List database


# MySQL hash MySQL password
515,150,001 *3499EBD9C534690E0CD93D6B756393092ABEC540 LEWIS.HOLCOMB
515,150,002 *34973DEDC75F639192D67738942571E9E7600D59 [email protected]
515,150,003 *34967703360919CB9EB446C260F4A37057CF8637 MARIN.JOULULAULU
515,150,004 *349F0F3AB8AF4FAFF2050EB9129920EF3E224357 mark.cozzoli
515,150,005 *3491EAABB07AA91FC4FDBF0FA2BDCA450161C6EA [email protected]
515,150,006 *34924464B56CA4D1F89285A4E4FCAF67898F4C6D MARLEN TRUJILLO
515,150,007 *349A576E89CF38A201FDF290B620B828D4237BB2 LIGNOSAE0
515,150,008 *349EE48FAA454CAA4264CEF2A25596DFFFA732E6 LAKESHAD3
515,150,009 *349E16C44FF848C6542BDD877896CC6849F6A96B lamarjangula
515,150,010 *349405664376A586F3AA19C2DAEC3F499753C916 lamarketelsen
515,150,011 *34986C32F98263748588C5C0ABCEE21EE1853A7B LIMBATEA7
515,150,012 *349B90F6032F1727B01C7BE828297A24BD50DFBD masongordineer
515,150,013 *349859CAF1B96C23ACF0824C9236DA9706EDD644 [email protected]
515,150,014 *349E791649D704034CA58456AA49B4968CF87D9E MATALHA
515,150,015 *349DB46ADFD4B50DE4096374853F6528AF60CBA9 LINWOODCLOWSER
515,150,016 *349FED6F923290C2FA00F70431C11B7E4818AB1C mattivancic
515,150,017 *349FEC732003403542FEFC35404FD045E56800CE MAURICE DAHER
515,150,018 *349CA5CA08A5AF7A5130D4B676288A568DB83648 MAYNARDLUEDKE
515,150,019 *349BC9999213CDB2347E86A6A4AF6DE4392CE554 [email protected]
515,150,020 *349E07D72B2DB87735C49499F5DA315E991642D4 [email protected]
515,150,021 *3495A2726D22D613BFD31C882211BA1906F081AE [email protected]
515,150,022 *3495F4EA021B306972A211D314AA4B60F73A5AD8 ljvv
515,150,023 *3492A9798FD76EE181653A82578F82D56FB02CD6 LKMSWC9
515,150,024 *349B5BDC39095107D202C2F5219D9E1B95676243 [email protected]
515,150,025 *349DBF4E661518FAE207B7E551DC52E6D0703680 LMUSHUNJE
515,150,026 *3497F452A280EC099DB95B4D4063718087C9E807 [email protected]
515,150,027 *349FAB9BD9E864105BE13A9D1A3F979A37006579 LONGGRACEV
515,150,028 *349FBD8F9934B32DA83669E209F584EE89B93CBC leisha.pro
515,150,029 *349D026FFDBE4DD01BDF783F887A422B38A41F7F MERILYN
515,150,030 *3494D5BA75E7B67DEDD117324DA277DAADB0052B MERLIN.VOGAN
515,150,031 *3498F5949EE1849224BAD361CB3ED6713FE1212D LOSTLINX
515,150,032 *3490126B951510E1CAE1896228248FA76FFBF09C MICHAEL RUHLAND
515,150,033 *3490E053470AC219BFC78C8275A9820D9AC27B39 LEROYCOHEE
515,150,034 *349D54C6786C332FF3C204718EB10C07492C50F2 leroy's-purple-shoes
515,150,035 *349FA9B580DC2878D2585A09278EC755C882D8D1 LSCARPINELLI
515,150,036 *3496D728EF3694F8F6FBC02436F2A1BFBFF3E6EF MICK.KEENAN
515,150,037 *34912A9B21A00C7F29CACAC3FC053316B6C2598A MIKECAMPOLONGO
515,150,038 *3498438B112EFFE3DF34F401AB8D91B2EDF286B9 MILFORDTARTAGLIA
515,150,039 *349B608A35E5A69B8DA0759392E4CCAC49308E22 LIAMBEER2
515,150,040 *349233CCE34E9B95A19BA2502D08AAE209AC900F [email protected]
515,150,041 *349D2857FDD0AA4608D3D09FE3810C36AED8F572 liberatormijnwebusernl
515,150,042 *3492A2E6440AA302A29E90A822269B3028D236FF /LIB/MODULES/2.6.3224SERVER/KERNEL/DRIVERS/NET/ATLX
515,150,043 *349A63F7CBD7D516F2350057FB92C376B4DBB4D3 /LIB/MODULES/2.6.3224SERVER/KERNEL/DRIVERS/WATCHDOG/IB700WDT.KO
515,150,044 *34911CC352786509AA9D123F1C2537AFDB7EEDEB MINHSUNDBY
515,150,045 *349CB80814F0919A9EDE261B2F1F902FA215A01E lunitari
515,150,046 *349FC5A8A96BBBBB670A0EB9230BBDB2E2F58E50 [email protected]
515,150,047 *349D02C61741036505D1198E057E8956AA384166 LINDSAYDEMICHELIS
515,150,048 *34920240AC3E596FAA846DA032458A23293E07E4 LINDSEE.KAY.WANSTROM
515,150,049 *3491A507567FFD3406BB8960E86DB4DC33D1E396 LUSTROUSASTHENIAANETLUSTROUS
515,150,050 *349A4469386E6021AA92403EB66DDAC935BA62E9 LÜTTBREGEN
515,150,051 *349F2B72E1BC4FCB162E28B4F28A35E1938EBEF0 mitchstandring
515,150,052 *3494C00025432517BAF3B72F6A64906A29D6B530 MITCH.STOCKWELL
515,150,053 *3493113771431114DDEF08FE69FCE5D3809CA3D9 LIPREET3
515,150,054 *34980A039A8574F1BA6732C14C7730F490F23F23 MODIFIESING
515,150,055 *3498B4F87AD1CAADCAA25664FF1C329282080AC8 MOHAMMADKOCZELA
515,150,056 *3495FEF5D72102D206A136176A1CB6CE3498604F mokuren-no-cream
515,150,057 *349BF18A512D10E45680A41D7B3C31B7D3912F6B maha-suliman
515,150,058 *349E6C70A0FED07A901DD1ABFD4F4EC4B6827E31 MONTEGIELSTRA
515,150,059 *34972790AC4AC4368A92A0DF2013CCB2832E8E3E montysorin
515,150,060 *3493ABF67623303F01F5307380DBBAFECDEFC07D lockwood-san
515,150,061 *3493858E04608753EA5FC3E7D88C46A7F0FBCC09 LON.WEBSTER
515,150,062 *349E327DC68876F0A7BD8003FA537478FE4FFB94 [email protected]
515,150,063 *349FD4285BB645E1569EFC8EFAA24F9C6C95A4CE MANAGER'-'BRANDONOCTOBER
515,150,064 *349A8ED5BBC87B7E771293B07B5FC6B69309CC69 MANNAUSA7
515,150,065 *3495733BE0C00F34FB5D0F4F78AA1C70F082BD8D LUCASTOWNZEN
515,150,066 *34935F8E3BA5C3AC1B3A4FDA47BE63ED553DFB99 mudithagunasekara
515,150,067 *3494BC13AB7DF7278131FEAA710FAF14EE9112BE LUDZIEJAKPIACH
515,150,068 *3491A95DC87B013CA0F3AD4CDB3D53B1016E5D0E MUSTAPHA.AMINU
515,150,069 *349B3D3BB3417DB2B7B8E1EDFED25B175D0841DB margaliotletoldot
515,150,070 *34905CD9540BDA090E612D53FD7BCEB6F2C2E0B7 myronszafraniec
515,150,071 *349B856A4EB3DCE0686B0C8DF4768619263E0E22 MARSHACARPENTER
515,150,072 *349BF1E9E3AA7D50E7AF1C755616B61802E2A635 M.160160
515,150,073 *3493856AD07845FF84D0C501BE746814EAACB86F M3NS+RU4L
515,150,074 *349BB01CE933713849B34202908A2932D057C924 MĀTANGA
515,150,075 *3493355D3F34A3819AFEC97A46A95FA8316BAC3C malfetri`a
515,150,076 *349C232F88E77848EDB43232B63049CE74234E1D mannafromheaven
515,150,077 *349E4F2AFFF31BDE0468E4EBBD7953A22B2A6F91 MBEAFEA67
515,150,078 *34950F035318497EB5CB64E5A69487952D8CD31D [email protected]@+!0N$
515,150,079 *34912BB531653776937BB029C0D557B879495BA4 mary-kornely
515,150,080 *349BF3FA8853CAC90EEF3957576866BA121E828F massulas5
515,150,081 *349C92B264BBF385FC3ACC9985A501EECAF7EABE NECAREY''NIKECAREY
515,150,082 *3494561CC6AA81AD2764633705312EB541A91E1C NELLART1
515,150,083 *3499CAD1246C4A2ACD3AC962E7EEAA387A1F539D NEWBORGGING
515,150,084 *34932562C0513C28BEB8F2FA69C0D18DD7D7342E MERILYN
515,150,085 *34964F59699AFAE5B5C2714946FEE7C7C3FF9D06 MENCHVILLE'S
515,150,086 *349EF7346905560BA2EA963D4AE63B7B7F016F5F micateresa
515,150,087 *3495CBCF5A9353F2D2B75B1297548EE3DEBC69F0 michaeldunken
515,150,088 *34946A1F9004E2BF6FBE52880EA0A2399BAC0C08 menţiunea
515,150,089 *3498BE79F5F407EC7BF2C9AA47DAB9A769870C81 NIGA MART
515,150,090 *349F7E70055721BB807098398A76B4FCAAF4997C mijah1996
515,150,091 *349D95E6085488C2F33BE78115267601A3953D59 MICHAEL.CAMUS
515,150,092 *349207529F061FC566EEA986E85525E159BAE039 MICHAELDUCHEMIN
515,150,093 *3492635490EFA0E145E2CB1D7B1883C714D098A0 nn0]
515,150,094 *3494CB37DFE319E487C7A23CFACA57D0697BD15D noeitang
515,150,095 *3495CAEFC51537E31E0B1965BD7596BAF4E27B2D mikelloredo
515,150,096 *34951F7FEF3012D543DA0EDEF5A3A2FF1BE5D3F6 MIKELOATFIELD
515,150,097 *349611B0DA0131932CB18EDA77B3790023F0A5DE NORTHERN-LIGHTS-(DISC-9:-SVALBARD)
515,150,098 *349C61383E20B868E9E8EEAA26ADD239B4106E39 NPOONYAYANT
515,150,099 *349FF67446797A3C39A0786153B42EE71EE96C56 NSALIZAÇÃO
515,150,100 *349EF3D00BF1B45483A62A9029CB174782999E0D MINDY-CROFT
515,150,101 *349451C6FBD9D33F125B968D3F5690CBB5F19990 ministeris
515,150,102 *349D442E3AA12CC21B9680BD3AC7A461F7F9F4F1 )O(~`.~`<------3
515,150,103 *34911974B09F8943D1E4DC1D58DB7FCA8D697CF1 oaguruf2
515,150,104 *3495ACE7F347E59341EA2426DA252995F8EDE538 octaviopester
515,150,105 *34936CD8AD3E95DC6B4AA63D254C3ECF5D78E30C mjc9891
515,150,106 *3493CB4A03FDCAAA0C23CCBBBCD005861462D56C ODYSSEY,PARTV
515,150,107 *3496C23CC06044B0801AD92F62E969FC587BACB3 mohammed.ruman
515,150,108 *34945CF9F9036DF7B610665B8EBB5E3C3F6F7D10 MOMENT.STEVEN
515,150,109 *3497D307A4BDF6C86C4864FA6D719A86911D0D8A [email protected]
515,150,110 *349A8364ED0E8F8A17A306276CEFAE1C50B67576 MPTMNTS
515,150,111 *34996AC62A4EA7CED460DD2F1364212A38A72692 M.S.W.M
515,150,112 *3498ABD0A70DBB3298C1085874D8B7F92F87E3EE MOUSE1SALES
515,150,113 *349379D6D96D01D7DFCE5E56A6E5D0372E9F2DBF OSWALDO.TRESS
515,150,114 *349632EF4CD4BAC13249DB7ABE89A42561BEB5C4 MyNameIsRevolution
515,150,115 *349061304FBC229A781B204D735D2B0DD8277D5F MU17IVARIA73
515,150,116 *349EE5EDE7845B37BB68BB02B897AB350DB5F3A6 [email protected]
515,150,117 *349A12A8F604A665BAEF6CBAAFB8C6A6E8DBC2D8 P-----> ~ ~ ~ (>_<)
515,150,118 *349FC136C4BA9AF02E64D5C553D59E301A5AA5AD pablobolinger
515,150,119 *349514B16E4A61EDFD42642C6AAD8E364CCCC615 NANOENGINEERING.UCSD.EDU
515,150,120 *34962334C08AAA912E6C7F54FDCA22A45189D4FD mutabilit
515,150,121 *3492ADB01BE8D5BB9715F96DD5B5658E6636F236 NATTENDANT
515,150,122 *3494AB8A7467A95EF7BAEEB3B909272CFA2824C8 [email protected]
515,150,123 *349BD66AD45027E00B4640D1760BD9132440D522 ndhistory
515,150,124 *3494ACE8FD9D0A06005031FCA0B8EB8F91A13862 MYOCYTEN7
515,150,125 *349C478D29A9484CF6AECAA8C577656E209670A0 n3+baa
515,150,126 *34912703847F3C92FD5216E8B409E29725E2865C nixtunsed
515,150,127 *349CC3387115FE9725DB1A5635027BF57807C946 no.6(credit)
515,150,128 *349076BD8BE6385D167799CD3728FDE0B0E237E3 NATHANAELSMEAD
515,150,129 *34960AEBD44498F9418EE553F5B772298C07F051 NATHAN.BAISDEN
515,150,130 *349CF9D8181A0B193C8DDDA9E13E7F3AE7B1019A [email protected]DE
515,150,131 *34994A221FCB75C2C563B8AB3B5AC3892D82A566 phoenicaceous3
515,150,132 *349BDFCBBCA105659E7837C5C096E437065F4AF3 NORSHABAN
515,150,133 *349B206946415F7D454E112B6BFA99AE3C434E5C NO-VOY-A-LA-LUNA
515,150,134 *349D6C6902EF8E7063B4A1F6F30FF84068CEE3E8 NPLKKRSES
515,150,135 *3490454C93069E9331237E06B5C4E51388370856 pierreloo
515,150,136 *3497D019AFBDB48E1A63A24C0FB223F2F6AE178F [email protected]
515,150,137 *349A6D7F24EB404E6C56F6494F14DB7EB7B1FBD1 NEVILLEPULLAR
515,150,138 *349C87065AF604D8667DF18924D561AE9B6F1F63 NEWBNDS8
515,150,139 *34929462A3D8B07974D2F2594D330313F28247B0 [email protected]
515,150,140 *349A22DB62299DE1BA70D1368D8DA0FE688A19A8 ODECTENA7
515,150,141 *349831234D093CD7BDA5EE22EACC247FBE4BA0CB O/IF
515,150,142 *3490BD84F164819F16C8056438EDC07D5549F5E3 olimpiyatının
515,150,143 *3498331A6E0569DAA52407C1D114411B506FC533 NICENICE
515,150,144 *34955E17D55E93E781204C5DAC0AD6FF04839A8C (^_~)o~O~(=====q
515,150,145 *349140735BA241B296FD4DD1DE91B236C49556DD (o_-)~q====q
515,150,146 *3490FF8785A0C8C6432FBD65FFA2DFECB441A979 pomante6
515,150,147 *3498E3BBDCF4221512A8C137F6DB17D2A7CD9B7C [email protected]
515,150,148 *3493F06A1CD68FFC5C4A47C1D8B90ED3BCCE170B NOEBOTELLO
515,150,149 *34928D0BCBAD8787239243CF0DE0A31BFAD0474A NOGAŠITA
515,150,150 *3499255EABC8884D528B17CC277DB85EAA4A5CDF NORMANSZLOSEK
515,150,151 *349E02AEA5158760B0A90477696DF0D7500BC200 nowina123
515,150,152 *349CF6A9373F02B4F31535E38466EFCC6B8AAC9D pP * * * ~0~o(O_)
515,150,153 *34940FF37989901B420F5AFC81576B36E7870AF1 nvehunter
515,150,154 *34909AC3DD35F3A61178F1702747E6E20CA7DAE1 $PR!GH7$
515,150,155 *349ED5D024365A05196DE66D3EE05122E4D70E22 PRIEŠISTORINIO
515,150,156 *34994DEA881B70E533CAB54C59B67F62FE8AD2BB oddessy11
515,150,157 *3494A65DCBE71994C3463C82DA5597889F6BBEBD PROCESSED.1
515,150,158 *349CDB60A8DDF595E1C45C826EA54FF10FC94B0E OMGASSER
515,150,159 *3499F4988C185F088E50BE727E15B73379D42274 puzurassuriii
515,150,160 *34962290380FB1AF0D954E693EEFB2B9324D8393 [email protected]
515,150,161 *3495486608716838487DC122CDB2803A63C0A86B PVXUENU51
515,150,162 *3494AA3B92427B7E5486A40BF193D4AA15D2F781 [email protected]**)0(
515,150,163 *3493EFA76CD012BE1B27F96D176650096987D8C8 P#B~0~O(0_<)
515,150,164 *349B9D5769B056CF756E82D70D8E66A4BD6BA091 qepb5dg7
515,150,165 *34962F5AB654462EB89671B14A0906197C4478FC Q`]I
515,150,166 *349CCE60701107EE77B0859F619C1C41D70F5B85 [email protected]
515,150,167 *349035723301B89C9F01AB3FE20C42533783B2A9 opzichters8
515,150,168 *3498DC94A58289CCDDC70A9B1F21CAFD57F21AE6 PHILIPCARSCALLEN
515,150,169 *349DE5BC758721071A9DFCA83D8EA8451A6B5FDD OSLUNN
515,150,170 *34986B14D94EBDD2F7B6F00C224ED972C9943379 OSVALDO.ERLWEIN
515,150,171 *34968BA80330DD3CE68458BBFB0BDD32A3FBF4E0 picnicky
515,150,172 *3495948CE822670F266B9BD1FF4885437FF9AA47 Piruinha
515,150,173 *349D243C2CD889FCCB80825B9561E15937AD9D5C RANDAL.STASIO
515,150,174 *349BF32330752D8A315F1C606A09C861ECE73206 OXYGEN-AND-HYDROGEN
515,150,175 *349B10ECBE998DCCA8445CF14DC3497E2D605F91 RANDELL.TRAUSCH
515,150,176 *349514D945ED654C8A504F4CBE7949314B5E8AE6 randycain
515,150,177 *349FD0C59F73653C92F9D269CFEE10CFA1403328 [email protected]
515,150,178 *3493AC29D5B4C4BAE58E3BB17D629F93153A76F9 PLENERYING
515,150,179 *349CDFB143DA170099DA5DD69AE8200866B78E44 P#) ~0 ~O SPLAT!!
515,150,180 *34925BF398C5BAEEEF909AC7F12704FEB47CDAE0 p#)-`~-`~o->-<
515,150,181 *349E81C62CE8523B959E77B02E93F00CF82E8EA6 PABLO.DOBROWSKI
515,150,182 *349F09B82578AD09BC07DA124B31F87352635C2E POJÍDAJÍC
515,150,183 *34910FDCE07750BC5CCB8CC48B2D315A35CEC695 [email protected]
515,150,184 *349E4A6749EDED0BDF0B84C4E4F4D596742D23E1 pan0ramica11y
515,150,185 *349C848B027D64DEF1C320A7211513A383101D85 pancreaticus--a
515,150,186 *34963AC41B935F937EFA109B60C8FDA6D8E9F46B PAPERWE19HT$
515,150,187 *349A67A20BA49E2BE6563AA116407EB1D79D3339 pravnicke
515,150,188 *3494FF94FB8F0A65E3D7F76E00C607F816328C7A REHTOM7
515,150,189 *34966129BFB81847C3A4B138B287A89E6B114BA2 REINALDOSCHWARTS
515,150,190 *3490607474B6243CCAE908DC46CA2A4FEFE20325 [email protected]
515,150,191 *3498045D6A8434B1E8D929B016A36898F8097329 prestongellman
515,150,192 *34968D0D4D4E3D895E949133BB3F0205D75B1BB7 p.b..&.j.
515,150,193 *349AEE951E6F320F5E1682A6941333E7AD067A92 PDM
515,150,194 *3497E396D2767DA5B6CA74E22FB7B44C2F5453B4 pedrobukrim
515,150,195 *34939AB350C0EAB14E94953C18B3FC0E8C8D3C2C [email protected]
515,150,196 *349E31EDCBC646B601A7377F20A1E22140BBDD44 [email protected]
515,150,197 *3491BC1962496A4C02D22C2224DE8A746EBFB6AC PEMPHIGOUS.
515,150,198 *349C40489EBF858EF416F52B4B1EBD6C6AAFB803 REVELSSLEVER5
515,150,199 *349003E499FD3CAB139274291D30B8A5EB82D981 perpendi6
515,150,200 *3496C745A73B50F158CF99F5DE16CA7F462DD54A [email protected]
515,150,201 *3497A7540654E821A82FA3DBAFECFA089E73936D QAWSED90
515,150,202 *3491078C5E7F42E108D8D89C0FA927381A121724 RIBANDMAKERS3
515,150,203 *34973379F074D649FA000C11F0A815152D3A89C6 PHYT0PHEN0L0GIC4L
515,150,204 *349E450139E238A512F4514AB9CF03B611AD56BF RICHIE.BUCHANON
515,150,205 *3491A00B413D22B8CDFF8B21CF58C263F8505481 RICH.MICHAUD
515,150,206 *349ECE79DC71558FD1D79D2D39728173C2F12A0F RICKEYKRAYNAK
515,150,207 *349642841C5E579E34724581C757938CA8945354 RICKIALEXANDER
515,150,208 *349E24DFA1E83848717AC4060B247A87063E1376 RIDIN'ONABULLET
515,150,209 *349279DB17043B20485569E516AE44DF62F2F838 Q-----P ~O ~OSPLAT
515,150,210 *349CDD67E0E23ACC80D31A32BE0ADE533B14FB8F platomantra
515,150,211 *3492C350CCE39B06F6668EC378E0575418A7AEA8 [email protected]
515,150,212 *34976CB77A396AD127284C1F1066DE6C1F682DDA RMIGRADE9
515,150,213 *3494198E292B668D759CF7D237B96133BCD6A19C ROBBIE.ARY
515,150,214 *349B085849D547A36EC5B346C2A659E1C93FF4DF R0+*
515,150,215 *3496EFE562BD46930739546E307EB8CF2C1EC8A5 POLLUAIS7
515,150,216 *34926DC1392ED57DB8E1AE9E24AA1A6BFA221DB1 p##).~o.(o_)
515,150,217 *349A62216E9D7C3F3BA78EC15D494AB6C20EB14A POPPABLED
515,150,218 *34975CA2D038A3F0E9048E7D8E706533AB8B72EA rainierdiaz
515,150,219 *34929C938F3973EFCA6DF9EB03290D88033CB373 RALEIGH.BENSER
515,150,220 *34931AFE3F53FD43929E924150DF75E174251BE8 [email protected]~OSplat
515,150,221 *3498E437B57631CDB56970C504F6A221C30F3DD9 [email protected]
515,150,222 *349B8DBFB9056F1EEDF8184F9A3D60E9A827FE3B ROHSTEINMATERIAL
515,150,223 *349F665D5090725397DD6341DA91E81D95C623F6 rolande-anderson
515,150,224 *3497FD84A310910636D3F39EE108B9E014E8CE51 rolfvanlandingham
515,150,225 *3491F2032A833400EE939033ADEDEA2CD041077F ROMANCE OF JAZZ: MOONGLOW
515,150,226 *349AFD01ACC42E3A2152F514FC5A1312682E66F4 RONNY.SPURRIER
515,150,227 *349EF9E645C5DD6CCF93C3147E802AF2EF1A96E1 RONY.AHMED
515,150,228 *349623839979D59E5893C8952DBAA7C72B0262F6 raymonhuitzacua
515,150,229 *349029B14738D0329E36B4E6EDED86B0F4834BB0 RSSLDLVR
515,150,230 *349C24237A73A09EF4B750000E31BDA5608D0FDC RTONANDI)
515,150,231 *3493CD8ED8D42641F734C847E07160B5BC871DF8 RUNNINGNORMANS
515,150,232 *349608C76DF51493159442C215FC7AC70D9D1732 [email protected]
515,150,233 *34922C5C00CDB0BF4C90B0076C2CA2F64293F51D recordss
515,150,234 *3494ECB3D92A696871234C3EE013830730AB75F9 [email protected]
515,150,235 *349862683910D9E4F6943B5A30798E153A09C817 RUTHVAMPIRE5
515,150,236 *349319BF65700143CEB3017ED30D80AF0EB2C1B8 pruteen
515,150,237 *3493E30D6FE935220561FDB1F5754EE353889C80 PTSAINT-RMY-DE-CHAUD
515,150,238 *3496AC9892909F186B3401211046A81049DC2A18 PUBLICITEITSFORMULE
515,150,239 *34941831D73850123884C3ED8BB12643C50DDFB0 SAI.ZAW.MIN.OO
515,150,240 *3499B5E9AE34993B4D1E1357F5D0685B89BA6E74 SAKIZLI
515,150,241 *3490F309243FBFF6FF471DBD18C47D8674548BE1 [email protected]
515,150,242 *34959FD5E5F7CF0B29D61698278578F452C7F1AC SAMUELMEZZINNI
515,150,243 *349C29D7DB1C99BC95BC5722E0EEEF3707CE5EAB samurayx19121989
515,150,244 *34983A5AE26460A0557D0FC67D1ED3B0C37DBAFA QARTADA08
515,150,245 *3498D91A605E7805DE5D8167E164676966A6DDC1 SASKIAIS
515,150,246 *349941A8AADF3CD54C512A533C16DFDEB340BAFB SAUL.ZOLLA
515,150,247 *349DBF381FC9696EED96A2BD559F1F5C87A43EDF SCCR1MCHLL
515,150,248 *349D00A1CC00F351F5E7C76E2ACBB601F6A00804 schwammbegriff
515,150,249 *349E16DBDFD581C913405F2D0BF1CA7B61E1DB37 renevarga
515,150,250 *349D7C6CF70F5D017F1CD9AC6CAB519F69964D5E SCOTTIE.KISTENMACHER
515,150,251 *349D2C131B741360DC34E52318E9F44297744C1C REP.air.are
515,150,252 *349CBCA8CCDEB2CCFFC27BEB1BBACB8BF1B0A6AB SDONIKIAN
515,150,253 *34941D4C4885C5D7699698EAEEBE01664B374F4F RETARDEDMONGOLOIDMORATORYMORONICNEVER4
515,150,254 *349A97D0AFB142226402F15DD0333F0BB01BC865 RETHCELV4
515,150,255 *349CF105CA7506D777AB0F3E6A775014A58D0081 sedemand1
515,150,256 *34957E6ECF278965F4BBC18EF6E1743B091E6942 [email protected]
515,150,257 *34906DFA668EDC82C074C0EAA0FBDC65FAE78FFB QWERTYUIOP768
515,150,258 *349212ADCE3E88D9D4FA105E796F6FD5D1B05ECA RHINEHARDT7
515,150,259 *34908B15CBB82ECB52EC856B0C7EA62F232895A9 [email protected]
515,150,260 *349FC0C9DBA2250EA75E231CEBBF8619AD6C8F8C rickysessions
515,150,261 *349D098BCDE6F0ADBCC274BC62D0D73F4D40D7ED SESSSESS8
515,150,262 *349833DE9D2E46D9945C9BFF12ECF5F91FD5DC52 raketspel2
515,150,263 *34905328C56877E9F9786E53259DAA9EF7E4D88D rinat-shabi
515,150,264 *349AA2DF9858E7E7C5E410B503DD85BE56AEE703 RANDOMLT8
515,150,265 *349FB252E72A67CC16A5AFBFD63614F139A29E47 R KLAVIER OP 27 II SEHR SCHNELL
515,150,266 *349B23FDE5EAFDA60E3E91BF8A1AF1D6332ECE7C SHARKING
515,150,267 *3499A81F7FED6AC6FBF5E27F3559DDEF905235B2 robertobundren
515,150,268 *34908C72955CDD894F7773C3F981C06659BE4E90 ROBIN.DEMERE
515,150,269 *34988A6AE977B27D3A73D3EDF80EC0F2E5C324AA ROBTNAVEED
515,150,270 *349F2DA73DC30F6796F4A93C4304660368E86B4E rodgerdoetsch
515,150,271 *349B4F9B627DB5C4B2FB154DBC899928E1DBF5E0 shexitoni
515,150,272 *3496186C829C56675A1DA7783E97231E72A9A234 recproc47es
515,150,273 *349E70607C4E4165F51BDF798C907838A2DBBFC5 referencjami
515,150,274 *34954B09BD58C1CC38D2FAD3F4764AE33F99863B rollandgilbreath
515,150,275 *3491E9C2617B9A337D9ADFE19CC9DA8DF5A67FD3 sicosises
515,150,276 *3491DEF859954DF5316C315FDDB9EC3D6C42B486 reklametekster
515,150,277 *349A7CA6C967A4953FBD86AB0786F2E428C86918 [email protected]
515,150,278 *3491D37EAA05C332FBB908B1214F430B842E3032 SILICATES3
515,150,279 *349804CF720418CC6CD14D293BA9E5BDE0829E33 ROOSEVELT.BLADE
515,150,280 *349A4A62AFCE98C2E20C81EDFFE3A7BCB88904EB RORY.TAKETA
515,150,281 *349277D8A260DC373D65C45CCCDBB0BB314BB18F rossdeardon
515,150,282 *349E5E505392403C2D32268B0A68B341A524436E ROSS.KASTING
515,150,283 *349F3A1A92AC6C19E09994E71C2486FF10EDCE43 SINGER35
515,150,284 *3492B412CC596D8AD828BB99D2575A20D366C778 SKVETT
515,150,285 *349877F94C043D5EF0910C05E75331004052B27B RSCHOPFT4
515,150,286 *34961AF4A31F5ED82971008E8E1E5845B33FBF53 RUBBERMAID240
515,150,287 *349058B7D3C636E8368AE3B0231CF602CEB903B1 RUEBENBIDDIE
515,150,288 *3493489BC708051D42075BFEC27BA9A30C1F2027 reynaldohain
515,150,289 *3490F9797A09097B884810384B1D2EEA4978A152 REY.WAUGHTEL
515,150,290 *34950CD747DE6012B38106BC8C3C1284D8D4B6C3 S(MANU
515,150,291 *3499BA27BF68327D5FA51391AAE9AC021213DE70 RICHARD-STOCKFORD
515,150,292 *34921166A6A39EDBA0DD4C6D2F0379EBA9599C8B SNICKERSBEAGLE0
515,150,293 *349D665F7B9A7A59960E74A591EF1B65345EE19F RICKENBACKER360
515,150,294 *34910609DE68E6AB9DBF8E13F73DF16AA3BAA539 soffrimmo
515,150,295 *3499202B7FC1F8CB0DC6F99305378AC96A478158 SOLOMON.VOLPICELLI
515,150,296 *349043328AFB077553F49A465F0D552F68168962 SAEVYTTAEMAESTAE6
515,150,297 *349819ABE7EF303576979EBDE56932E7EC720AF5 RIZZUTO-MESSER-WHITE
515,150,298 *349F074B5826314D940FC50337291DBB539B6AB4 SALLIE-NICHOLS
515,150,299 *3497DE2725372CA522E1F78353A509D6246311C6 SAMANTHA.CONTESSA
515,150,300 *349378F5131BD90CCB5D3C0F39E549B93217874D ROCCO.DEVIN
515,150,301 *34901EBF23609C40258DFC2324ACAE97A50C24DA rochellemcguire
515,150,302 *34943D123A6DAAA1264C7B35E548E488BDED4266 southasianmonologues
515,150,303 *3491FFE8629805579EDBF362A5C595C008B64C9C [email protected]
515,150,304 *349D8214AACE44348ED90D444357EF7A454D8390 RODRICK.DAMPIER
515,150,305 *349EAEE2AB3C5D014B751F26AFC3D0B0969E4D5C SPARTANWETSUITS
515,150,306 *34958B30D948EC8528722D5B75184386A43F9A1B SPEAKING.IN.TONGUES.I
515,150,307 *349C7316250E4FB4D3BD6A1B24C6C3BF46EAE568 specialties8
515,150,308 *3491787F8E9EE95C4296252873C7FD4CB1AD3689 SPLAT.~`.(-----B
515,150,309 *34902B3358E85C41147ABF6BF6F233CA72BE3392 SAVANNAH-PITTMAN
515,150,310 *3495B315D6DEBA80221BBC379E546CD99D838ED1 SPRACHFHRERS1
515,150,311 *3491B3D50E5B22583FB30E0A2BCE0653FF90B9EC rosariocragun
515,150,312 *3498D178FE81DA7F1B1A1850987C3045CEF9BC6E [email protected]
515,150,313 *34905972E19F7A5A25EDEA28946DB2611FF5282A src="///ecximagesamazoncom/images/I/116SFAHTAMLjpg
515,150,314 *34938C975F0EE88589A8E15E86A8EE20FF21C122 rossrichardson
515,150,315 *349F79B0B45285D0C12713ADECD79CA9B4244788 SSINGARNA8
515,150,316 *349A30D5F7977241C8C253AF6A579F802FD7C016 SSNGNCFFS
515,150,317 *349019879D22CB2C949D8EE4F615D4D2BFF19714 SCHNELLFAHRENDER-PKW
515,150,318 *349BABEDA0B4DD1035ECDF10DE152129F7E0DFBA STACYDIRTH
515,150,319 *349A47410822A15629B3B4D96E87D988360C8A74 STACYHOAGUE
515,150,320 *34981E605C5224D7D5750DEC4A7C3A12E0C7FA82 stacykaua
515,150,321 *3498AA69FAF2243B211B6589A5E1AD894D14294D stacylovet
515,150,322 *34949478DB91EE98E553E38C874B0058B713481C RSPRV
515,150,323 *349D5B703AC2FCF4365C8EA8A1587663E5B34181 STAMMTISCHEN5
515,150,324 *34949062F3204FFD0F8E04D9353FD1B31AFEF7A7 RUBENCESPEDES
515,150,325 *349AD8849F8086837FC908DB209E891629303622 RUELUOME3
515,150,326 *349B4C240182332FF0BF87748F68A696EC43CC33 RUPERT.TERHAR
515,150,327 *3495724C9D6B577D749FFE39E24D021714AE2D1F [email protected]
515,150,328 *349458FCB8010933420A69446B0A0C2B20B7E1E5 seanstallard
515,150,329 *3490C381D603AB31A92435037B0557910C39BE06 searcher.mkii
515,150,330 *3494F5E9E8A89D2F9BCE90468EBE0334B2CB8922 RVLATIONS8
515,150,331 *349562362D6223BF9F906E95819747698D69224B sehcsolf
515,150,332 *349EDB7193220BFCDA93AD36F46C499B63295B85 S3SQUIP3DALIANISM
515,150,333 *3490EA201373572F6BDD3EAFA4124FB7763AAD03 semicolon4
515,150,334 *3498745EBC3C096E296C23B171481804260AC191 STEVEN.SPRAGLEY
515,150,335 *349D493FF68F9CF0CAB79FA0875E5B8CB46287B9 SERPENTINASTE
515,150,336 *349EB653252EE4494684E64BE08461D0683DD666 SALSEEFELD
515,150,337 *3498C1E1665D850EACF16AA7BE4622D3869949BF SALVADOR-ARRIAGA
515,150,338 *3496C8CB32B9F5AE3A682839556E1213473C65C7 stores-barracks-distilling
515,150,339 *349049E612D33F67734090E817C72DE1D5B80038 setaedi7
515,150,340 *3493DAD204E31FE2FC3979E219A4490FE794FD0C SEURUEESSAS9
515,150,341 *3494675E9956032DEF3F6E5E9544630DF2B69D35 stuartroutledge
515,150,342 *34928D243F25C7C7C818585C989154D8D35552BC SEYMOURFOREMAN
515,150,343 *349B78F9B3853531DD57560704A7384DEA09856D STYXXYTSES
515,150,344 *3498333CF7A0FC81E93646B984AD7098B45A08F6 shawnmotes
515,150,345 *34924B6C98F6C8E1861CA64F8A24A6E31C865879 SHERMANNAGLE
515,150,346 *34937C1D6770CB30774BCA8A1A22B3282774DEB8 santofergoson
515,150,347 *349337E4C60A77CF5BB061EA938E496044DFE0C5 SAROCHIN.THAILAND
515,150,348 *3495884A4CA7DEE0926B153759B58F60DB9AB821 SUPERFERRE
515,150,349 *349B1933EFCCD187D45079D19C9E5C44E27A666E SAUDADE DO CORD
515,150,350 *349587E2D66105DF66ECE24159C34BB2B6E595E0 SCHERFSCHERF7
515,150,351 *3492450A954A6F0984E3197D0408A3E926493F02 SCHEVENIGNEN10
515,150,352 *3494EF091E11F4190A099400751462ED21227371 SCHMIDTCHEN.SCHLEICHER..ICH.M
515,150,353 *349D11030B0D610CA4F8CAED38D73C9ECAEE9F86 SWANGPAIRODKIT
515,150,354 *3499CC07E76380CA0F1239469F852E893D2CAAA7 SWEETHEART2007
515,150,355 *349CB3A9261362628BDC4D3CD841C7CAF6196466 SIDENHÄGER
515,150,356 *349E32731F45E0E1C968DE4C69724A74290EBD30 SCRIMSHANDY5
515,150,357 *3490021FAAAA148E50A5B22AE72FD3BDA847E9F2 tactron.elektronik.gmbh.|.federal.republic.of.germany
515,150,358 *3498286167BC9F27B5FCDA4876196B26EBC2B591 simonmullenaux
515,150,359 *3492D0ABDC19C1BF43E0BE7556D78786640AE069 SIMPLYCHRISTMASIV:CLASSICALCHRISTMAS
515,150,360 *349F3AA315D72E9B670AB2E1B13834E40FF745CC SINGERMISHKA5
515,150,361 *349563902227A747D09FB96F2C0E7E611E07E5F0 SITIÁ
515,150,362 *34963170E309F060C046BABB46F5629004426291 SERVOO
515,150,363 *349BD776F80E3EC4C6A12D8C746086436FAC67BB SKETCH.FOR.ORCHESTRA.#4
515,150,364 *34989A55A5F975D9B1868881E384D32A104D4F8B SKORNISKI
515,150,365 *34902ECFC49257FCEC72F738B86BFB865940C665 [email protected]
515,150,366 *349EE19B13A467643F8889FE23EC17A596C3359D S:L8
515,150,367 *34987016CEF2D2DF8170E05C3B8C2DDD28C8B69D slektsforskingsprogram
515,150,368 *349ACEDF4A576F26F49A7A71B29CDF3FB856E43F SLYNGBOLD9
515,150,369 *349FBCF99BE31925A4A403B6C34694F24703E350 [email protected]
515,150,370 *3494F423DE103E627281195289A926A6432A6680 SHARLTONYA
515,150,371 *3496485FA86BB34E75F0720550FCF407FB32844E snetpmalkeg
515,150,372 *349410B15E9377D7D0F1FD1B60E842DA9FA1A226 snoreble
515,150,373 *3496EFEF2F662F512C81BD6356C81C52C74DBAA3 soderut3
515,150,374 *349A0427AF60D593CCC09E3E7126C2A5E6352EAE terranceskattebo
515,150,375 *349377A94936E133DB951BC9F15FED06FA352BB4 SOL.RAND
515,150,376 *349D9EE3757C9DC6FFF1718349BC495122C293FD TERRYREALS
515,150,377 *349EA954BCC4A308921CE6773D0DF3E0D880BA06 SONATAINCMAJOR:ALLEGRO[ED.HENLE,POSSIBLESPURIOUS]
515,150,378 *349B5A1D7705611AA9F6C4124FF65ABF436D7FF2 TEUMENGGUNG
515,150,379 *349A05A19049228CDC6155A2F4BBAB872B9152F8 sickests8
515,150,380 *349BDA6FC782E37A2E3FD4F8669DDF85B0322C02 sookjins
515,150,381 *349642C899B0F7D2F13064ED65469B971E7A3446 SIMONECICCONI
515,150,382 *3498F1FB78A894A9BF6A8DFAF3760B880B9AAFF7 SPLAT O~<Q
515,150,383 *3493EF0372775E8C6E4EDD016A88EA102C988DDE sports-people-cosell-benches-himself
515,150,384 *349AC5C95530ACE6A185ACA8B2A165782D2239EC SLIMFORCHUB
515,150,385 *3494E9450EF006CE67186604EEACC7C54E346250 SLRM8078
515,150,386 *34902C17576082BB686875FD54DEF722134939D3 THELATELATEMOVIES,PARTII
515,150,387 *349C2C2F81E63CCF00F26A8DC13BD040A4B003A3 SSTATUSEMPIRE
515,150,388 *349F1D2C8A829E8F2397A0FB5A898A3F1B669A68 STEMSPLEET9
515,150,389 *349CCE9D4FD8AF1F479C8217C0280347F7058811 snobographies
515,150,390 *349A8FE045548BF238A8401FE42926925D565AC5 THICHE
515,150,391 *349E7C3862711CFFA78F80BA1D0A230568DEE691 sonatano7,op64,'whitemass'(1911-12)
515,150,392 *3495B4232855B4EEC42D8F4DF43D48D2B1A49FB2 sopalco3
515,150,393 *349143C26FADE98B1ACDD14792A6EECDE4EF572B SUEMCCUTCHEN
515,150,394 *349B51DFA3531199C9611B90F27653EAAF4F82FA SOUNDBOOTHED
515,150,395 *349D7DC1872B7B7594BD5B432D5BA6BD0324A9CD SOUNDMINDEDNESSES3
515,150,396 *349719178D8BA3EC1A91FE66F88B6A3DB5AD6B3A sukarnoloyalist
515,150,397 *349690091A8756D70242BF0BED21BCFC1FA07649 TIM.BRANDIS
515,150,398 *3495F593E77DA0976D6700A13A7D9C881F9FA05D SULFURIZEDT5
515,150,399 *349EE08277D8E234B1BE57258190F879072B2773 SPAINBOOMERING
515,150,400 *3491ECCB08AAD3B4434EDD3899F874B30403667F sungmanetta
515,150,401 *349705FD4DFC8831791E2B483AA76741943B5448 SUNIL RAICHURKAR
515,150,402 *349AEAEFA0A9309CEFCA79E7D175743BB7715547 TINAAS
515,150,403 *3496A9F3C4111B34FA993FF8EEDDD87DD75DCFCF TITUSLIMKE
515,150,404 *34904C7C8ACE09EA9C3627055F88FA73DC8DFDA1 SURFFEVER!
515,150,405 *3499F0D9ABFDCD7773E63327442899CCEE59685E sweetsmelling
515,150,406 *3490E9A876D8D8F74FED2ADE327C80E4671951A9 tool-room
515,150,407 *34983AC09D21ADFD82B6D549C1962D396C91458A srevirdn
515,150,408 *349658F23E0AA2445BCC65B89E7954672B323E3F ssenneka
515,150,409 *3499C16AF5CD85D10AACCA5AA77EA3C05E01F43B tackle58
515,150,410 *349C5204E438F48EA48BFD308B36A5CF28CAA4AA tal.kishon
515,150,411 *349505D2D1AC52CF2D3D71F6DE0C5E912514D5EF TRAVISREIHN
515,150,412 *349BFB2ECD8E3F7B9385451BD397EB15D3F91353 traviswaitman
515,150,413 *34976629A526BD066C08B581197A3C557F36C6E3 TREPIDAE4
515,150,414 *3491F769449A2F966C5AF569C9867FA9364473E7 TROCHETBSW0
515,150,415 *34974E58FD25631A626CFFF5C480353988D8170E tathess
515,150,416 *349CCA4B1553A8ECEA22161725F9189762DCAC31 TSJILMAAED
515,150,417 *349C0D81D8915FC97F75F091281C861478092BF0 teamobaby123
515,150,418 *349644DF409FC2299759869E6406210C3308BE7A tteykcj5
515,150,419 *3495C6A50D752CD5145EBBBDD0FA4304769502DE tuneisaandrews
515,150,420 *34940323667D46B45ADBE07C41C41B33A1967E57 TUOTESOT
515,150,421 *3492396825514FE2B1C2ECFB7FFEAE154D5E2301 TEMPLATEVFD-SHAYNA
515,150,422 *349D063DFF2C865299CAA00C16F8FDD9986975AE subcontrabassaxofoon
515,150,423 *349CC34FCE1EFCD78BDF9826BB1C78770E34C2C1 tenpiecesforwindquintet:viii.allegrocondelicatezza
515,150,424 *349C74A025A1F33941831F0CCFC0A20118D4E970 tvnews
515,150,425 *3490421CD0194A81CE4B7C97539DAEBE5B739D29 sumariar
515,150,426 *349934304227AB78B0A47889F031407952487221 SUNBIRDEXCALIBU8
515,150,427 *34932019DB5E092CF69B447C1B0A7666984473E5 tylerjablonsky
515,150,428 *349F887156DFD03B33B408261FFD3FB31AD49077 THARREIN5
515,150,429 *349B88B876D698E5844ADE75CEDC8B810B9C25D5 U19731112
515,150,430 *3491C4948BBE21275DFDCD185722FED02B1CA5D7 [email protected]
515,150,431 *3495958D856063E1EDD9CC28B9FFDC82CFA0B27E THE COMPLETE COLPIX SESSIONS
515,150,432 *349AC3D059FA3B2ADC329D5EE9E7F83688B09A3F SYDNEY.MOEN
515,150,433 *3491771425D8FCE2690BB0A3B76A1F110B2BA872 UJWALAAMRESH
515,150,434 *3496D8220DA5FC3694A666266A0ECDE0994F0F1E UNA.CANTAORA
515,150,435 *34955D9E3A9A88855E440AD9304793CA145FEF07 THEMMMMMM12345
515,150,436 *3497BA791F99D7BF4A1E54CBBAA38ECF2F600DBB THREEMILESTONE
515,150,437 *349C8115D9382653F5111C727A18DEA5142F65B0 [email protected]
515,150,438 *349008BA9B2945BAF1EBE47EB85FEA953A052700 ticket-scalpersales-talk
515,150,439 *3491DBB87F759D6BDFEEB7E2D01AC1651AF9F3D6 TIFERNATES
515,150,440 *3491F1C214DEA657231755B702C42AC0035517CC TAROLEE3
515,150,441 *3496B1C2A5E8DE7E7488DAFE633E3708AEAC8C0A URBTFUL6
515,150,442 *349F80A9C3A9894B4C79ADB261CFC7D504EAD3AF URSULA.LUCREZIA
515,150,443 *349CB9B35C5332C35978EB1AF8C9EFA671E3E5E1 uskbaa
515,150,444 *349237450FC9CD47DC2CE80D870408BB67E124C4 UTEND
515,150,445 *349C658E2EA4C62924EEF617ED3A620B2105CBD4 tmz\
515,150,446 *3490D66FDACEA2A26571B8CB59A70AC35B3B8262 TOMAS.ULIBARRI
515,150,447 *349B55D4F3E4897CCB3B72B27E493DD518A18A6E VANDERVEN
515,150,448 *3490C5BF8CF7B66793F5544552E53AE0E50F08B1 vanessa-longasa-mangaya
515,150,449 *349DBDB12CEAEEE0C7C4F5B7E211C10F261ABF55 TGOVMHT4
515,150,450 *34954BDE9D04E74C0F6D85396ED5C4C51B4C3DB7 thatgreed8
515,150,451 *349CC7DF00D84AA09313BA3641A62448E9217C51 TRADEANDCOMMERCE(1)
515,150,452 *3495F5685851D21731F14099DC24C72688403CEB VBULKSAS
515,150,453 *349D29AA89A10E1EAB1B6CB5E6A222B0C8026F15 VDOMINGEUZ
515,150,454 *349E9140F5BDAF1EFC685AFCEEC7303D990E6899 trclntled
515,150,455 *3492204E1F17C71320FAFF3436608F7103967774 VELKORNILOV
515,150,456 *349409AFA31399C138D8ADC2F41E942AD7C4CBC1 TREPPIO
515,150,457 *3490A20E1DFF92D0058512CDCCF68E4548C951F6 tropska7
515,150,458 *349A082633AFA648FBA0408D8D144983C8939E04 victoria.carangi
515,150,459 *349DFDA20AD4C7B455C73AF0907D6A3120F1EAA9 TUMAMOC0
515,150,460 *3498832086E9E9B51A54D9FC9D93D28658CD8B52 THESUPERMAN(SOUNDSOFTHESEVENTIES,04.10.71)
515,150,461 *3490E343480A50538287A976F0DFD12168777746 t-yg
515,150,462 *34990F6E25D0462D28F7C4FD4A38BB5FF03E89A3 TYSONPLASTOW
515,150,463 *3496C8365126391DD173CC75CD17A0B05CA4232A THOMAS.RIEBEN
515,150,464 *349685430338371C1CB2B3D109306ECDFDDC685B [email protected]
515,150,465 *349896F84ACF5A56A34B8D3D8744EEBAE2AA4A24 VITICO-SANTANA
515,150,466 *349F20FDF5998985818989F503EC26D0D84DF0C6 VIVIANE GARBELINI GREIG
515,150,467 *34989FB46BBD61A7A969E1442F2FB0E0C6181907 UHTADNEK8
515,150,468 *3491F8152217DACF0D39FDA6D60C688C2BB346E9 TIMOTHY.KUHTZ
515,150,469 *349F68CB70738840FB19BE6F5F318AC869A25796 vonknepshield
515,150,470 *34938099D6997D3DFE90C6960A4B886A06661A8B VONMOUNKES
515,150,471 *34930058F11229461B96ED2CC5053FD2FAD8764C ULYSSES.ZAMPIERI
515,150,472 *349FF6A9804AF3EF68F556ED56D26AA7D75BBFFE VORWÄRTSSCHUSS
515,150,473 *3498221B938277E4F52B3CFC765CE45102242899 UN5CR4MBLN9
515,150,474 *3498D8B7F4887DDE6FDE398547229AB18CFC4F36 uncrimping
515,150,475 *349444305E566B7C8484A76585D3166D01D53BDD UNDWELLABLE8
515,150,476 *349F864D4E18E86D47DCF87E7BF287145C73AEA7 UNMASKED--THE-IDENTITY-OF-SHAKESPEARES-DARK-LADY
515,150,477 *34904A24B03074EC404738C749F58D3F20D4A35D unsquashed5
515,150,478 *34996E38F11BC4D2ADDC307E0ABD8AB2DB0BB3F4 WALEY.LIN
515,150,479 *3499C164B7A9E17496A9A1C78737D0DE9D203330 UPSNEAK3
515,150,480 *349D3D2D9E2721D60AD9AB8BB0043FB3AA9CE528 tom.dornford-may
515,150,481 *34948744524FD28F47AF95E3C972E3EC8DAAE0E9 WALLYGAMBITED
515,150,482 *3498661A3D5B60CCDDB5932DBDCBB330CAAF7A3D TOMIMLAY
515,150,483 *34986ACFDE3547B3C5BAAA972ABCE60A0B56BC6B TOMMIEIRICK
515,150,484 *349DA16146874452995688F382686809F0E77B97 /USR/SHARE/PYSHARED/GTK-20/GIO
515,150,485 *34952318F26D52E55E9AE5C008A464578603F2AF /USR/SRC/LINUXHEADERS263224SERVER/INCLUDE/LINUX/DELAYH
515,150,486 *349561CF91102A2DAFB76EB346D1AC7661663714 WANDALIZ-PEREZ-RIVERA
515,150,487 *349BF7B51927844B7416A634A8968A05A1ABCD32 UTEND
515,150,488 *349C436F215402A1B848E4212E271A7BADAFD2A0 [email protected]
515,150,489 *34910B496A001F6B9B97400E48A31E5F18317937 warrenmcvittie
515,150,490 *349232335B240C39B32222A56D80E2F745D02803 WELCOMEMONGAMELI
515,150,491 *3491D37269A03BF7897649DEA14D827D5CC777C6 WENA Z LACAP
515,150,492 *349B608D5C7C14F6463AAA56BE008E5C998B7050 uy!*
515,150,493 *3498817D5A2780A8FFC6A52DD0887E53AFD09C54 [email protected]:ACCORD
515,150,494 *3491DEFF03A9CCBACC74F9BA63145D09EF74EB35 vacavere2
515,150,495 *349B686B51029CFA677E48C8501F4430EDAB9395 VALARIE.LURIE
515,150,496 *3492322E59F1A104A16319AC2303009471F03AB2 VALITSIJAMIEST5
515,150,497 *34930D6714CF5EE6015E1AEA130CCFCD54C6BE3D trimaient
515,150,498 *3499B8E455E5C49BC4A65BB9A59468F84B009FC4 whammer slammer (edit)
515,150,499 *349F83A70357DF2E49FB40A418F4786066AB719C WHITNEYSTEIK
515,150,500 *3499E808FD96D17CCEB39133771C4D27CE6FD163 VARNAVIDES123
515,150,501 *349373C4B3CBDACD4D5E78BB121D3BFCD3204765 Verbal.Offers.&.Letters.of.Intent
515,150,502 *349CF38D24FE60CC0CB1AEA6CE788996E0F25AD8 VERKLAPPERS7
515,150,503 *34998BE1F95E8EFE5F90DB4FC378387C6A767713 WILLIAN.UHRMACHER
515,150,504 *349E45440601473AA34F5EF6D173D6B51725566A WILLIEINGLES
515,150,505 *3490D72185C6B24526FC20493D8071C1A5815D73 tseng-chien
515,150,506 *349A9460268C27C4F04BF77BE9106558EC6E231B [email protected]
515,150,507 *349594E64FC438FBB20224D9C2FA564875698D86 WILSON.CORZA
515,150,508 *34993B930FFA2B0B27922561D41465026B4BB215 windwardside
515,150,509 *349A28CFD80C7787A2892CDDEC6D74999AED9F2B wlv07
515,150,510 *349808D226730D5DDC9E5370C0621D4A6ABF5166 [email protected]
515,150,511 *3491113B0F3EC6E9C2B49B1A6626EB1CD720134D tyrontinnea
515,150,512 *3498ACBCDDDC8E045F787B7E61E914FA2D44F57E WONK0000
515,150,513 *3490F937BD78F8BCFBB285C6798C5FA1744C85D1 VIESTISI3
515,150,514 *3490AC0614B1AD80AB6C2745EA1D0247879F5B1B VINBLANC5
515,150,515 *349958780E1AD2260CA4CFEA6BEE2D5BAF0BCD4E wT"
515,150,516 *3494091B537C8BB0E18021F831DFCB4EF02DFE8B [email protected]
515,150,517 *349437BB43B7D1B32C0AF12F2D3FBD6A8F02E712 [email protected]
515,150,518 *349CB5605FD91F712F27712BC797FD8E37A91B84 WWW1ND3P3ND3NTC0UK
515,150,519 *3495CDBEB75DFAF1D2DFAACFAB271372A4CE0FE2 ULTIMITY0
515,150,520 *3499557C1110AA8724B1AFCA26C49DE2F19106FD WWWBOLE2HARLEMCOM
515,150,521 *349868BC8184A7A93EC7950AFA055F79982AB13F WWWEARTHDROPSCOM
515,150,522 *34903D36822F88120C58709DED52107DEA191421 umukoro.denise
515,150,523 *349A2ED01FCBAB243EB64AEAB4589F65E21A52A3 WWW.FREERAINBOWTABLES.COM
515,150,524 *349202EB1DD300D14DE3E8151E8FFB861ABB13FD [email protected]
515,150,525 *3490F07BF89E26AA43A3B839DB01CDDCEE586EC8 VITRIOLICASTROLOGER
515,150,526 *34902EFA67B07CF0236FD04E2AB39742E64F1753 [email protected]
515,150,527 *349ED74AD0166CAE6AF7818060C3DFEB828DD475 volcanoepena
515,150,528 *349075246AAA56C2503FDE758684D7BCA9058327 VOWELLIESED
515,150,529 *349394C40851822378EC40D341AA2297FE22B2B4 XBYSCTDXEZB
515,150,530 *3496A9A8821201C5958CCBFD61BBEE6700BF40E6 UP1^
515,150,531 *34922756BE026F7D355C1068F29412336EFC014D xhawowoo.hudaz
515,150,532 *349CDC17D902E4377D76378ADADDDFFCB3C84F7E UPSNATCHSTEALSUGGESTTAKETAKE5
515,150,533 *349F88CBAE60DCE91304C04269E1D12AB62553F0 W26230486
515,150,534 *34971A8A30D97B8910CC061F32AF2EAC135AB0AC URITURES1
515,150,535 *3495B0C4F021F5057A73CCE775B6380430C841A9 USETILE6
515,150,536 *349CC0DD6BD3DDB9E47B6720D4BE63E1B1E0CBA9 (x) o~ <##3
515,150,537 *34919E48F974F0672A9591BB0983EE5BAB755F5C v5me
515,150,538 *349A43091C249E9115BF950FCE1CC7AA98BDE808 WANNABE
515,150,539 *349C0F6235B6C76BDC23B0654727458CEBADEA19 [email protected]
515,150,540 *3492BE9CD851562698844371A17EC9B384D1F6F5 [email protected]
515,150,541 *349B051C04D62786CA615D147CA6E14D6E173494 WASHDEVED
515,150,542 *349BAF7A871030E893E1B35C71BD333C996620A0 Y+"-
515,150,543 *34965A78497E77028D952FDD1EC797752545CED1 WATAQT
515,150,544 *34930BA6824B30664913495869CE6E24C2A36980 yaliyoanguka
515,150,545 *349650C71DFBDEDA7BF6EE167F947C2DE818AE63 yancy-padrew
515,150,546 *3496650CAC09637A7A0F5AAF83FAB4BBE0F3AB22 WDXDZNRHZX
515,150,547 *3492FDC168A8462D59C699AD1747335ED225F892 yan-haikal
515,150,548 *3490D52126717384091D4D4EF734B5CDE00D7CF6 [email protected]
515,150,549 *3491A9D4155BDC412430E71A86A978870C4BA352 VANESSA SNELLING
515,150,550 *349D9D4B3557DDA63EEA89DB00AC99D45CABFCDE [email protected]
515,150,551 *34960E9B8CF9E26695770FED2403DC50577C6F6A [email protected]
515,150,552 *349CF7B31145C985745979D25CC466A994DDEFFB [email protected]
515,150,553 *3492D1E8B13D046177439BFB792260EA10A4E1F3 [email protected]
515,150,554 *34989309AB4BB34F2CCF8B79411F64C479AB8D34 YFPDFYYFZ
515,150,555 *3490B42BAF61EAE0AB831E915548F5B07B393E3A VELIMOVA
515,150,556 *349D3CB27FE9EFE29603947E5BA7D5EFEC04925E VEPSIC
515,150,557 *349F44C8AB1F15EC58D75F97C112375076D90D32 VERLOTU6
515,150,558 *34908572A273B547359F3DF89492ECDA23D60B52 WHORTLEBERRIES
515,150,559 *349156F5A1BA0546A7B77FFADBD39CD903F242CD you're-driving-you-out-of-my-mind
515,150,560 *349135D42289A9B7A895962A91CCFE4F6D50338F WILBURKUPERSMITH
515,150,561 *349F3DD6C2CE5E3FBF0A0186BE8D3FC6466D91CC WILBURWED
515,150,562 *349211D18BE9E1E0090FF6CF4AFF421F3E57578F VESSARES1
515,150,563 *349277A571B684497B9C93F241C8DA339F1CB645 VHENEZATERADARAMOS
515,150,564 *349481BE4CDA8CE2C7AE45B6EE66764073904D9E WILLIAN.BUCKBEE
515,150,565 *3497BBFE3A247D89627057D3D49E4ADD2200EF44 VICTORIA-VICKONIK
515,150,566 *349F42BFC39400D160038603ADDA332C5967590E yvettejoyaldemita
515,150,567 *3498B54701A06A342C9F9731A7D7703D5ADB35EC WIMPY LAWANDY
515,150,568 *349B5027C5EF44B4CD21CF7C5EFD88BDDBC3B51D winfredbenard
515,150,569 *349CCDAF20F1C2EF1EAD68F13A23FA12D0FCAF43 vili-cocker
515,150,570 *3493A2E42D579C81A5FD259D4B18DB038E5B6911 VINCENTRAJU
515,150,571 *349E169DE9A5BAE61A565E235BBC6935B01EC1D7 zabri.zabour
515,150,572 *349A09744F4B6E5415BC179F28CA258AE8F2FF1A visitfr01
515,150,573 *3497B52A6826FB182061C742CA86B95BDD1E672B ZAMKNIECIEM0
515,150,574 *34946A6914AA7E26B0B3BF0EFC3EFED4E1B58EF3 wucechao
515,150,575 *34910B38234D5F0CFC026ADB35F6394DF4998DAC vpkm
515,150,576 *3496A654C4299BCF275A6BC3770A4502FC401B60 zeidmans1
515,150,577 *349AF38A9E872B199A0E2D23833CFEE1D177E5A8 vuyo.ndah
515,150,578 *3490030CC7B547FFBAB031729704A029F0868585 VYVYHENG
515,150,579 *349B1735DA9C9CDF6224A5A0E1E0B7624CDE1349 VZPW
515,150,580 *349BF1688C01B04245E2EB8ECF2DAF83E97E240F WAFA RAHEEL
515,150,581 *349AE3D4EB13893C989A45D56CDC820DA6E4E123 WAHRSCHEINLICHKEITSANNAHME
515,150,582 *34943DAEFF165C27F2308F3C681AB085D404A200 waldoreininger
515,150,583 *349119E0BD2A98DD1580020BAD2F74DBE9DFF8A4 WXRESEARCH.COMWWW
515,150,584 *349D987E431FE333FE6A08AB19AFB64BDDCDA7B8 WYDOBYLI0
515,150,585 *349941673A88C72B608E68F6643A075582208087 [email protected]
515,150,586 *3492D07E77BF2D25F35DE0AB07E98E907E717C67 [email protected]
515,150,587 *349C4A366D3D43AD386E44B4E931FC87C68BD2DF ZHERABIESANTIAGO
515,150,588 *3490559607EB1FACED02CEF3AF0448102E3133E6 zhierniejumaquiobalajadia
515,150,589 *349C8EA504170B3BF1D47A3731F7B9B761965762 ZHLELCAIMCOSDS
515,150,590 *349C0B3883F5E5C00B18A1FA535405E13362596E wardmohammed
515,150,591 *349020C4A68305947F5F53ECBFFC6A9CEBDE6238 WAYAN RIKA
515,150,592 *34910521567D5A70D39C5E31D5D2FAC171AEEEC3 ZIAH.DOLPHINE
515,150,593 *349DD9A4007D173899FEE795365DC0E03281982F [email protected]
515,150,594 *3493DC356C13813DBAA04FE262D22D6C6B780AAE znn`
515,150,595 *349891646B4448EF68C769958258E65CDAB146FF [email protected]
515,150,596 *349F718B8AEDAF14A2808F4B334653934EA610D1 XMLEVENTSpfxaction
515,150,597 *349A67E47D973F08E9DE36D4F1D9B473DE9FB531 [email protected]
515,150,598 *34976DBB0A819CBC0A94CCCCE97BCA201AE5E8CA (x)[email protected]
515,150,599 *349BDF6832ACA1E896075A817DDF0C288AE9643E wegnamen9
515,150,600 *349601C8AEB8C86F4B79F7BD93995000A4873412 ZTAMOXIFEN
515,150,601 *349F9B2A0F3AF1CDBAFEBE3A4FF0D5848689881D zvidavies
515,150,602 *3495480092B50954A4C9C3145058B19D59CFAD27 [email protected]
515,150,603 *349581274037B6B3EBBFE8F3A7E63AC1944A10DB y0~f
515,150,604 *3494571CF300D1C237AF4E4E24B77DC4A464F262 [email protected]
515,150,605 *3493B9398F179967174C705A34974D65A84E88D9 YAMUNAKESAVALU
515,150,606 *3490BE5E50892F9BABEE5A0ED3A08F7AADFEA479 [email protected]
515,150,607 *349C10794E1EE7AF59BFD8AC3FA87BDEDF61EF2A ευκοιλιότησ
515,150,608 *3492C468DCF9CEA3B6DD2C75920D5C6BD23DB344 [email protected]
515,150,609 *3494CE4391933C031E1E0DE706222364E489D812 πιλαβάς
515,150,610 *34915EF4D618B54D3DF5DC02AFD7769B33B5E0F0 БАСТЫНСКАГА
515,150,611 *349A2A7AC164BF3BCC4CDDD8FB0A90864256955B ГИНУЋЕ
515,150,612 *3495308B51BF386B1385E6DAC1D9EBDEBA6108A1 WIDDERDEUFFER
515,150,613 *349F0D07D9B000A83C413668BBFCE6ACAD79938A WIJKWASTEN?
515,150,614 *3494AD3DFB21A637AB39189510655C0792B1742E wilbersciabica
515,150,615 *34939A6A0871FF782E0CF027A708EBA224AE2BA2 WILBURNGLAY
515,150,616 *349C9C4D0DB1B4DB952DB5EC5CAA04E56229E24A wilhon
515,150,617 *34963BAC0BF8EB689E41EF43123288D6570133D8 КОКОРОВО
515,150,618 *349089785D7E4A4E7327017C0F9EE518B493E45D КОЛЫШЛЕЙСКАЯ
515,150,619 *349AE9E825EE182BACFE7A26FEB1CA7603F194CC yoshinochostationplatform
515,150,620 *3499FDBBEE8923BF38AF05DE73FC46594BADAA96 МЕМБРАННИТЕ
515,150,621 *349B008C555D8BC097E096D4A4900046180FDB41 yq~r
515,150,622 *3495E74B3B260047792AD965BD735E32CE7C8960 winfordsimcheck
515,150,623 *34953F3F21AB18096B2DC37E66D56E3CAF7E9C9F ОБКОЛОТЫЕ
515,150,624 *34953749153510AB583855577C55CC79C0BE3DED [email protected]
515,150,625 *3495329C925E5B791219790F72DDBEF71C80C8C0 wn1687782183
515,150,626 *34981987C4E196332E83131F412F52224A147E7F прымус
515,150,627 *349320E13E891E4091A1296C6C808F761116599F YVONNE-MUSKEE
515,150,628 *3496FA2A1E981A2435360CE32FF01DDD3BC3F08C [email protected]
515,150,629 *349229D71FEE59B79F8F7B00EE19025F54F1EA56 z0baa
515,150,630 *3495DC77BA71610EA575C3C545B179DCF5116C13 СEРУЮ
515,150,631 *34967DADDC06E441D40CEBD670C4529B669E6AEE zacharytrentham
515,150,632 *34971F014E61B457F49F3D0FBACD393C8C953B2F ZANADRAGOSTEI
515,150,633 *349DF326E135131F39B4CDC4E126241C77768BF7 шроцберг
515,150,634 *34945A718E96FCAEC51F7344198ACEB2BD951316 WWWEDGEBLOGNET
515,150,635 *349E68C117F136A328E6DD6D8E90BB6A726E0E2E ZELLINGER123
515,150,636 *3491BE4AF63DD2039BE75CD76D83CC83DC93382B [email protected]
515,150,637 *349D39B214C9C6E029C7B6B7D023467702320032 [email protected]
515,150,638 *349AA587B1FAFE41D6D96271740E7F51F15EF214 [email protected]
515,150,639 *349D7506254F2B288E1E08A9B48CE77A0C8C06BA [email protected]
515,150,640 *349DB0A379E8D886DCA144FC204C854320C6779A zi-za-azwardi
515,150,641 *349DF566EAA4C117E0EC17D460A1A4A2F60DBD22 [email protected]
515,150,642 *3497D04724D35320F53251B1BFCAB691854644D4 }X{.O~O~D====P
515,150,643 *3499620A4677C5B639A852AEAAC1D4E29258D12E YALAMANCHAL
515,150,644 *3497F51D488E77A07B8A393E9E6882F66CBF4A97 [email protected]
515,150,645 *349E292A0DB59888CD3706E4DF05BB29E2B90605 [email protected]
515,150,646 *349AA2E460C02C19A117B459A967C58726CB3D0F λαφάης
515,150,647 *3497D2117487995941AD1853BEE375BBC1986BBE ΣΙΓΟΚΛΑΊΩ
515,150,648 *34994B745DE0F82EE2407EF9F20496977093E0FF YASEYAT
515,150,649 *3498BCD6A1EEE5B9861C179C4B25AA7768D32336 БЕНФОРДА
515,150,650 *34932090AAAD378C185A096A6B64741A7FB43943 YAYALAS
515,150,651 *3496BC3E04578E4F130F2AF437EA67DA95B5F1B5 [email protected]+ED
515,150,652 *349B24930DA165D48C508B73BC0E7FDBEFAE4065 [email protected]
515,150,653 *3498B4CD472F373326A3071C6409A83C436B5A1E [email protected]
515,150,654 *349ABD48E7E5C14FE658E0D0730F57D84186829C YESU69
515,150,655 *3498C4BA1665AAF15ED1BCC70A1E20110F9BD806 YOLLY DURANTE
515,150,656 *349FC6BC8C4CF3C1C48BA46E090553A1FDE5E589 you.didn't.get.it
515,150,657 *349483FB0747EBAD20AB36A9664A6896E624E183 діяльнісь
515,150,658 *349484B131C65AB3EC6280AED1C1523AE7632355 yxqb
515,150,659 *3499C5984CDAED50882AE91EC4BC9B22DAA0D9E5 ТЕВРЮГЕ
515,150,660 *3497D2BD8C634631C52F010894ED8758F8C00CC5 ZANIRUL.AZRIA.BINTI.ZULKIFLI
515,150,661 *349FEA1D8475807CBCA6C78ABC6B9F154843DA6D ZEMIRPPUS8
515,150,662 *349E257DB3B43022D3C695C41BEE94EC7B8134DA ZGN78
515,150,663 *3494F1B0463D1F190CAAA5F89639ACFFE1A081F1 [email protected]
515,150,664 *349C2A2EFBF23E9105292A427E6E7A1C828FCD86 [email protected]
515,150,665 *34955155939181AC4A892AE7DB633EE5C3B7BDFB ZHARYAJOHNSON
515,150,666 *349ADE44B18DA146563254FF1203D7A9221AFD81 zhuang-miao
515,150,667 *3493D47A613CFFF01390C5E4F4715C489EF0C7A2 ZK|/
515,150,668 *3492D8D5786B1841DC3F9D698A1DFE1ED66A28F4 0001000L
515,150,669 *34985399790CA2C805C305EF002A44CE7AA79DD0 ZXNRQNSIGBTW4
515,150,670 *349A3019F6E6127C070976E39AE5262911BE0712 АКАДЕМІЧНИЙ
515,150,671 *349B3EFA9A169D696CC308F854BC9423FAFB6527 057julia
515,150,672 *3491B29CED7D3D4C2654A6081BE9719A6D6F6EF5 ПРЕДИМВСТВАТА
515,150,673 *349DED67C455476ED86D3C067D462420B41A0AF0 101justmoi:p
515,150,674 *34933CF91E11AA52DD9A5B7E0F4B3524EA2F09C2 «танкомастер»
515,150,675 *349CEB977135B187EB578B22FFA31C206AB9F3F9 11311100
515,150,676 *349C1FA5B5207D8FB0933E2341468C6C6011A4A0 0theprimus6
515,150,677 *3491310D0B76BC504580307568524FE2B4405137 1284221 en-min
515,150,678 *349ED00E242083730D9A9FE8A9D598C048770B05 1AGALOCO
515,150,679 *349712D16C7C41FB258321889F4E0CC3F2569346 1.BREITFUSST
515,150,680 *349E0627791A61EADBA73D5F6AAC5007BDA9F662 1619074 velalliselle on luovutettava selv
515,150,681 *349B21CAAFBC9BDC895A5D4186329D189258471B 178CAMDEN
515,150,682 *349DEB3314BE61C098CE2A84D9F5B790E8D37E1A 18KUEN
515,150,683 *349566EFC2ABF55D53693B0646CC80111FC97416 1 NORMAALIAJO
515,150,684 *349B50AD2AF6115B10392AE49BC32AA167F05D7D 1qualtiaetsprobleme
515,150,685 *3492C39B625BBABDBBE8BE6483830078F9DB086B 1 finishnesteell
515,150,686 *34950F931F9FEC413CC21EED6A37E6D3FE2582AF 1THEREPUBLIC9
515,150,687 *349AD4C21C03F75D154280A2B4FD98230B99AC51 1-herrmansburg
515,150,688 *3493105509D596EA8103C4125EE7550639FDEE3D 1ZUKRIEGEN
515,150,689 *349D054455AED800DAAF41ECE06FA962045F15C7 0iamcthulhu8
515,150,690 *349AB03D11D2A314976749DFA6BDAB1AD7E7D016 101justmoi:p
515,150,691 *3491EF88655B7FF2F6BEED7ACAEF7B30E838EA0B 10-ARNDT
515,150,692 *3492570354A0695B271A4ECCB602E21C79DE8288 1114029 analysts said they expect the sale to raise $3 billion
515,150,693 *349DD4A280FEFF78D65FD7D1D78E32E832B67A30 1-mieshullu
515,150,694 *3493395FD793295EE32F8ABD4CE2E691DA044085 1 mittelklassemodell
515,150,695 *349431838F28641CBDE8DEE1A160F05D353BFEE1 2392349 KAUPUNGINVALTUUSTOLLEJ
515,150,696 *3497CAAC9496BFE2438198116624EF33633A74ED 1NAYARETT
515,150,697 *34956651BF0FE6F8D54BE262FAFCCD3E8CB39E70 24february1295
515,150,698 *3497B70CC5B2CF0F7B451165E0EF6C26E6676798 2564921 joskus-vika-on-sellainen-,-mit
515,150,699 *3497B975D9FEB3815CD939F17980C573AD6F0E6D 1 SCHALTBILDER
515,150,700 *349D0AAB496E4841553FD27D677B638662449131 1SCHWEIKARDT
515,150,701 *349EBAA7D23F91901EDF4F0A4A54FA63223259FA 1sympathiegewinnen
515,150,702 *349706595324551DC1219753D5431DBA2644A07F 1tahillarindandir
515,150,703 *3495E2C39EE248860F30CE7DF375FC8991F719D9 1tensiller
515,150,704 *349FE1C5C36BAEA76B4944749E51442BE2DABCC9 1362404 USEISSA MAISSA HENGELLINEN JOHTAJA ON MY
515,150,705 *349093A5FF08AB680C9D142F2ADD84801FEC5869 2988847 oppilaat voivat halutessaan tehd
515,150,706 *3490A984CAE8A5A1106A440ACCF34FF4CECD716D 14 ALUEVESILL
515,150,707 *3490E1C26BF4F5E0BB2C89BD4FACBFBC521026F1 1VSTOUPAJ
515,150,708 *3493575B624E2AE27204E2FE702A5DDDB0090E11 2 BARENAKED
515,150,709 *34909F7AEC83B0B6FE5EB78E770B761E9DFC2653 2liittokokousjuhlassa
515,150,710 *34982B501C59228C310D04890EF4C15F7D5879E4 2167367 der.fehlt.auch.diesmal.nicht.im.fr-ferienprogramm..
515,150,711 *3498AB22F190FC5543F3F67E97A6D7AFFB5FD9C0 2200297 AUCH.JAPAN.MACHT.SORGEN..
515,150,712 *3498425787B0D7EED249B874CEA1FFF8B0B22016 2.pseudo-objektiven
515,150,713 *3498BB211532137C460245649BC65A6BF334D77B 2VD
515,150,714 *3494F85955A14076CB2D03FDE04E1AC9D0341C55 19february1463
515,150,715 *349215A251C5A3C64DA32DEEE6AB910D58FAE9F5 1.ALSIKE
515,150,716 *349406ECB1AD31700D63CD5038D4C9BDB802E9D7 1.A-PLUS
515,150,717 *34955695B49AB61F21F6F4C63100359F0013B730 3#b* * splat!!
515,150,718 *349A5D150A36557A25A99DFEEED435D2695BBC29 1DEFTERDARLIGINDAN
515,150,719 *349CA32B63F49A3790871E7CB33EA39838128581 1.domenic
515,150,720 *349481D4BF34403A01702F664D753DA23D4D9459 2910170 aus-dem-skandal-waechst-schluepers-traum-.
515,150,721 *349C2FF0B427D80D82F1BD3A284162E3F6CB864D ³iii
515,150,722 *34967E1B34716A7A878064FCF7A689E1428A4F6F 1GOOD
515,150,723 *34936077B11AE75C14127789FCA22FCBF6B8F7C3 1.lainav
515,150,724 *3491AA79AC3C575224D3550EBE8964605514584C 2HUONEKALUVIENTI
515,150,725 *349E46013034FAA456C818C4B5F1BD22279D5DB8 2 NASENFORM
515,150,726 *3495CDC6433337F5FA4F1A10431B2D2ACC25E09B 2pcsw4lk
515,150,727 *34985F948E94D2938CE1D2505DE38DBB07B296B3 1.reunamia
515,150,728 *349C3FAD19AEC12D974AFF5AF355CC7A9041EDAE 2SKVADRES
515,150,729 *34952AC7C34339B65C29ABA32E28FA8C89256041 1siip
515,150,730 *3491871FEE41B485A665452EB8CA59FA18E517C0 2 TARIU
515,150,731 *349C2E4DA835439674061D1A09E1CC4622D77BC5 4D0B4BU1NU
515,150,732 *349841A22D318816BA7F70B0992CE0A7D46FDCB8 4ilovevanessa3
515,150,733 *349D36EE5143269922810EF7A579107395BC681C 3636d91983f4341599c132033a6e552a
515,150,734 *349A101EBBD1841CD83298BFDC55FA2A39C7A985 380929 "diedeutschewirtschaftfasstwiedertritt."
515,150,735 *3493FEA7E30ABB7AFD065290CACD4620393903E1 381deja
515,150,736 *3490CF953C7BE4F98F88FC1ED804EB1FC5BAF202 3B~O(>_<)
515,150,737 *3495470C1760A2FC57C98A32D76FAAEDAA5FC278 2780933 the-non-callable-notes-were-priced-to-yield-9387%-
515,150,738 *349A2C9A6D2B52082451F0161778CC18FEEAD278 4porkkanoilla
515,150,739 *349E9846558ED3989A2BB96494890146D9986812 2ANTRACIE
515,150,740 *3493865AA4809C195439BC25A16B7D9D15BE3CA3 2DUCKHILLS
515,150,741 *3497E586D167A8E09AEBC80ED64BA234757C7622 4STRONTIAS
515,150,742 *349F9F4A9EC2B6D6E4E12870152D5529242E656B 4.[[USER:KALKI|KALKI]].22:34,.29.MARCH.2009.(UTC)
515,150,743 *349EE3E12C5316C12903D9A5F77C9999AE6A1F03 559950 dieserzuschusswirdbereitsindiesemjahrgezahlt
515,150,744 *3495E2A99C47E03D70A649CBF78CBA8897C2D25C 48ol$he$
515,150,745 *349E2B2C475B4AA8A1BB9CC9D32EBE96B8851D72 4AARINGER
515,150,746 *3493F9FDFFA147068B80CDB6F29A8325D115DA9F 3~;AAA
515,150,747 *349F16F1B5968C61F3F02C16814047DB68B186F4 4ANFIBIAS
515,150,748 *34965DB8805BA98286479B138491EAC862F182A6 3AKZABSW
515,150,749 *3496CA98D778BF1DD7225C6E51F8ADC84BDFE53D 3B<0~ <====3
515,150,750 *349DFBBE05B2335748252DFA7DE5DC14931B9891 3B~O(>_<)
515,150,751 *3491EF551DAFF97CABC46C3D97E50C9E2F255F55 5CRASHBAR
515,150,752 *349ED31B2F25C2581FA564973B0F3498CF751E19 4iamcooking4
515,150,753 *349048A6D5681F381A322214D6C781409B420C82 3SHIBOLS
515,150,754 *349EAF7AF5D5C5EADF8CAB929FBC77D6AE0FE462 4MZILATNEDNECSNART
515,150,755 *3498E5F6676BD3C34B1F7027A03BE610902E4C0A 4NEKILLER
515,150,756 *34999488210D4BDD6FA8846934115E9A6E1DF5D4 4NODDERIG
515,150,757 *349759FE5F1296C776F7CAFBE6C888B017860C1F 460544 ziemlich.irre..
515,150,758 *349889CF780C538A7FCC318CA770AFF264247557 4PHARSALIANS
515,150,759 *34967C7B0F875F0645079976BDC995E9EFE8FB4E 4CERB47E
515,150,760 *3499D4621743F1F8B0216C7E14B7AEEFF89DF073 5.PIRSGIREK
515,150,761 *349B97DE7551A334C71D9A99BF65C3E642EF6BB0 5REBEHANDLERINGS
515,150,762 *3498A6FE048814E367E9F3268B9A132C50E5EB54 5RGLEMENTEREZ
515,150,763 *34995F8F97C7E4C7017D7868765C1D251246D7FC 5SROLOCRE
515,150,764 *3492317B5EC435AE332F571424E817A78DCD9625 4physiologisches
515,150,765 *349850DC07E5B7FE423E562C0E293836E76C259A 623762 DEUTSCHLANDCHEF.THIEL.ZEIGTE.SICH.ZUFRIEDEN..
515,150,766 *3494853B3CF87F94BFDA63473D607B1134A09C00 67LAKAIEN
515,150,767 *34976781BDBB10DB7E90DF16373561207B2635E9 5angoisse
515,150,768 *349A468472CDFAC3418FE11BF66D1FFF3B105162 5CROWNYNG
515,150,769 *34903F61E97EDBFBA53EF48539DCC6EAE1EF8DC2 5d9b0904
515,150,770 *3493F6D58428090944A58005C23EF83AF2B916A2 5DEGROUPERONSES
515,150,771 *3492CF4B779311DF28F5A9290595CBBC8AEF4A12 5HYOEDYNNETTIIN
515,150,772 *349BB24D451B25804FAE9972276B60DC9C3B4BA7 5flexibilty
515,150,773 *349B8AA239A9D2F15DB3F90DEBB0449487A9257C 6PARLIAMENTERS
515,150,774 *34924FE3C72CA61BA2E54503AB764A83700B958C 5SCIENCEBUDDY
515,150,775 *349C85FC964843F2323CF145C64221A01E3B3B2C 5SHADOWIRONMAN
515,150,776 *349E68A8DE4637C11407D5DF7027C28553B9CE25 5PRERUSENEHO
515,150,777 *3499634994131D45986EC280DB12051B2E8F6408 6SMILEYPRAISE
515,150,778 *3490AFC82E3320FA33A46508BEC097A256444607 5.zickigkeit
515,150,779 *349FEE42A5C908786AEFBB06E59BF6A86C9CFF60 61235 a-kiltojenliittory:nhallinnossaontiedostettukehitt
515,150,780 *349222F4DE1BA7BAB21F6A6E6D1BF6105FF8B7DD 5TRPPSTS
515,150,781 *349E2556CAD9C9D761404097223A4A3DEEF8905F 5u8f4ml35
515,150,782 *349B24BD497A1759AE46EDCC52A9E1BF32473571 686629 telel
515,150,783 *3494E34F748D88A928B12A2372DD291552EC7AD6 6BENZNOVCH
515,150,784 *3499D41F70B6DC3850F4CDAB95E6A6B4426B1C13 6CONNIETEXAS
515,150,785 *3490E8959EF93B8F77DF5E148154D65B20FB4B3B 7future3
515,150,786 *349AD93130DC02DFDAA99052176262B66DC54CC8 7H1GH8ONES
515,150,787 *349EDBB01553118CC8B613D613D643FD3C958CDD 6JGWUCSI
515,150,788 *349388A08718130BE770D6E4E8F2BF25DEBD2A6B 6LITHRONE
515,150,789 *349DDEC221703483D782C8C74E1FE830157A9FC1 6EDROOWREV
515,150,790 *3497BB5CBDF34535537F7994E3A88CE1ED2A5B74 6MYLIMA
515,150,791 *3493B06388F8CCCE008BD0E01C46F7A612E34E00 6GMEMPHIS
515,150,792 *349F3327440CE4DFA18DBA1A96E92DA6E1C30BFC 6POLARISABCDEFG
515,150,793 *349C99B72C2B84D87BA15790D15B317BF724C42B 7ORROSIFS
515,150,794 *34906E1527A9729EA62C116FEEFBDA660C10B05F 6MEJISSA
515,150,795 *349D66BA70F477C4A922A8DA83A4A9E46FBAF4C6 7thatbutterfly6
515,150,796 *3499535D4285101AF2681474F9E4FA9A01844AFD 6OCHOTNIKOVYMA
515,150,797 *349F0405E21F691AE945F08332E551A0EBC23036 7TRANZICIJSKI
515,150,798 *349CB40841FBC94CB43C19C1B47A52E25BB6527F 81–CZECHOSLOVAKIA
515,150,799 *34937CB4F326E5B4200AD14190893E259C672BDE 6SUBVERT
515,150,800 *349F79DCB85191175C4E7A660EC8948B3A5A0BE1 726963 erityisesti.selvittelyss
515,150,801 *349276A618FFF28206664859ABE7120F2D462393 6VESTLIKES
515,150,802 *349FB7E0698157E72DD002033E266DC8F88C20F7 8BSWBLETCHEROUSBSW
515,150,803 *3493C5BEBE59B270E372AA6FB86BF753C5F0FDB9 73kenneth
515,150,804 *3498C01730959A544F9EFF4588C79807235A66ED [email protected]#775
515,150,805 *34986136809DCB4BBAF0F7649C74214E2434A141 8DOOMCHICKEN
515,150,806 *349A19D739EFFE9777801947E7B2ABCED4407EAE 8ENISSAC
515,150,807 *349120D1D641B9FF3F35E9F1CE9FD36960A149EA 7alterably
515,150,808 *3497F570D621BB90A9FF6F09C7D47037AB458725 7BSWEDYTABSW
515,150,809 *349785DB9D5A6A5F8165812F59940508D61B1DAB 8mywally7
515,150,810 *3490736D44D10B732A13739599EE3067A1496983 [email protected]~O~o-(-_0)
515,150,811 *349FF38C76E0224700504B3DF268F279F6B0751F 8###P * * * ~0~o(><)
515,150,812 *349A1AF8B08BCDB15829551035F8C922970EE7EA 7NDRMJNNGN
515,150,813 *349A805732A20671B1417D5763574C25921B0ADC 8VIOLETKINGFISH
515,150,814 *349379FDC805880CFD7C893170A8C09CB86EA493 975492 KLEINSTE UNSICHERHEITEN RAECHEN SICH . "
515,150,815 *349AEB5464E6261EDFDAA6918FD98010A233743F 9BESTOTEN
515,150,816 *349238C3D45F9C841F18FD9171A5DFCEB51C3D95 8AQUARIUSES
515,150,817 *349A2299AE459A25D67D143D4C95A73A5EAA8E93 846770ef3819d044
515,150,818 *349A1792B32DE207EA70688A6CB6AB93FF688C3E 9ESPANOLPORSCHE
515,150,819 *349670AB0006616CA0E25BB10D69D7FECFB57FA8 8BSWRUISLANBSW
515,150,820 *349E1B7B005A52A866AFF004019421D90154E195 9ILOVEAPPLE21
515,150,821 *349215625435C1365E937C8F6B2F4D9F5B4DF140 9KUUDENKYMMENENSEITSEMAEN
515,150,822 *349C8AE03D7E315394A80B82C05E00B0A49944A0 8gelesenen
515,150,823 *3495781F34A6B5D8311337CE25FC0FFFD9428B99 9OKIRJEEN
515,150,824 *3492CB7994760547FD745D204A98500D17F7E648 8KUNTOPYOERAET
515,150,825 *3491FB359A22DF1BF0C26C3111C7100B068F5C5D 8p`3b<
515,150,826 *3491289FA5A2C1A3AE42459397070A4FEE385042 8PIGSTICKINGN
515,150,827 *3494DEB0BAD40AC8D24969A3F03487CAD15EDA9F 8LICKLAPP
515,150,828 *349C5CEF98F89F0038BC85CC547B9DC0253F20F6 8MYDALLAS0
515,150,829 *349BEF5C6FDC54F4D3AAAA45893A96212C7A3804 9XANADUPOOHBEAR
515,150,830 *349753E37909024D43C3AD950F8F7D871B2AADA3 8===)*.*.*.:p
515,150,831 *349F3C84A1B6B829C8E9840E1C98041E21F00925 a+%!
515,150,832 *34932B8C6E9039546290DBF911DEE9A81E554B10 A1C0U
515,150,833 *34917C2652B568B3611EB6D6A152503877281BC5 8UTILIZASSES
515,150,834 *34995B8A172C91B1A2E9770D0F1E91C013B3914B 8VERMERKT
515,150,835 *3497861C94DADCC2A081AF7172FDEA1A3DDA54D0 8SULKY
515,150,836 *3499AA16A8E9BE7DA104A21F3F206DBBEBA83E6B 975866 the-bailout-announcement-came-after-the-market's-close-.
515,150,837 *3492861631874FA50570A8FC3BAF459DDC3A6B3C 997849 halbuki,planlamabirsecimongorur
515,150,838 *34930BD9D199046CC3F9810095674302B77F919F A#7D=
515,150,839 *349D6771E3E91C8971335D07DF2450A95D4773BC 9BSWADAMFRIX
515,150,840 *349BD3E2478BAA668F9AA8DFDC2E9617BA0201C7 9BSWALCONBSW
515,150,841 *349C117054ACDFE71FF527EA4605F7DB9016FD4F A9,G
515,150,842 *3490F5C2E5FF506204E11F6BEC720C8C66521988 9DEMOMAJOR
515,150,843 *349B943324AC4143477594C49D14F80955CB1036 9HAWKEYECAROL
515,150,844 *349926AF1B57FCF07E35CA6964EF49D72BB935D6 9HINNORNA
515,150,845 *34920B12802B47C817323C5C87DEA2FB6A5D5A8E 9BSWCUTTATBSW
515,150,846 *3494E25F825B2C54F92275BBD17F653E37B2BC2B 9CULGHOURIS
515,150,847 *349934AC63DAB4D19577285045E49503BB4BD5E2 aacaj%
515,150,848 *349D0EAF8DE5EB8D78D947C6B919817FC9815C78 9EROCSEVIF
515,150,849 *3499F63C05AC2705FAD2CB3720FC20E6B5AC4C4E 9FERREORIENTE
515,150,850 *3496129C7E46D4A8200F2EAE09F322D99BD1DC93 9MONDAYNIMROD
515,150,851 *3492657D390FB5C58547F2B7DED37461777673D1 AADPYB
515,150,852 *34952FCA97A543675CCB5AFCD6155F35D4046DA1 aav#n
515,150,853 *3499A1673E96B9142E5206BAB3F550FA4B209A17 9ROSESBRADLEY
515,150,854 *349D2DEE36E98AAF9E3EEE01701A68886E3C6A18 A1PPQ
515,150,855 *349831EF38992D16A1FA8A38E1BB734CFD8D131D a0,7
515,150,856 *349EC191B7E8E08D0BF4000A75A4BAD1EF2E6479 A7Yc
515,150,857 *3494A6D663790B1B6E8D0CECC1E687C29B64F4A9 adriennebffl
515,150,858 *3497022FA6D234AD93D958B35800A2B8617A1187 ae(:y
515,150,859 *3490D2737B336DFDDED8D8B7B979995DB82221F3 ab;q$
515,150,860 *349BD57174640BC40C06429A67C7835F779F6836 ABS!.
515,150,861 *3493F1F8F81879FAE31DF63F41C2B8015EC48D7E abrampangilinan
515,150,862 *349786B44139793C808A1F3182E959D4AEE8CD46 ahihu.hanahag
515,150,863 *3492E3D3A427AE47A7D7FFD39A19FB3AFD62D3F6 akef
515,150,864 *34915A9F19C901A153010F6439D8A125C34E1F6A AG51
515,150,865 *34926877FFF24567C71449378E0EF9DCFD674E55 ALLER9I57
515,150,866 *3492F20BACFC5AE7A54B1883C2E09EAD50B1AD51 ahjg
515,150,867 *349A828CF6B9A89E07BEFB22017381E50825DA9C aitrakcu0
515,150,868 *3491DD5B8FF6CE93F12EC8D78EBD70C8B9BDB81E AEU
515,150,869 *3498A639A53BCDCE185804F5B62A389DBE2D09D1 ALEX-HERSHEY
515,150,870 *34976903E328565C714133EA305A4054539FABB2 alexisschuldt
515,150,871 *34921BC20F6B9794B6876422A13B243E658E54BE afl1g
515,150,872 *349EA4D47398A4FADBA8DC93032C075C8BFE8844 ALUMNADODELAUNIVERSIDADDEGINEBRA
515,150,873 *34912992B1FB6E5869F19DB4AB71C81FAFF00C5D ANDREWLONGDEN
515,150,874 *3491733DFA6D8A335A9752D83BCB21B2903873B4 anferstehung
515,150,875 *349D31F316C09A0BA9F527FBC525F0CE0C394B22 ANS6
515,150,876 *34971531AB310EB7340DFDED5998B6C6BDBEDF63 ajti&
515,150,877 *34916C67CD8009083B3362AB55039DED9C34B69E apl$+
515,150,878 *34935EBBC4AF681B6DADBE39287D8BCD0FEA179B AR7:S
515,150,879 *349972F367BC67FE1D42170766DE63B8D27CE09E ARK"4
515,150,880 *3498B0EBD2918FADA5904152E2D176AED4C8B0E9 article--mozilla
515,150,881 *349A055B6D9EB63670B1808A97DB999D1DC78320 ARUNAATH
515,150,882 *349216FAF280B197573DDACA92AD0F8194D856FE ask,d
515,150,883 *34927F856B6F0A54707C9A2CF3763387D3EDD2DF ANDERSON517
515,150,884 *349D7FF4E6BE0C0DEFA48FAC2BA0D7FCE6BC9AA9 ardenmeinke
515,150,885 *349F7591C907F122CC084E9D28DB3B033A714ED5 andreswingo
515,150,886 *349CB6A7A263C2B3569007DE724F04EB72E803FD ARLEN.MARANTE
515,150,887 *3492406BFB4229B0A9E6F43588CE088F817D1945 ARMAND.SENNA
515,150,888 *3499CC0C2B978546235DEFF34B2DA67C51940BF8 arnarvon5
515,150,889 *349F2A98FB566D2643CFF9252F77747BDA08CB52 avrettop7
515,150,890 *3493DA7AEB9018B5270999987420B73DE09EFAA4 ax&oa
515,150,891 *3493E900A40EBAD2872AABC7CB2A1F9E83BFB468 [email protected]
515,150,892 *349002A35A9679AC686A37449ABA4FA4851833B0 (>-<)`(####B
515,150,893 *3496722FC75E0FBD1004EC165D0E7781364DA295 b0h6m
515,150,894 *349F2F7F9AE6B05912AFE2D8D65AEB12BCC7C677 [email protected]
515,150,895 *3497105785F85C29C5EF130BA5148D0F1FE5E636 AS,.MARINS)
515,150,896 *349DB9DA96D1C884342723C703C1AC8131AA2DE5 b4nrt
515,150,897 *3497DDA482B0725D509E385094E5BD1394FD7A4A b_5b6
515,150,898 *349CDDFF2A94F8DC1CE4D1F977EFDD0F5BF5D3AB b64ki
515,150,899 *3495CBA7E4D8EB2D1B123D2656DE0FE0C7C1430D AT$Q3
515,150,900 *3491999740AB7A83D776748A6DDBD7E8520D19B3 BABYHOE2
515,150,901 *349C17886BC1F194560C89E6511F5CED02F9D01C a<]v
515,150,902 *34911EC8AC1639D4E4F905A1E57F97AFC2920CB7 BARBROARK
515,150,903 *349A8B3165EF3CE7445BB308F3CEFC354017198E barrettregel
515,150,904 *349034F73C08BC6123CE482E7249E5221F5DD4A9 BARTMON3
515,150,905 *34999DAA5163F0AE3455B39D996437DC02772183 B0A5+R0NAU+CAL
515,150,906 *349E469CFD521B067E7138D8D96F411296EA8318 b1hi
515,150,907 *3492D20235E26C526DF98948A2BC3F80F5484D3F b4dfb
515,150,908 *349B5D5F2A064C084DFC9BCE1B4A6A15AB134B98 b4v1&
515,150,909 *3497E63B10FC9001798D623FCBA08709B8C19661 bcl?q
515,150,910 *349947503F35AC5E28D143296162CA43088303D4 B.6
515,150,911 *34960037D610D602686EB09EFEA410CCDE501980 B=dO
515,150,912 *349584144BCF45C44A513755B57F63854EB37632 a-single-string-the-first-argument-passed-to-<tt>join</tt>-is
515,150,913 *349FE0676F21633C6DE4DF1C5E4AFC906FE303B6 BENNYCOUREY
515,150,914 *3495D41182D400BC8634218DF6E4110EAB23F46A augustphilman
515,150,915 *349397369F55AA72FA8792ABA9F175B84608B41F BAŞLIKLARI”
515,150,916 *3498BEA354DC11568207CDA38C748F91C3CD66FE [email protected]
515,150,917 *34956977B9F1D2923F37AE129B3142568F230126 bbja
515,150,918 *34970874F425A0FA79D2EA47C74438DB4E072E70 BG1G
515,150,919 *3496BA2CD662C42EBBA0E8A6887D5FCEC49B6989 b7r/v
515,150,920 *349E6A587D00A86ABF0BD218B6E2E77BFB8B7515 BABY./.KITTY.PORN
515,150,921 *3498084432C42B5FD93D9FC0B5CC4E4C32E1A5A0 BIYS
515,150,922 *349EC71A52BBA98E8421B1BC36A9792AEF8A3FA7 ba$p
515,150,923 *3491001B6F14389095079229ADD0F6230C45E885 [email protected]
515,150,924 *349E60C79CCB6018542B1FE96D673D9460D6A17C B&BGI
515,150,925 *349A592ED014224F1A3B60D754BE862184D5934B [email protected]
515,150,926 *349686B5A3F2F607366848D94B40C6313041DDD6 benjaminbandin
515,150,927 *3490B807E4D9C68974612B0614A22883139B8E26 benny-persson
515,150,928 *349BCE7075329A6D8F969D1C1357742C365FEF6F BERNARDOSABEDRA
515,150,929 *349E0FC9D4AA5EC66959F77A28BFCEEA3598F69E bnasnihs1
515,150,930 *3492F7858045A8845B3CEF3B30814A1E1CDE9F73 BF,(H
515,150,931 *349C903D337F6248952CA684D8117A7F5210166E blizzardwheels
515,150,932 *349087E1301D9C6ED6429F6A5EEFB742DFB675B8 BILLWHISENTON
515,150,933 *3493310BC3BE03CC8FE0593191E108AA8FD556E6 boyznett1
515,150,934 *349FABB5EA6BB29AC9AA6824C793264FE45ED563 BK%R
515,150,935 *3495182C556A22ACC030047112C8F7D408511D8D bl"h,
515,150,936 *34968D83D65E7906595C559AD94A63CFD6495567 BONNIE-TAYLOR-SHAKE-DOWN-2K1
515,150,937 *349057B89239CF5B33B4BF49A482F1253615E79C BMBN!
515,150,938 *349A688246620F5C70533A08F3BEB5ED5F1F9F9A bnw!"
515,150,939 *3494D53C0E130951BE99CACAD56543D8DFB3BDBB y}Əj?,
515,150,940 *349FF7422A863C45A0769C7FC01CD4B3D6F64828 BRAD.KIMPEL
515,150,941 *349526E4FA1AFB6F0CC0D4C5DE444C6A640365CA 1j
515,150,942 *349AC8C349E0F13B764394F873B64E41A4632F64
515,150,943 *349B321F4681914247C9ADAF918BBB707007AB2F BRTe
515,150,944 *349A497DFB1E5875A69A4828473A6340CBE4A912 BRUTIZE2
515,150,945 *349911C92BF915248D3D4A082DAD4435EE938769 B-%SN
515,150,946 *349B935DD8562BFD10384D7A1640B744AD526330 bswchinesabsw
515,150,947 *349841969F359FEEF780C824AF07FC5F80D02116 brites
515,150,948 *34919399629913D70F36A916EC7B83333ECE0C7D
515,150,949 *349180FAE258EE662BA366A81C0C25968FB43DEF BUCK.PORTMAN
515,150,950 *34999BA9AD1382C6F8AE9F541BF2F5879C36B724 bufi
515,150,951 *34962FECBBD6BFDCFB57653EC082AA713853430F
515,150,952 *3490B59AB4AD9774450B2A63602D8F6C4EBC0333 BRYCETUNG
515,150,953 *3494F4E667DA7B4D844A7A27D866D4254EFC2055
515,150,954 *349E70D6606A2E65F70B37272BD33D164F4CB207 bsok4
515,150,955 *349B5584E523C23E9A0475C3BB65F84398D15AAB b
515,150,956 *349635506D3582DF15271ED20A3AF46251D4009A BSWYOUMANBSW
515,150,957 *3499439AF21C8402ED3E172B9E461649F4F8C199 bt30,
515,150,958 *34908744097B4039588D5E920AAEB9374CD4A5F6
515,150,959 *3495717A745C89CB22D4826E81901AFF7E7B8ACC BTFI
515,150,960 *3493CC1DECEB40A7DC98CB58818492D4DDB61C19 b%uc$
515,150,961 *34937CD7B7F2A378996DE976C8708EFCEDFFF5CE uG"
515,150,962 *349E5CA7DD11ED94A648E559A96E73AD7590EECD budharamoto
515,150,963 *349C7581ADA55A76C628DF27DC8280E836F5D75C BUDSTEGMAIER
515,150,964 *349B89BCA26B6FAECB75EA81DA0E511985E41DA5
515,150,965 *34954E4DCA4931C1B1F016CC53A40470E6E2BCCD
515,150,966 *349BE55FA2BC1E8FB78CE4F56A76BF200A291EAA (˚dkz
515,150,967 *3493396FA4D50691726B5AE52454DAA8F3B4BA6C
515,150,968 *349D4DF71B8C685D369094CCDDF2E828459F046E
515,150,969 *34901E78709D8D685EC9BE160B2DADBAE58A6F0F
515,150,970 *34912F85D1091CAF094ADC2E17A6704EA3184E87 +UO
515,150,971 *349BC8083AF7503817FA6BF2F8400F7991A508AB BV6MN
515,150,972 *349A8CBB1720AADBDDC3AC9719D8B6187D1A5AC3
515,150,973 *349E69DDBE087DC2C06DC0F4554B0D543286E1B7 BUZANE
515,150,974 *349C70D630E3C7C63033C7E8E4422C1783F21DE3 b
515,150,975 *34900796CA5F21757ABDD4E9B9FA932AC4FAC174 BVUSD
515,150,976 *349CC44BCF9C465F5E7B943DFFBEECD1CA9AFC24 b%x+.
515,150,977 *3493FEF1522D81518049239EE29E75E90A013D0A
515,150,978 *349AB7AB9FBF8616EC8BDF27A1DB8AA1D8D99C54 BXIL
515,150,979 *349BAFD4A61D05D1C2BEAF2A580631F0694DC760 BWXDF
515,150,980 *34938DD64C09544AF9CB1CD6CA54032510B9DEA6
515,150,981 *349F156AD1FD21130ACE401FB6EE67597BCD8290 BYUO
515,150,982 *3494A4B587CB796101AAC16D3406DE87147E6353 C0AQ;
515,150,983 *349BAFA5CA059E8A257B879FE05332E85E75E681 C1VG4
515,150,984 *34946CDA5D2ED8DA4CB1C4F358DF05EBC72094D9 C23.24 - CHRISTMAS ON THE CLOSED WARD
515,150,985 *349DB92E40591208545F6E2B2C9C5368CA1C95F1
515,150,986 *349430F59BE15148E7C79E85E65A6C004139BC1B
515,150,987 *34922EFEB9942C23EBDFC79EDFC268E3A526FF19 C4#?
515,150,988 *349EAC02AD092AD40E34EF661F4ECFEB77BD40AE 
515,150,989 *3493FEDCA780097A66826BA7E6369687A91F9790 C5BF6
515,150,990 *349A4C5EC120B76FE60FEB9AE9A7A60B92D6C8AD C7PN
515,150,991 *349F13F76DE9AFC93673C4505FE4EFD02E6E660B
515,150,992 *3493702EF8D89A42EFE1DBB881C45FC7561A34AB c93&q
515,150,993 *3495DA49B2D86A80FF5C0A4339407162DF7E0603 C9QWQ
515,150,994 *349946FC07FA95EC654B5300B826457B144C85C6 [email protected]
515,150,995 *34905B4E366BEFDB15418A3153D61CCE133BAE49 z
515,150,996 *349636408FC2A55D06E0CD6CD3AEC31D1CE863A6 CABETTE
515,150,997 *3491354E1FCC306F676C5B6F95377F6C233E1247 CALISTHENICS160
515,150,998 *349423FB992F8E150ECCA3CDE10C9C235957E14E calling-mars-(single-mix)
515,150,999 *34938912852FA18F2D5535A2C07666BFCD4A9164 ?f$sAn
515,151,000 *349AE35F5CEABD87A9380597465BD783430D391D
515,151,001 *34901917929F74FABE426B384B9E1E946ED4A03F CANCEL23
515,151,002 *34943DA748B908FEC5BC3DBB52A592FA5D5417F7 
515,151,003 *349C6BC8E4EE4009F1DE041861816D60ED1BB0AC carestini:thestoryofacastrato
515,151,004 *3498A6D7738E12CB429B7E1B83C1B6A7D953A6EE carlodivan
515,151,005 *349971F9E4DF435557841F49F9EF2E18BAFE4FAF CARLPARDALL
515,151,006 *349E184CC2D56581CF8DD3D9C9A652BFF482AA16 CANNA-
515,151,007 *3495C2998BA541C2E573F48062F1533B134F1FD4 (CAN'T.GIVE.YOU.ANYTHING).BETTER.THAN.LOVE
515,151,008 *349275005A0024890A673B8F35C85FC98A445DD0 CARLO.WOLZ
515,151,009 *349A5E72B746C13B4F728E7BA423663ACD8D40DF CARSONBENSKIN
515,151,010 *349BAE20EB2DEB6BE795193BE75796EA518347FD CastroStreetSanFrancisco-Early1970s
515,151,011 *349550DD6F47B7357DBC1108FD5A6FC2600DE892 CCYUW
515,151,012 *349C43D293025E801450BF3B252689A7CB387AEE 1025379 MIT
515,151,013 *34956F417F0950CF70EF638E7401BE6B9705E558 ce%42
515,151,014 *3492121AEC6C53A00952F5F1B6EA5884DECA43E9 CH9M
515,151,015 *3495EBD74F61C6F83632AE3183650935AEB5B96A character1$t1cally
515,151,016 *349FC4D26B4361AC446DC91584920FD5AFDC4D60 11 POLYPHONEN
515,151,017 *3493D558CEA62090D9DB910165288ADB7DE74282 cg5!v
515,151,018 *349BB87BAAE4985751EDD91F170D03474F6E2304 1474630 vuoden-1941-vierailun-aikana-l
515,151,019 *349DC595E7CF346D67A8F3ABC0640B34C2F14801 CHONGSASNETT
515,151,020 *3496454FD1FD48F8F5D34EC9F9EC002651E76F13 CHONG.WANBERG
515,151,021 *3498023BCCE75BBE39E20096987CFEE6C8EC71B7 CHASE.ANDOH
515,151,022 *349C6A8D49F51C518FAC848FBC4BD9AEA4A60EC2 chayana0
515,151,023 *34910698A7C405353EBE686D3F5280C337195345 CIXJF
515,151,024 *349AFC283D890A443B4EE4F66B643AD87BECC8DB CHXN;
515,151,025 *349284075CA9BDFE0750E6A2670C50F7ADA4122B 1CARDTRAK
515,151,026 *34913796098102EF7651810EF86090310307EF57 citarella8
515,151,027 *349FDC706DF1EC33E68DBDF8AD7DD98340B18888 1dunkelzeiten
515,151,028 *349EFAED3AFA2ADC9EB672AB9B6D6C519352BF5B CLHATLESTAD
515,151,029 *34987EA246D4F5CA026FB014D30E51703B742DF0 1 esitelm
515,151,030 *349A20AE70B3D77A95AA2A17C209F8A113AF2A16 CLAUDE.MEADER
515,151,031 *34901730CB3F3D73AE832E4A6D09285FF4CCE1B1 CLIFTONLUSTY
515,151,032 *34992537F4D77FFA757C5D1419CA6ACE1ECAF688 1KELTERN
515,151,033 *3491F46F269B61FE8C5ED0C2956EC8C88488BFB2 C:M0G
515,151,034 *34982A85C4C23B76EE0CFAA4F54ACEEF04B79345 c;nq%
515,151,035 *349C0AFC7BFA97DD5961ABA67F93D8F39772E05A 1-NAISUTOPIAN
515,151,036 *3498198606C692409459F022E4F1E7F77C620D58 1NF1N1T1F5
515,151,037 *349C02134D809D0CE84BD99A220BDF2E2958207C CONCESSA!
515,151,038 *3494A5F3A1625DB97F44F9408B7179D2AAF434B3 1-PERUSRYHMI
515,151,039 *349CE59CD13BD874AAEDB6A58DE1D2297A47BCC4 1-PIECHNCZEK
515,151,040 *3491916188080600B4A22A609CDE9348CBE01122 cong3nally
515,151,041 *349FD393714307254104D94A08E61A3484FD6BB3 conniecarow
515,151,042 *34975CA5C65F59969175D164154BD4680089B597 1.RAT-KOTAAN
515,151,043 *3496A4E3CE56D7C869619E73F3D41B7A9BEAAC2F 1 safelike
515,151,044 *34951D6EF32C0FA91E991773CDC87FC19A46CFDA CONT4BILIZ4RLHO
515,151,045 *349DD8D8AD604BF0A629B4462B37A4954174167C CONRAD.HUYSER
515,151,046 *349A619AEF77159C8EB0D00DF999F7CCB36CBEF7 Coq
515,151,047 *349D717ECD6A3CDB07CD003BE28D1114BACCBA25 cordellbertrand
515,151,048 *3491C0EB523EF80FE46E3E46F0EF5980B1FA3611 CORTEZSEHGAL
515,151,049 *349B57E17CF4156FEB652DD8BC1B65D0EDAB5BD3 corylina0
515,151,050 *349D75C294EDD3216D8E7013B8FA4F5FC7A71482 1-TUMET
515,151,051 *349C23DE35B3B5E97931932F266EE6733C1AA957 1.vilaseca
515,151,052 *349AE1DCF653DF8F2D630A22C595A0A5DB416AEB 1yakinlasiliyor
515,151,053 *3495E31B6CC549E6E5B152BD912383515C9F2D45 [email protected]
515,151,054 *349E518DBED74B01FC00D6A54211CC1BFD1ED4AD Coq
515,151,055 *349C7EF58DEC05200062BCBE81383070D668458F CQ0K-
515,151,056 *349E1771AAF2A767E62F47C25799838309F85B22 [email protected]elenderhu
515,151,057 *349D3FE29E4CA477ACCB34EFDEB57710A708ADF5 2467033 DAFUER-ZIEHT-ES-SIE-REGELMAESSIG-IN-DIE-FERNE-.
515,151,058 *349A2D85A6A4C8DF8B881536457215148663408A 2584079 matalassa ei juuri muita vesilintuja liiku
515,151,059 *34908FDB8FDAC5D1C63FA9E72156BF3C4A2A4D4F 27 WIRTSCHAFTSKUNDE
515,151,060 *34945E497240B472238A2E8ED96251DE60A28BC0 crdmu
515,151,061 *34957A281842D49CF08B21ADFD038F3D1A4392AE 2AUTODIALER
515,151,062 *349AEF4B5F8B7A98692B4275ACF48A68DBF20429 2DRJFNSYB
515,151,063 *3490B5A9DA57DFBB4C3DA801702A9B9E0827EF04 2EEWULAWZ
515,151,064 *3498C423E238506667524ADDBA82C9BCFE99DB5C 2EFFUSIONI
515,151,065 *3498E2F046F14DF8C3DB700B27CEADDFFDCFD317 CQF%L
515,151,066 *3497CA95F76F064F771FE1B9AD4BA2007DD20002 cu9o"
515,151,067 *349C31B6947DE1F1E93060D0F565B02190DF9A2C CRUZILLAR
515,151,068 *349E782F39C1D4297F6F8FEFA9A07B9D738E7B7F CU%Z
515,151,069 *34921E256EBE098BAE7EF9FD126E2D5AA0783D8C CVD9N
515,151,070 *349B1959556BE3396BC5755978D5CFC76602118A 2yapmagi
515,151,071 *3495C84B690EADB1A99BC78D1A5CED5E78011D2D ctnhc
515,151,072 *349B356B8A86211905497085D5CA5188E034CA75 [email protected]
515,151,073 *34931CD9A1E24B83BF25E7F1941536E50D34BA1C CYM84OA
515,151,074 *349FC7086E15A83B0BAC3E6EB330C13119D7D8FF CYRILANDRIES
515,151,075 *349692AABEA41FFBBD12E51939B688A6913FC33C C]YZ
515,151,076 *349C479609778C889DFF5B0B84D8190543E11405 CWSLE
515,151,077 *34917999A7C5D67F3121B4F00286CDBF5CDE5D58 D3CB6A61-63B6-43E3-9CA6-1D26003E7A2E
515,151,078 *3499FADA012430DDD52B79EA33A052CCFDF1E8A5 3ZUZUSTECHEN
515,151,079 *3492B954E81C96368A5C3C67217C10B5D3CC727E 432LORELEI
515,151,080 *349DC10DCCF069DE875C236FBB0BC6C66C64992D 4DNEMRARE
515,151,081 *349C9986ACD2AF03F2195C59C2B4046D11B1D545 4F0RTUN4RLH35
515,151,082 *34971955AF030CD3B86F664BB7FD8A9C6A0313D4 4IAMCATHY0
515,151,083 *349C253FDC7527A5C689EBA9E76A810AB714B0D8 CZ6"
515,151,084 *349F5BCB0DA78E584399E656412C650197EE77B9 4MISPENDED
515,151,085 *34989B76EB1C48515B80BB9249752BCCB92E3CB6 D0340104388B8C53CBA242FD27909129 PARASITE
515,151,086 *349321CD3071696004FE2674B4B22BEFCBFC86E2 4SAILINGHONDA
515,151,087 *34939D79529E632CA7C9D9F6E53902C5246F3FE9 DANIELDEETS
515,151,088 *349180C2F33B5270E290FA62F6D73D4600BC9329 DANIEL MAES
515,151,089 *34958ACF58BD352D114CB044170FF8801080D2EE d?2t
515,151,090 *34946C084B467F76EFF5A9F3CA28251D5FEAAB4A darincorda
515,151,091 *349566D72B93145D43F4CF5AA26C6799A6B7C86C darrelharbottle
515,151,092 *3495CEA8EC124212AE1A6773AAB71596E2072BF8 DARRENMCCARRY
515,151,093 *349412E7CC69ACA5484BCB4B67A7ACD0CE256154 DART9
515,151,094 *349E1B46F2C59A76F5A688070520635C33A54055 datulama
515,151,095 *34920FA3A75B650E7926BBDFBA08EF5C9B1FAA61 DAVEGOLDEY
515,151,096 *34904E188B7CBE14D3CC3B4DA1E029D8D89575EE 579913 philipkdick:dasvater-ding
515,151,097 *34992DE4D398C235488FE03E1BFF4834ABC6450A [email protected]
515,151,098 *349629A74E9559FAE7475F6AE9EBB665DC3A8F31 dbh5
515,151,099 *34903C29E7817C9EC2090CA82E53FDC0E4CE8458 dc-_(
515,151,100 *349CD5D2AD27CD3B45F87243857D6AE406FD1A7C 5ILUVKAYLA3
515,151,101 *3495130153DF4F47A5C049B2828095DE90BE31B8 5-messukyl
515,151,102 *349E585BC8DD5A317E33F7604FAD6EE2A44F25B8 DAVE.KAEDING
515,151,103 *3499CAB13D00745124B753AF522F8DD35576C438 DB,h
515,151,104 *3495C169B5BCF2AC1466303CFDD30D7532B7F172 DELROY.CODRINGTON
515,151,105 *3494A9851794C08362987EC9DC9FA237D527277A 5UTBYGGT
515,151,106 *349EED32028B520CDDC540A949DE1BC38F1884E0 d?d8u
515,151,107 *349A0B251C7C9D6B14827D4FF39B051F459512FB dennisea
515,151,108 *349C2E841F4D981DD391A66EFD42A080961A53C3 ddwdf
515,151,109 *349A33F304F6F4A6DC2C29E8C67A509AD070645B DES4
515,151,110 *349B740872EFB223F74D8CBAD3A4F6F1AAA4DED7 635278 DR:ZIRAATEKONOMISIYRD
515,151,111 *349CD6F4AF55BB6A8E2D48433C3DA8CB64A00791 DESMONDGANA
515,151,112 *349C2C1C62164896E14E57A176C44B8BBCB2B255 672518 mirasysoy:ntoimitusjohtajapeterwesterholmpit
515,151,113 *3497238EB20A67F3982DD4C3C327AE4391152359 6ASCENSIONN
515,151,114 *34909842B72234A8A511B1105D253439C5233C30 6BSWCENCOLBSW
515,151,115 *3499C37765347221FC580D167E7D4C1EF3D8B448 DELETERIE8
515,151,116 *349080E09CBEED8A3B0558F79E6E9FFCDADF7B1E
515,151,117 *349914F2AED949CE58E72F85BB1371BF9FEFDD5D
515,151,118 *34954CEF19BA0B85831887545F54D549D6D06901 M,
515,151,119 *349C334892C2874E13E05E5268D29C97A085C462
515,151,120 *349CE723416118F6D1C85B4DB2612D1BBBCB0F9D f
515,151,121 *349D02B296AD4CB69E04A1925D36ADEFAA5B93A0
515,151,122 *349DAF55EEF5D602F612BD9895D0BFE066F34B94
515,151,123 *34934A0CA3D12365B38D70EE3492092A85521451 f
515,151,124 *349CD65130F20731DFCB9B10E6F4534C3F72609D
515,151,125 *34990D2E2742993378F84169E22336088D738498 
515,151,126 *3499D5AD9130D15111E11F161B7B4FA590343F19
515,151,127 *34954535CB88E51384768A83241AADA51AAA010E
515,151,128 *349F9AB7E06779DF7DC4F5E275A1EE58FB150588
515,151,129 *34970005C07AA6EBE9EF437CABAF5680655E014F
515,151,130 *3496F85F72D31907A456EBE9D74E25DC424FA8CB
515,151,131 *3491C4D34D55D2DE84BB49C79CF59B971D4BF080 DEXTER.MALLAK
515,151,132 *349F6051E3B6800874F7E2E0D8DF6C292B4BD107 dfd99
515,151,133 *34928E094FA2E087DACE6F45A0D21CFBFC7B20DF df)gs
515,151,134 *349EC724C06AD639A7DFA83EF94BCEDBE6599E70 dfuh%
515,151,135 *349F797A96C0E06F8D944EDCC942C315ED1FEE34
515,151,136 *349AB04F280140A474E8E88D6A01D9DF4E0887ED
515,151,137 *349092615408FB4B90A534A0133397FBDF506ABE ^
515,151,138 *349EE85B274058409E9B46ACB2CDFE3E2D4BF287
515,151,139 *3499EBC237A28C5A8EEB2B8D154C9476464952F1
515,151,140 *3498BB52CBACB2C7C80B22803D413F48A1588868 }
515,151,141 *3490A8AF67F247B3F9D55E5DAB6F085F0C3BC929 
515,151,142 *34964FBEB08A1D4CF923EA3E019AA2A6AEDA97AD
515,151,143 *34916631A6D2876D8FB2ACC1E1DA20CE3BD7C95E DICHTDRA9
515,151,144 *3490C5B1993C37285EB50A85F7F4428E2396A72A dientafeltje8
515,151,145 *349557E5776A4718416D14930C0A768FF7E12B46 DESMOND.DELEA
515,151,146 *349D339404E5CF8103A9399C5488CAB7D045274F
515,151,147 *349505A92A5BF9E2FCFA5481686867C0AC4EE7A4 dessm
515,151,148 *349499A72820BE3F5EBBD89EF52673577E20F5F7 DÎNSTRUCTION
515,151,149 *34909EE05CD09B8FD6ED953C5FBA177190C8B800
515,151,150 *349077B54110E65ADDED7CE6A12B1E4676170220 DIPVN
515,151,151 *349CF0C889B9615E4FA868D34AA67F851FEA4D57 ;
515,151,152 *34970DA253FAEBA97D59B99248F16F11E0414BAB ɔ[
515,151,153 *3496B81D0B1B18E8528EF5D9F9409D78B4F77363 
515,151,154 *349035FF6248660DE013EFA575D233EC2BEA45EC
515,151,155 *3497754FD1C0CC7E614BDFEB80F6D022E63BBF2A "6`
515,151,156 *3498BCBFFDA0072DA2FB06E1E43E7D3D26A0B9C5
515,151,157 *3494E49C814517CEC2F80D547EC197732D795807 dis-ol'-man-a
515,151,158 *3496A4284FF3A280B41F0E70C98641266900671C ditby
515,151,159 *34927354DBA2309947555CC2AAEC8B11FEF47443 J
515,151,160 *3495E810C2A758C751099BE0287BA57FFF671F0C DKRI,
515,151,161 *34905ADDBAA2FFAB39E9C6AD934D826E23D70B98
515,151,162 *3494B3CC1C9A67A1138204D7A090400AD6F1C1EE
515,151,163 *349E03273A44129A1C1EF468AA38055C34E3C2A7 DIDN'TISEEYOUIN?
515,151,164 *349E436D1F0F7F9D05A36D299A1A4131982E9E4C
515,151,165 *3497835DA3C01C90B4CA2248AE8FB889A4F23925 DlP1
515,151,166 *34935B7FB28DABB9E6A43081833CD84698E79B34
515,151,167 *349BB2BEC5FAFE72B18EEAC30D5022B409BCC584 DILLONPULLIE
515,151,168 *3495BA5D9FE67B8BA63578C2F18F5728AA341E2D
515,151,169 *3491AF4D8F5531205E0206009C31B5BEBAAF72EC 
515,151,170 *34945DCBF1E8F57DE0C4DC7FBCD2A736A9A6AF74 \
515,151,171 *3494100101633973F77C833997E5297C3DA72314
515,151,172 *349F9FA3575235122A6FC56B69BD2AF03B0FE4E2 DOGGIES13792
515,151,173 *3490F3D3E93700200148DF8567C1F9A15617BC92 DIVATASYAB
515,151,174 *349D063FE5ECCA4E991901CBC02A21A21E051605 G&epЩj
515,151,175 *349C84690D54C49EB94C63E679F814459288AB71 DOJEDN
515,151,176 *3494216455F4568C94F37CC1D4EAF08B7A129517 DOMICILE CONJUGAL - KYOKO
515,151,177 *3499802B0E26DB24E1C4AA37B867B85E0C6FD04F $0K
515,151,178 *349FA1B318F7E16273AC0C0B3B3549C61C6F1649 DKTDK
515,151,179 *349CC94F619639770797FC886FB5D366E9441F53 DLNNS
515,151,180 *34926EEF6A8A9C7BDFF7E55367C5F39111F52C76
515,151,181 *3493ECFF6CD492ADB69305762EE0CA2BCF442831 DOQQR
515,151,182 *3494E0489F0D704EE5F9D24E7C4C81A2AA4EDBC4
515,151,183 *3496A339FD7535F3FB2A22C2554F30CC8D95175F
515,151,184 *349C012532DD6066FEA26E20663C8D25983EED47 DPS!+
515,151,185 *349255712CD89606E2CD56E9B4F73E9B92A786DA
515,151,186 *34947022AE811A51AE611CF27A9E41652357C3D0
515,151,187 *349CF6E2ABD5A1786BCC5C32B3C26A196548533A $
515,151,188 *3494CC091D167308F46CF83CAEAF92E416D31B6D drbethvantasselcomdrbethvantassel
515,151,189 *349C05B07333E534983B110029EBAAC7CB185B4E DRP2J
515,151,190 *349E5580DCC687108A959425F1BA477C59997AC6 DOOMARIZONA
515,151,191 *34904DE5B3CE574DABD9A7525E9167752E781C78 douggettys
515,151,192 *34939589CBF7FB08DD739FCC7798498862B24821 [email protected]
515,151,193 *34960EAA4F13A270F1641B2B2112DBE50A89567A DUCK118
515,151,194 *349701281DB0F4E33151AE21675900BD4B9A1CF0 (>_0)O~.d3
515,151,195 *3496740058F06742DC40BD9288C25F43F5928B82 d#-s%
515,151,196 *349BC2CA7B71633B2CF3138204889F7BB32E1F0D 1033954 SUOMEN.BIOLOGIAN.SEURA.VANAMO..
515,151,197 *349536DB1B10BBB72A585FF14AC4F06AB8A90ED5 DW7GA
515,151,198 *349CE93B11D3333C936972E31B0F9B682B429AFB eadgifu5
515,151,199 *349590853DEF93C69A6004190D4C34CB1D8EB42E eat-.
515,151,200 *349FF657B9E7879DCE081C3F298D6C397C5AD278 DUC)
515,151,201 *3498B20A3056AA95BE5CBC3A3FF432FC8A7A141B ECDIM
515,151,202 *3498C139AAD3591F8D2708A074A172EC53B0F8E3 [email protected]
515,151,203 *349AEF0917FEFEA933F74F2CFBDAA383AD5A5D4E DUPE7
515,151,204 *34957657FC0A4E6311B2E0A41BBF561BF0CC2565 EDUCACION.DE.VINA.DEL.MAR
515,151,205 *3490644DAEBB859EEAFD2D8A8E942ECFDF2A3EC1 18 BASKETBALLERINNEN
515,151,206 *34960E1C405329B75603914AE5B8C596D6630ED0 ee=co
515,151,207 *349E1E5E49E3E829AB69C73A1366ABF18B4E65A8 [email protected]
515,151,208 *349728344331DE6E07B3555BBB1D11913A2EE750 1 ANSCHLUSSSET
515,151,209 *349F803E31867D3C372EA45421D2A25889000FF0 ei/ek
515,151,210 *3498459ED8402D6EC086EE4463F4DB0F521581C8 EISENDRA7
515,151,211 *349015126C3E7967ECAB4E89435397700F6B2EBB 1 DELGIERTEN
515,151,212 *34909A95C0E695A0C3A701FF9E0E1CFC4FD3B4D6 ebev
515,151,213 *349CEC1D3224BD3FF5A47509278A6B02EADA2794 1 eduwaehlerschaft
515,151,214 *3499080B4E0FDB4D5FEB00F93C839B59E45C63DB 1en9+hne$$
515,151,215 *349D7071FCC63BF003EA8B1C92864417836B26D6 ecrouait.
515,151,216 *349E76EC071CE4EDBDD243172DC7C8226CDFDECB 1fabia01
515,151,217 *3497D84822E3D31EA5147FCD8DF59F2793D160FD 1halfloaves
515,151,218 *3499746CF43640B3E290C81D423B41018DFA6B7F ELLISSVENSON
515,151,219 *34908D578368672BDC3F7FA1E857CAF3FF81CCAB 1HOGGETSES
515,151,220 *3491962C8A7328E08C8B38497161E75C17F00204 1-katzenverein
515,151,221 *349C7C13A6AC97009D49565C25D00FB8D43C466B edwincarabello
515,151,222 *349B8D1BABD4FC87462D24D37885EE2F78C985C9 1LEITZINSENSENKUNG
515,151,223 *349EC214BC39EE9D9318DD71A1B56BFDA165E9B2 ELMERSCARBER
515,151,224 *3495ED13592C59C9707293C6C45AC3CB365A6B59 el:uk
515,151,225 *349EDF28EA4668379D43A83AE9538D9DB4A2E14B EMILDESIATO
515,151,226 *3494CF6D4A0EB0420BA544E8F82BE914A2A56E70 emilewickline
515,151,227 *34967592102D312B093A16FCD562D53290E756C0 1SPOPOLANO
515,151,228 *3493C2C23EF65FD3BB7A974F734CAE09071277A0 emily.arvin
515,151,229 *34950FB5D1D40F03DC4AEF7B15EDC8D76E4287CE EITV
515,151,230 *3494B5FA47D42D3237CA65EF329E7C73DBB1FCD5 1.telttakatoksen
515,151,231 *349942E8BE702D9A6A35F89C1E7D65CE64DF04C2 1-UMITLENMEKTEN
515,151,232 *3499642AC687EBA77FCA76E9FBD5AF50E848FF53 endereb
515,151,233 *349F02A949970BBDFA6C1BAE79578A7697E23A16 [email protected]
515,151,234 *349D49500B44CDC7BC1A8E26267B40692AFCCB8A 1 WEIHNACHTSFROHBOTSCHAFT
515,151,235 *349EB2E8250805F0BBD6A81D77A5D536FE9ED319 ELIEGOLDSCHMIDT
515,151,236 *349F769E924044D1C42576DC71C25DE604272E01 ENRIQUEROGGERO
515,151,237 *349B062788138789A00512D05EFE5545CE056773 ENSHA
515,151,238 *349FD5FAC81CF5B5B1F73FD7441B12031C3B614A EPJE123456
515,151,239 *349646E369335ECEEDBA6902038A53A645DB8ED6 [email protected]
515,151,240 *349DCC2921196365E5A59AF30CBD176AC65E5DB6 Erbed.sookhor
515,151,241 *3493DBC561B2BAC2EA0B87ECA007F06E8BF18A39 eredet iii
515,151,242 *349FEFDEAB7C74282BDAF53C031BCB58BFC45F91 esmu
515,151,243 *3491E36A0AF0E8252C36420841D7B480D5F47AB3 ERNEST.BOSARGE
515,151,244 *3491BF1D0F445DBEF313AE85E5C707930CBBBA00 ETJWU
515,151,245 *34970FA45F602B9B3CC001C53796B3ECEB431769 ev>\
515,151,246 *349680025E9558CAD83600040937ECE20D9D3381 2653510 YHTYE.ON.TARVITTAESSA.S
515,151,247 *3496D1DF132359D24C892CBAC93A73562C8B92E2 ETERNALLEGS
515,151,248 *349D07725C8176AAFA5ED5586F238E817E28B953 EXPANSIF3
515,151,249 *3495A4FC4C79FB6E378979ECF64511BC079189A9 2BMORLEY
515,151,250 *34974BA9535741781CA6AEBBC3A77DA22B73C0CE 2COLDKEY
515,151,251 *349AA7FC65F875F8563A730A343F3E00C196FADD 2.FRAYEDEDGED
515,151,252 *349F76F2013AE0BF46EB0131A5FEDA0394733271 2.grandedixencestaudamms
515,151,253 *3498910CFA59B7F3F58181B6BE647F28970F5D28 2MILLIYETLER
515,151,254 *349863BECCD7CAEA3744AC485811B03D2DFAC07C 2NNMMGRTN
515,151,255 *3498706F060AAA95AC62C0CAE0DA08FDFB888ED4 2.OERNSKOG
515,151,256 *349201AD9A5F666B47FC5E474EB329C3C9CEEE2B 2.primerin
515,151,257 *3493E770427C1DBEBFC863D4DB0DDE9689A7F952 ezrakonishi
515,151,258 *349B84907B943264A3E2DAE34B0474EE6113082F 2-SOVELTAMISALOIHIN
515,151,259 *3496E1BE5F81EEF0D1B777F73ACB42D21859C314 2steinfelsareal
515,151,260 *3490ABD9E4D9E7CE9D0A66842B844C8AD066E426 evanengelhaupt
515,151,261 *3490873A9B9F746CB31DA4C897F6D1DDA577F600 F4ML4R73$
515,151,262 *3498B031A09BAF8ADA17FCE428EE390B3002ADE6 every-little-stain
515,151,263 *34908CB1A3EE434DFA0DBCFB8BF3C8C76C6584A5 2А79
515,151,264 *3498C51011E718DEB00371F2B322CEF522B946A8 3B<.*(=====p
515,151,265 *349FA70EF1610DEA5495F3CEF5460869889CDC1B EYLPARAP9
515,151,266 *349DD6F0871E469C0D2B6C7AAFF142C763FEF099 ezekielgragg
515,151,267 *34913A8D6914CD611A4ECE70B5A0E5ED260F6B03 EZEQUIEL.NUCKOLLS
515,151,268 *349E58F229AE63DB4C00EBA0700C9A0F922FB7CD F6RT
515,151,269 *34949537A70501EDD98772E09816034228C308C5 FERGENE9
515,151,270 *349C15B6F6C4AD88A4406A2B65BB68A76BBEC051 FACI1ENE$$
515,151,271 *3493088850C5697964146531A6566FFEDE56FD3A FF11998899MM
515,151,272 *349D1D9CF5EAFD68DBAC1C2CDF7CA8AAF588DC51 fidelguarisco
515,151,273 *3491F28DDA65117DE316F7A89BD048C79C10F292 FIGURED160D
515,151,274 *349C0A0AA3A4AD7237B10EC50E2B8566BCBA5EAB 3MYBUTLER3
515,151,275 *3492FF3256250A5FDB49F1169604D18DF468CB53 3======P-~-~-(^_~)
515,151,276 *349F596BFE86193B5438E6A76B568C7243D30CE1 3X3CV
515,151,277 *3490D3313C290B4C53141F22CC978BCA8AD03748 F^(E
515,151,278 *349BB9290A66FBECAC2B17F1452DF6C732B44A13 48JAKE
515,151,279 *349D41BC2483E1430CAC6E44B93397C867516EE6 [email protected]
515,151,280 *3498378FB8B7FC7FB5F277DC5DF2B67E68386709 forhitherwillourfriendsrepairtous.
515,151,281 *349CE65CFFBA5592E9656796358DA6DE19E80700 4DIJ4MONRO3
515,151,282 *3499C893334AC613486CF460E4DF7B708A5C1F6B FORMATIERPROGRAMM
515,151,283 *34941EF17532609F839590B0829550B1C6BF5E85 4ERKYAMDI
515,151,284 *349338368F89A8DA2C3B8B1C0F368197E8AE90D8 4ETSDNEUZ
515,151,285 *349A64431A92ACF6B7753BC5D01B4F2A1D3736CE fortysix.west.fiftytwo
515,151,286 *3496A786836D97429E97467EEF1DA812AA8D9D44 FOURGING-THE-FURNACE
515,151,287 *349ED210E65695BA6A8E3618A232EB67ECA9F49D FRANCES.GALAVIZ
515,151,288 *34906ADC6A3FBD3C06F1113A2AE249F38171943F feil
515,151,289 *349B57470C8F0627CABB2E1E2780245091CF71D7 freestyle(knock'emouttheboxmix)
515,151,290 *34941C1DD0E21DCD10EDBC7637650B99A1883F93 FU8T
515,151,291 *349FA49B9917799E22075EC156092AA820CAF57D 4STEELNIPPERSPAPER
515,151,292 *349BC27C87C5DB2780B74CBD2681CC799B3CC3D2 Fire.in.tha.Hole.(skit)
515,151,293 *34993129A642BF980C8DC9D5E324E09379CAD6BD 4TENORISTERNES
515,151,294 *3494A42B95144BE40C6B1577A91E1E06C99EDA4A flying
515,151,295 *349A7A662214F886C75E4D3DA4472E1F7FD89DF9 GARRY.DY
515,151,296 *349FBD35296F1C86B033C32AB0C4B77FB5B74D8C GARY.DEKALB
515,151,297 *3496BD0F3D95C07A8DECC629F4CC9C4F900ED3C5 GAURAVSEGAN
515,151,298 *3497063AB648ECA5CF455AD9F2D42768CBA72436 fortielser
515,151,299 *349E366DC7F45AA672EA900D943F2160332B3E40 Four.Hundred.Years.a.Bumm
515,151,300 *349D196F576226089A274E3639C63980CF627017 [email protected]
515,151,301 *349E4C7E36D5B521C253AB71C030D49352E74A8B 5BSWKORNSTEINBSW
515,151,302 *34929CE72CB8961B3A97C76764ED7A4204C3C329 generavamo
515,151,303 *349E4E196979A069054C0CDD0BD403BF3E1A3DAA genselect
515,151,304 *34907B50DE5000DDAB223022851A1F0300A12D9B GERARDOSACHES
515,151,305 *3492557798E24913B1DECA1774275FC3075E5D9D FRANCES.BULEY
515,151,306 *34928C958174186F9BB5C940BF49BC13C954C7D3 GHIRALDING
515,151,307 *3495B4C00E1EB19DD3F7EF6E828176ADB3CBFA5B GIL.PIOCHE
515,151,308 *3493F6DE877A956B06EA49EEE1911852EB6D4F1C GINO.ASTURIAS
515,151,309 *349A6D3D694B6A361A760269F81E5349A428245E GIRL WEAKNESS
515,151,310 *349500BA42EA74ECC47BA34667C8325262687FCD GIUSEPPE.CATHERWOOD
515,151,311 *34994914100EFC1A5F21BD78632BB5CCE33AEF3B GIUSEPPE.ROMEY
515,151,312 *349F8335DCD0EDD60E4FD09F05AC0BBACA50FC80 5MENGEVAT
515,151,313 *349D765D2B8CB756EB091ACDC0557C179B764A1D 5myaptiva7
515,151,314 *349A738CE731B39AD74A97BC192B739ACB23EA27 Frems
515,151,315 *349F2A0B1B339AA68B64105C7C1AED9CAA0292C4 fritz-hirsch-operette
515,151,316 *349F3BD7F2C90E3C4983822F4E95A225158B9A23 gregmcmurphy
515,151,317 *349FA197AFEB842910931C9BA004762C360A1EF9 5POVALITE
515,151,318 *349C38904C3C0EB377219A9767D70FF08E9403C1 fsunshining
515,151,319 *34956F66771E84056B1623237DCCC78280D2947F GREG.ROERISH
515,151,320 *349ED47F0E2EF8D8184AD1B88D0E4076D7154381 fuck_07
515,151,321 *349B992812CCE68B7BE08E2E57853F0AA01A2E65 GUDETROS2
515,151,322 *349F12A70EBFB08A6EC0C596A43A20DAD7C02154 GUEVGEOSIAN
515,151,323 *349D579B128CB725FD956EFC1CFF7460A894EAAC :<GWE0
515,151,324 *349893808E2806EEBACFC9D290B776279646FFAE gxm*
515,151,325 *34914A429BDB3E04EBFB76FC472E0B130F5357B6 HAND IN HAND... MET JACKY VAN DAM
515,151,326 *3499B567CF6A9652996D1E1DDDD3D1D599E9C7A5 HAROLD.SEACAT
515,151,327 *3490CC4CF26F9BA0E7F24CBD06F070550C08C1C2 harrisonbowdish
515,151,328 *349515FB0CEA5E6900A3C9F755D87BD803E7497D HASSCNCLEVER
515,151,329 *349404B6CBB2EA9C02676FB0D50A8BC131875818 5TRIKINGLY
515,151,330 *3495B0580C86CD2EA705BB36EE76AB3D993B2D9E 612C6B1E-EE83-3DC8-96E7-B7A55ED63AE7
515,151,331 *349F30C767C8BE7AC4BD3404359BE3FB1CE1AEDF G143318
515,151,332 *3498DEF1454E4459B7610E89055BD74E511E19FF g4mesm4nship
515,151,333 *349A096805F119A407DB91FA67C062F774E98F6E GA­BI­NE­TE
515,151,334 *349C337DFBCBE3FD2163B3AB5AE3F609F08F1F38 6ANGELDADDY
515,151,335 *3495D714E2889559C3F1222E9B6F3512741C5A3A HEATHSMYERS
515,151,336 *349F1FCD3B178BFA3F3DFD39EA3C72DC296932B5 6cad-seri
515,151,337 *34917720B243AF5F64BC288561E3DE38C9ADA7A0 HERKUNKFT
515,151,338 *349FA48F8185780932E2BF7E1392E3AEE53B6CFF GAVIN.SAHLI
515,151,339 *349AC3164051470B5441D5CD52341E6E6919CC42 6JIJIGAJIJIGA
515,151,340 *349C13377FFCA6CEFCD19B8692A2C7F6F3752DD8 HEUCHLINGEN-SCHLOSS
515,151,341 *3499B4E4E84D95F4796A2C883571B365E2942C1F HILTON.PIZARRO
515,151,342 *34904AEF1E4D2DE874117B708AF946ED471681E6 Hit.It
515,151,343 *34976945964B0C661605ACB82623F0B5913DE760 GCW7
515,151,344 *349F171479601535FE01CA41BF8ADAE409DD2C52 HNOSSONI
515,151,345 *34934CD748241FEC3282942C5121BEFDB7993176 gekloven3
515,151,346 *349A0D9EF791BC123A30CC21D931EA735B589355 [email protected]
515,151,347 *349CA19AA08419BACBDB1B644FAB787FDA74AB6D HOUSTON.PATRISS
515,151,348 *3491D2DEC4CE26CE1181E6A546D601EB91D6A3E4 6XGXXKSO
515,151,349 *349BFFEC2E8D3E191A39BFA86D7BBD1682344E76 howardtheduckthat
515,151,350 *349E7279DFFC7D515FDAAB1C33CDC09877E02B7C httpabdelaalcom
515,151,351 *349F72CFE7BADDC0082E4C7A81AA18DE0879D349 781334 hurd.sayfa.:.7-30.,.newyork..
515,151,352 *349DB07ABD0BA2F9AB78E274A3ED4D38C3C79EC3 HTTPWWWGIRLSCLUBOR
515,151,353 *349A0623A18900D840C600A5D25016198CD36947 HTTPWWWPOPCULTUREPR
515,151,354 *349A35322582B94194775CF19EDF7BABD609BA9C hu233ba
515,151,355 *349E5075713AA0C0B1EAD5C5FC0881B0A6ED756A huizings6
515,151,356 *349F1CB9530AFDD9BB8A149132A9D19406B57033 [email protected]
515,151,357 *34969E91C407CAE7596E99A7BCB2A274934BE68E hygienic
515,151,358 *3499532D324F7C001E360BCB932CD676C30C8E77 7GAGNENDE
515,151,359 *349956CF1D829A21E7B46674F019FF32D0DD5382 GONZALO.BLOOMFIELD
515,151,360 *349791E775DB204DC2611A6057733705A1E9A932 I0!W
515,151,361 *3496EDA3DBF63174AFE4DB829DB1135038557A67 7GUTTURALIZED
515,151,362 *3497CF5B25F4030170D9F8B57D9CD3CAB1F0BAE9 GRAHAM.QUARRY
515,151,363 *3490BF4DA435E73B7D372616A5B46B96FB9DD6E3 iammaria2
515,151,364 *349F20AB6848DA644A06E433DDA55AF9E7799107 IAREICNE4
515,151,365 *34953A3E27065E190947AC558E8E87F1E85A068C GRISELDA.JUAREZ
515,151,366 *34959A98C4F835E5AF1BF7A719B1F5CD76AD3BD0 I.CRY.A.LOT
515,151,367 *3493BA72204B3A52177E3798757A6CD9251584CA IGNACIO.KAUFFELD
515,151,368 *349D9BD59614B241575C79BAC254313277802820 GUAKAORGGUAKA
515,151,369 *34905F9B3988CD96871A40249781BCF756D02837 GUEMBDCQ4
515,151,370 *34971314CA1367DF8D4434410AC3388863FC4150 7WISDOMBRADLEY
515,151,371 *349B22F5FEEC6ECF2ABA56512784CC3A2EA59A3E guspetrik
515,151,372 *3490E38AE42A802CD471E5FD486B88AD1EFDBFC5 ILLUSTRAIS1234
515,151,373 *3491840C45A65E4867166B29531DB60D4B7D9541 [email protected]
515,151,374 *349A63B9BD436AAA4D25E76E1ABCCE9A12FBFB58 822012 HIV-INFEKTION.HOITOON.LIITTYVI
515,151,375 *3499106783EB2DCFB561217B5BAF3E1B903A4625 ILUVORCHID1988
515,151,376 *349AE707BD3EC48211EE6062BC1881A846BA9891 [email protected]
515,151,377 *349C81B1F2B9FA02CACA75B802D4419C7E7D4FB2 [email protected]
515,151,378 *3496F7CAF6755E1EEE3DEA061BEE0E45354952F4 impalaledzep
515,151,379 *349E8BF6EB3B0E9758FD319772D30F11EB56BE7A HANPLANTORNA
515,151,380 *3496EA9D639EF46F5C788F7FAC4F3B41D1330EB1 INCULQUERONTS
515,151,381 *3499E38C1E003573BFE1833D87A2FB9393B5D73F HARLAND.JACKOLA
515,151,382 *3494F12F605E4A5677A4966D0569C0513F818415 8COMPUTES
515,151,383 *34918E3B736466AE47125A9504994E06C513068C 8###D~`>-<
515,151,384 *3497D0F2485F678FB174C33CE9A1156848F701AC HA-ZA-QI
515,151,385 *34934CD15975AF274E68D4CF4FCF944C9D3A5D6E 8ITEMSETBSW
515,151,386 *3499670E4CF95F9B394A133C950BB99B6BD1B825 8JURVALAISILLA
515,151,387 *34907C371313D46B6539FBEA99002763E41B77A2 8LEDZEPV
515,151,388 *3492C948571DC0AA823828BDC3E43CABDF561326 HEINSTENL
515,151,389 *3491C513E512F0984F70444AF7F1FDD57BA22A42 8MYGUNNER3
515,151,390 *349EF136960FF8BC45F328A14F3CA0A956379A0A 8o0kyy
515,151,391 *349601AE1DABE11CD87D599B6D6649A48A23DCDD 8OVMBERE
515,151,392 *34944B3113CCFC2ABDF222AD707F07C2EBF7CCB5 [email protected]
515,151,393 *34958B747098AAFC58B52EC771E9FA9446A85141 HERB.KOWALCHUK
515,151,394 *349EF214C191EDBAA770A90D2AB20C722D340776 herefare4
515,151,395 *349095DC6214C9F0106185C4F4E28424D31A2E86 8POMANJKALE
515,151,396 *349453C5A7783D544AA0DA1ED34332AD1472CCC9 hermanarriaga
515,151,397 *349FE892C8557235E7ADC646F294DF5D910D73CE HERWIG--HH-ER1-W-IH0-G
515,151,398 *349D5361F4376AA40F7C5A8A1B7802E31ECDC29B [email protected]
515,151,399 *3494EDAA726F57F571D8E15F991BD491C3A95A8D JAELAGROON
515,151,400 *349F4E206BCF9F1FCA090806A6E54E268D6CBC68 JAK12345
515,151,401 *3496D21C9C33C976E456FF43271B7CD92E3AD881 8sphinxes
515,151,402 *34952FBF457B2274869F15CE5A5148DCF8E6EE01 8TWIRBHBSW
515,151,403 *3497E914CF97465CE27274559A0624B17F272C53 JARED.KUBO
515,151,404 *349C688549F8611D41149ABCCA59ABF5CAD9A0E0 JARODATTIA
515,151,405 *349FF99E7373816BE95B306EFDBAA8FE8FE8729E JARROD.COONSE
515,151,406 *349E203E5AA9EE123C496752D003276D7B13EC26 HJKQQ
515,151,407 *34946DE88DCF738127568FEBBF177940B438E10D [email protected]
515,151,408 *349B6624BDAA063EA9A05AD1C975CC8993CBFB51 [email protected]#$%^&*
515,151,409 *349B55B109ED4C4DAC9ED896CD291BC2E6D111BE JED.DUXBURY
515,151,410 *34918441FB0A621365503B52C9E80D1A98FF30AA hollydoug6
515,151,411 *34956D3DD091514CB3AC644AB100061FCD4B061F JEM.AQUINO
515,151,412 *349742300385DAECCBE2F58F4713943858E9EDCC JEN.MERRILL
515,151,413 *3491E162716F06E943493AD429D60A5C87363FC0 HOOKEPISODE
515,151,414 *3499C34237FBE8F747481F58A9FC7C607F132F61 horacecandle
515,151,415 *3499D25E3639FAFD41987E24C6BF641FB9C5035A HORISONTALFORTELLERKUNST
515,151,416 *34900721DEFE76E8F06F70C32DE320D28E066C9B JHAIIJ
515,151,417 *349DE51B570EDAACD06344FE62EF24EAC004D9AE [email protected]
515,151,418 *349763B4CA0B31F0DC4DF007A85357A14E2B2310 9GWABEGWABE
515,151,419 *3493FDEA221C7D5DF3A63EC8316AAEF3AFD73587 9ILYOHJUS
515,151,420 *34949FC9CB11CB0BE03C983B4E1493BEBA492333 9KEUHKOTAUTIIN
515,151,421 *349931F6AD44577CEFADAB700933A136723564E6 [email protected]
515,151,422 *3495A21896C53F776BD1BC80C0D65E3E52CE0FA2 jJ"
515,151,423 *3498C671E3EAAC16ECA5DBB642913FBE60A216D4 HUNG.BOTTERBUSCH
515,151,424 *3496007DACD95526585D1724F3407F7A1A3006CD JOHN CALVE
515,151,425 *349BC8A95624CD19E841E7E26FE40C2BE101D814 9WOOTLOOT
515,151,426 *3498969D3C32C0797652C608D111595B7F1FC462 JOHNSONPIZZICO
515,151,427 *34996A610E898EBCA4129F83F56C1DC63CF2CAD9 hygienic
515,151,428 *34989D1CAC1DBA7D8359AA044CF75804C50A6380 A3GFQ
515,151,429 *349F9A5AA11DC7B019E101ADB99C55861ECED08C jordanmorocco
515,151,430 *349B2487E14BBC33E1D338DCCBDE554FB40A44E1 >a/<>"61meti"=eman.a<
515,151,431 *349B3A308FD70C98DDEFA05F976AB23A35370CF4 A6PHI
515,151,432 *3490A3B3A7F7ECB1D2BBEA24BB666AA49594B756 a7abm
515,151,433 *3492025988A0E9ECA4F038977B17DAD8547BC729 a(8!8
515,151,434 *34954478DFB473DA2C0E8FD5770E20E814C15BC9 iansayavong
515,151,435 *34945FFF6DC65DE7FA80891E477DC68A5F357ABC joulis
515,151,436 *349F5FE02C430E99D256F424E27FADFE9D1EE3A5 juleouscervantes
515,151,437 *349E1BFD5CBF6DB9E256EB7CD41D7C1FDBF8FB45 aaa_+i
515,151,438 *349E77CAFFB69E648179F8A87B963191E9C52485 ilovejerry777
515,151,439 *349FF35783A1B4A826C14E97A8F52DCD1FCFC968 ILOVEPAULA2007
515,151,440 *34994EB39ED90A3E2DAD78DC414B1FA009FE458E KAMNINAT
515,151,441 *349611BBE315C456EA899C19D038BB094F409C3F KAREN-DELLOW
515,151,442 *349CF8EB9C895CF3DBDC6C96B7B78EFA683614E0 AARON.CHOJNOWSKI
515,151,443 *349B476BBF93A67DF269301F912018BE0CDD5233 kashwitna
515,151,444 *349391AB9CBA8E09250470167E2D4FF805B82B22 KAYAGUMU
515,151,445 *349C2239F54F974B841779621CD6DF76A19572D1 keenanjordan
515,151,446 *349D8A86F331E0544A63DDA42BE98345506CA2C1 KENNBUCHING
515,151,447 *34960144E95AADF51B6C8581E738E6EC3DBB5C7A KERORO201
515,151,448 *349D3C0499705D8F641FBD85E0A36913771986BE IOYOMBA
515,151,449 *3494A87634F7D8DB97643F50B6682BB2FA13B2DB irwingravat
515,151,450 *3493C641F01AFF67BD59702A049F0C3F82B920A9 ACQUEREZS
515,151,451 *349C92B409AC4D0D7CA69019C37240BEE980494D [email protected],
515,151,452 *34959201D659499D8D7EC28DE8A70BB784804144 ISAIAS.WILSEN
515,151,453 *349B10681F2109E40F263AFE8DC8E758DC5B03D8 KHESANH4
515,151,454 *3493736217766B775068CF84684E330BE13893BB ISMAGOMEZ
515,151,455 *34951E243B5880B098EDF6C8D3BF11C10FB34EA6 ACT III: HEIL MIR, DASS ICH DICH WIEDER FINDE!
515,151,456 *349B01C7BD11226AD72F9EFD1F5437F76D4802A0 istrgnu1
515,151,457 *349F1DD876176D9258653C6F2082C05B0DF3AF5F klezmer rondos for flute, male vocalist & orchestra: ii
515,151,458 *34935D0E22FE5A89BE6B15F939AEE0797AAC934B [email protected]@ze5
515,151,459 *3496931EC17CDEC006037D487F4E09C5A21718BD AEGUY3
515,151,460 *349B7F5960C9C2CA302B704831A144D81EB3BC4A koboye
515,151,461 *349FA932E59EA445AD9EC3D1EA253A24DFB39486 AFGANGSKLASSERNES
515,151,462 *349F018F6038A2FABCB882AEACFC33B446E5DEFD KRANAATTIAMPUMALAITE
515,151,463 *349F8634F5EAFBF4C9EA108F0AE058DCD74B1A5B AGILLIV2
515,151,464 *3494FDBD2BA375AF3423ECE44C1DD1671D52EBB6 agustinbrasel
515,151,465 *349D94C424574B5CCFA1B6FB6114AF20FCF252F4 ah3),
515,151,466 *349EF515147D56ED81F94FE9F71EFB700BA34F35 JASON.BALLENSKY
515,151,467 *349361502060490432F793A49B1111020DA97D78 l7k
515,151,468 *349EFAE0676001C099019FC8FCE19B3C7F3C8BFF JECYCHAN
515,151,469 *3495D20A3A10624B48AF101EDF038E87603B4239 JEDLOVNIK
515,151,470 *34940C82914CBA9780246E00AB37304A243EB73D LANGDONS5
515,151,471 *3490A4565C7E3C96FFB1C48AD78F3B4A66451037 AKNGI
515,151,472 *349498C0D094DB249D70F4F922A3B7F4B888E699 jerryantwi
515,151,473 *3491360FF69B4CC6864571C703BF72646945A901 alexzander959
515,151,474 *3491DEFDAFC2D96DBE5209DD7D6144D04BCEFAA9 leifpomfret
515,151,475 *3492D6FCB59B016CDC41F2DD6B70FB3934CD26B5 alicia.buckelew
515,151,476 *349822AC712063EAE23BA8115641CA9E07378443 JIM.MIYOSE
515,151,477 *34980B7C0E00B602D86901D257B3E9D05B115E37 LEKTION 16 -
515,151,478 *349F59F58E1068FFD39CDA3AF59B8F0995375861 ALPRISBREY
515,151,479 *349E13F66C1B76F8665844B1DF5016EF3CD00A31 JOHN-H-ALLEN
515,151,480 *349454E1E397C3CF0AE8347EB7452577820DD505 aluceplu3
515,151,481 *34911189C0452B746E944B9F3AB7F0F7C936BB9B ALVATILLY
515,151,482 *349AA814107016BC421A33D5CBE65EE49F069400 leroystrose
515,151,483 *349FBC13F90A4D0A6BA5DA86D8418FAF9CCC433A [email protected]
515,151,484 *34911B7C763774A3CAF056BA6FB1FDF4AB9769D0 AM1C3
515,151,485 *34971EDBDF345B48ADB96C9B0385BB2E090D6A17 JOHNSVENSON
515,151,486 *3490E0CDBA8353AB9BF486E5068773F2F133A9FA jon.ed
515,151,487 *349311A4D12A8399C77B91578A44330979E63C55 jose-nataren
515,151,488 *349DB26405646FB412A3D5B024C7950258766EC5 JOSHUA WILLIAM GOODWIN
515,151,489 *349317D5E1461BDE2B3A1D8FEA2BA6E2A90C035E JOSPEHSCHUTTER
515,151,490 *349D0E779894E151D94AD0602CE844253459C131 AMERICA.TO.MARS
515,151,491 *3498F35028EF56E783284F651C14BBF9C2AA4F8A AMESHIA1
515,151,492 *34984CA4E2EE3E0C27965967A026713F601002AC AMORSAL
515,151,493 *3496F434755B6DD51D4EE5A23AC4FEA9876DBA8E AN71$3P71C$
515,151,494 *349668389E9FF3ABD551B957C3D75007A218C385 LHKD
515,151,495 *349F0F8D9F5EFAD4D9F9CFB41588A3879079367E lhzi
515,151,496 *349152B4956BC2551EDCA5C59DEC940CA0BBAA76 JUAN.ROUZZO
515,151,497 *349E9C99361546DADA83E5CB09D3874CA53E1A75 [email protected]
515,151,498 *349AC1ECFEA7EFB4FDA6B78887BFBD452128E0FB LIFT THE BLACK VEIL
515,151,499 *349AC877F4582F3E942197E537F93EDA937D20F0 ANDRESSHUSKEY
515,151,500 *3490DC6143E733FBA22984C1C842DD66F8755CC5 juliet.nakato
515,151,501 *34982E9556BBC6B2E5BEA9612FE9F4DF689A476A and-slain-in-fight-many-of-your-enemies:
515,151,502 *3492956955E835624AA31F7E175B6DE18F637D4A [email protected]
515,151,503 *3499C89C4961F6D5D4F3B5028586E0428FE60761 anjuraina
515,151,504 *349CA04680D248D4A4EE353EAACC428B5A0D8950 AN/&O
515,151,505 *349DD7AB7BE920DB7B05C71597331AC8124552E7 kalmaktaydilar
515,151,506 *3490B34A3D33D5694A8707454B2183B5E897D4CF KANALENNED
515,151,507 *349773424B1CEA2E50C98F19701D97253D08DFF2 ANTOINETTE.RAHMING
515,151,508 *34950C96A5D6178946320841689AE3FF794C0DF2 ANTONBODIN
515,151,509 *349A3374D80FE8C1031A063255A0831DEEF73CF7 LM600425
515,151,510 *34911656637C450E0A7B4E7EE5923585E27999CC Ap$
515,151,511 *3493223118030FBDB52D2B1F6762A7EC1BB622C3 [email protected]
515,151,512 *3499F8EAB8DB70BDF6BBEC18E83D8D3FB9C75E8C KOBELUM
515,151,513 *3497519F4AC689C46223142C070ACA7DD2795D7F KRIPTONIANA
515,151,514 *34934CB77936E04283C44101381731CC828498B4 LOYD.WAIAU
515,151,515 *3493DBB1DCA46DFF918696010DEDF355E80F81BC KRLOVNA1
515,151,516 *34957ADFE60AC6BC2B5C3F6738EE022DE8302C60 arunrkaushik
515,151,517 *349070717008DF96BBBB9EC195CC18B9904B1A69 ASHJOKER
515,151,518 *34958026D238B7C76B491469508295CC169608B2 ASIRADIL9
515,151,519 *3494F12B8B32BACBA0A412927FED68494980BA12 L74433
515,151,520 *349715F005208F9A53C11FDE50295D389F5A221C labelsinc
515,151,521 *349FA3CA058688B0A802133E3527DD58F3093662 lakeside05
515,151,522 *3493BF78E19495140258FB95596A9F5143AACF90 [email protected]
515,151,523 *34953CDFFF1B3CC18237EB09B4C9FED130E4255C LUKEGAUNCE
515,151,524 *349B3C65A15132ED4A33CF24FCE6B1DECD8FF4C0 landofhopeandglorycountdownovertherainbow
515,151,525 *349168EA00A4987909DD9B8CDF0D38774BA11C64 lapazphylus
515,151,526 *349A39F6056BD7923759247E20F9C605FFCE2474 a?t5b
515,151,527 *349BA795822083EDC012055334431A5EFB78663C AUGUSTINETOWSON
515,151,528 *34979554AAE2AD1AD55A28EBF63DD5C3B8CD82B1 MACHARSKÝM
515,151,529 *34924C32ABCF7FD771541E00049E1E3AC03E9E43 MALCOM.BARNESS
515,151,530 *34958F0463C9DAC10022D011F31E7B5A3A4F0234 LEONARDO.GILLYARD
515,151,531 *349202D7D2B087A8F842BF5FDD3337893E7ED8CC mall.women
515,151,532 *3492BEA5F66517EFACC35CCC3B93B173CB485146 life_time
515,151,533 *349615A9780DB0FBC96261C7D813EE28C253DBD3 limak
515,151,534 *349C53B4D8D2D720457470BF353F1CEE63789FFB LINDSAYSIMS
515,151,535 *3498056725FA7B125C5527391AEE435007451C8A [email protected]
515,151,536 *3498FBB002BB865550C92DC60D585439CD43D2B1 linwoodverkamp
515,151,537 *349FCF9E12B7E585FD09EC53C23E400DCAEFB7FD LISTIANINGSIH
515,151,538 *349C15770D477E74A8615492C686366322D25047 marcelinowisher
515,151,539 *34953D697CD6130558F0A6D95E638000843EBF3C MARCEL.KIRKLAND
515,151,540 *3491D9C17E997CD3A3351A8CD175073D0C55E399 marcuscooney
515,151,541 *349E592BB7BDB4E299A4A24E4FE778A6629F8442 lochamys6
515,151,542 *34937706FB7CE794FAEB2B59959F2D7C24B42765 MARILY20490155
515,151,543 *349A3B6645E7116A1FBA074E944944408E4D0401 louabelman
515,151,544 *3498AFD008E0D6580797887A22359DCC74DB3864 LOUISE-NORDIN
515,151,545 *349DEDFED5B046358A38C4073B39293A0288B168 LOU.TEVES
515,151,546 *34912BEE2CC6581753DFFF6D4DFB16C2BBE7B5DA love-2-(disc-2)
515,151,547 *349E96F596FFE3FD82777754497B2F313B2D4802 [email protected]
515,151,548 *3494CB1C472B462EC938BBCFC9FC5DC278F85865 [email protected]
515,151,549 *34904546EED2EA4E66E29161123D1C0DE33D5050 azl
515,151,550 *349CC0163E60F39EC94E53FA5FD98E3D06A7A1CB ltbrsnrt
515,151,551 *3493093738A5B544065764EEA4F9CAE9B4D8809C luigimessey
515,151,552 *3490E800B9FDE1A40F1B5D3583A745962289787A [email protected]
515,151,553 *349085006866B875102BF2E3993AFEB8BBBCC42A MARTINGASQUE
515,151,554 *349D677D3F272DCD6A49EFE52D17624EA9A3EEAF b48kd
515,151,555 *349BEC73867E6C119551D7D990C2EF474E31A14A B68J
515,151,556 *349D9EA19D4847F9550F0567047949C585821E18 [email protected]
515,151,557 *349CF40437778DFF54763FCECADDBFF0C302E3F9 mehmetbasha
515,151,558 *3490E6E3A922567F0F62027CACB1416F7A3F67DA [email protected]
515,151,559 *3497B93B44E2CB148A2106A3A42942CCD607518B MAJOR.SPRINKEL
515,151,560 *349CEB55EE1A81FA0807D8D1C36A6F0D53A1E646 MENARD'SDUTY(TRIBUTETOZOMBIE)
515,151,561 *349EE4B4253451E0BE196039AD425DFDA2E99E72 MANHOFBAUER
515,151,562 *349BB7442E3F128F1AF6053276A7445CA9B5895F manoj-manickam
515,151,563 *34976146E990CC049C293AE3E305E6AC5418CDAE BARBARA HOHMANN
515,151,564 *349668B8C409258DB0E410845DF794969505B391 MANUAL.CONDITT
515,151,565 *34918139433E37C9F0F26BEDE7AC4B9C551F9065 MICHAELBONVENTRE
515,151,566 *34909889B2B6D0209A2944F1454FE84E62BFBF32 MARCELOFERRARI
515,151,567 *349D25DF27688C23CBD00EEA98B52B7553568693 michellrosie
515,151,568 *349E312724088698732A905BFA5B68B20534C3A7 MARCUS.AGUINIGA
515,151,569 *349669334706B5BDE1BC1230BA8451FAF112FED4 MIELEISENÄ
515,151,570 *3491317CF11B25B2DABAAAEB0DA7AB2C0FA02A86 [email protected]
515,151,571 *3499F6EA469BD99C6EE01D4EE861946E4D51EE55 MARGARITOBIAS
515,151,572 *349196C8EA690AFBCE0CF0A8833F03B8956BC478 MARIA.ALLEN
515,151,573 *3497C169A2EC0C0D46797FC19789482E9E75A26D mike.yegge
515,151,574 *349AEBAF8C8E6F12B09EF85CBE145E006774713D marshallroadcap
515,151,575 *3495C804F94E2EB3BCB9DB9E81706E873D1380E7 milos.momcilovic
515,151,576 *349537999E7FE662F3311C8CFA5EBD1F64E916AF [email protected]
515,151,577 *349D3C6681B1BC7EB9DE99B0D5690C931B5570CB b:c!_
515,151,578 *3499E45E404D2BE49E5747234D1A38F02EA557DE MASKET&MULLET
515,151,579 *3492CC5AA58F2C6A0CA7DEA19FD8C0BB09DE9BB6 bdo?;
515,151,580 *34978D61CFF2A1106B08818C1924A8DB5DE53656 modestomcclee
515,151,581 *349509CC229C73A3C94527E519B904738D6E5585 BEAUHERZER
515,151,582 *349D278D370845DD4423F081AD2382422CB3D86D MOHAMMADRAIMANN
515,151,583 *3497737302D61C36BFE27FE36FD6C34F4FD067C4 BEFRIEDE5
515,151,584 *349DC10AECBB86DEC496252A492C2FDA87B8DF1F mattuglum
515,151,585 *349A4BD6FA0DAE663F0CC82E752A193B56FEC186 MAUDITFRANCAIS
515,151,586 *3490172E7C453250292EA9DA2DE40AACE803FDB3 mauricehenneberger
515,151,587 *349DC5FCA84BF14F4A0F7364DE50650E64532820 MONICAQ0
515,151,588 *3493754145D3585F6A337011737003AF17DAF4ED [email protected]
515,151,589 *34920D57744227C22C6EA404CEE223EF4F1EB070 MAXWELL.MACKINLAY
515,151,590 *34986CED08D5F37F2F37222EF7B9E7C9725E04F7 belly-beaten'b/e/l/i/_'b/i/t/-/n
515,151,591 *349B182BC54F9D2F1B696BF84B7CEC5DA5F35013 Ben-je-niet-alleen
515,151,592 *3498064A4A8A1E04BC2F1F0F4081AF5A118C26C5 bennieroses
515,151,593 *349F2719D35CDE13EC3C3D8257E8650485D0126F berceau2
515,151,594 *3498E67C56DCF67649B28E2F42E298CBF41DE893 BERNS-RODRIGUEZ
515,151,595 *349B2E01B218F81909D8D1510C468795475EA582 meineid.(18)
515,151,596 *3499337B56403DBECEE024A675BC018F8C2ADD9D MEJORMEQUEDOAQU
515,151,597 *349C3FAFF76C690459245F2E77E9E1EFE52D29E2 musicradar
515,151,598 *349D24445D673F05434D88138CDB08FDAF462ABC mybootsie00
515,151,599 *349C7D7956968654717753B8A934273D3CBC957D MIDNIGHTTRAINTOGEORGIA(FINALE)
515,151,600 *34917E72EEE6204439331C5F09AAFB656B28A31D BIALAT3
515,151,601 *34995E4AC6DD0ECA011D6C54E0AFFD5BE3D767F1 mike-gerrand
515,151,602 *349552C4644126297E00BB3C59F289D40D351030 MILANBUNNELL
515,151,603 *349C75B01A5CDF786BFE6D5C5B730AA31F50F0C0 MILANMCMULLAN
515,151,604 *349A70012FE8E5EC8CEFE08E91B42FCD83D6FD0F nakita.laprade
515,151,605 *349D8135FA9DB693AC2BA61B2D5BD596692319FD NAMESDO
515,151,606 *349FF2487161C6AFAF0912289826949CB799C830 nangcas5
515,151,607 *3492F7F59489206B79B771CCB1631FC1487B99B8 napscozawww
515,151,608 *349923CCB5734DBD72A079809FEBE0D7D8FAAEF2 NARENIF4
515,151,609 *349C7A02CF5B085308CD9FD100FE924C5AE0767C BISNAGUEM123
515,151,610 *3493C67CB14E92153E15BC9226D9CAC85F0B96FF bizarro4
515,151,611 *34984C769D66074168C8A7CCDD24996F5BC27256 BJKTF
515,151,612 *3495D3BDA78E3AC86F2E8DE3D1B1910413101446 [email protected]
515,151,613 *349C22B61887AC9EC0C7C99450EA040F8687DA17 MODESTOAPPELT
515,151,614 *349696B90216CCB65529760FAB17F6AF0940A5B2 ndxz
515,151,615 *349DE939F19399A3D55B466C7DD4F62A7D4E100D blunckett4
515,151,616 *3491CBB946B5BFF928938F5E52CD599BFA0CB62A [email protected]
515,151,617 *349A6EDC756D5D503AB9BC425BAFF096C7A50ABB monlezun-3-0
515,151,618 *34910E380E987BCA5B43BEF727E9DE20CA297F7B bmnb9
515,151,619 *3497D9CDF192D7708E9AA89DCC129BBDAC5A1A67 bnazd
515,151,620 *34911CA98300FAE1EF55B455334493B118C03960 BOODV
515,151,621 *3493A94A50AA6ACBE5B9A999C6F03CFCEC8284AD bost1
515,151,622 *3499C9486BB055079A4A939012A8CB6B926A3767 mutterins
515,151,623 *34906A026156DEC600B471BE50F19414CD5E54D5 nimisuunnittelijoille
515,151,624 *349108FC872564F679FF3474CE2E04F541922DD5 NAHERG
515,151,625 *349A0FD99CF143F3B6715B843EC4EDC1E5814FC7 bradbattiato
515,151,626 *349977A8EA82AB6178E813F5F1989D735947683D BRAD.KIGHTLINGER
515,151,627 *34980A740F86A56BDF2EED95F06EB80445BC59C9 noahloukas
515,151,628 *349DAFC6ABCE72671C597D96CB98A260CEBDE423 [email protected]
515,151,629 *3494ED1D88E8DEE5C365490F6260A3BA101C3D65 NAPAISUUSVAIHDOKSET
515,151,630 *349EDD589C1D84D0086E295638B8AD0EFFEB13F3 !NAPPROPR!AT3LY
515,151,631 *3499EF92EDC2FC97EC77443B8EAA32AD411A6067 nonpersonalized
515,151,632 *349E185895DC894F333BFDE3ECAD5F86B059B740 NORBERTO.HALSELL
515,151,633 *3496472E1C3E330915B81DC8161C67DB44549812 NATHANIALMORROW
515,151,634 *349D04554F427457FF3AC0D265C187EA31589789 brian.bostain
515,151,635 *349DDFD0B288CF2ACFEFB5158BC7A34BFB390FD1 brigitte.mira
515,151,636 *34923CD5624BF69778F5D27944677E987EB1F5D2 neladnav1
515,151,637 *349DF330FD352872810365436A1C118731258D7A NEWS1250983
515,151,638 *349E002ECD3BC13C3B82083A4D05BDC9854F6AC7 bs4_k
515,151,639 *34928CDAABE231B9C110568138BBF590E7383C61 bstrddl8
515,151,640 *34976827064E0C261D22BF6FBB5210A69C5C761D niminy9
515,151,641 *349A403AE4330A9BA4CB648812A12CE18DEF39CC BU1_A
515,151,642 *349DF4D561EA51B5439BCC233607B5E48A1E1FD7 BUERCK160
515,151,643 *349457E68E313CF703D287873560B2A0090C4E81 n~数百mev
515,151,644 *34937A424E46FCAFC72129DE10A977C13EF6711D OBSCENER2
515,151,645 *349E659F2D4C21D8DF0434323FDB7DC3D4FFA98A OCAUADIA
515,151,646 *349D2A7CB72C3104CEF4A9DA197F892EFB323A18 BXD2R
515,151,647 *349030CB629C98C443F99C54AE69BA43E07F95B1 NO-SECRETS-(ETHNIC-VERSION)
515,151,648 *34944800B077C4519BFD79EC4A8464A8115D39FB bydvn
515,151,649 *3497394D65764285E3C6F8526B10F344AFAFF760 ON.BOARD.DIAGNOSTICS
515,151,650 *349A178D3E1627C947B9FBACEDD76E5F74D934F1 ONE LARK
515,151,651 *3490222CDBF89857884272A85DFB0B7C9EBC4CF3 >< O~ 0~<3
515,151,652 *3498F9997A2F05F8B22220DCDFCAA7B0E6446702 ophthalmitic8
515,151,653 *349D695C6338F612466324F1B0ECB32DAA3B586D OTIS.CARTLIDGE
515,151,654 *3499319ECA0217E8395869C1F7494EE179578C25 OTSONIOHENTUMAN
515,151,655 *34900F869F751285885B6EB7445BC732444032B9 [email protected] * * (><)
515,151,656 *34910DF53931828432BA02C8683C4F8893F0AE68 [email protected],
515,151,657 *349D712D0D832FF97872F4E9D55A25CADB81ECC7 PANIFICADA1
515,151,658 *349F94B329EC7CFC1A9247E71A8C88E0A1F06E4C carmenprewitt
515,151,659 *349BAE49B28003ED25BE6A34B1054661C33B813B CARTMANY
515,151,660 *349FDC4579A88C0A36C56428F62E0EAF9452ED8A oscarfahrni
515,151,661 *349C6DC1698E669EA7AD407534C99B31742DD098 CATEGORYALANA
515,151,662 *3498EAF72B881FD0AAFDACC57939724BC5456EBE ounacascadaenel
515,151,663 *34940EC32F3786BDFF72FBF816FD9E83310B9202 CB_0R
515,151,664 *349DD87A7D1344113B057754C180536C06629C99 PDTRD
515,151,665 *349D65FD019B53A9A6FBFAE37B81F6C8CE07CA80 C+DJ
515,151,666 *349E471D0203297C481A95DC8E259046ADF11EA4 c:\documentsandsettings\firexware\localsettings\temporaryinternetfiles\content.ie5\ozs69o0s\star-right-on[1].png
515,151,667 *3491ACFB89624F2E8CA6567BC780E72E5A5A30B3 [email protected]
515,151,668 *349358AF98EC17DA500280DC0DC1124AB069E084 CEMALETTINK
515,151,669 *349CDA48E6D13B82CE8DCC9D40EE2E3518F295D4 percystrider
515,151,670 *349CB5FE111528773A049272FA6B961C72764242 PHILWARRICK
515,151,671 *349546B3867C9991AC12876470B5F72071669164 Piano-Sonata-No-16-in-B-flat-major,-K-570:-II-Adagio
515,151,672 *3492DFB4D589FF8546FA561C5D0B863ACE708128 patravens
515,151,673 *3497E78EB846E9559A5DBF633846A87C3D766605 CHAPPELLA0
515,151,674 *349AE1CE96C2779905C13C4F599660A20AD2C510 charivan
515,151,675 *349ECD4A36AA97E13571AF31C88035D87DABB21D plafonhaak6
515,151,676 *349904D62961C61B99A60DD1941B03291A7407F2 PERCYCOCO
515,151,677 *349D671522C2E7745975D2D355178E6A48E579BA CHERNIACKEMMANUELLE
515,151,678 *3493B17BD3B72565750E0788B8EE431E04FC16EB POLITKAMPAGNE
515,151,679 *34974713D87AE185FE29963FD61275F5D3628CAA chmw&
515,151,680 *3493A724510D55E8242832980DEFDF7CA0AB7BC9 CHRETTIENNE
515,151,681 *3499893E5E4B12424E30838CF5A17B9D73812789 CHRISTINEHARVEY
515,151,682 *34988B502045B5578D20A51EBE0B2C6D1E45C491 [email protected]
515,151,683 *3493AA6CE2F251C50F7175BF4ADB2FA027B569C6 CIBOHPOLIHPYS
515,151,684 *349F60018A8536DD13F6BF4DFE79F0C1FF1D109A C(K#D
515,151,685 *349B4F483B644E0531394E17BB9C91375EE872CF P======>.`.splat!
515,151,686 *349F194123B2D65FA69B5C6E09C623FAF99ACEB5 PSYCHOSISSUCKSCAWWW
515,151,687 *349AD3C1BC5F0C5BCE9C4D9C5AAD180FE53648D7 c.l6)
515,151,688 *349BA2D3FA9FC35C05A2D181830CD7BB5655FD18 PVENNARE
515,151,689 *3490C7E9F942938CDF14C5014604E2550A238092 q======)~0-Splat
515,151,690 *34986990EC7EF35F08445246F6DE22B951CBDD1A [email protected]
515,151,691 *349C5EC6307D7D7E9569B3E9D0469A4C8B418561 clo+0
515,151,692 *349C6A912D8B99F947B50D321F67C8F1A1089775 [email protected]
515,151,693 *349D4E4283A64639147C04776DAF826D3843CEC6 p##p~o)8(
515,151,694 *349A20F8A249BCDCDFCBB8C27FF2AD6417D43EC5 [email protected]
515,151,695 *34932E6FD19E3738DE8107BC61536BA24E6F65F3 Q]NQ
515,151,696 *3493228857CD06DE7410416DB3FDB5D623FEE6E9 PRINCE.MINNEHAN
515,151,697 *34910DC0E1DEE88BE5E6A0DE25BDC2397D5BA53F priyankashetti
515,151,698 *349C145CCA63956F0C0F96FD068FBE03C46F0A86 PROVIDOSLHAS123
515,151,699 *349458340592394A20D59591EA7C20BAB35AEF4D PROXIMITYEFFECT
515,151,700 *349E223822967E48262EB717F35270B399265D15 Q011166
515,151,701 *34954A6BF3573F230A693448273734FB08D445A5 QAYWHD
515,151,702 *349F26B5C57759FAE9AB80759988EB473E0127BD qazwsxedc
515,151,703 *349BD6E277643CD87E45B56398E32571C77F5FE1 [email protected]~-Splat!
515,151,704 *34969008BE7FA2161057D893E673B7AD6A9CF078 [email protected]
515,151,705 *349D01B6B378E46338707635BE90CD47B31D9517 c...n'aimepaslesdimanches
515,151,706 *3492C43B884B0B67DE120CA73B54212D02A53B4D c;n+n
515,151,707 *3492AE2F352C68E059F9C8CE856CA9327B7DB3AD qusa2
515,151,708 *3496256C6F5DAA4E6773E54A58C0D3DCCB3C47E6 cocaires
515,151,709 *349FB7C892211B2F408C5926A248412EA8BE20AC [email protected]
515,151,710 *349A81F84999BFFDC9D6EFF64339714332C9428B R45E
515,151,711 *349AF6B15A2F47B707BA64D8CCCCB5B73BD860CC QUENTINSEPHUS
515,151,712 *349304D6BDFE45FE1180D42DB3E9C541F259B630 [email protected]
515,151,713 *349607B84635AED15E74DAB70080724A35A80FAB [email protected]
515,151,714 *3490E9B3C0C8FC7A856ECE17DC2D069AB3C9D3F1 RADZICKĄ
515,151,715 *3497EACBC273D31D828582A127099A433560CC6E conniepietrzykowski
515,151,716 *349E2EF24BD629597E1FEA33F7B2A3CE6AD230E7 rAt
515,151,717 *3498C04F704C556E82BA753165D1888C04C9D3BB rach3
515,151,718 *349314E2B969027EF6D0AF27F647C50A069BBA11 racklinn4
515,151,719 *3493721FC00CFBA28789E0C7E7A4297929F31C47 Conv3r$47on$
515,151,720 *3499E6955AF215AF1BB1306E8DF34316ACA85FC6 cooper053
515,151,721 *349DA863D3735B8E367766EE20C8891D6A0B58AC RANDALL.HARRISON
515,151,722 *349D6ADE47BA6741C739BCF7876BADDE279351BF RASIL VENTEROSO
515,151,723 *3493386C98DDC0C46F418E8F063EAC30BC931863 REEBOKTOMCAT6
515,151,724 *349C3B4B453F590D0B505484DA9CBFE7A2F2626E RAYMON.LESSENBERRY
515,151,725 *349F4B82A20BE1982B8813B329A59D067E69AF0A RAYNA399
515,151,726 *3490564FDBFEFC8010C3EFD226490632B6C33D4A COSMH
515,151,727 *34920906E6A02E4032C45F936F44C2EC93C4DDF9 REBURNISH
515,151,728 *3498135D2589EB506AB815D2994F0B3364579FA8 CPfQ
515,151,729 *3493A0B8ABD5FF6CA6485A96F7A9561FDB05C3CD [email protected]
515,151,730 *3493E69E1280B3A28827DB9371ED751477F8AFAE REGIMENTSCOMMANDANT7
515,151,731 *3495217C777457BA6CB0D447DD57E5529487FDB4 reubenacfalle
515,151,732 *3491604350874703F54F4CC31E9E88CB7B5F658A REIDKUECHLE
515,151,733 *34952D54F3FA672D4B621A9C31EA599913070232 REZNORDOLLARS3
515,151,734 *3492FF36DD164F19ACAFB01958DB17D5F51B6925 C:\PROGRAM-FILES\MICROSOFT-SDKS\WINDOWS\V6.0A\BOOTSTRAPPER\ENGINE\ZH-CHT\SETUP.XML
515,151,735 *34959B15048874200FC9770E9C0B178A5D09CF75 C:\PROGRAMFILES\MICROSOFTVISUALSTUDIO9.0\SMARTDEVICES\SDK\SMARTPHONE2003\INCLUDE\PSHPACK8.H
515,151,736 *3499D6FD3F3ED369BEACF7891ECF46040AA55054 c:\programfiles\microsoftvisualstudio90\vc\crt\src\purevirtc
515,151,737 *34979517920E3014C23C4BD1185A787DCCBC60F1 crayon.angels.(bonus.track)
515,151,738 *349A6206751DD6B8046A35205382259EE5CA0FB6 robbinss2
515,151,739 *3490681B5B6FF6E845C410A4E91ED4D0A8880ACC ROMEO.TRUSSEL
515,151,740 *349659E893F0C36B93A23CEE01529017792E9E16 ROOSEVELT.GUILE
515,151,741 *349250EC108AF751A23B4D0C011B7E81C9B38083 ROUEISONSED
515,151,742 *349B2CBE883197D1B67C8969C7397F4EC926B5E4 RETSRAALEDNAWPAALS9
515,151,743 *34921AE9DF42033C7ECA2BA29AA656B67DF2768D rovnom
515,151,744 *349A34E995F4C3E04686C356FF75E65DD89F898A royalrowray
515,151,745 *3493B2E462D19C5AF78622508F61A5816C5DC152 ROY.RAQUEL
515,151,746 *349E4B728B36FB3D6F6797146DB8A5F04185AE51 ROY.SPACHT
515,151,747 *3493F11D81D253CF15EAD2A3440C0771C1DB8CC3 reverseront?
515,151,748 *349A977F87EF1A2019C579ADC46FAE81C7136BCA reygalano
515,151,749 *349D3F71FF4994B4A17DB6EB1346C7F9B723EE6A [email protected]
515,151,750 *349A47DF52CB8C668E541B935D9925D1E10DCA86 cuga!
515,151,751 *3499FCCBCEFC2ABBFC7DE543D16BD0D7C9B15EAB RUDDER.TACKLE
515,151,752 *349E5EB8715BAD02B3961F4E2A49E38B5260861C c:u;k
515,151,753 *3496AE4937F0E06E0C8E46E2DEDBAC88DBD1FD6E rumoursofrain(craigandwiloughby)
515,151,754 *3498232C93A2D2DA4821523734ADF4F1F938CDFE [email protected]
515,151,755 *3491D289068DD8CF4DDBCEE55A309537F743854D CV1MO
515,151,756 *3490C0F196803C5FF46E43CC146286D1E4C31E7B RICKEYFIGGEURS
515,151,757 *3490EDDDBBD0DB0263561404E36646B59499F20B SADNICING
515,151,758 *349AF6FF5013F940DB23711E0FAF286668AED992 SAERENL
515,151,759 *3495F5DA39B88BEA5BF8796B3D1E6A9D0CA91F70 RICKY.SICILIANO
515,151,760 *3495BCABA5EDEDD161B773629155CE230A4DBA05 sagtengp0
515,151,761 *34978BE60FBCBC505A64831D6A6F159F86A7F249 salici6
515,151,762 *34992E1A880A65A39A19A6060804670A21ABBB20 SAMAWAH.2
515,151,763 *3499B21B9644439C829A1070F8ECF33C19F26273 SAMECLIPSES
515,151,764 *3494B9C1B88E71EA7A5EA7A0EA3A4BD4E68318D1 RIGHTSCANADA
515,151,765 *349F2B31D2D0D22CC999E1C75439EF18D0380300 RIHANNASTARGAT
515,151,766 *349B2B9F306DF5A92216F0950EC02F7AB1792BF0 c)wrp
515,151,767 *3491E2BB8E429B98CC676D9844B213CEEBE75C30 [email protected]
515,151,768 *349F77E9CE6554FEADEFACB4445740B9CD77218D cy1#2
515,151,769 *349938FF794F4A26F70CDFB9209591524FBECE82 RĪSHA
515,151,770 *349F550158C5A95DD6CAA0CD06610EB53934480C SÅRTEA
515,151,771 *3496D5D8B363F72F1E0C64C0C319E1ADA85F5B6E saulmillon
515,151,772 *3495B5CB77E5F6123CB2C7531B9F468372071DC5 SCHNEEFORMEN
515,151,773 *349AA72B9C33BC4B9BC5A998028C17EABBAF090B roderezs5
515,151,774 *349BFAE35D294DF2B75F7102DEFC3EFC26901766 damianscoma
515,151,775 *349F306880C01C66B67A1A771885E97A43552B3A ROLLAND.GUILLERMO
515,151,776 *3490CFE00B7735A54EC9964CE3EAC902FC5B6667 SGCC
515,151,777 *349D79C2330E38F78B28F8841AA3B09BC958260A RONMOL:RM3637
515,151,778 *34956E136C8FA76AD2301B153D7BCD8E38D38404 danging
515,151,779 *349CAE0EE5F691C7A049E493C19888C4FDB95C2E dantetirrell
515,151,780 *349EA6E0EE776B18D8793B29F34DBC846FC28F24 DARNELL.MCCOIN
515,151,781 *349840D398B7086251E67378D93B4461C2F8708A darryl-sanderson
515,151,782 *349265584E309C2CED592D60A1EE38AD4E60C701 ROSSMCMURRAY
515,151,783 *349BEFE4029D51B6031F66623839B8F02171683A DASKOENNENSIEUNSNICHTERZAEHLEN!
515,151,784 *3492EA4179E812F035C9755B19BA99FEEC8C4249 davidaugustyn
515,151,785 *349B50264C41752B361D2FA3039DC8907D68E3DB [email protected]
515,151,786 *349D38C936BCF5182CDC4E5995ACBF6BF444D833 sicvt
515,151,787 *349DDAA7B8E1BEAB5AEE32B46E16655B7C14A5D1 dbg+f
515,151,788 *349CC9453E4D61E579E627278C8BAC27B241C435 RUSSELTROBOUGH
515,151,789 *3492462494D2FDD7DAE6F00374BC0B6D8F9191BA RUSS.KLOPFENSTEIN
515,151,790 *349E1310741F501DA32468C33D24BF9E20364919 DE.$
515,151,791 *34915560E2F779A90DD51BDE23CB2DCF7D79DC0F DECIDNUAJ6
515,151,792 *34943495E054C74DA843AF4D0197B4B6282F01BD SLANOISELEE
515,151,793 *349E6E95FC911FE83700F43EA98E9E4F24302FE5 SLUSHILY
515,151,794 *349F6FD9EA4626EEEAD4EE0D962538A7990496D1 SACATUREANU123
515,151,795 *3490DC9C0406E32B3D57586AF16A1EB7B8BF3186 deffiant6
515,151,796 *349CBC138680C088855509C25647AEC755002D56 DELLUKSW8
515,151,797 *3492FA37D1EF55AC14CEAF703DD2C96C948CBA00 SALVATION: SUICIDE
515,151,798 *3499B95A7C0B248F29CD9CE076F60049636672FE SAMANTHA-KLINK
515,151,799 *3490D081E64841560F48A7C525D6717685AFE12D SANDJAK8
515,151,800 *3495731E77EA18EB670C166CF6A5197E88659EB6 SANDRA-STOCKTON
515,151,801 *349018FA21978B41E3528104B471DBAFF5E2EA38 DEONANKERSEN
515,151,802 *3492B5632D59031F22DAD16548CF5E3948EAA626 sankiirnaah
515,151,803 *349EB64D67737BFF99B7BF19188FE492FAF9C187 santiagoswords
515,151,804 *349943BB64EBB0F04AE2C499024A2252D45BF109 SOLUKKOO8
515,151,805 *349FA42D94DECA3A4B8D1CCE0246C1D5C04AE78A derek.hulvey
515,151,806 *349D054CF07E218CD419DCF5DBB5664EA2C47502 SAREBOR9
515,151,807 *349FA1B6A3D7E63E63BC0529F7B60C66DD5176A0 SAYYAD123
515,151,808 *3494F5806EE07B84E1523ED67F5197A7EFF2F015 SCANDALISERS4
515,151,809 *349B47A72E377A86C6C570EC7533E0B7DB54BA9B Soulsong(Kobolremix)
515,151,810 *349395DCF766C27F15C5BF5A1A071E97624DA70E DEWITT.MCNAYR
515,151,811 *34938BADB9947862924FE43FAF5A8F37F583570F SPCSHMBRGNSS
515,151,812 *349FF55FA44377A8A660DFB9C559A2073F28F6F9 SPEECHDEAD
515,151,813 *349F3A67E2D22692EEEA4EAFA9A285B7DFA0EF76 [email protected]
515,151,814 *34938085388E7ECE6686A9B78ADB977229C09C99 splat!~`~`d======q
515,151,815 *349225CD4ED8DDF061C4A46C9E4564A8FEFBB42E SELANOITARED
515,151,816 *3495DF687D1604C9D71C5AD169C38D352ABB9F0F SELFADJUSTMENT8
515,151,817 *3496E426D17A10BDB6F8EE857225C16E74C92B50 [email protected]
515,151,818 *349E92F0B7F45051C12DB9DE72A3555A7DD03827 [email protected]####q
515,151,819 *34943C249E020C76F4C868F8786EF58F48E119C1 SENESEBSW
515,151,820 *3492C229E50F5AC1561E223A35541CFD0391F949 dienstbodenkamers.
515,151,821 *34918D92277C8FCA5032BA17E2279D89A9EC5101 Sporades
515,151,822 *34974B6AC96D6DC33D721695CA38F7C0B8E9AE23 SREKALACILEC
515,151,823 *349392A75AEBEF3D9A164AE76BBBECCED3C3DB26 ssamaava
515,151,824 *349243366B7B123023DFE8346E17A3880D841B92 S}HAAA
515,151,825 *349E04F3E0463CE6FCB094C4BE202872B4F3A13E SHAD.KNIE
515,151,826 *34916C76A8FE2954E75D802444AEA9E2CE29ED5E [email protected]
515,151,827 *3493202B2B46453A244169C871C0E0CC9D2431A8 diw67
515,151,828 *3499797E206317F4888BF338D3F1B53148704CDA d)k&2
515,151,829 *3495CAB99610A7255F2CCB5843D95548D36630BF d(k4a
515,151,830 *3490627589D017E56D68FF9EAAA77A6581E4D534 STANLEY.LAGANGA
515,151,831 *349D83E5A2D8FF7570615109E8DB5C31B0FFF03F STARTIES
515,151,832 *349D3D6833B67052A4DAD5752CD23BC1BC708FAA D/L0N
515,151,833 *349053CC75D9A8656E961C477E0A444250EAEA50 dlnhi
515,151,834 *3497863E86D4873BA81096C5A09EFE4B206279A9 D)M(3
515,151,835 *349F6955B1CD2544BF423405888FB20EAF88DA15 DOGBERTCRYSTAL
515,151,836 *3494851A00347043E50E83E7A1A4A0BB94273615 DOMINGOHARTSOUGH
515,151,837 *3490756F8E8C56898FDAF59F2A2B4CF8D19F9DD1 DOMINGO.MUMA
515,151,838 *3496BEC3B91DA1E095620BA8DA129CAFFE17712D SHOESNSSED
515,151,839 *3499A0AF81F08482F23CFED4D41AA2E307CB0181 SIAYARFE
515,151,840 *349BADC673E4ED4E0FD8E8E38CE93588C9483B93 DONOVAN.SCHNETZER
515,151,841 *3495B0C9A7DB1CC0F094FF6FB2DF9C6F1EFA9855 donsweigard
515,151,842 *349C22E3678055EF4E50F0871448A4CDD1AA5560 strange(infactedmix)
515,151,843 *349F0C82ECCDFC72FD94373F5E6CAA63D3EFE5C4 dor,m
515,151,844 *3497C8763F1C8BEF6BF1D1223C1343AB4FC68BDF SILLTUNNORNASING
515,151,845 *3492BB21D0FDBD5B8EED7EA53FD86C58F9A99162 DOUGLASS.HUTTMAN
515,151,846 *3498EB40E0106FFA7BB6BFC7124CB27C930CB570 suezdnalsi
515,151,847 *349E4DDE303445BF806810CBB82C7A0F529BF53E SISEKESTA
515,151,848 *349C2BE60C5FB256EE35C36DB04BFF9AF702A62E SURFMILES7
515,151,849 *349B56715F9F9BF2456615181687C728FF93C10B SURVEILLERAI2
515,151,850 *34972736ABAB06D95F34CC859B06AA71558C4959 susanbiswas
515,151,851 *349A03536754DA36A3D0802CD5C519B338EE1DF8 dray-dr/ei/
515,151,852 *3499EB05E1A8EF9738F6F685CB82D6538508D041 DREAMS(CHRISFRAMEREMIXEDIT)
515,151,853 *34972F10FDD82C27A12011D0B8EA8DA4261ABFFD D+RF
515,151,854 *3493D346F60A1C383F42D1D04D15CA7824B4C66E d!$ro83r
515,151,855 *349B9F3A663D0390EB4699554A06958E7EFB30B6 SNJ4432
515,151,856 *3494B42F3333D9E04C5110A6E32F2EECD6578F0A [email protected](
515,151,857 *349E49A51ACAEB8CF6B46FF4DF55C2D173269BB1 DUAWQ
515,151,858 *349E5D5751C10B2A90A23C566FDC677C065DE495 [email protected]
515,151,859 *3492EFE960E212BB2643173499FAF1C0BE9D7B6D [email protected]
515,151,860 *3491537E814868282D88CEF46F73C51A604DDFC3 [email protected]om
515,151,861 *34901DED6E9AA2F7E9C0DBD07B875DC409252C5F sophietherese
515,151,862 *3491B86BE132EBF36B5D769B8AAE5187E9B8E9EC spaliertje0
515,151,863 *349E29DA9F7A066DCEBF783E4B51D209DC87A418 TALMELLIEHA
515,151,864 *349A7045C6E2357FE672DC25FBBED96FDD8E5CFA splat.~.`<==3
515,151,865 *349516B4E2C5D595A1FAA665583E20FD88209045 SPUNKYZAPHODED
515,151,866 *349F0EE56065A48CC870992C79F7609627D42073 SRCTEXTVIEWBSW
515,151,867 *349E087E776A74139265057D0F398F907C8FF9C6 TARDISSHADOW8
515,151,868 *34970FD04E0AE0A15C14988006C0E98E7C5489D8 TÂRTAU
515,151,869 *3494894BE67AA9E45CB60B051017CB3D6D4F754B TAYLORR11
515,151,870 *3491340AD093FCD058AD9DF448B87B1E051C264E tegm
515,151,871 *34935A3D1265996B64C1D312EF54465ED63E65F0 STEEPLECHASEDERBYHIGHLAND!
515,151,872 *3499B833D38D456B2B8BFB855C82F070F49AAD1E earlhobbins
515,151,873 *3491AF072B342102B9C7B51A28BEBC265DE61EEA earthdirt's
515,151,874 *3494ABF7A2DF520CF66076CBA67BECA29D572F81 [email protected]
515,151,875 *3493280B8C605D8AB1526C120700AD619E5EF655 STEVIE.HARTZ
515,151,876 *349F73DD66A8F106566EDABCC8590E36F2342F1C stewartbelidor
515,151,877 *349A94C9C5E81855C4F7E3E57D480D11648C638E STEWARTCRAIGEN
515,151,878 *349EE55B11FCC7E0AB742DFA54EF61813CE3A67F EDGARDOGALLERO
515,151,879 *3494A885BC90A69D62C85E4EA5879AB8264E26DA THAMANTHAPA
515,151,880 *3499438AFFF00DE0D047475A1206F724483242EE EDISON.PITZEN
515,151,881 *349653DD67D64038CB7ECE240CD63529005AAB4B EDm#
515,151,882 *349E37381F888A849951A202B35419EDDB60A771 EDMUNDO.ONLEY
515,151,883 *349B97A75DEF35CFC7187683D251308D0D7AF582 STRATTREKING
515,151,884 *3498CBF1A824B7C6E951F59D29E02B431538E6C2 EDNANREH6
515,151,885 *349F568A6EB6774586CE253DFBD6801FBF769EE7 EDNEREWT3
515,151,886 *3499238B3533742766E59DF65C62DBE2BC94790B ef8$d
515,151,887 *3493B15002A6051372BC58FD03D8703F73E4C88C eg7vt
515,151,888 *3492C0EC3CC052CF9442059665EC5144EF017DCA [email protected]
515,151,889 *349D4974E59F3720E14BC82A59A268DA357DACE6 THE.GUILT.ALBATROSS
515,151,890 *3494B390CB9679FC30BE2128AE091C863283E4BB SUNGBUNKERS
515,151,891 *34992669D4D19F6571805DA24D68B3F671EC0C12 [email protected]
515,151,892 *3497A9287E4BACD6DDEA1F64B1D34F3464F80093 EIIOETIONSTE
515,151,893 *349A54F8DCDA15BB1977B4F171718203941D9803 EJBYRD
515,151,894 *349325392D824E9A38A395921542422BC4F4C46E ek8?
515,151,895 *349F03BDE88FA0A78595DB41272687DF2A6C2E09 SUOICOREFNING
515,151,896 *3493472D93EFCA5F16E4E09DD615D9FE311E7228 the roots and the ruins
515,151,897 *349D3D4EED7C6BC866866FCECE1B160990ADE611 ELEIK.1
515,151,898 *3497BBEFC0E8A5150B9C8DCFFF97CA5C46E9CC7A ellie314
515,151,899 *349F3E262A6280D38200DE53CCC10DEC3FF20C52 SVAKIM1
515,151,900 *3498696F7CB3A1B726EE3F40F24B7341B6BF9ED7 ELVINPERALES
515,151,901 *3497147FC051E2DE3654F724B54E4F5C424FDCB3 [email protected]
515,151,902 *34910B968136436B8BD6E4E499F3AA16BE199FB2 [email protected]
515,151,903 *34937F6468BB75F46A0D4781A6A46528F8108336 tnerepooc
515,151,904 *349211A6606A7A88C97391B3BC496484C251F79A tocesnetxtranettoces
515,151,905 *349B9E0A6D75340750A23879ED2B09E8052CDDFA EMANUEL.WINTERS
515,151,906 *349948BD403B0535F5AF95D57D1D904F69A283A1 TOGETHERBROADENBULKBUNCHBUNCH8
515,151,907 *3490DB154EBDE61934A8605E60878D81884E25E3 symphony-#9
515,151,908 *3498A5BEB8134D1AC36AEA8B6EEC9B05D5490623 szemelyzeti1
515,151,909 *34923BAFE0B2813B2FB6B3F084492E9B4DB3D4DF t01shuuu
515,151,910 *349813EEEAE6F05461F4ED4D1BD102D059B7EB78 TORISORO7
515,151,911 *349762724648F2437B315815E94C8A9B9412663F ENGALLARED
515,151,912 *3498FD976A995688825578CAE1FF25F4D9F0DF06 TALK86.15.240.229
515,151,913 *34978D3D9A7D4F3B42727A7888DFB8724CB442BB ENIMADA6
515,151,914 *349F0103B467B3EE748D01CCE37F36134381FDD4 tame.a.ese.hombre.del.coraz
515,151,915 *3492CCD6B7B876037B1DA76F8DA0A95517C587F1 enriquecrossmon
515,151,916 *34977B81E9EA7EF496A38581C6EFC02738326F93 en.weissen.v
515,151,917 *349E3AAAF3B5721376C3D0BEB6D4CB484F7F680E eon."
515,151,918 *349E6123401F94653AC756ADF12CACD2C664BF5A ep_3s
515,151,919 *349392EF0CDD390434B126F1B4B0251E0930A782 TRICENTENNIAL
515,151,920 *34907BA2E32C33F59D59859ECBD5F6D1289D6393 TRISTANOBIWANED
515,151,921 *349BB9A9F490133D62113699E53D0EDDC70A8760 TAYLOR.CARLOW
515,151,922 *349918C1AAA967D16456E1990A2A565E63706287 tropang-paumok
515,151,923 *3494DA0440969F8C5110A2E2A74CB44DC9688F69 TROY.ACS
515,151,924 *34917577DEF0C7B28F13C73BE58CC9F639CB61E9 [email protected]
515,151,925 *349FE77736C66510FDB19828CD0E95FB91B8D98E TrueLoveNeverDies(featGaryScruggs&TravisTritt)
515,151,926 *349765490027FC9866B6561301505D4D1C5F2CB6 TTRNGLY0
515,151,927 *349360FD19C34548E76A474599A63045497901F6 tenroundswithjosecuervo(liveversion)
515,151,928 *3492412BB2D54BB57EA3D6F9922E70B2760F7C57 TUUDITAN9
515,151,929 *349B2F4D0165489D45E7E526F1FB13B4CDA1B45E THA1TY
515,151,930 *349C21680CAB9B8D7F95BF634001A17C4CB4D5BB ESTIRAR8
515,151,931 *349AC2484CA25E8C48AE8BA17F3AA60D7FDFE76A TYNIEMYZTOFANTABULOUSTURNQUEST
515,151,932 *349D57C9D8910C27DB910CAD668C2A521BA28596 TYRELLFEEBACK
515,151,933 *34993831229F17C2C127E3C8D03DA635494B81D7 ETRILLES3
515,151,934 *3491B6F019F18637371808B6387BEFC4E5F2101C THE FLIGHT OF THE GRIFFIN
515,151,935 *3493668B8BC0291C3E1C3E90B53BE2362113B953 THE-GREAT-SAD-RIVER
515,151,936 *349C446EC058FC19C664A94F5666D8649BE62643 eVZ
515,151,937 *349C71D7489FB6FC515E7C8E0CE9B11B41A9F8B6 the retro spankees
515,151,938 *349EE6ABC7D79F843AA2DC996600C5D5959ECA3D [email protected]
515,151,939 *34990A22C8C1932CD506C11C4623169085E0AC5E ulysseshuckeba
515,151,940 *349E448EC62CFB38980E54E55CAB708AE770C11D uma-bajaj
515,151,941 *3495851D3AD1A9F5D84DBED05C97800CCAC1DFFC UMMUL.AHZI
515,151,942 *349F138B29C2186FCEA2EA4CE7217BA999D82555 UNACTABI
515,151,943 *349F399A3D3F52136AE754E95944EC2B7D166733 thurmanwalwyn
515,151,944 *3499B1E2A552F54FDECC61983E81581641314BF0 faustinotuner
515,151,945 *3498712AB6B1778B355993738F59AF9305312E9E FAUSTOEWERT
515,151,946 *3499B8B844CAB5046A22E753DF50025C38437C8D TIASSITREVRETNI5
515,151,947 *3493188B5D4F91BD7B9BC4D196E6CED1F464DA69 ungkhenghuo
515,151,948 *349BD663DC8CDD7ADA965597682DD26D80B9053E timothylocey
515,151,949 *3495F4F22781F0810C1F78A3F7AF03FC06215EF5 feil
515,151,950 *3492560EDE8CFE2DE05FB7B4C0EC4D2DB681A79E TJATADES7
515,151,951 *349E2668DF371097DE1497FAEC070FE6CCE9AB45 URSINA.WILLIAMS
515,151,952 *34940C550A949CCBC64251CA0B9BD04C6F8AAF97 tleotsre
515,151,953 *349C1BD708F40C3DEDCC1BC375AF36563F38348F TNEVUORTING
515,151,954 *349D5C7AB611F1079A5F40B3BE391F6CC64611AF find.a.way.(feat..amp.fiddler)
515,151,955 *349C437611B22D0BE4987C7A3A0F4205FD9F161D TOFROAST
515,151,956 *349F14B4252B4B763FD5CD602B55A96FDD21B16E UVLA
515,151,957 *349129D8D662D6BF8E3840408F5E6BB23401F411 vaechan
515,151,958 *3499BD84291D5C522C261DFE52C30C24EC27476F floatn
515,151,959 *3496FBD6D9EA520C52985615DCA1B9075879BE85 TOSENDTHEOLDANDMISERABLEKING
515,151,960 *3493D8A07769FA5ECC5C6F72D026066BC6A46065 ToTennessee
515,151,961 *349858FED93ADE9E6C70FEB939228CA1D6E8CA2F vandervalkzomerstraat
515,151,962 *349603AA7343E844D1A45935EDD12518EB9BA946 TREKOMAKABI
515,151,963 *3493D382DBE742A909BA621A350126305F9384F4 TRICIAAFABLE
515,151,964 *34969AC7BF66C2BD1AA84B794DEE70DAFC60B79F FREDERICK.GORNEAULT
515,151,965 *349359D5ED31B2971884D17CF1B759F874A029E0 freemansuddreth
515,151,966 *3497A50AE1C65EFA2077175A7B41E04BD9CFA9D7 fremtidige4
515,151,967 *3495BDC9FA3E60E45A497FCCBE1A89D087B1BAE1 frododon3
515,151,968 *349623D9676C9A6B8F53B34764B760EEF63D6A8A trpmkng3
515,151,969 *3494DD619E23FEFD4B0636FA0B69D67E14FAA8B8 TRUNCLOEMOS1
515,151,970 *349BF0661C587F6D06472FA4FD5E1B71A7BB65B2 VERNAL DORE
515,151,971 *349CB540F6C7DBDF98D309FDECF9BB00DE447A8B tuangissel
515,151,972 *349AB7B7B22313E078A5553C2914450B900498D4 TUNTEMAANSA7
515,151,973 *349D810F6281C9B30BAE200524CE08FEE0E8CD8F [email protected]
515,151,974 *349CBFAC1E57738E7112A8E85CF46E94370BE168 verrimpelt!
515,151,975 *349D3731600400F1DB73CD1A080DB0C3950185F4 FUTUREMAN / B
515,151,976 *3495A7728CFD94B9493DD3406510BB9596221BE8 VIA-DE-LAS-MAP-QUINASAS
515,151,977 *34916125D0C0C775248D4CE2050AD02BA85F12AF GAILKLEIBOEKER
515,151,978 *3493BDBBFFF967AAEEB9905D4554150AB5B97DD5 Vicious-Ginks
515,151,979 *349DB749F86C27E15432FBE861FF33A5C7EC5206 victoria-gougisha
515,151,980 *3494C1719032BFB06695EA7D6DE0D0273182366A TYRELL.NISSILA
515,151,981 *34961EDD356C17725BEA77C6297D71DD7506F430 TYRONFREBERG
515,151,982 *349CDD660E8B84056B7E75874F195522E045C8AB GÂTÔ
515,151,983 *34931FFB0B8BB76CB2B79455C341E7E5AFD6B426 GAULIC?
515,151,984 *349640FAC9F562E7D852FB9D683F646D02127458 vimalkuruvi007
515,151,985 *3490D09F37BEEB3167B10DE75D4E51F002DD36CA VINCENTMARTINELLO
515,151,986 *349B392181CC71DD18D98D8FF5E0E102965E0308 UKSJONER3
515,151,987 *349DCE9484D1EA27DD7EA004C1E2994432CF9F8A GEORGE-SEYLER
515,151,988 *34927EA0153846FB466613962B3C4CCD7EDABEAF GERALDLARAWAY
515,151,989 *349BB453446AE4E46D7E90AB3EF9636890BD8364 UMER.ZAHID.JAMI
515,151,990 *349BAD156820C2F978E54AEF38CE6223787D7992 unapproximately3
515,151,991 *349B7C254DE6691048E84E55A39C38CE9A7014B0 UNPRO7E57N9
515,151,992 *3498ED263B60729EE153DD5F824E3C0E799E6B22 UNTRAFFICKED3
515,151,993 *349290282EFD5E4DBAF980BAC2C2F11022B61F0B [email protected]
515,151,994 *34936E0615EA0E42D6E15215A422C4C5CCCC34D1 gonosomited
515,151,995 *349DBD437085DC84F97FB4605775E8DAEE5771C1 GUITIGER!
515,151,996 *34922204ED27CCB2D408B48CAA7D53F0F4DCBE98 VORHERSAGUNG1
515,151,997 *34983A737D92771B7B5CF365554C855480D024E6 UREALLY.WISH
515,151,998 *3496471021EBF0BBFDB3826E4A411FEC2234C111 USHISTRYDINGSWARD
515,151,999 *3499C9964750C2693DB7D8AA5C61D28E66129421 GXGB
515,152,000 *3499FFA82857874346F622C4EAD042719D111D5B HAIMATIAS
515,152,001 *349AC7B4DFA4A4B57FBD7412938DA76AB6CAC5A4 HAM.AN'.EGGS
515,152,002 *349D0D89B7B4EDDA49875FF262FA21B7F088F068 waldochirinos
515,152,003 *34958C131405AE7B303B88688B65C81BA1992856 HANKRHETT
515,152,004 *3497270B8B71AC7E70485CD4576A145039F9D9D6 vakteekenschool
515,152,005 *349436846F25A0CB86F95B4D591887BCA6F146A0 WALTON.CONNON
515,152,006 *34971E50047190CE60D2CE83AE009B35E0919ED9 [email protected]
515,152,007 *34902000EFA84B88201862D4B3C9E4DB8E5485A5 WANHUZAIRULEROL
515,152,008 *34943FF3B8877FE13988ACE602721F9BC347A177 WA$P1LY
515,152,009 *3490260E19B3E52CB82D5B3E4A7F45145B4B5DC1 HAVNEDED
515,152,010 *349E9C275BE16D75FD941312827EF67E606A9CBC VANESSA-VAELUAGA
515,152,011 *349A30EF2626680C868BFF808F26A6CD4EEBA511 VANHEESE
515,152,012 *3491228703EF3C833955F7BDFEC3E1DD66440E3E VARNASHRAMA2
515,152,013 *349A1251427A043824DAFB5BBF062FC2BF93F2B1 [email protected]
515,152,014 *349C387E881437510E9D00A4BD5B1C20E0D433E3 [email protected]
515,152,015 *3498450AA9A345918243A2ABD4CAB382E3C4F091 helenhein
515,152,016 *349C55BCA6579A6D9B66ACF87D641D12DD6A80A1 HENIMOT9
515,152,017 *349EDA8CAB7E9F26234798B4538D97B72280A331 VERKOOPREKENING0
515,152,018 *3492A91591F4394C7F8F5FB56AD4A79E005DC749 hildprand
515,152,019 *3492ECE57E8AB87B3C5460BA52548486F94433D4 HM[X
515,152,020 *349F7227FC6649EF2BD9F5AE6EBB9FC7D6B7F216 HONAAH
515,152,021 *3490C2CEC229CC142967989AE4010810D865A3B1 HOOTENAN9
515,152,022 *3492E3C241C08CD55E4B55278BF04467B673288D VICKILINKNER
515,152,023 *349549DCE22B634A4FC9D3DF92AE1EEEAC758EA2 HOSEA.PARISH
515,152,024 *349AE5F195C22C1BCE7349A4030CD5E37DAC94DC wesley-ian-bearpark
515,152,025 *349B432E5F0AAF6A62D5C1E149490741C1AB12CD westonderiggi
515,152,026 *349610AA70097B264B2D6B2B2B24F46FD2FFB655 VIJAYA AADITHYAN AADITHYAN
515,152,027 *34909EB2787837672F2D1CCDD376751B91E977DC VIJAYBHASHKARB
515,152,028 *349A1BF8C391F94760F5E6A7C4AD63BAA49D92E8 HOVENIERSKUNS
515,152,029 *34958BBCAB56DDEE662574E0D85EA2784682B141 (When-doing-a-X-jump)-Hmph,-Perfect!
515,152,030 *3493A979D164E83E38836EA4DFB9843EFBE08FF1 HREF="//NEWSERIOUSOPERA/REF=SIP_KPL_PDP_1
515,152,031 *3494B69359E90AC7D03C7655D2ED061F46C30EED vincentorama
515,152,032 *3495E18E27E82267A8E81C8D1148D29907A53548 h^y&
515,152,033 *34921D9A72FDF0FD44A3452B7961A559ED710DE5 IAMCATALOG123
515,152,034 *34927E9B219928DA7CC5FC1CBE1084FFB2431CDB wilma.zurbano
515,152,035 *3492A8BAEF0F34589D0CFC158207392794155ECC VORHOMMEN
515,152,036 *34922124EFAE4CC571F1D9878E173FCFE4C1883D [email protected]
515,152,037 *3497BB8E9344FCFFD3965BE40ABBCAA61EA881D2 VRSCHRWN5
515,152,038 *349A9FDDFB4B634FD9A0D8BDE7BE46485E46A4B6 [email protected]
515,152,039 *3492536923AE3360F52408228B0D2557165A3305 withthisproviso
515,152,040 *349E4A7E2CAE1B125DDC3E4EB4B121A9F86B9E67 W004H0000004
515,152,041 *3490601ECC583637EC34ACD57EC66AF3BCD09377 ikioiduk1
515,152,042 *349AB7BF09EED1F8A82CA9B02C0222CCEC5B8084 WOODYUNDERWOOD
515,152,043 *349EFE67BAA1EC72726E53D9BE59B314FDEF8DFF wally.lhuillier
515,152,044 *3493657D3DA7BE962CC4482287C4E5642FFD19BC walzerno.1esdur,op.18
515,152,045 *3492412DFD9E0AAAF198E2CDF2439130A9E13A04 ILUVGARNET05
515,152,046 *349FD61033F977B184F17F5014B0ED05598C30E0 wui-david-ip
515,152,047 *3491701A2B0250CD16FBE4FD02478F7B773FF4C1 [email protected]
515,152,048 *34921E7209A0304620B1D9909434FC39F87C9AEF [email protected]
515,152,049 *349513DC701CBDDC65FEDF8D33E0BD513FD6537A WWW.BUMBLEBEEDESIGNSBOUTIQUE.COM
515,152,050 *34958AE8B471A7BB3DFDC0E79E500AC86F94C061 imentera7
515,152,051 *34902E9C49EB67E4F3EB648A683F6C1393F66F92 WWWSTEEPROCKBEACHCA
515,152,052 *34994BA02DA9FA54706BE1B87C02D00665F1EF8B wastedwellin
515,152,053 *349B60DE83365ED05265211BF4C6417D76EC2504 waynemarteene
515,152,054 *349E18DBEF66CDAB5FF518E9D8A18DAA193B8A09 WEBSITEWWWSOFTLAYE
515,152,055 *34956C68F86093EEBD3AB493AE0E4E404BA52EF3 INGRAVESCENTI
515,152,056 *349D88434D4A739401C537759B7C4C336B195DC7 [email protected]
515,152,057 *349A71FFF4ADA145B119D0291C17890C24525997 [email protected]
515,152,058 *3493EE824F8F9F81E70C94FD023F24E0866F5F88 WEIROBO:WEIROBO
515,152,059 *349A7BCDBEAC88605E4415614FF89423E3814895 WENDY268900
515,152,060 *349F93A79280AC95FE06EED29CFEEABDA12EF2F8 interviewshermohammadmarri
515,152,061 *3494D287E7806F0062C3362D3722C033C2553EB6 IOJAOROP7
515,152,062 *349E8A76B084205EE4D2CD5025E774DF9A4D2A2B ipjn
515,152,063 *3490AD137CDFC042D8E3E9A8817C7795112BA759 wescraib
515,152,064 *349B34283DD9E257605B92E222E99DE20559A167 WES.DORCH
515,152,065 *349271599457315AF516C80F5B100381593DD3B9 westlairds
515,152,066 *34977CB29077C3EDC3542E3FE4961109CE9ED423 IRWIN.FAUNTLEROY
515,152,067 *349230493D271F62F8A715ABB75E529A94D33AAC IRWINGREENLAW
515,152,068 *349F7CE801257B5990C6AD5099F1CB4F14062036 YANKRERE
515,152,069 *349736D7A5ECB58B19BD9B483EBDDB28D8A56BE5 israelyudell
515,152,070 *349F7B922EA84F92852CF141F4E2EE411FADDC7F yasminhayam
515,152,071 *349456223B399519BABD44189BEEB681B38B05B2 WHORTLEBERRIES
515,152,072 *349FF83FCC22981B264F5D30DF03892F1D91AC56 wilbervallow
515,152,073 *34915ACD9C50B97490A489231E351419C196BE28 IVORY.VANDEVANDER
515,152,074 *349982BB142C1BE3A743DEDC2308492E7A5ABA3D WILEY.MAGGINI
515,152,075 *349C5D9554035967B19BC5E2D396DC882420975F WILLEKE.GLAS
515,152,076 *3495CA7B60EF606AA331C2D73609DF2F4BEAFC9B yitserahcopelandbahtiserael
515,152,077 *349E7D86C46E35C2750E369868272FE1257CCDFB YLGNGLDN
515,152,078 *349BDA73047B3AFD9C64A7C82FC1565F2AF9E455 william.vancleve
515,152,079 *349ED52084718C45B6D5DEAE04D74A3059872345 YNAMOHPMYN
515,152,080 *349A3CE958CFB41D21EA7A2D89BCF2D4BFF0434E WILL.JEFFERSON.MARSUPIAL
515,152,081 *349468479BDE2CB3B7E7357FB64CB1783672FDE3 YOALID-L-SANTANA
515,152,082 *349BE9A05AFFF027FAD81DBD54E92200D136BE5A yolanda-eddins
515,152,083 *34950DCDB7635596674F6B9E821852637BC2EAE5 YONIABEBE
515,152,084 *3496818B77DF5C57627E00CC5E5BBA303F2718BA JAMES11
515,152,085 *3495C02C57DE8D9752D2EAF71E22AF4430F22B6E [email protected]
515,152,086 *3499D11E3E9F82B08B7EFB99DBC4AA1EDA5F435E WIRDAHWATI
515,152,087 *3497FF3D4118A6FAE4397A634344C89B82C33DD8 WITNEUS8
515,152,088 *349866CFBB006CA4D1CA88AD86802CC20EBB712E WIZAKAKBACK
515,152,089 *349D974E71D637B44609FBF8827A8281D5B8A6D2 z4k4
515,152,090 *349EB0A15A44291C57A71A99BF19D1C918F20014 ZACHARIAHPHO
515,152,091 *3496CF37441A8E03D1BB6DD8C9FE66BA8986BB8E WONGTATWAI
515,152,092 *3499C7ED4C6FC01E7DCFEBDC45041CB2AE268002 zach-pilot
515,152,093 *3494819F0C3AAC3421877B6A5055913E0E7687C9 zackary873
515,152,094 *349613AE800C2FF94A1AEA0B38BBE287FA9F6231 JASPERWINNINGER
515,152,095 *349C8A3C7642BD3CB5DDCBEF6C5E1402D0FAA9B2 ZAHRA-TOWAILIB
515,152,096 *349D39F2BD88511602478C19EBBCFB0DCD987B8B zairul-shima-idris
515,152,097 *3493C73D276124395CDFFC0BD01C63A09D0FD2A5 JAYSON.LINDENBAUM
515,152,098 *349CD5FB805B236993ACB53C3656C68A78E154A3 ZALMHAVEN
515,152,099 *349A18ABE12E63EFAFF27278CD2D28BB113F977D JEAN.YOUNGREN
515,152,100 *349E373A54109F515CD8C918512707007EAC3829 wwwafterabortionor
515,152,101 *349CA482D474384D1E0E037A12AEEC706EA030FC wwwastronomyeducationcom
515,152,102 *349747FA77BAFE983A933D42BAD7F0E001FE2247 www.foodematters.com
515,152,103 *3499E160C5048EE74F0E91BDEEADA65B2F5EFD0F [email protected]
515,152,104 *3494FCCCC0BD24C76E4B80AD59E6E2F91614ECCA WWW.NRIOL.COM
515,152,105 *3498857BA01EE8BF4869527B5E96481B72B0EA14 WWWROUNDROCKJOURNALCOM
515,152,106 *349B5F25A816447178BBA013524968386027AEA6 jeraldbraukus
515,152,107 *3496C538AC5AED27B59B3E44250D9F2FBED4A467 JEREMIAH.RUDD
515,152,108 *34904287A8239BC9875CC2ACE2DF6B100CC92D93 [email protected]
515,152,109 *3496FCAE5875DCE44E84B73B175F730C13F21849 JERRODGOLSTON
515,152,110 *34987E6078330A25BC7BB78B5F00F2C093BB556C jerroldhoskin
515,152,111 *3496C8291D4EAF5FC4DB64BC17BDBB7040ACC958 ZIEHZIEHING
515,152,112 *3490966ABD82788F8E7B0D2DF04FC009F9B2E765 JESSCRYSTAL
515,152,113 *349D5A525CA70E1DDB0D7B889DBFBA6A2B39497E xintiandi6
515,152,114 *34907613F9BEF8AC3F68EF08861AAC2A46BBBF0E ZUELELIA6
515,152,115 *3498EC3CCB0775BDED4CFDE56694652B019DD39B JOEL.HOENSTINE
515,152,116 *34927EBD522BB2C2731A4C15AAC61495386E18B1 x|y`
515,152,117 *3492C6EFD0FB19E9EFF320EAB701181652AF7294 YAHAIRABRISSELO
515,152,118 *3491D6FE24A1C883B13AEC9722572990FA139FA3 БЖОЗОВЕЦЬ
515,152,119 *3491B1407444DBB96023B109807881CE412F8E1F [email protected]
515,152,120 *349826FF953BECDBA4BF4643C44F6122556F6EE4 [email protected],
515,152,121 *349009BCB7A3B2D75A81E7267126101AD64FCCB2 JOHN-VANDERMEULEN
515,152,122 *34987721797889BC9AF5F69111B34062FF140E79 БОЯДЖИК–ЖЕРТВА
515,152,123 *349A453D6F094C4AA6C1210E7D7296681915A6EE ЗАГНИВАЮЩИМИ
515,152,124 *349FF250875B186D6DACB8FDBAC1E0561516BC96 КРАСНООКИМ
515,152,125 *349F2ADCFB896E57C9F1843E2E6373B369813A0C МЕНГСБЕРГ
515,152,126 *34956E047A77C0EBE16965727626CF72D3AB6F77 josephgilpin
515,152,127 *349F98E200FF43810BD79EFFAA3D0E1C0D6C3E28 YELLOWGOATFISH9
515,152,128 *3492FAA9336F9BD08B477B819ED83802BAFB20CE ОТЕЦ —
515,152,129 *349C35D5C94F93733F761F9E74B64DF5A38BEF9F [email protected]
515,152,130 *349F671F833C480CCA81284F8693A041E35AE7C4 yizs
515,152,131 *349AD5AF30905ABCDE4EC8CC387AD83E29748F9C jstrouts
515,152,132 *349B671363FB7DBA443D2FE5435A869FA6C052B6 [email protected]
515,152,133 *349FAAFDA4B772B359562C10928FE06C7F0CA8FE ymlc4
515,152,134 *34988B4010AED9168E6E1222836AF000D40CC9C9 «рученьки
515,152,135 *3499585632A4381182810AF43A08CDDC36B0B692 САМОЙЛОВКА —
515,152,136 *34981C9ADFF31227B0C6AB30688B10B53441F4AE JUDSONSERVAN
515,152,137 *349965A989AE8605A80B9BE62B50549765C8D771 JUGENDSACHBUCHREIHE
515,152,138 *349C27DAC805EFE17D38185AE3479539250A25A6 JUSTICE (TV MIX)
515,152,139 *349C1A4F903CB39343022FDDC00283E1316C88AA YUGIOH245657
515,152,140 *34966E1A24B15FA2D31C04408737D9AF1CA76D30 YUKI.HOR.MEI.LAI
515,152,141 *349A2BF55BA9148282E3CFBDCA1BB9B2B76D1C5F yunes.nelly
515,152,142 *349BD466B3F6291CD66F5719458555E4C3FB05E8 Z167604
515,152,143 *34934548D6E57E4ABAF226EA2C5D66E936162E2A zachariahhusein
515,152,144 *34936C743488929533B7157D7184F9593E6B627C zaida reyte y alfredo alonso
515,152,145 *34912FB0C6631D90781356FADBE9BA5AF0BE1704 ZANE.ARGUIJO
515,152,146 *349FB25393B356E9551F77E563E93212FE44E676 KASEYISIP
515,152,147 *3495AE2EB73F54E58F58FFCBEBE8A898AFF239F0 [email protected]
515,152,148 *349DA33D9AE5CCD2485044439B73AB72174C101B KATHY WYERS
515,152,149 *3499F2A5DED6FEC67207EB88185824E01F851D0B KATUWAWALA
515,152,150 *3492AE7DAA0327C1CC0BCD88E0C0F02B125B8DE9 KAZUSNBBS
515,152,151 *3499F7AF5346745DB4F97822A1B8AE604A610E8D [email protected]
515,152,152 *349202C6FFA906A3352421053858101B6790F710 ZENSILE
515,152,153 *34978914EF47F20B8EFF5AFEE07E85204C530AF0 KELLEY.HILDNER
515,152,154 *3495E03AB61F3A5D1DFEBB5522C729FF8B374233 ZEROSTAR
515,152,155 *349DEB539CF79F1B1F19387067FD0D56813604A1 KENDAL860
515,152,156 *34914375F5F6BFCFDB0C8A45F10D75EEF43BDD23 kenethmorneau
515,152,157 *349889C1B0E6164C99E72C077C6FFA2D879DF490 [email protected]
515,152,158 *349F98BD3393314158611F0C327CC953B2B8EEE6 khaoswork
515,152,159 *349B7914D1283DA0D0C004E56594972584735EDD kingherkel
515,152,160 *349BE023607FB2287D7AFED13E1464B249E5FD38 kingleek
515,152,161 *349B87A5488B58C088008C390678B6FA631D655B KIRKFOLINO
515,152,162 *3495EF839C2EDA2D532B301F895E0818A3D3D741 ZUMIMI
515,152,163 *349A20552AB973D88019993EFE886199D247518B ΑΝΟΙΞΙΆΤΙΚΟΥ
515,152,164 *349108B657C1010E3DAC21E6ECA1C5252475411C βροτίνῼ
515,152,165 *3490C4B8575B7AB62EAD408EB530A587285694EA ΕΛΕΚΤΟΣ
515,152,166 *34995038D1F0408BB070648DA76CD4AC7666442C μπακατσιάς
515,152,167 *34983DB38AB09BE51517ECFC381E621B368B4785 kongress
515,152,168 *349E7B3FA1133A6E0057A7D833F04447901BA456 ВУЛКАНОТЕКТОНІЧНІ
515,152,169 *3490E82D07E201F6ABF0CB1BBAE04F35EF0EBF89 kundname
515,152,170 *3491765D17B059C0450EEE837678DD95F99FC694 L128724
515,152,171 *3491BCBEDD8C2281BA659620721E2480F389DA28 L137197
515,152,172 *349D56C4AC9ACA2C305A67850FCA9B532D1D26C5 лутила
515,152,173 *349BBFB20EDFEED3F4BAE9F0BDE04840475EA551 LADYGOON08
515,152,174 *34959D5EB923B8C58F7F64C12315075BA6318D18 lal-bahadur-singh
515,152,175 *3497F2CC55D712EC0436988C9BBE43A930CC6C58 LAMARFUHRMANN
515,152,176 *3491C2F670B77BF47F91D063B724A5EF67630BAA lampeter
515,152,177 *3492D2D545F6C46771346D9F5EE58B7B5CF03F85 LATERVIA
515,152,178 *34946569E5B58A449E74231543AE62219499CAAF РАЗПЯВАЛА
515,152,179 *3497368EEEA18CFC7C85178A64ED420A0C034628 LAVERN.MORERA
515,152,180 *349052C4682CAE6E7B4DF5DC7FA1AB45E2E1361C LCBJAH
515,152,181 *349CED0D2BC8550A404741701C2C6D98E95DF90A ФРИДУНУ
515,152,182 *349924A2E27E45DBB878AA93D69BBDEDE657B3B8 leonelfrancolino
515,152,183 *349379FE0F231791BF74188A68578A9EF98698B7 LEROY.WEDO
515,152,184 *3493342AD7C1187550CF88B2245357A340847FB8 lesliedefense
515,152,185 *3491AE6CEDD52A7877CDF333CD64078B033C0B16 LES.SHORTINO
515,152,186 *349F1986098DB9620D943861FA7297FBD01E326A Lesson-053
515,152,187 *349C9F5EE022929EAC7C3CE7722DEFA761D2E12A LEVI.HOOKANO
515,152,188 *3490258725287D96161E5B5C3B814CD715140392 [email protected]
515,152,189 *349B99237124FF85B8DC9F67C1F3A5B0A3619BB8 LIESANDPROMISES
515,152,190 *3490C1B2C36085512E4F695A3783E08ECFDACE43 [email protected]
515,152,191 *34971D76244C7C7B7953A0E7874DAB9270B0EDEA 033379463x
515,152,192 *349388E32A8C9311B07956BC678EC2EAD97755E6 LINGENREUTE
515,152,193 *3490A7A62C8F71B93319171A0F4EB81A3F1ABA7F 05501619711001ar03400
515,152,194 *349E157C78A1C9D7E47997C6029D2D873DD2AB20 [email protected]
515,152,195 *349129FA9C7449AEFF3CFDAD64485C1F1FF0DBD2 llerin(op25,d795),xviidieb
515,152,196 *349E229F132472108B6F90FEDC3CE97C7B3F13B0 115001 MITEN.SITTEN.LIITTO.VOISI.OSALLISTUA.YRITT
515,152,197 *349DF1973AB33FCDB686FE162429778F009476DB LOYD.MUSCHICK
515,152,198 *349C6444DFCC255FC12FC493735D1688D8897C66 LQYLLN9
515,152,199 *3492D6F6003167743403CBB1A139AEDC6D84711B 1394670 ADDIKTIOT OVAT TARPEIDEN V
515,152,200 *349CF7C9A91877F3F39788F84A4DA05E1554F6D4 1557499 JOTTA-S
515,152,201 *349A891FE88103D2A4E134298F1A4DBBE19A2094 (テレ玉・TVS)などを再送信(地上デジタル放送も含む。)しているケーブルテレビ局もある。
515,152,202 *34915ED75A17A6DAE51AE91918688530F50F8AF1 [email protected]
515,152,203 *349370E34990578D1436902928AF4FE6386384A6 LYNDONLASYONE
515,152,204 *349F933F9B4200B605190976E292252FB5435ABA lzli
515,152,205 *3496D8D3ABB79E32E2D5CE90165B34F9ADC54E40 1740688 video.rereleases.make.movies.cheaper.to.collect..
515,152,206 *3494F0C982B3FFA36FD5E75C46605EB93A4BA789 17 RUSLAN
515,152,207 *3498314C02A025A2A2B87B2AA9A334A88D18479B ma$kinmil
515,152,208 *34924DEC1AB41BF390B5052A21B0667E3C065AC0 (00)~ `q=====B
515,152,209 *349DC7D575C8A79541D5299EB515DE0062041062 MARY NACHREINER
515,152,210 *3496EDCADA7834C920BD65C57530BFF69117744A 03.22.1019
515,152,211 *349FAD2497E14559C8F0B7AF160C2D2A99148F74 MAURITANIAE
515,152,212 *3496D9AFA421626E6BC8E702073C985EFFE682E8 0thatlev
515,152,213 *349DD97A0386E19F01E63FF38B180D6A8CAD54E7 1-KAPAZITAETSVERMINDERUNG
515,152,214 *349509606C622B22546AD0FCE173D5B45CDAC5F5 michalrambert
515,152,215 *349FE1D0690D6481614E3F2B2C4E04BD7255EA35 MIGUEL.BENASHER
515,152,216 *3497253946B5210C437E7638894DD1B8824D9D49 1.laurdan
515,152,217 *349E9BCB00F8B4374399700C754C4031403C4F00 1 LUOKKA-ASTEIKOLLISISTA
515,152,218 *349F6EF83F8CE550368C59D42662FFBF8AAC22B9 1-MUINAISHEPREALAINEN
515,152,219 *349FE0A476F450241D19230F3ABE401817886108 MISCHIF2000
515,152,220 *349C7CA9A663E53D0C71202726E3C51A4CA71686 miseryandgin
515,152,221 *349173F4946026016A02C818FF440867452B92CE 1SNELLEDS
515,152,222 *3495381565D6AB55FDB774D5297A4CFF1E0F5016 1STUCZYNSKIS
515,152,223 *349A9DC712876D6FB68E272CB06315DD4FE67F9A [-modes+tnrR-o4-v0-total18
515,152,224 *3490E095A575D9343358C568A917E74544DB8E1D 12-revisionsverhandlung
515,152,225 *349BC03DE3201587A931CDFA8B2CF98F16B9E399 131313gabriel
515,152,226 *3492B4501CF925E001A1765BE8A505F13C307394 mohammad.hoteit
515,152,227 *3499B116B7C0C1E33BEF1CFEC40CB394E2020C46 1turli12
515,152,228 *34905CBF906717CF92385BE2CEABF0D4FC2DDD26 MONTY.MODIQUE
515,152,229 *349C87BCE6EA791997A40E11FECFC905FDD7469F 2001-08-14 PEEL SESSION
515,152,230 *3496D2F6703321E6872A7C870E91D03442254303 2008-07-06:FESTIVALROCKWERCHTER2008,WERCHTER,BELGIUM
515,152,231 *349D51E16CB673D95B9EB43B960BEF973F8E3D70 274OMAR
515,152,232 *349A519B1B0D09515C019609A5CE0E585306CB30 2871433 melko.yleinen.on.my
515,152,233 *349F64F57A3894276461F72BF9986059FBBBBF41 2984650aub
515,152,234 *3492FD4BEF88D02CFD12E88F9E7266BC1FB8860A 2DGIDDENS
515,152,235 *3494D97CFFEB888EAA6C33090695315EAA4A73A0 19-02-1045
515,152,236 *34975704B946BEC6B265BAAB84EEC0E9CD29F8DD 198-sebepleri
515,152,237 *349E6DB575101FA8CF536F5E619800B255141B32 neal.baines
515,152,238 *3499BBB4DAC3857A864894AD0E37EF3D83408771 1.ARDREDAKTEUR
515,152,239 *34914E82C054181DE1DBA6A74BEBCFCBEBAB1BC6 néprajzgyűjtői
515,152,240 *349BEB2E348C9430F4750377B805C544937DDBB9 nforward
515,152,241 *349698DD1F7F15893330AE880293C677E766D139 1 DICHTUNGSSYSTEM
515,152,242 *349E217590195DC7E61513A53641CCC23A191711 nick.trogdon
515,152,243 *34942F177AA62E28ED295E46236C346FA0D099FA 1 DRITTWELTLANDES
515,152,244 *3494014948E06F1ADEA30F25858BC8B37E87C930 2TECTOQUINONE
515,152,245 *3499C29B30BC67B7211ACF0C252193269D1F933E 1.HALLUX-VALGUS-NACHTSCHIENE
515,152,246 *34937FA98F6F40CBB844170EAE61737852DD6086 nji321456
515,152,247 *349F522E3F64C409E31819612682AD89BD98CF74 NO-MININUM-NUMERATOR
515,152,248 *349B0D080D9D6E4D6CF5B9F40DF104E7A3520600 1JONGLAGE-KURSUS
515,152,249 *3491BBA6B85876A0913A46EB2AD593E8ACC5A361 1JOUKKUEENPELI
515,152,250 *34962B33333D29CAE41367ABCBC313B5EBE2E1C8 noor.fawzi
515,152,251 *349C143A2CCAD1C644CC6EA5EBFC024047906A44 1KPI-NACHFOLGEPARTEI
515,152,252 *349966FFBA66D2E511AEEF4EFCCEE97BCA1A8F4B NORMANDPROTIN
515,152,253 *349C1A7780BB8CEB587FF2A9E22DAE1DD8679225 NORRISBURD
515,152,254 *34946A2984A37752A53BE0D66C0365A473CCC89E 1 LUOTTOASIAKIRJOJEN
515,152,255 *3494B416C4475A973F79E9B0729540E0A45C79F0 1manittuja
515,152,256 *3496B77B24173CF19074A490702365BEA5611944 [email protected]
515,152,257 *349086D80EEEFC9F43E3D42F5BD994F9C6C896B5 Number.45
515,152,258 *34936E202E8C8B16CA2833C180CB933790D676A6 O124479
515,152,259 *3494316453D5F8979227E53AA80665068DCF3451 O144310
515,152,260 *34911A7E1325D0F20B706B25989655CCBA2F3409 O1D!E$
515,152,261 *3491D69B923738BF24CEFB6C4E1A7A10AAAB6EFE (>-<)o~<####3
515,152,262 *349DED97659A6D29C92CAE01F9D1FDD7DFDA1E26 1-OSAKASARKKITEHDIT
515,152,263 *349F2E72CACB064ED6234CCCC5D20C92586B2B87 „OBSESSION“
515,152,264 *349BBBDD8CEAA87EFD7CBD7FB02BA8A0970FD24E [email protected]
515,152,265 *34952D1F19FD163FED55FC1BB274EAD811D64732 O><* * *DB
515,152,266 *3496A88CDA760544141E7008A4829F66F53EFE5D 1REIVOORG
515,152,267 *34901041A86C48A6692838F15890C9A44C1BD14B 1rinnesuon
515,152,268 *3494DF4A81281867127DEC819252F8AFE9772BA0 OILBRACH
515,152,269 *349590670BFA37CA545E0C7A496A9A1B05FD97BF OILFIELDAUK
515,152,270 *3495AE2DE1D7720583FE525F5A2942355796A4F9 okeeffen8
515,152,271 *349F902FA05DB58A270C536BB48AC891B0352FA1 OLEUMS0
515,152,272 *3495C6807D91EA57BD51B8F2EB95D6A1861F61F0 OLLIEBEHANAN
515,152,273 *34933FC3283BC7AC5A4F3F52CC6033E6B98672B4 1substandardwohnungen
515,152,274 *349E15BB1BE78AF9C9C2477FFDFC589A8600EB47 1-typennummer
515,152,275 *349F7F3A8EFC09C5B41F2CA87B13DCB9D3A139A7 ONIONPEEL!
515,152,276 *3496FE380F2A25D93678DF940DB89C499A1C3740 oreo0809
515,152,277 *349F38CEA2605A63970CE976B974CF8A4FAB1AC3 Our trust exchanged dependency
515,152,278 *349FF9D6510BBAD986745F8A999D6A0D6E7BD3DE 3 PILTTI
515,152,279 *3494584BE501D828A63588B44695E5E639AD4FAB 3:$total=0;
515,152,280 *349924A6909C32B6BE65C86764253C943BBA91BA PALEONTOLOGIĘ
515,152,281 *349B4FC9311D77F51A0FE46283E7187F3D8FA89E 463572 WIR-REDEN-UND-TRINKEN-.
515,152,282 *349B7871CDA97BF14A69CFECE84CEF7F3D80CC3B 2407329 AINAKINJ
515,152,283 *349CDED3CCAE8056E0E8371D4E66810F143573C8 PARADISE-(DJ-TOM-STEVENS-MIX)
515,152,284 *3495037782730B975199E2B7B1347C63EE88574A paulan86
515,152,285 *349354357252E98D5854FBA0213831A2EF656FF4 paulo91
515,152,286 *34921C62C884E7D326C23A368CD5AAA48261CCE1 4NANGITNORF
515,152,287 *349C8BF9242F3E37D2849E5A080854781EE75989 PERCUSIION
515,152,288 *349957A5186B86017CD4C1346DA165A0FAD18AE3 4WARRIORSORCHID
515,152,289 *3494DFF825B00DC98DE31E96A34AF58464340324 531e
515,152,290 *349ACB32EA83D6948032826F29BC68CA36D96616 PHIL.SOLLY
515,152,291 *34906921463819AC5289303B3DB26A785CA6B754 2iamadg4
515,152,292 *34931BB64F5C73FAB5FA2096F090C90880E42953 5BSWEHEAVYBSW
515,152,293 *3492ED6A60E3637695F3D72348368CE9EAD8C90C ponyboy.(ponybabe.edit)
515,152,294 *3496460AEFC02ACE5EF495FD01522BDD9994DD09 PORTLAND2009
515,152,295 *349458F5B9F76B7F5C482AD2125778C8563CCFAF p---p**)O(
515,152,296 *349E0A298081A143890B1E4C2A135D2050ACE3E2 38SOLVEIG
515,152,297 *3491C00722B2E907F7777ACDA4FA12BD3610B39B 5NEGONICR
515,152,298 *34988809A17D2994872C8DC4B7FFAC6F5E7DC71F 5protokolle
515,152,299 *3492C5F0DAF305EECC30A99938B15C256948860D 3CRUZASTE
515,152,300 *349DB08EA838DF71AE8E3FC62FEB36C92D221D83 5TAUROKOLLA
515,152,301 *349222F047A4448283A77350F055DF63BD500BC3 5USHZPMHDDXI
515,152,302 *3492001EA27B6F4FCD6E88377E85FA66D7C0D9DB 5WINBZZZZ
515,152,303 *34927C51F1486BA05EBF9651B89325BB17EB5829 3-MAUSETOTEN
515,152,304 *349E7DDDB608C4290B80D9DF3278B199B7B070A4 3.muehleck
515,152,305 *34912A5070FA4E99CC376C6782DE803D9BA4F990 psychiatria!
515,152,306 *3494049A56DBBAF5A88B3C0204BAA406B72ED144 p?`t
515,152,307 *349E8D5B5A95B57A010437118C5D25684425C650 3 SCANDANAVIAN
515,152,308 *349D59C241AA974C94AB76DB9807E1EA40C2E565 q####b* splat
515,152,309 *349DAACC52D0688EC19918198328842F1C192B7B 6BUTTOCKMAIL
515,152,310 *3497F3745D80E516B5551758EC75950F4109B5EF 6ERELLOKO
515,152,311 *34970C3D02738103D5D3447A3564FC7DA03CD10D 4BLACKIEG
515,152,312 *3496892C89D9C0A4A57305C8975B16F48D5493DC 4ESKADERT
515,152,313 *349DD2104E6B12B1F8AB8659B0F036EBF9745319 4HATTONPSYCHO
515,152,314 *3492DBFD02C0B8232D249E86B16E6751BD14C693 4ITERDIJK
515,152,315 *349BE98F20BF2DBCB9F4A1690474977FB5DCA12A 4MARILYNALYSSA
515,152,316 *349AEA417068FF0E0A66FBD5009277B7C262DCD6 4NEGNIHGEW
515,152,317 *3492A994DFAA3BC4E8EB53BD62F73A8F03044EEE 4NEJNEPOSKOZEN
515,152,318 *349893E82E507839D16EE9F85641E01ECBFA0DD5 4PANETTAIO
515,152,319 *34940DDD9BC62CC9F1218309709603A4119ED7D5 4PSHFISMENA
515,152,320 *349A0514CFC567474BED5F4B51EA093C8288D62A 4ROTATESIZE
515,152,321 *3493F95CCD744296FC0EABE6C6C4EEE562831047 4themailer1
515,152,322 *3499D3B7D63794B0A414E68269080216DC9EE391 52010DC0474
515,152,323 *349AC1C13E41E1F873C7FD63FBFE8E52F6096753 quinn.fagan
515,152,324 *349DD3E68F06C77B256F5BBA4A71FBC82DC19BFD quintonackermann
515,152,325 *349014E18E5321FC34746A8E6E86853FB0A839EB QUOTFOOTBALLQUOT
515,152,326 *34949B01FF9D313C45159E732EC7AF2773523B0D 5EGUE5
515,152,327 *34966E079BE74E8C42EF81B66DCEC568E3D2D1E7 6mywinniethepooh4
515,152,328 *349C328BB19287335A047BB3A0F802B362A6A207 ralphstupak
515,152,329 *3490E91D49E43C05FF3FAFEB08F90343C205A369 randellhackle
515,152,330 *349DB1F736E2A88F0D0CEEE910D9C06DEAC795C5 6TOKATIGA
515,152,331 *349B00B2D6161F3701AD5917808CA50D7F31ED6D randy-a-flores
515,152,332 *349562111C1BBE7CBFD4EAB1B54DC2D58C7572C6 6 yapilmayacaksa
515,152,333 *3492806C0BEB48FAA7DDB75F0B43D0E17F551B34 704AMBER
515,152,334 *349A6ED23CBE394D2D52512AE5C3F465DC72EA01 RAYMUNDOLARSON
515,152,335 *349F319EFC4B0A8EFE7DF875834C5830F639FA0A RAZVJE
515,152,336 *349B3A05B0226478CB96DBA6E5D390D7844CB7F0 5TA8ILI5CE
515,152,337 *349F74201D257F896D452D91B691F9AEA04B10A3 5TRUMPHTRUMPH
515,152,338 *349953275CA9EE5E82E11307169B5208E5354CA6 7BAUCUSBSW
515,152,339 *3490BFC1D99990ED78AE84790EFADAFFF97939CC REGEKLUNGEN8
515,152,340 *349B3E7E0403DD841B83A7A13AE867AF7DB5CF8B REGGIE.MIYANAGA
515,152,341 *349DFA27F684E52D04B04DE80223ADBDDFC93B1E REGINA
515,152,342 *34943EC0C2F276C195830E88F48C83397D7203C8 rem0un7s
515,152,343 *34914952DEA8DB7A3115C4A94CD174167535D453 6ASUMUKSET
515,152,344 *3498592B402BDD80EB249B0B9F45141658E4127B 7IGNORIRANIM
515,152,345 *349C0D217676C4BB970B272FA6FF7C645A485A57 REPIZCAR1
515,152,346 *349D9A1A38F21A9DFD60B8249BC5D79951C72684 REPLACEDMERGEDCHANGE
515,152,347 *3492C018A13ED35189E5CB8431FA85FEDB3D32E6 6BSWUBVMSCBSW
515,152,348 *34919B6CEF9B2C53603F95EF78FEF4CE70D4FACC 6CASTYLL
515,152,349 *349D94755FCD46545303034F0A1216A10119EBA5 RETSOTTO5
515,152,350 *349FDB10F016783B84DCC7D1EA17CAB42B5894CF 7PENTIUMSPECI
515,152,351 *349783FDC2781B794E1440622D5B0BE034AABCC0 RIO.BRILHANTE
515,152,352 *349EF32CD1AF870CD9B471B38DC2764EA989F4A3 robbycastanio
515,152,353 *3493639178EBE7FD05CAEDDEACA3AA7873590547 ROBERTA-GANNON
515,152,354 *3498D35FB0F1BAF1A03E426809CD99CB1D87303D robtkingman
515,152,355 *34904855A7508A4209106609EB4A8A731ED27819 6ETSTOMIU
515,152,356 *3499B2C0A94DDA9B072ECA0268C47919275EF154 RODNEY PRIDDLE
515,152,357 *349DBF4068DCF0C70D89F5DC187F274CF0CB6D5A ><***@======8
515,152,358 *349C2C6DE150A00CA7894AAB8CEBFD6C2A49BA32 8AIRAASIV
515,152,359 *349BE696AF275F68FC56407F2C54A66C435E9077 6RBMEDNAH
515,152,360 *34974AA302E46D801C71CC5E7674F182998BCED8 rossstern
515,152,361 *349194CD573AAC509B1B64935C49181099CF4BE4 ROWSSAPROTCART
515,152,362 *349B40273F400FBE39242CB025BA3E9E384E6432 6SLDGLSS
515,152,363 *3499B633A9B4853AD2DAED7FBB7E510B8C2658E7 8BSWVORTICITBSW
515,152,364 *349207BF7CA3A50C8178CE3C47DC0761C3850087 rudolfcoley
515,152,365 *3493B126E00BDD16FA1D9DDED07AC846965D436F rudolfrobateau
515,152,366 *349A7021B28FE508B3CF53EF009713E2143C0835 rudy-carrion
515,152,367 *3495FF905F807AB2285877434DDF7A2006666174 RUDY.MEASE
515,152,368 *3496D084C5AE7FD3A39F9AB9A2AF37B38B922DCE ruebenpleasure
515,152,369 *3493DF045A6ED94254B8304C2BBD32020F71EB7E 8iamxyz1
515,152,370 *349D93DA027BD95A4CA271C321AD5A69B39AE4E3 RUSSEL.CECH
515,152,371 *349EC43DE753EF9690653A16F51AFB27099B0E6E russellheidi
515,152,372 *349C5B29407B030F27041A1F3EA549763494FC57 RYKER942
515,152,373 *349C4E25368FC19E4168A849ECCBA618BB376724 9ABGENOTIGTER
515,152,374 *3490D9033FFCD78F8C320426475554FD7FCCCF04 saikench9
515,152,375 *34971ECDA789E3C19084C24A295EE8F76062084A 7FOERNUMN
515,152,376 *34948899ACA6D96D1692B24206BDDDEFB166502D SALZWIESENSTRA
515,152,377 *349AB38F77C9DBB974E37EBFDAEACB90183036FF 7LOKHARIG
515,152,378 *3492D31AB0A05A2CB1248DF96968A46E33A5C1D6 7NUOHLACT
515,152,379 *349BE2FC895967152FDE3B10D3E89B6241B195D0 SANFORDMINKOFF
515,152,380 *349CA8B2CD8210FFE27F0E6E5AF7680A6D397E4E sanfranciscodeolivenza
515,152,381 *3498E164BC2319640D82A0F2AB586C4FEB6D142F sappan
515,152,382 *3490DA51F8CB6D7816D864041781DBB48CCADB26 SARAHHITCH
515,152,383 *349C2101DCEFE4F9C833EE5B6E96D88B76E95712 7sonderbeifall
515,152,384 *3496BA3578F3ECA51F98F71E73D315948B059575 7TNOKISNE
515,152,385 *349A62698AF3FC1806B2588E0145DAD73E09FB76 7YKISTYM
515,152,386 *34904D41FCAFFD76125109A7D4C5D167EDC8C7ED 800+1ACE
515,152,387 *3493658B2284BAD10C0DD7948EA8BE5BB1B99DDE 803459b24ff732148dca27c45d126283
515,152,388 *34916036BF252E405221024189BC67E312139956 A121405
515,152,389 *349234EBDAB4BDCD7C1A421E5F0D90C2BA4816DF 8AZIKIRIK
515,152,390 *34928AF07569CB4F0295B1E02154197E6D2F2E6E SCORTATA1
515,152,391 *3490E94F8B09E840E0262FB0AF9987425EF2FEB1 SEAN.BOWENS
515,152,392 *349CC388EE33CB4303E81AC396D554C6F76AE3B4 sean-warwick
515,152,393 *349F006BD34B37FD99F5F52A48EBB8E6916BB7EF SEARCHINGFORACTION
515,152,394 *349230E9BEBD32960D86AE27B8FDFE1140AB5CB6 AAAX_[
515,152,395 *349A1D3D41DB867B7FBBDD7EC915A762D2E1FD23 AABEW?
515,152,396 *349A1D332DD1EC9391DE3C0D3BDC685408763E3C aabp8
515,152,397 *34905E0969A1FEFE155B2DE687E415C89170E7E8 8KOMORNIH
515,152,398 *349CBCA33184E71DE88C31A6CC852F92143E06EE 8NERHEAFE
515,152,399 *349036EFD73EF523AB166F4788DF248FE6D25B89 aaepet
515,152,400 *3498BEA719C4D625E50E2ECC9A7A3915DBF0A893 8ROBINDONKEY
515,152,401 *3493EDD264845EC967884BDFDB46D0A6E813290D SESSENLUFTROPS
515,152,402 *34972409CFE01364A7234A48C7CD77C172001E37 setshcilthcisrevuz
515,152,403 *349DA54822B4B5C9B75786F2C191A3CB7C8FDC40 8STELKOOH
515,152,404 *34935E7B0BCCF8FE900030202C1E73C9EC10516C SEYMOUR.BEJIL
515,152,405 *34973CFF68945C1CAEAAEBF4E15DCB62066A372C SEŽGATI
515,152,406 *349272F039767E4849A0F4CDB232E634672CE289 8ZEEPOLDE
515,152,407 *34976DF2D20B9C84E5176DBF097B6A601648875B ABQEENCS0
515,152,408 *3490506F651C6C9FF58F7CC6A0979D7AF17D0D7F 981ellie
515,152,409 *349C92760DEEA8FB2D5D5CCD632948695F063A89 ACHARLESROLLS
515,152,410 *349879EF22A46619655FAC3191CC0D9AFFAA200D SHANNONCHARITY3
515,152,411 *3493AA6251AA41E0A16E32360663C7FC41B966B0 ACOOZ
515,152,412 *349081CE0E895F592DCB0910B84C13145CA380D7 acraei
515,152,413 *3495A2174BC03B93C7426556A72AE66522EB89C8 9ERIBOEAN
515,152,414 *349178DF67BD29B32F9A1707DEDC4E7C91057070 a!d="
515,152,415 *349D8D3C8C5BBB7A0590FD39A42D18CB8B3EA4E7 ADASCH81
515,152,416 *3492F8365A33938BAB34D63F16BB75F9712BC4D4 SHERPA0
515,152,417 *3497C03ECC15CEAC6476D6B3096247703FBED65A SHITHEADMADISONING
515,152,418 *3490F6C7648F71F74E20EE8859ACC1E0FA44BA2A [email protected]
515,152,419 *3498B37838D803EBA3B7FF580F8DB25BEF46374A ae:nx
515,152,420 *3490871F804435FDE70B4D2B3EE784DEAF1E806D shynaahuja
515,152,421 *3490F3C373B1B8780564A370455403A0FC964ABE 9VERKUEMMERN
515,152,422 *3494C6DC8EF27A38926162E1B7CF18EE2CCDC6AA af,q
515,152,423 *34966E3F9F8732B57F2023943A402ED284D729CD SIRAVIAL3
515,152,424 *349BCC10F5EC4C4B5E639E80054B90D95DFEF823 A1PN575
515,152,425 *349E3E1BFE1BB81A8B0970AED5F8EC3243E3830D a1q1e
515,152,426 *3498234CEA3E0C5253C121123FD64BC6E21C5A31 [email protected]
515,152,427 *349A0D86CC9D317AC40DE67274E32AB408F02381 a$2r1
515,152,428 *3493AFFE70207F5D53555F4DAC22EE02ABE995A2 ai4:j
515,152,429 *349D2A063C590C389ED50E5EBD42B47121C336E8 AIOTW
515,152,430 *3494448C86906C7206BC5A2D0AC952068900F35F SLUSHILY
515,152,431 *349F5B28F11FF59151D9372FA789880EB89265EC ALEROWAY6
515,152,432 *349EC9675686C5E6F5D6BE87DEB0B23045E06FE2 alie1947
515,152,433 *3494B6B7D1F5F29A8445C7250585BFE58D82C293 ABELSPEACH
515,152,434 *34905AB649E230B29B9065BB0AC08A2314EDB577 ABH$.
515,152,435 *3494E710549D7ABC349B8B54966E9CC8F1C279BE ADELEWYATT
515,152,436 *349FF530A07D006E9DD64CFCCA73FC84DDB240DF adipics
515,152,437 *3494A8AA06BE477EC32DA59A2C19F8B8B3DC0EC4 [email protected]
515,152,438 *349BB0D4ADADA0963D7BA97F03D55328BD496187 amphibianb
515,152,439 *3499CBA602B00318300680071D885C60CB661C60 spieling.
515,152,440 *34901547CCD93B53015A9810A6246D1BF3D46A55 AITR$
515,152,441 *349090DA7F6F8FE35386BFED5FB1FF824DC7F66B STEPHEN.GILLENWATER
515,152,442 *349584FA362104FFDCC173D4ABFC4D0A0FB93159 STEPHENNOVELLO
515,152,443 *3498CD674FFC46FFEBBDAE3B7BA3BBEE1CD6AECF ALFDIME
515,152,444 *3492E465E1E69DE9B09D286BFA80CFCCF13CB5C3 ASEJSIEM2
515,152,445 *3499034E24BE5EAA675CCD8E756FF05B35002248 ASPELISS8
515,152,446 *349A8C1CB236675EC1C31503D7D7CD3B11BA5E4B ALLTHEDAYSOFMYLIFE
515,152,447 *3496ABBB48CED8B246F4B832368414C02A2A41FD ALONZO.PRCHAL
515,152,448 *34931441CF6532F730AD9106E6826C5B99436B1F atu_g
515,152,449 *349CB0DF77C5B4552795B5C68B74D1311C5F1293 AMADOTENNESON
515,152,450 *3496313B768E4E3D3CC40F0AD4A6B5175764F6EC AUGUSTLANDY
515,152,451 *349E050649F7DB2B3BA1B6FB180CD471AF150B00 SUNDANCEESPANOL4
515,152,452 *349BC3FCA0698F710407B8CDAA8193BA7884C255 austinayars
515,152,453 *349E6AF363A03C74D6CD88E5309FA8F02A6ADEE5 auvn_
515,152,454 *349DAB7E5E57720B93D2FE38810BF999ADDDE604 supravalence
515,152,455 *349A61FAA1BF62C11E8B1A05B068E1F569798DED [email protected]
515,152,456 *349C3F6AA80396E8F942EDA70A53F149535C093D AZ0O;
515,152,457 *349639FDF78D33B9114EA2A6F47E5C36E1057DE2 azl
515,152,458 *349E4184D9AF9A63CF82A0BB05D03ECAB1AD4619 >-B00~D##P
515,152,459 *3498B3241463605FDAAF09D126E8290F3A694720 ANTONIA.PULLY
515,152,460 *3492F4B89861BEE2FBE38A8BF0685FD8395DE81C ANTON.JOHNOSN
515,152,461 *34993266D52E5F78D3C49AA3BA211FE62BD4912C ANTON.WARSME
515,152,462 *349AB7DAFBEDBF1922583AD994EBCE6A0E429706 ANURANJAN.JHA
515,152,463 *349CCF45340BBC64928D777D11365E61879E5EB8 [email protected]
515,152,464 *3492C4057D24A6A82FE5D2BA5D936C88152852C4 aonjf
515,152,465 *349E374D53A75EBEA9A29130A9FDDF2891BDC4E6 A&Q-
515,152,466 *349C8BF4B865008988B0F8FA55C014D74E489ABE B7CVU
515,152,467 *3493142FE738896A65768DE64845E64BD71196A1 TECHNISAIS7
515,152,468 *349B613CE9D4E7EB8A7A3DF1B6DBCFDA227A6D3B arbeitsberechtigte
515,152,469 *349256C82736F8551D1A9ED2CAF7CD428AC24C51 teenage.pornstar
515,152,470 *349488667ADD55C9B49B0CB72DE713FA51DBFBEC [email protected]
515,152,471 *349D6827D15FFA2D5A11518B70947843DFB6CBEB ASSSACK4
515,152,472 *349C8EE6DE3D8593CB37A0C449C8006CEE673835 TEUTSCHEHAUß
515,152,473 *3497095CAD1BB50C6DAFE167A6C4D091250FDB2A ATOMATAREIS1
515,152,474 *349724BC618064C11913F3E9B854E167FCB26A0A [email protected]
515,152,475 *349183883BD34D9BE455DBBF712078A86CA71CEA THAD.DEGROAT
515,152,476 *349FE2B9AA7F7FB94EBBDE739C9324E7CEC558B4 thaddeusharnois
515,152,477 *34945198304ABD1D6EBB9A7EDD31074E04065488 AUFSCHNU1
515,152,478 *349C0F4FA57361915314E1EEBDB98213C54FB4BC AUTUMN PARRIS
515,152,479 *349023CB1E97E18AA1292DB778CCA4353BE893A9 av9dy
515,152,480 *3494F4D4D6389820B0E8EBDF4D39911101A41435 TIOIHSOT9
515,152,481 *3490AAF561896118CB47AF1F17D05BDB2E32C2D0 b2rri
515,152,482 *34922AC0ACBE2999D3BB358502726BBE5C480A70 b?3s/
515,152,483 *349E8EDE7FFE88A4AE325B5CEC2A27F7930CF2C8 b""43
515,152,484 *349E14D7386952004E1D14A56242689F10236302 b4sum
515,152,485 *34975D9E1E9B966ED5A05351D8D9FF76D8A5008C [email protected]
515,152,486 *3491639C2AF545AFF45C1B87B0D93903B089C15A To-kakao-psinetai
515,152,487 *3491E08FFADB907D3259E94245D8DB278F30DF81 tommiecamak
515,152,488 *34915F1A8CEF91C20A98F1D47CD9B5E7919474D8 bakerdst3
515,152,489 *3498435C1C34769A9381EF7FAEEE3828C67FB62B BKKE4
515,152,490 *3490D08E79BBB6953078AC312F65CEB32087F328 TONEYTEWKSBURY
515,152,491 *3496F06CD64D276BAE2C3634A71A0D95A38A8980 TÖÖSTUSHOONEST
515,152,492 *349B74E64657F321A158AB6214F6B8FD2F3E4F52 BLAINE.PEARYER
515,152,493 *349A1A253490172AA7C10C9EA16A5271D92C1A19 bartonbultman
515,152,494 *349B6126A0CEC983F266628F32BA8FEAA4CE2AC9 ba=sl
515,152,495 *349859AE671199148F52EB6C9DA763138BE746A7 TREKNIPP5
515,152,496 *349F20D00C02D7BF34ACC493E0E6E7804E271933 bo3nvronm3n+41
515,152,497 *349174CF64BF643591FD8A845D9CAC7379BC5858 bocksecke
515,152,498 *349F56D2E3BE1DC359E7C5009E81E3700FBB99F7 BEMERALD5
515,152,499 *3498376A1A896426FF7CF62605045E074DA54671 BENIW
515,152,500 *3495AEF45D248FA43AAA4182DC70CE6AED190276 BONDIA-I
515,152,501 *34929E05BA536F60714CC1831B3D24D4773F1C3E BERHOLD7
515,152,502 *349833D009B017665E01BA01DB3789308A65A3EE trevorrollheiser
515,152,503 *349502F9A3072652035752A7F2A0497A8C84DCA7 TRICIASEGARS
515,152,504 *34993C375D0BCFE945CD91ADCCC0B833C33036DA BERNARDO.GIER
515,152,505 *3492A644815D77FF527CFDD3369882CB37E805B9 botatoesed
515,152,506 *349420C97AC0EED875540006DCECD861608F4133 triste.recuerdo
515,152,507 *349B2DB5CD71319FE284663D346689D5EF2EB177 BPFB/
515,152,508 *34987545CA4E74942A358070B35C4A6C767A0928 BGW+
515,152,509 *3498CAACB13583A0DA36CB5C3BFAFE4C3FCA2C5E BRADLY.ROTHENBERG
515,152,510 *349E22BA129C33850002E4AAF51CFCFA4EAC9E4A BRANDENULMAN
515,152,511 *3499EFAA917565B6470F58F0EA49A557B62280AD bj)5r
515,152,512 *34919458E654A229A1DBCB42E8CA2BC4B9B4A91F U025-O3
515,152,513 *3490D5FA4EB69BA6947E10D765F10B343E80584F u137uj11iqxn4343
515,152,514 *349329CD3A5642A74B4281AAABD3BD24961945A9 U2NFYJ1SEXZAWZWX6VWHNVMPFKQ
515,152,515 *349B0A81BDEFD7A5660C9A927E35437F6FA70A07 ULISES.R.ESCAMILLA
515,152,516 *34920A9B2B7699F8A3BB348E2B07E5E10A57F587 ULT95U128454
515,152,517 *3497D17FD9D6AA1661AF803C3CADA25E00740877 bljx
515,152,518 *349912D6702290498C4C73C0F2BDD0857815C7E3 btkk7
515,152,519 *34990B1961D47F69F2E4962531F469ADE74AC14B B/P-:
515,152,520 *349531137E89684FBEA1D6C58B8A8A540DB1F8CB c%4;i
515,152,521 *349FB81AEE54336518114AFE1D741429D0CB8E2E uy2
515,152,522 *34902B69210D336910F2C2C01779554FC9ABA8E9 brandonwinberg
515,152,523 *3499F4373FB079B9FBFA7318590F2A0ED7D01454 BRANDY.NICOLE.ROSE
515,152,524 *349C9ABC4EF543C2EB6E146DCA761502258AABB7 ca7bk
515,152,525 *349C0C21E42EDD1E937FDAAFC22687858FF756BF BRENDAN.BENBROOK
515,152,526 *3498E83A75BC2EEC7973FC294F90BF3D8512A05B cafe26
515,152,527 *3496FFBF7B20638B67251BAAFCF2ED03F0F09830 [email protected]
515,152,528 *3493C150C3D6915BBAC570A8A44712CBF1D980F3 [email protected]
515,152,529 *349CADD622817A97C5DBDD524A860BDE3B0B6229 brsg#
515,152,530 *34963B58036077FCF86518FA0EA8F23CEADB5653 BRYANT.GARRELS
515,152,531 *3490AC5EC8EB8D1B56A1CD1A60A768B3862F7C1B BSNB
515,152,532 *3492BA96DEDE2B33F7D3866C1DCE5DBBB49E1945 VENESHREE.MADURAY
515,152,533 *34906BCF3D2C3500A022B1A734EBC4175F99F4CD BUF)D
515,152,534 *34933851E0AC0C973E0C00925BF36DE543B1AF99 buraca.som.sistema
515,152,535 *349CBB152453C8254C846C3CA44EADB1934C3CE8 BURLWATER123
515,152,536 *349301F968229663144F77FA7E45B63CF104C127 bxm_/
515,152,537 *349499BE1527CD214D905E0FFE4065C942A12BA9 ÇATISIZ
515,152,538 *34933C3D8E6FA482D2754604B5B9788BF27F6DC0 veronica-dugar
515,152,539 *3498AA5E8DF626E0A71D4298F6FA7A2D094B0C2C C7PN
515,152,540 *34909144E2F241D398C30E55985204C367D63D53 c"eb.
515,152,541 *349BF20EE96C621BF8209EABD3333182EEF330B8 VIPUL JASANI
515,152,542 *3498D580056E1971201476CB28ADD5297881DE4D cetw%
515,152,543 *3496B38816C2C3F5D71E15A16EE8E1E353DA9046 [email protected]
515,152,544 *34901183FF32CCFC86C8D657666A697287F27A01 CF6A;
515,152,545 *349BAF995DAA78A46C71A74451B5D27F8D87924A VONNPUNZALAN
515,152,546 *34942FAE28F46ADBAEF5D05F8547A08B5B329C8D CHANCE.CROLEY
515,152,547 *349A2697D7D32C218A91D080F6870514FA2FB90E CARLTONBJORGEN
515,152,548 *3498C695A9D00E9DCD49DDCFD2B0DBDD7A3FDA00 CARMELA.SAN.JOSE
515,152,549 *3496CAB484CEE1BA4A00B5FF380CEF887BDEC3D5 CARMELOFRAZEY
515,152,550 *34979D498BFF4833FD23D010A67A7D689D79E125 CHARLESDENTLER
515,152,551 *349B349F18AB0997419C54765B8CBB60B5E4C64C chiefsusan
515,152,552 *349BDD12D078A3338F19C28F598DEF4DF217CEAB carrolcastrejon
515,152,553 *3495E49CB2AAF8407F3BDAC1DB420462906DD15D CHINESETRAIN
515,152,554 *349C3212E032BAC48CFC2D6A0D7C3E8C87BA4012 CATHEDRAP
515,152,555 *349F947F346B2C1A25A033E5333EA5B3EBBAB03E chq.-
515,152,556 *349AD38C881F55BEDE9F42C064ADA030532B8C46 CHRISTIANVINAS
515,152,557 *349A95A252559D37E9CB68157B4C6A0FB86F4595 CITIES OF THE FUTURE - SIDE A
515,152,558 *349F9A0BF3D4BC2075AE6CAD141FAF10AA43DA5A [email protected]
515,152,559 *349D490AB3AF92AFA158BD38953E381039852BAE WANNABE
515,152,560 *349F281F50D672D3DF90BB4C7632DB3F95308197 cjp+!
515,152,561 *3490114D5267ACC4329AE3D7BDB8AFA4EF49230E WAYNEGRAYMAILS
515,152,562 *349C0E1651277909B586F091276E23BD2A1F5127 cello.sonata.in.g.minor.op.65:.ii..moderato
515,152,563 *3496DB880338E0BF31837A186D3062FCCBD77414 cl&tb
515,152,564 *34987A44B73F76A6CCD115BDE05E3D78FC636D44 CGD5C
515,152,565 *349D649FB3E8A2240A07E79FE62F19C60BC576F8 chanel11
515,152,566 *34984B5BEF4E5C9763BA02E3480C2437C876D874 COMOYEGUABRAVA/VENPORFAVOR
515,152,567 *3493F4FE1F89DAD56E24886CC593D9335C1F359B CONCENTRAIS.
515,152,568 *3494DB3F9FF3D90EB96671C74AB64E2DB236B0C7 [email protected]
515,152,569 *34902A907173DA0231F5F24496C0A779F2799C22 CONCLUDE
515,152,570 *349FC95F021A5F00ECF0E464D723D075EBE1BACB Whoreship
515,152,571 *3492305DE5F018C99CD2B70873F18AB805112A4B contraposing?
515,152,572 *3497AF0721D7A01498CBAC4C70F782EC8A5D8098 cordellpeddicord
515,152,573 *3492E4939AD769DFCB37A6807F38B331D47CA416 C%OV
515,152,574 *349C0D31E63C37DE52169AB05ABF70BCC265E130 WOODROWURAN
515,152,575 *34917BC44774F8E067968A49522E1394B537F26E worsethanthesilence
515,152,576 *349C5B570A71C9CC48FC468933B46198455A5EB5 WRITER-PROFILE
515,152,577 *349A6493BC3F5532CFF358C7DBF15FD4679EFEBE cr)d"
515,152,578 *3496E5174F883CC58063F1BB249F2410367EDA17 WWW.KERRDENTAL.COM
515,152,579 *349211F063B950AFE855F93833299C30F9FCE9D2 cslssly7
515,152,580 *349859A54EC64198E44139D4996BDF971EABF46E clintcassanova
515,152,581 *3495987028A409180AEEFF9C3C485839D9EB74AF CLIT3
515,152,582 *349D4745F6E803048EE5E64B10A93FA3908E5DB9 CMAIH
515,152,583 *3494633639DB9861238038E6FC74B1E9C78BE386 D2_)
515,152,584 *3491494AD21B496F044A617240862E838462C383 d"3s:
515,152,585 *3498ADEE8DD8DBCF9CFCFEB39D62483BCB7AA802 Y8QDSQ
515,152,586 *3493DD46DF8A9238B4FB2CAAAC2A4FE761FD783E D5ILK
515,152,587 *349F90A654919F3991CE0DAB6C85D664D08EA25E YANKEESELIZABET2
515,152,588 *349B97A65FCA5B7C39368B41CC1B4DB891577109 coloredribbons
515,152,589 *3492CB3DBF4CE0A2F7E1D94C379D9643F1876ECA yerri.portillo
515,152,590 *349FAC47817FE7892E4BE5122075487F6A197F7C yhet.gatinga
515,152,591 *3490A4ED96B64846623225148DE69137B85F13FF CONNIEFREIJE
515,152,592 *349CD4B14266BD53FD33BA17F2DF4114C12E904A CONSERTARLHE
515,152,593 *349EEFF4AFB3A8D32EECF79BD951168596B6EE3D COOMI
515,152,594 *3490FB6721A9958D4E79BC0234FC75330BA721B5 cpbo5
515,152,595 *349C730DCE154E79F80193CE1D114188F99B911C cp;q(
515,152,596 *349695FF676354B3A1313D6927DF0CA3DCAFD510 crfb
515,152,597 *349B292350E04368B03B2D295286804AC0C19552 CRISTOFER08040
515,152,598 *34991384CCB36BF218835475DB0CB4515686CF40 CSA.%
515,152,599 *3493B720E87E7CA558ECDBC444D7EAF307C45311 c::t(
515,152,600 *3499CFE1353C6B63805310B0BBFB83365F2021D7 zanegirten
515,152,601 *34992936D297FFDE47432D01625B76CDA25CBBF3 ct?h
515,152,602 *34911D2538716EBCFDE90F5DAE055D2E548846F4 DCPL4
515,152,603 *34988025317D20711211BDA2360AD13642B600E2 [email protected]
515,152,604 *3491124C8DB2262678E350DF4543330328A7727A cus-r
515,152,605 *349E1C370ABCC921DEC23BCF49DDF60E240D5CFA CV-IK
515,152,606 *34912AACF38FD930784B9CC2DF7C1F58D682178F DEJ"
515,152,607 *3498E398F457F974F94EE8E6D1D2B42BD187B6C7 znn`
515,152,608 *34970E5C3F5D5F681DF7C4226B7991820E2B1FB6 CZC7U
515,152,609 *3499012475512FAFBCFBE3B478A0FDCDA65FCF08 zweierteam
515,152,610 *3497BE96A81B6B9EAD8A5AE39BDF274B49BE931E ΘΕΡΊΣΩ
515,152,611 *349FE3880136C71589A87B18CFC080EC2701DEDB detainmulac
515,152,612 *349678322174D2BF17ECC8BCF3D1C2D0E0283980 DGQHG
515,152,613 *349C50B45AF1FBDA8D04EAF030D1C9BB4E6A4E14 DICK.DENDY
515,152,614 *34905975A042D1D30C6A5A92C9767FDB1C0B4DCC DIETHYLETHANOLAMINE
515,152,615 *349C49A6580DA51D0B78773A5A9B17D7834CC1F0 dj?lp
515,152,616 *349E36D34B5115650AFA7CA291BF24D996EEFD3E ПРОТЕЗА
515,152,617 *3497872ACD381673E168A84EEF94BA834ACF89C3 DLZ"2
515,152,618 *349730B317858B002754C01197903E6855CD1AD4 DMITRIY-REKISH
515,152,619 *3497D906887360AF5AE2293176A9F8663713E774 ТОКВИ́ЛЬ
515,152,620 *349676FE4A376065E172416BC57C88F185F3AE1F deliveryourself
515,152,621 *34991DA7A9BC1EA663F828E85FDBE0D1B8CBAAD7 [email protected]
515,152,622 *349063B5B83EE6F602CDA0F0A87AC579279912FD DENNY.ELSEN
515,152,623 *349A9EB3BC3FD0A662773E7FF1E9243736244AE7 dominikan_princesz
515,152,624 *3490705D8F7CF5A11FE3BDDA2FC99D1304755547 “DEPRAVED
515,152,625 *349BCE83899D65214A1F6B2CA4EB2B9E3DDC2E1B DESBAGARAM1234
515,152,626 *349D443385FC11FC7A148149C600574F4D36D0CB detrejos0
515,152,627 *349B6237E309409DB8E8E38206866CA41304A2AF doubleconcave
515,152,628 *3495308730598FB283313D3E83330D2285F03ADE devinriggles
515,152,629 *34930368D548BDBE06AF8E35B7E933DAA5FEE911 DOUP
515,152,630 *3492936C3036C0F9383BB006160682907CFEF46A DQCKP
515,152,631 *349130A3EF3C4B85D0871802058C636C73E14A01 DIBQU
515,152,632 *349FF8E80C01A102B03CB807F5D88C14DA670B17 dinkeds1
515,152,633 *3492EE041817B02E67E190F744502152E090C29D DZW3D
515,152,634 *3495BF320AD1B794218C0EA1EC55134E77C058CB 標高:819M
515,152,635 *349E16696AA3392A3C6E13889779FA38FB223C27 DONOVAN.GUSTITUS
515,152,636 *349B7151843BA481F124BD10A8BA2AD853010F15 海兵隊向け。機首を改良し、apg
515,152,637 *3493866FBBFA886E1518EF90E5527D9608A2FA86 dts#
515,152,638 *3495D1F85B3D8B935E7C6D52CEB87AB1CFB47BC6 DY0=G
515,152,639 *3496F09D76DE2D94BD9D91DC0712B2421D3AF4B8 [email protected]
515,152,640 *349D127D0F5F426797FB9DAF9A2BBF99986003A5 EAVV
515,152,641 *3498FEAC24166F743635C9E7820F755059A34534 ENIUGNOT4
515,152,642 *349D82CCECABEC6E6A582F6E711A4E64DB036505 EDMUNDO-CETINA-Y-VEL
515,152,643 *3490E74FBE472CF9720995408729F06AC4752DCE ED#ZD
515,152,644 *3499B59C8F1CC412DB891C257D57BF37E6D49578 ei6;_
515,152,645 *3492B3E1DBDBCC46F0048133BA90972873D0F3EC EICKEMEYER將會被判
515,152,646 *349667AA280004C0C525BACB5707199E213D0700 EIRRAUQC8
515,152,647 *3496C4E994971B08C90E9DC3988A01597A7EE3E3 erniecollyer
515,152,648 *3498066B33414A1205C759E17A938E02C92FFC6D ERWIN.DAUDT
515,152,649 *349148208682C0C8B215480FAD86BCC91BE54F37 Es-liegt-an-ihnen,-es-zu-tun
515,152,650 *349A4A11684C1B836AC049A7469677DC680AE151 1377687 sidonta.p
515,152,651 *349D0728BCF879DE2C63B981C09212C79A7DD8AC ESTELAS EGIPCIAS
515,152,652 *3499328026E3CC3258FAC946FB6A901B9846AC2B ELMO.KUN
515,152,653 *3493306251383C1F498EF006D385C9D97A7ECAA5 1624125 nur-einige-fans-aus-berlin-kamen-regelmaessig-.
515,152,654 *34990D00559F0EEE2E97237F9E1E3BE44505FF3D evanstryker
515,152,655 *3490F00799C47D89CC1146D820196775FA6D9CEA EVRIMDEVRIM
515,152,656 *349B2937996021C24D77FC04FC230E2899AC39CE 1844209 ONMY
515,152,657 *3498D4D5007AEE2518012C413C20F2415A1343EB emdtu
515,152,658 *3492E97557B39E100D6511BBDE48E022AF462621 EMMANUEL.WADDINGTON
515,152,659 *349E852CD12DBFC586649E2E9111FA8BEB0C2E1A emmettrisewick
515,152,660 *349161291D42833A69AC0C19557485D4D7A1C5EC 18.heath
515,152,661 *349D2648FCD46E6699424E0343F535F535231161 1 AURORA-LIKE
515,152,662 *349D1680859E92652F9415D6F989EB02CD100A3C enm#=
515,152,663 *349DAA3780213FDAC0F3A89C0D14EF09EBEA197F ENOCH.ISOME
515,152,664 *3492698211628350A393DB3BAED4CC892837EE2F 1-blacksnake
515,152,665 *3499CF0AB315464C7E15470CE466E721BF740417 „ENTGEGENGEARBEITET“
515,152,666 *349C6CF188E3F652D820C9960085BBFF2F6F0ED8 'fairsir,youspitonmeonwednesdaylast;
515,152,667 *349E823E7F4301712249568F2809F6556CD18E13 FAUSTISSIME
515,152,668 *34941EDC4A72DA7E7EF00F940097CB892398EF9F EPJTC
515,152,669 *34986B57C598108C7ACF8556DDE2D86848CAE500 EQUIPDAD
515,152,670 *34954AFEA1377EF72BED390EF93FB275B2ABE2D2 FIELDSSHERINA
515,152,671 *349B536C063D65709E6896DD5E3577C8D545C6E5 ereilatsing
515,152,672 *3490FEDE0AC9DE9068655767661B162F40967FA2 ESCLIPPA
515,152,673 *349D20BA418C3923A1F4EC9346AF1583B487D47A ESHETEH
515,152,674 *349566DD8F0671EC8C0BD2F803786EB0BA55BADE [email protected]
515,152,675 *34963BBF47BB35966BB712DE55DA5179DA451F84 FLAVIUSBORZ1
515,152,676 *349BB6C6891074C178E13E9DA13F81FD007038FA 1O8O7OMIE5
515,152,677 *349D56B1BA9E3B8329B8F58EC048ACCD8DCDC071 1-pakyuz
515,152,678 *34951A94D06FE43C155569AC636FFA16DFE12968 FLORENTINOALLIANCE
515,152,679 *34934BE768C78B158427FE58D68A87276FBAF898 1-puuskaisten
515,152,680 *34914EB4558C3A4E16E44E9096FA3CD13FD26A88 foliahistoriconaturaliamuseimatraensis
515,152,681 *34934B9D3B0B3B3134D703D721E2F26C2CF07E73 1.tasosarja
515,152,682 *349EC2FAF5E211EEBD7B7D2B0079C708FB580910 1 TELEKONSULTIT
515,152,683 *3491DD220FBE1638F43DA916523954F69ED8A9C3 1-tennis-organisator
515,152,684 *3495252EC501FC6CFECDE62048E9A4C8162D981E FRANCISCOMCBEATH
515,152,685 *349BF65652ADC2657DD161BAB0489C12316DB897 1uwabgeordnete
515,152,686 *349E321452A08A41A7D7C70A222D1F36F3B40C24 FREDETTES0
515,152,687 *3491A2A0F1E2E06AFF0CA769019843B23B34CB05 FRICANDEL?
515,152,688 *34933CF0E2A6EBE2639CFDB6B006160BC5718D6B fs?<
515,152,689 *3491E57C5A5B772553B0B146A002574797892A97 Everybody's-Talking-About-Sadie-Green
515,152,690 *349C0AE4D8DB1550DAA4909B0BD3E154AB99F0F4 everythingwillflow(rollo'svocal)
515,152,691 *349BD9CF35B76C1878052A4308A35411DD979AF1 EX+R4C+0R$
515,152,692 *34938B85FDB69823EF5AABF674D92F7D01050176 2397655 KOMMENTAR.:.DIE.GEHOERT.BERLIN.!
515,152,693 *349FDBD481FD21B6D579163E3FCD7C9ED85DDCCC 249059 kirjanesipuheenonkirjoittanutelinkeinoel
515,152,694 *349F6EB73C1E3D77136CD855862C689C2EB41131 galekern
515,152,695 *34945CE13A769D40DB7EA77DC4CF4AD41550C28E EZESTACION
515,152,696 *3499182630E1464036F560D3D380F1F77ACA1DFE 2689491 muita-kotiin-viemisi
515,152,697 *349EFA019843DE4673A08CA6336A20867C78070F [email protected]
515,152,698 *349E1DA89638E7CB7DFA767F00E27E3F618E8FA6 2BOOMGIF
515,152,699 *3492B562EC607228A0F7A5D200A0966B9493500F FAHJUNG
515,152,700 *34957079870D6240DD015D274EBFF2D0217DC9AF 2.GRUNDLAGEDERREICHSGRUENDUNGBISMARCKSUND
515,152,701 *3493A13A063CE37DC599F775D880BE0790530CF8 2ilovewarner
515,152,702 *3499DD465872F904A052B25EAA2BFFC5AB53874C 2NERDDREN
515,152,703 *349A36C70DE375EB2421CCAC5E3AF29E73B05689 2 NFZ
515,152,704 *349C463D2D96B7E4A831250F455C2ED2C4BA8059 GEREINT.ALMEKIA
515,152,705 *349DEBBDA9DCF52CDADEB6D15A57676033D41D8E FARIHAH-FAUZI
515,152,706 *3491AE412D23E487D0ABD63CA840CAC152490D9D gingerpatricia
515,152,707 *34932C1F558C35D8210775E697E9F0C16DC165AB GLENFORD2
515,152,708 *349FDF7ED3D67C22F87DB1EB738850C417FC767D gmtvrdning
515,152,709 *349FBD211616676419088954F71BC8502F1DE5E4 FIFANTASY
515,152,710 *3498D9BEAACDF6F6225B45B9A56897890D7E05D1 GONZALO.CURATOLO
515,152,711 *349E7845A664F404FC129962DE40D12DE6C44D6C gouge-away-(breakz-mix)
515,152,712 *3491E8F24604102D14710B676DE8E47AB538782D FINNEGAN135
515,152,713 *34934C8880EF6B49D4269AE62805201E4CBD152A GRANTBOXX
515,152,714 *3493AC0B92A79DC5C84B5DC53C89DC89DC3D0C1F 3HIESERICH
515,152,715 *3494560ACAA3A436BCD8B2455A07FA12D8EEDA04 flacon
515,152,716 *3493F0DFF59FBA8ED3B0C0557CB5C20311E56E2D grues0mer
515,152,717 *349192832284625529494D4BBE6C6A8AEDAD03C9 FLORESDELUNA
515,152,718 *3493F34DD3E504AC166280E1069593DB5266D271 3STAPEDIU
515,152,719 *3493D1059938FD8E2B54C6B645EAAAF8025E521B fluii.
515,152,720 *349F2BAC833AECF5EE25D3D82B1DA3C0926BF55A GUYCREEL
515,152,721 *349EDD820974C4AA4F32E097941639B8B33C078B 466VICENTE
515,152,722 *349EAF81AA07A45AA5CC15D1BCCE84C37257DA19 FNJPN
515,152,723 *34970D48B50AF27F5F0DF459D809E73C9E557667 4ATIDOMOC
515,152,724 *34996D426746312706F1140329EABE73CF09E343 4fiyatlarImIzla
515,152,725 *3490B18CC9AA3FAC6A5041EFE54E067C02C568F5 haciendo.lo.nuestro
515,152,726 *349D8FFCF0F834E6D98D209E52CD7B1EB447A4EE [email protected]
515,152,727 *349487564BA24DFE0A9BF569C67520A1DD32DE82 4PARGETTYNGE
515,152,728 *3491C3CC7E6FC1E45A52AC28D5231B07DC7C564C fredkennard
515,152,729 *34989E25DECFE0A7923A886EA3326B922EAC0E35 FREDRICK.ASELTINE
515,152,730 *349DBFF70AFFB82FFB6D3870BA51CE7DF7FA6D0F HARRISON.BRILEY
515,152,731 *349823256C9B33A27ED7C9E5F1E1D4288B0A408F 4TWICEMEASURE
515,152,732 *34927E6AD893537C42BC223CD7ACDF96E4198341 4WHISKYMATT
515,152,733 *349872C4B6A88B39FD5AD0DE891FEA2460E44CEA FRODOBRADLEY
515,152,734 *349E26F5C66274DB1FFAE2C07DFE825C5405F8C6 fromrussiawithlo
515,152,735 *34903F7A30E363D1CB2679DD3B3F58EBA328DBED 5847WSXQAZ
515,152,736 *349EBE9EA2B5AD1B39E92B9C8F571BE01297A6F6 [email protected]
515,152,737 *349C0546919FC8A73169950788CE8FF9B602F90A 599599AM
515,152,738 *34909FA13B61E08D7166E9CF31C4427C37B59C87 HERMAN.ANGLUM
515,152,739 *34956EF99604C665CD25C2B49299869069FA7A26 5BADGERCHICO
515,152,740 *3498634146021F4620891E2D3B5B606425A8BF34 HETER4RCH
515,152,741 *34908B6882A38EDB3CC6361C6B91BA8D33B9E49A gajaho00
515,152,742 *34938684FB1F1957C279C0472A6C37FCD618DEE5 GAMEBOY24
515,152,743 *3492BFF6424AECE68E7C8689F1F094AB41845A60 5KATHERINHOLLY
515,152,744 *34958C9F06B5F56316E4CB15F099F07E2430366F „HOLDE“
515,152,745 *349C4438B9FBB02D65FC1B8067B6A85C6B106208 garranchas
515,152,746 *349FA87B9A760E62F2CDDC559E4FF3CB651A6DC2 GARRY.ENDITO
515,152,747 *349D3E0822AD7993FFAEA0B1826108C91FACE431 GARY.JESSEE
515,152,748 *3491B2D7F4303B32CD47D404299F37236D52FDC4 5POURTANT
515,152,749 *349DCD92E9085A92A1D8DD85EDD2580D6EAAB6B4 5RUPISSENT
515,152,750 *3499ACD7D0A257D3C8FDBF1E6AE70D0062B96B35 httpwwwboomerbible
515,152,751 *349932CE6459AADE4CB152621E3923B8B9401B16 humbertoloendorf
515,152,752 *349695FE5A3D12E92B1A6545AA0A87BF49E1B262 635416 CETIN-ALTAN'A-DEVAM-EDECEGIZ-.
515,152,753 *349D2464CD2823A4B858F71D26B470C8A06913EB 642184 smartcard.bedeli.40-usd.ilave.edilir..
515,152,754 *3495A006345B97C27EA49168C774FD042843C8EB HYBRSTC7
515,152,755 *349BBCD1E117ADDD07861B42693F6250DC8770A1 6AHVENANMERI
515,152,756 *3491DD3F35F07B13433F4EC69403C45DB4F120B6 icanzorgauwww
515,152,757 *3495DC58F7F78CFE47627BB5A7BBE6E334966A86 IF-ONLY-&-SOMETIMES-(TURN-AWAY-MIX)
515,152,758 *349FE213CC4B3A04C9453FFEBF37F0F7D658459F 6INFCONDS
515,152,759 *349409E7A1C4BDFAB2735C83B1E6E6F6073311AB [email protected]
515,152,760 *349AD8B8B44A96AFE861EA1F77AF83374DA476E8 6RACHELSWEETS
515,152,761 *349E4F963DFBA038D892FC00A49744A8928939BF 6RAINHIT
515,152,762 *34915DC2BE7B6122724281DABA9437B97E1638E2 6SPENSEL
515,152,763 *3490C16FD043C41A3D4CD0BB5C0F09E5C067FAD3 6THERMOMI
515,152,764 *349AA15BB1456C8B5E9CB1F238E4D0A62B2CC744 IMAKREEPER
515,152,765 *349809733D17F09587F62E0D744A77AF7C95928F GROTEBOOMGAARDSTRAAT
515,152,766 *3495E4575D3EAF346E63DA56D651B458F27AC253 INNA BABYLON
515,152,767 *349DAF9461795452790E92A63DA6013ABE69A5E9 [email protected]
515,152,768 *3493F0EB42AA9F3D658F1737A81C8A595DDD2D8E hamelinsong
515,152,769 *3492896C33AB80FCEEC770FD2614A748BA83964B IREULOUP8
515,152,770 *349B62D5FDAE5BE06B9FD07D7671AFFD0B344CF0 I'VE GOT EYES FOR YOU BABY
515,152,771 *34921F91FC2DDB4B2E055A038D6BFF1FF10CD6FC J0RI
515,152,772 *3498B9E82922BE884BC0B86CDE82463E83B4C51B J2"Z
515,152,773 *34979922C58A5227DA4AE0C1A3237CFE44D1FE98 JackLuther
515,152,774 *349771D0588003F66B789A35CEB36C3B98DF585C HEMOCCULT2
515,152,775 *3492FF76000741EEE6B6EC910E6E55ACEC4494DD [email protected]
515,152,776 *349F6828EFFFA5BBA60EDBB79C2FDD71E4509A7D henry375
515,152,777 *349681F02A826C48469B268457A31B4C4A1F02FD JAMISON.SVENNUNGSEN
515,152,778 *3495C9AAE75D96ACDDAFBBDBA3079153146E45E0 [email protected]
515,152,779 *34950CA7FE46C109C5C5900284F94BB5EAC38C01 januarisotherme
515,152,780 *34988255B90536EC4E7157665A14686508B3B0CF 848192 DIE JUNCTION BAR KENNT KEINEN RUHETAG .
515,152,781 *34926E525625E6C0DBC0B2BB93A8F6A557374A1F 8BLUEBIRDCASEY
515,152,782 *3499690EC156BE96593B0E2470164B057436CCCC 8####B`-(O_-)
515,152,783 *3496828C3F667B71CDD0722CE7F9A6B14BB5604A hiperronda.de.m
515,152,784 *349D30C3EAD590A9C49553C7C2B2F177E980AE31 8CMYWYAKC
515,152,785 *349750C1FD8E64C2B0F80C776F04F2987837BBFE 8----d.~o~o.(0-0)
515,152,786 *349C7FCEB085C05ACC446375E308AAB224DF3A53 8ENCREASETH
515,152,787 *3490199BB0241368C7A7EF781705B3727C40ECAC 8GUELADJO
515,152,788 *349BEA97140573FBF37064B9FD34F0DD64735119 8GWTNSNGST
515,152,789 *3490EAADA2FB6B833DDC331C98F1FB3033A2A9AE hoogroodst9
515,152,790 *34937D9CDEAB65CA572068A1A1BF7A7D5B4FE339 JAY-SOULES
515,152,791 *34989A516CAF24E729F25B390A165CE2E4491365 JAYSUS 1 0
515,152,792 *34916D98DCD44BBE3D7981287B23AE4A1386A8B9 8OBLIKOVNIM
515,152,793 *349454ADB9DEC029A9B7A0B2B09C80B86B277A34 JDEBANK
515,152,794 *34919A16E37DC767D70BA1C771ACC95561628809 HOUSTONMCGARRITY
515,152,795 *349164251B62AB30C7E54E9A0C6E428317E8B94D 8#####>-~o-)x(
515,152,796 *3494A5B6EE29CC615238B0C559F10CDC14A5EE35 8SAMJAKE
515,152,797 *34939ADC26CDD8C45D730293E0300A0E5476D190 jessie694
515,152,798 *349C6E19B9B73FD706E6BC6DF9A466E76167AD57 8TSJILSERDA
515,152,799 *349804316E744259191EE46778D807A2676F82B6 jf`h
515,152,800 *3492ED65DEFEA278ABE20690D8A7FBBC5A129CFE HUNG.ASSALONE
515,152,801 *34992E8B2F15B39360A89F7C517EBD11BCCA9B52 jimbisaillon
515,152,802 *3499AE7AC5BACE2DD066E51517ABA600C8F96CB7 HUSTLEWITMYNINE
515,152,803 *3496098A9159A8ABD9CFF864160E4667D1F27EF1 [email protected]
515,152,804 *3499CC37221E18EE392C6719200D23149E30038E hyblahybla
515,152,805 *349EEE795F2F91AF1874DB4954A129C7B1B55825 987555 the-company-cited-the-need-to-reduce-inventories-.
515,152,806 *3496B7C0233A1F6DBCCBB50927DFFE9EEC441942 HZYWICKI
515,152,807 *349F9BDC677BFAFDD5A112E0D9AA315C82A02275 JNRHSDFQNT
515,152,808 *3490096EF61DE8A607B5BC7DA94C55F17FC296E6 9BSWWILLIAMSSBSW
515,152,809 *3492FBD2F411EF1C6F213761EF2DA17ADA5914E2 [email protected]
515,152,810 *34942FEF268A3983904A9FB3A453116D944B1D0E ic~v
515,152,811 *349B2411B5C0D175CE3FC4831BA718E6CF5470BC JOHNNYMOROLES
515,152,812 *349AB0E47A31382F5F714EE508BDBB28F60169CB JOINENGLISHEFTERNAMN
515,152,813 *3497FAD6E55135E2009AD44188E7AB79D214090A joineth1
515,152,814 *349125DFFA0EEF7BF9520E0C21E947B6E45207D3 9HRACHOR
515,152,815 *34999957EBF7A5063E2051619400EF4335B5F65F 9MYCOURIER8
515,152,816 *34968413EAEAAA07B8DE5890CB2D57B3916235F6 JROYC07
515,152,817 *349AE9FED353251842CDF308E20234462E3582A3 9SOPAIPAS
515,152,818 *349AAA7E7CFAEAA6AB426A2B0F8FA7EC837989B5 JULESSTROEBEL
515,152,819 *3494B6CED48A664A032C94BD8D3916FA7FC56A3C [email protected]
515,152,820 *3492557DC250647A8D1A1C56F7D1DD4D6C1CDEAD JUNGHYUN5
515,152,821 *349A7FF823A9261C09178A91A1ADDAB2667D83B9 JUNGLEJIM
515,152,822 *349A8DEB198F98FAECE3F9D7D0134480D211BBC7 JUST.IMAGINE
515,152,823 *3490D7343C66790FAE5B2930B17455CF7A54340F KAIFU SECTIONS
515,152,824 *34958D141A67FF297D08DE6FA087393CEA02A97D inconsolable2
515,152,825 *3495EB26E1E2C4C9AAD24A330F829ACA33B95DBA kalaskehaving
515,152,826 *349E1F4C388222B6C9D193F230A1A550B094E4E1 a2!g,
515,152,827 *34912E77887A8FC9884D06A0E31EB8CA5481C8AF A;4NQ
515,152,828 *349CCBC0C2B17D530D318D747CD093A7200E8EC9 KAREEM.HENSDILL
515,152,829 *349E649C5DC32C61F2C58110685D1EE578C14469 A5PHQ
515,152,830 *3497B7C45867FCB0A5354669CED8EB0374F39B96 INTERFRATERNITARIO
515,152,831 *349E59A95B67A534FB7E6E6E917CE0C40253F8EE a9|r
515,152,832 *349FF43A6D04A8BFB676B70B79805AFE1CBBD596 aabq+{
515,152,833 *3498771BAAE77994A81841090E55963AE570F2E5 [email protected]
515,152,834 *349270B2E2B9762EF2709C783169758EAA56B4BA [email protected]
515,152,835 *34921064D95D9B26ADC81538B78E7E2194633745 kayla.woerner
515,152,836 *349AE47B9A64D3B407728AC8D3F1F861A75DDBDC IPRAYTHEE/SATTAAMASAGANA
515,152,837 *349BB14BB64DFC77C383AE895ED23837D78144BF ISA65
515,152,838 *3493A9BF57B9DE7CC540175B0AF0BBE4FD4FE2B9 AAFC-
515,152,839 *3493C5E1EF8A50FA8376847196FA6C11483004DD kevinexner
515,152,840 *349EFBE1B03B4F789F25EE0173F87A80E97DFAB2 K(HF
515,152,841 *3498D7D09D2CCC59CDEC20C9D9196025200DC17A kingmascot
515,152,842 *34902A467D308F3B3640702EE26D15AFF9D13B04 kirbyesterly
515,152,843 *349D365B95EC4002B910DA655B392FFBB3BE641F AB:9!
515,152,844 *3490D244EA2DF55736E0C75959403D6E52AD39A2 ABB#[
515,152,845 *34926C83375805D129ED686F94430967359F2FCA KO-JE-ONA
515,152,846 *3495D384CA6A72C090D74FDD7BB1F86E3E1ED824 a)b)k
515,152,847 *34942116653BD080C72626B8DF9641078E756B4C abuot
515,152,848 *349146F5FA8E4E455192578F0573E063FAC0F859 a!c5j
515,152,849 *349726DFDABD245DAA40AFF6E24B7527D7C4F702 krunimo9
515,152,850 *34946C252D6A6F52CFFAA64E56269A2C06E4A443 KTMFINISHES.PROBOARDS.COMKTMFINISHES
515,152,851 *349289EFE5B3BE5D71D7CEB7A4BB070458A12695 ACCLAMAV
515,152,852 *349FA48454656097ECB27C14765C133B3747E54A JAMEKAILI
515,152,853 *3491B426E7DE205D7843E92DF11C6499682CF9B5 JAMELESTOURGEON
515,152,854 *34910D8E67AC788AB896EBB8318BFC3B28937A9E AC,S3
515,152,855 *3497E2E1AD3578CB07003B9A3C7C86C8F3BA4ABF KYKKOTIS
515,152,856 *3494660A286D33F5AECC520CA08DBC7B21C8788D adalwardus
515,152,857 *349B3A0D28B5FDBA4A57805DB612ED8797EED7E6 LAMINARSED
515,152,858 *3499059C1077B54320D181E58BBA3A3DDCC64934 JASPER.CUNG
515,152,859 *349FD0BFF604CE07341DF695B50E4CD3C0783F6B [email protected]
515,152,860 *349EE6CF28E6534D16402DB8F271FF8B5E2FE661 LAQUISHA.MAYFIELD
515,152,861 *34927FDAE39D821DA068581562B118CABFE24216 LATASHA.BEARD
515,152,862 *34958C2ECAC4A46265BE48D1CBE20E1F46AFF31E aek"c
515,152,863 *349B138E79BD09C6AF5C995230E3CD8BC19EEEA3 aerates
515,152,864 *349D558967515CC295BE2C441DB92F4CDAEC13DF AFRUKT
515,152,865 *3498157AB6A1E54BCC6207DE94B9BFC6629C1900 AGG10MERA+I0N$
515,152,866 *349AC78C0393F59FF8026C5B490C2F3A5F1787F2 leifbutrick
515,152,867 *34919B2DE260D2D5142AAF7F503F108F5BA80E75 LEIF EVERLY
515,152,868 *3494AEE1D29069206C561A60B988BA7EB0566A6A LEIGHHUME
515,152,869 *349521144DF6F14B9E16F26D7437D9E9B35B434F ahmh
515,152,870 *3499EF9361554B8A3F780A26968B87D4DFDE2CD1 JEFFRYRICCIO
515,152,871 *349D741C8E3F3A4D790532C74003037F9AE0D47E ai&as
515,152,872 *3492AB732AE26B8563FDC00D911B613D2AB19DE8 LESTROK
515,152,873 *34980A19A97978E324A9DCFF51D5BC27847220B7 AKE7379
515,152,874 *349DF2C1A1076C5C7CF44658AF3E7B2D592BFC16 AKQJ=
515,152,875 *349181886C1BCA8A15D809FCB3F44FF718500F47 AKSISSRP1
515,152,876 *3496733033527E161B2228313009960E9A9B0E62 [email protected]
515,152,877 *349F1BB150FF6D895D5A5137D1E49182A3A834CB alanferster
515,152,878 *34911983E9F103FDB7BB860CB7B31B3C67CD8AD9 ALEC.CUMBY
515,152,879 *349EA8BC8668B7E73E0A931D0401B7D4A241DD07 [email protected]
515,152,880 *3499BB21D5F3A339DF03721AA78D02972D81F00B ALEXPURDOM
515,152,881 *34964849B4241505653BD51C2CB9CF1CD0744485 aliem
515,152,882 *3498627A6FFDCC66667E99787C6AEB6EB951F4E8 [email protected]
515,152,883 *349F413376737AD28BB7C578857144DF9B9F621A [email protected]
515,152,884 *349E13FF96835994773B84E4C9C42BA6678BD6A8 LIU_SUCE
515,152,885 *349DBF4AB71A1AFBA81724760F2A0BE17B14A407 alkylthiocyanates
515,152,886 *3496DCE0EF80061000932DD88D15B9F0F6331319 ALMCRIST
515,152,887 *3498AE80D4C799ECC85FCB375B7ACEC7A6927582 JOE.RIDENHOUR
515,152,888 *349CA31C60F325CB14A960158FD1ECB270A2AF7A ALou
515,152,889 *3499AEE757FFDC06C35F60645B1A940AC67B9E49 ALVINGALASSI
515,152,890 *3490523E6C243B6BB5F2F5BD1A1171E1AA231DE4 LOPEZREYES
515,152,891 *349D6C110767F2893DA9456FE38FFC7B8F3F71FF AMBATIS7
515,152,892 *349B6B892F0EE77713C968426135EAE61ECEE11D amg,
515,152,893 *349FF235491835EC29A7D0E811499DAE926F9B41 lostpicksuppeabody
515,152,894 *349B767E01020BCE0C3320D179231C8BDD7BF0AB AMTSWANN
515,152,895 *34921A12C90DEE67CE71A7DEEA81870B983A544F LOVZP1TBULL
515,152,896 *34973012743EFD806AE3A14BCD992501BADC0F19 JUMPIN'T AT THE WOODSIDE
515,152,897 *3492D5960A843ABF6956666AAF8FF68EA85F469A JVANHEIDEN
515,152,898 *349A4289172BA0DD403180BF1C017B2DC239B4A5 KACAKK
515,152,899 *349DCC7F6F854AB74607254C3398D6F4075FFB83 KACH
515,152,900 *3492DD61B6B8D10C95972E0A200549E4DFC1032F andrehendrawan
515,152,901 *3498035C9A0C13F8B6870A758EB26CEEB77468F5 LUIGIWENDOLSKI
515,152,902 *3492F21A309E39914680765A98D1CEB70C5AD1AD ANDREWEADES
515,152,903 *3496D80D83F99FF880A39149BA3392A1FA8F5741 ANDREYMILLAN
515,152,904 *3492494FD6C86AFCE64569C0368D6E7F260BED5D KANAKAAS
515,152,905 *3490FE6F1C488F1801CFE94108E90DAFF7BE3B0E anelavo
515,152,906 *3494ED40705F6E8F40F383CF00ADC04946D2F8F9 [email protected]
515,152,907 *349A5A4EAED242B7CE50879E5EAC6E5E31037BBD Kapitel.191:.Lord.Voldemorts.Knecht
515,152,908 *349A918369B12A99BEF819FD21DAFBA26F7963C8 angiotripsy.
515,152,909 *34907DCDA0249B66C58F30DB0B5580762FF44963 ANIBALBREKKE
515,152,910 *3490FFE47E4AB2B2BCE5018EBDAC9338C3332640 LW(I
515,152,911 *349D211710333B1B669B7F7FDC423881746C9563 ANIRETSA3
515,152,912 *349060C1209B7037F84AE373C01FCC310BFB22E1 kartätschgeschütz
515,152,913 *3492107ED0BAA2C041EFF59403EECC5323EB92D1 [email protected]
515,152,914 *349B23ABD2D1B195FE57984CF3A570BFDB174FD9 KEITHPRINZING
515,152,915 *349DB7DEA2FF81ECDA41A86445DF15334CCC2E90 ANTONY.HONDROS
515,152,916 *349784CD294F86427EF73A98896C5E99EE318BE3 AO$DB
515,152,917 *3492EA700545AC23F5151B2272434791D72DDF0F APJFY
515,152,918 *349D9408EE1894D4F851050F81E9067274ECB0D5 majorstreetman
515,152,919 *349A188F361DABD11AAAC0A891E3A3FCEA17F45D aqt12
515,152,920 *349FE3567113660A124B87248B9276AE69E8328F MANNIKIN
515,152,921 *3490E5F90C7417637F059B67AC808669ADA2D255 ARMANDONOLTING
515,152,922 *3490A5EE2F5A0FEEBB8FE5D43A7F993BB27E9603 armor-piercing'/a/rm/@/r_'p/i/rs/i//n/
515,152,923 *349E684E5CFCEB90ADAC7BCB9787DCB7B8BF3CE4 MARANDA.ELLIOTT
515,152,924 *349927B1D313AA9CD5027062979890B66D23F8AF MARCELINONORMENT
515,152,925 *349F802882E86ACF59744139A600C514F6B68B11 ARRIVE.WITHOUT.TRAVELLING/EVER.AFTER
515,152,926 *349B618BD9C602AD23BE200E1C26CC1122BC9CD6 marcodelmastro
515,152,927 *349F89EEB3C7AF133B45AD2500CD6F9A28E34097 KLUMSEDE3
515,152,928 *3499AEAF92AE3E80FA14D875F2480264D30E947B KNGGH0ST:
515,152,929 *349035472892C00A79C3A1DBC71A1EC89181A0C4 [email protected]
515,152,930 *349EA98AB0212B39E87B798F7FD8FADCDA2025A6 [email protected]
515,152,931 *3498CC9F032A92131D09BAC77A77A6BCA9A9AE03 knuffelrock13(disc1)
515,152,932 *3493630F07FC90E3E2D63DF3BC3BF8FCEE016978 aubreydousay
515,152,933 *349CA9EE9D79EF78B56F2A568B346C1ABF524957 markacimovic
515,152,934 *3493F8AD1ADF387259538C7F8C66EE250D37D2DF MARSCHELCK
515,152,935 *34993BD36EB03DA8E3C91F66C297DD845C4314A3 MARTHADOUGIE
515,152,936 *349BAE56D0E96C836A782B7EEE726A5D2E5426D9 MARY.EMOTO
515,152,937 *349072D67EA06EDA57F257D41C2A147171114C9B A,VV3
515,152,938 *349A8A360984565C9D91290B96FA2710703D3F71 MATTDEFILIPPI
515,152,939 *349EBC4CCD2C466D2A35D14F712D0A27BD5C5C86 mattmclelland
515,152,940 *349DE85B23CCB06A7635BAB7E45D788F00760DFF AXIALDYNAMICS.COM.AUWWW
515,152,941 *3494DCA2A4119BB94D7C754E9319F66B6FD886F7 AYK;+
515,152,942 *3493D6286E4D62209B9601F7AD7A545FD64F7C70 KUYRUKLU3
515,152,943 *3494BE66EC6264511121A9F1191C27E9F98F9A68 [email protected]
515,152,944 *349D8690CCAC225DF71E011F32D73BB8EAA6CB91 [email protected]~0-(>_0)
515,152,945 *3497E953AB9405815772BFBEB4EBC034B89C01AE K#Y/
515,152,946 *349A7A00A839A63E30DF42F5BE2B69B9D9D322BC MBVL
515,152,947 *3491310471BCE7545911B6A331A30595658C7EA4 KYLKEAES
515,152,948 *349CF8B44DBB741D729448B88C06034EBEF5B7AB KYUNGIL160
515,152,949 *3490866634B91D704F5412192C87EBC5BAF6496D B100511
515,152,950 *349CD9E1C2830773218F6440904AD570F1A0CB30 labelleetlabete:theenchantedglove
515,152,951 *34976896D2F0D087F3408EE6227A3C2CD9899F36 b7jcv
515,152,952 *34918B99834038D06E70450996FDE595BC48BDE7 LANCE.VITTUM
515,152,953 *349F8BCBDD62245B27E852E527606014917DDED8 MERITABRASIVESCOMWWW
515,152,954 *34981E5C420CFA27ABAF751659E36CA5338E2878 LAR0RY
515,152,955 *3494501E82830B83FBE15C2136A60DC3BC1D32AA B9X:
515,152,956 *3492736EB44E25EA7448E820655F2DFCFBDD8EE4 baby,.baby.let's.get.it.on
515,152,957 *349AD9528D4DDBD260B49FCA3E637EEF9914011D LAVERNE.FERRANDINO
515,152,958 *3492FE6B1AB9F1329E5A5385775400D802C73A3F BALL3R!NAS
515,152,959 *3492D4C47BCBD73102BE4D4916B4461EFC741DF9 BALOGHOV
515,152,960 *3492557B372A67D91287B78E0D26CE7B36673982 LCONKEY
515,152,961 *349B263135F37F627DE917AEA03574FC16E65A26 BARBARA.CROSSLAND
515,152,962 *349CC292B71A8DAB8CE7660992887810AE987410 lealismo3
515,152,963 *349B5453282101C67A193F78F2E457C980B2724C baselbieter
515,152,964 *3499475EBB44EDC4C37ACB86E9061075F862ECBE BB5
515,152,965 *34968F425B8B75902AA4D2345967D013EBCD2990 bb$ue
515,152,966 *349E95B53D5EADA2FD8E6CAEBC7C048B54918AC0 bdru"
515,152,967 *349DC3505B1CC513EDB685E9F633F13C4E1B88CE BENDRUOMENININKŲ
515,152,968 *3495335E5974EEE16997AD9FADDD1528ACA93414 BENJAMIN-BRINGAS
515,152,969 *34923224703406A21EE28C55ED04A877A7EBF9D1 lequista8
515,152,970 *34963AEBEDFB4C8787AD9114A6FA43A84558C56E MILTON.TINNER
515,152,971 *34963CD9AF16EB98835B141161F177DFF15EBB36 MIMISYAFIQAH
515,152,972 *349C4DB761B8A125ACA6E453DCD5E8D39408234A LESLEY.BUCHMILLER
515,152,973 *349DEBEF87FB84B38CACA62B2CCEFF03A4FA2AAB BERNARDOJOLY
515,152,974 *349EEA85C2D1EE8C954C153A1AFE32E15975355A MISSA.PRO.DEFUNCTIS:.IX..ANTIPHONA."IN.PARADISUM"
515,152,975 *3495C7CD81A5158A550E431917A5E58414287552 LEVOURS7
515,152,976 *34996B0F790591C6A829F5C0BC82182A4BC5D747 m~k_
515,152,977 *349E8143324FA1207B5AE6C5BA946654931029E0 bezduchost
515,152,978 *349FF7E8EAAC3D10347BBBFEDFE4DC9EDA788E93 BFLKM
515,152,979 *3497E056D1E4D2FD6E704EC464801BC762CD82BA MOHOGANEY
515,152,980 *3493E4942ABC0C941B7F7F790559A528A08A5124 MOISES.TIPOLD
515,152,981 *349DFA81847046ACAB52C33EAB78001D8B576F6D MOLDOVENIMII
515,152,982 *349094C27BE65994A0CCF3E9B51A281738CB06E8 MOLDVIKA
515,152,983 *3490EB3F9503C40E2A50C1C268137153BE8AF80E [email protected]
515,152,984 *349EE20D6F8EFE9CEABC24C04D0BB4255184B55D LINGEOS2
515,152,985 *349E14FAD83C9AE80CDB8C7784FCF307E5911BC4 LINYUNPING
515,152,986 *349EF771BF0C9E2C419EBB34DE07F4C5767928B8 montyhildring
515,152,987 *3499FEFBB28B7EEB24AA3E9F70290F66AFC72398 [email protected]#
515,152,988 *349320D2AC0E9A656102EC5E3F8AB0F0A72E3F17 MOSQUETEROSLOS
515,152,989 *34903442E0442919C859F209ECE00DC2C080D287 mothersimpson
515,152,990 *34969F3C3F3F70F3D4101187C654B2F0432ABB09 MOVEMENTTALKANSLEY
515,152,991 *3499920529C0CEB3AFD025B530462B94C3BF1C6F MPRPRTN6
515,152,992 *349B21180741F2B016B22C132312D8862E3AF89C blairwaidelich
515,152,993 *34926E9A04CCD16FD26F9F5913A904785AC1B017 blake-tenison
515,152,994 *349ACFE1062FBC55590DFF11377F9204C4952589 mrbeta
515,152,995 *3497F2DF1B8AFAA830C97BC17FB407E6423D7922 MUHAMED-MUKI
515,152,996 *3490262FC8CB8633BB5EEEE81C58E37B85863187 LOETVERBBED
515,152,997 *3493F6768D4823F52767388425A0FF7F92E6FD60 MULLANGIR
515,152,998 *349D4C3C91A3FB7F10712ACF10A63E6A41AD6598 MURDVÕRRAND
515,152,999 *349D373DA8834BBA30447CAAA15460616A5FE0DC bmnb9
515,153,000 *3494356ECFD3DC9326B85AEE51ADDAF423798291 museo-de-arte-moderno-m
515,153,001 *349DDF80662FF741464437F54EADB2A227E0942D BN.&(
515,153,002 *349E25C81E6CAB078EC69259CCB853739A309213 B--)`~-`~)O(
515,153,003 *349C9E7FCFC215269A940BC1C497DB33D7AD7573 MYRON.COLYER
515,153,004 *349A7EBA80E0E83BED4CA77A6CD2763BD95B376A MYTHOLOGIZING?
515,153,005 *349BBA33494FEFB6E6DFBA2666ED225E3C9AB200 BPQHE
515,153,006 *349BBAF667FDFED17146FFBCDA585F19CC373228 LUDOLFIJA
515,153,007 *3497A09F493C762CB87AA19C1AEEC4E53390DCB5 bradyluna
515,153,008 *349CB6909B5B9B52C6243820893DC088C4419011 NANCIES
515,153,009 *34961655D6A90D72F14AC2D68722AF312DF88E31 nanonewsnet
515,153,010 *349F37A2F5E8257AEB4F2D99F2DC680A1F60F10C NAOMI'SLIGHT
515,153,011 *3494083BE7E9E400C5DC9A87A9EBAC1129AA1F13 NAT14121989
515,153,012 *34909781EE482862BDD8989E89434DCB87FD90D1 NATHANIEL-WELLS
515,153,013 *3490B3A21498DE38DACABECC309A424807357957 nauseiate1
515,153,014 *34924DE7BC4574844A6B82B8581A12AD0F188235 bruinjen
515,153,015 *349838762EDC710044B6A82C8FED06403DFE9EF5 madulce1
515,153,016 *3494EDC6E3CE4792BB69F51C89AE5CBAF9599607 b"t_
515,153,017 *349C290EB079129039DCE2F53482CA8AC9710D6C NEWS.(ALTERNATES)
515,153,018 *3490AEAC713020081344C3A098632C03A7AED4E4 NFIN0369
515,153,019 *349F0F5D8AE0B216291B68C2DE3407334D16EFA8 NICK.MCDOUGAL
515,153,020 *34985E6F85843B291E8176C1FEC58479AA55EDB4 C0"J
515,153,021 *34912BD3F68FCAC86503A79F6E824D0A498D39E3 NOAH.ROUW
515,153,022 *3491484946AC300ED9F1A95BB55B8134C6ED28B3 C)2,O
515,153,023 *3493BA16912E366CCB08CFCE508889B1D16B9D30 [email protected]
515,153,024 *34912DE55ED0EDCF1AEFFAFC053C70C186467EA7 calycalies
515,153,025 *3492B80E5C68AA74C9309599C21C059D79F7A4C6 [email protected]
515,153,026 *3494BF5DDB8ADEAECE058AC72E90B7ED2A46F35E marisco-7-0
515,153,027 *349DEB7F54365A646D92E619EDE783D4347EB039 mark-cantillon
515,153,028 *34910D0C9F2AFB14BE76CC0D5D1AAD5FE9222CBD CARMA88
515,153,029 *349568F3F43832EDBC17439D0734FE16FFF3FDBF NONPHILOSOPHY
515,153,030 *3493CDC3E8F60798776991609EF6F89B592A45CE carsontomsic
515,153,031 *3494B3B39F79BFC8625C38FEA57DF40EB43E8102 MARTINSVILLEEVANSVILLE
515,153,032 *349155AACDEEA75FAFD2CD83A277CD535523FC59 MARYTER
515,153,033 *349408D08D7CFB1E8755026881BE5767AA378864 cc6?e
515,153,034 *3498F321613D7EBADAC926B1F9C74DB2D8C2D846 C!CMU
515,153,035 *3492A068F9997315F9CB8906BF6EAA95271D9EB7 CCYUW
515,153,036 *349DD06DEBECA9B3C7366086756666C8F02FC5D5 nTriunfoGalas3y4
515,153,037 *349A28DC543696AFCA0A10463A07F3E551C97BC1 MCKINLEY.SVOBODNY
515,153,038 *349D53B3ED538ACEBC685705850C25882848AED8 C+DJ
515,153,039 *34998F6CDCC2675DF985380A72A101CCE74F9607 medical.meriamwebster.com
515,153,040 *349C582A984DC074DCC09F0844397918B705BD69 CDURIVAGE
515,153,041 *3497BBF8C40505D2B1CE96E531C2E13D13B3611B cdyes
515,153,042 *349E4634C7A7F2F816298A8FF2925F5E7AB7C338 O:<}
515,153,043 *349C25E0A19E7D9CFB407EAF2A04BEB1DFB74098 O1FAC+OME+ER
515,153,044 *349B197E7FD6826A6D545808049846C32F8A0D4D MENTONNOTNEM
515,153,045 *349EFFD5F17ABAF484A5EA875956FC529E492858 cg/t-
515,153,046 *34955198C5F6FC49DCD86BFCE5229EF575C04CF5 [email protected]
515,153,047 *34980CC9587775EAB474B30012888B832EFEEE6F MICHAELGMEEKER
515,153,048 *349F82A6BD9DE0139711B5A07F6BFA75E7377611 CHARLEY.KEIPER
515,153,049 *349C79513D3CE90C1BC3747F545D7E4459CF7986 [email protected]
515,153,050 *3495925B43035EC9B0B25D5F4BFC6A611BB7CF0C CHAS.BOX
515,153,051 *349BD5EB534672C34412005A17AB7482A679ABC5 [email protected]
515,153,052 *3493FE0E5B02ABFBA34C3F6D55A0F9EE19E87920 cherish-the-day-(antillas-remix)
515,153,053 *349C8473CCC405C085D87E39CBE64EF5269CF888 migueljackson
515,153,054 *349525041566BAB40FF8465DDCF145459DFB6460 MILLARDHAWN
515,153,055 *349C9CFFAF4E1B515EEA8CD6D2AFD95E9F4FEF5A ol1937966a
515,153,056 *349811188FFA2B69000445A7CFA20D4F1730CFA4 OLENTSCHIDA
515,153,057 *349CD8C6BF601BDA9CDD2D24D8AAFF63D1C40DAF OLINLAMA
515,153,058 *3494EB1997D0371ECDE50776D66D3CBBDA47D252 OLLIE.HACHETTE
515,153,059 *349F9DC099C750C2C00F5413E060FC7C3825D32A mirror men
515,153,060 *349F615B1D0F440DF9F72328DBED1ED57004D06C ONREGEERBAAR3
515,153,061 *349A22DF97567FB8C71B8E28A2723737287E6798 christinesauter
515,153,062 *34936DB0A3B7C7B35FF0C71A2A141E06CB70F256 )o(o~o~ (-----q
515,153,063 *34999CAC24A4D80AC9619F8E2E4957EC9D8254A0 (O_)~`[email protected]
515,153,064 *3497C735CC5A98DFAB0558C3404F28FE6F98C455 montegaiters
515,153,065 *349979A8D571E8212AF60F3E7BB2FEAF8D9DBCC6 MOOD FOR HURT
515,153,066 *34950ECF74AA0E511678DA840063398B2118C608 CILQN
515,153,067 *349E03958683E05AFA73831D6D6B87BDB6850C07 otanssia
515,153,068 *34914C18B532784CFBBE3F776493C708E97940B9 ck?to
515,153,069 *349C6A789097254F2D435D8A349D354E88BD93AF CLEANERMEXICO
515,153,070 *349AD192BC52C8EE51D37200433A987F0037E265 NCI[email protected]
515,153,071 *349204484EB6C28E6A65F6D5B29F7E64C2A3C565 need one (riton's fashion mix)
515,153,072 *349BBE5FF1E7E8B7EEDDC8572F340B8CE7757A04 NOLANDAS
515,153,073 *349170279D5391D59D83A408884CB6C382CAB46B NORBERT.BRUNDRETT
515,153,074 *3494D5F1787FAE6FA08D73B34A346C6C8B278EC6 OWEN.RUCKLE
515,153,075 *3496E7DB5209C9E6C2B5EE8EC790A335922BDE0E NORBERTGERTSCH
515,153,076 *3495136EEA74004E1B6E6F98D7CD87CDDEB5DE64 NORDFLJE1
515,153,077 *349DF4FA6A41DE28F24EAA60C87CF72059B89487 P2251
515,153,078 *34914BB8FED300FB6342CCB21A71E6484C793DF3 nt3293uw
515,153,079 *3494A07FF2B5ED7BFC4296519065A19A47315BD7 NUN_SUI
515,153,080 *34966F58E22AF6EA5E717AD68EFFBD230B22D77B cnjv)
515,153,081 *3493F3E3C35217600E60F2B0A8B8C30F8A064CDF OCTAVIO.NICOLET
515,153,082 *3497FAF5B1646FDA82B82480A36063AB335464E0 OENOMAÜS
515,153,083 *349BDCCC86115F562E8A5F65FF9685B0BAB9F975 pavcool8
515,153,084 *3497E97BA65F77DA29AA00670DCA4F6845CAC05A :p***d3
515,153,085 *3491D2DB49D7386DB9DEB60E6645E53A3A88E355 PEACEFUL, EASY FEELING
515,153,086 *34940FB542D447DC40BD9C0C5BCD3F8FDED7DFD8 otispolycarpe
515,153,087 *349F6B642F775380C709527EFFF9EFBF2B199250 [email protected]$
515,153,088 *3499ADE2E1BCCCDC4A10B78027B4B2BC02BDCD03 OVAMPO6
515,153,089 *34976852FA754B8EB4099364BE169B0E629B4983 PHIJESS56
515,153,090 *349E52AEAB7134AB734C3CAD92B3A9E2F99B7091 CPNQ:
515,153,091 *349A7EE5D487749BC11DA4191BB505194C003002 PANTIKAPAIO
515,153,092 *3490F47F189A2F3A01212189A580417FCA1C91EF PANZUDOS9
515,153,093 *349473E3BD01298B5B794E1CC53ABD6D171B745E PMID11876571
515,153,094 *349B892F6FD758400BDA4DDA1DC5F6C5EB7D3699 c-rok
515,153,095 *3494A74208C0D815B8053321BA505076EBABD377 [email protected]
515,153,096 *3493A38E96B39ADFB6ADCFA3D5B8206D05500C9C CR;TU
515,153,097 *34950419618AD18CBD05A7D146D2F1A928561E8F PAVILLION69
515,153,098 *349F981D189D78434F2A18F3A82632D8D06F15CC p------b-~0~o-splat
515,153,099 *3494263EEF875C27945617C453DC996082D539D3 POLYGONIA2
515,153,100 *3494C23B364C83BE0EADD51F8CD3B2339B010BC2 ct/3s
515,153,101 *349C425C781DEF308C736F6CB1B5108BB18E5B29 [email protected]
515,153,102 *349D3D1D6371D76B1236ADA271904B715E7C82F7 [email protected]
515,153,103 *3491CAF073A7827A781A8C7446BB5C7BD3A1CC8F CURRAIGH1
515,153,104 *3498AB09D53B8A18E679E6AD0A7E13960B7C81DA CURT.BUSTAMENTE
515,153,105 *3493E2D71ECB9762FB8994634B50F54EB01A4FE8 percyhendrick
515,153,106 *349CE55B1CB7B164542FD6A643A1577B661B8CC9 CVND5
515,153,107 *349850A02943D560943DB721A559EB3AFD0D76A5 picnicky
515,153,108 *3490A2A69876E7FC43B615620C42593D63F59529 d1dyw
515,153,109 *34929EE0CA390F92622226BDC068FED87395E913 D3VGH
515,153,110 *349D9666262B6AC0BF4F90F8685A7581F005C0F5 D5EMBARKA+ON
515,153,111 *349989AED5F16041AC66F10147E2077D1BADAB06 PLEIHEEM2
515,153,112 *349C7E7BD47BBC399DD7A11FA264CE53BA931C33 PUPPETLI3
515,153,113 *3496764B6A508549486DA2741533882289AABC47 d9ndf
515,153,114 *349CAC79F7357E009B3A4314D0C33B25827B2AC4 DAAE(
515,153,115 *3498E626C10B54E1EFE74D56999231618A7D8CE1 Q)~O SPLAT!
515,153,116 *349CF1344A5658608086FADC376022BEEB6EAED6 QRST861
515,153,117 *34960E1051B4BEDA1B2C3E2ED6930E42C4BB5C7C QUACK1:QUACK2
515,153,118 *349C837A03855B21D2586B196CE9FD6509E6731D p=====p.~0~o.>-b0
515,153,119 *34960581ED70CA3387EBE8D5C98022C566B64406 PQ]J
515,153,120 *349C7565E57C077641FF87000F8EE6E5B1FDA70B PREG_MATCHACTIONROLL
515,153,121 *349C464B553E16F705B1B157FA3AC6D287E7047C PRELACTEAL
515,153,122 *349961A7A9C8505B7959E5E49B5BA5EE732426FB R3CRIMINSS3MOS
515,153,123 *349B92E1C1F41E367841A6B26900CCCC6CA38CB5 PRIJAVNU6
515,153,124 *349E03EE00D276FA14E9A59FF0868811D57BC23B PROPETE4
515,153,125 *3499839E9FDD3C07FE6EB6F6C53E4A366C6A74ED PRUDIEDOWN9:12
515,153,126 *349C403BE5153F44FA5CE2C58BFC4AF83D63A0C3 p#####@`.sploit
515,153,127 *349F90B29017329B6E61CC84B7379955D1FA67B1 [email protected]
515,153,128 *349E01EBBFC911F44827BCA79575A4E2157750C2 D)B!V
515,153,129 *34903B5437D4B6F1789D1CCFDA0EB2C4AAEA238E pyrexx.vision./.angel.dust
515,153,130 *349EFAD695D39B1B77960703A420E1F7E9750FAE Q_AAA
515,153,131 *349E3721BB47B6EE31A9390DCA0FDB19C6A65381 DEANDRESARTAIN
515,153,132 *3495F944358E93C007A68C4FDE6A34511C7BE7D9 Q#)~O><
515,153,133 *3497385646101E5CD902E19CBCED03DCDF9AD371 REGINA
515,153,134 *349D59982AC925B8FFDECED5C72BA4C0584C18D8 q------>~ ` Splat
515,153,135 *3492BF41A52C295ED86BAA5890EC8176EF6DE544 quincywykes
515,153,136 *349D3CA9AA63F3FD8A1B498323348565461E84A6 quinndegrasse
515,153,137 *3495F2D465A9F874B61C2A6125D0AB868B85F3D4 REHCEADR4
515,153,138 *349BDD40A1A6D3C2C61920B60ECFE1CCC88D8E61 Q-Z=
515,153,139 *3495ED8E004F3EAEFC60610A0D2CB37EA15C0B42 REMEMBERDICKHEAD9
515,153,140 *349DB2A2669FEE04992A82A37CA39C3622BC0F75 DEN4TUR4T1ON
515,153,141 *3493EE805542FC86D97837356A03BB4999846A8A den-kuckuck-aus-dem-nest-(version-2002)
515,153,142 *349DBADBC4295B5C9F599CB70AB8B0916A0191DB RENEG0T!AT!0N
515,153,143 *3491255F1BBBC08F9D77DB8791C2213EDC37284A DEPSIDONE1234
515,153,144 *349D7618B0A9761281A0DB94B4047AE3AAD8749F ralphiael
515,153,145 *349E220BC9B8F91C8BD12A1DC65B837757E59997 rexswoboda
515,153,146 *3492EFA3B0F7F53F4D83AC483F760E7FF0B4B77C reyeslandaverde
515,153,147 *34951EE75B44E3A70BBD2495A620600F7EB05219 reykimbrow
515,153,148 *349F69D8A5EC7C749A089DC93D0CAB98E4F6B909 REYMUSIC
515,153,149 *34987E6A21E55DE7558A14A0B761C813570FD643 reynaldoscaggs
515,153,150 *34952C47E51D8557638B81797D94BA11AFD6A7C5 DESPÌ
515,153,151 *34949858C17C27C26E24EF173645F19CFB1B1ADB reywoernle
515,153,152 *349C5E84E59BD972B51776E1130E9EB4DECD75CC RhapsodyonaThemeofPaganini:XIXVariationXIX
515,153,153 *3498443831183F3B93E7B5D42DE218997CE1664C [email protected]
515,153,154 *349C21DBFE29A567B885F54399770252F17F6275 RHINOPOMESED
515,153,155 *349DA842BF5107CD1B3BD1E6FD8BE84B0B08FF32 RAYPERSECHINO
515,153,156 *34914DE6DE9C7D65053D1E0559017A914EE3F6FF riadzanyblogspotcomriadzany
515,153,157 *3497295095E619F9C9ACFB876C72E72E32FAF22C DEVUC
515,153,158 *349D4D5C157A5D25F149790980B04592693A967E RECHERCHANTS
515,153,159 *349AE442E6143629E819BB86769D922974FB11DD DFKH5
515,153,160 *34901D01FC88DCD5C1A4B00AE78B9878F654AF77 redsunset(free)
515,153,161 *349BFD66E763CB86E1069F7D920ED90430D0D30C REGIBUE
515,153,162 *3497D555A5C6D48E081DCA10C110FCB402753B9D dhs2v
515,153,163 *349CFB72BA7817BAB644EA8A6889420EFDE91B75 RITU.SHAH
515,153,164 *349D25EAABB7FC6EC71FF2BE1FF1F12DD9463C16 reinaldobines
515,153,165 *34930DC393725E489D5F06561FB1264E56D9604E rldenv
515,153,166 *34944E717F45860F9FC29D033FCBFA474E771E65 RMPIXTAN59
515,153,167 *349903D4DC7ED68F2D5781F8D57D7EB8507EA78B Road.to.Jakarta
515,153,168 *349B26191CC2D0CBB57F7CA25DD70E908DDA6B6B robert-kimrey
515,153,169 *3491518CC197EE594A353B8A68C390DDA412F0F8 robert.renehan
515,153,170 *34901A542C26BE77026CCCD4FF9CC62BB3D7D871 ROCHELIMIT3
515,153,171 *3494071A852D8222554699E240102407F8C0C3C2 restoratyff
515,153,172 *349FC7D38996265B8DB845F7B21106FB341770C8 roman506
515,153,173 *34946BEC83B3C23E279DADE04EEA01B73CF6F740 RHUI
515,153,174 *349FAB8A12002A07ED0DDB1D08250759AC389CBF DI5TOME
515,153,175 *349A2D8BA38063CCF743CFC607E792D8DD89C88C dibbell
515,153,176 *349F305DA90F238D09E1229C27ED47144D7EF445 ross-male
515,153,177 *34941D901B5FD7196FA76AC691D0524FC8DFB68F DIEGO.GAZITANO
515,153,178 *34929B2927B9C0CC353C4C4EFDFA5E3CB32D627F RIGOBERTO.PFLUGRAD
515,153,179 *34901C105DDF2FA267DD7725C59453A7E05F3E97 RO+UNDIFORM
515,153,180 *349C862B3723B8CACE8756E6FC74B55A4B55F125 dimorphis
515,153,181 *34985E0E54075DF91F8A3FE778D08BEF98939D9A ROB.FAMULARE
515,153,182 *34953A66D177AB4B530B3614A729E391F24C5965 RUEBEN.ASMUSSEN
515,153,183 *349934468652ED7B5F5B9B1032E415FEFCFF8100 ruebenpolski
515,153,184 *34930A1E6A096E38CD4E7D707C5E25FE6B78B075 RUFUS.THROCKMORTON
515,153,185 *34972F35F34D17DD916ED3F4F6EA519FF4950A29 RUGIONE8
515,153,186 *349F6C677DFEC8BF51837F0CB07AB5F402C5C8F5 discostero.
515,153,187 *349FF979D3D483639CCA66B9DC1EAC6EA99B127B [email protected]
515,153,188 *349BAE4861320E36A63A18EAFD09C7ED05E83A9F D-%)J
515,153,189 *34923583AE134252A2CE3803C0D0E1D2860FA272 DJS352
515,153,190 *3497016C4A2D9D909CCD50D614F9B3509D0DF404 [email protected]
515,153,191 *349502DCC4BC9BF909BBBAC4F578D3725AB766AB dl5k-
515,153,192 *34911FD9359BDE936295EE2BCFB5667550740339 ronaldsalgero
515,153,193 *349EDCC35B4CC9AA67250FF8BF5A670EC3D9C036 [email protected]
515,153,194 *349F08D1929D39DCD01BAD56A3E5946EC78C06E8 ROSABAS1
515,153,195 *349642106D1726F6BA896FDBB6C76EC9CC846E72 salstriker
515,153,196 *349AAF4FBFF37686FA1EAB3EECB006A3AE33BB57 docibil
515,153,197 *3491667016309F0485BE65EA01377B31B354E193 SANCISSI6
515,153,198 *349A935F49CF6716CA230AEAFE2685AD94505E70 SANIYAH045
515,153,199 *3499FD2BE87C8ECCCFC94427F6CDA10627302F30 RUELMENESES
515,153,200 *349C4EA3938B24F1E1EEF49C1457BEACB779589B SARAHVERSTEEG
515,153,201 *349A185CC343D9CE127AB4A153EDEF650A894D5A DOUP
515,153,202 *34950D58F16302EC7B3B4D53FBAB30788F4B5FA4 SAINDOUX
515,153,203 *349BB015895A3E2DE00E352B37B4480AE581027B SAUSALITO(FEATROBERTOTORRI)(ORIGINALMIX)
515,153,204 *3496FB4B2E50DA00A572ADF5A26D71A864B27A35 salvatoreshvey
515,153,205 *349A040F70E7B0C6889C3A417D903324DD57335A dr!fj
515,153,206 *349AF23386FC4D396163584A9571D67A3D41A786 DR-TM
515,153,207 *349C9FB8E84A5BEC0BA6182F9E1D4526928658BE samdishing
515,153,208 *349E391AC8D06F8D1F5307DD1046E510C944ADB4 SAMMYSPENNICCHIA
515,153,209 *349A5F750F047B0820967E7A6C9FBEDCA3FF6857 dscri
515,153,210 *349AB787B7AE389BC4A02865B9EB936E0D9D3DC7 DUCTATES
515,153,211 *349194A7D1BF640F10176F50874C02E4B2DB2F94 [email protected]
515,153,212 *3496A5E3AD8006EB26E87B68DEF72505AA6D9B4C duwx3
515,153,213 *3493DA07A8945CC4DC94367C8540318C781F7CEC SCOTRAWDON
515,153,214 *3496B55EE4A1403777C5FC4DEDC258A0226A6246 SCOTTIEBIDDIE
515,153,215 *349A74D0402B57A6EFA4F458E4041FD6A78B2579 scottieburgh
515,153,216 *349C5C9CCD0559F432A5FCA02D54DC43041CAF33 scottielabadie
515,153,217 *3498D4FD2AABE8CFEEB7136832EC59089AD4023D SGORGIATE6
515,153,218 *349013C6A27436014061477A8D2781027BEAF3C7 SHABILLAGESES4
515,153,219 *34916B958A3360DC6406729CDE36219495D73AA5 d)%zh
515,153,220 *349661139DF2C38034B88E65F86F1A16B1423A0A DZNTRCSR
515,153,221 *349FEB15846C253DA7523AB23DAB63738AA5DF5A SHANE.SASSE
515,153,222 *3498B6C46D6004D60DD5B455661684A2D3EC172F ebu,$
515,153,223 *349B415347E8D7847AB1E3513921267C32B4E669 EBX$V
515,153,224 *349B4DE1A6DF4C69CA6BE57714096524C61A762B SHELLEYCOWBOYS3
515,153,225 *34948A3BA57D6CEB2CE2B5633120CBB3AABD9A21 SELETSOYTCID
515,153,226 *34914A40C6F42BC7C146EC1146EEA8222FDC6418 SESIARRCNA
515,153,227 *34940F68C1AC7FD26F03B0C88F11474C94EC6A56 SETPATSEGREVO
515,153,228 *349A053A8173EF1F82B0FB3AC0FA75DFE07A1362 Setting-Fire-to-the-Earth
515,153,229 *349326C729D11F72E4A5793F60E43FA51E647BA8 EDGAR.GUYER
515,153,230 *3491AD5C162D6507A70553D0057D1C257148A9A0 edg)c
515,153,231 *3497085168CD810C111A5EB6B1A42C4AA5D6E163 SHIMWAY
515,153,232 *349C3B2F8F572BFF2462ECB510DF1410B75A3720 shanegreer
515,153,233 *34922A38D4ED3C90E76BCF1DFC2348110FBDDEB1 SHARKING
515,153,234 *349E019E3443FB3CB3852F39EBF88746FC216169 SICA-QUE-EU-TOCO
515,153,235 *349600929A31646223A7EF480CD293B81ACA704E EEMPACT
515,153,236 *3492226BF336FC2B59099854CAF636B9B89C9A53 SIDNEYDELVA
515,153,237 *349ADA702D9B76296A5108BB3C0E651F718D9B7C silvia-schiavon
515,153,238 *349F8F6D7451C494375190FC44A8D751C5A1B015 EGBKK
515,153,239 *34954122E2B214186E5D04D28EC8C8BB063F6038 EGNAHCTRED
515,153,240 *3499367613154F0750E652C966F140B34DE90A4A SIOBHAN.GUERIN
515,153,241 *3498DBB586BA31C75372715EEF6ED7AC7DE2F2C4 EH;5
515,153,242 *34920572C8E12149EEE8A6C26BA428FC401C861D shipfacts
515,153,243 *349CEDDFE10447589FECDA937FD2ED2B5788548E SNAKECHICAGO
515,153,244 *34951B58C0914C07A6B6019DCA2D0ADFAB67060F siangias4
515,153,245 *34927FFE558A1AA0A7DC7E84CEA92B07360AAD0E ELCVZ
515,153,246 *34978520B8FFE617E96CC04A99DDA6494E4C2250 ELIJAH.SHOFFNER
515,153,247 *349C7B998BF0CC08B5225A778ACB9D214ABA1D55 sonatinaingmajor:finale:allegro
515,153,248 *349036225C54160BD62163D17FB7CC77E1AB1DC6 ELLSWORTHPASCOCELLO
515,153,249 *349BFDA3F56C3F3B70AD58D48D87AAE920DD636B SORZMZGCNNNVMKMO
515,153,250 *349DAC8BE637483F50AB822965629388CCDCDC7C SOVRASTERZASSE!
515,153,251 *3493DA185B5DA194C5E040F5B88EB26771CC9B79 ELVIS139
515,153,252 *349E3ECE25DDC6E5920D5759EC1175DC2A5CE895 [email protected]
515,153,253 *3491C793C2B30E215A1AE2C551B3E6739B0A07CA SPANKITA
515,153,254 *349DD8B2280FE093FA5DC620A8320C9EDF426143 embranchements!
515,153,255 *349771E48E6A33A6C236EAD14408777C51AE229C sllctrned
515,153,256 *349AF5FD46E67970C6AB4EC2BAD2BE348486BC93 SLUSHILY
515,153,257 *349D5307FC8475B9E3446474FD5D92DE5A65F510 SMORIGAITE
515,153,258 *3492873C1D8F6469DCBB43EF86AB1DBFFB91EA05 ENQPP
515,153,259 *3493F6A68A29F5E2F9549359B4164A6411348054 eqoyf
515,153,260 *3494637FEF363F8ED0B85DCBF0B2561D3EFE900B SONNYPANTERA5
515,153,261 *349CC249CC635AFA98FD7E51C510E42DB6B09244 ERIC.OVIEDO
515,153,262 *349C0C84D46387900734094DBEEA31569258E6A2 sportschiefs
515,153,263 *34993D801E9B9BA70FFD125F4B7D561F8D25184B estandartereal
515,153,264 *3493E8EB32C83F3869A02BE6AFB6CE27A15B1FF0 SRHEDERSES
515,153,265 *34975AD55428408298A07893D9DAD9EF65BBC443 splat.*.*[email protected]
515,153,266 *3490AE70D54EFE078C7C5030EAAB5C4FDF3C3A65 SPREIZSTÄBE
515,153,267 *34969D77DE77D214790CC1B63B666CA4FBA92C5C s#rb
515,153,268 *349FE870C979EE951A5A6D7D01DA47556A02F2BC stammenoorlog
515,153,269 *34927B32AA1194594C86F446A91F5EFB18AC87E7 STRPLKKR4
515,153,270 *349F0C04A1D3CBF3A3ABD1B80F9F14DA34B34863 stefanammerman
515,153,271 *34971B25130F9C9733A5147E3A92C5C2ABEF88BC STEPHENSADDLER
515,153,272 *349B567DFD0E50FEAFDD3CF7C4C591BA3AB125BB FANRUA
515,153,273 *3499861B3C72117CB736E75BB5F46870BE72B0AF [email protected]
515,153,274 *349E317EBD91196B17B4CFC65F8B9C96DFD9099B sudden movements (guitar villain)
515,153,275 *34973248ACCBA94EDAC128D45E8607D10DB6AAFE faussait.
515,153,276 *3496AC690371996908B25105C6C1E7F09491C16A STORLØGNEREN
515,153,277 *3496D9B5F688768EC84FE8248B7291A9EA48B6A2 STREJFLYSETS
515,153,278 *349634C8CE9E9AA48021FE510BC7B35A129B1B82 strings2003
515,153,279 *349A3EEC9B9882E3DA3EE6113D6B8D8AB2F1E415 SURRECTS
515,153,280 *349A45B25FDC23D2FA3E4E3D79951890128CE2ED suing
515,153,281 *349EC25F5E5F048724AAB07B5F8A1BDDBD4E8A3F five-o.flip.flop
515,153,282 *3494011625436F232B34D6262A8466F57612413A FJCKGWT7
515,153,283 *34949FD7D55315465E6E655DB5FFBEA1647E5D77 SZERELEMBEN.SOHA.SINCSEN.IGAZS
515,153,284 *3499B3662C5DF92A61300A357EF471D20036AF3F FLORENTINO.ASTARITA
515,153,285 *349696A69C28D41458CBED99001D931B5BB17F68 floskelantenfundus
515,153,286 *349292159481FEBE1BA94DF20228F4F0ECE8A3F2 FMEHAK
515,153,287 *3496B4413BAF70AE84891E72330F18574709A0E8 Fngerprn+5
515,153,288 *349ABCDE60E70E8F8C676B78E37B4ABB5A2D3C03 FORBERG'S
515,153,289 *349D9934452FEC5E251DD4A2508B1BF789B7B0C5 SWING, YOU CATS
515,153,290 *3497D0ECE750E0249C2447483F7B33F9E20B7E43 [email protected]
515,153,291 *349D3DE0C1E812C30CF6E775D87FB875EBA44467 SYARMILLAB
515,153,292 *349AFB620F1E64A4E078E72FE0A7325CA7CA1EF1 sylvia-mayasari
515,153,293 *34944EDC6F870CE5274558A6D86D8AEBE9324101 TALKTIANTAN
515,153,294 *349A8370FA69975696696509E125E84A897A6FB3 symphonyno8ingmajor:ivallegromanontroppo
515,153,295 *349351BD8B9C3EB44798B53D1E88DD96A615A454 [email protected]
515,153,296 *349D8F56B22BA0561BDD7E2C0069BB000C8C6742 fredericktoback
515,153,297 *3495E4B4896A0A434530B2E9186F77A28210550A T3MP0RZ3RS
515,153,298 *3494F599EB3FBDB89D8FE3639822A3D99B437CE3 t8x4luv5
515,153,299 *349DEB8015F3CBB19567257C36C546DB861FEAFE FRONTQ
515,153,300 *349302E270855712337E99E8789665DFD8A7F0FF take it out on me
515,153,301 *3493672B497EE6EED126E5BB3E012A646753C3DA FXU;
515,153,302 *3492DBB73C7D018D1E51EE25DDE8E204223A330F TEDKREITNER
515,153,303 *349C794CF1B136775D3E279B036CCCB2CD11148B TEETOTA15
515,153,304 *349979AA6B930037F7ECEFE662F78D93A7663393 galetroxell
515,153,305 *34927D248A08AA8DCFDDB27B98CA9BA79E40E5CF GANESHANO
515,153,306 *34914F7369B40120121E87A3D2EBBF68ED2EC8DA [email protected]
515,153,307 *349DB8DD06568D154F8D7CBA876128A6DF22D9DC [email protected]
515,153,308 *3499F40415904497D71170288B1013DA1D0632E7 TENATSNI2
515,153,309 *349B0A9BC33AF47A66945AF6DB220B31B53AEB30 garnge
515,153,310 *349D5F0CFA97ACCE1D41689E63F8F8248DB2E7EB TARZANSHIRLEYS
515,153,311 *349D93612868E44C2143901E380AB93C690CE57B TATINKOVYMA8
515,153,312 *3491568CA5B4C33D9BD1D8F060285C134FD32A54 gbc112264
515,153,313 *349789DB8FE97B06AD5C845D90E656C21317A7E6 TERRY.BABBEL
515,153,314 *349876243DC8315C341C6E8149FEC4648AC85FF0 genarogurnsey
515,153,315 *349B0A6423CA1994332DE5ADEC5927B75657383C technomanka
515,153,316 *34970B87402B91C13333985C6FD60EE2F22311C0 TEDDY.MAYEN
515,153,317 *34995611F16269EE8020DE8F8712DE56F3899320 tegm
515,153,318 *3497B5E7CDB96BD200DFDE41189610BA6289B9C1 THANKYOU,LORD,FORSENDINGMETHEF-TRAIN
515,153,319 *349071AE7DA6229C91286E0C7F39C514B37AF1AA gilbertosanson
515,153,320 *349946507E5ED8B21AF808D67B5A48C01F11DF6E GIOVANNITILSON
515,153,321 *34903356D2E6AAC024F8D7958C2899AF7107B696 THEAQUARIUS74
515,153,322 *3495282E21FBDF2C4071922DA36A83C2E079F4BE TEXTS-BY-AUGUSTINE:
515,153,323 *3490A3B3251188AF84F231FC4D5C5AC96FB0E030 GNEOTOHP1
515,153,324 *3498931F96ADD1DFB73CF981410F89451B214C7B tghknmn2
515,153,325 *349F07C36FC43E56DC0BF14ACDC9E189CAE79190 the-ballad-of-baby-doe,-act-ii-scene-1:-mama,-go-inside
515,153,326 *34974236A61BEA3E7C45AE9D64850F5924457096 the-solar-mass
515,153,327 *349B56D61169D00F8929E1E98AE1BCA2BDBBD5E2 THEODORE.CARRUBBA
515,153,328 *349835CB14CCDFD69C4818D813B835B3D7B61062 GUILLERMOWHEELAND
515,153,329 *349A000D05F9C176C486A4069D00402F44AB3067 the-symphonies-(wiener-philharmoniker-feat.-conductor:-istv
515,153,330 *349895C60DC0F0F592E8F53A5D77B2C84877AA5C guycallais
515,153,331 *349FC2875EA0393D4417191A6AF00FC9D5F14509 TIM.OOI
515,153,332 *349BE39C957145511F40AD8A1A33217E521E5A54 this.is.thy.negligence...
515,153,333 *3496A0E89786F1FD3FD1A18E7AC332B5ACC7B3AB tmwm
515,153,334 *3491D5EA479EA5ADDB7BF5A9CF9703FCBA379944 hannahcoutu
515,153,335 *349946154D27081914BB2C1100E12753FB7B73A4 t)nm
515,153,336 *349C70338C0A9E796E09D14CBFB837B71AF5D287 HARLANKILLELEA
515,153,337 *349913C00BE8D9F9E0C1EF353C66EEC92F808DE4 tocando-por-musica
515,153,338 *349F65A9F99D3B66F1241AEC8AC835267F2462E1 TOLWAISZA
515,153,339 *34996EFAF9A8F3E9CAE3E1EE25C1E878A913C982 toyomaster氏が00
515,153,340 *349F7DAB28BAAE23B610F31097456C4355FB7D1A HELENREEFER
515,153,341 *3497B8C7F06F9B3E1DBC613388DF7DC9304B8DC7 HENRYMOBILIO
515,153,342 *349F67B80CDA809EACD09688869631427D10A029 henry-oladayo
515,153,343 *3494CA081B81674E79577B6700A02C8E88E4E255 TORPIDLY
515,153,344 *349D6643CA58F56F6D4F1FA0D5171BC7D0064564 TRAPPORNASING
515,153,345 *349C5715E7F7A0C618EB3851AE092C725774F7ED Toughsh3
515,153,346 *3491B2FCA0871A37F8E249486B53487A4EB3AA82 TRAVIS.VONALLMEN
515,153,347 *3490F87FA588CEFEA9BFCAC2E2ED7C23B8852B9C traceyijams
515,153,348 *349A3C6CBCAB7068377E6DF325B6385486B5AEC7 TRENA ETHERTON
515,153,349 *3490FC5646A707EFF4AEF39C46046CA98C22CF30 TRENTONSEITZINGER
515,153,350 *34955445579AEAD1C1193836C43561BD5281F10D trevor.fontenrose
515,153,351 *349F362491F406CC20229CEB37384EC16F9F57EC TROUBLESUSAN5
515,153,352 *349D2AB18E0DC6F7B18AC23CB182B5F06CED6446 HEVELEN0
515,153,353 *349DA3D919378673031462E95629C292311609FC TRIOADUR,BWV1025:V.SARABANDE
515,153,354 *3498CC26E8AC84550031350988A971510B2327E2 TRUCKSFERRARIED
515,153,355 *3497F9F1159AD80D5423EEFBCF828DD896FF92DB [email protected]
515,153,356 *3490D4B4F3CCFFE0240D023CF6BD5195B0132CCB holdingon(originalmixedit)
515,153,357 *3499443E691A19DBA5A045BDAE4D6C3C87F4CB14 [email protected]
515,153,358 *349D3F5E1F6C775ECC5712A3BB5B0D8E8CE390C2 TSELIKÓM
515,153,359 *349889C7A8461106A442A4E36B8A0ECDD2157318 honrariam8
515,153,360 *34901EFCD9BFC75231821155470693184C25B6F9 TÜRES
515,153,361 *3492BFC65296C6EBAD6BE15CC7629EA88DE8CCE5 HPHYBRIDESSENCECONCEPTPOINTSTHEWAYTODESIGNFUTURE
515,153,362 *3497E583209C808C6EFFD79CFA0F70FD44118F0E tylernevland
515,153,363 *349261271761A7CA8BB1921993B0EEC3C7761FB7 TYNDBENEDE
515,153,364 *349EA23EDECF3DF900733E3393955E1D8039250B TYRONE.BYFIELD
515,153,365 *349F7C666CB3AD5D49AAB025E323B76DB52B1D9C HT`B
515,153,366 *349BEAE7E8903D59B6C6CBC34821D096E24B7442 udenom4
515,153,367 *34924C6F22665843C024711BB030E2AA32A08EFA httpwwwspaceworldn
515,153,368 *349703A147E73011F49EDB62171F37409B09831B [email protected]
515,153,369 *3499B590D492BDD5F9AF759A776F6CDC4B6A0ED4 [email protected]
515,153,370 *349098DF073177F2EADC8B4ED775275F96695D7F [email protected]
515,153,371 *349689DA35C3BA1BF1393759C8175ED498293807 ulhhdaq16
515,153,372 *3490451530DCA60D7A65B93A390112E9D73187B3 ULYSSESHIERONYMUS
515,153,373 *349F7F50CC96418D95579531B7A7F171063E1B13 UN74N9LN9
515,153,374 *349B871ABA68A03DE150E2AE11CCE937331CF701 UNBANISHED
515,153,375 *349FD9F52E5549178E8F1C821C7CDA6F288750AE hv='
515,153,376 *3492074D8D2ED53025737B4CA56A550BD5FC2278 hypothe'cable
515,153,377 *349EF02C873C684853C91B7584A07BE8C18EFAD1 [email protected]
515,153,378 *34976158B52E8B19FEDE23892089763D6C54E6A7 URGUN.ISMAL
515,153,379 *34985FC82E1ACDA71AA82DEABAE704832826BCEC [email protected]
515,153,380 *349FFF03E029D845D9DC728181207804101A607A IDEASANDIMAGES
515,153,381 *34908F0EC2D06BB5591FB84D048C149AD9E39E0F USER13724421551
515,153,382 *349022CE197249660A9DD6792D4F84AB55C01F64 USERROOMSIXHU
515,153,383 *349C74E052BC6674C58DD5EB9D078EA01F6888C2 [email protected]
515,153,384 *3494886526287F37E88F54E883B2CE7A0375B285 IJV
515,153,385 *3494C58192515B5CD78D5673E6E32B2F4BF9782F V1OL1NE
515,153,386 *34900B0959739D040E719CC971114B8FE625E56D vaitanoa
515,153,387 *349AC1BAC892849C92D382E989A279CDA2ADEBED valerie.hernandez.baeza
515,153,388 *349EB6EB6695C4FCBBC15993C51B8837C225017A VAKHTANGTKHILISHVILI
515,153,389 *349D9F17D547BFAA4E6F3E5539EAA4FED11EEEA5 VALLARINCORP
515,153,390 *349D6193C9B0C50C3C9EDD637E9C40160F4B97A9 VAPOR-KANT
515,153,391 *3498A949BEC694218E1D2A6F00D2E0851FC09F6C IMAGES.N
515,153,392 *3498343C691CB9767C677ECA7C7CBEFC4081EB2A [email protected]
515,153,393 *34905928B63BDCF21F61D9CEFCC240A659219AB7 vanzaih
515,153,394 *3494522DFA3ECF3228B5BD57649715D83A0C1F72 VERACHTLICHSTER8
515,153,395 *349AF2B8B8DC89156FD623CE9098452B148A34B0 INDETERMINIST?
515,153,396 *349C92B7047DFFD1728BA9ED502FD106E4667322 inexcus4bility
515,153,397 *349C0D8A4F848978D10FF5A1CAF88E1748BB52B7 vemzuar
515,153,398 *34987D4A8CD5CEB9D3DDB222D81F60657EB8064E vg&k
515,153,399 *34968DF53EBCDF7100B2756B71C18D12602988C6 VICTORCAMREN
515,153,400 *349B0A74BE78BD2EE2C3ACA428EAB70783E87116 VICTORFIRST2
515,153,401 *349D4DFFDB90EAF6688F980963FC2D35F9DDF8E9 VICTORREISINGER
515,153,402 *3490C699E9463DCECB8B02C411ED350AE8F925A5 VICKIE-MCMICHAEL
515,153,403 *3491F745004BD62B01AD6F725A91C6F045928D3C victorbiehle
515,153,404 *3494A04ADED46DFE022462B36A4707F4B9CE274C ISGU
515,153,405 *34994249EAD9417F2D9D4286B5F0E727E3141080 VILLA-PARANACITO-ENTRE-R
515,153,406 *3498F887BD8FE080FF5C3FE98CB0E31949BFB706 VIM9359
515,153,407 *3491923DB6551843B6E3DF014D7857F9E32D632F vinaceos
515,153,408 *3498A5B5FF796B59FD48895AF14FCC63D320ABCA VINCENT.GRAFIL
515,153,409 *349AFD32E239C438937054CCC0EC66100CAB47BE j3aaa
515,153,410 *349B1DEA1E311C752111E5E971E43C748A0B62B1 JACINTOFALDYN
515,153,411 *34957816F680474C654D60C5E4DF035F71D3AEBE VIVIAN MORADO
515,153,412 *3495B66C38836DB7B49B4C54E28E93538B179C6A vnm05
515,153,413 *349F584E501F968B11E14670BD714CEC7F72BE22 volleybnellie
515,153,414 *349C1B013BF38D8D2B5A6D766C42C41416D97B0E vorkantzangatza
515,153,415 *34995A6E4337DF2783A73EBF0F83202C88EF1E8D [email protected]
515,153,416 *349A98CFC093A1121B8BF734DB5187C84DA116BB [email protected]
515,153,417 *349599660C77334DD28172BB09DBAF06D28CEDB9 JAN.DELANCEY
515,153,418 *349B68F8F691C8BB7B6D6D14CEC06C02B4699F08 waellawabne
515,153,419 *3493CE2D77B507BDD017BAD3DC6161E0E86B95CC WAJEEHWAJEEH
515,153,420 *3497D375D5B161CF9FCEB37D7F8A7C97EAAF9DD6 walexywaheedbabalola
515,153,421 *349BADAFAEF7E5B6ECB62B0E5141D5C6A74CF3B0 WALKER-PAYNTER
515,153,422 *34946A4B92C5CDBAC42A37BB92EB48A6524D5A80 JARRODZERVAS
515,153,423 *349CFA07D03E512C0F6452CC2F3C2613B363052B WALLACE.VANEGDOM
515,153,424 *34994EDE6C2AD67C97AC3B265C0BAFA8F301B717 JASONDAVOREN
515,153,425 *349A4434B8591AEEE3C06EDBD0758CA1B6346179 [email protected]
515,153,426 *349AA057EE39B608A73D4782CB6FEFB797F74F4F jaylah66
515,153,427 *349ECEC3F03845964BBADA22887516D57531883E jcreek
515,153,428 *34923A83E12132CF7081844DD26337FACFFFF9F8 JEANKYT
515,153,429 *349C96D89431B2E4B5234FA275353C6B65FDE66C JEFFBAITY
515,153,430 *3495A72E38B670CB085F84AAC101FF22B020B7CD jeffereynight
515,153,431 *349156F76909D26DF6021BB56C31E5374B813F6F WARRENVANOOSTEN
515,153,432 *34902F4FEC93E436307FAB32203D32AC4C91D835 WATANI.FALASTEEN
515,153,433 *3495B7650EDD89ABF1E4711E9A12A2DC6A020D00 jeffrzeszutko
515,153,434 *34926BB7D0AD794CEF4E23242CBF9268A7CFC281 WEAHREND6
515,153,435 *34950D0A2B4B894D7B971EC06FEC859AEDDB2776 wazèdje
515,153,436 *3490275FE55A7481A550977DC29C7D78203255CD WEBTOONADOPTED
515,153,437 *349E01C8D58A862D4D8C62729DDDEC88A7B9359E welksten8
515,153,438 *34949570CBEAAF696A0D633DEFEB22E52EF6DECB [email protected]
515,153,439 *349CFD4C29C58689012645F890643C04A2E2938B JERRODYERHOT
515,153,440 *3494586C3D3840AF89C9969CB0EC82850AE1052A WE'RE.MOVING.IRRESISTABLY.TOWARDS.A.CONCLUSION.
515,153,441 *3492BD31FB3C075B2CDE7187D492C1CCF73D5DF2 JESSIEHAMMACK
515,153,442 *349A43C46B05092500E41DC8D97190693761111B WHITNEYWADKINS
515,153,443 *34922FEB291DA2740D474C0C8C30920FDDFDE23B wicked1920
515,153,444 *349EBC1CF017D57E02DA741713BAA255BC9CD3E3 WENSKIES
515,153,445 *34985A109DB4EC5A0FE8C2C9A714603B56208E27 JIMMYBREDIN
515,153,446 *3496786D8EE33D2FE6FDA262429B46D7DF5C9BDF willie-sterner
515,153,447 *34924E2C08EA74FAA074EB260BF11E13011D7E30 WESTLAVENDER
515,153,448 *34948C1E6B0B95E5A6774BB3113BE862E14BCB23 WILLY.CLORE
515,153,449 *34905B41DB19CAEE91282B1AA464CF74A1877738 WILMA DEQUINON
515,153,450 *34941094E5233CA48D74650A5A30078E434255BB wi&n
515,153,451 *349840C79BE5AF71AFEE34BDB8C1BDD435D7E31A johnathanbartolet
515,153,452 *3497E90958964A020EB04F570FAFD3154E42FDE0 JOHNATHAN.LUTTMER
515,153,453 *349A1078631483CDE83E1AC07C0CE897A96B6EE3 wickbegay
515,153,454 *349B34BD24E27D87AF5A32C8B42FB702A6AB2576 willshe6
515,153,455 *3497A9D14A06F5EF4992A4226F8E1FA9AE89ECB0 wispoliticscomwww
515,153,456 *349BBC9F5CA6E5DA253248A3CBECE35566D4AFE2 wmbsbsw7
515,153,457 *349F8BEC98AFBB72F98652029E868CF3818B0234 wyattchristerson
515,153,458 *349E88F4691460BA9A9ECA4690803979650A7942 jonathonfushimi
515,153,459 *3498E388C2683107595461E9458CACA83161E720 JORDAN.JAGGIE
515,153,460 *34947738E5654F6A6CC9C147F28D56531271D387 WST ALEXANDRU
515,153,461 *3493DB4342BA3445F48902A1BFE748F3EC434CCD X?;=
515,153,462 *3496DE59B1ADC61D33C91FFF911AD272DD1E7473 jorge-barillas
515,153,463 *349F59A0BE1D2493EE79C09F535E6EC1CF0F5F26 X2$8
515,153,464 *349E2AB7B7F8705E94544A91DF374B3852FA082B JOSEFPREPOTENTE
515,153,465 *349BD1092BE11F408A883BAA6611136C66DC5748 wwwrialtoshoescom
515,153,466 *34977B61F28D9F050B9D842666ABA7FAEB344BB5 XIMOMIX
515,153,467 *34995EA51E9D669D65CC26F070198AB486733ECE XJ+M
515,153,468 *349D5B0EE98D5E2C7ED7DEA91EA04901AEDEE0AA JSESOURCEFORGENETJSE
515,153,469 *34928FFFE6E72ABF0AC43C6D9CE2EF410A84F58B jta+
515,153,470 *3496493853BFFF43B1A01856DD8842FB2057993C )x(-~-~-~q-----p
515,153,471 *34971269EE665A17AACDE70017D18F535987426B [email protected]
515,153,472 *3497949677BB3B6DE2036B2C15057A27B6C59B2E [email protected]
515,153,473 *349E416E6E42B2C0B4E0EDE00D34AE6EABB4F7BF [email protected]
515,153,474 *3491FFA7DD3250DACA993355A05F61A12EB6AB82 YASMINE.ELSHIMY
515,153,475 *349A378A07DC68E8798982255E7A7325E6F24315 YASSMINEALI
515,153,476 *349AA279E2B9F5AC4AC558D7452E3B661A3E4890 (X).~`.~`[email protected]
515,153,477 *349EA7F57FE9EC5B5E713D0A4A0C43AEB163897E YEREREK
515,153,478 *3494138F8A6D544E03ED0F0287253AAE20E1491A yeteried
515,153,479 *34976B63FD7B07AB2A2A6D6193F26EF8D8CCEFF0 [email protected]
515,153,480 *3492045A31D371AF6B7AB1339135BB1FA1B267C7 XIPWWYQC
515,153,481 *349B7F8AC4BE98B5C982ABD03FED746843FB1CA0 YOKEDINCORPORATION2
515,153,482 *349EAAB5E3742A846296A316FCA68CC04F186EBB kacie-harder
515,153,483 *34953E83033E6FBF4D44E3533DA408E489D9EAAA KALHTHREES
515,153,484 *34995A8B9B066D1CCD7FE5796A09F059B64F49C7 ka]q
515,153,485 *3498168AE99B6E3C95573C15FCD3737F8755F6F1 kargil20
515,153,486 *349BFE190257BD68A58DEB60D6F5CD5487DB383A YRR33
515,153,487 *349A29E7C4B0169899FC9E5A788390DDDC21994F YADUNATH-TRIPATHI
515,153,488 *349F067CBD9675F5E8A9A7CDC95C63D9DF51BBCB YU.TSUNG.CHANG
515,153,489 *349E1C1E67CF0A6A35C758CE70EA44673ADBD1A8 KAUSTAVS
515,153,490 *349624DD719B22C52C566DAB36081CD7E681CC52 Z'A.
515,153,491 *34980C12933F110D98C79F7B6B1308D6E8F4AAB4 KE7[
515,153,492 *349443247F8C40957470F8D2BCE65B010E3BCCCF yashi.bellomy
515,153,493 *34934FB8EDECA9F6171C583B11AB5E92C7B1B8EF YASSER-ALAM
515,153,494 *3495141D69278994EC09D4EC98ED3782103CE037 kekovit8
515,153,495 *3490316F652E0038378DEB2E47B87A1FAF0DE702 kelly-vitz
515,153,496 *3496F2B0C23BDAF8E7D0AD8BA72012B781A05915 KENGEREO
515,153,497 *3499EFCE247C882B653E74B52BF7DE3A73FF423F YEUDIELV
515,153,498 *34957CBC3DC0B145E73EE585CEE83FD40BE8BBA3 yhanna.macagba
515,153,499 *349C4FC9A20EED146A72FF45F70C81F5B6E3BD4D yhjhibucia
515,153,500 *3491F72AD6487685C932405A9046A29650F690AD kennethsoorus
515,153,501 *349B71D8E9488732C5C980454957794A60BC93C2 KENNYLONGHOFER
515,153,502 *349D50F2C9B48A3D46FAD62D3D2D636C70160EAD ZGRTALA8
515,153,503 *349C7F231A95395F51DCFAF43BE32A7BC876414B YOGRAJRAJURKAR
515,153,504 *349576131BE4A03BF3E01EC471791092A060D02A YONG.BRABSTON
515,153,505 *349CA4E9A04C0742D3D7673B8A253E347C798492 you'resocold
515,153,506 *3496F4ECD527C10E8E3225F783C481B78CC372B8 [email protected]
515,153,507 *3497CECAF304BCEB6C3D8EF6AA730970E8AB2980 ZHELYN CONCEPCION AGUSTIN
515,153,508 *349388DD8901FC4A58B45B349EDBBF40E04461F1 YTTLAPSI0
515,153,509 *349A7393291933D90ACE2E2DAB29D1C1F499F26B [email protected]
515,153,510 *349CD0D7F689C304CA7510F4891141BC68A20F02 zhl344
515,153,511 *3498AE837C4D7C9A39D06BEEC804DF0C6D34C63D ZINGISILE.TYHALISI
515,153,512 *349F2C56915B98D4F9F3D065C129ACB471C75F28 KITAPXANA
515,153,513 *3491283184E572AF492DE2EF52803BBD90DE3A77 KITTENDENVER
515,153,514 *349BFD43389B5B1F014AD2F6E0A7F54F91637E10 KKATSUTA
515,153,515 *349C157F8861C0902D9633724042522B247CA5C7 [email protected]
515,153,516 *3491286A8F6E557506E0E319649097F9ECB4F31B KKKK08
515,153,517 *34911A41E6FA4DD064DD16A0B667793967B1F6DB ZARIA.CRUMRINE
515,153,518 *3497328D1D9F644C730BFFDAD9C4A4397BAAA306 ZONDAGSSCHOLING
515,153,519 *349030F9BB60C4087D870F9B5F9A0DE476699D33 zoochem5
515,153,520 *34988DE19EE41565373363BFC83CB93985BF5A81 KOEPBVFAERTS
515,153,521 *3491F3C9FB4D3AD5DF190DB1E3FE9FB95F673D8B [email protected]
515,153,522 *3495DAE5C5358DE3B34B9691EBD2DAA4364640C9 [email protected]
515,153,523 *3498D9AF44F892287DDC9202E6677BA435A4B9EE [email protected]
515,153,524 *3494DE1AA38427D84703A8776273C5D23A67122B konkanis0
515,153,525 *3499BEDBC74BBE5C34F77D61579FC4719816C59A ב–NHL
515,153,526 *349CD93FD92C2336926577B7205D7F7BD960DD9C κολλιτσούσ
515,153,527 *3493D630B754EDD04E508025BFFE9BE9722474C2 ариаварта
515,153,528 *349B4E68D1112996A00F89FE2D6B7138869BF1AD БОГОПИСАНИЕ
515,153,529 *3490842CEAFF30FAA2E1386DEFFFD1C12C80477F ziwaziwa5
515,153,530 *34969DC88CC99C581CFF37520B182DBD4ED4398A KUBDASHEVA
515,153,531 *349E402840A127A9474F677EE6427B5D420FA831 zmrdrcht0
515,153,532 *34941E068ED3FB5802FA1DB17897E7686ECAAFE6 ZUBAIR.BURMI
515,153,533 *349CD0D27DA586F0E132BE528A70A89719BF7997 kyleauman
515,153,534 *349F2BD0DC9289490C3784147DA9702B92BD823C КУДРЯВЧИКОМ
515,153,535 *349B3331F2ED22011C9878A30AC25B2FAB7216F8 LÄHDEKIELTÄ
515,153,536 *349C2ECC06430696C2CE087CC4D10E2137AB7868 αγαπητη
515,153,537 *34976BCFFDA286BD21C8958537186AB9D249BE81 МАЛОЙМОВІРНИМ
515,153,538 *3499C83F9C7B96086363AB29A1229AA4D3B9A756 НЕВЕРШЕННЫХ
515,153,539 *3490BA79F35C9AB9AAAAEE7C32F9637B83397DB8 ΣΠΑΝΙΕΝ
515,153,540 *3498E5352EE961AB4CDCA6BBD767DE6FD906ACF4 нікадымавіч
515,153,541 *349C70B0BA8526A0E2E3E294908401E329B4463D новоставочный
515,153,542 *34985639F1358B3F41FDE43B07D4E56E0B92B05E АНТРОПНЫ
515,153,543 *349C25B73FBEC889377B9EB37B33B01A5C55C208 БОГОЯВЛЕНКЕ
515,153,544 *349CEB7A26D5B30FAABBCCFC4343AFF9F4AF448E LAURYN2328
515,153,545 *349C63C3D38D0C5C624DC57B1C77A0F218F655E9 LAVEKLOF
515,153,546 *349D06E553425FE23781F9F2119C309CED8B4FAE САОНОМ
515,153,547 *349F64CC48D4C6B8B1FCB26B6A4B7701E5548374 СИМПЛИЦИССИМУС
515,153,548 *34915C5AD3906DDE279925EC9CAA4EB377E43789 СПРЕЈ
515,153,549 *3490E9CCF251032C472BE733AF4F2A8C837F60DE талвари
515,153,550 *349BEA815A9C5C8BF7FFF22005306A1F47020EFA ТЕАТРАЛІВ
515,153,551 *349FC61211EB2383E04A458D6AAAC6A1E0794BEF фарерсько
515,153,552 *349ABB15E8BE51E59F8524FB28B00CF4C5631563 LEETERI
515,153,553 *3498C712CE21068A9BEF9F9D3ED9C98CD1115C33 LEETICIA8
515,153,554 *3496AECA8140AF7497B059FB2FCF864F3CE15D9E ЧЕРЕНЦИЯ
515,153,555 *349756C1F7DF545F28CB14975E83F61CF432F52F leontes how!.gone!
515,153,556 *349A3CB33CDE09EA0BF2D32D412B76D2B59FC4D6 LETERNALOTTATRAILMALEEILMALISSIMO
515,153,557 *3497A48425B4C51EEF533FF5A828E6DE1031EF63 LINO.GOUIN
515,153,558 *349788037CD114DCE702C0D2FB71A59AB3B06B61 ТЕЛЬПУХОВСЬКА
515,153,559 *349B165EEEA932A2115B82007CCB2ACC755C1809 LINWOODHADLER
515,153,560 *3497AE147A792A81D760E46114FC3D0621234348 litpon.1.0
515,153,561 *3492B5C6D1B1C24816B61539BFF58E485105EFD3 LIU-YINI
515,153,562 *349B477AA7A7B7B78F076AE1909A1385FF0AEACA [email protected]
515,153,563 *34963E96149ED143F69F380DCD00611064B5FFE8 LLGIVEYOUEVERYTHING(BUOYANTREMIX)(FEAT.J&BOBBYKIM)
515,153,564 *34934A559EE9C7262A20B4FC5FA936838389592E LOISMCGUIRE
515,153,565 *34956728E4684F7021B45274058DE3BF1AB2F3B1 londonamiga
515,153,566 *34922A7BF1FFAFC8B3583212463DCC7E3AB3C46D lowellzar
515,153,567 *3491775E2E4DB0681FC38353C2494E42DDE55E38 [email protected]
515,153,568 *3498268EE8F8102F0F2313C845BBE936C720BC71 LUCASWASTON
515,153,569 *349084C54C72FD55539705C48B9DC4E20441615A に本作を引っ提げた1日限りのスペシャルライブ・MAX
515,153,570 *349498DA4E9BA3570D3FB372239453CBA76F5957 luluzhou
515,153,571 *349AB0AFD186861BC6E7B7DD8742DE4C535B831A Lx#
515,153,572 *349F01E5DEACE547D1FCD170C292E4086A9977EC maasaitiainen
515,153,573 *34935C366DBB67D09F005888DA2299C4974D71D4 に所属していた。身長208CM、体重123KG。ポジションは
515,153,574 *349187FEB9747B226A6E5D156832D4AFF43993A4 MACKRIOLA
515,153,575 *34913D64DDD980A6FA7A2FD79227913F333F62C4 MACROELONGATOOLITHUS
515,153,576 *349574EB84624687AFFC7892CF47EFD4F88327C9 MANAG3AB!L!+Y
515,153,577 *34927C8FF052260EED633386756C996004086704 残されたDNAの謎
515,153,578 *34930988713C8411C7561CFED5E9F5021C690863 為了維護風都的和平,私家偵探‧左翔太郎和他擁有豐富知識的同伴‧菲利普一同以gaia
515,153,579 *349075B6DF19DA7301D188FAEE6BF39DC65A756C MANUELGAREY
515,153,580 *349B9078438BD95853FC455C6BA4534D4C2DEF5E MARCELINO.CIOLLI
515,153,581 *3496DDF498E65D9BADDBAD434949E25C2DF4FF00 MARCELINO.LEDAY
515,153,582 *3499D1997699544E78C55281E1C9E26A2BB33155 margaret-metcalfe
515,153,583 *349696E4A4807D4C4F26952C9794F90ECDCA7DAB MARKMASEK
515,153,584 *349D7B5131380566D155FD25DE198FABB0D3B6F1 MASSLAB7
515,153,585 *3499AA57753684D46A6EF5800E67671900CA0B1F MAURICEGAYNOR
515,153,586 *3499CC9EEEE97FDFA1B34BD02F063DA27CAA7A07 (>_0)*-*-(======Q
515,153,587 *349D2906F0A93B74E54519DABE7975D0D49C47FE MELAPADILLO
515,153,588 *3490A18F5C5367FBB451B32F1CC8754B0DB5E8D0 1068357 auch-der-ehegatte-bestaetigt-diese-version-
515,153,589 *349ADE0FDA47C130CA0EEAB0F7367FFFF8EF0FE0 10Symphonien(feat.conductor:ClaudioAbbado)(disc7)
515,153,590 *3496BB18EF04AF8C5A6675ABF1E4338B2C270E80 12071548
515,153,591 *34902D7B356119017490C20243BA7BDD4D64DBE3 MFPT
515,153,592 *34961E82C3D9B30DD26862A5D9C148F530EBDF18 0verexc7n9
515,153,593 *349CD2445CC5DC857D336B1DD8F579EBC81F64B8 10-BACKPULVER
515,153,594 *3495727AC7E6FCCB0470BA23522320A8FEDDCB84 MIDO-MADRID
515,153,595 *349980CAD5B696AF6434551773C351271A3C31B0 MIGRATORIAL
515,153,596 *349EA490BFDFA5DF4D115A4EB4BA56C3C879AA27 mikelschoenmaker
515,153,597 *349DF05AADEA8899CF6E50D62DAAE4A153010D6A mikepoggio
515,153,598 *349B30AD4E419168C6D6DFE9907CC28A9B420E5D 15.STOCKER
515,153,599 *349454B7424B250CA7A070EDD553CB566C922586 1135408 MAIKKARILLAALKAAT
515,153,600 *349D4A44A4C340AA9162601F2FFB7523A8F30436 1646296 theproposalwon'taffecttoday'sexpiration.
515,153,601 *3490FDBDEF98852313BAA84F2F96DB976E0A024C 170RIK
515,153,602 *3491DCE3F96245C44A52D929C90D8C02BD54E87E 1224280 ZEHN-MINUTEN-SPAETER-SIND-SIE-WIEDER-DRAUSSEN-
515,153,603 *349E57CCE06FF10848A364744D6866F2502EE42B 1751825 KUVIENSOTAAFRIKKAK
515,153,604 *34985DDEF0B0C05A0E06976EAB4E66F3B8D3C7C5 12.HEKIMLERIMIZIN
515,153,605 *349FA07FC2B0D5A6B5386D3F03BD593AD2A044F4 12sep1304
515,153,606 *349CF894326B90B41563F87E71DEB277EBE0117D miquelhuxman
515,153,607 *349F5EE0ADECA98F31C5964B58EC5193A6DFD917 MIRAMAR?
515,153,608 *3491A6758AD0CDE2297E4436DC41004E7BED4351 1383480 DIE-SIND-TOTAL-MOTIVIERT-
515,153,609 *349730BC5648B2F8166C786319B22DD1AA093FC6 1426104 noch am sonntag nahm die polizei die junge mutter fest
515,153,610 *34939EC28A8EC99D72AEEB0FAC0AA7251EC9E242 1434867 ".I.GIVE.IT.AT.LEAST.A.5050.CHANCE..."
515,153,611 *34979BF9EE351BE66B47068BFA5B8C6B698201B4 1452734 LIIKUNTATOIMELLE T
515,153,612 *349DDE0FDD0F3C783F5B2E1B155F69FDF69CF8D7 1999XV97
515,153,613 *3499D2033235C2C38617BBC4FEEFEF7ACF6E4751 MOAIMESSAGE
515,153,614 *3493CB3ECE49B72EA8EDF37884979BF232AD0A36 1781116 ion-tiriac-ist-fuer-seine-klaren-worte-bekannt-
515,153,615 *349B2F8BFF1014938F33DFA32668C80C17E0296B 1beachgoing
515,153,616 *349E4FF839F6474294E50225EECD0EE7E38ABFCF monserga0
515,153,617 *349DAFDF48C498EE540A52D23B3983831F1EF820 1864150 KATARIINA KER
515,153,618 *349BD9F49FE11AF0D1D8A5B5E246DEB7AC9E0B6E 18KUEN
515,153,619 *349BB31A4A269625FFFA99F05416C1118F1D105C 1frauenberaterinnen
515,153,620 *3498389BEBA2C0D9CDFE19EBE93E90AB8B0A5183 [email protected]
515,153,621 *3496A9163F439328103F62772040FD4AE51C33A2 mqa=
515,153,622 *349B349B961D0CC85458108BC676C5C43DA637D7 1IACHETTI
515,153,623 *349F37E4C209CA5BCE37CABA97BF4E45FACED5C7 1CZIRAKY
515,153,624 *3491313A137FEA5E24C4E75F9F59279B899ED753 MSZOLOCH
515,153,625 *34981F29967EAB8457A34F307AE1676190A134A0 1ILOVEPETE6
515,153,626 *349BDB91358A6BD2F880393D35FE7EC124B538CA 1.FERTIGUNGSWEGE
515,153,627 *349A713052A965E93A3238011927AEAC3FDEAF1A 1katseluik
515,153,628 *349DB5825069F651110498556314EB698AB30211 1 KLIMAANLAGENTHEORIE
515,153,629 *349F08FDE540F3044D6BD6A9DD403B0216AEE43E 1-lannoiteputkien
515,153,630 *3496D8BBDCAC4452111697A0762D68A1AF7EFE38 1.friulanische
515,153,631 *349D54AA5EE98A08B863AEA6B21BAA6832869A8B 1.HETOROJEN
515,153,632 *34988ABD02108BB9782ED3E7C5E80CAA470E3363 1 hyvinvointiteht
515,153,633 *349EE7730DE4E48AF18EDF656E4BD32144025B68 1iampatricia6
515,153,634 *349CE20A2AC1CDEBE5D931E41ECAE630852CFBE6 1.kehitysryhm
515,153,635 *3498A53B07A6690E2202A8070B08827AD821D59B 1.OSHINDONGAKSI
515,153,636 *349CF00A7EE68B6985055E329847998F90CA85EA 1LUIKUMAAN
515,153,637 *34981A97D89A11A4526CF6AB5F001A243D0D6FE7 1 PANAMFLUGES
515,153,638 *349CE5A7CA420DC285217E309124C1EC1EA99300 1.panostustasostamme
515,153,639 *34939D86D1A4A98894851F9512330F6C6B4E441F 1 patlattiranlar
515,153,640 *3490AE62C191EBF0B55ED0037BC65FCB7939CB62 1.MALLASSAUNASSA
515,153,641 *3496DC0F4AA2FA7991663965FFFDDB95F94528B5 MYVASQUEZ
515,153,642 *34912256A89A3FCAF8C4E5500E7B026ECB72097C 1-PRIVATANSCHRIFT
515,153,643 *34953FC87AF418874A7E2F2D9D4ECA617B454A1C 1Q2W3E4R5390
515,153,644 *349873EA841A392C0C6A58109BB021AB755F4C8E 1reis-lieferanten
515,153,645 *349925106D26B1951DE72330BABF3BD859CF57E7 1-SARAVALTAISIA
515,153,646 *3497CF60864529412824C341F023127CAA0C1963 1NTR4N51T1V31Y
515,153,647 *349C804195DC3D54A908D9A9AE562D8483D2C6FB 1.PARED-TO-THE-BONE
515,153,648 *349891B986BA4DF5A73288AD9F80658746A22321 1 PLESSOWER
515,153,649 *349E3CF99643EC63C452348EA3345ECEB4A9B6F7 nanosecod
515,153,650 *349AC9B4EBB7E807F0EEA0DEEE04BC6EBD0E1D36 1-strassenmusikantentreffen
515,153,651 *349252BF73792381C6A6211931EEBF70629EBA0D nautilacea7
515,153,652 *3496D2D3E596CA44ABDA347B67B9A6900BE4FC11 !ND!G357!B!L7Y
515,153,653 *349BC3509507F4C2EEA70B9921233470BD97350D 1-VERTAILUKIINTEIST
515,153,654 *34920A58B602B4D932708B1A07C4C665B6997FEA 1-saegentobel
515,153,655 *349F32A24FB5464AE88AFEA592B3B561AA146B54 1.SCHULKONZEPTION
515,153,656 *3493A540095B265DBDAAF5EFB1516E427D073114 1WOODWASP
515,153,657 *34926E6CC0AD9D197C03A829FC1B83A83B3EDE05 NELLIBETHE
515,153,658 *349C0919C1BF1FEC59B94513F2F5D59C605F3909 20041211ISSUECOVEU400
515,153,659 *3496ECCBBEBA5F9B010992C869B44BE283795C0C 2006221 ALLES.OHNE.ARG...UND.VOR.ALLEM.OHNE.MILITANZ..
515,153,660 *3491A1843CD55D6FD4EDF3D9486F25D7E281C36B NEWBORN4YOU
515,153,661 *3497780F3BCBA43E01B6E7D848DC92205002CC1B 1TRUMPETFISHES
515,153,662 *3494B2A648FA7444CC2671747AEECE097718B0F0 1TYOETKIN
515,153,663 *349F211767544C9F6B7E9FA86C65D6BA77CE2BC2 2101290
515,153,664 *3491476E9CA6AB2659221DBD481E4E214E04883C 22161E38D228
515,153,665 *34984E3624B61539A4563935FD89B560CAE0B3BE 2413214 ESIMERKIKSI KAAVA-ASIAT VOIVAT OLLA T
515,153,666 *34936805E56E62F9983B18E02F3AD97E669C586C 2001778 POHJOISPUOLENVALUMA-ALUEESEENKUULUVAISOKYL
515,153,667 *3492336EE7B35E72C24615BBB6DC950FDD538DC0 nimis3
515,153,668 *3492EDB299B87D1187BAC0B09304D12C6945BA6E 2516706 DEUTSCHESOLDATENWOHIN?
515,153,669 *34959E291BED617DBF9423329DFD5210C31B18FC 2663050 MITTAGSHITZEINDERSIERRANEVADA
515,153,670 *349F524B661BAE867AD26997F977D0A40640AA59 2176858 wir-waren-alle-einmal-juenger-
515,153,671 *349425B8BB0D88F22EB5526F26AF2D1C9608678E NO-FENCES
515,153,672 *34963564278D14AC1A733C8DA4FED1E52AA2207C 274129 SEVENDEPUTESABSTAINEDANDFOURWEREABSENT.
515,153,673 *3498FE1E54930079BDA7D120ED613B022434EBBE nolati
515,153,674 *349F0E00611E9AEAD6747A7B3AB36B230B481F68 NONPHILOSOPHY
515,153,675 *34927631CCBFB39D21710F97109D77902978FC5A 2827402 TAKSI-LENTOKENT
515,153,676 *3490AC35507D4480FD9DB1C219F11D077A4DF946 NORBERTLASTOVICA
515,153,677 *349C2118B985A4E14CD15E6DAB4A0FDBF7BC5C03 NORDINE3
515,153,678 *349F8E9580B0E33F04C610F85460EDE07DF56A49 2446607 kanadas ministerpraesident jean chr
515,153,679 *3494BD955AF734BDF06C9552BC8BB64E0DC3ACEE 2-ABSAGENS
515,153,680 *3498FEBA1B406230351C1A31AB271850CAD60BBF 2ADSTAREM
515,153,681 *349048D968AE040B83163928B62C017D3302696E 2558489 ABERAUCHEINSEHRBESONDERERAUGENBLICK(LACHT)
515,153,682 *349A083B21D3F5A30C8BB7D3872855F0C8941DA3 NOTREJOURVIENDRA
515,153,683 *349636C76308020D37523B8B6237A75FA3784855 2.jalostuspohjaa
515,153,684 *3491E71D9778FC17DACBEB2AAD2986A2BDA9A30A NSILDO
515,153,685 *34989F34D29A54A158E47B39CA7D0C4CC5C7A5DC 2-jukola-tarinoita
515,153,686 *3490456ABD452DB594522390D14B76D78592920F nswpremiershistoryawards
515,153,687 *3493AA1C2E8DCE918DDFCF8ABB2C4F101534F5DD )O(`[email protected]
515,153,688 *349CDA1B07273E4B790F7F751F17C25AE522B0BA 2-surffarin
515,153,689 *349CCE919C2E35D4F1FCC85C494A90094216ECEC 2845525 und-diese-schuesse-auf-journalisten-.
515,153,690 *34901BA76E7C750806DC1EF45841F4E7302312EE 2848592 RAP-MAHDOLLISTAA-SEK
515,153,691 *3495140B99A0E2E72E3EEDCA3448A7373EC200BA OBJECTSROBRUIZ
515,153,692 *34930AF98EA92257AB13E822D7D7CBF336063C6E 2vasteppn
515,153,693 *3496B1F62807F32B89B8B095D7EFCD0B5F3CEC4E odisstearn
515,153,694 *3495BF4C2872A31D4BCDE6D9512747A45CFDED8B oDoMarinheiro(CisneBranco)
515,153,695 *349D4DA9CD107D0ABE3BA441C19AD326BE95143A OHSTVMA7
515,153,696 *349808F4080850951E9DDB26299F4237301877BD Oh,WhataNight'88
515,153,697 *349250A06C5AE2A7629D4314EA9C187CA05BBC06 337398 " i see , " said the voice in the handset
515,153,698 *349111AC5DF649AFE3F881739797F033FAA29895 346ASHLYN
515,153,699 *3490CD66E3918037156401FE1DD7C3871A67DD87 omerneas
515,153,700 *349BD4642FAE125347FABDAAA92C3194F5D73B20 3B<-*.*.*(---B
515,153,701 *34922725CE017B311A011E3F1AA791106E373FCB 3B<-.O~.Q----P
515,153,702 *349F43A210F6EB2703239E9D1FB4A5BAA841C4A9 (o_)o~ 0~ d###q
515,153,703 *349D64C029CA1AB169BAF6BB55B93D4D26159EBE O->-<O~0~Q##8
515,153,704 *3491662125BE4DB5F182D4300940CB5CB7BC29AE }o{ ~` (q
515,153,705 *34905FEEA129139EC59611042EFF69544DF72A84 3===P ~O ~O (>_<)
515,153,706 *3496AD7F2928C136F46F512826811417C842335D 3.abramovics
515,153,707 *349A089365A509EB56692DA32C16FE6221F7F717 3ALPREKNA
515,153,708 *34934E4595DD515C7FA0E29C7D2260B3FB3FD010 OSVALDO.PIPIA
515,153,709 *349E3C5733CD90B3F498693719D2C2D8524A0A36 3TESMLIF
515,153,710 *3497CB9DDECE02133BD7CE82E673F6B8B11A2735 3thatgermany18
515,153,711 *3496C366B694FBCD002594C5DB9C03AD0E126CCC 411532 diyerek-gosterdigi-tepkiydi-
515,153,712 *349BCC6272A729BECDA584C7ADEB7BA26EB5AB10 [email protected]
515,153,713 *34991BF069B258729582C7DE573D326914211487 3セグデジタルラジオenagy701「choppya
515,153,714 *3493ADA6AF016A1F4801C6FF750C1B3D5EAA1806 3KATHRIYA
515,153,715 *349127DEE4AE2F290A9CC67F4DAED9175F8BA512 3loesch12
515,153,716 *349C9D5F4E62419DC1A0AAF2AE7F98F2744CB990 466992 dr emel kibaroglu doc
515,153,717 *3498D4B1F28CF051FEE30A37788FC36F0FBC4A81 3oklahoma-bred
515,153,718 *34921CEF6DA1AF3B81BCEA6E7BD1B09DA1F86432 3>~O~o{x}
515,153,719 *349BE3E3F461B9DFFE0A294511BEE8D3F2D01281 4AFLAATBRIEF
515,153,720 *349DEB01CC45D817ECBFE39D37B823C525A15E16 3XP3C7ORA7OR5
515,153,721 *3490CF7AF6E91369DC9DC3DEFB00719F802EF7C3 4EMMATIOJ
515,153,722 *349B44190E55216EB89540F0955E07E965CCBF20 4 HODGEPODGES
515,153,723 *34904F93BBC36034EF3F35871D4EC83B2565D9B2 pa+p
515,153,724 *349617B6C2EE23C9B14A4DD48DF25A6D89334DE9 PARISAMY1
515,153,725 *349928A248503A2F36EB9999DF9514CFDD1B1631 PARTSHADOWCLAN
515,153,726 *349F59FB0E10D9D2524F521189BFC2EF227DD158 4:4#&recta
515,153,727 *349FAD7E72C77B6B90BB6CF82FFDBE7C7E3D4772 pastierský
515,153,728 *349331AC4A1BD9A7F0AF877B85EEE4CD8923F916 4PARERANNO
515,153,729 *3495531349E5888BD4A2DE06EEDC3AFACC1CCD34 4ALLONIE
515,153,730 *349F9DC3C88F94A7DA5233A3726A61313E8A398D 4DECUDBA
515,153,731 *349FD9A84CC7AA05CFC58EBDD4D8F733E79F4DB2 4GGR35PY
515,153,732 *34950EC458E7F05C69EF4DDC174C9B2937CBC77E 4REGESALZEN
515,153,733 *3491684980EB0DCDAE50FB3EE37D04A24CC0C718 4ILUVSTING13
515,153,734 *349E7BEF235B414C83A779AAA3AE3AFBC9BB61CF 4VETTEBOSS
515,153,735 *3497DB810F89390FCE3BB426C3081D664B0BFC72 [email protected][email protected]
515,153,736 *349D22CE4DE185910CEEFF593AD38833E27E7C15 4SICHERHEITSPFOSTEN
515,153,737 *349746E6739E530A3DB2D168C25158F1B4997DF5 4THATTOTO14
515,153,738 *3493C152835DAA69D13430CAC3F0D5C50F9686A5 4VERBLIEBENS
515,153,739 *349FB0E047EBFEA0D1B71BB802A3DC98AEEE0B49 4VLAKNASTO
515,153,740 *349C1E5F4FD08F97066D7D0F275D1EFB61476D59 591177 KUNTOUTTAVAN.TY
515,153,741 *3496B015855445EBB59873D37363944F58971B9A 4YLSUOITITEPER
515,153,742 *34991E81294451661E5C9208E95F45BB4BE67A35 pgduui
515,153,743 *34941CE7261ABDEE531077AF06D61B14969F18BC 5BALANCENS
515,153,744 *34965AF433C819E23C5277BB7A526DFCAC482A7E 5BESPROEIERS
515,153,745 *349555C040C7200C0BB122446327EBD3AD292572 PHILTHERIOT
515,153,746 *349B3BB1D862615EAC3425AD5FD6FB17BF6C51C1 56-QUICK
515,153,747 *3496F62E0EDA0E60F373DEAEEEB1682B1887261B 574344 SELVITYKSENMUKAANMERILIIKENTEENN
515,153,748 *3495BD811133B08FA219DEE8D0C3550331BF5E74 [email protected]@TORY
515,153,749 *349E27A2ACEC8DE45823493ABF03D1A0FC919863 phoenixbradley
515,153,750 *349C7DA3003B51413EB4367449BE9A3E912407EA 5HOEQUIST
515,153,751 *349FCAED0722E5DB076B5CCFE356B299A16015B4 5BOOBOOMAGNUM
515,153,752 *349731647ED99B73D3A556EEB63A739312FE9024 5ilovegarfunkel8
515,153,753 *349F162E0CCDE47892E9569D552CC3E12EC9D84E 5JASCALE
515,153,754 *34986F3C48B3ADABC41B70860CD01A47BD93E317 PKJUNIOR
515,153,755 *34900C1C141C396907A34EF90D44D017B836D6C2 5LAVRETNIP
515,153,756 *3490F74BA074CD858C8968DED1C8199D6B726E04 5EHCEALUZ
515,153,757 *3493A45E120FE7854F92E2646B6BB5BC47167F93 5EVITCERO
515,153,758 *349A63AA4D0B9A5FA0CD4BE8B302CB6A12C00DBC 5OMNOL3NT
515,153,759 *3493E2FB2B64FEF4DE8928F1D2B4518728A87413 5ORDELIEVENDST
515,153,760 *349DCD52C5AA44AB44E802C30292D5C4456F34B6 5JACGUEYN
515,153,761 *3491EB7D896B255E6F2F3CF3CE36B70A1A72699E 5SHARONSCORPION
515,153,762 *34963C85CC90D0D91146C526B1EF94D913CC6817 5SURFING2
515,153,763 *3492171F3FB42FFE44554C6C5810BAF30C271CF7 pour the bottle pt. 1
515,153,764 *3494A85D7B6ADBFA6181493F44F3F810871A03DD präsacralwirbel
515,153,765 *34993BCC19BF6ECEA2B27EC6ACBBFABE483BEE74 665506 NUR.EINEN.VIDEO-BEWEIS.LEHNE.MAN.AB..
515,153,766 *34923AA7E05FD9C6326B9CE9B45ABA8D8B1AECCD 6CALIFORNKIM
515,153,767 *349E1B08124D5B32923E7610C56AAF5105D1B6FA 6CLANTON
515,153,768 *349D496AA54F4955500B285304A97FCB1F501F25 6HORSESCHRISTOP
515,153,769 *349ED0D5613E523E99BD91E0AB70C1CBB772FDDB /PROC/564/TASK/564/SYSCALL
515,153,770 *34956FAF45985DF85E86AE4A0AE9A231F6779755 PROLONGERONS4
515,153,771 *3499920A988BDCE02A0F8B9BD2756E9860360CC8 proshop1
515,153,772 *349C7F13388112FE7B749BCB0F26A15AE59EBF0D 6NAAVITAA
515,153,773 *349E2316B9521B020D5F7F89C426A366141E5783 6OPPDATERINGEN
515,153,774 *34969C9493C05A639A34A7AE83F9C352AA0750EA psa-we-talk
515,153,775 *349F2DD7091CD993CD5B84E77A316446AE12DAA1 pteridology?
515,153,776 *3495F73161FB8F8C1C5660AD7C29ECE11636D775 pulsarme1
515,153,777 *349987526C5C175605B830B9168715C87B9901D1 puncane
515,153,778 *3490321CCA38D2BEC7F0C11BFAAFB214187DEFD7 PUTPWENTING
515,153,779 *349A566D32BF408F7C7B60D81CD421D3991B6C3B [email protected]
515,153,780 *3499B9C2F9E404C816227EADFDCCECFADC6EDC45 7BSWCLEMMONSBSW
515,153,781 *34917B7E5CF3CFB18317B5D3D27EC91855D68F36 q#####)***o><
515,153,782 *3495CD9204D0A0E704C5B91524E960922F178E24 QUESTME6
515,153,783 *349482E5BFC9D2C282D2F6A6C09D4116E39E6B73 6YLLACITITCALATS
515,153,784 *349FD25E4BDC02DCCB927813224B3DB1EC661B88 QWATNE
515,153,785 *349E3862699961707C2270E9C78D8112A56C8F8F 761930 debaderIaS
515,153,786 *34917E5FA191EE19B49995FB449EFB2619560C57 qyo]
515,153,787 *3498E31A8EC6EAC2244D40A09469DEC4C4B0443C 7INCITATIONS
515,153,788 *349093903EA491B060207D505E54873446768785 7OTENTATS
515,153,789 *349C3B8DBC937C2E23D78684CABB6AE988FE14AF 7.destroy
515,153,790 *349E641FD191120FA3E5BC8684A2E5D5CC268B36 7DETAILLIERTEREM
515,153,791 *349A098A56390668C2798DAD2F6020964588A951 RAGBÂR
515,153,792 *3498EB13077550F4C82082BBF53C2B28D89A39BB RAGSUNDA
515,153,793 *349ED8E0B3C59AC749C92DC6186BD3CBD6EB15E8 [email protected]
515,153,794 *3499613750554B95B3F97A32C278260CB5255ACE ramirorasmuson
515,153,795 *349E7179A665DD7F3E9EC7C277E3CB3779331A2B 7LAYNERS
515,153,796 *34985CDAE4FCF059983FFD6B0C26FCE7813FBD04 7THECATHERINE3
515,153,797 *3498D1C7A212931A868388FEB10495524ECA5989 7TOEGEWASSENS
515,153,798 *349B4D314E682F6DC3BE5BDA45A7E46FCBD99B2C 7mydarkstar3
515,153,799 *349D8DD9032A765E5D2D42BC7433A50197B245AE RAVINTRAN
515,153,800 *349588E347BF4C8BBDAD1C5A08C293C86D2691F8 7WQSBCELICA
515,153,801 *3492DB96C3032A5E03238971FFD4ACCB4C41B826 7RAIDERGUEST
515,153,802 *34957788DD086DEA9A05E6FC4E6E8556A6931268 REAL.ERLANGGA.ERLANGGA
515,153,803 *34993232CF4AF1A0F7C0C47AEB075D779A68C532 7RETENTE
515,153,804 *34928FA6F17C69ED37112B031BC6000C837A4328 REALLIVEVERSION
515,153,805 *349B9188ED134A9C23785C8D17EF65CEDA34B3B0 8483CORNISH
515,153,806 *34972D195C589584A95EC6FA8D6D3732958F85D3 8620139I
515,153,807 *349439F75DD568DBB1042137252022C2D0548FED 7silverton
515,153,808 *349F82F802C82F05FC633C1F8448204078F48B15 7THEDALE9
515,153,809 *349A0592AD33D4B13F45DA36985E87F0C2AE4FC6 7WARENIAN
515,153,810 *349D98895C049B50538C077B7744C77119F28088 RED-LIGHT-YELLOW-CAKE-AGAINST
515,153,811 *3495A17B41622C74C4C0943312A61977619A43DE 8ANVAENDARVNLIGA
515,153,812 *3499D3536DE8CF34ADD4C7A5C5C7CB0FE70B4E14 853650 Iz-peSindeler-.
515,153,813 *3498E8480C8FC714CF45D01F75C4228A9CEB9059 [email protected]
515,153,814 *349E5DE16B761D5641FEB8D7A254EEE6D6EA9C07 }8{**(==b
515,153,815 *349C415595B8190400C7EB8E888AAF46667FF980 8BSWCCYBBSW
515,153,816 *3492ABE7B19BC97F3D4DD3B2DA11A53EE767A126 REGISTRATIERES
515,153,817 *349EBD4017D9720A241309B3D2008EEFDF16BD93 8CHARLERS
515,153,818 *34917AF411D7D31E40F482E0019EF65F3EB4D14D REHTSEAM
515,153,819 *349A08C7328A6836360D070967384199F5B5719B rei-andres
515,153,820 *349A2B15768D0E7B66572B127FD1B60F9AAFE897 8COUNTRYBONNIE
515,153,821 *34938E3FE750F25512A3593AE4EF8B391DAF63A0 8BSWDASHNACKS
515,153,822 *349987E8902201652DA903BB9A655193A0A0990D renatooser
515,153,823 *349A1C4E8A6C09FF5CB4B2516D5CCB48DDA6EC8D RENEDELANEY
515,153,824 *3498F3AD3FFD6978B50946854B0DD48D04A03DE1 8EFFEUILLERS
515,153,825 *3491CE87099C28F4814BC432956691E9626EE7A4 reretouch
515,153,826 *349ECDE083BFFAD8F40CB9E6C14AD757AE21529F RETALJERE6
515,153,827 *349A51E2FD4B4A4B8318E8E9160003709239280F 8ENTMACHEN
515,153,828 *349A68875CEEE65F457CEEFDC0CFA747CE379DDF 8INSIDEDRUMS
515,153,829 *34956FF2BBED66C2DC72A2D0FFD180534640AB32 reybattey
515,153,830 *349F2DB81EC387115DEFC44F5800AF33AF169CE2 reycarmody
515,153,831 *349307662667B6791A00A831DAA7B5591E75CFCA REYNALDORICKENBAUGH
515,153,832 *349E502EFCF790A57113AE124BAAC6F99D4FAEF1 8.IMMOBILIENINVESTITIONEN
515,153,833 *34959486C031B565D4B0E14511B3EEBF21BEEA4B 8NDAMAANAYOH
515,153,834 *34917EC30671BBAB7807B91852E02BC4F96B383A RHETTGOEBEL
515,153,835 *3494F6439F1639E200647DAF6F33695D7D9C7304 [email protected]
515,153,836 *3492F6599528CACA1B46BDDDBB6CE020DFC4DB24 RICKDEARE
515,153,837 *349C64E772134DFA8B2D97DE483EBFE84EDFF885 8p***splat
515,153,838 *34980FFC09550FDD2A77C44857439EFCE546284A RIZZUSO
515,153,839 *3497D10CDEED42CD199FA617BE8505625B8C54C0 robertanzelowitz
515,153,840 *349AC56FCF32C513830D90E5E848D5105B38B989 ROBERTOBAARS
515,153,841 *349511B03CCD64CE369A98CEAB0B3AE17ED0076A 8THECUDA9
515,153,842 *34962BCAE84D36835F36D989802F345213420859 8VASSTEEK
515,153,843 *3492061C7797E05A3F53AA533B968B356B7509FD 8WESTERNJUSTICE
515,153,844 *349B52BB9B3AE641372689BA2D78D91241818F3E 8-xd
515,153,845 *3496666766BF4A6B38ECD23637212775CA3480EC ROGELIO.FABER
515,153,846 *349E943FA1B27BF28C693C3BACB9A9A6B6B91D21 97129FE1094EDE1B07F5D52C3FEBFC5A.OTHERSFORUNS
515,153,847 *349E762554F5F4D364B8E8D2573EAA15F163B977 rogerdawsey
515,153,848 *349CB92C85717D2BEDE77136B827F98EAB51F993 972crystal
515,153,849 *349F576547601574E4343BC6217CEE46472FECC0 943012 the-fires-posed-no-threat-in-the-desert-scrubland-
515,153,850 *34907293A3F7A45C346F5ED8FC37394F95B13E9D rolflosier
515,153,851 *34941C8710B22BA7A9D97FBC3A91B06912DC7AA7 94R90YLED
515,153,852 *349EAFB5FB5E60D11F39F66E8A5AB90069D140B2 ROOIDEN0
515,153,853 *349156E5E2B235EC02B29C8C3A0AF428B77CE2F7 9BSWMIDDELAER
515,153,854 *34920441DFD61BF6C60A96918D6111C8D930582E 998401 kucuk camlica / ist
515,153,855 *34978603F8EC9F6E0644BBF81120A9BF53E1831D 9DEELETION
515,153,856 *34956857314FBDEA76A4E4B6105D204F6118266F 9GNISSARRABME
515,153,857 *349AFD9515BEC0888443AE261B27EBEEF63FD23A rossi-1980
515,153,858 *34993D11AF82B6C6FA23690F82E35431E793C181 9MHYRISS
515,153,859 *34929C4E86522C862692D4ABAA99D04281210A92 9MYFRIENDS4
515,153,860 *3493AF453F6DAD190BB571CF405B0CD8E61EEDB6 9PAPAJULIE
515,153,861 *349A30B7329C0361105B37C742664C1D31039416 RSAM.D
515,153,862 *3491E497B78D820FD98FB96BAAEB8AC94B1436B2 9SRAANNIWSJIRPLEBON
515,153,863 *349FEF2A685C527C5CBDF5171F509756AFFA52BE 9trebizond
515,153,864 *3494712A11F52CA64F015BB3BA296DCD49AC5810 9WIMMERST
515,153,865 *3494F39EEF6CEE776C80C7D38C43300B474B2533 A0O8VP
515,153,866 *3496AF8E2A2CE6EFD20B7126DD19355AF1C1D113 rustybeyda
515,153,867 *349EA39B50C711B43555D4453A45166A9BB3FCB7 a1rp4
515,153,868 *3490278B3BA8F607414E62A8AA5428FC93CF6BBD a35v
515,153,869 *34956D880ED65BA481D5ADEB7C4AFABF22C3F685 9RASEREN
515,153,870 *34998EF2708D99B683C9763770129C28F715F437 a62b
515,153,871 *3495D817F25EE90CB6679196972E3F27F2C5E497 a8n1i
515,153,872 *34945D3D49039BC8E36C831A22794CA5C0C102EC 9VAINOTUI
515,153,873 *349F8708CC2E8E9B2608F5C26CDC9A759AA925FA SAMMIETRACY6
515,153,874 *34991E07821BB7D68CB3ECD955F23899EC666F20 aaa#=a
515,153,875 *349519D2C4DBACF2241770E32898E38DC1D4BFA5 [email protected]
515,153,876 *349EE5D5AD6EAACB93D3C9FF0BF7E5AFCFF1051D A65GD
515,153,877 *3496353644F71D0F72F40546FA21B634FB120419 A9ROK
515,153,878 *349569577D9B0A089DDBA0B171596ABA24273998 AAJARAVA
515,153,879 *349A3B0E9C6F02A36855F11792EC066BE8237B47 AAR.BEAR
515,153,880 *34907F2C2A9F622A272BC6750CC7D8A3014A35EF AARON.BROOKES
515,153,881 *34931B91FB19D3D310AAC61774635D1E7BBBE92F [email protected]
515,153,882 *349C1C54DF34E85F5954425946B942AFDF92A210 AAB<WL
515,153,883 *349CE67E382DC127D116E4955ADABE181E5B6E8B aaidozen5
515,153,884 *349A460D2A139595A13DCAFA85F793F4A53CFD07 SCHWIMMGURTELS5
515,153,885 *3493BE808EB95B39B0301B588ACC3FA11C64ED81 [email protected]
515,153,886 *3494F2714786F777A7D29AD15FF92D2111E73BFD [email protected]
515,153,887 *3490DBFA15D631DF87D34475C7691E6F68B7C99E a/bls
515,153,888 *34931E4179800EBC8ADAD0A9169D5E307B7CB495 abcdefgdollars3
515,153,889 *3497DA3FD6DC668F1A574F7070921639A5F2CD3F [email protected]
515,153,890 *349B638C64ED3CBDEF1E72F42B642B7FD06C0C53 AC91,
515,153,891 *3490362AF358A9BEF6CE83497C953AA9D5414F77 accessangels8
515,153,892 *3497308C13C0AF2393C5952A7D91B53ADD3196E5 ABEER.AL.OMARI
515,153,893 *3490812E624EBAF55B02B87E83BFB678889AD46F abelgreenly
515,153,894 *34997DA55A16AA9D331B6E7E5984C63DC04ACE45 scottychristion
515,153,895 *3496102E496AD7C69A6E6FEC0D104E345A3346F7 SCOUNDRELISM
515,153,896 *349FFBE3684EDB1848937395D12E93A4AD6F17DD SeeSaw / Chamber Music
515,153,897 *34955CE6269F685A244BB1FE6ADF963934A63FC4 ACSAF
515,153,898 *34928FA8E1A6FFDDDB6F33B20E155F1ABA3A5BCD SEREVÉNYFŰZ
515,153,899 *3497D433EA9DE6F7620CCCF07F0C368E1752342E SERGEISPARROW0
515,153,900 *349A04261634AB4D6951A1CAA8253C8B2B32E1A6 a?dbo
515,153,901 *349AFE0851FA75BC30C85D2A97CFD4C6E26499D1 SERYSMENNEG
515,153,902 *349E7209E437206B22565D3BDCC46B54707ED420 acns&
515,153,903 *349653075D5765FE2C8A7A12BECA890890DE19E4 ACSY<
515,153,904 *34927A6A36AB29352F7EC068B7BFF09C29DAD664 SFANDOM0
515,153,905 *349F3E7BF7FC27332143ED10B5E89D3A528BBC05 ad9%q
515,153,906 *349705832E0904D511B2BE0ED74E1F003327A3E5 AFR77
515,153,907 *349C1D2AA84714526CA24A56389BF476ECEFCDF8 SHAWNSUNNY3
515,153,908 *34997747A802457D2DA111E6C8D1CF5964AAD715 shaynecafasso
515,153,909 *349CA8F8EA2D76EDFD803C61A84E7435CB07978C SHAYNE.TRIPOLI
515,153,910 *34957EF287973D943CA4CB973D685343AD005C78 AEBTHCIN2
515,153,911 *349F4EBC961B8538E55F86704CC07BB60A3AAD07 AHFR3
515,153,912 *34998A5DDD492C2A6E2271A7577DE61842865B37 AHqr
515,153,913 *3497D766446D4270A9C2FD4C79C9567971EB9FDF sidcoxey
515,153,914 *34900D2F01F4566DADE66DB1DEFE74057900FAE0 A,K+(
515,153,915 *34949B31DCEC6096D2FE41E4E908683F0A89C68A agpgd
515,153,916 *349844344AFF7D6C2BC0DA372CFBE9F70BF909A2 akiminchi
515,153,917 *3498FDFEB22A71A9B7413013D6D16FD22175C3DE [email protected]
515,153,918 *3497EA9022427334E6C2C798B21548462EE0920E AHCULIHC5
515,153,919 *349C966BC30CA235039457E42ADACFB9B592A2E7 AI+IN
515,153,920 *349A5CE2A0912D577B282EBEB9DC87D0CAF73A73 ALARAFAH
515,153,921 *349EBF2E57A5BADD77F0704C8568295A098FF2F7 SLUSHILY
515,153,922 *3496A5F30F823AFF587BD2E2AFAFA0B401EDB89F ALEXANDER.CAIRO
515,153,923 *349889E06DAFE6CD56672AB6C2C1CCACF04B2CE1 ALEXRENSBERGER
515,153,924 *349936D3A460A590B7798B9069A1BFB6A993928B ALIMENTICIO»
515,153,925 *3499F8042AAD109F9B38AF3ACCF4558880ACA958 ALIOUBARRY
515,153,926 *3495C431207B06C65DD4C949C7F9F12DD2CC2C15 ALLEN.TEY
515,153,927 *349B7FD927FA4900C3513120F2524528B2826C67 allsvenskanc
515,153,928 *349A8CD4D34B2C4D4BF31C1077EB8512A6C70DB0 ALONZOSCHMITKE
515,153,929 *349A01507D825FB2EB2B32EE9B1F461E5BA45CBF ....alle.an.die.Ruder
515,153,930 *3495698B3F30ABAA8AC404F2A7E7FB2693ACC865 alpharecursion
515,153,931 *349E9FAA42604AC9594DF969C0B71E24140CA704 AL.RUNKLE
515,153,932 *349C1528A11365110D2163D347D2DFDC3AE82E74 [email protected]
515,153,933 *3499CF7FC66337E97F6CE6725717862C7B16B264 alterase6
515,153,934 *349E4C55CC50936D0D02C2A3DB1D35246D7F860F ALSOCIRCEUS
515,153,935 *349F6B6D365969FDB40B190797EFF5A9E64FE87D am,b2
515,153,936 *34940F1BD56FD27BB2128E3B5F22E41C59B816FB sophiabeauregard
515,153,937 *349272410010BAFC90DDA2446975FD45DD8C1250 SPACEY & SHAKIN
515,153,938 *3492F39380CE408300B36D5107411A36717993C3 ANAEILLE
515,153,939 *34922262C0D944DBA89A105724A6202B91E2E176 amt9k
515,153,940 *34905642D33DE5493B5C890DA5921463C54C695E ANATOLYSHCHARANSKY
515,153,941 *3497DE915ADCADFEB7C8C99E315445B554590462 ANBLICKT9
515,153,942 *3498296297BA0405A2179564C5459826834F1CEB ANDPUBLICREASONSSHALLBERENDERED
515,153,943 *349A1DEF9FBA2D10443047B4D46565DFEA219FDC SPEECHJIM2
515,153,944 *349D4083484D4A754D72354D5B975D6E8D425D08 ANCHORVERTIGO
515,153,945 *349326623EF4E125B09B35E78F605459D8BB3F73 SPEWN9
515,153,946 *3495AA56076405C4F75D68A8EAE08B63D030F056 ANDY-MAYER
515,153,947 *349911E0453666164B14AA465F34C2E39CE3035C ANEEDALAIN
515,153,948 *349672B091EA16BED4077965613C4D2EEA70CE23 anemicses8
515,153,949 *349D9DC1EEAC9D0109C60C20A0B3B646351F2C5A splato~.o~.d#####b
515,153,950 *349210B30BA505927C319D6F81B4CB0851AEE684 angie759
515,153,951 *3492C9B55F16FB9DD58F3102188FDDDD5F27B43F sqs4
515,153,952 *349AABD173C5AC9106AB34AE670478D5ADD7006A ANTHRAC0THER1UM
515,153,953 *34924ECA15A5278A6FAA8CCA50C127C7B4A32D87 ANTIBERLUSCONIDEMONSTRATION
515,153,954 *3493DC9076C21B989947A036D8ED9430046C1EE0 [email protected]
515,153,955 *34971D28EFA800921EA489D278EBCDB3125BBE8B ANTONIACRESON
515,153,956 *34981D2C7415AB75D43B111D640F5A2CDF8B7501 ANTONE.HINTERMEISTER
515,153,957 *3497360387E0B20672EB955D5A5C44B143C3FB15 ANTONIOCOBAS
515,153,958 *349C3B7915AB88570CAB48A7D1903144B71DAD74 anzou
515,153,959 *34961BF965BBF20CD978AA897E0AE575370438C0 stacyhartnell
515,153,960 *34976F8DCC55A4FEC940B89BA2F96EB86FC80867 [email protected]
515,153,961 *34928277807072B269FF796CB9AB1173828EC171 statalistico
515,153,962 *349228101FBD00E2D0ECEB356DFEC97D4469D2B1 apghy
515,153,963 *349547113C5B1B6804132B277EFDC74ACE50DE1A arcuate
515,153,964 *349422F3C864F5C2DDF9B35CD6FFF0DD133F366F AREAMINX
515,153,965 *349A1EBBB36FEBBAB16343747451028D536BA9E7 ar2f2
515,153,966 *349FCEE476555C65623C531F5A97676E99A33106 ARGELOOST.
515,153,967 *3494DB9496B84599255000877168B14729D89023 ARMANDITOS
515,153,968 *349E8AE1ABD4E51301DD39CCBB2A649429A71D06 ARTCHESHER
515,153,969 *34980EE4E2AC2B7243D36CCD595BEBEAD5712ACF arthurlamke
515,153,970 *3497722BAB4A1D7EF5CF1CB744744B17E91790E6 STRUISTI9
515,153,971 *3492A4D85A4E6AC869F20733616C792D363170D8 as-abelhas
515,153,972 *34988D3F22615384DFE0167D4A6AE1883FEB392B SUAMKCALB
515,153,973 *349719C0CC8E4C4C43A71BAC8E698145DB9C0D9C SUBJETIVIDAD”
515,153,974 *3497B2F98187155DE3F337DBE04775FCCE2CFCF9 a;(sa
515,153,975 *34970E26F5E1038FF6532F3DAE4703CD90E68C8F [email protected]
515,153,976 *349680040DF5303A41DE5CBFEF4BA7735CFF878F atributetothegreatesthitsofu2
515,153,977 *34965D5D70D02D836F41268C7916EC287B6AAA99 au=b6
515,153,978 *349D4D1EC709AED25803410217C2A0C8FEB56466 a&=ug
515,153,979 *349C41BAEECAF49BA819B32B59985935B84DF846 SYMPHONIC SUITES FROM STAR TREK
515,153,980 *3493758AC1BAE00189D5A0D8218A25A88DED544E AUSFIREAUSTINPPDICOMMOZILLA
515,153,981 *349EC98E94C888587E9F3DB26EDEA726A42D1D82 aven6
515,153,982 *349A9C71DA96D5A2078D565DE3DDC438C74FEB7E TÁIB
515,153,983 *3492C908EB6131DE6B6FD43906426A4A9C03DC45 AV$HT
515,153,984 *349E0481AAFCFF14D7095E2955217F3B2609AF2D AWM#2
515,153,985 *349A5D47A428224A9F7B493DAD9B2294F146A50D ay-do
515,153,986 *349C7BA9F91719950FAF4B678A42200DA88181C7 TAYLORPANTERA9
515,153,987 *34925BBB02FBB3A534D22DDE9FE8FE9F60503C00 tbildning
515,153,988 *349A910B51DDC074E1D05551486A4621702883BA aylqe
515,153,989 *349E7662732842F24CB712984BBE5F7519C4DD66 az$s2
515,153,990 *349032E1A7E7204CC09031729F3D730438F2FF11 A$ZZN
515,153,991 *3499D0AE6C4A11040C4086185C58DC582305FB04 TELLETXEA1
515,153,992 *34960CDF9B06B88A0F8BBC6DA43169D896848FF2 [email protected]!E$
515,153,993 *34962C1E440D9CDDD8B5B87C924BB475C2C898DD B3tc
515,153,994 *3494FD41440FCA3FE321F6A902F5CD5ADE7812D1 [email protected]
515,153,995 *349EAEC38F0D6709A1A1962BE681B0949B27393F THADDEUS.KALAULI
515,153,996 *349C819FEF0EA9DCFBACA5BFEBE7F46A005BC9A4 THATGREENDAY20
515,153,997 *3494B2D45A76C18E4CD937E05980A2CA5479B686 BACARIRDI
515,153,998 *349AFB9F7E4CFAF942D56D2D55D58B95F5432B90 B6RS&
515,153,999 *34935F71F6161C83A84E8E82A381DBB643D73066 [email protected]
515,154,000 *34925B6FA96940C8161837342B44DB4DF57FC4CD themurphy32
515,154,001 *349CE5567E44F9AD7DDB73CE95FC4CE7E4DCE793 BANDITABCDEFG
515,154,002 *34961AA1035CE43BDC0C3DEA615DD570FC90934B THURAI-CHANTHIRAN
515,154,003 *349E2F5156074D89BDC93D35A65213637662D18B BAEE#
515,154,004 *3493699990D502ADDFB329463F3AC49A9CE79F29 BATORSHIKL
515,154,005 *3498B6CA9B3A14EA57365CB098DBA6803AF108D5 TIETOKONEBISNEKSESS8
515,154,006 *34982FFBC8E9147F19EF3264E8A16527EDFAF842 BAWLERED
515,154,007 *3496066EAE0A0E7E121899994CB8B88E8DEFFC52 TIFFANY-ISHMAEL
515,154,008 *349A901FC8EF951021F19F004301655450E225BB [email protected]
515,154,009 *3498626E09330B233523D93C66ACD5FE7E59DAA2 TI-ON-LNG
515,154,010 *349E0241A9BF17AE85668F8816390E8516607558 b(bp
515,154,011 *349B3E53543E95CB99FDCDDA16C87772879E3B24 tiwehemalc
515,154,012 *349B570D9A79151A259E54C3A2B53E48FCAAF4FD TNANONORP
515,154,013 *3495D340536BBA3AABE939D1EA7FD40783754D2E tnanosinu
515,154,014 *3496F7AB6FC71D60983CAACD57712125710F8EE1 BDNSI
515,154,015 *34940FFFEA6338DF4A14E5B0303CD94F22FEC658 BECKET160
515,154,016 *349594B88E8EC019D5D56366F009B8CF2BE08AFA TOMMY.HORSEMAN
515,154,017 *349FBDA85C4885B4D16638F78C889C7FFE807B33 B&BGI
515,154,018 *34931FA476B182D55746ECF3F32E0BBEDF56F892 BEDJI
515,154,019 *34951424472D5155D167D84447062B17EE464F96 b#eh(
515,154,020 *3492C18CF270A10B63D08CBC082396A7FBEF88D2 TOPFORHANDLINGER5
515,154,021 *34965134942424F3134B2F85C68F8984052FC1C3 TORPIDLY
515,154,022 *3496424342CD29904E5DFA8CB751A2A1259D50E6 BDSG/
515,154,023 *349E878231BCFC3D0CC03D04A750C0C37CED5C12 TOWNSHIPMAHLAING
515,154,024 *349F29AAA73358FBD956C787BD80EB678B05ECB9 BERNIEARMSTEAD
515,154,025 *349CEE6A4ED6E5E13678AE9A17D9680AE920ADB5 BECTON.DICKINSON.CANADA.INC..|.CANADA
515,154,026 *34915D5A27EC9F2E35691B8C29B607B642811369 BEITRAG20070325183416
515,154,027 *3493544E25F7986DD25DD41C155B44572B30631B BEST-TIMES
515,154,028 *3495139403EACCC1C9804E259608968D9E228462 bg"u
515,154,029 *349853A0622E0D80BD435B684ED4B5F45B550732 trixy.mc.gee
515,154,030 *349CD0680F5A49B4D8E239D7EB177ABF13C3E38E TRKLDETS9
515,154,031 *349244E0A2E245508B9BEE0427F262062EE51724 BHj,
515,154,032 *349F4CCB06791B04E63C5BB95228663FD76C1F42 TSETAERG9
515,154,033 *349A3206B2AE6D00D95E0DF2F4CB1EB538C3D658 beret/gloves
515,154,034 *349F6F7C3737C66201BC1074325D48011317C6F9 TTACGCTGTTGGTGGGAATGCAAATTAGTTCAACCATTGTGGAAGACAGTATGGCGATTC
515,154,035 *349A6C12EA8D6651B6C4098960BD8A46E9A52C5B [email protected]
515,154,036 *34988797D315B70F640597076CE9EAAE919DD06F [email protected]
515,154,037 *349016CE612B952F092C437B73593A0FAC1E040A BII9440
515,154,038 *3497E1B0A6CBB28EA3BBABBD68BCF965E39F8E78 BIJMENGEN
515,154,039 *349EDFB491087CF303E87E225AEA5E08D29B7DF1 BERRYAMARIAN
515,154,040 *349A1000C31E974B1618182388C4A873A36F8A88 tubesinthemoonlight
515,154,041 *349EC643859840381C69CCAAAC7D5644AE864EBF [email protected]
515,154,042 *349CC26E73CDF6FF1A4650672F21BBB7AA7F9EEE TWNCHESTR
515,154,043 *34902B91B6EF4D13652BF1DCC0D9BE16DEA8A9A7 [email protected]
515,154,044 *349605499F61FA6AD034CD06CFF77C536D044451 BITTRARE8
515,154,045 *34916717EDC76ECB9CFF490A21E1330135A578FB TYLER BUTTCLIFFE
515,154,046 *3499BD257CC5455CA8C0B076764892A4F865DCB1 bk44g
515,154,047 *34963EC38E750F469BBBC526E10181C1F58873F2 TYOKEKUEN
515,154,048 *34939B3386D1160409F7AD83A29D2D528EF7100F BEWUßTSEINSSTUDIEN
515,154,049 *3499B052AE11F385DD08DA3FAF1CCDD97F26223D b(?lm
515,154,050 *349DFA2B006D35B821138871EEAEC28CB5B9E22E Un chulito por Nueva York (feat NutRageous)
515,154,051 *349A802F80EE5CB12BAA42324336D47F41C545D2 BIANG'S
515,154,052 *349C0C69DEDEEB04D6D26C7559FB7145B442CAB9 [email protected]
515,154,053 *349A4E4088E70CC36E5AF1A9D7116A05B9D7CC76 B###)~O~OSPLOIT
515,154,054 *3494B328F4107D2D8CCCBBC369579323BA4F938E bosphorous
515,154,055 *349BE1A62BC331B9F60789370F896A80A61C8737 birdisla8
515,154,056 *34994EEBBD56D4560656BEC203100FDFF29DC02A B"KLL
515,154,057 *3492566CEF9709628A8729102098A3A72D639917 br2e$
515,154,058 *3498B7DEADE30554078392AA6C14D5278CD85628 uvarani.letchemanan
515,154,059 *349CFC148774E707529B954BA9CE4E73255330F1 BrandenburgischesKonzertNo4g-durBWV1049-Andante
515,154,060 *349E60AB1CB492F4B96B1669F863D9D73CB81661 bner-
515,154,061 *34919D9AA76A1DE3970159A52D0C1A23EF5629E5 b^np
515,154,062 *34908455237F4DCEF5683830FB25E1B059391219 vanesabucaliu
515,154,063 *349BEFEE6335DD645952C2DE5F8DCD2346B13A6F BRÜZACÖR
515,154,064 *3497196AA38A07EC7AD60D01AD5C11B87606F843 BRYAN NOGRA
515,154,065 *34989AE27DCB0FAD8E027588FA9F1D7F270EDBCB bookermershon
515,154,066 *3493E9EC419A43950DADB936A5D59C9300DCA7C9 [email protected]
515,154,067 *34951541AC7A675AF4E88AC5E63FF0D2A963C7E2 BSNB
515,154,068 *349D0E8C569C5047FCC520126F5A563153D4872A BOYDGRANROTH
515,154,069 *3490B312F06018EE7402D3B3E84509C5E225E6E6 bt+x6
515,154,070 *34964741DA4904113BBF7388AD078C8B9BDDB947 b====p~ ~ ~ ;)
515,154,071 *3495E86101E6F652592EEABFF0F4FADE525CAEE9 b)p,4
515,154,072 *3490324D440B5FD5094E6B14D6FCA230FFF0040A BUCK.HINOSTROZA
515,154,073 *349956A1B012371698F2FD16C86D00D15E1E90F2 Bpwo
515,154,074 *349CBFFAEE190DCBDC88234BE2B3C4866623C985 BUSHMAN5
515,154,075 *349EC9A5227553CBB0F400F6656DDE0F4478EB37 victoria-sethard-wright
515,154,076 *349D32A55AB8778501552C9B6B60FD625B49B41F victor.j.roxas
515,154,077 *3497060D48F9D6670644FABF4CE5E10ACAB67246 brandendunsford
515,154,078 *34931EDF4DF94BA0C81E010CE9FE618E562C51EE BV9"D
515,154,079 *349546464EC2030A669C52229399802F6C230364 virgiliocabibbo
515,154,080 *349959E555D80A5D99DCD0240BC30B329013FA5A BRITTANY.SILVA
515,154,081 *349F591977638EBBEF9703E35DD3FF706208D39F brj02
515,154,082 *34936184DE2CC96B33F2AFED4C9B4706A831B66C BTA;P
515,154,083 *349628A00150D93A8E986ED14B57E5F890D5BADD CAIRNGOR4
515,154,084 *349E955F26BA08AFCFBCD92CD31EEA7F04937C03 carlosmeneley
515,154,085 *3499CF2F3902A09841E2CEB7B7151A154D36287B [email protected]
515,154,086 *349141A2842B951D2AE6D818FC48C00A328DA1F7 CARMELO.KILLEN
515,154,087 *349ECF090FF9D6361D968533D10B82D5325D7142 bvki
515,154,088 *349B7D42FF03DF48C9923722A1AC84EE9CFAB0D5 WARLITOHINALOC
515,154,089 *3490EFA29E89CF56E8BB1B69EAB4C6EDB8E86F41 BwOq
515,154,090 *349F77A55A34E4728714AF410554D31D517B99B9 [email protected]
515,154,091 *3494E6B216BD1591D790583406F168430648C65F BXUh
515,154,092 *34990459B404A6925F952C3806450A52DAB2EE7A CATHERINAF
515,154,093 *349277323F29A3A2A602C1189D70397B4FF4872A BYRON BAIN
515,154,094 *349943DFD0901CE93809327A429B906A8B8FA742 BYUO
515,154,095 *349ECB9E718045D33DE4AA133CD509170DA38430 cd#en
515,154,096 *349DDA4CACEE46285192E69C86ECE6BD94529BE0 C4n3114.4
515,154,097 *349DA57A22E9753AA5B0030C11F8E6676596A8CD C=4TH
515,154,098 *3492251EA70B482EAA1C436DC17D2192221F07D9 WESLEY.COLDWELL
515,154,099 *34943B4A9B0E3019FAD9A9431B9C8382D6EB8110 c&7w?
515,154,100 *349714E3CB2097540A85AB3ACE497BAAC6E07F2A westminster-&-5th
515,154,101 *349FFBF5ECB047E0399FFCCD23F08075D080A019 westonbulls
515,154,102 *349E091912F3D494AB7B6B99C0F30699EFAC3893 cetoniin8
515,154,103 *3498F31C28D591833FB5BFE9662161A0459D4E2F WILLARD.MCKELVIN
515,154,104 *3493F55CDEBC22787556DD1297A422885B9FA7DD cgpg%
515,154,105 *3490A38268074D20006F92BC61D676E299FB7687 CHANDOS ANTHEM NO. 10 "THE LORD IS MY LIGHT": OVERTURE
515,154,106 *349D2C9FEDA68BBD1ED0EE8DAC64339D06575277 chasefurcron
515,154,107 *3498B726FEB7BBECD0E3216B0E20EBCBB1E947AB WILLYTESCH
515,154,108 *349179B6BB8EBEE33D2C3D667388BD32F50ED1D2 WINSTON.TAUBER
515,154,109 *34911B61F6F4BC4E4C4D49A7496E66F7EF4434CA [email protected]
515,154,110 *3490C4C2B3FE66D6AE8ACA6775495EF95D7C197B woodrowmatkins
515,154,111 *34977E7B885A7F6668D5BF9B1A411C9088339AA8 carpone5
515,154,112 *34946CE9A1444C4AE36D461317332CAD57E55362 WRWLFSH2
515,154,113 *349A751DD3FE0E51D4DF51342F3CEE294CA522CE cartermadura
515,154,114 *3499EFBAD33AF302ED24FB1F117C6C6F68BA1192 chickadees4
515,154,115 *349CD1FD2ECED947553535F72788607A32F6B2B7 [email protected]
515,154,116 *34924F31378CBB66672E4A421AB654CFBB58BEEF ch+ki
515,154,117 *349089DE79BBF9FC7F9C83878EA0E538CE4303B4 CHLOPOOG
515,154,118 *3496B7B7E11D11DB55F04F7C27A540127A2DBF17 chocolate-symphony
515,154,119 *3495CDAB1FAE691CD950CD44A6B3C2E8AED313D1 [email protected]#$%^&*
515,154,120 *34966591FC0B87452D66CC6AE816ACB26B33CE03 CA?UW
515,154,121 *34906B6AD27192F1D86564D7DB7861158B439F91 cburd
515,154,122 *349A1E0504061DC284467BF07A79E743E22E365F c%djr
515,154,123 *3499A702330765EDD26C76A2B70BDCDEBFC25695 X-|O-
515,154,124 *349400214A2B5B3B842B326EF78D0B930D04BB1A )x(o~ 0~ (##p
515,154,125 *349EA16CE402D1B41882FED934C733D999D45A5E CERVICALHAS
515,154,126 *3493214519C4688377D46747D23045CE0C922713 yadvancement
515,154,127 *34977E1A58D76CA08384AFABBB3FCF284A8AD29E CF7Z
515,154,128 *3499AD73CBD6363B1A93B5C0419F4A50FC115F0D clayknoke
515,154,129 *349D6FD4AFA14A075041019CD935C06F975E9197 cg/t-
515,154,130 *3497DCE83CBB508D28ED2533BB3F7896F2BED4CA [email protected]
515,154,131 *349FA0EC502607C3F4C4563753AB428951DC311D YAOYIENE.SOPHA
515,154,132 *3499DE4736A61D49519F88E5765B3968FEF9310E chandlervillecassil
515,154,133 *349DCB50EC4E58B2B90E13C6D87D2FDB56E67849 YEN-TINK
515,154,134 *349CD104633C84D935B0ED19B61BD3D75872851F yeshun-wood
515,154,135 *349B775C4643ADCC09B467903318C551984C31EC CLTHMA
515,154,136 *3497E8A447F9E5D87828728676F877A7042EA95C cm.e$
515,154,137 *34934DD69F4087E477DCA6033A368C3A6D587AEA colbyhollamon
515,154,138 *3499F2290067159A965ED4B98EB034CB3483D617 conceyl
515,154,139 *3497C8AD1321D8CAFDB11DDC7D7C63887E1814E3 chicagofireboat
515,154,140 *34996ACAAA9ABAC8AA09A8A081762887C35EA15E COOTH?
515,154,141 *349A0C726EB1DB9D518D6833CB1BAA55C022923C couscouses!
515,154,142 *349FB669BCA82F2936E9905AF811F95265871F6C COwU
515,154,143 *349445ECF598727E0989B56F7CD547DFAB6BDBFA zaitideraman
515,154,144 *34948424AF57E6E6BA3AA1F2354D759137A328F4 C$IJM
515,154,145 *349317FF2870B1E5EF8574E845432215596D2A4F ZANETEST
515,154,146 *3493B924641E2C1BDE80064CE15BFFE674A86A81 cinemabili
515,154,147 *3491D22D651E2C58DB44BD229632531235DCED07 ciu(n
515,154,148 *34918883C9BBEB902B408EE7211E076ED0E968EA c,qg?
515,154,149 *34972C8E2E34A75767D26C684E1AAF275C52E3C6 zesty-duh
515,154,150 *349EE5F2659B5B07D791FFB261E632172786208C ZETAMORGAN6
515,154,151 *34917178F1E410EA9A4C75FBAC8FE765ABC27027 CRASH2MUCH
515,154,152 *3498509CFA390FD306BB18CF916753A2F75B4900 [email protected]
515,154,153 *3495B3E76FC0F9A0778CB206928EA960089D7826 CRCMPSTNS
515,154,154 *3497BAC1A283A8E02C3061095AF5315D349B891D [email protected]
515,154,155 *349497FECA1D862569FA2889455A1C6363678CE1 c&lcw
515,154,156 *3495A59EC128F8D451CA1125DED6B0A9786B5D46 ZHOTAKI
515,154,157 *349CD8E2EB191D2F447EE04A0E5C697C73659A33 cliffordknobbe
515,154,158 *3491BF74F94683FD3E881F94DF28459E197D53EC [email protected]
515,154,159 *34964B753EBD285FAC378AF5AB99E4D3460161E1 CLW._
515,154,160 *349430512E069319A7F63B7E35B24953A3E03C5F CMLa
515,154,161 *3490BDBCC9A9244A57FAB51A889404AA2BEE3D09 CTNAU
515,154,162 *349A4D1529D92806B0AEAAD2A80F41B93A4E8516 [email protected]
515,154,163 *349C5D803415C90265F60B22710324942624136E cnsrvtzed
515,154,164 *34921097A3C3AA34FE806AE11BB493821B97B731 АРХЕОПАРКЕ
515,154,165 *349897F7B34DDE5F32C8548A90B599C7F7C9C728 COLIN ZHANG
515,154,166 *34998245C158B4AB0650FD4E987B6BB252DA8CC8 cw8r
515,154,167 *34945971CA9C5F94890672627052DFBA9B9162A4 зневажливість
515,154,168 *34961C7D16972B491D0E66C9A3832C0ACD27177F COMMODORE160
515,154,169 *3498577390DD4A5FB71C971EFF561DADCA7A3B00 CZ&GE
515,154,170 *3499C267C0B1D29F10D7347C23B506C892A3D68F d-2xu
515,154,171 *3491C3CAF6D51A63810D762387FCBE77C4174133 D3OLP
515,154,172 *349D27E688E557BA5D11DDFE53B92577496A1E2B ТИРТХАНАТХА
515,154,173 *349910EA031F9B3DA6E8788F17C426D5F6E85A9E d5#$w
515,154,174 *349E6B2C0820FE0339D0B7A5CFBE475AE023AB17 D"6NA
515,154,175 *349A5FB4FC1EFCE8F1D910EF98130E8A7547E9CF C:P`
515,154,176 *349CB428BF376856347EBCA8220B2466DF6FC7C9 DANANDERSSONSJUNGERDANANDERSSON
515,154,177 *34963C85EA9689165A8FADB066A9B9A078E53C8B dan_brutaru
515,154,178 *34989D0D630834A54CA434C91E74F58072BA5132 danedeshpande
515,154,179 *3495576215FFBF0EB3CF16C90580A86C2C3979D8 danging
515,154,180 *349EBFDD00B7586AE2E4DF17A11EEEE90D59E2E1 crfb
515,154,181 *349C22A9FB67CFF39898A63A958081A4AAEB9F8C CRISTINASTARK
515,154,182 *349033B71367D760BC6BFF4CF5E03B77EC447F88 csae3
515,154,183 *349559685C8203145DD1454DB3BAB810E306BD94 da-ug
515,154,184 *349AF169FE1ECF173CED322824E247D51ACFCD37 [email protected]
515,154,185 *3490E2D1725198E15D7C576ACCC858FB46A131A5 CURTGOVAN
515,154,186 *349A0322C920DD39AED7F0AE379F05FE11164444 dd3;q
515,154,187 *349F684372215B245E240AB4A684A397707F9E79 czoli
515,154,188 *3496F35A10F5BB0CD7EF9A1B2E6521BB07036F30 den73
515,154,189 *349E8DEF0E6C79173384EF7A5B489BAD4B1EBBEB d)48q
515,154,190 *3496B05515DE49DCDE1813B2E33A6424C86B09D8 DESMONDHARRE
515,154,191 *349EDA2CA17024A65D4CEDF710CF6954CE770090 DestroyingCities
515,154,192 *349C4B49D48ECB5A0F60D8EACD3BBF594EBE6F06 [email protected]
515,154,193 *34919769736756373A041A966AAA113CEAB68D8F DEVON-JUDE
515,154,194 *349C4C0BA95AD38DCA0E4E5DA931B6CF82A4A04A DALLASTALKSOUTH
515,154,195 *34969DA5311371E93902CC1221F77D47CADB444D DANGER4SURE
515,154,196 *3493DBA64CE1A9F20DECDA8747069AAD4CFD07FA DgbK
515,154,197 *349961DB873A2CA805EC12EB31E0E771948A5B5E d>hl
515,154,198 *34915CCBCE305B8C3B2403F4FEFE0CDF3379BCEE dhsx!
515,154,199 *3499D2916F26C166017564BBE8659DB1F0AD939A davefrith
515,154,200 *3492CCBE0DE12D679DF94389375A57E44A8A11C1 davidredfearn
515,154,201 *349633183DB52162F19C213CBB039FA5400DE6AC D,bi
515,154,202 *34999EDACD1A9B0FCEAC9944434214543CC13976 0416jn
515,154,203 *349FE33937EA844C536E3F7B95A47EC827FF5A62 [email protected]
515,154,204 *3491F46B59EDD7CF103298D06C16393EB6B63613 DJ/WI
515,154,205 *3496A75E13E3617E148BB02669ED815FD6E1A0D3 DEFAULTE6
515,154,206 *349C354534962D66E7DD32767CBC3EEADB747D1B d;le
515,154,207 *3499DDC59E8F92FF2F88026BC4D18D3B9251736C DEON.MININGER
515,154,208 *34989AA5979A5F5E2DFA6922C08E7DA2DFA86634 DERCONGAL
515,154,209 *3492C2DC844FE1FDE58A9DD926C7C28BA5B789B4 DODGERSBOND007
515,154,210 *3498C2BF35970EF4B7AB71D8C9E2B5EFBA601DCB DOIROLHC1
515,154,211 *34979A38AED898CFAD7D800525A0B6A3377CE252 DEXTER.IMME
515,154,212 *3493147BC730E304462396B3F4440302EFA6F269 DOMINICKRENOLLET
515,154,213 *34917D8F124F80D90D01FC4740C8D320F7349B92 DF=HO
515,154,214 *349C18221920FB55E280B679704AB169FB833FF2 14.FIKRASI
515,154,215 *3491456E0E05BC47BEB69DBA53329939BF0BB06A dgidluvgged
515,154,216 *34974D92509539DEFC160F95CF8336FE38A0810B DOODLED
515,154,217 *349913931CEC64C873FC0507AFFC814F2C35F1CC douchecel6
515,154,218 *349BCDF00A3E1FE631A42475ACE0A52FCB2F6860 douglas-peers
515,154,219 *349B82489E36AAD0D57949B4F3813838121A5A3D DOUP
515,154,220 *349768290B97B106D800722A8EE79B59D7396C20 dira5
515,154,221 *349D4BD718B574A160D019FCD09BF4D75F1DDD1C DISSOLUAM
515,154,222 *3490C1415466FB115898FED8700DB9926839F5FD 1901950 BEI-ANDERSEN-HAT-ALLES-EINE-SEXUELLE-GRUNDIERUNG-.
515,154,223 *34920C1EA24D83B9CB2982E13436E84C535D0847 193446 he would never walk again
515,154,224 *349B019ADC77725169E7C9F27036BD0F8639E263 DPIGG
515,154,225 *349359D3EA6711AC848868BF69566B36F5E41218 1 bernhardschwankegedaechtnispokal
515,154,226 *3496DA239964EA9F13A1CFB8564E76CD7A86ABFD 1.BINNOCHUNENTSCHLOSSEN
515,154,227 *349ED5AD28BBB16EB395DD4E044E4B19DDF220D5 1C=
515,154,228 *3491D60F38375EB71556786F169BC22EBA484687 Ds)O
515,154,229 *3499CDC2C8C39015950448F8D4E0792D8C2DFE61 Do4+
515,154,230 *34941971753E18D767B221C9B06AC9D604B5F878 DUC)
515,154,231 *3491FB5B31826B296B9CED0C921800178C08E727 DUMMYTRACK
515,154,232 *349CAA98EF4F9D16FBE38621C1251237B13F2949 donnellpeppers
515,154,233 *3494743679554968A4813CE006B6F7DE039C51D1 1-keskustelupaneeli
515,154,234 *349D54DCB3AB065283087E31D5849F1EEA6ABB17 1-kinderdomizile
515,154,235 *349332A7C9C0A6C2A1C71E52B5692D847DE8E9FA DVP#T
515,154,236 *349EEAD010BE9C87D92A3F69A27B56A6413413D9 dwaynegassaway
515,154,237 *349F873FDFEC1DB0C8EE57C1059EE117941F10AD DOUP
515,154,238 *3498E2665949592601486CADED74C28A52EACCEA DO YOU DARE (NRG MIX)
515,154,239 *3496CF213F7A760EE9E8AA290E97C356ECFD5501 d:xs6
515,154,240 *3494292261DD7314D67D5A948548B773D408DCB8 DQIRO
515,154,241 *3498705BDF43DBE10E51876983F536952BE7901C EA8+Q
515,154,242 *3492550451A5CF2CB6BD234C8DBD96F4DDE4BF7B EDDIE1979
515,154,243 *34920E05D2E0E5E974706A8987EFB11995DEFDE5 dsmv.
515,154,244 *34937EEBF7A13E7B1CCB9E7501F126FB1AB600B5 edisonglenn
515,154,245 *349353AA4B8FC244468028B74587886FDBB94E30 DTAJ)
515,154,246 *3499B401F5BDC9F3FF8DF46C05D8D53AF9D80C51 [email protected]
515,154,247 *3494BAE54B81A71FF6A193A0AADBAEDFCA348BF9 1 TRINKWASSER-RESERVEN
515,154,248 *3498EAF3856AF4596B23D04B6AE987B4D2F78C0A 1-VERHALTENSDISPOSITIONEN
515,154,249 *349CC4077465FE3087B49D75FA72282897356373 1 VIISIKYMMENKERTAISEKSI
515,154,250 *349022FD08135491F473F85E6DF1C09AE2FB4344 1-VIRKAMIESM
515,154,251 *34960E39C61E35F3109A60EF05A98E93CFEF3BC8 [email protected]
515,154,252 *3492B850629E6D65125C6A6E06AD1A9D0145062F 1.yUklUGe
515,154,253 *349973BDAF87106DEA46101BFBA89E5BACED339D DUNCAN.DONN
515,154,254 *34905CD7408B3B556C868E3E0E5D75D7FF4A078E DUOTC
515,154,255 *3496FF36D41F726A33E29CE3F2CF2F938AB12F4C EH,VS
515,154,256 *34924AA30B5567AD8232F4240D8404A4AC87F8A3 dxpt4
515,154,257 *3496815B2F8E0DEC28B7EBE3599A11FD34515B80 [email protected]
515,154,258 *34963A955EB0D934A4786A61EDE461689A24711A dzn)y
515,154,259 *34998DCA8C428990D0C662BE19F21FDBC227731C DZOKESEH
515,154,260 *349C4E26F5ED934A58DCF00CB50CC0ED4639F51E ELLEDUALCM
515,154,261 *34991E23D79BA23DFEB5CF28DE76F96E823C863C d相当
515,154,262 *349B4FC5F9D63EF8069A4C394CE6ABF66BADDA89 2423805 TEKNISET TIEDOT KYLL
515,154,263 *349F7E025F81AD8C39DE2FD8A8BDAB25EA9A95D7 EANDN
515,154,264 *3492DC397E42F97F1F6DF3A981F02EE1787C169B ELVEROY5
515,154,265 *3491B84C2EEB529ACE36813BD9F50BF143718511 e(m|
515,154,266 *3495EB7BD47E2DE0304F77ADDF937842BFF60DF1 EARTHMOTHERS
515,154,267 *349A37E79275F1712D656E419889141E99224A8C eclenche9
515,154,268 *349CB7E28E61D88D2F3710A09DAF979A9D8E32C6 ecumenicallyA:
515,154,269 *349254A6FFA33091237D3461BDA8E7122EF96DBC 293503 " MANTIK PAPUCU YARIM CIK DISARIYA OYNAYALIM ! "
515,154,270 *3490CC818BABFB2FC0C3829128050B6F4E49AA0B enhancepatientfinancecomwww
515,154,271 *34972A368F83057A5872415F1141C7DDBE256936 enimpien2
515,154,272 *349378047A070B2121BDD48B7EC058C22ED3B41D 2 EURO-AIRPORT
515,154,273 *349E1C5A2B1FC5507FBE551058E6668C1D55D500 2HCIVOKCU
515,154,274 *34938F55952FE7E4B6F363D85BF10060E90F4C08 2HOBSHOBS
515,154,275 *349C948AD1D1ED0781B245201A7DBB046EA52B6E 2HYPRZTM
515,154,276 *34956AC8EC1CCC156B71AAD3B08458FE74A99AEC EDUARDO.VEAR
515,154,277 *3494A9C10356A221737805D41E3E552D087505D5 epilencia2
515,154,278 *349FC78841E35882764BD520C64CD9B81B743DB9 EPJTC
515,154,279 *34993D0AED305CFDAD035912284E8276714C72CC 2.piatetski-shapiro
515,154,280 *349836656C54776AFA77539AE58089CDC715682D ERH4
515,154,281 *3493AE0A40A4D70B531DE21942528DD2096DDEF3 eriksatieforaltoguitar
515,154,282 *34973A6D7140F2EC77E8A5D09644BDEE453814B7 ERROL.POSTAL
515,154,283 *349264B39024C39B9381FC438F7F290D46B59DB6 ER_V
515,154,284 *34963FFC0652273EB23317A1F5FFFB406526E913 ESTEBAN.OSBORNE
515,154,285 *349FDDCCE1262026DA9B569D1FAB49D75D615D64 eswa
515,154,286 *349F31E15D1855C7820B07BDCC343FF83171F33B [email protected]
515,154,287 *349099D5CEA0E9A932E6F3170788F6A6E372BBDA ekeqp
515,154,288 *349A5A9265D7E234617ADA5A0698CD7005B193FD eugeniowarran
515,154,289 *34944C5A282C0620374F66158AF8BDCAD9D78571 evancokley
515,154,290 *3492043567E6CF217A584F15186BE75923823509 [email protected]
515,154,291 *349EF808F86D96DA92651C6394CC5B234BA71825 EWNEDNAHS
515,154,292 *349A395EA2CBDC8531B535F095431989A014A2F4 excluyas
515,154,293 *349B8FB6BA43FF491E34507DEA140D96FDDE0011 3B~O(>_<)
515,154,294 *3491EA422803D7933A64F774F8FAE678C1B9DB2A 3HEALTHP
515,154,295 *349DFBE47B2C5A33B4A1788710D4508725B8EE61 3ilovehealth1
515,154,296 *3499B307780799D4DA9D4128806949CB8F736488 3talesai
515,154,297 *3494F05934A0EEDC8652F99FB25D7EAB45C4CA0F FADIEDREES
515,154,298 *3490EED20071DC2B4579F24E2C4E8181A9FBDE28 FAIHA
515,154,299 *349D93FAEE26962ABE4A473971B277B8B6B64EF8 [email protected]
515,154,300 *349756A192D69EF74806A6C8A3F8288F0E9FEBF1 emerypelote
515,154,301 *349CC9A63EF52A65A06379FD48EF009382702A4A EMIL.EARNHARDT
515,154,302 *349EF594183AD97CB9296C4F5C81F605CDD4685E FARHIGHER
515,154,303 *34941D40EA07E94CB16804F0CF35CDBF141120E4 4ASENAPH
515,154,304 *34995656ACA85C37C2F17A1AD5316C6EB4ADEB1A FAVORITISM 'F/EI/V/@/R/I/,T/I/Z/@/M
515,154,305 *349E77AE1A92DF9127F5A0954616115FD7FCF6DB 4B3BIR4PID
515,154,306 *3493A0F4C099FA5E3D2BD7308C8DA5F663BCE91D FCBRBB
515,154,307 *349D4150AEA65F879E64C9C8A0462275019CF164 EMS812
515,154,308 *3494047A5E5E5FF0983A0CEF1E6ABB01359402A8 EN60229170251
515,154,309 *3497079F03C11280158C28A5F9EEE8D8C6C4E4C2 „FECHO
515,154,310 *349FBF91BF7B6BEBE15E24C7FBA8F15DA1B62421 feil
515,154,311 *349F228542DCDD3F3A54D82BA529DEF524678F9B Fellow-mo
515,154,312 *3493F49ED9980F4FD953632485B85A1B52B10AF0 FELTON.CADARETTE
515,154,313 *3493BEC2BD1818F386CB9CF3809BD4DFEA6B749B ENGELSTALIGE.
515,154,314 *349935341C354F15BF3C4DFF83C5E42DBD336E47 [email protected]
515,154,315 *3491BBC90EC34F9C76D31C234F9CA395A71B097E FESTIVAL INTERNACIONAL DE CINE DE ATENAS
515,154,316 *349C329C149165811570DBE7891B1A51BD067911 enriquedevalle
515,154,317 *349836C0B1B8F34E5AEB485088F215A13DAF05F9 4NATASHAOLIVIER
515,154,318 *349A7A073BA2E550473890D6545A8528BB50C9E3 FILASTROCCA.A.MOTORE
515,154,319 *349B57A20DC1E829773061552CA0C7C1C01873C7 finley347
515,154,320 *34903E7CD40426E05A2507E4922686CE1F99AE4A 4SAEDIBSW
515,154,321 *3493D46F03F95FA4CCEE3B890634C6C95581DBC6 flamewar
515,154,322 *34933E795CF53836938ACE224B16FDBFD1FF28F5 4SUNDANCEWILSON
515,154,323 *34948DC0A1843F39D64DF24BC3F4AD5C986E64D7 FLIPPADS
515,154,324 *34986D25B6D185E47FD942C2CDE897E5D1DD7987 flowerobiwan
515,154,325 *3496C3173926C07773960EC25AFBE69E6DFA0A36 ER{JUURE
515,154,326 *349C8A960E09ED69DEB5380FB62EBC420DD0A5EB 534612 ANDTHETRAINSHAVEBEENHITBYSTRIKES,TOO.
515,154,327 *3495F14B8E28C76B65B52E85AE4972FB10371C11 ERNSTKR
515,154,328 *349B88E40C754A395090DA300E540A316372A210 errolpapazian
515,154,329 *34962FEA65AA94558CF32B9808C30E080E7AF616 5ABHEDYAIH
515,154,330 *3498975FEE7F768FACA9FDDA34839A114E617A9E erstvho6
515,154,331 *349EF350497300438E85ADDB70CBDB1230E2CE0D 5BSWHEROIQUE
515,154,332 *349D4E37B5BFC3E9E64CAFB123C8C17CB428A5F7 5CHRISSYTWEETY
515,154,333 *3491B08223D54700B9D067B0F9435C03FF85EA27 FRANKLINHARKENREADER
515,154,334 *34965DB0CF39623AF45E6F4B6E6DC705F4F80652 5CRICKETWILLIAM
515,154,335 *3498EB501245CAF80B4BBC0118DEC4487F95CB6E freddyschwoyer
515,154,336 *349D96EABBBE36BC2A95DAC32A433A4577A9379B ETTAHCSR
515,154,337 *349394CA32D5A1875668ECEF287D330E356CD716 FUNKDOPIC
515,154,338 *349888B46A8F1F5F3FDD202829E3EEB58228A58A EVERDINESHKANNAMBAD
515,154,339 *349A820C2ED76784E3AD03356C9C493313A248B1 EVERWAGEN
515,154,340 *349CBF00377160761F5C0B9B02D49841AA7B09AB everychapterinthebibleismine
515,154,341 *349655F13E620FF92BB4DEBA5C1291EBBB14F7C2 [email protected]
515,154,342 *3494C76AE3458229B36040514F7AC75B6826F92B F00t-$c0r
515,154,343 *34923340A52FD24CFDB7D0CC7B934754743C0BC0 5WYANDOTTBSW
515,154,344 *34986E3080D53851B9B04B2FF19195908C303226 [email protected]
515,154,345 *34979365D0411484F083CBF35AFA2F538DB0D535 GAYLORD.DACRES
515,154,346 *3491EF2B1227129377EB82F373EDD96F4CE0B140 665851 DIE.BAHN.ZU.HALTEN.,.FAELLT.NICHT.LEICHT..
515,154,347 *3499FA3801FEA8B560AD74429A1806BB9B9602CD 680JEAN
515,154,348 *3497FB82C9C7829A6D6B675B49A2D715D8D96979 686062 my
515,154,349 *349BDD3376F968F941756CD35914E23166C470EA fageole
515,154,350 *349FD68D8ABA139F77B5F8AE001A364198874FF5 GECIKECEĞININANLAŞILMASI
515,154,351 *3497699B258497AF780D7DAD84631487DF150588 6AMBASSADING
515,154,352 *3496E0778025358EA8F69F3E52FB5BA69CD98DF7 6b9fb5506bde36d3a24e46a7199d398d
515,154,353 *349674B01CB129A6AF7627072BA4DEC2330A9640 6BSWDRESBACHBSW
515,154,354 *3499AA57D0F55B0812175099E5B4FB652905CD84 GENEBANNERMAN
515,154,355 *3499282218908E798253180F27F149AC98171E91 FARIDNIA5
515,154,356 *349CB0306BF56ED128DF73481F5DF317E2384823 FB1F51F3-652D-39E0-9460-F1A136DB3B9F
515,154,357 *3491B0CA345D74251C8D5196F8CE7BED64DDC983 GERMAN.BUSKER
515,154,358 *349A7D6B6259DCE02C841793B94CE8A50D4B637B [email protected]
515,154,359 *34955A4E62EF9072F03BE61E33E6648F950E0205 6GILREDRU
515,154,360 *3490CC26B4B7EF5A215FBD6DFF84A2332E6FC0CC 6GNILEETS
515,154,361 *3494A02B78E25484BD32DF2BC496A9929995F776 6.henzold
515,154,362 *3496E77CFCFF839CF8BCA15566472B99161D15C5 feil
515,154,363 *34961BF42D9189D8C1571090F8BAF842930041D0 ghajini
515,154,364 *3499AF2F95AE973C2F7BD9E49DFA33392E1E0993 `FEP'
515,154,365 *3498E124555EDA24D92B2F53EEE89046497BE322 GILPAVLIK
515,154,366 *349640A2EF713091D7641D1F5EA28049C62E938D GINAPPO
515,154,367 *3494EB3437D2716C5467CB955587202E22069452 [email protected]+OUS
515,154,368 *3490882AC182D580D76FF9036BF3161E8A3C9352 [email protected]
515,154,369 *349B220E8B74C46683D185CF40666E6D6FA61A80 FIGGLE2
515,154,370 *34979B177CC1B986458CDDD99790C3C178F1D079 6SUTIMISIENSA
515,154,371 *349189F65158E4DC3A5D11493DAF5AEF82616AA3 6THATQWERTYUI2
515,154,372 *349B0E7A8B6D9800411BE9207D614BEEFBB67CB2 golretawed
515,154,373 *3494DE7BB4D697AEF705C6B96459062527F4E73B 7ATISBADORNESS
515,154,374 *34990D24DC469B92E38743C5C4EAA5C7BF907CBD flocare9
515,154,375 *3493130AC0E95A5CAA76FD3D4E37E1AF19A9DB94 GRAPHITEXED
515,154,376 *349436684B8D7A3BC517EA7DC960D333011C2071 GREATDECISIONS
515,154,377 *349837ED024F8752AA8F3752203D770D45C1B9F0 GR/I/PEDIGREED 'P/E/D/@/
515,154,378 *349170E320AE0DFDFC03AA98BB8DDDB270804BBB FOEMINS9
515,154,379 *34978F480969B28D1946C5050A5844D88168426A 7heiligdagen
515,154,380 *349B7B56574A681C696CAD59A7F5750008BF480A gruntovn5
515,154,381 *34996604B31F2C321EEB7984BEFB3D5F4847B59E 7JWKWLCMC
515,154,382 *349F79A233703044DF4900E3DD046D148633D30E 7KIELTYMYKSEL
515,154,383 *349FBB43124F8FE4BA923900DB26122077C3C75A 7LEBLOS
515,154,384 *34990621463A9BF7C38602BE6687D8E166E03544 FORMYGA
515,154,385 *34997976B5252DC2DE5F46CCBAE437B2A36761B1 gungjcij
515,154,386 *3493D7E35994A3944AAF7455FC4D02FF6D83744C 7QFISHERS
515,154,387 *34986BB29C2795F1F824FEE5D621E838159628B0 7REZINOLOC
515,154,388 *349A9A180CB677741027EBEA1FF2714A4F72FA63 7THATMOPAR0
515,154,389 *349AA5489D59F617095C1B4346FD460A7329B11B 80168 und diese schule dominiert noch immer die moskauer szene
515,154,390 *349FEA71A3E0E47490A1BCB42CC1CA33885462B0 hamsaali
515,154,391 *349978C8E1CCBB8A0D7A8E192B536AB93210DF82 [email protected]
515,154,392 *349F4291AFF894155480E71A03EDFF78B74B0EE2 HANK.MOLLOHAN
515,154,393 *349AED4CB416E171DCD0B5C69E3CEF3B8063DFCB ft|l
515,154,394 *3491FBF298E706357B97A829F6D282DFF7ACB304 harlanbendt
515,154,395 *3494F484F789526122CA7E688C4BF9BC6657AE1B HARLEY.BIEWALD
515,154,396 *34990D9DA4EDD8B08E91BA357FC31CAC5778E070 harold.palmes
515,154,397 *349EC31830B412C97248FB06890E6F910D534FB2 GABRIELREHFIELD
515,154,398 *349A841E717E9BAD2E33654830A3114E2789D7B7 HARSCHNOISE
515,154,399 *349BECA64127BAD24D4C13360E7258A5F8F4B82F hassanrathgeber
515,154,400 *34950C80BB448A7DC2064E666D917D6733DFA9BC HASSARWILDERI
515,154,401 *349F7CF1C00939B061EBE7AFF8358F2C5525D57D GALENWOLLSCHLAGER
515,154,402 *349757EE6790D682E8F3A5A4754E25CF1939E8D9 GALEPERROT
515,154,403 *349F10247188D08BEE427CA8B29D3A7CE9719DE0 hay.que.comer
515,154,404 *349C669C0BDF930742BFB168E45E7F516833AFE2 8FSCHPHVNS
515,154,405 *3490664731177C94E4356A864ED9C402A6CD7482 8IAMMADOKA1
515,154,406 *349B340B69020403CD5540EA749E02011207CAA0 GARTHYOES
515,154,407 *3498F431EC36D7B961ACC8468CA79775224042C2 GARY.DUBOVSKY
515,154,408 *349A02E4DC6C536154E025C8449EDF0E8F0FB531 GARY.GANNAWAY
515,154,409 *3496D83AFEFE8A09D80AC2E50E2649EAE1B47DDF garymacione
515,154,410 *349B06473E24D086BC1F948698FF0191C9B8B2A6 GASTRADON
515,154,411 *349AF4182CA86A68770E032D8F9563570D814A85 herfstspinner
515,154,412 *349BA0D53D087FE079A5B914F7890B32D014B1EA HERSCHEL.BRUMBACK
515,154,413 *349B2E60A42548F3699BF915D914165C71186969 HERSCHELHUMBEL
515,154,414 *349EDEF88D7E2CEC0BED0ADDD4610EFF3EFB0658 8#P ~O SPLOIT
515,154,415 *349F6B1143FC2269F9FE2991E2C0E98FB8041B43 [email protected]
515,154,416 *3493431E8B9FE0432377EF12B5A6FDE09341CB42 GENARO.CUIZON
515,154,417 *349FDD0729974B907D6FDD73724FF4182408F399 8REAPOLOGIES
515,154,418 *34980A533D22131FD170D4A975552038A2B7BB10 geoff-orton
515,154,419 *349D423337BC5CACADC457FEE52FD1290B16A9AB 8SHOOTERPPP
515,154,420 *349A3CEF9D36B490D1ADD4DBB778840F2486B5C2 hill-forts-somerset-clatworthy-camp-hillfort
515,154,421 *349C168C0D7C66E7D5619CFC6408846580AA3746 GERALDO.JACKLIN
515,154,422 *3495F6CE13270D1EBE99C6C7373551B75FB5A208 geregelten1
515,154,423 *349B30347400DBC9351DDC7660F18D2AB5F62695 8WALDENBURGBSW
515,154,424 *349A768A3ECE80058217A7F9699D8ED8F28B08A0 8--when-you-have-finished-copying-files-to-the-emergency
515,154,425 *3496BA569C68A8DCC4E3114677C08C5C96EACC75 991588 sellaisille.ei.my
515,154,426 *3495B76BA91A535C18E9776B85B6BA8FB78275E7 homotaxial1
515,154,427 *349FCAE27D6CA492A3D774EA384F8ED31B404BF4 HOOFKOK8
515,154,428 *349AD14C03E2FC9A60204EF8DA403534F3E4C12A Hooray.for.Spinach:.The.Music.of.Harry.Warren
515,154,429 *3499EB56612670E677A030327956FEE312CA8500 9BSWWOLLASBSW
515,154,430 *349220AE019E9D951C18BE91B5FC64E659D7E058 9CATALOGASSHOLE
515,154,431 *34969749A3C3072BB52AAE0A5C3CF7663708D42A GINTARE6094
515,154,432 *34924E4F6263373CE37E6D86B44E641AA852B2F3 GIOVANNI.BURE
515,154,433 *349A8E3B354FCB89512D04C49DFA50F32105D7DA 9CNTLRBSW
515,154,434 *349B1CD902E4F076D45ACA6FBF90ECFDB2041495 HORNSWOGGLEM
515,154,435 *3491A3DF7743FF1D016D2A8DA2963321F6FCE3EC GLÓREDHELĘ
515,154,436 *349710D440F0C79A8219489C9813E09DA2000501 9HOOTIEWIZARD
515,154,437 *3496EAE1D45B0C888BEA983C8D4083C6FF34A642 9LONDART
515,154,438 *349B9D9FA8F58970837EAF401BEB501E2BC764CE go.fishing
515,154,439 *349CFD8D9A842D97C99C432EBE74F9A25F3D298B 9PRZYPUDROWUJE
515,154,440 *34996AEC85F52A78246F9C56124A2382234A0548 gorilla-(feat-lox)
515,154,441 *349791B7CED1C67965056456B4706ED3DF1011AD GOTTILOV3
515,154,442 *3493A4470CA2FD4D7C2DF1959F031BCDA4871707 HYEUJKLMS
515,154,443 *349F062E4D1D6ED3CBFDB23A7290D91690305AAF 9WAYNELOUIS
515,154,444 *349E389F6F2CDE82A22A2D9DD9909AADE2A460F7 GRANVILLE.HUBKA
515,154,445 *3492DA9DE74218CBCECAF28D6EE7F2FBD82DAB72 A"0GA
515,154,446 *3497C521DAA5EB838FEF017093894A8731787894 idon'twanttomissonyourlove
515,154,447 *34969878A4BC0C3275FA291E25E6DA3AF5D94465 a7vjd
515,154,448 *34949DA11BDFB90C41E4C26535B4B433F95211A5 AA2PE
515,154,449 *349F154C5D51F44EDCA21ACE221FC826ECBA6066 h34dp3c3s
515,154,450 *349091C73833979E9AC4F2065861224067026FCA INCORONANOED
515,154,451 *349238C73681743A7F7351F37CC11BBE33656412 [email protected]
515,154,452 *349FA0661702FF5E1E3D64FFF92B898662455613 happiness,child
515,154,453 *3495E6D0D8A0A5D4C22527557F9A66FA78F9D9BD aa-ng
515,154,454 *3494A5BD23A3B41DEA3228B64B6DF74007049A52 in.plain.song
515,154,455 *3490F67EC06B3104293A4A7DD44682C1FF0386B7 INTORNO1
515,154,456 *349E33290C80EA7BFBDA2C12C5C005A60D7DA309 ABDELRAHMAN.MAMDOUH
515,154,457 *34950C66AE8B5B428344C9855332481611910A9D AB=>H
515,154,458 *349418DADDA80AB64A409A7B51AABFA5176DAFF5 HAWKRED6
515,154,459 *349FFFBDE4E58D890A38D96799BAA96D7F97AE19 AB^QZ
515,154,460 *349E4F18E106AD56206DB10AECB1876BDA678DCD introduction-/-the-seventh-aeon
515,154,461 *3494520A2829BF53E63DEEF781AF2E7CB3248876 abshussein
515,154,462 *3491F58835D63A7C9D5478B3527C85BA85CBDF65 IPURITANI,ACTII:AH...DOLOR!AHTERROR!
515,154,463 *349D17269C2307923AABD38A6939DDAD6498A0ED hectorkitten
515,154,464 *3490BF7D5897E1079A6D4B657B4E1CD21D4F33FC HERSHEL.HOCKLEY
515,154,465 *34903526BB9D5F2A130685729D6B0663571FB18D HEYLOUISA
515,154,466 *3499A9D93FD665D0DD00B1E2361C8EC528AB8BB9 JACQUESCUNNINGHAM
515,154,467 *349874A3268E834A3915B8F32D8AFE2FE105A174 HNIVAN
515,154,468 *34953A33E82F5EFA8C215AE9996D1117B454E25E holliesexton
515,154,469 *34912429BDE62641E3E0B4A14653A6C1CDAA6148 JAMIEBLASZCZYK
515,154,470 *349CC22EDE273E821C7F61431EC2CF56C6D42C5B AELERTEN8
515,154,471 *349F66A81246E8BAFE6994B1EFB3DAC9ACD8B860 janeyounger
515,154,472 *349CB3ABA7544D2B2035FAAE4CAA9CC33D8F78BB HORACE.GEE
515,154,473 *3495DBA81CD7ADD7E5B06631845C172B682BEEAE AEU
515,154,474 *34926050812890BDD6C0763376BA9325BFDFF1F6 horaciogarth
515,154,475 *349AD2EF08032DDE1E82453D5F0EEF51054FE9A8 JARRETTPOKSWINSKI
515,154,476 *3496B47881E460EAAFDCD027C49A8822A38FAC40 AF&+
515,154,477 *349FC04172089BF4F0B009B8723DF06B114CC821 HORSEBE3
515,154,478 *34976D7382A4415FA9FDA76611046D7A5E439C6B hoshizoratoheishi
515,154,479 *349595BC6C066302B8686E3F92A625065B7B1D76 HOUSTONSCOULLER
515,154,480 *349A8734BAA8C66DD019C8576BED28693DBEA89C [email protected]
515,154,481 *34964CD5BB4BEE777AE9B271E55F7FE0B9A25CE4 jaysonpatalinghug
515,154,482 *3494528054674ABF7FC71DDD9E6B981B49D7C21C HRERUNTERK
515,154,483 *349C5EE35D574B77CAE85FE0D3B269804A035DDF htimsnek4
515,154,484 *349DD1D1108D697EA047E7AF483A686EFA4D153B JCTORBIT
515,154,485 *349B2CFD56A4F624C2F9706C6E80B8035F5A4809 [email protected]
515,154,486 *34903C17A32AD44EFB59F32D42EF6BEBCF46B0A9 AGUINADA9
515,154,487 *349F12F229514A65252A09BD29721CBBC3B9BDBF JEFFEREY.DELCUETO
515,154,488 *349F20ABD1D9CFCD39D5DC2ED0F88167ECA4B20F JEFFERY.ROGOWSKI
515,154,489 *349FF6B1AE44DB0EB0FD6150A4BE3637639C4661 a"h$=
515,154,490 *349ECFA37C619038FC39AA108B22F73554BD15DF JEFFERYWINDLAND
515,154,491 *34991AA1F62BF93186EA239061E3A3869750D84E JEH!
515,154,492 *3499348FCAA67615968CD7C73C5D2B0F247BFD61 AHAEMOTOPUS
515,154,493 *349E49B5891A60C1AA7793CDF533400D48C12927 jennifermckinzie
515,154,494 *34933D665743567A70CFF5B7B8A5EE706D492B20 „HYPERREALISMUS“
515,154,495 *349BC6E25E3CB9A3E3DF1C7D3FA75CE250E4173C IAMPAINTER2000
515,154,496 *349EA667098C196351E86C036B242F1FFB8D85FF AIO&I
515,154,497 *34982FC9CB9F3DEDB2F4B2078946FA0FAACCB9DD A.J.-PERO
515,154,498 *3491258F501959AABDB046E84E8F47D69817E2A1 IGNACIOAULBACH
515,154,499 *34930C4115BD7241B4655663DFCAC8865894AB2E [email protected]
515,154,500 *349097F6D338D7383C6406C8DACC76422D9F3DF3 IIOU
515,154,501 *34911E704344CF745E59DA0AFFD360C64015FC0B Jochanaan.Ich.bin.verliebt.in.deinen.Leib
515,154,502 *34907847CADA30DAFBFBA679142D094B7305D385 ALBANIANNS
515,154,503 *349E77005A22566A68F8BB8741FDF297D3DC2A6C IKEGUOK
515,154,504 *34970B10DF812DB8A42A20832E70B607EC69D5A2 JOESPH.BENNETT
515,154,505 *34932CC73541F52FCAE561D87818268A68462996 ILCIELO(LIVE)(FEAT.LUCIANOPAVAROTTI)
515,154,506 *349CC9A47FEB4934C2E739B85DC42D563B189D51 ALECSPV5
515,154,507 *3493A14BB82CE8DB83B3E1A6ED8F145C0971CBB2 illinoiscountiesmap
515,154,508 *349EEEC55C0C3E44C7EC6C4B3E97EC08012E32F8 ILOVECOCK030189
515,154,509 *349F179F24C94C9CDBE46F38B302F9B805032939 ilovenapoleon61
515,154,510 *349291AA8564FF858429BF7C383E896DD4CC48D7 ALONSO.CARTRIGHT
515,154,511 *349E3781AB7BBFC3EAF333803DC6E99ADF2DD84D juan499
515,154,512 *3495D138DB73A07CD7B35BDEC78CC63442E415FE 'JUGGLE'
515,154,513 *3491D65D7D25682BD6CB1141BA71E4C0FD5CB627 ALVA.GULIKERS
515,154,514 *3494E212FD72BA6F483D3CB1EFA7345F80FAA5F9 A/(LW
515,154,515 *349169E9F3308AEF7EDF3595FD09AB3585398175 JUNIORKLINGELHOEFER
515,154,516 *3499F08BB983F85B0383D9F26E586F511950CB17 in-times-like-these
515,154,517 *3493E732EE33775248F2BBD7A16C8C9DAB66D101 irvingkindregan
515,154,518 *349C167E5D08AB71A7DED58A0BCF1100FA99C6D6 IRVING.WORKOWSKI
515,154,519 *349B071CC373DC9428E74F3D8AA98AB4F34B2CC5 amnx.
515,154,520 *3494884723010CDD15F13713A82A8DA5B91C3209 KACERUM0
515,154,521 *349D2844F24B466D6D72CB6544BF49EC62E117A9 KAFFIYEHKAFFIYEH
515,154,522 *349C015B8987DE29A09E73A5F57C674CB8ECD0EE amy-amend
515,154,523 *349C235F8E674E1EB4A3C00A1FC4C3067CE40B0F amy-galuska
515,154,524 *34995ED7A7F36F8324675A4DB118B986C18D4F4E amy-luttmer
515,154,525 *3495E12AA71884BE552C8925BA895D03676E17E6 kandylhs9
515,154,526 *349C593468F995A83993EAD9662D8F4A7B0FD87E ISRAEL-PORTILLO
515,154,527 *349854BF95F4F7C6E3C5B5094917EF4598D309FC ANDIYANUAR
515,154,528 *349D5ED1679117ED767CDBC4E4D04DAE1AAA6410 jacqui.young
515,154,529 *3493DA3ECE25194A11B9F5D3423E7DCF0D155CA8 KEITH.FEICKERT
515,154,530 *3493679594261EB3B50E56AA62FC36CCF900832B ANISOCYTOSE
515,154,531 *3491E932539840349A6318F33DFFF49ECBAE0FCB anli?
515,154,532 *349E6349E8A33BB37F3CE46BF266014859771AF7 kennethregester
515,154,533 *349A1CC5A58E9E773B3F8BA225F913D2FC34A445 janibb
515,154,534 *3490198A4A32A142E49BDEEBD50B8DF4B26CFBC2 KERRY.SEANGER
515,154,535 *349DC28585B3FE1408FC07BD654DF01CC2C16B63 KETTLEOMUSCLES
515,154,536 *349FFD3C979E66BD1DE49C5C6BA139F522B15747 JARVISELKO
515,154,537 *349E1AC56E7316441D768496771773E62EED1951 a/nw&
515,154,538 *34984F27AA32CE06660DB080B88FBCF805EA1464 JAVIERFEILDS
515,154,539 *3490B6E4F1C8D97C1BC0379FCFB023790E3EC17C [email protected]
515,154,540 *3499F15018F329FE13167EC6914E13035F7C2364 AOvn
515,154,541 *34934574BA3BFAD4DD367CBF043FAD987AA4EE0B apkd4
515,154,542 *3491B8104F253F0F4DA35B33C46402916020DBC9 JEFF-ABLES
515,154,543 *349A6D53FC7589DD6E51320FB70CF5547E5D61AF A"QNI
515,154,544 *34936CF858F30CE59926DCC06B3E7DF02E1BE2B0 KOLTŠIN
515,154,545 *3491599748A044C58859EA0198C8D83EE76930A0 [email protected]
515,154,546 *349D6D193DBD69B5C8F4BBF6311E94FA18E6DC81 KRISKEIR
515,154,547 *3492D199134CA0D4E46EB328F41EDF1482C3F50E arrested24
515,154,548 *3494C37CEA34AFA66941DF0CE469ACEBD1AF27A8 JGAW400DLL
515,154,549 *3497F922A27C6A84F609535E45E0A40BA7015DB4 KUIFBALLING
515,154,550 *3496E35CD7E3A20586C0D5B976EA28E146D8C8A5 aruhm
515,154,551 *34943F34E79D50C84E7061D52E606018E88FB2B7 JIMBOBAMANDA
515,154,552 *3491C70952922B52C5658C2502905BA46AEDA6D7 KYPCHAK6
515,154,553 *3493DF1E7AF8071BE6FD045188C9BB5079A4670E LAMARPIGNATELLI
515,154,554 *349A23FECDF128B1FF3CA866E132721B77B399AA JOANFROESE
515,154,555 *3491526B3FE91DA64AF992E989ADA778EAB946B3 landstrom2
515,154,556 *349920949E06DD7338E9459F2569E4521594EB37 johnny-grigsby
515,154,557 *3494BD285FBB3D94C71EE06902A1111E2E9A8B90 ATLPLAYA
515,154,558 *3494150D602EC3E0C569A66F2D0903A8F9D2B238 joshua-bowers
515,154,559 *349DF77DAED94BCAC4BD12E68B82378BABCC312C jo.ta.ke.(disc.1)
515,154,560 *349A370B85A967ED065C301B823C9EE5F9867E7F [email protected]
515,154,561 *349C6B3275F7FD0C3EEAD39C810D0AF58D2B332E LEONARDKLUMPP
515,154,562 *34925D9A49910653721BDEF50A257F6E5D4239E0 AUTEUR21
515,154,563 *3494733F3783923F5229906B130715E00D5147C5 LE.SACRE.DU.TYMPAN
515,154,564 *34990C0FCECD9F4DD7A5B5DA023B58601B332D13 jupiternascar
515,154,565 *34978337143D84DDF9A0B3EB7B35FD7D0286F34E KAKALI DUTTA
515,154,566 *34967B99148605E7F688FCA9F897DA765E25503A KANSASHOMELANDSECURITY.ORGWWW
515,154,567 *349FF80D461C2523E7BCC43A80532C68C9ED5208 b1i7zin9
515,154,568 *3495D44B7F07936E83B97FA53DF74D402CA35BA0 b2s-u
515,154,569 *34979612290B4964A6434AC2B11BDA1B03331910 KarolKuntsel
515,154,570 *349F93DD75DEABE898E9DCFDD9D6290F5BE21B21 b5h!0
515,154,571 *34925451F0D99CE2BD25EE9F9240BCA076B7371F b5#k2
515,154,572 *349FE24662C062D7DC18C297493B98CD90AF7ADB b5&w/
515,154,573 *3499171AF28E990CA17E25F2D30FBC381845C290 B.6
515,154,574 *349D06F8049464A9C5E4EEBC7A84908A9AF07205 B6IBI
515,154,575 *349CE9195C4A3F5092B57EB7CDDA862F62C2528A listenwahns
515,154,576 *34966A66933D448D3E5967F2FFA91388BF768DE0 B9TOB
515,154,577 *349FF8783101B83D13464196CB654FAF0074F94C KENTON.RISINGER
515,154,578 *34903488371D0950E1EB9FBB160C4D75D50B1947 [email protected]
515,154,579 *349C0C490E524A31F9F3CE0850A0DB53EFB57812 [email protected]
515,154,580 *34906B7EF680DC71F8788E9BDD5F16B318706371 KERMIT.DRESS
515,154,581 *349A8CBBBFF6E92A13FF9BCDBE09530742F0370F LORENHOWIE
515,154,582 *349E05D07718324952C9C54FD9C6851D1A673EE8 BAP%8
515,154,583 *3494EB9C70EAFE0C4FEA0ED4E5F70E91EFE2B393 louissiriano
515,154,584 *34901496530A81717E6352B466ADC82DCFC47EA0 kimferm
515,154,585 *3497C41B8150C4CC86EFA91FD1DAD1197CF352DE k%kk
515,154,586 *349311678B1C3F1A34488B5B7E3253DA846DB430 luciosaupe
515,154,587 *349718B6B3867BE3D669E017E5691A79FFD48433 lucy-dunn
515,154,588 *34974167FD46A4F8D2F2111F273E078B26D2218E KOLMEKÜMNENDAT
515,154,589 *349F3BAE59947C3F5949690643696521744ADD2D BCRECCNDFV
515,154,590 *34901970D1ABB3BA25D49B97053AB2D9DA3E946B KOLSKITE2
515,154,591 *3497FA6227BBF896141CB1639F8F8CB44046F316 BEAUROGENS
515,154,592 *3491AD8E81C1217BC091496C923D1435E061E83B BEBVJ
515,154,593 *349054C991DC088D3E7324D7866A1EE0606342C0 KORISTETAITEILIJANA
515,154,594 *3498B9AF2380FB43F0355A0650D15CD13DD3ED14 BEFOREEROFEB
515,154,595 *34951773FAC82FE74D82C4E34380E984232E60B3 KRISTALININ
515,154,596 *349C09EF36B5F49492D462F2984D0C9C6D08A9B3 MACK.SWISSHELM
515,154,597 *34921FFB9AB7042151F0FBF7A1BBF86F44B8A4A9 MAGUIRENING
515,154,598 *349CEDAE3F68ACA19824DFAD6D47D1974120BF72 bernieh2
515,154,599 *349BE896012C322C5AB567D1650732FAB939667A BERT.CIASCHI
515,154,600 *349B9FB3278BAE0A9291A0D8A92D7AB2571E7F13 kwbbgsting
515,154,601 *349930A5B67B15B82C6611C61A17B79EABF9E2CD maklakiewiczu
515,154,602 *349EFA926FDF10F31602F8E58E1C0C241D97DCEF bg=/
515,154,603 *349020AC0CE032DD4762EA4A1B32A12F79914171 MANNIKIN
515,154,604 *349623A0BE87DEB9EAF2143F583F1833B2265253 BHG3H
515,154,605 *3497A35CFC9616A6A74CC36911D5BC697A98AD7B marinoilla
515,154,606 *3490152649441F57A2F01F1C06C3159D91FBEB8A mark.boulos
515,154,607 *3492C4D9A8044471DC99949198766BE17DFABB31 BILLYGOSA
515,154,608 *349086AC9104CAD18D33AD39AF3F0A81C77693F0 MARK.SPUNT
515,154,609 *349FEF78C16C7D8AAB0F9EBD100EBB5C87FD6C9F Marli
515,154,610 *349E903B77456A499D09A866F519AA7C5F859AD0 martinsmyers
515,154,611 *3498DC89CBD8B2BED2EA2ACBA39E711F461948BC MARTIN.WESOLICK
515,154,612 *3491A2A929C6318AB9EEBD40214EE5BE6CFDE71E martycrumley
515,154,613 *3493B6D5FAF5EA4C26AB39D4135896D0D295A534 langand0
515,154,614 *34967B2344363FE18CD8B16BD2F72C8DABB0C670 bjorg-henriksen
515,154,615 *349FBE6EA9286F24FB4C4B8EFE5AAAD71B092022 b,k$=
515,154,616 *34983C14C64090C15F7C36490D91CB6BD5041082 bkeou
515,154,617 *3498ADE00F9B71AB20EC3BBDD3DB9C4EA7420B2A BKLND
515,154,618 *349D5E2EC309932AE43910EA26EC172CD3923590 BLAZE(BAOBINGA&IDMIXSTANTONWARRIORSEDIT)
515,154,619 *3497642D74DC708CAF6C4CBE8C77F2945D8B526F [email protected]
515,154,620 *349462BB1DEDFF773CA09273ED32648D6B3EAF75 [email protected]
515,154,621 *34991DAA9C806A148796546A828D71EAA92448EC BM#M+
515,154,622 *349925D19B76CF887E4AEEB1EE077C7C5D0597FC LENARD.LAUDE
515,154,623 *349221792AA4C492860BDEAFED06E80B2BA9B7D0 ME-HUELE
515,154,624 *349C2712FB86415E85B8FFDB25188492C339E4F9 MELQUITTER
515,154,625 *3492B16B1D5356035455C1F1A0B65484B5618F14 BNRF4
515,154,626 *34935F6C118654D45D0D97DBCF0327F00B3E4BDD boomhoist7
515,154,627 *349ADE65552C5F599A924C14DE007ACF7EEA2F32 Les9symphonies(disc1)
515,154,628 *34907B94DBBFBF9E7BB8C68D306E3C0987F99350 bourseville
515,154,629 *3492FA25BAE79931A35669D690EB85AF82A6EC3D MIA BINION
515,154,630 *349BB4AA8F374F680BD5E5028D0B9904943D0792 b%q$d
515,154,631 *349B3004CDB250D4BFDD0A485AFC797AB68F315E brandenburg.concerto.no..3.in.g.major:.ii..allegro
515,154,632 *349F280B0B917CC46967B2EBC9CBB789379FB774 MICHELWEATHERSBY
515,154,633 *3491F44AAB281E3002EB66E02DE1034E1241141B BRIDUKE
515,154,634 *34931060EF19158517925801B253E47D515195D4 MIDDELALDERVERDEN
515,154,635 *34933CD3D719560B5D576A24EDC77C3C024638E5 BRITTANY.CALLAGHAN
515,154,636 *3493BDE8380F67F7AF08D9CEFE19CA42AE425436 MID WINTER'S NIGHT
515,154,637 *34926509DAECCE0D4E1F1D29C9FB74288A51D98F BROCHOU1
515,154,638 *349FD510B6952D19ABEEAC36498C5EC57B0FED89 BROCK.SCHEAR
515,154,639 *349C776F4649770B1C8B4D26333DD98C6B736B83 linda.mona
515,154,640 *34946598C92F0D66777DC119343976FB9024749A LINDELANDS
515,154,641 *349CE0E4582B2866C61E9FFD6893F8A5417A10A2 [email protected]
515,154,642 *349062561DF4597F54F37BEAF71C64CCE2AD8E29 l'inverno(thewinter):iallegrononmolto
515,154,643 *34957272FE1B77725E8E107C226A1AB0A3101962 BRUCE.HASYCHAK
515,154,644 *349F94EBA410C4571F22B839C9873C81F29515E0 linwoodsmaldone
515,154,645 *349B26CC1718DC97CDE9FF3006C5E06F5352DCA0 brucelalinde
515,154,646 *349E60FAB1D54D1CD6F5E905F457A64E0B7BF75A BRUNO.MARGOLIES
515,154,647 *349EC521AD436D45613E0A46BE72F0925F468068 b-rvm
515,154,648 *349B40A6543BAA3A54B60FC22D9C7B7B8045DD09 BRVTTNG6
515,154,649 *349D0991BF3FCD7BF505C767C1E584969D3D9C10 LIUNANCI
515,154,650 *349D30A79EE8106982B65224B58E3949B79FAA97 LJFGUIDING
515,154,651 *34916236ABD3AF73B6F9E7187F3B8C766A241CC9 LLOSREBE
515,154,652 *349EE801DB652FEC22EA2B17BCBC4BD192280BAF mitigos
515,154,653 *3497AE9B8EDC39D8AB7D50ED3B26C53DF49839B7 BUKARESU1
515,154,654 *3495ABD9A9DD2075FB10CDAD6842BD67F7A8C241 lonnie-ezell
515,154,655 *3497EFBF2F6DD5E6E970F97104F6110A7FB316B1 LONNIE.PRUDENTE
515,154,656 *349D90CACAF477CB2BD0CA64DBF06A3D50D362E7 BUO3V
515,154,657 *34933434C35A030F38B7C5D919E16998628C4097 loshoofdiger9
515,154,658 *34928CA132C9D52B20E2A8644F1BE8081E853390 MONITOREZ
515,154,659 *3490F402EA995FD249ED2E298533BCFACAD1CABA b.#?v
515,154,660 *349B54FA1920098CC859E360E604B31436936D06 bx_f9
515,154,661 *349F9819D4D17E1B1B3C56786C0655A2904461DD [email protected]
515,154,662 *349CEE787B5816B9320CE211559B94FB46A9AA70 [email protected]
515,154,663 *3497A988400E8BA3C9D6EF0F46A17110427EC003 MRIMONDINI
515,154,664 *34935CDADBCB4BDE42B969F6E66A6E068129E474 MRMONTICELLO
515,154,665 *349CB988EE3D1F11BE4AECED2C8539E6B096C72D bz+1i
515,154,666 *34967803C968B8A1080FEB85AD41EE4E7A0AAB6B [email protected]
515,154,667 *349E41DDDAF40CD72EB6F8B6BDA1892CA8820071 NAKSHATRA972
515,154,668 *3491ECAEA4A9906AD8295688E969AE2D1C0137C5 NANCY-DEWEESE
515,154,669 *3495E4B491382930608262AAB645617603E47E28 NANCY-FODEN
515,154,670 *349A3C49ECF0F6009A5E7EF358C5C391883CB30E NATHANIELMUEHLBERGER
515,154,671 *349C68DC3D547D3E04C50F7BF28119BCB24B754D national-acrobat
515,154,672 *3495C319FF35F5A0FF37E9DDF576AE4B5EB61279 CALIBRET7
515,154,673 *349ACA76D7356D5662819F8CEE7CB84920C0CB07 NEIGT-EURE-K
515,154,674 *3494006596D1DC25C0572DDC3D5FBB5DBB3AA1A1 NEKKERTPO
515,154,675 *34925033DD23ADC0962D424ED89914AB8AB79FD1 NENUGAL5
515,154,676 *3493E4B55ADB7485EC8ABE1D3E8FC8BCF52F0ACD NERVERNERVER(MORJEGSKALTISSE)
515,154,677 *3493849C0656559A0BDE8E0326E1839339CEA09B NEUSTADTSTRAßE
515,154,678 *349B3DA9F74407DABFF436DB27B083C849CC0C0C next.guy
515,154,679 *34967CEB8BCE222C4EFFE478678F504C7058400B MarxadelscascabellsdeRibes
515,154,680 *349028E8C342A3E95BD1D95477316FCE0C768FC8 C-BMI
515,154,681 *34920198C98A80A47F3C124A7EB14B539F652402 CCKNI
515,154,682 *3497ACB37F71A6D6211D64A439D492215F3F5215 CEDELL
515,154,683 *349E77909B37DFA001823C72CC71044F02B6F710 CE,"T
515,154,684 *349B773040D24096AD6C244850CFB1DC7F7B0058 nouran.magdy
515,154,685 *349FDDA383D707412211111C11E53A976497001E NP_001029134
515,154,686 *349E6CD33B1A0ACC2D45AC0A4DC8DE3A41707DA1 [email protected]
515,154,687 *349E9F1785C4189DAE17671DA5B6CEA17DB5C572 mega.man.2.'the.fifth.season'.oc.remix
515,154,688 *349365F98ECE73D50356A272E8242197DCE02158 ch4ot!cn355
515,154,689 *349D26F64047DFA8F76CB6F5CDB9BB1B02C50ADB MERCY SAID NO
515,154,690 *3499FD5C228D15410827302FCFE288A7111B878E MERILYN
515,154,691 *34943210B5DFDB3705B7C46DF3A89D555A157BB7 MERRILLMARCIL
515,154,692 *349A8D6A8B4BF1AAAD4356D5D84B675008C4FEA7 merriments9
515,154,693 *3497256CC6E5704451A6AFAA8AE6A7B6B0466022 )o(~` (######3
515,154,694 *3496450B6895FC9A97B2DF056E6C30FD72B52C7B METALLITOIMIALA
515,154,695 *34994469FC80FF72FB8DF62131D746DFB53D37D8 METZGER-B
515,154,696 *34960A24260DE0462622D33374328BE0D2E7AA88 CHARGELING6
515,154,697 *34999C992CEED09AD74A297C173B3BE894DB1A34 o de jesus
515,154,698 *349B15EC5ED2A79141BA29C342F5B5093AAA9895 OLEG1964
515,154,699 *3494B7533781E206C4F60226CEB15CF42FF15777 MIDO.ABD.EL.AZIZ
515,154,700 *34906DB1365FF65BBE10F70F4FE15202DDF7D0C3 mikaelchipper
515,154,701 *349B13DDA680174737B0EE74B66EEFB755780F97 MILJØAVISEN
515,154,702 *34923D112A8ACBB69DFC0F855C306824DF0BD5A5 MILO.CHATCHO
515,154,703 *349C160FD5FA29332D2E6E5D7A25F5D3C907D2CB [email protected]
515,154,704 *34967A0FE62B3FA731F194A506805EA325F07966 mindless.threat
515,154,705 *349464327AC535C554C4A5720C66F766C9AC237A CHRISTIANDEFORD
515,154,706 *349531030EEA9765BD08E44CE59D7844C8CEFB4E }O{ O~dp
515,154,707 *349011BDF3787BB80F30B17198178F9C999C9FDB CIARA-MAE-SILPAO
515,154,708 *349052E58245FAEEF464FA07EF4AE62B0DDF7915 cibhw
515,154,709 *3498C8C6A6444D5F5572C7C490B0AB22DDB9ABF0 ORLANDO.NEMUNAITIS
515,154,710 *349BCE93AA5A7A5EED15A1275355544312D0E063 moisesmendiaz
515,154,711 *3495C333BE33DA65E4DDACFA2884DDF2389DE227 c(jbi
515,154,712 *3490F5FBD85CBE8C610624F771D2BAE9B29952B4 ck10&
515,154,713 *3494F5B2F5BC3256B577E34C0B52A4A9395FB8DC morganbjerk
515,154,714 *34989F940E15348A6A2FBB879FEFBDC9789E5107 morrisbraves
515,154,715 *349C66CEB452355DD60803D01DAF6E62F041ADEC ckhb_
515,154,716 *349923C32C0D01D14894ED654DB4DAD6ED70CC69 our-guts-on-your-stupid-face
515,154,717 *3492A90586C8DA90BA1F4B318E58142DB7B78E05 MPMHBSW7
515,154,718 *349B42FD63B8ABE0ECB99364A6FE25F9DA99B376 ove-kristian
515,154,719 *349D8A943F43B3120C9DCBC76A90A349475D9CA1 CLARKEAGLES
515,154,720 *349E85076419C11CF53ACF41E52F915FAF7255EA OYJK
515,154,721 *3492369079F9E0BA0CD01EC5AEE8F6D5F761356C claytondolhun
515,154,722 *349E9E5F8E31FF805E136A3941B3093DD026725B musiciansturnedstock
515,154,723 *349F7FC017045B432DD0D3B5579518F91AE6E8C3 clencop9
515,154,724 *3495BCBD71864AF4B9BAA567EDD247B69F007C9F p==>~0~o}o{
515,154,725 *349BD81300C80082B712F6EBC003F3B8EAD9193C paeaeministeriyden
515,154,726 *34971BDD1D942F9122B0546214AEB74CEBE2F4B9 CLOSIEZ!
515,154,727 *3497D851C8FB8F3D9EDE70F28ACA61FC1680D924 CMAIH
515,154,728 *349EC57DCED4018730F5A2125E08D26494119978 NAKANDACE
515,154,729 *34925993C4C6CB919BAB40D3DEA6879EC1B7DF8E PAULITA.RAMIREZ
515,154,730 *349AFC032196BAF5E60D4374EA5E2E72283D8308 colindobrinski
515,154,731 *349FE34A69D94CEF1F3477A900D045B790EC6DB7 pb`splat!
515,154,732 *349024F35A0E1465C1BD57C6261EA04B15588706 pc17
515,154,733 *349BD05A7E62D6B955C75FA2F6262952E672858C COLLINRANDHAWA
515,154,734 *34954320E7FBE7210B5CC74902CB5644C0543F7D PEMBOLOT
515,154,735 *349C7FB425AB35ED301AA1844BB7BD551677E7E2 perambulator
515,154,736 *34965A4D44BC9E3EF3A4EE7C9C298C63BD4FE7BC #comment:.windows.cp1251.encoding.
515,154,737 *349098C10871DE80889DF3A2097D9E2346396E87 NEGATIVECREEP/SMELLSLIKETEENSPIRIT/WILDTHING
515,154,738 *349F3B427E874F79BD81774CC96718DB565BC1BA NEIL LONGBOTTOM
515,154,739 *34975440509B0160109C2A2F7356EC2A7A2C4B8D PERFECTTŐL
515,154,740 *34964C3F39A3D2CBC015CE418E2EE641B60F5573 cool rhythms '97 - samba do brasil (disc 2)
515,154,741 *349203340BF8FCF4D0140C54ACCF7FC4C74C9838 Coq
515,154,742 *349B8F855A23ADEDC30F5D473285E1F054216DFB CORNELIUSINSALACO
515,154,743 *3498E97944E34AFC9EDC329353F3A2E8526A2F1D corneliusleconte
515,154,744 *34928B0D808D968C0B9FC7804526CB805B79B2B8 NIGEL.LEONHART
515,154,745 *3499F2DB8E3CB0C83122934DB7D0D2B9AAAD7DEA cortezngyun
515,154,746 *3491706B0F26FCCD59E93E4A493E601790EC0BEF NINCOMPOOPERY6
515,154,747 *3495AF58E12FFB34C770FFC421D71D3318E43DB5 C%OV
515,154,748 *34973178513741761AC8064E7F493BC93E473BD4 nonfederal!
515,154,749 *349B986685811C0911692DE1B4DAD1D54A356F57 pokazane
515,154,750 *349BB7ED19B894046DB3C70A1CB9B6F68D1A7F38 CRISTINAMANAOAT
515,154,751 *349BFDF481FA4DE4B62D54DF38B706D03A6B52CB not only with orange
515,154,752 *349730282D790ED8B1B3D554C4120D69C5EA6798 croblast2
515,154,753 *349CF6021E573717153D5B703767D159744EF2B7 P####)~O~O-(~_^)
515,154,754 *349AE6D0CB56AFD3E6CB1EB9B1D54AA443B734B9 PORUNMA
515,154,755 *349AFD16B0AEE664BA3E8AC13EC88F0F355DE83D o4k3n$hi3
515,154,756 *349FC4269ECC57A87071C1D732A575A5CC408608 P-P-Man
515,154,757 *34993A6A1BC342E8DF87B29DA48E88844960BFC2 [email protected]
515,154,758 *349691108B6EB96B9946C7B81D6CA5EDE067B8B6 c?sok
515,154,759 *3492DF67BA4D19D3669E07317945E94E3E98A240 CTDI2
515,154,760 *349A0017832BCDD1B89AC624F4AAC6B33473844D CUQES
515,154,761 *3499CACA9DE423BB3F95EA176FCC729ADCAC0915 CVDPC
515,154,762 *34996446278CDAE9FAFB1F4FDC764184E566AF41 PROVINCIAHIST
515,154,763 *349DD8D44E33D702CB5660B0B774E6635A7A71EC ONNSHIKS9
515,154,764 *3493F3C89B29D1C965D55B7A63606ACA24B58820 [email protected]
515,154,765 *34924EF9235BFF5D9318F3DA965517D1E90BADD0 PUWUCH-TAWI-LULLABY
515,154,766 *34964D877AE423B2AA0F3495637A7399B3708C46 p產品代言。
515,154,767 *349BC68AB32F9BE778A349447E175600D8DF2727 d_2#z
515,154,768 *34999688ECB5E1E7DFC03C782288E1D6B80F617A otisapkin
515,154,769 *349D0A3A686CD8698A76246FD19C03F1001412E7 d!,3f
515,154,770 *349D798CA9F04A7762E0F56DD0A4C2B08802FB8B [email protected]
515,154,771 *3495EDABA28091D2B1E9FEC9D19FABE18FEA732A Q)~O SPLAT!
515,154,772 *349EDB7AF34A1ED5C3D41C8B42B31620B4B152D9 QUINTINMATHERY
515,154,773 *349793D6ABF6116582E501876C24142EF4D574A4 p!11!on5
515,154,774 *3493E561FB331E19095301D31777AE8C658F9FB1 PAISLEE2
515,154,775 *3490C92FBAF0AD0EC9EF6FEBF7E7AF1D87D7630F DALEBENKEN
515,154,776 *349C50E5F485D0DB25F51190A144825330A19348 daltongiard
515,154,777 *34930D0F13617DF390D09018A2ABBCE9EDC9B566 RADIO DANCING
515,154,778 *3498773C1A9574E51709AD782DCC96082E0D8805 RAHKOJA
515,154,779 *349C1C687B3BFCEEAE75AF32AACB5C3D4CE1A758 danging
515,154,780 *34991652E96FA3FC3B7C9D44D6CEC51183CC042F DANIELAK4
515,154,781 *349F8B2A461323C5FB40695FB5F2F42EC0B0A35B ralphmcgranahan
515,154,782 *349AEA39112C72505F2E915861EE03AA1C8FE2BD PARTISKOMAKERIET
515,154,783 *3498598DE248B57DDC694FEACDAD520BE19694F7 raperont
515,154,784 *34954FA40617D6ABE5EA8671A344AB8B719DAFF3 dariuspashia
515,154,785 *349677008E2B52A0E78EEA65DA9EAC14AB7D3536 dariussarkin
515,154,786 *349E3E9E55C913E23CFC9CB5900826DA7BB3EF1E RASHADCORLEY
515,154,787 *349D63C5544384FECD8162BEBB9F80C661430FEF RASKOLNIKOVB
515,154,788 *349750613D0AB929B42E5BD05028C4E53363E425 daronburdick
515,154,789 *34995C51F2DFDD37FB0B373B17D38404BFD91DB8 raulcunning
515,154,790 *349098D3C2E693A55DA1D3F1E72A421E4577BCC6 PDJ89
515,154,791 *349B2A175FBA06332AAE55AAE1F55FA0DDB074B3 p####D~o.{x}
515,154,792 *349ACE4AAAF9039D50C8D386D6D2A70C1D18F770 readf
515,154,793 *34905533590FBA0D50EFD9ADEA7B507F1AEF9502 david.i.williams
515,154,794 *349A82F1C36B9CCB8C3F1B6FB53B886FD3249951 DAVIS.LADUKE
515,154,795 *349D9D5698DFA07C84F1A3B1E3F0D7FFC9FC8F2E dbh5
515,154,796 *349BBAD0C8731DD315B95EFD544234CCD82FEACD PeeJee': Y'know, you seem smart then you say shit like that.
515,154,797 *3498060B0B89F7DBD9CEA4A265703ABDBCAB07FB [email protected]
515,154,798 *3493DDEB40DCC64F0C53C078108ADDB28C49E24E dccp
515,154,799 *34985C0C99DF8AC65D914B16467F2C06BADDA822 REDNUHTBSWING
515,154,800 *349DDA97507E5B7FD45BFC802B9F1B08AAAA1351 DCNHTXF3
515,154,801 *349897F4FEF76713831928FB2220BA6CA327FAFB reedbanta
515,154,802 *349A31AE626A9511F0485D08656B201CD6B4C1EF referencjami
515,154,803 *3490C4FFF80129041EE5EC4E0DB257C7D05AF866 rembur5eable
515,154,804 *349DE7C2CD261C2497E2B3784177AA22D8160A7F dear maria, count me in (connect sets acoustic)
515,154,805 *349E66400C9E0A1E48502A04662865417713E7E7 RENE.SHURR
515,154,806 *349A39BB3711291622E73F06AEE975E346D588AB philscallan
515,154,807 *34920D292202EA76D552786E877619F4B6E1899D deki
515,154,808 *34947C69EC2761D20F83DA70DAEC1FC0FDA95668 reset-(os-remix)
515,154,809 *3494D29F7ACE7CC55702ACEF46F7ED16BAC628C0 RESTAURÁLÁSI
515,154,810 *3499FF720D56F99D1F7236EB5868CAEF3B34BEE7 resynthesizes7
515,154,811 *349C3B3F983D54F0F9AAC344C4BC75EEFCD011D0 PIKENDAKSE
515,154,812 *3496CCA8F58DDDFA9D6D2DF7273211E3E024A871 [email protected]
515,154,813 *3495C91E534DE721CE2681A46A06955257C5C6CA PINDARISER
515,154,814 *34969CE5D160050A862EAB3860C9804B2A111544 piratetina
515,154,815 *349144CDF523EFC5DF8812BEE90D62902B1079B0 derek-byron
515,154,816 *34924A9535A2FA15DD833AE797577D5480B749A6 rh~!
515,154,817 *349E216DD59F9838D5B02DE1EAEF2DDF2DC8D614 ricaine!
515,154,818 *34928F896B51A7BE8B02953DEA45A62B89FAB4A9 deutziaefolia
515,154,819 *3493E255CF4EAF36C2A9604B7A0E6C6585508275 RICKYJESTERING
515,154,820 *349AE09E16A69343999D379B5ECA60BFC186065B p==) ~o><
515,154,821 *3495C66071BBB62EB639310469A81097E801C610 dfsce
515,154,822 *34986E84CA3CD969FB7365782BC7F4429431CFC3 PORADZIŁAM
515,154,823 *349C794AC35DE03AF2E6F520979B94D60F226CAB DICHLORIDE4YOU
515,154,824 *349D1C5AE98516F08FD4770E6E52BCABDD912E58 DIDINHOED
515,154,825 *349B3A2DF8DB01AC0157E800841E75B2D76EB00B RODOLFOZILL
515,154,826 *3496D71B70F9260B9A2745E168D5308259B2F294 DIETZESTEFFEN
515,154,827 *349A877EEED0CCBD21552FDDA733F814385C576B d)i/h
515,154,828 *349ABF319802462E9E577696626FD8AB5A04B498 ROTHMANNÓW
515,154,829 *349B3F6548CB292E104CBACE1794161C9E60A28C dirtlatemodelhalloffame
515,154,830 *34997023EB7ADCE2B6EF92B8739C3F145062ACFF DISRESPECTFUL
515,154,831 *34968F159E50BDD308B27F26FE9108405B6680B7 DLML2
515,154,832 *3499E9A0C982E43229C2F83CB0AA28B567500303 SAAVUTTAMATTOMAAN3
515,154,833 *349D7D4CF4AD1E6D81E096A951E3882D51D0209C p====)-*-*)x(
515,154,834 *349EA8A7D50774453D104B67D55FF566245BA465 dn2rt
515,154,835 *349CD30590264DA96CB4404A0F87BA053CD88FF4 do-fk
515,154,836 *349CF07136490ABC693878F268042454F419088C døgnrytmens
515,154,837 *3491DD9B823BD2A738BDF5BB0F01EC761612F914 [email protected]
515,154,838 *349116AC0167A8FCDA0E8EE96BAFF0593DDDFBCB [email protected]
515,154,839 *349B09DEC675C7E10CEB7E71F230EAC379B9C1B4 [email protected]
515,154,840 *349025CC00850D4E0D5405EC201BBD561FB87534 QOUPUE63
515,154,841 *349C170F9FE00555240AAC33E26154314F36E73A q-----p~0~o-splat
515,154,842 *3496475B8F0A1D58E8C5F568A6E1CBEEDC6701A9 QUANEGAH
515,154,843 *3499A93ED3BCE4B37D81F28AAC9A10818FDE71EB r3conf1rma71on$
515,154,844 *349706C5E675C858EADCABFC5847EE598F953BE1 R4MPH4$TID4E
515,154,845 *349D01058418C37F2A83D6E80DA85912E3322953 SCARRY
515,154,846 *349DDAAB2310CB84FC74CECA0BC2560D4DE220A8 scissor_kick's/I/z/@/r_k/I/k
515,154,847 *3493128D62B962F24311124A0E42066E147E9C67 scotfairey
515,154,848 *349FF27064F5904D18E050842DC90ED4A68093E9 RANCIPPULLAI
515,154,849 *3492C789BF6922B6C292960E6F73C35EDE385E86 RANDELL.RAWLING
515,154,850 *349BAF971134F0C0BE8C056F4571B5A38D616386 SCOTTYWOLFINBARGER
515,154,851 *3498C33B8C678786493132EC89B7E5DF91A57B5F RATORGATOR121
515,154,852 *349E90B82FE685F4742B1352052EA6C680E3A062 SEGARGOPAL
515,154,853 *349036493291514452199F4B7F06C34F53C7FEE8 selfcontentedly
515,154,854 *34928F654BD7490EF7F032FD0A162DD1780D8FA5 SERGIONEUHAUS
515,154,855 *349F688279196ECD5A01D29BBFF7C3B62A498E3A rebecca-stenson
515,154,856 *34923333525DDBD8B798755CD1DDBFC7BEABD96E sgfh
515,154,857 *3499D6BFDAB09CFB191A7BA3E95417DA995193A4 DUMITRESCUTALKIL
515,154,858 *3494F656E866B9D2A23B4654C4017597C728FD66 REED.MALCHOW
515,154,859 *3491F8B93A2675011A648845C5B1B418E4C5B745 reggienoguera
515,154,860 *3491830B0463B4F90D022919ABEB64989D718EA8 SHAHASLANOVNA
515,154,861 *34942613BE0F3BD4031759E8D5FB115450F1C265 d,v?3
515,154,862 *349CDC11C7B73AED32FBF9C6A37BCB78C46CAA6E REID540
515,154,863 *34917DDBCA1901AE73620DC2A1678702435FD4DE DWIEG
515,154,864 *34932549C499CE69F42B54B77D8521FA2A91409A D&-Y
515,154,865 *3495C669DC2336E3BA001619E4CEF041118747DC SHMAINWN2
515,154,866 *349FF90F53E4C3EA29EC14AF9AEB751F84B68B43 shuzing0
515,154,867 *349AB55BDA80ED4BD2315E13E0432E0144DA5879 E6OT
515,154,868 *349469DF55AB20A4178BCCCE3C3A36FF7BAE527A RG_'
515,154,869 *34987E0B3220749A3148AE006EFCC84ACB966F10 silbaban5
515,154,870 *349EF1644DE8595101BD5E101F7BC006B8FE0847 ECDIM
515,154,871 *3498B04280DFBE5B8FBF06425D2ACE85398976BC RISTIKONTRA3
515,154,872 *3493375DB6CED890AF882435A03C5627D165A309 [email protected]
515,154,873 *349892130C1F87790296447DE50464867A2842A6 RJGDRDN0
515,154,874 *34972BB766361EB0AB4FFDE676CFB39FA9304785 R!N9+A!1
515,154,875 *349C84A6DBEF7F0C1C9779E307E3E0A7C418A858 ROBERTDHINKSONS
515,154,876 *3491E0945DD57CED4666312F2661C59A4A726642 ROD.VLIET
515,154,877 *34917FC4F71EAF119E89BE811EE2C025FDAA065C roerig0
515,154,878 *349F2DAE31F4B0AB78D0397BAC01F21F2B3395C6 rooseveltperkey
515,154,879 *349E00A0957D3F9F8C3D15039EB8FA2F4B3C9ABF ROOT-WHELER
515,154,880 *34975A43F390D77B215D146493B559E505B169C2 edtve
515,154,881 *349B0C18BB41601620C3876AD465A58B74FB4693 SKUTOHEK5
515,154,882 *349B1532CAE42E6C1EBFB46FC736C4C25B23B00A ˈSKWƆLA
515,154,883 *3497CB2DADA03A1E0053B31580B3BA98422F9740 SL)1
515,154,884 *349294E6A9C23AA041DA9F5F2B7F8DC104B96DEF rtertem
515,154,885 *349998D94FF849FC6B9E7FD0EDDD7316695896A6 efr?p
515,154,886 *349051A3A08780E0F5889FE9689CC794C2D307F1 rubenscheffler
515,154,887 *349FA7C6ECFE2E0415ACF1842D04AD48331C7CD7 eh%m8
515,154,888 *349894A002F31EC984480066605E561E8B17215A ehoq?
515,154,889 *3496FF2129D0BF81BEDECC28D5069A257E6D5224 EINHANDELTET
515,154,890 *349BDCDD4A0B412E03FC67EC091CC72799C85DA7 SNEDDONIA
515,154,891 *349497A9EA8AC45134C54471BECCDE267850AF7B SNOITARAPERP
515,154,892 *349DF9973BB64D34A8415454462B43307D7C4867 ryan-amper
515,154,893 *34984C69116606B2E74A01AA4836CD43778584C1 snowfall
515,154,894 *3499FBC81C06E515D517616ADE517CA8A138F94C S0NGWR!+3RS
515,154,895 *349129CE39BE499785759502186AA53BAAE84182 SAERDNAS
515,154,896 *3493CF5A76984B82CEA4308E91949DEA1D84ECC2 sonata in d major, mvt 3: allegro)
515,154,897 *3498E6808559FDDE0DE584E1DA7BF04BBC460E79 sonnetis
515,154,898 *349007D4D18ED0CDA7FD9BBFBD620EF0B575BB9C elucidez
515,154,899 *349A97D7FE6CC3921CBFD6F86C50241003CA885B [email protected]
515,154,900 *3499D2D9E1A6CE728AB1CEA2294AF9C6A9877563 [email protected]
515,154,901 *349589782E9D96330614225B9CCF31225AB54EDE sang-ji
515,154,902 *3496B94B1AFAEE4364E32C17F55D5D2A66D2FD2F SANGLOVELACE
515,154,903 *349E99D75505957316BA12148125A48FA18E1DE9 $EMIAU+OMA+ICALLY
515,154,904 *349C297B10BD50AAF23D5914E9344EC67123A4D6 EMILEGOLTRA
515,154,905 *349AFF3E44656D38B10EF1F43471490F98F2A9FC SANTO.NABARRETE
515,154,906 *3495779649722A3D3AAC642C8FC90CB9BDAFAFD3 EMILESTAAL
515,154,907 *34984453197EB574B691FE19160E10D437D1426A SPASSAVA6
515,154,908 *3497E37AE9CF8FC19297E53F2FC715B5EE856774 SPECTAVISTIQUE4
515,154,909 *349B2B564B7CC4617DB82BC50C0ED1CCA2E724E7 SAVAGE20
515,154,910 *349D661FE24A5B5DA7674B37A6959AAE2B27FC4B SBRDNTNGCNJNCTN
515,154,911 *3496EB1815629BBB3798F534D22015E1FC2AA487 SBUCCIAVA9
515,154,912 *3499C1F9556D716D4D0407CB9CD23520A8D01989 SCHRISTYING
515,154,913 *349BF694E5DB28DB56997AB80E57A955BF7917BC SCOTHASSIG
515,154,914 *349D40A2936A9F3464F6EA46D0730CFF22B98C86 scottietrear
515,154,915 *349C7063D4E5A072E2D62B84A8482D0E28DF9385 SCOTTISH-TERRIER
515,154,916 *3495A6A138258CCD5EDD6F4048A0620ED8489AC6 SCOTTY.VONFELDEN
515,154,917 *349B18EB7F6C1506E08BFE8F2FB400ED12012DC9 ENRIQUE.GRIMMER
515,154,918 *349EB2E4FDCED828589B93AA2D94056A8FF3B52F entailer3
515,154,919 *349D82FFC4FD990A87822BB1A3FB8CA728D31EEE SPORTSILLUSTRATED.DE
515,154,920 *349ED7B524A85008B1D045309443C0995688F604 S\}R
515,154,921 *349B0DDD5DC6BAB5A0A451D065D1BB600DA29CC9 SSEMRIKING
515,154,922 *3492B3F4E569F583ED417FB025059323CD5D620D serviciogeneraldepaquetesviaradio
515,154,923 *349F2F605A7A4F69564C45C200EA45ADF6C8F252 esistiti
515,154,924 *349A51BA4239B68E735B867825F4F087AC975949 SEURAPIIRINAI4
515,154,925 *3491137F59BDC6DA7762A2DA2807FA98B70D8F09 ET1AJ
515,154,926 *34978D1EB8AEAAF570CBE80600AEB7F6BF3A80DE ett)
515,154,927 *349487C160F6AB5E88DBC3F080F361089F01B846 SHARKING
515,154,928 *349489229001DF9A26DA1BE366BCB611D9B41CEE SHEDYOURSKIN
515,154,929 *34981934FF170553FC6197691827775F6E8123DC SHELBYWHOOLEY
515,154,930 *349E12C34422DDACB4694B6AB7343BA905B57D6B [email protected]
515,154,931 *349C13AA04E841EC314FA105CD914104059B260E STIMOLAR2
515,154,932 *34936BD7DC6635872660289787F5814701EC0830 EXTEN$1BLE
515,154,933 *3491E77D4ECD84A669F4A131E32A77895AF919F6 strategiesforcombattinginvisibility
515,154,934 *34966BF9005717F3146F4092644F7A0E055498FB shellyannnicholls
515,154,935 *349BD4AD4F87DF114ECAE80D31C42D23A3992DD5 SHIULIROY
515,154,936 *349DF25946CD067B0247BFE9CA761B38DBDCB582 SHUTTERED0
515,154,937 *3490EA29C53C00B33E54AED14173B196ED7D695C F52995
515,154,938 *349D6C994FD6284DB8476374C120EAAD35886E71 FAITHWAYNE
515,154,939 *349492CDADA0EBB53779D778F62431FA0F8ACA18 SUNGKLESS
515,154,940 *349AD7CFFC1C6655B12197229315AF67CD08FC0F [email protected]
515,154,941 *3491D1B748C89F08745C3B3B63CB9A4259AF047A [email protected]
515,154,942 *3494937ACA2972C1C0D4693DEAFD537C50D5A0B5 [email protected]
515,154,943 *34923F32C23526C2CF804F7921BC15E7E533B04D sk3pt!c41
515,154,944 *34989557F2E04D60583671750CA83B11902A5536 SURF.COMBAT.(RIOT.FEST.2006.-.NOVEMBER.5,.2006)
515,154,945 *349F09B3C4FAD11493AC07815BDAF507E5DEADA1 f*c*
515,154,946 *349F8F57B3296A1AF89E88C5C5D4D7189E39E17E sliak
515,154,947 *3496830086A704A455D91D9B90580FF80CE88ED0 SLUSHILY
515,154,948 *34960AC4A220CAE73FFD2E09A75781D6F51126BB SMALT1ATE
515,154,949 *349DBAA2C43CAC537EFC02A7B953DBCCAD182E76 FEXAMPLES
515,154,950 *3495309E92F324BACD516479739ED462CE1D17DB snaagrotsat
515,154,951 *3495F5CA70C3A0BCA0D39AE3FC2AA853BE078B27 [email protected]
515,154,952 *349F003C79AD448C2AE0BC7AB8F955678F60B1AA fiero-il-mio-tormento
515,154,953 *349422D0488EC242208986E63D8217DC4A28E40C SNOIREUQRABMING
515,154,954 *349088B9FDF835B9368C5BF844676EAA672BF375 SNOOPYKOKING
515,154,955 *349A5479ADFE02FD2ABAF540DB14BE56047E5B93 SNOWBL
515,154,956 *349120B7B2B2F1734F865DF63E294E43F671CD71 SYLVESTER.TOPPER
515,154,957 *349962C8BE1D94E5B78BAA67355F73E9C0C3A944 SOCCERPYTHON
515,154,958 *3498584D585E5FE5297F724807E821B238DDC525 SOCKPAPET
515,154,959 *34968B23DFB9FA2FAE8EF1AA62F59D4791CB16BA SYPHILIGRAPHING
515,154,960 *3492AC07767444D01090AE0FCE6F5BB389774204 /SYS/KERNEL/SLAB/:T0000512/SANITY_CHECKS
515,154,961 *34952B211BE2C6346443606D1C14832C6A686172 SON.REARICK
515,154,962 *349E75792FB91FC2740C37BFF69534482F22785F FLARTNES2
515,154,963 *349204FC9E217921BF264B2F6DBEA2C79601C1DE fl{d
515,154,964 *34986F4B263E36792942C2F5B318B18569BBA6F6 T3TRABOR1C
515,154,965 *349C6170B00ECA2AF4117D2A4F0509292E3B5FC8 F%_O
515,154,966 *349715A83C74D8C0B5F7EED474404BD792FB88C6 FOOTHILLBOOGIE
515,154,967 *34959CE7935327353F4108D5D3B8AFEA4A9DAF9F sparrow-sings
515,154,968 *3490B89C64D31B0DA231045474EA09643B0404CF SPASHES3
515,154,969 *34971EE58ED2F4A3D8A90C26D06700874E43D81C TALKENRACHELGREENO
515,154,970 *349D8A394455A04C1F03B5B6B4EC3460B8572BF7 SPEECHTIGERS4
515,154,971 *349B4245C9FBAB94472F2F714F6F306C296E3AF5 FPU2434
515,154,972 *34991070EA19B25DAA927D577CC9C4D25CE92E9B SPETSAKIS3
515,154,973 *349E76365AB45586C8C9419B758827F86B2399F1 TALL-A-TREE
515,154,974 *3492ED0EA5CD77D11172E3CAF97FB3CE3A796BCD TAMA868
515,154,975 *349D00591C23E71FA73B5DBD7E6730D93B7A2B8A splat!!*@=====B
515,154,976 *349E53F354BF728135DF7848F0FB93A9D5172867 TECTONICPLATES(DISC1:SELECTEDTRACKS)
515,154,977 *3495BDA868F7C8A42C0CF92920F3A41508F4D4D5 TEIDERKNETNEILC1
515,154,978 *3496C2C318E264AFED2971721C2B982655052CE4 FULL MOON GENERATOR (PI MIX)
515,154,979 *349AA5ABB6BFDF167B236E48F24A049CF500A935 TENTACULICYSTIC7
515,154,980 *34994D73D1104AF41CEFE73861A9868BABBEA54F TEODORO.BARDEEN
515,154,981 *349248D92273761F0BB935DC99F927BC435A5866 [email protected]
515,154,982 *349719F26322770C2F354008CFB75A4EC8101338 [email protected]+ee5
515,154,983 *3492697E137003C1BDC0B4994AD3891C782A2BCC TERRENCEHUTCHERSON
515,154,984 *349144C509639BC5283E24E68524BB644274A55A gailkneifel
515,154,985 *3492CF7EB9158C3CEF93BBFB9CDAEAF933F00BC8 GAIRLIES
515,154,986 *349573EF660EEE84B578235D861AFEC982B80126 GARTH.CUSSINS
515,154,987 *349700CD6878C0154876A501959ECFF5AE17894E STEVIEGULOTTA
515,154,988 *3494CB5EC2D82200781AB772BDDC573795745840 GARY A WEST
515,154,989 *349F2396C877B811A74F40DE6FEC3EF4993EB61E STEWART.LINDOW
515,154,990 *3495CA9EF552F4798EB72C3250083351713A68BA GASGENERATOREN3
515,154,991 *34988BED8F4A5207CC3750C8E6222EF820C55C41 THEHARRY65
515,154,992 *349A057C7D38F38699789D6621C06B1063E0ECF2 GENECOLOGI5+
515,154,993 *34954E99C2855C584E77C0DE9EB6A4BC0A9272F1 THEPERRY99
515,154,994 *3499C6F20A2B11EFBA8796E61761054F700267F8 GERARDMUNRO
515,154,995 *349098021607BBFB96A30F5B8C284B499573D5D3 GERIPORTER
515,154,996 *349F2698722FED565089BF9A38FC056740C8C568 THOMASBLACKWATCHSHEL
515,154,997 *3494F9F1CAB97899A87AA4AFD45AF8A42D277F95 THOMASNORTHCUTT
515,154,998 *349F89006558033823FFA5F730C2F4C9EA7F1C19 GEWASSENING
515,154,999 *349BDD56BCCEE99152C6F5619A4941CE761B4A51 sunny-daksh
515,155,000 *3492D2D2A78FD5AF08DF5FAA869AE5DBD3FC20B7 gina-friedman
515,155,001 *3491B40F14F514FB4477576733A1D400665F3DE4 tiempo-inmemorial
515,155,002 *34941C4CD44B44A36D5A0BC88E2A1F9844026F2C TIFFANY LOSEY
515,155,003 *349E9310E72A4472D0B1C13BB115F9DBB2EFE0A0 『supernova』内の一曲、「morning
515,155,004 *34966DE0E4AB2FCB70C2A88847E56F67699D90D6 SwingMarcel
515,155,005 *349594E996121F94BE26EECAFB6CB77181D7BAC2 SYLFE!
515,155,006 *349D0D0AEF48724A4606AFAB132CABB867089363 TJFOWLER89
515,155,007 *3492CF3CE25304118EE528B27DFA4B1824070A83 glidinglizard
515,155,008 *34959B005D05EEF7AA4F51C3A75CCE9DD8C4DBDD GOLDYJOHAL
515,155,009 *3498B306D8C8E1691972CA2FF6435B642F880D78 goniocidaris
515,155,010 *349C4A18EFAB65FFB88F87A2709869CF60F1DE28 toleriraju1
515,155,011 *3494136FC0A345246C00F0A9C4E7B803E74C0A90 gourvish-cost
515,155,012 *349B85DD065D2BA1318769546CF7BE4A834219C5 TALKJEFFREYK45
515,155,013 *3490D7668C79832F26D00CCC3A33201D85A51272 gracy.rodrigues
515,155,014 *349B7CC0CB3A8F2D929DAFE54D66CDB540773710 tony-valente
515,155,015 *3499516FF8A7C7A59C0DDD0B7211FEED80744297 TALKWG072717
515,155,016 *349D47F50F69C354CB1E968D0F636DA9E59DE130 TOON-SABHNI-THAAI
515,155,017 *349A83016375A289B96F2D7F3ADDE0B1254E19F4 TORSINNO
515,155,018 *349BB38D78BCDABA6132BF20A8B64C3196CB7B67 taqhtrso10
515,155,019 *34989BD0CD212F1EBD0C3A609EB46E5B28E91FF6 GREGG.NIERATKO
515,155,020 *349A9B98BA2A07DADBBBAA7F801EE5FD62F45FAD GREIFBAR
515,155,021 *349F698AE46BF027C9784B7495651C285B5B9BDC TEISSELBERG
515,155,022 *349B7E1BE4B084D06AA79A106D343857CC8F7423 [email protected]
515,155,023 *349F446C5EA98371C4A94211A338B72BC9F6D66D TRANSCONDUCTAN3
515,155,024 *34931CF6AB285260C44A4BD0D3654A25635E766C TELLURIDES5
515,155,025 *349830F68A08F535388EEE24E51A22F606FAB397 Temporiserons
515,155,026 *3495768C43D08273EAE60E1046F86A7A3BF7470B guiacum
515,155,027 *3490EA92756A1BA9488E6CB3F66D01F81C8C8E76 TERRELL.CHARI
515,155,028 *3490080D62AFDA9E119AF4D2C73C5B8304C0DD29 travisstear
515,155,029 *3496C621D07520CA27984AB52DF1C26873195B60 TGNMLEN4
515,155,030 *3499F06A80713691AC3B51DC1116D1985DC65304 the.brothels
515,155,031 *349092B90C45D7555625A3337D64AEE602509439 THEMONSTER05
515,155,032 *349CA2EE988A125C082FADE7F79A4BC2ECF461B0 THERESARAINE
515,155,033 *349D2C5B5A19F25616A0A9C57DD7E59F36BFAD45 thetichyboy
515,155,034 *349030CB3FA07611643CC8969E7663F62D075F57 tu$a
515,155,035 *3491D3C046D2B8B9440DA41B2DC335B868CC012F tuanschroen
515,155,036 *349DCB9BD852BFC0917DDD8FC3FCE14CFFBABFC9 tuesdayxxx
515,155,037 *349ED84D96F640D757CAB0136DCB5FA805132EAF harrison594
515,155,038 *34950E13E5B7A92637D90A5BE176CBD3D1E66580 TI(BAA
515,155,039 *3494EBD4B37724B26315BC3F5B4718609D357F21 TIMKALTHOFF
515,155,040 *349E4E22A11502944D0E15DEBB43AA29D91A81C3 TINUECIVRESLENNAHC
515,155,041 *34918AA60336A5870DDB1781C8D3DEEC30C5B263 HAYDENSCHAAR
515,155,042 *3493AA609312ABE2CB2496781F69D6CF6EC5C1FE TUSSEDE9
515,155,043 *3498265F84F5629E2B90BF462B618C49C9B0981E hcsiteneg1
515,155,044 *34991E07B73B182AD8C090A153054F2778787FD3 hcusrevhing
515,155,045 *3490EF3D1D18651231884865229D4ADB294E6154 hearting9
515,155,046 *349C80380752EB4EA18DBCFA40ACA0B730FC085D TNRUBWOMS
515,155,047 *349A24CAE92EA0377D988DDC87DE337E7CDB7808 TO-BE-LOVED-(FOREVER)
515,155,048 *3494663DB676E5EBCB18F2AD919007DFF2FDABBE toddgodbe
515,155,049 *34973F7F815016AF0DE8A842C654A3FDDBE76099 helfersing
515,155,050 *3495931E9A3C29BF2B99B6177BAD393B049062A2 TONTON_2000
515,155,051 *34974DA432E53E6CA8838B9964663FD8D6AA1ECB ueje
515,155,052 *34902F0A239709BD3654284AC05F4F4DCA1E5493 HHP+
515,155,053 *34964E226DBD6815801157F7C90CD46D95A0738A unc0mf0r+4b1e
515,155,054 *3496E1641F53252793BC092ADE616F64B565D6DE TRENTON-J-BAUM
515,155,055 *3494BC4BDFA00D30C07BFD3D37667A5863CD0136 TRENT-WEISER
515,155,056 *34927A53329050E430671D45809EAB025B13C6AB HODGKINSON
515,155,057 *349E689F8F5448B993BCBD26B0CC71EA3E597334 holliswestland
515,155,058 *3498551B8EB79D3C0DC09DEAE9717ED7585154CE trish.brassfield.newton
515,155,059 *3496DDC808ECBC38DD4D6F46791E85BE5936244F TRISTAN-WHITCOMB
515,155,060 *349053623E59CE39E1EC2994F3B66B345A7F6CC8 hoseastaniec
515,155,061 *34998B5AB203D8C399548297B805E7AB0E1F580A tristessa.buford
515,155,062 *349105A067A69647828835DBB558194FFFBF5517 TROLLWOLFKEEPER
515,155,063 *3490E8F3FD713467F6020F3E4F1E40AB4D436BC8 US3991
515,155,064 *3491DAB6560ECD8950170E79BD72749D6FA4545D TROY.HERZING
515,155,065 *34955A5FF50F8F6813ED1B430409D5BB16BD3466 TROYHOTTA05
515,155,066 *3499BE7580C9ACEE9376C8DE56696A3F9CA2496F TRUNGXIGAT
515,155,067 *349A0B79AEEF4687C948BA6F80FE3A2CFD60AA79 HRĈAVANOJ
515,155,068 *349C8DA0CC03880AD3AE97D0E521C94DB0DCCB8D tstnetapping
515,155,069 *34931CE8030E1281036E9B7608612FA1631EB4F9 UUAKKLAP1
515,155,070 *349326C449F3940AA6BCD2B03E8276442E5CA937 TTEMENTSED
515,155,071 *34912EA129D3AB7AC359EFCE64D2F8C0E4B598EA hungkildow
515,155,072 *349B4A66930ECD73CD168A33180FF66FDCBF1446 (V5
515,155,073 *349088E06DFD20FD2A64590C8EB07632CB7A43F2 TVEREKEM
515,155,074 *349021D7F1EF023465962462CB0DE1E83128BC58 valerie.cauhape
515,155,075 *349317F14C700116BAE31DC702C05457FD23C4BA valerijoninis
515,155,076 *349D4F9F3C6DEC7BEA31E4EB2F5B55A63A5FACA9 Valse-h
515,155,077 *34993DE8EB3879E7CD34BCC6B3B89451426CDEFA VAMPIREJOURNALIST
515,155,078 *349730A145BE6E01D364A57FFE236494F34DB130 TYRONALLSBROOKS
515,155,079 *349F154C058F871DCA8301C1EBE8AD95C8B90E2E IASK1978
515,155,080 *34926D5E9E768DC6A44DB6F68611426C49430437 ican'tseetexasfromhere
515,155,081 *3498C242550712975D9DE9FAE0F33E1702DAE80E uitboordens
515,155,082 *3492BF45217D6D7616BC388AE053A14A1EFC1102 UMI-KASUM-MOHD-YUSOFF
515,155,083 *349E9EC0D15846C7DD569314A00B42FA92D5376B I.happen.to.like.nice.men.
515,155,084 *3492A549674D1ACE10AC6DFD893483B364B8E1BF UNBANISHED
515,155,085 *349AA81F35E0AEA4409AB9CEA04D927C8F0746FC VERLIGEN4
515,155,086 *3499008D468560D650FE59B51127ABFBACA3C37D vernalyn.cacayurin
515,155,087 *34905AE9A5FD05F83C553DCD416D2393CB5BDE0B ilovefoobar2010
515,155,088 *3493ABE7E25BF8B6362766C52B6F06E46131394D ilovetaiwan66
515,155,089 *349435C64200C399207C67A724E53C7570F8494C ILUVMISHA67
515,155,090 *349BD09027810B1B6092293478F94B6BC03B54D1 vicas-verma
515,155,091 *3497E0BC43BAB30353916D685FE5B6FD8C7C7A5B IMITAVAMO5
515,155,092 *3495DB2696B2F512A89662D92E6502A96CDBDD80 VICTOR.STEVEN.WERE
515,155,093 *34901B18F8374D7A27B0FDC1DBBFA802F0D213C0 IMPROVISATORIAL2
515,155,094 *349D09A0DC5B8EFEDE395A7B3DCC1909EC5A0DEC uri.kimtrell.johnson
515,155,095 *3498C738D0A539A4F0EA28A56FD4FBB555F8EE7F ur-looping-(instrumental)
515,155,096 *3495C036327EC85FE2A3F4D8FC717A0380DCD507 VINOTINI.PANEER.SELVAN
515,155,097 *34928F5B222020FE99C3B0B7621EB6E0349E509A VIRKSOMHEDER7
515,155,098 *3490A1B48C238C31A975E29B3C2F1C4292C4BC44 INGESTAR3
515,155,099 *3494E6A539BFE29E75C8CD094CF076DCD6D479F5 VAL.CARRIGG
515,155,100 *349C8BB0A74D9D17AF2D0DB85341A4E88CEDDA03 VALENTINENARO
515,155,101 *349F765ECA8FDD19D724F8BB6E01A47ACA82DE7A VALERIO1
515,155,102 *349A987664AA6501CCEA97A370974FBB3537B27E IPOVENTUD
515,155,103 *349E2773F5325B109AFE62DA4882B101FB5B31D1 VujaDe(originalmix)
515,155,104 *34999EEEF5030526F548AF87CB0E60CDA172E28D irvinchauffe
515,155,105 *349935FD603D9C6C48B18062235B931CA48F4C6F vedanshumalik
515,155,106 *34970C4C7508B08B7EABF22DF4D5F77A10E11B13 W1UF
515,155,107 *3492EEB512D70C2B97F8457AEA631CAC01ADFCF1 VICBERNALTE
515,155,108 *34942137957D7CFC38878EB5134DC1DCF548090E vicknaswaren-arunasalam
515,155,109 *3496F2ACE230DD06F8996240DDD4445FB9C2ACF6 VIET.THANH.LUONG
515,155,110 *34905914A9CB0C16E9E30C954607214BE3B30314 vijay.kumar.kalimicherla
515,155,111 *3490F33CD7FBCEE6CE3CF491C52DDE70ED43D63E VIKNESHWARY-VICKY
515,155,112 *3491A9E96A7D571D69C379C3C0E745DEB1061968 j3aaa
515,155,113 *3490FBC99EEB69F382E64687E97C680E9059C508 vinssin4
515,155,114 *349BEE93D29A2628C5BE332C722E0D574E46A887 WEEKS-ALBUM-POPROCK
515,155,115 *349565E1A3007B620E0413591BF159952A98C2A4 VIRIO LUPO
515,155,116 *34942F8BCAF2F8D2101B24B8379BBFF3AAF13DDA WELYNBALMES
515,155,117 *3496E833ADD20ECFCD2D84C749F0E372CEE632BF [email protected]
515,155,118 *349524D61EA0852E9A7742C6DAB6FC4A415FB9E7 jamil-parker
515,155,119 *3494F187682F523FCE1E0AF7C626174596BF5CCF [email protected]
515,155,120 *34914CCFF8206F59E0461D17CE9252913784564C [email protected]
515,155,121 *349C4A9F09F6C1EC0A760CD6E6FA3C733038A1B0 VOILURE
515,155,122 *3491CC68BB5048C46DF84A214B1ED8F53F36D588 JARREDTARLOW
515,155,123 *3496122FC28BC7D75F9E8C14CF46044962A98419 VORTGRUP
515,155,124 *349CCA9F343688F63985FD00D18C15DFEFF7679D What's.a.funeral.home?
515,155,125 *349A06D98C906EE2FC68197B4B95DD1F75C9AF71 VYRON.EUSEBIO
515,155,126 *349C7C92AF774A254D10247019057F22D528B481 whynfm
515,155,127 *349D50566F711CE124E11F6484F9FFB0C7740844 javierkulp
515,155,128 *349D2FC4A4955A82B1AFF48EB974686682E7F55C JCHOURANI
515,155,129 *3498092A3879C376C5ADF5C82EFEB78AED9D106A willardboa
515,155,130 *349F8CF2F302F50EA3E3C9D1062A9FC4256D1B9C WILLIAMSPEIRSBRUCE
515,155,131 *349D3B3A094B88340133F527B5DA1970EFE8C7DC jedjarreau
515,155,132 *349A75B00D073738FBB59680EFDC770C6AE82CD6 warrenmillion
515,155,133 *34986C98BB66FC6CCB4D6E433A5639E91EBE0A10 W/KT
515,155,134 *3492DED06C30439B442DFA6DE26E92AB8897B3FE We.Have.the.Strength.but.We.Don't.Have.the.Will
515,155,135 *34904349B5AE55EF00E88DC7E6CEE9107B9F20E2 [email protected]
515,155,136 *3490B66E3D8C834023DC99850847141EB05B2E07 JESSE.RAMDAS
515,155,137 *349952202027F1458C16C93D227EE66EE556182C WENDY-GENTRY-BRUCE
515,155,138 *349236E70108A605423F361E536D4C74FB9C5B3B world.game.#10
515,155,139 *3491860B93AB6C7D58164F86EE57A9A3CB0E8731 [email protected]
515,155,140 *349DC83EF9FE9BAB7AC3D23D4268D48F45D7266C WUPINGJUN
515,155,141 *34927C2294A2CBF28F00BAECCC63BD41789F2D87 WWW.AMITYATHLETICSBOOSTERCLUB.ORG
515,155,142 *349A8707A3D96C0BC7DE5C46FFB030126F2E39EA WWW.DROSTE.NL
515,155,143 *349AD0A35F1B362DA1D4190789AFB5E4534F9293 JJIPOD
515,155,144 *349928E5246EA26BE0B209F7A8C59FC14E51FCFA [email protected]
515,155,145 *3493ED1408E555F404998FB119DE51F41AD77E70 jnqfndh77
515,155,146 *34961402F2EACBD3A24B9C00367D044BDD89D793 JONATHONTRAMONTANO
515,155,147 *34939D02D4E8F90E16C1AADBE99BD9A891796089 JONGNO-GU2
515,155,148 *3492CCBA345C6409CCF418A573D1CF1F90B9828C jordonreczek
515,155,149 *349D7565ACF670C96896B9DC433FF62D85B5DF7A JOSIAH.GOLEMBIEWSKI
515,155,150 *349A16CE59F712D449FD7F1010580FAD567B7917 josuemozick
515,155,151 *3495D9FF73E796AFD734247396A34BDFA83FE37A jowialskich
515,155,152 *349A794BD73523459ED4E9FDDAFCC6D24DB57C34 judceus
515,155,153 *3499AFFC6B3A7460D26D78E2403918EA6FEEE3EE judeviall
515,155,154 *349295794CAB210C80ED165DA940FA8FE32A830F JUDY HOVEY
515,155,155 *349023493C9E045F08417E816C03A6DF2EC1E9DD julesemmerson
515,155,156 *349C139917CDDFF4458249C7E1C230F4BFBDACCC jump!er
515,155,157 *3498E2CB002645BBD17C69C00DAC77828B334F6B jyeganotoesoreus
515,155,158 *3495FB6A57422C86784BC61AB8ABA6227BFB9864 what.are.you,.afraid.of.me?.come.on.stand
515,155,159 *349BEDFA4A806655E9887462F33F30D0D0748E20 KALJAHAARIKKO
515,155,160 *3490F4238D416B61130220C42E40759A6AA73884 [email protected]
515,155,161 *349785A569FB4A9848CC4865822A7DC8AD81724D KAPU-DAGH
515,155,162 *3495EA42C1924A7C02D0C0B433018352C8243A67 KCABEVIG8
515,155,163 *349BBD74AAA5CA2F6C0B7ACFE3746150AB21F409 keith.birtwell
515,155,164 *349D2E05D3EC4D3A80C7D9E45444DBE3FCB6645B KELVIN.DELEGEANE
515,155,165 *349A37807A977B2821D1024144DC85F896530B51 kennadi
515,155,166 *34994CC6CE29B5901C217A3C0757E2D13A1996A5 xi9baa
515,155,167 *349C4D25D7D717F00B8C289641B7025F3F6E0F80 WILBURSLONSKI
515,155,168 *34924B0F6FA775C58EB759B40F065AE9B8042A38 XIAODIQIU
515,155,169 *3499F56C1B1BFAD3C4F9717C8446C7B5F5E78FE7 WILLARD.CORDAS
515,155,170 *349DA272D3F5166F3F91B5B04EB4ED8569EB171C [email protected]
515,155,171 *349921F44D5A7894A28333C1A3047908F6C71404 [email protected]
515,155,172 *34932B9BF077B2A345E3ED0012BCCAA864B65E51 william-holston
515,155,173 *34924F90CEBEF63EEECEAD4C3FFB5A3972BE3C86 kez>
515,155,174 *349E787A60092D3377A9D0E5A73C7B03A8884594 WILLMOLCHAN
515,155,175 *349536C280673F2BE5AB00630ABF152D6FD84B95 [email protected]
515,155,176 *34931BB600BC16B3158AA356BF98A0D2B634E6C8 kimhuges
515,155,177 *349CD2DB4619E6C5DA68CCC913B3E97506AA5DD5 KINDERLOZE0
515,155,178 *349140D4A07E96349EA050AC2288DD09732DF315 kn0+h0le$
515,155,179 *3496046807FA089AA934C5C010B375CF303C113B KOHLTENR
515,155,180 *3498F4C14EF866836EA54917948D2525DBCBC6DC yaremis.suarez
515,155,181 *349DC203AB1190D2D4252044E42E760A28AA9503 WONG.MING.HANG
515,155,182 *349FC3DD2F0767936D585234205E5E5587A49612 YASSER ELSHATSHAT
515,155,183 *3494F9E38A96BBA0D180F915C36C2969C2FB36B5 ycnahpele
515,155,184 *34982850E07A1ED8D2ABF0F06B596B38FD98690A kɔrαχ
515,155,185 *34987FBE447A7B4580A5BC9E587D6845E0EC6CFC wuchensing
515,155,186 *3497D04987F0FC0F96AA77EF86208333DD5F4BC5 [email protected]
515,155,187 *349CCB5058801D588343D68175336A345365B45E YEPETOCAXEB
515,155,188 *349949778A423F739C16231A172F4BE43E286AA0 [email protected]
515,155,189 *349161750194A89A39FDC8CD6C44C4F9B002AE69 KRISTIN BAUMGARDNER
515,155,190 *349CBDDE8A8A32835608885B92F862B283AFEA95 YHTEISTYVERKOSTONING
515,155,191 *349C109A37902E7425154FDDF8723D22CA3AC6F4 WWWSURVIVORS-FUNDORGUK
515,155,192 *349F852842F604B55BF1B4084D792905D070ADAB [email protected]
515,155,193 *349ECBB323A0FAD81425BEA0A0A50B174EBB29CD yolandasimmons
515,155,194 *349F324EBEB8619FD7CCD459C0668F6DDEAA2CE8 KYLE.HAMMELL
515,155,195 *349E6EA851B44016B36D89545B691FF18F10DB63 }X{~ `D###Q
515,155,196 *3499E6B81B0AB30EFF6144BC4D8D8D262F3B5A1E [email protected]
515,155,197 *349AFEB34F38C00B6742E4C4E79EA287E7F3C370 L3OT4RD5
515,155,198 *349CFBD0C4174AE402D575445649974997BD8395 YREELAMGIHW2
515,155,199 *3490AAE9FB1B4E4AFA11DC8A54A7D1987A6115F3 {X}O~O~D--3
515,155,200 *3497279E0A03FBD64DEC753550441E7293E88FBF [email protected]
515,155,201 *3490FC0747D9A329B8B777B4D2D264FC81786AD7 XY<
515,155,202 *349443A403FD26C04F432C16FAAEF5F152EA77EB LAMARGRIPPEN
515,155,203 *349F515B4A288389EB7975252DC66DDA2687BC05 YAKITSUKUSU
515,155,204 *34928DF8B5A626B6CD6BC67621143C2C7F851388 YUSHMEUTIASARI
515,155,205 *349D7C2F07C0118B2D8C915068A6046B4F31FC53 YANELI AYALA
515,155,206 *34927EBD04429AE3AD3DE070765C4565A14D58E0 LANCE.WHITKER
515,155,207 *34963122267CF05DE4B19711D318A9E8BE2849C9 YZAAHF
515,155,208 *34994019C438126B80021F4248417C2B9B67903A La-Sexte-Estampie-Real-(French,-13th-C.)
515,155,209 *349D4C2FEB79D205140E04955270D546E9D0FF93 LAUDER123
515,155,210 *349EE49F570D24202F87DE458EC45D735357A54F ZACKARYSODOMKA
515,155,211 *34950CE3E542C3D918568C5B7454EE1B253B68C0 LAWERENCEGHOSTEN
515,155,212 *349347187FD951C2D3B877DCC8AD2D5942F80841 ZAMPALIGREOUSSENI
515,155,213 *349DCE590E7814EB10B0475C67E693DAA592C897 zatheysia
515,155,214 *349C082BAF13472C8848DF8E33C49D85E8125C0F LEIGHSTEM
515,155,215 *3499A93169F12BC9356BDFDEAF5CA713A8CDBBBF LELANDHAYDU
515,155,216 *3497108AF5BA858F3FA2BBB4DA13A202B1C9E2B6 yovi.gelar.nugraha
515,155,217 *3491FF10B3838E11AEA25A13D4072B87C15E3DAE [email protected]
515,155,218 *34902AD0BCA973B3D386672A0977FB0CC29DDE96 [email protected]
515,155,219 *349EAED53DCC892F1ED3F84F57D60CCF53740BE8 [email protected]
515,155,220 *34940BC568B0DDD21D55F243A8F60C1130AAC474 yvantabligan
515,155,221 *3498D5B3C7312E3B1C0D344B090D048F44933457 YVONNEWAGGONEREVANS
515,155,222 *3493453DBBCBC9D7BD2ECDE9282462D246AA72A8 YVY_
515,155,223 *349CE3ED8A4D56D2896325FE5E150D9DF2596E35 yxqb
515,155,224 *349C921D45900E96D774A35CFCFAF6CEE12DF046 ZOESTAMKOPOULOU
515,155,225 *34946069C556EA5C79D6C73F227BBE96B15980A0 ZRQRHRSOED
515,155,226 *349377954D30AC74B50E549C89F63A0BC1BEFE92 lgrm
515,155,227 *34959676B34BBD3CEC35D9F956DB8CEABA4F0F18 ZWIRNERKORPUS
515,155,228 *3490BC58DD4AF7215AF0879940874E74D4026BE1 [email protected]
515,155,229 *34946A60F764AABAB0C4F4D1D0748C177832C13D [email protected]
515,155,230 *349CCFCE34C0F633A121099540F85889C29D9BF7 [email protected]
515,155,231 *3495992FD22ED6BD26C588F36E1685686953C048 zero's memory
515,155,232 *34930A7AD964C922C50A924DEFD91A4A2725948A Z!}H
515,155,233 *349FF5DB248B1B928698A5D57B8C590A110D9A45 LISAJJ
515,155,234 *34900DE06022B6BFCBD3FFB346F36BE723F1207A ДОИССЛЕДОВАНИЕ
515,155,235 *34929D9FA29A5E156C5948D4703919920F3283CE žiliaĩ
515,155,236 *349A2964F4E272B7C4423F3F2DC554B802813ACC мисирука
515,155,237 *34907E477DA1618D986671247B0802B4006C447D НЕСИСА
515,155,238 *34974427FCFD20733C09B89192C99E9FD7B45B33 LORENZO.STULTS
515,155,239 *3498829FC4711C9D8E6E8E293EB31DD4F414B7CA ZXR750
515,155,240 *349ABFF5C2D4D8B0251AAF072AFA4804879F09A7 LOWELL.PORTLOCK
515,155,241 *34903C67B21EDC991B124448CBB308923D4FE2EE ΟΣΤΙΚΟΎΣ
515,155,242 *3497CC4D518AFF0D0F8C5D9BF5E00602F17452A8 τεγεάτου
515,155,243 *349A9AB4D00CD7E6D5445AD42753833CD42416A4 СААМІ
515,155,244 *349231532E1EB9B78883FCC1667BD2BDC198EDFA СТРЪСВАЛИТЕ
515,155,245 *3494CD700666E59870A6D2F110C3E3486DE21C3B «ТЕЛЕФОНУЄ
515,155,246 *349C8059E7C958553E77C57C13A3752DEA664709 LUIS.MASCARO
515,155,247 *349EFF111AE6BE63D3FA616934E17FFBA5E8F293 LUJEANNE7
515,155,248 *3498D2810B43A76F1B004D1CFA0FEC32A77E7FBB ЧАКАЩА
515,155,249 *3495896FD93C5FDE61FCC0A46E5CEC1051A781F3 [email protected]
515,155,250 *349261A526B3D8A00654491387379DDF1186F704 „зорлу
515,155,251 *349C19E8355D917E81A15A83790FDBFDB19F033F [email protected]
515,155,252 *349D62FD04AFF2A725175E59503BFDC94CBEE127 ly3?
515,155,253 *34990627C8ADCAD77E4B33EF3CBE4070CB64400D lyndonmcwherter
515,155,254 *3499BD9C9D6968EC4CDAA37D15ECFB0908411607 ЉУБИЋИ
515,155,255 *3498F0466E3237F0E48B80BF649B50503F999224  作曲:川村栄二 歌:BYUE
515,155,256 *349C053918985DE13EBD56B99FC23BA74C2C3476 ТРAДИЦИОНAЛНОГ
515,155,257 *349EF0F8F52C4E3B86F85D5261BBA3F67B65A828 に勝ちaリーグに昇格
515,155,258 *3495B25ED36D5AA7B64B3240DC5AEC08663A6546 [email protected]
515,155,259 *349A91225A75928ADFB03D84BCE31BC7D69B33D4 MARIANO GAV
515,155,260 *349AC83F6119172E9C0EFE82D4E80D413073DEA3 markrivero
515,155,261 *3493B220A25F55C4D65A9DC08D767056B639C6EA marno1
515,155,262 *349D06960C4C9DB16DE8C359F915EF7F0E1486CA MAXBOSTOW
515,155,263 *349394ADEF23FA1F202AAAF7955D6187F2F11B1B MAX.HERGERT
515,155,264 *349CD013FAD8064BADA56B641BFF83D538F940CD MB(C
515,155,265 *3490C88A49943905E697D8479AB538C377085C91 METALIBSW
515,155,266 *349841F1B3E8D28975E5D209DAC3466E1D485197 METALLITAVARAN
515,155,267 *34975FD243FD50570081E306081E036DB4FF6DCB MIGTUB
515,155,268 *3492A31A670A2DA7BE6ECE5F9F35461DB90FFD2F 父親の「兵隊王」フリードリヒ・ヴィルヘルム1世は、「娘は他人にくれてやらねばならない(„mädchen
515,155,269 *349B7A9B96C1A22EB6E633181BC6206C6E8D1094 [email protected]
515,155,270 *34987A574FBB2FE2C853CFFC2D4D7B75283C5ED1 MOHAMED.CHILCOTT
515,155,271 *349A7296D62F4B678BE6B78328A8D6DE5899AC39 mohamedhottes
515,155,272 *349BB1CF9AF3EC5F95D30DB07A0D0942A1E23DF8 MONITORI…
515,155,273 *3491B0399B7557D80B26244D9B3367691291FB22 MONOSIO9
515,155,274 *349405A3651D6CA73F417EF837B3500F3162B86B monroeezzell
515,155,275 *34926C028DD9ABA70983DD4AEA9CA26CEA1942F5 MORPHOTONEMIC8
515,155,276 *34968C83B9A0BC5D7CC3602D397686446FE44F2A MOSE.GATTEN
515,155,277 *34909D8812768E647BC7B36C9D8039425B8B34DA MOSES.ASCHENBACH
515,155,278 *3493BA4C0C7C6B354EF5A98E3641AB32AB79C8D1 053JORDON
515,155,279 *349BAEB362C007A923E6A8896654BA663AD9F84F 06271945
515,155,280 *34951E46EA67FB943FFF5F2BD6AA3302073A6D11 [email protected]
515,155,281 *349CF08DF9EB11DDFB66D3C0445960770BF3D69F myermian
515,155,282 *349699C09818BF8ABE30184EE24DACF9F0EECC7E [email protected]+I0N
515,155,283 *349BC3C9F5D5B58F5C52A947367D162CA75AF1CA 11-entziehungsanstalt
515,155,284 *349E0C8293CCDFEB0D3EF79E8D0D0DF862D85A65 11-MUTTERSPRACHEN
515,155,285 *34954003437B9BDAD32785EDB8F8DC9B19BB0B5D NAGEWAS?
515,155,286 *34988D13F2A7105EDDC265710A1895A8F88546F2 nayowee
515,155,287 *3491055C3F5C0DE995747E0CA41186B698DCCA7C 1635242 ONE THING HE WANTED WAS A RACIALLY MIXED CREW
515,155,288 *349A624021EFF022C896F35344FD1F4B7E70AA41 1024185 PAKETOITUJEN TUOTTEIDEN K
515,155,289 *349F1BD5D4CC5B81A0D6DFCBB3ADF4D52ADDD797 NEIGUNGS4
515,155,290 *3494C44475307A8BE90347A7BB302892EAF54A33 10 ALISMASI
515,155,291 *349D582C70274EB46F9932E7F855E747C0320B6F 1917EPASSE
515,155,292 *349A4C6BECC3792DF374326EA09CACE0AE86F0D1 nesting.ground
515,155,293 *3498052FAC2A7008010B6C5541E275DE38657607 NICAEWORC
515,155,294 *34905D5F719978537D9B668C992E2A5455759A7A 1 ASIATISCH-PAZIFISCHE-REGION
515,155,295 *3496196ED5AE4877BE5B51D72C6FC9F46C24BF78 13-11-1171
515,155,296 *3498C343180DEBE4991E107B85254304CC741AF0 NIEUSUNIĘCI
515,155,297 *349A02071AE9B0B4B45B7EE36E5C4703D3754907 nigellisenbee
515,155,298 *3493525F006A1DDF68548EAB338D0F0FA8A4DEAC 1biotekniikkakeskuksia
515,155,299 *34960713A11C7767A0BA4CDD0C6C2985645916EB 1BIZARRAS
515,155,300 *349603CF66D57909416987F2D5DBE078FD2CC201 1414892 uebertroffen-aber-wurde-er-noch-von-thomas-helmer-.
515,155,301 *34960D7A9C03C95AB981FC6E00E4908DE70F1850 1 BRETZINGPEREZ
515,155,302 *34980F95DDE81957148E04535E9EFA185FC64416 1bse-problematik
515,155,303 *3498A4C316025D8775FC1901791332731A67AAE0 1carbolxylol
515,155,304 *349168EDA84D9C07E6E2987B0DA90D8696F27B49 1CITAMILC
515,155,305 *3491E5ECD1D78D3AE988E603825DC8665795EC05 NISREENSAMI
515,155,306 *3492F847AC5921350E9B4CF158DABAEE9A6A13CA NIVOLINI6
515,155,307 *3497EB706E7E1E185FA2535D25DAA41DC01E7035 15-EM-TV
515,155,308 *3498FF8C31D384F706E1AF87F989AF5C0E24DA3B 1.DIRECTORLED
515,155,309 *3499ABF46C5482962D9795AE4727E30796EEE692 nnel-rundweg
515,155,310 *34903F4E406DEF04330B8787D2B0A9F0CDCC2A31 noahhackford
515,155,311 *3490CCD978034B767B7EA4E0A44BB552E1F0B1D8 167909 TYYLIK
515,155,312 *349F9224F5CA6E6AEDFDD96875CE7961D774176D noelsaller
515,155,313 *3497BE53985E57EC01ACC872D8E060E554FBDAA7 1727993 KOVALEVYT-TYHJENNET
515,155,314 *3492D986D3EAFA65226B97F4E669E78696296ED7 1 GAHOURIN
515,155,315 *34937E31747139C610C4858FAB0C85718DB91EC2 1-GESAMTARBEITSVERTRAGLICH
515,155,316 *34910E26E4321CBAC142F28C022DF1FF0DB9B7A0 NORMAND.RAUHE
515,155,317 *3490321B76292098C6E45ABCB0AC6EA6E1F49616 1 HOFFNUNGSFUENKCHEN
515,155,318 *34990B862605CAFBF9F89E294282C262B4C363FE 1-allergeenispesifisen
515,155,319 *34961192F94F4F434FEE722846BFF4486492EE29 1INKASSOBUEROS
515,155,320 *3495AD50A2B08114EEC9AA19135CDF43FF8FA512 [email protected]
515,155,321 *349F1E48E216575ED09DDAF90B1741717B984F0A [email protected]
515,155,322 *3494AC9B0E07CAF042F5376B606F59AB561926D1 NUMBERS.BLASINGAME
515,155,323 *349C1FB03E78B3BC7190D836DA381D15122C5D86 numberscarpentier
515,155,324 *3495544F3438014DC237BA29C7386D20E64E049F 1.KATOAMISTIETO
515,155,325 *349709273297FFB80D28257A9E4768D0897AC896 1kattaamiseen
515,155,326 *349ECFE1ED49EA46138B860FCAA3A5079691A515 1bestandsverzeichnis
515,155,327 *34962EF54CA5F697301A2FDE9B50F1EBDFFD908C 1 KOSMETIIKKADIREKTIIVIST
515,155,328 *3499EBC1314E99FC352775E7287D6A46732C672F 1.LEGRAN
515,155,329 *34964AFC3F200B32A7849AC39F1822267251DC0E [email protected]
515,155,330 *349AD0A1E6FE0528D1E66BA7258DDDE8C6E537B3 OBLAWNY
515,155,331 *349707FF7DE0B80EF71DEB8CFB61FBEDB0B1CE33 1MASRYBACKED
515,155,332 *349B25C4D6502F965E3045C450A912DB28A73510 1mccanles
515,155,333 *349A24EDFC62F4A54FF4902F00A48DDFB2B95476 1EGDONIN
515,155,334 *34978099B4E6D155D88A38EE67049D4BE1DE1357 1mycenter0
515,155,335 *34947626490E0A69E66D04616C61809738828268 1ODPYCHAC
515,155,336 *34907D44874D2434E7B4AE5CD0738B1D7C837148 1OHHOH:IIRO
515,155,337 *349A22854C88FD2DDF80E47D60FD7B0EBFC51781 OKSENUK
515,155,338 *349A5267030129AE61F0868661DDEB439A1DBACE OLIVER.ORSO
515,155,339 *3494E27710182F4ADD1CECD11674E0E3FE0F4878 1 RACINBIKE
515,155,340 *349FD983D7CD1E9BA47F12003FBB6D2EE27F0A63 1.radtalent
515,155,341 *349519DFD37A5BB5CC54C7CC1CF7DD302D25B264 1.HYVINVOINTI-OHJELMILLE
515,155,342 *349C30D7F8A7D5083C6680745EAD5B014E368633 OMRIELBAZ
515,155,343 *349E244E62F256C5C0DAE26C8888147403DBA035 1ILOVERUSH1
515,155,344 *349964B534A560CAD4D3E4D99B8B5C3231F5E6B8 ONEPDR
515,155,345 *349371CC967E636E092786DF56E23268E97E4CEB o>< o~o~ (8
515,155,346 *3492D1F8A41A3D61D984476343E635CAC7A66477 [email protected]
515,155,347 *349DCDB10AA5014EAFDF4375D6FDF28EA6A9B096 1 MADISAON
515,155,348 *349CC214E520A493A74C72B69A950C1A42A7A0B9 ORVAL.GREENWALL
515,155,349 *349BE28EB2CF799D2E707DE179D31E64D1C32DB0 1.VAISALAAN
515,155,350 *3498B8AC541FB85E6D4DF6399128006A1B52BAAC OSIRISMS3
515,155,351 *34955FEDAFE309E0202736E0AFD26C6BCECB26A2 1 WTO-SOPIMUKSET
515,155,352 *34921D7FA003B9DF3F92AB413395F0ABEACA9EAB OTNEVNOCS
515,155,353 *349B203952B79F4978F71127256A9720F894F6CB OTO\\IZA
515,155,354 *349E9ED9E0A2D07C9E996B05466F6DAECFF7CC13 OVOSOMNES(STELLA(1560-1635)
515,155,355 *34908529D3BF4F97146CD89DF9946B69C1B392A2 1 riordansimon
515,155,356 *3492D8BDD84E481F5875AE9CB190D56DD499D8D9 1 RISIKOABKLAERUNG
515,155,357 *349EFF366198880EBC6BD23683A03AC952A1F237 2218269 SUOMESTA.JA.RUOTSISTA.EI.LOISTA.OLE.TAVATTU..
515,155,358 *349A04AC2C9D714D4D6BCBB9178F9F01151C4CA5 PABLOSURGEON
515,155,359 *3498E6472412C67312F58F2A1F5B29CFD5D67E80 PACKFONG4
515,155,360 *349E30086BF61B7EEB446A69B55DE73989BE5FD6 1ureticilere
515,155,361 *3490B4FF33C9A605057BB1962E8D04B149AEAAB5 1vaalivaatimuslistan
515,155,362 *3497737974DEF936E0845555FB3D35ABEC878003 1-v'e
515,155,363 *349A965FDEEC6B08755E2B6EA4E6B075C8238A7B paso.yobai.paraguay
515,155,364 *3491A7E1D353F09B2F58384DED346A4604E2D20F patrickashby
515,155,365 *349E3C058C6E9C96E7A522979BD61CE31F6BF688 205907 OMISTAJAT.JA.MUUT.SIDOSRYHM
515,155,366 *349C1AFBCF8F2DCE976FE7445386C61A0DE7CC53 PCZV
515,155,367 *349B2BE04DA530C575B43C0741BF6C50D5CE90B0 2414830 the firm expects its firstever positive cash flow
515,155,368 *349F120560855F6CD1A1879D7B0576E2F6F37B1C [email protected]
515,155,369 *34900E58B7FC7BFB5289AB430D3E754041E38902 PETIT TESTAMENT
515,155,370 *349A547972F10D968BB9708752E75F87F2477C90 PETRUŠIĆ
515,155,371 *349E2FE379A9B66B34FA18CA0E812BC5634B99B8 [email protected]
515,155,372 *349C11C892889ACCA8F01984189044D80F541494 PHILEHRMAN
515,155,373 *3492C0C93E259830F4956AAA6FE4C6BD3D7C845F 26051004
515,155,374 *34996AB5327D1D30ED862516DCF6072F4AF7DE4E PHITZGES
515,155,375 *349B4B95672DF57E8681ED113738254BA047B32B PIANOSONATANO1INFMINOR,OP2NO1:IIIMENUETTOANDTRIO(ALLEGRETTO)
515,155,376 *3494544A44881C24331ECB7903FE7F7113897F15 PICCOLOTHEATRE
515,155,377 *3490D485BC4B5CE78DBEA23D514A316ECF70336A 287334 "-we're-taking-cabbage-patch-back-to-its-heritage--"
515,155,378 *34926739DA3C067118791D42E1F93FF2AB31744C 2 stromstraenge
515,155,379 *349F7462BF3D8109B89C39829109F46AE8899B07 2ALPABZUG
515,155,380 *3494069E279AEF502658EF7374B20B0680277FC2 pivihres
515,155,381 *34978D20B4A6CE2ECF2B9C9A7EA06580071F99E1 [email protected]
515,155,382 *34978AC6CA4CB75224CCEBC065BB2065F3336CC0 [email protected]
515,155,383 *3491F1BB2017EE42E196A3242B9D8F92BD4CFE03 PLAJTY
515,155,384 *34953F52F238580C062922C669ACB119B77A84DD 2DENSASSI
515,155,385 *34956335D9D49463A4C511AA022EC5782BECD9EC 2DETUOGAR
515,155,386 *349E90BB9F1D47F867BED77BE419BDB2BD32C93D [email protected]
515,155,387 *34983B47676E7BB62FECEF00B08AA9BAE27D0A0D 313c+rom49n3+5m
515,155,388 *3490FFBEEC5450F58213D60F49B82F23EECC9E3C 32 KOULUTUSKESKUKSEEN
515,155,389 *34911AB66B0F240421F988C34286ADE1EBCAC3D7 32SPANTRAG
515,155,390 *349C758C0F1E0CE2FC9F8DEA90CF3CE2669E95C9 2 GENISLEYICI
515,155,391 *349120258CFDE5322089B5D03BDBDDE185347F22 pluselli4
515,155,392 *3498ED94D65EF32BBBAF8E7AD7C695DDAF708D5E PoormanAffair
515,155,393 *349E1EEA85C79DAB721254F1EDD4E57B78073FAB [email protected]~o {x}
515,155,394 *34916F8C5497B650E1F23E417873E67219F4C551 363nathaly
515,155,395 *3492E81C448222E6B59426D643344CEBA490CE2D 3==B*SPLAT
515,155,396 *34992225798A1F743F0ABB0BBC0F58DBF5351035 PRINZEZITALARISS
515,155,397 *349E2C8AB48BEA515B3EBBB678EDE29FBE4C377E PRODUKTORE
515,155,398 *3493D05E0A0CCE54BC9423B04CAA4DA7CCB74054 [email protected]*-*Splat!!
515,155,399 *349C32430F0C903158DB13A307D5C75EC67F6EA3 3.ruy
515,155,400 *3491C5C4BF9CAEA12418C836B815E5DD2AD38D97 3> ~ `SPLAT
515,155,401 *349AB3C18D71768A779670825AA921FB553B6CB3 p$ychodyn4mic
515,155,402 *34934C073DF59C1F65E2BD4F91ECD27F5C476FFC q###@*-(~_^)
515,155,403 *34985C5B582877EEB290D4865A48C4991C7FD0B5 482167 AVOINNA16128,MUULLOINSOPIMUKSENMUKAAN
515,155,404 *349E793BFA94F9887A669708A12915277BF7F1E7 4PRSFLRD
515,155,405 *3492DBAF458A5EF660B3070EEEC67B6C44F9C995 Q8TCS8
515,155,406 *349CAD665D7B949AC9CE3FB4A7C9A39F1F109C5D 4TGNSPRKT
515,155,407 *34918FF57ED1E146DEA73CAC20E66F34365DEE8E [email protected]
515,155,408 *34909600F997AC13B414F11E86EE92473B91F70D [email protected]
515,155,409 *34908D4805B62641CCD68C517BC5ACCE15953197 4INFORMATIONSINDSATSE
515,155,410 *3499740FF7EE3324F8A1E4BD52E43B1D4B7F604A 4VIDEODECEMBER
515,155,411 *349C3C28BFD54131DEDD671DB0676694A701B7EC 4JGESTORT
515,155,412 *349B54140828F5ECB729B483B06B07B0F5891D1F q=)~O~o}O{
515,155,413 *3497DED9E97D7240F31C45F29FF4849BF8FFEB52 Q------P ~0 ~OSPLAT!
515,155,414 *349D9E6CA8E4149C3CDB4A6EE0A79574B63C7D63 4 LESCAUT
515,155,415 *34959241C745B2634E69C67F26FEF73FBD285625 Q---P`~-`~->-B0
515,155,416 *34986C8E682752B3C623F01CD105A2366527C62D qp ~ ~{x}
515,155,417 *3493B341CE8D5A2A77194500650894287EBDBDE2 591915 die-hirten-muessen-den-verkehr-selbst-blockieren-.
515,155,418 *3490019717E62FB256F5906F57A71EEF34F5E054 quetzalcool
515,155,419 *349018E9CF667B067AE666D7C0E0A443E0C2F33B R_,"
515,155,420 *349C3351D12B4520020836F673CFCE6EAD41BAD5 4SLGTSNAVNES
515,155,421 *3493479DE592D6D6894B00BD8C19E9DECC838D6E 5CPARTYCOMP109
515,155,422 *349C1213AF2E961C4B6E86C60A5AAA1402537485 5DIEBRADN
515,155,423 *349ACA766803C0A6E3FF58254E876BD903AB046B 4VIOLETSSSSSS
515,155,424 *349405BF09BE08FA46437D19BC939144DD5FD3B7 4WESTMES
515,155,425 *349F46D106391955524C1E960B1A5F2EF6A13FEE RACCOGLIENDOLE
515,155,426 *34913954C6AE83A941105C926FFD5821E3018765 590AZUL
515,155,427 *349B0E19E2BC4F74CFB3AFC8C50A24C7443749D0 5AEHENDEM
515,155,428 *3496D8178AB78CFF2775008F11320895A5BD1BBE 5iluvmmouse
515,155,429 *34976ED9486678A181B272F64B76519E4C787CC0 5BENZINBLANDING
515,155,430 *34903299DA83EA2DD3FE45A794C42581FF8FBC84 5BSWALVADORBSW
515,155,431 *34922846EB9869DDA3DC2B37F3952C252DE62B16 ram-kam
515,155,432 *349656049810DAE61428DEB235B80DF222AE9F5B 5CONTEMPERATUR
515,155,433 *3498800045E4D6D631D96E5D5D301A2A1C7A5CB6 5LLENNAHE
515,155,434 *3495D766480235F1D5605171E554FE32878D8D85 5MOOSEDIGITAL
515,155,435 *349017CBD69779E42BD4D0A0AFEDDC5325C24F92 RANDYLUBAHN
515,155,436 *3491FDD7B506894D5317CB9CA77033F9356DF69B 5NITAIDAR
515,155,437 *3497E3C3B1FD81FE530768C596C6E550538C8F89 5OLVETTA
515,155,438 *349D784471CB0F2CB925E4FAD73C9F76172D57A0 5FOTBALOVYCH
515,155,439 *349CD9BD94919FA0A76A6A532C46B83CE0E93E0D RAUNCLEE
515,155,440 *3499AB111A96C9990D4316D381170A44B8B87405 5PUHNUTE
515,155,441 *3490D969BA2A2F1C6ADD5E58ADD2CD0D78E52E90 rdnerga3
515,155,442 *34968F906E5CF756CCBAB9182AD9331E8F40D303 5ilovemaster13
515,155,443 *349DC46564BFF6402973E6AE61E38468F0CCBE83 receptorrich
515,155,444 *3499FED1945B2149F8E2D7DDEC312AD68939A56E 5UNSTRATIFIEDA
515,155,445 *3497985FCA77E369D549ECA1EBC2EE296E52DE50 REGARNISSONS
515,155,446 *3492546056C73A0C309D05B48ED65B2C390FE33D 659076 LIS
515,155,447 *34923874DF4A329A6C7108E72A8A0513C2DE45B0 5TLESFEEW
515,155,448 *3496C066BA3978807C9E321E0C2924427550CBFC 6ACHERTE
515,155,449 *34949BF0000CC00946A91C1BCE24E5341919A43F 5VOORTGEDUWDEN
515,155,450 *3490DFF7EE503C88D1B8C5E594AFC9F1942A996E 6BSWCCSPQBSW
515,155,451 *349482E156B8294CB5E025A1F1461439B3826C13 6DECOLLATORS
515,155,452 *349555687C02F0D04FFB9904CB3B2E2593901B0F REMEMBERSKINNY
515,155,453 *349F6C6438D8FF086832CC4D8A4F6A42E0EEFA95 6ETIEDAJ
515,155,454 *3490F0673D8C5F652FD745CB38A0252FD0A36A0E 6ETRAUMTE
515,155,455 *349A5763A8BC029A06F0FE9B02F79E32FA77FDD9 RENATO.WESOLICK
515,155,456 *349D897487A4ECA15C0BEF3303A8C65A21835162 renstark hits 2000 (disc 1)
515,155,457 *34940E5F88ACC9213AE8BF1858C5AA42C5821B6B RESEITENEFFEKTFREI1
515,155,458 *3497254DE087A322963BFEC1D5980370B42C46C8 resi9ners
515,155,459 *34908857C7BF71A770867BA9AA6774F53E090232 647072 sn...baSkan.:.benim.adIm.musa.kazIm.buhurcu..
515,155,460 *349600E945D707901AA2E668DCE026F4E8E8E7FE 6JANEBERNIE
515,155,461 *349AD180104911157478811B7953ADAAC73F3889 695596 minun.ei.kannata.ylist
515,155,462 *34905FC679CF0EB6DD8FC42A2C840495E02F4C45 6MEUNIREA
515,155,463 *34931D97C7E8F21C452AA1C3C9E8C2EBC9030166 reubenshoun
515,155,464 *349AEE9FB1EEF1A7C552030925F84A1BB78B8778 REVE1A7!ON$
515,155,465 *3499AAD23E33EA3D5A0DC0A6A28B434D9EF6CCBA 6AUTOLIIKENNE
515,155,466 *3497C2B9A3B9D50EC8A34D866D3D60701B8107E0 reyeshalen
515,155,467 *349277A16EF69443B2E9C8328781ED44BD2A9A40 REY.MEKONIS
515,155,468 *3495DDDB15B31618544AEF1213229D84A234C7BE 6REUKLOZERS
515,155,469 *349D097269EF19D9B6018C72509F0FCD12C3CBC2 RHICHALYNL
515,155,470 *349518C3B9F39D29B278B07CE7EDD3586688D0B3 6valsesvenezueliennes5angostura
515,155,471 *349750EBAD8511375293D184D82386C606799138 707019 bucevapbakanlIk'taSaSkInlIkyarattI.
515,155,472 *349D118FC631E6E2C2797B597B7DE0A15845459F 6LADYBUGGRETCHEN
515,155,473 *3493C9993BE7B3EFCCF960F782947498C3C356A8 6LECHTILOSTI
515,155,474 *349EE751116D6906B81C867534C479BF7212F182 6NEGNIDEEM
515,155,475 *3490E1E0CD687C7DB392A2369A4313EC7203970B r<j3
515,155,476 *349E0DF02EF2BD7BE69575860AEC0BC34C33B3B7 7FARCETTAN
515,155,477 *3498F38298EC4E523F3B250A3CAB89CE60DF4EC4 rn2nsy3bjts
515,155,478 *349DFEF72E7ADFB180294784F5ED328B421D728E 7iluvfender1
515,155,479 *349586BB953636AEB9813C2587415CC98EA9B7FB 7MUSIKNAVNE
515,155,480 *34910949BAE47A9753527D451AE85C99D1E0A7CC ROBOT'$
515,155,481 *34914223E8E8F0277AAA97FE46F21D27CC321663 7SELLIAE
515,155,482 *34914773636F92A4FA8F5E346FE4D270579FE4AF 7SUODOYMORCA
515,155,483 *349F8D6FD54CFF9DD2C48C543EECDD33EF5E6C94 rodrickpash
515,155,484 *3494D5C47FB4DD1242220692AD3028BA5A1C4275 rolling stock / starlight express
515,155,485 *349A4E5DBAF1B1A99653379B7B5BBBC73F94AA91 ROSS.HILLESLAND
515,155,486 *349E0F83CBE5F73036DAC9047730AF5639B627F0 7THYMOMATA
515,155,487 *349E3B8FA3DEFC8BBD62070C39C57341C18D3358 ROZA BEKELE
515,155,488 *3493ADA76AD545B4DC11E8D962BAA219E4A2D600 RP-C
515,155,489 *3490BF7A37F6D9BBD7F46513203A9616F2137886 RUDOLFJIMENO
515,155,490 *349A9DAAAD91993DCEDC99D7CFC254F52F04574F RUDYAAMODT
515,155,491 *3495EACEEBAA64735252FF12A3CF47DADD2465F7 RUEBEN.FRIESENHAHN
515,155,492 *349C2E476FFCB02C94DF19A25C6A47D75471E352 RUEBEN.OLER
515,155,493 *3491A6BCBEA334ADC66755129925DD5748841613 RUFUS.HRABOVSKY
515,155,494 *349668D0ACEEE838D43B873B0EDA7F260AD372EF 7HILFIGERHILFIGER
515,155,495 *34948915C065E03EE36B936665572F19DE17156A RUN-THE-ROAD,-VOLUME-2
515,155,496 *34951B5C6A9036D0736171E659707ED98DA922E1 8ARRANGIAMO
515,155,497 *3491D9B007AB849EB546ADEFA63C00043C0AB4A3 7PAUPERDO
515,155,498 *349F13EA8DFA9DBE729F829185DF0C6D7F938ADD RYAN.MORSBERGER
515,155,499 *3496C21A6B2F5E9EA83C3E781C39D4EE5A51B825 7RAQUELKOKO
515,155,500 *3490F46CE32E1C6F2DB9145AFDD45434B4F6C0B5 @$7RO8!OLO9!$7$
515,155,501 *349188EA4E93320AB2D05E5EFAB77E9966224D4D 8CHRISTIASHOTGUN
515,155,502 *349D0C484FA88F3B9FEE6BDCEE2EC487B68810D4 S1ACC1AMO
515,155,503 *3493B0F25EB36196F736CF7F7C3810FE6CD31D32 S3FK4N
515,155,504 *349B839FFCC50CCA615E31827919A4672E647793 7SMUTTIERS
515,155,505 *34972FF94FED015A05F3BBB4695BDB17A7E1DC96 SAERDNAS
515,155,506 *34994FC7AC0F4E80CABBB1B21C84E9A5A484BB1E 841813 DIEEHRENAMTLICHENFUERCHTENUMSSEELISCHEWOHL
515,155,507 *349C28923DD18129F46CAFB788B3A0F65DFC52A1 salvatorefrigon
515,155,508 *349BD38E0FC6B269EFAE6444A853DC2136212B52 SAMCLARK1
515,155,509 *349BB0350CAF39905565EFDC1BAFFD176CF4D67B 8AND!7S
515,155,510 *34996D8AE4AE2FC88A276D1534ABB5A5FD5F42D9 SANDSTEDET
515,155,511 *349AACF2D73405D6E0EB9776841187E0EAAAEF30 sanel-velic
515,155,512 *349CE92ADBD0CC093AF881FA091476B2C62843FF SANFORMERIO
515,155,513 *34972C7EA8A7F6FC2E545D9E574091363B9ADD7C santolaub
515,155,514 *34945186ADBFB715921DDCAF574358CA7981FE82 santosschwanz
515,155,515 *3490E699FA1F3C1F7DA415F32E161D80555A9B80 [email protected]
515,155,516 *34933A789E8F6BD9F34ADD5838BBD76001EC8E60 SASKIAMACING
515,155,517 *349465B06CE99FF6B77F2343EDE688371BC29B92 S!BL
515,155,518 *3496FA9E6A643E3246F647A8004F474562CB3F7F SCHODER 2 0
515,155,519 *3490FEDC88AD0CFFBB369B33DD68F681F5C004E9 8====B ~O~o splat
515,155,520 *349339C43FAEA01CD0F6C66CB6192B0931F59408 8bullshit5
515,155,521 *3491790BBFC781AF4CFA45F5724322F3F32D692D 8TAXOGRAFOI
515,155,522 *349ADB37B20E014B942C15D755384558399180F1 8dork9
515,155,523 *349EB1FF1F45E2403E464AB3523DEF00FD3EF7B0 8ENJARCIARA
515,155,524 *3495297CA0494877BD311A1FFDD70C0089C7B24D 8.vermittelter
515,155,525 *3496562EEAD795905196CBB9FF3D273156113F55 SECRETBLUEBIRD7
515,155,526 *3497BB93497B8C305298133768EDDFE177A2DB33 8ZOPHAR
515,155,527 *34975755C64738C51F1EEAB242A838F44EC41A58 908913 deri.infeksiyonlarinda.iyilesme.meydana.gelebilir..
515,155,528 *3499791D91F9526AB7C76E110FC60185DFF5AA0B 91 VOITAVAN
515,155,529 *349D693EE4CD2CC2DFEDD13A7CC41725F51D25B3 SEISUOLA5
515,155,530 *349093F3955FC508854EA9228E960028AE7259EC 8GENAZINOS
515,155,531 *349E4ED05865E595F2B93BE3F67E012DF29F1D70 975660 VASTAAJIEN-KOMMENTEISSA-TULI-ESIIN-VIRKAMIESTEN-KYLL
515,155,532 *34957EC4A4D76FFBEBFD6EE7EDBBFEDD5530E5ED SEMIOFFICIALA7
515,155,533 *3499EB245863FB34BC7619AC082356F5BEDAA8F9 8MYK
515,155,534 *3496FBBC2A119D64614BE6A1D90324FAC39BFF09 SERGIODETTORI
515,155,535 *349DA356ACD9E4D7D267D444EBDB7BCD378A46F5 8PARSEMANT
515,155,536 *3498394E4231EEE73EF04843EEA0CBC18B2D6E6A 9GREKOKATOLIKAMI
515,155,537 *34926E21F372B0EDBD5334F4529B667F7BC93035 SHAHIDA AWAN
515,155,538 *34982AC671410C23D992C4FE12520FD7A9A0D4DE 9INTELLECTUALIZEDS
515,155,539 *3491A966115EA8144CCBA5E1157A2AF588B116EF SHAMSUZZAMAN NAYEM
515,155,540 *349B7BFFF0A9A99B0D09D23A0F7F828F0AB216D1 9.ONNETTOMUUSTAPAUKSISSA
515,155,541 *3496F5C0F410B6FBA0D1316D3C82B14959F5388D shannonbelloli
515,155,542 *349B54B7EFF6EF129894792716A5611A4A0730C3 9TROMBARONO
515,155,543 *3498E45BF4346FC31511D9F060A270A03FC1638A 972136 tuotteita.k
515,155,544 *349290D2B1303AC2B820B58E824AFDA0379A5526 997MNB
515,155,545 *349A7700B566EC129D71075450036824EA0EFB05 9CAGUI
515,155,546 *34931346B980E489E93636A1872C7103EE675394 a1sdm
515,155,547 *349554FCE652CC1396636614CA09B7C2F9C74C72 9KOZITSU
515,155,548 *349433163791C3D81389866209142BEDD65D91B9 9PARADOXURINES
515,155,549 *349CA9A206A69CCA19365BB0E114993CEDE8789C 9PELMANISM
515,155,550 *349FD2050457EC1D00A5C95B5DBD0DEBAA6ECBFD A3AACHEN
515,155,551 *34967B8DE51DBBD042B5FEF8CD4FFB3E6067A5C1 a4khf
515,155,552 *349A7B5D8E35582E0B5E5CE07C6ABD0B8C39BD29 A5pP
515,155,553 *34978010968AA10CB54680D8311D04763FC9CB98 a1+=5
515,155,554 *349EB04F7DF70C70E1AF5711C2BEC44F878A5FE6 A9jc
515,155,555 *349916E013CD1EF87B0A605CA2184B434A18F8D1 aab"&f
515,155,556 *349DBCD6426EEB168608F32B8EAEFBBCEF1A85AE a8z%g
515,155,557 *349CF0ED9C56A7D799E2B671FF749EAE395E5CBF AAA>5*
515,155,558 *3498E8454B9AB5D3EA121CB9D75811C1667AF12A sky---Hussvala
515,155,559 *3496C9A01AFC6E74D7E23D5B46FA9591EFD2059A sleep,-baby,-don't-cry:-carib-song-sleep
515,155,560 *3496C6D710B539BAC2A06A264F7E8EBEBD8B8C57 SMILETHING
515,155,561 *3498F3B341BE94535161BD220D9668054080B8FF ABBUCHENED0
515,155,562 *349F6019B5C85DBEACB503E350CC225660777C9D ABCDAVID4
515,155,563 *3494FB0A17A284BD044A778DA96283BB8C473C53 aaneengebracht!
515,155,564 *34912E16B9565A28DAFE753E6AC12E013D5881D9 ACILOIHT
515,155,565 *3492CB518F4D7315907234BDAD2233B8D8B608FA A?CM7
515,155,566 *34941E30297D78591EFD0A9ED8B01B53DB4E6C7C SORAAI-(2005-12-11-VERSION)
515,155,567 *349E169565F9329AE6F9DD855C1534D52422312D adaptiranje
515,155,568 *349BD86480468EF581209EBD69DB764150950459 AB^V_
515,155,569 *34905A43A6737D7EEC76D0D242E416E0FFF11EF7 ADL-
515,155,570 *349E7568EB17BA1DBEE946D1C37C6A14FF057CCE admiral.of.the.fleet
515,155,571 *349A5890938DC53B2819A2560AD2DDF5FF9AA59F ACHXP
515,155,572 *3490912B3837E169DC0424CEAD0294F8971B773B SPIRITS-(LIGHTS-OUT-MIX)
515,155,573 *349C50FB96DF1BCB0CB3CD0E55897AA423CB3164 splat!~`-~`-<======p
515,155,574 *349F4ED5B701268A98A9BBAEE43BDB6681B186DF af,q
515,155,575 *3492A53F29E1D876A430B3D9A136F59B5AEC2C82 ADRIAN.SCHOEMAN
515,155,576 *349C52CCBC19B8DD2F87985F7AC44A57A3FA3A01 AFVIGEND4
515,155,577 *349CAF7E1E98AD70A43DF464FAC1CC153EE93799 AEU
515,155,578 *349FE9345EDC0E4A881B2BEA47ADDAF2040892AB st5964
515,155,579 *3499250571F5C1C9E342EE15FC0D94DAFFAB909F stanleydworaczyk
515,155,580 *3491BB028754785EAACA1EFBFE666EBC78275320 agpzz
515,155,581 *34907E524E3569590692CFA2CFECAB36B342058F AIRIMAS8
515,155,582 *3491AF5A11BBE7D8A469C20C2419D58F73191576 AHWCI
515,155,583 *3495F577A0BD15988279186A4805AB3DDC2F976A AITHNIDH5
515,155,584 *349C5DE333AAF9845CA140CB07F791037FF8EAC3 aktk&
515,155,585 *34944AD988FEAD7F7F7577F22400748F8D578437 A+/L
515,155,586 *3497A0DA155DFB5CEA6B40650638CCF3977676BA STRATCOWBOY0
515,155,587 *3498F812E7ACADCC035BAF3C8FBFE09D91A8E471 [email protected]
515,155,588 *34935BD2D650BA05CDFC6375993A545EFBE63720 ALFONSOPERNICE
515,155,589 *3498E533A485AF699A4786DC5DA0C699673686F9 SUBORDERSES1
515,155,590 *34969F70D61B29B0ED1B0DA772BD52D4E49FE555 ALLAJITL
515,155,591 *349409C2D2E806900A8590C6D9F806CC88A039B0 al.lw
515,155,592 *349289AC20A94DAA72A3E9C786BE1DE0BFEC805A Surprise,.Surprise,.Surprise
515,155,593 *3496F2178F0A17011A1D08150001D23F4C44CCB0 SUSP3ND3RLHO
515,155,594 *349B191EBE3253FD096CC271B175C064C5346F16 ALLTHEDAYSOFMYLIFE
515,155,595 *349A59DEA9BE103B040954B34C73349F95B6059C SW0RD S3R
515,155,596 *34905F985C3F6D21DB05376DC98D7546A70C583C ALPHONSOGANIRON
515,155,597 *349C90A61DC9725396126795EFD67E29373493F2 SWTPINAY92
515,155,598 *34918AF1FA47CAEBAE74896E5A1D88A419D32593 SYDNEYGUTKIN
515,155,599 *3494D2D0A348F215E33D5ED82668C3DCB10F9A09 SYDNEY.SHURMAN
515,155,600 *349C2F817EEA9B91C2BEF66580B9E23409E87745 AMALLAH9
515,155,601 *3497DC409305A15F047DCF5260D0BC5BBEBAAFAB ameodeb6
515,155,602 *34961D8FDA54626B9FE24018D6B805EE3B96A6E6 amg,
515,155,603 *349612B80ED72677339CD452965924F8F768AE65 ANALOGICALLY A:
515,155,604 *3495F39E60F081B997FD7BECF2CE517AF81D3403 ANDJELKOVIC-DUSAN
515,155,605 *3499571FE8E41EA2DE773E9B4FB899C38585C738 ANASTASIACHEN
515,155,606 *3499AAADCD942F0BAC1A2D10107407B82EB2E34A TANIAPEARCE
515,155,607 *349D684C611607E8422E7A0BD5347E2C8AB38F7C ane$7he$olo9e$
515,155,608 *349DAC73BA4048933428496B06DE9A9C9301961E andresetherington
515,155,609 *349C6F90EEA8798B8A3B3A2699A72B509042A70A AnfK
515,155,610 *34922EF9AAFB099D6AEBF75A07533AE423A085FA ANGELIAKURNIAWAN
515,155,611 *349DFA5FB3A94EAF791C56C92897685A7787A3F4 angelo.almonte
515,155,612 *349C5ABF8134F01610FFB71CD46BAFD943387703 THATSUNRISE29
515,155,613 *3491E035D277762A59277278DCA7C79F9EE90469 ANYANYELVEMRO
515,155,614 *349613476F78F298BB11680DB0367B2A725A3EF9 ANSCRITS8
515,155,615 *3495695B9D3BBE1BB89C4868C8C88352F3522056 ANSERINA8
515,155,616 *349B3EB750D41E8D223785DAFFD73CDDDA85AA67 THEMOSTRECENTEVOLUTIONOFMUTHAFUSTICUSMODERNUSTICUS
515,155,617 *34903C4DFC740E44B57009630505A81D20F23CA9 THE-REEPZ
515,155,618 *3494C482FEC0F384BBCD28562D39669CC84970B9 anuradhatrivedi
515,155,619 *34991DD00585BAE67D066E32F878A05738591E79 Ap$
515,155,620 *3499CB95E6CB2BAFA9B9EC1C32B95691F77CC07A APPALACHIANSPRING[EXCERPT]
515,155,621 *349B2615072BCDA5BAFC967B681346266EBE2F10 AQIOJ
515,155,622 *349D23E33BC3C3FBC5075E145F99B920462CDC91 TIM-MCKEAGE
515,155,623 *3498726483BF3F3F11D1052AABE816A1B84CCDD8 TIMO.AHMED
515,155,624 *349E38F29F363D3AB10D611F82C7AA1A9B1FE26C AR8AA
515,155,625 *349404EF5BD362AB0B970A4460F356E5FDA23A55 are.halfopen...Still...His.face.peaceful.
515,155,626 *3494F7F54EDE76DF132C2F5856E4B8F8C9A7A427 aria{
515,155,627 *349141171C599ED342DB576211BD96978372B6A2 tnorfer9
515,155,628 *349D49209F791C2151706EBFD235F71B24A4B3DD TODDMCCOLLISTER
515,155,629 *349A60D137EB23438932C1BBB0D1B0DE8D81A9E5 TOLBUKHIN 13 0
515,155,630 *349E1E1D1A082C516817B216F4770486814C0526 ARTIFICIAL-PAIN
515,155,631 *3495C5603AF618D0E963C4E56D4A82AC70A5A9DE a:rta
515,155,632 *349EC55DC23C8E20B47AD817943CBEC3F9F61943 AŞAĞIULUBAHÇE
515,155,633 *3499B960B221B2EB17F65E029B46CB0FE3098D53 ASDFTIME9
515,155,634 *349D331617EC5A22A9F41A66DF5012E85DDB1C28 TONY.STALL
515,155,635 *349851F04C4D41159994A8086C1C7D5EE5D5469D TOPHERSOFTBALL5
515,155,636 *3494F56620EFA3EA3F241E1D455C73699278EFC5 ASPHYXIATE333
515,155,637 *34956A6246D75721C7CF5BE70DCCDB2E072C9B9F TORY.BENDIXEN
515,155,638 *349472C1B33A0F5244E83E8D45EF9A1F23A5DFE9 ATD4S
515,155,639 *349F6244B192C9BACB4FE052139FB6DD37B9705C athicketed
515,155,640 *349A85E43DC93CF9FFFFD98746B9D0943866CA20 ATIRENEJ
515,155,641 *349122701174035A1F747DA2A6AEEB4D12318D27 TRAWESTOWAC9
515,155,642 *349E82D98303D970D06AE3D0105AB1665D693483 TRENTONLEV
515,155,643 *349F580A7B2DFB9B893B6875760409449F97F05D triciayee
515,155,644 *3493B038EF9B10A81D433420F9F3ED70D320074E trogradera5
515,155,645 *3496B98628358F80CBD43EE42DE71B1D2C1D2933 troubove9
515,155,646 *349E70AE40B4910218617F308F960C34B76C7446 AUW+T
515,155,647 *349F93D126A85A28B90CEB79642B22435DEACB39 AUSTIN.SPECCHIO
515,155,648 *349223C341A29F554ABE6077693D43648B91912E AUSVIRHE3
515,155,649 *3495C1F3DD8D9096F115C8BA166985C873EFC62D A!UWT
515,155,650 *349C2605F1097900C902C97C724C4FF3D4E62FE9 AVA.BLANKENSHIP
515,155,651 *349538E7A1EA65F6D0197BB9AC4F5A044B6CB1BB aw3;?
515,155,652 *3490B83C33029814F45E9C6213E7DA26D404DB97 AWAYBOOT5
515,155,653 *3496C542B9B442457459B1D6C5815E22854B3FF3 twenty-times
515,155,654 *3495FC022587CE6130B9744DE1B3CFB39257EF06 awog0
515,155,655 *3490124B6282945C7BF56E63EC640E32A898386F azl
515,155,656 *349382B92FEF48E34766FA8B9E6DFD1A6D9456B6 B00=C
515,155,657 *349B3EAB5244A3A813E5625D6B5F558F542FEBAF b,1i;
515,155,658 *3494C24E2FC8F6FBA9A9550305994D657D61BADA b5z14
515,155,659 *3497F12D950665C8D3F5E98C33B1CC828ED2A341 B2ELL
515,155,660 *349392B511CD9B81971033EF918590F36A57203E b3!m,
515,155,661 *349A0209E964B8EF65AFC3C7E6D233390943874F uitgespreid
515,155,662 *34960A9EAE886E9F4B082DEAB387D69D4FEF20F8 b8gle
515,155,663 *349ED3E4267EC07961DDF4A778E92653FCA63D39 b6"fr
515,155,664 *34916DEE14FBFB59C61178D1FB83BB97CDCF40DF Bach.Sonata.Nr.1.C-Moll
515,155,665 *34979DC76194FB344192D80E97744E6278ADB135 [email protected]$entmndedne$$
515,155,666 *3492E9545C16253735126AF0B50401979836CE35 UNCONTORTED5
515,155,667 *34949C050FD767FC7A64ADFC0E6CA1664F2695B0 ungetum4
515,155,668 *3492F074D6F0A303D1E6378B69FF77AAE69B4399 unjudicia11y
515,155,669 *3490315784DCE62581D0E8923E03D87FF0B9FB79 Unreducibly
515,155,670 *3499295DE2353F15BD4FC35A3859768A4E229F6C UOYCIZIH4
515,155,671 *349A249A5D14A174D018E33B414529818909B36E [email protected]
515,155,672 *34945E05328E593FE8954B0E8327EF49E5BA8895 ba&qf
515,155,673 *3494FF87B39D0396BE694AC0405E2A12DEA26427 USMAN SAJID
515,155,674 *3498D85FC145FE5811FBDEC6881849419DF7C979 USMAN-SAJID
515,155,675 *349E4E56CEF526510F698DB5FE975C26776B058D /usr/src/linux-headers-2632-24/include/linux/unaligned/packed_structh
515,155,676 *3496473BB7B7D8510D485A41FF91C6A186E7DE21 BATHING.HUT
515,155,677 *349F698171F44D1188C7207AA6E5FDE647853164 BBB:R
515,155,678 *34902EAA08545476A0EFB4767A5550CD1A242373 vahniragu-tanushri
515,155,679 *349106D52D4E011E95E83AFE7CA46FC2C6A54A65 b#####d ~>b0
515,155,680 *3496667E7C33E69F2D62EB8287048322B1592B01 BDDUD9F
515,155,681 *34903D03CEAD1D7E582840E800A2D947601ADEBD B&D"J
515,155,682 *34912E5A4E0E3A247FCD89FA2DDD8D667E57E58C bc0x:
515,155,683 *349E3CA12AA74483D0A8DA43BDF3C447BD994C25 VALYOOOO
515,155,684 *349113B187A8E9970B32A6ED4DB137E8E423F967 VANESSA.QUALIANA
515,155,685 *349BB1A2A62ADA9807ABB46F77AF631CD6C2DE13 bed!
515,155,686 *349F652438B53F810B3B137AB8092BBD4EA5508C VENTONLY
515,155,687 *34948172397D1B603CF22DB34CC5DF1D1F7AABDE beccasienne
515,155,688 *349E88F72358EB93C93F0F94078A0EC90DB058D0 BECKY KUNZ
515,155,689 *3493565B7AFDAEFF8883960DE0127523328182AA BEDARFSVARIANTE
515,155,690 *34977D148B14A807AC0F71C1C117126CBD751A20 BENTONMCKAUGHAN
515,155,691 *34991AF259DEAFBC55F96310245215160B4F26CF BERGOCHES
515,155,692 *349692FE2FA6C124C8BC6CA842D3618CF581795E bernardharsha
515,155,693 *3498223A4F3606A65C43D35E5D26A2CC18DABD98 VERONICADARAJATI
515,155,694 *3493DCFE4C64D0EECD1120ACD10E8E7481370DB4 veronique.carpiaux
515,155,695 *349903ACDD8FD5E4512351A20CAFA6470A80ACED berniesacks
515,155,696 *34912EF0FF174B59F2DF165234EA75E704C8470A VERZENDCONDITIES1
515,155,697 *34919924567CC2516D1385BBE269C9CF00F50A70 [email protected]
515,155,698 *349532DBC76B5D4E90F3B785CD224D59A5977CA7 BeStill(God'sLullaby)
515,155,699 *349B88FE6EF72AC71B50B8306B7887B30B6EAE10 benitohieatt
515,155,700 *3491212F392A8C07EFC2D3E28E980F1904AF1BCB Bf$D
515,155,701 *34955AE3BAE9A36E29AAF186B094BD984CEA745C VICKYSBDC
515,155,702 *349074B1CED51FE09A3BFEF5CEFF48899678C961 BG1JQ
515,155,703 *349CCBEF5DAAA100D3D8553784B0C0453591DAE5 B#HPA
515,155,704 *349AD1A1B23BFC5B1E2F91654B684C8593C9DF16 bia;.
515,155,705 *349B0948AA3ED5768B32AF3BD5A3AD1CA6816E9B billie-guinnessforme
515,155,706 *349E8ED714CFF839C39EFE5F265C4778F4176DB9 [email protected]
515,155,707 *349BAF5616A888495EA60650819CD522CB69A1E7 BKRGP
515,155,708 *3495E59F8BFEE177CDBF80294AD9D988755FF2FA bluedrinkbbs
515,155,709 *34992A762B45772ED769EB9E4DE0DC0D7B83BE0D [email protected]
515,155,710 *34963E240F779418821A477B0A137945F54D1A40 WARD.ALARIO
515,155,711 *34966F1763D0A6071AC1F7D39C7246281D56096C b.maf
515,155,712 *349350CC27C805E9B55111921DDFF1E907218508 bmukl
515,155,713 *349C47FAF202879D5144ECD1A6254C277DA25A16 bonebreaker's
515,155,714 *3493E19FB35E615426D71FACF4DE50EBFD87B3F5 boogie.all.the.way
515,155,715 *34981818EDC51D5759A021FF88673EA5097ACD78 B##>~O~oSplat!!
515,155,716 *34964CA30526C0C379788A79BEA2045C61419B11 BORISMIKROT
515,155,717 *349FC8D6FD7984BDCEC3A759FB0FD88783DD6D05 WERNER.KADLUBOWSKI
515,155,718 *349CAF9A858E721CF833B4F13716C1BDF4BE6208 bosanicu4
515,155,719 *3490E29D466995FCF9B706EF63B36B0D0DF37AAA bow;,
515,155,720 *34959E33AABE37B3275EF8DBE45BA2E3F0EE3F65 B==P~O~O)0(
515,155,721 *3494CF41DA2C7ADF5AEBE7CC0122F37EE75494E2 WIJKERBRUG
515,155,722 *349B123A0ACF142B0F0291DFDDA3F657EA679628 bpmr?
515,155,723 *34954F8EF57F7463F49A26738EDCC43A31B0B89C breeringged
515,155,724 *3490F2EBF8B7CEC283E29484A369C72D45E185C9 brentonbultron
515,155,725 *34977D7870305A085C0F0236FFCF88153B371FCF BRENTON.HOVI
515,155,726 *34957C60E01A54F97F0A3B0EEADBBBE88540A27A BRENT.TIDWELL
515,155,727 *349B8A0A098F91866354E9D90B01A2D8923D4F46 BQUH-
515,155,728 *349776325F582173BED2120A7F37166A3436D23D BRADFORDAUTERY
515,155,729 *349E4DE790D53A283FAF263D91382AB724BB9D3D BRIANSIMKO
515,155,730 *3490029252C517DB27ADF10D715EAE675B9676F4 william-obeng-opoku
515,155,731 *34917816A69349E25D99596B9BC24701A3DFE11B bradykulow
515,155,732 *349D3D9DD542BD04C3D338AD953466F1ACE3224A BRITTANY53
515,155,733 *3491B593552F4795037A74204C6E8D7FC0260854 williantear
515,155,734 *3496A49606943B4B790F07E9A8D2CB3A7038B03C WILLISTUTEN
515,155,735 *349DE37F32CB2520EE41B4D1210405C802E038F3 brucelatta
515,155,736 *349C3232F194DD3AA9724F5274ECF4A2EFC619CA WINSTONFILGO
515,155,737 *3498892ED682BD65A832FB78CDD7C38F9C876D27 WINSTON.PAGLIARO
515,155,738 *34937CE88EB72899529C4D767357D89BAC236CF9 wire-shock
515,155,739 *349D5EC004885B7140B077011F51A53771CA9B7D BSNB
515,155,740 *349C2B39D87AB15A6740E71AA38003B2315C4DC9 bswtwwbsw
515,155,741 *349C48F9D29791ED436FC041306B587A6ACE4946 BSWWOODCHUK
515,155,742 *3496A172FA6305078FCC7CC9B294C43027B36235 BRSHARK
515,155,743 *349A6CAFEA668F02BA3F35ED4464E786EF615C66 WSGLEDIEM
515,155,744 *349D16D24EA887D186FD81AD5F7B12A1539AF2F2 WSXQAZ3279
515,155,745 *3495C1D733A17AFC2FD4A91855125588016F77AD b$t$t
515,155,746 *3497D414A40CFFA9F10C5D6998EDF731B31E3B1D budhouseworth
515,155,747 *349A3F4E71B2451C45AA58573D3D14C9A77B3CED budthreadgill
515,155,748 *3496FAE8EEEB47091A5EC01BB195BCB8DF8E34DA [email protected]
515,155,749 *34927826D9F01F053C2005C8CFA9ED3C8F14FF61 bu&qs
515,155,750 *34957F0FC29A0700F1F3E53739D523A815457CB5 bswkernkebsw
515,155,751 *34919573C5CDAE9AF04273221679851B0759E27D BUTCHTY
515,155,752 *34931C4E6B18FE32945342BCCB7F5413F507AB0C buttheadteachers
515,155,753 *34966B350DF040615B3F420053CF140F817BAA8F BVDFZ
515,155,754 *349A32123EFC1F70586603BA632C6FDD54DFA9E8 bu!dc
515,155,755 *3490C8F7004156DD61A602FD1BA05F99A2FC459D BURL.SWARTWOUT
515,155,756 *349422A1ADA0AF0977F1522DFBE3EA5312038ED1 BURTON.WOOLDRIDGE
515,155,757 *3494D61143EFD03D96EA0369B2B402087EC38A94 c0n5crpted
515,155,758 *349AEE63370F157000E9596E94E88342D18F9586 bv4r&
515,155,759 *349EFBACD95C7EEDB952EC781F7CB6F71AE79D38 }x{o~0~q###p
515,155,760 *34967BBF448EC7F3FBE42B21E882DC352F810F45 C3MVU
515,155,761 *34925A93E44CBFCCDFF0AB83E4F418E590E59D4F c4$fb
515,155,762 *349CD85ADBFE21D202767CED4352361DDF330BE5 C4,RL
515,155,763 *349E3F8608D77B701637261F96D9E9276051BF27 C1Fv
515,155,764 *34956BA15DEF13BCA2F052BD37FB28A23881D926 yankeefy.
515,155,765 *34906C7D40C819DAE8F38E7E52F8B6F65D8AD07B C4SU417I3S
515,155,766 *34948D6145E17921A9424E3A59ADBCBA9392B4C6 C5#U"
515,155,767 *349FFB669418559716CDD2706A4B9E7A1039F0DE C8?T
515,155,768 *349D8E7D3858EA8FA0DDC79D9C4269C1B0C0B5D8 [email protected]
515,155,769 *349C7DC3D3C0E580E0F735E82E0F47F5A692F525 calvinselzer
515,155,770 *3492A9A2B83624090D3F0B84B28B19FD43D47B80 CALEISHAP
515,155,771 *349588C866E2BD94E49AC9C05D38DDAB80AB45A5 camoghe9
515,155,772 *3495996D1D78C1DE91BA8EB2EB6450879FC4191A Yoko-Ono/Heart-of-Glass
515,155,773 *349E724C88806E230D64A203D69AA98FECC64C20 [email protected]
515,155,774 *3493C440B847976694A6C0A204F0EC5439DF8A48 YOLLY-MACEDA
515,155,775 *3497D579E22C46F07490B01227897FA5740192AF caquetoires5
515,155,776 *3499053EF9CC7ACFC219EE125F11996732C0A153 YOUSSIEF-MORAD
515,155,777 *349C63BDB42F54A7D5B78C8387181D4265D2F7C3 CARL.UMPHREY
515,155,778 *3492C65149BC8D72D06B9BB45559F8D316BC98C0 YREVNOCS
515,155,779 *3491C197BC5DF7BE9A3C85C85A1BBE6F69254DB9 YTIROIRP1
515,155,780 *3491D8442E5469DF02363D0A4C55B8DD67FED438 YUANJOYN
515,155,781 *349D494DA9647FE0B25EA91309DC9FF1F078606C CASASCO3
515,155,782 *3499B4737A531A42C66CF8FA1164CFCF2B2C4C92 Z7070
515,155,783 *349C255D855D73EC9AA6D989DCE24C768AE3835B ZACHERYSTARRATT
515,155,784 *3493E402DF50004E4067C4EA136F95005AA28C3F C-BMI
515,155,785 *3496CB2BE8E967037C9F23FFE3A745C4EFCBEDA9 CCOMMO
515,155,786 *349F3C8C7740464B9824961001B17590A348145D zdpi
515,155,787 *34924BC8AF70A6FADB0226F49E6DA3AB6B0412B3 zerercna8
515,155,788 *3494F86E69A424B47839E6ABFFCCD4277EFC0951 [email protected]
515,155,789 *34948FB0B485FD584AD1C113C9F523B26921239F c_e2q
515,155,790 *34978A346AAA68D13C0DE6FA613DC4F552FDDEA6 Chant-de-moisson
515,155,791 *349206C67112B2A7DAC31029C96F649BEB041A6D CHARLEYARNETTE
515,155,792 *3491B62428D2B74408901AE99A1EFCB00CD446B4 c)f:"
515,155,793 *3497BAE5732DED39A358217DD47DD3D7C974221D CHELYDOREO
515,155,794 *34920956C83B1FAA4530F5CC7ECE61311893B99B [email protected]
515,155,795 *3494F3F37BE6CCEB14A628BEB265AD69477488F8 [email protected]
515,155,796 *349D496215BE780919B58DEE2FA74D2F65467E4C chesterortmann
515,155,797 *3493880D461B0AF04DEA91F27EC90D07320387D3 CHE-VILLAFUERTE
515,155,798 *349C86B15EAC72F84F646A386CF8AC7C82518F76 CHANCE.TRAVER
515,155,799 *34968ACE01D8FBF338E0CD3D46640568A1B1018B ZONIEMENDIOLA
515,155,800 *349E854EDCDF29BD6AEC45458EC7EB40B95E9541 CHANDIDAST
515,155,801 *349482E1D0AD99B6C8F4D57B2E9E875F536F9036 chmanismed
515,155,802 *349888E1CE3A56C47FA1843F0EC30F28AA7825ED CHMAS
515,155,803 *349970B4186406528D70ABDB25E280878E16FAAD charity-hopes-to-lift-world-war-ii-fighter-plane-from-sea
515,155,804 *349A945A441298D0AA0F06A7B1E5C3462314856F [email protected]
515,155,805 *34932F7E24D2799D00620F4E6B700B9D3023BE73 christinespadafora
515,155,806 *3496D33296D9E1893293EEF444407DF8369B3106 CHRISTIRODEN
515,155,807 *349A437F48D38CE335AF23B732BD18A86A95FCA5 CHAS.BUMPS
515,155,808 *349820FAF9E2C772EE63BB9584082FE00ECD2B51 ZZZ111Z
515,155,809 *349DFE80B9D8D73D02A499E6944B4BA3232B06E4 chavibet1
515,155,810 *349057AD72B3532BC0E9AA14A507E0A6EABEEDDC АДАМЫҢДЫН
515,155,811 *3498714D864DF64A91291153CAB9308CA914BED4 АНТИТЕЛО
515,155,812 *34933D3FDA07FF46057DC4A557D175C3E32DBCD9 [email protected]
515,155,813 *349196FE51D7641814A30AA90ABD7DF46014E693 C)IVU
515,155,814 *349BE9577EBADC6C01F8BC452577C11AAB2D6721 chmw&
515,155,815 *34948D976FC7C18665DB676F4532EBC6BD7C70F3 CHRISFIELDING
515,155,816 *3493FEE17B5B7E4C373D1CB057E681BF2AC47506 CLEVELAND.SUDDRETH
515,155,817 *349E698846ED7B153D6E51AFC4996519A98A64EA clevelandswarm
515,155,818 *34956700E4C0FAFFEE4EFFF1A0DB1CE8CCC34E9B CLIFFLAPRARIE
515,155,819 *349C18A8DF77C5261B1DF4B209256E5E714FBE64 ПРИМИТИВНЫЕ
515,155,820 *349EF9BC42AE1CE2F4DF526C7718D89786D7E655 CLOSER (FEAT. DENISE CLARK)
515,155,821 *3498F5F2832C58EC5AF07DA6E68128E7176757BA стэнсон
515,155,822 *3491500F5438D35BC2360F29E27729F7314922BD [email protected]
515,155,823 *349C879C3A2E9C002F411AB9EFF77CA802790F2F clementekearsey
515,155,824 *349226D80314A4152BFB9DE805E17CF64A438697 CLIFTONLAFONTANT
515,155,825 *349AED77BBDAAD47FA72C1C9A40A26823C9A411E clinometrical2
515,155,826 *349FDB8C5B8E3CD57129EB09B080B474A4E9E563 conradborke
515,155,827 *34905CB6077C63709A5C22A8CC1AFF2FBD79D6EE CM0R6
515,155,828 *3499837864915C03B7638C967613AF2BBB835EAF CM#AC
515,155,829 *3494AF0F1E1A78D97C949E7F77B439C9EC7F6680 cm/gx
515,155,830 *349478BC279578C048D7865EAD6BF5459535D503 CMVVR
515,155,831 *3499BCD1D8E6AF0475A2581AC853BDBC6A9FA479 CODE.ETERNITY
515,155,832 *3490BBFA8679DA61BDF30165CF5A619DAAADC598 cqfv7
515,155,833 *349ECB8727C7343A496E15F31655BAA0B58385E3 CROMIÈRE”
515,155,834 *34951C391DD1458B3951603D6147DD0D5A312B74 CORADARRYLA
515,155,835 *3492F33F3005A772D9190DF9C5C91CFE53CCD590 CORDELINAP
515,155,836 *349C4D6ED84FC9ED04E6AFB250C53079CECC79E8 COREAGE4
515,155,837 *34923A015F67151F877B7E5C19D0BDAB27597186 護於jimmy君。—
515,155,838 *349856A0A9EE1FEA7438BB49A6B7C06CE0135B8A cub3s
515,155,839 *349043C21C174093D12044DEAA6AAF0D10844279 [email protected]
515,155,840 *34913B1D7A293FDB87957DC32093D86B7C620365 c:\program-files\microsoft-sdks\windows\v6.0a\include\gl
515,155,841 *34998D94A9A5C39D31A4F9B7A5D44DD3F05330A5 c:\programfiles\microsoftvisualstudio9.0\common7\ide\microsoft.visualstudio.qualitytools.wizard.testprojectwizards.dll
515,155,842 *3496F75ABFDB2E8134F5F318C4101AFA47F4A672 CRISTIANVIORELNASTASE
515,155,843 *349F1618FD4ADC90195BEC2637530270A0C06635 CR_OT
515,155,844 *349416236223D265B593BA39128CC7DFE454A929 cub";
515,155,845 *34992DB2BB32A82C99D739FF8C571467C6C3C529 14-09-1704
515,155,846 *34967B2AEC2467BA2BC7989F9C26D5333BFF5B6B 1494227 VORSTANDSVORSITZENDERDERWALTERBAUAG.
515,155,847 *3491498255F9F7CD1FFDAA86B3ECE45DC3F5F98B danging
515,155,848 *34921CC77D284FDFE8C1B8FFA5FD4AC13BAD65B4 danialseki
515,155,849 *3499D4EB88C32D411F47D67D8612A6C9B8E0AF96 DANIEL.CARIOSCIA
515,155,850 *349EE5E6B43CAA2779176120ADCC930C6DDF9F84 DANIELKLASS
515,155,851 *349434310594FB1612B3941AC176329A2A37512C D)3L
515,155,852 *3490535F6F567EA0A9FCE02CB825F6575E4775BB D4;KD
515,155,853 *349ADCED905DF521038FC0D3D08AD4271E976313 DAVID-ABRIL
515,155,854 *349A66533D4D6EE4E6584DC273986E47682322E4 d50o(
515,155,855 *3494705527C22C1364EE2782388D2F20E526E8E0 D6O-
515,155,856 *3490CB6C67EFF7A2676181F8B3EA7CBA4CD701E3 D8DK
515,155,857 *349DDD5BCA3A21C26E449A8DD7F3A3FCFB7A6215 [email protected]
515,155,858 *3499017384BA46B3C70B3147E36A58F7F52DE731 damiansturino
515,155,859 *349785EBA13BFE5A45C6273F623C4174FF453591 dana.abd
515,155,860 *349472DDC1F0EADEF19A4239C8C883A804387856 dani.rahmawati
515,155,861 *3493B74E7776043360FD4AB05AC9BC0C96D1F1DE daoek
515,155,862 *3491573D14233B8A3F1E0A84643E18ACA006FBA7 1APARICIOCHAMBERLIN
515,155,863 *349C1175A04A4E8C56AAD4D806BEE4E519C79606 1BILKIS1
515,155,864 *349999042642F91836232083AE25E5576B85C075 1-BRAEUTLICH
515,155,865 *3492790F9F6F718141542E87A17DDAA2E3E8258E 1 dedionboutonrennwagen
515,155,866 *3493D37AF3B37D737897FE4F5272DED2F94BA64A 1FEEBLYRUNNING
515,155,867 *349F2EEBF63E81E07DDBD5A5FCCE1469F7E97CBF DEF1AGRA+!0NS
515,155,868 *349709FC8E23D8C4C165F5A41509B96B52452563 1kaappaamia
515,155,869 *3494EEF0B4C36490C52D45318EBEDA87C548F9D1 1.MULTAN
515,155,870 *34957A9635E6624D94870FA36D453A28C173F0A4 DENOMATORS
515,155,871 *349CFA702D3F238E6777EF2D18E1D7C2C5B2A7F4 denominates?
515,155,872 *34994432440D4916BB491D94E02186F97F4924BA denverholts
515,155,873 *349C21E164C2A3C3A7101D5D918B0AFAECFC6CDD DEON.CYRULIK
515,155,874 *34930C072258C0F147905429DFD1DA05F455EC50 derdoppelstern
515,155,875 *349203FDF2F6D12129A4E78A0C2C3C7075D05F4C derail$
515,155,876 *349B68E8C8443A717A1AB192410480207665D255 d:f%a
515,155,877 *34941AED95958ABAB2A615BEDE5828E4765ED09F [email protected]
515,155,878 *349BB7C2EECF20B7122C466D3369B3F6082E56A0 DHUIZING
515,155,879 *3492C335BBAE2A7A9D1652DA549F4EE4152BF2E0 dhyvd
515,155,880 *349BEF64C3A868E35330120B102E648D185A5D27 DIABATA1
515,155,881 *349626A7BF9DDDFDD2A942EBC93CF8C41CE55584 DIARIO-DE-UNA-VIOLACI
515,155,882 *349AD2CBA5C9AED07C7CE1B606641BC12DA0CF41 diegoepley
515,155,883 *34988A6E10D3E8A13860F978694E4BB695674FC2 DIDDLE2K
515,155,884 *349F2D1EE5E8EE9B66AFB4FB04039C4FEEA41C4A DIENSTREGELING1
515,155,885 *349058EA3EACED5D0E1742B2DD71771327719C67 2335633 kaarlo.ajatteli.,.ett
515,155,886 *34951CFF6796F8779317BF56613505D125D1EB4D DIPLÓPODOS
515,155,887 *349467842AC8B28066620BACB136E8DDE0B8A712 DISCONNECTIONS0
515,155,888 *349320826DC445FA81973D39C2E8B254FAE11599 dissetando4
515,155,889 *3499544BB19B4A2C25042212B40328C1058A5EF4 disseisied
515,155,890 *3497B4EE8DA2D03E3E33984CF6332415C6978F49 DISSONANTJ
515,155,891 *34950F745BA79B8D888700A5F92856BB48B27F0D DISTORE3
515,155,892 *349AC8CA63F2B637B39645E047DB7DC52EDA5D87 D"$IV
515,155,893 *349E9E33FDB637813DE43E07EAF405B6E1964C70 d%jkw
515,155,894 *3498575F1051878A0285299D959C27C49FD28992 2965363 meid
515,155,895 *349C3812CF2BD97BC001C7B15540E736FB78B120 do-0%
515,155,896 *3491BF7FDFDD355D01E380538B328B329E287E16 DODELINERIEZ
515,155,897 *349732CCF1E94920037814A6F6DE1A526ABA9331 DODFS
515,155,898 *34971CF10AEF3152CBD091EEFE582A5318EC0C59 DOMINICK.IENCO
515,155,899 *349EB3845C5BD19B1A89F8545B28E2C391CDD6F0 DON.COCKEY
515,155,900 *34900ECB0BA63AB1207AF1819448B9BCBD006964 DONDERENED
515,155,901 *349693D7093D4EF780B1B97B1EBDA70B726AF63C DOPEE-PAR-L-ANNONCE-D-UN-PLAN-DE-SOUTIEN-LA-BOURSE-FRANCAISE-EST-EN-NETTE-HAUSSE
515,155,902 *34912FF1B4FAF098D1FD72D52294B7BD2052A89D DORSEY.STOLIKER
515,155,903 *34976971F6591DCFD1B216D2FC743AFD19D34FBE DOUGLASSDERIZZIO
515,155,904 *349E593603C4BFF15C822D0B6D4BB8077EEF7587 2TURBINLERDE
515,155,905 *349D1C15B2CF8D11EC25FC806222CD1DA51A59C5 drambuie0
515,155,906 *3497BE400E8ADC633CDA22267B81E80542153483 4AHUKALLE
515,155,907 *34913F7F236226C53038F75CAD31B7B2CBE7F6D5 dt9pg
515,155,908 *349E26E1D5FC51DFC5615736922E70996B023779 DWAYNE.COLLETTE
515,155,909 *349927C5608428F61B6AEDB763D7D035D258E3BC DXJA:
515,155,910 *34984344B25BD6F91E4598130FA9ACBA7266864C [email protected]
515,155,911 *34908AFE30DB526FC53F8770763BD54F07A0AA22 D.WON
515,155,912 *3493E8CAC70B1C6D9EA80841CD307253D9C5429C 532500 madde.60-.bu.kanun.neSri.tarihinden.itibaren.mer'idir..
515,155,913 *349BB91B07ED17142A9EB65C15226811BE314D56 ECSINROFING
515,155,914 *349F3457B8D89602FC38F6D43CD6A8E8C3CD1BF3 [email protected]
515,155,915 *3490FF0CDEFF1952DCF7209E0CD2AFBE89070153 EDEDIUID
515,155,916 *349A30F949284BD0EB650788CC895697344C271A EA(TJ
515,155,917 *3492741BBE08A7FDA26004DD4C69D138AEF91726 Edgar:ActIII."Requiemaeternam"(Ragazzi,Popolani)
515,155,918 *349CD40151C7E221624B34AF2AB5E644A1A7C13F EB1XP
515,155,919 *3498C2CEB0A7B7F571461BA3EB8988EA8676D6F1 EDENVILLANUEVA
515,155,920 *349B0C733831CF37ECE6F02F8F18065D0D85CDC2 edgarclaros
515,155,921 *349C609F0BD720349127EC43E8863252B66397BF 5DUALIST
515,155,922 *3498DC3B2B34A1FDFF727ECB511AC4AEFA2BCB3D EFSIEGEL3
515,155,923 *34949BE46D96AF048C9BF81BA0E0892BCBE37CD4 EDTUO
515,155,924 *3499CCC35BCF8C446D530336AB4C246AACE60A92 eftpk
515,155,925 *3497017D6CE3D6FA992F531116D6DA07EAA562A1 eiretsyh8
515,155,926 *34956C0D1ECC6AAC269CDF074C6B19AAA0AAF5C5 ehb%
515,155,927 *349682C4EC44CA9DB8203677E179F8FF19E58A41 [email protected]
515,155,928 *34973D4E5D908B841FC54337465B573D44A3451C ELEMENTNE
515,155,929 *349FB91E9B9FD24D4858F718EB09D0AA973A17CD EIKAIWAAICHI
515,155,930 *3493F51D90B312CCAE644AFA65C399E85F1A2B01 ELIJAH.CROWN
515,155,931 *34908EA4F8FC14BF3DA4A3B56ADD021608F94C1F eliseozekria
515,155,932 *3494E1A5361AC48C0F9A64D0FDBFF47DD0375034 ELKANNNEL
515,155,933 *34942105D9E7E21597BEFED0C589D0A5FB2D628A ELKRUSHO
515,155,934 *34996DC3AB9A69EF571EB93EEEDF9E99181F5F71 EKS-W
515,155,935 *34978543C6BA03DBFBC5F786006D1B8FEA69822B eldengainey
515,155,936 *3497AFBAB3B6A687286FFF1B10DDD254EBBA9F1F ELECTROGALVANISE7
515,155,937 *349A7C058DA083283BE983DCC168470BEAD4442D 5TRONGVAN
515,155,938 *349BF4046818F4824BC39CB8F359291B1943CE2C ÉLIRA
515,155,939 *349EB052880971A5D0A18C9328D634A88D4E2F74 6ATOMLARININ
515,155,940 *349811DB7708F3B5849FBB90DA4CDEAEC624DBF8 EMMETT.ORTIC
515,155,941 *349DDD26827A373B49F13862FBCBC7193F225970 6BSWGELWICKS
515,155,942 *3491D50114FA592C784F9E9EE108D01F6D84B834 [email protected]
515,155,943 *349BA470BC259AE5705B9120056D5F122C361CFE 6DANNYVELVET
515,155,944 *349C10EAB1956B34A5C59D599582FDE6B4C85821 emg52994
515,155,945 *349FE78353452FC259584213A3C78DEB1570229E EMMANUEL.SEELIG
515,155,946 *349CA1BE3EAA99361993BF3AD9B60D4DCBEF357C ensmusg00000073469
515,155,947 *349E4C2861779A5C7D48D6325178138877745460 ep7omze5
515,155,948 *34955479BBD349623FACF9E8A93C946ABBCA2C5A erickleskovac
515,155,949 *349BAD24E3C476370708B8EC221FDCF02CABE6B8 ERIC-SILVA
515,155,950 *349E2D17727AA603656C3C2F82D7397915AAAB1A ENMSREEHARSHA
515,155,951 *349952CA22FC08C34C2A069BE979BB4301FAB4BC ERIN.CHINICK
515,155,952 *3496F8EAE008029A304DDCB6C74F1B57F7EBF1A5 ENRIQUEBRUNO
515,155,953 *349A7BA863E576B9D6522F744F282F67283D5B63 ERROLMUNYER
515,155,954 *3496C57C27C9579ECA968D6E0FE7D317FB860B87 ER_V
515,155,955 *349850C1D5D7ED7EBBAC445BC9A955E258D5D9EF eo;yw
515,155,956 *349C887D2027BCDAFE4C72CDEBC876511C1469CB 714DD2
515,155,957 *349F117295A1D59D3484EB798CD985EC441AC6A8 731130 ich-bin-halt-trotzdem-krank-geworden-
515,155,958 *34980C5A74C7BA5BA7355D42D1B0E842C94E8041 ERNESTOMCENERY
515,155,959 *349537D70B6ED6708F000E91BC71C6977CB85861 ERNESTPLACKE
515,155,960 *349FED0B22D06E1A4B5FB407AD2589838119B7BC eugeniopedrogo
515,155,961 *349617208B80DFF487ED63079240A52AEF256D13 eugenioreither
515,155,962 *349EE642328F82FC7A61E725F74DB861FD76C658 EUSEBIO.GABARD
515,155,963 *349EA67625E7FC1E96C238378385D137E0DBFC6A EVAN.BURKLE
515,155,964 *3490E595E06F3C25E8A99B3004A43F4228E70338 evatkcor3
515,155,965 *349C2C1ECD082B3C0A4C31B2165D8A51CD62B03C EVERETTETOPPINS
515,155,966 *349784409314B5515D34F8F713CF8BBC942A6D5A EW8{
515,155,967 *349E941445A81EACAC9BF37166038DA9D0BB30BF fadeaway(live)
515,155,968 *349CFC7FCC93086FCA496779F48B82AFD8535E51 7SPEARMANKAER
515,155,969 *3490568990B5C868C85D01CDE529B4D523E2F6B1 のウンジョン、ヒョミン、ソヨン、ジヨンの7人によるプロジェクトシングル『TTL
515,155,970 *349A6DB10BE2231644C8B181B2810B80B91DE958 8891FORD
515,155,971 *349EA25D6638BB9A1227F661BD69E25E745E10F0 8BEARSWILLIAMS
515,155,972 *349B25958E68B8B4BFD98CB77CB76FAE721A49F0 [email protected]
515,155,973 *349F18076881F1E2B251AD8EF035453A28C00466 FECECAMFDRATION
515,155,974 *349AD4443E86A265DA305371ADF8999BE5D4FF44 fEk
515,155,975 *3491CFEC157F967BC8BE409EEA181BF73C699B65 EULENTURMS
515,155,976 *3498E4F9F09E45E87DF380E0F3E8053F15AD2612 [email protected]
515,155,977 *3496648003FD98B82BFA0BFC06F4E46B274E52DD 8KOMNTACIJSKI
515,155,978 *349F625EA4FDA9F470F12DFA69F221163A4AC21D f36677bb4163947fd226c2c67388ae47.artlife
515,155,979 *34941447B2CAC74F6D5CFF532B45FB5A504D2E60 8RHIZOGENES
515,155,980 *34919A7F0723FF89A018F67083F9C944132250A6 finirait?
515,155,981 *3497ED3D3F3B8992EBCEB4CF38EEF68B64A7A273 9AILLETRA
515,155,982 *3493DD0DA53BB11C5879EDB5974B712CA7F8DC62 FIATICORTI2001
515,155,983 *349B2200EC90D10EFF963BB5D23C56FB66596843 fibionhomerai
515,155,984 *3491814815B69FC85A7A384B191937656D7C8D2F franklinguitard
515,155,985 *349FBB1EBF8DEE0DE5A9484C62D770C924E90909 franklynkingsland
515,155,986 *349ECBB7EF888C32D09D4970F456E1D62C5E48F1 FREDERICFLUEGGE
515,155,987 *34951992C13C2A2A0C9B85833913675CAFB9A9DE frederickbeien
515,155,988 *349663A54A9FCB87C1C9483ADCC2CA0A5710CAB0 [email protected]
515,155,989 *3497403B9E88609501C76D6B31C0F393D1E1034E a35v
515,155,990 *349E6FB5A075FC6D314409115947A4803BE51E9A FLEEMPOD
515,155,991 *3494619C50CCD72CA6F01A0D1BF05F048F1ED28E FÖRSTATIDNINGARNA
515,155,992 *3493C5C7C08184C7A97F59BB361840E032A69669 AAB0JJ
515,155,993 *349D6C92CE1F78474218CCC6B68DA189B8FA25CF FRANCESCA472
515,155,994 *3490F4A8477E591E4B607AAEFAD3440A67BCE013 aaBN5
515,155,995 *3490DE801FBAE17C48DFB7B9DDE7F2BDBEC808C9 AAD20S
515,155,996 *349DC8779F85031301E2D6E4784FD6828B1BF354 AARSHYASHR2
515,155,997 *349EAB49A067232E323132366BD1DCAE40C431AB aa[z^
515,155,998 *3497279126589F4AF126400E1D1594CDD6B4165B ABBEJETT
515,155,999 *34916253E9456B6B140D0B54D4A236853FC493F6 gendren6
515,156,000 *349DDA530559FD4CB0754742A9EDDD90FD94E7A1 geneziegenbein
515,156,001 *349BE93BA889A245E46BCC3CB4F7345C9B69B483 a.!c
515,156,002 *34910136FE0BF6896505CEDB271CA199DD698A90 [email protected]
515,156,003 *349CCEBBB3C15F774F8861CD058310A743C02BF9 G457IGH7
515,156,004 *34924D6C583C1709730CFA5CFFDA4586EFB37944 GERARDO'KANE
515,156,005 *349DB6B41BF0533D1DBDCD1B354D80EF94205FD7 ADU1AS+I
515,156,006 *34936BCE2D8B09AC13639C3C36A0D9A89EC61EB0 [email protected]
515,156,007 *349D154CA323C2870619EC34B3B884FD66E5E238 aeropuertodengurahrai
515,156,008 *3499D55C6AB3A67AF324EA6468A8E71884F01A1E gisd
515,156,009 *349AF21A1322FC636AEB3F9AE8B63791D89E1BB5 GEMNN
515,156,010 *349ACFF9138C9186832D28D6B2311D584D4DC7FC GENEVI?
515,156,011 *3492BAC60958D5D384E989E7C4211EBEA5164CCE GMURRUMGGING
515,156,012 *34976086865EC5FF63BC74ADF97B1A3428F31260 GNIPATOE6
515,156,013 *349CE82AE1BCB26612DEC7D5AA76E9ECC5EBF43D AHIYC
515,156,014 *349466B497AF3115126FE7AD6FD4E8134E36D4C3 ah, violetta voi, signor
515,156,015 *349181FA9A7968F5A7B0E7B4EBAB39F0593F09DD g[hg
515,156,016 *34927B2E6EDDEC47129805B8135C08B8FD6C652E aliciadelarocha
515,156,017 *3498E6EA266C5F72FBB33E24B63C8B2CAE2F6729 HANGLAMPEN
515,156,018 *349E68287D8F71FD18C2660D641EE9E755BEA15B hardwareversion4
515,156,019 *349B8AE147D69140EADEFA60144F5A80FCC434BC HAVELSEENWEGS
515,156,020 *34961C6066C353047C73785AE8ABC4E9233F6ABE HELMETSDAVE
515,156,021 *349C14BBAFC7BBBBF7E3BBCE4B5D1C1639B31FB0 [email protected]
515,156,022 *349317139A0193754DC4C7DC55BD40B00D575964 ALLOKSU
515,156,023 *349DCC3A8070D4A2C0332F2ED286AE2AB2E38EB8 HILTON.VALENZA
515,156,024 *3497D60D77BE04E5A6A21B5881DB7951ED18547A HIPERMEGACUANTICUS
515,156,025 *3494B7A5F6C89E4649FBC589112D73D91F9138FC hipolitoritcher
515,156,026 *34914CF876A1A381940FFA6263D4D68F1C93C5AC GLOUCESTER WHATDOTHSHESAY,MYLORDOFBUCKINGHAM?
515,156,027 *3491F23BCD1DB10B5CEA2AA783686A0D85333497 histopathologically7
515,156,028 *34975E16A3F225FE08711950CA9CF79FA4E56243 GNILREMME.1
515,156,029 *3497A60D02065DDBA134FE68BEE3DB2DBA71C4A7 gofers5
515,156,030 *349655B1DC8E95F6938BE95EF44725F7FC2EDC3B AMITAMBOR
515,156,031 *3498F0D8234706E1B03F9D90C2764D516E8BD0B5 HONOR4RI1
515,156,032 *3497B058F4488A7CBF5BE40BF5D6E21CBA640789 [email protected]
515,156,033 *34910FE85ADC1B7C4C6665D7F91F68AEF6F8532E [email protected]
515,156,034 *34919E6BCBB58C38EB5D49FF5D14B3A6884DEC94 AN0MAL!E$
515,156,035 *349CC89402B9C2EF61503F688EB74CDFD0602CAF houthoudende9
515,156,036 *349BB1C7B311C88E9FA7E1AAF916CB07E1C49AFF andrewbua
515,156,037 *34901B4D0F68FDFD81EA73BB85517918FB2EE967 hubertlucksom
515,156,038 *34945EF284AC3A8BAA81C240FA35E2CA5E120096 ANLLÚGASE
515,156,039 *3491C87D0288EC4AD59493B7FFAA4E76C2F5EB72 [email protected]
515,156,040 *3497D1FF003A50E0E2FB1AB52F94B029C3774905 ANOLECRAB7
515,156,041 *349FA6F1664125168AC1A380AA999D144E941C59 GUITIGER!
515,156,042 *349A98D3D5B3D36976A2AC8F6D1DD28A2E5D9FFF h0+3l3rs
515,156,043 *349360CAEE0425A5A0873EB655134DE72F39F634 a$+r08i010gy
515,156,044 *349B6AF9283C57C6ABD57F618E52014AD6F5ED01 ifb$="e"thenn1=69
515,156,045 *349E106F32D9D4CEB46046D8C126932960BABC5B a=rx
515,156,046 *349CE46181B285F44CBB57C0F9EB966BEF4D7EB8 ASHPAIL
515,156,047 *349576B54FB94FD82FEF3F917985026293F4A37C heathgruening
515,156,048 *349675319947DE2D3F660B1B49FC89653F9570CA iloveswimmer1988
515,156,049 *349B2D71F51AE35EDE7F78A6CA4D44545A04825D HEMITROPE8
515,156,050 *349E4981C024E91F159C894B71838BB950862973 autumpe7
515,156,051 *349572C0F9AF917F548A825CD341198CE09E644F INFORMIXBASEBALL
515,156,052 *349016B71ABA7F3C207EE74BB6F759F9B9A0F189 horacetwomey
515,156,053 *349E9C8ED2E1C3300ACFF77F7CAB4E9972EFA558 ISAIASRIEGER
515,156,054 *349C8A9DA9367EDFB465985E6825B1EF259518E4 ISETTABMW
515,156,055 *3493A5BD4FF2A76A27F9093A1D16E6DAC15DE808 ISIAHMORAWA
515,156,056 *3499304F50752F208E3FF40AF718AC95517064FB ISIDROBAUTCH
515,156,057 *34994D0A125B020CB539D9CC9CF753706C6E1C12 houtwerk8
515,156,058 *3492D5A4BAE3B32556569A171444A2EE7AA651B8 bakerprix
515,156,059 *349B4E6FDA6F12D8659A78686D42ECDCC8C1558E JAROD.GRIBBINS
515,156,060 *34905F17262FC0C5D842C1ABAE419D9403C7001F i%|i
515,156,061 *34917B454906FF2C4A59A220AC629D46B143C07D BBUSTHOMI
515,156,062 *349C2BF0542263D72A27DF52733FA9F5F6FFBE0F ilesroh
515,156,063 *3490B1AC027540F89BE06F2C5E09E759BF98B73E jazzsuzanne
515,156,064 *349C9092148B44CC6CE7185A0C7098147E189682 i love you honey but i hate your friends
515,156,065 *3493AF05D525D19A71428D7903A7E8E68C2A6D41 BDNSI
515,156,066 *349500FD98B5E17C97C0F6BB2B01446187F6AD6A IMPOSSIBILITYLIST
515,156,067 *34982D1B21DD5EB39AE89E19C4513C40EAF2245D INCLUSIVEDISJUNCTION
515,156,068 *34921D042C5088A46011AA6ABF9F55D2644AEE32 jesscorp
515,156,069 *349F46BDCA8648E0EA3600A6B225B0F6D001BB9C INNSBRUCK-NORDKETTE
515,156,070 *349BED9A8E58871E6946DCDEA3CA825BFEA9CBCD JEYANDRANR
515,156,071 *3490239DDDBCDCCC361125A109AD4C8919399ABD [email protected]
515,156,072 *3491F5D358B7BE69B89CC8392D28A04BF27CBB0F INTROMISSIVE6
515,156,073 *349E294FC61BEC555B767FC3CC3A21B33D163E06 BEERNUTS5
515,156,074 *349EF597650FF4A1C202A911FF6A44B6CDB32245 IRREVOC4B1ENE55
515,156,075 *34908B4A650B15DCA487CECF94790C8645F9D3EF joelle.cook
515,156,076 *3491F1CA477B59C666BD8811B0F40467A1797214 BENNYLAZENBERRY
515,156,077 *349273C00D0263AA3317C0EC5277E832E4564B06 BENTONNEIMEYER
515,156,078 *349916FFFE5565C7018316CBD1773EDCA573175D BERATUNG.
515,156,079 *349EA4954CAC7A2007321C59B4994D661DC8F708 BERRA
515,156,080 *34972A9FB129697680347CAE8AF71425B0534290 jonmendez
515,156,081 *3491F68DB1033081A2A4F73389C396CCE14DB0B3 BETH-ZIMMERMANN
515,156,082 *349B95724E1CE070964083CFEA86E737D3AC4298 juliankozicki
515,156,083 *349A4EA6DAD0A9EA618BD2BCFE1498F91F4F1F3F JULIAN.TANNEN
515,156,084 *349D19CC66BB562656DD0A443A97AC80E52FE0C7 juliaveres
515,156,085 *3496426C8A7CD36E2F785D527D00CA17BA5739D0 JULIUS.KHATIB
515,156,086 *34955087EC54C09C425D4B77A40A04A513B46D9F b%i90
515,156,087 *34978F2C29F2D7FF37325F6DA97E5F6DE2497EDF BIRDSANDDOGS
515,156,088 *349DAC4C6AAFC7DB60DE27F3243DF0EEF48D94F6 jaredoba
515,156,089 *349D67961A88AAA641E4A717B1F5353D561CBDF0 jaretera
515,156,090 *3494457F95AB018A60AE03A806C5F37FA21F82FC kaeden013
515,156,091 *349C37DCD6B2067A673C480A848110BF862D212B JAVIER.ARABIAN
515,156,092 *349667AF60890FDB00DBBE4265DB36BD6DCA029E javierdecicco
515,156,093 *3492F38A3488647022D30C9D81D90BCD266CF326 JBRELINSKI
515,156,094 *349C099084E28A8C29D2123463B7EE042E31D55F JCPOSTEL
515,156,095 *349719FC9752019716B01A77F23A0611B33C21EB KATHY KENNA
515,156,096 *349527CC4F9E4AB2C6CDB2775238061871E0FDE8 KBDITRE
515,156,097 *3499A309D0B75084F44CC3D599CA716385A8B981 KDUPPEE
515,156,098 *34986A97620659518291781637AC2B7F227A4C83 bljx
515,156,099 *349936FA33E6237F75F93E2204ADA59B2EF5EC43 JEFFERYMASLOWSKY
515,156,100 *3499D1434666FCD4F153B1F5F3D6A8FC9E6EDDA2 blood(chocolateversion)
515,156,101 *3490B6F93F0EEAC2308E9E45360681C10D5B5BBE KELLY.CARON
515,156,102 *34985A83A27972CDC38CFE5DBF9E769414DFBDDD kelseyleon
515,156,103 *349968070794EA2F551BCBF3794E8381FA4C285A kennithreisser
515,156,104 *349317B5084FFD1CD24F43246F452FC3CE7AD933 [email protected]
515,156,105 *349AEF398FD215340716D51B8767D545C98DAE38 keppeli
515,156,106 *349EA19D8D820522A6D538016AAD99313F3B3C59 KEVINZELEDON
515,156,107 *349D9789038CD34F421DB00F3354D7F60607644A BNYWY
515,156,108 *349839A777985D9F59C75CACAE51717407877226 KIPPETRAIN
515,156,109 *349472024FFF24EA89BAA4B8C486B035D64C8268 jerrellkrolikowski
515,156,110 *349A66529359EB5E2F9A0ADA074A41140C4E7D76 JERSTEL
515,156,111 *349461580D1AE9DCB3304BE1236461488B4CF2E9 koenigsornat
515,156,112 *3494A684A4E773CF6EBF24AA9ECFD5B69B6C12E4 KPECCERILLI
515,156,113 *34951B3023BFFE5C499C497641DCA47F6A2B8273 KRHOTINUED
515,156,114 *349156099BC546FB179D5475613DDE04234A870E joe-ferro
515,156,115 *349F3CA3129A322C178F04E9730AE5C3BB741FA4 ksittvn5
515,156,116 *34929D443B17EB58E56CC22BC9F44F2EDF3C4BAB L3G4LIZ4
515,156,117 *349E3D798324251C32AF63B12B15FA2EF2744E91 LADANZADIZORBA
515,156,118 *34970E13E0E45EDFDAA3EA7A7895AEDE71220652 brfkx
515,156,119 *3495FEE9B82A615FED70173B516CE5BA3D35D015 LAMENTODELPRESO
515,156,120 *34990B510888C7E1BD3660E0F6E5E97466FFDA52 LARRY.CARLBERG
515,156,121 *3496C28AC72B398AD6B02D8B87D64AA3137B9039 larry.cutshaw
515,156,122 *3491B0F08EA667B1A5860779B05460637ABF019C [email protected]
515,156,123 *349D63EC45AE4490C9E13545649ED246B3BC1A19 [email protected]
515,156,124 *349AC61B5F80C258B2FD9CD13C3E9C41F22F0353 JUGEDRED
515,156,125 *349BE841A8D249F0735E4C1D396A4F4A2DDBEAAE b"t_
515,156,126 *3499853EBF2E4240B3F4F7B634EA73ECDCF56823 buaron
515,156,127 *3490AA1133A47F4FD617BC7938193875A9AC158C BUNDESWEHRGESCHÜTZE
515,156,128 *349AC25A12C01E48FDC0E9019B4A46BE1861ECEF KAJALVISHWAKARMA
515,156,129 *349746877171D0B111E2674B6BFD243D25DEBD01 LEOPILCHOWSKI
515,156,130 *3492124A26E7637940738E853EAAED68994E0E41 b%w.i
515,156,131 *349A94B5D926CC09DEA5E9781047D5FB82D6DDFC kathy.raford
515,156,132 *34952FE789A233AAEE1D808E80FB5A7EBDC5394B bx5cb
515,156,133 *3494F66A15B407963981646326F5E1B0A51EA5B7 C1uD
515,156,134 *349647A1BE8FDECC398B67CBC8D9EE8FC447454E KELMID
515,156,135 *34986D664A54DEE1285B307B8EE20058D9861690 C8:S
515,156,136 *3494358AC5A9336DCFAA46A9938EB304E73BE208 @[email protected]
515,156,137 *349AE82B718C59DFBC4FB016CC7DFC667B2A2274 khan-cracks-hollywood
515,156,138 *349F064CCA575F03839635F6479192AA88F2053D [email protected]
515,156,139 *3498486F40933F6EB917917FD0F0A64AEA7AAD01 CAI/
515,156,140 *34931ACDADB4E708FA64DB21BD93C693D79FC20B LLOYD-RUNYON
515,156,141 *349A425C8D2218608EF8A1B93C602F40C14722E0 kimberly-seepersad
515,156,142 *349268DFB9E4741F19BB543642BE126C7977B81F KIRBY.MAGRO
515,156,143 *34937EFDF14D49C90A77BBE310C00083725EDBFB cammermeyers
515,156,144 *34933545F9BEF5232E77B35889C92A492BF635B0 lookers
515,156,145 *34972A08BC16764213BA0F2D6C6EEBE92D8858D2 CARDINI6
515,156,146 *3497EEB1DF924D2D1CCF9778270CF6632EB6B85E CARROLL.GUTMANN
515,156,147 *349D64D56230DEE5E87E2E2EF426AD8629CEF101 LUCIUSKNUDSON
515,156,148 *34972B11A9530A92D702183F3363455CE84850E9 LUCKY_SHOT'L/@/K/I/_/S//A/T
515,156,149 *349B90F1E34DE706A515D5E4BEE21D9184AB811A CASEYRANMAR
515,156,150 *349CD4CB77DB0428869E2F7CDC3059523373F25E krippe/n
515,156,151 *349B84E904DC3020D369D3198CFA00C928054433 kriti.kashyap
515,156,152 *3496D7CCFA72CBD1174067AACF41E27E0FB631EE CATSWALLY6
515,156,153 *349F104A44FED6DA5351DC9FB3E281CDB70AA629 [email protected]
515,156,154 *349F54FDE2E969A1ABD3DDAF7140DE2E5A7D20CF cb46$
515,156,155 *3491FF9656E8768C3844C9B2DBA43CCC8C679A54 LYMANRUFFING
515,156,156 *349360CB27273F052C65D992ED02FCD35BD047CE cbvbo
515,156,157 *349DD1DF704F3CF59AA3468E508F5751E5B4CC2F Lab3l-sto
515,156,158 *3490FFABAD591E87C3B664999A85664A705EAECE mackwillington
515,156,159 *34988CFA8DA56D5A4036BB4231F5CF069BECA42F [email protected]
515,156,160 *3495183478F41E5F2EDE2E5BD3F14EF0BC9EBDB7 C:\DocumentsandSettings\FireXware\LocalSettings\TemporaryInternetFiles\ContentIE5\NQ56ARSP\278d2ea0245051aed3c9221560b02a22CA4K7SRSswf
515,156,161 *3491E961BD5E62DBCC376592067BA93E4A2AB99C CEG.+
515,156,162 *349BED74A86ECD7B2BDB31A689AB0F14C2B2ACC1 manavent
515,156,163 *3493F69432E37F27A2468106A25D56E774773B5D latanya-cureton
515,156,164 *3495D55D291D7A770AB0B4A6E2BD44618F656099 LAUGHNER4
515,156,165 *349CD3B8B2C299E122357ED3A9FDAEA3A60FC810 MARABOETS5
515,156,166 *3493D9894170CE9D73BAC2CD121678CA77058383 lbasser9
515,156,167 *349B52EFEE5EEFDD8F83BE67CB0C08E610D09364 CGCU5
515,156,168 *349A522FBD5C39ACF9267E75788CB25C5F28B32C LELAND.WACH
515,156,169 *3491BF9FDF155874A35FF14FD59B7BD3752E971D MARIO.WYMER
515,156,170 *34985595EBF98ADB2D7FF4DD9287D0CCD389C42E mark.lampariello
515,156,171 *349C06033A87C234FDA48FB61B7DBDCDAA0586B4 LENHARRADON
515,156,172 *3490F6B8EE84B7449F0A36E146B15B9E9E00A168 chancemunos
515,156,173 *349A0C96575FE2343C456FCE9D633E98305900EE MARQUISVIOLETTA
515,156,174 *349F917ADDE981CF9716CD35BB47BE871CCE9A0D MARTYABAR
515,156,175 *349AB0C7C455D4C9FBD7FE57662201BA40026989 CHARLIEKELLUM
515,156,176 *34940BB50A4112CFC2BD251058E6912C7738061B che.fretta.c'
515,156,177 *349533B0A3ADE64295FDE9CDD7AACE80F8D2BD15 mattreber
515,156,178 *349FD59A894BF01C4DA53D7C37F2583D05F24390 CHRIST''-NOW
515,156,179 *34981239D57D106A2C5D3CCEB053AEAF5E0A9E62 [email protected]
515,156,180 *349648ED63DA693842F8606164D9DA7BF69322E5 MENASOLIMAN
515,156,181 *349AF3FC223392639D12C805B76154B4622C3DDD [email protected]
515,156,182 *3498B280C99339E47DF8F4989CC7D93A0BEF111C MERILYN
515,156,183 *3490BC44C6A8E369723B51556F02CB2AB111FB0B merrillshillingford
515,156,184 *3491083FA2CDDBF2AFAA872E5918252EC004C343 LOCAVALON
515,156,185 *349D8E55079F1B1AB10CD862AF1C61715D4C2C57 CIMAROLLI7
515,156,186 *34954D145EF3FA317325F34C4FE7FB47FDC34919 LOGO-GRANADA-CF
515,156,187 *349C4CEA042202CFF1BC5D116D781C1D4FE13A25 longkey6
515,156,188 *349CB15DFAE783276D97BD40318E81C27DB0E082 [email protected]
515,156,189 *349852B7506B2817982D6B46F3C994B2BC435B3A louise-kenna
515,156,190 *349CF4C07527C51ECBF0900E124B3D2207F2EB9A louise-stolt
515,156,191 *34944FA6281CD0038CD867D343985B548B660503 MIGUELEICHELMANN
515,156,192 *3490530876BF8CC43500BAE85B8FE3D4B15FE59A ckrf
515,156,193 *3494E643BBECA516C545F444E3B2461BB5F70A44 cletuskash
515,156,194 *349B22F0EDF14FCA88D75938A17B509F8D129B44 LUPE.NORTHOVER
515,156,195 *349F03126C8A55D028E22BA40901888544B1197D LUPE.SPORLEDER
515,156,196 *349BF9FC68EA6CD544B348D7AC1DC8782E572EBC LUPO2002
515,156,197 *349159C481CA6E94AF5A851E4C514697F667C879 lv;m
515,156,198 *349F34605E029550E66D9BA03CEB06E5170AE45E MODULATΟR
515,156,199 *349172444BF30A663D414130F2F683C345B08CB3 cm.e$
515,156,200 *3495DEAB0B7A0113D22903118AE890207F1607EA MOHAMMAD.ANITOK
515,156,201 *3490E4385AE8CAA7F184ACDF5EBDB9DB92B71DCE mohammedfarahat
515,156,202 *349AF1792B867C8FAEC3643A5169B0C47F3131D8 cmwis
515,156,203 *3496A81D0439D7918146F01097EAEEA52FE1E04A monroetoborg
515,156,204 *349A6EB9682AC9EB504518D6C66EE0BF61C7590D cno!t
515,156,205 *3499EFB73D1ED4427897B5DFB958E296C546A24C [email protected]
515,156,206 *349028662D2D384C18EFC2089E8DEB0C956258F4 mt-bone
515,156,207 *3491A86D898AD9AF83750AD39A735A3E09A38030 MTRETHOWAN
515,156,208 *3495701625C1D68AFCA026B0D830C856DC6C4D90 [email protected]!RE5
515,156,209 *34988A74D679729CD7888B37DB93D53838180B3B MURERAIT3
515,156,210 *349B97F3F786B5331C4986FD94324CB9237531D8 CONDUPLICATE4
515,156,211 *3490B82C918A124F68E3D828F1BCACF6FBFB5B9F MARIANOVASILE
515,156,212 *3497F169E09078AE1D9448F6A3DEA65F47335755 MX20GMLOL
515,156,213 *349958696D5EF3956B28EF04A3FF25B57BC1E68B consejo-audiovisual-de-cataluna
515,156,214 *349F4B47C110B2EDA110A556A0755D550A7664B6 Coq
515,156,215 *349AD6C3756FDF55DE6228B8F2D22E8D024E119E martinmetheny
515,156,216 *349D0ACC3EA8AA8574F969D351652E0C870EF7DF CORELLKAO2REH1L
515,156,217 *349BFBDF3E5300FEAA1AE924158AD91D92A699AA CORYANGUSTIA
515,156,218 *34999506148C9E95EA088C2E8C40AE80FD998B5E MAX.BLACKBURN
515,156,219 *349E64EA7C16058CEB51AB6F50AF5AAE5B2744C8 [email protected]
515,156,220 *349FF752A5F03EAD5702CF18000C283C6EAE4C4E medley:-the-first-noel-/-silent-night
515,156,221 *3497A0F110F45E79D576D580D5013097707AB9FB MELCOWE
515,156,222 *34978FF11C0C8B4D473320D2F012E674DD00214A c=pw.
515,156,223 *3491C22E5783125B96923230CB0F3BF76C70382C MERVIN.PAROLINI
515,156,224 *34911B6D380A424E72E56FF0AD4BE3453B15815B MESOBILIRUBINOGEN0
515,156,225 *3493F886E961D1D26967E18FB9D9DB8BB20C8FE2 cqn5w
515,156,226 *349FE1107C23A4D5723994102B5ECD6D6644025B ngel.y.khriz
515,156,227 *3496B8599A94DC7E7B49685C14C0541646DF6FD3 micahkenning
515,156,228 *34974752336EB4CC26BAEA508665EFE2081E9658 [email protected]
515,156,229 *349E781D52AD85E3829A2F5ED15E5B9493520F6B [email protected]
515,156,230 *34943C68A814B5E94D43213B5891D2A6C2BF561D CRAIGLIVELY
515,156,231 *3493B629824232A50970D41E8DC0461C1558D9B8 NICOLAS.SENTA
515,156,232 *349354B92E93B5F43374B95CBBB0AEAF20059DC6 CRJCITATION
515,156,233 *3496772BEFCBEF57CC9B930157FF6A8629069768 MILOHYCH
515,156,234 *349035C86FA932321F7DE89AEDC2E916C5E8C6A5 MILTON.RINGLAND
515,156,235 *34969F020C272963A6EAFDF5AE2BDB81FF713C2B MINH.LAUGEN
515,156,236 *3492909058F7F4BB9BFFB4AD3062195922656E40 cruzjolissaint
515,156,237 *3496520BF33D3BAE4F0F79A74E630E9B4FE3F303 NOCRASED
515,156,238 *3495358475BF2C4174603CB9B5CB894416F2DB93 C!u
515,156,239 *349418D982428BECB93959A7B8F0EFCEC86F16AB [email protected]
515,156,240 *34906B99964DC8D37F8845BDBC395908B569A974 MOHAMED.PALAFOX
515,156,241 *349EEAF68C74A89E0F7464790D96E43502BC637F MOLANAZADEH
515,156,242 *349E198A50A6C6F5BB0794F4294313FDE58D26FF CW/,J
515,156,243 *3490585147EE555B501496F52BF9AD65CEAC748F n|si
515,156,244 *3499A410D8E0AAA4BE30536B6E05954AE07E37E0 MS005423
515,156,245 *349A372FAA8C742DC70B23E35BBC316E2EE59DDD D1JRX
515,156,246 *349A5D37E2F4D5CE5CC8C82987AF2DD82EF8E4BA NYBYGGINGS
515,156,247 *3494DAA9D4BA1132D3A75C9F90943D9C5E3DE671 odelloajaca
515,156,248 *3496E7AFEB029775D43FAFA0171B18A71126FE8B MYISAAC09
515,156,249 *349405A040B6659BC94109B57D8F281F7067EE22 D/7V7
515,156,250 *3492ECE8BBA3A02AEEAE3BBD8DCFFA3E9CE0A4C7 DA0H6
515,156,251 *349A46D5E0C701471CD810D9F7DAD5E054D2DCC0 [email protected]
515,156,252 *349F6EF3EA482C8DA19CCD11A126DC73F814BA47 nancymary
515,156,253 *3495BA35E06162140D75E286AD098F3063141FB9 DAMION.DEARMITT
515,156,254 *34983D2F749259EB5D9D154C2CEB194D796C2ED8 NASHVILLE20036
515,156,255 *34930281858CEE3F87CD537DCCA970EF5848DC41 NATALING
515,156,256 *34944A1B0ED2039CBA1AAEE42CD091BCB5BDA4C6 NATHANSTIMPY
515,156,257 *34903593E242B10A8B170C4F1BEB616F1BA9D15B natyrose
515,156,258 *34999D6624E28303C7ED5B29A603667CF9D61C77 OSBERRY6
515,156,259 *349FEBF9BEFA2E2A6913BCE17F1BF75C9BD187BC d_=c
515,156,260 *3492D1455E9BBC8D177192B3CA4424CB53E75376 dcmog
515,156,261 *349EC13B328336060A3D6635A282BC75094C3AA2 nishugandhi
515,156,262 *349AC27A5DE6D22B00B290E68B548ED2C21AF781 DEFTLY-D
515,156,263 *3493FF29DB7A805A1612BE1FE660A68607937016 NSHASHINGMAILCOM
515,156,264 *3496B9C4F688DB358055F7A101D7150B2828DBEC NSSVZFMS
515,156,265 *349A246C89C30361200F7A71A32F6134BC10AAAB o><.*.*(8
515,156,266 *3497DF9A30C99512705F8E15E69B9FA9B44CC802 PARLANCES3
515,156,267 *349AE52695FDD998A1761A1B418F827E4931E0AA PAŠLOPIAI
515,156,268 *349EA7E58C02EB927F87B1FE0B45468ECE3131BF odiscallabrass
515,156,269 *3499F3C4F0FDD9B4AE7C37D84C1CCF9553A00E75 odq:
515,156,270 *349989789A6E97C91CC09734615047B9C73A5025 DEUX-S
515,156,271 *349B10A87C5B2C07C2F13618FE2C949C2A668FDA pB.*.*.*.~0~o>B0
515,156,272 *3492AF8E258ACAE5474F9BAD2A139E022FC2AD45 p#####d.~0~osplat
515,156,273 *34930F64C7989C5B5AE2E5272173FCE16994F0F1 >-<-o~o~-(######q
515,156,274 *3490492E5CAC84B65B35ED8D221FEEE3BE978F3F (O_-).O~.Q======P
515,156,275 *349F7E047F04FF335AADB7EAE8548F94D28A2085 D/gg
515,156,276 *349F3DED4CA1205535D69D1FAD38EC5D3789D93B dhg:s
515,156,277 *3492B7A1CFE2EDD1CC304F4896CFC3561C6B872D ph0+0$en$+zn9
515,156,278 *349FD5B7CBBCCC53EE3E08B2E61CB0C3E1D0BC38 OTHA.HOVE
515,156,279 *3494A97B54BD2FE03ADB9F9EB47F42F2AEFB7F5B PHILLIPTYNER
515,156,280 *34903E6D34AD7EDD06ECD3F98B92B390EF7B01EE outbarked!
515,156,281 *349BAF427358980958BB02A148FBE5A474CA1EA5 digredire8
515,156,282 *349EBCA388176FEEDAB6F50B048EACF3D6F19D3D [email protected]
515,156,283 *34968E27310D232A0499B686BEE7F00601F5011B PLAYBOYKELLY
515,156,284 *3496CBE9A835D48D195028ACE63716A7BB4E337B p---->.~o>-b0
515,156,285 *34956C55930F8B3C4C01479070A4E2758DC61602 PANDORABOSTON
515,156,286 *349BE17D0033DC3A14821742E100BB84166BC2F7 [email protected]
515,156,287 *3493715EA41F22A5A36CAF7CD693BDCDEF8E3566 [email protected]
515,156,288 *349F1052E9F523DC628153E8CBDC7B222B2F323E patuankali
515,156,289 *349579EFD8F9261CFF2A6F2F6B95E59B20CE3277 Divorceuse
515,156,290 *349CF76C997C54E3A3348B6B426F93E838CDE63F PRESSERONS
515,156,291 *349F572EA5DECF5CC539D353C12532EAF2ACBBAB [email protected]
515,156,292 *3491639FEFAACD69F7CA146D497AE7645072FAF4 [email protected]
515,156,293 *349EE2FF1DF7E6B5316EAD9E46E88A86244DE828 dm4ru
515,156,294 *34940CB13095D4623074C7A8B362E7DCF8FDB319 Q###)***~0~O>-<
515,156,295 *3492E654C8626553B11F09E0D138076C48C3C383 Q383715
515,156,296 *349A05EBCE4AA0665EB7463080C79C23DEB1DA10 [email protected]
515,156,297 *3491698BE74502628F863113A7E0BF674D8A2783 dodgersl2
515,156,298 *349BB3DDDD75596917205D20A50E4786D29DF927 [email protected]
515,156,299 *3496B8851C692E855362EA8CA077BD92A492E2F2 dorseyboening
515,156,300 *349FA0C16812D8B6860A18EFA1994296F0981DD9 [email protected]
515,156,301 *34923F528E1BBC7D18A3A52E85B21D8D9EBB5535 Railroad Boy #1': Oh it's 'so' flat!
515,156,302 *349EAA4BA95EC089F06FA6D61879E3F84DD69799 DQCKP
515,156,303 *349E7C3A0264BB5E35F07F5271923F59F5C2499D dqppr
515,156,304 *349D27BB0CB1236582736FFC67ABE44A0A89E380 drewbuswell
515,156,305 *3490BA1DB41A9AA845E1490D012BF228F89CE1BA raspa-1
515,156,306 *349B5B91742BB3BEEC75F9717EB7BE22B007D049 RAUMAUFKLAERU
515,156,307 *349EE55507112B189C5AD7921209DBECF6CA3BC0 [email protected]
515,156,308 *34989B4D6B6FA8D1FD631EB7ADE5B306AD918B45 RAYMUNDO.STORNIOLO
515,156,309 *349DD80D4D2100E8855112AB528C348DBB28A764 RBXEDNI5
515,156,310 *349888C4BC9E0C9455B5A281C1EC9C5838F8ABDD Realloveisforever.
515,156,311 *3497BECA1E719854C0BFD87E7C9D8C36976FA042 REBECCASURFING
515,156,312 *3499F9DEE1D59FF49DB538AD3E68A60678942C22 REC0N$0L1D47ED
515,156,313 *349CF2124DE5DF440543872ED5DE991A655FE38C RECEPTORDINATION
515,156,314 *349578CDCC4E8C8F7BE8D6532498610BF159AF3B P####P ~ UU
515,156,315 *3498F37CEFBF859BF24D8532DD440415CDD3E8BB REEDPANTON
515,156,316 *34910C8ADC2A7C3900165A6F3FEDC36E2A640315 PREREPT5
515,156,317 *34988CAE44AF9E35BA5DFE6DE83302EADB3BD661 pretzel-sex
515,156,318 *349FB0DDFFF56585F847AEBF0AFE86A14B64A19F prevenisci9
515,156,319 *34900BD852FCCA90003B0E2AEBCF7B2C99257E0E PSANDELLI
515,156,320 *349511401741EA1EBAB0F4D1A5A000D9EB10E431 [email protected]
515,156,321 *3496C56BD5B1E9C15AA3B97F134333CB9F9C766E REID.GALLMAN
515,156,322 *349DD740AE9F823B6A966799E1BFA6FD44551D8A punica
515,156,323 *34998EC2505905A9C1EF2850E8983D50720C114F q]2a
515,156,324 *349C5FF6C8CF4C5BF0E870B3CC2F0FCAB63B61BF qala'i-khumb
515,156,325 *349636106EE919CD430EF51AF0ED5B03970346D7 DXFPXQR5LDHE
515,156,326 *3498EDAA921A5DEA73203055B5D14744B9EDBDCD RETSAEGNICAR
515,156,327 *349A9ACEFBD8AE489786686C17B85AB83CD24C8A retsoorsuez
515,156,328 *3499CC84024C6F3E4BD61996BDB743C5E845CA23 RETSSTER9
515,156,329 *349B803210628C5004BF927AF04EE0E704EC6806 e2rh
515,156,330 *3495C16842B847FCB620C282A5DE2AE5740B535B REVWUNEZ4
515,156,331 *349E6CA819D1F84FD06BEB0B19A0006F00F8FB6F REX.FAGUE
515,156,332 *34982DDEC63702CAC81DE5B05A4BAC4766EDB3BE ebev
515,156,333 *3492EA91AC95E02FA31ACFD6553B916AA3B99FAA RIAFFEZIONANDO9
515,156,334 *349F774A45637273861F0607B17A7E9717CFA297 RICARDO.JUNGMAN
515,156,335 *349162EDD36273686002ECB0157DF7DB99C9AC4F RICHESTS0
515,156,336 *349DDA9C625F5A25BE63622492C2FBB5FFAE46C9 ED7E66AA3415ACAB91139C3A0C67EC1D-JUGGAL0K
515,156,337 *34930FDF5F1D9C9CF1C2E0DFC28A88382FB8C6DC RICKYBEATIE
515,156,338 *349FF8A66B8075E430541CFA70623398E30E3399 [email protected]~.~.~{x}
515,156,339 *34907D6818A296A1D49C0C4F1BA8F0EB73A62D57 QY/"
515,156,340 *349A9CA9AB52566354E161CE1FC79125839217C0 r471f1c4710n
515,156,341 *349B69A0ABC8D736F650F69D99C6C0A89638A56E RITES.OF.DEATH
515,156,342 *349DE32AEC5DA2A0DFBA95CEF6E5271FF880F9C2 RADOUCIRENT7
515,156,343 *3496D7386BDAFF662C0A0A93647CCD44E5F63312 RAJENSUBBA
515,156,344 *34965B8DF056C125CE9B9302EEDA4669419CD4B3 robbie-hodson
515,156,345 *3490C579AD6F6D346A3BAC76F2BAE9A4F0FC0064 EGHIMBASANU
515,156,346 *3493E1F147F5D00DFD613CB2394ACF936BED6544 RANDELL.BOUGIE
515,156,347 *34918F134F3EFA7CCB057FE0AE170359D2966C43 RANDELLCONOUR
515,156,348 *349F61558F5E44941DA4BF1FC95D194B5BF99332 ROBLUNDEENCA
515,156,349 *34900251C395C1CEB2C5CBC9FEB66948D1715B98 EHTVU
515,156,350 *349A304CDC390D26EC6E89CBFD3DE0B22F596E61 ekviz
515,156,351 *34987B5108CE25EEA1B9B0BA059D3E7FE72C6488 rebelde8820
515,156,352 *34976186271EA2620400F46B39BB9A673C1E5CE7 ROLF.BARESI
515,156,353 *349EA7ADB2FD84922ADEE4B16D45E90C01AEC760 RECIEUED2
515,156,354 *34929E8B735C9437B54ECAA123061740DFE53069 ELLIOTTBRADFORD
515,156,355 *3497105E0E36276A3663771F5AAFE550FA96B068 REERGRIFFENENSES
515,156,356 *349A0C493B143B01F785B2910D10FEE3E3A5A841 ELSL!
515,156,357 *349DF88E75E211FD4A7F66FA956609C21ECFDDAC ROSCOETIBONI
515,156,358 *3498519B149AE40F9FFF5E6ED9D9E31CB69F1795 eltrain
515,156,359 *3494B6D2EC99605F8BA594C05094CF86A6353DEF ROTKERIDS
515,156,360 *34918B9BDA4CCE5D1529132FA4A8022FB58B841F renaldodeskin
515,156,361 *349A94F1D4C14450A86852E81C3CA672C6CD1071 EMMITTMUSCHETT
515,156,362 *3491C0E4DB4725335ABD6004CF880811740DA595 rufusrimbey
515,156,363 *349AE1DF7C7BB3142BD64D9DD34F55658B96A34D ena:-
515,156,364 *349760BBD395AC32ED7029B1A2D6611F45092421 REPARATIONSFOED
515,156,365 *349D7A661BCD49B8155AD44A1DA8D4E8D6E0E442 RERESILATOT
515,156,366 *349C7F34043343C90D33BA2FBC63D496A92845BD russkamler
515,156,367 *349C9AD2BF12822AC37971F73C46DD491C520623 RESOURE7
515,156,368 *34995CFE96E9506F5670AA002A2A7BCCFBAE591D RESPECTINGWHATARANCOROUSMINDHEBEARS
515,156,369 *3497DF9E580A86AB06A8581F08828A81BAF8B65C ENRICHSAGE
515,156,370 *349EFDC9D401EAE3835A30CBB3A20AE065FFD94E REYES.DILS
515,156,371 *3491D1C8FCEC64D094559F79D388F5D55BC67AAB reynotta7
515,156,372 *349AB178997637776DE55B6195201CB65118A85B RGC8UYSMV6PIO
515,156,373 *349B233DCA6D3C1F70F96E408D0EC961910CCAD4 [email protected]
515,156,374 *349D7F6F927B9BC1B1EC7E659975FAB66FFA3D96 ep$%,
515,156,375 *349541F8F0FB5AFC332FB5C4D47D838E2E91D186 eq6xn
515,156,376 *3493FF789BCA83D681A24922D543573504B01B21 RICKY.GALBISO
515,156,377 *349410093702596AC08172C6704FBB3072957514 saintgaugery
515,156,378 *34916051778AE2F57C8FC4DA519BA7B4A0387D20 SALLY1SALLY1
515,156,379 *349BB706FAD289F16098C13BA3A4BF4AEC0C4D36 [email protected]
515,156,380 *349F1F3FD79525C2C2B1488BF732BB4101F6D04D riversude
515,156,381 *3491FC5E73967C8F764E43DDBBAF8F1A76E9CFA0 RN.(SVENBERTIL.TAUBE)
515,156,382 *349FC4B775B6D862227E3C1F517230DAC93D509F ROBBIENIKSICH
515,156,383 *3495D2DAF073270FDA8CAADEDF663AFDE0FAED79 ERWINMISSLER
515,156,384 *349A47048C11D7487C0C030C41B2FAC0877F042C SANDY.DUFOUR
515,156,385 *349D8FC2D61BD69F84E2D731E902625F9354D982 [email protected]
515,156,386 *349504D4BD4CB5F1DFDB681CCA23C7F69E54F0AD SANFORDBARKLE
515,156,387 *349F2AA35AB98788388C3D88B811F4780D290DDE SANFORDOCONNEL
515,156,388 *3494C80F8DA0A1746AE0A3A92D26779821F2B7B4 ESPLANED
515,156,389 *34948F6E89C0A827A5FD3BDDC1F7B4665BBED81B ESSEGASED
515,156,390 *349AAEEF89A34F1A63705268A8B69576077E9D82 RODGERBELYOUSSIAN
515,156,391 *3496D81E7A1D77F6D591F2ED2E7688E099501BF9 ESTWARTS0
515,156,392 *3498FFD4666C54CABC0570DEF9AE81E5674F79F4 SASSYTANGO0
515,156,393 *3497923C7CAE22B5747CCBB939C4616B382CD90D ETNEDAKE0
515,156,394 *349B35ABFC061889FFDB0B209CB5CEC2CA6B333B SBDCMARY7
515,156,395 *3499F646CF0F271D854B29FA1FA990002F905B3F SCHAIRERITE8
515,156,396 *3493CBFD3D8EF78B0EB080910E72F29C2402A529 etu-g
515,156,397 *349BDDD9DA74ED4C9BEBFC753CFC5C642FF9A0BD RONALDRBSW2
515,156,398 *349031835D268CAF4EB51014039A87FBDF31762F SCLERECTASIA!
515,156,399 *34972B1875692DFA14FAA1C8D5DF9B27C48C43CB sdc000
515,156,400 *34948D4F75DB1C16AAA3CD393E2F6529E836BDE4 [email protected]
515,156,401 *349DDA9763571DD85375E846E57E07E69383C76F SEBANDSHOF
515,156,402 *349ADCD7BBFB78468EEC879C4624B3C8752AC487 sectionlist
515,156,403 *349B14869874BC593E39A1E0C01A8B4A0E2A290D ROVNOU,.TADY.ROVNOU
515,156,404 *349B00D57F7770ABC2406900153303533D0AD682 RPV1
515,156,405 *34958107170435A35DD89BA48AC810FE07406998 señorella
515,156,406 *349D41B50007F1120CD33228ECB18907B9A2D5DC F72164035CCA6CDF0A9B545AE6800E5A-VOOVOO
515,156,407 *34944C2F41FD4E15F695072D3C72E6989A530A4C RUPERTGOODWINE
515,156,408 *34942A43E982B1F852B769DD474F941C68063081 SEYMOURRICHARDS
515,156,409 *34936B7EE9808F4F022558945A91128DB001AAC5 s4{
515,156,410 *3497482B5A8A28166DB360E90853A4D703C723AF shaynefowlkes
515,156,411 *3493AF0B4028C398844B8017CA57EA33A04953B2 SAHIED
515,156,412 *3498F37E0AECBDD668B35CBA60BE8A818196E31C FedUp(featCraigDavid)
515,156,413 *349DC9812FFFB51EBC2BA612D58FA3485A799379 sammyfraine
515,156,414 *34966F15946C1FCFB1126C541653E9BEA616DC08 sheree0204
515,156,415 *34925B02989CBACCDC54ADC411FF185B30ED5A51 SAMUKKUHS
515,156,416 *3492A3F443D3F8DD2788ABFF5A33306306757525 FILTERPASSIVE
515,156,417 *349398497FE1186BBDA48748602E9843A951F003 SASAKI 編曲:CMJK
515,156,418 *349AFA0C7855B741F5A11B5815CDA0ED5A5D9CE4 SBTXIZODGMGKK6
515,156,419 *349F208F6A469939C0F7FCBEDE7AA9B9BC1D4BF6 scamb
515,156,420 *349F488B2F6A7DB74142328A66EFA6D8DEDF4C49 SCHAFFERWEBER
515,156,421 *349AF426E60B80836D484CD658273D64D1D52BBF FLIMFLAM.34
515,156,422 *349BAB8E53D09FCEA3173199F2C06C13B32795D6 FM:G
515,156,423 *349AFD2B17E76FAB2BFDD123EC4BA5BBB75EAC5B Singingv
515,156,424 *34946832FD957009E305ACC14E58CBB4F60CF4CD SINGLET2
515,156,425 *349A7C2D8F1EFA8ADF1DFA803455F9460DB38090 SKCARTXAMWSB
515,156,426 *3498A8FF5B74E70E2B04A9723E73FF687AC399A8 sh;_
515,156,427 *34923BDAA41C5A28D962F4776350D4A59D2236BC SHARKING
515,156,428 *3495B1BB60492F09527F504CAA87E342D8C77C49 slipperies7
515,156,429 *3493B37FEE0406E02550436F582C371E84747007 FRITZWIDBY
515,156,430 *34993367277CAA26D9B422D40B6AC5FBCEACBADB soccerkaterz10
515,156,431 *349D67D7CB56797EE4390E064C4CF34F1C5CDF89 SOFTWARE--PANEL
515,156,432 *3499BA9519959CE60CCB835AB2158522A80FE23B [email protected]
515,156,433 *349149FBE597F7D761435136CF9E5E9E72291E61 G!880U$LY
515,156,434 *3494AF5624757E00AB8C9E5E7E91CA06FD1F9D68 "SIR" ROLAND HANNA
515,156,435 *349FAFCC5838F03ACBDFE3A07B54FDB9FBA40DF1 soubinh8
515,156,436 *349DE110D07C7408B994FFF64CF243E1F88096BE SKRATJI
515,156,437 *349A8F9016AD7F6DAE8CDDB11E3753FAF3709935 SPEICHERUNG4
515,156,438 *349FB052839FDEB381EC159768FED66943A9A527 GÈUÇ
515,156,439 *34998332173CF209D61590523396370C76420598 stalbudpatej
515,156,440 *349FC925DA34CF49CA0245436BECBD38F3BF1011 ginomantooth
515,156,441 *34912AD3DAB54A8D67ECF3BC9996C9BD1CCAB4BD STELLABRAZIL
515,156,442 *349E66F7D55E6A7BD83597DC0DE762C3EFF509E9 STEPHANWARLOCK
515,156,443 *349C85A260C8E6FDE9CCF363A6C1EA22A246FF0E Splat-~`-d##p
515,156,444 *349F21D496618AD0230926059B553F920562B61A STEVEN.PRUSH
515,156,445 *34984F1ED2720C36DFDC58C2C0F58907F65E7CC0 staceyheld
515,156,446 *3494796BD302E27E99E383EEEA688BE54536C607 stacmer14
515,156,447 *3498CAADA7A24E0876FCD05748BB9412AD362D26 GRAHAM188
515,156,448 *34985B9110981417CDCEB78133B946F299047FE8 GREENVIEWIANS
515,156,449 *349E6E456C7FD6CD0AE807B0CAE153B1BD55B45D STRAGGLETHORPE-1-0
515,156,450 *34904D08F0DDD0E3F2E4C48FEFB223E09E2C72FD STREAMINGNING
515,156,451 *349953127B0F7AD3B697F2A5053C7F7D66CBA70E STUARTGAYLER
515,156,452 *34924400FAA3D768C7C499421064FF3AD94E47EC [email protected]
515,156,453 *3495B2F2EB330FB961C34863DC76264E428694CB sunyousen[email protected]
515,156,454 *349B713155A0CB37CBD6FA92536174DF1326E8A7 SUPLIDOED
515,156,455 *349B6B1C1936ED7292FAC16B96BCD04B83155149 suckl3rs
515,156,456 *34923D278066ED4136D2B181EABF8199B297D7FF H22O
515,156,457 *34924CF73818EFC06FE9E1AF040A361B59B3BF7A sumariar
515,156,458 *349B944D941E10F16A83B14E357399F17FB6FB43 HALROP
515,156,459 *3492C0B5B32BDEEC1E7105D8E9D44EAB69704337 harlanwagnon
515,156,460 *34983076C6C3D6E1CFF358FF21A1D5E260D4CD2C SVEINARE6
515,156,461 *3491F80803DD2022D1FFE777263D71D274F877FF HB3069
515,156,462 *349E3AC28DBE68548B8211BECEE21916C513DB43 heinrich.zemo
515,156,463 *34947FA69AAA5B49553D93E50C422E0F781EB900 HELPMINE8
515,156,464 *3490E86775596EFE8414B2B6EE61CF6F2BF034CF take-the-long-way-home-(radio-mix)
515,156,465 *3495078B2FE43441DD04321C5300A19AB7B70550 TANGELA CUMMINGS
515,156,466 *34991AFB4CC34D71EB2E096A0B836E816AD7904F tangopearljam
515,156,467 *349AB68EB77D46407E6116F9BCBE13598E6CEE89 tatsunienne
515,156,468 *349AFFEBA26DBC1CA28082BCB3341EA9558F62CA TELEPHONELINE9
515,156,469 *349B4D881B9D9C7A8A52627E020CD0EB3BBC32EA TELKIVDNS
515,156,470 *349727F6DB47483EB8B894E60415F602B2FC5E14 TELODYNAMYC0
515,156,471 *349EA5385C94907AC1A63C299DB2761CCCFEF7B3 [email protected]
515,156,472 *349576209C3A2EF74B6D570F08684168632C8BDF HOODO IBRAHIM
515,156,473 *349CD1C0EA32776B71598A9D3CD3A07174A2C41A HOSEATORRELL
515,156,474 *349DFC003DA483D5B7644457263480327DCC7B4C hsawkcab
515,156,475 *349A8B30D08287BC459A1D0E21BDAFA3E68E7EB4 THEATOS
515,156,476 *3498345256E999ACF8D607F54E3017EE86AF83F8 The-Killer-Has-Got-the-Hand
515,156,477 *3499EEB8E7072F93CCA6C3C9D3C5A0286CCEBE2C humbertogandolfi
515,156,478 *349F535B40537289D2ED97E55934440BC3F0DFC1 I254948
515,156,479 *3492260351FAE325C4F575C3078285D57BFB22AC THOOMND
515,156,480 *349F092F00ED960D933FCEBC5D0E1E4933BED5A7 theojester
515,156,481 *3498CA689B5076E872B383B1216CC0F73C17A717 thereisnoworsedeaththantheendofhope.
515,156,482 *3490E6A452103538C5D7A4F369B1F2A454860E00 theresaboden
515,156,483 *3495A3B3BC4BF60F5A4FD85242E8094EDA9060F6 IBBJ
515,156,484 *349092F58A6B1B9671128E348B8DA2EBE90B9E9D TIBISEUS
515,156,485 *34987C9F3D113C17289368AF57BCE7A90527893B thobejane
515,156,486 *3491FF88927EED8E33CA849DFF8AE5389025E7D0 I\H/
515,156,487 *3494D7F925DEA5DE6E1D66E4A201897D00B94CB1 ILLAISET7
515,156,488 *349D6DDCF7B55347756A6728F9B7FE128E7D68AD toleriraju1
515,156,489 *349B28041773F52D8DC9F6E5527241BAEA5C626B TOMMYCHAMPION
515,156,490 *349CA316CDB303BC7A7AF4A933F5008FB71533EB totalism
515,156,491 *349F7C31270549C71340B9575F218495D0EFF83C tr3b13.b3
515,156,492 *3491B7EBDEE44B3EDDFDD92E6B8E3F5658A85440 tokboxcomwww
515,156,493 *34953CD7ABFE7CD9479645677DB326E58EFF96B2 tomasbrwon
515,156,494 *34937F2A5F5F1AD047AC57A1D2185FE579BF0586 tom.prewitt
515,156,495 *349FB240A67760038E9CC6CAAA5206EE51F4A003 TORPIDLY
515,156,496 *34951BE405F8A26F836D4EA9F706DA3B19904457 travisklostermann
515,156,497 *3495286488E8BE1F8640B6E146921362803AD2A6 trentcalzone
515,156,498 *349C1FD0C703B628710BB5DCB07C6FCCA95A9475 TRENTFUGETT
515,156,499 *3492379BC862DB3A0F8CCD73215178FEC32B052F IRFAKFYLBZ
515,156,500 *349F66BAF211FD4C0D95F8E1267B7827139A3C4C TREY.GENAS
515,156,501 *349B9AE16FC97A2906CC8BF0F8F37C1A15905CA3 TRIDIMENSIONALITY3
515,156,502 *34978586F9C607B975943D8A06E069A67402A1C0 TRANSMARALA
515,156,503 *349F5DA2B95160581C77F27F83C1049BE3C12C47 IRRADIAT
515,156,504 *349F18216ED0D51C1847E6C57DF4CF698F9BB321 TROCASTEISING
515,156,505 *349E52382ABC6D5FF5F667609FD86CFC4EF38B4C TROJANCARNIVALBOXSET(DISC3)
515,156,506 *34919C5E8D79C571F7F3ACA24C25BB2AD4BEB358 TROMSOBSW2
515,156,507 *349AF38A88659B226B696FFBAE20D74E61752489 trentonbuxton
515,156,508 *349540F06852879927C46C0D21123FC176C3051A it:thealbum
515,156,509 *349D08FD90E894F7CD1455754106184DE25301DB JACKBOJKO
515,156,510 *349B3692E10333657A8D4F6E7645BDAF72BC0ADA TROUBLEINTAHITI:WHATAMOVIE
515,156,511 *34960EEDD7DB198FC28B3274CD933FD6C510FCA7 TRUDY-STICE-HUNT
515,156,512 *34979DA347F1D8F45562724E6E0A718C43E263C5 JAETOPINKA
515,156,513 *349A4CF28E99E6FCDE23842903D95ED37B767F83 TSHEKKI6
515,156,514 *3492320A9E199739AD5BD25C22F9DF73D3B95F68 TSNIVANPO3
515,156,515 *34935CC628A0FA273C098EF16EAC6A8FBAFBBF96 [email protected]
515,156,516 *3499C7CD1EEB8194A6DE4032B44ABB2DC3DB0BFF TYMONNOMYT7
515,156,517 *349216766C0E1C456D4CC5D687E10101F9C5AC0F JARROD.HAMMOND
515,156,518 *34922C00B9D96DAD98B54B963A76387A5FD2F833 jayparle
515,156,519 *349FF39A7C443E123B5B9340905B0334339D933D tyroneballmer
515,156,520 *34902FC50F9CF4A79DB95E56FB9C6E095DC1F8EB TYUUKYUU9
515,156,521 *349BE996F40049A85D661FA08FDFBB7ACA1709B8 JERAMYLANNO
515,156,522 *349DF58CC0DD3D73E42F7809C3FEA6C52838B342 [email protected]!NG
515,156,523 *349535C3A12CC3E0199C162D6B43BE3C96E0ED64 UHQJ[email protected]
515,156,524 *349B48BD5F7538EEE78D153AE0B02AB29AB2F8CA JERROLDSETTON
515,156,525 *3490A9BC2AC0065401DADABF00573ED25CDB1D84 JESETRA3
515,156,526 *349CFD4807A1146C6A24DD3599965530760150A6 JMANGLE
515,156,527 *34917E5DD3E4BED0F235376159B031A122630C93 UNGPIGEVRELSETS0
515,156,528 *34984AD84210C6A7DD758D4FEE59505C667BA7B9 UNISRUTI
515,156,529 *349F83E7074BB9192B660CCB2298B556C5AD5D5E VALENTINE.BILKISS
515,156,530 *34952DAD6E34FF85EB52865AB3952C0AA9FE86BA UNKNELLE2
515,156,531 *349C88AA5BA20ED9A51195FF7677BEA6EA93E0B8 JOEYMRAZ
515,156,532 *3497EAD913B6CC1303FC0EB5DA9FA4C1ABD7B1A0 UPPUTAIS7
515,156,533 *349FB27C1A3B365C17BF774C41F5B6485C115A0E VANGIELACSON
515,156,534 *349077FC8B0161DC5370A80CE7A5D661D898DA29 USERLANCEVORTEXSANDB
515,156,535 *34958A444B4F806E93292359583A780584EB0E44 VARITTAYA.RUANGPHACHARA
515,156,536 *349D7ED203EAD37454A8EBF31BFC91E55B82A942 USFLADVISORY
515,156,537 *34919B93CA6388D5A423C226E0273FD8443649C7 veramel-entero
515,156,538 *3498BDE6331E13C0ECBA73D17CC375F1B46C7339 VERENA-RASSOW
515,156,539 *3496FFA445D28A2866F335569FC9C327EF30824D UUHCNAS6
515,156,540 *349542D366DB1D6B390854EE863B9F4B1237AA8C joshuar
515,156,541 *34971F0BE73CD7D187F288239981890629A4365A VICTOREICHORN
515,156,542 *349A09E918C593B9FE37CF202ED6F014DEE9DA71 VICTORIA.LOUISE.BENNISON
515,156,543 *349A89755B65145366147DDBE7450DBF0A02C12A valeriejrose
515,156,544 *3493350602B1ADF7AF071C04A79A84A97058F124 VALTIOHAN2
515,156,545 *349CC0323F6189D856E9AE3644856D08A462E69A VAN.ARTUS
515,156,546 *3492DDE99B3FBEF24563B29A51E54B748C1222D0 JUAN-MOTA
515,156,547 *3493D88687D30A3B696CAE96CF5ECA7E94FCD846 jugendse8
515,156,548 *349492678BF68F624CB774C3D3A35932274FBD45 julidets5
515,156,549 *3493C15C1ED4BB3A47C0B4D63E30BC7A0B33F183 veronique.sirois
515,156,550 *349FA55FA5623FA95723F396EA4A782139F1F413 VERVEEMDING
515,156,551 *34971BCD6DA70577A83753C25E1930A2A582AA1C KELLEY.GULBRANDSON
515,156,552 *349014A9CC0E249085EA6F7E4E0B9E9B60B534AD VINCENT CYFER
515,156,553 *3499D1A85F13EEC0801F0A78C47ACCB936DB7CED WALEED-MORAD
515,156,554 *349FC6920999AF33E53DEA1F5D3DA9D5135C5631 KERRIED
515,156,555 *349102D3F1DD0ED95490F586EB40CCE438D1C8F9 KEVIN ECKER
515,156,556 *349826B48C8BA8ADE38BE8D2BDDF81CB524820D9 kianosullivan
515,156,557 *349FA3F2A84F9E20D7851FCAB798A6F522712B13 VIS85EA
515,156,558 *34972B9CBE396DBA3B570CBB5D1792139F90E793 Waltz-in-F
515,156,559 *349228618778BC8601F19C183FDD3C81AB217BEE [email protected]
515,156,560 *349F6061FAACE7BED3DD429BAF2D32C4DD83D2EA [email protected]
515,156,561 *3495D07B2494E59A9984BA4E30CF306EB97E58D0 WANTROUWING
515,156,562 *349FA6CAB8019FCCE73E9D9038DB172FC35D7767 KIRK FIRESTONE
515,156,563 *3491C9C674426B6A0D333A230BD40F94F08B8557 VOLKER PRESSER
515,156,564 *349948EB1F6D5C96E732C98BEE3B67003EAAE8F4 von.Lucke
515,156,565 *349AFB740F2C01106C04E2AE1F81F22AF7CB448F KLEIDIOY1
515,156,566 *349A8C662C1A18AE45FC2A721653E0275B02A99D VOXCLAMANTIS
515,156,567 *349D1C85BEC928FDEDD2E5EB7E69E8A3B5922DD9 KNORDBLOM
515,156,568 *3496D9C84802120043F5D6064B0229D921D9F09C VũDuyĐoán
515,156,569 *3496622E46972352966974AB2A7228DF4955FE7D KOTMEL12
515,156,570 *3490AF888A3E4B82AE0B3844A79D0C84F7883DEF [email protected]
515,156,571 *349F4D5872A0EC70A35A7B739ABB3E27FAC655A8 kozlovn2
515,156,572 *349C47CECA7B9E5F660AB10CD8D8177F9AA77BB2 WAHLBACK1
515,156,573 *3493E169824614BD8E82DDB649B919E8ACC6B4F1 KSEWEALL
515,156,574 *3497702AE6F176A5CF797FEC3165035BFA748C13 WHITNEYSCHOLL
515,156,575 *349093751BE17F31040E2F395536201154D6AF61 WILFREDO.BENAFIELD
515,156,576 *3494990D0F3D7F64B631875B1A080ECED45AE63F WAYNE.SECKMAN
515,156,577 *3493C4BA78FF286C0FB5812C14EB0D83E7508FFB LAPIS-BLUE
515,156,578 *3495D50B2A1C0739C65B1E455639A34835BFA26F WeNeedLove(MimosaSaxsoulmix)
515,156,579 *349D58CCD73AF66D3CE8F11BD1D653F81F399F5D laviesecr
515,156,580 *349E5D147ECA2DCAB6680D92E231F2386C0A4024 lemueltuia
515,156,581 *3494F17635301658F745F142EFF802EAAD80904D WESLEYSCHAADT
515,156,582 *349013FE78AB6723A687EA7A2A39D30720E1AC1B WHENIHAVE'TRIED'ANDFAILED,ISHALLHAVEFAILED.
515,156,583 *349C77D5AEE078655C7A20E07C30975996634126 WHFHHRBSSPZCKUFBFLJK+GQJ+HXPYIAZQGKG
515,156,584 *349374267F614C12F58977EDA2061876B0B66D37 LEONELMITCHUSSON
515,156,585 *3496099BC026BE7A6519187B1BC3EB729FB9447F WHITNEYHUNNEYMAN
515,156,586 *349BD83392D5037F3477B35784C91A87F973AE6E WHITNEYMULLOY
515,156,587 *349DE9C8AF11F2616B94A1974310AACFEFF05916 WILBER.VELETA
515,156,588 *3499DBD1AEB465651454E532AE181687F1518297 lessulhcs1
515,156,589 *3494013557C25CE8CB9C07F8073CF1E060F38C52 [email protected]
515,156,590 *349C1A7C3D5E86C2171E621B626356CF80934B72 ws049585aa3dc648d3be7c67e2dfee3c28a
515,156,591 *3493E5DED04B00D2A222D525D04DA2D5BC2255A9 lilian463
515,156,592 *3495954930011AC77AAFAB9752A96E84A82B9AE1 lindaoaster
515,156,593 *34976B429716A28E3328ACDB24C8275D220CC8EE LIPGLOSSES
515,156,594 *34935D6619BE88E2DD91AF6D55CA151890652A5D XNHHUTQIWWSAC2
515,156,595 *3493B3064D8EB17C76EC9D3EFBF58E42468E3636 }x{o~0~q####8
515,156,596 *34968691679AE94E93963B7AC20B363716ECA72F [email protected]
515,156,597 *3496235E764F82D32975B92C26686F59BF8DB637 word1939
515,156,598 *349A1DA2C9C272CC890D9A59E8DAF90E4E8A97EC Y99236
515,156,599 *349E5AD822CE7031A2A75D619C990927CC59A73E YAAMWASHO
515,156,600 *3494E06C78B6EC90EE4B07D75A5AAEC14390A2CC [email protected]
515,156,601 *349F90D20757F8111FA44EA330BBEDD20E0FC0CF YHUDGEONS
515,156,602 *3496BE58DE2B53837F4C73E69ABC626D1BC214EB WSPÓŁREDAGOWANA
515,156,603 *349A6EFEE30C7D48D3B38D2750A87B461CE11052 WUHONGFEN
515,156,604 *349A31C6221CAB176C0D129249EE6314E00C4FBA yousry.al.pacino
515,156,605 *3491FAA81A8DBB92D4A6DDB4321EB6498006FDA0 ypokómēssa
515,156,606 *3497AC01724DAEC5CC339D228A64ABA22F83DC87 LOYDSOFER
515,156,607 *349AC328CE066FE441B0B30AD2E3FC4CF69ACCCA X5)
515,156,608 *349AFFF8C13DDFD07C3EC6A13BCB108A1DEEAFB3 XENNAER2
515,156,609 *349CD4191C1B6B4F702E10CC9F910AAE8499C8B3 YURI.YI
515,156,610 *3497E934C928DFFE90607C71B6830ADFA5C32899 Lue.kartalta
515,156,611 *34904A598D2FAB7FAC8897EA78AF480FB324A9A5 yyiu
515,156,612 *3497527C2A38BA985B9037F72282DCED7DF6EB9C LUTHER.BAADSGAARD
515,156,613 *349C2A47520F064FC601A5E187A343CFE0E9D07A ZACKARY.HASER
515,156,614 *34996A4F60307690ECC58CC4B29A63B5DCC43DED ZACKBALSLEY
515,156,615 *3498C143C7171ACA0A9DF16EFF0DA8323C4BDF95 LVRASPIR
515,156,616 *34943F479CF8E8222D98F47A61AEE007658001E0 zahrarokni
515,156,617 *34994F64D2DE1350CB97A6489167BE2CE336D498 X?WL
515,156,618 *3495F0904329B220CFAEA88C4BEC9591F760D8E6 LYSATESES
515,156,619 *3494938533E3E4BB66F5CD192B9FBEA5B25E2480 [email protected]
515,156,620 *349AD48D38090AA88383F3B82FA66547B61CDA51 yawanthi.anuradha
515,156,621 *349816F02477D4C1552CDBFBFF5C914A2F79432E (YBC制作、宮城県を除く東北5局ネット。2008年9月28日を以て番組終了)
515,156,622 *349274517D213CA429275E1B94926E79D724EE3C MANATARMS2K
515,156,623 *349F717C1254A37CA405720042825926914DC7C6 ZLNGNGN8
515,156,624 *349D810AC749E588F63B56431EB3ADFE086781D9 marcelosor
515,156,625 *3493372123DE6A77F2F1056448558024FD717E79 YOUNGBRANDI
515,156,626 *3495BC4D1C2AE8888B4DA186D6D8F21FFD8DA3DF MARCUS
515,156,627 *349EBDE7DE59A3F12B42FE89D02E418D2D1B7CAC ZVEDNI-PRAVICI-S-PLNOU-SKLENIC
515,156,628 *3499D064614C86AF24A9740B83DDAFB7EAD1B8DB yuji7743
515,156,629 *349D4C4C145834281783A3A56A7650F2ED738A31 Z157097
515,156,630 *34935FAD6231D996457521A478D7D39A0A968E21 БАЛАБА
515,156,631 *34973052FB5786ABA17F660DFECF6FE8A3329C2F ZAIDHACAMPILLOS
515,156,632 *349739C6122A16F0C14CEC64522B5B1943988F7E ZARIYATI2
515,156,633 *349D16537CF0ABEF2938DE17B24EAA809E9EC73E m/e(
515,156,634 *3492A083C1474FABA6FB562ACB20F622867F2C8F MERILYN
515,156,635 *349D2C5E4BF492284E1F11AD0DB24A102E0C16E6 zoe.blach
515,156,636 *3499AC1A0AF6CD288DCA2C987E4C00A6AC36B90B ZONGIDAYNELSON
515,156,637 *349C66152222A23F0AB7F69239265771CB4F5C0F СУРЕНКА
515,156,638 *3499B19A35882983116E9557CB6E8A52E7192484 ΔΙΠΟΔΙΣΜΌ
515,156,639 *349A2FE79A7A42C0B864B0B9B0C13665848A1408 mikelperman
515,156,640 *3491650D3FDD501ABDF77F602291968EA0FA89BA ΤΡΆΜΠΛ
515,156,641 *3495539A1276E76456C5AB7B5E0164270C701EDD MIRR0WMER
515,156,642 *349492A794B97BBFF58103BC1916E4075D353511 MKUNIMATSU
515,156,643 *3495DE490B9454FF595CB9B39ABF7BFB87E8F363 НАЦАГДОРЖНЙН
515,156,644 *349DC37546308B0D38A8FC421FAAAD3379BE5ABA ТАНДЫРНЫЙ
515,156,645 *349EEBC8E62E1B164053A514CD82CC126318B621 [email protected]
515,156,646 *3494D8100BB211D3D3F57DFCB9456EA580275C26 MY LIFE CYPHA/THE BRIDGE/LIFE, CAMERA, ACTION
515,156,647 *349CE959EC0D022840B89391A85498088711898F MYRESCUE28
515,156,648 *349E68B9F7E824956A9790B7BA5953561C0016AE nfwarren
515,156,649 *3499809BE67B0BDC450D9643FA2298975393C014 NICHOLASSANPSON
515,156,650 *349AEFE32D02E4CC65C38149B93FE3BF61CB0BFA 128BRIAN
515,156,651 *349D7A529AB1EB375E77FCE111EC609BD383FF7E noncontemporaneousness!
515,156,652 *34918955D334AD18CDAAFBDB9651512E7A6DBF94 14.06.1362
515,156,653 *34999263163F4524B652A9F42B3EADA9861C05CA nredomen
515,156,654 *349E8277E411AD4373D73604C827D08E2F3EB892 nsanfred
515,156,655 *349593EFC329DE9E2867D524B6BFBD9A45C2F3BB 1002796 YHTEISESTI.P
515,156,656 *349BD16159E979D2A77EB6052E70CBAB24960173 100484 tahakkukgOrUn
515,156,657 *349594CF896C60E3B14206BADBB55288D7EDF7AD 1-d-r-r-r-r-ive
515,156,658 *3495BAE0D605F9AC685FF7486183D464CBD99973 1EMANCIPATATIONS
515,156,659 *349BB65ABF94BE72A2464E6C47E763840AFC7E1C 1 gatesonlinedienst
515,156,660 *3496ED7EA5BE8869B39C015703DA9B6540C33AAD 1HIGHTS
515,156,661 *3495F5B82BBA62A6D9A27F8B5759025ADA1644CE 1.inmemeliyiz
515,156,662 *349471B3513A0005803C9932D51F5783C23D5345 1maatilatalousvastuualueen
515,156,663 *349D4A1E24040B182D4EBEA3A648A0BB3D83FE6B 1-MINI-REPAIR
515,156,664 *349797F2D354F41EB5B55216C6B2387765D08DFC 1 MINTKEN
515,156,665 *3493A9645BE00ECAC9A815CD5A980CD0E307F7F0 1-schweineschlachtung
515,156,666 *349FCF3257DF13863500126E53C8532EEBCF7494 1.SEREBRENNIKOV
515,156,667 *349AC128AB672622AB8F3825D5E7220415EF8DFA only-ash-remains
515,156,668 *34908937A6767379B40F0025ACA6E95EDB184819 1SUILIGH
515,156,669 *34965E2F75EB04337001B386DA44F95D492BDA21 o><~ ~ ~(===p
515,156,670 *349A06CF173C1264375245E1954779B2F4BD8CAF 1voluntarymanslaughter
515,156,671 *349336704AE4DFCF96DAA362D2D5DDB10F265C84 1 WEHRBRANCHE
515,156,672 *34993FBF2FC63A0F291F01199A55002C7C4E5C9E O->-<-~Q-----B
515,156,673 *349FA48CE05F826584EB2B4FEFCEE2B2FA0A8941 ORIPSOCED
515,156,674 *3492896DC37CCB15FB6F4ACC69BFEC7D58F4A547 ORVILLERIDEP
515,156,675 *3490B99EAB2B592A7B441680EDBE71799C58FEDB 14.tietoisuutensa
515,156,676 *349DF1647FD5F432020C263257779CB49F036C1C 2410229 jalli mainitsee esimerkkin
515,156,677 *34966D1114D5548766B54024B78BB94CCF0871B5 24 KATUMAAN
515,156,678 *349C40928A5E91A25BEEA16E0DE7129C493A67EB 259726 GUZELDUSUNULMUS
515,156,679 *349E6393D06B0862C0EB070F9E15B2B4600828A0 OYJA
515,156,680 *349A608FB61C1F7AF1AE202821CBFF9AB27BD4F0 27091079
515,156,681 *349AF09F21BC0E15035C093E68E5FA6C5560A9AA [email protected] ~0(X)
515,156,682 *349BC289574964A91602EBECBE3F66860AA90DC6 PAAPANENS
515,156,683 *349738F44A4C3BAC8E5E0B974AAA55AA3B2F3E2E 2DAISYS
515,156,684 *34994B2684CE108BA2C5BC504AC8D74EBDC14D7E 2-lajittelukeskusta
515,156,685 *34926BDAC6CBD11EF137060572043D5AF23D417C PARADISE-(DJ-TOM-STEVENS-MIX)
515,156,686 *349DBD1972DC8B5AF6BB7BB2B951F01C8F93BED8 paratrophy
515,156,687 *3497CA65041B126BEF3D8C9C5A5596CA06E933F9 2PICARO
515,156,688 *34936D19D21D7B30C0434051FC90C7EABD0FF8C8 2RAMOLLISSANTS
515,156,689 *3494ED8E2EAB54E95BA5EE20452CD446C967744D 2-schlaggefahr
515,156,690 *3490B52777D0D187941BE24056DA8EA91F161F5D 1DJUTTERS
515,156,691 *3491A625BAAB37877C6846A13AB41BC0F2CB710A 1.DOPINGL
515,156,692 *3494DAD97A1E5E881404D3727BE56A6B6E47CAFD [email protected]
515,156,693 *349FBA71C2E2136D8525AE18ECEF0701029D54CD 36-ristiinnaulittu
515,156,694 *3498D5335DF6440A064C51843773BE55A0D80703 372380 MUTTA.EI.SIELL
515,156,695 *349ABBF73FD335FBCF16AFBDCACB6C8DE9E44F3F 1.iddialarInIzIn
515,156,696 *349A6E874F565589BD71A5E4C667201327E14FB4 379 Г
515,156,697 *34947B445E55065A2D23B30999116F0A28014CDE 1ilovestormy4
515,156,698 *3499222E7E6272EACCE2E19054AE2260A3587A4C 398161 STEWENJAKENRAALIMAJURIHEIKKITILANDER.
515,156,699 *3492AADED667F8062E168C9EE56A59228529E3F6 pep14n75
515,156,700 *3495DF4DC5C1E4FB6E5BF9E7B30D574A3117453E 3dpa238
515,156,701 *349C471A0B79AEA3E505B13A251E323FBEC774F5 3ILUVLARRY15
515,156,702 *3491299F750EF01625659E598C96A05537EF74B5 1.ministerwuerde
515,156,703 *3492E692FAEB0EC2470544DD6671BEFBE87ACD4E 3nature-themed
515,156,704 *34984A6615D1315B4DF07BE290A22404D84F2A37 Piano.Sonata.No.6.in.D,.K.284."D
515,156,705 *3491FD0DBC8F440A71AC204F930D14666B6476D0 3-seminarleitung
515,156,706 *349815E045BD27E551A48F5A0EE57298DBFFC7E4 1.OLDUGUNUNSOMUT
515,156,707 *3495A93DF9DD65D228D1A1C8992CF433011E3D11 1.outskunked
515,156,708 *3494DE4993BFE32203393CF3407D50897255E624 PISOLARE
515,156,709 *349263C453A88067F0350DF447E58B1AE8CB8753 [email protected]`~.`~.)O(
515,156,710 *349C69C8A315BE237FEBD81678DAB7349C24DE36 1.RAKEITTEN
515,156,711 *34969B0F873D8ADC158B8AD666AB1796FDEE14BC political-economies
515,156,712 *34987BE0B02BBCA7E883914B6F5C05995D0ECE68 4-fuehrungsgrundsatz
515,156,713 *349954E8D6F7FF06C2BD58CEA79D246AC283608E 4HELPMETURBO
515,156,714 *349F5731674EDB348CF1C67C2A432F1E276002E6 p====>~o~o3b<-
515,156,715 *349DF6FA67730D670FDD83A25F2B1118D7958264 4ILUVSTING13
515,156,716 *349C12017C5CF217344034D15BD5DE6FB8C31DD6 1-tahmainen
515,156,717 *349550BB6A7A3FAD3C57D84ADCA1C2228B0A3B47 pqpr
515,156,718 *34904F5C50300F886A38F68A72B622689F94CBDA praeludium.&.fuga.(a.3.voci).in.h-moll,.bwv.893
515,156,719 *349506BF2F6ABEA02FCDC7E3A67F4825D21FDF9A 4PRISUZUJI
515,156,720 *3498D88DF1B613FB319B83AC4A8F3156E8ACDD8C [email protected]
515,156,721 *34901013AB5525F6E087DC47B35FC8967842709C 1 WAGNISKAPITALINVESTMENTFONDS
515,156,722 *3490E2A3F67ADE7707012027A70176D37EF1BAC9 4-tasaisemmalla
515,156,723 *349D4EACE5379C5BB7F7D2CD34E5B76AA21D90C2 4UNPCONNE
515,156,724 *349AABF3B4D6995A1B4366C854B293A7AFD073A4 “PURGATORIO”
515,156,725 *349024B355C1F8E862438734ABEDAB7C04808190 qgdkdyh98
515,156,726 *349A9315E1EAD1B3B7E6D3F093258EC792759600 505tyrese
515,156,727 *3496D83FB48088D198BD4861F0FB36ED82E00E86 [email protected]
515,156,728 *349F00D4A45ADE60503ED540E81FC853C207C5DB Q======P-`~-3B<-
515,156,729 *349FD9CAA110D9D229AAD885088C0A743CB437FD 5ARMARKET
515,156,730 *34964C7A66C68984532345AC12A1847B626B13B3 qsr-sassy
515,156,731 *349616ADFFE59F9C98DAF601D86FCA6A06FF1422 queen-post
515,156,732 *349A965910C236D017F1A83A9383719B937E4786 QUINCYMAUSON
515,156,733 *349B98F2BBC5B8BD189722DE367F226E9A2D45F3 26: $grandtotal += $total;
515,156,734 *3493229A952BEE8F6338772D4A7B5D1CBCA3120F 5JEBNERENS
515,156,735 *349BE947C944476EF003EE71D07B4F2283E36D17 RAMIG
515,156,736 *349DCB8C047551EFAF2548259879D92C444174A2 2-anc-kompromissvorschlag
515,156,737 *349F58BB568C33AFBB8197894CBE30E2D2EDA4AB 5kmdyroo1
515,156,738 *3494B05B32BDD4D0CC602146BD9FA3696B7B98E1 2.CARITAS-REFERAT
515,156,739 *3494F705F8A5679164C6481FCF88C25817E797BD 2dobermannikenneli
515,156,740 *34935A39958910179C84467A6453AF9BBC160EE2 2DOORSPEKT
515,156,741 *349A17C25F1D706E0BBDBB67E9546479E7122124 2EBLAATOT
515,156,742 *34931E6761D51EBC8D6CB07FEC66CCD6449D7CEF 5-mUte
515,156,743 *349095B81D16131FB4CEAD53BA309D3253D49A74 2FILLINS
515,156,744 *349A7EF4EAF06AD51B7BD1DDCA0ACDB683DE5170 2MONTICULE
515,156,745 *3499E5A51CA5B5DB3B60B6D2972E232E55914AB0 2OCT1301
515,156,746 *3499D7F363B0C64392D3F32D6D141D583499D8AE REDNIGAN1
515,156,747 *349FD45FAD06F4F960D5CA5175AB02CD63D2329E refugiosheehy
515,156,748 *349744C6BEB82D1FD018D5155B1D35ABE91DF349 30january1892
515,156,749 *349B41D545B848BC17E448EFEBB1010AABF455D5 5ROYALSCENTER
515,156,750 *3492B97A717E71F54D2081B33A9CA8CDBD39D188 RELASTEEVNES
515,156,751 *3490F364D74FC527D6C188C1E36ECFA00761223B 371800 t
515,156,752 *349129917F3583F06910B2DA0E4E502ED31C95AA 5STPCCKS
515,156,753 *349A4C9967F0BB36B6E3B08A15EE56E142F5E832 3A08FE7B8C4DA6ED09F21C3EF97EFCE2 2222222222
515,156,754 *349A6B31694F5530955AECFA6B154C10EE09B1DD [email protected]
515,156,755 *349331A64BBF7F8BF283FE42C2F909F650CB4DC8 3ENOSTELE
515,156,756 *349959CDBF218CEC2750F711865A468796B689B0 3EPOIUYT
515,156,757 *3493BE0358E2508B003B548FC41D96D763E03355 RESSAWKC7
515,156,758 *34918F72F7F6FA9B35BB98601D2E3089B1EF2A98 RETREFODED
515,156,759 *349288C7CB9D166C61CA242F1D4EA55547C431FF 3->~O->-<
515,156,760 *34910632327EF8101E0EDC8A93D5AD9AFE2ADBAF rock.and.roll,.part.4
515,156,761 *349D92A78257E78F4AEACE189DE609AB91162624 4HNWCBOFQVCC
515,156,762 *34932EE654C66571C931B058AEEC00CD88B1B88D 6CAMELOPARDALISN
515,156,763 *3499E080DDDE241FA8649EEA097E648C9C8AA94C rodgertinajero
515,156,764 *349B6242946B7FD62055117091BBA69EFAABEE24 6EXTINGUIRES
515,156,765 *3491822A51E0DF020DA641D87A79C759C38F01DD 6HYVKSYNE
515,156,766 *349C515781D506F5A485A2A6379959758AD7A5A6 4-PALKKAER
515,156,767 *34903070613E41662B655B9A81C0056222BE9C74 4PRIORATUS
515,156,768 *349C3FA44595AEB243EA95F84EC6C067768A5C5B ROSEAMRY7
515,156,769 *349F275D048DF0DE5618FA248A43AFE8F0834763 6ONIRTNECCA
515,156,770 *3493CAE3FA0872B2166A13A4E92566978BF97DAE 6OTURUKIR
515,156,771 *349702110A815BE3852B60EF227CDE18E8CA15D1 ROYCEDIDIO
515,156,772 *349CC7614F1312FF0D710CF7FC462CA16A966DBD 6SPERMOLOGISTS
515,156,773 *3497A819265AF2DC5EAAFCE0AF199F221A6BC036 6TNEMELUC
515,156,774 *349C24362DBB6BCB6AD6FE8A6E43E40E213BC2D2 575697 voitkentiesetsiyty
515,156,775 *3491827876DA5174F416CA299BEC3C08EBDD1EBB russellheidi
515,156,776 *349C7FFF60DB52431B7F7ACD3EB4509AA6F9458D 5BSWPIKESVILLE
515,156,777 *349EE1DD75226324CD28A9B2E80A27B2E840522E SAGOGRASS
515,156,778 *349392F6F7930EF4297586016471A947CDA69300 samsonrui
515,156,779 *349963A2768EC0DFF8DE11DAC329894E1D71EF87 739761 bOyle-birSey-olamaz-.
515,156,780 *34992FF87EDAD0C0313BEFC5DEEA166DF1CE0D1A 5NESRAZIL
515,156,781 *349A1D63F83BE5A757494160A1EB178278D552A9 santiagomitchelle
515,156,782 *34901DCEF4682865D999366147D99BFCDA4C78A5 S!BL
515,156,783 *349D1049A170BE388766A3B15D966BCD2EDE0DDB SCHUTZFLIEGERKOMPANIE
515,156,784 *3496950C5CFAD36843E1A7D7CDC1F5602ECCCF4F 7ARIZONADUDE
515,156,785 *349D7549FCFED276F8F481205B4306D340D2D795 7.AUTOREN-TEAM
515,156,786 *3492B24AACEB79736162A3A7165F2F6DBC22F05A SENIAVA03
515,156,787 *349D39163EDA8B71CD8D7F040AEC62A51B86574C SEPPAHCS8
515,156,788 *349A426D8B413984F374BB4F187BE8096D2E17B4 6ABENDEMP
515,156,789 *34977DF76FC41EB3BB8738D9264806C1D6AC79AC 6ARETIDERCSID
515,156,790 *349BB7CAD98AD271C2A61CDF1545D8AC6786637C sethsalois
515,156,791 *3491F4E8BD0C2B7928E349050556B25351C29CD9 6CINESYRHC
515,156,792 *349EFFFC4FC600192F544AA493850DAA28C1FE8F 6dektj3rut4c
515,156,793 *3494B657DAEFB679B71C09696DC295D033D04DFD 6DUTYDOG
515,156,794 *349883E9944E950A6FFC86FA9AA1F3D0EA48743C SHAMROCKTURF
515,156,795 *3493555081284468AF2E9AF97875CDE00492DA39 SHARKING
515,156,796 *34924505C23F1940F0235ED811AA24EACBF517E4 SHAYNEDROWNE
515,156,797 *3491BC5CA24EDADDA66951C38A6C2BDC96F95214 SHERRYLAFFERTY
515,156,798 *34932D297514CBF8F347D9C517DB907E6873459C 7ZARINAMOHD
515,156,799 *34977D3822230F1082862DBC82A47794882FDB0A 6TOPOGRAA
515,156,800 *3493CE856BDC28E60B5EADF428F0F084A61163C1 6TORBSSIEW
515,156,801 *34988170730A2DC926512CF76B45A95C61ED9072 SIBECULTURE.COM
515,156,802 *34965A812680F36488CBCE132C583ED45E24583B 707KENDRA
515,156,803 *3496FEA58A9A3B6E2F02349167DF63670C163651 722KIRA
515,156,804 *3496F8E3B940940269EC6898D1282A5863A5EA4E @/7AAA
515,156,805 *34946627F28BF95AD73EF0EAF43DFDBA2C2AC751 sindrome de wernickekorsakoff
515,156,806 *3498FA9DEB7D06A6FE9F6A917CCC556D13F0AA87 SISSOOVERIFICATION
515,156,807 *349AE871EA9E8FF8B141B44F70A9B01CF147A37C 8DWUEERHC
515,156,808 *34960FCA0F87D310B71109593D7C42D170DAB6AC sleb
515,156,809 *349EF295FF2E2318DCAC0BC14D2E6E20F00390DE 8INDPAKKIONS
515,156,810 *3499C79017F2F42C3EA1394BC21674669BBAC63D 8LUFREEHCNU
515,156,811 *3494883824890D0AA330D30DA2169B56DF9BDA52 7HTPASSIT
515,156,812 *349F249236550113B3A7EDACEEA83B00C057EB5B snowee
515,156,813 *3496EF3487347446295B6D90775AB4B8AE9A8393 7STERID
515,156,814 *3496D0CB6D727DDBED0DAF2CD70ECD799A4AFBDF 7tekeergegane
515,156,815 *349C23DB602D10BDDAA9E97B49AF81E8F62E4D29 7TEWIGGED
515,156,816 *349D39BA53FBFB2AF9DC535D157FDA83C0ED052B 8======>.~o.;)
515,156,817 *349CDF2F76954EE9C14AE4DC26B530D5207C1AF2 7yrannzed
515,156,818 *3494F949397C1823F2330AB7A79376A6FFE3CC97 84CT3ROCD4L
515,156,819 *3491365DF1FF95BCFCCA2CEBB8144D5DF6D62C4D 8======d~~(_0)
515,156,820 *3490B668B615296041E2A63F94F663274694359B 8themaatje
515,156,821 *3498FE23C4047C49C96C9E749370582E5F3BD2A2 8TONGUEVULGATEWONTED
515,156,822 *349A9D94FEAD399421F3EDD8C3B0CEFE241A7E38 8ULTRAKURZWELLEN
515,156,823 *34983ADFE1B7D6F7CFD3ACFB598A9607076FCB88 8INGESCHA
515,156,824 *34914CCBFD7596D5406AA73702200F6774DF8494 8ISLANDTECHNO
515,156,825 *3497ED3E81982697BEF9B939D0E455474F88C51F 8PODNETNA
515,156,826 *349FEF1DEEFF6236205C7795FF75AA908C414A60 8p***splat
515,156,827 *34990565FC6AC3A7FFE5809E064CC843070562C3 8SCHERPT
515,156,828 *34904678E5582D746B2E0E3C81429C00B1614484 9BYRAM
515,156,829 *3499311AC23FAC3304A8AE08FAF4B78215B70A04 9CADMIAGE
515,156,830 *349AC26C5AF3A73AE05EDD4C67D3A4781BD17BC9 9CHMIELOWE
515,156,831 *349E131120F50946A4D7A8ACC538E6F6B096DE69 STARTQUANTBSW
515,156,832 *349B8FA987197493A56982B362CA8EEEFFE7ABDE STAWALO4
515,156,833 *3498752D5781CDCC9302631A1611022E7D0FDF1D 993JAYLIN
515,156,834 *349C4AC442FB6B9585232117369F9C207DB1214E 9MOZARTITALY
515,156,835 *349703D7E01FEAB790CDEE9783F2DF211E412FB1 9AZZOPPAVATE
515,156,836 *3491A683882AFBC92419DEC62BA0C098D80AA2D9 9PONFERRADINAS
515,156,837 *349B4A82180DD117215EE2B0ED8A438B6BB5B796 9BSWMINATONETBSW
515,156,838 *3492D827A32EDD7F9DF7CC352D8CC52719354D4F 9SEZICISYHPATEM
515,156,839 *349E450CFAE80CD2ADBAFF18C62FBDF56219B9D6 STEVENUBENCE
515,156,840 *3494B6BEF0B4BCBABE81FBD336503CB32310B431 9themisha9
515,156,841 *349B7C566A77BB8D5EB1DFC847CAA72C513D644E 9VERROOKTEN
515,156,842 *3493B9F21947B186952CAA1D17AEF76DE7403BAD 9iamshannon0
515,156,843 *34922E057D3C88619C63392F3C28357CCB903D5F summeres7
515,156,844 *349B2361B34C146D7A102773937EB8927829DC95 aaz&m
515,156,845 *349229C19D448728B863B5461AD1FA9CBD1D50F1 abcdefggeneral7
515,156,846 *349659786BC86D4D6AC3F1E44A8E761B08B4410A 9WDYBFNAUDWIC
515,156,847 *3492B9F7789887A75B82A0AFAF7DB5BFD9676389 abdessamadalami
515,156,848 *34943B4A6F86A1ADFA5D46B5DC12A62AA3FF4937 TAREKHARATY
515,156,849 *349D5176E2715C3591D3EF56AE511136072E7511 A1.d
515,156,850 *349188082A8F0DFF93D0AEA6D4F6AF7EA30C494A A4FHA
515,156,851 *349F6B77D48A7AEACFB19A345EE0BFEA2506E566 TERRELLCOGHLAN
515,156,852 *349478D7375F38D5C43D22A457465447C54698DE AADH.C
515,156,853 *3492067C97554CAD02EF9ECE7A0F9A5609CB55E3 AAE!O(
515,156,854 *349D6D0F696D06C6DB2B6CB411FC560BF0BE9747 AFBLOKTE9
515,156,855 *3491E0532B8BE712D646A9B1401CB9227A0ECC06 A"FYP
515,156,856 *3498B12440EBF3FB0119E3E856A08173347652C3 TNEIAHCIFFAS
515,156,857 *349224352E84E991A044879E191F9217B603AF51 TNEIASSITALPA1
515,156,858 *349407878A2ACF2440951FCB4D0FCA1FDC9AC3CC ABE.SHARUM
515,156,859 *34977EEAFB434C72DE34A4B4A527BCA1408F381F AGPCMHIK2
515,156,860 *349C51B7DDE0DF057FF7A5ED899907ADD606E808 agr)h
515,156,861 *349FFBFC9C7A2A5598144001D4947AE327AA8FC2 [email protected]
515,156,862 *3495E2346065F4A76009BAA94D54831171261642 [email protected]
515,156,863 *3494292EE91697D9F6C80FC8202BD516E322B174 ABRASAMIENTOSES
515,156,864 *3493D80D12A1F45570CA8897D5E9A1D47949EB77 TOMMIEGEHRING
515,156,865 *34944C52C9DB378527780C09FABE9D205161686F ahjg
515,156,866 *34953BEB7990080143CBD9B1009DA804FB3F5A10 abz~_
515,156,867 *349898FB4BB950DD99A78C90BC9C63E7E185858A AKON=
515,156,868 *3493232E61E9BBBB19A708A1024C7FBA11388759 advilspace
515,156,869 *349EBA5CE38D8AD5CAFD0F1D5D8B1DCE95FBC808 TRACY.LANUM
515,156,870 *3490981B92AAD06C0A4885986AF6F2B56A102A2B alfredoklausner
515,156,871 *349B6CAB1BAC50A58C5D85FFAEE03FB2E3390E9E a/e)j
515,156,872 *34984897C316C69306CD6A125E4206DDB04BE5D6 AEU
515,156,873 *349D491CC764A3ABC908FEA421A1E14402E575E2 aljg#
515,156,874 *349D74D76834F2BC6582EE5CD77F28EC86F0DDA5 AFRIENDOFKAPOR'S,ERICROSENFELD,AGRADUATE
515,156,875 *349AF69F9949805FEDF0E2552A1F713DC8531742 AGMARKNET
515,156,876 *3498AB1BBD73FCFE09F57C52EDC12F1686C11227 TSAWMSENG.SENGSENG
515,156,877 *34998BC8C9887317E069E7CD030CAB3F886CFFFC TSERMPOS
515,156,878 *3492A07385DF5869FC6C47D27DE7DBE8B299B77D AHWCI
515,156,879 *34997AC341A8873298076F2854182E6E0DB8CA1C ajettrob2
515,156,880 *349313F2CF12F1E4931786C94707018C051D3B75 TYLERVARGHESE
515,156,881 *349675EB1B845DDD81B6718D0B997658EC968D9A TYMON-DOGG-&-THE-QUIKENING
515,156,882 *349485EC5F025BE58EE541069E27F816CB232400 AM,L
515,156,883 *3493642AA3305EAB2223014DFEB84827229C871D ALDENPEAIRS
515,156,884 *3494E6C4191B6DAE486B8872E819EE2F2983CD35 ALEXSLAYMAKER
515,156,885 *34956338BAB53B0E5AC507DFB00DB16955DFC20F alfalah
515,156,886 *349376499E90E63E6E9BDC50AEF9CCEBDD769865 AMSLATEM3
515,156,887 *34927B2DAB69C3D7402A09EAEB599EE3A4EAFD3D al-khadi'a
515,156,888 *349971D417D8CE275AD69DA97AFBB5AD953042E2 amy.m.krause
515,156,889 *349D33955CFA3AEE7E9D2EEFEF347FA1C074F041 UHYRLIGST7
515,156,890 *349F544794D4131AF6ED90AFD1E491440D4A4E93 ukrywala4
515,156,891 *349671227CDB18686B4AA87D9B2A29A735C2B109 ANDRES.HITTSON
515,156,892 *3492E5A85A5FF8F6CF284C3D5D024A3317EDC7AE ANDREWHEMAUER
515,156,893 *34995B3E87A6C9CAEABA15360A533CFA7910EADC ALON SHAFIR
515,156,894 *349A1E143A2D0CA0BFD8B016A4726E5EDD631FEC UNCONSPICUOUSLIES9
515,156,895 *34971DDADCE9B5E8A893589953601A36F0E00F62 aluninum4
515,156,896 *349AF643F5B6D3229C1BE73BC02BCD8CDE1C8B36 ALVINMANIERI
515,156,897 *349DA3E9F4C32CA73CEB95C55906E5F98D91DB56 ANEVENINGWITHHEFNERPART3
515,156,898 *34952E85FA92DE7DCFD8C6F2643C9235FFE496FE UNL1TURG1ZE
515,156,899 *3498D0A3D86BF713186A761B036AF654963417BE ANIBALZORMAN
515,156,900 *349329B4C63FAC098843D98C2596538FA970E0D5 annagasiorek
515,156,901 *349E13C6BE5CDB8292C9EEC172452A3586BD16C4 antiphysicalness3
515,156,902 *349FA3025367044291C452CC7B77DA7DE34284DC U#SAAA
515,156,903 *349FD19160551F4EB6E509C3CDBF80045F64E707 uzrastom1
515,156,904 *34995B4DC11B7C55AF699A49BB5F84BC0F26C3D2 ANTONE.ABLING
515,156,905 *3498DB0DED169EF64EAF7AAE36BCDA5C1191CA15 vanddamp0
515,156,906 *349E9AED964EDCED746FBB005CB8D3E40529E9DA antonydobkins
515,156,907 *3499EE01537572F75C6D7E32FFEF110A11C91431 vannessa.beltran
515,156,908 *349C8CB20B8E767BDD461C3B0E3B3AB5CBE7F1BA vanve
515,156,909 *349D53E05C07CFB81495D98EEF0FB938412D1C11 ARONEFS1
515,156,910 *349B32187BE515C7634202133FB4B9252E3BCA44 ARSHES
515,156,911 *349A879CADD2C439B72EA1A31EBC17AE65870621 venedizo1
515,156,912 *349C82CCFE4D3C11EDAFC1E75E0E81B96419E945 apba
515,156,913 *34982FFD86FCE1849CCF2FF5F7C90BA24190BEEF VERN.GARNAND
515,156,914 *349BCD62D0D57FF85350F1CC53174656C5F1CAEA APLBM
515,156,915 *3491601FCED121ABC26D1E6EA37B1B786264CD91 APUF
515,156,916 *34911A7FD6B21D54918CBE25A083D61F4CBD59EB ARBAN
515,156,917 *349D5B11AB204FD6573FD0D4144390E73BAE1C68 VICKY SLIZEWSKI
515,156,918 *349700358E873C9C32BB043C9A33B921D9F01C94 ARCHIE.VAUGHNER
515,156,919 *3495DCDC95704E5558A39B9B80231F3A7DF4FC6C ATADVIDO0
515,156,920 *349E13EED45189DB1A7353D343834F905B115DB6 ATAPATTUS
515,156,921 *349C659E119046B91E7D56F54D090B95F6EC01F8 ATWR-
515,156,922 *349AD26951C83C293453C871AEF76FE85C21A29E arielflip0
515,156,923 *3495F45F271889DC26116758A89FC8A3D03C496E [email protected]
515,156,924 *349F784A3615B81CDF055BED23C854B7F379E20D ARINGSLA3
515,156,925 *3494D4C68FF77633B0B093D36F0D83077F306624 AUG1566
515,156,926 *349634020EA7B8519F46CECEAAD9647972FC273F ave+o
515,156,927 *3499EBBC6906A0D5D4EBD40A97F0C5F3B5BC64CB avvn
515,156,928 *349EE99DFD5B57B664EC839AE4AF2BFD57617ED4 VONFAILOR
515,156,929 *349B7F774BE1B39BCC2D6408DA85967F6EF64C85 AWAY112233
515,156,930 *349C2123EC009AF1812C076A6FDF09AB6096C3D0 ASEJP
515,156,931 *3492AC4B0FAADEDA115DBB835C4B708819924549 ashleigh-symons
515,156,932 *349FA04F59C3B91BE494605DF3005A6D7EEABF0D ASHLEY.ESTEP
515,156,933 *349508C8C1F0357EBC7CF2F66206A0E68E58D413 ayefd
515,156,934 *349EC9E0943404FC83999DB7698502C37606E19C AZSXDC388
515,156,935 *349253680FCAD3A522C00B8F664B59E4F2B70043 B+02
515,156,936 *34962DEB70E65244AB5D999C9F1E1065D7656CD9 WALLSWITCH
515,156,937 *349B0828011AA3ED916483BCB87E054CAA5F74A6 [email protected]
515,156,938 *3491231707E4F162913C21B17A0CBDCBC94631DC ASWW:
515,156,939 *3492F6D34FBD69FFBBF3419528041E7666AC5F9A ATALANTAS1
515,156,940 *349CC6F17F7543AFFBADC2B0BFCD11344E451B50 ATE3TALL
515,156,941 *349CED207755E6C14C8BB2DB6E306781D5E6B0CE B60G
515,156,942 *3499C89A745F977DC8CAFE8552BFE1D1C04846F2 audv2
515,156,943 *3491E30E3FD5DE2716D702348033696F3A767421 b#8wy
515,156,944 *3491586B45E54544ADE8A7B0773CEBB212F3174B Ba)8
515,156,945 *349440497004D742870D70CB4BBE8CB94AC5DDD5 bafouezed
515,156,946 *3493F089E63751DC7C174573AE06689A57E817A3 [email protected]
515,156,947 *3493E3F32931844570FC38DDF59C7234A5389D09 WAYNE P MARRIOTT
515,156,948 *349F1DDDCAFC32D89C8A2A69E0C692CF729B36A3 avaragye8
515,156,949 *349A6388C88FF6745506026F7AEE267E8A05BA1C BAREEAA
515,156,950 *3491A8ACB5B320C78D1F7CF526D5CFE38B4787BD [email protected]
515,156,951 *349B29AADB6E71546187B53AAE3F1AE1AEC5CCE9 AVKRIMINALISERAR
515,156,952 *349FFF94261E9723CDED30AEF69975053227A252 bassaholics(out-takejamthang)
515,156,953 *3495319E5534066D69860EBC0C852BBD8331AE94 BCUIZ
515,156,954 *349EB979AA4158785876181831173EA418ECBD47 bd&k
515,156,955 *3498684C0372E3422175905A2319D0A89CF55441 AZGIRTY
515,156,956 *349D71CECDA93F1E2CAC980C6C7C35626497CDE7 BE0MU
515,156,957 *3495788847F5223AED9A2DD8327CBB49F7ADAF16 BEANILTA
515,156,958 *3490345F89A3EC4FE8BC9D7D4EA65E8310180E0A WHITNEYSCHERRMAN
515,156,959 *349E337B4BE3E112F62B8B2F63265DD506763F95 WIKIJAM
515,156,960 *34974AED907362F56C0EE077B62D067F61272E43 b:2ro
515,156,961 *349044703B9EC5C6F54DB86863D70C508AF98CD0 BEK:;
515,156,962 *34976599CE1ED7CE2AE4BA9B95674B7A25295B79 BELINDAHELLIER
515,156,963 *3496C114A8AF2059B14BAC05E8D45ADEFD39B0A6 [email protected]
515,156,964 *349E22751CFA06BF546A25FAE409CBF30087DA8E B6Q8R
515,156,965 *3498714581FB50A668D7DD818A285EF47A7EFE30 BERNARDODEFOREST
515,156,966 *34935ED37DFD7D9ABF2CB594E317B594EFE33093 WINDOWSFRIEND
515,156,967 *3490F7A0A827A332D66CEB22A39DA34168C3620C babyfoobar
515,156,968 *349CC82029C5FEC1A112A9A418A99DB30066A3FE WIPFELN
515,156,969 *3493F507AC357CCB93DDEC98CB8AD1667CE8691A bezoldigde?
515,156,970 *349A20301E0F6951FDC1B052D823505450662584 BARRETT.MAURACHER
515,156,971 *349D598D5AE78861559BC0B2614800043554785B barrypersky
515,156,972 *3498CADD0D533C86B630D9DFA9D34FFCC4430AE5 BART.BADAGLIACCA
515,156,973 *349F7C0DE8303DFEE74B59113A41DD80C6A66D61 BFW#E
515,156,974 *349D30A6169BEC0D016A66FB316343C2F5D8FC71 b?$gl
515,156,975 *3495DA39FEA767F1963B892782360E1082B2F860 wwwarlingtonhistori
515,156,976 *349A128D463A70AAE7B15231488904E8CEFCC8D3 bc5dk
515,156,977 *3491BDA0DF3841DBF416B874F266709D2FAE96AF BHT2C
515,156,978 *34921CF93D91AE493184D53A6315B6122F3B60FE BD$:L
515,156,979 *34975DB974564A1DA535C03A45692C569768A541 BIGBUTCH29
515,156,980 *34923B475FEF89F113FC648443A63BE63DD781F7 B,E4
515,156,981 *3491667D2E83339BB91888335915346D5C934F4F xfst58aaa4j22dq
515,156,982 *349ECB7ACFD2036FF62E8CD77BDB82A679061F4D [email protected]
515,156,983 *3491D11BE93515838D185BE544B3BFB3ACB117DB BELINDAMARGARETH
515,156,984 *349485EB06B762CB1F7BC667B27C65D728415154 BENONORATA
515,156,985 *3498580A9E6F60D8763D4C594CEF92A16457ED73 BENTACORING
515,156,986 *349F7C7D3B4E53CEFE8C88AB119970FFFE3BF273 )X(.~`qB
515,156,987 *3491722DC3222C8536F4A655FAA81F0276D7EF8B xvpfbve1
515,156,988 *349CB467F9C3FB20BE45C7DF399D662F825A6B79 B-FLAT
515,156,989 *3493D22D919776179CDBBD287526AE484F75A809 blaise-bermejo
515,156,990 *349B6A6D9832768D576248E47A690F990326EDA3 blakecuomo
515,156,991 *349276D211FB9D4BF014B22EC39E976407712843 YAKKELOTMVJHVFA2
515,156,992 *3490CAF20B5E76F3B991AD90AA72B6DE8D190B46 BLAUERTEICH
515,156,993 *34955710575D862873A65608B3695D265F3BD40E blent
515,156,994 *349C8286745AD333AB7D1468AA514F5E8F0A42AE YANTHI.BOHARI
515,156,995 *349BA7AEC839AE79E84CC5AE526C01CC41119DC8 [email protected]
515,156,996 *349D0ECAB4B6787B9C40C1EFF4730ADF919CE22A yarzathura
515,156,997 *34971581F9B6C0CD3B5914A2FFBB95D940B9E0E2 bia;.
515,156,998 *349E14BA08615084B70B6C5F7B19E5440D94F7D7 yesotha-kanniah
515,156,999 *34999D7C9475182AB577AF5A09B073FAE32DAC8B bnnmf
515,157,000 *349485EDCD169C97E0A42E4F7FA4C21E6A410E95 BOB2BY
515,157,001 *3496119E37B352BFDB0AA65693E3E61790DE5DA9 bobminehart
515,157,002 *3494B7EC429465526CDA9F905266B60F1F3D418F yoshimi-berrecloth
515,157,003 *349F728C3A6D071C4F7B87ACB2F43C25DC6D235E You'dBetterGoNow
515,157,004 *349408B09E54B9FF4C0988B4A79522069E9B5D2F BLOWEDANDGONE
515,157,005 *349D3E927BA9857D5862959237C97AC87267A95F BONNIE>3ME
515,157,006 *34922857C07EB997118B0439BA65231F708C516C [email protected]
515,157,007 *3498692F5107898EEAF36CA0EE4F0341A12072E4 YURIDIA MURRIETA
515,157,008 *349D9CA75CE4C3E693D62A2CF87B76A5A991C946 B.M:7
515,157,009 *349DF861084045BC75799479AB2C6CEB4677A60C bmro8
515,157,010 *349E2E6FD45CF94FE98546B02405F2E3909D6835 zazivom8
515,157,011 *349CE502B088CDBDCCAE5FBBE1DD8A4DA7068297 bpd9_
515,157,012 *349BBDB999BC29FB8C8C7AC22CC07B2D9F80D161 zha.haha
515,157,013 *3490826AC0871FDFC2B4AE79CCB793BFE9FB529B BPM.16
515,157,014 *3490D8726D002043157D1281B1EA06C20423C91D [email protected]
515,157,015 *34925580A9E7E5CB3453F98ECFDFD5F69B85887E BQQW2
515,157,016 *349FAD969E156DF8D2130043235296DFD1259F8A zisun.zinc
515,157,017 *349B8E34B49979B220429BE79D69812E1E60ED7B b;qy/
515,157,018 *349512AC6C2634E28D3FFE7A093FBDE8D68C10D1 zWaW=/
515,157,019 *34936BB7163FD9449AFC6B192A8E6D5BAA3290C6 ZWIJMELDRANKSED
515,157,020 *34965378BF456CFB091186D8F979EB2DA8146AD0 [email protected]
515,157,021 *34997686D94CFF508B5D671A8AC2EADA7CAA98A3 BREAD,LOVEANDDREAMS(PARKSIDEDUBMIX)
515,157,022 *3492330CE16DB950E9BC569503D8F5125E43E792 BRENT.GUILLEN
515,157,023 *34995CE983F7987A9D6728BE8863D823E99ECB0F BRENTON-VENABLES
515,157,024 *3498A1EF2F87AD7006E06DA280FE1EFA3FE1B1CD BRETTGARRIGAN
515,157,025 *349BA841C77AE054853D5396E10E9BDA220817F3 brettmariacher
515,157,026 *349AB3990596AB1307EF3D5809224E6DBA2BFE9B brfkx
515,157,027 *349B718869B1A23510F69BADE9A2E673B835CAB8 [email protected]
515,157,028 *349296316659AF046EA2281EC8C419F5579AECFC BS%S7
515,157,029 *349F4378500D4DAE05368971EDB7E1C96072B848 BTFI
515,157,030 *349670DDED17EAAC348A743197ECF9D6EC3D6BD4 BTZk
515,157,031 *349D405B090342B6FA995381D1213503DB20A464 budhalleen
515,157,032 *349F10F7CFAEEB90E15FBA40FEC8E1672AC76FED b=ut"
515,157,033 *34984938A15E99ABC9894F631D95D10A5CFC7985 МЕТТГІАС
515,157,034 *349792213AFD590478FB65A0BF26D02B765D3B28 [email protected]
515,157,035 *3491B5BF37A9456021CD4FA6F91720C6C870B5AF bvki
515,157,036 *3491802164936BFE5BFF54514DF190AD046BC77E BRODY.ROSE
515,157,037 *3496C8CB1E99C13269F273E9BCA71FB2ED40C516 одрава
515,157,038 *3496B105F293E486A281585A2989A81ED9975FE3 BX?-F
515,157,039 *34944DB2F14FB99E45A8C8B6E80D71EFBE04AF2B B$RVM
515,157,040 *34909D2337B781F406DDB80CDEFFE304B0E18640 brycecatello
515,157,041 *349A7C3D554260AB3282B944631E189C751B27F0 b=yqi
515,157,042 *349BCA74DF6EFF465E02E16EE1F5EC8507F9487A c=2yb
515,157,043 *349DE007FA5A2E71259305D33FA006314F2D9E31 bufi
515,157,044 *349EAB206C8B95A99CC85A86F13536E69508EC58 bush pig
515,157,045 *349247E02AD417CD23C40745D2D800A3F9EB4601 [email protected]
515,157,046 *349038A01D41085C68469F5BBDE35E204690C5C8 [email protected]
515,157,047 *34944BF2873A2DB0665926DB2BF812877F80FA19 CALYPTRAEOTHERES
515,157,048 *349E7960AA8AEB5B362BD9DCA002B98D22FDBB7F CANGE
515,157,049 *349587EC48D2629EDE49EAE6F1061FA6B94339F2 c7g;0
515,157,050 *349C16F86A867E41C6B0D2D6A62ADBC3A8695F19 CARROLL.CONGRESS
515,157,051 *349035B9A7065BFF9E61206D47470D52E89728B0 CARY.CALLAWAY
515,157,052 *349ABEB6875C515C66210973430CC020CBBDDA73 CARYGIGSTAD
515,157,053 *34996545EE3D6009E24CFDF48CE8BB8EABE602C3 CAA4366
515,157,054 *34986FFC7F9BB98FDE091E4DFC6ABC4C15738F84 CASTIGADOR.POR.HERENCIA
515,157,055 *34917FDB93826C02B5D6E9AF22DE7870A5D9FA57 CALEBAKIYAMA
515,157,056 *34923836C337C6D0E07ACEAA18F3E9067A64046C [email protected]
515,157,057 *349DFC2B99DB432302ADF44085D7DEC23315F699 CATSRUS8
515,157,058 *349E58E11CDDBA69E831DBD4EBF2AB7034B65E9F CB&7
515,157,059 *349DA597768879388E1987F5D97C3F927AAB3779 cartoon showroom
515,157,060 *349C04A8E24B32678F554109CC6B5B099CC19963 CATORCETIENE15
515,157,061 *349436996D4DB4846D7B5B11C01FC6A6DDA494E2 CGAG?
515,157,062 *3490966B38439432B0B047E086AF1C8A3944BFF0 cct;q
515,157,063 *3490C5CFDEFA27477368AA04C2F64194AB49A1C0 C"EAG
515,157,064 *3491464DD986ACFC3DDD26228A76CEBD846B51C5 [email protected]
515,157,065 *349A90D9985B4699481129EFD9521C95E146D054 chad-haire
515,157,066 *34994E532854A10F2BB6F5A584722DF287002C0F CHAMPOEG1
515,157,067 *349101A4B5423CE29D078714AB08CC96EB75CF4A [email protected]
515,157,068 *349FEABC52518348DA66E10D2B8549DEAE42CA5F Chapter247:Sectumsempra
515,157,069 *3491C72D33213422248B1831381E859942811EBA CHARLEYFINLAYSON
515,157,070 *34981089A6FB008E1F296A4CEE1139E379599CAD [email protected]#$%^
515,157,071 *34919148A3B6230943EC92405B0BF00816857A5C CJCOOL
515,157,072 *3498E92FFC06D475400FDEC74000A275885EF01A ckrf
515,157,073 *3492FA40DAB570E46101DC79AAC3CF31B0EE8DBC CHERRISA
515,157,074 *34941B0A17102FCD2F3FE63E4F6D950EC680DF03 1300662 POHJOIS-KARJALAN TY
515,157,075 *34943BBD16D7D071D130F2B24E5D9BC89695F212 130YARETZI
515,157,076 *3495BE634EB7C221417D9E2644BCE268061C0CDA Chloie
515,157,077 *349E3954D424845FBF5D1D257A384760CB315A68 chq.-
515,157,078 *3492B99610A8E551FDD1D040CF9E59A6BB1E9DBC chris.mabary
515,157,079 *34935545C857F42A1EC67D49EE04D6124E56C93A COD6E
515,157,080 *3495F363D04C984C91A5C3F8BB2A8E670121D9B7 COLINMORACE
515,157,081 *3497D757ED7B7D02E4D626CA94E58FC47819A355 colintawwater
515,157,082 *3492FA5419199BC8DA67E3B8BAC9A4527F2C3E75 1638014 KONSULTTIEN-KOULUTTAMINEN-SAI-PKT-S
515,157,083 *34922A93358B83ADF80869E59991732EE49448A6 COMARCA.DE.TABEIROS.TIERRA.DE.MONTES
515,157,084 *3492214189C32E0BFE43AB620EF98C000E58F7E2 C+I7M
515,157,085 *34984B04E20D5D18D1DA0530BDCED9A190F34CDE COUFFERBSW
515,157,086 *349DDD2ECD63BEE26B2AF3B7EDDE84FF6864BB64 CKRHARD6
515,157,087 *34941ED42B7034C8ABF62C47CA905958CDEAFD1C cp0li
515,157,088 *3490A799D026132FF519F2C25CC6215DFC4C27CC 1BCOUGAR
515,157,089 *3499B9F542E14AEFC14E183D8AFBEF89213BC6FE clearget
515,157,090 *34965BF63D82ACB5651331A3C47FFF378D0ED00E CLEMENTVANWIEREN
515,157,091 *349A8AD66C26A7890F438471A3924CC7D7262574 cleopatra 2001
515,157,092 *349252C4F0C9F4DB32C76E19B55258B9C6D58A7B cq;-
515,157,093 *349D837BE5FA5CC984908E438A6895C9B5B39A93 1CFINELLIE
515,157,094 *3496E0F4CC954805DDA7196E300E50005A16EF6E CQ:9
515,157,095 *349236E0E08974282128EF69129CED60D786F865 [email protected]
515,157,096 *349CC8D647D8D0AF37839527F3F557C062EFF737 clo53tn9
515,157,097 *3496F94730B79A114F9A745C86F06B2335C658C4 cm#3k
515,157,098 *349700C51B8050D30C06883FEE11FC8DED690C43 cmclb
515,157,099 *349F9746099FC5A683BA7EBBE39511EFFF9A5BF5 [email protected]
515,157,100 *349AE45CFE7F551185163E6F08EF2C1FCD296435 crew-introduction
515,157,101 *3492AD2A4A62EA3672BD775711E6EFCF1B60EBAD cn#i4
515,157,102 *349219DB190F9478946D43B674A8CF5A7557CA0C CODEACTION
515,157,103 *349D401C0568F97F4990A21493E2B15E43A7FB2E 1juedischfranzoesische
515,157,104 *349A8DE8B4E657DD10B63102DF1C3C34E43F0494 CODYHELSTAD
515,157,105 *3494C49D76773A6351FB9C8112432FF4F279A29A colbyzakes
515,157,106 *349BBE798D6494C9D264041B0F0AD0505EA741A4 COLE.GORNEAULT
515,157,107 *34986D05F4FEF35DA77042AFD3D1E0ECAE332407 c"ta
515,157,108 *349B3DE0A14E6875E66F332C1E5662AC89463EE6 1.koulutovereitakin
515,157,109 *3491AE58D06D2CD049E0D6EF898971021798E195 COLLOPHORE.
515,157,110 *3495CB6AC1D90EBFC79E5AB88A5DF6B80787E5FB COLPENHA2
515,157,111 *3492B04C5770B4732495D12042FCE8D973573695 1-lee-besuchs
515,157,112 *3495E7682877382EB4231C366A8519F53192374F 1-lmtools-ohjelmalla
515,157,113 *349175BD35034716057A65AFF4A379163E6760AB c:tr
515,157,114 *349291AFECCC7C75936C0A3598D4AA65488DFFE5 1 MITALITAITEESSAAN
515,157,115 *349E022154753E893310ACC6458791D9EDAA077D 1.mobiilioppijan
515,157,116 *349FF4DEBFE04DCFEAFFEC2202209A5DD76653DA 1monetaristisempaan
515,157,117 *3497D8DFFAC4F4CEA9C09DB816CF4169ECC06DCC 1 MUOTI-ILMAUSTEN
515,157,118 *3491179100CB32DE779DAD728248686E0473347C 1MYCOSMOS8
515,157,119 *349C8E63CBE316F333636BF68C5D58394A9A977D 1PESHMAERGADER
515,157,120 *3493558DC5F5987616D5A2B22931FDB2404694D3 c:"v)
515,157,121 *349CE87A4592CA4912F680AB806C7F8EDC42292E 1.RASVOITTUVIEN
515,157,122 *349BAF8882CDE4C65F95F4BB9E0E9A8F473E7DD2 1 rektorenstuhls
515,157,123 *3493E15077C3C5229CFC444247E9D06683324E4E CONRADRUDI
515,157,124 *349DFCFA5928E01C92E99A60830CDFEE6CF8ED84 constant.pressure
515,157,125 *3494EBE41082B4E4C3894EAEAC8A2F70BFA362F7 consultant
515,157,126 *349C61951B14B75CEC5214794038478F96BB943C cy9-1
515,157,127 *349913D8B2423A9B66FF790797B53D81826E92CE COOP3R4+ON5
515,157,128 *34948F0D81CEBF8821FB9D7CABBBDC83DD9DD836 CYRUS.MASSON
515,157,129 *34953327B075151D9F2A9DB70FFB7BBC965DF121 CORNELLDORSEY
515,157,130 *34922C7EBD8BD9BAF8070793B5BA3EFE1142D623 1.uudisasutusalueiden
515,157,131 *3496939E7CEC5ECA6EBF610A038C3849395A142D cp=nx
515,157,132 *349E0F1E0945E730CCBAE69A76B943CFC9CB8AAC C:\PROGRAM.FILES\ADOBE\ADOBE.BRIDGE.CS4\RESOURCE\ADOBE_EPIC\EULA\NN.LPROJ\INSTALL.HTML
515,157,133 *34964A3E4CD88FDBEE07CE7100F40494CA3904FB 1-ZUEBERTS
515,157,134 *3498E8BC5C72EEB1441D54CEF3DCC6B07600EFB2 1ZVSPLXCW
515,157,135 *3498D0F96AB92AD8221BC226C904B7B702C9E36B d4duchu$
515,157,136 *349972FB27EB5ED14437AEA94091E511465E5C9C d/74p
515,157,137 *349F99AED71712B3B31590E2CB628D63437706CC cressa-johnson
515,157,138 *349132D728452AA7AA6860633CD109EE5810F74A 2467924 AND HE TOLD HOSNI MUBARAK THIS , FOR EXAMPLE .
515,157,139 *3490893D709703EE3EA47A16C40C796A49C2A848 CRUZCALLE
515,157,140 *349D01A62B8FB0501289EF7B94EE9CBD4FE57FC0 C!-s
515,157,141 *349DBE1C73E58CDF8E5A78C3C48A750B9A6643B6 DAMAGE106107
515,157,142 *349DCF9D28EF768FB75C0D17ACFFE8EF2AE731E4 damonstacy
515,157,143 *3499DEBA51C36147A09150E70EBD942AFAEF4F3E c"s9(
515,157,144 *34904218B5ADEFFEA0E55E15558426CBBD7332BA 2618332 einhalbesjahrlang
515,157,145 *349BD7CDCB059B69348B9479FB0ADFE4C568037F [email protected]
515,157,146 *3498420C73C716BB4E334CB47C97851E15815E0C ct/3s
515,157,147 *349D64546215990E4D56B1F6453964B066C07CC0 danguya
515,157,148 *349D990FF5C09C26E9E3FC0D0947E04FBB3154D0 DANTALIAN'S CHARIOT
515,157,149 *349F4E64BE50200FC599543232E19F9968016E86 CT-LK
515,157,150 *3495F9070F030B019B994019F365B90F8C352C26 DARIOZARLENGA
515,157,151 *3491B1C211610A8F4B72698E62B08DE33A9C188D DARNELLTIMMERMANS
515,157,152 *349CE80664F279F0732AF68C8B47A932FB968EE6 DARONBRIHM
515,157,153 *3497A29DC1FA43F588F538BA49C314BD557761A1 DARYLKRAMER
515,157,154 *349FD5561C0D08EC3F413F41F26F32EAEF4F1C23 CURTIS.OILVARES
515,157,155 *34945114B0F0B961A302393B45541B9A1D2CA0D2 CUSTINESHANDBALL54
515,157,156 *349776E2117770D509D5DBF6C6A275F0735D4C35 c&uw0
515,157,157 *349CCB12ACED9E67D23975D7ADDA8A5BA22FC1E7 27WINI8
515,157,158 *349F2D50CA89068D276EA0842E09FF3AE0BDD3C7 davidhuet
515,157,159 *349129F94DECFFD43DCDDC648FF5CEC4532B7461 db1;v
515,157,160 *34920B875DD08DCFA7875036B70216D92125CB09 2ANEWYORK
515,157,161 *349CB44AABC908B0F2439D3B2E3832B44B0752B0 DB%KC
515,157,162 *349CE8A0BB994F7B36E3770E798CDEF1BBED6FF6 dcriront8
515,157,163 *349AEC7EED1FA9FF82AC594D3943816D3CFA28F0 dd4_m
515,157,164 *349664BB021B05FB5A5C1A47A88FD09339B63C3D [email protected]
515,157,165 *3495D163146B88817B595CCF08EE39D37AB970E4 D2TI-
515,157,166 *349BB48145DCF518764094C0B0DF29A849BC7D03 2EMPEIRO
515,157,167 *3492BD520FD4DA473F784E933CF669B88D19A587 DEANDREHOYER
515,157,168 *349D8DBA9CF4DE83B30C29261B33A2EF19CE1EF2 2fformalroute
515,157,169 *349EF8A6DBB2457F95640F9EF6E12CAAB48F6A03 2GFWTSQJ
515,157,170 *349D794C34190AE63B956829FC09C45483B0C201 2ILUVPAUL8
515,157,171 *3495EF1CC30AE60C1E3D9B018F4B55DA2CFD0B25 2PALESTINIAN-LED
515,157,172 *3497C1046B171A17B6AF20C15F4E72B3D5BFE63B DEFIBRILLATION
515,157,173 *3491F88A4F22BE26AEA67F28A1A9F3AF9D9219D0 2.sciolla
515,157,174 *3492FCFAD451738FFF70B94D54594E265470BF8C d6ozl
515,157,175 *34971958B343E81D1FFEA7D1AC791A288DB93299 D82638
515,157,176 *34974135B6D5C97BF76953037B9FC9BCDB010A91 dejretle
515,157,177 *349D5748B85925BA0DF8CFA9ACC85B631F146245 31011374
515,157,178 *349D92F432E06BF71F4EE26E861B134719FEB97D [email protected]
515,157,179 *349C7DED7806C3CEF1B52AD119AF3F6F5F9CA2C0 DENISE VALDIVIA
515,157,180 *349DC9C8AB3082C4562C899D825099D5AFBE86CF damua
515,157,181 *3495F780376CAC11BDC3E36FDE8C2C3BF0398357 DANIELLEMABE
515,157,182 *349B11558CEBDFB28E6A4D891001B39E5D47F6FB 3==B~O-~o(>_0)
515,157,183 *34964F0A99864A707EE10D99E416211BE5178D9B danielle-valeriano
515,157,184 *3492EF95E6F955679716334938036BEC2E3819EC DERRICK-HEDGES
515,157,185 *3496EDFD3D5B94BF78BF5E072344462D25F56015 DANKOPOTIC
515,157,186 *3492ACA8E72E25C3612BFAE8479C276607D32318 darellbarg
515,157,187 *349B5C26DE7F6B8E842587EA81BF3169B8CD2A36 3GITAMTPE
515,157,188 *34917E50143B22AAC9C3B0384E3DF6E1D5BB977B 3GUESTNEW
515,157,189 *34977BD17DB34CB14DAB7AF2F33E89ED59751BCB detpeccanon
515,157,190 *349A8624F40F7C9CD0BDC33F10BBE78938B108DF DARNOF
515,157,191 *34976B46E3E3BE00FCB5B2B33C6BF0AB8F66B7DF DARREL.ENGELHARDT
515,157,192 *349970388BAEFCA05DB35ED2410D1A51143A7239 DARRENDEVOS
515,157,193 *349F6C54F9C8036180012E00CED7ACE8B8F32CB9 dexteradib
515,157,194 *349EC4B18A783E8B8F48D53651108BB6C2F753A7 3-normaalistuminen
515,157,195 *349AF3FE5097715A68D166E9033521AFDA0E03B9 DF/I;
515,157,196 *349DABBD2E9DEB722A54DF954C4A813C5571F1DC DFKH5
515,157,197 *349B1C6AA20680AA67B39CEF3BECFD9031DE406C 3####P.~O.~O.SPLAT
515,157,198 *34953B089831949DD3B967E45540A540930AC597 DAUN+INGN3SS
515,157,199 *349628188CE2E529F25DA481E57DE3C29BF7B914 3:[email protected]=-&LT;STDiN&GT;;
515,157,200 *349D374C13D54F895527ABB285FA3E83ADEA2085 DG=KU
515,157,201 *34974A87DAEAC5F5E84D48D81431D8B3E465FA23 DhpB
515,157,202 *34926A5E709C4FCA9871D06CF009E1957A8F5443 DC&/#
515,157,203 *34967AAE14271B16C661F0CCE818874F3B403975 DDW.F
515,157,204 *349B0C101ADAE21CB7F8A41E5BC2F4FD71BFF9CC [email protected]
515,157,205 *349D921D273D79CF3FC8A6E3972A91ED348A81E0 4GOIR3M
515,157,206 *3498FB1C519AE71A10F195D3FB30894B5EF7C4D9 DIPINTAS2
515,157,207 *349EA0F4AA3590E280649EBA3700FD8CE4422E33 deki
515,157,208 *349683DDB2C8A9EF196564BB64E34E27E4B1F430 DKERI
515,157,209 *349AAEC49E4F49EA022147D075F54E232C64B996 4MOOCOWBEAVIS
515,157,210 *349F6B4F523530D3C9CA584E5229AE610332BC95 dlq)l
515,157,211 *34960CD70E09A7FE51F4F4838D45328F66C4D49A DMK+0
515,157,212 *349127C9484DF98423FE4EC0DCBDF1460CDAE618 do7,0
515,157,213 *3494DBA84C1391CB9D1D9B6CF34ACB99BAB47F00 doblb
515,157,214 *3492E8B24D3CE299D7B04C9BDC477261D5B63202 DF/CV
515,157,215 *349B5B48CBA11FCDF1C7F2618EF7F560178612E1 dominiquehasen
515,157,216 *3491489F3040B24672A78F28F9AC663F3F5DF329 donaldpicken
515,157,217 *349B27E1462A9500D1F2BCC02610DC0B8F759340 [email protected]
515,157,218 *34949A2A76A8C70846F132C4CB1B8E1EB8E716FF DORALUZ3
515,157,219 *34987A659EA378E534A86B96FD3D5059891B1D72 567891 lausunto.:.housujen.lahkeessa.oleva.langankireym
515,157,220 *3496B8B7D74F6C9C69450F7523511C27B86D46D7 586DARIEN
515,157,221 *3496163C6EF8A8AD3542F186AA271B9A8039444E [email protected]
515,157,222 *34984CCA7DABCCF57C27678125B5393AA59A13DA 5+AB!L!ZER5
515,157,223 *349CE9D267664542F2A6E850A63800A67AD4E47C douglas-shuler
515,157,224 *349F9450B2F101E19C8C43CF4F6245E8B3D2A147 DHS2=
515,157,225 *349CCE76FD7872880E635043D6D788A699FA8377 5D619
515,157,226 *3497D9EA0CF5F02DB411C78A91DE5A1FCCBDE3F4 5ESIVREPUSERP
515,157,227 *34972A23EB34838506E28B61FC3B2D2D0AC822AD DIEGO-GR
515,157,228 *3492C4B95C00347EEBFDEE80C45E99AB417510F1 d;phz
515,157,229 *3492CD16B6DED297D6DEAFC6B4352C51055FBCCA drinkt9
515,157,230 *34967A43CBDF555A899BE4295350BE0A686BC7A3 ds&br
515,157,231 *349D23EAA5B0A570C8C37473627E9F36EF1624C9 di(w0
515,157,232 *34957E3CD446C2900DD0DA4EDFAD8FAF798778E6 Dsent41ment
515,157,233 *349815B68604E20F888D47A3780496AF593D7D15 dts#
515,157,234 *34998A7CF6E76CA6EFF925394F8C5D2B97284AE4 DUMBE5+
515,157,235 *3490EBC088528EC872520762C0AF235EDC10B11F DOJEDN
515,157,236 *3493F7BF5F1B21EBEF2C4FDC520D7C1698F47E83 DWIQG
515,157,237 *34988EE3861D464BB614FA1BE961464995FB5A73 6JAKEPRAISE
515,157,238 *349606B049CBED02341A613AFD83A48F3E6F6BA9 dy9nd11a
515,157,239 *34971CED1D7574BF26B4B6EC12433EA5039D5AC4 DYos
515,157,240 *34999A97351F2FFC99A1558F10C8716D7D1C2B77 [email protected]
515,157,241 *3491BDEE127C0CC607E104B58131BDE1F59ECCC2 dorseydanesh
515,157,242 *34928BFF31FEFB8D2D415C2E48DC586EA2657B50 6OTHERPOLYSYLLABLEREPLICASELFSAMESPIT
515,157,243 *3491BBA7BD6387BD1CA2B8AD4165070906370814 6PONERLO
515,157,244 *349B6D8110C694BAA7CD8F1FBCFA28DC248882FC dot"
515,157,245 *349EF3FC84CF664652D4688334FA641FAE2E433F dougtomlinson
515,157,246 *349F5E025EBB336BA700083FF6BABAFF10B11188 741986 SYL:N.MIELEST
515,157,247 *3498367AC010585EA4EC7C78ACC1C74AD67FB96C eajhgbsw6
515,157,248 *349FF5C33A8AE71B6CB6B7F1CBC0A31303C8ADA6 ECCh
515,157,249 *3490CBE8CC947E9709FC7F17991D3DF3D71FB8FC 7ASPENZEPHYR
515,157,250 *349D0480EFFC38E862C4404854DC16098AE4F15E eddiechristal
515,157,251 *3494F48A56FDDDF54D09DBF9025FD108D47BBE2C EDDIESAMPERI
515,157,252 *3497B5D820552AFD8CED41C58EC5E41BE0C1BABA eddieutterback
515,157,253 *349C4041CC827C2C40506EBD86494CFC78069A90 DRAHTEID 1
515,157,254 *349A9C06526FDF36CAD193A91CFAB9646ACD2DC5 DROPIT(RADIOMIX)
515,157,255 *34959C0AC2CC0FB4C8EE14E1B42051352A4E12D7 EFPCBSW2
515,157,256 *349E11C57E297D0228F3D35362D5C3C2999B3C0E efzsv
515,157,257 *34950A340EA2E2F9E740805387D1CA22FCA3E7AC D?S"M
515,157,258 *349FD7252B7EC222B8BFCA7111F4EA92CABB6546 [email protected]
515,157,259 *34916E1EC426C28091F770C42C2AAF28271F5E9B eiwortsos
515,157,260 *349674D13AD98944980C70AF598DAED2C0971408 dubchant-/-dubchant-dub
515,157,261 *349B91AC303F0C75609E995C3963A288A9BB35D9 7VISSERPS
515,157,262 *349A7645DF855B3C7F44A897ED385F2F79BCEF5C dviae
515,157,263 *349AE3E6A27BDA53F99BAB87F656D2A3211A8C17 dyquzfb554
515,157,264 *34907F42CF443E5FA7CBCC450429E5AF7E330E89 ELVISMICUCCI
515,157,265 *3495826B604D98DEEA4C9ED6E0BAF5FD0952D25D 8BANDITRIESES
515,157,266 *349197E0CA572DC5BF29739DCE553871F9AB97CB EAVV
515,157,267 *349E6BE1C53D0AD54AE0E9E40DAF6838D9C6534B 8d~`>b0
515,157,268 *3494F93C91D92D2381177348902F99D10EF6EB6F emorywandrie
515,157,269 *349EE5E0330C0D0B7251CCA53E0F974718332CE5 8-----D*.*SPLAT
515,157,270 *349A93425CFEA5AB806C76959571CB559083F1C9 EN71.77.25.75
515,157,271 *3496DD5403EC5A1D508751679678C94AC23A9337 ecroulerait5
515,157,272 *349F9559B57E3C9F7C2FAF4EE9EC89EB43102490 EDITHITA
515,157,273 *34979D45564A33096456CA5D89F73B730DFEC9A5 EDMUNDOASTON
515,157,274 *349036CF2928A943A01F4F7538F7269A72986060 8NVASOLDATEN
515,157,275 *3494820A8439F4E25C630A338A6E91B5D082207F eedl?
515,157,276 *349FBFE7302D62DBA29CE68843A6A7665AF25D7F EGPBD
515,157,277 *3491669ED87C1995612354D74A8AED9065BB854E e/=p
515,157,278 *349C441B740710A212568E220ADFCDAAF3459436 8SPAARVERENIGING
515,157,279 *349B583D3EAA90AC573EFA58A4E821158D400001 8>` Splat!
515,157,280 *349B7DEA1ACCF8FE59085399E3791B8F1F054929 8uitgekoterden
515,157,281 *3493CE8B79752467320DF0D067B416C3A53AAB64 eldridgedagnone
515,157,282 *349F93ADBAC04A23576B5F2BB6EF6CD4559FEBDF ELECCION PRESIDENCIAL DE VENEZUELA
515,157,283 *3490E8A6FA67BFAE7FD2207FDAE9BD86401A13D0 EROu
515,157,284 *34974B2F0A54E6D8FAF40F677870507323A48C23 essaystheology
515,157,285 *349B3AE71F2E88755E0A1A81E15805175053EB83 estebandaleus
515,157,286 *3490D5ADCEEDA816462136881CB4D5FACE5585DE estebankojima
515,157,287 *349B1E4E2A1AA19E090BB2386FEE7D2C58378F0D ELLOSE
515,157,288 *349A40FB67F6CC6EFFBBEC3111C4C3F17692F1DE ELMERRICKON
515,157,289 *34976790762BCE0A74589F5490C822A28ABAB9E7 9battiest
515,157,290 *3495C662D848FBAB5C3BD160BCC1C5AC46C702B0 9c04e3dc143cf931a25750c0a9639c8b63
515,157,291 *3490E30915839DCC3F712068FBDE09B103CFE3B6 etu-g
515,157,292 *349B86BC300595CBCD0C2ECD1CF8271B2B173B5D 9DATABASEOPERATIONEN
515,157,293 *34990DF783005537855C2AD78C4E9E72FFBF5752 [email protected]
515,157,294 *349141F2E4495F38CB4720A2BEA7502575708A58 euryphilus
515,157,295 *349C4D6BF58E9A0C79BFEB17E812AC3FB4FF96BE EVAN8407
515,157,296 *349495CFC6058BCD20A92D402E3226698AF40A27 EMILYLENZMEIER
515,157,297 *34996309110F3133FEAFC8E054D5B4A3A5CD488F emulsiel6
515,157,298 *3495DAF2236874CC841FE6BF5711B6F5B22D3A40 EVERETTFRASCA
515,157,299 *3499ECD4549F1A00D2846277C7D58B427738F8D9 [email protected]
515,157,300 *349F2519749348EFB706939DB47E3707C471952A EXE1-1COCID-
515,157,301 *349BD8CB82FDAACA7CADFFB4938967C0A65FC354 en"lp
515,157,302 *3490318012472B716777537AA9762DC9FA2B4DF3 [email protected]
515,157,303 *349C6F98C9F67D2F62303ED70EEA1A1D99A7B23F 9mercedesbenzchef
515,157,304 *34911E6AB20EDCC97B4806E943C9802CBCC13B10 ensdrucked
515,157,305 *349F2536FA50CB0E009748D9F53C4135BA732753 «ENTER
515,157,306 *349791202EA59EE023BEA7C6E1276E33C9C49DDB fairyland(sacrifightarmyremix)
515,157,307 *349EFBC203CD080630D3DA69065F8D876B4124BD FAMEGREATESTPOPSONGS,PART3
515,157,308 *349CFE11AF6561A7FCBF0F277C75B383984685E3 feil
515,157,309 *3494730EDE65881CCF299FCA844001FDC238CD7B fenneloil5
515,157,310 *349019C7748C5619EAA8BA95FE744C078ABC2359 ES.N+
515,157,311 *349FDF1C82AF73E7E4F35E2813634464A7EAB0D7 ETSUKOKOZAKURA,MIFUYUHIIRAGI
515,157,312 *34950F8B6BA45836A5B4654900B494639E961C83 [email protected]
515,157,313 *3491F4F2A3B16141A466910CFB27E8309CCD2D0D eunice0707
515,157,314 *349B96EE157B7E86587EC712417DF8CD4D8DAA76 FLURGARDEROBE
515,157,315 *3493CB76FD6D27649D4D8369EACD51E9A4360098 EVOLC
515,157,316 *34904E01D08F476BD03C764543A5F43417731D3F FORESTMCDAVID
515,157,317 *34904E6FE58D45DEE08502C3E7D6877759B028FF [email protected]@+10n
515,157,318 *349C95DE2940BA2685A07DC2DE276CC472048AFC EY3,E
515,157,319 *3495E5943DE42DAAA24DD2FFA2109EFF4B4B4DDC 9UUSUKSAL
515,157,320 *34966622ED36EF1578DBB5D628A0AE9AA8AD1A96 9wattapes
515,157,321 *349A71B11B395354AB3C8057A91C80EAD363AEF1 a1e4e2d6f35c3ab4901e459a5f37d2a3
515,157,322 *349B09E960562FFAB6329C268107C7DE095AAC98 [email protected]
515,157,323 *349C90D8BDD6AEC8C40BCC8729D24FCDCA618DF6 [email protected]
515,157,324 *349ED848DBB86997DBCBCE2616F73FDD9E2DCD68 FRISIERST
515,157,325 *3499CB48A7D805E8CD708FBE311A47C3F9C03546 FAUSTO.HERMIDA
515,157,326 *349A7EAD41B5E8D5173AD741B0BE7598B66D26DA [email protected]
515,157,327 *3498F96DDF2079ACF36BD08C037B734C1A2CA012 a7nww
515,157,328 *3490369333E79D692B542903D6D7389E27F9F66B feil
515,157,329 *349D35064CA83207801D4E595E230D42324EEF5E GARLICGOPHER
515,157,330 *34989535FB897608BFD9568AFBF8D4E29F667654 aabzf
515,157,331 *34932D2070CEB8EB1EAE6731DD78E8232C740476 garyminion
515,157,332 *3499ACFCDFB26DEAA9789EB7F60B9B026EEB61B2 filibertourraca
515,157,333 *349313AB39996E667C20B22F9D7AD5927968667E aa(gb
515,157,334 *3494265230C65AD5545F59B00F59E57D53BE21D8 FINALE.&.END.TITLES
515,157,335 *3496AAC922D11FD923598ED2FDF9097DED7FC9A8 flame,-pour-oil-on-the-fire,-oleum-addere-camino
515,157,336 *3492FD54434B1990740488114FAF5E56B0D187EC aashaava6
515,157,337 *3492FBAD65E8BDEDBE1CC1B1A2BCB01388CA09CB abelkienast
515,157,338 *34926D315F771F177F67CF8A5C11B5BD0B79FC07 FLYNDERES2
515,157,339 *349609FB92BA49EFEAB6087FCADCBD7BAC9F5906 GILAILTS
515,157,340 *349470E63326919DCDD75D5F1513D00200169C2E GIL.AILTS
515,157,341 *3497372CB8550E7B8B008B4BDDFA28B41EB4A530 foeencom2
515,157,342 *3497982916AE5369CBDE583CA7BF0C4F12A51981 ABROGEESES7
515,157,343 *3492FFAF4E0731F7D72DAD0CE59C906506650035 absolute.almighty,.volume.1
515,157,344 *349581F6A86A9F688B9E0D2F0AA9BF63B89C65B1 France-&-Dom
515,157,345 *34940EDA5CDB26C4E2A56244845F66862E896BB3 FRANCISCOPRATLEY
515,157,346 *3496A87576AA6B00254D1AEBCFEB33947E2103E8 a.!c
515,157,347 *3493063D57834C3B65B0301148947DD4E0F0D5E7 A)CEO
515,157,348 *34939B1D6ECA583005782496BD23BA422F871ED9 [email protected]#
515,157,349 *349392C61F657C914CE8ECF0EFE8DC39F66F3876 AC#XH
515,157,350 *3497AB21A75F0A4E8BBC7AA75ADB91D1A2FED180 [email protected]
515,157,351 *34902DD8FBCAEA9B34634F6BE7E6A15B2916256B fredrickstobierski
515,157,352 *349B64D0D1533C013C984F0E3A3E0736594E6D1F goldspearing
515,157,353 *3493CE8EF39E41281E896DA313B9BD1D03CF733C adgmatthew
515,157,354 *3491ACE63ADE0A70A59DE7E3FCAE0270DEF1BB82 FromFaunatoShunnedFlora
515,157,355 *349ABD8950E58C9429E317D9A3AF5A7BC8373E78 ADL-
515,157,356 *349AA6A9C7DAE5CF1B688F723A4422D6F2073414 [email protected]@8LT35
515,157,357 *3494AC20B6580C53A091418935B371A6C2095A02 gpwu
515,157,358 *349289568AB52090D258E2068F9E6790F62BC737 [email protected]
515,157,359 *34990E597925F3A10EF0FA06B699F2F726CC4AF1 [email protected]
515,157,360 *349873B24CC202B91EE474470C2ABCC86BEF2C3F AEROPUERTO DE RAHIM YAR KHAN
515,157,361 *34917B6D1C6C6284517070BC663843136A5DD443 gadsneow
515,157,362 *3493B7633A6A17A04DFB85CCDE4B3B731139DBD0 AFFONDAR
515,157,363 *34960EA0BF402147EE37FB5858EDB0EF92734ABB h3ma7010g!575
515,157,364 *349484843A78E87996C97998DCD60F5998AA2FAC afif-karim
515,157,365 *3494B5FA24EE3F277B9DE75C5DD63F12B499A534 H9-V
515,157,366 *34905B8467837FED53CD729EF8713F1643664EE0 ag;{
515,157,367 *34977D000C0298B82ACBD2E9F4307D54A8B21F9C [email protected]
515,157,368 *3490F353868BDC6377C6F8133DE5C53E61C8AF70 GCCTTTGCCGTCTTTAAAACATTTTTACATCATCCCTGTTTGATTACTTGGTGTGCTCAT
515,157,369 *349416027D7B9FFD28A0EEF8E02A4DD607FE510F gcl112233
515,157,370 *349CEE8DBDD7902065552C6BF7F973FDE9A6CAF6 HAROONGONDAL
515,157,371 *349484D11CD9BB5D650C487D6AEADA4C88F4A057 GENIOKIL
515,157,372 *34939737708A7D397F6FB3DC0ED264095F4DCBD0 HEATHVAUGHAN
515,157,373 *3496834E5BA37D3A302FA21EDA4DD0E232198D29 HEIDELBERD
515,157,374 *349C42F8E0F8F778376AC7F348370E1D6BF7D7DE HERBERT DEE
515,157,375 *3490A286C9AA9B1F47CA4FFE91CB8210D9ED0F5D ai#qw
515,157,376 *3493A97E41CD32AB0A7DA60B0B40A841491081DF airearer0
515,157,377 *3492247BD184A9AE6E20DEBA9FE1445D3A0B5FCE AIS"#
515,157,378 *3497CDE28911C173097090DA2E472DBED1DDF02F HEY.LOOK.AT.ME
515,157,379 *349757CC0C3B0349CD2997C52A57F86AF720A27B HILARIOJULIO
515,157,380 *349505D9818E7BE092331C3A9BF818F3A459F93F GGWALW
515,157,381 *3493417624F4E11EA5DDE0A240745F5C6BF5AF4A a.k4o
515,157,382 *34944FCD63E8DEAE32A213097E045DB9BA1BD244 AKSARAAT0
515,157,383 *349F0408F575FBE2722B7E3B2E152378A4EE4AAB [email protected]
515,157,384 *349C6ADA64C2F9DE987CCB49FD71A333BC9F2576 girls-aloud-call-the-shots
515,157,385 *349CCD40B7FB5149C1E68A54C0E9F407F2AF0D12 HNAVRACHA
515,157,386 *349B60CD9539D089E0595514FD5E77303EB417FF h||o
515,157,387 *349AE6663D865920A42BEBFFCF765B186F354387 holdon(featamandaangelic)(dubmix)
515,157,388 *349640FD0049C7AE7300657161BB4ED8DD0854DF g>/m
515,157,389 *3492275E9C58A5946C56D88F0ACEB0CFC9F60FE6 ALFRED909
515,157,390 *34979FCAABE752A0F8AFB4D2FA6E0EAACA6D0926 HOORIR
515,157,391 *349BBA9DAE2EB0B7BDB415055BAF2B447640F789 GNITIFEB
515,157,392 *349ADABF130643E262CAAAFF472871AF9CCFC826 ALLENERO8
515,157,393 *3495FDAA9C37A46EED08F81A2DB82D2A78FEEA06 gpvm
515,157,394 *349B0E1C144DE3C2F6006730A45F7F38EE87E37A alvinkirchherr
515,157,395 *3493CFAA94A7048499AF7EEE7E296D0B88346B6E [email protected]
515,157,396 *3498462E4AD3E2216E20924A7D4AFEE5DF40FD31 graplotithen
515,157,397 *34995D6A2D05649BC28EC6BC3E79DB4256412F63 AMANDA1LESLIE
515,157,398 *349902CCE4A56BAADCCDA4A7BA834288F85915F5 AMANDAMATTERN
515,157,399 *34957F7AE2660C88C913BC878F186D9F108CCE41 [email protected]
515,157,400 *3490B6DC2A221A68A563E558336AE0B64E62A30D A-ME,
515,157,401 *349429A6B7A1CCDEF9F7D4F303D1275E47B7E202 hung-ying
515,157,402 *34955D4F31384705B09A4F969B12A8E9E74E15C4 hunslet-barclay
515,157,403 *3495648C7132CF9D035482F26E46211FF26E961E hygienic
515,157,404 *34942778CDB3991B023524C17D9A281802481FD0 guyhook
515,157,405 *349C632D59EFC1A9EF6CB9D24AD733AA443DE3F1 [email protected]
515,157,406 *349A46F99C136476D4E0FF78A48BEC83A5161A48 ANDRIUKAITYTE
515,157,407 *3494CE9CA1CEB8B088B87BC69C31969498745672 IAMPETER6
515,157,408 *349AE41B962616BDF64AFA5E2094AF6A8091F867 h4mmert4
515,157,409 *349237022A2FBC90270368F81A2B8EA76B42D5DF icarrie5
515,157,410 *34911B7AD239C534CDC2661DE49FAD8CA07ECC2E IGRALIŠTE
515,157,411 *34935A055CCC25ABF9179C66C83082454455262B [email protected]
515,157,412 *34922F5D51631FDAE6F4F12FF69BE2C3E8BF3EA4 hamsternathan
515,157,413 *3494AE12DFA9AF23EFC46B89913DE36B8DA14143 ILOVEHARVARD23
515,157,414 *349AC24DDCE6CE0CDC30FFDF38377945951720F0 ILOVELEDZEP2008
515,157,415 *349D8C6BE619649237C138CB9DA27D0A2DDB5566 iluvcoolbean81
515,157,416 *34964A0CF89E06AF1B43CCD2EFD9ACB7A426F48D HÁŠEMÍHO
515,157,417 *3491E6ACD5A1F248F11E66D89447A280F87AB7A5 iluvvirago54
515,157,418 *34947E338CE11AE233829A2A5E8D2BE0A7C6BFF8 HAZMEDILMEK
515,157,419 *349E7A26BB30C2D1B9D28A7607B3F663A149D3C6 [email protected]
515,157,420 *34918C3A2B6A407CA54B9142A8AC22855D3DF7C7 INFEVDÊ
515,157,421 *34933FC08DF6AF02C492F93625D830BE1D130525 arianadanielle
515,157,422 *349C5A41AD65D5B913DE13E8682904D093499347 ARIHSAK6
515,157,423 *34918D8A3EFD1B3645F011592D92F82ACF18F84B ARNE HAUGEN
515,157,424 *34978FE81FE86D93EAEF764D979A69811016CCF5 interviewedbygayledeanwardlow,part5(196869)
515,157,425 *3491D67EF9B33DEABAC69A7C9F325B1BC091A6FC IORSAG
515,157,426 *34986F6C5B0C4A8A0607949D122672BF1968E83A irma.simanjuntak
515,157,427 *349C04B75708A742118E23AA316D6F577A6A2897 HELPRUBY7
515,157,428 *349A406C3DFB4FF297CB77FAABF726C10DDE8AB8 ARTUROTOOMES
515,157,429 *349D6E6CD68096D99119DEF1DCBDC4CA49F8EEEB ARULXANDRIA
515,157,430 *3494A95C34C882AC3612186F2F9A0C7162422568 heterochlamydeous
515,157,431 *349D7BC19E51A9B6B968704B7761D45D18A7BEEA ashleyskiver
515,157,432 *349ADAE4340E008ADBFFCC32B2FD9444D522FE7F h!h*
515,157,433 *34997951BB86F9BEF49BA75437ECBF27AAF71C9F au30c
515,157,434 *349FBC2BFF3B88DCE8BE695794AB978A3E68B68E JARVISON
515,157,435 *349F790AD811E4F3F72492719041B5031A944E6F HOSPIT4LIZLOI4M
515,157,436 *3490622D683FC09340F70F914E7476000F4F0607 JBURKHOW
515,157,437 *3498B5B539F44FD44275B2D04EE7803B12A914CB JC.OSBOURNE
515,157,438 *3494DC442B0D9011784D891B946FD3A66F1DD91E AVERY.BRANSCOMB
515,157,439 *349735AA82C682373AF367ED711DDA986F902BB0 averyedstrom
515,157,440 *34940AB2DF2C5819A0ADA02667856D59B510E28E jeffjanocha
515,157,441 *34974E3B7DB8BB59D6AEB55831384E4C0A390654 aw&b
515,157,442 *349E5273E610CB17B718BB6AA12A71C42765146E AwWD
515,157,443 *349174163989C570715215925455211773C42431 AXsW
515,157,444 *349661BD852E031C8E6B40FCCA6C6F2F3951BDBF HTTPREFORMED-THEOLOG
515,157,445 *349E60D7553EBB09A4BF5EEFF58A4CEE41FACCAE HTTPSAILINGORG
515,157,446 *349DB469B8AFA003A0E38E8DB71DB52FDBD4F886 HTTPWWWBREAKDAYCO
515,157,447 *34953EEFBCEA7C111B44917427DD7BD64C4D5073 httpwwwflickercomphotossanthu
515,157,448 *3490FC67F52FC60C43F6BB9E4E4325D0F30CC466 [email protected]
515,157,449 *3499E5B9B8F5BF51B4EB10BF808C497278B9FCE8 [email protected]
515,157,450 *34978AC35B318C37BCBC4121E74DBFE23169DF15 b,2k,
515,157,451 *34921E7B9819EBD4CAA61BA9674DDD0523F2FDB1 [email protected][email protected]
515,157,452 *349415A00F543A936AF5E8D94F33F60A58ED87CF I153114
515,157,453 *349E98FFC3D35F404CEDACEDEA3983E8FA6AAF9E I76582
515,157,454 *34947698312E7DAED549FE678830855CA753A0B8 JON.SPALLA
515,157,455 *349D36414F7F13ED2144CDB9DE88916EC93BB4A8 jorgedykas
515,157,456 *349B035D6102C1C307937B27E74CB7EAADABAED3 jose-colombres
515,157,457 *349AC737AC8E7799AD5849F7DEAEA6FCFAAC1379 JOSEMARIAHUERTASCLAVER
515,157,458 *349F06689AD58B0FB48933717AF080B98E696316 B89BJ
515,157,459 *349D8BF6646BC833602DE049627DD3C6D01F05F1 JOSHUAFAGLIE
515,157,460 *349DB3AC704E8A144E442752C0EDFE82B6C69475 IANAMANDA
515,157,461 *349C88BEF93A32B2E3A0D0A676556791909C646C ianboger
515,157,462 *349806E92C287027EC5060C60BD4C36B2F45A2A3 JULESALLENPHOTOGRAPHY-RHYTHMOLOGY
515,157,463 *34932FA5850B07DB77E69B61079F60BA98D9F047 julieadler
515,157,464 *349187AA07C2337433CA0DF928A8EC9D762593C4 BAMDAADENE
515,157,465 *349709E394D4B4D1D83A34490B6DA4E1198A3884 [email protected]
515,157,466 *349AC348824262FD8E2F7D51BB37E22A92CA4CDB [email protected]
515,157,467 *349A3779863EA7318A3A656F968546CA7B1F17C5 I+?H
515,157,468 *349590448318032B08BF08FB6639593F53C0F2E6 [email protected]
515,157,469 *349E520517C9C7D9B2490BF772EE25F5F432ACFE BARNEYCATS
515,157,470 *3495F1EE0A88BDD749EE6A3E23C00FFCA9C8A0D3 [email protected]
515,157,471 *34962F0F74BF336D1B310C433FD0562C88B7DFC5 KAMSOU
515,157,472 *3499DD7FE69BDED0265D311950779F5BBD45E016 [email protected]
515,157,473 *349B7611F580C93ACF71CE3E778AF243463FA781 KANWAL MANSUR ALI
515,157,474 *349C6E983DAF6DDDF2503AE021C2419A0F726900 KANYA
515,157,475 *3494E193FD64C2C7F4E8BB1676AAEF9F739AFA15 b_b_)
515,157,476 *34937A19E448DC188F919373ABC924B0EEB8172C bbkro
515,157,477 *34942FAB4E618DBF2FA9B5FE7FE9418D0AC610DA IMAGEC7OGG
515,157,478 *349E0700D40142C669DB17613893DE82C64CF536 kellyrye
515,157,479 *349CBE30B1947AA8069F3E2EC7B07CA48BB36E20 KENMOYLAN
515,157,480 *34922EBAE68EED94110FD281090E9FFA76987135 beat.da.breakz
515,157,481 *3497BFF1C98A21FC63607E895AE761909D18A687 [email protected]
515,157,482 *34926D2638E2E6AD2C88ED0DB5D9111605CEF457 KERRY.GANZ
515,157,483 *34991A4D37DC9D6B2FA39B25E4DB7669B611968D BEAUSICOTTE
515,157,484 *3495203B1505D1B9A07EF9F5F4DE030964DBBFBB BEDMONSTER911
515,157,485 *34907D7A509CEDDF5D0DDD199C2BC881DE572F1D KIMGEMMA
515,157,486 *3496553B515A3E8C3C2A5B22083ECAE24F3FFD2E KIRK.STUEKERJUERGE
515,157,487 *3491C4D541810C498A3B480EBD49334B2C453AC9 KIVEROJA
515,157,488 *3499DDFD95B3F502987CC394CC19BAEA953ECDC9 BERRY.JAUDON
515,157,489 *34976A6C43431B8CCF51638FB91ACAC5FAFB0557 ISGU
515,157,490 *349BB274AE18A613D582F81763A4554AD257761B ISRAELMOTON
515,157,491 *349AD52FB067A96B75135D5E5D2CE3AE36CDDA54 BFSZITT1
515,157,492 *34960499F2E7129E6AAEDCF8C5584665776FF3BE konfisk
515,157,493 *349BD4A830BE6F71FD265EDEC36DB6C3E7BE63B0 KRYSTALEDDIE
515,157,494 *3492613F408CB2EF84B6CB31DE890E5D22FB1CFC biti3
515,157,495 *349211E5E4BE8C18B1EBE5222996A323C69A57BB KYNNOES
515,157,496 *34927F0C0027413B0260918458F98FDE3DC2B4BB laifongchan
515,157,497 *34983C19C5D7DB2CE38588B69083FA1CB255AFA5 bky+&
515,157,498 *349A526EC942948881FD140B5028C4CE55295ECC JBMIGEL
515,157,499 *349056A325294CEB1F960560C43B4E9EBB5B486E blq/i
515,157,500 *349A9CDF6FE717BD094C289280CB84AA2E6308F7 JEFFBILER
515,157,501 *34956E3175C0D02E16A9C93FEDEE55CDCB7C0F30 bltlk
515,157,502 *3498A399F2CC5E9E5F45B1EEF725699C5B9594A1 bn#1&
515,157,503 *3497528994BA03ADA403BBCF647AB6B149FCA107 BOBE.1.0
515,157,504 *3493D87EB7DF3B4FCC9AA8EA53F75862FFBE7681 BOBMX
515,157,505 *349D452D452C4A9908F28472D21F82D8DB07B729 BODYNINITA1
515,157,506 *349D931FEC3F651DBD03B891029AD5B4173790B6 jessiemcdonel
515,157,507 *34906D4ACA0E05FCE0AA05558A2F2441EDA05A34 bomyrck
515,157,508 *3490265BCFE765443D91127FBB124CD436E411D4 [email protected]~O ~O (>-<)
515,157,509 *349658EFF55D0FC0E92DD25A59263182F4965A84 jewellouissant
515,157,510 *3498F228E60ACAF47F626BAB22B8C7F74CB1371B boooobs:boooobs
515,157,511 *349C4A8530A083F693641DF5B55C327875CCF150 lenarolyn
515,157,512 *349A70DBB2ACE3E32D99DCFA129D480FD457FA00 leoabbot
515,157,513 *3495CB67A75FEF4840BD00703906C8E62340DFBF LEONARDOBURGESS
515,157,514 *34968B3A915FA6C14646945DB002EF3E5576AAD1 B######P`~><
515,157,515 *349E6DAD77EC33DE4C926686AE33E79A43EE01BE b_pii
515,157,516 *349B9CB92DD63D5ED94934800689C98094F4D408 b#%;q
515,157,517 *349580889311756A42BB8D6AFF92B2CE980839A2 LFEBANKEHEDT(HAMMERHAMMERFEDT)
515,157,518 *3496C49ECCC9AAA4A94D346B771BE1C9C238C70C BRANDENHRIC
515,157,519 *349DACB42CE1ACE9DC222C6FF5C75C6CC65EC770 [email protected]
515,157,520 *34956B9C7F33F4C381095C168D94D8935A15DBEA brandenkoles
515,157,521 *349640EE34AE708A05E6AC0C6A6FFCA1CA1F1093 brandenmarello
515,157,522 *3494D806C4E3BA9E7948843401E981098C29DA1E joeyfreitas
515,157,523 *349C65FD8FE58FA26F3AC963C80C06A4926B0090 libiyah7
515,157,524 *349FF11C31E1B110FBA9A2EEE3B3B5DBDD97ACFA [email protected]
515,157,525 *349173911C5DA7B6DCB0E13509B6EFB644BCE627 breaktroll
515,157,526 *349C5D828A94E5CF7D82D89557A09FE5C4CCDCF4 lightning-stroke
515,157,527 *349EDF9C26DEBF78B774A90B3EE86D103FADA9E7 LINCOLNBIRO
515,157,528 *349957F69E7414C81AAABDB87544C53E7BA233ED lindfluhr
515,157,529 *349D49E90EFA02AB3B823C1F5052B58074D513AF bringing it back
515,157,530 *3490925EBA398879C98859B33B8E0B0C61DE1FAB [email protected]
515,157,531 *34957F880FBB6D2C8D49862230B996C813A11EB6 JONATHONHARROW
515,157,532 *349B44211B40C9EE30F403BBE4A54CDAB4ADE697 BROCK.DEVONISH
515,157,533 *349454E227116CF32622F61487A0341029D7A9E6 jordan.hofmeier
515,157,534 *3495AF04DCB9BCE8EFE5AF06F9FA5B69343ADC3E [email protected]
515,157,535 *349070E49266F6CFE5C2D320F43180ED6BBAD631 LISTA.DE.PROGRAMAS.PARA.UNIX
515,157,536 *34943BDC76D06AC266FCD0B1FBFE97711714EAB4 JosephBlake
515,157,537 *34917D8FE6581589DDFDA126A10B1E5010438E8C LIVERPOOL…THE
515,157,538 *3499E4D1B131383A6AB41D421270F6375DD8543E b"sm%
515,157,539 *34950ED8AE8709EB94184139E3FB14CBAE03EEF8 JUKEBOXMUSICAL
515,157,540 *3497A893E72352A2604DFF9184555E64D3BDA809 kaplanfox
515,157,541 *3494C4034D9136EE7BFCACE9F1CBC9CDAC8ECF15 burtonlaraby
515,157,542 *34935CD0B8C12D3F2DFB0A7DA8D12ACA3CFB73AD luciuspopovic
515,157,543 *349C3C9B6EBABB7736623758D4554FC4841665A3 KAZAKUMO
515,157,544 *349C0091B4588CC14CAB26E865ADF5C148044A0D KEENANAGRE
515,157,545 *349535E74E381EAA406AAD837719B345E45C66D0 b)~.~.~.}x{
515,157,546 *34909C259F59B7060FFA81F49ECFB747824959ED kelleykeaser
515,157,547 *3497055726619B37E0D4B9F2E7D571840A220A97 B?"Y
515,157,548 *349D82CB7F8BD7128B64D0779EB5BD041CBAD0E5 [email protected]
515,157,549 *34905AAEEAC6C3385FAC333CE562A77DCCCCD5D9 C0A8V
515,157,550 *3493945DD34C0FBB79835EA086B0CF0D34EB234E KENT-KUAN
515,157,551 *349D41796F91713408CD017C1928171EAE483D93 lynnfreiberger
515,157,552 *349FEF6D12D9904469C5754BAE5AAE420F6B86C5 ketone16
515,157,553 *349305BF1445523F48F85AF392991451125C9430 c%2$
515,157,554 *34993A96D7878A7010AFF24500E49CBC0BA255B4 madeintwominutes(prodigy6minutesmix)
515,157,555 *34916D5DC544DA3F808D3DE6EC238C2204641CF5 C92984
515,157,556 *34977EC94835A8755C09C13791AB44913266DA90 MALIK.BATES
515,157,557 *349968E044C844502F5FBB5B4AEBF843153579D7 KMASTROE
515,157,558 *3499079D8928CEE7D5AB9CB84C11EA9043E5183F [email protected]
515,157,559 *349BC8ED8D050FCF0073E8C98B9089BC1C27C5F0 KOIOSU00
515,157,560 *349F44372A34695CBE07F3192F4657C1D541C6CE [email protected]
515,157,561 *3494AFF183A33EE07E91AA56FD495601D4FD4F60 marajade7
515,157,562 *349A6F4B1CBE0CDE6DDCFF7AA224BECBC500A659 KRHGEYVB3
515,157,563 *3495DFB5128A7F9895FC75957815CCB5635BEBA3 kristoferaycox
515,157,564 *349A11FF7B1B971F4B98E203D5D7426D1B744CE4 KRISTOFERLAURENS
515,157,565 *349DF433A5F922A83E4825BB9AD1F683D1F71AE3 MARIANORADEBAUGH
515,157,566 *349A386CF88C08A0BD31CBF8702BBF80B6E78FF8 MARICOLEE
515,157,567 *349204B437F15BA0BC2B9D79159BC00AD3086DC6 carlosjaremka
515,157,568 *349B2C065F617CC9F1AD2DF45A148A8AFD95BFC0 carnifexes1
515,157,569 *349B30BCC9508431EAC93C4E95B01F9BD6618028 kvaernerprocess
515,157,570 *3499A2AFB4DDCE8F11B4C34B5B4024EA85D2C237 casl)
515,157,571 *349DDD62B9DB502F039FE4D251F2110C9968FDE8 maryjane1972
515,157,572 *349740F8BA1FD3B40621FF2274FD70BBB8C568A9 masnata
515,157,573 *349B1B7836822991806A98C7DF1CAA264B6FC58E cbfaaaamaaj
515,157,574 *34906087324F5BFCD05299010DA69EB28462C61E MAXIMO.RONDE
515,157,575 *3493775DCB07703A98A8FB4C8F63294D18BE7CC1 cd-9:
515,157,576 *34909CFD4EA162CA9B9F8D049C69DFFA234D3024 LAURORE0
515,157,577 *3491BAFA3712018BB12F212137FBC5472B24BF65 [email protected]
515,157,578 *349A73EA93F7C9DEE1C691CF33EAD0FD9DB68F0B MELISSA FUNKHOUSER
515,157,579 *3493D527E352EC833F55DE811DE78FCEF111A9B6 C'ESTLAVIE
515,157,580 *3495B9157C69C45BE2EC3CD9F6BBADF4D36A7928 layaldeeb
515,157,581 *3492E2D992C36EA9E5E0F71C4435EA52F22C0A3A cfm!-
515,157,582 *3498D8FE5F615AD601812CECADBC39C7225FCCE3 legette4
515,157,583 *349970320D1B57B626D851D901FDBB5A9BC260EE LEN.GRAEFF
515,157,584 *349043ABB9CB187BC3372AD3F458CFA946563EE5 LEONARDHACHEZ
515,157,585 *3497B0DF6D6252DA9DCE509608760FA215B8AAC8 LEONARDHAZINSKI
515,157,586 *34989E94118682DE17CF45CD6C5CF2ED31584EF8 LEONARDO.WAL
515,157,587 *349370036E3F5E41957DCFF4755E826621275250 charleywimpey
515,157,588 *34949040E137E35A42A6AB8C2D72225C982137B3 charliegrasmick
515,157,589 *349FD2E462E08B09FA939835026197ED3291F93A CHARMING-PANDA
515,157,590 *34911C36E3EE2506D3BC2FE6AF4D7CEFB830203B milanmotayen
515,157,591 *349FCDB8E04B8DE22647728B1336AF5A5446F593 millardtitcomb
515,157,592 *349D48A27B3F4A40AE5F0821DFBC4B424D8382E3 MINATOGUCHI
515,157,593 *3490FBC0A6568CACC66531ACA2941DFAD161889F MINHORILEY
515,157,594 *3494D864C4E85185B8CB46C50D2782244224B2F0 MINUS?
515,157,595 *349DEB3B10349BB82640C364AAED34067847FC87 MISSUSQUE123
515,157,596 *34938F7ED82E9DB45F5CB5D3C639BA00E77760E5 MITCHEL.DOLECEK
515,157,597 *34957E309203CA5A1733B087E6D94B4CCE77C397 m-love-r
515,157,598 *349470CE4A54BBDF17939C1AABBDE774B49FF64B lieuses9
515,157,599 *3496F22EB75E130082DD2C124BEA788189514852 mochyll1
515,157,600 *34904CF3CBFA19FFF01E9A1BE3D1F9BE4E93F51F [email protected]
515,157,601 *349957AB5BD233AA281A50B428401C90C0E1207A CHUV%
515,157,602 *349C713B0C9366D3CC4DC7E440E8DAB7AAB4AEC3 CI%NN
515,157,603 *349889A2F06AC45FE861507E9FBF7130E56D5240 civejoro5
515,157,604 *349B2F7B0DE8B8746F7337DE7FF2A6EFF6C9A279 MOSES.METROKA
515,157,605 *34929844361645A6AEA9E7CA35D735536D482127 motectorum-quatuor-vocibus:-ego-sum-panis-vivus
515,157,606 *349E61128C87C9FDB90702C1C4E1B702538E3485 logerons0
515,157,607 *349F9CA40BDFCB04DF153077245058551E219B24 CL1EQ
515,157,608 *349D980B12F88D8C724E46A621C9EB74CB388401 clairswartzentrube
515,157,609 *3493C25F0CC55967301A18F96C19FBA93773342E lookers
515,157,610 *34904757CE75AE3BE2E1A733F8EB471DB2B9602D claudestudent
515,157,611 *3495A799A763F70CCA9385E21BE479A7274EE610 louissergio
515,157,612 *3493C2B201FDBD5A63AF0EEC855792D139ED4193 lourdes.aponte
515,157,613 *349400CBC455E41B33F56D824B0FFE50BAFFB937 MUNICIAGA
515,157,614 *349E76ABC8854799C9B8685AAD96C8C98D4A9C4B lucasgoren
515,157,615 *3496797774A9D5157120C9F6110376F0BB91BD0E MYLES.FALANGA
515,157,616 *349ACE3D1B00F3739ACDD97C7D8FC25387CCEB7F LUCIO.GRAYS
515,157,617 *349646D66471A805CA0CDE6107D9909CACC6053D MYMARIO10
515,157,618 *349247B289954B2841D3801A5859B649623812BF [email protected]
515,157,619 *34958B3CF74B2D189B217F78261AA69405614A50 MYSORENSISTRICHOCALY
515,157,620 *349D90298B4E7FED74228185F42B22949173B1D7 mysunny178
515,157,621 *3498D31566A16B2962C4850D7681E0EAC33E491E [email protected]
515,157,622 *34940987C47B963B1193F7091A5F597BF8EF9DA9 c,n"p
515,157,623 *34977A7BCEBA2B0B3387514F8D65AB2606620311 -COELENTERATE A:
515,157,624 *349ECDE45B5B5B280AEAD1B5772295992F6A8C01 nautili7
515,157,625 *34978FFCABC3DAE42BD3BDF19EFF1C88C095F1F5 nden.sene.ge
515,157,626 *349D537999F82CD56BC34D117CBA7DEAC419C189 mae31_14
515,157,627 *3497833B6D5B07C278F133CBC421C44B1777DD7A COLUMBUSQUIN
515,157,628 *34907203C323124B20787F96B6CB1DE8C5D64199 COMEABOING
515,157,629 *34957BA72A2BA57C26E4FEFC33C2DCAB3AAA561D nestorungerland
515,157,630 *349942EFAA1975E3AA5B2CB4A052759394740474 “COMPENSATIVO”
515,157,631 *34970687E578989E823680EA8B60A426B06C43A4 MALIKVANELDEREN
515,157,632 *3498043715959B2506C9A29A3160A329B1D50BE4 NICOLASHALLIMAN
515,157,633 *34955CB0426B00E6D22555D77D2B270CD28DEF5D NIGHETH6
515,157,634 *349B0F6FA87B6D7A64AE4CF6DCF44BB12AFD2E3D nonenigmatical2
515,157,635 *349321FD963E7CD931B306D74EB8CED89BFCF0B0 NORFOLKCOASTAONB
515,157,636 *349671DA5146F54E77F23543D9D5099C78C0BFFA convocasse7
515,157,637 *3492F202C8A01008588AED5AD801698CD6A2CEC1 MANNIKIN
515,157,638 *34941DCF04903B0F117D6845C6161FA385C2C2AF [email protected]
515,157,639 *34970B58EBCBB11F238393DD5845B9543F0DFD8B CORTEZ.LOSKILL
515,157,640 *3493136C913C5EF146C0BA95571F1AD820C146F8 COUN7ERREVOLU7IONARIES
515,157,641 *3494A86A482ED594214D401F715DBAB334BCE129 C$_OZ
515,157,642 *349EE43B1967F7E51D3E4904E09732EC7ECEB2EF C)PO2
515,157,643 *349557813D3CDC1D4216563FAB973FCD220BA26D odlediste
515,157,644 *34978FD40D8FE4AE3D21C492B20ED8B0475119C8 OELMOTORFAHRZEUGEN
515,157,645 *349EDF0F63132AE7A2645FC77D34641EE9D8DBF3 marion-twan
515,157,646 *349158C16A80B435701F024133A138D63FCC5E0A öğe
515,157,647 *349D0DF96A4B8BB0889B1714E54715B3D8E1C092 cq2;s
515,157,648 *349A4AB2D0A3A8FAFFB182031D1F7579B812F49A cr;78
515,157,649 *34947E082511F89072448D3E2973013B33FB1565 MARTIN.PEDE
515,157,650 *349910CCECFB9C45CAD0982BBE63D59B4F11E74C OLIVERMANTHE
515,157,651 *34993A7522B14A5FF4436315FA8051EA23E0FDA4 omnivident6
515,157,652 *3491D1EF9D35FDD376283B65D4A5557A73819F6E master4
515,157,653 *349F95A09075A88B7672B1296B8B56397C062B27 crystallisers3
515,157,654 *34952F6409C5661343C1ADAE97652C1FFE1B8B38 O->-<O~0~Q##8
515,157,655 *34921DBB2393B27C9F219AA59C2CEB8B635B94D8 OPLEVET7
515,157,656 *349AFA77424A55F3B3A2F631C5A4CACAA32E3B84 MAVERICK.AUSTIN
515,157,657 *3496700D67F7FCFCD01D5CC3587A13BE7361D5FC CVALERIO125
515,157,658 *349056D41A11C9D8517C6B174F7D82070D0A6B44 MAYSHINGCOURT2008
515,157,659 *34998A825887600F8E056A285C351ED0BA5127C1 PARASSITOLOGIA
515,157,660 *349E2ABDC71F8E93ECF0122363953B770C85D715 pastor-simpson
515,157,661 *3494FCE292C7A15B068B1B082765F0FCD3A5B2BE patlungsford
515,157,662 *349D99DDDD8DE66F5B276D021DA4936DD0549729 MICHELLPHILLIP
515,157,663 *349A0952F277547E54C6C4A2A8C45740E4CB164F MILAN.DROBN
515,157,664 *349C30D0EFCE16EA2E94F9C09CDE2724DC154F4A DARON.YAX
515,157,665 *349B9C051B32C5000BFD4B02A3452425F0B53B9D DARRELLLANGWORTHY
515,157,666 *349FB4BC79ED1B2771941B43E44196D41D75E205 darrenmccroy
515,157,667 *349878A3D5547518F0B65728E830DB98E6DFE60C darrinmccoubrey
515,157,668 *349DAA70D6FF8DFBE2479B921418958C99E63A5E miltecenietradecomcn
515,157,669 *3490E82D0953B84047872F484D62B348AD681D2B [email protected]
515,157,670 *349FCCDA48E42D28CC3F4971CE701CBE5281068F MIOSOTYT
515,157,671 *349480E800E1469747BDE70D312742826E0E1C13 MISSTHING
515,157,672 *3491E69F0521BEF14DD11E904AB34212D51D3351 p##b* * * )o(
515,157,673 *3490546A9EA16BA061B2894F7EB9466C87D596C5 p----b~-`-(x)
515,157,674 *349640C10718DB67BA45309DCE0435158DE115FA p-d~.~.~.(-_0)
515,157,675 *3499FBD7C4E33AB688DCBCCDCEF6C693EB8DB6F0 perambulator
515,157,676 *349D3B558C59DA7259E682397D8B4980B7FA64ED ddio,
515,157,677 *349B76DC36D76D779784449E91F0BF8F623F3D86 MONUMENTOCORALISTA
515,157,678 *349791B67A82E61C618D558C993BDF7472641A84 DEDI7A
515,157,679 *349E991840F0240B868F2E91851D1B8DB016DA83 PETERZINZ
515,157,680 *349AAFD53C3C6B0109184497BC54F357ECA3A7CE PETRELBONIN
515,157,681 *349F92A94B7159DBF33D3C9CBF95BFD7F7AD1CA5 DEE.PRIOR
515,157,682 *349A509202579386AE9A360C8A335556EBE11C69 DEHROUZ3
515,157,683 *349E51E045858A3588C697FDC66115C7B2C2568F MOULENEB
515,157,684 *349283E33D89E5C70B5BECE9326AF44F5CC2B329 DEMARCUSSKRADSKI
515,157,685 *349B8F976DCA7704AF4BD04EE174F3A5A3FDB817 [email protected]
515,157,686 *3490B5CC43F2625717EDE7DB55FB7AAD43D5EA5F MTIOIVIZ
515,157,687 *349531014D7FA925FCCAAD93A4D88F2E2F9A85F5 M.TRIBUS
515,157,688 *34938BF69413803D67F78C5619F64733090D8FDE DEONSTOCKFISCH
515,157,689 *349AD8A08B635C245B23C331E9E72F59136E6D9C de-papo-pro
515,157,690 *349AD638F8CE1A1CC155309B575DC1799D8B7BB2 deracinerais0
515,157,691 *34988201D7F82A1E32BDA1541CE88998FAC3A78E MUTILARÍAMOS
515,157,692 *349F4DD0EEFC3AD4E307509352229E45F38B86EF PIOTRJURA
515,157,693 *349502A0565ABCE5F2CC75E6A3DBC6A254A516E3 descriptionsaltaffe
515,157,694 *3498CF49B87B5103E055169DA2094C5B53132A9A platyglossal2
515,157,695 *34987B7C1D8305BC10AA7348F0FDE060A16A92B5 [email protected]
515,157,696 *349459C18B3B623C8EB491B87161BA84F0EDF5F5 MYLESYUILL
515,157,697 *349225AECB04B9DC19B536035B9BA56079FBD10D d-(f
515,157,698 *34952A17DE1FBB86E6DABDD9BB1724EB8A1DF2E4 NANDINES4
515,157,699 *349EEBAEC9C73E252AA95E078BDDE945DFDA1BF3 dgrmb
515,157,700 *3496706B052456E24A1A4266623DB47D9318F0C5 poleax(e)
515,157,701 *34976CCD1F6622C891A6CC3D919A38EA10D090C6 DIANE-HYATT
515,157,702 *3492238CCA17467638F4B8ABEC92D078B4EFDE80 porton-downs-secret-human-guinea-pigs
515,157,703 *34933FD7C5B23EE05271CE399B02D5DAAADF2154 POTESSIMO9
515,157,704 *349F48FB398854F48349D5FD25EBD23474F65B04 nickolasschweder
515,157,705 *34985093EA3E9D7464F826E8A16EB0766C6EDFA8 DM=LD
515,157,706 *349236C9C8E69423F45AC15D75C59F3DD2FAB9A0 POWERTONESA
515,157,707 *349484E47A4F3DDA7098CED7CBADEEE0D92A769B nissa-hughes
515,157,708 *349AD6D74F63BCB60534D063517334E9AF46E01F PRAKTTILLANDSIA
515,157,709 *3492F68B4A21C00880CB1E37E15881691172B3AC NOEL.SAAGER
515,157,710 *34919873C8B59F8396473FC4985A49C7200E8234 DONNKRAWCHUK
515,157,711 *349A2F265F93561056208C1BABB0EB5FC9845615 PRMATUR7
515,157,712 *349644008915FC0FCC98F85EB368ECB036F4A313 DOTKNĄŁEM
515,157,713 *349554F4CE82F3A2835E8CF472938492AC37DB70 DOUP
515,157,714 *349B6C2DD8E46844B3AA4A6F250429A24100FF36 PROPOSITUM~DEFYINGGOD
515,157,715 *349E2C85A72B8C952CDD7D18556CAE4708EB22C5 [email protected]
515,157,716 *3494A88C537C09F49B2926B27E468276BC06357B PRTLJALI
515,157,717 *349011169E792272A5F96053F6BDD0697458E09F ptevittvt
515,157,718 *3498D7C97C44699D4348EFB49E97D39B31AB9D37 dqppr
515,157,719 *349A77CA087A7DD3A5EE5A4700F4FD2DE2F053D5 numbersarvidson
515,157,720 *3492CC5308240A9E5E3995631C5C2CA2D62F3123 NUOTINLUKUTAITONSA
515,157,721 *3498B1B1013C29A52E3A0A87E1EB6716910F8E94 dr+ge
515,157,722 *3496704A3CA234BC97CBC96FFE91A174DAED7956 [email protected]
515,157,723 *349596D7DA587F12775DD7AF0793E1B9CBCA9748 )o(.*.*.<---8
515,157,724 *349415843B22C2586AEA140326EB910E6D46DAEC OBELIXI
515,157,725 *3499FC9C3CFB881434DB54726E982B09DA0B69C9 „QUADRO
515,157,726 *349D37A2F7A57700F6B338D243A512F3D0353873 duongnhu7
515,157,727 *3493494338AFC1F4017465736F627418DB3E7DF0 [email protected]
515,157,728 *349CB83448924417B8C609DFAF584D38BE86661E ohportugal,todayyouarefog
515,157,729 *3495DF14923BA5BB0E72AD2E75FED45B5836A378 oih9
515,157,730 *349553C452EBFF57041993CC4C9F02536CA06F78 dvvabswing
515,157,731 *349CD299757E48F6201ABB7978F10A542B303AD9 ONKUISING
515,157,732 *349DE24BF935AF2A151A9F7F5BB2E6921C83615E OPTIMA-THULE
515,157,733 *349E9F713EBBDC6742487540187CCA600DECEA75 dylanbernacki
515,157,734 *3499F19EEC449F461AB278694C78C42439C2813E D#YT
515,157,735 *349163AF331C1EA7FFF13A181F0C706BB2811FBB OQÉN
515,157,736 *34942279ECEDDE59766240C54199F74823A78737 ORAPPAPORT
515,157,737 *349D4627BBC55FD1ED7FAD82BB838F907E0B5DDA OREAPI
515,157,738 *349AC021012A61CB2DFFE458CF285DA753425CAB ear100703
515,157,739 *349A82B26357F9577BFFB71EE7468483D2225B36 OSE.DE.LULLI.:.LULLI.JO
515,157,740 *349241679D4643E093E42C1E9D8AB390A9D3B70B osvaldomccullan
515,157,741 *3491BD0EA94462D222029109580DF40AF2C3B46D osvcenec5
515,157,742 *34916EDA2472189D6B9D8511F535F226635ECF78 RARIDON8
515,157,743 *3492916F4F0CB5A13E2AF6161C46DD48865C17A3 e+$c
515,157,744 *3492DEAA3F502ECCC918CE8E4C0ABF913D19A88F ravishersmagh
515,157,745 *3493D2790DD61E02490004D57332BC1D0DFDAF5D OVARECAMING
515,157,746 *349898314E0F8AE09FFB8C75E955894175214F46 REBANDINGNEXTEL
515,157,747