 *352500D0E21366062DF3F7720D3716A821D67A6C [email protected]
520,483,971 *352DFF04E656024004A7FA8A6A4F433A044E6BBB Y3BAA
520,483,972 *3524052970F7F54D9462AFB95EB2BF6515EB6B0F yasblockmasiello
520,483,973 *35215046A71B067EC324CBB0AE76E7787D84FACF YASMINA KIWAN
520,483,974 *35274D12C330568626BD73BEB11104EF1F0E5435 yasmin.lino
520,483,975 *352426D42B0E50A20E75D2496017802DCAF6E3A2 YEAHGUY1217
520,483,976 *352C5E31390004063D01A2AA09D18F126CBDF8BF YOMIKURA6
520,483,977 *352C5B9950EB25D3B28AC8EF47B78ACCAF44C25A RASCONI
520,483,978 *3528BFCD20D28CA4C9E7DD4E011E1BA312E55593 [email protected]
520,483,979 *352E86B508034BAA50FC92A7BE898468A1DAAFF3 READDRAW2
520,483,980 *35253486C7F060E903196895C0683898079928B4 yuzukakinjo
520,483,981 *3522B1E327325AB8007F41316E67518A0FF674B8 REALRECHT
520,483,982 *35251A742B9C2313E67813D810FB5AE14754A7BB zhaohaomi
520,483,983 *352473DD7B344FAA55A35ADE186D16879E34222F REINFORMERE8
520,483,984 *352CA7840020237DFDAC8616308A75487D075358 REIVILOEMEVOL
520,483,985 *352CFA7B558909F7649D6ACECB4E9FDAA89DF1D4 ZIFFERTE9
520,483,986 *35250FCBCD0B827BD2BAB884AEFCC385C542A11F renehipolito
520,483,987 *352A98D99EC77AEB3F3A6427178EC3A6CFF633C9 RETURFERED
520,483,988 *3525C24301CFCFB2C492FAE4FF2D573DDD9F6A48 REYNALDO.KEMNER
520,483,989 *352A797FA994D03C616097F593F9C427AA89B13C [email protected]
520,483,990 *352E93D16239F12E1102F4F6409E2D98EAB2F64F R%I
520,483,991 *352A95F55D2F59CAFB519DCB39CC02E9FC2E904C „ZWALU“
520,483,992 *352B7B892D6FA09106FF7A6CC0D17F55603B790F RIGHT24.57.157.81
520,483,993 *3521AF9C759739ACEA1E0B37C1CEECB82D98C342 RIGOBERTO.SANDA
520,483,994 *352E436673008398BF2234BCF886432A90713AEB «ΓΡΎΠΑ»
520,483,995 *35291FB31B0529689BA069EFA808E5391157669C АНДРОПОГОН
520,483,996 *35210F3EABFDE1C220630929D05C6AE464D8E7D2 RODERICK.RUGGLES
520,483,997 *3528333C5CE8F180D433E9615996E86A346D3362 rodolfobankert
520,483,998 *3526646E10894AF583ED6943BC618CEAACFEEEE2 БОРЯТИНСКОМУ
520,483,999 *3520E25D978529C7009DA0043B2074B2154605CA ROMANTISERIONS7
520,484,000 *3520D0F914274CE661CCD2993B288BD0AC65D23B rongerard
520,484,001 *3523B791E217A37C089D1E2519348E0FFD9663CD rootiness4
520,484,002 *352609937AB8B166B4E1D4153CCD139719466A1C ROZMEZIM7
520,484,003 *352C6D46190459F59EA31AEA12729D842FC56BAF RUFUSLOUK
520,484,004 *352055B1EA44107DEACAEC4868F4AFF1E152B586 ИСМӘГЫЙЛЬ
520,484,005 *352CF08B9E429ED888DCE726863BCC283F9E5E98 керамия
520,484,006 *35222CE44F1E467BBB43666053B9652A87064824 ЛЕКГОЛО
520,484,007 *352EF47460052430431C4B5B9393EA49E9F78C0F особености
520,484,008 *352EE8B7A6AC36FB740E93155B07E9DC4A17748A [email protected],
520,484,009 *35230A4EBC89EB76560BE9C9D752B05761262445 SALGTNILVES
520,484,010 *3524C1D6C4914F7BE764B29CBC5CA3F5CCAC75D1 [email protected]
520,484,011 *352BF9A61292FFAD633E06E93AE1E0CFC1FF7242 salvadorollivierre
520,484,012 *3521CD2EE52E98C151E960663FEDF70B6D3E6F1B SAMADALI6
520,484,013 *35279A1F4EF07A9947481788DBF0AA4DD937FCCF ЧЕБАТУРКИН
520,484,014 *352CE675A7080D3FBD5D4C6EF3FB6DA019A08242 sandaruwanchathuranga
520,484,015 *352043809BC396F93B373A8940D23B3E5C4012E8 santoyake
520,484,016 *3528EC7D524017327B852F82182F970D80E93F39 SASHADOROTHY5
520,484,017 *3529A94D1B0BD59346685FC3B51A2626BB64907B sbg`
520,484,018 *3521E61AA8EE37953E0BA1CB400FCFB4D1AD77B8 scherpziende
520,484,019 *352C0ECB39FAB043F7896446E1696F498EAF9326 [email protected]
520,484,020 *3525AF014A7A2990912E7163DA536730C2D5D7C5 SDNABNIAR4
520,484,021 *35253EBDC68C1B438CC77BDE10EF42E16D5ED41C S+E+HOSCOP!C411Y
520,484,022 *352BB0B59EC9CDB41961E3FDE98BCD4DFCCAA953 SHANNONBARTHOLOMEU
520,484,023 *3522CA2AE396BAECEAA26832C82676D3EB2E8E56 sharpsetal
520,484,024 *3528603E439C9E7A920B990007F1FDD03B1DC577 町田市I
520,484,025 *35267852108F60694E94EA338909A16CD1722173 SICHIMENING
520,484,026 *352BBF5B8D622CF5983DDBC2FF36817E0314D594 SKRHUERS4
520,484,027 *35222DF08A5E598690689264E583F317329864B1 SLEEPINGPARTNERESES
520,484,028 *3520E80A45714A9F528044ACF63619823E354AD5 slngrln4
520,484,029 *3526AB80DDED8822184EC4065797BC711C25365F soiseli-soi
520,484,030 *352DF6C6A66C71531548782131CA88A68BA60662 [email protected]
520,484,031 *3522F43F0AFB7B1120BFFB9D56B19FF15E8BCDBE SPHIITAU8
520,484,032 *352AFF8D78AA8179EBBE9339E1237A89B6A446B7 [email protected]
520,484,033 *35284FB9939C0D3F41C0B0DA5FFF2C36BC2C8579 SQUELCHINGLYV4
520,484,034 *352AD09EE39F25B8D895094947076663704C0990 ssc3pt81y
520,484,035 *352757AC6107B340891832FA60F0F87C80018FD0 STAKESMANITOBA
520,484,036 *35216AB1AA9561E323F5CD6FDEB8AC870B719281 STANFORD.CORKUM
520,484,037 *352A3F2E34CAF091D8D066D572CFBFBB49709EDD stbblst5
520,484,038 *35248921C24C61620074A7DDF3C4AD4A9AE525A9 stedetstedet
520,484,039 *352A4BD785713B458ECD39BD1CB8163821D6CC84 stephanslotnick
520,484,040 *35287867CA9E021C1433AD5062E4B867C2BF9A3B 10,原預訂2006年3月發售,不明原因中止。這個模子之後改為OPTIMUS
520,484,041 *352FE86970EEFD8099A6F7FEA8D6002DE9A5B120 11cleanliving
520,484,042 *352B92AC7D9D0A1CA01623F7E84A4B0ACCBC883F STEWARTNEWER
520,484,043 *35238D19C44FB53BC4F5F1ACB51F9C2A8FF04981 123123connie
520,484,044 *352FFD567313AF1A9FBE882E6A514FFE58C837F4 SUCHITHARELLA
520,484,045 *352664B15C292D27330E53F18369F9FB29A3270C SULPOREZ
520,484,046 *352D1152B038F8016CFB3F8BD887A9F874EF423B SUNSHINARTHUR9
520,484,047 *352FBC3F758167BCC0606D1D7EE2B12D43CF509E SUOELIP2
520,484,048 *35248D55B91E9F604D95E73C905B5197DB02455B SUPPRESSION28
520,484,049 *3521753E2CB59232BAF7A01F981EC98884F00370 1.AMMONALSEOKSISSA
520,484,050 *352030B7E19EC51CF59E2544E41A152E2DD635BB 1 ASAYIR
520,484,051 *352BD094ADFEC652EDFD35A212EC8AF6139F1A6C 1 CAMINO-REAL-OAXACA
520,484,052 *35289E89D2AC5587FED671C785669F8B256F9B35 SXNISXNI
520,484,053 *352C6569F7D94BDF37C9860D2F00BCC4223BFD44 SYLVIEPHANTOM9
520,484,054 *3528669C84D0A2497B746E104211B1FFE45BEF90 1-FANTISOIDA
520,484,055 *352B7225D42C086ACE7A0099472AF702D74F1959 syousokued
520,484,056 *35281DA81A4B34D453B38AE998257804052CD3A0 1HUMPHREYKSI
520,484,057 *352A1607666E9A2798F48A06C45DD878543C6C5F taffy-tucker
520,484,058 *35200F831997399FF0F3EC5A14002CA2075F3B9D 1ILUVSPORTS9
520,484,059 *35244F9F0A1B95321AFB6BFE148922709BC7E2F1 TALKSUGGESTED
520,484,060 *352093BA3C29B8A172D0F27238641ACBC2C2F0DF 1.LUGINAA
520,484,061 *352CFB29CDEFE11CC36C294E0F82EBFF0EFAB2E9 [email protected]
520,484,062 *352139DB470326184B426BE6728848E151FAD008 tara.arens
520,484,063 *3526E49456F6283ABBE43136C18E82A7516285EC TCCAGCTATAGTGGTTGACTGAAGATGATGACCTCATTTTTAAAAATAATGACCAAATCT
520,484,064 *352717B268F4C4C00F9F29547FC682D8ADA76538 techser
520,484,065 *35249C72D2031A668EF8520F8AC0EB690623C5B9 TERENCEOSOSKIE
520,484,066 *352C55D0572E95911B07F49FF851848508DF9816 terryfairey
520,484,067 *35288389D6E7084319A0F7AD087BA08B1FCCCF1C TGNEHVA7
520,484,068 *352832B935DB9848F9288509BDB68F23D2689B0E 1 rapartist
520,484,069 *352C95629D8C763276B704C6966E82FDF1169453 1SCHEHLJUNCKS
520,484,070 *352B89590BC64325BA6F43E1D72724EB96187372 1.siemensstadtgrundstuecksverwaltung
520,484,071 *3523273B5E64F2672E8C4B08DCB4B60368195FFD 1SMOKERS-PEOPLE
520,484,072 *352D52C7FABF9184405ED04B1A6FF8E27F3684E5 1.SOKMALIDIR
520,484,073 *3529D97C21A9EC956B4C521CC7AE1CC347FD7C96 THE.CHALLENGE.FROM.BEYOND:.A.TRIBUTE.TO.H.P..LOVECRAFT
520,484,074 *352D93D0205C6FE98041A11A45DE3AC19C8CD8F2 THE.KEY.OF.LOVE
520,484,075 *352D6A47E9CBED214DE61FB1D1F0D1789097CE00 1.VET
520,484,076 *352ED176000DD544A39E6EA3FE92B4982F91B366 2096353 HUONEENJAKAIUTTIMIEN,SEK
520,484,077 *35243B4FA68460CC86857D0BD0B522254CB2CDCF THRDBRTIED
520,484,078 *35237F90B0CA6829D7B2FDAEB53C53A131FA4DAD THRouGH iT, THeN SToPS, LooKiNG DoWN
520,484,079 *352971E02096AC27A1B0F1AD59C79BC6F6F00760 TICOS.-.VALS.SENTIMENTAL
520,484,080 *3525790CDA2D9E65CA24010AF25217FB6103BC92 TK.M
520,484,081 *352DB27A0DCEBE3104408E2131FE20AA8063F4E0 28051971
520,484,082 *352C8B5E0FF1B00C0D77F4DD33FA0A8318B09050 2 begendigin
520,484,083 *352F5E511029AE96798AFDA496C21AA66693838F 2COLBERTISM
520,484,084 *352857D93D77FB1B75C9E08435E89A642D5B9772 2FLGLLRCS
520,484,085 *3527352973C706C8F707948724030C51139FE0D9 2-JARI-PEKKAKEURULAINEN
520,484,086 *3524A5975B7A28FBFA1795B45A0FA33D240E7470 2MUUNTELUSSA
520,484,087 *3528A8067EF5241F61A9CA92FC8D52FD94BFE940 2NSVLSSNT
520,484,088 *3523BAB9AC9FC1E4B4F249BA5482362D3FC02944 2robba123
520,484,089 *3527A8F194E23FFA67AD035EC359B75FDB5C1111 2YPERVOLH
520,484,090 *352238D1269C6308CF590DBBAEDAA11DCFC10BC0 TON’GA
520,484,091 *352BCB4040539D45A580721456A9AB7611F9C15F toni.ely
520,484,092 *352245CFC70529849F5D373F8E17D8AA422A1AC9 341667 ANETTEGOERGEUNDTORFRAULUXSTRAHLTENAMHELLSTEN.
520,484,093 *35216ED5FC1F2A6AE0C0D311EA22640DC477AC71 TOOUGLY2
520,484,094 *352041BAD3078132D81DFE4702A2619BEA90ECBB [email protected]
520,484,095 *352676466B9C000B8676E844E2C69537BDA8282E tr4n$l!ter4t!on
520,484,096 *35254221DB064756B4CA981CD5B9A08821B041E7 471160 TYYPILLINEN OIRE ON NS . HERMOPER
520,484,097 *3520A6146F28BAEB799C9D6BF0FFBE453153EC4E 4HETEROOUSIOUSES
520,484,098 *352FC13821E12AA0EC87A5E37293E832EE0ACFFB TRHACHO6
520,484,099 *352AA9E28E920A3C4749386733AEB142C544AB7A TRIFAJRIAH
520,484,100 *352264C02E5073BA04CDDBA66C1D2F9D3348DEBF TRINITULEP
520,484,101 *35256A65DE7D266DE8B37FC6744BBB0ADA9CBB06 4MISJUDGENT
520,484,102 *35205C262BB1434356F1C73D43691DF2C1A78D95 TROHSERP6
520,484,103 *352F44D96A03FDBA399330B7025FFFC694E453EB TROYBUSTINZA
520,484,104 *352AE6970F5DB105E6D095A9170BEE9A5AA35C6E 4ORDERLIES
520,484,105 *3522F6A6B8265173F0228F93F2DA770EC017CC01 TRUELOCK1
520,484,106 *352A898E0A7FE404DFEFF4057E2D8BE114811630 4.SENNUR
520,484,107 *3526ADA9985572DDCC6BE8D9F0BEA8945A2AABA3 tumilieta
520,484,108 *352ADC1D60D91F520560282BA83858A60AE61DBA 53.eintagsfliege
520,484,109 *352A442B327D08F7ED5B746CEA3A460D03568AE9 5AUJXLRXTNP
520,484,110 *35206982A9B4FBC3D6372AA119E987660348B3A0 5CHRONTELBSW
520,484,111 *3520BD78E68A616C242E9D518537A06E6C4F2159 TYLERLORD
520,484,112 *3523C97BC9BD3FC4227BA979B64B2EC804CF3C98 TYRON.QUALHEIM
520,484,113 *35213CC20DF11AE3C2E4A0B36FB3CA05145D786B u30aaa
520,484,114 *35227B91324E953B97C1E185C296470757A81D03 5RYOUNGBSW
520,484,115 *352D6A1CAB34EA6AA034377BA2C3480AEDAB602C U~LN
520,484,116 *352E6D3E50EDC82B27F24D67B85FF4C6F178DF95 Unaccusingly
520,484,117 *35280547498484127CDCA00C83006239FA6814F5 5wlu4np8o2
520,484,118 *352F7E2B2459E91652604BFCC2D04901290874E3 UNHONORABLIES
520,484,119 *3524457A11CBFF2D2B2556241819C16354FF2A34 Untitled-Hidden-Track-(An-Old-Trowie-Ballad)
520,484,120 *352ADFE4D045360712569A7C5C3FD106EFFF0A41 untruest
520,484,121 *3525D44EF2B7BEDBB01574FAA5ECA59F1870B9A3 6DUCALEDUCALE
520,484,122 *3527E7B3FF97A77964E55D83DE486C268D7BA5B1 Uscirono
520,484,123 *352DA8FABF571DD5919C9302400F1AE754582335 6FANAIENT
520,484,124 *352F2FD8643A415D0F0CE956716997271C5D2520 6KETTLEMAKING
520,484,125 *352F6E05ED823D375821B59B5CFD1C5D45BCEB63 6myoverkill9
520,484,126 *352D49A4940BF5334F616CBFC259837DBB6AEB5D VALA JA LUPAUS
520,484,127 *352A0F70487781FD933AF3865A07BB30952FB68C 6VALVAROSE
520,484,128 *352033ECB11A58B93D7DA8B5D9DA70A0AE88107A VARUN-KUMAR-S
520,484,129 *35270260F09EEB323BA8C2D6DDBFFD53163A7B9B VAUGHAN CHAMBERLAIN
520,484,130 *352DCA93ECD36B845DE3B721EC3B5DBED434A206 718dean
520,484,131 *35238CE35F10F361F94370567446BF2E643EC9E0 766schleudern
520,484,132 *35212A698666ECF2AE6F20CD783E5AC05C20C5AC VERONICA.LANUZA
520,484,133 *352E0BC5059740D17798609CE83346C8DCB68529 vicentavallejo
520,484,134 *352BC8AD78A58736F74EE7AEA7B1AD47B00B0EC3 vicki-dasilva
520,484,135 *352A61D792120198EC7432A3010D37C8C1B0B579 vickymcallister
520,484,136 *3525FA46B814E6F72D664D9CFAACC5F71B6A223F 7BLOEDLOSE
520,484,137 *352E076B22162460769A015ADB4A57C8CF620C19 7CHECHUN
520,484,138 *35205053A35C656FB9535A225D606086677966E2 VIGNESHSURESHWARAN
520,484,139 *3522DC5F5E88580B931EE827FF5C1CBDE73A9247 VIOLETA HISOLER
520,484,140 *352408808C06ACDB7ABE75D957CA913D3EF9ABD5 7LAURENSUNDAY
520,484,141 *3525FA3F6D221596183EC23321286783C8D18ABD 7LYONIIN
520,484,142 *3526B61131192777B37870C137689316CB19B015 VITOKENNING
520,484,143 *352594EA8E766EAF71E79BC4ED4561EBEFD82F04 7REESCRIBAS
520,484,144 *35261BD985FC0EBA53627F2C18239933BB5ADFB3 7RUXPUCKETT
520,484,145 *352A645F27A127C4BFE7E09707C8C58EA887425C 7TVANGSSITUATIONENS
520,484,146 *352A9041A11A668652321F44DDA204E063B0B7B6 VOTJS
520,484,147 *35291674B254D005333C893347A9F2406336E8A7 81-ZI
520,484,148 *352263AB7A9EE8B61A3DE2FD81A6AA1363B12491 vyjayanthimala-lakshman
520,484,149 *3526005D0100857ED846FB3EC775CB637C354F5F WAEGHE DAISY
520,484,150 *35205FEF95353D14602D49C1A33B5CD16A493AB2 waldoryman
520,484,151 *3524E17D5664B4A386D194C06CF43A85F108F8B0 walkermorison
520,484,152 *3520BB3915F977F0E2491CCCC77D5110233DE81F 85662561d697ae675e1f32743af22a69.maidens
520,484,153 *3523FE669D646B8EC2B9675305FC23CEFF632672 8BYGRNSERNE
520,484,154 *3521435398D91460DFB2B29DBB8B8A1478AB5718 [email protected]
520,484,155 *35218DBCD828B223EC82D4240D69F1FA4E8AD181 8FARMARTINO
520,484,156 *3525575FCB40721C14425453AD1ED6DC705AF25D 8FREDDYCLAIRE
520,484,157 *35229721C9CE824363D33FD47B548F19D68921AB WATTHANA CHANTHAPANYA
520,484,158 *352C289865202FCC6C96DB99400B3F717BE520ED watzlawick
520,484,159 *352253E40263470C61E7690D0D3853B74C66FD92 WAYLONTYCE
520,484,160 *3522A3DAF148A75538A574D689FCC53A34736B0E wcactus3
520,484,161 *3528B079DF460CD84635D84974FD04BEE664B4F8 8LETTERLUCY
520,484,162 *352D5B5AFD3F0E5760A8607AC9C08ED246FF78F1 8OMNITUDO
520,484,163 *35233B8734365337243564F5FBE078DE3C947AC6 8PRSAGERAI
520,484,164 *352E1B60482E8DE47B987A0E70054B970951BADB [email protected]
520,484,165 *3520C02D52328055F2893B7970C211EF4342D09B [email protected]
520,484,166 *3524501E3297209C38AC18700A32210388FEAB32 wernerneeb
520,484,167 *3520EFD0733DD90A43199913F63FA23EA6084FE4 whats-happening-at-uwp
520,484,168 *352A8BB121A894415D4C167B5AE29E9DC413AFB4 when-reality-fades
520,484,169 *3529699F83A1C1E51C3C6D9843048945C6E1EB62 WILEY.BEZAK
520,484,170 *352251CBEF03DA781AB89F0734DAB6392F3F9655 WILLIAMDYOTT
520,484,171 *352D04B8ECAFA1A7C238A3ECBBAED02E599392A2 willmerses
520,484,172 *3527CADCCA08602E853D91AC318A6F37BF4355A0 9NOVEMBER1684
520,484,173 *3523A478ADB95F6D4BADE2AA81F9871C76117A14 9PORTABLARE
520,484,174 *3529750E4205B294170034590E9B9CA17D993368 [email protected]
520,484,175 *352A6359BD98050A6A96687A2FFC658904D64C82 9SAVAGEANGUS
520,484,176 *352B1B6307419EFCA3AC2B31ADB505FABF25D51B 9seriousness
520,484,177 *3523F2A6FEF715C47E94F8B26A518CF37C850823 9SISCHIAC
520,484,178 *3523356932DB0110FEF27ABC8733A6E2CE091C56 )x(0~(----8
520,484,179 *352AC1C9AB86EE32CE97C7907CFA05AEB1AA9958 a8fzl
520,484,180 *3529D07D799F4CAF963BA0CB51FDD3A21FF0CCC4 a9na+
520,484,181 *352936A4DE3FB686C061785E2FD7A4E3EAFC69BB X]YJ
520,484,182 *3522139F405E2B86EEE860AB049D3FBEDAC59D17 YALELLEB0
520,484,183 *3524D1C738D247F596C89C2E2A6F617D7B601812 YANOGO.FABRICE
520,484,184 *3524AB5C09E79622E02DBFB666942171B424FC4E aatw)
520,484,185 *352E2CD5D103934253847ACF5105A4E44BF9D0DC abrahamcart
520,484,186 *35200043A565AC0A774D49B2D41769394697203A yolanda-elizondo-gonzales
520,484,187 *3526011854E89C657EBA264242CA901185DFD177 YOUCD
520,484,188 *3526ECB8A7751A89915650B70C9A06EB322F28F0 your.brain.always.comes.up.with.answers.(9)
520,484,189 *352B52360BC4E595A8FF8B3B91113C1C8755285E YYM%
520,484,190 *35247BE11D86BC495F6D4F1D04F1458617020163 ADAMLINDAED
520,484,191 *35208547479567C03A7474250D7A7ECD9A4B2289 ZARDER8
520,484,192 *3523671F72AD861778DE6E42BE55ECDD518E29C3 ziguiella
520,484,193 *352A935D7808DB251C4B00DA9E4B7AE748004B50 ZMIŇOVANOU
520,484,194 *35268EDD4BC4C220A960214DA3D6F9E80268DA79 AGRTA
520,484,195 *3524A01BB1D172122A383FF5AE1489C9C7A8640B ahusn
520,484,196 *352B30F39E12A70D42EA163659302D7B61E8311A aixemús
520,484,197 *352AD23417AC39C2B35E6E8EAB6EDD19F12066DE a?kpo
520,484,198 *352430D0B978B6CD197BF027532C375734BD5B6A КАБАЧНИКИ
520,484,199 *352B2F3FBD31938BFD45D4D02CDF8F42C48F4DE3 МОРМОНСТВОМ
520,484,200 *3524642A4829CEB743CF891BCBC44E5EE714783C ПИРОВАЛИ
520,484,201 *35224B60DDE494C25D9542A0DA57B79F5EF6EA95 alleging
520,484,202 *35211F093D3A0FEA46C6F6553611E627269A8B60 alvarobrasswell
520,484,203 *352F776017D617626F2AA6E37B972F3BBE438044 ФОРМАЦИЯТА
520,484,204 *352774BD5BCDE388A046310C5E201C7FF3E401F8 «ЦИ
520,484,205 *3521B1404160741672BC9594D3A1F915C5F81BCD andrea-marie-berube
520,484,206 *3528C515A10443584365CAEBE369EB1E6AFBE6F3 ANGELINA926
520,484,207 *3529FF95ACCB6E3E28E38627850BF57B02E9F292 anx-(
520,484,208 *352C6847D027512DE4AD85E5B51B0D2DB5FC5EF2 arhq
520,484,209 *352DB6922A5B1EC9353DB61A26DB86982CCF160F arrim
520,484,210 *352A64C2799E690771E72B0EA0A305B7D0DE9E90 ASHLEYDRALEAU
520,484,211 *3528FA752D21889C4102FBB254824429D7BD9256 asin.hasna.bhul.gaye
520,484,212 *3529C35B18DEB73F2F398AAF54AAD0D468730D87 ASWAN,OP25NO2(PIANO:EDWINMCARTHUR)
520,484,213 *352AD1D11B1E0011864EBA307CB379D2812B2BE1 atpw&
520,484,214 *352CC41EBE568C22B091CAF695CFB7FF2B818EE5 aunprovokable
520,484,215 *352A353AE9D73590F2DF73B8E99D9C366DE66783 AUTHORTHOMAS
520,484,216 *35267BEBB4E7EFFB757F33AFD505DEF7C60F5280 B44UF
520,484,217 *35282EC02DA5CECC59E17F61C7CF48D5F8ACC594 baovv
520,484,218 *35208885DDD517FF8B631208357122948AF97DD8 B=:b
520,484,219 *3521CDE282408EF96998D2ED52E6039BEF8E69B6 BENITO.FURCI
520,484,220 *352170D412A11EA0D3BB66C25008704BD278A2BA BENNETT.YOW
520,484,221 *3523686FD36ABE714BEB36B15E6B1EA7F3B1AB20 bepf
520,484,222 *352BF7C668E423DC3BA34009AE3C58CD3C6E90AD BERTRAYES
520,484,223 *35282ACBBC05AC50237351198BF3D14DE81F2938 BESACTEA
520,484,224 *352DEF435D3061CB60B1F73C0D447D68C7D586A2 beyngewand
520,484,225 *352FBF41681A20260BFC78D5CBB23E152A61BA87 bizygomatic1
520,484,226 *352953F73C1FA155041CECB2F385E0374C0D16EF bk$sn
520,484,227 *35253951E6808448761CD102A353F29639511C88 12261834
520,484,228 *352E4B10FF413CAF4731569A92C7CC57F5249B5B 12-ZAOUI
520,484,229 *35236355DC654F074B8F4FFF10B44F4F5EB57CC5 1332854 ILTA-.,.Y
520,484,230 *35202C361F09BBEC051649B8416974D4AFE57C23 blaff reader.
520,484,231 *352D173EDA41DAC8A63DC76DA42302822DCF06DE 13 MANALARI
520,484,232 *352FF4E2C2B72D8A1CDFE982A068EC6DE2EAC121 1469275 er-traeumt-von-frueher-,-als-die-zeiten-anders-waren-
520,484,233 *35261287664AF4C0ECC727D814B478DB4A51286D 1555682 onkokoneellakuviajapelej
520,484,234 *352F17BBAC1EF534BA6128EA6310574A8CF17BA4 15 ALIBI
520,484,235 *352A24ECD246162E5541F0EF699EEBC6C8648C8D 16081107
520,484,236 *352670A1DDA24F1E7034B622011AC67D8A0DDFA4 BOHEMLO
520,484,237 *352FC5275357F3DF5C29FD07BF993F270E70FDD6 BOOKER.BONKER
520,484,238 *352688876827451EEEDD390E4E764EB8A2C07A5A 17-diyip
520,484,239 *3528F7E32044BA85BC591BB58915D6EC06F4EDA0 18-12-1622
520,484,240 *3525922BE2C71CC75476FBE74B62D5F372CA229F BOURDIAL8
520,484,241 *35234E8A4C375D599DF63B2F7A1B2050D6AE3A2C BPjS
520,484,242 *3527FE6EA2B31BB8E6C57F13B8DB9D2F298B4C98 BP-Sneak-Up/BP-BadGuysvsGoodGuys
520,484,243 *352FCEA8BEEEE24BA653604833DE851753970900 19OCT1746
520,484,244 *3526FE0967A726CBB694B27B7FCC3AB18F4562DF 1-ATHLETENKREISEN
520,484,245 *35252D12CA5436615BE37DC1BB74CD058B1F6C62 bradyn980
520,484,246 *352E26050B1024E6056CDA2C11E6BACB4EC6BDFF 1.BRPAUKUN
520,484,247 *352519330E662AEBB6B60C37E5CBECD927BFBAD2 1.CHICKENHAWK
520,484,248 *35235946287DC1D87646CE28AD6F834E613E9AD7 1expressbriefes
520,484,249 *3522B26BDBADFB00BAE7D9566AC8F3E4846AFE72 BRENT.BODENSCHATZ
520,484,250 *352DA0093B412E64CDF17582531EC017E6BFF942 BRFJ"
520,484,251 *352AB03A3E0F289CD3B8AD5041D1210849C58878 [email protected]
520,484,252 *352660A36651B2BD18E7CDFF5D17925ACC352519 brózdów
520,484,253 *35261E471D8E171FA9F234B40C3BDDF7759519F7 BRUCE-TOWERS
520,484,254 *3521B8A2FBA307F3FC977BC23E20E461D5146BF9 brxv=
520,484,255 *352994BB328D54AEB85263340EB59BCD54AC106B 1LEHRSTUHLINHABERIN
520,484,256 *352648FD5175731CBDD1BCEF743EAFA8E4B51A7F 1.MAXIMIAVGIFTEN
520,484,257 *3528AE883386E0BBCE1D1F6C811A90FA94F892F7 1meteryalleri
520,484,258 *3523960603D7BD1E7375C717C78442D87D54ABD8 1.mp-pys
520,484,259 *352D8DE1C49504246358A5B22F99361FB009F70A 1 ROSVOTTIIN
520,484,260 *352BD3F6C23B39A7482AA301AFB6EBB23D19EB9A B_UPF
520,484,261 *352FB246DC1F3E92173F9066B8730C44A020D84C busterhewgley
520,484,262 *352D366BCA550995A638BD0A64A69408E40D5410 1THATKAYLA6
520,484,263 *3528BD6130B6C684F4E2604C062AED8CFE866724 1 TUKIJOITANSA
520,484,264 *352EB7D4697738421A71A0B03D5E0B6FB8DF8CE6 BW6EA
520,484,265 *35279BAD7EE6E43F3FEE29728375B8E07F9D632F 1.VET
520,484,266 *3522261E80D83677F3AB8334B8CD9788CE76FD37 1WEBMATONA
520,484,267 *352A3A8C469E1D951A79EB1BCA4DE640C92DFFF2 1-werkstattrat
520,484,268 *352BEF04EA9F1A1BD8FC97F8F198119C9DF11E34 1.ZERSCHNITZELT
520,484,269 *3526B550BAD853266B79973770AF4C193EC118E6 by/cb
520,484,270 *3526F380E0FF36C4D75CA560491696250405B2F4 c2:1d
520,484,271 *3526B521FB030D90C231016DEEB70F4EE7688D91 2844315 uusi.ihana.suomalainen.reformi.luomu.gl
520,484,272 *3522CEC432D6DAE69BFCD7462B2774216CB540DF 2873405 rakenteita k
520,484,273 *352C25A9FC4685FDAD985289941D6A0101C3FC3F 295AADEN
520,484,274 *3528154AF7A80DBD4F99E048E1BE7BDD05DFDDC4 2-ankkurointipaikkaa
520,484,275 *35278704F27601F2A1AA85C7FB1C6CDBD050ADBA c;4qm
520,484,276 *352D2994077FE4C73582D4B9650B77B545229CC8 C7$FK
520,484,277 *35292A5AAC26B20194855981C347EE8A797A5CCC 2lessini
520,484,278 *35289E778ED26CA8056D130FE9C33DE1DE2DB952 CAE0D425024C3BA6AEC0B15D2DCCDE14
520,484,279 *352F28F2A30C1473D14B839173BE9FFA16A8CBD9 CAFFE1
520,484,280 *3523C866587ADC54DF52CA69726F831A7B84560C CALEBWOLFERT
520,484,281 *352A1B54893C12DF88776359C10E2374D2C4F4CA CALSHOT8
520,484,282 *352C951CE544C8AE5FC091F57581CFD77E900B90 can'tseetheforestforthetrees
520,484,283 *3521B6E33CBDDDE71FB5E7E20121DCA91C9D0E23 carolinev2
520,484,284 *352515B31C4CB2036BBEBBD614D0036D79D40B8B CAROLSINGLE
520,484,285 *3528D375AD07BE3AC4C6C478B55773F45A06B8DD 2POKEMON5
520,484,286 *352F2B169B50AA51262CEBFDFDDC25C475EC4F17 [email protected]
520,484,287 *35258ED8DD31E307312DA71F22D833BD44D8ACA3 2VAALINE
520,484,288 *352C1DE75B7D9402A7FE0A8287D05B3432C84DB6 [email protected]
520,484,289 *35215B23EDE45C71EEB4DA37216F704AA8666E98 C/COS
520,484,290 *352D23F5158F18DB8CF48969B857FD70497A1DD8 CEDRICK.BROSSOIT
520,484,291 *352BF705392070E108CA6A8E5122246E594941EF C$EE
520,484,292 *352B5C62EC65480B33DE8FA6AD9B068021898272 35D79213.10213260
520,484,293 *3520878836CBC3A4CF86CCBA5FA7B72981BF741A 35.DISINTEGRATES
520,484,294 *35270F24660C77DCE132BE90D7EE56B77F7D28E6 cf!+)
520,484,295 *352387551449EA16FC5C108DC1D14A086047EEB1 cgjhn
520,484,296 *3521282D615F090336B40C722C42116212D234CC 3-EVANSVILLE
520,484,297 *3523F79837036AF0E5252D13688EB5C661D14C7C 3-HUNSRUECKGEMEINDE
520,484,298 *3528AD85969AC68C77D7A3F32A020FB63E0C9A3A 3ISSAPERC
520,484,299 *35268A5D90B807B791ABAB5A97C58C5E4A1FF94B 3######P~-~-}8{
520,484,300 *35233F07A61A411F4DED4ABB77F599020BED0636 3YTIRREG
520,484,301 *3521B63CAF73D4F0E42D8BBC1C3781EDD36F3A7C 436surdu
520,484,302 *352278CF50B448B9D2157F50D5062112513B9F31 4660 OZYASAMGIBIBIRKURULUSTA,OZSOZUSIFATGOREVINDEDIR.
520,484,303 *3521DEDDC666482C7C3EA3CD3E6FD69AAAE275B8 chase.mahoney
520,484,304 *3520CA241CD07C9DB57E5C97D2F6A7407EDFA384 CHAUNCEYMOORELAND
520,484,305 *3525240A9C7F9D55FFF19B7F5AF18C6E34D9AC41 4EXCALBR
520,484,306 *352347B333E8F5152A8C883AF722EA28121A7F29 chigrogg
520,484,307 *3521675B721C61A0D534913E23C66A0CD1888B8F CHIMALONZO
520,484,308 *352D0D239269E26EA2146CE95C7BDBE7082185B9 chongpapiernik
520,484,309 *352922662B5ED50E487B5B219569899D4C8D7C59 4MOOKIEYAMAHA
520,484,310 *35283FE1F869F57FEE3224F89D93AAEA682081D3 chris-bergson
520,484,311 *3528211E5D803354402485E324928398F2641570 CHRIS.CANELLA
520,484,312 *352049CCC6E501E8FC13138BBD14475C4CB21ABD CHUCKGEIBEL
520,484,313 *352841BBD8F42DC573A73867CB6423A3AFEF3EBA 4RIZZZLE
520,484,314 *35271AC3977DB8EDD436338C259AE5B84A550349 churbanov4
520,484,315 *3523143F619A0274FA0D1713B61277A11B53A34B 4supurgeler
520,484,316 *352E9195B0EF926D9C04A938323CF0EBE53A3A25 4TEMAENE
520,484,317 *352B1220E3EA75E8197DD29A8493777E50DCA54D 4TINLIKES
520,484,318 *3521EFE987B70A0AAD0410BF7EF316177272055A CIL-S
520,484,319 *352A22CA5CD4C0E27D99C9CCC9C87B5E378E13AC 4TURSELL
520,484,320 *352E332D55692E8F4E855289F8F1836697FFD30C 5031711er
520,484,321 *352184782DE772CD892FAEE7AFB170656389F147 ckys
520,484,322 *352FA4B2853FB179D9B147A9091D6EF54555BA51 class="srtitle">p
520,484,323 *3526AF4BBEFD94CDE014FDDA64B9A647514C4000 claudiotann
520,484,324 *35217A05F5CA70EB9B37A39911EC3EE0DA3B1697 CLEMENTMALICDEM
520,484,325 *352346ED35EC505BDEFDEC2943E7FF59B7161EA7 CLFL9
520,484,326 *352E682498095C8C96AF1A6028808FFD195F3A57 cm$!_
520,484,327 *352BDC27C257952923F301C26D2C7A23F5818B2B cobridor4
520,484,328 *352952D29EB35EBE49736580CED29F040DE5574E codifiait3
520,484,329 *352006FD18158D1B9C6099483A6DA2117F7CCC2A 5FEMRENS
520,484,330 *35232E9E8E72F24A10679745AACCE53E69E777C4 5FUTILENESSS
520,484,331 *352F72A8F9680962C60C242A225710F07CF4141A 5FWTOGRAFHSH
520,484,332 *352AA04F87A5EF985B89625CD858EE62488A06D6 coltonoram
520,484,333 *35210E290229F8BCFFBDC47455AF7598F2312709 concertono.1incmaj.rv181aii.largo
520,484,334 *35202D03039238CA1EF1ED4AF17D79A45C8077CA 5SABUCALS
520,484,335 *352EC30CAFF40C93E8950969094C6264C810807E CONSIDEREREMO
520,484,336 *352BD8747F354C2DB1504C44CBAD3F4A85195370 CORNELIUSVACCHIANO
520,484,337 *352B1875E42DC0B85FFE4707A08AA165F072940D COTE;
520,484,338 *35241E33741C78A5C633404CF4D8A78D4E4A5EC8 5UFATTELIGHEDERS
520,484,339 *352206856D0F52959C489F78111FCEE364D5D39E 5VEDERSTYGGELIGHET
520,484,340 *352335EF6B62AB844E3A651C26BB06D772EEEE7C court-determined
520,484,341 *3520491E0958500A01ECA70C2EC8E63E4DC8A2D0 coysha
520,484,342 *352B43D7E72B5C0C13EE6568946FB8D4B99A3159 653HALEY
520,484,343 *352A252C265C481015E42C8C540FFC89203CDEC2 c:\programfiles\microsoftvisualstudio90\common7\ide\projecttemplates\csharp\database\1033
520,484,344 *352D018332ECD3AC11530C59AE9AC5841509D8B5 6continentaler
520,484,345 *3525887F6052C848F1034825AE3909065BE8B094 6GUARDSHI
520,484,346 *3526531E2E7124CCEEAEF3C806CCD3200D68F610 6KVITTERTE
520,484,347 *352FF231DB0ED95EB72EEED7F879E15E0452F393 CQ/V
520,484,348 *352B24C4B541B2B1F92BA8EFEAA47D885D4DCB1D CREDITUNIONS
520,484,349 *3528511E8B3F9D09C5E10FE4B9FD6985740306C6 6TAPPIONSAKIN
520,484,350 *3528727B31F9D1E079CCDD1C82C8BC4DCE8D48AA crtd9
520,484,351 *352D60EE2E8995B762026671314108306A6A7894 cry$7allzn9
520,484,352 *352C62FA8A9549C51D62F64BFC80E09FFDAB162B 762026 (.38.).".JAKE.AND.THE.FATMAN.,.".CBS.,.12.6..
520,484,353 *352F06729909C00E19AE14D749C4F08BFE7D47C3 764jasmin
520,484,354 *35270FB87EABA0EDBF8E828A3A646BBEE44781AE 7BALJUWSC
520,484,355 *352F8C378EFC2D1D3591508B68F44AE2D7F70A8A 7DIRKDATABASE
520,484,356 *352A6E500F80B822596021875ABAD0D4CB122ECC 7dozer
520,484,357 *352FB3812BF1BFC252A20D89738AB041E722BA96 CVF&F
520,484,358 *35231F02B2603F80C589116CF0215EC1FE061597 CYRUS.MURRIETA
520,484,359 *3523A790449F26645D679262DBA5E5C6F4BC8A1B CYW.
520,484,360 *3528888542C205FD24D62488946631E48F25AB87 d3lz!
520,484,361 *35241AEDF91EB3A24A380065FB2091B2EC27BF17 d8(i=
520,484,362 *352DCF9E1457A7DA1A9CE92F1B6C7FA5FE6B3CB9 DAGUDOJ
520,484,363 *352383CCFDDFB6E6B7746A2A1B9FE9824B98E251 827EDGAR
520,484,364 *352BC16D90A1BDAE51F02B6C5C2B049926124BE7 8: 8 -# -& MISRULE
520,484,365 *35241EFAA27ABFAC088B84ED9D3DD33B9E080C01 darwin.brooks
520,484,366 *3528F8790C1CF36C383B42AF07E2DFF038ACDB42 8BALLASTREIZENS
520,484,367 *352A6FB7FC97F86D152C4F1FF8D21E289AB42096 8BANKINGMONEY
520,484,368 *352C5D4219128D358A0F7F563EE5A0B53E4CAC34 8BISITTITH
520,484,369 *352963EE7F6985506D73CE1FC6AE2B63D1AF8A6D dasha.barton
520,484,370 *352E0A8DE725AB8058F1EA54AC8C4A7A2554839D DASWAHLKAMPFFAIRNE
520,484,371 *352848917A7FD421F42C93324B917E730668720E 8BSWMCRISTINABSW
520,484,372 *352B1FC713D8C013F84B35718FF70ABD4EFF96EB 8COSMOSKRISTI
520,484,373 *352FC620FF7369E5AA2EAF1819704F1CF9C111F5 8DISKETTN
520,484,374 *3526692BDBFF8638EE66BA9E12F3EF1704940382 8D.~o.}o{
520,484,375 *352B91EB8B55700A862C962726129260D20696B4 8GRILLAGEAS
520,484,376 *3528F0F3B32EEE0D46F9CF9286AA44DD3896D891 Dce=
520,484,377 *352C208F1C76B45D8AC9A0974A5EAD93953C9567 8KLEPRATWERK
520,484,378 *352330E73942960F2EB60646F8176D9D61B891B1 8LINDSAYSYDNEY
520,484,379 *3529117E2EC2F77CD1956F2CF534B1056A6CB351 dd3.%
520,484,380 *352F7331DCF253FA7B746652A4653AE10D1B21EF [email protected]
520,484,381 *35247B7C7C70058439701B2067C26955D620796F 8PERIFONEARA
520,484,382 *3525DE7615B6DD92B307BDAEA883FE8B356A0E2D DEEPRULESEP
520,484,383 *352E501F5CF2F9C82CA46150B3AA6D49F6A80898 8repressieve
520,484,384 *352D32C050D6AF570A67EDA5972FFF37831CBACF [email protected]
520,484,385 *352CCE388403C67D13F9CB51F967AECDF04EF9D3 delayed-type
520,484,386 *3529758E2E2CAEB20109FD8897A6BB13C60D9CEF 8YLGNILFFUCS
520,484,387 *352489BD19078F018CAEE6364D24929D4080FF69 demj;
520,484,388 *352030E99267CBACAE3B478044C8050E254932DC [email protected]
520,484,389 *352D04243F48BFE4DE6F81A5BB8CA69EFFC1D078 deng-yuan
520,484,390 *352BF82A11F3470382E44F586436DFAD590C3225 929186 AUMAAN-EI-SAA-KORKEUTTA-KUTEN-KAIVUKONEELLA-TEHTYYN-.
520,484,391 *3520CFD4311DA0B5926D618F980510B44BCA45AA 955198 gazi-1985-yUksek-lisans-psikolojik-dan--ve-reh-
520,484,392 *352F85E7128BABDFCAECE7F4E1809BA92C125540 9BANANAJUNIOR
520,484,393 *352C9B1A13BD6DE03450A8C10631F57289D7A0FF 9BSWKNOBBYSBSW
520,484,394 *352A57DC5F6E4C1D415CE6E1200938AA9BD18594 9CARRIEMARS
520,484,395 *352BD1690168DC924B1AB55596831113BE2A8AED devaluions3
520,484,396 *352F127AB119F495B4ED213DCD047FFBF7067153 9KUTHAABHII
520,484,397 *352AE4823D9C9ABAB8079CBAE460A67C2C17CC2B 9lonely4
520,484,398 *3520FB16E43D7CBA9EEDA48154F0ED3D0101DD80 DFK(
520,484,399 *3526D9314D924863A348462000469F3DEDF17DE4 d//gt
520,484,400 *35221B1F1D5237B2FBDF9C189B8998AC4D5ED694 DHOD3NG
520,484,401 *352BE94A994CDCB7B225FECBB86C9B7A4807645D 9ZGIBFFYI
520,484,402 *35266ADCCAD73680E26F8B1C2AA0D4AE01EADC33 DIANA758
520,484,403 *352E12A06BB77FCEC4B577FA62F4D6CA49B605F9 DIDENHEIMS
520,484,404 *35276159513CB91159C47F9851D58908223CE21B A1WK+
520,484,405 *3526399ED8BEA8643A2980BC1B8B38DDAB43E7A5 DIMRIDERS
520,484,406 *352B0CD6F11B9E93C1004198FF4DFCC54C65BDFF dingo312
520,484,407 *352BF8A61AE8B156DDCB5B9BCD035C8F7794C258 DINO.RIPPETOE
520,484,408 *352E44E90204AAE5ADB5D06CCE985412FECDBE5A A5-WX
520,484,409 *3525E14146047F85C0D74B57C18A29AD2E8D9D2D distrito-de-neckar-odenwald
520,484,410 *3528791E96E3CABB6F8D016014A94CF13C227405 [email protected]
520,484,411 *3524CF1AB475FB06415BD25A340A768DBB8087AC aaxb5
520,484,412 *3528EF607C41004E0EF61B51441B7BAE641D75DA abkhasyano
520,484,413 *352E306AC1FBDA412EC596010F035F6DB9047EAD DOMINIQUESTORZ
520,484,414 *3529F421ACEDB30A846AC8F957CC3C9CF497795A donniegreenhoward
520,484,415 *3528D1BB7D2FBAB7E72E62391EB7AAA76C20A46D DONNIESTELMACH
520,484,416 *352BE77BBC1D7F0BA7182D9B789DCD9952AADA20 acceptor-impurity
520,484,417 *352DE90FBDEBC5385EB1E9045106735FBC6D0070 ac/%i
520,484,418 *352B87E25A220D9867AE6510441FEBB0B8185FFF [email protected]
520,484,419 *3526319C47DBEDCBA606F9F90EDF346535394A92 dpdpz
520,484,420 *352FB2CB6EF35E20215DA44F524F0C45014257B5 AFFR0NTA1
520,484,421 *352112F16DCA855D7B9344D32E008633B57422B7 DRQK
520,484,422 *352BE784B4E7EC24C03C934AA0747CE6F0EFFE9C AGNEWARISTIDES
520,484,423 *35295CB76C24390EAA25B7A934C5A1DDEDEE7701 AG&T
520,484,424 *352C0CABF6C87B2D8C2263A416AC45C67E3A48B7 dtlnc
520,484,425 *3523BB5BD6B58952B87611E2500A16A01A54BE27 ahq,w
520,484,426 *352EBDC3B1D9352394A9785C7296444B13251D8D DUSTY.HEGGS
520,484,427 *3523C4B4422885C22D86BB9C4A065D3FFB8B077C AISYAH.ATIKAH
520,484,428 *3520B375304BFCD0132255431C781E0432AC7ADC aiv:d
520,484,429 *352DA08E85434058F74BB3F703325A8C3613831F DVF24
520,484,430 *3529E5CDB3A43C38B7BB9D62822D271CC437E903 dw$fp
520,484,431 *352C747F5AFDE58F67714AB0EDEAF2A471740B7E dxvq)
520,484,432 *352EDC458E39550D0BB2C718B356A68257D36B3E [email protected]
520,484,433 *352C444BD7276C0A4FDCD160FC2BBE8664DFBCB6 ALEXANDER.TATIS
520,484,434 *3526B225520C6D4981C274C03A0A29E7FDB46804 alex.tatis
520,484,435 *35251FA709DB48BCE7ECD93DDF0CB6077A23241E ead39b0fae9b181481c5530982130409.5gljghtr
520,484,436 *352DB85FFCAD00EEB2A953441BD1C20C289CD821 alleging
520,484,437 *3528DE14B134AD5FCC004978F0C42B96732CA682 [email protected]
520,484,438 *3523582914C60E3B4A270BBBD8ACCA7ED31DE44D ECps
520,484,439 *352C6774DE2C6035E48DA63211736872B9A64441 alxpj
520,484,440 *3525418A3F5A347519B4306110540870E4CD4BAB [email protected]
520,484,441 *352EB5C09CAE12E3EB38AF997A29F1978DBB6243 AMARICOTTI
520,484,442 *3523DAD2A233DBC2DE15520B736ECCE80C7C356A edmondhollon
520,484,443 *35219D7D5865ED89EEBCD470191B5F7F169D1012 AMBULANZZÜGE
520,484,444 *352F7369C9F477C1D0BB8F7B0BC08A425E380F9E am#-v
520,484,445 *352D720A42E8E6F84328C514E829CFEA926D51EC andersonclowers
520,484,446 *3523768B0DEF536946006F1A811A933BEA91C37F Andfollowssotheeverrunningyear,
520,484,447 *35265810B76A730EA1432235898B6274135592FF EGGENBERGERV
520,484,448 *352BBBD35716BC7A1CDC6A68D32D9C04797F4380 andwattas
520,484,449 *352FC6449F55BAC0F467AC603177E2CAB592179E EKIME
520,484,450 *35210F9E796407A75F851B7350DA93103BA8D270 el1ta
520,484,451 *352D37E14169143DB8CCE4168FEE9D92728A5D50 elbahctu
520,484,452 *352D487C5F9B180CF5EB6848D9FE60F62AE9E482 ELDEN.TEMBLADOR
520,484,453 *3520670B2CBD7651BF22CCAC7FD440FC151FFA0F ANTHONYVIKINGS
520,484,454 *3520D6AC6718EB4C80E39A74172CF9C38A56FB61 ANTIONEWINDOM
520,484,455 *3523119CAC4E993ABF6855364315B32613508ACA antips2
520,484,456 *352FEAADBB27C9B600A0546DB2C2B8BBFFC38E1D An/Z
520,484,457 *352E38267237D9AA13361E5BB79CDE9838508528 A/P$B
520,484,458 *352663FD2DE971007386942434DF32186527228E EMMANUEL.KIENTZY
520,484,459 *3528B65897E7C6B244A5809BBA78B18E43BD36B3 emmassaps
520,484,460 *35222D3EF0630513938EEAAC017A23DA1936122A EMMETTMUNDER
520,484,461 *35276B58A1B9C31413F0B88E876970882268DCDD [email protected]
520,484,462 *352C1E8E5988F7479DF6E71043CFDF7E5791D375 ARCHIEMARILYN
520,484,463 *35208E19E902F8D3C0926A6DE0C39718FFA2D44D a#=rg
520,484,464 *35297FDD895EC570E84F8C8DFE0B6E686F4EAD0D [email protected]
520,484,465 *35237C4C097320C4E11DA2AA1AABD77878609E60 ENGRANDIZMENT
520,484,466 *352EAEED015D678747D926D9434BD86E6C53F82D arliegerdis
520,484,467 *35269A140375FB29CF4C1687BC40D4E8F10EB512 [email protected]
520,484,468 *3527189B0A3727B6454D2C8369E3A816DAE81282 ARMANDCONDRA
520,484,469 *352DB0C711F061321A9934EC29C92BE4E5388976 ARON.KAIN
520,484,470 *35205F5A876025DCAD812F0C3728A32FFADB5732 [email protected]
520,484,471 *352E58682F853B011F4094AB8E7A10EE62006D10 ENVIEES0
520,484,472 *352EAB263B7BFA565A3373DBF760EF70E7AB64C9 eqe;x
520,484,473 *352CED5731887AAA0C3ECEAFDBF723A9571814D6 ERICAARRUDA
520,484,474 *352249EB6615464FA473CE4283F2A8A9ECC2F3D9 ASONDAN
520,484,475 *352E69858F71E5C477A40143AE0977F847207019 ASSISOSI9
520,484,476 *35255490C636EF79BBBE239F61385CE8B60D7088 ASTRALJAVE
520,484,477 *352C989B8E50D11A42FD499D32729A9B4895BEDB esparranc
520,484,478 *352D9C236D841953EBA6EC8DD312FB1EDD958901 etebmocc8
520,484,479 *352BBE77FC7A30ACC4E3C91C90AB1FA95E186EC8 ETQM,
520,484,480 *3522C83A4B6B46EE4C20D4AF2414CD3336118DD4 EUGENE.LAZARINE
520,484,481 *3522BFB5B5CAC4210B74F4842BEB13AD409E359F aubreyrimi
520,484,482 *3522978A820073E597DF8B0D98DF6606E5251509 auc$:
520,484,483 *35217026473B362D1F044590663B3AB7A9FFEAD9 EVEITALERING
520,484,484 *3527E8CD4106350A469AAECA72B45A2FA623AFDA AUGUSTGUTIERES
520,484,485 *352F8CD442AE45EC39077F120E44AB39C74BA436 augustineboerm
520,484,486 *3523C23C1D2395DDE17F303B7FFECA4E1D3E2F5A EVERYTIME-YOU'RE-NEAR
520,484,487 *352E1890CF0CBD9AA7321B1041E540EE29B0018F EW^K
520,484,488 *352E4585AAFA9CF8C5909427A4AD474B4826F4CF averydeblasio
520,484,489 *352E189BDA91007671CC170200BA1CC82DC81AF1 AV)H6
520,484,490 *352E7B1BD0C7D1FD30089FE676681814594BCC6C avsjk
520,484,491 *3522E3F7F6CA1076B736761A052885A4D1F726FE [email protected]
520,484,492 *3526C8D729B264ACF74BA99EF77CE35F9493EEB5 FEEFEE7
520,484,493 *352C431233443FF732A6FDDCBB2667E20C116382 B0Z
520,484,494 *352E8BE66ED0FA71DDA75F2A8B27CBD473571E70 b9kw8
520,484,495 *35272618A9C78C65F3DA58047E0B0E702977BE2C FRENCHLAZOVIK
520,484,496 *352658ED18932C407FBC427EF54052C1CA863416 BERNICETORRES
520,484,497 *352AC4AC45ED9EC86EADED518E76E0C2354A3A59 bestoffrankherbert2
520,484,498 *35203AE491D26A8D61B103D86CA6672E1FFD00D2 [email protected]
520,484,499 *352C365B2B8189596A2355C958A45F3C29E470F6 BF2A
520,484,500 *352B7E502D8A4E26E81EB16E45C52D9C1CE2690F bi8f)
520,484,501 *352587A56F53009E6D573D187C75F9D13CDB6F9F GAYLORD.DESORCY
520,484,502 *35288F5003C6FDC416C11DA456819632E154E950 GAYLORD.STOEGER
520,484,503 *352A4837F210B7C46EEDB89A2327BCA91E54179F G;C
520,484,504 *352D50E100893CCDF499193C3DC3E72BBA59EA35 GENE.HOUSEKEEPER
520,484,505 *35269A28BA16B9E71A4DD8D76211F3D142982FAC geniusseattle
520,484,506 *35277324EAD268602B241838783A502ACD60475D B)N
520,484,507 *352A8243EC09FE49463458F06A1F6E2601A7A8EA bnt_unoh
520,484,508 *35269865A0BD9DDE1A923370329AA5E8B904B6FB b_o:c
520,484,509 *352AF57BA440D67AB8029BD32FA13185A37DD59C GITARRENFINISH
520,484,510 *35222AC85C6F93B7BA0D3D2ACDBC09B5446DEF5A GIUSEPPE.WIMBER
520,484,511 *352C7538D88B9CEB9FF3CAEB30B025B95CBD435E BOOMSCHO2
520,484,512 *352CE9384BCD2833B2E0B832CC4FDB054D023AC7 BQ)ZK
520,484,513 *3528A396A2AE5B3CE75632A9A38D8AE195FF4CF5 BRADYPASSERINO
520,484,514 *35219B1935567E11F4A0A02AA70E7B19A3DB49A0 BRAFFORD9
520,484,515 *3522F2C15716F07105B3080411AC4FC29260EF25 GONISTEN1
520,484,516 *3525C86E4A051BDA2D44CEF44E8E48FB07ABA04C [email protected]
520,484,517 *352F3078B53A38F582A1F68E92FE9393F3019BF1 GR4MM4R4NS
520,484,518 *352BC37DF91B9B3C2F002717278BCF95388FE6E1 green-thumb-(live)
520,484,519 *352A6BD10902EBD06426CA11BC6B3373C32A9947 BROOKE HORNE
520,484,520 *352AB32D4315DCF4F5D64255869261B55B1A9DF4 BROOKSBENTHALL
520,484,521 *3526ABF9DE93AC622E3C46F61023078D2E6B08E0 BROOKS.LAYOUS
520,484,522 *352693F1BDCE2968EA94E67A4566B8D9113FDD8D grhgoro4
520,484,523 *35236ADFE7CFB80606598EB004BFD6618A4F670E bsboe
520,484,524 *352890397156D0F040706D102E3887F3EB09D518 B_t)
520,484,525 *35283316416A9C82105D2AD573215C40BD49A4EF BUNDESAMTSCHEF
520,484,526 *352DEA659D31F69CCBD1E5263E065FD809F688E3 „BVERWGE
520,484,527 *352A0887133CB7AEDB35DB50418B1C2DE504408D b;x,o
520,484,528 *352FE1B0C91AB640A6197ADF6F540E2F934C8B04 C2E.
520,484,529 *3520D806DA788E15A7CA5E3A45A47CEFD6134232 HAUSERERS
520,484,530 *352E2AB14AD4FA467F7694DEB626DA57CF0068AC HAYMARKHINE
520,484,531 *3529506369647178F08D436E7254A2EE7A693878 HCM_
520,484,532 *3520A1DF8B5183A6228F8568A2F3AB3D51A13EC5 CAO"(
520,484,533 *3523D13873262F6EBA04C0B0D6586E4A0BD4396F CAPTCORK:MAVERICK
520,484,534 *352EA48E456F819991B3A161ABEA59E4C575FEAA CARIANE4
520,484,535 *352F69278EA948AD2C4CA61B31FDBFAEC03A232F carmeloenwright
520,484,536 *352B5093272CE37E2AB5A333F3DCEA8F9D9ED40C ‘carmen’
520,484,537 *3521225EDACB30C86C597C8BBC866B675B42B66F [email protected]
520,484,538 *352FC240D37445941E916A23CD6FB859EBEB2860 HELDONJ
520,484,539 *352BED0C87AE672965141424DAE7D06E16332E47 HELENTHONG
520,484,540 *352940FA71024E24DCA706D0B6D1E18B2AFD3AF1 CARTERHASTEDT
520,484,541 *352F3186B9529B28ABBFC3A7EC1F2056412FA3DC hepisxanunê
520,484,542 *352B8316FF64F792FEBF4ECC6031B3157C94C991 herbertcarmack
520,484,543 *352055CA85070E2396FD43E2198B7A35D77A8707 CASEYLYALLS
520,484,544 *35271CF8A59420E2A91AFE5234E090ADC259CA0C cathy.falletta
520,484,545 *352ED0570BB71F410C279353D1893BC9FC24A18A CATHY-ZOBEL
520,484,546 *352E091B52A75691DC6B4377A73D79E49F80CBD9 CATSIMAGED
520,484,547 *3523443BE088EBEB5E6C26C255EAB399063FD409 CC_OE
520,484,548 *3525D419FB45EC533825BD7FBB6D0EE77EEC9C8A CEDRIC.CLER
520,484,549 *3528DC192B1229F9649E1668EAEBFDF2A9E3941F cf5nw
520,484,550 *352F3F1650BEC0CEE293C5DDC7C6052E6F3CBD33 CHAN-TANTITHAMTHAVORN
520,484,551 *352183E9F8EC25BCC4D3A23CD786650EE374135B CHARLIEBALSAM
520,484,552 *352CF3356F3B6A73B4F6CA48EF5DD1F9196E80F8 h{meenpuiston
520,484,553 *3527E4D69EEBC3CB66312B1C3FA4997FF54AEF0B CHERISPAULDING
520,484,554 *352C5FFDB6D9264881DBEEFB9E8A0B1F299F81E4 HONYAKUS
520,484,555 *35240492459CD073DCDC703F49F905772D127E77 horizontalness
520,484,556 *352416D24E78D77CDB3B802F33D555161E9E787F CHRISTINA.SHEAHAN
520,484,557 *352F403F0CCD9F239358CF2276F97C0877080D95 [email protected]
520,484,558 *3527945C70160744136368762738AED23599F2B0 ciara191
520,484,559 *3524DB40E6B77F75AC765B03ED963B6DD73E9933 c=kn$
520,484,560 *35259DD848BD0646801A45F0C79717A28B848585 CLEMENTE.LUCIUS
520,484,561 *3523730B35521352749FF384ED05F803E83B8AF6 [email protected]
520,484,562 *35221D0D22840E230A12F3401B0A15B3B0FDAD00 CLEVELAND.LUNDERMAN
520,484,563 *3527556166A0B220B44F3115E774B94E62143274 CL_&I
520,484,564 *35278D5C67A66279EF5855D7418CB9F1DC338177 hueynighbor
520,484,565 *352F70F1E68B78B104E170672091C7E7D2C0BD8F CLINTONBORLAND
520,484,566 *3527C3F08F5193477936EA7F241202BD8703C674 HUGO.REIM
520,484,567 *35283A0B92EA864B023106847E8A1CD68375BB4D HUMPPA-EINFL
520,484,568 *352BB3E6F681DE1749773044F0AF207E068B81EC HUNGPENLAND
520,484,569 *3528B5FC136FAE15454DF879CEC6DC5A6FE34C48 HURMOKSE
520,484,570 *352D9A11F4EA0F696C726432003F79184C4AE1B0 HYDRAU11CS
520,484,571 *352E281C48C6B87EC33F8A1CB25BCF5EAE2BE4BB COISA.DE.PE
520,484,572 *352D9ADF2E5C4ED795626898D91A421CD04FFCDE iangoulm
520,484,573 *352EC755411160C63CBE3F68FD70F7FF4A5C5847 idkjjbf
520,484,574 *352911DA921EAA427DCACA69352265396DBA4854 CORO.'K/O/R/O/
520,484,575 *3525E7741A1A05A824DA0B946AF98134BBB69A54 IMAGETIMMAN-SHORT
520,484,576 *352EFC90992AE3F9213D7201445EE954F1F7E491 IMPORLHE123
520,484,577 *352F1D1BEE3983CBC3EE2DAD49B65A512EC0AFFE IMPREVE4
520,484,578 *3527473A6E3A13400B1E232F2EFC9FABADAF82DA CPDZN
520,484,579 *352C69A568019D1F7ED69AC7431B8689F237EF46 ingurgitera!
520,484,580 *352B9C952D9509F33E04CF60FA704CB419F5F5BC IPPERONT0
520,484,581 *352AE75F8CFAB227EE751D4DB2FA4097EEFAC78D IRQYJLMS
520,484,582 *352DA28AF811F7028C9F8144FE3FDE435C41C274 cqp1
520,484,583 *3526316AED76924A25B609AE56DBA99565304819 cqs5/
520,484,584 *3529A1D1282F2CD884F4F3703AA9E9BE6C2AF53D CRITERIE2
520,484,585 *352189E61661B7A9AF1BF46869FB4D9A17DFF00D CROCHETEES
520,484,586 *3528989086E2AB88B57E70378E37DBEB0DDE3651 i was glad (psalm 122)
520,484,587 *352B8D8E7367F203CB7E58A5F4B0D669657FD106 CVQT%
520,484,588 *3525D5512848CB45EB66D57111EBE5DF963291DD JAVIER.ARONOV
520,484,589 *3525B9D2A80AF654184A2A88F426839B570A2F76 D0&s
520,484,590 *3526B4625F90AE2AD25D51878AAA71F1217068DA D7CGG
520,484,591 *3527532DBA57F1D1BFAF2BA2C2503B85B3E07765 JEWELL.ROSILLO
520,484,592 *352472E5AD507243DF4A963D2A276C1D597F768F JEYNV
520,484,593 *352FB662CDF62E85B20E539BB00B44D1B62C0756 [email protected]
520,484,594 *352B79C0709ED628542115C325790DF3C6E8AEB7 [email protected]
520,484,595 *352FC6A2DE5D39F19F4547AA7500007468C71491 danesilvernale
520,484,596 *352E60F4B16C5161DB3E59CFAD6D5615C2F9B75A JOAQUINHARCHARIK
520,484,597 *352422D472052E9B6FE7A29E274BCB6A6EB7E2FF darlene-mcbain
520,484,598 *35271DB6EAC132A1C2F6793362A01059D9FD77D3 daronwiederin
520,484,599 *3527E5E671A8486C0C8D2756FE7873723464DD5D darrelprellwitz
520,484,600 *3520D4D8959F7C092259A0C93A04855A15C96D89 DARRINYUPE
520,484,601 *352E122B7BC649773E33325F132B0FDDF405E4B1 darylthackrey
520,484,602 *35212D923F91EE1D25DE2671EE4F7FA0615134F7 [email protected]
520,484,603 *352B989EF6AFEBDD290C4042F37B7BD40E98C89C david-ray-skaggs
520,484,604 *352F2F352C36BECE89011C68E174B6C345619DF7 [email protected]
520,484,605 *3524ADE7287C72124F98604DF52A6D121C1B72CB JORDON.GIBERT
520,484,606 *3526120985EACB57442A29060ECF34AF954F1F32 joseneubacher
520,484,607 *35266522F6BEB60EB39EF487EDD84205F20195F8 db+jb
520,484,608 *352F4EF179E53AF109CEEFE281EFE59FC7505921 delorene1
520,484,609 *3521787DB7637BD0491AC2241BE071775449D660 KARL.FESKO
520,484,610 *352208BD56BDF67C508DD9FD596678D43AFFB81C karolinelien
520,484,611 *352DCB4D840F7F9021028EDFA3F8F4C27598B645 [email protected]
520,484,612 *352B880BC5A65BBFD6B6D865E4EC58B6B6345996 katoentje6
520,484,613 *352B45068B6DC3328B9099AD5D54DB4410850A0C detwin
520,484,614 *352760E189EDDFED8D0582E2C438A9229C23C3C0 DEWITTDORMAN
520,484,615 *3526DCA1C527040F8AC4E2E25CEC195385B52CCD KELVIN.SPAFFORD
520,484,616 *35297C33C687CCC04E10E820F607A3DDADE4E907 DF_.H
520,484,617 *35280194769FB17FA766B59555B55C913244461E dg0bf
520,484,618 *352EE65D917D2BE7F24A64AB95CF4CACE0A692AF ketocarbonyl
520,484,619 *3526E3A667392EC30990D983E924D94317C6A2D9 D,H.S
520,484,620 *352CF15BD7783840618057C0DEB354D9B84F77F4 KINIGAMA
520,484,621 *3527D94BAD736A25CD31D904013C84309A3BD976 KIRIKLARININ
520,484,622 *352EAA004C9BCA8D8503738E729E0F139939500C konstantiovna
520,484,623 *3529EB1BD4C74C413B0E71F1F6847FA091E3C109 KORREDNOS
520,484,624 *3524D5F5A75885A985BAF78C44B4F3E1A15C2457 かつてはksbでのテレ朝ネットは緊急時を除き17
520,484,625 *352CE25D5987013FDA04A691EE373AF767F0C30E KWESI EGYIR
520,484,626 *352E96BC6E6FAF69BC6FED8393FE97F4F97043DF KYLEGRASSER
520,484,627 *35265F74B882CFB095DA55571125039F4B7237CD lamontsprenger
520,484,628 *352AECD14F873E3B203F8DF03EAA2246E6CE8949 [email protected]
520,484,629 *3527BF4B60B2ED631F6763ABFC3BA10D01B6F4DD LANDWEDEL
520,484,630 *352825B77BF7F11B6761FCD54F78758585F19E73 la-riots
520,484,631 *3529F907E3A77DEADDBD01155DF3CF8AE394E31D d\l:
520,484,632 *352F0D874A295815E9E6AB26AB0B9B3CD052E58B LEE.GARDINO
520,484,633 *352F36A49DDE4E2EBA445C3C55C029F989DE3762 dn24h
520,484,634 *35212BC2A60B22210A764964EB75B3FB8D6CEDA9 lesleymenlove
520,484,635 *3529123F55D057756CE7F25DFB8B66CC989E3743 DONOVAN.DIESI
520,484,636 *352D2615BC3DC8953431E0A0D2576E083F44EDE5 LEUCOSPHERES
520,484,637 *352711C3E9DAAFAD94719D02FDE2C9908B62E53B DPAKA6TO
520,484,638 *352332BFDFDA90D096E8278331ACA8087A0231C5 dqn64
520,484,639 *352DC0270856D6DBD08FBA8568D49F5EFBEB3F29 listadealcaldesdesotodelbarco
520,484,640 *352581C1A70567E687123AF6909601D5833245B0 DREW-GLASS
520,484,641 *3524992C2FA4D62F13460FB4CF78CEAB17F76D11 Dr=F
520,484,642 *352F3B03CD2175265AC0293BC57AEDCE1AC595CA LLSSKKL7
520,484,643 *3524CEB52DF801FD494D5C4F5A90F400F329C66A logan.jaeger
520,484,644 *352572824958AF7FFC6D98D8827ACF1AC69E9132 LONNY.SAIZ
520,484,645 *3525519DA0926A1C03EAC1404DDC53CAF9B12B8B drmb1
520,484,646 *3521C98432E4AC133AA2D5FC4B897FF30EDBC9EF drugdiversion
520,484,647 *3525959F28FFCD59223FA7830691C7F74B148D53 ds983
520,484,648 *35216167C461AF3BC80629D1A90E6120864D1131 dsszv
520,484,649 *3523A8E3E3CD3084F8EB79B2A9AA8488A70031F0 LUCIANOHILES
520,484,650 *3526121E1F658A828F22C2B68E66D985C055EC2B DTT/$
520,484,651 *352806CD4D3259871ECB39E28623910C1DE1A034 $!M0N!3$
520,484,652 *3529E14B5606A905C117EE35082C61DB19259EDC DVb8
520,484,653 *352FD03EAC5B2D42D3828F72D6B1AD351592062B MAHECHA5
520,484,654 *3521B45F35F770B2A5153EF64320515C3CBA7334 malhafunk
520,484,655 *352E764CEDE8D4AF3A087A0EB2A69EAAA73F62CC [email protected]
520,484,656 *352C415A4ACD611C5B8C981E9D936103390C842A MARCELLUS.HEUPEL
520,484,657 *352DA24357BD5520D6857F72A830292B2BAECB34 EARLBAGNE
520,484,658 *352630A5FEA9583A827D3D14995D3F1C30C73367 EARLSLONAKER
520,484,659 *35298691B810CD7F1EE08F83687F26E3EC333B44 EAUKJ
520,484,660 *35277582C74D7C6CE66004A96A4DD1245A3DFB45 masterflags
520,484,661 *352C7DC8BAD98BBC39614D00606EBACDDD2419B0 meetinghouse.N:.meetinghouses
520,484,662 *352A2D3EEFD1CD5D222C33C986A9337008180625 EE233E9F-4229-3CED-A47C-8FFB995C43EB
520,484,663 *3526D216E4E0DD20DC7F0016547D39F2BF81695D EEPANN
520,484,664 *3523C9339B9B242992E792F724BA972E456DD451 EEP%R
520,484,665 *352320DC765E540FE0BBAC7F3F8E6393B991116E MEL SALZ
520,484,666 *352EC573F0CCE71F2C8119911A7A3AAD2FAB3FC9 egif
520,484,667 *352AFF51C22C8B4291B4AAE891EF40138AB30515 EINGESTOCHENEM
520,484,668 *35235D839A5FC5E6A800FDBFA3D02B049440077A MIKRAJI
520,484,669 *35229636E5CDFF35C3305366518AB00C72DB1ED3 milobreon
520,484,670 *352A5F0FFBACA33683AF0D9297472BC7041E2959 miltonsafron
520,484,671 *35268ADAC05D44235855BE03B0E6DD1ABA2B0E8E MKUE
520,484,672 *352E52383102A2E08A3E97A8383639072BE97BA9 MONTYROSEBROUGH
520,484,673 *35267B12EC86BCAF202CF643EA51DC3779BB522C EKC0E
520,484,674 *352B6B96ED2A137C3DFF68B136CD193FA0BAB174 M]RL
520,484,675 *3529CA0459E8168BA22E34BB2C2947FDE1967E03 ELIVEBSW6
520,484,676 *352218DEF2FC8F89C318047E35B2F50AD40B5C7F elk=s
520,484,677 *352DBED0B2D7596446C10DF7FB7C0F46CFC4EDBB MYWINDOW83
520,484,678 *3527526BE2C0AF3F9CC8562F545328A72FBE3AC1 NADPRAVIDLA
520,484,679 *352DE59CB803DF817A469EE52A838F59ED23F7B2 naehkenns
520,484,680 *352B9D96534A654CF850AFCDBE9E4F6CD17028EB NASSENALLE123
520,484,681 *3527E362D005CB8DE73C4E3DF3D8EFD81101AED7 NATHANAEL.BROSSETT
520,484,682 *3523B3582CF97F8228FD96E9A1B1EB47310B1B38 encensar3
520,484,683 *352B31B0E6BE8ED63B418985A24BFD90AEAAE077 [email protected]
520,484,684 *352F4194BB412582CDBCE4F819E7769778F82017 NELLMCDONALD
520,484,685 *35261E8DA85A70B77FE93840010D0A4EE70C6487 eo_jq
520,484,686 *352B67829D9855CCC5DB484EE7AC19A37FAFE7F6 EPRENAING
520,484,687 *35219864642531E636FD088B71D3F526092BA1B6 erbilol
520,484,688 *352E4C13A42E89C96F0B63C7C643B98846C407A5 NEWSROUND-UP2(B)
520,484,689 *3520C33315BEEB84C94DC26DA0D04155319F703A ESES$
520,484,690 *352AF584E08B6B6B8DC847240075747FA7682A8B nicolasbrimer
520,484,691 *352ED8652C49C95906376F14B14D83A9F520A500 es-ua
520,484,692 *352D13A9B3483F06D3DCF508193CD81D3C49EE9A ETILOCAR7
520,484,693 *352CF48A64485058ED41A4DE7B149BCCB2F73BAE NNE.VALS./.LA.BRI
520,484,694 *352FB09728FDEBFE951C0A749DFF86D2D95B3B57 [email protected]
520,484,695 *3520603D1C890929F2E22A2B379341049CAA9740 euq,n
520,484,696 *352F36FF676DCC48AA1B0D0B515CA08F113792A8 norbertmertens
520,484,697 *3522514CAE359F7D400492FE5EF7AE7ABF1D96FC excitari demoni
520,484,698 *3526105578A51CCF3741A632FD05F450DF780683 NÖTESUND
520,484,699 *352C2DDF0D5060E0D09E85E599D7062292D5D642 NOTKCSQTFA
520,484,700 *3521A4C44F64F7F6CC6B8DD62F7DE463FA89899C fachtexte2
520,484,701 *35239C9960BBBE22B26BD6EF27A1E5FFDA5899A3 ODAMERIKANIZOVANIE
520,484,702 *35270F65948D023F1CA8EEFC4AB3EA08E7003CA9 farvningernes
520,484,703 *352D79CCC3E002500C61CE97F2BDBE6AB18FA806 FEDEX台灣
520,484,704 *352BC23F075C21D2861AB7BEB86645745C1AF22F feltonvanderau
520,484,705 *352BEEE26237E6527707C9A1171BB80A14385110 FERDINAND.MALORY
520,484,706 *3520486DC4CA7AF87A46064C72A0738F25561B11 fiatistonu
520,484,707 *3524A7448C63D44A4B55D7C21DCACFF08B2A650C FIREBALLTAURUS
520,484,708 *3529643FACCF7686AC8E20906342F78DB1E4BFC6 florentinomorrall
520,484,709 *352F5348AF900490759696B9CE163533A143BE83 Original.Dances.from.D.365:.No..20
520,484,710 *352480BF84800C539783AB31F7DC289DA939A0CA OROCANAV
520,484,711 *3520CC797F77CC0934EB61D71D150F2C497AA04C forsythey8
520,484,712 *352BE75A136548542762E6DE9ED4DAA1B6CF2648 foryou(spontaneous)
520,484,713 *3523B7D72442997B529860AF1D346D2FF45E3302 FQT
520,484,714 *3522B34030847EA86FD6CCF7B13E9AE7F379AE68 P#####> ~ ` (>_0)
520,484,715 *352873404938ACFDAA2E6FDE019995B3542E9226 F*WN
520,484,716 *352CF4019F1B325B1F8AE94EBBC8B83328B319AD parisciulla
520,484,717 *352A0DE78C9BCCC323A73AF6242F3334107387B2 PARKERRAMSFIELD
520,484,718 *352F7BB2229EF89AB869CDE31E3484D3F3410071 pas plus monsieur (feat val
520,484,719 *3526CD31FECCDB7B03061AA92216AB65BE9AFC69 PATRICKTRENTINELLA
520,484,720 *3525A0E1670EBF5F24782F480C7155D8C005C8F0 Gck
520,484,721 *352F22B52F2984BA04101398AE0595650DCE7D9B get-out-those-old-records-(disc-2)
520,484,722 *352360C9F44DB802BDC6953A1AC3D0164696D711 pentaoxacyclopentadecane
520,484,723 *35260C90E3F14F752FCA5562F520D5A9BFD70B6B GOCAIN
520,484,724 *3526A6BBCB6F7D84CC5E63E4D2DD1A1206282AA1 goofeegurl13
520,484,725 *352339EA89B7454704795C71881A8487637C07C0 GRADY.FORBS
520,484,726 *352EBC093226A51F33C9562B833AB23EA611C802 GRADYUNDERLAND
520,484,727 *3520F1625EF5BC66589CAD3ED4D83E884439DC4C PLIKARIJA
520,484,728 *352555554ED541484FEAB78F099B12C1CE93AC5B P=====>~)o(
520,484,729 *352D80D7F13E0234D0535063A444EC2A21D679DA PP**)8(
520,484,730 *35238CD4CF63C4E416E6B606F7FCB649CAE3C15F PRAGYAN-DUTTA
520,484,731 *352E5DBE00685B166684C2BB34925F0CA635890B Praise-the-Day
520,484,732 *35261DF2A32378D88D336C2DFDBC7156E08DE29B pranav034
520,484,733 *3523932F03E68F4A709C20CD9E36BCE608E8B0F1 [email protected]
520,484,734 *352BC9376AB63F30F0D6F8E45EA6941CF1B60CA3 HAI.MONTOTO
520,484,735 *35212CA5E1CB93143A8912B37169A932D27348A8 PRINTET7
520,484,736 *352A6A0CD1C219E3E8DDA879C072110B41202FDF punkhorn3
520,484,737 *35209870A607148D985EBCDA9E379AF978712A27 pzdwenp9
520,484,738 *3523FB06CF4107D57D08E454D73CA8784E35EFED q####d-~-`}o{
520,484,739 *35211580C0B181E88ED471A979D9F7D24D93F3F8 [email protected]
520,484,740 *35239F4947C082626D77389E57C42D114BBDC171 HASARDERAS
520,484,741 *352136C9BAB541D7E4001618BE03DE3A4A28FD8D Q=====>`)O(
520,484,742 *352992B0DFF57A2AAFF91E3169CE6045106D3398 hazem.hessen
520,484,743 *352ECE458C9BAE0D7461653D4474B49C910CF4F4 questaegne
520,484,744 *352BFEECF6F6A5F89966DEF03DAAC92B826D9C38 RAFFINEERT8
520,484,745 *352CDB59B23274B76EF7DBE2E48A1072A17D9BF5 HILARIO.DULBERG
520,484,746 *352AE32C18A2796233D05DD93E57D382DD0EDC09 RAMONFRAME
520,484,747 *35233A7CEEEB221524406BD586A007A9E21E6E81 HIMLARNAS4
520,484,748 *3524C119FBE7FE39DDA297614C94FFBCB5701F25 HIRAMHARO
520,484,749 *352EE0E1E9FAEE7CBAF49E2878B6C7FCBE6A71B6 RANDY.CANA
520,484,750 *3523C2DD3A9909A4A656905A1BDB78470F5D39F8 historicoreligious!
520,484,751 *35240E364F93B2A496254DBCA13BB694896C55B7 HOCHZUJU7
520,484,752 *352B8941BCCA38D4319FDF0D87904A616EF0B9F9 REAFFORESTATIONS
520,484,753 *35273708C50140E9FEF08D88E62E1A37A2F828BD reangela3
520,484,754 *35236E75A9F83346677D425B7D1B177A99F0AC7E RECREUSÉES
520,484,755 *3529006D93CA9FE208731B316C335AA7707A1E8F Rec.Room.(w/.Demastas.'Feel.No.Guilt'.beat)
520,484,756 *352B6DDFF9E3B1B43A04F88F6D607DF954AE0E75 REDISGRACIÂMES
520,484,757 *352987E17AF49B9AE8A9D10A36C0910942DF3B80 [email protected]
520,484,758 *3526192B076398B8F5EBCB1EE447BCD86D89FC34 HRIBERNIKOVA
520,484,759 *3525D1ABEAB0E79839859B0ED8C45B5B4A7BC3B8 [email protected]
520,484,760 *352916EA8331F9E978EB8A67B0CACE58DF59EC87 [email protected]
520,484,761 *35254E1D6C6BD7D70ABFEF8276B0C291EA7B1FE5 HTTPSPINTONGUES.MSK.
520,484,762 *352F29FE4F10374C9846E09B26EA134E04620317 reggie-go
520,484,763 *352A57EF7FD66AC3ECA6217D36ADD7BD5FB8FB97 HTTPWWW.KH2.CO.UKKH2
520,484,764 *352073423AE86158FD79E408BA1A3992FC96FFD5 REM4I1IN9
520,484,765 *352CD369596270BB5178DCCB2AE00D78E2776BE9 renukena6
520,484,766 *352918CCEE4510EF7AFC8E2B7F80A2CFA918E9BC HUGH.ERNO
520,484,767 *352C81E136277269E6756A644EF3F95B0C083789 HUGHES則提出一種改良的OH
520,484,768 *3521600F29678E26739A2E6F2CC4121A5AC6E40B HUMINES3
520,484,769 *352B8196FB766364080DE4F23571E274BE4B50B0 RGESPR
520,484,770 *35291141E33D3614457E4E82EF81A268AD6E4BF0 RICKEY.CLYDE
520,484,771 *3521BF681C4C9887EC5A0A1165EF6073F3A3BA48 i9e
520,484,772 *3520AABAF291E1EFD94F8937E38E6E2984A87430 IAMBLUEJEAN1985
520,484,773 *35260580888B6CBE5236939ACD351ABCAC67B8DD rmcfwpg
520,484,774 *3520BF5958AF4344175EF65D97777B22BA7FD7ED RODGERHANSROTE
520,484,775 *352A3DAB3DA00BE81E46A886A6E118BC3E8BDE0A rodishihara
520,484,776 *352C37FC2BDF08F3EC3A22307039B34ECDB65DDE RODOLFOCRAWHORN
520,484,777 *35231C3F15F61AAB4EF2F58D108225846BFB9E4B RODRIGOBIBER
520,484,778 *352EC90D7FA39C5BD38661115C2BAC4944870B14 ifeelyou
520,484,779 *35252B2A565EAC1FD618CB4DAE884CE297A5C553 ROOPMALHOTRA
520,484,780 *3528942C02CA86349505FB43DC5EBDFE74D09E58 rooseveltgruner
520,484,781 *352F60BF1EA60E0AECC831E6781482FA177B4B90 rosemarybraxton
520,484,782 *352DAADDFEEF5E3734B2FB6CE28FE2ED569DED13 ROTTENHATE
520,484,783 *352EB138065DFF1DC090B9DA81ED0DF2F1C3AD05 RTSNOMED4
520,484,784 *35239F3E8C5FF082E575FD80FFEF83194F5194EC RUDOLFCATAQUET
520,484,785 *3525F2CE278E81DF72E878369D771600545B3D36 ILJOONAT4
520,484,786 *352C47A0244660F8875BC18A9FA3E794B9C6CA5D RUSSELBUDHRAM
520,484,787 *3529BADFCD2EAF2EDA6BC08F643EECFE473C3CA9 russellshivley
520,484,788 *352EC5795151AD6AE1842497746A946A87C86622 IMAGEHSLNANTUCKET01
520,484,789 *3527189DA87D7DC32E28FEA2888C39758DCC012F rvds97
520,484,790 *352C78DCF1DB60F30A529685B6BBFB4D610C9CD5 ryangreening
520,484,791 *35205D9DF85A69D87AC4C526385C949952187B7C INAUNIONPAY
520,484,792 *352857D9B8E7B13F41256E818A3F2F65930F1E39 SADEFLOWER
520,484,793 *35251EE535DA8645A4D1F16AEAAC73440021B7C5 INFAMENS3
520,484,794 *352CD6FDFDEF48F3C39F46EC6862793FB7656971 in-shining-violence
520,484,795 *3521463CB926EAD08A574A321561ACBD8AACE008 InternationalAudioLoungeEditionTwo(disc2)
520,484,796 *35262A33B036DB9864CD4D77173417279A808165 IP?AAA
520,484,797 *3520D53D5FCF65CFDF4A9D3601A3CCE5A739AD6A ISCHRISLAWSON
520,484,798 *352A3FE83EBD7F99E419E00C3B6F844AA57B3F5A SCHBLINDING
520,484,799 *3524F0B4E9058AA0B65C728A0A803279C82D4D49 ITSELLES-SUR-CHER
520,484,800 *35249D0E98181B3360702591C48E1656F8DFBF80 IVORYBOZA
520,484,801 *3522D4E68FAAB0B8AE80C96484E049C532FA1126 SCOTTYHOCKING
520,484,802 *3525D0A3FBAD98C981B2DF72DC8B9C0A151C00DA i'(x
520,484,803 *3521B683337C10E0F18C2D668A1BBF1C5943E6C3 SEATSSEATS
520,484,804 *352DC804EAA4D0688B0C96E783209175A8A5DE20 SEBASTIANSINDONI
520,484,805 *3525581EFC583570168062928076DEC887998910 JACINTO.LUCION
520,484,806 *352C2A74002F75AFE917571D85E008D6B00DCD84 jackbooks
520,484,807 *352563867A59275410A353319EEDED1867CD3A99 «SEEBRÜCKE»
520,484,808 *3529DB79E834E555A5950EA5C643FC5EDC0C337E SEGREGAVO
520,484,809 *352EE8E5A2F701182EA91116A03D776074253D4A serata-eccezionale-miccoli
520,484,810 *3527F009ADF07B5801632E7D5DEA1985621148E6 SET-%TEMPTiME-$REPLACE(%TEMPTiME,SECS,S)
520,484,811 *352EC94BDFA3B910EA4A65F5DE6ACBA7E3A87EB9 SEVENMOUTHED9
520,484,812 *35274C15D08980B30900D238C400D66EB2554817 SEVUOLBALLARE(FIGARO)
520,484,813 *3528C454EB82B54682BDE2545972EE164A6DE8D6 JAMES DOUGLAS WOOD
520,484,814 *352646C80F9F3E5CE333C8819635A9929F10FED2 jamesmcgaugh
520,484,815 *352709E2992177646E656A3AFBF4635A758B4D43 SHEENA-LEUNG
520,484,816 *352BD135462127DC00539E7F71CE49D8E457A04E SHELTON.MANSIR
520,484,817 *3527049C7B2DA7CDA9C898A3C622724F0BB01066 SHERMAN.DOLHON
520,484,818 *352623D2599BA0E873DE183CD5322C2ADC25E145 JAROD.HARDI
520,484,819 *3525EE4ED428604C8A9ABE186E15E18528ECE217 SHETTY12
520,484,820 *352D1CE4BD3EFEE4B30E18EBA49AEA73155850A4 si76934250
520,484,821 *352105D0B4C94AA13023519E1D2FB79FF689BEAE SIDDHIKHAMBAYAT
520,484,822 *3528C3B265EE75647DEB86E52001F8FDB971DB9E simtekbsw
520,484,823 *3524F5992C048B51AEE380D14F8D5F7E9F9781EC ŠIROKOJE
520,484,824 *352C4F68F27DA44C729C86AEB9060C77697ECC67 jhm|
520,484,825 *3523F25EBEF1E8DE93B618B3E9E02DE3DA46C50D JIMWHEELWRIGHT
520,484,826 *3522756FCD07960F5CAC4BBB0D365CAB28E86F35 SOEKTOGS
520,484,827 *352E2263741624A46A5B1116D88C688234CF1607 SONRIRE
520,484,828 *352A3905175FC5186380C3A5CE7694C5E1DC801E JOSHUAKESLAR
520,484,829 *352CF56A1F8A391E1BC38A62CD06E18E0F675C05 JOSUE.ESTELA
520,484,830 *35211E20F7A0C9D07C8D9AB4DA3656C935EA270D [email protected]
520,484,831 *35285060C562CAA027D7B6E282BFFD64B6C902F4 jubilarian
520,484,832 *352A5FAAC11346F9319DD8E3672179C2550B4AA7 JUSTINDIMEO
520,484,833 *352403A4B82F45BA612884B80812B76B7B2C5517 justinmannon
520,484,834 *352D917730BB40B84C072168D1D5912DD4D41B8D splat!~`~`(-p
520,484,835 *3522D78CF391B718AC43AB17D9A17950E02963BB KARIM MORCOS
520,484,836 *352986EEE0FCE33ADE5E3F316DA0F57E45241A2C karldoenitzcom
520,484,837 *352092F7D927EF03C7352957E682451DE33878CE KAYE-MCDANIEL
520,484,838 *352F134BF729BEAE0689718A6A2A6EC5E24CBE38 KAYRAHATI
520,484,839 *352504CA69C015A87DEC21C75FF34BAF29C3DCE9 starosc7
520,484,840 *3527EB078F2DFB25561965AF755E62BBF3A4BD7B KENT.WYATT
520,484,841 *3524AD56EDB913A649FDCA349DEB288CF7A741BC KGLG
520,484,842 *3520052A968092E0344D9E8CC2DE68529B1921A7 KIM.KRZYKOWSKI
520,484,843 *352C86AE0FCA763B7190C95829BC1B892D6EBBCA sto"rsignale
520,484,844 *352C31BD0FF07D6FE5619676AE1356C08762D375 kommunistenjägers
520,484,845 *352617EC72F793B84450814FE0B973312CA234EB [email protected]
520,484,846 *352865815B941E9A281CE016FE7221061A7F4CC5 Kuldne.kuu
520,484,847 *3527C1201E76B0EF9C3751F9C5925A7284DC6E87 kulet26
520,484,848 *352E4CE2E41D17220F51E88625CA6EC02ACBFAC0 [email protected]
520,484,849 *3526D367E17F853299A3915269152DCC6AB896F5 LA+CH
520,484,850 *352B630565760D51D1E69464610E1E90A0F170CC LACYCOLMAN
520,484,851 *35236E2B68CF7B776A59EAD5AB0EE629FB4DE54C lacydarks
520,484,852 *352BD157A2A63CC6ABF9AC67807EFCAC07FE6CF3 TALIANIKKI
520,484,853 *352CE0CD693F1774E4454A88336418B4BC967626 [email protected]
520,484,854 *3520E05763C6960035D74622D5DC53E26145C87C lanegalbo
520,484,855 *352C6EB1B0673FD72862678040D3470CBFDC0499 LANTTULAATIKOSSA
520,484,856 *352BAC108340383A79A4CE40E3C228CE04DA8F3E TATSORAB0
520,484,857 *3520FDA84C5FAD5AD0EC47DEF26988FE8AE1D3B1 LBRKB
520,484,858 *352FB573F7E320C5F68DF806C5CC47AEE35E5654 TEA<
520,484,859 *35225211B14BF3451FA05D96DF1049CE1D254741 LELANDMATHRE
520,484,860 *352A7DF0094412BA50B77814CA0B763ABB056D99 LeLierre
520,484,861 *3523B5357124F87524E54B7341AB8B8BAEF838F2 LEONTIEFPRINCE
520,484,862 *352866528428A08A83769FCF46E100FD2F4B84F1 LESLIEKNIGHTS
520,484,863 *3525218E8EA15111576E74C4742A4BA2B6B1B2E8 <li><ahref="fb5.gif">page5</a>
520,484,864 *352A966C539DF840829123200FA8CE241A50CC76 THATGHOST5
520,484,865 *352685A5C79706FB190DCDB153DD6EACA807A855 The-Eagle-&-The-Rainbow
520,484,866 *3520EECCF929C494DF8E96C7ED5C9395E62B5E25 [email protected]
520,484,867 *352348AE6A01D984B23ADEEED115D9973C2400BB THE.FUNNY.DUTCHMAN
520,484,868 *35235712FBB39E97D3B0824C13D1DBE6009127D8 [email protected]
520,484,869 *352478E4FF6697A2F94E9033161C4C75F7A6055A THEODOREMCAULY
520,484,870 *352752DE27942ABA2165B3BC4E507CC31C8D1F87 LINDSEY607
520,484,871 *3527D7A5A102B1C7740710F6E0117646C45725EF THERONALONGI
520,484,872 *352C9048CDDFD8B28DD4C84C144FCDC05057E922 LIONELPABELICK
520,484,873 *3528F4BD9F9750531B3F5E7297AF350870D1EA77 thesundayafternoon
520,484,874 *3525E47A0DEBB8769AF78FB0E6FCBBA1AF37EACA THREAT'ND
520,484,875 *352FBA5BA080601E78AD57B9C335E95153421428 TIMAJREP8
520,484,876 *3528742029C0828D666830F48DBF7C383DCC9657 TIMBA(TIEFSCHWARTZDUB)
520,484,877 *3522395DB2782634430E873839B2B3479EFF8334 LOOSE.WHEEL
520,484,878 *352F247AAD7170EE059BE6D13F2957A02BCB3E6B LOYELLA8
520,484,879 *35218FE7208B8220AAED01B70B602EF50978E080 LUCIENONOFRIO
520,484,880 *352EC243CECA1E82B16417B00EDBDE1AF12A626E lucienparrotte
520,484,881 *3529103EEC45901E5AE4E39E078953A9BB87053D [email protected]
520,484,882 *352451BBBEE46043CCA88E4E72707693C2BC1C53 [email protected]
520,484,883 *3525D74E6AE5F9AC7B4A455E60F25F846CAAB6AB TQV6
520,484,884 *352222D109970066AB2F5B5CE077D9F623716760 LYNWOODRAISLER
520,484,885 *35238761976E39D3DC464D72C43CA3CAB99F6D3D Tribal-Roots
520,484,886 *352814AF19BC8DD0B79E4DBD3AF759182D73491E mad.cyril.(hello.girls)
520,484,887 *352461234E7307D47F8DBC1EA27B119F0FFE9573 TRMMLTJ
520,484,888 *3525C44DFA914AD28BEE65DC14805BD7586E1538 MAHESH-BUDDIKA
520,484,889 *352D109E7C6C3F847FF1906E6C5B79D6D09BFE58 TSITSITHES7
520,484,890 *3523668C7A41BAB3CE5608EF9B08B02E6169EF72 [email protected]
520,484,891 *3528B87C5A89E02C3BCCF9ADA8F3A7977A2AB715 TUAN.CHIEM
520,484,892 *3526A5CED7F10CBB0E74C2CED3EFC58D2648BB5D tucker.alexander.foster
520,484,893 *35263E4FA90706560859FB8692FE0FF5FDCB5440 malouyame
520,484,894 *35258E907ECAEF63E3B446D2C94635C8AF66F56A MANUAL.ILL
520,484,895 *3529CDDA01EC8542D5C25D99CB5C1C9F5DC1727E [email protected]
520,484,896 *3528AD6F8C6BEF7BBCAC3943FC653832794A6ACB txyg;l
520,484,897 *352C4290996AE5F963096636AFBBE44BD68011F6 TYREE.MASTEN
520,484,898 *35218DA94533504EEE825E4D79C7C351BAC77B03 MARCOSBOURAS
520,484,899 *35250AD007AEC9831C0DE9CAD39106F22A6DF524 U=~=
520,484,900 *3523917303472C1739212A0D16ECB264598C639B U117186
520,484,901 *352C0AC7CF4F6EB4C2D498E17087118B1CE57491 [email protected]
520,484,902 *3524FA51A062E5CA427B0BB9047781D851B18D07 u\ie
520,484,903 *3527676F76485ED9043971995DFA71260B34DEFD MARIA POTGIETER
520,484,904 *352C9D5254184A9ED0763736B246AB1EF4779893 ULYSSES.STANDRE
520,484,905 *3523AB0546100DCB73F776F762AADEAC1E5329FA MARIOCASAMENTO
520,484,906 *352C9ADAE4AE7BF1C9F37486D31D3D1CD3C89056 MARIO.TOLLESON
520,484,907 *3520DA89FE1B9D484A53DEA030B11CC4F0B7BDC2 un!d3nt!f!4813
520,484,908 *3525B6E9FDED99C6E54FC398A7359FBFF8D54CF7 UNSTIMMIGKEIT2
520,484,909 *3522ED5E8FF71E3A02B1A6F55CCE2B1196AF0A30 MASTERPOINTS.4
520,484,910 *35242F534A91D09D0F98DB5B32DF28E9CA0168E6 mathewcraycraft
520,484,911 *35253E0C1D0899EA95B8E20884F3613FEC27E389 MATHEWGILSON
520,484,912 *35291CB13416C1830221E7E1C879272F74CF50E0 VANAVOLIO
520,484,913 *352470F5785655169026D9AEBA07D09DF67CC314 VANCEGADE
520,484,914 *3523F9C071437D887A52A24200273108DC7F42EC VCLUTSAM
520,484,915 *352A8B761A6BE2B5FD40553B5D9161A86CDBC30C VCOORDINATIVE
520,484,916 *352DCDE6B829614F53DD7C7B3D9FD88B07D46E1B mc0001309
520,484,917 *352A5580057D409E46716ACAF8CD3614154928DC MECH4N!5+!C
520,484,918 *352CC94ADED9FC45A6A879C2D608612E09D82478 VENUBW
520,484,919 *3523A59D537EE1DA7598FA9FBE1ABD41052215A3 VERDENSHERSKERNE6
520,484,920 *3527E97FB0DE7B23D1937E99EE6AF41B5059B5A4 melissableeker
520,484,921 *35299B42C030D85411CAC86FF2BDEF2FF93612C9 MELISSA.WERTH
520,484,922 *35229BF4C14678FC15B37F8F40DC20180F08DFA4 MELODRAMA7IC$
520,484,923 *352370F71AB4F8775D1B3BC43E35C5B57E23746A MICHALARMAGOST
520,484,924 *352CE805646EE9BA7C712CB14C90DF291FB01070 victoria-w-boss
520,484,925 *3522B8E5C7E33721ECCAB10FF7E2452C5447F778 MIHAI.MANOLACHE
520,484,926 *352F923DF7F46A38472995D2880EDDA3C3A84693 vinayan.chandrasekharan
520,484,927 *3523E552E078CB1418822B412EA49ED2A1862D6C VINCENTFARRIN
520,484,928 *35276B0C1C423A2E6E5D3B835AA4DB0DB3CCD426 MILANSTENN
520,484,929 *352D4B5568858F5B96DAF2913DBFB484E02F6C55 vinceputaski
520,484,930 *35265B4121FE6E9CE726463229C927D1601C7529 MILES.ZOLA
520,484,931 *3527C654A4D898A572C6539F0ED64ABD850C9144 VIND3MI4L
520,484,932 *3524CF5966B31319E4C44454CD799B9B32951B77 VITO VETTORELLO
520,484,933 *352340DAC686537CEAFA53E023AE67C15086F4BE vivir.lo.nuestro
520,484,934 *3522C03BBD9A4D22EB688A6627A8A5A9EA39157D mk10i6my
520,484,935 *352D3884C146CB3348AC854AFC84580694C6345E WADE.LED
520,484,936 *3525D9D79F62FA2F7F4DC5660A1B866C3864D8BC WAFAALISALM
520,484,937 *352A1E15BD351855F9FD5771BDE5074CD84FF37B WAKEUPYOU'REDREAMINGALIE
520,484,938 *35232E8CA5630925720E10FE2C7F9B51EC43C3DE MODIFYTHEVAN
520,484,939 *352D41E468EF8D2AAC9A03FC05893D941D9CDE4F WALNUTROAD942
520,484,940 *35274E6D430B3F50904053B2D5FB38F7B42CD2EE WANNABEHULIGANER
520,484,941 *352770E204F52A3672DE4C5BA624A6C49ADD6BCD MONTE.BLYE
520,484,942 *352350896AC7DD04244F85665C1D553C5FB68F66 warwick.bower
520,484,943 *3526F65BB6721AD13CFA929CDD39E3CDDE0D4D2F mortonsmolensky
520,484,944 *352BFF2FC54D01B399968C728C43C4F5B7E5C8F3 WATSONDANNY8
520,484,945 *352D9D74B65BACBD1406D245FBA9951D7B5C7F11 WAVEFORMSYS
520,484,946 *352F89711282EB59DFF98BFCB7E87FA76443608E MoshPit(c)
520,484,947 *352F908063EB35B86527DCB7461288A72F66E33B muntenia89
520,484,948 *3520BB6E3B2259645C869906E2BA4B160290D552 MURDER-OR-A-HEART-ATTACK-(INTRO)
520,484,949 *3522C8A8713D5CCFAA78583487075736AB384117 WH5TVFRXGU0NZ
520,484,950 *352D2E84F8769007CA5AE3963D648207295068CF N163689
520,484,951 *352940ADFE50BE583D2FAA907820EA5028926637 N:A8
520,484,952 *352DE9EF86B12A5F4B0DDFC28160F8E90517195D wilfordbowersmith
520,484,953 *352FD2DF1DF1BE5AA9D13893B6A53DD15780E890 narangerel-purevdorj
520,484,954 *352802F83E050C731F047BAD78F2735C61058F29 narendralohokare
520,484,955 *352602EA614120C9A4026970CAF25CA1232F9DF0 willem.jan.peters
520,484,956 *352A1A0B8867ABEE61F4088901BD0E0FC60E0E36 williamshollenberger
520,484,957 *3524CC2487FB1C67498C845C80BEEB122336FE4E NAT-NATZ
520,484,958 *35257BD1BA1CD50B7C2101C9B10001AB2FB2217C WILL.VELASQUES
520,484,959 *3528243DA63AEB9A2E6E53B100EF7BD4C991E6DF [email protected]
520,484,960 *352EF36D0BA5C8A3B7A0058D6CB1E36DD6C7C996 NCMAPDOTONALTAMAHAWOSSIPEE
520,484,961 *352827B4A06A54C533F63B7260708FDDCD434088 WITTEKINDA
520,484,962 *3525D7F292DC14D904F104C1743E27A1F861B7FC WOODLEYGRAHAMGILMOREMARION
520,484,963 *352803515259CD1DC8941BA624BCCB688506929B [email protected]
520,484,964 *3524B670939F32EA3C602BDC73952FC68DD1C8CB nge,op17:iiiderg
520,484,965 *35287F60E49DE802AEA702B72FD3FDBA8CF4D9AA WURU AEFO
520,484,966 *35206E5FEF06A288DAFC58F215C4C084A6BAD80C WWW.EMERALDFIRE.IE
520,484,967 *352B02CFEEAC02016313BB381D1E62228A35EB1B NICHOLASMERCADO
520,484,968 *35262EAEB7C1FB3D28E0184C03E8E850CF707541 X7JB
520,484,969 *352167F3DAF149CC47E7E045D050643C4527A14D XGYONJIIDGGMSXS
520,484,970 *35287DD205761EDCE14146CEB8365F0FF66C8F3F XHOSAST
520,484,971 *3521D847D4AFE880980BDC5DCBEC973CF5B01DDE NISHISUN7
520,484,972 *352ABC246B68F577301FB315746712D653D351F4 [email protected]
520,484,973 *352213EF432DDE0918C74ACA208AFFD82D73E8D8 [email protected]
520,484,974 *35212AF2576FFA23DA4B0CC3F4E8EDD43DAACCD7 NONCABALIST
520,484,975 *352F596D7174F47D1B8172C71DE7EDC5A36F5F58 novemberceria
520,484,976 *352D10846E240C38C6ECF33A2BCE2A7851F81AA1 nrebieling
520,484,977 *35222C1AC41B5E46877440FCC655B07D3D5D12B2 [email protected]
520,484,978 *352AF813C063EA3414C8018D3EDAB16BF4E40934 NT.'
520,484,979 *352C7F924D389024CF3F809E8391854BE7A83FD9 NURUL ATASHA
520,484,980 *352C023901A5DE20AEDCD165E22C2B7A4DD7B9E8 [email protected]
520,484,981 *352A8027876E9D123BD5CAE1FB879F7DB92F14FA YLGNIKRIMS
520,484,982 *352B1C3A40E1891AB5660F18D26476EEDB17F888 YTEICOSR5
520,484,983 *3522E8E9FA3684DD60314DB013B8BFBB123D6ED4 OGLU
520,484,984 *352846BE851A48A0ACFF5D1D086B24FAB4E270F0 YVVMPCIZUX0
520,484,985 *352CE7425A03A433F7416E7964A45BEDAC863099 YZKHARY
520,484,986 *35207313EC7156209A266DF525B83012DC404644 zacharybuffalo
520,484,987 *3529BA917820F875C3504B90C013CDCB2A485A59 o*m1
520,484,988 *35275D38CA825F40C40146DE41173670E213E5E4 ZAINZF
520,484,989 *35296ED17FABE2B26A287D14686F08635479CF8F zameer.khatri
520,484,990 *352BD71FA8593B982000A47253CAC7043796AA04 )o(o~O~q#P
520,484,991 *35276F48A47F0E07A5A8389E5BCE42767E1067A3 ;).o~<-p
520,484,992 *352B885DB126C3C57901B301BC8E6BA45B743432 (^_~)o~-<####q
520,484,993 *35279E1208AF18276DC31D4E27217951CB9E7359 [email protected]
520,484,994 *352F107FB67DE5C8362890A47171493B05FA0724 ORVALGROSE
520,484,995 *352D47FCD2A320969EA0C7F5ACBB69080EB1BCB1 zhaojunhong
520,484,996 *352F06FE6CCFC8E9247D12E4EBB9EB6D7947C9AC otistibbit
520,484,997 *352C363D8929D2E377AE6520CECCA8658E421DF6 otruciu
520,484,998 *352EA0F09F37F13765118DC759F327439EDF00CC БЕСИАШВИЛИ
520,484,999 *35293DA98F17F36D7522BFB5EB3BA03850D79A1C paroissiale0
520,485,000 *352D523CF9F27483E383F8603A9774BE1EE213A3 PATBROWNWORSHIPBAND
520,485,001 *35232D4AB4B801E8EA3DD0CE1BF0520405C595C2 ИЛЬСКОЕ
520,485,002 *35286B423DA4ABD8C08AEFED08FE7F8A9EFC73E6 КІНОПЛІВКА
520,485,003 *352528667D0791E5C7B6E2EA52E01B3BE535768C ОПРАВДЫВАВШЕЙ
520,485,004 *352D319BB90D9A1D44C7BA8ABEC330A5CD64C7FA ПЕРЕСТРАХОВОЧНУЮ
520,485,005 *35258F286ACF2E50D52B189716B66D4BE60E79B5 PEACHSTSPEEDWAY
520,485,006 *352A5AD8C47F9D1A7A3CDE5CB9DE10794ABF33EF PEDRO.FIGGINS
520,485,007 *352BFF3D820C5715B8806AB74A56D904CC3345EF PEEVETN8
520,485,008 *352D574BC86BF20D8A191DFFF10D04FB59DFEE5B penoncel
520,485,009 *352ADDE0EA5C3265ED7DAD812A9455902A2D703A peterrubie
520,485,010 *352DB6AE07EEB7FF95F80A679341280294946AD8 PORFIRIOFREDERICK
520,485,011 *352B591CF20FA0EFD7AD6934521438E60DC76D3F porterwiechert
520,485,012 *352135E435FE7B586C28159D8A7C626A6FCB05D5 [email protected]
520,485,013 *35237DD68D92D69C1605E99869D5A04D51761EE3 POSTOPALLEYDROP
520,485,014 *3524DDB1240C68DC2781C17E8A32621F93B4C1A5 PP**)8(
520,485,015 *3523741703C4077BF54B8C097057FCC8BDB429CD 最受欢迎卡拉OK歌曲
520,485,016 *35237491E9B16DA071AFA0732227C9DA54E314AB princehaynsworth
520,485,017 *35213592B7C0FF472AAD7733ADCE0B2D44F82B04 priz0n
520,485,018 *35246E4D5A5E1EACC81A30CF32EA4892D710AEA1 p--->~~Splat
520,485,019 *352CAD90907728D3B430911433AED86A94D3ED0A qwaszx
520,485,020 *3523E607DA2CF2821D16C7E88AA70E9C1B143FFF 0.0191321.groups
520,485,021 *352ABCDD326D73016A38EF43CFAD94DAD7297063 raphaelbolster
520,485,022 *352111E9CBC355920A3EE5FE5712108E297DB7E5 [email protected]
520,485,023 *352D2ECD649CB342A393F95F362C604C7052E8A8 RAYMON.WERMA
520,485,024 *352D21732A74A960E0B2D93F804804FA657B0813 [email protected]
520,485,025 *352A10D512DE6232CC65E4A3BEB5203476E4EC86 01131483
520,485,026 *352098BA8530F139F8A93991A878623B0DFB9BB7 regest
520,485,027 *352D24B340E9DE20BF8107247EBA3570137475CE rejaldejay
520,485,028 *352CA3E0AFFA6D5E25AC0AC814BE7277BB71F097 REKTALNIH
520,485,029 *352F41BFC599A52EB47E0EF215FEF4F36B01718E (>_0)**Q8
520,485,030 *3525CB746B80AA2A2FBAA49EAF30BB063617C2DB RÉNOVATIVE
520,485,031 *352B9835273ECE2226764640EBE429DA55B18D35 REPOLAVI9
520,485,032 *352346E6BE91C00DC1E29F4127CBC4444FF2CF71 1237034 beslut : tekniska n
520,485,033 *3522F3FCE2FE1396992C6C3F516157B04D15F762 RETRATODEJOSEMARIAMAGALLONYARMENDARIZMARQUESDESANADRIAN
520,485,034 *352EDFA74510FEAF5EA65714DBB5D69F223506CD REVIDAR9
520,485,035 *3520EEB69486514471DD7C94EB58682427D557E8 RF00244
520,485,036 *352ECA2B779447BFAC688A719D7DB4CA92F33004 149928 robert need , head of the corps' public-relations staff
520,485,037 *352A269544227ADCCB35F16303AA509E9B4B8AA2 richievisnosky
520,485,038 *3526D1E1C51F3CE1F2A34369F2E3E33AA4198F5B RICKEY.INSTASI
520,485,039 *35284FE6241D2B0A125A4F0C8D4F60D11DD199D6 rickielikins
520,485,040 *3526F5FA3A4008E84420103AE5F2144D17073752 14mar1751
520,485,041 *3529B7EC049C213591D07CE81C736EF6066D368A rieht dah tnediserp eht dna ehs ,yksniwel .sm ot gnidrocca >p<
520,485,042 *3527185FE7374F8BBE753B279285165378735FDB 15WINTERHAUPTSTADT
520,485,043 *352EFCC85E58B379E8542ED30D0441BFCBBF3838 166QAWSEDRFTGYHUJ
520,485,044 *35241917A38D394BE6DE096147034E27119D2B95 ritesh-dhir
520,485,045 *352FD6F11BA2811B98BB74FB72C326D6C3BC0C94 RJOGINDAR
520,485,046 *3524F19E5FFCB6672DAE25B771BA2F860836B82C rncsstt
520,485,047 *352E78BC63E895B7EEBCE20523138668551CBF12 rodgerdobbratz
520,485,048 *352516696B652FD020AE8BF9D450AA19702CDF53 1ANNOTERENT
520,485,049 *352FE1B44429B48C5EDA225940CF997E18B97507 ROLFCONNEALY
520,485,050 *352839B29947A8AF0BA45C8B03F6AF55300B1292 ROLFDIKET
520,485,051 *3521037443100D5EA7A1A08A4BC6D11C6BFB2B1F RONNA JOHNSTON
520,485,052 *35230C15A58D05EE050601F962ED5F2FCF33A7BE ROOSEVELT.PINNA
520,485,053 *35210B7ECB64F95222368CA859668BA83FE54D04 ropingsilver
520,485,054 *352A33E7B034643A51440B4B48F1E66CEDD17706 1.empfungen
520,485,055 *352DE331AB5CDC5C90CC8CA5647567FB5A312EF1 1-ERDIENBARE
520,485,056 *3520EF06BFDF41BE4A3D509D9FE132C5BBA2A824 ROUVRIRAI0
520,485,057 *3529E5112A6733ADE79740A3BA106049A7F27CBA 1HARJOITUSMAHDOLLISUUKSIIN
520,485,058 *3528666ECBEC2BB52B8077C5E29CB68841A53FD1 ROZPOWSZECHNIMY2
520,485,059 *35286289029AD03A9C52BEC4E8F80575B1EA8D68 1heroides
520,485,060 *3525F70EE3CC9DAEA0826A9059FE9D5EDBB7F1BA RRGTSLSS
520,485,061 *352CA6876A07F89985397ABC0C53D34765AE64BE RTROGRADERAIENT6
520,485,062 *352946EE78D967782E97ACF7AE936A6FAF931CAE 1 NAAVAPELLAVAFROTEEPYYHE
520,485,063 *352D63C22FD2B457BC449831D33E481C29347D77 1RELENTE
520,485,064 *352AFDA711BFDCF6E4E74C7FDF89C0D6FB80F55F 1.RETIREMENT-SAY
520,485,065 *3521F057FC12C03A63CA67B3BE55FD9FA41F51A4 1.RUOTIVAN
520,485,066 *352B4A904E80A0E3FB8A5BB893676E9F4B2072F1 rwaegung
520,485,067 *3525E6F451A10032487C8198B68F21BA25E6AE8E 1tobacco-addicted
520,485,068 *3525A8EE270161A2F60651D864F61D3B1F1492A8 1-TULOILTAAN
520,485,069 *35229279CF2BD1C047A2E462F33DAEC6CAE80804 1valtuustouutisessa
520,485,070 *3524AFF79CF01183B02905ADCE5B849C536C70CC 1.VUOKRA-ASUNTOTUOTANTOA
520,485,071 *3528112B0F13A3EBFD90FC6790AF4C8C9592A962 SAIGHDIUIRIBH2
520,485,072 *352FB87359B81C2A5939F968D7634AFA3C349190 2100458 tilaajarenkaan.teht
520,485,073 *352263A7C3C9C05E08A9BA5B66F821D810D5EBC9 227HAMZA
520,485,074 *35298219BE7A302FCE4517F8A17CAF72393A1C3D 2748442 sangen usea oli kiinnostunut kulttuuri ja ymp
520,485,075 *3527B0516938509BFFD6B25D0B092E182AEFD888 28-L
520,485,076 *35268AC8D11C47B616B74E82458DFC7A7E8DBA09 SAMANTHADEVOL
520,485,077 *352EED2D5AE7D4A84C3370322D376E0E6D3A9D90 sammieurbino
520,485,078 *3520221F5EEB6B8963F44D7D6EFB5E7CBD7AAFEB SAMOGITION
520,485,079 *3525D62A9E143B6E9159E6B91370A1139F2EEF92 2f1651347
520,485,080 *352167ED0C79BC47854E89CC533AD3F7D4544C80 2FA5756150
520,485,081 *352D5E6B94D516D9C741BA5483BA1B8742E61033 samuelsyal
520,485,082 *3528AA9BF876A4FD1ABAB462DECBF2756FFBF64B 2KOTYLHS
520,485,083 *35202EF21E073386AB7452938AEAA57934B682E5 2-kovuSturulmasIna
520,485,084 *352CC7F5F5AC51074B0591A851B806D946419694 [email protected]
520,485,085 *35286E4AD560DE84A7A78712E2346522ACC76A94 2-mieluisimmiksi
520,485,086 *352927E0DA4B68B289EFA982E1DE319DC137D157 2-notice-to
520,485,087 *3524F4B809BE6307C91BCC1D8DB15264BD35CF38 2POCKETCASE
520,485,088 *35282A2996666E7942009C7ACFF5753BB106CFC1 SA-SABINE
520,485,089 *35234B3F642161FD3F482580DFE417868E0CB31C SATTVIC.
520,485,090 *352DAB8E55AD6AB938ED568A663AA007BE17E0B9 3:..-..3#..-&...sequinned
520,485,091 *35207DA08031A08560F874691C0AF2AE9533A8FC SCANDIA..S.K.AE1.N.D.IY0.AH0
520,485,092 *352194F32FFF37A1E7A1296EDFBC787350CB5744 sceloporus.
520,485,093 *3525A205B8120143DD092099D3720C9C170AFBB8 schoften8
520,485,094 *352A0519E0B7E029E2F95AA6301AACC42BF53E0A scottiemarkevich
520,485,095 *352FC0EEBD937FCABBCAAFE8E2BA513E25C994F5 3IKOTILLA
520,485,096 *352FB0AC4CF5881799D7D8A03DDFF64DB0E7F976 scyphus
520,485,097 *3527BFDE5926345104394F6CC5B37C9CE76AB9EA 3#####p~.(>_<)
520,485,098 *3520FC7171FB8015EDEE770E060120CFC53CEE9F Second.Fire!!
520,485,099 *3525DD0B0DA553CBCB51CF5FF6E4FE26679D46F4 SECONDSTORY WORK
520,485,100 *35231E3A8815F3095D0582BD0856D5E9DD0BD230 semi-autom
520,485,101 *3528945C1B4EAE50F53C9335290A8D3636D9B2A2 SERIAFFADJIT8
520,485,102 *3525DDC07310D81C0BC38C8FED13FA51EC5BB80D 4CGJBILLY
520,485,103 *352BE09DA00898E695CA162290D89A4EA20297C9 SETH.RONDELL
520,485,104 *3527C23A766CF7D957996F6A23332F9FB62A92AE 4LASTARGV
520,485,105 *3525C36282C0BE73EFB9238A8EFF53C0F449F9B0 4LEHTIPUUT
520,485,106 *352A0156956118A5576E69A08634E5367EB966D9 sfquiz
520,485,107 *35249C6F67CD097E0B628B2DD04CD89D623FB5B5 SHANEBUENVIAJE
520,485,108 *352402D3E72CA7A75CA1310239E01E3566AEC25B shebarambo1
520,485,109 *352AAB3056E902B4BB1F93CBE9F143096323F005 SHELBYLITTY
520,485,110 *3529803A1E61C6E8A4464C8B189D93C94B58B761 4TODKKERS
520,485,111 *35247854160EC1F3833A0A37C973174AAF6DCC00 4UTOMALLI
520,485,112 *352987A169243D4B81146A766CD7F856BB0F6CA2 546983 SEVGILIME SADECE SANA ! ! !
520,485,113 *352795F63D65395FE491F2774CE4A90E8A9C3B28 54TYNGL4DD3
520,485,114 *3520CCF5576736E189EC0198E7444CAA3DB3D721 5804ullyot
520,485,115 *3520FA9B1C164FA07E73A6708AA826E7A25FAC71 5CAROLINASASHA
520,485,116 *35262C6789918B5A837747AFF5D6ADDA3AD9799A SHONAUILA
520,485,117 *352BC07046B6B2FDA3AFFE1BE34F380F63067FA3 SHOPTOWNCENTER
520,485,118 *352A7FA3AB75ED85530884C4049C809DA3F6F5A8 5DARNEDARNE
520,485,119 *35297DFCB6459D5557EE9D5CAEAAB8DD56E786A9 5IFORTHET
520,485,120 *3523ABEEB5E27428034090212C88C98029100C8D S"IN
520,485,121 *3526652B57C12FCFC2982E57C9BAFBC324570B4C SITTIE AINA
520,485,122 *35273FD6332BDCC22272C43BB103DF52B2346D0C 5MONTANAWOLVERIN
520,485,123 *3521F28B06CC5B10DC70F2074CAEBEDA801E05A2 5OGASTRES
520,485,124 *352B3D6A2AFD503929D8C7ECD64036F22933CDD0 5OPUSPENGUIN
520,485,125 *352012BFB517E24FFB2F64E4700AAA0DA5D88D5F SLAGTERYE2
520,485,126 *352CF51DA6E307FC641F51D453B054C672C69050 sleepingmonkey(encore)
520,485,127 *352B199ACD5448DDF47B898BBE898D8C3658C6F4 66495 OLEMME.TY
520,485,128 *35248B9D09EFFE3E0E96B16862929CDC66561FC2 soapwort
520,485,129 *35216453BDC7D1826D0596B8CD40F912B7A22CDE 6CEDICAVALON
520,485,130 *35248C575F524F6121F8AFFC1E4D9583218FAB96 [email protected]
520,485,131 *3525005758C3CEEA5EE39EBF46D4C9FF8847A732 SPAJARIT
520,485,132 *3521229F0EE89B189B81C33F3A3F03FA6FA7B398 SPANISHCOOKIING
520,485,133 *352D9700A02C56A55B5863342E8C9C67E0DC5714 spellmaster143
520,485,134 *352F5AFD47C192C673FB8F4CC4F274BB2E6E762C spider20
520,485,135 *3528106EE08FFF98D78F971C06F1F0B078386EE3 SPIRITWHALES
520,485,136 *352E0B52DCE2D81F56E96BA329D781EF0CD5A018 6ILUVSAM3
520,485,137 *352C9AB84B9D06DA0FBFAD9FC76F8A4EFE9C220E SPLATO~-O~(------8
520,485,138 *35230B642A73D7AA16252600C63346FEA990F1C4 srosivdaed
520,485,139 *35202804C559AE7E78EBFC64ECD56998E9DBC8A3 6VANEFFEN
520,485,140 *352B2F4EBCEDF9F476A91B0B6016F10F0A00D6A4 [email protected]
520,485,141 *35268883E2E9D49020F9E7589A651BE1D2EB2687 STANTONZUMBA
520,485,142 *352ADE0BFCE9C5BC8609D38B9891198CCDC82D22 77.SIR
520,485,143 *3524F219BB0F2CFB4FE3375368A5912491782C3A stefanwarehime
520,485,144 *352002A03CE7C46A00D9E8F7FB95C619C15C3E06 STEPHANCOURTOIS
520,485,145 *35281B7ED89918A1B63AF6B50D23F43B5CEDA80D 7BECKINGTON
520,485,146 *3522840B09A6B85A5808EF2BD3EF3C5617151A6C STEPHENSLACKERS
520,485,147 *352055B503CC7E8D249146AC0CDF4C834720BCEF STERLINGHOCHBERG
520,485,148 *35227374F08F1F10F638D143F66D5E4D509A731E STHGILYK5
520,485,149 *3523766CD895EA7CF995E84319A07C4FFBE034BF STHONGMANILA
520,485,150 *352736A479DD1C9FCD7000796093995DAA5ACC20 STILLAMMOS1
520,485,151 *3526708997B26538EFE0C972012350A2323BC570 STIPSEY
520,485,152 *352FD1C52DCF27F97D90221A4612ACA6F9D3E4AF STNASIMONOC
520,485,153 *352F01823F35F4E1BB1627E5DE83042B872CFAC9 STRAWBERRY SWEATER
520,485,154 *352CC085368CCE85486FC6EEC449DBE8B9D6D434 stuartaliens
520,485,155 *35230F7A23A0FD180E7E836ED8B1FC0E98F2C983 [email protected]
520,485,156 *352212EE451728C244C993303D4485247CF329C0 7opar35
520,485,157 *352BAB7AEC6F1CC5EC5EBD716B47CFA44A1348E6 SUMMERBOOGIING
520,485,158 *3521751D004D0D63D447809332DFE357E7973307 7R4N$MOGRFYNG
520,485,159 *3526767A0583B60A5A2AFEB30FB574EEE4F6E8A5 7SIGVARDS
520,485,160 *352C5077DE95F7317A30810CF8443141910A505B 7SOLEILPEEWEE
520,485,161 *35298ED94D6081B24D74034B558038E43B77F711 SUPPORTERATTESTAUTHENTICATEAWAYAXIALBACK
520,485,162 *3522C01C8B2E513A630BF8F8518659807626C2DF surfmatt2
520,485,163 *3524749BFD2D0A2EEB1C97D56281C233028C40A7 SWOOFIT4
520,485,164 *352D3FD7BA7BEF33278102E6E7C46451F879E1B6 SYLVESTER.PICKELSIMER
520,485,165 *35215F6446908FF4BBBBA0F3B94D3ADA5513AB3D 879405 ATATURK.HAVALIMANI.IC.HAT...YESILKOY./.IST..
520,485,166 *352BCB41A9A6806E00130E7854F69FB76003A5BB 8######)*-*-*-)8(
520,485,167 *35261B22ADA7EC0C2B660F649F8155DFAC9FF971 SY|VEREIST{
520,485,168 *3528EA2BB36F5A17CD6157EE4FCAF5D17C7C9FA0 8INDSKUDSSTNING
520,485,169 *35212FE346CE21B0E3079A19A1870AE7D87CC008 8======P ~O~O(~_^)
520,485,170 *3521C57DF6FB413C17F550D79E03FBD0F3DB672A TEODORO.EVILSIZER
520,485,171 *3526DAFD25807852C611131E04C6C79464FCBEEE TERRYMELCHIORRE
520,485,172 *352AB2A4763F5922C060716D618EF8FEF4FDA374 TERUGPLAATSENS8
520,485,173 *35215D87365C1C553450DCEF6D4C5DB99C9612E2 TERYTSREMIT
520,485,174 *3529228B090689AF437CE8A55972BB10313A4163 teugenhausenbattle
520,485,175 *3525ABFD4BE7E664FA73AB8280F175778E0377B5 TÉVEDNIEMBERIDOLOG.
520,485,176 *352446281911D7B444A2A9718854288035CF2E58 9CLANCYTIGERS
520,485,177 *3529B396D30FCCFD73305426B0BB4F56A67E767E $TGAAA
520,485,178 *3528688511EBCADBDA49554E3AD8054296E6A617 9geoidal
520,485,179 *352FB627EA290ED86BEB9280CBA528C3DFCA05DB that-high-lonesome-sound
520,485,180 *35278EC564A083715229627A33694F43C1FEA83F THECHARLOTTE2008
520,485,181 *3520C8AFB6D2F0822C23A5F748391DA79F338250 THECOMPLETEEMIRECORDINGS,VOLUME1(DISC1)
520,485,182 *35295F7B5FDCF136B2292FDE61CE302CC6E898D4 9TAURUSPASSION
520,485,183 *35209F65824CF7C1B37F13320480FA5A53D89265 thetransglobal&magicsoundsoflaszlohortobagyi
520,485,184 *352C28C4B481B88768D1F3ECB4F22BB816C83102 A.^&
520,485,185 *352BB050285064EAE6C8F3DF35F9283B0DBD4752 [email protected]
520,485,186 *35214F608644276A43D9234535EAEAEE8A278EF7 a6$n!
520,485,187 *352020D37E86E4F965CE86E20AB068CBEA2C0F44 TITUS.LACHARITE
520,485,188 *3522C304C52D97736FEB3264431C6F56D6DA4694 TJUWXCKKDYING
520,485,189 *352479B763B2E119380368C9E8891389307F2AAD aaaapl
520,485,190 *35265AA5A45350D0343F008684CF180FA958ED81 AACK:N
520,485,191 *352A1E2F94C46B18B990942313138EAF66FFB7E6 abigailxxxx8
520,485,192 *352F1DDAD618A7B15894983D26DD3B49F9E72EF1 TRACY.SANDFER
520,485,193 *35276FF3B055AA7277413BDCEE56452D00E456BC tracy-sires-dugan
520,485,194 *352A258676787F1622D3E73A38DA198BEB3BBD39 TRANSFERODYSSEYONGOINGONWARD2
520,485,195 *35256654045C6BC1B0DCE3F1A38A84118EF62871 TRANSFORAMINELE
520,485,196 *35253DFEF746DF7B698BABE5E026D60A614248C6 TRAVIS:
520,485,197 *352630051F606332C7689734F5551EDDD62E9A9D Ac0c
520,485,198 *35205795300C119809F2210F992C0CB7A1A5AE57 ac3~t
520,485,199 *3523658ACDB43EC09F4869965117CB86B37F38A9 ACHMATOVĄ“
520,485,200 *3523F6FB42A7F32D429951BB5D24ED493780CFB3 TRIXIELULU
520,485,201 *3528270D926FDC1EB1942AF418BA0A9EA1638C15 TRUMPTINGBSW0
520,485,202 *352C28F1A3F6036A5DCCDC86878EF2457E6CE667 TRUPCIC
520,485,203 *352BE2EB8315F8CB20B384CEB225374B16E10FCF tshegofatso-letsapa
520,485,204 *3528A63666D1E3BAC3CB623B88D89DAD0E784E05 adn2%
520,485,205 *352B365ABF1E133378948524ED3BD00480FA8861 turkishmarch,op.55
520,485,206 *352CD06A8BBEC34A56E844046A43EAEF92FB8E02 aexcl
520,485,207 *3526AA37982BC97F4B14B2CD391F87FEAA9385E8 AF5.D
520,485,208 *3525EDA3920589AA649E9A0A78D467C26B6C2A09 AHMED ELETHY
520,485,209 *3527FB5E911B69B1DB1D72F4501A1F9AAC2EC6D8 [email protected]
520,485,210 *3528E7A5D226E6D17A1E2C51286527E31A67A302 UOYP"}
520,485,211 *352D3AE24FA6949089D80DC02FCAC8522980F05C AKK2L
520,485,212 *35281EAE41C6F88229BBF93D6AA676247F68D026 upeneus-quadrilineatus
520,485,213 *352F2551F95A9E8AB437EC5E193F04C80479FE51 UPTOWNRESIDENT
520,485,214 *352FADABBA0C896D39B0366B5A495E877C8EE3EE USERWEBBPHILLIPS
520,485,215 *3529D906B89D5A40AAE8D9CA76DB9513CD3B07B7 UsetheUltimateSuccessFormulatoCreateAnyResult(10)
520,485,216 *352BA65FE22C99CB2EB9BF89604BE658E816244B ALEIDA-SAENZ
520,485,217 *3526FF443742E6B5DEBC990DEF981ABF2D1DAE09 UTAMAROS3
520,485,218 *352829BABD83F11B79C871FE4D3956590D32CB7F UTVIKLINGSTEORI
520,485,219 *352D81700481903413E1945151641FF1CF69DD34 [email protected]
520,485,220 *352CC53FD204052108BCCB3BA95B37F4669742AB alibaba&themicthieves(featphlowtron)
520,485,221 *35266E4171B4F04454EFD828659E7CCB97AA6188 ALLSTATE69
520,485,222 *3523893FEFFE2B0336D9C49BB3712F64C4975F56 VANESSA-GUEVARRA-MANALOTO
520,485,223 *352F662AD02B2BC9A44B3D24EF40DED1271A2134 ALVARO.VIGOREN
520,485,224 *352868E232F1CC0F5FE758261E642FE0DDED4875 A%M8&
520,485,225 *352216DF09D8C112FE7D58398F0F5BCF90FDAAE5 vasthiurizar
520,485,226 *3523B56B0AAA5E68515BBBEAE98124EB81AC2252 AMJGONI3
520,485,227 *352A0322B1F4FCDFBA0F43F775455D235C436DAA ANDREHOLME
520,485,228 *352645294E49AE9E3B747B54D5FDAC03BC050036 VEMBYI
520,485,229 *3529EB42CF056B2E34E43B780D485FA171A03AF5 venus.exaure.beltran
520,485,230 *352439FCDF2BAC67481F4E30FA550D1C2CAF85F3 anesha.johnson
520,485,231 *352A3B4B5429F18B64DEA2149A7C49E6CF440D71 VERONICA-ABAIDOO
520,485,232 *352DC8B710C67D896ED314FC8542F2D0A81D54D5 ANNODYHR
520,485,233 *35279398E52C10C4BFEE59D3C3BA675E6C640D6A ANNUTAZZIONI
520,485,234 *352DDA748440AD3C524A1BE6FB6FB54868FB5B44 VETEROTESTAMENTARING
520,485,235 *352A9FB3DF0B30447BAA8417E3841EFCA501B5E5 ANTIONEIUCHS
520,485,236 *352530158CB0E42B1511393890EADAF49A01A8D6 ANTIUNEMPLOYM
520,485,237 *352E59A901C0217ED857E8B259B03A1DC01D6159 a_p4c
520,485,238 *3524BB77FB8F47F7347B36BD880783EEBD2D26DA ap$e
520,485,239 *352FB301EFDCF0ECE4BA9D5DBA266413D8A39A05 APPELSAG5
520,485,240 *35263D9A72612DF78FAA9CF67A3595DE06C2F06C AQXRS
520,485,241 *352912344DD8AD5D63314107737A8F82FACBB66C VISKURILAIN
520,485,242 *352202948105F4C4546C0B93FD94E265BBF233B0 ard0(
520,485,243 *3528B26F4F94E8F6A436ECD116F9BE7DEC086BBC VIVACEV
520,485,244 *352D9E1E36AB4678EAF11F4CF392B4DB139AA6E0 arhq
520,485,245 *352CB7D93BD9455AA3093A710AFCFA743D4EC622 aro,%
520,485,246 *352DB7599C78A8C12C6A1EFD84634EA5A308B0C6 VONHEADY
520,485,247 *3525C4CF4C735E001161C59CE689F7C724420089 ARRACK$
520,485,248 *3525B9357C64812C655BD93CC9D1E45F55CC50D3 årsavdråtten
520,485,249 *35293BAE68A29D6E9DC7F4374C5C4956DA890BB9 ASHIMATYAGI
520,485,250 *3525CAE40A392EC10869194350DDFBC5D18798F1 WAIKANCHAN
520,485,251 *3526E0B491F9C8A4A974697356A6A982EC5984B9 asx6w
520,485,252 *352C4FE73D7C50F0B88862F3E41D6FEBCF59A3FC WANGMO DUKPA
520,485,253 *3529B1A357872A207EA8C0A71A8D41DE20FFFA78 WATESCA SPROTT
520,485,254 *3522FD0BECDC14DEB7E04B2D2C294A601BC9BC04 wathsala.munasighe
520,485,255 *35245C87F05B987802598F947F61698A984E61DB atwm
520,485,256 *352F2FAD7909BD9A3127DB1DF51E2E560873FA04 a-uf
520,485,257 *35280E9CE4E6FD73C4353269E7D71B93EBEEB793 a-ul
520,485,258 *3520372C44CBD4B24A591E920EDCB6CBF1FE425C [email protected]
520,485,259 *352D58E72026D309303F27EDB0C3555D52FD9D8B westonfleming
520,485,260 *352C8264CF475C052F3B0EF6A19EC9264982B58A a-w$7
520,485,261 *3521318A6C821506251B436F1072A6EFD278F6AC a.+$y
520,485,262 *352D836B66173B32D12735C40C911856C57184EF ayazkhan1
520,485,263 *3527DE560FA89BAFFBB23F65630CA355CE82FD43 WILLIAMSGRISMORE
520,485,264 *3522D5A8616739B5ABCFB6B5A5F2E0158EA683AA B0kne+c5
520,485,265 *3521ACB5CDA4474EBD05C26245C4688EB7843FF0 b2oa6
520,485,266 *352F121F4E64A4A87BF3191716DAA4001DAAD893 b3=h;
520,485,267 *352016CFC1671B0F5703A1E6CBD050B8CDDCCEE4 WITA.HENDARDIJATI
520,485,268 *35253FFAE5582D6CE4176927F658F9445258EFB4 B6ALL
520,485,269 *352B8FA9FE53D61BEFB0DE50FD25942C441B1B6C wo<6
520,485,270 *352FAEEE9CC7E188F5E375AE8D6EA4F00DF173FA balloonbomb2
520,485,271 *352DAB5A3671B8F07C11FF3AD129FB8F1FAE1938 BARNEY.LIPPEATT
520,485,272 *3526C3EB4A4142BC559307A921E86D104A959556 barricadoed3
520,485,273 *352ADFD216D418BD5F2CC39CAE5C6199F0A054F4 BASISARBEITEN
520,485,274 *3528B81C401057B32303539C03915FBCB4CDA297 bcjgw
520,485,275 *352C2D2E0A7C80F2A6E653E8CA752D88E9BB1BE1 bdxiq
520,485,276 *352584434109CDA69F18150CA3E82F0A4D846024 [email protected]+E$
520,485,277 *3520904FB2D0E0C7BA765FB63BA8811BD9A08A13 begripverskille
520,485,278 *3525ED800FA474B64910FDDE9FC24D222BC50481 BELEMALBUQUERQUE
520,485,279 *352B0F3B740A7541863C650A25C7826EE4B40FE1 X%L/
520,485,280 *352BDCADD50A06C07D5FFF877C0931798EF1EF92 yahussain7861
520,485,281 *352B25FA97A4F909871FBF65494AA36880A05698 yau-
520,485,282 *3521927E9BE89656FB3F2D1141F9CD3A41E45955 [email protected]
520,485,283 *352429D4940663B6368B993D0CF71D9D62B63B7E YENGGIL
520,485,284 *352CF3B93CDA92F3F4C13A27762C7ED5CC51FBE9 BH0,
520,485,285 *352B8CA119128F61FDC53E0A3FD2523D23F9331D YOUNGMCKEAND
520,485,286 *352BC82F81A1F6CF18194FFBD1982B4395A8E580 YRAGUNAN
520,485,287 *3522DD3840CC37276D62E5BF5772AA35852EB5B2 YTDGYFLHIG
520,485,288 *3523ED988885C59B5742831619C23EA9C780A0E9 bill.merk'skogogmark'
520,485,289 *35269AC5E2B260D11FAF60A4432D8F2458098E06 bk3kt
520,485,290 *352C5797B23BBD93C2F96F7F5A6F563EE27CF3C4 ZACKARYWYTCH
520,485,291 *352B8D43A37F41C3CB8562468BC84EEBB24E023D ZACKMCBEE
520,485,292 *352C93AAA1E2DCC084F69F828343EF5DD81D388C [email protected]
520,485,293 *352150A5E4AD67C1776227A206A9DF6CA4B6A9D1 [email protected]
520,485,294 *352DEFB1250D307BAE3FE2DCA030A4E27B51CC10 b&m7c
520,485,295 *3529767C4013A41D535DAC73EB0E9B63A7785A4D bobbyjing
520,485,296 *3520B7929E6107027F6FBABAAEE102C12E727A27 ZINTLEMTYI
520,485,297 *3525D1989BAAE2DE353050F44E35A2511576DCB0 boq_v
520,485,298 *3527D54C9BCA63A21FB52130B67834E6D6677F06 bournj2
520,485,299 *352B1D78639FAB84D4523DDA8EFB73260CAAAB6F ZUL.AKMAL.AWANG.KECIL
520,485,300 *352CD199C8C91A2ECB9B6FA7E2D2A883A491B8D3 ZW6T
520,485,301 *3520690DADF5228C9FB11AD5C6580C6210393C8B BRENTENGELHAUPT
520,485,302 *352F284451F565E0DC3262F6099AEB6D412B2D95 λαγεια
520,485,303 *352D903849A3733FDEAC9987722ECEC97A2A7BF0 BRICEBARREIRA
520,485,304 *35232C0DE5B008F6FACF69B42C5D21991EF3383A BRITTANY WOOLARD
520,485,305 *3524410CCE8AB4D8A55AFD65D8EB2708CA68A6E2 broderickbressi
520,485,306 *352FE03620F7AC1A9A2E6A3B3FDD282D5E74862E brodericksansotta
520,485,307 *3520125AB25A71057F26C11B7C96B0648E3316AF BROOKSPHILLIPI
520,485,308 *352C1BC5BBDE28ABD6CAC243F49AD6AD092F46CF broueg
520,485,309 *352695F9235A5AB8749954D013C6B939C73270E4 BRUTAALTJE!
520,485,310 *352513414B55FED8578544E512BE80C4BDF3F2AB bsolt
520,485,311 *3529F19CC2E157E635537AC37E3DD9718BBD67FE моравицка
520,485,312 *352CE98AB0A540933B973DFE5EB9CF833CDD0F1E BUDI.SALMAN
520,485,313 *3528DA0FEDE6A70AF01693B392CBFD3B7A16517C остналите
520,485,314 *3520F0A0E531C3246A94FB49111D5CB60BEF3066 CAIROEGYPT
520,485,315 *3529AFAE77379E93286B420F8DB6B8C219156554 (対処)関係を把握しました。RUSK
520,485,316 *3522E8753E6274EAC5F7FB4A19BAF8BB3C179CE2 [email protected]
520,485,317 *352A30CE5DF44E37A4A510BC9D2CA05E230F4B3A CAROL.CINKAN
520,485,318 *35222743DDDF464BE9645A3D2D78F1283E13CFF7 CAROUSER
520,485,319 *35264DF5DFE3953AC985719BE8D735172782E336 catechetically7
520,485,320 *3526B990FCB1771F9A82D5FCDDD6F0A4F916872D c)cs"
520,485,321 *3529844641ED738A7D3C0DB46405B025CF754159 c*dr
520,485,322 *352397E3CA6A99BD3828E06E3A4BA61FE57E1CD2 c::.f
520,485,323 *352D7A6E979C934122CC90466723F0495AD9714D CHANG.DEJOHN
520,485,324 *352672B7BDADB7015C8669DE109996CDFF9F0BB2 changes160cronholm1
520,485,325 *352628D927F06A0C8E34F228A142D9BE66253D6D (00) o~ O~ d===P
520,485,326 *352B98E38B8CCFE0F6DEE8ACEBF67701C21236EF chaunceymunise
520,485,327 *352D2AC54507AE5631983A08E83B177C6EBBCD76 025COLBY
520,485,328 *352E466E677F7A6F9C468363B75BF4A020CBF680 047RANDALL
520,485,329 *35210D8B2342EAF9800EA127E818BF83F305A8BB CHEVYCOCOS
520,485,330 *35244745DDEE759DCCBF99A2CC57D202E6EB5F6C chinguero7
520,485,331 *3526178FCD8D9F24EDFDE4796635E02244347D9E 09111533
520,485,332 *35295B01C7FB0A0225BB691EC64BB46FA35D88F4 CHRIS-CRITELLI
520,485,333 *352172810F447F8BFB9B0BA14069451A546D9A97 CHRISTOPHER.ANCY
520,485,334 *3523F88B0B119D714CCAAE200F60B0D987EB8411 christopherlavanway
520,485,335 *3526B6B0DE9EA27179396DB19EEBDEBC62FDF909 10-HIMMELMAN'S
520,485,336 *3523562177CBAE4C4235851E3D4791339ED3BACB ci3;"
520,485,337 *352F6BEDA23CF018D7061EBCBA6E3171B6ABCD4D ci_5e
520,485,338 *3524473304E898E8A0319429D0CBF1628C50E1BF CLAUDIO.RODNGUEZ
520,485,339 *352851C35D9D850A3D9438DCBC9204E92AA5A8AF 1749647 kurssi-4-:-rosendahl-saija-ym-.-.
520,485,340 *352BC30547BB716C81F66128745FC3BF77B62A2A 1780913 NYT NIIT
520,485,341 *35228AE7A2E7351671286877AF1FC670103E456E 17SEPTEMBER1322
520,485,342 *3528B6C9BA03697B3C53923A853D237519FAA60F CLEO.GAYLOR
520,485,343 *3525A307AC25C1FBA96AE47527435F98F1636718 [email protected]
520,485,344 *352093AA1DB969BFF2486D9A4507845873EDE28F 1991---1996:-THE-EARLY-WORKS
520,485,345 *352E5AC7D3D17A156F6C9AC8656920E0A2A2F5D9 CLINTKUHLMAN
520,485,346 *3523CAD8BE55FF32831A19B73BB34CDFA2DB9C4D 1AELVIRA
520,485,347 *3520A2470E982D31D29DC295694EFC84BE0ABC25 1-AKTIIVIYHTYMIKSI
520,485,348 *352ACA655DC0FB76AF77C1E2953787EC21E47B21 1.back-buttoned
520,485,349 *352CE366F623468A687099E3712B0FE7242635FC c&lzq
520,485,350 *3528A111C78EF2515B235FC057CDC768474CFFB1 1 HERALDJOURNAL'S
520,485,351 *352B1CFC594C40FD9969C60B83015BA12CC50DC6 1.hypo-haus
520,485,352 *3526D5655F441BAA0D9247FAB805FB43699D3DE9 COLERIDGIANIA
520,485,353 *352FA5549F835C8D53651EE5996D373A02C1927F COMMUNIZATIONS4
520,485,354 *3521C82E72F9F4386C9E8B4F0A6F82817A1C61DD CONCEDERCIED
520,485,355 *352AE9C3A5D8C28F29B4EA3B5E7E28B9909D923C 1NTROSUSCEPT1ON
520,485,356 *352CD343CC52573FD8A8A4587FED0D734BCAC5C2 1-PARTIOLUPAUKSESSA
520,485,357 *352F5B9E3334186BDA576BBE2EB0EDA3FE260053 1safe-guarding
520,485,358 *35273A87074E3EC42846F7475F44E81304548059 CONSISITORY
520,485,359 *352ECB29DB7DE8792D10E8DEA10EEF8885C71D7A cpa:
520,485,360 *352B8392357FFED19783161E72306DE9D5503C36 2-ASIAKASPALVELUNUMEROISTA
520,485,361 *352D0192494010A95695B9177F943D8EC5806671 CSbV
520,485,362 *352D324B6D0E4F3E209F649DE637CEE1AD84FC94 2DERANJA
520,485,363 *352CCFD893E1B7D539C2870EA57235F7E438BAAF currents
520,485,364 *3523161BF74771A35A8E6D73212F66E1925D30A9 cuwg%
520,485,365 *3524F7CCD5BCB8276CA8F32E2A5B7AC83C6356CC 2-KOIRAKENT
520,485,366 *3520B1CFF97A87C1FC5E0B475B64BCD5F06B5320 CWCCQ
520,485,367 *35288D5E182976E27A7B7AFDE8DFD4151E3160EF 2-PAIKALLISSEURAKUNNILLA
520,485,368 *3520CBA2DCAC11883F0A1BC0C906F181D8F610DC 2PUSSYS
520,485,369 *352E5FB6A00F4007C3BF9588503DC494EA34E8F7 cywx
520,485,370 *35297171C04528017C758FF98BEC05ADD05FC304 d/3t
520,485,371 *352A03D70A456B81547CCBAC4869E7667AB66C6C daehnesos
520,485,372 *352531A4E6C91B41C3C0EFC97ECF390B205478EB daererof1
520,485,373 *352BDC4CE4A05F6832062AFE488EB76A0E71F6CC DANAH.ORG
520,485,374 *352FAFA90FDB57EC707538DF5C3FDDD0A6532FF6 danatoyt
520,485,375 *352630CDFF514573B6796104754953AE6002B2B2 danielzavala
520,485,376 *352A3FD94F6964297E13B6C02AA146AB05921C5D darellmunns
520,485,377 *352AAFC69FA00BAE5C55E33D1C96BE1604028613 darnelllicklider
520,485,378 *35249CD06524443A3B9138DE9F453BA36DC6D34E DARNLEY4
520,485,379 *3521ED6BA6FE9539C3534874871CA6B09ABA4D06 dashaleslie
520,485,380 *3526F04071F04158FA307B87733E8641BEC4F0EC db:.)
520,485,381 *352108CE87A51A4D090737741639B3B7EFE57F9F DD&K
520,485,382 *35202D551B02B949642E825232B3C2A4EB9E5D54 4HARAIMOD
520,485,383 *3524E3EE4FB3D64EC7877F6FA346E9C164454556 dd;y9
520,485,384 *352F052A7C196B00249FD768EA77CAF5722E0781 debollar5
520,485,385 *352A24FBA522C9B58D3A12D99B85F7766E5213E5 Deb.Stallard.&.Patrick.Drews
520,485,386 *352623E3A617786B1D57A25CF9A9A3F7E2C9F0DD deckskrane
520,485,387 *3525A54D529A5E251CAE673DE4F2BA3F98D98F9B derry.grehan
520,485,388 *352447A11EB634FF29B63D8CDD74455027CC0E6E desiree.van.der.merwe
520,485,389 *3523CB47547748B9B273019C4F7D4A0A06DB9B8D DESMONDALIAS
520,485,390 *3526629CAB761F1E1D57EED840452BF51481D778 DEXTERGENIS
520,485,391 *352840EFEAF70F3C24D0F3E9E7CCCF5EF98FBB0B DEXTERMCMANAMY
520,485,392 *35295BBFD77F265755BD62E2270069A8A627F232 dezfm
520,485,393 *352D29A4FA89EDCB05B70AFD56C2CEFEB983C006 4.tukikohtansa
520,485,394 *3527F2F48506CEC8A917AC9B46461FB783BA9C78 4 WOCHENPLANARBEIT
520,485,395 *352ED0C164D288A17C51EFDC275F81895CCC8423 4XCOUNTRYARIEL
520,485,396 *352B28B7D21E001A60DAE0E726EBC0360C02E193 disciplinakitschme
520,485,397 *35270BE5B05B0290337276C5176A29D4B69C716A d,kb#
520,485,398 *3529AB83850C29A39907CFF05DAF7C86C778649D 5GHOULGHOUL
520,485,399 *352C81BE858D51129CBC5D6DC9BBFC40D32BB5EF 5IAMDANCE8
520,485,400 *352590834746B7A6B7909F681D0D8B1C65DB60CE doctordrug
520,485,401 *352047E88EE43DB2F70F34DA6DC00A5DA6AE8B60 DOGOODBYSTEALTH,ANDBLUSHTOFINDITFAME
520,485,402 *3524C069AF5E0941F589E37C6FBC6BCB2280A47E DOINA-AND-NACHSPIEL
520,485,403 *3524DFE7AA0F0300BD7620A1FF07C4D6CE06A5F9 DONGXIUWU
520,485,404 *352DD268B9F16D82B45CD33F924FA149934AC360 dovja
520,485,405 *352338E958658C9E2C2664EE4803BB4D94094875 635564 birlik-apt-.
520,485,406 *352A64F54C4C132D6161C1B193C935BD83CD4D56 DPA582A4
520,485,407 *352E46CD1FD292739AE4073A506F20466A20F7E8 dqil
520,485,408 *352500D806596E250C2B2FF1E6132586B0AA85B7 69A空対地ミサイル又はAGM
520,485,409 *352C1F4FAC8B7883A89396A99CBFCE76864002C9 6BONDESSON
520,485,410 *3525DB0ADFB35ACEA1D267183150DCABA5B74582 6BSWFIRESTARTER
520,485,411 *352A9FB3607F55CD21AD0569CC3A7507389B9F79 DRPV_
520,485,412 *3525785E374CD906251442FE9E81E9B7BF5FFB5B 6GEPROKLAMEER
520,485,413 *35227E79A094AA1530848E89BEA767851D1A30C9 dr.xm
520,485,414 *352F3C7D54BA29AB6064FBB3AADA8C27CE485D21 6KOKRHAL
520,485,415 *3528B27D07F807D2685D562CF9C50C098944AB07 dufpd
520,485,416 *352D10909A9B3CC3F0CC446EA7F85E77A2E601BC 6mydillweed9
520,485,417 *352AF8E447151C855B91F0FAA1B8775665462C00 6SHUILIEN
520,485,418 *352F1CC156FDF2BC5C5C64B353918104C2D64A7A DW&P$
520,485,419 *352C25665BF8D439F5A49DD77699CD8AB1887E26 DZEMY
520,485,420 *35259BC8F30B1ADD2DD84B4AE93762DF29E15AFC eb7ek
520,485,421 *352E0EE514F16E491BA8BB644F532F422465152E 7BLEIMEYP
520,485,422 *352F3DF980D8FD2AE0965A0303D5FB169E0F98C7 ec(;$
520,485,423 *352796D36C7303090BD057C715CD3E38808E54A6 EC3P
520,485,424 *352167FBBB06A16303E8D0D69AF1D93F13F098CA EDMONDSCHAPIRO
520,485,425 *352CD92F2090091896976C087C7B15B371D7D409 een%-
520,485,426 *352997583187625BCE466D7829F2728B323AF871 EFRAINNAKANISHI
520,485,427 *35216D1449ED335F23D8273E08D63F5D2ECF2180 EFREN.MARCOGUISEPP
520,485,428 *352EA69546BBE52B2360EBEA6CF5D3C71CECE773 7NARKWTIK
520,485,429 *352103F9A5C98DBF55C8625FB7DFA1DF0F8CAF36 [email protected]
520,485,430 *3529FDE3C1FC721B97DC0740AA258B9EE5F4CBC4 [email protected]
520,485,431 *352E30B57540AF823FF9FC4FB978C9FB1B3F38D9 7 NYBERG
520,485,432 *35273841D22B5FE18C0D0D3495911753963AD89F 7october1586
520,485,433 *35217360687D299EB65593EF07C0F99EB32B690E 7SREZILATROMMI
520,485,434 *352058C3F156A4C3C25416C5910BC28F3148C29B eif(
520,485,435 *352200C45D424500EA94AE905BE6C4E33BEAAA58 ekpaideytriwn
520,485,436 *3526C63EC0247BB9276040C1C071E6A3364B28B3 eldridgeantosh
520,485,437 *352D2CF6E1B6AACAB2BEF1F9D95B7EEE8EF53882 8ACT3RI0L09I5T5
520,485,438 *35218069138B0563C5FEA63BE492F2EF8339BC94 8BSWEUGENBSW
520,485,439 *3520AFEA1C8E6E9AB38356D23FE4D6F0281B7523 [email protected]
520,485,440 *352F5982E2344322771B75E9CDAFDB09D7B9E2D7 ELLIOTTFORWARD
520,485,441 *35214071BDC133C2AF5F4DAC6B91E7A53D4F543C ELLSWORTH.MINCER
520,485,442 *352F66B76B66242998BFFDB9C014DEAF612E3D73 8==D.~o.(^_~)
520,485,443 *35257031FAA1084436260B0FEDF658B682BB7A15 ELMO.PALI
520,485,444 *3529AFB743FAA8BF718C2DEA5CE8B03728DE890D 8D~O(><)
520,485,445 *35267001B8F1D1421BD3F198AD7D88603A9FE081 el-rock-es-mi-forma-de-ser
520,485,446 *35228672DC439CD2D46A7B5EC1D6DF7A3592D2A9 EMETENEN4
520,485,447 *3522E514403623C8E461D880ED9070539177C784 EMILHELMICK
520,485,448 *3522980BB7E5DE666141CEC28B59DA8876CF4C9C 8MARTHACRAPP
520,485,449 *352D3D0D93540E40E93BBD5F5249BF394765A782 8NITESPARKY
520,485,450 *3522297ABAE55F8D0999B4379BC6C449B8B3E3F6 endoderm!
520,485,451 *352FC4B2E694F4B7A54B903E33ABB74BE4E84271 enjolem9
520,485,452 *352EC6608FBE4EBCB87C120BA8F7B071ADB75BE4 ENRIQUE.TOLLEFSRUD
520,485,453 *352105D8F2053AD4EECD61171826EE7CED0EABEA ENTSINNEN4
520,485,454 *352036C24465390C570763A36ED74835F16E5297 ependais6
520,485,455 *352CAD040BA1636D1849F0004B893E7B05BA9D05 EQH(
520,485,456 *352C8C02558973F5BA4BBFC2967694FA1C0237E0 ER=l
520,485,457 *35254E8F20E7BDA3292D320278E72ACB5F000657 ERNESTSCHWARZE
520,485,458 *352E576FAE8FE9CC83BBCA4A453BD0025B24712D erwinnoia
520,485,459 *352B5539326AF670650C79E53074A22B40EB7794 ESITTOOR
520,485,460 *3523BA87BC5D1EF3FBE2A591E3E918BB67A28D85 esterelenajok1
520,485,461 *352242ADE32534C942337CBDB729108587F71641 ETOMBACHER
520,485,462 *3527A72CE70D872837BB139B05857B6CF4A7EDA8 EVERETT.BORZILLO
520,485,463 *35248EB6604B2A15D45EC56E72ADD0260C3E1DAA everettgorell
520,485,464 *3528D16E08C4FFE435F1A64436E38555DAA6AB0C 9CALIBRABA
520,485,465 *35233F8C1329F0A3B4BEA92F6DAA8B94FAF8E49D 9colorerais
520,485,466 *352FE568F715F0B816DD15ADF59688A13AF3BFC2 EYKAMPTO9
520,485,467 *352735FDC6F4DB4A3D74A665769730173C0076EE 9gedeund
520,485,468 *35229E60B4804EE9865BA50BD18B165F0BC30026 [email protected]
520,485,469 *35216C3A74118BC89D92B7E453D4D1B2EE8EC5DF 9MAZORRA
520,485,470 *3523F96B8108A5EA8C9A65AD004B0AFB3E96CC78 fa.perez
520,485,471 *352B45B158A7937D350EBC80C4D7EC8EDB5ACBC5 FARMDÄMME
520,485,472 *3521B1944BE838F3505296D5197FB84BD9D406EE FARSENE!
520,485,473 *35293D276741B9461EB48F26F50DB97CB7CE5E8E FCENDY
520,485,474 *352F03D54FC96CC35C0A6C7F6108D644FC69FEE6 [email protected]
520,485,475 *35253FE58EAE36197A8CF0FB5D20C55A4AA8E2D4 9REHEARSALEDITED
520,485,476 *352D1401E78BB6EA682CBAB73375A2CE2BA89F1C felicia-stevenson
520,485,477 *352D9513643BAFB547DF6AFF779DF2700AD60E70 fellowless8
520,485,478 *3521B0A3281CD2DD0F78AB98F1D733BA72C22EBB FERDINAND.LAJOIE
520,485,479 *352D1C2C22FB5191DAA39316F10CA5CC121265FD 9tabarets
520,485,480 *35213638FD92C7528F8C5D0DAACE6D660C721A96 FIERA FARADIESYA
520,485,481 *352B8A7CB85AFF36798CF6CD10461203A2869F9E FILIBERTOGRAGO
520,485,482 *35233FC589A3F7AEF32A8AC2AEC48A100B842215 9TTIMHCS
520,485,483 *352AA19AE436AC38D56703840737654C92DBAFCF fimuni-linzacatwww
520,485,484 *352BA24F59A4937F320AA63F1554CE7270C3EE6D 9VERGEHENDE
520,485,485 *352329110D9E4ABD7A214419B1961E7F362F371C FIORILOVE10
520,485,486 *352EA887020DAE8743F213EA7B77B8086326B8E3 fiscally,-fiscals
520,485,487 *3528BAD962DAC56AADD43DB8D5F0714BD03C766E fivewayfriday
520,485,488 *35276E0A17766348CFCC090BFBC5026F151DA9F5 A=2MO
520,485,489 *352036C8C459F1A8750F716641A72F95E6AE8830 focusiing
520,485,490 *352ABBBCD41BC35B1490748B7AA00CDBDCFEDB1F FORRESTKULBACK
520,485,491 *352677A51FFD48D5C0951C4E4B4EA9B38B0F6C38 FPR;
520,485,492 *35236BBCB9E0A22521619514B062EAB229B2ECE0 a9q1,
520,485,493 *3522A282886637CC28FAD0A220A5D03C512C32E0 frankie.novak
520,485,494 *352E70988FD8D1C6C650564AA0D3E02FFCB8DBEC FREMDENZ2
520,485,495 *3522E4ED8C0BF0E9FF21AA72103666C1F98002BC AAKNIDHA5
520,485,496 *3522D0B970DC798CD4ABEE3FE3D84AE36BEBEA78 aa:yr
520,485,497 *3528999A2FCACAF0E0F8E9199E75F0DC93BDA2BE ABESSINIENKRIS
520,485,498 *3522E3E703AEFE6CFE4A9D871F897AC8577A7F6C ABSPERRVENTIL8
520,485,499 *35202F3526DD285820DD96B493889D8ECCEFFFBA ABTM
520,485,500 *3521DFB614B2F259DBAF66A02BD0427ADB59DD2F GARYCAFORIO
520,485,501 *3522811A97C16621540B161E9337824AC4A929C7 GARYLUCY9
520,485,502 *3527C88F3C20E43C7EA49F47090D93AA601DA6A2 adalbertoguntharp
520,485,503 *352BFF4215B94341221F87A435DB10BDC2E13235 GEOFFREY.SCHEPIS
520,485,504 *352D3FF70514844C97DAB7AEC7E15F245E6B2C4F ADAM.RUYLE
520,485,505 *35296477FB10631F7E929701F5387C053A15A7D9 ADAMSMILE
520,485,506 *3528DBC6A12A7DBC0F22C87F6D0AEB7FC56C05F8 GERRY.MACALINTAL
520,485,507 *3526BFA3772986B1D12AF2DEC5522203ED418922 ADNUHSARC
520,485,508 *352CA42A2CE9CE26B977B326ABE9E6DA44754811 ghostranch
520,485,509 *35299B86A2205BD9AF788E7F77BB0C204D70446F AFFARPOS1
520,485,510 *3527E84A7F6A864CC81B7648258FDE5243234712 AFormalFunktion
520,485,511 *352062F04D785C8D9C063B7A27338723C5734339 ahe6"
520,485,512 *3522542298859A7958E404FC982BEAD90DC9188F greggfournier
520,485,513 *3525E91FC639742F758717B1318D551467CD5B56 a+ixa
520,485,514 *352C5273F8AB2C8C1375D1CFF5323F91B84C5E5D griffinhed
520,485,515 *352E431658F540243AC2DEEB23E6B563E9DF7AAD aldenkotrba
520,485,516 *352CCC5219C6C93655A7AA4D8BF71F1ECA78C1B0 ALDENMASCHIO
520,485,517 *35218920F7F9EEBF16432B0473643E638C400D93 guykiehl
520,485,518 *35298016D51EABA9C7386A36176576D723152B74 gymm11
520,485,519 *352757ECFED8ECA862CFAF5C01680440AB4ABD3B h3lio7ropic4lly
520,485,520 *352E0DAC9376F818E21F70B562F4B814F01ECEB0 alleging
520,485,521 *352749C9EBC9D04F274F7F5F87C94B1A31E92920 [email protected]
520,485,522 *3520D89DB9AD19AA0F5ED9BD4608CCF7666286B5 HANK.KLIEVER
520,485,523 *352D3FF8BCC0F6B2097754133F716818D1D7B655 [email protected]
520,485,524 *35234DFF954ABB115EF5C52592B8729EC1E6C1C9 harastap
520,485,525 *352373947E95C03EDD942BE6AFD9D97C82524058 al;ml
520,485,526 *352E610C2906BCCB502A5D5310CB9B8B4DF70830 alpu1
520,485,527 *3521E3AA1AC61F54C2AA414EFE7C3F28AB91A1E7 AMOGAVEERA
520,485,528 *3521AC2C6234260F4CF7CE5DAD6D4A0AD26EA46C HELEN19103
520,485,529 *3529A262FA5AACA23F710DD7C9527A1456C60892 AMRITA THAKUR
520,485,530 *35254737B9E9D81439F1F3EDAF2CA53FD248A5A1 henryhoelter
520,485,531 *3521C02D51C510D331BBB098F841EEA48BE023CA HERBERT.MEZERA
520,485,532 *35257B4EDC108BA1C2F90FBCC0092E1C12A3BE69 ANAMARIJANOVACIC
520,485,533 *3527239B7FF98B0DE84E797FA6B6E8B450292C7E ANDREA.JOCHIMSEN
520,485,534 *35222C233C255FD0A686FCCF7CF7CF4B04C80A10 ANDREA.MORFEE
520,485,535 *35267997B4CE7C0C14A9CA7A419AE9735734FC14 ANDRESOCHWAT
520,485,536 *35260F9BE48B7A0F2FDFE8BB91617DDA5C369184 ANDYSHELLAM1984
520,485,537 *3523C042F19F821EBA0D3FC9F5F44F12EBE92901 ANHELOSO8
520,485,538 *3522E53FB3A83710952D0632FFC000D4F0CCE4F8 ani.e
520,485,539 *35252DC53DE4259204D21CE472C222B69B5C66A7 ANKD1
520,485,540 *352C0AE3BE6A962D158C77F4CF69D233255BAAFF hiccuphiccup
520,485,541 *3521944E52FB766941E27BA77E77A8889DA4C926 hmcshmisiapsbsa
520,485,542 *352F79414ABD090CF2A10A29DD41B717036CF419 housemotherly?
520,485,543 *3526C3F2CEA641314767FC8755DF28A77F67A7F3 arabiki-dan
520,485,544 *352D869463EC3E3F7CDE7F00D7EBAB77894A8BEB a%rj_
520,485,545 *3526CFB4A5949AF7D17063CF123CE7848161FA5D arnoldberg
520,485,546 *35231B9D0CE1D70A08608D5659F9EE37DD451145 ARQUÉOLOGO
520,485,547 *35221AE74F3DDBA8DBD6C8C4E10106DB60BD7369 arronhepa
520,485,548 *3525A1980B344B1193659909BA83BFB92A72E66A HÛSVROUWE
520,485,549 *3526DD8C9F978CBE5E91FAF079D62FE063F13E46 asbcr
520,485,550 *3521665A81976E8A54F999033E1B71B291EF23B9 ASHLEIGH.ILL
520,485,551 *352F6DE23A40E0E5EACFADBE0367DCCE9178766A aslio
520,485,552 *3527416F304E8509AC7C85F2BF10C4BA10E36B4E IAMXXX10
520,485,553 *3524C3DFF75966FE26B2F6DE42F50F272F66BBDE AURELIORALLS
520,485,554 *352AF1E7F16DFE3D6CA41B2A83500F911D2E8B4D AUSTRALIANMUSEUM.NET.AU
520,485,555 *352CB41843C20B0DF27441E89FED944D7FE4BBBA automaticcoatingcomwww
520,485,556 *352657AB4C7DEE74755297626621B2AA2C58EBC9 IDDERFFAR2
520,485,557 *352222778904097A4A85540FBDFFFE0114754383 ihm113b10
520,485,558 *3524ABFBFCE1DD8F77B3DDE6F07EE0E729AA77DB AYDIN5
520,485,559 *352BA4CEE5DDDEF3F89A00EDD6447E2A924C65D8 ILOVEBIGMAN41
520,485,560 *3520D3CC7FFA982934255D8C53FD39BD3CD042F2 ...IMMERWIEDERNEU!
520,485,561 *352BA526C2E5D292D3A6067443909283F12C6046 in+39r4l5
520,485,562 *352FD66E2D0AA16DE871520A363CB9CD9C235ECC BARB-LEIS
520,485,563 *35295CAA023DB9B93AC634F69CCA94DAF37115AA INSYRIA
520,485,564 *3524914AF069B7D8658421CE9559FA82624B46D4 intensitätsreflektivitäten
520,485,565 *352984A272E956DF3A745F0B6E44CA866914BCC0 INVASION.OF.A.STRANGER
520,485,566 *352363D02A4A7364D32893BF0B8227C6C9D1152A [email protected]
520,485,567 *3521F86BDC231FFAA4561A3AFF1D82BF6A636944 ISAIAS.JUBACK
520,485,568 *3521DB0E8BB114D0C8F92CCC06065ED6AC837CDD isiahgreife
520,485,569 *3528CE57F3AEECDE6CDA67B27A206A2556072488 B&D%O
520,485,570 *352FE27529A7BF527B774F58E82EE5F3AE8FA9A8 IT-AIN'T-NECESARILY-SO-(ARETHA-FRAKLIN)
520,485,571 *35284A314D8C75DC5E0878B7D6973F308ED792F7 BELANGVO1
520,485,572 *352706186391211CA88BD531BD9BF0F6EA037CB1 BEN FLEER
520,485,573 *352DDB6A78B741A061365C98AC02FBD874DD3DFC BENJAMINDEGAETANO
520,485,574 *3524B6712130B29530535C5EDEBB0948E3C6D664 BENNY.DUKEMAN
520,485,575 *352F8B186D56D7BB747000BF72C475115ADC7C89 JACINTO.VILKAMA
520,485,576 *352BA6829A5F7438B870CDA5492E22B85F93538C JACKIERUECK
520,485,577 *35273F20D659A944ED13FF71FEA1DB909AF69B0B JACKIE.VACEK
520,485,578 *3521B1F4DED3009047C1B71A5B317E29E281FA83 JACKIEVANDENACRE
520,485,579 *352A9ADAC4FD0B1D99C4797F948B480AFF2D5FD3 jacksonblare
520,485,580 *352E9D6DEFA140167FC335FD6ED4D0097BA7C159 [email protected]
520,485,581 *35266491471690C3BC17197B72D0EA960ECF47AC JAMALKAUFMANN
520,485,582 *352E7E1DD6939EA427A84FCD00A70B18E92287EC B;Ew
520,485,583 *352B766BCE302C622D65F27B67BE6EA9902D9E1D birnen.1.0
520,485,584 *352AD7AAC725079119F40991E477CAF4483C247C JEEATONED
520,485,585 *352ED33D66429F0429FB0788AAD4FA19CE3B747E BIX.PENDER
520,485,586 *352558FA85C21BC344D44CC3F4FFEE27E4FBF23E jeff-spurrell
520,485,587 *352A92C89ED568B6CFD9558E02D68C1C01135A17 jenniferhegstad
520,485,588 *352858BA616FE84B90DA3BC3BB96829781C6C3E0 jeromystandrod
520,485,589 *3526E6A2ED45D10BB5716D6CEAC7BD5DCB680742 JESGORDON
520,485,590 *35227BD86DCD618D4419699BFD189412E16B8CA0 jesusblasco
520,485,591 *352C2BA59231ED9D0CB8194BE7B699BD5935445F bo=iq
520,485,592 *3524DDB2B8FFD3FDFBDE825DB5E7AC235888F5E4 JOHNIE.MCKERCHIE
520,485,593 *3521485C75240802C005AA4E91F6A82289523F67 bositt
520,485,594 *3525F57EB3EC387B231F1AF89E05CD84ABE0988E BOYDGERSHEN
520,485,595 *3528CB18FA90BF67C04342075FB49EED4F00DEAF bp2(t
520,485,596 *3529B52234A226C30A96AF1B6F80C71915D1B306 JOSENUESCA
520,485,597 *352C63F097E756843BEBE5C52A359CF13AA42A22 JOSHUA.MARAZAS
520,485,598 *3525F44ABD78D730712EE8980D5A32CCA125E605 JOSUEPRUIETT
520,485,599 *35290ECDEB8C3F123286E2683C9CF016A2AF6756 braeden164
520,485,600 *352FD50C4E6C2D2D1FD03FC7A821309644D3974F JUAN.BEU
520,485,601 *352B3538B48519B8A7130C5D862BD7BE8DD047D4 JUDSONRUSCHEL
520,485,602 *352816843D700CFEA890227FDEE442D15557244E bridgesteddy1
520,485,603 *352B058A9F21C6CA725A2EEF7516D63F3CF45739 kalamas8
520,485,604 *3526ABEA9064DF503E42BAF1024647D708AD34B7 KAREEM.STANKO
520,485,605 *352F2F62B2E3DF2D2FCCB82316FAE01F2AF6CB16 BRUCE-VAN-WERT
520,485,606 *3522376EBDF438AF480137B2EF1F08768C912061 kartoffelkurenes
520,485,607 *352300E0770E3F4593CBC87CC5E5D8583ED4F4A1 katholikoses
520,485,608 *3523B3BE85FE3758FEB8EDA06B52B32AF3ABFB07 keithdaisley
520,485,609 *352D3F189535835C82C0B941CF24FDEB184A3323 KELLEYSURRETT
520,485,610 *352E25A73730D79B0747EC729592A34A9536D077 kendrickastacio
520,485,611 *352E5FD391FB9F711220CD757F229BDDACBCAA70 KEVENKINDE
520,485,612 *3522E52EAF01FAB173F1B683427054CA83293A37 KIAUŠINĖDŽIAI
520,485,613 *352C767C3F6E9B08C877552B0E5E49A5749E226E KINGDAUTERMAN
520,485,614 *3527DAB7178CB33064CDA6042CE9C8EA6120964B KING.MACKEREL
520,485,615 *3525B352612A645AB20AA13489C4AB41E6E04216 b!ttb
520,485,616 *352003BD0ED3F4439DB552E416B3FEC43BD678B7 kn8
520,485,617 *352F444EA4BCD74DE62CE0FC1CA8BBDBFC2A7D9E koos-marais
520,485,618 *352F516226B8326685CCC235B5977E45F7AF99C3 [email protected]
520,485,619 *3529153B6EA39918DF5D23935C73D8B6BD918FC4 BUFFY:.FOUR.PLAY
520,485,620 *35219A626D668AAA8F9B5FD36984556A246CE572 BULLETPROOF:'-"THAT-REMAINS-TO-BE-SEEN,-MR.-KEEN."
520,485,621 *352D0F3DAE6DCC6DABD9336932F6062CFD77FC52 KRATOSANDTHESEA
520,485,622 *352C6541F42058C380E84562E5067D2E6BC21C3B bvhkm
520,485,623 *35225E8B4CF724C7FFBC2AC11A6B06D7F21368CA LARRYWHIBY
520,485,624 *352B4BCA2F9B019417F7821900053329A254284F la-Trestioara
520,485,625 *352B22D322384417FAEFA5404A0EE9E6E1A08C73 c9t5k
520,485,626 *35255F2CAD9849527783195896D2E25F78251B0C CAMABR
520,485,627 *352FE9E2EDC79529A7DBDC6B1AE3981F2E07C8B1 CANALHUESCA
520,485,628 *35297ED2BBB4EB14101995A83D94C37A678AB73C LENNYGOLDAK
520,485,629 *35210093EDD5B2068FFEF363DB72A520F76EC035 LEO.GUI
520,485,630 *352F703E6AC0FFE9580500CCE771C2AB8CD7563E LEOPOLDO.OREB
520,485,631 *3521B09112829261724B1272645593C30943C0AC carolyn-bero
520,485,632 *352FF63E3CDF0E817697DE2A7F3E6123EE30835F LEOROSSNAGEL
520,485,633 *352221263828B3050DB5C96AEB2DCDB301D1E02A lesterpruyne
520,485,634 *35215B7495FF6AE4AEFAFE649FF6CA06E8D8C091 Letra.G
520,485,635 *352C4D8FE882C69F33A894B796E06E913E0739BA CATHERINEACHIENG
520,485,636 *3523D334E5E947729E289EE65AAA256344CA8E9D CBBRVTF3K6TF9KKNYA0SNTCW
520,485,637 *352B32EC5C8A3433243708E087126662AA3B6D06 LIGHTBROWN.2.0
520,485,638 *3529864068C2914803F4B89B4D160F921FA7F59B CDQCD
520,485,639 *35270114C92AC0E58786840C1823FADEFABA1CE5 CDW!B
520,485,640 *352B15B02F472CAFBA9D89C625B9A1AE0A16A8DC [email protected]
520,485,641 *352AB7363DAC386642D7AC21FFF8C12801089E04 LIONELDENE
520,485,642 *352E6DE00BC6673A0896B8D8A2B5E9CE279235FF [email protected]
520,485,643 *3520D9395F5B94C4A34F2536677EC6E0AC59E38A CENTIMILLIMETER
520,485,644 *3526B68C5EC74ABC2B83132085C76F97956CE2A6 LIUTULF
520,485,645 *352C1481E7865492BE30772EF9006DA23D4F9C40 [email protected]
520,485,646 *35290CFE139B5CA1FD0EB59257A9AFE02449F7B2 [email protected]
520,485,647 *352C77298E040CFE0D309A5404E072C94737D144 LLOYDBURTT
520,485,648 *3520C57DB1859E48D2E64495325333178ABAB391 CFI$D
520,485,649 *352B6968F488370045935EB275EBDEF0016FD9B5 [email protected]
520,485,650 *3521A67763B392E75B8987E6F9741145419E8C70 LOREN.JAGNEAUX
520,485,651 *352FD2D4957A45B567CDB74C85AA96522689C3F8 LORENVAILE
520,485,652 *35271BD6806355D870B2D70572A44DF0957A1879 LORENZODUCE
520,485,653 *352D253B4CA567096CD10D480125FEB365E017ED [email protected]
520,485,654 *352AEEF244B4E0B0F8284A65538AC8DD0EA6D4B4 lucasborzea
520,485,655 *35282BB36C3A3E0E450227EC0135F763E429DD5A CHARLIESHAPINO
520,485,656 *3525A12736B185FEE1F836090D2DC635A36071FE LUIS.FEARON
520,485,657 *3529A323B4A7032DE18869BC84C6EE6C0C27E108 chashusar
520,485,658 *35237EA103E5D725F4C81731D138023A71792F12 Lunarium(feat.ChristinaSoto)
520,485,659 *3527F0799E48BF224DD689C5DA7158F58ACE4963 LUVAGLIOS
520,485,660 *35277A68C36EC7870B3BEBA6C353CAA6928AFE08 LY0037
520,485,661 *3520B857C1E3D3ACBAC423F3EF4365423349A3BB LYANNA.LE
520,485,662 *352E96B51D6E7437B6D8C4069CB57FB97412EAEF lylegaines
520,485,663 *3523BAD3C5C44591DAC25B329EBA5F43E74BDE28 LYNWOOD.PEDE
520,485,664 *3524485E0DDEFAF4E5EC89C340E656F24CF1D863 lyvxssmn34
520,485,665 *352B90AAFA1AC55ECB318627CC6814B60F7C0AF9 [email protected]
520,485,666 *3520DB2829F82B9B3FF6CEC298191550BB8BAC9D [email protected]
520,485,667 *352764D09DBA9C34D344A4E972E3EE679F5729D0 chjb"
520,485,668 *35214B59FBC2D3870E99BE6AD52F9759E6EB9FB8 CHOICETOP1717
520,485,669 *352F575CD3FFB31534350CAEBB0C29E1E9C637A6 magneticusa
520,485,670 *352E2E9E387D783F4D6389344715FAF59A2F130D christopher.fauci
520,485,671 *3529C6A64F1C627834765E3D19DFC7BB8F84FA24 MAKAPÉ
520,485,672 *352A8292785B82A2CEADD8449484956438335364 C&INW
520,485,673 *352EAE8A9D116EAF7C772BD3BA9779527B1CDEDD MARQADEH
520,485,674 *3521DB8685CFDCA3DA9962E58277751EF08BD4FC MARTINAXLINE
520,485,675 *352D8F13423A4D57BB5ADB8FBA6F598C663C458D MARTYLEDWELL
520,485,676 *352517EFD6F19CBE77A1C39933A4A0FE6F413BA3 CLEMENTE.SILVESTRI
520,485,677 *3527A251245C2DDEDA3657D7C88B3CCBF39A0F0C CLEOORTELT
520,485,678 *35259FBB2391B540BC1464AAD4F97657FDA9545B C=L+I
520,485,679 *35261E4482A146D67AD80E5CAD4DA969A485A246 clover-city-g's-(feat-jim-jones)
520,485,680 *3523B5211043C1B69FCC504B1B8EC66642BE7702 MCRBUK
520,485,681 *352C15A75539A11914FF6D23B683CEA519A34A96 CMINUTOLA
520,485,682 *352E29EE82F03A2E8D68B836C6D06AEBA5BD7FBC CMN&
520,485,683 *35201F1BD6EAD1599C5F8159527937864DB89DB2 METROID:.MINI.BOSS.ROOM.(I).~.KRAID
520,485,684 *352128DD364902DF07369AFFD4BB209252FBB444 michael-vito
520,485,685 *35227AEB233373D51E2CAE6AB940E83496C190B3 COLTONRANSFORD
520,485,686 *352A1CF0910DB6970C40A65BCA0E66A44B77ECA9 coltonritthaler
520,485,687 *352DC3AE97DE083C9E1CB82086852872BCA93AD4 michou30
520,485,688 *352E258BB0637794836A18C050C4C579F94EAFDE CONCEVRE4
520,485,689 *35295593178AD158E131CE6E643E4713D552E691 CORNELIUS.TISA
520,485,690 *352F367DDD1B498D320F76E4482F7BD54AE4543B COUNTRY:
520,485,691 *3527E6899CBFB1E640DE5309D579000B9654A461 MISNAVIGATING!
520,485,692 *352400F653B456035E78D26DECDA39DBD06B48D5 mm4ture1y
520,485,693 *35296AF8EB1C3A4068A3987A92BDB51F8FDB6D91 C:\Program.Files\Microsoft.Visual.Studio.9.0\VC\VCWizards\AppWiz\Generic\CustomWizard\Templates\1033\DottedVert.gif
520,485,694 *3520A99A8D2CD5DC5CD7641003529FDDD0CC319F C:\PROGRAM.FILES\WINDOWS.MOBILE.5.0.SDK.R2\SMARTPHONE\INCLUDE\ARMV4I\FILTER.H
520,485,695 *3525D61704D0901B10376BCBE7F6332BF1A69E30 CRAIG.DESERRES
520,485,696 *3520349A347D7FB999C840DBF91191F559290020 craig-hazelhurst
520,485,697 *352EADAE07C473883EAEB84BFCCDFC7CA5FA7412 CRBLLNGS
520,485,698 *35224B1D361B2913DB09447BB694A28E88FC2D0B MoodyandSoul
520,485,699 *352965EE5A626F496250E71F3B75F31C1129A489 MORTONRIEGEL
520,485,700 *352352E07E33958DE9E0D5F75E5F6253F224B093 MORTONRISTIG
520,485,701 *3528D4AEF0F9F5CB3DF2C6EE8CDFD6156FBFA77A CRUZSZACHEWICZ
520,485,702 *3528E67D446D5E51B2DA100BAB60F3D68A0D0B0B CS0s
520,485,703 *3525858BAFE4F7E77F3EC7F9CAB10EA498A5CBB6 c!sq&
520,485,704 *352C28607B533D3DC7655C995739FE56F0011FBD c=ua
520,485,705 *352DD9BA576B0458EC21C88AC201ED11F3677EF0 CUBA(EATMEEDIT)
520,485,706 *35286F9706F94AAC26D64B0DD19B0B3C4DC189DC cumpridas1
520,485,707 *352F926D543028C560A96F0C77E1F1324A9FA40A CUTTOE2
520,485,708 *352B16FC0A011CD5DA32057D8C6536FBCEB489EA CWENKZZ
520,485,709 *352B7F8F91EDFC874A24E82AC8237EB848570FB8 c:\windows\system32\dllcache\lprhelp.dll
520,485,710 *352F3952660323CE57B6DA23510335A32FC13A92 d?0qt
520,485,711 *352D7B9BB5E27AA7C084B0DA95FFCF62376B6626 NEGACJONISTYCZNE
520,485,712 *3527BEDAFEF45E0B5D40998E57CEAF595DB9344F nekirtne0
520,485,713 *3524B62BAEC7543330F7B1A036367E8B2578E2A2 NEXTFCE
520,485,714 *352CCB256EA76C10C7049560FC7C2F3C2F002FDB DAMIEN.CHAHAL
520,485,715 *3521B54FE933C9982E162F241EDB1BC82D4476BF DAMIENMAGNAN
520,485,716 *352C3959E8240C5F5BB2E00ADB22C580A870A1FC DAMONMAZZELLA
520,485,717 *352B01083B846DE1E1666D7255AE2333CA0ABB5E DANLIRETTE
520,485,718 *35269244E7229D3E5906812C46AA33969C8BA4EC DANNYGIN
520,485,719 *3522A4CF9B0A46CF062A85B7B35C56FD48503525 DAQ-
520,485,720 *352F08F4F8B12E6FFC2B1C911277C051C1FE4EF9 DARIO.FEHRINGER
520,485,721 *352805B4CB30890663429381B0FB0DE6F7241896 [email protected]
520,485,722 *352B37BBD1D9F7BCE0A2243261D1945BE1E90C4E DARREL KENNEDY
520,485,723 *352642BD674927BC4A5A165312C3284ACDE3C648 Nobody.Can.Go.Back
520,485,724 *3521C00CAA9297AB63C6A09E184E760598A74720 NOE.KEMPF
520,485,725 *3525154F6B49D77396860828C8904F3A8A98EA24 NOLANKIP
520,485,726 *352794E82FDBEFFBFC0CF000E8B33728EAFF0FF0 DARWINCROSHAW
520,485,727 *3529624CC7D81C71E80C65626058A803E90E57B4 DARYLHEASTON
520,485,728 *3523B885DA2D2A9B04587CFB9BBC4B8A8925681A DAS?R
520,485,729 *3529815CAAD68C129F2CF6FD51265EEFC1EECBAF dc"p%
520,485,730 *352A9F146D2D6F66B54AC08BBDA10DACF2921C3C nvm.iv.(taivaanrannanmaalarit)
520,485,731 *352665C7C0C2A204BF042A3F474D504F8E32D37A }o{~`-~`d------8
520,485,732 *3520E497274E383EF11E70A3DC666EFB798CF782 OILMUCH
520,485,733 *3524CB2674FD4A5E3482C63B69D3C99D905F21E4 [email protected]
520,485,734 *352867C86CDB219265BB9369EC9462049362C9C0 ol$baa
520,485,735 *352C6420273A1F263F100F6CA8DDA708BFEC92FC OL<F
520,485,736 *352414504CFA60B3AF0C387CC5911EA769A33612 DENNYELSKEN
520,485,737 *3525EE28A4E14922E96E5FC5B42B470C23DBBD53 o.miei.giorni
520,485,738 *35207EF154137612554417306887CE5E56B06769 DEREKBEISCH
520,485,739 *352FCC81F6DE126555A059765C8B12424C22FBA0 desp8
520,485,740 *352497BC6A4BA441E3EEF170A259E2F06BC56B9D dfor$
520,485,741 *352B79D29BEB0A33CE79F699AD79C393E898629D DiFA
520,485,742 *3527D73015F42E3F6587063C3540F3C9C93CD0BC OT=$
520,485,743 *352DA4928251A3A75FB135A0BA729334D6E1971F diso)
520,485,744 *35203CC95AE62472D6862730861C43F80FCAA735 d!l$u
520,485,745 *35295AB2B2DB54D17D0E27827D13F77333CB119A PARAMETER-ESTIMATION
520,485,746 *3522EB4401DD34E7322D54039BA4D4EFE9BE2449 donna.m.bousquet
520,485,747 *352F9001F53EE9067FC4E6EE8DEAEC6C5912850E parenticide4
520,485,748 *352CE1B581CE6CB7A0B4074CE400DCE9589CE8AE parlin.sihombing
520,485,749 *352818DF025A408F336D57236EFE85A877A3027E dora6969
520,485,750 *352B86B2B0836FD2E17551494100959B34D93182 [email protected]
520,485,751 *352031437BB52EED16EFAE250AF8CE8F12123B3C PASSOUTLAW
520,485,752 *3521007F2234EF54F71D13D720311EF164E94C0A dosidosi2
520,485,753 *3522BA821093700359D990DA5E2FBAF13168BF70 patty-koch
520,485,754 *352E64E2CFFFB9170E23C62D328A3111C5857055 doxv
520,485,755 *35275368C1506D8BF7485477342F970D41756256 dqil
520,485,756 *352F7EB994AD2A9F0D634E6338E59FB7113D4B06 DREW.YARDLEY
520,485,757 *3528BB12F905AC9CA91FF97C1F2A619842BD39B5 PERRYCRNKOVICH
520,485,758 *352A5B653A26950E748B2FB52CEE46F697BF9C13 D!RM-
520,485,759 *35234EA981B252D2803EBE58C600D0BF476EA1B9 drv3r
520,485,760 *352C4F9524464CB7C4844416B881449AF62C01A4 dubbings
520,485,761 *352FAC190813AA900733ED23741936F0792BFD04 DUDDUD.
520,485,762 *352561899C4602ED671DBC0697364FA9290236A2 dvh7o
520,485,763 *352D26E45BD088DBFA46496BBD33117E32830AA7 DWUF!
520,485,764 *3526C596CBC07F1D214D47137E56B4274A1149F8 “PIOJO
520,485,765 *35205E6C7F075871F7D0F8A8CC0D3959E9387B62 [email protected]
520,485,766 *35263A88B1035CBB4E0D1248BBC2273A2A45E0B2 Plume-Latraverse
520,485,767 *352AAC9252CE6F903B4EF1CA3EA01A304044075F p------>`~.)o(
520,485,768 *3522477529EAB54A4FD4FC6C6C37ED65DF8C9B56 poiuytenter
520,485,769 *35239C8474DB025D38BDA689EC0FE97F9171F5CE PP*.O><
520,485,770 *352ABCA38A4F097AE4408F63579EE0E4D3DB77C8 prelusory.
520,485,771 *352C7BB6BEC2694B4F1B1A859D2947536A7ACD27 [email protected]
520,485,772 *35244E22BCD8504A3B014C06964601D0997DA382 procompensation6
520,485,773 *3526FCDF66495A9ACB82CED6FCA8C9F78BACEC3A EKSEMEN9
520,485,774 *352ACE59F3AD50F240FC1CAEE39C9BB7847D1AA2 ELIZAET2
520,485,775 *352986D125FF18CC52D513CB89C1D8878D06FF92 q======d.~o.splat!!
520,485,776 *35289C565A0E1D168FA9D316CDED491FE87CF0C6 qmh%
520,485,777 *3520C05CD31789E2E5D79CAE051A749E0D29134E QUENTIN.DOLBEARE
520,485,778 *3520E496D1C4D24B81BB09834AA45F2F08A5C0B1 quevengasanpedrobolero(mambootilioportal)
520,485,779 *352C143020E9366135C8C1E389991C73CD51C525 RAHIMTPV
520,485,780 *35255E2F07782B91BA6F19637D1D4A0A426E41E5 ENGOUFFRERAIT4
520,485,781 *352BC326715DE7A985BA21F4A70368DB3DC48692 [email protected]
520,485,782 *3524C743C2A71B645D15076A5B249872704D3DD8 RAYFORD.BRASUELL
520,485,783 *35286C5EE92E42A8FE6F97593C9C3D481D511059 erasmoigwe
520,485,784 *35213DF0BD2B456219C15212B3486B582667E796 EREROLPX
520,485,785 *3529B8167554DC5D5856064BE73244F3D62862AA re4screen1
520,485,786 *352F13B69C4913130017B46D97D3DD0B0E91115A esparranc
520,485,787 *35289481985A151AAB6D5C42AD029555D161EF83 ESTEBAN.MILUSH
520,485,788 *352852D8C5A0594DD59D838B6146FC936C37AFB0 es-ua
520,485,789 *352E36E0C66049DAD5454A0EADDAAEDDBE9FAADF etiiangiss
520,485,790 *352623A02DCEE40B8E0A53EB7DD6327AC06A63C9 [email protected]
520,485,791 *352277FD478AAE16E9140B514FED0A94AB10CB16 REMMAHMA5
520,485,792 *352310C41C2538B51164193D273B164A3B791BA7 RENATO.DAHLINE
520,485,793 *3520EA6EC14471AD487996CDFF194FBD1DC40939 EUPHORICREALITY.COM
520,485,794 *352BCD855A30081D80F30DFAA53FAA1FB4B5E004 EUROPEAN.RED.MITE
520,485,795 *3523E97CF1CFCBB4D216A247640616B1FBC3B431 researchintouse
520,485,796 *3529E5B7474FB58F6BA8BE1FE56DC6276209579F EV'RYBODYHASTHERIGHTTOBEWRONG(ATLEASTONCE)
520,485,797 *3522DFD58573B6AB6373A1457003A5EACFB0D7CC REVISION-LEVEL
520,485,798 *352E18EC8763417A20E53F11283803DFCADE7D84 REXVUNCANNON
520,485,799 *3525EB85404A1EB4308907166A1BFE16FC4B254A reydzledzic
520,485,800 *352272681948491918FD03043CB34275545AE71C REYNALDOKOMA
520,485,801 *352E4A5D8DA10BAE0404D68B30157581A34751F9 REYNALDO.SACHTLEBEN
520,485,802 *352AB4555184FEAB75F281DAF248749CC158AA52 EYKT
520,485,803 *352E01B69DCBD2E2C70359067E784AEEB1A4080F faced7
520,485,804 *352E755BE6F336B70371DFE80DB16393017FA1EA ridethebee
520,485,805 *352790D26AE77B407CDB7D9B85554F2DDCD79ABB RIMINIBSW8
520,485,806 *3520776393EEEB2D59545A7B9BA0A5C3DD62DD33 FARABELLA12
520,485,807 *352995A8F0D470D0B8F1A994073B44DEC965174A ripkim11
520,485,808 *352B331AA64E5FCA911C08EC1E3D134364F78917 [email protected]
520,485,809 *35293919F74405B0AF9ABF41B95E2763AAE03860 fayez.b
520,485,810 *352244E4421078DB54AFEB5B79FE5DA7F8A74552 [email protected]
520,485,811 *352FA85D00A0345A706E557E86492C38EED4F77F FDMS8831
520,485,812 *352809BB682CECBD77106A820C6995897CB01C36 FDYRAA
520,485,813 *3525E4896A6045B49FEB6F257E07EADE35FE6373 FEDERICOWINSOR
520,485,814 *35262AD44EF504E126ED9D8D09B12B622BE263A0 ROB SQUIRES
520,485,815 *35246B2F95682794B81C91FF2C5631FBE39B2129 rocky-pallet
520,485,816 *35295D37F648704286004A8421F1BB1ACBD9924F ROGELIOISLAS
520,485,817 *352CB1110518B2D3B64D711277D0B738DF34B591 roiretxe3
520,485,818 *352BE4CD4491DAFCE17548B05E6FAAFAD0E1F040 ronaldhostettler
520,485,819 *3525BDC64342830CE0955534859083D5CB5DF2DE ronaldstandefer
520,485,820 *3524098B52B0D76202AC95E72D7912810E53CD7F roncallejas
520,485,821 *35228496876EFAACA0A58FED5718C2A8E1ABC181 fisktom
520,485,822 *352AB415AA23F56CB08CF26ABF8154100DBC3EA0 rorynicco
520,485,823 *352073AF8215F29A69BCFEDC50F67EB1D38F4A58 FOREVERLL
520,485,824 *3522F7A921DF79EF7F200A5E2591D1FBC8EC218C RUBINWORNER
520,485,825 *35294BCA5896C8DA7335B62042268E4A35706D4E RUELLIAR4
520,485,826 *352F2F42A047FF57BEB3F8305CBC04FD594BEE7A RUSS.NARES
520,485,827 *352C61F92AB9EB0DD74468A37EA49B954775F43E FRAYNE
520,485,828 *352EE481FB67C2D0F1BF1BB00675A64ED802295F S(740
520,485,829 *352B7895E65C547144152D12C01A8A77E910B066 S79959
520,485,830 *35255EB4E770C415B670FC3EFDE68F77BFCED2B8 :S-AAA
520,485,831 *352398F8A6628AF9F8F00A884EEB7ABC1D727BB7 SALVAISIN
520,485,832 *352958F6E723447EEA2739A0723671B4B89C61A9 FUORRY
520,485,833 *35292C484F24A87F4F0F5327085E9DCCFD72518D SAMANTHAHERSHEY
520,485,834 *35285FBA12AC0EA042FD4AA9684519DF5A860314 G*1P
520,485,835 *3520DD6B2D197BC1DC461B5AB2603DC6F2AE6950 GABUTZA
520,485,836 *352B0168FFF0FDC2E9332F35CF530D9D1CEB868B GARLANDTESTER
520,485,837 *3520D2887D3B97FF728EA531F4D174A7BD205000 GARTHJORDAN
520,485,838 *352FE8A6D792FF531F015338CCA264C9DA26704D G|BR
520,485,839 *3527A485F7EF32B54C05FC0A5962BB741AA2D8B6 SCLEYGH4
520,485,840 *352A38BD70C0C8B855064BEBE2E76D35A4D1F09A SCOTTY.RIFAI
520,485,841 *35228F57C7C23205F2419F2AF3D63CDA291D1AA5 SCRONGTRIWET
520,485,842 *352481DD5C350971FF9E8AB8DFFE146E9A16EF8E GERMANKREIG
520,485,843 *3527A4984F4D31D06DA52F93F8EE81AB1975ABF0 GERRYVOSKAMP
520,485,844 *3521C637A818FF122326A8038726C04E4AEFEF8E get.that.money.mayne
520,485,845 *352417A0086509EF2D252B9BC80E5454F4657D52 GIOVANNIRISEDEN
520,485,846 *352A3EF7354CE83BE523A24ACBCC040B06272A08 gitsefeb2
520,485,847 *35253215136EE79DA0DCEAABC33A9B30CD6D54EA glycemia-gl/aI/'s/i/m/i//@/
520,485,848 *352CD33E9370A7DC19E4D6854B39473F138FF054 goldschmiedewerkstätte
520,485,849 *352ED4E93B2CCE147653338CB958559C448A222D gordonmccoy
520,485,850 *352B95DF7691B5E52F86A6C713FAE58A36EC30B0 GRADNJU9
520,485,851 *352115EDF98C3869F8B8294BECB989E691D61BF3 (SERENBAN)。
520,485,852 *352003EE85BAAEE5E954C2B76DCD1C82CDE34775 shamiel
520,485,853 *352C33BE165896611454E4F91C21525384DB9893 GXUGQHVV39
520,485,854 *352921E4FE71C728E24E08FE4791ED755DE459AF shonjeffs
520,485,855 *35299277159B110A30A59E9830824B6E4225AF3D hand.of.death
520,485,856 *352B062F953D8BDA48C9D2569678251F9CBB4731 SILICULO
520,485,857 *3527E8C958BA017772A705ADCAE10102EB5DE596 sinetica
520,485,858 *352F6A660B8DAE059719893FEE522BC834A388A8 HAUSERERS
520,485,859 *35264BC4F93FA28FAB90D91ADA20E32FAD8B90BD [email protected]
520,485,860 *352B6D6B7F4EEFF79BA160FFE1952BA70A3F04C0 HEGONGTAN
520,485,861 *35203DADD096BE38A1610592696E4C2EB8616FE3 skotin
520,485,862 *352E5FF70CC5AE6766B3E793843E2B71888F93EF hershelrendler
520,485,863 *35254A2E5385097EE41CAF14DA4974A9C4AF0FA8 HESTNUTS1
520,485,864 *352537974293BCDA3B879665D0AB8C37CF210CE3 higashiyamanashi
520,485,865 *352F2063A20AC7FAB46AA532FF19B0B8A66AF6E7 SNOIREDIARTNE4
520,485,866 *3523E0563CFA7180B2A8A78FCC544FEF7217EC32 snootelet
520,485,867 *352B13C04E05803D95E2262EF2BDEECE5A55226A soapwort
520,485,868 *3529B12E50085D5C2A92CF440D500BBA2F735B3A hodaifa
520,485,869 *35220DE35EF9244E8F93312AF3805CE3DCB68E52 HPROTHO
520,485,870 *352C3CE3B37DCEDA7DC43D5615745A7F1D9A23EC HQA7
520,485,871 *352DA287AC1AE7E4A9B45BB70C9846B0DCD8C5CE HTNAIDAR9
520,485,872 *352520E71CEE8CBBA3899658DC5340B8F6C02099 httpwwwtrinidaddril
520,485,873 *35230A6CDA3DA185E567DEEAA5CC80CE78EF8954 [email protected]
520,485,874 *352F73F3B3627861BF5BC078575A866107DFBADE [email protected]
520,485,875 *3528004A6D8B5BA890D0A11C309EA69AF6828D03 SPLAT.O~.0~<3
520,485,876 *35241BFDD352395AC3EB5FFEF227D496F89B3131 @SS3MB1IN9
520,485,877 *352393236342206DE9FBA32BEDACA85EAB0BF67C i.am.just.a.girl
520,485,878 *35227329411AFE2EBF9FE4E3864FCB0DDB8D0016 STEELO(FEAT.RAGGAO)
520,485,879 *3523BD260C5218D780B2E3CFA15B2B4F62B77369 IGNACIOGALBREATH
520,485,880 *352D600EFDA3E2AF11C8343D8AFAFE82DE8BB748 STEVIELYNS
520,485,881 *352F69A51410FD0C8ADDA94374D583E040FFBDB3 STEWART.HOLDER
520,485,882 *352526D0D35EF444C19D3FCDA28F48A5E4B49BC8 ILMAHYKK0
520,485,883 *352A95D2AF8A12FE748681F02798F1CC5F075AD0 [email protected]
520,485,884 *3527BA694762AF0896031DBBECAB3B936B2897EC IMONOSE
520,485,885 *352FCDA96DE0AB0E2CDB4EB193260984C3E4F762 SUPLIES3
520,485,886 *352CED32A3B4321FF192311AADB6518D1FDB46C7 inthelairofthezombiekittens
520,485,887 *352CC630C8BD9932DFD725E8FFF232C33E70D338 SYMBOLNEWPASS7
520,485,888 *352D375084780A59A754C194929EACF02BD0D71C IRON_MOLD.'/AI//@/RN_M/OU/LD
520,485,889 *352828C6DC31DFD192B14A1D11B2E5A2BF6DC152 SZABLAK1
520,485,890 *35211FFC381118D4D3A062082DC15B82CF63E49A ISČEKIVAO
520,485,891 *35274E5D7EB3FFC59CE54C7BC58FD7499BDDCAAD isiahpennington
520,485,892 *352CA1152914E9DAC4488533352F2502C440998F ISIAH.URBANI
520,485,893 *3522A1883EA32858880EED71D7C410E06FB05A41 TABULERE$
520,485,894 *352CD49BD1765804A616ECB4970D4D354ED35D8B isrealohashi
520,485,895 *3529C9946180A272702CC88F8BFB2F8DFA23C0EB ISSPOLCONTACTS
520,485,896 *352ADF80024B3958752FE456443DEDCA0A4F9A67 IULIANPUSCA1
520,485,897 *3522D4E6CD064C6F2CB07CD476CE7651DA4A1E14 IVANBLOYE
520,485,898 *352601CC1D17748DDBE6C89335B0A883FF9EA281 TALK96239233120
520,485,899 *352E7B6A48CDD15DD37D91B2F4CB34DDDA4875BA iy:s
520,485,900 *352DC877856DD4F2A9744CBBBE7D1E42461BE9A6 TANDYRAYMOND2
520,485,901 *3522EDECE5C55B06A20BDE1A753A52F8F87B1E94 JACOB.JANEK
520,485,902 *3524FE9FB60E9A5C82B4363DEFFED85AE55862AC TATUM BRADLEY
520,485,903 *3525ADF8443B47EF09F902ECC0D43A0C665DCDC4 TB20018780
520,485,904 *352D0DD5F0FCD6DA6A079B5FCD61019F1A6F5B6B JAMESPACLEB
520,485,905 *352183C9FEDCF21A35330D31E06CFED593AE97A2 JAMES ROLLIN
520,485,906 *35219504FBC6CD0DE9F16F1C325820686F1D2C14 JAMEYOTTOGARY
520,485,907 *352E23F958FF8699549FDEA5ED475FE25CC0A1C4 JAMIE.KOTOWSKI
520,485,908 *352AF6CBDAEAB2D0BAAB2434FFF3BAE52A4D13D6 tednegron
520,485,909 *3525FC22B8D0179ADCACEF137389B6AC6FD7D1E9 TEISTE
520,485,910 *352183D552F2868138164F096F356E5BDB298537 TEOFILO-NENE-CUBILLAS-AND-THE-EXCLUSIVE-NATURE-OF-TRUE-LEGENDARY-STATUS
520,485,911 *352FBFEF6BA0D4A4139D644960F6A1E9FEC13F29 JASPER.LOHRMAN
520,485,912 *3528E3CBB1DA1C252BB26FBF7C59DAE81F9260E2 TERRI-STECHER
520,485,913 *3522EBE3932DE8DFBD9980AC0B504D0189364474 THADDEUSNEWSUM
520,485,914 *352E6D1A32B6871DCB2A2EFF2217C80E702207F1 JEAN-SMITH-WILSON
520,485,915 *3527389420583E1B9AAF339B0156EF5D8DE1EBBE the39steps
520,485,916 *3528B48AB48EC365DDB3CFB4853985078F3432DA JENNIFFERMEDINA
520,485,917 *3520893FAF510B10E577ACF4B4E02BD0285D3D62 JEROMEFOXE
520,485,918 *3527B5AC71358ADCC27637F82AE5713E6FF97508 JEROMY.WOLFARD
520,485,919 *352E6C348820265BF7BA21E2CF8CF3A6FB044247 theharvard36
520,485,920 *352D7C5A9A70BABD6260887D402FC578F836D683 THENADIA1990
520,485,921 *3523F4B74E21CC31699E1C56D3CB03FD7519E607 theodore-lopez
520,485,922 *352AEBEB91FA5478790B9E6B33BC53555117587D JIMCURLEYHAIR
520,485,923 *352245A247809569816E24877A0EF15E8CA5BE69 THE-SCIENTISTCOMWWW
520,485,924 *35244740F7714C8732D09EAA0650C8747DD036C6 JOANNEFRANKBERRY
520,485,925 *352BCE7D03B218EAD71240A3113C8C0EDFB67EA9 JODI.MCCARTNEY
520,485,926 *35222098D9322A4ECA8F91A7C6567553E0A053CB thieving7
520,485,927 *35268A9B2DCD9733DE1B40D3CA8C9D38C04E1EFE JOHN MICHAEL TURTURRO
520,485,928 *3526CE7C6C3F1E1B6BEA5A156FF6B1CB1E5369B4 johnnymeis
520,485,929 *35258C4772D01609AF8258B46A69D0C3A8AB458A john-tunney
520,485,930 *352E7E4D78C1B49E9AC95149F175DBF8767D26FE jomarierodriguez
520,485,931 *35259B36F912DCA56912776E7D2AEE334F88C382 tikmperes
520,485,932 *3527ADA1B1F9B828F115A16C1E4C712CD57C781F tizim3
520,485,933 *3523E6062B12FDA83F8417BF5463995C1FBA1101 TOMMYWHARRY
520,485,934 *35266F8B4E0569EBA3C1127861D37CE53758E3A6 tony.carpentier
520,485,935 *352D6720D31CD66F68F857157E92B183A2E02B66 justinlucek
520,485,936 *352E6711D32F8C920C0EFAD0BAA0830551B916C3 [email protected]
520,485,937 *352C43E048DD20B9D95F6FD9D0C7DCC33FB3BD62 JYOTI-BASU
520,485,938 *352275CF2ED604E844B2FD40E23970958522B1DD tracytollefson
520,485,939 *352BE84A6219E632C4E55C6D0784C57CEDD7F266 trapasser!
520,485,940 *352B9D5963A257435EE9A3CEBB7CAB7C9FC6AE78 TREIKA.HAWKINS
520,485,941 *352F98FECE658462F35C376B81F01D24BD5251B6 TRERSFDSELSDAG2
520,485,942 *3524F4ABCB8837830F80A4691CD20EC7218F0D1F KAREWAS9
520,485,943 *35281929662F3B057AC8EF490D483536BA8F38F4 KARL.DITURI
520,485,944 *3526FB41CB2D71D2F96C90924452156FF9267BB7 TREYHEYL
520,485,945 *35289D298C5F9C2FDC31B68950E82A936DED1E3B TRIRADIATEA2
520,485,946 *3528E6226A9967097F647A0F4440911ACC3ACB81 TRISTANWAITS
520,485,947 *3528F7D290200CBF4F25CF71D3319A4B95520F92 kathy-kedzior
520,485,948 *35285D0CEF1FB3CB47C9F98FEC35901DF7922474 KAYSIONS7
520,485,949 *35279ABA86DAF1B9F8C2E0EBCB00E36987DD1D3C TRU$T4B1L1TY
520,485,950 *352B934007994045C50110D79537214D0F161C20 KBMARKACI
520,485,951 *35251A08B34C28F496F7341A0B3658916F00C336 TUNKRANS9
520,485,952 *3523FF557BA32E307E8750EBDBC6DE00F00D1707 KENDRICKBUTCHER
520,485,953 *3524FFED3D2422932E62F14374D72F23081D0877 kentlagos
520,485,954 *3525C5E4FE7954546577692737BFAFCF2E12CB83 kentonsteese
520,485,955 *3521EDDE941D9D0C33FAE47A8C3E3EAD6DA343B7 KENWALNER
520,485,956 *3527867B10249EC1761712816E107DCA4EF720F0 TUTKIMUSVASTAAVANA
520,485,957 *35228F601F70DD61FF46077AE77D8C1AD7DD38E3 KERRY-COFFMAN
520,485,958 *352E0F832404F0C383E9549CED9276E7F7D8FC5E TXINARI
520,485,959 *3526451D68B58BF8705993640DFA22AC5788F0E9 TYHJYYDEST{{N
520,485,960 *352C2955697A3D139D485A99C6C53F04919F0298 KHATIJA2
520,485,961 *352047C8D8FA3B9470AD6A33F05F8DB4B69C33DF KIMCASEMAN
520,485,962 *352F75489CEFDC613D688A00299D982FFDB4F266 UBERKOMMENDE8
520,485,963 *3522223339EDA1619F3DA6955D695B8B87860029 [email protected]
520,485,964 *3525D45086A401A4261B03F704F20278EC6B5B6C UGLIS.
520,485,965 *352A7A8B7839B0EE7C829EC2E9A4F304B07965B9 [email protected]
520,485,966 *3521FD407E6CCEE216798AB16B9FD376C7D42472 KJØRBEKKHØGDA
520,485,967 *35265E1E28A58ADBBE4C9DB63DA90304E7CA7038 klaudiva
520,485,968 *35274F96697A79D0CCA635829BB41A7B9AC9C14E K~N9
520,485,969 *352D7029FB585DD398D4F28BC75795F752069FF0 UPPITCH6
520,485,970 *352CB46A18432B7109C6946D8580955144AF6885 L!+=
520,485,971 *3529BA17D1E17ACE17E92BC8E531730F4BC4967B L1TTORAL5
520,485,972 *3522FE4F77CB9AC30DC29125C074349B9E83DD24 utingeradielseal
520,485,973 *352FEACC5FE77FFE4549ECE1761C2A4AE255BA20 UU-O~0~-(---P
520,485,974 *35226B3F21C3FE71C3A8F6545F9CCA9E0CC4A7CE [email protected]
520,485,975 *3521A057BC3B1333099C74A91AAF39518B0338D8 V60011611
520,485,976 *3523AE7D26D60B32A4E799A8998D13DC42FF8DF9 LAMONT.MONETTE
520,485,977 *352740AAF00883F0BB59002E3979BEF72B8D99DB VADERGOPHER4
520,485,978 *352BC25921903F0D84D1588153E2ABC6D63DEDA6 LASERINTER
520,485,979 *3527364258726F16C62D8D71F12698281593A7F6 laura-shepherd
520,485,980 *352980B1DA85D86CDC5EC6749EACDFFA9E78115D VANCE.EPPERLY
520,485,981 *35247BC0E54F4C7270A1704E09510803065C275A LAWALABIOLA
520,485,982 *352554AFE62C587C4090191899A317BBD22AA9EC vangie-booc
520,485,983 *35296F453EB7FC6E53119A9674AAD4B5D863408E VASTAKAH4
520,485,984 *352D8A5F8952A99651B1B095E0EDB44CA79481FE LEE-BOON-SENG
520,485,985 *352E2E2F796C68811E9EBFD37BCB7E0DBE63DF42 ventoneugeneplum
520,485,986 *352A8AA3A2FDD79248FB16315E393EDC6EE25C85 LENNY.SWEADNER
520,485,987 *352EFB99E7807D25694FFBBD5C3592ADC96B5799 LEN.WEEMHOFF
520,485,988 *3523797305DECB17FEB4C2B162AA9DC3CB450D58 LESLIEKOHS
520,485,989 *352BAE7FDD9C312C0C61A235D2CC9D8325D0F414 LESLIEMOODY
520,485,990 *352FAC58E5E21CB03FAF3C2E3042C20DD5C106E7 LET'S.KISS
520,485,991 *3520E4F0CB1D6EFA54FA2BBB15A597AA5D53D198 [email protected]
520,485,992 *3526EF4B2F8168EFCB5A42E232D53436A949BDF9 VINRAPHAEL-MABIOG
520,485,993 *3520CF7A20A7D6E681816C7532BEEE9D7A7CBCC8 VIRGILBURKITT
520,485,994 *352FE2E6232CE15DE35D14A7D1A28C28ECE0837B VIRGIL.PLUMADORE
520,485,995 *3528DB7C27CB0DEF9F4C627D7C6A6B194DBC90C0 virginia.agpoon.bailey
520,485,996 *352792C2DA00C64525F48384800076865FDAF8F2 vitobergamini
520,485,997 *35254CE11609B4CF52D8FE2A30DFEDCD4E012C99 VLADLIPICIOS
520,485,998 *352A39E568F4CB2A18652A3C29F3D1BA813ABF94 V*MT
520,485,999 *3529063361E7FFB87AA3B80D92CC057A710400BF WALEEDABDELAALTAWFEK
520,486,000 *3528C8FE6C89100A22123FAB1B7BD7FBA505B471 WALTER.HILHORST
520,486,001 *3527CF1871F09EE0C3449830D8D2323825999498 WANASIRI
520,486,002 *352A5F9532B6C2BF3403C07BCCF1D2AB2B1CEF67 lofthous4
520,486,003 *352863EDEE0B27541F3973A7CBE253543BFE230D WATIYUS
520,486,004 *35225622E1E843450EB4CD3A411AB0DAACA1FB64 LONNY.MORGENROTH
520,486,005 *3527FBF7BD2DA2FACE4D5517C734F85285E4D672 WAYLON-PRUITT
520,486,006 *352DE96B20A7F5D9EAFBF2F3D49827BA4C89FC12 WAYNE.YAZZLE
520,486,007 *352085D6DB3EA5464DE3E279AC15154434E62F28 LOVELYLISTING.ICANHASCHEEZBURGER.COMLOVELYLISTING
520,486,008 *352C66E3281A8EA225A7BAFEFC3E46A1CE6827C2 WEATHER_SIGNAL'W/E//D//@/R_'S/I/GN//L
520,486,009 *352A63CBB7886ABA320F08CE78CA1C19EAF853A8 WEBERDD6
520,486,010 *352E87F00312E039C60D2C2DCD8796B751D32BE5 WELLENSITTICHMÄNNCHEN
520,486,011 *352EC0253F39C2F331EF5632CBC5375ABBF61560 [email protected]
520,486,012 *352AFC97B6B06AF8BAFBEF61C3C575A54A99AB97 [email protected]
520,486,013 *3521910454012ABA73A30EE86645C8A1D11EBE27 [email protected]
520,486,014 *352075B0834DF1EB364604C6AC099F270A54E063 WESLEY.XIMINES
520,486,015 *35232B93C1F6C7016071DF98A60612E452D2FBF6 Westside-Story-Maria
520,486,016 *3526DB9A422A4E1716FB3000201A7C78991F7A33 w-fn
520,486,017 *3520291218AB83D0F6251E72CA69973B2D94C6AC white-summer-(alternate-version)
520,486,018 *352C3E6CF7B250F02982363ED7E0F1F4E3FC454E MACGINTYI
520,486,019 *352C9D42B1C69192FF6D7082B0FC6D917C2C412C maebaa
520,486,020 *35226D35039CC72797ECBBAC70918DD42BE87B55 [email protected]
520,486,021 *3521A66CDE85474848E03380904474A01C1CDD5B MAJORBUCHOLTZ
520,486,022 *352A2A478AF45F35782705DD0A46693277600B22 windy.sharmila
520,486,023 *3520191A14F83EB4F705F50C9EF5D744785867AB MAKIN'-HUGE-BUCKS-(FEAT-SENSATIONAL)
520,486,024 *35272DFB994EA458F1E3140AD36FE7A52F7633B3 wisdomtoyota
520,486,025 *35224E59106A9BF5221DB341FAE98B16766E2307 WOGUEGBE
520,486,026 *35215280950BF694CE38C2D1F5E99000575F94A6 mara-valle
520,486,027 *352D529741F1D0A2E0FC92CB151B365E2ED9E0D9 WORLDPROUTASSEMBLY.ORGWWW
520,486,028 *352A5BA476038F1B1A87157B4037538F4E34FAFF MARGARETFARMER
520,486,029 *35260B70FE9FABA8725E75EC15D9D83510D16F19 MARKUSFLIPPO
520,486,030 *352C6B1F2CEC7E4E9807C8B5A0B3B0F892BB4C15 MARKUSLAM
520,486,031 *352D54FD6B7C8B1B8B359CB46F3A702AD208D0F8 wwwradcliffeedusch
520,486,032 *352F2B6A826A3EF3041D6E3DD0728330A1DE1D9C MARSHALL.AMBRES
520,486,033 *352E8C8BFF7BC9453F19BF6CC18B98D9F7B437CC XAVIERDIABLO1
520,486,034 *35261CB42B3FD6716CA0E74C42AAD963BFB8CF3F XBNYMLX28
520,486,035 *3529643ECC2616ED809934BFF3859D6D306C8ED7 XCOUNTRYDEAD
520,486,036 *35233062AEA7FCE055EE685136ADC3B8CCE97CD1 [email protected]
520,486,037 *352B0029B1CFAB45BE4B44AD105553056C7E8205 XU-XUANKAN
520,486,038 *35241F8C3614F9A67992BE1E123E8FD3F7AA152D XVW'
520,486,039 *3526821BF3A705A8DC16EC59FC00DA49B62C46FB YÁNLUÓ
520,486,040 *352527FB1A961BCFB9810220E9065A0142541C0D yellowlight4
520,486,041 *3526239D89DABC859F37931F84309B52D87634E2 MESEMONDÓIRÓL
520,486,042 *35220F62F3FE6DE27CA931F85DBD92EC80C29C8C [email protected]
520,486,043 *352D7791F31C051E9885A5B3E74A76EAE584CAF0 MIDTVÅGE
520,486,044 *352576B1688218FE13A0915FC19823F200FBBD53 MIKESOWER
520,486,045 *352C1F5FF2D43A10A1516454E3E7652AA179EE73 YODELLAYHEEHING
520,486,046 *352FEAD4141BEBFAE788D071923810B854F14CF5 milionukorun
520,486,047 *352F982BF9F92F2FC2AB487364B7A529C46BC8F6 YRITYSJAERJESTELYIHIS
520,486,048 *35264A2D3067340AA6571BB19D6EE564D2A3F55A miquelsmedsrud
520,486,049 *352FC7E8A834448575E78CB9EC7F9F7D7B674BD3 Y{TG
520,486,050 *352A17BCEBC90E93B5214BC6E3AB8FF588D493C7 yunianastasia
520,486,051 *352003237A800648E159F6C3B87262AF17EA0724 ZACKARY.VANKIRK
520,486,052 *352C0E71E6B83F7F75AC7B7248397AEC972E5F72 modernizacionecologica
520,486,053 *352224C578408D218785F56649407FEA7A5B3168 mohamedsturino
520,486,054 *352E23C92DEDACD43F7476C5AA0A61BB04EA7591 MOHAMMAD.KERIN
520,486,055 *35294D281F2F0C69E0494ED8F8E889735A059BF0 ZARARDANDA
520,486,056 *352DF3AF4BDCA28BEDC179C163E8D87F646E5171 ZARREYAB.ALAM
520,486,057 *352D7FA1F8DE9CAC5D9B58FF38CC3535BA9968BF ZELDAR
520,486,058 *352782423A024179815780A1AFD1CE4D49077B70 monster-(feat-bloodshock)
520,486,059 *352FE46F6FBA6E44F411048F459C8154A71D1E37 moonpeewee
520,486,060 *35213BFD84066C47B0EC9D27714929C646A88F3C [email protected]
520,486,061 *3520F79D756AF7F461CB109D88AF8363382A3D5D ziwiscan
520,486,062 *3522DCCADC4354B3FA24F31939FE3AEC0B7E59F1 ZUKHRUFANADIA
520,486,063 *3526B1214D631DC054F769DB8134EA0CB66F02CC [email protected]
520,486,064 *352D00514A4077B4C346422BA8D750C090009250 ZWZ0
520,486,065 *35271B638D709A84795ADBC8FCF06571EA8063F6 АРАДАНСКИЕ
520,486,066 *35211AFF6B1851D0EDC73284C9BA01689A054C3F ВАЛЛОНСКОМ
520,486,067 *35274AB5812D467DBACC445080EB1F22EBFB3EF9 NAPOLEON.BEJIL
520,486,068 *352238088EA1FF81691DA339FF2473D8A4B62E58 NARESH-AHUJA
520,486,069 *352D78AB8C21EC2500A1229C0D56CA0B019D77C1 NATDEATH
520,486,070 *3528154F32A19AB64F6B213B2EA6D793702CCE0B КЕЛIССӨЗДЕР
520,486,071 *35283151BB5600936883A293C4C2BF0B7EB3D962 NATHANJUDON
520,486,072 *352A5B5432EDC5E937D6011513455F3BD5563211 nature apr
520,486,073 *352B3D381C2A6FD5B46EDD7C1ADED50D4BCA1CC3 НАСЛОВЉАВАМ
520,486,074 *3524232FF4C2C4102431D0FC9235E0DAD9C16546 NEILNORDMARK
520,486,075 *3524B420B6B333180BF9B8FAD898D4A5D3B0C184 NEOIMANOM
520,486,076 *352DC008726367A677C048C8CCD3297F6DDFFBF2 NEPHROPATHOLOGISCHE
520,486,077 *35275ECF22B88249A3B7E66F46812464F17F101F ṆINI
520,486,078 *352D55B0FC0E83359A70F560E332AA0DD4EDD72A [email protected]
520,486,079 *352EA49914BB9013A536235A72FF6F93D4B604F3 NO1TOUCH
520,486,080 *352332DFE025B50877CD784F2DF260060A1F4039 NORRIS.AMALFITANO
520,486,081 *352CFD2467ACCC23BF3B6C8E9B9FA1BF583E6D00 NOSHES
520,486,082 *3529494B980C605B7348905DA4F18A0143AB4C2E ODNBFEID
520,486,083 *352C8E2DB685BDBAD031D69AAA3224C20E04D77B OGURCY
520,486,084 *35208E6C0937476671B2B92DBE98CB33B0A1418C OKEODAN
520,486,085 *3529E37FDC0E30152250D38E3106D0B5A9007870 OMIM160605554
520,486,086 *352ED416E2E4BF82385926D3FC7B87BAD0917213 OMOTANIM7
520,486,087 *3525E25CE999DFEAAEC19365BB94030262D25A3F o-Urbana-(Ao-Vivo)
520,486,088 *3527A82204CAE17AC3E6B3E05B5F61433442478B overgezeild?
520,486,089 *352203B2DF6BA012AC10A4D7DA2B8ECD66ECDF6E owen-pike
520,486,090 *352BBFA29ABDAF0FEFB9833476010989C98E8A76 0535.ANYTHING.NEW
520,486,091 *352DD7646BCB158A8503723DEA83C8335E3BD002 PABLOSWANDER
520,486,092 *352B91672683EBF475A464BA5564D28C464BE3B6 PALUKU102
520,486,093 *352B6992C0111BD35C14E1534C8C70E1853D787A parisphotos.eu
520,486,094 *352BC0B796482363B3CA16D5883AAF5910D027F1 PARKER.CROME
520,486,095 *3527700B2C8FC411C8EBA739B39708E5DEB39944 PARTIDARIZAIS
520,486,096 *35281B138A591644A3D25B6BE83738278C814B49 PATRICIAAINSLIE
520,486,097 *3528B2FA6D3554B2CFCFFAEA08FFCF454FFE68F7 PATRICK GAUDREAU
520,486,098 *35271E067331116ECE07A0EDC2E868D8AB40BD3C PATROLWOMEN1234
520,486,099 *35221B6DD37BC0282C82340BD94D169331EF31B5 1320411 JAKSOILLAOLIOPPILAITA201.
520,486,100 *352FF6C2786D1F41606982A8F10E90CAA83DE86F [email protected]
520,486,101 *352FCA02B21C4D26F66A5046B54AFE2906A2B772 1356302 esineist
520,486,102 *352C15BBA0997DB8FCA936A10337E1A89139C627 [email protected]
520,486,103 *352246D343E1A05E20255DA1E160C24431A5E61C p####d~.~.~o><
520,486,104 *352E0ED9C960F9FB09F84596D87177D9F410029C 1/3OCTAVEBAND:16KHZ
520,486,105 *3523CDB20FB247D98E2032FD7A4C59D604420405 14P41207H0124C05C0P9
520,486,106 *352F91A448C2CB516E96F5D23D37BCF90E711834 pentagramalbum
520,486,107 *35279F6E166FF01DC8C98689CD9EC6101AC9F475 PERRY.GOTHARD
520,486,108 *352F17434FF7E318CA33F57991D32FBCFAD5BA41 petelakers
520,486,109 *352E26CA909DEFAFE5552CDB14521466CEFAE87D 18UNBEUGSAM
520,486,110 *352CFB2C27B5F487F79285D39E5C7A71270DAB58 191.gotti
520,486,111 *35221AE632ED43D440762816145B907D4D027AEB 19SAI
520,486,112 *352DEB911D62A19C141E05E0E2D9C63A7C197F88 piceaabiesbark
520,486,113 *3529C37E20B170319A813A06A0E46EDE49B6C0C4 P.IK
520,486,114 *352EB5305BB9BF1C15879DB013C6BAED86D2FC25 1.gastwirtschaftsgesetzen
520,486,115 *3523A208F66C2C57152F234AE3DDD23E58B39C53 PJAYEKLJICQFEJN
520,486,116 *3524CA02918A866A42A134FE65EFA43C7ACC8852 1GOLFLENGTEN
520,486,117 *3527A5349F6E8F05084886E98A8DAA1F10DCA806 1-icin
520,486,118 *35260C18377EB41AD585E56642E656CFB83A68BA 1.munter-kernigem
520,486,119 *352E78E0E2EAF27664FEB1FB8BD5A02B0B6D25F0 [email protected][email protected]
520,486,120 *352560B4E487B1A562C4282610E15FA9DA79708A 1-OTTELINE
520,486,121 *3526C936F7F422568E7FF7B5FDD95F08B0AD892D p######p`~`~splat!
520,486,122 *352E6DD4E3BB0BD75DEAB85F32232332F8BF8E40 1poiskitkemiseen
520,486,123 *352CD2523A44496FDB2FABB06ED1ED30B164DACD 1-puheenjohtoon
520,486,124 *352F62A3DFC93300E71F5490B1CC85526005EEE9 PRECIOUSPOOJA
520,486,125 *35242DA76E11C28D9F97656B7EA376C811965E53 1-sillet
520,486,126 *352D0E4E127B5CB1DEEA24E7765A60D3950C9FFC PROVVIDO7
520,486,127 *3520BC250349781851B5CFBCDD62E9549A1C9A87 PTBAG
520,486,128 *352D07431088DF62D946DB35046F9E8082A0AD5F 1XXX23
520,486,129 *35298B9D871448606EB0FBD6397E3DA2F12840DF Q>~0SPLAT!
520,486,130 *352A691ED0EECFBE2E50924EC6B3E37F7EDEB3DD [email protected]
520,486,131 *352040E6E3453E3A3B760F6270E8A5A2197E532F 21 ZUTRAF
520,486,132 *35263EFF62D90F615978BF63645BB1C938F8A2EB 2318491 AN ZWEITER STELLE FOLGT VISA MIT 3,3 MILLIONEN KARTEN .
520,486,133 *352E6C297EF70D95F9D6F2D4F85354BC8D69199A 2356172 BAROCKEFUELLEFUERDASAUGEDESBESUCHERS.
520,486,134 *352CD1279FA6EB9CED3AEA2D5A94B343E0F68D3A QUA$I INC
520,486,135 *352E908374C44788190EA1D788B4E618E5E42BC8 2677077 TOCOTRONIC.NEHMEN.IHN.GLEICH.MIT.AUF.EINE.US-TOURNEE..
520,486,136 *352282AFCF04A8430BDCEFB2232E7E86EEDD6DD9 r393rmna7n9
520,486,137 *352AF7B3BDAE04DA4B468B5EC9F4E6D529C140EE raleighhouck
520,486,138 *352D46EBC56DA2540E293E2BE27920D9D0C78619 RALEIGH.TARELLA
520,486,139 *3524CA801339C71EB13E2F9E526C91E5054A0A5D randallbieri
520,486,140 *352B96EC9B26F8970B802EC58FEE951A5571B83B RANDALLMARINERO
520,486,141 *352F2990F66802DCCDA75939BDFCD17C43BDA0F5 2HENDONN
520,486,142 *35272BF91704281C95C660F37B3F719C16B2DBA7 RASCHPLATZ–PAVILLON
520,486,143 *352F111F20EB3175E007576793A8C76D17A42E50 2 NELI
520,486,144 *3528B9E921945B12BF18E93787398AC7BE250FA4 2smiling
520,486,145 *352111D35B2CBB27DB228DB3772223D1D100C64C 30march1480
520,486,146 *3528D42310DDCB50A72E20709B9F26C3109DBF8C REFLYGARERS6
520,486,147 *35205F72EE780E4DFA735D518A3F2039ED93F015 REID.COCHRUM
520,486,148 *35247E125F69BDB23DDF76EBA4D358BDC0525DF8 Reinspection
520,486,149 *3521E10AD98DB52E6C9D637DC7E1AF4C5C5513CD RENEGOCIANDO123
520,486,150 *3526EFCE0581E884E27B583BFF469B17E5624884 3##).~.~.~(o_)
520,486,151 *35272612EEA7BBED02BF8F510395956F22CF3BBD replacement.for.rlogin,.rsh,.and.rcp.
520,486,152 *352ECBA453480D10ABA308DBE7CD53D3944A0436 REYES.STEINHARTER
520,486,153 *352E7CD7D5074CF180144A13C4A9A0199F0248AD RG4AAA
520,486,154 *3520320FF8B5FEF6B18F48DECB7EE5ACDC456BE8 RHETTCLAMAN
520,486,155 *3522E20A9790BBED41213927230FFCDC3B588914 RIARMASSERO7
520,486,156 *35251885FB9133570F98431D9072673E2FA371B6 4epierez
520,486,157 *3527CC7E117E472E3E928A9FDB30EA8A43C286F5 RIGOBERTOFIUMEFREDDO
520,486,158 *352F03E33926F05F76DCB60C4E6296273B9F0733 RIGSRETSSAG
520,486,159 *352413D64BEFE3B3122A44182DDE9D99D6E21DDA robbie4you
520,486,160 *3521D1330E08C0624F73DF8EDE4EDA425E904867 RODOLFO.BRASWELL
520,486,161 *352C1A4498C4EE5484F7841A167DD7CA168F8603 RODRICKJANIAK
520,486,162 *3529B9C91F22FEEB9F5529453F6957D265079818 rodrigodismang
520,486,163 *3526D51FD7D82FC1BE485F201A07D174E6283009 4VERSCHLINGEN
520,486,164 *352A4A366B72750B89F547D2D0F8335B7AC142B3 4wittenstein
520,486,165 *352D84108DDA8D938FEF310C3AE2EADF9F792E75 rorie-hull
520,486,166 *352B791F07A747DB518370A52016356088EB4F6B RORIEHULL
520,486,167 *352DB0513E5EE571CC605DE572C4FB2B57B919A7 5COPIENTBSW
520,486,168 *3521834E8EF4FCE383885DE520DF2EDEA00149CB 5CSIMORP
520,486,169 *35280FDA71BC9B47898A7C64A4ADD95F28F27059 ROSS.DEBENEDETTI
520,486,170 *35226152B6646230732F3380C00DD6270281B4D8 ROUTESTEMPLATERAIL
520,486,171 *352C59CF1CFD5874F8464E62FCD3CF8C00700FE5 5GNIWNIP
520,486,172 *352EDADA766622CE13A22564EBD6E222D6BFE216 5ilovehelper4
520,486,173 *352E728855D5A544045C1FC36012BCE64EE06937 5OCTOBER1608
520,486,174 *3529DCB36ACFC1AB5FE81A7A1360EEED09867627 RUDY45RUDY
520,486,175 *352F81469DDF7AAC707E1D1FFB5B4F011720C743 RYAN3900
520,486,176 *3526B6CDAF5860A93FAE046BAD199E3C5640D023 649katherine
520,486,177 *352541C926C4FDA09364083F658B99FCFEE6A862 [email protected]
520,486,178 *3525E52B3CE74440AE156D7092DABC1D95A36099 salharrigton
520,486,179 *3526B65FCF42C54C9CBEFF70559CD24A1F403451 salvadorsamayoa
520,486,180 *352C8FCA2B575F390DB67AA109F122F1A9F6D221 6CORPUSES
520,486,181 *35221EC7B65F4B0D719E994749B4D049EB638098 6FARMACEUTUV
520,486,182 *35219878654EE76AFF81D5373FE567747C547B11 6GOOFYVIRGINIA
520,486,183 *352B2D3F7D78FF30B0E54118F05B29CB0F76D4D4 6iamalthea7
520,486,184 *352EEDF6DD8FE68CACB97538311337C0CBD1CEE3 SANDFLY
520,486,185 *3528C8885DDCF1C6F6F0F852FE1F38C0D5D6287F sandra.maines
520,486,186 *352FAF31EB75438CB9687D9E0FE8081A575AFC9F SANGGISSLER
520,486,187 *352303784174C5ECC0DCC32DAAAB0FAC9E999578 6MONUSKY
520,486,188 *352EF16D93452263FDD8D3367A77BA7FEEC3CA1F 6OCTOBERABCD
520,486,189 *352892431E819309B29BB8C07D3A9356D04E2B3F 6PY4ZAKSEVKI
520,486,190 *352C09F90FE356210F11B352CB36AEB9ECE974C6 6SFOGAVOS
520,486,191 *352A89277C8E3E291D685120CB2CDC474A252570 scharp
520,486,192 *352AA1C9EF55B53171F3D2A479C02A2B24DE1D48 6WANCLAN
520,486,193 *352826914CA9D1856B3F73E7455291CB98B6A299 SCOTT.RIGGENS
520,486,194 *352EE49D674992F4492009322F4F36FE0B09476D SEASONSARIZONA
520,486,195 *352E45919FD7FFEE813F657337E948A6E76FA720 SeeingThroughtYou
520,486,196 *352763563E00F6D1F619BBB26964F69DA2CC4AE0 788 pysy
520,486,197 *352FCB64A58A64FFB7705D406385FCD2F3DBA244 791ALLISON
520,486,198 *352E9F077E2513D428DB10D0E91D7481B61EC621 7DEKLAMIERENDEN
520,486,199 *3529CA36F8EB6BE100E142FF450E99F6CA22D37D 7ESDNALNJ
520,486,200 *352334F7CA13865F4586AB93D77B00420390D68F 7GNIRIMDANON
520,486,201 *3521CCC79D344AC875FC29C35DF948090504F6E7 SER0DI4GN0SIS
520,486,202 *352E780D6A191E7FD4971C001DCB2FDB6F9A3319 serratil0
520,486,203 *352F498E7A23DC15FC21AFAE0EB98CDD478DA64B setembro(remix)
520,486,204 *35252BE57743F142995675C8A91D1AEB22726B54 7LAURIETIGRE
520,486,205 *352098423444F63E8A93760591F8D3889BDDB05A SHANE.KUTSCH
520,486,206 *352AADAEB33D2236B27D390444D20D4716C2876B [email protected]
520,486,207 *352D7D902D71E3EC57922F4F927EDAA12DF132F1 7ONDYAKBSW
520,486,208 *3523EF5D0E4FDF10F0A5301B3AA09E0CDC925DBF 7OPERATORANALYTIC
520,486,209 *3520B9E2D41F6C67C5AEE91231CD42E608057307 7RUBTHGIL
520,486,210 *352600F606719FAD9CDB4802C75D98611B149ACD 7SAALISTAJILLA
520,486,211 *3529A6B4A9E120172AC00491AF55AEA9AD41FEEB 7STUARTBASF
520,486,212 *3526E40DA02CF85B78A63C52CF0EEDEB1C68F2B3 7THETROJAN9
520,486,213 *352186736B6B36F7C2378DBC71D033614A08554B 8#@.*.*.*.~0~O:P
520,486,214 *3525BF3C249A3AEB7176FE3A1148A8A7773D736E SHELL)的名字命名,该算法由
520,486,215 *3529819776A356282E5D6A51F7ADF0214DF52507 shining.skinned.friend
520,486,216 *352F5B91B55A6AC4CDE41A5AE4D760F5DF998B73 SHPYLGOREIH
520,486,217 *3521C0E7102BC32E9276FD14E75E4D6358F73D5A 8BINNENGEBRACHTS
520,486,218 *3525733B338C979C02E73ECB48FCEA93EC14F8D3 SILVERDOUGIED
520,486,219 *352BACC1D819CDB4C2AF9BEAD27B8756D0F0053F 8DANSZALENS
520,486,220 *3524275C2732A996D6B0A7FCD8437E55DC949FB9 8DENKWET
520,486,221 *3526D731A7C104AEA620F1557FF8FFF604FA38DF 8DOOMROPING
520,486,222 *3522D23F1FE9F4DE00C02CD6259C708977E569BF SINEHEHTIA
520,486,223 *352394132C8A4B2D48D84B2942C2CD5782F4AED9 8DURINGSBSW
520,486,224 *35251D0C784572896778FF606BBFC7C055DDEE25 8EDITMROTS
520,486,225 *3522201177A0BC53B4B7937FE2FCD40BB6518A81 SISAURO
520,486,226 *35250BB7CB6A3D2ECDC2D63196BC3FE7A38E4E72 SISDIAKCOV
520,486,227 *352248B6F4C6D0B4DC263AED4D67D7DF8DE2B593 8LADIKLADIK
520,486,228 *3529C75770F0D3A01FED5C5EBF62CF56A786425C 8MENTHOLS
520,486,229 *352FE1863C9E99B2DDFCC91843B0BD6586350086 8#####>~o~o-)x(
520,486,230 *352D955CA5119319A526FE0EAB55EA06738482E3 slacker06
520,486,231 *352FDE6A137A8DD9828DBA3DCDEF0945F1233ACF slibeny9
520,486,232 *35227AF668803F1ABB091307782E84FFAA9328ED solcando
520,486,233 *3526861F9A1EA6CDCAAA15574DFCF4F6C3AD1FA5 sorrow(breaksagoodmandown)
520,486,234 *3527B1C8A266F2D420F83EB936E449A6CD65F19B splat!!-*-*q###8
520,486,235 *3525AB482CB9B68C8020D7BD2CDB3CA25AFB3CE0 SQUEEZEDS9
520,486,236 *3524AFE0135A7CC164208AD65F7A69D2E498DF26 SQUIRTDWIGHTING
520,486,237 *352B3169DC6B951DA0CAD8B2FA17623D6DD46AE2 SRC=HTTP//ECXIMAGES-AMAZONCOM/IMAGES/I/11JW57D036LJPG
520,486,238 *352DDABA53002AF3A5EA78B6D9A484A949FB342E 9SPEEDOREDRUM
520,486,239 *352C8EC5935DD468CFEAD4383EAEA11E87B3C27A SREHPLET2
520,486,240 *352BA6D82CC82305167CFDEAB2B8E8AF5710E1E4 sterlingdecosta
520,486,241 *352FBFD1494CD531F568DF43E18320B72F7E3CFB sterlingtwomey
520,486,242 *352BF15AE460841F8B481DE163A40246F06497B8 STEVE-KEZMARSKY
520,486,243 *352D68579EC954D97057B96A2EB45DB92E1CB433 aab'0o
520,486,244 *3522F52F28B0CF237224C78DD8833E76344FFB78 aapoq
520,486,245 *352CC9BFDBAE824A1E1451026FD6F7FEDCEACA6F streamofconsciousnessnovel
520,486,246 *3526ABD2F4B63992CEE0A9EB84FC76A26C325C9B ABDOC
520,486,247 *3523F83D98D8C0F9A5187FA2BD9AF6AB6D227156 ABIURERESTI9
520,486,248 *3522F6E64CCB88E5C14218C6D7DF87A0EB7A886B ABIZZK
520,486,249 *352AF2A0B220F84FB913C60DE7AB60DA201ECBEB subcontracts.
520,486,250 *352A536617CF535CCEB1FC7667E4F74E1E846A4A [email protected]
520,486,251 *352C15360A502891DCD2A576564897D1D1F9C460 ACQ7A
520,486,252 *352C3805C8C55A43AB01C04C71B23DFE36F42655 SUPPORT.PSYCHOHISTOR
520,486,253 *352AFF1753D24F519D33E4114BCD3D525E640883 SUPRAMIRAGE6
520,486,254 *3523064E39C85A060835C6BF928FACDA16147EBC SUSIE9
520,486,255 *35213ADC18F8D8DF5786D03248A1719DEF272A89 symphony-no5:-iii-largo
520,486,256 *35234018FA3976F5BACCAE055F36F0B6BDB99813 AGIHCIHS3
520,486,257 *352E6C0E56F48FFD175049654174654FF56DAAFA AHMEDSTOEKE
520,486,258 *352DFEB15C64A69267BF8CFB46CCC5AE68217762 [email protected]
520,486,259 *3522D3B05422CA1A7A0C5AD505BA7BB2B0BF6446 TEMPESTVIBES(FEAT.DANAKIL)
520,486,260 *35252D7B5E06CA82726090E04AFF81AE600CA986 TERESAJUDITH8
520,486,261 *352562A17DC9BDEEE531DD95778096F76CCCF2E7 termolen3
520,486,262 *352A4CF7650D8ABB38A158D8C2B2EAD3966A8554 TESTEROATMEAL2
520,486,263 *352EDCDA150E3E2F1E3F2F9F38F15E83EB68440C ALEXANDREROSSET
520,486,264 *35214FE43DDE52F55C95537ADCA127445981539E ALFRED.YOVANOVICH
520,486,265 *3523165758EF72D21CFDC4A3F1B3DE4F5216C421 THATDAGGER02
520,486,266 *3529396493D6E53FC4A551D0C6E1DD05BED20ECF THERON.DELFIERRO
520,486,267 *3521F252CC06882B74EEB0ACFF0EF0B1F97ACEF6 THE-SHIFT-OF-TIME
520,486,268 *352183FBA47DE67B17C092CFCB8EEA86C4ED7B7E thetrainwreck
520,486,269 *352B2C9041C63A27C5264E5C2B0AE71048D0DCC0 TIANMATINV
520,486,270 *352AFE246096E75CB11A1F7BE3E6D2DBE29D8936 ANDREASVAGOTT
520,486,271 *3526B8181AE8E86F51F99D82D6FED26F8465C667 TickaTackaTelephone
520,486,272 *3520A2B7407AE2CC914F916AB9095AB6D28C7050 ANDTRUE3
520,486,273 *3523158AE9E9786A28244E457981B62FA63A4553 TIRETSSTERITS
520,486,274 *35209C93F2FB52CB8BF13B34A9D980B6EFD75B7E ANGELOCHRISTIANO
520,486,275 *3521E53B052955FE02165593BD79008302B5F482 TOCOPHER8
520,486,276 *3525B89D1BA228794CDB79ABBA16379677485D87 TOMEU.QUETGLES.GRUP
520,486,277 *3527669AD40FF8A3AA3E4869E7FC013F1FE26112 TOMMIE.CLANCEY
520,486,278 *3528FAC18D6E7B39053D9C3E9817331E94194EA9 ANISALC1
520,486,279 *352608AFF4582DCA9EA72A0D8CAA4CB365060A8B TORY.STEUDEMAN
520,486,280 *35251AF6BCE5E926846E8967E96691D93B689235 ANTICIKLONOK
520,486,281 *3521E695BA3D957482CE7028D24A01694C206364 traceybelson
520,486,282 *352F891F60C52513E9B6207100734278E5CA1D6D ANTONYSALIERNO
520,486,283 *352917EDE9C9C035F7D7E967074D761120672051 ANZIEHENDFTE
520,486,284 *3529888998D562CEEF8F0348EBA045161EFD5CE7 TRASLÁDELO
520,486,285 *3521AF56A58B55CCB340163CBC2A21EAA60AF13F trauma(jamx&deleon'sdumonderemix)
520,486,286 *352DD1D9D75F5FDF1092EC10FA2AE54094FE7E53 AOMd
520,486,287 *35245D7BA48006BD9404644A2336C10066080648 [email protected]
520,486,288 *35263FDA8253E008F4A16D363ED50ECDA34A0CB6 AP$O"
520,486,289 *352C4C21039D99BBFE92D2B57AD5A172083A3333 tristanpannenbacker
520,486,290 *35203A7292D4074FDA14FBDB01336D25002ABA45 trna-queuosine
520,486,291 *352B69257FC09D3C2DAEA0A4EF6129DC7795B35E trvlvlring
520,486,292 *3521E9F6D166C0B0E871CDBB082EC13A9BAE68CB ARCHIERAICHE
520,486,293 *3521D16761165B464A44C69981FD21DCBC2E6949 ARCTICPUPPIES
520,486,294 *3528FBA98055D5863AD907AF18027E8FD3488C7C TTYEJLE1
520,486,295 *3521F285E48EDBE7868149A770C2DC6B94617C17 arrondissiez8
520,486,296 *35211529F618BCFB47F2FAA2DEA170AFCE269E70 ASEER.AL.SAMT
520,486,297 *352E803004535522BAF090323ABFC2038D01677D as/t
520,486,298 *3524F595ECA55EB5BF72D5B934B7817B69921540 a.t_h
520,486,299 *352205344A498B864D382AB7EE60745D5466AE98 au=pu
520,486,300 *3523635AA5735D51127BA216735CA8390643BF51 AUTOASPIRATION9
520,486,301 *3529FF267ACDA1AE7DF082FAB6431BFAE9617C3F AV+3U
520,486,302 *352E725C74914AA0F4EFADEB802EFF7CDB1F7112 AVATARIANAN
520,486,303 *352942E0199D4788D6087721CEF6C43FCB91FDE3 AVZT%
520,486,304 *35218AA2535A9C2DBC4A9D5165456D42CCF3A977 [email protected]
520,486,305 *3527F7EBDA1224038ECE715A4B210FFD9C72FFD4 AXvn
520,486,306 *3526A33DA3E238DABC0F32826115768B741B282E azomaceda17
520,486,307 *352E366988226478E431B497CF56A71CC93DED0C b!0:
520,486,308 *3523A3AE95D230E2FCC2FA0E0C7DB37CA06BD184 UMBERTONE-NANNI
520,486,309 *352AAA9504B3687CEEB99848D58C47CF459F9C77 b0r?q
520,486,310 *352AF7C489A9ABFB0FD9FD525661F177C2466B7C B9gW
520,486,311 *3520E2255AB1AC991A693A79F3E6A615016FECC6 BACNN
520,486,312 *3523F91EABEEFFB7436EC6D98D3D51A4210885C4 baovv
520,486,313 *352D0834011B9EAC4313C5EBD6C61846EC401E55 bartromiro
520,486,314 *352803C72A9E391356F74C8AF8F16E2BB7CB0F29 basiltreked
520,486,315 *3521A5B0AB34A8BEE6E9327DAB2923A4086937FA BBK=1
520,486,316 *352359E69A4CE994E69FC51AD98E39BB26D1F367 bc6v9
520,486,317 *352E745F853E48245B57CD844D137FC01DB4B4CE VALENTINBUMGARNER
520,486,318 *35240B7D0E4517FA80C3901CE4076193915EAA2A valeriea.dillon.clark
520,486,319 *352D49CF1712845BFBE30B1F2BAF471F82879CA7 VALERIELOU
520,486,320 *3520A798321D8A63691547D3CC0292D61BA90582 benqsiemensel
520,486,321 *352EEC26936ACCE05E889E02171FB5408AB34E8A bepx4
520,486,322 *352A7D163AA95889B0FDC461FA925EC8F18E9B38 VDO/
520,486,323 *352F8991D4A52353A60FD4658A7D64D4E07496F7 VERONICA-SPARLING
520,486,324 *352346054DC637D7F2834A5E6F7B4FB4E0075D41 vervaardigt
520,486,325 *352E02F2550389E77BEEEC5FAB6F04D84F912136 VICTORMARESA
520,486,326 *3528DB187ABA82848202AC10211999DA86B93DFE [email protected]
520,486,327 *352ABC11CE72EA1C3769C0AC81752B41835BE012 VIJAYKUMAR9
520,486,328 *3528E6D4FEDB7DF5197D91D6D23EA5A21E17D23E BILJETTER0
520,486,329 *3527AFF4FBB9E15BA2450B1366578B170D78057D VILMABAGUZIENE
520,486,330 *3521FF675C01F19F2DC72E7C07B03BDDCB1E8DAB BLAINE.SONG
520,486,331 *352A907BC36EDEEF2BC9BEF5C0C675C0C7ABD99A BLALGER5
520,486,332 *352DB9F19F0297D9B11E3A951AC4AF345FB990AF BLEED-PAIN
520,486,333 *35267546EDE85D606C8503029E7090F2BBE9A738 BLIKKENSES
520,486,334 *352DB95AB214E6AC1D8D3D44BC7CED05B065F5DF B&_M2
520,486,335 *35241844E0FB0C5E51ACCB19B02B2E4163286D54 VUURTORENWACHTER0
520,486,336 *3527740D1AC16F0E9AAD68D3C88BB315319ABDE9 BO3RVAN
520,486,337 *35254972DB1069C5D1EF9304E6B48BAB10E3FC15 BOBYRAMS
520,486,338 *3520C012E731F99ACEC28544550ADA15070F0553 WALLYLISA1
520,486,339 *3524020480B1EB1EE3D3D589097E4FC677C14665 WALT BLANKER
520,486,340 *352B6918B48C7450B555EFA3BE96E18A1F6F6A75 boobooabcdef
520,486,341 *352B55B79D60D2F8C07479B7535AF8190A7EFF5D b######)~o~o-splat!!
520,486,342 *3525CD3EE3002323DF5C8D4611EAE2575A8B3A1B bradkillough
520,486,343 *352042EF488DA3270A75F4DC6237100578114A52 WENDELLBOTTINO
520,486,344 *35243C32BFEC8F365C454EA24405F16BEDE91E5E WENDENERH
520,486,345 *352439A9F5AA4F68B3DDEC8E0FC92F2FB6A722D7 BRENT.CHEW
520,486,346 *352F1915FFA0CBA4C919292D33D9A520AEF552E3 [email protected]
520,486,347 *3520B817ACD49A58715B1BA4EC5212F19666999D wheelies
520,486,348 *3527BE704C2A0326A2F063514A7F8255B2CA3772 WhoWill?
520,486,349 *35225CFEA09E6F3B260112E446BB010D3FFBB2F1 WILLARD.WEGENER
520,486,350 *3523509C470C7795A723D075AFD45BC9D7BBDD9F WILLIAMSBURG79
520,486,351 *352469EA04BBED745FBAEFBB2446DD966EB4337B WILLIEPICERNO
520,486,352 *352D43BF1DC31E9A5BF47FBE6B6D6FF84ECDE032 B.URX
520,486,353 *352D9222B214BA53B514AD94F8651D458007A2AB BWh$
520,486,354 *352C08F0274E9DBF4832D81E1DE7FCEB5C2CAEE6 wombatgoldie
520,486,355 *352E93935F2FF8345E1C555133A1B81EC674C02E CAMPINGANDTRAILERTRAVEL
520,486,356 *35203EF57195BFF8E3201D443AC42AA106263A98 w#v.
520,486,357 *352A0FD5712E2157F01478D5351285F664925675 wwwjourneyoutcom
520,486,358 *35252AB1F6CC22502E38D9A0F77ADAB170EF0500 WWW.NEUENMARKT.DE
520,486,359 *352C66989D935C904EEA2F8C259A3CC0934060E1 Carl-Craig-vs.-Johnny-Blas
520,486,360 *35251B17BB0812CFB5A6B8EE68DDC17FE7D00C46 wwwtreorchyrugbyco
520,486,361 *352753E530BBD5B7558C63197186F2263097BC11 CARMEN.AMELANG
520,486,362 *3522DD7734FE263ACCD75837CE06D07A9F0FF265 [email protected]
520,486,363 *3525CD8133F8261B4BB0308BC5A7107A3F1B24AB }x{.*@=8
520,486,364 *3526D8FC329C5006432C9F2245A4B1D0B00F3A1D xedbmsbw46
520,486,365 *352C29F97E56D790D4F44169976BF705EA35CFB4 XFILESASDFGHS
520,486,366 *3525CF8EA67BED05951C924628562EDCA07FED3E xiaojuan6
520,486,367 *3525D240D6EAB1FA5AA96A6262606937909AE113 XUMARYV
520,486,368 *35261C2E9FB7834AFEE7CBD3D4CEB5EA5C8B6597 C"DI,
520,486,369 *3522CC3A131AA97656364ACD807F51965C7A2808 [email protected]
520,486,370 *352BA927693C75374CAB6BDA69B54EABCEEA43A6 censurait!
520,486,371 *352DE50B50D5150C8995226ABB76FF9D811DC085 YHTEISKUNTAJAERJESTELMAET
520,486,372 *352D1E57D7431A2BE4BE5A0FA2915149D0D916F5 YLEARKISTO
520,486,373 *352797AD99E9AF685A05B4EDF5F132D2385EC447 YOGICCIGOY3
520,486,374 *35269E1C5163B5920CA1BB6B1524607FB84DBFBD CGLC/
520,486,375 *35276EA6314C9EB29D68BD61586089927C991172 YTILAERAHAMAY
520,486,376 *35293E8E8EBCA88C7FEC19D604B46BB434EBDDA2 CHANDRIL'S
520,486,377 *3527523A7FA715A8017BFA62879C0FFF30DA6284 CHANGLAVEAR
520,486,378 *352662D7876D3573A92A35B357A8CA577C1FAA6E .chaos:digital
520,486,379 *352B620504E72A2F0B95AF3E331BF6531A3902F9 CHARLES.BOYE
520,486,380 *352977F159B84ED6C4AC0C3203932EBA363B7878 ZAIROLNIZAMZ
520,486,381 *352C4930D84409CF6BC7DEC051E43FE0883A202C ZALESŇOVACÍ
520,486,382 *3521F82A02EAFDA9C8283F1DD6817CE542919148 [email protected]
520,486,383 *352813BDD7EE3F9DED786FB605B6CBB7298D7691 [email protected]
520,486,384 *3523DC0EA92E405B81760A051A7DB352F2EEEE21 CHO2Y
520,486,385 *3520FF923B7DBD57359E05BB746CCEA7FAB72068 CHOKSOMBATCHAI
520,486,386 *3522BF8F58C089CEA6B813570CC3595C6625AA60 CHONDROSEPTUMS
520,486,387 *35225F40C364FDA8E4F633A846AB11FA6A55E3E3 ZKGHKQIED
520,486,388 *352D6BD7849DE1817D7DF9E52DD92F97CD61F7CB CHRISTOPHERCAPINO
520,486,389 *35246F7FF4FE73B914F412601C3CCC8F3319EE00 ΝΕΦΤΊΝΑ
520,486,390 *35218EAA95BA04E32924186E518776BBF0A7D03D біївецька
520,486,391 *35206743A38CED7E078F0FC0F523E56DE3D3FC7D КЛАНЯЕТЕСЬ
520,486,392 *3529F983A419B1E589E65B9A137E48A7B260A67E КЫММАСТЕ
520,486,393 *352B7B8EBAD1C2C3CE5A2DFF1486565E3AA413CE CLEMENT.MOSHIER
520,486,394 *3523425206C7BEB71278567E3EA1BC2A6F98B261 обменивается
520,486,395 *3525040B09D543E2BABD695AA713A5DED105EE6E CLINTON.BORDON
520,486,396 *352F4321A84176A191D106842BC52CB56DC14A5E CLOSEABLE?
520,486,397 *3524AE8A209109876DFE39BE55E7BAF5B5024F54 c(nl+
520,486,398 *3521D99995BEE7C189AF233C48767AB2C227876E ЩЕБЛЫГИН
520,486,399 *352191946D5DA26C2AAA7BB31ABA2626D1EA964E [email protected]
520,486,400 *352DF32416B95DD87FCADEF02F75B02B596AAEBA 」と呼ばれることがあったが、これはthe
520,486,401 *3525998F7E86B9E348FB867E3B61E5ADED73485A COYLISY
520,486,402 *3525320DAAF78391E4BFB10A9012A82342B21171 ことのはの巫女とことだまの魔女とドラマcd「マドリガル・ハロウィン」
520,486,403 *352F984D8035CFC736B2E1387EE74CF69A5FAF66 CREPIS.MOLLIS
520,486,404 *35204F16FC44DED30120E92FB64750F18B531910 CRESCENDOED?
520,486,405 *352F4EC2826EF1512218BE03693549C99BFB72AF [email protected]
520,486,406 *35218367889E51BC0012146C9675BA7ED99545A4 CRYSTAL.THARP
520,486,407 *35234A7DB269633721F6EF0931CF3C632479BFA6 csd(
520,486,408 *352EEA077456DA475073C0FD110B0E58FE534922 currents
520,486,409 *352868F8036D2CC4AEE5840C521665BE9ACA99DD CUTTIEPIE1121
520,486,410 *352C3B0B0AD2C5BFBFD458197AEE0245722E892D D23/S
520,486,411 *352A99F82F2415FC3D41BA992A5F1CE3EAFFCC06 D4S+4RDLIN3SS
520,486,412 *3525F56083200D163B9BB536A117D66CE93F5339 dallaswerk
520,486,413 *352436A5993A77F69B7062AFC62EBDCCDE8B76CC DALTON.SVETLIK
520,486,414 *3528291DC48B0D0C86B0D09C8904C93695D7FED2 DANALIZL
520,486,415 *35245EF23344E05539992DEE0B7794EF183BE833 09ud015
520,486,416 *35246BE5F5635051F80418AB331EF082D98AB2D7 danielle.goldsberry
520,486,417 *352165DCFCD9073D3F1F5DB1D249381E8715791F 0R3N+A+0N
520,486,418 *352D2FAEF491648503EFBDE0A806C964F52A8F46 dano6
520,486,419 *3529ED176FC45F8072D3B8BEAC26AA7A6974F80A DAPIBSW5
520,486,420 *352D91352E69A1BBDEDD3DB6CE23F8508CE37939 darell.dianne.cabahug
520,486,421 *352854602D6B7FC0B97247AD2B703AF052368B09 104lexie
520,486,422 *35252C1950EBFDFBDF1FF76A6519C08263FE1B23 1215344 exports also grew , while imports declined
520,486,423 *3528F494864BEAA90BDDB33B5D434DDB3D4FDF88 DASNEUEMUSIKALISCHEBEWUSSTSEIN
520,486,424 *3526E6C76E57882A6E42E3051E15B43D5681BFC0 DATINGTERAWRAY
520,486,425 *35284A1FAF96AA78C0D20F6DE133551F47221F74 1343766 operaattoreina-ovat-jari-oh2bve-ja-harri-oh6yf-
520,486,426 *352FB52942CAC5C3A2F86F523D033E810105222B 134472 MIK
520,486,427 *352E3670443010B65942874F4F0818E2CAB466BD db8=y
520,486,428 *352DCEBE68AC3F38E90C5A1D7FB33CFDF1F92D35 Dcmk
520,486,429 *352632214C9F94F9EDF955B049C35459122A3A2E deanlontz
520,486,430 *35286E902E33CC55FBB2C81FF169169797AFAB83 DEBORAH S SMITH
520,486,431 *3529A06847FC938617A40A03EE331E43BD325D69 declamatoireses
520,486,432 *35270D7EC0E39B48DD9BF44F32CC7C1A0A45FBDF 1785144 PALO-EHTI-LEVIT
520,486,433 *3525D7799B033796B5BDAB2E02A59ADC2A359303 DEL.RICHISON
520,486,434 *352E4C3D56FFFC683CFAC369B60794BB3D91791D de marchena
520,486,435 *35219CDB256570836ED77E1BD3EFA95D08A91EFA DEM?U
520,486,436 *352319C5819C074EE2DF25ED1CF21B8D15B5D054 DERAETEL
520,486,437 *35287736E2327F67866679B5E897EC1EDF984612 dhbny
520,486,438 *3529003CDEC677D7824361D35D1D9E93B9EFFC6C d!ie(
520,486,439 *352967ED67D788F7AA668AEF5C980C9F1AC5E15B diegoharrower
520,486,440 *352B554C16983E5F3E8F0AD2123A8A2B8DC3CD1C 1bosque1
520,486,441 *352A0755B42DA070596CB02073AA32FBD22B0BAF DIU"K
520,486,442 *352529B44F5C2C01EF7263A953BF3AF2863C8683 1.goethe-generalsekretaer
520,486,443 *352D1EB89205DD67B07D3F663F21339DA4B32FB7 1.IMATRANAJOISTA
520,486,444 *352AF1C0707801DBB56CD5A46263CD41AC18B616 1-JUPAHTAVAA
520,486,445 *352D0E7108BAC16C3094C97F57FC6F39F7405D7D [email protected]
520,486,446 *352BDF9A04CC99C9F3E13DF9B7438E86CA6CD277 dnkrh
520,486,447 *352B29637002B7174033518EFD9E3C59211D5C1E dn)_u
520,486,448 *352965136CA0AE1319CA832C2A3BC87C8B7C5E75 1MERULUS
520,486,449 *352EEFC35E07D4526DE797D93EAE4196CF50AEFD 1michelinmann
520,486,450 *352AE5BF4C1AFBD96F5BA6A1639C540EBADF3F03 dofoqolipo
520,486,451 *3522B9E256802EF6771EB07220906E9F9F8E033B dok2.
520,486,452 *3527255005EA181CEB1E51172BE2186FB6FB95C8 DOMINICK.ROMARO
520,486,453 *352718FD7A256B45F6C5BA046BA5F7A0815A3620 DONG.COATNEY
520,486,454 *35280212008C3CEB68DFD4B1C7D4C89530647F53 1OR3NZ'S
520,486,455 *352DF9E01BBFF98AFDB23F1D7A1B19890091D4F6 dongkyoo
520,486,456 *352670FB82EB5B6E2661788F75FC42480A669F65 [email protected]
520,486,457 *35253EC86407CB0F871397E4CB70B69FB32A3142 @1PENSTOCKS
520,486,458 *352C38DB573E21B045C5D75D51CA1DF688577F05 donnieamoroso
520,486,459 *3522AF1F2638F2FE2F9A61BA4D391A927C3B2C87 1PLASMA-BILDSCHHIRM
520,486,460 *35249B4311B6CA6B139D170329D05576A4844354 1 pumppaussysteemist
520,486,461 *352967B5312E2D3324B7989579564EFBF8A2411F DONTEROGAS
520,486,462 *35217309E57C0CF33E5522DE5AF8D3111EF00CDA DONTEVACLAVIK
520,486,463 *35295ECD36E49115ED107944A1D2CA7A80A18BAA Doorroll
520,486,464 *352E9365F0A246048A37BB995169B3931C6BE2E9 1.SERPOJULKISIVUTUOTTEIDEN
520,486,465 *3528D5EC8CC6A0580D5799A0ECE05CEF1E649F9E doug.learned
520,486,466 *35298D5418A33A2053E23672FD4AAB61278D24EA dp,yr
520,486,467 *352B49FBEF1394BF065B098F8B0012151F575A87 DREUC
520,486,468 *352B39B054656A7593FFE68BFC808160978B8306 drofmats
520,486,469 *352A85BD4378E9FE79BDCA9F4FED5AF377C0174C 20KAPTEENIA
520,486,470 *3525AD70A454F6CAE40F82687B282FE1CCC26658 20KHEIR
520,486,471 *3525DE08D2AF13A35754C8460EE0F3C6A56B3E6D DTCRI
520,486,472 *35266AF8D8F1C4F315CF63C7B10C5F44BB3936A8 DUMHPAWNGTALKCHYINGM
520,486,473 *352629E59FB9BAE71D2E207A089AB96AAF3A4B4B DUNCAN.DATIL
520,486,474 *352EE3004020F3B350755A3D2674FDF1B4671DC3 2392174 flughaefen-,-mietwagen-firmen---alles-wird-bewacht-
520,486,475 *3523E133A6C2BFB3CF6CABD8499FF1C22019D339 [email protected]
520,486,476 *352DB750CE0B229723E6C125B41D40730CACC220 duroset0
520,486,477 *3520CC916BDB7D1A6C5FD39F568A78213DEDF299 DUSTIN.PINKLEY
520,486,478 *3524A64B455CE99BFEA37091CC7A477D0E869802 24932170x
520,486,479 *3527AB3144F40662AD12B34A2C52711EC384436E 2890383 MOSTGERMANSHADTHEDAYOFF.
520,486,480 *3521897736B8B8CCA70851041AC131AAA37B1392 2923560 VAPAA-AIKANAAN ERN
520,486,481 *3523EAC7352C98BC99BF21FD7E846B91CFC92609 dzr-
520,486,482 *3527FFEE71B3DD5B14878B7689735C64C38632FA [email protected]
520,486,483 *35267C896CBADB5536A4480A8C6C2E40B81723B4 ea=qm
520,486,484 *352B79EBCDFEE712BF5D1F675B1BCE09DBC1C848 2CYNWULFN
520,486,485 *352564F3C2EF6B98D0FB7B9C9A1157A341674C26 eastridge123
520,486,486 *35213B5FC74E3E669209EE26B110FFB9329FD2BE EBAUCHOIR1
520,486,487 *35232ADFBCB4BC4984B4E4B38C3D7E743E741F4C 2ONAYLARLAR
520,486,488 *3521105982177819148A43BAB57AC8D4CA5C4E99 2PAPAMOA
520,486,489 *352D25E0143CB6AFED4A4BAC6464CE8659E44E64 EETACIH8
520,486,490 *352A56F668B9685A67800A6AFD94AC754C2DCC34 EGEF
520,486,491 *3528744F074F1E20AC76927E9357A5587941CB76 EHEBT
520,486,492 *35201334DF076A3589AE6856BA45A452441EDD82 378133 LATERAALINEN.INHIBITIO.JOHTAA.
520,486,493 *352A8E1BDEAD38EE774E3841D4C09E68E41AB601 3DELGADINO
520,486,494 *352ED2C0199BCA7FB84126594F22C4142F013AD9 3==D-`~-`~-SPLAT!
520,486,495 *3525C8DF20C4C2364EA7FBCDD10BD7A7A20009FA 3VIILASI
520,486,496 *35273C46A01E3086105DFA3D545763FF8654F728 422275 GOREY , OZLEM
520,486,497 *352FC5B84EA5768019E55903A924DADDE14C787F ELLSWORTHHSUN
520,486,498 *3522086D35205FF0B9A9FE65F10C231CC40EEB03 4FFILI4T3S
520,486,499 *352B410A438670B17C9E9FCA5CEA4A99FC408756 ELMOBOWLDS
520,486,500 *35255BA0CBD7080DE42BC8D00C550D5EB54A005B 4NURSEAPACHE
520,486,501 *3525881B7D64CE0D2D72FC17437C6C491D1D6FCE 4-on-again-off-again
520,486,502 *35275C4163A7C14A2F33B1CB94555DFC64341E8F 4onechts
520,486,503 *352726F4A8CAC631C9DD3A5123B9E165DE6C8BC0 elwoodsumbry
520,486,504 *3522FCF5EA346764447007700054EAFA81019FBB em6m=
520,486,505 *352EC6535AFBBCBB68371C2B33506631D5E42FA3 EMERLDA3
520,486,506 *35243CE2BAC85452D16AEA6E4B4E881D1717FEBB [email protected]
520,486,507 *3529D3A724055C0DB0C734F67DAC1C37C782B898 emp11
520,486,508 *3523EA76D865BA4ED2C662BA57329A8796F54E1A 535338 LEIJONA-LEVYT-OVAT-PUHTAITA-JA-TERVEYDELLE-TURVALLISIA-
520,486,509 *3524FA55EA5F9BC6CCD4DFABE4E096E45763A3EC 5BRUGSER
520,486,510 *352600C6FCEB5B1C769BBBD6FA4B8D4FB9CEDC1F 5BSWPARTURIENSBSW
520,486,511 *3527B89B940DDD8F042685F86A4C33CC98A87291 entraineuses!
520,486,512 *352563C0CB57B7C9FB6C58157E80C08537B6E71A 5GNIZILAERNON
520,486,513 *352A4C6960F22EAF27853D446C81B2388E850C4F eqn"i
520,486,514 *352C3BB9BD3C59B28898DD578F6672DC1F904B51 erickruffer
520,486,515 *352B7B19D3E458A1D3B56B143F2E7A8D82DBF457 5mygraphic8
520,486,516 *3521AE8285456157EBE8AD5616A211CBA3AAFD30 esqim
520,486,517 *3520FB620501B013A52FE8E8A1F80E26FFE94683 5RICEBISCUIT
520,486,518 *3526ADDAD9659C569D14618E4D10C71C4F958E5D ETO^
520,486,519 *3521DB8EA560F159B54DEB49C3A04912AEC1D314 [email protected]
520,486,520 *352263F46896AFC04901655DAE678C74D20EB513 661448 teht
520,486,521 *3524F6B00F21E3256CEEC4E8C5D65EF96AAB1ACA EYELIZAROVA
520,486,522 *3522F16CA737C6BB0B278C2C5D3F84C525EEB680 [email protected]
520,486,523 *352CAD6217FF45745621D3069EC2EE92BB445EA4 F7610538
520,486,524 *352B73DB1740043FEFC9B56D8575C4F3DC456E46 FABIANINGRAHAM
520,486,525 *352DFD396B93E8DF717C8D73CB7A04B1B2A8B642 FÁDIA
520,486,526 *352CC0E72CBCC2D38CA0A2BD865A908E89BD603E 6EPAEVARMOINA
520,486,527 *352A05C474B25E0BD70EE60C3F8D23C92FDF080C 6ESTATETAX
520,486,528 *3521B74BC037384C02AD7D554DCF6AEBB0543485 FAREEDA.
520,486,529 *352A43CD0ADAF7553E3F3957AF24D04B5EC7EA44 FAYESOLIS
520,486,530 *352068F81A3C0A839004C9B8158BF2E93E974F73 FELISAURAED
520,486,531 *35283A7059C73B86A6CD4D91B811A34FC7BA3D5B FELLOWSLAVIC
520,486,532 *35207E111D2EAE9285FF18314CB3B75F8155C2B4 fijiwaterdisplay
520,486,533 *3525B92A3B73028D6093EECE8BAD0FA3041E08A0 FIRETALKAUGUSTUS
520,486,534 *352228D949A2C308C9B631BECE8FFA012944F980 firmavo1
520,486,535 *35251FAF79A97B6D083F6A39B19F12E6A84FFAF6 floyddagnese
520,486,536 *3520EB4FF146076697303EDDAAD97281218CDE91 [email protected]
520,486,537 *3524437A17BCA1B4746E83F735FDA9F2DEAA3FAE fmontricher
520,486,538 *352A83F8A08A30606FCF597A51FF4485F538C89C FORDCAPR3
520,486,539 *35267B3B74B2E54325CFF5317FD63415FFBE2AEB 777sro777
520,486,540 *35291D95D7FEF3EF2E93D9035E47A8187A76F365 7BSWFRESCHET
520,486,541 *3526333D6DF474CBF46AA2469F059D0F44F3BACD 7CONVAINQUIT
520,486,542 *352CB438C704CDCBBF97CC9F6366C8ABAF80BEC4 7FLORIDATERESA
520,486,543 *352F65E8F495913DB667DAE1DF1B66D45AF61F72 7maatschappen
520,486,544 *352149E397DB09E058E6E4D9D06792BACBB1AD24 7PAASHAASES
520,486,545 *352B6E9E51A792C4763B4BDB6EE7DB12C10F9D03 7POSTPONUJE
520,486,546 *3526FA233AB06931566241EDE0DC9A8EE63A1466 7PTINMAN
520,486,547 *352BD24D7A2A127773F59D4D0E38BA4286F784D7 7SACHLEIS
520,486,548 *3522CE8D45AF4CC30F1452BEF6A93311F1FC2E80 frachir7
520,486,549 *352AAB61807A240E71E3159D7CDBA5DE5A68B417 fraskaria
520,486,550 *352F4780F028DF812068BA474FB487F6945A389F 81E54A
520,486,551 *3523535EDE96D6B2391C68349C8603523B17170F 8887SWXWB
520,486,552 *352A605C4365532246DED14213C67612013ABC1F FRTGRWNG0
520,486,553 *3522BAD29FA7994715FB74CCB0B9C766E9EB214F [email protected]
520,486,554 *352BA30A15A31B2300B74CCD478A1E638462F607 FWOQXHH8
520,486,555 *352703AD5308E97BF0B8BEE75A328093DB9E8EB7 8ILUVAPRIL6
520,486,556 *352B701EF3682BD983FD0491CCAA9B33B410DA77 [email protected]
520,486,557 *3527CACC7C49610097B2AD8A540989FEBABE9CB5 8MASTIMO
520,486,558 *3522BCA6F6EB71A7AAA9537BBA8351DED58C1DF5 GARRETT.BLANKENSHIP
520,486,559 *3528D364E15F03E22CFE0398D9229330DB23B7DD GCALEKALIST
520,486,560 *35235B1A5AA340A3C8E72D4657124EC4FC92EE50 GEBARSTENEN
520,486,561 *35229FABAA501E17BC9C06199463F75DB8F46FBD gedrogte
520,486,562 *35254FF5937FDEE00E6A6D5082B24B7B9B4D39F5 8NIKTISSL
520,486,563 *35284BCF0544ADE5A732940ADC47D2614963FCFE [email protected]
520,486,564 *35221A69D65715CF690004596867BA5DC9B66FF3 8PRAXABSW
520,486,565 *3529526286E9B3CC31B158D485ED54FB9D4463F5 8thatplayboy6
520,486,566 *352893AB938FEEEEB3A60D876D144886DCD02A3B GINGERROOT5
520,486,567 *352A20F339CB68424036379B9E17B1173A65B60C GISSELLE416
520,486,568 *352A300AB7EAA91260A1D7442359DD0D8F818DCD gnikamelit
520,486,569 *352B1D8BF2016B887AC6EEC5F0043576F04FEADF 9BADGERVISA
520,486,570 *352CC2201501DA6362611D1BEBE37B25AC5EC9F2 gomel'skaya
520,486,571 *35278BBF8A8B2A9509FD9BFBD346F25C16FA53EE 9BSWTERRIGENA
520,486,572 *352C9570DB1C6FE1664F428462BF12FE5D2851AE good morning you unpack your stuff yet?
520,486,573 *3520311C14F5B3D616EADF6A652D189D98582CF1 9DEFAULTJUDGEMENT
520,486,574 *3525C2C35F3D1D3979236340DE2C9EFC952F4980 9ENTROPYTURTLE
520,486,575 *3527692274E7D701708A4A6C619FCA215130DB99 9FEARLESSNESS
520,486,576 *3528F750411CCF6A9E2493EBCEEE95A8281EDB7F GOURDIRAIENT.
520,486,577 *3522E6F41D2A8EF8EECFF84AEB72F21B312FAC88 9LENGTHBEC
520,486,578 *3522A6A07905A2536AE3EE67EB3CA97A8E61D5F8 GREVEHOLM1
520,486,579 *3520B35743813AE26AF70BC4B97725A2EBA4231C GRÜMMER
520,486,580 *3524A3A5692B62754FDC542D2B312C666E45C396 9SCERNAIS
520,486,581 *352337A7CF8D6ACF18E2F4DD7229BC4FB471555E GSLY
520,486,582 *352419987B8D49D478616B7F72DED5988DCB28FD gunnerboomer
520,486,583 *352C61D474AD5C25B15E697FD520741289C1CF90 9wegvluchtte
520,486,584 *352107B152C377D25F3C7297D18C520B0D25792F a0hh%
520,486,585 *3521D483D6538875E8F33CEA6E0DB6F758D1EC44 A_0/P
520,486,586 *35234A99564B7C00481A7EAE12BF86E0AADD4746 HARLAN.RIGHTHOUSE
520,486,587 *352EB9EA5B5BF31B9676F0F241A6553D25CD116A a(6fj
520,486,588 *35221D78C99130DD4B60940315F25881998C8324 A9VP5
520,486,589 *352B30AB5E2EE9BA43518BAA2F4C0952641EE14E AAB+L$
520,486,590 *3526E9CFB0379F7114DE6AABEB58B5994AF20D92 Hey-There!-(Hi-There!)
520,486,591 *3524BE445A7DB05A2DDCCE81BFC89E8574426418 hfer
520,486,592 *352CBB4453D303FF1EC3A201D9C1802C9EF311AD absagen4
520,486,593 *352E4BCEF4A55869F55C5B8C9FB594B65F9D9CA7 HILFELETZTE_
520,486,594 *352CE5C8CBAF3761B5A143FBB258B60255A0060D ADANMIGHTY
520,486,595 *352A47402D8CEB0B8AA4EB9E371F509204908A01 ADCC
520,486,596 *35203B8CB30F05A2B0042EEEEDE72F99615E9EB9 HOBERTSEEKAMP
520,486,597 *35267776595692594AC91A259F7704A6AF57962F hochschnellenden
520,486,598 *352CABDD9D411F43AAD33FD952E164AB9CAF5E1D homewestern
520,486,599 *352F9902A4B654741C55F6C2C30A49B8C6ED325C AFAZIJOM6
520,486,600 *352BEE63A83DCFF7612FC5B44F5EC9D719D31FDA A=GB
520,486,601 *35211DDFDAF092642894B7F808A22FE11A748162 ag$ls
520,486,602 *352543DD0BF5858DDE0F7FBB8C786833A12F071E [email protected]
520,486,603 *352BEE5CE6A3A4F9FD3543A2B91F4106FAEC7D0F AHMED.KIROUAC
520,486,604 *352F9F459D51F94C994B1F1658F706C5BD60D604 HUGHJAFFY
520,486,605 *35278306BE81A49BEB6904D464C4AB94636D40F0 aitwv
520,486,606 *3527100A56801D337AF31E9D658216F3AD132435 HUNTERWHATEVE
520,486,607 *352AC208C71DB8B262EE063D6F6CAD6CF76D1163 AKQS
520,486,608 *352F6084D10484F9F35A31F5A8F430C71A7668C0 IAMJUPITER2002
520,486,609 *352F78CB465FE2DDD5366CE13C61903625B9C60D ALEXANDER_GROSS
520,486,610 *352DBE232AC3DB6AB1DA515028CDE2E0CA671402 alexsoundara
520,486,611 *352DA4CB985E060BCB3B4958828B75C7F3E6A428 ALFONSECAS
520,486,612 *352FAEB9115BD7A5A8A3231A50EEE11DFDE8C456 ALTON.PREBLE
520,486,613 *352328212EF5CFF08DDCA0E3F1BAF3EFDF749E92 ilovesnowman12
520,486,614 *3528E4418BE604551267862A0DAA27CD4F83D62D ANABEL778
520,486,615 *352657D14322D79B3F09F174DDC9D4DBCBFACFAF INFOGOLFING
520,486,616 *352C4537F0A9FCF6463286D7FD1FDB323EFDAE20 ANTWANVERBLE
520,486,617 *3527483676DFDBF091BDD5BA92A634C7336265A0 ANWENDUNGSOBERFLÄCHE
520,486,618 *352D99D70D74ED963031D89C20EDD0BF2BE3D95A IRISHPOPEYE
520,486,619 *3524D17300437C9AD83CF7C91496E26FCCFB46A2 APPOGGERA
520,486,620 *3525E92D35E134BFAB794D6FE115C6A194AE6448 isidromagorina
520,486,621 *352231818548A121CFBF4E88C6A31DF32C70EDAB apztasuz4
520,486,622 *352A0AB623405B7801B180F7A2E8F99ABD1B691E ISMAEL.NOVELLI
520,486,623 *3523A12A1488A472036F05316F2B672F6B598041 aqd1k
520,486,624 *3526CBCB65BFFD57A5492BD0D2573CEE4EE9E691 ISREALHINKS
520,486,625 *352B3FF7AA7AD33A509163AA85F05563170FB0C3 arborerait6
520,486,626 *35273E93554E04D6DC3D79CA525ACC7B6271C6D2 ARIE MUSICALI, BOOK 1 NO 15: SE L'AURA SPIRA
520,486,627 *352E1E4432A65A29852BD27FD13BBEB88FDDDB4D JACINTOVAINIO
520,486,628 *35223C854B3C5221631E2BBA62A99A9BAA7DA523 armandostiegman
520,486,629 *35255D51A33B29F5049DAD07D869A75F315ABB28 ARMANDSEWYERD
520,486,630 *3522D1B7C65878C8A5BF320C059B58E26CB2E20D JACOB.GARNETTE
520,486,631 *352032AF78577398E3F25280A78B12C15272F17B ar+ok
520,486,632 *352FCB686DA00CBF78D2DFE833DF1909580386E3 ASKÖKNARNA
520,486,633 *3526F6EFEB0854C1484B63853DEE316603D9F0B7 ASSAF BEN MOSHE
520,486,634 *352C4448E5B6F4EE7B55CF7CF3CC1F260E2E0A08 AT9BK
520,486,635 *352E8948D35F82658E2B943DEBFC5D4A90F383EF JAYNE-SISSON
520,486,636 *3523E6A348E0E6C3F2526FCB1F1DD8895AA2D060 [email protected]
520,486,637 *35263486D7566ED98F2032D57CBAF2D8BE977091 a$u+r
520,486,638 *352245AEE303C8EBB7FB895AB69A8FC6BBED3A16 jennifer.kelly.tisdale
520,486,639 *35255E9718FF553D4A9D93C5D1E2D274647F3DAB JEREMYGELNER
520,486,640 *3526BC8A4A36FC87A747D8FA4CAEDAC51233939D avwbe
520,486,641 *352E06A1E7039A0DB616BF63796B8870F63784B4 JESU3
520,486,642 *352456576D305ECC44A5FE74C4DF05889B137FED [email protected]
520,486,643 *352B2D3A82ECEF22DF7C55C125688DE85D0A9FA0 JIM.MAJKA
520,486,644 *3524809E136559DA62355C9B53C2F05D8DD878C6 b3()z
520,486,645 *352474705B5C9C2E830944C395754FD1AA356D11 johnniedadlani
520,486,646 *35281E414F794263AAE181E6177F6E09C34D3A2A b4s+!n4d0es
520,486,647 *35281DF85D9702DD3CDA813099E8BF6AD5241A37 b6rnd
520,486,648 *35255619E22C326A2E24886CA237CA2F36486F3C B8Vh
520,486,649 *352D357C3C9F3A536FCEF40A91099B78E0B412A0 JOSEF.FRAILEY
520,486,650 *3528FBD927FAF4D37BE887EC5F0BA204D11B0A67 JOSEPHMAKLEY
520,486,651 *3524F58799FB515A6743406C7491056F66AFD174 JROYAA
520,486,652 *3520971F7F2947EFBC6A769F28054B139E678B77 BARTMAULE
520,486,653 *352425356D6B2531C216676F333AA986170CDF26 juniorguercio
520,486,654 *3521529F2714B195C0F2532F4864D21607B215E9 juniorlefaver
520,486,655 *352FBC2869AF41023A098DD41D2D226529BAABEB bavlnárskych
520,486,656 *352AC47C2176A2D2CDCDE9B71D0AECCD9BC48C93 BC(AM
520,486,657 *352E650E51DC46B6CA7F7235FF54B89A4CFCED27 bddn6
520,486,658 *35292F09A11A6F941BF83BE4B360CBCEFCB8B5A5 KARENHANLIN
520,486,659 *3523AE6CE55F3B01AF4B2B01332E72B06B98B511 kasteleninutrecht
520,486,660 *35286AF7D0A1A02D04D3C770E3C966E82FE97913 Keep-in-Lane
520,486,661 *352BC70E6EF77A4157A4725C63E4F9D90A392116 bepf
520,486,662 *352C573091F071D6BF1F31A9ECEB9FAA5615E9AE KELVIN.DEMBROSKI
520,486,663 *352BADF5E1256C01C05189232EAE8FBF43A7247C BERNARDOHOLLAWAY
520,486,664 *35255EF841E59A6EC1F7EACBCEFC0666A7CABD3B berry131
520,486,665 *352A323652CEB1CFC4BC0DDC257BCFFD4467A8CC bertpasternak
520,486,666 *3523EEDAA9A83E09418336BAA95E1A124C86B441 BEWUMBAY76
520,486,667 *3528887D37CCCCF0F05605AB955CFE19390FDCBB BFFH?
520,486,668 *3521D7004F1FB3538B0E5119B94E6777AA56006B BG&FT
520,486,669 *352802E2C76F0BCF96F9936B40F8CDA1D08DD990 bj!h
520,486,670 *3521213A6CD68117ABA10D0A42FDC72BD44859DB BjrO
520,486,671 *352B47B9FD3EF67871F2C8FFE41CDB44FEC2ED0E B)N
520,486,672 *3525231E950BE3AAB106CB1DE9E21FC7741B4FC0 KRAIGSTIEG
520,486,673 *3526CD9691D65496B2E10C71BA2FACFEA673ACC2 bnew
520,486,674 *3521F0B41BC1357119410E6F6BEF3DAA764BBE3F KTDL
520,486,675 *3521892786F2EC786E08C9240F9C2014A58097DF BOBOWAAR
520,486,676 *3522F717ABC5EF1D8240F7EA0B152C58CF3403B7 lacitcelpopaoduesp
520,486,677 *3529C357B5EF6D2B4D81F53FC90E28E3151E6F10 BRESIENNES
520,486,678 *352024A4E73CCDA0169D1076ED0ABBE711B09ECC brittgaukel
520,486,679 *3525D013BCF21937C236D55BDD127593907A7DD2 LAVERNWILFRED
520,486,680 *352EA893B9E3DADEC8E9C40B6315AEDF79AAF19D brudenats4
520,486,681 *35265151A8FCDFE6E875A9DFA5EF89B32BA15A78 BRYAN.TYMA
520,486,682 *352E7F9CAD3AA7E32EA3A9E4BFE9DDCC80F1C216 BRYONCARIVEAU
520,486,683 *3526B37034B5B653AD7C54E26E5DADD73F55FA82 [email protected]
520,486,684 *3522256BCC604EACC86BE43F2DCBA00FF70310DE BSKJ
520,486,685 *3528F0E2ACA3DE0C5F777112CD827299F9A013CB lenardpham
520,486,686 *3527F0D4819A742506BCB2A2D3A3D8C30B6F869B btilises1
520,486,687 *3521E5B46303070180281B8B65F69F726D15DFDA BURCHWERCK
520,486,688 *3529714EA19DE6C2A9AE17A9D5A8D77BCDE45F2C b&v6s
520,486,689 *3524C3C51F28807ADAB27AB35F1DA7869505366D [email protected]
520,486,690 *352FA4D68801F0D6A73435C834CB451D4B19C4B0 b=-z
520,486,691 *352CBD0A0F4C955D18CB8D711FF295BF22EDB755 C60QN
520,486,692 *3526DA15FC3841A1F333D6D697FB9C9D97DFD1B5 californ76
520,486,693 *35242EFADFC88F76537E268D090CB6EFDD0C1DC9 CAMERONSCHMIER
520,486,694 *35287F4512D43B472E4204559F0CFDD22409AF9F LIZ1985
520,486,695 *352F08986C42FB61A2E5697BB27D251F86AB16D6 LIZZIEPIRELLI
520,486,696 *3527CEC2E879BEFEDEFC1B138871A5106991D70A LLIPPENS
520,486,697 *3526BE3DFE1B86B76423C96FC6D69214AB64F918 LLOYD.ALMOS
520,486,698 *352888363EB634FD9FB7D17CE836399478DEC56E CAROLCORBEIL
520,486,699 *352E7EE53B2DFB7991609B135B24705DEC80A685 CARRIANM
520,486,700 *3524179A7E4C986D94B8382BF3C2F62E1D8764A1 [email protected]
520,486,701 *352EBC0843255AE2B1346073D8FE39C97D67A76B CATSDOOKIE
520,486,702 *352F62363D398F7BA1C4686E41634D345701CAC1 luisgleichweit
520,486,703 *352D3DD3C83E1FA136490F2FD6C29841855455AE CCPDS
520,486,704 *35258EDA233CFB0454F59E1FABCCE149C33F7485 lymantrifone
520,486,705 *3528F5FA95C81539D75C6D7D02F97E57A77CAB0E LYN&THEINVADERS
520,486,706 *3520CFE563AE4A77023BFA84D082659D7D07E96D cf(m)
520,486,707 *3523F712B46C9B716567AF83BDF82E3C90634E64 mahaiza
520,486,708 *35212F7B648BF31E4C0F5EA11CC9F4C624C7B43D CHAPTER13-02:ESCAPE
520,486,709 *352770CE6E535AE94A1469421313E25F0DC82D74 MALCOM.BRASBY
520,486,710 *352A870C97E6580392A6ADCFB5AB64F6EE6A83A5 manacita6
520,486,711 *35231B16B32146CA964E1B5F0019B187C2CB5728 chen陳堅
520,486,712 *352DC1FB7C9E5F47065B084E817556D65AF6683A [email protected]@[email protected]@1
520,486,713 *3523BEE43F6C2CCFB598064C9C40E60F05605A3D CHRISTIAGRACE
520,486,714 *352A83D0B3DA9AEA58C15317ABBDEE80AC84801B marlonsoja
520,486,715 *352E9C941EB0F593E79A4DB7907F16DE9DA04D2D chrobrow
520,486,716 *3529E1857BF3D6716171FDD3DC5C5A1CC76789FF CIECZKA4
520,486,717 *3529C67D612DA1F19522508E6343675503D0AFBB MATERIALCRUFT
520,486,718 *3529E6B090B351D2AE469C0C7E86B2E2FDAEC26D ciq!
520,486,719 *352186BC28BF260807EEAE3A2402EEF3207E27E8 cix$o
520,486,720 *3520B3FC83408D4F68BDDE1631EB0832A29168E4 claire.dyer
520,486,721 *352C4B2062D8CFF07F1B5C308F08223E46037AD7 CLAUDIOLADAY
520,486,722 *352741CFC1FE40496ACAAD08C0A5CB3785324AFF claudiquer
520,486,723 *35222ADAD4CCC5D66329C2CCE704942CD0940606 CLAYTONSTEERMAN
520,486,724 *3527DEEE7320DFA1F1BB7F6FEE64FE4756B7437D MCMAHEN..M.IH0.K.M.AE1.HH.AH0.N
520,486,725 *352CD20CF4A250CAD5CCF825138F2C9A56D3018C medhavt7
520,486,726 *3525FF91D824D10A3050FAA76604E5748CEA10AB [email protected]
520,486,727 *3524068152C8EB45D907A7B44C3B8770F92DCAC4 CN0NO
520,486,728 *3527ACBDDD57E25D187DC54B8241C0863DA2C89F CN6ZR
520,486,729 *352AA22A97C9BA49DF90EF26F138B55BA1E5FB84 MICAHCOSHOW
520,486,730 *35221A328659E334BAB058E290013656E062C108 coagulated-protein
520,486,731 *3520EE01C70E1C87599E1A7D813CD2206285A4DD CODY.STALEY
520,486,732 *352F854A01F50C884F3FF68086F5B2E50D0C60C1 MINDESTQUALIT
520,486,733 *352B89AD4884D8313CF5E8A9A074D01E0FCEBA0B CORNELLSTEJSKAL
520,486,734 *35229C8841AFAFA211E9117F49F46A779063DD46 MOHAMMAD.SLAYBAUGH
520,486,735 *3527D646D87EA4D8075772C2AA2DCD7369CAB01E monkeymasters
520,486,736 *35206EEB4DF8EC721541C04B655CA55147E8A6BC C?#PD
520,486,737 *352ACD8B1F9D0BCE2368A51D72359494BBE54114 cr)ig
520,486,738 *3521782D5077787783B6AD80B8BE44B5464E9975 CRITE
520,486,739 *3523FDBF6BC5065ABB91862F95579743990AC2E1 CR"WW
520,486,740 *352E4EEB1F2A686AF0EE5EBDA4C5E9C9C71708AA ctza2
520,486,741 *352700E8C44B7105BFC8956E63E74560C5F46F86 NAISKOORILE
520,486,742 *35287590AB63E1D81663CBBB8A73E18D6620A3D2 currents
520,486,743 *352968508BFD137FFDA95A2526822D13E60EC15B CURTLABARGE
520,486,744 *352C1A5BA020864AC498B080A43332F1119D7DA5 curtsmoley
520,486,745 *352125D4D686A0DF998BCAACC2D3353ABC7FDB0B NATHALIE GAGNON
520,486,746 *352A2EE26644FAA5BF675AB8333229CC9E45F992 CvMd
520,486,747 *35298F16119D748EE5BB01EFDC09A1D767497E05 NAVEIRY
520,486,748 *352141B262AF7D353013B7407146FC4DC2538732 D3LQO
520,486,749 *3520DF9FB838010D1E56D8A50F5A374A19224E4F D84CC070D7C78BE6700705A9FCEC836D WONKA1603
520,486,750 *3526A04CFBE48E8A7865AF108F3952A3895A96A7 d8ph3
520,486,751 *35291A6D350085D30A8AD216E619178C0D521122 NICOLAS-PEYRAC
520,486,752 *352DD3CB83232666B025F401335048C919C0778A [email protected]
520,486,753 *3524A4CB9B1B036A636BC14D31835D7AE03E83C8 NM1240483
520,486,754 *35239EB541ECC504C9D9C2E1C449FCF2860D6854 NNVCLTY6
520,486,755 *35255950BE4AD54CA6402225FBA847B3552910A6 DANSAULNIER
520,486,756 *352525853E756E4142399F1A7AD0415A281E47EF DARTWERT1
520,486,757 *3529D94EA543F92501939F8108F87DA0D608A949 DARYL.ENAMORADO
520,486,758 *352C05A19E24A1E2005EF09861383DD1C80C0691 NONM473RI41I$7IC
520,486,759 *3526800630749F4B3EA3588D5F0BF2AA9F81DDB0 DEANROSENBROOK
520,486,760 *3526E4E35238E9A74B553A6BD2662501060F3856 DEAN.WHILLOCK
520,486,761 *352C92044089BC1A8422848E0AF393ED81019495 DEBBIE SALERNO
520,486,762 *352EE2E55F7ADAC0DCFAA2E161813937BF20CFEE OBJECTTOBEDESTROYED
520,486,763 *352A30DF968F853D2868F9D8E94D404867E851A9 delmardoehring
520,486,764 *352D4F4E0D01EF3554900526493E195FA6EF42A5 DEL.SAVELA
520,486,765 *35282E7CDF1ED19C1F52BF9ED33959F197F1C016 OGLU
520,486,766 *352D83B2BA6BECFCF67343285CE9593DB8F182C7 OLD_BOLSHEVIK
520,486,767 *352D5F3E7399C31D1D9116879411ADFD537B25D5 [email protected]
520,486,768 *352AC57E9D1AD42743163E7D1F677FFF2F91D8DB denisecole
520,486,769 *35274C45F7FE42CE924033C8925300716D6F0FAD ombr
520,486,770 *352435A0836C3ECBD80DBC4345343CB3E0E479FA des-notes
520,486,771 *35270062C9D5E68B6DA50B7E6E59CC001BA1D94C DIGGERDRAGONFL
520,486,772 *3524931E1C7999B1B3F59D3CBA76469B15CD88C3 oswaldorassmussen
520,486,773 *3529B76D47D8EDE3BB327AC606EABD94574DB444 [email protected]
520,486,774 *352FB582B175ABC7DC40570951D508511E1C840D DINO.LANO
520,486,775 *352931423364A991D9A670201C469452AB345047 OTTERLIKE
520,486,776 *352D5A45DDD48EAEE4F4ED62F1FA92D0B293DFF2 PACKTEST1
520,486,777 *352C6111EB594CB074D630F1AB6DC489E49C3682 DNELO
520,486,778 *35284A06E76A8388BB7112ECD8879FAB18CEC091 [email protected]
520,486,779 *352705A8154DA2C2E460AA4B637B57EF5D5FFC39 DOMINIQUEANTTILA
520,486,780 *352DDD5936728B7CD6ED38A66256E34DF5137072 DOMIY
520,486,781 *3522EDA82CB35E08A9F52CE638D944FD61CCA95F DONGUNTER
520,486,782 *3521000727629F68E1CB291A3CD193DB3AF1F4F1 P####D~O )O(
520,486,783 *352CB36D419DA98BAA7C0C0CED5B27212EAFD9A2 [email protected]
520,486,784 *35239148B3B5AA4A0E73E67F1C65E98318CBFDE3 [email protected]
520,486,785 *35281779E44569593624D494D40FBA6BA516BBDE door,wood5open/closewithsqueak/bounce
520,486,786 *3525D9595958A8D23BF98E7D011614940952B5FD dorothy.weitz
520,486,787 *352FE940A21110336E6BBE7B17F005ABE030B31D DPNH?
520,486,788 *352D899D8D6232DAF4CF0B37B9D18B50B89620F1 DQTR6
520,486,789 *352DF1239973BDD3AA6A27F137056E6F743605DD DRQK
520,486,790 *3528D48F6DAD499187E4787909CDDC24B2E8583B PORFIRIO.SLUPE
520,486,791 *3521AA488CE8AA2D28833F93D125B1D1E557D1F8 dubbings
520,486,792 *3521B2E83569241B3D439D7258207255B439EF66 d-uo
520,486,793 *3529658011035B65C186F7D18130A758B170EFE4 DWAYNESADA
520,486,794 *3523C26C779AE33AA26DA9D25931ECAE43BFCA57 PRESSURIZLOEMOS
520,486,795 *352E9E7C87C959587983530DAEBB93C4665CFFEA prestongooden
520,486,796 *352C6CF3051B9DCF75874F90B5A9C48775908B85 DXXG
520,486,797 *3529A811511287557C6F30CC2F2F076932EBF98D econfig
520,486,798 *352BB4AA53D5A149036C9BD7946643496D9B3A14 [email protected]
520,486,799 *3529487875095C80AB84F9F5D7D90FD60E113655 QIUELIZABETHM
520,486,800 *35284A4F0F78779051BFCE1FC9A38A3A9FB33E61 Q------P.~0.}O{
520,486,801 *352EDBDA49D9D912EED3130B97081E08343427EA ejtroode9
520,486,802 *35272234BED7C1989F7E0175C086E6DF0FE0410A EKABR
520,486,803 *3523319C4A112FDA6A4CCE63325C86BF08CD1FA4 ekihsuok5
520,486,804 *352FCC99DCDFDAE2F1F3896E8958EFCBCDACAC1D ekottaragamastra
520,486,805 *3524861C9F0A3B77BCEB654EBD592DA608718DE9 ekstaasin
520,486,806 *352D486DA9BA9114A7A0CB38026BF8D26E1F083F RAAMSESN9
520,486,807 *3528612613BAF87F46495CF30A7A34FA367B7B91 RAFAELHU3
520,486,808 *3526048007B08799D66CB749089A22B1C143983F RAISYUUS
520,486,809 *352643A52872694718CEDBDB8968E369BC78882C RAMON.HOFFEDITZ
520,486,810 *352F1398FCAB165FEEB1B3BB5B6568A73AF9A223 RANDALSIEGERS
520,486,811 *352554413A3E7ED72DE389AE180F351F086350E0 Elvis Was My Daddy
520,486,812 *352C612ECF1137E064612913113021571028EE87 emdub
520,486,813 *3525D177C6BDAD9E04935D8EBB94AA6F105C8B01 ENBREAKB
520,486,814 *3528CCAF509CD1ED66A2D56BBBDC2B234594D7D1 REEDMORSE
520,486,815 *35228356B3FB57E8B5411989C4D7BBBF9A1A8E7A [email protected]
520,486,816 *3520E6DA24CF099B8296B9E535B0A94A1066E1C0 epetzanit
520,486,817 *352752292E8549CA89F2B3EDC0FB92B34047D07F epistropheus9
520,486,818 *35251CDA01A78FED2B0E74E808EC123FE848BE4B eremiet0
520,486,819 *3525ED1ACEF4C9B9574DB870F43F9CFFEBDBDBD7 RENUAL.1
520,486,820 *3523E66A5218B557439E21138A2EC4DCF428B388 replacement.for.rlogin,.rsh,.and.rcp.
520,486,821 *3528F36CD8D18E96DEEF876EB79178B81F861C53 esserare1
520,486,822 *352164E916FDB98C7FD462BA2FA430CED009BDF2 estebannicosia
520,486,823 *3527FBD0720CB53C8E92C2C6360EF255A6BA1F0F retrvslepmets
520,486,824 *3526371FD3BC825FEC4316BCD27DA29200024207 rever8er47ors
520,486,825 *3520986DBBC924BBB70A95382206CDAF52A8A9AB REYKIILI
520,486,826 *352165A1DD82AE549AE8226E67C8F4EB58F5F2EA RH6M
520,486,827 *352B5014B55FCFFFAA53F6975B052EBB803D8B9A eugeneheidenescher
520,486,828 *352669978FE539DC56054A42ED908F29F8EF6DB9 ricardominnehan
520,486,829 *352E7693534EE314EBE2E5E4DB4565243D4B4A02 RICHARD.DAGDAG
520,486,830 *352DF83C791F19E25AF70E50CC51330E73191654 excipula6
520,486,831 *352CF936B331C44E506903B2259B19B282031B7F ROCK.DOKTOR
520,486,832 *3521CC310C36079DC0F0A3A9ECF610F53F4994F5 fabianpapallo
520,486,833 *352FC5806F820B24D7EFCB672520C9BB8D245A1E RODGERMARWICK
520,486,834 *3521A472B37F4DC942E61864B7A072328C7E85BD rodrickkovats
520,486,835 *3529CB6BEFF6507046631568A8F1BC41B52FFB73 rodricklimbrick
520,486,836 *352FC25889AF9E263C65B05CB96E99675831E8D6 ROMANCHÓN
520,486,837 *35207CA5D0974231EFAD419CE237C6807EF5B9C5 rome1957
520,486,838 *35268EF87F0DBC911C4E320700A73E0DC960AAAB RONNY.PALAS
520,486,839 *352B181327E5DAB31DB3F35A063EB6DF60766C52 ROOMED
520,486,840 *352BB32EE5B8F86922554116CE3F5431644EDFDF ROZPADNIĘTYM
520,486,841 *352CAD430E1450F9B664543166E84EE763FB9D19 RPHALENTZ
520,486,842 *35208B146549780579C5955537A12F8FB2840D85 FGHLEON7
520,486,843 *3520F64ACFB9F0FF3DB97FB986EC0288AB27A463 RUBENMOZINGO
520,486,844 *35204F4F29C30EE7FD2CFBF9D96F6576F167985E FILSLUT
520,486,845 *35285AE8C28507545C3C90A8D819A75E7D03DFAF financielle!
520,486,846 *352A49D1838639F921C2770CFCF02603320A8944 FLOWERILY2
520,486,847 *352DE33BE70AEF16AFD7FF931E1D3EF6ACAC8583 FONDSPRINDF2
520,486,848 *35245B040E422A0263508FB94A17B3C309159F5A RUUSSELB5
520,486,849 *3526A46E9B8AC7FDA2772B6B9EC712E2AA587EBB FORMELLE
520,486,850 *3526C18BFEC4635A9F8890FC1843496CD5001973 saibbus3
520,486,851 *352832F6F60ACDC255924C1FBCEE4BA54AD8F199 SAMFORD.III
520,486,852 *352EE8377DD58A5D4EA1BEA4811AAE2C4421A6CD SANDFLY
520,486,853 *3527471FE22191DCF077E4CD292ACB2F0CAFC266 FREEZE MOON
520,486,854 *3528A754A70B4D629BF8D9F60D6CE94601D07A6A FROSTROOT8
520,486,855 *35263A336304C1DFD5AE7B5EAD18104112C7D85B santangelo13
520,486,856 *3524F946B8F753D38A9A1C333ABFAFE29DF389A5 SANTO.LEGNON
520,486,857 *35289AA42EF36B80773BA078D0C3038AA93A4AEC fu4
520,486,858 *352BA218ED39277DB99FCB64071F19DFEEF33840 FUCKED-IN-FINLAND
520,486,859 *3525C47490F26CABC1906207117C0CF5EC35859F garfieldrardin
520,486,860 *352D2CF420FDEFAB62B442E165AFB36F7E20F25C GARRIDAS3
520,486,861 *35221EA142C86373C6A7371DFEAA5ED97E7018A4 GENAROFIGGS
520,486,862 *352950CCCAB37C00BD8DA738433813351BFF61CA geoffreydesisles
520,486,863 *352C82BFC6107E2C12A4C47FDADBF5B1A331E7E2 GEORGE.SCHUUR
520,486,864 *352733564ADBE465439B95172FD08E40427E383D SESNANIF
520,486,865 *3524E3556600F08A66265A9AC414576748A0CD1B GERARDFORSELL
520,486,866 *3526035D7684F28AAFE5C421EBBC9F5236817EF5 SEVENTY-FOUR,.SEVENTY-FIVE
520,486,867 *3522BE5F30F0552E2C53CBEE2EB67FE83B0E7987 ghetto love (feat t-boz) (clean remix)
520,486,868 *352E04018CC47C8FFD5C87FD2C40A981B201A950 SHAWNBRICKNER
520,486,869 *3527A3646AC3FB03704BF32EC3CC5DBB16D3F877 shermanmartell
520,486,870 *3529BC0C171681B9A5FF9E42BA4C63287DFB2136 glorifie
520,486,871 *3520323348B29139A2D112C54B44DD9A06F3F9E7 SIDEREALLY7
520,486,872 *35263627DCF1F1968007E420653F1390E82E4BEC S+IGM4+IZED
520,486,873 *3523CAFFD8713E545AE0D83D58CACB7A81E15AAE GRAIG.LEU
520,486,874 *35223A58A584FFDCA2B6D7AFD32A1A473B950AA4 GREAT-GUITARS-AT-THE-CONCORD-SUMMER-FESTIVAL
520,486,875 *35208C94CBB0AA19804E2F598291C88907A81634 [email protected]
520,486,876 *35298A4485C1DF0565C912084D589272DF608A02 gumdag
520,486,877 *352851DE19516D7E7601CA9BF7382EDAEB1700BB HAL.ORDMAN
520,486,878 *3524B646098D92BD40E866A520552991EA493E96 SOLRIGGERS
520,486,879 *35284C4FF08A3CC35E819E22851D0AB203B30B53 HANKATTILIO
520,486,880 *3521F476E2C1B54FF26B3CBFE4071E32A87DF9A7 SONARSCOPE
520,486,881 *352BAB648D0EFE17241AA808ED8535B4A440C03C SOUTHBUT
520,486,882 *3525CC2292E5C425D1D5B63B98749849AC547074 spiral-coda
520,486,883 *352F2BC145FAF67DD82948A8198BEDE202232F97 SPUNKYMURPHY7
520,486,884 *3523187E820E2759F3AE83A6D74700E608A22EA2 sralau
520,486,885 *3520AAA42BA58F5A46F9C2D8DDF17E2DBB32DAD9 HEHOUKEN
520,486,886 *3521207053E096A96EB7534B40CB1A70BB31B970 HEI!-MAN
520,486,887 *3522164D6206A75527E798C27C46FFBF40935AE6 hero-(super-hero-mix)-(feat.-josey-scott)
520,486,888 *35258E609ABFD8ACDE18914069E4E92958D4F7D8 [email protected]
520,486,889 *352DBC70B06E185890B55B0EEB8884AD5A56E090 hmi-phoenix
520,486,890 *3526BECED39E32CAD62788E7CF983EC5F4131619 HOLLIS.YERBY
520,486,891 *352163E8ED001F36F89D6F292294761DC23BB4A9 HOME.SHOPPING
520,486,892 *3525A3EC4469BD178E2BC543FEDDEA824DC4AAA6 stumpieses
520,486,893 *352BBBA765748BC2556E86F410D1F75956015172 horaciodos
520,486,894 *35209EE2E8B4BF22DD455970C4D9A766EB5EA5C4 HOTELDESUEDECOMWWW
520,486,895 *35233CF8C5489AE04FF7FC9BE984C6C4A80EA0CE [email protected]
520,486,896 *35283FAAE7C967949B2B2E23EB382EFA718027F7 HOWARDSEMBRAT
520,486,897 *3522F26373499978E80C56DFAB51AAD5A89D2492 [email protected]
520,486,898 *352A0814678E3DBDCF0E6CAA85C34606AE820B0A HREF="/NOVELSFACTSRIGHTTHEMWRONG/LM/1C4GYEYZZQV84">3
520,486,899 *35272A6F3AFAF00457C39CE9F2AC89243B08DAC1 sundancer(disco)
520,486,900 *3521DCE6D6C56D6C8E75C7E506751D9BC947A136 SUNSHINEEUGENE3
520,486,901 *3528DBF0C896A3C81A1CEC5486B7ECB976D0528D httpsifycomnewsinte
520,486,902 *3522F0EAD4F128E41F541BD0D2979CF5CCBE5DFC [email protected]
520,486,903 *3523CBF5351DE0DBF2F1D761F6B6986EA7D73F69 svahovit8
520,486,904 *35236ADB67D434C33BE98CA9994481F74A00D6F7 >T3BAA
520,486,905 *3525583AE36D7DAF0812938B201C863294148538 T4RRER5
520,486,906 *3525AAF228D34F4CA7E64A72E5CCE9CB56E512E1 TALKDYCERED
520,486,907 *3527F171264CCFF7C29C33F7A582E4E1B385F2EE TALKLANSTON
520,486,908 *3522B41D012103754C0DAA3F292426C96BFB3C72 IEVEBSW9
520,486,909 *35263BA73BD8E5588EBA0A6022B44A55729D3379 TAMARA-MCGREGOR
520,486,910 *352756EC8CC9F28BEBB6FA6FB7E2A0E618E8CC8A ILACIDEM2
520,486,911 *35275B00F8D1F2174988C65169E37B7B73F5599B teodorominerva
520,486,912 *352BA5B4A6055543A5AFCF6AA32F98B5DF6B9BE8 TEOKOKWEI
520,486,913 *3527FE68FB636DE3630AFEEE469D2618C80295DE TERMITEN6
520,486,914 *3525C516F32D6F7B54F04D85ADE7861C11BF4857 incubano
520,486,915 *352CA588EECF4E1AFAAA52AA488A51CF71FFA2AB TERRENCE.TANNIEHILL
520,486,916 *35264C4E895A3ED57D1643A6EF0732ABFEACF39F INEINANDERGEFALTET
520,486,917 *3528C455F1853E8D45BFB91BC4DE098E61682F9A informationsstrmmerne
520,486,918 *3529E673F69E3F164D59C5C453C6DACA11E3980C informixginger
520,486,919 *3524B5D054638946F24ED41B6BF6B016F2B25B8D THATDOLLARS87
520,486,920 *35208F14F884CD768F734ECE424B6E4B3CD6710F INTERWIKI
520,486,921 *352D279B56C538C85DFFE43836ECD441DC2CF5D1 THE.CHALLENGE.FROM.BEYOND:.A.TRIBUTE.TO.H.P..LOVECRAFT
520,486,922 *3522A4AB3E75640D0842648625660F3D60C4E02E ISAKCZI
520,486,923 *352A52A8204BB752F2D0EA6E41D3AE994293F6E3 thesleepingbeauty:lefin
520,486,924 *35254AC64EBEE08D3C3A490AB6606133851F0E89 THOMAS-ELLIS
520,486,925 *3525FF02EFA806F48B558A81CBD8F4090126A6D1 JACK.OGUINN
520,486,926 *3523EB7DBBCCEFD33F39448F7700EAA3DB105D9A TIMFERGUSSON
520,486,927 *35237526A1C2F3A2D21DD210B1E7F125665D4603 tiroza-(feat-bruno-m)
520,486,928 *3523687C6597B87CB4FC50180B6389ADB2881064 TLANUSIYI
520,486,929 *352633A286D58E01EDA5D0C7AE11E5ED6FC77CDF jamiehempel
520,486,930 *352642E7785528A8E295E1C6E8B0C1E32C8B92F3 JANE SMER
520,486,931 *352A1A2D412E8401749035EFB951D88D6E4314E4 [email protected]
520,486,932 *352494559AA40E2D49F7E49AD204B7C25AA4A827 TOMMY.CALZADA
520,486,933 *3520B73561BC8581750720A9767D687F4DBF748B jaxon799
520,486,934 *352E6327A56D8A75FAEA972494278395ECC6D9E1 [email protected]
520,486,935 *352A2B8884F43DE7DAE8F3AC99082E996BFDCD7D [email protected]
520,486,936 *35287B4787E74AEE52DB79D1F1973BBE2C6DD7CE torneen2
520,486,937 *3528FA96E5C37F5EE4A1DF8B5413366D91AA1BD0 jenniferlarsendavis
520,486,938 *352BF096CD4D4B0FC3B94113C7F8142D59621378 JENNIFER.OTIS
520,486,939 *3524DA3CBC500685F85D67F68D266BE3A064C9EC TRASSATT
520,486,940 *352CDAC7AE21D03B29CDD2076F51F7D24DC16095 TRAVISHONG
520,486,941 *352361C82D587A08C43CCFB6D22864AA29BD906C TRENTON.GIRTON
520,486,942 *352BA46C5E48034B14DD4D584BC61C3092DA061F JESUS.PLECKER
520,486,943 *35236BA10B9095D0EFB49A26AAA059219E48C376 [email protected]
520,486,944 *352F27A8DCCA61C1CFD20FC79D09D0A25E9E4B24 [email protected]
520,486,945 *3521253E3252166132E6981581D57D5DBA481631 jiban-krishna
520,486,946 *352DA7CAD1CA03C63316082C1023815E2B902955 [email protected]
520,486,947 *3525F3978128011E8508A543ECF32D5753DD098D TRIX-STER
520,486,948 *3525557621A839B34772E09018AD69FD4E120068 trlstrls0
520,486,949 *3524222E2F90B0F4861D232651C2000C06047BCB trumandelosier
520,486,950 *352FC020DEAC58329F404AC6C53F97447CC4FE83 joanbakewellinterview
520,486,951 *3521DA31551A0E236A8C064017D0A32BE1E93EB9 JOHNNY-SAGUN
520,486,952 *3526A15D434CE7F9ED772C7AA6598714AE019A1A T}UU
520,486,953 *35281ACAF3895E24CD5CE14740B3B3177F9CE6B4 TWONY.MAC
520,486,954 *352C53D5BD666087E694FBFFE60FF8B3ECF33A1D JORDANCOVERT
520,486,955 *3529BA9A26F8C3016B5C49685505940942F051B5 UBRIZZYUBAHUBZY
520,486,956 *352DE46D4E0ACF915CFDE1F2AC14CBDFC4E3650A [email protected]
520,486,957 *3525F8C81C916D490D04C86B5DE455CDFF4FE9EE juc
520,486,958 *3520D698D822A15BB51E748F5FC0E5D79D4CE511 julioappello
520,486,959 *352F3724A669ACB552B4028813664DA15DEC2E6B [email protected]
520,486,960 *352185368C3E43FF445A06355646540A20F27EAF ulfhednirs
520,486,961 *35286DD868E597BF9429D0C65F55BE6AEEF33714 JUNIORVOLEK
520,486,962 *352F3E5CE54803EDD0AEFC099F32F6EC0B8CB4E5 UMA CARTA PARA DEUS
520,486,963 *352952D89C01EFD2CE481B6240570672A6614C79 JUSTIN RELLA
520,486,964 *3523D19119960773059ADC9F55F03568ED595751 UN-BUG
520,486,965 *35233D41F181B369FBAC37DC71140A36D4F3E156 UNNTODAELEDD4
520,486,966 *352D630E41419B35470DE850AF8D32688514DC87 UNONEROUSNESSES7
520,486,967 *35240F792E9EA7C3058C47F126D24C7D6E5BA5E8 UNPROSECUTABLES4
520,486,968 *352161C1125D4B8AAAA26279860D3B3B4ECC72E6 upgradesecurity
520,486,969 *35226CFBF850C8C021E7E78BCC0F5CC5651BF3A4 KATHYBROWNE
520,486,970 *3520DAE9E8447C9265FA837356A1F41476D01C9A keithbaize
520,486,971 *3527A3B41C5B003374C10A93403FB8D749270063 KENDALLWAISATH
520,486,972 *352D3EEAC115E0FAE2C8058F9292F31B3BEE8DB7 kenneth.mac
520,486,973 *3525346B9B144F71227F0B27E6080BE1689394E4 KENNYRUNCK
520,486,974 *352EF15899B00A57D0F740193B5CA60BE53081F6 kenpetrunger
520,486,975 *352865234B0F3C7CF45D4CC3A0EE45C5D5E35F36 [email protected]
520,486,976 *352DD42546A1E06FB839C1CE7257EED26C78B237 VAL.DENCE
520,486,977 *3529495117B980AC3F3EB4178F8065EB324E5206 KESHCHALE
520,486,978 *352AAD9FC0E71CDC6264A4342E3D30507216BA4C KHAYRANS
520,486,979 *3524B3290611188689F10DD20B73E08E7C017B35 vandemere
520,486,980 *3521198EFA32234A682037494F6E8873EF198B4F vannilyn
520,486,981 *352A687D918314E96005B2F9166109E52A376A25 KNEWLEN1
520,486,982 *3522836862FA76602C6A0E6B99CE949917AC69C5 KOBRENIK
520,486,983 *3525A48A03F309729CBD73F9191AD5ED4093912E venglovskio
520,486,984 *352070119CB0A81FAC51A091809A1F9F02A7FA14 verbuigingsvorm9
520,486,985 *35258098BF0E469753EF9ED1C80023F708BA7BBC VERNON.OKERBLOM
520,486,986 *352A1A90D3E1FB7BEB2770EE20A5EB0E567F52EA VERSISTAS5
520,486,987 *35259C33E20D4952EA08D38A5CDC1EEF0792953F VERVALSEN1
520,486,988 *352912CA2E3E7CC7394C327EB72ED5BD58038D09 kristine-kim
520,486,989 *352A4FAFB439625A84555AF2428BB75C2CF9061D KRISTOFER.UMIN
520,486,990 *35219B1F832F9101A89E804D62B7F2DC385E61B2 „kronengöttin”
520,486,991 *35253469F4089A9E107D4143E5D27843A8538C3E VIDYASAGARRAYANADE
520,486,992 *3528604D394B42FF4611B1CF1E4FEB1CB9A73504 kumudhufernando
520,486,993 *352B1F675A9BAA9F280698533A130CBEC536035A kurtruthman
520,486,994 *3523FE2E2BDD00714677CC512ED01BD5A5DF0CA7 LADYPICARD
520,486,995 *3520EB7F24D424F628E3DD32C92D08AF43AB3C89 [email protected]
520,486,996 *3520888996A3A657D48104C74871521233876242 LAMONTBACHINSKI
520,486,997 *352E7C74F9B6989A7B047CFF5D5D9B4A615919C6 LAMONTWARNIX
520,486,998 *35214B5E5F69DEF69DD69E929E31D7724349C8F9 VIRGINIA BOSIBORI
520,486,999 *352281C00BBB7169449A9BF66CD2F75D47650CE6 L'astronave.che.arriva
520,487,000 *35260F171B86BE2EBB4424319472059FD74A78C6 VISUALISATION FOR THE EARS
520,487,001 *352E2AEA9AFBEC9B22E4D237CAC249B1E6543211 LAVERNETHACHER
520,487,002 *352D7BE0C210BF8364D71DE8A88E3F67BBC20AAA LAYTON.LEWIS
520,487,003 *3520F88A13F9F3DAD2C5086CC9804B2D383B7824 LAZARO.MCFADDEN
520,487,004 *35256643CF772DFE3BABF75FAD5DCFBD67B8C089 V{LILASKUITTA
520,487,005 *352CE3C8ABAB5D069DAF8E7E33FA5DC4197E37D0 VOLTAGE.DANCE.CREW
520,487,006 *352562A27E43CE16E3089192C762A03409E72642 VONALLMENED
520,487,007 *352E9FE1FB70E711A03929B1C8ACAB8A09AC01FF [email protected]
520,487,008 *35278AE9A680B7F99F6CC7C2EB6D0FD3BEF48CD9 leonardleiker
520,487,009 *352C3103211AC790F80B05444EA0B7A73786488C LEROYMICHALICEK
520,487,010 *35226613DC2B8BC91D96FDB15342284D3B68DE85 V>+Z
520,487,011 *352C84B4279A1BE8CCA1F6B6886A97752ECDBD79 LESTERKLINGSHIRN
520,487,012 *352208C475E3A7BDCC9A252B39E07E78ED758D77 LF|`
520,487,013 *3528C2233349CBE62C0FF46682C07D13F3E561C2 [email protected]
520,487,014 *3524BBE7E555F1CB9464C7D9973D5675D2DED154 [email protected]
520,487,015 *3520636AA7D39C27E8216A9C35E7291A2C598EAE limelight.3
520,487,016 *3525F0F2BD4E8CDBA7CBA0E3A9FD640BDEA364A0 LINCOLN.WRIGHT
520,487,017 *352F73FA00E70CF3E3152925107DF3F0B81EE62A little-carole
520,487,018 *35230E93EBC3F2AF187D6CA347EA952EB2FB3DF4 [email protected]
520,487,019 *35252484C7FA7DA8FEE8D3AF09632B7E742EF56E [email protected]
520,487,020 *352AECE316C9C1EBBF0B1DED11114E3DC4B94711 [email protected]
520,487,021 *35299FD3451CF3176DADB631467BB690AF94F6A8 WARNER-MUSIC-CZECH-REPUBLIC
520,487,022 *352F34516F0646DA6602E85B3F1DCC6DB7929561 warrenouinones
520,487,023 *3528731C0C30E6CF266FB4DDE4085DA937AF60FD WAWTS
520,487,024 *352BF0E715AE9E1215244AA770DB68991CDE90C8 WEDGEDPRIOREVERYDATE
520,487,025 *3524ECBE5577D2594CA2E87AF64C7EE727C2FA56 lude.no..11.hdur,.op..28:.vivace
520,487,026 *352006037BE8B4A5990F55EE437EB149DA5AADE0 [email protected]
520,487,027 *3529865628A8084756FA320E195EF98AADA39D03 luigitedrow
520,487,028 *35281A344D5C2120323729DD4348CFB4E132E673 WENGSPF
520,487,029 *352E15CE7C97D587CC66954D46867CDD03E3B87E WES.CORRICK
520,487,030 *35211F16660674979919A85F83E3DF5EBC57AAF6 WILLIAM MANGALUS
520,487,031 *35232DE3707360CEC7AE3E9DD461B28614E1081E willieschnicke
520,487,032 *352E591A772055FC16DDCB0923AE554576D3C44E LYLE.HERRAN
520,487,033 *352174102971153CDF3422936E50A8CDDBE32975 WILZENDOBAUTISTA
520,487,034 *352295DBE2FB94E3EA2A448A3747EE545FABF72E windjet
520,487,035 *3527480467E92698AF97DAF2F191041B87C6AB0D M1SSY
520,487,036 *352AC1191621E385F02A25CD7273B70B9D52EAAA malcolmwalking
520,487,037 *352F1D01C4A90ADC2C8F1E26C2229C6C39BC1F2C MALCOM.FORCE
520,487,038 *3521AD78DFDDD31D41EC8346A345E3F4F190C059 [email protected]
520,487,039 *352AAE5388F2A6B7B04FCE7FBA47893484B1F14C WWW.CHEMIPHARM.COM
520,487,040 *352F73F199B6CD23F27F868FDF6A08FB6D8AF6B6 MANTENERSI1
520,487,041 *35273E0E53929685BD09F32BFB1CE62F7F9A71E0 wyattmiska
520,487,042 *3523750B4E2912156E0E8D143B5F1E11D15A3FFD maplekid
520,487,043 *35203BD6B5AB52DF91D5DC338E475D3605C8444A [email protected]
520,487,044 *3521C3D4C596B4B0C171F32DE6B5EC149D6FB0E1 MARGARITO.SOIFER
520,487,045 *352530BA8D9387308D1475C9B0D85A6483FE1B1A MARINESERGEI
520,487,046 *3525E55070790D4FEB2AF49D559F5A89DD077805 )x(.o~<---8
520,487,047 *352C9F7CB50668433DE179AAE6929421024B8683 XRHMATISTHED
520,487,048 *35274EE274BE4E47744A9018185D2BAAFE6C8AF5 [email protected]
520,487,049 *352DB62708B972D5426968DAF9F33E38FF3AE90A xxh5
520,487,050 *3523F802AC3FF5AE2657CB31B3839A138CCA31DD [email protected]
520,487,051 *352E88E0D1BD2CAFECF5BADF6E850C13469A06E9 MATHEWWELLS
520,487,052 *352D7D85A4F0D87BF3EC220635577B5EA1404C41 maxijazz&soulfoodcaf
520,487,053 *3522E468A29FA1F1012296E3997909F2F4AF3356 YTICARAL4
520,487,054 *3520DC66486B6ED6F7397FFD3BDEE90B2080DAE7 [email protected]
520,487,055 *3520D5CD4EE5396D522A1594565611980A653944 ME3&
520,487,056 *3520181C67E8333BB6A8357DAC3F40416E8B2475 mehak-luthra
520,487,057 *352D88E56E1D5939F7527ED214732E523B563763 ZACCHANCEBARKER
520,487,058 *352B256F84E05FD95927984465F253601CD2C7AA zacksobanski
520,487,059 *352E026B8E1C3D2C862BED7028F35F9AF58E7396 ZAHARIAHDAUD
520,487,060 *352979BD1226B7A69BCF0CCC8B675D8C366E53E2 [email protected]
520,487,061 *35258EE94501244BDECC6C572EA6EC52C7B11800 [email protected]
520,487,062 *3526F0EB5CF37E4BA169CD9D1C68C1883F9275E2 [email protected]
520,487,063 *35236B3B567FEE81F37A575B7635FD2EE6379A13 ZKM"
520,487,064 *352889E31288116200367F43BD02A199C6087AFF „ZWÖLF
520,487,065 *352CA7CC612F74CD1E1E858A0D17D0BFE0949825 ἈΣΤΡΆΠΤΟΝΤΑΣ
520,487,066 *3520FFD91AC6DA7F94745DC71F894602BFC50594 MIKESTYER
520,487,067 *35263B03DDF77BD42443C386932551082C634868 milesj
520,487,068 *352989C26F40F664CBBADA706C71B5DB64023B34 MILLJAMES0324
520,487,069 *35266814AC8553F1609A3A127EDD69EE67920D56 ЛАПОНИИ
520,487,070 *35224BE1F5D1ED911E673F652CAB6AF8E2AAC0FF monophysitic0
520,487,071 *352A54889C32A058A2D31B5C5B7358C0CEC878DB РУЗДЕЛЬКА
520,487,072 *3529F6C4C89FD7288281FDFE8358B8AC41F526C0 MOSESHARUM
520,487,073 *352BBA5D66079411727A409904F5B5A1B07197BE motiles
520,487,074 *352B3D6C81A751E5E38BCCAC30B31F8DD896AB6B « jacques
520,487,075 *35236E38B954608609A8C763BF80B6896B91AA4D とも、参考品種ながら特Aにランクした。特に、
520,487,076 *352E2D3BA2B9236753B9211D599D657BA4F0C85A n"cbaa
520,487,077 *352F5A0E59D385ABF467BEE1A2FA45E951AA92B2 [email protected]
520,487,078 *3529F00B84F64C94DA10E8CD3566996B99EF5CF9 NELSON.RYEA
520,487,079 *352447221DA03A4B91EF19CCC0D04EFECF3D3D0C NEVYMAZE4
520,487,080 *352B281BF77A5491CB39B7B06B3B7B0667CBA8F7 nickydowning
520,487,081 *3527B3B7307284C7F2D752B7294B7A19B5CF414F NICOLE-ROSALES
520,487,082 *3523A91C4CBC6CA5705847D172DBC0952815F1A7 NINE.SETTING.OF.LORINE.NIEDECKER:.VI
520,487,083 *35245000C8D029EABB3042E824A6471442705044 NOLIMIT(EXTENDEDVERSION)
520,487,084 *35201483F9D37F69847B681F51DFC3E9A7F9EA63 NONVIOLENCEINTERPRE
520,487,085 *35224691733463DD3AC468DF9194E466A4DBB241 NORAMLY
520,487,086 *352A691CF22131A609465182856A95CC5690F700 003(Α、IMPACT、OG)
520,487,087 *35216D3E91C5ECCD7A4176BA3A46827D9127574C ny!u
520,487,088 *352F2FA2DC6DA13F0D246A15CC35671C78432DCD oceanic.spheres
520,487,089 *352184313E230AE6F2ABCE6EBA3462C139993E9A OCH1OCRATIC
520,487,090 *352DBABCDB8081929351220FCDD0C8195627A93E [email protected]
520,487,091 *352FB041F10FC9AFC2EB12847F2462A612D71C57 O->-< ~ D#####8
520,487,092 *35207AB3FBA2A80A14314DCDC9C4670C9BE837C1 ode.to.a.beautiful.nude.(feat..rufus.sewell)
520,487,093 *352C6B7BE1E43DD6C5B63DEDC4E3FA6FDBFA3842 ODWDAA
520,487,094 *352238747A0A5E3EE361A8B0D029C4ACDE5C2822 OELAKOVIC
520,487,095 *35210253F50D5BAF91A62DF8FB5C49C79BBF987D O?>F
520,487,096 *352574E2BD20D4C6AE0BF47CFBA1D52FDCA2D2E9 O MAGNUM MYSTERIUM CAROL: ALLELUIA, PRO VIRGINE MARIA
520,487,097 *352B39CA01F0FA8C59E10973C8D9960336A3B48E On.the.Contrary.(Au.Contraire.mix)
520,487,098 *352A24549AA7AB09B32750D645115E6E67425CA0 ONWBYLE
520,487,099 *3528324A43A86C9DB7381C6096E7308696CE993D OOGPPOG1
520,487,100 *352A294393438614F83E7BDF01BF56FB50B47ABE }o{.~.`.q==p
520,487,101 *3523B36C2FA167C29F9BB46FA963FE76056FC9A3 orientiert9
520,487,102 *352280734E3FE49B49599BA5813800D99E1EC2AF OSCAR.HOLLIMAN
520,487,103 *35253EE6ED767B5FB88F4B5C7D0E3BF8E64F47AD OUTBACK(DEFCON1REMIX)
520,487,104 *3520ADCB64D7559140BC7CDEBA7E2BDBDB2588F9 P311M311
520,487,105 *352539C7041582DAD4C8150DF2B6464963B20872 pakeveas
520,487,106 *352E2F3F1CFC39E07354EF2CAB1E17EB6FE79CE3 [email protected]
520,487,107 *35241505AA50B1C8E3131920E4909E3BB59FABB8 panturkish
520,487,108 *35251F1C1B340F39555852C1D90A5E3C5D1D9A1A partitano2ineminor,bwv1004:vciaccona
520,487,109 *352D324857904D5D1A7C6A592BC474C793635DB1 PATRIOT.GAME
520,487,110 *352E4C096F7D5BA77006A1C5A1BE8D731CB59BF5 PENNY.DAYNES
520,487,111 *352D8477ED62D29F95CF57645414C50E4A77EF1F percussion.in.hi-fi
520,487,112 *3523195D1F830B66A486F0B34BBC5F16331AFBBE 15-ATAYABILIR
520,487,113 *35203E0E59827B1D9466E0FED0D073C12D61BA80 PHIL.LIECHTY
520,487,114 *3520ABF57E57CC1E3DB565782CDCFBB5CF551218 1791290 auch wird die faecherstruktur beibehalten
520,487,115 *35244A0F4F2DA396308C35310E219DBB1223CC51 piano.sonata.no..1.in.c.minor,.op..4:.ii..minuetto
520,487,116 *3522367D1FC78C7BB9EF89DC3485F1052E9973E4 PICKERELWEED
520,487,117 *352809B5F1798E6BB6B68959B54E95D30D1D4305 1-aivokopan
520,487,118 *352B35D6641AC2965F600D2E33A2E8354E642222 polskyses
520,487,119 *35275A293D59DDFF038E09E47AA20686D2946602 POLYSCHER
520,487,120 *3527A8DC5D8F5F901A73F3AFD15BEE2CF5E4A19A 1bre
520,487,121 *3524680DA5F28AD87818548AC587D29E7876491A 1camping0
520,487,122 *352CD1A67B4A992FC0EDA7A6EBD299BEB660BD63 1-EDESTAKAISET
520,487,123 *352BAE07399F05E3950A5550C3BC006444E0C584 1ELEKTRONIKMASSE
520,487,124 *352BA00DD5530C1F708529BEF4B9DA088C1F1D4C 1.HALMEET
520,487,125 *35219241C739517369838F4F46A88247F4B6CBC7 PREELECTI0N
520,487,126 *352AC07BAE56E8F1DAAB2522008CB725CD82B0C5 1INDUSTRIETUERMEN
520,487,127 *3526F7BE90B2AE77C260AE198A43317F3BF183D3 prosogyr1
520,487,128 *352DF8FB06417F3C78975B554E1A14EEEC57F2C5 PROVIVISEC7ION
520,487,129 *35236B54C053452D13BC90E8945C2FAD9F25A998 1KCELFFA
520,487,130 *352B84CB3311C02EC9412825220773B90C98E9BA PSEUDOBLIQUUS
520,487,131 *352CDC2889168B9EB7BAEB5A4FEF713211B757BC PSEUDOSAINT
520,487,132 *352DAE320D2C5DC4A2E95EBD550F8C0F7A784511 purification.by.hatred
520,487,133 *352BC0851E56D8C5121D28758BF1625D40E1D547 1-MATERIALTRENNUNG
520,487,134 *35272230DDD9422DC9C536859388435F80C34476 1.MEHRWERTSTEUERBETEILIGUNG
520,487,135 *352630C2DE5DDEA66CC6D76E09CB8AC3421D2914 PU|U
520,487,136 *35233C67B66E4587F9D61FEA5264007EC9F75A9E QDOMAIN9
520,487,137 *352DD5460191BDFC8508E1EC042E13814793F2F0 1perfluorocarbone
520,487,138 *35237A13300014A3149E6B50B43396A8C2D0B24D [email protected]
520,487,139 *3525DAD11B8CE0B2BFCFE1B9874012D89A2486E9 1.rakennevastuu
520,487,140 *35296D7F995A970A67DBD79BBE06047FA8016F66 1.randbetroffener
520,487,141 *3524D31ED17C80368E30EE07F586B3DDB191BDF1 QNBI
520,487,142 *352B47F087F8DDEFB3E58091E5438FD4DC59B3F4 q######p-~-{x}
520,487,143 *35237715AB3FD0D1517943FD23C09F908B41A553 $qtf
520,487,144 *3523A52FDAB9A7715B1866E0F451780247B88F8B 1.SALLIYORSUNUZ
520,487,145 *352F2CA880C1262AE31A6CD43D812D178BB4250A QUELVINT
520,487,146 *352FDE3256B9078424A925885C58A01BF97C3817 QUITTY
520,487,147 *3520F5B5B69425F228F51C07722F383450DA27FA RADPH1234
520,487,148 *352111FFA04DABDCB663E9C5E571236A1BA1BAD1 1.VET
520,487,149 *3527BA6BEC37ED784414A708401A55C77DB7F400 200ELLIOT
520,487,150 *35246BB106C3E702BCD4F2C3CED253671432F573 2155661 kott sisaldab kergelt p
520,487,151 *3525E7BAC874038873E7CBA99E9BCE745576A97E RAYMONDBAZIL
520,487,152 *35293401C94D0BCCA2C168FA58C614BA617C8214 RAYMONDHELOWICZ
520,487,153 *352E5D83098626A38B60AE7C2FF6C654DCC75CDD RAYMON.MEDINO
520,487,154 *352BB11E10A014AD2B72641BADB5AB2B58E1F958 22.oppimistilanteita
520,487,155 *35267481D8B3EF8A0D8F03AA9A253B59CEB1454B REDRUUGN6
520,487,156 *35250DBB1184A116B24FF1A2CE3362AE3C2A85E3 REFUGE PLACEOUTOFDANGER
520,487,157 *352E8E9E8C1A7DAC8232D4DE7E83383674D3F2E4 2492241 salow muss es wissen
520,487,158 *352A3167143CFA59071FB0C8ABA437D2D73B8038 REINSCRIRAI7
520,487,159 *35233D7DAE56730A568224372EAE18690B1F3BDC 2611062 bush warf ihm mangelnde kooperation vor
520,487,160 *352D73C6F49A2984B12B5979BD7CF9BF82DCBD33 2624485 valtikassa.k
520,487,161 *3527E47E3520FBAA73B796E18C4D4B637080FF2C 2737191 AMERICAN-HOME-DECLINED-TO-COMMENT-
520,487,162 *352290BF28A20B0538BD5AE8D31224DA941F6E22 REPR151NG
520,487,163 *3521FD7E60D1E839F85E95C80E1CAE3761BFE373 reubenites7
520,487,164 *352050AA6480D1F8431FC2186EAAE15880DDA5DC 2BAUSENS
520,487,165 *35285593441F6229C5D2A9CAD87D8D311FA0757A REV!5!+!NG
520,487,166 *352B263DA46C44171777100608E58E645EDC1F64 2 BREMSVERZOEGERUNG
520,487,167 *352BAC85507AAF32A7716006A46B30823F5D7950 2.costarica
520,487,168 *352142584B6A2BF81C7B18421C1A18C7E9C9E547 RHIZOPUSNIGRICANS4
520,487,169 *352FA41C42DCC0D5A5B2688E212C68392B913382 2iammaiden
520,487,170 *352C9245EB8C5F42115ECAF9AF3079169E46755D 2ministerratsveto
520,487,171 *352BD3CEDEABB495FFAEF0F2B959329473A8441C RICKYCLAN
520,487,172 *352CF18F26C5B00E0684C3BCF0B4017FD9CBD4FD 2RUZHENA
520,487,173 *3521D83C83F411E66CDE7F22F1C3C48B0C016CEB RISS701
520,487,174 *3525FFBDD0B635515850CDDD454E9B49E67BAC10 3b< 0~dp
520,487,175 *352401009CE92763990D879F1F440D3954600BC5 3#####d**>-b0
520,487,176 *3522ED4BF207791722AA1165935E79E5B1AE7A6F ROHRANSCHLUSSES
520,487,177 *35221EC77EABF7926E4116E8B8255EDA5800A565 $3MP11C3
520,487,178 *3524B4490184EBACDD053C20CAB6C1E3D3E43F52 romeoakima
520,487,179 *352FBAA11976D3150C6178DACC884429CE1825FC ROMEO.BALDOVINO
520,487,180 *35204237A76303633BD611E60F1BCB6758EEE31F 3######P~0~O.}8{
520,487,181 *3529A67FD7FF5DA074D0ABBD74CB226E29E2129A 3ROSSEIO
520,487,182 *352BB30C7031DF39EDD67B81005EDE696C729F20 ROOSEVELT.SUTCLIFFE
520,487,183 *352C6181749DE3E318E7D99B9B115356C20A2541 rory-barton
520,487,184 *352CCA371A4CF2165EDF08D499E0F7DF3580B2CB ROSE-AZMAN
520,487,185 *35203A779DD81882B82386DEB2EA2FB3464A9C01 ROSEMERRY9
520,487,186 *35269C342AFF38358C1DFB7A74659D6A15945A97 3WEIGHTOMETER
520,487,187 *352B4DFFD5970131072B7174F1836A42D62DAD97 ROSENDOVOSQUEZ
520,487,188 *35256A19A4A0931B93CC1466BB6F2AA4139B4376 ROSESHEMIEP
520,487,189 *352AC0220B1E33C282B155B8E072520AC7D1C0F1 3X+NC+NG
520,487,190 *352DA5998F8FA1B2F53C0CD23FBBF948DBD72D5A ROYALWENDTE
520,487,191 *35254726CFC809B98A7C6631302AC5C68B978C89 ROY.LEAN
520,487,192 *352242A6C413CECCA8DCA5429B3A752B1230C06C R!P}
520,487,193 *352274A2BBA6EC938D7A50913138D5FBBB836089 RUDY.SUGAI
520,487,194 *35203FD5F717BCFEC4A8A14D09A195A61D684F53 RUFUS.SALVATORI
520,487,195 *352A61EDE67ECE5AB23D39B7A09B3ED20BF08675 runnerlamer
520,487,196 *352951E414F8E570C9C535B24BE4E140B31B70DA 4GREERD
520,487,197 *3525F679B9BCA83F8AFC1D3D95A5853273DAD1DC S1GFWRLVLLDG
520,487,198 *3529E65E41D273832090D16617A3FDAF3B6E5FE9 S34 ROS3M
520,487,199 *352FD29D27D65B97F71BC3C21424D66EDF16AAEE samantha.brea
520,487,200 *352CD97223A6EAA8F1521354E1BFF80F29A71C30 4OHWTRAEH
520,487,201 *352DDBFF096864ED0F9374B8BA6C009D80D2B2B2 4PELGNIHC
520,487,202 *35208B1ACCECC1FA3DB8515242C1B155A602F7A9 SAMIHAH-ALI
520,487,203 *352355219B6F7D91C8F76F2830EA711DC4D818B9 4REGREBN
520,487,204 *352CD43349399034912D87693FB8C5F6BA186550 samuelhuot
520,487,205 *3522601BE930BA0FFCA4B4FAC4EF39A41CEB9E13 SANANSHEIKH
520,487,206 *352C4CCD42F0D578029D0154EE51A166D8B02B68 4SPEECHLORE
520,487,207 *352D874E2F64DB18BDF33470118B3407A6A159FD SANDRAOCAMPO
520,487,208 *35267F2BCBE32596FFE78203077BA6FC457BB6AA sanjose1starwars
520,487,209 *352AC8E8AC820BC6F08B325893C49E003E092C42 SANTONINS1
520,487,210 *3526CAE987D05E0830AD43D106CAA12FAE216C01 SASHA-ANG
520,487,211 *3528FE5CF15A9ACFE796DDEF6567D6D73796ACB1 SASKIAKILLME0
520,487,212 *3520371807CE73432805D98C170DDBE1A0A59E5E 51814 suunnittelutoimikunnan-teht
520,487,213 *352F90FC2647C7BD7E2037D392AE0220687367F6 549glenn
520,487,214 *3525F199F15128D473FAC458F281D37AB569EA75 5BADCONT
520,487,215 *352E9D8C6BF05439446A557727F76DBD2D93BF74 5BAMBALINA
520,487,216 *3525A2A85E0B07CFB1180D377F5E52265AEBEBF5 schoolreality
520,487,217 *35288F30070B9CD8541D741496596A2618992F49 scott.lothian
520,487,218 *35220C239DDF517E7F4FA509F9C2BBC15D81C1B8 screewee7
520,487,219 *352C3AE1D1A2AC94C2AE4A583952FCDD05C8306B SEANGOBEIL
520,487,220 *352341460AFDDD057E74FB7E3A29B8A1DBAB7984 SEANVLAHOVICH
520,487,221 *352C8260F397FE6B6DB6987468D28177D1DA6532 5iamplayers9
520,487,222 *352948FB62DB67E4035E927EDB497FB7DC83F9EB 5MEMORYKING
520,487,223 *3527AFE355D47EA3DFE19F5F90991197A1F0829F [email protected]
520,487,224 *3529F4EF3417997E2252E9117C0E82CEEB2B2D25 secondaryarmament
520,487,225 *3529AA585F4E5A8A316D8240440CB78DE4060FD5 SENDITGORDONING
520,487,226 *352037079D355418A8021621BC9E804BA9AE8785 SESEDIURD
520,487,227 *352413D1107139BB99751CF8AA977F25D68C14CE SETEUQIP3
520,487,228 *352283C6D708CEC709B763AB105E9FDA11625517 SEXYLOU143XX
520,487,229 *352E9428328824E48881BF5439EC30A6281895A5 SHANNONIMPALAED
520,487,230 *352C65F3DFB7D8D06482DF77B3F0D9F9643E8AA2  61P
520,487,231 *352C60B0BE7988EEEEA75267CFF57D05443747F8 66QZWEMJ
520,487,232 *3529859394F46931E3EBCC9CDC2D0F804EA4DB54 SHAZYARZ
520,487,233 *3529BC597CBD349CEDD6DC7BC961FC7E6E61FAAB 6ALLECCULOM
520,487,234 *35287F7F0660904F8CE75545057D39D462C27D26 6ANDREHENRY
520,487,235 *352A941839189D9B86F7F6B72CE99CFD87B60E30 [email protected]
520,487,236 *352DDD90FA3AC639BE5A086E9B99743CB130807E shermanjauch
520,487,237 *352ABB6D3C6419FF76DF65AE6BA6300B4242A578 6DIAMONDAEH
520,487,238 *3525AB4E8E22F9BC154D48F46F5FFD98F5A07720 6ESILLIK
520,487,239 *352BAC9A852D6693CEA0FDF211431696BD217525 6LARGUE
520,487,240 *3523C146D8FCE898828EEA55C0650DEB8E78A8CC 6MINEGHINO
520,487,241 *35299E05311AC6875793C9ABB812A7DB9C481134 SHEWEST
520,487,242 *352C8C8157EF55F9101A19F3327FBBE1AD135ADB 6NEDGRAVNINGENS
520,487,243 *352B14D81D7F5283EC3D5520007C031C1E8DD90E [email protected]
520,487,244 *352F394EFD47B4B1137980226D33D52F8EAA8EEC 6NORUPAK
520,487,245 *3528D54F4D9B208EC63F98EF8C22E7FD60EC975F 6PLURALITNHO
520,487,246 *352C583BDEF421CD7EB403BB2D8DE2D8A6B63A60 6REGUIRING
520,487,247 *352F11F991108FA629F87ABE59368C8626AC26B8 6SALLINAV
520,487,248 *352EDC0BB84625DA99BC2534D7E1FF96AB190657 SIDEWAYS LAUGHING
520,487,249 *352310191243C53C6ACDEF9EC389666F618E4AA5 SIMONPOH
520,487,250 *352F5222A14A5C36452301E2B82A54E70BBE27F4 SLONGWAL
520,487,251 *352A3C5987EEF7F6DAA793DD5280DD1181360189 SO1U81Y
520,487,252 *352B5FFA0699D1753005B07EAB15928062664714 7ORNONSSNONRO
520,487,253 *352931C8A124962212B1E83047216CE917DB29F4 7SEIRDLAREH
520,487,254 *3529C49BE70308B177BD45F5B0BBC7DBE8FC5DA1 [email protected]
520,487,255 *3521BA935C4134356BC85928A5D26E8C7C871482 7SUPPORTBILL
520,487,256 *352ACBA345232428BADCC78B23D89F8B41C91FC8 SONSACARE5
520,487,257 *352CB13AA2C5FC28A4DFC553209824D4E458AF0B Sose-mondd-a-mam
520,487,258 *3521D039AA7D504FFE4057062439A14468982521 7VANDERPERREN
520,487,259 *35281B05B47B59297A68EDA75B844613068F5E90 7WIIKITE
520,487,260 *352E1E26086A3F2553D27528DA7068E5CE86F8C0 817360 drosmankemalkayra:-yard
520,487,261 *35244EDCF6CF6D369B9A0FA1D6165EF0DAD96A11 833macy
520,487,262 *352CBDCB72E8444ED9DC51D96889725838D1972D 8COELOSPERM
520,487,263 *3527C4D810E2131FD852037743EED37DA584743B 8FORSOOTHE
520,487,264 *352C96CD0B80666D625B1D97DE6789E5425D1D31 8GLIDER10
520,487,265 *352A407FFDAD46A6D75CB4DD3176809D79094BA3 SSERPXEATOYOT
520,487,266 *352D281DF767AD33B07D018BB68B55C68A7B9468 STACEY.BOISSELLE
520,487,267 *352141AEA4BDC202FB0E4E292F38F0D888CD2BA7 STACYORTA
520,487,268 *3520BF5A7DB05E17BE8E268530ABF0D02941553A STALE1MESSAGE
520,487,269 *352A4C62D817B6348099E4B983A3A7FE57FE60CB STANLEYLOUK
520,487,270 *3522F4018B7B48231A4A9DFF29B89117F9EE4F01 STANTONBRIDDICK
520,487,271 *352A036C8F80D80388F64C9870A02C4F612E659D STAPANJU6
520,487,272 *352A8141951F9F3870CF7A9CD7C6397135EB8A6E STEALTHPANDORA
520,487,273 *352F92A754E3A817358EF7E7361D6BEE4F9574F4 8OUTCROSSING
520,487,274 *35262F67B7FE80DF1F6DA5F2D9F6F627AE43B12B stroudsburg2
520,487,275 *35276768AFAE728E53720C5A20B899274BC74579 8STEPONEA
520,487,276 *352A0BFA2C4C01B1ABAFC3EF22704C8C4875AC69 SUBIDORING
520,487,277 *3529339CA1A6FFFE13954F331B67CD6D66836F95 SUKELLUSKYP9
520,487,278 *35256FD4F41273B92342B83EFBB22CDF73BC90C4 906abdiel
520,487,279 *3527D90F41E3C6E9A80087E6016A1074B75F777F SUNIMOMO8
520,487,280 *352EA66CBEC8C7CCEA80B31DBB615B572F29BF0D supergruppi
520,487,281 *352EFF5D934FA11F77FE85C837BB77E044E11BB4 SWEETYMARINE7
520,487,282 *352F32AC0653EB9F0D2E159F1B722636A3150756 swing-tail
520,487,283 *352B9093A4FC7B17E725ECDA02480943AC7DB751 SYOKUSIED
520,487,284 *352E85D7CE7EFEDC37F0A3BB6553E529637FCBE5 9LYSREKLAMESKILTES
520,487,285 *352533487DEB80D15FDFEB1FE15212C7BDF5F64A 9NACHTBELS
520,487,286 *3529EE991DC46099E2AA790E00A9EF8C9BD09878 TALKCIBT0123
520,487,287 *352042B455927C1E2EEAACD1FAC234D8339BD146 talkrtstryaolcom
520,487,288 *352F6F52F1CFE495E1A713AB5FEC16EB57E66C0F [email protected]
520,487,289 *352114D2B6FF593550803CD3B276D39D2E0EE3A2 9SMSIPOTU
520,487,290 *352874D72F6B309873F4F6A0AA44D0817C81D095 [email protected]
520,487,291 *352CDCDDEFE526E650D110EB6C243D510B566E4B tarantellaop.18
520,487,292 *3529B1E49A5633E64985B6A6C5BCE7001913EA03 a/63t
520,487,293 *3524E0F17AC4E9EA6E652CAF0362DB5494E7AD2D THANHCHASEY
520,487,294 *35244DE188D55C810091F690E90F5989CDB69B5B thanhkuhnert
520,487,295 *352CB869251EF165C330E3D272BBCACF90F2B566 AAA87J
520,487,296 *3522084A0B12B0AB252B1D27E8EA972C73E12A61 thatpremier65
520,487,297 *352D0475852C8B20C4C0B6A4EB418A89B5E94245 AAB}>8
520,487,298 *352E0D95EF9DCC80D471ABE51DDA001FD91ECF84 theexcalibur96
520,487,299 *3526AB3EF5027F451A19935AD0E02B606D15668F AAESG|
520,487,300 *352E0BF9C953788DB7B967DED164499D483C6A1D aa~v3
520,487,301 *352EDEDF1D5651055EB0BBAC6F01E77DB494D0BC TIMMYTURK
520,487,302 *352240608818CE631BFB78E919E4E5B62DA3551D TIMOTHY.BURGY
520,487,303 *352D71A5CC14264C88809792F3A72DE22F098419 ABOUTTHEAUTHOR
520,487,304 *35228617FBAD83F4CC8D79C78092DCCA4D657A1E ABREEDDEERBA1
520,487,305 *352A2AC49DD706F83B4197BCF1CAF731B76591B8 abvmd
520,487,306 *35279C6155C8AFB58B85CA4444FA9519876ACEC6 TOBIAS932
520,487,307 *3528930CA76B56C0E16504A556CC34DB2B2CA5D0 tony.eid
520,487,308 *352C0EF35A9673C3114F6E61350E2B88FB395ACB toon7153
520,487,309 *3520BBE3C26071871ADE33780DC884982C18CA11 adherbal2
520,487,310 *352A933208F30C9AB74F79BF04F879152EB5F079 ADOLPH.KORTH
520,487,311 *352C717FA705096F403927D2EA2B1E46170B0847 ADRIAN.COUSEY
520,487,312 *352F9278A206DE625E969C6E413220245C354948 adt;
520,487,313 *352185FC0E33AA3597C6839A3E031CABA56444AE TRATSCHES
520,487,314 *352E04E34ABB9B6D33033E9B6303B3F70F628636 TREBORJESUSED
520,487,315 *352333320894AADEC784D87DA896A4B94DF0B55C TRES.SYFERD
520,487,316 *35220D9CE1C0430E9124A8A29FCF6CA56E74C253 trevorwebb
520,487,317 *3525A70501DB9EB6F0C30E74AEEC14E3DD5413D9 A+_F
520,487,318 *352AAA9DDE2A905E72FD8F9FF01C3B5CB91D04BC AF,.L
520,487,319 *3524E066733152AC4E91006212598DCD068C2B8B afw+2
520,487,320 *35250BF32B147E7B1353EFB05A2A433F603A2BA2 TR!P1!CAT!0N$
520,487,321 *352DF2B9204E8BC0A253A24A9CC6FEDEC8092EA8 A:G"Z
520,487,322 *3520AF810B1792F94EB25EF71E04E7EE452B2B57 TUNNELBANESTATIONERNAS9
520,487,323 *352090905B1399B0AA42BED80E3B00C48CF38A2A [email protected]
520,487,324 *35275A0B4DFF3DF65BBAA0133B555E4050EEC551 TYYPPIOIREENA
520,487,325 *3522F667920DE9F90CA2E95B3BCB854778580321 ugljiku8
520,487,326 *35267CEB86D25638778E86B6E75618628F96135A UM HAAIB
520,487,327 *352E194B1C713FAC269415FBD42F584A71A03D70 aiit.
520,487,328 *352BA00EBF89C008A6B232E744E35F746E25EB14 ALASEIS
520,487,329 *3523553767A0A371D2807095705A2BA78BE7ECF4 ALFREDO HERNANDEZ BATERISTA
520,487,330 *3527B49DC5A4860F1FD808CC2FE943461F747E7C urkundenabdrücken
520,487,331 *352B1DC8E67A15B0D2C9974A11C915DF8167991A US4395
520,487,332 *3522D3D2A7A99DBA51B8708B4EF0CDE57793FC17 ALISSAPRUITT
520,487,333 *35219B8F53CC91945FB93E19A0CAB20BEEEA91B8 ÚTVONALVÁLTOZATAI
520,487,334 *352FF29914D5A88CC051233A313D0E91976AB901 UZJOGUNIHING
520,487,335 *35205DD494876753BA4CF271F19B7E815ECA019E UZNAINMEMON
520,487,336 *352CB5E83ADC5CC680C718C6466665771E76406E V4\#
520,487,337 *352F9DDD1F45968572CFC3BFB43CB98AA627B37C VAKENDES
520,487,338 *352A992B0401AE7562426DD49E26CAFFB0740DDA ALVARO ANTONIO ASHTON
520,487,339 *3528FA9C7E8E6831C78288FFB9D3730DB7248201 amadogaede
520,487,340 *352594E376F119C71C7A5ED3E33D9AD3155CD225 AMBRITE6
520,487,341 *352A0259B2CF04115A33D4BA797E582ED74659C9 VAN-BRYAN-GUSTILO
520,487,342 *3525881CC36A1BACEF8D633BF97ECF12F03AA9F1 VANDRA SIMPLYMEMIZZV DORSEY
520,487,343 *352CE130FCD2954B963D13C9B65CFBFBE34E81FF vaneetanandrajog
520,487,344 *352569D1D50A5777310B9C1443C90A238B411DEA VASANTH-VINITH
520,487,345 *352B5AB85C966BE1352E92A62871E91E84872BBB vaughntaque
520,487,346 *3522FD0B33824923B2027EF9335C2CC6B7722C2B amlear84
520,487,347 *3524466EA85DA8759E49309D09B599CA9DB97E32 VERATMEN
520,487,348 *352BFF08A2A750E5CB5817E3994B9034ECFDCA92 verfh
520,487,349 *352E0C366EEFA5A6CB5AE87D494D3179C1E05315 anatkram1
520,487,350 *352F94FDBB5188D258F114A9EC9C6A3738625D9D ANCG,
520,487,351 *352B1AE1417DAF67B0AB42C338ECB1F3A8D28482 VERSANDANWEIS1
520,487,352 *352620B0DDE3AE958366C17DB00B82A4D4288647 ANDYPING
520,487,353 *352DA258EBC96D7819CF037C8847634AF73B0018 [email protected]$
520,487,354 *35254A6015AC9F576542CDAB106F322BDCC1B883 A/NGT
520,487,355 *352B3805C60C7962C3A482B3AEE9EE2821FF522B ANT?E
520,487,356 *352CEBC9149EF4C377272D70122BF0AA06F74C51 VIOLENCEANDREW160C
520,487,357 *3526487C32DD663BAC408D54EA08B9F25A3F1C6E VIOLETA.GUEVARA
520,487,358 *3524D570C8F918BA8A00E2DD6DA1965E5373505F virgiliotoure
520,487,359 *35243192C1832F62CBCF8E2A4DA5AE885643DBEB ao;8h
520,487,360 *3523F6ACB1B0BC360117A10A351714ABDDE8C031 apaastaah9
520,487,361 *3529B3751854BC29444E43591A893D6056A66394 aphlf
520,487,362 *3524CF4AD63028E60966444E2DDF09546079E2D8 VOLLTANKEND7
520,487,363 *352ACF15950D7B9AB70F5A0FBED834B4FB2D765A ARBPI
520,487,364 *352C314C1178D19FD0AE7EFA1933D89FDEE75646 arhq
520,487,365 *352F75D7A083541820A2809120A0406D83B97E99 wadeheisler
520,487,366 *3523F96932610A69FDBF51E1F7E32880B9769E20 waisale.1.0
520,487,367 *352FF03BE758DE529CCB6A5B75C867086A976D49 WALTERHARNISCH
520,487,368 *3522667D920D1E7E0CDDDCD5573A27DF92C8A30B warnakulawagachchigethushan
520,487,369 *352AFF0F6BAA4A36F33B2A376B8FCA91DF7F4A21 A:RSF
520,487,370 *352B830536D5EA1102E2138E01A89D5A9DE2A6F8 ASA.MAPPS
520,487,371 *3521414CFFCABE93D543CDFA00B5502A0F173AE6 asi8d
520,487,372 *3529193CBD180FBE5FDFBCB38B19B89601E09339 wawwaw-wawy
520,487,373 *35260D58A71365940D98AE8C4F551F8E578729ED [email protected]
520,487,374 *3523E0D859FF76AFD99244DC83C5945569BD087F WAYNE.TSUI
520,487,375 *352B10055B837BC08E7BCA9ACDB514FEC1699EE0 ASYNCGRAPHCONTROLLER
520,487,376 *3520881E29FF99C773F3F9598260D38004424792 atp%8
520,487,377 *352329CA727D155BC19900AB04BF9CFC1F1B4FAB [email protected]
520,487,378 *35295953C2CB1E5876A43808C4294853AC301DF0 [email protected]
520,487,379 *352C6692829AD6F7399DB037563D45BDA9D1A650 a-uf
520,487,380 *352DD33C8B27862E8957119C78C41541E0B7B8CD AV(GP
520,487,381 *352207BC08EDFAD3E257CDEBDCEA1BCCBED149DF WILLIE.PETRAUSKAS
520,487,382 *3527184B4F20545723839A3D3C959D80AEF946BD WILLISWRISTON
520,487,383 *35273B35AF9A226FCFD5B25937734E1F5279B63A AWD-L
520,487,384 *35221179D2741461B8B5E7E505DB29264C14022D axelghpersofirma
520,487,385 *352894DAD873EA616BEC2432D5C54DFF9ED1AAF7 AXOQM
520,487,386 *352FDB458410BC76E03CB87FCF3D6F76C7F19498 b14ub
520,487,387 *3523F01AF2E8F7DEAF83063E2E5C5BF854D83311 WPOE3F2B
520,487,388 *352996BFC59C22B109EDFE0CFF77D75DF88201D1 bagmc
520,487,389 *352127CBE7963257187A2D8E369A9BE3D1DA2A31 XANTHROPOGENIC8
520,487,390 *352252791CE8C9CE2396DDA458E434189F2B1D42 XAVIER.JENNIGES
520,487,391 *3526ED0A6C15CB505A1ADA28F24E55E89510C60C [email protected]
520,487,392 *3523AED104CFA67B5CFBBFA7D1EE8C59C3484F21 [email protected]
520,487,393 *3520E4BD0C385FA329D599B1CDA9E25E0074C4F0 xn56
520,487,394 *352F1BCD144F51CE1C7A2FD667AA52FC358DAF43 XOKZLJOVYW
520,487,395 *3523585A6C1E640D399DB264DB03274F3664BE84 )x( o~o~ q######8
520,487,396 *3527F85D0F7C6B269C60EE2EBAD9771CE11A9168 BASSDADDYING
520,487,397 *352A49AFBE0360E334B8B65E18C71E86C4484DF7 BATJAAN
520,487,398 *35216D2BEC13F6FCB70F998DD654C76824EADC25 BAZANGUISSA
520,487,399 *352D0569D3E14869187104210BFDF9C2827B3C01 bbllaa
520,487,400 *3527CC637F8C989E520D49A3FCCD2823AA4A61C7 bc4e
520,487,401 *352AC784F0465A9D76EA266B9D5CD913F64AAEE6 Bdk6
520,487,402 *3523935C4D4E389AA28DCBBE309E938E4B782624 yaromdepaz
520,487,403 *3524AF4ECCD8A1B4B7790BF12E4788D5ED559355 BE#A1
520,487,404 *352C0D1CEAB781445BD61A926D4C9053DDFB03EF YDRACCIR9
520,487,405 *3522EF40DC65393365113D3E15F5B02120115DAB YIGALZALMANOVITCH
520,487,406 *352D1278987C1607E521F1AB038E883256EEB2EF YJAHUQVOZLZHED
520,487,407 *3520F6888330285A0F2CAACCC7DEDB238F8D4D21 yjo_
520,487,408 *3528FED25565B703CFC80BD926884232C90949D4 BENJAMINBROOK
520,487,409 *35290041CFAB85CAB210C7DD6E5B4197D8DACC06 YT9(
520,487,410 *3525C001665787DFE470D82007CA602BAB90A9E8 YUKI.NASA
520,487,411 *35230F854113930491EC03F7F52513269D8E7691 yumiko-nakahara
520,487,412 *352B11826E9A48E95E5A76E9C226B0A617F2A908 [email protected]
520,487,413 *3525F0F31170EEE07D6DF4B115B14F2C1BD4EEE1 z07aaa
520,487,414 *352E4BC047DD393BA0BF015DB4F4DAF2BF073CCA BGn
520,487,415 *352CC986F16C8AD0EC7543A8D5DC88AA5BCD87A4 bieya
520,487,416 *352697DCEF369D3C0E9D217BAB4BC676F4D63243 [email protected]
520,487,417 *352D8D6C1A916B596A179017BBCF3A9E20A9B053 BILLIE.GLENN
520,487,418 *352418B1D76D48E9CFBB4BA519BD02429A846C1E [email protected]
520,487,419 *3528A7E49236127B5E3745A921866C51EA8807E7 BINNENLIEPEN
520,487,420 *35293B65F7E6745CEFC1446BC2483EE097631730 ZURA.AZIZ
520,487,421 *352A677F22F45C390CB6DB61C5FDC79C33566F75 δαδίκεσ
520,487,422 *3529EA270C99784D8B0F2B93A5D2F4E7B957A582 #:E
520,487,423 *35219819C93FF84DE993D628262C4370E650C618 blk7q
520,487,424 *352584963414F6D620286550E082C2D0C1999421 b;okq
520,487,425 *3521CAC385D457D99A68ADE56E4640BECE089FB3 07051487
520,487,426 *352E1B47AAEDD3B3E15977F34319F2205161DBA1 BRDD#
520,487,427 *3524F03AB2A3053479EB25E9F157202FC2C1F40B 0V3R3X7R3M3
520,487,428 *35214130C52A7333D32B3B918E93EADE16B41C65 BRING MIR NOCH EINMAL DIE JAHRE ZUR
520,487,429 *352363EF6494E09236B8DB64D22F863B8E35F087 BRY5
520,487,430 *3525DFFD9C54DC1EEE3DDFB4CAB0F176017E0A74 11-IliSkisel
520,487,431 *352966CE9F78E94D35F70CDB8FE2AA52DD5660DE 12-29-1613
520,487,432 *3525E92E3954184186C62295C5F9C76991F4EF34 b"tor
520,487,433 *3526C5CD6C2ACD748C2CE54A43790436DBDBCADD budiida
520,487,434 *352C1034E3D3347FCC3A4BB6C57EEC1022DC8CF6 14-07-2001
520,487,435 *3521B6AAD761432B158CA76D7540F1223FE51A39 1812-FESTIVAL-OVERTURE-IN-E-FLAT-MAJOR,-OP-49
520,487,436 *3525861324546BD08409C919A302A0D73EF578C0 1918485 zurwm2006sollallesfertigsein
520,487,437 *352B960BDB6CBAFB3A731FA5FAD82A94D9C80EE6 CANDI ASHBY
520,487,438 *352A96D95B5414D951581FE15C93746651C57834 CANTELOW
520,487,439 *352C30AD000F4D155B0007AFA409D0A24A49B074 1.ALTERSESSION
520,487,440 *352CB721C860D93197A73124BB1FD795497EDC5A 1 ayirmayacagi
520,487,441 *3529527B39F6415AB28B80ACAC010916B6A60AF4 careyavelar
520,487,442 *35237F1DAB38B59306268115D93C4F5A37A2BC9A 1-clownte
520,487,443 *3521DEF2E7F4B3E38409C20A5268D724996160DD 1clubleitung
520,487,444 *352C09D2885350DB35894395721F1748B9DDB170 1 dialekttransposition
520,487,445 *35230326FFE53B3A611AEC04B5291F4743E372D2 carltonvaux
520,487,446 *3528B0BF2E1B589E5FD455AB2395A7777FCB1DA6 CAROUSER
520,487,447 *352009C695E1FBC0D7755670216636E0DB070087 1HNIABSW
520,487,448 *35241812048A083338342D93F7DA3948D95A864E 1.HOME-PARTY
520,487,449 *352D330849C3BAA5F0E786A12CE524F103CDDC3D CATTLEOWNERSHIPMAKESITAMANSWORLD
520,487,450 *3524247E6DFA7A9A43D3F0AAB8AC71F6009A6858 1identificationofeachaccessevent(eg,estab
520,487,451 *35269A2DB29F0CCABF046546EDC14C985E30747F CBT."
520,487,452 *35223CAFEB8B8836D7665B0480A8DE34EE788919 CCC30ACE8982FE788188A1512B6DAF0E-LYNDON
520,487,453 *352513C3E1404C1E0400F406DA450C33E67E5A02 1MCKELLEP
520,487,454 *3524EF99266C52A3A81A476301E4E3FB64A32BE7 1 MEAT-AND-TWO
520,487,455 *352A9B45D89F41277DFE84D324545160324E985A cdhal
520,487,456 *352549D85FC37B981FD88CE431010FEC3EC897D0 1-MONSIVAIS
520,487,457 *352C4B3AE4DE3BFBCAF366B8681EA9FF70EC08D4 1OKSALALLA
520,487,458 *3529B3E724EC4F8E7D07AF8F3EF4C72ECE793203 1.parallelslalom
520,487,459 *3522DB3E1CCCB1708C3543E7A73AD4D8493695A7 1-REDDOLUNURSA
520,487,460 *35291A9C1273D3FEC5B779E278CC43889EE6BCDB CGJCHAOS6
520,487,461 *352CD362728054A1EC1DD79D50388728706BC74F ch5-v
520,487,462 *352E92D98FD61BED9464506D528013BC97BC954F 1TAUSTATIEDOLLA
520,487,463 *3523EAB2C25F94D8FB6CA054C2942C55B2D97059 Chapter25-05:TheSeerOverheard
520,487,464 *3521A6E3385014556DEE7B568DCB22EBAFC13D17 1VUOTEISIIMME
520,487,465 *3527AE2A6E60BA682288452FACA02581D916C210 1YOU-KJUS
520,487,466 *3529A526CB61E716460FA14E540677BBEA43890D [email protected]
520,487,467 *352FD8B031A3F988326AE4C1F1F66F9D7F224A53 2.02.1435
520,487,468 *352ED7C43642E8E4D17BBF8D6C83020D27C5C34E 20GIORDANO
520,487,469 *3522868259BF32C272C0A01DDFBDFF5C1A136B73 cholesterin8
520,487,470 *3524B5E83C477D3F19C8F2F19615D0BD1D3812E1 20SICA
520,487,471 *352C9189419846DB597A3CFEEBA04EAB4A5D81BE 21FEB1369
520,487,472 *3527E28CD1A1A53D2BAC61E45C0CFF681612DEFD christopehr
520,487,473 *352AD3A534EB27814026384FF8401D4BEA4721C2 chrome_scarlet-kr/ou/m_'sk/a/rl/i/t
520,487,474 *352FA8C8072A552655F66F9B0A8DB348D48F6955 CHTA5
520,487,475 *3522D41CFEDC5D725A08140A42F79D677BB5409E CINQUEPOINT1234
520,487,476 *352601F33E63496BDC1E2CDA641CA5E7A3F0DE08 cjs8t
520,487,477 *3526EA375DC809B8FF96E601D6670AF0B4064CD9 2650650 luonnollisen henkil
520,487,478 *3520F8A05326C54F9D1E5AAA11A5B60288BDC77B CLEOHENGGELER
520,487,479 *35281A84E9D2EE6828A9EE9D7CA6C9602848911C CLEY-CORCUERA
520,487,480 *3529360A33566F995EE82166B5D26EFA6E4EF4F8 CLYSKSWA
520,487,481 *35291CC5761B377E7FDD59EF1657B91C04E7ECCE CM2v
520,487,482 *352AEDFA631655F1D63C36D44CB54FC8E8804587 coa.h
520,487,483 *352746243D949D876928BDD07BD5E8BFBE96208D 2.KOMEDIASSAAN
520,487,484 *3524BD012849C6558EBFA39A4D551F4A781D7058 2lains
520,487,485 *35220DA7C572413306CEDB441287C12A6A0BBE63 COMINGCOL1234
520,487,486 *352EC751FBE28BF387B467546AC43180E810AA08 CON476:TOSERVE
520,487,487 *3522A8CEECB286D94BEDED71711CFA6EDD5EC95D con5erv4tioni5t
520,487,488 *352A3DE023667F7F4701EB8F54741B1A726C60E4 CONICESCUA
520,487,489 *3522AC2C2D4BE659C46770BF3E02AF955BA61E75 CONTRASTIMULANT
520,487,490 *3527C2ECA3EF08566F24D4E2B6E447BD3F1C16CE co/%v
520,487,491 *352A2A23932777540181F57ED5DDA72A95879BB1 cpa:
520,487,492 *352B37F1E717FCCDA9760B976E37F68DC5CCF694 3=====b-~o~osploit
520,487,493 *352C90E3C37F715EAB4E8FB08BD0BC4C2692E73B 3BOTTRELL
520,487,494 *352A02CF84AF2C569372BAE986DEBD17F5EA2E3B 3-bricks-(feat-raekwon-&-notorious-big)
520,487,495 *352A98484E1457F8213873544015FA222B75E4AB 3dioecia
520,487,496 *3524B6C95517826CC5BF996B7736EC397D7D9851 3NOTENCEPHALUS
520,487,497 *352CDEE9303756F7DAE2BF30F90BFABCA46AF0C6 3=====p-*-*-*)O(
520,487,498 *352B371711CE360D9511D670588F0FADB91AF461 3##p~o~o3b<
520,487,499 *3526A3C64364FC5BEBB9754E6A12E22E57089926 CRCFBBBS
520,487,500 *352900FE668E1EACFE37DC3D43FF9F1E3F227E13 crcp.
520,487,501 *35230EED3828D581ED76D950EEB34AFB0EDBBCB5 CS0P6
520,487,502 *352A3181971B74658B3481CBAF9782A6C23F1811 csrkv
520,487,503 *352C2B36B126CB7D8223BE033C058972CD117B75 4INANELLA
520,487,504 *3527BF6C377C4A6E12F90EE3E3547DDA64E11A85 culturevs.nature
520,487,505 *352029ED708A7E4D3A9626DFD45D7664037A43E4 cusj
520,487,506 *3529952D9E43D3E64C9CB96A6F204CADB4843ACB CUW-Z
520,487,507 *35228CBA75CD0AC8FA70238674DFE83D9F6474E7 cw+t
520,487,508 *352D6F2E32DABDB4E7F38459EB4C2A30FCDD5D19 D-0AB
520,487,509 *352F4EDC4F00BDEC3C939082E954D2EEA56E6E06 5ANUTTEDH
520,487,510 *3521BC1A14D22448F728DF77F6458E657E298150 5ELWOODASDF
520,487,511 *35279BE63AD2AC0DC4732D39681A26B1C9F68F8B D1SSA71SFAC71ON
520,487,512 *3526D9329F0FAEF94EE954014593746D50BFD356 [email protected]$m
520,487,513 *352AFEBD2D6E1F1288C8A4CD0E5566FD91EEB38F 5HORSECOUGAR
520,487,514 *35294899439EA9DB52379E6733F0D6812EE73960 5ilovepearl8
520,487,515 *3523A7FB365B3F1D7948ED4786E99112CEDD07D7 D6IP_
520,487,516 *352F6C9BB8DF7A840E3ED20C7FA7E71A3559117D 5MONESHWAR
520,487,517 *3521A77D7C61A828A885905280E6C5B132D5C917 d8!yx
520,487,518 *35210C947638D15D40B7E145AE985CEC771E01E1 DACCEPT4
520,487,519 *352F5AB20A4951EEB0F1EFE55C926BFCE2DEB083 5SNIPERQWERTY
520,487,520 *35267FBABBED4E3C678F34DDE626C978BB669A31 5SUIKERPLANTER
520,487,521 *35225833CD41E03DB3A30A25B425072C442CE5F5 [email protected]
520,487,522 *35212A49349B5036687A26CF31105E3EC194B65C 5TR4T1N1
520,487,523 *352B0E675BC895B869BC527DFE1A56FC6F9197D8 danialcorre
520,487,524 *352F3ABF4EE59FF680D1EE37A318136FFA017A50 DANIELA RISTOVA
520,487,525 *3520D10B635517C78A0B06B7A8F0A60B7148068F 5UTRANGERADES
520,487,526 *352BFA0303C296A6C05F9801ACC69CD764A64014 dannydog1
520,487,527 *352370D91150CABACF1985868BE372830BDEAFB2 darwinbeltz
520,487,528 *35239CE306175BBF9C2A57E9063B0B3489FF19A0 DARWIN.MUSTARO
520,487,529 *352E87CA848DC9052E49834664B054596A46CC8C daskonzerti
520,487,530 *3528C0B9643166070E4A5C2B50AE703D6A5A3F37 DAVID.SIWIK
520,487,531 *35293DB881F184550FD0843F336F4CC13A7639AE 6CGROFLLUBJEROMITLABRELLIM
520,487,532 *352230EF8AE1CDAE9C51552A3CACCCEBC7169DC3 (><)*DB
520,487,533 *352B671F10387A8C0370CAC799E546CC8233ABD6 6ILUVBRANDY1
520,487,534 *352D0DFCD70436E8E45D9DD6A9E2448B1DE63BED DE;k
520,487,535 *3522D4BB2D89A927496F65E4178EDD64703BB119 de&&m
520,487,536 *3527669E0226C0B4C7C8E0A1E03BE8A38B3DCBCF denise768
520,487,537 *352FA70FF93E45B45143BC593D94206AA0E9235E 6VIDEREUDVIKLES
520,487,538 *352505C80EAA8161A710059D0A001609816C86D4 6VONTINA
520,487,539 *3529715AF4C81C50DEC2445F512195366B71666E DENNY.ABRAMOV
520,487,540 *352AED81D8261421440225A81D067D1B3ABC0AF4 723KEAGAN
520,487,541 *3524AAE851B27D252DFD1E5B2F987360ED8887C0 DENSISET8
520,487,542 *35205D8D201BFBB697DC07A2C9A41FD3967B6EEC der094t0n5
520,487,543 *352937EDDB9BBCB37AFD70F6261C0B061FAF8B42 derekrameriez
520,487,544 *3521563296DBB77C8D3E3ED136F028373839A9ED desiree.glass
520,487,545 *352979B9211895A11D8A6BB358C12E5923A2E392 7ENRENOITKNUFDEVOH
520,487,546 *3522AB73B536B9C76D8D208231EB32C404AF9536 7KWARTRE
520,487,547 *352DF77007428DB5B201970E6E4885615831C14F 7LARRYKEVIN
520,487,548 *352932FEE9AAE315ECBFF03B9B0687B43199ECDE DF_.H
520,487,549 *352903D26E73B7B54AD75CABF5D64B224425D4A0 7SUPERAMBITIOUSES
520,487,550 *352F99A58986477B4BA50376400BEF6DDE470E4D DI!!:
520,487,551 *35226640256DB5C43DF874F557476FA690950473 83N01+
520,487,552 *352FABEBDC97D63301851DCC4680E9FFAD59DD08 84DCUMH
520,487,553 *3524AE46E3B8066BEDE983E8D8E7A20EF074F866 85.versen
520,487,554 *352FF3C15E7894811549B2AA7423370CD8DFDDBA 888jimena
520,487,555 *35233B9045A76829650F8A1D7912EEDD0773AA24 89 SAD
520,487,556 *35255093F5B174319FE081EFE93CCF3D26B3C5F4 DILBILIMDEN
520,487,557 *35248EC7EEBEA57EF4485075E4B93E59E7D75272 dim!o
520,487,558 *3526E5900B4A228FA13321C764A18684C7927352 8CLOVERCFJ
520,487,559 *352EC3B1E1221AE93B5C7DA3C3F6F7182AD04146 DJINSTIU3
520,487,560 *3520609FBD7E7D13D66C0F7EFEA6C5D9641EAB80 DLUYJSSES
520,487,561 *352D82DC1D8985416359E029CBD2D566E4400A82 dn"li
520,487,562 *3527C31D20633572DDE0AF40C144A8AF5645090C doj?4
520,487,563 *35284757D7D79F3CCCD03CD1506C0DDBBCFF03E9 8REDLOHEPYT
520,487,564 *35291C1F3F906261D2C67921A70D5D924E63910B DONGFOXWORTH
520,487,565 *3523F3867558613A920D67508B88200C10B3F597 [email protected]
520,487,566 *35209363653D985C964A6013582F875C242872C3 8SCHIAFFO
520,487,567 *352018A32A8F63F90C12A36AD2C09F4F7E198772 Doorgezocht
520,487,568 *352E411A2041D822DF907D8B72892A0A51AED404 DOVIEDANIELLE1
520,487,569 *352971535C44B063B589ED32DEE9B25CC7867751 90.Ozenli
520,487,570 *352F324B8B5F95A2C1639F8C697BE2C17E0FC5BE 931241 in-the-1980s-conservatism-served-sun-alliance-well-
520,487,571 *3525EF7249927E035A071AD13967995A823019C7 #932 Disapprobation -- N disapprobation, disapproval;
520,487,572 *35248F5732AB2762B5601C5101416479F751F0DB dpdpz
520,487,573 *3526FC69B992BE924F26B8487E1258516D8D1C0A 9AIRSPEEDHEAD
520,487,574 *35241A4164542BF84A58A6362962F9430EB6455E DRUPG
520,487,575 *3524EB2F73FEB51670D68C47A26E0FFC1531C5B0 [email protected]_
520,487,576 *352E34D90316694E372B7D1FEE93A70A087DEFC0 9MANUELLO
520,487,577 *35248E62D70D2A26245B8279026C794D966670E4 9NOUKANKI
520,487,578 *352B6B00CDE2904B2E027F4C582EC74182379E00 9OUTLAGARIES
520,487,579 *352E67C4D4C8BA57FEA5158485E6990774086DAA 9PROSKRIPCE
520,487,580 *35223709FC2AADA13DBA22B4D8411B5855BFA97D a11us!v31y
520,487,581 *3522AF979BA651301EE21054BD8CFF45BA8C7AAB earlesmitley
520,487,582 *352D1199E7DFC6358D0FE97FE9EF597325B781A9 aab9<b
520,487,583 *3524D23F7ABAE0FE674AB78AD7E8B569B8DC7A2C edificammo
520,487,584 *352BDDAD00B8AA706D9AAC6515EFE629C195118C EDUARDOBEBOUT
520,487,585 *35229B3BA462B470E096E18549E15F0085094BCC eduardo-coudet
520,487,586 *352EA99E21F1F98E8E91F470BAF4568B171C3515 efbe=
520,487,587 *3528DDE8DB5146D62018C7B0872ADC29F5A05045 ELECTROCITY,.VOLUME.6
520,487,588 *352DFFE1AE19C6EE8036CAC6459DFD4ABC86C23B ELIJAHSELVIG
520,487,589 *3527B5E1E2FC4B0262890B33443E6D0ED2835401 ELISADALE
520,487,590 *35233291E150C196FBF569A448134CC2A1A78F64 elroycurleyhair
520,487,591 *352917C00C118F9611965EF7237D7C83B59B9D16 ELSIENORM
520,487,592 *352CC61EACAAB2D23CBF613E5AFECDBA32DD2286 elvinrutherford
520,487,593 *352D9FDC2AB4A835C856068018AA9EE2196D4DC4 AANAVIS
520,487,594 *352A7DA0FEBD68539A26EF614369E1B64B48737C ABJUDGE
520,487,595 *3523DDF8F24916CA31EB6A7D6270B10BBCBFE0E4 en66189187148x2
520,487,596 *352A5F94CA05259752220ECF41FADCB0A633F4C0 enduring-freedom-(part-2)
520,487,597 *352B6273A962ADC528F1EABB2717FB20DB36DC20 ad5orbate5
520,487,598 *35229CCCF6C81D9A99352F5353A6E7EC323F8825 adamlthomas
520,487,599 *352771FA219D267FD7132296A6304ECAA4629D4F adh,"
520,487,600 *3520312FF4E8028D4D9ED2EADBFF0B8B494B1E25 ERIN.MCCRONE
520,487,601 *352397AE699C35E3DF2B387D3E9DDCF521B69E52 erniefranzini
520,487,602 *3525F29637ADC8876590E191507E413E70296C08 ERNIEWICKLIFFE
520,487,603 *352CC8182013600736C1B64225EB6C4F8169647A ERUJBSW7
520,487,604 *352FC0F8B1E7FB52F49C123D9F65C65F42D0FDCC AFFREUST9
520,487,605 *352EE17AF591D216DE800D1B30DF36067F444C2B ahmedprevet
520,487,606 *352DE9B7D8377BB6632648731E6350D5C87DBB88 EXCUSE ME I JUST CUT AN ALBUM
520,487,607 *3521B5FD930ED1FC227146128B5AD0DFF0AC5240 EZEKIELSUCHARSKI
520,487,608 *3526A15BA875448F1720DF42D0859AF268A88726 EZEQUIELTRANSUE
520,487,609 *3527BC09AC589671ADC3A5D9E139B40B01090139 ezrahuffstutler
520,487,610 *352F647921A95EB211434E34652354E2D9028567 AJIWU
520,487,611 *3520ADE2292FE84DD257A20B2FBA9DE7BE0C7F47 [email protected]
520,487,612 *352C2CE706CB7E895EE74D219EC1E8874B813597 alexisdevary
520,487,613 *35287FB33C39DFE2C276CECB1A76D1F2BC7983BC FAUSTINO.COLLI
520,487,614 *3526A5485D89697FB9F222ECD5954D72B9CA242F faye-disc
520,487,615 *35260219B75DC892EA3934C31B299D8381705FAA F~+D
520,487,616 *3522516338B81372F6742BCE23EA2EC3CF330175 FEEL SO SAD (PEEL SESSION)
520,487,617 *3521DF28DBE5BBFA84327F196C26DD1C9B2F2507 FELIXRABORN
520,487,618 *35246F5F22BAB23ED757E09ACBB2D9E7D0D3B699 FELSENANLAGE
520,487,619 *352286015D15396147D5534C605147AC72F6DD12 FERNSEHATEILUNG
520,487,620 *352278B286BE830020B2D28BC6D7C512927004B7 a--m6
520,487,621 *352F1F54CCB961AAECF2A059F60B4B76FF855818 ambrosesolima
520,487,622 *3526CA370E65A40A1CB8F8DADF4A8A7356C63E0C amw)s
520,487,623 *352B62B732AAC2ADFAFDC0AEC550AFDA8D9E4A6C An%!
520,487,624 *352EBC9EA6A070C8D79E0C1C3D3DE83D402ED98A anbd2
520,487,625 *3522CA003A0CB5F0A7B5905A0CFEED3360F917ED FRANCES.MORONTA
520,487,626 *352069F1D5584C77628B96930D0CDB7F1579BD6B ANDREKOENEN
520,487,627 *3529E887331E7751BE0849443FE1BBE3EF5775E8 FRANGEREQUE
520,487,628 *3524954960D99263EB8D6FE8F4E7C934081F1113 FREDACOLLINS
520,487,629 *352BDD2845321F28296129BE65B9475B80AD98DF frfore
520,487,630 *352FE3FB2AF59E4BF0E81C914D03C0CAB003465F ANSWPOSTJUNG
520,487,631 *3527AE2CA144AF55744B87DE877AFED75803DDE9 functionsinaddition,attheb3classandabove,thereisa
520,487,632 *3521341ED0070A9C402242D64580F9A8F114990A antionewestenhaver
520,487,633 *35292CA13461BE26BFA69566AF0502B9DEF8782A F(WL
520,487,634 *3522B93B278305BC56FBA807716DD423CA7D9713 ANTONIOPETHTEL
520,487,635 *352D2D403C34BE6BAE109F95E3AF2DF5459BF562 ANTONOPHEIM
520,487,636 *3525FD1116DD05DFD7865C8451ABD9A052543AA5 g180905
520,487,637 *35246D6EE624EB0B3CDE7A6A9995ED03ED2D462F anveshhamaanaanaam
520,487,638 *352723E46A33B8D0731B55C655FAD820C75EFE20 AOC
520,487,639 *35204293B713389459C91B453D9E9D7D27E3D781 aqa_g
520,487,640 *3526CC369FC42DC07728B1210517C91AD1324338 GENARO.GUNNELS
520,487,641 *3521713DEDE64A09B6461E28B19A14CBF22C8885 genital.mutilation.by.aids.infected.whores
520,487,642 *3527CE8937B51FBB82186CE233125F3A442D3342 gerardgrimmer
520,487,643 *352A938DC2BEA8A547D31D978D03F3E6F647F527 getaktete3
520,487,644 *3522B72E1E3F0D9E64032300E0E7C9720FEA7849 arnoldogrotheer
520,487,645 *3528BD4FE504E122D3F36B8B7532469A81173174 ARY,0
520,487,646 *352681F99BE8AF28061CDC725AE7B4B72E24783D GODRONIRATI
520,487,647 *35243DF9B29F6355E50678602A851C8495284251 ascus
520,487,648 *352C223468288753164B057182368064A8071F0F ashleemao
520,487,649 *352804D5DFCD44283C008D2AC59199EBDBD3EFA7 ASISAGIH4
520,487,650 *3523D32411FE44B35B5F261D3E42703AAFF43549 ASSIARG4
520,487,651 *352FE23E47F4C4B0D0C334119AAA5E42623E430C GR4DU4T1ONS
520,487,652 *3523E6618BFFAC580596E70D476BFFFE44F513DE [email protected]
520,487,653 *3520A8FBFCAF037E09ED951D80362D4301F4F25C A.TITANIC.SPLASH.(AGAIN).4
520,487,654 *352361D1449F12832A0B4372D95D8001BEF8EF3C [email protected]
520,487,655 *352C48119EE8BB2BC61B8B5B070F37772E617075 guskrabill
520,487,656 *3527CAB5B01847F8C71CD466B088EDA867674CDE [email protected]
520,487,657 *3523B46CD7EA478908D3EF44B9552EC6964A46E3 HALMCMORRIS
520,487,658 *352030D662856008EAA6B1D1E97D552CE7BD4F75 [email protected]
520,487,659 *352CDC8D91DE364A3E3EE6B1AB220225D56927C3 hamilton.augusto
520,487,660 *3528912C00D366A53787ABFD10EB6F1BC33193ED AVENTURERAIT3
520,487,661 *35298DCBC734A7C31B60C1BE6816B1B31CB79741 axp+t
520,487,662 *3521B7E87A1FE51276C7A3CD62B162286C4D4138 HAZARAT7
520,487,663 *352AE315CC817A606E8E1913A86465A6BFD80338 b1la73ral1$71c
520,487,664 *3528D2047056AFBB52F313A405FCCBB040046643 HERPROGR9
520,487,665 *3523745F3FEE4B01985C271A0D1D10A461B36C46 highfonts9
520,487,666 *352FEB37F4D50EEFEE7A150642CA319DBA7AB4D8 HINDUNESS5
520,487,667 *3521C88794F40D12410B44C661607BD420AF29FF BANGALOREEXPLOCITYCOMBANGALORE
520,487,668 *3529D6B716DDC9AE5EBBED7400888270D2D39F2E HOLSVIKS
520,487,669 *352A460E577347D76075F68CDD820D321EE54CE9 horaciovoelz
520,487,670 *352A0E4DB5CFBEFADEB35DDF7E1EA9750588C28C BASSIMORINDA
520,487,671 *352339777B3F4F8DDBC6043CB351914C57A9B5E6 href="//miles-brewton-house/ref=cap_kpm_pdp_17
520,487,672 *352FC50591E47005D00F3931513A2CF24DC73EF2 bc4fca3597b93016bfddb6011c431b59
520,487,673 *35253018F895CB8DE95C5BD5CDA7063F545BBEC5 HSF
520,487,674 *352A8EA85D6D883680869E345C27995796874675 httpwwwteknotikaco
520,487,675 *352AC122B7779AFAF408AA60C4C2CD05A5ADF033 bddfunktion
520,487,676 *352488646576C1147BBA50570C7272C8818BF493 bd/m
520,487,677 *3528BFF388578E3AE4DCA9AB4CE635753196090E BEAU.MICHELI
520,487,678 *352C9B7A09DC89D6A8CB02B2F249163D8B506939 BECKANDREWS
520,487,679 *3521163BE7FCF3D23DC05CDD457187FC0334B6C0 BELEEFDHEIDSHALVES
520,487,680 *3529126FAF18D623C938BAA03F3DA41EECD36A11 BENITOGILCRIS
520,487,681 *352199FE7E7A99165C305DEF0F09BC01743EB0E7 I5ZX
520,487,682 *3520487DF91D90C7BDE6EEE5A626E1A8DE1842FA BEORTWULFF
520,487,683 *352571CE982467326FA525EA538402865ECBCD5D bepf
520,487,684 *352E288D9EDB811F579F43B4D0515E3D9476F62F If.I.Had.a.Possession.Over.Judgement.Day
520,487,685 *352FBB00BBFA2EEF375D026F383613CE1219BBE1 bfgjk
520,487,686 *3529E5FC536979EC5F8EB98439008ADC60FD37F0 bi$4!
520,487,687 *3527DA9B960D45378C10E32058CEBFFDC6083F04 BIN!6
520,487,688 *352143D4C730DE8A4E2E4D3ABA486DA91FFDC9DA ILUVCAESAR00
520,487,689 *3527ACAE444392C75C53F3AA832DC442F04F10EE BLAKE-SINGER
520,487,690 *352F957299826F3C10A8801E007920144320768C B;LFK
520,487,691 *35266AAC95B90264A4B0EBBAC99251F1EA7CC322 @[email protected]
520,487,692 *352181422A1352E1D6C617FAFC163385B905D4F1 B######@~O-}O{
520,487,693 *3521CB1CE4E789648CD2C92DF61B264DBCA65CF1 invicnible
520,487,694 *352C8EE4755D16504D6749AFDD62DFF85726DFD3 b(q:g
520,487,695 *352A7DA4721B61837C73C2786512D9E4BC7F021E IVAN.BOUTET
520,487,696 *35222000C219BE6E86D26F0D6299EBF556982EB4 BRAUSTER
520,487,697 *352512AD998ACD0A30492FB60EB4A088D49C2451 brg4p
520,487,698 *352F9538B6FB89C1B91242803D38BEC909CF8B41 BRITTANYERNEST
520,487,699 *352EAEDC04190DD9673A4368AFA476E87FD3352F JAMES.SCHLUND
520,487,700 *3526F401EB840F10E3FA2A3D088C632F81D6BD1E JAMISONMEISS
520,487,701 *352EF1351E477AEC13D0FF1DA7C1B49EB0E774A3 jana-nix
520,487,702 *3527C43DEAC3536D60AD5F5F7551E7736EC3E4CE BRY5
520,487,703 *352252771C4C8E90F0D89E462E8CA59A1FFE2185 B_,T
520,487,704 *35287E6FDE3BE8766CB0CF3B5D777373B7D055EA [email protected]
520,487,705 *352DB4937F5159EF4448ECAE1E5F6CE3C047E3E8 [email protected]
520,487,706 *352F9DB34E104C59247AFA09DD2E2C64AE4E1375 JERAMY.GLUGLA
520,487,707 *352A31FF621B7C5917BAE2F0C24475290C3E86EA BuFI
520,487,708 *35204040EF6752C0C4A0055F8B56F11F4AB95120 BURUNDIIN4
520,487,709 *35223CB6C7D54F841E73BB0C43F559BA04B8B81E BUSTERGAUGER
520,487,710 *352C2D9A59946A4AC4ECA4A5CE9A5C6F454AA7CB BUU1
520,487,711 *352BE2E7994D0344709A32B652C5B41ECD73B340 B+V"Q
520,487,712 *35241A205C3DE9065B9593407B4892DD1247F5BF BXC.S
520,487,713 *3525495B9AA7B96DF7FF1005B4A45CE33BE2A032 JOAQUIN.VELARDES
520,487,714 *3527D83BA164F8CFD26A2E8D9229CB1C9D806236 [email protected]
520,487,715 *35272A5E5EA381AFDA0950522BE06C644A925982 c1pa
520,487,716 *352036677D2FD74659EEBBB9166A2EF15F9F27EF JON.MILLER
520,487,717 *352A8BBAE10212525DEB241EAF653003E42C4CDB JORGE.JUGO
520,487,718 *3523596E0E90544452946958591F7379B48A07C0 JORGE.NIELAND
520,487,719 *352C476EE285ED834B78E61B3D6B81E2A6AF6376 JOSEPH.SMILES
520,487,720 *3525D9063D3D2507C90289ED00F9B072DE2438E3 c%8b?
520,487,721 *3520237BC1E5949241E4F9B1EA972DD81AD7A79D jubelhornets
520,487,722 *3524F43EB1F7BCEB726B812A5233B4F068B9A36B JULIO.SHAMMO
520,487,723 *3521797ED52D4315E38CF7D4ABE696226CE12575 CAMV106
520,487,724 *352508CCCA5DC9B0052A3BCEC859DB689D77E4C4 KACI-RUSSELL
520,487,725 *352E8D580E3B3E3C7EE5D2A924A440D9330624BA kai457
520,487,726 *352E59C5F8054015C459E2B67D6219C3461C6EAC CARLTON.SENECAL
520,487,727 *352163E1AF7230D7624989D0E94643FDC000AACB carltonwohlwendi
520,487,728 *35251D98365856357C75C6FDDCF995DA42227E33 carolyn-keber
520,487,729 *3521C94A01549879144AE88238541E166BABB258 CARROLMANLIGUIS
520,487,730 *352A1EE3695BA1A55C0B2AA1CDB0C809FD0737B2 CARSON836
520,487,731 *3520C28E5CA33F27B05AA8D5C9BFD527262AC8C9 CARY.LIFER
520,487,732 *352E2A785B0C8F6AE8888D0973660BDC16F47D81 KAUPPURIENKATU
520,487,733 *352F9252CE005F3CE824209356F13ACE0744C36F &kB
520,487,734 *35226BCFD5E915D3FE4D73E0285A752B6EBCEF68 KEENMURLEEN'-'MURLE
520,487,735 *3527C681988CF4B8B562C6F88C796C0232DA2062 kevennealon
520,487,736 *352B59EC4FD6975BF913970ED40A0059C6C78D07 CCL.B
520,487,737 *3520C1AE5CD8E72F41789B2E03C5E80F20C38D26 KLAUSBLD
520,487,738 *3523A0122DFD02F0E3046BC8F08A4613E8333D5C KRAIKIN
520,487,739 *352B6838873189CD1CE41345DE90CFBF2A1AF0F8 CEDRIC.OCANO
520,487,740 *352F467CC9FE4D4FF237FD4241E384294663AEFD KUNSTSPROG1
520,487,741 *352C0B4B731BF4EBD0CE751D1DC6719F23DFC096 kwxa
520,487,742 *352633E2542036E4D82A6AFA7DAF9FCF49BBFD18 ces de clavecin, book i: suite no. 3 in c: vi. menuet
520,487,743 *35274F8A2DEB7D8C73043D4B19188ABE402A79BA Chadathon.2000
520,487,744 *35281AC50675F13917951291837B4B883D4BDE1C [email protected]
520,487,745 *3522618ADC5E1A0B7F9A32033BB26F7F0BA19E2A [email protected]
520,487,746 *352876DF0D0E0AE263CB74916A30B2ADD142BAC8 [email protected]
520,487,747 *352FDF12B05B8B084501EF056AC4621637147B61 [email protected]
520,487,748 *352F86119C101678AD659B34BEB91D4DC31D2F20 chantellombard
520,487,749