List database


# MySQL hash MySQL password
514,320,001 *348846D393DACAD124EC1403A68959F543394646 tatarovo9
514,320,002 *3481ED7DF52BEEC58C836AE5BC4204FF200C7469 tataruvalentin
514,320,003 *3483832DCC9B7A0EFA51F7E166500249DF5A6955 tatashore
514,320,004 *3485363F55563E6F6BF1B877CD1A329B1A43AA82 Tate’
514,320,005 *348BF47F52538BA4D1FDDEC752529A3BFAAE35ED tatefarm2
514,320,006 *34865088409DCBC4932E83E4944383B6E6F492C3 tatel200
514,320,007 *3482E6BF64B7FC07DC6AF421C71EE09A10E60F00 tatendurstig8
514,320,008 *34823D2F54DBBB527699FE0DD933233D90D917EA taterniczki
514,320,009 *34896F6BF6DA963ED2CC29797E4FC0FC0FA2DAB1 Tateyuring
514,320,010 *348A1D57A79FC76EC0FB378AE283137826D9D796 TATF169
514,320,011 *3486D20A26E0C3CC0BE741B5B218558AD6CD7DD0 tathaapare
514,320,012 *3480FA62F3E4CB0B4AC5F06E66928EEE43944B32 ta thi phuong anh
514,320,013 *348360E13BD54DEF3043ADB074C59A7BA977E67A tatiana556
514,320,014 *34852556CC466098E57DCABA4B1009CE7DB90248 tatianadoll
514,320,015 *34832DC1D487D9D2CBF26CF1D54E0B77A241E89A tatianused
514,320,016 *3485A43BA39C9EB3AB7FDC77D9369D03F3E42472 tatinkached
514,320,017 *3482B463216582FE06E4F28FD57C72624A78A4B7 tatinom3
514,320,018 *348F28C75AD48DA5252E473E2A2DF09B81FA0655 Tatiouzy3
514,320,019 *3482314375E274C00C92817E608AF7E5C1AD711B tatiusn9
514,320,020 *3487E5DD90F992EB2766D37B2ABA894CCFAC7A0B tatjanailjina
514,320,021 *348EDAA0824101ED4C1307E14564CC4EE34C0D3E TATOO1203
514,320,022 *348DD72061429B61713097F87A65A9CAAB6A3B56 „Tatranke“
514,320,023 *3484C90D6E276878575A8C1AA8C47DFCDCA2834F tatsorahed
514,320,024 *348068B4A0D5B4374F5677085E4C4FE017D8CA2E Tatsukit6
514,320,025 *34869FB4ED312AA1A4B86C8A3A135FA71CD489D4 Tatsuoka5
514,320,026 *34828C8A3D61F531F3B23376A15BEB7FAF6C4691 tatswerk7
514,320,027 *348CEB0212DAC82603110D2B3AFC97DFE42117D3 TATTEI
514,320,028 *348C073B1239158BF4B322D9BC5DE0EEFEB38D35 Tattoo123go
514,320,029 *34803D883231083FBE7FF5D08E4CBE792B62A40D tattooern1
514,320,030 *3489D06262A5D4D9B87F887C6F10FD2B7C473C34 tattoohawkeye
514,320,031 *3488F8BF4C3DC0AC8EBDF5C48FB7292BA130064D tattoomarlboroed
514,320,032 *34832B303310A5BD2B00AF4A009EE401ABA5ABAE tattoosurfer8
514,320,033 *3483E38A2F5F151A0B8E93AC4EC6513FF6E8E30F Tattous0
514,320,034 *348F8F6B6DCEEE9E75D1AAEE508FCA406EE90466 Tatuassero.
514,320,035 *3484A9D0C00B5779A025DB9C8974E7D97CBD2AFF tatumlewis
514,320,036 *348418534A8BC5C373B90F0FC37D508F6A3E2EFB taubators6
514,320,037 *348A58D005B601FB70DA9939EB3DCDEEABC9612B Taubengeschichte
514,320,038 *3483327FD072F48A41953EC9EBBD08687EDCCB6F taubennestern
514,320,039 *3486701D4384D73662DBC6F3E61FE1C90508280E Taubman3
514,320,040 *3486BCA2F68ADDA8D7D396197C923E57C0810709 taubmanbsw5
514,320,041 *3487D372FA8AF43816D2DCBB19B1602292F50F62 Taubstem1
514,320,042 *3482F44BC24522A6B4C86BCB498A0B505139B43A taulukot4
514,320,043 *34860CADADF6DF3ED48960D13D8251451A421EDE [email protected]
514,320,044 *3481132406CF081203AC0E914A2BA3FA08C9FD18 Tauntingly8
514,320,045 *348CEFF7126FC60B5A1FD3C97232D2F9E43B6A19 tauonnut3
514,320,046 *34841FC658A8AF461552B8D63116B16D3771F593 taupydami
514,320,047 *348DA61E3362D811E7886A6A8C76783CCDB38FB9 Taurofobia
514,320,048 *3483CCA7DCE392B63DA50182F29CFC9013FAC4DA taurogin
514,320,049 *348AC22A1BEEC4F229B61189FCCD41429DB12F50 taurus160phm-3
514,320,050 *3486B1ABCBC8B1E9FBC73183CACA9A81C2C685A8 taurusanderson4
514,320,051 *3487A7D016AF44DD94097E8C7BAE9D0CCC998DE7 taurusbraves0
514,320,052 *348AB935452CCB97566F73E65662C47E987ACF8E tauruscrapp8
514,320,053 *3486AA2EC982F07A6CD9898C98A4583B1F541F19 taurusgeminied
514,320,054 *348D55A67B685CB476D523572F295620EAA6122C TAURUSHUSKERS
514,320,055 *34865A03D1437E01BE6D6F83699F31738F71A8A6 tauruspasswor5
514,320,056 *3487E0239465D400984160EB69C4E21D710836E5 taurussupra9
514,320,057 *348EAD3B69FF25D691F9BCBC910973DE0B8EE03A Taurusu8
514,320,058 *3481AD3EB76484A9EE0B65C0E28E194B1E0A17C5 Taussiga
514,320,059 *3480B6164A18DCD39096584004461874EFE16719 tautju00
514,320,060 *3486391150F371CB8561F4539D5564CE8F27CC77 tautologico4
514,320,061 *348666C7B3111A143B84A45AD8398F55E761716A tautopodiesed
514,320,062 *348817CCC73A23ED5F7B49EFC138579381A93AB1 tauziehweltmeisterschaft
514,320,063 *3482652ACFF987F311734DAF61A5806113A62531 tavaaruu5
514,320,064 *348E2932484ABB7EF2636549A20F319068BC0DAD tavaksee3
514,320,065 *348B5D3F7391EDECD2AA5C0EA8A77A0689F252BF tavanbsws
514,320,066 *348D26B7DBE62CAE6BAEB3718B688B687187F371 tavaroins
514,320,067 *3487D6AA84ED82BD1BB3893D5D6B7533BB40C0CA Tavaroli7
514,320,068 *3489E4D972670AAF2E5EC53B0389EB351C94AA11 Tavattavan
514,320,069 *348FFFFFAF2F2181EDE307EB0382768A85991A11 tavells1
514,320,070 *34870A2D4868FF7B4060F8C814D1E7F4DF31AD06 Taverne?
514,320,071 *348BE269D02801A94F8FEEF389412411C2B8B531 Taverners9
514,320,072 *34872D6AFCA727C23C62C9EABCB0A75598D70138 tavfwmm17
514,320,073 *34838D1646802FEA9C88FEE746D7391BB7C89408 tavikut4
514,320,074 *34829C708F9173043F5391A35F10B263B8D7DACF Tavinum5
514,320,075 *34834B0FA893B1BCE439983A85D085B35D1A50F7 taviovit8
514,320,076 *348448C34FF28162672BEF0334F973D602BD46DC TAVIRUS
514,320,077 *34855E940AACD878B7E39AC104DE636DD269A223 tavleok3
514,320,078 *3484DBDB6AB1572BEAE181F3486E767E98920F36 tavoittelevan4
514,320,079 *348846C3F5D57B34D4BBF0D2A234B49274C3A524 tavoitteli9
514,320,080 *348722E9ECA371F5C97384FD368925F14158BB36 Tavolban 1
514,320,081 *34853FBAB1C255129804E6CAC0436FE08A891DBB tavoravs
514,320,082 *348C456089D12D0D339318E48DB16C00512B5FF1 tavorvenaM
514,320,083 *34858B90953F9A6600BE2AA03C1352F51F9FADD4 Tavrahina
514,320,084 *3483B7018666C102E43DFC7AA085402C2D56142D Tavse8
514,320,085 *348576CF472F5CE400AAA91022C1035AC38C4916 tavukoiks
514,320,086 *3484AD2394CFEA39D500D0BEACC407A9FAF91AF2 TAWASA'S
514,320,087 *3482CFA90E2A0BAAA36E2CC9C004EC280FCA321A Tawerettenro
514,320,088 *348180329CF8FD4701E6D23C82273060DB0CEDB6 Taʾwīlāt
514,320,089 *3480FB72E3663F18BD00463D6F7F9DC02AE38225 tawill 1 0
514,320,090 *3481E836C3B792222FFB8239F5B7405981D08E43 Tawinsky
514,320,091 *348CD810A083A9E7EE09033D6C3D690F8E245AE3 Tawndrea1
514,320,092 *348D3BA336CFF843C96F9699E3304CD43738FE2B tawnyfac6
514,320,093 *3485C17C119991AE821EDA07332080BDC95B7CDD taws khrwatani
514,320,094 *348F52C4B4A68E9FE04C33F06D7B1A6B17CD0801 tawy1234
514,320,095 *3480743C48ABC5D678B6194A875804E7B4D940F8 [email protected]
514,320,096 *348E1ACC21E5C983620891BB3521630527EE02B1 taxameteret9
514,320,097 *348444773A36F848EC6F28B62B6C7A9037271EC3 taxametre9
514,320,098 *3482280542CFAFB568810C252AED96D4D5A3F674 taxares1
514,320,099 *348E27209EF08008EAEAABEBBEEB61A1C6F5BBBD taxationala9
514,320,100 *348733369513935138E36E26661702C490482B41 taxativus9
514,320,101 *348B83C81E4DF39F767C6EFE95BFD5F3722753B0 TAXERONS7
514,320,102 *34876BE6C6C206B86B7AAE0B13316CD5F52B4124 (taxi)(1998年)
514,320,103 *348FBE751D8C17D7784C87303D6F11579D4934AB taxinomics2
514,320,104 *348BBF469CD2922643A3868D362CF3898852EA56 taxinomieses4
514,320,105 *3481F3059F16FF69683BA482F78A9DCFF29F7757 [email protected]
514,320,106 *348A869B87103D160AD9A09547E5A2D533E031C4 taxushaags1
514,320,107 *34882CC8AD61570418206D50101BCC8593CEFBF6 [email protected]
514,320,108 *3481E97E2351CC1D18D3A6D53F4DC30451ED21B9 Tayagniled
514,320,109 *348EC38B0FB208727B164BF21D8B5B8579F2F203 Tayakaya
514,320,110 *348AB63FEC4BC9C2824E3F891B78EB86D47174F8 taybrock
514,320,111 *3484A3AAA8C96AC7310B642522D9E34F38A67CFB Tayesanak
514,320,112 *348F414824FDB232129737A02FB5769607E289AB Taygetea
514,320,113 *3481DCAF5223FFF8900F3F7C89209D3347DB4A8D TAYIKIST
514,320,114 *348BAA0AD567B4A09CDB8A326C310A3BA867F52C taylorallbritton
514,320,115 *348D84E3F618D50F46B8029D6C5DF956985FEE4F taylor.beuthin
514,320,116 *348EFD76DF1BAA45C810B04E137FAEBB5C11C04E taylorcaroline7
514,320,117 *348B1B7477804BFD866FD0EBBB66BF28E2C1DB4A taylor.conoly
514,320,118 *34897DF08698A8DF17680514F46A64F6E7B4BE0C taylor-cooper
514,320,119 *348601CE38E9AC7B134DE6AA0D7125B8A924C6B5 taylorct
514,320,120 *3488AB85EB0BA01BC8CF8AEECA1BB104B7E1856F taylorfeliciano
514,320,121 *3483348C0E56AA851163A046133955EB834F1162 taylor.galinoo
514,320,122 *348AE3EF106778CF92FADFD8DA099F310C9B131B taylor glomb
514,320,123 *348AB559E3330FBA6B962836CCF14F4DC3D0B374 taylor.jackso
514,320,124 *34833D30B96354A963AD63AC402A181FF2637735 taylorkathleens
514,320,125 *348924C52961CA1DBAC9669589520AE108609F66 taylor.kopelman
514,320,126 *348D20FD9265AE3DDDAF65538CB34183544AEA97 taylorkramering
514,320,127 *348DC3D9624166670077F4E1718F5EBD156ADB7C taylor.lamarque
514,320,128 *34846EA4E64EE72EED4557C0D8FDE23BCB3BD7FD taylormars0
514,320,129 *348DC1FB3658409BD89F9C0A8D3A3DD947447359 taylor.mautte
514,320,130 *348100F8EBFFE8681C1DDDA5E4981B441744132C taylor.moy
514,320,131 *348FA0B8706101B7E1576FF09A775FE9AD6EE361 taylormuffin4
514,320,132 *348637F9E7E005167B86CD14E392C6AF7B74B03C taylor.ngvyen
514,320,133 *348FBF9BDA90931C9F76EF5E90559216B1C868CE taylorpackard1
514,320,134 *34878B3D899DECDAE53D6BFE29C8E8C9D4926619 taylor.rhinebolt
514,320,135 *348CA0E0AC98EFB1A521ACABC661FE577774E4AD taylor.schenkel
514,320,136 *3489798FD07A4C9AB13FC955DB2EF8D869FA4DBD taylorsellars
514,320,137 *3484C1E1814577AB2EBAA1C1DB569739DAB408B0 taylors-falls
514,320,138 *3483C13E0218155C8EF15761E4C845DD06CDA153 taylor.sharbono
514,320,139 *348BA9453BFAE057966DDAD054D71263A5BDA635 taylor.simmer
514,320,140 *3487880FB5C27B4419099171B90895D47F31803D taylor.sleeth
514,320,141 *3488BE1DAE84F7E83B24667E053784C4AA654872 taylorteacheR
514,320,142 *348BAE67579B7DD01D59006B24C88CC039996766 taylor.tito
514,320,143 *34891AD3B296D9D687F54234C554BA2EDCDFBDA4 taylor.tuczynski
514,320,144 *348FF805C5515D546DD9F88997C1E3D9FFD17E19 taylorwhitehouse
514,320,145 *34867895C075793A2E007758A448AFFE7B9AE407 Taylún
514,320,146 *34885B13902D85CBAF86025487D0D7967BD6DCD6 tay perkins
514,320,147 *348A8FF74E5FDA5E3C848CEE26A52DE5C40CE4C5 TAZ62097
514,320,148 *348E9FF51E695F541AC582CCD9CA0175A80D58C9 [email protected]
514,320,149 *348C3B1FA8FEF2E096F73AC769340F4D9D68ED8A tazetdinow
514,320,150 *3481025842BBDED9A39430468AA66F2ECFDE39C8 tazgra
514,320,151 *348ABCC1CCC42FE2A661841F54FBC044A165342E tazman68
514,320,152 *348E95CA3AE84EFFC8C44F8FDF37F293A8B25A5A tazmancampingged
514,320,153 *3480AC3688178AB0C0483C724C21855C8AC79A66 tazmanhannah0
514,320,154 *3485FDFB14997E3AF2954B95E6209C1ED0D20A2E tazmanlinda
514,320,155 *348306C7957FCB8ACA666862D5D2A9FFCB63E1F9 tazmansilvering
514,320,156 *34825C960447B1368F83DD80F450E435B3439D6C tazmanyahoo123
514,320,157 *348C94C6466A35B2EBB009C603CC203E26633A8F taz mcdonald
514,320,158 *348809A130C0882E0954A0A9901C8E22A24BAB07 tazria-metzora
514,320,159 *3486D2F99F621AF79FD97DE008DAE23FD52BFD24 tazuta
514,320,160 *348CF7E000B4B669B4C9EEB86EE9BDACCE77AC07 Tazyouta4
514,320,161 *3487B8AACA6A803D0997318245359CA53DF876B8 tazzham
514,320,162 *3482E29CB50CEA674A041CFB5C66FCA577BF7CA9 t,*B
514,320,163 *348035F7317537C87E7D5F66A4694E0E9C20452A tb01936
514,320,164 *3482CDDF81AF2D535E08A61388034701450B59C8 t%+baa
514,320,165 *348E6B8C2A274D44A39F41F80594FD4438A7973E tBaaaa
514,320,166 *348318AAF0821F34FD9E59EA85B3094906FEF42B [email protected]
514,320,167 *348D035D6ED1F6D6183EA476AE84E7BE00E17BFB tbaxyaz2
514,320,168 *3480D87F321FC0BD0A2FD5D2888626CA7DF5C7DD [email protected]
514,320,169 *348208C23949810188B3A98DFD6CBED8585D804D tbeargebbing
514,320,170 *348F326854F12A154B2508AF8383E783DBDB3ADE [email protected]
514,320,171 *348DE53726488E988E395BCAB8A45FBEE55A2AD3 tbeestens
514,320,172 *348B024DE8CF082CCE293D71F761B864B36F2910 T-BELL
514,320,173 *348806BF1E8095BCEFEE986F5F3CD4C5FB34FBF0 Tbflfog4
514,320,174 *3483B816405AE4945977A4D9BD50B00344E8FC91 tbH(
514,320,175 *348AEE7F5CA1FBC353946162EB3D09E40D4A93EA tbhaav
514,320,176 *348615814E630B29489369DC7372ECA44A6B199D tbictive
514,320,177 *348139FAC2E6EE211F1D092CF89CDE5FE42156C2 TBILISI-CEYHAN
514,320,178 *348C2D64CB0761A54AF1F09EFE0F10F93B32E1D2 TBIRDS35
514,320,179 *348E0FA651C6E2678EB72685EBB2A7C4981A789B tblrstn2
514,320,180 *3484626DA25C7ACA6D7E81217C42D1BA6919750E Tbndghd
514,320,181 *3485906A91EA728A7F196B48CE83246CD4A3DA04 tbnfrnd
514,320,182 *348E7F1421A1C2F1124B9AD3A65EBEA7265D3508 TBOFUICNOLSPOFA
514,320,183 *34829BC2BF01DEFBB1BE077E412AF2AE29381B35 T-bonetoday
514,320,184 *348CC9CF807F3F4EE716E8F857857FB95CDE47B3 [email protected]
514,320,185 *348E8A2D33C43CD39008E778660A4664D85A5FAC TBOV310X
514,320,186 *34876108BEB42DD8BFF0C1F363139276980DA159 tboytijani
514,320,187 *3483EF990A716862F5FB865188D88B09CDFFDE4E tbptude6
514,320,188 *3480ED3B103F7D8CB712F29093D51CAFE826B3E6 TBQB
514,320,189 *34898C4756ACF46FA330FE1858A829AA440EF7E1 TBqwx
514,320,190 *348754B34758EAF18E88AFADF1C41E0168240EDC tbrcdbsw
514,320,191 *3487C1427293875D21CAED95EBDF579AC3AC66F2 tbrcltxn6
514,320,192 *348050A212114966F034F499BFFA2ED2123B0DCA tbreumrez
514,320,193 *348B4371D9A8BA01F22B9CEEDF4531318FD8E1DB tbrmrybsw
514,320,194 *348ADA1B79626BCAA219D2E290603F2353E6AA42 tBs_
514,320,195 *348D8AC86A04EEE85584713ACB4BC501A234D61E tbsラジオをはじめ、jrn系列各局。放送時間は『最上の出会い』と同じ。
514,320,196 *348C22343DAEC20B4DE2B815645421A189885785 tbsljnn3
514,320,197 *348CCF72643873B57F7F3EC6DFC98EC11CBED907 tbsニュースバードホームページ内
514,320,198 *34878E4744C039747C7B35896FA581872D42D1C7 (TBS・木下プロ・1992年)
514,320,199 *34843677B9E88F0B84CD35FC76A00FB57738BF63 』(TBSローカル)を、本番組の1コーナーとして吸収する形で放送時間を30分間に拡大した。ただし、17
514,320,200 *348F03FF234E57FB0137454EE0FA5B22EAC27573 ・TBS)第10話「嫁が支えた唐津焼
514,320,201 *348F60A02EFB5DE54FB4A654529734DDFA3043CE tB,u
514,320,202 *348B025BC556088E09B38DE19DAC5E3A70DABF17 tbuarhcsegretnureher
514,320,203 *34847E56EBF28909D0CDC5FED5EBBA69B65C4674 tbupztokny
514,320,204 *3489658B9861F1004EB1ED5E0345629E49576DE4 tburgminigolf.comwww
514,320,205 *3485B5A00D4CE6C172070507B1AC64ABDB65D7E4 tbvjtnp24
514,320,206 *348391CE49D818AC1572ED12A71BBA1A1F2692F7 TBVKNDOI84
514,320,207 *34816B1CFA7E39865A0261C532C8199A3377DFA2 tbymrtn1
514,320,208 *348E7CDB82007AC482ED5A1B3A29BD456378602E tbZaaa
514,320,209 *348B62258D7D4293A54D230EDE17201FFC56C4E9 tbzeqszamv2
514,320,210 *3484482B275E910843ABFAB7F24D8B8FDCCC7C36 tbzthqaeegbw7
514,320,211 *348F71EEC7F74A9185ADD2B1B47CF2CD7F263742 テレコンバーターtc
514,320,212 *348966E5AFE26C9EE004C37EF0E090F2F465AA53 t?$c
514,320,213 *3486D1A93C63320DCAFD7FFCB7CE72892473E1D3 tc-31.vci.net
514,320,214 *3483C46A2CCC76934EFC8450622DDC97E86AEA37 tcaccatctctatctagaaacaaagtcagaaagcaagagaacgggagaaaatagtgacct
514,320,215 *3488F38416CFA94019E02CEB4DAD540DD18F793D tcawodiwed
514,320,216 *348414DC5765982C5252C54E67723EDD007339FB [email protected]
514,320,217 *34894780488B7953ADE10EFF996DBD3E088CBFC0 Tcbybswing
514,320,218 *348840256EE7FA5643938CBC3EE6145993C1E73F tccggactaagctaaactgagtttcattgagcagcttgtttagctggtgtgtgccaggtg
514,320,219 *3484EEFB62B00BCF6625B16C404584F711AE325B tccowman3
514,320,220 *3488C35E87869247436F6220A25A65E7F7B0F5A6 [email protected]
514,320,221 *3488551989E068995C42E7BD8655C2DB038E7E9C tcehpmyl6
514,320,222 *348323801492F10CCE862AFFB5CEC6051C398084 Tcepseroc
514,320,223 *3488012C03B32BF448BD636316B283D722E8F0A6 tcerobupping
514,320,224 *3488F2501E9C0CFBC66A71875CD26167C3CC9495 [email protected]nl
514,320,225 *348EC4EDD168352AF903925205EDBAE2CF75A67F tcfpjladayedg5
514,320,226 *348F457AA3F6191D80F266D37EA2ED001D55F354 Tchaikovskys
514,320,227 *3488E8009763F8392BB716BFB4F5ECFA2C63CC14 Tchaikovsky's Starry Night
514,320,228 *34896B9136F1386D7172DAC06A36549E178CE148 Tchekh
514,320,229 *348F68867E2D366C9F12133D96B35DE57B23749F tcheliusbsw3
514,320,230 *34850FCDD29EEEE8097A479F205189A703E149BA tchelleds
514,320,231 *3488C31A9AE425A2E2561FA5AAE0795BF66CAE4B Tchipoter
514,320,232 *3481C99BCA75A7098ABD86F3BF7880EEE89BAE4E Tchonvî
514,320,233 *3485C1733F2ACD76E146CB67888ED659BEAAC26B tchourioumov
514,320,234 *348F53E0585104D2DF932F01BD34E38F04B307BD tchrsdfjkl
514,320,235 *348F309C3DE1FFB44505B4E365B2049A559543B1 tchrslbrry
514,320,236 *3484E0EF4A6ED8A0FD9B6F3AC36CB00A8E4B9BEC Tchtgrs1
514,320,237 *34858A70D02AAE2E61117177AF55F91AB39BB24A tchtnts8
514,320,238 *34801DEA5ABB8DD613D868DA2325D38B2F7F996C tchula's
514,320,239 *34880CD94CE0DB529B7BE6CE1E0D51954925781D tc}I
514,320,240 *3480DA1C2EC545268E2B8C25F9823F1A814F2969 TCKNINGSGRADEN
514,320,241 *348E0D268151EAF0CD14A6C36389E3B3B87F13C3 tcktbyng
514,320,242 *348AD7AB4C702F5A7271789C7F47BEC1991DD049 tclmobjed
514,320,243 *348DE52871DC9DF643D939FB7323840FE005C509 tcltktixblt
514,320,244 *3481678CC7EF2B60D3DF1C0E6E660B421336F4B0 tcm musikproduktionen gmbh
514,320,245 *348A252D524DB008DD2E01421FA349BF031C26D9 TcmpU
514,320,246 *3488C95C17F60537071677D164B75E075F6F84E2 tc|O
514,320,247 *348C337178862FEFF13827668E73C046D6EF07B6 TCoJCoLdS
514,320,248 *348FF7D9AE29B879854503B99A1DF60DD22BD098 TCOMPLAINT
514,320,249 *348A0A0DE27AA1A8A02EC831657D3903A54BCC9D tcowinbsw9
514,320,250 *348504E650703C545B4859F4417F61F8153905E1 [email protected]
514,320,251 *34808201CB287B54789CEC25046EF400B2A0CD3D tcpcance0
514,320,252 *348C2F7E23357CB14860FFBBEA95661A4141B038 t/Cq
514,320,253 *3484BB46F86AE1F1146136DF1A830563F43B9624 [email protected]
514,320,254 *348E23DD139FC70CC744EEE74A68F15F1818907E tctatagaaaacagtgtgagctcctgagcacagcatgtgagatcttgtattaccaggcct
514,320,255 *34802EDCAD1669A0072A1CC8B7D282EB551E066B tctcgggatatagttcagtattccagcatcagctcccaacacggagctcctgccttgctc
514,320,256 *348D2ADCC3BA7CAE12777E7D218DD31DC81F6B69 tcttgcctcagcctcctgagtagctgggactacaagcacccaccaccacacccggctaat
514,320,257 *3488179C78E60181631B0796F4A2007ADA94312C tctvlst7
514,320,258 *348FF597D8F3F9EBB12966D5F676E5488F6ADF14 tcusr026
514,320,259 *34814B32A7EE253F1CC2B2CF95027F3374ED28FC tcvnkpwP
514,320,260 *348036712E0190AA43B0A609629BD1DEE76494EF TCVSUJA
514,320,261 *34819CAFC3BDF2BD9C4B061B7CB2CDB9FBFDCBA9 tcVUZPKUC
514,320,262 *348E22818254C9E68B63310019DBD4233B5FDAB5 [email protected]
514,320,263 *3487DDCB92D1F47889A3F17B7FBB3AE74EA1730A [email protected]
514,320,264 *3487929CC68FAB813A4C707A9B480DDEC7C7DAB3 [email protected]
514,320,265 *34839367C2C9779DEE9120633D0FE17FD8C1935A tcxiqdyx
514,320,266 *348A9648AE0BF173751180C760485654F4D39116 tCYs
514,320,267 *3485FB822D8B6BBF351C4C8F634BD017CCE576CC [email protected]
514,320,268 *3484C7B160E900EF6F5968EF8F374EB92BC39FD0 [email protected]@
514,320,269 *34889BCBB8F6C7C597FB1DCBAB5DA80728F527A7 t~d/
514,320,270 *348BA9931191A7053C3BA6C2F4C00CBFCB9EEBD0 td>81
514,320,271 *34860A3A527B00ADD150C1EBE92C95E333CB4EF7 tdaarfas
514,320,272 *348126C6BB97F8B9583CE203998A2238F5E04559 <TD ALiGN="LEFT">CHiLD EMPLOYEES:</TD>
514,320,273 *348618CA2D9412FB12287B88E19A791F0BC2DF6C [email protected]
514,320,274 *348CEA9C3E18E875FC057444D2553D32E42E9A63 [email protected]
514,320,275 *34863FCB9349C9ED9364BE2A2F0EAFD808F32ADA tdchinii
514,320,276 *3489AC9EF21AF413B7D8E777132A2155257F137D tddbrrtt
514,320,277 *34849A7D16495461123455610C94827963E20C32 tddn1234
514,320,278 *348A16FE543F6C9BCBD2EB287321C6CE6B5BD104 t'DE
514,320,279 *34889D3AA5DA2BAFE1D241D9F1392BA685C3AD2C tde"
514,320,280 *3486A78E3387915F62E6A4FBA1C45ACBA129FF6A TDeaaa
514,320,281 *3480CEAD0B7BF76D71F400A41778568D48EA6E53 TDefiende
514,320,282 *348CDE264BF5BADF9AB5FF443BEA28059DC82F02 Tdeldni7
514,320,283 *34812B728747B63D762A43A7D6976C4798721138 Tdemseding
514,320,284 *348DEFB836FB17576C03090DBB1CD22542476B24 tdfturyse0
514,320,285 *3487B0208D8065C4F9167FF96C4050BC2CBCB10B [email protected]
514,320,286 *34823E5F3E6DC51360A048E8DB5302F6294ACC98 tdhT
514,320,287 *348C9DA61C0E2806A3E607CFBE9B50542A0961DC [email protected]
514,320,288 *3482F2138330FCFA1FB900810367488D8CA916E6 tdicbsf59
514,320,289 *3481717310C9051DA7471994CCC6BDEB1F9125BC tdirksme7
514,320,290 *3480AF17806421A2F7505AB34732CD65DE1B09EF tdjirtsn2
514,320,291 *348C163A999F045A7FA68348B9463F8E6FDF181B Tdjiwni2
514,320,292 *34849B948FD9A1947A352839974FB44A19267420 tdkrqbsw7
514,320,293 *34822CE0F32E965D3856A5A24D5443F8B9D627ED [email protected]
514,320,294 *3487B60A0D727651E484D90F47707174AF57A17B tdktimewarp
514,320,295 *34878FCBA6638891F0703AE6F5DBC2283B358616 tdkyon4you
514,320,296 *3481CBEA25CF0A9A5AA4D7562B3F0CEF85AB88B1 tdldkhtpgbl6
514,320,297 *348F0C99C41085C1180BE4483B0912E5CAF53348 tdm-to-tdm
514,320,298 *348768BD75A64F665158E9B281C85A6B54DCD6F8 Tdoibsw5
514,320,299 *348A15F4FDDFFAB7EAA82DD561BFA10E83AA06F3 Tdolçub
514,320,300 *348F0FE8BB5AE973885EE8D25D2BE7F8DB3CE604 tdomination4
514,320,301 *348A1197700FF93C6B19C4B87910707C997C7A3C tDPH
514,320,302 *3484BBBE0AD4EFD06198024F93C3BC929D928BCD tdqjyyeixlow3
514,320,303 *348A320EB20C88D0E733FA81274376D01130EC85 tdroonaV
514,320,304 *348E7A898DF7E74A81CA7579F3AA480F3F6079B5 [email protected]
514,320,305 *348FACD531E314D3C39CEB1AC9A60FB90A348A92 tdswnschn
514,320,306 *3485C379DA36C82FE621690577C33DD3E7F06E09 tDxT
514,320,307 *34884CFD49A608CCAF9E82401DAACEC65180F1A7 [email protected]
514,320,308 *348C74AD15B19AD8956C5AADD72C94D1B434B1DE [email protected]@ph
514,320,309 *34842CD77640A423B6D3F507E4F482E0F104CFF6 tE3b
514,320,310 *34856BF4BCF8369D24285A0D573245E72331A095 Te4-1e4ve
514,320,311 *3488840AC2788EB8A20D4C18ECCB5246B760272C TE901
514,320,312 *3489960FB384968E24FA5688904820A4ACEB8CAB tEA!
514,320,313 *3487928BE916FF8FAE228A46AB0AB0D520D2433F tE:a
514,320,314 *3488AA99FC588B1C4F1C4CFB3FA347EE7DAAA723 [email protected]
514,320,315 *34893A50071B70593CC81A8C67B9554E31B613D0 teachables9
514,320,316 *348FC73DBC46A351D065C258FF648B2FF3EF080B teacherblonde8
514,320,317 *348C55CB7728475F9798FF0B3E67292D3B5D63D0 teachercestuicestuing
514,320,318 *348B28E9C09FDEEF272F14FE6FFFF12E92AB8D06 teachergarden1
514,320,319 *3481E972E4F94C3270A676FDA4D0E17F99B1A2B4 teacherjasper9
514,320,320 *348316F9DC6DC167DD71073F39CAC05BE54A1091 teacherjoseph2
514,320,321 *348EA8778B0B2B7AA1594DD8698966AB918D964E teacherkelly2
514,320,322 *348C131F0DBF5AB411A85407D682EC25486EB056 teacher man
514,320,323 *348F4C597FD626266F716368A4F646A3E8F62865 teacherpublic2
514,320,324 *348BFCEC67E060AE2A7125127A32174B0624AD3E teacher-punched-and-spat-at
514,320,325 *348DB080BBD2F79A0D96F19FAD8551703C1D37E6 teachersamelie8
514,320,326 *34897691F8C0E85043A5ACF78B313A34B59CD8A8 Teacherschicago
514,320,327 *348A178C9B09B200E94127CE4DFB9B5A9A12D688 Teacherscoyote
514,320,328 *348DC9228289E3E6B43301BA53CB2F858B7ADAA3 teachershawkeying
514,320,329 *34874CAAFF20CA6BAEEE64E3BC86793639B354BE teacherslestat4
514,320,330 *3480C9ECEC898D878BD99D5A0AEBAA88852C82E6 teachersmailman8
514,320,331 *3487E513426BAB4DB5C3361D9FDE6D1DDEB7B8F9 teachersnewuser4
514,320,332 *348E2DB7D057169A74B9276CD4C7608170D76F39 teachersshebaed
514,320,333 *3482319C027F5D9EF0AE35B0D2095BE739606907 teachersvision1
514,320,334 *3486743178728C0BD2582A4FFFB3D05F499B664D teacherszephyring
514,320,335 *348114FC34265FE4B4FF92626180BCEF1A620E5B teachervs
514,320,336 *34817AFB263486808F36B25E374F76254476B1DD teacherz0
514,320,337 *3480985DFD7E4F3087D89D68C1B5E36F9B1A331B teaching-elder
514,320,338 *34802CF922D8AF40B7D2D8D308CCB3E73991B8A9 teachingexcellencefellows
514,320,339 *348D833970701B2CCD7FADBFA0FC183112A1F8E9 teachmeteamwork
514,320,340 *348B37139FB3FD8DF9C059D34918EF6B20C531D7 Teachout6
514,320,341 *348EA7AE5556DD9D8884FB552C41A7A61EB3C3AE Teagan793
514,320,342 *34815018E14727122B771FCA02E19585AAE79BF9 tealhampton
514,320,343 *348B763B01064E8D218EC51FC9AC14A40125F313 tealsasgk0972
514,320,344 *348760358A6C502375E95755DA954115D7EAAA48 teamA1
514,320,345 *348DF63948183598B0FAF98D3488A88B360BA3D1 Teamdream
514,320,346 *34820A1AF3DA61471EFC34F953F3CD9C8F446438 TEAMID
514,320,347 *34898073D53FAAC74A6EBF7BD4734A6281310C15 Teamite1
514,320,348 *34854445A8928EBEF5B14D629605E24088F6C049 TEAM-NOTES
514,320,349 *348FDC96E0C70AAF59D3C07A338D2BD3B6D6F22D TEAMOJONADAD
514,320,350 *348614D726B070F0A3CA9D573768B266DBE8C5DF Teamrif0
514,320,351 *348DC51FD7016DE9C0B66CFDF13BD2E98590D80C team.runcorn
514,320,352 *3488E8E9C60D07EDBFD58B3B5BFCBD4630E09CDF teamsprint3
514,320,353 *348DF4E864AB96A4A7F60631D4487097DB735989 teamusa1980
514,320,354 *348AAF8A0A63E392A88C83860E0AA0D3E743D6B0 teandrica4
514,320,355 *34896F01C8E7AD05A4D9BA183FBE32AF35151232 Tearany2
514,320,356 *348A5A25E67152D58D1158817369859220D1963B teardropping5
514,320,357 *34805DB15FC9F809154A78E30F262E458F014387 tearfill0
514,320,358 *3482C7F9AC563E70B53D0DADEEF5D0E3A102273E tearfulnessn0
514,320,359 *348BA1FB953EC53B4C18A3D821CCB6BC1D83E222 teaˈrim
514,320,360 *34880DDB331EBD06AB777A9E40669C80DFA93475 Tearles4
514,320,361 *348F482F108F15D1CC827702314A19050115BD15 tearmaidheacht8
514,320,362 *34890D76FCF044F280C334C89A4B0E5905912EEF tearmannached
514,320,363 *348A353A03726C11AE6BA875B528F5115EB4CE8E tearmisty4
514,320,364 *348DE3AEF268FCFDB17BACA16F376C0EF5CA4419 tearsalting
514,320,365 *348422B4583F846031701FB53F1562E9C5738F46 tears_are_not_enough
514,320,366 *348ADBB2D1EC40F91294E75BD160EE069BFB21F6 Tears of the Dead
514,320,367 *348849B2E5C8B9165F4F24F8EDC2258D46FF7FDA Tears on a Pillow
514,320,368 *348124E7660C8471782038246E3736BB848C9182 tears-thug
514,320,369 *34857EF77AE98E4FA2755A0666A3287805336698 teaselli8
514,320,370 *348A93FFC13EE82DE2BB94ABBCD3C31445F56119 [email protected]
514,320,371 *348A33037106576BF70AD48B0AD713DD56D02294 teathbsw6
514,320,372 *348F81A86899F3B96F28581A8FA7E6FAA33D1677 teatilauq0
514,320,373 *3481F6303A8C9830C077187CA15AD90ABD20FDFC teatraal6
514,320,374 *3483F69BCCB85BE422E94EB49E6FFC2580FDA6C0 Teatrogrupo
514,320,375 *348BE3C1EB82BA9E4B9BE80AAB212BF4798AEB9A teatrologo
514,320,376 *348FAABD11E2AA1FF8B16226C4D576146335005C teatro-regio
514,320,377 *3486587AA6E9C7D89E1415763D5E06ED29CF9C7E teattereihinsaed
514,320,378 *3481E65DFCD28747977F65B8686E18069E324C50 TeawithLizzy(Radiomusic)
514,320,379 *348BF364D64096CED93A2136D7597F1561503D75 teb}
514,320,380 *3484A31323FB8E1A445EF3625DF420F2E5DBE9AE Tebahplab
514,320,381 *348341098F311A95A8A460EEF2DE65981FD9FFA8 tebazilemaerD
514,320,382 *348A2B42DE44F3517DA61B21D36874206EF2522D tebikagn1
514,320,383 *3487EF83FE544C87D772463FEC29530F9DED61D8 teblmenneg
514,320,384 *3489E37F436E855042640C05F8050932E57497D1 teblrofs3
514,320,385 *348C557B9F29DCD66465395F880ED2269AECB42E tecedoras2
514,320,386 *348B44F7A11543B51038E7056F5F243FA2DE8F4A tecerruts
514,320,387 *348BDEB8A77BA8DDBF570C62FBD4597068C52F78 Techamosing
514,320,388 *3482AC74BF9468EEF7790E0576456BB85800A81D techboogering
514,320,389 *3484BE037D39E41617ADA276DFF166FA0E539A9A techbookses
514,320,390 *348573B8C457FF73781D690206B4C9B1BA89B3F9 tech_cmp_sw_4_5_name
514,320,391 *348AF08A954D75C77DC22ED2C252F7031A7DF37E techdarren6
514,320,392 *3484915B994C81240D6CAB062C5B731DAC066CAA Techfghs
514,320,393 *348688326FEF125AD0054E33189D6C41FB451107 techforze
514,320,394 *348ADB797897E078979482EB5C5E6CD6ED0F59D7 techgreendays
514,320,395 *3484F342383A4E2BA4FA10903AC837D7F644A99A techitaliing
514,320,396 *3487203C49C45982AD48FD683E719F011D3AFC46 TECHJOBS
514,320,397 *3480178F6125A1551E7F6AFB7B5D69DDB569716E TECHNICAL FIXINGS LTD. | UNITED KINGDOM
514,320,398 *3484FEA9B2651A51F20ACB8EE123B8532B206A92 technically-demandin
514,320,399 *34879D1B5AF24D1D4CB88AC254DF74EBE7C19FC4 TECHNiCAL SURVEiLLANCE iS CARRiED OUT ONLY FOR WHAT THE
514,320,400 *348FB16937E43F4BF9DCFFC3944FE1502037F21D Technicon5
514,320,401 *3485D78FE4129FF6F33D40FA99E3716CF1EC2167 technicophilists4
514,320,402 *348B95B052621053C515102E81E4D1E2654EA940 techniical
514,320,403 *3486EDBD87F798E9D69C5B311CF8845053755B0B Technikerbaas
514,320,404 *348C999DC37DA558B8579B1EA46F8AE618431C4F TECHNISER3
514,320,405 *348D8256539389EB316B24F3CA56426BA7222B5D technocharlie5
514,320,406 *3486841723C2834F513430A3A6A69B8D4CE8B086 technographical8
514,320,407 *348AE2DD03F81FB579DF39C00375B0E23CB8D633 technojoel5
514,320,408 *348DECD1261BDEEF27129CB02C65B33DD2D269BD technojoseph1
514,320,409 *34833B25910D2AFA5141CAB2E7350D6DBA6F47A6 Technokratenregime
514,320,410 *34896E5E16466D23ABD6DDC4763E15B0180E3792 technoliverpoing
514,320,411 *3484494B7CCBC7B7222BE11B8416C8A604871CFA Technologiekooperationen
514,320,412 *348FA613B8355CFE68CAB3A91EE024D3C5F22451 technologieseuroscie
514,320,413 *348A09211A083E92B3B1A045A208804A8F850854 technology.and
514,320,414 *348752396D73F54D6C0E7AD2A485573399CF6AB6 technology.best
514,320,415 *3486690311DB44E4BF220200F38094159E40A908 technology-industry
514,320,416 *348CC5CC1852E95D9739918EEDD6440436ACDD9F Technomisty
514,320,417 *348EC7AFF514DDD656D7AE2A84B484C1A1F3692B technomor
514,320,418 *348A354BDB1F3E1A05CE464969DBD6203B0EDF5F technoroger1
514,320,419 *348D511887BE8B68D1C3BB16ACF4741F06960AF3 technosteph3
514,320,420 *348A1C491E71A02C5C03CA10CC67BB4A73E7E457 Techruthed
514,320,421 *348FA3BF5B5996D499CA25EA4B459A79D0F68DAA Techwaying
514,320,422 *34881F4A95C4178ABCBEC371DB58A4CEEF653679 techwebster6
514,320,423 *348B12AA09D703F159806539193C1F064335DC82 [email protected]
514,320,424 *348601C904D21C96466EF06003C8CBED7AE60FD0 TechWIG
514,320,425 *348112C7761F31593C9DADF0A1EF4D6AD98673AE teckenkombinationern4
514,320,426 *3483F17A5E6BC7FB559E9277FE713EA1E0275BD4 “Tecnica
514,320,427 *348028FACCF8E163AC6D9BF246E3540CA68018DC tècnicos
514,320,428 *348D658A4B54497F4510F0D2A7386A8267C6E5AE tecnologiche8
514,320,429 *34843BE0D3A47BC670ECFC38299BFB7E41D0D176 Tecnprom7
514,320,430 *348EB7CA8D09AB7A8CD072DCE931E4E4484A4676 [email protected]
514,320,431 *3482802A65DAC086DDF431EB83809CB7CEB38986 tecoluia9
514,320,432 *348D33E83C72B2C21E22C65F60D11064A1A9818F [email protected]
514,320,433 *34884D3632409ECB373C243F0B2C08716767B95E TECTOSPONDYLIC0
514,320,434 *34826663A6DF1D5E2FFD07BCE27BBB6FC487216F [email protected]
514,320,435 *34870FDF534E9D94EBE96EE3DA7CFDBCE2EEA441 ted78
514,320,436 *34812EE9301A2ABCB3FF223D8E78EF3D3722561A ted.aguila
514,320,437 *348EF938B8B223F9EBE748654DE91B15B5E7E0DD ted.andreula
514,320,438 *3480CBA76C83E00C8EB21E311EB2C8C5C1DC1906 ted.anewalt
514,320,439 *34846ABBEFB6DF8DAAC663A78E3E3F1AC42EDD11 ted.baltzer
514,320,440 *3481643E3AFE4F85230035ABA9477EDD10EEB025 ted bonis
514,320,441 *3484C8FBBBF7ECEFB32B6CB595F4D318BC59FF43 ted.brushwood
514,320,442 *348C9068C2CA77324FBE695C1F60FBCBD83F3B03 ted.burke
514,320,443 *348004E8469CB3418E9CC71469C935FABAE661EC ted.canellas
514,320,444 *348EF0566C8FCBCCB464803EA858C6528A18FC87 ted.carn
514,320,445 *348B30232246799E68B00985EEE5781BF97E4BE0 ted.casseday
514,320,446 *3484CC28B896217495DB058C83005E86742ACA1F [email protected]
514,320,447 *348CC270CC1ED4DF0052A8DC7E6E7BE9496B70A8 ted.demoss
514,320,448 *3482D4AB8E85BA6645FB0008172A1C26A8EBB72B teddifer
514,320,449 *348EA958C80A386A74D867EF4C5B1EAB438E7351 teddy.ainsley
514,320,450 *34807D2937A02FA08F5D70422C14D1586BC6E61B teddy babcock
514,320,451 *348EE6AEDF302818678D407746D6F6F4256AF6B4 teddy.bramuchi
514,320,452 *348DE76A827E3021544244FED0222A336DEFAAAF teddy.bryar
514,320,453 *34845B1DD0B52B1F19D60DBB2B0DAEDDFCBB93E7 teddy.caminiti
514,320,454 *3480D381FD5832936AF96898D610AC2182332862 teddyclover1
514,320,455 *34829C3806D167A624E1756396DDD7ECE71A6AD4 teddy.consolini
514,320,456 *3480A45BF4447E48BC413A812701ED1D96999E83 teddy.cristobal
514,320,457 *3482B31E4DA6B5AE6FA5C2FFB9678434CB0F2E68 TeddyDiaz
514,320,458 *348AB37F6B382AB2D868DFF5332282AB93FB6352 teddy.dickman
514,320,459 *348B92AAAEF7AD167F8BC86FC6B2A8BDFC6E4C93 teddy.fishburne
514,320,460 *348FDEF30D543EDC0BBA0A0DDCA09446E1A0D27B teddyfished
514,320,461 *34871D925F1837E5DB779184C11E55675F10C928 teddygo4
514,320,462 *348B05B2835F8597A6C1919C33FE759E9B52071C teddy goldstein
514,320,463 *34811425B123A0FE59D04602513FB47D7027B440 teddy.idemoto
514,320,464 *348BC3F544217C30D11E1E6666CD055FC0166BB1 teddyisland2
514,320,465 *348AD9BAEA40C3468243417EFA6FCB7D6E30A4E8 teddy.lynch
514,320,466 *348A2E21B1C1F81933D2D500F62BEE375B01364C teddy.phommatheth
514,320,467 *348A168C9A65F98408BF3CB434747CC0683AE23C teddy.point
514,320,468 *3487085321C52977ACFB3C06524A47F3EDE53BC4 teddy.rama
514,320,469 *3484E35F6F1D971F06577A18A8D51BBB3CB346F0 teddy reynozo
514,320,470 *3488ED77B82CFAC54185A4872A0A78E4AED3B401 teddy.sowers
514,320,471 *348EE8318DE50C04FDE79B34DA514124DB738640 teddy.stai
514,320,472 *34816DDF67F76D71DB0F1DB882F8949849C06521 teddy.syrrakos
514,320,473 *3488E17E1BF2C8C5968AA7E2B3319A722F0C9D8B teddy.vivenzio
514,320,474 *3483BE6DBFA8ADDB9FBB9DF14745451ECAABFEF4 teddy.wollard
514,320,475 *3481DCD98011259EC049B8EE9E15B22AF5EB053E Tedeana8
514,320,476 *3483D9AF625946ECF2F1E7915AC4E5AABD6DBF70 tederheden?
514,320,477 *3484EC6AF3E30AD37BC3B2A4CDA794BD4E78C24A tedernsts
514,320,478 *348E12C07F4382C33D2C326D5DAC45E1D89B4433 te-de-saint-fran
514,320,479 *3485FEAE98E28967A4DAB883E0D36B3940E42E2D ted.essen
514,320,480 *348835CBE80BF05E79484CA775EFBAED368F8ABE tedevohdr
514,320,481 *348B982361316BF9EE2E5CB9365757991B8DC178 tedhelir8
514,320,482 *3480CE2E2786FD104BA165FAEBBBCE7EC78A65F5 ted.hounchell
514,320,483 *348AC0C6CEAECBBE0079350D307F95442D2A7286 ted hussey
514,320,484 *3486D05217DABAE4834C27825AE5C2D4BA86F02E TEDIAVA
514,320,485 *348F4CC83356BDD06E5310386F6FC772209333CD tedierestes0
514,320,486 *34844A0D8F341C297EC33E7BD3A77EA02C260F51 tediO
514,320,487 *348CDBA230CAC2058559695B3EE91E1B81D4AE82 tediousbeatbeat
514,320,488 *3482E63591C164045AF4BC9B059AD1318C7756F6 tedisegil8
514,320,489 *348C53AD00FBDEA88F2E09A8F7AC958E692180F4 tedjabsws
514,320,490 *3482C59DA2ECF18AC23E18563C2573234EBE9FE3 ted.lindboe
514,320,491 *348C87A40E8435025A33BBB8304A31C76AF17BF4 [email protected]
514,320,492 *348E8E8FD2AE78C5E878F9E1C69850DF54C451A7 [email protected]
514,320,493 *3480A636CB50AD23A139CD90A44AA68596D657FF ted.mcinroy
514,320,494 *348C3E2B9CA88F7D9823024C190E192AB6EFFA19 ted.motteshard
514,320,495 *3488C175A2ED673E2E08A2A52AB981C634D25C13 tednafre1
514,320,496 *3484E4C5A763B0AA26360C74BDA4DA1FF8B43492 tednalbis
514,320,497 *3483A19225A7898721BFA22426CDB39A8DACB05E tednubro3
514,320,498 *3485156ED1C61A8137B6698B2B40CCD9D1E4327D tedoncommissiononsite
514,320,499 *3482ED0877507C2147D883451648C9384819D20F Ted!ou$ne$$
514,320,500 *348E788D480001EDE50A4704B08C552E95CA7103 ted.risse
514,320,501 *34837F33E103D08C851B54390B4410CB6EA20A34 ted.savic
514,320,502 *348128A31878879080DC748110C630D51EC17C49 ted.steinberger
514,320,503 *3485366759CA5C63B156E5C265CA68198E9240AB ted.wates
514,320,504 *34863C05F709EDF6E078897F5D6E0E537C0CA050 ted.westler
514,320,505 *34828C6642097184C39DA13AE6EAC23F3AB57FC3 teebkcotS
514,320,506 *348EAB45EBAF051577273C73D724CE285FE1AC38 teeC
514,320,507 *34825295B5C5A7452DE9E54D4EF73E8BCB948AD3 teedo_23
514,320,508 *3484FEF6F5330BEE5AF4060F2868EC2A8C8BA248 Teefall4
514,320,509 *348F05E3D2FF1FF16D4192D098C2BCB9B9A4612A teehsecaf2
514,320,510 *348E619AE860CEE12986B640135388A059ACF6EE teehsraeted
514,320,511 *348D9BFE094D25D39D3C68750F00FF7E61831028 teeitup:evenpa
514,320,512 *348FC0FA161387F99FCEBE3E710D7F5974A36FEC Teek2
514,320,513 *348D2065524EE348B954AE48474466C5D29687D3 Teelerts7
514,320,514 *3488B13766C2F32517A87F4B050ECEF3761EAF35 teelpsth7
514,320,515 *348CA90972E8AB5381D592DD9359E60B5EF0D28A teemak18
514,320,516 *3484CA4D25CE3B87594CC08257F5E5161CA102DA Teemanumeroa
514,320,517 *3482D0B144255698BC0B7950C29B37FA016A4DED teemaplaneettoja
514,320,518 *348EB0FBBF41165AB05E244E224430C101D6BDCE teemsree7
514,320,519 *348AEBE36F4B0EF1BE25FAD50DAF8A3D0085523C TeenageFool
514,320,520 *3481CF362F92276726ADA81FDBB322BD7E35B9A4 teengamred
514,320,521 *348226AEA2258A82AC06998BA1AE9D6F963ECDCF teengangersesed
514,320,522 *348FA63E19233FA5E7814A2A3E66EE3D488E5A59 teengerigte8
514,320,523 *348F431FA24A2B5120BBA31BD7EFED40EBD57D31 TEENIJUAN
514,320,524 *3483FEDFE6ED87237FB63D4C86373E0227583515 teenikkis
514,320,525 *348870D2AA0C6BFBD443F47237D2D88FDE004153 teenpup1
514,320,526 *3480EDD2CE7609191C90FF3F6FCB8DE8143300C3 teensex channels
514,320,527 *348D0ADE639B8D187987B93CB6B87ED91A519F65 teenswar
514,320,528 *34894F4B4BAC7B9C28D4F33456286A402E08B921 Teeproewer
514,320,529 *348EC08DC19317F47FA0D447091BF2F4BF94AF9F teertseming
514,320,530 *348BB12BC523B0CB854A3486CFB7201C086E47D9 (teescribodesta)botellitadecielo
514,320,531 *3482FF1B05002491B7D5FF4C27AD2D3AC4A273C1 Te estar
514,320,532 *348CE59F45E8E131F1E9488C767D39C85E364E36 Teetiak8
514,320,533 *34863CA60053434505D8DADD2292C091F78C43DD teewsreving
514,320,534 *3482095385E2043DF4F02E762F5CE495BE47C65F teffins7
514,320,535 *3481F2656802D79F766FE9CE312FBE890489C2BF tefilin2in1wr
514,320,536 *34896ED8C09C112ED61A6B6441BFFC13FF935CB3 tEFiXXQ87
514,320,537 *3489FF74A7339E78F4A4A8065DBB45A4FBFD37C2 Tegatrofed
514,320,538 *3487C4681B34F144B50C196934E1DD5D6A496A00 tegdikhfxqgs
514,320,539 *348E52A25E2B0E103F46614ACFB215F8EA39DB19 Tegeldem4
514,320,540 *348BF003388D8B68C07EEC07C76A272F03B61A3C tegenartikelenS
514,320,541 *34801BB47FD5C623AB4EED855A3FAEF50BC5F7E0 tegengepraatsed
514,320,542 *348C21B49625E4618A9AE9C3BA22767CCB5EF088 TEGENHIELD3
514,320,543 *348F46A640D05977016714AA3236DAC20CBF6B7C tegenoverstaands7
514,320,544 *34886DC706692779B592752A782C4C137746802A Tegenstandster!
514,320,545 *3485DDA8E2D27F63FCD5CB5708DA401B58995E6E TEGENSTREEFDES
514,320,546 *34867AF59A3CE6B1007CA5C8AC4CEB28C4840612 tegenvielens0
514,320,547 *348270B0077531A75255453F61C39F3EA3A7578B Tegenwerpt5
514,320,548 *34822EEFA546BB3913B8D188829FC0198AD87795 tegenwonersing
514,320,549 *348F6FF2334556D7E5993AB366398DF868A48FCF Tegenzee!
514,320,550 *3487AFDF12DC38DF4005C3A235403C96BCF61F15 tegguntruocwen
514,320,551 *348A8FA0B983D0500C279FBF4FBE2AE18E1999E1 teghariapaschim
514,320,552 *3486DB55E408EC128C44D54317B61FAB040494B8 teghtem9
514,320,553 *348427EB08F53D4579B270FC417459F4055736DE [email protected]
514,320,554 *348847776BC46BFC99A0F955B887225DD93E316B tegnings
514,320,555 *34880274C7A8D48124ED4AE4768BC0632CD4D94D tegtegeerfnoitulos
514,320,556 *3485AC398DFCEF283C45C879865A9E97BC7DF239 tegtegetatigufnehserfylfeelfffo
514,320,557 *34873A29864E6FE287D1B7E147DAD9CFCC50FC68 tegurbsgadrevh
514,320,558 *3481A45FC14A8B72C4E2CA4D46C6CC124AFB0B65 tehdkin8
514,320,559 *3487A5737C85DAF48658E20C1EB5F41055913B76 tehillim,iv,part2
514,320,560 *348B189FA8A571C7AB2DFBF139C60A49092D0B4C tehling0
514,320,561 *348AB8799CFFFD13F64A642F12C3D92A289BDB7E tehnoloģiskajai
514,320,562 *3481C41B63FFA0ECAAB1FA568454D3F4300BE99F tehoniness0
514,320,563 *348ABF273DE4FE060D2FCBAC173F203143BED1B8 tehottomat7
514,320,564 *348DB919793656AE0CDFC0D855543682AE6667DB [email protected]
514,320,565 *348056416E099F4691E3769096154A859D517C2C tehsiubswed
514,320,566 *348C69BF5E153B161E438CD4E21676BE699E258B Tehtaanmyyml
514,320,567 *34848462C5B76367DFF8A2A186DAFF49CC48FE47 tehtaanpiippua3
514,320,568 *34818630155131CBD3DC06533D07371F55C65C63 tehtaantyömiestä
514,320,569 *3487E2C84ADAD647BF0BA5EAEAF0092550C8F74C tehtaasta7
514,320,570 *3485406838A89C222AAB3AF96EE38D98368F4586 Tehteet3
514,320,571 *348621BECDC770EBEDAEB53A67604D46126BAA1B tehuantepecersed
514,320,572 *348C7308ADD9F09E1483378B286E256FD8040FDA TEHUELCHUS
514,320,573 *348A875AA76B2057C935D02803AD62C4579F37CE tehyaeu
514,320,574 *348923C659F5E067CEB04161F135E24AB23923E5 tehαnologio
514,320,575 *348AFEBB2C03D310AD5D8CFEB21903DA472582F2 teichhühnern
514,320,576 *3481D0CFD446B9FE05FE9B0F4F91F2DD9ABE3444 Teiflltsfy
514,320,577 *3480FDA590432D53C6FD7B8445A8F58F3EFBC25B ”Teig“
514,320,578 *348CF1642A3A065F1750E879F11A9D0C2D12BCA2 teighälften
514,320,579 *348B6F8F49D0669272DC508F1FC153F06640EA45 TEIGHNIE
514,320,580 *348B8F43465387FE34952E903EE77FD8C06C45ED teihcsdoods
514,320,581 *3487406630E73D32A34B62903721C2487F540B0B TEIID
514,320,582 *3482A433BB5CDB284EE8DEF6B669149064495617 teijoiting
514,320,583 *3481B2C4A9B8121CC8989F8896805EE8EA0730FE teikanko6
514,320,584 *3481CAB8D49028D372766B4EFBD21B18FA3B4BA6 teil05-dasschmusek
514,320,585 *3485634D9EEEA129F2E2520403E8221F6653C932 teilden6
514,320,586 *34811F4F4B44A3DF0B2577E4013A82BB105A5427 Teileinkommen
514,320,587 *348E7BE2B532D590A41FC8997367D62FACDEF542 Teilhalogeniert
514,320,588 *348023576CD8083500AF922598834EDCAC91E985 teilskalen
514,320,589 *3487606BA1BE18A88B390DCF3F3EA08D85E566F1 teilstörungen
514,320,590 *34833249CC1A1689D9796A9B607483C894105BF6 teilweise/a
514,320,591 *348104376EAE69D3FCC0EDA86313CD20D2015C2C Teilwertansatz
514,320,592 *348071A4028DF665807C583C10D56ED0FDFC49BB Teimeis8
514,320,593 *3483EC1370CC8DE41D42DECE83F16DEB29087951 Teimoor5
514,320,594 *3482F26007309F741A9CD2E15AD1BB91B83C5910 teimret7
514,320,595 *348E52E5656D7BDDB1E7765943F4A0615FD14121 Teindraient1
514,320,596 *3484C8FE33C374D174BC647A871E4ECB81063DBA Teinein4
514,320,597 *3483B957A8AD62BDDEDD3ADDD8ECDB0C46E151E5 teinen pushiganga
514,320,598 *34818B5DFFEC0C149D789DC987BFCB070F796BDB Teiniteatterin
514,320,599 *34870E612576384199B0A8053C3624944C7C4D22 teinobe3
514,320,600 *34883B8B080995BB918AD3D1825D3445A3845CC7 Teipoarii
514,320,601 *34824DBE041D81A99CD1D42A83C22E61ECFE06BE teiresias“
514,320,602 *348BC0EB947A9932DA4293E0E84A53F09783C902 teisclinn
514,320,603 *34810E47C17FC28AADE8F480FCC6DB28AD7B26F7 TEISSIERIDAE
514,320,604 *3487BA44CA3601D7BF9CBFDC99329FA53DB5A5E8 teitsimu8
514,320,605 *348DFC9D6A375291DDCD395E37122391812A6C34 teivauqa9
514,320,606 *348308303F54DD5065C59C79C83C5CF71A65A3E6 Teizs
514,320,607 *348F93B6EAD7C2AD60074AF5FD26F684355B3177 te+j
514,320,608 *348189054C1127C85C4A199E1BF782CE7AB5CCAC “tejeros”
514,320,609 *34880FA71E86534F08A1632F416D4C1D54163C1F teji randhawa
514,320,610 *348A68E94036F7E8F2CA4ED84AD085F943D134C9 tejkahlon
514,320,611 *3486465B139BC00DCD34D60D5721C5A6923A4C0D tejoumaled
514,320,612 *348380B819C32B74A167569BB78E91BE47B41608 TEJOVA.NTO
514,320,613 *3487045831765BD8A4CEB18F05948B0C2C50F664 teJQ
514,320,614 *348B4FB0DAE7267E47DD9A39769FE2CC717ABC95 tekapnets
514,320,615 *3489ED5DAF10BDB5F3008E7570D22449DC4E85CE Tekcast7
514,320,616 *3488AEE389CDED3FF3372E2657B4B9FF3B27B8FD tekcordergiB
514,320,617 *3486EC9DA159F2DF13CD4AD7E3FF1375985D4078 Tekemästä
514,320,618 *34832B12BA938FE2AD05667998018043A781BD33 Tekenfilm7
514,320,619 *3480152D87BB47566BBB1D5CF4567A52C28EAA2E Tekeyehing
514,320,620 *348F95DFB3A33F6DAEEF03CD7927B8CC5AD698C0 TEKI)
514,320,621 *34898AA63C13BD837E8062B246589FA9BD81D403 tekiatuf9
514,320,622 *3483F7B1AB4267B5FC3F6983DED32378ACC905C3 tekidan5
514,320,623 *348B4DF0562DF6068B82EA02DA5339406361B578 TEKILA14
514,320,624 *348068E38DD320C3D71203D36B5614A02DFBC922 Tekirdağspor
514,320,625 *3481D19376654AECAB280FE85D984BBA42764E77 tekmatebsw0
514,320,626 *34898F87A8334828EBC0C1E82164058B564FC2B1 Tekniskeinsekter
514,320,627 *3482B1145C3C85D7FEAC2FBC5BFDFE338F617F2A teknologiaftaled
514,320,628 *348FED2F88FE998B1EDF8FBBBF0D1800A40DBA10 teknologiakes1
514,320,629 *348BA35878C67BA4AD294F700CB85190FCDA8BC8 teknologiakylaeyritts
514,320,630 *3489A0BA9051659894C7A9BBAD1572B477D84593 tekojalokivillä
514,320,631 *348786BE07DE97EEDFE90E5204704678155B9E99 tekokuitas
514,320,632 *348E79E5EBB48D9BD24386E7D8A6B25256517AB8 tekovaihs
514,320,633 *348C1C0087DCF9C9BF3B4609F17ABADC366D0D1E tekracht0
514,320,634 *3485BD1B0C3E8C010AC306CCEB799A35BD2FF63E tekramerp8
514,320,635 *3487A91A78DC01B9ED9BD1A364B356758F1D482E tekramlenahc
514,320,636 *3483081996C2C926F801FAFBAE215ED3CD46CD53 tekramleumaS
514,320,637 *3483FD71868F6ED5A0884F568D657C0EC9A4B6D7 tekramymmat
514,320,638 *348E9C6F7C436252CDD19BF9FAC1A37ED9F6C966 tekretaw2
514,320,639 *3482AD46295EEE12EF84A6D7648BB3D5E248B9CA teksabrelpmas
514,320,640 *3484BCE5BF6DF3B92BAC8AF9395293827E4BB007 teksank5
514,320,641 *34860764A67D37BA6D4A160EA0E668D11A4A1AD7 teksmejhing
514,320,642 *348D2F167675CFD094FBF701399BF80849F3E8C6 tekstniveaued
514,320,643 *348552BECBF9DDC44C1C0CDFF0B4E8A865B7CE46 tekstwetenschapped
514,320,644 *348BEBF1DE32836794DF59D1E9F98ACBBA389596 [email protected],
514,320,645 *3484251102B1C7D5618CF7FA47695C211805F696 tektonik3
514,320,646 *348420298F3156F8CEF82234362889E29DF33B1A tektonskued
514,320,647 *3485F3124FBB59C7128DA0FBA1E7A13366DA8082 TEKTUMIP
514,320,648 *34891CC2BA98573D4155FA2748547EF5C191718C tekysha7
514,320,649 *348B96E2EFBBE355C76EBB7B92EC8FEB22D27CAE telafu
514,320,650 *3486A39BE0A20FD45DF64A112FD16926AC5E6FE4 TELANTHERA6
514,320,651 *348F70AD843C2E16116AD624A7593C8235E3174F teldaerht
514,320,652 *3480DDC54FD5D2D5B00EBBF9D7EDC8B660B10A4C Teldnebbing
514,320,653 *348A066953F9A2E4049BAAC0A9C10596778C1611 TELECARDIOLOGIA
514,320,654 *34805FC7616785A7345D9B3B4FAF1FD7637E1314 telecards.islands.co
514,320,655 *34885465B76948458AF24940A571C4A762A7A3D0 Telecihos
514,320,656 *348520CB14F2DC56432A3737CE93DACDB29C5286 teleckoje
514,320,657 *348433500235A4C451558346446F9439A48747F7 teleclubbed
514,320,658 *34869FEBF2B3A36875CB23BD32DBB1E65F1D9B2C telecombetty1
514,320,659 *34828C04C65DEADCF73546C9E5AF3596EE4F87FD Tele-Communications Inc. Nynex was buying into cable
514,320,660 *3485E55B627605C8973CF598766E4FA212231958 telecomrhonda2
514,320,661 *348AB027BE556C6B1A3EC89FB9304F076CE6EF23 Telecomunicaci
514,320,662 *348439BB7B28BB4A7EE014B66628D9D1400BC19D telecomvision4
514,320,663 *348571E7A85CC263417DA7EA552D5A980142FC67 telecottagings0
514,320,664 *348EC1DC0CEEF0ED0700CE87BCA482085A5F9792 Telectu
514,320,665 *348BE43A52FD933F257CC06F5B94C8FFF6DCF51A TELECUORI
514,320,666 *348C57DD359BBAD1DFA28ADCA61328F313ACD61C teleden1
514,320,667 *348B529005A2E9AF8BE0F3197F3E9F2C825B7F49 teledine7
514,320,668 *348AB8CD858103CDAEF6FEE8320E441B9CE3CC86 Teledyne4
514,320,669 *3480C3FE63B2A5B1238F7FA012431F96BC6AAC47 Telefiwing
514,320,670 *3486BCA1F46A2C936D9C7B9EFC9B407BEAADEA9C telefonannoncernes5
514,320,671 *348E3F598922D7756E6F46DE04D0869D247F1539 telefonavam2
514,320,672 *3480E6DA10A2B6B9F050B332CC789DED77E36D85 TELEFONBRUSE
514,320,673 *34805AE278A8FB4E7DB042D7406711423EB6CC9A telefoncomedy
514,320,674 *3480960126B08A5BC895BA36424A18F7D2123DFC TELEFONEERDE6
514,320,675 *348D911E400591780BC0BF2AB6367DBC5E605A17 telefonkonvertering0
514,320,676 *3485255DE1BB34832E9F026D055AD24672F829DD telefonnring
514,320,677 *34812A7F4372788A1915E7B65A05231D3BA51190 telefonsamtalers0
514,320,678 *34859ABC8A54F53464205EA516A843225AD66C04 telefonsvararnas6
514,320,679 *3481AB65A15856745F62258148C142F42A1E02C0 telefonuj9
514,320,680 *348587A1A2073A3F830C99280CFB280B0948D036 telefonvarningar
514,320,681 *3484D14450A308BA82238BBEB0AFE6E2449B6C55 telefragged
514,320,682 *3487028448B4C85EC836FAC9BDCB3D8BF4345BAA telegniring
514,320,683 *34808CE612E80F0899037FC97511AD5B1CB80E43 telegraferoed
514,320,684 *348DD6951D25630727032615643C3858F3C59D91 telegrambezorger
514,320,685 *348EB76DB6FC77C7A6AC49FEF2DEABD01BB6B361 “telegrame”
514,320,686 *3485FCF748FC7739C0ED5EB824E5A7E9AE2C8F08 telegramstyl123
514,320,687 *3480B3FD6B55FAAFCE60A0D593601D4D18092E19 telegraphyreceiving
514,320,688 *348AD479B68D0D4FA23DDD993D94B7D60471EF09 teleguidaged
514,320,689 *3481192193FD9335DACBCCC9FA1865C066666857 teleiwnetai3
514,320,690 *348F4F503F9EF576B9FE331E482146A80830BBD9 telekommonopol
514,320,691 *348CE4C84DEBA31970AAEC7FC7F64E07F2F7FF8D telekonferenssystems2
514,320,692 *34820A6968220A543F0425A6B54188E832F25196 telelogic1234
514,320,693 *348D9A07663276BA6C093F0AFB1B8F505B5FAFC4 Te
514,320,694 *3485584EAB5EB26B6CB2571E666BCA4DC3B3EA9E TELEMECO
514,320,695 *348BAB37E69F570E18110CA220265FFDBD9FD0D2 telemedizinführer
514,320,696 *348191CFAB7FCAE7560EBF5D42F7FACFE672E578 TELEMETER7
514,320,697 *348EEF4645AD74564B82D7476087F0F53CADCAFF telenovela-style
514,320,698 *34864CCCB793F305785FED6B04C9A6FFF130983E Teleorganic6
514,320,699 *348C3C6E409F655B191A6E878410D7EB230AAEB5 Telephone Arab (Shantel's Bucovina Dub)
514,320,700 *348C3EA69F16777431ECDF148549F151D4B0C7A0 telephonepc
514,320,701 *348419F2F5D9918F8170AA1078F343B6557DA1E9 telephoneterminal6
514,320,702 *348FF616239A7A4811CF30CD3849B7C42566549C telescopi—
514,320,703 *348B09A03A238BCFB0C998F89D9C18920A6CD6D2 telescreen.
514,320,704 *34865D416C8258252FC419CB7A12A049138F03FD TELESESES
514,320,705 *34853630D9FA6F1736FC67897B9688AB81FCE739 TELESKOPETS
514,320,706 *348892B5F5EC660353BCC47DD13C519B4840A4B6 TELETAMA
514,320,707 *3481B9683253302CE33571F31084DA1961B08C48 teletubbiemeuchler2
514,320,708 *348513EE3D0CB00323A63688166239D752973134 teletypesettern8
514,320,709 *3481EA2F8F8E9D773D7B52B8919CF354753CA47B teleusebswed
514,320,710 *348563A3154CD1D3B18F6D877AE742BC759CB325 teleutosorusori7
514,320,711 *348F5D20887849EA67EEB31C24E7CA66341AD8D2 [email protected]
514,320,712 *348D5FAD91879C2A31B87D9DA78744F8C43142D9 Televiisorontuksis
514,320,713 *348D03ED0F8FD6865C47F124B9A39158BBB11888 televisioncookery
514,320,714 *348FF6BEFAE38A96B2E02526EB61421C961878E1 televisionqueensland
514,320,715 *348FE4BED4CA6D8272F67E4532528A48E4AE9C30 televisionreceiverparts6
514,320,716 *3481FEEE3263B4AAA5735FE9D375D86468CC4864 TELEVISIORYHM
514,320,717 *34861C49A3DC1B9FC41B3AF918C6F97B6512378B [email protected]
514,320,718 *3480A897E4DE98882BF7236A71129C68D50F6A46 telexed123
514,320,719 *348E290EA8A8E29938393E6B327E713A950F0E58 telexistemas.emendoza
514,320,720 *348E14581E7A0830CAB9E08C0DA0A0622D9B7F1E teleytaioing
514,320,721 *34802534B028890DCEBB97D2D8D40A5D70F5A3CB Tel/fax
514,320,722 *348BD4CD39DA3C3A3BB101264B94AFD5A3B315AB telgipekips
514,320,723 *3487044067788E9D171132688066113E05A32988 TELHERAULT
514,320,724 *348330ABAC71A64E69F78157651B6F4B2FBE101E Te Liang
514,320,725 *34840D92D4DDC04AF8FD460AC6ECE4F16B236468 TELICIA-G
514,320,726 *348B2E6E55299D380B5F1EF2EF0D39752BC7C3DB Telie2
514,320,727 *348E7A48E203E49892567D4B4E67272A5DDF1E33 Telimeling
514,320,728 *3485EE7B3C8FBD0831EAB74B835BCD848E0F3BA8 Telisming
514,320,729 *3482478CE16D1B67BBACD76E71D6D8BA879ACDA7 tell-alls160
514,320,730 *3488AA2E15144A9F8189ABE18B01A3F0E340FE6E tellatsraa4
514,320,731 *348F6F6E339DDCA85FF9A0E5F50DA808D4D30A90 Teller»
514,320,732 *348EA25B318E512CFA4F587D8F367E8019E23BE0 !tellerrand
514,320,733 *348FE724621770C5A07083A72350AA6F3D37925D telliotusa
514,320,734 *3480AF6B149B1ECCFA94B58DCD4AC3205ED6E045 tellipsnemmaS
514,320,735 *348B3C097E578593B2A6B35A19113C610854B5DD Tell Me How do You Feel
514,320,736 *348E506F69B703A44186BA656546B5E361DA676B (Tell Me There's a Heaven)
514,320,737 *348F751C6C42A0D71A81F2660BFBD3A0B8372AC0 TELLONETHINGFROMANOTHER
514,320,738 *3486B52AECB0035ED9A380D57AAAA0E408FB33D3 Tell The Coach
514,320,739 *34823B76AB178F36F8C81A8D2787327CA574C7DD Telmissian
514,320,740 *348C19793B6DBDBA020F11A405F786E8DC2DA1A7 telniniarD
514,320,741 *3485127E907932821B2D1CE862A662678A8FBBB3 telocatorbsw6
514,320,742 *348EFBA0E6E83FFCCE51847C7EB7EAFC15556D50 Telonseses
514,320,743 *34825FE34C1DCACAF01CE279BE8A94B041328318 TELOS-CRITICAL-THEORY-JOURNAL-AND-ITS
514,320,744 *34882B9EB97EAFBB158B60263B9ECF91A112C41E telphered4
514,320,745 *348D926D76E1880F90955EF59F6632DA647CBE83 telracsytrohs
514,320,746 *348ED3B535E6FCE7D7A08C166EBBFF1357EE59DA TELSAMMASLET
514,320,747 *34863F59044DF4A074407A79BA3DC803F6F59C52 telujksd2
514,320,748 *348BDF7955CB2480D20B403081AFB7DD03627C83 teluoB
514,320,749 *3483EC1CE76F93318BC4EFAEB4AA02B67AB4FD7C teluriosing
514,320,750 *34868E0CC71AB2CB05F7E0EACA4D42A00FA6045A telvisiolhetyst8
514,320,751 *348919E16781333FC9631A7B444BFBD4A3828486 Telyphonus
514,320,752 *348E7A0A0D6029ECF6FEEA3855DA2E1B43D01B3E Temaleia
514,320,753 *34832E465CA7648267777E2385E1F1B207639EB7 temaphaest
514,320,754 *348F296A0F566BBD852A19BBB7040C47D0135FC9 TemaRio65
514,320,755 *348038014CA6D4739FB431CF338269B4FBE6E2F1 tematyke0
514,320,756 *348C036CEECC143606C3B1F63F74B47D302B07F9 Temblequeares
514,320,757 *348B0528267C8FBB52D16EB990CB8D2789CEBA44 temblequeteos7
514,320,758 *3484D96A65C497B02C2651CD4355E58AC14A84A6 Temboz
514,320,759 *34819B3ED2C3D95E8E69D3D5C769FAFBF929FA49 Temenzas
514,320,760 *3487B67B64B3064F4F49F80136DBD9747D04FAA7 Temerarie?
514,320,761 *3484E743D8F34218DE663CED2B7A755232F0C16F Temerehed
514,320,762 *348F29D4437C4A2E97C63E56C64FB21BB5AA7937 Temescal03102006
514,320,763 *34837E14B459EEE36EC86688A8D2FCA670D62C0A temethessem
514,320,764 *348D359275EC7D119B7AABD4687480DEDB771FA1 temias123
514,320,765 *348437C782A43391C38C8AA10440AF2D9E16C40C temiladeadetule
514,320,766 *34849C98B2D980372EB017590D0DC3A7141F4694 temislup7
514,320,767 *3482A5CFD3BB21674AAFC05CA1BB554F236046DD TEMIYA03
514,320,768 *34802A701F66C826E47826D17D0D6772C6D0F158 temmagA
514,320,769 *348064A746C64C799493A84874601924574D7665 temmureppup1
514,320,770 *348941FE52A7665D05DA20CE06163398F8C8FD83 temmurrofing
514,320,771 *348EFC8E97549EF937E906B2E8143C1BA8900373 temogelp7
514,320,772 *348F31DA6587B489B34C58F6CE8ACF8580C2AD62 temoham1
514,320,773 *3488FD1B38A50E187F823AADB83DF191BB773B9D tempchiefs9
514,320,774 *3487865AF8447E51B500CBDA91F1F5A279B4FF83 tempeitoit
514,320,775 *3487027CEFE52F9A637AA4F3ADED2C6139562AFB Tempelleeuw
514,320,776 *348E386DFB71F58061E5892B8C1979A1830EECED tempelstein
514,320,777 *34836B6528392EB628FCD52ACBABE6ED875BA05A temperaturaendringening
514,320,778 *348DC69EC2EF1838570029C68CA5F166DBF0FAD0 temperaturausgleiches
514,320,779 *348B4D511281E69B7C2581C931FDA25AC24560F6 temperaturecement5
514,320,780 *34824A607F66D8469900A37BF11324BCF58EBDC9 tempero gostoso
514,320,781 *3480B465AD80D2FCBCB1B66E175B24F053E3F93F tempertantrum3min.
514,320,782 *348E32E82C6EBAF359DDAF993115B5D05C090652 TEMPES
514,320,783 *3483470A519C26E427FDBC2D620151C0374ADD1C tempestc2
514,320,784 *3487223E9188397AB7D18DC6CA6858FD114038FE tempeſtuoſa
514,320,785 *348F2764D66D88E61B300AF759042156E7EE6939 tempgiantses
514,320,786 *3486A706C45CC76A619F0634CE1B508233E1BAB7 Tempisti
514,320,787 *3480520C520775E57C58F05ED795220C24125973 TEMPJEFF
514,320,788 *3488AF5F64ED58C20DA268571D679D9D8852804A templardom2
514,320,789 *3489E7C63D47511B0584F9EB6F8C3030C0A998F2 templariuszową
514,320,790 *348D7967C62B2B781EDC6FEC5E7E3E0BE66CA356 template09f9-notice
514,320,791 *3488902D4E4678B873D64994BEC88B414A7B3729 template12th
514,320,792 *3489FBD854191E39586F424CA76C95BF617E740B templatecategory_red
514,320,793 *3483356E6FFEA2984D34270755FE002583F3DE0C templatecfbhoftempla
514,320,794 *34827480B54EA9A05AD36176A3001EF3A1A88163 templateconvertc220s
514,320,795 *3486F879E7E71666D354DB0F1FF9FD7FF341B03A templatecopts
514,320,796 *348C925826F4331967CD3A077102628ADA95C55E templateesrb-t
514,320,797 *348C240FC1637C48D64BDCDEF7A99928FBCC9DEB TEMPLATEGEAUGA
514,320,798 *3483402000487FCB777385C198870FFC058AE9E4 templateme-refdb
514,320,799 *348A59A6041A6F6834749D4CEE0A168FFFBC36A5 templatemulticultura
514,320,800 *34819A2966916EA545AA0EFFEF9C23C6D8733534 templatenay
514,320,801 *34895D2B6E37573E0F527EF3BB1BC22163B1AAEE templatenorthernterr
514,320,802 *34837B21B901CEA89F52489951E2233D56080B01 templateomxi15
514,320,803 *348A7E3567A6FAF20A37CC98E28B505356F868EB templatereadpersonda
514,320,804 *348D2A162265709E665DC9CDA590A778EDB14A80 templatesap
514,320,805 *34826B04FC28572F3DFF510FD1ABE07C8DAB0052 templates.really
514,320,806 *3481A12F3EBC4112C9A268D03DF08BE543AFE794 template_talksectstu
514,320,807 *348EDD0827175930C79FC1A8350289CC57BE0C74 templatetemplatescie
514,320,808 *348BDA6CF5AACF48657D8C8F4106EA0FEFF4219D templatetooltip-unwa
514,320,809 *348D0E27D2F4444780D92BB95F5148A54C3B307A templateumiamiuser
514,320,810 *3486931144F3A66F7360DD9CE4DE834EFCC32DCC template.wizardman
514,320,811 *348342909EB5A20CCCD509ABD937DA307D61123B templelessesed
514,320,812 *3485C2F037F1DC878224B429F8F6920DF84B2765 Templeoge
514,320,813 *34867EABFC4717AF4B9B363A0F8E1D8DC3E214C4 Templises4
514,320,814 *348CCA232DB49C17D4F6ED47C5574D408B4275EB TEMPLLATE
514,320,815 *348C3A5D9FCDA552B1E84D5D09A245139830395E TEMPLOLLDM
514,320,816 *34816237312486E19DC2EBC2B52A9BE7C728873A tempmario7
514,320,817 *348DD7A71EDDE16AF65F54319B217CFA5B3C560C TEMPO33
514,320,818 *3481943659BA8A9B4CABF4E66D8F5BA34C03D8F9 tempo.comwww
514,320,819 *348C56F4255A5790089722027D118402BA0AEFF5 temporalbasketb1
514,320,820 *348B9DE66FE3ADE23D1EA1403EC5C02DED652F33 temporalclaire9
514,320,821 *348642CCB4EE10B8174C2C3056AE6323E4E1ED34 temporaldanced
514,320,822 *348A2D2829ACA70F73B9877200BFCA81D17EE4CA temporalnewcourt2
514,320,823 *348DC4ECBDE5999961C4D73460AD71589676FFA2 temporalpanther2
514,320,824 *34858D3B57BED6BCFAA78227EA891B701AB9A242 temporalplayboys
514,320,825 *34878358F6CDAA29282F4231EC3302B8ED7EF193 temporaryordinary6
514,320,826 *34876A0A58E45C0A414CF6565DE03795AE6A8F0C temporeggierebbero0
514,320,827 *348C31A08D3F7E4735278874C9AD284685BE9632 TEMPORISERASES
514,320,828 *3489B70A3F5AFA869A1C4D8E63591857B6C2F4E3 temposu
514,320,829 *34854797A42B8940387A14B3DCDC8701F4C11E0C temppauk6
514,320,830 *348165E6F9B61B985151B5C7AAE8DEC163BA0CE7 temppera0
514,320,831 *3481C00C4F66DE38BBC2A69DB626B79DCE72E49D tempranearens6
514,320,832 *34814C461D46FE5851122502899644E06B7A45D7 TEMPRASTE5
514,320,833 *34884AC607E0FC5B180B2773724BE39B931FD8A1 temprati6
514,320,834 *348D145665E58E8FC383B2EC789BA1C33D895E04 tempresseras
514,320,835 *348AAC7693E87F569601BF28CE3311C6E1B060AE Tempsbdc9
514,320,836 *348752B394AF4CC6F6DACC936CB4FC1B82C49790 Tempsonny
514,320,837 *348DDB1D090E3EA84F3964C62E57DFA1BD6A1139 TeMPtAtioN
514,320,838 *3489151540853E05434901D5CF29267E0755F39D temptationdemon
514,320,839 *3486C2D11160E17AD0018AC1B69BC2DDDFB2851E temptationmarty
514,320,840 *348E3BF892D60E71B08856CF2649E1B91371D0BD temptcho
514,320,841 *348366AE7A4A7503F2739A10E0B7DC5AB843EDAA temrenleri
514,320,842 *348C26C965EFAD4584E96BCEF5F88D57DF52DA27 Ten0p1ast
514,320,843 *348B124F04BCDABE2D006808AC6D10D04FF27E50 tenablenesses2
514,320,844 *348E441B70F770581ACAAB593C48B2D2B47E1B99 Tenacious21
514,320,845 *348AA5C02E4EC5866C9E44979DAC2F2F1D3F3EF9 tenagatn6
514,320,846 *348D6106FF13F30CE34ACD1747B766CB042B91FD Tenaksala
514,320,847 *34898067BD53854CEB5C36A480CD2EA66F76B1AA tenalparpus
514,320,848 *3489D0CA8DAAA6A8B79B577D4A0DA1F2BF2AB944 tenanto5
514,320,849 *348627765C551BA6C5D4410DAEEC7A70637B9F38 TENANTRIES3
514,320,850 *348D513FDBECDEC2644040DCF0C3F30041283FB0 tenantship7
514,320,851 *3482D40F44403CE19B98108EE614A37012706CEA tenbroek2
514,320,852 *348372EDE932259F53A0E46C5A52758676E13453 tencadras
514,320,853 *3487CD0615BAA2E2EBBDFFF8C0CB940404A8505B tencionarar4
514,320,854 *3481407B4E9E984316CF1882A7D30027DA4BC727 Tenczar0
514,320,855 *3481E583CE9276D0D56E5EFC15C9460A0ED16E92 tendaleros1
514,320,856 *348D7F3AF9C299ED84F29FDC97E80D77F38BA25E tendants?
514,320,857 *3484E7D75E0620B2EDEDDF0DC7F50659F683AC5E Tendaran
514,320,858 *34879FB07E0A81F98A1441432918224BE6AA2245 TENDENCY THEORY
514,320,859 *3488242AF00F3D61D400BCFEE8165312B6D721E5 tendentisque3
514,320,860 *34820540C393A4C240F905DD07D5C3514A27DDE8 tendenzstuecken7
514,320,861 *3486319AE3F2926B9D95829FC15598D752630194 tendereyed1
514,320,862 *348863CE02C78FFC0D7577D9BD3CD13981B34B1D tendrillies5
514,320,863 *348DE26930F41E3FBC4EA138F9A2EA4F2C30E991 TENDULKARSMS
514,320,864 *3487C6B0C18123414DA1388E80E8EDEAFDD4DFE4 teneantque3
514,320,865 *3480DF0FD673A3E4E5F475044B62C938FBED3A69 ténébrassent
514,320,866 *348E7A57B259B00B1A022966876DAADB3C9AA43F [email protected]
514,320,867 *348D8C7BFEDE52AEB710F8C8C7D611D1714E4927 tenegivo9
514,320,868 *34894A5468BA0BFAEDD3BAB8FEDD7E2981F50156 Tenelet8
514,320,869 *3486DE35FA71E2C7BD030757F39BC2B93C8279A7 tenementalis0
514,320,870 *3488CA5D357E06FB910173DA12EA3C0669A52302 tenenslovermainstaymaintainermatroning
514,320,871 *3484E4AA6E69FFB235BEBFDBF33DDB9E0AFDC765 tengę
514,320,872 *3480A12E1CD509C43CFFA0C8741E0F5CDE3D0E62 TENGIZAS
514,320,873 *3489D3E3DFE8BAF87867356D823693AAE998434F tenglio7
514,320,874 *34887118BCAF035374373B33BD104212DC0BD90A [email protected]
514,320,875 *3489FC45B567617FA6AC6D5C213884A8698F4439 tenğut
514,320,876 *34828137E7DAC84E6ACC8F9B8A47D5780DE576CC tenhcircne3
514,320,877 *348DCB02CEDD5272905A37A1E1DDA7C15E512D3E tenhoon3
514,320,878 *3483E83253F298FB539FBFF9911F028E5E63754E [email protected]
514,320,879 *3488264EE1BAA2B996C0C80AE2A54EA7185B49B7 Teniers1
514,320,880 *3482560811A0971BC12612E55BFB0881B4EE4FEA Teniet5
514,320,881 *348C097B5B1CE1ED1B86CEA4365FF744FBA0DF99 teniies
514,320,882 *348F6DF780F9A4DA8888DD10E48E0ACB0126A8FA Tenilom8
514,320,883 *3482128B57F3333B4B568F0A66945082161EE1A3 Tenisku0
514,320,884 *3489AFBDA62FECCF01B6C90DA15E8076BE5867AB tenisovýturnaj3
514,320,885 *34824213AEF7D34BC3662A30F0F2D7BEB26B5644 tenkcort0
514,320,886 *348B02BD19EF1EFBA918E97D8728E4A90B0D55CC Tenkert2
514,320,887 *34840B3CDE7D4A236C5E31EAB4E8DC2DBE032517 Tenkmotor
514,320,888 *3481521C04D7D92ACB2759CE215470FB9269AB6A tenlelling
514,320,889 *348296F4FCE0B9015B85937E70A498025EA862C5 Ten Minutes Ago
514,320,890 *34884C5BB6F53A7C9EAFA83D3C3D6418122EAF95 tenmocwcsemajttamkuansemajttam1
514,320,891 *34857B7C060668BC37E57FEE5DC7A88191F714FD Tenmooz7
514,320,892 *348455591CE3C683247A7248EFDB3B849EFEADF8 TenMoreTurnipsFromtheTip
514,320,893 *348B28EFE4D57B9FBA3D0EEDAE04CD9E46BBAD5F tenmotsuctcudaivretalfbasudrakcap0
514,320,894 *348A8881C9EE0BB6D0CF67697CD930BB6B0FEFFA tenmuren8
514,320,895 *348F096B8C7FA52CDDF61A68D2F538FA4D660843 Tennille?
514,320,896 *3487E19217F3970828533EBDDADF59B05B0A2E1A TENNIS1944
514,320,897 *34805085E8D0760B866FFDE4F63F324D97629862 TENNIS2008
514,320,898 *348D25FBA84DE51E83FF3D65092686FE046B1479 tennisal
514,320,899 *3481D4A1769469D30841EDA7141E3A114004CF88 TENNIS-CALENDER
514,320,900 *348A5CCAF8FBDC7B7F2DEC9332B081B154C3D32A Tenniskorrespondet
514,320,901 *348684F58834CC305F3FB6B57ECDFEA4D1BD364B TENNISMIKAEL
514,320,902 *34830ACE7D3841A62C04F0CB89B47A48BD85CDA8 Tennisq3
514,320,903 *348627F82FD8CCD80925D6BD3C3DCE2DFDC4DE26 tennisscooby1
514,320,904 *3488BFCF8CCFF48E80FD8B68A0383A715D487E05 tennissquirt1
514,320,905 *34817F0F0342F2030840FBA750A5AAC7BB7CB6FA tennisvanessa2
514,320,906 *34819A664EC9753483554F7A5D6C1EB4773066FB tenniswicked
514,320,907 *348CE3C737FBA97CC6E13BBAC7249125DA7C96D9 tennoseinotenshi
514,320,908 *3480A6BF9987C5F4BF6EB8BC126B2183D7F0667F tenotomised4
514,320,909 *34838926E012653CDB0658E571E38AC41C3621C2 tenpxetenztunzeedkysp
514,320,910 *348FBA34D594222A3CF54FF07F745A491FA729B9 tenragsmaerd
514,320,911 *348973CB8A1E8814934B1930D73F4C7ABF6C0BCF tenreldnahrof
514,320,912 *348621E288D3946AFCE34872EE48E8ACFD2222C8 tenrevnning
514,320,913 *34835AF03B74677C6AA3B863BE5FF9E3D8D92652 tenrohytteB
514,320,914 *348481E3B552BA09AC93C2F47911BB949E7157C4 tenrrykS
514,320,915 *348CA743E7007F43677D71811BC141189018DD75 TENRYUKYO
514,320,916 *348E90A7BB0BFB747F4C6B567EC22063E5A3E88C [email protected]
514,320,917 *348E5D45D3DA701123390545ACA2437047D06D84 tenshi (original extended)
514,320,918 *348B52317768F29D3CE28AE5FBD636AD59CE69FD tensoactivosbswing
514,320,919 *34876A7FAD6C548F06BDB26EA7D035BFDB9995B1 tenswert5
514,320,920 *3484F46C3579ECB760BD25F311DF940416D9D5E5 [email protected]
514,320,921 *348A5980422A3B48E509F3C4B8F6BFDB5374D058 Tentaculoid6
514,320,922 *3486BD606DAE1AA8D02D22DA3C3BAFCE82F69528 tentazione5
514,320,923 *34821298187DFF4A2DA665A77096712D9EC8116B tentcode
514,320,924 *3484B1B42CE1CE1305D74D9ECF5EEEA4FD2F5282 tentennone
514,320,925 *34862E3C48166C13A4E14DC0ABC60754B903EE86 tenteres9
514,320,926 *348778CA503299170BF78912D2916D7DC63F9577 tenterhooksoutout1
514,320,927 *3481C483AF4C25B88118EBFF2575F1C87B280391 TENTNITV
514,320,928 *348711F797E5EBDBB2DEA73F0807EC1ED0E1BF06 tentoonsteldening
514,320,929 *3487C07A1467E88E9B965F91A51E458318FD52B3 tentoubsW
514,320,930 *3482BA0D6337408AFD3CAB73D0FD225AE2A2259B tentrats3
514,320,931 *3485CE7EA74B3D741E2325B3454DDE1914D2731B tentsewdimeohssurehcamuhcsycart2
514,320,932 *348D0699EAC424029BEDD810B743EFFA041E6FF1 tentsex
514,320,933 *348D157409258EB8BE4F8526051DF28E8FBF5992 tentwent5
514,320,934 *348FC9654700BB6FED240988CA523DFCAA077D1D TENUESASMESSIEURS
514,320,935 *3487F5CA7654225A098CDF166932071C9BD12065 tenuico$t
514,320,936 *348E716A3F172AB75C2A796321880CC072EAB11A tenurablebsw6
514,320,937 *3489D5916974B9499D44A8209D39E0CB3E9A4DC4 tenure.admin
514,320,938 *348AEF8251F4C7DE30FBE9420F50803E775CF07E tenveaneidutsstetlukaf
514,320,939 *348926128BBE7394A3DEE6B615574CC10AD40A21 tenvuori5
514,320,940 *3488AE885F7718CBE775031F5B4DA9F0CDF76961 ten went up river
514,320,941 *3481209648C92E1FE500D853CBC076953221DE20 tenwhitestones
514,320,942 *348C7A02BBCE112D978DBE3E4DC3BA34EAB3B5C4 tenxmgrft3
514,320,943 *34892212ACCD194FF03F4AB476DBFA8BF7C88A0A teodoreo
514,320,944 *34826B479782E05774A414AA7580DAE9E51DB92D teodoro.beanblossom
514,320,945 *348C188328D640998878D5F6FBC15B1DA35ECD03 teodoro.cuestas
514,320,946 *3485FA5E2E7771C0AEC7EBC4A99847CF99C3996B teodoro.devotie
514,320,947 *34860516B37C3C301026B0B1EF10A3F2FDB40E74 teodoro.felber
514,320,948 *34855D42BC685E956B580DA21B044BE205243DFA teodoro.kersch
514,320,949 *3489FDBAFA24E02F422EA10008FDA4FB6799DE70 teodoro.lammy
514,320,950 *348391C55ECE07E425C3796BA84B88282CF2DBE1 teodoro.lascody
514,320,951 *3485EE1D2C0A9FFB60AF3CF04662AE0BB5B47030 teodoro.linch
514,320,952 *3483385E8BFE73179E0184EB639282763B8F0B99 teodoro.mccaa
514,320,953 *3486E0BEDF2C7DC99A07E3C66927CA36A594B65E teodoro.overpeck
514,320,954 *3483312E63128F95DFFA233DD82FDCAE3B56C65D teodoro.philipp
514,320,955 *348E473634A1CA74B9D56FC01CBFEA18C86968DD teodoro.rodrigue
514,320,956 *3487C0C50F38358310198D9DF209C440BE7D3932 teodoro.shover
514,320,957 *348BE3844018D7817A2C87A317627F572B3490D0 teodoro.yeeloy
514,320,958 *348F7F34B82783EF88731144AD8B5AD958965DEC TEODRED
514,320,959 *348B7D1EC051ECC1C8BB8EAA2A608920E3573AD5 Teofilio8
514,320,960 *34812ABF60934837CD2D3C9DED76C053585C9743 Teofista5
514,320,961 *34888732156AFDFAB57AC31808E89A268F1BEEF0 teojrboss1
514,320,962 *3487E9966E97AB90B9EC47E419752A1C52E8065F Teokrito6
514,320,963 *348E21C06717F30359B5C6B182B889AE48B55B3B teollisuusmaihin4
514,320,964 *3487CA17C1FDDF7BA19B4A61CE1021BD0C474080 Teomorfa4
514,320,965 *34851E283F08B2821B7E1434AC2DD5A083EDB298 teopnon0
514,320,966 *3489963A603B7F3D879DAEE441A4FAA45893EC3A teoponpogan
514,320,967 *348A3367C006D2DED49CC4B9B0BD56A85A630A49 teoriapolitica
514,320,968 *348E75A3ECEF23B1DE50E7A8E4441B61DA49FCBE teossaaning
514,320,969 *348BAEA92FF9ACFD83A4EFC7C55DB48E7051EF2E teo yvonne
514,320,970 *348DBDF11A5D219147DC357760BFB93647251903 teozegna4
514,320,971 *3489482164BA322B6DBFA5058EC00A9579464BD7 teozgnin6
514,320,972 *34854D4ABF949556AA2CDF05C5A2B925CAECCA5F tepalcinguense
514,320,973 *3486C1BE6493C6291671CBFA86ABE04EA1611C26 tepelenioy5
514,320,974 *348E77B5206A061A6EA0FBDADC1D41ADEA2EDCD3 Tepihima5
514,320,975 *348151F0650CD013BACD9C23BE5B06D20C4B8E8A tepmurtregniS
514,320,976 *348FA137DB723DB95632EEC439188588AC343032 teppeprodusent
514,320,977 *348F44F66CA0DA6A58F89AA27E940DD945F6C486 Tepr empereur
514,320,978 *3486A731F2BDA4FC66CC9BDB8C8F49BF6190C70F teptep ignacio
514,320,979 *3482677E2D5D030EBF0BD3EF9EBEBCB23FBA0B04 TEQHNBCL26
514,320,980 *3485BE65EBAC3714B7FF5C827AD6744A8AAE659F TEQUAN1
514,320,981 *348752445D0899F4CB3BF163D0751AE81E7F7568 tequilablue3
514,320,982 *3481EF20C270EF96BCE8900C2B719AF8DD600922 Tequila / Break on Through (To the Other Side)
514,320,983 *348A9442B43F5FCDAA99897A2812134DBC7629CE tequilacamping1
514,320,984 *348C8CCB3619BC84B4CFA947C2434A2C4E223169 tequilafelix7
514,320,985 *34883A7DB3978EDEC60D4C3BF62CF30A11CF7F6E tequilagold8
514,320,986 *34845EF3EEAEE50BCF9CE86DD7CE28C8F0683407 tequilajessie7
514,320,987 *348E632D561E42F3C1E37755129BE9F95D18D2DD TEQUILAMUSTANG
514,320,988 *34840A7149FA1E63C7704B5DEFBB70F0019A1493 tequilareefers
514,320,989 *348825A23264A64E6E6783D0DD7033CEF1E9578A tequilavalerie2
514,320,990 *3489A562E414B31586B09AF542608E953AB119AB $ter4di4n
514,320,991 *348FF2E022DEE9C403EAE55F2693A233BCD8FF01 teraadeb
514,320,992 *348221DE4876F0F08471B93C95BB30D33DD318D1 teradiation6
514,320,993 *348DA37544F176A791B045445ADC2AE20CCDCBF1 teraevaenaekoeisyyded
514,320,994 *3487BA1ABB32082D2308102C07A56F80F9ADF351 teralcbswed
514,320,995 *3480FB1D652A0F99BA22F2C0108CEFA58357F0AB Teramop3
514,320,996 *348AD16233594FF179F31A6ECB3CB119AE5DCF28 terapinėms
514,320,997 *3480BB13C1CFBF76AC51EBE86B2FBF65A9EA4D78 TERAS2
514,320,998 *3488BA911DE1647D4521FDF0625BD9DBE4BED95D Terashim0
514,320,999 *348DEAB7AD0E5B0B39F1FE984624D343845569A6 terasine9
514,321,000 *348CEA78FA3827010784B20D6D115381B301E1C2 terataki8
514,321,001 *34831430C8A176EEB3CECEB1C4ED8F1E8255BFCB TERATOGURO
514,321,002 *348CCEEDBA3FF6F3DD613A6D31A90CC29472CA78 teratomyzider
514,321,003 *348A938EBB28B780890D7B13B3BBBF704E62E5E8 terbasar
514,321,004 *3484D878CAAD726689660B74283EE2646DBD6D3B tercehui
514,321,005 *348B9E9BCC404BD3371B8D457B409AA578AD87B0 terchies1
514,321,006 *3486701C24C9C4E7D134EE88716F500A6BF795DC terdadapat
514,321,007 *348BE92A7545E0150F50AC01B1851C0D9B21E26B TEREBILI
514,321,008 *348C4688247858B67096E6FDE77A2D96A354FC53 terebintho2
514,321,009 *3483FBF35D294B192F4BDB1FF1BDE2482CB7E707 TERECHTSTELLENS
514,321,010 *3486761DDA3BD5111A58CE93F523FF340BEB339B tereciing
514,321,011 *3488945AFFAA7AA0D68C3625CE79393A8144AC04 tereddri
514,321,012 *348A703B90651D1E54205D1061C74D5A63A05F97 tereesta0
514,321,013 *3486B8512E8CA5C94526581358E04F12DFF844A9 terelina9
514,321,014 *3487160CCB1C882FD5DFCACEECEA1074B85CFA26 terence.ahrenstorff
514,321,015 *348E7DF5BEA8FFC0201820AAEFF1AA30E85D724F terence.depree
514,321,016 *348B922C09607BEA3626FDA12A8091E3881C3A0F terence.derentis
514,321,017 *348D901747EBBE5D1385FD27C2597358C3BD9A23 terence.dudzic
514,321,018 *3487E96AC7F9E6EA3BE000A9DAAB8053FDCF989E terence.dziewanowski
514,321,019 *3483AE76ADB182066A56A851C27B5389AF438813 terence.lefebre
514,321,020 *3482DC3C94CD04706DFF92DB357B7E6171D8E07C terence.lingelbach
514,321,021 *348417EDFFB83462CE9D1FF0865C6B2052DAABDA terence.linsday
514,321,022 *348035325EC68817B39A4284057DD103F2CD6E43 terence.merideth
514,321,023 *3487EE84FD57ACC062C63D839291EB8D67135AD2 Terencened
514,321,024 *348D215F05366263B5409828E222DF3443131C68 terence.posch
514,321,025 *348612567B1E8AC6C53CABB148F15806FA81A8F2 terence.scierka
514,321,026 *3484A6686160A843F7E2478CD541A8C57010FC5C terence.sokoloski
514,321,027 *348EDD742480AA5B35A27C2F7017483FB76CB1EB terence.soose
514,321,028 *348139747918BBD268C8EFA8FA51719CF97B2AEA terence.swamy
514,321,029 *34806156035393D531C87A48386299478BC87172 terence.texiera
514,321,030 *34810D26603B4BB2C14CB6D6932CA55265AB3305 terence.vanniello
514,321,031 *348CD875F268EDF0FB77FDA29CBD9819C88862BB terence.warsme
514,321,032 *348C35EFB73F2B28B125D148E1897E19791CD2FF terence.watling
514,321,033 *348DBF7226967EFFD647D2ECAD1872F858EE126C terence.whitted
514,321,034 *3483DBAAF38E677C926CC2C12C447AA88EBB6AE8 terencia3
514,321,035 *348C5F67B9528B8D155BF1DFDAF0B5C31B746397 Terenzhandschriften
514,321,036 *348F7040B7D35A73DD339A6DDF1B068D1B5768D6 tereqî
514,321,037 *348C830217F17D668BD735E80D8394BFEB9F2C4C terertlis
514,321,038 *34828857DE2D3ED5261A4C64AFD19D21EF33FB24 terertsn2
514,321,039 *348E9FAD359E9802776C37872F9CF0D4A77BA9E3 teresa1937
514,321,040 *348C596086E5A35FAB123AD26D9E9DC1FAB63568 teresablonde0
514,321,041 *348107A63EE97A2378D35096D2C80C78DBDC542E teresadancer9
514,321,042 *3485ACAFB97E33C508EDABD6CF99F635FD55CF89 teresa herr
514,321,043 *348A7798F6165A20CA42B16192F8F7DEF6DD8F64 teresa hibdon
514,321,044 *348FB2B7F4330C06815ADFB905A8FD40B70C7B94 teresa morrison
514,321,045 *34884A8D42D82FD38A0D45D7D922B15E2B66F1B5 [email protected]
514,321,046 *34819C47556B870695C6EA54EE995F9CCF11CE3F terese hansen
514,321,047 *34873893622F464E5590F4BD1585B214B5E7BE71 tereticauda
514,321,048 *348E5DDCDAEDF3D7D11161B72F92686A1E439886 tereticaudate2
514,321,049 *348165BB2DE6B0C0FD30E9C37DDFF4914E55B3CA teretit2
514,321,050 *3485AD2739C6596657CC580422C6B08A0D186DEB terettol3
514,321,051 *348239D9DB21DB9A9D3CD90104120DAE27FD7758 Terézhalmon
514,321,052 *3482F11D1D1FE1FF28A1D8D0BC2AACCBCC9B9CF2 terezině
514,321,053 *348BA657AB2353449D1F2C03C51ABAA61F12DAFA térfeléről
514,321,054 *3484E905860BE8FA7A489F7DC44F726118A9D995 tergaling
514,321,055 *34807BAEADB7D152112379490A330FC4893664AE Tergaque8
514,321,056 *34809897EFDA50541E67A12548B6AEBDFD8BA934 tergath
514,321,057 *348D0837B9077F50E023D31DA53A675E60E4DADB TERGEN?
514,321,058 *348AF36B0F45F8986C44F485F4B27D5D3D00D9B9 tergernu6
514,321,059 *348A4288AF3C07112E7080D245DB36B7F96CE60D Tergers1
514,321,060 *3481F698E4B80B510D37F39EFCE5745887635DE2 Tergerses
514,321,061 *3485827FC14C3758CB344D840CDBF2D901EF2D10 tergiversasses
514,321,062 *348AA6B51482E991D34366C1776A55D6D2AA2D46 tergiversos9
514,321,063 *348AA9B3F71FA7BCB89072310D2CC4DFF23BA0F2 Tergolong
514,321,064 *348E0DCF4CBE636CFF253B16AE777369D07D69C6 Tërheqjet
514,321,065 *3488888A647471477DD6E636CEEF985952042195 terhoofd8
514,321,066 *34854ED6F614BD394AEB6B5BC5F57491E48833A0 teriamnas1
514,321,067 *3486B4F149CA1D8C1339503D97895A0871FC1370 teriniaed
514,321,068 *348A89E8E54079D1DBEF16BA16A8CC3EFE03A8F6 terje23
514,321,069 *3482D37251351E7624B525826CDE957FB3559908 terkalleligted
514,321,070 *34850EBDC78F131CDE559A6656989B99A3FBD02F terkaraf2
514,321,071 *3483890EAB8F897A85779BB2D4A7EC6835DF3D4A terkastaring
514,321,072 *348EF4FDBA706E7783204288C232651EF1C905F8 terlebsw4
514,321,073 *3486B1CEA1C4E3F7532B4C0CC888C0A744894B59 Terlices6
514,321,074 *348E0878AA7901F21053B12AABEBF335813E4BBB TERMINALIZEDS5
514,321,075 *348CB6D394578E6DCF554439CFE2304DAE5A443E termingeschäftes
514,321,076 *3485327F4BF4C9E1A9525179C2F04BE1776ACB85 terminologerne4
514,321,077 *34855F008131A1B7D89B7083DC5FBE66616101D5 terminologist8
514,321,078 *348C3C6586E399C9ACFB727F3DFCA3127ECC9B78 Terminology»
514,321,079 *348B17FD745105746B2665FC14059C339D29F04C termionebuis9
514,321,080 *3485C9B72B4CEBD6D819B974A7568F874F77FE24 Termitai5
514,321,081 *348FF2FABFBB751149A798976629633205BA6776 [email protected]
514,321,082 *3480C1C95FC3414753BF1DE2BDFC6B19A428D384 termobeholdernes7
514,321,083 *348017C9493C34289EC939CB9F8DC62EFAC6918B Termola
514,321,084 *3480DE3395098E1B18DD33D3F4227940033F529B termoskoop1
514,321,085 *34801D81918A8DDB1C4A7A6C122C08FAA279146D terms.photographerle
514,321,086 *348FC2B9C3EE2917E5E6D023BB6F91BA3F944677 ternados
514,321,087 *348EDF3F9A26D7D1262AC3423BA04487F12EBBE0 ternel retour (for erland josephson)
514,321,088 *3484D84B6DBA1FC27CB07BDECD7BACCFA337BFAC ternensed
514,321,089 *348157AC25C77188DC2ECB77068DBA41B91A2565 ternuera7
514,321,090 *3482CD8A6C3E411A832C39AFC2D1497ADC82DDF4 terobmub7
514,321,091 *348E17C5EF803E70001762ACED6E11F167CA3AA7 terokhada
514,321,092 *3482F2087453C6D8B57FB0C34B9F077D8324D4A9 teroriginti
514,321,093 *34830FB7EB64A03D68C1F748AB0BEE539DA8058B terorulo
514,321,094 *348F277AEED059D4C7F53C3147A7F69DAC2DC3E2 terotering
514,321,095 *348626E4D5B46307802C979C778FB5D855DDF7A7 terpaardE
514,321,096 *348C3CE290948811982B18AD7C544DE069C51D66 terp-building
514,321,097 *348B3478E09A5BF7630579BC56C3B5EBA9F8600B terpenóide
514,321,098 *34813D668A410DB258A794283219471D32CA810B terpilenol
514,321,099 *348EA43D65AFD4AB8F10E36961859356D5D6C81B TERPSFOOT
514,321,100 *34809219514B4568C4DF5049F54ED6E99187B719 Terra $al
514,321,101 *3488639B9911372B04A029E0E0B7CA6CF88567DF terra campbell
514,321,102 *348C75FED90506055A670D4ADEE53A2EEEF4BADB Terrace’
514,321,103 *3487A69D8FE65E3969726B044DD7C79B72DD100A terracebbed
514,321,104 *34836405CCB0940ECD538889F80F08EF4C711FF6 Terracottaschmuck
514,321,105 *3481AC4FE9DF5FAA685CA5BC889991DB64816608 Terrades258
514,321,106 *3482388D8DFC960CF888945886034E4E20B7A3CE terramondo(surlesailesdutemps)
514,321,107 *34800BC3CF772D6494A01467A4D3B247A4CF0CDB [email protected]
514,321,108 *348CF50BEDC3EC98C6BC35C5788601F35C5DFD3B terrance.abelardo
514,321,109 *3485C60BB8BE1C0E81C48778E5111F6255FE69C5 terrance.baraw
514,321,110 *348A61A90CC488A5D67B8ABCA64A95764709564E terrance.bickett
514,321,111 *3481C33D9FDDDA527B758F97BE98348B26C5114F terrance.budzynski
514,321,112 *348E3A5ACB2D12EE7251F19B43B8B4583D032482 terrance.buel
514,321,113 *34806D6F6FE44FBADB15BE7C9008C80976EFB641 terrance.calder
514,321,114 *348BDEFAFD7B133A364945869F37102FCA9F18CA terrance.colomb
514,321,115 *34819653C835072FCBDCAD3BB331A9F4BFE78D07 terrance.corsoro
514,321,116 *34877479AA2F2F043DFCA4698B14E34E1BB01796 terrance.crome
514,321,117 *348DD3DE44461343553D0A4E62D10A74C489736A terrance.fennema
514,321,118 *348314F4EB0A7BA83D288CDF74C1B1E595E63C60 terrance.kertesz
514,321,119 *348107665BDC7E789F68527D1C54D95B86B0EA81 terrance.linnell
514,321,120 *3487323D971CFDE74301AE3F1A3E88B5FC87EA22 terrance.longway
514,321,121 *348E32F9DF72909D77B1189858EEE85DF5C6D042 terrance.millien
514,321,122 *3486AABD0FE08E319D9FEE17A9BCD060CBEE81FB terrance.pinkos
514,321,123 *348F873572FD17DD60DC04DCFB0EC1D8E4290F6F terrance.pinuelas
514,321,124 *348C82446983FC69C9B059879B2B0A2E52F1CE66 terrance.reio
514,321,125 *348B9C8FD34DD0E2060A53428344C99D22AA29D5 terrance.ringgenberg
514,321,126 *348CAB9D61FB8F59A088980B06B406D7FEC4FDF3 terrance.ruegsegger
514,321,127 *34807FC0C3BD4F4A5AFE6D3E60CA27ECB110C3A6 terrance.sedenko
514,321,128 *34837670F07AA4D2DEC0C2C5BA9345C4CE55CCD6 terrance.seppala
514,321,129 *3481A49E62013AA02E0491A3121607DC0CF408AD terrance.sobota
514,321,130 *348E136F32800A7781DD286D167BEEE7A679F0E1 terrance.wiltsie
514,321,131 *348422B0161E0072EE9517492F1BCDE65A150931 terranoe0
514,321,132 *348DD1FC6C8101495B571D7B4629758D0C6B89C9 terrapin83160talk160
514,321,133 *3487A9FCAE49EA78E25FD05C9FFEEF69F6794F44 terraqueas9
514,321,134 *348C4C55EBE47E84E0A475A74D8EA956CDCA6AFB TERRARIA8
514,321,135 *348BC564205632E94B81147F174B40FCE7AA7536 terrarientemperaturen
514,321,136 *34854A216140BE45E6B93A66BB2075877CCBCEFE terrecro
514,321,137 *348F2DF17023B4AB47686AA8C471D283DEEDBF9D terreden9
514,321,138 *3480BD7F9908A9C8A41566B05E11BCB7EF70496F terrell.burlando
514,321,139 *34865ED16ECBA75D0CA09C4A8F289BC4A17DD0AD terrell.chalmers
514,321,140 *3480F3471DD19B8F5E6B183715E85539B7C3EF44 terrell.crewe
514,321,141 *3487E1BA172E182B2169A284653F22BA533BC5C6 terrell.crosiar
514,321,142 *34802F19512D361AD9C006000EDDFBCC4BE5CF36 terrell.godoy
514,321,143 *3489A25C49D7A1B390F28DF5CAE7FFAA39D5BCCE terrell.houser
514,321,144 *348854DC3EEEFD66E0C6DB6F1A79DD95379D07AC terrell.janitz
514,321,145 *348C8D75BA29BC67BDD456D033442659F8760A12 terrell.liz
514,321,146 *3482ED58CA606C570F7CB6A3A52EDDD688CD97A7 terrell.mor
514,321,147 *3485B175510B0D7807A5B7058B75271D0BB3A31B terrell.nhek
514,321,148 *348832B9E29AEFE64AA8F76698187D605BE996FB terrell.nirschl
514,321,149 *348A2B9B950458054BBDD242D7F37D3CFCE54CEC terrell.pantoja
514,321,150 *34893A3A7E1EC07E286119AD74894A95107DF4EB terrell.poitevin
514,321,151 *348EBEC3BB496018A9E3F9A0C7719EF4C98B02A8 terrell.punch
514,321,152 *3483476E9169C1B176B79BA48FD46064973908CE terrell.sakakeeny
514,321,153 *348A6CF50FF35D1A686CD111613ECA64FC27A78C terrell.singleton
514,321,154 *348BF7A5F9E8D471188673D0D066CD5ED0432BB4 terrell.sok
514,321,155 *3489ACB0CEBC319B3900AFA87034604C790F089C terrell.ticknor
514,321,156 *348338018A8374E12A5CDC01DB2848AA8651E0ED terrell.traywick
514,321,157 *3485E38C060AC25D2F4D3208E6504087E323CABC terrence.althaus
514,321,158 *348F503171E0CC128A48BBCBB156279B5E459AC7 terrence.clason
514,321,159 *348628EF62511E06309AC6CE4E3EFF0EC1546F2D terrence.crofford
514,321,160 *348113DA9AA2E974824761349B754028A3D51F8C terrence.govindeisami
514,321,161 *348D367D59E8E2E80AEC25C37278B53ADE09A7BC terrence.grinnan
514,321,162 *348E96B9561C80E014FD99229B9EA6797F643E00 terrence.heinitz
514,321,163 *3485C61F2DEA2DF327D2D86654EB97565581383A terrence.hodnefield
514,321,164 *34807356B155106FF6098E5B5A71B9ED886C5228 terrence.holec
514,321,165 *348EE50B313D1FC01C9B46866EE9C1BA748BE5F5 terrence.kelso
514,321,166 *34841FFB683C4D7AC683D460C32CC8352F1D2031 terrence.mosha
514,321,167 *34846F3D147BFD61D4E32571775F65D317619C2A terrence.panza
514,321,168 *348F475570F3AB038F0F651FAB7091B7669A9B93 terrence.reams
514,321,169 *348EB0B95112B89A1712697DB89BC382E6E0C75C terrence.solares
514,321,170 *348020F8C4D1DBC8E053194CC2E00FC5D4B68AD0 terrence.treece
514,321,171 *348B59554759F7CF56C7D50E983B64A3ECE551D2 terrence.weakly
514,321,172 *348F939EC5DB0CB6473DBA1F583BDAFA3E14D835 terrence.zeschke
514,321,173 *348E4FBDB7DB6100A39F13C52075501AA940C079 TERRERAI4
514,321,174 *348D59003DDE393CDCE741CD40654DE555629DB7 terrestr4ever
514,321,175 *3489DAC661C1F5AD767589892ABBBE3E605B8307 terrestro1
514,321,176 *34885F43C5C4FFE34F0BB2FF962F92C9745EA3CD [email protected]
514,321,177 *348AD8CB263E94387963444384FB49B59946FA9F terribile»
514,321,178 *34810DD5D7DD58E0207912ED41349C6179D82F51 terribling2
514,321,179 *34841CB447B91A6AD258440A91CBA7EE646D8269 [email protected]
514,321,180 *348BF1B8B0FD02869FC09E6EBA42F32430508E8A terrierlist
514,321,181 *34875606BC01FB81A0113C9DAABFF2F70D84EB0F TERRIGINOUS8
514,321,182 *348D51B19EF3CB7BC9EFBF9E97D7E4BF12847306 terri ison
514,321,183 *34820F7B186CB04336CE9A397E59D31452602BFC terri jones
514,321,184 *34803A0E5395A8F8654D25702B95B4D26D70D1CC [email protected]
514,321,185 *348399FDB4C6ECE27D67C6F49C5AF50CAE3ACE60 terrisayers
514,321,186 *3487316201FDE57A5441C24D763B6E6521C2420A [email protected]
514,321,187 *348E82D24DC4C20890C78966D0D3A0E33F3BC7B3 territciy
514,321,188 *348342E56848F8B1F13C4651162C70C6F341B837 territorialfed
514,321,189 *34868CFF3C82524FE573BB1FDC1993EC2B345236 territóriumon
514,321,190 *3486DFC4B305B0315AAAAB1084CAD84B0769302A territorydependencie
514,321,191 *348CA643F6C2BD86346561431E7F5641B56DA255 territoryfly
514,321,192 *348D01663C90E1305BFD644D4716A55EFF4388AD territory‘s
514,321,193 *348790CE0C5F3A27C777151E59C1C298274E66CF territorywastewastelandwideopen3
514,321,194 *3486532BC10F300765F7F0EEEF1A5DC0B1F45594 terriwalters
514,321,195 *34806D64E1E7B790F5DE4C555380A8C32A3097E6 terrorbewegung
514,321,196 *348EDC045946131A92A927CFCA257E3B38ED84A6 TerrorBot
514,321,197 *348A6DA9336222447488FDD1DE8EDD60351C8BB1 TERRORISM-FIGHTING
514,321,198 *348B5892A53896B998FBB66CDA17F63A0100472D terrorizzasseros
514,321,199 *34815F34CDF3642C4D92379244A282C8C880B19C TERRORIZZO7
514,321,200 *348BFEB1936307DC11360DBF9668BEBC73D7FCA8 Terrors.
514,321,201 *34859C7143F54D781DAC5A9C5FBB0C4E2590EF8E Terrorterror
514,321,202 *348609A2538ABC4685FCEC59DF6CFEABDA525D85 terrorthreat5
514,321,203 *34847A8001102A428EDE3EBC1089AAE44FAE993D terrospo
514,321,204 *3481BA429BDAD71FF0F9D087970D2547495A5FD7 [email protected]
514,321,205 *34892E3405104B2B95D9A031DBBA786DED1B652F TerrtytownLATarpedShops
514,321,206 *348D2BBDD579C57FAB25AF809B5CB2F848AAA243 Terry (#2)
514,321,207 *348DCBECE42CEC295B4513A6D1722FE6A57A1FE8 Terry92072
514,321,208 *348DA5BD84DC46338110B7B3E05BD2EA310B02B6 terry.acklin
514,321,209 *348C7D6DCF1DB200A73F18D4894B79CB4FCF28A4 terry amores
514,321,210 *34803E1E0F256BD936FDC9EAEBED0D728ED246F6 terrybeagle2
514,321,211 *34812759FA6470A9C12A3D363EDBE2492A5A5AE9 terrybrooke6
514,321,212 *348B20AAA6F013C06650523844960B64C1209609 terrychristin9
514,321,213 *348C8317614BE85F2FCBC4F4309620FD30DE9A12 terry.ciallella
514,321,214 *348169C92DC87963F80479FCAFD8257BBF9E1A6F terry.diabo
514,321,215 *34807C60D4BEBCA6A3C436472CBA8C9931BCE5F7 terry dockins
514,321,216 *348C7D69BCCC5BE75363FEC86081DED1F05FC76D terrydragon5
514,321,217 *3480B909B4D4F5CD16916B119774AF1322DCD389 terry etlinger
514,321,218 *348914612B61BDDF863753E14B1B8A1F2D6FF52F terry.failor
514,321,219 *348180D3E6C14C7717C002FF18686F023C0AAA94 terry.fralin
514,321,220 *348857C67D7EF11FD9671BE2C2C8063C342F47E2 terryg0e
514,321,221 *348259F129E8775EC562E510FAD9C1AE26CDE905 terry.hegge
514,321,222 *348E210ED077AD57C88EB5861986D39628800213 terry.herrig
514,321,223 *3487B16F046439C5D7E32B4224ECF15383EC1E45 terry.jeleniewski
514,321,224 *348968761DA22A9DC7E9183CCB8BBF572ED88452 terry.kamat
514,321,225 *3486DD6DA4C467DD06284EAC0FC5AD0F960EEF42 terry.klawuhn
514,321,226 *3488B0759970A4AB829F5B69684BF5AFEDFF285A TERRY-MATHEWS
514,321,227 *3486E154BE29D55AFA852F1FD268B7DB89DBD39F terry.mccurley
514,321,228 *348B158D6C951A9416EAD3D22A632A1503196E4A terrymittens9
514,321,229 *3488E6198BFB515E88F122DBD3F3FF467D492CB1 terry.mondella
514,321,230 *348D3482FCB9550CE459A97D21A2D292B18883A0 terrypentium4
514,321,231 *348C0D49FDF180A90790780C5CB284AE3C47EA00 terry.pires
514,321,232 *348F6C5BB883FC4B73C4DACBEA8843255F17BE10 terry.prast
514,321,233 *348D9E89D2D2D79B04315D5D690DA034382F92C5 terryprof3
514,321,234 *348DF4460EB40EE2DA55EA35ADE7CD03D4F67C50 terry.puebla
514,321,235 *348AB871EA10684978A2210E7B8D074D808820DE Terryripper
514,321,236 *34892890DC78B2772058C34D2B984B1701EC4633 terry.saenz
514,321,237 *34810275AC4403B97144D6592829BF79F32162BF terry scheidler
514,321,238 *34835F92BCC019FFD46A5C36E50F761AB79EC389 terry seigler
514,321,239 *34873262A4951B49640BC00BE6FBD39C53255767 terry.shidel
514,321,240 *348E867A99B01C4849EA97B2C7CFB5AD9B8975B1 terrystanfield
514,321,241 *34897D2FF6EDD9CCC7CE34223CB97D5B99D7EE0F TerryTsao
514,321,242 *348F07A0A219B188857B60ABE5657EAA0C283D88 terry.weston
514,321,243 *348D1105103F89419B92DA19E003E6FF07F20F67 terrywish
514,321,244 *348A79B2D612882AF1DDABEA9566A77EA3A2ECED terry.zbinden
514,321,245 *348A346720BFF277A2B4170D54242BF26AF8A298 tersbetonining
514,321,246 *3482693590CAB5515327A9C378F46E2B4C0CC749 TERSKINHEVONEN
514,321,247 *3484C179ACA147337D846FDE6FEBE3080E586F19 Ter
514,321,248 *348BDEEB05DF86B34C2E7E5450C7365A24020054 Tertbsw5
514,321,249 *348C6B46A38A3AD9AA04D05041BF5E21B3465D06 Tertiärartillerie
514,321,250 *3483B813E9C217EEC2B114714849D07D2A77414C tertium-quid-l
514,321,251 *348759C5FFB0AD0E9B5322CB5F25D99867F44AC5 tertlhems
514,321,252 *348605857D2D9E0A9314BD27510D679AD3E0B4A7 terugbezorgde4
514,321,253 *3489C24D148F346691F5B33816190406EF64E378 teruggerooid
514,321,254 *3484EF1A57F5841F73634BD5A9B48C18C516D7A8 TERUGGEWERKT2
514,321,255 *3481B01113B018E7F9E220BE2546AF2F78C47B91 Terugkaats7
514,321,256 *34843D658C1A137BF076B64187DB2DB7C58563E3 terugmarche9
514,321,257 *34878591A5C6E1D3B0F4D90D412DFE3EAA842436 terugsprings0
514,321,258 *3485170696A7FACBBF5DF1EFDBA59D0A4DD9AFE2 terugterug6
514,321,259 *348F195AC6BC7EEB0A063C151843C03F6683A43F Terugtrad3
514,321,260 *348EDDD428F4C37723B91E80A93054D99F47D3B5 TERUGVOEREN.
514,321,261 *348A85070C6290A520B83814A635EC6C7997D3EC Terugwijken?
514,321,262 *3484C66C6D9F19CB706AD289FB54A0E49ACFBC69 TERULETUKRE
514,321,263 *3484095E46E521C300D6A398AF5A754EF5D9B396 területváltása
514,321,264 *348B690C9509C20F31C808ADBC634E1BEFEF7C7A tervamäen
514,321,265 *348ECA48F2B7DA5B5D62BE60CC0628111DAF80D5 terveise6
514,321,266 *34841D030564C5B15D40F34B27D292B5712F641C Tervetuloa katsomaan k
514,321,267 *348E0A6B95928599CF5F3E90DD53BB122BEB422B terveyskeskus8
514,321,268 *348BEB40485F0FB7D13026F98866A31F4CC75283 tervimmied
514,321,269 *3481E0C51EA126BCABF0B054914FB8AC5189002F tervishoiuportaali
514,321,270 *348E024B43534572E58E67591CB25D1B46D509C2 terwitch5
514,321,271 *3485AE41EEE8FD467C51D6FE2E59DFD859F7C4BD Terzija5
514,321,272 *34832497C87F0520AFD2518EF946F52E9D3CD9E3 TESAROVITCH5
514,321,273 *348CBECA8EBDB2FC40D09B35409A09D4FBC8C2D6 [email protected]
514,321,274 *348C8E9D1521A4FF4B7E94471B7EE817DC675D1C Tesebbused
514,321,275 *34859B4A8102C6022EE22C0EA7F34F961E9DBD00 tesebdlr8
514,321,276 *3485C975F5E0DF05FAD93BD1110F85892BBBAC01 Teserkr1
514,321,277 *348A0375390B1F46DE9FECBBFCE6163D05FD06FC Teskov1
514,321,278 *34807731E98168EC58A13DFDDA735704368C1050 teskuakr4
514,321,279 *348AB4FD4F15F18CC71870FCDAE801FA889F0345 tešlainis
514,321,280 *348A19F3001E7873F42A512C48FCDD5A2FFF0C73 tešlar
514,321,281 *348EEF159FEADC8ABB6765DAF7D086ABD34CA6B8 Tesliḍ
514,321,282 *348D412C63DAD32A5B19301A558260E87B969786 Tesracs8
514,321,283 *348C975BD6DF835617258851DEC70D62115C627C Tess455
514,321,284 *3485BE4E49F4BEC1E0160B3E40E414D7D3421914 tess720
514,321,285 *3482DF77DEBB0D6176FB40F9C2139EDC7671D9F1 tessa gallagher
514,321,286 *3488C584B401CB15ED13C674BB79DDB4AC3775F3 tessa lamberts
514,321,287 *348C4C2A7D94B2E01DC79FFC2297F9E5BEAB71DE tesseraalinen
514,321,288 *348F739A9FEA43971E65A734F1787596FE2E822A tesseract1234
514,321,289 *348576D0C4266C4AA9F47402A0B0FE9C57AA380F TESSERANTS7
514,321,290 *34817B26CF4EA5F430D9642DD08D5D414CCC2F52 TESSERINO0
514,321,291 *348DB0307AD10904208F7EC21A833CBAB8FDE40F tessihcs7
514,321,292 *348EE072AB56D165ED0C9C70BAC91B417CC48A93 [email protected]
514,321,293 *34877AECA21ECCB70B5ADAC1A8668A6CDC510B9C tessulp8
514,321,294 *348063D576221503AAB9AB24571E487FD260ABCA TESSUTA6
514,321,295 *3481B343F51137D01985EED58C5B6E03AE905AB5 TEST2MILLION
514,321,296 *348EB49FF22825E6FEA6D9C63ED3DDD5E0D92792 TEST2SCUBA1
514,321,297 *34822DAC399B33446D1DAC7A22415A65F6054B3D Test2tom
514,321,298 *3488D81EBD84BF2291F37C33665E65CF3FC4BBAA testaamisessa4
514,321,299 *348DD7B514BDD8D76D2420D230EBCA7A72570BF2 testabwürfen
514,321,300 *348C6CCAC73A558304FDCF02459A26B956011091 testamentases
514,321,301 *348746E024AECD4C6CF944CBC5553AF6F3F6409F Testaocroce
514,321,302 *34873C79798D2D4242F00BF91DDC05D078FBDAC2 testara8
514,321,303 *3488C0FB1CA490674CC63B635EF496F069528E7B TestataFacoltà
514,321,304 *348A1B5F9014020F4E84C9D814FBE47077AB6673 testateS
514,321,305 *348BC6F40831F29F369F4C3B1AFCC7B5D57BECBE [email protected]
514,321,306 *34802577396742AC5785D44FE2562BAD28D09F40 testclark6
514,321,307 *348515F2767F549F8B4A0B74D8D0579F78D72939 testconditions4
514,321,308 *348204CF63D68AE02622240AC59CD4274144E314 testcorrectactiv
514,321,309 *34849D1A06DB2244406D894A18DB9599D59B1541 testdon4
514,321,310 *348710D41B5996DC911260BF25AD64FAD9B5D0B8 testduke9
514,321,311 *348BB5872C48183F5613B5DAFD6FA213DD6D0719 TESTDUMMIE
514,321,312 *348EAF893FA38C111775002EE43361DAA0CB918D testedest
514,321,313 *34894F5F4FBB6068BF824DA005C45ABFEADE088B testerdylan7
514,321,314 *348642FBFBCDBAAD9B6AA52FB27403DBAB5FBCAD testerelephant6
514,321,315 *348AC1CA96F454DE8B2E843CC81EC1AB6A1544D1 testerenergy5
514,321,316 *348D437839302E3CC34A8C80DDA12DC61937B31D testergoober7
514,321,317 *348153B228F6EE0FBD42E3D2635A9F4E7636029D testergregs
514,321,318 *34815DF08F85238D4B7DFBC4297862E3F52CD21C testerhelp6
514,321,319 *34864E64D7EA9ECB63ACD65CB0C13F7F8ABEBCD2 [email protected]
514,321,320 *34891C13F31B448B4BEBFE812A73A1640D3DDC42 testfersje
514,321,321 *34897EE5B4BA0972A6DF15DE5AAC283E9753AA1E TestFour
514,321,322 *348552AEE4A33EFEB16A823DDDB213D2CACD6CB6 testgrandma4
514,321,323 *3482A67404672F1A64843154AEDE8F038ECA32E2 testhvt2
514,321,324 *3480AEFAE5EED2AD8A7F17F0420BE097E8FAE8F6 testimoniada2
514,321,325 *348CCDCDD55D7BC2F8A81A94C3CEE7DDB314C1C1 Testimonialisers1
514,321,326 *34802559E79F640D23DAACAC7C4DE8EBB6D6B12A TESTINGATHENA
514,321,327 *348E6D0A96EE836D7A4FCC95DB1007BD666EF8C1 testingcuddles0
514,321,328 *348BEA4B95C0D50CE48C739EF050874927B354EE TESTINGDOGGIE
514,321,329 *348CE22113161B984B7D2BAEE816F98C767E0144 testingedward5
514,321,330 *3487141E81394CB4F4F4E95FFD3F9ACA94A50F92 testinginternet5
514,321,331 *34881851F668E05AEFE4AD7ECFF70A045FA6F46E testingredrum8
514,321,332 *3489BE6C2E0AC601E24B52F08740F431AFC09D8C testingroses1
514,321,333 *348F90F7847EE86ED4A5B0BDACD807249B9205B2 testingswrit5
514,321,334 *348DCB0F56CD904E0C1EB0E87756A07FDCF6D91F testing the waters
514,321,335 *3488D49F34666D7AC4E94BD55C414D3C3D3253CF testingtrucks3
514,321,336 *348FEE83847E40D13EA5CFF3F8A3071F12FAF501 TestIt
514,321,337 *34827DFF19EFB38EBEE3D3016788B0B867154046 TEST-JUNIPER-SWITCH
514,321,338 *348CBAB311F9FDF38FC88560DFA7FE266C3B5E71 testliv
514,321,339 *34858705DB3AB39DE5FAA8CC3690943536175A1B testmebuddyabc123
514,321,340 *348D728BB16ADCF7F92CF8C9DD0D9A735EDF16B3 testmoronis
514,321,341 *348782EC4C2EDFCAA0397D8733F2DBACF3A09563 Teston2
514,321,342 *348A6340890E5B288A2F3CB643A5022ED94DB6A9 testosterone.co.ukwww
514,321,343 *3480A877B20E5F2F33FFA6CE3321CDBA87A57A4D testreyes
514,321,344 *34885A399EDB099CB34A9835732790D520B1D817 TestT38Description
514,321,345 *348D0EE59BA63DF57A5137CDB515DDF8115743D5 testtestnauticing
514,321,346 *34843729EACEF67028472EBA5767D7AF96B07DA0 testtestorioning
514,321,347 *34862B10F1C2E4001376EB7D2526F38595A9CAF2 testtestphil4
514,321,348 *348D2AC7A221C67E5B1DCB62BF78A825F988390A testületéhez
514,321,349 *348E52E94F47F9FFAC4C6DC7519F4678786D1CD6 testuro1
514,321,350 *34897A650578A311F94F1735C33F863EAC97F1B8 testvérsablonra
514,321,351 *348A15D9EADDA24CCE0734E6E8776E36CAFDB481 “testwiseness”
514,321,352 *348DAA36DBC0FAA46878D83841A0ED27854842F3 tetanizaria123
514,321,353 *348738B053E32F8F4A66AFA0D6515F0744AE6116 Tetanoso
514,321,354 *34863EA50336FC4FF275EDE296837F4D78B1256C Tétéghem
514,321,355 *3488FEDC75004F62A11EA91A0A53DF6097099758 tetelksing
514,321,356 *348466441BAF6B642B6C2B0F4C279C952E195C0A tetered9
514,321,357 *34850BAE048D2EBB78C3443870DCAD9B2E33A31F tetfirhc2
514,321,358 *3484E4606F025D1C99A9E9BB737595AC3EA717FB tetheam9
514,321,359 *34891B1BDFA6840A49CF0C6DEDBDC7B68D2C47FE Tetigos
514,321,360 *3485BADDE6FBA21A18CD8156C09E42C6B24AE2CE tetkejsorpofnitak
514,321,361 *348EF2A15CA8670AEEAF5D8077237545A22B144D tetledna2
514,321,362 *348A0C37C43AB65943D8E5AEC8B408E34E9FED19 tetnnane0
514,321,363 *3483A20653699DF7D9AEEEB7D2888A012589C65A tetobe
514,321,364 *3481CFC03D6B2C1E711F4513D3D3551051911CCD tetr48i8los
514,321,365 *348347EAF7CB7DB1AD2BF77AD6B04642463DCD39 TETRA304
514,321,366 *3488AD939024FB44E2C0782D7E1EA75A30A489A1 tetracenen6
514,321,367 *3481968A44A96FA584D21CD2CDEFBBBA28BB12C2 Tétrachlorobenzidine
514,321,368 *348C1427ADA6E1F13E05F44E192359AFA4A4FE00 TETRACHLOROETHANE7
514,321,369 *34872A39833AC245A53D6A595B79712D763BA40A tetrachromatic8
514,321,370 *3483F0514C4FCC35851ED16A8E8853043F266AC1 tetradontses
514,321,371 *348190D8F210D7FD421F131BFE75EB2878A684AF Tetradynamia!
514,321,372 *348D947DE235E213F608302ACE72702615B7A25E tetraedri9
514,321,373 *3488A42188C09EDB4752F33488673352E6ECBF4F tetragonses1
514,321,374 *348CE2689FEC8E1A9EE778E3B7EF238EBB51F841 Tetrahedra
514,321,375 *348C46EDE2749110E19D04478EC4D858272D0AE0 Tetrahedral0
514,321,376 *348FF06D04C7BC1B0892EC5495B22B24227A5600 tetrahydrateda4
514,321,377 *348604002A50222D01BF21E129E3286AE3EFCE99 Tetranuc3
514,321,378 *3484F99A014C0570BBAAF10D6BF2E16671D2B9E6 tetranucleotide7
514,321,379 *3487F45FE3FA9D322EB0F18D88E6D6E1CC3F0ED2 tetraoninaes9
514,321,380 *348E7A168065E5D63771F620632421375F7B29A7 TETRAPTERON6
514,321,381 *348DC37EADFE45F3A07A12E1459EA828D963832A Tetrasakkarit
514,321,382 *348AC634C17F2F19518F919216382025C833A039 tetravalenti1
514,321,383 *348A8511F14E388F98D4BB0CB869A47592C2CC39 tetrawrofwn1
514,321,384 *348CEFF67AA0A35278C975ED78CD786120114273 tetredricos
514,321,385 *3485848AFD4647D837108E232EEDCEA57A178783 Tetrekl5
514,321,386 *348E7517D3D735C9A39495D70D401C87C16C0B84 tetrhedral4
514,321,387 *348B48C3B7CD4BB3181CE99FE4534FA50848D60A Tetrol6
514,321,388 *348BDFD094F3D46276E0067CE40E35AAE82E5982 Tetszik8
514,321,389 *3485F9DF04FD03DE60F1A329FAA1C5E615AC1391 tette3
514,321,390 *348ED4AA1F6D709EB301C5FC16B5F63E560A2CF8 tettinsmonnejG
514,321,391 *348B860A4B78C0114F04487A5EF50FBCE10A9303 Tettished
514,321,392 *3482D46D6D119718403383013F699A13D1F42B5A tettrbenget
514,321,393 *348AD19D176AE8E3513111959351758B6B55CF5C tettstaden8
514,321,394 *348800025D62534E4BD789DC097DAF43F69B3514 tetukuzu3
514,321,395 *348943160ED22983B471FC84FDE06A854F48D38F tetuziakiyama&g
514,321,396 *3489361EB877FE727B81EB67C372E9237DFC550F tetyaev
514,321,397 *348B6024ACA323838CD10FBEFAA5E132FF2F656E Tetzieg7
514,321,398 *348BFAFD16396BF525E156182358327E7D03341A 『tetяis』
514,321,399 *3483C516CFE488406D8315CBDEBCBB06A57F6757 te#U
514,321,400 *348AA84C45D835E9DAED8DB2EA2CD6500ABD875D [email protected]
514,321,401 *348AD9DA8A30FD82020A915397B102DAEF268699 teudeila
514,321,402 *348C6734BBFF51C3A759F037EBD7B34249E49B08 TeufelsburgSaarPano
514,321,403 *348924D1E7575CB6F513C2419E16D7B5A9B8E966 teufles9
514,321,404 *34888F06A85BFE389721A9AB1CC75690584DC34C TEUGELLOOST0
514,321,405 *348F218C90A725F5CE590C26F06A48809133967C Teugnots
514,321,406 *34808656C6820D4EFE3A0C6C5CC14782C6F8FFAC teumiba
514,321,407 *348072FB4D92AF2812ED6AD21A89C54F685166AC teurapid1
514,321,408 *348E80DC60CAC9991C0C09BFE7BF72361966E80F Teutiburgium
514,321,409 *348486D4880036B769B3E3AC382FA28035A90DC2 teutonice
514,321,410 *3482597A15A15BE6E1F0FB76C7C820E700795129 teutonizmem
514,321,411 *348D4E0FE2492E8ACBA5C482862951219D38A08D Teva20F2009
514,321,412 *348B9952C954F851ABE32FCAD7A7FF00F35057A6 tevams
514,321,413 *34840AC7C46863B3DCA8CAE0F4AAD4469CC68C24 Tevegnied
514,321,414 *348D2E8D497BE3F1674EE8E74BD37620CECC7F1A tévelygésébe
514,321,415 *3482844479D84F9CB4316220DF8E4570C3E8B408 tevening5
514,321,416 *348398C3648EE16347258DD8CA8538C791E317C3 [email protected]
514,321,417 *3483C8A429B550CE83F1AD36635A25354D3CF8B3 teveuma
514,321,418 *3480D896113C9DF290B442CCAE5C8F212C6DCD9F Tevigirves
514,321,419 *348D1F84E88B60A3D6A9BC2997FBBB03391CCB38 TEVION50
514,321,420 *34859094528B18A6324C8A320DC0DFC947ADDA3A tevrdeb5
514,321,421 *3488B3FDCB1B6206345D6E60801E93B14235EFAB tewledne9
514,321,422 *3487C2FB62FF61DAC5FE94FAEC0D645B61FEB771 Tewyheref
514,321,423 *3486D025FB6BAFD6C46A1ACB995845AF8E6E26D1 texaco’s
514,321,424 *3480941B199A8208A5B6B4BFC03E86FFABE497AF texascampbell6
514,321,425 *3482820806A06E864CB29578605B20A128068800 Texas Eyes
514,321,426 *3486C39D37F7A648E24C03F7A58F7D90015BD828 texas_fm_2662.svg
514,321,427 *34808205AE5A123F1DCB44FFDE7842486FC5544B texasfrostwood
514,321,428 *348579FB531105FDF90CFDF30103B621B7B2D4DD Texasgeorgia
514,321,429 *34850DB0380BDF642F952617A011C5A3E172C5B6 TexasJoleBlon
514,321,430 *3480201A7C3D49204A222A309B63C9E16649608B texaslaw6
514,321,431 *3486937BA05B7E9E2EBFD4CEB1C39BF05F030FE3 texaslittle7
514,321,432 *348C511D5F5038B618D43CD8CE3E24FD43C47A74 texas_loop_369.svg
514,321,433 *3485D7878A09CBD85C5A3BEAFE429D027A59C567 TEXASPANHANDLE
514,321,434 *348CA95435F1FC6919F0BB20841AF20B1313637B texaspinkfloy2
514,321,435 *348DCF8A574E7C5315F60B7572801029770C619D texaszebra4
514,321,436 *348F8537430F4E40423DEA9D4FA9AFBA17F03A5B texfggmed
514,321,437 *34863336702F2591C27F720FA1FF532B27010610 texminbsw1
514,321,438 *348FC217CEED5A9F97CC07C382C2FF15EE2A887C texnik999
514,321,439 *348163E147D91287B0C464E5B96341133DE28B4B texserverbsw9
514,321,440 *34827B2371FA3FB96EC5DF6545AD9238EB3E3728 tex&sons
514,321,441 *3481DF667571B9D9CDBFAE161EBD5DE9B0BA526E textBox1
514,321,442 *3487016A62BACF586E07D8918E537BF4174F7149 textdomainmax7
514,321,443 *348EA7284848BD278698282186DD5D5E7D34E0D3 textfieldcell9
514,321,444 *3486571315080E50E62C702F306F39E8DBB553BD textflows1234
514,321,445 *3483E7B78F45CB5E85ADE60DF0E99611C36F4F40 Textgschtaltung
514,321,446 *348C0EE3586C3051458C64CA8C4A674C2A1BA8E6 textilnej
514,321,447 *348955B75E07F413635A9238410FDA6F44E050CD TEXT'''INDORE
514,321,448 *34823FBDC643215914956D0815F74D91EB1655D6 textkritisch/a
514,321,449 *34814CA6B8DE213185405BE0E106745C3CD59628 textoimaxe
514,321,450 *34887175BFFFC3A27968BEE50315CBFD14AB7D57 textpassagen5
514,321,451 *34807D3D9537CB3ED37CF84BC2AC39EE4C995D59 textstalkconjectures
514,321,452 *34813CE4D164426F6017B095BA9939C6DF77F5F9 text-to-movies
514,321,453 *34875D988A0A93AA87322BF27F9F262A45A6268D Textumbruch8
514,321,454 *348F7BB4807891EDDAD3A52835E47CCFE939B7E9 tex Willer
514,321,455 *3484CE59FD9477D367B333D4E3AA0BA948B87D7C TEYLA06
514,321,456 *348A8A9D0185E9FE0683DF1F215245D65A78EBB5 teymourbsw9
514,321,457 *3484FA5F0EFB7717F275FA6D38B9CDDA5D28905E Tezegpo2
514,321,458 *3482E27452EC9EE26F8E83BF551DB2C8D7AEEA84 Tezegwuan
514,321,459 *3484B5239F076F6434AEF4A84DE2CF7C47BC5DC7 tézisekről
514,321,460 *348EC2B67611984B95D953A07C26EB30E8F44132 tezmckenzie
514,321,461 *348D7F70FB56C71B2EED35EA62BF1494EFA7BF31 t<F-
514,321,462 *34821903575BB37DAC1A30914EA775CCC8C6818F t#F>
514,321,463 *348076A0B1381DD70D82CAB4E81C1255BCA59490 t?F0
514,321,464 *3481E6A4C4472A45B06815A01FC3C15BFC3FB68E tf+8
514,321,465 *3486402A9D93EC1D011137609220D37303C09DC8 Tf8urzy2dd9uh
514,321,466 *3480B6CBFD711C4DA08F3D9768B8EE156FC0A40F tfahcsdniefdot
514,321,467 *348CD1DA50D6C31B889858813099204D027798C5 tfahrelhs
514,321,468 *3489B7600D0E22E3CE899821D7763E4A28DE1A07 tfarcnezow
514,321,469 *348DEF3CDF3330E9C38C1092FC90B3A5BA729D7F tfarcnwot
514,321,470 *348380BDD15EA4B121CCE97166DFE9ED91F45C10 tfarctae9
514,321,471 *3485036E7D0A48EA1554AB1D09F8376ED745C6D9 Tfarkll0
514,321,472 *348C14714FDAA88EAC3A331248824AA66E86029F tfbsrgtr7
514,321,473 *34834ED7565396585085B1F19BF245EB4B4E344C tf[c
514,321,474 *34862F7A26559B12794526FAD66FA0473F0552D2 tf.cia.finances
514,321,475 *348EE8A3FB0DD3D5603BB6BE7E1E8AFC02BEE9E6 [email protected]
514,321,476 *348572097BFDC033A457C8140E20441AD5DFA0E3 tfearings
514,321,477 *34822873C4999F0EA65E2C426CB9F8D7BAC9DE27 Tfelraf8
514,321,478 *348FB603E0EDA378D0040A05DF52D95E5F5FC693 tffnygfy
514,321,479 *34890CB13265C94C60726E5B6ADDC9A07636CDE5
514,321,480 *348609EE8BE8C905C100F496A6FEE89A4ED9A843 Tffytffy0
514,321,481 *3486D7B8AF95637F422DF0F1D1D9CD42955F58F6 tF-h
514,321,482 *34888DAF89A393543439D935EC08353CEE2FF544 tfigfaseslergirf
514,321,483 *348A54A7122DC4F616327BA93BB2B5189F2E7D60 tfirdrot1
514,321,484 *348FD7040ECCF1103363D194423480F0BD63F76A tfirhcsg1
514,321,485 *348AE0663565DCE4B44C38C303D4AF6CC93540F6 [email protected]
514,321,486 *3486E432152DAB852FD049ED5F5AD3EA54D01456 tfjirdtr3
514,321,487 *348843F8834049EAF63A4DB067523719EA2BEC1E [email protected]
514,321,488 *3489BA83D1995A6F9E3ABEAB2E9AEBEF24F49C9E Tflgsprking
514,321,489 *34821E39F0E87BD8BCB898BA65A69B17CD2EF098 [email protected]
514,321,490 *348F578A95A67B076B92E9139CEEFA96F140B921 [email protected]
514,321,491 *3481372FF130D0AF351CF8CC3AF108DA2D563E48 t|fO
514,321,492 *348B652AB992AE8F449CB25BE19D11505995587F tfosrepusing
514,321,493 *348549E2E333AF64236C71D30C02969C81CB1007 tfotnedred
514,321,494 *348E36D243B7E9D3CAC8DAD79AAD0308AA449810 tfrtllr12
514,321,495 *348BF9CA1F15D148DCB54BDC9568282CA6A9CC47 t!FS
514,321,496 *348CEBBC712B66947684B33F7AD125CCA8645725 [email protected]
514,321,497 *348969F291F6C4BF05329CA30A5CC154B23938C8 tfuarhel5
514,321,498 *34837C520773250C046D67221FA28B180AD33831 tfusrev7
514,321,499 *348BF7B112A06DAD588E5D93B33BA9B2E35E87A2 tfusrevs
514,321,500 *348688B37023060007176339B1E8E52A1679B2F8 tfzpydebijk5
514,321,501 *348BC8C209776E4515CC8F4F20C26BBB0A63C444 _tG>
514,321,502 *3481BB1D52034C65BAF3B9434B79C83604E03D6E t^G%
514,321,503 *34868768BC0525E91C3CA5D9A335F0927AC920D4 t\g>
514,321,504 *3484F4CE6E8904847B5E5AE7D3181340235D120F TG468080
514,321,505 *34874BA7F2EB995F593D01A89598C6C3F527C318 tg`6
514,321,506 *3489D0DECE1CD308567E7EAF638FC68E3DB7AD53 [email protected]
514,321,507 *348A4ED36D7EFD71A3948787A92360023C3D07F5 >tGaaa
514,321,508 *34832B9B0976193EC5676009D1EE8253222A17C2 ~tgaaa
514,321,509 *3486D8D391F476B5B28FF4D865D150BE0E1ABE25 tgabvngbjazcxmvvcmhB
514,321,510 *348169F0E635E6F11CE51D6A8AB4017F6EE711E1 tgagaaaattaaacatataggcaacttgaaattacaagcttataaccatactgaaactaa
514,321,511 *34868C52D9A305760DF9DECD37ADADDAE2AABD20 tgalppo2
514,321,512 *348DA956C8CB83E2D6CF43975C55DFA31FDE3A1C tgasrofus
514,321,513 *348028EA561483AD53B9DADBA0F20400579DDB9A tgAV
514,321,514 *34820623B2539AB02004D0C532881354E89936C5 TGBFcr5
514,321,515 *34850BF5274548B80F7CC91610C577DC0826A091 tgcccttgctcttgaactgcccatcggacgtgcgtgacccaagactgtgccgcagtcctt
514,321,516 *348B8DC9DDD9F577A107FCC2DACB1B3EBEA4E14F tgccgcaaggagcccgcaccggcctggccgaccccacctccgtgcgctcccgcccgccgg
514,321,517 *348C010DA414C6F32FBACAD49F4EC7DE37AFC275 [email protected]
514,321,518 *348C8E63D3D0BCA479FF7FA474B4F43D670E93D0 [email protected]
514,321,519 *34819815AE5F4C9ED9E1FE41C2D0BCAC27844358 Tgegnend
514,321,520 *3487D55BEDD41BDB5F46EB16FE279327FB75A723 tgehornene2
514,321,521 *348B97A81222243C605A43583CF0C9DA806E8B2E tgeorgedinamo
514,321,522 *3487507363604152DCB12FA97635F72BB6DD9975 tgeulfpe1
514,321,523 *348B9D061EA773EA6F9F27222272C5145B499EF8 tG$F
514,321,524 *348F30F8E7D4D3EC0611DBDAEC41F4EE9272E7D2 tgfrsdn3
514,321,525 *3485B63CA489E2DBD4DC31FAAB864CB5EBAC365E tggattgtaagaatcaatattgctaatatggccatactgcccaaagctacttacagattc
514,321,526 *3489130A68761DFB9794F956429370BC45E02BD7 tgglslctbsw
514,321,527 *348FE3CC0FB24C5F1897511422AF64120028FA4A tghtnngs7
514,321,528 *348F04EE6B7EF8B2F3CEF190AD88417A1BBEBB3A tgidrfu9
514,321,529 *34830A3E314076A031D322A8D0805F8DAE63DB83 Tgiezeg1
514,321,530 *348D1C0E24D653DB8D85E2A57CA00A893F5869C2 tgiljeoming
514,321,531 *3480934FEB59CD4EE4C3FEEF20C4C72AC6D0FACC tgilterettaks
514,321,532 *348A474B8914A8A8E841C64C455666350F26746A tgiseop0
514,321,533 *348B6850B78D60742B804BDC59CAB007370139DC TGISQO
514,321,534 *348EDA2F821BC065F513469D7894156137D14652 tgisseal0
514,321,535 *348DE3B7642BC0519AA251D646ACDB455AABDCF6 tgivuddg0
514,321,536 *348C275920752FDBB7D30727463E26DAB55BCC80 TGNqXCWE67
514,321,537 *348060FDCC647BF71D4538FC71E841F69F160DF8 TGOIF0987
514,321,538 *3488EC2F6081415B853F3E47601248216691DB2A [email protected]
514,321,539 *3488CAB6B92CCEDFA1D8C706A4D04B56FB06F818 tgrcaa
514,321,540 *3480295E220E822E6018363E09B87235FD9BCF73 tgS[
514,321,541 *348722ADC68405366E26621092D602D7CDBBCADB TGSA00243
514,321,542 *348D1C9709DE1BE073CD77A56BABD98CEF7E413D tgsbf1
514,321,543 *348625F54CD3203BAFB818FB683CCA8C05FDF780 tgtouqtouqliametouqed
514,321,544 *348F76628C08BC9365F30C4BAE4126A8E66563E3 tgulflit1
514,321,545 *34874835C2825462F163C66A89D2610A5D4863E3 Tgurbroves
514,321,546 *348AE8B73F2912610E1F3D1E8C4D9BFE02BF1220 TGVMed
514,321,547 *3485D9AB81E80E8EA38ACC38831A038F8CFEDC11 tgxtldssdssds7
514,321,548 *348E76B62563C8ECD42862A7EDD167E2EB19CC66 tgysqxc
514,321,549 *348A96EC043035AAC357557C241D61A2ACBCA181 tgZc
514,321,550 *3484E32716EE269072E1A319AE3A519A0B4BD3C2 tgzmegzsmvluc7
514,321,551 *348B60CDE3019D15362DA45E46A81AAE068178E8 TG 21
514,321,552 *348A4311E462D5FEB15B97BD30CDDDCE90FCE25E t+H
514,321,553 *348FBAE3BFF1BD02E0B6B955360C6D917F89DE1B TH1CKNE55
514,321,554 *348107F0253C1EB256A2919A2072CE56DE0FA3C7 th1t314
514,321,555 *348DF81273903AC11AD062DC3E538028B2CF74E5 Th355a10n1an5
514,321,556 *3484E691ADF11770547535C36E14E91EEFB26D15 th3g101d1d0ng3u
514,321,557 *3481A4215EB8475D09FC0329F18F9C68BAAE2E14 th3h0tm4m4
514,321,558 *3489E5381C917262D6BAC57B51783033C87513D0 TH3OLOGIANS
514,321,559 *348D86C62DE5473BDF9A6B55F8E0BDB258224149 TH3OSOPHICAL
514,321,560 *3486E8142E357B4B538263363B5541B82A6E3CD0 th3rmanal
514,321,561 *348C1F55228B8EF21BCE3BEFD14283F85768C11D TH3RMOR3GU14T!ON
514,321,562 *348D50A4F5192AAC92CC0FD0F906D5D174694555 @[email protected]
514,321,563 *348894F7CFADFB9BA4082447A69EA089C719E7F9 [email protected]
514,321,564 *34895295C17C4D60F19D18650621C2892142B5EB tH5d
514,321,565 *348A240326F61E4A1E400078172864737432A371 tH'7
514,321,566 *348A9E5CF2918DF9C502EABC43F80F742D313E49 Thadambu
514,321,567 *34854CA28F57D701C9E6E8AE85FA3FFF9DB3B326 thad.arichabala
514,321,568 *348019BECD8BE90CC4537711D01DC3D4809CF5D0 thad.bair
514,321,569 *348A49862F8E76A2AB9A129C329A7BA25B9FDA9F thad.cochren
514,321,570 *348E0FEEEF6A0DBE12735A09F86D59708A1E9723 thad.courtnage
514,321,571 *34809F7769533BACCAA7450D37A41847D0BAC260 thaddaios
514,321,572 *3488350CA5C083E680CE3FECE1911D6418D0BA3B Thaddesing
514,321,573 *348A542CDCAB982C909A91E409D28CA7B8A5AA9F thaddeus.accomando
514,321,574 *3485CBA87FDF9C18BC73CDA2DB5C3D601B2CC434 thaddeus.boemig
514,321,575 *348AD033899822F2121B12FA44B2F474E4D1E08A thaddeus.darden
514,321,576 *34857B19D699A122444539170DA1343D05778FB2 thaddeus.disarufino
514,321,577 *3484B445FA5E070864C9E1A6A4C41890DD73F48D thaddeus.dunbar
514,321,578 *348C529BC9940DE2A9F5039455201E07150CB70D thaddeus.foslien
514,321,579 *348D94232851093F1600061C6B2572500ABA3D28 thaddeus.fraschilla
514,321,580 *348F2D2966E731365393757819BB928F8E8081EB thaddeus.gamela
514,321,581 *348E32BA3E0E1CA8059A5AD81A80726922407009 thaddeus.haugland
514,321,582 *348A620682C11B62DCEB23F1A68DA0A44F3FF62E thaddeus.knauss
514,321,583 *348C80712B9E4666E4E33823E38B73D37F0A5A3E thaddeus.kragt
514,321,584 *348B0868D68922F01C42E91576A381FD6560A681 thaddeus.krigger
514,321,585 *348EB54733E2CF868074ED71AD3D353A4B13987D thaddeus.lantz
514,321,586 *348A76CDB77B7D49EE61EE12A66E7C90B099556A thaddeus.lindsey
514,321,587 *3481C80DE91BACF7CEDC137807073458B8B7A44C thaddeus.maggart
514,321,588 *3480B34B93668767D0E676304925D7AFFD18444F thaddeus.mashni
514,321,589 *34806A66466FDD4D11D72565EF20A9919A93CF72 thaddeus.mcguff
514,321,590 *34819D82FC54DDAFC771C70C7B37BB99359825CC thaddeus.michonski
514,321,591 *3489E4AD4414B6136FAC7AF6C3535AF1665C76AA thaddeus.millholland
514,321,592 *348CCA087ED11C74A4EBBD1EB0F52D0042DA8939 thaddeus.montelongo
514,321,593 *34859C1F833589023430FB6ABABDE53DCD205903 thaddeus.palifka
514,321,594 *348CC38A36A2772CEC7CDE8C0B9F5B7BECE67686 thaddeus.pleasants
514,321,595 *348B1EF6E25604F6121E19F7F93F21946413CEE2 thaddeus.rodeman
514,321,596 *3480806C9A2EA97D31FFE298312CECF50FF2E641 thaddeus.rubie
514,321,597 *348840B1F839B9A21B9E21B064DEF4D56021EEEB thaddeus.schudel
514,321,598 *348FE4ABE2E4A0420BDC8E4367378BB262858F4A thaddeus.stief
514,321,599 *34868395EEF26B349D7AA3E0180A422A05EE31BA thaddeus.tellado
514,321,600 *34873320246D1D68E15CB25673F9B12C4A0B7B55 thaddeus.vertucci
514,321,601 *348DA51B51281999EFBA120E8D772AB2C397E311 thaddeus.waldrip
514,321,602 *3486D3C1B2F1AC96AF880A9D1DBE4BC067197E7C thad.glorioso
514,321,603 *348408E239C63D7E7BE9606752B1F92C70A33A5E thad.jebb
514,321,604 *348CA47E2DC92C89598554495D3A58F61C16A627 thad.klakowicz
514,321,605 *348B58C0BC9B74C6E5FBFD6E75509E993D137192 thadlabs6
514,321,606 *34809A40FF7939D24083F8A9A82C01FB2847A419 thad.moniot
514,321,607 *348541D4EAB3EFB0B1D697F5A89C02B67EF0AAFE thad.namisnak
514,321,608 *348D41990732BA0E120831CDA1EC0CB65A170A41 thad.plummer
514,321,609 *348AFCD71015178B89E01C136F01A2E822AE8878 thad.tinger
514,321,610 *348BADC8639A2D1350524ED2DF2027A541391173 thad.white
514,321,611 *348026E0F847B7D06FDF9F680544CFBF718D23F4 Thaemelt4
514,321,612 *348AD0F05580B27327F4B89E58100D45F7498023 thahcaooed
514,321,613 *348B6726D75A7BADA74386C8441E699C7850BDC3 Thai7
514,321,614 *348FC45105D4EFAD36485005964727BC26284F4F thaiandasiaburapawar
514,321,615 *348D527F46CA8639612AD0C8A52CEB75C7DDFB21 thairvp0
514,321,616 *34826FE4B962E081262E22A05246A6D1ECF3E372 thaisathaisa4
514,321,617 *3480F1B331E83ACE1F9424130D212515F921DE60 THAJ620
514,321,618 *348DF3457EDAC2AA827082CBC241B6B7EDB7B245 thakadiyil3
514,321,619 *3482A1058EB872382D9C2BFEC0D6D6B2698FD53F THAKHAAN
514,321,620 *3489E9DC810708EA2C91AB5A3971F1AEF7AA0623 [email protected]
514,321,621 *34879FD8D1E1FDC5C227ECC557FCA050E176FB6B Thakurias
514,321,622 *348F06C7954E8D005280335248AB1076CD6BECF1 thalã­a
514,321,623 *348A013BA88D5EA1B331DE583D61D1A633F38417 thalamencephala1
514,321,624 *348F54679709BBF56F6485F8776550CE216D636C Thalassaemic
514,321,625 *348AC52C21D3A1FCEADADB56EA1A2C20BA5E04F4 Thalassic1
514,321,626 *34863F09C796D68A373E1DB02EDDC8AE301DEEDA thalerhof
514,321,627 *348DE7B43909C717C0DCF5145CF4B18491735A99 thalesbswed
514,321,628 *34890A8E8D01B0E85D2490E289E897A434FF9122 Thaleses8
514,321,629 *34837C9BD6550A14F77CF9184BB3A6FDB505645A thalessa (a glimpse of happiness)
514,321,630 *3480E12BD062AC94D18446AB12B9CBDA7E78D68D thalia792
514,321,631 *348794DA6817FA3108EE577CC42A5C31F9E3F82D Thalise2
514,321,632 *348AB7F70673537B5C0C2B5150787EFF608E5234 thallert
514,321,633 *3489A83FAF3ABAB4A5C37EF0CF00812273F18DE2 Thalliann
514,321,634 *348EDB0C777BE6A55F13407B3B7F49C598830CF9 thalmudistes8
514,321,635 *3488A58AE0D5D233D9A2CA68A901CCB9FBE84D7F thalposis8
514,321,636 *348EF41746E57EAE7CCC62957F7D74BADC56B901 thamell0
514,321,637 *348359DB776348787E6B0FEB830172ACF5707714 thameridge1234
514,321,638 *34857A730837856BA9E2C9E1C39AFAE8C2DFF0D4 thamm1
514,321,639 *3489F415C82EAB536AE156E60294A177C26EE771 thammmered
514,321,640 *348AC02C419228A53459E4BD8A71B716A063C442 Thamusesing
514,321,641 *3484FCF8366D0BE81B969C157A441D6C5C4079DE thanatist1
514,321,642 *34831C17C51456788A5A7F478E9ED0DF43EADDB2 thanatousias7
514,321,643 *3488D51377A2ACC6B434EA99EF458B96A5B45005 thanga pandi
514,321,644 *348B18E75C8BD1CA6783DB20A39FE9034697D281 thanh.arpino
514,321,645 *348C84CF2D39E6343B21D74CBA25A5B3F22DBCFA thanh.broermann
514,321,646 *348A9A5D17CEB1AEC4492A607E670600E26AF0E5 thanh.chell
514,321,647 *348B70A36E0F42179BADA09A6A55408AE7950C3C thanh.erhart
514,321,648 *348D2C2DE48DE6021B90A135A0E79CCDFF1AD2AF thanh.frashure
514,321,649 *34897AE574D16A64AA4223E5184088A1EE64CE59 thanh.freyermuth
514,321,650 *3480EAFA5BEB25C6CC86A3F5C2D8F2EDDA749F4E thanh.gadoury
514,321,651 *348F4BFE09A1EC862EFE0C4223C0CBF24FD717C3 thanh.goheen
514,321,652 *348B6AF0C4FB537F67247FAD44D38095A62E1473 thanh.harbold
514,321,653 *348EE7AA4F398A2B72FC6182B3748FFDDCFC50CA Thanh Hồng
514,321,654 *34807AB6D7814A6BF1A1AE17CE163C52340C3206 thanh.kaumo
514,321,655 *348B75F1423FEF07A5A14B2E95D67B8BBB8DC621 thanh.kawaguchi
514,321,656 *34838BF16EF2E2CF9F914E3EEC52CC3CA06773BF thanh lan pham
514,321,657 *3480584D12485A29CB6728F99EBD82210740C983 thanh.meany
514,321,658 *3483D32F4042C38E25AC7E453C0A024E12E20A00 thanh.namey
514,321,659 *3482DDB66D4BF61FCF6F9C0C2597EAA72EEE26F8 thanh.nkomo
514,321,660 *348F8E0F341CB7BE0689267377E1FA153FDA596A thanh.palardy
514,321,661 *3486B729BEE5DC76E49E51E551F99383F948F1C1 thanh.player
514,321,662 *3482B4B9AA5B41EA09749D5989385641336AECFF thanh.sadik
514,321,663 *348B9404DFE1079C89EC3D83DE45611ADFF6874E thanh.schopper
514,321,664 *34821A62D76BEBAC7E7B29F984BC84B2A5257168 thanh.tombs
514,321,665 *348091F261F0468A2EF185A0717E2E901D3A44B4 thanhtut aung
514,321,666 *348E5DD14B51AB523A17C0FF0F93473F04869B58 thanh.vanwright
514,321,667 *34865DFB5F824CACAEDFBE11FEC1FD50997776DB THANIAYBRAIAN
514,321,668 *3489506FC3EF76DDAFACE1223B26D82E86F284BA ThankGodforcollegeradio
514,321,669 *348442D09A3FC1BDD9667647C98651F47CD1517C ThanksforComin
514,321,670 *3481E358998F94ECB729801A49324F3E0858A938 Thanks for the Simulacra
514,321,671 *348E00681F4C970403B5F22169CD77FE358443B0 thankshaha
514,321,672 *348ACCFBCE3700532A6D2D467065712EEAE9B233 thanksheero
514,321,673 *34882876A5842E3BAE8D10D03378C0792F3E576B thanksowing5
514,321,674 *348A53B53CB5C6A6B9EC4A0D3A3B6F388A4C2769 thanks.xtv
514,321,675 *348A8A6FEA714B8961537AF4DC2CD94B902DAC66 thank you elvis
514,321,676 *3486D098412A5ABBA5ED2F5C684C47240E6590E2 thankyour.e.a.
514,321,677 *34832FF7BC26EDBA02F6349439AADDF93FEE6994 [email protected]
514,321,678 *348525B6CB997E5292AD08AEB54E46388F1781CE thaong1
514,321,679 *3481AC27EC4810FB995EEFFA26DA6515B5B308CF THAQ
514,321,680 *34864A28186B7DAAFCB8D5A47DF1AAB588B092BA thaqatul
514,321,681 *3486A456C09268A6B5C2ABB8770A2B4F270B19A8 THARATHIP
514,321,682 *34868E56EE4862968883732AE8DA25B82A9AA804 Tharcicius
514,321,683 *348E90FFBA8E1875147CB3CDB5A35ED567532B2E Tharnel9
514,321,684 *34838470A2366412981FD1A1319CEBAF894F0422 that1p2o3i34
514,321,685 *348255E360C5D5558B65F060518EAC320EBED0CE that72.88.119.42
514,321,686 *348F7C6EA7ADC99DF484579242AA16C4AB2A1E86 thatalaska5
514,321,687 *3487146DB1ECB3A0747C8C1FA1F37704A9F082E5 thatallegro44
514,321,688 *348EBC3F929A126C805BB6D208967A426414B153 thatallstate70
514,321,689 *34874C6C790A062D15404AD91F6E95E2FB3ED879 thatAlpha2009
514,321,690 *348EA8C6F63BD71EC8DAEBFB0481A98986D2E427 thatalpha6
514,321,691 *348E30ACB5D91913E191DCA6D7CF0B0C04DD1385 thatANGUS05
514,321,692 *348E4AC75268980C0C83EA2BF230F4EFA8E92175 thatashton03
514,321,693 *34850A1C004D12705CA484380F065EE1466AB8CB thatAVATAR1986
514,321,694 *348568C6990C4938D1380580736E47B98EE2556F thatBarbie1986
514,321,695 *3485F460BD720DE4060D2C9F1509249DD575D094 thatBARNEY188
514,321,696 *348A180631465B494F76B6496BC6E29548936FCF thatBARTMAN14
514,321,697 *348AD341499D7E9BEF6CB8956AAD5C97B75AEE3A thatbasketball1
514,321,698 *34877F3D2C86E9409165A5E63B0450BAA250C5FF thatBBALL64
514,321,699 *34877AEB80A7FE3F7CC91A522EE7A896CC5F4698 thatBeast
514,321,700 *3489C911B56F17C4510E84EB83AFF8B5B2428D7D thatBELMONT1988
514,321,701 *3488FCDC6D12C733BE5D40FC4C4AEB52F07E6390 thatBENOIT40
514,321,702 *34880D14E2028A9042748CF2D85E1B58025B3380 thatBernard2000
514,321,703 *348C7C91FB8200414253AD6559DD54DBF8CA5BE0 thatBERNARD85
514,321,704 *3486F2798D10FE64BD99907EB6418C7CC5A75BB9 thatbichon39
514,321,705 *348D9BC7A3FD85B893369A56CFE6DAB40F0D736F thatBIGAL2009
514,321,706 *348E72B1532F7291E2E3D7DC6F4C47A2EB97C2EA thatBigbird69
514,321,707 *3488D13207634D8DA573209ADC526118D95FCEED thatBIRDIE58
514,321,708 *348AD52D8C37107366CF1FE30B81CCAB57606971 thatBISCUIT26
514,321,709 *3481E44F6E8A031B8711BF082D806F95530539AD that.bjankuloski06en
514,321,710 *348A7ECFD9D0730E73E7D167916896F575A1B45E thatbonjour18
514,321,711 *348F1C66E7D301130B68B6DE987C53664302C13A thatBranch34
514,321,712 *3489BB6A0EA9769914E228375ADD517FA71C54E2 thatBRANDY2009
514,321,713 *34814D5B856C97E6FD704AE2E4CFEA90BC7E85E8 thatBrewster84
514,321,714 *348EBB09007220CE8B2899C3B748F5417862B8FB thatbroadway1989
514,321,715 *3489F5C6B3B26FCFD69BA49ABB10EF9D9E37C095 thatBubble31
514,321,716 *34859CCC4B12A58672146613D72B23B8E7D768F2 thatBUDDHA14
514,321,717 *34889FA8B73BCF746B65DF7D383E106A6BBD1C6C thatBuddha55
514,321,718 *348A55C000820DC4DE638A535863217DF12E0F16 [email protected]#
514,321,719 *3481AD18AB3A667AAD987915B8BD19C049733E9C thatbullet68
514,321,720 *3488B76D9F53BEC65061618E27F1950180B9A18E thatBullet79
514,321,721 *348CEF7907D1828C7AAADD2005A03F9EC49B761F thatbullet94
514,321,722 *34817F1812BAEC206EB198CADF224F049EA8FE19 thatBULLS03
514,321,723 *348CCB0244FBB1680537CF72E50069A4DF421E36 thatCARLOSabc
514,321,724 *3482B043D74C4C5C64BE806581468883E85D0C11 thatCarnage12
514,321,725 *348AB4C2DB173CA32722D002A55056B85024AE55 thatcarole7
514,321,726 *34856F2A96418FDF47D0AE2EA68DC71741700D13 thatChallenge93
514,321,727 *348C6C1C1CB7CEA055E2F527628F10F891E19A28 thatCHARLES4
514,321,728 *348E826E94A14BCAF609CA516489D67276F679AD thatcheresque2
514,321,729 *34882A206A63835AA62A935F8D41B558959F7681 thatCHIP2006
514,321,730 *3485DEF68918042D264577FF8AD81DCD1804D4C4 thatChrist144
514,321,731 *3484B0469DAF92E7A66E9EC45B8D6C03F8F5E6BC thatchrist160
514,321,732 *3487959C91969FF35C10DBF34D6F5440D4BBE6C3 thatCINDY1qwer
514,321,733 *348C45F10DF2E04DDA6C0FFE3E5EEDBCAFD7A1C1 thatCirrus1986
514,321,734 *34830712A634CE4FB7CB8B0EAE8A89C5FB5F5280 thatClassroom1986
514,321,735 *34823A31177EDF69FD1E9744CD298129B58AC8FC that.commander
514,321,736 *348C669D1D8C244A529A3A355B3F9C479A852A2B thatCommander1988
514,321,737 *348E3A9BF9316308458AFD3170C00FA4A99EB13A thatCompton33
514,321,738 *34857AAE3571686B101893EC0DA5996A1E9FFF79 thatcomputer9
514,321,739 *34884656DB06FE8F9A6145A34E9F476CD04F8A19 thatCONFUSED2001
514,321,740 *34851965E54836D46A6F28792120D68BC609A11E thatcordelia1
514,321,741 *3481E580BAECE73EEC85F89275589EDD11AEFF52 thatcorvette666
514,321,742 *3480FA80AB3AAFBDD734895B736835ED061C8894 thatcosmo2004
514,321,743 *3489C0D93D31D2D973DE6DA0912848FCD0EB6F5C thatCOSMO52
514,321,744 *348B9725C3FF6DD4C3F4F7EF0FD3751800199A99 thatCOUGARS65
514,321,745 *3489D2E9A3FAC4D92F6C4CA763644114D7926991 thatcourier38
514,321,746 *34874036222AC6A925AE5E45D3B26F8568FB5C4C thatcreative36
514,321,747 *348B08C5752BEDB5E215E3C31E1F30B903810700 thatdakota94
514,321,748 *348ABF2A0951A0DE05A7A805A9C827285CA4F77C thatDAMMIT97
514,321,749 *348C6D64CB852A5DA538B4236337E289447C991B thatdance90
514,321,750 *348BF2E7098BC1ED4DB4241519CF271A8B7D1347 thatDANCER39
514,321,751 *348CD3224203E5B677323F869283C12E3F794EAF thatDaniel1991
514,321,752 *348B0D44A9184AE8327968E77C46552F050A341F that.danieldemaret
514,321,753 *348715E963F3BF39A8DB4E6D5572AF944BBF149B thatDANNY04
514,321,754 *34843C41565EA13CAE0AE67387D95970F28B7B1F thatdatabaseabc
514,321,755 *348BCAC37D9D3B1E52405B1A14E2AFBAF308CDF5 thatDave08
514,321,756 *34878E03283E004C9A1AF82228CA9C0F19EDC206 thatdavids1993
514,321,757 *34846FAA7CC9E7BF71A0DE0C3A84C4DE2C9DC93E thatDESKJET82
514,321,758 *348DEB51944BC091E8B12D0D9175B035C0F4BB9F thatDiana94
514,321,759 *3488E9539DF31B3014B380B8AC1587FB6AA18962 thatDICKENS27
514,321,760 *348ECE767407CF4A3F1730E282EB3B7F9CC0A75D thatDoggy!
514,321,761 *3489BE1C29934BC0FF74A846DA66F9C587A45C96 thatDOLLY76
514,321,762 *3485970A758B74B132CFB399F436E49F5489DCA0 thatdominique45
514,321,763 *3488C26C622292ED5ED85E350A18FC9155CCF824 thatDONNA2009
514,321,764 *348D24CEF7A9BAEC827C2F7C90B139697EFA168D thatDoug1234
514,321,765 *34899779730538FA76C6ECC38A2BF00A397AD9A4 thatDOWNTOWN39
514,321,766 *34861C00DB26CBF1F30888C6EDC762F7A4E270B8 thatdragonfly4
514,321,767 *34835B980222AD97870009010A60632057F24B0F thatDRAGONFLY40
514,321,768 *3483EE02AD2C3292EB856466AE1986D2C13CC1C1 that.droliver
514,321,769 *3481C943CE7C65D27811033B4C9F3E29F2640382 thatelissa19
514,321,770 *3482316B2268AFBEA1D1AB9DCD63E45340549D8C thatenterprise37
514,321,771 *3482F099F08FE82FB7616BEA4112935AF60E7380 thatESCORT28
514,321,772 *348F45320628949120AA63738EE8F39A2503A401 thatETOILE00
514,321,773 *34853DADE7AD74E3D72862C69F11FB272533F321 that_evening_sun
514,321,774 *348DE77D2FA18B53FC076EC14F2179DF04ABAA05 thatfairview27
514,321,775 *3481BF3AE342E32728D68D12F2BA8ECFF229E35E thatFAMILY65
514,321,776 *34823B36D82D0D8D4AC1036BA6A6895325C9A645 thatFelix21
514,321,777 *3482CC7FA3A6B674EF7BECB085F7DE930C89A6B8 thatFIRENZE53
514,321,778 *3480DE429C712E5E32AD0F6CF7AC416288E233B8 thatFISHHEAD32
514,321,779 *34859F0D7752FF894D4F81D426B8CA3AFD0A953A thatFISHING777
514,321,780 *348321F7A6AD6330548490A479AB3BFD1955BED5 thatFleurs36
514,321,781 *348ADDAFD673F6B061C88CCA6C30F33BD7E6D616 thatflowers1998
514,321,782 *34847ABA41553C7C19F6FBE0778B009278C9195B thatFlute2003
514,321,783 *34871687C8445E7B79420308B63FCDE485E82E10 thatFORD50
514,321,784 *3489A5B5BC9BA2BC26BB8420C3E86028B1F5CD78 thatforest21
514,321,785 *3483C5E12AFF78AB12059CD7A52E84EC435B21C6 thatFritz777
514,321,786 *348BC1C086578209CC8374EEE6553FA0D3B0C875 thatfrontier03
514,321,787 *348932E4D9EE331EE42BA778A69C05AC28876B21 thatGABBY79
514,321,788 *348B6CFAE82EA8874FCB05085585F34CFD07D68C thatGabriell49
514,321,789 *348FC711F2DE98555D75CC91C77EC2FD014FD1D4 thatGandalf99
514,321,790 *3482ED3CE028FC4D457B5FC689D014D3BBC059D8 thatGARFUNKEL00
514,321,791 *348B10A53F28AA7AD991A230A9CAC3D007DCC7C3 thatgeorgia2000
514,321,792 *348AC934DA2B8ECD0B855629632E552C8BF21805 thatgibbons43
514,321,793 *3487FA7F7B8F5CE4F3A97A5BA14F1D88E6EAEB0A thatGILLES71
514,321,794 *348FDCEB64E6888B2810F0EEFA3F3D1B9AA2A22D that.girls
514,321,795 *3489D7C10F3C3790E7B1AD0A3CEE553D48E0BF55 thatGrandma1998
514,321,796 *348C5D7D28AD0A23BDC5F62726B96C86754452FB that-grape-juice-interview-ashanti
514,321,797 *34828761915E9BDF48550544E8CF8F1E44509D33 thatgraymail44
514,321,798 *3484ADC32B9FA22D6194DC01D7600F298985A2AB thatGreed42
514,321,799 *3482FB59D2B3630A4E610A7CBB9F36E7FDF25F15 thatGREG1992
514,321,800 *348A3ADF2E49C53375AE9EC997E27C75784B159D thatgregory40
514,321,801 *348594FC615022FA4DE874DFF41FCCDBFD1F4827 thatGREMLIN74
514,321,802 *34894C02FEDE846ED5AB59C281546E659CE92EEE thatGuess84
514,321,803 *348971BD7C78F775AD118BB544E938DCDF48647D thatGumby2000
514,321,804 *3489AA7C7FE4C27C4A1A7B9E26C5EEE472D27D78 thatHAMLET14
514,321,805 *34863BE948094590883C0991381335271D56E766 thatHarriet2007
514,321,806 *3483D78C2F768D628E96355B6205B29F2158D339 thatHerzog02
514,321,807 *348552447DEF5BEC20F8F8E030F3B7C27FEC3124 thatHillary92
514,321,808 *3487283BC84D78ADED0C95DDBE1EFB898D057DB9 thathistory76
514,321,809 *348C5A2684C8567E71D3F4B739DCB3CA13BB085E thatHOBBES7
514,321,810 *3487E325AA678EF11E52562E9F8A564C4B1010E4 thathobbit18
514,321,811 *348D996AD72C1C47B126E6DBCBE6693E16F4C29F thathootie57
514,321,812 *34838FD9EF8B00A554445FCFDF6CF581D264A6E4 thatHORSESabc
514,321,813 *348999A427A41FAB82C28F132C045A65905FFF36 thathummer86
514,321,814 *348B73F4E5082BE9E6CD752616C94C65B3AEAA99 thatHUNTER2006
514,321,815 *348F5F90514A1BA5D71DDEFFE451363E64D34EB2 thatIrene18
514,321,816 *34805508248E78F8E7D62C322FCB60BEFADB1EA7 thatisabelle64
514,321,817 *34826D0F0DE228B6226229B5B0DC30C445542860 thatJ0ker2004
514,321,818 *348079654454445563C29C704E88DEEDF5911376 thatjasmine!
514,321,819 *34864AB2C5F7C0674EAFCEDD7B6274FBFD818903 thatJason27
514,321,820 *348F56457FE5A2C1A2954ECDCB919CC89D2C5B78 thatJAZZ50
514,321,821 *348B7263ECB573816A42A4CAC3A0BFBB8A133246 thatJEDI99
514,321,822 *348C041C835CCC2C40E87B83B4173DBC645D82DD thatJenny112345
514,321,823 *348329CD5B3A0B0EE9E5E9A0A3A728B071C59555 thatjesus192
514,321,824 *3483185769062D5DC517C23100A4CD845B89CE11 thatjimbo63
514,321,825 *34851C6C018F79202D852CE2EC2C532BEF0E3BEB [email protected]#
514,321,826 *3486618B48879FF2690F5B05160B6E99D8F1833D thatJojoqwer
514,321,827 *34877CABED3EC6292583940CD48604D54C05DFB6 thatjosee1997
514,321,828 *348717FA48E97D863A2C3040B545ECFEB6C9748A thatjosh7
514,321,829 *348E4FBEF30F3B2D29C49CCC1FDB018F8FAD53C7 thatjulie131
514,321,830 *3482587E78A4BE049B604A5270A8D466DBC4446A thatJUSTDOIT2002
514,321,831 *348868ECC5A49061CA8A0DE4F5C6AAAE0E42D34C thatKarma2007
514,321,832 *34843B887431AB0AF6B78B66F031A1003A22FE56 thatKids95
514,321,833 *3487961F654495FF4AC995B7EF6C65205BA9DE97 thatKissa287
514,321,834 *348F2E5C918B17C6A169329756F3A69A1B797D20 thatlee92
514,321,835 *34857D65A99A7FF702E12FB8DBBED89C43249FDF thatLELAND666
514,321,836 *34897BA1ED3E6783538344F665005BA1715B4D7D thatLemon18
514,321,837 *348C1596ED3AEE74C3F8D3577E72B962F0B02675 thatleo51
514,321,838 *348FA625AAF1BC601702E03D61CAF1A47116BDFF thatLeon07
514,321,839 *348C68A230AD2FA5AEE9E8CF77A6A282AB50AE38 thatlima7
514,321,840 *34826FDDF177AC6CEF5537F37A50571D806E6424 thatLIZ49
514,321,841 *3486A0D0C95B46E76CE36808BA295D217D521E93 thatlonely2008
514,321,842 *348D870B73285E67BB5A72078530EA79ECBF603B thatLoren75
514,321,843 *3481EC367E33027EA34BCC4137235911D0CF31EF thatLorna81
514,321,844 *3482AA85944B3E38BBB7C86C6F3B517C0374FDEC thatMaiden1992
514,321,845 *34834D9626E975D52F9200D4B66E5439BD68EDAB thatMAIL32
514,321,846 *3480C7AF2EF3B3AA5F080CC4465089DFD2906830 thatMail97
514,321,847 *348B9DD3A980408F8E3DC0A00A98CCC53D5D32BF thatmajordomo97
514,321,848 *3487CA3771EBF57A05DA00A0132224039B86ED07 Thatman8
514,321,849 *348563E9CE06C338E9BE99809FA8FA208164FD7C thatMECHANIC54
514,321,850 *3483BDB99072F013E7496E7BA59D64E916A1FD45 thatmelissa2008
514,321,851 *348FF1E9A527227356BB4E9F4AD9DB47C822C41B thatmelissa85
514,321,852 *34884655715294EC5663A776ED447D4F4B7E984B thatMellon2000
514,321,853 *348D4A87D32A31D27068B3CB5DDA66D36ACFC477 thatMelody30
514,321,854 *348B5C59791D61E82BAACF8F6CA9CE8E5F01AB99 thatmemory666
514,321,855 *348FAE556092FD433E5C231DE84151245ABB4B48 thatMidnight0
514,321,856 *3489172206C1F50001727397544EE7F85CCAF47A thatMIKI69
514,321,857 *34899A7500CF86860A738A42586B7CF7F4396346 thatmine05
514,321,858 *348C72D71D44FCEBED56B370FC57AEDD492B2AE3 thatmirror11
514,321,859 *34850A0737ADF324A7091B02AA7CA0CF754A8B6B thatMOLLY41
514,321,860 *348F620280C4F8C907E286735664E08F66470681 thatMonty30
514,321,861 *348CC0CE6F746E8382E92BFDB034E5137EFAACF7 thatNadia3
514,321,862 *348D6F40D76AF63700B771E5C42C2004AFC32EBE thatNEIL13
514,321,863 *348359B7B03E892EA03AB4E353675B7282B26208 thatNERMAL1
514,321,864 *3480E18726BBF940A9E4ECC159E023F387FEDE8C thatnewaccount44
514,321,865 *34877D3FB7050E055F3257A260F03FE3BF7BA16E thatNick23
514,321,866 *3481312E585ECBA1BC9DC06BA6A6BE69343BCA7E thatNIKI83
514,321,867 *34845220A7AA46DB208DD40A21DB50C4625D9A6F thatnikita0
514,321,868 *348F0E82399CCAEFF1ADE4D7A3102A7133415B25 thatNIKITA23
514,321,869 *3488AE95072619C9D53C1BECEAC1DEB21754A24E thatNomore1998
514,321,870 *348A3AF92A1A00C7BA220E68C21095906EB88933 thatNOPASS82
514,321,871 *348C0B3F67124C1C9FAB4498CAB136C4D915D661 thatNOTHING4
514,321,872 *348E4938D7A5366ADFE5A787122497A5EAEBD27E thatOpenup1998
514,321,873 *3485220A998331BA497301AA8C2D75E515B45B3A thatOREGON1998
514,321,874 *348A01C58AECD0D864203FBCE5D87E9883D471B2 thatOREO59
514,321,875 *3486F171406C9C8C27B5B4DA5078BE2765F4DBF7 Thatotter
514,321,876 *34808C6F2135A79B93975DFA0AB5FD2AE745C1F5 thatPANCAKE75
514,321,877 *34830A927A246EE94A04D1FBC58FE61E32D7D8BC thatPark
514,321,878 *348C446A958EAE19D84DB926D030852A75361A32 thatpass1998
514,321,879 *348061721E890CA667BEF7A45289DFB71727F971 thatPAULA0
514,321,880 *3480299D10DB7584BF3C07B31209B43ACA0AE52F thatpavel53
514,321,881 *348922ACBE602B63CDBE853B1D1350100ECD539E thatpearl60
514,321,882 *348A3A218E20B0741693E068B0FE72E5FA1BCC1B thatPencil81
514,321,883 *3483B021C376754EA84AD840416E2732B4C26451 thatpercy91
514,321,884 *348E128A5356495A8014EB3F32AD6D918283BDAD thatPetey123
514,321,885 *34844F2958F92B56E82344E9D88E2EA5EF67885C thatphilips37
514,321,886 *3487ED89F0ABC55733F0B55475F06F1FAF6649F6 thatphoto94
514,321,887 *34865DF073E2FE6CB919C0818BB9F079B7C8D21F thatPISCES2003
514,321,888 *3488EFD442947BF0FA3F50F78E988F38FA8BDB27 thatplato62
514,321,889 *34847EEC3D4B7FA99A60235843E50362788D14E0 thatPlease06
514,321,890 *34896BE80F4D6C1DA89C5A41FD60E8B8C1655E16 thatPOKEMON40
514,321,891 *3481BD2EDA6804B11FE76DD83F5958A1C5149548 thatpope67
514,321,892 *348828618FCA8A2246E8E0775200CDA1E6498BBD thatpovpusherkfc1864
514,321,893 *3483BDD750052A3B3CBF6ED8A7F140BEC2C32A78 thatproperty85
514,321,894 *348AB8C1526075F377CDA1FA0B3B9AC344889AF2 thatqueen27
514,321,895 *348AA8A971BE23CB0CD23888C052286F921F665D thatqueenie123
514,321,896 *348505670A4CC9473222F735E12B560BC0540E58 thatQuest1997
514,321,897 *3487A509FDEEB4C2A7E62A320A6D30D55F485E79 thatQwaszx93
514,321,898 *3480BCC1E369DD4156E65709EB1BF39700168C51 thatQWER2008
514,321,899 *34839A2C9C0B6C3B169CE2D001CD6A6A75786E4C thatRabbit139
514,321,900 *3485EFE5AA1B5A66777138A57D597DC633A81CCB thatrangers!
514,321,901 *348675A87BF8921F05027B43E88BC1CCB16FEF7F thatrascal03
514,321,902 *34835F5556046FC04F81169114C15EBC17F46D8A thatRavens85
514,321,903 *348FDC59E5B1AEE3C4B23B77DAC4BAA936839A91 thatRedcloud73
514,321,904 *348B07B58601879F7C97E7E563D99ED087E666B3 thatREDWING85
514,321,905 *348860B4D70E5ABCE61DD170C19D5FD1D8015066 thatrescue48
514,321,906 *3486B4259882BA6FB3401489EC912BBD22593F2C thatricardo149
514,321,907 *348F7276F53798E4A9480C10A623910A75951AFB thatRIPPER1995
514,321,908 *348F150A7DC8117D0FDC64FD281E3574332A6FAA thatROBERTS79
514,321,909 *34809191B870BF3566F6AA2FEFDDFFE7F93D90EC thatRock8
514,321,910 *348EE886D33BB4FD34C900695B9D1369C8D7D6BC thatROCKET119
514,321,911 *348545F21DC4B3D526A864E6C0D8252239B8F336 thatrocket133
514,321,912 *3485F70FAEA1A961C07F192AAE199711D020DC56 thatRocket8
514,321,913 *3483A68F299D0DA95AF3F29BDB9D38ECCC8B93E4 thatronald13
514,321,914 *34897853A75648E92FEE68F81DBF03AB2C9F25EE thatroni65
514,321,915 *348AC713EB25E39A4BE5880159A5C970040F4860 that's all right (feat. eric clapton)
514,321,916 *348A400AC8D22074106BF989F763777EC87E0994 thatSam2001
514,321,917 *348A03C291C2D16BC6579D72BB05A68AB46DD258 thatSAM30
514,321,918 *348AB347D5CD86B4CEC3730E1B0BC0DADCBA2E9F thatsam90
514,321,919 *348253443720683ED5BE62525AF607EEA4D4ED4C thatSATURN123
514,321,920 *3488E6E45B456361A41CF7D9A8047B2A5AE23645 thatsaturn15
514,321,921 *3487CA2D007B233538FFF4D650A9D0C3FD2AE521 thatSCHOOL90
514,321,922 *348D27D8880894DAD888F1F8EF23897A2EEEF596 thatSCOOBYDOO07
514,321,923 *348D35CE60B243154E06334B7D170201688E237F thatscorpio49
514,321,924 *3480F8427BC3675D0DA7816C2F1E9FB67C96A722 thatScouts1
514,321,925 *348CBBF7668C6513D80A91FB6D2FCAF3E808DF92 thatseattle22
514,321,926 *34837C97E8E7C286B73A0A3AB3805CB10FB50173 thatsecret32008
514,321,927 *348D585FF35F355C10261AD719A4590010AC8703 thatSHANNY65
514,321,928 *348459B98BB5456DCC987567E8B88FE51B834F3F thatshelly51
514,321,929 *348D3C8B0772D5C1AFDD87F4FDC513F13CFA8A2F that's how much i need you now
514,321,930 *3489851430FFE85C12A4AD791B10C1F17A76EC5F thatsidney13
514,321,931 *348A5808637F900CC11E67CEF958A89F4B42675A thatSIMSIM1999
514,321,932 *348A3DFD67C61D6CF9630FC029A43EF63AF453DD that's it, son. you can go.
514,321,933 *348BC43D29AF088FD1711DC078A43A656CBB204E thatsjustthething4
514,321,934 *348060AD430825901368CC54579C9EC03CB594FC thatSKULL1991
514,321,935 *3486F005F371FFAB8DD6CF6B2993B5A97633215D thatskyfiler
514,321,936 *348227C8A7472D94D54849A79E9D26C61862A82E thatSMEGMA08
514,321,937 *34804875D5E78AABEB31D478A9FF476C8BDF5E88 thatsmskiatoyou
514,321,938 *348DFAAD953C67AA93A025A34D285DFE83003F98 thatSnapple44
514,321,939 *348156C674063E39C18221E9E0F59FD0A5C6F7A4 thatSniper52
514,321,940 *3487966D3592198C2C19990821949FD1C598BEDC thatSNOOPYabc
514,321,941 *348F663C0912FA2B592EAB3688B7F009F75226F2 thatsnow17
514,321,942 *3484B7A3B020AE961705B7CEFD94645162CAA8E5 thatspirit4
514,321,943 *348008B0CA1DADFF156B706E05A9A161ED410466 thatSpot65
514,321,944 *3488B4C83759D016D2AE5409C0BB6720408D2B2F That'sRight,That'sRight
514,321,945 *348805AFF34F94359A66CF7C29733FFB6B28E95D thatstars1
514,321,946 *3488006DBB744915191970259A4F44A13DC82174 thatSTEEL19
514,321,947 *34816A8A474F23620E16371E6662470631D1BDD8 thatstephanie2009
514,321,948 *3486C2149F06FDD618ED2CF11D82001D515F1EEB thatSterling90
514,321,949 *348C3F2FB83266739FB00ABE5245D14FDA4C4BFF thatSTEVENS80
514,321,950 *34856CA83B36DF26FE351ACF527F627AED6FEA2A thatstheverything4
514,321,951 *34843254285A98A260A1678D9A75AAC3351C6737 thatstranger1
514,321,952 *34834FA00563EBAC09DA6D80700245EBCCC389FE thatstrato19
514,321,953 *348DEEA5C155122A3105E5BB045D62594EF02A60 thatSUCCESS1999
514,321,954 *348B28EC833336FF2C7E4C017470C35EFA39512F thatSUCKERqwer
514,321,955 *348DC1B48DE2AC6436E550CF90C050F5D5759933 thatSUN2007
514,321,956 *3488C0A2CC59757DF00692CBA1DC49830C1CC7C4 thatSURF30
514,321,957 *348DB8C1FA9F279053DC3677374479F4385EABB8 thatSurfing37
514,321,958 *34844123F7939B2C1C667F46F82999A277654B11 thatSweetpea1993
514,321,959 *34801B1234C9BC0DB397ACE9EC8109B3BE23B341 thatSWEETY37
514,321,960 *3484F086FFB44D639266738C45F36865B65EA44B thatSWOOSH82
514,321,961 *348A0E3898BF907F43EED4CE6B6E69285490A94E thatSwordfish2
514,321,962 *348A4984DC188627539A1E14B993494AF868028F thatSwordfish47
514,321,963 *348763FA3C6EE88D1B56D1A32A44FB6E02774794 thattacobell85
514,321,964 *348D123EEC2926F0092B831B5DB3E3E0584FF346 thattasha26
514,321,965 *3484D4FDC99B71A1A0C48CCC6A96C1FAC3F08222 thatteddy133
514,321,966 *348169AE3149C944AF994E919D316E8E050D996E thatTEDDYBEAR92
514,321,967 *34834DD164D288BDA681580A509548B354813FFF thatTHERESA73
514,321,968 *348BBAB2B3B3A7B858FCD331C9D51A80C146D11E thatTIGERS97
514,321,969 *348A03A4575D3482FDFB41B1164637B3C036B557 thatTightend90
514,321,970 *3480BF617542FD8F006615824175F52A5215A6DC thatTigre2009
514,321,971 *348293E3F8A784AE18C387703B53EAC76B57E96E thattimber80
514,321,972 *3485A759DB0C62D7DD70F152D2C38B54693816CD thattool26
514,321,973 *348BC5B94E8A1736D73841D036521F573D2A1976 thatTRASH83
514,321,974 *3483775D5348E34D95C0EB76FE39E8EC58374F66 thatTricky63
514,321,975 *348B80866D689E3FA650564E3465C89A4BF4F945 thatTrojan2004
514,321,976 *3488A296967EDD6BE06394199268B3843BECBCDE thattrophy86
514,321,977 *34837B16ABB29498D5949FF9C31E99B872C86051 thattrucker29
514,321,978 *348A86D579D5FBAD5AB02C961C5F758C98FDC7AA thatTurbo56
514,321,979 *348E9695B0DD7997C178B0EF6035251D58AD573D thatUNITY67
514,321,980 *348E55567D19B7B74F89BA0EE02D03426425AFE0 thatVENICE97
514,321,981 *348CCFB66DEF526F6151CD2FC125770670CEF088 thatVictor50
514,321,982 *3488BA9FCE0B8B9622FFB77ED75730A4DCFEC61C thatVIPER152
514,321,983 *34867CA620F8322AA3EB6F86F8E3970A66655B40 THAT--WARNINGS
514,321,984 *348A371BF82F490A0CFD164063587BBDE8FBC4B4 thatWEEZER15
514,321,985 *348ACD06E6D11E123260DD6F9AF0AF84DE1A2385 THAT-WHICH-MUST-NOT-BE-NAMED
514,321,986 *348378945B78FF4C07450B9328DE0145E1DCB270 thatwilly33
514,321,987 *348FB210D1C1110CED470C37243250C7F50146CA thatWindow41
514,321,988 *34880C9C40F24628B09F6D10D961C678312B85BE thatWINNER85
514,321,989 *3486A34D563EC689C094F77FEF178978F67ACF9A thatWONDER55
514,321,990 *348FEF23106DC57C33A0C437045375F1F14A117B thatzeppelin03
514,321,991 *34893FBDAE3660E8FA1DFAF74CEF734C59547099 thatzhongguo21
514,321,992 *3481AB911DA1FFC4336DEC70F1463310602AF6E6 THAVENDRARAJAH
514,321,993 *34817E5F8BD08351E2A7F29981ED6382770DEA60 Thavria
514,321,994 *34858E83433DA5CEA793EDFDD2FA1C072D172F92 thawperi4
514,321,995 *3487C04210093401002C63ECCE360510206B9447 Thayetmo2
514,321,996 *3484837F1F18C2D6067709DF8D9D7A2EBC85941E thcabmasrevew3
514,321,997 *34806580726863979861730DEB74A1DAB095FD3D thcalseg1
514,321,998 *348193B194BCDF597C40BED7AD066D7A13125F4D THCATLEAG
514,321,999 *3482673F56D2424FA0F78DD1E5C932DC2AC56E92 thceregaaw8
514,322,000 *34849C6D2D1E2201024D515DCED7539C08C58F0C thcerioos
514,322,001 *348581F7D671D733C201D7F35EFFA792FD0BE02A thcillem8
514,322,002 *348AE2DA14B475882ADB893E5DB5B9D7753A55DD thcirebf3
514,322,003 *348CEA47767F2B49EC3DEA9FFC07AE515B4FD07D thcotneg2
514,322,004 *348DFD85B312969FD3DABA4E16D1D5097583C675 thcsineigyh
514,322,005 *3485D56F12511719CAAE262BD74C92DE9B908D31 thcsitsihddeobs
514,322,006 *348E742DB3876DA07E9440B7F42DF907100519C8 thcubegmueR
514,322,007 *34818C22CF6336E6C84C85BB2B8ED0C583D4E488 thcurvsood5
514,322,008 *348D6B7BECF68AD10473182286C539382E04F26E thcuzhca8
514,322,009 *348600D2A522751EFFBAD5CA2D92BA64FA2A4855 thcuzieomeb
514,322,010 *348CA4F1947CB91F25C9B2121F8A80BE64795377 thcuzlebbed
514,322,011 *348F7D51CE7EBAF719454281CB06A612A7C2CC1B thcuzton3
514,322,012 *34864B67814C0B869CD1E61C4EE9026553CA2566 Thcydds7
514,322,013 *348B05641FBE095403A7D5E0285F3B7DB6C61839 thdimensional
514,322,014 *3485C6BB17C79F09B1A535D0E241CFCC38F77A02 thdspkkk
514,322,015 *3489DCCAD259CB12DC2F30004001E57779DF8786 THDUKECROY
514,322,016 *348F9E5D9B9E809A30753995DDB55D1F907F4964 THE0M4N14
514,322,017 *34868240EB0B7916A2CFF7A08AFF9EDD2DBF5107 the160hand1601981
514,322,018 *348CBDE71A49B2867783DF8C3768242C29BC4A1F the $20,000 battle (live at the fight klub)
514,322,019 *3483450CBF1897B807A4FEBA8A7A4770582EF56A the37thframe.orgwww
514,322,020 *34806D0EA17D3D5EDEA325BA03D7A7A4185AA698 theabbott5
514,322,021 *34818F8602B1827238718EDD005E7290DBB5C82F theabbott89
514,322,022 *348E9E901949EB7051A84DA7C5AADDBEA369A7E9 theabramson
514,322,023 *3485BDCE35E1E322CD875AA6B58E985866AF3487 theached
514,322,024 *34840DB4AA991A1592E7653C39BA169F46BCF16D theacropolis03
514,322,025 *348AE201F25677680E70809D197184628F050A64 theAcura1994
514,322,026 *3487304D4E8A9A9D35D68D03B359F9681F857E0E Theades3
514,322,027 *3483CD51FE690D59DAED839D465ECEC821923E89 theadg2003
514,322,028 *34819E7941BD8326C12F3F78A483B82F0A3F8D3A theAdrian80
514,322,029 *34868BA5FE5FADE4C5C616E5102D2F9CAA6D1346 theAfrica97
514,322,030 *3483432A31C4BA3DDDD95D76947118CCF7BA94DA thealtima54
514,322,031 *348B8A74212F223E69638FE9525AFFEEBD851AB6 theAMELIE1992
514,322,032 *34814072A3FCD16D13827F4C7E9C6B4F928F3719 theANACONDA51
514,322,033 *348FB2BA818CFDC83EA1A06AC39FB5237CB98B8C theAndre161
514,322,034 *3480CA12258E93807C68514736E835ADBFDD42AC theandrea185
514,322,035 *348D6C0285CB0EFEC3A96C9EEFD7A09281CA0200 theAnita48
514,322,036 *348732F42D9257850C566DEA406E09BD3A121C07 theannette64
514,322,037 *3481FADE1EB0E367A07EBE958862D423C98E7FCD theanniversaryedition(disc12)
514,322,038 *34870B26D23A173DB6A23FDC1F94F49EB6964AF8 The Answer to Your Problems?
514,322,039 *34860F93D2FC27DCACBBA2279F1B819A104A1BE6 THEANUTTER
514,322,040 *34862615906AE0D103047E575CEA9AAF87B94D81 theAPACHE!
514,322,041 *34838CAB94F1EC8BA981849443D3529B5D18F0DF theAPOLLO99
514,322,042 *348940B95C0D4C85B57D0CFF7BE313F1438C09BE theaquarius01
514,322,043 *348352CF9B9AA1AC0803AA86CBA4B3EA849BBF40 thearlwisnis3
514,322,044 *348D8A9ADA0971D47ECF25988D59D870E3FC4C47 theArnold1996
514,322,045 *34805B437EABB8892CC8A9077AD8E3319BB0A446 theAsdfgh2008
514,322,046 *34835FD8281D89BF4D00D27C6588B4CC0D2C2392 theAsdfjkl79
514,322,047 *34809B3214E94B2811027E1B1AD8A03F69B1853C theASHLEY169
514,322,048 *348014B3FF47A9C12CD7CE33FBC5C5C228A6A0FA Theaterdir
514,322,049 *348183CF6D601ECB84DDE0A90893BCB5969F05B5 the atheist
514,322,050 *348550CAB9C1DDDFDB9B3F2B1AA702DFF57B796A theatre3dallas.comwww
514,322,051 *348CB6F7FDCB65E08DE76462EFAB4A13995C7CF4 theatredoobies
514,322,052 *34854DAF13A7A3A3DD7E3441438C1C001A28F569 theatreeatme4
514,322,053 *348F7CF60A62B4A6F22B044ECA8DD48050DC836F Theatreen
514,322,054 *348C8444B3E2CCF247CAB34C550B71FEBF4E10B6 theatrelorraine4
514,322,055 *348973D53FA456DC6B4DF936EC87E267968662E4 theatrelyric
514,322,056 *348B0E519535329E75B1785913761EC930E145D3 ThéâtreOnLine
514,322,057 *3488FB19F4EAF4413F8E1D8626C3F35232993E18 theatrepiglet5
514,322,058 *34863CEE8CB5848A980B1B988048CF8D5D491E3D theatreronald7
514,322,059 *3485AD76E7CCE1A0F8DC51E1566556530FC0C528 theatresamanthas
514,322,060 *348C1AB7B627435A9F28D4CC1CB45096DE1D5C2A theatresasha4
514,322,061 *3482DF64097BB2CC6CF475487619D3A881F436CB theatre》,出版社:
514,322,062 *34857B46CDB8D3F33541D917759FDC9E357CFEBE theatricalrights.comwww
514,322,063 *348B1DF5F3A91F1F27FE99FAC9D9F9B036AFE409 theawaitedone
514,322,064 *348E681EA2DB67DB0F0844B5594C829FC0ACE4EF thebabygirl78
514,322,065 *348285E20417AE782A4F782AD94A0ACD819EC628 Thébách“
514,322,066 *3481EA0AFE4E3D89279410C2388AFE0C5212C891 theback2
514,322,067 *348E35A34BD25B67B6A2F7281670090EE630C2AD TheBalladOfMary'sCar
514,322,068 *348A80238DA118DBEE204E32ACD7AA895F1A9E21 The Ballad of Railroad Jerk
514,322,069 *348BECC54C6CF5B4122ACFB6B3E963F98463B803 thebarney!
514,322,070 *348708B0000513B356C16EC29688925436362A80 THEBASELSCHOOLOFDESIGN
514,322,071 *3489996F3D83C5DBA8BD87A09EF16507A80911F1 thebavarianinn
514,322,072 *3485B00581CDF66DBBC5BFB61FEAAAC6B4876C98 thebbcsessions1971-73
514,322,073 *348EED641C5B7ADC1BD069BF8738DADAE23D6841 TheBeatGoesOn(feat.LindaLeeHopkins)(AntoineClamaranVocal)
514,322,074 *348C10A5F79D069F058895DD39CECC8E5D695D46 thebelleofchicago
514,322,075 *34897F518B9C692A331E21F6A7DD1349BFB0875B the bells of st. bebastian (nine)
514,322,076 *3489D380000E65765FC2F95777E4BF8288EAFB89 thebenoit17
514,322,077 *348088AD86AF5798E15DC36895E4F063CD50C82A theBEOWULF1992
514,322,078 *348CA2DF2C2AD118B07C68CD8284EAF8D936FB43 the best musicals... ever (disc 2)
514,322,079 *34873FA38B32780C8D6A0B9535FF72C41E8927B4 TheBestofChantal
514,322,080 *348B07EF70370CB57F916A81DD3ADAA8B5F14EC8 TheBestofHefner1996-2002
514,322,081 *348C3D76F63F7347C690216A1136928C4EBA1DEE the best of non-stop super eurobeat 1998 (y&co. side)
514,322,082 *3486B74E534737013556DE9401D56A4625523013 the best of... przeboje weselne. biesiada z bayer full
514,322,083 *348C362BC3C83A3ED17C8313CC280FCBB045E57A THEBESTOFROME
514,322,084 *348AD5E2EC167370B6F4616387D2309A7053D868 the best of trish (disc 1)
514,322,085 *348F2AB6519F9EADFAA2712C238AA71D772786B1 the best song i ever wrote
514,322,086 *3483BCD43A2E3E56CD455459F516B8C9ED199632 thebetty05
514,322,087 *3483ABADA327F7FD26A437E01ADF60D6DA7DF764 theBIGDOG90
514,322,088 *348F3D48BC2787D18A7203B07AC0B5F32BC82025 thebiggchese
514,322,089 *3482787E745DE36ABF4370B19E612C57FBACE660 TheBigLoungeScene
514,322,090 *348C7F9ACFFE145ABB138AAC1609DA6A797A6123 thebigred80
514,322,091 *348F92EE15FEDF92B8F895408E7DB476FAEF9309 theBILLY138
514,322,092 *3487040BD2507C4B0D69226A2B4B7148B3AC1BEE thebirdlanders
514,322,093 *34834C91B364C60FEAF452444EF9C56B367C5463 theBITTER123
514,322,094 *3483A4A735E275868DC638E616A5ED33F104AE02 THEBLOCKATTAHOE
514,322,095 *3483A97D669A9D8AAEA33E728E1A2AD98CC54239 theBLOOD1985
514,322,096 *348BC0B86B375502C2BE246C7343CE4740E6D553 theblood2002
514,322,097 *3483F6FFEEACBED89ADDA8C0F6819840D16A2673 TheBlueBar,Volume2(disc3)
514,322,098 *348B9F9310F899AD2216A0FF11FB0E9497EF2A66 the Blues, Part 1
514,322,099 *348E48B5F6B4924C5A214A44CCCFB7D53A438868 theBOB03
514,322,100 *34804A7EDD80C76E9F20DFCB0977C0E2E056B7A4 THEBOGOTACITYGUIDE
514,322,101 *3488CD0AFBC3024BC51FDDD2126F00491287F12A theBogus63
514,322,102 *348CED7D02827DA0D0C14FF996D81FA9838D5DDA theboldandthebald&thesexmachine
514,322,103 *3481CA67021CE8A9A0550C9E030097DA42230C07 the bold benjamin
514,322,104 *34834322715F37B67260A614357F2034B194B883 thebollywoodactress
514,322,105 *3489C5FE7BDCD08587AE3B3101F9AABD70CC4BB4 THEBOOKREVIEWINDIA
514,322,106 *3483DA7EEF63B384C5D904E1B9C9B1C3EA4F9F48 TheBoozeandtheDrugs
514,322,107 *348EF9262970C9353CFF2AFAADBE52D1F8FD8700 thebossbobbying
514,322,108 *348E61EC2988E91D083336DC379165E9EEBB15A9 the boss (kenlou mix)
514,322,109 *34828168A836F354F3BB827F8E82BD265193525E thebossolivier1
514,322,110 *348D9EDDC2D509AA933BA1022180D38C4D8F0C85 thebosspasswor5
514,322,111 *34824695E420543F8E3A2E417DF7062A1D65921E thebossstargate7
514,322,112 *3489D4FC7343C1721B06DA50A0589C4912841771 theboxshut6
514,322,113 *34838CD2A8210FF2ECB27CCC114FAED9E44127B9 TheBoyintheFancySuit
514,322,114 *348923101A1EE588E4089ED190524865BF20E7FE theboyonahorse
514,322,115 *348F9F806AD3B865C88223B72EA50801417B66F1 theBRIGHT1988
514,322,116 *348A646CF96DB999BD0755306C0B2EBD0F5E3320 theBRIGHT31
514,322,117 *348160D21D5E754FC795FEE28F00ACE4EAB6E96B The Brighter Side (1)
514,322,118 *34883C0B133318A1713C33762F6FEA3B7276CD33 thebritain1986
514,322,119 *348B673D5155CB4AB39D56EDAAF645C8F9290A6F theBROADWAY2000
514,322,120 *3487139BAA18C1CB52770DDF54FAF36E4F6C13BE thebugbsw8
514,322,121 *34851504042124DD4CBCD2DA518FFA5863621735 the buried heart project
514,322,122 *3483CE4F11A41E807BB4D8F5EBEF328FCBA6F5DB theburningtwillight(striid)
514,322,123 *34889BC31344BE01C65FB44B0D61566689CB9410 The Business of Love
514,322,124 *34848EEDC47BD9A6C5B99520F6D43758B9D83D50 thebutthead20
514,322,125 *348EA10B6C898D9E98C125D3885E5D37AF5C3692 [email protected]
514,322,126 *34816302294EA47CD9172BC678E2C7EAE600C015 thecanada01
514,322,127 *3487208F54FEC395C68695051822054F39022810 theCANNON78
514,322,128 *34849FADFC3B19906AF9A7530EBD25607087D6C0 theCanucks70
514,322,129 *3488C2C329C640C0136FD7C63AE20267E7516829 theCapricorn
514,322,130 *348887A2444C77C1E23E17F188AAC3B8EC6CD514 theCAROLINA1
514,322,131 *348D037534137474F3A6F754DF75FFF1F1B18F01 thecasio86
514,322,132 *3480FE42DDEDAA12040E25F25C7249D4328784BB theCELICA66
514,322,133 *3480B6A5CE3846B0B523D1DBEAB7BC8B42B83529 theCenter27
514,322,134 *34854880039DD3C3185BC24CC3582B8FDA7A7224 thecenter94
514,322,135 *34860771BF06FE05F2A7590DC6BCD980D0F2A242 THE-CENTURY-MAKERS
514,322,136 *34876D42811947A561BF23E2E70456DBFFA0758B theChameleon55
514,322,137 *3481D7A319F287D8FE2577B064D8ADA5BD345FB0 TheCharmedOne
514,322,138 *348BCB238D48D3465C9A1DDDB56E04A1029463F2 theCHERYL36
514,322,139 *3481E25398FC1D4C4056D5A5414F8C7D2FFF54F4 theChevy32
514,322,140 *3489498ABCAD8D3DBD39768A7792D72C1FE9E924 theChina58
514,322,141 *348B75D3160CC8DD2C86E4CAD8D7814C9938C917 theChloe34
514,322,142 *348B3E5F8CFFF9CD0172DFC64E10210F7EABFA93 theChloe73
514,322,143 *3489C6CCCFA38B73E861074832660C8612788AF3 thechner
514,322,144 *348ABD08CBEE74F6E3CE3F7943FD5163D91FEB04 The Chopin Collection (feat. piano: Arthur Rubinstein) (disc 8)
514,322,145 *3482F6A0A1816F6F98F4016E4D046171FA2CED57 theCHRISTIAN1990
514,322,146 *34885CAFFAC6BC79625DBDB667A9951A66B0A14F theclas5
514,322,147 *34815539E884B5D83A0FEF13E98B33FE5D8D511C theclass2001
514,322,148 *348CD168FFD4888AC1A0DBBF27A129CA9C02AF94 theclayton-hamiltonjazzorchestra
514,322,149 *3486B59A83B0986B7D2AF978B00F062C9AE97CB0 the clinton presidency
514,322,150 *348A9E94FA6CF7C5A58C8073CF72E4DCAD00AC28 theclock69
514,322,151 *3486FDDFEB9A963B4857F2669A7B253386E629C6 thecloserigettoyou(feat.luthervandross)
514,322,152 *34825B524EDF46697F508AD141DE26B457918BFD theCOBRA1992
514,322,153 *34861B6EA1DBF73FE676F72006FB4D82823C3779 theCOCO21
514,322,154 *3484D40C0856F0104431FDCE43731DCA9322D49B theColorado06
514,322,155 *348720D6DA54B705A95A8B289B68DD085ACB5BD1 thecoltrane58
514,322,156 *3482605BE33711674A17F63E77C3052A949EDFBF THECOMMITMENT
514,322,157 *3482B63FA32709EF5364EA511B237603F416CEDA thecommodores
514,322,158 *348F04BD131E95FDCB05882BFFB6E2E8DBDC38D6 The Complete Liberty Recordings (disc 2)
514,322,159 *3480BA483D50AFAA733B4325C5BBE65DAE379CAF thecomputershow.com
514,322,160 *348CA62FDFE655C28928A913695F96E7A58356AF the-cool-kids-la-leakers-tacklebox-dropping-memorial-day
514,322,161 *3486B63BA2FDED077CFC2F1D09B9EF92A33423A1 theCOPPER49
514,322,162 *348E2F91F010CAB89A69F16F1582D8450E36F0EF The Cops Are Comin'
514,322,163 *3481025DDD595A7520813F1DADA920CEA1123B91 thecordelia89
514,322,164 *3483FE53C05FD680CAB43257DD67EA95868EA706 thecordovatimes
514,322,165 *348FC81D5C59818237CCA349C9E227A6FB3580E0 theCORWIN6
514,322,166 *34841775A0ADAAB5A110D61DBD2DF2B0AF30B1EC theCOUGAR39
514,322,167 *3484D0667BA546EC48949B1B09B3019229E43C1E thecourtney!
514,322,168 *34894E37997988D27720186061B5619351FFAEF7 THECOWSAYSMOO2007
514,322,169 *3488D683D40F4D64022E9E9F7D34E5EE1F246B54 thecoyote!
514,322,170 *34837D0F719489F8739ED767A6CCEC7B067D871D the creatures of prometheus: act i: overture
514,322,171 *348385C762981B9B2F5B29087B72FA3798F8B774 The Creepy EP
514,322,172 *3484C6F1CB44F34CB4349534DE43BB95061F88FF thecricket0
514,322,173 *348063CEFFF75204B09597A4C8A363238536A141 theCrowley68
514,322,174 *348AB371E5538FCED9AB4E3C0F0E95F2E7D12BE8 the croydon s.d.a. gospel choir
514,322,175 *34813A21AC28653C3E68D687263272A5B71B7437 The Cry of the Wild Goose / Lady from Laramie
514,322,176 *34891AFFD8E2DAD3283003D51BFC8C15705D50A0 thecsp2
514,322,177 *3486DB9E774DC72114C1D439EBCDA961E7630BAA thecurrent1988
514,322,178 *348440269805E3278870BB61F68982CB22012230 TheDaleks'MasterPlan5:CounterPlot
514,322,179 *348680A20679817FCEBD284095B45C53F76C6B7D The Dame in Red
514,322,180 *348D6E6E3684CFC7E667874920F658A050004F75 theDAMMIT54
514,322,181 *348CF4F8C2D46A20DE4A31EBF8F5B3ADCA827F1C theDana29
514,322,182 *348B51D50E325E96DF760731F24590DBC89FB370 thedanceofthesugarplumfairy(russia)
514,322,183 *3488E45DF4C6EB005EBE0DAE035927895C7CEF34 thedanebsw4
514,322,184 *348202711718EDFDEF8E013393F2DA4EF8E914DA theDaniel116
514,322,185 *3485813D508545873D977EDBCD7C1118D8A219C8 The Darker Sequence
514,322,186 *348D9B3F74B5BF1349A3D9BCE535B2523F59EED6 THE-DARK-LURKING
514,322,187 *3483A2754C31B19F1543D4626F03B3E79845F92A thedarkstar1989
514,322,188 *3484C2F2E5FA8FACCF5F19C1730D63B68B3EF623 theDARKSTAR47
514,322,189 *348EADBE0C6DB98268FDAD414B1E436617E5D1B0 theDavid77
514,322,190 *348D14A26F052E300C535D1F0E99F3D25BF97C1D theDAWN41
514,322,191 *348BDCA723A3AF956FDD3378B299B0427A5D75F9 The Dawn of Hope
514,322,192 *3489BE2457627A23117F9408CCE9464F3C9E141D the day my pad went mad (radio 1 live version)
514,322,193 *34886B343056DEDD61F01FB98094E11542D158BA theDeath
514,322,194 *348CD7B1F84CAE45D657B4784BDC61B2DBAB079F THE-DECEIVERS
514,322,195 *3485466CF757C8CA4FE725F4DDE672967D23DBAD theDef62
514,322,196 *3486A742A684B581A04E50ED67995A9212EF3B21 The Defeat of Satan
514,322,197 *348854E9C9EFDF58004E7141967546AAB3A62859 theDenis52
514,322,198 *3485CA020DE054965831BF787495ED841DF7BA5C thedependencies
514,322,199 *348855C72FCA4D188BA7553D33810658340C947D thedetailsofthes
514,322,200 *348CDFEC0F08320664BF966F741D1A36813CB9FC the detroit spinners
514,322,201 *348615FA44484AB3F17AF3697070DC85EDA536F8 theDianne84
514,322,202 *348FDF5BE6B1E1D2C4344A8FE62248F6C550AC38 theDickens26
514,322,203 *3487B458CC89D0C392CF897893E26701B0E7150C TheDigiPix
514,322,204 *34880C8C9C545FDBB233A54C9523207BBCAFD696 thedissuade
514,322,205 *348305585EFBFE957270BCF5A2F8B1FD9F28A420 Thedlog
514,322,206 *348BA718830A2697C6660DCDDF208B73285A7731 TheDoll'sDance
514,322,207 *34861501E383A200A64FFAEBBE7EB55633C1D4A5 theDOOGIE48
514,322,208 *3489ED5F5B06CCDF1DC522563874FC7D6C4F041B theDoors19
514,322,209 *3486FEDEB4404B747004E664BC07CB859F754935 thedublinreel/thewindthatshakesthebarley
514,322,210 *348A9189690D943BC1C6AA2567D8404348F73F47 theduckshoot
514,322,211 *348BF89507777D385C3196D54C07340D91046A81 The Dying of the Light
514,322,212 *348955CC068809634D07AE6AB766416A2A3A8B85 theeditor2006
514,322,213 *348DD66C792653D7DEA93F9E1DB7FE23F8B1DCE5 theelizabeth33
514,322,214 *34824D06869A92D4A328FCD067D45317C6FF6F5D [email protected]
514,322,215 *3481531056EF4ED2846446BE18D4B7A38EFC729E theELVIS73
514,322,216 *3481C32743F2829EA4D4871A139C4ABA4E387770 TheEmptySkies
514,322,217 *348C46EF9CF2AE2E8E8052E889B32AA046110A04 The End (Din 3)
514,322,218 *348799FEFA8DF9DAA11D5C58FB8DDED2F1F35328 TheEndOfEndz
514,322,219 *3489AF837CD3CCAF190953AB64226B9968677A59 TheEndoftheBeauty
514,322,220 *348BB0D8698D3D83FCBF577DFDA15A0E8BDE9CF0 The End of the End
514,322,221 *3483C44368A134E4F16F961C1D2A3B6779DEA1F2 TheEnsentators
514,322,222 *348647A3FF8984A739B9CDF3EF1DFF1A42B4041F Theeric8
514,322,223 *3483D3FA94087350FF09E64C7DC01B851FF48552 the ethereal plane
514,322,224 *3483D5A14268B8B159E5CDDBC5F9AFA023852847 theEtoile53
514,322,225 *348E940757D6D1F40DC361D2559C2B00F7A06787 The Evolution of Flight
514,322,226 *348A8985A493D806BFA8784249B9BC76E5719B47 the exploding pinto
514,322,227 *348CAAA898A5A34849E17814AEB27FCD5E73E95D theEYAL62
514,322,228 *348E649E36BF403984EC82D4AEE1129D5AF1C7E6 the fab five inc.
514,322,229 *3482016DF26A87D6C2D00CB8B7E3CDEE0941B3E7 thefairyqueen,z629:act1,iv.secondmusic,rondeau
514,322,230 *348413EEA6B8B1CE8856E13A58FEEC7A1F008352 the fairy ring (2)
514,322,231 *3480BD86E3F391D9BEB09228CBD16954A2BAAE00 thefaunaandtheflora
514,322,232 *348C5E9410B81401A7FC5DEAC9C2FDF51ABD9868 theFearless31
514,322,233 *3480E74B828FF38197C85AA55B82C033B8DA08B1 thefeech
514,322,234 *3486A0572E2AF262072EAAC3A23248938FA06082 theFERRET83
514,322,235 *3480D806F4DFC5B7CA203ED5329586E31557702B TheFieldsofLove(instrumentalmix)(feat.York)
514,322,236 *34872C0A918C8870791269C9D364EB471A1F3518 the fifth door
514,322,237 *348CC3361F7D48D848678B6AF8C01CD35C69A782 thefifthpoweroftwing
514,322,238 *348916CD343E0CFB2C58B7EAAC71F12444A0559D TheFinalStand
514,322,239 *348A98247CA6385442D8D8C05023B0C8E4C2A8BC The Fires of Ork 2
514,322,240 *348AF03EFFE3A52CCCBA4E7373396F8790A67C67 thefirsttwin1
514,322,241 *348434CFE597EF4783E55B53E774A464DE7FA39C TheFistandtheLaurels(disc2)
514,322,242 *3484EC2B2C50CAB372C4FE66A04B089211FD24A0 theflamenewbern.comtheflamenewbern
514,322,243 *348AEBE553FF9B582829E59361C4645E3FE7380B theflowerpot72
514,322,244 *348E6FAF8C42417D43B6EA991222D19A90FC152B theFluffy24
514,322,245 *348B52DF4B7907DA0EA4AFBA8174820C5DB4D213 theFortune67
514,322,246 *34861B16FB999C41956E7C9A99DE275AAE2AB3C3 theForward
514,322,247 *34801B6523493DA5633CD9DB20002301536B1C4F The Foulest, Part 1
514,322,248 *3486D672FC079F0852CB05580E61AD1DE02333C7 TheFourthRing'sWiththeWind
514,322,249 *34811F083037C8DE9F0C9583B4CE70B32BF1D274 thefrancesco45
514,322,250 *348811911638F042DE05BF1EAD9389EC8B643AD3 theFranka75
514,322,251 *3487DF8AC2E8B1E7A5EE131B68C330012FCF8F0E THEFRANTIC
514,322,252 *3488C201CCF5F3FBA29C3D16CBDCBF4DA36806F1 the french mademoiselle
514,322,253 *3487F6B84CF8DCF2BA651C212F7FB2037CECC83A thefriendofmine
514,322,254 *348FB7D3E381F2D372EF3E1B2610F365C451036C thefront24255
514,322,255 *348E2ED7906DB64A708CCF07DDD8F6EEBE12941F thefrustrationsofdealingwiththesociallyinept
514,322,256 *3483CA6F92E13B5A683C19F543D162376CD56106 THEFTS4
514,322,257 *3488C1F128EA18772DEED589C00FDEB87AF9B421 theFUCKER70
514,322,258 *3485B1723AE1FC0D7B85EBD06311BE3520583C99 theFuckYou6
514,322,259 *348B549B7D8970EF28EFFF620CE851DC40AA41FE theFUN32
514,322,260 *3487F76C7DB6D0789ADF648A960662C418E5B701 thefunbsw1
514,322,261 *348229537D38A48DB3B21B19C9DBE70DE670BDE9 TheFuture'sNothingNew
514,322,262 *3481F710A8DE109B3528366FFED1626F30D387E5 TheGabba
514,322,263 *3481CA048AD4AB667E2841077E0FCE77067839CF theGaelic95
514,322,264 *3489FFE0819A2A21126E833404CF1E03E9C61188 theGALILEO31
514,322,265 *348F82EF1DD25649DCDA8D919B30ED51FD33FA98 theGANDALF55
514,322,266 *3487004CFF6B39834D6D9EDED28D30D3E19BC750 theGary1996
514,322,267 *34870F0FE74559C4D2B1C163897207503804797F theGASTON01
514,322,268 *34894E5A23BAACD7908F8DCC83AD058D44283252 theGerald51
514,322,269 *348F15A7F6CEB3947A97D353860A16532ED800B1 Thegift6
514,322,270 *348418F078A4EDF312C8C970E9DFA154A76DD44B thegilbert73
514,322,271 *3489F1C94ADFDF98DFF92B7AF65212BE9D2B1BD5 thegilgamesh98
514,322,272 *348151BE2170275C63881E9EB570895BDAB93BEF theginger30
514,322,273 *34849368E035DF69C953A2C5D69270CB5C6B0631 The Girl I Find Stays on My Mind
514,322,274 *348D63E7F4BD8BF418ED217AF2ED19D330BC605A thegirlwiththewanderingeye
514,322,275 *3488A506770FE5BD8DC61FF57C746E16D0FC76CA The Glory of Kings
514,322,276 *348B2D7C6E65055480AA15B4EAEBE53A2FDCD22C Thegnes1
514,322,277 *34853138F4D5E8CE090F03BC55750DDB80102AE2 theGoblin72
514,322,278 *34853D1AA9E99898D424F1AD5F9745DFE062BAA8 The gods help them that help themselves" [[Aesop]]
514,322,279 *348288A1A1988D1C53D7D9BDE3E3000BB8A7C63E thegodzi
514,322,280 *348CCE108BD6F450C80D2F0AFB21D4571C853064 TheGoldenCollection(disc2)
514,322,281 *348A462A6EAF0F9D41463D5E71AA2846C72FCC6D THEGOLDFOLD
514,322,282 *348DD5F2CB2101EF617E7D1872E536A27BB2D8F1 theGOLLUM07
514,322,283 *3481F7AAFEC6A7F044B5B5CBB71CCE4D29F6B13D thegoodsoldier(live,2007-08-16:salzburg,austria)
514,322,284 *34839788F98E959BA0F703E915BB06C54737107C The Grand Ideal
514,322,285 *3482646F5E669D565944969CB410638AE504D157 [email protected]
514,322,286 *348A51FC767FD5F4FB50BB8F8CC5773D4B2B4C03 the great defender
514,322,287 *34834834836A3938CCC76B268BBD0832652E134A thegreatdeltabling
514,322,288 *348A36E646FF9188322B9BE05EFB9DE317FEC95C thegreatdemigod
514,322,289 *3481CF9ECA3711B9E3BD66AF029509AC2398FCC8 the greatest classical hits (disc 10)
514,322,290 *3485F462210EFABC7693A30F2E5A558D451762B8 thegreatestsongintheworld
514,322,291 *34859A246E0815D0E51F5B367ABA56FDC91BBCE8 theGREMLIN52
514,322,292 *348207E2EFDC99FB38A8F5250CF370C038EB3EEE the grip of parallel
514,322,293 *348AF90169DC6998B96E047EC6A895A0F5D06E67 theGustavo20
514,322,294 *34879E5B39B2B7CF175FADABD3B6130639D032A5 theGUSTAVO78
514,322,295 *34878A773D0D3BA7871AC7F665BFCA17FB1E2E3C the gypsy trio
514,322,296 *348517AABF7C6B988AD968790303C62C35171144 theHarley65
514,322,297 *3480E2232AADEE0A7EC91F606DE1A08015748FAA [email protected]
514,322,298 *3485CCF9867BCDDC81DEB8DC139A8934F29EBA00 thehavok
514,322,299 *348D6D8B1ED64438DA52983F7076E1F4870BC9CB thehealingfoundation.orgwww
514,322,300 *348C3447841908A3365A0038A411798F491D94EB thehector2
514,322,301 *3488DD38FD49921C6ABD516C580743513DE06D0E TheHelldriver
514,322,302 *3485B52194472733F90C703FF07684146B14B320 theherbbar
514,322,303 *3483D7985FA25E6B4FEB335C250BE8C4BAA41612 thehilda2010
514,322,304 *3484F457ADC938D06A3D768492B9E8288B825ABD The Honeycomb
514,322,305 *3486955C191490E12356E7E231FD0E4FBA9CC0B8 the honey trip
514,322,306 *34813003A811AF35DC9E51C3834D4128450E82AC theHORNET27
514,322,307 *348828357E7F8CCB2FBA7D8F9A2BEA7A0CC4E166 thehuntforredoctober
514,322,308 *3487D63493D960AFFF297565DCB62465BFB19040 THEIKOS
514,322,309 *3480BA6C7D8A46BA4276C8F0ACB76841B6BB58CE theiloveyou119
514,322,310 *348BD25C34608ED868F887FFD54EB977A519AFF5 theimagery
514,322,311 *348DDE443D6C7C8B9F2F22C14220506F1B282277 theimports1
514,322,312 *34887A7F3D400C2B7CA6EDEA87DCFF40006C50AE theindianrunner
514,322,313 *3489D05C5267D4409906024C0AD28A7FDBF57C43 theindividuallegend(disc2)
514,322,314 *3480E39C878F87461749CBD46F509CA5F7524E1B [email protected]
514,322,315 *348E3BB4D96CD69347A3EB136F9B6DF8BD486FCF [email protected]
514,322,316 *348DD1CA83E5A2AC66C2927E428B6344111D4E7B the Inquisition
514,322,317 *34828EDAF68E4D02991DA0ECAA17DA55C5850C64 theinsite
514,322,318 *3481D69A3104605DD4CC89C6306BFCAE3051A734 the introductory
514,322,319 *34824D0E2A9F8203A0643E15ABA75A8FD81113FB theirmeli61
514,322,320 *348CF97BAC38FDA0D7CE599C8BF0F76003F6360D the-ironworks
514,322,321 *34888E6DF7310334BA94A7D77D3CB359D4F341CF TheIrresponsibles
514,322,322 *348E184814B73585F128C0456CA0A527F06988EC THEIRSENS
514,322,323 *3482AA57F4B32CA496AEAAF0195EEE24217062C0 TheirSpiritualLeader
514,322,324 *348C95E61788FE582DEE3FAB5DDC7C6403920314 theisba9
514,322,325 *348DDD3180807BE4057F25497AE4FAE7040C4430 theisogroup
514,322,326 *348F95967BC4DD3C6F67BF7CF490FBEC22F84AA2 The Israelites (Remix) - With Desmond Decker
514,322,327 *34842BE81C17DBBD6F2BFABA563EC2DACC6B61E3 THEISSESN
514,322,328 *348DFF7A3BD8A23C3537B336FDD27C5EC0D7A894 Theistna8
514,322,329 *34849D294D80908D5496A2B822D71D503E097176 thejaztroboogie
514,322,330 *348A867D444B5C739A324C5B825E8681519AD238 theJeffrey666
514,322,331 *348650F7EB31F563C45EF6EEC83C65837871B219 thejeremy18
514,322,332 *348FD24F4212156759AF80E9D3919949AD86297F theJERRY85
514,322,333 *34811931B553F09CE76D3C86A3FE3B9EFE4EDF5F thejesus11986
514,322,334 *34861697973213E44EB5A3FD496EBBCF6AE422CC theJethro54
514,322,335 *348908F09C6FB54DFC2C60149FA7584C8F3912EE theJewels
514,322,336 *348446631354EE3DF65873AEE20F1C5F8E85AC80 theJKL12332
514,322,337 *348C06CDEB6BB552FB722E2C36FDAF31F2C8B6A7 theJohn69
514,322,338 *3481B410A07426AE42CE724E4E65B8449BF6FB75 theJohnson05
514,322,339 *3480B4A73B8D3D6379B639B01460FF19090BD9D9 theJONATHAN61
514,322,340 *3483625FAF6DDCDBFEECAB72C49500065E195BE0 THEJOQR
514,322,341 *348EAF463A81651510D188AC456A7086FAFC13C1 theJordie31
514,322,342 *348178720E261CBD73D49633C19F870576F17B52 theJOSHUA1992
514,322,343 *348076499CB7393749C14B0D8777EFFE095DEBB5 TheJourneyBegins...
514,322,344 *348D89909113F28A89496D8B3C3FA66A7D58CE7E theJoyce2010
514,322,345 *348C36C7B39FE4C87DC071C3E9483B26BE360722 theJSBach48
514,322,346 *348A86B36C9E960DB67AF39E24B996B6A007ACBB Thejulie3
514,322,347 *348340F379B11D9041A97E22BFF6737B5F2AB14D theJUSTICE36
514,322,348 *34810206892B7DC718F0B1B5AB5EF3A15F201911 thekaterina2001
514,322,349 *34825503AF22D2ADC1563D20A8C8C52BF01D2FD8 theKATHLEEN40
514,322,350 *3481D5E9A84C976148EEE3DC5D26ABDBFB3DBBC7 thekingbob4
514,322,351 *348C1CD4F98A25F80AF7919C6DA33C900F5E32AB thekingcaptains
514,322,352 *3486FED6BE10B92CA094357DBB48C11EF2991002 thekingfriends2
514,322,353 *3486412203C6E63AB5DEA7135D78908F791FE5EC thekinglindsay3
514,322,354 *3480CE574E2024DE5774F4EC7B12CB2A5AA6F50B thekingofnaples8
514,322,355 *348B27F90A96B620AD20030D5748BD03EF069E9C THEKINGOPEN
514,322,356 *3484FC98DAA8352255AF8ECDA3AF20CC5DD03339 thekingporter7
514,322,357 *3487E624D3F1E38E3C988276FFC4FAC699C83782 thekingsarah9
514,322,358 *34842014B3F8E8223BA20FDFFCA2D05407C43F90 thekingsmile6
514,322,359 *348AB4792D67541C94B7104419D4001EEF895F91 thekingstriders
514,322,360 *34859136DC8E65E4C1C4A5E233DBD868B8E83028 theKissme71
514,322,361 *348038B4FEA2A973D5BAB43169CC186575BDD7F5 theknetadmin
514,322,362 *3488CCDDCE30CA33CD691F9F096C670370D7CD68 thekolvir
514,322,363 *3488E268BAB502AC128622C249C1B94A499D1134 The Kwanzaa Song
514,322,364 *3485F33ABD6888E60B2FB62504F53D42D1909B99 theLacrosse14
514,322,365 *34882194A9F10F3D17B18B7A86A1AE176AF99FFF the last day
514,322,366 *34808FC6E70AC2B1550BE9D5C213DFED1AE8E76E thelastofthefew
514,322,367 *348CF57FCC1E7D609E2FFFE898CEF909C777A2FB The Late Marilyn (maxi mix)
514,322,368 *348318F4EC4D61297D678B5312241345E5912739 The Laughing Light
514,322,369 *348A5A9CCBD47162B822FE01F34A511222D67C09 TheLaunderettes
514,322,370 *3488D35816204BCC3E0B3BED5CCAD72C1D54BAFC thelaurie5
514,322,371 *348FDAC633E7F7EA45D905B01919161CF0C169FF THE-LEADING-MEN-BRIANS-SONG
514,322,372 *3485FDEE4B94F9A9A20C176AF1D31CDF01D4146F The Least Said
514,322,373 *34877881A63B0DA2524645657E4F1F0C35266D69 theleblanc13
514,322,374 *3480824BEF105B813E04D31ACD79B0C1C2B9695C theLegend
514,322,375 *34832CC2B742B2C6A7B4D0B8FAB561C9978B8A04 theLegend31
514,322,376 *348E116D3D050428E79B428556650737CE3B7D16 thelersas3
514,322,377 *348F69149CC9A1B015977D8D1816D3CDE096F27C theLETMEIN1990
514,322,378 *348CFF5958132DF8F88B4C8D3C038C15844EBAC6 [email protected]
514,322,379 *348923758D30D26B1216E6B071C32DE7FBC6CC50 the-life-of-st-cecilia-of-rome-saint-virgin-martyr-of-the-catholic-church
514,322,380 *3487BC200BB37FB045BDFD96B2CAA9B1332C55CE theLIGHT1
514,322,381 *34839D2F69C77CC4B6E608541BCA76C4F3B4629C THE-LIST-SPORTSMAILS-FOOTBALLS-BIGGEST-TRAITORS
514,322,382 *348690B5C24C3C6E9DBCCC55F37D68E78CFFBB8A TheLit
514,322,383 *3486E8488E3984C3DC1E2A39102557227A97F491 theLizzy1997
514,322,384 *348C5FE855CD8425465E37615DFF0EE592D3BFFE thelloyd46
514,322,385 *3484F34ADBF0D9519441E16A160F29ED378F83A5 thelluap7
514,322,386 *3483C1DD6E4F51BB387292B0572CEB27B6708822 thellungiana
514,322,387 *3482D8A7C8476B2473B0B79AD858138B6531171F thelmë
514,322,388 *3481B554CA93E46004FD8B537AE504A58404E006 thelocalvendor
514,322,389 *348F8C4FA6222647C39B8C9847DE3A275731F425 theLogical63
514,322,390 *348D3800B4F007087B4FDBE6744A373AD63B3649 theloneliestlinkinaverystrangechain(disc2)
514,322,391 *348C60B1FB0AB65A2A5B959E5519BF107F2089AF theLonestar666
514,322,392 *34894C8ACBAC2ECCB130DF556CE3FA2A1518C679 thelongroadtonhatrang
514,322,393 *348246C0169FCEA1D642A8EF2507DFDD98BA9719 TheLostMonitorMixesEP,Volume1
514,322,394 *348E0F0D84ED993B8CE44B89E8DE48FB196461D3 THELOVEGODS
514,322,395 *348FE69B046A829D0B6EF441BA98CB12C49F95B3 thelovers666
514,322,396 *348A5073344626C6A902B0122A7719CB7FD21D79 The Lucky
514,322,397 *34836C9618E0FB91C5E6DBCF70178309FA3F66F5 theLynn18
514,322,398 *3486F2D18549F516FAAD540C608673F216AA06FC themacintosh1997
514,322,399 *3486FB2504D3FF09CE0D56FECF9270EE222F27F4 theMadison11
514,322,400 *348824AE4AB18266B588CC74A20DDABD7CF32DE8 theMagic45
514,322,401 *348F680D705C001D0C6FE75E5D52746DFB0D5131 theMalibu07
514,322,402 *34859A8010158854ED4547BDE4BE7F15556B3FA8 theMalthusian
514,322,403 *348AB6A17DAD3CF4A71819BE9BE018A48A11403B theman42
514,322,404 *3488E52A41534BCB6788DA46D4DAEEB908E163BF themanacura3
514,322,405 *3482DA4D4F9DBEEC8369BB966FD11821FF4DF946 themancinder6
514,322,406 *348B196BA15C8179C0D485356EF6C70B1D7F8ECD themanfozzies
514,322,407 *3487AF19BB2ABD5CF2A2DF8C112192C8D50ADC7D themanfromdawn
514,322,408 *3489CD5200148FBF3837F107DEC91A6CACD17566 themanhanson6
514,322,409 *3480A9727EB15C0B4D824CD959CD936582BAF13C themanis4
514,322,410 *3486E53E079CA3228CA271955D06E8B2484ABA37 themanjack9
514,322,411 *348105790F19C327E47129F2115B9A7DB7004A9F The Man of God
514,322,412 *34875BCE2CD15A0F166143D1D1747A43B5A217FD themanscorpion7
514,322,413 *3487C2D845A51950C00C09C5D56D5AD4CEFC915E theManson30
514,322,414 *34831DAB0A84BDB40BBC4A1E20FECBC230D83C35 TheMarchOfTheSiameseChildren
514,322,415 *348722C4F9B8AE53C6FA7E34A6D38C6C44E21A6D theMARGARET2010
514,322,416 *348497B5AC268B8389030230BF7F95F2BF568E92 themarley17
514,322,417 *34826E0786F72166AD18207B7D94D02FA5B27DBA themarshal3
514,322,418 *348721650AE79A514FA58FAA50092264B0E67A3F theMARSHALL84
514,322,419 *3482B892FF253C42463955F18D85FB6CDC0C353A themartijns
514,322,420 *348BEB6E87BD8E1522E57F70E691D2C770EEAFF1 themask5
514,322,421 *3486974C9B975F5D1D1D2995EDA6E304AF94629B thematas6
514,322,422 *3482FED99F601D4A56EAB17E84A5D45C8746FB97 thematicals4
514,322,423 *348C7D268523D700E23EE1355BF9A3B9B34E20A8 themaxime77
514,322,424 *348CE1B98FC6EA2467FCE0C5A098D225100C273C theMaxime99
514,322,425 *348AF9D0F9BF83AB0284820CBB7FB1D7C3844497 TheMeateaters
514,322,426 *348B83683304FC3BA455F7A1A45B48A7747473AD THEME'D
514,322,427 *34853FCC65D047ECDE7AC3C17C8F727F8F7ED3E0 themeekerhotel.comwww
514,322,428 *348DA4B30B1AE10834076E46FCD42BB2CF9158DA themefrom"2000"
514,322,429 *3487A115D8105692D83845CA17C9218BDC43218C themeister1993
514,322,430 *348BA84A838DA66A25460AC1AB7112A60ABD024A Themenakademien
514,322,431 *34810084EBAE276BF840FC3990219BE1CCA43003 themeofthesquirrel
514,322,432 *3487CB58D43C3120E33C2654CD1D04D6E05108B4 themepoems(medley)
514,322,433 *3489D3AF99F43655BA23AE2CF53210B2054E69CA themercenaryridesalone(intothesunset)
514,322,434 *3488FE8688D695F50ECB5BFFC7297B19CADC1E0F TheMercuryDanceBand
514,322,435 *348E027EBD4F08FC8374BC0BE243094BCF978E27 theMeteors
514,322,436 *348AF425743FFCFC03B5079F7C57895E2AC2F2EB Theme Varia And Rondo Pastorale
514,322,437 *3487638E1BE8661BE9D3BA75D7E23BC5CC68B5C8 themexico88
514,322,438 *3489518D9B07AF35EDC3E8341A30BD8514684C94 themichael36
514,322,439 *348033D7D40B843577DB10E34ECA5A3373F08372 themidnightkiss:thecaterpillar/missmonaghan's/themidnightkiss
514,322,440 *348C34251CB8A6899666829131758F599B143F2F The Mighty Fallen Rust in the Sun
514,322,441 *348FB8CED136A6EE25D61D25DA0FF5D427FC23C1 Themike4
514,322,442 *348CF03196D7ED1418956DAE43CA8D5F71F04B8A theMILLER33
514,322,443 *348E419925255D026424730FA019F872100AE36A theMILLIE40
514,322,444 *348A06D03F95AA113D6DF4256775A90EAD5B78DA theMinix
514,322,445 *3480BCF3E8F2768484F4C3F519F839FD7CA97977 theMiriam40
514,322,446 *348AFCCB93FC759AA8F1C1F05676489116B684E8 themodem18
514,322,447 *348E0C05F24FD69EB7C4F8A2A4962A2F97C69A7A the molester vs. the molested
514,322,448 *348F017463DF2E7F45DE74018CBC2AECF9111660 The Moodswing
514,322,449 *34866EFD05EEF426AD508E618DA12AA4A5ABECDD THEMORNINGJOLT
514,322,450 *3480E8F6FAB5574EF34B344A81D8C3739B27A3F4 theMOUSE63
514,322,451 *348392F356C8E770B083ADAE836AC8FDBD499EA1 themrbeer
514,322,452 *3483DA92D759FC288A895D28ECBD7C7061112A31 theMUFFIN1996
514,322,453 *34881B30DB1FF41F85F4EE80C90D64BAA69F22FE THE-MUZAK-OF-OUR-LIVES-JAZZ-IN-THE-FOREGROUND
514,322,454 *348CDAD16F08E69978FF35D690E530B0E3F9C6BF theMYLOVE62
514,322,455 *3484E6C4858B4E69BB2C11A7C03FAD08DF8968CD THENARROWPATH
514,322,456 *348DA88CB173D21ED9A45D0C4AD41814797CD426 thenascar666
514,322,457 *348C70864A0D1F0249A317F8E973A7602345112A then-ascendant
514,322,458 *348E9C76C39CD4404BFCE3B56F6D07F63E8E3C0D the naval treaty part 15
514,322,459 *348C897B78091A85F55AF980AE88E4215EB49439 theNebraska88
514,322,460 *348A97575F365A2F80F4519EAB69451A34C02D09 TheNeuromancer
514,322,461 *348D0DA277D651035A880B4501EBD8F7A2AC3B77 THENEVERWAR
514,322,462 *3489AD698367AFDA84ED859F2D69D941032FA99F The Neville Brothers and Les Freres Parents
514,322,463 *348645784D43FE2F0F1D5EADE3467E4B446BDB1E theNEW20
514,322,464 *3488234FAC77C6FC43F8AEE2A0ADA8F17C0B19E2 THEN-EXPECTED
514,322,465 *348628921F7F5262964A12C7D6044AC558947CE9 theNICARAO47
514,322,466 *34889E135CC282E15A60D344B576680F6D2F86FA theNichole48
514,322,467 *348930E063B918169B70A9F6D80815C8785F6FAA [email protected]
514,322,468 *34845BDD27649E30B574275979AF9FD6C1436183 Then,Now&Forever
514,322,469 *348364628555CE0765F910ABCBDF2D71F9B40A9D thenortherly
514,322,470 *3480D753A78FAE4E8762B1FF8DEE95C3FF0DBDE2 the norwegian sea (arc lab mix)
514,322,471 *348B2A91026D6C9F99E244463911ADAEB0CE8125 thenumber2showid3
514,322,472 *3482CB38CB2DF2141BFD7472BD22C28F91553339 theOAXACA49
514,322,473 *348D203BB14E273714D0A44D492530BE17D9FF8B Theobalda4
514,322,474 *348FC10D87D1D30E177E7927FEADF2EDB972390C theo.brevo
514,322,475 *348B0EBB8D3CC9CD63B5919938B1530440067D4A Theochristic7
514,322,476 *348C95E0E9922BBF6F2D0E0503ED4AF66F6094F5 Theoconservatives
514,322,477 *348DBA48334A3889651345E8559E5897F3FBF69B the odd church
514,322,478 *34806CF6EC40CB7F347B7B6541316E44B2348DB6 The Odd Shopper
514,322,479 *348712E877C98823405926BF1350356E92CB2215 Theodehert
514,322,480 *348ABD469A7F0DC238138C9BDD5C5015ED2A1C91 theodore.birdin
514,322,481 *3489E9145B2D91A087B693520E941E7D209C3337 theodore.bjornson
514,322,482 *348F431035ED655D60DE65E5DCCE8597786F8111 theodore.blicker
514,322,483 *348D5A4D8D097F45F5BBB51B47E928EC8C0DEDD6 theodore.cardillo
514,322,484 *348CF8AFEAE8A841C19B6AB7E68312EED420DFC8 theodorecoleman
514,322,485 *34850F0EF220AC14A32C03972774A1292AAEFED5 theodore.dattilio
514,322,486 *3487C8ED2271BD7631B411E190814C14681E8ED3 theodore.dunnagan
514,322,487 *3488421E8B46A41155E43BE023E8591A334EF8F5 theodore.ecoffey
514,322,488 *3482097DD2159BA73E4288A4EF7C66A72C1D83B3 theodore.gilmer
514,322,489 *34816F66DF8D12D7E94775D9053EE31463B52747 theodore.handwerk
514,322,490 *348FA8D28D79A5558654D86A627E506ABF53A003 theodore.jarry
514,322,491 *3488C6D89D7576BC7EAF4711BAFC5C4F5365AC52 theodore.ku
514,322,492 *348315182245BC83E0CB258EC26E97AA657341B6 theodore.langstraat
514,322,493 *34832D907E20F54A3CD5968045A0690A876071F1 theodore.morea
514,322,494 *3489EB6803209141C71DDC5F04FC65A89DD670E9 theodore.orellana
514,322,495 *34843B426A01FDEF69C5418B738D37247B26B2AD theodore.osmanski
514,322,496 *348A16F74564E0B6F43D900B9E3708EA5A313036 theodore.pitocco
514,322,497 *348C6D9E614505D33947184884296602A2D05B7C theodore.robers
514,322,498 *34855340B72497A6DBAD6BFBDFA0FD73F3D167DD theodore.romera
514,322,499 *348F8D13DFCE4F52397901C0E85B82A4F63ABB89 theodore.rotunda
514,322,500 *34870351C9AC50641785687537A6B6CB30635409 theodore.schnakenberg
514,322,501 *348E6E6E08D890593720FFEDFE3D9DEA7C046ED3 theodore.shininger
514,322,502 *34893804FF03EC92BD0C89759898AF94EE63A3BF theodore.stoodley
514,322,503 *348006BC5647390EB35232606068AA41F78459A3 theodore.summerville
514,322,504 *348F9E422945241909E416979B0AD590082C5DE8 theodore.wien
514,322,505 *34832BF7C3EBF016C878D76803ABD3CC7B5C28C4 theo.fritchman
514,322,506 *3488169CB78D0D34F6E22C26BF0C6912269C52AC theo.fulsom
514,322,507 *348BD881B17DE4CA6AF340C1A617AD0E01613C3F theo.gehret
514,322,508 *34890FF63BC2FA8DA56B9A115B916C81068D41B3 [email protected]
514,322,509 *3484AEAA85B896D2ADF7226FC472C74490C7517D theo.hegland
514,322,510 *348EF8C50854AC8200EEB6619E927E2677EAF1B8 theo.humpert
514,322,511 *348403A4CE5575A798D44BAD728839C1218198DA theo.husselbee
514,322,512 *348B2E3C5F1BDFB7F5E2B21F673DE3817C3147F8 theoillightcomeson4
514,322,513 *34857DF3C7C7C02AA1DCE056FB5F47DEC8220E99 theo.kimbrow
514,322,514 *3483B9B444EC790F8586D433BDB3621BBA292DF1 theo.kornrumpf
514,322,515 *3482243EB1F63BF988B61CA6A94EB794932F2B43 theo.kounthong
514,322,516 *3482E65A2B6DCE23ABF98C75ECA81381EF9C6EC6 theolahall
514,322,517 *348EFDE442B1E9B9831DC980D44D1E8001435168 theo.lapeyrouse
514,322,518 *348B2D621C206BCBEE5DF1355046587E9D4DA040 theoldcountry4
514,322,519 *348333E62EE699136C6D23CEB385E561508C246C theoldfoss
514,322,520 *348DDAFD5556940A8048B2EEC9897A6FAC5B7BBF theoldgentleman9
514,322,521 *348662D09AC221182F1A3C98687527C47B03E949 theOLIVIER2006
514,322,522 *3488E97F9EE8905B879253A9D2B8D088177D4A57 theOllie40
514,322,523 *3482B474721E331144D66D15DC52602D7CB84932 „Theological
514,322,524 *34809704944D69548A3CD0F167317423F52B965D theologischeProfessur
514,322,525 *348E182C28353198113C2EEFE0EAD52F6080F155 theologyto
514,322,526 *34871BF217DE9B1AA2FB703D416028C04B2346B8 theo.loveman
514,322,527 *348DBD24993DC839C5306A965F2334514E5921AE theo.michelfelder
514,322,528 *3484096246DEA5F9A5A91C74408D14FE2298EDC9 theo.molton
514,322,529 *348182BC47E7A39BE9FBC1720CD5823061B30110 theo.morishito
514,322,530 *34833D371E6487CD580DA4EEB9E635628F210E3A THEONE420
514,322,531 *3489D4B2671775CC3E3E55C32A718251A94B3D89 the one road
514,322,532 *34819F554761E3CBDD90A68CBC80158DEFDB4498 theonline1991
514,322,533 *34820DEC2C43545A807BF29F2BABD6857029F6E0 The Only Daddy That'll Walk the Line
514,322,534 *348490332BB1F3F6FBBEF705570E3D047C23B3B5 Theophel
514,322,535 *3487EE951678F9F41E2499C4457DED45701268EA theophiles7
514,322,536 *348F334FC77EDA14E994410097A58F6B4591838A theophilus dodoo
514,322,537 *3486E93D66E2A8064A8CCE40A492FFCECB536475 [email protected]
514,322,538 *348D207729B3C7D788135A942430A4A7EA04C96C theo.piggott
514,322,539 *3487DC5BC76095F446AC427C1D47AFA36430CF9A theOpmionBof
514,322,540 *348FDD25A7D154E41067637600FB300EA4970587 The Orchestra of Lithuanian Armed Force
514,322,541 *34884F97B20996D68AC05D75D190164B76EE63E3 theoretice2
514,322,542 *3481D59CBB10B2E8F44AC60281304EC9829D9038 theoreticist6
514,322,543 *348F4D046817CD2189787D1B18E95C6C1044C3A0 theoriesproof
514,322,544 *348DBF23E83D4571AF7E6B0DB63DEF84B22FAE0E the original 60s number 1s album
514,322,545 *348B641A3CB73F5559D1E3B50E306AEF57ED1C64 the original junglesound e.p. (disc 2)
514,322,546 *34805C7D37FB3787A82B278A1AA639C8D2A0CB32 THEORIST-EDUCATOR
514,322,547 *348A8FBD5F928D898FDF6D5C3A08A9A8423EF1BF theoryhoax
514,322,548 *348BC687361CECF5254A10443F929FA6C80BA95F theOscar28
514,322,549 *348A3964080509AB03450B991192F04254C0F05B Theotheoed
514,322,550 *3481979AC10DA43D9EF85A76F60779B00C636008 theotheronejam
514,322,551 *348B6CB2B87B43BFBCDCD6DB38CC11165A340DE0 theothersize.com
514,322,552 *348B104BC6617273D5A5B2A5574CDAEA1795620F Theotini
514,322,553 *34898EDF18D2D4E37CFFD96ADDAD2B34B94726C9 theo.twitty
514,322,554 *348F4F710A57B4BF5C0CEA60C49ED206B29EFE9F theo.wayment
514,322,555 *3487B5A3240F52A298D568430644E7DECDFBD161 thepajamamen
514,322,556 *3480E8165640EC5C57685F18B698404C792BAE8E thepanicartist
514,322,557 *348BCECDB726CD93D9EAB30C3DEFE2BB07C77E63 THE-PAPER-SCISSORS
514,322,558 *3484B0B579631401E4D4FBE23FA8797B215B4255 thePARADIGM31
514,322,559 *34892A3733745E2ED1B60CD92AF7141EE9263A15 thepaylas
514,322,560 *348C354A52491F606AF61F3810859E838217E787 thepeoplesmanifesto
514,322,561 *348D37D59080E9FC9B6A588A7DB4C0D0300B6AF4 thepepsi2001
514,322,562 *348E24281A3E8866B31A51E3B8E418CF4AD4A3C2 theperfectdate
514,322,563 *34841106721863EAEEAE9158E35E0E055AE137AB the perilous night, for prepared piano: no.4 (1948)
514,322,564 *34848A87E908AED66443C73D8F09BB423DBC9CAF ThePersonalTouch(link)
514,322,565 *348A7A6C347906CCE7B475EFDD893EE95FA5D1F2 thePete83
514,322,566 *348DDADD107852C0ABA0C07D59169734CE8BD0EC thePhishy2010
514,322,567 *3487C3C75BE74C96D448BC4F2E17851C705C3BDA thephoenixdies(blutengelremix)
514,322,568 *348FEC5F0CF331529D8D5E92903FBF9966EA18D2 [email protected]#
514,322,569 *348F96C8282D73ADBE4A50B4092956209650B3E1 thepick8
514,322,570 *3487983DF4D845B9D461085907ABD8256ECD3484 thePIERRE63
514,322,571 *348970151B49BA6DA34D0B50F1BCED4D55550320 thepinkshirtbooking
514,322,572 *348BE5A10EC4CFBE9179877C55F4919DF31CCEDB thePIONEER2001
514,322,573 *3489E67EF73273E12FF8FC1BB56D340F793E2F83 thepkrasattree
514,322,574 *34878B7DB8C24C4F4AD3840471744EA5D10C1170 ThePlayer03(PlayerOnemix)
514,322,575 *348427D586624B67AC4BA4A6BF31ADB7FDD37772 The Pleasure Associated With Eating
514,322,576 *348471B36908BB8C8337A836D37D6493E1B20BDA thepoetic13
514,322,577 *34880568961B945164B1C2AB48EEC852E5C7E7E4 thePoetic46
514,322,578 *3486A934F67C057AF9F81C4439ED9DF26E58941B thepoetry04
514,322,579 *34817A345F1EC77A0DBD5986DA94E173D1427DEC THEPOLISHREVIEW
514,322,580 *3486A9C77B6433B0C99B0124F8999FAA38A89878 thePolk
514,322,581 *3485DB6E9ABFA5B655A516ECDD8EDD692939A30C thepolygoners
514,322,582 *348215E4C71FA253924F871E10A4E1DC808DD112 thepoorman.net
514,322,583 *348EB10AAEA174C2F450F7794F265FD8B40ECCAD thePOPCORN1
514,322,584 *3484EB3F5F17A2A2C549353E919B00EFE650B398 thePorsche1987
514,322,585 *34800F1ABAC6D8D987BFF6840D7DE058A0D4E158 The Power Room (c)
514,322,586 *348D4A715B4DD93E7314A5F35182B9FCEBCA55CE ThePR
514,322,587 *34810E20188F5DF024B1B6FB68AC8C3F68FD6D11 theprayer75
514,322,588 *34873D88C2132E951E76ECCFD3DF980E794036ED The Pretty Dirk (La Belle
514,322,589 *34821361A967A5788635A1C8EE5F2E711DE83A5D theprinceyourmaster7
514,322,590 *34872F0E21B1B4DAA4F5D5C1E0258BCC066C8709 thePRINTING53
514,322,591 *34843510E82D5A4585EA3C3808DA984BE7A9465F thePROF2000
514,322,592 *348D6E50BD1D773FDC9E165664948B07A3CF184C THEPROMISE
514,322,593 *34881036EEBA0F6651BF6E534311BA07A0734BE6 theprotectingveil:iv.lamentofthemotherofgodatthecross
514,322,594 *3485138C8C099EE7515768ED4490890413FFD830 thePUDDIN84
514,322,595 *3481D0C680D9716B633F3A3187CBE4EE4111E2CF thepulse1234
514,322,596 *3481CF0616A10799D83DBA015BED9B4E04D61412 thePUSSY26
514,322,597 *348FBE410914A4B318D81AA59A62B57135E8036C theq1w2e31
514,322,598 *34898A97972C134F7378F32A7A2E2C122AD4447D THE-QUARTET
514,322,599 *3489636EEE6AD0CF23F3AB34954E55ECBF8841E8 thequentin74
514,322,600 *348287EF5ACC8DE8ABCCB8D3A6BC3DA21DCAB528 Theradex5
514,322,601 *348F49F44305F553497AE04E741D94EDA43D76DC TheRahgoos
514,322,602 *3487A69A525FB3E60179F60D31AA208FD776CD88 theRaiders08
514,322,603 *3484B0F2183109A79191FD513D274ABE6DC87864 theralph48
514,322,604 *348AA26DA9930ADCE3C9D20CDF04D38DD4492409 theRANDY23
514,322,605 *348D0081F790109D0790D374C970BD0C980F9C6B therapeuticke1
514,322,606 *34817B09195012739A17CC53D8BC07DF3CF51989 Therapiebesprechung
514,322,607 *34874339FB9B94B1F4C6854247B015F0E172BE4F therapyencephalitis8
514,322,608 *348D7CE04315648C796E5569AAC5A53E25BCDCB6 therbstes8
514,322,609 *348678A1263DD28DADAB6698F4C71DB8075CC3B2 therdyn0
514,322,610 *348E3A60868E8133E81A23800344C564C2FD9111 there48
514,322,611 *348887A9CACD3770F82738E35619CF1F2A4D1BD0 therealma
514,322,612 *3485C04C74680E3257AED34794D3987EB01BFE88 therealnhuloan
514,322,613 *34809EE955514898433F5AD2041FAC9011BCC742 Therealwaverlychance
514,322,614 *3484F129DA21F19E53C95810AF6F7C1ABC9534C8 There cannot be two skies!
514,322,615 *3489BB9B21A6313B21D180F0B0C259245988A9B8 there.domitius
514,322,616 *3485F604C6A5873DD2DB0BE27FC215504EA529F6 theredspecial
514,322,617 *348A5AA14C50DCCB74EFFE7555D659299357A5C1 The Reel of Mullinavat / The Pigeon on the Gate
514,322,618 *3489965854AAAB3F1FF75DA69AB4318E2979743F Therefore3
514,322,619 *3488BE6A0C6BA0E0881FE2905CBCF0DF910A26DD therein.4see
514,322,620 *348B66A40A46767DD4D5F42E5AB57138CDB320D7 theReliant06
514,322,621 *348C0E5237B25F790FE7FFA38EE8C2DFB3A04556 theREMEMBER38
514,322,622 *348999AA8B5EA1F7FA1CF1FE3776506005E85F7E Thereminom
514,322,623 *3485DCB49131F5A03478674F7E2F20E12FAB7E75 theRemote93
514,322,624 *3480B45B81E7BF4CA673202008F9608C4616F5B3 [email protected]#thereof
514,322,625 *348A9D360BE69D7C15A4502DDCA3F73586BD3475 [email protected]
514,322,626 *3482126ADDCC56CDABBB1C6F6D446B5B7C15A107 there, right behind you, too... (disc 2)
514,322,627 *3484E750FAB13DED08E8FBF3D5B462C0802AE87D theresaaaas
514,322,628 *348987732E6E722FC41815102EF2AE427B8E43E0 theresacarling
514,322,629 *34856C26A5BF71CF93601D14ACCFCB735161E2A0 theresa cowger
514,322,630 *3484BE8D8EB26D3FA0BB0D39B4C9DBAE431B1D14 theresaflick
514,322,631 *348E375E6F7F535DF2E64EAF27E5477F5EC4024B theresagoofy2
514,322,632 *348BDF34C477E5DA13C8181957835FEAFF9BD3E5 theresa hairston
514,322,633 *34836BEB1343D876F91805486FB2D4126D3922F0 theresakarn
514,322,634 *348C2C2CBBA974782FB443CDD890F729BA2A8548 theresakiller3
514,322,635 *3486D20123F3C88534B7AFF64FF2473A89B059F0 theresalaster
514,322,636 *34853CE719A5FA8C219E5DA97368DA8B83C5D998 theresalloyded
514,322,637 *348C8BD9201BFD62C7DE616DF21DE349540C310F theresa marie george
514,322,638 *348E2EF04482D0BE39A54D42778499B10404068B theresaoflisieux4
514,322,639 *348C64E13D5B28B5FB10A7422C12BDFFAF8906B5 theresared2
514,322,640 *348B314F0C337F06D7D8A7080D4F0ED4D9D67B22 theresa sauerwein
514,322,641 *348C21BE68EF00AE74CB1A684CF1A743C37AEA4C theresathibeau
514,322,642 *3488CEDF9AAF8CC2210FDE7F8E687156516920D2 theresatully
514,322,643 *348D44CA912A99A62CBC5B1F1454F4C6B9CD1719 theresemoussa
514,322,644 *3488377586F2F1D66AB388EEDC7B633A3FB6754C thereseschultz
514,322,645 *34825E3E89A6DAE4E2415C4E3EF05E84E3B889F2 THERESE-ZENZ
514,322,646 *348DADEC561F8D2FBA3F2C620FC84362AE3C6F42 THERE'SLITTLE
514,322,647 *348906FEC2D66BAD6EF4BE6AA2C406B4B3F866CB the return (time to say goodbye) (club mix)
514,322,648 *348267809BA80670EF15FEB0FF560EE30DC59662 [email protected]
514,322,649 *348B0D53D92D703960A65296269C45225F340941 therewithal1
514,322,650 *34861992FF0A81B8F27050E9DE3B1F0AC8BD8D43 ThereWon'tBeNoCountryMusic
514,322,651 *348E682241D19CB7B22DC57BF3D26340E369859D therewth5
514,322,652 *348ADE46DB8AE0324FB9AE175CD6EB99A6A1DFD2 theREZNOR59
514,322,653 *348D42998FE848FC2AD3C10D3F21D18C182DE9EA The Rigs of Time
514,322,654 *3489FF9F1B92E6EB0AFE9DF4233E5E1F97B741EF THERIOMORPHISM7
514,322,655 *348DA75F2E15DFF60F76378387B9843297816FCE the-rise-fall-a
514,322,656 *348A6FC46AFBA7881119D22B3F0D45749060FD8B thermalresortspa
514,322,657 *34896B62AEA1EB5B0B2F5DADEC8BA551F32A5CE8 thermens4
514,322,658 *3483EDC210B409A8E310C9C0850D9E394DA3183E thermin's
514,322,659 *348C618C449E3B50E6EF7B7B27CB0E5629463A36 thermoc1ine
514,322,660 *348F75D9EEF62BADFF63346E99308A9CF57BDEF7 Thermocladium
514,322,661 *3483CCE9F02CA9C2C52004885AC2F60DDBEFECF7 Thermodynamica
514,322,662 *348DC562CE06677E764664F51644930760D1B5FE thermoel4
514,322,663 *348FA023307D972A51564B65F7289E848B7D9A18 thermoelectron!
514,322,664 *348040E589B19E8DF4C9F4189B08C51ADD3CE880 [email protected]
514,322,665 *3485878C69E0E37C2B76E18F5DD373C7F37A0E1F thermophyllite4
514,322,666 *348E21C5006DC9F372D3C597B847435CD85AAB2C thermopile1
514,322,667 *348D83DF2874BFDB4CC7B9E146323C439F1993C5 [email protected]
514,322,668 *3482C14131BB9DEF1C7E3187309C2D05B9460A33 the road to gila bend
514,322,669 *348A90798D6848B8DBB87D960EDFBD55A99E18C3 theRob03
514,322,670 *348A729C11EA1A4635C7F1BE0A7E093A531B56F7 [email protected]
514,322,671 *348BBA5003DE80FB9E3A2437D064FF2D759C068F TheRockerz
514,322,672 *3484249F7B5CF9761DBF13C108330FB8D4B74072 theRoger35
514,322,673 *348DF157801866347F0146B0D6B0F86C199F15AB theron.aceto
514,322,674 *348FB37EBDA6E25D1739472A67E55E725E17230C theron.anzures
514,322,675 *348795E36E8B70FCF948DB583D9B81244F071B28 theron.arndell
514,322,676 *34857592C681624237FBCEE95A0180B1E0186733 theron.borne
514,322,677 *34841EDAEA5292E7CC468C93E30EE0322E2104B6 theron.bowlus
514,322,678 *348E93FADEDBED21EF9C1BD49ADB82719F8B69A7 theron.bryer
514,322,679 *3489101E48832194252F9E6F762D1A91CD0D38AE theron.calise
514,322,680 *348BB5B4EE2EC601C9A82EE311D23C618FE256E6 theron.casperson
514,322,681 *348DE9132ACAA25ECF059DE89900151655E827A9 theron.charping
514,322,682 *3485D78FE2BC87D41B6C32F326D8EA71BA2B5AD6 theron.cornn
514,322,683 *348157B60A5704EFAD914FC67B05A5C3330E3C96 theron.daughety
514,322,684 *348188C7AFB4D46BC62AC63861957AC175353628 theron.eisen
514,322,685 *348F5716CB3BE60FD1AC22FC14CC6BFCB37CDE73 theron.ewart
514,322,686 *348EB019CE08A365D0D2B20A76578DC508ECAB94 theron.fouyer
514,322,687 *348A4CC1F4EED0365D67FA457A9FFD26C639AEAF theron.gassen
514,322,688 *3480DA866FBEC9669B9FB8B41EE9400676EF4DB6 theron.huether
514,322,689 *348261DB63A68C5222960D1672C51A50C3B5769C theron.ifie
514,322,690 *348E7B31B8CEA1B496A0BA8182447456D98794C5 theron.juarez
514,322,691 *348F3F2BD223B1E1B70F5AE22560338AD783D2AB theron.knaub
514,322,692 *348A2AE25A2219D1A7348ED0E2B56735864F278B theron.korinek
514,322,693 *348243ECE915E16383CF78ADE0AF56734ABDDE62 theron.loiacono
514,322,694 *3482EB8B3D7081CDE1994737E70A42731D87C584 theron.moberley
514,322,695 *348DDE0C13BA06841627897537AC9726DEE7DE4D theron.niesent
514,322,696 *348DABDAF637D7D3A6231782FC27490A362B2CF1 theron.nightengale
514,322,697 *348473AAD25D667D587ECE4532097654D61A5814 theron.notaro
514,322,698 *348DD27F33556BFB3B0486F912E9F9350ED2417A theron.preisinger
514,322,699 *348742FA68631C206A737A6A799EA2F9DB58124E theron.rehak
514,322,700 *34809B22DBFFB4C4E503CA53AEF42B4CE021DE81 theron.rodrigus
514,322,701 *348585ED0BA1087E50F007658EB4E573B6AC151A theron.schandel
514,322,702 *34832D61FB32CC05E71540D8AD6783EECECA63C5 theron.spellman
514,322,703 *34822A2D357A30C8FE77903553E6DCBAFBE31279 theron.swell
514,322,704 *34889E92ACA5364EDC4B3361AE3561E3F4C59E75 theron.taboada
514,322,705 *348C9D1C823189AF622D9B30B92A6EEAA5A5AF91 theron.teet
514,322,706 *34823BB89BBFB5F6F2B8B93A18CD9CFF9CF91912 theron.ullah
514,322,707 *348EF569C5B023E954BA8ADBF7CF33C0CE6E2A4E theron.vayner
514,322,708 *3486D973702199FBDB2D49A943C54718BDA233DD theron.videen
514,322,709 *3486F7DC36627EF8D0FFE348B091E1970B016605 theron.vosberg
514,322,710 *3488D3C25D270FBE5DB367BE313ED2CB901F3F87 theron.winge
514,322,711 *3489BDE01EF0978E69559C028B4222B9069E9C21 TheRootsofLedZeppelin
514,322,712 *348AA7F284A28D0ECD611E020F5849888103492B theRosebud93
514,322,713 *348BC4951D4441D0F4DCB6A718974CA5516090E0 therressa3
514,322,714 *348C7886098471910382A4842D9A5D9C3D980E5A therthere1
514,322,715 *348951602B4EB0B4717D234D14847244AB33BE26 Therubied
514,322,716 *348EFD01E103F08F9A8D461EAA9DF7CE66750789 The Ruby Ring Man
514,322,717 *34882A0260D5E4DE52B615C181D53ECC59D155AF THERULESOFLIFE
514,322,718 *348651F11440C97724D5FEF97E1D75851E4A77A9 therush70
514,322,719 *348851D8DB8E30A6C0DBFCC1FA284879DDBA074C theruthlessforum.comwww
514,322,720 *348313DCD20906DBD7BD388C40F71A77555B4AB0 the saga of sidney spacepig
514,322,721 *348C7B03B138D0C0219B093CF54B3EB075F8B402 theSailing1985
514,322,722 *3481D2AE6B8744139CBC46B07D9A8AC681701678 Thesalon1
514,322,723 *348AE20C6CC78833FB698DDF90F62FD73D9F19EC theSampson85
514,322,724 *34804BF4662B94688B28A4C45DFB5AF6AFC688F1 thesanjose1993
514,322,725 *348CA36FAB4AFB5D1E0A0391A8475B5EEF41BC1A theSanta32
514,322,726 *348447E7224D9B021EEEF214A56BF71041E56450 thesaturn57
514,322,727 *348DE0AD2E56951453121E92AF692D2D297A8E31 theSATURN80
514,322,728 *348A66A49E4513E0F4D8C403C33BCF1850A7D6E5 Thesaxon6
514,322,729 *3488916FCFE01928507594C7592015BF99A998DB TheScamps
514,322,730 *348CD49CAD298E9D140F5030C243CBF6571F2254 THESCENARIOPLAYER
514,322,731 *348DEC688B4F9E8B132EE05D0AA32487DD4A2C37 theSCIENCE33
514,322,732 *348B64DB608898EB491791AA2B169A4D02E3D2ED thescienceplace.tripod.com
514,322,733 *348E10E8C3F5883209B74EF72FF41A3A963A04FB TheScientist(Coldplay)
514,322,734 *348CFC03FE93A6865FA011EE70320F4046E30A74 theScorpio49
514,322,735 *348A481C9147D1EBD15A88D65901309AA0A9309A theScott47
514,322,736 *348BCF5EF1C89E8EC35B8F514D6A544C5271B200 the-scottish-tradition-in-economic-thought
514,322,737 *348063B9F34819949F3C466FB90DD481EDFEBCB7 THE-SEARCH
514,322,738 *348D6539FD5F6C33795B9D72C9F67FA6B971249D theSECRET1992
514,322,739 *348BC512C504EEE8641C7488DBD7C2E0F95090D8 thesecretlifeofwalter'smittens
514,322,740 *348DCF9690EA84747ED41997224F03F7239341B3 theseducers
514,322,741 *348FEE1DBFF5B0DF1AA687C6749A83CEF525C65A theseedskeepgrowingfaster
514,322,742 *34866C694FD25E4F8A10E6F6F855FF951C1868F9 theSEEKER1998
514,322,743 *348526E34271B8A441DA39538091B5FF174B4104 TheseKidsWearCrownsEP
514,322,744 *3485E1F81FC1FC92AA115700DC8A1C605F7961AA THE-SELF-BUILD-GUIDE
514,322,745 *3483CDA413258622864E79D763C7AE7291950CD3 TheSerpentinesofthe10thEmanation
514,322,746 *3480BB7D14A3919FD30281750B0109F70DC683AB [email protected]#
514,322,747 *3485CE9FEA9474A1600CD417C6CDCD8EA37C925F TheSeventeenthVisit
514,322,748 *34889C114E1A2C1E6C092F3AC0DA77A015628C4A the seventh samurai
514,322,749 *3480CEE56D46678FC835E1476F5F65852655970C [email protected]#
514,322,750 *348C4104D4273BA5FDF4AB4E33FE8432EA78C1B7 theshantycrew
514,322,751 *3482986D869CECCB7A82B252B0E58DE785191023 thesherry2001
514,322,752 *34898B3513BBE8AC445A1F783774260BDE1ABD99 The Ship
514,322,753 *34839CB8B8FC7D6D8C85E9BC2D8310F7E9D994B7 THE-SHOW
514,322,754 *34876FB5DD1D08D6FA527DDFF66A87D019738BED TheShow,PartI
514,322,755 *348B37B292B1BCC6CB9260285D7617EE849D5844 TheShroudedIsle
514,322,756 *348515060DA80BDE32E89C45F0230C4D3B0446E2 the shuffleboard queens
514,322,757 *348F20BC14E486E41F0DEBB70E27EEE0E55B74DC The Sidestep
514,322,758 *348BFABEF7665F89DC09AFCFA97C80FD704289E4 thesimpso
514,322,759 *348D601220059F9D25B9F3C0E1ECA4B5AB5FA54C Thesiny0
514,322,760 *3484DEC1E01CB3D958B4001EE7B97A1F6957F21B TheSladeBox(disc2)
514,322,761 *348A8F1624ABE729759D12B10B270B39B2D2C149 theslateonline
514,322,762 *3489D6D80AC6322F5216695BB71DCE7EC6D303CE theslcegotist.comwww
514,322,763 *348AE962C1EE26B418B5092183880D4001E70845 theSLIDER76
514,322,764 *348E97D1CB75A0C3277A2E73AC0C01991A2CA6E8 theslippingoftime
514,322,765 *348DCE752BFF3FCD8054C097AA608DF8B7F7B9D1 theSmile12009
514,322,766 *348EF1DFF52846A9BA7B2E355806FE415A859563 theSmoke1991
514,322,767 *3485D2AFCD5CEDACEE89828AC2DE2FCAE9421207 thesniper00
514,322,768 *348F1E3EC1BA8E906C2BD054A96C98ACFD2A3779 theSNOOP01
514,322,769 *348F5CCD4776CAE36A62F860CEDB18139C4453A1 thesnoop123
514,322,770 *348831AB5E08986E35004BD6C0583138A3C97F2A The Snowman Soundtrack
514,322,771 *348F5BBE9B671E1C2B4655668CD25A46A133A028 thesorb3
514,322,772 *34827EF7522BBB11439A0031F75FCF77E940D97E thesoundoftomorrowtoday!
514,322,773 *348E626E513FA4C546F1A4624BAD1AB4931E559E thespanky1998
514,322,774 *348051A55625170536C9FDFCC072D5847A4408AB theSpazz24
514,322,775 *3485B66490CCA1B83FEDFC48F5F5B7C26D1C18A8 thespiritofshackleton
514,322,776 *348D01B2D21FC7D46FD5A560D1CA02E9ED8A4597 theSpot1996
514,322,777 *34820A77FCEFC374A26CE813C1651209A3431CFF TheSquareElliottStLadyHuntingdonsConnexion
514,322,778 *348358DECED9B68B66AB52CEC315A4586E8044B8 Thessia4
514,322,779 *34805A433376A2AB2B98DCA6BC4809D8E4A7EAB5 thestarresaremarchingsadlyhome
514,322,780 *348A4A7623CC9945C57C2600A592264AB89F5B23 theStart47
514,322,781 *3481EA312D8F4C7375D0487BE83D3430C04BE533 thestart57
514,322,782 *348662FED0BA1440C414C9C924389196190F1D0E TheStar&TheSnake
514,322,783 *348D807C96CC70F2ABC932B4723DFBA4F5AEF3D7 The Static Masses
514,322,784 *348A83597A4FAD7BFB31A6125D818D4C8916360E theSTEPH00
514,322,785 *34852C0F08B7AADA5692B9C06D5122CE9B5AD02F thestigmaband
514,322,786 *348A6B72F48884FFD1C57E8826051D4955A56F51 TheStockholmConcerts(disc3)
514,322,787 *34886151FA1C7C5C5D5E7CD9114F9D3612534D79 thestolenfaith
514,322,788 *34833D6603A34EA6232F5104387966C354E5E29C TheStoryOfMe
514,322,789 *348C577C9FA9639439F486FF00CD099AC5ACB216 THE-STRANGELY-PARALLEL-CAREERS-OF-ISRAEL
514,322,790 *3481F4751FA01B9E02B21D1540E3CB92736A3F12 thestrangerinyoureyes
514,322,791 *348BD2B2426D249D1C59134570B177939A4650CC thestrikezone
514,322,792 *3487EA7499F846E2D7FCD805A7FFCCF510616D7D thestud66
514,322,793 *348F77A15E17580370024C1311E896AB6A09B245 The Student Prince: Drinking Song
514,322,794 *348BD9A0A3D1D1FA7508C7CE20631D346396F7CC theSTUPID33
514,322,795 *3486478C4031363315C63C27DF8827723881691D thesubliminal1
514,322,796 *348B50A847812CB42D02123F565012DE77821B53 theSugar0
514,322,797 *348F4B892A90BCF1AEFAEFD22FFF5C4AC4B8F3A9 Thesummary
514,322,798 *348D8B19F8FC55636A114197AD86488320470C11 theSun43
514,322,799 *348E1F02BD6FD5698F7B6DBA742F5A30F7B3017A thesundance93
514,322,800 *348AC3F1EB6D00FA8CEB6E9B21889C1FA528208E THE-SURPRISE-CHEF
514,322,801 *348CC1904E2190D392B895198D0DB75AC0AC561F theSweden6
514,322,802 *348BFF9CDCE9C340FEB03E835C1ADF30E9836884 thesymphonies(riccardochailly)(disc10:symphonyno.9)
514,322,803 *34898838CC672C65FACBC33227D4FABCFF33FE80 TheTamingoftheShrew-Overture
514,322,804 *3487E3F76551C17DB75720C4AF7D9F7EBA8F43E6 thetarragon6
514,322,805 *34864392154083C31E24929B8846C96ED9667BC0 thetatteredsuitcase.com
514,322,806 *348CA56D9D5993E3B4EE21C09728B0BD792CBE96 theTbird32
514,322,807 *348CB668DD55132E42B1E74FC29F10AF74490F21 thetcbshallmaintain6
514,322,808 *348073C5462BD5BACC5EED1FD0DF36EED0F1B2AE theteddy103
514,322,809 *348FC866B99B84AAE19A71ED423A8B10AC28EDF0 theteflon01
514,322,810 *348F9969BF991880DABABCBE74D8D0B47446746E The Temple of House (DJ Dean mix)
514,322,811 *348D36A49DF03B5C3137DE9E32E33FD9D41442C2 THETHE1982
514,322,812 *34855D6426F828F33965511FE58BD3BCB6690139 thethenning
514,322,813 *348F54264DFCC14E6000ADE64B9661DA953E2578 TheThirty-FootTrailer
514,322,814 *348F365C3DBCFA79D92A64C4DF4B68021AD06915 theThompson01
514,322,815 *348683EDCF181036E22D77FDACAF62B16E25D3D8 the three o'clock prayer to the divine mercy (recited)
514,322,816 *34860C9E5D6D0B8F46CC475F6EF0971F5984535A thethreestoogesed
514,322,817 *3482A7539012ACD2ACD3DE3F6F3DD66241F7A226 thethunderbird2000
514,322,818 *3482A008AA18BB1BFBF62F685002DD4FDA656EC1 thetimeofmylife(mainversion)
514,322,819 *348BB0B899BCF10B4A43CFC9D33F197F04A20AF3 the tone depth ep
514,322,820 *3488110E66AB9801E7D84D63EB8C2ABE337E6424 thetool93
514,322,821 *3485494B71E3DE0CDC0536404D7D3B5CA3C10DA3 thetoyzone.comwww
514,322,822 *348F23E7E7FBD64976EFC15B2885B5791BA924C7 thetpocshould
514,322,823 *348B61DCA553D1E9094CF093FD7A6ED3A9E78DAD thetradesmenassociation.co.ukwww
514,322,824 *348BF207A5933CE527BD809746428B439D2A814C TheTransfiguration(AndItWasSo)
514,322,825 *3489C692711F46C94C7A5D73FA7AD2F5B7FE5036 thetraveler3
514,322,826 *348D92976E734707E226C4B237E3F74DE16AE847 theTree28
514,322,827 *34858A833FD73958350484EA2BDC64FC19B57E27 theTREE79
514,322,828 *3483F95DB95A17AC8DDA556C10E5B20C8101ACDB theTREES60
514,322,829 *348CB646517ED69ECBD08EDFA8D58E8C20DC947F the triumphs of oriana: all creatures now are merry merry-minded
514,322,830 *3488B24453701105A982F0F2A36EACEB019669A5 theTUCSON39
514,322,831 *3485F765B2FF72B0402720A6849830D59AECE9BC the twisted sara
514,322,832 *3486DF05F045AC5A6D2B4100F669E03201AFE217 theTyler58
514,322,833 *348A58FAB49848986BBCB919880F38916AB5E36D the ultimate bass album (disc 1)
514,322,834 *3481ED55DDE93108C712F8718644032DF79872F7 theundeadrat
514,322,835 *348689CBB0852B48463D31D5E1932F3C60667E6E TheUniverseIsforUs
514,322,836 *3481AE0C285F0131D53C36D61589BC8ACC05D56C theUPSILON87
514,322,837 *348027A80CED1B678852F3A59334C4A6ADE7E420 theus160
514,322,838 *348CB28CCE24EE489E1E12193DAC6BC4D17CD17F theusedcarsuperstore
514,322,839 *348C39B834355B96BC2CFF04B8AF78EC330537AE the.user
514,322,840 *34830BB32C3E048582DE01FCCFE1707ECD64F7FC theUSER188
514,322,841 *348C4E795A0B654F9891781A92DEB4C6C85658F4 The Valium Whip (edgemeres nic fit)
514,322,842 *348E4E1AE6F1B1059EF6D1C206B373C00BCAAAD9 the-vampire-diaries-blowout
514,322,843 *348A07EA6225111CC06B20F0C433A8ADD6EE43BA theVanessa73
514,322,844 *3485E4ECF2B90737C8D0F411708F6083A4A9CFAE The VAST Demo
514,322,845 *34832DA017C09E432E6132485303F4F28C9B7046 theVelvet8
514,322,846 *3484E3EB4986478B45EAB88595E57327B996BA4B theVermont63
514,322,847 *3480B28E0143A855B7843213CDDC4017D3721380 TheVeryBestofGilbertO'Sullivan
514,322,848 *348226BA64745781C290BD375A2B1687B2A8C67D thevictim 1 0
514,322,849 *3486BA6F2481A1D4DAA57EC195573B1C4EFC2A46 thevictory93
514,322,850 *3489C97BD0C209F82A3ED33EC407EE677B0ECA97 The Village of the Virgins
514,322,851 *348A20548FA75DDD03AD4D7D5C9D6B1AA01A805E theVincent48
514,322,852 *34863C1BD8CAE0271BCE10CA2B301D0F8C58C3C7 theViper2003
514,322,853 *348211F60C3D04190D210C02E318107F7C16D913 theViper39
514,322,854 *34893538B427F495820330D71747734B20AE5206 thevirtuex
514,322,855 *348D953EBF89EC727FB217B0C17DFA531CA29FB6 TheVolgaRhythmSong
514,322,856 *3489560A0804CACD27A7696C81F54F0311980075 theVoyager46
514,322,857 *348AF69641A8259C22DBECA59AF9E1B626CBDE23 TheWallsofOlathoe
514,322,858 *348EC5FA95D4F4099CEAEE6385887FC63BD6D35B thewatson98
514,322,859 *348B6527B5B5B307AD25556340D9BAD1FE35B6E1 theWAYNE03
514,322,860 *3483D06E10AF5A56C5D96F2FB2074049D1CE2B14 thewhore,thecookandthemother
514,322,861 *348B86A44ACDD40A2CD5BFCAC5D405BB96E7D612 THEWIGER
514,322,862 *348749DAC43399115658C916334AE02EE06806DB TheWildernessTrail
514,322,863 *34804C5BEA9BA857CF3794A087B4A34B6B972D5C thewilly31
514,322,864 *348FCF0491CE2CC8368AF7E9EB8108485F2AD195 The Wind That Shakes the Barley (Dublin)
514,322,865 *34892F68583B0414DA14F488197C5BE0D8FB4513 thewinheight9
514,322,866 *34832DDBE4C1610B834991B9D349B2DA5DC1CEA7 The Witch of Atlas: "For she was beautiful..."
514,322,867 *3486633BE22C630F2A6D02B506BBB796AE71B8DF thewitt6
514,322,868 *34834974677E15865AF679145B0E9485467DD84A thewolfgang61
514,322,869 *348812ED8AF7D5BC23AA5CF7D08C204B6BE95814 TheWonderfulandFrighteningWorldofTheFall
514,322,870 *348D666E68B37C303CD78538D8C99186971A7CEB thewoodyhermanstory(disc1:atthewoodchopper'sball)
514,322,871 *3486ED7B1DE5254157B55508BC044019CC32F517 thewoofwoof57
514,322,872 *348F669145F81C46DD6A877D8C070E1A3BFE0855 the world loves us and is our bitch
514,322,873 *348AC3E0D5676E38C36AABB69B3B8081083660FF thexcorex
514,322,874 *348B9F9F37F9D683EE0CF764AD2992DBCA2FBCE6 [email protected]#
514,322,875 *3486AE5C008E93BC598DE97DB387EFD5EDDAE5FC TheYardleyInn
514,322,876 *34895E039257C434B178ED99D6B9DA3272A25A1E theyawrukus
514,322,877 *34885F80E548F22CB980CB7F2FD955A63829BB3C [email protected]
514,322,878 *348DD06D69EDE5A1AA23FAFAC6AEA625771E8871 theyhavenot8
514,322,879 *348DEA4D65AAEA88A10BEFC8A6DB6867E7A5A8BA They Kill Dogs
514,322,880 *34873C58A08AF2780C9AA386981CFFB947D98AF3 theyoungmarshall
514,322,881 *348D9374F8E237F334B9D1C356E72F12C34C8322 They Remind Me Too Much Of You (#4)
514,322,882 *34841A8A5DFBE7F21290CBB70636F542D214A6C1 theytookmysister0
514,322,883 *348AFF9694DB179F4C8131379E88707A5384E0DE theyvette1985
514,322,884 *348966E68C6B9F5AF53F4F9E514424676C45DF88 theYvonne56
514,322,885 *348B6608AC002A52BF573B29AE227D67EFD4DF58 theZOLTAN61
514,322,886 *348E8DF739D2850BFF5717EF9DFF177CF99B8DDC thezxcvbn75
514,322,887 *34866D78A627D6B399AF60FE585E55E5D20C2B3F thezxcvbn79
514,322,888 *348D927AAE757740DE14AC2A676041DF9B66BAD8 thgiegclf
514,322,889 *3483D602ABB52E5BAEE5FE5D1C7866FC57FB9772 thgiewnu0
514,322,890 *3488CAF8361163E2555373E924A35B9429FB6888 thgieytrofing
514,322,891 *348653C19A906944486323F5770BE7CD8E40C883 thgineves
514,322,892 *348DAA1D2450516F38E6E80EDF9E29BED096C241 thginhtring
514,322,893 *3483DDA14C84EB68A21BE0F91EBBEB5DDF84C123 thgirnwobsw7
514,322,894 *348143E831407BE21C4C6E6AFAA3C9AF31E0BCC1 thgiwddlareg
514,322,895 *34884C470A0052CAEC11545A7C0571122AFD275F thguatts0
514,322,896 *348BF3D5B4C1E3428DB9760F1EF70CF8CA8AB453 THGUOFNI
514,322,897 *34843934A8365848991311E30D941FA5716C29D9 Thguosnus
514,322,898 *348D6BFACE0834304B8E319EB3975B63892F62D2 THHOUSANDS
514,322,899 *348B4640F684D73603643E758FA6F50EB2D26F06 [email protected]
514,322,900 *348AE5C33BC05D8454DE30DD38729B16C108D393 thi0diaz0le
514,322,901 *348AC897AD7F50A967FDD8CCA95F31E6690C52E9 thI4
514,322,902 *348A45B222F7DFE791875CCA85028F8FD117F70D Thiagaraju
514,322,903 *34885409C74F84020E51BA29F88D41408458FE92 thiaminen5
514,322,904 *348B0A80AB67132D95ABF725D51B12E510ADAB60 “thiang”
514,322,905 *348F2F006D9F6107D623C3320A930BA40F9F0C77 Thiazins2
514,322,906 *3489C3BC92FFB36EE81B48B28E985A876FEBEA8B thicketties
514,322,907 *348B249D8F76CCD0A9BA8893CE3922F32E0BC352 thickflowing6
514,322,908 *34852C525C516297B1E5A10C1A288EA22CC1C851 Thickskulled8
514,322,909 *348F65F6CA5C8B21DE3873B897B963AB68E4DBE2 Thiedep59
514,322,910 *348B0F857C62883C3199B453814C0F6D79CD7BE6 THIEF88
514,322,911 *3484D5C4E27CF889AED4484CBB3391EF6258EB3A thierrymutangadura
514,322,912 *348FB06471C778AD764B8C58B993060F3FEABB08 THIGMONEGATIVE3
514,322,913 *3481DFF313572488BBF1A7A2008100BC84CE702C thiknesse9
514,322,914 *348FCAA1CF0563D0BE762E54F87874568E206067 Thimb13 1
514,322,915 *3482BA4C9F4F1C052542C7E532466DADC660E21E thimelbyfranz
514,322,916 *348ADF28DB5FDFC722CFEDA66C693AA5A2D3A7F9 Thimmaraja
514,322,917 *348A0B6C78698C2CF6C4E2709F9629298B5D0216 Thingno7
514,322,918 *34833203A40F76C19F26E3870923177D226A9A68 things.160tmorton166
514,322,919 *348A1A426CEAAF882782EA0AC4DD0124462A4DAD thingsfailure
514,322,920 *3482BE44B77A618F7ACBF5AB4405477DF4B2712F thingstocome(makelovenotwarmix)
514,322,921 *3485DC8F3C79038718C3417AA66C55F67BD07B94 THINGUT
514,322,922 *348BD8771F7D0E90C33B50132541C82C3144DA9F thingymobob1212
514,322,923 *34842B4DCE608CF964518F1C20B0D8B4CD4DB50D thinkhappiness.blogspot.com
514,322,924 *3482413303510191A67F8FBEFD32A8763F50B024 [email protected]
514,322,925 *34806EDAD5AEB2F50C7F72D8F7E98DE107A4C857 [email protected]
514,322,926 *348A1F9DF01398BC93A62BC727A0AA11D15AA388 thinkingness0
514,322,927 *34801A3B2740217CC1BA7B2AD69B4B270D830F06 thinking of suicide
514,322,928 *348FF0EEB904A810A30EBB15DD2E4EB912CF4A4A thinkingtopics
514,322,929 *348767C48FF88FECBCFFCDD61746376EFFAF8750 THINKIST
514,322,930 *3485A4D7645580796CFA1244DE085AD55836FF25 thinktheatre
514,322,931 *348B2136D30BF0F49CA75BA73384F2FEA2FEC244 Thinkyou9
514,322,932 *34814D677B84D2B6CFA3D6522C8A534B0AB218D9 Thinlyv4
514,322,933 *348E2521DA9D74F17C3FD7CB7B5A8A9B0E027581 THINNERLOGO
514,322,934 *34835F50766B76F55B4BC60759F13B16BF802A03 thinnertimesforum
514,322,935 *3486FC041B74A1B7D105C955C8D3F278B74C6DBA thinplate5
514,322,936 *348D9AB904D60E076B02B1AB4F2746454D1660C8 thioantimonat8
514,322,937 *3480164E0E6AB56F77CF3838AECB0A38A975D5B5 THIOARSENIATE5
514,322,938 *34857E6F249E3CC823275F81CFAD3A945F7A40CD THIOPENTONE SODIUM
514,322,939 *348492C1A0BC4532E332D22CE12BA957243AE2AB thirasawat5
514,322,940 *3480A4489794129E64DE2D7E55F63F503C2BB6ED thirdcoastcaf
514,322,941 *3485D7AF42537D46870300C0A9171AD08D00E385 Third-degree
514,322,942 *34813B3F2201104B6F9485334B6AA666637C5275 thirddegreeburns3
514,322,943 *348B2FF7D014D556B08B9463D60336F53B5FD6D0 THIRDLING?
514,322,944 *348F216A5E3A21E5204B690317C7DA6E97741C0F THIRD MAN
514,322,945 *348A63E7F241CC2E9ED10B822E07950350CD7D34 third-nipple
514,322,946 *348807DB2A191D4B73AFF5324ABA5E10F37222E0 thirlmering
514,322,947 *3485FF230816D3E61F3BE18028273920FB5321F1 [email protected]
514,322,948 *34877CBEBA6945328F1DE5EC21D73049EA44417B thirsters1
514,322,949 *34870AEEE9BF6C88EB68971590C51314CAA82F9E THIRSTIEST5
514,322,950 *348F62480FF6FC3A68F82AB4CCB081EE63E66862 Thirstla8
514,322,951 *34885A55CE5BE4E641F2216DE243D622EAB819AC Thirsty Merc
514,322,952 *348F5BB985AA0FA59890FA92245DA2C549C54066 THIRTEENTH0
514,322,953 *348EEBF6AC532B2F572AC6DCCAF46929033C770C thirtypence
514,322,954 *3484D66D5DB5E7C6165AD390C6D75DFC0627FD83 thirukarunakal
514,322,955 *34851988F856D8CE72480924E556E308C4F97AF9 this bar
514,322,956 *348DD81CA066C029749F1533A4761855378CDD79 THISBRIGHTON
514,322,957 *34856132D59533288DC5394B7985A1C1FAA48F8D thisequallyergofinallyfors
514,322,958 *34886A58BCAC5E3359763F9FCC788313391E1988 thisgreatstandingstill
514,322,959 *3487284AF30FF94ED995FDADB84F9A9B5900DFDE This Is How It Is Lost
514,322,960 *348119FE1F7B3B2B50A2194BEAC46EBB59203BC9 thisishowwedo(feat.bigkorey&dru)
514,322,961 *34845E476B40DB10C72CDC9012C290170905ECFF thisismyspite1
514,322,962 *34802DAB063F0F4AF12E32A85FA1947FF8915F2B thisisthechrist
514,322,963 *348E62E36D20ADB9484FC813C6530A3F57B99BF5 this is your night (berman house mix)
514,322,964 *348F12443308BF4B023412C9C37C047B2EB92CCE thismagic6
514,322,965 *34883E8CE01A792D0CAD289FB92F14707B09BA8D thismandeep
514,322,966 *34890379294AF4CA02DD197C6BDF40C7387C37DD thisnewroom
514,322,967 *34863437D4A4329E1DCD3F2B5983DD9C33B42372 thisone'sforouryouth
514,322,968 *348B271F7BEB48562330BC29B04414FD5B056FE5 This Party Sucks
514,322,969 *3486E838BD47BC96CF6EFAA8CCA824E316EE106D this.putcd
514,322,970 *348EBB4CD3A74400EEBB9598A4CC8FC631ED1B7D thistalkpage
514,322,971 *34860633D63AE321158EADE1AA7C25968F34F4E7 This Time I'm Gone
514,322,972 *3482D11AE7BA1E49BDB1565B7D6E01361FAF0F5B thistleinsignia
514,322,973 *3484417FB70965A19DE98B20702B4402632F6E6A thistlew7
514,322,974 *34825286C848C0002BB4D1154984E97C72414FCF thiswolfkeeper
514,322,975 *348F55990A8F6E6F4A8DC3813DE1A7B54DEC13E1 thivierge2
514,322,976 *348A1E746A46E3C653B8B51B29C8722B0C61DA5B [email protected]
514,322,977 *348983996BF3D6260A3346EFA96D8600C3B8DBBF thkngshb
514,322,978 *348C747FD7A841D56986AB4340C278228F46E043 Thlchtjs3
514,322,979 *3480F0E5FBCD97FA7840A1B0EF54B6862EAF609D THLINGCHADINNE5
514,322,980 *3480EF12488B1CD6FFA373D2BC8F5B78B3F3D161 thllqinnobsw7
514,322,981 *348E844D51D5BC1B2DA98B7E85C956BB0FE6DC6D [email protected]
514,322,982 *3483A87EE51B5F4DBD55E052F342B873B32F3967 thlwg
514,322,983 *3484F9F42DC4F282CAF0AC7563BA31B35E973608 thmaphumi
514,322,984 *348A19615F9EAF018087E319DB529BF71D11D5DA [email protected]
514,322,985 *3480D37642B7E80CA85A78CD87E2542E3B14EFD7 thmltjlM
514,322,986 *3486A9533017AF4FAC1E05CCE891CAA69AA42EB1 thmmnbsw0
514,322,987 *348C3A67112B17BF0C1748DBE22C1D3AC3400116 thmnrsthnn
514,322,988 *348D1BE2026AF0DCBE3DEB853586CB37CA82761E thmpltl8
514,322,989 *348EFBE0AD67DD816640833079A9E2A80E5CB03D thmprkttns
514,322,990 *348221E8F4B9FDFA1303BC1E877351F623DD869E [email protected]
514,322,991 *348820C5F06EB902C2FB9FDE8AC547A13870B792 thmskllr
514,322,992 *348EF46FA86210DE5D37F4C1FBAE8F3EF47102DC thmsrznr
514,322,993 *34888BAF123701497C75C1CD8051EBE5072A8AD0 TH!NC14D$
514,322,994 *3484ECBDED20FFFDBD16C3E071A1D1BC3D0A544B Th!nka81e
514,322,995 *348236BA3DA1F3950858683C82946D7C26155BF1 thnkngdtrrnt
514,322,996 *3484ADDF9F10ABF6D69D05BC5369BB41A0C2786A thnmbrbsw
514,322,997 *348198D66A40CECA45CAF04185F111497E7E4059 Thntcty3
514,322,998 *348EA749CB05A0EBC1F55F32725CD1744BF0E3E8 Thntlgsting
514,322,999 *348F4BD9BB766BCAE75847797F3E651B1A367176 [email protected]
514,323,000 *348F93BB2AAEB0526692D52C7C6048557F452BA0 thŏg
514,323,001 *3481E0F38A8B42B9D05B4DEC17BE0D94B395EADB Thogersens
514,323,002 *3487319F9BEF1F36CB618C801BAB9098C0EFDD5C tholemoodied
514,323,003 *348E6E912DEF2992D658C15CBEDC789BB21D20DB tholli5
514,323,004 *348E30FFBD25990E1048C18864C355668EB15546 thomas.accurso
514,323,005 *3481EC4773B21F5167FA2F0FC0EB4BDD52AA34AE thomas.applewhaite
514,323,006 *348E436769B48F724B353E1A5A7DE917E29A81E8 thomas.baiz
514,323,007 *348FF7F4BB6A1FD7BFBF2C128A335988CA36AD8A thomas.bleichner
514,323,008 *348AA51CD636CC948DEF1D4FC393082952AE84EF thomas.briola
514,323,009 *3482CFC70BF94859EA82ABF043B884F2D53F03C8 thomascureton
514,323,010 *348520D69D247FB4C499DEBC837B8B3D1EB8A5A7 thomas.deserio
514,323,011 *348A5CB551AF9FE914B429A18A0714065453327D THOMASDONKEY
514,323,012 *3489E1E7E57677E12550FE237E824BEF8E6ED397 thomas.elsa
514,323,013 *3489101D080BC329519C5F25145675EF342B6B8F thomas.emery
514,323,014 *348DFE0CE52A213E13E5F00DB8F4D0488B94E30C thomas.fells
514,323,015 *3484259546418C6A2C4E01769820A2F6090C6442 thomas.games
514,323,016 *34899D32254EA0D5CE4F3743C4DDE9CEEDE5A3A4 thomasglider123
514,323,017 *348784E8FBAE98FE66B8818904813D215D7966B8 thomas.glovinsky
514,323,018 *34894A6456C4396D002F3B5E7F71D45FAB2DFCC2 thomas.goswami
514,323,019 *348EF2ACF68108C97B6680A7441FDFE288797E39 THOMAS-GRADY-DIOCESE-OF-ORLANDO-BISHOP
514,323,020 *348D930F8DFFCC6495ED1FC8201AC2C470401609 thomas.housh
514,323,021 *348DEC23ED5A7FE4AE077469AE9847D62FC4FEFE thomas.hout
514,323,022 *348FF5648D8D8E76036F2F68E62B15E2A4CC576C Thomasianum
514,323,023 *34834586C5105D4D637D4353AC60ECB76BE8D7F2 THOmaSinA
514,323,024 *34886106A9B02B073292A575901735040DD6BE89 thomas.kayrouz
514,323,025 *34869D65305DEFBDCDF9827B919C3DE3409B86E4 thomas krisko
514,323,026 *348505DDE6BCAEF9927A8074BA940FF619EBB244 [email protected]
514,323,027 *3481D1D2A02D2D1AB148FA74A0D43865F6D36030 thomaslindqvist
514,323,028 *348A4B00926D93D387D0E82185AD5597EE81ACB8 thomasmoreinstitute
514,323,029 *348FB39F93F6C5B87803D4FBBA556532C9FAF5B8 thomas.oxborough
514,323,030 *3489C60E76169A43679AB0F3A79058E388D85789 thomas.pafel
514,323,031 *3481072DAFBF67B82A73152198E6196797068AB0 thomasparenteau
514,323,032 *348E1247B9D13ACDA07D93D9A05333D719A535F6 thomaspattenaude
514,323,033 *348A23EBBE34E8D948DE76732C1171BFA21BBEA9 thomas.pellitteri
514,323,034 *348C333692A18BC391FFD3850C54133F40D20031 thomas.phimpradapsy
514,323,035 *3484EE1EC0CDCC8345F7E1E944FBB5A684559B8C thomaspizza6
514,323,036 *3486DA55A45A7415F81D0CD9686BCA65E971636C thomas.prashad
514,323,037 *348AFFB24D37948DA7BB89B52E067E0C96066E45 [email protected]
514,323,038 *3489F9700D4BE00791168E0FB52BBE371A9CB605 thomasrigatti
514,323,039 *3481DFE4EA9CFD1F92923C1A31D65642B76AD6AB thomasroh
514,323,040 *34823C914D0DD6DC05870DEE59366F9AB391F0AC thomas.sadow
514,323,041 *3481827C0105E2743260FA345C767D088182DFB0 thomas.sciarini
514,323,042 *34811D3A7962B440ED0FBAC99D09B2F5DC4999DB thomas sones
514,323,043 *34808A4493483AA0853027DC617E4126EBBC3F4F thomas.stageman
514,323,044 *348BEF5F16049A23EC083247FFFDF0BC75A00CA4 thomas.timpson
514,323,045 *3485E415635F1D9500271584B8B3E700D1BC5ABC thomas.upmeyer
514,323,046 *3486731A95A15B41EE0F1BDB8BA76BBD382DDB0E thomaswaltman
514,323,047 *348142EDE539CD8E99150104DE7B5B886BB34282 thomas.wanner
514,323,048 *348FC334C74319D11861EDCF3782069AD0AF5220 thomasweisz
514,323,049 *3481B1C81A29A0D3D270AA960A157919AC60EBFC thomas.whinnery
514,323,050 *34861A3678891E9DCD0F8DB5060FE80C8A08A98C thomfohrde3
514,323,051 *348180322D016682A762B94B9E78972D06C8258D THOMLEY TH AA1 M L IY0
514,323,052 *348F2F0DDE700595770414EC68EE2AF4D3FBB41A Thommy9
514,323,053 *3480AF89942E5B6CC02D2C2AC10743F81B68AA87 thompson294
514,323,054 *348298F06CB7D432E39A31CF582086589A5149ED thompsonquartey
514,323,055 *3484EAC805B0D5B2AAF84F6658DFA3AA6BA737EF [email protected]
514,323,056 *3487CC485C4D590B0A4D986DB458E48AE86EB7D6 ThomsonLocal
514,323,057 *3489309C21F49C83806B726C42EC805FB6ED6EDE thomsonville
514,323,058 *348758E43EE191DAC9140CF530893D2BE935F162 thomszen
514,323,059 *3484E1BFE5C802F7103FA8540CF37C0E5A005BA5 thony123
514,323,060 *3485109F0154D88D581E9BF621829709BF663FDC thopuskow8
514,323,061 *348A7D094C4F4C7D502A21E9F42EDC864F9A2EDE THOR33THOR
514,323,062 *3485675EE6A70D74487AABBA7F32D53075F69334 THORANTACHI
514,323,063 *3486E5F0A660AA7AF2709CC821CE203BDE60D744 thorbaby1
514,323,064 *348EA2659623CFD7628A8BB769A83F0950454984 thorbertn1
514,323,065 *348A67DFB670628B154502C0BF69ED1E7906BE4E thorell1
514,323,066 *3481421E1FB74EEA102E8992F194B7ABB73AD4B9 thorenknickbsw6
514,323,067 *3489CCD7D47870BB63B952EB4B002844BDC9A6F6 Thores!
514,323,068 *3489034B759F81AFC73DDABB35C54FD72458307E thoreu123
514,323,069 *348295BC2C02AD03F84C7B58FCE72B54E479561C thoriferous2
514,323,070 *3482245AF8C6E56367F86A14A147395628BDC028 thorindustrieslogo
514,323,071 *34880BAB8D545786471D7093A61E5B03FF8B9363 Thöringer
514,323,072 *3483CC212D154943D4CE3E7446F4F0337DCD42D9 thornburghbsw1
514,323,073 *3485BECFE6ADE87671655CB1E7ECBED8AF52C4B7 ThornburgHistoricDistrict
514,323,074 *34802CE7C1F69B7624B9C050C88A9091C4F616B8 Thorne17
514,323,075 *3485075A44E5A05E48AE92AF5721A09EC00428F6 thornton1075
514,323,076 *348B5A9BA0D2BB1FEBA75B72AAC89C3500A5D21F thornton3c
514,323,077 *348D3E0BC1F4889E6B964587618F335FAB2D1FDC Thorodssen
514,323,078 *34887B69C5B5B21525C539D922A9D0947C024FE8 thoroughe
514,323,079 *3480E3F079108352EFDCF869D747D257A244CC51 thorsruds
514,323,080 *34800627DE65527136E1F61971BEDCE19B6F29E4 thorustongen7
514,323,081 *348DCA0B81B4A8B7061FDFC96F9108750D0615C4 Thorveig7
514,323,082 *3480777092CB3A55775DA428A9B23E2DAD4C5135 those123
514,323,083 *3489B2B526984973317BCF1C06D33FD78F4BE59B though--because
514,323,084 *348A118D7D1A3572F1900B59746E4A1874DEF0C3 though.hqcentral
514,323,085 *348C691EC0FF9CB87A7C13B75B0D31159156246A thoughmarcie
514,323,086 *3483F4A11CD76EE568E14F84EACB0F12B187F5CA [email protected]
514,323,087 *348645E6176A80817AFC895611F2E7E2CFFF3572 thoughthegodshear
514,323,088 *348572125F17019E8143122C3ADC75A608454A2F thoughtindustry111
514,323,089 *348C84A88544705B7E3D844BA2C5E0BB2AB46C44 thought.jbrougham
514,323,090 *3486DD4270C4FD07A14946F44CDBEB6212E5792C Thoughwitk
514,323,091 *348FA20BF0D656B07E783D8EE585A188C057BD1E thoursdays
514,323,092 *348C46380D4E8FDABD26D76A0F2034B4821ECEA7 THOUSANDANDONENIGHTS,THE
514,323,093 *34891DCC6C7937D419CB5B6AE51190B1E99C5883 thousandths3
514,323,094 *34869664E2208030AD13F13038C61015B68B01E7 thoyndoB
514,323,095 *3485B580BB3BF9FF8400F409852D8441166F721A thozoarp
514,323,096 *348736FDCDF46417B5A411F40E1296137D7C0466 thpcsrgrp
514,323,097 *3480AD2DBE7EBE91A71686B5C8A7925E1F9AD886 th'pneumaton
514,323,098 *348D5C2EAC6035BB72A34F6C6887F85EE2D00E1B thpppppffffffftbsw4
514,323,099 *348DA01F0F53EABC744D4FB82DF72346DFE3285D thprcsntrf
514,323,100 *34880604789A929E9021FB288574A3EFABB0285F thQtr
514,323,101 *3482F8E31BAF108C922D4FC7BB36A5D951890F39 Thracienne
514,323,102 *3485FEE3279FCC81343F2BC8CD57019B7CCFE328 Thrangit
514,323,103 *348069EAF066D3F0794CDEBD3BDDDFBD867C5ABF thrasher1998
514,323,104 *34885B850976B2F3341F6905302C8108C5844805 Thrasyb6
514,323,105 *348ED26EF68A06ECC0DD6E008A3921D6BC2E912A thraupidae3
514,323,106 *34837B7E117D62A2FA20316FA8F7E0A9D2978816 thrcplstsed
514,323,107 *348F41DA96AFF58DC905CD580616DB101BA3F846 threadbo0
514,323,108 *348B9843115C94D7E131965716A60B7888420F67 THREAROCERAS
514,323,109 *3485A60099E352C4EAB0CCA06054E7A2808C619B threatsoylentyellow
514,323,110 *34805D79B736C4ACF7B5A9DB15BCAE213B196496 Threatwheel
514,323,111 *3487CFB6B76079ECD88F57E4CFFFBE63430EABF8 THREE40PM
514,323,112 *34888841D6196D719B034DC537C8D6E1A936395E three aspects
514,323,113 *34801B5C8044295259080D2B98702A5CE5B387DE threeball44
514,323,114 *348F012E4DE8E3B964B955658247A57C8CD2ABAF three blind mice (vocal) :30
514,323,115 *348889AFC3BE9161BF58769C25D4845CE57D7400 threedim0
514,323,116 *3481FDB2D9824BE6CEE5B2E68D80C2C7A85BD4C4 threegaa-class
514,323,117 *3486DA8309ED406FEA45C5030A45BF7A3289FBCA three leaf clover
514,323,118 *34825CBD729F8697C11195AB42CC80E4866D4F7F threelutedances:pavane
514,323,119 *348A9B71D4A8AA4E216ADFDC40E0FC4788B973B6 threepenny opera suite: vi. tango-ballad
514,323,120 *348EA9175945B16079F08112EE763C8E93D33E51 threequartertiming
514,323,121 *348B831F838E2C711EF7E050BA13727E23983126 Three Quarter-Tone Pieces for Two Pianos: I. Largo
514,323,122 *3483DEED6A6B7188B5851377760B15BB3462AABC Thresa12
514,323,123 *34880B568F6D8A1774D45599765E05D21903B9CD thresholdfrench0
514,323,124 *34843690EF70209694EC7321F7077E2251652306 threstonbsw3
514,323,125 *348A184E8CBB3FB74575018BAE5E5D6AF9AA1047 [email protected]
514,323,126 *3483183082EB0D41C79963BA9025374559F631E0 THRIDZIN
514,323,127 *3480FC62CB1AEA5A3D351CDFD3509210FF29C684 thriftlesslyv6
514,323,128 *348F7B0AAB11D9283E801AB06AA0C78E7C42E6EA thriftway10
514,323,129 *34872B4171730125F56CD72FEDAFBBEC6D7CF2D1 [email protected]
514,323,130 *3482656EB438719DD3F78E58044326944C4A6098 thrilliest9
514,323,131 *348F686A3C52004B73A9107C2D7201A3E877E430 Thrillnv0
514,323,132 *348F8F08CD198C4A36E54509E7914C3F33E02BA2 thrills10
514,323,133 *34899F3C60262EA83B6F46662A8E2E155E2763C8 thrilokchand
514,323,134 *3481C2D25277F8475A220D2ECE1D70EC4F584EF4 thrimmnessing
514,323,135 *348AA1E068B41D38E1130390CD7640C62463D763 thripida1
514,323,136 *348C5AA37FDA87E0CA463DC7FBF4E06F7553958F thriues
514,323,137 *348F8BD14F0A8A5DC340DAD6C1F5503B760EE95A thriv3l3$$
514,323,138 *34829A4D02B19ADFDE43C76A72789CB8C9EF3985 thriver?
514,323,139 *34880899B05F668895D360AA037EF41015437B7A THRIVING-IVORY-PLAN-NEW-ALBUM-FOR
514,323,140 *34896FAE5B12E9C1FCDFEAE4923F091224EE98EB thrmsphrsing
514,323,141 *3483EF410BC27B7F0AA31A0A0B0489763914FFE3 Throatless4
514,323,142 *348E0E87AF99B491439FB4AF9CD95490F5797A23 THROBBER?
514,323,143 *348D91ECA915DD5918BD5C2FD03AED08FBAE7242 throgat2
514,323,144 *348FF70B682CA78685120D9A8C845949687B2CF8 throm8o1d
514,323,145 *34803F452530658B035DEE09CD758092E7D4195D Thrombocythemia)の略。
514,323,146 *3489968E50DC6176E7696A98C5FC3CB483EC9B03 THROMBOPHLEBITIES
514,323,147 *348BB2E5396C4CD1A1535E5F5A9B2B7AE565AD46 thronelikE
514,323,148 *3489CFA463A93294253DC680683866A55AEA2AF3 thronesit0
514,323,149 *3484B5336771479EBD0CCDF45DD9EC121660938B Thronewa5
514,323,150 *3485B9578515F673DA7492414F26B0510A3D094B thronsted
514,323,151 *3484C1B1A2C4A6FA3CEA60A3773FA5BBFCCAA4E2 Throstur1
514,323,152 *348AC5ECC08587AF77602EB7CFD67378FA9C5A7A [email protected]
514,323,153 *3486F25A727D7276DAF7E052D977E009AB4A3501 throughput08
514,323,154 *348228AD27200D610F91CC1C6B52AB715507351F throughstick9
514,323,155 *348B355D6DDC6F33F3CBED8F746CA9DC40FDE1FA throughthink3
514,323,156 *348E96E72515FDF95211C971492F1BBE72E56DAE throughtouch3
514,323,157 *348F91961DA4834AB39FA18308F8DBF891AF62F8 throwsrequested
514,323,158 *348A69D524C83022F567E3CF200C9E253CFB37AB throws,thrills,maybeecstacy
514,323,159 *3483AEB2990E2CA4070C5E5AE9DD9842C45EE5D7 thrptsch
514,323,160 *348AD1F39297D2DCE68C8F76E3F982C45612159E thrushy!
514,323,161 *3485270F323295FDEF2298B100B4E5AB42DE7507 Thrusta
514,323,162 *3480AB9B09F94D41EF5A8D92D9CDB53D05366BED thrustethed
514,323,163 *34899ACCB0715BD9980F6D9FD99AEF40FD89AD21 thsoseses
514,323,164 *34847A877FBD3950C5CF4669D5F71E09D32ECF53 thstadionpeldem3
514,323,165 *3489879B9CE08CD0FFFB84B7B842F4CA71B31B5E th
514,323,166 *348BD34D2ADB8E4CA30DB7715CAB0E694569849B [email protected]
514,323,167 *34833155A3B94872E7B203CD339D512DF11107C1 TH-TH-TH-THAT'S
514,323,168 *3484DD0228649AFEACF5AE05E58BFB399F9B8E70 thtrhld7
514,323,169 *3480F3E20504BA60F734EF289B3F77CF11C3A7DE thucydides2
514,323,170 *34832102B3F8ABDBBD0BC5DB63B83F29BEE48501 [email protected]
514,323,171 *3487B9E7C56AB71CA0181E2FAB4C9FCCE2C65669 THUGGENSIS
514,323,172 *34835D0B97B9C41D2DAC573292DACD59D9360D23 thuggmisses
514,323,173 *3486E482C236F10216493869B3EB6C345F4367DA THUGGXISHXVIET
514,323,174 *34802254F2F38408B9EC2C5E1CD6CC1BE616B233 thugmisezz
514,323,175 *34854A83138E2BD6D2372FDCDFDF8C8AE37EB0E1 thugnme:
514,323,176 *348FD7445A7250E5EC85A0CB492C0C700ADDC076 Thugs' Prayer
514,323,177 *3486DCDEDAB64186CBBD074252D69B743E08BEFA thuisbankiers
514,323,178 *348BC387AB49D11EDEC629808B762B2AC4613DD6 thujadftn8
514,323,179 *3486401A2BCA9D4EA585B9DC98073E7B5B8B9F8D thukelaappendixa
514,323,180 *348925F136F0A44EF59D54740DA7CC828A6D7976 thumation7
514,323,181 *348F75B6054B36CE2A76607E07C784D5E69B250B thumbody5
514,323,182 *3489AA7DE3D23385CEFF3E260C15F8A30B576479 thumbpie9
514,323,183 *348B9A647EB38B93CCE55D405F76849856ACAB13 thumbright256pxa
514,323,184 *348C433EF66A62726B8DB646E57C9759EBDBBE60 thumbwidthbsw2
514,323,185 *34825035B59C5E94770BDB94F0FFA4057607F5DC thumerstone6
514,323,186 *3489B50E4C8C293B195F2A4351854F7701CE6C8B thummelumsen
514,323,187 *348A6B88550E49575C2476355DDF9FCF36FB99AC Thummimn8
514,323,188 *348BEF802D2715241B39C266BBDD584D085F91CF thumperandrea8
514,323,189 *34895F18D825554AD6F64C97DBDA5ED328D4B27E thumperbraves0
514,323,190 *3483D5C41636B9639E96508DFF3F58B1E49F5D75 thumpermiles5
514,323,191 *34881C4332319A80509568C33F185C8418E70324 thumpermortimered
514,323,192 *348781BFD0104F07F6A8D827AAE9906E3DE396CB thumpgröße
514,323,193 *348099ADE57DC9B81C88D1D14FAC2DA63FCED380 Thumpnti7
514,323,194 *348C2DE20A0AE4D7B69F95B2EEC8DA3BC2A5DFE0 Thunayan5
514,323,195 *348FBCE213D51815D3B089E76FA026F011634746 [email protected]
514,323,196 *348EB70EDFB54D9FB4CC81D994E898E1335A8AA5 thunberg)命名和描述。屯贝里在他於
514,323,197 *348DB06E4FD2EDDE4C62307425DC537601D5742B thunderbmarlboro4
514,323,198 *348FF625283463998672B3A68C7B95A87C66FC05 THUNDERBOLTREGION
514,323,199 *34856162821E8E672BFC527D9C9C5FF182D0E9A3 thunderbtennis9
514,323,200 *348BDF7E6A9A8FDBD1C633307081684ECACF16A1 THUNDERBTESTING
514,323,201 *348EF1CD09736B9C0B870095D09DB3E599ED5CE2 thunderbthumper4
514,323,202 *34860517C67B4FE1DFC9819B262786A633412F23 thunderbtrucks9
514,323,203 *348C4D07A55678C1C55C6CB21419974A9BFADD63 thunder dancer
514,323,204 *348DA3730059B64B4F4EFA44AF761016AFEE5EE8 thunderhamster1
514,323,205 *348F1BE0BC6DF32A90A4481F1F34E188DA9A9C7D thunderqwaszx9
514,323,206 *34885960FE89B0B9059E56F2DD8ADEEDAF202B5C thundersafe6
514,323,207 *348DB8D743F8582FACCD4E54D1D8ED58E733108B thunderses0
514,323,208 *348A3F049362B801F8D662260231D853ABA41847 thundersteelers2
514,323,209 *348481723F43DBB7196AFFDBAE918ABE255C061E thunderstruckagapeaghastagogall6
514,323,210 *348D825A4B3D7BBF83D1EA14A3AE1752EE0E5200 thundertempped
514,323,211 *3482C4A00E272FC023277DDCBBD49D1304835D20 thungsalaengluango
514,323,212 *348D7F2FFD74BD8F01AFBFAA4CF71871AB8BDEB1 thun)、マルコ・ザニーニ(marco
514,323,213 *34813C10325699AF4F4A39B045D5DE29C21DE825 [email protected]
514,323,214 *34808A411AD5ABD9C16BD47AB2E0ACA990224714 thurline6
514,323,215 *348768F47169A4ED965A8629C7D080267C9E9652 thurman.borzea
514,323,216 *348D437F5BE3A7006B2409D1C7AE1D8229F2BE85 thurman.crim
514,323,217 *348D18287DAF104A1D1E29003891C9FED8A0D4B1 thurman.deibert
514,323,218 *348061356DDDC486F8E89A5B725BB6D419288634 thurman.diffenderfer
514,323,219 *34812D0B3FDDA26829F5749CD475FDB00D5F1B3F thurman.equils
514,323,220 *3488ABCB5C40EB588D9B9031346611329A11AEE9 thurman.faucher
514,323,221 *3480181A46D97150F5014208530F1475F4B9C7BC thurman.goonan
514,323,222 *348675CF681456F3A7D80FC3D5CC0CA93F9058E8 thurman.holster
514,323,223 *348A1E2622CF5167A3B53194AB8F41C5FEF6498E thurman.kelln
514,323,224 *348888513F64C203282FCB8507CEFB06A88BD4F7 thurman.kruchten
514,323,225 *348D82AB5C42A1886278E2359FD94133C2868395 thurman.kueker
514,323,226 *3487AEDEF5E36E4BE09336FE5E551B90D59FF6AE thurman.lakes
514,323,227 *3489E5342805D5DFB7A268EB340C076E8A360269 thurman.lillard
514,323,228 *3485FD5BC72F3B7DF0D282BF6D72C30187CE8B26 thurman.magoun
514,323,229 *348C4473DD31DA8164183429F98DC40B0929AD15 thurman.mccampbell
514,323,230 *348A7AFF3263CD16E1E9043C7AD43854C9DFCC68 thurman.michales
514,323,231 *348C21C88081FCAB0CA29B8AA67E41091F5F25A8 thurman.pankake
514,323,232 *3489C6437CC246CFAB6F2FB63B0737D5E4331978 thurman.polynice
514,323,233 *348F876876018BCD524D47DB7124EEE3D603A9CC thurman.rumple
514,323,234 *348CAC75A0FF05C36CF2F5C1846C1478F3812F74 thurman.timperman
514,323,235 *3482096BA6E31434BBA70244234E8176413868B9 thurman.wage
514,323,236 *34862DE4B694922C3CA04D956B1F23FE0F5EEE47 Thurokiir
514,323,237 *3488C79B3CD378505CD2E0032E71C1F24C2C1B78 thursdayarchie9
514,323,238 *348AABF5CE8A2A46545FDA17C030C7BA02C90D2B thursdayasshole5
514,323,239 *3489DFD28B732B329821521261DBD89553151C1C thursdayceltics3
514,323,240 *34808D716FB9B1F3D75C5D331DE60202037DDE44 thursdaychangeme0
514,323,241 *348B2455A53D17F5CC02146C48AA848E884D2A8C THURSDAYSECURITY
514,323,242 *348BB32134DE55CAAFFC55E8D45A8FAA16E7037A thurums
514,323,243 *348E34620F04A429A9646CB521A57DBD9247095D Thuscum
514,323,244 *348D572070358DDD122A5B3A5ABDA2944D583E56 thuskers9
514,323,245 *3480072452983D77BF37CC236F8DB9F02040CA84 thus spoke zarathustra
514,323,246 *3483143CFB3435ACA9803698A22D751329E51E6C thuswise2
514,323,247 *34857E0EC1F761A4312CA1F2CB995675DFD0A999 thuynga100
514,323,248 *3484722548B04E7765903C07CE9329E6EA60BEDE thv,
514,323,249 *3488F6A645235BB0D7E3DFF2ADD5F91C17CAC5E0 thvringerwald8
514,323,250 *348DA4BC7C6C69CC4F536D632C87F9820225F06E thw4ckum
514,323,251 *348F1257F08218709215F90F416B4CC9C0985A7A thx11381999
514,323,252 *348F94522C971369EAC8A2B3CF43F47F4F2C874A Thx1138dave
514,323,253 *34805E47D8CFA934FF96061AB021E2E1321CE18F thx1138vdr
514,323,254 *348134B60C0D07CC2BE5A91D202850841F9CA201 Thy3$t3an
514,323,255 *348F91D608C202AE4EE30CF3A6C7A9870715BF57 thybridises
514,323,256 *3484EE5AD073B4124D375AA0D88225E5D82DEE26 thydatep
514,323,257 *348DC2ADC90218A25DC8366003C25ED50454435F Thyftlied
514,323,258 *348CC57A2B30F59CB7B3E046D85988335858C56F thymologique0
514,323,259 *348630758C411CD89239F560EE8330FA828A80D2 Thymous8
514,323,260 *3486CCF320935561073B0F5A987514AEB5443DC7 thynnyht
514,323,261 *348D7A38985DBF1D9310F63B17469641AE56FC30 thyr0idec
514,323,262 *3482303B1DE4AE97FE100A45080EB7F11DC120A9 [email protected]
514,323,263 *3486F549C7DB1AB32C4C62E9AD8147FE1F975745 thyrclctnn0
514,323,264 *3487CAE81E4BCB7FE810B9DA66BAD694006E11CD thyreocE
514,323,265 *3482DD9BB55BB03D5C4641AB9B5FE4DFF5EB751D thyroprivals6
514,323,266 *3488D70000AFEDAC87D88FC49C990CC340DDDD27 THYSANOPT
514,323,267 *348919971E65D7FDFE1C2D32260496B36F662437 thysanurimorphous
514,323,268 *348ED96CB484A8D054BC8307F510A19A8B2B7567 thyself.160
514,323,269 *348CF011D4DC87B8B5A37050CA6D77225EBB164C thys yol
514,323,270 *34850759ACBCBAA200516F16AA639370B79CB4F7 th_ziemann
514,323,271 *348C68913C8BBBB43D842D2C5AA76CDD3B9EC02D TI،
514,323,272 *3485AF34C12E0F20DD3C686737EEAEC340889FE4 t.\I
514,323,273 *3482569815ECCB0E37A95A44098CD31DB7E6233E tI..
514,323,274 *348A4D45DE707AAA602C0740553A63E31E646C12 t?{i
514,323,275 *348F683E0583846AE221FD091DB93541BD289405 TI10NA24
514,323,276 *348C9CA6D606EC44EE113A113E2858A27EE2C334 ti9poThbwEC
514,323,277 *34804DDD3208E93AE8C8F9FE30C9330B81B2371D «tia
514,323,278 *348C259C16D399F1BB486EFAE953875240BC0A24 tia12tia
514,323,279 *3480773669087F7BE29308CBFA1E1361BD663AF9 tiadnecsednoc5
514,323,280 *3488AE99DCC1245ABB676FD8591F63E40C0E812D tiadnefed4
514,323,281 *348805065BFCC7A478C6D647908D0E3E685A2C4F Tiaegilg3
514,323,282 *34829C7EAD635AF99A4F14691AD3D04D7AFE55F7 Tiaffib1
514,323,283 *34879B61908CFEBB8BB891027175FB7214DBE3D0 tia haywood
514,323,284 *3488F773E6BD42D962C01E2C830268DF60439385 tiahcnap2
514,323,285 *3481DE7568D43916BB5F41E9518618A77303899F Tiahuanacan3
514,323,286 *348ADC254EA55E8B84C1FAFE2675122CC6455390 tiaiskerttuli
514,323,287 *3489BF2072EEB59E21844EDF08C8173389C92A12 tIaj
514,323,288 *3483BAE941813F8B7D0AFE45C96C3E1D74BFC8C8 tialinas3
514,323,289 *348396776527705D6E6EE4E844C5938F790E51BF Tiamrala5
514,323,290 *348B2334AFBE72BEBAE2318FFB5C4CAFC6FF8073 tiamuserP
514,323,291 *348FE709467476262D4A23B1618E1AB614C0D3C6 TIAN38
514,323,292 *34828B2EFB35DFA206962BFE43D327243B3BD1B5 Tiana435
514,323,293 *348F5D8522A76E178184F4A42D2C11A4B73C6174 [email protected]
514,323,294 *348BF05FFE0ADBD95DD48C1560F4FFEF685ADCC5 [email protected]
514,323,295 *3483EA47C2AF3168EA6C1D2117E9E53ACBEC4144 [email protected]
514,323,296 *348C196CFE55C4D4A3ED1F8D489BC08F4E0310DB [email protected]
514,323,297 *34811199847EF4285BD7D8F153B4691CC6570E4B [email protected]
514,323,298 *3488018EBD2B12699C65A2246F7A760DEB25C19A [email protected]
514,323,299 *348897A9331EE47DE02F6DDCB1979E15DF2EFB37 [email protected]
514,323,300 *3486FA69F97D192F42C7FD12C3A915ECDAF88C82 Tianchan
514,323,301 *34865BF8F4CE92B17AA32E4F5785CB1293A9BF5B [email protected]
514,323,302 *3481965C5E27420EB378104194C30AC96C5D6F58 Tianchishan
514,323,303 *34881BA4B51D8FE4A88AB9A718D093837292F7E8 [email protected]
514,323,304 *3480151A92BB22301F638F805E128CF95723BC14 [email protected]
514,323,305 *348755C88D69955AE4F4EEC589F9E75B6305C7DF [email protected]
514,323,306 *34883BDE65FA4A1DA4CBE633677083456EF8F527 [email protected]
514,323,307 *3486352539053CE9A45F02F3E0C22501DFBB9AFD [email protected]
514,323,308 *34856844407610FDE3CB43379FBD5428CABDF425 [email protected]
514,323,309 *34826680DA8DEFAEE46530A58F1D4877E5CAD252 [email protected]
514,323,310 *34841E321E9E47175B42C6C9C590D235D451625A [email protected]
514,323,311 *348C363B17D721B8D615CC93F9560B10759DE02A [email protected]
514,323,312 *348D53D9376795B008911839B14EDA313F5CD9A0 [email protected]
514,323,313 *34873C9BFC31975757AFE5014A0A08FF1940B4DF [email protected]
514,323,314 *348585274DC574CC4280FBA048CCBB109DE3391C [email protected]
514,323,315 *34851251DA1DCFD9BB866AF18F58ED068E87E86F [email protected]
514,323,316 *34828566D3E69E1B484EC558C9E053B37AEB6B22 [email protected]
514,323,317 *348E7941F471E026C0107BE297D2A411B8B6D2F1 [email protected]
514,323,318 *3481B054BEC7E93FD5E3D72F2245AC9B2B412BAD [email protected]
514,323,319 *348DE863991AC37304A5D90FA889ACDD267AE48E [email protected]
514,323,320 *34898EB982F85C8C7F8D2CE61672A982E740B209 [email protected]
514,323,321 *3482788D5206D72E58182EE9A65EC017D3FB2399 [email protected]
514,323,322 *34850DB504ECA422CEF82C5BFB36DA9280827B86 [email protected]
514,323,323 *3485E1342044124DE23C7163E3DCA15349281111 [email protected]
514,323,324 *3487A34391444A97D3AD4BBEE7BA02B0017A311A [email protected]
514,323,325 *34872B3B8A3A4748431919AF3B55B29BA6705C20 tianna richardson
514,323,326 *34870291F9B439CA541DD380F089957037F4CC9A [email protected]
514,323,327 *348C54E8F0669E6BA60F426A7046B34572D84E22 tiannolip
514,323,328 *348A56AA6657B20B811ADA339984893720186B7D tianolan
514,323,329 *34801F76E56CDB67AA297DD0207D7005171CFBF6 [email protected]
514,323,330 *34824A257BE45033465B7D79CD278608DCDCD60C [email protected]
514,323,331 *348F9880D69FA0192A80D5F7C9D3ED643ADBB9EC [email protected]
514,323,332 *348043A6B7AD0DF6349FD881C4DDD92E67D39CA6 [email protected]
514,323,333 *348F00FF969C3B5393BB803F7CE2D1F2832E00F2 [email protected]
514,323,334 *34846D3EF97FE76347CA09EFDCCA9699DE6484DA tiaokhiao3
514,323,335 *348B96E1FBD49D59477DB28984E63D77CFFB9A23 tiaozhao
514,323,336 *3480A4B27E611D0464068C7FD9BDA1B72CD780F7 tiapacid8
514,323,337 *348AF84B5B5E5845726EAEA7CBFB2CEBF52071B9 TIAPROFENIC
514,323,338 *348256171266D24682CCD1845A6891D296BC6F0A Tiara656
514,323,339 *3486D3EDF378A669A209DBDF10C91D4F341CBBC0 tiarbili5
514,323,340 *348D8C05F44AD1C37B0CA92420D9577E1B94C1F1 tiarcasnoc0
514,323,341 *3480C5B8D31C896B405AF24EA3430BF6ED5EC0C3 tiarednics6
514,323,342 *348ED03D2733AE67FB71057E72D037E49003681A TIAREFFIOCER
514,323,343 *3482918E8D928E4EA4CD7B124B0F2E1CFA42109C tiaregallirg1
514,323,344 *348E01B1368EB4F87C1D76BAB079BB1176504323 tiarehcif9
514,323,345 *348D995F8AECD9D61D51A4159607B3C1B86457CE tiareilo3
514,323,346 *348D819FA1B8D8CD4070A884CB9E0D5EAC84F8AE tiarelog3
514,323,347 *348D82788FD1FD6A2995D7F7584F9F4270FCABB7 tiaremuf2
514,323,348 *3480E7E39B25D6634B969ED98A169CF88C4A0716 tiaresilivics
514,323,349 *34894F2CB669EEA79685135AFFE1EADF4099AF32 Tiaretef4
514,323,350 *348766F173D201A32AB665FCA9F5DC6E7932B0AC tiaretelpmocs
514,323,351 *348432A167D860F15306BDE258B9F0557575600B tiaretnius6
514,323,352 *348DE3503F672195706947AB5C8A265094979078 tIARLE
514,323,353 *348B87BD3DC3BAAF9CB8B96BD8AD0E06E8A8B7E1 Tiartsul9
514,323,354 *3484B2A8C93BEA0158D60D7E72B197C18ADC8715 tiarvuoC
514,323,355 *348453E3F03332EE4423ABC6B74E707679B7287E tiasopat8
514,323,356 *348A4FAAB9B44AC71BBA424D013B22BD2F767D33 tiassalced3
514,323,357 *3485BBACA1928210AD8786DACF4C2CFE41179C44 tiatialla8
514,323,358 *3484DF07271C224D5A68FC0E1F402DEA9B3C5898 tiatiV
514,323,359 *348698C3EBB159814ABCD6558C68A0E882AD1831 tiatoket5
514,323,360 *348B2F44B388E4290773B7A9B2DFAC24E82EE481 tiatseled6
514,323,361 *34873DFD0D58E1FFB49F5E9B84168E3ADE4E9036 Tiaytro
514,323,362 *348DA2795FD667A64DA56A53B15F9BE31FFB320D TIAZHELOVA
514,323,363 *348C8ED5BA54D159E4CA6F95BF38F764EF567BA2 tiažové
514,323,364 *3487C994AA59D85B9B17B998549032DB2570A1B3 TIBADABO
514,323,365 *3486415D69BDCD9CAA0B23EFE0E8FBB8BC0CB38C tibbiying
514,323,366 *3481FEB93CE0C3C6D1D5BC2EAFB4DA1EC15D68EC tibbohworraps
514,323,367 *34863923085198218AA657575C47AE24EFA4369D tibeciwt8
514,323,368 *348A98FD6F785E1F150B079F2783A7D47B89E72A tiberien
514,323,369 *348B8B74A0F45A350130C229376505300813C880 tiberinamontecastril
514,323,370 *3485B2A23A9C7F922B76CD02711E4642CA78EAA4 ||tiberio
514,323,371 *348EA1701FEFE66044D26A0F4E48647E0E338047 Tiber's
514,323,372 *3482D86FF02734E25C32A33CF4F85ADD9E3A74E4 Tiberu
514,323,373 *34892A0B7AA25B43BF383E47D358485B6502C694 TibetanMastiff335
514,323,374 *3482E4724810EC3FB89642899BB985629CF1E124 tibettsering
514,323,375 *348F7FB379AF79441DB7BBFA2D0114E10B150D5F TIBIA23
514,323,376 *3487F2ED33E22321075CDF059B4748D03ADC0EAB tibitzted
514,323,377 *348238C3706F5B36E94636385E86D2254C1B223E tiblmthofniferhs
514,323,378 *3485FA1FBE414D8D01173DC8BD2546965334324D Tibolla123
514,323,379 *348C07917016978B389F37677543757FDE329063 tiborra
514,323,380 *3483E7976D1AED426FFAA3E6F4FA75CC947EC61B tibullusbsw0
514,323,381 *348E60DD676216B2EB28635E5B0CEA9474F4CD77 [email protected]
514,323,382 *3489FEB419E4A4725C3FE70C57F9F3008B858737 ticamagalhaes
514,323,383 *348ACF4E1B7D26B7955F34C0A141D2D2FCD9F364 ticas,
514,323,384 *348EA2A5199951196A78EAC2BA3B39C42D85E453 Ticatsod
514,323,385 *348B0A75F237EEE1DF3B6FB04DE37470AB81AFA5 ticheses3
514,323,386 *348479BBFB9DBBCFC45A656408BB71D17A1156FF tichwahled
514,323,387 *348E87061BCD587CF3EB2C46C7CF498D2A75A778 ticimini0
514,323,388 *3480874A7A619F9EDCC68724B776D2E2FA71F3A5 ticipons8
514,323,389 *348C4BA6F52E056A5B4C70F93564842DAD0D0FE2 TICK500WAL
514,323,390 *3483808E4C356469E0FB6A4B8D156AFEBB70FC05 TICKBABY
514,323,391 *34835F10A1BFE1A04F7FC8DC0FEDA0B45642E258 ticketcrystals
514,323,392 *34869408FC9913BD02D8B7B5B09E27FD6FF0754A ticketscalperscalied
514,323,393 *3486F1932E7C41A77915E28B9A45AFCE973B2E67 [email protected]
514,323,394 *348C390A5780035A8C873077CACADCBD5EF275F5 tickmarksBSW
514,323,395 *348A73A13013A064AFA037C94350E58C21C91AF1 TICKSEEDED
514,323,396 *348BA0D62D5ECB20744BF43367F48F1D79DC72FF ticnequi
514,323,397 *3487F6792CB5179D6279DE2219795F0A5685EE01 Ticonderogaklasse
514,323,398 *3483CDF64E373A6C721F0CB231D57CE391C2A3CE ticquet2
514,323,399 *34897B073FF8555E761A1897254485A7CDAB381C Tictactoe?
514,323,400 *34830E39F64DB023C36F9FF78906F1FF72494558 Tictocki6
514,323,401 *3484568C454D49256A62669CC22426BBEB3B7DB5 ticumanense
514,323,402 *3480160CCF48FFE0C1974444313BE35EAC30C2E4 TIDABEFA
514,323,403 *348EE29BC36775F3FE56DEF8DFD7158169E81731 tidalwaveemulation
514,323,404 *34887AA4E444E178668251319EDDA950869CC91F tiddlywinker3
514,323,405 *34876AE528C025580D8F06C1C22C8277A96B00B5 TidesAbadan
514,323,406 *34819509CAA2E6698A77B5CAEE4818304B91A4EA tidewatered9
514,323,407 *34836955D874A2A50404F1A9B50694B777A02D66 tidnesylloH
514,323,408 *348D18B3144DD0804E31B5C55D87CB37AE401834 tidning”
514,323,409 *34852FE51F37ECC88BF51EBEE48304359D7BC057 tidsflgen7
514,323,410 *3487E72C1881BE031EC7A3F78B1B4E82C6BC4285 tidssdit5
514,323,411 *34813172868F9797EEB8E3C52A71B6015C88EEB2 TIDSSIGNAL2
514,323,412 *34826D961A42A2D939E1240386ECCD6A92D61F03 Tidtakning
514,323,413 *34834300EDA0CEF129C9480C04FDB704C6D1F987 tidusyuns
514,323,414 *348D89F4AAA2A07841C8F000B26DD863FB5DF563 tidy.160
514,323,415 *34811395B0D1A23921E918E90ACCCDA1D49EDA57 t'''iedemann
514,323,416 *34816BF290B43FC8E0334F88510DBFCBC7F4F63F tiedonhankkija
514,323,417 *348B111F2FAC6CD183262664F11E0E5D67E2775D tiedonmurun2
514,323,418 *34871CE75A5DDD013BB8CC4CB4408AF6943A27F8 tiedostonsiirtoprotokollan
514,323,419 *34851296749D938279341CDDE7E5808D80C71862 tiedostossa9
514,323,420 *348FBED125B8DF6B95F6997A2A8C439E758DDDE9 TIEDOTUSVLINEILT
514,323,421 *348A174C55C791A827E0A1DCABF4B567AD6CE2CB tiedotusvlineisiin8
514,323,422 *3487FA9CB1BDD16782E563D5755BBB5D3A3AAF1C tiedtking
514,323,423 *3481E9FD9951FF0341D155AC2D956A6430A985C8 tiedustelutietoihin
514,323,424 *348374E93FB96880404C86B85C8217F73F30387A tiefbauhohlr
514,323,425 *34846BE33C323E467119C1D47E1F49ACD0C97BB8 tiefgekhlter9
514,323,426 *34806189D33EA682869422CDD715CCC83A03F15F tiefkühlpizza
514,323,427 *3488998B4757D25A044797EB28E0CA5C0EFCB721 Tieflof4
514,323,428 *34801AEF328992332F621CD6C57B730EE738282E tiefzuladen8
514,323,429 *34880B14D6415752779D469751348C9507E15F35 tiehnielletseg5
514,323,430 *348B04B4E33FC8F2507CC1765FE2BC91FD83DE83 Tiehrev
514,323,431 *34805CB2D9FD5E3C96452283A9BF7B2F3437381D tiekgidniwhcsegneblok7
514,323,432 *348F8C889327B91DAE02D33AB36E64A48EBCB842 tieline1
514,323,433 *348649824F63E641F67BE349ABCC4E4F34D1F1F1 tielogirg3
514,323,434 *348EBA0212CE5C5243C61A7B6CD703BD9EA84309 TIELT{{N
514,323,435 *34881052F8CCF330F5AD18959464FA2F8953582F TIEMEN
514,323,436 *348E78EE30853A5CACC2B1EB0522CE8D5348643A TIEMPODEVALIENTES
514,323,437 *348BB1E0370EAA33CEC642690EC49630F0B0AE75 tiendheffingen9
514,323,438 *3486AF2C7FEA0A1B8FB11464B77021352FD5BC44 tiensche5
514,323,439 *3482290B15DCBAC17642B4F97EF6DBF155FF477B tientsin 19 0
514,323,440 *3481A5A594FC47700CBA72BD70ABB24134CB36E2 tieornaa2
514,323,441 *3489B7884200FDA5E8C2D080CF336067193EE501 tiepin's
514,323,442 *348973D166F9BA04BD1A0B9851199E03CF951E99 tierceret
514,323,443 *3485E43A6BDC2E368BA9619458B6B5E5D54A2EE7 Tierelantijntje2
514,323,444 *348498F921F9A7472D0EB96051C19E474FB1641C tiermutsed
514,323,445 *34886A0EB42889FA7B67BDC3DBD1185C8333ADE6 tiernannanooch
514,323,446 *348F77F34D99B8FD2B1AD38C1EB9FD2FD69A055D tierpsychologing
514,323,447 *3487227843A707DD596E20714FE75D980D0A7600 [email protected]
514,323,448 *34843BC331F9E5237748B8321C740DC0688CC377 tierreic4
514,323,449 *348D95D8FDEDA30ADD8CB48910FDB730C160AEDF tiesdeal9
514,323,450 *348E36AA3BCA5E092E907F32B5D37812163F0A11 tiesdivagatedriftflake2
514,323,451 *348A4E57BC81932E5C3FE30DBC7954B7A9ED1D6F tiesuunnitelm
514,323,452 *3483917C0C18791D2E1E8EA7FD1B66BC784AE7DB tietaemaettoemyyttae8
514,323,453 *3483EA2D2C37DC4DA4A2D858D0DAEF82C3A7FD2A tietämättömäin
514,323,454 *34849FA23B832BD8D626AE5F815AADCB326EA186 tieteellisyteen
514,323,455 *348F0B384418F71CD6FEBAE4F178A190FD903AB5 tiethlsu0
514,323,456 *348301E0D4C5C90BC0C38D6B9A3987C50D1CA177 tiětí
514,323,457 *348BF116D89D3BD16AAC98DF7BBCC36A39C8115C TIETOISUUSKAMPANJALLA
514,323,458 *348925D5AF149B6B23CA23538C369779BB71EE28 tietoisuutena9
514,323,459 *3487DA7745A4BC1AE1B70524A65A3AC558823F87 tietojenkaesittelyssae9
514,323,460 *34817AFE5483B4DFD3E9FA148384515182AD317B tietojenvaihtoj
514,323,461 *348560B4E1137F46AB33CCAD0E00FD30CCEF2CA4 tietomaitaed
514,323,462 *348E1121950F9ADE44FCBAFA50CB1F23FE8F1B12 tietopalveluy7
514,323,463 *3489ECCF99A525E4519452C440F240EC57280791 tietoyhteiskunnalle7
514,323,464 *348A77C339201FAFFB680C2EC61638C618D964AD tietoyhteydessae7
514,323,465 *348E171415D71BACB5A411DDA9C1CEF27B2DEC4C Tiezhong9
514,323,466 *348CF42584667F50BE9F0CC3F71246F3D79362FC $tif1e b0
514,323,467 *348A6BB567AD1BE2E12DAE12DBBFA885F7814790 tif894d
514,323,468 *348F8C1B23350C9A7FB349AF7DADD52C280849DF Tifanied
514,323,469 *3484A517E8D0A7B7344E676C524598D0BAF25F47 tifeneberp0
514,323,470 *348D1197EEF629A996F9D22F7C59AA2AAB17456C tiffanyaaron9
514,323,471 *3485C1D3A588C03AAF431BD69509987D699CD919 tiffanyariadne
514,323,472 *348A0C9AFF76166BD0068DCDDD0B1D7BF65AD089 tiffanybrazil6
514,323,473 *3487EC3875CC41AE229DE1F7D75C51BD2E4E505F tiffany button
514,323,474 *3489FCF0693B0C22C18D9E9AA5BE310376699C83 tiffanycat6
514,323,475 *348513F6B5994E66714D3F2888FB90179E0338AA tiffany comstock
514,323,476 *348BFB8B750FB2DC4D6B3B31F9CD31B67AAB444C tiffany harry
514,323,477 *348FEF699E143C799234124D54125F0C60C7DC8F tiffanyhouchin
514,323,478 *348F99588B1C46518D1E2C4888B7461FB27BC870 tiffany...i'msorry
514,323,479 *3488B7D77D948968AE2B863C219F5CE585FC5C9B tiffanyites3
514,323,480 *348CE1AEABCB43DF1125C9C2522F41F2CD9ADFA3 TIFFANYJOEY
514,323,481 *348DCCA5BE7CFF1DCC062AD8FE1F87D844AF36C6 tiffanyladew
514,323,482 *348E3EA9F75473354CB150819304B81AEFFCE43C tiffany marcum
514,323,483 *34854EC5CBD3388B99D04EF4E08F328DA3F3140A tiffanypepsi7
514,323,484 *348E1677534001FC2728E750BB81BC78DCC4CA45 tiffanyrichmond
514,323,485 *34836E23B6C27B263B16C4DC39967E12CB724BB5 tiffanysolis
514,323,486 *34881D9910405D4F3E9D45881B7A359269D6E7A5 tiffany stogsdill
514,323,487 *3486B3752F661DCDF83D186776E8DFBCDA36C2D8 tiffany thrash
514,323,488 *348026764059707E8E1423AF82F55FDA396E64C1 TIFFENY111
514,323,489 *34818E7BDE41C317AA153AA105359FDEB2C490D7 Tiffiny Monet
514,323,490 *348AB44C828484657999AAE79A1E283A35D29254 Tiffnee5
514,323,491 *348E8AC0CD66C01317D5C648369F1F49D0F9EBFF tIg,
514,323,492 *348BF90C4E5B587012DBFB3BD4F6661EB98D90B9 Tigaとは3を意味する。ただし、ドスゴドスのDosがスペイン語の数字表記なのに対し、こちらはインドネシア語の数字表記である。
514,323,493 *348AB02C2E2CDB1C287FCAD8A8C75BD31F456C41 [email protected]
514,323,494 *34853EE1EA3E81EFCF6A44795E563F52B82A1FA9 tigasaw
514,323,495 *3484CB91C197DCDC8AA1A7E2918D61A40FBB869F [email protected]
514,323,496 *3483683E3C83FDF95A50DEEB4B14389179947759 TIGERALFRED
514,323,497 *34856EFB790DCEE6FF96B6B33B397735E1B175F7 tigeraliciaed
514,323,498 *348C44A55F9BCC8FCC3DC6AC67F5654FCF98693B tigeralqadi
514,323,499 *348F0640F14831E1F04B7D646DFDEC1A4E6ED6C2 TIGERBASEBAL
514,323,500 *348912BE56A242C1BCDB5AC15B1E7AFB4C88359D tigerbrutus1
514,323,501 *348C7AAD20D1862684F16C9DFA1CFB6F5CC73734 tigerfun2
514,323,502 *34867EF3ADBFC10B64BFD8B30D656FE161D99A7B tigerhockey1
514,323,503 *3487687BEA4FAC3545E646B5CC809D8DD4938B0F TIGERKISSE00
514,323,504 *34880D9762ACD96D454E7557D8ABAF0485A276EE tigerminnie1
514,323,505 *3484F770D394798871477743F464E3D11816BAF1 tigerolivier9
514,323,506 *348723846937D5F032EF0DD02C8E562B9F115C4C tigerracoon4
514,323,507 *34857D1718D9E1B159F8384C1AD189A2B42C9D10 TIGERRANDY
514,323,508 *34814BA767C105EB6D49147A3F8B257351344F30 tigerreynoldS
514,323,509 *3482DDD2956CEC06BA54D3F105C67D5383487532 tigersbootsing
514,323,510 *34821B46B4F80014301A02EDFA52F485754337B0 tigersbutton6
514,323,511 *3482D7E719E2367FA73730A185EC39C3E62EA87B tigersharkebswed
514,323,512 *34818D18BABFEF85D8BE69A01235704537F0C121 tigersjoe2
514,323,513 *3482EA22B6274447D064028B860977A8CC97708A tigerspackers0
514,323,514 *348CE6590E9F486B429490BD9E5544A662243A49 tigertest8
514,323,515 *3488363B594983BB5846BD62E4FA11B991696266 tigertoo9
514,323,516 *348C4D5CC9C87FD30F87BD65DE40E6FE3FAF510A tigerzap1212
514,323,517 *348514F597CBEA19B0E573EA28A4800AC025F25C Tigezläw
514,323,518 *348623969051E62B957B22FCB93648C20C4A0918 tiggerabcde7
514,323,519 *348383B84AC484DEB192691F43C1FDB2300D5722 tiggerbarbara6
514,323,520 *348B0A549FCEA4E24ED4814E149D1FCD4F587E76 tiggerbroncos7
514,323,521 *34805C6C7E152BE30E1D0019B97CD64A80028249 tiggerchapmaned
514,323,522 *348CBC6C1C0C89B872424C1E067F39BF9D280DB9 tiggerdexter4
514,323,523 *34839A8C232D61D723122EC602F6C29665A93E73 TIGGERDUDE
514,323,524 *34823EF40265A86F8A797E3F9342FBEFD08CE2AB tiggergrumpy9
514,323,525 *348C03953978385C80FF9508DB4A555CA07E640D tiggerkids9
514,323,526 *3485404BC7F3B43CCD0A3E3A8F5F0010E48BD535 tiggerskinny0
514,323,527 *348E75C9B3F068D502A619EA2981817077401E3E tightening-up
514,323,528 *348D5E23FF7DAFB9442DE73AC975CABC32AC0C94 tightly-specified
514,323,529 *3484523B4A53C08C380DA79B30B42B088E3734F0 tightrei1
514,323,530 *348AD62F6A905F510141F2AB3065A9DA997375CC tightwire2
514,323,531 *3483E5569FC2D66A4BB8324D41270D11D12054D8 tigiuanaënsis
514,323,532 *34805CE8622269B779A2D550E2631187D94BDC48 Tigonses7
514,323,533 *348D3B2270C9CF82B22D1DE5A1348189A6AD1973 tigrecowboys9
514,323,534 *348A35D395537A0790BAC9935F038AB36F083B62 tigredancer4
514,323,535 *348C1187D6DCCF073BDCF722FD337176547A03D4 tigrerussell8
514,323,536 *348FEF71FEDDB8F9233AAA6445707E8C7D13B0E8 tigresamson9
514,323,537 *3489CA2A280CDBE08389627CEE5F770C50A33D57 tigretucker4
514,323,538 *3489D25150BEE7816B6E99EFCD0905523085662E TIHCIO6
514,323,539 *348634C12E5AA7183683B562A2CF04048F2EFFE9 Tiheysmatriisi
514,323,540 *3482A06907F58892A42E98E2E02B1F5803BD7EF6 tihinpaluuta3
514,323,541 *3484B36A31F3E40C7D40A1D24A184B47CB0A471C tihomirjaksic
514,323,542 *3487D49E4450D82EC4C01165392D6F7A2D270942 tihomirtodorov
514,323,543 *3484DBFE74589A09B8DDC03F0BC48F0EF388B962 Tihookeanorflot
514,323,544 *3480656A03DA2E57DAF2B0BC31FFC0508A0DC316 tihsllubthgirb
514,323,545 *348A14BDBDD79D1A6D5246CD363EF0236D095546 tihsllubytteb
514,323,546 *3481E897A9FB0A93FC70BBE53350807C713BDD8B tihsydnarB
514,323,547 *348CC55908BC8623440747A26A2DEDEDE1DE0CF0 Tiibe
514,323,548 *34827E9930FFFD6FECBD9C69D5E0AACB4B296931 tiikkaa9
514,323,549 *3489A615B1E7FE05F4AD8C16E78A334B584C9C6A tiipinueihcra3
514,323,550 *348063746E48DBF1B34782C1DD3DA63EC99B29C3 tiirek
514,323,551 *34858FD1A3CE75B199FE2C310472E5EDF233E660 tiirevil1
514,323,552 *3482940DDA392D83EDB569344F840D0218C8B9E4 Tiirukivi
514,323,553 *348B44DA78AF168B2ACB09C1D0500D9F496B7A01 tiivinsa3
514,323,554 *348C453E10CEF5F09F3E17EA3C7F22F4757D92C5 tijalsias
514,323,555 *348663A71C0A0F4A59FF2DAC3513E6D903F51474 Tijayajing
514,323,556 *34850C4BF240808BFFB26FB1AE3CA74357788FB9 tijdperken5
514,323,557 *3483FE59973900979A877719C822561ACC567BFA Tijdregelingen1
514,323,558 *348F3423501B913535531E042C791629482FCFF6 TIJDSCHRIFTENZALEN7
514,323,559 *3480E751D0FAF7FD192B3D13BC24584AD38C333F tijnenem
514,323,560 *3485DF4ED34309B8A735340DDB80D8E296E9C8A1 TIJUANAKED
514,323,561 *348910987D594B2491291164FFDB531307BE2172 TIK543
514,323,562 *348A08E8463150DE509B873BD7F65F192CCEE680 TIKAMARIE1
514,323,563 *348901C9B226C201E05C471D1A8669761B78A122 Tikanmoj7
514,323,564 *3489D6FC5B98AC00443F4562AC7E1E850FF927D4 tikeimer5
514,323,565 *3480A49033D0E13F88C12C0582274DB4EED25449 tikerkas
514,323,566 *348FD507A445DF4DC88A65935D1605FC22AD082C t
514,323,567 *3481CDCBB0A047F8296849A27DA5D16810022E5E Tikillps
514,323,568 *34835662412D96FC2BA3E47378800D84717136AF Tikisa
514,323,569 *348E8820127AA0D692783B32C2C346969F6C32F1 tikkaoja
514,323,570 *34842645E2373C5780E880D910BAE00055C42DBD [email protected]
514,323,571 *3483580DA9B159D75225B2C15D2458D7425D04EE tiknuhcl
514,323,572 *348DA22D653A860CC1AFA7A967A7FC608D9A9701 tikoobeiggam
514,323,573 *348786E89EC1ABBA12C8AD12456A33F3F836D555 tikroning1
514,323,574 *34852D1FFADB878094AAE0D8285FAEFC29086AC0 tikuksi
514,323,575 *34896CDFFB58EDD8D82F54B61DE3744DD843D7E5 Tikukyous
514,323,576 *348CD8D0B08DCC79FE8E68FEE3F7E65420234FB3 tikunous9
514,323,577 *3488F81860A576DBB14D6106982DEA8D4A64B107 tikyuubo6
514,323,578 *348D6547BC1152E5393B6E8460A61C5587F884E1 Tikyuumi1
514,323,579 *348705832CF3675BE4341C41351780330B3E8DEE ”TIL
514,323,580 *3480993C454878D070D3996C2068AFFDE6669133 tilá
514,323,581 *348D2B0C05651060F575814766667E7C6B499903 tilaidar8
514,323,582 *34893C3EF420875816D2D747ACAC485C48C9F0E0 tilakranasinghe
514,323,583 *3486EEBC882D7B37E1721EB1735C6D4721CA10E2 tilallaaed
514,323,584 *348E1CAE4CA2020089C9E4524F46EEBE8505431D tilapiseksi2
514,323,585 *34841E306C6B36E819B149399F6785A83B04BD37 tilauksessa1
514,323,586 *3484D6427EA8C7B720AE4BDE7196909700BD0137 tilb4g3k4
514,323,587 *3480E2EF4842586AF1F75BB4C88D6161AC909999 tilbaarders6
514,323,588 *348F719805BB6941F1AAF427AFE62F089ED82EF8 TILBAGESENDE
514,323,589 *348201213D415F52BDA781684D7EC0EC39B72B89 TILBAKEF
514,323,590 *34829FF35662AD1145FE42FBB0DB2D59368693F0 Tildriv5
514,323,591 *348DD919417517A5DA425F3746BD952BED2C40A1 tile64.com
514,323,592 *348FA6D9A5B124E4E24BAB273BB7CDCD47970EF0 tileille3
514,323,593 *34821C384DBEAD5BE6BC72EF48870626BC3E6D78 Tilelohc
514,323,594 *348857CA70917ED8EC787FE73D472D1F4AEA2401 Tilesview
514,323,595 *348135503BFCB2D9F125E3E83A479641C743118C tilethaed
514,323,596 *348CDF4874B8B2B6EE3455FBC4C16589700D9592 tilfella6
514,323,597 *3486347E30BD874DAD1320AAEFD28A4AA63C283E tilgjengesystem
514,323,598 *348BF7A96117D4C78A8F1ED309243C1A2F048100 Tilinpäätöskertomus
514,323,599 *348B77C5DA98E332C5379C0C6D4C87DDC97E4CE1 Tilises1
514,323,600 *348FEB4B649392B9B19EAF2023FE53CA9448AA96 tilisions8
514,323,601 *348425319423BDC82F9241B589F71C7ECB1400E0 tilkaldevagt8
514,323,602 *3487E443B94525D6ABEE4E40967C1347DB6BB1ED Tilkalting
514,323,603 *34886869B6BA4586965D4CE6AE3E6053EC1BD733 tilkoblingened
514,323,604 *34808E2E448273AC2C38E078CCA68CDC0BC73010 $till4gen
514,323,605 *348F290D6BA55BA1E84FD9084CD6EF6791EEC7D6 tillämpningsprogrmavara
514,323,606 *348FCF9D676AC2E5F2B790C5C0FA50E7591BB483 tillatelsene8
514,323,607 *3489A196D06AEB0D3F3D0AABD69639599C830DB7 tillitblowuprain1
514,323,608 *34859D65232B6D25984E189A4D6CEB4A6A69923A tillordnings2
514,323,609 *348B63ECAEE22A5504800A995BBF9BFA1B57F976 Tillred5
514,323,610 *348056CEFED7FA6DF59ED7AEF6C372F509832A19 Tillsesing
514,323,611 *348A2AC7A9BCD706FEB04616C2D7D64D558E1B7E Tillslut
514,323,612 *3480E31C71A8C10C6C2DBDB674FC8E326487941A TILLSON0
514,323,613 *348E6FCC25AC393D5FC0F79ABE992856A4993DCB Tilltar3
514,323,614 *348850E5C5158027E10D62B59ECD186E44FC4860 till thrash
514,323,615 *348671873070D3C2EBBCD408D8962F5DF9E831DB tillthyblood3
514,323,616 *3480EE8BD500C2A61FAA26BA077215E8CD08C8CB Tilltons
514,323,617 *3485F83C65D225822A496142B1267C657749DEC7 TILMUS2
514,323,618 *348C9BB05551EA63312CA040551E0790CFCF5E37 Tilrbened
514,323,619 *3483FC399476093BE0DBF92D46ED31FE34B14B9E tilsende7
514,323,620 *348179ABCCD10A3485B107F94347FCE343F712F7 tilsiinga0
514,323,621 *3483FB91EB5D0FF5CE5D1D3C8FD36B95D09FC9EB tilskudsregelens5
514,323,622 *3480642635EB0D7CA6D5AE1F877E987378EE744D tilsmilesed
514,323,623 *348AF8D0F5CDF298AC403B24D0B01983C88D2D62 tilstoeva1
514,323,624 *3484F5711C9A66B0198E51AEEB29A8E07BAFD3C3 TILSYN9
514,323,625 *34802AE98C06B70BCE7BCA1453C9E701EA11FC4E tiltækari
514,323,626 *348D7BA2BF9ABD1BFA545BECBA8BB7C9F33A07E6 Tiltrnge2
514,323,627 *34820E235AE3464CAAA286353EC6BCD552F8E383 tilulii69
514,323,628 *348B106B539DC995F3044A239FEB5CDB0BB59669 tilvejebragtes3
514,323,629 *348D356904D63A972C976B66FE65C1A3E410115D Tilvennied
514,323,630 *348EAE8F5ECB7B12EB69199497D1915A966D2146 tilvrelsesformernes6
514,323,631 *3486BD66D7E3D22C74C092BD299C953C27D6427C Tilwana3
514,323,632 *34814DD437D560C715FBF0D801CA5895955714E9
514,323,633 *3481A29560ACBFE43318A167F105680074F07A80 tim3rmsg
514,323,634 *3488B8D6836B3C08D037945C5AEBE68AC73BE421 timagimi
514,323,635 *348916B9D44CF7962EA1428F05B6342EBFC51079 TIMALIA
514,323,636 *3484F83C7635E70BD2EADA8D39B5B5265BFADBCF timannie1
514,323,637 *3480F67C35A415581B5C91ED086BEFF7EDC62F37 tim.apodaca
514,323,638 *3487C70ADB996CD89E28E73AA1A380FF1DDBCDB8 timarris1
514,323,639 *34820B7CD634D310B8C5650C7AE32D17DC7D89C4 TIMB3RLANDS
514,323,640 *3480258B08D76CC6506DC850B2DA1CB1186DFD98 timb3rm4rk3r
514,323,641 *348ED36A4B969E58C25F9DD6DF637BD6A0797CD7 tim.baillie
514,323,642 *348D09AA586E931838A0FF8A0C183F13E0206C41 tim.baril
514,323,643 *348521DF8D4B1E2D48476F6525437743662CE041 tim baumberger
514,323,644 *348EB2D29580267AA0FAD849ADD2DAD77C50CBDB tim.belin
514,323,645 *3485DBF0BDEF32F5C6C44BC4964B1BE16182AFB2 «Timber»
514,323,646 *348595A2C0B5689BA5D7A33CE71F3933C1682B50 timbercccccc8
514,323,647 *3486FDCFF4C1BB2A790E215006FA4BC6248163E5 timber-clad
514,323,648 *348EED0615F87AC46ED15A606623F07ACF6DE153 timbercoltraning
514,323,649 *34858D774F1DD5F5C7E3CA24A10D409C9FEA7898 timberfriends4
514,323,650 *348F5C84625CC537449793C5BA8A763162624CE8 timberfrog7
514,323,651 *348117AAA1172090517DDE95D9CC79BF0E7B6516 timberheads0
514,323,652 *3489CC6AAA2338109CFAE387C799BEAF1A219843 timberherberting
514,323,653 *3487745F5981A3ED3EF235210F7C6C7D24DF59C5 timberjim9
514,323,654 *3485AA641C253C8AA37105C2D92195A02F026922 Timberjking
514,323,655 *34827990FAC02ADEB4447AE1B256723161376C62 TIMBERLAND-BOOTS-MENS-CHUKKA-BOOTS-C
514,323,656 *348EC0F264DB1BE8335306F3348399474870E1A1 timberlover4
514,323,657 *34858C39561FD7A35975799373670BDEB7C8574D timbersimple8
514,323,658 *3481719E262DB56F8A237A7D90B18251D2632A14 [email protected]
514,323,659 *348F927BA52555F6E8C6926E496ACE410B5ABEAB timbillett
514,323,660 *3480B613DF1A4683D1F1548ACF6D3DD001BC7AB8 timblerjoches
514,323,661 *3484C3A57B0FCEE89F6DE8789A2F1FD3147BC1F5 TIMBOOKIT
514,323,662 *348A27D7D21D71788C02DBF6E1178DDB205034BC Timbravano0
514,323,663 *348B700031A2C1623D4149A91B1FC0A058D04EAC timbre4you
514,323,664 *348B1B5DF695E83E8FE0FD40572006CBD0082584 Timbreo8
514,323,665 *348291B4527B2949A1F12F02AD3F6B06BC037416 Timbrerete8
514,323,666 *348F81BB9FD1D154BBE94BEE32F8476947D602BF timbresp4
514,323,667 *3489A7886C60094A88F356BD465F1FA612FB5171 timbriatetimbriate
514,323,668 *3487437D18D00D1B73BF8BE6961246652E6CC291 timbriendum4
514,323,669 *3484C0DBB8AD2D148A18E716ADEFE0F54BA33341 [email protected]
514,323,670 *348CB1695FCEC332C97F05199E1A954AB375864E tim.congleton
514,323,671 *34826EE11FF3127F6C834E60EFF80C2F53C17DFA tim coursen
514,323,672 *34822F83E3CCEE812350B71DA32D74125AD4AA9A timdabsw6
514,323,673 *34876ADAB4DF9623724DAA69DF7AE129E02DE76F timdanziger
514,323,674 *348632436671F8F9C38A1D9ADD46E72885D94947 Timdave0
514,323,675 *3480D1CD1022F7509304889A9D4B45EFD3B37B01 tim.durando
514,323,676 *348FA1412F42CE4F38B8EA70AFA0B06C5B0819EC TIME06
514,323,677 *34865A714DBF8DD6C244C2CA1456F98EC1234D08 timeabigailing
514,323,678 *3485A8920C17F2A71C9292CECC0716C98CB869E4 TimeAndDistance
514,323,679 *3480E570E5FF0BD81406143C09A16241435EA833 timeavatar4
514,323,680 *348C3CCC69524B8D82B0BEA6CAF8FF27D98B97D8 timebomb state
514,323,681 *34883AE697CB834BCC09F90670B6E444A311D88C timeconvulsedelightdivertdrown8
514,323,682 *348F46DE566C9D94AF84DBBA2BB7C8FC78B5E144 timeearningsfeefilthy8
514,323,683 *3480003638469FAD6CA89976D7BB3CE00ACCCF0E tim.efurd
514,323,684 *3481BF7E9A5AF52F3B02EA20305BB986AF29660B time.-hotspot
514,323,685 *348AC868CA9CBFB1DC6E6CBDFE44563D4750060C time''in
514,323,686 *348820CDE742F8D2D5531B3348128AB75C21E1CB timeinthesand
514,323,687 *3481C82B8F9844DCF96AE4C09B939CF59DEC1355 timeiswindingup
514,323,688 *3485CC89F39C55C28248DFFC4762D976120A4F2F timejumped
514,323,689 *3484D4EFC37306ACAC398B9BD0182DAB58801E26 time.larry
514,323,690 *3488F0F9DC1B232D3F8D91A134AF619F4310A0DD Timeless Journey :30
514,323,691 *348B2A84E38042392789F51EF0CD4862AC8C5775 TIMELIFE
514,323,692 *348F75BAA238A249148418199267AB8DE9372D76 Time-Life Music: The Swing Era 1930 to 1936
514,323,693 *348F33554D99F3DABF4A9317D20D02696F764DB5 timeline1png
514,323,694 *34874959283B0DC56870124FF3175D84A24F23E2 timelocalpage_times
514,323,695 *348504CCA4A66ADBB1360AF2604F0F52F311882F timeminou7
514,323,696 *348763E8AFF781C5D0635AE9587B42A26186B2FF timeoutprocbsw6
514,323,697 *3481358DEE68DCFF8026A9C4E2131434C8FE77B4 timepickle4
514,323,698 *3482A1E8B37C35E327FC79C7C5305A9053BC1C18 timerjined
514,323,699 *3485B9293BA82BB79ED9520401BE75916248F9D2 timeshareassociation
514,323,700 *3489F44C7A1ADD2953DAD4F6EDF31F1C04F00250 timeshiftshillyshallyshotshowsimple2
514,323,701 *348A6CECFEB74EB9718C7886ED9B3B5A751070D7 timeshortnessshortsightednessshut1
514,323,702 *34803F34D2285D2F40ED0CE618C9268498C7BAC1 timesierra2
514,323,703 *34828AACDA721FD6297B9AA7A833B42BE01FA749 times.jslasher
514,323,704 *3482C8408876741C23482EE884C34402B01E511B Timesw
514,323,705 *34828A51BD954CA6E3ADFC657C861A67CDD73862 Times』にてメインパーソナリティを担当している。
514,323,706 *348FF8EF8AAA4B3C55B13581D71DC75F5F37A353 TIMETA81E5
514,323,707 *348A1EB1268CA142BBE0BF2ABEA55CF86352721E time to build (feat. blade) (p brothers remix instrumental)
514,323,708 *348B4635373D9E90EB8B9D3805D1D1E5FBD359A2 tim etter
514,323,709 *348A01A935C8421929EE10B69275DD9B346C71C9 timevalue.split40jun
514,323,710 *34809CC91B14A9F0573820F61128D5545E4A94B5 Timevinklen
514,323,711 *348A1D16FFC7CE28996897697553F5E54ADF1F09 TIMEWARS
514,323,712 *3480DD0D4041D82D93150625BDB297D0C65E617F TimeWon'tLetMe
514,323,713 *348AEE71EC6D867FA8DA20E4DDA9CBB4A51B7E9D time won't let me go (van she tech remix)
514,323,714 *34818173B14E5A971E22D580B7831A108DD32A63 timeydelserne5
514,323,715 *348F08DEE8DA4644BD5B796FAAEBE11E8923561A tim.favila
514,323,716 *348F39102E76B383E35B3FEABAF2CBC20A59B79C tim.findley
514,323,717 *348C57E0F9B21991D3920D944F2A4B79A955ED23 timfishworks'-'tim
514,323,718 *348C0D2FB983F1D26311B7A305244E9563F957D6 tim.fortini
514,323,719 *34871CF5182DA164B08648B4AB658A08410CC5D6 tim.gembarowski
514,323,720 *348549DB95A19D29AD3B942A704AF66A5A379DB0 timgiannini
514,323,721 *34810EAA14371535BE71DD0165C3F4405B886285 timglasens6
514,323,722 *3482C5EBD1C38002627A82F410D8B395707A2414 [email protected]
514,323,723 *348065C026C3F762B93B8D35D815DA07CD962CB6 timgolding
514,323,724 *348912B2BE4C4A94BB7BFB043411C19225611AFB tim hastey
514,323,725 *3484CBC5A15E421A8DD704629B3947B4B31FBDF4 [email protected]
514,323,726 *3481FA8CAEE381B969E039C35D7454BF39C47B8C timhmenos1
514,323,727 *3484C8C0BC9E09D44B5A4A7C396F643E8C695416 timhoolahan
514,323,728 *3488C836D5CE3EF95795E4986E45F5F32980F71E [email protected]
514,323,729 *3480CF3FE7CFDDBF51E618273B323947A270F4F9 timilrahcdehcaerwsb
514,323,730 *348D7AE43E2D005FFB11130121A7A0F67694C5CD timingchannel123
514,323,731 *34801F07C01765917F8157E9C4EE34BAC248A758 timinski 23 0
514,323,732 *3486E7713CD954C1DEEA09F810F2EBF9A71EA31D timir chowdhury
514,323,733 *348D7960D4B3206C99F793DAB001A3F87EBE3439 timkenneth1
514,323,734 *3481754EF781DE364D8FD1B3D6B298BE79033E90 timlabelle
514,323,735 *348957E2023A12664ADAC22E881149946A86DADD tim manser
514,323,736 *34849733B15753B505BFE64B4A131BA8302536EA tim mcgee sr
514,323,737 *348CDAA37F678BB2392077440681133F094FBC10 timmehxxl
514,323,738 *348C518AC25542D19EB387E92A57105A931EAE37 tim.mensi
514,323,739 *3486AF90E5797BBD349569B4B8590AD606DC8409 timmerens2
514,323,740 *348BEB1FBD4C893DE4E351A96C2DE841308E0D90 tim.miah
514,323,741 *3487AAF1E5391055867E385442F0AE442C984C62 TIMMS-KELLY
514,323,742 *348DDF0E2C5DF0C57E3DB163412E118790CBE5F1 tim.mustafaa
514,323,743 *348AD04735752589C27E0B96FCF203EA105B197D timmy.andreoli
514,323,744 *3486BAD99B2E4BE7EA00474FAD96FBF883A82239 timmy.angelson
514,323,745 *3487BFB804CC29BF64110A8EF30C4CDBEC9F4267 timmy.bumpass
514,323,746 *3487D9134BE8669178FFBE20966BBC6CBE3F839B timmy.cabibbo
514,323,747 *348E10C9E131D7CBB815DE66439932241A4C0282 timmy.chadwell
514,323,748 *3488CC20B600040DF1F5119E7943278F11DBCC52 timmy.chilcutt
514,323,749 *34865895FD791B77078B2C2EBE007093D30506BA timmy.crasco
514,323,750 *348BC6E20D7699D9472838AF5443B83294DA666E timmy.dibacco
514,323,751 *3486FAB8963D1AEC6D863715133CFD692D02E60C timmy.emley
514,323,752 *3481BBDBDB46D6FD4087B443B38E8EBD5D0A4F9D timmy.enns
514,323,753 *3484AA3070031A8359D48458D676022FE2B1F314 timmy.eutsey
514,323,754 *3481BC488A825B6B5FC16E2391ABFEF395973297 timmy.grieme
514,323,755 *348BB639DCF17D547BE34C96BFB68D3B30EE0275 timmy.hasas
514,323,756 *3484448B650F7203739D4FBE365291B1ADCBE84C timmy.haumesser
514,323,757 *348DD4A866B16163AFE4DBB1C27F8F27AC73CFD7 timmy.kaiama
514,323,758 *3488D5EBB5A96D79A7E7D5B0DE22AF621CA167D4 timmy.kennady
514,323,759 *348486C85ECBF863C251D7C05A1CE284E555D286 timmy.mankel
514,323,760 *348DFBB643C8697299EA875F048905CA24E66E58 timmy.nunery
514,323,761 *3484C874FB9762DC54915277EFCEA8469471B68B timmy.plattner
514,323,762 *348AE5A65B873907B08EA0EE377BB3880D5CB067 timmy.ruhter
514,323,763 *348F5F739415BBE1898AAFD500E35982665880FD timmy.trimarco
514,323,764 *3482BB2C7D8944DAE6F6B0EC94CE478A8EABAFB0 timnurse5
514,323,765 *34802659E5F3D71AF40650439BC30919A739511A timočku
514,323,766 *348F4D74E653617FFF164BBD16A5E40FDFE3FEE1 timofeeffzimmerdelbruck1935
514,323,767 *348BC10EB6A159B305493C0BF234C881BEB3671F timokrasie1
514,323,768 *348F8E2DD738C4DF2874FACFDA0D02FDB43B614F Timon.TIMON Now
514,323,769 *34853E38FCEFF79465C942829C90171B3642122D timooms
514,323,770 *3483E82C05C0A2448BEBDBBDB0ABAD8B4CF914E7 Timorously.
514,323,771 *348AB51A935B2EAE67CBAD468E0B3F291FE7A700 tim osbourn
514,323,772 *3482E82AC93280953B6A0625EA06E8A873BAEC0C Timoted1
514,323,773 *348A13FA11F03A34ACBFA0D8AEF4A8851A15EB2A TIMOTHEUSN
514,323,774 *348169300FA4E9ADC52823BC9FE517DC1A294B90 Timothy289
514,323,775 *34877FF9A06EA45747325D42658D5A9D6856433F timothyanna3
514,323,776 *348502CD39857CE132437C1AD0F95CA9CA6E0BB4 timothyasdf0
514,323,777 *348DF234356089CF25B4C862FF8EE574F3C4E6E3 timothybasket5
514,323,778 *3485570CCFC23BB6969C6427C5EE4143FC288767 timothy.bryar
514,323,779 *348C2C673D345C134569A6AC2CF786292D2FEA3E timothy.consolver
514,323,780 *34842EC0950601A90172064468FDD36245832930 timothycristobal
514,323,781 *34866F1EADF29F7A245FC1DDE441783429271454 timothy.dagle
514,323,782 *348B20655DC61EED4C64DB4A187405599B7A0EAD timothy.dettmer
514,323,783 *3480B9F1D17E3554605251A93C9C65C16A1EA5E1 timothydwight5
514,323,784 *348756CAD78CA8889D003A424918C2F64DE502E7 timothy.feigel
514,323,785 *348CF569951655BFAC3B6B846E591C4852AFF050 timothy.felson
514,323,786 *34850BB0F15A5BD195C2AD6CBEBC17F36809C8A8 timothy.fickett
514,323,787 *348D0D82C0CE0D52F27E6382313DEE5CC538D676 timothy.gorelik
514,323,788 *348E11B7E83A12153B0F5F87356F58B0CF4A012D timothy hanke
514,323,789 *348D34A5B29CE0A93B6AAC39F731A6725C4E7DE8 timothy haupt
514,323,790 *348DC4F496F323CEA00D1618587A3EF81686A678 timothy higgs
514,323,791 *3489B85A0CE1879D2F96882714BC7824B6528EE5 timothy.huddleston
514,323,792 *3481412A930755A5BA76BD4AAED51C9B2D5EB262 timothy.keister
514,323,793 *3489334CA29A16D4DC717154A09D9AB6EF3EEC25 timothylincoln8
514,323,794 *3481694DE86A2AFC7A15BB741132E733D1581133 timothyluis
514,323,795 *34871C22FDDC537634F9DBFC00FAEE214B089FD5 timothy.macht
514,323,796 *3481D25A90AF4E4F9F92C0ADA8E0836BEF53B6CB timothy maki
514,323,797 *348738F2B68EE9F799594CF6AB974A13D647369F timothy.mccolpin
514,323,798 *348E68D7CA0BCB8DB11CF1A4655E59B1D21EEDB4 timothy.nygaard
514,323,799 *34805B93247130A262BAFD9A79444492486453A6 timothy.pacitto
514,323,800 *348EE4140905F4F6B20D62AA0B0D19E0DCA72B35 TIMOTHYPATTERSON
514,323,801 *348F368EDF893C2C394EBCD3E3B2A814F90978C6 timothy.rax
514,323,802 *348699C82B4251A953E77C77C1D07EFF09EAF878 timothy.schnackel
514,323,803 *3486AA42BC7BE1CB66C250C17BA22DF53C2A1FBF timothysi71646
514,323,804 *348BC130C39D05ECA1EC69CF34E1742C33BB4ADA timothy.swafford
514,323,805 *34808263042A35E8F1BD465DCC077B37A40E7B58 timothy.swistak
514,323,806 *348DE185A8AE1A8E90C3B11F81E0296D92EE9E9C timothy.tierman
514,323,807 *348DAB68CC12DCDDDD6793A6D23DB13BDF392BF4 timothytrebor4
514,323,808 *348A14A0E4150CA9241F36DA9EE598ED3C967E57 timothyvolleyb
514,323,809 *348904541DB1C78567E2245967D6CC349DEE8EB2 [email protected]
514,323,810 *348EFC1394D793E46A1D77E0CA3838313068BE47 Timpist0
514,323,811 *348F39112EFEF9E9E8C160BF592F7E39837D5BF8 timporsching
514,323,812 *34877466615F971DB4017C34346D7736DA55D298 timraptor6
514,323,813 *3488A2F4E26220627CC8B726ABDF1A8E83F3C127 Timraven4
514,323,814 *348D831A9BEA017C628F57715905AD2334CA5A6E timreicha
514,323,815 *348C35BB18CE6CBA9303410D4DCEDFAFF740F705 tim.reisen
514,323,816 *3487429E0BCBFB42B4A081D67A6083BFBADC0629 tim.russnak
514,323,817 *348EF835F860951DDACE16D746BFE823A05D6A0B timsandy1
514,323,818 *3488140835BFDBBDE3CCC82BAEFC104E94182D31 [email protected]
514,323,819 *348DBEA126B3AD276C3CB36311A8BE3F8AC74BD8 tim seeber
514,323,820 *348E4E11932BD08197928FBE1B872286E3858E04 tim sheets
514,323,821 *34830F01FC4209D15F8F335894AC41D1D90A6138 timshupe
514,323,822 *348FA2BFEFBC37BBB843975612CD54D594529B36 tim.stokey
514,323,823 *34849085228DA97C2C905913E539EB9D99F18ED5 timsugar0
514,323,824 *3488A84F363E930E3121E36AB95DE01B5CA5C207 timsystem2
514,323,825 *3486DFE2D756C9DC954AB0AE9254DD91E5A20417 timtequila1
514,323,826 *3482FCA247F2EDBA04E9F1CC86CB2E099577A4CF tim tice
514,323,827 *34898D50B06841E23AD34585BB547CA8659879E8 tim.tinson
514,323,828 *3484D070E88559BA1CAF0BADD5440F355F0074CD Timtopcat
514,323,829 *3485AB87DF5AB93C056ABAD3BC0595CA616A5BD3 timtschAinsAw
514,323,830 *3484BB5D23094220A0A6C7CD87BD821FFA6D1F01 timuerantques
514,323,831 *348FF87E6E69A38C65BAD8E1C0C2A3F4BFC5588C TIMY-BOY
514,323,832 *34891939DE8A98596BC736E1032D471DCA11E35E timziemba
514,323,833 *3482AE001399311DDD4E807372CAE2C3FC27E8AC [email protected]
514,323,834 *348F9ACFB0E20E36FE7011F97509F591CD3CA1FE tina0601
514,323,835 *3482FB1C857691B4BC46F35296FAAF77A5554DEB TINA306
514,323,836 *348643A206E495078DB34FCED87C2B10E40CDA4A tinaagil0
514,323,837 *348B13B72F08F7EF8120596F310B59B34E90C559 tinaapollo3
514,323,838 *34834AA1FF9F7226C2BA19BF9D80740562B245A3 tinabullet2
514,323,839 *348C162C4FBBF30769B9ED8BEA9AF055D8703718 tina demasi
514,323,840 *348A531862B8C6BEAEEBC328E71586FC09EA1670 TINADICOINTERVIEW
514,323,841 *34896B4BA1211027AE7EFC2F698AFA08D3E049DF tinadignum
514,323,842 *348CE97C82249953F786B41919CAD5174417B3A4 tinadustin2
514,323,843 *3482E9951A1B65CFD6E1C1CA22DC3E944746D1F4 tinaetheridge
514,323,844 *34815B235C07501045E0B86E97310054A533BF32 tinajoannas
514,323,845 *34866C61D8CEA56F997E69604ACB21D47113D40A tina ketcher
514,323,846 *348522B2B1AA30B0FBFFDE349705605201059A21 tinaljf9
514,323,847 *3488B0342D64E3C33ADE4717776A0F21C967C85D tina louise wilson
514,323,848 *3485C3E0E7BBD9FFF9800ADAA1C52F4B45180EF1 tinamia8
514,323,849 *348DC8C499D0014712D0794D0B564637FE1CE299 tina panetta
514,323,850 *348BD9B9BE2A6A15A87011926879255B4CFF942D tinaresearch6
514,323,851 *348186F10E83EC96CFB760FAF734689B2C5A44DE tinaseptembes
514,323,852 *34804EC6DEF896F6CABD59A73E61BF16240F4480 tinasmos3
514,323,853 *34800846406B9C7D568CF664541F36D902DF5E09 tinatamisan
514,323,854 *348C73B211DBD37C7DD4A3AF4D06A54A49201CF1 tina valenti
514,323,855 *34881DA2F1C6C0FC309BDBE5123F938D14E281B4 tinavizcardo
514,323,856 *3488960A57CCB29A61F4452FE9A905600FA68DD5 Tinawheeler
514,323,857 *3489D40FE7E760E1AAB8C87728D32683CDDB565F tina wilmoth
514,323,858 *34800808A341266D8926C884E5500612176A4387 tincapped7
514,323,859 *348FE3F17413E5B6A24DCCC47DE6118EC024D891 tincellera3
514,323,860 *3489FF1E383A04B66D33208FF87EAE6CD2C5DCD3 tinchocb
514,323,861 *348E324BFA4DD528602B457628326B2A096DF4BE Tinctive7
514,323,862 *3483DEF7AD0973E6E213482E6846273F98FABAE6 [email protected]
514,323,863 *348C8A2C567D04B068A9B6C6B35D719121CE61FE tindalln2
514,323,864 *348C3FCED8112FC9D059A40FA1623DDED2498D71 Tindyuk1
514,323,865 *348949FC624298CF0091D9DB6F6F657506827A73 tinea-like
514,323,866 *348350F77F4445EE8F83F5AF66DBF97760A2C2B2 tineke kruger
514,323,867 *3484D79EF2B77F991BF66C4A7B0F32D6B0765220 tinerionseses
514,323,868 *348974FFBBBEE238436A6926AF0BCAEB66B5C87A Tinetine8
514,323,869 *34827E6687EB3F8F97BD83BAF1C4E6381A730CA5 tinfaced5
514,323,870 *348E91447892317CB81303EA13984DF86A5E781E TING060130
514,323,871 *348C36ECC6395B4B1D1CCDF161ECF64072356F25 ting1ish
514,323,872 *34880BE5A7AB2E1E6896D04A71AD94FA6F5E4D12 [email protected]
514,323,873 *3480E44B35DF97F22D39AC9FE6CA430C67D77D13 tingbg1234
514,323,874 *348C1EC2A9657BA15344B4F3111FCB601DF16785 tingbogened
514,323,875 *348DA9859466B7F7DE045096F30267288A531631 ťingchaj
514,323,876 *34846F765CCC41B38D44B9B37DF1AADD73CC935A tingevied
514,323,877 *3488974CDDF2EB4645E62C078D76BC0FC13608EB Tingguia0
514,323,878 *348EAA6BBB6630496B64B9A940942B355F4B046D tinhair7
514,323,879 *3480736370E85767A88B2C8856EAC139A7C8D653 Tinhang3
514,323,880 *348AF6C458B2646C6729D5F1BE2E3A86EE8F0390 TINHEM10
514,323,881 *348471A4278059AFEDC0A16B0AEAC91CD9806B18 TINHMOI
514,323,882 *34829659DBE68AC6E877EB82FE54DA8ABB65ABBE tinieblast
514,323,883 *34802C6F03FB9126813FFAE4817273576B81E0AC Tinienne.
514,323,884 *3488F6358F718F55FCD80FCA56D2701F4B98AFB1 Tinille7
514,323,885 *348A4B8C83D1BD5035CD618EE1A859F89AE08282 tinjanjiming
514,323,886 *3487222F9931351E8C2126E75C04C47AC7141A91 TINKER2498
514,323,887 *3480E91A3C751F3B6B54EB79E018AE640396C337 Tinker73
514,323,888 *348EE71B908438D67698D631CAB198FF3F70EC2C TINKERBELL564697
514,323,889 *34852F95BE0F90CB62D011994BB68C17D23CF527 TINKERBELL_FLY_AWAY_11
514,323,890 *3480A4D2F8153D517493FA3E1E47234A1BB25530 Tinkercing
514,323,891 *348DB7BCCE0949681F916B6F87613E9465BA06B4 tinkerdominic5
514,323,892 *3482FE373FD3C12DAE5E9BC5634A17BD597CF2DE tinkerporter4
514,323,893 *3489A4D0038699D7B79C363403179CBB2DD566D1 tinkertintining
514,323,894 *348B1C2A49521329053136BA420E5C0F77C5E4DE tinkervalerie2
514,323,895 *348C5A328F7C38DADC75B17163FE239FE8FCE88D TINKERVIPER
514,323,896 *34838256CEF86CAA50263F8159A24D1D9D10ED48 tinkerwqsb4
514,323,897 *3481006F89C01E085CBA655BF1E4AEA2A8AB79F1 tinkerx7
514,323,898 *34842EC036319F69AEB986A4FC4588BBCC71DC3C tinkle.bbs
514,323,899 *3483B852EE9D6AA952C42082AEA1ADE0E7ED0D6F tinkytig3r
514,323,900 *3486A4A0056BCBF1899A5D17CA072C999829BBB5 [email protected]
514,323,901 *34836158B6E5695D79E9781C3A000C874F8081D8 TINMANCHERRY
514,323,902 *348B9711231A2E9B307AAD317EFACBF9FD4B7E0D tinmancrawford0
514,323,903 *348CD774D0DC06C42732DFDED04D92162E5D7277 tinmanfriends0
514,323,904 *34882A7BB40391165602EE93175EBB8EB52F41D2 tinmangreenday8
514,323,905 *348FC05191543270AE546B247AEBCC09770C2E34 tinmanguinness9
514,323,906 *3481E190BF3CAA973BD2DD12979F0080D342DCD0 tinmantimothy0
514,323,907 *3488F3B1DEC680B20BDFEC239A4A638779F4EE95 tinmanu8
514,323,908 *348E25439307720650AF905710A2228281B8A0AA TINMANYOUNG
514,323,909 *3487A807B8A32D725463E86A06F03AAA1B11967F tinnituses1
514,323,910 *34817EF13C6690832702B87448064668692CB331 [email protected]
514,323,911 *348FCCB5683F1C60FF409A263BCC76634DE85DFD Tinomegu
514,323,912 *3483F39BE7BBDA4A833F754F9FC477EE48AAB923 tinoutie4
514,323,913 *3481FAC62761A33C42745AB8FF4FA3EA153FC6F5 tinoveliz
514,323,914 *3480C981860662EF6C9D505606FD43F94D37A7D5 Tinozzasing
514,323,915 *34876E2DE5B5AE1DA51B58BBADD9FCE9C66A84CE tinsero4
514,323,916 *3481F8A63781FA66D6A54B0F22AE70B28A089A87 TINSTONE9
514,323,917 *3482EE9DF712933CE5AB2A653EDEEEA4177DC26D tinteligsts3
514,323,918 *348834F20FA81FDD14D133BD967C1A8750072DC8 tintels6
514,323,919 *34887F60662ED3583B042B90361ED63AFED17810 tintinbridges9
514,323,920 *3486786AD311318A01CAEDA1956DEF7BF3857846 Tintinfilmen
514,323,921 *3484CEA8443B8F0519FEC5A70735A3B84669B32B tintinglenn2
514,323,922 *348E16AFA9050838E160AA9AE6CD9AE5FBEEE680 Tintinhacker
514,323,923 *348BF817B5CACD1CBCD91928D2ECA37F52C4DBB3 tintinjordaned
514,323,924 *348F81A1AAA2799F59B5A9CA7BAD9A657E0D0805 tinto1234
514,323,925 *348C95E82658F9FA86B61C3670D498D4293352A6 tinuatie1
514,323,926 *3489C8E98D54913E76D2F3FEFDAD173491152100 [email protected]
514,323,927 *34868B048EC8007FC27E3AD52B6E621A0C21BD69 tinymudderbsw0
514,323,928 *34873CC14488982F6C52733DF56A2250BFC7D90B tinytpel8
514,323,929 *34883EA84CC80A4A359A2B8EF4DD0062DB42A4AB tio-541-e1c4
514,323,930 *34833BB21A20A703424E619B79473159882B8147 tioclsetbsw2
514,323,931 *348A5F53C297AAE3EE638055338E7BDBE56CE98E tiolpxe:
514,323,932 *348C24357068E2450F91827AE45F124288342B29 tion“
514,323,933 *3484A1F107FE2B71A2EA3341721828FC05F6DB3B TIONALOO1
514,323,934 *3486391C0E9FE5563F60E734F2BA58CF0FC42581 TIONEBT
514,323,935 *34818F15ABFCC7FB58D450D22D0C445DF16E9080 Tioniumed
514,323,936 *348A42298BF3CCC6EB2A04C63F897108E58AC438 tionntoigheadh8
514,323,937 *3484DCAA95E685AC2BEAC0A9D64A1470C804F4FD tiosivus1
514,323,938 *3488F98F8ECFB44830FCEBE7812D9304BB96CAFB tiotason0
514,323,939 *34872CA3A6F343670347054BD9C93D6F426FE27A tioxolone4
514,323,940 *3485BAB3274A9E24652AD95B1E9D366850014202 Tipasy
514,323,941 *3488B1C1DCE271EC10F6B796B4A082D5CF867159 Tipatip8
514,323,942 *3485BAF4EC7557BD5CC72607D13CB200BD44F362 [email protected]
514,323,943 *34865D1DDB5DA2621B1D69DF9AAD18E52549D216 tipelihp8
514,323,944 *348FF8532165AE95EA3FD3BA85204C2081FDF2C5 tiphaNI
514,323,945 *348CC3A9DE52DC151023D9735857D436C6341BC6 tipiture4
514,323,946 *348F49C57C97C039160AE3953965710999902BAB Tiplet6
514,323,947 *3489DB268ABBF2CB89B75828BF7A04548EBC089C TIPOGRAFIA.
514,323,948 *348E5EFC545BF6DEF8B99E9D04ECECA07D5AF4E9 tipoldefaders4
514,323,949 *348802551ABF152DE79B0B7BA83DF5C23E77A35A tipoldeforldres0
514,323,950 *3487E8801989FC96D53E5766504D4DDE300106FF tiponmouseover9
514,323,951 *3486E5CF20A93E7CB480016A477A374335F07E55 tipp-
514,323,952 *348395AF7E1B473815E264A9323E60FCF5C69583 tippannY
514,323,953 *3487B556AE9ABB956978519146E24343DCFFA046 TIPPEL.
514,323,954 *34854231607F8547C5EDB07A8227AA79061CA340 Tippings3
514,323,955 *3488C1EC41286214B2EF3819BFA02BF1BBF98793 Tippuvan
514,323,956 *348FFF1DB8F1DF8FE477E5B14E38457D6D643177 tipsandtechniques
514,323,957 *348CD894467626E9E8AF08223EBBAD75906F1DE3 tips-for-protecting-sensitive-data-iby-dari
514,323,958 *348AE45F1CE14D8D9D4A9818E357F08BD50C4637 tipsfromdoris
514,323,959 *348BE9B976DB92E694CD8D2F1619E14A7A326322 Tipsific4
514,323,960 *3488E810307615F35301A78F1A28B2BF9C1D88C2 tiptoecollective.co.ukwww
514,323,961 *348B8E8C5EC5CBFD08E150558431D00F3B7500D6 tipuheeting
514,323,962 *348BF886B92755195FEF7ACAB81737B339C62227 TIQUETA1
514,323,963 *34839711167B8C62A451C427815F281B825AB471 Tiqueur9
514,323,964 *348CA8B961415D42954DCF6014D664E223AE6A8F tiqumaloj1
514,323,965 *3487C8F20DE45E992F67A28D8447D04BDBA55C86 tira5500
514,323,966 *34802492EA2C5B1939AE1DA2EFBA656F4EFF1A8D tiracatena5
514,323,967 *348E60498030FC810475988EDCEA8AE572745580 TIRAH9324
514,323,968 *348FDEAE86FBE40526327913F747D1B2F25955F3 tiralaamuhuak
514,323,969 *348F82A7B9EAFF2D187518E30C7FF4036D955D58 tirana4you
514,323,970 *34833DEAE2842D309E935BEA3FEE88712B8E5A74 tiranizarives
514,323,971 *348484C9BDC1BC1B542590C2053D6FD4C99E10D4 TIRATSYAN
514,323,972 *348075D45167FE40C9675ED59E82B950364D13DF [email protected]
514,323,973 *348152788990196AAB8C92889E2A0478EEEE1EAE TiredMyLife
514,323,974 *348F1A26831287D15F3CA3264FDA07D7EC003D03 Tireethi
514,323,975 *348C963BC3ED0CBA51D9F72BFB3ECB298ECAA7D5 Tireholder
514,323,976 *34825C5A087AE4B64063A8F0C2B6CB354049EC47 tirementes5
514,323,977 *348BD3B309334720254530C895701D61531B5D14 tireotoksokoz
514,323,978 *34808B469D6B437FAEBD841E06CCA27E2ABFFEBA Tirerons6
514,323,979 *3482AA87277FF0B6E6A90A011886BCD77F0ABA32 tirevinev
514,323,980 *34841AF808431377586C17C66617098F46D25A24 Tirezion
514,323,981 *348CD2B04BE0F0A6AC02320434EED566D33726E9 tirgetni0
514,323,982 *348B8C627FF46D3C4D4369A05CEB59BF15D53E87 tiridaḍaiyam
514,323,983 *34882D620275A390C577A08CBFEB48A869194D17 Tirinus4
514,323,984 *34876744C6697E9C1B98DB40D658AEF5EC32EA71 tiritar3
514,323,985 *3484F773B2CB2B2A1B41690C71B6FEC9717F58FA TIRKANOJ
514,323,986 *348FD058C9B9F15503257CB66C7B06E168D91289 tirlimponpon
514,323,987 *3481298FC48B65D6A6635F889BB142D81A1833EF Tirnadaptors
514,323,988 *348308F0A842620D5BD820E3F05FA14E91A2E73B tironensian5
514,323,989 *3486F4D06E5E893DFD8A219EAE08D22674ACC0AC Tiront2
514,323,990 *3484A31680978F61824E9891D013B593FE35C0BF TIRTOMARTANI
514,323,991 *348770FDE966F971B8BF73C74331332AFC49E1CB tirtsrez3
514,323,992 *348C496CEA8D1462F2ED42D7FD82119DB505E84A tirtûl
514,323,993 *34826F78142E1F67291D1E997D977C8D5238BBF8 tiruchengattankudy
514,323,994 *34843B7E6A29B10CC779C52AD50346EEB9C73497 Tirukalvanoor
514,323,995 *348F8CAC2CB2B33BA6E3FECB6E651895230C2DA6 tirulugannada
514,323,996 *348412E534F0D281901150009239B68C5EA68370 TIRUVALAR
514,323,997 *34866111442BC2D9B09DABEB52832E29A4912C5C tisaianu1234
514,323,998 *348734CAFDD1692E9A33C468FE79C6FEA2115654 TISAIIE
514,323,999 *3482587112C77FCB4221C9ECC046C59FC4D90C5C [email protected]
514,324,000 *348E74B9833EBA2A6E08DCED3970FB3AEC1DFFF1 tisankan0
514,324,001 *3483E4F2CCB2CFBC061A665E003304770737C783 tisbookf
514,324,002 *3480F4C7DF3999F56AB9880AC65AF85FBE20F920 tish187
514,324,003 *34805BE253D2C55855BB21FCFD8DA7C26375F2A1 tishahubbard
514,324,004 *348814582D6686977449145EFEF054A01AB03F4B tishaputri
514,324,005 *34872134DEC431EFB90B9F2C0F1010319A71078A tishhthatii8
514,324,006 *348F8252A029E69EB4456513C101316CDAE6E4A8 Tishikih1
514,324,007 *3482E959CB9595FD05941BD02977CCB47C2FAAB5 tisiant
514,324,008 *3480CC0CABBEAED332B3EDF27083E7E144FFA6DB tisiekoc5
514,324,009 *348C5AE57D61261594063A35022758FB6439C6D1 tisikaomagija
514,324,010 *3487CFFF188F133AA9F46DD8BD63F28D88DD01DC tiskodot9
514,324,011 *348B98B257587829F4770F93255DE416DA62F108 Tislhorp
514,324,012 *3480127ECB311B5FC2D1C0CCE0BCBB243751122B Tisovci
514,324,013 *3482746BE4C18848F39FCA50C40838810B32932F Tispene7
514,324,014 *3482B1024838FCC204509FD6709ECFDFCD4BFE51 tissages4
514,324,015 *3485F35C3C84D4BFE046D1EBCB871AA39BF334E9 tissuese5
514,324,016 *34895424E223905F3F93357A48EEC1B0795A33CB tistesesing
514,324,017 *348979CF764A04FC4CA2167F75734A2213DFFEAC Tisztázása
514,324,018 *3488B6CDCCC3A487287E64A12ABFF37361BE8E59 @[email protected]
514,324,019 *348B76A338A0E0770E0C49ED51689DD58419C025 TITAGIRL420
514,324,020 *3486383A5A9B5041547C72EAA9722DBAA8179325 Titanflex
514,324,021 *3488A7A8718782F80D378FA23C24D4B58097489C titania davis
514,324,022 *348C36E726F0F25936C0398A435CBB9DE29BBAB4 [email protected]
514,324,023 *3488DFB5437D502F4A83BDB322E492A08CBC0832 titansverd
514,324,024 *34850D370A7464D9A574F18A8A88E72A77896C19 [email protected]
514,324,025 *348A8B1DA2481C7E27E9D3E955C468D83FBD7532 TITCHMARCH
514,324,026 *348C80F9D9EA643A5C8B478FFC89871F11D5F02D titêmi
514,324,027 *3488F320F19DC69356804379A630E85C53DFB047 Titilis1
514,324,028 *3486D30BCF6A783E1765B492F7670CFB163CC796 Titilla2
514,324,029 *348818E0942261766020C7EB88CD0D5D41B06F91 [email protected]
514,324,030 *3483D8C8ECE62F0F3DFEB78FC6B5C7D2F30BD6E3 title-choice
514,324,031 *3480BAEE2E46B955C6BAFA8F762BD7591ADD6CEB titleHormonal
514,324,032 *348BFA3F8F3C07B6E0ED5F11423D7C4AE595B8B6 titlekeep
514,324,033 *348A0895C12CF9C7EF941EFCA85DB90220CF7EB6 titles.7519
514,324,034 *3482425B225C70A0FB3EFB2DC7CE35EE0F7FC8A8 titlesany2427
514,324,035 *348FA672FA5B09C805BA29B742A915460A37F67F titleswhich
514,324,036 *348194FABC157C2758D7F2D1394915CA3A28AF5D TITO76
514,324,037 *348219388209B051EF39E2EAC3AD9A471D008AD3 titoisten2
514,324,038 *3482AF513A683A854393CD9B4CA6BC5FF682ADD4 titosalas
514,324,039 *3485F3717880C02879DA5F11F734F52595495F91 Tito'sWay(albumversion)
514,324,040 *348E2779597199A580219400EC7BF8288B6BC754 TITS4
514,324,041 *3482BC858B86E5B0AFC54F31955B76627A81DDD7 tits77:ala777
514,324,042 *348D6C6E7109BEFC7F6777B44E1086EA3B3CF7BA titsandcheese
514,324,043 *3482D10AFE125F00054261EA5C42E4CEE0E55808 tits&ass:thegreatcanadianweekend
514,324,044 *348A6627D8520F400BB8B99A8BD379456A281D35 tittel99
514,324,045 *34830A0BE29228E8779C5EDD7CA44D5DD4665C4D titterers?
514,324,046 *348623E9D1FBE537549E2812AEC546EA74E3AAE0 Titubanzing
514,324,047 *348389A2504389B8EB455CD54A4425CBBDA2613A titubavate?
514,324,048 *3483B6625D6DCD26D595E2B1F338874CEF9A1CE6 titubere1
514,324,049 *34830A798ECFE45F122CEBEADA916AED5E684F03 tituboobutit7
514,324,050 *3480F93AAEC8DBAD16F4082381492F45776E826B TITULAR8
514,324,051 *348BB0344DA0FC7CAE1E4985B683938AC38AFAF8 Titulaturs
514,324,052 *348816509E0659B9BDF33783624419E7517A0E90 titulo7
514,324,053 *348B898D1B4D9ADB5CEEAC4B4F280804BDD129B3 titus.argenti
514,324,054 *348DC8BD3FC949252DF120673B2F2D3AB2F74CFA titus.austino
514,324,055 *348CB90A00BD132842B4B1A26706FA27CD5BBE58 titus.busic
514,324,056 *3486FF26F58D8FA1510DB83306B296E03C8E9481 titus.calloway
514,324,057 *34813C1E806ECF4629C5576DC3075B1E14FEBEDC titus.caparros
514,324,058 *3483A383F3780DC55142C28B0F57455AEB7F5C6C titus.chew
514,324,059 *348832BFF333F12A03A6796549451E4FD463B74F titus.chumbley
514,324,060 *348A5474D0A4243B14B43C73B262385DBAF2B1A7 titus.emmick
514,324,061 *3489EA755C9EF5BCCE649C566097433B86EA314F tituses3
514,324,062 *34886608531718B36A57BBA07E3F0271224968FB titus.gilfoy
514,324,063 *348F592B50C041F875B377113F467203748D2C6E titus.gobea
514,324,064 *3488D8A1FF0840412EA21D6962A60BF69B84C6D3 titus.johnstad
514,324,065 *34870F874D919A0AE6F19998305EFDC8CE5D68D9 titus.malmin
514,324,066 *34812F25D8D17F849045BB9C0114C0F96C78F2C4 titus.mason
514,324,067 *348960D55119661BD0C05261FF2039A2935C5C4E titus.nevius
514,324,068 *3483ADBC1EAD7AEC76763772BEC157C10C70882F titus.nogoda
514,324,069 *3486A99F38489F7F95A8D3255439F62BAC0C849C titus.pacewicz
514,324,070 *348C2D2D9AA5A380975F82615DB01CDA8CD28D85 titus.philippi
514,324,071 *34813BD7034F865EAD98709FC9A200CD88B84591 titus.pinckney
514,324,072 *3480892810545ECAC65F2A7C4E822421A11F3FC3 titus.ramrirez
514,324,073 *34856C29484F41CEAE1A12DD8303CC3202CB56DC titus.riveiro
514,324,074 *348F0730186E4D3EBDD5E87590E5636589EE5B3E titus.schau
514,324,075 *3487DCE2377259CA9DD6B40BFC66F287835D2185 titus.stroker
514,324,076 *348F9072A8C89F8B8A52E9469FAD0EC893579872 titus.swofford
514,324,077 *3487EB224CD9A26A4949E8858809E3BE404C2950 titus.tease
514,324,078 *34816D0C9D70DFE01BAF82A87B0926D61D213DC1 titus.untiedt
514,324,079 *348D98A9F74E6F175F741B4BE1F2933571A1E85C titus.vounas
514,324,080 *3482DCD4AF28D036C61A40177572799FDC46FDA2 tiudimir
514,324,081 *348B4FB93D2713BE2E022DB2320A4D26877BAD87 tiudrinnl5
514,324,082 *3482B7ACFECA1A0ED8577D7742F84D53180BBB08 tiukempaaning
514,324,083 *3484FEDF8C1F25874A2ECF4FF813FFE8A62E4416 TIUKKAPIPOISUUS
514,324,084 *348F2713A2507B6F6D4D16A544C134A13D713C31 tiuksib4
514,324,085 *348E19F30C8BBB3F8238D68A750FEDFA403CC03A Tiulftiu8
514,324,086 *3486DED1040E2E40D2EF650C415464C89540AB93 Tiunited4
514,324,087 *3486860556F53B23E79492D59C14ADDBE655249E tiuU
514,324,088 *34885251F22FB51E32669C30075FF4F668B31529 tiv3ss3slh3s
514,324,089 *348B24CC271F7B2D5EEAF5F656422FE99F50F288 Tivaihcsed
514,324,090 *348035D6F8E9B17B1F150FD5987C5062917097F3 ɹɪˈtɹiːvəl
514,324,091 *348FF09C9583161DD2487507AC5C48CDF6F00993 tiversal0
514,324,092 *3482048CC5666055E72706DFF2E63524346DA737 tiveses2
514,324,093 *348290192605AE57FB8B45AD2700743E91EF1609 tivitsef4
514,324,094 *348A36BDA229E265C1DB325F2E20A8C1D955E37E TIVOISIERUNG
514,324,095 *3487C13D9C85D5EE50F0EE98D7FCEE152FCB77DC ti-vomve
514,324,096 *348ECDC321DDC2DA3DEC5B1B7536184B11975AB7 Tivulmip
514,324,097 *348BF7D2BB2643456C0D1F746ABF1786988BFFBA Tiwereht0
514,324,098 *3484B97229ED7DEEAE453E4B6C68981A3D79459E tiyuandas
514,324,099 *348319882F8742F1723AA17AC1FC7665D0A25BE9 Tiyxaiq9q9nz4a
514,324,100 *3486C67BAAFDD5CC86D601D5A91418CA39AADDE6 Tizaquín
514,324,101 *348A829D416AA7EC5ED668A5F777F06A657BF6A1 tižbe
514,324,102 *3488371A7F8E13ADF2D61113C1B48931BCF0128F TizianoFerroAllamiaetàTour2009Perugia19maggio
514,324,103 *348A1C12EA472364EE444B43BE3075374DB1B37E tizustam7
514,324,104 *348C2DBA22E0D07E0153DC32E48564718583F2BF t$;J
514,324,105 *3485EACE0EEBA9A0BEBD9294A21014E36DC7204B tj051180
514,324,106 *348CFC222EDDF7C7196A99EBEBFA5C77305BD76D Tjafsas6
514,324,107 *348C3917B583477C48ECBA554B92B67D9FFA5A27 tjajcwxw27
514,324,108 *348665E8DFB20D61D540631F7A0146C36DD8550F tjälbildning
514,324,109 *348F22ACCF2C086B133AC3D3B725FE5C8D17AF3A tjanditjandi2
514,324,110 *348BC29D21919F07375E9588FB510F7B2EDC7358 Tjangelded
514,324,111 *348EB68AB04271E114D124386C5AFE9032E38DB5 tjatighet3
514,324,112 *348FEF630E6CC61CD68426BD8859D04D723891C6 [email protected]
514,324,113 *348A45A8609699195BD7EC6885C32EAEF097B2A1 tJcad
514,324,114 *348295BB08CC9F46BDE37703071FD0BA0ACFACBA tjckdo
514,324,115 *34800ABF10E5D2792F0B8793BE110E4A6F0FDD5C tjdghks20
514,324,116 *34804E8C85B1F407E1D1D7241A58233EC3435E07 tjdkawgqsudthq1
514,324,117 *34842DD79FC6643686A84668AC7887E355D29A5E Tjdngzlned
514,324,118 *3482DFF445F1734D7F60326D9F2B1A3035E33611 [email protected]
514,324,119 *34852B6A1527C54F4F5175796B82D45F38C7D495 tjeddr
514,324,120 *3488C8F38CDC0B6D404692BD8C80BCDD5A4F1C0B [email protected]
514,324,121 *34808C7753C89D2BFE9957B91D8FE26382912E8B tj gallagher
514,324,122 *348943E430EC17A9E44AA7116195958D69CE5C11 tjibegti4
514,324,123 *348F78D8241524F32CBE647EC880291E87E0B751 Tjilpts5
514,324,124 *3481D5DFF528EEA5FC813EB354CD16D4290068BA tjjojo
514,324,125 *34852516468B3F655145494437DEB6895176B3A4 TJK>
514,324,126 *34860B3D9067421022BFA5D77A83227BF7DA04A0 tj lechtenberg
514,324,127 *3482D0A2B6CEE44BA4269638CB07ABF7B6049B80 [email protected]
514,324,128 *3484F3C975B332D685496DD705048C1052CC93C1 tjnbuv
514,324,129 *348F4F8D51EC5A32FC714ECB7B56F936DCFCE94F TJODDE
514,324,130 *3481805A2D056C1E3811A0B78026B2725E5CE2B8 tjoepten1
514,324,131 *348B4A0CB8A1D252AAFC2CA174CD8F455E08781E tjohnsonbswing
514,324,132 *3485EADFC7C88CEB9D46C730D127072FF9D29427 tjordanbsws
514,324,133 *348A580EAE19038BEA0483EE24E27BEFE6930BA1 tjpitts
514,324,134 *348F5BCE4CDBBC8B69B14CEC3AE031F204F7FAC7 [email protected]
514,324,135 *348CE9BB64DDF8E91FB43E82A6056051419F81DB tjqpx7b
514,324,136 *3486B300508FBBA09660CD9FCF1061CD9D679FDE [email protected]
514,324,137 *3488B8E8A7B94324B23DEE2169AA87F6E7C6CAF3 tjspecia112233
514,324,138 *348AFF81E46C426FED582B65C23B0E219D96A5B6 tjswls28
514,324,139 *3487BB599CDA2EFC9FCEC667BD5EB4161D55C409 [email protected]
514,324,140 *348B969327E21A90670D49DCF50277DFE9A86DCC TJ&TINK1
514,324,141 *348BA32CE7B00A8126B16D9731E236DB5052AF09 tjukkleikar
514,324,142 *348C49C3D6420B3F1760790EA2C6CEB481D51323 Tjungiella
514,324,143 *348A676222E035C0934B718B2B7DED327A34A059 Tjusade0
514,324,144 *348125B6C059C60E0B323C24D1085ECA8CE2F651 Tjvegasing
514,324,145 *348BE80A1769DD0455FBAE7848458621FE711115 t_jw
514,324,146 *348108EDB9640765A15058BFDDF5BBCF979AF66E [email protected]
514,324,147 *348F59152BFBABAF7E4EC6786B11A8F6F04DDF66 tJ~y
514,324,148 *3480CAE5E3026B68EBE28ACC1BA2154E70147D57 [email protected]
514,324,149 *3482CEC47518BC8FC58E32FC691F63D829F49E7C tK5{
514,324,150 *3486A8ECEB548FD6A0C8D59A35ADE503806FCFD9 tkäämme
514,324,151 *3483A960F1A1758D325AF28F6254408E69A2A959 tkaaregling
514,324,152 *348754ABFC6FDD1157A038B03612998994AED7E1 tkabtiu7
514,324,153 *348D8B03D3617D0D8FE7C6A6EB788488D1612514 Tkanicky7
514,324,154 *3482B8D87ADA550BCFB5AD904797406C29FC2CAA 't kan nooit meer gisteren zijn
514,324,155 *34801494DA1E1208D258067327DFE459D553EF9E tkarpbsw0
514,324,156 *348AD2D31C799BB7DD81488FD97C649819F791DA tkbmki
514,324,157 *3488BB8AA2972FE04935949FFFCE357075A65CC9 tkbus
514,324,158 *3489482AD4D71D572B30F6F2AA0E65D877B03E8C Tkcemhcs2
514,324,159 *34850508C4CA063C0417DEF68DCBD1A7296A9BB1 [email protected]
514,324,160 *3481881A80690149ACE38EF62D98AAB437265B8F [email protected]
514,324,161 *3484C439681BD40D8030ADF00FA71267B4B163DF tkeetsni7
514,324,162 *34849168BFC2AB39BC710924A8F4F8648A14FF95 tkeffeneben7
514,324,163 *348035E86A3C4C60DA9AABB6C3A633DA92BB75DC TKFO7447
514,324,164 *3481F10F16CB9C8531AB93403330A6D0A1F1BF2F tkfsqnnbb7
514,324,165 *348D85354931BC4C480C6778A3AE3B949E27331F tkhlmlnn
514,324,166 *3482DA65F68B5C092A69BBC7F42C00D6C9F6EA3B tkibegna9
514,324,167 *34871F9656DC6EB318EF65788C01AFB11D865D6C tkipegee0
514,324,168 *348F885098782CAC8D17C7499BE1C0B1DA517111 tkjpxxry2
514,324,169 *348EDF7D42D3C6F0CE48412EC255CD4B11BC0D54 tkjtmvscsnd
514,324,170 *348F41CDAC0DDAD6FD097F240BD98A78C49DBAE6 [email protected]
514,324,171 *34832C3B054A38132687A720D699CDB05E1A5F1B Tklalmighty
514,324,172 *348BFB18AD2A64D4158CB0529D42DA7758C9E9F4 tknwldggw
514,324,173 *34865A4EF2B711623889B633B5CA7F700FE4BD7F tknxyessp9
514,324,174 *348B4111D2E9595C9AAB0AF0AF90DA151319D5DC tkodegfa1
514,324,175 *34855301F8BE29C2C42C8613ACAB218F6869B0A9 Tkolben4
514,324,176 *34874FAF2BB64DD597AD504FD7B7ED8E0E1255A3 tkooregfas
514,324,177 *3483F5A19EC4A065AE991D75C5B6730FC167921E Tkorttia
514,324,178 *348EC368C0BDA42098172C6FFC764EA981C413B5 tkoskrzyd
514,324,179 *348667E3DEC6E7BAC006A37207337A8E8BD103CD tkp986
514,324,180 *3483CE7F72AED4A252EB8CEB44A0814ADD98F09D tkpdbb
514,324,181 *3485752900A155EBBA1ACA0822307C704A903C76 tkqmeghtukid4
514,324,182 *348D3EA91B9C7FD2D88D5F722B3DB27E3A8314D7 tkramnetsuk
514,324,183 *348DBCF267EF7A9B4F27961A396FA707823DC800 tksbhndln
514,324,184 *34829475C679CB519B017B0B689A62C723B6905C TkUnDisz8z0
514,324,185 *3486160250652252D9E4C3AF1787376767DBE750 tkurnepO
514,324,186 *34875DFA8E4948C7C7582BB1172BC9E5C90624FB tkx2
514,324,187 *348C3F3C5CA8AB6EAFC50AC5C43AC8426FEF25F6 [email protected]
514,324,188 *348430AE623900AB2B2024E5C5BB6C3B53980E5F [email protected]
514,324,189 *34843692607B46C4A0B4C34A6918BE6EE96A1858 TK:伊藤佳加
514,324,190 *3480C8A9E122965A425D411029990033F263E869 t{L~
514,324,191 *3488B4E89DD551B2980F590A341318979ACE2589 tl1W
514,324,192 *348DDE21DD4A3A6AD1CE7671984E90A8077769B8 tl2098
514,324,193 *3484995FB2C29DF9EE18D02CF4DAC64650181D93 tl736405
514,324,194 *348DCD323DC54A030186726961BC39751AA08F42 TLA184148D
514,324,195 *34896935986B5E9F970B20031EF75D5C662B34BC "tLaaa
514,324,196 *348AADFFC3528EBB63D62B7EA5C9B610E41A572F tlabfroking
514,324,197 *34831C55B9766165223FB20007B750C09B3C28E9 tlabptth0
514,324,198 *348EEFDEA33590624F0AB5A4D59C48C4D40791F3 tlakiltenamko
514,324,199 *348B6DD0D9FD5D8DAB3BE92490BC366E74B7D57A Tlaksalos
514,324,200 *3485F8CC4A67CC98E4142C2811C9C5B0875E36A7 tlalix1234
514,324,201 *348B2622B33857EE7F588CDFFF663AD7C23FB0FC Tlaloc’un
514,324,202 *3487AC7D92B8A3153D801E0AAAE09BA3D22BBCFC tlangden7
514,324,203 *3481DD7113B9AEC9DD16A64CAFC0005B0BC648B3 TLANOC
514,324,204 *348E2D8BB80BA049E61ECBF0B358C42F4B7119ED TlAU
514,324,205 *348DCA1B04675877BB3C1F2FF2963A896B04E6F4 Tl.baa
514,324,206 *348C8A25E004588FD19A3883A6BEC7B29B92220D tlbgbtlngging
514,324,207 *34882AD67936CA042901B5C195230F26F5744C9B [email protected]
514,324,208 *348352AD2AAC1DD637DD76A50DECDCA6FE5F678C Tldcbsw6
514,324,209 *348552316E6E1DFE8ED1B76452672AC8F584D7F3 tldenterprises
514,324,210 *3488DA86BF8642984B281423E84BD328ABC74489 tldyrwnfnts
514,324,211 *3486D604036C4256CC9417664257921DB41B41D8 Tldyvpnied
514,324,212 *348A19BB6C8BCBAC1B8A450449989355C623F9CE [email protected]@R1NG
514,324,213 *34805A9823C106329376DCB0556F9D54D105A2BE tleal76
514,324,214 *348EB90136E854DAF77D01A616065E4217B6373A tlebsinliuv5
514,324,215 *34842DE6E744BC8F6D03B9BFBD513B390AE2D711 tlebtiing
514,324,216 *34859B95E619E13C521D6B6CCB3B6C7A00FEED0A tledevu8
514,324,217 *3486A657C00F0BB7E8DF21CA7E3132EC71AC76C7 Tlednaw6
514,324,218 *34852F8269523C7B7FED10745083C4335561E478 tledneub4
514,324,219 *3488C19AB9C68541CFD95AD41963EF9048BF78E8 tleepsneget5
514,324,220 *348334F3783D8209543D6EC1BD1D24311F93B259 Tleevebbed
514,324,221 *3483D773CC679359BEE9EACF524FE9381A079720 tlefawhcing
514,324,222 *348606C5DF0A7D6804D0B2567FFF4ACF776CE6A4 tleiuereu
514,324,223 *3485AB5BE68366B6DEC40D82240178106CC75AC3 tlemnaid8
514,324,224 *348B51506EDA066FF72C415C550EDF435B84DE66 Tlepbsw9
514,324,225 *348EDE617A97C2C2D7BE185C14E301CAACAD656F TLESCOPE
514,324,226 *34895FF7DD2B3D4E296A6AFFAF1D312B325127E6 tlesnawk3
514,324,227 *348044B257F9D5198E8709829CDD6B70E1795414 tletueb1
514,324,228 *34800B6E5022A3DA9050FD7687FC1F9086ABEDA6 tlffany5
514,324,229 *348005F53A8165FCF1F4BF9F917F0CBE66C0BCE1 [email protected]
514,324,230 *3489B81B07D1531EC230BE727F2F0C71525DEF9E TLGATT
514,324,231 *348E1AD643AC820C9BDBEAF42AFF21EA214E5872 T
514,324,232 *3482DD3855BC01D63F491F79C8C900A1BB727927 TLIAJ
514,324,233 *348DEF25BCFB8B551D07C3810394342F237E71B6 tliehrep4
514,324,234 *348B5DDFD1A7AC5954DE141F5470DBABD27BC435 tlikaows
514,324,235 *348C4F98D85AFE1223929A2D0E35B25774CFA92D tliniger3
514,324,236 *348455AFE5111E4AE5567631D74BF7BF4EF380BD [email protected]
514,324,237 *348D4C36F238BDAF464D359E6B9C22DF0C04C159 tliubtoo5
514,324,238 *3483457D0AA9C558A440FACBFA0308846C997ADE tliuserdisavianuserb
514,324,239 *348FB537A42FEE08D43977C519B9048AAE8785F2 tlivipuls
514,324,240 *3487F61D203E9C50434423A7EEF5282460439434 tlkmmnktns3
514,324,241 *3480897C85B81F97A013E91CE003C81ABE7E7B93 [email protected],[email protected]
514,324,242 *3488AF908A128E26A3EBC75310EA97C9892E4360 Tllyrnd5
514,324,243 *3487B79B40BC3AB6503366C9361FB39211946D47 tlmntz12
514,324,244 *3480641FB5109BA239398D83EADA37E5672DFC5F TLMON
514,324,245 *348CAF74D9A90F5F7FEA10C0E4EDF76964A960F1 tlndshnsss
514,324,246 *348BD3D11F7337D2CBF9785D62E638649426AFC8 tlogohendro
514,324,247 *348C7417ED16C98B3551DC2B016009B2D7E8A256 tlohnab2
514,324,248 *348901881CDFFD9CDB357F9D5732F5D322EA6F09 tlomety
514,324,249 *3480B2B75C23E3CA8F0031162E7DC6131C4E451A TloqOSQ22
514,324,250 *348D14C85DBCE3B1D084735052E77793A6B9016F t'l'pthq
514,324,251 *348A1DC1796AFE46C40A6DAE6410903E72FF3736 TLPと言われるものはより低コストで、600フィートから3
514,324,252 *348A3394835425FB16DFC494316DBC2B7B08BC58 tlrligbccpdpk
514,324,253 *3489769CF2451107C91037CBB87C26B0DE810E49 Tlrprry0
514,324,254 *348BF08C8C578C6958623D4018B8215983E12C40 $t
514,324,255 *348A0BDDACE4D8E92FDBF4AA1A3BB6AA62AB1054 tlshosing1
514,324,256 *348F86F1DA8363AA5826E09B746D54049A2A44FA tlsjrjstlm
514,324,257 *348852D344986386BE94AFD3E44F88C203F584D1 tlt0644
514,324,258 *34864B93D706AD60286CB93B8AE1FAE5757F1EAD tltgryawkk4
514,324,259 *3482A63CE41844036D3D214EDD3E3C0ACB0F689D tltrnz
514,324,260 *3485DE2EE474520128A141E918C96A28B85CB3D5 tLuI
514,324,261 *3486D55E65DF07892407624A75DDD6CAC5AEA3E5 tlujinnfuk1
514,324,262 *34859DEBC50FF5859E87A1E12DE5B1F8E85F0D34 tlumaczen9
514,324,263 *3483BA0FF17DA753063E807E58797144AE8D0424 tlumaczennie4
514,324,264 *348EA8D62D0FB6E0E5A7D64B3F67F1E743EA72FA TLW1315
514,324,265 *34826E6163EB2D888F2B1A6E084CC6500D374619 TLXbGVOKbiKoXoc
514,324,266 *3482C9629BDD3DB9B347FC6A0E7CF732F6D1B63C tlyQ
514,324,267 *3488CCD5FACDFE63F424A4C6276E43D1B0E4033F [email protected]
514,324,268 *348FD747E2CC296BBD1E0EDE4758C8B4BA571586 t$M~
514,324,269 *348E69751568191B0E0FBDCB74C6D9D480985E83 tM$"
514,324,270 *34860C3ADF7B0EEE583663E4CFEEA391B3A3146E tM#-
514,324,271 *348C24F4487711A68BBF53C2D778448D8925644F tm0aaaaacaaj
514,324,272 *34832BADD18ECDB445A439C454EA1123F8122F35 TM0BJI35E91XSPV1N
514,324,273 *3480DBEBFB17A4A540FC39A9D12229EC8AEA69F6 tm221160talk160
514,324,274 *34876F5C5355C9822E994B259C5C3BCAE5CB97CF tm-30-480
514,324,275 *348F19B31EE983382419A5739FC449E2D7B5BB6C T!m83rlands
514,324,276 *348F844703D6A12A995DA549DF7BA85153B82CD8 tM:aaa
514,324,277 *348EAFDA176897675C8A2C6B0A6234CFCF7189A4 TMACJR
514,324,278 *348862A050D7F068B26E59D0A293D4B9E8B2B604 tmadna
514,324,279 *348869796157111F6E0940064C116EADC12C39C8 TMAPCMCA14
514,324,280 *348B0FA227222D02AD075282D5037D577FE79722 tmavejsi0
514,324,281 *348CF8E8B531C308EA880F4400314F380DE8CFB4 TMBITCH
514,324,282 *348C62DBA6A0A0B2293234819F63C340768F70A9 tmblweed0429
514,324,283 *348B52C1C588D1667B876CA6CD640CB2176F6661 tM&D
514,324,284 *34820044C140738868F4E2CE54BA2186F40C2812 Tmeonrev3
514,324,285 *348D067F9126AF9A6195CCCD2E4FE1331B16768C tmesawtiing
514,324,286 *348047701242131ACE475B89A6876F0532513F73 Tmetseb9
514,324,287 *3486EA2A90073F2C6216B14B6455B5C02A9A6CCE TMFDL183
514,324,288 *34883C7FED2F6295C501F1A1042FBED42151636E [email protected]
514,324,289 *348963CE8D71FA0096E7A5AC962D5FB1AD536529 TMG0411
514,324,290 *34861560015B00F07B9F20E594A501D4C2841EC6 tmg551
514,324,291 *34845F2C157077B4DFD0516DE77F5C9B7AC09797 tmg657
514,324,292 *34819E138A70CFB79135D207FF9C05414F9F2AFE tmgdxsq0
514,324,293 *3480E2EF92B8F745024A386A631895CE437214E0 [email protected]
514,324,294 *34833A0D93B33DEA3360D221C0DC608DFE1A7394 tmgwrpnu9
514,324,295 *348FA8F3D1E041B22ABFC2F239611BE3D551B776 TMIIIA2
514,324,296 *348F4627CB91AE52290002144DB0B3FC882C48D8 TMIMAGES
514,324,297 *348C0301849A61BA542F870C07FD8517A3E31793 tmislaid
514,324,298 *348A80009AD304E8181A91140479A7E3BF39DF94 tMJ1
514,324,299 *348D2A3954E78136FA1333BE5FD49063EA184990 TMM101613
514,324,300 *3489F9D31AC2D39F663D71065715913D23A071E5 tmmareger
514,324,301 *3484BFBE414D657B2BC5479E1D32B7D30A37CD0A tmminuz0
514,324,302 *348A0A11AEB3A8346B70573E1B3D0468008A0A71 tmmrfrses
514,324,303 *3480CBDD029AA0EDED152C4404CBA96F13F44EF1 tmnstrngned
514,324,304 *34882E68120D0D2E2FACCFE0421A0B580F8DCD2C tmoignions0
514,324,305 *3488152715F61FFDC1FC628755DE7DA98AAB1773 tmoktool6
514,324,306 *34814EC91E98B90C5BF8D9FE1D8137E3607E3FFD TMONICA
514,324,307 *348229972A3F8C9D7CBE6C05DB7433B596E52ADA tmonkbsw6
514,324,308 *3482E076EF67FDD08B9D41D689B8BEE04FF9B516 [email protected]
514,324,309 *34804D435D2FA798129921AF43894CF28F6200DA tmpst123
514,324,310 *3488E01E3B36F6D162726B9B92196C6E5D89257C tmreresing
514,324,311 *348EF49C1EC663498A09F46C08579932788F7FA2 tmrfsthcvg
514,324,312 *3483BFA25A4092AA9E38BE2F220EB9EB18C8AC23 tms007425888
514,324,313 *3485F7F75B080C46F1F9C1021EB2F2F25DFBA901 Tmtimon
514,324,314 *348DBEC9D0081483445EE391D44B9510EECC3952 TMTUse
514,324,315 *3486807DC5BFBADE145EAB1635FA30F8C5071608 [email protected]
514,324,316 *3489559AF79A9434FE832070EF8A7608FF684D34 tMWd
514,324,317 *34880AF7D86C1C2A2FB606318B12E8BB79804C58 tn290
514,324,318 *348A85763D2ECD513AB24E8915ED6B7D8503B16B tN38
514,324,319 *348EA19DB1ACCAB06ECCCE7E53465C2544B31611 tn605838
514,324,320 *3486055D2C7021E45300A60FC16FB14B326C57B7 tnacesoc4
514,324,321 *3488FFE0722034436EA810B4180A73F26A403C36 tnadnammocspeorg0
514,324,322 *348699A2050A6015323CEDF6BF8DB25FC1B92AB8 tnadnoder2
514,324,323 *348CD57E2FE31D6DC1ED8FED093BF955207E1E76 tn–afa
514,324,324 *3488F06C9B19A3831991BACE37461ABB083B2267 tnahpeleaidualc
514,324,325 *3486FC368209009899A7934EF69055C325FB1BEB Tnaiduting
514,324,326 *34804F6CDFBA52134DD5DC3B926A44EBDD34AB77 tnaivednon9
514,324,327 *3482C89D6B782623CDD9C4F8566DE9236A589310 tnalcane3
514,324,328 *3483E95E700C7DDA170EBF249D38CC50389A20C9 TNALFIG
514,324,329 *348BA4AA6037C273EE22EEC2A68DFE5E378B5641 tnallirV
514,324,330 *3488E1922143845D9D35A4AB1E2B1DA500D5D345 tnalpmug
514,324,331 *348B1AA52A71B70D616A70F19190120697AEFD41 tnalpsomed
514,324,332 *3488AAD0CD28A2EBCD2B93C131A8D2DDE2159A0E Tnalpurd
514,324,333 *348B0E1D4D5DE726EE1047AE4D9547862F0318C6 tnaluov0
514,324,334 *348DCBD37815D0778510E46C8D2D9202A3AADD9B tnammargorp8
514,324,335 *3487D6F93DF54F0A322E9068F8012E396D0D8716 tnanicul8
514,324,336 *348022B52746AB3EC34A8E5D35253DD28032279F tnannoitidda1
514,324,337 *3488C9C445625D6120B572B3BCC4CD29B237782C tnarbezes
514,324,338 *348270AE8F049FE51790191C962B37DA7CC81214 tnarginahpetS
514,324,339 *34881AE013C1C79D5A26097E1A82B9EEA07FADB5 TNASILAUDIVIDNI
514,324,340 *348220C67C897552C7C80DA6F88093508F382FD4 Tnassiab1
514,324,341 *348A9DC740FA5043009F07192EE797BA1065383D tnassirehcne8
514,324,342 *348F7313A5C27B76E52379366BCD87EDF275A6CA tnatcepsed3
514,324,343 *3481CBF4315D4B3927C4BCB38D84111631C19066 tnatcurt6
514,324,344 *34836589F576BAE03280C218B3B2236F61522FBB Tnatimiled
514,324,345 *348E19EFE9D591E7DD2AFBBA3E87869077F127D9 tnatomac4
514,324,346 *348F0790C5E095025DCBC58667AF9E472514E0FC tnatresing
514,324,347 *3480EBE180D003804346AD78E76D9B878A70E023 tnatroppA
514,324,348 *348284948118D29049BEFF11695B2184B190221C Tnaulased
514,324,349 *34804823B34F584B8449E476DF2291B3FC19D572 tnaulfering
514,324,350 *348154DB90D66EB8526403743D5A13E171351826 Tnauolf1
514,324,351 *3486A4E4ECF7463B1F598DE60667DC1FE189393C Tnausrups
514,324,352 *348B9168F54ACB340C39AD616E9C552E93179528 TNAYARTXE
514,324,353 *348C67AD40E7FA862B9E3D6CF95FF5EE77BD3407 Tnayorc9
514,324,354 *348508CEA64E6C6CEB11E1F45C28477980C0EA09 [email protected]
514,324,355 *34837EEEA388D0863EB6E258E6EB84876824F5D8 tndebndets3
514,324,356 *3489B7A2FD69D8BB9DC960E0E8E78E6E89E80108 tndncslied
514,324,357 *34867562A01E5BA3A2525B580AE00714FD472E72 tndrhrtdnss9
514,324,358 *348806669F4E7A7506466BF81A2C8A7E009DA7AA tnebirkser
514,324,359 *348EC22CF790F127D93B4F963FEE9CB309652F4E tnecsenimulobirT
514,324,360 *348F005F3AE751612DBCB24C1158B647A88E86A2 tnediccarednu
514,324,361 *348294974D01B95A082C1E8BE332F3EA9097071B tnednecsda6
514,324,362 *3487E9205BC9580338D6853255FF83991F3389A6 tneetsegtaaga
514,324,363 *3487A1F8940AF5162A53BCAFF48D1F8B4F479735 tnegbsw8
514,324,364 *348D74BD4143A263FF10CEE16917AA7F864006C3 tnegerrev4
514,324,365 *3485192A8EF3BE9B78258BC67714EA8B32655D1D tneiadraf6
514,324,366 *348354224B6BE3A3A92D9A9E462C302A430FBE0C tneiafargas
514,324,367 *3480A026626B25626455746A8E6D70931B4DD04B TNEIAICOG
514,324,368 *348128248EDBF4C152A1AEA270F1721ACB9574EF tneiannoitisoP
514,324,369 *348E7F597A9B2007F1E121A0818CC5E52FC250CF tneiardniojer5
514,324,370 *348AE1F17612F39EB39AC1D7509ECBC83AA54BEC tneiarebruocer4
514,324,371 *3484DDBB47AE4AF6437277073F25D3D4C170678A tneiareguob2
514,324,372 *348516577A827A6D158398517B9B7A9A49FD47CC tneiareifinalp6
514,324,373 *348E7785E641CF31824C3C579A48DDB21E433B7C tneiareilpitlums
514,324,374 *348FDC868C7BD462B3FDA81048CAF793607B0F96 tneiarerreses
514,324,375 *34898397B0CDDEE869C27CDA3589F3D288B43D11 tneiaresil9
514,324,376 *3480B27FB61EEDCCF726DFC017D6E8F7CC161B0D tneiaresiropmets
514,324,377 *3487899E2F5B6573243970669F9A34FB5D2A1EC4 tneiaresnepmoceR
514,324,378 *348F1FEF9E8A672CA0764C369AD2C5FD04C7966E tneiaretnahced7
514,324,379 *3481BCDE1AD8E407A6C356DCB92D212E6E26B48A tneiaretropmi
514,324,380 *34860C660A0F11DCE0DF01E0185686593ABA0334 Tneiareutitsni
514,324,381 *34872E414D3D0E12CE5F0779D2526E0D15E8DD90 TNEIAREVARGGA
514,324,382 *348E45432B4DC8552DB9BB6B76AD21717D4A93C9 tneiariurt2
514,324,383 *348941BCA78C66AE25FE5A59C039C891F24F9A20 tneiarras
514,324,384 *3488A67014FC29810FDF01762222FA8B30EFC82F tneiartibra5
514,324,385 *34835E3DD88F86E8070FD2EECEB373D31BB3F23A tneiaruguani1
514,324,386 *3480AA54BE324DACAE8F435947E30DC7B758E0AA tneiasirallecrap3
514,324,387 *34876C2E28611A46D7204B74AE68AE2865CAA8C3 tneiasirged8
514,324,388 *348646E5EDD5D2810DDA9DE97F49C15CE1AD90B3 Tneiassidruot
514,324,389 *348B7DA81E18DD744878EB0F160EE3E69F3E8064 tneiatno0
514,324,390 *348C2E362C559B070BA9272C4987AA11829E5BD6 tneiautitsbuses
514,324,391 *348C5F1067F18B598990AB3804DC17F17B869D64 tneiavil0
514,324,392 *34816265E74BE89AA76CF48B8921118C285B3CF4 tneicsinmo8
514,324,393 *348B12770B1E7EA82C383BE3E28F931E7350CD15 tneifitsym8
514,324,394 *348D2888F2C978E68F91F58B9C9698844E0BFC13 tneilpit9
514,324,395 *348E06C9C47FA2AA859FC16A3F4921C699B84E03 tneiruah0
514,324,396 *34820C51F09DCBE70900B82B8BAE76609191ED44 Tnellop
514,324,397 *348863F7681E29443B75210FB02FBC4373A07655 TNEM111
514,324,398 *348CF794CBFB28C016EB62E5AC556F9FDFB0E0B8 tnemamri3
514,324,399 *34853AFBF946B0DCDE1990330F8E95A826BDAC36 tnemegau9
514,324,400 *348DDABA29DCB8387B3D11E68528826A97A3FEA5 tnemelbanesiding
514,324,401 *34832714ECF1D754D31BDC49599E8F4BD51C0A59 tnemelpmocca0
514,324,402 *348A8DB48648406955C37BC65A7D758DD02793BC tnemeransni0
514,324,403 *348665DE483EB53FEA59436750DB77B9972EE21D tnemessinuejaring
514,324,404 *348CDA2B793D3E73055B2EB39C1CD5F9ED2CE797 tnemesueluduarf6
514,324,405 *348CA8F152B6AA961ADEFEA6A74973A14B5B1E67 tnemetatsrednu9
514,324,406 *348B10D468BE0C54DAEB1A7108773B86DDDDBB14 tnemetiuqernu6
514,324,407 *348B4A83E1D30413CBB2FA091C4F4BA3A2D00749 tnemetohcarc9
514,324,408 *3480DA80037371CF00618BD0936E5D8FCC705539 tnemetteuqocs
514,324,409 *348D2796450D2B295BBD3A9CDB029ADF343E93EF Tnemeyap
514,324,410 *348435719286E41CE457AB2441CE89D531FA163A tnemeyessarg0
514,324,411 *3483FD3A66CC499B8112A9692DE9701D07D424BA tnemmalahcnoN
514,324,412 *3489CE33443BB7AE4EC2DCB262C6C095223393FC tnemrefi6
514,324,413 *34869E37A9469B54D6EBADEAB6CB293E9C900E65 tnemteba3
514,324,414 *348221F18CCB0B1438C8DD40B64B1DC2F2A8821F tnemtroppuS
514,324,415 *34808D9C618304AC86A9C5248C9E4C84BDB5EDC9 tnemtsujdasim9
514,324,416 *348051C25A28661EBAA751164A8ED22D503C0D1B tnemufrap8
514,324,417 *3480945F76DEB25F281F3BD9D85FCF1BD26E4DE6 tnemurtsnitpuah
514,324,418 *34863811D5CE8209AD8D61A02332001C719E2A5F tnengialpping
514,324,419 *34891533B7F5E3EF9C2D36CBBD9812B4C19908D4 tnenimeis
514,324,420 *3486EFFBEE4E0156CC37E3D34E48048DEB8AA6E2 tnennerp7
514,324,421 *348804827236033C98EC6F995DB2ADB692392CD6 tnenopmocai7
514,324,422 *3489A016C8B6FF790DED6376CD686E87C02D7EE1 tnereirr5
514,324,423 *348F60554743B7350FB22E4C337B62B9A8D2BAFC tnereliffe5
514,324,424 *348828FECA072501ABCD64049266CA396F3AC146 tneremrofnoc7
514,324,425 *348EA6FDE387FEEBC19CFC66D20BF4056092AE07 tneresilaicremmoc8
514,324,426 *348F25BB58B1045FE4F297F10683621ACDC2CA74 tneretide4
514,324,427 *348168C21BBBD26110F49CA28AA9926BD5D63F9E tneretnierE
514,324,428 *348BB22CEDD71A625B1C6F97B747094A4BB93857 tneretpecxe
514,324,429 *3482BD86E684AC93AB1B8498CFEBD8C9DA03D975 tnerifer4
514,324,430 *348C3AE866D4A3E4D3C34931A30D16BB2EBCDF3E tnerrapD
514,324,431 *3482F4A51DA3FE7834ABFCA1E739F62AA0DD10B5 tnersirolav
514,324,432 *348ACBEB520F1A2CD71B1EE758725CC12163FFE5 Tnertit5
514,324,433 *348B81B793468AA034D87E7E84758AC0A0748EA5 tnesilyt7
514,324,434 *3489BEC990BC9D12D8477AE6745D8BF6AEEBC270 tnesopor4
514,324,435 *348D6DCFA68C30D19F77E80529ACAEA446C8FE54 tnesser6
514,324,436 *34820A61AB0B855E60D78E6731BF7E9BF35E1622 Tnesserd6
514,324,437 *3487603C2F4DADB1C6AEA0B5ADFFA3465E29A31B tnessiorcca
514,324,438 *348E18BC7F7F10CEDE3DC6AB02AFE9F9DC7C924B tnessiso0
514,324,439 *3489804151DA1243FCBC5DEAC9C6B5E295B54F7A Tnetcel3
514,324,440 *348CCAAB5166452DECDF7425DFADEF38AF343C2B tnettehcacer
514,324,441 *3486100B5BFC1E3991DE83E7BA477D3CE4DE14CB tneuqnilbsw9
514,324,442 *348996AC6FD0B8793F93EF821AEB664293290DBC tneveyad
514,324,443 *348AB1479C6DE6319F6D52FDFD908E67404A376E tnevircsuos3
514,324,444 *3486A7F6CFA8CA56BD1F24088503BBDCB1E44B30 Tnevnok6
514,324,445 *348D96C03FFC40E2070DA71CA0099F86D9E5A190 TNEYARFED
514,324,446 *348BF8DEE487CE2B8C53EC16F9ED5D91475E2850 tnfdnmmczstnftttnfwzstnfttht
514,324,447 *348B0100AB238AF918BB886FC78DDA2926122A72 [email protected]
514,324,448 *348CF4A0326067F51D5717305B7FD16334E39A43 [email protected]
514,324,449 *348C273C6961B051B52A1FCF62C8C4C1452086F9 tnguyeneu
514,324,450 *3489EBCD7BBC97E934D92BFCF77BD4DEAACC5306 tnhpclhc
514,324,451 *3480294AF0BFF02E2A96B399AD3855C3014C699F [email protected]
514,324,452 *348CEFD668599357501166AF44A8AB6E852E5F0C tniasahsas
514,324,453 *348AD266ADFA50588F552AC25D1575BCA23B0DB6 Tnihelaed
514,324,454 *348980B857CFEFCDBCA58901F9A5D4596C39991C tningskonstruktion6
514,324,455 *3481C5EAC742AA772445874008032C7D7203C0DB tnipsrev2
514,324,456 *34881310B442E5955967B3C41FA407EA31848684 tnirpamos
514,324,457 *34860EF74AB9429001AA886A02897F9655D10D60 tnisepip1
514,324,458 *34864ED5BBED9D334B4F47597136C906FFAF44F2 tnisuuyk9
514,324,459 *34827AA8C76414C8A25962ED5C4B065F95ABA13B tnitezoring
514,324,460 *348005B44449A075D477BB1E2FD5E72973253B2B Tniwhdlo
514,324,461 *34855C4CD4FC11B17B9515B6FD01D868182B8863 [email protected]
514,324,462 *348094E065A29734976E3D0228DC3A7F7DE777B1 tnkcqqtucg0
514,324,463 *348BFB9F09FA5FB61B6280C36A4907BD85697835 tnktl
514,324,464 *348ED7C9676EF0E54C1C0BE15132FD33EED16689 tnmakc
514,324,465 *3488EE161A2B45D8C37491BCD15C926085EB42A2 TnmblMofourCatholicForafatheiB
514,324,466 *34832B9EBD0B37C6F7CD85332240557AE8F53E2C tnmbng12
514,324,467 *34812FBC2F6B0CD326350F5973FAD62FF76FD5C6 tNME
514,324,468 *348253C44E118C8F1BD16E777BF959EF35D87156 tnmnhrnt
514,324,469 *348246E489175E743154C9784E3DA8A8F8C88B5E tnmnncc1701
514,324,470 *3481A863ED10231792FDA57940255FCB2984FCAA tnnanebns
514,324,471 *3485B1F451AC1D8655D338B55849613FF5E3EE90 tnnlbnwndr8
514,324,472 *34810D211A8E349B3505F6F92AF1CDA87BBC3F59 tnnriv
514,324,473 *348BB10AD1D290D6BC4C94A533BB404CD1B79D5A Tnnrtnnr9
514,324,474 *3483D311D7036F4B9BDE907CB67631B24E4C21D7 Tnnsstrs5
514,324,475 *348771BB89484439D257D5F08A9F8E8C7915EE15 TNO2003
514,324,476 *348E7AE17F4E5EE4EF74966532DE6D7BA5163955 tnobodying
514,324,477 *34853B24B7843E00F27B9ADDC0546C309EF7F238 TNODIS
514,324,478 *348FF03F890D41E979A0F91C4D669FAED0FC5641 tnodular4
514,324,479 *3484EEB9B724D1D7AD220AB52B983A78DF462F14 tnomramo
514,324,480 *348B7C95A38676B664D8C2B890C6B1121600C7CD tnomrevecitsuj
514,324,481 *3485DC803F51A6C518369DEB296F3B6773D7416A tnopneiht
514,324,482 *3481A52C2F74D6AF59B4202AA8B374BB4669A9C5 tnorelra5
514,324,483 *34817A5F6F110E11E860640C0F9055BE377325D5 tnorenalgged
514,324,484 *348ABD90C41AA0FB56288C98E46B5A62D71668CF Tnoreng3
514,324,485 *348CB31DC4E9E62AF84B20701AA0E49C3E6C4223 tnorerol2
514,324,486 *348E07AFA6C09DB2F1804607FDE1DC09DF65F470 Tnorerue
514,324,487 *34841078F074B1B9184FDF9E681B13D04C2BBED0 tnoresilars
514,324,488 *3482D2EE1A4FB1BD497E48405AF9BCFA7FF6FFBF tnoresitamilc
514,324,489 *3488B3D02A8D237DB16F115E278DD532CD1BC493 tnoressiacing
514,324,490 *3486ADCB9FB0FBF60BC3958775AEA162BFC68DF6 tnoretcejni9
514,324,491 *3488B6E4D15FD1B7718089834517E716E0F39D87 tnoretnav1
514,324,492 *348D6E5B87902773A52AA17F9177F8264D5BAAEF tnoretsuged
514,324,493 *348C9233E9D1792BA4E864A12C2B5CB6F9462E77 tnoreuoved1
514,324,494 *3489BAA9D9FB70939DCD8735EA94BF2D34B83003 tnoreuqalp7
514,324,495 *348134A1B8B46502427F468332CC3266D2911778 Tnorfelt5
514,324,496 *3489ACE71C20481B624E3C0F00DAF4BA5F6A49AA tnorfwob0
514,324,497 *348DD475AB563BA90E8A36FC2AF415ED11626B7A tnorilliuobbing
514,324,498 *348B7CED56AC69B35A79C481F9C41C4A51CE0979 tnoritap0
514,324,499 *348B17FAAAFD5BA22CFD1831BD55F445CDF3DF4A tNPF
514,324,500 *34855EB862A45F4623A15134673C367FFB9578DF tnr0805211356008
514,324,501 *34842C5102D32F974C81AEB87BEC1D0D8D6021A0 tnrnnrtp
514,324,502 *3480287812865490904E4236F7F6EF9058D625E1 tnsilb865
514,324,503 *348D2E09115EA1E45A6F7FEB772F63B5C75C9FB0 [email protected]@1!Z3R5
514,324,504 *348A5AF26E17020617D3DB39EB0300971C88B1D9 tntdynamite6
514,324,505 *348E9EA3261F097A3774A9C641A2EF0BFAD58ECA Tntltnnn6
514,324,506 *348813FC8B955165D62FF634EE75B1CDFB93E05E [email protected]@L!ZER
514,324,507 *34866174FA22F4569A1E7CD23C316EA66FA1569A Tntmeph0
514,324,508 *34871816E4C9475983A8ED7465EF3C5A76F88351 tnulegep5
514,324,509 *34877D73EE0C7B59D111722F994C70E373C1D9C1 tnuocwened
514,324,510 *348565C6CBF691F6A108C9C7E53C8C623C65F7D4 tnuomeromhsur
514,324,511 *348739DF3ECCFDFCD775E565BA4D1F33099265EC tNxT
514,324,512 *348DBA32259D2DCF4B206275FF45FC4C73B54E9C tnybttns
514,324,513 *34807DF7A35D5132FD338E17AA4ADE4CF184EA84 t*nz
514,324,514 *3488F303E5926C609918FB8D68896BFC8CF5C514 t<O$
514,324,515 *3482B39D04E3888AAE8D05CA783A329E9A923EC1 ˈʉːtøː
514,324,516 *34815B165E966C25124A568D6CAEC32BCC9F311D [email protected]
514,324,517 *3483738701873AB2F07FD52AB7BFF7B26100D2E8 t>O9
514,324,518 *348AE0B916C87C57B4D87F16C6032D43DB7C864A T#oaaa
514,324,519 *3488E8313E6646355F29E56D9D39F932C67B414D T-O-A-D
514,324,520 *348DDEA017BE251F0BE2209B50C8AACC1B292C9C toadbase2
514,324,521 *3482EF3D9594892D3E7B599907CAB889CBDBE13F Toadf1sh
514,324,522 *3485FED0A422C776A783F580631D34D2518360FF toadletsmall
514,324,523 *3482A3886B42EC958B0820AADC47DC113C6B8988 toaggrandizeamplifyaugmentbloatblow7
514,324,524 *3483F69A05695F59CCC55ED220259359C14C89C1 to alice in thunderland
514,324,525 *348CFCAC8438828F2E9F6460B1458703983B05D4 toallappearances6
514,324,526 *348C1458B314A9888AA3568CDC8A90B9A0ABC23C ToAlltheLuckyKids
514,324,527 *348705F9144B9CF4434FAC459008C7224916D193 toan47
514,324,528 *348CFD3DFBD0B153C9E84DDD222C15B7EECE98BE toa-suo
514,324,529 *348FF8E83D635CDC91E5DE3306F52F3B2F7FB7BE TO A VISTA OF MOONLIT DEVASTATION.
514,324,530 *3489E23019F4818869399A9A9BD76B1F5582A07B tobaccoite1
514,324,531 *3482698ED15477FF2DB7711E1307EA2B5E20EA96 Tobakses6
514,324,532 *348B8FC829891DD468EF11CB0E2D2DC04281CD02 tobbletkerese7
514,324,533 *3487A9D68D20F77A197ADDB1C6267B68D3F51C81 Tobbyy
514,324,534 *3480751128BA64039CC9ADDE11B7D4E2ECD356CD tobebot'-'boot
514,324,535 *348A9BA6E45F82F356BD970C117C4B83F193B87A TO BE GAiNED. WE ARE NOT AT WAR.
514,324,536 *3489A669E22D1E4DF04A7E1F5EA53FC9FB3B022A tobeseechbespeakbidblinded
514,324,537 *348DCA69C85E67E4D0222D1A65CB05A8F3AE2A96 tobesoldnntil
514,324,538 *348AF011A72F1D52BC13EB8E2739E9756515613F TobeStar
514,324,539 *348E2DECDCF8455CD5A0D2D72BE3733AC344AC55 tobi7261
514,324,540 *348C0708A0341F6D334EF60AF39123188B03E6B3 [email protected]
514,324,541 *348028C730C4658D899E9EFE6E7BB9F0DDC923A1 tobias.bolda
514,324,542 *3488CF38FB7AAED30647066A00DB0692457C0184 tobias.canny
514,324,543 *348E9A793368A3D1D5AFED6BA0FF8B8EC4D9825A tobias.dudleson
514,324,544 *34836B7FE73FCBA5265A1E4B487D67B3B59AF8FC tobias.garafalo
514,324,545 *348C6ED074D52BFBDE566FA0EDC5C5D56FC05DBB tobias.isenbarger
514,324,546 *348B92E360172B9A306CE7319ED56999F1916CB9 tobias.jun
514,324,547 *3480F58220109683CCBEBDB06266BE78FA8E0197 tobias.klepfer
514,324,548 *348986EAA715137BF5598E36195819EB75A5FCEB tobias.maccarone
514,324,549 *3488930FA3E583D2183F4C4A73E376554E5C99F6 tobias.opatrny
514,324,550 *3480A7F6022227C1AC0913CE97DEE33DDA0AED5D tobias.plocher
514,324,551 *34840C8372D8F31F971DC2F478C692AD1C59BB5A tobias.sankowski
514,324,552 *348B7A49D69EBB1024AED30231B7C7C021CBCA6B tobias.schnorbus
514,324,553 *348FABE8F40D5954CBCFF753D8E3590E81072590 tobias.sherrow
514,324,554 *3483EF056796E5C62FA4E089AC8CCB27826395F8 tobias.simonton
514,324,555 *348798A7A9E686410240FA5EB9736C818A16286B TOBILEINCHEN
514,324,556 *3486852841289738285B8F7DB253F1ED5A8A8C77 Tobilling
514,324,557 *34805DBDE098CCC85686B5D9A630146DF6BD13B3 tobiseed9
514,324,558 *348A2F9B8F1CA5C425FFD17266F86414CD6098E5 TOBS65
514,324,559 *348EBBE7B0AF4F82B4EB445BBE03632AFF5DB702 Tobunio
514,324,560 *34805F964E74BCBC26D5A8EEE1FE544649C1CD82 toburau
514,324,561 *3483721FE644E295E957E586EEB1428BDF4191F7 Toby435
514,324,562 *34831E8AB20D3ADD8091865AB1FD350D8B9EF161 toby.alge
514,324,563 *348206CFC269AA6E5779661E4B343AECB2BB60E3 toby.amailla
514,324,564 *3488C0E6A245073B9415617993B3F2BD83174637 Tobyanne5
514,324,565 *348E9ED1363EB05A35E3F0E4EC13988522DB3746 TOBYBABY924
514,324,566 *3480E8A59B4F70671B94713628733D6B6D8C5DD4 toby.bouchard
514,324,567 *3481693DA3266383D87CFDFBF46CD54B38495E6E toby.carruthers
514,324,568 *3481085D57297CAF1A09C44E9A8F4EC4792C4C42 toby.collyer
514,324,569 *34806D0EF39DC7F43F4EF7A6BBC8469C3C793B3E toby.daigneault
514,324,570 *3480343D28759540DC4336B21BE9DB57E07C2D8B toby.devita
514,324,571 *348535603A9C540C4CB619C8D4B9E7B51A636313 tobydiana2
514,324,572 *3486C4E3AA0E729097EBC8F2075FC2A36107C489 toby.ellzey
514,324,573 *34857252916B86003D767D9823F5F10746BC9138 toby ewing
514,324,574 *3489296729A4E68A68233FB75276B36225915068 toby.goffinet
514,324,575 *3488DEF81D58E2AEE55889F95A934F010C78CAB7 tobygrumpies
514,324,576 *3489CCAC5157011BB1B36C287B2B3821F38B466D toby.hardester
514,324,577 *3483D7B9396724EBC895AEB3FE6FEAA013449EAC toby.hedquist
514,324,578 *348026AF1A8FAC3BD09841CE923F0843B0222F24 toby.hemstreet
514,324,579 *348F59131AF81948FFD420ECEB928CCB675F894D toby.hollier
514,324,580 *34835AA9CA34504CD270B6CE6A953FFD9F3FD6CF toby.iwasaki
514,324,581 *3482632B8E7153041D600DD21D67056BDB1A177F toby.kolaga
514,324,582 *3489688DBC745B50960102AB090AF5DBE0BA32EC toby.leyba
514,324,583 *3482800489DED93125F0BB88BE59D44B6EB3E03B toby.mellos
514,324,584 *348701DCBEEF99924C16B5F249069A1C5B386D87 toby.modica
514,324,585 *3488D2B41A2E574825ADAB5FC63B2482598D56DE toby.natalello
514,324,586 *348BA7D4599B928661F012186818266951BC31F0 toby.nisbit
514,324,587 *34883721DDCC10B89289B87F6A693DB3FEFFCA6D toby.raduenz
514,324,588 *3488CAA1B35EDB2EB076F86987E2CADAC66205B6 tobyrebels7
514,324,589 *3486DB86559089D551BB6B1E44A2705C151635A9 toby.scarrow
514,324,590 *3487E813D6E72B459838431B8E3635A431801250 toby.spanicek
514,324,591 *348185336B6C012106AFA94F9E172B4E6D866DD9 toby.viti
514,324,592 *34823894AC9E64913A3540CF55D5B3D76DBD468A tobywizard2
514,324,593 *34835ED100D129501758EA8CCBA05327132A9D05 Toc260037010
514,324,594 *3484C7E9E5F2F52BFBD3E81D91D2EBB4A9B88BE0 toccataandfugueindminor,bwv565:i.toccata,adagio
514,324,595 *348C18921676268F70EEE111BFA22576F1B81654 Toccatae-Moll,BWV914:III.Adagio
514,324,596 *34895B1666BEA40FF73BA866828D408214425852 Tocedor
514,324,597 *348A8273ED4B2E5D0691A758268A56D58BCE2049 Tochernt0
514,324,598 *348C72897D9832871D4E5D771141C17AFF80CAAB TOCHTERMANN
514,324,599 *3480BCCC7018A0093F75D6DFC5D8794BCA0DA5BD tochtuoses
514,324,600 *3489869EA71F043F162180167B4A3D8A273A738E Tocinited
514,324,601 *348C1D8839F6E53D5DEC5574DE883B0B92B287D8 toclosed5
514,324,602 *348BBBDFB0588D7644F2DC093C29387FDEAFE3E9 tocommand5
514,324,603 *348306B0E506F992BEC96D238F70548C78EFC4E7 toconnectionsconsequencecontribute7
514,324,604 *348BA3778693BDE1EC88217AE67CFA5BB6F3FADE tocontactconveycoocrowcrycuecutaneous5
514,324,605 *348894F285CB8546DC0F1AE16840AD4D463FCC6F tocorrespondencecoverdabdashdeal2
514,324,606 *3488021414B4B0F9AC06A4F11FCDE0C0D87C6D25 TOCOXM55
514,324,607 *348700DDA674B16F24F99035D4F39EA0D5BE074E TodaAznarezdied970
514,324,608 *34854402EE785F6B4EDF7C6DE23ECAF363D7C559 Todackj4
514,324,609 *348E2D4D1A41D15B720200B2373D477996075585 todaychristop4
514,324,610 *3488B0405768BB30B1FEB46D94ACA087A187829F todaycowboy5
514,324,611 *3480689462738A155A965946DC04D9BA7ED8F0D7 todayhammer7
514,324,612 *3489CF40BBD2380C67B8DE8A2B4CE420513F4672 todayianela1234
514,324,613 *348C62E3B07BE3CE39F626C717522711DD1CA6B2 todayoshii
514,324,614 *3482630996187BFF51A34AFDD48B965BD8687972 todayrun5
514,324,615 *348098A1C02647A57FF79299FDE47D9EF909AAC8 tod.bealer
514,324,616 *348878960B78380C4FEBD3844E03CF506469B8D1 tod.behrens
514,324,617 *348A16F14EC9DF635B85B39C0A61336FA3483F8D tod.bertch
514,324,618 *34880736FB8C8F897F100DDA1577A6E444555163 tod.buenaventura
514,324,619 *3480DD506B4FB7FA4A6EADDF060B256522CB5BB0 tod.cousins
514,324,620 *3483927CCFDE938F8A3C24BD2A39FE5AF670B867 todd.bleininger
514,324,621 *3484DD83C9E20426F23C9CD35C4EB5247685F74C todd caudle
514,324,622 *348DD089994268F5FDD1C3C36DCE4D4BC43B312D [email protected]
514,324,623 *348CE5AAE3F731143C6931720A0357D682DB3DD9 todd cioffi
514,324,624 *3482E522DB1384BCF43E7F489128AF07347AECF3 todd.councilman
514,324,625 *348F7427BECEBA59BA0BB72EFAE3F78847E77E22 todd.cruson
514,324,626 *3481319548F7CC31563A1C959D3AFFDB8F8FC218 todd.czapla
514,324,627 *34835A8E6AFCDAE1961CDE191B617E208A55954A todddedmon
514,324,628 *348CE70921A458B7F9F4DA90B50CA8BDFDD03E10 todders7
514,324,629 *348F53817DCAADB88697291581FD64DB99CAD687 todd grunow
514,324,630 *348A3A0D73896C6B3CECE750D9C19309E234B27D toddhume
514,324,631 *34853B6132EC24A2852894D9ADE4FA703684959E TODD-JENKINS
514,324,632 *3488440D8DB459482B89FF2F75DCF660B53114AE todd keiser
514,324,633 *34834E21D5148C191A2060B58B64A696852447B0 todd.lamfers
514,324,634 *34882BDACCBF7A3642FD80B1034C26367907FC41 todd.linney
514,324,635 *3489FDD40C4A335DC8C94F4D37508764AE879D82 todd lipscomb
514,324,636 *3483693203C7918A4DD56F88EBBB043FC6B5F573 todd.mangione
514,324,637 *34843CD76F4802D8C62FC8C19490E4DEC06A29C8 todd.mcconnel
514,324,638 *34814E0BFA307B01BB12B77955A041A1DDFD8381 toddmcnab
514,324,639 *3483F4FB27999F91E3F48921EB1F6A0AD4D120B0 todd.miguez
514,324,640 *3483469BA1B183A6B06CA0AC9153B8FAF7D41391 toddnaquin
514,324,641 *348E5E5F5EE273F9A61954B5115F6E4F3E08A8ED todd newswanger
514,324,642 *3484C544C39DE3D2F674E7482C810BC8D9B06571 todd.nichalson
514,324,643 *348B3CBFF4A1DE7DB48E24894146BFDA9A4795F2 todd.rollo
514,324,644 *348E5A0C73CA8FB70E0639A1D333AA828E03F765 todd.shuga
514,324,645 *34854828AEE14D5C112D6D4B3910EA22B0DFAB5C todd_strasser_author
514,324,646 *348C28D4ACA5B33E3D5105E1A4D4FEAF25A437BC todd taylor & the tragic rogues
514,324,647 *34861387A89B42FAB95CEAB78B7E1957192D5E5B toddterrill
514,324,648 *348427CA84916E8131ADEF07174E9326A5EA7FB8 todd.torain
514,324,649 *348C35F268AA8405CF4130BE55953D544C3B2B97 todd woody
514,324,650 *348E3A2C1019A2B524D7816A9DB3321983F85C48 todeafdisinclined2
514,324,651 *34833F9BF84839B4F768A4080E2A28473F94400D tod.edenholm
514,324,652 *348583135116B7BAD437E013344D6CE4C0630886 Todeisart
514,324,653 *348C5823186D6217DDF55CC57F7D17AC4A1F65D7 todennäköisestikin
514,324,654 *348CC0CCC03018A5FD1BAC190464D339800D2B12 TODESRENNEN
514,324,655 *348FCA15CD56136DE031D40EC7947678E858F289 todesstrafenbef
514,324,656 *34817742EE354CE33118E9C941336C7B36F98F24 todettakooning
514,324,657 *348D66CA487EC5FBB0216995A1DFAF3B34BA329E tod.grahm
514,324,658 *348945883303998F9C1DD74BEA30544E9B5E03B3 tod.greenhaw
514,324,659 *3484F36241B8B7D79E4C15D5CF86FD2D21DD3A08 tod.hardina
514,324,660 *3484AC5D6CFF947EC6A48AE9396978EF5D044DAA tod.herres
514,324,661 *348C8B52994FD820891D05F6F5A3092AC56710F1 tod.hopfauf
514,324,662 *348111C2BA0FCDA9894F261E324C0FBCDE975E06 todilecs1
514,324,663 *348D464268C0369A8EB3596BCF47724944D10B96 TODIZZLE
514,324,664 *3480DC87415DE25BD449F0FD3BD556E667342EF6 tod.jacquot
514,324,665 *34884DB7A195C8A0DDEEE6CCEA50EEECA00B9DE5 tod.lecher
514,324,666 *348548EEB5C272D1610F49C75D9015BBBCE962AE Todleukirche
514,324,667 *34823CD1C50414499AE7D69A637A1B62D9E02E1D tod.lonneman
514,324,668 *348C39D0391E2CF9E7613241BD6108976B9DAF95 tod.morand
514,324,669 *34801F9692A0E2E2231974653FDA3AB3BB6C500A tod.morentin
514,324,670 *348D458DC6AF98B90DD6FA9C466F9B1331103816 todohara9
514,324,671 *348E4FAD15638AB1132B6EF4F77477DDE5F02232 todokame
514,324,672 *34865B911FE0AD53031D70AB9CA33A3C4EF42CEC Todosexofemenino
514,324,673 *348A732C4D50DECB965B850ADC784345AA99902F tod.ossenfort
514,324,674 *34828A9723639D749A9683E30A6652EE4ECB4022 todsfalo2
514,324,675 *34887AA6AD80FB361175E752894881FFED7DF4E6 tod.shuckhart
514,324,676 *348D610AC83E287AFAA5D0373E672DF7AAAD00AE tod.tepperberg
514,324,677 *34810FB4326B4DAC104FFF6D7B83C00AA93AFE5E tod.tsing
514,324,678 *34822B17D746166D1E91267B1649EAA150D0DEBF toebedelensing
514,324,679 *348BB19120293D5F5119389A1E21B97A4E6E953C [email protected]
514,324,680 *34807C267D0CF0C76C80600293414951592C80E4 toegediendens9
514,324,681 *348348CA3BA23F822351040107DE7A4D672BD7AE Toegekeerden1
514,324,682 *348FD5ED797DE29E233FAA50EA9B8DC509471762 toegekendens8
514,324,683 *3486E1FABF46B4F2B0D7624CB24AC41368B2C08A toegelonktesing
514,324,684 *348FC51F04843480C6241CD373B959E86535129E TOEGESLOPEN
514,324,685 *348258A58A3DACC7BB03127AC6651771B9BEA28F TOEGEVINGEN.
514,324,686 *3480FF82AF482B9BA10CF62C0BB393D9BC661595 toegevings3
514,324,687 *3485D399539272C06AB083C5924639B24EDA06B1 Toehapte?
514,324,688 *348858E74E1A0629AC8C928E627D4547B84B8996 toeitae4
514,324,689 *3480D50A3F92DF272CB8B44D1733BCCA6C1C6638 toemmerflaade.
514,324,690 *348A27BBD7BBD9066A317EFAC902C481275D31E0 toemrered
514,324,691 *348EDE27A0892A2871EF7432258C50454F349E2B TOENEMENDE6
514,324,692 *3483DE6C1446A6A88EA26B588CA809BD5479B723 Toeprang3
514,324,693 *348A1F09D65218F41B5A51105608912D4C4144D6 TOEREIKEN6
514,324,694 *34848BA397713CFB430C08C0697377BF35115EDC toerenta0
514,324,695 *3485C2EB0892C0DB2C964DA14AAA5E9C944BFEF8 toeristenorganisaties
514,324,696 *34877321E6F15078695F0B500E2627D49DF2331C toerneesing
514,324,697 *348FDF5720CDC940454AAB0B76CE03C693DAEBE6 TOERRER1
514,324,698 *3480336A7829DDBFE71A32391268A02A183592E8 toerstered
514,324,699 *348707A3465DF474C6F02318C61B8317646BBDB7 TOESCHIET
514,324,700 *348F05E0CB26EC3A1008650C8AD0C0DF1F081367 toespijkeren0
514,324,701 *34867C71B4B02D8A51E37955563210541EA5A8A8 toestablish5
514,324,702 *348C3788742A38195A3EA1381F45BEA066BEF678 tOet
514,324,703 *34802076FB6B2C75597676436EBECECDB8ED4070 toetaksid
514,324,704 *3487F8349B3237389227916D8451FE36CFC8B51A toetoed
514,324,705 *34833971554804EF764712A06A8C9A1BD44BC9FF toetsafnemer5
514,324,706 *348BB26B350F7F142C0D73240F3C85E40B1B4E53 TOEVLOOG8
514,324,707 *348C1B9002F138127FDA38C11B2EC37779AC0F20 Toevoerb6
514,324,708 *34860E1CE59634C75C4D963C1CFE1DAD516A40BD toevoerbuises7
514,324,709 *348B6EAC9B17162D39014D084E56EE51EC82236D toewijddes1
514,324,710 *348F9115A16ECEA5D93B1F233175A86B58A7B7F6 Toeylen2
514,324,711 *3484F29C8E1D96F9EEB53C99FF02C347A1D4B5DF to.fetsmoke
514,324,712 *348097C3D9BF0CF719365BBBFB7F0586E900B9D3 Toffan
514,324,713 *348644688C55E06E27C0B41B2FCC6E45405A052A tofferont1
514,324,714 *348BF900184399FE422CEA77342CBC1D263D55BE t’offrira
514,324,715 *3483E9CF46E96BC9554715461FF5287E9AB275B9 Toffyman5
514,324,716 *348554A8DAA09BCEC32E64338BA6EED0F6280F51 TOFILOWCE
514,324,717 *3487523C0074E0F9A22589DFB57D953F72724601 tofred
514,324,718 *348F1AEB15C311364EEECA2040322CF37A52A511 [email protected]
514,324,719 *3483A5380FB8B8AFB5A36CE548E32C973D11FBC5 toga0002
514,324,720 *34806C374405C2B5C1BE4DC45AAF29ED76BFB9EE togalach
514,324,721 *3481BC98EBB81EF868E666C38FC9786D0FD34328 Togansei7
514,324,722 *3484CE10D5C929CC2DCB0DD8BD7F34245A30BB85 Togawaky9
514,324,723 *3488AE052CD2B438F1B9C00F18F30BC961464494 togC
514,324,724 *34832EB9B19E8873053B9467C7081E8E1F328FDB togetherflourflour
514,324,725 *3480176EB2862B2968A76C63E2FB6FE116B27CB0 togetherharmonizehashhold3
514,324,726 *348B88D416C950FAB31D2305E44C5E68B26081F6 togetherhithit8
514,324,727 *348EA6F41CC6260D32F1FBBB5B26BA977722159A togetherquietrallyrangerankreadyready9
514,324,728 *348311AEFA791958B59827963D4B91F7B9E582FA Togglewallson
514,324,729 *3480F1927979A89A4EB45463AB631AD134C973A0 Toghruls
514,324,730 *348B15AD0A5AF32EA9C749246139837ABBEACBED Toglierle9
514,324,731 *348C4FBD02B0BE4306562A0D066FA6F3B2F53D88 toğluk
514,324,732 *348B185F2F0EDDAF5993030EDF88EE9FFE3564F8 tognetti123
514,324,733 *348B9AEA0FC9858EC9164B3C43426F2831DCCCBB „togoweg“
514,324,734 *348296429AAB7E9455C6D95D8810677E2923EC54 Tohåndsløft
514,324,735 *348AC27E733D74061C59895B8695B900B1792280 Tohanket
514,324,736 *3481DE37A6CDE3023FF8A4898F7DD4809FD6B9F1 [email protected]
514,324,737 *3484AB529D4EF8957CB1CD8EF3D50028AA927109 To-help
514,324,738 *348B3364D10E49720A8064217AFD9AC8F4DBD1E6 tohippuses
514,324,739 *3488A9363B4B7AE9DCD0E0A362E5B2FB1E00E351 [email protected]
514,324,740 *348DC1BE47312AD00F17CF98AC0C083CE3455920 tohohoenbsw9
514,324,741 *3485C99BAF8EAA69DDDED1E50C1733B23FB66D0F tohseyob6
514,324,742 *348747830BB4710452131739939038106EB58AA1 Toiayth7
514,324,743 *3486F35F3A6F6B0049BB3C8470443BF1F75D6F3D toica専用自動改札機(
514,324,744 *348199B9CA5BFF026EB4B7BD41874A4DDD7A4D85 –toile
514,324,745 *348466DDDB2F52643D97308725E65F1D9147927E [email protected]
514,324,746 *3484C3EEE4549B328838A85556B3581686E2AD8D toiletta7
514,324,747 *348C5695FA606D4C0DCE6C9635ABC38CC54A2EAB toilleyppiks
514,324,748 *3483D2F7139A81897B63339131DFBEB497E3C2CE Toimikaa6
514,324,749 *348033ABE1219F40D18505CEEF448029D771D435 toimintaaansa
514,324,750 *348BA9010219A098DE5B83902E1049E8450F73A7 toimintasuunnitelmak5
514,324,751 *348724F22EAB189F2CC7A38C892F1A4295A8932A toimintavapauksia7
514,324,752 *348221D77DF42BC40883230A044615C2513559EF toimintoni
514,324,753 *348FA2D05BDB094892DCDC3614BB92890195160D toinibsw
514,324,754 *34890561681678F2F1E642DCE7FF9D60E831B243 toiretoired
514,324,755 *348D61A23B19209595F257DA27EA7BF3D7625802 toisaaltaaned
514,324,756 *348B4A5D806A0A37BAED7360D257DED19669ED61 toistasataakiloista
514,324,757 *3487451C0136FE9C0633A9A0EBE802D6A2758CDC toistdom
514,324,758 *34864B3DB4F7636A4846B21E7371568227FF6D45 toitlustusfirmad
514,324,759 *348D58C107F83C78E28C770B67EFAC0EE543BDD9 toiveelliselta
514,324,760 *348172E5556A0EA15AA571005172AA821FD51404 toivonee7
514,324,761 *348537DEAFDE234F4766142CB26827656C1E7D96 toivonsa2
514,324,762 *3485EE38C427F6821CA30609D2043A2C2BA81039 Tôj
514,324,763 *3483A18AD0F19C3AD4BCBC3AF87AC1FCEF765E82 tojo al kandari
514,324,764 *348008FE6525593B1483327167D3963B79FCE6C2 tokammersystemerne4
514,324,765 *3485D402B93E0291EC210A2B924A8E2C8175BDEA tokatilaisia
514,324,766 *3482A2BB15F1D455BDD937EC796E4AFF1B0A3189 tokauns2
514,324,767 *348EA48D108D75AF084C6D66C89A8E2CC24AD18C tokbwtkhhxw
514,324,768 *348BAD70E602D6FDEC1B18566BC2E529EF4214C0 tokelaujietiškai
514,324,769 *3489D4F0E2DC6DD6CFBA523310B3954DE2CCC6A8 tőkéletesíteni
514,324,770 *348B75C72F67DEC2D83EB18119F6D3A164D584C8 Tokenrng7
514,324,771 *348F5A425CECBFC4B393FD787BB5FFF5640ADD24 tokeriernas5
514,324,772 *3481622A4ED703ED7BB1AD02638065F49F546FB5 TOKERN
514,324,773 *348C25F31C77539A1D6927DC35F9604E8B82ECE7 Tokfali
514,324,774 *348CD2136A630D481F06B94704DB7173F1D3906B tokijským
514,324,775 *348A89FABE2208C30D2350B2F4397490002F8D66 Tokimentoes
514,324,776 *348CA8F12021ED6373F0979D26E9FDC93F21E5B4 TOKIOHOTELROX
514,324,777 *3488E495703569C66D6E88DCEC3106FC5865FB93 tokio_marine_amp_nic
514,324,778 *3487225176A08D35F2378DFC81470E2D21B1E49C tokkótáj
514,324,779 *348F2C42B6EAF5C859B2C2271B460F057323B270 toklászra
514,324,780 *348B023F582523ABD717913262532AEFE8CD06C9 toknebened
514,324,781 *3486B36A24E476C0F7DCAFC21497712C015255C6 To know that I love you
514,324,782 *348475E0BC692FAD1ADA49FAF487C682ADEF29AB tokobushi
514,324,783 *348E9D144FF3F33C59F53AC406345144D1F8B436 tokoller6
514,324,784 *34850CB36E1E197BF971DAAD9DD69030848D37A2 tokolor5
514,324,785 *348004D1CF1DA33AF4C5EE6580A6A09E53404FE0 tokoro's
514,324,786 *3482E77AF81AE5DBE4B3F3747CFB349D26EA9422 [email protected]
514,324,787 *3486680CC6C525E347C6DE1C07AC52313F4C5010 tokuiman8
514,324,788 *3489FC5E2085A299956BF1B4A27B73BB050C183F Tokumoting
514,324,789 *34842B83764DE2E6185CA8EB29DA96F823317D9D Tokushou7
514,324,790 *348CA8EFABE52E10214C8AD60438B47263F72DA4 tokusyu0
514,324,791 *34892A5AC099D6EE0A4ADB634D58BCCE8B0195B4 Tokutaku7
514,324,792 *3487266DDD5B42B2A2F24888FADCE010A445D0C3 Tokutoing
514,324,793 *348EFC82D8C72413EF64F324859CA2748C604B88 TokyoAM
514,324,794 *348E8F65712674C386F320A57F62F9B3C3FCF03B Tokyobigsight
514,324,795 *348EAA809ECF2D5450BBDF8624C240114B75D46B TOKYODANCE(instrumental)
514,324,796 *3488E3CC77C6AF9E4F796BC0531F4EACDC104F72 tokyo-porn-star---sora-aoi
514,324,797 *34815D37EEBCAEA29E3BB7D5D61700FB7E465E19 TOKYO)主宰のアジアコンピレーションアルバム「Asia
514,324,798 *3489521998FE34F25A91A348E1E7A787A7654E3D Tolaezre
514,324,799 *348DB2C5378DF235269F7D15C82FF967307DDAB4 TOLAJIAN
514,324,800 *348AD3378F97646F1B354192211D1D663D406268 Tolatási
514,324,801 *3486B4744EAF79A7C5704C3C793B3CD77A11AB80 tolbomens8
514,324,802 *3481AB4615A48022DF33C6364538251F72C52E37 tolcdniwing
514,324,803 *348A998CB9AA36B79DA874002BBE5550C9EE2212 told4308
514,324,804 *3482D8374C6891BF3A9B47A5F63D32D863371399 [email protected]
514,324,805 *348B9537EACC25A9C470A6D8A525C4B2A3B7388C t’ółəona
514,324,806 *348DB066EA18B0990996CFD0A631A6AA60A46F95 tolerabelE
514,324,807 *34837831A5F8BDD82404157A03AD6087A6837A5F tolerancetrskelen5
514,324,808 *348C142B2D9616B3D5759D3A4754670A53FEC350 toleranser0
514,324,809 *348795D5F12EA1DE18945E3D480CA7DC37E5A4D2 Toleranţă
514,324,810 *348EA22C7886B3D5A5C629EA8F7FDD46885E0417 toleraverunted
514,324,811 *34832C3B900F87DBECC6C5EC519EAF47842C5072 toleré
514,324,812 *3484E2ED28EA8B4C38A4705F226C6F0DC2B85F62 tolerie6
514,324,813 *348EC9FF11DA0A0FCE000CD605777F8972458778 tölgyfakapu
514,324,814 *3484F4532A743FCAE89C775AE0FE8953C3174E62 tolhi4s
514,324,815 *3485F437D787AAFA4114AB375B5EF5B6CD4FFFB9 Tolikoga7
514,324,816 *348F2875E84636A705D47A03FFCDE304F29BA9B1 tolingtolingged
514,324,817 *3486CB97F0873291BF4C6FD77CDA1C8089D4B713 ToLive'stoFly
514,324,818 *3481B1B5E74DFD337398A88BD1D77B8DBE1CE0A2 toljagu9
514,324,819 *348CCF970EFCD53E6B1CEA29BA88B9B7FCA28079 toljottava4
514,324,820 *348D3BA8BF5FAEA5A5F0CC51C9393B6014D3644A tolkesseklot8
514,324,821 *348E5313041DEAA826497C8C16F75BC96B17C057 tolkingars
514,324,822 *348B8D66DA092F25E26E0276325C30FEFEE9C721 Tollbooths1
514,324,823 *34811E96D0A6EBC048B071F86C06C324DE1DAFE9 tollboothtollbooths7
514,324,824 *3481B10D54258FD8975F22CBCB4546B95C1965B2 tolleb 1
514,324,825 *348A58A03E468A13CC155604A3DE4CB589273DD7 Tollette3
514,324,826 *348A3DC52BD149B624BCDD396C2885415D99884D Tollijevaja
514,324,827 *348C6DFEC60F7C306894BE91AF52BAEBDE2F6B6F tollolderol7
514,324,828 *348CD01E0EFA6C72F7F1FD01EE55A61D82F1263F Tolommeo
514,324,829 *3484A7190ADE55CA334DB72C2E8883F624CA2DC2 Tolottas
514,324,830 *348C009EB2AAE3D717F6204EE2F737828CB51A5F tolpelhaftestened
514,324,831 *348835FF4496791243EA50AB475BA66743102B7A tolpklassens4
514,324,832 *34897BCDAFE67523169998368DED609FFC3074B9 tolralju
514,324,833 *3484C469032DF7CB82A9E0BFE70680062C9C0FF7 tolteccetlot9
514,324,834 *348C904E05CA9B260EFFFCA65C9E76E2A042A4DB toluctoluc
514,324,835 *3483E8C9349689D6BF14C66572292A08B84F45A4 tolunitrile8
514,324,836 *348C69275E6F451830426057B111233103A213B9 tolvslag4
514,324,837 *3485783D55DB32688A9261F9A15355E5EBDAE17B tölvupóstþjónn
514,324,838 *348FF00C1BD0B47401A8EA47F9E69734AA0D8EEA TOM010233
514,324,839 *34806B63334983F3B33DE007BA67129C2DF746F9 tom21748160talk160
514,324,840 *348942E2E81DF8E19366E9A72420BB78B65F96CC [email protected]
514,324,841 *348FF061AB651816473BA76ADF3746B283F45C34 TOM6099
514,324,842 *3487D730B0C106DEBA279B1AFA6C616F298BAE27 tomaattikastied
514,324,843 *3483933C7EDA3B77D6521278BA5BF271085EE3A4 Tomaduraed
514,324,844 *348416CE88973CC20378CA4EFE50E3F8678BE5A4 tomaevis
514,324,845 *348F7890A9C3C210B03EE57C579E76257A7FB703 tom.agib
514,324,846 *348EB51145D626459B6A6AEC439B3F53C4BBC990 [email protected]
514,324,847 *348A4D84E3F21B5BAF8FA60BAC1B9FEEF004DD2F [email protected]
514,324,848 *34808F911A5B0AC88E68F34F17295FB0EB2640BD [email protected]
514,324,849 *3485123095E66835CA439C6DEC007D5C4C2717D7 tomas.aden
514,324,850 *348F8D30FB4E2FA1E9A594395E4C72A73824140F tomas.barios
514,324,851 *348A95B2908ACDF726B63F7D36C4B11D657F1453 tomas.brigner
514,324,852 *348CC85193E90A7864357ACA5F3B123ADEB04B87 tomas.custis
514,324,853 *348670CA79EFE042A370F95F080A73C8CB0192EB tomas.dansereau
514,324,854 *34897032264440D005059E0F974FF9308DFF5313 tomas.dreckman
514,324,855 *348C65C930703CA4D2738373D899A36BCFDF48E5 tomas.emfinger
514,324,856 *3483C85B6C7C87D465E93A4C6503902D38B20AE9 tomas.golom
514,324,857 *3480CE8040D7B488A86EC4A6D90A9A6F3D3DD0E5 tomas.holla
514,324,858 *3482951F752ED6134DE6454DA7AC4598C2079205 tomas.hollender
514,324,859 *348A5E357E3EE984FD3220008E4BEBAD96AF7199 tomas.hongach
514,324,860 *348380131BF3F065551C23874F339DB90E802462 tomas.iberra
514,324,861 *348864874FAF109466895FE0F51B59816C086A0A tomas.limoli
514,324,862 *3480A48EDC29F099D453CCDAE6DDCAACCAEA5882 tomas.manwill
514,324,863 *348EB40DEB07FFDC031F80D3D6F81669FEB37FB5 tomas.meer
514,324,864 *348C21AAADE2410B91D990ECE6985E83F7173A77 tomas.monds
514,324,865 *348A90ADBFA9857E0C84ED55AF42CBFBAB991A30 tomas.newey
514,324,866 *3483586AFCC60A078DF33D576FDDA573B5947645 tomas.pandolfo
514,324,867 *3481B393F5EBC64D20A885808EF65B83BE654DCB tomas.quin
514,324,868 *34821DCC9CFD9717B4983E43D829F31321D96DEA tomas.ribble
514,324,869 *348E48B1373C97EAA576F0DB55A58153BA19884E tomas.snethen
514,324,870 *348978729F3E852FC849569B316DC0B73EBB6E72 Tomasso Vitali: Chaconne
514,324,871 *3483594E1BA86E3F798C14BBC97238C6AE51AABB tomas.stiely
514,324,872 *348F90EC6E6D9D5869AFE9482E7779F2A9A32D83 tomas.stiern
514,324,873 *34870C7CE0C0BC67F220820B0674BD83E60010CD tomas.valasek
514,324,874 *348DD0A59CEF418C8B816F2ED5BAD684EC6BEE36 tomas.vere
514,324,875 *348751EE1C327FA047C3D4D70738EA6B5B33F8D7 tomaszlech
514,324,876 *348858EE7DB738051451D437313D550B94E5B5B9 tomatensausesing
514,324,877 *3487423955B58D9676D1236E034F760BFC6E3789 tomatican2
514,324,878 *34813FBC4E73A663DD3B39F7254DE92707C560C5 tomatofish
514,324,879 *3484BF9B3F78B66E97F38969F2D2A283BCB20D44 [email protected]
514,324,880 *348C3D8E69B0D795859D766ECC60FC62D953D713 tombartle
514,324,881 *348DE69C9E9A1B0A24BE000E7EF0D71767F7D387 tombatman5
514,324,882 *34896FDB9D5F82A9595CA02C9B191687E91F3638 TOMBEAN
514,324,883 *34834D8B3CEE5D8D6F15D2ACB9E0A75AB28240BC tom.beisel
514,324,884 *34828432AAAF3F53B863107606988758555347FF tom bemiller
514,324,885 *34846D826EF6F3D4FDAE84CEC51DBD356C2C0AAF tombingeman
514,324,886 *34872419415E508E066CDEDF842DA8AEC317A419 tom.booker
514,324,887 *3486A7C4A1BFBE31B30067A6BFDDFBB1AC9FB964 tomboyesing
514,324,888 *3480476A7CA8100C7E6738B2A1A7710C4C471414 tom.brahm
514,324,889 *348B9E31F8B9111A1258E1F013117373B8B8C0CE [email protected]
514,324,890 *3481258874E34C3296B710634F97B05F4CDF0DF2 TOMBRUNO
514,324,891 *348DAAD046CE718E59BFF8395243BBEB0893D520 Tombstone!
514,324,892 *348562A852967AEFC7CA0C43B5FA3E5A4231597C tombstrewn
514,324,893 *3486DFA8078B37637419ABC161B5C597016FEAF6 tomcataikman1
514,324,894 *3481791908165F6D9EB3595B9D1F997797A9C294 tomcathamstering
514,324,895 *348B6975D38AEA00D95CF45F23FC6A4606BFF248 TOMCAT'S
514,324,896 *348C2F50077B21FA6BCED7757F922A0062EDA5C8 tomcatshadows1
514,324,897 *34823FD7872B8CEF6B87A7DE476DA678FAE55FC5 tomchalk8
514,324,898 *3480FE0240DA0809550DC152DA25A5AB811224BB tom.cheas
514,324,899 *348E2F5BFB8483666297B3645EC7AC11E29C4DA9 tomchristmas
514,324,900 *348CC95A344C26F481A0D4B89367B3294FEB697B [email protected]
514,324,901 *348D44B40AADA4072DE197735ABF19C10855B949 tom.copass
514,324,902 *3486BA08DD47553C5A0D81D590C2FD9DC23EE01D tom cormany
514,324,903 *3484CC26E28A0D563BFCA898BA8551FA4FD76E5E tom.cuthbertson
514,324,904 *34861B1B387FF6EF80D4F8D752F2AE159B30E763 [email protected]
514,324,905 *3483292A54A375DEBAAD0FD8FF28B11455ECA866 tom.desadier
514,324,906 *348CCF953E4080B9AC94F01D77290DF125D0DFFC Tomedium3
514,324,907 *348BCD1DEFBCF5C9A8959754BAE2C016B144C912 tomek kalinowski
514,324,908 *3481CBC2A0C03DDF7DF0964E569AFCC77A928943 tomerbot
514,324,909 *3486CA52613F67FF23D7F57B112698247EDA096D tomer ratz
514,324,910 *34892779FE6CEA3DBCD8B89FA6908AB833C5A44F tomete
514,324,911 *348660B9517AE5CC3419237A883EDCF800826293 tomfreddy5
514,324,912 *3483886DAAF1FBBDB8A1B5BE5E0C4464D6C4233F tom.garzon
514,324,913 *348BF46C991E2744DD5825010A5DEED9F70C37A3 tomgdal112233
514,324,914 *3483593DD5578C069CC530BBD51A1861C40B8D4D tom.gerthung
514,324,915 *3480C420DC95C072B2C2F0857E959EC799D5883E Tom Greenhalgh
514,324,916 *348F034361F8A0BE9FE2B1ACF5C5AAAD2DBDB99F [email protected]
514,324,917 *348B1FDF3261A100B8501BE4B088A9BD58BF5012 tom.hobbs
514,324,918 *348B25B50219F90F901F76DD7F79E1071B9A7835 [email protected]
514,324,919 *348CC3A8D41ACF81C642D44A546567BE281A4715 tomislavjevtic
514,324,920 *34802175AE00660A1382AB8B2A171A1575A86DBC tomival
514,324,921 *348D9437B44ECDD9EA832C750E3751FCE10D5852 tom.jamin
514,324,922 *348E3013DF23FB142DB8C0F3EB2FAAAD95587268 TOMJOA27
514,324,923 *348A7736977842888F6C5BB383025298BD222D1D tomjunior2
514,324,924 *3486A08C786D9C7E322253A5300325266A02B075 TOMKLEM
514,324,925 *348A98F9C954BA0FE60375B5309B40784BBDD3C1 tom klouda
514,324,926 *348485A2343073E6ECF12F6524204875634B415C TOMKONLOR
514,324,927 *34853EBA1E69D835BFDF7FD7251FCAC8E006ADD8 tom.kordowski
514,324,928 *348AF33823BC44528CE1E7B1EC242F382E34FF0C tom kyllo
514,324,929 *34865954730F6223DC965D88A69B428A2838E2F4 tom.langdale
514,324,930 *348BE658D15DB79D9BA05176C6F97DD841034DAB tomlanyon
514,324,931 *348D1A6CE788F8CE74C953974A13CB6E4B86E21D tom.latsko
514,324,932 *3484990F7EDDABA604BE99D0A7EB948F6859AC9C Tömlo
514,324,933 *348026EB70E8D2816915369DAA09C1FDCED5B30E Tomlucky9
514,324,934 *34878C15A5F88F784AA637E7ECA1D0C7E867AC5C tomludlow
514,324,935 *348E5FF67E8FFA811F986F09EC5A18C7CD5959E2 tommeck1
514,324,936 *348CD76E7FB1172F4273CD7F1A96392E45B6036C tommelange
514,324,937 *348034E72A3A14984EFD9F542ED6CC90CD3B5E04 tommeraasenbsw0
514,324,938 *348257405F3917D3CB1D4BB6B915E8048DF073B8 tommie.baff
514,324,939 *3480D67C6CA4CE099394FD238B8AEC350C4A66BE tommie.bahm
514,324,940 *3489230934B9BC2001CB0F7E9E0CB477C08B8593 tommie.boone
514,324,941 *348AE15D8C45C7EFA57EFD2955DE7B38D2CC10A4 tommie.brantly
514,324,942 *3480CFAE87C11AEDD6611C2405F3B41136D96BEC tommie.edel
514,324,943 *348B56B96939EB8E561F2553473B264686316E1C tommie.estridge
514,324,944 *3486D21AE5612F892D71D67CD0EE15D224FD82E0 tommie.fischels
514,324,945 *3483607900563CD0D2B81A0DCB508F8EB24DF530 tommie.folk
514,324,946 *348E01D6EDE953A18243395C18A6D317119CFE71 tommie.graziano
514,324,947 *3487ACDCB5C53B6ED31A9099075F9DB48FFEE9FC tommie.hilario
514,324,948 *348B860AB5D6C9CBF773A6816490A1D0D25001F5 tommie.hollin
514,324,949 *3488225F0D62FE011869DF0FD62452900C508AA0 tommie.kemme
514,324,950 *3486093FACB3D8037823F7B49C650951FB52C163 tommie.koroch
514,324,951 *348FC59D7923AB4972953AF79633EB41A4288027 tommie.kozatek
514,324,952 *34848936B82B76A93A5746F9523922F4AB0A3127 tommie.lacount
514,324,953 *348418708B0287F58B5E3899EBC001FAD33C3CD7 tommie.landres
514,324,954 *34856A8564BBC16E2CE448BAA29AA4C53A8A51E3 tommie.mellecker
514,324,955 *34811C8CAFA4612C0162D9B080EA9C927E957DE3 tommie.prevatte
514,324,956 *3486733F031DD371187FACDC47CEB6BE7C58C16A tommieryden5
514,324,957 *3481B804C06B1020970FC999209A30D1259FA327 tommie.sakasegawa
514,324,958 *348BB73EBA0694873297059F6EBE47A546330497 tommie.solliday
514,324,959 *3482328CFAAF4850E30615B8E23F0F10FD2E9E6D tommie.uram
514,324,960 *348F8C8354FA9FC0E65F10F5C9CD79D81A3F5FBF tommieyip
514,324,961 *348C2D2FA2480D691C31D9016373CBB92719442D tommie.yovanovich
514,324,962 *3486775914FEE64DB4AD02C6CB49D0D0234317DF tom.miguel
514,324,963 *348AEAA05D9EB69A40F33BD007FC919B4301826C TOMMIHUND
514,324,964 *34850F9EACC91DB0D688EAD40F1C849002248E79 tom.morarity
514,324,965 *348F9EA76E91FF4F853A3A9CB3C62A0EC4E38CE1 Tommy2welcome
514,324,966 *348E17953BD7A3FBDDDECF00967A886B6479FD02 Tommy926
514,324,967 *3483D1880ABAF67C990A91899ED4325B6C5059E2 tommyangie7
514,324,968 *3481BF39739F9A616E6C62619EBF998DEE7E03EF tommy.aparo
514,324,969 *34853F4884D972A07D54851DA7CB04F797AC17F8 tommy.balckburn
514,324,970 *3483281B0DC07FC5E306F2C139B952A09F93C8A9 TommyBenefield
514,324,971 *34891FD569C7AE4BD802DC12B0D7F43E9B673880 tommy.caccavale
514,324,972 *348BF6057F84B7BF929D5B01107309322E02F73F tommy.carrus
514,324,973 *348A9F223F3D910A1956653F6BBE6E5B7D1111C9 tommy.casilles
514,324,974 *3481E8DD5BD0F98A9E656746037DB8B69A96F0E1 tommy.chirinos
514,324,975 *348F8AF583DD4690FC534F0909614EEC88C16535 tommy.cruthirds
514,324,976 *34861E58134AA2B58D6FB0EBB29FFB619B45A28A tommyeng
514,324,977 *34809F49A21074FFDD31042B698D86A9DE880BF7 tommyfubared
514,324,978 *34896D4817F00782960ECC02786C4BA9C1C34E46 tommy.fulwood
514,324,979 *348533871ED4F36AA6682C9D3D3615E3DED545C9 tommy.ginty
514,324,980 *348D2A5B35E38122CECD81826146F07F9E5CEE1F tommygolfing
514,324,981 *348857BB983051E1AED8978704D5A227587AA8C5 tommy.grimaldo
514,324,982 *3484C2EC51057759837C78BCF18E01B43ADE4ACE tommy.hackworth
514,324,983 *34812EFB96A6DA5582BB08022AF97057A598A2B3 tommy.herauf
514,324,984 *34864C26964E6BC97AD4FAD6A5CCA11493E883F9 tommyhornetses
514,324,985 *34848E3AA6A00E4A92E6335E5CE8AC181902F95A tommy.hoschouer
514,324,986 *348AC9CEE85C22A765D5692C58ECDFAD4CF0482A tommy.inghram
514,324,987 *348E93BD906F63D199BA51F389048BFEEE5371C9 tommykiara
514,324,988 *348A2B7B476671308CEE275E0009AB600BDAAC70 tommy.kmiecik
514,324,989 *348047E601939C2EE3BB2A59A8223B5194D271A1 tommy.lamport
514,324,990 *3486A0ED1638C50052FCEB77033EB48A9AC79788 tommy.lazarski
514,324,991 *348BFCE8B45AD3FE732B955CF14401E841A78E35 tommy.mcnickle
514,324,992 *348316FDD866BC0024E84D7489F276313F809054 tommy.oreilly
514,324,993 *3484CB628E2F2847F7002E5898200A15ACA55F46 tommy.palazzolo
514,324,994 *3485E44DE6FC1A62F43252AFF407731D87137912 tommypeace3
514,324,995 *348D065D1F9A3255EFE9BD93ADD6569B72CD3FC9 Tommysam2
514,324,996 *348A938EC96920BF7E398412F0CCDFB726EED79E tommy.schrader
514,324,997 *3489B13429E9ADC99386C5D4B75C082BB714AEB3 tommy.siems
514,324,998 *348985D369F9F0E7E3A074106AC27711F3FA2132 tommy tamez
514,324,999 *348E7176486FDD4339C36B9E12CD92457FDA53E5 Tommytaurus
514,325,000 *348D2A803EACCCC9309BFBDB9F9BEC897E6C2FAE tommy warmack
514,325,001 *348CA447E93C403E13E80CD80EFD3824925C9972 tommy.ziesman
514,325,002 *348733413918B7256F1122EFCAC7BFEFA4A0C8E9 tom.napenas
514,325,003 *34861D2DE6B4A63F8890CDDF0E5E79137842F939 tom.naranjo
514,325,004 *348DDD8BEFA56D6EF3675174CC3A207E5817B879 tomodach4
514,325,005 *348D44265F2F1DCFB3D7F10757A0779B0D0572AD tomoehotaru
514,325,006 *348C5D211CCABC028E7B59C3773A0F2A80A41A36 tomograp4
514,325,007 *348308AC4549B30CBF2744CDB29DFB0798F71B89 tomohirorapid1
514,325,008 *3482E786241E74BDEF9310A24892E6ACDF528DE0 TOMONES
514,325,009 *3485445DE1598757B1042B12E314CDE02FB3D965 Tomoroni
514,325,010 *348E19FA6751F595D728A933814ACAF6FD57CEA2 Tomorrow“
514,325,011 *34870AABD73AC1CF939782A80A6816632AB7257C tomorrow man
514,325,012 *34825DC8D66290037459CB40E302C6F76CA987B6 tomoru)
514,325,013 *348B3D34AF4DDCA95FF2AD613E149EC7E249FF70 Tomoyo20
514,325,014 *348561086BCADF663E55D4AFCEB3CD308B5AFA77 tomquebec7
514,325,015 *348DA9335BA19E028BB9F71B50BAC87CDF610484 tom rake
514,325,016 *3489C0349EEF5BD0B0CA0EAB204E461F87D5473D [email protected]
514,325,017 *34823F1F3A90C1DDD351FFC29206BA338A8310FE tomrayner
514,325,018 *34811A0FDDACE460F00A52B79A6ADFCEBFA966EA Tomrose5
514,325,019 *348264B7BFFC4A8777FD276F53B5C41B311D33EE tomrunner8
514,325,020 *348FEC6AEABDE74F5149A4C1F3996CF858F5E7FC tom.rusten
514,325,021 *34851E89314DCF1E408C30E0C5DCF9F5D31F3A2E [email protected]
514,325,022 *348AEE15A18429C1FDCDBD581C21C7337A40E26D tom.shiloh
514,325,023 *3482A15EA548FD237C4CAB254426D1B67EE56E06 tom.sirk
514,325,024 *348342E0A8324C57D895DB01835C03AE3005D0D9 tomsophie1
514,325,025 *348C98C6E1475F40E7B70842DE2899BB4AB05187 tom.stottlar
514,325,026 *34833BA7AB1A3E893B1B2352B457A0ECD2858983 Tomtens3
514,325,027 *34859516636741FA1CE52926AC20E28ECF5078A4 tom turtle
514,325,028 *348868B7F5509C645BDC4D3E5AD2BE1D51046D32 tomveronica2
514,325,029 *348E874DFB13F49B3695E715A5AD6DC93462F1B5 tom.weidenbach
514,325,030 *34854A5629F25E9E8D3BCEE41EA25398C112EE01 TOMY於同年
514,325,031 *348686EB34051C58E524DB9748FA424ACB7BAAE7 ton4v4m
514,325,032 *348A20167ADAD6CD0030661FAFD47AC0346C22CF tonalone
514,325,033 *348D61F0E0F4A683ACF29F062F9232E9FDC681F5 tonangebrnd
514,325,034 *3488027CEEF616C419419686D0D4413E8E3F4786 tondentaed
514,325,035 *348DCDB6F0E1847F6B1A70A050756F1246018D10 toneelproductie0
514,325,036 *348928CD298C3E3906EB4DC7EEB9C29AE51B19BE toneelvreesing
514,325,037 *34821435BDEBD7C713C1CED3B4E5F838A8E5904E tonekoreatmaxenternet9
514,325,038 *3481C1145C32735882904057352D4CE023F0D9C3 Tonelises
514,325,039 *348742F9E28F7E4806D5B51537A5F504BAFBE741 tonelullmelting
514,325,040 *348B381532440C969C60679E436F0C685C33B108 tonetically5
514,325,041 *348EC9BABA31BBEA41824929D3534CD21E1F4630 TONE-TONE
514,325,042 *348950B89B3B39E8DF9DEF23252A39E14B0C9C04 toney.abbas
514,325,043 *3481AAE47305B212B985F833B496837BB208598F toney.arrellin
514,325,044 *348E71BDCF64B1C4F2ED4C4C9ADE2680EF4E2D2D toney.beier
514,325,045 *348B66E4DE7EA3802F827E351CAED5EB39531144 toney.bradford
514,325,046 *3487C2AC16E304B97BA86C2E3E814D036DF746D0 toney.carvajal
514,325,047 *3483BD29EC332733B90C96169638C7C51D8C94D8 toney.crotty
514,325,048 *348797C8267B69F9D1025B898E1496C78289C136 toney.culotti
514,325,049 *34831F49BF1B9403BB56AE9B19AE464AF474410E toney.devilliers
514,325,050 *348E456AD609F5C2BD5C16400CFBBF7D6F6B7642 toney.ecklar
514,325,051 *3480DC4CC7DF0DE20C01F14319F69CA2B05E981B toney.gaisford
514,325,052 *3481A26D4101C153C3391B3291FA4F23133FEF47 toney.gomes
514,325,053 *3486FE2817BB0B5A09AF36EB86E7A685E19D2C17 toney.gordillo
514,325,054 *3481D07FCE6A32094374F9A6778BC38106C97672 toney.kornfield
514,325,055 *34873C87AD0CD0FF35EC921918A7A14AE7C7EE9A toney.linza
514,325,056 *3480A9941704859105C41E55C1EA50D76C20B8B1 toney.maday
514,325,057 *348B781CC1B0106D48AA5232F941F44610D9F1B7 toney.matherne
514,325,058 *348A2472E6C357DC388706A621E47D3EED23F3D3 toney.moons
514,325,059 *348F5F1021D4E046D9881DC3067C442E4D61564E toney.nakamoto
514,325,060 *348B261EBED149957BC4F63FB8E9330C82DC6846 toney.rade
514,325,061 *348F1CD054D9DDB3EAF7354F716B628028346278 toney.santore
514,325,062 *348FE0B8C3AF2691F9B87CCF6490BF5742891757 toney.soukup
514,325,063 *3483020A47A7C9FB5B6618DA4EADF15A45C88DA9 toney.stockstill
514,325,064 *3486C45FAAE0AD295F01A309BEC50FD147EDE6E0 toney.tarella
514,325,065 *348E49BC04FAE2ABEB24E48553A67C71AC29EC60 toney.torrella
514,325,066 *348AF90AA90CD46D96CAB549CA61BEAA75428C5A toney.waite
514,325,067 *348B587DBEACB0C08DCA23D529A835B3838E65E4 toney.waszak
514,325,068 *348B35CE0261C6C376F4658FDC281C7BB171A5A2 toney.wurz
514,325,069 *348B831509123940F592043977CD7318E06103ED tonförråd
514,325,070 *348DA17CC0D054B9042ACD63E7DBCE193C07E89D TONGAN_BACKHUMP
514,325,071 *3483FACBBC39C6E7D99C9819AE6E0148EB53B52A [email protected]
514,325,072 *3486FB4C4626CABF7F86C202031D954FB82F8AE3 tongklier6
514,325,073 *34826AF4477B30C1880B6476B69D863C5D10B326 Tongmemalai
514,325,074 *3484106615044F492A42BF4CC5A9AE0007BCDE69 tongmg
514,325,075 *348587A621D66108F676E1A77E92BAA6BD1BBF6E tongpunt?
514,325,076 *348F4B22853105EB2272CC2651D710879BF0AC1F Tongschars
514,325,077 *3483A84F6DCDA0A3A69A20047BCCCD40E2F51E8D tongu3-fl
514,325,078 *348DFE4C9CA8A2CFB19016900AFF8206F890668E TONGUÇ
514,325,079 *3483C7EB5A0B780B367475EF14E7C5CE9327D2B9 tongueshots8
514,325,080 *3489F6D684FB27E7BA282313FA1775C05930C8D5 tonguin2
514,325,081 *348E3EC6D85D7EE6DD8E6A98C9C3115C2423DC99 tonhalból
514,325,082 *3480F3847156BF8878526B543E16FE091C82E4C3 [email protected]
514,325,083 *3487C50517D22A92298A62EC857173256F62C2A7 tonicenesing
514,325,084 *34823736D0644FAE60F54A8EE8189786E3567956 [email protected]
514,325,085 *34887864E68F35910C375AA55D8A4C19B6914C35 toniderrodelk
514,325,086 *34829704C156666D0364D0E555D4BF14FACB1D81 TONIFIERAIT0
514,325,087 *348145AFF27BC0C60A045424C88680A52326B020 Tonight(feat.MobbDeep&JoeHooker)
514,325,088 *348F5B60C1CAC961C4EA90386EDC19B5024CCFB0 Tonight,Ifeelclosetoyou(feat.
514,325,089 *3485AB0D003937ACD8C8FFE7AD599ADAC5D35D0D Toningv7
514,325,090 *34862869F836D7CCAE2AC62B09750055BAB93341 Tonisha3
514,325,091 *348E9CDE85A2F94256917E7ED54D5559D34A2901 TONISHA32
514,325,092 *3482603390498AC97562CF4A34EB5BA2AF24D098 Tonite... The Singles Bar
514,325,093 *348ECAD92DA699BBD77FCB7D9B1631BAE6022729 tonitruante1234
514,325,094 *348A62B616015011E4278EE5AEECD30864FC9268 tonja32
514,325,095 *348EB6230E9923A9779A82E8776FDD458F453D86 [email protected]
514,325,096 *34800F06DDD3C99BC7030B34FE52FA6858E1245C tönle
514,325,097 *3483237CB90B5D0D71A366196FE606A7315855C1 tonlettonlet9
514,325,098 *34868C091DAB883C24084D1F9CFCF8B594A9A6AD tonnagerne9
514,325,099 *34873D256EB19525EBE3E32BE71FC20551FD7378 TONNEAUTJES
514,325,100 *348D2297852B4E1E003EAAD7BFC6F5054ECA0324 tonnsend0
514,325,101 *3482914FD58C995F435EDE27F49BE689CFEDDAC3 tonntachonamara(thewavesofconnamara)
514,325,102 *348B960A6E3EB535E91AE1902B1657D9263EBBA7 [email protected]
514,325,103 *348B7406E444295FE38434E1290AC0E759C08D13 Tonò
514,325,104 *348B88C84AEB9F20D776946A3D9A3EA57552CEBF tonoavail8
514,325,105 *348FD26112CE83F23AB93C388E2D3DAA69DD0724 tonodake08
514,325,106 *34847E7BF63B42ED1245A04FB9A28556D6A71605 Tonogram7
514,325,107 *348001F038F3C59B140A91009F34703F3791A428 tonorman2
514,325,108 *3483936A945101BF1AE47D7551AFC8982F7083F5 tonotoriousof1
514,325,109 *348D5E19408892984D0C4A177347EACA38295038 tonovicsing
514,325,110 *3486C0BE991D434B229E226A64D784C1C2E0710D tonsatrix9
514,325,111 *3483A4C34DA156180837F38B1104B71D3CA2587C tonsenes6
514,325,112 *34834E578A283BE537CBF1D7C99F8AE186BF5213 Tonsilabo
514,325,113 *3482F2A55C19E873BFBE1FFC0E9A35CD58DF24E8 tontista2
514,325,114 *348F5B21C1C066C2BB5061C433A9A823E2C2886A Tonttu Taneli
514,325,115 *348B37A34B459E9A79064D2CCAEFA048B856AF88 tonwtika3
514,325,116 *348A4E6A39077C4192DA42937D68EE805116BEB7 TONY1016
514,325,117 *348A4C0B431D549DCFFC8FA6C19122EDB16474A3 [email protected]
514,325,118 *348A3E4766F2055F67A45FE270BAA11E75000EEE tony367
514,325,119 *3480E7C9AD0C87155F07A2EE6ED3F086F2AA4BE9 Tony446
514,325,120 *348073B280590E86A5C387D41CE55B3C5AADF206 [email protected]
514,325,121 *3489527FFD23B57D03174258819D4EBC95C8D403 tonyablackburn
514,325,122 *3484BA5BF1F6F062C10F8B663FF85A9FEAAD47B7 tonya garnett
514,325,123 *34885F1F92FFCD08959978BA5AA1FB30DDDDE4BB Tonyall3
514,325,124 *348B547B4ACE5F51018044F05D06E18906C85A89 tony.atthowe
514,325,125 *3485B1A3F8E4BFB283EDC3AFA4CBE34BBDF725D8 tonya venable
514,325,126 *3489880D957DF982A09F87096C231DC247C5B26C tonyazavala
514,325,127 *348A2DF855BC8BED1A2F6C1CA4ADBCF4F7DBE8BA tonyballer
514,325,128 *348EEB0FDE75A9F91DB9AA98045A0A70F8E044BA tony.balmores
514,325,129 *34892264764462F451907B19C2996462F98D5EF7 tony.bava
514,325,130 *348C46BA5BF1779F7D181CBE6BB0C5FBBA889C7D tonyboner0
514,325,131 *3484B32705FC00CBFDADC95036A2B7BE40EA8BFF tony.bradner
514,325,132 *348B4DAEB53FC7F5E752EF856D195C9887483ED6 tony.bultema
514,325,133 *3482F860EE352B40A265E40F1707D50A295C30E2 tony.cabiya
514,325,134 *3481228CCABA26970BE438EC7637FE090411A78B tony.cardo
514,325,135 *348483FE69C293871EA23A47361C6A32798E05EE [email protected]
514,325,136 *34854D4BA1175965A12AC576C72A42F5C0B0B808 [email protected]
514,325,137 *348AA888107019C9B9D46C1F81595F21FA41ECB2 tonycipollone
514,325,138 *348DB01755ACBAB1B2FA79BABD03A5525079A2CD tony dellwo
514,325,139 *3483219C7481F7E6BEB5485C704CC089227B000E tony.dieng
514,325,140 *348F7E92AA1103F2B6AE3B006E28B046DA0ED0BB tonydimascio
514,325,141 *348CAA6567E3D6809CA20233AE7F7CA73E0EB8A8 tonyfaber
514,325,142 *3482404A9CA9D724830FCF79112BE97C52997C69 tony.frediani
514,325,143 *348AC37686DEA88FFF2BB1A9A8C6F333AEB32E50 tony.gaige
514,325,144 *348BC2C2A9B7D80E20A0E5B970218450B2E37A44 Tony Grantham
514,325,145 *348A1B690B8A6182B2829DCCF1C0C2A2D1733F25 tony.grudzinski
514,325,146 *34855A73971A974088C72E172D16BCECCB28B691 [email protected]
514,325,147 *348CC9D79773D96EBE4B5C52028AFA1F54944FD9 [email protected]
514,325,148 *34848AF48E0FF9047669BB5E778A534B4103BCCD tony.herold
514,325,149 *3483B891A8FE889000317CB733179C51B78354CE tony.hinderaker
514,325,150 *348F1A907C8AA88CADFDFC47E84484DB82BB8437 tony.kleese
514,325,151 *348460726B232B13F834251366845FFF9732FADF TONYKURL
514,325,152 *3483A331CF691FB1AFA20A1421D6AD302B26E77C Tonylb
514,325,153 *348FD3377DB80CA553AAD94CCBB1F7B785ECACAD tony.linamen
514,325,154 *3481B1F3FA9FB3EA33577315AF1E5AE9D011EA76 tony.longman
514,325,155 *348C6BC0C38F3CFE37172F546210B76AAC210633 TONY,MARCELLA
514,325,156 *34813DEE211BB3574A56C9F10359F813F6228F80 tonymartinusatopgunyahoocom7
514,325,157 *34867C37CA48B1F14FA173306DDE7B46D91A55C9 tonymemphis9
514,325,158 *348640071580DCFC82FD0CB9A51CDBED5FCCCFA3 tonyngam
514,325,159 *348F06937FC79D6ADE28567D78B62119DDDD3002 tonyourslerv
514,325,160 *348958ABEDEBE22C31A5C915E0F5D5C3D8C76C9B tonypascucci
514,325,161 *34860EA3986D2A9F243540C64F2B8F812123BC15 tony prashad
514,325,162 *348487641AF947B40A3B4504175290B9E32EDDC6 tonypurrone1234
514,325,163 *348C9280FBBD9E6AFE6E759DA81FA5BF9E8CC0DC tony renshaw
514,325,164 *3482033C82B0BD7FA159483D5E21511F567A5761 tony.sasseen
514,325,165 *348AADB80836EC766F369656C58AF69214D1C6F6 tony.skolnik
514,325,166 *348838005AB35D3FDB1D030B54097E314B386BE7 tony.taubert
514,325,167 *348C79F9B3F1FE8422E9B51FC3E4EC531A375369 tony.tew
514,325,168 *34834D2F312AE6675143990E5826FDD8A2EFFB85 tony.victorian
514,325,169 *348314FF466EC8FA285C941D0A70E0F7D1C0AE9A tony.wichman
514,325,170 *3485E8DE23C862823A00C8268CE306AAA7B6CA0D tony wingfield
514,325,171 *3481EA9B16C51CB2A2AD9C10EEEEDE676A3E3801 tony witney
514,325,172 *3488A5CD108C0D8F8DE5201A6627193FF1131FC1 tony.wooton
514,325,173 *3481D4D85B227C683DE024258686C31988FD2BB7 tony.zanchez
514,325,174 *3487F12A8D6B0ECC27A806F783DC87146D7447BF tonyzelayandia
514,325,175 *3489447F54D7B75F91E6833BCC83B33A3B925077 'Too
514,325,176 *348EAF3411EFCD7F8A0722722EB818AC73C4637E too1 kit
514,325,177 *348FE9ADDA8AD56B6640AABE44DBBC87BBC7AB55 tooancientanubis
514,325,178 *348A5706D1146D17DEC2F8F4E16020EBCEDB0E34 toobdrahed
514,325,179 *34890886F122A459B781440C9FDAB2648C0424C0 toocommanding
514,325,180 *34808C5C20F095542D6F675C1B2CBE09E604EC59 toodham
514,325,181 *34837F035B434A5F7FB46DF327BE285B3236879A tooflove8
514,325,182 *348BA521A694C41E83BD36AD8694C2489B4BEA3A too frugalstintless
514,325,183 *348C40A59A02E02888353F5681090350D7AC351E Tooftlas2
514,325,184 *3487799F323A8C46DA166E7037AC389B61F91570 tooftlas3
514,325,185 *348A9BD2449C9ADEECE2B09AE74E2D082E1098D3 toofyppued
514,325,186 *3486D329AA209E6CCEF70E56E0BA93D39C45DE39 toogieob1
514,325,187 *3480F9B06B5D9F00FA15CCDB28A913AD69AB3C35 toogoodtomiss(vocal)
514,325,188 *3481B10B422E2B07AA5342DF772B04BF5DF28699 toohip2bneedy
514,325,189 *34883A77ECFD96CEA8F82547A7D37A6FA6ABDA37 tooiende4
514,325,190 *348DB63CE104F3C0FED1F91728636E74783BA340 tooii
514,325,191 *3489896FB6F72A2891D262637BD4672B1EA64853 TOOKIECODY
514,325,192 *3481AAAAD601E51F73BEBDBBDF07E08BF40EF8E7 toolandd1
514,325,193 *34883733ACDFC06476010F212ED0153CC850A74D toolfiler2
514,325,194 *348F5E9CBABDC9067FB4AE69D15D133BD1419ED8 TOOLGRINDING
514,325,195 *348EAFEEB29358D9A9977132142F00F8E01C05E7 TOOLSTOCK3
514,325,196 *34886339966BF95CEC3124D7051895FC168A7C2E tooltipscss123
514,325,197 *3480429B755A0B7D3A8EEC692637CAE059701FD2 toom-1
514,325,198 *348E84BDD6AE32B0DC40D5159354FB81345668CA TOOMBS T UW1 M Z
514,325,199 *348373E0C036DC6484C2E0FB20AE6E55F7A39CCE toonhoogtensed
514,325,200 *3481C27FA3C3B656B15896A15A1AF65465696162 Toonlaw8
514,325,201 *3488E1883CC7475A8320B6A097CC21B8BF799E39 Toonsteen
514,325,202 *34873A769F72C6FD0D0EF19D9B6792000B79ED95 toonttnoots
514,325,203 *3485BEF64239318A7E8E26A4D7523A4F8C3E68FB toorpubswing
514,325,204 *348A891238B8581E7252DF9E6089F4A6ECB85330 Tooshes2
514,325,205 *3481C617E47B4ED8FECB03EBE97B3E094F149C5C Tooth5om3n355
514,325,206 *3484F709125BDD46115207427ED1AAB857255FC7 too; though, in the mean time, some necessary
514,325,207 *348462CB5B8073A0BCAA889EF3971BE0ADB23F50 TOOTHY0
514,325,208 *3485E5485B2E401F3189694308FED182A57BA920 TOOTIE0
514,325,209 *348BE909C5BFE58580282E99A4BFBB85DB2A8912 tootie's grief
514,325,210 *3483B589109213D124F638728144017ECCB22DBC [tootsie
514,325,211 *348712FB602EDD5AA70A95AF9DA96ECF33533095 TOOTSIE1958
514,325,212 *3489C70AEBA14951D05289735B3A4D7F6D4BC784 tootsieaaaaaa6
514,325,213 *3483438112D323D666E4A3D4EF25FE5C7090FDAF tootsiebarney7
514,325,214 *348CD7528DE947A7E42B80D22525693268E8A894 tootsiebooger5
514,325,215 *3487862920552AF4BC2D5FBBADEC118F066174EF tootsiefreddy0
514,325,216 *348A982B082D6871B6FC9B26B44C0988AB018553 tootsiegordon2
514,325,217 *348671780043228CAC76E9146F399D148B1FE7FC Tootsiep3
514,325,218 *348138FCC5A63F561D84C01505F15822CEE01684 tootsieretard5
514,325,219 *348B714C42D2A5B0DA63F629242A82F6BC341ADC tootsieshebas
514,325,220 *3481341E3F72FEB624D49FE1EACD72AD23B23061 töötuskindlustust
514,325,221 *348A1A89EC4844D7F8728739344A0D15094B60C8 Toowey
514,325,222 *3481913F1BF3F58142998067EE7DC57FA9FF9165 Top 100 Allertijden: Editie '95 (disc 2)
514,325,223 *3483C5A768540981B90CDCD27A18C5C9419E9A81 topamosing
514,325,224 *3489DECEC04B4D7FCE4DD265917AA673CE294EA5 toparcwelder1234
514,325,225 *3487354EE9DC625EEAEE87A4B0F417EBFB2CDCA3 toparlakbsw1
514,325,226 *3487D049B475C4CC01E23C9BCC3AEA70AC069D05 topattumi (taking over)
514,325,227 *348A83965551A648AEE149724D03326679607D11 (TOPCAT)★
514,325,228 *348FC28ABD12E216A07DD2D297681D169B469B8E Topcat>
514,325,229 *3482345AD593AD60F55931B7D3B1E111A72289F5 topcatactive6
514,325,230 *348D4D8E067DD74E0716C4291AB1F5449640B966 topcatgenesis1
514,325,231 *3488CDC03698F61370F739173EFC3C22C64B05E4 topcatlamer0
514,325,232 *348A172DB99DE53FB5D86E020D811EE92A3C4B46 topcatsusaned
514,325,233 *3484B4873BDF4DD0611DF86420FF893753DCEBD1 topcontributors
514,325,234 *3485FB63E3BEE54D094BA425BEF3A980454BE4CD topcoolgirleu1
514,325,235 *348032706333EC9762E7A0121304595BFC2AA4A1 toperdom.
514,325,236 *348485F58A3ECBF58EEEA1E6C16CD5FF6C6D86A3 Top-Flight Mechanics
514,325,237 *34812EA1C13CD9B730E4F82B352401E867D28D85 TOPGON.bbs
514,325,238 *34890CA2F881EC46361501A04B6BD1D21730F559 TOPGUN123123
514,325,239 *348895EE4008D65DE7391A2AC705C830C0338706 topgunchristop1
514,325,240 *348313DA36A67CAA360D525B40CC87879BE3D348 topgunkidses
514,325,241 *3488738E82A1C0297112263D2B77BEAB8EB37503 topgunlincoln7
514,325,242 *3486F815EEE92776D121E29C57DF6262F4933786 topgunmarined
514,325,243 *348D595D9D3408B50CB8B5DB6DD6F28F0B0A097D topgunmedical3
514,325,244 *348A779F348FA3558F1FA51DB6616F74D7A1326D topgunmirage2
514,325,245 *3482C66D70A868B0CDD24C12A18E05764EE68E21 topgunmonopoly4
514,325,246 *348849912EDC90F9D25E7EC2351D2B24A36B88E0 topgunreader9
514,325,247 *34839EE7B04189505316FBAC844285B6C15D99B9 topgunsenior6
514,325,248 *3480D5B2296CD7DFF3006AC979C43E664647FDA6 topguntyler3
514,325,249 *348DC7E469A744FBCE4873546728D93B8AC88BDF topgunzaphod7
514,325,250 *34804F13951D892F6D4DABE3EA41C515F183000E tophdomw9
514,325,251 *3487C55A8C52F4AE5C1A48F493D73B8E4FE683F5 topheader
514,325,252 *34846B68EA188FC49718A3434869386761D1B201 topherdebbie2
514,325,253 *348A2F429070C2ED1A7076C7E7FCF5F7045EEAE9 topherjessicas
514,325,254 *3482EC2AF037884FA931505126936507757424F0 Topherv1
514,325,255 *3489EA08EF922E96104470E23E691275A87E6581 topherviking1
514,325,256 *348C39315B7759A7351189244249BBB1BD80A257 Topicala0
514,325,257 *3485DD9055C647C50D9AF7F57CAA371D61EE3236 topic..i
514,325,258 *348FCD6FE70040811A69D4DB9A7470ED7F9A602C topicif6
514,325,259 *348EE7901A6A86CB1D9CFFBE0D0CD651ECFF4F24 topistas4
514,325,260 *348B015954BDA64090173B443BDB19460FCBEDB2 トップキック(topkick)とは別にwシリーズ(
514,325,261 *348B2DC15660D0AB6E1CF13D1DB1BA4F4E918471 topla123
514,325,262 *348487402A8D6F9248FDE5974411AD02C401739C [email protected]
514,325,263 *3483B679A78C156456447DC489243B46F2A372FC topljenja5
514,325,264 *348320C7E4DBD2684D705705D10F4B730A6B606A Topmdet4
514,325,265 *3483417074D11808543595B74782DDD9176A9AFB topmuzicaeu1
514,325,266 *348724311C8FB22C7957979C8E79F3FB60EFE58B topocentrics9
514,325,267 *348A0E6DB481092D6067F5736E20655F8712F758 topolesking
514,325,268 *34850CFC83742221746955165578A5AFCB115613 toponomasticadialettale
514,325,269 *348F483883A8A66CB78B4A2C7A43E4C02A19F955 TOPONYMY5
514,325,270 *348E1D3489CCE6FA502260EC01685E798748AA7A toporkiewicza6
514,325,271 *348D2A9803EB2E970ADB03AB3410079B6B8199F9 Toporowym
514,325,272 *348D60484F2D8235FE79C9D2E4FC1BDC20C00AB9 tópos“
514,325,273 *34833570546F03CDF324313098F45AF0B66B4F78 Toppilan6
514,325,274 *34839C8BF374953E6A8EEDC87FE4F741592D7745 toppklassade
514,325,275 *348744E8D9E5DAE43CAEA9087E0CE07FA1165408 [email protected]
514,325,276 *34803148BD9E21DE9D2A440852AD50943C5AE9D6 TOPRAKADA
514,325,277 *3480195A52B3281DD0A4D07F27212A7618BF25FA topranking(i'mthetoughest)
514,325,278 *3482A4EDFB7F937B6140F887F8B38105E030DF70 topregru7
514,325,279 *3480EC71B09AD95A8BB907215EDF6D6FE7E8F1E5 tops9
514,325,280 *3483F305EBD6549E3FD051BFF60E0E875DEC4566 topsportscholen
514,325,281 *3482C2BD5072504943155D83F64D51286831EDAF toptitlebswed
514,325,282 *3484AB51EDD737AF03958E6825688CF364D91E54 Toptsises
514,325,283 *34842BDB4484711FF11D40C6960C0F95D602CABE Topwise2
514,325,284 *348ABFFEF7CB8F360147B37DA4FBEE2DC2DF0B12 topyam
514,325,285 *348272F1192B15E53EDF4F9C818758C6D7C9AC87 toqueycantoaogg
514,325,286 *3487BE83378305D3CE27F10F256D38EC413D64E1 törähyttävän
514,325,287 *348438B04AC9F3C2628C5E98F5A78C01FC95B2AA Toranaam1
514,325,288 *348BA07A19B2DE56BF2A97CE0701D50C30F5E2A9 TORA-SANS-ISLAND-ENCOUNTER
514,325,289 *3481917B0826C70EE545803B13263F0A4BA80263 Torauslinien
514,325,290 *348439E69166379BD13DCF0AB12750D0B3A035E0 torbaricI
514,325,291 *34880C828C4E3914A197A535801D4414E53C1DCD torchtreefamilied
514,325,292 *3489FC7612D731C631C3B1B0BA618E3D4551EA92 torclause
514,325,293 *34845A54A13B7A852DE66EC86F4D6EB6D45E7595 TORCULAS
514,325,294 *348F03CC5779C3C915DA31EAA5EA2CF3C50A1C0A tordrionsing
514,325,295 *34867EBB6506E6B2CDDA3F5882229F58F5A01322 tore boe
514,325,296 *3488A926B0363176644B62DF52D702E3069A1DAF toregardremarkablenessrenderrender1
514,325,297 *348DC102FB353276E64A4B44612CDC4D506556F1 (Toren
514,325,298 *348AAD6C6D4136BFE5F5F1D81C48E24C8C1CB94B torenderableresponsibleresponsible
514,325,299 *348D10BA5FB86FC591C9E64B77B2EC11296FC948 TOREUTICS5
514,325,300 *3485FE92900C4B871599C83D647F473C3D0EB5FF toreyharper
514,325,301 *3489FCB7D2B794B18CD4BDA05F0306A46D04108B torgovi
514,325,302 *3483DE4BE1A46FDE527BC48B0D722644686FE134 Tori185
514,325,303 *3488F9A4FA7CBD7117AE3BBB543176808127EB62 Tori522
514,325,304 *348EBEC05B861BC8B3709BB1D6297779DEBB6377 toriapjming
514,325,305 *348C8920DAA06DF7C2544E604BED5B69569E730A tori-atama
514,325,306 *348A178FCB2D0C25CDF1CBA6E408926396388F74 torico-torico
514,325,307 *348B6D5DF6FE98C43F95B1B39B295AEA6C011560 TORI-GATA
514,325,308 *3484D6F8D84A7E8F0CE39C66655FB96D2E07F74D torimaring
514,325,309 *348054B578FEF34AFFB34F350530F181D9CB8A57 Tor$ion$
514,325,310 *3486DCE8A23494C70C954FD523C1DC7F0CC53DF0 torjillo5
514,325,311 *34893D70BFBD027EBC976B8C59D78641CB140094 Torlako
514,325,312 *34817BF2CB4EAE8256A53BC7B493D08A62C34427 TORMENTE7
514,325,313 *348B785B5CA0BE3E77FF5A9FEBB3CED15F379ACD [email protected]
514,325,314 *348E19623D410664418B2DA0265B46278A052C40 tormentressesing
514,325,315 *3482CC93BE6A37EC88688A47CA233B8895DBBA2C tornado cloud
514,325,316 *3487CAC4C127031B3060EE2FD996FF8CA414CF2C Tornadojagters
514,325,317 *34816111F9C79E9F47EB0CE179AED5C691329E5A tornándolas
514,325,318 *348EC05EF95CF01BA6B3BBC7CE275DFCABCDE33A tornates9
514,325,319 *348F638770BD87A62F2D8DD869DD156B49EB18FC tornehamntunnelen
514,325,320 *3489332CDADA3D8902122CE5E5E241FCBC2BF5CC torneret6
514,325,321 *348BA6BFF33723A460D9FBF4FC220B089B84D076 tornilaulu
514,325,322 *3482395891602D507076B6C2BB94B5D329AC88B2 torniran5
514,325,323 *348AFE8D4FBA400D0A712D803861844AA71BE7FF Tornivis5
514,325,324 *348BC7A9762CA600674D544EEE8C40B14E68F9B5 torocán
514,325,325 *3480CB1E7C9A77D581048598A17364E47553BBDF TOROKA
514,325,326 *348D24FAB956D4204CD58234C6264AD957D67E39 Toronto70
514,325,327 *348369EAEFED2074F5C3FBF2E1CC4850E23E8698 TORONTOACCESS
514,325,328 *3483381AC2A31EACE46590CF3FC69D4471ADD465 TORONTOBRADLEY
514,325,329 *34823F46065BCAEA029E12EECDBCC8905B9E4519 TORONTO-CENTRE-YORK
514,325,330 *34876E097DC13BD6300549E80EF708BE117BB87D toronton4
514,325,331 *3488D97D1A57D293EE1CDC13C0FCA4DFAB236EA0 Torportale
514,325,332 *348C39B0D7F0FED32E44C192C0F1DD53068AD906 torques!
514,325,333 *34817A47F3216E2939BF6F2AD0C796A26D860084 torquirs
514,325,334 *348B10CC058644F1C871A6B538E80AC5202EA8A8 Torreana
514,325,335 *34822CE359B5F321CD39B848D9B93DFEEBBC07EB torrearse1
514,325,336 *348F907B95DBFA7EDDE27945FAAE6B2363A7BE19 TORREFICATION4
514,325,337 *348A515CF1F63C5FF65CCF92FFD0CE4ABB318E0E torrence、
514,325,338 *348AD3D58C73786C7A69060F330E68908C3864C5 «torrent
514,325,339 *34856F260A2A05FD1CEF9B193D7DE8F51495794A torrentfuls1
514,325,340 *34831080A0BC15C837FD582F9749C83F98186C37 torrenzial
514,325,341 *348AF769A7DB715ACB24451586E075B1C9040912 torrfirent1
514,325,342 *3486B3B8E45327A5D7A41308E1F48330A4DD0512 [email protected]
514,325,343 *3489B0F519D8072C98487BC38C4F787B1D9C31F3 Torrilsing
514,325,344 *348F19EE6B8A069CB356957637D95ACF44506123 TORROCA
514,325,345 *348FBB8FD2AAD10AC02E20048BE40E10EF93112C torroni.
514,325,346 *348A784BE652961B6B0BDD98870F1AB98A002780 torrood2
514,325,347 *348485DB8F4E3D5B418E29790A41211E60DD93D4 torry bellamy
514,325,348 *34851F5EDB05E83D33A2EFB700CEF2004038C460 «torsdagskveldseminara»
514,325,349 *34853E9BE1F4BF450B7F5500CE30209585AF72E3 Torsigraph9
514,325,350 *3484FB14C94E7E04719F4B16E976763F1DCDB87F torsiosnsgesch
514,325,351 *348A28130F5F12C852C5E5DEB15713CA9926AA40 torskegildet1
514,325,352 *348C0FBF715D6FE8DCF1631251312558FFB44D9E [email protected]
514,325,353 *3487AFE2F3E282965C522DE91B1CB7CE52388FDA torsten.lihra
514,325,354 *348DDFE6344D8F750191506ACA60B3BAB4B30234 [email protected]
514,325,355 *3488AE9AD7F65B04D5F99C7247C686CB92780576 TORTELTEAM
514,325,356 *348ED7A643DFF38AA7F092CFB881AD3F720205A7 torterendes0
514,325,357 *348CD0321289C63C8ACF2B3F41F6256F55AE9ED9 tortion1
514,325,358 *34867E0F6D0C2C962E120922737E323472C96F20 TORTIONNER
514,325,359 *3483BB59CF6D16E775F0909C0393AEAAC1210FC6 tortonia2
514,325,360 *348C15D25BCBED77049B8EC88A76BB2963A3DDAB tortoricibswed
514,325,361 *34884CE543D43F2791530A124E0FDEE76F4EE9B5 Tortosiera
514,325,362 *34802F889297C62B45B2B031D0595CA21C8216D1 Tortrícido
514,325,363 *348DE3AA27A97DA8C0571ABAF69C67C9CC79D3D2 tortue1234
514,325,364 *3489AB00A369BF8169C8E3A7483F53E62057D0C8 tortugash8
514,325,365 *34816CDB3A6AA297AB31E3CD984E40EC1AB036D3 tortuousdeclarationing
514,325,366 *3485590ABA275C18FDB201F49632C63BCCD14DC7 tortured.momento
514,325,367 *3483F51132E1CAE6964317AD70F65D809B939387 torutras
514,325,368 *34810749EA54B76C86B760C53D611D24E44DE136 törvénycikkével
514,325,369 *348C2801B3981EE9C8A9C3AB3DE8B59C3F7E0E65 torvenykonyv
514,325,370 *348A73DC5C0582BCBB7496FABB4E30415AEA1873 tory.afflick
514,325,371 *3482F14C81B7DE9641007E2EE2C5FAB7D711236E tory.allcorn
514,325,372 *3486D60994CB921A6D3365B46703B1C1C3915FBE tory.bachman
514,325,373 *3480BB83CD23E32E5DBE17A6A9CA5F3ED9971E82 tory.bascetta
514,325,374 *3482DCC5D99B985044DEA34DD78865C1170AAB54 tory.briguglio
514,325,375 *348D939EDBF1E8F284C4FB38971DB7EDBE16AC17 tory.cavagnaro
514,325,376 *348351B0396A305D932538193072E56625C67D8B tory.defosse
514,325,377 *348659CAEC02D690FCD1586478DF5978CC5E282B tory.desjarlais
514,325,378 *348D9F7A80F7297C8847B1FA9D9D711769B67FC2 tory.elza
514,325,379 *34868ED557725987133CCC2532610AED7832EDCE tory.frilling
514,325,380 *3487D23828B0EF3C8401B59B70F0B6D5EC729ADB tory.gutterrez
514,325,381 *348FEF6DB8155FB56F2B7AEF6CCE2993FBE0690F tory.heemstra
514,325,382 *3488A6CE76C4E6B5A321DBB2A8CBFBDD330C1115 tory.heineck
514,325,383 *34856FEA27179E3595E4170751821C39350AE14B tory.heynen
514,325,384 *3489A6162B1850C1B9B79767F8AF072901D3E992 tory.hilb
514,325,385 *34827C06C914EBB1FD88B10BC7C163820454DE68 tory.komatsu
514,325,386 *3487CBF158D788DE9838438AAC3092E232C33908 tory.kutner
514,325,387 *3489B7C46AF19B911D6F0EDA84D6AABDA008F994 tory
514,325,388 *3484096B4BA5925BA21BB05C7C3C639860F16C24 torylara
514,325,389 *348C6F98F1EAC5C02B507A8FC6F1C3D70E676E39 tory.lawsky
514,325,390 *348DF853D3D779E49BEFF18ADAE6099802DFA658 tory.line
514,325,391 *34807DC47EE961E6A9148CA5E40C4030A7D12E65 tory.lonie
514,325,392 *348BC63566411DDA18707D6C8E6C9748B3D1A778 tory.momon
514,325,393 *34866CA7CEAFEA9DC1F8455EC34B3456E9CF260C tory.mulhall
514,325,394 *34867EB2E149427EBE753EF7E0BDDEB627866375 tory.perryman
514,325,395 *348CF2BCF77E315CBCC077408C87DC295EBE84C5 tory.pierro
514,325,396 *3482B19CE8F3DCDE0006A8AAE2D3EE8D6442D532 tory.podolak
514,325,397 *3484BE9752C698D5254C2803EF47DE654473B1AF Toryreck
514,325,398 *34848783EF4F1330FAD4073E820E1AB95A6AC824 tory.ruschmann
514,325,399 *348FE2FB6F2A781E83EBFB464B8C4B657BDA6919 tory.saul
514,325,400 *348D316E10D82819B8FD45870E04A16033B55A54 tory.sivley
514,325,401 *348768A23568C417236F5BDA49F9AA6CB8F610EC tory.stilner
514,325,402 *3486500238551CB6EC659E72842F7915A0C00427 tory.szalay
514,325,403 *34826E40D1A18FDACBF4EE23DB7F36473C685E6A tory.tehan
514,325,404 *3484872C3180B12BF5B11DA1B36283BDB2C41756 tory.veil
514,325,405 *3480B760A44032013FDCC6AC459E38B3D98512E1 Törzstiszt
514,325,406 *3484610552A0B547DCA725E8AA8B6C510153B9EB tor是核心,提供socks5代理127
514,325,407 *348F15E7E3A2F0A3CD8ACDFD03C22878C62700B3 tOs
514,325,408 *34837763D2845BFD4F27A10F6E68C8337FF5916A tosafotbsW
514,325,409 *3489F7C7614D6F3836C02E111C19EC317B15B37F tosarjan6
514,325,410 *348E845527296BAF77172277CAF3DA95F037E244 tosasinz1
514,325,411 *348B188CF28AD5AD246229D66C90428B070EC78C Toschewa
514,325,412 *3480367C4C8B74EC84A88BD850BEB013BA825D99 tosetsud2
514,325,413 *348BC240A51C106C93C7C788934FE3E4AACF12DF toshaedenn8
514,325,414 *34821C228A61064A597313754FC23A3D42D8F994 toshell3
514,325,415 *3486218F9535ABB6A2CC474A8C9A46CEEA4F44EB toshihito0
514,325,416 *3483C603F529E1E9D6BF8994D9198CA54742B42B toshio masuda
514,325,417 *34807BED9E4ED7E1F142E014049B2B160EFFB2B9 [email protected]
514,325,418 *3483D9B4E20AFB32D2FBB2D36F57C02EECF30738 tosiaanhan
514,325,419 *3483519FD55E64A07A2F492322CA60D355246717 Tosiate0
514,325,420 *348906D7C25F24156AAD4ADF834D4D3AA85C0E80 tosinouc9
514,325,421 *348A1FB590968B50BDD8CDB0B2A3472E826BDC16 tosin sunday
514,325,422 *3489FEBCD08621DB23334A2BD7D45E3BEAF38097 TOSKAEW
514,325,423 *348B46CF6399763FB8EFBCBE173B54769E0D4B27 Toŝodaiĝi
514,325,424 *348D8DE3FC0937BD3A9F3DE049B721886B24A33B tosquia3
514,325,425 *3487A03D5B63A554BB67D1571990884C2D418C52 [email protected]
514,325,426 *348ED28344CAC3559BCDDC6A674B69ADFE0B06F5 tossicologie6
514,325,427 *3485D35F066B1EF938BF9E8300EC7F739D3C6E1E tossiscano0
514,325,428 *3480B85907E1AB24C921D112391D441011F0FD42 Tostaram9
514,325,429 *34852BD4024EF1AEB7AFF9811C872440F2E4523F tostera3
514,325,430 *348DB1270256BA54009BFDCB496290A19E161C79 TOST
514,325,431 *348645193C9139C9DEC53580B1DAF7CD445C8F3C tosuffersupplyswim
514,325,432 *348AFAAB2425708AE6434E3BBA4276CA29D7AB88 total160floor160area
514,325,433 *34831BAEA884FA7B02D82A3CE78A6409CB841C02 Total2006
514,325,434 *34891593FFB39953DDEA7D87F186E118EBA690F4 Totālais
514,325,435 *348AE46DD28685AA7027CA73553F164FA1BDF08B TotalBowling
514,325,436 *348220EE5F1083F7F01A079F66A19957CDAD5A61 TotalDVD
514,325,437 *348DDB206D6909C7238E63EEFDC43128AA8B13E3 totalentrepri6
514,325,438 *348D217A0E45E2585DA815CA62BA0D733FE4B186 Totalforbuddenes
514,325,439 *348B7776118F05C4DD4F1948E9AF90FEAB820268 totalfrbjudande
514,325,440 *348FEC174799AF20D8C7C50DA5459A97EAFBC57E TOTALIARAN
514,325,441 *348CDB14028045904FB1AF2C0B9F1719227FB49D totalindonesia
514,325,442 *348125B0DEB06AA3F433D388B4D95E3AFA98A4D3 TOTALISM0
514,325,443 *3484A4C3343C5853067107781B5A64DB7EADCD37 totalisrent8
514,325,444 *348095452C6DE2CB2F30A2967A2553530C8D7D61 Totalitätsanspruch
514,325,445 *3486122673E415838F712A0D7074FA4EE9CB415D totallis3
514,325,446 *3489B001809797F2CCDBC6607FAB22D24890C6AE totalo2002
514,325,447 *348325190A441729267D84BFD3C3B836C658E748 totalwordcount4
514,325,448 *34832CE34C3A61C673AF0570E9F77279F9526B91 [email protected]
514,325,449 *348444B9C40B1B2EEDC0BE319E7CF0E8C9FD4690 TOTEMICS
514,325,450 *348D4152641ACC8A2D70276D49765E82F70B1866 totémisé
514,325,451 *3487F7F5B45280F20E3CE1D7CDDF7468CBDC67C1 totemistisch1
514,325,452 *3485351C61A06F00206003951FBE19D3956AC427 Totenkopfa
514,325,453 *34804E1B1B18889AC644552B9ABFB5E23D8D3C50 totenkopffahne
514,325,454 *348A28E059736DFC6E364C17B0952FCE1D02E410 “Tötet
514,325,455 *348B01D31B52469F953E01505F71E4F01218B5FA TOTEUTUMISTA
514,325,456 *348D3560072B98D2552AD6407C1A7EFCE30C5542 TOTEZAI
514,325,457 *348903CABEDA98C2A6965DF9ADD31C75DD7FED41 TÖTGES
514,325,458 *3486B5026B79AC7B18A980B55A82B7B10C8CB1FF tothegods
514,325,459 *348DF534E02586BF02201D4F3DFF74A072B81551 TotheNight
514,325,460 *348CDEC2DCB5A4220B7E2117EED4ADBA42043F30 Tothers9
514,325,461 *3483796425040953D114A89FDCAB6C57563E3623 to.these
514,325,462 *34851DE69C627EBFD20142D16D35535F79CA3CA1 tot-lots
514,325,463 *348B8B7F5ABBCC8B748566E01AF19C571D5357DE [email protected]
514,325,464 *348DA32C5EDCCE6D7E8A5B0B57FBA202A687CFCD TOTOZAZA1
514,325,465 *34819A8B80A30C8D367B07601AE285FD6A05E028 totschlaeger2
514,325,466 *348FF5BCECB971E7A7FEA3ABC548A59A075DBD26 Tottlola
514,325,467 *34892B6745C2CC67BF65F1B5010D18ACA86FD9F3 TOTWS
514,325,468 *34892A3B1F95840A3A7B34620CA1496EE076777D totyounglingyoungster2
514,325,469 *34838ECBD601253DDEE905DBC46597B051725632 Touaé
514,325,470 *348D627D9EC0D96EA6D6F6446ED9235007F28219 touavyymgm1
514,325,471 *348C731885ABFEFEDC887D49E158B9157F5CEE42 Toubuniking
514,325,472 *34865A3C9791D38162A6A4D144124E460FFCF028 touch3r4i
514,325,473 *348F998D26531DFCBAD51AB031FF1BAD62491935 Touch A-Touch A-Touch Me
514,325,474 *34898A1CCF42E6831002637BFF9B79F0B29CFCE5 touchepierre6
514,325,475 *348B78E0527C27245CA129595D85FC1DBD8385F2 Touchezpasaugrisbi(alternate)
514,325,476 *3483E988639A91069A296E63856D63A406B5BE41 touchfinalefinalizefinishfinish1
514,325,477 *348E4B5C796E47D6E25B22AF752129BC1988419A touchioned
514,325,478 *348014FABC1309871199AEB7D0EDF3E237F0EE79 TOUCHIONS2
514,325,479 *3481F0D0C879B409527CED12750932A8C1D01D91 TouchMySoul:TheFinestofBlackMusic,3/2000(disc2)
514,325,480 *348880B9E0D75CB28D246B18C16B24AD97EE4CAF touchthigh7
514,325,481 *34873E8505D1A56D165EDCA48739D4F3B6DB99FD toudaicoach
514,325,482 *3485DE7E80DC16E454E41D7673DF430C33C79F3E [email protected]
514,325,483 *3488695048BC8F1B7CA6486FD942BBAA857DFD73 toughcating
514,325,484 *3483E9D96F8252FE2A79DBFAADDD6DF70EA51913 toughguys1
514,325,485 *34815F71E290863E6A2E2E52C4E636EB0AB0B2A1 Tough Luck, Trashcan!
514,325,486 *3480D22DFEE5C2FB48585C98E63F8BF830C7ED6E Toughras3
514,325,487 *3484DD0A201A5F9402BFBBEEC5DEFF50D9EC7EF9 TOUJOURS_OPTIMIS
514,325,488 *3487AF8CB058B82528BCF38214022030F958FE49 tõukame
514,325,489 *34810DB6F15F2046CED93861D7ED7E3C1C78281C Toukyuu5
514,325,490 *348E94D823C5655273F2F7F00E8AC88CA5EDB26F toungering(feat.jessicarabbit)
514,325,491 *3484307FDDBADF94C228CA89543630AD3A302A75 tounjčici
514,325,492 *348D62A73FB86F1BA8DA2E23594C63FE07A11575 tountemboaning
514,325,493 *348458334F9920C7C1BA1625279AB078E635D50D touqndrowtouqxedning
514,325,494 *34875BA9AC93C2A673DB4480E2D891D98F1B702C touqnoitaitogen3
514,325,495 *348C9C53161A8087BAB8D4960B3D5A68B21133E4 touqsitouq
514,325,496 *348FC4646B7BE1979E0C475A2E93111A37762B0B touraillage4
514,325,497 *348AA44511F2FC18CA97DAB66D2DD3B532CB7BBE tourassised
514,325,498 *348D76024F7C123C8D3BD826471F98BD275BE3A5 tourdisse5
514,325,499 *3481CF1EB66405834BCEADB585945EAC9C1CB3E4 Toureinzelfinale
514,325,500 *348D9DEB0FB0B29FFFAB9D9BD22F015501080537 TourePortrait
514,325,501 *34848829BC236D548C48E6101222BC9EB6139F3A tourferryservices
514,325,502 *348FCAEF1D9D849DF2C5E543AB673AD12C33F289 [email protected]
514,325,503 *348B10E67223DACB97DD3CEF36E665316D91B6D6 tourismplus
514,325,504 *348930E14812EA6E2CB1B0BB145BD885A2BBC911 Tourismusinsdustrie
514,325,505 *348FD09BD8034E235FD91C63859F8B873F9964F2 tournabuoni6
514,325,506 *348C910237986A5FC9DCC187F873A692423109D5 tournaKbnCd
514,325,507 *348D6ABB0A938649651A5091D6B15BCD1AA347EB Tournor
514,325,508 *348FA6AE6C0F7ED4915146D03260F54F6E00B4A2 touro562
514,325,509 *34832A7305DF9ABC375F5708C5F36FD452497864 Tousetsu8
514,325,510 *348D83C3DEDF06847A72E06331ABB60AEE7564FE TOUSLESPERSONNELS
514,325,511 *34829C0D57E3E5AA9E745096D9415CDE96E49391 Tousses?
514,325,512 *34852C6DC9E420DF71EFB1941B0FC1D264B8D191 tou-tow
514,325,513 *3484384DFBC0C3EC2BEE9899410A0FC50FBD9509 TOUWPLUIS5
514,325,514 *3485EDCD0B9BD0E6060BA288517654AC5A12AF50 Touwtjes5
514,325,515 *348FADEC84C878A520661348E358CBBE1D504C76 Touziest0
514,325,516 *34875780934D32787CF4B7F33F3669E8A01B3ED4 touzimued
514,325,517 *3486A641A5FECA9F1F6EA71CD827F001CBAF5886 TOUZYUU
514,325,518 *3482DC212FC4CADFB97AE5E48A91EE51E9DDE7D9 tovabbi3
514,325,519 *348609AA0C0FE88F01682C0B69B8D53A0818331A tovalue
514,325,520 *348B7520F53ED8681263FB4BF4903F041EFF98B1 Tovarpasjön
514,325,521 *348B7F77B93F18F2AABD5DE534988004288A4277 TOVEJSKOMMUNIKATIONEN
514,325,522 *3483F15CE5B3BDD063BCAA67B6A2F28D7397FB15 To Walk to Valley of a New
514,325,523 *3489C59517FCB9CCDCEA5DC50347D789DCBED18E towardsearth
514,325,524 *34811FB29AD8DD8CDF3DCB9684D37433F2A541E7 towboatses0
514,325,525 *348CE3E707D10852CDF4E889B12E9DC4CFF4469E tower-key-lights
514,325,526 *348DAC8BFB844210C54A21FCD51B639F49FADAA0 towerssupply7
514,325,527 *3484E857DE05A3D8BE4166DB168D93C829E53DE8 towerweight6
514,325,528 *34839AD44FC669BA65BD008F51414795426F7EE8 towjoe
514,325,529 *3484F5658AB4E4350ECAED005F3F2036CB854D2F TOWN-DECLARED
514,325,530 *3489D2C22782CF953942D54FA26A7FDC93297CB8 townfolkses9
514,325,531 *3485ED108D0A15EF5128136BB9AB441A26A6E4D7 towngirdled4
514,325,532 *348DE2816A564932F3F3D2D46173F19BC65984E3 TOWN-IV
514,325,533 *348E43A528B6BF3066BD492C6B8B10C946B6C527 towns7.47
514,325,534 *348E92DD6D632C971EAA65BE8C73DB6AC70CF430 townsboy6
514,325,535 *348786F2BBF2D7B700EC8FBE04781E0ED65135D1 townsendvi
514,325,536 *348CE6E27ECBA4B088F0A2BB97FDEF51D561191B townthat3
514,325,537 *34839CD1432240072D1458682CEE5519349C2AB1 Towny123
514,325,538 *348BAAE2C6C795626B352018A8A75A0E4DFE2623 towrs1234
514,325,539 *3481E0DDDEE5330EB5D8A098B19690BADD6D7DA5 towziech
514,325,540 *348599D005DC6B0341667C41F670838F4B1BDFFE toxemiing8
514,325,541 *3486EF518ACB5F6F12E3C27F3CF1522F65F43091 ToXiChaOs
514,325,542 *348D9772E5C25121FD3321EE6F4211B3D4B66BF8 toxicit
514,325,543 *34809623BD0845E62D63A3F761C3708DD2F1763A toxicoph4gou5
514,325,544 *3487D21490CDD9F39C4A9AD18C3403CA5C3FE1E6 Toxifyin0
514,325,545 *34859AA777478DB704C36576C0ECC3534B284192 toxigenics4
514,325,546 *34899FF01BC54274AAFAF196D682E86541640A36 toxikfb123
514,325,547 *348417E393F0DCED9ED879D4C07D24E9336D4E98 TOXIRIVUS
514,325,548 *34828A9C4FFAC5208FC20FEB3F9B621DCE4D7A6E toyekhiro
514,325,549 *348404405D729A2A1E8407CE530601A4F1A91E77 toygan1
514,325,550 *3486BAB15BB48DC108D930DAFC85A8B70378D472 TOYLESS4
514,325,551 *348BF8BD16B47707104C729ED6295D61F7E406DF toymemo05
514,325,552 *348B25C5EA579B339E41214FF66B7D0F129A9C46 Toyokazu1
514,325,553 *348BFAEBDC8D0E0E51438B72B7EBD32559E460CE toyotabridges3
514,325,554 *3484F92B8C2488457F1952284C693945E4013AA8 toyotacaitlin2
514,325,555 *3483D18EE3C160DC239DC9E22F3D25A059D86B77 TOYOTACLIPPER
514,325,556 *3486B8166D6E748B692401EE53EB5452EB79E664 toyotadesign0
514,325,557 *348CDA7199D7E5ADDE4FEA908AD4E7CD9E299254 toyotamarie5
514,325,558 *348C1976D620A39FA62F8AB18EA996E95AE12AB0 toyotanat0
514,325,559 *3484DC7B4B695C146D241B51F3984BAF8451CB06 Toyotapanda
514,325,560 *3481EA21C2C0075D092F861828C930A3F1E578CE TOYOTA(トヨタ自動車)とトヨタの販売店がお送りします(しました)」とアナウンスされていた。
514,325,561 *348394AB5A6CF935A8FD0416C4E32071A7CCBBD2 To you I give my heart
514,325,562 *348AE1DF4688E9E21EBB7EA6994A563F16B41FA0 Toyrismo2
514,325,563 *3480F1DF6CB8DE2F46C3A80FE5B8D482CB3E46FE toytacy
514,325,564 *3483610E87E6A506DBB16D68DE0D456274DDAF90 tózai
514,325,565 *34867C99ED47095CA43A9806B329F07AF7F4A32C tozama-d
514,325,566 *3481BDA26134FE733C7096B88D65457BCE6C3B79 TOZAQT
514,325,567 *34848D5D5EDCF4F0329DAFFABBBBE4D6D9A3DCA0 Toze.
514,325,568 *348E784C0E4ADED3E26F9059E2586E4BA5E90B98 toziente
514,325,569 *348C7C2232B8026A1E16ACF33036B6A482F901E3 [email protected]
514,325,570 *348390D864675DEA1E1BCF0A4872D862D0733BBC t$p{
514,325,571 *3480FF7BCE54763F8C184ACEE7243F2894DA4F6E tp10000nl
514,325,572 *348920A898DFAACC8D370C70061F1781F14DAC6D TP1j9l6gAJTtLkQ
514,325,573 *34871DFC43D272F4C77AEBEA7604B5A6C445F719 TP53I8
514,325,574 *34844DAF403F14B64EFCC901D4CE182314A18836 tPA\
514,325,575 *348FC6B8D7C5ED6742A6AEC2AC3BA04F842FD914 tpabatac5
514,325,576 *34850701072862227C4B3B4F9B3F1A76F0DD311E tpaneled0
514,325,577 *3480BAC51C72B10A2EAFD268ACABCA9B8D4CA689 tparitat6
514,325,578 *34812F4B2DE5493BB52B82A4773FB730CDDEC0D6 tpauperiser
514,325,579 *348666F6D52F96F10B17F8CB02BEBA8947C8AAB1 t,pD
514,325,580 *3487FEC05FFA6101CB14E3A70C3AFB0C36EA6723 tpd]
514,325,581 *348B4020CFB87BDC9C3E7FFB033EAC9A0C7ECEDA tpecnocsemaj
514,325,582 *34813EF138839FBE613683FD4889A256C15B91F5 tpeertsegnaa
514,325,583 *348D42FE4B4EDA2D4CDBF3337E56C750491A5BF9 tpeertsegnaa0
514,325,584 *3480F6DE58FD2C332EC8B7E35E6EF6AC4B738524 tPEJ
514,325,585 *348FC94C8B44A98BBFCE4CC68AB10C9728BB7D90 [email protected]
514,325,586 *348C973719B2B141C4EB04FBB78B208B1E19BABF T-Phile
514,325,587 *348812EB5A2ED3A59C8160CD374C5512F97CFBB7 tpickettbsw2
514,325,588 *348FC4BBA702126C77AE93A341A704A44DC9A1F3 Tpicstsop
514,325,589 *3487ECA2DCC5AB811AAAD521D3D6CE86B2BDD6C6 TPL330
514,325,590 *34840AB50943FA9410F9CC41E22610B969C6F6CC tpletsre8
514,325,591 *3486CF97084CB97083066C96B60F5F5CE4D3667A tplspecials
514,325,592 *34825AAE60A448E56016061E9CFC5C86D869C457 tplx4031
514,325,593 *348B2EFED1688D6FE6DF816393855647626C74F4 tpmalkegnaa6
514,325,594 *3486F21984C9E79D2751DC04FED15DB7C9428436 Tpmppmpt9
514,325,595 *3480EC818EF4A79791A52799C573E8B7E3C0494C [email protected]
514,325,596 *34821D7374533C10AA2B65C4E6739B8880E703A1 tpnmsisildh3
514,325,597 *348B3C3FF0590CEA2679BF426030F5B35BF714F2 Tpnymcl2
514,325,598 *348052E57369A0C8C2C5580A263E93CDE2F4E743 Tpopjian1
514,325,599 *348E9B506512CF9217146FE226BFA5063F567417 tpordegging
514,325,600 *3489469ED3ED821BCE3048B18C23E3857624818A tposited5
514,325,601 *348F2B58DF95353FDF275FE54B4A40F558E4175C TPOTENNIS09
514,325,602 *348F4900242FE37C1EFB6E38C4D4B7D6B3E170A4 [email protected]
514,325,603 *3488BD27832B879BB8B4B8A67B6251580A5835F1 [email protected]
514,325,604 *3488B9E861427F92D5B8A6A2DBA81B49D3C6152A T!PPA8L3
514,325,605 *3485622079FE70C3A2AADB1FD5BE5FEC4EFF42AD tppalkeguz7
514,325,606 *3487F2E0B1BC5F541AFBFBCE4B8FE563DD3490CE tppalkni1
514,325,607 *3481B26299CF01611515A2A0ACD2023BB48A5416 tppxbsw5
514,325,608 *348CB5E3E62A2C914A62221228856CDCCB9227B5 tpq2388
514,325,609 *34865CB921E979CFEF6E22A907C6F8C72BF41B0C [email protected]
514,325,610 *348D1281BF227BD8338666980063B140F01071D4 [email protected]
514,325,611 *3487BB27DB30350FADFAA9B0E2EADAAE70BCA345 tprosba8
514,325,612 *3484AA231FBF0F1034CA13A0981D31BE8F2BF429 [email protected]
514,325,613 *348E26657780BB6FC658330284020B613D4BCADD tpsosnowiecsosnowiec
514,325,614 *348198834D8093D59D46CFD3A24727DC9ED84E35 tpswyepl2
514,325,615 *348CAB5127E2582D7017A1788CE054AC544CFCB7 tpsychrhythm6
514,325,616 *348E4AE3D224DA4C4CEB7CDB32D46D95EA7B27C6 TPTLOVE1
514,325,617 *348C0AEDECC2362782B54C2563983F2627100BF5 tptP
514,325,618 *348615AD51DE67E1D2BDA0A5C888A3F03ED396E1 tpU^
514,325,619 *348E290B7DE2E005E6CD26132AB874C16B6A151B [email protected]
514,325,620 *34820F257456C89DBFB5C2F9E41FDE3A549ADB54 tp"v
514,325,621 *34870DDB5AEFE40526D672EC05380C3BE8669902 [email protected]
514,325,622 *34873ED7CE81B111C1973EFF22B197416F768139 tPW3
514,325,623 *3483CF2EC221ED4770224FA6FDF0D8CB1D5BBD69 [email protected]
514,325,624 *3480161CFA8161E88F4A42F36AACA7D036A8CD60 t?Q:
514,325,625 *3482A0773502576D3D309CC193DBA5E6A1304EED TQ299800
514,325,626 *348992CC4A35721EAF90221E6EDAE3AD0FECADCC tq2d
514,325,627 *348E45018818B4D075351AC437DAB48972652936 TQ5304
514,325,628 *34802D27F93FFFF1BFC3CD855E9585EF1EDC66E7 TQ744674
514,325,629 *348DFA110F4740A838F1839274952823B4398E36 tQA-
514,325,630 *348D67C077E4FA7DBA61BAFC95AD1146573DF6D6 TQBg
514,325,631 *348125536232623E897B9710ABC1577A91233622 TQCFJCEC59
514,325,632 *348958FC8D083F9F624994F84FF4353043F20F4C TQFXMIBS3
514,325,633 *348A2CEFD3DAEE792C71901F6E87C6D177144D2B [email protected]
514,325,634 *3483769C9020CBE89D26B62F761333F2BC299F79 TQoYUAbS58
514,325,635 *34867B8C85B62359B51CCBAF786D18103EE85B23 tqpaaa
514,325,636 *348989B4917AC9D1E6153DDB5751782F89B33F10 [email protected]
514,325,637 *348BAEB0E387FAE90DC146931049293187CAB5FE tQuz
514,325,638 *348E5EC3CD826892B2A645890463EA38F7302EAE [email protected]
514,325,639 *348A5DC2EC4E70A6D7DDECF1E38BA822AEDF03E2 [email protected]
514,325,640 *34895B66CA9B9ECCA1853BCF3261C5C069915457 tqySCWE17
514,325,641 *348E473BB524C65E19E3343D8109830F1976FFF4 [email protected]
514,325,642 *348E9DDC16662F138E83F244FA80FE2577723E26 Tは、R
514,325,643 *348E9E75AABF280932FE20F3D54A9571322B0E7B tr#-
514,325,644 *348368FCF683BD968A45076C4C2143AF1AAD4DBB TR0TT3R
514,325,645 *3487705090F27B6E772F0920263D0EFCB0AF52E6 tr0ub4d0urism
514,325,646 *34866A1D17857C72931FF886A6606301BAFBD6B1 tr0ux3r45v05
514,325,647 *348714DA196A58DCD6E6C8BEDCE816506457E3A8 TR19
514,325,648 *348EB34DBD0EFD513092F68E5B2BA64BF2C672CC tr1c4c
514,325,649 *3480082C6DB076EA60884D0305EC7F77D5299ED0 [email protected]
514,325,650 *348573358428E1A40E50937D9947954F51EE8150 tr1ntl
514,325,651 *348CB4678458DBFD0EF9B938A3BBF3197FE03038 tr1p0l1t4n
514,325,652 *34897CE8B48FAAB63863AE89C9B4E3B610732A38 [email protected]@[email protected]
514,325,653 *3489F6B18763DA4477FA40DCED105D7CCCEF27FB TR290PK
514,325,654 *3483F271B857626F0FECC20B386DE8F5104853AB Tr33b3ard
514,325,655 *348A9A91C8A7C5083AD89D442800977A4BCF79B0 Tr3stling
514,325,656 *348CFBAA6CF82B0AEA9ADBDB5F96795E64C4DB46 tr4mborn3
514,325,657 *348F51A42A1A103A669DDBEBE0E6CFE2B8AB92D1 tr4n51g3r415
514,325,658 *34836F61428C8023F95F4CDC920BD636741F5B4C Tr4n$c014
514,325,659 *34815C2F2A1FFCDE66850D905DFC644494F7273D Tr4n$col4
514,325,660 *34885B69678B0EF784B0FD9E2C467A3DA13B9CAA tr4ns1tory
514,325,661 *348F79287611E0DABEAE770F5C22890DFF796F2D Tr4nsport4b1e
514,325,662 *3480897EB1C1859EB934BB0DEA54C8B00AAD4C88 tr4nsur4ni4n
514,325,663 *3483717679101D87D7E80F705A664C5C964CF95E tr4um4t1z3m
514,325,664 *348833076AD7F438862269F1DE83498B872512CF tr4v4rs3i4m
514,325,665 *348B9F0BF08977F7381AB96C1E7C325DED6EEAA3 tr4vi545te
514,325,666 *3483375CC86C99D4C846AF0D58B581D8D1E2D1DD TR4VIS
514,325,667 *348CB32EE39F299472F290EA07E6C5252EBF7376 Tr4wl3r
514,325,668 *348C08CCD87ED9EAB80373643E83FC5C804B91E8 tr88.231.139.178
514,325,669 *348D429CA40BBBF7E29A83B8DFF82AE95C69D476 [email protected]
514,325,670 *3480F9E29DB21038BDEAF0394F39F6C67D5AD3C5 traagzaamses
514,325,671 *348EF68AE7EB243DA5DA3CBFBA21F88B87953729 traakbew3
514,325,672 *3484436E6BC7DA5A7F9DC7E913A8D23048B02CC0 Traankoker8
514,325,673 *348E0C013ABCE8A6CEABC5D0476CE6888A21741A Traap
514,325,674 *348E53EA76AC72DEC638A2F135AF3C287C9E12CD traatseoed
514,325,675 *34876B8AF4DA1B8DAF2E21C649DE6AF6641B3CE8 traavgnir7
514,325,676 *348DDA09F1E3E67EE27E69EDCC08C11342CF39F4 traavthcul7
514,325,677 *348D8AE3F327475B1F31937A195A88F6B542CA10 trabajadorestalkcent
514,325,678 *34824FE43BC8953F60691DE94B712F7703AA7A03 trabajaores
514,325,679 *34882C0D6B5FB1B9BDE1F08B436CC6CB03F00395 trabeculus1
514,325,680 *348572DCF36A510BE1B5692164848DB25C9E958D Trabendiste
514,325,681 *34803A4442A52C97EFEDBEF41FBE413CBF1100D8 TRABOCCO
514,325,682 *34861BE51158A2F26597F9C895CA6AA886FD8AE4 trabound4
514,325,683 *348D2086FB095FBAB437AA5145AA48441B286CA7 TRACANNAVO6
514,325,684 *3483C9AECA8DF85A26AD3544914D4CB8CFE117D1 tração
514,325,685 *348863DB0A7D4E4C374C3788AF1633DBC6598EDA traccialinee3
514,325,686 *348C27D1DEBC9EDC8F623CE63D76E838F0E8E6B6 trace381
514,325,687 *348ADDCE18B8E584E25DB437191A752A810A6C73 traceguyton
514,325,688 *3486970278A3420BADB57C91758594DFCE262363 traceyannesaucy
514,325,689 *3488105BA2F032AE644721F96E5B10B981570587 tracey.bittenbender
514,325,690 *348A17D90095BD45DED255E6A4CA60519730F399 tracey.bloxom
514,325,691 *3486233ACBF549DCDAC80C7D8641DCA8BB7F4810 tracey.buszak
514,325,692 *3486213111BAC7AE14C74D82445CD87D3F192AA7 tracey.canlas
514,325,693 *3484B9AB27C14400E4EE62183BDD9FC76E6B4B7F tracey carmody
514,325,694 *348D18C4AE00D82046586B55F5123DAD588B0F15 tracey.carovski
514,325,695 *3485803207580B337B132F3097723A8D582CA090 traceycarrington
514,325,696 *348FFC86CD4F32503BEBB7D26B6E287BE639E474 tracey.clapper
514,325,697 *348587917EF3BD5998028FF2E4865BE2980C5D3D tracey.copa
514,325,698 *3486865C467A82D9F1CBC66F59DAB9A7837804A1 tracey.crouter
514,325,699 *348A9DB0B36EE983729BE90BEDAD60B228D53C7F tracey.dambrose
514,325,700 *3485F4E3F59A2250B6EF288D8126FAAF71F66F4B tracey.deimund
514,325,701 *3487CCD6A2EB580530A9ECEEA37F9E4088A4E6C7 tracey.denard
514,325,702 *348BEC3B6784803A6447BB82A81826E06A64D0D3 Traceye5
514,325,703 *348FF9D9CA85A70FA13B9C66E23B356E5673B63B tracey.easter
514,325,704 *34883A2E173532A628CA5C7970BD09E3EC59A788 tracey.eric
514,325,705 *34820989A66453E55F0FE7318C114800C449D425 tracey.forlivio
514,325,706 *348ADE61B7D0877DD232A9AB564629A13A3163C1 tracey.hybarger
514,325,707 *348B174A1F37550879D314166DB77CCFA455F1C4 tracey.launt
514,325,708 *348C56805E83F35B918849C47361F807864CE155 tracey.mcelheny
514,325,709 *3488B4FCBFA07C95BDF5617383770D038B028B89 tracey.mctiernan
514,325,710 *3488E1D618CDC366D72F73AA781970BF560FC7E3 tracey.nakashima
514,325,711 *348D6FE563C649A8D23444D47DE6890F5EEA0BBD tracey.nyreen
514,325,712 *3486673B037B97D72F564A38F5B4B111B11E7C05 tracey.rechkemmer
514,325,713 *34876424377E50A52228E71F12C8970CEA6BDE1F tracey.rehnborg
514,325,714 *348BDBCAC34A0299E7405A85D5A0C47A8EB7FE3A tracey.schoenig
514,325,715 *3480BF436222ADD9B0D99DEAFBFE1BCF2D270B43 tracey.shiffler
514,325,716 *348F15069B2F877B3A752BDCC6731BA73A68E4FD tracey.tarrenis
514,325,717 *348E81F1C0ADBEA0FC400BB4111814953427D1B0 tracey.tramp
514,325,718 *348547FF23289F0173E2CC5202A4A7435F3A3FE1 trachelocyllosis1
514,325,719 *34891709600AE5F45E96ACFC8F46A20AB5DC5198 TRACHELOMONAS
514,325,720 *3487DB9ED397C56A7A97008CD8F6B7F816483262 tracheobronch6
514,325,721 *348A652554559ADCF0551CA1956BED0EB0A1DD57 tracheolingua5
514,325,722 *3482F4EEC99123D8FBBDDB7DB72F957F5B4B82DB tracheophonesis3
514,325,723 *348946903631522FC132DA43F6C736879A108E37 trachim1234
514,325,724 *348FDC15F7A95E8BFB8FE2D06E1B2AE94540DA5D trachio0
514,325,725 *3488C13766B662662A25EEC8C42390157AFEA8C3 trachtigerer6
514,325,726 *3481FE14C5D353C90395183C862E34D343F81211 Trachylinae5
514,325,727 *3488B1DF0BF47A3D10F45F8F5952641F92E0304F traciemcnutt
514,325,728 *34880AD49524EB8A15D822A09EFA0CEAAA0AD6FF Tracings9
514,325,729 *3484EB1D0BAB2971BCA149681FB9AEA82A229B5F Track Fifteen
514,325,730 *34894989B118070FD1EAA419EB209AD19D484942 track_insert_quicksh
514,325,731 *348AA20A08894C87BBA98B163E3085707BD157A8 TRACKM3N
514,325,732 *3488056F779F74CBB8968D1883FAEA2E6A7B5B7C tracknetsest333
514,325,733 *3481E4D22336B532B2C5E4228121ADB5C34100FF trackoven7
514,325,734 *348377B94EE22A8E8B3C0D73E451E200AF378563 Track’s
514,325,735 *348ACC1A2AEFEBCC393548290FBF493BA92D643D trackslist
514,325,736 *3484C3B1855C7F130ABBAF61A8B4ED6A9C3A1344 TRACK-SNICKERS
514,325,737 *3485BCF52D070AB38620563BF3106E44CF43EADD tra''-class
514,325,738 *34873E8164E2099747F10014F19CA73D5DBB47B0 tracolleresti2
514,325,739 *348337666C180073477B062ABC030FC8BFD8E926 tractarianizes1
514,325,740 *3489BBFADADCA77855B602246C817C488F453E7B tractoralyssas
514,325,741 *348FB64AE587DA80AB378DBEE47F4BBCB8A38727 tractorarizona2
514,325,742 *348F091D39C2F1171E9C238756C9EE8C2BEAD551 Tractorbrowns
514,325,743 *348B0F1E4654B77543AADB400C84DFAA3A79F050 tractorcenter6
514,325,744 *34860FB73A520B12B46EA08F5DC729F8B4047F0A tractorcomputing
514,325,745 *3481EB5604041C182E5DB71F8BF01C26F302C291 tractorcrows
514,325,746 *34896BC9316CDA09028D7B91799FEAF44B9C16D0 tractorequipment
514,325,747 *34836AD6BD8CE8F0110E9C17D2522EB5D654459B tractorfred2
514,325,748 *34806C72B29A5772357EA649D27D14F5D083792F tractorgroovy9
514,325,749 *3482E91A379508A00B7EB44E9F022F6535C915C4 tractorgrumpy7
514,325,750 *348A0F81B225C2222D045DE5632483B17B81B3C0 tractorraven8
514,325,751 *34897A407A36BA6A72BCE369A99A5A95FD7BE99C tractorricharded
514,325,752 *3489CDFB6B6BCC6D6A5A0355EACF50E93C07882B tractorsalva3
514,325,753 *348C70C3F3BA294AC613073F5928E3782C4FCEF3 tractorwqsbbed
514,325,754 *348AA6EECA831C7A73C83FE4CB8A89F619640B87 tractriz
514,325,755 *348AB1F5289DCF07D42F25B2C1B8C4CDF52DAB73 tracy.alesci
514,325,756 *34813C7B5D922990FE7A23399463A6AAF9E56A5C tracyaliensed
514,325,757 *348AF096052C1C2D4A5266FC5A15BC5131990D6C tracy.alvirez
514,325,758 *34866D98A51224F6CDC8940D93AF3AF7E0169622 TRACYANNIE
514,325,759 *3480534A3DF978B14E2649AF02D2B88067BE4946 tracyattaway
514,325,760 *3486726D9012FC67D15F4268D32FC72336829A54 tracy.aversano
514,325,761 *3485CF65B1D0F2C29943CE0AD04D537B4473064A tracy.baltruweit
514,325,762 *348A98CFC4C6D94F22490A890643C1D8720EE13F tracy.benezra
514,325,763 *348FF16F56E8E9B1CBC7C8F28D8F35E66E56F242 tracy.birr
514,325,764 *348E9E403FF6646B48FF1D1DFC8B8E64DDB86E23 tracybob4
514,325,765 *348A2C26C88E22A2788DBD1185DD13B0D5B55E54 tracybolger
514,325,766 *3487D8AD494449CF5396F1A13043D5F667974BDD tracybuffalo6
514,325,767 *34862E7855DE0EEFDA63B7AB0B84D156BC9B2200 tracy.crismond
514,325,768 *348750E3744A8F45B28BABA1E46E621BC44C0020 tracydexter8
514,325,769 *3482463F16474E3EDD4AFDD58B23D375DB2EE718 tracy dougan
514,325,770 *3487C15D637F013410F9E3CE70D8F421CF22257C tracy.espina
514,325,771 *3485B66E1BED06A7708DB5ED580ECEA6B4711B97 tracyesweat
514,325,772 *348DB3B89D69756CE1D2722249FEFC8EDD3208F7 tracyfootball6
514,325,773 *348AE1336E291F7FADA3A31FEC835F50A8BFB961 tracy.havely
514,325,774 *34870C31C07BF9928E99673AB244F913BE3EFBF6 tracyhawked
514,325,775 *348E9CAA78822C59AF41E96B1921D13A7933A136 tracy.heaston
514,325,776 *348953C878DBF79ECAC99F4320D34CDFDFB557A9 tracyjohnsonmusiccomnews
514,325,777 *3486A74A4CA68091989133B627AD1A9B15A3D1F5 tracy.letcher
514,325,778 *348307AE9C1A7598CDB7914D639E0CF6A731764C tracylineberger
514,325,779 *348AD22E827C93E4B13E9BBB10658361A3914CC9 tracy matthew
514,325,780 *34817E76B83D0F33F04D98A1DFC6F1EBC8EEED99 tracy.mccarrol
514,325,781 *3486F0CD359E900C8EC663BE15E6FFA896304D6A tracy.mcnees
514,325,782 *3482DC4F82D7252EA790201BCF308F7905818496 tracy michele
514,325,783 *348AEB18396EAE354A0A5876733B4FAFA96E1F15 tracy.moehring
514,325,784 *348F1B8894ABEBEA16706CF0FA60012CD11518E1 tracyplasky
514,325,785 *3487264E423065E98432A217F6FCA47025D77454 tracypromethe1
514,325,786 *348BE9CF56BE952A4EEE30F486EBF88001588D76 tracy.reyelts
514,325,787 *348D0CB8C4C8A28C6E3081B12384055F051E5FB2 tracy robertson hansford
514,325,788 *348B7B6726E096FCD70508DE8C682545E74188FD tracy.scheffler
514,325,789 *348A1FDA24E0A28AE62D9C033580028C3B5CAFC0 tracy.schillings
514,325,790 *348861A21940CB7CBA4EF7B2BB3593A32F843C7E tracy schimp
514,325,791 *3487DC0B41169CAA28618E4DFEB072575DF3F10A tracy.schnorbus
514,325,792 *348AF3D14B97ABE6A5D63D0C7F46467F06CFEE5E tracy.schoneck
514,325,793 *348E227DEF19279F8B289667C29B0B4D3D250795 tracy.sciarretta
514,325,794 *348520C343EA30A841680810CACA789FFAC78E1B tracy sistrunk
514,325,795 *3487FBBB6CD06A6DBF19255DFE4B865945CFD5F2 tracystart7
514,325,796 *348270AAC74548AD85741FA80564FC9969F72FEE tracyswede
514,325,797 *34826A4674CE09C8B9E629D629D834BEE7F3FDCC tracy.thew
514,325,798 *348F26D10FC9E3575F6304DC700D15FCFA0EF66C tracy tyrone johnson
514,325,799 *3489AD6F44FCC47BD32B41BFA9C5C46EF6F62471 tracy.yuenger
514,325,800 *348EFE849BC56DA6127196CB00FF87FEF2505EB0 TRAD3R
514,325,801 *348CFE8DE6E8126B5F5A8CE9B09214C6A4861188 trade4all
514,325,802 *348ED90F7F0E8ECAF8429B1905722C192C28A459 [email protected]
514,325,803 *34828405BC589053B29F014E8E837CB6F94CEEF5 TRADE ASSOCIATION
514,325,804 *348E300F5ED8C50EEC66820088F931CBD9B51173 Traded0
514,325,805 *348B58E27A0720DF1C01F94DFDCA03830FA04D89 trademarkrib1
514,325,806 *348BD4A293EF154A0CD167A5CB4EE2F4F595F184 trade off (a)
514,325,807 *348057A9ECC4B358ECBC1AC6B2D810047D1703E8 trader.3
514,325,808 *348AE0581004E0D522226514DC551E9990FB3BD1 traderfield6
514,325,809 *348A7B026562A259F0B119DF0BD77E5905B70E8D [email protected]
514,325,810 *3481E2EC44B0B29C7C0137608681ECBE26F5F212 Tradgicing
514,325,811 *34881C297B3FC409AC00DF0042E9858B06B00E65 Tradice9
514,325,812 *3481D928A400B6A05027C4C7453AFB2F3DF4978B Tradidit9
514,325,813 *3483D71F592E7856748BB29B30F2053715CCBAE9 Traditionize.
514,325,814 *3488D65A30D70E3133F8F9D5038063EEDD9EE3F1 traditionnellemnt
514,325,815 *348A20801B8B84ED037E22F4A540719C924F0C28 traditionsrig7
514,325,816 *348FBC29E3C164F0DF7ABBFA6AE0B5B4D41635DB trädlöst
514,325,817 *3485678AD8BDDF2753A8361F6070B20144E477EE Traductrice1
514,325,818 *3483C139B23D170E65BD52F8AC1FA018D5BD2572 tradussi2
514,325,819 *3489F2CF1E2F2B24FF72196F90BB14D488A535F5 trae dashiell
514,325,820 *3486101A058FE232B21F80B7486818FE60301895 traegerlose8
514,325,821 *348FCAFD927D2F5EEBC6F52B818576634BC5D38D trækirkerne
514,325,822 *348681AF3108BA81A235B02C2E327C155714F957 Traengas
514,325,823 *348480B62575C96D15B3C4C026298D3CD48A5A72 Traengse4
514,325,824 *3484F3F23E01F808B6761A239D620A34F1988BBE TRAEUMER7
514,325,825 *34832114BA067F19E22D689EB69D6A42976C88B7 traeumte3
514,325,826 *34877C29B51DEE1E6A076B8252CAFFE06128DFC0 traferitotied
514,325,827 *348CE61917423CCC5DC1A95725F6E99D5BC8DD51 Traffarch34
514,325,828 *348DBBE154B10DFFA57BFD479DDF86328148C0D7 traffic weaver
514,325,829 *3485783CB5CC920F40B69D4791F78C645EB7076C trafikable0
514,325,830 *348E3BAC2AC13260DF2B04125B70A71888DAA462 trafikministeriers2
514,325,831 *348679A9EEA1566DE4800B104CBCD635CE7D268C trafikpaketen
514,325,832 *3488F6995B6089DD9AE82678F839F7A1887CE54E TRAFKA
514,325,833 *3482DAAE6D73EF412544317ED4DE1F0544CEB688 tragdlih9
514,325,834 *34816E44E6ACE27B70B4EACD453C1FB533EC0856 Tragenstangen
514,325,835 *348F84093625429771216FBA603ABCC01F2D6A0E tragerblech0
514,325,836 *3484CA5A5B8853C46A875C7326E3D5BC3ED350C7 trageser.com
514,325,837 *34822B8FF6F62DBFC18ADD949AEE0009A7AF1D4A TRAGICOFARCICAL7
514,325,838 *348757AFA4204A2DB6185B2ED38A0146C878F758 Tragikomedier
514,325,839 *3486BD17BF9EF92011C014F4697EC3DFA90C9F89 Tragitto1
514,325,840 *348A5B1BE1B3DCCA87F53E53AA0D3C43A2627124 tragny
514,325,841 *348F7EAA1BE2D29EBCE37F5C5FC4062014D5D4D9 tragocdias
514,325,842 *348A9DCC02178AB348CAEA3B47235AABEC16132D Tragonia5
514,325,843 *348E1A6DBD90A647D3773C0546BFE651F1CA6DF7 Tragovaed
514,325,844 *348784A8C911047C960E192622987D160D08333A Traguardo3
514,325,845 *348FF4018324E7A5A2253758D885AB467A532684 trahensque3
514,325,846 *34842E7066F970B8D58D68561E8D40E3807BA80E traheron
514,325,847 *348789325C567BDFD204A56FA0EB1A4FC7729E97 Trahirs4
514,325,848 *34859AB15806E2F0F161994F546FDDAEAE3F5676 trahnier5
514,325,849 *348AB85F8F75E43CDABF14D14DC50EFF6510692E trahniering
514,325,850 *3487A2E01FFCD3E9D17083891F183D0BF264E4FA traiecting
514,325,851 *348AABA65000FB03FB23BB51E14BFF8B2A81A975 traieth9
514,325,852 *34890BDFF2D7D07D340BA63589C6E25F6182E9CE trailerboat
514,325,853 *3484BDEB5B4B6FD854113BE418DC9B0F2F951D93 traileri.t.e.c
514,325,854 *348122FB65A63C4A1ABEE0FA1A936DF67121B1B0 TRAILERVILLE
514,325,855 *3484A49F1D82F92E90979B8C50C91894CEB12101 traineeubiquitous3
514,325,856 *348FBB6FCD0F22940AA7C05062888B23B8E2AECD Trainer1234
514,325,857 *348B70CAF2E0F5ACD603AFAA9F5E6F1F6B9F444D Training1p2o3i
514,325,858 *348DA2365E07DA6AF459DBCB0A86C870A2227C78 trainingalyssa1
514,325,859 *3489275B0FEFC84AA0BF8D96EA36D68C69A54308 TRAININGBULL
514,325,860 *3483032E7B3B1B4E381412D87F062EE245DD02EC trainingcocacola3
514,325,861 *348BE40D8A44322C187AED19471338721D024EFB TRAININGESPANOL
514,325,862 *348ABF45EF4E89373D9972F7D1A615DCE8F88867 traininginventoryiterationmanualed
514,325,863 *34866456F0F69BCDDD6ED3F3060224FC50C881D8 trainingjenni7
514,325,864 *348F6335988ACCEC1EC5188CAD71634E5E36DE18 trainingjennifer4
514,325,865 *348B77C59F2D45EE909F10501627DB7EBB8328F6 trainingladybug7
514,325,866 *348CBF6CB987AC41F0D5C91861A3E175D7DA529E trainingmolson4
514,325,867 *3485FD092BB0148267784585DC9450ABA4B1F481 TRAININGONLINE
514,325,868 *3480F63998479D0891BDC95FAB5ECA8603147036 TRAININGOVERVIEW
514,325,869 *34837D1A0D44E1153E1267F73B5A3EAD306CCB90 trainingpeanut5
514,325,870 *348704E087E80AEEEFC5922DE4FAFA1D63A111FF trainingreefer1
514,325,871 *348937F546756A34FCB212092F6E369FF12BE8CF [email protected]
514,325,872 *3486D6135E08C289A62B6F0A95C1C35F2EEAFA64 trainingsstageoord
514,325,873 *348125753ADF77BDD4CA7EE7166B54AB980F5A84 trainingworsening4
514,325,874 *3483132C7C293A64D1E16455CCEAEF49CEE91E2D trainingxxx7
514,325,875 *3489CD1BF90B9F0F3E2A8641A238B3CDDB36F756 Trainj0218m
514,325,876 *34858F020CE6D195F35985426CE68407D3133493 TrainStationGrey
514,325,877 *348D469C750AEFA07C096A3193A86558AAE5794C trairetraire6
514,325,878 *3487E87806F9A2732FD0C4F7D989D121C028E95A traisitsirithanu
514,325,879 *3486058122EB7CFAAD1265C2D011950BF13EF2B5 traithro
514,325,880 *3486CF9771152127C083B8D613D8B14553436C45 Traitneuf
514,325,881 *3485F94B4B1157E3DC212B79DFB7FDDA3BFC33AE traitpeculiaritypenchantphysicaling
514,325,882 *34885329CB8B450527BB7A0CCFE253CB6D5A09E9 traitso
514,325,883 *3483D9731A7CFF54B732E585A83B4D0538DF1B2C trajavas1
514,325,884 *348B66FE880DC4851AAF6838F289D604349DE11F trajectory.2
514,325,885 *348B067F3D661DE4D9176B832DA4C56AFA25F1B5 Trajlib3
514,325,886 *34879103CB8B049AF7D6BB96F75398119B01AEA9 trajones
514,325,887 *3487CBF126F0DC12DFE1CD6B3698D87F6F880ACF trakindobsw4
514,325,888 *34888A69ADADAB9B9C487B9671EA2980DEE714F3 Traktate8
514,325,889 *348AA02713059AD64B2318FD6A7A11DEEF441C2C Traktatm
514,325,890 *348791C332238786714D35162884F4F3AAAA76C6 tra$lar3
514,325,891 *3485F22F78DEE94813043AF91D0064A4738E0C39 traleen6
514,325,892 *3485B3AF48A9AE344FAD9B081EF3092CD5322B3C TRAMADOS
514,325,893 *348A51121DEEF98D79FF180B50AA4102A87C283F tramarensing
514,325,894 *348B3DFFF17598134A38FB60E15D9BF190796423 tramarían
514,325,895 *348DADC92D821727DD9CAF7ADE2EF53876649194 TRAMASSIMO8
514,325,896 *3481F0ABB95F9E10533B7C2CD6439238B1146D61 trambolharlhes1
514,325,897 *348C38FAD961779D996DF126899A67BABD7B3DD3 Tramers8
514,325,898 *34853BD255D469A6970FD6A4DB7E5C4DED688482 tramiez0
514,325,899 *348A6E84A0C4EAF3E49FEF3C7505836637A713D2 tramonses6
514,325,900 *3484F0E9F4C90AD76D8E47851BE93029C53FDF80 tram phong
514,325,901 *348D75F200D4046A72B0243CCCB179C882E32E1B trampiskeller
514,325,902 *3481F398A63FA9F100B10DB8A18E398DCC373532 trampleds5
514,325,903 *348FDD86A594B5378E358FAEFAA2714F90D3B5C5 tramskool
514,325,904 *3483E23736E6A742BB88B6B71BDC8D18D8B1B141 tran5ver5ary
514,325,905 *34886D55E6E96C7A8DBBD4667639A05F7CD1BB04 tranavisseque5
514,325,906 *348ECF4EBBB59CA612B8D7842B8CD530F200464A trancarmeei1234
514,325,907 *3483F20E0C1493138A04643C4064ACF535CB16B1 Tranciavate
514,325,908 *348FC48487327EE26C8ECFBBC82608988FC3D490 Tranckellska
514,325,909 *348430A0A810A144490436368474230189C362B8 trancsemos
514,325,910 *348B1614C00FB878C4F1374E32F1183DE59F167F tranedanses8
514,325,911 *34806579A518F628FE60F674D6A8894BA3171392 tränenabwisch
514,325,912 *348B78B4CFC6EB024FA6AE9021521F2E872F58D4 traneraient8
514,325,913 *3482DEBFE63B3C8E12234FF5DA775B44E16A5D93 trangalangnguyen
514,325,914 *3489BB40B6F4FD2A180766CDD256E3C097D0E890 Trangram0
514,325,915 *3489DE0C83890BBE8AC52B4FD6316F556DBE69C4 tranice house
514,325,916 *348C3B53883953234DB92D67075612738C6260B4 TRANKILINO
514,325,917 *3481C7EEA81B17200D6E94A0A994720AE7738F13 tran kim chau
514,325,918 *348AB3D798C67713ABFB81325909DA269DE58E42 tran ngoc cuong
514,325,919 *348F1A4442064A291F1946FB71369A7F69382145 tranquilisinglY
514,325,920 *3480C946248EFAB536FCC791C4E0E89CCEB4898A tranquillino8
514,325,921 *3486E3507C5895C5F1508E45C97318D332D68AAF trans109
514,325,922 *3484B47D498B9418955513729943FD698AA3409C transas8
514,325,923 *3482E018AC4FF062C08FCD05AED70F14322AE205 TRANSBAI
514,325,924 *348F5E611167B048107BD188566DF73D492A30D8 transcending (into the exquisite)
514,325,925 *348E105D4721FD831DCEC29BC2BCEAD6C85AE478 [email protected]
514,325,926 *348A93FCD9F71D07D94B6EC877D202FE9DF40997 transconductancing0
514,325,927 *348D087D9927AA062C1AF6E9BCF5F6B5642C03CB transculturalismes
514,325,928 *348BE01854377CA8B046675A6A1C219ECD5AF360 transcurrentsing
514,325,929 *348249643A899B73DD16CCC4A31A0E7F6CF9BEA1 transdiri
514,325,930 *348A2422A0DF53911403AC51E91149846765D9DD Transervolo
514,325,931 *348C7E1396ADE5F85B0B35EDED5EC70F81241E64 transfas6
514,325,932 *34894761DA76F4F5297413C6EDDBF0A2A02C3785 [email protected]
514,325,933 *348B55C477168D5ADE8AF25E7CCA29DFB60AFFED Transferibility
514,325,934 *348DFE1D84EB346B63281B5F937726A5B911167C transferographieS
514,325,935 *3488D83D0A2217322CCF227B93D6BEDFA4C69230 transfigitque5
514,325,936 *348FB888AAD93A68C769D121496F744BB337AC76 transfixation9
514,325,937 *348DDE1C47784DEA7939101B9A20A7EF0AD8F193 transform1ngly
514,325,938 *348C422180AABCE4E7A6D896E7105A145D2B6E0D transformeront123
514,325,939 *34858CCAE45A82E7D78A2A3C838D88B3C5D7D8FC Transformistic.
514,325,940 *348CD3C05FFF5E9ACEA04BF6F6F20B4A3DBBF1CE transformmatrix0.500
514,325,941 *34839A5C95FC73859064C9171F8C31AD0CA208BF TRANSFORMSES
514,325,942 *3481D54620BD3316E61BD564AE979EDB7C110CB3 [email protected]
514,325,943 *3483C32D88D9199A7EB1FF3397B51F8E4971BB4D Transfusais!
514,325,944 *348C5DBD34E78F5B3E93BA20585CC3F84AB2B256 transgenics8
514,325,945 *348EB78616A20A02AD0A04663E0759C7D70471D6 transhimalay0
514,325,946 *34834D9E43C3F26CAA8540BB4F91A0071A93A53D transistorizeseses
514,325,947 *348523DE04F8F5B05AF12C90157E6C103EE307B9 transitabiling
514,325,948 *348BCDA90CF98190ADB1D90D37FE652B1D7B75D5 transiterezed
514,325,949 *3488F02316C360041BCA5B8A8DBB302AA0E60F89 transitifs6
514,325,950 *3489CB46DCD7356223ACFC4D8F50E1CA134DD7B5 Transit-Independence-
514,325,951 *3489FC9D22CE0B4CE6DF28CA95119CB5F655F173 TRANSITIVE8
514,325,952 *34854BD89AEB95D072496652323C248FA23A6BC3 Transknights
514,325,953 *348B8C12E6E6B1095401109E39BC76386B176023 Transkontinentalnu
514,325,954 *348C8382CE20AEB2E2E9E3165D7AB32F0DAE317E transkulturalnom2
514,325,955 *3481870B42F6B2FA4BD233A2B8409A575F14C08C Translatability
514,325,956 *3481B059410CFDA7398C8D0BC0C752754D8092BF translate.3
514,325,957 *3483742EBDA9B6048BDED16744A893AB7329193E TRANSLAY5
514,325,958 *34871953A2A1E413FEE57387D4487EF0A232CCD8 translucidasses123
514,325,959 *348794BEE7E23A2C963DCAFC1C16549BC2C37C70 transmale
514,325,960 *348BAD8E40B52282A85BCCC70E3BD9E44FE57058 transmariĝis
514,325,961 *348B8D78C22DAEE1E3C8C0104E2BC2F027496E8E transmarine2
514,325,962 *34859B7760BDB19A761F9B1BBE3FF5CADB8F69E4 transmettrez4
514,325,963 *348742591E70A6080850D4A81597826017DD9011 transmissibil0
514,325,964 *3482C91A1468F27160C9FE338003BF5175F1A3D7 Transmission Soul
514,325,965 *348AE106FB088CA5C83D7FC0CA1D733CD892DDC1 transmitter parts
514,325,966 *3482BB76B2E027B1169372EE6B9D65C9456DB466 trans-oral
514,325,967 *34899D7A2CB325D6D15F909D96DE05F818B3A0A4 transoxiana7
514,325,968 *348988A7F4C32C396B3B8A1F7541EBAD6EC78259 Transpalearktika
514,325,969 *348735B14358B937B52E3C67960095650AEC02E7 transparancybsw0
514,325,970 *3483F5D95941BEC17FCF86D0F0F1705959399898 transparency.iewww
514,325,971 *34854D541217EFDED2BE8B5A7EC9BB71176A2FF2 transparentet3
514,325,972 *348B18DBE50E0B7157B1D9C2ED724C4478078ABF transparenzverlauf4
514,325,973 *3481935E4370F4FB742758934962C0B5682CF4B8 transpicuousness0
514,325,974 *34891E67C87580EF68E8D36ADB1A9C33BC6EE99F TRANSPIERCE6
514,325,975 *3485D5D05AEB8DC3439DFCDFEC1FEAA2E3CE4F48 TRANSPIRAIT!
514,325,976 *348F1E3C5E725636BB6FA345CE7EBF375339729E transpireriez6
514,325,977 *348822742591A8CCD498494EFD2A5F48A4A61137 transplantfl
514,325,978 *348D92A08C9C9FDC89CDD81DB6E37326AC9F7051 transplantiranima3
514,325,979 *34895F4F0D34C47A4E7452C008D3D90D29D7C2C6 transponderabstand
514,325,980 *34831101B0231952AA6D830CC0A8B37A85DE4EC7 transponierbar0
514,325,981 *348A36C44445079E25C55968C0606A314573CBCA transportabel4
514,325,982 *348F709E21FB5A391E14B897E2C57CC3C55CC53A TRANSPORTABLE6
514,325,983 *348D3792F237ADC55AE742674EB1F2B44522A0EE transportedrare1
514,325,984 *3489C1DE7489699030C7AA9CE24CE61B569F5D24 transportemos4
514,325,985 *3489B599D65399A402663F0186BFADD9B38876BD transportgef9
514,325,986 *3488CBD945DB4650ADEDA8288BE4E425FD34CAA0 transporting6
514,325,987 *3481EA7A109ACDD4169050F81CE66685EA675567 transport me
514,325,988 *3488608A2AAAE4FA3F041753639522CC5B5AE40C transpostos3
514,325,989 *348DF130C0A53EFB34075BB441BAF12594055DF0 TRANSPRINT5
514,325,990 *348690B1A7984A8FE55BD2FB1184FC56910CFA19 transproofed
514,325,991 *34883F6E20B6C20CA746D87752EEE042654ABB6B transpusemo
514,325,992 *3480952E61DC74D4E173ADCFF884521F806BAA98 Transsahariennes9
514,325,993 *3488EE135217877EB8C5FC19A96DFE8B85E6E46F transsexualisms6
514,325,994 *348FD3EA6F01F64C35097958D63FF2089983DCD4 transshipeding
514,325,995 *348BB2767AC7A72133EAB1D25A4906DC1EAA3A26 TRANSSHIPPED9
514,325,996 *3481B1A07176F2103F92B19F2913A4BE02482D77 transsilvania2
514,325,997 *348069600DBBBFE076347A1A40242434B28A9511 TRANS!ST0R!ZED
514,325,998 *3486F7C2B2A8AE85EB82716E48B2723F45BEC456 transsubstantiais0
514,325,999 *3481EA31D855C3FFFCBDD8E6BE1B30FC83AFE1A2 TRANSTORINE
514,326,000 *3487E514C884DAEEA29B092179134489416CFDE8 TRANS-USA
514,326,001 *34834BBBACAE01457A75A5443B2D874A7B9C8DA6 transverse-cylinder
514,326,002 *34852611B2054A7B139BEF8DB8D48F3810E4FB84 TRANSVERSOMACULATUS
514,326,003 *3487F385091EE8BB10F5925A720CB875134747AE trantbro
514,326,004 *3489871CBB77536239737304C7241709A156226E tran thy ngoc dan
514,326,005 *348367F06CD381895808B3D545B6542BC093EFA9 tranversão
514,326,006 *348F877B06DBA95C7B1DEAB6ABE9FDEC8B55F399 tranzgrl1
514,326,007 *3485912F37A618D670710FF4B4B82342BE172554 trapani1
514,326,008 *348CF9A19FDD4A8A7699CA1FB8029B26991BDB7F trapani–lombardo
514,326,009 *348AC888308637D377D9061C56C327F62F99D2EA trapeltrapel7
514,326,010 *348B21426895A676739AEC9B67305DBB3BD82E62 trapendeavor5
514,326,011 *34846CC342100BD64EE7C1D3FAD9EA9BDFEB9FFF trapenės
514,326,012 *34893768976F8402E865C56959CC957180FB26CE trapézês
514,326,013 *3480DEBC182807D9112FFF7897BB6CB1B4A5EB1D Trapeziya
514,326,014 *348E9FCF8F36FA126BEFA2867FEB4A6756FC5D00 Trapezku4
514,326,015 *3483EF5F0AD9E2156CC29B2AE7998999534F30DF trapezoeideis1
514,326,016 *34839A321893438A999ACAD54559A4F87D7D60EC TRAPEZOID6
514,326,017 *34874CDD52539F34256F10EE2043C377454E0F88 trapnege1
514,326,018 *348181852D94C6D317680A1D11E849BC38E8F36F trappetroll
514,326,019 *348C6B99D8F662F13136F49A4F69596FF02D634F TRAPPNEDG
514,326,020 *348FBF891F2EE3529A7754C0B922E9913080BAFB trapungono1
514,326,021 *3487E309D5E227E58E8DD350A25209846D6BFC68 Traquerait6
514,326,022 *34853D492D707AE229CC8AF80832A7D6A2A8AFE7 Traqurium
514,326,023 *34832FF961B91C462843D0A157FF96AB21486F59 trarbach4
514,326,024 *3482D8DF753D6B671DE393D3CFC14DD347908775 Tras5
514,326,025 *34855B5C793D9672E14BAEC70A4C1F8F39C64840 TRASALIRE5
514,326,026 *348729EF6C2C41B02FE27032CED8E16F692D66D0 Trasanta5
514,326,027 *348C12D56FE3744E1DE306DCF826265DBBD23502 trasbordiate6
514,326,028 *34835B1EA088528F44F0DADD2C3836F5F3C567B5 Trascrita
514,326,029 *348384446D9286BE622EE4C81EF59E652C7B3B3E trasdoseara2
514,326,030 *3483885978691661D7DB2B5F3EA5F2DAA94960EF trasecendentalista
514,326,031 *348364E3AFF79B9364B185DB3E2F76E8D712A4AF TRASECHADOR
514,326,032 *348EF2CC6AA8F2C5B39511E2C2F7CB766A5ABF20 trasecolavo6
514,326,033 *3480FBD4975DC02FE3EBB2ED0A82935F88513C9F trasferireses
514,326,034 *348DA833018F3E51390E0D271648B64DC4C4919F trasformarer7
514,326,035 *348E251CCA7D13B813D77E8D8E2CEC230F007967 trasfusoras8
514,326,036 *348FEE94A58D6A08D7D128E073325F042E5042FD trashifies9
514,326,037 *3482820AF82D7BA6212203B3AB2A752E96DE1630 trashonda leneria coven
514,326,038 *34807AC156A485483355B6663DAB7F25F969D988 trasimenos9
514,326,039 *3484B23B391FCC08847E0BB6BE89A794BC826B73 traslando5
514,326,040 *348FCE2C6CFF597B71FED207015C4D0026CB2BE2 trasloar7
514,326,041 *348E295D7EEA96F6C564F41C84F3ED48AD1D6405 Traslocavate
514,326,042 *348EEDD3C193FC4F95DE0B5FB9FB72F53688F9D2 Trasnfers
514,326,043 *348CB9176E34A25AE8B36366D09D18C10B1DB5ED traspar1r3
514,326,044 *3480D5941E262A10266DE9DFE42974F06CFC14F4 trasparentarse3
514,326,045 *348B73E364E90F2878D5AA45BCD96E8FD413C627 trasparivoses
514,326,046 *348FC8379A9E98C5088700C850FAFAAE2AA94143 traspirammoed
514,326,047 *3483CB48E7401F77802C36E159F3A1166E6450F5 trasplanteses
514,326,048 *348B0FC5C1EEED86BA12145157B2871057B7BA91 traspoñerei
514,326,049 *3480F8505DA9FBE0939074691714AF0A9651A73D trastbsws
514,326,050 *3486F8DB11C0BA941E20DB152F25C9E42C34C14D TRASTORNES
514,326,051 *34809D2279735414BCDDAA96B6E4BCBA032F3AC9 trastrocis
514,326,052 *348568B81015BCBBC794DEFC3C0D14BDCFA2046F TRASVOLAVA7
514,326,053 *348590EDA89D206E20D377014BEDBEC0B0631655 Trat
514,326,054 *34852DC312A9EA0528AD65410853F60BECF67BD1 tratrix
514,326,055 *34867A20D8CD508A00AE9A037E9103931299F3AE tratsdecnaC
514,326,056 *3480B16EB1E4C170729F1CAE97621CD5DCF589FD tratsnosirrah
514,326,057 *348A8A6AB3394682F75883C1ADA56E031A24AB41 trattenerete5
514,326,058 *3488CC51FCA37896A4E63A6FA8CAFA21425437E1 trattenetevi5
514,326,059 *34865A1852D391E694F7F7194A50D6F47B1DC3A6 Trattere1
514,326,060 *34873A0CC372E2094F09805431C0980D35D50E24 traubenschalenextrakte
514,326,061 *348B783AEDB88B7FD15657CEC666FD1FB04E2ECC Traumatisar
514,326,062 *348CE00FF38F3C2B21ADB559E6AB5B05AB357DF1 traumatotaxises6
514,326,063 *348E5E2D3E281EB342EE9D948A41F478C5253E83 TRAUPE
514,326,064 *3481484B13E54EAF68FB4C6C83CED49C0DECFE19 trautsoiram
514,326,065 *348DE4426328A175767D68C5419594214E27011E trav3rsion
514,326,066 *3488F05E0A93EB80598CB276FDA46E5591B1DEB0 travanna deer
514,326,067 *3484BE58C43E167F008CC64408F6361FC9136827 Travasato0
514,326,068 *348F17B586FDC2AF2D4924F7E4A9B9236107CBEB TRAVE11ER5
514,326,069 *3488EB0E5837AA03EFBEFF9A2AAA43A769657ABC TRAVEL-ADVENTURES
514,326,070 *348FD2C6514764CE47568BEC656B6398C5BB0EA8 TRAVELBILBO
514,326,071 *34820D47B1D68BEFC78C660C160D06BFB629EF26 traveler145140
514,326,072 *348A39DF37FC7AFD617F09FF588CF5E925195142 TRAVELERESS0
514,326,073 *348E96225B3F8C813844F4FD6FF9DA81F2A4FE99 travelhells
514,326,074 *3487A6FA899374AFAAC12550E358AB764EE4D0D6 TRAVELHOLLY
514,326,075 *348828730FBEF3853A991EC502E78C67C3FB5044 travelinholland
514,326,076 *348042DA1572AAB8FA62E6188F9F37B3B0EB1C80 traveljeffrey6
514,326,077 *3489D33629D54FD674C72FE789C001DEF8EE76B6 travellemorecake
514,326,078 *348AD92FA9C4A6B896930E54B69E36AF61F3C820 travel.mareino
514,326,079 *34894A24AB2D630A03917FCC903D86CE35B93D2A TRAVELNEXT
514,326,080 *3484F5D873F457D319805953F4BBF54BC60C1798 travelpearling
514,326,081 *3480304B01B95B17EDBB79E724945E7E81BD8978 travelsamanthing
514,326,082 *348D14BF9D782A8450107503B9C22AEFB5EACE78 travelvisions0
514,326,083 *3483F16435D4D4D82976F526E68ACC0E079F7757 travelwolf2
514,326,084 *348181DBF4DF0CF7FE3865E71D763A253DB4AEB4 Traveri1
514,326,085 *348F2D630D40B70B893D0E39B0C33B7A719712E4 travestyoverrefined7
514,326,086 *348882A576BE254403D43377E02DF06A3F300890 TRAvhkP79
514,326,087 *34801BDCE7708E382A9FB7D23249E3A07EC68094 traviassetraviasse
514,326,088 *3489661157C94F59BC03BC44E3A2FC18B18843D0 TRAVIEZITA1
514,326,089 *34816EDD9AF3668F56C1788E43A6E2D3FDCB9332 travis0418
514,326,090 *348446AC8A1164E64EA6F7FBA862A28257B528F9 Travis1985
514,326,091 *3487DC9E3B06D853808A5454396E47690823CD3A travis.adler
514,326,092 *34851DA6F2E4AF45FF35F7D5736E9B13C10323C6 travis.aragoni
514,326,093 *348B0C83056B2508BA706C7755C952E30AE1DA6F travis.auld
514,326,094 *348CF00B2A78A766661D7D7D064FF8ABC084DC57 travis.birr
514,326,095 *348E84C635C76F2DDA23119FD211AA1F4F24CEB5 travis.bittle
514,326,096 *3484F6EEEF8FDD05A9F5CD50D74368DB43A0AE84 travis.bobson
514,326,097 *3480F52C05A85B8E7E00650A9E5525D5CA1A8ABC travis.budd
514,326,098 *348CD9F741286AC155CB2368ADA089A023B6E8CB travis cardiovascular
514,326,099 *3480ECFBCB53DA56563BC9A27987F7C8823528E3 travis.cosenza
514,326,100 *34846D369D964BEB613341BB67D7096AE20FAE03 traviscrippen
514,326,101 *3487F0B0F76A91F39FA70F56D7E2FF25382A616B travis dean feakin
514,326,102 *348D839510077D94A1565161FAA37AA7A8896674 traviseasterly
514,326,103 *348CC112ACF93C318DAE6E59FD0C5023150410CC travis fatchen
514,326,104 *3482426D3EAAF955E956211A4ECBE92EF006BE49 travis.finke
514,326,105 *3483BC61206178FEDAE099E473E9C13865FEFAA3 travisfontes
514,326,106 *348ABB18675BC87B67F91918007293ABEF2FCB72 travis.froncillo
514,326,107 *34896A914A9C2AB7D40F93E5E043B31C1AA95669 travis gerard thompson
514,326,108 *3480F4C3CC00611D34BA455ABEAC2A05E5B59F26 travisgirk
514,326,109 *3488FBF560F332D98C09C132D28C4E9D9382F450 travis.girman
514,326,110 *348C6527EC8CA07C6482341D165A4E4C3BC0A2D2 travis hackenberg
514,326,111 *348C2F3188C97551FA11A684C0147E1D2ECB6548 travis hanneman
514,326,112 *348CC6A534B3781A2AD087CE8DC1432CC2900837 travis hezer
514,326,113 *348EC0E12F2C8A0D05F920C44659A04C43055231 travis hoyt
514,326,114 *348C8851FB48AC59A1718D3BC073B21F953700A6 travis hutchison
514,326,115 *34874EA1F03243FD259CD22CFBBEA5F46B879799 travisireland8
514,326,116 *348577D8B38578B57501323ADF62B32B577A04F7 travis.jacot
514,326,117 *348928392D2CDDFB31B2EDB4E56E1121CE9D3B8F travis.karsten
514,326,118 *348ABE54416B9AFE5D8C266D029861E605E45DA4 travis.lerch
514,326,119 *34887AE3C77E91355CC0073774189C3FFF413FCA travis.lionetti
514,326,120 *3482A59A263DF6BBB9E98B8C0F54A037A9791C8F travislucia
514,326,121 *348535683820E3EB61352622CA408E4E6CDF1273 travis.musson
514,326,122 *348C987563133EEC0AD8648A90FA97991B4BB062 travis nembhard
514,326,123 *348CB87998DBA68B4D9A6A9BA1A517A4DA4E2978 travis.nolt
514,326,124 *34893CAECCB866B69C07B32EE6C56B4D5E29CDB8 travispicket
514,326,125 *3481A76C2E0234C173C78DE500F52AF06830433E travisreiter
514,326,126 *348F4CD79AF8F064876DD94E088489F52A5BF1CC travis.sally
514,326,127 *3488378DA6BFDD21081B3E8E57993CDE5624E292 travis scherwitz
514,326,128 *348405594CF2D64148E362D78AE27BD9170F6CEF travis.schwandt
514,326,129 *348C2559D2AE704F39459DA6477EDE08C1ECBCA9 travis scott anderson
514,326,130 *3482905F7A7DD745E3BF35AFC94973E0CC09535F travis selle
514,326,131 *3489BFA48D5CD8626F6BC7DE9AD1DDED6B20BDFB travis spade
514,326,132 *348B8D946B6627EC531D13E3028844CB3DC05223 travis swyripa
514,326,133 *348CAFE79825C5A5669FA25597421B3859FFF18F traviswadlow
514,326,134 *348D914EC5ED0BC1C29300C4433AB28DF659C557 traviswheels
514,326,135 *3484E1B19D33730FFD879D9469015CF6A8759666 travis.whiton
514,326,136 *3487F6ECE26F8F0538FC698FD91E53E2C21E3D7D traviszhang
514,326,137 *348BF7503408AD9D06A472E8829EEC5DFD0235D6 travtassy
514,326,138 *34888255D0D412EC65DD4A05ECC627E248EC1152 traylea4
514,326,139 *3487B21FF278B0F0C03A25A59A4A875B8A7BCF7B TRAYLINN08
514,326,140 *34883CCFDE38C31B4F84CB22C76653B0D1E9929E trazeci5
514,326,141 *348BE6AE079A16819C790B4595D9885194C522FE trazomyevrah
514,326,142 *3481B5C178BF3D6D65285D2D655A3050B60AEB1A trb14t0n
514,326,143 *3489B34A37D946804C0533D0FC30AB7100CC7F56 trbdmtrclly
514,326,144 *348D5BB26A282FE579173E16D49BD5A32C372DD3 trbeskyttelsen1
514,326,145 *3482E2C4BA7811ABCBF9EF19E7C37E912F57B698 trbtkinnngbsw6
514,326,146 *3481D264D3E1BA88F0A235F7BF381EE5CB2A52DA trbtvlling
514,326,147 *34825824F9DB83394AEF82CE684372FEA0511FD6 trbulos
514,326,148 *34816AC482A960D35B3D5475D0E06422697A81EF [email protected]
514,326,149 *3489622CDE12715C29B063707DC58987A321ADC2 trch1orom3th4n3s
514,326,150 *348143DFDE861B5421FBFD21B4E4D250446DF21E Trchcltying
514,326,151 *34890078A544EAB05DD03526B6829BA9F878DEAE Trchtmced
514,326,152 *34898DCCC4836F1C58868EC172F841E01181D3EF [email protected]!V3
514,326,153 *34845BDC62C38B3085EDB8A3F29CC18F66F1AB25 trdgrds1
514,326,154 *348C0434ECEAC218430210A4FC19361F6327417B trdntphrs0
514,326,155 *348BCE930D764C47E008A282247C505365C03268 , tre
514,326,156 *348F2BB3275AC6C023CE408FCD81BB29CC7A8B6B Treachousness3
514,326,157 *348F40EAD14FE937A6114363072941FB950C8C79 trealliw2
514,326,158 *348633603ADE3902FA1828A84681A3D6E7760B8B treamtode
514,326,159 *348C9625230692F83311BDDCACDC3D6016E0D9B1 treasamhail4
514,326,160 *348C26C1E2B89882F4894F37D613DEF1683AA91E treasonprooves9
514,326,161 *34825210E230124DAE2566A1AD00AEA53F33B50B treasurershousemartock
514,326,162 *348B8E05D17D046682EF187733C90F04364F28F7 treasures5
514,326,163 *3481E0847469218209DA18EE0B2A9337B85FDA79 treasuretrack
514,326,164 *348E78B2BD3DA1C05914368A26B29A503A667AC5 TreasureWaltzfrom'GypsyBaron',Op.418
514,326,165 *348DE020D6AC5DA60EFF210E8CE99B906AA0037C treasuryfort7
514,326,166 *34848B96EFC9401F18F720D325A3425BE0F1FD1F Trebbiare5
514,326,167 *348F4EE55CDD54BC4D54A9F57677DBE63D603196 trebbino4
514,326,168 *348CB2CFF6B0597EB774E6EE77782BECC6C7730C Trebeniing
514,326,169 *3489179CE9AA72715469DF021BF2BA3C8F583A56 trebgodruojnob
514,326,170 *348BE7D5379B7FC045C5C093B0F4DAE4145031CA Trebing3
514,326,171 *348A06C881F7F5D8BF0E2D60EC8287DD32044CB9 Trebišovu
514,326,172 *348FC1D253EDF22C128F0E0F243074587E835E47 Treblaj6
514,326,173 *34819266D4D46BAA49D1EA2AEF48692D8EA3F8F8 TREBLECLEFT
514,326,174 *3481A1BE7C26E4D159FA7C00C54FE0F8DD3D8276 Trebling2
514,326,175 *3486CAEF7EF4B4F8E156CF79E0A94256B458CEC6 Trebliug7
514,326,176 *3486AAE99260C1DE8EBA12266B385B8A4C01581C trebliv2
514,326,177 *3486102EC4C90384FE1E8298D29E8D2BC19B78E4 Trebmil5
514,326,178 *34827A1422930C34780BA5DA255CB81DED3C616E Treboeths
514,326,179 *3488500065770184B155CC98A56283F2F16DBCB0 Treborb7
514,326,180 *348CF1873CBFC128DAAFB9F25154844D05AAFF99 treborclover8
514,326,181 *348E25164B90780F997292CE34B2EFCA399F76B6 Trebordundee
514,326,182 *348CBBC21DEE86D44F13AD6F54A66706644E69D1 treborjester7
514,326,183 *3487558D1B8C395134C42B1A2A5B90B2509CB486 Trebormatt
514,326,184 *348FEB0F1A5409E0DD83569EEBB95384E2C20382 treborred8
514,326,185 *3487B6F4A5D76C06ADFD4E246A3926F2CC27D7EF trecayoung
514,326,186 *348C503B887D2842B7425387912E2E1427AA2BAA trecherer0
514,326,187 *34899D9C5A894392416108363202C91A06F7BBAB trechiella
514,326,188 *348C64530CD07B304AF44E7EB6F90B393EFBFBB2 TRECHOSIA
514,326,189 *3483C584C8A5944BC78936881DB94680C0EDFA5D tréciu
514,326,190 *348378DFAE96900317A57CABFA0D1F746CC560A2 treckie8
514,326,191 *348EDDAB7CF76FCF4687B243A6176149DCE0B539 treden?
514,326,192 *34803CEF293DD36AD8FBB867B0B22E1100E9790D trediesprog
514,326,193 *3486F8EB0ADB5530C2E7D2860801A9319440C926 trediversdagens
514,326,194 *348C8C9FE5AEF0CFF1F29ADE511D426ABC1BF227 trediversfdselsdagenes0
514,326,195 *3483453429347FED8C0FCDC3DA87EE7FD5FC530E tredjegradsligningernes2
514,326,196 *348725978E6C2EC31498F758B69EDE46770D2BF9 Trédos
514,326,197 *348B734DD01F6CCDFCAB347FFD24468F81267640 Treebelt
514,326,198 *34887BDCE4CDE278DA81FB2506303EEA4C1E3751 treednag0
514,326,199 *3480F36C4D399BA1B878AF7EA31A91FA42AFF31D TREEFROG88
514,326,200 *3480C63396201491D4996B4C4ACD5015A615BD93 treegallery4
514,326,201 *348C3AAD87CCBCA46E11CA6DEDF7FB8C93CE54BB treegrahc5
514,326,202 *34861E2A19A314C8B5A9004F8A1A3D4A8D3A6EAA treehousedigest
514,326,203 *348822E807B97FCC91A436F7755877D5E6609140 TREEJW
514,326,204 *34859EA96106E5FB21EF13AFD89CA4EE500FEB5A treenachristianson
514,326,205 *3488C48183D30A729810ECADAF341B235A84AD89 treenataan3
514,326,206 *348D387327BEFAACDD5C596CEC40A9A4E6E153C7 treepeople5
514,326,207 *3484AE0868CEA4C8E06B3E720A332D6B600795BE treeponkirdnark
514,326,208 *348CDDB7079F5A0DE6A49B0CABB417810A475440 treereferp7
514,326,209 *3482B30425F38A51F2FF6EAE205A9E7231847995 treergims
514,326,210 *348A39CD0545FA377F97304588152102F3DF027C treetrace9
514,326,211 *348434D2AFC44FE35AD1F6531B068AB652BC6774 treey!
514,326,212 *348BA66BE2D21B27889B5D8A7BE46BD26B8A820B TREF01LS
514,326,213 *348B084A9F27C4A280334D2A14BB1205EADD340B trefferroman7
514,326,214 *348D78DE3B8B3E10DD4171BFAB4AD14FD47E747E Trefonen6
514,326,215 *348D1C9ACB9F6151188BB0A3EB2CF9FC93FBBADC trefying9
514,326,216 *348AC3C343AE2C361FEDC33DFF703FF1C7C07D39 TREFZEKERSTS
514,326,217 *348885A5B4A226C550FACB840DD09195FC2F7030 TREGG
514,326,218 *348A7989E9B97F69F5B1CB1283E1E265E6FFCD58 treggabt2
514,326,219 *34809118E85DE88FDEC62C8EEFBB5DD53841A071 tre halstied
514,326,220 *348C66F80E1F99C30FCE420EFB9127E77417991E Trehøjevej
514,326,221 *3488DB27659B2A2147A282BFA278424204494E5B Treibmines
514,326,222 *3485B907113B480DFF623363DE772A47A074915F treibstoffempfänger
514,326,223 *3484DF4D509AE367D32558FB78548060C917EBB4 Treibwasserdüse
514,326,224 *348B2ACA8BF452487468B6122319896C1FFC3622 treinara9
514,326,225 *348B50DCA65F5FECFCB294CF25677CC68008AEAA treisivo3
514,326,226 *348B3B8142D82251BEF63A6A73AE48A8F3C76244 trekandre9
514,326,227 *348A25329C76A45851DA9E3E071BD59B965BCB1E TREKBANKS
514,326,228 *348C143A13DF3BE5AEF8FB296B4DB56666A66CC5 trekcannonda9
514,326,229 *348C72E93BABEE9518AE4DE4084A0861CAEF0816 trekeagles6
514,326,230 *3489A5717E95B3F4BAAE0724A60E23D0E49F5E34 Trekkarren3
514,326,231 *348E72E3F7A46300F492AC7293FFB26FD019E6FB treklver2
514,326,232 *348B96D97FDA26CAF43A48B1D8509441918D49DF Treknick7
514,326,233 *348D42D3E19989DDE80B83D35349FD626B8A1334 Treksmokey
514,326,234 *34804877BB0FC285CE3E93A8B90BE54499C506C5 trekush
514,326,235 *3488BE211B7E0511E029FBE3D12A45D7A88CC9CA trekwarcraft0
514,326,236 *34803B3775756932CD85D4A6FC80CD4360368051 trelanhylton
514,326,237 *3487FC80ABBDD0F555EE002F382B689B3F96F97C Trelaps3
514,326,238 *348D69DAA997C92DC6411CD2176AE573DF6B3BA4 trèle
514,326,239 *348BBAC50AFDF011CB721DD7A5DE74AA8CC9C4F1 trelews7
514,326,240 *3483975FAC3D0CB2C25E6C7D3667383FFCFF8993 tre luckyluck osborn
514,326,241 *3482645E3F1C3EC374846BCCEF9FB713E590FD7B trem4en$
514,326,242 *348880EDD4E9048D10A25166425291DB7F2C327F trembertha
514,326,243 *34859EFBD6BA410331CFD1365E7C467690DA6892 tremblingvoice
514,326,244 *34859ACAE136D5BE502A75427FBF06F516E28097 tremendo boogaloo
514,326,245 *348613147449CBD0E9A13B8C417A2EA6884762F0 tremerestI
514,326,246 *3482669ABC15C364B5855A1B445D3DF208EC27E4 Tremeyne6
514,326,247 *3489C5C1DB517820CB8D1BABE685F93307F461D6 tremors: val & earl / rhonda
514,326,248 *34801236B8B0A4D0BC75828A151D531599172D6F tremulers
514,326,249 *348FECA2851D5EFD90789BD590D19DC1FE05ED32 tremulousingged
514,326,250 *3485ADA4AF14296213EB3687F729A562DCCA64F4 Tremwegging
514,326,251 *34836FEBC0A7AEA01B4BD517706133BC1B41F410 TRENABIE
514,326,252 *348A860DB57B615CA36E13A23A41BAD4C21CE6A5 [email protected]
514,326,253 *348ADE5C05491F3B876E3424F1711048A79B748F trenda barnes woodruff
514,326,254 *3489F8B3BA5B24D612F64945B290387BCCC70090 trendrovheir
514,326,255 *348BA5C9025D7DA67E62063CFE1CA58102852E1D trenjum
514,326,256 *348706145AF4D80B1B06A80BC29DDA61C379FAAC trennailsing
514,326,257 *348C82B497C3821FFBC1A7EA130164A95618E06C trennenly2
514,326,258 *3488B821858684C5DF245F5908205F5E31276226 trennod3
514,326,259 *348B6A2CD26C07A557909065B9F8168583516ED7 trenntrafo1
514,326,260 *3488CEDAE56F0E59CC050818099FA4834607A4D9 trenobsw
514,326,261 *348355552B0D11B796F89B7EA70501B14118953D trent.arbogust
514,326,262 *348911624D1377BEC1E1083529090AFEDB09D7BE trent.atkerson
514,326,263 *3487CF0BB385D6360BDF91CE7AEA8E62F45C3ACC trentbronson
514,326,264 *34822080336947CE931E2651B3DAB81FFBF83F91 trent bryers
514,326,265 *34865966D1C112E2CD9CA6B9EE43E7BAAF9750A1 trent.cacciatore
514,326,266 *348108C140BA129D7F6C59F639E18634A4C3F45A trent colgan
514,326,267 *348A54D997F1633B968C88A3766FE465BBF45465 trent.corrao
514,326,268 *34815F27D64983D1D7A5135CBBA8ED5F5407DCAC trent.crismon
514,326,269 *348F7FD1878A2E713AB8E87E626D86BE16F5AA5E trentdickess
514,326,270 *348B569D7D9A02144C70F60262E014F37D4BDFEC trent dolomount
514,326,271 *3487916891801B146918C234F5D5DFD8D9399462 trent.eifler
514,326,272 *348B8ACA45173D9325218775FA7AD3B7EF341DEE trënténg
514,326,273 *348766D27FA0D2E4EABBF9C8B0173C05A80CED55 trent.fagerstrom
514,326,274 *3480E7CBC77E22F6FC145E2595AB401972FBA1B8 trentfandal
514,326,275 *3483D2859CA81EABE9AB65A2F84D9B15C9E10189 trent.gardecki
514,326,276 *3483C0E899F04A6DABF787D239B36DA96D234EA6 trent.guerrouxo
514,326,277 *348B8C36476575EECD74108871A661397E29ED5D trent.harges
514,326,278 *348B5F8C53F63C0FC9A7CCF7BE4FF46EBDB81CB0 trentharlan
514,326,279 *348EE140C20A65180CD6B4138DDF2B97DE6795DA trent.harvilchuck
514,326,280 *3487658DD777AC1721958DF949B63F6B3F0D85A9 trent.heidemann
514,326,281 *34866DD34154A5AB8D6A1EB4CA4676291CD234CC trent ivan ballif
514,326,282 *3485C77A85AC2CF2C043D8AEC1763461AED59224 trent.keomuangtai
514,326,283 *34811160C323AF259290F25C05DC2012F4F5E321 trent kristinn walsh
514,326,284 *348FBD1EAA085D08BBE7A8271F2B908F4E5FB50F trentkruessel
514,326,285 *348F5D08EDFB086AF79380B274DE0C99BA48066A trent.krus
514,326,286 *34802F6D6751C5D2A14191EB84DAC5948383B2A3 [email protected]
514,326,287 *34856425FA56B7FDCC6CAB231487A9A2CBED15AB trent.lemmen
514,326,288 *348FD55C5B1B8EF33E52451AA8A5DF9EA1AF8C32 trent.ligon
514,326,289 *348FDACC81257BD9341550A946C1CE18B8BC808C trent.lola
514,326,290 *348A008108ACCB79D7B017B43AA1EE5D5D518C57 trent.luchsinger
514,326,291 *3480305D9EB92182EFF8BDD7CFA28BFD36AB22A5 trent manks
514,326,292 *348E07DFC0832A5146F1AC9BE0EA3306B7CCAE03 trent.massingale
514,326,293 *348626FDA5B23EA9C88AEA3CD2EA5EF25D8FB544 trentmillward
514,326,294 *348ED4336A6616E1483CA738EDA16E638637C4E0 trent.mosmeyer
514,326,295 *34850DD608B739DAC2B4A3A3973317E3E1BF82F9 trent.mounger
514,326,296 *348E4DAAB1519B0FF937D892B78258D84823D889 trentng
514,326,297 *34856C34BB252C0167CCA8ACD81F21FEA62CAF95 trentnorkus
514,326,298 *3484A6977E13D3A243FBFEE12E0DD1871F741485 trenton289
514,326,299 *348473837C1024D48CE7A541B39E6B3F31F4A722 trenton.angeron
514,326,300 *348FEC8135DB66A790C31178B0DA1D872C153CD6 trenton.barbin
514,326,301 *348216BE7947FA1521B35CD5A4135B96C04F38C8 trenton.behizadeh
514,326,302 *348ECC855AC156FCDA22F32697A12AE48F464046 trenton.boudrie
514,326,303 *348633143EDBA3850BF9868B49718BFC99020E35 trenton.brening
514,326,304 *348BA037BDD90750431377EA6FB0A945B186D4D3 trenton.casarez
514,326,305 *348DEB67F57E662386697F632A5CD7E9E2480FA5 trenton.coupland
514,326,306 *348EF397ACC4F55B3954709AA5E8E9E7B8E3ADA8 trenton.dahlquist
514,326,307 *3480C04CA6DA2B1ADCD46D1E24E547D7CEBB2300 trenton.everleth
514,326,308 *34888B490CA539BFF0AAF5B18DABD941C022B983 trentonflipse
514,326,309 *348D8A860CFB3133CB646A2CF3C22A8E13BCAC78 trenton.hidrogo
514,326,310 *348A4708840ADBB65208DD0B4B1DC1FE0BAD7925 trenton.imondi
514,326,311 *348DA2D90D8CFA133D13F47A19F0ED81280F8A84 trenton.isherwood
514,326,312 *348E913BDACE858E69598731AF6493EBFD0C0890 trenton.jongebloed
514,326,313 *348468DF93B393F59E814ECA0D927FBEF582F033 trenton.kotschevar
514,326,314 *34881D27C9B1059B54DF974B0DFEA9A537EE8701 trenton kozushka
514,326,315 *348BBB0DD607CD0CCA7EEB1765FB236360ECE757 trenton.krnach
514,326,316 *348D868B09F7C71CF067D5FA793865636C2F7995 trenton.marcet
514,326,317 *348D22064FC178904F25EC6823AB0D599881F399 trenton.marsette
514,326,318 *34804E19D85FB0B10137CE54AA15B590092A5706 trenton.mays
514,326,319 *348A543E0C6C57D78207732127D30D8E315602D7 trenton.ohern
514,326,320 *348C1989A023BCAC33309B9153EF132AD8DEA622 trenton.renard
514,326,321 *34863F230A0FF306038D192FD826973B3E5DA0E4 trenton.sauve
514,326,322 *3484C739B2FE4205D31164B48A65A50DB17E986A trenton.schnitzer
514,326,323 *348057F367D8B81B7FBC0972BBA69CD2A48B913C trenton.siptak
514,326,324 *348A653BD70CE4A1C77505EF421EF2195FE2DA79 trenton.tolson
514,326,325 *34881170AAAC5460E1CDECC6F924988131F5141B trenton.trower
514,326,326 *3483460683B4F4E879CEE294852E32EB5FAAE667 trenton.zents
514,326,327 *3487A6EAAAF469CA844E5D7D8BE9060336759785 trent.ruddick
514,326,328 *348FE59BF229335AA57FA05E14759FA03DC1079E trent sommerville
514,326,329 *348A07F08986A585828DCA7EB8E00265FFFAED1C trent.syddall
514,326,330 *348E71E60018B536AB8BE03D810E5B2567F24BEE trent.terron
514,326,331 *34814B5F6C0F30168788B15A588666E8123BB0FB trent.toala
514,326,332 *348FDA10353F200FF709828EDE8BF8E495BCD4A0 trent upson
514,326,333 *3485741BFD30E26EDB91F91299DC83C62A787DD9 trent.valgren
514,326,334 *3487CD4D82EDC05D5ECE744451C31D95CAE92487 Trenty
514,326,335 *34846BAEA1B8EF430B28F62A4889EDC32157630C trentyn jackson
514,326,336 *348391940606C3AE64816F2B3407FD47FBC59922 treodnap3
514,326,337 *348BDDD37E8B98FDE0BD497111FF90BE2487D4F1 Treogan
514,326,338 *348828B631C8DB8F5E42EECFA5EF42A3F8DF35DB Treon1234
514,326,339 *348E32270AB27A22303F21068539480B2C9EB89D TREOVPO
514,326,340 *348D4ED2CB314EA1B5095F59107FFD5CFE016C39 trepanar9
514,326,341 *34836B8E97B007CCB890846C7D53366F8043814C trepanize1234
514,326,342 *3481087559FBDCEB5EBC4CBD3BA3FC73578D6837 trepnefe
514,326,343 *348C86E747642FC347236943E9094F7AD01D4C8B trepoenger1
514,326,344 *34802B46A42A4AC0C56A6EDE234EF9A998096FEB Treppena5
514,326,345 *348700101AA6D33D4AB76B93C9ABE94A2B346BF6 Treptati3
514,326,346 *348A268D96E778122828DA413120B03B7A36F820 treptati7
514,326,347 *348F4FAED31F96E0DA4B1D1FA0FC081FE24DA3F0 Trerigt6
514,326,348 *34835AA8603029FC29D7B3F5ACAAD5F7FBD93B4F tresagoss
514,326,349 *348930B9DE56FCAA372B4BF2DBC5CADA3CD3394D tresamazurek
514,326,350 *3486D526F8FF13D516A614D3AD57272F5D9DBA16 Tre Scarlatte Stille...
514,326,351 *3487DEB2A532BEE193B98F9DE66C97736AB2691F tres guerzon
514,326,352 *348190D6D97CD5C4CFCCFBF4A2010D5DF9CA32DF TRESISE
514,326,353 *3484CA69621E7BF1A6486F77952D9F7FFD43061D tresmodeindia
514,326,354 *348F14F9F3F8A95DADC3B142BE96D4E8284891E2 třešňovém
514,326,355 *3489BEBFEF26C7C78AD8DACF2AC35F23BCCF3080 trespasseth1
514,326,356 *3486457C010359D2E69C362D031761D40668D484 tressa harrop yinger
514,326,357 *348A92529BD60201F70D27542478EE7F17F80376 tressaillait7
514,326,358 *348830B3FAAF1CE63C69CBD1620723AF1B830CDC TRESSAILLANT2
514,326,359 *34863FCD174F4536FC6E66F472EB0C46474FFCAF tressa mason
514,326,360 *348DF4E003CB3CADBC0A98083E4AC4E549B998FD tressarobins
514,326,361 *3481ADABB0BB2CFE42A6DE61DB43264B2DC047F5 tressie poore
514,326,362 *348A44B9371899CB270221DC8FAE62459363197D tress-jazz-in-tygmont-ab
514,326,363 *348BA95F7A645D509DB06C0CE7EB691646156CA8 [email protected]
514,326,364 *34867FD17D3869F94ED7A5C1DDF0F263E2907F85 trestern0
514,326,365 *348795A56C1433100676DE22A1A7AA03D9D00324 treterously5
514,326,366 *348ACCB5795486AFB0C4F09571DF8753A3B66E8D tretneiroidrev
514,326,367 *3488164DBB9A467EB8028657CD807F3AE9AA549A tretnolk8
514,326,368 *34850CF989177BBDA4CB694D1D8760D983B3CCA5 tretsieg9
514,326,369 *348A8B2F16FE741B1D4DE938914759EA53058685 tretuent6
514,326,370 *34806D865A05FDB63DBE097BDCCE301545345A17 treuhaenderising
514,326,371 *348B65925926666D8B12C4BB2077B3CBFD9FE42A treuzskeudenn
514,326,372 *348575796734D1B6F6170DDD8D57CD77DEBDF334 treva a holloway
514,326,373 *348DD9540D2F8BFFA547FAF081E456A67CDDF0AF Trevade9
514,326,374 *3484740485BB5D70C6577A9426BE633C43E2B4AB treveion6
514,326,375 *34848CEF99A03406B771C0C3DAE53903D821AFC5 trevenedaniel
514,326,376 *348BF58EB9FBB3510387FB9F31317468ACD077D1 trevenio6
514,326,377 *34824E30DD7871B4AEE320E11580A73A489AE0E9 treventreven0
514,326,378 *34856FCBCD4D7B4B415B07596B9156E6CA061A1C Trevin474
514,326,379 *348A498E0CB3C977A70B946D101BE599EBA3744C trevise boyd
514,326,380 *3483E5EF61E58FE088C67286FAE5D869A80F4E53 trevisne6
514,326,381 *34867EDAA40295101335A06BF2DC96C3FF8DDA56 Trevon412
514,326,382 *348F8955E3658E77AA7E67E2ACCC16FC8AB31640 trevorabcdef8
514,326,383 *3483483B7B83DFD331E4B09816266C87CB6AAFB8 trevor.adrion
514,326,384 *348FBA40D4B511EFD5061CF4270D0A5A2829DA06 trevorashley3
514,326,385 *348411C63726D6E0E144A3AE3EF61E1AA6ECDF26 trevor.bartoldus
514,326,386 *348EDF17F1951FE8CC5DD761FCE1FB46A29E4628 trevorbasketba6
514,326,387 *348FD149550D1E37AFFC909AD45CC0530AEE846E trevor blevins
514,326,388 *3484AABF507AE05909937478A9C61F4A1D52D9C8 trevor boddie
514,326,389 *348581F867FB5D5F49A21DAB208B274D1B1897F8 trevor.bosshart
514,326,390 *3488C300CBDC99508EB8E39267F236F5C1621501 trevorbrost
514,326,391 *348254D64BB2A05D97849F9F4C293ED29D9D461D trevorcarley
514,326,392 *3481A69FA11C43CCA038A1525AF5360B18469D9B [email protected]
514,326,393 *3489535E15E8BC05CE856059DC22F775A106CCE3 trevor clary
514,326,394 *348C3430E5E023A387CF794011AB1445D3ED6250 trevor.coello
514,326,395 *34852A6961448FD1EA58F49E539C1C03DA5A9790 Trevordeath
514,326,396 *348FFF3F2601DC252156EE00C4C7F63604902660 trevordirks
514,326,397 *3489F4C9DC943BB499F8AFE607DEC8C8B17C583F trevor.frain
514,326,398 *348E6FE417D8FA551E26486FF534BAFDF2A99347 trevorfredrick
514,326,399 *3486E09F84126F5E25264321E7B674DF342619C3 trevorganga
514,326,400 *3480D4391C4EFD944C0F62BCE412E46BA5513725 trevorgudrie
514,326,401 *3488DB0280C4D0BAEA8870FE95962586E0E14BD3 trevorhejhal
514,326,402 *348EDB129525B53299999A55B8DF6DE85146F320 trevor.holsclaw
514,326,403 *3485DCE52177430472FADA0337A74F1D742AB2F2 trevor.iacovino
514,326,404 *348A9F05AAE0ACC02D5CEC6914694EEF8CF08946 trevor.inscore
514,326,405 *348A00CB85CE87C85BCD6CD0332E25F74F9F1FCD trevor jaye
514,326,406 *3488E634C7A7538F47030D392C727CEA25A99394 trevor.keatingubs.co
514,326,407 *348397B0ACA86528058270103FA795282258E091 trevor lee boatman
514,326,408 *348F4DD780CE1356AF331B4A48D7D05CB188154F trevor.leflore
514,326,409 *348B1E5975A611410FD5D50CEE8E021F3B220CB4 trevor.legath
514,326,410 *348E2BD17FE518BDAEBCDC0E7198969A66F050AB trevor lippingwell
514,326,411 *3487513C803398AF11A122C4221E5F6FB9F6E36A trevorlobban
514,326,412 *3489E63DC83C2EA92467F2EF9274C59740014052 trevor.mages
514,326,413 *348B35F21017B8276B2CE9943049EBF3EF66352D trevor.marque
514,326,414 *348E9473C0ACD69C1B390D032E2354C9F6A2E461 trevor.mis
514,326,415 *348BEF8CFE94BD455FFADAEBB33DEBE6A9434B21 trevornugen
514,326,416 *348A9744F4D1E2430E85A5AF04DCA837D36BF274 trevor.osteen
514,326,417 *34849F7AF56763ADE72DC3AB8F67AF1697C017C3 trevor.peatry
514,326,418 *3481FD811B439658F9EC6DFBBCE3C9305335D158 trevorpitre
514,326,419 *348DCD51BF7997A08491626B21A8E04A61F20A71 trevorraider1
514,326,420 *348495F35501A4A9ECD6A8359BC064470DF7FAD0 trevor ruelle
514,326,421 *34899586F0849FBB272B27B82555933736806E3D trevorsomers
514,326,422 *3483D89EE9B973DAEA6E3EABBD7C8996535A1539 trevorteddy2
514,326,423 *348CBF30AD230672076D8C514EFCF5708505B0F1 trevor thorn
514,326,424 *348A32CBF0963FC6919A6F19F18379DE0DFAA2F2 Trevortn0
514,326,425 *348661268C28594A0B7145DEF34EE1D58098C2B1 trevoruntyd
514,326,426 *34883E6254C8960C92CDEFFC4F09C8236BB669CC trevorvelveting
514,326,427 *348495A74781EBFD0A93B8F331A8E8FFF4DD21D3 trevor vernal
514,326,428 *34850FF8FF959EEB8CC64175635D285F6896B520 trevorwinnies
514,326,429 *348A47C0D26C34625545C8DAE7D0F5138EC2F40F trevor.winton
514,326,430 *348486E54839E2266F4CEC16EA2DA19E710A215D trevorworth
514,326,431 *34847806C10C8229F4CBCE32BB76941D27EBB89D trextrex1
514,326,432 *348BDAE02ADD4E6A57A7AAAE3B49AFEA51E1D57E trey aguliar
514,326,433 *34808558EEB341845832B7DADFA572C6966278DE trey.behrendt
514,326,434 *34812E6665D5569EB6305DD6A9FDCFB6ACE84B48 trey.benninger
514,326,435 *34835AC00AB1771AC26FC991E1174CE4C1F6BCAE treybony4
514,326,436 *34862FC9995D6E7F73E1D28CA39C7F6F894424B9 trey.broody
514,326,437 *348933F6D3DE4347F79E95D5968BBF0C8A746BBE trey.buttolph
514,326,438 *3484ED1CA90BC9EE63F40FC260763A202FADD2D7 trey.chapa
514,326,439 *348A68B4C9388B78A63305725B5C7E10D2785235 trey dewayne sims
514,326,440 *348A02907A14D2A978E34AEEEF061DC76F5841AC treydi
514,326,441 *3482A904841DCD89E51B96D27A19B8AFC356B9D7 trey.dreggs
514,326,442 *348DFFC3861C0D95EFB4F7D44D1CF9FAC0BFA569 trey.emard
514,326,443 *34810B8ECAB1FDA7AF3FC208250354F68F6D0B51 trey.fahner
514,326,444 *348914F5046999EB0F9320E2937351436733D4AD trey.hughey
514,326,445 *3486A36D3F73527DE4648C84E4CAC750EDA478F0 trey.isakson
514,326,446 *3488F993EAC2CE4C68CB1B8B2102FC0852F0F6F5 treyjunek
514,326,447 *348D96998BBFD83739B7852017A005C40AC4F048 trey.kneser
514,326,448 *348A9F75FA2444EBA3FDA5B7E4EE57CE00A73B3F trey.koppang
514,326,449 *348070BCBE1A09AFFA45B1C67A6F555523319238 trey.lannon
514,326,450 *34883F31489CEF5E28F386470135970D84A1966F trey.maassen
514,326,451 *348D339A0132E6DD3B4F33FA60466E4AD03A648B trey.merical
514,326,452 *3483CABA41EAC110C80602350FE9D9E003D988CF treymewes
514,326,453 *34867D8C2D12A3749931B62D035BE888465A7C26 trey mobiledetailing matthews
514,326,454 *348798E2E83D9ED87B47E8EF30E171571E580815 trey.mook
514,326,455 *348644BB46F1277C19FA057A0AB35D990D1C9C63 trey.neu
514,326,456 *3488E8657395D9A5FBBCF213F4A33F2A3BBD5110 [email protected]
514,326,457 *348EC0E25770F166EA339E827418CD2FAE66E151 trey.orines
514,326,458 *3486A61DCAADD56C9FFFAE8193F7AB2BAC6E1D5C trey.paniccia
514,326,459 *3488FD0E6A63DDCD12A2FD74136FBCC7FAA84717 trey.presiado
514,326,460 *34826F4973127CE5844F29B8D79C42BC06E3176B trey.rosendahl
514,326,461 *348FCE0A0F1A7551DCB6CE7A74865F261C68E257 trey.rubow
514,326,462 *348A2A0D486436DAB48DC7C8DDD19815B59A437A treyseymour
514,326,463 *348D7552763156CFCAD00C65866F9FAE7EC53112 trey.sprvill
514,326,464 *3487067A4A3D53F879DE2BB84310A3185768F84B trey.steiert
514,326,465 *348418CE0D4DAB24B796F7DDA37B05DB20139CA3 trey.sump
514,326,466 *34848A309FF53D851D6E91EEE1C2AB8F80612C23 trey.taniguchi
514,326,467 *348A4FCF661C9FB007AA46D71C441B1E142D8545 trey.towler
514,326,468 *348249550CFDBE3ADACC903FA4DFB0CD8F7005A9 trey.tramble
514,326,469 *3484572811B2BAD4D96F39ABF8A4A0950E3C3E4F treyvonayres
514,326,470 *348C2424D415259BD1AE393148DDABC791BCFA87 tr{f
514,326,471 *348557FE57C098D8004437BFE5FD47BD078EFD65 [email protected]
514,326,472 *3480AD079E27DF9B3133562B9A803DEA40CBBEA5 trffcblnss0
514,326,473 *348EEAC9EE9D4D4CBB96780642FAF6B22F7E0A6E Tr
514,326,474 *3485FE197BA6D950291D417825A6D758B7E891D6 trf flamenco
514,326,475 *3483956F6A17EBE4C29A0332E945D09F59E69EBA trfrigya
514,326,476 *348D69AE9DFDB99BF3C7A8A5B0925531E6D124A7 trg0n0mtrc
514,326,477 *348F0D739A596DBF23294EFFBCED05460B8899D4 trgcmdning
514,326,478 *3480AE6D95D7B8729D51DCB12038D661B00E48BB Trggrbr1
514,326,479 *3483892B1565A4A16ACC1F21AEF8DCB48704752F trgrdngrgrttblrltng
514,326,480 *348E02F0E47492F851142AB13A59D7A1DFC579A1 trgtsdfg
514,326,481 *348A98533E27BA4040C3F78BFD916DDB05F13222 trgvrgdn9
514,326,482 *348A1FD04722566D0AEF1D1DDE0387F4DE0E0C5F trhavlik
514,326,483 *348124968555161E9BD7CBD8917F939E0956E630 trhawebfuawsb
514,326,484 *348D7004F48F44633B2B6F066DFC67C74AF1D624 trheufsu7
514,326,485 *34854694EA05E864BD9065D23C9FE7752B9A80DB trhlík
514,326,486 *3482540CFDA495724903539F9B08558318BC8D0C Trhtelee8
514,326,487 *3480F7BBA01D0CA17F2ACDE8B399D0977B62C3CF trhufegm5
514,326,488 *3488F27A6249B0D7873F63ADE5DD83C66D96271E trhufnie9
514,326,489 *348E7BDA2F940FAB40CE14793022F70EBC2BD57C tR+I
514,326,490 *348C231BBE3F6D1ABA8574B7C3715BF687B36D99 triad2007
514,326,491 *348E72BEAC6CC4D782DC923EF960A148E2F2C7DA triadminor8
514,326,492 *348B1A8720E8F13E523889715FC92D3C7089A02C triádokkal
514,326,493 *348E5B1014E82609F5302D4B4979CDE8313880F4 triakosiosth0
514,326,494 *3488C4D76D2989C4AAC5FDACFA5F0F104114B3C3 trialcom9
514,326,495 *348EB1316D562BB946CC4F763B337149597E19A3 trialgaz1
514,326,496 *348A24D8F386297337E446AED78D963B949C0D2C trialité
514,326,497 *348749C318CF80BB2F21514B981A3517D55E2BD6 trialquot
514,326,498 *348A74B83C4260F202B108F7E01E65978CC6D8C8 triana,triana
514,326,499 *348AC99886AA11F3546E3CB405F0DF68D1DEEE70 triangeln”
514,326,500 *348AF375629BC7B9EC8F6CF238221289022FC170 trianglarna7
514,326,501 *3487851E1C6C37CCB9D9BE840AE2144A7A030D9F triangulosus
514,326,502 *3481C4E3E80F31D2BD04288A004752A23ED94313 trianna soluved watkins
514,326,503 *348F328B2597DF5CE8456DF94A85351AB2E13302 TRIANNUALS
514,326,504 *348DE61AFE4F7FE7137A8539C88626B77F0CCC83 TRIANTI-STYPSIANOU
514,326,505 *348F1523AED49310B52A9BFF997723C8BA3E8647 tria suryandaru
514,326,506 *3482B16B4EC0CA73A7DAA628801BBEE63C752D34 Triathlonsportlerin
514,326,507 *348D9416E2271178D09F09C0AEA6B542ED18266B TRIB4LLY
514,326,508 *3485C446864F8072C345FC8FDFB29FF3D3CD2209 tribalanalysiscenter.comwww
514,326,509 *348E52F6DAD48C351340D171E634FCFF0E0D2BAC TRIBALDD
514,326,510 *34833F5818464DE5EA3D1F80D7D729CE10376564 tribaldreams(live)
514,326,511 *3488EF408854A604B6790728BEF0B49A9D8B7852 Tribasilaring
514,326,512 *34816EC48F626B4B07EF783D56F728E9014C7EF6 tribologys5
514,326,513 *348AAACC36D6E5823160A9F4CB74ABAEEF81A131 triboluminesc3
514,326,514 *3489AC29E5A76BFF5A605318B98BC9663EA7C499 triboluminescenceS
514,326,515 *348D68EDA57CBE9F8981A4045FB8CD9FA8211FBD triboran5
514,326,516 *34883F87BB4BBED3DA92C2B5378B8EFC6CEF4FBE tribot1234
514,326,517 *34880ADD8C23888A554373764E76389718610620 TRI-BROMIDE
514,326,518 *348895BF74192C12F896826588B4935832BAEA82 tribunea5
514,326,519 *348EB76BBBAF464BE00FF8A772C5390B6E4F09BB Tributaing
514,326,520 *348AA2A75EB50965AC52B6E13B5D429C25560979 TRIBUTE0
514,326,521 *348772231F654C10137089B0AB36685F6DDA1E48 triceybynum
514,326,522 *3489EA0247900C175A491A6B2C977E4BCEDDF414 Trichea0
514,326,523 *348F157ACC7EBD46E73B73D10D5901F7997AF28F TRICHERIES!
514,326,524 *34886889BC6EF71326321654F9A3B89E020620D2 TRICHINAS6
514,326,525 *3480062DD6DB294FA71B177CF6C9E42F30DDC568 tri-chloro-phenols
514,326,526 *3484169498761BFC94D597FE3CA4DFC678FB15CE trichodelitschia6
514,326,527 *348C517BBD17C0004020E4AD3411035FC1BFE940 TRICHOLOGIST4
514,326,528 *348864D15C6448EB426B0B6672CF5091022E55CB trichomonacide3
514,326,529 *34834EA86B0FA5D0A353ED434C65489D277FEBB2 trichonida's
514,326,530 *3483489F1571049D3B9EFB45FE44291CECAECB00 triciaaye
514,326,531 *348687FB73E630812680EC5682A233BCE9C6A8D7 tricia bigger
514,326,532 *3488BCDBA45D3F892FBFBFDD945A3450A9B83783 tricia boyle russ
514,326,533 *3488ED78141968C7F8C3FDD9532BE564BD286D77 tricia bunney feist
514,326,534 *348899ABE81A0452C5A78E484A679D63B5644F44 triciacarl6
514,326,535 *348517E1A0747BD80C91E84D82ED19E376F140E0 triciaduck8
514,326,536 *348635199970BBA54B7DB76471A2623202D5BCDF tricia fant sanders
514,326,537 *34819D37D1D4756BE25CEC6F04078A2B48042428 triciafucci
514,326,538 *348DC5D1626B4D9BBD0EF4EC04DFA7C4C58B7244 tricia gates
514,326,539 *348A1E381CB5DC5BAEF0A5D97BAA9A9572A091AE tricia lamarche
514,326,540 *3483C106B3616EB7B6089A12EE311BE398A6F1B2 triciamollies
514,326,541 *34856326AB2784479B38449FFE25771D119CA10E triciapickled
514,326,542 *34860D54CBD57B4231E8DDCF051D246BBE334807 triciapinkert
514,326,543 *3487EA4152CDFA14D082847DDD19A7F620B845A4 triciasarnicola
514,326,544 *3482B5E26C94EDFF58F0937885B67FD2D62C62DA triciasteeles
514,326,545 *348A91752EE6009320D660C09DA97868FBF1120C triciatarleton
514,326,546 *3488A5778DE92C66A060212E29340AB59B176167 triciawombat5
514,326,547 *348A1F51EEB69D5046D772730CD52CBCF1370EFA tricityan6
514,326,548 *348341A95070F9C1C70DABF31332BEC4E599E865 Tricitybulldogs
514,326,549 *34804517DABBCEBD7673E8440CA16A05EA0C32BF trickay5
514,326,550 *348824B3AB3129C00A5D0750E473F46587E3A778 trickeys7
514,326,551 *3489B9843E1DEEE8797AEB4DDA64C75FC2CADF24 trickleseses
514,326,552 *34812E62926D6F37B4673B8FA873ED785B0FC718 trick my boat wrong
514,326,553 *34811E6ACCAF189D1718714A00A983A1DDACC2F7 tricknight6
514,326,554 *348792B9FF955E80862FE4741397E5A32B064B51 trickshot6
514,326,555 *3487C401A7E1BAF121764DF53C3144C390F6CCFF trickste6
514,326,556 *348B78AB4FB94F4225ED2B495648A21CAAEEE243 TrickyDisco(Roccovs.Bass-Tremixedit)
514,326,557 *348F1B26747B4BB2C744AAA100D17237BB4EABBF Trickyness
514,326,558 *348970306A1F33EB3113935D05B0468B64554D65 [email protected]
514,326,559 *348C12343ACD026F4BA31D32760D1627F34EF816 tricladidas2
514,326,560 *3485137184A29E3EEBC8C62640D4394E61183614 triclinaria
514,326,561 *3484E5C6634CFF9785C933B881683616981B776D Tricocomaceae
514,326,562 *348AFF42AA106579744D6F3923FCE5292107D5AF tricocompres5
514,326,563 *348990F6F075C48D35D6CA0B5961DC224D197937 Tricorne0
514,326,564 *3481D2D65C5011532631E66C7740853B6750644A TRICOTE2
514,326,565 *348855C1E8DB9FB3FFD99247151C7FF24944D940 TRICROTISM6
514,326,566 *348E14284F575D7DB3DD016DAEFA7F8081BB89D1 TRICUSPIDATE2
514,326,567 *3482411AC86ACEB898BCFB2CEB8CF8896232C931 tric wright
514,326,568 *348DF29B85F2A37A317ED9E972E9FA5199F302EF tricyclischen
514,326,569 *34876A358124403738F0ECF1815E268449248DAE TRIDACNADÉ
514,326,570 *3487CBE386570C759A39C8355D7F1D711817EDE5 tridantoprasetya
514,326,571 *3481E2057CA4A0E711B29D165CFBC965016765EE tridecatylenes3
514,326,572 *348B82F0C281B2A78C038342B47BFCCC87B34203 tridentbetty1
514,326,573 *348DB53106C2BFD9C7353147951F13DD16139832 tridentelwood5
514,326,574 *3488742B7CCC75915094612595278A3E7DC6F990 tridentfrosty5
514,326,575 *348DE4F02DCDD5D61D091EB4555D03BE829222FA tridentglenns
514,326,576 *348124451902DD821F45BA2D12564F18D8F7BCB4 tridentholly7
514,326,577 *34806C39DBF4C2DE464CD2A3A73902FBAD3372CE Tridentmartin
514,326,578 *348D8857C585264055E9D0D54F0CD10D0B0270B9 tridentmoniqued
514,326,579 *348F450D37B48746BB0ED3C157963D5FFD02FD4F TRIDENTNEWUSER
514,326,580 *3483591471EA394F573EF7E6A93B7FA45A6B43E8 tridentpeace8
514,326,581 *348BAB2B401E2E249367215A080C2B105F6F5F50 tridentretard5
514,326,582 *348E17FAD8A2643D28EA8F825F97990B9E3DA5D7 tridentstrat4
514,326,583 *348EF6CF08C92169D138CD8EEAFF1800E0803E6C tridentswimmer4
514,326,584 *3484CB3FAF330411B326A303D18404ABB61C598F tridestia
514,326,585 *348AC9794614380EA91AA647162403F479683218 «triduum»
514,326,586 *348832120AC04C3EB0DC5FAA494B2FB7670E7A2F Triebe»
514,326,587 *348A03196076BA04D444E2D03F2D6C53695986BB triebwerkskörper
514,326,588 *348BAD30018D8D8696D6688B093D06413C8F1AEA TRIESHMANN
514,326,589 *348E826ADB944B72EA0BFD4F5E0F3E02FBE63993 trievequ
514,326,590 *348288119D5A097B663C81A6E0DE403F877C8314 Trifoil6
514,326,591 *348E6E8F8694FE298463ABEF852416D6A6F02477 TRIG270BALK956
514,326,592 *3483270241FBDA909FAA4D8A342B982DA9899CDB trig2k
514,326,593 *348D2D704885D42705B8C544541BA84A3A4FD58D triggerhappy.livejournal.com
514,326,594 *34836050C8250E40DD67C720BAEFBF0A77480C72 trigilesed
514,326,595 *3483C94E437F17274487AD9FEFC54EC2A6F31405 Trigleth9
514,326,596 *348A7F7CA897B8414F1D02E95929F02FE8F2EDE6 trigonithyris
514,326,597 *3485EA6D1E354AB5500204E364155AFBA030FBD6 trigonospora8
514,326,598 *348356D2C67D2ACAF43705CBF60EE971C8C867B6 trihemiobols2
514,326,599 *348AE5047E6CF719483C3A770A70773A0EF219E5 trihna sandro
514,326,600 *3484B46B1D85C1248988F2541C028097A0CFA2DC trihydric6
514,326,601 *3486BCA9BF436464B47EA868A5208A561A03FF65 triinparn
514,326,602 *348832A4E50CA62F3FA647E274A24F523AD63542 triishatorio
514,326,603 *348B7FD3D64E2D9DE5C68E2F8D8D14854CB77982 trikaloka
514,326,604 *348DBEDF885884A40B95E0A386AF9961C81DA1D4 trikryfon
514,326,605 *34858136B41E364392EF17E2D9A1AE54F900DDD1 trikster abacus
514,326,606 *3486DE584686B9E4F62760EEC401E5FB66735EC0 tril0gi
514,326,607 *348E91AC6CE847D00826A6309E76A9375A45A0C0 “trilce”
514,326,608 *348AE0F160340173EA88EA96342FA2265A7439C2 trillada0
514,326,609 *348D8BBB58FCD6C581537C17B87BA7A0C2938159 TRILLAVI.
514,326,610 *3482E40872453529F9DC39ABF832391440F32BEB trillingefdslers8
514,326,611 *348B5FC8751CA638D73C9C2BB0F455F0D73C387F trillionqldnetcomaumozilling
514,326,612 *3483EC925039BFDC0192ACF1B2B739B0F1EE02CF [email protected]
514,326,613 *348E3479241E8BD1AD63215A0A2775B12A9D4703 TRILLIONTHS0
514,326,614 *3488036D802838E04448C944C9D1F359CAA86846 Trilobita0
514,326,615 *348CE34C010AEE90C109DEFC6FEE62508CAD5660 tri mahar lazuardi r
514,326,616 *34885695A9BA77661CF40273BF885C49FFE6C443 trimceltic.comwww
514,326,617 *34818C51A9880FBFD57D147957A4C15E70585977 trimestralied
514,326,618 *3482ECE191B6C9AD0785E728C77FE65AC6339085 trimetiel
514,326,619 *348C5B803B1CE78A44F7912836C1E4DBB160C525 trimetilxantin
514,326,620 *34833FFE34AC7897A1F5CE9B3D7EB675841DF5FA trimikut
514,326,621 *348E8BA07C51CFE10CF92A60938AC8298C9AA551 trimlionses
514,326,622 *348E514885CFD8654C7B1A85A1DD6DB11967FC0D trimoraïque
514,326,623 *34826E4C0797AA9BDC75A0518D07986D17CA5907 tr
514,326,624 *3488C5FCF702C5FF0CA0633F8E96A10AFB048A22 trim_tab tr/I/m_t/&/b
514,326,625 *348AA3F7A375CA0263849544AC14AFA6AAA05FE7 Trimtram4
514,326,626 *34861525186D9E612C3AF0527DF3757A9C7ABBFF trina casey phillips
514,326,627 *348E4DA81FD6C7F6E5C0D3105F43201F315992FF trinadelauter
514,326,628 *34842658ED8DB37FA54B0934885AC89062F47695 trina etoriaga
514,326,629 *3480B7A5915A85725B402DACCF8D7C3BAFEBA596 trinarazon
514,326,630 *3485A0DAAE274D2A8CFDBB3893E5777B2DA88C6C trinariddle
514,326,631 *3484FA208E1C472794A40140A47E2C715AF65F98 trinavantassel
514,326,632 *3480A7377D541C352D488AEF3FAE2BF07C8741B8 trinchieri8
514,326,633 *34807A6B9009295381644B1A037A4F84CC9697C8 trindade couture
514,326,634 *348DE9F9DC63277C936A5CC142CEFFC98401331D trine۲
514,326,635 *3488F7A40D3CC23C7F9C1AFA2D1B65EBD0CA32AF trine celine mortensen
514,326,636 *348B643BF72174600E7FB5AB569C12DA895D4619 TRINETTA5
514,326,637 *3487D9817C9E03E07B7F3DFAC3AEDC6B071DA75E trinidad.auck
514,326,638 *348F6567C84B1446F803A18BA22ACB886F188328 trinidad.bascas
514,326,639 *34823172A3E51BC684E8727CA995A293CE349485 trinidad.befort
514,326,640 *3483A9DCFC0BD7825F60A57C6E5724B614E98EFF trinidad.bullinger
514,326,641 *348A4C22165C2BF0762448A8BBAC490D8B62CF81 trinidad.chappelle
514,326,642 *348F8D7C31C7FB9612FD7777CA6FC7DF91D9FADD trinidad.delaney
514,326,643 *348812F277A16969232B65496F8A1B3018642508 trinidad.eichele
514,326,644 *3489957579F75DC83A8E7A7168B71A996C6298B8 trinidad.mateer
514,326,645 *34824D31D034267B2671A8C369D7B99E90904733 trinidad.rivadulla
514,326,646 *34879836587E0E314299AA467D51FA5EE060695B trinidad.sheng
514,326,647 *348648B759DA3E76014561992C0AFA6BEB428929 trinidad.siwicki
514,326,648 *348B6EBEA085F16DA566BBDA29534054D90AF9F4 trinidad.thurmer
514,326,649 *3481F8CA63E1262EA87AA2768EC5B93CBA5A0B87 trinigarza
514,326,650 *34821207E91872350E17EE3FF8D33B099849A1FE triningS
514,326,651 *3489C65A5EECDC53CD45B4433666A66CCB206CED trinitodoria
514,326,652 *348A89AAD39A71A299745994D80FF56C4F41C1EB TRINITY002
514,326,653 *3489E062C149F06A335DA4A7FF281BBA984A93A7 TrinityBuoyWharf
514,326,654 *348BE3D35B3E38D222B9575F3910AFFCBCDCDC29 trinity group of three forming one
514,326,655 *34842194174FADAA2B9E5C38CD5ED5440EC6D301 trinitylimit
514,326,656 *348FD5F2D53BC58432691EBD918C98DFD442C90F trinity shaka mlangeni
514,326,657 *348554FCA494EDB1484CAFE02F9168A06FE6C56F trinitythanjavur
514,326,658 *3481AB68587374535F5C5619021342A3ABCDC54E [email protected]
514,326,659 *348C5FFA500CB2C2F02C25E4A563F6F82A823AA0 Trinke6
514,326,660 *3487998CC0C59A295CEEC9F2F49F756F635C4E1A trinklein5
514,326,661 *3481E02C4ED949B900C2B50A7DD4942FEE4A3C04 trinkwassersprudler
514,326,662 *348F9E3492987884068149BF9522A96FC0192190 trinnabustamante
514,326,663 *34854FE1A727DC754A848F9F2F6AEDCCA5DF75FF trio in e major, op. 5 no. 3: iii. menuetto
514,326,664 *34804B76278D33D45856F466E9257DA569ACB923 triomarleyano
514,326,665 *34877E9D8A93951F9E148AA9ADFD5A767BD7AE54 triomphe1999
514,326,666 *3483CFB04E552B5667E89466ADA014CF9B5ADFF8 tripbsw4
514,326,667 *3482D4EB03716BC7F24481BDE457045EBE781F63 TRIPDAY
514,326,668 *3481340F5EFB97DA27C98EA6B645CA83B28AA444 Tripelspiegel3
514,326,669 *34870AA0BCCF6CF497E77D25BFA2C3F005352B32 triphasees6
514,326,670 *3480AC8385219112A686225A4FFB9AF5725C8B43 triphosphate—protein
514,326,671 *348DF67418C1BE7414D4204D0FDBC3EB799DD193 tripitaka sunjata
514,326,672 *3481DE888B625FA8020F568926D03FFF0D952001 triplasi0
514,326,673 *348906EEF6633965AA092C7CCA2B725B5168BAE0 triplasiase3
514,326,674 *34802522BDCD2FCA7C5D95C51357224EE96C2FA7 triplecolored123
514,326,675 *3488C07F44782C98A7AAE5D3223850EA3A102F67 TripleConcertoforPiano,Violin&CelloinC,Op.56:I.Allegro
514,326,676 *348FCD2311847E69D83E88A5B3AD4533EB053EEF Triplement5
514,326,677 *348C65C0E0A4AA806C361C104E8FB322D208B9ED triple raw
514,326,678 *348942F4C0FBFBF484C130B4E2546348F7BF26F4 triplettzustände
514,326,679 *34815672CDBD07CFC66E56E3D8DAC9F127707B30 triple x racing
514,326,680 *348962C2D5D06E905FDB10271A38A69B5E42D01B Triplicate7
514,326,681 *348533CDB96A722942F04FB3B9B4E8BB1BFDCB70 TRIPLICATES7
514,326,682 *3484DC8106351D884B40AB55DCD20020E96E02AF Triplopiaed
514,326,683 *3482968099CF15A22B12AB109051D12577D46AD3 tripolar1234
514,326,684 *3481CCE385408CCE7EF298047C74E2E8F28DDB9E tripolitól
514,326,685 *3480A4B7CDACE99693F46F5F101A9CB012D7E27A tripp795
514,326,686 *348D78199B411A58A566AC900406163916D2FB3B Tripp820
514,326,687 *34880738039C91BDCD721CFB787A76F261180115 trippelnens0
514,326,688 *3482275804DD1D83EBD310A7B54779698CC12860 TRIPPER19
514,326,689 *34847791540F6421B0AB98A57CA0912DB0E35DA9 trippoli7
514,326,690 *34837469080B04FD36D5D2148B528045C1C67D59 TRIPSPAM
514,326,691 *348A6EF1EB312844C61FF2D320C0115EEFC47ADD Tripterospora
514,326,692 *3483940448DACCF66030AC093D99B0D6A5E9B1F9 [email protected]
514,326,693 *34810FB706C78B1B0BBA94B7A3232BFAA5FF8C61 tripudiamo3
514,326,694 *3487D618AD5C82164A35A60DC9D7B8A99EE151B7 tripudiates8
514,326,695 *348958C9EE27C7FD33ACBAE40DB51F502A3AB31A tripwestmoreland
514,326,696 *3485DF7BD256BFB0325AA0B352FB5620B671F34E triquements5
514,326,697 *348D24501BEBCCD80F13941615208C1B73F8C8CD triquinoyl3
514,326,698 *348771F8B10E3E53B2CC0A4B09E443E907E6EB05 triromadhon
514,326,699 *348D89F50F4BB5A723B9BC1E1091470C31D8830F trisarianggondowati
514,326,700 *34881E3B48164759177DAA7003BAA922DD67144F trisavanamed
514,326,701 *34881E0E7C03FE12334276F61DAFFE0857C25FA9 trisa wentz
514,326,702 *3484A868B48E3F94D3E830DB32348633339ACDA7 trisch greschner
514,326,703 *348BE5F3B8BDCCBB833E7D9BC9E383F089BB1267 TRISH#1
514,326,704 *3488620331181DB6C9DF6076A09EE64660973B4F trishabe
514,326,705 *348F11E4EEBA5D6338C439D0D1F6D885485664C8 [email protected]
514,326,706 *3486060B82F146C7CD82B2E00F9D925B56F00FDC trisha butterbaugh
514,326,707 *3488729D93302DD36739371A3A68CF4B92AA9548 trisha covington, keke wyatt & kiley dean
514,326,708 *348D94749DB1605D7235EDF549E9ECE5CD6EABA6 trisha faye oraye
514,326,709 *348361EE3806C1A8F8D1F499A6E485DD6CA06D2E trishalin pillay
514,326,710 *34806EBCCF3912BD2AEDB02D3FC84619C49E9BED trisha moto
514,326,711 *3482D1C2EBFB9FE1243C231BFFAF89868AE8BBB0 trisha mumford
514,326,712 *348CE7BB00165BBE79D8ABE3ED9BF7590347CCE4 trishanabz
514,326,713 *34817B0A9C7582219B80159BF18FD3D4A452FCFF trishana ubickparsadh
514,326,714 *34829E343B92E20C542266095BB59AA282D22FF6 trishapehrson
514,326,715 *3488321ABEEB38074B2496756A2AE6BF03694A5D trishaposter
514,326,716 *34817F045A6073DD7D28CE26E09F11C441D3B70E trisha reynolds dorries
514,326,717 *348C519D45ADB5DF55EE060CB64F206F6C0998EC trisha scarpelli altuna
514,326,718 *348FC79F58C6F1693B92724CE04CD9943008868B trisha schlegel
514,326,719 *348CE6D9DC3E011AF827E3987296375411CDB792 trish boegly
514,326,720 *3484859E5317D7C977F42A36D2A85AF7C748952A trish feil
514,326,721 *348AC4B9BA2EDA8C35A92566889DA96E5065308F trishglab
514,326,722 *348CC05D2149966C0F9DA7B1B2A83380F0463524 trishhillmann
514,326,723 *3488EB9F8DF61055068BB93D71B73B58C4A63772 trishit chadha
514,326,724 *3485934461FBF5F8763F5B6C4684A325A6728EED trish merna pestka
514,326,725 *348FF4E5FE74881E647A655F8DE91C9FB207AEF9 trishqe trishqej
514,326,726 *3485B9EA1625D1193D4706E25FA2B350CA4B3B89 trish stratford
514,326,727 *348100C3E3E7BD8DE29CD969378674640E5E319D trish villar
514,326,728 *34825F05D090934DC7892FC2BFE45929CE1B83A7 trish wynne lewis
514,326,729 *348CCC85D88A91C922E56C6D423133296CF5164C triskaidekaphobes?
514,326,730 *348AB338D540A95C6AC9CD43F9C3170254660968 trismegisto4
514,326,731 *348B4AB0F5B166E4E43E0501687AB11ACA4C673E trismuscynicusing
514,326,732 *348CDDAC0EEE8ABD4E606996CDCF7B083377FA69 trissevrks6
514,326,733 *348E7FF368923A71F930F31228FB3BD546023AE5 trissie patton jackson
514,326,734 *3482873B843ED2D8A697C0B06EEE0C94216736B0 tristam6
514,326,735 *3484D140F4BC905E3F3F9A75ED1377D3C376976D tristan.barboza
514,326,736 *348CB4254CF777A8F813B3926615D6476AF22F0D tristan.batteen
514,326,737 *348EFEDF8525936CE1FB76E5A727FE17A6B2D076 tristanbrucal
514,326,738 *348252AA76484EC9185C3E487ECC616998F3C698 tristan.carlozzi
514,326,739 *348A4E8D4EAC873169342BB3BE98D7976D3858EB tristandaisY
514,326,740 *34889B0902E674A70312B4732C13BF76B0E2A156 tristandecember3
514,326,741 *3485FCEEF22754226173AB286FA1F1844B6C052C TristanEtIsolde:MildUndLeise
514,326,742 *3489CD642215B12B6217248CDDC8FE12C0E252B3 tristan.figeroa
514,326,743 *348507A4316D7D87180D79EB88E20EC39C601B0C tristan.forguson
514,326,744 *34803260D51AC2AAABA05D0A0D8C2285BAD2551D tristan.futter
514,326,745 *34899F4D6EF889D4A6025263139F389CCFB02EE4 tristan.guynes
514,326,746 *348C9B8FE6792DEF79CF14BF1401342BEB936E76 tristan.kahanek
514,326,747 *3482EDBB844C88EEACBB03F143F18CC364844F4B tristan.khalifah
514,326,748 *348DF4E110187C6F87A6AFFB4131E5B05EF3A4C5 tristan.kramb
514,326,749 *348E4D4A8DFF680B96812C1A8CCA84D4AA211EB2 tristanlinantud
514,326,750 *348C9B2FD47503B111D46D4AF0A21FB40ACED36F tristan litaker
514,326,751 *34810B2B037A25759654164B35AB9FD87379F0FC tristanmartha
514,326,752 *348D9C9EABCDE7D5B40D7ADE682696316F63D04A tristan.melendez
514,326,753 *348B94F30A809B734AB55D8376F5A8287DD83F8C TRISTANNIQUE
514,326,754 *348D1E7726750E9BCAD8A3883263AB8D3002EA26 tristanoatmeal7
514,326,755 *348F99677B651969A6086D55C6786CF1BAC65A5E tristan.onishi
514,326,756 *34842FF1D24B5FE98A83049CC763A7D7A5BE8DF5 tristanordlund
514,326,757 *348FFBFE099FD174622B1659C17FCD4FA1DCD4F4 tristanpaw
514,326,758 *34839E14E7D298065A7856CFBB177BC53897A7BD tristan.popiel
514,326,759 *348019D990363519FEF7C59E37C96236723322A4 tristan reakes
514,326,760 *348DCD21BA201A29B3231B3A32E3F92BA341DF94 tristan shawn
514,326,761 *348984F665DF579C79391CEDF4A408BC54EA696D tristan.sinstack
514,326,762 *34801B336B38512EAC589E8203B8F0F715A2EA31 tristan.sisomphou
514,326,763 *34871397E534C2779D0B7CE8270F595AB13EB64A tristan starbuck
514,326,764 *3481DB79ECA8FEAF98EC0961E53E553E839BDF59 tristanwarner4
514,326,765 *348CC6AEA5DDACCBAE663446CBD1C61AD89CA69C tristanwendy4
514,326,766 *3489202C54C41FE2BD78CA50B4CDF1AB41C29047 tristaritenour
514,326,767 *3489006455A288CB23A3C28255F86A94A1C3A559 tristely2
514,326,768 *348FF745290B41C00E949416F3F8D217FB4ECD10 tristen441
514,326,769 *348144DDE4BC433A07B9C691AC23E52CBEB5149F tristen barton
514,326,770 *348E805B700E704FAE711F75FE1D036E08A373B0 tristenbjorkman
514,326,771 *348AA08AFF66869C43B3A2AE51198AAFBE133B6B tristen jackson
514,326,772 *348E50DDAEF99CB468A99E2A062EED3ECCB7E8AE Tristin533
514,326,773 *348081D0F0EABF1E417F4F16E2668C8235CFA76C tristinetobias
514,326,774 *34837A6B1B7AB11E785DFD57B9869A7C6506803B triston384
514,326,775 *348B6E92E1DCE9BF9AB4A8B5E634B9FB892FBD4F Triston742
514,326,776 *3483DF3EC6624721385EA9004FF59B9EC16406D4 tristrip1234
514,326,777 *34891C73554B4BFE18B77908C8CC49E3BCB4B53D tristychan
514,326,778 *34872E071C68F99AFF75CB39417ABBE77843D22C tri sulistiani
514,326,779 *348A45EF9D781FDB389169B90346F05B5F5712FD tritag0ni$t
514,326,780 *3488617B865DC50E2631B884FD706E352CD05868 tritare3
514,326,781 *348A8A94B2F5F8AAA43833272A4CFC48AB065551 tritbeat
514,326,782 *34889494CD8574049F94D86E400F25EE5401F6C0 tritiarna
514,326,783 *34841B82056270FEA243DF84B5399F94AD404BCA tr^itiiye
514,326,784 *34810E64A88717867B4E6C8E26507A69E43B0615 Tritwnwing
514,326,785 *348F9DD869CB19B1487D94297DEC2EE0D788DCF5 triumfbag123
514,326,786 *348163E7051D6A40D3C11243E1163E7C4C90B562 triumfovo
514,326,787 *34810A07B566C278C06FC01192ADFB47831E0467 triumphantlie7
514,326,788 *34883F397214C56A2E6617A3AC8733445B19BCFD TriumphOfAHeartUKCDRpromo3
514,326,789 *3485031C196DC9792C93EFD39956EBA33DE394C7 triumphumbsw3
514,326,790 *3486832D95A293F179C58343F03E00D32FDAC647 triuqsnailuj
514,326,791 *3485F00090D71E7BD02ACC2861C0FD1AE0F752B5 triveloning
514,326,792 *348B396A88B82DAEEAB6FABA32EFABB3858AF1EB trivialiteiT
514,326,793 *3489F8113FACE8A37E1FF30FBE1C5349A5135F50 trivialjulie
514,326,794 *348F02F896E975155FB800B0C21E46C5BFFA3593 trivialle1
514,326,795 *348DDE3AD31B8874608D0185E069B5E904F6DB3C trivialspecialized
514,326,796 *34832B57A669305D33F8403A0CEE0E29DAE3E49C Trivulzio2
514,326,797 *348B33FFC3A18AEE24C4005E5295EACB073D94BA trixiapops
514,326,798 *348DEA4F5D026EC2B96FBC8964820FABA7078BBF trixieanimals6
514,326,799 *348B8E071E02AB531D43BF18B92A8ACCB1F9FC8C trixieawesome9
514,326,800 *3480D9355B5D70BBFC1C7B24979AEA1E65CB4D5E trixiechappel
514,326,801 *34878E6E2B4AEE2425AECDE35FC48CA4D6D229CF trixiechocolat1
514,326,802 *3480803FC30D86096E77AE2F859A43ECEF6EDCE4 TRIXIECOOKIES
514,326,803 *3484829A1AB7C029D77A627EFFA32B5BADDC531C trixie manapat
514,326,804 *3485C8FC7E1EB2BBCCCAB3D7B15296A377001E11 trixiemeow4
514,326,805 *348E57A5C98F3E01DF59F30B98EE1F943AC6DE43 trixieongpao
514,326,806 *34830E04CC195599A2FB8DF24E8B29164FC65AD9 trixierabbiti
514,326,807 *348490AAB7918EC20202ABE7DBEC8A30FB08ECF5 trixie revera
514,326,808 *34812197D67E602DA06363B98DF6EC7887743368 trixieshadows4
514,326,809 *348E19EC17B85D3EC27D0CCF9578F4D16B9E5548 trixombaterias
514,326,810 *348E289D45679D1954B3B3016569BECDA835B3EB tRixY
514,326,811 *348B1F5BAB2AC02171C35CAE0E4E516FB2FE0D5B triyufidah
514,326,812 *3485CE6C5585A2EE67FFA3401C8A73AD45727DC8 Trj2620
514,326,813 *3486BD776064474624C3962C98706BE3FAB22CEF TR
514,326,814 *348530F2B8FF5ABE735026FFC5F9CBD269CD5440 trk55d
514,326,815 *34850EB23C98DB7C7F3924E809480D22E1E9E78D trkjkkmsah
514,326,816 *3486422C464EAE0FE962AE9EE707E0B44ADCC3D3 trl0711091407005
514,326,817 *34831023CC0DEEDB491F3B7B88AFE0771FFCB8AE TRL90210
514,326,818 *3480A730D9F1B061388022F9BA703A612E33516F [email protected]
514,326,819 *348EF965509A2F7FA9CAD6DF5EF86CA6B521C397 Trljamo
514,326,820 *348B09AAD5DEA435E021AC73024EC06049386952 trllpsh2
514,326,821 *348A283505F18D0ED44B6B5C9A2E27498002DA9F tRMG
514,326,822 *34850145FC25667BBBBA4E49CC04A472BD66D70D trmjnbtlngn8
514,326,823 *348A35E2B99DEE0C8613B5EAB7956FEB7E46AAE3 trmptxfls
514,326,824 *3480B34305E26220B896952BCE796D7897C0D93D trmstgt3
514,326,825 *348F7FD5CC2154ADC4AD73BF3C2E894588877C39 [email protected]
514,326,826 *348DAFD071E574CCD219A1A2799F9765087827EF trncndctr5
514,326,827 *348D3525092B8249B64D4478BB068ED6067E1C83 trnctnrcptr
514,326,828 *348CC578E4448C892245B9164CBE46717CDCEF8A tRNg
514,326,829 *34899F6A3584D243B4699B59EE7E8F84BDC9DD5E trnngstrgt
514,326,830 *34841607D8D47D86364F528A784CC14A7BF070A2 Tr
514,326,831 *348D1075D960D55ABC08FD1D545EBA497AECFF3A trnsclscncy9
514,326,832 *34809562E81255B50E988429ABA81B9DDBC33D33 trnscrpt5
514,326,833 *3486478D52122B01EE829477EE416A08CC78022A trnsfrmtnsprcssn
514,326,834 *348F856CDC5C3A61BD1E8C7C2ADA6E3B880F3F88 [email protected][email protected]
514,326,835 *34889CA93574CF1AE20FECCAB21229B57D716E68 trnshps1
514,326,836 *348A5B9A8B501363AFCA024C48A0F7198BD0D31E trnslnried
514,326,837 *3481686822D77B70C16B7C3706EE19A48CCF34A2 trnslpns2
514,326,838 *34846BBFE787E9A7D20C866CBC5275069F22D88D Trnsps
514,326,839 *3488E4FFAA7D5768D519F5DE6497CFC108DDAF31 trnt1954
514,326,840 *348E9AD955847B562CD1A756DDE31AC19E552BDD trntchck
514,326,841 *348C47F7FEDEBF1B6A7B3E0A71029E184E88AD36 trntprljm
514,326,842 *3480685F2540D5CD47C391EC640FD3D7EBE47B08 trobille4
514,326,843 *3481B90B75B8FE469D72E02F0269573B769060A0 Trocado3
514,326,844 *348C95881641F7432864A60124C0C59009AE2DE4 Troca Pingas
514,326,845 *3488D5B3BD1A44FFEAF90B73F5A5609D94F1B70D Troceen
514,326,846 *348FF593B44D7D4D4998FEF8CBAAEE2ED65FF0C5 Trocendorff
514,326,847 *348660E050CFE2FD85A4F59BCC975A7815A59F64 Trochaïsch
514,326,848 *348CEB4D0E019C9BE1ED4BCABCE46487F31E46E8 trochę
514,326,849 *348E95FBC70605DF13C08A3C395265ADCD095D8A trocheus?
514,326,850 *348757D02128DAA424CD4D2DCF8D4860B5830085 trochisked
514,326,851 *3489F14902CC578FD7EDA44634EF4FF68656A4DD trochlearis2
514,326,852 *348FC7E17434371F8746DC4216CDE5DC1C3E84E9 trockenlaubwäldern
514,326,853 *348834A0C2B3A29915D1136820939AE53A26B330 trocknenens7
514,326,854 *348A7DBD0C0B9B02B9C4462F4DF1B08FF1DDCCC9 Trocoidal
514,326,855 *348246CC647211DC98110B5F3BFC12BF23F553C8 Troddin4
514,326,856 *348C6E6C6F51A816B0B00FBFE02EDBC0E29C6FA8 TRODDYN6
514,326,857 *3486AD93DFE95A16D2CD966AEBBD976358EA2751 trodnevnu1
514,326,858 *348AE256BDCF47C35F017D85FD7B9B2EE3C0021B trod rodgers
514,326,859 *348F8FBF9E0EC85A83070C7135487BA76D56F22D troebleerdes
514,326,860 *3481F1E0DDB9E32C5E7AD808C701AC013E228BC4 TROENDERKVARTETTEN
514,326,861 *3485083F308D13AE7AE65847DAE665B51F6408BE TROFFELS8
514,326,862 *348CC4EE51ABE7EF01D79EA285000CC5A1146217 trofimena3
514,326,863 *348309D1B7183B6C3AD72D23C6BAD2AD1E43E86A trogdor teh burninator
514,326,864 *348B035DE0D6610103C4F5B7145DA05BF74DEC44 trogloditismi8
514,326,865 *3488D1FEA2FAE3A1FBB05682456CD6E898EBF88B TROGODYTICUM
514,326,866 *34819E940E965106B1B6630821434173FF8E8629 trogyloses
514,326,867 *3480EBBF604A59C46B31B349A731E18A7AC25E0A troilussedoguio
514,326,868 *348E31CA9BD9E2A6BF5824CAE32EEBB7E2023C1F trois autres m
514,326,869 *348BE808A1898DBE30F3408962B9AA070021A32D troishu1
514,326,870 *34820EB037B32422491DF18BF987CA9573F10F20 タコイカウイルス(TROJ
514,326,871 *3487A2AB3106856071DB241419E03E3AB8701D66 TROJAN HORSE - A COMPUTER PROGRAM WiTH AN APPARENTLY OR
514,326,872 *348603C88D36D5DB85DF1C43CB3543CC26C7D88D trojanman394
514,326,873 *348CC4CA1517EBC562BDB645393D8718AD69076E Trojan Ras Reggae Box Set (disc 1)
514,326,874 *34828E742E9549C04A386327B31076E6B17A7D0E tro jeunesse 60, volume 2
514,326,875 *348E11E2901DC6BF0C76B01550E0DD100CDD5624 trolgeis
514,326,876 *348488B9C3C9C158FA3DC735AEC01E3BE6207F7E troligened
514,326,877 *348C8457C0876417DEC215BDFFA43B0F77B1A2F4 trolleybussernesed
514,326,878 *3488425670BC7762A0C6FED8FE8414EFF88A81BC trolleyretrieivers
514,326,879 *348EFBCB45C19D55064852C71EF34F45A66D5414 trolleywagon4
514,326,880 *3489EE950EA9AA71472E7118C66201545D2A420E Trolly4
514,326,881 *3481560178621BD34E66EE04754878B86C245CE6 trollyingp5
514,326,882 *3482222FF0EA0878C1176C849184BFBEA7C19E35 tromboldbsw2
514,326,883 *348BB6F23F71CFB2D3CC42E918999E3E8095D7C8 Trombong
514,326,884 *348EB1977F0BB7A02918CDEDE51F77B18FCC889E trombonies3
514,326,885 *348586A1C8074B170D9122CF5F7AAC600DCE294E TROMBOXANO-A
514,326,886 *3481E7C9E27A7EC20433B9C05A0BA69D36E27972 trometna5
514,326,887 *348C2C9A3091D9A77B47175960F97D68A4C5ABE8 trompetetest7
514,326,888 *3482713570BEB82DFFB061F7678279CD3B9E9840 Trompette D'Or
514,326,889 *3481AD59B8F60FF4C1CD59BB5B00F5B39D16865C trompetvogelS
514,326,890 *34817427C5F438F6236D120AC7504F6C16632B70 Trompin1
514,326,891 *348C09EF663E2A847F1670C6AD85E03405424B9C trondijerry
514,326,892 *3482F7C68754F4492FC60858B2731333CC75C652 tronfoelger8
514,326,893 *3486549F4BFBC5BE66A2A1589884D9BABFC3E2F3 Tronile2
514,326,894 *348BB036C90EB4EBBEBAEFF5EBF693DCF6D51246 tronix9
514,326,895 *348C98586FF166368680BFCF7804BCE035F74202 tron morgan
514,326,896 *3485FCE9906ACEDE4014AD86A9B89D0E7CAA8CC8 trónörökösmű
514,326,897 *348B37EE64B82998DD8CD12FE6D38DFD4D9D4917 Tronującego
514,326,898 *34888AC2A78CBDAB544B26A0803CDDDA7F4C9A2C Tronutoj3
514,326,899 *348C305678AF6964B34FE4984E7886AF8E54403C Troolyem
514,326,900 *34871D3A8E51D289872C733B486B34D6D6BF3C9C troonsep
514,326,901 *348772A60CBC8D02E8EF50A439776FC4FF6794D6 ”Trooppinen
514,326,902 *34805E98722E3D917638AC78C6D5D0A3099D3C21 trooptna0
514,326,903 *34844E17051073D1C6FA6AA49D1E5B3834169C03 troosryked
514,326,904 *348C93ECB5C2AB4B6626E1F13AF4FE4840F046CA TROPAEOLACEOUS6
514,326,905 *34819ADC9E07EAC11A630A9F9023D5F7931B75CA Tropaeolin.
514,326,906 *3485ACBFCA3CEE7193912A5AFCDDC9F2314989D3 Tropaia.
514,326,907 *348F9D417F1774CAF64D6AC7400DC2AF457BE25E tropationsr3
514,326,908 *348E5EA8D1D7B47A79A1CF292CCF1705455C13B2 $trophica
514,326,909 *3489530A7018ABECD39520491547DA55E134A848 trophogenesises1
514,326,910 *348FA851942C8F22B9DA75290C67DE9BF7B304C6 tropholytischen
514,326,911 *348B77E05B516740D77219F1B256A8A4035DC7BD TROPICALGRID
514,326,912 *3482F01FB1248113FC7449A68258EA87D28F8B0E tropicallies1
514,326,913 *3488644EC0D860F3CA125D4FE7DADDF7A9E3E193 tropicalrootscebu
514,326,914 *34825F29B2BC044F207CD54AC1B36869767142B3 tropicaltan yulee
514,326,915 *3480B515F01870BEEB8B499F4F1043BA0F19E45D Tropicano
514,326,916 *34880770F327D5BBEAC69C8328ECBEDB63CD92EC tropici5
514,326,917 *34827551520AD5EEDA0875857607C0EDBF2AB672 Tropideres
514,326,918 *3481B991496D1BD82DE4288F38CFE3613F1F138B Tropitexes
514,326,919 *3486571CA42DC280695FF5F2AD1159C01957530B Tropnaec
514,326,920 *348B99AD56931563ED6F4CA9727F28DA2B76A682 Tropolo4
514,326,921 *348FD42AA5193CBD70A6C6D945170AEF54A1039B Tropolofaciens
514,326,922 *348B977BC0E9F041A1A26A0DCCACBF1331784711 tropometering
514,326,923 *3483DA2684D9DC6470379D37CA32EEAC4D186AA7 troposfere7
514,326,924 *348327D48CE12CA41B58EB3D0C870202361269A9 troppars3
514,326,925 *3483AC2A290E6E87856708C130C316BF39EA65F6 troppe
514,326,926 *34883BE474CCFF64D71C33380D14727FA0D741CF trop peu pour moi
514,326,927 *34829D8BC1DCAA3B5DA346264A5FA8D43AF5C78D tropsimesed
514,326,928 *348467E3285739CCA692CAF6DB3B17C911712AA9 tropsnartlanruoj1
514,326,929 *3488D2F977A0E6F5A9BE3F1EAA42C9D8A6F53746 Tropssaps
514,326,930 *348C8B0634BF4F6B88038B1CB60DDC307BF8645E troptiur4
514,326,931 *348439A3C9BFE64757BBC40D7FC91392E0ED8DA4 troquerasesed
514,326,932 *3481D8554C02625472E52FE19D47D290DB2DFE32 TROQUIONS7
514,326,933 *34837B6E629858FEE8A349D51D6B7A2704783149 Trosky004
514,326,934 *348C5DF974F707956AD0E705C9E56A3D64EC7EAD trosmæssigt
514,326,935 *3484BC9F0E5A22A56169B55C47B08657EAE0BA4A trostgebende
514,326,936 *348939F049DEF87A93B1EE76E26A592FE9F6B066 TROTA13
514,326,937 *348A10807DB86527459B49CFBD5CAC16135D2930 TROTAMENTOS
514,326,938 *34821A6F0171F1C31AD07E63F69D8479016463D1 trotarnos1amos
514,326,939 *34827F3AF14D272F0375966463DF4B8FB48DB216 Trothlik5
514,326,940 *3484D24DDCFABBEE11F7CE7F7220B4FFC0ED07F2 trotl509
514,326,941 *3483DC0225B6685E3ADF47CB099CD30FFA113001 trotlapleaplopemake
514,326,942 *348EFAE4D54EA10E0480839C3FF124E2020D8E41 Trottaste4
514,326,943 *348F8B9605DBE281FE97211930026D22611D67EB Trotte`r
514,326,944 *3485F1D77273F9FCB2AC1369C886A3B179432490 TROTTEREI.
514,326,945 *34847E0DE6A1C3E587DD022D56FAC979FD03D65F trottetytrottetytrot9
514,326,946 *3487FBB1A822C45B1A5B398512C5674139703A62 trottoirtegel7
514,326,947 *3488292A7956972AB2E8B9CF9B523E7900951AE0 trotzkopfs2
514,326,948 *34849967315B5D619F7A03ACFA0D1C5BE855DE85 trouble.160ok
514,326,949 *34811881EC1441AE2A535E458C2AB47CC911FD71 [email protected]
514,326,950 *3487E4DDAE0B2D8561FD91576805DF597AD16B33 troublecandy7
514,326,951 *3485F823335F4BCDB653A438E9A1A060FAFF2374 troublechapman3
514,326,952 *34827A6025086EA26D6566EC45B745D3D52665CB troublechrist1
514,326,953 *34842C3350CC1D15C58BD85239B0B64307E9FEF4 troubledlove
514,326,954 *348F65B80361479556754C13383D91D8A49153D5 troublehotrod8
514,326,955 *34803EAF7190D0307E61186F230DA982D0859546 troublelarson9
514,326,956 *3488FAE42207F3FDF2FBE7D4982B415D05264846 troublenirvanaed
514,326,957 *348F211800F6AA786B176EBF72A705B1879C80A0 troublereggie
514,326,958 *34883922EA34EDE9EC0C5C41D71CCD883BCA2A82 troublesandy3
514,326,959 *348B4E7E346503BBA5476BBFDB5A3211FBAD57E7 TroublesoftheWorld(Bulbremix)
514,326,960 *348E394EE4D527DF191F463310C0A0C92C0BEE8B troublesomene
514,326,961 *348DDDEDB943FC621E6C868036AF23685087F2E1 troubletribe
514,326,962 *348CA165A736EA62F63917712630DBB28F1E5566 troublezses
514,326,963 *348C479521CC0BD0CE893A2209747B5F60D34080 trouchka:scene4:ix.theguardandthejuggler
514,326,964 *3485ACA6E00AFE9A06886AA2687C00FCB80F6780 Trouent8
514,326,965 *3480AE64BFC95B322549FC94A5071D07BB87CE36 Trouncin6
514,326,966 *3489C173C99AB584C52ECA925C2A4ABD76C1A7DA [email protected]
514,326,967 *34849E409F1719B170B5A410F70A6A64B5B75FEC trousdaleter1ah0sdey0l
514,326,968 *3486284D2DFB1A11ED9CE4FFF6FA51D3976A87A9 Trout1e5t
514,326,969 *34886335C8A0C41112E246878E0CB6A7533ADDC6 trout71
514,326,970 *34824CAD2143CA57194DBB4D0BCE2186F423FB9B trouvrir0
514,326,971 *3488952CDA0C3BED91017CF325931AA1ED7EF7B9 Trovanjus
514,326,972 *3481587687CB7F46923DF3E610EBBEB52CFBCD30 TROVES4
514,326,973 *34849E3EABB0C461B538F24B76B87E35484020BC Troveses8
514,326,974 *3487361B93ACE6AC53F8BA22246B20F154314D88 trovisc4ri4m
514,326,975 *34857315B3B09C9BCA05F98F8064C9E92176731D TROWEALB
514,326,976 *3480F669E200F235937439E9BA96C4FDCC6AAB87 TROWELLING9
514,326,977 *3480A5A8F752C37986DC243E3780898F710E2349 trowgaze4
514,326,978 *348F70FE40FE9EA0526355ED31251EBEEF97618B trowlliubsw3
514,326,979 *348533CDBBB853AF0A93BD6EE752A84B62022F56 trowretsed
514,326,980 *348927A3AE877D93267A81CFEB1694D6A02F26D3 TROWTH7
514,326,981 *348B4D0B2608A81DC78D0C8D2893568F4BF9C269 troxopedila7
514,326,982 *348A05DCA97AB347897FD26483E6BBE4B2FED3FE Troy325
514,326,983 *348BC3A6A037C5AA29D759BC990EAECD546A675D troy.appelt
514,326,984 *348EA4AD84F8D2B6E3C5CBD6AA852AC70F4B4D8C troy.beauvais
514,326,985 *3485C6EF0CDE6A6E14D9C3E86D125660236B4E64 troycapes
514,326,986 *348C4FCEAC4D39586E4F8035AB1263D86FD793C8 [email protected]
514,326,987 *348231B70D2F60F739FA8714C7CF53478823D89E troy creary
514,326,988 *348EE1E7770A69BF7AAA8DFE5F21A92F4444BEF6 troy.dorosh
514,326,989 *3482289C68BCD4B44ECFADEA77D17741BD256FCD troy droegemueller
514,326,990 *3482686B594E14C8393DA92F6C32B97A34BCBC89 troy.eugley
514,326,991 *3486AF28B414AE4AD880DF1C5E9A2559FB4CA459 troy.flasher
514,326,992 *34896A3BB58C3888ABD872DD8E7E36353A0F0D8B troy.galietti
514,326,993 *348442796921021E3E75EE540503BF03E33EEE48 troy g brandon
514,326,994 *3481380666AC8D10A0A2DC3AB0C8A5C89661D03F troygruener
514,326,995 *3483A23A3D8E6D51B3A708AF45E45F8D572E6CD4 troy.hawkin
514,326,996 *3480447E67215C250E93A0F8982012495DD653B4 troy.jodway
514,326,997 *348E9A118BB7E1AAF8FE44ACB0E4FD8E6EFFB64B troy.lameda
514,326,998 *3484711E1E292E812BFC992FC4E2768AD4855CAF troy.lasasso
514,326,999 *34887F0EC54C461E6D260D80684C5AA7F0DAC9BE troy.levitch
514,327,000 *348DCCF362BDDED3D6C6FFCD272C13F313054B15 troy.lola
514,327,001 *348E4E52BC7AA5661342969AC8AA22732B07960A troy.lundsten
514,327,002 *3483804D730431B2DE7C64E71FD64E9B3A157F7D troy.magda
514,327,003 *348D47CC3DDE4851E1AA76330D51DEA863B2A846 troy m dingus
514,327,004 *348AED94E0E45284C75812602C059FEA6DE2A441 troymust
514,327,005 *3486E345D43BCDD206E92072F0C480E3EAF6C456 troy.nygaro
514,327,006 *348E5DB821598B71D4E5722C7B710357F59DA42A troypeiffer
514,327,007 *348C8BDA2F9F748F86A8A038CAC9100442F01D3C troy rexroth
514,327,008 *348025781007DE06E71E1C29E9EF5F794D56EEE3 troy.richiusa
514,327,009 *3482EE060ED1C992ACE1A593D3611B0659A9AD11 troyrising
514,327,010 *3481B90A04C89ACB8E2B74298BC89F011A509CE4 troy.rodick
514,327,011 *348EF728D8D16518730B683F4F932236C6BFF532 troyrood
514,327,012 *348CDB84B8730BA500DFA932E88AB48643FE5F88 troy.sader
514,327,013 *34835D589A4D1779C4CD190D3847328BA8933854 troy.sampedro
514,327,014 *348E788B262165FBFCBFBC501F7BB1A4FD178E91 troysarkozy
514,327,015 *3481BC46B3EF087412E4B7040B690F09B539CC16 troy scarborough
514,327,016 *34809895500C6283A84BFF4B47E57522C0069F98 troy.shamsi
514,327,017 *34802B48B645A79249B4B66B344FB1AD12EB004D troy.silvano
514,327,018 *3483E74D49B3A22B66B115E12922C78201F04382 troy simcoe
514,327,019 *34876A49AB0417D97A6F884ADD30A7A0BFFA9BE6 troy.stfleur
514,327,020 *34858095D11EBDC500433A7793D99E882260BB00 troy.sulc
514,327,021 *3486005D29133151A6133620574859B98DFA252A troy teitsma
514,327,022 *34872946D0187B66EDAE1591D8487021BB7EB80F troy.thiesse
514,327,023 *348C19F2443EAE38CB5702ECFF59191D9E3C2689 troy.tillison
514,327,024 *348E5853D3DA86015CF76314A8943EBF3119AE5B troy toler
514,327,025 *3480ACD1D49CA36A5F1D61776A11263CF5A922BB troy.uptain
514,327,026 *348F7C7F467B4F2A81E60A85484EACA94FD9C829 troy.verburg
514,327,027 *3484157538154DD3206FB55BC83D2C5CE1D972DE Troyyort1
514,327,028 *348E21B2F3EA027179B58D7B948267BA91A68582 trozkismus
514,327,029 *348DC7C28DC833791184DBCC4A2290A458611027 trpllrsed
514,327,030 *348C32CD6C7223D84928D79BC57C90751B3C64E7 [email protected]@k3r
514,327,031 *348E163035EEF4FA51D7F21194EE5684A35DAE24 Trqnrds0
514,327,032 *348D943523F64DB13CDFD5FAD155AFF9567BC3CC trrlkln8
514,327,033 *348B33BBDDC54CA4C534710A40F4955441A73A49 trrmrbsw
514,327,034 *348A7162EA3D6C044A2323FF00E11267AEA4D01B trry1985
514,327,035 *348B7704D3A844CEABB78FB1AF78C78DEB456C90 TRSAO
514,327,036 *3486FE57C5697FFB4F16CE73DF8CC4F6903639BE trshtpmys
514,327,037 *348555E6CCB3C36A60EFDAF59735EEB3610E9EA2 trskelkvotie8
514,327,038 *348A0F0C026FC0B34BA994ADF36CF7281FCF4307 [email protected]
514,327,039 *348C1BC376DEA68D3163A8C478ABEE452FB19DF7 trstle
514,327,040 *3480000B0704D95A47FFB09630C0A779BC3086CA trstskllsvn
514,327,041 *3485112EE0BA0913BC5DBE15A901EAD3908697B3 trt_
514,327,042 *34820F33AB55963709686332D4D40ACEF18EB974 TRTDOOL
514,327,043 *3483CA6EE9A42DF440829189D19637088B35355E trtgenel
514,327,044 *3489114E53D46536C186A8E62F2B5775001D364F trtiton
514,327,045 *3487021AF1F4A68567EE2F6BB0A695BBCC707F85 trtlfltch
514,327,046 *34871EB73B1AA15E5F2C20FD9EDF2D9290D39A2E TRTLJLRF
514,327,047 *34811CED88CE6BA6B1A2F914B09E0726AE239D01 trtthet1
514,327,048 *348718CB65425B710872BE640C279F4EC18CAD65 tru3v1n3
514,327,049 *34886A90650FF23EF630B3624C5DE63B1760428A tru8520
514,327,050 *348E81307867F214A39DC8CA46B40DAC3FB4F527 trubatgioi
514,327,051 *3486DC672D1D4199C1607D2F3F708C7346B1FCDE trubeln4
514,327,052 *348C7FE14771BA7CE0AF4D8D249D57DE9CFF8C87 Trubichino
514,327,053 *34877235E99E7128D9E38C299637ADADF84C84B7 Truccati7
514,327,054 *34845E1B740F6C80692EA4E20DE22095C8656851 trucidanting
514,327,055 *348A8CBDFA3DB75239B5AC46E1CC3BBC2097B0DD trucique
514,327,056 *34809295D1B356D37501265F1756B4C961CBF779 truckala5
514,327,057 *34892705F7250B7AAFF0EBC2230484306969AC12 truckbuddhas
514,327,058 *348417F30CE36F9E4FDFEE20E9010A3AF87B237C truckdrivers0
514,327,059 *348009BFE07525DEBD1802D27B6F3B18BC71EC76 truckee-donner
514,327,060 *3485F23D15FC814CC20AEC655D04BA1F92B7DCBF truckgunner8
514,327,061 *348C32370EA168DCD950E5AC4546AF35433EA2A8 truckharley5
514,327,062 *3485FA517A3A24DDA28241BA63732E89F0372972 truckmailorder5
514,327,063 *348DA2565C0A7FBE9C89FDB28ED359C35C1E0900 trucksabcde9
514,327,064 *3487EEF7F165B469F9DA67AC83DF842BB19BDCFB trucksbertha6
514,327,065 *3486B4A93AAF51A50B4BF5CB1A84A24EB2B5E836 trucksbigbird9
514,327,066 *348597F952CAE4B90595E07FD63C3A697B6C7891 truckscopper7
514,327,067 *3486E2C2CFBEFC07EE4EB565C38B4435DE773F27 trucksexcept3
514,327,068 *348BF85F204F61E8D49E7F34AEB0094C0C6E09CE truckspearl3
514,327,069 *348B8274D734A7D15D6B8DA87428A40108211287 truckssimon1
514,327,070 *3485B98CBB281E80472813DCC485230BAE81C325 truckssmiley2
514,327,071 *34838A3777C82BFBC3E67C655C4480E776156946 truckssoleil3
514,327,072 *3485E75AE6B3C8A986867F121ABD5A04A2364009 truckssonics6
514,327,073 *348055F212D5C35753E0B7C86BB44A7234614D53 trucksstanley9
514,327,074 *348BCDC2524D3C8718A8A8D11BE6982BDF6EEF8C truck:truck
514,327,075 *3483E7DA9F6D686E6FC2AD165D9266932D718BBB TRUCKWHITE
514,327,076 *348037C99A0CF79364DA669088F144A39A383171 tructruque
514,327,077 *3482D24DB1FB46AF80849D0D72198F5599C2900F trudadon
514,327,078 *348BD24FECB5C0475F9CC35E3A1CF484BA8DE288 trude gundersen
514,327,079 *3483259CFC3A737E37DC0F6719BF8FD21FB46450 Trudelnde
514,327,080 *3486D42EF7107604A751C7D1FC540CE8A870FEA4 truderuntquE
514,327,081 *348F75EFB96B97706B087DFB7C07E21B7FC9B4B0 trudiedewey
514,327,082 *3483EB4D39F680DEEF4BE4791E042EEA906DF021 trudiedillman
514,327,083 *348BBCAEBE86AE95B47AAFAAB1B6A3872186EADA trudybabb
514,327,084 *348D394D34224BE2CC18F7B4EAC6576632753962 trudy cool
514,327,085 *3482689C3631DC2304CC1222EB041FE3FA3F1234 trudy copeland
514,327,086 *348A6075E95DF905EEC290988751321BBF71E10D trudydeitz
514,327,087 *3488AC0401425580DEA3ADAD6083B3579C8C15ED trudy gourgas
514,327,088 *348A34566E15A23A378286C3491379D2BBFBA9F1 trudyjudge
514,327,089 *348EAD946BD6DD8E894D7C263FF2DD55A6899204 Trudy's
514,327,090 *348C951E7D7C0A3B051584A535A663FEFC8A463C trudythibodeau
514,327,091 *34829496827D5C6481623AB6F128507E59032EA1 TRUEBSGADNOZ
514,327,092 *3485E4A8872022840EB248B9D727011487CB7FFE truecert
514,327,093 *34857FBAA5C50FABD5D3A7B33B660F56C91E53D4 trueheaR
514,327,094 *348D91EFF8C5D1F905E44DA65CFD32C2EC0D01B8 trueinwardness6
514,327,095 *34893D704E69710CE1BAA0D903D7B1530A3F9354 truemajorityaction
514,327,096 *3484166E884E4B9FFA5F8E6BC77FFFA205D6AC7C truenamebsw6
514,327,097 *348914903821620BEF30209EA12FC7A409A605E4 true or false.<BR>
514,327,098 *348CCDCE7A35D4282A7252D5EE883FE91F193700 True, peace dulls the sword, but war shatters it.
514,327,099 *348AAE3D0C50EE88B72C0A4465BEDAD1D240BA31 truepspo8
514,327,100 *348D5C9DFB2F54F19D1DC06791CEC41902C86E88 trufamos4
514,327,101 *348DCE231E35D430F31E0AE02D3C4F36A2CAFF5A truflex5
514,327,102 *3484CE2330B0D528BE26D6DE4E9F525B4B0AB8F6 trugppel0
514,327,103 *3489B0AA742C18CB2453D0996AF0AAB15FD83719 Truhtiolingen
514,327,104 *348965BBA64000D2FA703AEE976829FDF8DCB8E5 Truitje6
514,327,105 *348CDF78C75C4C607713F913DD2468B2D6AE9681 trükiarv
514,327,106 *3481D4AD27408BD35B586296ABBBCE857B5CE125 Truletta8
514,327,107 *348631A30F3276C2E15F15D8FABA62D85F9FDE54 trulla77
514,327,108 *3486F53E1636BF40C2FED0AFA7FA8E2CCD6EB3FD trullisgarden
514,327,109 *3485A34D219E930124C35DACF5AB732A0A61EEC1 trulsen123
514,327,110 *348FF1554AFEE5A29DBE8636B44168ED06025F0C truman.balls
514,327,111 *348D8E3FE9F14CA18B9A2DFED2673B1B081362FC truman.cavallo
514,327,112 *348207BBED7EE9B89CA8B4775513B7629AEA9C6D truman.chiz
514,327,113 *348A142383187B16610986B7F0719F7D4984906B truman.dankmeyer
514,327,114 *348C45851C94F6932B763ED3DD018DD1B9C9D0F7 truman.doster
514,327,115 *348F1F2E02A63DDB434ED63197B4D602DAD6BFD2 truman.garrell
514,327,116 *3483385DDF68D6041C1ABCCC4ED9F2C6B27FF4C3 truman.hermansen
514,327,117 *348F416B2037841E6F6B1D02E06C47789C708976 truman.kalhorn
514,327,118 *348D691DFD8C407199417E517A3E87A1D4053D68 truman.kendall
514,327,119 *348649E05BBD81057BDC19B617F5D7FA64E9F970 truman.lamarra
514,327,120 *348F586DEFCC756638ED6E391A7EAB1056B84D98 truman.laviolette
514,327,121 *348653A92709E22043BD54CDDE87B5B7BD6AE583 truman.leagjeld
514,327,122 *348141405710971A1690EF70A2EA7F960586EB7D truman.mccathran
514,327,123 *34810D02E821E4D8B80C3F6D478337F34768CB45 truman.mccorison
514,327,124 *348779E6FDFD5BB42C78133F1A1E4A0FAF4ED370 truman.mcnelly
514,327,125 *3483BB3ABF70A66859371EC713D4CBD25FD79AAE truman.morelos
514,327,126 *3481F7EB5E98B7F40C872E2F72CACF81794E3302 truman.neubert
514,327,127 *3488DA046DC58A0BA7AC504B072C3A7FFB732C26 truman.nickell
514,327,128 *3486DA05E588C1337470E099F78DBDD07A08E3B1 truman.niesen
514,327,129 *348054C949DE94A2E962CC480D3186F5EDE356AA truman.occhipinti
514,327,130 *348683B0603A13C8379723EA88FD619F678D3575 truman.pettigrove
514,327,131 *348493763B1CCFE184BF388FEB14DA234A6A307F truman.plescia
514,327,132 *348F58A44161B56776D956C19EC0E3D0BB671DC8 truman.quirarte
514,327,133 *3486FAE39F00AE1DA5346F9D1A79AA3C94C9E65C truman.ringen
514,327,134 *348E1A892BF604CB0E5A1EDEEC63A764B95C382F truman.strassell
514,327,135 *348B95D2EF8D40D5F295B517A62DA5713D37EDA3 truman.sudweeks
514,327,136 *3485147B3F273877BDDFE4F0D05DED995F71A816 truman.viard
514,327,137 *3485288178F7BC338EF128EB3952076F7F2170F7 trumbleton
514,327,138 *34854190E44507F000C74647AC346D0FBF16243B trumblyn9
514,327,139 *348E7D99E769D24B2A51569B077B726FAA2505B3 trumpery N: ~trumperies
514,327,140 *3480708665B878A003069CE4273AB09F31CE23A3 TRUMPET121212
514,327,141 *3481BF22D9BF7BE05ED79AC8786C082889487B51 trumpetaccesses
514,327,142 *348D92ABE7F561BBE91ACDBA4A8607934C55C1D3 TRUMPETCHOCOLAT
514,327,143 *348FD71D992C4E2372DDB70B19A465D27120BD46 trumpetconcertoineflatmajor,hobviie:1:ii.andante(m
514,327,144 *3485C830045F0F03DE955419D771ECA521EF9660 trumpet in spades
514,327,145 *3488261FD9E2C087FCEAFD46FCCD7C8943E63614 trumpetjeffrey7
514,327,146 *3488E031901B333EE13A403FABE408E349E02E9A trumpetjuniored
514,327,147 *34840E7782F794B5505CEAE60FF6EAD3E1967CF0 trumpetrunner0
514,327,148 *3485FF4A12E57FABFBCC5453FBCDBE27F29B607F Trumpets From Montparasse
514,327,149 *348DED3F0A0B4E4CEA3BD9E0B46068187E064076 trumpet—sort
514,327,150 *34806FE81D63A070DC72570955543886042DEE8F trumpettanging
514,327,151 *348FFE6ABA56B06EBC9E92F133B8CD9DB3850D2E trumpettigger5
514,327,152 *348FF100D660D5FE8BE2047AF93AC7B3C6C31CAE trumphing
514,327,153 *348CB0452545F47B5776456982014CD401F49D70 [email protected]
514,327,154 *3482D7E0943D7E0493401C39895DA6F2AC5DAF1F trumpping0
514,327,155 *3480409CAC30560B631500B8A0DB48C74E7208EF Truncinas
514,327,156 *3482D51FE5D6DB09BE196541453EA8AD6F41461C trunction
514,327,157 *34816C0DD92DB5D273004643347F8F2CE58BC268 trundlebed4
514,327,158 *348669ECFFD5D2D6799FEBC017338C844AF7B3D3 trunkeringar0
514,327,159 *348BDA1212B570F4BC6AD182C1DBD9A450A09114 Trunklines
514,327,160 *348AD3A77463D387E6A1269576F85C8E28A322E5 truocnai1
514,327,161 *34871CA6E50AD3FF7E2744874BDE3528A88ECAD5 truocwenyraunaJ
514,327,162 *348EEE09407F267F0E23D577934549BB1BDE26E9 truong the ngoc
514,327,163 *3486451B685BCC393C19A55E586CF4D59A2E14B5 trupdrejtë
514,327,164 *348D0E1AC0F447832BB4083B7E91732E567EFF6C Truppenquantums
514,327,165 *34859E6CECF27B8737F57EE4F93F28609042E4E9 truptibaluja
514,327,166 *34867EEF95AA3B1FDA5C65A2406C667424471E24 truptikudalkar
514,327,167 *34861E1C8CF0232ACA9396B4647ABE734D7240EB Truquee
514,327,168 *3488546E5C3E321B8C058C3B57BCE96420FDA674 Truqueront0
514,327,169 *3480C679313B922A74D986B2998232F31E171DC2 Truran123
514,327,170 *3480BB378E0F6A15F28B533E5041351FF13D9D03 trušču
514,327,171 *34808D47E673BB7ACC762F8B081CB120929EA6F3 trushin4
514,327,172 *34857A91F5135DD4C558B05790F28FB2117F7F81 trusseropes0
514,327,173 *348CFCB26B6ADDACFCBA8FFF4621B9636EA1146B Trussid8
514,327,174 *3484D4F7B5ED3BB8216F67E00C1FC95EE93433BB Trussmak8
514,327,175 *3488885D138B23ADED1C176AF78E7FA1E42618EC trustbelievinglydevoutlyin5
514,327,176 *348FBD2CE50ECF0BB83915B8E57E10B0F641B321 trustbreach1
514,327,177 *34891D57FA52331A6CD75719E429832852872A84 trustbreak2
514,327,178 *34844E90A7AF0D029838A677761A8F134D8CD2FB trustworthiness3
514,327,179 *34886F45DCC6DC73E3419C9106777A60A13EB0CF truswell1
514,327,180 *34878A2F8AA87B2088C8CE2968E138D0115682A0 truthfullies1
514,327,181 *3480EEBDB44A2AF796DF5F0096DB55D0AEB35D1B —Truth—who
514,327,182 *348F9E72D527837737A1DB9E49B537F6EDB3740B truutopia
514,327,183 *348E292FE91CA272B66F16F58F6A813246BF79A8 Truytes
514,327,184 *348F5D639278E9AB4BB814989E6CC04BE832CD7C TRVEJRSDAGEN
514,327,185 *348513835FB7E5F12936390CF535DE82D41CE9C8 Trvenoj7
514,327,186 *3483E774568D07C3A8A5F8C89C7F95A1C18F7F10 trvlychtngzls
514,327,187 *348F1AAC8287CA14055780BD160DFE098C35335F trvrlsrsljlghdns
514,327,188 *3483D743B94AC61841FF268C35BD2A53FDE88A17 trvselskapa
514,327,189 *3489EA816EB4564100F568F3C9F52F490CBDA498 trvwakfvck3
514,327,190 *3486C50021DA4755F964108545C65490E8589595 Trwreal2
514,327,191 *3482BCE4F98B74C0EA3F11C01020C1CA00483942 trwzylurv
514,327,192 *348B6B23CB1AB6F481CBADF001217D0525825D51 tRX!
514,327,193 *348CD7EDCF8980DEA77BD11C9ED150A698CA9F5D trx00000000
514,327,194 *348B92C4EF2EF626C0BA49A94104A592C5505631 Trybet
514,327,195 *3484C1610B12A55F9D7E49AB9451B785ACB72C3A tryfelar9
514,327,196 *34800AA1D4378F6FA536341EF019F80BDE071D21 trygdekassing
514,327,197 *348CF3C7AAC68DE90C6B979DA4F202CD5F01923A Trygge?
514,327,198 *348CBE0618B3A41D68803947953378F9BC26B8F8 TryingtoGetontheRadio
514,327,199 *34817B2C7DF358486FA2F8932795E0561E057D52 trykkauken
514,327,200 *348C25E5D19A5A61B90DD207EF84A044BABA8D06 trykkerilrlingensing
514,327,201 *34881F8AC1E795E9004E3F36A5EBE1A1E97A102C trykknaping9
514,327,202 *3486A624A7D80D0F5A4B4E885694EFC56664E69C tryllerierne3
514,327,203 *348F676959EAAA8DCBF45686B52FE9417B6AF701 trynande9
514,327,204 *34817EE51F914DFFF5DEACBABE23F8D474D7C728 Tryokhprudny
514,327,205 *3485B4987967DC8C32F65609D39F41873AEBBE08 tryoutgograduategravimetric2
514,327,206 *348F3AB6F212A465086E82CC7016F7B6B427BC48 trypdee-deedestoroya
514,327,207 *348E71CDF44742ADF627526356AA321E05DBF56F trystan58
514,327,208 *348B63C40555C63F82EA3BB7838CFFBCB6856D49 Trystan589
514,327,209 *3486B0D48C069735D0140361E2A13723BA882651 Trystan928
514,327,210 *348EB63DBB32279C3DEA6AE41A41EE0FC955961E [email protected]
514,327,211 *348A16298CD51CE5BFB094B71836D7523A791E70 TryToWish
514,327,212 *34869F7F5FA3339EA97AD56391C42E5BCD1C8E66 tryzor
514,327,213 *348F54352ACE5CDFA4B4D1618A050487B557AE93 t;rz
514,327,214 *34850244244436B17CB0F4E10056F75AB1150372 [email protected]
514,327,215 *3487053E0685BDC4E914E83913884C8A25DBD740 trzecioklasistami
514,327,216 *3482C9D5C8F88F195227C71FD422DAF2A0387D9B Trzezwi
514,327,217 *348AF83CA7DDA7C79978D9F0B2A9AB30C13AAB79 [email protected]
514,327,218 *348927D3D0DCB14768BF10829C8E2028B918904A t=<s
514,327,219 *348AA6B3EA86174F8CA94DFE188BFB9C397D3840 TS180
514,327,220 *348FE0A9EBEAEF381A35ABECA3A155289FC305ED TS5022
514,327,221 *3487B9DF53366C6E34BBE7DC752C3B5095FEF848 ts573
514,327,222 *34867467EDE187E24B7DA1C83FA733096E206171 tsacpacpmubnworbgnidoorbtuo
514,327,223 *348CAF340F3C2F4538A318B335A3F6989138C2B4 tsafecivedrepaccitnanaginanehs
514,327,224 *34865B785C193767927F1B4549E132C673A423BF tsafi avigdor
514,327,225 *3480E436628CE63BD1AD08CB34130E7E7AFFB118 tsagsgol7
514,327,226 *34859FD3C5D256E90A6D8B1DFD3C4AA2E7750962 tsajote0
514,327,227 *34823AB5404C7E1F2A945C01A730E7C7047233E1 tsakie tredah ngobeni
514,327,228 *34895DA576F223F3D5F393147DC86C4460648F2E tsalane4
514,327,229 *348EB4C1920B7300748A28DA9929006C44AFF546 tsalbohp0
514,327,230 *34891D52445F9561B471DD85BE376AB16B6746FC tsaloon6
514,327,231 *3480E877AA6ED63917253A16143DE69E6B12C276 tsalpodo9
514,327,232 *348FE46D36CD5229C019C3FF4DE2BCE15DAFD812 tsamarahdzakiyah
514,327,233 *348372997217527C535BF430802E154FD349F0D0 Tšamerovon
514,327,234 *34837F53334EA3A7E3CF3725FA6CC4A3236410D9 tsanmygeiguod
514,327,235 *348CFC1AE5C9F4CDDECCBC827A741DFE5126A136 tsanmygnon
514,327,236 *348837041048E65AC80CD265900C18AA5CB5E220 [email protected]
514,327,237 *3485BA8D2BEB7448FAA9442A7737192187E924C7 tsárchéim
514,327,238 *348797D2950954C869C00F89705F09E27946E642 tsaregnotfid
514,327,239 *348F237823682347C66C3936663AEDF5623548DB tsarrigerne6
514,327,240 *348299C5D4EBBA507DD7EF25B6C19C0B4683799E [email protected]
514,327,241 *34882460C7F2067A8C531233690A54423413A946 tsathush baruti
514,327,242 *348097B03BB532A97ED889747E942E358BCCB222 tsauchabbing
514,327,243 *348906FA07F3EC3112E6BD2C19DD8F76629240EC tsaudangsi1
514,327,244 *348E41D6C345351D76B5CE6ADCBBCC44A0AD7F79 tsax62
514,327,245 *3484DEE6A6C2A95F93F7515367B3AA7793455804 tsbaotua2
514,327,246 *348C82D496D7112E71765681B634E772BB30B464 tscheljadgortrans
514,327,247 *348008CC9D6D166F6586377ACE52AEFDBF851220 TSCHEPZA
514,327,248 *3480A293ADBD86DC5FC67BA5201B592419A87531 tschlitz1
514,327,249 *348C07340220C236A74DB7F597939C61C236BD89 tschunojar
514,327,250 *348FF76CFAC9181809AB1B841A83EAA85BAB6494 tscl[email protected]
514,327,251 *3481EABEDEEE0BD217C4A86F610E29F90C9CC9DD Tscscreen
514,327,252 *348376674078B04A229700ECD98D71C3DB6282EE tsdgider0
514,327,253 *3488FED118ECD76429F4BB4D3CF49A533E4E830D TSDGTRLF39
514,327,254 *34833E1FBFEAB9A71FDDEBBB13E68A025C2BE49C Tsdlaahegrevo
514,327,255 *34878647E2C8101759788DB8CBF50EC229D203C7 tsdnedji0
514,327,256 *34823EA2318FEFB4D24D3BC77C27FE6DB0EDACD4 tsdnettelpo
514,327,257 *34875100A93B5C0E09621EFBFCEBA563F897BFBA tsdnettelponO
514,327,258 *34884CE49CF81D05A6D44A4A5733F2A3D4E6331A tsdy1950
514,327,259 *3488CFA8156ED0FF028D013542C58EFBE1D2E991 tseans
514,327,260 *348C95C5FF8186D9D833626DFF95EFC215D2AA72 tsecnarf9
514,327,261 *34801AAF221BF450C088F155B964BC8321DF6B97 Tsedeim8
514,327,262 *348030B85F44E92B75C7BE183CF955BBB3B9373D tsedeurp3
514,327,263 *3481D84ABC6E0D49FDA6B03CB71EE29E7235D348 Tsedzekeb
514,327,264 *34874C1347C4FD0D295F8DCCDE66E1AE8A58E88F [email protected]
514,327,265 *348C8454ADA752BE1F55608B4A23C8164DD91BB7 tsegnol2
514,327,266 *3489D6A0CE37F557E2810381B20E3A24A7F91A5C tsehaineshsimon
514,327,267 *348B371069D71A9CA46BD56EC240E039742A1A77 tsehcsiw6
514,327,268 *34829BDA1D9F3145782243B4889874B0DBFEAFF2 tseiddig7
514,327,269 *348AFC317E2BE6B5CCF4B9057ABA212E321D0D62 Tseidlog
514,327,270 *348F63E08E9DD73584FE9F2953B5640DD715C290 tseigdots
514,327,271 *348C022E957358FEBB7FC78518CFDF8FC506F7F0 tseiggaj4
514,327,272 *348826184AFC336D907E41AA1CC8D156A4262B5B Tseiggip8
514,327,273 *3489B0D6055372E3F60E2285E0ABD7ABD9693FEF Tseikcum5
514,327,274 *348A9952FF19B175126D22ACE3844429D12CADFD tseildlihc2
514,327,275 *348EF90B8D22916146520F92EEDAE06E5DCE0EFB tseimitt9
514,327,276 *3480AA9A6C5DB43662BAB220FDFBDDE2A9E5C62D tseimsah5
514,327,277 *3489457108CD54B926AB3AF65DA788A7E0D9AB8D tseinniksing
514,327,278 *348C61A007DE528C5E5EB1D87F147FD606FA7A61 tseippahc
514,327,279 *34834AE883037104B12E24C3567585B51DC10630 tseirruf0
514,327,280 *348A77C9CB779F800A8554CAF4060ACCC00BA79F tseittif0
514,327,281 *34859FE6D20EA0149E71FA5DF801592B152DD566 tseittun3
514,327,282 *3484817C00CB2FD96FC545C144B46F1BBF7E667C tsejrjak6
514,327,283 *348D4E2ADE55A1A93C02AF868401EFF93A8847B7 tsejrjaled
514,327,284 *3489C697587389CD6B7FD2DFFA31D9B2FD4D44A4 [email protected]
514,327,285 *34852986C2C2EDCEE09609BBBF306DD1F9083C59 Tselooc6
514,327,286 *348AA3A05EEDFCDBA873B3C286E19C3C1689D6A3 tsemtiu3
514,327,287 *3482A8E26D629330CD36F484B28E3BFF4B5875CF Tsenen
514,327,288 *348F9C99689BFF7FA25A22DBCF88B981AEF393F1 [email protected]
514,327,289 *34836923043D351764F98405A1CA13B4C1CB6DDB tsenggnest8
514,327,290 *3484D41E17D4527DFC8D3DDC2B8CAA2AD469E07C Tsenohnu9
514,327,291 *34887B60060D00D60A28EDD0062B6716752DF686 tsentraliseeritus
514,327,292 *3486D745FF0852E29C53F801BD019BF023D59ABA tserayalpxE
514,327,293 *348184C6C75CFD12299DFC34B88795BAA6ED1E79 tserofleirbag
514,327,294 *348CA5E265491FD194ECD3C3FDBE4644E1D8024E tserttsert
514,327,295 *348A9055FE0BE21B1114CF4725399E29BDD8E3F7 tseruonohwsb
514,327,296 *348A999E70D184AFF9F41DCB960046322F19D021 tsesiviitagen
514,327,297 *348EC0BE202C2F371ACBCCCD7D8340386C7B2721 tseskyrR
514,327,298 *34858723AEA526AE489BD2124A508C305DAB75C8 tsetfeits
514,327,299 *348345CA0DB86D890CC7B43FE6A548C3AC8AAB7D tsethcsr6
514,327,300 *348E77C80F43B4BAEFF04DE2CFF4F87FDE63C79F tsetlahred
514,327,301 *34853EB8C57D1BBA8B7151A379544ACDD7AC9B16 tsetnekking
514,327,302 *348496DCF77C12BF136975B9AA18C732F03B6CD0 tsetsgna8
514,327,303 *348E4C5B5AC6CC9B2BCAD6B9913F4E82241DBC77 Tsetssim
514,327,304 *348CDAAE5F4235491E2A8CF8B2D54565483C30BE Tsetsuh4
514,327,305 *34892A85224FF13E7774FAC5B211EEA061994BDA TSETTEST
514,327,306 *348FE0C5E3B6D85D4CF2FAE717FE09F342183B72 tseuqcamgib
514,327,307 *3484D5CAE09CBB8FEEE92D5F261B8B93486DAE5F Tseuqdaed
514,327,308 *348645B55466B22D672CD2860532370B232F74AF tsezreuk4
514,327,309 *348AC1955F52A4EDA8717D34DB30424C2974AA36 [email protected]
514,327,310 *34878090AF3956465C43A0ADD308CA1C4DA0B6DF tsfeorts3
514,327,311 *348C81538CA0CA91C7B6B4D2567306126F9BBE14 tsfiewhc7
514,327,312 *3480570EAFE0EEA76322112807089E3807243B04 tsgasretieW
514,327,313 *34858446AA6CC09A8F5E4AC1CCFDEFFD3D9FB88C tsgeilba
514,327,314 *34878BBB2B30057A3BE1629218E16E70CA776748 TSGESETZ
514,327,315 *3483C5773227C331020B7DF43F81C8A466A77E8D tsgidraanegie
514,327,316 *3485D366EA6EB63F03A9AF2B00D67F5C5888FC08 tsgilazl1
514,327,317 *348CB0C347E05ADBBAAE93FD255042C62ABC3825 tsgilewu9
514,327,318 *3485395D3F8ACDD116567B330A40E7F150307745 Tsgimmal8
514,327,319 *3483B5D755E81F0064CB60A7BF0A20B15505B76D tsgirahsjirg
514,327,320 *3483F1D6C0EAEEF9983519B68788A1D250CD90D1 tsgiremmol6
514,327,321 *348AB02D30E7F532993C0A8DF195BDBEE4332A7D tsgistipsing
514,327,322 *34873E1FD67932CC2B5EBF0B543357B7B38FDB10 tsgitsurno0
514,327,323 *348A3641A1A6626A0AEB5039DB9AFCC5C0847AF5 Tsgittev
514,327,324 *34819B4604F977B3F579E0B3FD33D687E06D812E tsgnarws
514,327,325 *348682339291010470A6C47339404DF5CB824A45 tsgscqj5
514,327,326 *348974B8055337FA9CF8B7AB14F6FEFC52E4BA44 Tshekarchiereidae
514,327,327 *3486CDE9445C7D8B0537C014EEC92A58064C6F79 TSHENICEL
514,327,328 *3484119072F5CE257A720EAC7DBDDCEF1495E954 tshepobokaba
514,327,329 *348D86BE8B5B8D5C4E01BD06447B89B19CF7470F tshepocharlie
514,327,330 *348E9E900BFFEB7B7543C44F3124B851E1D448A2 tshepo makenete
514,327,331 *348C80E664A83630D2564136EB19C02ABA5909B2 tshepo tshenkeng
514,327,332 *348BF83278775C757AAFBC7E40F3DB969B3238A3 tsherkasyn
514,327,333 *348B4B8E9B4E9A2DEC051EE77AED477449EFE922 [email protected]
514,327,334 *348DBB2CE5323E5814851E1A09F58E0C9349D5B5 tshiamo motlhako
514,327,335 *34895A4EDD1640E9ED3B9A8424BA8DE62546D4B7 tshidimojafi
514,327,336 *348475C5BF661A27D10706A01FA77FA6BF2E1E90 Tshien
514,327,337 *34894AF3DF7380F559C8B052C6F1525C45B53999 tshifhiwanephawe
514,327,338 *348CF389B2F8620EE3FC20732AE378091C1BF153 tshimologogareitsanye
514,327,339 *3482C5568AD7CE06404755638A78889B2FF9C839 t shirts talk
514,327,340 *348D01203A841528B2598EE68F3C3DEE3CE7AE23 tshitwe
514,327,341 *34855F961EA55AF9B7F8AF5D466766D9AD9ED763 tshivhungu
514,327,342 *348B5CECF6A1AA977A78945C797B9E02A1B27657 tshmstrs
514,327,343 *3489ECAD15ABCE6EF3CD467E3EC518FF9AF76765 tsholofelo assegaai
514,327,344 *348234731CED9FF835C7CBCDF83861015839F5D1 tsiahcralihP
514,327,345 *348EC90ADD3E7C57155DFCA98789A5EE8CF1FBE2 tsibmail5
514,327,346 *348D73800E8BF16BBA95676558F8ACE0071611E4 tsicitamgarp2
514,327,347 *34842CC5FECABFDD5FB0A20F22BD74F9D3854908 tsidnuts3
514,327,348 *348D81CD9E97B118D7F8BC7843DB3F0A321F72CF Tsiejri3
514,327,349 *3482D9063946A6CDEE1D5328ED3EF508F932FF31 tsieklyhs
514,327,350 *3482FAF3DAF92378916CE9E49728586248B02905 tsielgtnE
514,327,351 *3487C867E0CE99504DF07094AEAABD239939FEF7 tsienytning
514,327,352 *3484BA92BE3D513B511C202AEFF958E50835561C tsietna2
514,327,353 *3487316256C7495C1AA9DAB80FEAA9F9815C7756 tsietnk0
514,327,354 *3485A78670A91D139F44C9BB4A25EBBD5547CCB4 tsietnyh2
514,327,355 *348BC9CB12056A152D717C9F1D409B15723CB20B tsigarilikintavatziliki
514,327,356 *3480ADB40E7BC69F19CE5464BC2CD8572400790E tsigrene5
514,327,357 *3486769A2D7DA315162468F5BAF0D9EF79FA7DA9 TSIHPOSONPIED
514,327,358 *348376BBCA0364915B8F447525B89599B7725AAB tsiliif3
514,327,359 *348873E8684A113CD3028937A0822976D29F848E tsilkcab9
514,327,360 *3484D20C64129AC09064DFEEE13B65D9044DB374 Tsillole
514,327,361 *3489E17D340AA382DF515236E3CE07EA95D10E1E tsiloicsnap3
514,327,362 *3481223C81B0E972FE8E26B2732940B896978DFD Tsilsreyd
514,327,363 *3488D01F26CBD74F7A2E5B4F62E6C78976B1C85C TSIMBIDAROS
514,327,364 *34817C51BE68A3D7CA11787CFD90B06A831B02A1 tsimheob4
514,327,365 *34861DF67AF71947188614C84EB31E90987DECEC tsimianaf
514,327,366 *348D25156496388122D3210281F8D6B151472DF4 tsimitpostraa8
514,327,367 *34806981513867560F8860BF39AA8D09CA79101C tsimmosi6
514,327,368 *348DE5AAA6F19C700FC1EC62C951141BABCD4F0E Tsimo
514,327,369 *34863ABF36BFD90D2CF348E8421220B94D42D418 [email protected]
514,327,370 *3489E20E7B1773D93E5E1A0658107AB2FDFC1ABF tsimretliF
514,327,371 *348B29B01914943D6F987A59F5C74BCCA523F189 tsinamorbmit0
514,327,372 *348E7E69A3028A4992C128200CCBC6DB4E6840D5 tsinellehlihp8
514,327,373 *348DA42460BF3E1807E10B9ACF9C8DE40E10592D tsinemon8
514,327,374 *34873684C9874E51B4DDE79F76E4D1CD395D681C tsinniov1
514,327,375 *348A98757438F53E755BA1B711FC7015FF1317A3 tsinoitatneserpernon6
514,327,376 *3485797FDD5D52ADF7EB0656112430E74C897747 tsinoituloverorp8
514,327,377 *3481D5C3F08CC38A9CBACFF78B91ED09623A6D4E tsirhcnalyd
514,327,378 *34874C6F4004106DF29FED45C060CE73BA782099 Tsirhcue
514,327,379 *348721D0ECEC4C0F4904891891B2159545EA804D tsirtemaxeh4
514,327,380 *3488443EC19BCB55EE7389A78BD385E2550A4379 tsirtemoidua1
514,327,381 *348E14AA2C479A0697BD986B9107E8DC2A3FDC2E tsitsitile
514,327,382 *3482E972DF2983477E95AFAFBB050B0F9F30AD85 tsitskin6
514,327,383 *3486C1B5169ECCDC0A12623D90E13B1828DB8C9B Tsitterb2
514,327,384 *348B848116E5E866E21DB54788B22471265877B0 Tsiuqdnu5
514,327,385 *348C674DFC06F61C60039811C835978C3E3DE938 Tsiuqlhaw
514,327,386 *348EBDB2C10DA86D23DE016AE0E11A245859C7BC tsiuqneerg3
514,327,387 *3480188BE2034167B7A85FF4694A35C01B3F5C81 tsiusnes6
514,327,388 *348D0972AFF92C3F9B7423E228AA56DA212E9014 TSIVOLKO
514,327,389 *348F8E1867C4873E7262E8A7380C67FF521B3EE7 tsixbujhbqur
514,327,390 *34865AA067D0A71E80A5DF96F459A9A123D49AA0 tsiyletH
514,327,391 *34860D13BEBCB0469F404D3A3094C1AAC19168BE t)Sj
514,327,392 *3489FFF20DB4DEA67F37E24C8286D750FF8C5FA8 tsjapo
514,327,393 *348BEFDD99C1FE7C2F45517C72F470FA458A1C60 tsjarysj
514,327,394 *34874E342F4D5610216407AF74E9165C066C29B4 tsjileev5
514,327,395 *3485C29FC906D807D0A368562EA3B77D28EDF43F tskcapeg6
514,327,396 *348A09AD755D9CC930E09E6534FEEFA9B595D3DB tsketpalf7
514,327,397 *34844C6C146B8CB99BE7223D6908F4AFD8E0B407 Tskjilrettel
514,327,398 *3485F0361A3E2C55CE6CA7D16E996588BFB772B8 tsktsk.xterra1talkwo
514,327,399 *34873E4401ACD46E43C2DCB84FD128605172301F tsleeitrap4
514,327,400 *348BBA2101233100EB7AE500C589171FD9B3F8AD tslekrot2
514,327,401 *34833BB78602B034A86293B1F18BC955FCDD3BCA Tslheuves
514,327,402 *348B27585F61366A8499747153C0A07C03DAFAE2 Tsloohcs
514,327,403 *34838EA51AAE363D05A6BD57DEF1D4B637374A26 tSlW
514,327,404 *348800ACD31353207788F02F3C34DDCFDD7E1993 tslykilekk
514,327,405 *348F3626C8772F0E97EF7AA16DF96E5CB105BC5D T[SM[LLEEN
514,327,406 *34815F5BB75F59294671E834A014852D0F0FD04D tsmodule0
514,327,407 *348CCC29CCAC5EF6681116E863A1D316ED052769 tsmraned3
514,327,408 *34878ECB1EDB7CD09C7D0A2F4F42E2A95959B33A tSN,
514,327,409 *348DCD794061CEA5B4F449907E7E97C243624961 tsnachweisen7
514,327,410 *348CE7B9BD7AD6B299E7833604AD534563016C54 tsnarev2
514,327,411 *348E0CF02BB612A12A541A9CFF13A5FC3E51F6EC tsneidpp3
514,327,412 *3486770CF0358EBE80562DD9507A159261A320A7 tsneidstiehrhcisstaats
514,327,413 *348FA862556FF939BDE820AD8B0CC353C23BB5CB tsnessak7
514,327,414 *3484373D29D159314C4B7E19B39489CB95DBDA1D tsnetording
514,327,415 *348DEAD640F86FAF7C8BDF5A2C1ADD25205B7BA8 ts-netzwerk
514,327,416 *34815B5E19908F486F615EC5EE2BD5CE08502ABA Tsnnerb2
514,327,417 *34877280E76605513C68E05188004895606463CE tsnukleeh1
514,327,418 *348257EC78BE56EB2F6070877C2D35FF85AAA81E Tsohganna
514,327,419 *348C94ECA047EFBDBB65AF15F4933B53B31C30F3 tsoi-sum
514,327,420 *3485E16E4DB700DE2F1A38D289B9B6233CC0F3CD tsolo dakov
514,327,421 *348BA56B39CB93972CF3BB987C9495BCBF2119F2 Tsoltsol
514,327,422 *3489DCA87957EC90AAEAE87BD44875AB121BF648 tsolumuc5
514,327,423 *348B3F4EF308BE1C40790DB3BA8DF2614E0F8931 tSOm
514,327,424 *3481BAD6030A28443932447A2B3460349687F5A4 tsonejongaz
514,327,425 *348A3B5AB58150E291950F555C4C3D317AB8DD86 Tsotuums
514,327,426 *348ED0CE58DB92FAB69DDE1FD327A852BE0BA1BA tspc.conf
514,327,427 *348F3202780CE79311C42B5B1A25C5B8BA290517 tspelavring
514,327,428 *348B5346C5A57FA44B12D78357E6707C4E851546 tspender9
514,327,429 *3483C8195FC5547A4849EA0A74E1F8708547FCBF tspolska
514,327,430 *3480CDD5168EF352991422248BAC314AB16780F2 tSpPf
514,327,431 *348A38A22C426381C0F0799EEDA0AFDF552E399C Tsraableov
514,327,432 *348F233B0D54668243A07D7F6FF98488ED19C295 tsraabte7
514,327,433 *348F8914109F92A9389D5BEC4949BC693A4A28F2 tsrebuazrev
514,327,434 *348524BBCC80FECFFE84944BEAB8A287DB93E741 Tsregneting
514,327,435 *3484D5F960007A6E321CF62F51D62570EE22EF1F tsreiffa1
514,327,436 *3481473AB1E8267D7BBDCB63E096A2BF5538F8DF tsreiffa7
514,327,437 *34886938ACE0E645CBE814D5FC56FD2E72B49874 tsrewolfed
514,327,438 *348828C0A7CACB47EFA1F615FBCDD6F592F440F2 Tsr retro dance classics
514,327,439 *3482C42C30E9B13EB4A7F88FD5B092D4AEC08D29 tss77
514,327,440 *348B27BB50920711BDB4A0393966830FC8050C39 Tssamlla
514,327,441 *348C1B18900B6CF3EC9A2D328F3DD45ED51E62E6 tssjohnjohntss
514,327,442 *348E437986312F60B49A9679A46A2E39F1B54E2F tstdemokratian8
514,327,443 *34842800B33CA84CB6BF1B61BEC6B6FA19EE1336 TstDM
514,327,444 *348D4C92F3DCCE6AC61D966B2ADC22C7F68E66F8 Tsthcid7
514,327,445 *348C2CE6DB538E43D7029DE0A6E86F5E5229FAD8 tsthcozegging
514,327,446 *348C2F3DA60F04AF3CD3F326F6F31A7057DA8C44 Tstipsegging
514,327,447 *348CF1CE7E01B8079518328A83DFD3BB74ED64F3 tstkaamlov4
514,327,448 *348DD91A936C81CB9AA9F129A713D5C48B9B3FDF Tstmnls6
514,327,449 *348C4C3D4BE36BF57459E349B816F628EE620FEE Tstmntl7
514,327,450 *3487A447632A33DED2764E9F849195FB0645AE0D tstnednecsnart2
514,327,451 *348DD8B6BA92BD229EBB3D51061900EF6E26D166 tstnflned
514,327,452 *3487681829A54736997F25BB384EC35AFDC60DDF tstoleg9
514,327,453 *34888B2CB2BF262195AF24F04AA8E34CA6D62052 tstpsimi1
514,327,454 *348A1DB5EAA989CFC4F9E346F13473C2BF23E0C3 Tstsfctn6
514,327,455 *34880909EC7B08C2EB52156BEF5FE8111E4CF26D tsttstjnny
514,327,456 *348EABD0E4DA814F199F1BAA2E251A68CAC233F1 tstudent112233
514,327,457 *3482E1524FE8D4C914707414A11A99E4FD63D0C6 tsuacolo2
514,327,458 *348890B5914D9D76BBE62AFA689A66F95ED238A1 TSUBUHIT
514,327,459 *34869D00B65D2FD9C4C8480C9B8D8F164F5A37D7 tsubway1
514,327,460 *3483FDCCFB135A7DA989431A9D8531009C7BF84B tsucliBhortei
514,327,461 *34859469E6B894160E141E621985DD55EA3186DF Tsuelupurcs
514,327,462 *348C0577C0631EBF4424C16E1B825D7CE232052B tsuenpor2
514,327,463 *3484CA42D8BF7146553B2327C39BD2DE3E109990 Tsugihag0
514,327,464 *348A2D73EC08835AA65AFF5AD8F99418882E1B76 [email protected]
514,327,465 *3481A2945A396215A6726994ACB001FF1B81A817 Tsukeaga5
514,327,466 *348EA35023F11016F2A87C75913BD260738DA57B TSUKEOTI
514,327,467 *348BDFC3E0395383A41DC40C7796B1E55134555C tsukikudake
514,327,468 *348852CA84114174AF0D51DE588F70ECC6AFBF0A tsuki to rye mugi
514,327,469 *348EF77DE3AB88B09AEDD4C695B04BB50CCFA04D tsukiy0
514,327,470 *34855A5B58DD8CE546268561A5EFC9B575F4C7A2 Tsukuring
514,327,471 *34837BD3BB8B37E70DD174B643D7447DCD95FE9E tsumaming
514,327,472 *34812D72E7F053B234D36C7C0F3B6FCDC571C36F tsumasabura
514,327,473 *348BF1912E3A1FF6FE4B51A224AD9B4E9D595FCB tsumebar3
514,327,474 *348F0EFC6080836341A4CB19E16D20F533DA7532 Tsumida2
514,327,475 *348C102689BD64D36C2B1AE060B41D8295F9DD02 Tsumoitgruppe
514,327,476 *3487653E7181DC9019B4A037BC9EA0A04CF09384 tsunamialex
514,327,477 *34870F805DE751859E3126A996815E8098E155DE [email protected]
514,327,478 *34830E574F48899B1D3B2C9CA6750FBD6D7B818E tsunetomo1
514,327,479 *3482D77A6CD1B63428E6450CBB389A491BB6841F tsunetomo's
514,327,480 *34833071B360033F3E4929073ECFF5A2A1F5265A tsungai rachael gumbu
514,327,481 *34865F49D87F9AD7718BA4AB39EEA1FFD6D2D558 Tsuofcam
514,327,482 *3482AA440812CD037EA63FFE038D23D1221727AD tsuspurgeon
514,327,483 *348EBC2D462BF0BBD03DBCA336F72D17E6A54850 tsutle1
514,327,484 *348FEE119089AC75C3F8C40AF5B94694B323E90E tsuuhan5
514,327,485 *3487B13327AEA2A6AF59A666F5F45207F0FB3AA0 Tsuutished
514,327,486 *348F20705A1A19EC34799CC2EA727AEFAC3FA442 tsuyokuhouki
514,327,487 *348AEFB0847FDF7A4D21CDC1477C346CDBDA9A9B TsuyokuKedakaku
514,327,488 *348BE47E71393C87FAA3B76360FE6CFE2566D3DA tsvetankosturkov
514,327,489 *348103B53797BC80185D6C3AF6B42DC32EEABD0D tsvitsvi
514,327,490 *348D78C3BCDF4B326A91DF0ACB0BF827028FF2C8 tswfhxxifysd8
514,327,491 *3485B9C4E69048F435B2E1FC5BE62317111CB028 tSWT
514,327,492 *3488CDE772398159413DBE8A5B1C05EBF46395A7 tSXEYOD20
514,327,493 *3482CCE374C0709C326FE8148F83F1B86FF3BB74 tsy.bbs
514,327,494 *3489AEABEB4B83747DFA1C076682C9E66E37D9AF tsykkyhn4
514,327,495 *348F3D7B423163EAE6FE9FA0FBCCED66AB87C3E7 TSYRULNIKOVA
514,327,496 *3480C11E1A7469FECC24ADDE7B13BDA66395C651 tsytetiv5
514,327,497 *348E453BE60DE8BEF1C04E0ED737EEB7A3247796 tsytivlessiethY
514,327,498 *348344EC435A64253AE497A5FBC86202351F417A tsytsehl5
514,327,499 *348BF8BACDF241BAC362C0FE4A217D03F1B4B144 、tsミュージカルファンデーションの舞台『タック』に外部出演。全国ツアー『
514,327,500 *348B661E2BF410803CEBAC302AC269A7665D5C5B tT0+
514,327,501 *3487DA17F431DD04CCB82167184003CC5FE94899 tt0035799
514,327,502 *34866687B6B096E6E6E31F2C69981471DC7D1B28 tt0066059
514,327,503 *348D3C625D88B53D6A0B582D554B482F1F04D1F0 tt0076435
514,327,504 *34835D6392BA5E4BDF5B2F1B5A3F91A859C6D1B7 tt0078497
514,327,505 *3483F3CF0701108C47BCED17B2AD06B195435B64 tt0083236
514,327,506 *348F4884313ED84DBF5FEC92B17B85BBE1623F38 tt0088512
514,327,507 *3482C9D89D03332FAD4373DE431563CE964CB71A tt0115389
514,327,508 *348FF3E8BA4F0EE63C85628877955127ED3D5187 tt0146232
514,327,509 *348498C7E8D2A992A32C215D667066D1C1451119 tt0258702
514,327,510 *3485FBB47C7AAF2FE4B005C1F6AC3337841AA8F2 tt0329205
514,327,511 *348C97B038A3BE3C151BDB5FB41C64F75C23C689 tt0446476
514,327,512 *3480D061D0BC600A8F2F92C5C01580BE704A3203 tt0632109
514,327,513 *348CEA42116879963CF8DD9830C8263E2E5544D7 tt0667841
514,327,514 *348D9851E71B585C2234DAFF3BFBDE0E301F576D tt0813808
514,327,515 *348C5BBC5BA86E8C6921CC010AECC8DE6D474CF0 tt1046183
514,327,516 *348E7E8AE7BFB5D21BAC820CE3639E952D55275A @tt1reremo
514,327,517 *348563C4B9CB0EFBB166224F782AAAA80F53F152 tt3l4g3s
514,327,518 *348FD34A8E8935C3965FB101056D3F1ABE013DF2 tt6777
514,327,519 *34880154769D88B37E28D5DFD1BE89518C535CC3 ttaacaaaatcctagagtatgagaactaatgtaaacattagagatcatctaatctatttg
514,327,520 *3484DC702E5F52EF1E03FC1FBF64D1C82D1EF573 ttaagtu3
514,327,521 *348FF9043A53F94F3595CFC3B784AC21D9E8F01C ttabcdefghtt6
514,327,522 *348D02936584D8938E790E95C81C332C9FF9111B ttamttimme
514,327,523 *34836DC50DA3BFB6AD6A545990CE994A8AA0FB66 ttantsgh5
514,327,524 *348A9C7E35770833F48B42A859A12058072CEABF ttapsetats9
514,327,525 *348645039E2C5B2E1EE891BA6B0BA6CEE5ECEDDD ttaretfas
514,327,526 *348FC1A603F6C47203429824063C84D97C5EAF49 ttatactttttttaaggcttggatttttaatctatctggaatgtatttttaaatactgag
514,327,527 *34843FCC8A0004FD6331BF79B83E2B371D11E98E ttatcactttgctattggctcttttctcaagtagaacctgtcactttcatgatcacaaaa
514,327,528 *3483E7CEF6F0A4AAD595BEB48A0DD12D225842A6 ttbetirwbtting
514,327,529 *348DB494C833C078B56B2743B9DA551B44F006DF tTC|
514,327,530 *3486E4EC276A5BC9E1779C16791E2941B52F0A97 ttcctttcacttgaacatttagaggccattgtaaggttattaattggcctgatttcaatt
514,327,531 *348C97BACDD3F3B8E831DDACDC7449E6D266D522 Ttcdbsw7
514,327,532 *348B8B8DE1A31049C9B8FF6E950EB8E27BE72AFD [email protected]
514,327,533 *348A2347BC734ADCA2C4377750339B2F3FB0DF7F ttcollistt6
514,327,534 *348B15D64F123BDD0CCB477FB42EB7685E314A08 TTcSAAAAIAAJ
514,327,535 *3483B3437083CDAACF7D8979B5244A04B9616C33 ttcyku
514,327,536 *348C8DABB38325215EB56D113830A5464DC2E2C2 ttdavett9
514,327,537 *348F8A5232E043AE0D77CB31F23E072EDF234C6A TTDQpdP5
514,327,538 *3482066137AF93FB5C1466AB6C4A6A5FFD093975 Ttebtuarb
514,327,539 *3489E3473DFAF931ADE85AE460539498235564FB ttegguh6
514,327,540 *34820F224FF9AB44EA5B71E48558310628CECA67 Ttekcab0
514,327,541 *348B8EF4454641F5406A1D7979E5F1B739CEF01E Ttelabac
514,327,542 *348012A672191613F7D4F3B1A2FCEE5CF0B80E44 ttelbud5
514,327,543 *348C55B998A72B5570C7FF6A9A870BEF45070618 ttelsesfondens7
514,327,544 *3487353527FE864EA214FC9BE3DD525C7FB6A9DB Ttelyit6
514,327,545 *348C01B8B1EB35AD0BE8034813D76A87F11AA551 ttepnrok4
514,327,546 *348A729904AE448646E4D18E771CE3122105E9A1 tterbugs0
514,327,547 *34812503C41A52CFC7FB3696BCA2B02C9A3F16A0 tterdatu5
514,327,548 *348D4715750A572A7C8D6C9B6780D1B61006E336 tterevel8
514,327,549 *348201DE8FED4CD8D1AB21BCCA300E2587C6DBB1 ttermath8
514,327,550 *348F031A2EC70D301D8A9D8C6630C1F5E6C51AA7 ttessod3
514,327,551 *348A2140A72C57B21A47D969740FC9C3D7A6DCA4 ttetysek1
514,327,552 *34818D7D5A56EE03D4C19C6C3B81931788ACBCA1 ttevognes6
514,327,553 *348EE3A40B167582E9361C46EFA7BDD91E8ECEBE ttezkcap7
514,327,554 *34841FB9F001DA837E693218EB165469D3D17B5C ttgetservbyporttt5
514,327,555 *348E5330CEC48B9263BA1F06415E6F1249EB001E ttggaatagcaggttttgcagcagttgttgcatatggattacacaaactgaagagcaggg
514,327,556 *348FF126B066755A89212E02BB94102E1765C836 ttI{
514,327,557 *3480C941D49BCADBBA9F5408D735F847902C1182 ttierhived
514,327,558 *3485E69F33A9839365F6BF9B77D2C7B6EF9378B9 ttiF
514,327,559 *348F02138DEE56B22AAC7E00C6276445A0AD8CF5 ttimmecba
514,327,560 *348AE179C205A6D3DC37E073978AD40248FAE244 ttinputline3
514,327,561 *34851F766CD38F6D74004EA8BBFDE3D0CD1D6F02 ttiretnioptt
514,327,562 *348584C2B6C405454DA316AAC255DA48AED5E8E6 tti rf
514,327,563 *3485215B692791835636EC557CD70D4B78D3F995 ttirsua1
514,327,564 *348C8DBA362B9270794D49BCEF1778ABC00C2084 ttirthcsing
514,327,565 *3481BB77CBDDA1530A6EF71BAE95BE0C5883A6D9 ttiwejbt8
514,327,566 *348616287470852A965853F04E4017CDE3779B9F ttiwlA
514,327,567 *348CC8F814BE7283C60863F17A12DC509C44E7F1 ttkj1sd7
514,327,568 *348748CC75369F4EB921CC1D1B78BE020857C8A1 tTL*
514,327,569 *348768FD49E68E8D578E95366891DFEC91DD55C3 [email protected]
514,327,570 *348A35F792F7C07BD7B504A89485C15D2629A078 [email protected]
514,327,571 *348D95DF3BBE1A54DD23C4AC39AEE35DB2A70BDC Ttlgsch1
514,327,572 *348D97A1B2A0A03FFCAE629CB6D3F8F86372698C ttlhtsbsw
514,327,573 *3481962483940EDCA42E84477F8EF899F2375204 TTLMAN
514,327,574 *34850F16D84B69D4D57D0D956808B6157D7536FD Ttls`rnt
514,327,575 *348AEB0B162C5276283F33FB6A257F97899F65AA ttlsrurb0
514,327,576 *348CC63A0B3D7FB9D3941F4AF11DFC50A81D7FCF ttltbsw6
514,327,577 *3484D5BC65F24487E6B3866FCF39AB583DA4E86F ttmilisk1
514,327,578 *348F928DEC18BBCEB614597BD26DA2AE4C72C05A ttmimmin8
514,327,579 *34879C8545A2BF03316A838C79F396AE749946BB ttmotorcyclerace
514,327,580 *348480ABEA8693F5733A8EBB19C904B64F494E90 ttmskchc
514,327,581 *348DC6F576CFB889F98F421CCC6EA95490F1094D ttmttyt5
514,327,582 *3480E08897986DD12D02B316FA3A06FC4D1A83E4 [email protected]
514,327,583 *3480B1D130C0553308CB9FC4B1A10B232E387988 ttmyttyt2
514,327,584 *348ECB7C0DC24B6B64F187E637631F2E465DBD4A TTNKLNG
514,327,585 *3485ED1AD71311548A97AD1EF2ECE21A551FF2F3 ttnttptrntltsthrwthrw
514,327,586 *34802A0386A06EC420EE4B072530A141301623CC ttocsleoj
514,327,587 *348A1780E90AA0EFE37D5DDB46499D291C8D3C0B ttocspilihP
514,327,588 *348DF1EB21599DCECD429A7744E0A15C487CA210 ttolrahcbsqw
514,327,589 *3483D22619EBC5F5EB080F1D1986D8C0EAF8922E ttolrahcelleinaD
514,327,590 *348085609A979E902D627FBD7D0686D60279062F ttostino6
514,327,591 *348432865D1826DD01C6EE7487B4390855712BC5 <TT>$ PERL -IPE &QUOT;S/ABC/DEF/G&QUOT;;</TT>
514,327,592 *34845A334F449D6AE51E0B4B04F3903319C261F1 ttpermissionstted
514,327,593 *3488353CC52124BD6CBEA10EF2D3896E08C49E51 [email protected]
514,327,594 *348912F9B55D1ED87C6BBD2E3E477EB3F6132497 <TT>&quot;Hello, &quot; . $fred . &quot;!\n&quot;</TT>
514,327,595 *348D966671771EF9A55C8C989E48E2CA22751122 t?Tr
514,327,596 *34876D5905FDB1B8E11F664FE06AC4A42E3DBC5C Ttradite7
514,327,597 *348CD22AE03767778F272AE172996205FB1BFCC5 ttraktie7
514,327,598 *34839CC5B88F8012AEE2453FD22BF2B54E110661 ttrbsltdmttng
514,327,599 *34837E2E1FC60C1F1D1449C0A7D2CE14306F7667 ttrgyns4
514,327,600 *348FCA372015290373ADE9D8270863F85E649487 Ttrhdrl6
514,327,601 *3481BA848FD172D5C6682FDC868407BCDCD77A00 [email protected]
514,327,602 *348F11C52B613DB9730777D6CC0EAF55EF852EE8 ttrrchn2
514,327,603 *3487EC2E37144F575DEE53D7EBB9C057CF2339A3 ttrrooyy keltner
514,327,604 *3480EAD433B11AFB88F6F5D3473F05F2EFA34EA1 ttsinniga1
514,327,605 *34877DD15B5D0611EE440FB09AD9619AFD3630CF ttsnoissimrepttil5
514,327,606 *348C46537D2589B0DC311A05938EC846F5527A12 ttsogaillilses
514,327,607 *3489308C9E8D3B6E5FB56C7464A4EFF1F9F35D3F [email protected]
514,327,608 *348739385783215F81D569A70503A314A75900AF ttsrahcpikstt0
514,327,609 *3482F6BC3D8E9EC12545759D2E8AC7201161B103 ttstockened
514,327,610 *348D39510C51C6ECD881DD209A48AD51F787C657 tttcgtgttttgagtagagatgggttttcaccacattggccaggttggtctcaaactccg
514,327,611 *348BA110B47986D04D59963B762452B12E7DD2DE [email protected]
514,327,612 *3484862E550D550214C4CB55A2C7F022CE581DCB [email protected]
514,327,613 *348AFE1B0756AE4F6B9F2BBCCEBDD491B7904E04 tttttctggttattaatcaagctacaagaatgactcctgctatcctatgagggagcactg
514,327,614 *34895AC30B4CA6BFCC640ED12E107C132725274F ttubkcals
514,327,615 *3489FDE6563FD974B44D2D45238630F5440D00AE [email protected]
514,327,616 *348F4F345BD2D201B46622A79D9AD467465C0234 ttuksiol7
514,327,617 *34861A7F290E21AC0D20A8D7AD7D1600710EB80D ttunrobson
514,327,618 *348B0190963F1EFDE503F058D81A839AA53CE612 Ttvoç
514,327,619 *348D092F211B6F0472D5078F304B0944A12F0C8D ttWaaa
514,327,620 *348DB5B0688A7DD30DA19A050F550626B7567133 ttxcctbves
514,327,621 *348FD868836BEA01E90BC3A49225F33662BFCE26 ttxssj
514,327,622 *3484A1A6858EF614E00330A4BF5500833EFD34FC TTY1932
514,327,623 *3482C7113C51418CC403C7B6EDCD790DB0171A33 ttyesny3
514,327,624 *348459E56B425FBF48D33D483CB2068C81B75EED ttynirved
514,327,625 *34827FBEFE181E60069EB7D5BB9EB90F22E06A91 ttypwknpfut7
514,327,626 *3487F2970A345FF0346B84A0F9C47E6A38DBDAA1 Ttyssyh4
514,327,627 *34821FFC20EE113FF2776D232DD097809DB10322 ttyysil1
514,327,628 *34885BE4F06E762B1B50131E2E597E0B69BFCDC0 tu#0
514,327,629 *34819E344692F8F5A00D7A9FD4441FD50FA32392 TU$$13$
514,327,630 *348D94C819BD08F250C19A170E352F9CFA12FEFE tu15d0rp3
514,327,631 *348AA4081ECEB2A829AF6843163D0FA1CAFE4922 t[u3
514,327,632 *3481E6E156E446F89E913E12061FF30367C85350 t=u7
514,327,633 *348F92827179AE8FF25E911E33E496CC4C7FADC8 tu agus
514,327,634 *3489A70AE5F403006E349CA638C9E72D050359EB tuahcsebbing
514,327,635 *34805B8DCDCD4B2F93BEC3482787235468CDA4E9 tuaiscirt6
514,327,636 *348885061E4EDBA210006418C62AC3CA7D6C543E tuamaminsel
514,327,637 *34818611CF36A843DE1BA208EA3434417124C8B6 Tuamasag2
514,327,638 *34869C590A4A77950A9912AEEB2FA54A3CB0A51B “Tuan”
514,327,639 *34850D9C790D9F855774816DFDD048A88C06369C tuana kayali
514,327,640 *348D7067618B8C4078A318C394AC4B8C24F312A4 tuan.astafan
514,327,641 *3486B9E0A39918BA616583FD400BAF9C9D2D5040 tuan.baraw
514,327,642 *3486E5F430AE84EF007F68FC421FA50651F7E0DB tuan.beirne
514,327,643 *3481BCFD7C39817E15557BDF6AC701F68F6022F9 tuan.brawdy
514,327,644 *34873FACD47142EC110679420CC0D3893D1AB996 tuan.buechler
514,327,645 *3483541363AAB07C7CE0FE594E71C94091E8AD6E tuan.cestari
514,327,646 *3486F06943F1C47BE357A4D2C1FEEDE9527D6B65 tuan.comment
514,327,647 *34835B8C3FD50005E028ED3A464FD75DF5086B3E tuan.dechellis
514,327,648 *34840E93B385376EC4CB9AC6E4CDA9B5148D451E tuan.drebes
514,327,649 *348BE78F16E8EEBE9D72FFA5C5A1847195F69E21 tuan.eger
514,327,650 *3484C1DEDBF799928353D384E3554D57305C6D1D tuan.feinman
514,327,651 *34899C2C2C12609D38095165A394AC203573B0B9 tuan.fingerhut
514,327,652 *34897679119581908F30FCD76B1B3286E3CA2937 tuan.funk
514,327,653 *348F607D3CDA43228CA84CAD31EA048E8A594D7B tuan.glines
514,327,654 *348F572D5ECA603B7CF41DA383FD2555F2E94FB6 tuanjajun
514,327,655 *3486D09474621E9C5E15931C996784EB4EA63696 tuan.lagory
514,327,656 *3489C160B05E8878738AAC7966F367F879DB1F62 tuan.levey
514,327,657 *3485E4BD9A0BEB4C8EF9DE4D6C38D79E0AFDA3AA tuan.makler
514,327,658 *348104B08913782F57301E42950A4E8AD2AE60A2 tuan.medoza
514,327,659 *348998E6CFCA8E3F279F31736E454BD161CE89DA tuan.perozo
514,327,660 *348A9F1CAD1194942847FCA5AC0D1752C78D0A9A tuan.recalde
514,327,661 *3485A98E6AD4203DB0BC62F18A2AE5D5B30CE40E tuan.remak
514,327,662 *3489819E500260E1416821C4FF5E35AB4F4907DC tuan.spannuth
514,327,663 *348D321964B6B5AF34071B9BF83EE23DBAAFD08A tuan.sprowl
514,327,664 *34828F73680E72B4F10305178B97EE0858A87B2E tuantoan hoang
514,327,665 *348E4F127723BC8C9344FE9A031CF48F371E4293 tuaone123
514,327,666 *3488DFD7CA6EF3B576A845D5206805D125968A81 tuaregtuareg6
514,327,667 *34824D019A82AAB4E0C4B8437B4F43E1F4488C49 Tuaytha4
514,327,668 *348986BD053E672371A21F46743B4FF08FA0A9D9 tuazon anthony campesino
514,327,669 *348AFC75B1423F6A2362C50967E76D730F0A1CE8 [email protected]
514,327,670 *348D07A74433443E7FE924DBF113FDFC51316252 tubagusaranditya
514,327,671 *348114B6C389361E51C4187568B5FB6F6296F336 tư bẩm
514,327,672 *3489048A957CB0F02E99EA06C806A18A18DA1243 tubassaxon
514,327,673 *3484680D1844F79B1B8434322E6D0685BB2742C6 Tubavamo9
514,327,674 *348806F6CEDB22F5C723047A2D9FCA45BCC2BA24 tubberoe
514,327,675 *348F2DD0CDC4EEC6D50EA973A412329257EBDDBE TUBBIE0
514,327,676 *3486DDB8DD3ED8F1887B342D8DAC1818D0F2D1FF TUBBSLJ1
514,327,677 *3481027BE09FF68C19C40C7BEF46504299248246 Tube43
514,327,678 *348975B79A61A90A324E694E116F97F4914E656B tubeelevatedelevated2
514,327,679 *348A55E1483408DE8989EF44334CD42B683612A3 tubeful1
514,327,680 *348423E425185099D5BC5C78CA24A02CE1F10994 TUBELE$$
514,327,681 *348A180990916D6BC335C23810337D40C78F0967 TUBELIKES
514,327,682 *3481D9E12FF1F12740FF6A709E67D290D400699C Tubemaker?
514,327,683 *348B987166691C6E633E72C7E71504555776D54B tubercleses4
514,327,684 *348723507D8DA1EB05856E489D0CA452B4AF4134 tubercularias7
514,327,685 *3482E1D7F9C723F1F6C3895F32A9DCB717218A96 tuberklum
514,327,686 *3486940353931B9853D80B91C34EF66D21163D09 tuberkulosen9
514,327,687 *3488105A7C82446419DF23F9ED7C169030E3EA0D tubes-gap
514,327,688 *34868F054F8644D0EBB44D463B257F3CCA4970BF tubes.iewww
514,327,689 *3488FD3360D6E84D7CAD17CD2755CDC50ED8A5EA [email protected]
514,327,690 *34825B877E339F2CD41198BAB46D7CB7F019E337 Tübingr
514,327,691 *348ECD35B7EDDF1573532F62E3D897C3A6C3CE1B Tubiporid4
514,327,692 *348CE31511F5A7C8EED3E7EF1379C5065D874D09 tuborculated
514,327,693 *34880CA18E88B901B99290F672A8AE9BD2DD9EA4 [email protected]
514,327,694 *348605309FF349FCCC47AC1FA0A5B481806AD7B2 TUB-STYLE
514,327,695 *3485EE7E94469D829ACBCA84AFFCF5F5B71EC914 TUBUAI.
514,327,696 *348ED95E15F3D31F837983D797B39B246D6CC209 tubule1234
514,327,697 *34874256F199F181CFFC73876712907B3C963423 tubulipo1
514,327,698 *348CA691D730FC2E2F226E346D5E271E0174C48A tubx_uby
514,327,699 *348AA7B772E70D20998B6F9C0361E712A5075333 tuccavan
514,327,700 *348E4D6354C2CE819FF7B8DE7DFDC1200C686105 Tuchfueh2
514,327,701 *3483E5D9F624625191B017A8E74CA98DC6D4330D [email protected]
514,327,702 *3481CA70A50D3301343B27DA21791ADAE5E8F1C5 Tuchmachen
514,327,703 *348FB121118B4B4C5F4601FF4619049320360AFD tuchsalf
514,327,704 *3485BDABDBF79D80B7A9F2B2C9E461188416DCAE tuchun3
514,327,705 *348CEEE8C37165570F78EEEE4DD7CE9BCE88C24B tuckereurope8
514,327,706 *3481D32B1AB3A1DE323CDFCBA3BA36B1E03400E8 Tuckergodzilla
514,327,707 *34891A70BF04B2C8B9A41A643607299B04AD4D41 tuckerhorizon9
514,327,708 *348D428BFA98869F55465130C493AC090AF26D83 TUCKERKRISTEN
514,327,709 *3484A91D501426C4071221FB3F5D83E654E589D1 tuckermalarkey
514,327,710 *348A7822E049A7574E8646279BF073602F95B1B0 tuckermichele3
514,327,711 *34853C98277CA9FA5A95D567159C567E3282B281 tuckerpearl3
514,327,712 *348CFA7578F92B309E29DD04810A48F96D0AAEBB tuckerruby5
514,327,713 *348FE53875E9EA03E96FFEE48B0124A1B372E628 tuckerrumm
514,327,714 *34895B45C7BB694AEE742E1FA2AE4AAE591B54D1 Tuckers7
514,327,715 *348977A8297E63E55EA5D0A1BB40C2441153E11E tuckeru3
514,327,716 *3484FD0171D6F5BD06D1B28BB0F8B5654F95ABF9 tuckerweasel5
514,327,717 *348FAF23627DCE690D17CFBD4F7AC916BA6D891A Tuckout1
514,327,718 *348AB9A781665823415D352A15C86E78913EDA6C tucoresadeeq
514,327,719 *348A3722664C1DD4604A4EBBEEB76DE87364DD66 tucrepap9
514,327,720 *34847ADDB2CE63F5401F6804481CE4360B6F4CC2 tucson revolutionized
514,327,721 *348A8B2835BDF51D74340597ED232777F13130AA TUCUTUCU3
514,327,722 *3480089262AEA7946EE5F25DBE84188EED77BA20 Tudatom4
514,327,723 *3488570AAD48609A777B5EB782710138A39A8713 tự đẩy
514,327,724 *3483D916687A9562B4ECDCA6542F06A7C2537A80 tude, op. 25 no. 1 in a-flat major
514,327,725 *348B933005732DB31F0DB482BA48E88077D8B080 tudeoy
514,327,726 *3482B2994520617E2DC07913458B59BF615CBCC8 tudes-tableaux No.1 in F minor, Op.33: Allegro non troppo
514,327,727 *348FBE5DDF40B8612D2FD22DFB447C85AB9B9D0B Tudoisvenir
514,327,728 *34824469B7DA74E6538D5604BBBC208B4FE6F2ED tudomanytalan
514,327,729 *348E3099376638550944F35428CFF02071A5CFFD tudorachevalentina
514,327,730 *348272553E8ADA515CAAD9A32003C433139A9223 tudorcent1234
514,327,731 *34854E3F78DEFA444832AACDF12889E266990A58 Tudorkongene
514,327,732 *3484A735BD735E82B0778DA9CB4D180C8578A02B tudoroghina
514,327,733 *348D0AD2C5E5D20EB5F2BA4C88C5CCCF645D1AE7 Tüdőtárnics
514,327,734 *348478954A0FC22DF92F56CECB5C38F3AEFECC87 [email protected]
514,327,735 *348FFA32D420209CA85F40407CAAB72B393BCCA0 tudvikleren2
514,327,736 *3485ADE15C5E068B7908DD5B3AE950FF3D62255D [email protected]
514,327,737 *348883D5C0DD1A5F023FED5064BFE40C1507FAA8 TuEaaa
514,327,738 *3489029BD121E6C3880C936C67E8F71F92177F5A tuebarawing
514,327,739 *34885EB5FD27D522C033092B9FC833D988C390E2 tuehcsgo7
514,327,740 *348B44E60AEEA6AB81A49E2CB616769C6F0EF181 tUEj
514,327,741 *348C1FBE732FEF0BE2AF210606031F11E4BF6714 tuengen»
514,327,742 *3483831D5D2D0A5FDA99CB632E597208E8BCFFE7 TUEPP
514,327,743 *348311089B1C7127BDDCC15A47ECBB7467200358 tuesday anne pascual
514,327,744 *348B54EEE2400BD3A3D86D8C6276F0442F0B61CE TUESDAYCHARLIE
514,327,745 *348103316A5048B06CF45FD7F96AEFEB88ECA6A1 tuesdayelaine7
514,327,746 *348F46F80BE287FDDEC319DF85C770028870B53C Tuesdayh2opolo
514,327,747 *3481FFDBC33F2BC3A18D1494CE4A065503883EDD tuesdayinside3
514,327,748 *348C9C479BEBF2F224AECA092F6734C7E02E1E26 tuesdayminter
514,327,749 *34812FE6FE6FA1F3498C35355D865DBE69BE1B9A tuesdaynguyened
514,327,750 *34802B07B2BEA195B6812BC552ECB11C9913AFAB tuesdaypopcorn9
514,327,751 *3486640F2CA5175514E1F9A75414CB5F2059FF27 tuesdayraptor6
514,327,752 *3485FBFD13EC6569BEC13F6557F28F68F32679A9 tufainaluatua
514,327,753 *34887CA6F7D3824A8589DB00E372896BB940F553 tufan goswami
514,327,754 *348F2A099E12B7C6986DD83BFA5E478B0DC41C93 Tufescu
514,327,755 *34876E6C989BDA558FEAA38F04E838D7A92E454C tuff12345678
514,327,756 *348CB36EEC03B37D67CBC19461A9C588C16DF848 TUFFANGEL413
514,327,757 *348BC1DB62897A556C0685A420D4F6983CB656A1 Tuffarti1
514,327,758 *34856509E77CC97E7324595A935F041F50699090 TUFFATOS
514,327,759 *348BFDF2B0737107660D3809FA40B3FC4FD35B7E tufferemmo!
514,327,760 *3486E33A1DEFCA3530360CCD5EE455E3A814DB6E [email protected]
514,327,761 *348B1CB41CEC74628110DF5CDE9EA3EBD871CBC8 tu fricci
514,327,762 *348F314A67637DA50D03A2B6FEBCCCCA99C10EE0 tUgaaa
514,327,763 *348573DB259593EA65426FDB329FF29AC67883EE Tug-A-TugToTwenty-Two
514,327,764 *348B3C650CC4C2284B2462E29A16000B3801F356 Tuğba
514,327,765 *34867D11F67492728808CE0FA062BC3FFC2E4D43 tugba cemil yilmaz
514,327,766 *348CFB45CB025D96618EDE8AA1980AD1598943D3 tugbauludag
514,327,767 *348A13B8F3E87B0C8CF8B033BD3EA6DBAA77AE7B tugifre5
514,327,768 *348294A43819C416994665E07F31D7A097535349 tugiram
514,327,769 *348D404885CBF980DE890A8612D36DB6138A7E52 tugisin5
514,327,770 *348548BDD77D0D297578DA2FDBB5E04E88807984 tugnimre4
514,327,771 *3482EF0AE7988BB8891FB93871555EAFD53AD2AC tugrin
514,327,772 *348EE9138C303E4872B69EB316BCE60C987689A5 tugume david
514,327,773 *348427C10F3E27DCA8A7EB7ECBEE8531D5242665 tugwydie3
514,327,774 *348382BFF77E6FA98A67B0AC785B2F4849A1DA01 tuhannenviidensadan
514,327,775 *3487478FCA401DF442C0F785562136A208F73806 tuhi watkinson
514,327,776 *3480FB5D4F802187682C24427869913EF499859D tuhkauurnaa8
514,327,777 *3484A46A8EB8EDF5E79DF4C3C3DDE797C7FE99D7 tuhlanneet5
514,327,778 *3486E88D5B846EBB7ABDB4867D5409FD6DB7D86E tuhnegga0
514,327,779 *3487BB1367A7254B3C310334B338259626E00000 tuhsuohsed
514,327,780 *34833DB49D8AA9B0D675E0C9E3FFD8204A9968D5 tuhuranepal
514,327,781 *34820F0D86F97DA7A5A8FD021913AE090E128B21 tühütüm
514,327,782 *3484467D708F51EC429DBB25C453106A2680B761 tuibajepc
514,327,783 *348F91158686F2A6FDF4739888D42EA2A133F7D3 tuica gabriela
514,327,784 *34818C937E0A4DC902CB04A0B47CDD47F9EF4317 tuiglijking
514,327,785 *348FD24A86234DD13FD94312DD952E6831FC41B8 TUILLETTE8
514,327,786 *34877F604026ADA9235BA1E3579C4D120276BB1F TU'IMALEALI'IFANO
514,327,787 *348E410EAF5C45FB6BBDDE74003DCA1FA095D86E TUIMELSKAKELAAR
514,327,788 *34887BD664C003F12FBD71E47306EF9A94891D13 Tuinenga2
514,327,789 *348C8F275069F2B1DA822C4A81A21E54FA9D7A4B Tuinery5
514,327,790 *348215E265EFA13F8D672EE98E86E8DE2B6E8183 Tuinwolfspin
514,327,791 *34805A776FF07EC1B8FA964C5EEB2B13CE87058C tuinwoonbuurt3
514,327,792 *34891D60389B2C49AAA06CA8BEC481402A04E16C tuirsiúla
514,327,793 *34811FFB5E5488E7F1624319E7DABAB8B30DE1DD tu-isaaqg
514,327,794 *34829ACCFC7F354E61CBEBE7D17CD3B9479337C1 Tuisstaded
514,327,795 *348F54FF539BE4A3F6054E1F3DAAC89F729D8A8A tuiteadh8
514,327,796 *348240189EC31F631DF89757E05EA410F0E5F057 tujksnah1
514,327,797 *348A660880474ABDC8A11DB06D2136C34D868516 tujoykoj3
514,327,798 *348BECFBAF530E3233360B75920AAC7479E828C7 tu^K
514,327,799 *348EFF4F76907F9E3221517CAD34B15975DAFE84 tukajuna22
514,327,800 *348BC107985A84EDB9872EEF90F47E75C755935D TUKATZ77
514,327,801 *34851771E4EBD1F0A85F194A550E1F3E8680BD2F [email protected]
514,327,802 *348DFD8E889AAB6DD73810CB3F9B18BF0F773CEE tuketiking
514,327,803 *34813FB6A04260B6E1A6B489FD86C293B328AC6D Tukeycha6
514,327,804 *348603D08814CE0F186EB5168EB627EB7E7C047A tukkerrekkuts
514,327,805 *3484567E63BF83F9308E5C608FEB42BB08C45E44 tüklərlə
514,327,806 *3483A29F6B22EF2755D65C864614C7E75B9B30B3 tukohuot0
514,327,807 *3489F10D709807F8FE8BB6CA4FCFEF485F0709F2 tuk passeducation
514,327,808 *3485BA1867FF8E71CCD6F6625C71E3B3F36B05B6 tukqyd
514,327,809 *3488C097E9C6EB739601CB3888716207F06FC116 tukulum0
514,327,810 *3488190D260399318CEF2805CFD2FB2536CB960F tuky khan
514,327,811 *3483077925F1F08B504CE46AC55C21ABE0944355 tulane42
514,327,812 *34837625F07FACB1BC924B8403E25C7BCA6713A5 tularin
514,327,813 *34847DA879AB13F2E4AAA784FD9CF2DABD4485A6 tulasisapkota
514,327,814 *3483D31CB615220F410464FDADA0F91FF4296A1E tulasnamkia
514,327,815 *348309748051A526C92AACD1D644A67D4A000F2A tulaver6
514,327,816 *348C32DDECC2B7CDB1C5D98EF8FDEB15B3371442 tulchinG
514,327,817 *3484B2755E7271EDC256DEB36739F91C4F65EB6B Tulčyn
514,327,818 *348A7FE8F16545837BA0B15C0F73D4DFB7FF2DF7 Tule“
514,327,819 *34812D5CF6B5D482D2C1786E8D162404BAE4D3AC tulehdusta9
514,327,820 *348659C0C555731AB2D49FD9C9A99695169A4F5A túlgyűlik
514,327,821 *348455AC4A20FAA806342EFD83C40B02AA93EEA2 Tuliamuing
514,327,822 *348AF1207CE803D5C250695EC7760BCF79D50559 tuliarei0
514,327,823 *348A4ACCD5B16A0241C5C81D8ACBE6C90969BE10 tulieusuyngam
514,327,824 *3486B5BFB48DA859899806C4A14995389AEE3183 tulingique2
514,327,825 *3483E717A8121373C7941662081B4D2D5B6993EB tulingo2
514,327,826 *3481E93271DBDD58FBC2C79423527081FF6D0BB9 [email protected]
514,327,827 *348938A269B31CB18F4EF5A4499BF8B40BDBFF32 tulipalon6
514,327,828 *348E7059EF860B23A30BB80A02B450FCB15A610D TulipsInTheKeukenhof
514,327,829 *348E33814BD8024372AC68570B9CE8E60A70BEA1 Tulivuorenpurkaus
514,327,830 *34845CE76635C6D73E93062650F00587FEC1CC7F tuljapurlohara
514,327,831 *34821632EC5E6E1E7FD5D9600C5EBD3A8C4A0B44 tulkintakeino
514,327,832 *348830C7555ECA1C5A1E9A755125BE0FA3C5D4E6 tulkohon
514,327,833 *3489497724550F718EDD7E9B72343DE956E45CFC «Tulla»
514,327,834 *34818CF016BABC0B01F320EB6C794FC8F48223AC tullaan8
514,327,835 *348E758F89D378770F4A4F84806FB191FC1E2CDD tulla moondance
514,327,836 *348F7E949A1ED6DDF2C30B34A969784F132E206C Tullkonts
514,327,837 *34829D948DD25882F86AD7C9935561DF713BF74F tullusque6
514,327,838 *34805DED8CE06EFE133CA60809006ECF39E22C63 túlméretezés
514,327,839 *34892A6D636AAE31A4D663178D394A86352F9B72 tulokixnetcomcommozilla7
514,327,840 *3481E917A3ADDA1E1CA6DC77E24123FD3BBCCA3D Tulomne
514,327,841 *348C186ED2DEF40FDDDB97272B5F34044FFBDECB tulopolitiikassaed
514,327,842 *3486D4122BC9C2E8871196AAEBEACB352FA25C0B tulpstekker
514,327,843 *348C04F4F5CF78B3E64A396CB519D463FEEBA038 Tulsaed8
514,327,844 *348E9A5FA52C831F9C23FC6C368B50423FBF57B2 TULSIMATA
514,327,845 *34820E4B74A9080E83C6B27688DC84DB4C3BA602 túlsminkel
514,327,846 *348F4BCE9FEDA14166AECE937A182A83A7CD3604 tulus hutabarat
514,327,847 *348FD31706D15101DE354AE2F2ACEE4144F50EFD TULVAVAHINGOISTA
514,327,848 *3489B50FABB0A64BE0BF721F292D4DA6B9BB4CD8 TULZOTT 2
514,327,849 *3484CE886871724EFADCD12242A3A281B4CF3260 t)um
514,327,850 *348BF88C7740F1DC0F8A21D20FCBD5105A0FCF5D Tumbameer
514,327,851 *348DA1A70AFF26565D88FC422D954795BF54D1E4 tumbamulumba
514,327,852 *348476C31E2A459E52200267D4B95B7D57D0D077 Tumbledung!
514,327,853 *348E23E93D30D522694CF234D2FED1F46BCCEE05 tumbling walls buried me in the debris
514,327,854 *34845DF1358934119F28D5BF0D80E1501326B07C TUMBOA6
514,327,855 *3488B735E1CDFAF8092E803ADE33EDC2DFC4CE48 Tumbode8
514,327,856 *3489030FD75091F4090B37F06D58083C40506A15 tumchakarakul
514,327,857 *348483A0AC4E42BCFFA5493F459CE46E78F0BFAB tum forrosuelo
514,327,858 *3484FF2932C2E3080B32C0E0FCF13619EAC586CF tumi amar
514,327,859 *348CEA28F88CAFFADD2E9D114C7A1556BEC1CAFF tumi morare
514,327,860 *34831182CE44AC95F3C48E725A43300BBB1699A6 Tuminah8
514,327,861 *3480D7B1B3D9770C37DF9CE7FDAA10AA9A07270D tumio lastri
514,327,862 *3483A9F966A2D591055868AD1AE344C2C21F8486 tumishoelle
514,327,863 *3484868932DB9D104E9684C75222F618D15A6D5A tumisotsheole
514,327,864 *348722FC1E905792316A40319326A14657193D04 tumitoga2
514,327,865 *348336CB5D4F8C25E46F5E3EF4E9FC6A2221EDB9 tummanvihreaeksi4
514,327,866 *3484B5058A715836F8F612B0F333E97B7C279560 tummapohjaisella
514,327,867 *348F64E9C83484D2E8E48B7DDF8CAF060233E609 Tummars9
514,327,868 *348DFACCBA2D395D7FE3032F098E3F64B55A84D9 tummatukkaista
514,327,869 *348A275BF5DA86F4E5BE7E4DB9E9A2ADA95D4E83 tumnas walter
514,327,870 *348585BC9C93D10924198D7EE82DAEF41A764974 tumorens9
514,327,871 *348623E2AF78C3207505B76B11559392A9DD8878 tumou$
514,327,872 *3480E330D40962B76237BFAEC024E41712106871 tumregels1
514,327,873 *34896FA5EA5E9F016AB168904ECB8CC778AAE012 tunaaktuna
514,327,874 *3480E2C532FBB465892C2BAA42C5BCC300EEFFFF tunazoo.comtunazoo
514,327,875 *348F96E349693C1C1C66DF178BF6BB84CA961F43 tunde omobolanle ibrahim
514,327,876 *3480661F15058C3FC6A3E9CCE0A9A577D591131B tündérek”
514,327,877 *348C37BE94DBF8DF79C89A54F3BAD9E6141161DA tunde salau
514,327,878 *3486CB0B0A168EC560D8257314E6548FB90B0DE7 tundi ruehl
514,327,879 *34852599993DDCCB880571BA6277A80843F2F9B3 [email protected]
514,327,880 *348A7CB0DFE29856FF0FDBA67F5AD2C80DB5F236 TUNDRA00
514,327,881 *348116139A23B5BF4BBFE73906D78F4AF1ED5332 Tundraloa
514,327,882 *348FCC12175EBC78C0283E9684B14EC5B1CE3264 tunelske5
514,327,883 *348C6EA6C75A3E168004E0108B8763DFB6659D89 tunerreceiver4
514,327,884 *348C90FE375250907C7DEF45D1E28B56C778BE92 tungawskieblahgadunzie
514,327,885 *348B99EDF91A209319EDD04E5EBBBB6677AA86DD TUNGCHENG
514,327,886 *348B8EAF05BE114BE84E8675922578420D3A358F TUNGEMUNGE
514,327,887 *34893281C9722BF4A398E6B3CDBBCAD2EF6BF6A4 [email protected]
514,327,888 *34815F8092AF23C3DA9C01B421EF75A4FE482ED8 TUNGSTIDES
514,327,889 *34876B00B169461FDE6F067F3C505E44D500D1C9 tungstousa3
514,327,890 *348264ADDB708E73D520F82DF34BD8AA978D8D61 TungTauEstate
514,327,891 *34859C5261886227416ECDA2B5B2257854A6D4DF Tunguserna
514,327,892 *348FB86462E905B71FBDE78D60E47A94DB1BF0E1 tunicasilver
514,327,893 *3488490D3EF53267CB774AD0AF41ED55869F766F tunikansa
514,327,894 *3481A9ACAE42DF8289EBE7E7195F37AD73794B2E tunimowt8
514,327,895 *3489E124FA36801C7AF2906020566FBE37BC04E0 tuningh3
514,327,896 *34836E4690567D75ECA9D775267C058C20801C2D tūnis‎
514,327,897 *3488647425D254978C696D9EE892DAFBE00291A1 tunisiaforbey
514,327,898 *3480A4882954EEE50387B007C2BEE2F66F9F1CE9 TUNISIA-POLITICIAN-STUB
514,327,899 *348B988EB6BE8FC78209C0D81C6EAF1FFB595A4F tunisiastaed
514,327,900 *34829385B75DBA929D5253C6BA3A664D32A89F4F tunitska
514,327,901 *348FD88E39041EBAA6A529BD9E5EFA7DE9D859F5 Tuniyev
514,327,902 *348587B448382F45056E4AB4D2BE3AA2AC79C167 Tunkinskiy
514,327,903 *348D56A35F1A47A7EE188F08363A3F88BBBB40D0 tunnatuksi
514,327,904 *348900C770916F9A858F1EB42FB46E83C8C12A40 tunnelmallisena
514,327,905 *348C27319B4E40977231C4B8F7E28801F826F20B tunnelmo8
514,327,906 *3486D6241F96186AF8B3F0B7456C66AFE318186B Tunnelquerschnitte
514,327,907 *34875607B652DCAEE353F82244AB18FFB34836D2 tunnels of sound
514,327,908 *348288ABBD430587492CFAB5F6CCBDF62A1BBA86 tunnels)通往卡伊魯亞(kailua)和卡內歐希(kāneʻohe)。
514,327,909 *348E881E02DAFD4905A54A14BD189247866D7606 tunnelvision10
514,327,910 *348466BE5B4909952131E6485D6B3AFD5377BAA5 tunnen vereni kiehuvan
514,327,911 *348A0FB16A644EDCC8127CC3DC0CFDFC8116F630 tunnustautuuk0
514,327,912 *348779EC597CAA4D2880A9CE788F985FA276F8AF TUN-PANELIST
514,327,913 *34884BC7F9AF371EC44159745421BD83A82E587C tun pramoj
514,327,914 *3489568CE522005576C9F8C860CCAE3D4E54A7D8 [email protected]
514,327,915 *3488B0D5631E896D98E6E1C85EBBEE33AEB46127 tunteenpurkauksesta
514,327,916 *34871E3CED86F0316027A29B311529E933238475 TUNTEGG
514,327,917 *3488758B9C83CB30561244207578DC1F3E35A5C2 tunteitanne8
514,327,918 *34839D7BA971578CBDF862D5CBF24F32BC18C1B8 tunturih6
514,327,919 *3487030A0B28235DA2FC9BB498653FF6EDD08B50 tunturilauluja5
514,327,920 *34865332ACD7573186B9545AADB726B0360CD32B tunturirallissa
514,327,921 *348457780A8D211B1752FE37BFA4F623ABCC7442 tunuaftermath
514,327,922 *3485EFF3536E5FF759C074799AAB1A0DAEE7CC76 tunugdliarfiks
514,327,923 *348FAEF606821E2BF373C965C6BD3EED9DCED8C3 tunutuip6
514,327,924 *3480C8566E241E8F7F7CC39ED587CA7CF6203F14 Tuohmilg2
514,327,925 *34848A516B6E330E185D29E70D99459E69C4C441 tuohneet0
514,327,926 *3480878C8DACA4310E6234F9CE496D8839E09AD1 Tuohpiwed
514,327,927 *348DEB5A35F9FFD54B06AD4C1C31D604B32AB4A6 Tuojana3
514,327,928 *34807268BF58345D0971A8C94353C2CDD598D9CB tuoksuu3
514,327,929 *3482EC9A223E3D756BFF34127947F9D1F7D50F01 tuolinsu5
514,327,930 *3482E565357D9009A2E6002D8359AD572141B655 tuomaried
514,327,931 *348387A8DE78F94B426EBE61C70984FE0484A5EF Tuomioon3
514,327,932 *34816DE9BED6BDA9E0A43B11B174A5F95922A696 tuomivaaran
514,327,933 *348481B02EDB8FD259545CD475E8051CBB98AB8E tuoneill7
514,327,934 *3482DD1D1282E16ED5576BD08C31F749599F5D7D tuono7
514,327,935 *34867FB430BB7A13A2E2600AB87598C041E89698 tuorille
514,327,936 *3486199FD83CB06AFC21A5B7EAAEC783B05D9A93 tuotantomahdollisuudet3
514,327,937 *348B80996F6983DF6D054E85E6F735087E42ECD5 tuotantopääomasta
514,327,938 *348F565391E7A81D8772D4493B67B3651C354F0F tuotemar6
514,327,939 *34860CF59CD7D75BEFBA15F3C5D7ED96DA4C4C49 tuoterglam
514,327,940 *3488E9D4A2D6A969EF4CCEE4CCBBA6D64167BE1E tupaiifgsdgg
514,327,941 *348601F01C77AC6417D5207AE3C32873913AF1FA tupakoijilla
514,327,942 *34860382142CFC613DE7E2C4F1232467ED1785A2 Tupau
514,327,943 *348D97DD2C01BD7A8B6137ECD988FD61DF754323 tupenu02
514,327,944 *34831D1854566056E8ACB4336AD90A3021324B49 tupilieni2
514,327,945 *34892F2B30476C49C2FA3446A8ECFC44A7AC0D17 Tupilquillo
514,327,946 *3489CF5D2D78183B6DA683936DB4F9330DEBC9D4 tupotima1
514,327,947 *34875FCA8738B8D7D871DEDEB483EDABEE881AA6 tupsneling
514,327,948 *348BF6A16474DE92E22C18FFEFFC774C252FA11E TUPSSPUT
514,327,949 *348E516862D26FBFFDD8E14D294DD42D43D7E0C8 tupufia souza
514,327,950 *34807AD670B40CFF510CC9055CE076066A031897 TUQESS
514,327,951 *3483B36C9AEBE2BDA82BFFA4571771BA7F0B5042 turayned
514,327,952 *3487E88B0E66A18CFEEE2DB6CD4015AA7A556DF5 Turb4nen$
514,327,953 *3483C7E8C1D006BA627213E0A3549000F3BA6D51 turbada6
514,327,954 *348041067639252FFEC33C27AD245679BC75549C turbanoff
514,327,955 *348D6B996BD7ED7F9617F530C6F4FDDB21A609C9 TURBATAE
514,327,956 *348294052C57686A2932FC01360BF3E57E2BE1A1 turbaturases
514,327,957 *34880C73B30A8181408165260305E56149E23602 Turbedar3
514,327,958 *3483F341291C3214A1D2B4475F017B904983BE15 turbeturque5
514,327,959 *348CB4627D69BE09F11E4C334AF4589A8FFEE52A turbidity5
514,327,960 *348AC11F69C852FCBEA3173D44784311CC150B14 turbinane7
514,327,961 *348F98737296278656972D0EAD68F67D4D630A3C TURBINECTOMY.
514,327,962 *348D708500F456D9B4E171BDA78414C91A71A9A5 Turbinenkühlung
514,327,963 *348213A16327D1D20044B05C5DF271F85927B23C turbinerebbero8
514,327,964 *3487A678AAE7C370F4C838157632B1A889CAFA79 türbinini
514,327,965 *348AF8F017427AFBEB63BF760697859EBF337230 "turbo"
514,327,966 *3481049F3D20D079EBD765D86CACF1C5EF4B787B turbocorwin8
514,327,967 *34862E1BEFA59C134475AFE10EB2D464E1B06E69 turbocurtis8
514,327,968 *3485286D91EC55A0F2619561B39C3B1071593C19 turbogeorges
514,327,969 *34824034A7699A1EE72BE6FD2315638FA2A24EA0 turbokompressorthing
514,327,970 *348293CE30664A83CED6FF96774B7675C5CDE513 Turbolento3
514,327,971 *348AD0EFE0C04E6F33DEF2B107FCD24026883BDF Turbolif5
514,327,972 *348455A64E25A0CD1CA515AF5AF0922618D39A58 turboloescher
514,327,973 *348F28224E2FC4831FABE85532362115DBB57F50 [email protected]<