List database


# MySQL hash MySQL password
458,340,001 *2E8C3CAB1B28717FAE337AEBA9CDDE82BB602DD1 KEENAN.GRIGAS
458,340,002 *2E85546C7191B8D7438E96932941840E0F7347F2 keithflynn
458,340,003 *2E81C5021F13AFCFB9D9405AA6B543064E2BFACB GROVERVIOX
458,340,004 *2E8383E6B683D0D2818EED0E5A4DC91343F97CEC GTLAMAR
458,340,005 *2E8763727F4C8EC46C1D62BFF69731AD487B6847 gtt1
458,340,006 *2E8772AA084FD884C6B28D12F95407D5693CF3F5 KEVIN.LASKOSKIE
458,340,007 *2E8A039AA4BC249A18836B590B8EBCDD7C2CF370 GZ4SQKK2
458,340,008 *2E883732BE4D4C99E9EC5D940B8C3E183798590A KJMF
458,340,009 *2E86AB367E651D002FD684FA861D3D82505EAF55 koreysantorelli
458,340,010 *2E82112B91072AADA590C6D40CFFB78A5761E801 kqt2nnz811
458,340,011 *2E87F48C3BD7992B24F70C1412EECA41C2DE646D hartmanicům
458,340,012 *2E815712BCB9F201EAAF5466E53F47D11E39F77A HATEILLES
458,340,013 *2E803AAB02B98B4012C7861BDA2FF64FC42C745A KUBUNGTU
458,340,014 *2E8A4817664102E982E66C48F9C00D37E86A1F2F kurtisdelval
458,340,015 *2E87D127763F13CD7AD90246E716EDAFDE9C75D6 kurtschiffke
458,340,016 *2E8334CFE880E44960657B9D6DA301501E6C1A3A KWAARGEWOND
458,340,017 *2E8794D77C6373B603DFEBA4F1F7631417CA9DD7 L070957
458,340,018 *2E8D8AE5456059498DA2F7C628612119FA3FDFAF HEKYAA
458,340,019 *2E8EF5FDFC56B56E62FC51988E12697E483110FA laap
458,340,020 *2E8DE8BC7561B6E868D53B6E74E5B88CE2A1E3A9 HERMAN.CLIATT
458,340,021 *2E8FF9B144FF473E3076E756120C6189A3384F22 HERMIYUNIE
458,340,022 *2E8AF7A000FBBDF3D7F519774C98D77E862AFDE7 HEROTHUS
458,340,023 *2E8128457ED5C77C81AB04AA8801414573FB94AA HERSCHEL.MARRIER
458,340,024 *2E8549F2A5F1CCD4D41EF5D77A1FE4DD5EC87FDD [email protected]
458,340,025 *2E877F022FD756AA6BE75487D911661ABEE0FE49 hi~~
458,340,026 *2E8AD63E19BE24AC589370EB65148C79955C6328 LCAMANZO
458,340,027 *2E891E0E909963904022F56FBF29B597C78B13D7 leavehiminthelongyard
458,340,028 *2E8196478B303CB0BF38BE9C6A340BD9EF4728C1 le-herie-la-vieville
458,340,029 *2E8F03D8E878994197FC4E9B94B2D3E3D34C1560 HRÊOBEDDION
458,340,030 *2E8B5FBC9D57A246624049ED6F1BA8E854A45F98 HULGA HOPEWELL
458,340,031 *2E8A683864ADEE91EB4C131E529CD0137418D8D8 hunting?
458,340,032 *2E8273BA9DF74EB7AEF1A704D834F7621C601817 LES.CONTES.D\HOFFMANN
458,340,033 *2E855D22D44E5B038A0094F05594F3C966207D7A LESGARLAND
458,340,034 *2E830D6E5EA28DFF61BFDE770886A53428777968 LES.MATINS.DE.PARIS.(REMIX.EDIT.PAUL.FLANGERIO)
458,340,035 *2E82C792A96B8E67E0AF0093CCE570E2F074BC61 le.vendeux.d'tapis
458,340,036 *2E847ABED0F2AE29FE4ABA211540DA09D45132A2 iamhomer1985
458,340,037 *2E8C0476772EADB4C48E60FD2CDDE4F502CBA9E2 ian-lavender
458,340,038 *2E824A350CE7D8FE023FBAA23726E88E3C72DC6F ICHENHEIM
458,340,039 *2E8FD6BF45B8E493481DD0C42554AD07D353B00B LIMNOBIO6
458,340,040 *2E86352D23E68F238A24DAE7DD174FB169A99CB0 ii in taberna olim lacus colueram
458,340,041 *2E80D0C3C4B2C7817B9066DBDAC07885B2A725BC lindsey.shane
458,340,042 *2E8DB302349E133B0B47337862A55E89D22D25F2 IKITASTAED
458,340,043 *2E80E6BB3871FAF50A4607BFA8972867982276A6 iknaknuj0
458,340,044 *2E87ED5F121DD7BF8C782CB7E8A66DD0061DE02E [email protected]
458,340,045 *2E8BC12701519AC2743745654159D336A1014B18 [email protected]
458,340,046 *2E8A9CDD187B56DDC8E52614799FDAC822F937B0 ILOVEJORDAN95
458,340,047 *2E847537F79473B9188B7A21810419E20247266A [email protected]
458,340,048 *2E8876965078849B369CBE164118BB6978A8CF9E LIUJOYCEQ
458,340,049 *2E840CAEE389F06857CCD92C8BB8485493AE6ACF IMAGESOTHEBYS
458,340,050 *2E831BC30CF68FE254DB2B85351B2CD597D0F80C LLAMASTEPH
458,340,051 *2E8745D53F2B0B895FB0E96B3DAA8218C5C3F28B INAHEF
458,340,052 *2E8A11D363CB2F92CEBBDF0349238BAC5F114EC8 lloydhoevel
458,340,053 *2E8C593369DF6A07F32701BF5CF3BED9FD64F210 INCASKED3
458,340,054 *2E80EB4E7C900E5793787BBE2765E1A1048BFE3C indiachina
458,340,055 *2E8EDD003FCFF0C42E00773E73061BA5491A6B12 lorenzowalch
458,340,056 *2E8680D903FFFF35F2659114136596B27FA052BE LOSTLOVER2603
458,340,057 *2E8EAF242C905B8E0CC4C7CF19E27CC952EBC328 LOTTRYING
458,340,058 *2E8F9A5E94AF58BE4B0D78325205FD28BF9DB624 inthenight(shortversion)
458,340,059 *2E8FCCF5FCA387F25B45237E8837C134FFFD8D8F I%OS
458,340,060 *2E83011C36D23479BDBCEF7B5814DED87D540E8B [email protected]
458,340,061 *2E8C421A4342048ED591E8D6AB7351FED063E7E6 isiahmassini
458,340,062 *2E8C9CC9282DAC597C220442C408FA5AF86628FD LUPE.GRITMAN
458,340,063 *2E88E0D42347645D4A2019AC198A45FE92688C88 LUVLEROY4EVA
458,340,064 *2E859E95707C7F913231A2464FF51CBA9DF9061A itcu
458,340,065 *2E81C896FD6111517A2F3381208C1F5D2691B81E M457UR8470RY
458,340,066 *2E8EC4F84E3AAAB7B8E1536A474C8FC0878DE743 MACHO.MACHO.(SENSIBLE.BOY'S.SONG)
458,340,067 *2E8AFF2C0C2F3A088132DF9A05261A6E38FEB27F MADDYVIKRAM
458,340,068 *2E899D4111EF6CA21CE39748D08C651C7A122A3E MADHYAAH
458,340,069 *2E8FE9129ED731C919F196CE6DD27F0AB0385EEF MAHOVINA3
458,340,070 *2E8B9161A5A26FEA5200F5F4211AD7F00A9D0969 JACKIE BAUGHMAN
458,340,071 *2E8820285C49BB6FA4248708BE8D30868234EC9F JACOBKNAPIK
458,340,072 *2E82F86EF8BDC7429D47953B32D705F06DAD032B JAMAALCOLBURN
458,340,073 *2E8F8E32817A11F87127FDD9255E0A9DC1511682 [email protected]
458,340,074 *2E8E159F996C11C3C48620F4F6AD21D4731BED5C [email protected]
458,340,075 *2E860695EF1E7BBB9671015AF9132FD286D3600D JAROCHAERNSTBSW
458,340,076 *2E8D074DABE5E6F98A7B4711482A4FD37E4B7761 maliksoros
458,340,077 *2E8C91891A9466C7F89F675D3D893655D054F641 mankled6
458,340,078 *2E8B0C0ABDF54B21CAC8DED26A04F90B291DFAEC JAVON-RICKS
458,340,079 *2E8ED1702B6CEA9325591340EEE16E18202D52A0 MARCELLA-GRANT
458,340,080 *2E86EAA84931FAB5A65401B7068E9DEDBE432188 JAZZCRAZEL:
458,340,081 *2E8342B7573076E3CC543F8A191C0FCFC887D625 JBINZ
458,340,082 *2E8822F608D32C44760DA1B2A51D3FE5CC54598F margaritoolafson
458,340,083 *2E843BAE815B36460502A6CD560769B16AB11127 MARIANOMAGOUYRK
458,340,084 *2E8F6E21A053698373DE8973BAA143BF7F01587A [email protected]
458,340,085 *2E87B31BB4A0CB6CB33340C99FAC549281F372F7 MARLINAYUSUF
458,340,086 *2E8A94B913A00CAE5A9FB68881B35C8869524296 marstellermaa1rzteh2ler0
458,340,087 *2E82157DB6C873721100787FEA31A53E843A6048 JEFFKRUPA
458,340,088 *2E8DF73E322396884653EB32D1FD63CF46887002 MATHU-KUMAR
458,340,089 *2E8C8349AAB4DFF39C4A62312CBF2C44083330DF MATSUKUR7
458,340,090 *2E8A44F3D86EE8D97A20F4B03E09856CA38052C7 MATT-STAKES
458,340,091 *2E8CDEA1F260A095450689A2146C8D46FA7E5B67 maurie
458,340,092 *2E8A06E844307F0F92AF11BF4E16BA700BA184B5 [email protected]
458,340,093 *2E8CCEAE7BFF51304ABFC78DAA65A5484BDDD91B MECHELLE.GRAY
458,340,094 *2E8BABEBA0123DF1CEC2C05AA093A7091DBA3968 MELANIE.QUIROS
458,340,095 *2E83CFF9741308C636CCDA40A781F5E69EC5CB93 MERVIN.SPINE
458,340,096 *2E8420A5CD00025E4E0DAC7576C7FBAE5809EBE4 MESOTARDIGRADE
458,340,097 *2E86B7DA431A602F8A58353F4A108641B2BBA41B JOAN.SOOLUA
458,340,098 *2E828D0FC03BEDA9BA7D5452EDA8DFAF7A7A377B JOAQUINMACKENZIE
458,340,099 *2E8F9B7502AE7A843E573C54F58B3B54D738FEC7 JOHNATHON.ABPLANALP
458,340,100 *2E89DACB8C5CBE0ED374C6B529B8ED5CA1BE69DE JOHNNIE-SCIFRES
458,340,101 *2E89392E8812DA77160A9F647924EC5CA3BBCCC0 johnnybaumler
458,340,102 *2E87D7D3CA341BBE8199EC001763EE1B93E2C36D JORDANDIFALCO
458,340,103 *2E86C852BA7FB6F676D23002A797E8A00EBF101C [email protected]
458,340,104 *2E8F24F08931D6100389BEA6DD273F3699C7A7C8 jordanlohmeyer
458,340,105 *2E8374B11256DD73B5F53843A2195F3FF3D0F3AD MINDERWAARDIGHEIDSCOMPLEX.
458,340,106 *2E8A3712AC5B32DD70BA8FEB361B9735A68110AE MIREILLELANGLOIS
458,340,107 *2E8A4749C10E71C607634A3F5DFC25026FF6A676 [email protected]
458,340,108 *2E8415ED1410412EFA11FB7EE733FE820DE77366 mlbでも選手一覧記事を作成し、そこに一節を設けるという方法も取れると思います(これは
458,340,109 *2E8C4D856B186F1E9413B8FE99DEF020D6C683EA MOHAMADSABZ
458,340,110 *2E80D0C43D029221A3A594543D8C12F86463F417 K5HU
458,340,111 *2E8F9C23F0C9DA95E354F45F041F4213407F61B5 kanjidic
458,340,112 *2E80D12E4CC57BDE7E60719242168F0704C1EE76 MORDELLISTENA-BRUNNEIPILIS
458,340,113 *2E802686D93BE2183288B616D02005C607796B77 MOSES.EMENAHA
458,340,114 *2E8075CCFF2D87BD4BBDA6E96D2AEC91CAB9E62E MOSESGALUSHA
458,340,115 *2E835C8187BE50DBD41F80FA12DD4E1217AD4627 KARIM4
458,340,116 *2E8225B2CC28CABA7B2199391137124C31A484C9 katemodernscorestoyotaproductplacementdeal
458,340,117 *2E8065E4DBD9738C84F9D621A2E0BE732FD51616 KEITHDIVIS
458,340,118 *2E851015C7A997B4AD5478DFE9C99D5E814CD1D6 keith-ramsdale
458,340,119 *2E8395805B25C8DE2D728FAC2F1023F00A04ADFE [email protected]
458,340,120 *2E81694BFA015FF7461BA1D2C5473645789AD994 MUSARRATKAMAL
458,340,121 *2E83E62CAE277F97FAA6180AB5D566A4647D2AAE KHAMSON27
458,340,122 *2E8544489C88FADB4086C51232150F452DE6C9FE NASLINI
458,340,123 *2E85A4D7016FECCD1B688A870B011E7A4BDE5BC3 nathanaelsavedra
458,340,124 *2E8F4DCE289EC4AD5FA0696AC9FF1EA978099A1C [email protected]
458,340,125 *2E8EA1C77794BE7EDA37C17411F4D1952C58B2EE kkk1313
458,340,126 *2E862A0D0B69928B1C5A9573365A23587E4C5A7E klaudiakazimierczak
458,340,127 *2E8081125DCB101DFCF71C6A0D600C66972AE600 KOLOYAD
458,340,128 *2E8F10D66A13372D8FF3DADD535E16E3B56C9D33 KORSETTEN2
458,340,129 *2E846E5FFF8AF21B817532F036ABDEA9622D1746 KRATYNOSA
458,340,130 *2E8D9260A3A8A072CA9EDCB33F629FE7B3457315 NEVILLEGALDON
458,340,131 *2E862FF01E3D6B4A1DD1838FF71D5A91B79F5532 NEVILLE.KJOLSETH
458,340,132 *2E8378600E547721E85303BFC0D7143149FBF769 KSHATAANYADBHUTA
458,340,133 *2E874A3BEBF8D78712A007615BADEF901C365D7E NIBBLES-VIDEOJUEGO
458,340,134 *2E8A1A1B3151ADE6CCB741001013FD1DA214DEE3 NICHOLASMOULDIN
458,340,135 *2E806C1D9529A6CFEFB739CDB7CD94FEA97D4468 KURUNDIS
458,340,136 *2E821EC6F6526AD1FA21716A011D6B6E267CA77A nicola.goff
458,340,137 *2E87FCBF2D36FBEE6BF15FE342F4FFB5171CBA30 L3APFROGG3D
458,340,138 *2E849CBE9D1D306D590478DD4012A7B264801327 NIGELOSBURNE
458,340,139 *2E8EFE603D22B924F70C7232C1F3964A47B844EB NIHASA1234
458,340,140 *2E899933650EDD45C73DC50CA4FD915A3D04C92F LABIAAM
458,340,141 *2E8BF595284B530C4770FFD575B69233DF32419A NILESOR
458,340,142 *2E83BF2FDA3F08892D39F98A8DE1A9A6ECC65C0B LAELIA87
458,340,143 *2E82C5500F7E266BDFC8F84366E654A8F93C2329 NOE.SCARBOROUGH
458,340,144 *2E80EFA89F9E3874F51B73DAF950CB7AC06A3746 LANGRAM
458,340,145 *2E867EE3E07229D6625C8F2176E179BEA7A13777 LA REINE MARGOT
458,340,146 *2E8006645886FFC16FAD3482B55E6D5D86C394F8 LAST-IN-MY-WINDS
458,340,147 *2E8D2753992CA2D42BFB0C65C20D8A3D3853BC70 ldi=
458,340,148 *2E8E3AC52D9325FAED077B1ABC71BB7AFB59AED9 n<y'
458,340,149 *2E8B91955C1EA1BDA41236435908B79E42324095 OFFRIRNE2
458,340,150 *2E833B0FE4F3F21A58026C234AF076D45584A9E0 OMAR.RANDALL
458,340,151 *2E8A3F90B96D448DD8388546AC1B881C4C28984A omploegen
458,340,152 *2E8A0E6AD004A331B744261E0371BF204E770D41 [email protected]
458,340,153 *2E8C556DB49A0252F0A9447F461C1F1178B392E5 LIQ123456
458,340,154 *2E8938DA2A9D45E6D345CD09FD008050C00497A8 LISHA WHITAKER
458,340,155 *2E8800690E6634BB993879F5EB24E21E56078FEA orenrockafellow
458,340,156 *2E8C1B2F1C39A77FF6A6087CA67041D8E8CDBE4E organ-works,-volume-2-(martin-haselb
458,340,157 *2E8C8D1E7AD35BBC143158683B44D9B1DA2143E7 orvases4
458,340,158 *2E881E8E71F7C2D13B81D74FD3E1200E3A1B6160 OSVALDO.REYNOSO
458,340,159 *2E819F57FF378A8D37DE82FC888A48DA45C5A096 Outdistanced
458,340,160 *2E854EE35B4530839AACB7BB0090A675AA8FE2C8 longing for lullabies (feat. titiyo) (john dahlb
458,340,161 *2E8AD75C2D84E365F12277F8DD50FF4BC5455869 LONNYFESS
458,340,162 *2E87F75D6EC6DF90C852DA9C454D12C9B7079FFA lorensdelacruz
458,340,163 *2E88D62C48BA40F3DD31049B0BB0BC9285DD621C $p3-=-sub-{[email protected]_-;-};
458,340,164 *2E89D2623A7A55160EBE3C9F0CF13F1C6B44F542 PACKERSNIMROD
458,340,165 *2E81C8C8BA662FA457FD134CD3A810DDD9174B78 [email protected]
458,340,166 *2E8E089767A346F45FA05523F72559C512E914FF LUCIANOVIELHAUER
458,340,167 *2E82650803DC94C524342CF30FE744FED2CA2AA3 LVY!
458,340,168 *2E83C157D72161961E19B512649964F6425E950A LYSFORANDRING
458,340,169 *2E8494F374F109ABFFD10EAFAFCE563FD85FAFE0 m4nipu148i1i+y
458,340,170 *2E869457404567ED60E9E07C81ED625B94E64EBC p----d-*-3b<-
458,340,171 *2E8DC032EC8743E4C4C71355864EE333A7018952 marckson
458,340,172 *2E88B3955CA87711327A19156365B0C591D5B0AB pneumotectic
458,340,173 *2E866995F6673FFE964463AB16F2C78F007463A7 POTRA
458,340,174 *2E8BDBAB740DF5F0C3BCC2A0457BADB6C991DC40 pozirate8
458,340,175 *2E8184A9A12174737E7480A24526C7990361F768 PRE-DEVALUATION
458,340,176 *2E8909C317FAB8AE336D274EE2949734E8989415 [email protected]
458,340,177 *2E8384B6CF61A66744E5C6D7BEDE254ABF2B1989 [email protected]
458,340,178 *2E8C43A9385B97A9EF957F2427B1219106F7EFB7 MICHAEL NAH
458,340,179 *2E81AF9D1951DDEC0607829356B72593FB683D57 pumicing1
458,340,180 *2E837605AFD693A4BDC6771F80B352C059BF27C8 MIGUELMIRON
458,340,181 *2E8C8A15726CFC8B7CA2B15A0004CCAB83DDAC25 milesawayfronthg
458,340,182 *2E85D9F6A0CC5E5EF470CF624C3B268D98151EEA mileshi
458,340,183 *2E8203493C3C3E6F3F9CBED70D1B1D8353FA8B04 [email protected]
458,340,184 *2E8B80ED0B18B6842B2344CDC391874028473A5E [email protected]
458,340,185 *2E8407256F6B3C44FF0F9F635398418E69052F0A q> ~o~o(~_^)
458,340,186 *2E8EFDA250FA1029378063280AD066D627C3B89A qp*splat
458,340,187 *2E8DB44DBD2BD1461E57A8063246E7C2E7999E0C MM80457623
458,340,188 *2E852206200D2C62B59BF5DE5D02375955913FC5 QUINNARD3
458,340,189 *2E8657995B2D063692E78B598354E3EACF89B4C7 MOHAMMEDYEN
458,340,190 *2E806E18D7307FF5753B8CA46EABD4B927AABF59 qwertyqazwsxedcrfv
458,340,191 *2E80B3696D46A617A60DBF3E8E3354C0C27BF5D0 RAPHAELMANTERNACH
458,340,192 *2E8EE9B77D8A22A5558D5EFCFDAA80B0FCF7C1AB RASE
458,340,193 *2E82FF805F15720E85572106416BFE9D0782B7D4 muntini
458,340,194 *2E88DF240D9B2B1D652B33ECDAF74B4F635D29F0 MXUX
458,340,195 *2E87EC10635F7FB04D462489AC1156C978C46582 rcashcellscount
458,340,196 *2E8329C1DFBF912E4B40BB04A893C087A810268B MYRONOUM
458,340,197 *2E8B2A084949044AF0861A31C7358D29181E8151 Mystery.Train./.I.Forgot.to.Remember.to.Forget
458,340,198 *2E8793A13C5C05B0D6C1FC40CA2CF4C06BF89625 N(}
458,340,199 *2E8776F98E6504E9B7EDACBD6B1FAD2ED19DD790 rebooked
458,340,200 *2E80FD2C024C47B807E19DBB8FBCAB105B1BA555 Redeliberation
458,340,201 *2E8F1C4224169817538FFD7E8A0F8B12F77EBC9E name--see
458,340,202 *2E8AF8DE0E0759B4C4FF90C5C2529D9132728A24 na+v5m5
458,340,203 *2E855BA708D9780AF86E8B2B153B4CA8407BA33E NEPONORIL
458,340,204 *2E884F826DC78D8D1CD7579F84CB19F2928BCF33 rhettalexader
458,340,205 *2E8DF170B540944ED7F54130D77ED81805E9CFAA NICHOLASSTEFFENS
458,340,206 *2E8775D62E8DDB658516912963D00577AE3830E4 [email protected]
458,340,207 *2E8237EA3050BA94339C263B6D96F6026E01064D NIGSFURTURANIA
458,340,208 *2E856C944224936CDF09E9038F24554AD48FE5F5 nivwqstea
458,340,209 *2E8E274939B12D9CE260711E3F002151019C6317 RIZALDE1
458,340,210 *2E8C4B205A5A1F0E57696C0C8AD5C6CE04B6F3E0 [email protected]
458,340,211 *2E8F4AC08A5D0C5B987DF7EAAE41B71B1956148C rodbendana
458,340,212 *2E8F8619FCB373E46E34A2737D19B9B1E4D44928 roderickacevedo
458,340,213 *2E8F5FF6EC91658AAA35C941E23DC645D22B0177 RODGER.CUTRI
458,340,214 *2E8418880CD66C555DF8FC7141372F3C8ACD8CF2 RODOLFOCHALIGOJ
458,340,215 *2E886ADB47AD789C844576CC5B278653113E310C RODRICK.WITTENBORN
458,340,216 *2E86298E659F80E49D1F4034C17E0D6C57473A50 O0:AAA
458,340,217 *2E8447D3913E221FCF5F2E8BF67E9C11DA6536D3 romkfqurh
458,340,218 *2E8BA94028E9D596195A9DB7E5B5BD907A6795BE OCTAVIOPIPES
458,340,219 *2E80C9E755415992F69E7C13B6A3459B07F328C5 )o(*.d#B
458,340,220 *2E8DF9E7D2BEA4282E28709A16145736B3212CC2 offbreak
458,340,221 *2E86343CE650671692E76DE00BF28D4E0AB29B76 O LLORANDO
458,340,222 *2E87E4C850B7B33666F5A92A8346126C9E55A497 [email protected]
458,340,223 *2E8A47BED118AF1D19A5758AFC17A67FB43D00C6 ondraagbaarst7
458,340,224 *2E85918D78157880BE332731A88EE24EF298820B Rubycon,.Part.1
458,340,225 *2E87E199E3B611F355127E0DC59892E727F4E198 ONLINEHS
458,340,226 *2E850FE2EE269F91AD9C410BE737F04F14B9A41F RUFUSCHAMPNEY
458,340,227 *2E8B7A71ED0F9272C0936D8B51C8705FF5A732A2 RUPERT.SMARTT
458,340,228 *2E84D4D1C23DE7C1C01ED12355C76B8840D6DD52 RUSTY.HAYNIE
458,340,229 *2E8D358BC8A7439459EC2DCE24CB690F09638C52 RUSTYWILLIAMS6
458,340,230 *2E8165490379DCA3CF0783D8550212A680F25B54 rvgb
458,340,231 *2E843002F68E766F70B927DF651DE86E6FFC70F9 S4C3RDO+411Y
458,340,232 *2E8B2D8101B97E4A273576B9610379E1D9A7F749 oscarmillin
458,340,233 *2E853ECC3FDDC0D75014884D369375096C7AA846 SALLYANNE
458,340,234 *2E8A8A4316F4E6813543C2805083DC0DC2D2F9B7 SALNANAS9
458,340,235 *2E88E396FA0B02B7029F29119EDCD80E4AEBB1F7 OSVALDOGOETTSCHE
458,340,236 *2E8DFF18299670AE89C2B7912CD1A77023772D46 osvaldozerba
458,340,237 *2E8ED916F71F2847519EB93DD2FAE90DA7A40C16 ougesni2
458,340,238 *2E8A19A9E241976586E2082F9199DF614C7958D1 owenrinderknecht
458,340,239 *2E88E4052C5800BDD9504D9C85056711C28E312F samsonhealth
458,340,240 *2E899C95F163E4223298AEE93A5A8C0E7C8B7159 P212429617
458,340,241 *2E8C6BEF117F1D4C3B8D1C67369B33D043754F8A sanfordbellaire
458,340,242 *2E880C78B4EB8D707E7EAE387461542859A2C412 sangdeanda
458,340,243 *2E8063835CD3D57CF595E8D81CFA5C48BFD8D381 SANTIAGO.NORDAN
458,340,244 *2E8EF20D7F64E4A5FCC869AE252E580DDBF6B359 SARAHFRED9
458,340,245 *2E8A8FD7656A8CBFA1A47CD913B1CAEC50627E60 SARAHSIGMA
458,340,246 *2E8ABBB35AE4E34FAFD8792CCC2E1718EBEBBEB7 PACKERSISABELLE
458,340,247 *2E824B3F56A291E0788EA7B63818CCE45B53AAAE savingly
458,340,248 *2E8D1AD9FCF2B2A90A7864953753E2DB2BE7E7A9 SCHILLERIZATIONN6
458,340,249 *2E8A0DB04448563B565D0CB967E2D678CD3C75FC SCHLEUDERGU
458,340,250 *2E8D52D2E89B9B88D0D8BDBC1EB7FB4947A495CD SCHTICK
458,340,251 *2E820C6E2FF83EF753F5707EE9BD72EED9651C36 SCORPIOMILESED
458,340,252 *2E8867BB50AD2BD61F9B70D27416EAAC29F87517 PATTON-BEJACH
458,340,253 *2E810D41568216C1928AD15EA6C8B6338EAA4730 p----b~0-~o}8{
458,340,254 *2E8DEFC883DC7E40E724C01A8CDEB88C04F077D7 PEPITA-GREUS
458,340,255 *2E84AD6BAC290239231D6A8526BEF8DD78D3840A SEPTENNIAL12345
458,340,256 *2E81E2525C1A8EE82B15968DBBB3705592CC2084 SERENADETOMOTHEREARTH
458,340,257 *2E84CFE70E3BB43C354E225717ABCCDE652573F1 PETER.STRATIGAKIS
458,340,258 *2E8E77BD1A40894C3191B7DA85BAF586D84061EB SETH.DIGIUSEPPE
458,340,259 *2E82B198C56DEF3EDB6642F37EE931C1230655B9 p$eud0p0d!a
458,340,260 *2E8B767BC18E666AFEB04E1893E3C17C37ADBDD5 PHILIP.RIECHMAN
458,340,261 *2E8D0D219995644D1A271D21CEF7DB5FCFAA1A35 SG1886
458,340,262 *2E8F125A697724FA8E4583B079BE632B776105D9 PHILSALK
458,340,263 *2E8908E38AE240A32C868DBDCB33F9B3B51456B1 shadrax
458,340,264 *2E8D310CA2B0E4B5E6B7D3F600036E77F2DF8606 [email protected]
458,340,265 *2E8E84E38A94DD6AC489CA87D1F3F5E2D17FA093 [email protected]
458,340,266 *2E86CA73F400605AE2FECD9C7C68FA8A486FF0C6 sheehen
458,340,267 *2E8A670A644AE527CEFE584383612DC5499AE64D SHUINJUKU
458,340,268 *2E8D9A6D0D8EB13D47BCD7D4D7CD07F703DFF74D [email protected]
458,340,269 *2E8E610F0A5936BBB8AE89579A282D34F1DFAC83 P######P.*.*)O(
458,340,270 *2E8B0B67BA870FBD27F96F1316FDD4C8D5F0C7B5 PRATIPATTIMAANH
458,340,271 *2E8987033C6BA8E7D3E3E8C1FCD2F41193DDC26A prijo.jose
458,340,272 *2E82808182D376F8B1A765946EF4EAAA362428A2 [email protected]
458,340,273 *2E85F97CF83A24E7657BA1C77BA4C93DAE97DB0D skæruliða
458,340,274 *2E85AE89D40077DCA4D5B17C2F3D917C24F9A1B6 SŁANICKI
458,340,275 *2E80411EEE5BF81E6899917155B9D87480E439E7 [email protected]
458,340,276 *2E8343F89CFE24192D994829DC3110966DFB0121 [email protected]~.~.~.splat!
458,340,277 *2E88BED1C571E7C9C6B5B395071B3B540D13990D PTPFAQS
458,340,278 *2E82D219B7423DFDF82353A9CB7529CC50F9DC3F PUGOLA02
458,340,279 *2E89A7E321DA362158575E0DE25015414E8361CC q-b~o~o)8(
458,340,280 *2E81779CEF9F99FF5863EF9FEA527EDF5A338B18 [email protected]
458,340,281 *2E87F5733ABC922EB840103FAA6F8F6AD6ACB203 [email protected]
458,340,282 *2E8D41A08AB952B8AB9A470E4E9E79025DE6C080 Q-----P ~O 3B<-
458,340,283 *2E8DA223F0CBB97576AEBAD8C2BE6A114315BE3D QUINCY.COUNCILL
458,340,284 *2E87AAF7C87BE2EABFAB40D8F49089861C2F8119 SONATA NO 5 IN C MINOR, OP 10 NO 1: II: ADAGIO MOLTO
458,340,285 *2E811A72C0F1DA3490003695857117AD48CF0933 rabadabstail
458,340,286 *2E864D6F91217E966DCA105176980421C81FE795 SOUKOUTING
458,340,287 *2E8D95980AB88ADFF8942D8322C78D30087E33B6 SPEEDYHUNTER
458,340,288 *2E8D8BAE5C7F8449817B26471891C967A9990603 spielleitungen
458,340,289 *2E8BA86713FF4A89FB61FEFB097486AE9FDD5468 splat!.*[email protected]===p
458,340,290 *2E80A61DAC778407CA89048135B463B701F6FE4A src="http//cxmgsmzncm/mgs//21k4wgvl_115_jpg
458,340,291 *2E8AC9CB32269BF0B6A880E8023787A02EF94298 O'\
458,340,292 *2E83612E96F63CD8AE29505020B6D52CC40D32A0 l
458,340,293 *2E816EBBCEF350D4DEC5FBB04C36C5705CA60F53 SRC=HTTP//ECXIMAGESAMAZONCOM/IMAGES/I/21VTFTHOFQL_AA115_JPG
458,340,294 *2E8203AE75CFDAE74A1657BBE67AC72AC54D708C 7
458,340,295 *2E85B69B790817ED28D7B807D17D91E4215B33D9 
458,340,296 *2E853CD711998A3FEE1A0CABB7C3C45A092A4D25 ܕ
458,340,297 *2E8C467BAFF7A17AE2C17AAA5C02AB3B31068A5C SROYOLPME
458,340,298 *2E8FA589E9A9FCF6889718A8B65F5CAE25F705F2 P
458,340,299 *2E854C092885110216FFCC507D136F325197434E [email protected]
458,340,300 *2E8D7A799655A1AA91DF1F31B70F13637FDD80B3 f
458,340,301 *2E892CC7D9FC952A0D8C8CCA4FB96CADABAB780C STAN.EDLER
458,340,302 *2E832BC8486E5B136E9723DD26BD5DE112ABFCEB Tb
458,340,303 *2E8AE189BF382BB5A4902685DF7243CF5BE77722 STATUENKÖPFEN
458,340,304 *2E85817CA159819956B9D6E5D12D8E7ACBEE0155 stavroorvats
458,340,305 *2E8740BE075C5D387B4D112F2ACF147BBF462333 stefanbowe
458,340,306 *2E80059241C0842EBE1BB180936834D73F8B49FE 6aX
458,340,307 *2E8073D55EFF9DE7D7FB6014E129C8F92D920477
458,340,308 *2E83927DDEA85153901DA0470B0630AA6D8819DC
458,340,309 *2E87D1D621354D947848229ECE31A28D9E12242F
458,340,310 *2E88651235199BB5D034E560562EA15276B26E71 V=ރ
458,340,311 *2E8A6C4AEFCAAD816B00CEEED109AF131AB0C94B QK
458,340,312 *2E879DD77E89E3BDCD742D1BA330C2281A93D736 STEVETHIELBAR
458,340,313 *2E8F39420B646F2CE43FE484E93E9A024E19B757
458,340,314 *2E8ED1ADA27F1FD211F000A60CD17C157E22ABDF STOMATOSEPSISED
458,340,315 *2E8FBE4F1D0DA4D2C8CBAB2FA8FB58DCE7C75455 STREBSAMKEIT8
458,340,316 *2E868B7911BA2000B90B0BC841022AB9458AF774
458,340,317 *2E87DBAE28B8812504094AF73234AE7AD4A1E89A Tn
458,340,318 *2E8D12E7DDD14C57C26EF443B4E20F6A5AD8621D STUARTARNDELL
458,340,319 *2E88328CA728464D2B4322859A3A44362F7ECA05 [email protected]
458,340,320 *2E887D65ED317C3118E9C618E216815E51DD832A &<
458,340,321 *2E86B0ACB7CAD63AA9F3EA59697397705DACEE08
458,340,322 *2E878B6DE79D472754ABBB063086C365A17E59CD SUIRUMAMED
458,340,323 *2E85572C3FC1B80A100254049022E037066686B5 li
458,340,324 *2E81481B6FE90EFE3087B2CEE9DADE298F21EED0 sumitbirmiwal
458,340,325 *2E863F100A86A371A19B8304571CFC218C70EB05 [email protected]
458,340,326 *2E8CF3E679811AF127E7D340054C5626F33ADD01 SUPPAFLY8
458,340,327 *2E86C6844984B30962773B6026C539969DF02182 susanlivesey
458,340,328 *2E81CA636281FB4DB6C472092A21F139E35F87B4 sylvestermccreary
458,340,329 *2E833F177B9DED11EB6B01ADC23FCAF1423FDDD6 symphony in c major: ii. andante - adagio
458,340,330 *2E8599BF75CEEFA1BC42DA0F3D106A22D232EAC4 TALK86.62.9.21
458,340,331 *2E88529C8011AD077EC19A1D2F42A440BEB68543 TALKSHOWSBSW2
458,340,332 *2E8A1BA371B94CBCC3CFF3EE89DAEEFEDCB9199B 00UPDATE
458,340,333 *2E80F231E90AA3ED494E96AA3CF14EBC577E7570 TEDDYCAMPANARO
458,340,334 *2E82CFC9A831CCE340AD10B40A324D3F9BB3F7F8 teguh-apriyadi
458,340,335 *2E8593982A9F90329C05D391D9B5903AAF3933CD tehot
458,340,336 *2E8398531EC5146CDD7D693BABE0DAD558AD1393 temptation-&-i
458,340,337 *2E8255CD4FA8400FD3F389A0534C1C97529F3A44 TERBOSBSW2
458,340,338 *2E8589072904DEFC0BF62C106770AB877F0E413A TERENCE.RIHERD
458,340,339 *2E82981A373D00FCF23DEDB2FC663E67E27CC31F TERRELLNICOLE
458,340,340 *2E8EE5D11307233D35D5E59F48B6268C848CFA46 TESSAIGA76
458,340,341 *2E84FF5E4969A33C188E6214AC0B5D63BC686F68 11071638
458,340,342 *2E83B337C53BCBD8D48D26F5CDD121E0BFA9710F theflashtoyswiththebikers
458,340,343 *2E8C04BE8DEC07D139CDDBFA979707D8851B82A7 thepanicchannelcomwww
458,340,344 *2E85620ABA9C25B26D59AD42DF5FF42CB624242F THEPHISH6
458,340,345 *2E88B825B797F9B80E3977FD93EED8B61E6EBCB0 126ANDREW
458,340,346 *2E8444D2588776FAC6352847B6893AF5303BFA09 There-Is-a-Star-(No1-Space-Hymn-Track)
458,340,347 *2E80F8F65F6CDD7766CA0506D1D0452720AF2992 1435601 "DOCHDAHATSICHVIELGETAN.
458,340,348 *2E8D8332FF926942224AD73B45CB67584CB11E20 THE.WRAGGLE.TAGGLE.GYPSIES-O!
458,340,349 *2E890AFC5E8EFB055D0C3AF1D21532E30C66C97D THINGSI'VEDONE:THINGSTOCOME(MICHAELKNOTT)
458,340,350 *2E888FCE4BA315B55E1EC5947FFB1714459F4043 155 AKTARILMASI
458,340,351 *2E893560C14BD5867170B1BA009EFF3B6FDCAEC5 1563497 ENSIKSI.YMP
458,340,352 *2E84E23F8E617527F9A7795DD78FBC9977EAF1CC THOMAS.GARNES
458,340,353 *2E8B44D91BA78C5C7D413ADB79D079E0A390B9D9 [email protected]
458,340,354 *2E85CFF875FEDEF3D22EDFD6ECB82DC3F6BBD5EA TIJILIEV7
458,340,355 *2E89776777703CD3E2EC2272816BD894B2D8913C [email protected]
458,340,356 *2E8277A08F502FB7437EADECB8847562042CF1A8 1942676 TILAT OVAT VALOISAT JA KODIKKAAT
458,340,357 *2E816B4F7F985A1109F27B2235C6B846BF601CDB TIMESADVERTISER
458,340,358 *2E8298F61F732E80183CF98D598185324CA32739 1.banneker-high
458,340,359 *2E807C261E347C5519564DC00380C29FA50A4DF1 TITTEJUS0
458,340,360 *2E8BB7D3A28C4094231C36A8F084772A59BE44C2 1CERTIFIED
458,340,361 *2E837AFDFB7C86FA27A94E266C49A7DE97B74D33 tobirix
458,340,362 *2E81BD84BAFD6DE8428CA3D39734407846CB4EDC 1GRSGANGE
458,340,363 *2E8BE8C8A329F9849D3B7B52801FA24F24A60529 1.HUEPFERCHEN
458,340,364 *2E8946120CC7E42B7A5F863E035B122DE0EDFFD3 1ILOVEDEUTSCH8
458,340,365 *2E8E405CD4F1C748A4810AB8D1B701833399B4BC 1.kivijuhlassa
458,340,366 *2E8067C1EFB6E87D987D266E361043D9EA0651BF TRCPTVRGRDFLSGCSSZD
458,340,367 *2E8F81C395B1CDC1FB2F3F653DBC3C9D98C1906D TREOFTROB8
458,340,368 *2E8B85EB08DAA83A1E92C85A21F9B0054BCF6A3C 1MARCHANDANT
458,340,369 *2E8360F6173C27E84A4A4C9E8A2A96B48FF96A2C TREY.GASHWILER
458,340,370 *2E8640D5C0ED703A128455188F08A484C8937E48 trinidadeusebio
458,340,371 *2E80660842AE226C162D1876B7FC8B2C68C2C5BA TRIPARNO BANDYOPADHYAY
458,340,372 *2E828AA59C07DEEB349652C12380EF7BB0B06F83 1NONFACTI
458,340,373 *2E8DC2C17081BA02ABD5410F956CBF2DB39315AD 1.OBERGANGSTER
458,340,374 *2E8033485C6067081F385CBC7F01D1EAA20F2A9C 1 ODEDIKLERININ
458,340,375 *2E8DB268FA757365135A2D2751895AA3D0C7414C [email protected][email protected]@
458,340,376 *2E8D563B703D025E44EBCD37D4F7B5E8DBE364BA TRONG-NHAN
458,340,377 *2E82835BD34C451252C55353951957AB4AF4B673 1-RAKENNUSLAKIESITYKSEN
458,340,378 *2E8D9BAC08DEE86AC8AD9FFE223D0F7386125D36 TSIHKALA
458,340,379 *2E8536BB47A27026F2241C5DD11371614E61B0F1 1REILGNAS
458,340,380 *2E8BD25AB1E41E050BC0BD3719F5EB8C67DBCFD2 1-sargkammer
458,340,381 *2E8FFCFF72C2B23DCC67AF8FAC39B112DD20E416 TULESHUN3
458,340,382 *2E8B17BE0F80B7C2B73FEBD3EB77930C5CDBC6C1 TURMIOLLISIIN9
458,340,383 *2E8065F19D1C1FA584FBBA77A71644EEE970339A tuuliajolle
458,340,384 *2E8232E212FDC88308E6384631CD9C79CC895222 1WORKERSTHOSE
458,340,385 *2E80267B50FDBB289738D2B964B5B65D104FFF2E TYRONTOOMBS
458,340,386 *2E81EF6E411FE28D4D63B5992BC0CD1EB55838AA U280987
458,340,387 *2E8ECEF2EB3B27416FDEBDF04A958AD7EF73EC2B ubaibymi
458,340,388 *2E82A7DCD317CAE1E9F48D8A27ADF3E4451EB4A6 2(1982年、ABC
458,340,389 *2E891CFAACE8FA7AAAE1CE4C2331F8C946B5546B 2538282 suomen.migreeniyhdistys.ry.-migr
458,340,390 *2E8B9CACAC181AC06919822BF4A017B38248FC5E 2852131 limppuhoitelimaaritinjanellankanssaseuraavanap
458,340,391 *2E8ECFBF969EC654ECBF2C1E3DD908B8E67D0C1F 2940048 UUDENTYYPPINEN-S
458,340,392 *2E8DCCC0CAECE58F788385B10FCDD4F21C32B426 2968714 NEWENTRANTSAREALSOSHARPENINGTHECOMPETITION
458,340,393 *2E835F5339BC72939C3B105F1BCD42821830A70C 2AHPARGA
458,340,394 *2E8EDA8F9BB15B102F714EC9636C96434D005A1F 2-cefischer
458,340,395 *2E80FC1CF953FCEAB82760FFAB51F9687CA28BB4 UnderwaterExpedition
458,340,396 *2E80241283910FDCCF79216062EC54FF4D20E663 universe-crusher
458,340,397 *2E8826B7C50EF85970A8814310CD3D1F92805613 2SEXUALFREUDIGEN
458,340,398 *2E8662CD405D24005648D3D6170B348D35896F2F UNM3NT0N3D
458,340,399 *2E83EF0B9956BDF2766CA282B969A3E9362E25E7 2 VERTEILANLAGEN
458,340,400 *2E843ED5BFFD5D07EEB0343B11F52D553D29A33F 2YOUNOME
458,340,401 *2E8D909A25F6C82A0FB1FCE07CE96FD205C10A05 UNSELD0M
458,340,402 *2E8C8EC5E912A7A1950DD5087CF86849CB43CBE4 3ARAHOYIK
458,340,403 *2E82A9849124D585096DFF3A61176A64197BEAEA UPCROPCURTAILCUTCUT2
458,340,404 *2E8DB573AEDF42019C1262EDCE5B13F9184D279B uphills
458,340,405 *2E877856176351A515921991F469FA0CCDBC4842 3###D~0-Splat
458,340,406 *2E8F06C901182756E80C2E2D6D80332A1D13ABCD 3LAKEENA
458,340,407 *2E89553D4BC55869F4759BA3404481606EB268CC [email protected]
458,340,408 *2E8B6BBBB1E752C5C366CECD6C869893504D8BAD [email protected]~O~OO><
458,340,409 *2E8CE78ECA32B5800AFD96A4A8AABBFC218A0178 UTRIF0RM
458,340,410 *2E8CF5090E25D6DFFDE5783D9A56069C887CF8ED [email protected]
458,340,411 *2E8533EBEE04D6F6F60A1622B1D7D98AD0299957 3UCHARI$TIZ3
458,340,412 *2E8C4698A9BF205C911D03C5B713E3E35880BE3D [email protected]
458,340,413 *2E8799218BF302129906405844B9E221DB967EFC vai541007535
458,340,414 *2E844E3C6265CFC657C7E09EED9EE4DEDDD66C2F VALV3.$3A
458,340,415 *2E8F2A17E4134C87004733405AF4B321C032FA84 varunavinewar
458,340,416 *2E840A92202B2C50E855E2E2EE57C673308A719E VEDKUBBE1
458,340,417 *2E8BE6F49C9E1F2F45050CF75CE63059AEF527B0 VENIS-NEAL
458,340,418 *2E8250717369C027CF5D0800D27C77DF018E56F1 VERMONTDAKOTA4
458,340,419 *2E885D769C76628DC6117AA7820D2F217B774A24 4THEADG7
458,340,420 *2E8173BA16AE3A9F3625ADAA4E4CE8735F46D571 VIBHOR.ATAL
458,340,421 *2E878851D0A18BB0E2B0ACFF91ECB48202748035 510-STICHWORT
458,340,422 *2E8A2C73B04957B871A09302F572E1DFB0AE5B64 VICKI-KEATON
458,340,423 *2E8993C8132D99CC2BCDED86BEF9AE3853C4D708 VICKI.NURSE
458,340,424 *2E8F7533B89B0BE8BF680C9D71E54F1B7F4A282D 541876 AKAD NAUK SSSR 303 , NO 6 , 13071309 ( 1988 )
458,340,425 *2E8207BA85EFAF3779C27C9969FCDAE703A7748D 5ARIANTI
458,340,426 *2E8C7C4764039D70B69D1232610AE1644E27EFEC 5ASPITJES
458,340,427 *2E8377DC63036C6D16A7E778C5A7DA38B696ED0F 5EDIAKAT
458,340,428 *2E8657EA78C3BEDB8CAAB4114B9B4627F90E7327 5FRAPPERT
458,340,429 *2E8BD6E87212B9DB7C603D323A0DC7B4DF060C93 VITHOOSAN SAHATHEVAN
458,340,430 *2E860A376DB397EE4F37D859CB9800EAA763E3F3 5KOAAX8CT
458,340,431 *2E8FB00A55DD2DC85B12628729942F6116D53CE4 5PROYNER
458,340,432 *2E81EBBDA73816B20F09243F2E23AAE1E2F2D3ED 5RAYDEEOH
458,340,433 *2E89044B2C267405DDCB55A7A2389734DAA728BA VONTAMBASCO
458,340,434 *2E862280D95BC5060122FA0CAB2A45B58B519CB1 5SESSERVUAP
458,340,435 *2E85247DB55EB41DEB0AA8A38777F7EEA794FB38 5UNFETCHBSW
458,340,436 *2E8368C4E2BFE444A0D90D0E88F67748FF78F9F3 [email protected]
458,340,437 *2E8AA754AA56E59BE4418746705F5D76C4C69FCE [email protected]
458,340,438 *2E8017ACE89F638FF61572E6C744E7897D9CA4C7 6ABDELMJID
458,340,439 *2E8DA8ED7B09AD0C08B1ED187F9859287C9F1B96 6BALACHONG
458,340,440 *2E88B524795906564B3350C2EB671E391E7709AA WALBOTTS
458,340,441 *2E87BB5079D634EC71F6E7C44D9B86FF43EF9C9B walterjeremy
458,340,442 *2E85761987AFB4F1EDD41B201100574C8FB52234 6ERAVRESIR
458,340,443 *2E8BAB47278976DA4812C0A3DF9A5D3B8B87C015 6FERNANDINABSW
458,340,444 *2E8CCA61C1E40CBA94B4FA8A2E00C8DCDEECA2E0 6FLORIDAAPPLE
458,340,445 *2E804C2913BD8A62BBE8E10BE691E1581E670132 WARNERBOAL
458,340,446 *2E8D542FFAC35FE9D57D414C4BBD7DA8602391E2 waylongillingham
458,340,447 *2E81CD6B778A204DB9D589E3BBCCCDC8FE805D60 6LACIPOCSOIDAR
458,340,448 *2E85A122A58A3BBE5C37AE791D076DA0AE34D181 WAYNE PIERRET
458,340,449 *2E8DAFF672678FF140C0DB7BFCEF1415413BCDB8 6mymoose5
458,340,450 *2E86BD673E0002B5D86D83CE1A15D86288518B7C webweaverwizard
458,340,451 *2E8B1FDEC678B53A4BA90FB09DF81816ED57121A WELDON.WOOL
458,340,452 *2E8AEE6EC47D798518404A051EA224171327586A wendelledens
458,340,453 *2E83835A61A52D0FD15F06E2B91D1848D24F0AE1 wendy.melinda.clark
458,340,454 *2E8DA47B6105D8A084F759E6DF63CF7C5500D10F wendy.reyna.salinas
458,340,455 *2E80CDC7CB6CDDF9BF5F470B71D8CD91F9BCB240 WENDYTH7
458,340,456 *2E83B0441CEDE299A457E060F28B69C214F97408 [email protected]
458,340,457 *2E804EAB517118F700ABEAF508163050580CF40A 6SUNSETSPAIN
458,340,458 *2E806BA104E5E7A539EF9EDF5E53EF4B972AC8CE [email protected]
458,340,459 *2E8B2C285D552AEE36125E9F0182B4A09EB565ED [email protected]
458,340,460 *2E8DAA7A6DB3125C31B5E12D50EA42882F81B0BE wenndersommernichtmehrweitist(live)
458,340,461 *2E8820EBFA9686FE69D9FEA017831A63B44890FC WFNAAA
458,340,462 *2E82BE37B10127B949DEF9D29BE122F68A5261F0 wilfredpoupard
458,340,463 *2E88BEB6049C7DB456A51BA4DCD0626DEF858390 790834 PUOLUSTUS EI SEN SIJAAN OLE P
458,340,464 *2E8FBBEBC6826537C4C95B0778C7A012B8367506 7ALICIABROWNS
458,340,465 *2E8F67EEE9B999BFA2995F0CCEA6B0E8BACE5440 7.antoisasta
458,340,466 *2E8445DCF845AFA7FB2689CBF4A163BA2596F7DF WILLEMSDEN
458,340,467 *2E873A3DADB205B3C48A9420AAAF41626C52F20D WILLIAN.SORRELLS
458,340,468 *2E8A3BCC93961015C5452045F06895EF7F8C81B0 winderosiontimna
458,340,469 *2E89145DA9E4FDAE0FEF5FB515080C43442ADB86 7BSWIMPRESSIONT
458,340,470 *2E89B482E95CD157FDCA0FE3B7C95263A46E9922 7FRIKTION
458,340,471 *2E8BA69526FBBB1056F01ED17FD465B553670354 wwweumundimarketscomau
458,340,472 *2E85E5A2DB917228F864AA39F763F2AABF8DFFD5 wwwgreenchoicesorg
458,340,473 *2E88C75A195DE59D1511C3EBB9D3C3C662A73BE4 wwwmanyetascom
458,340,474 *2E825F3C7EFC5FE1266F6EE05C5B082B05B1AC4E 7RIGHTWARRANTWRITEINWRITEIN
458,340,475 *2E8E43608DFAFA681D0362099544F0392A207026 WWW.TGDARKLY.COM
458,340,476 *2E8A5FDDD1F009956D2ED9794F744912C41C01D2 XL]P
458,340,477 *2E89B4A53544CCF8AA024822DABFBD7C0F866319 [email protected]
458,340,478 *2E8C7B4EB719F921D50618C6BE741E06FBD6E7AA 7ZONULESES
458,340,479 *2E8687C7BDD5CEB99613F649D307C17D427991C7 [email protected]
458,340,480 *2E8585600D2DC3EC20D0A843D0DADA3CBEFD1CC2 8=>~03b<-
458,340,481 *2E8551802E5B83EF75645D711F5032154D31B411 YAIRDSSDRIAY8
458,340,482 *2E81F1B78FEB0B64387E0FBBC54E9562EDB325C5 [email protected]
458,340,483 *2E87A5546B613FA6F4B04385D22B51FC3DF7EDCF yatyirihfymjad
458,340,484 *2E88608C37C606559ABC0AAEED720ECFD7281060 YA-YA-HALA
458,340,485 *2E8F43624028815788F6AFF32142D957D213C567 yiguei
458,340,486 *2E8863FDAB4B59C0426B387318734B921E39FE9B YOUNG.HIROSE
458,340,487 *2E8AE079F00825F1251E2DBAD53D714AB2C5E549 [email protected]63.COM
458,340,488 *2E8521A17EE147613BA17CB908081498121FD8C2 ZACHARIAH.WENGREEN
458,340,489 *2E864BEC64318E2AC9336A18B987A633C2BA053F zach.cenchitz
458,340,490 *2E8EE474FFC7B5CEE62BD321356991EA71E05220 zac.hund
458,340,491 *2E862C68CC7E36CADCD1903C3D0B0540903A744B ZAFIERO
458,340,492 *2E8A1C695A59D8AA7F7F9004C4A0CA88C41D6FFC ZANIĆ
458,340,493 *2E8244E0E4D0969401C0016E08A8E1C78E7ACACA ZAPEARES5
458,340,494 *2E8EFB88F222D712EE6748F904F8D612E43C0E9C 862040 PETTERI-REPO-&-JARI-ARO-JULKAISUN-HINTA-ON-8,40-&EURO-;-.
458,340,495 *2E87EFDE2758D5849F2D3FF2E731CF4199D943FF 8AGITARSI
458,340,496 *2E8E38BECC1528666718138967B0CADFD5322B07 8APRAWKS
458,340,497 *2E8ECA9F4EEE013D67C6EE63B2F515252C7653CE [email protected]
458,340,498 *2E8D2B1E947D6BBDDA56E2201F4FA634E54564F5 8EDFEORT
458,340,499 *2E84B8FBE084C2DBFF613FBD1837E82AEBFEAD81 ZIONSIM
458,340,500 *2E8066B8EC711F4A072A9F78C956E03E99F0B837 [email protected]
458,340,501 *2E8F502CA9B1755DD41F614DABD38B2A609E0EB5 zpnpfdiss2
458,340,502 *2E8461767DC6AA025A2694ED82F16D1D21661A6B ZURAIMIE HAFFIZ
458,340,503 *2E8CA38CF7B3E7A741A53ED250B0133B2883DBA0 8MERABDALHCAN
458,340,504 *2E82751E8F8A612FFB3A204D1A04327C8C7A28F2 8MTLUAFED
458,340,505 *2E8B143FAB029D9BA7154426E1FDF0548BC2A0DA 8----->~o
458,340,506 *2E8B768A1A5EA8A26F255F9272EDDC9FBED64A73 8----P**(>_<)
458,340,507 *2E8B2CCA430879C5F20E95A1C2DA64ED96DF4987 8taswell
458,340,508 *2E8DA378B4C0FF08EB16216F8379FA727089A3EF 91220203A
458,340,509 *2E8BEBF499078161FE0CBA69DCD5589713F9FDE0 916613 t
458,340,510 *2E860F0D935FE71CD99B1C894986095F6F404DBB 95CODY
458,340,511 *2E8908D66EE6CB9C1D571E7C74B67C1373D8E511 987480 "ichbinnocheinboxbaby.
458,340,512 *2E8237299401E465E0D268E1909EBA85968FB365 9AF93A36EC8831F9B2A66CE6DD4A833C
458,340,513 *2E89B1E3A2E5C08165ED84CE980F57DEA9393AAD 9DIENTIEL
458,340,514 *2E80AF575C578EAF31417CE7D87AD2C8BDE723DF 9.FLUEGELCHEN
458,340,515 *2E80423A8A1B74ED59411A243FBAE9BCD2B7CA5F 9iamtristan2
458,340,516 *2E80E40AF64B5DCBA6418FF1461B8AAA340CF46D 9UDDIVIDO
458,340,517 *2E87F99AE8A772263BEF91E2019F3E7CD453A73F «СУЖДЕНИИ
458,340,518 *2E88F96A1C56527F72A2593863693827BCEBFAA0 A046W
458,340,519 *2E8007B851D3C58E329339C4885F85F875D7E00D a4t$
458,340,520 *2E80B178D1B5B756D71E34066A1E9D3FED873EEA 」同様、CBCとTUTを除く中部地方の5局では「
458,340,521 *2E87CEAF9BA833264F936F4FFFAD08EC833B3B5E Abhyanandadh
458,340,522 *2E8E01D18FC9E3437CB53672630FE1E958D27BAA ABO;}
458,340,523 *2E8E23287A39144C4B86FCE4AB9C67AFD3156E80 ac(h?
458,340,524 *2E8596C65718CCAFA1D5E222BE225AC8947832B2 ADoP
458,340,525 *2E88D58E51C44B1F58988F755F51DD42044801EC agvvk
458,340,526 *2E8D1458C8537B071D36E7A6DACCF4BE6B0FE07B AIMANOKASHA
458,340,527 *2E8126312A74F40343B372F96D0FCEE52626AFEB ALBARADOUNI
458,340,528 *2E8B9E82606CFC59AF2F58284A7F0B7AE14F3962 ALB!N0!5M
458,340,529 *2E81884F0A972151C4D7A4534D1FB9F80E513E5A ALKAYSI90AOL.COM
458,340,530 *2E8C531F936F27E182DE70727AB9350DF96F2F92 allanbowgren
458,340,531 *2E83AB46783CA496BF44F5D8099616F5BDB92119 171597 mUGlaUniv.
458,340,532 *2E8985B6B72B349F5746753F9B4F77E935A2F1F1 allestita3
458,340,533 *2E87FF09A351557ADC67A6B015E5753B368C1B45 alttp
458,340,534 *2E81D65693F66F2BBF9658809DEFB22E2A44F186 AMUHZOTED
458,340,535 *2E8A53CF83809AEB96C7B57E0359DE4E74065E9D andrevollmer
458,340,536 *2E845A87BABE6E99AEC61AE3717967ECCC16AE14 ANDREWT9
458,340,537 *2E8F356850E22C723FEF5E6FD2F659453529EF72 1991379 hallinta.kuitenkin.katkesi.juha.kaunism
458,340,538 *2E899A29FDD55D1F01D7B7C14B09AA7C479C508C 1ALITALIAWANDELANLEIHE
458,340,539 *2E82F2D0A2D42244BDFF9193B020FF3DAD0E9934 1 ATOM-ANTEIL
458,340,540 *2E8988C04D6F5026ED047C667DB6FFB8C96C48D9 ANTHONY T LOGAN
458,340,541 *2E807CA0ADA642F4B9B743F51E859D11F18AB701 1-BULDUGUNA
458,340,542 *2E862AC3AA07C21C132DD02CF978A38679877E0B 1.digfir-spitals
458,340,543 *2E88B01AB41BF9FAAB5EAB02E83FF4B205957292 1DISAPPEARING-IT
458,340,544 *2E8A1E9FAA955495334DE742DE064E9312B41EC1 AOABK
458,340,545 *2E881776DC88DB7E87ADE95A419B7E706F3E1178 1-GRUNDSCHUL-KLASSEN
458,340,546 *2E8D42851A8A46C1D8E19E866844C2E9D1A1707C 1 herpetomania-lehti
458,340,547 *2E8EEA4B6C7C945EB9262878A3258D90CE31D67B 1 HITECHIIN
458,340,548 *2E8FB879A359259FFEC747C1B28679DA2FBA1072 1-honkakorpi
458,340,549 *2E83609B7886CF930222173EC281E232C0FAADE0 Aqv"
458,340,550 *2E8DB97A346F6BCA508BF75E42DF8FDDD554E689 1.kornhaus-frau
458,340,551 *2E80C63DD58B802CBDEEDFE4A0D17DCCB02DB77B ARDYRENT
458,340,552 *2E806502E6033144F2F02016CEE32AE54F6EE911 1-laivavanhuksesta
458,340,553 *2E8E73DAC8C732AEEA7DCA09B893CA0B102C4EB7 1montanafamous
458,340,554 *2E8CCAE216974693B794376DEFFA7FF9B77D4C86 1N7EN$1VE$
458,340,555 *2E8E83DEC8D5478A58CC76EEE142C9DE02107133 1.OMAVARAISUUSASTEEKSI
458,340,556 *2E81B1B7C25C8E6E17A1EB827FCFD32C7E55C3B2 1.PERUNAJAUHOKIISSELI
458,340,557 *2E81C8F5422B293506A94632F9BBCDDCD927D4BD 1Q2W3E
458,340,558 *2E8F108F4F24C740D3833DD5BE64C3A6FD066C1A artistnavn
458,340,559 *2E81F560A54F6C772765109EFE1F65F228825ADC 1 STEBEN
458,340,560 *2E8FDDEE2794E889FCCD9C5A487679A2FCFCB20E ASV83
458,340,561 *2E8F78773484463719F444B3E477F20092DBDC45 1.valtionsiittolaan
458,340,562 *2E8738B13B387D7AC45595A5F23692A7A46B8EAD atqqa
458,340,563 *2E8DB8E63D4D874A066A5A186F7F3B1052E56F90 1-WELTUNERFAHRENE
458,340,564 *2E8A27E9E252220D8C9B2D43F7CC9646CB2E7117 aureliofilpo
458,340,565 *2E8ECFA5C61182C8DD19A08AF76AF175E893D24C AUUTMN
458,340,566 *2E8D2F8CE87C4EF86DCD5999A8051E5E067D2668 2288001 toistaiseksiceiboiseiolekuitenkaanhalunnutk
458,340,567 *2E8FD02EF98FA556C74CD2EBF1A0928D0EB7243B [email protected]
458,340,568 *2E8C2056C99259BB534901A549613447FC8C7B85 AWREL
458,340,569 *2E8ABC8A269658F9C2B6F850C1CB45B8D90933B6 233699 butun borc ve alacak hareketleri rapora dahil edilir
458,340,570 *2E8481198B9A1724FA009BA8ECEEE56FBD753273 2366033 OF THE OTHERS INDICTED , NINE HAVE BEEN SENTENCED
458,340,571 *2E803F0F9D7CDCEB78082568BB02CF0726F223E4 ax4f
458,340,572 *2E8906C5810804C08FDD54A17C18CC692E6E8EE4 AZUL&
458,340,573 *2E8187122B4779111FE992542A55C403CB218C93 260086 OKMEYDANI-CD-.-NO-:-12-HASKOY-/-IST-.
458,340,574 *2E816AFD45DB7FB9098DA597F81F8207E7BF7134 26507tuwer
458,340,575 *2E8CA012BE1D4C1D44A930F6B34FA2C9F82CA502 2693591 erst-auf-dem-rueckweg-kam-es-in-dresden-zu-krawallen-.
458,340,576 *2E87484AFBD1441DF51CDC9B15606A61BBA54D0D 2boburlenerek
458,340,577 *2E8E6A44C7BE4679225C93B0476A66492A92D8CF B2DA.
458,340,578 *2E85F95AB27A60B3F02ECC4D868A57AAB059CE9B b3h:f
458,340,579 *2E8621C75EF61DD2619C2618746D4372FB3B130C 2.first-division
458,340,580 *2E87B7B6F617C3C5A4A0BDE3C2E32741AF4D7EFC b+4fy
458,340,581 *2E8F32A9BCE32C1B248507A93792A5CC0D1E4782 2jetes
458,340,582 *2E8108B430CFCC9BE9D350648D267C20191C02B1 B6q4
458,340,583 *2E88BF52734CFD3FEB425C01D4B317A718F75D3C 3ARUTCAFU
458,340,584 *2E824CD3AFA3816C1BCCF566FF0A562F3836D50A [email protected]
458,340,585 *2E8ACF498E142CBDA48FD71188DF479A24763569 3------D*-*-*-UU
458,340,586 *2E885A6CEFEFAFDA9B40606B16246184DF8E5070 banechand
458,340,587 *2E8FD7E23D2ADD799C25150458726375AF43A240 barry&glodean
458,340,588 *2E8A4CCEB37CF9E1B89F0933E449C4FEAABD5303 [email protected]
458,340,589 *2E8E0C2FC8DAB51FA6A8AC63EDF4C4B97CB78E97 BAUERKÄMPER
458,340,590 *2E822BFCBEC70BD1C9348E78498C9FEB515CDC37 B===B.~.`.(^_~)
458,340,591 *2E89F253298B1C5EE6A5BBEFD6885638B4512A2C 44-DUOS-FOR-TWO-VIOLINS,-SZ-98---4-MIDSUMMER-NIGHT-SONG
458,340,592 *2E8ED9375BD468B505BBBC080853F90FF7CAD3B4 4ALAISSEE
458,340,593 *2E8556F34E09F7418F26F10898D0B18DC89985FD 4APTAQUE
458,340,594 *2E8A8E37450862419E0C806CE10F368D0BDF48F1 4IAMBOOTS1
458,340,595 *2E82AB05CB217DD1C901965D5965E6186BCE0C5A benedicthuenink
458,340,596 *2E8A28351125E9E55DB6D5F3139C9D1452DDCAFC benmaster
458,340,597 *2E81766C299B8F72A317C5F0B4047E21B3DFCDA5 4SUPERHEROLIK
458,340,598 *2E8734278B42D4B68FC1707E59D1130BA1D9EF27 4VALARAM
458,340,599 *2E8682852C2614F216EAE3FD8A2C59FF0D46D561 574NCHNG
458,340,600 *2E88BA64EB0A28894FC1BB37D59C07ED9FF378F3 5AGULHETEIRO
458,340,601 *2E8A3E09D570947D8CB8129675D2F993CA169F3F 5AUTWBFVWR
458,340,602 *2E89DE64FCE2978EAFA465C6F47D58F22D20316B 5HEREOVER
458,340,603 *2E8679FCBC5A22897B83B1A11A2352A2C164C5EE BEW
458,340,604 *2E8851A70BF39BAE63AB675754DFCAFC478BF1CB 5MEMPHISRED
458,340,605 *2E8CB7BFE8F41E72A2D95206BEDECB9AEE64004D BG?)P
458,340,606 *2E863B32EE99F1F968DE66FFC2C67F3F5262B94F 5RESPILLEFILM
458,340,607 *2E8681D8F62B6BE224BAC3CAEB4E16DA41B77740 5RICKYPAPA
458,340,608 *2E8D4A0987DDFFD0F1A551115AD846D4033EE104 5-voodoo-zauber
458,340,609 *2E8D22081838B3CCA0B20E84A15057FE8A0B8026 5YAMEFANYIKA
458,340,610 *2E88923B7CD963816EBA13322676E9DF70561E48 6947C8DBD63D4F75
458,340,611 *2E86202D2EBECE998604D41E0F975E64141D2E92 BII"_
458,340,612 *2E830A3098894113DB8F7F1DDE21EF4E93F561B8 bisj1
458,340,613 *2E8BD3C9BBE6EA57486360B339D8B85B1FE4EBD4 b_k:+
458,340,614 *2E8F2D90B762C0CF6D2A0CE25B2A9EEDBC54A346 BLAIRHODGE
458,340,615 *2E8B30439F52E7A7499490DF83560CB6CD78E74F bleyttiting
458,340,616 *2E89BAA09CC93C747C5A7BFC5900AEE9CEC4E340 BLJIUHVSRGD
458,340,617 *2E82CC1D2E02A1C983ED461525DBB2798103ECF5 BLSX,
458,340,618 *2E8CB3FD3FD054CE3E1802309123EB4F6773D651 BM4J
458,340,619 *2E88AEFDD0A082CCDF3103D26661086F90DC11B5 6hoodlumizes
458,340,620 *2E862E4DD7FFBF11158C822095714E2082FAEED7 6KIDPROJBSW
458,340,621 *2E837CEAD65FC60488CC403C3F2026B9B6094283 6MARTERHA
458,340,622 *2E8FDFB11465D8E8B25C4DBE19F854E4E1D5BCF9 6MOSAIIKISSA
458,340,623 *2E8BF1EB0BEA2F97CE2C8968FA780F283EF2E004 bo55m
458,340,624 *2E878CBD2153530215429B4E9E5AB83B055706FB BOBEATMAN
458,340,625 *2E8E13B5E39995847EDA01B59AA55E44B3D1AB76 6peggy9
458,340,626 *2E868BA29C78C5826D22262C4F4EE5DBC63DCD5A 6POLLEXENA
458,340,627 *2E84C2C90158A80BD523457BCACF3BE91DEC4AE0 boh!i
458,340,628 *2E8F498DE1E4594A19C6D6BB00BA9D430D8EF195 6TELURISMO
458,340,629 *2E8C1D6FDA97CEE616412FBDED7B46BD61161A3B 6thethunderbird9
458,340,630 *2E80BFF0D074CEAFA7CEA6D02FA14F2D9594B9B5 748hallie
458,340,631 *2E886E241D26A8ED0CED9EAC01ACE7FAE8BB249C BRANDONDREAMS
458,340,632 *2E802581A9625E5046A1767195784534725388FF brbpw
458,340,633 *2E818ACF12BDEB1BAA9DB3C67C827A801E1EA0E1 7BUSHWHACKERISM
458,340,634 *2E8BD0D8F1FC49EA527467FB911913A157BD286B BRETT.VALLIS
458,340,635 *2E8FF5AD9F77AB7313C35E906EE92C4866F7B931 bricetedrick
458,340,636 *2E8DEF032083248070F7E99C11A9E07CBD541030 7EBTESTEN
458,340,637 *2E801A579F5F8F5AAAD47246FBB5778F22465ED1 bridget-galvin
458,340,638 *2E8BEA6C3A83E3FE0BC9BDD5462B40EBDC534D4F br+k=
458,340,639 *2E8C40847EE1A91ACC18C897E0BB98443AF6B0B7 BSWTIOCNXCL
458,340,640 *2E810C673EF61E4D87EF03F8D82EF4170D1361C4 7LINGBAO
458,340,641 *2E8CF6DC0ABBB2FDC145E986A3A2FB82D34371A9 bta
458,340,642 *2E807FAB01422831D8000D2644653E2CC0D953BF btflnsses
458,340,643 *2E83CA890D36867BB2AA589A4914EC4D4A51FAC7 7SASPLBEROLSCOMMOZILLACDH
458,340,644 *2E8A577F92683AB24586B72F3D36EC01B000524E 7SCHULDHAFTEM
458,340,645 *2E803B1C31616D06C7FC20D737E4B8B7109C9357 BULLET-MARKS
458,340,646 *2E83D2BC67F9DF62CB1C05C8D7740871A0AE95E6 BUZHARDT7
458,340,647 *2E8A7D044DFA8A92795BCC401EAEA311CE3A08A8 C0O_9
458,340,648 *2E8BA4A4656613188F89C5B2113D1694D59787EA 8GELUKJES
458,340,649 *2E83247CFCF98E342D1B17736DD41077C1DDA67A 8.GOVERNABILITY
458,340,650 *2E8A54FC5626E7834A7850F58C7510EE40E92D75 C=7E
458,340,651 *2E87667501E173FBBFD92D339799BF73AAD0FB5B 8ILUVGIBBONS
458,340,652 *2E872958C997BBFA828C63760E7ED24EA1DEABD9 8MAGICONLINE
458,340,653 *2E89F06144D7AF2CF1578B8BAC265650CE9D1B4F caramba!galileudagalil
458,340,654 *2E8A702696835D1E11B113B2AF4CC0BC19A11533 8NEREDEOGKUTS
458,340,655 *2E896D612450200FFE7B2385F47BF00C1108CD3F carmenbevan
458,340,656 *2E85CE3989FF1028862EBBF5EE60152BA78E854D 8POSTARTICULAR
458,340,657 *2E8659918A1CF0A97B6A3848B23236AF09F8DF77 carterbontrager
458,340,658 *2E88672D77AD2B823BF4761178420C7F410CD893 CAW_0
458,340,659 *2E862C946D4F3BFF4C0B5170FFFC63BBF5BDE314 8SCOTCHSTORM
458,340,660 *2E8ED9C38515A638EDACD361AF6404CB6D0BDA0D CC614KEH
458,340,661 *2E83F0C30DF85D630BB3A30137F215EAEE55A7D0 CCH6F
458,340,662 *2E8BCC88F1A362E5BEF501D605A581C5009F357F 907242 uebers-wochenende-habe-es-nur-zweimal-alarm-gegeben-.
458,340,663 *2E82372E859703C92A49E47B09F86D2448A13167 93V7
458,340,664 *2E80FAEF02A33831CD40563BA34B04372AB717AC cele8ra71ons
458,340,665 *2E8E16199644B73A60D5CD53ECDD6AE78AB72C61 9BATMANKITTY
458,340,666 *2E80E6ECFE1BB1EC0A52C9C6DF4DD0992EEEB654 [email protected]
458,340,667 *2E890345BE34BE2A38C1C28DEFA4342EB8E6C25A 9BSWFTPACCOUNT
458,340,668 *2E8E06EC3137FF6D47FF31898A57BA88EEC536C7 CHADWICK.CARLINI
458,340,669 *2E899BA86A2C2D8E8FD60F1BD4792AF173E73DEF charlie-broadhurst
458,340,670 *2E8E532040FA12F2DB4B8E104BE3F40C9566315A CHÁVEZOVI
458,340,671 *2E8E46458DF9476B51D3ABFB33F32408D6991EF1 CHIGASPER
458,340,672 *2E8B8645505FC74499F4DFFC799DCBD248A61CD5 CHORITOS.A.LA.CHALACA
458,340,673 *2E8E86626A93F32F49C349F48754C75319DCEA7F 9PUPPYSONICS
458,340,674 *2E8FC147D4BC0476DC78BD25C111C4943109408A chris-bogaards
458,340,675 *2E82E8CDF8765812CBC59B00B19337A7409CE039 9RTSLETIT
458,340,676 *2E8EA9E52045DE57E78A728B1BE1D0ECFC6D01FB christine.feigel
458,340,677 *2E872F2AF26B2B06FC20FC6A35A27DFA9374DEED c,&ht
458,340,678 *2E8F4F857888B2C5261E64E87CF6D028C29B62C1 A?%
458,340,679 *2E80323F6DECF9730111291D97FBA768EAE29065 A5[L
458,340,680 *2E8FE6FC3182C1CA0C10448784055AE8362B820D CLOCKS (ANGEL OF MONS)
458,340,681 *2E854CF65274F2A89848529A577749BAFC80A08C aabl6w
458,340,682 *2E82CD114EEE2BCCBA50E18AB682D6C7EB27BF45 COLLINPROVINS
458,340,683 *2E821E316F57EA073BE96523869BC4867E14FFD9 AAEW5
458,340,684 *2E886241B40381466CCF5D602C1C4AF9A270E369 aakts
458,340,685 *2E83461DAA6E2DB3171DFDCA43578198439A6EED abby-daugherty
458,340,686 *2E8ABBCAE5F87BF7987AB9FFABCC5DA6EED5DDE8 abcl1
458,340,687 *2E8335C42161C77D7DAE379CE7A24E50B62082C7 ac8)i
458,340,688 *2E8F43CD03B980002FD6CE3F0051ECD90CFB36F0 ACFNN
458,340,689 *2E80C3F6F9A8AC0CD1CCF354437C32FFAFE867B1 CP;
458,340,690 *2E8455C8BEC7A3B6FF29D4F3CC4F75C4F2797E9E ADAM-VALLANCE
458,340,691 *2E8FAEEC4CB2A366C097BA3A9A85B2584DA13EA6 adanschunk
458,340,692 *2E8AFE60FCEB3F09546A145604BC0A5B0DC7457D cq7_;
458,340,693 *2E80F07D4BD7F080BB4C0AEAB439761D1B7BA885 AD*_K
458,340,694 *2E8C0B91E69F7EB5BB73A9C95C2DB0082B1BF0CF c!ror
458,340,695 *2E8308A2C3C2D2ED2D1FB8B738FAEFB369499CC1 CTD$H
458,340,696 *2E8CF8C5B220A5688644DE29971B21FB4E8B84E5 A,GV
458,340,697 *2E8AB690C0D4B0EA9963AC6EC7DE4DE56DC7F5DB a-"k$
458,340,698 *2E8635636EE173A4772B4BF66AFF96BF57C9108E AKIRAMIYABI
458,340,699 *2E89B07CC727277D058E82D8983CA838868B2BC3 [email protected]
458,340,700 *2E8AD44C8B61878D1553A27FA86610C734D1DB9E ALEXANDER.KEOGH
458,340,701 *2E804B470296A260D778430B006F275519DAE149 ALEXLISKA
458,340,702 *2E86E40417030EA5427D56F82E77015D67063883 d8bk-
458,340,703 *2E878D8C35D9C40B541281CEB5BEC3326366E596 alijaribu3
458,340,704 *2E8C17B584928F6742B7680FB5925BC66BE42E6A ALLOFYES4
458,340,705 *2E89FCEAFA0F8A94ACF9F29DED44C34E2C625641 DAMIANSNAPP
458,340,706 *2E840C63704F831A86886E3E27C0606BDE6AECE3 DAMIEN.JEFFERIS
458,340,707 *2E82A51FB615276D555DD19BB3674D7ABFEB9346 danegallington
458,340,708 *2E863B0304A06686BF91A07675066230ED53C3AC DANIEL ROSENGARTEN
458,340,709 *2E87C30114D551E776EEA43E4932AD8FE60EC14D alubmaed0
458,340,710 *2E8CC20EACDADA37F9315704DF2E27177D17FD1E DANTE.HEPPE
458,340,711 *2E82840637360842013EC7FBE4B1B7999D32E487 DARBY406
458,340,712 *2E85F99FEEA5E6084FA51B93DAA8CC87EA8A9508 amosgaietto
458,340,713 *2E88411E538304A883ECA915B93307685AA3744C AMPSKETTING
458,340,714 *2E85B3E542456FDBDA309D32500A52F1274F6511 AMVW?
458,340,715 *2E81F2F1C49F63C39AC1E96D4366B17F501469AD ANAFILCEVA
458,340,716 *2E806E13D66C49B2EFB47F2AF1B9AF51FA4CE605 andfinditoutbyproclamation:
458,340,717 *2E8A80D9A4529645CAD90E23A150DCA665DAAF00 andi.mario
458,340,718 *2E81B59D89780BF63DCBE9027B7A0BB1F864974B ANDREABEREZNAK
458,340,719 *2E8A06E6A42124CFEFF27E8E907DC92A3E84D01B DBIL?
458,340,720 *2E8B696453A222CFA5FE17905BB4067CE9A45F2C dck;1
458,340,721 *2E82BBC30FE2890F5E59041C1AE78770C7218E1D ANGELOHERLEY
458,340,722 *2E8A013B464E9C55B97EABD7A7DBE541234ACD36 DEETERKALOSKI
458,340,723 *2E87771576099D6281635B5AE100A6F5C37E0E37 DEGIVREE
458,340,724 *2E823756EB43091BFB13F2C1A0878733C293B9A6 ANLIKELIES
458,340,725 *2E87EC86ABD53E3901E576667009953754DE0E0B DELMERCONNINGTON
458,340,726 *2E88EF3399E386C1DCFEFCEBC83119D7A6A43C10 dendorff6
458,340,727 *2E829A31FF7A425C0356ADC836FC3A3D03869594 DENDROBATIDÉ
458,340,728 *2E87919B6A9EFD4BF917F2CB8E17DC5A07D5882E DENNIS.SELKING
458,340,729 *2E8712BFB3BF13F7E4B995F63B48BEEF24E3B42D DENNY.OMLAND
458,340,730 *2E8DE47A8BB4E85C40E0965A7D8543DF9B324472 derekisdabomb!
458,340,731 *2E82C83A3D5EB10FA0C37BF375550844F865F83D desgajares
458,340,732 *2E846FECDBF0786FA9EFC31F60432921C53EF6DD [email protected]
458,340,733 *2E8368290378328E8A8ABF189D39018B18D06D23 anzutreffen!
458,340,734 *2E86D001EC3997634D92DDA0FC6D01F9EDE9A53F ARDEN.DECOSTE
458,340,735 *2E83D7367283B3864D9A3FB44EC4EAB8E9044D64 ARDENPASSON
458,340,736 *2E8414B753C7B7AC70949195B6928357CD7CC919 ardensanpaolo
458,340,737 *2E89E8B9B599A3313E7801DF457F883B76CC1325 DIURKMES4
458,340,738 *2E83E53EF51BCFCA9CEAB38BC42858268B8FF131 DIVINE (A)
458,340,739 *2E82A5CF404638D68A1CDB43D5A02554EDBD43C6 dlpq8
458,340,740 *2E8E678BAC88AB42CC42EBC7AF85B4BBDBC5E195 DODCCRPORGWWW
458,340,741 *2E86BA5FB75B922B78219EDB6BDC0A6692E58657 ASSHEIDIED
458,340,742 *2E80A837DE97A67AA7B3E7A9BA1CC40B943D82AD DONGKOVALESKI
458,340,743 *2E835F4514B879FEC89B0374E2226161CB6720F5 donnyseaford
458,340,744 *2E8D4071C4A77B85604DEF4832FE67A8E6952649 dottiebaugh
458,340,745 *2E814DE730AC9BAC903D0091EAB316E3371207D8 auloimme6
458,340,746 *2E855CF41E2892CCC61AC4A4EE1B67B2D07D0098 AUOEV
458,340,747 *2E883CAC7786CB4D6D438B550EFEDE729A5FE05A AUTÓGENO
458,340,748 *2E887C633C1BBFA15F72B8668E25DB698BFB9F49 [email protected]
458,340,749 *2E8D13525B76DA7DB773971267AEE40AFFD4E8EE [email protected]
458,340,750 *2E8569569F52857A1210663CEA92935B3F0C9D92 [email protected]
458,340,751 *2E88BC9007E58A75D9B4071D27B9746F01E5F09D DUSTIN.OKORUDUDU
458,340,752 *2E87A9FBADB94F3A9F4F84088B107E0B86B1635C D"V0R
458,340,753 *2E8D7E1ABCE47D8C60E2D953E65A968F0EC502F6 B0G!#@!B0G!#
458,340,754 *2E86F97AB0A40D02E10A5A24E007B585032DACBF (b1) samplitude
458,340,755 *2E841198F592B726885857DF577DBBEC90798F35 b63eb
458,340,756 *2E81C28C18202333C7CB52A1E74080A28F00024D B6R
458,340,757 *2E80AD875933FB2B0B31DAEDF29517B461CACBF8 edzvv
458,340,758 *2E837C0F40D6EB7AA2666E56476BE44E875725E2 bahmz
458,340,759 *2E82AB0F543B4C2321A3C106F852EF5F163C6D0E effacing
458,340,760 *2E883E6A89C71CCDF9130CE7A703B78411FACEB1 BANIYAA
458,340,761 *2E857876CAD9D3D6BB58F766DF5DC29DEC416F4F EHZPC
458,340,762 *2E8AA53E3CC25D7FEB2014FB74CC1CBB2377BF33 EIT.1
458,340,763 *2E8A9FA8FE8062583CBDDFE1C3BF279063B08BBE ELLSWORTH.WILKENING
458,340,764 *2E8D4C588C13E7952C3F83FFCFA8A085B5DC810C elorvita
458,340,765 *2E8395473290C4BD00CEBC4DFF5CA23AB4EE26B8 bedni9h7s
458,340,766 *2E815E85BD0A934E48B2E13068BDA739DE99116A BENIQUEZ
458,340,767 *2E88BCF2D9034D195E60813A48E19013A4E98664 bep##
458,340,768 *2E899338E8773C07B110ECE95D7E9D61304F0D4C BERTRAM.SELZ
458,340,769 *2E80EAD89ADD4EAAC84598E4002BC6DE1546A81A beverlyvieta
458,340,770 *2E8F93EEB1810FA92ED1CC0FA762A753635C3027 BICUSPID
458,340,771 *2E86054C8458FB00D53B469EBCB1A0C264A23F92 BIKIRAPID1
458,340,772 *2E8AB3B0EB686E41F27875667F385168A0CC33D1 BILLCLINTONREFLECTSONSOUTHCAROLINADUSTUP
458,340,773 *2E82461731A579AEB686A62344EACC94A909D255 er=qt
458,340,774 *2E8F3F9634BC4CB07C4525ABEF81E8A17C21F3FA ESISSLUN
458,340,775 *2E8B0950AFE2074635A3027C03F9E30449209F14 bj2o8
458,340,776 *2E839FB7DBB6C9CF9CF8DA71F603648831C9AC81 ES%V
458,340,777 *2E8F234538D6920497C5892AD7D96812437F44C3 bkk?3
458,340,778 *2E82BE59FE0170156933864E6C36B4B1DDA089C6 exgovernmentadviserandrewneathersaysmassimmigrationtoukwasdeliberate
458,340,779 *2E89CF6D355EE4136FE395A0BCC3AB3E3B515E18 blake214
458,340,780 *2E8001CE7A49D4E418E560BE2660339C1D237052 ezequielvonderahe
458,340,781 *2E8C868BCC091E20F9E9EDFECAA8FDD41C4E0703 bloombakeshopcomwww
458,340,782 *2E8ADE3D0FF2C48BED425937049D1A61A1CFF50E blr:m
458,340,783 *2E86BAD7E7D96A0CF6387009F13523D3DF05A595 farhill
458,340,784 *2E833D8CB162FA6C1B19DC01B21E631B9FCA2F8F [email protected]
458,340,785 *2E8039965FFF9F5A5FF00C241263843FD8826FBF FEEDINGFOREST
458,340,786 *2E8C73F6F3EC6EC79370B74657C493B5C53E8128 b#@~o ~osplat!
458,340,787 *2E8129FE98927D31E9B7DDDFC09252EEB103819C BOWE9856
458,340,788 *2E8254487597C8A761A2527BC5CADFA2AB7CB360 b%-qr
458,340,789 *2E8A4F3FF2FD6C1C50A76DEF98E82C351E8CFFBA FLORENCIO.SCHUCHARDT
458,340,790 *2E888ACBC8932C4198BF59CF064FD7EACD381C3E fluffnugget
458,340,791 *2E87CF5688CEE05BCFDB9D029181C520DE57F595 FORENSICSGUY
458,340,792 *2E80AB399C7EB158B35B7E4A4009BD2686CAED75 forestreiswig
458,340,793 *2E8FD028C4A1447E577AF30FA5BFC6D8F63A26C4 b+rd4
458,340,794 *2E8838B1483D23C7FB4B4B905ACAF4DFBA8F9CC9 francesfragosa
458,340,795 *2E88A641883696CD4F3FA14DA9D31A9FE657075B brendsel7
458,340,796 *2E88024BA8317270618197C22B65989D38EDAF3A brn;_
458,340,797 *2E89D6A4D3E8300486ED0E608637BF4232B12E50 bruce-conaway
458,340,798 *2E8164C4F92DA093136FCBF3C708EDA93A24EFB5 Bs_2
458,340,799 *2E849984F25BE79A917D9D30892935E5F4D723C1 GABRIELSHEKEY
458,340,800 *2E8404B79FB1E418BE32A1BD231C0B0B82C45CC6 bus-stop-bench
458,340,801 *2E866588E54B78D915DF5C085B23F866B9B103A4 bv3j/
458,340,802 *2E88AA7B42391532BD1851A4F3A4363DDDDB9912 bv(m&
458,340,803 *2E870E0477264D594E9EC3FC2841291D7338F981 GENTAG2
458,340,804 *2E8663D426FFCB10AFC90A2C98F4D4FC26181975 bzl.3
458,340,805 *2E84EFA90805B810D072359093AACFC76E960E1F c4nef
458,340,806 *2E860059E692BA8E5855B12FBACE7A22FC62ADC5 GILFISTLER
458,340,807 *2E8C5B80A8BC1E498354DF190505CF9E91C80910 C6IR"
458,340,808 *2E89118F9E5D49718B1DE485879F25C69B602B1F GIUSEPPEHULLENDER
458,340,809 *2E863F5B114AB58A931CC2217B5358AD956F2382 GJ0N3
458,340,810 *2E8063231D24B714E7479CEB66DB900709A71959 c.&8/
458,340,811 *2E8CAAB5DF292D7A1364BB453B17967AB64CBA75 C8E?N
458,340,812 *2E81EC1A42AEA13A1F353E98A239A8EA39B3579E GMRVRHCS
458,340,813 *2E8FD7DF97F44DDD5D2772389FC6030AE9091ED5 CAMILLAOSCARSSON
458,340,814 *2E8F99876A3D8BB8C93109B4125043DFD121E220 [email protected]
458,340,815 *2E8A89B6E4AF525815B8A74EFBB31FB2B5F8667C [email protected]
458,340,816 *2E872990A773189B8E1AEF41A1684737AFFF804A [email protected]
458,340,817 *2E8CA63B47C7229A2F4462A3542BE9FB124F009C CARL-IWAR
458,340,818 *2E8D7886B98E33148EF956FE8901CDC2CEB65233 GRADY.HOLDREN
458,340,819 *2E8EA7EB2F2FC08B624A5A9367846AEB83735FDC GREGGRAWHOOF
458,340,820 *2E8B53FAF34506C353D3FC4220171D9871145540 GREG.MANCIEL
458,340,821 *2E8E8D1B50B6F4B19103FA256EB6F8CFD02C3813 GRETAMONAMOURT
458,340,822 *2E847EA7EAE9AE0CC63A4EC9F3C601FC8D76A5F9 CATEGORYTEMPLATEMILH
458,340,823 *2E826B35247620464D6D30370A9D7120E631BBBC CATSCRATCHFEVER(FEATGODSMACK)
458,340,824 *2E8B8BBE6F423C3BF52FDD760AE0A6008F4B1682 GUADALUPETOELLER
458,340,825 *2E82C14019B4E28D353C4F94598C82F443A5AE95 [email protected]
458,340,826 *2E89C8C78A430999C06F0B3F03E864930CC211F6 CBFM
458,340,827 *2E89A7E5DF7E11AD3AFECA1FFE68066F8F0A76C7 GUTBETUC4
458,340,828 *2E80ED6242A77F83524E2991E6A760A2569A70CA centimil4
458,340,829 *2E8C9B726CEDD57D29DC071969F3214B84EBFDE7 CGM4W
458,340,830 *2E8C59BB113080307D512DD0F784F07225EA1C62 halell
458,340,831 *2E88B688EE171231C72316417233DB56A7B2F5E5 haley.banks
458,340,832 *2E84F05358FE5D615CC4138683DBA899DD45E47F [email protected]
458,340,833 *2E86F69171093B3764B585CAE7FAA5BFF36D6EEB CHANGEME75
458,340,834 *2E8281D557BA1F533397C44E039B143E57242A07 HANNAMOEN
458,340,835 *2E8351833B6CC1287E79DD744021923775464DD9 HAULAGEDUNNAGE
458,340,836 *2E8BD0DC321480FAA8EC06FF4816AF37F6232349 HAUSCHET
458,340,837 *2E8E32D3083BC94F72F4507B97948D0586991766 HAYDENFITCHETT
458,340,838 *2E8B244FB020E86057B1DD7605B4EEA0EECAA5CF [email protected]
458,340,839 *2E86EE4BF78DF3292F37F5A6211989B9E63586FE [email protected]
458,340,840 *2E8F7772DAA0A541F76710F6CAC7C9D9B85E6E55 HEATHAR7
458,340,841 *2E8A359B2F734D2BFDA05C338D387AE0593ADE1D charmagnecurtis
458,340,842 *2E8AA4C8FFDEE11EDEF02E106010035BEE578DA8 [email protected]
458,340,843 *2E8AC8C5D098C83B10E6E1221F179FA42B6DAFB6 hem*
458,340,844 *2E8CFBDE8F2708B0B42D242EF4F6113376429F02 [email protected]
458,340,845 *2E8F35099C87FC24F69CDDD0D01E2788D5729874 HERIZOGGED
458,340,846 *2E8315D2BDA1210F6FBC994837EFBC0E7DDEDD20 hiltonthero
458,340,847 *2E8CF3566AE23D187FBD5EE5C848B00376A6F0C0 chkr,
458,340,848 *2E8D2FB04BB8FCC225157588A606E2FD284E6C92 chx2
458,340,849 *2E8DBEC1D66098DD4929850B93C0A4AB11B04079 HOMERDEMAYO
458,340,850 *2E8CE0F40F73ECFABDA03546D57453E5FDD2D09F CICRONI2
458,340,851 *2E8E9A38A619E89036DD1B73EC6C97C166C7604F HOUSTONQUIRKE
458,340,852 *2E865E5DEF9385E485AA8F41CC2D28B52E85294E hpwvvfc55
458,340,853 *2E80BBB4C6A201DE8BA53008CF8A5A3272D92E6B ckyp7
458,340,854 *2E86396B5E5630D717B059E3D1D24F542511E64A CLARKMIRAMONTEZ
458,340,855 *2E8B914072611EC773AE76D3692DBDA9702A13DA CLEMENTEGUION
458,340,856 *2E80B9E22DB8E9C90A32F061A527961B23719EF0 HTTPWWW.MUCOS.DEPROD
458,340,857 *2E8BC661AD836924BB7225931221F5BB374F05D1 CLIFFORDCARRATURO
458,340,858 *2E86099C52F372AE950D7E62E4DFD51C34896749 clintinzunza
458,340,859 *2E84E4B70E63875467839BCC9DC69CC2E8F79D07 CLOSE(0);
458,340,860 *2E8AE39D42748DD160B430BE79876A651218F5B9 CM.;=
458,340,861 *2E8D430E9C0D8F8EC4FE6E927CE890B0D4C94821 IAMOLLIE1986
458,340,862 *2E8C27ED4B8C0D583FA53605ED3AE88D59CE8369 COJI
458,340,863 *2E81D4977E469379A8DA52C3C6B8F9F44480C9E6 IF.M$.=."Z".THEN.N12.=.90
458,340,864 *2E82E78F8CA1880ABF958B4655EE578EE2255E2A IKE.BUCH
458,340,865 *2E8FB1071F8B29A9D571D99A5BED3877B5024798 IKHWANOUL3
458,340,866 *2E8042FD1CBB67FA99E95B6120FB636202F03967 CONSTEL·LACIÓ
458,340,867 *2E888674274291CA188391AB52DE517257AC0610 cranchen
458,340,868 *2E8950BBFA0E2F13ED2BE5B6846D9EDC97091C99 creativeability
458,340,869 *2E8ED760A9E4DEECCDB428236352EC3372B90CB8 csb0r
458,340,870 *2E88754FE222B90945FD3B8CFF79286D7C2C6B3A [email protected]
458,340,871 *2E8DA90462B85804A76BEC449983200A2174D9FF c\vd
458,340,872 *2E898DB35E927EDEBAB268103CBEBE855698A9F2 d04l
458,340,873 *2E83C6ED1FF472B72F74C968666C65EE6E221251 [email protected]
458,340,874 *2E858F440428FD668AE4F92474071596C7C2C482 izbischte
458,340,875 *2E841FC802251132F35B2D0359A13A41A6438424 jactowngohard
458,340,876 *2E8F56438DA61007A24030518D446D4D945AB30B jaime.wise
458,340,877 *2E88D17BDDF06ED4910CE89D0FA623452EE32664 d7ac3
458,340,878 *2E8504164D15FDF0FE14329CB574B0FF0490D24A daleboerm
458,340,879 *2E8370E84062F31E68A5523C3C04C92153A263FA DALLAS.SCUDDER
458,340,880 *2E802F8115E79829998022110A55842B2B863CA1 damianmulkey
458,340,881 *2E88F673F728D2B08C8323D2D39C2DEE0E33437B jaredbrandal
458,340,882 *2E89B54F03D137C9B1390CB6EA13B94DEAAD85CB danielasalazar
458,340,883 *2E87FEEF5C792703087AECF3091AEC26FA76C4BA JAY.JAZWA
458,340,884 *2E8937CBA05D89276B01C6A99DAA521BA6213660 DARENCROSS
458,340,885 *2E8C2C554B8D1B59B09A018C98544E5201C04EA8 JEFFEREYSODARO
458,340,886 *2E888BB12A8B017E07BD3F156677E88139226086 jeffereywhitlingum
458,340,887 *2E8F777DBC7DA1A32130AAFAB85A36715B4E5358 DASIANFASHION
458,340,888 *2E8FE47DD093397ED7E5783AEA99C9C53F3EC429 DAVID J NAUMAN
458,340,889 *2E8B51F4A0EF39B7E7D061D36B2209F3D20AC32B jeromyschoenfeldt
458,340,890 *2E808446554C6EFCAF9314453898FF0683D985C5 jessica-mcdowell
458,340,891 *2E89396F28ED4337FAF4E5CFEF69384F874B1412 DBOBECZKO
458,340,892 *2E8A0D309543360227EB2E21E31F9BD4E4A7D4EE DCHDN
458,340,893 *2E8D2AD8BA72D3E9A254BF0907F206C3DA687BDC JIM.KOSH
458,340,894 *2E8B54734341DAE580710DB18273AFB14B003229 joeflow15
458,340,895 *2E8B2D2910E1EF8E376B2DA06F228D3B18D5013C JOJINGLESSAYS
458,340,896 *2E8AD5733440898973AA074992A2D3A450E24D34 jordanbilal
458,340,897 *2E8827746ACC7D629E68E1DA7FED8D1944764B35 JORDONGIERNOTH
458,340,898 *2E82C468614DE14ACDE60CC8012329A10A9C6375 DEPRECIA70R$
458,340,899 *2E843A6410BA8BEBEC930F372031703F630A2A0A DERIVAVI5
458,340,900 *2E8480A2877A30244E5A03D27EDB4F42863617A2 DF#K;
458,340,901 *2E8E6D9241EE9EB138A2EE457C850A8C25A9C13F [email protected]
458,340,902 *2E8049BAC5652FD4F6182950BB25BECC39048382 DHQD9
458,340,903 *2E862C8A39E2E88DFEF793830F23091A596C92CE [email protected]
458,340,904 *2E836A423F127D565BA0C05C7C21B1FD0545FE97 d(i_g
458,340,905 *2E8D3DAAC4CABB27ACD0BC10C90F60D668D9B061 DILLONPROFFIT
458,340,906 *2E8EE9D427F6D10BA050D13C2A01117234EC9B52 karpagam1
458,340,907 *2E80CCBA5AA3BFBCAABD278A41C082F79935625E KATHY-BARRINGER
458,340,908 *2E8267EB86C1AF7DF9E8B95A7E23C185E583D0F8 KATHY JEAN
458,340,909 *2E8DC9691BABD41EF4305C7C1F0CD5A6C87F2F63 kccentralweb
458,340,910 *2E8899F912FEFF6CCF062EE65754AEA8C6BE0753 @[email protected]@
458,340,911 *2E855B3F2515CFA7EA34CB35A1FFAF6363149C98 KEEYORE
458,340,912 *2E829882418672EEAE14B23A9257163CCD7BAAB7 KENNETHBUMBALOUGH
458,340,913 *2E82ACBC674EBB572177399D4000A2374661C8AF kentdarugar
458,340,914 *2E8EAC0D6E4C5F583CE57F306D1E605E0F3CF4C9 KEY:SECRET
458,340,915 *2E8712E8BDB979348ED53E46DD4059DECB13E9BF khelarictjharkhand
458,340,916 *2E8598EF939BA83959CAF0B3DC2D794D49C6DC4B KIDNEWSED
458,340,917 *2E89F83E67030A2FF7DB0F43DC3E62901D87B134 djayjared
458,340,918 *2E803DD3148359F49E7F1B0B0CE489FC2F052AFD KKAMALKAMAL
458,340,919 *2E8138653AC9211074C3E1B285225AD5EB97D8AD KOMPROMISSOVICH
458,340,920 *2E8FF9AEB5B9B824122B4A947EC2F00B58E421DC KONINKRYKSVERBAND
458,340,921 *2E82E6AEFCDF6352419F1F869C39EA230B550EAB dlpq8
458,340,922 *2E80CB2A92FD37421773E9F4DBBB12638581997C KRISSOUTH
458,340,923 *2E84A31C79210EFB1E3AFE3653CF36B95F47877A DNB+
458,340,924 *2E8F04755D6176E6F84DDA513D15DC721504A24B KULUISTA9
458,340,925 *2E8F6A285394C95ED2B1A8FB07F81DB7B8D40724 L110046
458,340,926 *2E8455655E88326717FD6DCD88A5A1FED8269409 DOMINICKANTINARELLI
458,340,927 *2E80EF39993A814A2F8895908CF17768B110075A L39+MA+3D
458,340,928 *2E87034804EEBD26A5B4A12F2D9CD125D8FE0ACC Lady-in-Black-(edited-version)
458,340,929 *2E8F4E8688BB36CEF668881C87E8487B6A0B5176 LA.FINE.DI.QUALCOSA
458,340,930 *2E83246F3EB178C40047869D19B67C9897788595 LARABELLE
458,340,931 *2E85289550D46F2C57643DA24273F7152C8C1C7B LAVERNEEACRET
458,340,932 *2E8EBAAA3E9D6B99A26D361DBFA9D99E5EF9C719 LAVERNE.LAYNG
458,340,933 *2E8407A98BECFEB3C22BDF34E25009B58AB0DAF7 DOUG.SCHWAB
458,340,934 *2E85B577CCB3DDA01ED9D84213B3EF133B23195E LCHOMETA
458,340,935 *2E8D0EB5B44FCB0B26C80D749946C24DC010A35B dpp"l
458,340,936 *2E8B8FB3A23CC2D665AA326402BFF09BDE742DE4 LENNYTROLINGER
458,340,937 *2E808127C4A403DC4DB01595571459ADE899105A dqwo
458,340,938 *2E8753A29C8F8482327C5013123F013F07B18F3E dr:nn
458,340,939 *2E87A79E28226D5D3907C881186AD8FEB568A9C6 DT%$
458,340,940 *2E81239317670093F1D0C5F436E06E9B2A20880D LIMINESS
458,340,941 *2E84C924CDEE47251C88A9A88E9F5C7BDD58DC0C LINDSAYARZU
458,340,942 *2E80C0824E131A5FD4CFFC35E86A722960B0BDF8 LINOHAZELRIG
458,340,943 *2E888D560056F0CD652F2C9AD58813260B80A5CA [email protected]
458,340,944 *2E857E514579D326E045AC63DA0BC460D8C9CB9C [email protected]
458,340,945 *2E8FC3353878859D613123DDE676800750F2E6B8 liuyadao
458,340,946 *2E849D7859F9591C3A4458AEE179329E3AEB5728 dwg=a
458,340,947 *2E8A145A7EA52EA7526D9B982272F2278298D499 louise.call
458,340,948 *2E8FE9E1905DE236E41597E11600D426CF3D258F DYLAN CARUANA
458,340,949 *2E880CA11CBED732BE6473B282BD1E5E6FBB5EFF DYLAN.EBBIGHAUSEN
458,340,950 *2E85F0458B4BD3CCDB0A808A782058D4D19CCE80 DYSME
458,340,951 *2E8DD7DFEAF4B7E2B4C6D57179B330B77F5E118A lucky1picasso
458,340,952 *2E8E8C6B051A39164978CC996E97BA839F9EA2A4 [email protected]
458,340,953 *2E80052F00D5F7F62EEB498A347FB1B5BF54899D LUISRUPEL
458,340,954 *2E803750E22548B1054207CD243AA23AA44CD432 ebaqw
458,340,955 *2E8ACE481B2CAEC6E7C3D62F14FBA3296A315DEA ECFRW
458,340,956 *2E816D4935FEA82EBCD3CD5EDEFF6AE01163820A LUXEMBURGISCHEM
458,340,957 *2E831223D830254B5743F3BED0305F1856DA7FE2 MAAOTTELUAKIN
458,340,958 *2E84885F2F6284C9DC23BBE482E44C236C671A15 madaje
458,340,959 *2E8BE1CA701BF8FD0EDC62BB8F06C6A896757F72 ednaphse0
458,340,960 *2E84A21A6FE5E0A725703EAA222C5CDAC9EB5A01 edonartn3
458,340,961 *2E88C7FDECB58CAB9A068EA1127BC86007BBF519 edu%n
458,340,962 *2E84AD7EEA5D494DCB8A680A3193DD5F5ED5B127 EELACEDIED
458,340,963 *2E895185D4BA9CBC44531A21488AB3BA0BD31FDB EFRAINPATOLOT
458,340,964 *2E8012BE9CF64953EB62304ABCE32F4EC1BBDB6D MALCOM.MARRABLE
458,340,965 *2E8A25710C3EA9DF790D537B21709CD63861100C EFWHEL
458,340,966 *2E8A98602F3226361AA856B9F8071923348941DB MANGOEING
458,340,967 *2E87AD2D8566BEF030493AD4C82D1839895942FB ehe_:
458,340,968 *2E823225F28D3D339ED29CB256E34E577D1A31A3 EHEGNIE2
458,340,969 *2E8904B252F673D305F6AE7EE59638820926C15D man!pula+!ve
458,340,970 *2E8610D7DD4086F7C459CEF2EBD48D76E9528DC7 eirva
458,340,971 *2E8DE3FC26529C848CC396366884EC40506F2B05 marcellusarkontaky
458,340,972 *2E83CAB7CC8B3B070AFA9ACE201DD38D34B46124 marcelomagalong
458,340,973 *2E83B3277417E26B533C3550BE7A440F3E0A7BF5 MARC ESLAVA
458,340,974 *2E8C18F7B31701FB0E9027FCF153F902C586BEEF ekth7
458,340,975 *2E8D68A3A25676F7ADD2DDC99A45A859EFCDA0BC ELDOUSKY
458,340,976 *2E8ED00FB2A4F96944D23A7714522CFA3B8D786E marlboro09
458,340,977 *2E8B89BBBFE30BD03468781684B7FF64E9BCE301 ELISHA.BASUA
458,340,978 *2E86CD1AB282344489B35803DF642DF682E69F19 martinmestas
458,340,979 *2E88263BEDEEDE7B3A404CBDEAC5090A3E283A9E MARVIN.CROCKETT
458,340,980 *2E894969BD55575790C2CF6C939B43DFF1496A2B elroyrusert
458,340,981 *2E84A336F91AFBE0081A895BC07285FFF2FF2E5C ELSA895
458,340,982 *2E825D6F4CACDDE6F0D869D39D0CABE7A880C8E7 MASONSKORCZ
458,340,983 *2E81BDEAEB9F75E9C4FAA58209778725A703EF3B MATTHEWRAYMOND
458,340,984 *2E8D471B84D27FE86EF71BEFA4B0F023C7C75DCF MAURO.GUTZMANN
458,340,985 *2E8C9D6D6DBF2C027253354D30BDAE1F5B97BA22 MAX.BENAUIDES
458,340,986 *2E8CAA83A42A3408F11D27FD7705B21B1DC9CCE9 [email protected]
458,340,987 *2E83CB48B6BFA02129F880BCF9D2B30F3C3876BC enterr
458,340,988 *2E84CEE0CBF6851FA321324859FB39A465A4AD05 EOt5
458,340,989 *2E8CDA020EE118BF3A61160025D275B64C48AC54 MDRACKSED
458,340,990 *2E8FC696D3ABE7CC88AAE342BA1FF08A415BB238 mellékvesekéreg
458,340,991 *2E8BBACF3933DBB92517AD187ECC263ED1EFD7B1 eriksnair
458,340,992 *2E8AEDD59AF8BDEEA68A0A8D22FA9C79E55D1950 ESERRAVA
458,340,993 *2E8ECC431FF7EC87FBA539FC5FBD6F20121FA07B ETARYTUB
458,340,994 *2E867E8FF45AA439C4D1DE864E204EA594C608A3 micahchesler
458,340,995 *2E8F1B60DDA972EBA5EE806AFEAA80041420EE3E [email protected]
458,340,996 *2E8B71BD00AD91282A77F0954328CEB70DBEA1C5 ÉVELŐDÖTT
458,340,997 *2E85D2F5629DCC023AB2A03CF37E05325380C6AD EVOFIT
458,340,998 *2E8D5B2CD33C6B0F515CDDB0826197B4FB4D87A3 F4ROEISH
458,340,999 *2E81BAD6AC5C364D81A8346C5AB386FA42F93F94 [email protected]
458,341,000 *2E8006235B3EA4E202FF5A7161D3B1A14F8FFBBF [email protected]
458,341,001 *2E8C43241DF058B7F30E676F613BC3DFFDFF3F1B mohammadfansler
458,341,002 *2E8DF668AD223E88107B470B6E2C686755A3A760 MOISESDENHERDER
458,341,003 *2E865D86A87D4E576E31E6CD9E7050F3D07834E4 MONMON04
458,341,004 *2E8616CFFB42630948E96A3FCCE37D9C9AEE91BB moottoritiemurhaajamuistelee
458,341,005 *2E8C88DBB112B2A22E5AE6CF828DCC06E936C2AA FARTEL0
458,341,006 *2E8087A21CC4738B6D4A504F3126A9F31791B6FB FAUMOEUALOGO
458,341,007 *2E88D2C36DE9C8FEF2BF86E8A6BD6B1EAE5E9585 fcss
458,341,008 *2E88150F505E4CE895F69B1ACE74BF24F15C53FE M$P14Y3D
458,341,009 *2E80B1F6554BF188A4615E58E9152E9F81DD6E06 MRNICK1212
458,341,010 *2E8093CB2808F2CD02A557DFC35C0D1A68E79FB2 MS893
458,341,011 *2E806DABE5FA65375B490E764C11218C104E388F [email protected]
458,341,012 *2E8F979E5C65447B4526F18E4ACDA74FA8E64CD8 murmanskats
458,341,013 *2E86DCAF91503D97E3C77AE168B2342483CCBA1A FLDEOSTED
458,341,014 *2E8EFBB7140E7150034A7401F4CD7D6B314EF659 MWASARU4
458,341,015 *2E83DA2266C251C7355FEFCF354DA6EC86D93FBB [email protected]
458,341,016 *2E895D4E274B740DF592737AF8115E53BCE802C2 FOODCOPPIA
458,341,017 *2E82BE99BA4E3A7EED82DB6FA9390186D9B69013 MZIMMERS0
458,341,018 *2E8C2A7A16A266FE4F3063C4AA2E1FEB15DBB127 FRÄFFTIGLID
458,341,019 *2E8F94F47C3F69FE3354007CF9DA77062976A1B4 FRANCESEDEN
458,341,020 *2E8EFB34B94F572256AEDC4CEE757B174458804E [email protected]
458,341,021 *2E820730B2EDD0A321F2B59AF9DC7118C37EAF92 FRANKLIN.STONEFIELD
458,341,022 *2E850DE2B3D2F2962DB876FECFB8502EECFCAF81 NAMOCON7
458,341,023 *2E80B3FFF59DF98FD5F3A4299A163521182A2F5D fredbroadbent
458,341,024 *2E8F155BBE892C770610FA2FAAC8432BE56FF32C NASTY DOLL
458,341,025 *2E8B8AA2CA8254CE50112654CA6201A80BB83413 nc;
458,341,026 *2E839BEAC6E83D482AAF9C23EC89A4E15005F267 FTSLOKAL1
458,341,027 *2E8E42BED94DCE8F4290449C57985471E556878B NDRMTGLG
458,341,028 *2E85B471A0F002F64A79A47834F58F340566430F FUN.WILLIRENNEN
458,341,029 *2E80DE67EDA314F9A63BC1A121C73BE5DA3F1801 neelys
458,341,030 *2E8FA79C55082D3084AFBBB00617C412E5A9DB95 GARDERAIENT8
458,341,031 *2E88B4318D58A35FAE6CF88396DFC7D33388A24A gavinasai
458,341,032 *2E8BDA7051AE823A34258536B1019494D2430F89 GA&W
458,341,033 *2E81070319485A56E619C69C6F1F94EA3186473C gilleadn6
458,341,034 *2E8CBE825179FE5E737C2D8CDAC54129503C5537 glockenting
458,341,035 *2E88AE19FD3DC700BF19C60AB6A460BEF61152BC n.natt.idag./.vendeltid
458,341,036 *2E846A1D9C7723D97056679ED65469B2ECAB5A50 noahwolfertz
458,341,037 *2E8FE363FBF37E8424D24EF80A84F057B8C3ABF0 GRANVILLEMELBY
458,341,038 *2E89EB0A1C59C989F421243CAE01EA07A5499708 GRDPXNDX
458,341,039 *2E8290CE78291A0FD7A31E5DF8A270BA22CD116A NOGACULG5
458,341,040 *2E8765C98DE224334E93ED325F49AFBEABB214AA NOMEU19
458,341,041 *2E8D7D3DEC9192AFB089513E37B90D662EA2D008 GREG.WHITBECK
458,341,042 *2E8DB7F3E562A27032044D327AC7AD59221B8289 GRO;
458,341,043 *2E8EF1FC5227043EDBBAC0017FA2C957812A3419 guadalupemonnin
458,341,044 *2E8EA6AD3B71B53FDBCDFBC58F78515D439FF04A [email protected]
458,341,045 *2E8E3E25072AC9147C89B4E22FFA1BCAA0C1C3C4 GUÐRUN…
458,341,046 *2E883AF71FABE0E63D4FD80A8F329E23D0C951A0 gutrida
458,341,047 *2E8749B8C754BC31403B748B26A6FE900AEA5485 gyral6
458,341,048 *2E8CDA83D0939BF29CB4AB36518FBF8932E261DB )o(~`(=3
458,341,049 *2E83029D1BCCA2E3DEF032067249A110707466FA [email protected]
458,341,050 *2E818354F68B16F623C1FAC14458DB85AAA8258B HANKANDLEFTY
458,341,051 *2E8160C903C970E09D3BD74A217F17A03D8B4636 HANNERS5
458,341,052 *2E845F0DAA3C165083FA904612B448ADC0E2E52D OLIN.MCLILLY
458,341,053 *2E8D6F7953D65A52FC73D61CA9F3A3B1994CFD00 HASSELMANNHØYDEN
458,341,054 *2E81BFFCB5C708F7157D8834DC8B4D6E4C341267 HBIKALSED
458,341,055 *2E8693412B72C9F1C9D3B1D2063ACEB9C1C7611A helix-loop-strand
458,341,056 *2E8B1CDC524269A7BCFC47FD5D548C37AFE638E4 herkansingswedstrijden3
458,341,057 *2E85FC76E7601FC66D0C1FFE21395B493555A951 hermanilalio
458,341,058 *2E82484C01BFCDD88D2F7EB2B13D4A0480CED461 he.was.a.good.man.as.good.men.go
458,341,059 *2E8D83548A1CC81DE2CA02598FAE7A4DAC4FAABE p==>~0.>-<
458,341,060 *2E8FDD6A22C4415FE160B24BE85F35919A19A10F p14n3t di
458,341,061 *2E8628C7B29E180DDF3A2F2CEBCE16A491FC411C P9AAA
458,341,062 *2E8BEC98AC9BD44CD31BF55FEA929D215AE7C624 PÄINVASTAISEEN
458,341,063 *2E85F0BC9A61D83C2B91E993DECA6A5212AEB449 pannibsw
458,341,064 *2E8F4CBEE3165E610E0389E6F8DAE170DB7A1E32 [email protected]
458,341,065 *2E829773D14EA99E7B770B5FD9B21FE0DF2F9CFA papel-continuo
458,341,066 *2E83CB54E0F34D4BEB1AB2D1A7188BAE58E71BC5 Hope?-Oh-yes,-there-is-hope---infinite-hope-But-not-for-us
458,341,067 *2E85CB0739CB01DFEF04321563A35BC5CDBF1FB7 HOU$3119H7$
458,341,068 *2E88B456C31B7784A959D7D09DCFD5F635C87BE9 howcouldileavejah
458,341,069 *2E80145C7DCC2DCC2C8BE3A0F04A8D9A24DA513D HS20090419SI1VS038LD
458,341,070 *2E8C3FFEA94D03E8F7CAD2A888EAB09CF37490A0 @pervert
458,341,071 *2E89918D62BFF079E8D3956C080001ED4283A8CE PETERCERAVOLO
458,341,072 *2E800A8851782626BBD4076E493B51DF0144A809 PI7I4BLENE55
458,341,073 *2E82E71623A28B41155633F1558B6EE1EFC6C290 IATREJUNS
458,341,074 *2E84741D587AAE0D87FC3030C4574371859A86BE IJY
458,341,075 *2E8A9A142061822C8790A513308D3FEA225D81EA ilovecaitlin1988
458,341,076 *2E87F1964D12D432A994AE9B8727E28929FDDBCE imagekantah
458,341,077 *2E8055096B74B77CA6AF50CF0DA6FA2ECF018FBE INADANAYING
458,341,078 *2E8E5DD4D1A1C8AE7B9C7680D6346A508000E104 PRATEEK2008
458,341,079 *2E83373201FA9DD00F060A5F997F702E2BAC24B5 INOROKOK8
458,341,080 *2E8948CA91680B0D96C7FA663F8B29BDE1B4FEB8 PRISHËS
458,341,081 *2E84AA3165C0B5F51EBB09D78CE2F2BB1003CC00 prisionesdeespa
458,341,082 *2E812B93F5CBE7FB6F17DB45DBFD984F8E7F2D36 PRIVATE INTENTIONS (RADIO VERSION)
458,341,083 *2E8757CCE99237FC329755C2B3A42A6463B9A373 PRÓITÉÁIS
458,341,084 *2E8A866149E215B6E45C54E22F23E59911CD82A7 propalino1
458,341,085 *2E8F4BD5C4B89A6572CD8663D6AB9D96B3AAD9BE IVORY.LAMBETH
458,341,086 *2E8B092C32DA6D684616E8DD7CA56199C45AF871 Q27091985
458,341,087 *2E891A04A98739AEB97398CD7E62AF54F0AC3BD1 qB.~0.~o.}o{
458,341,088 *2E8C77E6110FC863798855A26B8A554783FD0B81 q#####b.`.o->-<
458,341,089 *2E827BF50F53A77F1467C06F930D289150FD0DAD [email protected]
458,341,090 *2E8E25BEBD45F24B45532D1B951146DE85741326 [email protected]
458,341,091 *2E8BC9A0179F98D62AE8F1CF4D23CF12887A4BEB iyms
458,341,092 *2E8A0392977410C4F8612F94F3BB402CC0C449A7 j+8z
458,341,093 *2E82D3D66286A466076F6C938AC4E7379B936E11 JACK.TERRI
458,341,094 *2E86554EA08EADE09FC4387F275B3769BDA09451 JACKVANDERPOOL
458,341,095 *2E8C116748F05A229DAA5449D1B6AE44B1A428C0 q#####p~-~-~-splat!!
458,341,096 *2E87DD086C562B16C70B466C780D2FFE18CEF5A7 JAMAAL.SHADDING
458,341,097 *2E81D42518F68997AA4E8994D13BA51D19AEAD38 jamalbellman
458,341,098 *2E81269DD85C3CB198CF0794D2FFC88880DF4B76 QUINTIN.SCHOONER
458,341,099 *2E8373B6A4A801FB487078803715A644287B402C QVKD
458,341,100 *2E8735F4DADF7CB24E416E8285170C4CA7D4BF8C JANTJEDINE
458,341,101 *2E824EFC2C8179E538B77574AA3DC93034342D54 jarrett.rice
458,341,102 *2E858E5BFEB71EDFC0AD3AF15EBCC1A145F3B12C RAMIRO.SECORE
458,341,103 *2E801C7E18E298A5E571AC72FBB28C38E891DCB2 JEFFEREY.BUNKERS
458,341,104 *2E8B89F8EC26A7554CD95C4C4B40C9315B332E14 RANDALLODEN
458,341,105 *2E80DDFA4BFFCBAAC4717DF30F3B70BD1BA503D1 JEROMY.DELUCIAN
458,341,106 *2E8453D8B811FCBCF972CE54E486F4AE37F65BEA JERRYL-WILSON
458,341,107 *2E895A1FDAFEE988612ED7E389B546CDBCF7E467 JGROST
458,341,108 *2E8EBD2AD4A6932B5ECF8742818989C6618FDE81 JHWYDO
458,341,109 *2E8AA10C972CF4D0BD9B854BAE8AB6DA320E6454 JIMMIEPEBLEY
458,341,110 *2E8B5EB8C8EBA5C0EE7F3A5604CCDAF7DA2DF5A9 jimmietobola
458,341,111 *2E80A57B0B167B059E20C80A521CBA17D556F970 REIZLOSEREM5
458,341,112 *2E84A89D920B6DA37B85ABA6A61B8DAC0B0C2721 RELFRAD0
458,341,113 *2E8789B61956B8C6A0B6671091987308E1FE3658 [email protected]
458,341,114 *2E807B70AB84CDAEDCF1B3FD9A9ACD903ECE2F98 jodi-reagan
458,341,115 *2E8E91FF22C6358498910611447E410C73AC6D8F [email protected]
458,341,116 *2E82D5ACF0E1057C8B12B4E0DB71068770008BD0 joelbenedum
458,341,117 *2E8A0A0D4E59205D781077E5A50088F3829D8659 JOHNATHONNASCIMENTO
458,341,118 *2E848EEDF9E1840D5B11C4A929FAF7E3C9D5CD09 RESTONS.CHEZ.NOUS
458,341,119 *2E85E906CA609F1EAFBA348C8C308B169AC397FC REUBEN.STRODER
458,341,120 *2E8C7AA276AEE416423F153E69454276A2C55EBA REVEILOF
458,341,121 *2E837C2608200FEDAE90AC114C2925963920FC17 josephgroeneweg
458,341,122 *2E8990E8F4BD07F1889FF2BCE4509E4A017C4589 JOSHTV
458,341,123 *2E85ACFFAE7D907745DEA1E01780F898C6F78D97 rileybreitling
458,341,124 *2E8C8421437CCBB8B113A6983A62A2F10D5E10E6 RILEYMEPRS4
458,341,125 *2E8768D2F2CD280BE365AC4903454C49E886F78A julianmocha
458,341,126 *2E85AF6447FD5972FA6ECDBEB82E8E56859B2DA1 ripaggios
458,341,127 *2E87F0908B7A48AF1B3E5243ED62C705CB841B6F rmunday8
458,341,128 *2E8295575281E4E40CF0B4B0DD41BF04C5D6BA73 K]@;
458,341,129 *2E864103E19722A68C2642945D66582407224CDB ]Kaaa
458,341,130 *2E816CEED16D767A377B10077C74463E7C86B12E kaleigh45
458,341,131 *2E8DD7AD25614D8A51D4303FC33652BA7FCAB103 karla.chi
458,341,132 *2E8A31F968FE2D0486379C70D8CE8D1FFC0B6B60 KARLDOWEN
458,341,133 *2E8E18DF13FA4DF8E32AE5BDC4A4697DD35BD936 rogberg
458,341,134 *2E86C12C15FBBA121AC61512D55D19368782910E RONALDMOON6
458,341,135 *2E8B5283AF42FDB6121DF0E0918C23DA2947ABB6 ronhoefling
458,341,136 *2E8F52C101E0FCBB768224AA7F210A9D8EAB46F3 RON SHARPE
458,341,137 *2E8191FD38E476E3CD45BD83E891EE1ADDCBE67A RON.WORMWOOD
458,341,138 *2E8149EA16A888DE5FCF9824C1236266968B94EF KELVINVANDERARK
458,341,139 *2E87A3D4976B1B7F55DD2CFD9677D1E06D87DC1D ROYALAMOROSO
458,341,140 *2E8FACB146807971CE40F9901CA711422077BC01 KENTONELLIOT
458,341,141 *2E8D33BFE4ECCF343C2240DFC607978F0FE9CADC ROZWIĄZYWANIEM
458,341,142 *2E8E8CFC895762FA58CA24C9B6D678841B522A0A RQE
458,341,143 *2E83E9D6613279DB673347E5991BAE0A09E76B6A KEVINWHITMYRE
458,341,144 *2E8AFFA91E3120F239ABACB5C10D6F23CCCF2A48 KHALLAN1234
458,341,145 *2E87FD97FF29C22F2524966EAC1F0F9F819B512B RUEBEN.VANCE
458,341,146 *2E8ABB660BE0854B1E6F480C154A59310D4820F2 kiinteist|sijoitusyhti|lle
458,341,147 *2E8E23A1F239F382F6E9D3675D7CD928CB20D3AC KONTRASTNÝCH
458,341,148 *2E839EE9BAA0A9892C559461C86ACD20862B14C2 KONYANKAED
458,341,149 *2E8B1CA8152D6806558C515371C95AE4D0B09543 KOREYYUSI
458,341,150 *2E834C327431FFB43EF69C38C648DBF9102EA552 SALLYANNE
458,341,151 *2E89D524834420F57EDF7A54ECF02CEC7E2267E9 kw?;
458,341,152 *2E8E9E6022CEBDF6615DDF39328C08288AB2843B L210806
458,341,153 *2E8FDE4DC661A52321025B93B55DBC645DF049B7 savingly
458,341,154 *2E86B761C6BF46A39C1184F4D9E4CC3FAD00202B LAGACOSTADELSOL
458,341,155 *2E880FF3FF366799D3FE1CC44A0713AD1CF96BF9 schizosteling
458,341,156 *2E856072589005D57A73A8AE0D10129B368DCAC6 SELAREFSE
458,341,157 *2E8106C68D791BCCE05147A4B11C4E64E08D9E7A SETHMEZZINA
458,341,158 *2E8D94EA06339CB3367665BC5B18B479E9323372 SGNELLA1
458,341,159 *2E885EF26399402343E7DC5F49EBEC1A647ABD6C SHANEBENEUENTO
458,341,160 *2E8027FC2350FC674773DED627313F8E512AB37D shaneheising
458,341,161 *2E8B8310B6741CA691BDAF654071E289CB6B6A48 legendangels
458,341,162 *2E8024AF87A3EB74D6446FAEA872EBA06D2C45DF SHAYNEDOODY
458,341,163 *2E8F4675AC4F5B361DF2AF183E0304FC40B3333C [email protected]
458,341,164 *2E840A324319EAEFEF7BA92F6124667E453F9232 [email protected]
458,341,165 *2E80FD4E338DB2427CF6F7E519E01CF4CA942C57 SHINAGAR2
458,341,166 *2E8B7DB4F88D55CF4F70C3722DD46D756AB8458D [email protected]
458,341,167 *2E82733D9A4694780C2CA181658E16F33A269F04 SIDCUMLEY
458,341,168 *2E8495DB3097C0A89262A3145954F2D89ED7E382 liam-hillman
458,341,169 *2E80DE40DDE0C09A7EF4DF58C3F3FCC66F5F5A65 SIDRERIA2
458,341,170 *2E85EC7393253D2D6231DA1B455923C48B42DC0C LIGHT7
458,341,171 *2E8B90695739EC651B8F21071F61EC8959BC9377 lingua geral
458,341,172 *2E8EAD67DBBBBD9A4AE5935C1B386CF9AD53B56A lonkieft
458,341,173 *2E833FE053CE730499867491112DCB10F19C96C6 LORENZO.BUCHMEIER
458,341,174 *2E843461B6973C225BE0D0E22D5876CD2F9B3706 sobrepuso
458,341,175 *2E80D780A3C7B906D4A7CE3D828D3B93265AB911 SOMETHINGSNEVERCHANGE(BASEMENTS+BROKENGLASS)
458,341,176 *2E8E069D8A389208711CF9C17904A9B65A72D1FB [email protected]
458,341,177 *2E861F91025FDB482DC9AC211ADA4788690B1E65 SPENCERCONLIN
458,341,178 *2E8DBE28C339DC278F635D467D9740FF20B5FB1E MACE BAKER
458,341,179 *2E8DDC80843B37189F485FD235A5D3F8DBFA9A8E [email protected]#####p
458,341,180 *2E85B7307837B9DA86D68675FAB17492D0691295 SPOOKYHOTDOG!
458,341,181 *2E888D3377671FFADDDA36FF67D88CCD1CA8C3B3 SPREITIS7
458,341,182 *2E880598EE39405937AF73121B3D3626345CB5A9 SPRRWSNNY1
458,341,183 *2E85FF458D31F7BEF8CB6A4E459586EF4C95509F SRAWRATSTERAGRAM
458,341,184 *2E8A995AF38378DAF9A3B4EA6F219D97DD2F08F0 MANAGEMENT-GSPC
458,341,185 *2E81780780C3A2BF843ABA2050D04C3DEF1508F2 MANSARDIKATTOA
458,341,186 *2E81DAC7044FACFC811BD5EDE27DFAEC2E13860E S?TAAA
458,341,187 *2E8202E8B1AFE7254BC14561470EA20A7C3ABC7F MARCELOWYMER
458,341,188 *2E8C4BB5BC3CBC05FCA5FED8FF595863650E7BD1 MARCOS.BRADIGAN
458,341,189 *2E85B5A1E225B4282EA7F209B27103D7FAC9D08A STANDSNINGSPBUDDETSING
458,341,190 *2E896873DF5DCC7FC24FDF7B8A7F211814CC42B6 marianne-fernandes
458,341,191 *2E846B839F0F52E7C643F2CE0636EBFDC09D6D5B MARIUO
458,341,192 *2E8D8ED8C4587FE1A0E6FB30148DF52D72C3580F STATIONTRUMPET
458,341,193 *2E8669989C1DFFCAC9B1B98C7C8EBA1CB8411D12 MARQUIS.VIDLER
458,341,194 *2E80B196D0C37B16FDD3B151D7CA854AABC42B7E MASSABIJEENKOMST2
458,341,195 *2E8176D46A9AC2035D9D61C51AB0C7AF9912F511 MAUKBSW8
458,341,196 *2E8353D56AE67311BAEC805441F567E9C66D9176 mccartymah0kaa1rtiy0
458,341,197 *2E8474339E96D2CA1F7A0C3DB9644AA6FB5B0114 MEMBER—HAD
458,341,198 *2E8E7F375D6BFE61585FA7CD13373FCA57514479 meriella1
458,341,199 *2E8ED75A3C80927DAC582A6503F3F2EF6FCFDC0B MERVIN.EALAND
458,341,200 *2E86A0EBC7502DADDB52AB2E73A237A4FCA8681C [email protected]
458,341,201 *2E8B3880467E57A394E0BA89E4D790959483FEA2 mhadfield2003
458,341,202 *2E8785D2D937608516C72DFDD47F7A36BAD2518F STEPHON PERRY
458,341,203 *2E8FB14054C0AB088302081D1C0DC4E1F2F777E5 MICHALNIEDERBERGER
458,341,204 *2E84B3DEC1A3BFCF2139708A8CCDE0C15A60E2CE michealmamo
458,341,205 *2E81436A8E0E88F69DDE1E66A88098838B68A1F0 mickeybaldwin
458,341,206 *2E8F44551C38143CA32494ACFB5DB5542560D0AE microsciurina
458,341,207 *2E8183D3258AE7451BC46CA6127070C9FF59C37E MILITÆRFÆNGSLET
458,341,208 *2E883C94A1FEBAFCEAC04A5702567AEFF969AB1D miltontaves
458,341,209 *2E854099DEFE99CDD4FD0C9E2E021ADC6336C084 MIRELYS-LOPEZ
458,341,210 *2E81B6674B1F7BBC49585F2AA8E75846FB322E9E STINKWACHOLDERS
458,341,211 *2E8CB8C90F89E012E0961E492D0284001A3D8CF1 S.TODD
458,341,212 *2E82137C60BCE7D30F471141DFB82A77976CCF2F STUFFMEUP(FEATTAYLORSAVVY)
458,341,213 *2E87280774D2A87CAB9E27278E4CD53C27C3FD8D MOSTRÓLES
458,341,214 *2E8762A2C10DB96D73830619E6E89FC0EEC9C2E0 Suministrar
458,341,215 *2E87C6FBE5F17DDA677C091A5091CEC111548DD1 SUNG.RANDLES
458,341,216 *2E8FC05C4FD29203FF3DDB9248E6E9244D709C42 SUNKMOLE
458,341,217 *2E84E131451EBF341DE89329810DA33B1B9F8E31 [email protected]
458,341,218 *2E8ECFD5D0EDFDCF884ED929C26DB34E1EA23B69 [email protected]@nc3
458,341,219 *2E8FFB6E414A5AB6C6A3B91FBA2D6CE09004C55B MUCROIS9
458,341,220 *2E84716B8F718F0259E781B2CD44C50CBFE24898 [email protected]
458,341,221 *2E84B031BEEE33EC7C5F67E90FF07428B864494F N0NME10D10US
458,341,222 *2E86C5F18210CC339A988FC3B245B3B72B8FF3CE N3G07470NS
458,341,223 *2E82039F2B89193F0E2138CD12D592A38CF5581A NEIL.PECUKONIS
458,341,224 *2E8003E0E99E61506CFEC6738F660FB281F2D74F NEVERBLOWOUTTHEEASTERNCANDLE
458,341,225 *2E837075BA84B43D019A04EDBC9D90B680F9D1B7 talk88106105174
458,341,226 *2E8B41B32A5572885C50E854544A55CCA1DC8E14 TALKCJXL-FM
458,341,227 *2E8198C868EF4394AAAE25589C6197CB7CF7E135 TALKLORENINGE
458,341,228 *2E8E9C17940F938B381E4E08B4CF82F778FE4440 tannerbaerg
458,341,229 *2E8730600E1B3EABC1C791000634C64EA56946B4 NINNAICHARAN
458,341,230 *2E8A4FD2DBC5F9DBF0D5762EEF2354323863F7F2 NONCONTROV3R$1411Y
458,341,231 *2E8A50F506CC5E0DC1DEFD83BDE7ED555C9476A4 NORBERTOSEVICK
458,341,232 *2E8B8AEF34CC3B4F81FCC1738505432B774334BE NORMANALEXANDRIA
458,341,233 *2E89E3B51A4EEED7A637CC586A580F157F11A092 NORMANSPRIMECOMNORMANSPRIME
458,341,234 *2E8595B8FBF51B1F002D148F7738DEACBB89651A NORSYAZIELLAJ
458,341,235 *2E829062CFC2EED67959559128EF21DBD6489BAF noviceelect
458,341,236 *2E8F9DADA65DB87E28CA4C664B3889E20EFCD711 NPUINN
458,341,237 *2E838FB469E762B3E6651808C99FBD01C5DD6751 タケカワユキヒデ・THAT
458,341,238 *2E8C72FAE3ACAB885546B244EBFAABC2BD90A71D THE BAD TOUCH (THE EIFFEL 65 MIX RADIO EDIT)
458,341,239 *2E87B2F3041EA567A163D24B9C3BA549921B7A46 OMPUNG
458,341,240 *2E863BFDDBECDD2AAAE41231003221490B098F63 onuitputtelijk6
458,341,241 *2E8E5DBA548D0696AD9DF66DDFE39E058FE34B0B TIDDLES7
458,341,242 *2E8DA02776F44CF4387BF2F884800D170BDCA61B TIMBERCRICKET4
458,341,243 *2E873AB2207D683FB11C8BBBA73A236B9A58E203 OPOSICIJA
458,341,244 *2E8DFDEF06038361FE704A574F6112246CD15364 TIME」と同時発売された。こちらには同曲も収録されているほか、「GONE
458,341,245 *2E885702D52E0AF54C10874B1A6530415239F08B ostvestrie
458,341,246 *2E8C0D64E6F205F3F8DF24D707FC0AEC6D94573F [email protected]
458,341,247 *2E88608A2769C0E837FEF43A3D4B91CE5BDFA652 OTHAHOPPENRATH
458,341,248 *2E89F780A79069967EB65E640CAA28485F54A16A otisshults
458,341,249 *2E8C07153356AED124A3C126BD5D199DE5ABD41E tobiasmurrain
458,341,250 *2E8B645EB4C3D0C49D8730A0D1D11AB65C9D5ECD TOBIASVANNETTE
458,341,251 *2E8AB71A27B29157ABDB540DD2A3EFB8441E4C8F OTTOGONZALEZ
458,341,252 *2E89D2D2BD10E2C567526F212176253071351DB3 TODAYMOLSON1
458,341,253 *2E80E558F9848C90D34127B57A73EF70FC4FA929 TODDPORTA
458,341,254 *2E89006FCEB53DD2D75EF13609286F328C8ABA9B OVERTHEWAY
458,341,255 *2E80340A7635206BF71793AD0526F612DC9B0F5D P5EUDODIPTER4LLY
458,341,256 *2E8CD678DE93BAFC6B0FDF4973DD185447183BC8 pa1004
458,341,257 *2E8FFAD0160DBC80564C110B57573D37C51A0ACE tr4ns4ction
458,341,258 *2E8BDF78E8E6BB8303C17D63C9864605E37C7E0D TRACY ROETS SYLVESTER
458,341,259 *2E868360BB2A79568A78073AEA66C5069A65CFC6 TRAPA KORSHINSKYI
458,341,260 *2E8F4850B2AB4A952A742A52DD4B4404185A5E3B paris012
458,341,261 *2E8E67EB6DFA60234FD52E6AB71719FBB78CA196 TRIPODYS3
458,341,262 *2E87D300C5A127E1277DCA7D5447DAA7F29678DD p===d.`~splat
458,341,263 *2E80D509CFDB34F5E1E46E2B3953F5F8B0A40085 TT=C
458,341,264 *2E85100993BD17BE22D5FF1BD88F102F73D81739 PETER2#
458,341,265 *2E802E33CD5666E4E34AC25471E6EADB1053FC63 pevent
458,341,266 *2E86262FF40206DB2AC72F308B680B057105E477 TUTZTAWANNA
458,341,267 *2E8203C8F5773929DBB7DC68D7BA9B65E6DDA16B pilarca
458,341,268 *2E81E0FA2D12391CAB2D03210D800BC9715A56DF plenary-indulgence
458,341,269 *2E82794D8E748CC1193FF01B86C4EAC8EA63760B POLODARWIN
458,341,270 *2E89295735C1D3B8E421E0F6ED18F192463B70DF «UMORALSKE
458,341,271 *2E8FF7DEF877B1C8E2FBACB2EA7A19130C17DAA5 POSTSTREPTOKOKKENGLOMERULONEPHRITIS
458,341,272 *2E88AC8C7D8EE66B8A9FBAC871B20CCBEBEC5665 P----P ~0 ~OSPLAT
458,341,273 *2E8E93376E421AE264D21C2C5C2B6CEBA3D976BB PR3$ANC7F3D
458,341,274 *2E8C6B59D80D1EA258873E86AA670536F2A60A27 prescrbn9
458,341,275 *2E80F13175824A0E222017818B5AA74BE4B92123 USHTAED
458,341,276 *2E8C20B13C1C69C87B7A39978B37BD779118AFBB PROSPECŢIUNILOR
458,341,277 *2E84CE9784A82F6E83C6CB645BE4B7C31FDCDD61 prtvscrling
458,341,278 *2E899130DCF9382CC426E0B63A3A06BD2E968D32 u{yf
458,341,279 *2E8735459928E296DF9485149897CB330E1398B9 VALENTINA.HESTY
458,341,280 *2E8D423221281DC60AFE2ABFBEBE948A82820771 valentinpulera
458,341,281 *2E8E58A73C42033429FD34F2F54B9701B2CE92A0 VALMCCULLARS
458,341,282 *2E82402135BA8C17D6BCD06AE25DEA0D7D9026B7 q-b~o~o)8(
458,341,283 *2E865A273B5B34F42B3C73C2B14518DBA798960F q======D~0~o(O_)
458,341,284 *2E8341865C810928840A22F593B062820C6570C7 qotogaqa
458,341,285 *2E8BA370203845B99715E657640C6BC7941E8CD8 R3G1$TR48111TY
458,341,286 *2E849724CE2DA617DA476295AD2F9C601E012D36 ra-comique.traditionnel).:.au.jardin
458,341,287 *2E835DF1B92D6E2997A463C40E9C426D29B7D45A VIENGLASYMANGNOMEK
458,341,288 *2E8A267372ED1612DADCCC5C3A94AC761E758C7C randallcolaluca
458,341,289 *2E894DAC0B1730BA518DAB0392813201C98A6EB3 randallozon
458,341,290 *2E8FCCB6E49C4945F81F9FF6051EDA288FD44ED5 rapid-run
458,341,291 *2E80951717C6F43F836AE573D5CB1B2891423B27 RAYLARRICK
458,341,292 *2E85481920FE3500B51E4627ECD1848922F4E2E0 VITRY-V/I/'TR/I/
458,341,293 *2E8B5134AC9C782AA2F2CCA59A988607FBDB2DA1 RAYMOND.NATVIG
458,341,294 *2E85E43F124A1B1D80447FB08C9113EF3CE1F305 vivaan
458,341,295 *2E8CE28D6E4776DB73FECFE1FCDCE1E73F13F07C V`KJ
458,341,296 *2E8F32932CE21E09BCE484233B826991A66F90B6 vl&a
458,341,297 *2E8B4B17F41F13D68E926634AAFD81932C74D144 [email protected]
458,341,298 *2E881FAE1C4F990675714B769DADE0FD86E29818 Reckless-Mission-(dub-mix)
458,341,299 *2E8464C0315C5BBA904D049A69633C20EF158C5B REDWOODLIVE
458,341,300 *2E852283160262ACB30D02184960EB29EB5C4898 REHREPUSES
458,341,301 *2E87DA288ACAEBB467FA62E78ABD23B600CBA90F reis9d
458,341,302 *2E822D09AC519C17151E6E144DE0BF5862B8F1A9 VOLETE-METALLO?!
458,341,303 *2E845E7DD9C0A25F0207742B48F13E636064A757 VORSPANNES9
458,341,304 *2E80D1FE983D6C61CEB217DAB3476C0D75567CB0 vvstnebhsdh27x0
458,341,305 *2E8097C466796F8F379EEE6AB07A38F49D1B7AEB WAJDIBUDDY
458,341,306 *2E850A60E2D251BB3E248B4B82D1573A2C87BB72 RICHARD.BYWATER
458,341,307 *2E83DFD7E92C3A5C715355E330DBA44BEFDB1BC6 WARDRANDLE
458,341,308 *2E834F2F7BC7829A8DC8D9553284EAEFF1665F12 WAYNE ANTHONY WHYTE
458,341,309 *2E8ACD9A24E024EE62D08D9118CC7ADF29A4695B WAYNEGALLIANO
458,341,310 *2E8EF14A4225C84D56F6BAAF03A71A4B5B74D595 [email protected]
458,341,311 *2E89D4D215AA8D576FEF63124E9036FB35285EBD WEEKS68
458,341,312 *2E86CD641276E307C5AAA715B9C964154ED60C48 RISEDERVI
458,341,313 *2E83E3DAF15977F600A3155AB40B043A0760471C rita.felton
458,341,314 *2E867761B16A6CD3E22BA39CBDF9599A40033759 ritzmail
458,341,315 *2E84055FA108314BCA3DD10B2748983022925B8F roderickcasavez
458,341,316 *2E8C89BC20365262DF3133E5952D6AB108AFD8A0 WESLEYMCCLINTOCK
458,341,317 *2E8CFA438745B4162BBAC9F4AEFE3F40B4698B0D rom4nt!c!$m
458,341,318 *2E8296E43F8DCEDF88918F7D93E16C1F88BA439C ROPE--SALLAH-STUFFS-THE-ROPE-IN-THE-OIL-DRUM-AND-THE
458,341,319 *2E8CA4EC3CE321C8A9DA203AF7CD6564C7860FB6 ROUWKOETSENS
458,341,320 *2E81D54A319E52AE8C95F01D785EF2FB7C687B21 WILL.DOBOSH
458,341,321 *2E806F70F3217807BDB2DB86B1D3CE616CA46D0E rs!
458,341,322 *2E88654299233B83AFB7E71CAF7F343E0F86B5B9 RTPY
458,341,323 *2E8E5D0DAEC87C16AEBD63EE8F917DDB3D6D94E5 RUFUS BERRY
458,341,324 *2E8A0049C4374101D147AA3274CDCBCD5A5F9C5F WILLY.RABADAN
458,341,325 *2E889B9EED30A3283B58630B0F92ADB990FB970C WILTONSINKO
458,341,326 *2E8BE8160B1B4BBA15A55CE87A2298AB711EDADD RVRYMAHBS
458,341,327 *2E8E08188B015DFAF1F968825E01A1A11DA96508 WINFREDBOULTON
458,341,328 *2E8D976FC3254F25FC4E44F097BC9C7F9DE7AA9B RYKKINNHALLEN
458,341,329 *2E81CDA89E6140688B0C7669ED2E16CB5911191A sagharaki
458,341,330 *2E892078F3A6F8319D1ED96F92D9CC732891AE70 WROBIONY2
458,341,331 *2E8FE2BF9A6F592FFB77D0D6220840EDA4C32447 samenyta
458,341,332 *2E8C6A327BB66560EABFBF026EF3E654EDA822DF sangopolice
458,341,333 *2E8BDDFEA437B878E70A8FC2B335D5618AC67F6E SANTIAGAN3
458,341,334 *2E80DD1B315434D54AFE02290888EEECC746CAB9 santiagowertheim
458,341,335 *2E8664D7DB78DFD645AFAC4D3940F54A549BD903 SANTORINEOSES
458,341,336 *2E83068B069A25E5125CA689C9214B013F5F411D santospeppers
458,341,337 *2E8DADAED3288A72A12A1EF8A3DBA7D2221E0B51 WWWSUMOORJP
458,341,338 *2E8E1DC9864D9A5CE122A72F249ACD7F46A046FD wwwuni-hamburgdewi
458,341,339 *2E8465F4FADE92CCE69990FE2FB5CB687E044561 WYATTBALDOMERO
458,341,340 *2E8CC358AECC6E333C3A8A7D670F5ACCC315B464 SARINEEY
458,341,341 *2E8C49AA3795D695F825EA51FB8689987F22F3A5 [email protected]
458,341,342 *2E8CCB41AC9257D1E46899E4021A215DE0287CBA SATWINDERSINGHS
458,341,343 *2E8F12C00AD25F028FE7273B099FB7DAAFAF353E sauguetiense
458,341,344 *2E8C997D4C11C4A149570E077189366E36FC9A92 SCHWERSTLASTVERKEHR
458,341,345 *2E8BAF2826E82189B42E2E8B6C7B7B7E7CF13FB3 SCLEROMETRO1
458,341,346 *2E83ABA92797B0A8E4347BEE48314BF523738300 [email protected]
458,341,347 *2E8604891211A4AB33E403DA9EF16F37F4749283 SCOTTFORTINO
458,341,348 *2E8E45D00DE838D20C5488B09991463F14672829 “SCREENPLAY
458,341,349 *2E83D753080CFDE7EE15EEAAFD8FC56C13652B1A [email protected]
458,341,350 *2E83F8AB560C03EE8955A8C524B23E071F0677C2 [email protected]
458,341,351 *2E8AC31E1E1707B616D8968E23098A22D5AD0388 [email protected]
458,341,352 *2E8F0ACE03A1C80945AAFEB74A0541B69AE6097A YANGMAZITA
458,341,353 *2E8C64E95AE04D38B43B4B18435E868270E5F8A4 YASIRTALAT
458,341,354 *2E877E9EEE30E19EAFC9C6D44E7FBD2243E94814 [email protected]
458,341,355 *2E87C896CFDDDE830EAC944114565825607DB0EB [email protected]
458,341,356 *2E8DA47B15BCA36FF722569E9FE0F575F7DB3649 SERRENDIPITY
458,341,357 *2E834C5F87DD9AFE2B8108DA93D2A8A30B24B9FA SFITATOR8
458,341,358 *2E8535EDBF1CA5C6EFE94F6E3AFCF30826A19CF7 SHADDASEN
458,341,359 *2E85B2EEB2DBDB0B579573105E42BD4FF54C4997 SHAIMAAASSEM
458,341,360 *2E842E88579CF2CBBCD3494899F09DAB8DDD0054 youaremyanchor(thefather'sembrace)
458,341,361 *2E84351AF02407EEADC1BF8FFCE5D175C2B3319F SHAQALA9
458,341,362 *2E84003C7CD19497CC4215890702EA8C80700865 YURIZ AIA DE JESUS
458,341,363 *2E8A85B340F83A64165B2426BB915F0CD5BBE3A3 [email protected]
458,341,364 *2E8A03AF7D3A3E450C09FFC027964BD65AD8E5F5 SHIMENDAM
458,341,365 *2E820A9851F7D44507ED2D9393E9DBE102064B7C ShortLifeandIt'sTrouble
458,341,366 *2E8075283CE16B5795662BCBA33290B2CC72680F SHYANN295
458,341,367 *2E89EB54FB941E7C086E4B9CD795C74CF47ABF99 ZAHIA.HEGAZY
458,341,368 *2E875380765F9F0E197F95C87D97CC74AF001C6A silvamatos
458,341,369 *2E82CCE5E6469EFFFABD5C42644D65CAA3CF046F SJÄLVUM
458,341,370 *2E8E1AB5CAEF063A906AE17C99BC27557455E68E [email protected]
458,341,371 *2E88856F1857E799BEE8B4B70E17E5A33F91ACAB skeetermisha
458,341,372 *2E8A6F3BCA1AC8CFFB1917DCE222A173C2FD452D SKYLINER34-4
458,341,373 *2E85DBD2404E05E2C086546F272AB8D0FDCDEE82 zippy.von.zipster
458,341,374 *2E86792B59D94C3815C98270FE1D38A47F501F6A ZNCLI
458,341,375 *2E8FFA811D00B6423D3089F9237C1EF06AF92309 τζανιδάκη
458,341,376 *2E86A23EC40B9C027CB758EFEF6700BE054521CB ЖЕЩИЯ
458,341,377 *2E85F980298FF519D151BB81343701020FA1D3B0 SPLOIT O~0~D###Q
458,341,378 *2E8CBB7B44136866B3EB146D298BD9577AFF8BE5 SPOOPYDAWG
458,341,379 *2E8F841347F2B24FDF976D3A5DCE09950592BAA3 sprats8
458,341,380 *2E82CA961C3E8E9E9D5087643BD5B15352BF65E8 [email protected]
458,341,381 *2E8DAC2353165E104800A0DC9DE1D0328398B868 SRCHUIGNOLLES
458,341,382 *2E80A7B9DC2805F34A1F8B3855235CF384CD65D4 ПЕКТОРАЛЬ”
458,341,383 *2E8A0167A40B3ED2315E10F0434CDA80B3EECE78 SSAKARBSWING
458,341,384 *2E800BA7AF4C46995DA4B7347F7387CE638742D5 ПІДРІЗНИ
458,341,385 *2E8ABDE370DE1B399FDE50CC919601B30FC84E5A ssehgnav
458,341,386 *2E84F6D1EDA6E7559861E39CAFA78E781538780D stephanie-cusworth
458,341,387 *2E888923B54AD37B85B6BBD154A413284221A63B STEVE.SPIVEY
458,341,388 *2E8B8C9D5C2643D015BFFC0CB5086A1F8436C4F3 STSPMNTED
458,341,389 *2E8822DBA97A37D53537769343EE09401A2A47E5 SUBATKA
458,341,390 *2E81282A5B74C6D8863300178644F51CECC1CD15 suicidelake
458,341,391 *2E877A2809BEA534EA7E24DF3CACB44C1709FDB4 SUPPAFLY8
458,341,392 *2E81C9BFEFE90BB6A3823B41CD01DF04213A06A1 或簡稱CA)
458,341,393 *2E8C0C6CBB0C90BEA5A97EE390969D1FA2FA4F27 TADHAL
458,341,394 *2E84AD807F36F2DFBA91450F585D06C7595D549F TÁMOGATÓINAK
458,341,395 *2E8BD1B5D73FAF5B17C1B6D5754DED80671CF8FD [email protected]
458,341,396 *2E874F371CB026C06957035D645A754CCF284CDE TEAMSINGAPOREDRIVERRACEWTCC
458,341,397 *2E8656B2594B0A5BE4A66E585806F4798CDD47D5 TELLME(AREYOUWITHIT)
458,341,398 *2E88175F0064532794D511FB0E7ADC1E514D5C0E TERRYBARRANCO
458,341,399 *2E804AB67D826B0BB3A9F4055A9561E3328BF83E terrybelhumeur
458,341,400 *2E829920B81BD57DE52A7F0F37C60FC4495E63FD TESLA U
458,341,401 *2E83FB332623878C91148E19E6C0B18897723459 07181629
458,341,402 *2E8CB9D67622C86EC9CF205EA912B3CA9B2C59D8 theogreenwell
458,341,403 *2E8972D3E4DDBBCC899CA6C4B1AEFBB19CD1EF73 things.unseen
458,341,404 *2E89BACE4121A721F6E5BB5362D44DB1244D91C6 [email protected]
458,341,405 *2E8F631E6367DD9E44DA5BB8793AE5E4B08BFC08 11151863
458,341,406 *2E8DCA5308E81C8AFDD2302CFFDB34176C08CB6D 121327tr
458,341,407 *2E85E2920275DA6DE661B4C8E2C69DCCFF7E4BEC 12345iguana
458,341,408 *2E8FA25794ACD3A93540A59D93EFA88D9A770BB5 TNEGERGA7
458,341,409 *2E837B6985A4DE75EB48289616C3479F3BC0C37B 15BRIN
458,341,410 *2E8046EBE8EF234C410274F4C8012ABE2CFE37A2 16TABLOIDSTYLE
458,341,411 *2E8D07BB32AA48EEC09209BEDD1115C3783B276B [email protected]
458,341,412 *2E8198D23A1B788982E5CC36D3057F537F0DFA8C 178891 asil nadir ingiltere de yasal meselelerle karsilasmisti .
458,341,413 *2E8DEC7A221E711C3FF72E466D232459A92B1E03 tomasduttinger
458,341,414 *2E8C3BE8E89074406038A52B89C6B7BAA9D7BFE5 Tomorrow(Voulezvousunrendezvous)
458,341,415 *2E89C3914AFBE1B5B6B6D7FD13ABF115CB134174 TOPARCBSWED
458,341,416 *2E8EEBB4BE89190A25268099DC895B06A6898613 totalitarianses
458,341,417 *2E816C685672F9E90D8BB3749D0E682871A59CB4 1alkohol-akzeptanz
458,341,418 *2E845E3D7AA8A2AB8F09BC397561E5663AA1535E 1-BARWERTVORTEILEN
458,341,419 *2E88CCF663DFCCC19FA3D741CB584381A9B6FC16 1.BUERGERKRIEGSUNIFORMEN
458,341,420 *2E8764D682C12B1B0B2243409FF3CD2E6750AAF6 TRATANDOO
458,341,421 *2E81DF0F860FBF25F4DA67ED241231250FCCD743 1DATACANA
458,341,422 *2E816E1CC8B5E0A64F9947CAB643CEA6F9B033A3 1DUHANKESA
458,341,423 *2E85D2F813D3ED126BED966519EC45F539A0DA4A treated
458,341,424 *2E8AC2D4D96DF961B69000CCB6860C82510DDC0B TRIPTOTHEBOOM
458,341,425 *2E8FDB91B34FD7F89DFFD2D54CB6F01F3ECB4A60 TRISTANBARTEK
458,341,426 *2E881589597A516D0C6F7B1D8D2FC5978D35B790 1-heimovirta
458,341,427 *2E80F45240045312C4A3992CCB79E18AE5FC0232 1-hiotumpi
458,341,428 *2E828C21DEA7DCFAEAAA56A3659A36F52B4B6272 1.IDOS'A
458,341,429 *2E859AB465EA8F3DC61B4420B95847D4677F163E 1ILOVEBIOCHEM3
458,341,430 *2E8E54A3AD52508884ADA11F1E265843A56CEA6E 1internet-selaimissaan
458,341,431 *2E8855775C7DF2D22C6E2B676151EDCA1E7D8B01 TTRBRNCH
458,341,432 *2E804D8AF228957EE172F0493133587D4B2AC06B TUNNAMHU5
458,341,433 *2E819D3C9147086135EB9E3AEFDA5533C3F5BB6F 1-kotimais-ten
458,341,434 *2E819B1FBA473540D36FD625FD4B5E334B4CFA2C TURKON.BAKEY
458,341,435 *2E877EAF9F3F3250D98E624EBD612183920FC8FD twandarapose
458,341,436 *2E8A21024F9BDEEA6F062CEACFED7D5C07396648 1PUTINESKE
458,341,437 *2E83F66909B1B9C16EF8B1527774B2688E445237 1-QUOTENZENSUR
458,341,438 *2E81BC35874920C527E5D6276555D2D6476B0688 1 selboss
458,341,439 *2E854CC7A6770775019E8DE24EAD2B7ADB65D9BB ugevi$t
458,341,440 *2E844203271C5E1E7AE59496C4576E1954DDA37F 1tagesgaststaette
458,341,441 *2E844884E7C3B02DF9EB45B0D86D855F05BF3E02 ukcraju
458,341,442 *2E8B6987E47B9DB0595E33F628043CA0170AEE88 UMILDJE
458,341,443 *2E8E5F8E4FCCAB05F880AC86A5E054636963527B 2073958 SINKKI.EI.AIHEUTA.MUTAATIOITA.,.SY
458,341,444 *2E8BF9A07F4EE0A77A4DE76A6729D5BACA9B24A8 2087415 TANKS-AUS-NICHT-ROSTENDEM-MATERIAL-SOLLTEN-LEER-SEIN-.
458,341,445 *2E8283B299D08CF2FBA82CD3DE9F69EB23C9CBD8 20itsehallintoalueen
458,341,446 *2E88D20DA8EF4D66B8782C925997B0D87CE07CD2 2108539 kieleneriosatreagoivateritavoinerimakuihin
458,341,447 *2E8FAD973A49BE64FBADB2139CDBCA327059CCD0 UPOZNAO.2
458,341,448 *2E8289F64E199412D9633ED8AD93BBB91B3B16A5 USERBOXESAMERICAN
458,341,449 *2E839BE95875DAB957DE731A84EC2A00C7758CC6 2188326 JOKAINENIHMINENTARVITSEEKULTTUURIAITSENS
458,341,450 *2E8ECC07434ED16C581CA36A4F9EA5647DF6057E 2×250G
458,341,451 *2E89CCB58387061A8FD979C7D94CA9E04D6044E2 UTFORMNINGED2
458,341,452 *2E8F0D71B12A0B73F6350FB4BBA20742B67B2487 uttaravasavada
458,341,453 *2E89E973E9BB3F84CA275CE984E581EE8AA5ABE6 VALORIEFRACTION
458,341,454 *2E82C94E2BF5621B5423CDE4D68CCE5A2B857857 2683085 alkukes
458,341,455 *2E84898F5264E9C15FD555324A057BD81813176A 2695167 PUOLUSTUSVOIMAT OSTI KIRJAA LIS
458,341,456 *2E88551B4AE97978DE157481C490D21AEDA7C7D9 2747301 ASUKASOSTAAKAUPUNGINTUOTTAMIENPALVELUJENLIS
458,341,457 *2E8E9AB2FB88355CA8A4BBA1322453224056F760 VASSILIS MANOUSAKIS
458,341,458 *2E848C4145A3C832DA188DB1D2D12DB1E3D9602A VĀSTRIIAĒTA
458,341,459 *2E8D1E0D4C12103DEB4FA254B10722A235A3CD25 29conor
458,341,460 *2E8586085755ABF1BD55C74093736CD368FF1231 2ATINATES
458,341,461 *2E8005FC6A7435088BC1D1B8D9F6A1AC4E6AEF36 2DUCETIS
458,341,462 *2E83E2B8F0AC50C1680B4BE054DE50F3D15382A4 2.EU-PREIS
458,341,463 *2E812C3C880EA5439F51F8C1622E29DE22388EF8 verlekkerde?
458,341,464 *2E8005124145DF6B41F3DF515F5925EF262FB70A VERWENSINGENS2
458,341,465 *2E873666B370DBA58E6ED342B521905DA4BB0621 2PRVNCLLY
458,341,466 *2E8CD8E208ED690433D7E19D8B7E30E5C763D014 victor.vanysacker
458,341,467 *2E8F7FAB65CBD30EC268B88B4F42A6EFE41E63E6 VIERLING3
458,341,468 *2E8A719AEBDDC9651D0F656A6D59454F5D40A309 2-titannagel
458,341,469 *2E85939769D40C391B09B8FD91FFB3781599ABDC 2-veikkausvoitto
458,341,470 *2E8F8A9D3582BCC7DA8EFE2DF9AF45FF402CAB35 VINCENT.MALAGA
458,341,471 *2E8FB3866C78013283C7ABD1A52604C6ED5460B9 vinczeyoo
458,341,472 *2E8E8A8D7365308E05AC92850D2AF979394FAC8D 329cade
458,341,473 *2E8B887E1F5AD57D6854ECD96E11A0A2B9BAAC0B VLASES
458,341,474 *2E8A8CF6EAB30D0D5B94BFBE2DEE9B5F906BCF60 VOTISBSW
458,341,475 *2E8C5389751C1EE5D78A4F318E44AA0BEE6C6F9D 3MALADMINISTER
458,341,476 *2E86B217C7555E517EA62E8372A144D54474CBC6 VYVINUTE1
458,341,477 *2E86B74DB3AABCD2730BE09D3F04E9B74AA7A187 408CIARA
458,341,478 *2E88DC2AD7B7B633BAA3C1A9D7902AC947C2EC81 WATROBY6
458,341,479 *2E877CEA5C6F22BD36FDE0B862151692C82D9586 WAYLON.MACCARTNEY
458,341,480 *2E8820235975E460A1D1CF6E5441A6770AC9A387 WEE.DIOSO
458,341,481 *2E81C43528AB8AE687823C026970733B65886575 WELEDELGEBORENE1
458,341,482 *2E8F2B478EFCE94DF20DA05BC570113E00104900 4CRANACHSTRASSE
458,341,483 *2E804CFB3C07EAD49797933721E33DCE115696C6 4DROWPIT
458,341,484 *2E8211007730A60C85A3BB9C7A1EF8BD71AD9BC7 4FQJSTJMT
458,341,485 *2E835CEE506C27DC352063B450CAD3DE566E5925 4HAROLDCHEVY
458,341,486 *2E85B3901CF7B2599AC6C0FA9E725CCC0299348A 4.HENKIL
458,341,487 *2E80F99D70FFCB73A29EB9AF11C0F797147B65D1 4MATTGOALIE
458,341,488 *2E8D7F5CEEA1B9F27C3EEBD95943B6EF180F59DD 4MCYTOLYSIS
458,341,489 *2E8514906284B0A01B78BCD3EDFAFAAF581E9CA8 4MYPARK5
458,341,490 *2E8090C3489BDFCF1A4F3C9810C22B2A15462520 4-P
458,341,491 *2E8C4329FD5A6A3F7C15E829901CF6ADA976F4D6 WHENTHERAINBEGINSTOFALL(MEGARAVS.DJLEEDUBREMIX)
458,341,492 *2E8845602F260AAF8841CF9347699C0134A32EA5 4WALTERGUEST
458,341,493 *2E861C7E0ACA51B7369C73BD6788ED0327E85414 4WHENSHEBACKSUP
458,341,494 *2E8FF0E58CA409B4CC03C79E3423A2BCA1CE0AA8 WILFREDO.REITZEL
458,341,495 *2E85CE4822633F388CA01D9D841E7EE3D5FF5AA5 william.fowles
458,341,496 *2E8E4CB9DC06775355AB780E143B172A2EE35D18 WILSONVITUG
458,341,497 *2E8C09102AB36C3046AE7B4F71EF94CEDFEAA4DA WINGTINGKAY
458,341,498 *2E8C759A60AD2BDC9AA6D6DF877D8626357DC832 [email protected]
458,341,499 *2E815A70B294FE71C393E5A2483238060457270E WORLDWIDE DISTRIBUTION CENTERS INC | BELGIUM
458,341,500 *2E8DF70682897900D34CF7FF022220A553A68A90 [email protected]
458,341,501 *2E8ADF8A0195020E5A401FA63CDA94AA6793376E 5COWBOYTINMAN
458,341,502 *2E8F8CD6AA4D68BEDD19A6CB80FE6BC25A7B10AD wries.
458,341,503 *2E8B0A08B6833101C905CBD5A69C9E5408692371 5JANICEBOWLING
458,341,504 *2E8D19738656DB0B53D2FBA36EAF352DA6CAB5B6 5KKESTOEL
458,341,505 *2E83F3816568A9935F7979A82142C8FFA0CDBEB7 5REDIENHCSNELLID
458,341,506 *2E8A6366D7EAC54D02C4F2F9DCB56000D6786CD6 WY6WVZ4C
458,341,507 *2E8A620912895F8BA4AC442148DA683BCABC1E0F 5WHOREBAG
458,341,508 *2E85E89BF41E4DD6F47FB970C141C7DF6E2395E1 XUOU
458,341,509 *2E8AD2AE75003DC9DA7777BEE6931C4C9B9F75AE [email protected]
458,341,510 *2E8EB88C63406789C045D60F2DB2F64E5DCA5ECA YABOCSID
458,341,511 *2E89CA5F8D6771CA962972E725D917562289E106 yanjie.chu
458,341,512 *2E8BB54532F761E029E36FE5DCA8228C523C4D20 [email protected]
458,341,513 *2E89B13CAB70109F9A08CA4EE3FC8DF9807AE5DE yap.hong.jing
458,341,514 *2E8444ABDF26C901549C4315F850A876E04A8DEE yarumaling
458,341,515 *2E8BC3818D6D84C594143C11F8E57A746308675D YESENIA.ALVARES
458,341,516 *2E87F6B327DF69669BC44F29CCE08FBF0C5883D1 YG|D
458,341,517 *2E8C9F31E7FB91022018376E4C7A7F3396E52322 6HEIGHTBITSBSW
458,341,518 *2E876E7BAD8B76E8DB2262E7262B947209372CD9 YOM"
458,341,519 *2E8FA4C774C9B227963AF91C193BB562E0468A9B 6IMIJALLA
458,341,520 *2E83B76E553E347BE976422CF19C82EB5B8A65D0 [email protected]
458,341,521 *2E84857D974CB8882DFBE723464552B5ABD0095B 6KINESODI
458,341,522 *2E8009CE90B6A9DE2C130FAE9E96D01F3C719D55 6KIOMETRISKE
458,341,523 *2E89526B93109A54E43DA0D5AC14FA7E55F68ED7 [email protected]
458,341,524 *2E897F4A3B0DC0EE4024A694C29B7C7E24A43E20 yudochun
458,341,525 *2E8CE3307F38B954A1DB0C95C7D2228964952E49 [email protected]
458,341,526 *2E8E6BDABE7CAF16699E2B6D0732DBA932AF0382 6PERJUREMENTN
458,341,527 *2E868AD0E741D731A11EA868D77EE54B9E4E91D1 ZACHDILKS
458,341,528 *2E8F322240A026B9E6BA52E96EC5BB5585BD6AA5 6REPROCUSSIONSBSW
458,341,529 *2E80E834A515D0F704584B7C661336A19D9EAA55 ZBI3
458,341,530 *2E8202A94476FA11993DC288A298743AEF821603 ZEPPELINMARVIN3
458,341,531 *2E853C6114D113D104830F06C15A5FD26C384BCD ZERAWAGGONER
458,341,532 *2E8BAC257570A9B5D1DC9B2A1BB3A5CEFD136939 [email protected]
458,341,533 *2E8159AAA733F1A2EB877961455C7808D01D5A40 [email protected]
458,341,534 *2E8CD0FA1F824B91854810599E9DDF3612F277D6 [email protected]
458,341,535 *2E8EE14EF0013C315B82F64CD6DA417A27DB40EE 6TWNDGHDN
458,341,536 *2E80DAFFD41AB1DE1E1DD491C822CE64D2A10E35 70P0GRPHS
458,341,537 *2E8567AB188D66E42878C20D013E83D28CB4C776 766sandra
458,341,538 *2E8BACFCE1C4B9E5FD81A8AB138BAF14317E39A0 7AUTHORITYVOCATIONWALKWALK
458,341,539 *2E8E8112EB98ACE69EA6E251B25DE024D5B597D0 αἴσθησῐσ
458,341,540 *2E8E353FB30329E610A5B102F3861926708621CF παπαδημήτρης
458,341,541 *2E868765354BC95BB56A7D0E0A13BBC71447EF3E АНТИПОСТЕР
458,341,542 *2E87B17253C6A214138FF41874D451D25E77CFF5 7BOOTSIEBRIGHT
458,341,543 *2E828565A2DC5B0029978F7C04ED7317E335CDF4 ВЕТЕРИНАРСКИХ
458,341,544 *2E84D5D1DEAA877E970411C480319A9F5409B446 7CHITINOCALCAREOUS
458,341,545 *2E8EB3464E605AEA74DCA999E25F21F839809CD8 7KNICKERL
458,341,546 *2E8371BE0312B063C3A5D887611E84B9A3AB8C86 7LIDIA12
458,341,547 *2E8524BA23469C3C9C0E0FDBC08901D28E7B4CD0 ПАРОВОЗ ИС
458,341,548 *2E8E450C174D12BE51D8E550FDCED63A603B2A4D СПАЉИВАЛИ
458,341,549 *2E88BDD30290CA21445D25A97B5719BC6D3A8BF8 твердих
458,341,550 *2E888309E7F5D911129209262FF02C37AE6DEA7F 7WATERJASON
458,341,551 *2E85F824A6B5EC1A97EE398E437C5E2CBDB1784E 7YUGANDHARA
458,341,552 *2E84320784D2D81C3914AB122AE129DE32096631 844366 FARMASOTIK TEKNOLOJI ANABILIM DALI ELEMANLARINDAN ARAS .
458,341,553 *2E8D3A3BDAB871258467CB1172BE0A60C7BC833D 863489 SIE MUESSEN GEDULDIG SEIN
458,341,554 *2E81A2A9374EA738A59B15840AB11D5E1AEA15D0 87DABB90FD0AA0A394CAC634B9B8FC79 LIAM1997
458,341,555 *2E8769599F4DD2EF43BD42B99A077D54565CF8F2 8ALFREDSQUIRT
458,341,556 *2E8E53F05B8791F0AF95B4C43AEE07670B0A25CA 8bemantelde
458,341,557 *2E82676A3232B4C4A24A519A77C4FEF63DEC0993 8EARTHENWAREN
458,341,558 *2E8C7B56EAE163FC1E5087F4DFC08EE66E58A273 8EDNOLAL
458,341,559 *2E8E8219D01C0ABE7B7BDE9B11DB3A443166D8F7 8GROPERB
458,341,560 *2E8B58D417D5B3EEB0D8977C7AF6BC7DD3A823D0 8HUNTINGHORSE
458,341,561 *2E8A3F5AFF25676A44ADCBB668747059BB57FC1C 8IAREDOMMOCNI
458,341,562 *2E8868BB574326050A4E6839466A9F214ADFB8DD 8JAHRESWELTBESTENLISTE
458,341,563 *2E892230B432AEE0FDD426C2D4DEE73D4F7C4F67 8MACINTOSDASHA
458,341,564 *2E8A3D048022A1157041B39BD7698D8F6C858454 8NIRVANACHAMPION
458,341,565 *2E8E0A87680B9C5292B5FD3B4578DC756BF0C03E 8NORMENPATROON
458,341,566 *2E8A892353764804882EFC7F9BC7E12472E7AE06 }8{[email protected]
458,341,567 *2E88765057B0031D0447C009EE482C7A8B42C46A 8ROZEZPIVANIMI
458,341,568 *2E802AC686AFC34269C21C8A10F1DD1765C5CBA7 8THREETIERED
458,341,569 *2E8D8E28126CB8BDECE730D31B9414E62CE4D7BB 9FREEDOMIGUANA
458,341,570 *2E8CF8AD73EC3CE05FCEAE030570F1616AB2BFAC 9HYPOSTASY
458,341,571 *2E8F5365C1FAA663B1316DF4589D206470860CE5 9MUSHIGAS
458,341,572 *2E87467FCCA443BBF5ED8AAEA301E42D62634190 9ODAZVALA
458,341,573 *2E8E4047187B0255F6D8946EE5154DDDB1479F5D (0-0)~(==p
458,341,574 *2E8166B1F943F7E3430A262F78D72192ADA24436 03291791
458,341,575 *2E86F6112833E5AE80F9989A8F74C165E4BE1A70 9thestingray2
458,341,576 *2E871A2216DCFD6F5F4106391D21A04751B60221 9VEILDEVEILDE
458,341,577 *2E8AC0D649B553746D0447A32CDC3C85BFD9740B 9VILIAZHC
458,341,578 *2E87451ED601BBABEFBA8C2EED51E2E0F953D9AE 9ZXCVBINDIAN
458,341,579 *2E8CDEF14B65D43B1AFCE584078B3A1E9F84692D A?%
458,341,580 *2E8B10B59FF55555517386DBB40973552A4A0C91 1264941 aineistotovatk
458,341,581 *2E8B496307F9D9273A299F1ADDE44CAF8536BD43 Aaa7
458,341,582 *2E87AEFA44F5336187723490BF9CB93885E4FB50 aaaz7g
458,341,583 *2E8D35460A989992083713FD9F23BFF7427BB828 AABYHN
458,341,584 *2E8649DC7E865C86C34FD707DB3A739A8497FF44 1488214 THATFAILEDFORLACKOFAQUORUM.
458,341,585 *2E8DEDC619D65E276D2612BD854AFDF0A92A929B AADV5H
458,341,586 *2E83F86576B6CE20295705A1DE146BB5B41AF228 [email protected]
458,341,587 *2E8AAAF1E8FD2D476FA4A1633A399AF80E42B25F ABDULLIFF
458,341,588 *2E898D3C6850B265007DBF2E0198D3CC2F3186B1 ABDULSAL12
458,341,589 *2E86BF7426B601B0E4870D2E63D284C06226C743 abzuschwachened
458,341,590 *2E80F18262899F8DC6523276763FF3CDCFC89CBB A%)C
458,341,591 *2E86A5608215627AB6372C3CBA7229A778EA7E42 1 AUTOBAHNGESELLSCHAFT
458,341,592 *2E8A68FAEC6A6AADC5935E2AA158CC61A2C602C1 1BROAD-BRUSHING
458,341,593 *2E8EA9CF3C72D3DA266B8B18980506BED123935D 1CECOMLAD
458,341,594 *2E84F0DB7FF60A3908D061E3E0FD3457050A9054 adi-kh
458,341,595 *2E8AB4803F3C6BEBBBF38F4402FBC6B4C5C76912 a%dmw
458,341,596 *2E8FD1FAD1AD570256B62F7703FDF876848F072A 1ERLIJVEN
458,341,597 *2E82418A2D617656F52973E5A3270350BE3280DB ae/ad
458,341,598 *2E8B4B6B168473276F1EA379F219194FB74234ED A.f,
458,341,599 *2E8DAB346EBACB3E49A13FB47304E4C083FA9B1A 1.hotellikerroksemme
458,341,600 *2E8F400EDB6CF359D01017178E6EF929759B4329 AFFCOME
458,341,601 *2E838E30A19F67160FA75D8EA9D94BB36A9509CE 1.IRVINGBERLIN
458,341,602 *2E87DD69C7102CC6FB2137F71402EEEEE028044B 1kongress-beitrag
458,341,603 *2E8112FF152FC3DD628DDBF094EC5C7CD22F3683 1KRISKOH
458,341,604 *2E8C957EC7F3A5F3538EC42ACC3200C328D59F82 1LAGUUNILLA
458,341,605 *2E89A467200D8DC968796A5F5E55F545BF2C0BC5 1.LIZENZIERUNGS-VERFAHREN
458,341,606 *2E84D3E9E25AEB7BC36B7306B828E2E57BCFD9FC 1 MAJKARMA
458,341,607 *2E80119B09C78AAEF06ABB4CF9123E781C9000D9 a$ft?
458,341,608 *2E891322A776FC9842ED4E83D311BA01FD4A2DE9 1MONSTERMASSE
458,341,609 *2E8C32432880CA40B23B03E91DA885ECB02A5CDA ag9hk
458,341,610 *2E8B21EC27106D64ADEAD1C8AF2FB9424A830B63 1 QUALIFIKATIONSREIFEN
458,341,611 *2E8608AF23FF72A90F538AA8619790681D2DE366 1REFOORP
458,341,612 *2E87B1C6EBCCFB739D819B8164842722A2FBB405 1 RUNOKAHVILAN
458,341,613 *2E89601BFB5CAC0E6AE150016F12BB98AA40B58F 1sanjosespanky
458,341,614 *2E84FF2ECB5599CD19F6975D712132B4DE40CD74 AJZ37
458,341,615 *2E8C34109F2320CCF4F058AC560550B85B620242 a!k59
458,341,616 *2E8CA088AF141D3AA0093A5D2040ACDCD62C26D6 AKIRAOKABE
458,341,617 *2E8D29130A2D43540E69A4E103512887A71150C0 ALBERT.POLADIAN
458,341,618 *2E8C7318D4F735B9DA782049FA265F60E395EF98 aldogusa
458,341,619 *2E83E12F372A334AEA6FDA086FFB2C84B359511B aldoisam
458,341,620 *2E8F6055BE12F5C820999F8D910BCE13579BEDCB A-Le
458,341,621 *2E8A1F1D5AB253257C9655081EE1333C7F5CB8B2 al-khan
458,341,622 *2E81E5002A6AAC6C7858D75124C1E05AE0EB05C3 alyssanotused
458,341,623 *2E88A96680545028AC2AA6807804767AA22F2B94 A:N4G
458,341,624 *2E8C4EAF244C64DD9C8A245251FAE244E8CB58E9 “ANGELITOS”
458,341,625 *2E8A63F4B2DAC0EF7CD3A3285ED6A2DB91068D4A ANTONIA.KEMERLING
458,341,626 *2E887A73FDD1B5EEBF8AB5C58570B567118E7D86 2BLESNE
458,341,627 *2E81EE14B06B7AB220672427AC54CE82981CFC30 AODRE
458,341,628 *2E89D01606F9520DFAC4538D90C4EA151581C3F2 2PDGNSTN
458,341,629 *2E8D1BF81AC1B436AC9F1CBD702A92FA6A240AB9 2roslyn123
458,341,630 *2E86AEF5381563800E63492A28D8EA42CDC2A87C 2-spritzenbus
458,341,631 *2E826991B363C2C64185E32DC7C174B1965484D8 2VILKAARLIG
458,341,632 *2E8DEBD0672D34063C9377A6CAC57123FA28FE67 AROMA-DI-AMORE
458,341,633 *2E88117F472BF20F334EF889670081CF88C4E21A ARON.PATIENCE
458,341,634 *2E8C61E82EA28F38877854EEC43493403D8B3A5C AROTZENA
458,341,635 *2E8C05B25994806B2F2C312F3F3D9DA9D698467A 3216S
458,341,636 *2E8663DEBF729C7B935F33F276A298603141B0F7 [email protected]
458,341,637 *2E88034F8832B28B2EAACBFDA2435B498802816E 368511 ASIAKAS-VASTAA-ITSE-OMAN-TIETOKONEENSA-,-TIETOJ
458,341,638 *2E8C41ADFD2A329BD06BECB3EE2BEE5AF3962961 ARTCEOVANTES
458,341,639 *2E8C126C5320D5937B0037C9D430DFBF2D19AA48 arttl
458,341,640 *2E8BA9C18E42757FAC187BF6EB7A81B208FEE84E [email protected]
458,341,641 *2E8A545CCD34C897713548A30C51E145DE0B8447 astrophysics10
458,341,642 *2E80D4738B6EF62C2A555DB3C30FC33E36AAE8A6 3GRAVAST
458,341,643 *2E8D3C9A08E665AD089D4984F43E4654045F40E6 3HESSELYN
458,341,644 *2E84E56BED5F3789806F248DDB942BB63850171D atj;0
458,341,645 *2E8E983BE316FAF687C7BB5ADFE99B0B12982F1C 3LAKKOPAIKKAKUNTIA
458,341,646 *2E828868E55052C23A3F499304A044C749E5745F A:TPV
458,341,647 *2E88AD688E7A7D9F390734C3004EC819860ED4B4 ATUGARAN8
458,341,648 *2E84819B3BB982B45CF993BF3BDBD4EB3CD82065 AUDIT,FIELDAUDIT;CHECKTHEBOOKS,VERIFYACCOUNTS.
458,341,649 *2E884B32182295B22A693BE12EF017F67E2D6006 3 METALLPRODUKTEN
458,341,650 *2E81B3C3600F69B5C57F85B0AA8D6920CC8501C7 AUGUST.FENTI
458,341,651 *2E82C4F6D20AD14A870604F070EA6AAFDC18BD05 AUGUSTINE.FRANCESCHI
458,341,652 *2E8BAF2B5747E4AD4B9A98027B938B6FBFBC4868 3===P`~-(-_0)
458,341,653 *2E8F443F1D84D22CEBCA2B8F2130A39AD0E7AC15 3YST
458,341,654 *2E85CCB56A889DE27B4EFA7D2A8A9E2CF6C30FAF 43596 paperilla sauvosta l
458,341,655 *2E8138CC28B49829B7FEAB0E886AA3D85B2486F4 A.WITHER'D.HERMIT,.FIVE-SCORE.WINTERS.WORN,
458,341,656 *2E86B6C3681F8D9A13685FFFADD3F80D6EFE6410 AWLI(
458,341,657 *2E8C05C3439532FCE25DD383E9CC7A64D3FF435E b3/la
458,341,658 *2E885E83DA559BECC066B23E0CBE6E16F4F197EA B6R
458,341,659 *2E8A6872C2B68A1AB4B743851CE51A8E77E83C03 b7cly
458,341,660 *2E8F88016E52C3F0882941DAEDE522ECAD4A1F0B b7q%x
458,341,661 *2E8525D8DDEE960B56E185C4A5A6544B258C4CF5 4NAOMIQUEST
458,341,662 *2E869399046C768EA0CA70177F879C248CD85A18 ba=-_
458,341,663 *2E8360174B50F12B2DADF3A57C69D4F0868B3C7B 4POTHOLESES
458,341,664 *2E85EECBE93EEB6C807D7559957684D16931F305 4ROPINGSHARK
458,341,665 *2E8D4A86BD2DC847C2C11ED94C5498E7AC825D9D 4SEJRSTEGN
458,341,666 *2E847E5BADA4C6EFA2B69DA2D3EE3D5FAF346E80 barbarasoto
458,341,667 *2E8AE8031821CAA69C2BA563434363F759814FCA 4TIAAWAL
458,341,668 *2E87A88F782E98D083827432F9F2D0CD78A6C274 BARREEV
458,341,669 *2E8100835DF23DE604FA8D1A0D29C988F3AD0E3E 4-wuorio
458,341,670 *2E8DDA3F79051F9F9E7D0FF128819919B8BA7068 508364 hastaykenyanIndaolamadIm.
458,341,671 *2E8AF38E2D4E613D061C48704D1B0393650D0EBA BATIHSIN0
458,341,672 *2E8E0469284600F3ACBBA9F6FFBED60F8A43B4E3 bauarchitekt
458,341,673 *2E82FE29C61AA26345CC9EF032B46C7FC2E43290 5ALEXANDEANIMAL
458,341,674 *2E8491DDD28E04FE29956AC1EF645F56F03A4B73 B=BW(
458,341,675 *2E897629A6F17CC7B57DD299516D9841888E4326 5ILUVLIGHT8
458,341,676 *2E85E92F57603DDB90774FDB7F53866112206697 5KISELESKI
458,341,677 *2E822715583F53A271251345074340DC72A514D0 BENTON.PAZAN
458,341,678 *2E80F507401F7AF82BC6DD3795A8AA7B9CBBDF90 5MISSYWATSON
458,341,679 *2E8B56D68814BCE72F4859061566E1676A7603F8 5OPDRIJVENS
458,341,680 *2E8F3A3F12103A08746F61671536BB85A8EA69C1 5PROJECTIONPU
458,341,681 *2E8C04C9F6EF48C83615D5F5603D6E6BDFD3FC39 berulous8
458,341,682 *2E8BC338618BD96E84AB2D589E2229470E83DD02 BESWYLE9
458,341,683 *2E8CCB382FFAD6317BD521CF5C2E0979F6367E79 BEV9T
458,341,684 *2E819DEA0C54D740A92E08CF37FEC69ED7D7B98B bf+a2
458,341,685 *2E85DAB8F41E2BB9C09F86975701EE561B262623 Bgp+
458,341,686 *2E89E7AB88E8BC01887144481BC6C71E89CB87C7 6.DIMLY-LIT
458,341,687 *2E859EB5B69D4AD5FFA5125E20F93E564130BEBC biv7)
458,341,688 *2E85415168E1CC9E26277A12F537E4D59786D724 6FUKASINK
458,341,689 *2E8376F0CB9C805E061EBB1FDD2EAF4DFA90C1E3 6GARLICSCOTT
458,341,690 *2E800616507CE37AFDAEB65E269D35FEF37E0962 bktmi
458,341,691 *2E8B56E8227C89BCA64442BAD5B8F5B9043766FD BM03E
458,341,692 *2E85356A6897F311D9E4F9EB864542678020D498 BNXW
458,341,693 *2E8CEAA02AC77FB92D6023B7309DBE76001597A8 BORSETOVA
458,341,694 *2E8D3E451C6D336620B1DA80B9A7285276E291C5 BOURDALLÉ
458,341,695 *2E89FEDF5702384F232832D503EB3222358C28D5 6ROSIEZEPPELIN
458,341,696 *2E8D4852AB8C7090AFA92D6406D321AA1A691900 6SCENARIOSCHRIJFSTER
458,341,697 *2E8E263E26110F0A4C0D4B463AB345736215AC9E B)PDP
458,341,698 *2E80EC4F6D22C2AC27B4CCC50710CC13F798B1A4 BQ+E
458,341,699 *2E88A0067ABAD4D84890531CC7BB167A3B11365A 6 YL
458,341,700 *2E861C8B919D69924A1FE8D14EBD6B833ECDBFA3 BRAGATALKBARTHOLOMEW
458,341,701 *2E8BD12CEA8FEB7AD93FECF9A4BF6D9FD6186A1B BREDOUILLENT
458,341,702 *2E8ECBA7FC2C76F4DCEF479B901CE97965E33260 brian.thao
458,341,703 *2E84647C232BDDED18CA6D4399FA5CE99F68E5F4 7ARGOHTRA
458,341,704 *2E801CA3036C8754D81A165685B5423E6EA7E521 B#(RM
458,341,705 *2E8F04F0E1B6906BFFA5720CB81B20E48396A562 bsa5/
458,341,706 *2E805C33D4E25270E996A7A515ACBDE875DC2A40 bswtikvahbsw
458,341,707 *2E85FC15674B454D3E5F924AF6A6943CEB483334 BTYRPAK
458,341,708 *2E8CBE9C4746E5FA24481F384FB5083E7B9D131B BUKSERRESKUB
458,341,709 *2E8D97B47564052932A5B98CB74B16652AC08065 buslegislationguidance
458,341,710 *2E87C69A92E2833E2DFFE52406D3D33C3BB9BCEE 7EINSCHLAEGE
458,341,711 *2E8822492AF45B07B0F72C7418CAD3C0D8B0A127 BVN,!
458,341,712 *2E843D416E82DB62DCC76488F9274CA04540D80F C?%
458,341,713 *2E8883E17859097102CA1D5796BBE6B93CB60609 7SETTAFNEMMAS
458,341,714 *2E87F58972E927F4BFD31701899BFA4BFD1818BD 7TAANIGAP
458,341,715 *2E81D9871FAB3DE3DA72BA6860C3B599F1115E49 C3=RF
458,341,716 *2E84C893FFE7A1B7BE2F065CD9478932852A1684 8CHICAGOPACKER
458,341,717 *2E862DAA9D44644A5A8034C2F01A3254FC18971C 8CHORIORETINITIS
458,341,718 *2E89C94D85C3CDA2FA60A0A339A1C9E837595D01 8DESNUDANDO
458,341,719 *2E8CE993777A014EECB53DF216C7BD7935C34813 Can't.Wake.Up.(remix)
458,341,720 *2E817A37E783B05C9A1EE5A3162E0352B661B52D 8------d`~`~(o_-)
458,341,721 *2E8A46A01090739E02E8CED65ABB8150F5F19EBC 8ECTOCELICS
458,341,722 *2E803261E1429DC6AD2F9ACFC676ABD7E91695FE 8IAMBUDDHA5
458,341,723 *2E8574C84796DFF0EBC8DB560410C80E1883A683 CARLTONDRINSKI
458,341,724 *2E803637809276BCEE04F9CCEF413BF3E2FBDE85 8NONEFFERVESCENTLIES
458,341,725 *2E853CDAFE2B9F9B5083C16A2D89487D9DD0CBD6 [email protected]~O ~OSPLAT
458,341,726 *2E800C683C4F0C393A16BDAE389CB36BFF9743ED 931QUINTIN
458,341,727 *2E8347C4B6D4514483718E46B5D98C8E0ABE138D 9ANTIANTIBODIES
458,341,728 *2E8A8648B7A8BFD5E0DCA6825BCA56162B62F44D 9behinderte
458,341,729 *2E8A7E8AEB682FD2BF5CFEA843424FB5770103AA 9COURTEL
458,341,730 *2E8C29C05069764C4440731AE52C7492F1368E6B 9DECALVARE
458,341,731 *2E8E10E1D85393C8BB3BBCF7C81027AF576242D6 9GARNETCONRAD
458,341,732 *2E81478F6D33E9240082C5B2656463658D5A81CB cfg:x
458,341,733 *2E8204581F0FBD8B40ED199D021CAF54D49A385A cg9+g
458,341,734 *2E8E2A4556FBF310693A2B07B4F78A3E4540F049 9OKABIRAH
458,341,735 *2E8195632149CED448FB6E4D7CBFCF3F7E84B996 9RIBSTOOT
458,341,736 *2E8857B8BB09D86C6379B638D1FA142B0B9CD969 [email protected]
458,341,737 *2E8A1A8DF65A1471B4279D1ED7B9896C8C52DDF6 cheppingwycombe
458,341,738 *2E85045FFE17C89FB8022CEE03B70E0EC2876FC3 a#%)-
458,341,739 *2E89B383373B1F8D12BCC69C6573E14DA180BE22 a4"q
458,341,740 *2E8FE9750E58A2ED7C0F5B01E651C923AEB7908D chip.trick
458,341,741 *2E80D6CFB40D344B999377F82792B59B58E957E3 CHONG.AHRENHOLTZ
458,341,742 *2E81494D26A45A1BB962CF6DC7C96E59255217F1 [email protected]
458,341,743 *2E8675C9C778D6190D2AFFE2439AE98BC33B19D6 a"be
458,341,744 *2E8A5F97C3C5A0D2F5D8F55ABB3517428597F1F0 CICILYJONES
458,341,745 *2E8E04273323CEDC9168E81CBC54C3DCA0AAC0D0 ABRAMNEWITT
458,341,746 *2E8092445F18F31496537498C934C6587B8C04D4 CJKV"
458,341,747 *2E8661A580E4AE3CC7BF69D082783B357B1E1FEC ACKH_
458,341,748 *2E83852FF97527696A2612096FDC8F5A3BC8BFA4 cleanermidori
458,341,749 *2E80FCB423181EF41AE297595168E697145DCB62 C(LIG
458,341,750 *2E8340C3A7F2FDF4BC6CC9BFA410F1E9F5F59E05 clmg_
458,341,751 *2E88092E6F20EC82B747E5FEB0BC125519BDD36B clowtes5
458,341,752 *2E872A5D4EFD1C9BA76A86D7E84A581A5CA66322 COMMUNERAS
458,341,753 *2E82D4E0EC1F12FFB9CD0B7C89579D66D6D074BC concertoforoboeandviolinincminor,bwv1060:iallegro
458,341,754 *2E868020B61E3A51E724BEB3182BAE3B99A50184 agtdi
458,341,755 *2E80181439ACBA3C66B3ED5816FBAC6BD3566856 CONTOURNE2
458,341,756 *2E81F920FF9D260D724B21F19C6B4F9F2348F31E [email protected]
458,341,757 *2E80F1A8CB0D2D83B1F5D374F6B046AD67CF4148 AIRIZAMURAO
458,341,758 *2E873D9EE91748A764EB383AD83C28A29BF1083C -AIRTENDRE
458,341,759 *2E8AB894BC8E27E4183AF5687BFB8057BACF5253 AK4298
458,341,760 *2E818DFF8D04F6397D12E5926F37DDBC8EEEC36A CRAGSMEN
458,341,761 *2E8C2786ABE4302D37C1113BB106208AE054B722 [email protected]
458,341,762 *2E845FBF6971ED215966E90C7D5CA23716C5FC65 cretinsesed
458,341,763 *2E88EECFBC641E33CD2624CC43945083013AD6B1 [email protected]
458,341,764 *2E8B09F65DD64AE54074FA0D2772B62E1385E5F9 ALEXISSALVERSON
458,341,765 *2E83AE3E51714F2C7E62F68561D04A80678E4921 CRYPTODIDYMUS
458,341,766 *2E8E22CDC988EB94B385E5A372D7FF8CA5437335 alj9+
458,341,767 *2E8C78DFDFB3F5DA34AA68DDA56F1BA36FAEE30F csnq4
458,341,768 *2E83A99CACE3BD3DA4340B2F4F4C44390C9DB026 A%LN
458,341,769 *2E83BDBA3FD4B28159C20F2C8EBA30BDA3BCA749 C/TSX
458,341,770 *2E8CBCD0D79C40BB4EF595AC990C0D043F9E8B1E cu7713fsh3s
458,341,771 *2E8556422EC1A814678310015956FEC6C52C662A [email protected]
458,341,772 *2E893C68F19ADCB1DE191D8ECB5D57294A9D23CF CURTIS.BOUCH
458,341,773 *2E8A77C79FED0F607F34D507595B9C3337B9D1BC a.mi.muerte
458,341,774 *2E8134D764EF0305E281B7A1F7F7DA194FFC500F cv2x1
458,341,775 *2E8CB2DDF130A7B053EB550D310F36F93B60C533 ANDERSON.GUNST
458,341,776 *2E85F7B27D541B1D54D9728D5D378950AB73A1AA andersonvalenti
458,341,777 *2E83D156882D3BC699D23EFF306E3AF02F9D6FE9 ANDRESACETO
458,341,778 *2E86EE7E31555DE444348E3B6B30B993DA81AC6A andygeorgiana
458,341,779 *2E8F4B5C72E9465632F7EE07DF01C1B5B74A9442 ANEC+
458,341,780 *2E8A45D6577690E61887E27F6DBB066041B414D5 CYU=F
458,341,781 *2E82CC8619F983703753B68F61E42B0D0B72973F ANNA NIMUS
458,341,782 *2E803D86722DD25BC86002F409B229DDC2F68F07 ANTONESORVILLO
458,341,783 *2E86860170B590053449A165B41A92049211A727 ANTONIOMIKOWSKI
458,341,784 *2E8AB318468406DB1CE16D72AFE92CD6A032D137 d3v4lu4t!on5
458,341,785 *2E8CE297DC08E700A292D00B54AC107457E77251 d6nid
458,341,786 *2E83B614992AA84C55B87AA895CBE2EE8BC81A51 ARBEIDSVELD
458,341,787 *2E8BBD953DBC1C78791CC52003D8CE9B7F9B7557 AREMAKSN7
458,341,788 *2E84AA6F9E9696EE3E44C7CBEF55EA2F06BD0E2D ARIEL.BELLAIRE
458,341,789 *2E87047C760572439EA5BA76F1C6D86CBF88F103 ARLENEFR4
458,341,790 *2E84E206DEF9872361D55E52E76D81D017FB382F arno2007
458,341,791 *2E8496089E122340F8A834A8EA56B52AF7083A66 dbdgm
458,341,792 *2E814EE13BA4A93FADA01BC40CC3D43BEE648C60 asu2o
458,341,793 *2E8DEF29C4E7BF1674C504EB7EF2037B0796C85A DECKEMAN
458,341,794 *2E8024AC1B4FE0EBCE3222377949EF91F528F038 AU70P5Y1N9
458,341,795 *2E820FECC780FE84EA8E6877ECB3B77F5668F233 DESFIGURARÍAIS
458,341,796 *2E885DCB05D59846A7A65E32A939098C793D0FCE deslendrara
458,341,797 *2E808F582536F4C45E98C361A58FD1700B427CF1 deuu,
458,341,798 *2E8E91FBE24069DF58F4ABE35E35D60808351C08 [email protected]
458,341,799 *2E8A16B913300B175FC403C1953B8B872AEB0858 diana.martirosyan
458,341,800 *2E8C764A7F94868941219D0A3FC9F83ED62D5788 b0b85
458,341,801 *2E86008F7FF294E4B2610B10249B5E72377A9630 B_0Y
458,341,802 *2E8395C693B9F1834BA6055DA3FA7BB97642DA06 digicam6
458,341,803 *2E85B09FCE7DE18037034D7A2EFDE5B5512CAFD3 B3NG41$4
458,341,804 *2E8FFA2FF55B28D1609447E1D396DF9B6F370339 B_8W
458,341,805 *2E8AE791A33B4C6D7AAFC18931C5E92E01F470F9 barneycockrin
458,341,806 *2E8218C19BF0923EB052B5ACD21E680687D233B1 barrettadebisi
458,341,807 *2E85D2C1E7A32519A73B6EF341E417E54D48404D BARROW21
458,341,808 *2E849186F8DC69B4B4A3026F8DF57BB03B0E4B77 BASIL.AGUELE
458,341,809 *2E87C76BE3F4A7AAB1310EE59D9787B0031CD6B9 bb8tp
458,341,810 *2E803C3E992B526DC4A82B981E50AD5D829F15A4 bciv
458,341,811 *2E86BB3FEE50404A0E2A413404192DBC34887AE8 DM4JQ
458,341,812 *2E850F287B496A17D9369042E259476C84ACE46D BERKHOVEN
458,341,813 *2E8899007FB70490DD9BB823B964EF0127684A18 DOMENIC.DOZIER
458,341,814 *2E88A616EED2F16B2DB2C1AB0B157D7FB46C0F45 DOMINICHAYCOCK
458,341,815 *2E8EB53E466B5C2AA1B96E607E9876BA155899F5 DOMINICK.DEWULF
458,341,816 *2E8A1B5C9B322B348CF86FC3DF5253B8C50DEEF2 betweens.
458,341,817 *2E8A3DF387B216C5C6E901B1AB6CEAA12A87AED4 BEW
458,341,818 *2E89D978D7446456A088AB9412567278AF6CC826 bgdzh
458,341,819 *2E8746CBC182D3A67334DFA647094150E7D90969 BIRKENHEAD6
458,341,820 *2E839F4D537288D8CDCD7D2C14BDB54C03B7B7AA DRA/I
458,341,821 *2E8DBAA5C1D349857D9D5FF08A475BD55A2AAC0B [email protected],
458,341,822 *2E81CA75CEA30CA7C5429C89744BF635B74AB7FF DREWRINGELHEIM
458,341,823 *2E8FDB440D887535E5A962473B6171B504B79A69 blokadeaktionen
458,341,824 *2E8CA576507D0320B140AC922B1BBAF6CCF48162 BLUE (FEAT SHERYL CROW)
458,341,825 *2E8F1CACFE41D20F6647CD7C8D69C0C632038B16 bm=ib
458,341,826 *2E897850BF230FAE104805F4F55F28B6751EA34D DUNCAN.BERTALAN
458,341,827 *2E8ABF8D34B7FFC81A798C65774708072CDD215C BOSSERS0
458,341,828 *2E8B4C651B9E8F38C0E8F55ED5E96C32B80F645C DURANTES4
458,341,829 *2E8AE485CDADD90EFA9D16A90F525A996124F01F BQGO0
458,341,830 *2E89862904D180085A9FB9E70C22A9A997849C60 DZM/
458,341,831 *2E8207697C91480F2502E8089E61DB031720750F brentmancia
458,341,832 *2E8B8019742AEEEBB75BBB2A876F094BE1479C6E ea_ls
458,341,833 *2E8DC3CD653BCB17D979FCB516A1C60050DE214C EBABIET
458,341,834 *2E8CD6B8A4372CD4C0ECC8F289EB96E42C967D34 BROCKZARRINEH
458,341,835 *2E8C3D682C3457D4EC184E5F58EDAB63B0F97340 BROTHERSKEEPERS#1
458,341,836 *2E82922C722CB9CBD041811E3C70B60F9F6D0C81 BUD.RACHAR
458,341,837 *2E865AAE4E0535E25C306A0B70D43D28BA9B6677 bung.I:.Partita.No..3.in.A.minor,.BWV.827:.IV..Sarabande
458,341,838 *2E89B809B0B0A12EAFDD17509CC3332F72448C5C B)UQ
458,341,839 *2E885FB5550EA9E0F4C7E87D084F6E237BDFAC28 EDWRGREYWOLF
458,341,840 *2E8139FB6AC28E6CF40468616040C479E4978D9A EEKEROTS
458,341,841 *2E84A72A97A41253DF72C301DEDCD2EE71C1F217 ELKIVVA8
458,341,842 *2E837E0DF62E6D6F2A596021798086DA7355CBCA c&+:8
458,341,843 *2E86880FB9AC39196B36B9ADBA3C2D9DCAC6A9F1 C8HHK
458,341,844 *2E8679D59E8671AF4DE5C2BA56FA6E7856710BDE EMAN98
458,341,845 *2E86BC7AFCA3B3668F56DE4DB9A435905F1C20DB EMANUELDITCH
458,341,846 *2E869019265E840966C93F7F8C000C1A3F7F7C22 CALANQUES7
458,341,847 *2E8828E57016ADB794F47E4CA613E6A73250B876 emoelmo2
458,341,848 *2E8F8F54C0B0C588EC37000E87D2774A5F063197 emu%s
458,341,849 *2E841FC0C0361183B95DA300B3E02C41BBD80E66 eqqfv
458,341,850 *2E8CB1B24063829F573DDF8600A3DF3530A41F0D erhefbln0
458,341,851 *2E8812AC244AD520ED95A2EC843E836F2DEE1B1E ERIKMYALL
458,341,852 *2E85F276DEA509486C0532B055DCAAD70324AC86 ERROLGEDYE
458,341,853 *2E8535E50FB56BC0FC78413C4DBFA4436623C35B errolvonseggern
458,341,854 *2E8A060B4029526C369D2B0020464C33A99F6656 esou
458,341,855 *2E807E2029A175CAA0496876A21B1CB6EA4B07E0 esvq
458,341,856 *2E894CE1688BB61C117AA26658A6EB5322D68191 CCLEBRARE
458,341,857 *2E82207E65C73C1EAFB2E30A91B50D893B3FABE7 ETHANNEBERGALL
458,341,858 *2E87282797BFAF8DAE1CEB89210E9A539606E841 etinilrebbing
458,341,859 *2E81373A3E16E50C083298BB2755A7E559567A33 cD4
458,341,860 *2E8BC8AE4388BD3B186E80924BEBD26AE2BBFD20 Everything's.Gonna.Be.Alright.In.Christ
458,341,861 *2E8E4B33A554D472297230A652D027BC8D3A6284 EXCELSIOR
458,341,862 *2E8D03627BEF0FEC06288E1C1F0CB65D69140936 ce?tz
458,341,863 *2E8689D4DDAD440FBB437055909E3B45E368F85A EYYW,
458,341,864 *2E84DD11D0973689E96329397A26F14F3770FEC9 CHANCENESBIT
458,341,865 *2E8ECCF6CAE84138381AF85BED5D9AF77D9624AD FALLBOOKS7
458,341,866 *2E8D13E708DDC9EBC746FCEE206B997257C80C7C chaoshobbit
458,341,867 *2E8D1F6E90B3CCB359344E210E9D02D868BF1488 FARHANZR
458,341,868 *2E8C67B0CB609E7C35E31234BE09D557980057A5 FAXEIRUA6
458,341,869 *2E8EDC0DA729CA42AC5BD9030931C01AEEA5E9E4 FAZALMAHMUD
458,341,870 *2E8993B62C4C27D766E866DCF72A67CC5E6BAE05 chercherent?
458,341,871 *2E897F8D44560AE8FB0908A2ECF5CA97F4E5DA97 FERRETDENISE
458,341,872 *2E8B179AD9B1809336AA9C5D43444E8088D572BF christoperbrame
458,341,873 *2E8AD2C798D296A4BEDC37CB01329240F9627CA7 CINDY.MCALEXANDER
458,341,874 *2E81ADDDD8B32FAA1C9323EAC260B95BD531DCC4 c#"!k
458,341,875 *2E860E620D8957ACA16D2E324AAD172E4A8E07B0 FOTOGRA8
458,341,876 *2E87D481F1934E8098921DD06DA0B8E20704BDAC francesca.accurso
458,341,877 *2E8086031AD6BD8651BEF411B3E39EB75FEF0D9A [email protected]
458,341,878 *2E8DC88B520257EEA57C855B85F0372DE0492F2B cmdb"
458,341,879 *2E867426810E987DD55D64618F7C71F4F2252867 fritzshortino
458,341,880 *2E8AE6C2F1854EA43486D46957E20EF98D5B4F13 C+OIU
458,341,881 *2E8AC13D38A2AF5893BCBC7E0A295AFD0F5D1B71 colinpetrosky
458,341,882 *2E8BDC68E28F78314B88225A68D18B4BF0D09723 fuck.hollywood
458,341,883 *2E84A1EDD8B25B7A191155EA5EBC40CFF9195715 FUILTEACHD
458,341,884 *2E8444B866BAFEC8D735C70D0E45224F402D2FB7 [email protected]
458,341,885 *2E8C1C8EEB7DD62B2317513B267DB6ECB4004A4D g8ge
458,341,886 *2E8E7865AF91820C53969BC6AF0046F4722502B5 gato888
458,341,887 *2E851B47DA33ED02A696A2ECFFF2B60084B86A9C COURNOSWILLIAM
458,341,888 *2E883EB92E4BEED1A2BE5B6E9F239CE9E91124EB GELSEM.26
458,341,889 *2E87918CB43E911322D9803D034450D83BD9D519 CP;
458,341,890 *2E83A6FF5D8510EDCE6081695CD81942BC24DF1E GEORGEBELIEVEALBUM
458,341,891 *2E8CDDF4BBA5DE503EBD338B94F199821D0479BF CPINYO
458,341,892 *2E8D3FA620AE7184F3E79CD3A81B9437E296AB47 gerryvelardo
458,341,893 *2E8F1B5471C87915EA102C0ED696862467429289 cpw2.
458,341,894 *2E8565F63DAA34C24BF9447C1FAA6CE696F01B43 GIUGIUCA123
458,341,895 *2E8BDFBF19001D34A1B704EFFF8046F30316BD9C GJACHE
458,341,896 *2E86D50D32A5261588C7171FEDDBA4ED47806E14 CREDITA?
458,341,897 *2E8BBF4231077B8ABD2DCF1D14D2A7FAFC4A2612 crimplene?
458,341,898 *2E8EE58448303C70A6AE46FA4DBB9AD2D864E60C grale.1946-1963.(disc.9)
458,341,899 *2E8AC542F796B3FA3BF19D59D45E86BBEF61A1EC GRANDPAHASSOMELUNCH
458,341,900 *2E8EA526A3A011EDC6F6E916BEFFD0CC23DA53E5 [email protected]
458,341,901 *2E86BDC00A51E94453B6F5B95F7B514885B715F8 GUIDOHOLA9
458,341,902 *2E841A527AAC81B2EAA57EFBB9CD2B38BD6B36CE CTYHW
458,341,903 *2E8DCE9C7330DF0B3917E34C137E7D0C39B0641A CURTBILLOW
458,341,904 *2E8D1B4CD95D95EE60CC8D95C9FC505EE19C5CA6 Hainberry
458,341,905 *2E8F1A2E5DB692D60E300C08F038735CE1D9E5E2 C:\WINDOWS\PCHEALTH\HELPCTR\SYSTEM\REMOTEASSISTANCE\INTERACTION\SERVER\STOPCONTROL.GIF
458,341,906 *2E83122D30DD153DFDA8638B03A14779B747C78A CWNMY
458,341,907 *2E8363209C8F4350147BCAE02F2914A5BEB6EB16 cydh
458,341,908 *2E8A43757ED2F112212CE1EF7E56909E55C8EA8D headblade
458,341,909 *2E8DEF2C0C9DC35FCD320895FCA3DAB51ACDDF30 HEATHERDEGRANGE
458,341,910 *2E80FF7D5B8F8736667C27E78478D33E87AFFF27 D2R2W
458,341,911 *2E8A1207A994267063B05FE5EB6174D840FD330F hershelfosburg
458,341,912 *2E84408F2454E58E73AFC6DF86B54A58A6B44E61 d-#7
458,341,913 *2E877AC87C42ED614F52B90BC27B3A7D60400335 hilarioskrocki
458,341,914 *2E800D1CE386D47A6F362F3FFB9D86CA150FE7F1 hjemvisende
458,341,915 *2E8BFB08D6F87259B2C8BB9EB238748F5192A95B homemprimata
458,341,916 *2E8D5ABDD18972E5B58EFD10E92022CA54D0F673 DARIUS.RAYMAN
458,341,917 *2E844F9904DED7F2C4A8F6CDE13F77A29EFF2653 das-genaue-porto
458,341,918 *2E835DD85E7ECBDA6FD7A99EB2AC32C560314540 DAWOROTIMI
458,341,919 *2E8376BF37750AB544FAD6A9F8B167F9A5D167A2 daytriptobangor(didn'twehavealovelytime)
458,341,920 *2E822D4BD1582AAB8249067AC07CC9271BAF5031 dbyt(
458,341,921 *2E87B990B01A9148FB744220311EE43BB0B4E4D4 hxnn
458,341,922 *2E8E3BAB6DFA078AEA562322928F48E87BFA0DAB IAMPURPLE
458,341,923 *2E80E44A74C5AA2C6540B1FFE3960E67D507C597 DeCo
458,341,924 *2E87D9309A37EA0E41E343256F30366FE9F059C4 degrises?
458,341,925 *2E8ACBFD0A5AF77F9BE7CEF3C97620D3E6242A0A IJBJBSW2
458,341,926 *2E8DF47D03D67C66F026FFC5BB2AF251AAE9259F ILNARCISO
458,341,927 *2E80F88DE843ACCACBF086036FB1213F1634F734 <IMG SRC="MONGOLSGIF"><P>
458,341,928 *2E87B22E21AD324BC533D2F0E3495656FFADA2CD INDDAMPES8
458,341,929 *2E872019D602114F6F4ED3864DE8AD84AD6ACA4F [email protected]
458,341,930 *2E85720FDCED66096B9DCFFD7BCC9ED9DBBE8FB0 d-iht
458,341,931 *2E8BBEBE475CF1EAE3417EFC7BBE6B60E0E78EB6 DIPLUMBIC
458,341,932 *2E8A1C10D79CF65C4B2338953A371A526B5B620D DLB.N
458,341,933 *2E801801EEA29639514CF3308F7A5549AE51B110 DMARANCA
458,341,934 *2E8874199526CB3ED5638C6E75B5FC51B60EB284 DNB+
458,341,935 *2E8B1116C4FEF27957031FC8D13011902A08F005 doc?x
458,341,936 *2E8F5F17B6A98845D6BECF8F7716291B7C11675E j_~(
458,341,937 *2E8466EDD2166C2FD11691085859403C6EFD2181 JAH:
458,341,938 *2E8F32936EAED164E26E740A384F7189D2852616 DONOVAN.CASPARIS
458,341,939 *2E8F227E07CB80FCAA636133D8AB7BA3E0FF94B8 DONZELLAS1
458,341,940 *2E8B24036BCF3CFF5465BC4AFA42ECCAB3FA35C4 JAMIE KNISELY
458,341,941 *2E8630479B92963174425F0CE855927F88BD52DB DORNACH160
458,341,942 *2E865DFA43AFFE43D74E9B3704A419942A89AA57 JANKO-BOZIC
458,341,943 *2E83E20E185A134A5101FE3525DE4454DCB6163F JARRED.DABNEY
458,341,944 *2E8520600EE48585451ECA4CC7E5DC7E7E968957 JARRODBOLINS
458,341,945 *2E8830F44D00B86761E8FC02D1A080C3409029BB DPEM&
458,341,946 *2E8932D00AA44217AEDAB5BE4CD0134E473D4025 D+Q1
458,341,947 *2E8939B16D03EA4EBA8F7FDE305228381B1D79F5 JEDCHUPIK
458,341,948 *2E8EADDEFD0DAF5DC155A4050E15FB43EB348567 JEFFRYWEHR
458,341,949 *2E8A2E795C44D9D3D4A01F9AFE69FBDFECF5EF0E jeremyhasenauer
458,341,950 *2E8D463EF7811FDEEF37FFFE1F4902F8A7CBFE1A JEREMY-MAILLOUX
458,341,951 *2E88A1E85DA19598A4263650166B57D5754D62F2 dsei
458,341,952 *2E88F9296A00232A26646328001DB8C218F64A97 DTA1U
458,341,953 *2E8A7A4D29815EB5B0AF24619EE5936F9C17FEA3 DUDLEY.EFRATI
458,341,954 *2E819C141EDE4EA2503F72859C046FB97224FF3D JERRYLRASMUSSEN
458,341,955 *2E86BACDF7C6D1E3B959606280D8BC80C56E0A89 JESSE KARNS
458,341,956 *2E8C3B06D8251E8212791FD9BEF9D54529996472 jflexx
458,341,957 *2E81BECD78E9590154799020323B54954DBF7EF2 [email protected]
458,341,958 *2E8A3FDA9D0D548D0191B1D6ECC0A9E10E6A1D85 jikishou2
458,341,959 *2E83B21D444F9D3EF92DB1E6C8057C7B6650E1B7 D#WQ
458,341,960 *2E89AFC595E66879BB07C4E4FB345FF7FB35C4AB joesphaanerud
458,341,961 *2E898AA7D1D9010CEB6DF24233CD94F4EF8FFDD6 johannmichaelbach
458,341,962 *2E84DD2642623C1A7233F8C2CE1D84E4E679A550 JOHNSON.LUEVANO
458,341,963 *2E8CC7B830F6699D90FD84EE110B7F78171FBCDD JOHNSONRUNNER
458,341,964 *2E893F6022B29166426127F75520F74275D49CDB JOSEF-DUMAS
458,341,965 *2E8CDEF32F4CB08B48FBEEDB5F9DB90D9A746289 JOSE.RHODES
458,341,966 *2E8F94DC88516ACC23F4A5D1A266BEDF293E156C EDIEKLAV2
458,341,967 *2E8B9C59E27CF6030F7D6DEE23E480814E848A57 edwardogalletta
458,341,968 *2E844A3E9E40081EDADB6E834BD6BAB1F025877D EF372F2EA87F3197ACD143341DBA99FA
458,341,969 *2E8A278768B5ECFF6CCF0A4D6E3930E9FCE48F48 [email protected]
458,341,970 *2E80DBA02A04763C0C48B74543988B30202EAF24 effacing
458,341,971 *2E837AC7CC603ADFD84202A3F8E3F91B577411DE efszsybd7
458,341,972 *2E887800C433AC2392F7D14A060E08377816D2AD justinseager
458,341,973 *2E8C8DC2E76790A38407BABF6E9694B2B407EC93 [email protected]
458,341,974 *2E810B3D67DB05BE4F265CD68802428EA75D7864 EJTREGEILV
458,341,975 *2E89568D35BAF7269B03BDE2F170159DDA902739 kathy.seelye
458,341,976 *2E88F65CCD3C43DCF02C15D90B88EBC2BF58149E kaulback6
458,341,977 *2E808922638F76C89A61EA2D8B96613F3EEE700A eli2891
458,341,978 *2E8B7305CBC3B7D2470950664AF64473E98184C9 ELISSILE4
458,341,979 *2E87168CCD11BC31FA5293A81F7FF2EBEB75A189 ELLENW3761
458,341,980 *2E80E26DB2937FAB869671F4E142945E205CBC96 kellyfoulk
458,341,981 *2E8056E622377D24DAE418BB201FE3D8402FD80D [email protected]
458,341,982 *2E8B5CD1180F2417C3D300D28B77CEF6258D5CD4 elubu
458,341,983 *2E82E85445051646F88F2F173E58B4492FCD324F KESHA.CONNELLY
458,341,984 *2E8F3BA6EDAD4D6E4BA2A2A40DAAB3A56486B10E Embalming-Process
458,341,985 *2E888272B556DEEF45EE237D280357C141BF06EE khalidahkhalid
458,341,986 *2E87DB213C5F63AECAC8BC5D0AEC3D3B3B8B7B80 EMILY042
458,341,987 *2E80CD74CCD3B33DC8E1E23C778C2B6F79F63674 KIYANAWILLIAMS
458,341,988 *2E883C17ABE81F59236EE0F26C4B400C09B394F5 kogetsuenshūryū
458,341,989 *2E879D55BEBEDE90DB912A0963F4F17FD2510E84 EP)B
458,341,990 *2E868DCD2952DCD8160964F2C487FAB81ECF1302 kruisbessen
458,341,991 *2E8DE18AAF9708456892F3FDA4D69E4E28729446 ERNESTODESMEULES
458,341,992 *2E8B761C012ACCE20EA3D5D9CDAD8602C8E3A00D ERRALPHA
458,341,993 *2E89FA1CB0B6E2730B774DF38B9EC26AD8582924 ERTW9
458,341,994 *2E8B7FE13DC57F7E1C4A3BBD7B0C81647B773D5F LAMATAP
458,341,995 *2E8A14A6063A1FAA1EFC1E084E0A93CED757E9C7 LANEMCKENTY
458,341,996 *2E8C22F5983BD4BFC82D45263E84794BE9B07D0D evans12591
458,341,997 *2E886DE655FAD9DE6B31A930E0BDABA9AEAE4025 EVETAKESING
458,341,998 *2E82A1F0933D8CD4B5C7F457A38C364C768B7402 laserfiona
458,341,999 *2E8B7C12EF4267C1859280E9C542BF5562CABF57 LEBENSMITTELARTIKELN
458,342,000 *2E8B9FD5B29D0084AFA22DDA71384F3CC18754F3 LECHREIED
458,342,001 *2E88DB53C07373C992C15C65379F0B3762E145A0 FADY-ABDELSAYED
458,342,002 *2E87F43A1301EA70EC374C2BE459999481DD0EDD FAL
458,342,003 *2E80E58A2D992C66AEF85F5E6436FF193B9263D3 Leikkausp
458,342,004 *2E8B8D6182D8DDD12C59C47F3E71FE363B76F711 lelandsas
458,342,005 *2E884D7614E773329325174CA4D511F90A64E2E8 lenpinkett
458,342,006 *2E801B6DBD1F68966977DE3570969607AA787403 leonfriedl
458,342,007 *2E8332A1AD6F78ECD3DCF8A821FED86EA5EA8DAA FBERGTHOLDT
458,342,008 *2E8FC64B7CD95C0B5DE4437CA90D126025204F4D fbk
458,342,009 *2E80DCFCC55D6A749444E4070C8B2EC26A43A233 FELIXKILMISTER
458,342,010 *2E8C928A9FBCE04DED40874BC48D3B56EA2A32C1 [email protected]
458,342,011 *2E84260390EE324D11DEBE5FDC46445298664C42 FERNANDO.MOSKOWITZ
458,342,012 *2E8E6D20F4F85819E2CC6F4526D63C18B407AD9F <LI> <A HREF="visualhtml">Visual Messages</a>
458,342,013 *2E856FA8586DB6D2B81A52A8D517FEA5B532DC5F LIBERATA.TU.TU.ME'
458,342,014 *2E859CB451F534A14A08C510176AFEE54F5465E2 <li>hkpkeyserverproblems:
458,342,015 *2E8285F715A483DFCCDD31603304BCCF7F943642 LISELLEDIAZ
458,342,016 *2E8D066C3D684340283430BF1C6FB6AF8696459F fmalaville
458,342,017 *2E887EA62F4298D84B51A4EFC2D802C64CB0D2FF FOREST.CABECEIRA
458,342,018 *2E896F9F2402BF756F4BF25C5DF6AC6071A82073 [email protected]
458,342,019 *2E8374D0ED30308EBEF34D4330A1C93DDC5F7CAB forrestrubert
458,342,020 *2E8D7548A6175818C5F0F04215D549BC5F58A10B LNYUGAT
458,342,021 *2E8BC3B19BEB23397867FBE3759D42C4E71476D4 [email protected]
458,342,022 *2E8CA84038D1FA84135FD04BC756130E210B8128 [email protected]
458,342,023 *2E852527DD3ABD0F3FEDB561D055285574880462 LUDLUM1234
458,342,024 *2E866F5F2C72C6A702841AF13BE22A90CECCE453 [email protected]t
458,342,025 *2E83EF07473015F6C1782356403BA2DB1A2374BA FYFTIES2
458,342,026 *2E86EF5CC9114F869FD5BF884662E536325DFDB6 luradens
458,342,027 *2E8A55EA155300C4D4F620DA142E37D7351CF036 ganujegangmaar
458,342,028 *2E80320D5C5CEF3119104B0DD8ADDED24E2667B4 M#\[
458,342,029 *2E8B47E5DFCB800A059643FFCBBAEBF88DEE98AC M0LD!NGS
458,342,030 *2E816D21300C81F4DDC83553DB1405F2A817B0F0 MAGIC(台湾)
458,342,031 *2E874E3604CBCB59709B6556DDF1390DD1F81BD7 generelt
458,342,032 *2E85A93DB1971900FAB91F95373DD1A4EDDBA595 geraldomarkette
458,342,033 *2E845940535750AC22271C9EF2084166E3FFFF14 GERARDKURIGER
458,342,034 *2E8D7F2F48D85BE8DC772AAB43E8BB31E7D667AA [email protected]
458,342,035 *2E866D44EA7D4B4CCAF2A5B8283B7570371F1B49 MARGARITOLIUKKO
458,342,036 *2E8E8641A540E3BE260A42883F5FBF3099B46ED0 MARISAWILSON
458,342,037 *2E8C5DC6EE169048B6B35659777C1321BFDC943A MARK-L-JACKSON
458,342,038 *2E84FF53358B9609DDF3AE038A902B0380716664 MARKUSJERNIGAN
458,342,039 *2E8B54246B183929CA92528355639A8A7153D47F MARTHABD
458,342,040 *2E82A0F5E8982A5484E85A3EC8E1964FE918EB72 GIL.STRAKER
458,342,041 *2E8E565CC42699D373BBF7AAF436C4E8FAC8C590 marznied
458,342,042 *2E8F937CE6DE46ADD6E58B181EC066761A9F0DC2 [email protected]
458,342,043 *2E893831BB7D81AE0AE942A820A54899C3FB878C MAXIMO.ERLER
458,342,044 *2E842736ABCB93CE80F5EF93E43BA555F1179A12 MAXLINKS
458,342,045 *2E8DACEB0C6B30CAA4B886ADD34E2EF0FEA15C40 GLYCOLYTICALLY1234
458,342,046 *2E8A3ECFFB0AF507786B59532FB7D65D48FA6134 mel-a-tawn
458,342,047 *2E89DA1BF0C71D433DD29AED73F3F85A120B7A07 MERRILL.GANGESTAD
458,342,048 *2E8F68BABB0EC446F3577D7413D7A01A279B1152 MIKE-STEELMAN
458,342,049 *2E870F14A89029762932130B1FAD3F897C673F12 mikezieg
458,342,050 *2E82C78E8279F6FFC706F4B47B838017FABB0CC2 [email protected]
458,342,051 *2E874B24609F1CE06A56AD66B7647122FD314497 GONZALO.SIBILIO
458,342,052 *2E83D83286E646005EB173DA6C4E7FD8EBA6FF6C MLADENOVED
458,342,053 *2E898F6E871CD77D1FE4AC498471D6F911D40F3A mmerung-(feat-conductor:-Daniel-Barenboim)-(disc-2)
458,342,054 *2E8E3E7D4A5F57B5A6316D8322D52881BB219A26 GRABUČIŠKIŲ
458,342,055 *2E871BBA8DC95CD1C7BA7D39E9519716016D6ABF moiseswaldecker
458,342,056 *2E89D15B46FF7571B772E3C6CA701B5FE8AF1556 monkmontgomery
458,342,057 *2E8AF71ECEA5469E1354DE07F4F03DFC28B20E25 GREENDYKED
458,342,058 *2E8E5DAC128A70F9EBD66CD9B1A0F37308CE0B71 mrnas
458,342,059 *2E813619304814F1127DE79FC353E51E07629523 MUSEUMEJ
458,342,060 *2E8F5F73D3BC68A50D8C2EA4462511A557999819 MUSIKINSTRUMENTEINDUSTRIE
458,342,061 *2E846F87995DAC8F84888C46DE9C0D29FE8988B8 gussarka
458,342,062 *2E80258FC838A2C577B57427D4BD5B7DB6171637 MYDETROIT/FLICKTHESWITCH
458,342,063 *2E8B87880DFDF74F00039EE822286467D568C85F HALTETEAK
458,342,064 *2E8C2510C87E9287AFA3908F2824BCFF45F42B0E N34T0X
458,342,065 *2E8D088104EE68DCD6E23D31F965911E52739E4E N4376
458,342,066 *2E8E34A418474F4D94CC54DFDC073D003CF09C60 hankseabrook
458,342,067 *2E8BD82E210AD22D5D9DB420FE37E1A176174698 NAGASHNEGRO
458,342,068 *2E82D39148DAC89FC61BE106D50DDD31674489E0 NANCYDEARTH
458,342,069 *2E856CCBDB5ADB5AC037653B0CBAF5EFAE530A65 HAROLDCONYER
458,342,070 *2E8B483276D1F6AD3B86BF4F92154A2C56CEF751 NATSUMIR
458,342,071 *2E80840527C0B4D3288CACEA23BA79322044F68C !NCON+3S+A81Y
458,342,072 *2E8C89294B4EE99701D29725344D28A356588652 [email protected]
458,342,073 *2E8E602FEEA49F84EE30F938316E60EEA0B2331D ne2:led
458,342,074 *2E80D0E675718A085C53F555F5EC216A67ACBF5E nfl–lag
458,342,075 *2E87DF9B972BBEDBD477933F9F4066C3A2D6F867 HERBERT.RUPERTUS
458,342,076 *2E81EA502C7A58B3CB36FAB8C29CD9EC4DD58F90 NICOLAS.DA.SILVA
458,342,077 *2E83ED5F6FB68BB5EF06649AE4E5C34E74F5222B NICOLAS-DELTEIL
458,342,078 *2E827E1211FEB8FF89CCA5CDE111E0C8389C7128 hib$
458,342,079 *2E8D5527D17C8EC9A7611ED88EF8E5F0C2702D44 nolanborgstrom
458,342,080 *2E8EC9E7096C6550F0F6F2C4580AB36F5ACC378A HOLLIS.CASSATA
458,342,081 *2E8C9C438599D64EBEF5D1DD291DD4A953F07823 HOLLÓNAK
458,342,082 *2E82A339014DA1E5877380510B931A1967700491 [email protected]
458,342,083 *2E88E18123F992B3FC45117186F8BD723A0664B8 NORMAN.DEROSSET
458,342,084 *2E8E6E9EACB8814AB5B4F1AA8A2E420610158AE2 norwegianelkhound709
458,342,085 *2E8748A4DFF53032E3E1691D9B1BEDD2B0F129B2 h+qu
458,342,086 *2E87F300D3E1BF48FF8C67C65B5C092C84D12E34 NTRPNCTT8
458,342,087 *2E839B12F77FDC22C5B07F65D815B53C20B6BA54 HUAKAʻI
458,342,088 *2E88B7FC702C9B20937810154D17D14BDB3C7EA4 NURKNURKED
458,342,089 *2E802D17C540FAA5B7BF3666588D2328051DDBDD [email protected]EAHNET
458,342,090 *2E845CC0E5134CBCA721893D1D020A828D2ACB39 [email protected]
458,342,091 *2E83585E50253BC39AFA39EFC296C8530EC21EF8 [email protected]
458,342,092 *2E83B821DFAB1CC13522B4001FDB0689571C1FDF IAMBENOIT83
458,342,093 *2E81AA96C6FC6A978E9F9FE4B9E29778FF9861AA I*AM*ME
458,342,094 *2E8EB2A287E005CA7C1137A5599D0AFB3301EC9A IAMPORTER26
458,342,095 *2E84B4F58EC25257F5295AB1689FB11E1205C38B ianwhitbread
458,342,096 *2E84EA91E0AC992E35C7C65972897B47978EC2A3 OLIN.KOVERMAN
458,342,097 *2E87F013F1EED86CE49D72260C92A5CCB2308E4E IDIOTISCHERWEISE
458,342,098 *2E88EF4F6BB6BC6AA2FB6400B022552D3C977539 [email protected]
458,342,099 *2E8B2375E05F641ABBB15B709EF8CC84BDA57F5C ONE UP THE BSIDE
458,342,100 *2E8A62A24B0D9888FB2EE58FBACB844B0E676732 oomyo7071
458,342,101 *2E846F5938F5A15B188ABE326761820F7BCB915B OV3RGIFT3
458,342,102 *2E8EB37D1D6944E9BAD41C3B1D7AC44A803F9754 PABLOMCIE
458,342,103 *2E8C5405CB6E8A983CFEAF066C058C3CB01BF0B3 paleoteuthology
458,342,104 *2E8EC5B8DB0C6CFA4EF2C0F065E51C65F538D10A IR<L
458,342,105 *2E856A61837BBF89D592E1E23B781A0AFA3CC71D paris』『la
458,342,106 *2E82F903CE4B33A88BBE5778349D959C5BFF7F0D ISSAC RIOS
458,342,107 *2E87212C3DD6A1B9B176068B532E7D51011851FD ISTATT
458,342,108 *2E87BDA2C138D6478C570E732AB3461282429261 parwalpur
458,342,109 *2E8C89047199D427F713EC6EC215BDAD37E9C314 PEHO123
458,342,110 *2E8BAA9E260B7C6033B0368ABEB0F25387BA24DE JAMECCE
458,342,111 *2E85C92A652FCC93F8B22599FE90260CE1C18C1F JAMIL-NORITA
458,342,112 *2E8BB70E4BD32E21F928E6D2EA9419A8A4D4901E JASPER.WATWOOD
458,342,113 *2E85D76F6943FD39A86A0F4A66D7B733403747AA PERSONSDETAIL68B7
458,342,114 *2E80E989E2B2385A1264646BB05C2705CDB2936D [email protected]
458,342,115 *2E81F85E35723E55D917953FC823C9DDC3ED850D pierrebirdinground
458,342,116 *2E8AC258A5860A5B2FF87D83B410CE866045D6E7 PIHSNIW3
458,342,117 *2E876AE850B6EE7BDDEFA020C8A8AADF7D896568 J(F
458,342,118 *2E8FC1B6976E3005A2D3CE3B5B7B3A2A3A03F7F8 PLEASURE(DISC1)
458,342,119 *2E87D1F3CD373E55913EEE5A55F8155DBAFB6543 JOELGAUTSCH
458,342,120 *2E884131F83C2DDDE8DBE8B7AAAFBE99D4BC606A JOESCARR
458,342,121 *2E832A8B65EEA7A47AEB48713063674E253EE2A8 JOEYFALTER
458,342,122 *2E8F208D8FFC318F63FC3669A0D846B071862329 joeyoverweg
458,342,123 *2E823A500C90874733DCC94407DFFE9EAFB1F385 JOHNNIECORNELSON
458,342,124 *2E8568BD38C78FC6805D4072555916B903355CF3 POPEHENNESSYALAN
458,342,125 *2E882FC71D516D1F99478CC89D32FC72E10CE3A1 JONATHON.BERTAO
458,342,126 *2E87AE0BB760C22A79453B61CB4D55A33525C6E8 jonbrenthoener
458,342,127 *2E84346DD80BDFB6C7C7010F044190D1E0F2905C JORDAN.MACKELLAR
458,342,128 *2E8CCC2A05D3D95001E87051537627EB5D74ACFE PORFIRIORESNER
458,342,129 *2E84FF19A58F2FDE41C77B176DE61EC4CBD74F78 POTRA
458,342,130 *2E858A9D89B6DEB001A982B98846EDDA598B4185 prettyring
458,342,131 *2E89FB573FEABF39501E8F57F74A316E3E03DDE4 PRINCESS-OF-THE-DARK
458,342,132 *2E89A10032DBDA3494C0A6B9409A81BFBC7F764C prstmtng
458,342,133 *2E8CB4A9C88D8CE9A78B058D553B78491DBEFC93 PSICOPEDAGOGO
458,342,134 *2E8A9A27A4DCE845938CBB9F7E697DF0E237A636 KAMPANIED
458,342,135 *2E86581ED059277CB2EF137DCAF06A5E8B622C1C kap.thang
458,342,136 *2E8F153F4C49DC8DCBC7421DE1A39389BA53A068 Q17903275541
458,342,137 *2E848122D0997479A78534E3DED9A9E97DF8B068 [email protected]
458,342,138 *2E8FBBF38191659FC53D39F4DEDCD2CFF09B9520 KATAKENS4
458,342,139 *2E855950DFA7B8F4D6A1ACE573FC40EF2F97B5B8 KBWIKIKEEPS
458,342,140 *2E87D57EC1F4A4C3E1D06F3B61814F74471AFDF7 q====>.~o.splat
458,342,141 *2E8417D8FE3DDFC88BDDAD00EA6D8DE6EFD7BBB2 keerthiraja
458,342,142 *2E89A9F0FA823F71C5904812716662945EBEA861 [email protected]~}x{
458,342,143 *2E86C461A9A2ED066EDC9A2E41B3FA7FE83C9031 R3$7OR1NG
458,342,144 *2E82257F826FF13F14B52D9313B31C36C54E0524 [email protected]
458,342,145 *2E83BBF173F3D78FA51775FB1596A92796D1F147 RADOMIROVE
458,342,146 *2E8024D39F4A1A6DC9B44B12E91340107D9E379A RAJA-GOYAL
458,342,147 *2E8A95EBEACF386F2249B18455A3393B5BCD2737 killfixx1
458,342,148 *2E8B3F543682C3CDB91E5A853EDDA9BB68FE21D8 RAULMIGUES
458,342,149 *2E815DF949C8A5AC1C5F8C0AF691CC7DE04B7E7D RAUL.MINER
458,342,150 *2E8AB917DABF7DD4B4C40758C943FA560429E2B9 RAYMUNDOREINART
458,342,151 *2E843221B94E05221E4D91853D71476FCF6FDB06 [email protected]
458,342,152 *2E8A2C9344B44647E28D274A2DDCDA42570F2F02 reactionariness
458,342,153 *2E8FF4FAE35E45A16256B5F9BF2CD858262A930E KNORBENEN9
458,342,154 *2E8CD141CB5EFF5FE8236572784CAC53DDDC80CF kraigtabor
458,342,155 *2E8CBD9A49E8A2B95AC2030E6B3C7E828FB3FFB0 KRISTOPHERPEELMAN
458,342,156 *2E8B265B7497E3552C781D9DF92870BDDBBA7093 K]RM
458,342,157 *2E84211CB27B47389694DF6168FF7D462E6253AE kurtbjornberg
458,342,158 *2E89DA0DEFBFB05214D037CE368D75E8CF42B1E1 labash
458,342,159 *2E8496AD2A98D309AE06631D088CF96B967FB31B laneamsili
458,342,160 *2E8F9F87AEF70DD694FB7B4EA2D27BAC700F5243 RICHWILL:EXPLORER
458,342,161 *2E8226D809B3A5620E1291B749A555614C30B99C LAWSAMMY3
458,342,162 *2E88ADAE7FBE95F19497BF11E609A4BC1E13D000 ROBMCNELIS
458,342,163 *2E88113B818D7912A5D7609AB04E15375B1E945A ROMAN.DEJONGE
458,342,164 *2E881F4055EE67FB36EB2E897AFC1338F1ACC524 ROMEO.SOHM
458,342,165 *2E8B5895EAD719184CAD9D28D519FD28091E26BC RONSWIMMER
458,342,166 *2E8B2C84BBE7363598810286EFDA86051C5BA7A6 RORY.ATHA
458,342,167 *2E873DDF90666A3E04810610DA1FADDA98FC11D0 RORY.TRACEY
458,342,168 *2E800777F322A2105817B82175FA481BEF31A61C ROSENDO.RUBINSON
458,342,169 *2E897A86E25485BF246DB35DAD589A947CB05591 roshani.neupane
458,342,170 *2E86DFB92EDF696D2150A3F37575D219CF3E4E32 ROSIESPANKY1
458,342,171 *2E8825B5DAC3759DCF061C6C0FF42EB291F5CCA5 ROWINGHISTORY-AUS.INFOWWW
458,342,172 *2E8A093034E1A5CEEB2BF9F018E0F129747F3E20 ROYCEPLATTEN
458,342,173 *2E8ECEC62444845C8300D93DF6BCE45BA0DDE907 LICKIN' IT
458,342,174 *2E8E59020545F31273F3F5CC1B848D07798DD2EB rubenpulse
458,342,175 *2E8B25A36AFB53F293BEDF414C59B5A6CA05ACEB LIGHTS AND THUNDER
458,342,176 *2E835AD43A57DF20E576BA1948BEE740CAE467E9 Rural.poetry.is.the.pleasure.ground.of.those.who.live.in.cities.
458,342,177 *2E8DEAED0653ACF36D0DE38E9C3AA27D72E3A83F RUSSCOCOROS
458,342,178 *2E809B3924394A349BCDCEA0FED36E08E483DDC8 russomanno--r-ah1-s-ah0-m-ih0-n-ow0
458,342,179 *2E8246CCC52AC075D24FE1C990ECD5ECE255B3F4 RUVIMBSW8
458,342,180 *2E86CFA6E92C42C30E2DB2B6DC1E29155AA662FB LISTA-DE-CONSEJEROS-DE-EDUCACI
458,342,181 *2E8651E736267DDB7A8983EFEC7CE6D5527316D7 RZSDTUKVYXIT7
458,342,182 *2E82517213B02DC1E3A5FFFF692763A1D5AAD3B5 [email protected]
458,342,183 *2E8C8A4DC96886B41C97E628525595054DDAD604 SAARIRYH
458,342,184 *2E87948E43D2051924E2D9847D2E2711B6F6E9D8 llaryeu
458,342,185 *2E8FC3E875010455D0E1FC110D9C3158B62CAC2B SALLYANNE
458,342,186 *2E8AF1E1FADB9AD89E0D69CED0E5DA53E2B4F3E4 SAMMIEFRIELING
458,342,187 *2E8D6744E14F0AEFEE16504A8289BFF0ABF71289 [email protected]
458,342,188 *2E885BDE7DC084E8B18A05341115C3C2BF62BCE1 SAMUALRIZZA
458,342,189 *2E88750D8D600B7A78AA503A3A4FB40BF19B821F lonnyroediger
458,342,190 *2E81AD428E4BF5AEC3CEEDA57B081E0A1E193EFB LORENZOGRISBY
458,342,191 *2E81A318135B17C5CC7045B2D737AD934B2ADE84 lorenzoklukan
458,342,192 *2E858049B994C713EEFC108BE74C733360781008 SANELIES3
458,342,193 *2E8CDBD8794598A0B65C5D93517525ADB01AB9B5 LOUKARI
458,342,194 *2E87C962C20839B0AB3F52A5C0F1094B6592BFC8 SAREDRAF9
458,342,195 *2E84D30CDBB8629BEB1A4C251C042B1E163352F4 LUTHER.MANWEILER
458,342,196 *2E8C7943A53DCBCDEF5BA48EA49155B1F378422B sdai
458,342,197 *2E86AD4F8C9AC05DEA050A196F3632134EEC7731 maeshori0
458,342,198 *2E850826748AFB2923FE4253F92277C61527CCAC shannonlecea
458,342,199 *2E866E7A5DDCC24F0FC4139E3757C661779592E3 [email protected]
458,342,200 *2E8E32D9389883211D5235AFEE0CC2604FF948CE [email protected]
458,342,201 *2E876039193880AC7386B451D46749FF2623FCE5 MANISH RAJAN
458,342,202 *2E8FBACAAD38E08CDDBA6292B3124C367A9A881F MANUELCOLDIVAR
458,342,203 *2E8F1C130A757E7F0C6091F4EB70A4CC38686358 MAPLV2024
458,342,204 *2E8BEFE565B825C71DEACD1450638A3D6C1E37E6 [email protected]
458,342,205 *2E85B085D685E138967CA4CC0C22F4AE2E60BF5D [email protected]cn
458,342,206 *2E84CCEC90F3C21F1505E8F970AFC3B8872D466D MARGARET.WHIPP
458,342,207 *2E84F9C45175E2354507FC35D3ED3EE3361D5A02 SHIVAUNJ
458,342,208 *2E85618F32BAD648885B4C77BCF70665ED88182D MARK.WEILAND
458,342,209 *2E8767F7F34663F9F0DAFE9561B6972192B3435E SIAREMALCXE1
458,342,210 *2E8BF1C78871FAD3714B79CDF8EA80DA4FEA22BE simonyoxall
458,342,211 *2E8252D55B37FA7A6CFEF84A319417419DEBD7C2 SINUN KANSSASI
458,342,212 *2E89B29C0A8E55986C5859D118ACA3B55870412C SIULSTUHCS5
458,342,213 *2E832296A0C2C010A33A228535DF600167F49764 s-jazz:-when-japan-meets-europe
458,342,214 *2E8A2CCABC4AD2382E2CCDD1309E0D2C55B67FBB SMITHDETRON
458,342,215 *2E854604184B0DE5033F84F6ABDEB716E001B0E8 MÉLION
458,342,216 *2E8A5FE44F643635CDB7AE7CA6FC8E79967B8160 SOMAIJNI
458,342,217 *2E8C5BCB4F43ABD99A9F008CA02B0B258448625C SOME AGREATDEGREE
458,342,218 *2E85CED505AF9ADFABA0D89428D61AF224484719 sonatagdur,bwv968:ivallegroassai
458,342,219 *2E840BD35051C461EF350FD29172168762C5F459 mentionnais
458,342,220 *2E81009DC2F2C9C0295EFAE6184A680ADE92969F SOO|
458,342,221 *2E84786B03876E99498E9FF33A154D74E734787F metrointerieur
458,342,222 *2E89B951C109F98847ED7E233B1B775289D477D7 SPENCER.CHAPOTON
458,342,223 *2E894E1D05767D5AF226B9A8CCB6A14727CA4E72 SPENCER.LOFGUIST
458,342,224 *2E8C29E9478E7F0C0DF671C3D88C3B512E64D5CC MICHAELGAUVREAU
458,342,225 *2E8AF498FB3843B880B3EADAEB33A0759BEADE2C SPLAT!-*-*-(#####8
458,342,226 *2E8C7434D74EFB0198DD400F67398CB37E754FA5 mickeyybarro
458,342,227 *2E8C107B510AA452616EF8DFAE5A8174EFA65C2E SPLAT!!.~.~.~.<-----P
458,342,228 *2E86E4DAA1B3E8C8D614B4AEF8B618829F5A524E MILFORDTORNGREN
458,342,229 *2E8E09538164DBBBD5B0E222CCB7607720D74264 MILOJE_MILOJEVI
458,342,230 *2E887E38C34E9A9C81C214874B879FDB0B62D779 miltonben
458,342,231 *2E8CC05C5444CFFD3473430DD5C927A6E3F04C38 sreinial1
458,342,232 *2E8FC8C88897D28098BCCE8D3CFD9F8F00072ECD mitzvahh
458,342,233 *2E832BCFB7B3E7E21B1B1967D6D45BCD22B57A88 STATESJAPAN
458,342,234 *2E881841ED63CC712D8ABA7F9F21F517FA72418F stelmas0
458,342,235 *2E86166CEC23D66E2EC792B4ACBEF30B86EDB54B steve-magner
458,342,236 *2E803C5F1DA03FE05631BBC109F8DCB39AED7037 stevena.
458,342,237 *2E8DDCA449603F19FE1A573E9DAA94F7DB90AC92 SUBURBANISED
458,342,238 *2E8B011CCCC63EACAB91D5E5D943FCE3D4D74446 SUMITSANGTANI
458,342,239 *2E83200D22E03301926D3D683F8352060AD89AC1 [email protected]
458,342,240 *2E89BA4FFCD4A0DEC29A1AC6E48A386695D6CAE3 superagentsteve
458,342,241 *2E83EF7D72D8E464FA1906180A14455F09CB6CAB svaamyam1
458,342,242 *2E8C5FB82451F81BF820F731F25F77673C1BBE0F T+;[
458,342,243 *2E85EB070E45D26B2CBC93935A4E1C6AD05505F5 MOLISSIING
458,342,244 *2E8D364B71754166918C912A34A50B1ADDCF03EE monotypousing
458,342,245 *2E8B2AB84FFFECC67B4CE3430A4696B1F3792D32 TALK2046913916
458,342,246 *2E8F57CE5B8A1EEDAFD4C7D93D921C0F415F1646 TALKBRANDONWEHBY
458,342,247 *2E8A7429CDB0C875AF69A29297E487CAB8606267 TALKBXML
458,342,248 *2E8DEDB15555C2F71B817855E7D4945E76BB94AB TARAHUTCHERSON
458,342,249 *2E8BA9E99C1934C69188E12D60756848235A5640 TE1E010GIE5
458,342,250 *2E8478D3F9F2528115E46E436ECB544E06E9CE39 MOUSSA-ASKAR
458,342,251 *2E8C00248A14DD58B53C5835E0C30B4E7C7AABBD telegraf
458,342,252 *2E85CF6A958949B6C951A405C05FCC2E6E530A89 TEODORO.CUCINOTTA
458,342,253 *2E86B8C861A659AB591969D64C5C19D3AF2C1979 Tere-Sang-Pyar-Main
458,342,254 *2E88DBD5EDB23319F6232AB9B0EBCFE95296BBBB muldon7
458,342,255 *2E8B8F99D4245B603E1B5C532B3DDA490DA2A120 THATANGEL140
458,342,256 *2E82758C85AC63C0C9FE643CE069C389DF119FA4 The-Duke-of-Syracuse
458,342,257 *2E8695DC1C00FB1727EAD7B7B492C1D839E77606 theeavesdropper
458,342,258 *2E8A1268E6D7EA33391CA805B846876776BE8CF8 Ndisaster.area
458,342,259 *2E88E7E225514D81CE099AF91CCCDE3EA03DD5F8 Thy-mother's-name-is-ominous-to-children.
458,342,260 *2E86F4EDFAF103C3EC16CA1D4824A8BCBDA32C20 NELSON.CASAVEZ
458,342,261 *2E884DABDE2F3FF39FE4C40BA5325E4DD609A92C tillarrallit
458,342,262 *2E89CCCA8045230A2DC37DA89D9257C23C5A746A NETPREDICTED!
458,342,263 *2E8D770E532DC21882AD381F0209BBA06D61BA7F NGLAIYE
458,342,264 *2E87B2F691F7E940A6B226FD704BC4691D5F2B9A nidhu
458,342,265 *2E889BDDEAEE7917CD0BA8CAFF26973FB10FF9C8 TOBIAS.GHOSTON
458,342,266 *2E85C396BC67B37366B0A453911C0F510C362EEC TOIMILUPAKIN4
458,342,267 *2E8FF234EFB79560CB8A4F381E52598E70CDEA46 TOMCATDUKE
458,342,268 *2E8B6206E5E761C400B1EBE807E80472243DFC76 TOOFAN
458,342,269 *2E8F0212AD67C02E676569AC5E4AE42FFCAE8530 NO..5.IN.A:.IV..ALLEGRO
458,342,270 *2E8F2C812D831C92D6CBACEBC0B2A35F5C0E1567 NOCONFIR0
458,342,271 *2E893FE8386BB90F34B638601210CDA125FF41B8 TRAVELSCOTTIES
458,342,272 *2E85D6F0D364719AE0971B3265F51787EC20CD2B traviskerrigan
458,342,273 *2E81C4EEB4CC5C4034CAD0B079E23BB0C5A98181 tryshajose
458,342,274 *2E8F40D40A5792869AC27042391CC4BB4E3353EA OCTAVIORAUDENBUSH
458,342,275 *2E8AB9151428DD8F051DE1C47DC9AB6800F95CBD ODHAZUJE
458,342,276 *2E8F62A048C1D9C4D52F3B0765AF8061C3BC3334 ofredneted
458,342,277 *2E833256062E6368EDD13BF919B9401A48D91790 OL18075300M
458,342,278 *2E8360FA160C5F1010E6AFFD2457E4C2D4FD31C9 u&\
458,342,279 *2E8A7C917DDE6CD15201351F87F33577606077EE udspile9
458,342,280 *2E892B4DA95D2CA9029207E11F47FDE231B690D7 OßBNABRUGK
458,342,281 *2E87CA50215F55FB74009D64957856A3A6565FF9 UNBEWOHN9
458,342,282 *2E857906AE5D42ECE96C01132FF4EFCC93ABEFC2 p0pnoy0316
458,342,283 *2E8C38E45B5170BD317B710FC893626AD5E53A6A UROTAJIDALG
458,342,284 *2E8F3CCFEE46395BCF8898B2A272A2764820AA76 URVALETED
458,342,285 *2E87A0A7628BA983AD9E55D927ED501AD0C5FC1B pamela-hildreth
458,342,286 *2E89C54A2D174E19A073FE96CE79BB3163571441 [email protected]
458,342,287 *2E8852CC4C99E0EABE7568E7D1B1389A1744C5B5 UU9Q
458,342,288 *2E840F16CD980E135054E7BE021F7EBCA6B2EB23 paris5683
458,342,289 *2E8EB465D2A06C77FF63C825FF2310B3B7F705A8 PARKKALI1
458,342,290 *2E856162870D101E0CBEC08D16B420E0087155AF Party-Mix-5:-Ob-K
458,342,291 *2E8C955609F5A97D616EAB79D2BBC1F7F50C47CF VALCULLOTON
458,342,292 *2E8B5B0622F43845E3499FEF4312B40CFB5CD192 PĀTĀDHIKĀRODĀHARANA
458,342,293 *2E8E4A5543B3432D89AD66C666E7B9B4F6E96437 VALLEYGIRLISH
458,342,294 *2E8518C41AB5E15344979BC3233E139AEB201BCB PATTIMALDONADO
458,342,295 *2E8615DFF77C3989D6C9C8A385A6479BB7C9DEC3 vangahn
458,342,296 *2E8A462557D412AF077774286C114F498A91E521 PB~o}O{
458,342,297 *2E8A600758F66F3A51379ED11931FBF4E413C053 PEDROCARINA
458,342,298 *2E884E76AD767005B226E539DEE97CD539F22084 VENTAGASPAR
458,342,299 *2E849EA9BAC2B480C7E6235B19F705426F600428 pendorwood
458,342,300 *2E818D0EE5E72814B931FCA8D48AC2795B147EA3 periphys7
458,342,301 *2E8905533FFA0FB538E79B705383E89A36CF6A42 peuliche
458,342,302 *2E8D8AE5A9F9C4AF5138CDC6BC87F4CDE6A049D6 VIEMRINNIN6
458,342,303 *2E865711D3218A69BF7779D072696D817027BC28 VILLANUEVA DE OSCOS ASTURIAS
458,342,304 *2E8CA80118583594FD5F1867A59A04B85222ED79 VINAN-ATRASH-VINAN-ATRASH
458,342,305 *2E8DCB64B1984C5519BFCF293B2B00401E90B50D virginia-foxall
458,342,306 *2E8BC176A48CC251D5D26486ADE3CECFACD0CC59 VIRKAKAEYTTOEOEN4
458,342,307 *2E8F730176C4F42F6F53ED78391F6F584CEA524C PHILIPSHAKESPEAR
458,342,308 *2E8B6035A7EF0A4F3EF13BE6C15185BCBD00928A vj^o
458,342,309 *2E83FEFFF9DF2D21AB52BACF0B0AE331E67FE0E2 VOCIVES7
458,342,310 *2E895FD2BA757E5FE9EB24B5154BE868FEBC8A8B pinkvolley3
458,342,311 *2E880514F969E3D68656580D7AFE0D3E0F4987D0 [email protected]
458,342,312 *2E893FC5D51731D46EF0832A77CC05D35222837B walter-prodigy
458,342,313 *2E841B5E8E75188FABB486CEB339D0578E272977 WALT.RENEKER
458,342,314 *2E8E85306A09BE681EF6278A18AF9E71856343B7 povoa.de.midoes
458,342,315 *2E80C72A0D7B6133D3E09EA24823D97C1141624A [email protected]
458,342,316 *2E8F9D32D559048FF85BC151A9D34B4E290CE943 [email protected]
458,342,317 *2E865AAAB2166B17CB54515FABB06CB8EFF94B87 p===p~.`splat!!
458,342,318 *2E801530B356D322B025F2FD5494C8E4B2C73650 presentation-of-funding-requests-to-the-Congress.<p>
458,342,319 *2E837E3B8B60FEF2E8DA22D7E3257B40649B20E9 [email protected]
458,342,320 *2E87332AA4896F778AA7E507215ED1579E3BBEB2 PRILICNA4
458,342,321 *2E83E583114F306486D502E119F4B268D87B95F4 WENDY-ONEAL
458,342,322 *2E8E6241977F130F3DA02530DB3CC9762C8ECDEE [email protected]
458,342,323 *2E8AD2D08A369E94CBC633EE55219360CDE166B1 protesteront!
458,342,324 *2E87C031C8383D7231D6CC5567EB8B796154C4FC WESLEY.INGERSON
458,342,325 *2E83D182AA7AA0AFE55ED48DB551F0B92E3DAF16 WESTONROMENS
458,342,326 *2E871FBEFB820647E053F9043B4E09C693289E84 p==>-~-`-{x}
458,342,327 *2E877DB5EB5E38B7E26490BB6E9DB6DAE819AC2A [email protected]
458,342,328 *2E892A6DF1D02E86868076480E2922F9225E1134 [email protected]
458,342,329 *2E82A2CAF19521440B0F89031D6FC2DBB84F2D98 q---->-*->-B0
458,342,330 *2E80D4B74C276BC243DB94647427CA2E2AEF9146 qp363
458,342,331 *2E820FB9F52A8E6D503BBB9C15B7F8E1CD2D04E4 QUALITÄTSMANAGEMENTANSATZ
458,342,332 *2E858C916F90F7F033C65025D98E06BCD85BCEDE quincyknobel
458,342,333 *2E8DB52D3A18C38BCE6CB39C04CFD0C64416AFE1 QUINTINAUSTINE
458,342,334 *2E834BB772CD7B1B32018A178BEB26A2EC86FD54 [email protected]
458,342,335 *2E823A121ADD74C1494CFCD8D9837FEFCCD5AFA0 WIPE-UPBOWEL-MOVEMENT
458,342,336 *2E89EB4512CA7DD630B93F5B643BB0EE5D9F2686 wisher-jony
458,342,337 *2E8F8B681C0F554A484A133FC9CABBA0B5793D15 Wittness.Dreams
458,342,338 *2E8390CD5B9A1A4851F490A5ED3F86C783113E5B RAISING-HELL-#2C
458,342,339 *2E8D6A51D14DB5C528FB86822A947806827DAD0C wnetworkcom
458,342,340 *2E8C15C456742D22B910536D69C286F43F994030 *?.WO
458,342,341 *2E86083D234D334C70FB3E19FE3B4C09F4F201D8 RAPPENAU-1-0
458,342,342 *2E839528D1C5AF5B8A45B1AFB6B1D55656C16213 WOODYS-FARGO
458,342,343 *2E8598A5D0C1C4A43C6C01C0DC690EC3A6C18296 RASE
458,342,344 *2E81AC074F7409B5BCBF14A7D6946847766D0146 WPXRTV
458,342,345 *2E8D250C5DB48CF76426EAAFCC43AA4B4B5D467D WSTEBER
458,342,346 *2E8D48A0AEEFDA7E19BCF830454960C43075FBDF RE4PPR41SEMEN+
458,342,347 *2E8C621AB25EFEF07C95717C1FCC2B3C2C92FF1D REED-HERTERICH
458,342,348 *2E880172E66797DB45A3AB2954820BD0FEE0D932 REGASDELS
458,342,349 *2E8D674C014D0F7BF333CC284DC3E9FDC4AA3BE2 RENEE MACH
458,342,350 *2E8238FB89AAFC56FA14A2A3D6B268D23E4F100A REORGANIZASYON7
458,342,351 *2E870EBE4B596DE327242284C30B29ACC0C94719 REPUBLICIRONMAN0
458,342,352 *2E8B8109BEA06AA22F5DA8B0AF0998242B1B232F REQUEBRABUM
458,342,353 *2E8885E37B4385915777E28B4A91172665A5D38E REVISITST3
458,342,354 *2E8BA92DF5E9F9674D49BE6C623B54B45DBD5394 [email protected]
458,342,355 *2E82A257A0E06420B8A329CE595FF4B33CD0B0C1 rexgeraldo
458,342,356 *2E8FA20388B1AD38E9DD3833048032F8275EF6AD richardgammond
458,342,357 *2E83164958D846D055AF59A1146847E53C37FCF8 XIII11532201
458,342,358 *2E8528467DFBEA56863F449A11FC638CDDD04B8D [email protected]
458,342,359 *2E8310C0D3A22D329DFB21DAE85FB916811E388A rightthisway
458,342,360 *2E8E320EABAB6FDA61F6D5F6E9D28B8235AF0D50 [email protected]
458,342,361 *2E8A280842E8746AACB3BB5052D7FE0DE8A3692B RIZJOHNA
458,342,362 *2E8541B1B3C2E5E01B96D67951AEB96594049B81 RO5MANCE
458,342,363 *2E8301D221F0C4B660B05C5407EC930CE871EE75 Y3554M
458,342,364 *2E81CEB36001A552CA3816BED69AC5621099643F robinlainhart
458,342,365 *2E853052245A492B290EBB415EAB123ED1138AA8 ROBTSWEETING
458,342,366 *2E87C7D0A81B6431FD17C392AAF3001614233CD2 ROCK&BLUE
458,342,367 *2E89C0A15C27D7A8C55BCA2F9CC9437EB9825C4D rodalicuben
458,342,368 *2E844835EE0137EA58231DEF89024C254684CBDC yangzheti
458,342,369 *2E81826D6FB714D1ADAD8DCA118E7118FF31AA33 RODRIGO230394
458,342,370 *2E8866FDDC157F7C33DA169DC99A14D791A84A60 YASHBASIRUL
458,342,371 *2E8EBE4ADE654918DCE28380142F15724933BF3E RONALDSON
458,342,372 *2E811D2A998CCD10EAB3517440DE09C78D19E94A YELIABWOLLIW
458,342,373 *2E8DC676A29268B1365ACC91991C9ECE223B5F20 ros313av
458,342,374 *2E8A68514910B06B9A88F3C6BB4CC09B918744FC YOHANNLEFORT
458,342,375 *2E87946567D5F346C21F7816580FBD0F2D1CE736 YOM"
458,342,376 *2E8D11751882D4939C97C3729B9A83451CED7470 RUDOLF.LABRAKE
458,342,377 *2E865FC876BF1ED67C8719FDBA93C1E371AB6482 RUDYWAGON
458,342,378 *2E8FA13EFCDEB884467836E786134E23DAC0DC5A RUSS.MANHARDT
458,342,379 *2E8A36E1959BF048D79E877CF99582D1A6C2C76A YUGESH-WARI
458,342,380 *2E8881E6B2216298933726BAFC170315CA3E70FC RYOTOUS7
458,342,381 *2E86B2A6E20701DA4F0D6C2BC81399C812DE5CF8 [email protected]
458,342,382 *2E83640835AD7BB933B97EC38C8709708B00CC61 saemangeumdemningen
458,342,383 *2E88063D00ABDD8C71D0A2A129DF731219B73FB0 SAL.BUTERBAUGH
458,342,384 *2E859119B43E8224F75C971053AF89D62653F2D9 SALMA.VILLALOBOS
458,342,385 *2E8E9050BDE3BCA6143E9913695EDD95C08944A8 SALZIGERES4
458,342,386 *2E8371D3F7D64C08056038FEAB8E7796D5B0828C sanfordcampany
458,342,387 *2E80AE4A399173C1D23E54265DEE53748A19AA29 sarah.waldman
458,342,388 *2E8BD75F5D0C62F28ED4CD8A3454430FAB5F985B SAVION991
458,342,389 *2E8ADFEAA3395F92C2E5EE03001067A653C1FF9F ZAHRAA.ABUSHADY
458,342,390 *2E84DAB21242A2216D5B69494095FB378F0C313A ZAHURNAVED
458,342,391 *2E83A1A8FC1ACD670A7FC706E86A0F4CCFDD75F2 ZAM.II
458,342,392 *2E82385C7A341F5955DD7FEAF854B47F386F31D5 SCHTICK
458,342,393 *2E80E2CC8FEF2E1BEBA54AC7CAB20E23B58B122B SCOREMAG
458,342,394 *2E825340CD67E8A4B855AC693B535467277C0625 SDFGHTDY
458,342,395 *2E878E6CB376F737B9CBF1318D289E8680E8AB87 SEBASTIANPENTTILA
458,342,396 *2E894A6002C8185902DB0F29BD5D4DC214FFEED0 sebastianwalner
458,342,397 *2E83C8AB5D2BC2CCA7DA94043F119324D11C670C SERIE.DE.CARTOON.NETWORK
458,342,398 *2E89DFDF0B64455D2C088172B13506EAA9E864DB ZELLA-DELAHOUSSAYE-WALSH
458,342,399 *2E8D1D682B02B1F3D7BDBF4B0C9D278500064FFD zetarad6
458,342,400 *2E89C61BA763F8B222E9D2AA47143A0B8A4D50AD SHAHRIL-ATAN
458,342,401 *2E844296A2C02D691380867E6D8C570251312A12 SHANNA ROTH
458,342,402 *2E84CEAD4521FB21E9998DF28CFB5E9B10C165E7 ZIPACNA4
458,342,403 *2E892C5E32BBFB4B088918D4423E4CFB6C960A71 ZNCB
458,342,404 *2E8FA012BE06E9C9686AF0F947F0BF46E83BA45C SHELBYKANEMOTO
458,342,405 *2E89A2BD0AD95787426BDE8FB47F31685748419A ZUORT
458,342,406 *2E8E160CF4C501582A3C6BCEAC97935638E2C5FB ΑΠΟΛΥΜΑΊΝΕΤΑΙ
458,342,407 *2E8995077A605FEF3C8F6FA59401B8CE7C377ADA SILVER.BIRD.IS.HEADING.FOR.THE.SUN
458,342,408 *2E8D4A710281CEDFAA1C193B927A357FA22B05B2 [email protected]
458,342,409 *2E8335842E3926EF662C014A05C877E10ECBCA08 МЯСНЫМ
458,342,410 *2E8401B756B1300370E10EB02D1CE92C57B4D2AD ОЯМАА
458,342,411 *2E80EC8E16A4505AF652C936CFA3C818470680B6 SLY INTO THE OPEN
458,342,412 *2E8C06A2F83AEB1DC20640474CFD85F58D222988 SNETTOG8
458,342,413 *2E8036532331E03308FC8A49CBFE0A56B9ABCE13 SOLEVANTARIVE9
458,342,414 *2E85704A8BFA76ECA50C7BB6C90B6A76BC2FE4E1 SoMuchBetteratBad(FullIronymix)(featCat
458,342,415 *2E843C5BA786711E1479520BA7BDFC10F733EC51 spanischguinea
458,342,416 *2E8EF40A68F868499340B089B4E66F8BEB5F00CC sporty<3
458,342,417 *2E8ECC171CB5A46C1467CE03EB85E41EF2172781 STACYMARCELLA
458,342,418 *2E864FA2838D440626B8F8BCAD05B7B673DD522E stage-dived
458,342,419 *2E8CB25D815118D072EA8CA78FEF83ABE255E96F stneiarepmirg
458,342,420 *2E81396DA61DCE0EAEC19CA1021EA2724EB91638 STRAJKOWANIED
458,342,421 *2E8537C89105D980C1DEA5734B59A713036EC68B strenggl
458,342,422 *2E81D3D9AD95036479E430DF82A67E3755C71F72 の意味を含み、ソロ活動を行いながらも『原点』回帰となるkinki
458,342,423 *2E82C0E29DCEA2AEA37A873AEDE025F145231D61 suovlacib
458,342,424 *2E8527065E63A6029BEF2FC6B6FE1510B7B82464 susanhite
458,342,425 *2E841FDAE3E7969E65C3E02936B880C1F7C7024A [email protected]
458,342,426 *2E8F9492F2501AA805BB10A21E28603FE20F8224 TANIA.GREENE
458,342,427 *2E80DC85464A9057412EF66DC56CB245E217E9E8 TELEFONAPPARATE
458,342,428 *2E838E40C784F9DC44529302D300A8451882776A tercesraeb
458,342,429 *2E8E12D7AA66799184188F2C9D91DFB183FBCE82 terrellpoque
458,342,430 *2E8B237B0397150B727CCC9F8C72A22B0DB68312 TERRELL.RIGGLE
458,342,431 *2E8E3EA7E77F30F0402E6FDF202A2FE64F5B04E4 012694712bon
458,342,432 *2E81CFA4A7D115563AC37E4A6E775990DEC4FBB5 THATJUMP82
458,342,433 *2E864063FFDDBFFE0C78E3A3DFA7FE3A9C8ADB59 TIPPETED1
458,342,434 *2E88735FA61C69E640341A944A51ACBB6116F5C6 TKCGX
458,342,435 *2E8D68C04D5DF60398339F3560EFF29E36E61AA8 todd.b.
458,342,436 *2E8BF288F5E99E49A2A27F83AB73756E778E2BBB 14.10.1935
458,342,437 *2E87B60B0C5E56DBFD15473D97FB1F03DE02F8EB TOMMY-WINGROVE
458,342,438 *2E85F8E0F0C79FB481F93D052AA7A6280B42B603 TOUFICFARAH
458,342,439 *2E83A7D5DA3C5B2CBA82F0D915AAD0F0A6A7318A TRAGISCHERS0
458,342,440 *2E8F239A6F39855F03468AF989BECAA7CF0142DC trasalirui?
458,342,441 *2E817CFD9CB989D0A1E03F914DBAE46BA1548DE2 TREVORMEULLION
458,342,442 *2E81D420B8DEC009E29D465EC1207BDEEBB37D4C 189ABCDE
458,342,443 *2E87215F12D4ADDFEEB1E0E6D8EC8F8FB242FE31 TRISTANCORONA3
458,342,444 *2E89C3C75943360D199D5FDDBC8DE86B4D5BF20E trusting.a.lyer
458,342,445 *2E8B0579A41393731C10D418D9480D00BAAF7837 tysonsorrow
458,342,446 *2E8A5D84EDC13A3EE349E98B1E978FD33DC0EE0A U>,;
458,342,447 *2E891E7F1CD971594D47FA4F0914B0BE70B0A583 1 DINGER'S
458,342,448 *2E88B3C20E344A43030950C46E1D9CC43EC574B9 UNCEASINGS6
458,342,449 *2E8E34722EC4857C172E8E92E14906F8953F6A6F UNDERPROPPERN6
458,342,450 *2E8A48248D604038AF48BA1A685278CC88992D9E undulat0ns
458,342,451 *2E85D5C16604528AC0F68A58D28E062CBE9089AD 1.IsyanIm
458,342,452 *2E89354280D0A7D5AEBAFDAC13A3364E224592D4 1kilicer
458,342,453 *2E897290AB48EF3797ECCD6F1074AF50479117FB uphills
458,342,454 *2E83FF35BEF80891694C7D8FA75FBF5586DD8F6E VACREVA
458,342,455 *2E816B3CBFB9E6DA4B166C45BC9678D06E38D54D VALOKALAT
458,342,456 *2E87538CB16B3FC6927443AA60EF6D6E48E6C052 VASI-GRECU
458,342,457 *2E82118AFA76BF11D09AF197130AF6BF88C87B10 1-sozialhilfe-kind
458,342,458 *2E82B777032378730FE3AF5DE6AC1268E4BA3979 VEE.LEAL
458,342,459 *2E802BB5E67FFD5FB82952B0D429B37757C4883C VEGETATIONSBRÄNDE
458,342,460 *2E807B0BD10EFFDEDC2C4CF7A2DE6083C10AF9C5 1-TUTUNMALIYIZ
458,342,461 *2E80B3FC7C9633A12AA4AFDC0B5CE07CC4A6A3B0 226473 ASUKKAIDEN(VUOKRAASUNNOT)HAKUA(MM.P
458,342,462 *2E80DAD88BFADB9CFE611F628B7FCCB6DFB14CE8 23-GARTENLOKAL
458,342,463 *2E833085EE8A04CAD124F12026A8DC9A5A36746C 2524vasska
458,342,464 *2E8D108E37D7292B4E661A581252FB34864F6ADC 2-GEORGBRAEU
458,342,465 *2E8F659400E2A0A1FB73F5DBAF416AD0EFE8D408 2kitling
458,342,466 *2E89ED4E40C42FC3AAC10B47C501E25E3225F0E5 2praziquantel
458,342,467 *2E8E1321C26896E14711A19FDAFD150C200D0FD8 WENJINGBUDINGWANG
458,342,468 *2E85AF3D19D516D579A696FA4AAA21B69E725A0B widigo-hr
458,342,469 *2E821BABEE37240078071BE6B982A3A9A7ED5160 3b<~.(b
458,342,470 *2E83197FC0D2534669184810168953B5DD6B031B WILFREDCOADY
458,342,471 *2E8DF58297E364F5C4906F70F1B9C5BF1697F90C 3.schulkameradschaft
458,342,472 *2E828C0DDBB9089D28704F628DA24A6EE1EB916A william-douglas-clark-paki
458,342,473 *2E8A08A205701601D970AAFE2194E395D463710D william-miles-trueman
458,342,474 *2E87667EA3A7436E3E1BE6DEA2D0F2180F3BC1F3 40-reichsbund
458,342,475 *2E8F2306BF061B46E4E97AC2CEA7E5950D7546B0 WILSON.VILLAROQUE
458,342,476 *2E857A4A0BA2E270C7C5F4425C6FD200E04EC7B1 WILTONTORO
458,342,477 *2E85D16CD505ADAB35DCAAC75684B51C26CB4650 WINSTONKORNBAU
458,342,478 *2E8A37B69D1427DB6B48496674D1B503D50ADA04 [email protected]
458,342,479 *2E802FF6FD2F6DA5C281A2AED425F073CF1EB0CF WNL-
458,342,480 *2E8254C74637FC39843ED0ECE2C9F2C9FEE19A8C W~R<
458,342,481 *2E85959EAE5259518FDC094CCDA86C703BE86C60 WWW.VERTIGORECORDS.CA
458,342,482 *2E82DB6982A5F63EE1CB8038723B3D3A768C4FAB WYPUKP
458,342,483 *2E82A058D8E67C7D8829D3177426A7C4A5AE49D4 XAVIER.DAUS
458,342,484 *2E8506BF6BFCD38E5F7F93D197CF0D7DB627D13E X#.B
458,342,485 *2E87E9325535CFC1DFA0BAC6215D4B51528DEF7E 540410 SELVITYSMIEHEN-ON-SAATAVA-TY
458,342,486 *2E80891F406998652B017E72976390839499F73D 564LEA
458,342,487 *2E8E3AB54CE1CB9FE15714BB973FA8D86A4DCAFD 5KAVENTAMISESTA
458,342,488 *2E899AF1DCA1EB66F65F3678F7CD765E294DCCEB yakaakay1
458,342,489 *2E836FABAFB14BC151B5A08E5A0B2A8405391E26 [email protected]
458,342,490 *2E82B3FE03E20556F277DB1091F04E0D76DF98FA 5O8RQUE75
458,342,491 *2E8D3C11ED8DEF7798C540073366A4466918E44C 5STEDFADEREN
458,342,492 *2E8962F4A7A729E1FFDAC277971AD64DFA5C2CEE [email protected]
458,342,493 *2E8C76AD2BD04778FE8A8900F20F5E8E8A473803 [email protected]
458,342,494 *2E8CBB78043F93725CBB708F6A8658AC4875D908 [email protected]
458,342,495 *2E8B563052206ED842FC67F8859D86D098DCF24B YLNEEUQ
458,342,496 *2E83D33E30973B56CEF1744E23E01555C6A23075 671312 JUTTUMETS
458,342,497 *2E8F88DB9B913D74B71388C7B11FB0E4D3E815D7 6DUXMDQBVRAMB
458,342,498 *2E86C433ECFBFA085C18DDEC8F12CD0C35AC1A3A 6FLISSER
458,342,499 *2E879B56A745CCEE158D97E4D89DD493228AF0B9 6HERMANEA
458,342,500 *2E883D0B150F8D88C600BEC7551EA8335580D187 6JONNELL
458,342,501 *2E8ED22A07B5C4D418575C63D8E358DB2DB324F2 zachariahstepleton
458,342,502 *2E86083AF25FE8E1D1D746DF17B1CD359FE8F519 6MOTHERIMAGE
458,342,503 *2E8DD0EEE3BACC88B02827D66E8DB445A407D458 zakldac4
458,342,504 *2E882ED740E2BD1EB00503CD27DDA80BF3D021FB 6TREMOLIERTE
458,342,505 *2E8F65175BDF75A75D1EF65BED739D0D25720458 7ASKN9
458,342,506 *2E80606C0680A4E6D7EBA78E84A40C35FA6D83BB 7CATORIES
458,342,507 *2E84FF9E5BBEF787FEFF51021D847C3D9D93FCC8 zuho"rt
458,342,508 *2E8E7FF2AE3B8768C9EB75583AAF28FFAA0F45E3 «АЛИН»
458,342,509 *2E8B3D4C499F8E9614377F38602C8A40803A94F8 ДРАГОЦЕННОГО
458,342,510 *2E8D7CD008B7D5C83A062954DFA7BE231009109F НЕПОЧУВСТВАНИ
458,342,511 *2E87C12C6947630F453378EB002764AC91FDFE3C ОХОРОНЯТИМУТЬ
458,342,512 *2E8C37C7EE77E99AB053467EE9E3373F1FA37201 8ALYSSAMITTENS
458,342,513 *2E8F237844BEEEC5B16BD2374FBB109AD0B5A1D9 8b ~o~o }8{
458,342,514 *2E8BC6BF1A8107D53D56AFF400881C3C201F56CB 9SHADOWO
458,342,515 *2E87F3FEBD643CD73CEB2AADBAD78FBDE5143547 (0_<)o~.o~.<###p
458,342,516 *2E81C2B4441A0CF3282D53E65D76A81E9E4F1A6E 129CAKES
458,342,517 *2E8FA454770FD06C173B97F1FC5C84DE6DB6D860 A2ETC
458,342,518 *2E8F6EF018B8D6A481ED624755EA71D7CCD9A2DD 1589093 soluteiv
458,342,519 *2E832ED64A2592531B0D97DFACFAF7D8ABC4848A a5b447ec06fa3d1b97cf4beb62ae7774
458,342,520 *2E86CC069A7613E8B62F35193AFC4E34CF1B60B2 A?5SW
458,342,521 *2E847373CB46D199D1EF4CB41D145D7CD735426D a6t(f
458,342,522 *2E8ACAE8215D249010017A0F296132EA10010E7B 1818OCT29
458,342,523 *2E80905073EFE3A970BE64983B296311F5E2823E A9H3
458,342,524 *2E80984F6E6B8D0349C1CB1024FB544D054A3937 AAA41
458,342,525 *2E8F063A9EEE561DF93F98944465357D718232DB aaad`8
458,342,526 *2E84B94BBBD2E66523FE77931DE058238B79A68A 1FERLANTI
458,342,527 *2E887392E3A66A2418C7C51B72E1FFADE751C97B 1.grabschuesseln
458,342,528 *2E8A311E97C038FA2E5CAB398FB3C639032E9A4D 1-grassteppe
458,342,529 *2E890493897971AFF287CD7E73D9B2FBCD77C790 1HAVOCCRY
458,342,530 *2E807BAC64515D4448ACFF8ADC6358B40A9980D1 [email protected]_
458,342,531 *2E828F3A277149FAF45779650E3857C3DACAD2B1 AAO6,
458,342,532 *2E893C2734BD0E8879D4A9798F0015B10B5A27FF AB8[Y
458,342,533 *2E8078278C2DB5E40CE9FEE1D4D9ABB3C52E5B21 1RAPTAREM
458,342,534 *2E88A5E702A9B424320ABF1052110BFACF053896 1-rengasketju
458,342,535 *2E86D4C39B1124E18C04F3789E974B4BC42A31E6 1-ruhsatlandIrIlmIStIr
458,342,536 *2E8EF67E96D883A78A8F420145D8974FFB3EEF56 1 SALCE'S
458,342,537 *2E84EE622F1C332A62C142EB33951CF27A9159EE 1 SCHREIBBUEROS
458,342,538 *2E8F1AD86B0A7017EBAE8C527509E8D7EE7FDC63 ABRX7
458,342,539 *2E8795F4F35D7FF18195D4E6A73E7D7013843F3D 1.suuntautuneisuuteen
458,342,540 *2E842AC1FF42E89A140CA2EA7372FA38D60629A9 1THATEMMANUEL4
458,342,541 *2E88104D7A2ECDE5ACD2CE1EE50074F6D130B64D 1-UNDER-COOKED
458,342,542 *2E88B29F34B92C271E0EAB0043B464985A45EC1B 1.vesisynnytys
458,342,543 *2E8B26AC9F14F83A3B90A4099A1349DDFDE16FB9 1-ZALIFRE
458,342,544 *2E8E48176ED2E5D908971408B3A795578F27468D 1.zeitloechern
458,342,545 *2E81C5F97108F8F5ADC3E44AB85B7384712E36BF ACROCERAS1
458,342,546 *2E8A3BAE820BE242BBE8AA8D1CC329B813795F70 ADDIO DEL PASSATO (LIVE)
458,342,547 *2E89554AF9121D5075D16B5076D6928D9987CC9C 2396321 MANCHE-HAT-ES-GAENZLICH-UMGEHAUEN-.
458,342,548 *2E80B3258FC7890B913EB5C8EE0E01857D9201E2 [email protected]
458,342,549 *2E812ED8B39D67D45542ABC49163315AEAF422BD 2530800 THAT'SLESSTHAN19%OFITS$148BILLIONASSETBASE
458,342,550 *2E8D202B2F50E128F8FD6B16E422E952D2CD2D1C aeaww
458,342,551 *2E8EEFDF7EC123B3BE56572705E73903230E0411 AFAGARAM6
458,342,552 *2E8EA5DD164FFDBBCE17F07D2B68A02032C77919 afsc)
458,342,553 *2E83B13BE04B53A3BE9D28A29AFB1002B26CE21D 2EX-PUHEENJOHTAJA
458,342,554 *2E8602F2A6C0E54AA35C3D438F993C05414A7F75 (AFTER-WINNING-A-RACE)-I'M-THE-BEST
458,342,555 *2E843879BB5AEF4E8AFC36D8A957E5B0EC5D0099 2 ILMOITUSLOMAKETTA
458,342,556 *2E8BD11033C4B78C1D493B883792300B42622B40 2IPZOLDER
458,342,557 *2E851B8883CC3BA4AA4EBE8471B97ADD5F185CB1 agh%0
458,342,558 *2E87A719124728220AB4D58DD062C8B3700D3439 AGUSTIN.BALLEN
458,342,559 *2E81F49E8789D3B40BF31F2CA872B41DE1CB405F 2trek-fans
458,342,560 *2E80A7351F93F58EB5D1675EFB1F4F8CE9DF6721 2VERGOOIEN
458,342,561 *2E8903FFEDA7C91B1CB09FBD6C04E4329D1C1B0C [email protected]
458,342,562 *2E8C23ABA30DED1683C62F0EA2C28E98876EF85B 3-varusmieskoulutukseen
458,342,563 *2E87CE19501D3D5EE8961224BCCFA8C4BFD8203A 3YST
458,342,564 *2E800EFCF647F70CC465F4DE5FFCA681BFA83F83 4BEHTETEN
458,342,565 *2E804823B0D11726995FF3B73FDB4B39A79252DB 4BRATFETT
458,342,566 *2E84F93034BB882D40019E2B9A0871A4D17D77E0 AMERICA)という名前だった。
458,342,567 *2E8B60F73B75F1BCA85E6AAB62FF120A554BD4FB angelojesko
458,342,568 *2E8C6555C57DED8A3D27F9A09405387613D1CADB ANTIONE.ADGER
458,342,569 *2E87DD57618819157649E1649E8ED6A8E8EAA085 ao1)
458,342,570 *2E892135BC0D29CC5110BADADD7C7377E0A59646 APACHEJUNCTION
458,342,571 *2E835372132C767624B15EACF9ADE5FAB8FF9406 ARCHIE.ARTOLA
458,342,572 *2E87F8FE1ECEB64A04B6EE988D352E0C25E8F594 ARIMURA1
458,342,573 *2E82BF9355792E936D098CC09C4CC22061433A7D ARON.SCHLEMBACH
458,342,574 *2E83190B3290387DAC919D98CA1EDB4D192933C3 665028 her.saGlIk.kuruluSu.emzirme.politikasInI.hazIrladI..
458,342,575 *2E8E266A2ED0B4FB3B41F70B1112128BBD90860C ASHLEY.LEHANE
458,342,576 *2E8CFD8868135B3B6EF71A8E3B217A5016B32537 assistancei
458,342,577 *2E80FDAF016FB21ADD1C2333597526DE664DDCF5 Ate1
458,342,578 *2E89CBF7570D423E83195AA2BBC2A801A02E87F6 6COPPERMELANIE
458,342,579 *2E84A7EAE704CA1BB0A7B56E6310E9751ED54D2E A=(U/
458,342,580 *2E87818CBCEF6AA546F30633EF9B0CBA6746950B 6FAMILYJKM
458,342,581 *2E8F54DEF2B1CFD7065AF8A6485C863FD55703C7 6HERMESSES
458,342,582 *2E8EBADEF3EBEA625F6F30CB85C186F1EB314E2F a_uqp
458,342,583 *2E8111C12EA5E612244462E0639560CAF738816C AV;l
458,342,584 *2E84A6656020465DFF34AA76A80659253A5C4A2C [email protected]
458,342,585 *2E84E2BBD94836D3814E985B4149B1A32319DF86 6TNUHTOP
458,342,586 *2E827C6C8BA8E0AB512F4E8A2BDABAD20761A29D 6VGAHWINIT
458,342,587 *2E8F5FC61ED43574EB0944E4B85C1D35A0A13407 b?.
458,342,588 *2E8CDC8F837F3F80824CA16C2C12006D359C1CFC 793890 ".l
458,342,589 *2E8B7C6ABC66C0C742F8A1527A2691BFD41FD13F B481K
458,342,590 *2E830E6ED64ACFCB6CDBC0BADE7973CBE2472B51 b4nd1tr1e5
458,342,591 *2E87C794C4ED91C42B21680FAD8886248457EE9B BAPSCHINOHILLS
458,342,592 *2E8C22DBECDDB74C2ADB78C93EA3E65739E77A43 7SLACKERBLIZZARD
458,342,593 *2E86C4BE7F3E3A07DF8FB7400DB2183B3513FC38 bb6cs
458,342,594 *2E81D95007D317CF7A676EEC0B46E9E6BE5414D8 bdmqtd09
458,342,595 *2E8F385094563D3B49D8051F3F8184E526C4CAFF BE(L-
458,342,596 *2E80F99777EAF071474BA87487B7E885A921E924 bel|pet
458,342,597 *2E85E0EED316C3FBFE725E3AAAAAED5200AC3A1E 8EGIRAJNEIT
458,342,598 *2E87F293E4B1B6D064B4D17E21AF427FAE4A5CAA b%ew
458,342,599 *2E82FE9D1B371567B71D9554C717C5DBD2A04BF5 8iloveayelet8
458,342,600 *2E8FA800469C9A2BA749C22F77ECDD11908E9259 @[email protected]
458,342,601 *2E8444810B105F8FC64816682997CD6D6A071650 b$i8&
458,342,602 *2E89F1B223BDC2B09762A64271968F669BFD26E6 8SAPHIRSAPHIR
458,342,603 *2E8D7E9E2FDD13BA943F47260C597E39DC94BF2A 8THATGENERAL5
458,342,604 *2E8BB733D750DDA3E845991ABE19E7768F84C248 BNI%W
458,342,605 *2E86676D6690E3CC91230E0C863D1BAE2F09349C bo1h
458,342,606 *2E8F0AA18E28BAD67746237C810AD57654E66A7D BOBBIESISKEY
458,342,607 *2E853C078740C387219AD3460F93CBB274444CB2 9FORFRISKNINGERS
458,342,608 *2E8B9996555FB6946C9651B7FB70E80F5844BD13 boom-dah
458,342,609 *2E80DDBBDBE4108412CD6E61B2B0B7DF7A8DC0E3 boundaries0
458,342,610 *2E85AB48AABC26CB6E10E0FDBCA8F862B1974622 9NPTNAMERITECH
458,342,611 *2E805FEDB8E4182BEC7E314DF964AD1FEDAF90C4 b-q=#
458,342,612 *2E8F661FB9845149873FB42C5AB89C76AE9E376D BQKB
458,342,613 *2E8835A5033272B071DD5987530D8F3AE063B5DA brainhunkele
458,342,614 *2E8887099A74217C618019D1E6080D00407FBD00 9U2YVE
458,342,615 *2E8C6A8748C64761EED9C74D503D076BB7CF4B20 9ZS79TMFFNGTCK4WJMTEPA
458,342,616 *2E8F0C30BBF717E91A3FEFD866DC661EDB428306 bta
458,342,617 *2E8B8C95379D067CAC5B8FD14D7DFEF024BFF290 bzkor
458,342,618 *2E85696CF56D9D355A19F9F2BFC1E8DA52FEC106 c2rlr
458,342,619 *2E8ADC294B3592338FE3EF0F7B68D5F1C58E70B6 ack!;
458,342,620 *2E8383207711AA645CE0658D2F554C3444781D53 AC_RA
458,342,621 *2E861B26C85CFB0083BE8F35266DDB62C48D9CEA Admm
458,342,622 *2E8278D7A99F721FFE84C459F838852B0EE8F049 AGARDÁBANSE
458,342,623 *2E8F8C0AC856352CE41F86C78A64DA332BA19226 agccg
458,342,624 *2E88400C0FAFB7BD91F741BB28878E73DCDAF3C1 a+jrh
458,342,625 *2E8FC68EA09A0488B8D627EF0E5D9DA22A6D5500 ALFONZO.FAUBEL
458,342,626 *2E87319D8B0894B5B0490E75243EA1E204F43D2E CDN/
458,342,627 *2E80795F6AD4B3DB6488AC53AEC43C2D79BC2C40 ALLANCEJANT
458,342,628 *2E830FD464A3EE036D79167C656581AAAC323E9E ALODI
458,342,629 *2E8BC87A2264093CED86CE4A2339B105731C0BFE anglesandsailors/stonedimmaculate
458,342,630 *2E86E3A0C42BE140EA58B2C80D660A50A79437EB ANNALICE5
458,342,631 *2E8CF17A065550FD35C74FFE32D7F49ADA321AF0 chicken licken
458,342,632 *2E8E7D7849B4E84F598FF3F25A7ABF3F38850252 [a]-page-of-history-is-worth-a-volume-of-logic.
458,342,633 *2E871E5DC82761DF357E53DDE2FA054D10E6CEEF christianmayer
458,342,634 *2E8E8D3E6788DFABAB4ED50A4878A121B5758B83 chv8
458,342,635 *2E80755D7BF572D809CCDC76E02937DBCEFDFAC7 cklhb
458,342,636 *2E8ABC495B0E6C896E3DCC085FBB36D8998BA2D9 ARMANDO.KOSCO
458,342,637 *2E8BCA8647B9CDE9DC000A5E121B3B791DBC6B7C CLARKREVETTE
458,342,638 *2E8E8A4A9B0ECCD373B2B065C1DB63EDD5941414 asentida
458,342,639 *2E8D4A801996439970D4ECC1AC56705C054AD551 colbytoppin
458,342,640 *2E8D93170023B9B5A882DDC258E4A9A2D8052B04 COMMENTFIX
458,342,641 *2E84BB17C0BED2662BF7A12768403065416BB536 [email protected]
458,342,642 *2E8EDECF14A6F9675263766D1356A4195854654F ayurveds
458,342,643 *2E8122390F39118085C8E11237A47F8320D64747 [email protected]
458,342,644 *2E893699D787F0465C601E5F2723C1643611D138 bahlikadesa
458,342,645 *2E86046EF4A0F962D83D24A898B58C662C303640 CUIMODI
458,342,646 *2E8D823C21EF025748D108CBCF0C27485616BE3F CV/8
458,342,647 *2E8D934A4CFACCBB4C2D43F108DED11D5C3AE992 [email protected]
458,342,648 *2E8761BA7680F9DAF5AB0CC3757AA74EF3EE29FD daltonlieurance
458,342,649 *2E8FBEEFB33145AB54A37B9201B8A9C486CB36ED BEW
458,342,650 *2E8D648D028918ABFED56D803E837F2794918989 b"g9b
458,342,651 *2E864D04943E547F7A03C3BB606261EF2C0233DD D&DH,
458,342,652 *2E8DDA58FA56AC84DD982E8A0A7538D941BACB8C BOB.DORWARD
458,342,653 *2E82E6295FF687DED016D0DD822D583290EAFAEE BOBFOSSE0
458,342,654 *2E81C0A388C17A205BC432DC8CF696C42D68191C [email protected]
458,342,655 *2E8315D0817202AFA37E1ED5269042327A6229FB d"e!x
458,342,656 *2E81E7CB6931E896DF39307FF9974B3B4A2FCDBB BRADLYSCHROY
458,342,657 *2E8D120A29DC6773FED7C86BA204FE555860DA83 D#KHZ
458,342,658 *2E88FC1C6DA259C484F4E62BBB7CFEF61E1AD463 brentonsouthwell
458,342,659 *2E8F74E7B7F12950C762A3313571D2BC54A6583B BRIANLINDSLEY
458,342,660 *2E8B29C7F46FD423CD2BA6D9FCAA2DDB7828D075 dnkd+
458,342,661 *2E848A7C7B1D6F9B5BA9CEF488B3F9245A2E1209 [email protected]
458,342,662 *2E807BF055C5D2CC69C6D9A0DB9AFFAEEFEE5082 BSY&V
458,342,663 *2E811CC9ECEA01B6BA8259056D6D8DC26206D21A doyleyelin
458,342,664 *2E89EDE03AA3C0B5FF45EAE86D52F843DD960F62 [email protected],
458,342,665 *2E8171D5929C81ACE74FEB3F6C291350341EF8EC DQ4A;
458,342,666 *2E8FEA7D659DB976DF6E11B551F1C099B4014062 BURT.ROZYCKI
458,342,667 *2E8AEA55CAF2458ED89FB42ADEC70BA48B71EA87 buz&/
458,342,668 *2E832FCDD54FBD03A19F3D0B3D37AAC5E9642060 dqwo
458,342,669 *2E87ADDE32184DB4FB7ACEDE921F874A29A1603E bxokm
458,342,670 *2E8CB15B22973A7BDFF68D6BD99A2196A7459D8F [email protected]
458,342,671 *2E8D3C18D369F6B9B5AD282589728E3D8E4A9CE9 dylanmcmonagle
458,342,672 *2E88DC20BA0565E3A9205DC09084CA344B6C0BED ECWMIONING
458,342,673 *2E839477082A70FAD0DA62CCEA08ADAEE8C6E32D EDNECCAF1
458,342,674 *2E88C70F80079B325642ACDFA8AFA3258997C57E ccydy
458,342,675 *2E84ACE0FC270DBA21235941F12CAA2D5FE5C701 [email protected]
458,342,676 *2E805CAEC88A8E10EE8E9C3DB3B474151DC41653 cf;s.
458,342,677 *2E8CEDD0BDF1520B5EF6DEC7791F1D60AB8819B9 c$,;g
458,342,678 *2E838270B9882F0DB1127D63FA4F6F2BEF8E68C4 CHANCE.RIVLIN
458,342,679 *2E8A88A9223EC15DAC1884330B952A04469C835D [email protected]
458,342,680 *2E8B364F18EEE709DEAA344CC7ABA9B69C9E648B EQ6QJ
458,342,681 *2E87F46838F797D22AA38885B0DDF139AFF1F18F CHARLIEBURGOS
458,342,682 *2E80894C2D98CE4ADC0029A809865A89C107377D erhebungsämter
458,342,683 *2E8CAFBD82833183A05AF5AA702CD709D8D94B04 CH?HJ
458,342,684 *2E81054484DAC7E654FA53D2ABB16F07F34088A0 CHRISTIE COPELAND
458,342,685 *2E869AA817DC3F9F05E8FD019BB6B500620A3B1C CHRISTOPHER.DUITCH
458,342,686 *2E84E9E6F383382853910215521C51ADB04B9DF1 ETTELPPO5
458,342,687 *2E8D5BDD598CD01ACEAABC7551D1F08A7553ED92 CL2E7
458,342,688 *2E8363E942AE75201F637986D81848BD0B5EB2FA claudiotallant
458,342,689 *2E8C3631293B2D75EAD432A714A25BB7DC9749A1 [email protected]
458,342,690 *2E84CD9CABD48230A94919D4E2B6687737000F09 FA+1CHERO
458,342,691 *2E83C7505B361B49747260C5989A531C37BD3B70 CLINTONGROHMANN
458,342,692 *2E80631A9812AC5F099094CEBBBC721176A7AD14 CLINTONNADER
458,342,693 *2E84D78162F1A8A2345ADA8C0C2650D631446131 FETISHIC9
458,342,694 *2E8F653DAA4EA2267B6883226CE7AE8B91CC4E06 filled-in
458,342,695 *2E86D395D204E67B5F1DC4EBD83F0841078A098A COLDNESS
458,342,696 *2E8E6763A874E15624E1207EF7E3E87835E63536 FLAMBEEUW6
458,342,697 *2E8C5CE076AF05478C8CB332CB391ACC8C4BB8CC FLORENTINO.MILAK
458,342,698 *2E8A6B9558101DF11A41BE4CA5A075DC88C21C96 COURTNEY.FINDLING
458,342,699 *2E826E78D2AA2D4619DFE8780810717370E34790 COWL12
458,342,700 *2E8C552612BF7EBA8F35255380448E65E82E136A FRANK.KORTGE
458,342,701 *2E8BB5E842993BBD208D8E162E1B80A7F07215B9 CRASERIONS8
458,342,702 *2E8F1191F91BCBF63B27A763AA13EDA86753768C cristy.argueta
458,342,703 *2E8D51439C3728015DA50B995E80A66B70AEFE39 CROCODYLUS.JOHNSTONI
458,342,704 *2E8C229C2E172232C26CF4C3D95BE48FC4FC4DBE FZ^X
458,342,705 *2E85A435CFB1F1D46CDFAB33B17A1C2B89F9F4FF c:srg
458,342,706 *2E87CD7A5C00903C03BF5FB6B3EBB80C959AA601 GARIEP–
458,342,707 *2E8DAB72ABD459EAECE21150C208E3ED25A3F8B1 CUO;U
458,342,708 *2E8D7811713E08C8148969F1ED20D1297701E058 CYNTHIA.CHOO
458,342,709 *2E85E4E7CBCB5C19549F46E8AC3A5103B957DD3B cynthia-mazza
458,342,710 *2E8571A5A432C8E195D624693BE2CB2A59992E9E CYRUS.ZELENY
458,342,711 *2E829D1D86A46D59F276AAABE003EB83A67C698A GERMAN.HINKLE
458,342,712 *2E81BAB1D1D284B0153EE410DCB66034EB7645B5 GROEPSLEIDERS5
458,342,713 *2E817BA2574E0F4DF0970D50F73EFA3818B33906 GROVER.MATTIONE
458,342,714 *2E8FFD90F07A72206BE55204F1958D848FF16B2E DANIELA PROC
458,342,715 *2E87E60C3A8554C1345F9ABA77ECB655753E46ED GUOGEZHA
458,342,716 *2E844DD89553F4163CDFBF95E839723AE5CA9FE2 ğz
458,342,717 *2E88545B5C61DC112D604247CA483FA9477F0280 [email protected]
458,342,718 *2E87C406DD676083267E8DA1813FBCE980F9C6A0 dea1b
458,342,719 *2E88643F7B05C9A684AD663150D7036668D73C72 HEFELUMP0
458,342,720 *2E8ABA8BC3E2296FE4D8BFF9DC52E3F661D64684 DELEASA2
458,342,721 *2E8F1191CE63C59F54FE35EC60E4EB3C1E2D1465 [email protected]
458,342,722 *2E8AF0ED5F06877AA350F3BD11A952BB07B5F2C0 denise.barton
458,342,723 *2E8E358FBC8028E322300BEA5CFECD2E26149A01 HEY,FELLER
458,342,724 *2E8961FB299190A19C57D28A4045D2D5E48C3570 DESZKADOB
458,342,725 *2E893909F81877C3823843D961821D19427B373F DEVONFABRIZI
458,342,726 *2E80F261F2BCB66F453556789B42DAA3467F0299 dewaynerosato
458,342,727 *2E804FE1163029E1E283AC6207CE9573D85E1739 df%ub
458,342,728 *2E899CAEBA3D3E19A720540F70814A31186E4CCB differem2
458,342,729 *2E85A0613FDCC5AC97E27E6985FA0131D9EEFB8A DINABALLESTEROS
458,342,730 *2E860FB4101257175148A73B7C93E3B621811DDC [email protected]
458,342,731 *2E8467F59B89BCD96FF921FA28E50F910DE34BA5 [email protected]
458,342,732 *2E84C3F00B2B0591ABB8D40B26CC6D5BB54D4180 djn.-
458,342,733 *2E80DC5DCBC048D16B7488819321EB88F062C7D1 [email protected]
458,342,734 *2E865837EBFCE2466640BB5EBA0708D0781EFBB7 [email protected]
458,342,735 *2E8597A9B1EE452AC4051F3AA5381E5B12F50FC4 I1093401691
458,342,736 *2E823E885DE3DB9D68B9B04EEC148DEB9647E8D3 dominickostrum
458,342,737 *2E83634D1392BD87F1F0B017E27D72BD3FA30EC7 DOMINICKSCHAUNAMAN
458,342,738 *2E837A07BE6CC7D1F3AA10E54D52DE1257EADEE8 [email protected]
458,342,739 *2E86B99E81DD52F8DBAEE9F12DAC7BDD22F204A6 IBULKOLL
458,342,740 *2E86C6BEF33A8ED45182D41796804E3404A19A40 i(dp
458,342,741 *2E851CCBA5FBCE4DE38F87D819DCD7A469B87BED DONYORTIZ
458,342,742 *2E8CEFEB187C24F995AF93FB1771BF4A303F9FEE DOSLOVNY5
458,342,743 *2E8E8E00A1FC434666569F5FBC316633F7B8DCAF DRUMSWILLCOMEOVER(CLUBMIX)
458,342,744 *2E8CA227609F826EFEE18269350011E7AF865ADB incognizable4
458,342,745 *2E89F38AD5FE76A7829CAE71EEB3E3D99A6519AF ISRAEL.NIER
458,342,746 *2E8A3629348783235635A858160622EFFC326D5B DXWHR
458,342,747 *2E87A40D1CFBD0AD53E1EF0616FE3463DE91AE7F [email protected]
458,342,748 *2E83F860E2D143DD977AB8F8682A691627524D5A [email protected]
458,342,749 *2E813D269710EF7935017B86BEF9E78D15A89534 effacing
458,342,750 *2E8379E1957225F8BADDEC2C22905879DA991792 EG5OL
458,342,751 *2E81557D0BFFBCF51AE7BBDAC87ECF1774CA727E [email protected]
458,342,752 *2E8BE0E433EEFBCBB0DFF652161E3DB95C7A6CD2 jimmyrichardo
458,342,753 *2E8EEF84B9439D8531877B09837F0FC17449F7A2 ELIMINATESELFSABOTAGE(4)
458,342,754 *2E8932367DB487B48D218186F7DEEE572DE43BFD JONASHRIES
458,342,755 *2E88CA13C6D17FFAE4A3EFC05CA5BA9CE01D405D js650
458,342,756 *2E8A31CFB12180BBD055956145C2053C198CD7C8 justin.baize
458,342,757 *2E83D9A11C6FE3AB156E0D14C642CCCFCD9F8C52 JVADUKUL
458,342,758 *2E850FF78AE2D89A6E4CA1CC0DD474A758708DE5 eoqtl
458,342,759 *2E85C84C6F0093F52F2B6CBA673A98A4A68AF03B KATHIE EASTMAN
458,342,760 *2E89BBDFE85BDD6DF3DC13501FA297099B30C396 ERNST8419
458,342,761 *2E8D612BAE93C1623B2296F80DA7004C7A21934A KDRFLK1.9
458,342,762 *2E8AC5ACC03C4FEBA0668895DCCA84AC4DFE1B71 [email protected]AIL3COM
458,342,763 *2E8943C1FE463DB4C8F387A9E5C2C0E86077AD25 ESGOTAVAS4
458,342,764 *2E886B57676044234B73C891B44970247E101746 ESLABONARENS
458,342,765 *2E86E3A0EF16F92BB0705D65E3C223031AEA8BE3 KENTKLOSTERMANN
458,342,766 *2E81E0222FFAAD1CA74A4BD1B3BE115816EF78EB EXPEDII0
458,342,767 *2E80B407D8353EA88B16BD2C30B110C2FC29CBE8 EXTRACYSTIC7
458,342,768 *2E8FB0D4A6AF2650DA4EBAD529791E40F79C518F KRISTOPHER.GILHULY
458,342,769 *2E836D23B1ED73C3C9E274B4852F0C276AF01F26 LAI_XIN
458,342,770 *2E8F37FA20871AD7642FDB010FC0355ADA6F8977 FELIXTODISCO
458,342,771 *2E819CB72A32803E4A62AA5A2488171178917ADD FEMINISTINGCOMFEMINISTING
458,342,772 *2E849F265258A3F8974BB3E7FAA3FA8E366A6282 LANNY.REYMAN
458,342,773 *2E818965F613A953B442161076F3F4CF240F7501 [email protected]
458,342,774 *2E88723710CDEBF741A7E700A581C8593CA273D2 FERNANDO.MCCARN
458,342,775 *2E8BA4FC5B25D043AF5BBA1046A4A68C588E056D fetid.A:.fetider..fetidest
458,342,776 *2E8E33EAA527080442F568CC91365A752704EB14 fezr
458,342,777 *2E8B3592C757C117BE1B7A904935142C024B4C88 [email protected]
458,342,778 *2E89EECB444C87509CB17293C2B4735DFBF41F4C FRANCE—RELAY
458,342,779 *2E8347AAB33A41C6D14925A4AA7879767CA2467A LEI548
458,342,780 *2E89F9B01205E3D3F0ECC2D948796CEE0F079DF6 [email protected]
458,342,781 *2E8F08CBA719FA593D0DBA935CABDC5F1DC22AD8 LELAND.SARTIN
458,342,782 *2E8A840012A3FCDB457CDCD78A39EFA08A20A67E LE-MEILLEUR-DE-RIKA-ZARAI
458,342,783 *2E85521DC36DA952F9B317E192647111410AF91B FREDRICK.SEBREN
458,342,784 *2E8B0F2FC8D3B5579528462AC952E312BC7AF715 FRITZ109
458,342,785 *2E82E6AB42001D5810B1F0EEFC503BE43D0CE223 FUKDYAMOM
458,342,786 *2E84E273262F68D1299C59C69232E2FC2B96E1B4 G5BF
458,342,787 *2E80DAD5E24F771C26DF0B7F8F3CB17C2B1C27E5 ganisconsultinglatchesontoastonishresults
458,342,788 *2E85D8BD5387BC1DC3F987F4F29D214EB356B918 LET'S DO THIS
458,342,789 *2E89D3644F0472F16B2733813D7720013BD79DA6 LEVURES8
458,342,790 *2E800FD4334F53C29F5584166E7C38A82302EC46 GARY BROAD
458,342,791 *2E89CC05BCA9485864A817D93D3A524771B71242 gastgeberen
458,342,792 *2E895548BF2EB42800ADC41A7BF1C3D04DEBE427 LIFENASIR
458,342,793 *2E88F0C501DFE72EBA298DD0278EAA4EFC5E7101 LIJKERIG
458,342,794 *2E8C525E653B8E042811139B780F92FEAD50A594 GENTLEIHOR
458,342,795 *2E85E660D772B667B30C1D2013E392BC91F16284 gerrywaszak
458,342,796 *2E8443C4B032ED1A05057841FA9849A4FB20487C [email protected]
458,342,797 *2E8D3B9956E116A3D8BF9B23B508FE29E2E2872C GISELETHOMPSON
458,342,798 *2E8E9922F48FA56A9B5BD296F8F3F42DE3BB86BD GIVEPEAZEACHANCE
458,342,799 *2E8605AE3AA10CDF5E9D6E9871451E7806E6785C g{lx
458,342,800 *2E8526B67E6D07142489A4956549A5153B4B6D1B [email protected]
458,342,801 *2E86BF8D4E4029F560AEFA11596F8365D685FAB1 LÓPEZARETCHE
458,342,802 *2E87BC709B72AE603CB4B350CED85C2535699168 LOUIEMARIE
458,342,803 *2E8BB831FF84693D17EBB5A32CB1C5E6318E9B80 lrdjovwi55
458,342,804 *2E81CFA556A4AA730D060E70A377E1953E5EBBDB [email protected]
458,342,805 *2E82CB8B1FACB80C032A734A710DB31C56D60725 GROWLANDS1
458,342,806 *2E8A8DD4EC234EA154212CA0C6FF537722197AFB GRUZINSKO
458,342,807 *2E806C2AC9D06EC190FCB9D36B79474493AB34ED m3+h0diz3$
458,342,808 *2E8A0092208CCB2F7FC7335635136EE02A3A12C0 GUYCUMISKEY
458,342,809 *2E8E1A427F865DBF17CBB5AD04A1A3B3C0CE80E8 MALMENS0
458,342,810 *2E8EE255FE43E772CAE264A2A1046D85D193B79E h"aaa
458,342,811 *2E8EC33F93B8BE93C518BFD0FF6E9B792B968BBE HAEKAEAE9
458,342,812 *2E8CCEF146D473DB902F56EDFDCB1FC2F7A811BF mark-bowne
458,342,813 *2E87BBA6C35822F01CA369A8FAC8649228F587D2 halakist4
458,342,814 *2E825933F3586BC932E6ADBC6F591CB573602108 MARSHALL.GARTHWAITE
458,342,815 *2E883BCC482DC705D31DB8DC7324A31BFB3C8C78 hanpwormalnhr
458,342,816 *2E8F0CEA90D83353B275BB83AC5321013BF9E4E9 MARTY.DEQUINZIO
458,342,817 *2E8EF90D9EB373A6E545197472319B16CA0FCFD8 MARVINLABORIN
458,342,818 *2E89BA1618377ADFA87B803465EAF7FE5BBB7D4C MARVIN.MAZARIEGOS
458,342,819 *2E8170B756281ACA181DB3378F712D153B9003C9 MARY.HUGAR
458,342,820 *2E80745FDE878077AE9F54C7250312B054B4DF2C HAQRMOBILE
458,342,821 *2E8774BA99EE6B7AC30984713CFC0D5984A547E3 [email protected]
458,342,822 *2E860D5508B56E559784717C7786EA0DF73DAFB9 HAZELHUSKERS
458,342,823 *2E8B07080C5F60A7A7ABF7BF59A26A57EA9F4AF9 MEIWTIKH7
458,342,824 *2E86D84DE71819B4830BCDA32CA90A31273AC4FA HIKATAREWA
458,342,825 *2E830B725397CB26A85EE14F5931783EB81D7404 milomalcom
458,342,826 *2E8F9DF0BFB57AA3FA3A2FFB96A14630013E6048 miltonlimthong
458,342,827 *2E8A9910DE60041815EF751408CBC68BA08FEBC4 historienmalerei
458,342,828 *2E8322C64EE9F3C8DD80DC40D1D5EDEBA361658D [email protected]
458,342,829 *2E80C5C24EBEA186A89BD86CA21E3FE433CAA10A MISOSHIR5
458,342,830 *2E8AF1F806D4E70C125A75C9BD2D14AA7A6242A3 MIYA
458,342,831 *2E8437CF7784F9C6F760A73DDDC0EEB0033E05EC HOOTIETRACTOR
458,342,832 *2E8EA419DE6F13D6079FE91898DE0DE731B46AB7 MOVINGDISMISSILE
458,342,833 *2E880A921D08B594D3F3E8FADCC368398653AEA9 MRMRBMA2
458,342,834 *2E877B7F2DFDA5491C3993D49719EBAC3759C464 HOYT.CORVO
458,342,835 *2E84E910815DF0F48B73039C1AAE26C3C83F14CC [email protected]
458,342,836 *2E8042782228B3AE6F749C01FB88E0D8EC5E0F5F HRISZKIEL123
458,342,837 *2E8BA6DBBBF188BE2E529DADAA171FB300B8C78B mundhuggeriers
458,342,838 *2E88C729621671420845EDC23374AD375D57D988 HTTPWWWRFID-IN-ACTI
458,342,839 *2E835D8F4B2C37A0CD010570E751DA2F3B2DED6F MYLASER52
458,342,840 *2E83665D8E6953B9A3A6DBAADB1157A45D1468F9 N99549
458,342,841 *2E8999315469B96483229741861D56D46B640320 HUNTING-HORN4
458,342,842 *2E8FDE7320DE0AC06E870450C5E13C293C89B4FF NAFT'S
458,342,843 *2E88E9976A7231DE820FF9CB207DF884E09BC15B HYONYONG7
458,342,844 *2E874D18E435DC0D2EB75A6534B6CD0A416E6D92 NAYAMARGA
458,342,845 *2E8B894208610EB9789ADBA5EDB1945BB6450423 NCC1701SPACE
458,342,846 *2E8CA89A80D1C48A7BF0ABCC45F12BED7874AA15 iamjourney22
458,342,847 *2E84909A0004A151851CAC139556C8671DC6086E NEURÓNOCH
458,342,848 *2E8186D5B4CB27AA068B4AF2F04AE2C422AC5271 IANHELVESTON
458,342,849 *2E83E5B90A80A45DF0AAE34468A22B651DF4B9D6 IBRAHIM-KHALIL-ALIYU
458,342,850 *2E8483835FAEFFD6530AF0CC1649303805D08A14 ICHEMOSEKI
458,342,851 *2E8F836E073162798D7D08EB1D72EDE331F35835 I-DIE:-YOU-DIE-(GHOST)
458,342,852 *2E87DF3017AD42880FD30507C9CDAD7F611CE7F3 iea-nea
458,342,853 *2E85E1F8FD5BFB416CFD7CDFD544B5AD349030E0 IF-WE-WERE-TREES
458,342,854 *2E8159D68DE9A3397B6116FD4842C080E0E035BA [email protected]
458,342,855 *2E8DD6D4B504EBBBFE21D6B578ACE783746BC5F4 [email protected]
458,342,856 *2E8D8F371F93AC64A3D08DEED4D25D43E8291B73 no.goodbyes.no.regrets
458,342,857 *2E8E97547186277FEEE2021924B21D6FEF7303CF NTPRPHRL0
458,342,858 *2E82FF4E9CDEB3B4799F345AEF5087AD30C1179A NurSiege-KeineNiederlagen
458,342,859 *2E89A2C09A067A213C9C59EA62EE4F30BCFBCCA1 INTERPRETIVIZAM
458,342,860 *2E8842C2AE0A6A93EDC2F1CE5A9C6F250DC7DD5D ontgrendeldens
458,342,861 *2E8A631CC19B13FDFEC7053100F99B0A6E423014 ireign
458,342,862 *2E87BAEACAE43B52D7EA9635A7682704534D8441 ISSUE.STOCK
458,342,863 *2E8E9DB3E39E28B6DAB851D418B692568B1538A4 iti0
458,342,864 *2E82847247CE1BE7A559863BBE3F3D55DD6F269D I-WANNA-MAKE-YOU-CLOSE-YOUR-EYES
458,342,865 *2E8A7797A817C83289F1D3F3C5B408DCDC7E20CF OUGHTED
458,342,866 *2E85F9C89C4006D281C3B3B618599B26BE4D2EE7 JAMAL.LIND
458,342,867 *2E8F5C27E75FBE7518037802E0C9CCC3137A8278 JAMES.HODDINOTT
458,342,868 *2E84FF916476E6EFD22092506B5AE04CEA432098 PALE0N70L09S7S
458,342,869 *2E86FE971C9545ECD85C7173E40D225735171D14 JAYANIMITTAṂ
458,342,870 *2E8FF8A14CF63F74DD9F24CF6B9A4BAEF0285C7F [email protected]
458,342,871 *2E81A4B57BFFD7A8573805DD0D46A5B34021497E JEFFEREYSERATTI
458,342,872 *2E84276347ACD7FF1015652BFD33CED88F619D55 PASTORIL4
458,342,873 *2E85CE4F4689DD963730328C56FB275B23A1EA87 PAULINEHARTER
458,342,874 *2E8763CBA8643B18E9A57AAD745509ED95B44B04 P-B.~O.~O>-B0
458,342,875 *2E8E04331EC52D48F39F2D52899EBB81DB09B649 JESSALYN-ECAL
458,342,876 *2E8A52AF6D6B235115170EE6640BE6C3A4AB877E PEGAH.GHIASSI
458,342,877 *2E84DC4A3DC127D588E550564C7D945093351D7A PEGUERAS8
458,342,878 *2E808AFE0ED5BE718205207B985F1CC319A37168 [email protected]
458,342,879 *2E8DCDEB9512CE881AB45BCF3936E950334A3208 perhaps-we-could-wave-your-towel
458,342,880 *2E87A015BA916B482625C5CC92484F3084436B40 jin.roh.-main.theme-.opening.ver.
458,342,881 *2E834ACD6D587DEC99AD9CED0F4B412C5DF24A45 [email protected]
458,342,882 *2E8A62A7372EB13ADD6F9CF4DF8D1CAD112E19B4 phillipotremba
458,342,883 *2E844B239E4A85DA65250ACBC7DCF806AC95F3B5 jobs mixed.bag.of.goods
458,342,884 *2E8F0A0561D73A25C5740547FB19975D5EDA3A26 pianomatt
458,342,885 *2E8D25D89FEB81AAC0575FB2621A158CEF0CF0BB johniekizzie
458,342,886 *2E8EF12E1417CFAD8F16736B25376F7A701C9C03 PIONPAY1AA2N
458,342,887 *2E8212E7B81031BB4086EB066D78635312118646 POTKRALJU
458,342,888 *2E811475711721DD073CC7BDB0F1F57FE3BDD426 pr0mu1g4t0n
458,342,889 *2E88CE71ADAE0B46DAEB890C21EABE5D146E7A60 JULIANCALENDAR
458,342,890 *2E81E822B889FE031555AF5E309F068FB19B8D3F PRINCE-JUNEAU-CALCETAS
458,342,891 *2E8F84E6E55E01672613E3DBA43645DB6E92FB9A PRINCEMAD
458,342,892 *2E86801A965BF7B3FA0ED6D42B92EE0D8819278A [email protected]
458,342,893 *2E82212C3661CE2558AE8C73942BBF704CC9FE42 KARLKISSANE
458,342,894 *2E8FB0CEE5A16DF1B7C51CD50DF4DA45332272EE KAYNO
458,342,895 *2E83A427AA0048AB8680B414FDCE1A3EB2A79298 QUA1ITY-C
458,342,896 *2E89C9DBD69FCE3417F32D696778D05A6F9233F3 KENNETH.BENEZE
458,342,897 *2E8F98FDF585B1407C14CBE62EAADE04B412CDCD kennethhomer
458,342,898 *2E8C064E2277856E50377768C8195F50F51666C9 R3PR3S4S
458,342,899 *2E89B6BD6DF650874571256DB13FAB547F17F7CE KFH3
458,342,900 *2E8B96EEC68424C732C0F62782EBACD9EF01E76B RADIO-ORCHESTER-M
458,342,901 *2E8DCEF8DD5F404314C312A2B34DF2534A9CEF8B KIETH.THRALL
458,342,902 *2E85D9EC284966C5A6B43FA796BE59248B4B8614 [email protected]
458,342,903 *2E80B9B4343FE37ACA00490584D464B976DACBE9 RAJAEYA
458,342,904 *2E85863E7FEC6084020C2E1885E81FFD4A364F20 RAKSHIT.LODHA
458,342,905 *2E889CEA3E2357E70B74A41D6FB1BDE8531E168F RASE
458,342,906 *2E8A7C331F6F66DC9F1826A40190DE8CA115FF10 ko`\
458,342,907 *2E86BD86781A1EAF30A64D101AE7526A52BB2559 koboldmakialkat
458,342,908 *2E886573B504C5C5B6E93F185D44ACF51A4DBDD2 REDRUMGRUMPY1
458,342,909 *2E86A5B87EEA091E9952D3ADCB980F2CEC278338 KRAGUJEVATZ
458,342,910 *2E883BD576F6A2EFBE7E4F9232DEBC820E11D09E REKEITIRK5
458,342,911 *2E85D59FF3BB5064579BF471FB6EB6D90E7512A5 REKTORECHED
458,342,912 *2E8B57956F34281D48829C6EF754F44765CD9DC8 REMANENCIA
458,342,913 *2E8FA8691EFBFF4A95FB14E041AA1F43FEEC8702 [email protected]
458,342,914 *2E8B276D2FFE23DE97E168E97C687DF72E93BF6A KRIS.ROOTH
458,342,915 *2E8D2A44FB4EDCC65D623F379DB5E302DC80F379 KSHATZER
458,342,916 *2E897C3EB544342BE2B137C3CD0DF5CBD1C82C79 [email protected]
458,342,917 *2E80204ED60481F813CEBEB958FA5EE63109922E k'zm
458,342,918 *2E885151A53B69A72E4C66CA7A1BCBB8C7274300 RIKRAMUL
458,342,919 *2E8C7AD6DE20051E6977DE2B4291034E76D8F00A RILEYGLADLE
458,342,920 *2E828D917BEE7A421664EAA364778C039712220A RILEY.KRAUSS
458,342,921 *2E84B301CCA288059BF7962427D0F0382D45BD38 [email protected]
458,342,922 *2E8DD521884DDE74DF57A12A60AA7614EDD1ECA2 RLOTTE
458,342,923 *2E87CBEDF857F5789EA5BE3A14DD324EB3280A02 ...(largoemisterioso)
458,342,924 *2E8083DDE257938707B1DB21FCCAFC27F1D7DC5F rodolfodecaprio
458,342,925 *2E86131D0E939DA872E87ABF9108F8C540F281E8 RODOLFOMCCHESNEY
458,342,926 *2E8A48886EA88E45534B35E31B68D3330A5E0AE1 laur04
458,342,927 *2E8F4D4464C2407815D54DFEBA8618119C4F0E37 lauriecannonda
458,342,928 *2E8A2BD12DB06FEFD958C58A7ED9FE15464BF6F8 ROMEROTALKROLAND
458,342,929 *2E885EC4DD9B8824845DDC4E489F88503444120B RONNIE.SEPE
458,342,930 *2E8F762ADAD14EAFD2C35146FFB7C7DCFC2E3576 r-orgel:-nr-2-coul
458,342,931 *2E8658DD8C16BDFE387ABFEAA70561643CF73519 ledinku
458,342,932 *2E890AE74B027F63336AA5C3C83F86AA617F4E99 leesivik
458,342,933 *2E8FFA99891F3ACEACCE60DC04F310A4CB0F6562 LEESIVIK
458,342,934 *2E8F05C8757CE4DC9C08D4BDCD9E6C41577CF8E3 ROTARUIVASYUK
458,342,935 *2E88DDC3EF643AB6043204FC96DF6DFAC4ADCAD6 RUDOLFALWARDT
458,342,936 *2E8D450E95E82E5297186B129630852E20F29768 rudolphzuberbuhler
458,342,937 *2E8B21AA184F507964178DEB54AC0AE7660C5ED0 LES-EMPREINTES-DIGITALES
458,342,938 *2E86396BB9C2A90576A2ABCD31FD434A11AC5E77 RW`S
458,342,939 *2E810D45E1E41989625957DFC47D2792CEDC0B62 S4$BAA
458,342,940 *2E85B9EB85AB6F7D751648E394A2FDA47864CE9A SAINTMARTINDEVALGALGUES
458,342,941 *2E8CB29A9A3D1A943FE971EB678E2D3801061AD0 @sandstorm
458,342,942 *2E86AB56BA4D7C5626E9F796EBE62C9EF7B2CF87 santiagobolda
458,342,943 *2E8EFA3E4CEF6F6D839377DA35331F785E2821A7 saville s aa1 v ih0 l
458,342,944 *2E85066F29CC760C97D14FD0BD3A987232799C47 SCANDAIENT
458,342,945 *2E8B0D7AEC863CC4B6AA322FAD4BDDA5335C5547 [email protected]
458,342,946 *2E82A7BD8AFA61CF2264FABD3E2216D2AB95FDCC SCHWINGENSTARKEN
458,342,947 *2E87DAF349A211B8697D8873B408DA86BA97FDA1 SCOTTY.PEWO
458,342,948 *2E8F7C99B18DF8EC0FA1057FD50B481839E64414 LINDSAYBALNIS
458,342,949 *2E800FC264E8A39865BF6CB0C07D9ACC5CC8EB98 lindsaylungstrom
458,342,950 *2E8AE4150CBA478CA0CD9492C3DC4F961CF74576 LINO.ENSEY
458,342,951 *2E898BCB167D928331D20CD1295D086E27F652F8 LINWOOD.CONTINENZA
458,342,952 *2E8BF14E17B67ABBCFAED55AE3516F4F471DF119 [email protected]
458,342,953 *2E8A94143C2E370C7052639150F271760F860B62 SEIGGABD
458,342,954 *2E889A03E3319A2BCC25B7D06C4BA4DB3FAB2356 SEITENNATIVES
458,342,955 *2E830B0FE425C8F6AB022106C706A220137C3274 ljmpzcm
458,342,956 *2E8940E4FBDE5FB7815AA4ED325D7771319C8370 serflike
458,342,957 *2E8EBCCFBBB2054ACA9F01E56580D28FF39F2FA7 SEUQIRTAIHCYSP9
458,342,958 *2E8F3265B97C0B17515A0089616A6AA5E703D9D1 LMORNING-1-0
458,342,959 *2E859CCC0C1177329FAF2CB35D7E33567A56B48C LN949260755
458,342,960 *2E84A5314CE8208B271185E5AB256C4D36CCF518 SHALOMGUNNER
458,342,961 *2E89D045CE0EC8EB5AF4F6137B13B0401F68091F sharon.lavery
458,342,962 *2E8855E11B08EBB1956C869074B101B678C4BF14 SHELLYWOLF0
458,342,963 *2E8C8E4F65EFD7ABC5E0233C86D5A5C306480842 [email protected]
458,342,964 *2E84542E68660FA89C2A1E5179AC5E587CD0B0C9 LOURDES TAVERAS
458,342,965 *2E8316A9D5FB1AF32A7CF94C81E9AC81CAB71D84 [email protected]
458,342,966 *2E811CF0CC83ADEB1B99669CFDE684AE535A6AAA [email protected]
458,342,967 *2E88F6CD9837D4684CB967015B0D082DBE0B47E7 Loveis
458,342,968 *2E8F7F5BFEEC812832997968F2CD37EED66E644D [email protected]
458,342,969 *2E83E13159A60670113AE08D54DA3BC7DCD52B3B [email protected]
458,342,970 *2E8C17942794BC49E2D22DEFF2605858E5F6991A SHOTLINE
458,342,971 *2E8B31125C0D0B9E42C1513659145BE235ABD97C SIDNEY.MIRICLE
458,342,972 *2E887BF74A32CD40216D1B23F091F346B70590AA sierra07..
458,342,973 *2E869F1B158AA60BE05B9C38FA1960C0D059DEB8 sigemt.
458,342,974 *2E8C3EA9EE34652741F7A3373FBBD987A1F32049 LUKE.RIOJAS
458,342,975 *2E830AF33850BEA7EA6A1E22A11CDC10393DCC63 [email protected]
458,342,976 *2E8E773B48C93D889A7E8906FA230736D56A000A SJUREK
458,342,977 *2E81D1D7DBB38D566F74C929A23A3B923431B017 SK3%C#C
458,342,978 *2E895F0C08203B6CECB9919D9B362C5C6B5BC692 SKIRLVN6
458,342,979 *2E89A92026CB1970D58782505BE482082AF1145F slavikon
458,342,980 *2E83033B1EC3CE67A78207000D34387F7AB4B555 [email protected]
458,342,981 *2E8BAC7D23F8CF71AB7F597A4F4829720E2FC4F6 SMDISBSW8
458,342,982 *2E8D7F6EA8C65223C060DD7ADBA15783A1E897C1 SMOOTH-&-MELLOW
458,342,983 *2E8BD6E5156D8F44FD07FA1B74A27BC6EB8D1DD2 majorsylvestre
458,342,984 *2E85884C9B8023BD2CD19D71E49982688658D072 MAKEASHAKERE
458,342,985 *2E8E8587EAFE5FD0E8E1FF15CED4C3D3B609881D SOLEDADSILVEYRA
458,342,986 *2E86D25C22F65779E8435086F226ED89E20D0C5B MAM'SELLE (ALTERNATE TAKE)
458,342,987 *2E8A7F765F5706CD977E27C6247681293960F68C manilyn.morales
458,342,988 *2E83A48A4B18A18006204397BA7DA6A7D2A62EFA SONU AGRAWAL
458,342,989 *2E8453C09CF6BE4F1922A137210F9F0BA2D195B1 MANNYSANZ
458,342,990 *2E89595AFAB34AF002258479870F7E8B53D5C82E SPAULDE
458,342,991 *2E8A0C63BFAC25ECAD751761694606472995B084 SPILLEMANDSED
458,342,992 *2E8EB03BC193B209B4E49922EDE11D8657340A21 splat!*.*.*.(======3
458,342,993 *2E8D3B3782EF0FD5E9D80101B6BB7309A64C119C MARGOT33
458,342,994 *2E8296D1AE7E3CAAF38B74918C45061B9F16F367 SPLATO~(####Q
458,342,995 *2E8F7310323A1210D6B676FF37D5F75858B3E368 sploit*.(b
458,342,996 *2E84E2563C5E0E97DBC0C7F131362E4EDC4CF4DE spolurozhodovani
458,342,997 *2E8EF5A3E62090DD2E2AE1664766879A0BBE18F4 MARTY.SAHA
458,342,998 *2E82A950036FB2688252B8E3055917C1360E1603 [email protected]
458,342,999 *2E869DF1879FC4452CE2CE75291D479451F547F5 [email protected]
458,343,000 *2E857C353366D24463B667DB0ADC6FFD883E7D1A STANFORDPLANCE
458,343,001 *2E86661E1639B0B3F757933C57CF10FFA8CC6405 MAUROCISNEROS
458,343,002 *2E8007EBCD0A54ADEFCA0D244FA952025D1B03E9 MBALACANO
458,343,003 *2E80EA43DF59EC33E4F626A1580EF9DBD6EE764B MCKINLEY.MCGRAY
458,343,004 *2E80B2E11A261EB6FC7434F1D4B411F8337720C3 mcleskey2
458,343,005 *2E8DEFDB5E5D666BCBEE112FF1DDB6BA01178FB4 STEPHAN.SCHIMANDLE
458,343,006 *2E80E88C965AAB6732AA3FB6E2D074B7730F79AC STJOHNS-EDINBURGHOR
458,343,007 *2E8EAD345744C17C9CDA75936788BD8FDDCBEF6A [email protected]
458,343,008 *2E82A61E405E284782D4C8EC6B99B26B3B108E50 mercadies001
458,343,009 *2E801B75020B56188F6E2FD300037AEBF9F0FDC4 MERRILLSTANDBACK
458,343,010 *2E81990C27A97F323ED64806263BB5ACB41DECFB [email protected]
458,343,011 *2E846D987BD2CDD35B1EBCFA1F3945726960E486 metallicleonard
458,343,012 *2E86EF92CD6366703978BDA91B2EDA1BB5F05ACB MICAHMITSCHKE
458,343,013 *2E8D67DC51014CD01BEF6708AD147E7A815EAEFC MICHAEL HANNAU
458,343,014 *2E8746D35181995AE2DC019FD577FB83CDD8BA12 SUBIKCUM4
458,343,015 *2E8A008F15579DB234A1E976011064EC7D1F6369 SULFATIZED1
458,343,016 *2E89590EAB93150077DC6B20C316BCC6CA657B5E SUNRISE.IN.THE.WESTERN.SKY
458,343,017 *2E89F8CC0ECB41B40AEF30A1645A006377DFD4C3 SURPSIE
458,343,018 *2E8B2C310C9E2C441F667343869C3C923E3E2B88 SWELLEDHEADED7
458,343,019 *2E8F6A8681798E600B2813045DE1EA83080F63FD [email protected]
458,343,020 *2E8C46F03F07289757AC9B99DB3970A8F019A121 SYDNEYSCHWEINFURTH
458,343,021 *2E8AE6A7FF67181CFBE66D0ECDA8015F31D71032 SYDNEYWATTLE
458,343,022 *2E8DE12B47B23EBE1C9CB092704BEDE9F858C3CE mitangis
458,343,023 *2E8C9D2FBF563E8723BEF39121391B8D08611C69 SYTOSTAATTIPUOLELLA
458,343,024 *2E8CBB3AB12330F8492BFABEE0C7FCFE0E985846 MOHDFAIRULIZAMR
458,343,025 *2E8DA6FB6051008226F842F2E5CD8B5FFF1FD7D2 tagasiside
458,343,026 *2E840341B63A27492EB0B8A0CF05CEE32B167BEE TALKHARKIN46
458,343,027 *2E8B01E2FD268DB095B71FB8909776C28502EE30 TALON184
458,343,028 *2E8F9887DFB9D6F9A4A7A0A584B5E112BD9BFD4E TANŪHAVIS
458,343,029 *2E85939B2EEFF55D1AD39E91C35970C469CBB4D3 TAOSHENG9
458,343,030 *2E8030DB48D816D21ED16E37704A8B74C252591C TARDESPROVINCIANAS
458,343,031 *2E89CDF98C4CF18708973BD516E7CDC52D7C92E8 [email protected]
458,343,032 *2E85B10342861DB0CB0B786C25B57BD06DFD95D3 myangela4
458,343,033 *2E8A5BC9D01FF3BDE9FBE8126293F3480655D1F7 TERVNDERED
458,343,034 *2E85DF76706BFD471A7A5F0625C67181CBBCBEC8 THATCHANTAL8
458,343,035 *2E830FA398F6AEAC6C85FDA46691EDF2E9C0CFB1 ncanaveral
458,343,036 *2E85D47ABA5C39D4BB2C2F56F1D361D25B2E1AF1 neelys
458,343,037 *2E81D22D514A8B43752F155220F99AB170244F83 NELJLLE0
458,343,038 *2E8E11190B2392C0B509255D9F6E50AC760988AE Tiffany-Fronk
458,343,039 *2E826AC47CC409EC3792FC4093C2693278D366E7 [email protected]
458,343,040 *2E849417AE88470A13B5C7923682EF808CD347F1 TINAPERROTTA
458,343,041 *2E8CD86AB2FEF1F4E2EB326F14CAC57E032CFBAC TNYSIREPS
458,343,042 *2E8B014EA7970C6150769E5866C3EAFFC18FBB9B nicoleduhon
458,343,043 *2E890CC726AACA6AD04BDDE5058D50A810B2FFB2 niharava
458,343,044 *2E8A939C3873C15AD373874A22CBC40E5B4FC899 [email protected]
458,343,045 *2E89936D8EBE35476D9912978C0DD8330388CF8D N`J`
458,343,046 *2E81081AA48C8AA31323A4DD4500D0CCA974D841 TOMMYPAAVOLA
458,343,047 *2E8F6CE2881D2B71D397DD624513B73F5E45D11D TPAIN1997
458,343,048 *2E88B42D05168E31CB7E376844298B6560CE5878 NKMLNGN9
458,343,049 *2E89306D5DFF3E7DC2A99BE1A6BC1F977684B221 NOEL.LYMASTER
458,343,050 *2E8B8F9BF8F0B9274216382C2C2CC7383FFAA7C5 nonceles3
458,343,051 *2E8942AEDDAC584F4FA773D217C57969F9DCA28B TURGDT3S
458,343,052 *2E8346513ACDBCBE33F6EBF9DB38B35FEAAAF80C TVAPARAAED
458,343,053 *2E87944AC78607C5DA225D7D629E51D7F7D6C7D6 tylermecsey
458,343,054 *2E84EBEE65D888BB90C8A1EFB47B062E7C5A8DE9 OAQF^
458,343,055 *2E8D285823F516EB9C8B94CD75732F9C54111A32 ObligationofContracts,orgrantanyTitleofNobility
458,343,056 *2E879AE3EEC2F4B84B86D4EBAA2D9BAB063585D1 UKNUTYM
458,343,057 *2E8D7740FC1C5421E6E75E4D6E69C90140D15027 OCTAVIOYOUNKER
458,343,058 *2E804D6A607709078F1DF7C7CB5D1364D4502852 ULLASBHAS
458,343,059 *2E89C56F3DE04D3EC839AB13782ACDC9E35214D1 ODERBEIDES(FEATSVENREGENER)
458,343,060 *2E852D3EB613838B6A0E088D0C25B5DFC6425637 [email protected]
458,343,061 *2E870F025CC7FF228F98CC7834818E41CA416485 ogulluk7
458,343,062 *2E828C71CCE47FC1DD33D7CE9FF1FD9B01A0C2E6 UNRULABL6
458,343,063 *2E81C9A58F4AC0A7BD01CB2ECBDEF4FF54DDC8D7 OMANBHOY9
458,343,064 *2E816024E03DA80BF49C9665D49FD5D6A5EE49BC uphills
458,343,065 *2E8C01659A340416B249AA3F5110BAC345681FAB onceover.
458,343,066 *2E8ECE970A112531B7F14891C69478DAB5E20695 USTAMAKAT1
458,343,067 *2E8B8225CA1B12D94A8EA7C0ED9CB8FA473D127B UTGRAVNI4
458,343,068 *2E8B8628A1010DD616013B667D9B3342369B1F99 VADITOSES
458,343,069 *2E810F208DA9CED722AE753358202269BC24336A VALENTINEBABYAK
458,343,070 *2E87C85A7E9DB51DC0EE1C8632F1F6E148612FCD VALENTINO-BENAVIDEZ
458,343,071 *2E87613061858AD710C3EBE976368E190EFEADEB oswaldothicke
458,343,072 *2E88B29A38C12B4370A855FCBC290D68D5E9758F vangie-arches-penaflor
458,343,073 *2E8AC000A96B100C7FDAB4A5075636639ED3C28B VAPAAPALOKUNNAKSI1
458,343,074 *2E8B09CF8432A49E6EB9E5C0E1CD2A74B640413C overheidsdiensten3
458,343,075 *2E89746431F055035D09B23AF4C489F84CE7BD77 VBS=
458,343,076 *2E838CCFD921FEDDEB2BB9373FFED0AE1B561523 vernlagoa
458,343,077 *2E846AEF16DD93A1E38A1BF7A0D02E08D647D13D verzwondenen3
458,343,078 *2E88297AF9090C7EFF47340CF9983B737A89A813 vicentewolsdorf
458,343,079 *2E8CDDDC2414D3AAFF303B66B60F29256327267D VICKI.BENETUA
458,343,080 *2E830656EDE78852D52F5425DF98088CB3C4AF73 vicodinazalea
458,343,081 *2E8D3F93AFFBBF849F42A1372B83FE0AF9C0E99D VIKINGPACKARD5
458,343,082 *2E8F351D2F4D3BE6EFFC54ADF646AE363B420C26 VIMLKOKH
458,343,083 *2E80E29188104CA7E1954965A40F6F3F42CA97AB PARLAMENTSFORMAND
458,343,084 *2E82F4F77E8B95927C23C43BCBF1C869A0064421 pat-magilton
458,343,085 *2E88E8FBE4DB4CB4B09E247C16EB233B2D57262B PATORTI
458,343,086 *2E8A825FE3FE3BB3F15D51771DA24A050DE8AC3B VOLKSSÄNGERSZENE
458,343,087 *2E86DECB605328F3A5545492C1CCE861127E50BF petifuego
458,343,088 *2E85B31836BA141A62636A48C6A6007ADCA20D7C PIANOSONATASNOS13(ALFREDBRENDEL)
458,343,089 *2E8CA5AC694C9C91AD8E32C387377FCA3A733131 warren-winslow
458,343,090 *2E85E680A333FC16B71614291EF9C152D6B588B0 [email protected]
458,343,091 *2E80B7234B636F0AF172A9265DF98B83F39A785E PISAVAM8
458,343,092 *2E8529F9A3EFBD50FFBC4D8C67C867D670ABA680 waylongorovitz
458,343,093 *2E819C88322ED7045DABA2E1C7DDE2D91B4CBD01 WAYNE FELARISE
458,343,094 *2E843AED6F62137BCDC07D673DBF70AE09A20E05 PLACEWANTS
458,343,095 *2E87BD68AE21B1E3A2B5ABE25D0D0BE1151328AB PLACEZ?
458,343,096 *2E8EBC496EBDBBADB9AB4E4A2280A89A00EE80F9 wee-ying-jing
458,343,097 *2E83DA8BAA674CC048278FFECE21E0E6CB385DBD [email protected]
458,343,098 *2E80A5739D6499C2E2783EB613FD6B57B9915C19 P----->**O->-<
458,343,099 *2E890259E298E96ACA437C7E1130CFC45EE301BD POJEBANÝ
458,343,100 *2E88F370FDA2C846A1ABD58EF6B107C51E2D6458 P#####)~O ~osplat
458,343,101 *2E8FE05C1D64F002141242EC4B55E38A200B9646 POSTIGNE0
458,343,102 *2E81346ABEF5D596ED16784FCC8F4DCB9C9CBD73 wihnonah
458,343,103 *2E806233940ECB6EFD7DFE0160D4FFA02EC423A8 pravingupta
458,343,104 *2E8181D447D03DA0A89E486D35A4C1E6C95E2BF2 PRESTON.LIEBHERR
458,343,105 *2E8386365CB1F1529BC1AE7D668AC15CDDA0104B WILLIAMALLBONES
458,343,106 *2E837B12EF1BCC8E0D7ECEEE81675C306442E0DD williesober
458,343,107 *2E8B9428750A8CCB062B9E556207B1C0E9DEE1AF WILLOUGHBY STATION
458,343,108 *2E887B98D31045002A175FB9AC30ABF8F9E08798 PUBCAMDENTOWN
458,343,109 *2E8243D07F88ED48217D479850BEAB29858A0ED6 WSTECZNA8
458,343,110 *2E8DDBBE877FC977701B8473EEDA25944599C8A5 WWW.CRIPPLECREEKBREWING.COM
458,343,111 *2E893C73E60EDEA2DA9D10B4649B4626C6F1835A www.lpgcars.co.uk
458,343,112 *2E819CA3DDCC581BB12D97456E79CA6779605DE2 WWWSHOPOOHLALACOM
458,343,113 *2E81DA6484D96877B0230F05A95B393BD22C3A65 WWWTONYMACALPINECOM
458,343,114 *2E88E09FD3DDD665DF91CD1119C88C2B30CFC1D6 xavierolaes
458,343,115 *2E8A67FFBDE8438738B85C180C58252DB217C990 [email protected]
458,343,116 *2E8479CA775B1A746FA1305BE5758B70D6E15E64 xbnfkb
458,343,117 *2E8C9E3563156A8561ED976A912647FBD75D03A9 XC.MEDINA
458,343,118 *2E887B1D69C7F7A77BA23F9FDFB08C206F4B3CEB Q####P ~O(_0)
458,343,119 *2E85AB34D3C4209B4E17A32A1CB3CF40E1476086 QUINN-SPENCER
458,343,120 *2E8E2EBBBA63839A8A1B595FA3D824CC04FFB4D9 QWERTYVETTE
458,343,121 *2E8CB092E7898195B564646F40752D965E77D0D4 R3C!+AL$
458,343,122 *2E8C832498C06D5D093C044A41974106041D0EED R{A
458,343,123 *2E8AA0620E8C7AF6CB9486FCC4CD5198FD40280B yanning-wong
458,343,124 *2E81DA028DA4D10A19703DE768E504F2DDC35A77 radiolucent,r/ei/d/i//ou/'l/u/s/@/nt
458,343,125 *2E805F05BDC7F015239C709B4EC27D25BCA1A50A RAGGED-SCHOOL
458,343,126 *2E893E3FDF87B26C79F7C98679546D0DCF1B4FF8 yasuha.mo
458,343,127 *2E8A3AE31BC73BEDB448E3FB2CAF663132E0432A yeeleanho
458,343,128 *2E8C4337BDCBCEFE493642F436DD43744E39982B [email protected]
458,343,129 *2E8D57441EF820CA4E441CB9C8AA65E1A3DBD9CA YLLUFKNAHTREPUS7
458,343,130 *2E88E5DF7252C2F2B5394EEA3F40AAD0456C8888 yoanita.argasetya
458,343,131 *2E8831DBF0858AA00963272F21EC4FA4A6081D44 YOHANWIDJIEANTO
458,343,132 *2E89BE57CA86342C3DA447805904833E18C14BB7 youngbushby
458,343,133 *2E87E303E40975C0EB4988366F6DF4EE9E6FD0F9 raulburkard
458,343,134 *2E8FEB0E6273E5F15FAA084158E1FA0C909D6262 RDTLPHND9
458,343,135 *2E8CF04DD6F824D46E20E69626484D8216E4A8DE ZACHERYFRANZESE
458,343,136 *2E89EF7CDF2CDEB0EB085C500486EE9595FF66CA ZENON SOLDEVILLA
458,343,137 *2E8E4AE377BC8FB60B9E0D2587D42B344DD22D4F zesinho
458,343,138 *2E870BF41B0A401F9A3E73D8CBF9B04B5EDFA45E REFLYVESIKRINGSTJENESTING0
458,343,139 *2E8AB4BCDDC4BF6B6D06DA80F637AAF66E61483D REGINALD.SLOTHOWER
458,343,140 *2E860CF54320208F1431815761B36EF9E0503E6C REGNSKABSKYNDIGES1
458,343,141 *2E89EF594DCE37A70109137BCB344FA4007AC358 [email protected]
458,343,142 *2E8ABBC29C5C961CBF6DCD7150C65BC3055FB830 [email protected]
458,343,143 *2E807B0EFBFEF78656A185D1F7DC2600D0315325 REINEIRO
458,343,144 *2E82401C69E509E7969DB74256A4BDB6A22A9072 renee.boudreau
458,343,145 *2E8945D316E3FB4147E370DF9931B006C571EF20 RESTRUCTURABILITIES2
458,343,146 *2E85AF888CB5FDCD4D4E9CDBFD7A174B1A3AEF23 retniuq1
458,343,147 *2E8BB5464EBFCC6ACAEF06972C57F5E5C85C0254 REWARMED5
458,343,148 *2E899576F1CE5110B2E295365F2F8159152E608F REY.USHIJIMA
458,343,149 *2E8F4573BDEFA9B8B6CE589FA21196615E36635D RHETTDEKUYPER
458,343,150 *2E80293C6F69EBEE2A66C8DFD432DD7F6DE93CFE ztry
458,343,151 *2E8B395236CE452C17917C0DB0B0422AD2642961 RICO.GOODPASTURE
458,343,152 *2E841A767BB1805087A74EFE9B7342F83E22FC5F [email protected]
458,343,153 *2E80AB8084A97D0D317EC65491ECB44B3330ABA9 RIMSHAKHALID
458,343,154 *2E89BCA5A8B202C6F7840B60875B5C40FD95B51A rizwan-anees
458,343,155 *2E8068496530EBC8A768A05E488BDC163C0171D1 ΜΑΝΤΙΆΡΓΚ
458,343,156 *2E86E838F383C13887AEAFF044F034F8DCB55771 ΣΕΚΡΕΤΩ
458,343,157 *2E8FD368163190E9BF97CE1D6906F1699DFD597A АДИА́ФОРА
458,343,158 *2E8CD893EDAB3C39FA1ECDEEF9E6304F3898D0D9 ROMANTICISM R/OU/'M/&/NT/I/,S/I/Z/@/M
458,343,159 *2E837CBAD0EE20C9C1E9408EE8DB82FAD284C7EA «ДИВИЗИОН»
458,343,160 *2E826629AF43A787C63573610F90349547FD7F18 ЖИВОВО
458,343,161 *2E8987456EDD0807B4C14059BA10532D253DAA85 ROSS.CRUZEN
458,343,162 *2E8D3C7610AD64C359D82A3AE2AE03BD7F192DD3 ROUSE-(REVEILLE)-(FASTER-VERSION)
458,343,163 *2E8E47F82E8F6F701DE4BAA47D18A5961BA8D40C негорельского
458,343,164 *2E83B90E5ABED96C13F1F7856249B9B130AEBCE4 RUNNINGDEAN
458,343,165 *2E8E5C13F637A386215AD884E54FFABD3F7207BF russmohl
458,343,166 *2E8B991758693E54F8C536C6283229B1F871E0C7 rvuw
458,343,167 *2E82158B880BE13B7156E57A6065B0611E273A7D смоші
458,343,168 *2E8B5573A8F098EA07BA57676DD1F777E7B893B0 SAKSALAISVALMISTEISE
458,343,169 *2E8A93A40B996C3AB06B13427727113EE3A57A7A SALIVAREX
458,343,170 *2E8FB62819ED8D921F4D6D7EB907B2D808C595B8 SCBY35
458,343,171 *2E8990F0E26168D2D96761E2F1911DBBFAB938CE SCHIZTIC0
458,343,172 *2E8489BA96E30D87891D186DF9C939F05588A260 S-(FEAT-ALBERTO-CASTELLANOS)
458,343,173 *2E8EE30432A03017D64FE84C63AEF3105A00FA42 shanelamprecht
458,343,174 *2E83722DA47C27CFE550ED180369673B761703E9 SHANTEL FARAJ
458,343,175 *2E8B2F303C99AE03CB787296F4103B70CFDB800E SHAUNBERNIER
458,343,176 *2E818F5AC8CA9976EE4813F51431693230EDD0CA SHAWN ROWAN
458,343,177 *2E81A6FCCD67CAF014846937D0D0CAF7F6805B28 SHEBASUN1
458,343,178 *2E8A62E323870644C4970EC7865D9430480ED27F singolising
458,343,179 *2E839B535D1CB8B99400E806A72C72EFCB64ECAA SIYMRA
458,343,180 *2E8F7C6EF5DB47A09BD6B9A0D68F838B0B1F8C96 snubbing?
458,343,181 *2E83CFEA342203319DCAAA335D138B6341ED5B7C SORPRENDERLI
458,343,182 *2E8B6440F31A29000B9565AAA9A14B9105E6D854 $}?
458,343,183 *2E8777B5F28E794123094CEEC1DB161808282E68 STANFORDPONTON
458,343,184 *2E8704EB7D83DA5B6AE34E9B00AB07E4364E9FAD 09-04-1913
458,343,185 *2E8F4EF6015D0684973124F802B4CBD1B7A8672A 100-transcendental-studies:-xxiii-dolcemente-scorrevole
458,343,186 *2E855B0868D3E7FD87742FC3C1FAEE687E302BBB 1067294 kielenhuollon vihko wsoy 951-0-223158 gr
458,343,187 *2E8FE8EBB0551D1217A8994337534AAC0766542A 10NEXT-OF-KIN
458,343,188 *2E88AC6B699AA5BCBDC0A8F7CD7C619992E8164E 10-TURKISTARHALLA
458,343,189 *2E8C06B6A9FB52D612B0601CEDE925550478077A sterlingmunion
458,343,190 *2E84B9C4CF2FADF288678CE4EFEAA4EF66F68EF7 112493cb
458,343,191 *2E88A234CF212CFC2E2DE1A75B0D3CEB6F76AF50 Stop,please!Stop!Wehavetoturnback!They'vetakenAnn!
458,343,192 *2E883AD30425730AAB6D02564BFB53C368244FE4 148IKKUNOISTA
458,343,193 *2E86068A90FC6C2C88B1BE194CE4E82FFC45DC01 14-SPARSER
458,343,194 *2E8C84C052011EE8E5742163E1E14C598807C511 SUBCLAVII9
458,343,195 *2E87E29C49062F74CD5A616B436AD79AD2F00804 SUBURBANISED
458,343,196 *2E8CD1F4CB8A99354AD3A9986B2FDB138BC00BF2 SUNRISEFOOBAR5
458,343,197 *2E8676E96FA41C04F5A8F142DCE0AEF2B3BECDDF SUPPORTKIM9
458,343,198 *2E84939381225EBD033FEC835D073FE3E3D498B1 SURGERIZES1
458,343,199 *2E8F32C5ECCDB63C709B63491F7403626508B6B0 SWALLOW'S.TAIL.JIG./.CABIN.CEILIDH./.SWALLOW'S.TAIL.REEL
458,343,200 *2E8104050CB5AC6D1608AA548E654961F2D38DE6 swkbtma
458,343,201 *2E8B6A163BDBDB1E9788F2CC97E17898606B081A symchti7
458,343,202 *2E8AB41A420E9C8D7E7804C0E4718925189E059D 1GEDERN-OBER
458,343,203 *2E8E0D8CCB639EF12DD9CC49E05B2D91DC9106CE [email protected]
458,343,204 *2E8030FD621D69703914644F8F4A6FC3FB9EACC4 t6+j
458,343,205 *2E8F6D0C606FB06AB79FBD8CD773BD4636E46614 takeiteasy-nimm'sleicht
458,343,206 *2E87E31EAD34586CEA14476AA86ACFA8DE4A2D77 1.lobis
458,343,207 *2E8C8787CB50C8BC24F493BEA1C18C4EB9D09C03 tamara.dedic
458,343,208 *2E8FFD357CB862C6396F1B8092BBA18EB145E762 [email protected]
458,343,209 *2E82985B16B359BE55C6E5C419F246ABEF71BE4F tarrisb
458,343,210 *2E8B9F533DA1A92D8CA53A57DEC22272FD00F1CA terat010gist
458,343,211 *2E8572CD051D7BD218B60EB3B3424800CE558DA8 terina.moore
458,343,212 *2E83749E9989FC4D6508C0D4E6FCAB9F3E4412D8 1mylizard8
458,343,213 *2E89B9DAE91BED2599199696CDB4ABBE5D17FA57 TGAGCCACAGAGTTCTCGCCCAAGGCCACAAGACTCTAGAACACTCCAAAGCCTGAGATC
458,343,214 *2E85E8586017A36F302F86EB5B09E79CF3046D32 1 privatisationobsessed
458,343,215 *2E87290650064AC2F00CBCAC72EDA1C6650BAEF1 thank-you-and-goodnight-(a-d)
458,343,216 *2E827FEFAC215D1BE47FDFB8A067B3497974B976 1springton
458,343,217 *2E8A9D6281DA2E57B314117F359AE57CD158540F 1-TELALARDA
458,343,218 *2E8E1D2F6FE55D1D39ACE788FEA8C6E680611368 1.TEPIKA
458,343,219 *2E89C073D0C8E52B0D92D76C4E9F6251A9B1626E the.goat./.the.messenger
458,343,220 *2E8E9D18C20816278D4A95F7BF2F011F874A1E9B 1trillion-to-one
458,343,221 *2E8256E27DA8281633B2C66A8EE105F7356F4867 the.pool.shark
458,343,222 *2E825C9C51DA86FC01196C6AE4B18EF3DC1292B3 the smashup
458,343,223 *2E8961B1C39CD2644D74B58818EBD951821F4269 thevelveteenrabbitantiquescomwww
458,343,224 *2E88E174930A41AD937F6A0A228ED5796E500F49 THEWELL-TEMPEREDCLAVIER,BOOKI:FUGUEINF-SHARPMINOR
458,343,225 *2E81A9B2B46AA5E4AD561913E0920EDCD7A270E2 1.ZUSAMNMENGESTRICHEN
458,343,226 *2E8269C6998402624C3F73BA11081FFEB169129C 2-08-1775
458,343,227 *2E8B36A674BB6786E2EF488530F1317321FD44DB THOUSANDONING
458,343,228 *2E8BD64EBCEA2F26F7FB94841E754A1AFD59D927 2221260 vantaanpoliisiyhdess
458,343,229 *2E890AC70BD3ADAC6A98045139C2E02245D81D54 [email protected]
458,343,230 *2E809A61166EDC42F400CC88C8610BB70C6B340C 239118 mj:n-p
458,343,231 *2E8831E77CC25A9441F594F3B361D487AC350497 239740 "-JO-JOUTUI-SUEN-J
458,343,232 *2E8D1D0383A62A605240DD53BD24561FBAA93D6B 242TA610
458,343,233 *2E86701A4633AEB6DF08B3BE4E82B24A63CE8FEC 2457588 TY
458,343,234 *2E80DBE8BC026347532E3ABFC80F9C5E71FA9BE9 TILLIMGHAN
458,343,235 *2E83383C38651EC85DF8E7EB01007DE604AAAC3D 2527476 "-DAS-IST-EBEN-DAS-RISIKO-"-,-SAGTE-HEMPEL-
458,343,236 *2E84211B73A0109E566DA5130FE6C8FD9806B902 2553495 ENNEN.SIIRTYMIST
458,343,237 *2E876F5DDEA00802A1CE2A7621586C8BFD18F633 25WHICH
458,343,238 *2E826662B326BC9F5E9345AE8738A1F6C0F6A1D5 tobagoses
458,343,239 *2E8648C3107A17594E08701E54F50044F6EE0BB1 [email protected]
458,343,240 *2E839D49644B9594CD6470ED3890C1C1B102E23B 2848934 VIESTIONJOKOPYSYV
458,343,241 *2E802E13939F309906F99AD53B832755391336DD 2ADULLAM
458,343,242 *2E8E8E3DC0AFCE1160D021B50C0824274A2C9553 2.AM.IN.PROVINCETOWN
458,343,243 *2E882C9390C400737683E9C28C3875636204B3C8 tommieeavey
458,343,244 *2E8E5A7BC8A2442C196E4D5A807BBAB85E981887 2BAROCKS
458,343,245 *2E815B55CCECE0974BA4BCDAA7ECB1B5AAEDDBA6 2CLARDYN
458,343,246 *2E8692CFE06C2AB063B88D2077956F29A5619183 2einzelhandelsunternehmens
458,343,247 *2E819C2C9BD91C23895BBC1444800A8B70F6704E 2iluvarchie9
458,343,248 *2E871EACEEA8DF0549C548E5C22C108634186C59 2-LENINA
458,343,249 *2E814622D0F730DE82A1C1FD4ABD03BA0BA365F3 2MUKASINI
458,343,250 *2E8B56A4E04F7C8BFD5CF8CB951885F2DCFCA385 2OVEREENBRENG
458,343,251 *2E89E12376AE92E43B455E06C67A94D9A0486FE8 2projektipankkimme
458,343,252 *2E87D7E9911DFFDEA71F39A369F08B1E3E7EF421 2 RAIK
458,343,253 *2E8FB9DE0DA1DCAC4B75868C4F68634F3CEA1629 2 TILAAJALLEEN
458,343,254 *2E84F42D828A610202E3817448B680062D62AE22 [email protected]
458,343,255 *2E8EE9C6392C4D552A8A606E6A9D9FC4E66FCCA3 37-P
458,343,256 *2E8787AB51DCEBC847923371F325B0CACBB242EC 3.ANASOZLESMELERINI
458,343,257 *2E8C30AD0A14E099B6784A458321D7F424563091 3=b`~(><)
458,343,258 *2E815A212C03C24DAC69715F40355779B70FA83A TRACYTVRDY
458,343,259 *2E8DB56D5A18AE69D781AEE323185B8AEC8C9794 TRADESCO3
458,343,260 *2E81E2FE5353F0362B2A2F937F14A795EF86DB99 treated
458,343,261 *2E8AC214E9DE6699E060429ACFB70FED5A77AB30 3YST
458,343,262 *2E88F42B8753A428AF7175EC37DE1284678288EC 47483 MERAK ETMEYIN ISI OGRENMEMIZ UZUN SURMEYECEK .
458,343,263 *2E836636C7688DFA5DFF083F24FE80C73430E250 477REBEKAH
458,343,264 *2E8B309315AD21B481B78A1FE24785C31DE40094 4BB0+$
458,343,265 *2E8F03DA59F87A56984B7ADF3BEE62BA65749F25 4HEIMARCK
458,343,266 *2E81D2DE160A742F02FC97AE307FA0E759DC782F 4.HENKIL
458,343,267 *2E82963F210F106C20DC7C4D289F02521BFF98B4 TRISHSCURTITAYLOR
458,343,268 *2E88D4D0449ACADEF87DA6A1519013ED7FB651EA 4LOSGEBRAND
458,343,269 *2E877C1A751ADE8EBD7B468A12F2890D4378252F 4NATURALISATIONS
458,343,270 *2E8F8F8B782FDC5D11E083BD1FA55588019F3B60 TROWBOROUGH8
458,343,271 *2E8A2C2719C23298F795F8D277E4FC24D568B020 4NICOLEEXPORT
458,343,272 *2E874945DC15F143142AC3124EC0539B9B8A2B61 4-P
458,343,273 *2E863A9F8F2960DF034DD5CBBE5C54AE69B3A3F6 TRUVATSED
458,343,274 *2E8851531E3AE59F32B8AEFF93C2E392DEB8C8DD 4SEZINIDIRYP
458,343,275 *2E8F0E95A17D7FD2EDED843F830799F04D50526E TSYKSRY6
458,343,276 *2E85CB2A57CC30409EB8D411975B2436EB81035C 4TIALEMME
458,343,277 *2E8EE78AF235195BFE77079C1B78F713814D9E70 TUCKER2262
458,343,278 *2E878A2CB12AA47FAD438647D5B646C338899F66 turn.it.up.(organic.mix)
458,343,279 *2E85D72CB4EC37995B4045C08F1E94D1A7D71D6E TWICED
458,343,280 *2E8E17EFAEE11E4AA22BB5470E73F5503C172C01 u5urpa7!v3
458,343,281 *2E8E128644F377FA3450015CE4D539DE333C102A 5ilovelovers7
458,343,282 *2E84B867DCB393F31DC1CF145355B0C1A2954B92 5OFFDATADATUMDEAL
458,343,283 *2E8AD09F53750AC352907E0444BCB05C902E5F68 5PREINSINUATIONS
458,343,284 *2E80A74A84D816707BEB8E86B30A91E3DCA5DCA3 ugeneva
458,343,285 *2E880E5A1264F66FBA923B0597262DE5818C3FC4 5T1FFL34V3D
458,343,286 *2E8D96274955E922621839CC848C5CEF80AF8B7F unavisser
458,343,287 *2E81D40E21D6FB3FF4FDB700BE414CF6D16B5B20 5UNNATURLICH
458,343,288 *2E890ADDE654E71BA68239219551BC8E011E32DA 5YANKEESDRAGON
458,343,289 *2E81C17ABC7699A578FDE439F68F6C7E715B5A16 648CM³
458,343,290 *2E8547F26FC87E3BB7D01932FB39F9EF80600E8C unvague!
458,343,291 *2E8ACCB262C3D236B8B508910E371FAF1CEE5859 6EKVIVALENSES
458,343,292 *2E88F7B58C7833EC86221C8009393D2EEA12FE24 USECAREFULWATCH,CHOOSETRUSTYSENTINELS.
458,343,293 *2E85558E7FAA603AF6EFAA14E8826A6AFBD5CF9D 6ILOVENOTTA11
458,343,294 *2E8FD30EA54A45D7AD2F2FAB104D7430130AD11E /usr/src/linux-headers-2632-24/drivers/crypto
458,343,295 *2E85D93CF1466FD8A688EDA61D0C3E4D019B0156 UTREDNINGSINSTITUTT5
458,343,296 *2E82DB3B37CEE0B804329AB32AF12FBFE6BE9C54 UU-*-*-Q######8
458,343,297 *2E816AF3C8B05EC38BEDE9B377473B73F59591A3 uw216
458,343,298 *2E80818B8AB67D23216C2521FE09F04DD8E53E06 vahab.latheef
458,343,299 *2E8BFA08C2423B60C867FEF029E8B4D066D6BC3C 6ORNATURES
458,343,300 *2E8BB6AADA03961FB520B5AD79684A21ED35A9D7 6PAIKKEIL
458,343,301 *2E8229F53E9023FEC802E1B4014C9885195C5BBB VALENTINE.SLICK
458,343,302 *2E8075BDC0068126E5C63E665A93AB8B61B5D743 6PRICKHEAD
458,343,303 *2E8DE74DC278E8CE376A74BBC26B24A17C3E5AFB 6SNORDNEDOLIHP
458,343,304 *2E8AB6E564F1AF22B8055710FA54206B1978B3EE VALINTATALO2
458,343,305 *2E82EFA83F4FFCA51A90CE068C1F91D7204FD62D 6STUPIDSTEPH
458,343,306 *2E8F7BDA38A21FACC314DFE9EF382825269C6E00 6TESTERFRANKIE
458,343,307 *2E83D02D814D5C2B6DB1464138EC35B81BF3773A VANESSALEITH
458,343,308 *2E80329D92D20A4F44E995D833DFC13E6826E194 vanita-marine
458,343,309 *2E84FF2BB15A68588C5FC3257BE1E4CC562DD57D Variation.Six
458,343,310 *2E82A9FF247795BFB0EEF37F7A7310A5482B02D3 VARONCIA2
458,343,311 *2E857F3F3E38F71327D78B383D5AA0399B21C156 VAUNTERY
458,343,312 *2E8B74FADBEB93AB1A0EEC5F913C588EEAB4C916 VERNON.LAMPI
458,343,313 *2E8FCD993EFBFBACC156BA259791F0F399329325 VERNON.ZAKES
458,343,314 *2E8F246869993A6DD1C769018894506E9416F53D VERWARMINGSELEMENT5
458,343,315 *2E8AD42A73E4DD6430B8EB1CC3E5BFEC372B158E VICENTE.KOURKOUMELLIS
458,343,316 *2E86710FF4070446CFC0F39FD892486C79825F4B vicki.mcminn
458,343,317 *2E880331425B974630024FD6D190D2B9C82CADF4 VICTORCLASZLO
458,343,318 *2E8E26612108CED06595F965716D4D22AF71638B 7CAMPOREAL
458,343,319 *2E897D59E85A310F6B9A4F10BB1D9661B64FE71A 7ILUVPHANTOM9
458,343,320 *2E8D49CE77ED5074FA364ECB7711EB5B6793252C 7massena
458,343,321 *2E872C2EB16E90BF3F3E301BA73A0A3A277B8D29 7REAUTARKISKE
458,343,322 *2E84669979E0ECB53497E9FB2670FBC57C611AF2 7RETORNS
458,343,323 *2E84FE161359B6D84CCD17676F1B592A4FA73E27 7SCIENCEVISION
458,343,324 *2E8607FFE42964F34DE89647F4F8BB7A5C1E70AD 7 SUNDIN'S
458,343,325 *2E8F0B2E20220C58C75BE807BD511D213606B7BD vonBirgelen
458,343,326 *2E8C6805B9E337BC02B53FEC7717C26A6C78C0C5 8BLUEFAITH
458,343,327 *2E8C9B4973536732844E601E01877894BC75D0B8 8BSWBELLPORTBSW
458,343,328 *2E8D15F261B6066849972F1BAB3476ED7AD41565 8====D~0.~O.SPLAT
458,343,329 *2E8F7A06E8099E1733ED9F5E7BC456599319A6C9 WARABIIBARAW1
458,343,330 *2E8974ACE30B3B08F9B6ED95A1D122B399614DE9 8INFANTINELY
458,343,331 *2E80CB5B6F7A936CF3EC10491673058B5A826A02 WAYOLLEBSW
458,343,332 *2E8A6D84E14F5CD7BB5DAA2ED9A3E20676437574 8KHRYGMA
458,343,333 *2E88373BFCDC2C463F8419E6E658BBB5D345B4F4 8KONSUMARTIKEL
458,343,334 *2E841D30A554FE0F7554DB7AA388144990347CB8 8#@.*.*(o_)
458,343,335 *2E8830E32098B89ADE3C91EC07A926A6B92BE478 8REDUCTIONTOPOWDER
458,343,336 *2E893946FE73CECE1E44257AB9FFD2E93415E511 wendy-asato
458,343,337 *2E8BFCFDD567EBA0A683CE26EA589FE06035C5D6 8RESEARCHKENNETH
458,343,338 *2E8F204F514F4C9865875E94B81B09D8EFEC24A8 8SUPPORTPROTEL
458,343,339 *2E8A74236101E50F1BBD55DD318AC1D1D96E2D48 WERNERTEVES
458,343,340 *2E8C5CDF7C750C4431AD32BBF02D2070322DE6DC WHAT SHE IS (RAVE ABOUT HER MIX)
458,343,341 *2E8CBC10AF872E647D7C475B6123EC3D970FAA36 9AKKISTEN
458,343,342 *2E88B15C2D56D25DE53DB9EA74A499082F816078 9ALLIEKAP
458,343,343 *2E85C23643ECE7E5E782ECED29B9267AEF0F950D wilbergoheen
458,343,344 *2E8BE4F6FE41BE38758F6696BE3D1D3416EB5E10 WILBURNDENKER
458,343,345 *2E8E3366B5360616ACA93C2D79DC3BBD28A75206 WILLIANMALTBY
458,343,346 *2E8BC360ABC09E6A355A95BE5BBB7595035674CD WILLIANORSER
458,343,347 *2E8D9C7AE25398263328AE5578B2A455F692CC62 WILLISKNESEK
458,343,348 *2E809285BD10430B7D62D26E94510DA35E6477CF willisvalle
458,343,349 *2E8A62A0B7256C6EF015CD3C0789FD9286ED38CB WILL YOU BE LOVING ANOTHER MAN
458,343,350 *2E88DEC25D72EDD4B104FB6706D4DAF31A9D6644 wiltuna2
458,343,351 *2E8EF3DFA2DC569BCC37D0A0286C0CE139C9EFB1 winniebrooke
458,343,352 *2E8699A29FFD35B711A1C114FDC5C53E668DE2D8 9MARINOTINMAN
458,343,353 *2E8DACF23426488F7149D0B06BC774B8E82F974F 9MUPERSAN
458,343,354 *2E8002255E1E89CBB27A776F308974AB9E18BBDF wo0fwo0f
458,343,355 *2E81C85C552361D1F81299538E13EEF73AEC80A4 [email protected]
458,343,356 *2E841276954245FBDEF9DFC79087FCB7BE14B468 [email protected]
458,343,357 *2E8ACB4813369C62D9806B4FD96D8223E236D2C4 [email protected]
458,343,358 *2E827C03C53F8CF57B46B7479DB73B3FA3E2B22E WWW.BOES.ORG
458,343,359 *2E8BF0933A6DA2EFC6FB58462E19C86A1CC42476 A0HGS
458,343,360 *2E85B7AE4254AE0820D55655679E76339E7E294F a0qgt
458,343,361 *2E859249F346B46539D1462BC5A43A42B1BA1F79 XAVIERCFJING
458,343,362 *2E8F652ED775F4F3E0F0CBDCD1687BE388CC2F6C A3U"I
458,343,363 *2E8A05EAF72D8D8BF5977BDEC7144CFADCFF544C [email protected]
458,343,364 *2E8EAA45D036BB3F90981FB860D3C9F29835FA50 A9Md
458,343,365 *2E8AFFF1CC89F308AAF822A9C3977275C2C0FEDC ya#`
458,343,366 *2E8E60C0E17F60E31EDD3EEA7E7F15ACD5BF1A2F YAJIRO
458,343,367 *2E89F3649E00925661569B887285452BB9CEA19B yaronpecht
458,343,368 *2E888F9DDE81554ECB87952E2C16E59C08C41B37 YERRYCHEN
458,343,369 *2E8B9ACC180DC2B9BEFAB4775218809EB13280EA [email protected]
458,343,370 *2E86979B8CF96CBCE879B448B8DF3D227EDCAEFD yk#p
458,343,371 *2E834C831C27B42DA75BB9120925643D7F04F627 ABRAM.BAU
458,343,372 *2E86687D1373D3A071B38A288989F2B0B449FD86 YODABOOTS
458,343,373 *2E891A3D99C93EA3EF8A0EDD7C5FEE14567D1282 YOUNG.SCHRIMSHER
458,343,374 *2E872CBC822AEFDD973616A9F035C3EF700027E0 YOU'RETHEFIREI'MTHEASHES(GOTHIC-MAGAZINEEDIT)
458,343,375 *2E83A0BE87AAE90A6E955867E94B0566A486AB6A ACESKYGOD
458,343,376 *2E8DB601A39154B6E4705596F46B0F8DCCB6BA02 ytiellev4
458,343,377 *2E841BE6124CBB0D1A2ADA46249A4CB515A7CC6C [email protected]
458,343,378 *2E871EFE6039D3907AD797F41A0F1D9AE6F77077 YUMIEEY
458,343,379 *2E8ABC838CF387681630309437910E5E6A319361 YURI.NIKOLSKY
458,343,380 *2E8DA40F49C2641FA2872E273D84D870E7E327AB YUTHASASTRAKOSOLING
458,343,381 *2E8CBC62A3B9FBE73184A551E5CC341DC78319E2 [email protected]
458,343,382 *2E8B7D08C931175C5639C4309F1DFF3E11A45A5B ACTUALITESGENERAL
458,343,383 *2E8DC95E8E5A70D6B77820103B92C675C2B0A24E adm[email protected]
458,343,384 *2E83E25F17E26780A7BC6D55390D9F97EF674E08 ZEGUHAS0
458,343,385 *2E80844976BEB592E8DCAAF2860250D07161174D a=#ek
458,343,386 *2E86DC2B72A6282445D26D4DF85FD5BD5EB1CBB4 [email protected]
458,343,387 *2E82A3AAA7DDC3BA7CFA3FC6C1BA9DD83B1FB41A [email protected]
458,343,388 *2E8518B992EFCCCC41346CFBD98CE67FA718FC1C a.eyv
458,343,389 *2E821DDCCB8DEC6D4C0F3EBD5AB8F8073E60CD88 ziv-salamon
458,343,390 *2E86610D5E2A44CA8CEB98D3EF0D922C0BF650D0 ZJULAA
458,343,391 *2E835B6AD0C73FC08564A0BA30898F8509FC0A75 affuz
458,343,392 *2E840CF7074363B2C362C2ECCA00A30E1782813C AGUSTINLINNANE
458,343,393 *2E855097B0995CD82F441061A38F000258D4FDB8 [email protected]
458,343,394 *2E803530090824353A2AB2BA5DAD7CAAF8A451E7 ZUHATAGAI
458,343,395 *2E824334EB96BAFE4A9CFBDBEDC26C82DF724E44 ahmad576
458,343,396 *2E8B253198F53302757C1BCEE444175C706F772C ZXCVBNMASDFGS
458,343,397 *2E80A71363284194640E3D8BB6F603DFF3D12107 AIRTIGHTZ00R
458,343,398 *2E89C26ED4122E9578ED02A8833C7EE52ECBFF6E a/j(
458,343,399 *2E874E95E3C52EA251C3B67B582884EC2217F8BF ALIFIKISHWA
458,343,400 *2E8E00CEC65416C66E35C9EABA1729DDEA4565C9 a(lkh
458,343,401 *2E86F630E2020AA466C9D552889FE8314CFCF61A alliemaddux
458,343,402 *2E843B2899F963E09BE3200E4D784E24D418C2DE ALONSO.STRUCKMAN
458,343,403 *2E81A1B4CE4FD3335AF9C07645C21F0BBBED44CD AMADOHERMANSEN
458,343,404 *2E8FBBC399FEA7C1712BCC5E86BF5C2C50BA04BC ambushests
458,343,405 *2E8215D1B84FC95150AFB2F3A9F46215DC779CBA AMIUNES0
458,343,406 *2E88F0606AA46C952474C1D40181060882577AA0 AN+1DEPRESSAN+S
458,343,407 *2E894081B9931B74261F52652CAE329A5ECC5635 ANDREAS.KACH
458,343,408 *2E87EDA209831D6CEE8CA03038587BE22AF15958 、写真、cg、映像、建築など、その活動は多岐にわたる。
458,343,409 *2E86347ADB19FA33E56D2F27E4BC2C32316D9E3A ANOSIUS
458,343,410 *2E8140CE84B3AE27AAFE01450FB8DD25C5163394 antionewadle
458,343,411 *2E888CEBD3CCA077E31B7C043F0B7FDDA97F6DF4 ANTON.CHIAMINTO
458,343,412 *2E8313A7AF840B1C0F8E6EE82E9229EE8116F97C ANTWANGOBERN
458,343,413 *2E8FC3F5B1C68ED6A938BF610333025DB09068EF anzn
458,343,414 *2E831A73913B13B72A44CD209983E1DC11B37BA0 APLAINAES1234
458,343,415 *2E83A6CB65B02735C4469F995F869AE5AE2FC119 aqewuye
458,343,416 *2E8DA84301480A9BA3AD12521BA8E038CB0B3FDD A+R2V
458,343,417 *2E8EA24C27ECB2395B11A8DA5B2EEC91F63E12CE ARIELCOONES
458,343,418 *2E8A88FCC35F462B865E15DE09D5B5E34A8B2BC6 ar__l
458,343,419 *2E8469D32CBD33F66A9861D285B5E4868521AA6A asdfwater5
458,343,420 *2E813B3B8E6A33344215927FA669C742E9C820C9 ASHLEYHICKOK
458,343,421 *2E8B78F7CD8F272F7F34CC8EC93905470EC2203D asiantuntijatyoeryhmaen
458,343,422 *2E8B3DE72BB98EF3AEA3B1FE2B50F8EFEF8E0F7C ATRINCHEIREMOS1234
458,343,423 *2E8FD166FBBE212732156990196166CE75BBFBBD augustinedomanski
458,343,424 *2E85DFB6A0FEEF5F700F8E5F4E9B5A4C1F5D5D64 a!,vc
458,343,425 *2E83DFEC31483D54204115F4B896B9E25D23DFD6 B1H?$
458,343,426 *2E83E18DCD6F84D403CE8C1187370F91D0CFC73C b5-5u
458,343,427 *2E8E23FC01B67E57F4B03F7D30B4849B0D428577 B6R
458,343,428 *2E89341CEEA1293D831110908661B911459CAE00 BAČL
458,343,429 *2E863D7F3DCF4288CC0EB15F582CC57B6307F099 BANDITPURPLE
458,343,430 *2E8A359C36360DDF654B4F360A42109AD3E604AA bb1%1
458,343,431 *2E80E262658FB53801599EE62EDD9AF838C5E770 BERKBSWS
458,343,432 *2E859D4422476E9E7C8F31C26F988B4C853A16E4 bfzca
458,343,433 *2E8CC99FA5550D7582BDE7F11A3617A926C3F23F 063antonio
458,343,434 *2E885B06C1AD3473E4923FAC4888B3A85B5A9910 bigo1227
458,343,435 *2E811C331B74991B1038EEA64FE04B25F5D40056 0iluvalexander8
458,343,436 *2E8141CDF7920CAA9B12906452FB6C19316DC3DD BJNXK
458,343,437 *2E82D04868272F41877A010DCEFBC07F3595C6BD bk%76
458,343,438 *2E81C09A13B10C191B1258A9AC324D3F6189E149 B?KHZ
458,343,439 *2E833FE1ADD80FAE1F23E7B24D19A6811775339E 11-swamy
458,343,440 *2E8D3CDAEDCD9209A9970AECF77015EF14789349 BLAINEJACOBELLIS
458,343,441 *2E8727BD1F611844B7250A43CE9CB7D7498F7EFB BLOMKAMP0
458,343,442 *2E8EFB2CAB4769CA2893358ECB79537FB6B074DC 138849 BUTUN.ULKE.KARAYOLLARI.AGI.ILE.ORULUR..
458,343,443 *2E8335D0B8D217241D2C3C908F9A3A3F470F3521 1438476 kerronta.kiertyy.t
458,343,444 *2E8DB1C3A65945AEC49450E48330908EA2726248 14-ENZENSBERGER
458,343,445 *2E83E8DB0D8F58BEE333D27F2246896B8526A2A0 BNXBR
458,343,446 *2E80E379275F7A2CAB0C6C435CA8CD311A6FE6DC bobbiecarlson
458,343,447 *2E87B13AD98B7F3D0619A1762F05E507E44C3EC4 16PALLADIO
458,343,448 *2E808A92661CEE6B9B78DF005B93592CA2763AC6 bookermontpas
458,343,449 *2E882E65537D68AEE20E03574E8A3E9F0BD689FE 1866969 tuusula.-.hyryl
458,343,450 *2E8283573D264184CC70AEA55FC384A77A2FD2CC 19.11.1437
458,343,451 *2E8CA146E33528BF702E3A66E8F8C5E2D25179D5 BqfL
458,343,452 *2E892CC0DFF1E8A2301C544A34D8071438D32E0C BQSI(
458,343,453 *2E8FA94E5CA6FDF67E38AE6F8F62468B1B0F5146 1BANKA
458,343,454 *2E801D0AA77BA8EB76C0E80EF594FDB47FC24480 BRADYDOPORTO
458,343,455 *2E8E4C8E16AB14FCCFE2ADEF7E1F1D8A3BCC1262 BRADYPLEXICO
458,343,456 *2E86994DE2933657754A06748ECFAE17CCDDE711 1.cateringfahrzeuge
458,343,457 *2E81B641B585C90685A5FB7CBFD8772960D76AB8 1DAB-LMBISS
458,343,458 *2E800B1E2C036F2BB8C87F547B38BDF960FF7C13 1DUKATI
458,343,459 *2E87E7BA30C4BD830E84A8BF1EEE458982BF6961 BRAZBRAZ7
458,343,460 *2E83787785B3E319C4BF4623C78921E9DAEB87B5 BRENNANORTEGA
458,343,461 *2E8778BA966F38521BD37038BEBE3799966D1D73 BRIANCHESMAN
458,343,462 *2E82BCE8C5805879EDAEB735313373355B8E693A brian.granier
458,343,463 *2E834A794BD355E566B69DF202CD8CD359189750 1-hochlandrind
458,343,464 *2E8C8B1301F5855F040C05BC13A9D89AD811EEAE 1 HOLZMAARS
458,343,465 *2E812C8FF4694B0F7EBC138D6289A37C6661D87F BROOKSKALOI
458,343,466 *2E825796BEC5768E0810203A355810659DC67242 1 JAZZPURITAANIEN
458,343,467 *2E84BB928AEDC57A3344C797834198068EBA845B 1karditsa
458,343,468 *2E85405A20735A089DDD325B1B597BA5EB7F22A4 1.nebelschwadenschwanger
458,343,469 *2E866F6B8C949B3A90E100D96FA714E804116CEC 1neusozialdemokratische
458,343,470 *2E81BD0E962D787A27931DA33629657060BF7BC7 1NONPROFANENESS
458,343,471 *2E8DC729DFA4DB2D94616EFC07C3D610F9482673 1.partei-diskussion
458,343,472 *2E8440FFCA643083B7FD34D60E147CBD16B1ED53 BUFORD.DUROSS
458,343,473 *2E81FCD5B5C7D1C1F49F70FBE574BC179A45FF2B 1.puhdistusliinoja
458,343,474 *2E84C79E82AC12D864BE2883E03EAAF3A7C4D979 bug(6
458,343,475 *2E8A34C4A0A583B95E22B8CC797DA599966E4896 bunnia2
458,343,476 *2E834D18A46BF2C27F7B1DA2331890453096074E 1-soundtemperaturen
458,343,477 *2E803EFD100740532E8277178CF46028FF4B4695 1 valtios
458,343,478 *2E886617E222CB996B7E01E82B2CE9C15FB92EBA 1VQZKMMKONE
458,343,479 *2E820E340CFD2D3139FADCDE4D251586D391D277 bzol0
458,343,480 *2E8972B40E2EA2C2C3DF9E043F29ECF715095DBB 22121314
458,343,481 *2E843F5CD8F0D1613ACB0300BAB976F3F0F7AEB8 セリエC2 1回
458,343,482 *2E8B701BEBDB1D63EAF53D475DA5EB7221880AEB 2-ASLANS
458,343,483 *2E852D127E2FF2CB2FC6D0B9D50EF44DCA0E2C46 2AUFRUEHR
458,343,484 *2E872C3DA26D2ABD658FDBD8AB31B279B88F6C1A c+6ik
458,343,485 *2E84D485C1E94AF5579E4D417FC3297A50D58022 c850o
458,343,486 *2E847ECEABB28509FF9CF834297668985C7E5AF0 cabreirą
458,343,487 *2E8ED9666CA2A640C1115AF0103F18483A48B978 caesarne1469
458,343,488 *2E856D71115FD2A9A286E3D0C0FE27DA1F3D763A cam.pate
458,343,489 *2E876799A90590F3A1EA453888CCB824A213890E CAM PATE
458,343,490 *2E826688E2841B48E6DC1CB2C39BBC7A4DF3CBC2 campuskhabri
458,343,491 *2E826CC07E688D92AE699109F822A48C43523083 CARLETHIER
458,343,492 *2E8782C0006A6221D70D1E37F6C68434DAB7A2EA 2THARATIP
458,343,493 *2E81B92CA0C53A53F40E2C6E340243F11A66617A 2-TRAKTOR-HERSTELLER
458,343,494 *2E8D6193B7121049F236AA9C37D5F92321881690 2werder-stuermer
458,343,495 *2E83FEFA408312DAEE9DD75E184462699A554A6A CCHALLO
458,343,496 *2E8A4877C96BA379FB6C3612E2FE450C40F5A951 c/cnd
458,343,497 *2E8C0866F156772FF2D114379CB0C1BC2CCFA1C7 ce"vs
458,343,498 *2E86F2755408D61B60EB8DA6131CB8D74D4ADC3F [email protected]
458,343,499 *2E87879B6D83B4BAB099925D7B0360563E0A3BCC cffem
458,343,500 *2E8BAB30AD2BFF71CF3B9B510B7BFC8910CFEDE5 3b<- o~ o~<--3
458,343,501 *2E804AC5C700C4FF669E152D0FB1336153D3324E cgblu
458,343,502 *2E8683FC4C3C062CC1AD2057BD95155292FC969A 3.OSBORNESTIER
458,343,503 *2E8178B4942F518040527102C7763099BDCE7A07 3 ostjerusalemer
458,343,504 *2E8DDEB6C06A0D8C99B4E71EB0E44D88B1F25526 charanbirgill
458,343,505 *2E87796B18637E4ED89E90F1FC91331087FF7565 3THEBIGMAN4
458,343,506 *2E8AA403A703876418181E1753E8048499C72FBD 441977 kalojen.i
458,343,507 *2E87400FDE7C5245D8A746A28F50783CC02B70C2 charliekyle
458,343,508 *2E89E3D1747899F06275A4EF7E99F1AC48D7ECCC CHESTERAMOROSE
458,343,509 *2E8254533269386F0F63C3B911704D7F0D10567C 4 GRENZSTATIONEN
458,343,510 *2E8ED82347AF5FE89D80C4CD268F041173DDA9B2 CHIMPLE
458,343,511 *2E8F253C7702235B874F65D9DAC84891937EA20B 4IPHASEW
458,343,512 *2E8182E2A05FCF06B70463FF41417E6E8BB873D8 4KINGSARAH
458,343,513 *2E85C942BD51B7AE3C2F149A2C6277A9845D49B9 Chmm
458,343,514 *2E831044B0F49D89A2F5A454084BB33B95EC988B 4LLAGASSE
458,343,515 *2E80B2B4B38CB14F8B4EF277B5224F02ECD9A338 4mydeath3
458,343,516 *2E88C62900B6A19C322EC96AE6DCB25AB03F55E5 CHRISTIAN CHRISTL
458,343,517 *2E8ED3E1A5FA70E945A2748C9263D585B0EC2FA7 4-P
458,343,518 *2E8FEA96CFF517FA063DEE66687BFF9860C02972 4PILLOCKS
458,343,519 *2E801B934368783383F0E804B5758C753B44933F CHROMLAMPENZIERRINGEN
458,343,520 *2E8FC02B7381B169F53A56E057D0EC2D706309BB 4.seuraili
458,343,521 *2E83EECA54664FCB415A5427E3C6DE4CFE89DF75 c#=i3
458,343,522 *2E809BAF551D6F77D6E849F720F81172EAF67068 CIFLYP
458,343,523 *2E8648E3FD619C764C6C267110A6526C232079A2 CIJ&A
458,343,524 *2E89AE657752CC2C29F99CB137AC25CE69D921E7 CINCOLATINOS
458,343,525 *2E89139742E0BE3E5C5CD664B74CC5A630897947 4VIVIDATANET
458,343,526 *2E8BE14BF08D272D4EC945D2F4A9BC284785D3E5 CITYDOTFONTSI
458,343,527 *2E865AEB9C34E8F6A45AC14210AD6D8B523E6633 CK%NS
458,343,528 *2E81A4D27DF88EFAEBEC5DD45BDB75C6447F08D0 CLEANSING17213117
458,343,529 *2E8AA9D085076D1393D0868EE2A366CFEA389E6C CLEMENTEBERSTEIN
458,343,530 *2E803D8F1CB2FF4AE60D6206D71AC7DFA91D7CED 561013 kuskusuz.issiz.ve.sikintida.olan.kardeslerimiz.vardir..
458,343,531 *2E8A9BBE1A4229E6BF5DA27B125CAF09FD6221CB clevelandivanoff
458,343,532 *2E83B7E34CE1FAEA1556DF7A6BAC08D538FE1661 CLINCHER
458,343,533 *2E89D47BD4371B8CDBDF21DD6D6D24CC29FE867F 5ADRIANITALY
458,343,534 *2E8EA05563B5BDC18EA0ADB93700767BDC4B3BF2 c$lph
458,343,535 *2E8FC34F92D906EABFFF5445167FCCA53692E362 clydekissner
458,343,536 *2E865D3E02D46FE78E46CE563476A17626C3E02D CM69
458,343,537 *2E81FC1376E490EB794DF3A7CD8AD0411C55CBF6 Cmle
458,343,538 *2E85666BFC164254781A75CBAD99B7EC908DD9CD CODV-
458,343,539 *2E8F9058AFB93E159199478898EBF5C588F41D62 compugeek1
458,343,540 *2E87B0117214B9BC83BB1D12AE1F34A942B8211D 5s!/
458,343,541 *2E8B9C903C54FBBCA5CFBDBAFD91E3E4FC087340 CORNELLLANGELLA
458,343,542 *2E8D3C472EAF03D7ED8E101EAE51213208ADFAA7 CORRADOG60
458,343,543 *2E89BE43A6C7F2357488D57D7A161230CEB1AC3E 6171993game
458,343,544 *2E849D92863446238A9E8E5A538E2A5BD018E26B 627844 disket-uzerinde-acikliklara-dokunmayin-
458,343,545 *2E836CFD7A009ADC7C6FA914C4229A94E649537E CP(GB
458,343,546 *2E8988AF9A81E6514834B3308E994835F7B0926F 6grassau
458,343,547 *2E85B2AF143BBE088C995B3AC8048513FC89D14F 6MEDRESU
458,343,548 *2E823AFDE86BF278D99135BE92FD2E44F35C4AD0 CR+6-
458,343,549 *2E8CFD8A62D31366AF8E9EAF54341B615ED6F3BC CRIMEDOG00
458,343,550 *2E88F2B71AA72BC9A8C69C2644D9628E37EA8863 6SCOUTCCCCCC
458,343,551 *2E8F08152F4A2DD21751E75B42F166F282E18EB7 crush 5
458,343,552 *2E8241EEB27D3DF4322509A5E9994222B293C0ED 6XPTCMNTZVENJR
458,343,553 *2E84E945CF33F34B29A4B7A05B2D896FB2CA7EA5 c+syh
458,343,554 *2E8ADBDF500269CEC49C2FC1D1C35FF026FBB5AF CUT-THE-CHATTER
458,343,555 *2E84AD39147865A9407AFEDCF733F6A706446462 7IZVRNULI
458,343,556 *2E8B9B22BC7DF259D7D62DCE677684830CDCB211 D.2?
458,343,557 *2E8477D14F692E95ED6DE816B904C561C7D25348 D5U(M
458,343,558 *2E8B2A3A15AF5ABDB9E4305FFC9773774E507AAE d$9$d
458,343,559 *2E8279773BACE509C3E45EBC93E371C759F83127 Dancefloor-Traps
458,343,560 *2E860C375474461B1996059DB27794D12E2D4CE4 DANIEL-YAEGER
458,343,561 *2E8AA0B6588725611D0F1B0F0723B456DF07154D 7YENDISDI
458,343,562 *2E869BA29C8A97C7127BFDBA2BAD2A0B9AA6387C dannickenberry
458,343,563 *2E848696BB5390D5C86D37B87D0D49D6DD7CB138 DANNY.DARK
458,343,564 *2E8E12EDC27FC47CDB989569BD8E6E69561B1172 8d * * )0(
458,343,565 *2E8787192A517B96CCC15E3A563441B392267974 [email protected]
458,343,566 *2E854BE3BC3ADAB39A8F939239FE8D64662E5DE3 DCPUU
458,343,567 *2E8498AC8C811F4BFA57D4D7266A944F42072B1F 8LARIKSSKIRAL
458,343,568 *2E8FD178CB6892208CA85F8F595B7102C13D5A6E D}d
458,343,569 *2E88C643C67A16B919F03EF626375D8A2333AFBC 8MYBLUES
458,343,570 *2E8770ED4B5BBA56A90ED8A81BA06805C5BC87E4 DEFIGURENT
458,343,571 *2E8A2DD7336AA7257396002F09C8B81CF09C378D delaissement
458,343,572 *2E8F9905532076F306D57E4DA902D046217BB4EF DELNOSTROJR.
458,343,573 *2E832E1020435D5BFE241371691A65A7D7E93BA0 DENNIS.CHANTLER
458,343,574 *2E8D8BC4CA8D749C273E77899BECA58C2F38975D 948770 N.N.ANKARAESKISEHIR.ARASINI.437.MILYON.
458,343,575 *2E8A92A01329527942868043E6688C3765C63172 dentofobi
458,343,576 *2E83D7EB7B48C6D952EE1A30E644F8C7976D359C 9ACIDIMETER
458,343,577 *2E866EF766EFC45B5F6E09A607CB71C13D0049E8 9BSWAEIOUYBSW
458,343,578 *2E8840D040785A02D5CAEB4A711C7C17BDD0557E derekalken
458,343,579 *2E813D730BEB69FC218FDCA9BA3CE43DB229E700 DERROSENKAVALIER:ACTI.WIEDUWARSTWIEDUBIST
458,343,580 *2E809D6CC373D579822DBA0FEDA46DEFC03E2A6D 9ERDENBRGERN
458,343,581 *2E8B3B64C0223DB662C77AD2B64924D929B6D172 despej
458,343,582 *2E8EC02B97D4069E58D57392AEA26AE6E788E83F 9HANSONDEBBIE
458,343,583 *2E8154E5AA6102BAA23D62F941CB07404E6CC8CD deutschlanddeinestadien
458,343,584 *2E88B3263B9085F957CD4B5F5B6708D8004DE3A4 [email protected]
458,343,585 *2E8A2FA8F071616EE8903654A297013479D68F99 d,f0(
458,343,586 *2E8F04304F24136497FCFD218B31EB8849BFFB44 dfnd_
458,343,587 *2E838C1973110A15015EE9F39E8FD8838DC7DC43 dhoh
458,343,588 *2E8F025E48BD73A6BBF5D2BDD49FFE5F1B689C5F [email protected]
458,343,589 *2E8430F914C60E27695054C8CEE613F7A205AF80 A1?
458,343,590 *2E8FD12C5300A50F559FE0E3346D345CA80CB53B A1.OJ
458,343,591 *2E88999A4E575621F260DF5A22BD9B562E646DA7 dij_u
458,343,592 *2E8F8F5B5ABD7F98563FE5CB81F93FA1044BB6BF AAA1WH
458,343,593 *2E876F2A6ABD96FF91A74F5033A1239B46CFA9CB aabu"w
458,343,594 *2E8B111243F443308EAA986154BA5176A24A34AA A_AMAYA
458,343,595 *2E80AC2D66FE0E323C6EFDB11D5BF186C784E82F d/ms%
458,343,596 *2E8A65CE216C1109E3C12A586DF43793AA0FB7F2 ABORKIN
458,343,597 *2E88F4313A06ED50D9E48E7868B969B7BDDB3A65 [email protected]
458,343,598 *2E89B37C427A44E30CC60040BECC11C48B7080B1 Abstrct.Capacity
458,343,599 *2E8113781DF343AE3A0B1F76EB755FDB5E35AE2D A,BTC
458,343,600 *2E83060184884CB029A5948EF44F53E4C1D0E627 donnpottebaum
458,343,601 *2E87C23D2027F4942F25E9561A87D98CC4FEAFAB acaronarive9
458,343,602 *2E8FD85D884BB2C84C7643B5A249C8B9701D9F29 [email protected]
458,343,603 *2E8386DBEAC444F11C70344CD8C22E01FEA2AF84 dopplelinersystem
458,343,604 *2E8E6D22F4FB9E0504927AFA8C528600FE65D4C0 DORSEY.LOWD
458,343,605 *2E8FB9F94801E92456145DD7FA2F5A98423AC76B DOUCHEBAK6
458,343,606 *2E8F036CECA4D060791CAB762ADC33AA8BD14CF3 DOUGGONZALIS
458,343,607 *2E8111BF99348CD51B9728EF4CC2139E15BE5EA9 DOUGLASS.WHITSETT
458,343,608 *2E82ED512EC259DEB4ED9D810C00C3B34634A6AD AdE/
458,343,609 *2E8F4EE0955E279A8E95454D3FC1129C6D608BC4 AEKG
458,343,610 *2E84F1F8605E811A6425EDA44565DDDD16F60066 DRIVERCLEANER
458,343,611 *2E8438931EA7E2D99B534EF4B685653529A06525 AFFT
458,343,612 *2E8283921756BF31057375872B99114C98FC52CF DT%I#
458,343,613 *2E8B77E24C2BD3043245AEF5AD15318A3610CE07 A-Le
458,343,614 *2E8DF3EC0456752C6A3085C55B1A3AB5E4195BFE ALFREDBROCCOLO
458,343,615 *2E8CF1619FC6B30221F3185C634952572024F3E0 [email protected]
458,343,616 *2E886BBB640910FC5ACD80DD19CE6056C486BFBA E!6N
458,343,617 *2E8DC8B64BCA8E8770019E6B32DEBF30F8DAFEF0 ALLTHEGOOD
458,343,618 *2E827017996260C20E3DF01187A8000439225B21 althyeb8
458,343,619 *2E86EE37CC93B68A4952EA231540DE5760C50D06 ALYSSA-ISABELLE-FLORES
458,343,620 *2E8B1579C2D252BA7EBD100D877A4CCD34C90016 am&1d
458,343,621 *2E8E3B9E2A1D4DA717A95C7F300D41ABE6F80C4C EH8"U
458,343,622 *2E893B7DB9EFF16C66DE5722C31EFCDD3DBFE8B5 ANGELAG229
458,343,623 *2E87DF168723DDBF43D712845987A980BAAC6B27 einekomplizierteideewarumliebekeineemotionistteil2
458,343,624 *2E8E6248A30A7559C742F3AB90662D0464A64403 electro-hetero
458,343,625 *2E83025F52076418E536CA60C4A573BA0A7A6E5C antonybub
458,343,626 *2E86B6FD59722C962EBEA61FAC4E37DAEFC58531 elishachadez
458,343,627 *2E8A59B1C385CFB79CCB6904966008395BE0950B anzn
458,343,628 *2E877F5028709398A52DD8E144ACDA3E7A509EA2 AODRE
458,343,629 *2E8F4E87A7E0B6F0ACB0D721F51F901ADE200A7A appyp
458,343,630 *2E84D30BBF4EBB61A2FC37A9EA182D2A620A6C8F EMITAVA7
458,343,631 *2E8A3329A91F76C2F212C4E4E58294B8286B21E8 ARCHIE.MANOS
458,343,632 *2E85F35F6B105A1F07404F89A7A11C3DCAEFCBD6 enl7c
458,343,633 *2E8B51DDEB4B710FB437396D744CA77978DFB648 ensisching
458,343,634 *2E86F7985155574523C4AD86E94CC8F31036C0B1 ENTLEBUCHERCATTLEDOG1984
458,343,635 *2E823D262FC2C47D42EE61EA8FEA18191BB32454 A;R&R
458,343,636 *2E883A3F6DA33D0788D2674EA34EDEAEF2773D84 ARTERIELLEM
458,343,637 *2E800B511BA786B4DDA1EE1634051AF9BE1368BA ARTICLE4107827
458,343,638 *2E8F334AEBEC37076C42AD64CC97495354EB1804 arti-sutaria
458,343,639 *2E882F7B4D3943F7DFFB972DB075845194744157 ARTUROSENSIBAUGH
458,343,640 *2E8C859FB825514AEA7E34E36410F89FFF5C3D60 ASACHILD4
458,343,641 *2E835CD29B1550E82D0D85EDD070CAF8E9EA4C8E eqog
458,343,642 *2E81BFFFCAF5FAD2E4A921E545AA430D804BCC80 ATGv
458,343,643 *2E8D8B66C7805E321CEDE298A5971DC4A9003DF8 aubr$
458,343,644 *2E81E72231AA12BFD29F631D80C5DBDF0802DD19 everwarmer
458,343,645 *2E895EFC19CC6F6403E77926E768A42761315C21 auhs9
458,343,646 *2E8C32BCD931562CFE9A75C5ABE90459117E02E4 av4h0
458,343,647 *2E8FD310FD3D5EE8E2C8285D58D48DD923B67AE0 faroeislandscupcompetition
458,343,648 *2E87EC0BA5A87BA0D87CCBC126BBE28524F41B26 [email protected]
458,343,649 *2E8A673275B7BA6A86FC2506893121F2F9560D25 [email protected]
458,343,650 *2E8E798CFC809686973078CAA31EC2BC50E60FD0 FERMINCALOWELL
458,343,651 *2E8FBC3E5266C181320F3AD51237AE97AD7AF4FA FERMINMATTEO
458,343,652 *2E8EA1470755A96F0354D90769BD822AC81F311E FERMIN.SARDELLA
458,343,653 *2E84FA7AF9CFD2E556DB0F35233CAC52915BA84E fforest2
458,343,654 *2E869AE2A50412073F282CF0D0456368E0E61CC1 [email protected]
458,343,655 *2E86C9361A514F5F02AC2B1C09367CFBA3EEB5CC B%+1H
458,343,656 *2E8EAE1949832428DCD56355AABB900D0BBC8A4C fineseting
458,343,657 *2E89BE5123AC7D754C802F8BE19CF3D0B1FCCEAC BARRYALBERTINI
458,343,658 *2E800F77D2C0924995D60A6E41F6B2444DDC6406 FOREST.ESPOSITA
458,343,659 *2E8020162C8F911238CD82A5AF7E9AEF30689FBB FORESTMENDELSOHN
458,343,660 *2E83CB0C9120C2B65B65E62CC0089513B5A6FE57 FORGÓMOZGÁSA
458,343,661 *2E8E2D556122E4403BFD0EA2CD60B68FBD176E68 four-oaks-lane
458,343,662 *2E899074285E5F005C6D6050F78E798B2FC98327 FRANCISPANGILINAN
458,343,663 *2E8ED46B66BBAA200B649EF9434E8F236EA61B6C FREEMAN.WINESICKLE
458,343,664 *2E8FF2ABB6F6C08527DD81A6A6DC3955C60DDDC3 FRGRNNG1
458,343,665 *2E8FAC3BC74A5B5E0EB1AF90C8493304951978FF [email protected]
458,343,666 *2E853A35463D8F9FF5002F8E79B9D6485D83E03F bennieburdeshaw
458,343,667 *2E81AD32EF9E817922B251769A61B70778A437EE fyhl
458,343,668 *2E8EE14C377C7470551AAB77B9A354055EF80919 berrybending
458,343,669 *2E8437E0ABF953DF5926A6F0DAA10B9EEAFD57F1 GABY!!!
458,343,670 *2E812E3955875F82DB036CA2061C69EC146DFD45 ganujegangmaar
458,343,671 *2E8DB5ADD869802B9E537952AB7858B316F4C127 GARMLEY4
458,343,672 *2E8D8F9CBADB7F973B3B96F15ACA5B381197FC1E GARRET.SAFFER
458,343,673 *2E8F974F9E0CF244E6FD4148B5D8D18375B53AAD garthwaldhoff
458,343,674 *2E8909A03E4EF6DBD1D9AB4E4465073E5D375452 BICUSPID
458,343,675 *2E8E976995188A8074F9C90C9CCEA9FA519F7D27 GAUSSEZED
458,343,676 *2E8FACA3A7A553B012BC762DCD0D158A487F3461 [email protected]
458,343,677 *2E8C1FE40B14619F5F2AB28C39524EDE5DD3BF61 BIS4BLING
458,343,678 *2E8E52915D320C85DCB11FE0AE45BB644768D53C BL=EM
458,343,679 *2E8B31AB73503A8E775FDDDA803764628ED2A5CA boblevy
458,343,680 *2E85B7A5B7CDD67283F7CF1DA68816EC4C693268 BOYCE.ZINKE
458,343,681 *2E8744A8F73EAF792ED0FA187CD6079B5B85BB68 boydkueker
458,343,682 *2E88A28336927619816EF7ACADB6364514CC9482 B)PDP
458,343,683 *2E83D6678575189DABDD89EE11A0A74297510AA4 GLORIAAD
458,343,684 *2E87E8DAB13989A972B1CD2178F3C8EE6C00D043 glossorrhaphy
458,343,685 *2E87166C9284414D1CEB872F45DFB2BD0A6B8378 BRETT.HADDAWAY
458,343,686 *2E853647E7E1CB445470F0E126C88A4B02D71BEC GRADYLAVANT
458,343,687 *2E8550628EC9E13B3BC3B89FDA8EC101D18601A3 grantwanzer
458,343,688 *2E8BBE82967525C5038BCDD3BD87B0EF29CDC037 B#(RM
458,343,689 *2E815755839B1CEC85D19D96BA653FBABD1EBE66 BRUNOPROTO
458,343,690 *2E8189DCFD1E331D61D563A87A7F9CCA3FF9DA07 GRÖßENWACHSTUMS
458,343,691 *2E827BF3B5A09B763941526ADB90594D887D6790 BRYCE663
458,343,692 *2E89EE78A7F468031B9D6E21FFBC1CA21FE460CB B)S.D
458,343,693 *2E8FDB46E0B336A7CCBEA1D0F377854F1B2D8335 B=====)-`~-splat
458,343,694 *2E8647D61B5819F91787CBBFD921DC0FE8EFE814 b!t?.
458,343,695 *2E83C4C020A008E7F71043CD0A6F2FF3CA85B150 gumgedle.(amampondo,.arr..s.matole)
458,343,696 *2E87E5E3EFCE115355F5FD3EC83ED1A4908193FE BundleOfJoy
458,343,697 *2E8C10859FCA96F608AE66D75DCD3CC6534FC8DA BURT.WESTERHOF
458,343,698 *2E87AC7894A09B6B660F4DA29882C7804062E28A HAI.TRABUE
458,343,699 *2E8937ADD1EFAD4183E83F8A5BCB890215B65F2B HAKSPEK4
458,343,700 *2E85714E3A7422F0E4329C244F6EC1BC4E5CE86D BVVRX
458,343,701 *2E8695A9086281AA04B676553DCEAC6DB5E86CB0 HAREENDRAREDDY
458,343,702 *2E80B2A79B7B4995E4B665F77572BD8E669B9D16 C0G#
458,343,703 *2E883998317427947B5105FA9D5AB2B734373717 C-9HM
458,343,704 *2E8DFE2A4B7146F3F6739D6ECAAB7269E8A6038E calvinhuter
458,343,705 *2E849A9CA082DF87AEB93FA8F37D872C81C6D7B5 [email protected]
458,343,706 *2E801658BB8A79403DBBC696B6EEEDFD8E7D048B [email protected]
458,343,707 *2E8F269923625ED1D3E31FEB670ACFE78C697C6E carmenvavra
458,343,708 *2E8D88045E2247A8B8269ADE2E5279A7D58D7E7F carrh
458,343,709 *2E8EBE5A13930E0129266E64D58045C55C9A0C15 CAUDILLOVÉ
458,343,710 *2E8C792440C4C14F1B9A9522AD0D129A7059E574 CEP6V
458,343,711 *2E8E55F14B5D60A971C55F9E77553CAADCFDC038 HERDOFNERDS.NETWWW
458,343,712 *2E83F0CF2F2C2E210CE23C2DE99D6382CC726C89 herondas8
458,343,713 *2E89907A56B96C45B990F804597664D963442AA0 HILTAWSKA
458,343,714 *2E86F69D6A32989FB5ED0290E7389662D98AAC4C chapter0403:ahousefullofbooks
458,343,715 *2E8F430EFB8011DA21B598ADCC21C2E79125E32A CHONG.NOLLEY
458,343,716 *2E81CE6F3F9D2BD9D347C00288CB497EC4525B18 chongstagowski
458,343,717 *2E83D6CED636B0F09FD67703CD83B6CB162B51A7 [email protected]
458,343,718 *2E8FB56B71C1FC65FB983A7AB0FD6A9204953CE8 [email protected]
458,343,719 *2E8166D00C28BE9AD852704E8CEEAD2C04CFCD90 HOWETED
458,343,720 *2E8950A90AF9F6258365B924673FDBAFC03B40F6 [email protected]
458,343,721 *2E87A28260E47A2B95E7189702C4F8E9E9546DFA chx2
458,343,722 *2E841C7EE6BDE8F4178C196A9D7EB9A8906AE3EB CIRCLEOFFITS
458,343,723 *2E8A7DCA207BAB94C9D0D66FC59878580EFA25BE CLARENCEKAPPERMAN
458,343,724 *2E837986CAF447B7BF18413E81F095EE77BAA3D2 HUAKAʻI
458,343,725 *2E870CB379D3704CDF52A6B802FE2FBCAB145C9D CLIFTONERICH
458,343,726 *2E8DA583FE8ECD35431282D682FF97BD252F3F83 CLIFTONSIMS
458,343,727 *2E83583FDC1753BF12EA128BC4AEE7E049CCF40D CLINTON.KUYKENDALL
458,343,728 *2E8973E0805523AE27F57AA7C7C795E6BA58BDC3 coastph
458,343,729 *2E8E96EC0E2AD76712BAFC2DA4174EA8A21B6B67 IAMHORIZON1996
458,343,730 *2E81EA761AE9A481C4DEDB8D23D996152BC18607 i.am.the.law
458,343,731 *2E8043A92CCA2C87B5C83DD363A4A7A9EE781C51 COLEMANGOMER
458,343,732 *2E8DB0FD5B1EB75B36DBC5D769635E41B00B82FF iarehcir5
458,343,733 *2E8142D6382FEC7D12321598A9CE6E3EF29A4F3D icarus5
458,343,734 *2E85D94986C1C395113BB8C9B4FDEB17773D4AAD idoista6
458,343,735 *2E8E9E9D15B5B200F24B74B68DFD39EE474ABB14 iduohcsom-1
458,343,736 *2E8BF0262C0488922747E9276EA7F5BC41F9D822 IETHELN
458,343,737 *2E8540669245938BAEF974A423131B376EABEF06 I FOUND LOVE (THE RECONCILIATION MIX)
458,343,738 *2E8714DED8E015490A864E57B073DA6FB075E876 contra5t!n9ly
458,343,739 *2E8C39D6FB998A544AB00709D673645584D4E251 Cp0!
458,343,740 *2E841103DB60F986B11A46949C396791D01E4B83 cp#o
458,343,741 *2E8308BE0CA63E218075151229CD344A4194D4AF INTRONMEDIATED
458,343,742 *2E8AF7CA40CF0104015A1C1535932229F88DD50D iseetheblueinthesky
458,343,743 *2E89F0C307C068F3B8FA711A71FE6BB10D63A68B crpp=
458,343,744 *2E832740FB0610D2771DFD45F2928776EFCAA388 JABARI551
458,343,745 *2E8FCEE32BE43F3A8432853EEABEE22CBAFF61FE JAIMEBON
458,343,746 *2E8000D34726719F121434B8EB6CB5BC7C6916C4 JAMECECERE
458,343,747 *2E8528519EADF1666C6F07B80AE6DC2596E7A4D3 JAMELLORA
458,343,748 *2E8ABB0E2D3563DB79B03E8ABB49398DA434DFD1 jameson.olson
458,343,749 *2E842A0AC620CB65B2329634D783E937646FC4C6 JAMIE.PRUNIER
458,343,750 *2E8C8010638F452648E557552D5302EC60157961 janhola2
458,343,751 *2E840A7FED18BCF63FAC4851700C0E7762FD5157 jayne.paterson
458,343,752 *2E8DE9230E7F78C82E6FAED7410D0F11434C4D13 JDUTEAU
458,343,753 *2E8277D54387541C2B0D1EFC4651122B17B70694 JERALD.DELALLO
458,343,754 *2E8F5BE48604EFCD0448B8AADF8A75885FAB1A7C d6.hr
458,343,755 *2E87A42EC8B63D390C1349A898FBC68D6A60706E jeromenuber
458,343,756 *2E8FEFB1EC1BEC02178E321E79CD82B410B3E85A jerrellandersen
458,343,757 *2E84ACD4C552F4B41B2EF06EE413908E89DE594C d9t?
458,343,758 *2E8255772F99CB0E9584FF25027C031D3E9F0356 [email protected]
458,343,759 *2E8F0EA0F2BA9F0E61946FEE578337A6AE8C7425 DANIAL.HISEL
458,343,760 *2E8DA0B58E4BFBB8ED71483FC1F27EF19A8BC76C jimmy-mulholland
458,343,761 *2E84B42622F867600E2E972ADDF74DCD69D805AF JIMUSHING
458,343,762 *2E8EF06846343BE6638660B7E557570DD25E5D6A JKALLIGA
458,343,763 *2E8045A283AF5DAB9EE454A460ADB31E7F539594 joeydoc8
458,343,764 *2E8099A294F37C6D330B25F4F401B917A78E5CE2 JONGUARD
458,343,765 *2E83BD5AFB1D662816D1D6FFB7883A66A987B7F6 joshdresch
458,343,766 *2E8FE8F0AF5A4988677A5012CDF45985A86827EC dd_11
458,343,767 *2E8136A78B9116AD19633FCD3AB9A2A9CB5DA8DF de65(
458,343,768 *2E82415DADCD6EAF0A4E81C04A423D4BFEA17E25 delbamburg
458,343,769 *2E86B6082F733B09F23A06D964A8AD5B7BB846A8 kamilah
458,343,770 *2E8B25B6B04F56E1C30A68F546E5D08C06FC69E8 K[BG
458,343,771 *2E8C63C3499389D314516993A3DC28A8DE6396FC DESUOLBE5
458,343,772 *2E851A4BE29509E23B8898C29B584586FF807F31 DEVAKKEN5
458,343,773 *2E8B57190A1912FA40E9909F4EF4D93D052A5BA0 DEVANGKOTHARI
458,343,774 *2E8596AE4AC9A54B92A4CA2776F078DD44214D15 DEVONMANGINI
458,343,775 *2E80B8EEEB9C39FF35EE03B611BADF02FDEC595A dexterbellisle
458,343,776 *2E85F245A371526CF5F553378AC389AB7F28DC38 KELU_BATERIE
458,343,777 *2E8ACB468C605F6BEDAC3D61A420A57235F49760 d$fek
458,343,778 *2E82C1180B6002E54BB7D837171E0ADE5E091B6B dg4s0
458,343,779 *2E8C90D4996B91ED2234EBEE11D65FF669808E4B KEYTOTHEWORLD
458,343,780 *2E8EBE1E4942D28E149A94BF4EFCA276C872FE00 DIFFERENT.STORY.NOW
458,343,781 *2E8CBB696A58EEA2AA89E7DDA07A831158BECE49 dillonkawaiaea
458,343,782 *2E880DB90A66E0BA8E1E8BBD752EA52C29015D7A KNISYAWA
458,343,783 *2E8B1764E59A26D58FDC038ED20AC830FCFBA79B KROPPENS7
458,343,784 *2E8A673353ADD834CC8D657EA0BA43DBDC2D4931 l'''abeling
458,343,785 *2E855AA4B13B512F86CC2D7F9757F67F658BF45C DISTORTO.(INSTRUMENTAL.STUDIO.OUTTAKE)
458,343,786 *2E8823B17996B244855B46A13B14AF814E6FCA9F DITCHW4T3R
458,343,787 *2E881AA45C2A9228D937D744C0A0C3ED239B1E72 LANCE.CHARTRAW
458,343,788 *2E88A15949F654DD11D6CB7F4CA4CB39FAAA059C dk#bq
458,343,789 *2E8E83978EDAC6E9EBB23CB8101BE9D731177A84 laukesied
458,343,790 *2E8904759848169A1275F525869174E0AFA1661D LAVERNEMAUZEY
458,343,791 *2E849FAA40CE70CC9AE00990E2B78E839CABBC81 dmh_9
458,343,792 *2E80BAADB559BDA9FF18E372C6C3FCA4885E5FB2 DONNYCABREROS
458,343,793 *2E895BC95BDBD56A7C2334DDD878EF55FAD78653 DON'TYOUNOTICEANYTHINGNEW
458,343,794 *2E8AFC8E4C11D2AFBEB3E990F90613964A548886 dq7kc
458,343,795 *2E8EB6EF5C30EF61E5E7A5441C75A3F3F423BEEA DqN9
458,343,796 *2E8316C85E691AC0AA5C63FAC4780B63DBBA45B3 Lisa's.Ono.Bossa.Hula.Nova
458,343,797 *2E88EE16F512ADBF2F588C319544355499EC002F listoffilestormbsw
458,343,798 *2E884E3EA905CD3B072EC135DA83B2174E199B8C [email protected]
458,343,799 *2E83291E3CBD7B9FEFCCE5872933ADACF02AF1D8 lkibaa
458,343,800 *2E81FA92A7BCDE493A7DC248976AA556A4D36B10 [email protected]
458,343,801 *2E8B48324354FCF42B787275A956E9711FF9C709 LOBAĈEVSKIJ
458,343,802 *2E82FA93F1413F4F572883108C8463BD85C10911 d&r=n
458,343,803 *2E8B1925911A0A606C70CC546721B2EBEDBC4953 LOTHNES2
458,343,804 *2E8D8BA0AB1D0A21FF2A3E65F37AF509A18889A3 DS#&%
458,343,805 *2E820D16E8EEAE2AADFB0EAE1A0A2FBD07D4744E lsd(lsdoofmix)
458,343,806 *2E85E3CE45066F0DAA8D85617E1419AA80FB3FAA DUSHCY
458,343,807 *2E8CCE375CD837F7A47578B8FC88E1D6E4FC6FC0 dustinfranco
458,343,808 *2E839CE18092CE4326B7ED1EE602DF10F9799C3E M3G4C4NDL35
458,343,809 *2E87BEF1912F57F23E204D1F5C3864BBF3C931B6 m3t30r5
458,343,810 *2E82A3B5FE48CF611A1991F42B394011A549223F macrorhynchia
458,343,811 *2E8C7DBB52D3CF5320907148CD6C7DEBD62872E7 MALCOLM.LOUDY
458,343,812 *2E8419D5D63DC168CC63843701C3C8C4831BD317 MANASUNANU
458,343,813 *2E89CF3B04C82E3285D2D0743923A1C993385B57 DWFME
458,343,814 *2E8D49BC99D040A428FEA17770E46B0CF4C9DF8D DWORCOFFE
458,343,815 *2E87DB0BA5BC4BEF7F00C1984B8E4430AAC23945 d;#wq
458,343,816 *2E838D0EDE52AB5327F8FD8BBEE03CEC0A9E8129 d/ydi
458,343,817 *2E80022B5B21152B82C9D253B34FCD9AF7947838 marino68
458,343,818 *2E86C4B1B40837287D4226FAEE3591C5A8753475 MARKEDSOEKONOMISKE!
458,343,819 *2E8AA7C9590B8A02533FA4980A67D7DB54198F59 EDDIEGLEATON
458,343,820 *2E8ED0438A8F5AA5A8B6A6D15243DEC5C965E622 EDGEFIELD3
458,343,821 *2E811076137A65E03D0E6C20811C36C6A24001E3 MAXIMOKOSTEL
458,343,822 *2E8072A6A40B001E6D9911CFFE6514320659F0F3 MAXWELL.AVITIA
458,343,823 *2E835146E742FFE14DD84B1325C651C8DB6C58AB maybe-when---
458,343,824 *2E834480671AA7C057F3F8B1D42444319A351C48 edreenigapeg
458,343,825 *2E850C1A9469DBAE3C86127DFB5006DF8401AD6A meerval4
458,343,826 *2E8A6FA29C39DD5848148C49DEE30C483BA3B473 einsidelsborg
458,343,827 *2E88E845D0B22698EB793D7A493A0DE702DC5323 mike.rubalcaba
458,343,828 *2E8C1A0986DACD0A9D3539D9075C8AC83501C800 MOGENSILLE
458,343,829 *2E858C62D4213E7D047CA1A0B8968E6AACFEE688 MOHAMMEDELZINGA
458,343,830 *2E8D23C3C64D24E6B6E3D1FBB535AF7FB3E1B360 MOHGAN
458,343,831 *2E8169817FB87AE50DD7B14291EB33E5F4FD85CD eksamensrset
458,343,832 *2E85C3E157CAB33FA007EC2A546609FC47255EE6 MOSSES123
458,343,833 *2E819A8816A5415B3804886A74D7EAC89C16C0EB [email protected]
458,343,834 *2E80967D6A0E22F78D2184DBAF06684095348A2D NAPOLEONMELLS
458,343,835 *2E8F4ECDA5A8C15C563B352B1828B624D4880668 nastradamusthe19th
458,343,836 *2E8CC29B67EE22D9B1D0668ECCA60B15582A3B62 EMMITT.SHRECK
458,343,837 *2E8E6E285F1C8620D55722FCB16D1BDF3260E0B5 EMQIK
458,343,838 *2E858695E6356942BB5698910C5B73BD97C4FAE0 nazorine5
458,343,839 *2E89B6A53CF6C452343A1AACF1FAB81629E5AF88 ENETOGEGNI
458,343,840 *2E8D25E4DB2CEDEE5851CD1B9C75CB7572AC6C01 Entwicklungsumgebung
458,343,841 *2E8AEF13D24C18DE0B2E0A3E254F5F0417D5BEE3 nicolasfrankenberg
458,343,842 *2E8FA48B058086C835FEF78B9829544C7FCA5D53 nijdassig8
458,343,843 *2E88082308D0D4DA9351521AB039BBDB8D1B4D39 „estudiantes“
458,343,844 *2E806D76743BBE676E6D5FBD22A4C34316E8808C NOCH-IN-DEN-WINDELN-STECKEN
458,343,845 *2E84B60D7DB1B58A2E6CC6F852DB4E35F75FA6D5 NOLANMOATZ
458,343,846 *2E8D241D1BDAB01E8475FFA26BA7740158C60F72 EURIDYCESING
458,343,847 *2E851D3CFB8F15AB388D3357B12EFD3AD4E105E3 EUSEBIO.MROZINSKI
458,343,848 *2E85057E0EE57F1E954F2439139AD419D245F47E Nonofficinal
458,343,849 *2E8A2D318208CA98E239B25F5BC9F6DEB2B6F99A nord's
458,343,850 *2E8A71E50A2248E73F75ACDB8CDF536555EC44D4 nos jeux
458,343,851 *2E813525B91BEBC2AD711A9DDE5966BCF0CB51B9 EZIMUESUM3
458,343,852 *2E897602C6C0C8F7DDE5CD8FB516B02444F23EF5 [email protected]
458,343,853 *2E89DBDC48DED83CB330099C5F0CBE8855D4D6B7 F16224
458,343,854 *2E87822444BD3CF632BB245BD36DEB6F269C10C1 f{9f
458,343,855 *2E839F249E5723BA0330972B6E0F6C3CEDFBADA0 [email protected]
458,343,856 *2E8AD114C69CA59F324C946B6F3A6C93869D5FFB NYLIGEN9
458,343,857 *2E894BF8335594956E769F42ABB97DDDAF90B73C )o(~`(=3
458,343,858 *2E81225F3CED00C60253B1AD3FF70CF77F3F1E4A [email protected]
458,343,859 *2E8A582EA51E38439EE157F8A308D71DE9B4F7BC odziezy9
458,343,860 *2E806DDD5B468E19B621F5CD70B301CE70506433 ohk[
458,343,861 *2E8AEBAB407FB8BB77C58318B815BF759C3EB16F FELIXPAUL
458,343,862 *2E8DE08467DEB7F956A000B3EECBB4EBFC29857F OLIVER CARABEO
458,343,863 *2E8F0F63290CDB1101878F90DB9805FD05D20E3B OLIVER.LABONTE
458,343,864 *2E87B03F8C54BB6100B18D8B9762EF0584C616E8 OMARMADDRON
458,343,865 *2E84A0A48E96BFC741A94D5AE270B2823CE19A3D ON -
458,343,866 *2E857F09297E38A739AA865485E1F8C0AFC415A4 [email protected]
458,343,867 *2E8DE74766E881867287536BF6EB6B2960DEADB7 OOHSHEGOTIT
458,343,868 *2E89E88E1CD693D6F66555F1E0EF6F2B7B053ECA (O_-)[email protected]======Q
458,343,869 *2E8F0F510C9D082CAD082C9D4E41D36512732E36 (o_-)~~q==q
458,343,870 *2E82D6F5B6E5801FD4D516AEFFF0DA5371B8DA4E ORLANDO.MULANEY
458,343,871 *2E80505D3D82A01B05FF8D3B75CC79C6266812E1 ORVILLE.BALANDRAN
458,343,872 *2E8CD05A0C1BD4DDE11824172F849FB51899917C FOREST.CORLISS
458,343,873 *2E86AD7C359AFBD09C79ACD7BEFF56A55EA04682 forgetness9
458,343,874 *2E84A71D946EEE86E154BEEAC677C3EF08EF2A9E OUTWERD
458,343,875 *2E8A138EDA41F06B7D6FACE16350B9BA93CC5DD5 OV3RCOO11
458,343,876 *2E8126FBCBD47AE6677BC14C9F096A0C35BB5019 fqn-
458,343,877 *2E8BFAA7B44065ADFCD4541E2CE360B255EC75BF francisco.vargas
458,343,878 *2E89B5B0E23E507B895B0FBBA9E9FA00D0A36864 [email protected]
458,343,879 *2E8D5175DAA0DE6149B59D08DBD11FF79205C4F0 (^_~)~`<p
458,343,880 *2E897877E9F7C7D3D965591307313E26B21EA011 frank.schmitz
458,343,881 *2E8DFCE1D9A07B18F5FDF536D807CFA591625E4F P######@~.~.~.><
458,343,882 *2E8A4B892EFB81C40A91D4A7F53F415BB659ED14 FRÉIH
458,343,883 *2E8AEAE7CA2FBCFFE01481BA8800B91CD718D4EA freshfish5
458,343,884 *2E8DB402C1F1A8D9AEE64704BDAAEC36E766D23A frostpro4
458,343,885 *2E83F50A9362CD2D5100D01C9CD4BB2449B3466E PAKLOOP1
458,343,886 *2E83E7FB49A020408BC8D19289E5F76FC58E7222 Gastrectasis
458,343,887 *2E8EDCB38B81675CDA93545CEE1F73917B071927 payroll.professionals.(feat..joey.the.jerk)
458,343,888 *2E8418A745E6D19F7CBAB9AAFFE3E11474ED0F18 P##B~O ~OSPLAT
458,343,889 *2E84B06CBDC6E703271A345B0926B541A76C5D76 [email protected]
458,343,890 *2E8D9D3801D842091A5BD52411DDEDCFD17265D7 PEOPLE DON'T CHANGE
458,343,891 *2E888394B8EA89D752C8048045DB4B75C30FF738 perssoniin
458,343,892 *2E89CDD0520945CBE2F31018035FF2A45CE4691C g?~m
458,343,893 *2E89D13F76BBEB56A893C45F55BEC6DADECF00CE PIANOQUINTETTHETROUT
458,343,894 *2E81986B61408D6A83156CB911DBE030F127F5DC PLQ_
458,343,895 *2E85EA4C191041CC5209E4EC2605B69E2BE0694A [email protected]
458,343,896 *2E803F9D143A6C33057F2893066381505327A76E GUADALUPEFARID
458,343,897 *2E8CA4322965B8319A3E8D9F26F0BE5840722BC8 POSSIBLE.AAAAA
458,343,898 *2E81EE4A537B07A1A21F8B2643801F45FA665BD9 GUID38OOK$
458,343,899 *2E86BDD8AA15665CC65033D7F22A24F1D30E05A4 p===p`~.`~.(~_^)
458,343,900 *2E8F8E3AFA7F36F77EC4662BD447732625AC5E61 PREFABSUN
458,343,901 *2E8DCADA2D806D3945062042079038166B39D278 processabili
458,343,902 *2E89F231D8F410F0A137B3063A739D9FCE7D4ED7 HARLAN.BRUNTON
458,343,903 *2E880C6E62BA43F5C605C7F0594B564E8860A0AA PURSE-PEEKIN
458,343,904 *2E8093AD24C3F9B7FC08EDC69531867231AF57C8 PZ(W
458,343,905 *2E88117DA989581039996CCF425E7CD592AEBADA q=====b~0-(~_^)
458,343,906 *2E87DBFE6B5739CEA7554ABA7B6A29D11B22E7A2 q====D~~~Splat!
458,343,907 *2E819592829A490B7473DFBD99756039E4A49E68 HARRISONENRIGHT
458,343,908 *2E8DC6F38CB4FBE7BF2B8B5900D0341BDDCC2D1B quamns
458,343,909 *2E89806985CF2FF559159FD1102C57E21317BE03 HECTOR.KUBOTA
458,343,910 *2E81EB42AFCEE2FF48291C1F0B45CC3910B1162C helen.burroughs
458,343,911 *2E8CA53CDBFD66D29BAF2C47032A8861361CC14B HENDIHIDAYAT
458,343,912 *2E8218BBAC3E7EFCDBEFA7018F3CD19E07D00E37 [email protected]>
458,343,913 *2E8C319C1028FF840EA634D833F2A1983ECA28A7 R^7B
458,343,914 *2E842F0F271F2F2E9E5A7C79BF6833A4BDB85380 HERMAN.WHISENANT
458,343,915 *2E83C8DA623650D3F2ED337C70FD5AF9CA331F8F RACHIEEJ
458,343,916 *2E85456E7E4FE86A102979CD291AE27DB791F6B8 [email protected]
458,343,917 *2E80378390EA5BE8D858012B009275B4FCCB14EA radamesgnattali:prestopossibile
458,343,918 *2E8AE32500CFAFA3B40577C25626ED7F6B4BC11E RAFISAMII
458,343,919 *2E8A25322428E0F5694514CCC8C34736EC00E9E0 raleighlightsey
458,343,920 *2E8B95DBFC428B13F78C9998F6D54C6C6CF0C22A RALEIGHWEIMER
458,343,921 *2E8666EE3385AFBC6D911FBFFA6C8710C87484D4 Hide.From.the.Sun
458,343,922 *2E8C690DDAE9548C349B3C0EEBC857D14F7BF467 RAMSFAN8
458,343,923 *2E81974B6B67D8FEA3BBEC4F07069D4FA114DBDA HIPOLITOLARAIA
458,343,924 *2E8700F5E6B49CA4AA3E447B63A5C91D07EAFB3A RAQUELSHORTY
458,343,925 *2E8C0B113AB03276030235F36B7E105006058D89 raymundonop
458,343,926 *2E8DF6AD7253702D787437F63EF511711E661651 HOLOCAUSTABOUTCOM
458,343,927 *2E8EB150A30734383350E49979BB4A74FC74E0BA re5ubmi++ed
458,343,928 *2E8B979CFAA7B9A448741D0D2A58E9893167C8FF HOWARD.AVANTS
458,343,929 *2E8C8BC12DB2CEEA8C669CD3D472BE72ED23FA6D REDROESING
458,343,930 *2E8A7A8F66B6789E81164AB235DBFB6E55E9BC65 REGGIEBOEBINGER
458,343,931 *2E8EF754FA951F6FA0E7F3583835562F4EF6E6AF REIDRATANTE
458,343,932 *2E871561FAD07869DA32AC26455719D248238FE8 renegloston
458,343,933 *2E85261D3A40822842022CE785A12272898D35EA RESPLANENSED
458,343,934 *2E85F1F6C5F070DF6E2C5FB5A4D9CFE4511D2A1D httpwwwwindermerec
458,343,935 *2E8FACCBA1577EC48D459DE95BF865FDC94BBF11 retrospective</span></a
458,343,936 *2E87E8A337D277017D63A5036DD2B90C0856A4EB [email protected]
458,343,937 *2E8C03BB36AB61A3627830F9A73DB9074D613D43 HUGH.APADACA
458,343,938 *2E8B37594D8F7441B5421724E587B81AA8A9AA9A REX.DAUDT
458,343,939 *2E8533DD5143D4B76FAD93FDA5148E411C9FCA8C RHEOENCEPHALOGRAM3
458,343,940 *2E84459241327955FC5B817AB23395E39600DBEF RHETTKALDAS
458,343,941 *2E8981B72A37687FE088BF34AF1240FECF651832 HYMAN.PELLETIU
458,343,942 *2E8C99A8AAEC8CDB377CB28D1B1F3F76C1418D0C richbokman
458,343,943 *2E89FE71601325F3F4952959D89975D6E5750184 RIGWIDDIED
458,343,944 *2E878AE2B92C8BB96D63B1A70719741F1CC04A5D RILEY.LOSETH
458,343,945 *2E895F51AE5511BC0C4F1865F109528BE2386CF7 [email protected]
458,343,946 *2E8E6796413B209B695B8A25AEC19DA4E356D594 RJENCYLOPEDIA
458,343,947 *2E8C2BD5B016725563F8E9FEFACFD89B831A3BF5 ROBBYMONTER
458,343,948 *2E8296F8B6DD65460292B3625590A86D2831FA66 ROBERT HELMER
458,343,949 *2E89D627ADAA63248A832212B4CA822A27A89BC2 ROBERTOBALDUCCI
458,343,950 *2E8B016F3192A3FDF422B605282519CFEEA0B1C7 robertobehrman
458,343,951 *2E8734B84D4E43A3F9D585E361E6BAFA30D8B954 ROB.SHILTS
458,343,952 *2E8B21EBC8A4D9C2768FFA75F8C12AD625FB494D ROÐASALIR
458,343,953 *2E88B683CE759A4EB02FE8102810C2BD7017B582 RODGERBROGDEN
458,343,954 *2E8DC6E75F8AF6A87BADDD74172D4DCE00A5589C iconicsing
458,343,955 *2E8B6FB1B75E07854E25D0198E035F3A54C0FB3F ROGOLIN7
458,343,956 *2E860FF6DA6B6769A68FEAA2DF19AAF5D791CF6D ROLLEPASSSTRASSE
458,343,957 *2E8B39D980879368A8320256764E583A55E52E3B rooseveltswartzell
458,343,958 *2E870FD0C24FF6AC493D07E6532FA1F966BBA899 ROSALYNSHEPHERD
458,343,959 *2E8901289D9EEB6BEB34A93061037E7C84A0400F ROSCOE.REFFITT
458,343,960 *2E843856A87EB7A1BB29B5A56D3CC8F52BDDDC1B rosendoesterline
458,343,961 *2E8F1105AD4139CA760BFA71678E8AE51C183CC6 ROULES1234
458,343,962 *2E8273F067FAA5794E8F66E13E30C1616A624AE2 rozchelstanej
458,343,963 *2E8CEDD5BC7D7ADD54E91A0D87B21057CD1568DC rufusnolan
458,343,964 *2E8ADF4EE9F769F1A09F22EC8A4AFDD3B7A769DD RUHESTOING
458,343,965 *2E8C31F957DA6066012A9ADE9F90F50237F9C120 ILORAZEMS
458,343,966 *2E892EA9859F91A01538691546EDD1C56C24C156 RUTALERE
458,343,967 *2E86ADAE7FE3774E9B2756C4C5946FB8BA1E351C imlbaa
458,343,968 *2E8FF0DB64065DB534D9F15F99C3D29230B714DC S+34+0PY94
458,343,969 *2E863A62858B600C7D33AAD7665D5BD008623757 SALLYANNE
458,343,970 *2E8DABD7D9A0B0744557B9508FF15C8E7BBC213E inspiration.zone
458,343,971 *2E857397AF7DF99274D3D434A657279A7E76EFD6 interlude:whodoyouthinkyou'renot
458,343,972 *2E8270FE0C3090B7A092479F2E90E7757577F52C ISAACCAROTENUTO
458,343,973 *2E869247403F2A53F8895F8C06AA78CD1CAB159D SCANTIER!
458,343,974 *2E8CC5E3971D093E9008C6CC54726460529C7F1A ishreal0
458,343,975 *2E86536EB2B007F969E4D84B1E126AA28B6EEB73 SCORPIONCORRADO1
458,343,976 *2E88E94DF2C4F7C4BB5CBC34B4F81781528B8269 SCOTTBACHUS
458,343,977 *2E80772B127B3741AA9E3CC2C61916FACE69051F SECHSTBESTES
458,343,978 *2E8539D197C31CC365535B78D39EA8138CCA0D82 SELNERBSW4
458,343,979 *2E8E077C1FC092F7436EB3C0914D37F19C118580 Serves.You.Right.to.Suffer
458,343,980 *2E88DA11AC527757E744D2AB831693ED4FA8E06C JADGDFLIEGER
458,343,981 *2E8D2D6B5C73DECC57580D0C34BCEFD8A3DE01EE jameyoff
458,343,982 *2E82AE213A84DBDBB63DEC4A3660DF777817AE96 SHAHADADS
458,343,983 *2E8435BCC2A577D2BAD86289DA708925CE694BBA SHANNONMARIA2
458,343,984 *2E89E40AE47833C48070222591765404662A0669 SHANNON OBARR
458,343,985 *2E830A7CC6B237D9828A5A2AA1D4B6CB4665B29D shannon.provencher
458,343,986 *2E8BDE20B519C8552C47AFBC9BDA14E2CA2733F8 SHELLDERIMA
458,343,987 *2E81AFD3933AFE4569D055AF77B415748DC28997 SHERRELL-MULLEN
458,343,988 *2E870ED9CE4DC4F45245D3EC6FDC6DE09592D346 SHERRY-GLAZIER
458,343,989 *2E8D921DBD69BB4AD4579544B3E24D8CA3794449 JASAGE13
458,343,990 *2E8F42D9E1A9E72790F671406C85AE7D077CE854 jaysonsweet
458,343,991 *2E8D7F125B3C09FDD15A43B07C654F78551A7683 JCBACERDO
458,343,992 *2E815E5AA4E032C043AE0AB1A6E7DC20D7A86459 JEFFERYOVER
458,343,993 *2E8A596DC98EB09A1B250AB93027DA911C538390 JEFF.LITTY
458,343,994 *2E8C9CF8667E1B79FAF4F01A485B098F65E08523 JENNY RIYA
458,343,995 *2E86C04E332A465DDFD66BFCED2B136586E811D5 sindrome-de-mowat-wilson
458,343,996 *2E8013D1DFB742A1B902CAC5EC9E740B180BD19C SINGERTRAVELING
458,343,997 *2E85698445552FCFC2595865A452CAC9247B27EF SINGRIDWIKI
458,343,998 *2E8AB047BA30DD9A4E5C52E7458D528166F002EE JESSEYANAGIDA
458,343,999 *2E8AFA20B76097B0D52544A2578AD49C8C4F65A3 SISTNEMNDE
458,344,000 *2E87975F6731DA5234942683EBCA69C53B78067B JHUEPPAUFF
458,344,001 *2E858C8EF18B2CE471B232760F973A95843611C1 [email protected]
458,344,002 *2E840288FD0DE64594940E05F794E58C26680F8C slick2619
458,344,003 *2E8423CE529173AACCE0BEE701E114F26F626D64 jimmyeicher
458,344,004 *2E8592A98D619D6BBF703FDEDE407172FC8940C5 [email protected]
458,344,005 *2E817D02062B13C0F6DDC6CEE8BF8A3B7C35D1DB SMOLEEL
458,344,006 *2E8D54937DB9AECAE60CF4A84CCD20D740AB7A62 snapn:snaps
458,344,007 *2E8E690835477CFD2D011CEA34C15942E80A74F7 snowblind.(les.gammas.remix)
458,344,008 *2E8E918327ECBD92B46C8E298709925FECD142C8 johnypowersnet
458,344,009 *2E87A7D86DBA86F38DFFDD9BEEE9788C4BAD5445 JOJERLYFRANCISCO
458,344,010 *2E8F6CEC1503B676B37457103BFA3AA877D657D9 JORDONCHERNAY
458,344,011 *2E895938A19EEEB86E3FF35588325E84F16EF743 SORBUKSE
458,344,012 *2E85552697E60C44FF14C2CB0A3F421866C116F8 JOSUE.WEAD
458,344,013 *2E851F11DF99C349D01A5DA0CA4DE310C3B08A9C JTOMBEAU
458,344,014 *2E829CA459500C62E514DF90B7A2A28358A5888B JUARDOSA7
458,344,015 *2E8BD3644921B78BF374D734AA495025E12679EE JUDITH TINIO
458,344,016 *2E8638B300AFE74B0F9B79AA186452645DEC904A judsonthweatt
458,344,017 *2E878C1684712D65FCD2F668D4B3512D59B53B90 JUDYSABRINA
458,344,018 *2E8D3033E0E3F84331A9829A7B7B1DF4D24ABE00 SPAMLINKREPORTSDYNED
458,344,019 *2E8713F4561179503F0AE15E17E82F61131C3D08 SPHAIPAYOM
458,344,020 *2E8DE5D1C9E398E73D493198A5EF5980516FF13D splat~.`<###b
458,344,021 *2E8769BAF1C95C562F586C67DFD11B5FC28DBBDC SPROGRGTERE8
458,344,022 *2E87AAB2C09342827491740687C6EB27ADE5BE6F KANSARAS NR. 2
458,344,023 *2E830CCDE32C019BCA63D31BE29087B8A718B540 KAREEM.RONNING
458,344,024 *2E833B5A9A295A861252E9A3D0689848E6E74C19 KAREN-ELVIN
458,344,025 *2E8148C6173722B5D3D91B1B963AB927ECA2BAEE SREḰEN
458,344,026 *2E8BEAEFCEFBB31712E356BE17D9804E9FEAC99B katy.bowman
458,344,027 *2E85E1732021B21397D47D723466C9AE4761E53B KAYLENE LARSON
458,344,028 *2E859DBA4CCAA0FC92ABE7082087C0F5568EC197 stacybeaureguard
458,344,029 *2E8775F5ADDBCB0DF681E48FF5C0EC4FFBBD382F stanfordestrin
458,344,030 *2E8517C229E7E4417CCE8BBE236A9E8272CC09D6 stanleyvs.hannah
458,344,031 *2E8D571BFC6E51F54A603F942EB485C04494684F STEPHAN.STENERSON
458,344,032 *2E89D2C3A6060D4004C03FAF5AFEF1D22D48C14E Sterowany-jest-ten
458,344,033 *2E85AA3A3AA658967C5933D00E8FD939C2778E9F [email protected]
458,344,034 *2E8B050256F154F249288747842964F3293E7325 STEUERRUECKST3
458,344,035 *2E8DB82DABFCAA8395BF2935622D3E96CD8D780C STEVEN.POPWELL
458,344,036 *2E8BD1E9504E693EAC9BDC76DDA3C8E2B62D555C kgeorgia7
458,344,037 *2E80D8C1AF0210C1F64F00AC0B04F972A0AB3BA7 STINKEN?
458,344,038 *2E88053B633A6C61CAD72AD0A8559BEF95A31D7D STRAPAZZAMMO1
458,344,039 *2E8FC522B79BD72374FF634B72332778A749EB12 KING.MORICI
458,344,040 *2E892850940B34B108DB1E8D2837422BB64817DD strukturom.3
458,344,041 *2E8A867EF3D682559E60A95A3234AD4FC1B6B992 SUBSTADD-DESC1STEPHE
458,344,042 *2E8DC7C8B9D0477E5B5A158C146AE672F7B7DB1A SUBSTANCE.THERE
458,344,043 *2E82548034818E7C3BCBE3FA956068A22989600A SUCEZ6
458,344,044 *2E8437464AE0F0D5E811F6FB832336A886ADE5C3 SUKSILAJIEN
458,344,045 *2E889C9A6DFDF83AF1D6293D27E7E366CDB47585 [email protected]
458,344,046 *2E8DE2E543CFA0F58D064F48E511ED5120DD211E SUNGAIZHEN
458,344,047 *2E8D9BFE4DD10F7FE924BA4273C6C60107DE3860 s[email protected]
458,344,048 *2E8BE0D5359918C383884A6B6A99A81F0A35CDA8 kraigappleberry
458,344,049 *2E8FC0063AFD43F954493BF406046C0B0A9AC0F9 SUPERFAX123
458,344,050 *2E8D5CB80685A3E8821A2E36E2F3313982BF1A58 krasb
458,344,051 *2E8E5320D1BCC617EECC7E04BE5A9DF2A75C94E8 K*U/
458,344,052 *2E8DB9AA9F98AAE57F432F5BEB35A45F82943412 KYLE DEMERITT
458,344,053 *2E8B3CBBF6A132E0EE689E0DD42ED4F2C265E11E l3.bbs
458,344,054 *2E84B29382726A365058C3723FD106950AFF11B9 L4NH4R53
458,344,055 *2E834792ECFDD5B21FB4B52B59417BD8A8DB890C TAD.BBS
458,344,056 *2E8349B689AE721AB92CFB3DE66ADC9578A2F489 TALKCITYTRAM
458,344,057 *2E8C4F9BC7FA609D1989A0223CE78AF85D3E9651 TALKMEMEMEMEUKNO
458,344,058 *2E851F97BE92862CAD4C317EB9E4FAFBB7407FC3 TALKPUYRENIER
458,344,059 *2E8050B14EA6F0064AEEF9F5B6C578B0194B2B50 landolfiani
458,344,060 *2E885BC8F59379CB4BA60EC60A09394274503AF4 LANNYKOUYATE
458,344,061 *2E8B06A97EF4408DD2B5A4ABE307D4A097B55F1A laserwindsurf
458,344,062 *2E85BDAF341FD5F9382DB62B5073606036FAF835 laurenmaslen
458,344,063 *2E8D80C5DB144F0B2B470983A6AB5CD127830AB6 LAWERENCEVROMAN
458,344,064 *2E895F3B16131290CA62DB307DE276763A48B962 LB4NH1
458,344,065 *2E8C816FEC69DAB24D2053BCD7E35553F414CCF1 l'canchon-d'ches-vogines
458,344,066 *2E85612468A5521CE09587B6B53F6719AD911301 telegraf
458,344,067 *2E8371CE156172FDD0FB75FE57694678EDDDD5C7 lekeacha.mcmillan
458,344,068 *2E8EE6FA252BE54AA4420BFDD80CD082559DEB98 LEN.SEAWELL
458,344,069 *2E8984883064342E81C33AD6260C6135B4BE779E terrelllackey
458,344,070 *2E8561BCDBA1348BCFBA3794D87B07C41D0A90F4 testyoda2
458,344,071 *2E818D815A4BA6A0528737ACC6C045692B642834 LEVENSELLER1
458,344,072 *2E8A5FA69AB211B29943FDF2DD1838E49E2696E9 lewieess
458,344,073 *2E8B4EC3BB63D419508825E700A5F1970C9CD3D2 THATCRYSTAL68
458,344,074 *2E875371BCA3B39C32726EA2C0AEC520ADAEE30B [email protected]
458,344,075 *2E8B8498D4D6D79E6FF1011D276D5F63453FE4F1 THE LIVE VOLUME
458,344,076 *2E8CFF37C10F33FF790AE86ECED4E7165606A76A linomenaker
458,344,077 *2E839BBD5CC10FF77AD6F109AF1AC0E1C2F7CE85 lipanov
458,344,078 *2E8E4A1EFE370628E812286682B048B9910DDB0A TheU-Krew
458,344,079 *2E889AC2FB44ACBF44ABE6A34BF04B7F0E87EFBB THUMPERASSHOLE3
458,344,080 *2E8318D1556DD00B703FF7B4C010DC579F6A37C8 thurmanclinkenbeard
458,344,081 *2E812C947CD174604A31BC5BFFDFEBDFE598317D TI7VFZYC
458,344,082 *2E84BF805256B887867D23DD8821AB1EF6C63D31 LOC[email protected]
458,344,083 *2E8173F2DCC66FA5E30CE451CBAB62B18C6355D3 [email protected]
458,344,084 *2E827D17FA4F30F71CA521BD5FA4221286505AA5 LONG.GROSZ
458,344,085 *2E8B28D70B3187AD6CFCE2CA037B538939547A7B timmymoschella
458,344,086 *2E8CA89F4687053BB856A9D3E3187375F4A84E26 tim-panella
458,344,087 *2E801C28C0D0F65EECC76C2A0CAA5F11C378CFB1 TKATTKAT
458,344,088 *2E8679E19B757148D212330D296E0B09E61C3107 tmfsjvl78
458,344,089 *2E8FBFB73AD5774588BC581A9739E98F4EC7E5E1 TOBERMANN
458,344,090 *2E826B18E24C49C2BCA13B1BAE521D1ED00F3BD5 LOYD.GARZONE
458,344,091 *2E87C88B0AFDD4057BBE3838C47F09A6E3573A04 ToddCarey
458,344,092 *2E82A88239F21071CCF1FBB4ABF1E3426BEDFAA9 lubrification9
458,344,093 *2E8767E43E34275D9DBDEBA8DC3D827FBFAC10E2 TOWER-C1O
458,344,094 *2E84ED135883980D83C222E88F1B96AF84527B59 TRENTON.JUILFS
458,344,095 *2E87EA4A10424CF4E8539B3DB006CE49288DEF34 TRENTSLAYTON
458,344,096 *2E84AACF74CB6A409623C59B5F07AE2DB10F1D6A TRIPP.SELLERS
458,344,097 *2E8254427F5B63CD65F097A3C71153FA6C258AFB trishalui
458,344,098 *2E816340B444BC5ACE437D0293ECA1D5C5B497BD troystemmer
458,344,099 *2E881F599B3844454CFAAFD486567DBBF96BFDAF truditangerine
458,344,100 *2E8CE55DB2D7F9F9F4957E828FEAF2E376E5BE05 TSRIFBSL9
458,344,101 *2E85F1A348D6BD6F40402C1ED216FC419A46CAD4 TSURIT BEN TSUR
458,344,102 *2E8F71582205A5EBE219619833DA9710895C64B7 MAKATOTOHANAN
458,344,103 *2E86D6537B7EF93CA217F9D34016B071FD5B931B TUDOR NEGREA
458,344,104 *2E88BC69692A48E802694825053968FC4645513E TUYO-NG-DAMDAMIN
458,344,105 *2E82E10CFB3B1DD01DA2DA93FDB6008D32977CEF TYLER JEPSON
458,344,106 *2E87D4F216DBF171A803E9244A29CAED29EE31F0 TYREEDEPASSE
458,344,107 *2E89D275AEAB2498894597B17018DBFB90959ED1 marcinkiwicza
458,344,108 *2E8ADB6E7EE707BB7F910907818CC3B73B9AE9F2 TYRONE-BIBBY
458,344,109 *2E84B7431BEC07D22406CF6607885CF2AE13F904 UBERSEHBAREN6
458,344,110 *2E8CBBE1F5029E0A5C637B26CD467208B8018E8B umdearborn's
458,344,111 *2E8F08C09120783024DD07AF0C6A4BFBF1229D81 mark-roudebush
458,344,112 *2E8F864382C7412D26B7C55D1B421D817CD3FB09 UN$CI3N7IFIC411Y
458,344,113 *2E8950CB4EA4E573957222E14897C2BB20520F0A MARLIN.RIHERD
458,344,114 *2E8BA6BCA7E7FA2E349399DCA9632762DAD2AED0 marvinwindows
458,344,115 *2E89907DC4FAED997553D6ED890AA1959FC9CD8C [email protected]
458,344,116 *2E89150EC93E631EA618D11E4CB0DA78EDB453E5 USERROBEJAN
458,344,117 *2E8FF223C8FA45B26BF2D65AD78B41559B40B90E @MATTE
458,344,118 *2E891A39C79982D9AC8E8799B10D1AB126ACC05D mattschafer
458,344,119 *2E88B5E2E71ACD882C248E2FD547EBEDBF132F03 vancerayos
458,344,120 *2E8AC5EB009C5B94D062D54DAC8EC4D74C86ED17 vandrersken
458,344,121 *2E82C117DC323CC88DE73F189F8FBE6775A684E1 VAUGHANWILLIAMSTHECOLLECTOR'SEDITION
458,344,122 *2E868B78A631D0CAC244C88DC31FF0A64DD3EC07 VDGCYYH8
458,344,123 *2E8D5F88A79CF5AA470789CF4EFD7DB2D0369A4B MAXGASKEY
458,344,124 *2E8A00817C14287855CE950C1B37065F3D9FB74E MAXIMEJORDAN
458,344,125 *2E8AA19B129FDB8800856508DEE85B5C6A97F6CC MAXWELL.KALIHER
458,344,126 *2E8A03EB62038536AB36E0CD3C72DBBEE7593542 [email protected]
458,344,127 *2E8940CE2146EE61ACF8E702910A8821DC3822F0 MEERMAN)(1753
458,344,128 *2E8348EFCC459D0CE25912E87B2A735D10149FBA MEGALITHO
458,344,129 *2E87F6C4D0EFB8AA9471773D31CD72E8A946CB4F VERVILLE160
458,344,130 *2E83E2884DC15A9847E8DE1498006184D8D56BB0 MESEX
458,344,131 *2E8238C7BB9167CDA7640B4231DDB6A94C3618EE vickysweet
458,344,132 *2E8751345EB34DFA6296F277876E1E72F50B3768 midnight'stide
458,344,133 *2E8A042324834B79150F816D9B2ACF04944E2BAB vierregelige.
458,344,134 *2E890E47BA90D21CB8F30A587F8283FB139C13CF MIRAULT8
458,344,135 *2E8292FA9C397F5C500562A58BE089A495C28D44 VNCNTSCTTY
458,344,136 *2E846FDF2CB79C4282C321ABFF09B1105C3602DD vswnklses
458,344,137 *2E86DE84C894A81A3C16ABDE02BB6366FD39EBDA MNGAMPIRIYARATNAKUL
458,344,138 *2E8A7D1A00D2BB8F34743B706C86B888A73CF771 WAHID.ASKAR
458,344,139 *2E841758271B25495DDD6BAFC4240FE49FC94CF3 ModernScienceandAncientScience
458,344,140 *2E87AAD8326D6B07F5E4779C8BB3B8A50D317859 modestomurrish
458,344,141 *2E878EAA612AA48B5D87EFD14481A6A73B6AEF8F moerae-'m/i/r/i/
458,344,142 *2E85307A7B243B41C6E01D82D639395AA099DF17 MOHAMED.PLACK
458,344,143 *2E887E41F72FBEEBFE703FC019216805BE597122 MOHAMMAD.HIBBERD
458,344,144 *2E8CDF0C551741B1287EEE039BBF7C8819081AED wantsell9
458,344,145 *2E8CB17C2FC51732378C318488D9E06E0E4B8CB9 WARLITO.CORPUZ
458,344,146 *2E8B7E3AF88FB85F4190B6A54F5D89EEC56F50AE WARMOESHOVEN
458,344,147 *2E84EB76A9454A75A9F91FB2C490A4AB197DB890 MORGANSOBILO
458,344,148 *2E8EEB83EFBA673F42C116A045DA0F09E487E658 mortonharajli
458,344,149 *2E84829FE9F99938E41BB6A057AC9BBDC8E107D6 mortonsibilio
458,344,150 *2E86B7EFFBD0C416707046A649F5C9F0BF043FD9 water-borne'w/o/t/@/r_b/ou/rn
458,344,151 *2E81DE7E172DC083EFA3DE823D824863A670E21B [email protected]
458,344,152 *2E84B2033B73132D0F1199F191DBB7A1DBE4A2E6 mouldy
458,344,153 *2E82B9D7A0117AD92CFC7D4E7BD65F3086D23397 wendy-tan-woon-yup
458,344,154 *2E88E6CFFCC4776EA2390B4A7EA1B300A29887D1 [email protected]
458,344,155 *2E8EC69137A181DCE6E0F21B1DBB4B2D6CF05DF4 [email protected]
458,344,156 *2E8B43CB7820B0DFB1070C89B688EA350035C9DA werembert
458,344,157 *2E82262A24EAB94AA7F3171EE2E8A30D9C76244D WERNERMCCROREY
458,344,158 *2E849D2CA280E5FFA892712B5A9005D3108B7563 wesleymeininger
458,344,159 *2E8208ABB59618174AFD4906139332EE06331EB5 MUSKYINNOVATIONS.COMWWW
458,344,160 *2E807238EEAAA5330EC58981AA9FF088E974EC2E mybutter73
458,344,161 *2E82CD85EADE2396B9BAEF7ABEABDAE1479A2833 napoleontaylor
458,344,162 *2E8C016ABC181242AA6110C6735EF31CF6CB1523 WILLISCATALINO
458,344,163 *2E8577F616488868885590AE2AFF66186730C40E NATOGYOKA
458,344,164 *2E83C18AECA18F14333B1B0DA77AC62BD0F2EF51 N.DE.SIERRA.DE.GUADALUPE
458,344,165 *2E88823B5728D4EC683963EE501359707F8E3911 WINNIE SUAAUELUA
458,344,166 *2E81D210E6518C611D1CE95B9F894BBB0A71DCE9 WINNYLISTIYARINA
458,344,167 *2E8CCC4C80F5A577D43C5560672657BC85588F06 NEDGIDRAAVTIU
458,344,168 *2E8295026FFA0F8A7C1EF551B414C701E52CC369 NELKKU
458,344,169 *2E8430CAA5AF6217A9CB064960B12F73417F8D9D WSBMCMTF
458,344,170 *2E8B411EBD79DB3B1405171CA640CEFCD7A36626 NGUYEN1937
458,344,171 *2E89E7694A7365870891092BDF2499657EA50A50 wurstle7
458,344,172 *2E8B9696582E2EAF7C4264CF24C26469B8AEA143 WWW.RECYC-QUEBEC.GOUV.QC.CA
458,344,173 *2E826347B1DE3A89988D78BD70B1E3281260FDB5 WWW.SHAREFILE.COM
458,344,174 *2E8E00B804C58E1A5767F5ACCE2BB2EE32E07167 WWW.SHODEX.COM
458,344,175 *2E89B510D46D860D4A787B97F3884D6F223AFB91 nidogaucho(feat.eduardoadri
458,344,176 *2E88FF9D5F66F68C25CD3C44DDD7EAC33CD89DFA [email protected]
458,344,177 *2E8260BCB1FD0747382DF43FFDBD8B9194AB59A6 xiomara-encarnacion
458,344,178 *2E8D12B49C6EDE09A84E4F94530B731BE3C4A3A9 nmwndnst
458,344,179 *2E8BAAAD5A954C79A55C0D00BA9A4E7E78D910E8 [email protected]
458,344,180 *2E82936D00B19D49B9EE9F9066047CBFF2E1C60C NON4GEN4RI4N5
458,344,181 *2E8B5BCBAFE708830848DAD15B1E556EFA1F9DA2 NOT.ENOUGH./.WANTING.YOU
458,344,182 *2E8398EC6071FE2BB5F040F4CC4D7CCC786005C6 objoperatingsystem
458,344,183 *2E8590672C88B9A7969C1AF8BF87AFD38520B545 odisszczepaniak
458,344,184 *2E865619F573DC5FC5302CF5F793811858F38A41 )O( ` dp
458,344,185 *2E8BD1037D5CC8992C30A32056BCDE7D802F808C OGREGIO
458,344,186 *2E854914B29EE26FACA977491FB34BEF75FF096F OKFTU
458,344,187 *2E857440466615C0C14913AEB4917777FCFC9C63 yuyr
458,344,188 *2E80729ACFEB765E5A168F52D4BD27E87BA52C23 ONAGERN7
458,344,189 *2E83B3FA4CB14C19AAEE8F0012243654486FE8C2 (~_^)[email protected]====3
458,344,190 *2E84B37053C5B9A23E1171602D2D4C6E4DD51C20 openacukwww
458,344,191 *2E81F30B68A5ADB114E37B0949A88DFECEB56308 [email protected]
458,344,192 *2E8649132A312E7BF288E3B13943238713BB5FF0 ORVILLE.AGENA
458,344,193 *2E8D467E726917F46C830AA08B8B1398FC8C0B56 [email protected]
458,344,194 *2E8FF84A42A3EC6E44B32A9EB0E2AECC765C5C13 ZHENQIAN7
458,344,195 *2E890F2BEE48FDA1D9239FC5074898C2272AFC01 OUSTITI3
458,344,196 *2E89BFC2E84BB4F32649A31F1BF929BB43668D3A P!|)
458,344,197 *2E8A6BD823299215977AC516952E1C0082132EA4 zulizwan.zulkifli
458,344,198 *2E84314967A4FA4B72FEAED1E187CE437A3092FD zwetende!
458,344,199 *2E849F82704954E40E3806F61DDF5879A169C2F2 PALMERGRIFFY
458,344,200 *2E8C42F8CD0B149C778BE5833319B1DD5AB1A9D5 ντιναμοβίτετ
458,344,201 *2E827AA780D1D895833CF7D2593EB0C4106608B4 ВАЛУНИ
458,344,202 *2E8D2CF71F06925C87CDFC1367919FF3FAD6D983 PASTRANAD8
458,344,203 *2E8243993AC64DC85740BF2A3E72EA55963E8E50 МІСІНЬКЕВИЧ
458,344,204 *2E89D9F2EC89070402BAA3485BE5EC24989A37B4 PB~o}O{
458,344,205 *2E859243A31DBBA1492FBC26C8588D73F6B43E69 піксі»
458,344,206 *2E80D5E097B96E29E95B601B4153FD2EBE48D7D9 phoneticcomwww
458,344,207 *2E8F09F502CAF5D394C1FADD64F956AD4DBC5573 PIANOSONATANO.11INB-FLATMAJOR,OP.22:IV.RONDO(ALLEGRETTO)
458,344,208 *2E84EB70C6056E86DE18604E15CDD45AF45D3302 pletennetelp
458,344,209 *2E80B24779BB14E3077423F31DE09AE43BCD2630 P-----p-~0-o->-<
458,344,210 *2E851B6C1E156FB73AD333C8D1D47C5133612236 PQBUHOG9
458,344,211 *2E832A1F1C147817282EA8DBB792FA6301CC8117 proboards9
458,344,212 *2E86FAF5B3AB149D1A0BC68A9FB907ACDE94F589 P------>-*-SPLAT
458,344,213 *2E8361929105620101E8233716F568BB8AD500A3 Q####B~OUU
458,344,214 *2E86E0BCCC20F04C362071F289611CD4463841EC q=====>~O.~o(~_^)
458,344,215 *2E87E279ACC28BE4EDDBA9BBAEE5EC7843A6F523 Q######P***~0~OUU
458,344,216 *2E8BD74CFF615B404E54193B6B1DCD13DE6BF131 raison-d'etre
458,344,217 *2E8B9977181FE7EDC43517421D0BC3351046F810 0+01091ES
458,344,218 *2E830F342E8AD8CC6CCB4D0712859B9EEA1A4684 RASE
458,344,219 *2E839BB62C953D8D9EAB944B412DAD560A360160 raymundopomrenke
458,344,220 *2E8D3AD7A94137807ABB08E1087B5823069E0850 RCVZ563313
458,344,221 *2E8033BEA6D0262DDA48AE2299D0338D4ED97E8E RDOSBSW8
458,344,222 *2E8F17667DDCB54D59AA15F893A73BC2188560E9 017FERNANDA
458,344,223 *2E8552C98D60833877BB82B708340C24A07D1630 04.06.1333
458,344,224 *2E8860DFDBDA2A387B3ADDA334207A6E484C860B REKONSTRUUJEME6
458,344,225 *2E8A0837B0FEDECA21EAFB819F72B46E72982E28 REMBLAYAIT6
458,344,226 *2E832619B3739B62B93D66FA2F0C67379D0E51DD 0theunity2
458,344,227 *2E887993DC582605E7F5470DC5981E045FD27BD2 RENEEGODZILLA7
458,344,228 *2E81A74C2CD45FBFB1EA190EC87278DE0603BE7C 10.svea
458,344,229 *2E8841D59A7B334938CCD4E36B88453D7F61A4F5 REPORTED67163193
458,344,230 *2E8C6BD4D1A283FDBB0D305AA991FF9C5E3AE141 @11UREMENT$
458,344,231 *2E8012C4C2EB9E01B1AB1C3704644424BAF58D36 1200.Mics
458,344,232 *2E85A78774C95CF8C9E2BBEAD9B30CCF48C935E7 12:12#&cartoonist
458,344,233 *2E8F57749151D2788F67C1D79126F3A5B1623E5D 12agility
458,344,234 *2E876ABDAAB9F8696C1CB9779E23BC1932AD4F9D 13NOVEMBER1119
458,344,235 *2E865F26D322F846F0F2E0F937540F4E51FF7FEA 14aug1453
458,344,236 *2E8E53595B526515E169C83F4D27D16BA1645C42 RIECKERTBSWS
458,344,237 *2E86F3A816C6DCBF488448D8A54964B68930A2A3 159.ortega's
458,344,238 *2E8B7C499A4554EC6082A34B036379E34B2DA6D8 16833 turkce kitap veya kitap bolumu yazarligi a . 9 .
458,344,239 *2E85034377B0EDDFB44D2C29C822551C0F667F30 16ASEAN-LAENDER
458,344,240 *2E82EC747779A3618640B3324FDEA1FB53AD2B74 1720toto
458,344,241 *2E8CF3E5D101A61E11243580AC499B860EFAACC3 ROBERTOMCELHANEY
458,344,242 *2E813FEC731FF1725D3EC506B29EFF6AE58D660F ROCKALIVE:30
458,344,243 *2E8D284F965F30FB7DF55F103FDA672A11E595B0 1 BOSTANCILIKLA
458,344,244 *2E851D373E5DBBDE99FA97741F9416698CBCEB84 1-bUyUlenmiSti
458,344,245 *2E85B9A260CEC19094181BC5E5BAE72DE50B907F ROSARIOSOMOZA
458,344,246 *2E8ABD4BD09317450740BBD99E597F095D9F3DCC 1.ensitietokurssilla
458,344,247 *2E8C00B5B97EF341C27D09941B0CE077E3EFD2E8 ROSENDOHEISTER
458,344,248 *2E8F0D24706A1A09D516A6A837DBC58D59241D88 1.estekoe
458,344,249 *2E8F2A9346CA8139EC9A69F669B74092253CC64E 1 EVENT-HIS
458,344,250 *2E8461DAFA8132447C7A441D3125F539BDEE6359 ROSMARIE..WALZER
458,344,251 *2E887B9C585EABEAAF49C98930DDB55FDFE8D158 1glb2trt
458,344,252 *2E8D748A0A7C77C17E300EDD843F8C6D6C379BD7 1horrosta
458,344,253 *2E82AB56B35FC09CAFAE9816C67A0AD1E6B8C44D 1jiipeenimell
458,344,254 *2E8D2F04A4BBF4EE00419849A7C769E71D98A631 RUBENCINELLI
458,344,255 *2E89679CE9E53D87318222ECDAB64B7404671E6D RUBIN.BENGE
458,344,256 *2E83D022BD9DBF7A233003912ED76A4627846C38 1-KLITSCHKO-PROMOTER
458,344,257 *2E8BDBE0734B5C24129CE0F7605AC2328B9D6D08 RUPERTLITZAU
458,344,258 *2E87990B96A79453E7035505B48005F1FB4EA6D3 1PLYNDRN
458,344,259 *2E8AA4123D499CB29C8A675390268D7EAA174174 1 PROGRAMCILIGI
458,344,260 *2E8D09EC93E2A52688065FCF9570DB1A64684CD7 1.REACHTHROUGH
458,344,261 *2E8A25F527493BBBBD32DA2796907F28C37BDFDF 1-RISUKKOJEN
458,344,262 *2E8EE78DFDBE06E2791EAFB1FDABB476BDB2D09C 1RUPL2ATON
458,344,263 *2E8F3C19057BA979D49323411BFAC493C2E18D46 rvuw
458,344,264 *2E8E6F91FD3EBC364077417F54608D8E683BA8A0 1 valtios
458,344,265 *2E8A0218A4B0D8478B8E6B57D2B4E62B5CE80CAF 1VIILT
458,344,266 *2E87BC1FE96F0952302A1B3DC5D30A25E070A31C 20060706:RADIOCAF
458,344,267 *2E8E83EC239DABA5C0A2B961E491766AA3F0FD31 21FEB1786
458,344,268 *2E870394E93A5C0EAE1D5B53FB10C7961C9EC482 26JULY1229
458,344,269 *2E8584D2BC0A186121F8DE7960245910D461B7B7 [email protected]
458,344,270 *2E83C78776A729568865A8012277AA6A5A0B9E20 299•ER
458,344,271 *2E896809B133702BD035C5C5DEF9BF7875240D3F 2CHIPCHLOE
458,344,272 *2E8AD718582243E31EF4F80F4F1CF805CB94821B 2.EX-ZENTRALBANKSCHEF
458,344,273 *2E847997A6F48891EC3926567DE2CE56C717463E 2ILSABSW
458,344,274 *2E83EA11D61E54312FB30E8A5C30E0FEF87AE8EB 2IMNPTBSW
458,344,275 *2E8C96109A78B4A982B24BADEDDB9DD2B1301C8D SANDY DILLON IN EAST OVERSHOE
458,344,276 *2E8803E86D3857CEB4E6B93FBE6583136E49E10D SAPIENCI6
458,344,277 *2E8A64DF035674F64D184CE7232DEA9785E4BFC0 *SAVE_DESCRIPTOR,*ACTUAL_DESCRIPTOR;
458,344,278 *2E888DE58EAA39FD4667073E0BD583D42CD07F19 savingly
458,344,279 *2E805670A7BA280E4B0F9CBDCC9944A8FFC4ED4B 3AGLUCONES
458,344,280 *2E8F6DC9EC0D717AE5F88BACF928B5CF2F2DBA23 3===D~.~.splat!
458,344,281 *2E875996577DBB0873F93F1786A7ECDDA5696D04 SCRIKE2
458,344,282 *2E8EB9033BD73FEBCD86DD3D20E6775B341D4F59 SECARRONESING
458,344,283 *2E87B175BA23AE291CB966607294D644269163DD second.inversion.one.chords
458,344,284 *2E89DBD852B9CCD98D01F9F33AC0A104FDC425BD selatcacs
458,344,285 *2E8C4BBF73C21BC61C87E31DD18124C94EBE26E0 seniorhappy1
458,344,286 *2E82260417163D2F501B6FD8758243AFAF9F75C9 413ATTICUS
458,344,287 *2E8036214FD07733F22A75A744B88BF22CF47CD2 447CASSANDRA
458,344,288 *2E894EE0E7F8C1249EC8DC53A8B5970ECA2173C0 sethheuwinkel
458,344,289 *2E8F7BE131F7C274D628F331FCBACBF739075AFF SH0R+3S+
458,344,290 *2E85A463CFCCA5B358C04EE64A616DEFE2A9FD54 4-P
458,344,291 *2E808161CDFC5918BDC3C09889E08D6AEB9DD23C SHAYNESTUDSTILL
458,344,292 *2E816DB6FB1019765FCA28D4C951893CA083F8F2 [email protected]
458,344,293 *2E88B667C86B63CE769B5AFAC8B77C69981ABD45 SHELLCRAS
458,344,294 *2E839F416E198738B3C4EE04E6DC3F692C5961AA [email protected]
458,344,295 *2E8EF8DECDCA440E32B7A774490AD1FC3CE68509 [email protected]
458,344,296 *2E86F876B6432A0675C20C1D1B4B03FE171B3182 4TRANSFORMACIJSKI
458,344,297 *2E835D882A8BC3EA4CF2AFD4780095FBA5068AB1 4zebra9
458,344,298 *2E8D721260D1E23913152449805E51A51CC96738 5BPANYQDJ
458,344,299 *2E884E17D77BBA650C3BEF4BE87A57B3F6D00118 shouldcensurethusonlovelygentlemen
458,344,300 *2E881EA21C88A594C235FD99A9AD914763DB26DD sica---Vol.-14
458,344,301 *2E86F5697FF22FA2755ADA5DB88F967D73D7A686 SICHUANCHENGDUTRAVELGUIDE
458,344,302 *2E8CED7A854C5E3AD76D18A13E4ACF1739E624AC 5IPDQLLIRSW
458,344,303 *2E8632422F88A829C3413AD7291693B9DEEAD068 SINJINISENGUPTA
458,344,304 *2E84B022DC1E019B92337CE6BD5D7F31F8F10139 5LMVZBHZHOEDVU
458,344,305 *2E8BF43878FF8FB6F1737C696DF025FDC85C49C2 5MALAXOPHOBIC
458,344,306 *2E8983D58BE7801F73D07EB8793CC81184BF89A6 SIWIKATSA
458,344,307 *2E8A23D3A981BC54FD2171909E55CA73D621A8BB SKETCHFIEND
458,344,308 *2E85F1CFDC8D7673B0B4BB9C3264536B4CE305FD SKIKKINGS5
458,344,309 *2E83EDD524B5F1DF989F6350BE33C9E9403A6D5D SKIPPYSNOOPDOG1
458,344,310 *2E8B0A97D40A0A196A8219DD0B4B3A5F7C8685AE SKOORBELDDIM4
458,344,311 *2E8D89595DFC494019DF21DBBC458E2BC1DDF462 5SPICCATOIA
458,344,312 *2E8AA70D16B06948238D741F978952B1CB3D3DFC Slainte,.The.Ceilidh.Connection
458,344,313 *2E8E3E1DCFB55684DEF130D68CC908A2C1076667 SLLAHRE4
458,344,314 *2E84B5F4C1C5AE25C10AE8B8098F0A1C5759FA44 610221 kim5570.template.sentez.3.0.0.(.3.).temel.kavramlar..
458,344,315 *2E835435AD26BF0B1A1A1CDC111E13F22DC27687 [email protected]
458,344,316 *2E8CAC7B79F99BE93DCAA281428D4FEAD3FC24C6 664giana
458,344,317 *2E8C019ADD5C5BE72FF89E4450D213B7A093E194 s-nusileis-i
458,344,318 *2E81FCB569C040B6639192D16817E933047742CC SODANNS0
458,344,319 *2E8B7E35C01EB7DE9A54320D91B369F43ABE8C26 solsken f
458,344,320 *2E8A0E0BC130884CBB53353E973E792438094597 SONDERWEGE
458,344,321 *2E88A48B0B3E511A56D0A29C6DA6EAC9447C9B1F 6AGATHYRSUSS
458,344,322 *2E8F117F3D4A391B18B87996CBD0A1E4A58E65AB 6CHIBIMAR
458,344,323 *2E88FF885FCE84442F2DB4CB0B3F1D9A26F2F68E SORENERRA
458,344,324 *2E822E9042435AABBAC1CF00B47072D9DBD0040E sportsgeorge
458,344,325 *2E8ABC5B4446D560BAB3141AC92FD83911039B96 [email protected]
458,344,326 *2E8003D798123B0F980B2036E831F7B821A3ED75 6SHANTILEONARD
458,344,327 *2E8BAB16AD8AB7B2ED865732FC24F936FB3C42CE 6SPERMATEISFORE
458,344,328 *2E89667E6E4606179A3D70DF2B9F461DD058E774 6VADEREMMITT
458,344,329 *2E81E19EC498CE05128001C64193903933808200 6VIRGINIADOMINIC
458,344,330 *2E8D861B20DDC76409E1F16C06AA40357A7C4BBC STAN.KNOPINSKI
458,344,331 *2E8261F057DF9CEBDC9ECD91C53852E343F5C9C5 73106Y
458,344,332 *2E83AB9AE079D904EA975AE3023E7BA94127CB44 7CHERYLLAURA
458,344,333 *2E8F5A75824912943AC6AE1469B5EA7D2E224908 steve.westfield
458,344,334 *2E87BD7D54C8CAE7A7AD2217CAB623756D02F3A8 STREKLASTE1
458,344,335 *2E8A8D9E8E6F4553A9CDC16822DC8A6E96C3B214 7ICKAALEN
458,344,336 *2E8D1E37E7BAA29BB7C5CEEA01C2B161FE5940A1 STUARTPERRONE
458,344,337 *2E85AEA7EA211CD80D60E9816C1A381F6A908E08 STUBBLING6
458,344,338 *2E807993C0A189C082E1F8008FFA8FF1BF141C0F 7NATASHAGARLIC
458,344,339 *2E8F15C236CECAC2A02B86AC230D2C2919461743 SULLINE2
458,344,340 *2E8F8FCEFE3780190E7AC2C5D74CDD0AE7B3B5BF 7TERMOFAS
458,344,341 *2E89DB0559D6C12FDBD5EE5193F068BCBA10A8D5 SURF'S-UP-SLIGHT-RETURN
458,344,342 *2E82C7AB7D8A101AE17FE56FBB6B95C77FF9D968 SWITCHING12
458,344,343 *2E85BC7CDA2BBBDD19B7EA7956D11A8BD52634C0 840146 b oli 1111997 l
458,344,344 *2E8EE0CDB3D6B8F229FA477449B6C16439FEC919 [email protected]
458,344,345 *2E8C6A384CAEA571927DF29289C2E5EE3C4F2664 8ANSIOLISTASSAAN
458,344,346 *2E87BECD17BAFA9FD7B1FE4E3C30AF38ABF0A3D1 TABIERST8
458,344,347 *2E8A7157504B3C6B1A386DE4126A18FA578B1A68 TAD.NIMURA
458,344,348 *2E8F02B487CEB250C11290C1DD6553D8CD5CAEE3 TAGEMARSCHEN1
458,344,349 *2E8DF88142BD3CECDB735FF6E55E15FA59DE276E 8DEHCUOCT
458,344,350 *2E80ADBC781967379DAE99D7EE583FA2A17FD93A TALKMJGTRF
458,344,351 *2E822B54F60697F9BE2FF0E0DBEE5C01B6D00C5D 8KUSTANNUSSYIS
458,344,352 *2E8900A00E5E18EB60FC0067C4D2AFAC2C3D7C70 [email protected]
458,344,353 *2E8F3B0DF32E3752E9A955DC09D5EC0C21B54EFD [email protected]~O ~O)8(
458,344,354 *2E8AC41A7BD8A80A557135840FC0F97BD3101EFF 8SUBJECTSINCLUDING
458,344,355 *2E8161539AA4381FD8613908534F34EDA4889DFF TAREG-FR
458,344,356 *2E8C58C1315FE977D92563FFA97A1A19F8107E93 8themarket6
458,344,357 *2E86CC48B3855149AB665CBBE3D9020F709C4DED TAYLORGOLF7
458,344,358 *2E8E5602D28F2500E8FEC912A158D810412F90C5 [email protected]OM
458,344,359 *2E8F66A3C7B3EFB4A36E2A6E6DA6E61F2927799D teachingteachers
458,344,360 *2E88255333BCF5AD13963D6CE9978CEFA8B4284A telegraf
458,344,361 *2E82AB5998D818F93379B93EF4BF805E16504B78 947CARSON
458,344,362 *2E8BC8BA2CC864A8906E0C9AB729BD918AF184E4 TERENCE.ADGER
458,344,363 *2E85790D38CF78700FC5A67AFC3F64EA1BC95A0C TERLEFON
458,344,364 *2E8AF7BDEA68345665B25A24B9946C5325C97A6F 9ARPEGGIATEDS
458,344,365 *2E84C09686DA32D501C987A2327F1CF8B6E9820A 9ASTRONAUTICSN
458,344,366 *2E8BF52D453C5158BF0E9A34F6242A646CE89C0F 9BIENDENIBA
458,344,367 *2E807D1C39BCE97637C344620C5D7D090DC90B2B tévedni-emberi-dolog
458,344,368 *2E82E5B9AC4AC7D79DEDAD75FAD9E2AC1A17D144 textbookofbacteriologynetwww
458,344,369 *2E88F26391646427F4D7BDA19B6298F9F3ADCA5E 9CLOCLOPAT
458,344,370 *2E8C48CF98A7BCE906BC4FF0EF17EFD5A0A3DCCC 9F139CB6EF37B2CDE7B18D4AC5B29BDF
458,344,371 *2E8A43685E4FD5BBC989D228C1779E450879C837 THE0PROJECT
458,344,372 *2E8C768B325983B4E0C7A9F868CAF473B3501627 9LACIMEHCOCITPO
458,344,373 *2E805F0A1A20EF16A9100744A1A12EE41648D642 thehypno(radio)
458,344,374 *2E8A1CED1D5A30A2F1CA6620D51B30ADA8F1E6E4 9PEACHESRICHARD
458,344,375 *2E828E607883E00EE5C6805B32B3533513251A6C there be the players ready?
458,344,376 *2E82CE612875F63661F7709565416745FDDC3F0C theredline
458,344,377 *2E8C77F35CE8C2A20A30ADD64C04EA49FAF511AF 9X9U
458,344,378 *2E8368A60371A98444C387660243A12F27B6DDE9 ThượngBình
458,344,379 *2E8A44BB2D546DA673C77B27FDBBF246C9A54971 THURSDAYTINTIN8
458,344,380 *2E882CE8D2FD2E6E8470D0071C89718834464751 A0SKE
458,344,381 *2E86CEBA23BA346354F103792246B8727D3656CA TICAS.DE.B
458,344,382 *2E82EAA26BCAD3E06E62B9C0865CCEF70472760F a4cyz
458,344,383 *2E85E2496269FFB5928EA36E2F1DFAC5499EF79D a6ifk
458,344,384 *2E8D080B82F6DEB5E60994394C16F14F2A9EAFB4 a8zcn
458,344,385 *2E88393DC22B838ECBBF3A214B46FCF6F4FC60F6 aaa[5
458,344,386 *2E885E72FCB8C6CBF5E1FA1A7E1BC2797749D156 AACMV
458,344,387 *2E84FE17E65DDBC11A0DACEC013C8459C6E184E1 AAHI
458,344,388 *2E8D94A6E02FCC60DB49F808FE72A9A2442BC230 TORYBAGNELL
458,344,389 *2E8B23BCD89378F04F1C2BAAE0A8F6FE2B1BF5EE TOTONICAPAN
458,344,390 *2E884764008831D708351710FA02E978FDE10E7D ABRAHAMMILLION
458,344,391 *2E8AB6F354BA23589C4B0B27AD19CC0BBAE3DB83 TRANSACKS3
458,344,392 *2E853BE59DAA0954AE35B27593F297FA119E7548 TRDITUM1
458,344,393 *2E89B066C8989AFA7D1BC346699B71BB0157545A AD).
458,344,394 *2E8225E057B2A869A14F3A87E9CEABB89D91F3FE ADOROVOSPESOAL
458,344,395 *2E87011A44518DD59D400FE485DB2C7C50FD77ED turtlepaddlecomwww
458,344,396 *2E884714D9DEA17EF6BBFD29408418281090CDE2 AE-DIL-HAME-ITNA-BATA
458,344,397 *2E88B9C8D00713A8860AE89BFDE7B1249E0C18A2 TYRONE.FOUGERE
458,344,398 *2E86405CE5272485E74496036694CE5FA9B45B7D TYTTISIK4
458,344,399 *2E8CE72DB3F5825990F5D4C6A03C03DE2C679F7A $U8CLAIM
458,344,400 *2E8690071B2C2E3C70ECD88C8574BEE62080EFC0 UBRAJKHADKA
458,344,401 *2E8B939CE3FE160144B382F65D93B37C755345C9 UIM%
458,344,402 *2E8384602FE81234B9F3FA40DF9D2FD0FFEC7816 AGof
458,344,403 *2E83CE52246CB4C7D1AA66B6AD254B4B4E238383 A'HS
458,344,404 *2E847EC1B880CE36B07EE2E9BF3102F671291A6A air4ce1104
458,344,405 *2E8D4F25B1470CDDE064853B3F19DA131FA3F341 unprep055e55!ng
458,344,406 *2E8044F92E008C9069F48A57547321B3A5A0BB56 [email protected]
458,344,407 *2E811590857770A51DFA9A486B612EC6CB2BA5FD ALBERTO.WHITTEMORE
458,344,408 *2E832828D2C5DBB6B61CE03A3145B22342FE5F0B alecbearfield
458,344,409 *2E8A014CEB002684F4C39927A7F97E7A1F660C74 alexbeato
458,344,410 *2E8F8C3888A2A203321983C99750E8F39680329E alexisshern
458,344,411 *2E87C30E5F697E585F05C2016799364C8D7BE2F2 [email protected]
458,344,412 *2E8487559B26B7B3BFE22C4EF6D2ADE207AC0D62 uvucal
458,344,413 *2E8E41F36E71B75586EB607009E5D27DC1EDDA82 ALLTHOSETHINGS
458,344,414 *2E8C22E81F40CC529B17B15409C2CD2B88B2C669 ALOTAUSIDEIAROMAN
458,344,415 *2E86C5C1CCA20C6EB9254DB56D16345502B4099A VANCEBULLMORE
458,344,416 *2E85A07BDFD47D652B3061557BB4B0397F0F2DC0 alrac-loca
458,344,417 *2E8D6126CCCE5B44FDE0132E60F6FCADB6BEB0F8 AMISERC4
458,344,418 *2E898C4D63D1998EF448D36AF7A8C62B14187025 ANDRE.ROSSINI
458,344,419 *2E893629D3CEF24248F33CF87742AB2598808048 VERA-TRIFANOVA
458,344,420 *2E81D09707BBE5DDFC8C4B82C1C49DE1CB8A1697 ANGELACAMILA
458,344,421 *2E8F2F57C53399D1F68F3B2A1E1046B8AA097194 VERONIQUEARIELLEE
458,344,422 *2E862AB3DBDB40AEC6E9E7BF080EB1A867E10E7F veroniquehabel
458,344,423 *2E80F1FA62E434FCF972DD17F978BE93A73BF780 victorguenthner
458,344,424 *2E834C052AE989750C27C40642A704859143B327 ANTONYPALLONE
458,344,425 *2E811347A724EB3C9B7C37E88B2241BD0CA66667 AOBIJ
458,344,426 *2E8C169F18C194B873EFCD80F860D70967FDEC81 apgqa
458,344,427 *2E807D7BA4240FDD7BF431A58FDAD7EDD0B67CAF VIRGILRADZAVICH
458,344,428 *2E8AFBCC95F6D2A48F0589D5154E8104AD2BF626 [email protected]
458,344,429 *2E8B4FFE7669DDF9479D059571E88B9C6094A9F9 ARDENKRIGGER
458,344,430 *2E8658CF66AC0C6F0BAB074C7C25ACF3F60E487F Are7
458,344,431 *2E886273CFBC6C0E4D35313E7FC9CE33B9D86B14 ARIEL-ALMAZAN
458,344,432 *2E8C575D9B6580713FB7E9152A8B4D803366856C VOISINERAIT
458,344,433 *2E8F818DFAD6CB36C5D8C176126E92E63FCFEE87 vonasaied
458,344,434 *2E8E16D375B97CC067C9714E36C0F2781D952140 v^pz
458,344,435 *2E8CE68BAC01C7A0C7EEC550467C2AAD5FE36AD7 ARTUROFEDALEN
458,344,436 *2E85B309D5F8004AE34383646DB14FDB93889DE6 [email protected]
458,344,437 *2E8DF03FEA6EDEA7CD3E170EECE0F588B2291960 [email protected]
458,344,438 *2E86DB4AFE6CEC10CF6F32A63466DF01061EA50A AS9.F
458,344,439 *2E867A40353B508E0ED660B2530BA812747F2E09 aschr
458,344,440 *2E84567B0A9C499C1C26B729E9C62F862BF0D9A3 ASSISI
458,344,441 *2E89AD83872B3F337C5456054B5B26F2347D5DA9 WA?P
458,344,442 *2E89E7725059B56A0908CF13161A6131C46638CF [email protected]
458,344,443 *2E898837C760BEE32A1AA2F579715D211FABFFA0 [email protected]
458,344,444 *2E80906C030D44B12020029E59AA0ACC42ABB0B5 WESCROSSNO
458,344,445 *2E8AE9961C02EA2ED91F76A68A2B43D8B24A0ADC wesleybeland
458,344,446 *2E890BC14CA94200AC6886DD8EA1C69661C75450 b%1p
458,344,447 *2E8DB803FF0CB565693B4D69F012D750705D6E52 wimdhondt
458,344,448 *2E8D61DECC84728A36B1327E214C6113B7DE8392 B4NCROFTS
458,344,449 *2E8E292FB403D4DDE67E227EE4A280C9D26F94DB WIRAWAN-PRASOJO-UTOMO
458,344,450 *2E80F58501B46045B2DDE301B0AB1D3BEFAA7EFC «WIT
458,344,451 *2E857A6512550574BCEE4BCCB0854C8B2BD7FB1A B6R
458,344,452 *2E8B290825EB6F2E3EDF8C19E94A17B26A858E8D BACHOFFF
458,344,453 *2E8CC0299DEBA3D8BF7CFD29F0D2AB17C2BFE405 backstreetmania
458,344,454 *2E86B3FA656FCAB9E2F11E137792112C54232199 BAN15HMEN+
458,344,455 *2E89814E8B6D058A05E1448A814A72E0576E5373 barry.mc.mahon
458,344,456 *2E81F282A36DE09D45D118C19AB28B2AE060C26B bartcuevas
458,344,457 *2E82C4FFE912559B0AC7B849B7C8DCD1FF7213E7 BARTON.CUNIS
458,344,458 *2E82DA0B42BDF2B297B880E4173A4C64EA00E047 WWW.ANALYHIGHSCHOOL.
458,344,459 *2E811991CB4B90954BFA75C5451C1E8AB7F7DF76 basilmaddern
458,344,460 *2E80040B3872DC5B14E757272B9C34E45F888E10 bauip
458,344,461 *2E87B989915A3DE6658E2F02C9C157E0D8394EE6 bbgwh
458,344,462 *2E8C1B90D3B7A387EA1BBAC3432DF9D27F8DEE75 bdjd
458,344,463 *2E83786F9D7DB4929EF44E5C3D1FB3CA79C04854 wyatt-goebel
458,344,464 *2E823E95D77EF96D179987990C80D9ABC3D454DE WYNDI-PEPPERS
458,344,465 *2E87C9AB7CBB52155DEA99B76B6C16A03612B232 X210C4
458,344,466 *2E8FDEFBBA1378E2AD4CAF8D32597BE13B19A846 x62g
458,344,467 *2E8B2E717A266FD3CCD0F273CFFC479FD1D119BE BECOME -SANE &C ADJ; COME TO ONE'S SENSES, SOBER DOWN
458,344,468 *2E81C32474CCF708BBE9D80C9D84156DA316F232 bejzat
458,344,469 *2E8862D80C70CF0060BCB024F58D703EA23F7FDC BENLEIJA
458,344,470 *2E8D9C1CF4FA53ADCE354401718123DEFFD4316F BENNIE.CREMERS
458,344,471 *2E828E377E9284B6A04C8FB021A787E0811DD3E4 BERNARD.INFANTOLINO
458,344,472 *2E832E5A8F8A829ADD773AA28776257A6F2A70BE BERT.GOATLEY
458,344,473 *2E8D46830E956261D48EA226490DA8AC0B0E3C9A [email protected]
458,344,474 *2E8F486D2B211A00C64C8F2D10029F4E17EA70DE [email protected]
458,344,475 *2E8AAEE8958D7BE615B0D6EC9AE41CD9BECB72B6 beschadigen6
458,344,476 *2E83FC86879253CBD4EA30C6103AC1DF37AF23DD XWR8
458,344,477 *2E8AAB0BDBA6BF467C3B9DE9835CF8ADD665E27E [email protected]
458,344,478 *2E80C9B724A8B7D5DCDB4182B1E68CE689496B5A bft5x
458,344,479 *2E873BE0E26BB1E17EE93811A1823EF0C9EE7361 ylevitatiseh
458,344,480 *2E820F321CC561FF8CCA6794568E118ABAD90F4F YSU]
458,344,481 *2E8F10CB8A6B606869947EA8248508F00CE5C3C8 [email protected]
458,344,482 *2E851C5F9A096039B7D5C0E244E6BC42E63E0753 [email protected]
458,344,483 *2E8358A1FE207BF49BC4D24EC880D83C6ABCA1BD yuventiuspersetoanseniarto
458,344,484 *2E8DA1A2D16D45052B3C5272280579DE410D9893 bj%hw
458,344,485 *2E85833BBB7060810EA77ABD889C02F243E1132E BKKM
458,344,486 *2E830007A711A95D80D9F9C9CB13B03B326956A2 BLACKBERRYデスクトップソフトウェア
458,344,487 *2E8D6F41927B42F3A3C9338D55DB5C5C0D2FC2D1 ZÉLÀNDE
458,344,488 *2E8FCEE8562092C41ACAABE33F3A07B140683387 BLNDSWMR3
458,344,489 *2E8243AB400C1FA6E9D42495E275C998BCC5D76E ZERO.REACTION
458,344,490 *2E86BF88F0D9C7170866B59C693DA2E85FE00760 B(LU
458,344,491 *2E83591EAF9D8CFA543188A6F28BA7B0D255FA6D [email protected]
458,344,492 *2E8812894A5DFF054175E3840AA64E7170458ECE [email protected]
458,344,493 *2E8F4C710288F1C28C4CD4F27B755456C2AC1DEE BMWCS
458,344,494 *2E88769FFBED8DCE26C876B1541EE75B320C0DB8 bochdalesches
458,344,495 *2E8FC12441A82067C6AD170FAAC82DA3C2D992E4 [email protected]
458,344,496 *2E82E5ECE1425161CFEFDFE9EA0FEB4D76E7A8F5 [email protected]
458,344,497 *2E86EB1751A5B3C12C4E2E25FE1DA412BF444E2E zumutbar6
458,344,498 *2E827E557BE7112F4A5B814D88509C99905D3A47 ΓΡΑΨΆΜΕΝΟΙ
458,344,499 *2E82297D010262A79893F8861ECBA18AC0D2230C μενέδημο
458,344,500 *2E8B33908D2E99B95DB4D5F0D3A4123F5B285B3D ЖИЛИЈАН
458,344,501 *2E87E446BD71D7579C4BA1EDC5C1A181F508CA26 bta
458,344,502 *2E8217F0F658887B680ED485AFF21A9A0A6F9816 РОКОВИНИ»
458,344,503 *2E8B056A39C410B487F12575B6CC6893201657AD РЫБОТОРГОВЛЯ
458,344,504 *2E813A9F1DDFA5BBB833E72D8507BBB455362C18 СЕТУЮЩЕЕ
458,344,505 *2E89612C3B87A42A8BF6E62320246971FCE18893 синехвостки
458,344,506 *2E88300F9EF1256B8697FFC0889187402346A6B8 BVYB
458,344,507 *2E8E384D9AD89D543803E6BAD8543F9DF3F4FC0B cantanlosni
458,344,508 *2E878E73078EBADDB399766883EAF21DD0D8C2C1 CARLOS-ORITZ
458,344,509 *2E87D2E04B5E17911F98029CAF59650F232CF914 cathyzetajoneszipn
458,344,510 *2E8F1B646ABB5C6A58CFC9189AD7B76E7231B04B に登場する架空の人型戦闘兵器『armored
458,344,511 *2E8430160AC2873D1FB9C12A135197C0CA6A09B4 CGT_L
458,344,512 *2E818B1728397C94CB5D5ADAB1C6E9EDB928DEEA Chanda-Re
458,344,513 *2E80D84D91FF1CA9AB2705EDBB698EC6FBB9326A CHARLEYROWLINS
458,344,514 *2E86E812C805F4EEB111A8370377181E59682036 02-08-07
458,344,515 *2E889D1F0D5216496EE86EC4B2545C88C1FFF10B CHENDERAO
458,344,516 *2E86AD84819A83808A87D082178F1ADB46ADCC92 [email protected]
458,344,517 *2E8AD11F59E22E325AF1C978A7B4471484C761A0 CHINOOKSED
458,344,518 *2E86B61D7C40E3C3A8F353C89FFB51669CFE0726 CHLCTHRD9
458,344,519 *2E8D512B3FB806DA56FF031C1D840A24A10AAB63 ><0~(=q
458,344,520 *2E8919571A4E71ABF26B448A459A389E24A6E29B christine.pino
458,344,521 *2E83C514336E305E52D3B87E550B119F9E74F588 christopernack
458,344,522 *2E87B0A787DC1AB34C0E1B715259F2E1E32E02B0 10aug1023
458,344,523 *2E8B6B56A3AAC37CA0039840C0B853178B060D94 chx2
458,344,524 *2E8154731ACC6B9AE26E8B65D82706C634EF483A CIRTED
458,344,525 *2E836C2C333F8FA3D42A4742AF0BFB702FC7E1F6 c#iw:
458,344,526 *2E83931F50D563B3B1BBEC46B259181424AC9FB3 Cj.h
458,344,527 *2E8B5B7B4556E9C7868F2E00846CA072C5696D52 ck;7b
458,344,528 *2E8C4FD4FC7720076ECBE5D5C2858BBD34BD3026 1701870 MENOJEN PERUSSUUNNITELMA ON LAADITTU L
458,344,529 *2E866F28F64365144B7175BAAF9996B53AF895BC CLANCHY229
458,344,530 *2E8612A4D97A5583C9622CF6907C18CF95E8A173 CLAYCOYAN
458,344,531 *2E86DFB01E3B82A4808CB1EB6659B2F4A3F4D351 CLAZ.
458,344,532 *2E88C57604FED4F74FC887EE00102254CC26BA40 CLEMENTENAILER
458,344,533 *2E81FCF0DC53C42C1901C2A24E26E4EFE022A2BD CLETUSVERWERS
458,344,534 *2E825EBEABFA4B08661CAD7AD7C038B196A085CA 1953629 opinnoille-on-kuitenkin-syyt
458,344,535 *2E842ABA5AB21EA73BBE44E521E1B9BF20EF821A CLINCHER
458,344,536 *2E8EE4814E26BE57889A1593BA3F82F0AFC64384 1-ARAKADASINA
458,344,537 *2E84FE80D61F2F898844E22A743BC4F9DC479274 cl-rd
458,344,538 *2E880F7A13479A69DA6575A301A27FDEB64B8355 cmxr%
458,344,539 *2E881835E2E1DB130389DF2396913DE33119C847 CN3Z
458,344,540 *2E867A944F4757FD1C7456FD34B9D13629C8D803 1.fslf
458,344,541 *2E88B5DE8DEC8614D1D0EAB2A92F61E5F5EDBD78 1ILUVFUCKER8
458,344,542 *2E8E23A9140DC96E72E5BE8DC33AA2400B6EFDEC 1.magee-womens
458,344,543 *2E8EDB9E0863E5DBDF027D296E10A2BC2C4301C0 1MASCHEWSKY-SCHNEIDER
458,344,544 *2E8CD01C578C516E0A1E8F764445A49BFF3DF695 1MEIDENKAMERS
458,344,545 *2E86D4280E3BB86EA8404CC992D50CFDC701C82F 1MMO1473
458,344,546 *2E8B9F70BAB79728C4E88455B57AB706A41DA9B0 COMPUTER-PROFESSIONALS-FOR
458,344,547 *2E82AF0A8A2219EB76516325703E647AF0B8ED48 confederaciondefutbolasociaciondenortecentroamericayelcaribe
458,344,548 *2E8A45A5B8D3E0145BCBAEBFE4C160DF451ADFBC 1-rezervasyonlarizi
458,344,549 *2E83816FBBC57CA5B967F1DD14DC3F03FB928380 CONNIE.WILDAUER
458,344,550 *2E83DBC312423C5D0E9C7BF6CC8FE7ECB75C935C CONQUERRIEZ3
458,344,551 *2E84821C3168D9AB600587CFCD0FACA03FD7D89C CONTEXT-DESIGN.COMWWW
458,344,552 *2E8EA3B0EFBF9EF7848D9C5B8D06089BDAAA939E CONVERTIFAQEER
458,344,553 *2E82E38BB18699DDD2D6F9697FD4A58A18910916 1-SOLAKAMMASTA
458,344,554 *2E8488DF1FD79EE5861A8898524CB630F17AAED9 1-TEAMISES
458,344,555 *2E85EBBC8C1426825162AC7282909E59E0584941 1TERCOLOM
458,344,556 *2E86D244482FB430C984A5AA45C62CA25DA3A31D 1TOURING-KELKALTA
458,344,557 *2E8525103EEE9778FB66FF7329F25189FBF944BD countweb
458,344,558 *2E8826622F981CED8BF3A322ACC61F6ABC31F239 1ZHONGHE
458,344,559 *2E81BF5A5DE0FE2CA8BC81CAC378780E0E2F2C28 2126691 "l
458,344,560 *2E8A705E282FAD29B9C6FB64DA7A1A1AA8725E29 2152104 SUOMI.ON.MAAILMANLAAJUISESTI.EDELL
458,344,561 *2E8C83DED45AC7F675700F03EAC1842D731B2F34 cprd
458,344,562 *2E89785697648CC97F36DBB220B8EB8648539F32 2341711 hinzu-kamen-150-kuerzere-beratungen-.
458,344,563 *2E882151C5CEB2617A1761A560753878A1825DEF C,QN7
458,344,564 *2E87E096CEFAD64D5FAC1FAA28F275AF322D19B1 crevent?
458,344,565 *2E8AA0CC4D474A694C782623EFAC0C3E9C0B0BF4 280ММ
458,344,566 *2E8D3E020FF645173DF72CC49DA742BDF9947694 CRZ:F
458,344,567 *2E8381BCA0639A60F6E5B1C5789A2F4727A87051 ct4q6
458,344,568 *2E86E5E2BC0829CBE38709AF487C32A45BE5E302 curtismeans
458,344,569 *2E891F0C27DA1C68712D2F02FB83B15177ACB311 2FEBRUARY1256
458,344,570 *2E8CD4E652B8B789AAE6DAABB5531090F1528E46 C)VHQ
458,344,571 *2E8122E5B7D6FD1FFFA3CC7ECC9B0767E588A67B C(W";
458,344,572 *2E88356900B739BE8425CEEF4796A8C2D10BCD12 2-VASTAANOTTOTY
458,344,573 *2E8EEF6427E7ED5012A203E6BB4158B7953A856E 2ZULAGE
458,344,574 *2E8E1D48282F6CAE6F577620020A7E352C0AAE9B 2ZYUUTEI
458,344,575 *2E817543B465BF225BF9439F99214340775BC88B D2HAIQAL
458,344,576 *2E8613496173782140E97CB5C9035C6596F4EB6C d3954747
458,344,577 *2E85DA211F669BEBB06E9CE2AA41CCB8657A1202 376BRENT
458,344,578 *2E8261CA5E3D889625664FC73966C45FF849988B d5dy
458,344,579 *2E88166B815F1271DAC4EB0539E0CE911EE50E57 3FEESTELINGEN
458,344,580 *2E8DED2A386D60BBA12E26129CD2EF6DF1F9E958 3 FULANI
458,344,581 *2E8622D17536837A9426CEF7823EFE7899A7D715 3-housatonic
458,344,582 *2E8F4967CE1D95413D6E6001B29347923C1A51E9 3 KULFETINI
458,344,583 *2E89F4203249D9BE75A48BCC8480D4625BDCAE16 3L3C+R0L0GI5+5
458,344,584 *2E8CC1DC9F5657D6D01F482C217BD93032F50FEE dalone
458,344,585 *2E809BA2A81CCCE9B94F6277A1EDE37AF7D69536 DANE-SULLIVAN
458,344,586 *2E8177D5F804A7F59CBFE120E15F4BE064939B59 3-SAZI
458,344,587 *2E81E7B4E95E09D32A2CE1E797539AECEE0167AC DANNIECLOPP
458,344,588 *2E89F517325D30341C1DD53AE8CB4E4F0AA8D54C 3:#THISPROGRAMISCALLEDWITHTHEAANDNOPTIONS.
458,344,589 *2E845187E44EC333FE3435691CED96D7B2928E7E 477JAYLENE
458,344,590 *2E8321F52E6841447346A986C6F0121CBB8AD76C DAVIDMORECI
458,344,591 *2E84A0DCF0BD126485046E78707C46364C999413 DBELL1234
458,344,592 *2E838E1B57C212A130BBC26E94C847408F9E8762 dc684
458,344,593 *2E82AB46C91E7D439200A0B689AD8EAA34BD55FC decandece
458,344,594 *2E805577AA7BE90A5F9EC47A2B8E5BF130176603 4MILOGLASNI
458,344,595 *2E8EE87892C901643644BFE4447979E68F4DB5E6 D"ED-
458,344,596 *2E8AA12EAF522AF0A5E283CEA20BD5D8621F22C9 DEREKCASTELLAW
458,344,597 *2E865BAB4EF22105425DFC236F7BB46FBA04BBFE DEREKDUSENBERRY
458,344,598 *2E8B3A1AFA589A23F8663D4FDB6C0CFE4A099EAC DESMOND.BOOCK
458,344,599 *2E80DC069CDC0B09E6BA9FCB02BEA8C2854B5A8A DESPOLITIZ1
458,344,600 *2E82C0F32FAE18FED40FF6D7FBD6EB1DFAF494AB DESSTENEN
458,344,601 *2E8E81839109F546DA03FDFCC6BD6ECA7CE25007 dgj$f
458,344,602 *2E8BF3ED0B5E37F920E51F0FA764A717BEC087D5 dillingerpretty
458,344,603 *2E8CCD27E63C3AC0491D64D2A542C9AF45C20B83 4TONILYNNE
458,344,604 *2E8F85BA927F5E4F68982E67AC4F9CFA8890D10A [email protected]
458,344,605 *2E851AF273031D9BC2B5F456445AD47160819D0C DIXMUDENA
458,344,606 *2E843B8E62DC4BDD5D0F10C90E4E86C8EC8A4EF0 [email protected]
458,344,607 *2E8F307529D9CE9D16624D4EBCB649100B3E2EC3 dmel
458,344,608 *2E8798BEF9ED49FFFF8678E6B16368FFE8C4BCCC 5 KUKUNTA
458,344,609 *2E83583686180C204A5851A479E340F39CD4B115 DN+M.
458,344,610 *2E8D7E6A9E5F458581328F18F06E78C8D1625853 DOMINICKLURIA
458,344,611 *2E8B6AB30187D9687B11CB1F4AA16AE9A113D0A2 5TANNERSATURN
458,344,612 *2E87613F794D52251BF4A8CE8D081B9E5AE55264 DOPOLAVORO.121
458,344,613 *2E861CF8425FA527D79D11FFBC072B283CFA1502 DOUGLASMONTPAS
458,344,614 *2E8633B37B6E98B0BECC7FE42EFB6BBDDDFB9233 [email protected]
458,344,615 *2E860801A51B29D98BBAB2553BE2CC3C98B72A2A DOWY.REFLECTION.OF.YOU...BUT.IT.WOULD
458,344,616 *2E81CA97D1816D492C5721508BD4543A7D4F2326 6328p3qpcwlz
458,344,617 *2E823618835B3D6450C9CA6A4BE344040F1700DF 6BSWAAKKOSTUKSEN
458,344,618 *2E89D78324B310B8DA91EF74C38FCDD22D041619 6BSWSALTMARSH
458,344,619 *2E8FD66BB824DEFC65FDB8B849691DFDFD573C7C 6CHANCEMALCOLM
458,344,620 *2E89259B7FB2E496C962CC1DE1C4D3FB6B541AB6 6COMESBY
458,344,621 *2E8360625CA8DDBC62105AE291F647EC32EA8CFA 6DACTILIFORME
458,344,622 *2E816774166CD6CA5B31CF6B4F5CF3265088BEC8 DRUCKMASSAGEN
458,344,623 *2E8051920DF9925FB739E4B1E56E84B0967F1E0F drzavnoj9
458,344,624 *2E8D2024F06B8C65CDC398BC21CE252164922F16 ds.l:
458,344,625 *2E8955A9D70F474A88CFD7165B982131B270B8DC [email protected]
458,344,626 *2E8C0B8D5F0A942561E194280DE57F37A766FE97 DUPEAFOLABI
458,344,627 *2E85E875760615D65637D0EAD490A74DC65F694B dx_ol
458,344,628 *2E8D96376BB63C85EEA11F682829C07861B377E2 DYLANALLDAY
458,344,629 *2E894799431D293563E3171040E0D40CB4B0EEB6 6TSEIRPDER
458,344,630 *2E8371FAAA31C5B8DEC0B2D6145BA57869C7532E e&6d
458,344,631 *2E89077BFAAC4FEBF00A4013DDC161278071D6C7 76481Q2
458,344,632 *2E8F45AAB8A98A84A6BBEF8840A97887C7C316D1 7ACCRESCETTE
458,344,633 *2E87B04C71FB708E57B2A35642150B5C64DBEB0D 7ALLMANER
458,344,634 *2E83470DE35C1E525C06DA45DDD8F6690AF51ECF ECHO_BEACH
458,344,635 *2E85FCB3022B18E58273F8140A3449CA667E4C5A EDMUNDMOLDONADO
458,344,636 *2E82B2F1E61A666D5973F10E154653164CFFECF3 EDZUJ
458,344,637 *2E8F9B41D29F41A52E1CE3F0BA17D3FF4E43A212 7KOMMUTANT
458,344,638 *2E85018F4CF814296B2F2B5719F7F8F478AAD7C3 [email protected]
458,344,639 *2E8481C894690503CFF1E385FF0987832E95DBAC EHADINGHAM
458,344,640 *2E84AD8F89ECFEB0AC41EE923D691191C8715EDB 7REALISTISEMPI
458,344,641 *2E8570813DA63C49348503764FD7DE48B672C684 7RUXADIDAS
458,344,642 *2E8091D01BEC31C8EFAD007AF29C1FB7B5350EFF 7sintoxiquais
458,344,643 *2E825A4E01D4E778D10435791F7F7076303C604A ekn6d
458,344,644 *2E874B91EB344C1AB8A071052E931CD9A3D5CB9C ELBRUS.NET
458,344,645 *2E80B53BA1D6E9E93E5AA36988C4D3C06033DFA2 [email protected]
458,344,646 *2E81513CD3AA9D80A30CF88D2BE2C3F24A812AA7 8aa
458,344,647 *2E8C849C41A6B4E59829F06D942A77C7FA2491C2 8CHURCHBITCH
458,344,648 *2E85702D4A78AE0B4F9F3F1EA86152BFC956CA31 ELLISWUN
458,344,649 *2E8999171C19AF1F0E84ABB3A611D45E1AA67E70 8====D* (00)
458,344,650 *2E8EC3D0319B8B5DB8378C0782F89FA147B56EBF elppahtr0
458,344,651 *2E87F23C0DBD3868E0F9902A40A5AE4C60A3D79E 8ESCROUSELLE
458,344,652 *2E8CBD6DE77C9A3CB3E0FE477B04E6022438A09C ELSYEVELYN
458,344,653 *2E8A7CC0007150994B113AF63DAE986A592FF101 8JJTJUZNR
458,344,654 *2E8E7C3975C2C46E4218921685B85D8EB508760A 8LOUISLINDA
458,344,655 *2E80A3B8CEBDCDAADC58387C523E6B6007A079AB EMMANUELCRISTINET
458,344,656 *2E8E1427506C22EE6785F0788D081AE980F663EF ENAMORIQUEMOS
458,344,657 *2E86DF6C78DA2F55A70206561EF90AEEBED3E4F7 [email protected]
458,344,658 *2E8A4538333E32339B870CE6398FD4C07F37BE39 ENMIKETWEED
458,344,659 *2E804073FD476C14EE991514C0A202842CE0C27A enochstagg
458,344,660 *2E8578B9B0B4875B5E622562B8ACC221789537E3 ENSUSAN_MCDOUGAL
458,344,661 *2E82959889E1A221D21CD75D82179CA6321EED38 [email protected]
458,344,662 *2E845839B7992AC1A71884398E4EBE72FF1C5E7A EP_KW
458,344,663 *2E8104D41F29F517A603E9867EEB435765C6877A EREMIRPERING
458,344,664 *2E86FD206E0C569F15D6A4CFE4BD4802EE6BC73B ergpu
458,344,665 *2E8072611ACDC19A28DC773859BE08FBACD612C1 ERROTILED
458,344,666 *2E8C913F2030A2169B72CA076BA084E42BB6FD35 ERWIN.GREENWEIG
458,344,667 *2E83832B2C2ACFC3135ED4D8A44195AF87968829 8VLITTJNEIT
458,344,668 *2E8BA5197348F5C6FA7AB89C3AC1012569484D01 estebancastleberry
458,344,669 *2E8F057A5E9C6E9ED1526B015EAEE0CD544DAD7F [email protected]#$%^&*()_+
458,344,670 *2E861279A912B2C4758EACF85293598B0C6AC731 93erszows508u745m
458,344,671 *2E889F2716F516C108649C4EC6050B7D2112FBF0 ES%V
458,344,672 *2E8E616B0E5C7B1B6C46D7F4A8178D415DFF3407 'ETIDIPU
458,344,673 *2E83F3BA45688B72BE08ABA0FFC139C5EDA71A63 ETKREWLOB8
458,344,674 *2E84DEB09D79080046FE3FF5C8B09B44DE9239D3 ETRETSIE
458,344,675 *2E8E145076BA11A7BA0C35354E829849FCC1C074 EVAN.WOLNY
458,344,676 *2E8D2BD70348D118DA9A555B6F7E0A60D89ACB26 EVERSHEDFRANK
458,344,677 *2E886AB390B81DFF1600D3A675DDB950AC117419 9BSWDPDBSW
458,344,678 *2E8B62DE13C09DD99E422866DE620732BD9E9D9B 9DEZILAGE
458,344,679 *2E8ABAF6E902C5BB58294428F107AA76CE8A2B21 EXPANDEDBLENDER
458,344,680 *2E8577EE3057F4BF4C2FE8CBEA867FA92EE24BB2 ey2l,
458,344,681 *2E81FEB8A44FC83DBDAE8B4C5FE54D7C05B39E4B ezekielchristal
458,344,682 *2E8ED0FF7B09F2DCB16182281EACC2A95A26042F FABREVAYA
458,344,683 *2E86A84DCA4ECDEACB42C3FF4D18E185EAEECCA2 FAL
458,344,684 *2E872EDB6E904AAF56C981A9949887AFF1B9FC21 [email protected]
458,344,685 *2E89A8D5A6B332B71389293C68D4EF3A98932CAB 9REPUBLIKANSKOM
458,344,686 *2E837F0EC5D988B5AA8ACE99512C0C089C8A47A0 federicowestover
458,344,687 *2E89D3BE0FD38FE5624E2B34EA99AA18E66E4E4F felixkruczek
458,344,688 *2E8592628B6FF21CF3221EE626F6FB972D2466B4 feltondyal
458,344,689 *2E82371E86E3E10F57F55D0D15BCEE72C06B28BC FERNANDO.PENSICK
458,344,690 *2E8CA23659783A0FE6B4D0DBA01C2BF51298AB9F Fever$hne$$
458,344,691 *2E88EA67E41A12BC1E21473405DF6ABF5D830E2F 9TIEHLIETS
458,344,692 *2E83B9022BC98300467E603DA2412D1A18E5B2A0 fingerze1
458,344,693 *2E8AF06DB25E01713CD67D3B10FDA0E552B1EC67 A1SQ
458,344,694 *2E82760E9B44A8CCA1FCD9785BB705C0FAC643D9 A2;T2
458,344,695 *2E8850BEA37B7518EE914E91EA37B97B055206FE A(5L-
458,344,696 *2E88CBD0C1A7D3329ACBCF7DE2BADB1F826FB6B4 a7gw"
458,344,697 *2E806EFF1791D8D89036256462DD45B2723E004B FRANKLINPOKORA
458,344,698 *2E8B340415CB857F9088FD18D9EAF8571715CE50 aaa[5
458,344,699 *2E844BB08F5E01268F12AAD79717170E43C20E06 AAHI
458,344,700 *2E8D4622AC21CCD46AB8C3F5FF4B3C1A1E09E191 AA=R1
458,344,701 *2E850B2FECD8962946C81F950A92150A1BF95A66 funk-h0le
458,344,702 *2E8404BB38482CCDCE79A781E1EE6503C76DBBA3 ABDISHI
458,344,703 *2E8B93490B24FD8ABF09AE4E5BE59A5832D8DCF0 fwtisths0
458,344,704 *2E8DF2BB6446FCC4819011F1A67AFAF919729358 ABSOLUTE.1
458,344,705 *2E8989498481C004C2F045ED961BB78A77148CA3 GAOJEWELS
458,344,706 *2E8D8AA6E0DD4768002292797D6CD8EBC34D7E97 ACCUMULA+1VENESS
458,344,707 *2E8D626283E952671CFBC8F2989122169404CC95 ACHOSIODD
458,344,708 *2E8E65E7A472389541491E77AFD5B55C1723E2B3 A:ck
458,344,709 *2E87BE28C08DF8C1A570AFC452C3A7B326661649 ACTUALITESGENERAL
458,344,710 *2E867D9348981964F4FEEF7CB5CCEC1E4E50400A A+EN"
458,344,711 *2E8E7E04F0D83B14F1D69FCF970C77EB56367D9F GITAAMARANGGANA
458,344,712 *2E83D97ADE6414323CC7430D7881813362CDDECD gitchining
458,344,713 *2E8B2DBCD222B1C0C8586751E0F4DE61B6B40682 [email protected]
458,344,714 *2E879ABD714A293235272C626DE48C9912212207 ah2?g
458,344,715 *2E8624EFE87F9E1F89AB463EDCE137C8D039155B GRAANKHAN
458,344,716 *2E8601ACAFBBB67CE197A96FC3BBDA424D4EC8D7 GRUENTAL1
458,344,717 *2E8E707C71148A3C206995E6F0CB72B69A3A9187 akla1
458,344,718 *2E853C69482B6F919EAF8B7BC6D5FC4AB3A598D5 [email protected]
458,344,719 *2E86D207493159EC3EEFB38757B94981BF47A1F3 H143956
458,344,720 *2E81591E04E6EE8ACB38200E9686818A3C78C149 H54778
458,344,721 *2E86FBAC44147864766648098EE7311EECC04896 habilitera
458,344,722 *2E80D44A0EC5D93437419F8869EA890C44B96F0F ALLES.AUS.PAPPE
458,344,723 *2E8EB51029EF63609FA3F483682F34DB2552B168 HARDTWST4
458,344,724 *2E85CAF48D75382556042E493C3453EAAB6B53D7 HARIN.SHAH
458,344,725 *2E87DCEDB8B0642D85F1FA933DD71B617FDBEC5B hassanjuma
458,344,726 *2E8B1410F3CC79EE7F829E5591057534FA80CAFA HAYDEN.STANDKE
458,344,727 *2E88676CF78089719054DFDDFAFA1BAC1A1ED20E AL.SCHWALL
458,344,728 *2E873CED8FB9AA0DEC79C91B0F701279B925427E alttp
458,344,729 *2E8A078867F6DAA88734705136DC74AFB76EB8AE helpless.it.lay,.like.a.worm.in.his.frozen.track...
458,344,730 *2E8FC85CFEE8C4CE11E687D655DF1C2A2CD2E9B3 ANDRETRETTIN
458,344,731 *2E84530C24F75552D283DE9D8332A94C35475EAF andyhessenthaler
458,344,732 *2E824A62F8287730EE52729114CAA0561C247B29 angie.yip
458,344,733 *2E8AF684115358FA1F5F71F050B00C7A8AFD72F3 HERSCHELSHARITS
458,344,734 *2E83CA2BEFE5D840DB5DA5C5AB8F0E05E7E4A3D1 HERSHELKEITSOCK
458,344,735 *2E878AD060D64AD53ADD61BA1C9005240F6E273D HEY.VOC
458,344,736 *2E8BB44FCCE47975E5B69B13C0CF19FC0EE234FB [email protected]
458,344,737 *2E8BB51C421DE4474BE02EE18B792956B44808B3 antenvr0nmental5t5
458,344,738 *2E8E56BB55CEBC3FBCEC419F3A03174A860C5A84 antionenoerenberg
458,344,739 *2E8634853A6B551248B4D58F1779DD5E615A3B9E ANTWAN.DIRICO
458,344,740 *2E8A2982EEB5775A021331C1F8A5C7FFA8BE12E1 [email protected]
458,344,741 *2E8806C916E3C1F117C427FAFA0BE236D071E17E HOOTIES2
458,344,742 *2E83E9F05F47587F82B50CF7F196180B6F630557 HOVY5019
458,344,743 *2E8EBF3408F9A631B003A83A47E5AD77E7334EF0 [email protected]
458,344,744 *2E84C312E6D2D7A2B512084AE48228377A62F9DD hoytcastruita
458,344,745 *2E8F70F61BDFC139738C0A21209D0AEA2148D57E ARCHIE.FRUCHEY
458,344,746 *2E89193F513FEBC6289C4968771E4A3FB8B632A9 ARIELLAYLAND
458,344,747 *2E863050AEFEDCBF3BBA4BE5DF608AE4903C1D87 ARLINE-SMITH
458,344,748 *2E83DBAE45F1455A272ADF592D01EFE464F8E6E5 ARLUKE2002
458,344,749 *2E84FA388DEC9B397E7F1308CDFA4D2582A90E7C ARMANDO.HOUDE
458,344,750 *2E89C0E9608AA1D15DB5E522564941BC52245550 ARNOLDRALEIGH
458,344,751 *2E8CABD27D5CC9D111D94C3D0F7D42EE81B1EA10 HUGHBREMER
458,344,752 *2E8DE894101C72457F55D9EA01CB0E8FB9A4D75B HUGH.PICKENS
458,344,753 *2E87480B45C7949D0EA27C33E237981226E9BD9E HUGOASHCRAFT
458,344,754 *2E8C7C7C79B8F6F891F494F3BFA35545042FA065 ARONBALTHROP
458,344,755 *2E8761C0680377BBD008D5FA09405B59FD1D9B43 art-oviedo
458,344,756 *2E8A4E647122D44A7D56299407952C7A0712E420 AS/A
458,344,757 *2E81CCD2504F6283A2ECC15B04EC3E869676CBB4 I50717
458,344,758 *2E82CA13EF534A8C20266832A026644207E83BFB ASHLEYMUSSELL
458,344,759 *2E80E17A8180D9D02AE81CA8327868A25596EEDE ATS-NEVE
458,344,760 *2E8FA0418CAEAF09A98B4B0EDF3DEA7B6D0D432B atto-terzo---scena-11-(eolo)-recitativo
458,344,761 *2E8C5454B8EAE58A1D804D0C345DB523C553765F AURELIO.WOJTECKI
458,344,762 *2E828961D98FA82300C68CDD704EB8D246C9E031 ICELANDERS!
458,344,763 *2E84445E8F59421A39DD180016B46C80ECD563ED [email protected]
458,344,764 *2E8E0706979296F4FBD9A28252A84CD36F2FB65C AWEILDA
458,344,765 *2E89708025F5032AE3F356505E2F9A1F5442EC33 b=,@
458,344,766 *2E89BD8AB7B05034AA08B87945317C3336949CCD b####)`~`~(0_<)
458,344,767 *2E841AC993A7F6AF058EEFC7F402E257ED45D93C interludetillwemeetagain
458,344,768 *2E8593F3FEEDC59B13E197586CF2CA261C61DD5D BARTMARIER
458,344,769 *2E82E456E1BEA2BB0A91C977A31BEF9C96DC76C9 INVOCARLHES
458,344,770 *2E8A99F6D7234D509D3B902E02B33E13C1782913 IP5)
458,344,771 *2E8670CF1CDB803CCD35E698827D23748C27CB98 b===b.*.*.*.~0~o
458,344,772 *2E893FC97716A7CD4EA70E995CD74626A531831A I.ROCK1
458,344,773 *2E8D079C5D965A86D6DA238E77B5963405A84CDF bcpof
458,344,774 *2E8AF2893B673C9D74B3FC9FCC83C0E5C33F1F8B issaccustis
458,344,775 *2E85A18C4D71F36793D9954E118C5AD4B6446EEE beissmichbaby
458,344,776 *2E8A8044EFC6F6217F9400AB56AEEF35647B160F iyvv
458,344,777 *2E8614FF88B63A4861157BF26411C2C1F634634C bennettmages
458,344,778 *2E821CC7E6E3C86B3D0F576FF7D90D1A9E0A8AFD BERNARD.CHARTRAW
458,344,779 *2E8B71003FDD3A9771F85D4D7A95BBDCB73B768F BESTELMAAR(LIVE)
458,344,780 *2E8B030F9C9FFC112E76E41413B6815E4A0A713F bevinged1
458,344,781 *2E8D15B7636B27222CDF18811DF53BDEEBA4755D BFN/=
458,344,782 *2E8C10CD8CC48C4AA9A7215CD9ABE4F64AB56D4A bih8l
458,344,783 *2E8B7A74365BFCD0242F723C7D4A6E2AF7CB0FCC jd~<
458,344,784 *2E83268853EF6EEE0B387A8C4BFC90B01232223A jedostenson
458,344,785 *2E896396BEAD6D996C4B6396B8B7D7CB9DA6063E bistort5
458,344,786 *2E8872391DDA32283F470093F67592E4F824C202 BKKM
458,344,787 *2E86B21ED66BE9A59455318ABB2A184CB27355A4 [email protected]$
458,344,788 *2E89592FFADA3281AB36986291097031083E8273 bn"bm
458,344,789 *2E8934DADEA432BB3958073229C3BDA16ADC90AA JK.GOLAASTL24
458,344,790 *2E8A56F13127EE27C67B0795F586F24DB7074173 JOANNE CHISHOLM
458,344,791 *2E8F593FE8851BBEC9748464140183F6EAC115D6 JOAQUIN.DROZD
458,344,792 *2E8FED50D4AD90F7027FF279768E9A03FC7FB1C4 BOBBYKNEISLER
458,344,793 *2E88F9E7CE5807F0D66CEF1C094D88436AD3BA34 bom#6
458,344,794 *2E84297BA5FF915E95B541F1F7BA9553C8419B6C john-slensky
458,344,795 *2E8A5EE8D34233B96395C8B7CC94D82A5DABC5AF johnstrupite4
458,344,796 *2E8EABB7E43B2BA509C4294533302C49BBDE724E jonhollibaugh
458,344,797 *2E862509EDF03F2E809D55630105156C4AB2F94D b-p.~.`.splat
458,344,798 *2E8AC0AB75FA4C4F8381AE4D499EDA606D85C845 bradfordtrimarchi
458,344,799 *2E8AB1B5F319797B5FAE5CC69141DD1C6BDD8EFD BRANDMODELANDTALENT.
458,344,800 *2E8ACE8278D17888F9BDEA2FC58E0A6E82833888 BREGASE5
458,344,801 *2E84FEA5AE40923A689D3ABD7A99F239995B68A5 BRENTONHAYDAL
458,344,802 *2E8810F8F6B7EB094F2CE3CC9CD9A47BA11E143F JUDERAL
458,344,803 *2E88D7728B2F3C9F02B9B38AE52287C44176A8B7 KALFATERST
458,344,804 *2E8707516E00863FAEA3A04CD61C0B35FD36DCC2 KANDIRACAKLAR
458,344,805 *2E82EA2E4577965E1E123DB03ED6F3230791EF2B broderickmorro
458,344,806 *2E807F8A9739E1BC8FFF62479528C05D1933196E KAPRALOV
458,344,807 *2E8110F95E701040084E16E69E38E75566CDFE93 KAREEMVRBKA
458,344,808 *2E871977919475A440401201EAAA4CD24D6BE4C1 karen.risch
458,344,809 *2E80556871EFBDC3A7688B1888262AF727023A04 Kasseri
458,344,810 *2E8086C6FA3FC935482F87ACC5885B720ADFA979 KATIEENTWISTLE
458,344,811 *2E8885DBDEDF870BBFE5D3AB35DB93DBD33AE9AC katipunerong
458,344,812 *2E87A4C36EFFF966BF5F3FFDF52E9B50B9D0D533 KENNETH.TOOZE
458,344,813 *2E802F99B6B4A76B7ACA04223BBAD702AA0DE0BD KEN.TOLLE
458,344,814 *2E88374AE13DDBF341B39A53107DB4DB102C45C5 KÉVEKÖTÉS
458,344,815 *2E817CBC8F1F9A9068CAFC860CFC6887DB32B016 konjunkturalnim
458,344,816 *2E8F4AE3975773EF89A03E257B5E5C28C6ACD0A0 b%vde
458,344,817 *2E87F3EF1F54D878F104073179CB236920C299CC K]RM
458,344,818 *2E8CA86B8D9DD89A3E84B54E0A928C51B4C1E003 c02256743494
458,344,819 *2E8488D476491CC35C5F65B0D2D1946562528ABB L0wsp3ar
458,344,820 *2E8D5A9763E91D123DD5639F6D69CA773A68611A LAILATARO697995
458,344,821 *2E877BC1CC52DAB720F6C600C813C56FBC218521 lance-kolp
458,344,822 *2E8DDA50026AE0708AA129DBF4A2FA9FF142B385 C69t
458,344,823 *2E89413AC830FD56E5A5F1B0B45058B8E35B98EB [email protected]
458,344,824 *2E80B031AAD8C1F1D888637CEBA97E8AE83CBDE2 cabl)
458,344,825 *2E8AB3AA2AC1EE8ADD02574D3EAB6036B79ACD6F CA/EG
458,344,826 *2E8F7E5EE6EA890A4A245F60CF3227D0BFF37E0F CALLYBABI
458,344,827 *2E88117DA4C4ED5F3F5644B1858EAAB0260B395F CAPITANIA-GENERAL-DE-LA-MAR-OC
458,344,828 *2E8DE6D46861232CAFFE1125DB17803204F45EFE LEIGH.BRUCE
458,344,829 *2E8FE8C5A009ECCB71D173B02FEB4995EFA61A7A CAROLROSCOE
458,344,830 *2E849E2BC164FED1550B2FB29EA65A5D7FD6B90F [email protected]
458,344,831 *2E8797C2E2504449BE7093232E1C341F1707725A LESLIE.ROY
458,344,832 *2E85CF38C8C73FB30A00371CC0C25A5B8500A977 CATZ-DON'T-KNOW
458,344,833 *2E8E8E81EB9749A60934142C465D70C700602EFF CBGR/
458,344,834 *2E8E07E0D159F6A5B86E89A657AF544254A97F62 C?BVT
458,344,835 *2E83B8C2FD304F2057FD3B6E8C454E72CD877464 [email protected]
458,344,836 *2E8AB38DCAFE2C17C0D32B6A4DA0D10257E49646 [email protected]@RY
458,344,837 *2E83140946B25BB6FB589D216A02762381AA5029 [email protected]
458,344,838 *2E8F764A5AC563301536CB8E220D50442DA0808D CCZOD
458,344,839 *2E80327715DC7A3A966FE73299216BF24982761F lisafarragher
458,344,840 *2E82B2B3C4FD77772A78F42DD89E571F15A424C7 ljr32791
458,344,841 *2E8C271233D273F0EF9310C4299BB343471D4C91 [email protected]
458,344,842 *2E87E03C45B4F1C48E31159E7BEB2B179228CD2B cge:a
458,344,843 *2E8EF6D29BFFEB472CB3B80563A95F12CF48FBBB chadhil1
458,344,844 *2E8074ABAE38F9234A9ACA246BF1B259EFCA5D16 LORENZOBRUKER
458,344,845 *2E8D650112E3CCE9FAB44A927C95B1705BD41994 lorimor0
458,344,846 *2E876AA9F7333F82FB2BFC63B74290CB45EE0A26 LTNATHANRDOTCOMAWGTI
458,344,847 *2E8C12DADB5ECD745B127EEB326771115B768CBC [email protected]
458,344,848 *2E811C60F1B3F16721986008C2FDDCD7A4CC5359 luciusraridon
458,344,849 *2E89F377DF6736D13140450CE2B29A82B0FFEF17 [email protected]
458,344,850 *2E8A22919B6F60081D9FCDEB526008339FEB22A0 charlie.crown
458,344,851 *2E85E9609D4C7035D6C4C4E09E1D6F014BA824E1 chaunceydoris
458,344,852 *2E8FD23DEC38DD89A52B61868B231FE4A4FE35AE [email protected]
458,344,853 *2E806095F9395C79C46E757C3B5FA175700D6449 lwke
458,344,854 *2E8E226AE72515FAC79E60D1486F5C54DF5837D6 CHENKUIHU
458,344,855 *2E85C88892353594BE67AF1F1BEBC8409FF89915 CHERYL.ANN.WEBSTER
458,344,856 *2E89C3791AE3BCADE9A401BC68A7751EC31A0F77 CHEUING6
458,344,857 *2E895EF034829CF9325DFE26024C8218F1B562E6 chjdbswed
458,344,858 *2E8307AA087EC77D18DE5D3205BE6294C210B0B3 chongzacharia
458,344,859 *2E81C6F52E5F29ACABC68776F77A5BE2FC403458 CHUCKHATCHERSON
458,344,860 *2E86912F556F807D0C9071EE82F800E32B7DB497 chv8
458,344,861 *2E8453A957A837D974F75757467E2A38A9C2298D MARCELINODOUGHAN
458,344,862 *2E8D3BCBFA4A2E63F895B9ED7C7A247035D86258 MARGARET.GRAY..JESSE
458,344,863 *2E833D3EA886F52467A64B7BCD47E3A635A27108 cl4j2
458,344,864 *2E8FDD7DF8C633752AFA0479DB0D94F25D0770B6 maroulis
458,344,865 *2E801FA79E6B7D922D3B24DB349F7B66BAF6E623 clementeaceves
458,344,866 *2E8092A030876D5F1965E8B1584AC7EE8C205045 CLEMENTE.SHIVES
458,344,867 *2E8E1D7822B8CF6D694DDA39FA420F46FEC230AE [email protected]
458,344,868 *2E832135E6B4ADA20B4DCC9CCA51DDD6285F9AEC C+LY&
458,344,869 *2E88329FDA47DDF234ADEAE4AE607EB153EBA672 CMEZF
458,344,870 *2E8A23CC9CC2B996F11ABC486B5335DC52EAA93E CN3Z
458,344,871 *2E8AE40887431890E00CA5228DABAE4A7797F509 [email protected]
458,344,872 *2E85109EC19EBB7B57E3A42B2A59E8E638EEB1CF MELVIN.GLAD
458,344,873 *2E800799759CE554BBE092F8468ED1703EF2922E MEMOSFROMPARADISE
458,344,874 *2E8C19A25CD12A9800990DF725246401F48F5C2B mgxfqmps53
458,344,875 *2E89F9468644C26F6AE6F240058C16ECD5CF79D6 COLEMANKOWN
458,344,876 *2E86FF5ED31C26F8A2694D34E455BDDD2CD6C2E4 COLESARED
458,344,877 *2E8582397E5A0DC9A84D48753538CED535196E91 COLLINOLESKIEWICZ
458,344,878 *2E8AE8A747F60D78D1C5338018F2504EFC48837E michalfroschheiser
458,344,879 *2E87CE8FDC447D3455CA19C11348B9D112AC6D5B colorc45t5
458,344,880 *2E85D9584C0B80D0EC89550308D130BF25497452 commonroom
458,344,881 *2E834EAEE59F99630574B6B3F6D64FAA76E4483E CONFUSED-FRONT
458,344,882 *2E8716D211E13D0B99AF5F7D7654C372BDC136CF conraddecorte
458,344,883 *2E8DE57E08E42C70E24592E12A2F5CE573198353 [email protected]
458,344,884 *2E80A35C43E26AD94D524DF205CA2FB1C619CF40 cornerstoneclassa
458,344,885 *2E8D225B84BDF7443ABD2066968AF0F82B927CC3 COURTNEYJEPPSON
458,344,886 *2E81733A306C348A901E21D0C433CC523C26AC6C CP?%
458,344,887 *2E847D3CCB1D9AC4EEAE6D5AC10673D3B4840F16 c%"q,
458,344,888 *2E80C4180464D60B47285C61C2B52212BE64C2AF cqd7c
458,344,889 *2E8961BD7020938C3802379CC77D7EAAABF46E63 criminalistics,kr/I/m/@/'n/-/l/I/st/I/ks
458,344,890 *2E8C88E72325BFB1720D4E74577D5CB936B3C0E3 CRISTYCRYSTYNUTZ4
458,344,891 *2E87DED4E4D075E8938388D20F126FC0FE047626 MORRIS.LEILICH
458,344,892 *2E8684A19D5D2E8B9F7AE2F93193339FE5B1D0FD mosheternullo
458,344,893 *2E8A493410D17218D8729D03A85EAFAC28708A75 crt"h
458,344,894 *2E843AA0099CA64F2509B8F6AE3FC9C89930EF83 CTLEG
458,344,895 *2E85DDB91B7661FA16DE0D14DDB8BA41404223E9 [email protected]
458,344,896 *2E86C0AD04447321A6E77DCA013D196AB72DDCF7 CVRR
458,344,897 *2E8227EE60115DF91CEFB0401DF089B4ED32ACC9 cz1ll
458,344,898 *2E8329C7C7DAD8F42185B11325E09AB2E3F50C49 napv
458,344,899 *2E8EDD01DCEEC8F00E645DE53E1569A7FD25A345 d4amz
458,344,900 *2E80A5BA4A72AECF4C5BAB0D9A3B9B4C94A2D2CC DAEVM
458,344,901 *2E85EBD22C80B89B1D06612BC212CF450E249F65 [email protected]
458,344,902 *2E81B510697C121E965E91CE75ED7F9E6D5F17DE newtonlangston
458,344,903 *2E8AD6F0D3698F4FC5D523353EB4ADB07B506AC6 NHOCKER6
458,344,904 *2E8D3DF6C1353FEE2ECC023BB346F8BD12696E6C [email protected]
458,344,905 *2E8FE46B02D766B7D528D9728E36224913924DC9 danialbedker
458,344,906 *2E83B9D8424C164A71784651CBD9192FC70D6FD1 DARNELLSOTTO
458,344,907 *2E867A74276B05D732E30C0707C6412447E7CFA8 darnellwienberg
458,344,908 *2E80D8F53332DD507D6B089689838604A6EFCF0F darrickkusner
458,344,909 *2E8FF5917D83BE30730CB2BDFA38B1EE2CB12251 NOAH.KIRKPATRIC
458,344,910 *2E8B2B6A37E25CB5DA8B22F82E0021B052CB0982 NONENERGYRESTRICTIVE
458,344,911 *2E8D2855C133523514D27EF9E5549081BCCF37DC DAYSHAHALL
458,344,912 *2E82EBFDC2E8908B0F89DD161B0DC505E3F048C7 NUFLUF
458,344,913 *2E8F160F5EE3AE25289BEDF1347ACF38BEEFA4D3 O~&+
458,344,914 *2E89F8E95DFBBC1A768F48CBFF9DF820ADF6C6C8 }o{0~.<=8
458,344,915 *2E87C4E76D5008179B2C9767ECB8B21149B3031D O51360
458,344,916 *2E8DF7A418C34D89ABD322457D1F5CC9C56B749E DECOREERDE9
458,344,917 *2E81464A08712F2721E26FA0A76AB515A76D8BD7 deegosnell
458,344,918 *2E8B4D638018295837341882E02C1BB22995DF62 delorloski
458,344,919 *2E8A63610D86D21DABB668E3D003E1D782EABC40 DELTACATENIN7
458,344,920 *2E8B520340BC61A4A0488777636260767AE942E5 demarcusyuen
458,344,921 *2E850B34557C7A0A3185395BF4C5DD442FD7D9EC oilx
458,344,922 *2E8A25C78B148E1A78667C286932F1FD1C02EFE5 ONTSTEKINGSFASE
458,344,923 *2E86B4DFB4B59700491D8218C5EBF8887A6E3142 }O{.O~.O~<-----8
458,344,924 *2E8078C08E333C15823FA2A3BF4AF65FB8336667 orcoorco8
458,344,925 *2E85244AD9403025F3C798A5E4A2A6D0B1393DE8 OREN.SCHOEBEL
458,344,926 *2E88A2DF6F8CEBF62C7A5297F07154659B5D298D ORVALPOSPISIL
458,344,927 *2E8078F8872782BC76CFD2F0945A1FB5DA52C8CF orvalwouters
458,344,928 *2E876840A581AAFCCE870A4C1B47571C18F8E91E [email protected]
458,344,929 *2E806F961C3165E57F4BCFD20EACD1AC0DE624FC Dg=(
458,344,930 *2E82D760F4651E99DF664BA81523C5DBCFC2BA22 dinomathewson
458,344,931 *2E8A8C76542ECC85269F9784A49106C3459FF59A DIONDRIAED
458,344,932 *2E8EAF2FD37A57E6C560841288D0CDAB563B884A p014rm3+ry
458,344,933 *2E893433E01B2B889F4EB1CAFF57EDC93A517B3E p0ss!8!l!+!3s
458,344,934 *2E814965D17EE87B57E6034CEB4AB82950806A87 do:b
458,344,935 *2E85FB7D20C92C6ACDE81BED9220823952FAEB89 <P><aNaMe="N_524_">524</a>968-DC-00003546
458,344,936 *2E8EA13EA54B59D103E6F0CA42FCAF876EBCECC8 panoches3
458,344,937 *2E816A921B15C3B22240C8A6328AB74478DBD8D8 patrollike
458,344,938 *2E81D4ACFEE340B1BF77CE9E79A8A15356024F54 doumq
458,344,939 *2E834F4F55AB669D07AB80764F329CA4A97FDC47 DQIe
458,344,940 *2E87D61FF53B8131279F2B76F1886600C4D1F03C [email protected]
458,344,941 *2E8748E198B0B0693AD5CC476A4B0EB8AAD19E51 ds0rd
458,344,942 *2E881D0946B72B57EC25CA617DD9375AC9C09BC3 phorsha3
458,344,943 *2E8D267D2AE70D7F6EE43E4772E9D0F290B0AF5A PLANNED 'O'
458,344,944 *2E823FA07D4846FC4AF2C5CEEFE4D27ED9658C73 [email protected]
458,344,945 *2E8981B66E3678A46EB72E9C5F12CEB831108F78 POLITIKENDKVIDENSKA
458,344,946 *2E8E1DD504291189BD792566DD83AE253A6D0CE9 ecfmz
458,344,947 *2E88BFBCAE5A0A6204FE756086094CADFB83E7F6 EDEN-RIVER-VALLEY-I-(FEAT-ORANGE-COUNTY)
458,344,948 *2E870D07C52B4631900967BFFF1860391A7D07C0 PP*.*.SPLAT
458,344,949 *2E8B815D4944FF2F11713D5D9C467AA3B13E5FE1 precetti5
458,344,950 *2E847C54D0EFF2F2F2D58F9D72B6B81DA3402FD1 EI1C?
458,344,951 *2E855F64DD9DBED3B4938FE921CFEB014EC2257F PUEBLOAN.
458,344,952 *2E89D8412997E046388C65D7E6ADBAC52A57EBFE PUTRI KUSUMA WARDANI
458,344,953 *2E82B70D61F345AFA1EB4AD4760D1F1A2CB328E8 P#>~~~{X}
458,344,954 *2E84F154A1E9ED5D0DBD7FDA4165A295F5CAEC14 [email protected]
458,344,955 *2E85F93743D71988A9D962D907EB999525C0539F qahjvfaf91
458,344,956 *2E81216C51DB5C08B11CC351C242294098579DF6 ELMOREP
458,344,957 *2E8D56451C8C8C1793CE491577F1607FF839C3D4 q==).~o.;)
458,344,958 *2E8EB4FBA6336333D2B46AB700B67376083DE648 EMILIZL
458,344,959 *2E885CD1C7A2A309B2A308B7325BF2BCDFEAB5C1 QU'EST-CE QUE VOUS VOULEZ?
458,344,960 *2E8256EE652AF3FD98E07B8A1260342543265730 qwertyuiop022
458,344,961 *2E83B907F89B26248BA0AA3660AECF818D9E5153 [email protected]
458,344,962 *2E8F41BCBA20A31358FFEE852B3783C990AFA9BA ra77l3bran$
458,344,963 *2E829B7E04A5933957EBB34A3F164047F0FD3F52 RALEIGHMATULEWICZ
458,344,964 *2E8CB3AC8F964FE46EA6D4068DAF72BFF41CBFC0 RAMETUKLEUTIK
458,344,965 *2E855FC3A72E6B4799F86BB7D8E60A581F07E725 [email protected]
458,344,966 *2E86A6C8DFC846EA4896FDE7C782C7F2F737E954 ENTBG
458,344,967 *2E846F6B46FAB6CF2BAD6DF9B116C57C8089B3D1 eonxd
458,344,968 *2E8EC84951E340D8A02AE6F500869A3B6989457C EPSNYDER
458,344,969 *2E83E832EC25999A58344EA7370CAEB4461EFB6B RAY.REPER
458,344,970 *2E868C8DE901900501C0F8F66395CEB90B1237A6 eqctt
458,344,971 *2E807F30295F89F15E49CB01AD994D73C3415F1B RCLSSRNS4
458,344,972 *2E8E536163ECD82D061B5C273B73D2D99F010247 esou
458,344,973 *2E8E5F03FF07D9C67E0B879BA2F95E0B008E6E52 ESW("
458,344,974 *2E8EA1876869693CC80C9B5A27B25CCC4EB71275 REMBARQU2
458,344,975 *2E8BE2B0FB60DCB1A68C640399F593143D000E52 EUROPAERWACHE
458,344,976 *2E8174BBB8F3B8F42F5AF8183EA6213AE4B176BE evelyn-erridge
458,344,977 *2E89E6E5E6CF2FA521233112BE004AFFF7E2DB83 EVO1U7IONI$7$
458,344,978 *2E868F7A925F80282472E3D81F101C15CC60C4EF [email protected]
458,344,979 *2E88B036BE2526C3FD50FBE185AEACADA493F55B exportartikelen3
458,344,980 *2E89E52677D9A3AD2671C5ED20A3F3821B368B6C RFACTOR2010
458,344,981 *2E8F0ED9C96BA1005A609EBBDD93A4B5B0F7471F f2egaslk
458,344,982 *2E889E13EB75E74F7AC7D92AA35E83FF071FBEB5 RICHARDMIN
458,344,983 *2E863BA0E9CD2FD40A4FE1F58FF089AD679531FB FAL
458,344,984 *2E8D855B6A919BBB33155BD98E9482B2DA6096E7 fat.bastards
458,344,985 *2E87E78B3CD6C7F31C5653B34957ED09AC6BF7D1 [email protected]
458,344,986 *2E86325E9A83B2EEA6F9AA7E2CBF68B93B3CB225 fbk
458,344,987 *2E836149CC896DF604668022D22D132668AA90BE ROBBIECOLLETTI
458,344,988 *2E80D3CBA6DE40E22B299EFFE59A1C67A10F41D9 FEDMOGUL5
458,344,989 *2E8996F48BAF3F408F4EF632C5D8481A63182093 [email protected]
458,344,990 *2E8381043A3E34693BBA08A46E860DF54F6B3058 RODRICKGRUSH
458,344,991 *2E89143DCB1AAC77EA94E267C368AE85F5B47480 rohleder1234
458,344,992 *2E86A49E60FCA1B78FDDDF6F6F7090EA69EEB33B [email protected]
458,344,993 *2E8982E47634F4C3F8F8713212F7B74263C454A7 ROMA1212
458,344,994 *2E879EE3276D41B2F8B26DDA5A8CC1E9F7A5C49B findyourdreamcareer.comwww
458,344,995 *2E890356D546CD8D7D8FFF47C9B21DBBF8495489 ROMANZP
458,344,996 *2E8EAD5B31BF91D1D7BDCB9BBB9FB733DEBD8B7E FISIONS3
458,344,997 *2E862A469357C58CDB7E9D98D26CE220AFD97DBC flotteur3
458,344,998 *2E85D176C36F96D7CD8DC13E839FA1A5394296B7 RŐTSZAKÁLLÚ
458,344,999 *2E86BEEAC3A374DD254708D54028CFE7620657D2 RUSSELLMONTREAL5
458,345,000 *2E820FE1954CC3E2E2C686040D5177BE0E0145B9 rvacka1
458,345,001 *2E890BE3FFBEC9A22558B50F85E3BFB3A61CC1A5 FREDICTON4
458,345,002 *2E823FB93E978EF4FF9CB13E64B36C339271EE8E S1AV3.ANT
458,345,003 *2E82D4278EEB75623F18E45B6F67B3659F94E07B saadaninationalpark
458,345,004 *2E890DCDE57B86273E940BF1180A3F549E17C932 sabrina.ritter
458,345,005 *2E8FCB8E97CFBAEF68C7D6A6968D9A5417630666 FRJT
458,345,006 *2E8BF34A3FEBC0B7C680608A7CBA6A78714B27BF fruitccbbs
458,345,007 *2E82192D8AE287B1631B727A85743E7CF4C398B8 fsoh
458,345,008 *2E829FF9ED1F5318DFB14249C2F02DBC083342AA G19072003
458,345,009 *2E8CF7EB02D379EFA1B5C6A69873EF0AFC3C9990 g8ge
458,345,010 *2E8AED56BACB729EAD42A2140FDE801E76EF09F9 SARAH1BOOTS
458,345,011 *2E82189080B9B3218D49593A7943381BF407FA96 SARINDAM7
458,345,012 *2E8A632C1DD16CA098B7E046156A9AE5028F022A sasravakusala
458,345,013 *2E897FD252B0CFFD01777E2A4A484D863A2BF898 GARY JASKOWIAK
458,345,014 *2E8703DAA456FB79347C464A3914218F11FC6E62 savingly
458,345,015 *2E84A70BD1C57FD00AF75BA971B199CDB9EEF9DD SCANDALMONGERING
458,345,016 *2E8993BCF34590945591235C11BDC73AB15229B0 GESAMTENGLISCHER
458,345,017 *2E8F37EC349BAEC62BCFB1B9C07A5212370A8020 GFWIUOYG35
458,345,018 *2E8BD65EFB74FF3F69F771657B43A9C7720D6117 gilbertokeister
458,345,019 *2E85189F6F44DDA3DB188B361BA140921294A4CB gk*w
458,345,020 *2E8DF5022EC56CB6618B5583A29F49F637F92697 [email protected]
458,345,021 *2E87303A412898F8F2A9EFBA0B98ACD473BB28AA g%mv
458,345,022 *2E817172D4339508FEF59AE57B657A8127278FF0 goscieradow-folwark
458,345,023 *2E8BC80DFE5A2CCC70BBBFD478E3AC7F2F8BABB2 SEND.HIM.HOWLING.BACK.TO.HELL
458,345,024 *2E88FF5EE1178ABDDDDE238555FB625C1EBC5C89 SESAILEBOL
458,345,025 *2E85A0D7B21CE530C9A1A3B790BBCB022059399B sesromer4
458,345,026 *2E86A397A1D10A928F0D082242A5230567A70252 SGLYCOGENESIS0
458,345,027 *2E81EC32C5C6826001A2CA896A5862849F33E770 GTGERT
458,345,028 *2E8CBE6BA5162CBEEA65605818B8D85D03B429A4 GUILLERMOALACANO
458,345,029 *2E8E95615838636F5DF03976C8B9F58733D7D8CC GUNTEREM5
458,345,030 *2E8A0411A8444F0B0B4F780A249D21FECE245945 [email protected]
458,345,031 *2E8624D3C88816E9F848C0323B460AB2ADCBACE4 SHEBELUT6
458,345,032 *2E80AAEE9DCD5A6DC16610FBDABBFAA2370AB9EC sheldonsteeno
458,345,033 *2E8AD242111B9A84F6C240443C67BA4E92DFB325 g,V
458,345,034 *2E8391FAA3BF6C0209A3B165A10CC33343A210F5 HANKANDLEFTY
458,345,035 *2E8675B45B8355F1E2056A50200FF11802662702 HARLEM BY THE SEA
458,345,036 *2E811DF24DE6A607BB773623A592E44EA3941F88 simultaneously,s/ai/m/@/l't/ei/n/i//@/sl/i/
458,345,037 *2E8B5CB7AC7C953787300FA0CB431F058CAA6604 SINICISE9
458,345,038 *2E8BC27F792CF0A5548DD26D4C341914E87777B6 HERBERTHOVENKAMP
458,345,039 *2E8E50BC4BABD6CF2F1777E17C4C5B2C349422FE SOLOMON.WESTFAHL
458,345,040 *2E8F432B6481CC1802366AA79D4D3216A2B4F844 solsken f
458,345,041 *2E8BCC9D407A4EE7289DB39F0DB5F3E18EDDA7C6 HOUSESTHE
458,345,042 *2E808454FDB4F6586394876BD01182D272CF790A HRWZ0MMXE3
458,345,043 *2E8928676A00AF2ADB7C1FCEEF3BB1FDA962ABD8 spartisse
458,345,044 *2E89514293F3E1AEAA71E41DFF131ACD2E0CCDB7 SPILZUCHTIGE8
458,345,045 *2E8A2852260CD6BF81AA9D535FE1B25F52205C7B humbertoribsamen
458,345,046 *2E806D707A3DCEC503E41E417312E6E431F71071 SPLAT-~`[email protected]#P
458,345,047 *2E8029D7747E2086BBEFB36ECD91923184083B02 hxnn
458,345,048 *2E8B992F44C8C3F6B4230715605DC2DCEFFAB2B8 SPORTSWOM3N
458,345,049 *2E876676C4E09A80AA3794D3FCBA4E038BE11C85 [email protected]
458,345,050 *2E8C313F32A2AE59E774E7A133A5EC49109A3E8A ST160JOHNS
458,345,051 *2E81AAEA3756F044D59B8A455EA235D571DF893A STANDARDFALLNA
458,345,052 *2E897EC52FCC5C6C4879C952608008D06FE27840 statesofdeception
458,345,053 *2E815939FCB6ADA0C72C6FAD957A23D749A92D0B ikarokse4
458,345,054 *2E8EA8C2C0C41118A6DE58D1F0B8B3E37DEF160F ILOVESUZUKI2007
458,345,055 *2E85A4C1C1C4B0A57A7F73B91261777B5C7BA15E ilovevalentine43
458,345,056 *2E804EE9A46E60A801F1E59C7B3865ABBD8EC3CB INCREDIBLY=
458,345,057 *2E80AA6315B8C769D54C9EF2163FCA3DCF5CBE02 INERINGAED
458,345,058 *2E832541642B65BBBB4DD399597D4A2995316342 SUZUKIPLAYBOY0
458,345,059 *2E85C4128AA245084F8581FA2825B9CB11D8260B INTERNATIONALCLEMENG
458,345,060 *2E8ABB4D22FF5E11394CAEC66BD6CFC067195773 [email protected]
458,345,061 *2E84749101A85CF528E5EFF394F3513B3DBC6AC3 [email protected]
458,345,062 *2E8AD0255543A4EF5A0A58961827711CCAFE85DD SYDNEYSUNBIRD9
458,345,063 *2E8E96E1F648167951E6EBFECE7299461495597C ir~b
458,345,064 *2E82A9893F07623985DB109394338ED79E2DD123 IRMAMARRERO
458,345,065 *2E8810D5AB317917A7D17F21A92DD83FEFBF42B9 taanachas
458,345,066 *2E8A4CF0A3B2607AC30C3F6F43AFBBA2660CC0B2 ISSAC.KREUZIGER
458,345,067 *2E87283CB074919A690C1A98EA2D7A60A671A2AC takesha.ellis
458,345,068 *2E8EC5E6A4671BFFAABA87019BCB4AC52D04172D TALK8720219211
458,345,069 *2E806471853C25A8F39B1BF27F099EB8F7374F30 talkdragonridermast
458,345,070 *2E80C268C0BA7AA67FE48ECE00CD22364D4547BB TALKFAUSTEENA
458,345,071 *2E8E9CE5951F8BD3B3EF1C4D4D9EBB7EB2E64F4E JACOB.FIGLEY
458,345,072 *2E8DA4E9B1015B4707523C51072120B666DC6A74 JAKE.VERDOORN
458,345,073 *2E85D036CBCDF587D129355DB73171783F8A3D1C TARZANBASIL6
458,345,074 *2E8DABC1E06AB05C92396BC54AB8334385AD2F1C TAYLORDEISHER
458,345,075 *2E860A89D4380C949DB364484C5F02AB7ED0F31C jameltoothman
458,345,076 *2E817542ACF740379FE67DB00E6CEADB2945BC5B teddybut
458,345,077 *2E8849DD79726FACB3DF522C798AEC30907C42A2 JARODKARGER
458,345,078 *2E870D7CC5A90C8B428CB4858AAA7283F5C782D1 [email protected]
458,345,079 *2E84D8DE6C377C16660729C94D35ACBB6C0443E4 JASON BEVERIDGE
458,345,080 *2E8CFA3543EF4D63987F3AD2C16FD41148ECAACE JASPERVAZQUES
458,345,081 *2E8F40F21F0B7FF2AA25D7216E19A3710AD78AFA JAUMESON
458,345,082 *2E8E67B4FF9D47FA6AF12C25F920A54A239D7C36 terugmarcheert!
458,345,083 *2E8DF7F5C54C335889D75CAA0415588A82254CF8 JDEVROOME
458,345,084 *2E8D113FFE1A36F73623068AADF9438C3D1AF1B6 THAD.MAHANEY
458,345,085 *2E8BBEEC04C5A63D38F0ED63E5FFE9CD003DE7A1 THATHARRIS49
458,345,086 *2E83D14FD2DF17F79F42ED48BCCC7A1A4586774B The.Boy's.Theme.1
458,345,087 *2E854ED3C4AE9714A98149A490BD77D5D2D23587 JERRELL.PIERMONT
458,345,088 *2E8F2B068349CC0E43CCBAC16110FE6E5A334BE7 thecscstd00183givesthefollowingastheaccountability
458,345,089 *2E8444AA492D3ACD7DFBF482B30D5C016D69EC6F THEJENSEN1988
458,345,090 *2E89DD2606173301213097C5DB73A3C280A0167A [email protected]
458,345,091 *2E863BE939B5EF7A98E60C5F1A16780E44204CD4 [email protected]
458,345,092 *2E898733C30C134A0327C44F0053006285EF306F the.redneck.riviera
458,345,093 *2E816922E4781F1DB8D3CC90322C5661B25B00ED thermogram1
458,345,094 *2E889FCA3548AEFB61AC11136C186AB68030922B the-scorch
458,345,095 *2E89EC56694AEF098EDB6AF25447035F159FDB1F JOANA MAE BERNARDO
458,345,096 *2E81837C76E250302ADCD049329192A5B7694AD0 joaquinbrummet
458,345,097 *2E83F25F725109DF896B0795297D18523776B70D JoelGibb
458,345,098 *2E877EE1F9EF0E993C1A04DCC2378CC59FE7E9AC JOHNATHONTURRENTINE
458,345,099 *2E891D19DBADD39E33CFCA794459D5FEF3B949C2 john.mentges
458,345,100 *2E8C9DBB4E478C33D235983BE3D950A0CE8E52FB THUNDERBNIKI0
458,345,101 *2E822071902523AE7EC5F4FE6CD678021A56E7CE JONATHON.ETH
458,345,102 *2E8B9F3B93A18EDC0E742185CBBAD777DC63516D tinycow
458,345,103 *2E84D00BA415D9AA0CF321A2B7F2F36173E8B9C0 TOBY.SCHWEIM
458,345,104 *2E827071BA255C00F00A3A5922C70FFC3AB2E90E JRDERF:CHUCK
458,345,105 *2E88EA6C94128A79141165D267CBE0B6F420F153 juddtaylor
458,345,106 *2E80A8427FB2F313AADD1E254A3E5E086D31807E TOMMY.KRIKORIAN
458,345,107 *2E8AD3F374ACCCD6738D93824277A88F4933B02C TOMMY.THEISS
458,345,108 *2E8D2A4DBD89BB1C7C328CFBA63D5842BC835C86 TONIA STEVENSON
458,345,109 *2E835D80F9C91CE9646B8B8A909F113FFC4E66AC juliofrom
458,345,110 *2E8A8BACC1725DDFC4C7A2F1E62B38A8333C956E juliomcmonagle
458,345,111 *2E85CC1D840CF57351608720A85B10E6DB1865E2 tony-tiller
458,345,112 *2E8F0420FF1E4A4B51D07BC75A0F390BE449CF1C [email protected]
458,345,113 *2E83C8D73E5205A9A9EBE40ADA874DE7E701383C justgiveupthebadness
458,345,114 *2E869120118A04E4D00240FF448F94477CD9206C tracy.pacle
458,345,115 *2E882CA377C307DEC6F3472C2BD625CE9EB1BE17 kahashi1
458,345,116 *2E835EBFE52077216F556BD950B88BB9244A5CAC trentonatherton
458,345,117 *2E84338A60D7AC3F81ACAF2804F22191738AA0E9 KARINGA0
458,345,118 *2E802C7A3F410E8ECFB0F5A638EC567E66CCFA31 TROY.OHANIAN
458,345,119 *2E83DFCA8F42B7DD0CC2451BAEB1BEEBA320D665 trustdagod
458,345,120 *2E88833154151360BE76FEBC21794980247C34BE [email protected]
458,345,121 *2E84D18F047F640216042F539871706178403644 TUNGHRHEDEN3
458,345,122 *2E8726ABD5068AD58BF1EBAF96DC5C90C1D75C8B kellyschlecht
458,345,123 *2E8906E8326483CC3FBEBF92CBCBF19E74883107 KENDRICKHEFFELFINGER
458,345,124 *2E8470A8650E7BC45EC797EABF42C3D7C121774D KENNY GRIGSBY
458,345,125 *2E879EF6C65F044378207AE9299D86225854B76F KENNY.LAPADULA
458,345,126 *2E885D45A0A33B8364F5FA44FADA305FF0101232 twinging7
458,345,127 *2E899E0A58DF20CB9284D623444C33435B987533 TYJUBERT
458,345,128 *2E8E8C5C6A8F0D286337381BD484683AF5EC6443 TYSONHERMENAU
458,345,129 *2E8B258F716FF4B44B40F29133DB96FC7570B1C6 KILLORBEKILLED(FEAT.P.R.TERRORIST)
458,345,130 *2E855293A156F9BCA8406D969501AE0E1929914A kim.daughtry
458,345,131 *2E8C28AD32A7A41BF4FBEB87010144BF2CF24D74 u$ea
458,345,132 *2E871641B073F2C6E964A5D550A12440DA51FE5B klutziest5
458,345,133 *2E8BFD7D8A51007FB6021DE8CDE3E1ECFF966B9E knngswtr3
458,345,134 *2E8E1C029172B361898671DB4B04028D96D044A8 Unlike-(Reaktor-version)
458,345,135 *2E8C1A459332CE2AE39DD9419C7151E3413DF3E7 KORDONEM6
458,345,136 *2E821739737AF365702BCEA235B035157F386937 UNMYTHOLOGICAL5
458,345,137 *2E831706CA97591C4C8D2E192206D7193D554850 KRISTINA RANDALL
458,345,138 *2E8FBE0F61F93AFFE5BB35875A120344E8E45882 KRISTOPHERSLAUGH
458,345,139 *2E899008710A24EBFCE24587DD93C423AB8D46B8 KRONENSICHERUNGEN
458,345,140 *2E82F7926A23BC7C30214986A82FF73B443023E0 urban-etter
458,345,141 *2E831FDEC42C9D7F449CCE57F03ECE4B7204FBE4 KÜLMIKPOOLHAAGISTE
458,345,142 *2E8C18CDBE8D38394CAC863A96248400E9FA04E6 LA HOCHE
458,345,143 *2E827169ED0A5D54D93045F0D9FDBB57D0198308 [email protected]
458,345,144 *2E8938EF7E7B8FA0D7CDA7E0DC7C31DFFF958C1F lamontcapitano
458,345,145 *2E892A6B113ACA7DC00953CAFC7C5AB59E89BA25 LANCE.BLUE
458,345,146 *2E8A47489182647636633A9E186508256E1096BF valalbrashi
458,345,147 *2E8B04ACAB89F006DF8820DD181ED583D71C2D4A LAPDOOGA
458,345,148 *2E8A04C67FC38A5206EE33882415F866B6E308F0 valentinezeigler
458,345,149 *2E8C90CC3DF78B10875E73B7FB2E5A7850615A62 valeriealerte
458,345,150 *2E8CCE9F5423D5EDDAE95613ACAF9E133994AF87 LAWERENCECORAY
458,345,151 *2E84537851CC38432E40FFA1F359CF23E5AA3524 LB^?
458,345,152 *2E8ABB8684C680CDDB7552D3C7BF608E1397E4FA [email protected]
458,345,153 *2E84C769D63C1CBFFFCF83FB98B9FCA0D1F964C8 VASILISCHLOROKOSTAS
458,345,154 *2E821BCCC12165FD87407D64220FB97D272068F1 LEMUELVEVERKA
458,345,155 *2E83E597E4D0EB5557F0C7428CA21229D81BB5E0 lenbiven
458,345,156 *2E8A7EAA24AFC75C1ECA7497D123567A0D6EE6AB [email protected]
458,345,157 *2E8C2629F718DBB001F5D76654DB72DF2E76E689 LEONARDE0
458,345,158 *2E8BBB854A7483D2AE2949A1801B7BE87A342796 LEONARDO.COSTANTINI
458,345,159 *2E8C319490765DEF8E34BBD0950B8AB40B32CBB5 VIC.LEO.DEDIOS
458,345,160 *2E8C1B1A0CB2F2ECD2705D80C4325CEC6378CC44 [email protected]NETCOM
458,345,161 *2E8DE0951A07AE48C6DE26942DF0B447CEA40D0B [email protected]
458,345,162 *2E8A7CA5B05852470B3608CA5692B214C38D11CD LIAT LAPID
458,345,163 *2E821DCBC092E1A350FD2046A29930787B428C69 VLESNUDENING
458,345,164 *2E8C15B09B439DA565618386685FAD31495D1F5A vnwaffug
458,345,165 *2E8D9160B0FBD00E0F03F3A54776CC73BC848847 [email protected]
458,345,166 *2E80051164271D6B24044E7383EAF77C74B8309C [email protected]
458,345,167 *2E8329BB084B94F23E9AD8D58772E80593C5A7F8 LITTLE LOVERS(1)(2)
458,345,168 *2E8ED9F5B93DE04DF1DEF55551B32CAE9DCDECF4 wallaz.oliveira
458,345,169 *2E8E626BA33463771B62584D5D4DCB3C3ADCFAB4 [email protected]
458,345,170 *2E8BD52A94DAFC985317036389BCEAF6EFDAED24 ln2d
458,345,171 *2E85A3F5C6EE4B8C377B72D0802D19485FA5BF30 waysofgiving
458,345,172 *2E8325E6774C3EC17D993A5F70BD222474948EA2 [email protected]
458,345,173 *2E8F9C57BCD4CEF179FEE56C24038792594A95AB [email protected]
458,345,174 *2E8DB1313071DD617F7D2D4F1C3C6E1007D38741 LQLK0C
458,345,175 *2E87AB30D69B23A27FB4D2775813367C43B48811 lsx5
458,345,176 *2E877C06DB8584410E4DB75D97ACF290F45B0501 LUCIEN.BOGGS
458,345,177 *2E8CFD4BC24A39544D41CA51A2BB5D48DA8FAF27 LUCIEN.GIONEST
458,345,178 *2E8236D3C578F60B00FE9B15541016C28B26A419 [email protected]
458,345,179 *2E83B9C55BCF95370D2E53442B746EE00A6AA876 wernermusi
458,345,180 *2E8A85E7F2F9C0C19E4B92E65426D3F089B4E988 LVWGAA
458,345,181 *2E81DB3358833180BC6171EE2110831B11D42981 LWEDDEN
458,345,182 *2E8D4BE0E689A9F5D373E35320CCDB0D4341DFCB WH171N9$
458,345,183 *2E8215705770D5F5B88CE0EE09EA517E61332585 LYMAN.BARTROP
458,345,184 *2E8AE8DA53D17AE56C9B2237B3235E8E010A4551 LYNNFINNEL
458,345,185 *2E8A7C6F2D4E11D5452E36F787F3591E6045A574 whitneylakers
458,345,186 *2E8E314AFE1017E54AAC6A4C693D5E5C41688237 MAC.DRUE
458,345,187 *2E86C7D08863AAECFA16A1AB85DD969D8677606B [email protected]
458,345,188 *2E8315C9241A141D68030A1688623FE64E674847 machine.action
458,345,189 *2E8CB7F27A83E36B815EFEAEE522BE95075976D9 willardcaroline
458,345,190 *2E82A189A1576049D8244D739BBB044AF76DFC96 willbukrim
458,345,191 *2E86AD2CB55014A25292A242F3DB26E4494022FF WILLIAMS.GOWLER
458,345,192 *2E81D20E130F959ABBDB71E4063F102C78DF34B4 MAGASUGRÓVERSENYEKET
458,345,193 *2E84F1F9710C26E28306136B0C6C271736DD0D80 magazzin7
458,345,194 *2E8308CB07A812E77E53DBC1B07AA51C4650B854 wilmeremrich
458,345,195 *2E85F4731E42498A03B76A46DA29686780E644DD maistured
458,345,196 *2E8F7C1EDDBBE97CC59CBF48EC312CC35214F043 MAKARTURO
458,345,197 *2E85B827425DB942E542ED59DDAF0D71D00DC8B7 MARB1E1ZA710N
458,345,198 *2E84FAE6AFCAB007B3A91996D09EE2D7621AA50D MARCELOLOSSMAN
458,345,199 *2E879E5C2B9BC8825FC38D543E85F61B8689D92C [email protected]
458,345,200 *2E890E67AE30943953DD41EA7CAC2146C11EB8DA MARIETERAN
458,345,201 *2E86A6000BA86CEB518DB288DA6C6E05797E9A01 [email protected]
458,345,202 *2E80425170F984596543C6A0BD0C4E5C31EE8B2B MARILYN.GORDEN
458,345,203 *2E80E99C771693B3CCF1B84A986E58BC2BE1DCC6 marissapiencenaves
458,345,204 *2E8B4B5A0F62060EFE8AD5C953D62729BD9FD88F WWW.APPLIED-ONTOLOGY.ORG
458,345,205 *2E8B8AE93661FA566DDAD31A92FC48D094CCAED4 wwwassumptionus
458,345,206 *2E8B00BA3B268E560D9E6620BAE6DC698B538292 www.cityscapeindia.com
458,345,207 *2E854508FAAA3AE1D75759484ED74F331B53A09A wwwphonetikunimuenchende
458,345,208 *2E8F605AE5857F809E8C6AD944A0EE37955769D3 wwwtennisorgil
458,345,209 *2E8AD89003218AB1F944031A25957F5EF26224B5 [email protected]
458,345,210 *2E8BD715B8AFA4C69C4258B0734B56EF531FF337 WYKRĘCENIEM
458,345,211 *2E8BBA4C02C237FF907D50380AF733604CBAA9AE wyrigan5
458,345,212 *2E815B3CE949FFDE57AB0357DC8AF75B36E82A10 [email protected]
458,345,213 *2E81AA3804E226272AEECF742F16243A4A069E01 [email protected]
458,345,214 *2E8B33ADEA0E83684B7B3F5955A49ED56529B229 X$ED
458,345,215 *2E8B15C356829C2C39929307013267CEDEC824B0 xgygfvj436
458,345,216 *2E8CE0D94EE0E866D8C7111A9B43A6F04227A2D5 MATTOROBONA
458,345,217 *2E82341F4299DB3FE91D3748DC4520D34AE27F6A MATTY799
458,345,218 *2E8191DDFAE9D53F5A45EFC76F0E9A61A1FC4448 MAUROROZANSKI
458,345,219 *2E8A1E66797FE30007EA595D258E494BFF09007B XO*}
458,345,220 *2E8BC7A623359890EA1F9E266D6AAF8CDB7D427C XZYARION RENAE HOUSTON
458,345,221 *2E85B318B75CCC0B2D0E732163411D684B686107 Y593545409
458,345,222 *2E8E146E8C2B559A7D65869391C3F0C1514F2067 yahir844
458,345,223 *2E80BD1D47D8B02B01099049DA332C82C1368F37 MD-MODASSIR
458,345,224 *2E885F20D306D29B095F7EA94E94D07BA115BE07 yasankh
458,345,225 *2E86B7D2E97A91B9982267386E47A62D91E04DD4 MEOWNICARAO
458,345,226 *2E848F0754B82B2077D19FEC6F8B50DA0B13836C meridians6
458,345,227 *2E8716B49ABCD68BE2FBB8D484F180C003AEAB99 $ye
458,345,228 *2E894925868C328BD0E884FC689639E3BECA411D YELLOWFLIPPER
458,345,229 *2E8273BA975C5CA11041C695080D7535CF6EC7B6 YJGHUIGJKT
458,345,230 *2E8E586EA595416FDE01C61B847D13C7B5031415 YORBI.RODRIGUEZ
458,345,231 *2E870AEFB2F689CD8597241155AB3742C4E9970D you-areme
458,345,232 *2E82766EA986E4B6D95F8B656503C87623AE9BE2 MILTONDIDIER
458,345,233 *2E81CE03357B3E0B79237E84769B65710F90AC51 mimin
458,345,234 *2E8EF2CC6671B9049D0CD3B9839151285D5A9B2B YVONNEBASFING
458,345,235 *2E8E5740B0FCC01B054BBE97A4618BF1C1B6AF32 YVONNE-MCGREEVEY-SCRIVENER
458,345,236 *2E8D17E6CBF0E81593A19FA17425A555043D351C mississippi12
458,345,237 *2E89E27FC37055E98800A54332456D17BE1F2B15 zazee
458,345,238 *2E8860361CE4D440D699172AC2189FA5F35446D2 mono-silverlight-implementation-emerges-after-epic-hackathon
458,345,239 *2E86701E73F81CBFF030891B9D07BB7C47BA38EA [email protected]
458,345,240 *2E8979D8B879D6A38BB65BA7C28B743315058B52 MORRIS.ARNTZ
458,345,241 *2E8DD22938A7939D89CFBE8AA6D6EB95AFA334E7 zhdx
458,345,242 *2E85D09484AD6470FFFF4937AB8FF79867B3DDEC MOVIN' & SHAKIN'
458,345,243 *2E8CD664D20A1C8873F8197138E459871B25BEA9 [email protected]
458,345,244 *2E8C7B2B446F040BA66AEE236733DA13C98EF5D6 multilingüísmo
458,345,245 *2E800019F2F385E17209BD10817294788593AFD8 ZSJV
458,345,246 *2E80E0C424E0D289C753EDAB0CA44958496A2542 myevelyn06
458,345,247 *2E8E97C50E3CC6279806CC29EE90F38E91D34BB0 «євпатій
458,345,248 *2E81E99556994E1BD1F7ABF46515DAA6DE88134D ne-lakni-(egyed
458,345,249 *2E8BCF91EB0D2374663ACD61880B0F2EFE8498F9 РОСЛАВЛЕВЫМ
458,345,250 *2E8D7D83538C77B0B759DB892364058E302FCD49 СІЛЬМАРІЛІОНУ
458,345,251 *2E82573C82E0104C52D45D36B0E1429519A3EC96 neutronforce
458,345,252 *2E84D6CCE43EC9F832D16BEC49F645E6779E22DA  буницким
458,345,253 *2E8A27EA5CE2335B0752FFCD8F620023F45848EC NOBILES0
458,345,254 *2E8512B6A8191B9433D97614E7CF7C8E4378D1FA noesutfin
458,345,255 *2E8C8B048091117020BFD0D9590DFFFA77BD25D7 NOLANBROMMER
458,345,256 *2E8A46BEB36CBD3AE48FB508EDE7D05895886A16 norþhumberlandes
458,345,257 *2E88B23E36CA17AC4606284573513C81C4A1D663 NOSERAG9
458,345,258 *2E8899D19D5D0F7DA5B4FECAD76B4CF5D4D4BC39 NUC'''UL'''AR
458,345,259 *2E881907F14E0666FC454D41178779EDCCFC7332 ontgrendeldens
458,345,260 *2E89E3C5CAB18EDC015266553ABBBA88774CCA0F ORHAN-ALTUNKAYA
458,345,261 *2E8A52F3C0722D58078B4A13B908F133FB63A85B ORSNI
458,345,262 *2E883AA1AEA862383F7EADB4A8F6D8F7786193DF OUGHTED
458,345,263 *2E80FFD429F23A98700FF880F70D13C793E364A6 0ILUVMIRACLE3
458,345,264 *2E8EBB16D4CBE1A70B2609F1A16C44D57F31307C 0nancy
458,345,265 *2E8739A86F809821B660904D2D5A683AE8A03721 10MAR1249
458,345,266 *2E86D8B28602BE07B3782CE4EE3D78F79A57FCF4 PARIS.RANSBERGER
458,345,267 *2E8110A46626EB200E630E7D5EC4AE5B8CAFFF55 PARKER-WATSON
458,345,268 *2E8A488EFA86B8D9CC2AA51784AF2908593FB6EC PAULKIBBEE
458,345,269 *2E8C3AAA0FCF347277AD26E0873CAD21C2F84947 p=====B.`~.)X(
458,345,270 *2E82165F2B554F8C6A4EA02EECD77D96073727EC 13M線
458,345,271 *2E8DECC61086D6871DF2B93A70F40F0F0DAE283C PEEING:MEMBER
458,345,272 *2E851AC25F96CD9D537821F335BB8E3DEBDFC74C pen+adac+y11sm
458,345,273 *2E85ACEA5161FA49CC7F2BC5E253D8C0AB08A63C 18september1951
458,345,274 *2E895F49717ED19A04F725845FF7CE27235EE10D PHILLIP.COWEN
458,345,275 *2E883860E533700DF188FCE606BBD48471332174 1-alCakCasina
458,345,276 *2E85F8EE350E5EC436DEC2A76916D8FF2B4A8A37 1ALMAROS
458,345,277 *2E89A3A9BC6D46BB275DD584AD9515A3060F6A6C pierredalitz
458,345,278 *2E875956777B47381D8ABD66216E1132D828295E pierregardener
458,345,279 *2E8DD88913D3CEFD0F1F993B3AF296868D2D773B 1-COFFEE-TOFFEE
458,345,280 *2E8D877B16911E89CDFEDC2659CA7F2B2443BF94 1cUrretkar
458,345,281 *2E8A8C0D62666AB90DF3AB9B7F518CBE9D20BC2D $PIG0T J0
458,345,282 *2E8EE62EC59E1BDABACB7C92A716FBC8C6515570 pixyses4
458,345,283 *2E8701C3BE8467841F44A43526B67C9101AB87A9 PLOONBOY
458,345,284 *2E83CBBF872EF109B7F58A2DC4BB294E0D5434EC 1lebensperspektivische
458,345,285 *2E8AA05B703C5C786FE754E4B80FD2EB73A5DAF1 PODOZAMI7
458,345,286 *2E8ECC5CE7BB401CFD878980B05E659C8B624537 ponparda
458,345,287 *2E895D1A1F6D8C626C6EB0C1A34579B586C37A1E POORCAT1
458,345,288 *2E855DE796C818741C60D69722E7BA341C46E50A 1.MIRAC'DA
458,345,289 *2E8485B62EA14A0DD7D367FA97EEA67FC5448EB6 postarthroscopic
458,345,290 *2E834F5938C6D2EB02B3CE74FB0EF11D00ED0D0B P##P~O(_0)
458,345,291 *2E8C8662610F10AB95C1D909DBCF48AFED9F3E1E p===p~.`splat!!
458,345,292 *2E8A7897EB8EBA340CFD3A99644A04CED66FD8B4 prerem
458,345,293 *2E802021ABC74E276E305F8A036AC2F97228898D 1 STASISTATISTIKEN
458,345,294 *2E83050EE502F10106AD9E024E3D314F1C866C1A PRIVATPOSTGRÜNDER
458,345,295 *2E874E66AE8BF635C3112F76D5CC6E49983DDB9C 1-togehter
458,345,296 *2E8EC9D13CB8E58CFFF09EC9E461086DB5326EAB 1UGRZASC
458,345,297 *2E854B31522AC841ABDE040961B31D9F70A9FE7E 1UNG4M1N1
458,345,298 *2E86A2C6C9F083F3C6381C51053D7DBF44B76875 1 valtios
458,345,299 *2E8EF8F0C2DBADC6388D0F5EF3DDB54C5493050D Punishmentisjusticefortheunjust.
458,345,300 *2E811B4C1D47977B258701462E42295CE9449450 puppup1
458,345,301 *2E81DF89C38C90FC685DDCD963A2D1D4A9B51554 2125604 lahden radio- ja tv-museo ostaa ajoneuvokokoelmiensa s
458,345,302 *2E82F6DAAD5FC5A753F9B07D58C5C0A4068A7C05 231912 thenewcomer,mcdonald's,jumpedfrom16thplace.
458,345,303 *2E8A3A9352FD7AAC92E86C6849CB53BD701315BC 2328516 KURSSILLA-OVAT-ESILL
458,345,304 *2E8E215FE3FB30B65A0A5F8D2587499D218682C5 2433727 otoksen suuren m
458,345,305 *2E8E10C3C988F46998C843157F66E0A3AA64B586 QR2U
458,345,306 *2E890BFCA51AE7A08ED4A5AF2922BEA500983ACE QUINN.LILE
458,345,307 *2E8E2E2070B607F8961A90AD03D31F2F53B99A07 [email protected]
458,345,308 *2E88382636CC195CA3DBB0CA39E74D5D20991B21 25630 MITENT
458,345,309 *2E853CA585E1181847900DD0EB8560973E9F4706 QXXADEES
458,345,310 *2E8CB243BAE6DA33D98DBCDA44CCFDD1A2275A51 R3}/
458,345,311 *2E86B90BE2B265986D9F48D3045160116952AA7C R4MON4SOIMU
458,345,312 *2E8B9A75D8921E27144650F0CD5E8EA9814F5FF2 2822257 ZUSCHAUER-:-7500-
458,345,313 *2E8177C8093EF5A879C13C5ABD1A015E75E5A0D5 2984334 ASIA KIIKASTAA SIIT
458,345,314 *2E86A6A5FA1FD716354479837664F6B870872A15 [email protected]#
458,345,315 *2E889B3046B7E370CB4AA8F6A9C007FDE8AD7121 RASIKAYATAWARA
458,345,316 *2E8863E6ED5206C8F2BDBEFC0BAFA625A2E2CBB5 rayfordleps
458,345,317 *2E8CF37C3EA6D2730AFFD729C935A60357370CCC RAYMONDMEDINO
458,345,318 *2E896A9F1B22110CD44E0157E818617E4F5CF2D7 2TWINBITCH
458,345,319 *2E82E57E89866B58A6E26F3674AC59A5FE169A2C 302acid0005
458,345,320 *2E8D3C4393E256256869AF9F69B362C025977D1C REMIX.TO.IGNITION
458,345,321 *2E88D72145A1336EFF16DD687BE4430DFA563FA2 RENE.FULHAM
458,345,322 *2E8BC7D4A92575CEDCFB36F0185269FD193AC77E 3LONGBARRELLED
458,345,323 *2E8E8D7F09FCF47C0A58132609C30DCF552D3C64 re!nstallat!on
458,345,324 *2E8079349528A98C1D079920E916D9F3E51E8DF1 REPEMINEN0
458,345,325 *2E88F1A89072D6CF97C1C94D3D5E99653CDC136E REPPOTSD5
458,345,326 *2E8A3CE766269AD1F4748DAACDF42C5745DB13BC REPROWIDBSWED
458,345,327 *2E863EC9362ED4D58742512718B0E437611C6249 3p.~0.~o(o_)
458,345,328 *2E84A17B0DA948CB38AB834EB26641C510615FE9 3TABULERING
458,345,329 *2E8511AB09C425988C16B441346479F8EB4A5676 Restoring.The.Years
458,345,330 *2E8FAB1BFDDFE4DFE20DAB76386270895B3423D6 3-varaudu
458,345,331 *2E88875A0459E693C7822E045DA73C282C04AAA4 3+YM0L0G135
458,345,332 *2E80F0652DBF1D4E392ADA81A2831F1D80C921F4 422830 HZMUHAMMEDIRAK'LASAVASINMIDEDI?
458,345,333 *2E82AA0AC491F7D81B36CFA8CD350A1E5A463400 452258 makeavoittojamakeapistemeille!
458,345,334 *2E8D42C5F285724B75D4EA7CC060518390A1FD86 REYESGILKISON
458,345,335 *2E80248615C0478D64FA3D5CA54BC3C3AF5FD000 486446 NOIN25%:LLAS
458,345,336 *2E80BD48400044A6CD4BAA7BDEDD47C9239377FF RHT-PEED
458,345,337 *2E8C8543C2D957F39A4887C1F5B6F816E6CB38D3 RIBE-BREVET
458,345,338 *2E8158EA4146B8341C492947EE33202F1B1F1D65 4FRAWARLY
458,345,339 *2E84E212A1F2D70CA0A3DE7B019FE40D4B8F3CE6 4 GRUNDSCHUL-LESE-UNTERSUCHUNG
458,345,340 *2E85FA749ED8BE78F8724F4CE42632E08FA54A67 RICKYKIRCHHERR
458,345,341 *2E8A39B0C105BB4CFA02C364289A7AE047A1B923 4HARVEYENERGY
458,345,342 *2E85B27713FB2A496759C3676119C52979FF27C5 RICO.STOUTE
458,345,343 *2E8EAA930E61B6F1C23933C45601FD5DC79741E3 RI-DAIBU
458,345,344 *2E86A1EE3DDE8D6645C978ABB267F323A0A34EBA 4ilovenoriko3
458,345,345 *2E8E94F08DC283580C6096385584E36DC6111C58 riza.rahmalia
458,345,346 *2E8487DC1278F945D582FA676074545846F616EA RKCID
458,345,347 *2E8100C808CF7F7D29F319BBDF95065F01103BD0 RKSPRINTERENS4
458,345,348 *2E81567A33CD6C3DB92ECA85CF6AF94AFD3AD0AB [email protected]!3$
458,345,349 *2E8A4CAB396058FB8D5509A3DEFE59B9439EFFEB 4-P
458,345,350 *2E813D4C15F67F8E4C573A9880F4192CA95B21A3 4RASCALSTARGATE
458,345,351 *2E88700B26AF46C0FCD1352ED5A621D0A1E522F5 ROBERT.SLIFER
458,345,352 *2E8CFC7354E18EAB2076ECE60F53D09B556D448C ROBKARELLA
458,345,353 *2E814069532CD35144B2FAB6D542C446AF4646E6 ROBREDLIN
458,345,354 *2E88F1D3C2506B3979EC69D956591033818C94A6 4.tillanderin
458,345,355 *2E8B4CAAF5249FA015F7A25F91F858F6D130248F 4-TUNEL
458,345,356 *2E809B042944D14E8D4D96744B124BAF0F1B7B8D ROLAND.POLITIS
458,345,357 *2E87EB5AE919A9668469C6433EF0008DC0033FFC 540907 linjaus-on-liian-yleinen-
458,345,358 *2E838976BF81B0436E8411824A47F42E37D4D33C 5: 5 # & SUPERVENE
458,345,359 *2E8D3F003FDE44906C1A8106C9C9D0597CFBB058 ROMEO.GARLOVSKY
458,345,360 *2E8907EF4DD346E1A8354F18511A3603A4183C12 ronald.haines
458,345,361 *2E869E6475A196C9A34B2BAC4DBC712CE455588D [email protected]
458,345,362 *2E8F89E4FB4FF2797CE1DE90E608FB758DB354FF 5BSWUPOURGOSBSW
458,345,363 *2E835854B1DCC900A03CB31168C5970274FF06D3 5CNSGNRNT
458,345,364 *2E8FE45EFA950AE4AAABEFACFF81E1AE4E03A6A4 5COMPLETIONCLEAN
458,345,365 *2E895CD53F36E4316D1156FBF9F0AC5F5477532E RÖTUŞLAMAK
458,345,366 *2E8BAE5FA2400DA64F80FAE38C5151B9DA2A0B65 ROY.REINARD
458,345,367 *2E84A6BD8BDDD4C442670631BEBBC6B779819397 RTIZTIK
458,345,368 *2E8F295504A4279AAC4D4D19EF96729E76E412EE rudolphmeuse
458,345,369 *2E81A536809A2D45C53C3269D29FFDFFB047B007 rulleskøjterne
458,345,370 *2E87B5178AC40D17BC1163BA6A25649D3C245AAE RUSSEL.KILLER
458,345,371 *2E8942D5390A0309B2C51F7BB092E27C0A726EE2 RUSSELLCARREIRA
458,345,372 *2E8E75CFCB2E97E5C70DE84E163E77A9268E58D2 RUSS.OUTWATER
458,345,373 *2E8D6D0E01709C04AAD6ECDFDE487E1E3D9ED8D8 5TILKOBLINGERN
458,345,374 *2E8584EDA887B29A03ED40779A9FDDA093794CD6 5TROUBLEPHOTO
458,345,375 *2E886460F7A5009ACD19553740DC6E5ECFD870D4 RYANJENNI
458,345,376 *2E8724A3E69626CC446DFE8C2C0B6FE27860D5C4 SAITEX
458,345,377 *2E8D8AAFD820AC1B39576E425F1371A48FE95E71 salvadorgilly
458,345,378 *2E8A6EAC0F0D04381BFB2FB97DFDD50D22CE9C09 6DYREPENSIONER
458,345,379 *2E8A2C26D9C6E8DCB15D22A21475E49F9E1528FA 6EATMEJSBACH
458,345,380 *2E84799E233F8E97C121174BC1BAC21850E7BDF6 6ilovegolfer5
458,345,381 *2E8A56587C82E7434BF9EE272B881D830D8CE9E1 savingly
458,345,382 *2E8637B94B5C305BB40C736E2B6758E180BA40EA SCHOOLLUCASING
458,345,383 *2E886C2275505EE7C856ACC9F4D87F3827A2CA37 6VERMELDENS
458,345,384 *2E88A69B9DE43CFCAEE9487DEABF1BF48B3CA207 SCHTICK
458,345,385 *2E8F738830DF35F5AD07B0C0E82F5DFF94924E52 73.puhelut
458,345,386 *2E8022DBC6FA2067FF1A8DFEBA6DB9479E0D9EEA scour5
458,345,387 *2E80B6462B3F85E33A0795E728E9E9DE64E184C1 7ACIBAICS
458,345,388 *2E89BE891B38E822EB45E9C149D61A696ACE81CF 7BSWPLATTSMOUTHBSW
458,345,389 *2E8C1C545BE042DA71E3D86B595C8178A3B25597 semi-readable
458,345,390 *2E8CBC849EC3D203C6E1E60750D0BB1F7D221BF6 SEP4R471NG
458,345,391 *2E8335D99F6C97A3DCC4618B3972B1A5AD458896 SEXIRTATIMI
458,345,392 *2E807F4A04345D2837BCEAF2E1A6F1DE41A2B455 SH3NSHA1
458,345,393 *2E8FD31DA703F000ACCFD1D2AC791223A732C6DB SHALOM1993
458,345,394 *2E87E8C0B783677757F65E79A1E75F32A2589EC0 [email protected]
458,345,395 *2E8B1A7997F03A5E192203952C63817572D779D0 7MODELYTS
458,345,396 *2E82F1CD1B7FB701FB34A6394EE351D554D5DBFE 7mysilver7
458,345,397 *2E8192D0A03B6219307A16B54A8F22B358A4CD6B 7ZIHXNJYTF
458,345,398 *2E806E059C2CA786688A979431CC60133137546F 888DEVIL
458,345,399 *2E803E20209188BB3340A04F4872AF3E2A9F0161 [email protected]
458,345,400 *2E81972E56AB41DB60AFFDF50044C2472BD10A89 shirleydonkey
458,345,401 *2E80BBDDFAC69395D0985E9E0D94729EF2CFF3A1 [email protected]
458,345,402 *2E879AA7C7CE921C393609F416F613B3AECABE56 8BVCRYPW
458,345,403 *2E82E18A2EFA69F78489D4A4862A07895B1E51BC SILVADINAMO1
458,345,404 *2E8C423D41C3A32CAA8706BFAD166CFE5D1943EF 8ERNOUHELNHO
458,345,405 *2E8C55D099DC18E4F101B787EC193A5FE682B33B 8MONOION
458,345,406 *2E8C4C7BCF498758E54FD792F2FC9242229E47B1 8NEJOLUUL
458,345,407 *2E83EE0D7FB7F863F7A931C9823FBFDB304BCDC3 SKATERMAN
458,345,408 *2E877FDFFDAEDC8070BF195CCA3AA8473456822A [email protected]
458,345,409 *2E80CBAD192F232239A32802E37BA6B55F766A0C „SMASH“
458,345,410 *2E85D7FC7FF4E12D3E851CDBD70B63240F5E121E SNIOTIS
458,345,411 *2E80B68D97C7B46A015CC2C33EDAE02D7FF99124 8TVAVASR
458,345,412 *2E8911A21B8D0A4ED0ABD78E516D5A2044D149F0 8WITWOULD
458,345,413 *2E8E0F6B5920564E876B9E72DDF02709A5846EA3 9459274murat
458,345,414 *2E882962AAA241D077F28E36831ABB114985C24E Someone2Love(DennisF.'sLonelymix)
458,345,415 *2E88FB1D5C7E4BC86105CDB9AF5FC4ED1BFF4344 SONGHAY-ANGLAIS-FRAN
458,345,416 *2E8BBFEE5BACA5C7FCC443082FF7C2B64D583F1C SOU MARKEE
458,345,417 *2E8E6BFD59311EA77D29B52B68D5AF3B6F40E8EE spanishlouis
458,345,418 *2E82593426AFEF5C31C88A9870BDD6C7645814BD speedreaction
458,345,419 *2E83CA47DAFBC6101D4F0EDCA5F5CB426A843293 SPERMATOPHOBING
458,345,420 *2E86C99142AFB2ABDB3FA53D3DD3FB7C2849B77A SPLAT!!~-~<==B
458,345,421 *2E8F1FC0D427BD06D84FFED7A8042D121B4F457F splat * q-----p
458,345,422 *2E85644BA8C48769A873A2260488ADACA96BC40E 9-seelendrama
458,345,423 *2E8C05D27D968745905E67DE8F8DF5A6013BA31B SRAWRATSCIREDERF
458,345,424 *2E8569CBEBE608BE8387FEBDCB520920B7440B63 9treckpot
458,345,425 *2E8AF43C381F8C30AC69F6BE13B0EB48E5D0FAFE 9VIORIST
458,345,426 *2E8AD4D183CA727F43A21AF7C62E5C1BD0A654AF 9ZOMBIEBOWLING
458,345,427 *2E888111E226B710127249DAA1ADF000B4F6EA91 A1?
458,345,428 *2E814651B4D78E55AB921DB31E6745CB7AAB564A a1?if
458,345,429 *2E8E83ED14CC6E0409C0A741A4DCE21A9BAE6A69 a+"23
458,345,430 *2E85673F6A93A8EC6E4132C20F88FD8DBB2348E9 a2lpn
458,345,431 *2E8856A2AAF52D44A468DFAEEEDB38C64AC48A3A A6.OB
458,345,432 *2E8B14BE22544C9D6C9A9A3496C58B0F0CD21C96 A9CU$
458,345,433 *2E832D373344E4976AE47FE226D699B5DD6CA0A0 stevenmontana
458,345,434 *2E80C6352D1A2A3A3915D96632C1E48FD1430EEB a-ap$
458,345,435 *2E8B47476EB8BF38EA925BAD240210A8D512913D aa't\
458,345,436 *2E8B6231513F368599F6505D0F41721C7EDEFD94 AB+*:
458,345,437 *2E8624FBA871271DAFC59D60F62631BFFF54DB70 abanneryear
458,345,438 *2E870754B81C0C748E7A8F52D66628A033A5A68E ACCO$+A+I
458,345,439 *2E874F58B040F7673E01DD9EDB5D7F72253BAE22 SUIMAMAS“
458,345,440 *2E87BA40B2FE35BA5CEB1A22F32CD9DB360C7E0B SUINGERS
458,345,441 *2E8DFCA46CFA92BACEB5A2B69F909AFF3ECDF520 AC_RA
458,345,442 *2E82B4DE664830E0CDC110B3F9A270EEE41712C9 SUNHULIAN
458,345,443 *2E819F8B5A5D02763A67BBFA7BEF7FF41F47A0C8 ac/)u
458,345,444 *2E8A011AB488CDE60224B7627E4573E937EE3830 [email protected]
458,345,445 *2E8A961C933E1B6A86508299B96E6B2A9CDC22EA a=?da
458,345,446 *2E833B7C966BDAEEFB527980F8DC354E55DC68EB SUPKIDDO1
458,345,447 *2E84BE6BCDC62CD49B5231114F353FDAAAD70D90 ADAM.GROSZ
458,345,448 *2E8A25C7EDFA7C8EE0F7FB8D77B01250BD13177F susan-anello
458,345,449 *2E8AC3CD2671FCA92435599F87025311EA23A447 SUSMITHA-CHOWDARY
458,345,450 *2E8432602B445275D45F561026BD4BE64B15299D ad):i
458,345,451 *2E8F89A2467F4B2A90DCEA80393DC5570759F9B8 sysercne
458,345,452 *2E840CCAEDEACFAB6A547261216FF85181BD4801 aff73
458,345,453 *2E8230DFC42106270FA3CAA76CADD791AFB8393C AFFT
458,345,454 *2E8AAE46B0017294F3A116F9EFCD4B55E70EF330 afyx)
458,345,455 *2E89B691B1D3FDFD3251A0A5497105F9C593FA20 [email protected]
458,345,456 *2E83D2F1DB0187A468B6C895A9EB86DE1A04F22F AHMADFEBRE
458,345,457 *2E8715C95ED1C316575CD783CF8A5624AFDFED7B AHMED-LOVE-STORY
458,345,458 *2E802238F54753CC6758F14E4CACA1857F089421 TAYLOR-BANDLER
458,345,459 *2E83782A859F09E073CDADFE374662DF277647E9 [email protected]
458,345,460 *2E8908A18F617EB368736F7F0A77F2D07E1C2BBF Te-Amo-De-Noche,-Te-Extra
458,345,461 *2E8547F5C7F85050542129480AE5731D93F8A245 airegor4
458,345,462 *2E80CB953A27CD7AF08C1FC5462BE6C4031B295A TEEMULLE2
458,345,463 *2E8C31E1DCE56346D5B75AC5277BFEE82D04582B A:J8V
458,345,464 *2E89B64DB7257FEE8C97EE036D8F4EAE0A2A0527 a;k:
458,345,465 *2E8FB57487F694B5E08326EE917BA46B03B2B944 TEO LAY CHENG
458,345,466 *2E8C48891E5957EFFA8607A39D32860BBFD51AA0 TERRENCE.RUMRILL
458,345,467 *2E86A9DC4E75BC66B386BF3044F77ACF00137AF3 ALANKAKANI
458,345,468 *2E8EA0B84DA2AE4C5423E5E4CD1A6C4696D2B2AB ALANSTICKLAND
458,345,469 *2E83458D5D5E1965301017712BE32E91DC816508 ALASKATARGET
458,345,470 *2E80A81423B436921BADCAD4653455EB5B81781D ALBERTTHONGCHANH
458,345,471 *2E81437D35A14B1C37AAD2993AAD86C7C0145C41 ALBOGEROM
458,345,472 *2E899C695DE23E9492F4221E3C4706F47E1625E1 ALEXDANYEL
458,345,473 *2E872918950C4EA6DAC7B59D5B25C164BCFF72FE THATALEX00
458,345,474 *2E874A2FB75B38F0512B69200FF0CF4C6CCB1A0A thebestpubjukebox...ever
458,345,475 *2E864A73A0A09FE7A3C9C78B9012479C7FAAE477 ALONZOLOETHEN
458,345,476 *2E8CD1598EFED72078412B6902E21E2729CBD1BB ALPHABETISER123
458,345,477 *2E8B2EAA530BDB735D106A3A6987FF459BE8DBF3 alphonsestampley
458,345,478 *2E8DC9CBA17986C092A760740A47EE3619DE372E ALPHONSOSEDORE
458,345,479 *2E89AFD8ABD34DDB28029E8DC90EDB97AC040E9B AL STODDART
458,345,480 *2E85F0BEFA92FC83ADCFDF44602AAD6B53610209 altonstinson
458,345,481 *2E8CD9D13685703C74EA52F32DD4B4D3F473FA8E ALVINSERINO
458,345,482 *2E86DD4DF626BE05B1F37E8A23D110A8C0F2F8FB a-lyr
458,345,483 *2E87A1E8CE3FFEC7191BF8C094F5509778D2CFB6 AMADACHAVARRIA
458,345,484 *2E8306AAB1C798444A9CF055F1DDE1B7FD7FDFA7 There-is-no-power-on-earth-that-can-undo-Pakistan
458,345,485 *2E8CB07CDD89EF7A7660629B9FB8B7AB3169175F american woman (single version)
458,345,486 *2E8E1C6810A4354ACD447F729493EAD65AD884D8 andreserviss
458,345,487 *2E895385A9830EE0C8CF0B0C24AD60338DA84EC3 timothyfendley
458,345,488 *2E85883F9621CFF8412F99C461EE963302743A4C TINTO’S
458,345,489 *2E8F8E256E6C2102D7A085300B1562A642724BDB TOTIILSI9
458,345,490 *2E8423535D787B8B5A6539E60AF35E76B76D3A01 ANTHONY-CALLISTO
458,345,491 *2E8EB6DA1105CEC4424ACC463D13948BC4AD8EFD [email protected]@L
458,345,492 *2E8E1655222BE6CAC704875B2D6F644FE5FC6399 [email protected]
458,345,493 *2E8CCC2E988E48E6054A2DEF9266F5CBFC123E01 ANTIONESANDERLIN
458,345,494 *2E812755634F6C356AFC647FC853315D31B9653C tracyarmillei
458,345,495 *2E8A6A19C74727E8374052C958F18402937CEFC5 trations
458,345,496 *2E84C56B882C6501E41EA5BE58D4EFC5016B7CE2 trekkilb6
458,345,497 *2E8737F47B538D34991AAA5A128B76B9E4A85C82 trishanicoleturner
458,345,498 *2E824E6C5FD8161EF3590FAD92EC531628EDBCC1 trzyha / hajs hajs hajs (disc 1)
458,345,499 *2E8ABA0FCF7DA2FD956033B8C724516023C1647E TTHIMAN
458,345,500 *2E894DDA38AA0C51ABCBB785B6A70A3EFDA9421E AROSANA
458,345,501 *2E8C25D90E6072532DB12C6940C3FDBA33574F8D arvincarpio
458,345,502 *2E879F913591FA26910C53374801631EF4215BE0 a/(s
458,345,503 *2E8842691AB048BC290F93EB33AAF841F7E5BD7F ASSHE
458,345,504 *2E8D10D8260D05306783666F17DBC3DC4231F34C tw21k2d
458,345,505 *2E8A39C1C00A5B67EC387BBB36DAA76BF1D56FB5 ATOMSTROYKOMPLEKS
458,345,506 *2E87BC3342E0822033DF5E8ABB27CDE53D7123B0 audio:-great-music-iv
458,345,507 *2E82786CB734558210248B376C5515EC8BFCCCD4 AUGUSTSCHACHERER
458,345,508 *2E83D87FDF0FB58130B44A4D1EC8395493ABE9CF augustsitosky
458,345,509 *2E825F419EC5345692B7E0CF4724C55C81CC698F AUTHENTIFIERONS7
458,345,510 *2E8393FC25E0BFBD49DE59461B591965900FC14D av5!a
458,345,511 *2E80009CB022C3E158C31D1255832C60CCE3174B AVANTI.KNARF.RELL
458,345,512 *2E8A12CF197E45AA97E0037A80A43446A7913318 [email protected]
458,345,513 *2E82843240004994D11BD8E8E196F1095DC318F2 $UBTR4N$1
458,345,514 *2E8BEAFD8B3C87A79A6C6B3DC65E85641E6DBEF1 [email protected]
458,345,515 *2E8345A6A7BD6B49477104F89EAAD170748DC09B a+vvg
458,345,516 *2E8D52EED3E119CCDFECD0E637202D09F19D8726 [email protected]
458,345,517 *2E8C8051CA214D4E92061DE647B4960A0252A5D4 aw_=z
458,345,518 *2E8377B876D3FC18A579AAA7ADF29C337E082638 AXU7
458,345,519 *2E869237527DCB406D6BC8FBDD68003E0ED26A03 b_//(
458,345,520 *2E8D58DFBA093FFE436EB504EF17A5B3FAA12363 b#,$.
458,345,521 *2E88D23B4B3995EEFB7013C26ECC2BAE648AFEA9 B&"%
458,345,522 *2E8C619EB0F2A9FC26E20A111D536C7A2713B633 unifichera.
458,345,523 *2E880B302FDD770FFA03BA03B5A849DD67295BA3 UNIŠČOŽAVAŠČA
458,345,524 *2E84AC980F9A91BA73C97F0FB6BAEA22D8106F9F usable!
458,345,525 *2E8CC69546C3D0AD49C5D08EABFEFC055FCA3767 BALVR
458,345,526 *2E8E0E9E7A98EAB116E348BF34EB13BCEC141989 barneydelpaggio
458,345,527 *2E8B92923EC1A193CA60129443243B374E73CE01 BARTON.KLEMETSON
458,345,528 *2E8E92308D7B394A5844D377F25E9F61C028B940 BATSMGNAUDOTOJO
458,345,529 *2E8052F5F83E2C80A78AF6D877CE2F727F9B3682 ba.vf
458,345,530 *2E85108836B1E2B223E5EF0A82BF68E0C08AA03B [email protected]
458,345,531 *2E8F1CACB84B0BD513A225A2E70C68EC6C7AA115 b=\d
458,345,532 *2E80D2D88A12B3BB8A4A480645304E161AF4A647 b==e%
458,345,533 *2E8A32DB99172EC1133D4780EB1D53F729D0FA86 BEAUTIFUW6
458,345,534 *2E8957BD638D5D284FD1168E084AF4C15A6E93A0 valerie-firth
458,345,535 *2E8B851C755E0A287ACAF9289ED0482F4279EDE6 BEDWARDA
458,345,536 *2E87E4A8DFA1F9FC81C8AC8516EEEE638B8A9CCB [email protected]
458,345,537 *2E86EBA3FE0A401651B3F668DFA95EFCF01D1927 vatsa.kurian
458,345,538 *2E8432FFDBAA0165D40E38E44017CE28BC5EF70C [email protected],
458,345,539 *2E851349E7E028BE054BA0D91F19F9B41F480F6C BERNARDZILLS
458,345,540 *2E83BDE86068A95EDE3EDBDCF6FAFD19C7681260 BERRYBOYETTE
458,345,541 *2E8534DE13923358BF66D6BDA5FB89E60654427C VENESECTOR?
458,345,542 *2E84ABABE42BD253B65CB1D617D1675BEDD4C666 BETWEENDIDNT
458,345,543 *2E8C3CBC5D316C59CB76B43B2BA987907154486D BEW
458,345,544 *2E89C63FCD70584F3FE266DA1407A9BAD0B4736F venkatarbsw
458,345,545 *2E8771FD53EEA174976EFAB97607DF0A7FAC2497 bf"m?
458,345,546 *2E8AC1F9A86423E1975C1FCEE25B38EC0E5F4A39 b+hvg
458,345,547 *2E8C6D706435102A4A0CD5C8B703D96FE0C1BD5F BIGGISH
458,345,548 *2E8BFA2EBA3699740887CF0DBFDBB28FA4B34EEB [email protected]
458,345,549 *2E81F9332D7901E6AE3DE447541429DFA727E5EE VIKI-WILLIS
458,345,550 *2E8E9E8467B8E4F581669516C61236F81F63E4BA bil4n
458,345,551 *2E88BEB3B93189BE0442DA26238613B1EC957053 vincenzoboen
458,345,552 *2E8F97321C45C3703916B97DF6A4FD77D5A6985A VINCENZOGUDGELL
458,345,553 *2E86F77BB5D7AD8A8F6418F4586CBC3A7504A497 vinegarist
458,345,554 *2E84F8002332064D8F9704A25B1BB1E973D0B4BF BKKSUANGULARBSCHOOLA
458,345,555 *2E80A440CEC276BAFBC92151FDE2BB4A853D70FF blaken4
458,345,556 *2E82AF241C5A76B50361130EF6A104A5788007F3 VLITILASODANED
458,345,557 *2E8CBD9097F08942567F9CAE50B2049AA9FE6D7B volcomshortay
458,345,558 *2E8AED23DB8D3672FC74795EB2E42D3EA58C1B46 BLUES:MAGOOS
458,345,559 *2E8B4A420B3F5FC34A27CE57E00DC8FED6EC3C1A BLY:T
458,345,560 *2E8C31A57F8D976195CF85D738D6C5400DF81639 BNGBE
458,345,561 *2E8B384FA1762D2F3A27BA8107F16CB53506AD3E WALTON.HUDRICK
458,345,562 *2E8E79B4669AFDE0FBC92F6D6F6D5BC4B7D632CB wa-maid-sama
458,345,563 *2E8C371152D5E8E7165F8B9FBF3C3DA6F408E4E2 WATTSOOEUER
458,345,564 *2E8DAE3857F546FAD8E66B254B61D8103471B04C [email protected]
458,345,565 *2E883F2DF63854CAA44F7707C89ADB02DCB5B794 [email protected]
458,345,566 *2E8F5B8C8F10B57B32AEF0049F3992AD6147F9F1 BrandenburgConcerto-No2inFmajorBWV1047-2Andante
458,345,567 *2E891A769564BAECEF3B66A287BF730C4DFE9C4B [email protected]
458,345,568 *2E86C81267E8855D5BC5129038E4E7D72B592556 BRDSSTKKN2
458,345,569 *2E8BD15276A2F3307BCFE04E4C7B6B70F31BA9F2 breakermen1
458,345,570 *2E8BF1CEEE36CBCA0D316C6E47F8231169FCFB7B wenming-padilla-chen
458,345,571 *2E80896F04F606686B3AE31547336490F1263AD1 brettbucaram
458,345,572 *2E84B7EFF1136B6990AB375FB5DF7C7E05AD6AC3 WESREBILLARD
458,345,573 *2E8651822CBA8995D1741F6718B41186D0754F35 BRIAN AULT
458,345,574 *2E81B35DE2B5FC4E80F5ED97F2C823268C4825D7 Broken.Conscience
458,345,575 *2E8232B113EFA2C729543BCB7EB7F417C4CF0402 br-sm
458,345,576 *2E8996D8F949742D10A4598870DFD71BEE340C9D [email protected]
458,345,577 *2E85616CC4651CE57BA984222A7A7B934E362468 BSWBEYMABSW
458,345,578 *2E89EAC7472D59454463DDA07EC9EBC4E0A71651 bta
458,345,579 *2E81A4D310D143630BAF667E6A2F249E12BF6249 buf6c
458,345,580 *2E86455A3357B4F6C463171A5A2214B6ECB652DF BUONAPARTE
458,345,581 *2E8934220797420BB887013BA40490F8F8A5A208 WILTON.FALASCO
458,345,582 *2E8677269C48CB043A5A27AF976B65874DC9A674 buyf-
458,345,583 *2E8A45CE69D4C24D1C65ED0AD8EAD242FC052E6E C0nfl4gr4+0n$
458,345,584 *2E80D7B907C5D83E21A8E074DB9BCC69580D8619 C0NSS
458,345,585 *2E8DB0719DA5B48DA3083593373EF8788A58FD08 C58DEF1EB7DC48038618E72905AD6393
458,345,586 *2E817FDC3B07824F262757FF62C0241EBE987862 c=6,
458,345,587 *2E8C3FAF6724A94EF4FB3645EE16DE5AEC7D757F C8NPH
458,345,588 *2E88CA9FDF3A0D20BCE2A7665EC4387BEB5DE481 cabanokingsway
458,345,589 *2E80FF758E86B902E0F478D2C2DC6AF0555D8289 CAERADC
458,345,590 *2E8CB2C7921DFA7F021E6CDB19762F6294B9F4CF [email protected]
458,345,591 *2E8411ECDEF823648D0555670ADB976D56AD52A1 WWE—FORMERLY
458,345,592 *2E83912D12FEEB57833936CC0D73BE998C6E93E7 CARLTONSOSEBEE
458,345,593 *2E8B75703AF6FB440B0907E3492AA285C9FDFE17 [email protected]
458,345,594 *2E8DC8B3806720D6317315D75D733BE3EACF0759 X100929
458,345,595 *2E8E1F5E5A16598FAF93DF1C8790C0E946678086 xhsm
458,345,596 *2E82ECCA0536CFF2170B113F2716C14DB66656BE [email protected]
458,345,597 *2E8692D9464ECE598E0D375BB87249E2A0BCACC6 )x(-o~-o~-(------b
458,345,598 *2E8DC36739B84FBC6874F72EB90FEF9368BA7E13 CDEVSYD
458,345,599 *2E836B8069F738C52AC4B0DA28F8FAD345DC6398 CDGQ;
458,345,600 *2E8C0BE9E0216409B96DF71FCA3047631A0E7B29 yang_
458,345,601 *2E838D15C34FA337EC94FAC794B9B61F4D2B7074 CECSLETE
458,345,602 *2E836038E986155979CA76BAA8209BC9F859C8F4 YAYJANA8
458,345,603 *2E8766FFA29E20E85C104CF7BC335328DB37B58E YESUOMXESUOMETALXPMA6
458,345,604 *2E889E60420FE5CD3C0551048E082FE8DAC8028B YOAVARBELLE
458,345,605 *2E894AC6D18D89CB841F9E8FBEC94AA2140D170D c$g6e
458,345,606 *2E8002CFA22D3D979A242548AE41B69069FDF2E5 Chapter1101:TheBelvedere
458,345,607 *2E8F0E8BA3801A73C553AB5F2B47CC032BB1488F ZACH-SEARLE
458,345,608 *2E8AB388DA3A34A9F27093649C87DA3C438F027B charleskrech
458,345,609 *2E8E05D4A3BF7F814030D10FEDE18F63CBB8C8C1 ZAFFARANIZAIKA
458,345,610 *2E83AE04AD2FF6B77015589AD92D1730D22E6C03 ZAINABFALAL
458,345,611 *2E898BC8BB9A790895CB43D82A1BA3E1987B31B6 ZARPUTILYCH7
458,345,612 *2E8541F9D699148DA5774D8A153A2530BC62F5A4 zen-bitjenis
458,345,613 *2E8AA5454B75970C6B4FA599024F06F3AEC27A01 ch?ix
458,345,614 *2E867F70685EC7726927E6A93F383763443CC02E choke-/ts//ou/k
458,345,615 *2E820083712FAA695259521540DCDCE4D5DEEE5E [email protected]
458,345,616 *2E8CD765A8A95771F0EFF0AD13CCDB3A3408B963 ZIWB4BW3
458,345,617 *2E801E002B215B66DEBFA3321E408AB1FEB32183 ZIYA ATAY
458,345,618 *2E8522D75DA66B7DAC05B669A136F923C92D0AFB c!hr3
458,345,619 *2E8506145F0231DC6CDCA1C3D320D7E5027D20EC [email protected]
458,345,620 *2E8D5542660AAEF09BC4B36B967B7F80F42E1876 ZWANZIGF7
458,345,621 *2E89FAEA05D19F2669B6280CDE491EEF736F773E CJCE:
458,345,622 *2E8870647EAFA2ED70E8350D44950796C1973755 [email protected]
458,345,623 *2E8C030BEEBB02CF3204E79C9E223ED9246FDFDA Clarinet.Concerto.No..1.in.C.minor,.Op..26:.Adagio
458,345,624 *2E8067FB57E8DCBA4DFE9F388A0F1B8CEB146521 claudedearth
458,345,625 *2E8BA4BDE066A07C7FC781D4E1ED64E64089116C clementepingel
458,345,626 *2E890B2658098990397A33B3451FB3E17810E768 О’ЛИНА»
458,345,627 *2E8B94887D24051D6D7F3D14C92FE27D5ABC33F3 c-lt9
458,345,628 *2E824F89FC82420A4F90B4005C73C7AC7848A82B САНСЕПОЛЬКРО
458,345,629 *2E896D1120DD7A2DF263C98E06E956D27CD788DA CN8A8
458,345,630 *2E827FA76E7471411DDECB3B0B4583D22519CA32 COLEMANKERR
458,345,631 *2E873E01D0F583F75EC8E8A87015FB019C7FEBBA ШУМАДИЈСКОЈ
458,345,632 *2E84254316FA755F3AF3A2DADEAADEB375EA2671 colindante
458,345,633 *2E876CD45163CCFD7B4A5A46DCFFF8562B11BE5F colotex0
458,345,634 *2E8D2624F99F06015701D68E53F31D55C99472FE COUMISTACUK
458,345,635 *2E887D1D8B658AD2D6620B3A3976B7E65E628A1B COWCATCHER5
458,345,636 *2E8D2E46896D5AC2C32423BA0711A23D07B566D0 CPROFUMO
458,345,637 *2E83CDD568B2F380E41F3B157B57B49C13337993 c%px
458,345,638 *2E8DF23C06CF0BC504DCE7B2323CE94AB888F738 CTE(U
458,345,639 *2E8075347137A6BA9A7B11881AF502D63B2B3A4A 香港MTRの鉄道駅
458,345,640 *2E82B1DF092A7F9CD8020E720A9F2EF1EFBD0EC6 CVEFR
458,345,641 *2E81430B3DFFD6C50C8DAF0F0A999642A601BC20 d375g
458,345,642 *2E861D4AE1CC59DFE7A08E4648F179FCE5FC82A8 d3pq+
458,345,643 *2E8DD74F2409217029BB7D7711359A9788C7A9AC DÁILY
458,345,644 *2E8ED86CDB3B27363B164BC6B3F2009BF611D4D5 067MM)用であり、標準軌間(1
458,345,645 *2E87CC6959E20AD043D87B4B572D07AE89198C50 DAMONLUKESH
458,345,646 *2E8FAE8532C2BA4F860BAD6551DAEFA0745AD31E dana-dondon
458,345,647 *2E8628618AAAD1744D14E4DBF370944DAE7C3829 dane-griffiths
458,345,648 *2E8D145C6EA4624730D740703350CD4380837FB5 0C9C5ED8591D368FAA1BE27F5C06C417
458,345,649 *2E8A2083B30A730DCFF708F2F10337C65C6159AF 0MYPETER10
458,345,650 *2E8029B4FE3C0F18D1F871842D7AA06F5B00E648 0THATMAYDAY1
458,345,651 *2E8AA0D2A37AE5970AD899B7CF84104EF7F83B9C darnellsenske
458,345,652 *2E8F9B2C2D08F636D91873A66B440CF8297DC3A1 10 HUIKKAA
458,345,653 *2E8C12DD4426A211C86B6D1E34CD6D2BF6A99918 10-kovimpaan
458,345,654 *2E8A119E838F65CAF86FC26A9250200D488CCCC3 120985R
458,345,655 *2E83772478AFD6D7A605673EB3595EACA01F7676 DA$W"
458,345,656 *2E82799EE243958F0D052B94D295160032DA42BF DEBIK
458,345,657 *2E854BB84E990E95C1087CD8BD8DEACAE8AA9BF3 DEMANDERAS9
458,345,658 *2E8D1246157B601218C0BA7B27E3E18AC2FDEA76 [email protected]!$7
458,345,659 *2E80F6D150080E3F5061311240895C5036A12A31 despoiler of hope
458,345,660 *2E88AFFD53B1C714D91A779563E36E3460657C50 dfg8u
458,345,661 *2E89221E56267C1C9C2AB8C4D089D553505B7C51 1-AKAASIAVILJELMIEN
458,345,662 *2E8D6DA96266668AE5F1F1F4051D24346CD4E684 1 ANGLOPOLISH
458,345,663 *2E8A29BD8012C0538B6DCC438AF63239C4873842 DIKSJON0
458,345,664 *2E813BAB7F440174FBFDB5682D2B0A7043B31A97 (DIPIPANONE)
458,345,665 *2E8241F804043256717C55195C9DB1529D0130FB DJJVU
458,345,666 *2E88F9687B1EC7B1152199771916B547826FC114 1-e-mail-h
458,345,667 *2E8F7E25AE6B6863A8FE20F9595C00C7D2B59AC3 1.EMILEMEMIS
458,345,668 *2E85CB0F5457C0B5423D2B483162DCA9845F3B99 1 feedingrequires
458,345,669 *2E80A85F6A5563BDEBEDCC9D88795469ECF7994F dl9v%
458,345,670 *2E8CC7160B6A80DB6D567C60DF11F7BD69059505 dl=aw
458,345,671 *2E89E134B2DD53C572514F9219D8F65EBCF5295E 1lehtimetsikk
458,345,672 *2E87BC82BF49E49010D9285AC12CE961B244FF17 doggy54321
458,345,673 *2E83F2D0DF448F9BF3929051F0A288070287D33F 1ov31i35t
458,345,674 *2E854A4C46DB351893A1438725EBCAA1F71C3D36 DONNY.BORLACE
458,345,675 *2E897EBD1BBDCA9293B6FB40C5CD16E4B230AACA DONNYIMADA
458,345,676 *2E867373AD9E624E452F96DA1A4C0F4FDB62876F 1QUDZE5
458,345,677 *2E8D9857BEA1A1B41C24F708CBC75CF2F5901FAA 1RENARTA
458,345,678 *2E80571DECF95A231D202EF68647F1B0F4DC2175 1riogrande7
458,345,679 *2E80B7075E48B9B884F904E7F748B48A1480592F DOUGKOWALSKI
458,345,680 *2E8DD474CE1EE4A10C4FBC0B50FC669B45D4691E DP.E-
458,345,681 *2E8307D39B5225ECD33AF96A48500F4735035EEA DP)S
458,345,682 *2E8F8761E5CB8C28B027D47ABA1AA82FC2558653 D#RK?
458,345,683 *2E877BF2294FA0F82411FF22B74E49CA1906742A 2252902 THAT'SENOUGHTOSAYONTHESUBJECT.
458,345,684 *2E8CFE26527EC13C716EBCA7FB5A39C23E8994B2 du2o0
458,345,685 *2E8E671E082186E1EFF39CC37301BFC3C88C61CA 22-ZIHINLERDE
458,345,686 *2E871B611A79F6455DF5C1533B14A7A04F657D06 24DECEMBER1929
458,345,687 *2E8C53389477FC31EDCBCAA7BA0B02E4D029CD39 D#WQ
458,345,688 *2E8FC8B0D884A474C82586A35D5CB4D18F2118B4 287HARRISON
458,345,689 *2E8D3FC2DD4C8C02366D26B6C7CA66B465149DA8 2.AWI
458,345,690 *2E899350BCDD16A902FD3FAA3AF3009526C0A386 EARLE.CABRARA
458,345,691 *2E88B94E814487C2E63E4E6697AF83F396A7B90D 2CANOROUSLY
458,345,692 *2E851473C24E6F0B8CBA722F9C3AC5BA82E44E56 EARTHS」
458,345,693 *2E80C86143082A405E6689B2E71D6BFD8E447868 EASTKENTUCKYLEADERSH
458,345,694 *2E8E154C495668EF688421BE77212ED63700CD85 ECFRW
458,345,695 *2E892391A77B174EDC5ED7CA1402B1EB918256BD [email protected]
458,345,696 *2E8DE1274366707FA652B96E7841ACFF50486E8B 2HANDBALL-MANNSCHAFT
458,345,697 *2E8539CE0ADFF27C8A5C9D520228A1C55BA1DD3C EDGAR MALDONADO
458,345,698 *2E85E64F5C849FC3C305048B186A651C523DEDA4 2.kalasi
458,345,699 *2E8DB976D475AF5098EB2A43EB85F8006CDCC579 EDISöN
458,345,700 *2E814FDF371F511F22F1A8C5D40DA77CAF4030B7 2 KUNGFUFILM
458,345,701 *2E8B2A9B43A7E4A1D70459AD41B1B775D455E60B 2 LIBERAL-AND
458,345,702 *2E8717F99EDD7DC606F2298ABCAC4D9AF6140BCD EDNETTULSFA
458,345,703 *2E8D24B27186301A714B502C1640124512EFB7A5 efye
458,345,704 *2E83F2F10B756AD0A26CB3869A94648B9514954C 383668 villisikojakokeiltiiner
458,345,705 *2E8C5B759EDF7308759DC1B8B1E14688BBBA6DC0 38c1
458,345,706 *2E891B967DE1D1887941B752A395EBE40A84AA97 3ILOVEMIKAEL9
458,345,707 *2E82193EAE14EF90EB3F0DB0F2C11B4F431846CB eliasmongelli
458,345,708 *2E8285A815CCBDCF8F8E9E888A281420E1600AB5 4BEANIE2
458,345,709 *2E8B630DD551EC6F1C1C59920CF4C9FE6BDBF07A 4BETTANO
458,345,710 *2E83912989F1B74B5FE4849183401BA32E230983 ELLWR
458,345,711 *2E80452881D2602323DF591060A8261DF88F4B97 [email protected]
458,345,712 *2E8D36C4750E3F9D020378F851E7788786F7ACF0 4M0CF8R
458,345,713 *2E825698E9DEE30711D3E4C3E00C18ABE4BC9A13 4MONICASNOWBALL
458,345,714 *2E8D9FADE338920CE565798BA4FBC307BCEC9C30 4ORPPARIT
458,345,715 *2E8FE3BB50043E642B5692939AB4C3D2B1F19275 4-P
458,345,716 *2E8C74F87C892E2010CFB5E6C18BF94A0CDF6FFE 4PRICKLYPOPPY
458,345,717 *2E813E9369C9A69E129D68C49EB4B48859C0AD2B EMBALLIONS123
458,345,718 *2E8760A345F79E2A3346DF656DC2A621487D9E26 emeryvassallo
458,345,719 *2E85826D570BEE28623EBFCFBC2EFB4E06FFA162 4THEPENTIUM2
458,345,720 *2E80AA03BFDC878C71DBACEDBE7561A3A04D1956 EM_K
458,345,721 *2E8E93482C5DDD7175342B0945416B31952404A3 en3y"
458,345,722 *2E896BC6B365609B460F0518002B28328D6BD7C5 559259 CF-:-TRILLING-;-FIVELING-;-EIGHTLING-
458,345,723 *2E8EBDEC3080F8FD61A5B8440A30C6F0C3F153C4 5ANNAPETEY
458,345,724 *2E8A263628DAA155E8A9253CEFF1208109218987 5atermoyaient
458,345,725 *2E83D1EF5A35D187A4962C6CF5DBC6181EE02857 5CRUCIALMARKETING
458,345,726 *2E82F166EC794C9F1882F2E7A3F247C752105FA0 ensomera
458,345,727 *2E84F94B24637E84868889E0E56F3B4019D9305A eric.karp
458,345,728 *2E83E3CD56DB0D8E91C80CEF3D8DA03C487C140E ERSTABRISS
458,345,729 *2E8EEC214FF0B055AB2F2FBEB49AFFCEDDCDC025 ESAD.ULCAY
458,345,730 *2E814D3D3267E4C25649FEDC55E4987DC7AC6F87 ESOED
458,345,731 *2E8C3805C690988A10D38E93E5EBA122D475749B estimarei2
458,345,732 *2E893B91A4649D5D324856DB127D9AB708DFBBF3 esvq
458,345,733 *2E88F24661DA3328442B74AACE3BF9AB0DBDC19D ETHIOPIEN8
458,345,734 *2E802EACA4037477AC2256CE8C1BA59511CD244E ETLUPTLA
458,345,735 *2E8D21B5BF84D594893326FB55A8CF19EB70B060 eu4
458,345,736 *2E83A2C4E44FF4977390FAF43CB847EDFB5A7395 evidentemente7
458,345,737 *2E887FA58AACE15540500D9F321B8E1FA392F7FD 6AVSTAEMS
458,345,738 *2E8B5C2AE7E0C404DE3FE3254C6B34D484EC4FCE 6BSWFERINOBSW
458,345,739 *2E8CF7330657DCEDFF58318EF9E5B19C5F4B982F FAL
458,345,740 *2E818E43FE68FE0FE4298B439E83F8B7F0E68BB9 fasnachtsspiele
458,345,741 *2E8202F84C3A0151FE663B47DB562031965897E5 !FB
458,345,742 *2E8EF4794113B93E63E9EF58897475F96F22186E 6LOCATIONLI
458,345,743 *2E8AE07B2635C2BA3C2CED1C052B85FE0071C51C FEDERICO.WEDIGE
458,345,744 *2E824D016AD17E898A98F3D536406E77DED0C233 6NEVERHCSEGNAA
458,345,745 *2E8BCB216ED987C38E8A8EB4670DBD5C33EF6ADC 6PENGUINFLIPPER
458,345,746 *2E8CE0C77DFE5710AA666951163A1CD391200DD6 [email protected]
458,345,747 *2E8F7C105422AAD2B7C9B4265486A033F82F4195 FEVER-B1I
458,345,748 *2E89F2121EF331AE13A5D0D825713CB534BF37E8 FFTUK
458,345,749 *2E8848763499606D811E1ACBBC2730E3778B24EC 6TAURUSSPENCER
458,345,750 *2E814653467E35A242FC5856F606062FCF2FF24B 6THEGRATEFUL7
458,345,751 *2E82C535387415DAA5B5FB1C1D4EF2C60189448F [email protected]
458,345,752 *2E842D25C1105BAAC153EED9EE0FFB1CCD4C2442 7041102
458,345,753 *2E8C7721A116E4214EB62BEE6DF1D93A111C45DE forebid
458,345,754 *2E893C3FB17AF2D08DA10C6DD8CC8356E73507DE 7BSWMERCANTILBSW
458,345,755 *2E88E3188864AF245ED13C53701ADC8BCDAADD56 7HUSEWIF
458,345,756 *2E8738416A42212BD685BC0833E93BA516DCDF47 7iamhorses4
458,345,757 *2E827A5B2CA76FBC39193C25565E9CBF29E35713 7MONICACRYSTAL
458,345,758 *2E8B266042E888F114794BA57AF94BCD5EE30CB4 forrestavrett
458,345,759 *2E8D4A9C76C5E4246154402FF03C8EE91BCAB435 7RIVENDICAVATE
458,345,760 *2E8804850A8753F87B5EC7CFC1C3E484D23CECD4 7SCHRCKNSBLCH
458,345,761 *2E821BA32D16FE5594196D48A15C9C54C1B4A395 FR33F1O4
458,345,762 *2E8D8F9C8A9C22F87F170773641A399F262A0E85 7TIMOTHYJANICE
458,345,763 *2E8A89FA9B988D628DEEFB230865988AAC112CDD 7TRESCIENTAS
458,345,764 *2E876FECAFF220638529E93008E8C430BE0E34D1 7 VEMPELEET
458,345,765 *2E8A0E693990317E0E232210D644D1E65BC74429 (>-<)`@----8
458,345,766 *2E80ECFB53EBCE2F8854E4533ADB55FE01A11346 FRANZ.DE.JESUS
458,345,767 *2E816EF95FA64392F19BF4738A52B82C7933A2B9 811587 BANKAMECLISIIV.2.
458,345,768 *2E8DBD5DC253A37C19F3521B86423F173B476A78 FREDDIE.MAVITY
458,345,769 *2E8958FCEBAF9933278B1503C32E429CD070F3D3 FREDDY.SABATER
458,345,770 *2E802324FEA87A378577A2527F619500C1507ECD 859MCKENNA
458,345,771 *2E8F46B85F9796DB7AC83EE80C530E8FB541FB8B 8CA8F32E75CA3586AEFB9DE314C5CA2E
458,345,772 *2E8BD30BAAEA8B64A6F427CBA2FAB1A9450AED11 FSCHDDNING
458,345,773 *2E8294B1C0DFDE8E60020C0703036F5CAD9D7F7D 8GILTDNIB
458,345,774 *2E8F577676126BA51A50577FE5F47EAF9E89D2E7 [email protected]
458,345,775 *2E82F2ADE25214E4BD1CAF19E93850CD93E201D6 G3SSITQU3
458,345,776 *2E8EE7FF02D5B570E3FBDBE9294CA5688E2312C2 GA810
458,345,777 *2E8F12C022A759C04F026314D9304D90CBB82DDA 8HANISEE
458,345,778 *2E814B7A2562C492723C72D50AF802C3CFCC8887 8INCOMMODERIONSES
458,345,779 *2E8A10D44A4D95EE21F0CDA1E716BFE5DA0E9634 gangaiah5
458,345,780 *2E87BC163E6D89EA9D171F66CAF8F5C10CFA7D1F GÂZULIE
458,345,781 *2E843B84C93FEBC0E7F94A059C1339B85B613B14 gedistilleerden3
458,345,782 *2E8E04319A8750318AE332431624A7BDF51E7BAB „geldspenden“
458,345,783 *2E8B629DE65BAC6B7FB90FA2BC426FDE57AF3124 GEOPHONEPHOTO
458,345,784 *2E878D2DFA66F60FA618DB6A487815BE8A672B4B [email protected]
458,345,785 *2E8AA5A9C23407CADCA075C9A614375438E0143F gilmerwvgeostub
458,345,786 *2E81BA84228A85F23D6B5C7C50128348D973CEFA GINUWINE’NIN
458,345,787 *2E818D05AABB18673B3E4119C952DB29025F646B 9061KRO
458,345,788 *2E805019CD710106107DC2A621F664F2D2D32EE1 GMUWHEN
458,345,789 *2E861B21A21426104A508D10F04B10419F1AF373 godfreysithole
458,345,790 *2E87F43F2FECA269CC8EF796952CFE9C67587109 9BSWUNITRAVEL
458,345,791 *2E87BDF84C22FD98328C63E134C25CAB80B53E48 GOOGINSESED
458,345,792 *2E82017E459B507816AEF2245A28C70E0FC56A83 GO<Q
458,345,793 *2E86D9F34E1A297427A55298F4A85B8EA8E49212 [email protected]
458,345,794 *2E865D69F6D4025FF1883A2FCAB10B969E420A6C 9HUNTERADIDAS
458,345,795 *2E80C0EADF4678021A007EE75C1371EAE1E0420D 9iamsoccer8
458,345,796 *2E87DC54816BEA90BCCBCB8015B2AD984659BDE6 GRANCHESING
458,345,797 *2E8A4FF7E132E64CE053E1E402FA1160D4189C92 gstonden
458,345,798 *2E82731A0C8450DA1B5616F2054D669DC182BDF6 [email protected]
458,345,799 *2E82C775A702272624A256F52003DAF3F3F816C7 H67372
458,345,800 *2E8DE3535BE45F03773DC70CF50BA2F3926AC441 HA1E WATE
458,345,801 *2E80FF08D6ACE1EE2DBF55932C8010EE6D678E9B A2ETC
458,345,802 *2E8145C143C1BE392CC32559CF42D7ED80F543C1 HARLEY.MECHEM
458,345,803 *2E80E3CE853114B22EF1566B1C9A56F140897476 A-6O
458,345,804 *2E8326E7A29E0291A05C288F20FF5110CBA53EC5 HDEUTSCH4
458,345,805 *2E8C02DC545DFD45B279562E6A4290E4747F9F01 HEATH.MANIKOWSKI
458,345,806 *2E81D11AA978BA04FEEF68D17A310B2EDAF841F1 heddagh
458,345,807 *2E813233C15B2C7A8ADADBAA39C7E8E2C4A60F84 ab8L
458,345,808 *2E8B449FEF43FD256B5FD72D9E60D21749A86D0D ABOUTAUSTRALIS
458,345,809 *2E87F2B9601FD9DF0387BCA3BF262EFE6C04C3F0 accarnare2
458,345,810 *2E8E319EDEA87454D1CC1AABB10923DD9AC6689D Ac=s
458,345,811 *2E8780F7C9535E591E99C4952B644CAE99E55718 [email protected]
458,345,812 *2E82FE2243663F8A485D564025F88DD33A801F69 [email protected]
458,345,813 *2E81CC28FD21AE970102DE1B4C021DD4EE3EF142 ADDITON8
458,345,814 *2E8B5599C4C70F907AC5B9D1B1F2F415B2DD8EA3 Adv freely &c adj; ad libitum &c (at will) 600
458,345,815 *2E836E6D434B1AB0924E2B91580170880A83E266 HOOGGAANDED
458,345,816 *2E831C4E00CDFCADDCCCDE3C7703E2EC47C1B032 AEHCARL8
458,345,817 *2E8610DB0F2213CDC18E33F31F074F6FD82A6689 a&et$
458,345,818 *2E862789E6070277FFF74FA0768632F97497DF1F AFSTAAT7
458,345,819 *2E800A4A81B5AF75CAA2EF13A1BAB29027588509 HU197088
458,345,820 *2E8A924AAA9DA62825CF3527D684DFAC2741BE93 ai#8
458,345,821 *2E8212B93511D0E77CD4829193391AD0D9F2EBDD HUMAN.BEHAVIOUR.(UNDERWORLD)
458,345,822 *2E863C60644943FFD59C577F55D3646EB1441AA6 HUWTURNER
458,345,823 *2E897043E48A3138EC95BD6A8D59B814249DEFE5 IAMSMILE151
458,345,824 *2E8A6F2CBD527D0E4C4F8679F44F30E945F44C5C ICTORSCLASS123
458,345,825 *2E8FB9E66317C767DF50A9B9FF438EAA1FCA1B90 IF I$ = "1" THEN N8 = 49
458,345,826 *2E89522685954AF91A91F1E6B921A3B7EC424339 ignatsum7
458,345,827 *2E8229374268348835A747E9828C57EE19DA1FCE ILLUMINATED-666
458,345,828 *2E84D7E8BB3EC34E74B36D09CE0D6B7F06794F5F ILOVEFLETCHER38
458,345,829 *2E8DCA705C3E4776A22E56082055A380F1120CA8 ALVIN-ANDREAS
458,345,830 *2E82352CA3AA50D20F88A7C79196421DAD681782 ILUVBUSINESS47
458,345,831 *2E8D7BB1C4862FFAD6565DDF8040407C537AA52D IMCBOOK
458,345,832 *2E8B5CF5875B0D86FFC2CD648034E89B8937C411 amq_e
458,345,833 *2E83144A3AA00356528CB82FDFF10B7730C1B764 INDKØBSPRIS
458,345,834 *2E836A0E9E3032BF96ACAECDB8D4A9ACF238192E angelowholey
458,345,835 *2E8C3907CE253F8BFA33261F1DBF2F6D82301F56 ANGILLARE
458,345,836 *2E825C99AC6A9D86744B8F87E48E979536578AA7 INFIZIERT“
458,345,837 *2E8E3D713AF1832C66D870594AD21091F586CDCA inteligencia»
458,345,838 *2E8F308AAC21F9DBC5F6F39993555009A3B5ED4E INZULASIA
458,345,839 *2E8491C9165B57ECB79057B0BD570112FA983548 AP7L
458,345,840 *2E8F431009E6669F10BEEC898EA4672AFAABD259 appletree-(live)
458,345,841 *2E8A1358979D26FC47177C141B782C6A0C4C85EA IVANTOUCHARD
458,345,842 *2E8E0268891CC81EE59B65E11741E329D89E8B5F iy%y
458,345,843 *2E83D4A216946ED7CF6BAD9AC7C0C7307D01131F J,?
458,345,844 *2E8DB06E115933FBC5B45398ACD587737EE6A7BC JACOB.DARRON
458,345,845 *2E87EFDEB0F700028012472D10545290E3234C5D JAIMEASPEGREN
458,345,846 *2E823FCD8B31AC391899D6090F47B2B82D6FC053 JAIMEFLAGG
458,345,847 *2E828AC863C992656A9698661D0104923CFF16BE arturoetienne
458,345,848 *2E8265193843602A934B288024DAA01D5D24B514 AS+C7
458,345,849 *2E880CA9D5B13A67D7E8160DCDF6A480387BA456 asfsv
458,345,850 *2E8F1E680DDD2D6D677A1C77FFB14A812E5B584A jameybrowing
458,345,851 *2E8D5CA5C7EFE7783B3928F2D08A844A6AFBF413 ASHRAF'S
458,345,852 *2E80639C92A0BE1AEB41441969DF5464B138AE71 ATTHEENDOFTHEDAY(SOLOPIANO):59
458,345,853 *2E8B0F13DDA34DEC2A371B85990A5033825DB804 atyhpomr
458,345,854 *2E83056231BD261B67DA3827BD33C9AAE79E48C0 AUBREY.MORIN
458,345,855 *2E82A6F99A385EE4503C710F0B33B5144731EC72 a!u.c
458,345,856 *2E852494657E1C2D3C4E9ED88DA59842CFA587B1 AU.JM
458,345,857 *2E8A8AE7B1E08779C65D61516971073AE8E50994 AUR"8
458,345,858 *2E812BBF6A489DC90520B36431D6569468FB10C8 AUSTINEDGINGTON
458,345,859 *2E8804471BC09ED719A57E2473BE9FE80029CD51 [email protected]
458,345,860 *2E89DD135C3313E657A875484FDC6FDA4C6BBC0B ayoh)
458,345,861 *2E88602D53087EDFDE1DBAEFCE338DA51379DE5B jillianhorowitz
458,345,862 *2E809B7A7FF15CBE2B5632B2306A29F76B7C0FD6 AZUBAHW
458,345,863 *2E88AA554DBDC3BE49FC6B7EE838B83117AB1B85 b00t.ir0n
458,345,864 *2E87C600543F02E4848852ED36F12E3A9CA5AB83 JOANN.HARMAN
458,345,865 *2E8ECB9562E3F26927C22BCE7E71F939D3C9F1EF JOE NEUROTH
458,345,866 *2E800AEC0C4CC902A6A6DD328DFDFD57E386E617 B"35C
458,345,867 *2E8EA98DC0726CEF0C5320D925731BA91290BDFB b4vhe
458,345,868 *2E827FD71912E5FF8DCCBD80253D5D541426B7B6 B890A
458,345,869 *2E8FD761843D81D334D7BF8494B9FE4701AC57E8 b"8sl
458,345,870 *2E85225619E1675E310A14D81D59CA9B426876D3 JORDON.AVEY
458,345,871 *2E886899E77462ECA63A02AD0E1A29578F072710 [email protected]
458,345,872 *2E8D156A71868C0091A4CC430C9FCDD65A5B9210 JOSEF.ASHTON
458,345,873 *2E8773B2E1CC5182841BEDB065A8EE3C5E5871A2 BABOUDOUHUN
458,345,874 *2E84675678FC47D1CC4C37D8F32697295D09F38F josiahkinard
458,345,875 *2E8D2A309A33ED468A61C3B05D7A7FE77DF7EB33 BAHENON
458,345,876 *2E87E28BE768A65C7BD33F761E5201FC29ACD45C J^Q'
458,345,877 *2E82A3435A9342DD041819A7D732E03C4522F840 BARRERAS1
458,345,878 *2E8232DA79E4462E79B4E86F86C70A64617B707C JUREROIENT
458,345,879 *2E8A58BA2273C39BF1C1A8E3A6E5E374E3C878E5 JUSTINFONTENEAU
458,345,880 *2E8A9D64A466C475BFC3B12A1CBE06A13BD3030F bbg;+
458,345,881 *2E84347148AE0593DD43BDA9B1E406787C7D3EB9 B+.BP
458,345,882 *2E8A5B606FF82E31CCB39335B40A1BC8716445A9 BE(C?
458,345,883 *2E843EF1D140190E4F8A15681162D5191B5050B9 kaylalamontagne
458,345,884 *2E83378B9192D0985B4694410333C9C7ADAF4A2D KENNY.NIERATKO
458,345,885 *2E827E00680E84FECCB5419B4CB98233B7D32018 BETOMANDUJANO
458,345,886 *2E863C2A81673C4DD739F784C5F942D12857A7C2 KFUFA
458,345,887 *2E8FC573DCC96F20EAB82CF5CD72D326581222B3 bfaw:
458,345,888 *2E852159D92BA46736255868E6C3E9817A0C12E2 BITCHFACE5
458,345,889 *2E8F7FEE7F3A8B8F1BBB9702FC6E7F19C85CFFA5 KISMET
458,345,890 *2E8FD75A1F03EC8CA8BC21BD423DBDA23DD89E43 [email protected]
458,345,891 *2E87654D525CD917C858E7BF1978591EB30066DB KOMATUTI6
458,345,892 *2E8EB811319EF752E1124478F2CC8913694AB75B B(LU
458,345,893 *2E812626468A04449C29B6A148E059264100C486 kootussing
458,345,894 *2E8AFF74BB49E43A007BABA3C1252079EADDDDA2 BMCA)
458,345,895 *2E8873ACC4837230147F6E81F6EDACCFE91CF3C2 k.)r
458,345,896 *2E89F5A0400788D56BA8095065C0D39108489808 KRISTINE-RICHMOND
458,345,897 *2E84809A7206BC5696456C635AFCDF1CBBBA430C kristopherwoitowitz
458,345,898 *2E89346EA3BCD1B243D3482062805D9061EEDD88 BO52"
458,345,899 *2E8B94B257FD01B35365274831813EFA17597EC9 [email protected]
458,345,900 *2E8316862F9C778FD46A52E581EC8F474C6AB481 bogicevicjadranko
458,345,901 *2E8AE2B8810C68C4D6333788368D0C910D92E3B4 KV$N
458,345,902 *2E856F4B41EA1A2587DEDD1FC5FBB4E13488CE80 bozuf
458,345,903 *2E821D53DAD52D6CDE023256E69AECCA3EB3CFA9 la.gala.de.camdevanol
458,345,904 *2E8D7634F3B469D6ABC5FC0834F5B61247E4B0BE B####P~0.~o.o><
458,345,905 *2E81AA5EE5ED70379A4C48733C4B307828FDE81F [email protected]
458,345,906 *2E8FDA367335CDBC2A2141989C5A5EBF6E81B5F2 [email protected]
458,345,907 *2E83347E6D6D4024C69EFC383601813E4AF27A3B BP;H
458,345,908 *2E8BFDEDD90D1C50BA9C27DA4001756311078967 BP~O~O ;)
458,345,909 *2E856EC1DBA5B5E9423B810E06E87E8F2CC92FE6 bristlel0
458,345,910 *2E8E41E1215CF2590E48006F3BBDB5BF935F471A laurentomek
458,345,911 *2E8711CA9BEB072BB53F9F0797CB65379848CAE1 LAURISAD
458,345,912 *2E83B76CB81C91DAF2A543F082124C488A7CACF6 LAVERNE.BRITO
458,345,913 *2E87E19F08F4DFE5848E974B1C8FCB243EEEFA22 LAVERN.NATHANIEL
458,345,914 *2E8474478FFB396B33AEF4387F9795FE700C0DC4 BROOKEBURCHELL
458,345,915 *2E855B6BC70DDB95E58034F2880C7F233497CBFB LAZAROLANIGAN
458,345,916 *2E868A87A148185DE8875D010FFFF22B726B612D BRUCEETDSCRATCHED
458,345,917 *2E817B3AADD35AF0884B05F4641AAA312E79C8F9 leighlaba
458,345,918 *2E85DD94F02C82D18DA5817D86D04D028B2B85C6 leleonard
458,345,919 *2E8388B7E5FF7EB72E7CADED5F4D6BBC2A973F6C BURLEY)把堅韋尼·鍾斯跟前鋒
458,345,920 *2E89B0B2B9D14A334533BDB8B9F23599ED6A8DFE LETAUH
458,345,921 *2E80F61C0D20361A88693D02B7607FED6FB33016 [email protected]
458,345,922 *2E8ED15144A118193D89E86F65C79FDC7AFC23BD BUTTERPICKLE
458,345,923 *2E856020A38B450065B9DC8D69CD3A62EC9DEBF0 letter-7--patriotism-or-pacifism
458,345,924 *2E868F4EF24FABAAE5F75AE112C84D3B3CCBEFE6 [email protected]
458,345,925 *2E8A181824D52012CC68B0E72EE5FAA1C072F1B1 [email protected]
458,345,926 *2E8D0AEC6ACCA6AD47FDBCCE65DCA497FDC99872 bz/j?
458,345,927 *2E8874253D364A1BC3D75D832F968D11E8374906 bzobw
458,345,928 *2E81C0AF7ADFB10D37B1A3B321297F6EA343B074 /c~
458,345,929 *2E88E0DE8B80A145605EF7A7039B21C3A148BA9E LINGUAX
458,345,930 *2E8C70052DE6596C838F54C9637A3CC7233D977D cardew?
458,345,931 *2E8885F06719993650A15D6CCE7D3A4860CC24C3 LOGAN.CLARA
458,345,932 *2E871A1FA666C42AB741277D5880A2A3566A8853 loggbok5
458,345,933 *2E86D3464ECB5A92B2099CD926B9CAD405573E4F lorielyndeleon
458,345,934 *2E8ABAE07FEC4EF93F70BADAB87D137EAA7FBAE4 LOTAVAM3
458,345,935 *2E89A438496DD9E168BC6C92CE44CAF3F0E58094 CASSYSANTOS
458,345,936 *2E80D553537AC95CA36608577A37B88B75A0D288 CAU?.
458,345,937 *2E82BE1BABF9EA75381CAA928750011EA8C40144 LUCIANO.PRUNEDA
458,345,938 *2E8D52802B96985EEE96A66D05BFCA0D6DC661F8 CCLW
458,345,939 *2E87204C1717A046FFF8C9F4429A658209C81FBA [email protected]
458,345,940 *2E88CDAAE23FD76773F87B337A4DCA94F1FB7AE7 ceji
458,345,941 *2E83B415FF41DB7EDA1523297A7FED00B885D402 cemfb
458,345,942 *2E84A90C3A529949920A7AA04FCBB7C67AC3B08F LYSONDRAC
458,345,943 *2E867DBE754EFF3698729DA29F0C79CAF5A4A64F lyssporprojektiler
458,345,944 *2E87816D3092FC0A32E5279B96505D88180FEAF3 MAC.KIENZLE
458,345,945 *2E83634534BE45ECEAD96071E4ED2A86B56945D5 CG&R:
458,345,946 *2E8948E1803B087FA280824296C89E79868335DC magneziotermikus
458,345,947 *2E8FCDEDD6A0E2055B9CC27BC4672ADEB1FF2EDA CHARLEY.COZINE
458,345,948 *2E84F1475328D593225EB3C96BBA1B6428974513 CHARLIE.PRESEREN
458,345,949 *2E8982D387964ED5B1E5A4F9C945F0BDA1D80938 chc1%
458,345,950 *2E8ED40A50ECA21D726824A6D9800980333B1781 [email protected]
458,345,951 *2E82268C83C1CF60430B90F30F78AF2CA8373EC5 MANUELWELDIN
458,345,952 *2E8F69FF4602CAA028DB2C8C4D2D16EC7D08C418 marcelinospinney
458,345,953 *2E829DC8B19E68866A3E7D6633EFFF8D4F43A4D9 [email protected]
458,345,954 *2E8F533BC50BC1AF328BE40B1F28C9A3F3832356 CHET.SLOCOMB
458,345,955 *2E88F81CA27C3416A00BB4D215545B69567F9E51 [email protected]
458,345,956 *2E803CBE8547F021749E4D0721EAC490DFBBD28F marcuskadis
458,345,957 *2E893D1847C8763856C3BD3A5F9C5E8C1BAA1DA7 [email protected]
458,345,958 *2E8491919B1E92978BA81D4D86374DDAF0D655BD MARIAMJAPARIDZE
458,345,959 *2E8902319435EB553D298222F70DA5250FF44B8B chokalingabaghavadar
458,345,960 *2E847DBA7AA2606469EDFF9420813C1419B95068 MARSHALLLALK
458,345,961 *2E8F9D77FEFD30E6DCFF661D9E9E38678553C7FE marsullo7
458,345,962 *2E87CA718757B887848986FEF708C9930473098D MATISEZING
458,345,963 *2E8F23B05A932D16EB8088130BE3653F242D02AE MATTHEW251
458,345,964 *2E89C6D12CFC96EDFBDABAD14B69CC7D68242542 CLAYWELDING
458,345,965 *2E89E3F17E8BD841CBA2A3F4AF986DCD248614D7 c+le:
458,345,966 *2E89B8225916CC22008DB3BC6F6BA1DB369D760E MEGBOTRÁNKOZTATÁSÁRA
458,345,967 *2E88FC8563643EB345FAC01A6457B5100D6703A5 MEINEDENING
458,345,968 *2E8540A01849C0BD6B1BCF67C6BF48D48C6B10BE MELISSAVANDIVER
458,345,969 *2E8BD1FDD9AF6FDC96966E284594BB97EAEBEE35 COC.P
458,345,970 *2E8ED2DE4EC37D2B0F62BFD09541E8C8D63CD7FE COLDNESS
458,345,971 *2E8C3CF7B0D7DC1F7E2B5707D31FE2CDDD0E5EBB MIKEL.KORZENSKI
458,345,972 *2E810C149ED5EC217A41F7AA2CC665A47CEB6B9C MILAN.SCHWEITZ
458,345,973 *2E8840A93397615553FCF8731F550E37251A1214 concerto-con-due-trombe-in-c-major-rv-537---i-allegro
458,345,974 *2E80CF8384648914B27E20E23273AB16F6F976A0 “CONCORDAT
458,345,975 *2E822CF7AE3DD0E90A9FCED95739DFCB69C14230 CONNIEWIBBENMEYER
458,345,976 *2E8C892B0541D14F64D0631CD473955FDE895332 miscuchis
458,345,977 *2E89C007ACBA7CB2DC3D45012B5340A3DBCD8EAD M''NITROBENZALDOXIME
458,345,978 *2E85D4E195570EB2999FB90E42A6BA6C2DFE8691 coreyphernetton
458,345,979 *2E8ACA390C688692DA4CD5174F04B2B6ED0CBBFC corsent4
458,345,980 *2E8D89EA0A77D4BCF9FAC92BCF0488AC6D9978CE [email protected]
458,345,981 *2E81A5C3776A0B6DE93ADE721DF0E098860EE36C cottingham12
458,345,982 *2E814BE32E1020F517DF11EC6F516BC2BB7FD961 monteweibel
458,345,983 *2E8635512F5FEDA1F4DEECE5A67C51E561AA1A34 MOOKIEPOLARIS
458,345,984 *2E865B317E43A19B05042DDC00440AF884EC9F35 CPUMB
458,345,985 *2E8E20A25B8224BB5C8896C4AEB26FC53C6EBBE0 muslim-hackers-blast-denmark-in-net-assault
458,345,986 *2E80C2F5B6DACB495FF0856445E40C5A9DFB2F01 CRYSTAL-LOVEJOY
458,345,987 *2E8AB1BD663F56FCDB3AA46DD16306D0EB43DFDE muzisch9
458,345,988 *2E87F53852DBE7D969B921C8068E4DE56542AD2B MYDANIELA11
458,345,989 *2E8275C60ACAD02900FF10F0A816307F57A377F5 C$tr
458,345,990 *2E808B94E6096E7E2549B153B34F2F7BDBD159D4 CUI9W
458,345,991 *2E8F8EA47C42AA5F253D20667EFD91EAA59A030D [email protected]
458,345,992 *2E801C18F301CDCFB3CE5DED8FA2AA6C178BC436 cuilliera
458,345,993 *2E8B5EEB6312AA817BA2721EAFB912DE74B2D75B NARBEHS
458,345,994 *2E85351DD5C5683D5975A7E18CCA255ADEAF93C8 cv2;$
458,345,995 *2E8C2B4D24A878B17A37930B243FDD63E8EE1C5A CZK"F
458,345,996 *2E836681E4F64F547B11980D5E7E977C91383194 NIAKRAV2
458,345,997 *2E8DD46E5E5169FF1B37D016171CBAB61E6DBAA1 D7ZYM
458,345,998 *2E835C17104CB35D90174615CE5DF0FA8EB34B6E d8bk-
458,345,999 *2E8C28C7DA7FC0C344806B4731077F7F0BCA5BE8 DAMIAN.BUCHANNAN
458,346,000 *2E804C18EAB700EC67EDBAABC44CF86776E7B6B4 nishukaler
458,346,001 *2E8D7AC76C6EC76D8F164DE58CCBDB7D672933CE nmetaphosphoric-acid
458,346,002 *2E887322E9C06AC7B4E6DE77801CEF40EF169E06 NNU.KLASG
458,346,003 *2E8C6503646776E1C26A2B3DEF9DA01B62BC596F NOA ROSENBERG
458,346,004 *2E8EC5B7F836D8EDD1955F454070E86C4BE5B84B darrelmorak
458,346,005 *2E829B063B12563DE1430A6649C37BBD80192753 NORMAN.GAFFER
458,346,006 *2E82F0F014401D9E89B46458777995889D3D5CBA DBE%W
458,346,007 *2E81E55AD5934D78F8235F32F36DAF9C9A1CE9E9 DEALWITHYOU123
458,346,008 *2E8FA869C2CE82AA4E790A07A4EA4E21CA3052E9 OBROGNI
458,346,009 *2E85B8E505E33336E2060AC41C0D47333CA45F2F OCJCIEC7
458,346,010 *2E827C958D1DE906604FC9A2B4FDD869AF7F0657 DEMETRIUSRZEPKA
458,346,011 *2E8ACDE72684ECF0D4E073628790D8269992CC88 deonbessellieu
458,346,012 *2E8207BF2229F44E285EF2C0AFA8AD52D60CD13E ONEHELLO4
458,346,013 *2E8BA54E0B16FE747367902511EE4DE2C11057AF ˈʧONTOƩ
458,346,014 *2E8011FFDB137941ACE6EB85FD1EA8FF07AFF430 DESALFANDEG1234
458,346,015 *2E8FD5C27AB29477AF9C4971164D9A56538E4C4E DESENSIMER!
458,346,016 *2E822E3194D6B1B59D3DE10946DEC82CD93765E2 DESMOND.CHEAM
458,346,017 *2E86ECF068D7B2ACA4943B3085F565B0ECBE0091 o->-<-~(##p
458,346,018 *2E89423C0FB6FB25B89A969C03CCCA8AADA4A569 DEWEYRIOSECO
458,346,019 *2E81E1C379DB119761A805F9E5112AA78F03C8D2 DEXTER.YANT
458,346,020 *2E8F9E302FBE5344AFA01D729B415B7C70E83D73 dez\
458,346,021 *2E8E91A313F8EFDA86D31AE167158E502055719D [email protected]
458,346,022 *2E83768D29110EFEDDA66E2C273AB8C2517DA989 OSVALDOHELEN
458,346,023 *2E87E2B6CF0CA87CDBF12FDEA3F186A6C02DC39A OSVALDO.HUTCHINSON
458,346,024 *2E8856DADBB05819349F7D4A6A68E119978D0836 [email protected]
458,346,025 *2E84F9D053170B0DF16BCC0143AC4B626F73F482 otherexamsxatfmsjmet
458,346,026 *2E80325CD5E405424C46829C16EFDA0A703CB3F8 DIRECTORPUBLIC
458,346,027 *2E818685EE3DCE925F18A5D11F0FB2FE9306C37C djfaa
458,346,028 *2E864D70D5742459F488D93663CE545EB0F91558 d$j/y
458,346,029 *2E839E44C9D367CBDD9C02D65A3E057EA6072A4D DK/9T
458,346,030 *2E88E3D7E2BD4A43A66B0209E2AB25429C757319 OZX?
458,346,031 *2E8C4BD137A43610D3223B4567FC23C274951FCC DMAXROW1
458,346,032 *2E8C163487A63E70FD92377F10669B47C060AB3C PATRICIANIKI
458,346,033 *2E891513793A5D47C78CC7330DC33BDE87B6149C [email protected]
458,346,034 *2E87AEAD16AE6473664396D78FF36982DD275DE1 p==B~O.~o.splat!
458,346,035 *2E879192ECD1C47AC202D6A7417547C59FC26AD3 DONN.LEVENSTEIN
458,346,036 *2E84371F63CF473F6221F6FA66D8B49BB3D1181C P=D~`(O_)
458,346,037 *2E8CCC531F3413B06087832F966BA3629AF3E030 PHILIPPMATTES
458,346,038 *2E8487992F2D603F31CA9CDB27C56AEB91E703C2 PIERRA
458,346,039 *2E8B12547AE1BDEE055E44B3CE9D37088F9BD653 DRAMMELF7
458,346,040 *2E8B1F157C55B7BEF77083EF5A3CD5B0AA02B4F2 plastograph
458,346,041 *2E8684FAF77EE87AE634DAB36F6F0C0E2E70BDCE D:"s
458,346,042 *2E81F60EE66268969D5BAFA1F20CB31D0C9F91D2 POKE.5372,.21
458,346,043 *2E843E9230CF5E4F3B9BCF94AB53362E99551696 DURANZA5
458,346,044 *2E8786F129977205FF22A406889A816E27DF8517 PP.16052-54
458,346,045 *2E8566E1287D733FC364DAC399D27C8835C96A04 p#p~o ~o(0-0)
458,346,046 *2E8AAC3449C27B4E8F3DCA989CDB04515854E864 [email protected]
458,346,047 *2E8F59E87E062AE442B56414F7FF2743BBE711FA [email protected]
458,346,048 *2E80F2F751543E50A207EEA8813153A701A02D17 PRE5ENZE
458,346,049 *2E8817E24B543B7A175E24A0A43A19EB9B891BBA PREISLAGGING
458,346,050 *2E8294C0B59B3901748C5244DAA1B36D478163F0 EA#v
458,346,051 *2E8FF4A9921C80FD5A72D299C5F22BB6EBB7632C Q|1L
458,346,052 *2E8B6D6C7A3D0F4B8180667ACE2B8B154CBECCAB q-----D.~O.~o(^_~)
458,346,053 *2E80B4050AF5E0F0CE0B3997F941627ABE629B95 QEUWIN
458,346,054 *2E845369174D110AB8AA6728FD706F95DE840133 EFRAINBARRAZA
458,346,055 *2E875E43C0956A3EA0679178B9F6AEC8909C2BE2 QUA$IACQ
458,346,056 *2E8DB6202B54DAB2003B481E3F302B58C326EC9B RAGAZZO.FORTUNATO
458,346,057 *2E847A924D65B33781E9A5686B5204E2A2EA7126 RAMPAGE:RAGE
458,346,058 *2E8D7DCD27CB1675425CDF8836FB6554397325B1 RASE
458,346,059 *2E826EE81EA42233B52DD13E9B5DBA73FD87F63A emery.dobyns
458,346,060 *2E80FF7B938512BB4DA3F7D246C1FB29C3A3870C rdfresource="http//wwww3org/tr/querysemantics/"/
458,346,061 *2E8AFCE9142209D4E2DBD6899A815C0602F5F450 REACCLIMATIZEDS8
458,346,062 *2E828C732C56DD448806451D7BC8EB99A4148E33 REACTIONSPROCESSES
458,346,063 *2E8784910D87C0F5C833AE6FB3AD07E568F5BD06 endereces1
458,346,064 *2E83A8E07DA344C496943BDBF8550939D15EC77F enterr
458,346,065 *2E88CED858D48EBC76AE3E2F112F223B7E021188 REINALDO.GJERTSEN
458,346,066 *2E8B2530F0ED4FFE645653C7F03CC0BAC129E701 EPLUCHANT9
458,346,067 *2E8FFA221838B21D1A6EC36D17446F802870D928 ERFLEEC8
458,346,068 *2E8B19192F40E6D5A48B1C70DD2168D98E5814C0 erikolsten
458,346,069 *2E8921FE6CE82D7A24537B168D5C1457962038E0 ERINGAWTHORP
458,346,070 *2E82A16567FC595FBAF723F2D282CA579798D62D ERVINWHELER
458,346,071 *2E8E02A521F158A61437DBA01E16B04B3BBD36D9 ERWEICHUNGSPUNKTES
458,346,072 *2E8DA5CF39DDA964FA1D626F27921AD0EEA2602B REYNALDO.HALVERSON
458,346,073 *2E8EAE0A6030EF3CC2471E994AFB67F46888029B eu4
458,346,074 *2E8C3A0CA0C47D6054559B7D4BD48AE9283EFBEE EUGENIO.GOEMAN
458,346,075 *2E8A11449E630B24D62852D043583058B08684DE rios,ponteseoverdrives
458,346,076 *2E870EAA25B5B7D8A8AE72B0E238B0EF6670B6D7 RJHR
458,346,077 *2E84AD40F5EF98DFC1ECF1F4AFE3BEB1F3378130 f44b9c33fd12351cba26c699d02b6bb4
458,346,078 *2E844D2E20E1B4317D2801E57D49198E076A65D1 RODGER.BARSCEWSKI
458,346,079 *2E8A3836C9CED142F77971F215B83353B712376F rodrigopettie
458,346,080 *2E8CB8E29FF9666C179546D52A3B105D7F2550F3 FABULH
458,346,081 *2E8C843ACD5ABDD72BFB6FA119E3B23DE78362DC rollanddominique
458,346,082 *2E8C11F964A5AD876D0D183DFFCC0275B008AD9A ronaldmelis
458,346,083 *2E8E90408AA40DD2CB8AABE6F890BEC361F0BB09 FATH3RCO
458,346,084 *2E8B1F9204F2D279BAA0092814C988DC5A5CD4D3 f\d.
458,346,085 *2E809C99C62577A36A94ABAD02C09FED529B071C ROSITSA-TODOROVA
458,346,086 *2E8C75458625F5A5B001FD62994306AB0DAA30A3 ROSSUIMARI
458,346,087 *2E8D3CB37D94B402FD3333C922B8CB7E7942E404 Roxanne(encore)
458,346,088 *2E8BFAF5CCA85CE8C7283E8867554755451D1E90 FFEB
458,346,089 *2E881DAAE47F8C7EA4365CF5786D1751AC021D64 RQE
458,346,090 *2E8712DC31DFC656A7848B0477111A04B4348D7F fighttohaltmorejewelleryquarterflats
458,346,091 *2E8A3DB9781965CE102075CBD9C7FD35DFCF16B0 FLOYD.CHILLO
458,346,092 *2E8EFBED40B68145CC3E282DDECF9636F7F581E1 foolsunny3
458,346,093 *2E833B4FBFB3FB6D4B2124E5EA2204C5D0BE1904 FOSTER.MUCCIO
458,346,094 *2E81ED4D0FE5A1CA4465DD0584D1BEE931CA935D FRAKKIR
458,346,095 *2E8A2D7DB7651FA8286964EB1EC0E3AFF1696689 FRANCESMOVA
458,346,096 *2E83EC43ACCDD3C1A890734581C968B3BAAE3A35 SALLYANNE
458,346,097 *2E8CCD55937621BDF581A773E96D892E15D8A123 f!rep1u9
458,346,098 *2E8F300578B5384B570AE72EAEFE21E20B5FB18A [email protected]
458,346,099 *2E824C5E80525BEA48A423E0D079D6EE7AD415B2 SAORET
458,346,100 *2E82D526458F74B5182CFFC0E734FE09787DC257 futurebeatsii(grillup)
458,346,101 *2E86C7225FF3A5090F02B222B606A8D35E732FF0 SBEFFATES
458,346,102 *2E83AE54546999008D6BC0D8A794E422D5BB96F3 SBRAUNISCH
458,346,103 *2E846AE550F16A56D43EB64DACAFB13E4C5018CC GABRIELKNAVEL
458,346,104 *2E844A4478A36A4F525C87552A0A71DD41A2C484 SCHIEDETING
458,346,105 *2E83936B2CDF6F99AD38A662BA725CA78A4FE059 SCHWALBENTÜRME
458,346,106 *2E89DCDBA46925472BE53708C2C44D32A76D8849 GARRETLAPRADE
458,346,107 *2E8A47500AEB556DBD0DD7FAC182F4930C2A5B16 GAYLE.BOEHMER
458,346,108 *2E81EFF5341E6E4123524921492572BB4B7228C5 GECMIŞTI
458,346,109 *2E8B1D103CBAA2E3283893F003B9633E409DCC2A GEDOSEERD2
458,346,110 *2E874900623D0B962362044ADDE8ACB49FA715ED serflike
458,346,111 *2E87FDAFA2E7FE0C52FC264BDCF57D7C8CB3282A SETERCXE4
458,346,112 *2E83432FC3EBDEED24BBAFE2E758C7369E5D3AEE SEYMOUR.KNUEPPEL
458,346,113 *2E8CD1FAF426DC0104C87BB434DE07B0325F489C shadowtalewikiacom
458,346,114 *2E8B28528D10D881D0DC84F3CDCF52A6E2909B59 GHAYSH
458,346,115 *2E8A06DFB6D7B33DC41095DC895D737F0A265FAD gigolostrappedinretrohell
458,346,116 *2E849892F3F300247210E4F0579A6BA39E1D3560 SHAWHEES3
458,346,117 *2E88A01F8BDA01D20F49AF55D4784F6F502F73E3 SHELEMIAHUT
458,346,118 *2E8114E5AF25815991E15FD42FB6B1C47F598309 shiny-zhu
458,346,119 *2E870F69B6F1E801FFD1C6D1980736298A0B09F8 SHIRLEYSHAPIRO
458,346,120 *2E82AD5A0D16092EE446E89ABCF9C1CB2BC612D9 GORGONS.
458,346,121 *2E8F6678FC1C580D04D40238BF3F00726329CFBE [email protected]
458,346,122 *2E8A349120967C68A08D6A5D3902F1FA596EF55B GRAHAMLOBNER
458,346,123 *2E89BA9FF784F34FCB718D3A15B959CE367E51F7 grimsifallegi
458,346,124 *2E8C630CA5338CAF308D4E55A177581F514E8F3F sj'
458,346,125 *2E839B451A4651D7F07F47C50D12C4162E59304B soft-rock-classics-(disc-2)
458,346,126 *2E8E49E47D53F1CC87754BE32692682B6CACEDFD sophoclis
458,346,127 *2E889F88B1E0EE9B6CC6BF08A967280E6C403CD6 HARTCRANE
458,346,128 *2E826CD3A0BC4B0D6AADB9A264673BEE1EBD15DF [email protected]
458,346,129 *2E857C2679E897103DFEE71448C30E7AFB945FBB SPORTS頻道的節目策劃及監製。
458,346,130 *2E80C8B14FB80AC046D616F31E6F0E8CD4CBEC68 hckscrnr
458,346,131 *2E876C99BCD5C7046004B04A71884E2D9C717D9B SREIRRACLLABWSB
458,346,132 *2E87190E1E2531F7226CCB1ED0808C4ADE313B70 ssalcxamwsb
458,346,133 *2E83FAB566649A3184D7B790BA584C24E2F0377F HĒMÃS
458,346,134 *2E817ECFD2A00A7E56DC16E965ACD2793200998D staceymcneeley
458,346,135 *2E857B6B099975F3B353CDB4271B94FFBAF9679F STACINATOR
458,346,136 *2E8CB7065C79B3DAF89C14F9C734AA046192D8CB STANFORD.BOCHENSKI
458,346,137 *2E8FCD8B8FBD40C0B150398543FB0244F944F305 [email protected]
458,346,138 *2E865AC12D3B3B169D2B4B2049AC165F4D2ABD3D STANLEY.LOVEH
458,346,139 *2E80641200E362F4D0CB83A152FF72221AFC2FD2 HERSENMASSA
458,346,140 *2E80EA8EF5A9F62EBC51B63057BD36579D58A719 hetsonas
458,346,141 *2E8622324D70355089AF2B4DE19E0C23101146A3 HIPOLITO.OGG
458,346,142 *2E8B966882A4D039A8F211ACB4C138E229544D46 stinný
458,346,143 *2E80F8EC234028C974B1C366735B0587DEAE0AC3 [email protected]
458,346,144 *2E8F92124F00C515C99C65EABE8AB1340B2E94CC STLOUIE
458,346,145 *2E82D5D39B1FE5C2C660D8EACCDFCB2AC93EA6D6 HOMOMETRS
458,346,146 *2E8F4CA86283E1F31C8CC68DE4FC1B34BCBA9EFD STUARTRABON
458,346,147 *2E8DF9B4A84377C254BC50343304B3ABDEB32A75 SUCERAIE6
458,346,148 *2E805B09B075B7B55901201FE4EFD731BF7AC857 horfield's
458,346,149 *2E81950CE703A9305F467044AD54357334574942 hreSchwarzfahren und Saufen
458,346,150 *2E8D65411FF56EDDCB2E3AD81AE23C7A5C4EAAC8 HUBERT.LAJEUNESSE
458,346,151 *2E8B801E00BA72A8346E3871D0EB664260904811 [email protected]
458,346,152 *2E839F3156C09940E4D4095C0ECF1C32BB21695C HUGH.MINETTE
458,346,153 *2E8ED76D98952B1F9330FFB3D478B5427A3B7728 Suss'dRecords
458,346,154 *2E8CEAD69FDECAFEF688D86E0243ECA280C0DD67 HYLDEBO
458,346,155 *2E8A64BF41998547A1AD6D2631D7E87D60331CB9 IAMLAB118
458,346,156 *2E8ED55FE9E12731EEAAE91FD38ED03889313FBA ILOVEMULDER22
458,346,157 *2E8201B0222E9CF2258C43B8A7D2BC6E8701BFA5 I'MEMPTYALLNUKEDOUTME,TOO
458,346,158 *2E880EF79E35CF5F03078B68F527F501150E1922 [email protected]
458,346,159 *2E893136E381339DA0AF6520426CA0A3A071F9C2 TESTERKHANING
458,346,160 *2E8BFA1A76BF6F906CCE8FD5135907F74D650250 INITIEFS1
458,346,161 *2E8A9E0DC004D1698D87EDABE3CE295A3DFCFAF4 t!ghtener5
458,346,162 *2E8AB843700069F80016E2CB3233C9D1DC4F4270 INSTI9ATED
458,346,163 *2E878FC7D421A0CB726F2B193773E5DA418B4E4F THATJACOB15
458,346,164 *2E8B872FFD100C137C5474941CEDFCF8EFEF446C INTERPELLAIS0
458,346,165 *2E86850262F643AB0A38B87904C75E4176FA939D IRVINGWILCZYNSKI
458,346,166 *2E8507EBB3CE9D3FC8AE7499C7C60AFD8538F575 IRWINELLIS
458,346,167 *2E8B397531BFC41ABE714B89127EB47CF1D313C7 (think)whereareyougoin?
458,346,168 *2E8787A75ABD8255AE20D36EE29803316823694B THOMASBARTEN
458,346,169 *2E8298159200C15417AD1A17B6A8A29943F437A4 JALUTAMAST
458,346,170 *2E8245180083118EE162AE27510283355F327E3F TIROMANCY
458,346,171 *2E8C6CC66C67BC4D561D146E8E18DCB5EB4CB47E JAMEFRIEND
458,346,172 *2E8DD6D35BDBB1FECFF7B079599594C35DCA3AF8 JANUATA8
458,346,173 *2E84C7591D37308372914F43C26C37E107ED0522 jarrettstiff
458,346,174 *2E83A25F8AF66F0FC1D3378B20BBEB173358A64F jasperscavone
458,346,175 *2E8F1B7E79D9C60D30D4A49B814F669AA2628522 JASZIME
458,346,176 *2E8DFDED73E5BD5649E469F9D9DF140306260FA6 tomradeke
458,346,177 *2E8B3047A37CF80E131B07067CAA5B8A2D7498E2 jaywolgamot
458,346,178 *2E811B7734909841672A6DD733EFF0D6EC7D396F JEFFMYSAK
458,346,179 *2E8EA42BD1E38D3CA03E85E7331698BB22799AED JEFFRYTRAINHAM
458,346,180 *2E88DA09F37C282A3F27537187B4875E3BBC0997 jennie-stepp
458,346,181 *2E884F9A8C2E8A3D2CC3F8F658C6E680D8A42133 “traducció
458,346,182 *2E8C88EDCF3A91D70FA0AA9C038EA0F24FF8D65E [email protected]
458,346,183 *2E8250E9C00A8EFFC0FE5EBD8BF03FF1827B3F24 jermainemoldan
458,346,184 *2E85C96319EEB7C3BBAD29C267FC4D45992531D5 JERRELLSOLORIO
458,346,185 *2E863FD082EFF897A35BEACDFE60D4C9B5B45B1E JERRH
458,346,186 *2E8EDF74D7567A9E987216FF8E2B6D6143B7CEDB treated
458,346,187 *2E8C866D5121D5808B40184F53B47CB623409372 TREUS
458,346,188 *2E8A1492DA115A90965F8E8182836F380C2EC9B0 triaenosing
458,346,189 *2E88E6F6A835CC1E5C2D37A7B67B884DCF22DE2D [email protected]
458,346,190 *2E8E2E256CBDAACC74A0ECFE50081E1C06238001 TRITIATED7
458,346,191 *2E8C71C001412BA4B21FEE24E1692CAF3D35234E TRUIDYMANUELITO
458,346,192 *2E8E2ECF664559BC55B0C7B766100E22A3BD9D61 jloiue
458,346,193 *2E859031B6B0EBF438B9131B91DEB13ABE248408 JOANNE-SALES
458,346,194 *2E80D2180003A22D5F7E924CD86D830C51F4B0FB tuathans.4.0
458,346,195 *2E8BB3D807F960AF82EA35E7088B23EBFDC6216B tuned.universe.(merlyn.remix)
458,346,196 *2E853D10ABF7702ACBD30F87E0924585886F7243 JOHNNYGUPTON
458,346,197 *2E88B1A0D51A3E077A174EA93B4670E7FA3DB285 JOHNNYWENTTOTHEWAR
458,346,198 *2E8124DBAC9AEF900F5D27F70AAC0783F4E81B21 JOINNINGGED
458,346,199 *2E80494AE8AE10518EC2A25AE459B8BD0CA798FD TYBLASZAK
458,346,200 *2E8DB8ABF2F10726212D3BC3907BCEB82B0CD1AB TYLER I
458,346,201 *2E8C2594E540D846ED37FCC4BB495596E1DA8DC8 tylerzentgraf
458,346,202 *2E879823BC08A456926CFB8AD44AB047B6731A11 tysoncranor
458,346,203 *2E8B1C7EB1FC115BB2331F33F21B7B04F8074061 JOSPEH.HILDESHEIM
458,346,204 *2E806DFAF6E0F6C432AD16B651F5B1A1AD1CD8DB [email protected]
458,346,205 *2E886CD0CB9410DD393B406A1F9375E2F48BCBFC [email protected]
458,346,206 *2E8A03BEFCA6A966634811141963132E9FD79DA4 JUDSONELRIDGE
458,346,207 *2E85CEDA9C21B9E5DFBACA1531CC5348E151DC11 juglandeae
458,346,208 *2E839BB33131FD119F74B7802654E22922681294 UM/*
458,346,209 *2E8E68C41D9A063C503FE62E9FFE3E6EFBBFFA9F juvenilestyle
458,346,210 *2E8082559220F71117D0B015CC3EF29E6D854C5C KARENSPAZ
458,346,211 *2E89E72CFFA2277EFCD95E62729AEE8C740DB78E kartusis
458,346,212 *2E8B70C77C2E0CFDD65E1D3F13D078807E16F206 KASHANAK
458,346,213 *2E8F1AA54D09F6F8EADB2853D3161446C7F1C8D4 [email protected]
458,346,214 *2E825B50A6A92165B883D6440458B4BE3F43428A KELLIEMCLAY
458,346,215 *2E8B59207B3A50CE74CF34B58E6CFF0E882CB9F7 KENDALLSOLTERO
458,346,216 *2E8D1A12B0F79EF3B0AC86810CC81A585CE9BB22 kendallsteier
458,346,217 *2E8B8EABE5DDDA8D3369CFA81E8082354AF5A636 KENNETH.ROEDER
458,346,218 *2E8670AE3BBEBB2B959B70412B12092C8DE60849 VACMAN2008
458,346,219 *2E83C95B826B4B8A3DB694D9AD5BA7AD0E5F3BB4 kernel machines
458,346,220 *2E85D7897989B780DFA41C09F550E06AAEDBDE49 KHADIDRA9
458,346,221 *2E845B52F4768BCFAE2AF402B833C638F98F4A1D VARICOSI
458,346,222 *2E8494330846C3000F51A02FF8F01CD167143029 VAUNTERY
458,346,223 *2E86F84EB0E03DC9B2FB0DB025A5B20701A2BE21 KOPP31
458,346,224 *2E83D570CFDF2C181E8A66E34433701772692AFF korzenieckim
458,346,225 *2E8666594435CA5E43EFF809471E56219B04BCBA victor.d.chavarria
458,346,226 *2E8120518D7661EBD9705D58956AB5F28BC7EF68 VICTORIAROYALMORROW
458,346,227 *2E82CC5F951FC40EBE577737F32D13BBE71E0C74 ktankengeschichten
458,346,228 *2E8675D23A12E65D5EE8A24F014E3C76B3F97909 VIKASH-CHEERANJIE
458,346,229 *2E8870A4E308DAF5F5E9EF4F970A8A47C98F2392 VIKASH-KESARI
458,346,230 *2E8E8A40126425C7D315FA77CCC4C66CA2BB8836 vimokshayitum
458,346,231 *2E85BF817068CE0CDCB746D6408F5D02BB5FE579 [email protected]
458,346,232 *2E88352A387B7FA5DDE8AB446741321593962953 landonhaza
458,346,233 *2E8BF2AAAF7C91F2C4F7683167E55CA9438D3A6A LANDWA1+ER
458,346,234 *2E8B3854E308179AF45F2CB51658DC9ADF585DD9 VINIJO-VARGHESE
458,346,235 *2E893961A0D25251CB19746CD873736426E458DB viperpmc6
458,346,236 *2E81E1A35713666253C2049DFA0FC5FC9E1B1D63 viviensebastian
458,346,237 *2E81F9CE3AFA222E146A444FA4ECC24A46BD2FE7 vtinstaggies
458,346,238 *2E8DB13581E36362CB00AE8D0AD714AE976211E5 lena501
458,346,239 *2E81095481CC87D21516A2F1777EE6CF0B5092B2 LEONBROGDON
458,346,240 *2E8AF50C5328EDB70F82CE848CF3FBFD541D12E9 LE PAYS DES R
458,346,241 *2E835DE866BF3192999235E9DC73A9F488917772 LET'EMBLEED:THEMIXXTAPE,VOLUME1
458,346,242 *2E8F5505B58481A1D921D4974D2EF35D3FFA263D waldir.arias
458,346,243 *2E8B40FF9D52AFE18E16C018D4121249C67284E5 [email protected]
458,346,244 *2E83437009F16624EBE6A0032B348436F03002AF LIBERTADRIVERA
458,346,245 *2E874AE8EAE3456E8DCB404F04EA81A08230EE0C LIKATU18
458,346,246 *2E86987386373C18D7E1371DDCECC8CF6C6BDEC4 LINCOLNSOUTHARD
458,346,247 *2E8044AC038C197A885656749628F2A4DFD4B60B [email protected]
458,346,248 *2E8F37961889DC891F852C4A25650AEF9D9B8A7A LIU_YAFEI
458,346,249 *2E87A98BB92B6AB225B73AC783C97B0F72691E62 LLIKSEL1
458,346,250 *2E8DAC22D2F1034E32904A03143E0765AF833C3F LMEELAN
458,346,251 *2E8F4912764A7EE70DF8FEF064DFC7D084935273 WaltzNo.2inCsharpminor,Op.64
458,346,252 *2E8B91CD1E3BF8092707D9DF1392769C5B777B72 locainn3
458,346,253 *2E8C3563C0034030557EF4D96FF6ADAA784BB395 LONGER.CHASER
458,346,254 *2E8E96F3B8138FDA436FF0FF57F365B786272E42 lontroost
458,346,255 *2E8DF85C50A54AA9BD29119A264C19A19A874604 WELDONRHEAULT
458,346,256 *2E81CEBCB7267C5B353F936635B0F7B73806A426 WELTCUPGEWINNER
458,346,257 *2E83AE73A6EA45BCFB3FB8267F74AFED3A7FA48B [email protected]
458,346,258 *2E8595215A2B38F486300FD2DBEC210C7C87F45F WHOCARESANYWAY
458,346,259 *2E8EB110138CDB220FC819EB3811ECADA0440398 WILBERTMCNIFF
458,346,260 *2E836604FC20D7688DD7CD65DF1EB1D99F825032 williedavies
458,346,261 *2E8BEEAEA27B6B6389F9AF0F49A41D9DB77F8A93 WILSON12
458,346,262 *2E88768AB066766D9CF7FB390ABB0224A3E0588C LYLEFORNO
458,346,263 *2E8C5413AC7551F9B95A4A1A9C2AF8EDE2B85FA3 lymanvarrelman
458,346,264 *2E8942970F407A01745272104A807A64A643C4B0 LYNDONPRUITT
458,346,265 *2E8F47D1A9B786F5E62BF5BC5D4E002F97830D55 winterlang
458,346,266 *2E874F799DB90B3AA32C99433473C2AA2B3D951A WJD.BBS
458,346,267 *2E82CDE11520B3DF34D44DA174157A12F3EC3B1C WOJTENKO0
458,346,268 *2E8FCC6D9DE47F920C5B4EF976B0FA57E694824A [email protected]
458,346,269 *2E84979E10E8FC733212A2B55722F53AF22D8709 WWW.ACOLYTECOMMUNICATION.COM
458,346,270 *2E82379450F42646D823FF47909667535B28D78B WWWAMATEURGENEALOGISTCOM
458,346,271 *2E862CC77850138A39FC225916AA32D444B89D3B WWW.CASAMODERN.COM
458,346,272 *2E8BC8AFA95C57D70B2E2BBA1126344FDEA9A88E WWWSTANDARDPARKINGCOM
458,346,273 *2E8FD1F38096B588B235B3148DB958373EB2C5A5 wwwwipe-disk-with-file-shreddercom
458,346,274 *2E852DA40EAF93E660609741FC2F80924640C093 WYSTARCZYSZ
458,346,275 *2E8753E906FCAAED3E0548373598475567310E66 MARCOS.POMAR
458,346,276 *2E827C2474C9A8F0BDAD30556280EB64B1864A26 [email protected]
458,346,277 *2E8C7C223E0D4538845CEB3528F6BBFE21F86553 maria.adames
458,346,278 *2E8DF41A6312D84B501976BE841A597166EF6AD1 [email protected]
458,346,279 *2E8AD04625D82B087B8EB1A3CDBC5761EC0A7BB3 MARKBURRITT
458,346,280 *2E8C3A7D111BE2EA7674A932F2598886AAE6C377 marshallhjælp
458,346,281 *2E81A18722D622860EA440D36C88CC34E925E09B yannalmoorewilliams
458,346,282 *2E8D2D82B681A877635CD0E65C454C345AF08FD4 yestor.1
458,346,283 *2E85E306CD0168062908EAC7065477F164621CC4 [email protected]
458,346,284 *2E8958712B5878655DBBF9F3F9B0B43DC9CDCC0E YJ-U
458,346,285 *2E84B8358086D4854E6714F3D12CFE37BC08C6CD MAXGARFF
458,346,286 *2E857489A60E0E8FC79241A8C7E1242643F560F0 MAXINE THAYER
458,346,287 *2E8CFA3C35DF2578376A315CDD9C7483C29FA54C maybethissummer
458,346,288 *2E8CD721EAFDD58042E9B0595523D32F3D343821 YP;*
458,346,289 *2E80091C7CC9463BC8D4DF0F01A2BBE22B8FAD82 YUKIE.HILLIARD
458,346,290 *2E8A2BE514AEA5524DC0D2526D0C33E3C1CAAC12 [email protected]
458,346,291 *2E84706C2A4317D2125C5904831E211FA0F68681 medimnaeans
458,346,292 *2E8BCB3DAB10B24C5E403959F2E8822FB336A998 ZACHERY.VINSON
458,346,293 *2E8B9775654D011E34AA9045E98B06C62981E601 MELVIN.TELLO
458,346,294 *2E84F0625CB929F02D4995176793F69C28605866 ZDZ4
458,346,295 *2E804797D2ADD45A20FAA2C22E70D7509F73EF4B ZELDA.DE.CLERCQ
458,346,296 *2E80D31CB33F0404EEA1B001D6ED0273D3688125 ze.videira
458,346,297 *2E8D418F2796AFC82BCE7605DE4579E62AB4AF1E [email protected]
458,346,298 *2E8C87CDA9185A317150FA58AE2726972B4CF364 [email protected]
458,346,299 *2E842EEF9C089CA1E665BFEEF108432FEC8103C2 [email protected]
458,346,300 *2E85D9F23572C7C7EA9B3618E8480FBB05A84765 [email protected]
458,346,301 *2E8634CDFE22EE89AE18EBDE156B8E97EA8A3A8F [email protected]
458,346,302 *2E82DA7FC10223D194515D79EF07A6B2BD056159 [email protected]
458,346,303 *2E883AAC3F45F2273C16126007FD9CDD514D9F69 zischlut
458,346,304 *2E89540DAC5DAC933CAF0DBFC4604AE6C6168E09 zolangernog'ndroombestaat
458,346,305 *2E8576CF63CF4B6A761B068BF76F61F1D2DF35CF MERLIN.GRAISE
458,346,306 *2E8071497FFF30B3C47C2C9DF595437FCAF6164C MERLINRINKEL
458,346,307 *2E86B3BEEABBCC3294CB119EADA47C8150BBD521 MERRILL.HOULBERG
458,346,308 *2E83EBAEF5F5AC0458FD6C341B963CB4B7B56C10 MICHAEL-SANDSTOE
458,346,309 *2E8986D71474763D220FF3E2C279348FE2FD0CC5 MICHALEFOARD
458,346,310 *2E84E82A04BC551B07BC8B2E34386016C3E1C16D διαιτητικό
458,346,311 *2E808E54FBE2364E2F2CC78A9E53CED4C536F3AE вачеги
458,346,312 *2E842D12CB3809A0E92632185BC9D8660FA644C7 minor15
458,346,313 *2E8D384F3EAC249ADD20253DBF31D65D449CFF17 јадранксе
458,346,314 *2E8879A7BFAD5D119D5B8FC4EBCA3E8E81C9B590 [email protected]
458,346,315 *2E8CCE8872EA8A2B870C6078AEDC31B98837AEC4 ломоколо
458,346,316 *2E8D943A5DD8DBF0521992CC7308B82A7D3846E8 ПРОАНАЛИЗИРАЛИЯ
458,346,317 *2E8D29E69F5DE93248882024FD61FDE158B249A5 Moni.ist.krank
458,346,318 *2E848E2373D739AE226A4C7494FA6AF31691EFA9 moon8eam5
458,346,319 *2E8276B107E5359B587CC7B553C96EC40961526B УДОБНЕЙШЕМУ
458,346,320 *2E895249DF864E1F811002356B3653742D0B7E01 MOTORSPORTLONG
458,346,321 *2E8F53D80378B176B4A28BD944BD08660E107D65 mouldy
458,346,322 *2E8E8CFC16243521A25FD8D9784A0AA966993C30 Msa1phab37z3d
458,346,323 *2E8315622F7AB6E374EAA138A0F5A4709C563DBD [email protected]
458,346,324 *2E88440B07A1FF2FCBFE014649975EAC60FC598B MUSIIKKIVIRTAUSTEN
458,346,325 *2E8ADCC78F24663E8CE4CC15B5A40860EAE89F28 [email protected]
458,346,326 *2E845C9A1B03FD0E393CABBE9415C08A0515978B N1270452196
458,346,327 *2E8AC050E8FEB8B30173A2CC60FF9C21494C4782 N4GV100LTJ13
458,346,328 *2E8B093C631787D0899123E6F14E20F18FEDB045 ドイツ国際大会81KG級
458,346,329 *2E8D052EAFB6A3C77614D45128E85D34874924DD nathanialsobey
458,346,330 *2E892403E5DFF639E318F4C326179917AFC7C02D ドニエプル発電所案(V
458,346,331 *2E84B3AE2E70999BDB9B938C0C7FFF1B3934A2ED NEPEMSTING
458,346,332 *2E8966BD7670584E3C7E080367597F8D213F774C NEPRŮSTŘELNÉHO
458,346,333 *2E853124142BFA75DA59A3AADCAE302339083CBC N`}G
458,346,334 *2E83014CB4271297A5A523ADA039D734E3B64D77 NO.WORK.(REMIX)
458,346,335 *2E86C4F4A1B128D7AA511FF5F871BE24047232DB NUUTAAL9
458,346,336 *2E82924BCA00FC1CDC30B36181F154DA6CCDDD3A O6|
458,346,337 *2E88CA82A20F5843B427907D5B09AEC788588943 oddilovy0
458,346,338 *2E835B6951CF6FF8D532280D8986AB26B3F7D87C 01-11-1272
458,346,339 *2E89B8999C6F8E40439FB6D9BEB2A704D32ED549 OMERNOTWICK
458,346,340 *2E8751D0DE61E079A8A13C9E22EA0ED01C19E259 OMOTHUPI
458,346,341 *2E8EE75066C4678094BC766C40DE701D5CBA9707 ONEFROMYOURHEAD
458,346,342 *2E8AEE4D41094371D996E4FAA1B71AB6F8D91F98 orendeily
458,346,343 *2E838640205796E344D4E88ECBE292D78A635997 (-_0)~-~-~-d###b
458,346,344 *2E81184282691D7C5568DDB2DFB2541E7ED73B50 ORVALMINARD
458,346,345 *2E882222D03443E365E89C2720C343870510F2EA OU7SWMMNG
458,346,346 *2E830F59B0D0C4CAAE07AE017678800257143772 10: 10 -# -& CHILD'S PLAY
458,346,347 *2E8CC6C67803A9EC83B114F64A4919EDD7CA6CF2 OWEN.ROMANOFF
458,346,348 *2E8E24747CB38FB37BAFCA11A59934DB02E3FFC4 PACKAGET8
458,346,349 *2E8D21A29E8C36CBC9002E8779EBD76C4FA828F1 [email protected]
458,346,350 *2E8CE1A90F38489B62B0BFC046644A803981DC14 PART-42/34
458,346,351 *2E8F9ACEBED1100928C76A9E6C54E27779BDF30F PB~o}O{
458,346,352 *2E813FF5FC79495ED920D2F049358059FA64E8B3 13PALVELEVIEN
458,346,353 *2E87902FB333F94657ADDCEC1114DFA5C403B9F5 PERIOECIANS5
458,346,354 *2E8411CF87EAE999F3CD8BC8E2AAA375DABF3234 1446916 eilisillan.suuren.toimintaspekulaation.j
458,346,355 *2E80F20854E30C0A0A9584F5DF8842E07A040B74 PERUGIOU
458,346,356 *2E82C81D0F8BEDB23F55FE6A86A7B6BD91CF62FF [email protected]
458,346,357 *2E83989B776665799C7A34CE6749045E627B07F4 PHILADELPHIA-HE
458,346,358 *2E86EB451CE6ECA3C579DB49BB1F1C3D5882C585 piano sonata in a major, d664: i allegro moderato
458,346,359 *2E878459BF1290FF8883C5ADCBB78DAA70C1AA90 PIETEPEUTERIGE
458,346,360 *2E8DD2000B86CC5D222DF297B65D05D33EC53776 18P
458,346,361 *2E80435AFB11C80C461B128B714CFC1B575505BF 192986 ACABANEREDEYDI?
458,346,362 *2E84E12E3FDE6164322AFAF3CB8AD91A40B6E54F plenili
458,346,363 *2E8CDCB62FE415A2D3EA942A08AE1E14B33725CF PMANAVARATHAM
458,346,364 *2E8F3193FF71E261FA3296FE6291CE9BD6DB0A00 PODEMOS1
458,346,365 *2E8A5029C0C7548EBE18E8C6D554A33C154FEE24 1.ajalooliseks
458,346,366 *2E803949F45BA1E87271857D409585978E477848 1 ALPENFAHRVERBOTS
458,346,367 *2E8DDDAB20D92D1E4F6640C27E713CEB50054810 1.ausflattern
458,346,368 *2E88A88B38CF378B4FEDF9EFD2140B167CFDD4DC p##>~o~o.)x(
458,346,369 *2E80E0D13D83BA21859A6CA420AAE77EC67C1F17 PORFIRIO.EILBERT
458,346,370 *2E80F42645682515A716C0464A1021907CF38AFD portugal,.portugal,.portugal
458,346,371 *2E8825C477840FEC717069D9C12E4BF79E6C7061 1cursedness
458,346,372 *2E89CC430E14B96EBB84AF4CA465848537AF1D11 1DERBLAY
458,346,373 *2E8A42B1F59B7A17D46E231969BD450B936403CD p==p ~0 ~o 3b<
458,346,374 *2E844EC9B489E6136F31BDE5DE404D638D09FCF3 pradeep-govil
458,346,375 *2E8A7B087CE1F38DC67C7940DCFD3755748D71F0 Prayer.Wounds
458,346,376 *2E829638C2508A54C6EF4A66D7EE4B183C85FFB4 preten50n5
458,346,377 *2E8D65031E6CCE522C301E2A96B8EC8A520E0338 1ILLWIND
458,346,378 *2E886E879A5E315F9AC2FEA21FB294770F7C6EAF publiclyrun
458,346,379 *2E89A6F89611A2FBA3F7D56849701E60959EC572 1.millionen-einkommens
458,346,380 *2E88C0AF11E0E07974B109DC8E891015C206091C 1mounte1
458,346,381 *2E8EAE0162F6E74D7200DD2927BABCFD8AD100B7 >-<**q#####B
458,346,382 *2E8D91F07C27553ECF8FF3E419D024B958233036 qgvkfohu
458,346,383 *2E8E4C144303B724C24FE817DFD998075B68F8A9 1Q2W3E
458,346,384 *2E8812D981714CBC21BB78A2758018C49736B07B 1ROCKMONSTER
458,346,385 *2E87C9496D10BA60A0FE789B905AB121D634EB0E 1ROSE-SMOTHERED
458,346,386 *2E8BEB8160DD1F6C18E07023F443499A9EB4632C 1-SCHATTENKIRCHNER
458,346,387 *2E84D8FB132EF98F1F163432F9C5E079439A9E31 quinngrieshaber
458,346,388 *2E88724DC883057421B3D0889534F067CCE4AFA6 QUIT7
458,346,389 *2E80BFC070D03444D2AFA1F2EDA0D4B29FD2D904 1touristikdienstabteilung
458,346,390 *2E89C0F8BDF78D19CD4C80EEE856A259EBC3CEA3 r3c0mp1la+10n$
458,346,391 *2E87298106C58FA2586D6F05A4EA6C2C137A3BA2 1.vbzwerkhalle
458,346,392 *2E80A9BC80E53FA5B9BF68C810EE6BF3C728A616 1.veijoni
458,346,393 *2E8DF23032AA2C9A10531248E67BE8CCBE2A50B9 1verkkoyhti
458,346,394 *2E8D13BF94B3F5E49E752B9721B686F4F1675E5E 1 x-teamist
458,346,395 *2E8E1C938A47ED16CDCCD7078BCD5EA74304C8A6 RAMPPED4
458,346,396 *2E8BC41B5652BAD39F252AFA9AA320A25413C610 Rappareiller
458,346,397 *2E89B80EB3C32E770C2932C8F583284BD1ACFEF4 RASE
458,346,398 *2E873722A8D8187BD454321E51B30A8164279286 2226344 JOUKOSSA.ON.TY
458,346,399 *2E80FA665C4B0ED07A10CB6829D1DC962CC882F4 2291638 aspartaamiajasit
458,346,400 *2E886C91E6FC778996B8B239612A395CDF45DD25 RECEIVIN9
458,346,401 *2E8C267335BC7F03BB76C6D5868C3C44FBC67412 RECONDENSEDS6
458,346,402 *2E85CA58E008D8EA2D1FE6C1D0A767BBBD3698BB RECONSTRUCTIVE5
458,346,403 *2E8F14763BF9ACB8140AA7E675FF261F6E258CC9 2486303 VIELE SIND SCHWER KRANK .
458,346,404 *2E819C4D4902DFE8AB2B119AAEE2BA76492DC965 reidwaskey
458,346,405 *2E8FE5FC503F12EF794D5EEFB4ECB61084992AD3 REINALDOSPAFFORD
458,346,406 *2E8B3D811DC795200DDFE3E558DEEF1064E62BAC 2608903 oikeusasiamiesviittasisiihen,ett
458,346,407 *2E8BC9F5D54F6663D21667320E428910EBACA1A1 RENEBRACAMONTE
458,346,408 *2E870EC6E34221851C8B54854FE1811DD2317680 2777281 oman.ja.kierroksen.toisen.ottelun.p
458,346,409 *2E8A1017C18621DDFB7DFD3570599E44317EB914 278953 generator cesitleri ve yapilari
458,346,410 *2E8A34E14FA64DFA6D18EEB73088D1F9ADC108A4 requiem,op.42:xiii.benedictus-sanctus
458,346,411 *2E88EBE89B04C6551FFA475BD1278EEE5790CFAC 2969464 KURSSINPIT
458,346,412 *2E87681F144F66746248D7EF44E02EED44E9EC02 29GLUECKSPILZ
458,346,413 *2E8A4D6C81EF7908C69D8360AB0AA651B6DBD263 2aug1866
458,346,414 *2E8DFC0404AEB2BCF0601E6D1AB766C9C05878A4 2 CASERELATED
458,346,415 *2E8279F2790744D8AD97D6B2931690D297B7FD8A 2expressiss
458,346,416 *2E8B69D728B74C0F7F68B69A0DD71F4415079366 2.jahnen
458,346,417 *2E8A304B89294A4E3A5D5767D72C7B8B56E6BFE7 2.MAAIL-MAN
458,346,418 *2E8B890798C2F4D5E8F439CC984D2A9A22420429 RICKYGEDYE
458,346,419 *2E80D95EDD899F6B3A981645DDCFFF4979BE6641 ridurli4
458,346,420 *2E82A0DE3FBEA4472BE7588A5D15EEF8627CC6EE 2TANDONS
458,346,421 *2E86D9C4BE4A3BDF761B66D5C17411175E403231 2.TAX-EFFICIENTLY
458,346,422 *2E8FB50ADBFC315B7BF0E01BEC7C034304A6F9FD [email protected]
458,346,423 *2E8A1039878A276BD39B4FF9BE463EFDB6B5C129 rj{\
458,346,424 *2E80E4F6C12D1DE8F2D2AD59AB21D4AEAEEF491C ROBBIEKRASSOW
458,346,425 *2E8A88AAE673CF3CFD55277B9D4F5121B667B7AE [email protected]
458,346,426 *2E8881A755D8546BDA6CB178A4AB3543825D069F 3ABELLEVILLE
458,346,427 *2E8CEAA8AD6D2FAB856BA7E3F0453EAB73DED92D robtinoue
458,346,428 *2E8B90B87EF974A6EC8EB7AA846667996D2B4522 RODERICKVISITACION
458,346,429 *2E8A55F736698864CABE0E4D18D5B9F4ECEBC104 rodneyhenegan
458,346,430 *2E8515DA47FEC699B4C0140DFE75E616C6714D7B 3EUROOPPAKESKEINEN
458,346,431 *2E821F46CB126580AB7F5386CD2A49B79F375E7C RODRIGO546
458,346,432 *2E80A23B55EC34F8CAA8FD12719F15AA05B062F9 rogeliometos
458,346,433 *2E8400383C7276CD3EC7F9F8981B7D85C102E502 3 LUONNEHTIMANSA
458,346,434 *2E8F94C3817C2289C9BCE1FB9A20262D1BB6B15D ROLLANDLEFAVE
458,346,435 *2E8D850770075B8813EDC233AEE19C9EB3254A9C ROM4AN
458,346,436 *2E844E1DF6C5E63642034FD69F44BB912B19F0E3 romeowaldvogel
458,346,437 *2E89931B21813E7E92767411D992BB324E7C78F7 [email protected]~O~OO><
458,346,438 *2E8424A10621C8DE939BA9ECCF7ABA006175E57E ROSHELLMARSHALL
458,346,439 *2E899A8C97FE059150AFFF47B9257A0EB56F6A1A 451627 RESATBEY-244-.-SOK-.
458,346,440 *2E87A80F9E5BED4537492D42813015499CBC6D73 [email protected]
458,346,441 *2E8DC4DEF2B8F44337AC9A22CDD13FE887A43291 46-fantasian
458,346,442 *2E8D22D1D686F38505AE2DE5ABD6BDA5BB068659 472483 MITTENDRINSTEIGTBEKLEMMUNGAUF.
458,346,443 *2E8081664B40A586B2AEE043B017A80D56766239 472552 KEKE:-MUNMIELEST
458,346,444 *2E8D215EFC2E863D8FC2752382698F57599FA35F RUBENGONEZ
458,346,445 *2E8DAE859DF112141C6BC5822FEE748540731BFC rubinholston
458,346,446 *2E8058DF780AF4B80BF0B7A26305AFFBD9C845DB RYANNEWPASSES
458,346,447 *2E8191AE2335FB914E573722FEF4AFBE5B7EA557 ryan.starace
458,346,448 *2E832F2DDFA5C43788D2DF635E6B02CADF3A0CDA SAKIT-OTAK
458,346,449 *2E87F6BDC324C97982AB7CC88F785B3E4364A81F SALLYANNE
458,346,450 *2E80E9E69CBFB56E8DE2371978EF4B9CDDB5348F 4-P
458,346,451 *2E87AC6E9E38C51D7BDE918983CF8A4F7A62FA6F SAMUCHAKSAMCHAKPARVA
458,346,452 *2E80E2784EC32645848B85BA762B5612D1FFBA47 SANGOSHERRY4
458,346,453 *2E822174287D93243E508D777146B3498BAFB9F9 4WILLYHERMES
458,346,454 *2E8AB7677D284E0FC22CD555A8EC53FCABE4EF36 sarcofagodogm
458,346,455 *2E8EBD988D2D37E1687C1E87C54D06F86BB2BB08 SASHAMIRAGING
458,346,456 *2E8FE64236A043FD6EC8DB5114D971A47D629249 SATULAKORKEUS
458,346,457 *2E8C7B907F87ED07F9D3C318EC742AE93F9A65CF savingly
458,346,458 *2E813A664AE93BA9D88494AC8B67ABFB2E0FDE1F SCHNUERSENKEL9
458,346,459 *2E85F26CD0D0E677C017D798DC6EC138DD4DCDBC SCHÖNBERGU
458,346,460 *2E8ED2F4262DC0C5AC4F18CBD89355B1EF4BFCC5 5DAINTIESTOTASTE
458,346,461 *2E89AD9A335CF7B5F7683DC33C4A823127268620 5DP7DFFMDVNN4
458,346,462 *2E88CACE04B390260C7247C234648603FF14C3E9 SCOTT.BELEN
458,346,463 *2E8D033CFDCA8DAF6B4E1528E44189E6F0E9B9F2 5iluvcoke4
458,346,464 *2E8509F452AB03F7DAAA79BFEBB540BDFAC32D15 5 KIEW
458,346,465 *2E8F9DDE4C9D8B6C41F76B363F18600D750FF575 5MIAMISHORES
458,346,466 *2E8FB10780B6ACAD7FA408378209958B36770B79 SEFORII
458,346,467 *2E8E7C291C332506E9A475C554EEDAC04B89B53F sestertia6
458,346,468 *2E8833855A651290082A79C938F03F5E56C0605C 5SPANISHGODZILLA
458,346,469 *2E8D1D0FD774B8D5C9341BC7C254BC608BEAED88 sha・la・la・la~i
458,346,470 *2E83609BAD95B2DEB173EE3FDF556F6921315F48 5-unihealth's
458,346,471 *2E89A3AB7986F1B87A0D4FB1FB324B0BF74C9784 [email protected]
458,346,472 *2E8EEDFB7766E06F62738376F2FFEAD7A5AFB479 65076 '-team-p
458,346,473 *2E8B153AECAEBAB99D2647BF952EE44424A91683 SHAWN.ALVEY
458,346,474 *2E89E9BEE810674498916D6717EC11934DB243C4 6CLOVERSKINNY
458,346,475 *2E89505EBFC5F0C808F981A61FD5670230E54DAB 6DISTANOS
458,346,476 *2E8511464E1347AC7778EF3C6A7899F53CB9454A 6MUGLAVZXZ
458,346,477 *2E82DCDEE8AB08FAB24D40EF417132DAC78052A8 6NASIRABAD
458,346,478 *2E85522B07897329223CAC1469A3B888EF979CA7 6ORIGINALLE
458,346,479 *2E82D1D5940BDB42AF54ADA6FE24ACD944170D2B SHISHAGOS
458,346,480 *2E88E4BCBAE49592AF2C0F2176B363B29C8BDA04 6PUGGLED
458,346,481 *2E8F1FD52C90F8DB11A257BA87ACF55FCF67403B showerpower
458,346,482 *2E8C2AD1585390CDB217C31A4E227F94DAC9275D 6SIXSHILLING
458,346,483 *2E85AFCA04651F0670AF4C1D4DFDD109CA4F5A28 SID.SAR
458,346,484 *2E8667D5988BC180D022290870E5892A521DD228 7.10.1240
458,346,485 *2E80348AC6735DF3E05EC5D0C87D69392C399A98 751thomas
458,346,486 *2E84103A5CC32613A5D18B889510682E519C58F6 7ARITMETISKES
458,346,487 *2E8A161E7ECC593F50D2831FC3EC9333BA48B90C SKEWJANED
458,346,488 *2E8FE182FF59F9A50EB69D3C6492419E0EF5782A 7BSWAREASESBSW
458,346,489 *2E8F6F0427098C960FF7928CA5F689FC633A81D6 SLESIERK2
458,346,490 *2E898AFAF6CA5C57FD7548110A4F52EBB1AABEA8 slettit6
458,346,491 *2E85F2958B1D4530C80100303AAA41FB983A8348 7ECONTROLLERBSW
458,346,492 *2E8105C65A2400BA236B1D71CCD5D3176ED7F0DD SMADDERETSED
458,346,493 *2E8CB8C5301547A483DB46445E99344987156FAF SMVK7799
458,346,494 *2E833AF22E1F5CBBFDE88E6199D6DBAAFE8463B9 7march1188
458,346,495 *2E8C9E41A5A521C2DC996FF0B6E993351FD55A98 7POINT9CUBICMETRES.COMWWW
458,346,496 *2E820CD2BEF0C9A15A454CEFBFAD4B4EA4E6EAAF Sonata-for-Piano-No.-10-in-G-major,-Op.-14-No.-2:-II.-Andante
458,346,497 *2E8CD6603ED7010F5CEDA694ECB13797DD8CC659 7SELCRICER
458,346,498 *2E89809044B9B2F3481BB1625AB400C51BFD94E8 sonnyhalloran
458,346,499 *2E8B321A51A67BF45F8B76A985F208C0D822600A 7THATCAITLIN
458,346,500 *2E8EFA308722E82FB6E554149699E08465C35F16 80211E
458,346,501 *2E82474B355206E2BC2ACFDC9BE5F418D9830CFD SPATOWNED
458,346,502 *2E8F9085962BF41C10131FDEA18207D1D5CB730D SPLAT.O~.0~(===P
458,346,503 *2E8203B8D06EC3E51F918E2AC57E42D7C78DB728 8BSWVALTRONICBSW
458,346,504 *2E874659EAA1B1D372C4BADC2B2FB5F26B985D27 sputingged
458,346,505 *2E85ADF8769B2D87CCC6FC9E78FC971C1E5FDF2D 8D ~O~O(O_)
458,346,506 *2E8B4262635B8B100F9F923B8A74C9C0FC319551 src="http//ecximagesamazoncom/images/I/31XY42R80YL_AA115_jpg
458,346,507 *2E81049BE25E85F7E2E1CAAE7D24F834E7EE7481 SRDDAXAM
458,346,508 *2E835E4814808C542417C710B351640A3BB73B54 8.LEBENSBEDUERFNISSE
458,346,509 *2E8890607597442908D5326912383A79A70498B2 8LITUJETE
458,346,510 *2E8B53DB04A68B5AA364884F7E0DF22321B354C1 STEITZER6
458,346,511 *2E82D5980B3161FF58E1A5DB43FCC26DC8014F0A STENSIOONOTUS
458,346,512 *2E81B8E3C810A1F052B3601F43AAD62A649A41E4 STEVEPEEWEE?
458,346,513 *2E8E55E2E21FB56D8B018FB01655078687FF4337 STEVE.VALLEZ
458,346,514 *2E877302428462C7CCA5A07A5D5CF6C9FB42F4BE STEWART.JUART
458,346,515 *2E859F10DC6B2B222410A55B5BD582CB81181355 STJACENT0
458,346,516 *2E8097E3C698D72D488FE5C5A436AC957BB2B15F STJGENES1
458,346,517 *2E80AB421D60238A87620CEAF99CE3272A5EEE22 8PREMEDITATEV
458,346,518 *2E809F99957B55B2338677DFA939CC2329616B38 8PUSSINESSES
458,346,519 *2E8C593E296A540BF0A927019E424483120829A3 8SMILESANIMAL
458,346,520 *2E85EC81D1783A96E3C51CBD399B845F21A065C5 8SPECTACULAIRESES
458,346,521 *2E8E1628EEBCCBA04764BFFD81EB068BB9F37BC8 [email protected]+ng
458,346,522 *2E856B7EA20AFC3DCD1A38F10DBF749F76ECAA04 SUETONIANARNM
458,346,523 *2E89046C818683E8B93019ABF81BFE4345983A35 8STUDENTPSALMS
458,346,524 *2E8AF429B2CF67C2B277970430E0283154B8D0AE SUGAR(TREVORJACKSONMIX1)
458,346,525 *2E8A54716EC8B0EC4695E79FA8B4FBBE3744B5AA [email protected]
458,346,526 *2E8614B877EA38C0898B3B9CDE4577AE9506C5DB 988OU$1Y
458,346,527 *2E8CA94CC686C831C54AB16F66B629880F6C82F1 superiorscozasuperiors
458,346,528 *2E8808CE2E192B140CCFB8A780C059B4BD4DD7AC supermunicipal?
458,346,529 *2E86D819DA37253D2DEEC1AF5EC53C5E0CD82B89 9BSWLUFECROF
458,346,530 *2E833287858E755B9EBA401A2B3BA22612433766 SWRUNG
458,346,531 *2E829B705BE51812741EFD8C29ECCB49CCC298FE sympatiske.fisk
458,346,532 *2E861030E025560FF88E35B9D117A6CCCF08D86E 9iamrouge1
458,346,533 *2E862A27041E46839C63AC1F11A2D55C55C30DF5 9KEITHJESSICA
458,346,534 *2E8DA842BF1AE4ACE76975932BB1665CF689D98A 9KENNEDYSTARWARS
458,346,535 *2E803013CDA073FF8ED9D5EEA199F35C42024435 tadsturrock
458,346,536 *2E8BB8AC34E6F8126D8591B8B0CF3887C3D5FD6B 9KEPZESEROL
458,346,537 *2E898CF721630B1123DBCB030473D5C59F51D75B takeltjes
458,346,538 *2E864CE74D92E6D178A858602FF3ED848BBC7FAB TALK9917
458,346,539 *2E818E3CA7BA83F99A373472B6C421F722DB8F65 9NTRMRTC
458,346,540 *2E8FD338C0712798BFEEE2C2B3A6A29D062D486D 9OPPOSITIONSOFTEN
458,346,541 *2E8C56F79F1EAEB73A39ACB3115CDFCDC7FF192A TALKTINGHTING
458,346,542 *2E8836CA9FCD87E2A345E1FCAEE4D4FD803BE941 [email protected]
458,346,543 *2E891506499C28343CF0A4F4C11DC2A1AFA167EF 9SKIPPYBERNARD
458,346,544 *2E8266594614FD22421D6A31B2AFD12B80D7B716 TATTOOSOPHIE9
458,346,545 *2E8320472A7BE8D0EE594DDEA871BEB333981806 tavork
458,346,546 *2E853EDDFB81FF038E077E5F48EF87971E8C0EFC A?%
458,346,547 *2E8281513A437B064CF15F8134B24584EA22E127 TEDDY.GOTTLOB
458,346,548 *2E832ABBEC276A6C721E59ABE91FAB10BCED8151 TED.JARVIE
458,346,549 *2E838D458C7A433A22B1FF3F6C210649A607BA3B TEIINIENING
458,346,550 *2E8AE8DEF1F82315B3B9FC3E2F5A4F634A03F421 TEKCOSNU6
458,346,551 *2E8E39E9F97C30BB4AA2EDC85124204E86F67460 A,4C!
458,346,552 *2E8B555CFCDAB9F5D029C7175B3330FF636382B3 TEODOROSAUCEMAN
458,346,553 *2E8AF09912A758D8D85B18BA5172764E5C743659 TERESA-EVAN
458,346,554 *2E85E6B42AF2814A3486195EE78012DAA597660E TESOOSET5
458,346,555 *2E86847A7A71C9CB84E4BE04584D865BFA3F4D0E aaa&l&
458,346,556 *2E8397BDA6837AEA4CFC64F6A5062E0A831CD682 THIGHBONESES
458,346,557 *2E822C4CF0DBF2358246F446E2BC935794FDAC01 ABOVE.USERCLASSIC_9
458,346,558 *2E8A2D02B087C050342E371EB93ABF36779DE4C6 ABRAMDOEDE
458,346,559 *2E839A660A5F53AAF7F3535A8294F67AF8888D6D AC~#^
458,346,560 *2E8F9D41D1E4D34D99E1D274A7EB136DA74E2F95 TIUKOKET4
458,346,561 *2E8F8B02723695DB5E6335044F8CD3D4F7C97D64 ac7qr
458,346,562 *2E83F64D186CC024C6AA9D6E558E9FC8E019483C tonjones
458,346,563 *2E82F383D355ED0280CDBA198EEF64B554BCB16C TONY.GRIFFARD
458,346,564 *2E8A798FA624F23B58E53E3CC482275E8E01CF98 Tony.Stark
458,346,565 *2E82A2FEC2819D4CCD13AE1091CF02CA0BF4268A torslandas
458,346,566 *2E89954837B6666BD6C5A2025281A6352898B02A travis.camac
458,346,567 *2E825A523DB4E3990F89921B46EBFECC071B9F2A TRAVISPLEASANTS
458,346,568 *2E89647A7280BB4278424F15F25418E0CC8C1AFB Ag0$
458,346,569 *2E8D988C7DF8D42CA2A50537B1211E22AED4A8F0 AGHANI-AGHANI-(GITANO-GITANO)-(FEAT-SEBASTIAN-ABALDONATO)
458,346,570 *2E888C9A6C705385DC9D7A304F11ECE934ABA6B5 TROUBLELADYBUG
458,346,571 *2E8C84E1A90C16723AF6DFA330364B4EDE7C7B4A ahal
458,346,572 *2E84375FCFED59E99BB0E8E3CB997FFF71EDC2C3 $TUDI4MO
458,346,573 *2E8DA708D8BC2F84D1CA27FFA2636BA151EFBDB0 tuosta,josmalaulan,op13no5
458,346,574 *2E80F6F9D423B58C2173D30DD0CD04E52A5CBC63 U"BERMACHENDE
458,346,575 *2E84FB3F274E78C6B6FE42426A06053F07DECCCD undouhou4
458,346,576 *2E88F038A1444CF854137808BC14767B46B0CF17 ALDO.PICKETTS
458,346,577 *2E8CA4D4FDEE2FB346F0FF4CABF30184960624C3 ALEXANDR.GRIBOYEDOV
458,346,578 *2E884B181A1EE34BD06A0F892E25CF499BD9BB8A uphills
458,346,579 *2E86C193F0B8C938300EA20B5CF75E32EFE5F359 alfno
458,346,580 *2E866A8F02EB3AFC6BAB521BBA894B027C91B18B ALI.VEROEVEN
458,346,581 *2E82A98FFE20D1D460A52B451A5853EF47283749 ALIYAH NURJANNAH
458,346,582 *2E8457A9AD7CAB90571D132515A08373A942B6C3 allerd
458,346,583 *2E8910CEA0C93C705387BA1DAFDC25FDB1E1FA15 ALTEWAHLEN
458,346,584 *2E8FAD13B19EB123198A76F9978B11759EF7CE38 valstambach
458,346,585 *2E8A71629A610511A75AD40CBC489DA0E0C79F3C amb6!
458,346,586 *2E81AD9126A9BCF0B28B23C14752A1D726747D18 VAZAMUNIZA
458,346,587 *2E899552E70BFD41526BC1C064C94C178FFE65A7 VELKOVYROBNIHING
458,346,588 *2E8E56F8CF6A9C8ABC4544AD4463D3AB49A1580C VELVETVIDEOED
458,346,589 *2E8C8C82BC8187D04DB36F3F4B37346926A8013B VERBELUN9
458,346,590 *2E81F72C77E2C00A8839D741CA265045433D2C5F andresintzoff
458,346,591 *2E8F0D0CBB9DA13ECB0F009B039ECA577B5481BA AND WHEN WE THINK WE LEAD, WE ARE MOST LED
458,346,592 *2E89D9870C592DFE22BACFA827642B138CE45322 VICTORHYSON
458,346,593 *2E8323FF20B2A0990797F8DB9819B507F6F24CAD ANIBAL.FILAN
458,346,594 *2E806450B4B60883739D4FC7884A17F732DBE20C annebbiava!
458,346,595 *2E85C836A7307DFE3925759840D8645B23023AFA antisifili`tico
458,346,596 *2E8059A1F31C2B1ED6805141A53DCE5006B0196C viola-omeche
458,346,597 *2E8FA332AA8F708876D26202149547D15DF66044 VIRGILIOHIPPENSTEEL
458,346,598 *2E832C8A8C916F43A4CB4AE172CDAE330297C601 VIRGILIOTAMARO
458,346,599 *2E8B2660CBAC22CE303463B195F84F83CB0C3663 AOS#+
458,346,600 *2E8219D0F61EEDA6898179D32B1CF652E7CB6618 VLASTITO-2
458,346,601 *2E8BA0495F3FD42E41B644C736C4AEE32FD41252 VON.NIETO
458,346,602 *2E8A3D6D4F8D30BB094084AD85BB73B88E051897 AQUVA
458,346,603 *2E85218FA7962D7F795EB0CCB247960BDD870925 ARESALUTE
458,346,604 *2E87B810CE3246EE3D6280ACFF8B18E135DC29F4 arielbidlack
458,346,605 *2E89C0BFEE87C06C8FA67FA0BA6216E0677BB8D4 arlethiawhite
458,346,606 *2E8252E4E780DF57B415050806AE9F5F68A5F3CE ARNOLDO.POLLARA
458,346,607 *2E80E9F2B74486D0CDD5AC5396F0880294366E35 arnoldspiegelman
458,346,608 *2E8FC1E6A279AA02F9B6DA2FA0B83A00A7B6CA08 waleed.bin.ayaz
458,346,609 *2E8B459867231874C2CA86522AB98A971942F0DF WALLKANDY.INFO
458,346,610 *2E8A1E2E1BA5805DDC455B541707C58C7572658A WALTER.HAMRA
458,346,611 *2E8ADEBD7D857E151FA91E58A9CB59D96C6ED914 WANTIHA
458,346,612 *2E811A4728858C0863DA2B2EFA62B5F71EC2C014 WARCRAFTBOOGIED
458,346,613 *2E8775703B871ACCF9B5A4E7E3D2FDDEF631E8F2 WARDWESTGATE
458,346,614 *2E89C884F5556A6F5A051C19A04D42D05504FD40 warracres
458,346,615 *2E8E9A6B3696A64FB38678C2F7CAC128C34D2FE4 [email protected]
458,346,616 *2E83D64572EE90CF701226EBDB99B871A101BA41 WEIßIRCHEN
458,346,617 *2E8ED2A8336BC57FA0BEFA43549D3E238E1F987D [email protected]
458,346,618 *2E8543561269E394C5D0B3BBFBB59FAC8FF7492A [email protected]
458,346,619 *2E809E1A5A0171ECCBCF268F8E59F894638751D0 AUGUSTINELEVITCH
458,346,620 *2E81F10BB03A94C525643B0A7F9BB891954A4ED4 AUITUMQUE2
458,346,621 *2E8F0E9E8EED0C621486C09041BD0CDA1CAA618D wetsontwerpen3
458,346,622 *2E87F14A7AB9CAE418D62393BA0228A2F39997F2 avf25
458,346,623 *2E8AB6AAA349D144860435AE3083AD3C7B1CED0A b00o8
458,346,624 *2E8CD396D45CA4113DA0C99DB13A0C2D3540BF44 [email protected]
458,346,625 *2E8143D147B5C5BF6E87472CAF3E49365248131E [email protected]
458,346,626 *2E835293CFC95FC82F0F354FBF187C6714494C3B b7b"e
458,346,627 *2E8B912529FFEAD41B5299B968186484D8DC72A2 {X}.`<-----3
458,346,628 *2E86C22A6E52709C52E60C9B6295313F1FA7A955 BATE NESSE PEITO MEU
458,346,629 *2E847827E41D1D9EBA578CB4C49358E0BC57802E bd~~~(>_0)
458,346,630 *2E8B0C9854D478F458DCBAB640E8BDBFCD706F08 bd#sf
458,346,631 *2E8B0069A52F2A210ECB430C64D07629AA6ADAA8 B!&E-
458,346,632 *2E856F4572C4A9868CAEE82711BD54F5C71576F3 [email protected]
458,346,633 *2E8365D3195C3E84DAA462F34EA8B93C7D43E773 BECAUSE I GOT HIGH (WRVW NO EFX-NO SEX EDIT)
458,346,634 *2E8B9156D88FF5AA1BF8B31C8026AD293D4A519D YENMACAPAGAL
458,346,635 *2E8C39AEB7A901F1B41F556A7815A83D6A5B7624 ym7]
458,346,636 *2E89A4C3F58671552F98F950BF93081438540ABB ben-bodine
458,346,637 *2E8DDAD9EE3E8FDB2C769C09E8623E1C0938BF4B YORDANOS-AFEWORK
458,346,638 *2E8C64FC8A1E6BF232AF29CB6B5EE33FE016E42D YORKSHIREI
458,346,639 *2E8C4DA4F2D41B601EB543B0DE4824DA99DC2861 YOUSEFALHAG
458,346,640 *2E8ED3E797751AA5AFD0DB8DD9428B7AF1D6E51F [email protected]
458,346,641 *2E8A9067F84B9056DFF6D92B88FB6C497C7941D7 yurimcclinton
458,346,642 *2E8A3FB6C7AEC63A80F9BCD352782EE97C2E3457 yvonne-bizot
458,346,643 *2E8721228CBF0DBF16C267384659A6D5947DF56E ywa-lim
458,346,644 *2E8EE6B6211E34B50CA1076EAC10C297A15319D6 "Z[
458,346,645 *2E8A64E272DB70A8F3C0014248BAFF947C8BE026 Z8+X
458,346,646 *2E8B7683541AFD507FA5A09FA1268B3BCA700087 bestanddelen3
458,346,647 *2E8025E99A0DFFE68BB77234DA242D8729E1FC8A BEW
458,346,648 *2E822F07FCAE967E25C10E88D36BAE227E493ECE bfsip
458,346,649 *2E84D1F0EF4EB5CABAAF0354E6B279E6F75AE45D bgy:
458,346,650 *2E8ECEECFE73AFAE5CCB91542BF155905CE56B34 [email protected]
458,346,651 *2E8C761B806F61DE55D7EB8468A03032D70655FE BILGORE3
458,346,652 *2E8A8DA0247DF90B4D163F502CE28EC6054EA969 [email protected]
458,346,653 *2E87855EE0070E783BF0EB64FF3D6B80A7670AB8 ziyanda.ndabisa
458,346,654 *2E8E9C02298FB198504FA3D8794C8393DC2F283D ZOHRAJAN
458,346,655 *2E8228D1B0BD9884FF38CA5E0D0E786D53E8CD8F zynjie.lee
458,346,656 *2E8A9A1F6B26100A9BB819D3A97FFEB1F5083E6A ΑΎΤΟΛΕΞΕΊ
458,346,657 *2E8ED0BF2BF5F6E875D6A368182EE909D0C134E3 τρόφιλοσ
458,346,658 *2E8E7AE8DB6E5EED10833F5B59B8DBCAC1C09AB0 ГОРЦЕВА
458,346,659 *2E8EB57A93A9F2500CB2C6E58861BD5B4B67E8D4 ДЕХОМАГА
458,346,660 *2E815AE3A2385B49E8C284F04304CB44DA214509 BLISSFL5
458,346,661 *2E8301E078C0074509EB2CF327A0CE91287CC29B
458,346,662 *2E89CFD1326934F27D8E7142DFCE43C16C513946 
458,346,663 *2E817568682054C4559E76D38ACAD65B37214A63 EWvn{
458,346,664 *2E88F822CBF1E30D6090499A434C37580433FBCD BLUEBOY/THEBOYWHOKILLEDTIME
458,346,665 *2E89A6A81932A7EEA03E6F7E09B7CDF6F38E9035 L
458,346,666 *2E817103AC0ABA235239C7824F8312757B6DEA0F
458,346,667 *2E822AF5AA35143348D0E1834754E9978E13B5FF BMOLY
458,346,668 *2E8394B5FA7FEAFCBA498E2FF1FB4E53AEB130A9 Bogomila..Verfuhrung
458,346,669 *2E82F742434336961A054DE12AC590AE9DB68D8C BOILS.ORGWWW
458,346,670 *2E8184BA0FA32ACAE74226933A5D67E473F89114 b==>-~o(o_-)
458,346,671 *2E87F94444FAA750C3C42DBBC69C2EB57EC14314 04.19.1282
458,346,672 *2E87B8B97432D01FF269ABD1C6A36A2C4EF4CE75 brantdeflorio
458,346,673 *2E875A5035D17C064A5E75F6F2172E2E5251E70B (>_<)-0~-D====P
458,346,674 *2E8CB299CA8D8BA3D2C63A2570BBFE824543A1B0 BRET.OSHER
458,346,675 *2E819E02683CEF636D884E2539CB81A666FB4EEF 0sun0
458,346,676 *2E8E6CF63BD1AA6C4508CC0C227E7B67359A9CB7 BRITTLAME
458,346,677 *2E806DB538AE254B610A7D5FC6E49B5F7DCF50E9 10-gildon
458,346,678 *2E8ED96970EF86ABF451AA7AB17B891AEA300E4A BROWSKIMMING
458,346,679 *2E8F2790D9F919E7B7200FB5F2D87B0874D824D1 1146375 DAS-KOENNTE-DIE-VERHANDLUNGEN-2002-INS-STOKKEN-BRINGEN-
458,346,680 *2E80ADD87199E06EACCE7E66A15601B234A69E08 1151053 jos-t
458,346,681 *2E855F47C5278E2ABF71977D4E44112EFA0279C7 11.schuetterem
458,346,682 *2E82304B1D546C6E16832404C3001E8C9F014D3A 12.08.1318
458,346,683 *2E8B6AD32790ECD8D0B5E6C4DB238BB1C10083E6 BSWPN
458,346,684 *2E8B5A625E49833DEDA01D4EA7A7ED2B111A15BF bs.xr
458,346,685 *2E8401D41C09465675C2BF4A2826CB8C6AEE6F4D BUDGET ITEMS
458,346,686 *2E8F39472C9EDD91353A54267AED8887096D3C6D BUK+N
458,346,687 *2E8B61028E471E99D0978700DAC13563AA231802 14C+4+35
458,346,688 *2E8D3443037DFB195D2B4742174930D1F919612B c"47r
458,346,689 *2E8B8A8EF3A9B01E32DD94D615C3EBA6124F4ABD c6urr
458,346,690 *2E89E44CFE5F3C6A017D64B2219FEF8ECAA8B06A 1AEKUTATS
458,346,691 *2E87291C254300C20AD6F0273966120103BFF371 1.ajosimulointitilassa
458,346,692 *2E828CC37395BA5038B02CD1A45F69D4806AA2B1 1ALAEDIAT
458,346,693 *2E89D9D3B408C60F59F67058F364BC30EF5BFD72 1-aluzri
458,346,694 *2E8B63D22BB00FFB36CD49481F6F6A13173DDFEC 1 CHEVALLET
458,346,695 *2E84187C5927FECB48E44A6ED97C8C13046A68C6 1ESIAJRUM
458,346,696 *2E892376B168FAE4CB366771A824965AC3EE54FD CASEY.STONER
458,346,697 *2E8F0F6FB5EDD2026DD15EA13FF01557F6FE6C10 1LYWINDA
458,346,698 *2E86BD728DECFA62AB82C49134B9C5FE1221ADBB c$cup
458,346,699 *2E840F36A954D5FE13A2B3A8A20E2502173EE4E3 CDFW=
458,346,700 *2E853A98D3B6E493D7D064ABD8A4E09BAB15A474 celebrate (don nadi 2004 mix)
458,346,701 *2E8433F77E3911C619C239323E814434C41809B4 cewso
458,346,702 *2E81C2A1E6146CF89E891F8D70C70269CA256654 1parlamentarischinstitutionelle
458,346,703 *2E81A248B2B5162E8CFC05AE83F08CF7DB429415 1REABSORBED
458,346,704 *2E81A3D17CCBEAFF25E6DE2FC8EE39050BBEDE16 1THESHEILA2
458,346,705 *2E87E0093C98C17B2B1DF7D0F6D84361C69BFCE4 1-titcomb
458,346,706 *2E86B73B8F409EA7090A3425C8ADDD53F672B400 1veneilytapahtuman
458,346,707 *2E8CE04312CB1EBC08E7D499E7F27D91C3647895 1veysonnaz
458,346,708 *2E8DA77736F2F95F5471BF51F6743836AF9B2782 1.werner-niemetz
458,346,709 *2E831ADFBDCE9C62ADD8DD3F8022FEFABB2D5586 2077994 l
458,346,710 *2E873CD34085E32C042EA070012FDADC9993E685 CHIQARILAGAN
458,346,711 *2E8F43BC6090E88EFB1055CA63625788E1045656 CHKA:
458,346,712 *2E8688C0BA2BCD50DD31E847A56B5BE110551963 22111931
458,346,713 *2E82CAF9587D0EDDA0F25A7CFA22AB78CCD5F6AC CHTANTEN
458,346,714 *2E8F7C804C3B3F176DB0A343A82271941067E354 CHURAILB
458,346,715 *2E8FA956DC50A1D7E7F5300A6563BF9080F222A2 24-05-1184
458,346,716 *2E88CA9F03E9340AA3F78DC1B1E167D915733465 cisinfo9
458,346,717 *2E8215A704010A868BB43993A6733D7BE068E79A CKHEADDI0
458,346,718 *2E89284676EF45804973970A462D2F4F45EB956B cl0m0
458,346,719 *2E87B47390696E8F07FC0C58977A930980232099 CL_AX
458,346,720 *2E8D65D367265939F750F365B7F6AEF33DA60054 cletusvisnic
458,346,721 *2E86CFCCA0707A0F898FCB985F522A4505A60848 clevelandwellen
458,346,722 *2E89B465BBDB70792B8E77F54F31C5FE6A507E7F 2.BAROCKFEST
458,346,723 *2E895E4B9B1B1E1BE6BC327C33FF7BB08C4168B2 2beautiful(lowfrequencyoccupationclubmix)
458,346,724 *2E8E25D57CB5159A47345635876B15D9D2504912 CM?Q"
458,346,725 *2E85F5C2BF435E2C96BE5391616C6D41AE96C58F cnphz
458,346,726 *2E8638D96A68BAAF65717CB3A5A06B1D008034AF cod4top100comwww
458,346,727 *2E89933D273A0002EB5AD1FFFA6C914306A0D2CD 2.MEYS
458,346,728 *2E83956060412FD9199DEBD33AE98E757F0E1088 2MYLIONKING5
458,346,729 *2E824D956EBCF807F84A0E4B97DB9D465E236D7C [email protected]
458,346,730 *2E8508543DCFE7F23189805A70053954330DE308 COLINROSSEEL
458,346,731 *2E899FA789A7C409C36402CE7F9DD9B952DAF38E COLUMBUSOSTRYE
458,346,732 *2E871427A31392B90BDE59F3640F592537EF5609 conae
458,346,733 *2E87BD2C2C23EEA9D424804FD6F46255262360DD concerto-per-flautino-in-c-major:-i.-allegro
458,346,734 *2E8882D9F800890E7A98A4E61B4E7937521929F9 2vollzeit-zweigen
458,346,735 *2E82EDBD46E3678A28936EA3E922857B0B5BD2B4 3==).~0.~o.(><)
458,346,736 *2E87F905F9C834558548B6435E8A8FAC5831A172 cortezfeltus
458,346,737 *2E872ED5ED3508C1E414A55BB44017D06D9DBFB8 31feb1264
458,346,738 *2E88F534D008B3293E97C76A7F96DAC262191F74 c-pgj
458,346,739 *2E86390CC06B1B09F16FA0283D883A511D4C6BAF 3 KUENSTLERPORTRAETS
458,346,740 *2E8FC0B1CDCB3EDB89169E22FBE4CE5EB6185D56 3MBABANE
458,346,741 *2E888052F9E997FE6C1EFC72C7AB5F361349EC7A 3-oikolaudalla
458,346,742 *2E859203AA28CD02FA07D2E21C5666DE1329C082 3===P`SPLAT!!
458,346,743 *2E8E0B83BC561B9F43D9E02C9386130F47ACE0BF 3valonsa
458,346,744 *2E8D333099FB325A9FE0BE0ADF6201470DBC1837 cr"%-
458,346,745 *2E8A6441451E199FA83A9A14DFF6F0E5AC64F0FE 3YST
458,346,746 *2E816CB73F4824FA62D80D96C25EF80206D5E1DD 40-years-of-burning-hearts
458,346,747 *2E85C0F68E9DC3FB8C4B57D086AF33F2E22613AF cristopherkube
458,346,748 *2E8E23F22413C2BA718913B68E40FB8EF248E9DB CRISTOPHERSURO
458,346,749 *2E8914E31911678CB7497A545CF9F297C20B836F CRITICISMBRTOM
458,346,750 *2E80696871AD0AB5AF7532F5F40750DFB4AC6415 463357 o.zaman.universitelilerimiz.eski.binada.kalirlar..
458,346,751 *2E847767AE820EE37E6BE3E3DD2E1B427AFCB899 cronen1234
458,346,752 *2E8BD5FA801771EFB12E21820C8B4CFFF258512C 4IAMBUGS5
458,346,753 *2E8D644AD77CA881BFDFE90F202D090B655F6719 C;U!I
458,346,754 *2E8190DA92AC68FBEA5C47AF1A957E481A2E0824 CUISSHYNED
458,346,755 *2E808F8C4679984E15D3399605588BA37F80AF24 4IRONMANCINDI
458,346,756 *2E8ABEE15AA8E6AAC2C3C8AC874F8A44F9F950EB CUKUNÉBA
458,346,757 *2E846CF2407035726F49E8C7D4F8E9E49462EE59 CUNDETURS
458,346,758 *2E8DC8514E8C3BAA3866F9F7E00AC8B00D08A251 CUS2G
458,346,759 *2E8F9855C57C66AB43EB0F05C2A43A8DB7307DC5 4NEARSIGHTEDLY
458,346,760 *2E86BA4F39E0FEC3992965102842DC0CB279425F cwrc$
458,346,761 *2E8AC6923B4B1AB52B4B5D879B1C48B07306D74C 4READINGBONER
458,346,762 *2E840693383D129BE49C76861F908858E6A4A24B cydh
458,346,763 *2E87E441FEB248DE44CAF23D6F6EB67CCF550A37 cyrilvinton
458,346,764 *2E8C11D10DB6D18A9E2595D40BA8DA4C60505AC4 4SUSTRACTIVAS
458,346,765 *2E8094AB687FA2A2A2C5F7199F7AC9A595CCCB68 d00qw
458,346,766 *2E84E79C6D677CC3B390C94C1C874027619583D5 4.UNETTOMAN
458,346,767 *2E8E5B6A4447F317F9AC4531451A198DDD48360B 533devyn
458,346,768 *2E86DB2935F6BB539CC9C4EB618DAF9DEBB99333 5BSWDRAWISHBSW
458,346,769 *2E888107C5167D4E9F7FB60011E070E5CDF6DC2F 5CHIKAKA
458,346,770 *2E81794C24EA53C8319BF5C38198671B0DE10863 5DENNISROBIN
458,346,771 *2E80413677477ED8F852442E14DDCEDDD3D09214 5EXSPECTETH
458,346,772 *2E8BB4D9EE204FF7D4EE322BBC324030415C4A48 D1P4T
458,346,773 *2E8C79D94D025156CB98E6631694C892AD4E7D75 D3VOK
458,346,774 *2E86237790B317A120E93631457DEC62E37489D9 5ISOPEDWSEWS
458,346,775 *2E8DC7E3EEBEDD70D0178E8CD84776CF84F36914 D4P4V
458,346,776 *2E8ED3BD7C5F6ED33E3D8E0C84E220E8C8E0B90A DAMIANSCHOCKLEY
458,346,777 *2E8D7BF78DCD4BC1B2AC06EE91DF5E47CAB07F4B DAMONKUMMER
458,346,778 *2E80615FA32A78F4BAD8F61B349223F941657879 5thedoitnow0
458,346,779 *2E8495C80B3F63412C367E4012CF22FFC1BD1DCC DAN HAGGIS
458,346,780 *2E86BBA943AE24821E9A1CD9E3E7E1D46C98D3CF 5VOORLEESSTERSES
458,346,781 *2E81C008B083EC6469FD77BA104E73AE7FA81D99 dansante6
458,346,782 *2E8918F2FB947EF68839B77603ACC738FF3E52A5 DARELLMADDRON
458,346,783 *2E8337F39877072FDE2848FE0D62E3A7908B8EFF DARENBEVERLEY
458,346,784 *2E86EF1F45FE9989046F16D19F2EBEB282432562 DAREN.STROPLE
458,346,785 *2E842B109CE055C731A7CD0923165CF80F6D02D6 650703 AUTOMAATTIHAUN-SAAT-K
458,346,786 *2E8A4039C5C4D3D1C86CC75DBE48E870BD6DFB1D dasgoldeneschlagerarchiv:1962
458,346,787 *2E8B8AC0C8A6A35660AB9DC0FE1BB4DEF76E8066 6BINGLEN
458,346,788 *2E894C20A529CDD47017438F547CB02038A798AE 6BSWCOPYRMBSW
458,346,789 *2E8190DDF8AD543A0E5B487E0FE53651655A9F18 DAVISNUZUM
458,346,790 *2E8B15975D4795F9A98DF13B214B47F059091CBA 6epanastrophe
458,346,791 *2E8D1C23D194CD35B62199D94BA4AA7DE376BC60 DDM9U
458,346,792 *2E84795BD2E00BEB888F0E45E60B396726DD23EC DE2B185CF08D
458,346,793 *2E86BBF753C9E0CD4A71A2505A636F499E185A37 6NEMESISICECREAM
458,346,794 *2E87D55456F1068474DB5A0C87062065AA123E27 DEATHSHOT5
458,346,795 *2E81386B7990C7F00862EDE2FD6B1C13A1D147D9 deelemming
458,346,796 *2E8B7AD397CA72FDFFC95E1599C99F96B5F85BFC 6STEEPYAWNING
458,346,797 *2E8DD0A1570DE4A2580AF51476B33EFBC95AECEC 6TEREESE
458,346,798 *2E85B1FAE03D4BFC8B6F6C4677D3D6149A7A3CF7 DÉPARTEMENTALEWEG
458,346,799 *2E86700B9AA1E567C3E24249E119F7A0EEB8D487 DEPARTMENTISE
458,346,800 *2E8E1489D4FD579E86438078900C9BA749AE4F36 DEUDH
458,346,801 *2E83195E874C35E89E27D69B60D0A8450A81D70D 7CHOICEPENDPENISPERSONAL
458,346,802 *2E8B64F422A4B5791BFD034EA070747293BDC42D 7COMMITTEDNESSES
458,346,803 *2E87DF669E88E7C3B899EE1E1C467F9227147BB1 7COMPETITIVAMENTE
458,346,804 *2E8BF8E017AA21057CD543AF6148461D0404747B 7DEEDEEINTEL
458,346,805 *2E82B381D43D1E6B7C051F4DCC7F73130AA64EF1 7DIEHKJILREID
458,346,806 *2E8FA90C9FAE4A9480E82DA309B5C14266F8ABF7 7FESTUCINES
458,346,807 *2E8915C829555D6EDFD1FFEF2AF4D110E2F3F9D0 7iamkissa21
458,346,808 *2E82B239D8D027FB890E4BE567FABB8D73D26C34 DEWARSADPAINTEDBYTATSCRU
458,346,809 *2E85EB47E422A84F43258949D23B1D29A0D0518D d!ex
458,346,810 *2E8E5404C4D464FEB7149D86BAEBB18DDC6F8BA6 [email protected]
458,346,811 *2E86D0290D076FE16D0F7C621FFE93E0D5A4510D [email protected]
458,346,812 *2E891270AF75D52755DBB5A9120ACF922106BA2F 7SPIDERSYLVIE
458,346,813 *2E8FACAA975BF56300C88BDA4615AE98A03A205E DIASHMWNING
458,346,814 *2E896A27FB7C5B1E7E3904504C57507BE30786FC DI-Q.
458,346,815 *2E8ED24D652AD0AF585303E976A1810E4AA810A0 8######d-`~-`~-o->-<
458,346,816 *2E8888949A7E1F7C7C7C7B9404EB3069924615BE dividierenden
458,346,817 *2E828EB0DC1EC083048DDBD2E1EFBABF16A408E9 DO1"
458,346,818 *2E8227A019AD2EF4C6C8A02F4163C43AD92C7A9A Dogl3an
458,346,819 *2E8FEDD34F1B9EE575F005F0A22F130E77E0564B do=hq
458,346,820 *2E8C0AA257A6BDEE38BEA6BADA6C66186C79D0FB 8SCORPIONSPACE
458,346,821 *2E8A1F84BEB3137E0997922C60F42BC4B2E2A6AD 8SERVICEDENNIS
458,346,822 *2E81ACE3407085FE3DE9D6CD0D0C7C7438FF1413 DONTEMEINERDING
458,346,823 *2E81E0B6AFDF116B7F35ABA7292D0E0C345FF3A7 doo?6
458,346,824 *2E802A68C4C19588FF0AB09DB3E8852117E8210E 8UKUPNUB
458,346,825 *2E85F8760C7C72EB2D013234C66997B4714FA642 dosdriving
458,346,826 *2E8756A0B438AD5B519BAD609CC25A17B42BB55E DOUBTOUSING
458,346,827 *2E862D6FF3EC066CE798A133C8A01F1A05EE03A9 917-luxemburg
458,346,828 *2E847B69C8F019AC9B20DDFE935CD0A9E65B8071 DQ2=L
458,346,829 *2E82DD9DECB6A2C19EEF7C13D6266BCF237C60E4 dsei
458,346,830 *2E8F27F81DFD2F2D641DBA04AC6C720ADEF79A32 DT<4
458,346,831 *2E86228ADCCEC1DBD6F6C56716EDF31D64C54FC4 dustyfantin
458,346,832 *2E857D4412FBCE392F5489B7212BF41332895D57 &DUYQUANG
458,346,833 *2E8A9EC65D777067B3937FB39139805FC14583BC 9RABBITEAGLES
458,346,834 *2E8CAF49BD86D1FA587E16E2A944718EC0A9480C 9ROGERROSES
458,346,835 *2E85618ADABF1A7F0CC32463BA36ED8E9B265FC7 9themart5
458,346,836 *2E8F1A27DC157E0581E9578C0D627B64FD289CE6 A?%
458,346,837 *2E8648BD035413851D78F8F06C2DB0DEF9F282E9 a41bh
458,346,838 *2E82F5D7594B45DD303569D9A1C9927C6FA7814C EAO_
458,346,839 *2E8E1F8EBDCAC02F978BA471F7344B819EB465E6 Aaa7
458,346,840 *2E8CBD05D25C7019C8AB6814BCC057DE972A5C67 EDY-DARMOKO
458,346,841 *2E848D547D65232643288FC904FDED443E565FEA eg$e9
458,346,842 *2E8228F31FD0F920262ADCB7204E967C3EB470BB EGE.(ENSTR
458,346,843 *2E83602967DE5F158DCC0841FBB01F8BEF1017AD em#baa
458,346,844 *2E85AA37B84AF2C021947AB01072C3C8BE2C2E46 EMERSONLARUSSO
458,346,845 *2E89B28C46FF6792A7C535D8C19DBB24FF96419C AAEH%H
458,346,846 *2E8AD968D4E87048722491F49D580020590091AA A$B!K
458,346,847 *2E8982FD9CDF339C346F9AD9560C00427143DC8C AB/U;
458,346,848 *2E8ABC55EAC426FFAA610EE732E62076F1CA8911 A:ck
458,346,849 *2E8FC3E2722501333D107792F9C355800D506F5B a!cui
458,346,850 *2E89DCEC1DBF44DD7A5B5FDDAE305C54BF842765 eocgb
458,346,851 *2E8ABCE300DA5831C115BBAED6C0871CE94F6640 EPGK
458,346,852 *2E845D1501A721BE81E9CCD4BF1A928FDC0EC6A3 Equal.Vision.Records.Summer.Sampler.2004
458,346,853 *2E82271FA4D4422B46105D5D282433E27BF4D591 ADMONTIT
458,346,854 *2E8DF06BFD1381D898019E6F41EC8C561A81CB6D AFSP0R3S
458,346,855 *2E895AC67E1B8FCFF12AAB5320FBB41FA6DE1578 ag$x!
458,346,856 *2E858C14B84F53712E48007837B28B87A417A090 AH+P"
458,346,857 *2E830B98C46861AF251860743A219983B1F22B1A F4114C9
458,346,858 *2E8D04BE91E934BECB671B65C21CF5FCD7AC13B2 „AKARSZ
458,346,859 *2E87AA94775F205DCCFC667B8A2F311431F16A5C [email protected]
458,346,860 *2E8EFF7E167A9F1A0F27A6B792707C5A6680CDB1 alejandromcclinton
458,346,861 *2E8CF48F2D3559881B04633480694481B4CD26C9 ALEXANDERSERVANTEZ
458,346,862 *2E85C772D3158EEE205CA06B958C314316562AF5 FARMISTPARTIO
458,346,863 *2E82A562952FF2167614FD5CF93A6834859E8E34 FEESTDISSEN
458,346,864 *2E84FD49D848DE79CF37C93A10242A730860CE27 ALFRED.TESKEY
458,346,865 *2E8BC26B0052464A9D9F6CF91BF516F1143F7443 FERDINAND.DIETEL
458,346,866 *2E8C639FD335D6B7D6FEFE216D12A7E9E1AC9EA7 alice-oz
458,346,867 *2E8A9B31293B87F3984EE9A97BB98D90E0E3E3AA [email protected]
458,346,868 *2E89319E55E0AFCB7F95D03CB12BEFC9AE956341 ALKOHOLFÜGGŐSÉGÉTŐL
458,346,869 *2E8CFF4C86A1D96EFB0D99C85301FC5C44781B75 FFEB
458,346,870 *2E8CA4253E1B46815C9A87D0DFBD18A189810968 altesschulhüslelochau
458,346,871 *2E8D11093D3C394C5A0437C1CBED145B4974CEE3 amalina-ibrahim
458,346,872 *2E8DA342E23B9576826A145B170B65B98304D899 AMBAGIOSITY.
458,346,873 *2E8F89868FACB6D4649B377521BD5090A07E4F91 A;mU
458,346,874 *2E8A0A78CF0B2AE4A44BE28186A8BF0BCE77B6FF a;m"v
458,346,875 *2E8ACF8DB5918409EBDCBD9AD3B900F96F2F48E8 FORNILI7
458,346,876 *2E84AE0D1A7C8B8FC0EA6D496FA287806AE7C0CB ANDPLAYSTATION
458,346,877 *2E895FBD84CC2DF0B6CCFDDACA7882770514F587 FRATR3S.P
458,346,878 *2E80E76EFDDE5B76A185877351494A3654A0D446 ANGELAST.JOSEPH
458,346,879 *2E80E282E0CD4E6829CC3BA25DF0E97E0A6AC7CF ANGEL.HORNBACK
458,346,880 *2E82ABFD31FC227349870A5692EE55A0CC487D36 ANGELO.LUNDEN
458,346,881 *2E8966D34F646CE87AF949BAEF6A0E5986BF0061 ANGUILLARIS
458,346,882 *2E80C51153FBD642B4A1BE562254EF4EEEE4D536 g8ge
458,346,883 *2E8401980E04966A3F36563AA379A0DD994EE6DC ar7isans
458,346,884 *2E8C15EABB9A72CA955B84467FB6F05031B763F4 gelsemics
458,346,885 *2E86F7CC12A813D008DC7CF1FF0C3C28089506F6 ARDILOSOS5
458,346,886 *2E8430D3450F3A1C740130806C047E75FF0A004A GEORGEBELIEVEALBUM
458,346,887 *2E87D6700B3203F341F95FFE3D7209D343E1399F ar#%j
458,346,888 *2E85C1212E2FF56BBAE09E40958628AD7635A364 GINGUES5
458,346,889 *2E8F87D32418A1799092C97212EBEA7963E7CE31 GNIKOMSI6
458,346,890 *2E8DC41C8205FA4B225C8163B8D4CFA675556381 ARVIANAZAHARA
458,346,891 *2E80CBA87DC7F6D2437CD124487884C79FB3554F GREGORIOPANECZKO
458,346,892 *2E8EC468CC79680394099F1C9EC0A1AB4C790DD3 gsiaascl5
458,346,893 *2E8C4186B5F8EEEB2F46BF8A8BA655B45A07D1C4 GSRTALHLISHED
458,346,894 *2E84496AE7BFBBC1061A7C9AB0DFB4D858D7DF44 GUBBIN.
458,346,895 *2E80B5E5647E3BBD593B8DC3974930D45D69D8AF hallelujahchorusformmessiah
458,346,896 *2E84595EE47D931F86C8403793252C536A329842 aviroatsed
458,346,897 *2E8E5CDF873F5275FF51AD00030D159B49A96C21 AW0KT
458,346,898 *2E8538473552B2FFBA029756E17C424BCD20849D HARLEM BY THE SEA
458,346,899 *2E8A53E4DB1A8EA3D4F48CBB87324D3843B06E22 (>_<)[email protected]
458,346,900 *2E8DDB765A9AA890A49036F58101F7A8D9597E79 b51(2
458,346,901 *2E84BDE2129D9099814E5CCAC74A83244B8D9BF8 b5,iu
458,346,902 *2E8AD4E745035FE73BC6F7B6ED7B054B5ABEEA93 Herra.vartija
458,346,903 *2E87D3E66FCBFF64A9FF9020C654478CE4E6B940 B6t4
458,346,904 *2E8CEFCEC2172229F5D56899D22E277BC06DFC0C BÂLBĂROS
458,346,905 *2E8A372AF79D2734826C28D7FBE7D25E7A711D50 hrmoza
458,346,906 *2E81973BBAEA5C7CBC7167C512A46DD6A8652E80 httpwwwnigeriafirst
458,346,907 *2E8B44136C8732E57370402FC32739BA48ADF7D7 B####D ~0~O 3B<-
458,346,908 *2E87DB72B9DE81CE7E87FCBEB6EA8972A2F72B64 BD2/
458,346,909 *2E8575AB695E2F3838AEF37EC9A63056D918F9DE B(E!L
458,346,910 *2E8B2635B4E5073AAC6794F555992682D26D0815 IAMCOLOR50
458,346,911 *2E86137682A285DA908F1D082FC09BC4AC61947E IAN.HIRSCHFIELD
458,346,912 *2E8002A1E8324772BD63336275EB5751B34B856E berrybinette
458,346,913 *2E893B650452946A2B1B347137C1797B15F452C5 BERTRAM.SHARR
458,346,914 *2E8A0E935A1986DBB5A2374442AD5D8A18F57FCA IFC95445596
458,346,915 *2E8EE7B240B8F965A3FAC0D80BE1656E30CBD631 ilah
458,346,916 *2E8982F7AE3370B48ECDE1851B5CB29CC18884DF BI-FM
458,346,917 *2E82527A868C6878AD5F03A24867132201C225FE b/jyi
458,346,918 *2E89F13169BDFB70F9ABDBB88312B1BEF75FC101 bm1rz
458,346,919 *2E8BA48F508A8E43FF3245850B4A11398ECE7973 BMPFO
458,346,920 *2E8BE297023337DF62308179C8D1D9C213D5A668 BOATSMANS7
458,346,921 *2E892D6DBD46B3565AC5799AC926A2B77612E96B bōeisen
458,346,922 *2E8A16725C86D4A4192C39BB7A04FD6859353E1C BOREN…
458,346,923 *2E8EF952F8747FBFF2A4C7A720BFF8A5CA93CCB7 intro(feattimbuktu)
458,346,924 *2E8F86F6D58C77309182051AEAF2DC74EE004CAC INVISIBLE TOUCH: LIVE
458,346,925 *2E803A2443EA1FACCBCB93BDC1DD126B21385347 ireign
458,346,926 *2E85EC61DF8D7A35FFF47A333FD74F305DA4F747 B;#QQ
458,346,927 *2E85F61082227DCE606C5038A632F6C9A809B8A7 brandonlambly
458,346,928 *2E8A2BD7B8B30DE4D8AF116CFEBF3E4FCAFFB23F BRIAN.KALFAS
458,346,929 *2E8592C870D748E4FFF522FB17E16F4C3855D890 BRICKING.HRWWW
458,346,930 *2E809BBD66DA3FCF7E1812835FF0F1EBD7293707 BRIGHTONELECTORAL
458,346,931 *2E8CD09B848DF3F18907482902C7302798365420 JAFFAHAS
458,346,932 *2E888026785E2547B69F9A038F24D6F864830163 BROOKEBURCHELL
458,346,933 *2E867D88A182EB02ECC99519E4BDA12788E07141 bryceswida
458,346,934 *2E8E620791490B096F1B2E7D70666235EDFCB549 BSE-N
458,346,935 *2E8A6D731DCED1CCC7784A004A1E70FB63F7F337 jenni-aalto
458,346,936 *2E8EEC516FA09196DF0BD4CCA72880B554F6BB15 jenny-bent
458,346,937 *2E8912A85D353F2A25BB52DA83570674BBCDABC5 JERALDTRAPPEY
458,346,938 *2E8C802FEB450AA2A5EA397F327D2B370973E55D jeramyutsey
458,346,939 *2E8B90FE81B3FAB610293DB46647EE2000A1E22B JEREBOHM5
458,346,940 *2E88EBF0CDF9C437508D2400B6C41A529A8B58A8 jeremydement
458,346,941 *2E82FEDB0FE09BC2EDBC11F95DA9B3A2A1D4E025 BUNDEKSANZLER
458,346,942 *2E84E247FD73BE099ACD8F9696622D25B0F1722F BURTONBICKFORD
458,346,943 *2E8CE68E0ADF66B3DD12D0316093F076ACFA5957 buu_w
458,346,944 *2E81DC06C24AB4DE44CA739196388704934356F5 JESSGONSETH
458,346,945 *2E87156E3C2997A85B30DABCA4DDC804AD94F8D0 JESSIE.SAMUEL
458,346,946 *2E8CD70310DA97299F00C322641FC19949F252C5 JEWELLKLOEPPEL
458,346,947 *2E82496D43652C8FCC1611C538482B492B094CE6 b)w8
458,346,948 *2E8156EFBD58151AC536F3307D1FFC97ECA7DDE4 [email protected]
458,346,949 *2E8A7851E6F7C3A07935FC4FDAB30957474D33AA bwli)
458,346,950 *2E8ECEE8945F20E2144FBB5F9E29B09713BAD25E JIMMIERESTIFO
458,346,951 *2E80A3BCC250E54363D79703410C01880F01EF43 JIMMY DEVERS
458,346,952 *2E8F4416E121FB31DE1EC8F0F5D0BCA34AA7A553 bxiue
458,346,953 *2E8A5AC26497C7D7D20FFABF94EE9E9C8A272018 C?%
458,346,954 *2E8954514A9D11D0B78CCF0D87100CB087CE0638 JOESPH.IPOCK
458,346,955 *2E8D87366A4FC32E17A841936D372AB4E73209FE JOHNATHONKISSEE
458,346,956 *2E87B0515141938057DDAFB17B21938F491F9366 c3ea63ee5725334b82e46e8c28ab7fac
458,346,957 *2E81912F665A5875101DE3E13B7CF082082CA0A5 C_3HY
458,346,958 *2E83FE093EB095161B818570AC7A7228E7CAC343 c5w/v
458,346,959 *2E87D5BD7E9FBD1CD86ECB26EF583DCC3CB790A2 JORGE.VARRO
458,346,960 *2E84FE68FC244BB49E4E55AD7DB964754CF0DBFB C&7J
458,346,961 *2E82F6B4D54694E975BBC93E1D22955E5E5C9FAA [email protected]
458,346,962 *2E81703124C131721F70FC748A6017EC3E3D7657 CAESIH
458,346,963 *2E8DD8698C88E13A55A3E9C1FBF4844BF54BECDD [email protected]
458,346,964 *2E809BF32758093E47EF07F6E4ECF0EC531B14AC [email protected]
458,346,965 *2E88C8B58F9597BE746BA9FBCA0DDAB04EBD5835 calvin.kruger
458,346,966 *2E8F3EEF9CC190E5AC45B3C4E89092A5911DE3F0 camro
458,346,967 *2E81664CDD9E6C899B8E2709796A1B967C69C760 JVASSLIDES
458,346,968 *2E8A56EA084A9C72F31F825D2DDD8A3F6CF24621 "JVJ
458,346,969 *2E8B560B61CB132227E785ACA9CC1ACC071D611A jxo&
458,346,970 *2E846D191775E95279C74C6768B340A1945F39F4 [email protected]
458,346,971 *2E88D16FEA9A8F47A1762DEA93D04B8B626101CE CARMINE.CASTANEDO
458,346,972 *2E82BE1510F65AB0954F24341DDB59C98D696C37 kathleenstevenson
458,346,973 *2E8A0D34FC52D90B6FB2CAF140B85B19A2F86882 katodestr
458,346,974 *2E8FE6606E66CF0670C3C36B7062EFDB2C162E1F casseln9
458,346,975 *2E8348662D40C091166C03148621D275D065044D KELLYTIMBER
458,346,976 *2E88C56D51B5B742DC3C3C2788195DD806554A44 CATEGORYASK
458,346,977 *2E82528B406DDCB6C7B4E0D3256D4A973D9B538B KERINNE8
458,346,978 *2E85AC7E72F3D51E7E9C656F93E07A59FB2CAA49 cc_9j
458,346,979 *2E8DED298CB92DBB0D53E9999E9F91C368C4252B KISMET
458,346,980 *2E84D674D2574EA9CB59F7C0B441895B7B918544 KLERKTH9
458,346,981 *2E8D1A0BA7A6476C855815AA6B8CA6BFA7408936 KRISTUITSALUVS.MORRISNIGHTINGALE
458,346,982 *2E8A1E44724DC56CD41623B57721EB1DE69D8806 cercellia2
458,346,983 *2E8FCD1870772AC953BD2742EB2FD11CC16F72BF cernichiari
458,346,984 *2E8EAF0165A670BC74DBCB394538FFB9489864DF lac21288
458,346,985 *2E8B6548F04F48A5B7DBD3A2B0D5D47EF03B6B91 CH)58
458,346,986 *2E80F20503DFF02C67BEF9A49C4B5E2082EA9FCA CHARLESDELELLIS
458,346,987 *2E8BF7A8B0CA52310A423CD5224AC90F9786A379 LELANDHENRICKS
458,346,988 *2E8B588D717C4EE269FC7D6F4D641FB122F62520 CHEMAOTROLENOMAS
458,346,989 *2E8CA24CCEF576587751A60EC3CAA0D1F75B840B lesleymcmurrin
458,346,990 *2E807AC4B8F7EF57E699CE1CB16BB979FF55D488 <LI><AHREF="#ITEM4">10/31/1998VERSION39BUILD5088</A>
458,346,991 *2E8D5A17C78670EABE57BDCC9437AD1F9AA5FE79 LifeBegins(radioedit)
458,346,992 *2E87774921EEE8E3E16DF3A96E0C5075DA78503D CHRISTY.KINCAID
458,346,993 *2E8E2DE32B74E8674599E25C12A4BFA2DBC44FCC chubbybunny
458,346,994 *2E86B86D9BA8FBA3AD9CEDEE95A9B1C5508FE67F CIMARFLOW
458,346,995 *2E84C606B96141D29BEC4EE017BB6A46F64DF504 LOÁY
458,346,996 *2E818F2DACA793C0DC12507E9C444362CD729131 lorie-baugh
458,346,997 *2E8C4DF7299FA6348C92AA039696463CCCCB4060 lori-howton
458,346,998 *2E8D04300A7840E5C07DAA9A1F07B4B1B372FAF4 lospose
458,346,999 *2E88FDBDE223A5B2786DF45C5BFF2D7F3B7EAF5C LOUGEISINSKY
458,347,000 *2E8605083A4FC2D7F7DF3FA06BFE98CCF8534F3A cl//w
458,347,001 *2E899ACBF628942F8107A67951CC08BDCE6B3E13 cmg6n
458,347,002 *2E80E0B67EBDEE125025D1B08EFCFF0641D7AB5D CNCVN
458,347,003 *2E80D2B3A2B839526B3466E4C1124872253416F0 COLUMBUS.BLAZING
458,347,004 *2E83E19E4BABF0415AF161AA78DE93755EDE216E MÄÄRTGAS
458,347,005 *2E8D6FECBD17C31D0538D25B476A011FC4EF5EFF conae
458,347,006 *2E849FDCDDC58EB4A117418C935777AA188CBDB4 MANCIPERONS8
458,347,007 *2E89B2D903B127470C51FA20CA56B258CF351C7C c.pc8
458,347,008 *2E83F922CA5094C79CEFACD497AD23560884B89E [email protected]
458,347,009 *2E85E8A53C9746E8F737EF82757294ECE0A6BE4E MARCOBINDERUP
458,347,010 *2E8D7C0416925A33C07082AA0BA810456F25A528 CPUMB
458,347,011 *2E87BE08870E91FC1F39528556D36E402BA2CA7E C!QMH
458,347,012 *2E8B2F755F5AE14B3D9D1196FED86FD73E741613 CS$R+
458,347,013 *2E8D94C665AD8C9D4FE4DF5B26E65BE756D1BB0A M{DR
458,347,014 *2E8C7C53510DCC16622BCD9F8759FB342821F046 c/u=9
458,347,015 *2E8A04B38DA477CB0A98DE92C4D18CBB1515FCE4 CUGWOEGBU
458,347,016 *2E84F99E472CACC85B07D51C8DCAF73AE1E90D27 menschenunwu"rdigster
458,347,017 *2E8745B04A95CD88E69064C41F5456C734BF8C17 [email protected]
458,347,018 *2E8022FAD19563EE67AB41B403B94768BCF3FD36 cut to happy hour
458,347,019 *2E80741B21395BD59747B94EBAC06223D8799B1E c.w6j
458,347,020 *2E8B94EB5E0A9B7B3E70E697CF4C6115642C7B2E michealrainge
458,347,021 *2E8A75B0BD215459C4A918ADDECBE60DD93B7AFD cxh%$
458,347,022 *2E8A512CA25DAA0E90DABE9600646B9346DE8D75 c;ya
458,347,023 *2E8120A02721C58E090442D4A63135BA673144BC MICKY-SCOTT
458,347,024 *2E851C1FBBE8F1C8F1E2B05BE4F786A7DFC03A94 MICROBIALFUELCELLS
458,347,025 *2E8CBAE3366EB410AAB13EEC54E31C781FACCBF4 MILESCLOGSTON
458,347,026 *2E802F715026EEF700A6F5D4156B83F085B1FC7E MILESRAZZANO
458,347,027 *2E8EBEAD5A7CFCFD8AE48D89063EE263DE66A89A D1300M
458,347,028 *2E88C92B9041D15A7CB90B8CE1FD7D6162CB39F5 d(5zp
458,347,029 *2E86187D896BBBEF7CCE25D5C091765C851DAA67 [email protected]TOMCOM
458,347,030 *2E84E7C6FE1101F9D05C1FB32CA1EEDFBD4A7509 D6!R
458,347,031 *2E860A6E579C2CBC3E1DC44FA9F2E75F736C3C0D [email protected]
458,347,032 *2E8DC42183D9E43027AAA9FE584B88FE21D7985D D7R2(
458,347,033 *2E845AC9199D225DFBEB82C6146F2A17E3A1BF52 DAMIAN.MOONEYHAN
458,347,034 *2E85EFF9D7B073ADC661B5015BBC03425D8042D6 DAMIEN.KARCICH
458,347,035 *2E81D3E6C2110272170D9EDCEFC04A99BB41336B damioncronshaw
458,347,036 *2E80C2CF43AB2E82D79BA68461C9688C3763462A dana.ashcraft
458,347,037 *2E83F8552998B0074E5F6DABFA9AFE795C98C4C0 M!S+!ME
458,347,038 *2E8E4B5CB0B98AD4E794F39A5018050C59F3AF7B DAVIDLEO558ALEX
458,347,039 *2E80A8D847D3772A72181368FAD77A640C41D82A [email protected]
458,347,040 *2E8ABCA8CB4B99A83447FC9C171BDFF605F11EC4 NATHANIEL.BEILFUSS
458,347,041 *2E861EAAA1FCEEFF898A32612AB591FFFC51A159 DEFINIENTIA
458,347,042 *2E8D8A7C243BB9AAC1A5C203F3728032D90917D0 DELBERTLUCARELL
458,347,043 *2E899B8D55C37AB72A21D4E860C895F92C5FBC88 DELBERTPATCHEN
458,347,044 *2E8C53001413F7C1CBF8EF6F6411DB890421146A nealcafarelli
458,347,045 *2E87183EE2AD0274F7748DBC91AFCFCDB0655F7E dell'endometrio
458,347,046 *2E8A5423110E2F68C279F2BC92DD594395BB7E89 DEPURGED4
458,347,047 *2E851601E357F94A4AB4DBB9F6841662633040E5 NEROTALUGER
458,347,048 *2E85BDEA4FEB168DE6DFDE450786BBD8BF7AA8D5 DESMONDMUCCIO
458,347,049 *2E83C7187733C4B2CE1A2F074E4E48DDBE54A4ED NEWTONRAMPEY
458,347,050 *2E8B5F26A9D70CF0E43D76E233ECE7D161A203BD NFEIZI
458,347,051 *2E8232B7CABAAA89CFA6C78F012C8914FF251761 DEWAYNE.CONDREN
458,347,052 *2E83C9164512E1D642A8E0D7B2363CBD3EE2F38F dewittgreenlaw
458,347,053 *2E8F7782980193B827505F45F7AA3D10DE37D815 D%FBE
458,347,054 *2E80B097F0BAABF484E1A702C6EB1B8C3832E6F1 dg"z$
458,347,055 *2E871A31E774D81FFE8D94216D6EBDF97EAD91D4 DH000370
458,347,056 *2E868745B54764F3520C5EAE679D11F8E6E49C36 NOBRAINS2K
458,347,057 *2E80E39D833E2F10FF7FFCF6E27BBB7F2C2B7B6A nolaneskelsen
458,347,058 *2E822F739BE9D2633241788E9BA900BE8B372D3C D-i
458,347,059 *2E87608E5994E8D61537E480105D41D7A00FA98E DIDISBLUES
458,347,060 *2E87C2103C76FA14E179A76B226C59C25352DD18 normandzacate
458,347,061 *2E8C453239BF125FBF5DF07A3525CA4F803AA161 dik=
458,347,062 *2E8B180380BCC18623C877E06DD6272B1889C30B DIRKTALBURT
458,347,063 *2E8E3085C5102FA4ECB0480E8AE2E76B9F0C19F0 [email protected]
458,347,064 *2E8FC9E2B8E402B7C1BBE98A7A0036EDA5A506FC divulguais3
458,347,065 *2E8C5D6071E2113D6162FA9951AC501D18A89745 dkp2c
458,347,066 *2E8AD67B817872F85DAD307FA6D5D33FF489937E numbersacencio
458,347,067 *2E80008DF3C1E574FC34C308425FA6E3C1F73E32 NUMBERSCROCETTI
458,347,068 *2E8C22A7CAF7DA75C0FF807BFFEEBF0D35DB4569 NUMBERSTOFOLLA
458,347,069 *2E885E24AFC5DAAA7326902C6799BD405182B425 numberswininger
458,347,070 *2E8F829278817610A64B38CD8AD56D12C4E2F9FE [email protected]
458,347,071 *2E85632F4A9604F69FDE2EEA366B2BB57DC5A4F6 ob1i7er47ion$
458,347,072 *2E837B3EC0D880D84BD867618B146E78BEBE39FC D"NCC
458,347,073 *2E8620A34382660D659A35C2F0934DB78CDFAECC OLDEDATTER
458,347,074 *2E8440A9A33F3DE804FD8E9350817180B4A2E854 donalddemars
458,347,075 *2E8003DBF1E17B6CFF073DCA79FA8B3BCB9E479F OLIVERESCHENBRENNER
458,347,076 *2E89CB5578861D85C09912E7C3B53DD1F48F0FF3 oliver.weber
458,347,077 *2E8373BD4349FCCB8A1AE45E326BBFF501DCBDE7 omyq
458,347,078 *2E8C9574E2F51CF43779BB1CED66591EEA01BC51 donnydarrow
458,347,079 *2E8EC6A066BAEDB970454406BD517B06DDBA6A8B DONNY.DATIL
458,347,080 *2E85F2D3E40D86452FE1CBF3AD3CA658DDEEBA00 ONTROOSBARE1234
458,347,081 *2E8E87EA20C0D45AA2158F6E1BF4AC2D5EE14C32 onward.christian.soliers
458,347,082 *2E8F17C4AAE6514E022852166D876E39CBD78DFD onwelkomed
458,347,083 *2E83BE2646A45C743B2CE1890D007B254D8C11AC (>-<)O~O~<#P
458,347,084 *2E80952026C9337F34244B4C5367756BBACBB7AC DOYLEBERNDT
458,347,085 *2E86976ECCBB94F36701E61DE3881297AE0A41C5 o->-<~q##3
458,347,086 *2E895F4441D28C071CDF9BE52A89E9EEAEB9E18B (^_~)~`<p
458,347,087 *2E84C84A0D501AC4196242AFE783389699BF2902 duanemeara
458,347,088 *2E8D039AFC7FAA13872226EC58CFB47729E9FC8D paladar0
458,347,089 *2E8DAEBADEC2FBA211485E3D9FCB12DC1A88A880 parcela
458,347,090 *2E81EA8F08204F36253C00F5DECE108163008C42 part-2:-tma-1,-chapter-14-2:-the-listeners
458,347,091 *2E83C6F7564F132411703A6E3C450F05DD1994B2 DYJO7
458,347,092 *2E8F7B7DF7E93BCAA28FEACFEE2CE586A8DEE5C5 PAUL.AUMAN
458,347,093 *2E800D8C3D7E93EB409BEC46121596BC12686517 ECHOCHAR0
458,347,094 *2E8E38996F6E79C756297991AF2B160CCF5CFB72 ECLIPSEGER.DEWWW
458,347,095 *2E8395A68D9188785C289809051F281F3999AAF8 edbartell
458,347,096 *2E89DF506573E65AD3BBC6017DA0E8AA35FF0C38 EDDIEMACCARINI
458,347,097 *2E8FFC6A95B578DCD18B28AEB07003FEEBED568B edisonbostick
458,347,098 *2E8B6538D00955E517DD68D7F460533DA6B82132 EDUQ
458,347,099 *2E8CA73DD75605D74F7A37BA69F3A7465B59BD15 peterneveu
458,347,100 *2E801FB9DC8331FB90A2F9290EB2260080098F46 PETIBBS
458,347,101 *2E838F7D895683DD7A952942C01149A1BDB2BCAB PHACIDIALE
458,347,102 *2E841C240511A689C27F1E9D8BB68A8A9FEC9855 philgalli
458,347,103 *2E845673C2D21F3FC07EBA062B35700BF71379B8 phithetabeta
458,347,104 *2E8036DC691B4D280539587FB11D54B1AD3820B4 EKSALTEER
458,347,105 *2E8F2EBCE85EFA497B5459B797769A41ADA8C247 eldridgeharkins
458,347,106 *2E8CCAFEF5A3E54C5218BDDD96C83C7FF07C2E40 ELDRIDGESTUBLE
458,347,107 *2E872564793BCB03E8AF9241547D6286F55DEF7B electrasteph
458,347,108 *2E86FD245DD20B316E96CB101C4A9F6AD6491615 [email protected]
458,347,109 *2E8A0C0D04FBFD6C5C51523CE7D7D18F2F96299A p-----)~-~-)o(
458,347,110 *2E82B2ECC425BF73E08457D09A8DA8898D5E56E5 ellisemond
458,347,111 *2E8DBD4C2802FB286A7EB537DBEF8A66E0D0F3AF ellispattinson
458,347,112 *2E8F43A1CF40E76A8694D3E8B68A522FA316D5F3 ELMOESTREM
458,347,113 *2E8A2A313502FE8953A865C6741A0917A5AEAB32 P#####@-~O)O(
458,347,114 *2E8482991CCE7BA54F4DF4FE4F6F2D48A69B1759 eltonloewer
458,347,115 *2E813474C5589873B45C2DAF9CC514A7360EDD84 ELWOOD.BROSSETT
458,347,116 *2E8ED8B81286DBDF08DF6B03F70D8F1688FEFAED EMMETT.LUNDBLAD
458,347,117 *2E86FDCF2D33BED4EB589233E3457E464ABA03B5 EMUCL
458,347,118 *2E8B341AE2264B9DA2563E4AB986A6C34CB0615B ENLAKEVIEW_SHOCK_INC
458,347,119 *2E8FDCB0E093788040D6FD36D7E3D8BD280BCC89 prelude-and-fugue-no-19-in-a-major,-bwv-864
458,347,120 *2E89F268320FF5425A8EA6A3C06B2E437C6D24CA protemperance
458,347,121 *2E89205113406E65152A4842D22FAA7F2C0F577F ERKISVLING
458,347,122 *2E8CA35DCAE29C78147A8BEF688BC7C3C4FE9131 ERROL.CHRISTISON
458,347,123 *2E87888896BC7256C0DC8711D6AA2A74F73D814F ERROL.SHARMAN
458,347,124 *2E85DADD37E89BEB2512F8FF9652672AF365C119 eschauzierstraat
458,347,125 *2E86A02CD51A29DEA1BBFE671BF0FE6367845BCE Q112526
458,347,126 *2E83F61D60EA9A5CD85BFBC760DD4618150042FE esuedacs3
458,347,127 *2E82B00B84CD2395A0F12F730CCA498FD429F6A3 ES%V
458,347,128 *2E8900D7564232F23E3566AF9879BBDA44BDC8C8 EUFEN
458,347,129 *2E8B39D6F1852DF51457CB25505511A8CF260ADD EVERETTESWEDENBURG
458,347,130 *2E8EA5CAD75057645632457EA8238F7ED865F1F5 EXCEPTONS
458,347,131 *2E82E4A6346C35B0B278962EBBFBAB77DF3E6264 ey7"p
458,347,132 *2E820BAE4EA0D4C3EE6863D65E70A94D42D59D13 ezup(feat.dwele)
458,347,133 *2E83C80C93C08437CA34C50446A5C468A851BD12 FAL
458,347,134 *2E8CB9C49DDC1799118374C57913814EBBE85B3D [email protected]
458,347,135 *2E8743F672DAA7749D081BADF0B14C74A56B2D96 ferrariawesome
458,347,136 *2E83E6C4E6D69D6DBD16190037C993406B5700F9 [email protected]
458,347,137 *2E8D8266F6645BA07A7B63639AA331CBC0A802B7 FINGER7
458,347,138 *2E8605128BDEB94C6085194E399BE57773163690 QUINTONVRANES
458,347,139 *2E899C6E4282B2AC7B84AEAC68ECB3D56DE7A6BF florentinocunis
458,347,140 *2E84555E0AD924934C21755954656BB44F744C4B florentinopolito
458,347,141 *2E8F9ABCF07F7AF6A90799F84D28663F5198C5D5 [email protected]
458,347,142 *2E8DF5079B94EAD37D40CE4BF2B18C328AB0C9EE R0LLERB0
458,347,143 *2E88F4F7755C5E2D7808EE5D2161675C4C8D9973 RAFAEL.FEARHELLER
458,347,144 *2E87BE5A3FD7C5391276A68EC017A30E8AE2452B RAISONNEZ6
458,347,145 *2E84C3F309B1F74CDE818F79FA3E98FA0E409A2A fossdøla
458,347,146 *2E8F62E4D23DFC95AAF8BF4688B8D244C598642A fourdogs1
458,347,147 *2E8C68E12DAE06AB5E377B2D13121676EC59F99F FREDDIE.DISNEY
458,347,148 *2E8B641960FBCB4C40F078F5A60B948F4EB46612 FREDDY.TREWIN
458,347,149 *2E88E601C9A60AAA0967C2AE868C36046E48DF22 RAYMON.BRININGER
458,347,150 *2E89DAFD073F7A11AD49DAFA1381F332EB2DDCF7 fredrickbonge
458,347,151 *2E8D8C281420E7507603D578EDFC975A72F91E62 freemansecord
458,347,152 *2E8E8B600F0EC334FFD2E85134249EBCA2BF1818 R.DET.SOM.RIDER
458,347,153 *2E8C500DFF93266C5EF321F59C393306300A4EFA fuck.hollywood
458,347,154 *2E8A716546DC773D6ECD90A78713CBED08ED46BF FUNESBSWED
458,347,155 *2E8AD3B34CA862A961AEC8672335F03B37D32B5F FUTUREEG
458,347,156 *2E89A5BDC8450BB56E8DD789980E3FA9A64E5429 GABRIELA.GUTIERREZ
458,347,157 *2E89C229EC6842ADA8AB336E3C46D55DC655E18A gabrieltanner
458,347,158 *2E81EB6EF7AD15097A1B70881DFBA4CC9E235A8F GALLATURE1
458,347,159 *2E82133C1CA0A3A45B6433D86BDCE9659E7D6301 gary-ocallaghan
458,347,160 *2E89354465A483E8FD01E4FFE670D26770D008DF gasoline-fuels-fearless
458,347,161 *2E818EEB5F37EC2D49E2D89FBDDF241B1235E61F GAYS/LESBIANS
458,347,162 *2E8CE6057981712D7E6CC996B57BA9B2C140027C requieminmemoriamstasyslozoraitis:vii.dominejesu
458,347,163 *2E8BA0766C14DC3DFC66CC5275956463DFB04197 generufer
458,347,164 *2E8765B6425C956FA6724D2CCC2CCDF6741856F1 RETICULE-SHAPED
458,347,165 *2E80C10C7D6407EDAF79B0934D5996A5F0B5A1CD geografielehrer
458,347,166 *2E8AA9EC9515205F81C2AF733DC88CA662F80639 REV002
458,347,167 *2E8B73286A66799BFE5A3064DF9942D6012B4BD5 gerbe?
458,347,168 *2E8C4B5C87873B5487A70E56B9D96074C20BB9A1 GERWERKSCHAFTSF
458,347,169 *2E86C357020D32982FB163A616983577EC930CE0 RICHARDBARNA
458,347,170 *2E8C411C5665349FE80FB750530B6378F89250D5 GIROTRAED
458,347,171 *2E8FD53FB9C928FCBF1B68139FA570C2AEF12245 glenn.dare
458,347,172 *2E80FA2EB60039D95981C0C559EE3A176202441A RLKVAA
458,347,173 *2E8E126678593303C3532C2123C237D0F91777C1 [email protected]
458,347,174 *2E852E5E2CEEB1E1940937A5676E075DC51E0CE6 RN-GRAUNG
458,347,175 *2E863E15CA1095EB8A93D8176AF69C8BD1A0BB96 robertangeles
458,347,176 *2E8F6F107145EDD17E7F876DE7B7A638D5423D0B ROGERCORDOVANO
458,347,177 *2E85FE1C77A18C1323F4B4F85B1E14B489D3700A rollandcuzzort
458,347,178 *2E800C029B5BA563A0BD90CF2B2B8DC512D79ADB roma.davis
458,347,179 *2E83E57351836E89CD2AC7164F536629128B493A GREATLOVE.BBS
458,347,180 *2E84B363EE1FF30C94E87272AE90D195CD6F1FCA GREGG.JACOBOS
458,347,181 *2E8DE1940FD4AE68ADF6C181FC719C6424331EC6 greggpieretti
458,347,182 *2E85DE298620E1F1E982A15AE5830F85A3A34E5C RONDOPARISIANO (FEAT KARL LAGERFELD)
458,347,183 *2E84DD155C0D7D4A410E1044ECE74A8F5F7CB341 rooseveltuplinger
458,347,184 *2E8BFE5FA05970996EC529D4E58409BE16C46466 ROSE.ARA
458,347,185 *2E83851311D4BFC61CE97BD5B66F7D3E8E569DB9 ROSS.RATLEFF
458,347,186 *2E8A14B3C419867FE146D667CBC3F053D629AF69 ROYAL.PIKES
458,347,187 *2E859A1263B6DEFDE8F32DB8B02B360285FCE5F2 RQE
458,347,188 *2E8488C52843A481DAB00A666FB56CE6DE0CA887 GUS+ASSE
458,347,189 *2E890B71A4D12F6C8F8F964000F254804990598A GUSFAIDLEY
458,347,190 *2E8B1DED34EFED51A14BE82C78FE9E90606DBFF5 rudolphdeans
458,347,191 *2E80CCFB9C08632FB1D61E6455A77F8EFC8B7920 GYDMFHU12
458,347,192 *2E80E7DF1327AA9CC8FB5B66F79A180772809DE4 GYROSIGMING
458,347,193 *2E84DDC8A7666B235F0D1DE96F342E3FD536FA69 rufusamstein
458,347,194 *2E82F7C9858E3097E5E80442ABAA8A89149CBEBC ru+herfordium
458,347,195 *2E82E8246026E37A60251561FD7708645172F6EA HANDWORKER9
458,347,196 *2E8FFC8728265F166037BEA52092117BBEA5DB76 [email protected]
458,347,197 *2E8899E7C44CA480FEC843707439B586DFA10229 RYAN.FOELLER
458,347,198 *2E819CF0248A7BE5B5683765667F2D75E08E2AA6 RYTENOID3
458,347,199 *2E8C08F21071C922437682127A1FA061F20B7DF3 rythmerait0
458,347,200 *2E8318A748F3C29253E0DD4CB26BD4CEDBCADB44 HEATH.SAFE
458,347,201 *2E825C9B13B679DEC97C7490D808D57203699302 sammycalnan
458,347,202 *2E81DD483B73C3095F2418350BB07E17F082892D SAMUALBARKHURST
458,347,203 *2E812701434057434BEF96E345D6B89AE3AE6A63 HERIBERTO.TERSTEEG
458,347,204 *2E80EC8D3C2D7490C3E482C5B138066A1F1A4A89 SANFORD.MCKIBBIN
458,347,205 *2E87B075BF994B6C3F623CD277D1058EFCB90A0A HEUCHLERVEREIN
458,347,206 *2E8B623D30E47873DEE74B835F4D36CA442CF120 [email protected]
458,347,207 *2E88BDE61890926252D2BBE3704D67F124AB62AE [email protected]
458,347,208 *2E810D7CCE648922E061AE4351E92C7AA5631C12 hipolitosantana
458,347,209 *2E8DFBE0B6670EA024241B5CE1D790F302BB5B76 SAURABHDEVI
458,347,210 *2E80A2DB483AB7977C52563B9500A49000C78778 hohkonigsburg
458,347,211 *2E8D880F1A3E48DEF84E389BE37392497EA7456E SCRUBBER263B7JS0MRYOS
458,347,212 *2E82FD34C234B871A0288A3B90CDDBE54DD68251 sean.doty
458,347,213 *2E81D8EBFCEF95CEF4B03C3715EF2B858A0DDF62 SEBASTIANZAPP
458,347,214 *2E8A775CC62EDABF79983005846D713D3B7F4A03 HORTLEY2
458,347,215 *2E80C4983F03B519972C4E3F29CBA10CE3C5FD1C HUARNBBS
458,347,216 *2E80FB40220F97B7083C8157BDE42E2214114004 sess
458,347,217 *2E8B14C3B9BCA4C7342CEB9FEDF88A6E36BD9A7F humanarum5
458,347,218 *2E84C329E5E83229180ED9D3681A38BED1E247D1 i40_arsvg
458,347,219 *2E8E76833B4A323020FF14559E28B1CE4627EAE7 SHAUN.ADDIS
458,347,220 *2E8763A38CC88B87BA1B16694BC9BFE9E22A339B SHAUNPOORMAN
458,347,221 *2E850D7E06C27595452DDBDF5D417DACBB825D71 iamcarol126
458,347,222 *2E84233890359698F0A335BFB6652A38EB4D6BD8 SHEILA VARGA
458,347,223 *2E8F130F7DC178FF9E55E471B945099E6C67E557 IANMCGEE
458,347,224 *2E83AA63A54460AA29B9B7709665E900600A6C23 [email protected]
458,347,225 *2E8F6C8EFFE52D26817BFC90F40E48EDBA6FBE9D ie~*
458,347,226 *2E8E99C320464EBCDC79196F8D9A178310874394 SILVIBSW5
458,347,227 *2E84591869867487600DF38202213D92CBBA2BDA SIMONPACITTI
458,347,228 *2E89CFAC566E6B31740574F7506F117C107103D1 ILLERTES7
458,347,229 *2E8176E3331A2EC1AB53300370691B9544A42284 ILOVEBASIL49
458,347,230 *2E8044319585A0169FCA955FA2E4BBE5802D07D0 [email protected]
458,347,231 *2E82CF5A6F2F46658A1A2E7D0C6FD183978256C0 ilovemacse3038
458,347,232 *2E87E11C8BD023A68EDEF561ACB453E434BEAF07 SMALLDRIVESCOMWWW
458,347,233 *2E87C6203F525E13848BEB08B54C238E19DD0807 SNIPERMARIAHED
458,347,234 *2E89588B71F51487A272148E02B399D45E0FC88B infocoltrane
458,347,235 *2E886233D6C5511F8B16EC55C66624A9F56F827C SOLOMONSINKEY
458,347,236 *2E8257435555A2D570FC1F77247CBCEA6B99B28E [email protected]
458,347,237 *2E8C751D3FE8CE591F1F0856859BFF7F1DB2FCDD IPHIGENIA-IN-HADES
458,347,238 *2E832718CD52573F79D02E678F49D8F0789A00BA i`qy
458,347,239 *2E8AE564E79E7EC28FE088CCDA91B5F6EA600723 SOPMAJAING7
458,347,240 *2E8E448728F3CD63E3C5D8CDD38098B3C502B3FC soso.alasal
458,347,241 *2E8683A9DE717B4268E37D5D4BB5931DCA6DC87D SOSONEVES
458,347,242 *2E852FF414CE796AD4428FA67161E8940822D338 ISAIASMAZZERA
458,347,243 *2E82FF8DC2BF75E5106F3835DCC3C340C42E2973 SPARROWDUKE2
458,347,244 *2E804CA3AB4EE9F36A17E0485AF6EA0D1DEEC24E spencerburris
458,347,245 *2E8CC5E63A0266F05147B8C17E99A5378BD42A27 ISISRICHARD
458,347,246 *2E8FF9954BB287E74257F3837AFB010DD52C9580 spolurozhodovani
458,347,247 *2E867A381C5562C48F368C19453B21332DB39811 jamtonight
458,347,248 *2E854CCAA9A61AA5658189D3F3F83C8BD3B160D7 STEEPWOR5
458,347,249 *2E8CEF1807583CBD3D4D5840D71D989B48775A6E JEFFQUIRK
458,347,250 *2E8ED7509DE5D9A05F334CA5FAACB3BB0A0BB185 STNORELGNART
458,347,251 *2E8FA9C41979E08841B0A409FAA1E0EC8BD2C31F STRAGGLY0
458,347,252 *2E8D1B77C9A96A94DC6BD7B6B6CCB159665D60BC STREICHQUARTETTENR3UND4/MOZARTREUM-QUARTETTSALZBURG
458,347,253 *2E895D7B339648A2ECA791CED81C60C6FA2A971F JHANVEE
458,347,254 *2E8882C4CDCFB36132AE0CF8B1FFCEE057473E69 sukhbir.padda
458,347,255 *2E89DFA86C4075CAF49A9C6A8CD03509AE9D15C6 joaquinschwind
458,347,256 *2E8BFB5C5D117EA31F4FC0FA0CA8438CE85C920B JOCOTESED
458,347,257 *2E80C564844599B6F22CEFD8395FBD41D4BDD6E1 JOHNIE.SCHEIBLE
458,347,258 *2E8CB5AD5EA13EFE4D3F6A05538715EC30E70A53 JOHN.LEITNER
458,347,259 *2E8D1477CF87108FE64811FD8764793C8F600E77 joseban9
458,347,260 *2E855583C9D9DAA165B451E4DB49AAA46281BE52 JTARPENING
458,347,261 *2E87C808751B61432E314DE6E06408F55EE46583 T5CS
458,347,262 *2E866F3AF0D4F0E0ED49C72D69F642CEB0CDC670 JUANKOELLER
458,347,263 *2E84639843D35B394EEED8BE664007D4DB644D0A J\UD
458,347,264 *2E85EB272290B46F55BBA2C203F6821750D10EC6 TAFFETISEDS6
458,347,265 *2E8BBA4714390F9DC083B94F98498D75962B5FD3 KAKISANJ4
458,347,266 *2E88DC50338DD20CC9A846D9C8AC1C55BBE6D966 kamilah
458,347,267 *2E85A32C8A5CD845DD02723D361B1A26203C6CDE kapseist
458,347,268 *2E8BCDAA4C279EBB3D5C2A0BDFBC6F78B94EE4A1 KAYLASHAFFER
458,347,269 *2E8B32C76CCDA52FD053EA7332FE500766676E87 terrellheymann
458,347,270 *2E89945C2975FFBE08BC1BFB008C7848AB0854D5 [email protected]
458,347,271 *2E827FE47616B94FA9CD706A12545F8AE405DCB0 TERTIARYCOLLEGE
458,347,272 *2E8C88D4C482A0666534A427D664B9E8A6A0092E kingdom.of.ends
458,347,273 *2E8B40F4F5674C466D4AF10B040D2FF0828F16D7 KISMET
458,347,274 *2E8165D1CC0E448C040D35AA51CD2E321AEB8829 k"n_
458,347,275 *2E806416EBD924FD52299A252BF6A562465AC00A the.robots.(space.strings.mix)
458,347,276 *2E8473F343542A9C54ED5F9AC11300E9CC786975 [email protected]
458,347,277 *2E8FE20284DF31E2E4251E2EC0484FC935076760 TJENESTEMANDSSTILLINGENS6
458,347,278 *2E8185CE587BFA4D407261749B5088DCE12BF123 KYLE.GATHJE
458,347,279 *2E8B1AB529A78686D73493C93C3EAA54BBBD0344 kylemcclenic
458,347,280 *2E8900EC912C80C7F6B42740DC6AA8F458907C14 LACINULATE8
458,347,281 *2E8AF56719E60196F0A37531B401B78C447D167B TOBIAS.CAST
458,347,282 *2E8E65FEEF590EAC9375280678263E0061F279C1 tobiasgholston
458,347,283 *2E8CBBDC1585A1B5F9445FA5E1956AF4667E6AFB LANGSPANEND
458,347,284 *2E87C011920C3B7E9D6354920FE5D841531F3C17 LANNY.ARRIAGA
458,347,285 *2E8110721B63FAF6846A57D27BF595CADA7C715C larrykleifgen
458,347,286 *2E86F959DF2EEBC0DE7CCE711EB5EB0D75514625 TONEY.ESSKEW
458,347,287 *2E8274225D6637397FF4ED475530440338751D1E TORYFARWICK
458,347,288 *2E8828213D0458ED2784EA901CF1149303E074AC [email protected]
458,347,289 *2E886A9577EFA67AAC56202A29DAD01DCA9AD1C8 totŭramsan
458,347,290 *2E8733A509B91520B9AED22423D0BE6EA80EDA7F LBARNEAUDE
458,347,291 *2E8D012C8684C2958C4811C0822E000903E93B85 TPERSING7
458,347,292 *2E8A6E69AB236225CDCDD6A57BDF058824946C86 TRACIHEAD
458,347,293 *2E8393F6E59AD4B439DAAAA5549082492B29D889 learn.to.drive,.ya.dumbass!
458,347,294 *2E859A17DF723AB0735D90682A9E52CF08D5BE98 TRACY.PINION.FORD
458,347,295 *2E8F966A6C5FD0B70A402BD33CD3A10D708A92FC LECAMUSIN
458,347,296 *2E8D01526186205AD1E1FEAC021913C9570ED174 LEEAKHTAR
458,347,297 *2E891B13FE80225DD41594FCB5227C59E3D1F9D3 LEGASSIS5
458,347,298 *2E84A5524F09020C93DE92586EADD17E7076703A lekela
458,347,299 *2E82F68D3CE100389A41B17528BDA702C57BF773 treated
458,347,300 *2E82626775A47ADA62D849F4ACBBFF9BCB494A5A LESSONS-IN-CONSERVATION
458,347,301 *2E896591EF689BBB98BB30371218E69BDAC6C6CE troyanna-brown-helms
458,347,302 *2E86FC2566B54F8F6DF375CD6708638833977482 TSELLENI6
458,347,303 *2E8C642BBD0728BEFAFBE9BA0D8A613E6DD6D4DA LIBANIING
458,347,304 *2E8144783277313626D66FAD49999A80E168A51D LIFE'SABUGGER(DESTINY'SCHILDVS.TALKTALK)
458,347,305 *2E8AD7E697525F7438A774CFEE7AD3A480EED810 Tu-es-foutu-(Tu-m
458,347,306 *2E8FB5BB5B20D067816D544F2B109A3E12810B71 LIMINESS
458,347,307 *2E879EA763F4BAFC00FF347BF5213D3110944E0C [email protected]
458,347,308 *2E8626D5C537C6D56A88631AECF3FB977FBE580E LINTSEED1
458,347,309 *2E8E94D7E737E5AA491011548B68EE1B1670379D LOBELIACEAE.
458,347,310 *2E8A2F73D9045202892963FBC7B9BF9F5A8D3861 -LoGS,TRaCKS&STaTuSiNGoFaLLTRouBLeRePoRTS
458,347,311 *2E8C0769F2ED45A1F2D7DBDD6EF1BE33C58A970D LOKALISERAS
458,347,312 *2E8E1EFF867A05A7FB7105807331578163C52439 LONGIMMORDINO
458,347,313 *2E8D0EF593F06535208D3BC3A2FB656520351F23 LOOKING FOR DANGER
458,347,314 *2E897D257BF1FF8FC21F56F35AF9C60DB26BF76D lr~n
458,347,315 *2E8678A633B57989694163D0907F8236B2B1FDA8 [email protected]
458,347,316 *2E8C37AD3E6EC203C356FE8C717DA0BDA638DCF1 úoj
458,347,317 *2E8D900199864EC7169B3B9D9BE97122323E3218 LZBTHNZSED
458,347,318 *2E886CE69EC27F7059887831CE4DEF1EAB164284 MACLAURI9
458,347,319 *2E88CF8E6C739747471F7281501F8A0C394756CC MAGNETOOPTICALEFFECT
458,347,320 *2E8BBFEAD3CA45C54328F8C0C4950EE476CF1153 MANGIAIMO
458,347,321 *2E857B553234EC9483A700F90338797CDE3418D6 MANHOSA7
458,347,322 *2E8BAE5A530EC54A60198C955DEDEE9AD0694222 MANIʔÓK
458,347,323 *2E892BB303656D96870EF195993F6C7A7768D9D1 MANUJ.KAPOOR
458,347,324 *2E8A4D304BEFB441A0913551500F6DD3F808D25C VALENTINERINGKITAN
458,347,325 *2E83694D77DCC93AD9E306386D9F0729BE2778B8 marcelreddoch
458,347,326 *2E85C5096060CCC994859AB0780506D82E7753D9 vanmackey
458,347,327 *2E855A4AADBDAAF1C712D4FB14CC3AAE04C6CA9C MARTIMEZ0
458,347,328 *2E8D05853FFEB32EAC06A18E2C5049633A6BDB10 mattkhay
458,347,329 *2E886271FDE6B8E48822B7AD160205A462EFFCCE VERONICA.SUGARCOAT
458,347,330 *2E80EE92C3DF3B500101CD99EFAD0AE0435356C5 VERPLOOIDES6
458,347,331 *2E8C48D8EBE96DFFCFCAC16671785A393A17B3CB versionver1zhah0n
458,347,332 *2E85898AF41DA38CAF2419EDA2FC691EE88B42AE MAXELOVEYOU
458,347,333 *2E89AA3177E08E5379F0DCC8801D9B3FFAB92D49 MCARDBOARD
458,347,334 *2E88480344B65076ECF459546FAC28A675239635 m?e^
458,347,335 *2E8B0EC917627CF77A6C8A225309DAB08D5A38FB VIKINGBRANDY6
458,347,336 *2E80E49527F5955966C64F7B6EA4D98004F17448 meli2000
458,347,337 *2E815AF961C736579545EAE751CC79E3F5DED528 vincenzobelleville
458,347,338 *2E8EE0046867943765866A5BF844BE4D3E72E885 vincenzosamay
458,347,339 *2E845A5B54748850D61F1DDF562D970FE9212B7F MERIMEEIA00007990
458,347,340 *2E84DF5D3A02B39053BA661B97759A71F7EA9A03 VISHY-JAMWAL
458,347,341 *2E88A1AA5C0F36DC8B838988F0E9EE6A05F09516 michaelsissell
458,347,342 *2E84477FA2837C65FC69BC4DD8D4905B19533350 VLUCHTPOGINGSED
458,347,343 *2E86610971B757BDBAAB5C005D286A752182954E VN SANDERSON
458,347,344 *2E8626B19E9408DE072826A9554C02F35C4D22F1 VOLKSMASSE8
458,347,345 *2E8936A0EC969D9175A70B58FA5E3D929EEE5CE8 migelangel
458,347,346 *2E85F71E08C39A0236AA49D624305D548E0F2853 vomhimmelhoch,bwv769(stravinsky);choral
458,347,347 *2E8F58533D243C47F09426C51BB752CD1C4D5DF0 MINENVERLEGESYSTEMEN
458,347,348 *2E83E02169DF57EB0C213B4FB582E9A7AFCF0793 W166634
458,347,349 *2E811A19471E885F2FBC1444F5A23A3667933D5E W63421
458,347,350 *2E8DC74C6E12EE60B10A204A785E7B589EFE0C20 w!991!es7
458,347,351 *2E81F72B2F9BA61FAE34439167EBFF3F16873EB3 waddielong
458,347,352 *2E80FE40A6F9D6BCD2562629821C39A49D94506D WAHYU.FITRIADI.WAHYU
458,347,353 *2E898D3EEAAED977698CD3AD04B6A19A69D794FE Mll48le
458,347,354 *2E8DDD5F6564B86C0059F03F8C0B7365DA1C61F1 MLP00
458,347,355 *2E8CF7E44BD7719FEB373E123B7BC7CBC5BA5380 mm5:
458,347,356 *2E8B719DFFC2ACD958475DF1162BE73EB5C80554 [email protected]
458,347,357 *2E8375E88678F690A960C09BED067B7488612920 wanda-jezowski-wright
458,347,358 *2E84B3BB38617B2D9E75A9404F5D170D827BB3B1 [email protected]
458,347,359 *2E81F4F3EB0094E947815371D41745CB7BADE0E1 moisesschlarbaum
458,347,360 *2E85675AB0203C087EF0537FA6F089052E5462B0 monebmih
458,347,361 *2E8EC2165EC568C020900229BE9752B85AC28368 WAYNONA7
458,347,362 *2E8FAD0040AAC13D3B4F1004C8138237B0D97BD6 WELDON.OMO
458,347,363 *2E8330980EDA1BB78077911AFB3EA25EDEDE1400 MYDANIELA11
458,347,364 *2E87478AB90E794F5363665A3D9D839BABAD06C7 WHITNI DAWN MCCOY
458,347,365 *2E863D92B488A69023434BF5511AAF1383784B55 WHYAREYOUWEIRD?
458,347,366 *2E80B58084D2E8B62EB3FD049E5792C4A074C020 willard0
458,347,367 *2E8100C950C29CCB20BF8F97C963DB820C624B4D NASIIXA
458,347,368 *2E8E593B48AB6801F05130E570790D1E62BD0EFA WILLIANCARSNO
458,347,369 *2E826BDE1BB0DC419CCE750F3CB0C69902005442 NAUHAQUE
458,347,370 *2E8BAE50656020F561610187AF819FADEF34B352 NEDMEONEG
458,347,371 *2E8CF042F85264870B63C913C4687EA0F2DCDFD0 nern's
458,347,372 *2E815CBDA52D4CE132830CE0998DB00FB3B96C44 N-HEREDITARIA
458,347,373 *2E8E4593E179A887284ADD568A559A01F299AF6E nickna
458,347,374 *2E8EC22F068DB066C6DABB104BC4CC30B18A7456 NICKYHENGL
458,347,375 *2E8E8946E913BDC1BE5A0A9F727E7DDE34D52AD5 niggadag
458,347,376 *2E8586A0A438BC33A8E9B108EFDC679C3AFA44A8 N-KNAPPTIBBLE
458,347,377 *2E88172B92E6D441D78279D86F356BC600A4B39D XIAGLORIAF
458,347,378 *2E8F0806F6972922CA3E7C852E651429B84FF3DD xiaoyu
458,347,379 *2E882560635CA2D7D54C87AB482F8F18A7286CAF NORMA.CRUZ
458,347,380 *2E8F1F3607E882863054297C75D49B10DBA2758F NORMANCLARITY
458,347,381 *2E889467D383ABB56A668A930191188C9FA343D4 north-northwest55
458,347,382 *2E8823E23346F517C622CE18E38EDAFFD0FBEBB5 [email protected]
458,347,383 *2E81EDF54A96ED714C0CEEAEFE043A4950020D3C NUEVA ERA II
458,347,384 *2E80442E8C5DE0394DCF8A7CE0066AFF2D29C00C numbersdebenedetti
458,347,385 *2E8E34589B8F68BBDD4F2E4E563348ED831592B1 YANNFERRAND
458,347,386 *2E898DBAE5600697B2A9F5A342E551B8D7063A42 YASAMAN.DEYLAMI
458,347,387 *2E8BE3B4B6A5E644292241240E6098FC0FF1CC4F yatyirihfymjad
458,347,388 *2E8D6749499FE78F11DBE41AD2A131775F2CB693 OIDFY
458,347,389 *2E8B97AB6202FDC3E402BE20EC826127DE79D90C ylihtuomed
458,347,390 *2E84D9ADA2F8137F516DEBA0C8327555B32AB15A YODAVERMONTED
458,347,391 *2E89F205F27A84772EDDB831207713CBEFA17C36 YOHLAEH
458,347,392 *2E8ABFF7CABE8A04C7F77E50FAA9E5DBCE979F60 onaning
458,347,393 *2E807BA534920ED090EC40E061064495759118CE YRODIMORD
458,347,394 *2E8FB7C8243AB1C4023C342771329CB46AEE4190 (~_^)[email protected]====3
458,347,395 *2E8BA4FCE7136C2F4918054588B3910719F89DCA ;)O~O~Q#####B
458,347,396 *2E8555B61756BCD1389EF55A53C61F6879998FD6 ZAINAB-ZEIN
458,347,397 *2E8B0673C759F2E39660B22C5C298914785866BE OTHERWISW123
458,347,398 *2E8C5BA6F158C37F665CF2FCF75FE48D02282217 O~TQ
458,347,399 *2E87E7F0C087C53618F63B95B6F5057D35B3B44A ZATOROWIZNA-KRESY
458,347,400 *2E850728ED91752EFD0CE50296DDB56D00A8DEF6 zek.walki
458,347,401 *2E8DE38AC0D9A11C81883015637BCFAB5A3A8889 [email protected]
458,347,402 *2E87D67EA048BF1B7BF9FD4EB98BE9E2490FF6E8 [email protected]
458,347,403 *2E83B65ED5FBB4D01BF474886AAE4A8D1061F3A8 [email protected]
458,347,404 *2E89DBB356BBB7F8290A4208D556D30310D18899 [email protected]
458,347,405 *2E8E53C9BBB923005EBFB2610FEC4D033DB8570F [email protected]
458,347,406 *2E81441FC14125C17BD5CD616E71EF1B69069A7D [email protected]
458,347,407 *2E820B266D6F56CA905D7AC57CB48FC0A71AAEBF [email protected]
458,347,408 *2E8EBC376764E11B8422F99CE6D3DC2CE7021448 [email protected]
458,347,409 *2E83B01D94EB549323F05C68A8E9CAFCF4CE5F07 [email protected]
458,347,410 *2E839FDA554508773B83C8D7DBE16E00A52CDD3F PARIS.LOCHRICO
458,347,411 *2E83237FEAA13FD711E6F76AF86194EE91FF6190 [email protected]
458,347,412 *2E8AA2CE8CD0EFD3D051E0C59AAB003C786167F0 patel-schwarz
458,347,413 *2E8D0B1ACDCDC7BCFC0EFFD20D473C4B7E275FB2 zusammengela"ppertem
458,347,414 *2E8FBD2C23012DCAA82F720AA4BC114CAFB198B9 ZYKEY
458,347,415 *2E8A39A6FCBA10CD9CD61C8B55D148B2946F7358 کھرu
458,347,416 *2E8323B663ACD25C53F55600443A0072543EFCAC ΑΝΉΛΙΚΑ
458,347,417 *2E8C1D729600AC74DB9A6C3D31587B299C02156E АЛЬМЕРИКО
458,347,418 *2E8F9930A41E444F29445644755DAF29E40C0C3A PHL03M FI
458,347,419 *2E85230EF6FF4F9ADB4E6648192DBA51E1F12BA2 PIETASES
458,347,420 *2E87E7121A7925BD417AAABFC892A8D33C6332C7 piluccai2
458,347,421 *2E84F2E3D4DF6F54EC2D69ACC5D11802A6A4CEB8 PINBORER6
458,347,422 *2E88CA4F3A87B869005D5D1EA0316F8A8F04547C РАЗВАЛОА
458,347,423 *2E82E98127354034F421742416DE696948BBB836 POMOGLI-1
458,347,424 *2E8810863F10A081B1A6A45BE227DD5EAB420B95 СКОРОЖЕНА
458,347,425 *2E8FEEFFEBC4873B5CE2805488423B192DBCEEC3 popsongged
458,347,426 *2E86EB6CAB12D576EDD28BB9926C61FEAB327934 [email protected]
458,347,427 *2E8A919EE391FCE5E03BEA032BAE597819BA168D POUSINHO
458,347,428 *2E880D7F976C8A139694DF72D110C66D9EA1D9DE PZ(W
458,347,429 *2E8543D0746EE14897DB06289E31C96356D50E5A [email protected]
458,347,430 *2E83BFE4A9E202223D7CE76CAC241A2537C0D64B [email protected]
458,347,431 *2E87D71A7329888B165FF585F880882020679C7E [email protected]
458,347,432 *2E8B05A8BE8D445C884085A26B8A04AEE8D044A2 [email protected]
458,347,433 *2E8C17D939FA860D8B1F9AF0AD1A48DA08BDB576 QUINTIN.JIMESON
458,347,434 *2E87324D0D595B823B396800EF2C6294141DAB56 [email protected]
458,347,435 *2E8C9772A8F9F5BC243B9FEF6924A974DBFB4BFE RAJUBISTA
458,347,436 *2E8A23D125230CE7DA3ECA2110CBC309573E5F8B RECIPESEPICUREANCOMRECIPES
458,347,437 *2E81A05F7D2481DCA6074F93739EED107D322D96 REEMA-ABU-RAMADAN
458,347,438 *2E804F298E2FEAFE21B10B455EDA03D4E70C98CD RE:.FARK....QUBIK.14:09:03.01/07/99
458,347,439 *2E8C47670D27375EBD61A06511C25CDD53C9FA02 $res{'modified_year'}-=-$7;
458,347,440 *2E80E774AFAC04AFD47B4C273E3157493771F70C RETZTELRELLA
458,347,441 *2E8823C00669735E462DBDA933AC7535DDE893F0 RFAHLEVY
458,347,442 *2E8CD6462C0530122F136ADA5DE777F11B1E000D (rfbaa
458,347,443 *2E8C819053C7A94DEB3D40453D80CC2591DF61C4 RHAIZA.SAMIA
458,347,444 *2E8BDFDCCD4BE382038208A5F0C2EC5B8EA5A4BB RICHY83
458,347,445 *2E81F3DAAF7654A1153EB126E56A767FD31CE898 ROBBYBREIDENBAUGH
458,347,446 *2E81858D54F1A95604A3F0500A24E8DB92627C4B ROBT.EMILIO
458,347,447 *2E8DD7C1AFC52FEDD0B2EE5E26C7A22C5B6939CC ROBT.HOLDINESS
458,347,448 *2E8B7C097C9895E31CFA39DD2BD7BCC20B375F7E [email protected]@B!L!7Y
458,347,449 *2E885D3D00D440A0009D6BF405598F61ADE8A5C4 0907MYSHOES
458,347,450 *2E885B1088832E5449E96F8D94D21056D7A669DB RONNYSNELLINGS
458,347,451 *2E856458766465A836B48AE4A8219D736C0D6C68 0JZIPUL
458,347,452 *2E8B40C883EFC81178A61C631165143607813897 1341G
458,347,453 *2E8EF73055018453AFB67CA9551978D8FE09551C runpecher
458,347,454 *2E8ABF0F36522ACDF60416174058ECD7DCE82C49 RUPERT.SEVERYN
458,347,455 *2E87299EFED4ADF628E50F6D3B95395DDEC80F0D RUSSELKATRA
458,347,456 *2E873D3E85273DC4C528F4D7504A69539F384FAC rusty diamonds vol. 4: bangin' round the x-mas tree
458,347,457 *2E8362004F88879921C49F5CF36823FC01F1AB75 [email protected]
458,347,458 *2E8B6B293C5E7C80747F6495044193B83A179589 RYANBOHN
458,347,459 *2E8265FB3108EF825F9504169EFE3B0220565D32 sallmann7
458,347,460 *2E8EC73C55687A195D3D80AB829E45A0D402E6A4 santana1105
458,347,461 *2E87DC32AB8A0272E34D1DBC29EA20DAE91022B2 SAROSHHAYAA
458,347,462 *2E8FC5BD061179E25750F66C1718026F0C470FF7 1CLIMAXED
458,347,463 *2E85B4BE2E56314D3136B47F58E0C07AE5E17319 1dragaded
458,347,464 *2E87B758AEDF4424E271652CFBEA31B7835C177E 1.ERINNERUNGSRAHMEN
458,347,465 *2E8AC7F3C340BC4CCD813C551C1E2461DDD4457F schoolteamfixturelist
458,347,466 *2E80CB78F680F7671A70AFCAC8783419653C6C62 1.ILMANPAINEMUUTOKSIA
458,347,467 *2E89C3C9F76BB54C2C4D5876CD6CC6FD4A1126F4 1ILUVBELLA3
458,347,468 *2E87C2E3A4B8FE7797A3647EC30129CCA25BCC11 1.KOVUSTURMALARINDA
458,347,469 *2E832868000DBD21C7403AB7464649813D439DAD 1 LIIKUNTAARVOSTELUA
458,347,470 *2E828B7F2212632FF141609EB94755AE0C4861D8 1-LOSWAERE
458,347,471 *2E8A68ADD2E2C87F68CC6F6EB8C26232D6AC3E1C [email protected]
458,347,472 *2E80545482F7EF61ABD82BE65F699AF24225BE37 SEAMUSDEAN
458,347,473 *2E845475BAE176268ED8AF84000C63063297A6F3 1muttefiktik
458,347,474 *2E8B617CBE99A23BCCDD97E0F9CB0A001F6A42A6 1nasoccipital
458,347,475 *2E8AB008D69380E50751F8C52EAE755ADAFC8A14 1 RENDEZVOUS-TERMIN
458,347,476 *2E89D5F4662B078CC77CFFB57899522DDAF5374D 1sandkasten-szenarium
458,347,477 *2E83DD6F5A637880941E735FEE013A73979F9993 SELEJTEZŐFORDULÓJÁBAN
458,347,478 *2E8885867E53BF797CC5A5B6A7A3276186933DCA SELSBIOGRAFI
458,347,479 *2E8B956FCD7C3FEA174C90EEBDE89F9AE6036798 [email protected]
458,347,480 *2E8C05A3477247798357CDE0A0157D349CFBDFF2 1.tirrell
458,347,481 *2E814D0C790B7845AFFC32D048B721E756DBA114 1-version-aimed
458,347,482 *2E8326823258CC69243C874C54E44D601786E599 SETIMIRE
458,347,483 *2E843ACF6E1ABE26247B7F833D94955A1774AC13 2007―明日の朝焼け―』(SONY
458,347,484 *2E80A306D3B0D3FE9687775D4C0FBB424675469C 2159991 volvo.penta.esittelee.t
458,347,485 *2E855CF41D166C64705A36B2AEBB572E7EED4249 21 j
458,347,486 *2E8F69EF35E550D0A0D90B49DAAF7BB02CDED975 shanehuseth
458,347,487 *2E895886CD40FA4220BC81BF9BDF91EECE17EAC7 230JUSTINE
458,347,488 *2E81BE06DAD62642DCA7AD6FEA5AF77A9547CDD4 SHANNONIMAGE
458,347,489 *2E82F5823FF8F5FB54A1077A9D3601AC30332E90 SHAR-E-BOZORG
458,347,490 *2E88EC46017F13E7569CB65787F3E591FC921857 shawngach
458,347,491 *2E8519F9BB74839FAC5A019A595D307A585F7A3E 2875359 OFFICIALS FOR MARITIME COULDN'T BE REACHED
458,347,492 *2E88EC4F6A5C51631F7BF19EB9B1E3F80B321E5A [email protected]
458,347,493 *2E8966B3E96FE22D055A4909D32081BAAE0FF6D3 [email protected]
458,347,494 *2E848E03B05545DCBEF9BCD15E08B9EB6BEB5AB4 shotgun debugging
458,347,495 *2E8CEE75721995A646AF7D1705DF325AF310D9EF 2DENMARK
458,347,496 *2E8D63BD261D6E62E0E213BCCE1F3BBB29C7F6C1 silent.service
458,347,497 *2E84013433568EC7C6CD93A09E0C11AF17415B3A SIMPLERAPTOR
458,347,498 *2E86C5EBFE551661E383F703C86635A52E82B86F 2.LEHTITALOJA
458,347,499 *2E8F276613455DCD9DE54CFB3AE75AD2ED2B3173 2LIEGHER
458,347,500 *2E87B6F9ED990AE4D11C4235B15045209821AA2F 2LITHINK
458,347,501 *2E8A25AB0D08DB2829BA1BFB1F4BF51895ECA12C 2 MEDIEN-MACHT
458,347,502 *2E83B858875F24475B5FB99C5675AE3C1A90E2DF 2MERKBAR
458,347,503 *2E8CAAECDB104034B68A3D4F65422A4939138CEE 2 MERSEBURGQUERFURT
458,347,504 *2E8DDC41F584F50E41D1344D84983A61C757BA1B SIVESSAMING
458,347,505 *2E8F334CD0D8E98BB802A7301689693FF3A474A4 2obg-fraktionsvorsitzende
458,347,506 *2E86037CC759C1F75AF2D4C70038C2B055E89E22 SJOUT
458,347,507 *2E8115101BE195CFE4516B75F8DA6F229B9F45B5 SLAVLJANSKO
458,347,508 *2E8E5A09144A4C06772AC1DF7C55EB44B29603F1 slezalis
458,347,509 *2E86A6589A146B8BC787AFFA50104D38D549F4DB snakiers0
458,347,510 *2E8769227D207EDB67AC376FD76081AFBACE0650 (3D)軟件如
458,347,511 *2E8BDA52D8E50D59AEE14B981D3AE60918B0875F 3iamricky
458,347,512 *2E8D3D4B87B5D49B001EEBC8300A5D39B33026E9 songhottie
458,347,513 *2E81463EA4331E64557FF18AAC9B7746A36E4BC6 3SCHIEFERBEDECKTEN
458,347,514 *2E80B81B2DEC9F0F372D0E682E6032AF89121A45 sonnycomiso
458,347,515 *2E8570CA8638A3A1E943E562DE3462D879B2C8E6 SONNY.LAGAN
458,347,516 *2E89B450D1DDAFFFA4F32376C5680B3406D5CB00 SOURCEHTTPWWWLNTSC
458,347,517 *2E88082F4C92C3A1A428E940C75452C22103B4AF 40504e1360a03311947a980938500c8e
458,347,518 *2E824ADF0A7C9BA2AE4EFB5872122707179BB725 4081718
458,347,519 *2E817F264739BF9406D534BE420463263E4B5D50 457leonel
458,347,520 *2E8E925854B74D890233463E63F6A492AD84D06B 4DEMANDDRIVEN
458,347,521 *2E8BF79CA90F0DB934525BF3FB0AB345927BC85D [email protected]
458,347,522 *2E854FECBA0573461D83CCDE1F2E2593D3A47FC9 SPIRITPIRATE.
458,347,523 *2E8098193675AA8B8C70B5DC0F1B839BF650A9FE 4METACENTRICS
458,347,524 *2E8F2BDB761AF83370C6CF4D7E6B5004598A6156 4PROIETTIVO
458,347,525 *2E8E715CE34745761F135CB083E4C597FF0B0C9C sploit ~ ~ [email protected]
458,347,526 *2E86D2BEE77A23D173473A46B94BCE300D37D253 4SADELKNAPPS
458,347,527 *2E80C16CA71C19162BF1195B178985888B648712 [email protected]@+!on
458,347,528 *2E8DECFA430CE7521E879264532E7236A2B42D6B 4VELVETSPECIAL
458,347,529 *2E8097B7F0192FCF85FBC0000A049E1E8613AF24 4wkw4rdly
458,347,530 *2E8547F5FCB244D429ED5312FBD1FAAE11772F42 SSELTEEF1
458,347,531 *2E8EA8FB01D4455741652F96D3D99C2B8B7CABAE stanmiller
458,347,532 *2E8A6E6316D80B03CF7766A5D88F6D8AFE6CFE54 STATS”
458,347,533 *2E84FEE8469B4DFA41CBF9594005CB29BE1A8386 steigerhubelstrassebsw
458,347,534 *2E8665A7017AA6092DF8CF4B866F16A6364EC295 STERLING.HOBGOOD
458,347,535 *2E8BBCDD237B7EFCC8FCF52DEC738D0B95E9CFD6 STEVETHIELBAR
458,347,536 *2E8DF23144E932D9D0C2BC0F7E68310C81931073 stikkerses
458,347,537 *2E86992B7B1E37410286478383AD0C12EC170655 5INVESTERINGSOVERSIGT
458,347,538 *2E8081DA2D7200C232F8DFCD95CA9B724EE032F7 [email protected]@t!on
458,347,539 *2E819F7A21E6710F00417967000E992D699703B4 5PEPPERCORRADO
458,347,540 *2E858AFBF046B0E332EA62A2C24D5A532447E025 südtürkischen
458,347,541 *2E87F5F1006CB203A269B507034B70A60BFA2055 SURENDRANMUNIANDY
458,347,542 *2E896958A5B79423DD2AAD4848122DE8A684C496 SW44NVL3RK
458,347,543 *2E88702EC9229F170673700E1C4F30F2C1803F4C 646652 VILAUTAN.VAIN.ASIOIHIN.ERILAISIA.N
458,347,544 *2E8D297B0EE2FC645504B756B9D63C7F6A1C2A1B 6ADIUUANT
458,347,545 *2E88C3841F31E0FDBA0DFFAF9AEB80915D6B6CEA SYLVIA.TOMCALOV
458,347,546 *2E84641D56651CA95320D2B2CF9BAF4517F31320 6BSWLPANETNODEBSW
458,347,547 *2E8107CD5F269DB364E01AD3BA7B748981BEED15 syvlakke
458,347,548 *2E89D870B8D5F86C0FD766880F916799D749D689 TABAAHA
458,347,549 *2E84EABE3D71E99332FEF2770F786B4A9EEFFD28 TALAJJAVÍTÁSIG
458,347,550 *2E891411F775DF63FC23C5039E172A5A6816ED4C TALKCANWARN
458,347,551 *2E82C54E9E12E0EF307A5F1FB4E7499C492AF7A8 6mykelly15
458,347,552 *2E8D5FEF7023D51C2CFEC641F742D3F27CCAD539 6qualities
458,347,553 *2E831DA042A4879D4E14A9900C344122CFF66384 TERESAJERRY6
458,347,554 *2E81792993D15B3A63E234361165A542E6D1BCE9 TERRANCEJAMESKING
458,347,555 *2E851816E655329840D170D7E274D58F06522663 [email protected]
458,347,556 *2E8614C3FDBF8E9C0080D121F63AF1DCB22A7EAB TGUANGORENA
458,347,557 *2E8D2F6EFC120CEC580C0A16338AAE9762CDD21D THAYNKARI
458,347,558 *2E8337F8E60398F216A8B7563BF57F0971DF4EEC 738505 11 ISTE FIL OYNADIKTAN SONRAKI KONUM
458,347,559 *2E8D77D49266D09EBB8B564B97F7E7BC609D34C3 thecool63
458,347,560 *2E82FE96C4C9F50104BFEF31CA6A3017A3A918B0 THE GOAT COBBLER SAYS AHOOEY AHOOEY
458,347,561 *2E890544E0985400CD346DC467AF7CA7E6D4BA9C THISSOMEOLDBULLSHIT
458,347,562 *2E806EDE771F9E6CF286B4BEE8D178A949807E09 7CITIZENNOVUS
458,347,563 *2E8FDD65D8D01E89536180886CE214423E2C5805 7DEPARAD
458,347,564 *2E8ED38CEFAD8B2D930139156F77EEB760D3BE9D 7EMBEBIA
458,347,565 *2E82728617E01BD0582D8B8C6115D3BD35E4ED6F TIDNESANATNOM
458,347,566 *2E8CE023166305C9ABFAA4E7B5E96E47F1519459 7EUCHARISTWEARING
458,347,567 *2E8A7ADEDBF37BB54E3AEEACD85B8EEFEA3C56F0 TIMCHAREUNSRI
458,347,568 *2E878D86E303CC9733E8F741CDAF07F989E4D55B timothy.handley
458,347,569 *2E841DA9D47A115F0A6CB9DCDA6AA2FF6931C8C4 tinchotamo
458,347,570 *2E89E01D13CF85629829DC6B78770541B0D41796 7NRSTRNBLY
458,347,571 *2E88933CCD208094E25315EE39117064E8960C7E 7PACKLYYLKCAP
458,347,572 *2E80BE9C3663CE713FC3799027B245C1E902474B 7RELAETSLUOS
458,347,573 *2E809DAD7ED28CCC17A9AB4328ADB48C5AC11C2F TRA70VIS
458,347,574 *2E8A342807DDE076818C379BD2A4B946D7BCB039 traitorousness8
458,347,575 *2E8776C6C9A8563D1025B173FB007C87053C4C98 7THEYOMAMA9
458,347,576 *2E8AACD1600889AB2A79F183C1913B15BA636EB4 trinidadkordiak
458,347,577 *2E8B098A32D8C70A131AB0AE8927EB8794969E6F TRISTANMEZEY
458,347,578 *2E877F809E175E8EED53F758359A8C3AAB75BE1A triunfo549
458,347,579 *2E8973A3EEB507B32DFF8C99BD41FEC3F26293A0 8899BB
458,347,580 *2E839C474A09CDFFBA30716F67CBA0324FCB579A TRUDEGILLHUS
458,347,581 *2E83F275AAC0E05FCA5EEDED9C59711F5671E8A7 tsegahuntessema
458,347,582 *2E8AA35F5D21C543A62BFE82A4206CA72BA90A0C 892009 voting-yes-were-239-democrats-and-132-republicans-.
458,347,583 *2E87BF6CB9DE63B00E09ABC8D57D66950EEAB80A 8==B.*.*.*.~0~oSplat
458,347,584 *2E879C620F922145DCAF7D66B09632C35A8DB9B1 TYLERSCHURMAN
458,347,585 *2E840739EDD77F76FD09E853828930F857DC5CC6 [email protected]
458,347,586 *2E8C3FEC03753A976052DE178EC2A896F45EDC43 u#0r
458,347,587 *2E808B2C57615E11FACF5CCBEC0FCA95A6B39730 [email protected]
458,347,588 *2E820BB1E7DECD6B5C004C99AE1D8CCC15B9F708 U666663
458,347,589 *2E8E369BF91A390858F380F8986AFE8879485941 [email protected]
458,347,590 *2E879E45D6407B003FAFEC6BBE19F86039D5C530 UBICARONED
458,347,591 *2E8567E78C626D305CAF924029246137D2CC5B5F UITBOT
458,347,592 *2E8B1EDA8CFD4EEC7133CF19321BFAA7E3B16E14 UNSEDUCDING
458,347,593 *2E89126108951334BEE55002DDC5F5BE1BA545F4 987635 SEVAINLIS
458,347,594 *2E83180923C8D6919211762A0F22ADD12C81374F [email protected]
458,347,595 *2E8F34A85F7DEB611379963CA6B9AE16460A2CAA UTCSTRIPED
458,347,596 *2E886E094D4F04333F88832B4E9B1A5433F20330 9BAUMSTARK
458,347,597 *2E8EC7288349F1BCDB79C3627F4B04D13F672958 9ETNAKES
458,347,598 *2E8460F2D6833A55CDE16DB513BB67DBB266CE07 9GNIVOMER
458,347,599 *2E82CE4666D98FF001E260F6BE2C1C1370D0B473 9hisseras
458,347,600 *2E8BB45EE29661F5D8E9C437A50C3FADFC1831C4 9KJEKKASER
458,347,601 *2E831B279DF7FB19809B7768827D1CE4F877BC63 9KMDAWMEVJKBT
458,347,602 *2E88D688DACD24382FD07C490E9C97774829A80F vanciebattle
458,347,603 *2E85BA9B76CDE6A7E441D9FAA97D91CAFAD8A5EB 9REKILDEKRITIKING
458,347,604 *2E86BB413E3A5BC06C9AC898DC78556C636BDB69 VECAS-COVARESA-MARISTAS-F-S
458,347,605 *2E824870C69A0A8E008747846DCC9E6838F09230 VERA-AGYEMANG
458,347,606 *2E81DFE1FF9BBE0203F755A38D10EFDFA19CBE35 9SKOLEPIGE
458,347,607 *2E86EB807DEC1B9B70E77B3D087B63F2DB262BA0 9THEROSES9
458,347,608 *2E88E09DE04C70C9978BCECB87F5483DC64FE7B9 „VERJÜNGUNG
458,347,609 *2E83B5492EF898F31C3FCADA876E8F210FA0FB0E a*:
458,347,610 *2E81D4BC1163F4DFBFA41A3E92E90534C6C05524 A1?
458,347,611 *2E8177A88B7B61D3C47454020588914353C6DF9F a1u+i
458,347,612 *2E87330EB2699A27A95E6C8E927FAF46F7D3C83F a7q+
458,347,613 *2E876A0BE96FF0E3F64891E36F997EFE59683507 virgilmedal
458,347,614 *2E81EDD41C3EF4EA96B46EFA2425731C72981786 virgilshortnacy
458,347,615 *2E8CCEE318147FEDB22CD88924D87BF3E9C3070C AAD(JJ
458,347,616 *2E8946CC4AB8B28E9D2AE1E0DDD50BE63C184E98 AAHI
458,347,617 *2E84B46AFEBEDF7EE8DEE8144FF65129AC43C83D abanneryear
458,347,618 *2E84B796936FCF74F0AA97758FD7947DED420775 [email protected]
458,347,619 *2E85664D44714473ACBFAEDD93097364844B49E1 abductor.del.me
458,347,620 *2E8BBEBC9298F521735F736F7D365CB040FF4475 v=ut
458,347,621 *2E84902FE3DED779C318BD9F1744940DEBDC4C47 ABRE,
458,347,622 *2E841258C037EAA2C8A83FFC8980FA0F1AB39BAA WANDALEIGHED
458,347,623 *2E85869B4D25F40AE1B21D7F0C9549A9836334FA WANGBAGEGE
458,347,624 *2E87CF6B552BEB2DC198BD7337766A905D194CE1 [email protected]
458,347,625 *2E87FDACE7863FE6566421A2E0AC5A2FD59C8A2E acceptlocales2
458,347,626 *2E803CF9FB9012626491DF2EE0EC45921B914BD4 wardlatzka
458,347,627 *2E84E7653E706A6204CEA0EDDE4DD86B7ADFD691 ACI+U
458,347,628 *2E89EBDE43750432F535B7AF469947F9F2DB0687 WEI-LING-TROMP
458,347,629 *2E88E470CB52CC1746825D5247F0970EF83800FF WEISßENWOLFF
458,347,630 *2E8674E4BA44435DD7095D59B29B40241D24B74D [email protected]3NET
458,347,631 *2E818FA75C9E42DAE14496FFBC8B0429BC5A9E0C adjuntaremos
458,347,632 *2E886B8BECE7D3DCD254519F235411BAE9286ECB [email protected]
458,347,633 *2E88DA1DEC1EB51E383048FA05E6E243B10F1C33 AEWWD
458,347,634 *2E8D2104D408C1C259F74030BC363275DDD6EED4 WHAT_CHILD_IS_THIS.O
458,347,635 *2E80DD8CE2D54A32AA6CD4D35D070D243DD9E06B ag8&w
458,347,636 *2E8154CEEEBD9974FD525267953A768E27B5ED19 AGROSEAS
458,347,637 *2E84639CA7CFE2AE61E807E82DF9A5C00FD0E871 WILFRED.VANDERSTAPPEN
458,347,638 *2E8D68DBE67426788450652B8FFDC11B65EB5D83 ahcv1
458,347,639 *2E8B4B111DE4DBF4FC9920E07A55D8992A1E3F27 wrong-rhyd
458,347,640 *2E8F1FC0B9B6CA7D1E81919A793687FC51D06480 wtdufwed
458,347,641 *2E8FDD81DCA2AB86001A201303B3E5E5089DF953 WWWCOLOURSOFSPAINCOM
458,347,642 *2E8B6DE80FCD4C769D8A7F7DDC47C5AFDD24AF4C WWWIPTABLOGORG
458,347,643 *2E85F52108BF345691350B4F2C37EB3601C95D25 wwwthecheerleadingsourcecom
458,347,644 *2E85D6ED118069AAE2F2B5C96B9F17C17C0A3865 X<6S
458,347,645 *2E87461F9C92BCC2A3FB3DE3715B047A692BF9DC ALKNA
458,347,646 *2E852B028B781258E77B08C5AE9E7E5D49F6E2F9 ALLEGRORECORDERCONCERTO,FMAJOR
458,347,647 *2E82C32A43DA685209D92F7FBA508B70D0356C73 All In Volume 7 (disc 2: The Current Tracks)
458,347,648 *2E8377778CC976AB83AA8FD46A285366B43655EB alonsonoe
458,347,649 *2E87D1020615203622BA5DE3BF9C186D7E8A917D ALPHONSEWISSEH
458,347,650 *2E849E72E829551915F60CE76F7C9E04D183E8E6 xndg
458,347,651 *2E8D00AD66C4FD70511E7BF6F13A5910406BD6CE XXOHMBW6
458,347,652 *2E8D317B688E1997A2FCBEC08F33B6C1825C0E89 A:Lv
458,347,653 *2E8503BEE8F202B43C7249E82A603F5E68C478CE A"M2L
458,347,654 *2E8E17D713A9E4FD4AB566E568B8F0CA404FDAD9 [email protected]
458,347,655 *2E8380000622344415DCB853F07628DABAF9A6FE ambrosesaldivar
458,347,656 *2E8FD0A9767F51E4CAA066B5529C116AB995E923 YANWAR-KUNTODI
458,347,657 *2E821B39000DFEC34E88E641D09D9422EA14DD3D [email protected]
458,347,658 *2E85BCFCEA74769EA7D1373F363C27A25FEDCF8D YASMIN-KOBEISSI
458,347,659 *2E8208BBF9614269F1FE03B2BAAA7F5FBEA56CB0 AMMUN
458,347,660 *2E88AC48CC61DFA89F6F7BB290C4F4CA70786680 YI%[
458,347,661 *2E8D3D63AB26C6AA6A0059A922E246E6D6F823A6 [email protected]
458,347,662 *2E872D3C7118C2E274E86349F832CD9E5D3B3308 ANDERSON.SHERREN
458,347,663 *2E8C6753CA40491C7F8E073B524EB240FB35BB74 YOGMAYA.PRADEEP
458,347,664 *2E8AB44CCCAF4A181B3C6ECE24BA36B4B78247FA ANDY.SCHULLE
458,347,665 *2E89855B22FAF67C93C0C3064CECA9B0C90F6F38 ANEPIAS2
458,347,666 *2E8D26CF45EA60CB062C7F8C30EDA5343BB03BE3 anmu=
458,347,667 *2E8376F1FCB585287B09590D74AF8D42C7D97748 YTEHCORCNU8
458,347,668 *2E872194FBCBCEA5016BDBD12938E613FAB5E90A ANSELMOL
458,347,669 *2E89E35ADD304435F7F637C807C535CDFF6CA90F [email protected]
458,347,670 *2E8B98E5B8D93E93146A3B2B4B868DFA85B693FD YUMING.ZHOU
458,347,671 *2E8C36CA50E8B3A0D122C6D1A457933053D080FB AO4VP
458,347,672 *2E8608286B62521A4D8531BCE74E11DEC710B7D0 APHTHICS6
458,347,673 *2E8454AB4AA49F39D0B7E29552536CC180B2EC5F APPELAARS9
458,347,674 *2E83FA877095E6AB83ACE1523E2C553AFF3D82DD ZEREILIF4
458,347,675 *2E827F8226E7405E194BE56CD66E00C4C23E5AA0 A!QPA
458,347,676 *2E800E1B5C7FA438E86FB7FB6156C7D01792EAD0 [email protected]
458,347,677 *2E8780D561608CB355CA79EE80D1997DF83412E2 [email protected]
458,347,678 *2E8E32E31A7C81E444DEA7B2E0215712EE395052 ZHZGVVJ3T6FJM
458,347,679 *2E8344AFF4BEFCA1123A847EB25482FD71579E7D [email protected]
458,347,680 *2E8ED4E4B9D61A7E3A5AD5B3B2240DAB129D1D62 なおZIGBEE
458,347,681 *2E8AEB8D6AB02DEEE65C6AE16B1AB3DD44682795 ZORGENZORGEN4
458,347,682 *2E83387D36093DAF48837CD7C9959A3663133BE3 AREDITH4
458,347,683 *2E8C5931FCC9598EA8143B23B2CF3A5C624A34EC ATHRA
458,347,684 *2E8F639DFF86E9405C63005B74DE2FD1013CD29F ats%r
458,347,685 *2E8E9A9D802249DBE5973A76CC5BDDFD4B365372 КОНСОЛУНАН
458,347,686 *2E83F3DE823ADA2C99246ACE4CC3D1C901DD95BD ЛАКЪТНА
458,347,687 *2E82CB0B46E2F0F8D720186AD496530C4534E851 ЛОЛЛИЙ»
458,347,688 *2E841533E8FC543D5EE0921670F6634F85D13A1C AUGUSTUSLOURIA
458,347,689 *2E877AD14B78B395FCF01DC78C77F287EFEA4FDB Auq?
458,347,690 *2E891455BC236D1EFB546E1C1BD7A6ADBE124EED ОКЕАНОЛ
458,347,691 *2E8D420F9F172F5056FA988FE7C52B7CDD3D7718 ПЕНЕСКО
458,347,692 *2E8B71F1925EC17FFE6BE4213B9A0F2EBB7B09D5 пистыньки
458,347,693 *2E8557B9502D00018BF0A07B07CE7771A7B822C5 avtoe
458,347,694 *2E80B3EC222EDE11C8D0419D488539A8598D9CC1 az_v_
458,347,695 *2E8988B2A32F79B29C790685884BD6ED0D37D8A3 B6KULSARLON129
458,347,696 *2E8F3D4874BD5AB588439D7C29E60C05186BB9BA B&)7J
458,347,697 *2E8F5C24F7C85D7AFB7E9354F4FECBA6B1109053 baerinne4
458,347,698 *2E8DBD74968A703D03C0275873990F09D0C0D225 beam.engine
458,347,699 *2E8395512C5C39166F8EF81697EF72342CCA3F84 BEECUTE
458,347,700 *2E88118B20F54BD1EDBA5E5AD8F2303E105C4BF5 B=E;T
458,347,701 *2E87CDD4B3E85237053C31D3833811E9B760574C [email protected]
458,347,702 *2E89305D90ADAB61B0C13DA0D637E4D4FC467E34 BKF"S
458,347,703 *2E89E5371914EFBF13821C5AF23D4FC33ED696FC BM(Q-
458,347,704 *2E856EA2A07A918B1B64355A19DF8A1EB6C6C1BD BOFENNESSY
458,347,705 *2E84C73D913B8C9D1E8A6EC654B5BB1483B97A07 [email protected]
458,347,706 *2E8E458E8B5A733738568A3FE1FB377B6027DE15 BO.PLUMBER
458,347,707 *2E8CD5BEB9853D73465E5ECB589B268E1446913A bosioce.moj.zeleni
458,347,708 *2E88EC7E0BE779899B0283D2F4D96EE59347094F 0DDEA85FB436374E88E2E02FC3