List database


# MySQL hash MySQL password
458,330,001 *2E8D40DF1B61DAA20546A3FFA3864F6E58C8E76D [email protected]
458,330,002 *2E8567E51E14661283ED7BF31835274208985F15 GHISTORY9
458,330,003 *2E8C107583EAA4112582E264EB9879E80B3F0F91 gilbertolala
458,330,004 *2E8E544D5250F6247EC8F0B2EADB7FB1C40F3318 4OSTRACA
458,330,005 *2E8AECF15AD0700561F33C2145546F59B4677220 4REKTFLUG
458,330,006 *2E847A56FD898210DDC2503900AC6881B1BF19D9 [email protected]
458,330,007 *2E8D56F339545609767368CDEDF9F35B1B0C2E88 glenblacker
458,330,008 *2E8FCD637589D6D1A10D7099FADD72D44F0DD3D0 GLENN TROTTER
458,330,009 *2E805268B4D5D890E15CAF3D6A8455CCCEB43CE3 4 spschatzmeister
458,330,010 *2E8892678525494266D977CA9E6E839D6A59FBA6 GŁOWY
458,330,011 *2E81EF8FB8FE3174DA9A0BACCD7E6D6DC01FFA12 4TNEPRESBSW
458,330,012 *2E87D5B5CD73C0F5F728A25C925EC8E1A4B2248E GNLS18
458,330,013 *2E8E2531B4E18CB9FDB3573A6C3B07F265637F42 GNR196
458,330,014 *2E83A331C1075EB27298D525831926CA0E65DA79 5BOOGIEAUTHOR
458,330,015 *2E888A27A26578BFFE6F7EBCFD297A49E5CDE7F7 5BUITEGESTAAN
458,330,016 *2E8411BB628112D74247C2CEC8D207F50D682B7A gregoryp9
458,330,017 *2E89F02CC66FA3359704BF9950494F7BAA656FFD }5fbaa
458,330,018 *2E8FD1098B35B3ABF563CD4BE41CDFD5EB5A30A8 GUILLERMO.VOLLSTEDT
458,330,019 *2E8E03BEF1A27C3A754FB57C916B3290A31FFCE3 [email protected]
458,330,020 *2E88733500FD84FAA3A7B7F6D4A779655ED17EAE guritransformator
458,330,021 *2E8DEB24F073CDC3D5E6F142E7D22FC80DC7DAAF h{%)
458,330,022 *2E84C421CFDDC6D170D647E1DB770A4C5A638ECB [email protected]
458,330,023 *2E8128C3E6282DF6419CFBE88C6C2159237A81F7 5MYPATRIOTS9
458,330,024 *2E8653A8E7FB3BA16C24EA0F7DBBA107FA5C13C0 HANKURAN
458,330,025 *2E88D65D68C28711445DB88DC9CA170433874EB7 5NONDEGEN
458,330,026 *2E8A7E1B52D7CE44488E2E5E0D09F5D7EECE1CBA happy(feat.bahamadia&viv)
458,330,027 *2E8FD25A17EC8593085F22CE14E56CA580A1C1CC [email protected]
458,330,028 *2E893773286B9909802EFB6EF259541EF1D46B74 harryswackhammer
458,330,029 *2E86E090546EE8A6EFCD86C0529955FB15549B21 5slavenska
458,330,030 *2E8F19F2133195964D480F67C809679AC7319657 HC-130B
458,330,031 *2E8344BE7A85EEB3577A3C25095E1BAD547C6ACE heartacheandpain
458,330,032 *2E8E14F0BD6D236760782349F8C66C1DB70B5CEF hendrobule
458,330,033 *2E8FEDDB29F5DD2C315C67FEB8DDBEDF4C642B0D hereisaship
458,330,034 *2E8E3A7CA0128F1A44B92E7B384F1CC71B53F938 5WHOOBOYBSW
458,330,035 *2E8E927BA46AA586BA39F7A4E3743921C0F4F3FD [email protected]
458,330,036 *2E8A8EE9550B1E9C82978C253AC7E9E8892722A2 hey.juana
458,330,037 *2E8731A65005867EDCE7D65537BE83775539607A hitchhik3$
458,330,038 *2E864B4EF4F048924D48A1325AE6AA2260E23D70 hofmeest6
458,330,039 *2E8F91617488103ACC5E0F8B37267EBA11DFB963 HØYMORALSK
458,330,040 *2E88991DA881E4A8EADCE385C0907C264B627965 hpwa1
458,330,041 *2E8DE6D3BF7983D2448C4F50B87D76D4B1159C1C オーブ65個 ストーリーACT1(本編で流れたイベントムービー集)のオープン
458,330,042 *2E8E4F1D88A49CEAB6A56D7C80A684B77EFAE784 6ALLIOET
458,330,043 *2E86E1EFA165881A73268D795176DDD8E6F20751 httpwwwsunfirecove
458,330,044 *2E849A48F933809A303D646D869EEDE05C25D62B [email protected]
458,330,045 *2E82A01F821F61475B0B5D326F5B7BCBA2BD8C95 6BIERBAUMBSW
458,330,046 *2E866A2D4D281C24314E254E1506F255ACDBAF34 HUGEONING
458,330,047 *2E8D0312E7E2019ACB0A8D28F7F08095D6A800C2 HUSSNAINASLAM
458,330,048 *2E80BF61FBA3CFEF33B5E5D7BFAD9B0B6ECD41F5 [email protected]
458,330,049 *2E8B84DD759FD0217F5320B0E55FE696B4C0DCCC [email protected]
458,330,050 *2E87B72AC1066A50979CE2BD7120456CD4FE2891 6KINGTRIXIE
458,330,051 *2E878BB68BF4DC766C77C3A16B584845C57FB57B 6KRTNZRS
458,330,052 *2E89160D41FD4CD7CE2EE4D8A08716D20BF68455 6MAY1907
458,330,053 *2E8AF043F5614870F1EFB606FDC4B318CA7715F0 ianberger
458,330,054 *2E873C421CA0B7B78F591E201B35FB021FED1D2D 6REEFTERSYNKRONISERIONS
458,330,055 *2E8F764E810EE484C583D258C725A868B1E817C7 idioma-en
458,330,056 *2E847A01F62EF47764828114F6B0E1A6C9486B01 6THEBREWSTER3
458,330,057 *2E802ADE1E4EF69334BC110694D63C53CFC35ADD INDIANAJONES:MARCH
458,330,058 *2E880D392B42DFE362E9FB04A8AD61023E583DA0 INDRA—PEMIMPIN
458,330,059 *2E8E6A1AB754E42B7228681A4C5DF27F3B6E063E informationit
458,330,060 *2E8119AA61AEE822E71CBCCFCC869A0025C2B8E7 7PIANOKNIGHT
458,330,061 *2E8501F0D61CD62497CDAAC0831F5465FD2C82F2 7SIMPLEADIDAS
458,330,062 *2E852623298F74165FFF52097617332B7078F8CF ISSAC.SETZLER
458,330,063 *2E8584596E6414E936AB805714531C9E69AFAA55 issacteamer
458,330,064 *2E8941D4E68DC9E4374872C067552A4F74293A59 itsme93
458,330,065 *2E8AF24079960B9BD13C37058C4E6A3136CEE1BB I.Want.to.Believe
458,330,066 *2E8F655AD0EDDCF9936C4ED15D8D19566313AA23 iwanttofuckitzel
458,330,067 *2E864B86550166E61B2E323014CF0B8CB6A3AA85 814391 velman-avasi-johtoon-,-toisen-kaarteen-alussa-3-.-sis
458,330,068 *2E8AC9FE6D298C30B9683FF1ADCA59EE70DF479A J13409
458,330,069 *2E8FC23B5AB4CDC46B4AC575AFCF50F4C326E341 JAIMEMANEY
458,330,070 *2E856D3F883E04D5B8CB8B2122C8269B86FA065D jarodockimey
458,330,071 *2E85D8DE28E45137CB274A84232BD94ABDEBDC47 JASON.GUGLIELMI
458,330,072 *2E8356D5F15462276686CF5E06A1A49341D0E5C2 8====D-~O-~OSPLAT
458,330,073 *2E8EE5CF5CCF63F18C2D46910C6F63FE043EB77F JE5T1N95
458,330,074 *2E8A4BE1F5D615A6FDA18EABB5680A21AD386869 8KIRJAILIJOISTA
458,330,075 *2E86240B2F5577BB9FA7549807451E18B6CB85F1 8LU3N9S
458,330,076 *2E842062ADFEBCCD40A0E7FCC2B23FFD191453A0 jerrodbrandauer
458,330,077 *2E8381F2FEE1AF88E684A1905DFCD4DD072AD119 JERRYMERLIN
458,330,078 *2E871BCBE65A245A97C95C99AD2FC772F94CF75D 8THATDODGER2
458,330,079 *2E81AB6E74E8F426DD64B69829A0AAEF26B285BF 90度16分~91度03分の間に位置する。海抜4718M。東西70KM強、南北30KM強。面積1920KM
458,330,080 *2E89DA8C39681C4A7D85A21C9707B9775987F56D 918665 dagilim-,-yogunluk-fonksiyonlari-,-kosullu-dagilimlar-
458,330,081 *2E8D918EB9A7616FA63393989DCAA7351678AC58 [email protected]
458,330,082 *2E8A7D350124386E88F0533F1844DB009B450D62 JKCBAA
458,330,083 *2E87F4948F1B41A3E251059092042746D60C1E9C [email protected]
458,330,084 *2E8A57F98BAA5DEFCE07C8D5B5A8A6031EC4C532 JOAQUINLYNAM
458,330,085 *2E84C1286BAC8602243EB8B1726BEC524B66471B 9DEPECHEZOMBIE
458,330,086 *2E8DA63D49F7758649CB2FFDAE92B05B9EFD2D21 joelmatton
458,330,087 *2E8F826335F409FFE8463C1F48A27484E52E7F13 9ESUPPONE
458,330,088 *2E8F68AE175163A25518676244C69D25F7404B0B johnathanstagers
458,330,089 *2E8F9BD49D4E691C93CA8775EE9B6A0DF5E6DA90 JOHNGOLINI
458,330,090 *2E80B08E896351C05E0A1E28C903079A8CEE1861 jolietorland
458,330,091 *2E8B9ED535EBA04214FC60108549646E3A243D4E JORGE.URBINO
458,330,092 *2E8CD98FF88CAD4D92F5472FB3039366B120394E 9NRNGSFRHD
458,330,093 *2E8DD7EE980439E8D152A227819755B5E0951F3B JOSEPH.SIDWELL
458,330,094 *2E897C71D0E02AF350F38540DF6BBA99B195D8D2 JOSEPHWOOLERY
458,330,095 *2E819D8086C2C62FE7A3A116347CF241C43008B8 josiahfalconeri
458,330,096 *2E8C674491B9978EF95CD1ED4C7EC5DA96DA6228 jq4&
458,330,097 *2E8C5A65FF7DA619A37955B159D88A9F0ED31D55 judyacooper
458,330,098 *2E8D462D084765995F39A54F9A1766DA50F02D25 9unturbid
458,330,099 *2E8F7843F9A3F4B17E0F04610F0687FE57B4546C a2&2c
458,330,100 *2E86454EE7E23FD988AD00424215E5D9F53D0BAB KAAMAAMHED
458,330,101 *2E8EC43AE23086062A62D73F179783D116435C9B KARENROTONDI
458,330,102 *2E867A79EE6DF7976C64F0C36B11BD74E84FAB50 KATHY SHARKEY
458,330,103 *2E8B2D8ED87B99BB2214AB2F5291633927422803 a9!nc
458,330,104 *2E8BE92051CB8331287F2697DAFE93ADA76F5AC2 aaaf~
458,330,105 *2E8322350D591296B1698D0E65FB54443ADA037C KENNITH.KALBERER
458,330,106 *2E8E32A6E6AD913DF2413E06D1602CB95B74A088 KENT.KERRIGAN
458,330,107 *2E87980051991589AC12D5504E1C681D7C721155 AACK!3
458,330,108 *2E864D2625CBE04F69DFEB6A087C1A5F6304D296 AADMIL
458,330,109 *2E8A4B174062F80A05A603141A0F29895F563A2B aaetm:
458,330,110 *2E88F86192F5F7D36EC43D2FBEB8EA7BB2C728E0 aapaane9
458,330,111 *2E8B1B9018DF16CC8D8A1EFD7165D4EB25A8BD73 abelapplebury
458,330,112 *2E867F2FFD045F7B284B4B85F7BB118A838B7F3B abfar
458,330,113 *2E8854C155DCF4D27BEDE7B92096F3880CA57591 kwanlin12
458,330,114 *2E866B8F03DAFFC171B0EE948151718453A59D32 kyleanthonymitchell
458,330,115 *2E87B0FBB2B98D8C12814125A290896C45CC81CC L!2^
458,330,116 *2E8F884A6B7360792773C2583A320866B0E3ED70 ADoP
458,330,117 *2E83B8A00B6700E18C4D7D53E035A778373A599D ADVENT-VERLAG.DE
458,330,118 *2E8B4B90596C0A3200DD8759BBD6637E23EAA95E aectype
458,330,119 *2E845D1B9EB5B7B0E1D4067261F5A52BD6AF137F LARDIATB
458,330,120 *2E8255A6F5B0685A2A8424F0AB072F8C621CF173 AEHSTELLA0
458,330,121 *2E8366C54F2BBE1ADFF55A8B1ACDE87881EDA407 aej%
458,330,122 *2E8817C40A280694BBEED7D4D6827BFF95BDAABC [email protected]
458,330,123 *2E862A504BD8C7AEED64AD7BD82958F1118C4F92 laurie-naranjo
458,330,124 *2E8A1A92EEFCBA5FC7FBADA1C47B088B56C485D1 LAWERENCE.MAYNE
458,330,125 *2E8492E4B14C772D7142A8AEF15B9AADFD40E071 LCD{
458,330,126 *2E8A00F5F2D154F7D5705B81718D07FE89F6A6ED agwz0
458,330,127 *2E88CF5975A81E36D29E6AD1C5AB22E49E385009 LEROYPATRIA
458,330,128 *2E84CFF66F04CFC1195FE74F7D51B920C2E087FC LESSCUTE
458,330,129 *2E8577FE461377A5516D8DAD1941CC8C48A07288 AJF28
458,330,130 *2E814B072EC65A20AB77C9F30A95DCB716973EAC aktemaating
458,330,131 *2E82CDB18C574C553D762F0F0F28338D77750CF2 AlexanderRReinagle
458,330,132 *2E8CCA1118B03CB9C34B1999CD9B7E29245C7336 ALEXTIGNOR
458,330,133 *2E82F000A92022D8F75C0E3C11D8FDFADADAF6F4 ALFRED.PEREYRA
458,330,134 *2E87414423DE503256652CE4C7DB376F9CE9A4E1 LM2405
458,330,135 *2E8922A681ACCF13FD0732EE4B17CF91A24D612D loadup(feattaynaherron)
458,330,136 *2E8FE2E0E8585DC3FE77432AAF1D51FC6740A6A7 ALPHONSENAUYEN
458,330,137 *2E81EE7E0564E06AB897AA367D1DD2CDFF1AC028 AL SOBRANTE
458,330,138 *2E8E6C0C56B1389C4EB4908D2155012C8ABAD7BC amag
458,330,139 *2E851E09C59DD40B675680FE0BA8CD4AC8B4A7A6 amc5e
458,330,140 *2E8F2AB68017E3975378F4B5E3FEC20BEF70E166 A!N7+
458,330,141 *2E81AC3AE4E6EBA7925D01E00752506D57805390 luvaghning
458,330,142 *2E841BBF8A8104BBA9C8D845653800253F079A95 anelene
458,330,143 *2E8AB9AF6660BF2DF5EFD02AD234787DD808DCE5 @#maggoty
458,330,144 *2E86FE3C1B0DB742C23041B976A8519F3C187EE2 ANOMOUSLY
458,330,145 *2E836FFE38F3F396BEB26B5FF0D2D7EFD687B7D7 anthonymotte
458,330,146 *2E8728ECFC7447940A779DDCAFD650AEDEC84469 MALMENS0
458,330,147 *2E85FB29EF4940ED80E631629CBF8B3DEB01F1A2 MAMA GA SANTA NI KISU SHITA
458,330,148 *2E8457D103D960E45E68034FA8CA3A7CAD7B238D MANIYAVELICHIYA
458,330,149 *2E8B404FFD3C9A8117B7CAA013EFC7E96B856E95 MARCEL.BALSIS
458,330,150 *2E8E92BCAC6FB137AE631C080457588C036BA922 marcellusbungert
458,330,151 *2E86F4CD229583CB9D59F1CE732F878F9D673557 MARCELLUS.TREFZ
458,330,152 *2E827AB929E39EFD8919825DCD97ED26BA44B300 mare mosso
458,330,153 *2E8E84D5CF8916B37F27304DD89CA0AE52507C64 ANUWATMATEE
458,330,154 *2E8227D19382544E0A303E11D53744F178214089 marianne-paraiso
458,330,155 *2E8B348CE545D4C498346CAA7FFE615A9C60FA4E ao1)
458,330,156 *2E8FDD0A3B478494DDD1EAEA453BF0D9B563FBB2 maripari
458,330,157 *2E8F8E1D171F1662474E8C803881A1E2D00954C6 MARLONPENATAC
458,330,158 *2E8E14DBE9C7259255B09FCC495F89743E6C6809 marlon.quero
458,330,159 *2E83E81584FA4A6D05DDF82B89DD7E8C6269CB01 MARQUIS.PLAISANCE
458,330,160 *2E83C2F8180728C99F4218BB62C5C31AB0547871 APOHCYSP3
458,330,161 *2E8FA1ABFFCC023E45366EB83DB498708D3A4FDF marvingeidl
458,330,162 *2E88C6350FC0D67154DF793A2B135CF9A0277ED7 appollot
458,330,163 *2E885E6E382522462C0E97C220CAA975F5C58669 maxtweten
458,330,164 *2E8545891338CEB8343A16CCBB601086FC5593D2 MEHRFREQUENZNETZ
458,330,165 *2E86BFAC3730417EA9BBE5EEC0E5E9ADFA899B8D MELOBERDICK
458,330,166 *2E8EFA313BE96F5ACDD3DE2413A1941938A849A8 arcadianprince
458,330,167 *2E8E9CAE4F0FA2FBC7AF9F426FEE8B1F55F88577 arliefellows
458,330,168 *2E8CB514380228FEC2CAECB7DF3FFA53778199BF michael.fahie
458,330,169 *2E8350C91F4633BC1A54FDF9F3CC6829D21E545B ARUNA RANA
458,330,170 *2E8EEC19632D39D64F6DE5778174D1DC4027CEAB michanned
458,330,171 *2E8D531FFBF4E2B5F79BCDC671CB7B1809992BE1 AS51-
458,330,172 *2E828F9D88AEB419FA908A0CC64AD3D4198A730F MICKEYPOLICE
458,330,173 *2E8FFFD75EA00331A7BE97974DC0CD40DB44A53B ASSISI
458,330,174 *2E88DDB2B00228D5994C087788DFB9E730F84B36 ATARISOUND1
458,330,175 *2E8B26145311EDB77D0E4797BACBB51A206BCDB9 MINUS/ORANGE.2
458,330,176 *2E8B5AB97FD92483F65440D3FBF0AEEB9A7BEDA0 MNDCNCS4
458,330,177 *2E83F780ED502FA36B8252F8A9E7BD677ADAEFD8 MOCNINED
458,330,178 *2E8CD1D05A3191DDE2324F93D00576AD17C6488A AV;l
458,330,179 *2E83A3F6478B8EBED935A571BC14493840C12837 MORTFIELD1
458,330,180 *2E8688DC4A75540A6DEACAEFED030CB11798DC03 MOSEDESORCY
458,330,181 *2E861BF3C78801B63C96967DB44BD2811B924336 MOSTPOPTWOCOLWRAP
458,330,182 *2E8A524A88BE300B3C45B9062B0666CA6DBB0B5A move on (feat. profisee & ema j)
458,330,183 *2E8940D5835DB6386863ACD05E0CF33338DE1743 b1oastronaut1ca1
458,330,184 *2E85DD1DF3604E1433EC87FC0FCC84757AD200E6 myjackson1989
458,330,185 *2E8071D1DA49EE696C7577D5D3899D3E910168D8 b8njf
458,330,186 *2E806466CF231E4F25B49EC6F88CC1048B0FBECC BABETTE.VAN
458,330,187 *2E86A2B4320111DEB75CCF537789C5EE0FEF0A6D babybhie
458,330,188 *2E8F9F77394EF31B9796A21849687AE773FCAA99 BALI:AHIPISLAND,VOLUME2(DISC1)
458,330,189 *2E80CB1CF7BDC4C7B2A1E3B6090DDF82AA59D8D5 BANAMATHR
458,330,190 *2E86A2F22C927A33140F4F3041F37A6A4A462D01 ba)qy
458,330,191 *2E8A7B9B69A763068824AE90A72A9B06F32A6140 NATASA.VUKCEVIC
458,330,192 *2E867B5BB1F8A8D70919B60EACF20678C9C49F97 NEDICSERBIAN
458,330,193 *2E89FDD1AED4516FD867E82CC70968C77E97F7E7 nedugsgi
458,330,194 *2E81BF83013031AC26B7C1D4F338EC6F2BD459D4 BCL+P
458,330,195 *2E8944E3A54BFB1880107B115C12B160B32BF723 B&,DL
458,330,196 *2E854B5CA375E66D52723078AA142E5CA326C639 be+ri
458,330,197 *2E85E1C39D41A6025B8DB63F8F9C48FB55895128 bernardnoris
458,330,198 *2E88F06414599799184B0C6F7CBB155563D553F0 [email protected]
458,330,199 *2E8C3B0EDB9F1D06E43BDFFC89E8047FD0656C23 BETWEEN DREAMS :60
458,330,200 *2E84EA7EFA89951C071ECEF845A242FCEAE50439 b#hso
458,330,201 *2E8862B3FEDA55CFB0F88D3D39FD03B28D160878 NPGNATURECOMNCBJOU
458,330,202 *2E8D1CF96962873C2757FE8D762F28B7C91C929E BILLCLINTONREFLECTSONSOUTHCAROLINADUSTUP
458,330,203 *2E8974AFCD6799EA54AEC959842815CFE773E22D NUHIU
458,330,204 *2E87D1BEA6DEAAAFA4586676AAF66B9FF60BD685 NUMBERXIII,ROXAS.THEKEYBLADE'SCHOSENONE.
458,330,205 *2E848CFBA7F4115B2628087000589EA2E54DAB63 nürnerg
458,330,206 *2E8662BF846F4216E5DC5F462DC4871F5E7D20FF }o{.~.`[email protected]
458,330,207 *2E8F4F6D33D2478A70E18ECE6D6D4666BDB955B4 B(LU
458,330,208 *2E8A5DE5B580EB9729309EC6401EE44B28982BE2 BNC4N
458,330,209 *2E864C96E7EC9B72ABFBE4A4A00C8A7847E52B8D BO-HURT
458,330,210 *2E87D9C8BC47D895393435F6063E1580E75E63BC «BOMUHEI
458,330,211 *2E885688541AA1FA5DF3BF22A74D76E53558B0C2 BOOKER.SERFLING
458,330,212 *2E8F9D9574AB097F4DCA234339FCD2DD0D5A82D4 OUCH-MIAU
458,330,213 *2E887B3F5E9208464E66011B861F84A73A4856F8 [email protected]
458,330,214 *2E8AD3BD400F4F8D1EE2AC189DD2FD4507CDFB5D [email protected]
458,330,215 *2E87A8900335EC5921E3EA0969E128E4C72163CE B(QD
458,330,216 *2E888F9F24296E8FAD65554C3AE42E56CD04DD0F brautna"chten
458,330,217 *2E8B7083B07CB7B619578FEB35898F72E34C7743 paulledbury
458,330,218 *2E8F8FA9E33B5B004D6B6677596A3779B103472D PAUL.ZERCK
458,330,219 *2E8010BC5E50F53F8431B619EBFA093254E550E5 [email protected]
458,330,220 *2E85326605BCFDEC7465F3748EB424228611D1E8 p=====d-~0~o-splat
458,330,221 *2E8DAE47DA612482A21A6F31E213DF8181C9B771 bryontatsch
458,330,222 *2E8FC512FE4C1BE7CA00C651EAD642E445099B0A percep7!b!l!7y
458,330,223 *2E831C71E4CCF7C7AB071686C64F63F5A1A8BADD BSWDEMARMELSBSW
458,330,224 *2E83B129A05C58AB6BC10FE0A81D9F587C5CBCB6 BSWSWOONEBSW
458,330,225 *2E897B9DD5480C38DF26C0308F85666AC8F09764 BSWUEBERFAHRENBS
458,330,226 *2E834D6A6DE7C864910A6238139AD04397F1FBF6 [email protected]
458,330,227 *2E8738F8EF14714813B08E26BE0EEAFB0D504F6E PHARANDA2
458,330,228 *2E8CE7A05287E30FAF7DEAF531A3A6FD820075B8 PHILLIP-KERINS
458,330,229 *2E80533209BA554EFC2849B67FB2F1948EB713D5 [email protected]
458,330,230 *2E8C713A7A2D8FBD94CA74079E1806BCD4FFFEE8 BUFORD.ANDEBE
458,330,231 *2E8E99EBFF9AE1CD6D8C661134BE647AB9A3A847 B_Ui
458,330,232 *2E8F133A91DB617DA43F1410B7541758016D6946 burialplot
458,330,233 *2E8CBB4D4DB1BE552A98290FFEFCD7453C128EA8 burlalrais
458,330,234 *2E877EEE0806C990BBA99803C5813F5C13FC5080 pinoy-sari--saring-sari-sari-store
458,330,235 *2E86962D11AD1C5F4CCD333F4C794FB383894670 piroskãƒâ¡m
458,330,236 *2E8D1DA65BEB3855295FC6A1D201E3FED5AEDCF6 PISGR4MOS
458,330,237 *2E89F5975E971E2448C540B091B0D4771D3FE4EB BUTTERFLY91184
458,330,238 *2E86FC3F1F1BBF061DF5F40C275B700453A55163 BWEI(
458,330,239 *2E8714230E98E521EE2A4DBBE107615305AE61E0 c0jpu
458,330,240 *2E8F1593BAEB3A904D2303207EB0A13267CB02B8 PROTRLA
458,330,241 *2E870EBB8C30F50B59ECE384FD8B18655362EFB0 PRTCPNTED
458,330,242 *2E87D4EC8A436A16BFE83BE478C8A2D4A1919741 PUFFBALL:'.EMERGENCY.SOMEBODY.CALL.THE.PPPPOLICE
458,330,243 *2E8487EEF4DE6F4902A5F5AD420A142EB31CF2E9 p) `(x)
458,330,244 *2E8D109DDC57ADAEC579BFFFF740829FA0AE0E4C q===> ` >-b0
458,330,245 *2E80E23617EB5AA10EE1B686EA5E2B8C974ECE15 Q-Bert-Rocks-the-Bells
458,330,246 *2E86CAF9860BFE0873EF3A53A2C8547E4F670015 [email protected]
458,330,247 *2E8F622E9C0D5DCBDD470E341DA4470107DB8235 QEJC
458,330,248 *2E8B680FE82B73A650EBAD4223597F4E628E33D7 [email protected]
458,330,249 *2E8EE99186C2B290EDF422BF1F88D1091AF3FE3D q===P.~O.~o(><)
458,330,250 *2E893E576AAE72F387148E7470B567A7477E7386 carrolsetera
458,330,251 *2E84E81E6B70FDEB28A4DF0A54375C89465B25E4 qp*splat
458,330,252 *2E8420CEBB292A29499C8952C6946657CD757D45 castigates
458,330,253 *2E885947522DE2019A32AF53661E0599E3B52E69 CB"5Y
458,330,254 *2E8FCB747E9F0642E1BFE1EACED9EFB7EA751B9A CBD3X
458,330,255 *2E8AD3CE0696EFF7671148999BD43FDB5CFB9931 CCFLE
458,330,256 *2E80675C45FE332105A2861A00591F1E666A195E C(C%V
458,330,257 *2E84AA654BF41430EB661A7C74403CB1E3961BFE rajahered
458,330,258 *2E8C25CF4E74ACFED404493AF35B6C524F55D524 RAMIROPASKEY
458,330,259 *2E85146DAEE96F4C719FEE5D3A7D8A24B0E89935 ceeu)
458,330,260 *2E8B526557FB9CB40C7D0AC81B98D149261A9492 randellstradtner
458,330,261 *2E8623721686D37F4F35C8C23F7124FFFEEA571C RANDYASDFJKL
458,330,262 *2E88566295A5404F5CC53B840C1E4C50584E3694 cfbg2211
458,330,263 *2E8BCC170A42BB4A8BAC28DA4C54EF0221F4FB4C CFud
458,330,264 *2E8528B7E11B1377345473515B866806EE1D9904 CGILDENBLATT
458,330,265 *2E896BC4E71E893F3F011B5A9674EFABD9AD0105 REINDIGNERA'S
458,330,266 *2E8BFFCB0AF5920FD9704F268F25A7A872D9BB1F C?GS3
458,330,267 *2E804A92012A152A021044FE079FA2C1EF35F5B1 chancespagnolo
458,330,268 *2E8D15312AD7FD54C950A34E38850CDB106A9697 CHANDAKADAVU
458,330,269 *2E88EC9433603D6A44A6A220879795DEB2869F2D renovatur
458,330,270 *2E880B4714A740997F674EEC202C93FE986C3586 RERECOGNITIO8
458,330,271 *2E8EC75244A34062E9BE8F9D0211CA1F758D33E2 CHARLES.KNEPP
458,330,272 *2E8688AA1C495A3C456C4333D89F415E30E21172 RESEARCHERS.16
458,330,273 *2E84F5BEB8B815D7C3B4FF1620D21C5B14131EA8 chbh
458,330,274 *2E8752BCEB4BE45C568549345C6067868EF6EFC6 [email protected]
458,330,275 *2E85D6B90ECC62B68134631DE7384E544692858D CHICAFLAMENCA
458,330,276 *2E83BF733B92E80BB5B257DCFC2304428D2F1143 CHIREAU3
458,330,277 *2E82F18EC04CD1D7942818765BC1E233BFE2D89F choregraphs
458,330,278 *2E8A64F38E7B81D88E4565966D1DC8286F980380 RLUMSDAINE
458,330,279 *2E8CF20994821DC0DBBA026FDC500ADAFD38C162 RNTH19C1
458,330,280 *2E8AA5269BD57986FCB0D45D8E70F05F4ADEB15F ROBBIEMIMI3
458,330,281 *2E8595BFCCF561613E91E1D3F125C208EA4219F2 robebgu2
458,330,282 *2E84603CEA354D3A6EFC1BF61D20429D33A1E799 CITOYENNEETÉ
458,330,283 *2E8F49552F4C0997E69974F7CD9F1932DB3ACA53 C;IYB
458,330,284 *2E8475861FE211E83715254C5ABBAD8F6FBB7973 roqegtj
458,330,285 *2E8207ADD503A7580FE3F7DF3CE88531F94DF207 CLEMENTSTELLE
458,330,286 *2E8B67EF2075A1EC60EAC8F19DD4B9B72ADF0902 ROYCE.VILLNAVE
458,330,287 *2E85EC1B59D0F25339D4973EDF542CA07A4B9B0F ROYINDIGO0
458,330,288 *2E893977B56DCD9FFD231AA13C87D07D31592290 RQE
458,330,289 *2E82CC8A7CDA872F2B0D987E13588AE2B64C9479 cliffordbaves
458,330,290 *2E8DCBCB19DC1A1785D8CE3F7FDD49A991774827 RUBENBALLIET
458,330,291 *2E8C90099253C25DEE14F393061A8FF88129E578 cl-rd
458,330,292 *2E82D9C684FBE1FD82EBA74F3E55482BDEE3A165 cmatf
458,330,293 *2E8695DF20F85E43ABA3F9868213DF1F2A00B50E RYAN.SIRNA
458,330,294 *2E89FF523D8FBA5EB84823092B7E7F240861BD08 C"N3
458,330,295 *2E891B1154495C1DDEA4DEA782348C4E605855D2 COFNIECIE9
458,330,296 *2E81D824A3AA56CD1109B7AE0869A83FC6639341 columbustobon
458,330,297 *2E88DE8000688150B66DBB1839B1A16D83A3382B san.pedro.y.san.pablo
458,330,298 *2E83618498143E005A62E5CF64BFE1EBE5610E12 SCOTTIE6199
458,330,299 *2E875557AC4CA390BD1778179D9668F80D116194 SEITISOITO
458,330,300 *2E82BE83D63B1EC01EDCD972E6104DAA7BE40370 CONRAD.PITRE
458,330,301 *2E801896035B1B43B7FDFED7A2A481D244AAB5BB CONRAD.VANDESTREEK
458,330,302 *2E8081A4A8E8DA74965BA0020C9B1A59B5EA2B74 corneliusbrislan
458,330,303 *2E8F58226E42BA4ABEEAE0F36427ACD1B4598737 CORROBORA71ON
458,330,304 *2E8476F4B5398F1EE97A8AC97682DABDFFFCAD62 SHCHIPACHEVA
458,330,305 *2E8266F5308BE9B8FB016BE9673EC60048AC9A23 SHELLEYRAYMOND5
458,330,306 *2E8D8E814D8E7A35A8E0A555ABCF00D03173281F she'ssoftandwet
458,330,307 *2E87D115E142FF618DB047954AC4E0A8671D3183 SHIVAPRASADPOUDEL
458,330,308 *2E88B145143BA2C4AB8D0161003BF9D7CDA40190 C#Q
458,330,309 *2E81297C0CA75774ED75EDAAD650371A191B6E7A SIEDLUNGSAMT
458,330,310 *2E8D0F336B3D7613A1D32603323F385A6CD8EF56 C,RVL
458,330,311 *2E8FE4DEB45746175CF6E79597ACECE492BE22FB SKICOASTFLITFLOWFLYGLIDEGLISSADEICE5
458,330,312 *2E88A8DEB596FA8C877BA1D0E59BEE53208BA938 ct4q6
458,330,313 *2E8A06924B18717FF4553B835A8FED150B6328C2 c&vgs
458,330,314 *2E80E8BA49D251BBE3B402B75E28DA6A3894CE87 SORBUKSE
458,330,315 *2E8E833F9F5B3C8951B67EFB1F86B9471AD8E73C D//2R
458,330,316 *2E8DC514C97E46B784DE779A6626A9E44061D44D d3wa9
458,330,317 *2E8F3871B3D0BC654849651F67123E7FF524FA38 dampant5
458,330,318 *2E8D4CD6D4B4045B30CED8DBA90F850FF5B6BB62 [email protected]
458,330,319 *2E86AD0EF847C4882BB60759F3287AFA04A8DF4A SPZ!
458,330,320 *2E8764736534943A646FDCD8A47A64555B741A78 DAQFP
458,330,321 *2E866B23FDE80FC63B0F5665A3ABC518F19147BE DARRELDOMPE
458,330,322 *2E8AE95E9FC8E346FFCC652A45BF3D30BEFF8E1E STÄDTEKRANZES“
458,330,323 *2E88235749547F4496973A5A9A67D74851BFF182 darwinbirkett
458,330,324 *2E85DFB7B411512A622BB7C25769B2E1525D4FF1 dateiende0
458,330,325 *2E8AAD416D8FEC97E71CF554C0D701F7A2E32E0F DAVIS.SMEBY
458,330,326 *2E86FBF3280FB91A9B76834DE0A166C140264EE3 DAVIS.SUPNET
458,330,327 *2E8697E99C99B9E748651600AB38F17607464490 stefansibounma
458,330,328 *2E8D1633AA6B1EBEFC28A57372BF95F2798D9708 STELLEILA6
458,330,329 *2E891608A0F9802ECCC02410C9B2FD7C82C68FC6 stelnow
458,330,330 *2E87F6D313760E4B5014772E6A30461CAA194812 steve-read
458,330,331 *2E8375DDE270AF3F42156E9385FF3D2D6051D5AD DC(2U
458,330,332 *2E8204EEA8BFE5BFA9D22B485F99786A247340B5 D.DHM
458,330,333 *2E83C5527A125268273C243ECF0F629C87C7A95F substadddesc1bay
458,330,334 *2E8CE7E568A0DB21DA74B61CFF1D44487ED14B1C SUCERAIE6
458,330,335 *2E8C28CE556240EB11775B97CA4B816775D1BD72 DEONBERVIG
458,330,336 *2E8703A570A8F0ECBA867A1C53DA644E2010230F SUMMERNAT0
458,330,337 *2E82354B1D25435503994627C520F2B04DE5D8BF DEPORTAR
458,330,338 *2E88C233327325A10A245A133FBAC81950A71102 [email protected]
458,330,339 *2E87AF93AE36078565DF45C5532B29A1B33A858B SURACOS
458,330,340 *2E8B379AAF8E8D00258A6C928F630720A7E21A79 DETECSORGWWW
458,330,341 *2E8FE4F725CB71E12F98DFB5E3DDC703C2F36FA2 DEVALAN3
458,330,342 *2E899EA6E4F45C8F5F2C6D4DBB1CE5FED029E63B DFHB5
458,330,343 *2E85B61EF917382AEF77EAA513BE8F719ED961D2 DH7C8
458,330,344 *2E802745440CFE0F8DB4FDDF01DCFB88300B02F4 DIAPHONICAL6
458,330,345 *2E8F4EAA54425FDF1ADC59664F2D92739DC7B30A diegoschroeder
458,330,346 *2E852A3DED9DFBF28DD5B78EF5629D026DCC89E2 DIFST
458,330,347 *2E8CDC89BD4A56919DEFEE7FF9926A7CDC82EFB0 Tabamatuarmastus
458,330,348 *2E87B3B359E64A1BC930392E8AEB451900AA1BA0 DISULPHONATE3
458,330,349 *2E837F581E9E9CEC4007D921DCAB1CF39C844629 TALKSODIUM-SULFUR
458,330,350 *2E8B193F80B8C42DC599ED478A6A8F69EA9629C4 TALKTJBMOVIES
458,330,351 *2E8431ACD801905346F005A1808C4FB41563DB86 dkrt
458,330,352 *2E8B4739D1FB3A76082981A0A3C6A0FDF570CCC1 DMIELHCS8
458,330,353 *2E88CD56391298887372B989CB9E8AC19AC3E555 dm#l
458,330,354 *2E8AE52E849BF01405CE509CF9E508BB5A7CF198 D!NH
458,330,355 *2E8CE2301B69A2B4AB124651384EB51587D814CC DNuw
458,330,356 *2E841F054E75B51B1EB259D030410077F157FA4D dohnisha
458,330,357 *2E88C85110C07E627B99D8BBB00F1BD2E039198A DOMNH
458,330,358 *2E83A3A3152F7307A0C002CFCAD832C5D3101CF5 DONNELL.EAFFORD
458,330,359 *2E8866BB668D3EF6C169C4F976BE1A15AE9FB50B TERRENCECASIDA
458,330,360 *2E80AF216BF41E5D2D41AD49922EB3D77504FCE0 TFSCHWRZM
458,330,361 *2E84B620C425D114D745DFD9B7E63E19D3E5584D doumq
458,330,362 *2E804F8DAC8D5740C23C6C83D94DC507B68C722A DQ-9
458,330,363 *2E875CFDED29054F3A178F19A6B6F45D137D778A THESAMWEIRAPPROACHTOPROBLEMSOLVING
458,330,364 *2E83BF0E459B72BF09C4A4B020670FEC54492EE7 [email protected]
458,330,365 *2E8FC637D78D254B9B3FAD4D24582234DEDBF57E THOMASBOWES
458,330,366 *2E8AA0321ECE3AE979229FA23A2EE984D7A26402 TIMMY.MAYTORENA
458,330,367 *2E8F3F10AF12E93DC67626D82B364FDF921DDAE3 timothyschabel
458,330,368 *2E80DD1AD27034B5A648E9940D1B7A8EE04B5EE8 DTFC8
458,330,369 *2E84C123B99386854A4A472035771D401DD376EA TLUCARI
458,330,370 *2E823EA44B30E19A6E5C4B784CC924B59C21CF84 [email protected]
458,330,371 *2E8D41A99044E8C2A9DDAA200CE8C8FD24270FEB DUJYA
458,330,372 *2E83A76C4DC0D5EA9F8186BA1997D0683E97D8CB Touch-the-Rock-(Rhythm-Rap-Rock-Revival)
458,330,373 *2E8C6501EAEF05083A7AF57EF7947D77C396E066 DUSTY.BOMILLA
458,330,374 *2E81BB75953E33F5DE20B158A44B1C875BC24B78 dvf4%
458,330,375 *2E81A65E8822D36D60061730D8B3FC93E162CD1F d."vt
458,330,376 *2E8EC19393641AA28AAF085314D8C5614ADED6DF treyjarno
458,330,377 *2E8FE047136CD2E85C829403A54A1E0A7F77FA5D trina.mclin
458,330,378 *2E893A37F17170EF8C4B2EF6E369F7B44C845616 [email protected]
458,330,379 *2E8C3DD31E7AB7F8F43DFF55C9BE23FC08EB84DD dz:1s
458,330,380 *2E8B3EFA3944B8173C6F5020AEB2693A08557FB0 TUNGSTOS5
458,330,381 *2E8B9CF00E51223B520D5BDD93E3E31BA09363E6 TYLERDUPAY
458,330,382 *2E8475A6BB2F9D5A3C19E0CFE21E1129522DE286 ty-mowdy
458,330,383 *2E8DECB4FC1261880661B240EFF2D5127A7A2F6D EAUTOBSW8
458,330,384 *2E8C40596C5A21426EB86263E6AD77DAC723480A ebmos
458,330,385 *2E8B614E2D7EF208EBFE4D2A0237ABC4FBB0975A [email protected]
458,330,386 *2E8D0C3DB5AB459452120EBF0A2073F6D0946E07 UGKCLBPS
458,330,387 *2E876070F03EBB8B296B29C2381A1B8B3CBCA80B ULYSSES-REXINE-ABITONA
458,330,388 *2E8C1C17DA38AF33AF58EB6DAA2829F5F1695108 EDWIN.VOGENTHALER
458,330,389 *2E8E819122B2B0AFDB50BB6ACB9F44550132959E EF0B41C0CBA82A09C8CA3B91AAA0F26D BPRW50
458,330,390 *2E87CA293A52469E189F664E54DBB4427A7D0B9D UNE1IDIB1
458,330,391 *2E83B323329516ADCD48EDCD8DA8DBE8266BF8CF USER1391395170
458,330,392 *2E889F4A6D72F48A5F6C5679457A3888F6A2A8CA eipdw
458,330,393 *2E84E37F5C07E636F24DCAC21DBB5838B2003E28 USULERNING
458,330,394 *2E84577B4F4F0490D4E8591643FF271B6D54A440 „eklipse“
458,330,395 *2E89CE6B480BF4C292D1FBFD8C71E3C3BDD30DAF elchevo
458,330,396 *2E838A7AB7AB47330284E93F6ADD8DDB2C5BD07B eliamaraed
458,330,397 *2E846F3A992031D35DC8D8291E548408EBFA6CED VADDI-SUMAN
458,330,398 *2E82D35E9E1F5EA1AD42B10DB9E0E1E4EACF1AE1 VALHALLAAMANDING
458,330,399 *2E8DFE5B74B6ED0B496A82C86711AF606A2CFBE5 elliott1234
458,330,400 *2E853D932C8BAE4822337F87EACF54DE2B165E66 VANEGGIAI4
458,330,401 *2E886B08F45FEC053A31610A214675A152841DDD EMANUELAMACHER
458,330,402 *2E87F50949C2C07B65FB72A38FB13395853CFF77 VEDUT0
458,330,403 *2E884DAD22A53AE2F2279DA140638EDE0C9F78B6 emanueltromley
458,330,404 *2E848A61407C7456AD9786A9351859F0D94F0693 emb#2
458,330,405 *2E83AB0EE11029C62601B874C62DA0E80CF1F7C4 [email protected]
458,330,406 *2E835A843920642C42B1ECE3A962B966B3283B0B emilemeaders
458,330,407 *2E82003D8C5A999FDCB09E5EFE6B93950A46AE43 VERN.HAMIC
458,330,408 *2E868FCC37FAE0531C8228FC1EC7FB6453774FF9 em=pw
458,330,409 *2E8D61E6540287DBAD3C5D734B53EC433294771A v"hi
458,330,410 *2E8F619B731E1DD3CC2F4A8B997452CE0718B126 vieri-coll
458,330,411 *2E868221F69964714DB6B1102ACC57BD1B8F295F VIGOUROUS8
458,330,412 *2E863E2F565E33576450CCE50468EAA2B7E28053 enterr
458,330,413 *2E832204623D38E8936440871B4890B0143FBC7D VISABLEINVISABLE
458,330,414 *2E8D6344D489F10BCFE6C7895AF13E89A1E983CE vishdurga
458,330,415 *2E863EDD9FE0A93000932599CC8C2B4B2D2B6057 E(RC
458,330,416 *2E809B7716DBB1B34D3A3A94B12DE0F7525312F4 ERQNP
458,330,417 *2E845D6A2E7E521EAACC235E7AAF241CC874999D W1`R
458,330,418 *2E8A0F9CE4CB9D092CB6F6620F744715850B600A [email protected]
458,330,419 *2E86C78A45962ECE5419530B7EBE903DBC1FC1B0 WARENVERSAND3
458,330,420 *2E8670111C5B95EC231449520C0D164D524102BA WARREN.PATLAN
458,330,421 *2E8FAC80C31A435B32A80E936B3520A4A077960E watermusicsuiteno.3ingmajor,hwv350:vi.-vii.
458,330,422 *2E86D9E0051E5143F9E594387E1C0E3FD3C42C5E WENDYMAVER
458,330,423 *2E86EEF54F9F554E97274F9D0598917B5F465B28 [email protected]
458,330,424 *2E81D6EF2734BEED92C1A39F096D025466D835A3 werner-kemp
458,330,425 *2E87ADBF4F4CCF0C335E01CB861B2B9417455DA8 wexa.wex
458,330,426 *2E82E2EBA5A400341B6BF02A2B297A57B1AE8B43 WHITEAERO
458,330,427 *2E805905D6B90446F01BB2C4CEAE30BDAEA61213 WIKIPROJECTSMOSTLY
458,330,428 *2E88D1A7137FD888FB9A26251DA2AFB0A11BAA47 WIKTTRANSWIKISALAFI_
458,330,429 *2E8FD9E39D432DA2D9E13C8605D21A9E944A9505 [email protected]
458,330,430 *2E89BDC64B5C07AE94482D7ECAE4D8848626BD79 WILLYBACKUS
458,330,431 *2E821C01763AA0319F65C3CA1BD0DA56D3412E34 etpu
458,330,432 *2E8B52CC5BA9E90B67D29EDD0C79E6123A701F4D WINSTONDEBENHAM
458,330,433 *2E8B0B7D28E64D8456BD717AF371B1E438F501C5 [email protected]
458,330,434 *2E81615727DA4584DF92B74635E4CF4EF7A98A1C wuigaq
458,330,435 *2E8B657FAF4FEAEF236AFD6C19788611DDD6AB47 eusebioslyton
458,330,436 *2E829B592DB262FA7DB4F32264AC31B6E3E87C59 EUWQO
458,330,437 *2E81F325D55DFAB03384374C1D71344E44D178FC WWWROSETTESGALORECOM
458,330,438 *2E850056F612E81D55ED3D94DB4F925516625E36 expliquei
458,330,439 *2E8D9CBD8B13EBE4B108DC81F0F8D0D652EFE02C XAVIER.NAVA
458,330,440 *2E8E0F2F8BD7C026D3060DEBE75048DA98BE2F7C xhx%
458,330,441 *2E8EA09BE404C12CC717C087031C25ECDBFC89EA XINKEONGWONG
458,330,442 *2E86255AA609088E5FC366BB168C45937E180DB5 xslth
458,330,443 *2E8675F36B3C71B951278ED98E19F7D9FA3DAA82 fat1gu35
458,330,444 *2E8FAF1573DE22E2D7A0EE2DAE8584A2AD71776F XULEXIAO
458,330,445 *2E889E8F19AF3423FCC3CC0AD126F5974F071FD0 Y148696
458,330,446 *2E8522382E169B1AB3EADAB8A04F14E685819CBE FENDOWRING
458,330,447 *2E8FCC86A558E1F7D766A99A1DCE30E83054DFB0 fersk
458,330,448 *2E8CC2143156B65E0D1BB6680E0482719F6A6A02 ?>yd
458,330,449 *2E876565BAF496FD0D450F9F2941EAAD3D9E03A2 FILHOTEXANDE
458,330,450 *2E8A3450790E14A8578D67A35BD5597A36B5DCFF YEYRTAKING
458,330,451 *2E82131A47F59F373A4657A49D735D9827228DE3 YMMITEVOLI
458,330,452 *2E842D7D6E1BB4298C616223C2F8ED69EB78AC53 youngcavanah
458,330,453 *2E8763E9EFD32FA77A58ED7ECE2DAEBDE02CB394 YOU'RETHEFIREI'MTHEASHES(GOTHIC-MAGAZINEEDIT)
458,330,454 *2E8EAF66B94E92ED28014D9DB048060AE03423A3 fireweakenedsteel
458,330,455 *2E87D746066AD7B4334B0268BEFA13108800195B FLOYD-MITBEGR
458,330,456 *2E8C7B650544F2C18FE7CFB376B908732518423E FLUGANS4
458,330,457 *2E81F86183359C27F37C5EB85AB4ACED5B83F209 FORBENETS6
458,330,458 *2E8EF08CEE48A30275C0D1B81C26BE1715886699 [email protected]
458,330,459 *2E8EDB3715C7FF72B85595F6F8801AD27DF054FB zhongtun
458,330,460 *2E8A147B52575DA6C45C7B16C50D82AA990C25E2 [email protected]
458,330,461 *2E8A5C1B5C7150A180C868F1290EECB0F085F8C4 FORRARA6
458,330,462 *2E8C5FA103C394ABADCAB3FE4E8F5BB26C1AAC02 frankbawden
458,330,463 *2E89694EABD43D6D3ACC72630E5D7059D94E9D98 FRANKCOSTER
458,330,464 *2E8E38B12FDEF10D31D12EEFC6B3BEC0D262246D Zweite.Kantate.am.2..Weihnachtstag:.12..Choral."Brich.an,.o.sch
458,330,465 *2E891B280B1F3B441F8A1BAA5280710D0621FCE3 zxrhk99j
458,330,466 *2E8029B350248B762027921416AC697E1039526D galechurches
458,330,467 *2E8EC6EF400D7C753E94E496213F8B08CF1F259F лд5
458,330,468 *2E8B78985F3271ECAF1FA545E7092BB60DCC6BEC GARRYSTRUGGS
458,330,469 *2E827F8A2A6E099DDA8BF325EAEDD0106F5F8207 gasmanj
458,330,470 *2E83FDAAA68270BB3936BA4AF9F6A3CF3D97AE06 gastonshead
458,330,471 *2E805B7A5A75FCA782B0528F656271070748038F GAVINMICHELL
458,330,472 *2E80000E9535D026ECF1718C3A65D899CE57874F gay(disc2)
458,330,473 *2E80CA286423E644259D3AFB847C3D51436849D2 ԱՐԱԳԱՍՏԱՆԱՎ
458,330,474 *2E836AE2D7F2B68C6FA1CAAD48C54BF8D1526D3C GENE.CLANTZ
458,330,475 *2E805B36931F9B52787C063EC94D3FE197AD99CB [email protected]
458,330,476 *2E8FAFE323C8177BEA16CE942C694F4C63074133 九巴281a線-i
458,330,477 *2E8E6AAE86D6B8AC987D87F4B726802F9F807ADF GILBERTOCHEEVERS
458,330,478 *2E89002D8164530542339A043F594F2DAD0DD44F GNIIEOMEBS
458,330,479 *2E89286F2840FEF870850F07562CE207A883781D [email protected]
458,330,480 *2E85473934038F8BC963CE320CACBFF5E083509F GOODROUTEEU.ORGWWW
458,330,481 *2E810FB06C48786E275E61A414678B4018B5B4E4 G}QQ
458,330,482 *2E808950FDFE2216F61F1913B6EB5A7F9F61E70E [email protected]
458,330,483 *2E885A4305001A4F4D10A3474CD5BFC257D58741 GUTHRUN 'G/U//D/R/U/N
458,330,484 *2E80328F960813EC03310D0E6BCE4FC259E45A6B [email protected]
458,330,485 *2E8B325E20E1902E4A4E7821942572BBA14AF16B [email protected]
458,330,486 *2E8DBDA9CB2D678AD995287DCFFBD828775F61E0 handsomegirl
458,330,487 *2E807B7058ADD1E5205569D41DCF2954DE84E929 HAPALOTE
458,330,488 *2E8CE1F856B1ED9827DE1AB9EC41310D17A2C0B9 harrisonstricklind
458,330,489 *2E882EC04C4BCB20918795ACB7A0999D856D267D hawkeyedavid
458,330,490 *2E8EE0E882BA70A426A860A8D1C70186898B0FD7 1136849 KESKUSTELUN AIKANA NOUSI ESILLE KYSYMYKSI
458,330,491 *2E893A666F8ACE152B449A985EE1472A2DBC9D6C 11march1099
458,330,492 *2E855DB8BA5802E6688F294E61E4FB7489128B03 HECTOR.SIMILIEN
458,330,493 *2E842DA7B5B7027AA0C78F896D88B52BB792C7CD HEH.160P
458,330,494 *2E87449475452C43A16AE5C422D4424CCF3A662C 1447545 SENSIJAANTOISEENSUUNTAANRAJANVETOAPIT
458,330,495 *2E865B07008734A313A4CB87217C93DB79DB0747 1476757 MUITTEN POHJOISKARJALAN TY
458,330,496 *2E8E1DF895DA2F29E0BBC277ADB3EEB364E071DB HGXYJ
458,330,497 *2E860EAA272D1337960F3DA1FDACDDBAA033DCEA 1584044 two.of.the.original.group.remain.in.the.band.today..
458,330,498 *2E8A873F18AB373D65BC79AD3100B69F03C5B387 1598009 sen.liikevaihto.viimeksi.p
458,330,499 *2E8D649C9D71A045B59039C501B33102AFEEB1E6 15.ORPLID
458,330,500 *2E8EB4BA4392B9967DB3415114BA451107D16A24 HINTERPOMMERN4
458,330,501 *2E85D4FF4BF8D168F350A32D29CAB78623C1116F [email protected]
458,330,502 *2E8EA8AB171D7CBBFD5DC9DFDD5239FF1F68F71F 1965435 j
458,330,503 *2E854165DB3BF1CC42317FC04B1DCD543B25B5F1 1997er26
458,330,504 *2E88A26F12B15B8EEBDB2927A4ACD79A6B87CCCA HRMASKF
458,330,505 *2E851C8D3529DAA425CD53D49382F9D3283D9485 1.amazonas-bewohner
458,330,506 *2E8DEC504E351A126C26F66959BC683940882C15 [email protected]
458,330,507 *2E8961B351BCD96D356B66B3CD7C5E9ACF8DEC8B htobomer0
458,330,508 *2E8F1488D1789A07578777BF66C06002F61F75B3 HTTPWWWRSSCCOM
458,330,509 *2E86346B00F073D2798C42A99E3C2DFD4BD5890B 1-bulmalarda
458,330,510 *2E85D79BCA569F1BB6A815D5D7069DD253378A7F 1 CHRISTOPHERAND
458,330,511 *2E830EFB74860683181A326FCCB6C4B1FD11E98B huberthuckabee
458,330,512 *2E8063B9C9C0E4A8DA3F9EC95B0616A3BF4D5D82 [email protected]
458,330,513 *2E82B1434946238E5F886FDBC5153C85E7D1FD89 HUHF
458,330,514 *2E866D2D69709ECE2D82B8E5A7B0DDE73464033A 1-hanhipaimenena
458,330,515 *2E8B74DCDB63795D434732AE7698145C6F57986B 1.HIGHTECHFLUGKOERPER
458,330,516 *2E8D059798DD0A75FC6CE340C2700F6B862E6CDB HYDRNGCS1
458,330,517 *2E83556EBFEE4A977FED210FD30EBD944CADC303 1 KORUYUCULARININ
458,330,518 *2E8603ED6285D57406831A1D59863C6892AA0990 1 KOVOL
458,330,519 *2E8DF414CD857E8DB2651E5661D527ACD1626FB2 1.kuzi
458,330,520 *2E8131CF8A7D7BDE4970EDBB6D1C935CE3525202 IBARRART
458,330,521 *2E83D88ADC35E03BAE088C35C01E89C32FF6896C Idle-Hands-Are-the-Devil's-Playthings
458,330,522 *2E89E78F7CE79C103B66EC30A8133D79953529FD 1maajoukkueedustukselle
458,330,523 *2E89DCC616CF6F1A18C6AE772C93001A29D77C76 ii%g
458,330,524 *2E83489F5B709C3C29FF4659A686A6BBF8E8B758 1-PRUDENT-PURCHASING
458,330,525 *2E8B6F6A84CDE82E46A0AA4FC56A3130BCED21C4 iloporced
458,330,526 *2E81CC879A0B3714D0717B36D845A6511F2C22DE I'MLIKEAKENWORTH
458,330,527 *2E88573B8C7F256227AEF2EF832E7D8400B79ABD INDISCERPIBLENESS
458,330,528 *2E80864BA83504E5BC0DC5404DC0959C6F81B14A 1 valtios
458,330,529 *2E885AAD2B8D61336841E71038BB4EB9DA80663E INKVISIITORIL
458,330,530 *2E839A62ABA8A62ABD04E6960D7A2344022BCDE7 1-WILHELM-NAULIN-PLAKETTE
458,330,531 *2E85833E78AA7E8F0175E55CC6176C1E08B7E874 1.YASMEEN'LE
458,330,532 *2E8B08693FD7FAB4906DFB057570BD0C92DB1B7B 1YLI-M
458,330,533 *2E843D9655F76886C2F07BED4CE41BBA2EC79B62 innrednings
458,330,534 *2E8DBCBE4FBE99CB8C1CFE646EE29A4F89159553 intentionne!
458,330,535 *2E86B9728313154CBA16C64328AD068A72113202 INVAUD
458,330,536 *2E802E2407FBDA7D09B8B2942138A7292FAEAE90 2183857 olet kuin tuuli
458,330,537 *2E8C8E048BD727CF71F62AD7D15CE61161203A96 2190594 LUETTUANIVAPAASUOMILEHDESS
458,330,538 *2E865032B6DB6B45B339CAC66FBD482EC05546A3 23.DONENLERIN
458,330,539 *2E8E7DF21C92849EC6513CD9F95E8E2BC3D72B7E IRENE GAMAL
458,330,540 *2E8E2BC9D225360F2A55D54E44F55152CA2DA434 2414251 YLEISIN.TALOUDEN.KOKO.2.HENKE
458,330,541 *2E83D54E4DC7D7B774250ABE433F357AD57201F2 IRMXBSW9
458,330,542 *2E850A34C3ADDA7E33C0FDCD102598AA8437BB34 2681194 SCHOENREDEN.IST.ANGESAGT..
458,330,543 *2E87A466E8C0AE674831E4E61FD6CDDB889EBC1D 2690787 milt
458,330,544 *2E8989D1C274ACD102B0FFE3002FD5B1D457932D 2743665 MIELEENSAATTAAJUOLAHTAASYNNILLINENAJATUS.
458,330,545 *2E82CFA55520C32BAA623D8637535F084B4A34A7 ITERATIES.
458,330,546 *2E8352E0D09286FC0FA73EE4BF49AE132793A2F7 2BURGANDRY
458,330,547 *2E8770A9AC82DE0280809F99653C2DFA75AC320B 2DETADREVO
458,330,548 *2E88A93DB3C185A440EDB7F2232CC4B9DDEC3D5F 2ERESERF
458,330,549 *2E85A9F76FA380792E5C197A6640921AC7FECF68 2.HALLITUSTANSA
458,330,550 *2E8A21B4DC6DC8FC0D1C2C1F36E66721EEA71BC5 IVORYROLLIN
458,330,551 *2E80D16ACC8A9960343F58BCE3E72104B6551C1E IVORYWETMORE
458,330,552 *2E8F7D731B7AE447EC433817CD95826C27DD00FF 2ILUVJAMESBOND0
458,330,553 *2E882779C1F031794B5D427D9AB028CFA632C5B1 JACKIE.SESAY
458,330,554 *2E83010EF462819BB050461BB13CFBE6F45C7067 JAKEBILLOCOMJAKEBILLO
458,330,555 *2E82B0E91476D481DA0574877F054FF9BDE583AA jamie.buffett
458,330,556 *2E8E653F5A66699CD117D77AEAE1C0BA608AD6C1 JARVISHANMORE
458,330,557 *2E82D45E86F256AFEB10E6E6F8EF53CD546A1F69 JASMINATKINS
458,330,558 *2E8F75B061A8183990468A95B040B4B2AE56D12E JAVIERMAURO
458,330,559 *2E81A9EE2A7EFD141E0096507EA7D727BB854434 jayabbene
458,330,560 *2E871965F81089AD83388BD3CF4A0103BF7816FD 3AVOLDEMORE
458,330,561 *2E8DE8AFB8F000A5DA4B2520C78019BA781013EF jeannette-todd
458,330,562 *2E8F3F5DB9D571390D10AEF0D7FCDE2056737F02 3B***~0~o}X{
458,330,563 *2E8AA7A0B819A357A77417A0CACF890D00A907B5 3---B.~.~.~.(X)
458,330,564 *2E8A4AFCB93541402E4C0740ACAFDC3B068B415E jefferyvlasak
458,330,565 *2E8D28927101278DEAA3E18B0FB0D539E3C998B2 3edeja
458,330,566 *2E8C2E2A2A57B6061553A1B02FA5F95B629AFBE2 3ENDIGHED
458,330,567 *2E8807EB79D7A6482DC20A39A8DB2EAF7D5234E0 3FERNOSTL
458,330,568 *2E89F34324A168E86CE0E7BBD8D5082654E9D812 jerrellcorporan
458,330,569 *2E8F454CCBE6AA398ED0FA8072395757D4426162 JESSIE.KLINEDINST
458,330,570 *2E863773EF35FFAB865A720E0D5AD6F79F9C2DA8 3----p~0Splat
458,330,571 *2E81681379E16931BF5B689A6F33E1EAA25848BB [email protected]
458,330,572 *2E802635DBDACDA5A1B12AECBE4836DD0CBF86B5 3.TUONTIKIELTOA
458,330,573 *2E8D93AE662648817D292C9644C8986BF5036E9B 3USPRING
458,330,574 *2E844EDEA9C379CAEF24821F4B05AFD32395227A JIM.RANDHAWA
458,330,575 *2E8383795A32EFC28678EA6737BA34E00BFCC3C1 [email protected]
458,330,576 *2E8CBF4EDD724153F8A8A266DFA50C2FADE7C606 JI=Y
458,330,577 *2E81B4883FF8C36C25CE97C9534B1BFAF96425AB 4ASSISTILA
458,330,578 *2E8744AB451CA68CA0B9025536C39CAA8CA0755A JOESPH.DELCUETO
458,330,579 *2E80EEC78A0AF17C901A79C3D1A00F8964EF53D2 4-ELITE-KLUBS
458,330,580 *2E8B66CD8959660B2F7CC0B1756FCA2EC8829384 4.fuji-cup
458,330,581 *2E84B92642ACB373F48F92A6D99DA5E7DB9400F6 JOHNNY.FRAGO
458,330,582 *2E8CD4B1FEBD54453F9095E00BBE1A66482BBEA2 4GZWZRDNP
458,330,583 *2E881536715C72015DCC4DA45FE29A0DDCA5FF9A 4hiristiyanlikta
458,330,584 *2E8600530BE4B0B9C2C48EE8D5C103A31F5835B5 jojibank
458,330,585 *2E85E07DDB5A7BEA9D80E1345BB3EC9A255CBD5E [email protected]
458,330,586 *2E80258A2E272543B65CFED82F67702DA4C06867 4MANTRAMURPHY
458,330,587 *2E8BE3AD4D3BF24357B713770E0C7425E15A0C2B 4MASCALZONCELLO
458,330,588 *2E8E7C40D4991F06A6E386ED3124CC6161E4C731 JOSEIGNACIOOROZCO
458,330,589 *2E8927A8A2E0131C20CA64AD73A8E2356A387F48 4MOUKKA
458,330,590 *2E8AB38CAA2D3DD070F81F6B08082FCDB573F928 JOSH.BALENTINE
458,330,591 *2E8E0B0C0123F26EC11A0BC076E559074E8934FF 4-P
458,330,592 *2E8B5E2059A94D92CEA5B52780B0ADE545AABFE9 JTDAWG
458,330,593 *2E89E8B76A3E6FD1AA9942EC99613426A7EC3603 4SERVERPLATTEN
458,330,594 *2E8702DC1FCC1A993BF2C7BABA35FFCC645B0CCF JÚZGALE
458,330,595 *2E884551548BE2ED458EA45385E0C4C604C3C84D JX2K
458,330,596 *2E8CB65B2929290CD61DAAFED28200E758496645 53HXADB5GMQZOLRQYIGLDNX7KRS
458,330,597 *2E8D8E9A0DE5B91AE9E21AA1473CCF991810849D 5AANBESTERFTS
458,330,598 *2E8FDA07AA9DA2E2B11924601EFA298919647D5B 5BOIRGYKMYN
458,330,599 *2E8C7AEE77E10847647D79E4E02ACF9BAFFDE03A kasvukipuja(featherrasmiesliiga)
458,330,600 *2E85DAFF3DCB102AEBD06837363DED735662E56F KAYA534
458,330,601 *2E8A5AD5CCC89A0572258C3C591F5904F936EC2C KBTHETALLONE
458,330,602 *2E890CF137FC86CDDEDFAA551BDEB9DB199C1A64 5DIAPTSRO
458,330,603 *2E8375CFA49460D8D147B20E7697213C1906DB26 KCWI
458,330,604 *2E8017FF5B91BBF9F938C2F629B7C4AE2F2DA984 5ENDMULTIPART
458,330,605 *2E8018B9E880B6D23A8B312D74CB73ED5E16EA1E kenan.jones
458,330,606 *2E8E69B83DFE3356697C1B353E13555B0FBF76EB kendrick606
458,330,607 *2E82ACE765D04944156F4B27B636FD16228C13B1 KENGOUDSWARD
458,330,608 *2E8F762A569BA9ECEA342E5CF9E17688FED5355C KENNETHTIERNEY
458,330,609 *2E8E2235B7DE4626D24FAEB384E4CC1B319F456E KEVENPALLAZZO
458,330,610 *2E8C669E352B16E08605148DAD6D1037F86145BA 5membrally
458,330,611 *2E8B9A5C4EC27938F7D6A1664C2B08291CE58BF8 King.Porter.(A.Stomp)
458,330,612 *2E890BA0E0F7301C7BBD337C413A2C2E6519BA68 KIRJAMÄRGID
458,330,613 *2E8AA470358C9A7A520D06EF7AA46DA765495200 KOGYIKYAW
458,330,614 *2E890BE40537C2EC246E38EE67F8604BD17F140D 5XYNTAHEYLJSZTX
458,330,615 *2E88A24F19758FCCC503B25119A0CB9DC820C61B 61087
458,330,616 *2E8E9A87E57A8411617AA88765D93502880B7970 671813 visio kannattaa asettaa ajallisesti usean vuoden p
458,330,617 *2E82D75CD9227BE6A97CFA1FA6FBF5D8CE3FD833 KRISTALLGLASWERKE
458,330,618 *2E80C5DAADCF124AD39B5BC1EB8F272DC9548539 [email protected]
458,330,619 *2E8BDB170FD578D1B57FF5929DE3DB01624FA6FE 6BSWADDBBSW
458,330,620 *2E82F35C84BDAD6087D83DA483B5DE55F0485537 kurhanfes
458,330,621 *2E895600767083341396CC1FB24B33FC5893E511 KYLIEMEADOWS
458,330,622 *2E88739866EC6FA7548C1739F6C741EF314C0C87 6GLOMERAVERAMUS
458,330,623 *2E896032F7D919EA06FC82C101CC479581734DA4 LABORPRÜFUNGEN
458,330,624 *2E8522CF8543EED021D9B41CA6F51B96A9019BE3 6iluvmopar2
458,330,625 *2E85BA3C27B00E49E7397445193A199D252710AC LANKHIKKAYENNATHU
458,330,626 *2E8D637B737D0393C48EEB061371A9BC98D420A3 LaPortePlume
458,330,627 *2E8B956D3E1F59F4B1DFD26EC08FFF1060133B6A 6.SONGS.E.P.
458,330,628 *2E823F27A7CB1966A1B5E176AE14F7E9DDF2D5BB 6THEXCOUNTRY0
458,330,629 *2E8A8E2D9AB4EB6D483741721490A07639B82E2B LAWXXXX4
458,330,630 *2E81D3B0D2FDEB1DBE3BB7427809765A72A6F849 LE02
458,330,631 *2E86DDBA6A404D956ED6EACF8ED648097E30699C 75B7
458,330,632 *2E8FD742A362D90DF43E091EDD2094C11F682344 LEIF.KREMKOW
458,330,633 *2E86A9C361DE7393EF9367741ADA1BEB9C9A7363 7ALLAGUST
458,330,634 *2E84EFD232BEBA1AE72BE2E6930990C793B3522C 7ATAWEKWA
458,330,635 *2E82F15BD4610F6C93BA4B04035D2B610A4CBA39 LEROYALSTEVENSON
458,330,636 *2E8ECA8DC821938552D3D15ED2985C120896F78A 7ETNAMAID
458,330,637 *2E875BAD0009C244A34743C73EE8100DB163F8E4 7GLASSOBJECT
458,330,638 *2E8C47150EE2DEA656C0F1F41DC26A9059A5DB23 7GRAYECLIPSE
458,330,639 *2E841F1BF9D6395E44534A0B0E5CA2779AEFB7E1 7HEWLRPDKREJKDY
458,330,640 *2E892CD7A3C9B5186C9017BA74ED629E700BAB7D LESTERVIESCA
458,330,641 *2E8D2193DE756CE8C2473695C4E498F6F221F625 LET IN ROCK
458,330,642 *2E833E876E0713BEB9AEDF035323942B90C420EC 7TONDRAIS
458,330,643 *2E86F47FC3C89117FC6957C8732BC7647D106E76 810676 HELSINKIIN-ON-SAAPUNUT-RUNSAASTI-MY
458,330,644 *2E8C4E540C81C6ACD20F6A5EDF2E5095C6DD3632 LITHUANIAINTO
458,330,645 *2E86729A47454F414DAE3C95D60384397354AC98 8BRUTUSSIMON
458,330,646 *2E8C99701EA3C712C0C39201F14E79AF979393C2 8#####B**splat!
458,330,647 *2E8194991A90C6D18253A8C2AFE0E9C54C15B50C LOOKING.FOR.THE.OTO
458,330,648 *2E8FA692F58FA0AC2878E87796E96EE8E89BD865 LOUISSKOCZYLAS
458,330,649 *2E8E9CE56D0115BB6793E5E6ED17F3D852B80A0A 8FORRARESA
458,330,650 *2E869E618F2E1A533ADBD3DA62EE5E08F1008A70 8FORTIETH
458,330,651 *2E88654AD7C86EDA9452CA635902B2286A385BCC lpsz164
458,330,652 *2E8A629B7FF44484011BECBF68B9407F071EDD5E [email protected]
458,330,653 *2E800EB17CF7ADD9D64A80D74B006F8CA9052F74 luka.he
458,330,654 *2E82A5056FC58F56C402CFDD1B6A42A71B0C7FD3 LUMBRICA2
458,330,655 *2E86137587405D9C6FCB54A6535AE816983A80BA 8LBORNIAN
458,330,656 *2E827D6DA300146E8A32F4F3F012A1E7A1879286 LUOTOLANSAARI
458,330,657 *2E8E5E3F06941307AE5596A649D5E2DF8674B435 LÙYǓ
458,330,658 *2E8C62ACAAE55CCCBD42B9C6645CE984687A6F0A 8MYRESOURCETYP
458,330,659 *2E850661CC5CAB6BB7E174A828683C9D0EC50D37 LWMNAWMNNET
458,330,660 *2E8BFF29E910A36CD4C9348F53A4B26C7C3A523F )8([email protected]
458,330,661 *2E888970AFA2EC7C2791A0A2576CD1D0C305F1CE 8---p-*-*-3b<-
458,330,662 *2E8632207216D00A9AC8BA217A302E8460111A2E 8RERESOLVE
458,330,663 *2E8252B4EA1EDD396F88D53E6C8588E8BAB3BF9B グレン・L・マーティンの製造機一覧
458,330,664 *2E888B665F534AAF04F0550FFD82018FA627820A 8XYNKIYS
458,330,665 *2E836D607FEA10ABF77B0CF6CF773688E2850D7A Makhoul.Winn
458,330,666 *2E8B416ACFEF2EE334E67138D6927272B9AA955A Manucures
458,330,667 *2E8984A287814837D8804BD1BF26FBBC68A7140B 」の98KG未満級に出場。1回戦で
458,330,668 *2E854E1D617E601A2F854C973D78BE1351A0DBAE 9AMIDIATE
458,330,669 *2E83782A22964D9EFA67B1C3AA9A35BED6919B09 MARIE.JOSEE.LEBEL
458,330,670 *2E8EB207F4B16F893C3B5F1D71A83DA4E29019D9 MARIEKIRKIU
458,330,671 *2E881F33E519FB6B29AD81AF384DEFA9EF5C637A MARKUS.KELCH
458,330,672 *2E8CD7D2FF185134B8A17A687941627230E62BC5 MARSHALL.ALTENBACH
458,330,673 *2E809A169AC053965CD356BFA37254148C6414DA 9ETAORPAC
458,330,674 *2E8BB0C4C3DDDD7743601175C3534E99B7C13035 9FEBRUARY1861
458,330,675 *2E884C2B9909E537CC0E16207943A42543B60719 9GEROOTGEROOT
458,330,676 *2E82C63F55A5410AA6ACA40F6811A897DC3545B5 MAURICIONITTA
458,330,677 *2E83AD977255F6C80966DF4B7FCEF58FE306A40D mauriciopuerto
458,330,678 *2E8C6A4DC33AAAAF13377FE1496976DF9F405B2E mauroshutter
458,330,679 *2E89C56D32F986DB09EDA3D1467DE78BEC8C5DDD MAX.SELLEN
458,330,680 *2E8D85AF78DA3E8DBE2A5B43F4559F669C5B957C 9LUBRICITATEBSW
458,330,681 *2E825DA28A781089DBB633683ACB142899F62C31 megan-groff
458,330,682 *2E816F38E362D97C28B654E5AD7883A16BC32679 9OCCUPANTED
458,330,683 *2E8893596FAA7F94EC718F0F36CC81769CD377B8 9PANTHER7
458,330,684 *2E8CCB5685CA18416264796D25EDD1FB91D31439 [email protected]
458,330,685 *2E858C1C6615CCBAC46D76C262DBA791AFE1D126 MESS_CALL-M/E/S_K/O/L
458,330,686 *2E8FF38FE5A2D3435A270F42C4A43425118BF2EE [email protected]
458,330,687 *2E8B6DD2A10B4CD15EA95572456D7337C06DA161 9SPAINCANCER
458,330,688 *2E81CC7057FDE46E0D62F824646A7E7A6DAD5FAC MICHELPENO
458,330,689 *2E850D92EA94F3A114BD835FC45AF51E75BC3BC5 [email protected]
458,330,690 *2E8F999661FA8933998D891EC2CE093F3B9D3570 MIGHTYDAY
458,330,691 *2E8854B76BC13F59667F7C12F0C08F9784FFAD83 milkandcookies
458,330,692 *2E8D832EACC0908909FCF2180E631DEA5C865811 [email protected]
458,330,693 *2E8FB9A6BE97418D2282836131A9A30CB18A8586 9UNFREIGHTS
458,330,694 *2E8A2233E7D80B84EAF0A48FF4C3722B86097E28 9YISOGNEG
458,330,695 *2E8DB4DAC942C603339000CE466FAFFF537F3B09 MOHAMED.ALIFF
458,330,696 *2E88698B851CCA87D4D98B850F298CEC8248F5BD MOISES.JOHAR
458,330,697 *2E81837711DB3F6ED30C86DBF3A37ED0A47ECD73 mo'.juice
458,330,698 *2E8476B39A5115ED9E9D36B95E33C3F9B26F06AC a52:r
458,330,699 *2E87FAB3A9755B655770EE8109DBCE274C146E6A MOTOROLARAYTHEON
458,330,700 *2E84BE7447B1067F28390628E8AFD53F2EAC491B A:9EN
458,330,701 *2E8CEF1C611D050F8FA5A28E744D67BD0683A322 AA198422
458,330,702 *2E8BE83BAA403A52466356C0204166B52EB6E2D6 aaaae_
458,330,703 *2E8B75F8F81CFC28677B2E938F64C15A99A2DB50 N3UR0GL4N
458,330,704 *2E88BCFEE64AC0CE3ADA047452E2B62E90430E19 aagahphbvwqaxg5
458,330,705 *2E8D5EAF11D13F84AA26B5D2A604B96923848EE0 AAHI
458,330,706 *2E81AC1D942019C180A1C284B460CCDBF682584E NÄYTTELIJÖITÄ
458,330,707 *2E8F23D73473C05E7E7713ECDED3D72E09E4963C AB=I7
458,330,708 *2E8825BADFF799EA24E01D9FBDA379CB0ACE1E75 NE-I.-INTERLUDE
458,330,709 *2E871A78D3991A853FBC9D1D2D40CADC8AE0E627 AbyssalPlain
458,330,710 *2E898B1CBAE9B6C83FFC9120C00C568843C717A0 nice18
458,330,711 *2E887040FCE1BBB49F7D8C8D13AAB457B2A88F55 A,D.B
458,330,712 *2E816A80E31C629B9F4447E2C15CEBF540D1C2BF ADITI1989
458,330,713 *2E87883F1BF0C93AE4A989D3F150F623D5EC5F84 ADRIAN-ORIGENES
458,330,714 *2E8FA683E2B84B206908E3DE549799C0D745A492 NORRISCHIAPPETTA
458,330,715 *2E80725F1EF350457D7395050B1B7297536FEB6E npw*
458,330,716 *2E8C08B59E6D8E2DCA7C30593AB761AF420EFA13 nwtamret
458,330,717 *2E8C5C3408675341D4152C17FD436905F19EA6A2 AFSCHILFER
458,330,718 *2E8B7ACCDFCEBDAE4E16249D862342E16EAEDF4B ODWOLANYM
458,330,719 *2E8F70EFAB38771E91A8FCC52DC1CB7F084FA2B2 OLENGRUSTAS
458,330,720 *2E8168C22CE273CAC8E42F47D2007CF80E899F8A OLUTOYIN6
458,330,721 *2E8F26DEA119F633A7F7A28CDDFAA23A6E9D817A A:HD$
458,330,722 *2E8758B45C1AF84B9CA9694CD4525F2D8B8A819B AHKD5
458,330,723 *2E837F59AD21136DB47A0875ABAEF8A43F07B5F9 OPSLEURT5
458,330,724 *2E87C9D8094304BE499978D2E0F6881715FC46E7 a:!j+
458,330,725 *2E888F82F86E52CEDAC6D97ED4AAA60A8CEE227E akaer
458,330,726 *2E8BB883EB66BFC457785A36BE7D7EAF3BDD0F30 alessandra967
458,330,727 *2E874B86D4E409EDEB0EBE409F880A436D902F3E p3r10d0n71$7
458,330,728 *2E8D03735F4397BB94585956E1445198EF193E1F [email protected]
458,330,729 *2E83619F29D48CEB074079230F9CC79E9F2B9EE8 [email protected]#PADAMA
458,330,730 *2E864D4408ECA3F64AB68A422404314C9B1218F2 allison.rae.smith
458,330,731 *2E89C6D74F4D9F30FEB39AA654478103AFCB8A09 [email protected]
458,330,732 *2E89B506569ECD332D71D2E3761E64458C22ED6A [email protected]
458,330,733 *2E84C233BDF8808F297BA2237D718DA60283EB6C ALTONCLARDY
458,330,734 *2E804E47E8D9BC06E098AA65A51E8460B12813E1 ALVA.SCHMUCK
458,330,735 *2E875A0E20AEFC5D98795E456D77D9035232A001 alvfo
458,330,736 *2E8E15AF448AEAA2FE7898683C0F5F6E6EFDB926 PARESSEUSE!
458,330,737 *2E819B91271CBC389D25ACEE60CE54A726A59CF4 patientfitz
458,330,738 *2E8E290BD42F223244FF539055098517759852C9 pauljeske
458,330,739 *2E8201A18EC250B3DE932DF035D9B9A511FB67AE P====B~.~{X}
458,330,740 *2E817DF5A655A1ACB69755928841F3B0E1EDEBC9 AMR(#
458,330,741 *2E85B624571D96BE4F7AEDE40DB4CB802BEECF71 ANKR=
458,330,742 *2E8D0AC3FB39B8A2B730475AFD23906CF7F1C017 anthony-maria
458,330,743 *2E8124A547732190129ECD94E960F4865577E8EA appuv
458,330,744 *2E8EF9895C3D943D3131BA27BCE8B47965FB9DF6 poohquay
458,330,745 *2E84EB5352AAC1CF8CBEA4BFF8390B82DA5752AB ARMY.AIR.FORCES
458,330,746 *2E8BF4AB232EC69934018A39290ACE9EE9BF75B8 PR4323
458,330,747 *2E8B3E47B874B393245366AB188641D51A08D416 articlemost
458,330,748 *2E86288D8D071072CAAE3965E682FB56507220A8 AS5M1
458,330,749 *2E8878D36229EA8CB150E247E8B1BC80EDA912AE PROMNADE-JAPANESEVER-
458,330,750 *2E87890578F53DEE119CF45006A35C34890EC244 ATIOJITOS
458,330,751 *2E8E03AB063EB4160AEF669158DB8BCF09C9FD76 atj;0
458,330,752 *2E869D8770E0A11CF8CA92BDFFED06EF3795A17A attnujsa8
458,330,753 *2E80ECC1991F0086DDD2ECBD792F7BA10030CD2F atuz&
458,330,754 *2E8B0247848BF4C36A0BBE645FDA2382412AD0FE q====B~.`.3B<-
458,330,755 *2E896E7BA4BA2FA659DA548280792FBCADB65FE1 [email protected]
458,330,756 *2E81515991B873365B3F56CAA18B97405A36EE72 austinmoan
458,330,757 *2E8961A642B9A01278F21D792FF3BE6EAD11ECB0 AVERYPOLICASTRO
458,330,758 *2E8B375D66FC7BBCBA8BA153D3A2CEC34A857B1C avivares0
458,330,759 *2E8A4AF823AFD16FEF090D8B5B085ECCF7E508C4 AYLW%
458,330,760 *2E8360455753D436F3C2E031A7E47016597426C9 b#:4a
458,330,761 *2E80FD8A9DA0015AC872CB13D4903F5E1B7F05C4 B7rg
458,330,762 *2E8062629B15BB9F9D32F71F2E7437081DF8C3F0 B9WD7
458,330,763 *2E867A56A9FBDA6FABA4E866D53909C922A2C0B7 BAROGRAPHIC6
458,330,764 *2E83E26013E97E5810B5239EE32C0FE3048A0B4E RECON5ECRA7ION
458,330,765 *2E85C1B2612C316B13741943A57491CC47F20AD4 BARTON.RODARTA
458,330,766 *2E822661501D64DEE3FC5AADB86DD0842979098A REGNAZRONET5
458,330,767 *2E802F7087EEB58333D7B9BA5E4F1C4FFF3B648C regoobatiuqihc
458,330,768 *2E8DD3EEC21BFA384180E9D14BB24EDA91D02B96 B######B~.(_0)
458,330,769 *2E889AB77D68F1ADBA428348C7F18F728CEB38B9 bbgwh
458,330,770 *2E8B8868885DE8CC52F1FB80CE98D9621F6DE93A reproduisants
458,330,771 *2E8F35FAEE6ED684297E17C10BBDE9D5D726723B bdke/
458,330,772 *2E8B55AF433F8739DC4591EBFE1430A3939028DC BENNN
458,330,773 *2E83EB46038504844AD340B788B398CB1EA4CE92 richieduxbury
458,330,774 *2E8E2D1E6F784CA440371DF7530E2D16A579F654 BESTIMMENF
458,330,775 *2E88879B9B224E45378DCFB5D067368D881359C3 betsy.hildebrandt
458,330,776 *2E8E6127EB283C4547F3CD277CA20BFAA98CAD10 BEVERLYGARDNER
458,330,777 *2E82DCE41AEA011A69DCC6EA52598B1BE62009DB BF/HD
458,330,778 *2E8E33A6957B75C871431DA8379A997566A14C2C RIFINITIS3
458,330,779 *2E8072CDE542552B908113796F77A738E53FE566 BHAWN
458,330,780 *2E8D9636F727359E6C934C35DC6363BF52198E8D RINGOFGLORYCOM
458,330,781 *2E8FCC653D95D3CEE86345D6B6958F1D97548C8A RIPHRASTIQUE
458,330,782 *2E8046D6C92C01C83886D74DF5FC9E794B209A34 biiaf
458,330,783 *2E834527F8CAA5FFE39121196B33738640FE792F ROBERT-BONNAR
458,330,784 *2E8EB2653732322494A27B90457865AA22307F3C ROBERTVONTUNGELN
458,330,785 *2E88E63EBE1F8DDFA3DB11D06358C625D45509FE BLAIR.SHARICK
458,330,786 *2E8DCB9240CC225F07F866B0A63E04590EDFF532 roccobentley
458,330,787 *2E82AC6C3F7639AADDFEDE1F356F2F50056726D1 roccodoskocil
458,330,788 *2E8B1BC57653D9581D978673822A1C23AFFC303A ROCCOEDWADS
458,330,789 *2E863EBCC6C29B4ECC31F89EC0001E8C6F8981C6 blauw(feat.thescene)
458,330,790 *2E8AA1105EB05A59B47DB21A27926F5B4FBC4F9A BLINK-EYED
458,330,791 *2E8BCACA50F5B4E18833B310D1E96328176D44E1 rodrigosouto
458,330,792 *2E89A04287E4C5ED99367E4907C844D964AFF473 b!lzl
458,330,793 *2E87B71818CE25ECF9047CD2C8828DB590D5DE0D BMOLY
458,330,794 *2E81863BEEA8ACAD86B1B992A06014F00140F690 BMWCS
458,330,795 *2E8D42F906D5C1A1D5DE52823D6BC67B53CDAD49 BOYFRIEND.9
458,330,796 *2E8DB15A57779FA9331847EB7E032BDDC00142D9 boysunga
458,330,797 *2E85C1B08BE8326ACF068925193B74D6CCA883CF BRADFORD.PERROT
458,330,798 *2E8ADB665BA7014837DCBA059B6E21585E83A268 RUEBENUTSLER
458,330,799 *2E881EFD16046E3B1747FA7CE04A9E0FE9163669 RUSSELJOSH2
458,330,800 *2E87341907B47D1E14E95918C68E06D3D3CF7973 RUSSELL.PERGOLA
458,330,801 *2E8FD769A48A383BE611BE06632160CCEF740690 brankaday
458,330,802 *2E8B79DD084138FCC1F1767447469C26DF65B73B SALMONSKEETERING
458,330,803 *2E860E6397E3F04E8C5F01A2A4AA997E21C1BB15 BRIAN-HOUNSELL
458,330,804 *2E8F5982163641290C61541445C99646B2A93777 SALVADORMCCROHAN
458,330,805 *2E886A9235B02EDCA2C25AF73C6EA3447B7CD9BE BRIANOUTLAW
458,330,806 *2E855799C5E0CBE5E57DE3FA6F267F1A57B7EBAC BROTHERSTON
458,330,807 *2E8A7E2CE903DE57F3639D435B979DF5C1B8D072 SAVAGEISAAC1
458,330,808 *2E8792C2BEFD8595C4653031C3F1E195E270654C bsul#
458,330,809 *2E8D1B52D22A47F8C730A01795988BA9453AA246 SCHLOSBERG1
458,330,810 *2E82B4636B22C274A6BC6397AD3015B0900AFA8D SCHTICK
458,330,811 *2E8A6C15B585D5F618B7ABC97AB3A3567C2C3022 scytale
458,330,812 *2E885C122461986F76A72F47F53017A05C824CAA bugsymax1
458,330,813 *2E8A733DA6CB80C98470B76593AAAC6441B9C11C bu_t?
458,330,814 *2E8272E3B27DF58AB5999AAF3B361157440CE3B5 SGEKRITERIETS6
458,330,815 *2E85A9F657CE350276AB583E84A9E3DB0D348026 b!w-s
458,330,816 *2E858BDD72CC300CCF61200E0BA157F1AF841774 bycz
458,330,817 *2E88D8BD7150C9F30C700FEEEF720C9591ABEF42 SHAUNA.LENZ
458,330,818 *2E85A9ACD652D64E72553EB7462208B81D320ED4 C?%
458,330,819 *2E893E2F349965543F6445C518EE6A3F0099D7D4 shelbycollinson
458,330,820 *2E8583FA39B68FCBECE007DF13DD50A4AA8D6ACF C0UNTERGL
458,330,821 *2E848642C4EBDF153EB3C7593CC55B73763332D4 [email protected]
458,330,822 *2E80211C81C02D666549C049F33DC1E4111D395C [email protected]
458,330,823 *2E8455DF576D64C359ACBA892706DDBD4F567F8C C2MQ3
458,330,824 *2E8A5BF51C26261F8482D3BD8E6AD8429CBA5720 c5sdu
458,330,825 *2E8D2518AD4C120BB11536FAEDD7DEB3EE8D8786 cab"
458,330,826 *2E8BCA751416D3E342781C0443D9543FB5997599 skobatu5
458,330,827 *2E8A5492E3B4E110FAAB0B2566207A16A6B8E496 SMITHJERRY
458,330,828 *2E8F1B8D26ECD59B0FBFFA5E4953AB907EC3B694 CAPITANSES
458,330,829 *2E87B4C271320F85E7D4738BD4883AD16049BCE2 SOLONSESES
458,330,830 *2E86BFCD8CBA1ADDFFAEAE81204ABCF2575A4BC6 SOMMERFEBSW1
458,330,831 *2E87431C08FE3E5209E199BC732524FA7CC1135F [email protected]
458,330,832 *2E853519AECDB1D18FF621CAB0CA36728D6FC676 SORBUKSE
458,330,833 *2E8D55DC8C7F8AEC649AA5FBEA0C96133F82B222 [email protected]
458,330,834 *2E8C355CBD0184CFD2C10F977D56797BB5CD953C SPCTRSPN
458,330,835 *2E83C4D5884938371DB4BA2E639AB9264DF92315 SPETTATO!
458,330,836 *2E80FDBCC02D15835770EA65F77F3BC1CC6DC03A SPLOIT~~<Q
458,330,837 *2E854570BA327D8031FB3BA56FDF3C79796FA650 STETTYN8
458,330,838 *2E89F0C41A97B72C63D6C0A91DB0A5D2CC5F69A1 STEVERHERBERTS
458,330,839 *2E82A3285A186E5D20529BD8308EDE5E6EBDA561 stockkäfer
458,330,840 *2E8F6E6AF38BAB73F55D75772BC82A025BF01B14 suite for guitar quintet
458,330,841 *2E8064ADDAE47C587119F1F133CFD2F9313E2D58 chongklitzing
458,330,842 *2E8C6BF2A4289DEE7734A0305CA2012296A6A66B [email protected]
458,330,843 *2E8AA85C7F7B0EB68ACE0D4BFC6C75A2EFC8A988 CIBH.
458,330,844 *2E8E6F2B9BCF0325A87E91A2D909830E1F2FD201 SUZANNEBRIDGE2
458,330,845 *2E8DDF712355ABEBC0ADC7AC58790A009A1A9031 CI.TE
458,330,846 *2E8ACD57338DD1E464592C2E748EA820F8585103 civilwarsearchcom
458,330,847 *2E8CF7F26D64BC02BA4102DFC32F0652AB81689A cjgwr
458,330,848 *2E8C4D34E081BD6B462F99760BE6C079FACE77E9 CL9H:
458,330,849 *2E8670DFA7425459A575E550D1D86C9A33321A42 clch(
458,330,850 *2E806B820F3851109552013909B386762583CBF0 TAKEACTION6
458,330,851 *2E8320C6E721742AF7A675890C3C3A589ED13329 cl)sy
458,330,852 *2E832B5DC350CA98CE88C6A303663206D59A05B5 TAPEATSES7
458,330,853 *2E8B6D925BA547A19241FD00875DB79F876FE4E8 tarek.nageh
458,330,854 *2E801F4F4A2B0A9D2AEC5B659F714F607234153D c:+nd
458,330,855 *2E88BEE297E882AE1736993BE64660CAC3280BBF TEACHERRODMAN6
458,330,856 *2E8BCF05DF93086D0A6588439D97394F9B0CD43C COLEEN GRUNDY
458,330,857 *2E84EC67853FBEC86B54157ACF98F7058592A313 COLEMANREINECCIUS
458,330,858 *2E8B7EB4DF44AA3A04FE0EB7F06BE475FBEF2945 COMMUNNISTS
458,330,859 *2E8210A617C761A359CC77BAF9B3A456625690B5 concerto-grosso-no-2:-iii-moderato-(fare-you-well-dove)
458,330,860 *2E822DD348BF63A9CD454B01E7278BE3ED0F6AEA CONJUGATIONSES
458,330,861 *2E87E6F5BC71666F60C328B9E0BF41608A109FD2 CONRADKLUEVER
458,330,862 *2E8D144F906B5B06D2F9514611634DC622291EBA tfp2
458,330,863 *2E84CA3DB50B733072AB89277BBE6DFC2B4EEEAB thaddubuisson
458,330,864 *2E867789C24F2D6E98E561DB1EEA2DDAECDA727F Cookin'-With-Kazz
458,330,865 *2E86C4059D77224CA0AE641ECED8CDA545273DF1 THATGOLF67
458,330,866 *2E88E6CD930389EBD23E5A49BC0D6AF82DAC09F1 craignes8
458,330,867 *2E804D7A878C17BBC6688A7F56B465F1497D5FEC TICETTAC
458,330,868 *2E855999E13FFDAD1D54FA865809AB38EA55E35A tigerschapman
458,330,869 *2E8A38E88F34B9DAE727E9904271FFA3FBB1CE5D crmilton1
458,330,870 *2E8597C933E2B61C26693B6BAF71D42A0C244357 [email protected]
458,330,871 *2E843BD2C5AD3C86D8A1384E1F0DDA8BD9FF88BD css$p
458,330,872 *2E8818DD40E33BD633637AC1BD06E8B098C2DD82 [email protected]
458,330,873 *2E87F82C3762D87FB396068F7CCD3F91D40A22CF toiranok4
458,330,874 *2E8AB49D21916C2D6BBDF4099EEA6CF2902D1F13 CUTFU
458,330,875 *2E8E20D400E0A28B41558D46BC317F20A9EE8F8C CW0/-
458,330,876 *2E8AF703AB01AE56F5E33A4B2F71A669B47AB19E TOSSUDES
458,330,877 *2E8D3B814A41DE7682EE637C824A5FD45FF2735F C:\xampp\perl\lib\FileCachepm
458,330,878 *2E85593EDB1FFE3E7C9709ECC2F6D64C7B027CB9 tousima0
458,330,879 *2E83CFE5FF4865C1A0972A59B0D191B3CAA90ADD c=z45
458,330,880 *2E86BD0B9ACA58FCB653677A59F9B0D98C27B5D0 CZEREMCHA1
458,330,881 *2E80C9FDCFD5D496C984332099BA781D734687A7 d)?_.
458,330,882 *2E8A6EE0AE079F1C0DFE62FCC8A2902597F0777A treated
458,330,883 *2E8B4C287E5CB13ED3F12C5F663AEA0E55395439 d1in
458,330,884 *2E82B4DAAC816830E3C6F6E436ACC12A16286774 tryas-dewi-puspita-sari
458,330,885 *2E8808CA11BABC3F36C1E39C832BBB1093CFA46B TSDFAALSING
458,330,886 *2E8D4113941E990B48867089247635CEE6618AA5 tsusa-matsui
458,330,887 *2E88ECFEFDCBCF57FAEE627FFF60A608049F0032 D/a5
458,330,888 *2E8EDEF52475AD4C7F6741FE8FA60F55ED2FC8DA TV=AAA
458,330,889 *2E868148B352A29A80E17CBA9D083A99EC4557E7 DAS.HERZ.DER.DOLOMITEN
458,330,890 *2E82B790EE7D5FE16F9249EC32075FE2217006F0 umndcl
458,330,891 *2E890C5E79EDF35F17726F57F0AD12F0C0E0C67D UNGRIPPINGS0
458,330,892 *2E842B2EC0AECAF3CA2DBC276D80EB37E4D06694 DCPVI
458,330,893 *2E87F3B09AC33EF915A215F4ECB45947C2295FFF DEAN.MCKAMEY
458,330,894 *2E8A57D932499205E27FD4B59CB5842CC442C793 URONIHAPPOJA
458,330,895 *2E85E3FE507451C7C4F5356E22627F99AD3553AD deebenchoff
458,330,896 *2E8BC9205FB3D0A4F670815B0B6B2CD544D5195A U>SI
458,330,897 *2E8CA336798F1C3E9941F771B3F88AA8CB543311 delh.
458,330,898 *2E89F21590E867791252A429042BEF75836D6848 VAGOACCESSORIUS8
458,330,899 *2E8C3C2F4DF8B0F76DE6062D4214E90CC36EA5D9 VALENTIN.KUKLINSKI
458,330,900 *2E8A974A1ACD509BBDFF1AD42297FE2C30F21BF3 VALENTINO ARROYO
458,330,901 *2E8FC066BC8F23B31B87DE03F8548F6E79E0C8FA VALERIAB9
458,330,902 *2E8423682F704825F777BCBEFE8FE304EAAD03F4 varant
458,330,903 *2E8B262783F139A0A9156FC9E2EC5625CCA7DB46 VEENA RAO BANE
458,330,904 *2E89927E1EC2AA44DDFB7F1669D7B9DFA847081C VEGETABLELOVE
458,330,905 *2E8A29CA9D0BE67778E05E08F3FE09B87AA7B712 VERNONCT333.
458,330,906 *2E8183CFBB8A98636D4273EB3C1972BF39916DFE [email protected]
458,330,907 *2E8BB404C53F27248AC3E61694291081654337CA [email protected]
458,330,908 *2E87BF63566B6DBA37E26BED1572D50B67ADB52D d?jxp
458,330,909 *2E8A7F5F004F614625DC8201C794E62DF54A1990 DKVI0
458,330,910 *2E892EF17A471181B60C21F9F48C8BDB8D91B62E DOLPHIN-WHISPER-REMIX-10
458,330,911 *2E80B789A4364A4833EFD4695472948FEAFB017D DONNIEBISTLINE
458,330,912 *2E839E959A98CD5166D9AFFF4EA7EF0A63E35C3B vredebonden8
458,330,913 *2E88307323BB89907F55720A26C0D88A4D753187 [email protected]
458,330,914 *2E8304A16F170EAEE5C2EA8AF349CDCD799AFE84 double-impulsed
458,330,915 *2E8B99DC5B02DA130D53CEB218A70D741C8F250B Dr.Atmo&TheBasaltBoys
458,330,916 *2E820D4DA07CC54B5D72074219BD9BC44D432C17 dr:mq
458,330,917 *2E84FE1A1658E77F5E31960672BA5768D53901EB WARTAJAZZ
458,330,918 *2E8F0C5A0889E732459487E1128D397096BAE906 wayne-darch
458,330,919 *2E8B300C4F037EC88013B86689D7F39D7EA6653E WAYNE-DJJACKO-JACKLIN
458,330,920 *2E831664C01381F12D5E0DA0A956F58633546F93 d_u7%
458,330,921 *2E81A77047E91B3357AFC34A7D03CC7A5D6C4880 WENDYDANAHER
458,330,922 *2E85C23943B0B37CCFC811BEC0378AAA8B90AAA9 duohlats2
458,330,923 *2E806039BD3D9CDAF8D8788A62103729DCE63675 DUOWECTZEI
458,330,924 *2E8C163251FBFC2728D2E0D5D815157847458255 westlife!83
458,330,925 *2E8F8BF692D89A028714C9B822074AFF1DF289DD WH!73N$
458,330,926 *2E87450CF13B96D0BFAE79E51A48D9F8AAB7C03A dwain-wright
458,330,927 *2E88B1760BE24684333A54EE742781AF9D7BE7C7 DWIP(
458,330,928 *2E87A43FDE5A5CF5908DB6FEA6F45AA88E4A7B68 WILBUR.BRAMASCO
458,330,929 *2E8E5AB2686E926FE05BC7BE9AE909A3D55B9CFA dwu_w
458,330,930 *2E81A71901A66EB838BB06EE5B31AB48BF7F619F WILLIAM.TIMMEL
458,330,931 *2E83F73AB46E727BC7F7F3FE61F0959833AF5D55 earnestblovin
458,330,932 *2E831758D38DED23A9686FCB8C193ED2298B8CC5 eb--2
458,330,933 *2E8FCEBA3DCFACEC6B4E645EC5328C4F89F32726 ebad+
458,330,934 *2E80C659D8CFBD1FC634087BE2212DE55FEC8E24 /WKU
458,330,935 *2E8206107C6B3CA8DF50EFF6CDBF11835A95E676 WKUNPATE
458,330,936 *2E8989CDA86DB845B0EE32DCEE188AD3D9F2C329 WOLF1HELL
458,330,937 *2E848DCE684F2745AC6B8CCB619B25D9478ACA4A edjy.
458,330,938 *2E8C8B5DDC1A7803BD7D354002CEB4AFBDBFCF5B edwardhackshaw
458,330,939 *2E8B4639F62892A4D9172AC121757935E9A781AB [email protected]
458,330,940 *2E83CDEAE862FFC41960399827C08FFF400FA9B7 [email protected]
458,330,941 *2E8416A5E2626809BE2FA4409264FB72DAB41B0E www2lootcozawww2
458,330,942 *2E856D46C2372B7F1CFD91A3F5F2AFFA9912113D WWWHINDUSTANTIMESCO
458,330,943 *2E8DE296287B813237DF153489677AE12661177C wwwpienburgercom
458,330,944 *2E87100797FCE8907DBF48B272DCCE014181D347 effacing
458,330,945 *2E8C1E397CFF5110895779A7ECB4DA2B2BB4A148 xavier.couch
458,330,946 *2E8BA7166F21CFC958E80933AE81789EDE2FE675 [email protected]
458,330,947 *2E8E08AD42D47B3B9F4375D8EF43057B60A4958B ELd+
458,330,948 *2E80DACEF120DDCFF26C92A45195FEE8EB8256FD [email protected]
458,330,949 *2E88DDFC4D4CA723E03D4AFE365EEAB43572D2B8 ELLIS.BARRANCA
458,330,950 *2E8A5D080ED8008D0D2E5A9AD8CF078503A4FB3B ELROY.DEEKEN
458,330,951 *2E8BFBD651C8C361CA9231FEB8D854FF28C966BC [email protected]
458,330,952 *2E8DC8DD3BFC7DC4779A16FF4547D8C1083A4D2C XU|N
458,330,953 *2E815BE054BE9936D619D23916236F5C72877FE1 [email protected]'
458,330,954 *2E8138AF0922B5B5C95E761BCD806F0E61D31670 yaeli.pressner
458,330,955 *2E83EBFA3E13C8EEDDA634458336A38CAAD8963C emilhouseknecht
458,330,956 *2E8289B8BFDC99178CC21E81035867A75ECC2C02 YANGOLIVER[email protected]
458,330,957 *2E8D18CD7B427A0167CB9D2AE04F11C8384F60DA EMMA2NICK
458,330,958 *2E899150D9582FA963BB5CF8BD5A2D71D25B1870 yc)
458,330,959 *2E829A42F89AE912EA86E3F3DD4483E3A4C4DE40 envisating
458,330,960 *2E86310D247C2114D0892FCF0F14A00978058A74 [email protected]
458,330,961 *2E850783437C3793AF3146269B4CD307C42BDA3A YIRANPENUH
458,330,962 *2E864C95C8CEC9072C85C5988FDFA5621DEEEAC7 \YM.
458,330,963 *2E867F08AAFE775343C690179C7736B532080414 ERIC.LOCANTE
458,330,964 *2E81D2C1AD75CE9762A677BF85072DDB8970458E er+p
458,330,965 *2E8561E27F4CD1C7423B4EE56718360A32BE7245 yriesiek
458,330,966 *2E831DD84A8E835DA4175621A41C8A08BF303A8E YUSAIDAENGGANG
458,330,967 *2E8F5648312155C3DFA54176D10BD5964E732EFD ESTICSILLAG
458,330,968 *2E80A0152FB5EDE94B0BBF8728FA883897B7ECD8 yusufu-atama
458,330,969 *2E8C22A413D305FCCBEFD91EA34E1F8BCDACB28A YVELINESSTAR,PART1
458,330,970 *2E8812E07E346796C0A008CFAFEA982EB1C72C17 eugeniothanpaeng
458,330,971 *2E8B88785ABAB7314B1E661B02BAB99A23D975EC evelyn1978
458,330,972 *2E8E58B90F56D189A73E94B89CF4A719B0D10C85 extenuerent.
458,330,973 *2E88802160DE2C94872A3B1074B09D1088E3EE15 F152656
458,330,974 *2E891A31348687109AA1E3A14F5713E678A0C3EE zacherystady
458,330,975 *2E8AD878D5581092F4F4B11A22DFCA318F727DCD zara-clubb
458,330,976 *2E8111EB27E7AF89DDF4AEA27EC370EE97D0693E zeisel
458,330,977 *2E8E1C8380E8CE0A9B2EFBF5DDE3E3F9B1A80AA5 [email protected]
458,330,978 *2E8E954063D1D1E30A83170830EF79D0770D7435 [email protected]
458,330,979 *2E8F0970588D6F65B1B6A80163AF3DE4A95A73BD faustinomarvel
458,330,980 *2E86A79471D8ED60BED946CABA8D0F88D7EA3F23 FBA3481E4C28D59B9260D68CD3D45414-TTR04DST3R
458,330,981 *2E82AEF15CE331270FB5338E49D653C648998291 [email protected]
458,330,982 *2E8A8395A8E8137B699866D2AC21BA8EC214CBB9 ZHURUNKANG
458,330,983 *2E896C1D9B787EF91DBA140EC3DD00228D323CCE ZHUTAITU
458,330,984 *2E8E204012398C2E85173B5143CE844010CFF6F5 feilie
458,330,985 *2E80E630F8101BB63839FF6DBA3EE0F47457ACAD ZYUKURAN1
458,330,986 *2E87D5DDF264DA4C05C32186AFD937C8C4C91E5A FOREST.MITTAN
458,330,987 *2E8ADAD0F7965A2914F287320CBBB80775FBF9BB FRBBNDSPL0
458,330,988 *2E8AB56CAAD108FE0B1AFB44D2758BA3BEB79709 FREDDIE.WELP
458,330,989 *2E8FE402529470EDD771EBECCA9EBDF755F17F8E FREDRIC.KINGSBURY
458,330,990 *2E802CF8C45F8DE332172B6CBB5645D749642839 грошовому
458,330,991 *2E894F18D5EB5D2D15FD5C9D1EC3EBD374D2145B [email protected]
458,330,992 *2E83F2AAFEB67314B24E69EBA65C7378F64873F2 ЕЛЕГАНТНОСТ
458,330,993 *2E895C3A0A5FA8FAFC1B7DEAF48894F736418125 еппісом
458,330,994 *2E86BD7056A8B98A65566ED3BCA3151BC7C4DFA6 garrick-richards
458,330,995 *2E890B3ED3BB66E92483B76A6BD10FE20461F94A gastonchristoforou
458,330,996 *2E8C2567B3E9DC91ACD466F0CF3DAF450D7C4E1A gayla-rapp
458,330,997 *2E868B767F48760C6FCC92901B0DFAA81CB4ADE8 ИНТЕРЕСИРАЛА
458,330,998 *2E8D2F82DF93A95787562C63CA4A5B56F86C4154 G!C<
458,330,999 *2E8C296AEDC6F0A2BED7215B210701DA97B89AA3 РАЗДЕЛКИН
458,331,000 *2E84B553F06BC184CDBBFAB6A5D116C4B27DE79F РУСИФИКАЦИЯТА
458,331,001 *2E8BA61EC4AB706C2099454554DF5C774D76636F gefaelschte
458,331,002 *2E8D4C1C1B52C69BD44A65B6667B52B62529E7FC GENEVIEVEBRISSETTE
458,331,003 *2E807941C8A679F432B9699D3EA5EE486818F095 georgedimsdale
458,331,004 *2E8D8E61F5E51D011D171CB41FD5DB6537230B16 GERMANRENZULLO
458,331,005 *2E8F367C4123D11196267E60AEFB74D249C19EC6 GERRY.SIEN
458,331,006 *2E84C7C552D33C3E5FB7785FCCC0863F3D75CA23 ТУРМОЛИНА
458,331,007 *2E895197B17B4AAC6587FD0BD324648AE3019377 gevolglijk?
458,331,008 *2E89425DA9D9B2853078DE2B103BACFFC2CA1CC9 GMBROAD
458,331,009 *2E82E141C7BDA4A1E855BD097DB3520804290BAA GOHELLO2
458,331,010 *2E8F99AD6ED23305A7985EC468B4919468773812 可是,這次出版引起了世界各国专家對中國建築的興趣,其中包括法國作家PAUL
458,331,011 *2E8779DB276ECB0243FFDD5C3E6B111DB127A744 [email protected]
458,331,012 *2E8D34C82AA2CD9D6A041215E26D016884ACCE5E grantvanconey
458,331,013 *2E8289550803092ACF32A5B079279DBA5AA8F4D2 GRAYLR
458,331,014 *2E84C9356301396E65F8910597F454A5791B421D [email protected]
458,331,015 *2E81E217BF4AD6793E46E7E95984FF95BABBA7C0 [email protected]
458,331,016 *2E87B95E87F7E1B9E5AC2B36769242712D935605 对MICROSOFT的VBS
458,331,017 *2E8339E0D483C54C75F219A99FBC05ACBC4172CF hairowett
458,331,018 *2E8F984444959F9ECFA400E526340EC4665769C8 [email protected]
458,331,019 *2E80B71CBB6E3219F375F20EF9AA5559902847CC HÅREK
458,331,020 *2E860247C106A996553962A2F1446AC76F47422B HARLAND.FLACHS
458,331,021 *2E8E32B1C6CB39A403C16F79DF7CC202DF384A71 HARRY.SAAVEDRA
458,331,022 *2E80E8D56E29266C7E0E971A0E2FC9A2AE8330E5 HASSANMOMPER
458,331,023 *2E8579DBC0F982FCC6A68A7B4F6C5601B4CD9432 hatbox7
458,331,024 *2E8BF0D8B02DFEE8E3BDE3657BC51DCA5C691EF3 haylee205
458,331,025 *2E841678F11BBBF33B43B36568ED625FD993D8CC heb'
458,331,026 *2E805E6283D7FF9426323CE92261EBB6377C5E1D heenehan4
458,331,027 *2E86D0A85E4149E189CBBDFE8A003DBCA9BE10AF [email protected]
458,331,028 *2E8E366345AF44FEC1B6020F572C4DCB9DD8785A (0-0)O~ 0~Q#P
458,331,029 *2E801747A94DCA6D16EA962EE3199D8496F7F6D2 02AMYA
458,331,030 *2E8E507D6198BF09508FAB657AD7F585915EDEFC [email protected]
458,331,031 *2E84A830DA9C475D52041FB3B25BFBED9115A640 HONGGUADAGNO
458,331,032 *2E848357F75453BD057D0EA9408C397079A52626 08191866
458,331,033 *2E8F3B9B77A84ECAD85D68F5194BD1F2ABEF7B5E houterigheid!
458,331,034 *2E8C385BD89838A3E4C88B43742BA051FBB65994 1056534 liikuntavedess
458,331,035 *2E8E2BB6E54C49093DF502F7D1CE55A35B911F36 1061543 ANNA.VASTAUS.KAHDEN.DESIMAALIN.TARKKUUDELLA..
458,331,036 *2E8886C54989C82ECB350D0AFB9F13043F7B4E1B 10C41$M
458,331,037 *2E8C96CE7767FE0F0FE94F06CFAF8D940722891B HTTELEMN4
458,331,038 *2E895CD43634B981FC068746C2AB96EFCE647512 HUGNATAN’S
458,331,039 *2E850177C11ACDD97D309431853CEE3280DF158B 1260802 julkisyhteis
458,331,040 *2E844C093054A68A4CB53393118DE199F2626CF4 1280137 jossinullaontiedossajokinhyv
458,331,041 *2E8C5A7B7E385BF4632477DD4A7C00EBF0A412EA 12SEP1585
458,331,042 *2E85FDFD77145B301AA7270B11024F5B4802AED1 HYDROPHYLIUM
458,331,043 *2E8E82BD708C31AE8D643B6C5550F2B18708DF50 143060 OPINNOT KEST
458,331,044 *2E82A0DE2DCE8CB7796E50C51C25D2F57E8541AC 1436372 MARIA.
458,331,045 *2E81E904CD46CE28DCDFC7517FCEC6E61974D4BE iambradley17
458,331,046 *2E8F5553A326D3FE96F40B82551932E700E17DEA 1660875 DOCH KORRIGIEREN WILL ER SIE NICHT .
458,331,047 *2E85A09183B89540310A8BB560366CD601674F0C 173445 IM.HERBST.WIRD.DIE.ARBEIT.BEGINNEN..
458,331,048 *2E8544D67AC829984456A08F54A42C89F7BF0D70 1895844 kolumbus.otti.kaapista.rommipullon.,.miss
458,331,049 *2E8DF91C85BB443BC302582F6EA7F57F207C8B99 19853011
458,331,050 *2E8E2E2632906AFBAFC8998AFFFD92AAD6C71EB6 IAN.SEAGRAVE
458,331,051 *2E8F7FBBBE4A657BEEC770DD8C98A4D6A7063114 IASSECOR6
458,331,052 *2E81A1C9DC374F2006548758BD4A41FBB7DECF8E [email protected]
458,331,053 *2E856A50916F9725D41F9F96811A09687340E327 1AUTOMAATTIVENTTIILEIN
458,331,054 *2E8B7A11E61191D54550805344DD247EBCDD04BF ieltsine
458,331,055 *2E82FD0F40EB5598793017E7839EBBA4384322D9 1CLIMATISANT
458,331,056 *2E8F2F0041C11ABE52B30E9BC62E94FCE695E83D 1emelfm
458,331,057 *2E8D8FA5E647D5766C9C3D4160B5A5BAD1E278E5 1 erityismenettelyll
458,331,058 *2E83640A18B8262D778DEDA1B8F4BDB5F4635396 1-erotik-filme
458,331,059 *2E8C4477DF3A968A2C8463C0FA4155666AF52B87 ILUVCHANGEIT!
458,331,060 *2E82E30702BAC064AF31BB0CE9949DAF4E1DEC38 1gyascutus
458,331,061 *2E8D35A587013CBAECBA0EF0D7B19C263336023C 1IMPAL1234
458,331,062 *2E82DACBC909ACB986A8A680049DB677B7417CC9 1.koh-teet
458,331,063 *2E8EE075FB9DFBD49A796AB612183C395AAD0A8E 1-MAC'S
458,331,064 *2E8C360C57063FDA3F5A1B103F0F9EF590CA9CF3 1 MINI-BREAKS
458,331,065 *2E83EB39A65C33BAB635C0F0723BCA20DD80188C 1.MOOTTORIKAASUPULLON
458,331,066 *2E87E8094D4BD30BED6DC8625E84135B8CCB8DB6 INDIA-BRIEFING
458,331,067 *2E893E3F3E44A60FEEB3F6417F4A77DF474B57A6 1pepecabro
458,331,068 *2E824B128640AFEBFFF3C8DD44BD14CE04509D3B 1Q2W3E
458,331,069 *2E83426E80830BC5797B91B09132CAD6C86CEEE8 1RINNSTEINABENTEUER
458,331,070 *2E80E4649E6D1826DDE5F65154AD1033D3F71F57 -intaglio-v:-intaglioed--intaglioing--intaglios
458,331,071 *2E890C2187402208E7782208DD828A96A885F346 1SCHOPPERS
458,331,072 *2E8E9610FEF8CBF08E36F895D1764E97AED07A95 INTRO: LA PLUS BONNE DE TES COMPILS
458,331,073 *2E8E877A298B90A08E6B95006E2CDFB9812E5051 1 syyhyl
458,331,074 *2E892DD57BD02C40CA4182FAA5EE239BBED332EB isabellebusiness
458,331,075 *2E8F56809B73E4C4A86CA7B0BE5D25316EBFACC5 2002-09-29:-austin-city-limits-festival,-austin,-tx,-usa
458,331,076 *2E87CD155AE1B808B06BAF45CDA169D05A2D3588 2080541 WER-IST-DENN-DER-RIESE-NEBEN-SABRINA-?
458,331,077 *2E8E43BAF11821B1AC83AF3854E6FBAA86A9D418 IZMIRAOL
458,331,078 *2E850302FB8B581A304423BF79E17C4228211746 J,?
458,331,079 *2E89BF4C79F1344AF74D85483E3E06DC3E10ED5B 2183105 aircraft issues were mixed
458,331,080 *2E86FED09A1F76FF926BC17F3E4FF4C1A6C5F3DD 2249321 se-on-suurin-n
458,331,081 *2E8375D4C7046873E4B816D0165E6AA2F03EA716 2285077 SIVUILLE-LIS
458,331,082 *2E8238E3B5B5FD18A7EC52F4FCECF79BA2333551 JACOBWELLMANN
458,331,083 *2E82D3AEA04794CF901FAE487EB3B24E056DF003 2294980 VOR.GENAU.EINER.WOCHE.STARB.ER.IN.FLORENZ.AN.LEUKAEMIE..
458,331,084 *2E8961835378DD890CAA428CD934CF61711BAD98 JAIME.SPADLIN
458,331,085 *2E89868335C9F6FECE9D45C3F8062E36DDFCCF46 2541112 sie.koennen.nun.investieren.und.modernisieren..
458,331,086 *2E839E7389D0B439FA400C8EFC40D967B5DB8489 2579239 about2,000havecomehereduringthelasttwomonths.
458,331,087 *2E8952B96246F107E97CC781E1B192A8C08C6065 26-08-56
458,331,088 *2E8AFBE307680985B2531C91380720174371884D JARVISPATIENT
458,331,089 *2E837B113A0B7FFC90DE17F3440370E48EF4C352 JARVISSOBESKI
458,331,090 *2E8C9D318BA26F30F66171EB9069961A839061B9 JASON.CARMEL
458,331,091 *2E8DF6EF9BA059C984D9E98774883B852DA77446 2632970 MIGREENI:MIGREENIONKOHTAUKSITTAINENP
458,331,092 *2E84F20DF6C229A0094B0F7375C0DA032ED9DE1B 2779820 the.price.was.up.2./.32.from.late.tuesday..
458,331,093 *2E859D1F05146D26C62BC37314EEC3151D0DBFDC JCUSTOM
458,331,094 *2E848B0FCB9C9F52644EDD7E909B859561023AEE jeffrey.mccullough
458,331,095 *2E8EF4BB6D82AB5D042447477C10E205878CB83A JEROLDVANEYCK
458,331,096 *2E83E121839A22A1CF84CBA534546D9BE6E5248D 2ESTENPIV
458,331,097 *2E82D76C0D605852504908C9E64EA07B15CC9FDB JERRYTINKLE
458,331,098 *2E88CD521F7CF0FB87117092E02A222B02AE4D1B JESSIEDEVOST
458,331,099 *2E878870A9695F0D686D203D86F79BBF47DF55C8 JESUS.SZANTO
458,331,100 *2E88C9698081965E48D20911A1E7E3242A89A393 [email protected]
458,331,101 *2E838B9E97E26A55F981FC1CE09C250EA1DFE29A 2-HIRSISTEN
458,331,102 *2E864FF7259D5785C4DFE5F734E58E9DEA7283A1 JINKYUKWAK
458,331,103 *2E817F40253CFA2148E02FB4CE6FCF9951EDFBDF 2.KANSSAVAELTAJIA
458,331,104 *2E8828F3DBCBC714E52B111EC2105DD9371B212A 2-kaupunkilaisnuorison
458,331,105 *2E8376039C3F88399138C0B779E77B2910C974D7 2KILLIGAN
458,331,106 *2E8D5900914D73E6DC6B7BB3B846AF8DD6ADF1D1 2MOTIVES
458,331,107 *2E85A84BB64AAB573CD107143BD8FEC3D504FE06 2RADDALGO
458,331,108 *2E89020ABFCC184C9112910FC50EB33CC260B417 2-runossakaan
458,331,109 *2E81E199BA0FCF8D5DCBCCA74670DCD8C7603D5F 2SIIVOUSPALVELUJEN
458,331,110 *2E823792876E7CB5EB91264F56BADCCDACF604E3 JOHN KATHMAN
458,331,111 *2E80D3DDB549A20BA8E500751DAF0D219C41991F 2thefriend8
458,331,112 *2E85D14F3B8D379931C3981B91819B5C0666F0DA 2X08
458,331,113 *2E8B77AF3AE92CEE0C4949A2AA88C1B94C8DB7ED 37roqia
458,331,114 *2E82853D38EAD1C8F40A73F39C3E0AD1E9AFA432 JSOKIVETA
458,331,115 *2E8FAEA3D2FACFAFD7620361BC21F90761BC884B 3B<0~<######8
458,331,116 *2E8701B68FA36E42DA294D65B49A986AD61877F0 juliandowns
458,331,117 *2E86823DFFD137672B7BB0068DF4FC4CD9AFA6D5 3###d-`{x}
458,331,118 *2E828749F3EEB8C37828727A80068826DAF66EDB k0g$altet
458,331,119 *2E89A11B996A16557D6305B4209D6E870EA9BFF6 3international-the
458,331,120 *2E8A9A436EFCADABCD8941FBD5D807B42BC95132 3KS3T
458,331,121 *2E81CDF17DF9ED0FB3FE699B85AF0729D5843910 KAHLENUKKE.RECORDS
458,331,122 *2E8E1E40690544DDFC102F4870C1A69B695ACF5F KAREEMDELONGE
458,331,123 *2E8626DCA7AC8E6FA6B7051A85A0A63CFA6F1AD0 karlbarfield
458,331,124 *2E89C4A0EE6719F29B77FD38D10B968E76A11F80 3thecunningham
458,331,125 *2E8D22528FD3D4ACF2C2DC674BACD7C89FA9830C KCXG
458,331,126 *2E884F3B0B7604953C81284D2E4D5679B8D321BA 494422 gysi war mitte november am gehirn operiert worden
458,331,127 *2E8C64FA5DCC7496ACDB0E730AA28CA4AE9E1A4B 4BIGCASH
458,331,128 *2E83158ADAFEA42674DC8EFD87CCC84CD5939811 4CAESARXXX
458,331,129 *2E84D94CAEA193169054E76583BB35C36A7F65DB 4EZIVITCA
458,331,130 *2E88157533B911F0DA14C82F7AADE02805189B6E 4HAYWAGON
458,331,131 *2E823C7EC87C7DAA59464DD16F61CD865C647940 4IMPEDITIVOS
458,331,132 *2E8C76157AC3EFB1F8A754343F599F8CC533266B 4.maailmankaikkeuksia
458,331,133 *2E85C304DA6768D4054573992F80B2A33D940C6F keenandawber
458,331,134 *2E82623725E9A280A357B173EB490FD21BB2C97F KEITH.BALCH
458,331,135 *2E8D44B08B2BCF786DFE7471D850B290E9BB89D6 kemstar:stella
458,331,136 *2E85CE997DDF18496882F4546B818D95BD9770C4 4.USALAND
458,331,137 *2E86DFC7C3F07F6384803D65796F78F9A45966B3 514498 silloin.avuksi.j
458,331,138 *2E8481EA158ACA6D7FB118A52DBAA560506B8628 KIMBERLEEST
458,331,139 *2E894BC284B2F22D3785F7976DA7DA75BD1E5852 5BEALLTUINN
458,331,140 *2E8E89BB5E9A0A25DB7C35FF38740207D42E37B6 knights56
458,331,141 *2E8305E8F835D546930AB58C51EFF8034A4E743D 5loszinnigheid
458,331,142 *2E8423C58E2CC1CABB5E4A17568B752E43975BE7 kuttiming
458,331,143 *2E849E18F286B8D76FD181F78642F71B44704FD7 5PERRYBINKY
458,331,144 *2E81886DECFA4EFF8E51505A3BC39382C7709BBD 5RAINAWAKENED
458,331,145 *2E8DA1E2AAE3D42476940F7CFC2AA3C103EABF70 L6887749
458,331,146 *2E8E4652992442B2653F62130D19BB7463D549F1 l\"aaa
458,331,147 *2E8E1918E48024EF1272CAED95ED87B864DE2FC7 LACESSAS123
458,331,148 *2E8DD373EBB7716EE85DACDF5FE672C25F33B675 [email protected]
458,331,149 *2E8B16BED9449BA422031111E8922232E807B2C6 LANX)(*
458,331,150 *2E8B94F5CE4484FFBFECF41FE18831F43FAC723B larenztatecom
458,331,151 *2E8630B9B51334DE5366014FE6436418E436CEB0 LAUKATA3
458,331,152 *2E8A8F66C101144E41BC54B6D646CF0A92A46DC2 6CANELASANGO
458,331,153 *2E89F3276F990E86EA6B3AE7C275DDB6937EA9E7 6CAPACITOBSW
458,331,154 *2E8645B183FDD40FC07068B2946E2CDE1C5EA1C1 6CASHOBSW
458,331,155 *2E8C429083A3B8E8B584F4FB92633DF0CBA08F6F 6COUGARSTUCKER
458,331,156 *2E8E628021FCB7EFA017304C09664288A6158EC7 6JIRANEE
458,331,157 *2E8500DE799A24FE2706C9801C4CD1B2E4BB818E 6KILLEENN
458,331,158 *2E87CE25E58E666FDEE37BE04F5467C1462FD3EE LEONEL.THOELE
458,331,159 *2E8ED8BDCFC512A28FD2925B58BC2F102CA800A6 LEON.MIERZEJEWSKI
458,331,160 *2E8825FEE360A743163C8FE607315CE23A90FC3F leopoldovarma
458,331,161 *2E8FBFF17E131B1E8E0EF4C5F509E6E8B7C8082C LESCOMDEN
458,331,162 *2E847BDAB7AD9EE94977D917BB88C8A1F317717B LE SOULIER DE LA MORTE
458,331,163 *2E859715A78E701D5A38E9DC1616518C5518B9D4 6OLBSIURK
458,331,164 *2E84B6F624DCB36C1B8E65BFF23CBC9C114FAF2B 6PTIOILLE
458,331,165 *2E83D9C9C3B379271A04A08790DE5FDD41D0A192 L'Habit-ne-fait-pas-le-moine-(interlude)
458,331,166 *2E8A871BB3FB6BA8CA9326B783F5A569FB4EBDA3 [email protected]
458,331,167 *2E8E1FEEACE4CFA0620D4E5AB804D861A0ADB4F7 6ROOMTERT
458,331,168 *2E8D31FF9DB5E35651BE07F21B5435401960272D LIBEXEC8
458,331,169 *2E8FABA4D938ABF81B403225395BDE86B2E94310 [email protected]
458,331,170 *2E86B8D4977C38AA4635C91F60B6B7E4C60623F7 LINWOODBERGH
458,331,171 *2E830BC866CC4E797F64E7B9DB2520B04BF053E2 LINWOODMATSUHARA
458,331,172 *2E81C2306E835B0EB5E8E3220B4CC79EBBE5D1D9 7AMYLITTLE
458,331,173 *2E82BAB330F44CBFE7D2761E2B77B954D927B98F LITTLE.MARTHA
458,331,174 *2E8D3579969C5397FAE4B554A22F2A53F0F989F0 [email protected]
458,331,175 *2E8E5D804FA40520AB423424C6AD188920840208 LIUSUNGE
458,331,176 *2E8B55F0410CB4B9CA256E4CEBC00915E351AA65 livgren3
458,331,177 *2E8F10ABE0D4001FA006246CA7003337FC092E89 longland’s
458,331,178 *2E8FEC3FB13E81FEE707F3BA6DD4767284EA7154 LONNYPONTING
458,331,179 *2E87C8E8D0D66FB3865FECB57B14F484033F9F39 Lord,-Help-the-Poor-and-Needy
458,331,180 *2E8E855B2AEC12DE5714EAC7FFB6248F19C728D9 LOUI3BOYJOJO
458,331,181 *2E85C298FD574B527B91178B7322FAE735205668 LQE#
458,331,182 *2E8BCD08BF3CBAA0DEC977F0B2CA1E4A01A8942E 7TREMPELTAGE
458,331,183 *2E874A5C1F288BC1709B44E1551FA4D0F5BC5893 [email protected]
458,331,184 *2E87254359FC77CBD8511094803C1A67A0A44715 [email protected]
458,331,185 *2E8D2EB915B48FAEA92B59E004A9C0F80E10FD71 LUVME4FREE
458,331,186 *2E81EF3B4BF4FFFC585A1A837FEF7E37E8CBA5EC macproto
458,331,187 *2E86836E0D3A39C5684435CABA74B0D697DD60B8 mai-el-dardiri
458,331,188 *2E810D198BAF433F5ADC93D29E4E5F7AD0208B4B MALCOM.DEPAOLI
458,331,189 *2E892CF4F3B49591003AE7CF0B67A1C93E8F089F MAMA'SROYALCAFE
458,331,190 *2E8348AAC107D8815EFF375FEF17C9CD5D1ED4D0 8DRANKEN
458,331,191 *2E80264C70CB773CA199D12EDEB284B30E945480 MARCELOAPPELING
458,331,192 *2E8DD4FF86B6D8D0433413958C6A4E39F6279793 MARCO.PINNIX
458,331,193 *2E8FCF8C942F1F2B8F16BCFFD38F370971223DB9 MARKEDMISTER
458,331,194 *2E82EB053B0C134F140F0D39551987E05DA1CEA9 8KILFUDDY
458,331,195 *2E84D7A4407465113D355CF6B1E9A39EE12496F7 8LUDEZLUDEZ
458,331,196 *2E83034E5CA68627922F1085636E8902267BF3F0 8MONOCHROMATICFILM
458,331,197 *2E81943465DDCFC2B839A5535104737F8B4A6A9B 8OSTHANDE
458,331,198 *2E87EBBD4699FA6A4AE29FEF5DCD7C5F7A8B4367 8====P-`(~_^)
458,331,199 *2E83D6DEB45735833217042650EDE63CA12C3655 8RIPPERPASSWOR
458,331,200 *2E8382694C7C4FC6BBE0A5DF4D2A18DC88484258 MATZKENHEIDE
458,331,201 *2E8C58F43E381309F8A1D790C896B270E2DB3FB4 maurice-desrochers
458,331,202 *2E85DEDE2569083010D635D66C452538D5EA1B94 MDBELAETH
458,331,203 *2E849C9A1E30C374540ED12D789A918D5918AE7D 930--------SEE-MAN-REGARDING-A-COMPLAINT
458,331,204 *2E8EAA3BC807A6B5201D1E1605466C5047E8FB5D 9621_SWH
458,331,205 *2E814FF4A23AE5649772E5688A4EA77AF60CADBD MELISSA.L.FLETCHER
458,331,206 *2E84EF8F0B3C5AA227B8124508E5872B64BAB687 MELPILARSKI
458,331,207 *2E880DFD0AA5F85E417377866D8FFF2C047771F0 9ARTHROUS
458,331,208 *2E8500D6B6184AC19990E73DDC1A26F894BBC612 MERESCHKOWSKY最先提出
458,331,209 *2E869A64E04B101B1AA1775C21D08D659623513F messa-di-i-vivi:-kyrie-eleison
458,331,210 *2E88F71B1735ED8FD99F3D79091538E89051644B micaely6
458,331,211 *2E81B0C08E190DC74763773F113C0A7C2F8EE222 9MARSALIFICATA
458,331,212 *2E8DC1E0D0709AFA565E8FAE256888D075FFB30E 9MERKITYSALUEET
458,331,213 *2E811B5FA0B50368127CBEC004174A4F69BB6FAC 9myconfused3
458,331,214 *2E864C01DF9697F6FB3CFE818816153E73AE5D54 9partisans
458,331,215 *2E80DDC5FC4A48E3BD4A38F156A00E926EFCE523 minhroquemore
458,331,216 *2E87FFFCA2D78F3B45002612458C91E6C6AD2E2B MIREILLELANGLOIS
458,331,217 *2E8E0BE12AA4EFCD062024F5EE976CE636AFF7F6 9TAFFYTURBO
458,331,218 *2E8A49B3F2260075BD8E5430722E28B48B2F6102 MITCH.CURT
458,331,219 *2E8724B9C349FCC1527A042BC090E87CC1715AF2 MITCH.KITTELSON
458,331,220 *2E8906DE6D765DB4637CE121C32C0211EE3A5DF4 9XHG6RV3
458,331,221 *2E8FC87C30C92144E602725A8413BE972B6DB97B a2dhb
458,331,222 *2E8285FB1A73868F3742E7CE91ACF7DCCB129D17 a$#)8
458,331,223 *2E8A54812EA501C5FA65DD355B56E1465FC78AFD montanadiablo
458,331,224 *2E8162AD0ED8A9B81BF2F1569020EDA7D028D5D2 msgoodiesblogspotc
458,331,225 *2E8D0EE2B6E9F2B718348DDB7EEC8FD58AFDEB4E MUCEDINOUSMUCEDINOUS
458,331,226 *2E85894B1FAAA7EF96643DB144910C6F30E9FB6F MUGGIERED
458,331,227 *2E85B35B155BCFA49E00D78E16A6D2149BDCE937 MULTISTO7
458,331,228 *2E8A8EDD0D0C5FF8AB79476F747DF1ED860BC25E AADGM/
458,331,229 *2E81E633A30FBF85A88198197E57B844E7115CD1 AAD}U~
458,331,230 *2E8B6C2CEB052CE24AD3E4070496BEE5DCF08448 NALV
458,331,231 *2E8A939A68A6C105A2324F0D7FBD0F4C2607FA23 ABSOHM
458,331,232 *2E81AC00DF4F71E345A007D3ECED19D84057E3A0 ACRX$
458,331,233 *2E821EA515452795ED93FF1D96EAE521B6B69A69 ADA.STEVENS
458,331,234 *2E8F141D6C388498BE49EA6F6FCFC0C1873BEF80 AD/EY
458,331,235 *2E877002A90A62AEB6A5ED6D9F38A79F097A75B1 Ae)G
458,331,236 *2E890DD9D2C6332AB44DA83B2912488C4A33877A AFGEKRASTEN4
458,331,237 *2E868F566CB9E1623B842CFB31B85538B1DD1A3A NONDECIMATED
458,331,238 *2E88A13F7671EA63002BCFA8B3F7552A2C20DDA1 ahal
458,331,239 *2E87BB060E786BB34D49739DF8022A2030E9D92C akash bhutush
458,331,240 *2E82900BF792438B4402B27163E9CF94C482B4F9 ALDEN.ORTEA
458,331,241 *2E86191C58B0CE7D4BCBF8530687CD5ED2301680 ALDOSURBAUGH
458,331,242 *2E8C216C8440ABE7B8E1C47E48447AB900A25D9D alejandromarkman
458,331,243 *2E83A6513D4E1B8BB1D306B6B9773469BC9C5554 odpovdt1
458,331,244 *2E82C8A52E0E6CE0B40DAFFCAF7D2333B1BF461A ALEXNISHIGUCHI
458,331,245 *2E8C6F70DB2E766AFEA3FD53824D489DAD49A348 alexprosienski
458,331,246 *2E81D16424D917F95F8760A472A8D88F4F215AD6 old.sad.songs
458,331,247 *2E8359D7119B5F163522EC3D3888399776A75A2D ONE MA YOU
458,331,248 *2E861B93303B1C1BFBA7DB4E5187BAB48E4198FD allopper3
458,331,249 *2E80D589748A065B97790E622A01DCC457B69D72 orenyum
458,331,250 *2E811867CFFC1068A55A160EEB0A31258541CF99 ALTON.COYNER
458,331,251 *2E8A7DB9F80E6A7D196CBC6BDC6182D62BACAF44 OROTAKEM
458,331,252 *2E88146BCB8952DC861E08CFC4387D73ED7AB5F9 alyahudi
458,331,253 *2E8047D3FCBDC8138F52E9713E11BA8796FF5C65 OSVANUA3
458,331,254 *2E8771E21B919D84A5940DC9F06F06479F63C026 AMP0000000000044104
458,331,255 *2E838152640194A5106A8211E58723E7894C8B58 ANDMILEAGGM
458,331,256 *2E8F5B1E7BE3B9E17227F90CDEAB7F8871B624A3 andree.tremblay
458,331,257 *2E8560D5A879A4C828519CCE9ED48A3ECD2941E7 ANDUIN.-.THE.GREAT.RIVER
458,331,258 *2E81BCC2F5E27324DE6D0695EBC5FA55C1538769 p>~~;)
458,331,259 *2E8AF9AED055E242A2F043C0F2406E58081BA567 P9&
458,331,260 *2E8775C6D7BBB214E74892AFD17809A455D7CA93 AN:QI
458,331,261 *2E848316FD464C01963A508D9BCEC44F3DA8EBE1 ANYWAY (EXTENDED MIX)
458,331,262 *2E80A167F0896F8490D43B2CE4458D372ECEBCBA pathofthehollowfigures
458,331,263 *2E87BB369622019A7AD178A95FD18D4EA058DB8C ardendelamarter
458,331,264 *2E80873FE9EF2BE82F245A293DEBC0CE3BB1F012 ARIZONASUNBIRD
458,331,265 *2E8A4E0322D3DD2A3D1C347167438AC074706902 arnavutçayi
458,331,266 *2E8572931DE7A1964885D610A489A1C3B20E5CB0 a,r&o
458,331,267 *2E855EE05FF74F516261111B0EF2EC836723E143 PERS0NALIZE
458,331,268 *2E87394CC6D47A2F33FC19F4094BBA0D889495AB peterpressley
458,331,269 *2E8E6B5B54C60C3134C9424A45C0D7B1D23FD85E PETER.STANOWSKI
458,331,270 *2E8DADAFD8C55A3928C50C641FA5E52C745F45E1 ASDFMIKI0
458,331,271 *2E8D44059F4A4D4FB6D8E18A4A18C07E386737D0 PIANOCONCERTONO.2IV
458,331,272 *2E84D044E468A3E8C0CB5A9D809BBBC4F7F96857 PLAYMICHAEL
458,331,273 *2E80672E3A568B61D83B0A3DEEA7EBCE0B0214F0 aud5
458,331,274 *2E894DD593702611EEA40E142C2D44D5117A9AC4 AUGENBLICK(INKUBATORREMIX)
458,331,275 *2E83DF75D558BA00AB0543F51A9D5D1DB0EAB2FC PRAHITAIH
458,331,276 *2E8A16505F2F8FB6DF97A4DC18CAE8DD7494793B avo!dab1y
458,331,277 *2E81D9F7940BAABAB3A8CB973E5429C78962CF86 PROPHETFOUNDER
458,331,278 *2E8DE45523CA4BEB48982DFFC612115F0B979E5E PSYCHSKILLS
458,331,279 *2E8F979E9B4658FF208256B9E9F04100D97C6B24 B68V
458,331,280 *2E87235D1CEA748FC015CE5B9DFF663483064A8D សqatar
458,331,281 *2E8788CC89A3265B23A577FBD89FD998B32CCA07 (^_~)~.`QB
458,331,282 *2E85E898F6513646010BB2E39A264663EF9979FC Q######>-*-O->-<
458,331,283 *2E89B5E66146A158D8A20A3556D400E628E06717 baek/
458,331,284 *2E860D79245544A5A8B6BAE59776F0CE7A11B934 qp*splat
458,331,285 *2E86D08A4C8BF9D004C514E2298BFA4F81229391 QUEENSTHE
458,331,286 *2E8F937819A083A563AF3EC5B15BD48835C29BB6 questfan
458,331,287 *2E8E8AB3B677E07BFA070E3BE1BA7FB86D659952 QUINCY.STANPHILL
458,331,288 *2E8599DAAC76B65663DC411F66D11A6F33362D1B [email protected]
458,331,289 *2E89BA07AD079B46EFB85019D1F4EF9A67148DC6 QUOTFREEWHEEL
458,331,290 *2E8C9281B4001B661FEDB3A492563DD870D16DAC QWFPDHYE80
458,331,291 *2E8726B7D46D2EED9EB84C6DFD43DC846DEBCB3F ralej.yetty
458,331,292 *2E8EF784F5A2B6FC0616B022E7DE8B8173913003 RASE
458,331,293 *2E881B78E030443754E51797EEF3FA0B8F56A9AB B)CAL
458,331,294 *2E83CACD0904AE9273E70CC7AAACC0C70A3B2325 BD~0~osplat!!
458,331,295 *2E81AA227FE375DCAC5578D053F3C5AAB4B01623 renatoshatek
458,331,296 *2E8CBE8FE841FCBEAF7EDA42B9C6B5586D6848DE b#e6k
458,331,297 *2E85395BAF1430B56FABFE4DDC944334A9BD821C BENNEREMEG
458,331,298 *2E84109F0364C9EA8EEDE593DD6204E434264D5D bensonhappy1
458,331,299 *2E8A2DF6AB3AB38BC556BF7B76E61710D9C16C6F bern-jura
458,331,300 *2E8424F8D4DB30692B12EF6A9C796222FD0C190F betobetos
458,331,301 *2E8BF6816091045EE88980286407E6BF9BEAAE91 BEW
458,331,302 *2E857BAE0DD06CD19FAA4A48B712C0D0A8FF48EF [email protected]
458,331,303 *2E80C4D31C625D6A2316FA82A8B8D52E6C567685 RILEYLANGILLE
458,331,304 *2E8F440F2D45D1F9DE2AEE5DA1ABE1FB687B8611 BFKU4
458,331,305 *2E83F0FA2E7DCE8AE312BCF671BFE619FA80FD21 BGORDON61
458,331,306 *2E8EB7081DC8D55EB1DB1D6806C3E0A933E793CB B-GRANGER
458,331,307 *2E8E0A4DD20ABB3F525791A3C09B678ABA9D95D0 robertozuccowersjasolo3
458,331,308 *2E84055D3736515510F106BD25ECB18DDDB13D47 bh,#o
458,331,309 *2E8565ADBD6029CC6FE2894F8E553348EF0A68AF BIU&;
458,331,310 *2E851B0E2539E2C2B01BAA2D3C60251EEADA1A75 "Rollins.Power.Sauce"
458,331,311 *2E8FB0DC4C86677BBB43E9E0C94D32FEC41DDDC1 [email protected]
458,331,312 *2E8985AD2CDFDFD6729C6BDFE5EEE079DB2C09E9 ROMYLTA
458,331,313 *2E89F749291005B524859848233798011ABA385D BKKM
458,331,314 *2E808EAC2E400D40DAD12829472EAAF538CC37AE ROSARIO.GENOVA
458,331,315 *2E81598A26F8BBDD50DA17BE91FD405FBC9F1374 ROSS.LIZAMA
458,331,316 *2E8B868E1BF28F9B6A450501A43AE53603326ADF ROUGHTRADESHOPS:SINGERSONGWRITER(DISC2)
458,331,317 *2E83AF9AA0E748554A0FE100084E5AC664D41E45 RUDY-REILLY
458,331,318 *2E8D7CD4BF3A303A7092EBA7C5357142E4571A40 RUFUS.DEBOUSE
458,331,319 *2E8FE2041BBE7FC3CD31F1A6FEC0BD5A9B17F18C [email protected]
458,331,320 *2E8F6FE666A1EDD773289E9649AC937B99BFB7B3 b;mag
458,331,321 *2E83B6C7069AC5B9169658872412BBB247122CC4 B)NGQ
458,331,322 *2E8960DCB3BFFE3B95265EDF6D36634E08FF93D0 rustybirkenmeier
458,331,323 *2E8AEFA5644AFCAD821D1DC75BF0F69E0C765D84 bnt$c
458,331,324 *2E805036A882F54DF47A533DAF2946DE47DD142D BOBBIEHEIMBURGER
458,331,325 *2E802F445379CB5289CA62E6100E8F83F08207F1 S4ES
458,331,326 *2E83E07EC24932075FAB30915A8565EBB4EF557A SAMIRA-AYOUB
458,331,327 *2E8E89E98259BF601D1264EA0C3CAA9AFDB6EC98 SAMMYBRUNSTING
458,331,328 *2E83BD3A77422368117F9C6B7027939710B51D98 SAMORON
458,331,329 *2E8328C9FA8CE74CE46E44E086F0666A23C7AB7F $bold/w
458,331,330 *2E85E5BA65AABFB65E4471A0AC22FD4BD6F5FE8F bombdaloop
458,331,331 *2E85BCC2B8B2DF349E249878D364B1747782725F SANKEKORTENESING
458,331,332 *2E8B64D868FAAC5D163C494381E83F1B436A12F3 bor.h
458,331,333 *2E8E0437884418F8DB94DB5D0B2C280F3AFB68F4 sarah.priolo
458,331,334 *2E85D6FB980D691DBEC8A3B678CEC42337D4F958 sastroasu
458,331,335 *2E8ACFDBCA52C80DCA5440CB2B65C1B6C7ABA6ED B---P~0~OUU
458,331,336 *2E8858BDAD48AB200B85CED6FFC50D851D7EB224 scopesightonastrangelookingrifle.
458,331,337 *2E801A3253DCF24FD83E8C9E2B8688B99AE2135C BRADFORD.BENNAFIELD
458,331,338 *2E8F1F9849F246613C2C8CC380AD652AB75194EA SEMIARCHITECTURALLY!
458,331,339 *2E8FF7DDE44EA4BF09FDBE4E23C35E314165D454 SEXYFRITZ
458,331,340 *2E871F7AD2B8F61C7C9301CF8DEF4BB4D529F749 shangwe6
458,331,341 *2E86C428ACAEE642744E12251686D225E4214F03 SHELTONDOLLISON
458,331,342 *2E8750B6C0AE26555B2C07F149E8494C19102465 [email protected]
458,331,343 *2E8047964BD6386AA5F74157680E069B5B598C7C bta
458,331,344 *2E80B5ADB888CB8AA60D5741B985A52E47632B14 budgerow2
458,331,345 *2E8E693A231A0477AD8681E353E953BD9E6DF52D SIDNEY.HARDAN
458,331,346 *2E88FD72FE0DC772CF08D51B50CE2096834D5086 silaslardizabal
458,331,347 *2E875CA5501FB27BA954CFA79A06DFF5232FC1B8 SINANDPUNISHMENTCOM
458,331,348 *2E8F404F5C8835F8636C4FB115152241631EA6DA butterface(reprise)
458,331,349 *2E8F0EED623BABCC1FBB0147748C4217DE77DD83 @smsf
458,331,350 *2E8F4255976E7BE66E3598F2C4F96E595E622B2C SMUTCHINGS6
458,331,351 *2E8847519C58FB198DDA5F7AE38BEE110FDCEC2E SMUTTEP
458,331,352 *2E87E9799BD789131C07B2E19319C6B99A00C4E9 [email protected]
458,331,353 *2E8848023CF90227A1BA314D08E292BF3BBB7BCC snoireppirga
458,331,354 *2E85E099B3BD9F8A0867AEE3B27E0106A8DDCFCA callme(americangigolo)
458,331,355 *2E8CDAAA0FA258A435BCC5B289A32A8CF77363DE [email protected]
458,331,356 *2E8AE56419307C5D4FB6160D16742E3ECAB6DF82 [email protected]
458,331,357 *2E84FB2637267314C8869AD13F790411417806E8 CAPQ%
458,331,358 *2E8DDB7BF200C7FBEE538A6DF265A07C5EF4F174 soupflog6
458,331,359 *2E8AE906E5FE312941F052F7EC3337B92FCD5FC4 SPERPERIATES
458,331,360 *2E8FDD04417E4763D59AAF45BE1429F61D98642E splat! ~`<q
458,331,361 *2E812B7D76038B130AAB0DE143F00FAA796856DA ccf"q
458,331,362 *2E8801D870FD0A6E6EAB575756570DC58192578D CEDRICK.LAVE
458,331,363 *2E8733584C150D167AC50A5D9F33DB5C369D770C c$,ee
458,331,364 *2E8A6DD0FA7E6C5CF730224909CC3938AD7303C9 CERB(
458,331,365 *2E89093BEFC50113147D4DFE27C08FBFFCC75725 Cfm4
458,331,366 *2E8727DDB183B4853A0B84985F78A5394463C22A CHARMININAY
458,331,367 *2E8942C0526386BC2B62A1356CD4557FE6727191 [email protected]
458,331,368 *2E819056111721C7A037856B9B5565C4749DF1F5 [email protected]
458,331,369 *2E8E05CD3A386491BDF6B1411DADE0AE71284B07 [email protected]
458,331,370 *2E813E79B96BE3168768B4B1755F47CBB62AFE49 cherryfr
458,331,371 *2E8B2CEF3CAD11B91A201242FFA4654B5968555F chitonochilus
458,331,372 *2E887EDF0B48EBB511E6CB7030B536BBD2C8E786 CHRISTIANROSELIUSHOUSEIVYGATE
458,331,373 *2E85F0F6F07E3D7A3757457612303DCF6A47BBDD chyaavayaam
458,331,374 *2E836FF857D7F549145CA46C838EB01AE7AC9237 symphony.no..3.in.d.minor,.part.one:.ic..tempo.i
458,331,375 *2E8E7EEF2929DA929C26605273E4B75A8C8AFFBE ckg-r
458,331,376 *2E86C2FCB5925F8862E407D9874AB5F2DE7E5351 CLCUL05
458,331,377 *2E839483F61A9CE561F0DCF84CD75C90B39D7B88 CLINCHER
458,331,378 *2E8E85CB54756B1F9CF75AE1A86FCC93A7B6B8A3 [email protected]
458,331,379 *2E89A80F7CC5E64AF034963E6BD85E1F0BEE181F cmu7s
458,331,380 *2E84ADF0B61ABC1ABA6D276AE8ED99DB35BB10CB COKESES2
458,331,381 *2E85B351876D3954AE71C1D36DD71F37350F2063 COMME-VOUS
458,331,382 *2E8E3DA5F8C40394A856181C2E430783A58AFA44 temabaseret
458,331,383 *2E81232A98C0E106459F43D377F0ED67785C7376 TESCO VALUE
458,331,384 *2E8E52521B2E1FAF9B08CAB790A0821BDAB70CAE CORDIAME
458,331,385 *2E841AEE7DFEA92C2B1EDBD287E3C2359D301B84 thatshithead1995
458,331,386 *2E83CAA0E40195BD3EE140540D46FF71358B64A8 cotbl
458,331,387 *2E80AFC17D20E2528C4BB5DFAA8F882B0F8C79E8 THEMARTHA02
458,331,388 *2E88B7E0415ABD2B4653B59EB214F538162820D5 ctq#!
458,331,389 *2E8B88939DF6E826110204438A462D95725878B5 c!uav
458,331,390 *2E88427D799F65AF4A7ADBD852629FFE19AE57BB CUO;U
458,331,391 *2E8CEABCD3EC831BC23C6D1062DFE87DD2C2AEB7 TNEMNIOJNE5
458,331,392 *2E849EC11AB9E0190936613BA3C0A010A107B293 CUTFU
458,331,393 *2E88300B9EB27A96A1CF0484A39DC68E9CABE89E TORMOSERÖDSFJÄLLET
458,331,394 *2E89BDA046889C1A28A7C02F4E4D7300B151BF82 tracy.mcpeters
458,331,395 *2E83D631A56BD99E34095083D354E54579336127 traveymcpherson
458,331,396 *2E82E752E0D24D4EEFC6067FA483411AC6B13B1F TRENT.STANIA
458,331,397 *2E866204CFCDAE592AE82354F4EFCC00790C85A0 D60M
458,331,398 *2E80676DFC7A3B1B626E60820777EE77CB7D065E D#9P)
458,331,399 *2E8AAC114A2A81672C7A5167F9E7238F465CFBA9 TROY N PAM YOUNG
458,331,400 *2E8C41E7FB188EED15E9EDC316C190B4BD7087E7 TRSRA
458,331,401 *2E8330ED91892E3E3AC6A78520A432756268FFC7 TSERHARIAM
458,331,402 *2E879C2A38A6FAD52908A7881E6967253FC38DF1 TSGINAH3
458,331,403 *2E8334C02E85E8AE311F08A1F429EB44B6873451 dannyfegueroa
458,331,404 *2E8C3B428B12ADF20ECB37B94FB839C908A3D865 twin.peaks.pel
458,331,405 *2E854E208DC41A6A0B6F2D842C141332C7EDEE98 DAPN"
458,331,406 *2E81AE6454ACD469A9D5B72E608850024B82F10C DARIUSKREBSBACH
458,331,407 *2E8E447C0CC09B0ACA19CB9748808050B4FCAE79 DArL
458,331,408 *2E8EE7E770017FCE148742266960FE6377806365 DARRON.HEMANN
458,331,409 *2E877B7B435040278A2A1E51EDDEA44140855E4A tyronchew
458,331,410 *2E8D6BD39787050ED5FBCC9C2B9A8C8990E7C801 DATENTRAED
458,331,411 *2E85CF1B24C8099E39E3059E320F8CD431AAF894 datoteko2
458,331,412 *2E8FF9B540673FAD28A93AA5252A3606E0908243 dawn8147
458,331,413 *2E88B6DA78AB79644EBB313B40B0F9D81D42EA54 DC4TA
458,331,414 *2E88C13075298DF8EEF1F26C6FF0D246043126B0 ULRIKE-HAAS
458,331,415 *2E89254BB3ED4DE395937DE128CB7AD91B129F7B ulysses.r.ros
458,331,416 *2E8E4554CF132B4EF7DF82F3196E3C05EC4D3FCB d#e(a
458,331,417 *2E80F74CC3559D1F228AAC4B7571B5C3DF0F5F8C DEBORA.BUSH
458,331,418 *2E80D70ABC2D86C7B054C72AA051B203501A1899 UNILATERALIZATIONSES4
458,331,419 *2E8B33BD27DB7A37C520BD37A5F55B183758D07A dec!s!ons
458,331,420 *2E8A2D6D1B86D8A797420D0D4AD1BCEF6C696B2F UNUSABLEA0
458,331,421 *2E8B653C9D43AB5ED32F7EE58012AC840CDE493C delaissement
458,331,422 *2E8E4850CB865370B13DFEC546EC65AFD8CBE7FC den9ra+or$
458,331,423 *2E8F3B74B3CB45ABC5BDD91AFEC6640897E07210 USERSQUATRONT
458,331,424 *2E8D6DA0012E5D14C1AB2476641524875150F3CE UYTREWQ8
458,331,425 *2E8DAA9582066A4253C720089915F335AD18C4D5 VALORIESIMMONSHAMILTON
458,331,426 *2E82F343B1AA64D50E3DE8876B82F7E11B9F5601 dewittliddle
458,331,427 *2E84E140FFF938CB2217AF14F1FB31E9952AEE98 VAMP-CAMP/PATINA-IN-'EM
458,331,428 *2E810997FA27D0E58F06CA68769CF96B43AE9445 DEXTROAMPHETAMINE
458,331,429 *2E850BD3A2BF7BF5FC0FA106CF5B9E2A8B79861A varoommag
458,331,430 *2E8AE9D54801DD985FD8A0508C1C78BBC091D827 dgn8.
458,331,431 *2E840DB70EAD581DA45307A083D201EF3BD425F5 D-JGU
458,331,432 *2E87C898A99BBDF6E6C1A59B5C104581FE35FECF VETTIGNESSED
458,331,433 *2E85260ABD3DBD8453E32B1EB48F6A2512AD52BD V,?F
458,331,434 *2E8FDA3203551D66A743706F3EE3C1C9AD550BC0 doi101007bf00928458
458,331,435 *2E8A2916C55AAB254E4874CEDB9569147A3B2737 dojjen
458,331,436 *2E875611DC58B84E40C02020A9CC63CDD6B78297 [email protected]
458,331,437 *2E8C96785F788AF58B7518FB08C9C075DAAB98EE VIIDENTEENTOISTAS
458,331,438 *2E86CA9BB59883702A015A34B9821808923C208A donteschlosser
458,331,439 *2E89CB5B4D0B59B3BA65F52C13793AB94A345192 vincent-kormex-trigerous
458,331,440 *2E8981BFDA914B00073D4C03A9515DD2FA70746B violassero
458,331,441 *2E8A6FC49CB5AAB47D660D99F6068A57418F0B77 D_PF+
458,331,442 *2E837329720D42B2CD70FCE0D11829D666558B7A dp=x=
458,331,443 *2E86AB38CEE0FB56DE903816C9384E3F4CDA5205 VNIMALA1
458,331,444 *2E83052A0A36ADCECD45554B1E49D4B6D4476F36 VPRT
458,331,445 *2E8DF44F9F339FEAF6F784A81C9EFFCB65A8C7EA DQKS:
458,331,446 *2E80DE42609D3DC236F00B46482C3D08AC6A25EE dqxfuy
458,331,447 *2E82299BD0A3D0E096F26C7BD3B9BF3FE06C4656 D_R?)
458,331,448 *2E846A42600B79D937E28667D4F0FDCCC3E73D19 d$rgb
458,331,449 *2E844465D58E1D1E9C912BC2EFDE64B30108047A [email protected]
458,331,450 *2E8E62D20912927A1B47CE4E3941D0D1BC797A7C dtl5o
458,331,451 *2E86EBAE5B745799415B60230AECC58A219E339C dw;6g
458,331,452 *2E8A638D976E5D9DBDED8BA4F9C5E0C8DC5C52F8 dx:i9
458,331,453 *2E85807E50F5AF893848B55DC6F984E1E432EB92 d#%y1
458,331,454 *2E8BBC0798E2BD39D7F89D996A3693CF37A7090F WESCORE3
458,331,455 *2E83B48C41D6FD845598875A5B21092031BA0F08 wilberttams
458,331,456 *2E8C4248A82DDB0561BA7B6D943E68203BA6B067 WILEY153
458,331,457 *2E8E4C7E12274A2B84B94F9EEC93761199CC880F WILLIAM.YORN
458,331,458 *2E82835358F0716DCE98213F9721B61DBADCCCDE ecroulement
458,331,459 *2E86B3F20635B82A0926ECAB24D1BE90BFBCE1E0 EDDY.SYPHERS
458,331,460 *2E8D01232A0C8B66B4EE15FB4F5DC516577A56A8 WINRACKDUP
458,331,461 *2E82BA3FCDD3F06404122423D7476BEFB911AFDB edward.gein
458,331,462 *2E82477A9328CF7455F60312E93048BFDB1C9E53 EIN.ALTES.LIED
458,331,463 *2E8D2F98D91C63BED8D1EA29AE668D8AEFEEF866 EIPSOLOPPING
458,331,464 *2E8FD84E37FB657EAE5243C41EE62223CA864790 EK0(A
458,331,465 *2E82DC8A10C7B35B1E0842A9B6D2332ADF910169 elijahfalacco
458,331,466 *2E84351AFCDDCC5B33415227CBE514273BB91B03 WWWKRAIBURGCN
458,331,467 *2E8709980A5BFD4475D5A84AD2471B5BFCC55BE1 ELLSWORTH.DIEDRICKS
458,331,468 *2E8A75A7719ABA9BC7FDD64AE4C28D800FCEC402 ELMER.NOLLET
458,331,469 *2E8B730C1D8D0AAC3D68BB485A52B283956C08BF }X{0~(--3
458,331,470 *2E8DD520130F77C3518CD7A4FB0A3EA23739EC37 elvintempest
458,331,471 *2E8CF3427E94458B07CF3486C84C9EB33647BD29 XBE0
458,331,472 *2E8ED605089E66DC4857212CE112E13BE2FA06C3 [email protected]
458,331,473 *2E8E9E8033E1F535E8205488ABFC86AB54E0DE8F embriogenesisenpterid
458,331,474 *2E8C79A71CB5162EAD8B5DC1AE702E682EEFEFE2 XISUO
458,331,475 *2E814288C8A0A8A3324FB58F45261F72ABE85932 EMISONSES
458,331,476 *2E854DCBE6340DFEC3ECA47A4EAFECF170D7001A [email protected]
458,331,477 *2E83A4AECC05B00BCFF586C284D5E4AE00CA4AC7 [email protected]
458,331,478 *2E84E29732C191B62DF64B6352F90B620E4FCBEA [email protected]
458,331,479 *2E8810D1491C9A8BF2902D4BD2ABC92D56927A94 [email protected]
458,331,480 *2E800A1E7EB98DB8393305C8EB08258FB1E123FD ENSG00000132953
458,331,481 *2E883F04562696C4D4E29AAD73E69942CF337384 EOld
458,331,482 *2E8AF610E2EAD92204551F33A97F12C4F3487258 yet have i left a daughter.
458,331,483 *2E863AFB38495515628376F55A97152A31BB7A51 [email protected]
458,331,484 *2E8B373F29D68FC865F4FA92E4B80DCC50560F97 y;ih
458,331,485 *2E8DCE679E1EA181A58608782CB3BD606163A4DC erincarreno
458,331,486 *2E8B7612591703264EABD142269BA253245B584F esrmeter
458,331,487 *2E8EE9DF38B81295FE403902074A48C1EC86FEA2 ETJVB
458,331,488 *2E856762D21D9F3AD9140CF99992AB7EC2DFAA55 eusocenglandcaptain
458,331,489 *2E81891A0B623E5BA064B48CF256C0E81C5DBD70 ynkoyivu7
458,331,490 *2E8B5B4F36E5EC87361D3C623172B8D4C4D1B8D0 EYEDSPY6
458,331,491 *2E872893D567DE34AE8F055810C663A45788ADD1 [email protected]
458,331,492 *2E8148F6CD4EEF33FE8739204306F342536093C1 YRKESMILITÆR
458,331,493 *2E840DAF8D347BCFA73D514ED700DB08A8E7D0D9 yujuan-tang
458,331,494 *2E8696132A1B297BBF54AC2C774669F925F9EBA0 FAÐERN
458,331,495 *2E802150E3AABE907E1DECA2288FE786BAD06BBE FAHRPLANABSCHNITTES
458,331,496 *2E852D9D291DBB31505C3B07D5B8B09AC1E25846 fatty-girl-(feat.-ll-cool-j.-&-keith-murray)
458,331,497 *2E8287D4953934511AF3AAB6245F16B14CA2276B FAUSTO.PRINZI
458,331,498 *2E8663E6350FE26612FA48EA2B19FE0EEAB11D8C FAUSTO.RICHEL
458,331,499 *2E80BC3F29100D0B52B91F759E068849B1904244 federiconoerenberg
458,331,500 *2E8FAEF4F545CA25F54F1DE479B7E91E294E4956 ZAHEER-AHMED-QURESHI
458,331,501 *2E81F9010903044CF3ACFAFA5B16B79AB3B95E71 ZAINAB.ALMAHDI
458,331,502 *2E8605C513659AF1D7B704315DE91466A7F5FC32 feltlike3
458,331,503 *2E8E72BAFEC080E5FB0DFE4CCBD854B9D739ACB6 FIDELVEACH
458,331,504 *2E8736BE0C636C3CC868ED769F8F3E95460A241A filedorff
458,331,505 *2E8EAF2255E9F998B1EAE48DBC49112C78FC538F ZEUSSANTA
458,331,506 *2E8CDA86FE65FD5EEA21CA1CADEFCE667C3A23BF fredorenstein
458,331,507 *2E836F770C98680F3914C280CBD6F461C9CFFA7A friandis1
458,331,508 *2E898205F6DF217D26109BF54AA34CA5B0AD09F4 GALLOGLASSES
458,331,509 *2E8D5512BF1641AC735DC2A473A9F23259A1D129 волочи́ський
458,331,510 *2E81DC2A0B07A629D8C83E4E4341E46F3D37AA76 GERALDWENSEL
458,331,511 *2E826FFA8E0EF01BB16142537472A182F20AC75C GERINGERE4
458,331,512 *2E81ED88469CB243424C953704C65D27150495DF КРАПКА»
458,331,513 *2E8807F14DCE00A6A4436AB7F0743DA4BCAF5FBB glenolnes
458,331,514 *2E8DFC373F9EA2347A5A812BCF89320D0033E4F7
458,331,515 *2E813450632FAAB0232D800223BD75037356692A ᤵ
458,331,516 *2E8507A924B44BCE2637E75CEC70E29AD97BA604 gobackmenenius prithee
458,331,517 *2E836405E0177BD7C0C3BE8A4F7AE6A373441ECE GOLIARDGOLIARD
458,331,518 *2E812D8A29EE0BAE2F65D0A9EE71D1460D0EB0C0 GOMEZ-SANCHEZ-MANZANO
458,331,519 *2E82967CECC0A96893F1BFCC7CBF114AF94CEDE0 greenbyteme
458,331,520 *2E8915BD3752F37E42986AE267F558CC3D387168 053527bic
458,331,521 *2E8CEDDFC16562EDBFCFEF9F231BCC2338765B37 gyh<
458,331,522 *2E841408A85E1D5024EF90E24AE27993391AD21A <)0BAA
458,331,523 *2E8F85F4EF0AB291304AAA43D2B0ACD718542C7F HAFIDZAPIZ
458,331,524 *2E802F6C95259E9895B751E678E3181E5AD53A94 11.08.1254
458,331,525 *2E83005543EAC2AB7CDAC4BCFDC91877B9977EA1 HARRISON.LUNDBLAD
458,331,526 *2E84D6E4274B54D17059A9BEBE29B41C3F036E1B HARRY.HENDLER
458,331,527 *2E8CCF48A33C21F74ECDAAA735868344CC4ABB4F hdfz
458,331,528 *2E894CEA2F0917995B5355A3E95D65BAEF728080 hectorschrader
458,331,529 *2E81034BE183B242604F82A7EE483118AD5FFCA8 11 arayacagiz
458,331,530 *2E8807216E344F3E4CA12266B5C56BE2879CD4FE 1216541 ILMASTONVAIHTELUA AIHEUTTAVAT MONET TEKIJ
458,331,531 *2E8A80838FDF73BB97A6D6E004D4B5DEEFB39856 129961 birarkadasimdamurat'inyerinialdi
458,331,532 *2E8461C40AB3B973B307A0F88E2428CFDA04C6A1 HENRY CROWE
458,331,533 *2E882F51E1E721F88BF4A601173D6EFE2DCC522F 1550323 UUSI LOGO FINNET OTTAA K
458,331,534 *2E8781959E65CEF77DC8B7C3D76430FC5C5F667A HERMANJESSUP
458,331,535 *2E84A44035353DFDB2E627FD1BA47FD5481FE1A5 18P
458,331,536 *2E81EC38D4A47C09C1F67432B69CFCB81BCB8FD2 he-rouses-slightly,-gripping-her-tighter.
458,331,537 *2E8FB0582F40EA49156644E35AEC2859499444BF 1.ciglenebilmekte
458,331,538 *2E85DE5F7BDA9C8D66DA65217B3F7BBAB8982C04 hipscouk
458,331,539 *2E889D371D8D6FB27BE7B48E97525EA6967443C5 HIRAMSHBI
458,331,540 *2E80C977D4FE7915591D57D9DFC94F25572C0796 hizarçayi
458,331,541 *2E8B7B71636060E0E4061960DD0E7177E58FEF55 [email protected]
458,331,542 *2E8EDD44156AFF062EAB7A9F5D190BC42C85CA99 [email protected]
458,331,543 *2E821CA44DAB55B6367772569410C0CA763C6EC0 1-HARTIALAUTOJEN
458,331,544 *2E87B3ADC79BD3DC0D1CCFE1DD3B79F70BA6C45F 1-HERZMUSKEL-ERKRANKUNG
458,331,545 *2E88DAC8379D07D4783ABCF559764EB18B05FE00 1-homers-his
458,331,546 *2E8E641F134C809842B2916AB689BC290E76B895 HS011485
458,331,547 *2E88EC88DD4450AD6E09A5ABBF654D373E74C80B 1.KOULUPOIKAVUOSILTA
458,331,548 *2E8ACDFEC0086727242C386EE4E0053DD0736549 HTTPWWWLEGIACOMPL
458,331,549 *2E884AF113BC37E73E54E416EE494996818C2A65 1MAIDISH
458,331,550 *2E85912DC02D5040D81323D29940132F96331872 humance
458,331,551 *2E83E9EA2B1C2A2353097F6A3252F9E05EAD6A4E HURKOLÓGÉP
458,331,552 *2E8E207876A7618ECF0AAD85FD7363F8AEB9E4A0 1OOSENED
458,331,553 *2E8E7315A68E70426F62953A90F0450DF0C59CF2 HYDR0CE1E
458,331,554 *2E87A622E0E0CC1EC098654D1B616632DD9F1505 IBERANDO7
458,331,555 *2E8132D7481DE368E97BC6D70C287E8826B0E02A 1thattrojan6
458,331,556 *2E8B0326948033BEFB7351D220484288DC482F53 1 WEHRMACHTS-WERBEFILM
458,331,557 *2E84BC9784269C069C0267655C259C4D378C806F 1.yozgat'tan
458,331,558 *2E8A202A983413D854CB78575F7C2334153C656B 2076444 DIESCHLUSSPASSAGEWARKLANGVOLLGEWESEN,KEINEFRAGE.
458,331,559 *2E827AC29728D48261D511CB4AF08BBAFF84985B 2085442 VEN
458,331,560 *2E80948EE7845B9A61A7528982CBCE8CA77BE99E I'KG
458,331,561 *2E8BD841364D9C10F60CC0A66BCAEAD1E8F639D1 ILUVCOLETTE
458,331,562 *2E83F345DEBA60F3C8D0751B3AEDF3EABA82EE3E 2521567 ilmoittautumisetyhdistystenkautta242menness
458,331,563 *2E811710A11FB48965693FBED1C78AE962E80FF7 2551315 DAS.GEHT.GANZ.GUT..
458,331,564 *2E871A18242187291F4FFE3FFB005C775A20B53E IMAGE09F9
458,331,565 *2E89E56EBC34050A237A75A8C7058D5EFF2A4248 IMELONE
458,331,566 *2E8ECD59575DA75073410D66CE2C7F25A70FF90C I'm-Home-Africa
458,331,567 *2E80203C403691B4DE5E0BDA4A99945EBC265272 IMIPISTE7
458,331,568 *2E81D3063F324814A75678BE4023D9F2A917E8D2 27ritual
458,331,569 *2E8DD60341045A77D420F3EF3CF6B171E537E3C2 INDII4
458,331,570 *2E8ADFD91709B833C9FFE2366B2465FDFF7D8C73 iopordihs
458,331,571 *2E8551835BA4E5F9F08E4C7ABF68A4EFEA4B942B 2AMHHZQK
458,331,572 *2E8755A0518252216775992C7CC6D88C06C13D89 2 BEITRAGS-PRIMAT
458,331,573 *2E81E7D2FBB8F786A956EE8542A75C302251BF2F 2C1DA79D24D8D055988F495CA349FDED.1260DAYS
458,331,574 *2E832636F41E43CE8F6880CFBC251035E1991B48 2C541B9D-40FC-426E-A2C3-B86B14DEBAFA
458,331,575 *2E8AC0BF417E0B38E8B4D1148B8834F3D5E65CB8 i.saw.my.lady.weepe
458,331,576 *2E8BCA43F166A3BF11F9073E782425C897EEC8EB 2GOLPEES
458,331,577 *2E8B9195D9D2FF5B65894670B261438858EB9BF5 itcu
458,331,578 *2E83B7334BC4DFDF63BE8A962CE9C61C88CDD883 2.LIKORLER
458,331,579 *2E8F412EA3FE20CEB411E1CBF2F97F864106BE60 2-neuberbg
458,331,580 *2E8F2D316303047A504E3A99255FE352A2161015 2SKOYFAKI
458,331,581 *2E853919E537C7FFF8EE8A7A5708C87EED196A87 jackbirkettobituary
458,331,582 *2E86B291D7D70DE1560328F71564F9BE958E67B6 jacksonmakhija
458,331,583 *2E8F742AB3D55D8B9381B996BB21A0EAF7C9F083 300ASHER
458,331,584 *2E835A06853320F1F31284C65993EF193A95B1D6 JAGDLICHED
458,331,585 *2E8153298230251DA40CFA1AFA5B15F47F6EA34F 3#@ ~ ~ ~3b<-
458,331,586 *2E80ED7D97938560AB38E9DFBD51B3198C4F8B9D jalonado
458,331,587 *2E8494F8997A7CB9A7A70F03ECFC1AB55F7D43E2 3MROMERO
458,331,588 *2E81EA316AFB300C1A4D864F08D576F2841EF4E7 3NNZTWRZ8IWSOM
458,331,589 *2E89D5FDCC2DA42C337F09B23DF77D9111884E8B [email protected]~O~OO><
458,331,590 *2E8CDD6018F4276E255CCF3BBA9C3A8CF9062B11 JEFFERYWHITT
458,331,591 *2E8D583BB2F34462C4E760B94936458FEC2215D3 42941 tubitakkonstruksiyonveimalatabd
458,331,592 *2E863EC0779B1DEC31590392C30962E263D3B47A jeraldmacvane
458,331,593 *2E8EE9464BE14724EB35D19C09037B1FFD65BB13 jerefalick
458,331,594 *2E8151E090DE8AB7E470C568FED2560F25A55731 447DRAKE
458,331,595 *2E890A420BEB57EAE6E351A5C14D75C53A8CF573 JESENSTOUT
458,331,596 *2E87917CE32C1AD3D28E2C6A57181990777725B5 jessrunswick
458,331,597 *2E88A97EA7C685D672E53AA4FFC5AD5022C7D22B JESUSNORED
458,331,598 *2E815027C84D07C51D954340DE9A044014957C52 4ADLAFAM
458,331,599 *2E833DAB9F7E4F11A4B15E02EBDA1C6FF8BDA5DF 4AMBROZIU
458,331,600 *2E86075631728E43BA01EF498B266F4C1249BAC7 J\G(
458,331,601 *2E8F69F723A907D91583CDFFAA0C70D23F7E4DAF 4IRRGLAUB
458,331,602 *2E8C4C02A3A92021B6797FEF4C7D4249732BA0AC 4-P
458,331,603 *2E81EBBCF349EED338C80895E6BF78973759D7B1 4+R0G3NC
458,331,604 *2E8B7045BB9B89AAFD8BE83002C81DA42F62D728 JODYBALZER
458,331,605 *2E8DD55ADF071103D21C38EED10FB760CB1C834C 4RIASSEGNATI
458,331,606 *2E89112FAC5346F893BC84C9BE43AB3D65D83ADF 4SOCCERRETARD
458,331,607 *2E8522C5B2EC486326B437910ED72B247C753495 4SUGESTIJA
458,331,608 *2E8A7DCD00E3CB4CCD32A057B9976434BD3963F5 4SUSPENDIS
458,331,609 *2E85B44E633399186864EEA750C24D9DC28A2A45 jojogun
458,331,610 *2E86F369DB3BF68B35A735AF86F052B6EEF883BA jooklat1
458,331,611 *2E88B74A96176568036C58DA4824A2CCE2797D2E josephhuenergardt
458,331,612 *2E892D072B307FBB33C5D1C22A936C3751E51851 JOSH.SUTTON
458,331,613 *2E8E17D0BEAFA77DF873225B93A341D4C41CB2A2 JOURNEYS-INTO-JUNGLE-(DISC-2)
458,331,614 *2E8AF0DCD90903B2FAE689A52130471C85414080 jpwa
458,331,615 *2E8785745CD5B9A4AFF3AC01EB12A0B3DEAC1736 [email protected]
458,331,616 *2E891FA2F3FE7632F3D978593F23578B81B1E116 5DISCRUCI
458,331,617 *2E8705523A31EE952EB0766B047784C8284AF1B9 JULIUSJEGEDE
458,331,618 *2E8BEA6CA9BC486C3439A4896FDE25DF849C1F5E 5EKUERZTE
458,331,619 *2E82197B3E2E19561144A8976C168E64B820CBC6 5FOOTBALPHANTOM
458,331,620 *2E8286826133450C9F9E20E2430FCE37EB9C9874 jungielou
458,331,621 *2E8D4015DD98B28E565838393129830E2FFF09AE 5KONSORTIUMSTREFFENS
458,331,622 *2E8363BAE0093537187E15E33223FC0281CA91B7 5MKGNAST
458,331,623 *2E8F4CFE335CB679D814A2B00AC5C1230A23B9FA 5PARKINGTICKETS
458,331,624 *2E85668D2E504A04A183564CA03FFC65FAD8A3D8 5RUGBYSTUDENT
458,331,625 *2E81D9CFB9E9337B8EFFFF180D7813CCBD1B431C KASEYMOKRY
458,331,626 *2E89B60CAC8EAB674B2283CAFBBEDF26A0FC95B4 5TSLSETKA
458,331,627 *2E8CF27A06391FB7F898B9670B2EE1BC42DDA0E1 5TYLER12
458,331,628 *2E86B89BE188834567B4D55AB54623DC4D7DF956 62ubuntu3
458,331,629 *2E85D23541D4074092B79EAE470BC01CA6FDD389 6ANDALUSISKES
458,331,630 *2E8C3F9441B9E5BAE699E7A00A618692FF2CDA5C KESERSIN
458,331,631 *2E836402C470FEEFF0C4C15C90851310833DD59F KesonseeMC?(featChalice)
458,331,632 *2E830CA2E5FA661AC450E0BCE57C5494CB9B8C24 6ELUCIDATES
458,331,633 *2E8DFBD79D9787B2B460D274CBCFAE028F2955F9 KIP.OROZEO
458,331,634 *2E830C04C2297988EACB949509D33C83D3F19269 KISAN1
458,331,635 *2E8BD0E62EF79EED17DD5D653AB57A2C5A66C831 6SARAHSAWICKIUSAXSARAHXAOLCOM
458,331,636 *2E8B1D23BA55526ADC2AB3399DE343215765FC9F 6SIUBFOOTS
458,331,637 *2E81CC02CB4BF988410077B32E37AC5FE8588655 6SNATERBEKKENS
458,331,638 *2E83B1B26F97DEA1D73B459D6C96BB4E8E5CCAFE KOLORIMETRISCHEM
458,331,639 *2E80B2C8A7BA2EA17431C77B1DE672B6BD665306 6SVRDDRAGERNE
458,331,640 *2E813629C806CCE7F33F27123132FA03D32819C7 KORACAHU4
458,331,641 *2E8C97D276BC81E54537878C7DA8686333D21A0D 6 YL
458,331,642 *2E8CEDD72A1662F26816139BFA4AA55D55DB3151 KRIMISENING
458,331,643 *2E8B51412F4811C637A30F2ED9D8A6D68060A2B3 [email protected]
458,331,644 *2E8D8D105D92B7E29E3D7DE13B8A47BFE8F5BBE4 KYYNISIMMÄN
458,331,645 *2E8C1F44CE5B1B89532F6E7A09345B20CCE293AE 7LAOGONG
458,331,646 *2E833E3D968A7BE28A04095CD163F367047D076D 7MICHELCINDY
458,331,647 *2E8490C03561BE8B83076177093182EB5BCB871F LAMARITALKSOUHANE
458,331,648 *2E806AA2A03085614806752D42AD0CCA7B19312C 7MYWALDO4
458,331,649 *2E8296DEDF3C397D14119C4C9E271834BB31E408 lanthony
458,331,650 *2E8AF5123E4A0EF5DE88A0ECE9A0C64902B09E8B latakias9
458,331,651 *2E896B31CE0D938F2A615F4E13DF10BB7C296B08 7SOMETHINGISMOVING
458,331,652 *2E88FBCC89ECA161C941FB60EDFD2A530869E655 LAWERENCE.DESO
458,331,653 *2E806B690ED70D98CF15A0DF3C26A2A72A7454C0 807OSCAR
458,331,654 *2E816E6FD11D83C9822B23E2DA05AF4B08C3ABA9 les fleur (fug reedit)
458,331,655 *2E8658E2F9C6772735E7046ADDAB8BD1869D20A7 LEŠTŠOVA
458,331,656 *2E8865371562CA79AE60F97611E9A874C821765C [email protected]
458,331,657 *2E8462625EDE5E238EFC1D26FE2303E9CD458458 [email protected]
458,331,658 *2E83DB185BCD31F902A6AC7FF8DB8C4969450CBA [email protected] ~O (X)
458,331,659 *2E89F59436292435B5719CDEDE25B0B15E05B5F4 LINCOLN.SAYAPHON
458,331,660 *2E8520697301DEEE93D0EE00133B70CD3CCF49D3 LINDSEYCORDONA
458,331,661 *2E8293288D3F6368757CA879C2BD921D3B433866 8p.`~)x(
458,331,662 *2E851CA193BD1942E9E42308700E2FC9FFC2D796 8SHALOMFUN
458,331,663 *2E8B243B4548D3246873C8A41A522C343CE3F67C <Li>STaRT.X.Via.<CoDe>XiNiT.--.-auTH.~/.XauTHoRiTY</CoDe>
458,331,664 *2E80AC7F70DF1A2721A366342A0F2AD9C7CCD68A [email protected]
458,331,665 *2E8271A669643CF65D0253F24BA52B17EF5EDA45 lmwu
458,331,666 *2E895C8E093FCB32D321A8687EC902EE73092DF5 [email protected]
458,331,667 *2E82B8606FD1E7D6D706AF0484BC82188CF96EC0 lonkrabbe
458,331,668 *2E81B33F5F01A9AE2737A023671378C57B50167C 9CROPLEY
458,331,669 *2E8257348B5F5898CABFC32A292B4A54A850CBA6 LOU.WHYTE
458,331,670 *2E89B467EC9DC68CCFB06E61BD0F934D4F3638AD 9DUCKJACKIE
458,331,671 *2E8773AB0DB8B74738D1318559FF2D71F9EA3842 lovevit1
458,331,672 *2E83A7A61E9F7393C6EAC4CE6895EFCA3FBBD63D LTGREENSLADEKENYONE
458,331,673 *2E8F88759A6947236B928D8CC5D8A9747261D801 9HYPOSTATIZEDS
458,331,674 *2E831CF7139924500E36E94D91FD73F5EF927E63 9NEVINNYM
458,331,675 *2E85156A82449996ABC19DF0697292B8C8FF2094 9OPERACONCERT
458,331,676 *2E8A9FC7551B3FF018FA251D55B4CA47C594826F 9PIKTEN
458,331,677 *2E83B57687FC2243CD5A2845CDEF694A3DC89867 9RANGERC
458,331,678 *2E8F9C958B001D1F69A43925132718164AB148CB 9SEATTLEMITTENS
458,331,679 *2E8A06A52253D88B26C5B97D7B5243926816F495 [email protected]
458,331,680 *2E8CA090A27AC43BD14670652C157519BE812736 A1?
458,331,681 *2E8AEC2436B43BB9BE56359EA4DAA5267C51D523 lutsista
458,331,682 *2E8A480D375B44849BBE06F88039A6A683EA24CE lynwoodeickhoff
458,331,683 *2E8AE6936DEC9ECD0F0AD80EBAF3A691BC54AD9C a=6j-
458,331,684 *2E8DCE6B3F3CDA7D091AA20C99B9C59D678CA7A8 M7\G
458,331,685 *2E8479316E8F2791A74B53BF318247869E5C74BD AADS`
458,331,686 *2E82EA12B2532DA8038A47A6FC0B5283C0C0005D aaph/
458,331,687 *2E85D5F3EAEFB721E0B3BECDA0892CAEEAD827A6 MARIAWEITNAUER
458,331,688 *2E87B693F9CB5707D0462ABA3E04C80CBBE16FD4 ABEL.GNIEWEK
458,331,689 *2E8E8F89C1765BDE7C1F60A809357F5D9912D642 ab.ovo.usque.ad.mala
458,331,690 *2E88B8EF87A37288831201A3EAE89E0BEA6FB669 ACCOMMODATIONS--AH0-K-AA2-M-AH0-D-EY1-SH-AH0-N-Z
458,331,691 *2E81F9B3A5A93723DAE45FCFCDB4176DD2D6735F ACCREDITEESES6
458,331,692 *2E801039B7DE3013C811816810315A6DBFFF535F achromatium
458,331,693 *2E8F5B8988884B2D10DCC4DACF01B585622E11BA MAURO.PROUDFOOT
458,331,694 *2E80FCC96558366497D6D42B30984802952E1059 AD90`
458,331,695 *2E8DFF9D8281A5A39D7E17C6BEB6EE2D2378D691 [email protected]
458,331,696 *2E88DBA1F69CD422339FE2ACB753C0783891E418 adamsimson
458,331,697 *2E8D7793FEF1542FDA44BD52CCD4236D9266CC95 ADESHINA ADETAYO
458,331,698 *2E8D6B6243FD3FF1B9E089E1CA37315D242A19D8 [email protected]
458,331,699 *2E8EB264BC1E4B99418C5E14345274F6276C71D0 meditation6
458,331,700 *2E8A2BABCFEC6C53FD2A9EF2FF3065654309630D AF9(
458,331,701 *2E8EC36AAD56AAFEC62443FD73E0AE9F65F26643 AGrovyKindofLove
458,331,702 *2E868E0EFA7E33D5F3310490943A04FF7D7D7DA7 MICROBIALFUELCELLS
458,331,703 *2E8BD69EB8BBE38E7E2BB292E7B30A5EA6087AC9 [email protected]
458,331,704 *2E8CE23E335AC4F9B6F8DDE823D9CC1526CBBFA8 MINIMED.COM
458,331,705 *2E88D7FF809ABFD934DB1021F8209BF31992EA65 AkMh
458,331,706 *2E85C5E70A6085973147C1C14143280FA46D7CD1 MNEEHARICA
458,331,707 *2E8ACBD1D3A65131F2FA48E8A3D8B08AD2887ABB ALEC.GUTZMANN
458,331,708 *2E8227E3C4184510C87165044B7C322DF11BC62E ALEXANDERVALOIS
458,331,709 *2E89AD2C1D011C046A6B5AEF8A38B6EEC7A9CCAE ALISTUIVS
458,331,710 *2E84CC04EA6B4E870E50DE417CF2283392115447 almachesed
458,331,711 *2E8D8A75708DB340B2CF8D509EC72D14683C4083 a.mb3
458,331,712 *2E84FAB32BFF6FF5590A6EDACB67F119607CEB34 a&md7
458,331,713 *2E850DC8ED0315FF26C9F03E53386CF9AAC171C4 MYPARROT16
458,331,714 *2E815C02D83BE766C8DB95159D5994FD16FE8F81 NADINE BURGOS
458,331,715 *2E81ED2937F89F604A6CDFC289995B3EB1D850BA [email protected]
458,331,716 *2E84A68A62A9D818909BAA16F14BC608070B230D an$"e
458,331,717 *2E811C0CFB322ED6261D29B19DFF6526B26F6348 NAJUGLEDNIJEGA
458,331,718 *2E80FCE812C53DA3161088843B2C198613857CF8 [email protected]
458,331,719 *2E8B8DA98CF1DF4F5E9B7C74AAE81326DB479E89 nathanaelbollman
458,331,720 *2E81BA8E652408D49161B676FB8304028FC4CD1D NATHANNAVARRETE
458,331,721 *2E841789CFED7FC0CD3938F73559C7243C11717E nc;
458,331,722 *2E87F5FA19E97D6FEC134D836556B58A40486234 AOGCL
458,331,723 *2E8495F34A026B07F959E0AB6BB42C84D9B6B254 AOQ0
458,331,724 *2E86A2C477B8C1F35651E5C5408103BE0B78524A [email protected]
458,331,725 *2E8051DF384F1AEA672B84D90BA7483F3C0A6272 APSCOMPUTACIONLTDA|COLOMBIA
458,331,726 *2E871970A75C45FF5CAAC7F5A4673B1EBA479121 a-qhk
458,331,727 *2E8B0BD411A1115DA4B7166B5E4DDC3FDA8562E8 NIVEAHM
458,331,728 *2E81983A7E70C904A4A437882323A5F7E161D8B0 Nods
458,331,729 *2E84EFA28449999F29A3058805F3AF74929875CF nordia.walker
458,331,730 *2E89B1B9BB5F37592E236FA48CB4E2A8BF221C66 normandlaning
458,331,731 *2E835C201F661FD27E87BE0DEBEE04B39079804B norrisspearing
458,331,732 *2E8269907710CBB9E01D82D93BA0C91A066DA005 armandoduffey
458,331,733 *2E89E76B435ABA88F62655A85319E2B1456BCF5C armazenarias
458,331,734 *2E87F407227A53348A36D679162BC1748D969A2D ARNOLD ALASCO
458,331,735 *2E82E52CAEC43CC11CACDF8C7934979CAA2A1B35 arnoldbaisch
458,331,736 *2E8201BEB11E3013F64379E229871527F4C5D44D ARNULFOFAILDE
458,331,737 *2E86764039F25F6428C42A7A6D79731056314EB8 [email protected]
458,331,738 *2E88E0287121DACDD4613127C36891764B3BC74D [email protected]
458,331,739 *2E841F6923912F2135511750F3E3DAE32A42B2B6 [email protected]
458,331,740 *2E8C6DA3A89DDA7852F539CA6652E55EF7D53E40 [email protected]
458,331,741 *2E8A56A4B62EE6200FA095D92057C1E01ED1EB4B ARTWHITTENBECK
458,331,742 *2E81D399325CBFF222A4607E368D736F151EB6BE as40i
458,331,743 *2E80FF9B5197CB1F0FF85F33E5F9137520336A35 ASIDEGRACIAS
458,331,744 *2E816A31A7D1D0F2C054A70C4658B8167269598D ATae
458,331,745 *2E81B4CC6D8E444E0FDEDB99AEEDFAE061B1B40C [email protected]
458,331,746 *2E8C6F3232A01EC0759AD4862A6BB6640E362AB1 OMOTHABENG
458,331,747 *2E88BA1D7589FFFFED841E4F8CB911FA27B3904F ONCELOT
458,331,748 *2E8DA31564DEDB5827365501AFCD8011B05B95F6 [email protected]
458,331,749 *2E8BD45BE4014CCBC3A44EEA9CF9265248BBE380 o->-<[email protected]
458,331,750 *2E81962B235F09B00CD7CD9F97CBCB3AA1865E92 auheuden6
458,331,751 *2E815B5FA97CF804AECE1EB9477E19D5082BC10E a/uk-
458,331,752 *2E8C1451E86FA8BD19D29C59E86308A0D100922D awpdb
458,331,753 *2E836228E67E1E960F118E3C98BB2B3D129D48FF otapiok
458,331,754 *2E8F79B74E76B3C1692C8104B00E3AB088BC6303 PABLO.BAILLEU
458,331,755 *2E86607D0F713E9FB74B8571B3E3E2F07574681E b&1,o
458,331,756 *2E86E3B58B9A2FBD30EC8A544F6FFB39BE15BE3F PARTIALRESPONSE1
458,331,757 *2E8B71CC6BE2F1646036E815AD2F43ECDE908F73 b96b
458,331,758 *2E8A6C69C1E2F5D92D412151ED92491177A90E94 p==b~-`3b<-
458,331,759 *2E8A0CCAECB578B2EAA78CA99098F717938331CD BAR-CHICOTE
458,331,760 *2E8DE51646F2A98F4BF7EDEC0355846E43176CB0 BARLLOW.BBS
458,331,761 *2E8219B8377A9E832F9A5370FFC5BBD6EDAA86E9 BARTONBOORAS
458,331,762 *2E8A2B8D49057E38798ACC7707840151E29EB81D [email protected]
458,331,763 *2E8FA0D333C94A9BCDBC2882243F75749CDFA400 PERLANYAAN
458,331,764 *2E8E141860FE6E31DC8FB54FD17215F190CD1722 perrydreier
458,331,765 *2E8DF5A76E18A7ECC63F00A8F005B78BF71B0371 BB)0
458,331,766 *2E839D0F1E4E062B6431CF318CE8C90D44ED04F5 bcaui
458,331,767 *2E82FC7FBA4355A6E50027EA080A77D7BDC571E1 PHIYKIE
458,331,768 *2E8961565F04E5F557CE9C27AFC63262FF144C54 phonie$+
458,331,769 *2E87FFB16B1F23B9E8D167DF03035014DFA14AD3 BEGE2000
458,331,770 *2E8A8415D05D7824064C7142AF0785D8CBBFD4E7 BENITOSOLLE
458,331,771 *2E8B6AC1535D5C670244F5EFDF796C5C878C1EA5 PLNITUDE3
458,331,772 *2E8BBDF1290219A42861B17E29C88A554D71780B PO11ARDS
458,331,773 *2E899701645CC54F3CCBE8B301E62636B1377599 BEW
458,331,774 *2E80836FD7F18D23254427DA09C2AF9B004921F8 B&FML
458,331,775 *2E882A38DE0AB3DF72801CD9D91F07644A9F844E Pritiskom.4
458,331,776 *2E822DEED9D00E6E63E458229CE4E343A09E774D P--)`~SPLAT!
458,331,777 *2E83D003F22CF97474D960D6DBFF12BDA944990A PUBLICINFORMATIONSYMBOL
458,331,778 *2E8F8C79485A164A30B0F20F623071E22F8F539A put-the-boots-in
458,331,779 *2E835FC6D368D91C414FE2B83795C6BABC51FF9F q------>~0~o>-b0
458,331,780 *2E8734FF193F291EEF98C4D65F83CB798A18D7D1 b-+kq
458,331,781 *2E8B9FF924637D247E8B89C780B966177E4A41D9 bkx_e
458,331,782 *2E8CD592D7D1ADE5A669FBFAC2ABE85A5D161A65 bl$cf
458,331,783 *2E8837F383919DC8A67872FBD6ACB86268C1DAF0 QW.PUPPIS
458,331,784 *2E8FC4FEB50733FBDED1B1B0EAB404611CF2F398 BM4J
458,331,785 *2E8825682CF1E1C34601EFBC89ABFC13F12FFE50 R3APPOIN+IN9
458,331,786 *2E8CCA5888E6DE207BBCC17F639122F4D904561A b,n,a
458,331,787 *2E84625293310BC315E7630792508CA0CDCB8799 bo9qg
458,331,788 *2E82CBAFF9BB29BAEB94E3EB10CC01BB50F76D06 bom#6
458,331,789 *2E8C0092FBFF689A4C6684EF63D55F81E23BF76F BOOKERLARENCE
458,331,790 *2E8B3374E6B97DEC4DF9F7DE0DAAF52C48DB5AD6 [email protected]
458,331,791 *2E82653CD0F1C63F2A7C9F029BE9FC99B753D156 BO!.R
458,331,792 *2E8949418B1B3015DC08065BF6B76387C3CC4A78 boudary6
458,331,793 *2E846DE93FC2E07A8BDB6916DAE60258A7AF8078 BOYCESTRAUHAL
458,331,794 *2E86DE21373FF778168CBC552B731DF86F6C8486 rbaraespana
458,331,795 *2E8532C2E7E9F9BEF2E39619EF709BEA84DFAD1B rbol.de.la.esperanza.(frida.kahlo.1907.-.1954)
458,331,796 *2E8B5C8F45F32156AC386C203D3F2A7D653A5BB1 [email protected]
458,331,797 *2E82F98CAD2CB9E66E1E5A4D8213102D356027B1 BP.~0~O.><
458,331,798 *2E871DBA42668B545B152982C39487E0421E4ACF BQ!LK
458,331,799 *2E8099EDECC65DA1BF0B162CE7348762237D0283 b-r&?
458,331,800 *2E82A587466BD94C6DFA4E887E2D93CB95E204C9 BrandenburgConcerto-No2inFmajorBWV1047-2Andante
458,331,801 *2E843B81B13A04C7C499A25E8EBF4CFF70233831 REMMORERAIT2
458,331,802 *2E8443277389C2C031A80F295C69B328662CFF44 REMONOPOL7
458,331,803 *2E8FD57C44A9BF5904017AB39E5B002EE59425A2 [email protected]
458,331,804 *2E868765CA88B1A78D7C5C719A59BFCC1E67058C RENGELとベース、サクソフォーンのMARK
458,331,805 *2E84D49275EAF46431C62863F787EAD4B4116329 REPLIKATIONSMECHANISMEN
458,331,806 *2E88E2BD1B98CCCF093BEFB1031015C157280B9A BRYONNOERR
458,331,807 *2E8A86DA6AEBBD8A9A77C74000A6B45893360AEF RichardEpling
458,331,808 *2E85F6DFD42CC89660FE959A1282881B6C69EA62 bs?p7
458,331,809 *2E8D32ABF690E80D9A3DC1D5106FE5E63EDCB6A3 RIFAZKHAN
458,331,810 *2E887A72A5E57E2CEC2BA8C05AD81C5873269CCC BSWENOTSLIA
458,331,811 *2E8B6B2A0C62853E26F3F3BD6EC30D37FA270096 Bt,.
458,331,812 *2E8AC5E3B786ECDB4D52D0A492D17C4212E7609E BTRLJ
458,331,813 *2E8261E11B08A340EF5E47F99BF6BC2BD5FF5FC4 buddyraff
458,331,814 *2E8165D98DDB9307A51F8E6B3D719FCBCE9469F2 [email protected]
458,331,815 *2E81DBEE189C5D4DAFC1053F6EF0616B41712488 RJ-PASCUAL
458,331,816 *2E8C83ACF6B27D8155B07F4FA4D5632E106DCC90 B)UQ
458,331,817 *2E86597D7976B0BFE4EB6E9843F57D9FA6C89508 burgesl1
458,331,818 *2E8A97AB147CD0F524B0E47BD7ED6A0BC523EDD7 ROBIYATUL.ADAWIYAH
458,331,819 *2E8483547A4BD4D18BD8ECA0360F1BA1C4D7F44B RODRICK.MROCZKOWSKI
458,331,820 *2E89F60169B0045CDA4D4C3A6DB885C68688C14E RODULF-HARALDSSON
458,331,821 *2E898B36B44C750D70CE645C994B726232DDCA77 BVW&
458,331,822 *2E8EFC153C9FFBA42AE2F3CA024E2E2D97432461 C=?1R
458,331,823 *2E8DE3F8D0BCFF9D26970AD67E7304BC43B11DE1 c+(2d
458,331,824 *2E82F47B48E0662317161DD517BA21E1A55BEE4D RUDOLPH.REMAKLUS
458,331,825 *2E8042E0B1AC7334710CA39C8BF06DC0A9C3D66E RUDRADUTT5
458,331,826 *2E8A8C6565EB5D89C844AD6A42EEF36130433DB7 RUIKT5
458,331,827 *2E882A9D99C59F57D9F9F4160A37AE513B36104B C4L1G1N4V45
458,331,828 *2E8EA538ED3DCC27273577C4A31500DCEF28A3FB russelmicro
458,331,829 *2E873F256CDD375616B0A959DC0C9404EF85B767 c)4zr
458,331,830 *2E8423EF0E88ED2B9CFCAE1D2ED885F2C9DEF4C1 c6ti
458,331,831 *2E8AE34F38E7E26C9CB6E241C7CF6B157F04F041 samuel.johny
458,331,832 *2E8991E3622BD78C67C6D545635CD6866E17D6E9 sangmomper
458,331,833 *2E84FFC3C7B80C300DBD6154F49D80D11D34D83F SANTOS.SEANEY
458,331,834 *2E81CA38541C438B3CE364F5519CC68E305FBE13 caneriverrock
458,331,835 *2E877EEAE9FBA371185643BD4A363E5762F0B7D2 CAREWOUNDED1234
458,331,836 *2E8465AC0FC891DD67DF761F9170913968B0B663 careysantoya
458,331,837 *2E8B40F09EEA9581871609BF59071E16A8C2AD6D schmos4
458,331,838 *2E808507D01E55D7D293E12287BC5A844AE4D8A2 CASEYRIEVE
458,331,839 *2E85192EB69F665F046424A6DF2E2D9C3A1D41F5 SCRASITE9
458,331,840 *2E8217F397F0B4E1343DA937FB84CD9213FEB30A Se4tn9
458,331,841 *2E876A1C9C7B55EBF7521DA440F07EA6962B770D CAVALIERKINGCHARLESSPANIEL666
458,331,842 *2E8E3264D34C5F954ECECA475F42B36EA812C693 cbnj
458,331,843 *2E8372E930516395FB89A973F39BB0556702C8B3 cdilk
458,331,844 *2E855F68EC9831F0E75040FA9C89124B5D09CBCB ced-,
458,331,845 *2E89277A942BC801944D115950A90D9F13182870 CEDRIC.KATKE
458,331,846 *2E8507A7EB612DD9A2DFA4ED3D0ACC9A9F0FE7E2 CELL52X
458,331,847 *2E833EC417498B0D3B9F2A1DC063484ED69C4354 CEN4
458,331,848 *2E829346F62BE69667077187AC1798ECD5397D78 CESQP
458,331,849 *2E8C8E05F159CEE0D5E638D7E05FC01133413280 CHANDELL6
458,331,850 *2E869EB5AC7076A5058555D6A5BAFCA6FCD2FE4B [email protected]
458,331,851 *2E8C50D294AE01E4245AF1B08E1CCE4B7EA2F144 [email protected]
458,331,852 *2E8EBDFC8DB97BF45DE9195C2091E2B987A030BC shiv:stealyourown
458,331,853 *2E8B34063293D88FA18ED99B6990451B83471AE2 SHONSAMPLES
458,331,854 *2E818EB1471B593D7CC3876A113573D14BB9FE73 SHREIF-TAREK
458,331,855 *2E86C2FF0551A74F678BF2346138BD193A8437AA CHARLIE.BEHMER
458,331,856 *2E8E78E8A6CD55659821758AACFE31C103F2A94E CHASE.MERCK
458,331,857 *2E83F09C07BCCB80204E698A74028BAECDB1F4E3 [email protected]
458,331,858 *2E833BD70C23D1EB964AF38AD01551EC72A6499D chereta9
458,331,859 *2E892134E0606155700722C02A9C089089F50D1A CHETSUNDBLAD
458,331,860 *2E89F71DE2586C574239A611DDBF4CB14895427E [email protected]
458,331,861 *2E81C7FFC63C661A9AF590FE6BAD5E5654CE2FD4 chol?
458,331,862 *2E81778B2785575EB75E304F8F717C07394AC59F SLOPPY.GRAHAMEC
458,331,863 *2E82DEAAE844AFFA1AA781AE06BAB29977E90A7C SMÀC
458,331,864 *2E8E9B49493502A946357DBC96CB8B4E9146D295 christian-sumampouw
458,331,865 *2E8D2F5667333FE734CE6CA426479091C221E3EB SMILEWALLEYED
458,331,866 *2E84A42CE42CBEB542BC91E39F258DA3DB9FE608 CH$U0
458,331,867 *2E817F18470C1668D347249264A559DE6196A038 SNOWMUFFIN
458,331,868 *2E82308FDA046AC576F598F650FAE078E7F59B57 SOL.SPEARS
458,331,869 *2E88FFE9FBC8EE05B9A835C540AB1963EEF10764 [email protected]
458,331,870 *2E8BF34A805201B46FADE9E3EA7DAB6FB49BD545 ciu.3
458,331,871 *2E8E3A744193805F062454FDEA072D76BDFC9126 CKFIH
458,331,872 *2E89A61AC3A15FBF85E90CEFEDD60CB2521E2725 clarencebuck
458,331,873 *2E8FE60A0D37325A577A42346ADC3CAAA32EC271 SOUGHTTHGUOS1
458,331,874 *2E86AF37092DA71F0293831BB6556EA2D65026E7 soupith
458,331,875 *2E8D87046D7AE040378FD6B5D66272B7E4C6D770 speedymacha
458,331,876 *2E84EFFA2E2E7AA17C3E8F31394FC4E9AE992ED7 [email protected]
458,331,877 *2E86285B34DBB1626F76834533A9AF612EB528E4 cmatf
458,331,878 *2E8388A6983590967F2C42CF9294A1E8738B59AF SPOT PUBLICITARIO
458,331,879 *2E839FBEE0A6AB3A1013A4DF1B9134FBFAAD1F9E src="http//cxmgsmzncm/mgs//215qjwnt3l_115_jpg
458,331,880 *2E8B3194C09B230F8C77D5A98B24B20A82107CB3 SRGFHF8
458,331,881 *2E85695CCCAAF2C69D5030C8A1987701AD130DDE [email protected]
458,331,882 *2E8D07618F219CCE7D1D1921B475F17AA1156C8C Configuration-Control-Board-(CCB)
458,331,883 *2E892AE4CA41DF278BA16BD4C8A044C20AA45B1B stantonorendorff
458,331,884 *2E85A4641F74DDD6C4883D0376BCB6CFEA29A1FD STARKOWSKI
458,331,885 *2E83D98F9C8A62F9B32E10072BDC2FF00623E23A CORRIPH
458,331,886 *2E89A7852919C60CC04181CCC6B1C71169DFA0AF CP;
458,331,887 *2E82282F208C49BA44CA6745634B2BBD6F7D58B2 STUDENTCAR
458,331,888 *2E8968E7530A96B2847AEC575D02F05D4381A0D9 Suite n2 in si minore BWV 1067: V Polonaise Double
458,331,889 *2E82723127D1C84F9E7F1CB9C3600B85527EAC81 sulphotannic!
458,331,890 *2E833B99B0A7D6D45C68BE3924115CD0D480E979 c:rgo
458,331,891 *2E85DD60011BDD6E0057F4C65A6BE0D329115F71 SWIRLED7
458,331,892 *2E8D0EA8C7A500E7D4BE86F727B3B4625DC38FD9 crystaljeremy
458,331,893 *2E8C0C76DA49A9273348C964CC723DE7CFB2C767 TaraMascara(Supermarketsedit)
458,331,894 *2E8B14BDB8428CF41DCF5E63D9D1653B10513ED8 \
458,331,895 *2E8468468A190626C850B2BBF13DAF299AF4F12C TAXANEBASED
458,331,896 *2E80B3B9552F533C1093351AD3340C27AC3ACDE7 0
458,331,897 *2E8D85025059EAA67443D4129FD32C5FBC543C94 TECHKATHLEEN7
458,331,898 *2E86940D8BCADA3951018516E8BD027DCABD8AA2 )
458,331,899 *2E862D409DDD8F89B954EBBFE65F5B423EA3AB86
458,331,900 *2E87E4DAAB236593164BF5C2810025B281E1519D
458,331,901 *2E817AACC7896755A01E427825626BE01DCC7AB4 TERNEYED7
458,331,902 *2E823DF73D862A89CB8BC6378F09FE3C9287B290
458,331,903 *2E82C38E4232A684B4E8A4F67A24F7A80CDEC971 :LƝN
458,331,904 *2E82DD796F27D496B9D247C8F0472B1B9B20DD80 P
458,331,905 *2E896B09E69614F566A7817B1C03B2ED98C4582F TERVNDERED
458,331,906 *2E8C39ADE5E53F2BFB1B31FB7D9BF72E17AB0BAE N
458,331,907 *2E8F499B4B2F0FA7E6FE8BCD98653F65A02E1D09
458,331,908 *2E8C4AA15789FE68F75DE930D852EAB421910E29
458,331,909 *2E887A51CAAC969658E67D60D3716CFBF16C29A9
458,331,910 *2E86BBFC13B0B00BA9E899178B67105A51A34024 C
458,331,911 *2E865D086E14D63FD169A6098A29C184190D6C08 l
458,331,912 *2E8B4D4A15EC2299C787579CC812CFD1ED6E13B4
458,331,913 *2E8E3694F7CC9209C0B0309BB235E3826CD66D48
458,331,914 *2E842304AB879B42EF8F8E08A0DBC7EF320EDD9D v
458,331,915 *2E8FCB3EFC64169BFC6191283A7B392B65EC8435 THATALBERT7
458,331,916 *2E8AFBA74B80C87A911E5541D5E1DEC8C821AE52
458,331,917 *2E8372847504A512803C6625FC063C9E80FF4B72 thattamtam12345
458,331,918 *2E814B8B76D21FCCB891DA7BFCCEC3F1FD19C39D
458,331,919 *2E802DF0ECFC69EEB25EC5AF6EE43BD8E9218E61 |
458,331,920 *2E8ACCDFCF4D5D50C922C1A640F37ACD29E4F94D
458,331,921 *2E88F032D4D8F048584F8AD1A2D077CD6813442C lg
458,331,922 *2E83FC0309616279248AE41A6A5F64A6B65435C4 THECOMET19
458,331,923 *2E8DE2FA7B8CEBA0919EA53E47C904F93DF67FD7 s
458,331,924 *2E81E49D1C48050E0A5D9315EBCE98F3C0F35AB3 d
458,331,925 *2E85F844EBC9CC46FF0E7A3CF6525B98CEAFE3A4
458,331,926 *2E8B73F0ADFB7CAB0D97F4EB02EC289ACB6F89BF
458,331,927 *2E898FE5F439DA9614084232CC2FDE16AA550C03
458,331,928 *2E86E35BD21ECC195AFDDCD9770FA38ED289BF79 h
458,331,929 *2E81625877DB98AB4B123A0A906A09178CF328AA THINSULIN8
458,331,930 *2E8E31FD8C128983B9A289EC2862CCB9EB304CAE ;|:I"0A
458,331,931 *2E8BC5C85CA889A79855427AF18D959CC34C1FF7 n
458,331,932 *2E8F8C07F5DCA22F1D5D296240407E946976F95B THROBTHENCEWARDSTHRILL
458,331,933 *2E8638482344010F55DA427CE65A5237B684035E thurmtor
458,331,934 *2E8F183A6013BB46FCDAC044EF68BE2956B32FE7 [email protected]
458,331,935 *2E8A4082491925CA4C4231BBE5ADB5B02B2B8720 Jm(
458,331,936 *2E81984086EF6935EA44D6AF66B10F6DC8AEE6D3 TIME19560102
458,331,937 *2E8DFFD885D57CCE5C534FBBE3748ECE1210A70D
458,331,938 *2E863DD8B02F1C5CB1E0A358F3F07CA00A81E7A1 <TITLE>GUIDELINES.FOR.FORMAL.VERIFICATION.SYSTEMS</TITLE>
458,331,939 *2E89AED0C0BAB5ED7E2DBE7850BBC8DE117CD74D 禅}
458,331,940 *2E851C3D8097CF452D6BFA126AC600DF07F04E0F
458,331,941 *2E87AF9B2D0AEB5A3A35ADF48510402A2DE64E68
458,331,942 *2E85BC7C4C69B461EF7EF405128A5AE2B54D1F93 TOASTIFF
458,331,943 *2E8B9237197FE05B285E1DDDF8E0047E3C15D526
458,331,944 *2E817B411704610928F5A4BF4ACBE873C1634D7C
458,331,945 *2E882609D959928D5931A661D48F5348B96E8C02
458,331,946 *2E84A42771E8E80D38A443AD36F0172472569CCB
458,331,947 *2E8F96AC180426BE0C9C61A7057FD75B7A6EAB1A
458,331,948 *2E8A66CEA06890119090D5BDF6B81CED53E6A056
458,331,949 *2E84F757B00D10AF952AF53B1F35CA1489571E11
458,331,950 *2E825FD91198058C188D71DDBB2611BF784E84BE E
458,331,951 *2E834823CDBAB033E616F1DD65A0DF5D7F74DE87 tonyll
458,331,952 *2E8E6C5FD2C30CC92344EEC51EA26228022E7B17 3
458,331,953 *2E843A070F2DB687C275EE7F34245A7E4E8E3253 TRACOLLEREBBE7
458,331,954 *2E856D995E5C0B4C28E317613953B6807D705EC5 014BRENDAN
458,331,955 *2E8AD61E508208BD60075F5BB4DA67F269F59B05 TRINITY.TEMPLE.CHURCH
458,331,956 *2E855B2C9593314B8F47A1A211C55FD3821C41E9 TRISHAWORD
458,331,957 *2E8962D25A645F63CC647464E87C112692D5B7E4 024mia
458,331,958 *2E8488C6CB1E7A764F1F095563E3E692E4F6E2EF 06-02-1864
458,331,959 *2E81C966B73FAFD693A18AF16A1D66D3044BC67D 1161759 nimimuutettiinarvajanurheilu-seurary.
458,331,960 *2E89404B6C536A16374E4E1FB4E8CF2B45F731FF TYRANNOSAUROIDŮM
458,331,961 *2E8DE01B7F310E494D26ECDC64AAEB628C51AC3C UANCLE
458,331,962 *2E8C0822417FC9EBD5D2D08151D51FA78DEDDC4E 1213088 automatiikkasaatiinpoisp
458,331,963 *2E88B1EA0A3ED2E654EF87C447DDFE4CBF4F4DA7 126goat
458,331,964 *2E87DB8267BE248815E3E004965CBEE2756973EB ucitelky5
458,331,965 *2E8FCB6821D9B7CF367F0B44A5A0CFAD42194520 UGALZ
458,331,966 *2E8EA51F2D371C1DF78548C48BDA79EC13C8C32B 156827 herUreticibirtUketicidir.
458,331,967 *2E829177BE5FD8DE13F7CD0096BD6C3DA40AFB41 158887 balik,kurbaga,yilangibihayvanlarlabeslenirler.
458,331,968 *2E8F89892BB3BAF5E11FBE6C46EC75D7EE91E69C UNDERP0SE
458,331,969 *2E8282EBEA6FF8341A1A463C218171E5DEA1FC21 15.TEWAAG
458,331,970 *2E8E42D7CD451C13F2A8B02363E714B9FEA8447E uninstructedness!
458,331,971 *2E8A146A6E168CBC14D1F128D0246AC395681D52 unsubjecteda
458,331,972 *2E8B1D2996C22493446B9AA9F0D09BCEE3F619DE UQDPGQSNZIR1
458,331,973 *2E8309782A6E63EA5D6A6586014B5DFFB6BDEAA6 USERGHOLF
458,331,974 *2E83259C7279E4A615C37B9D15066832A8408685 USER_USHEF
458,331,975 *2E840C16BBC507BC9A5578775B559B6F37856DA3 1AUTOBAHNPOLIZEIWACHE
458,331,976 *2E862E2C02CA74A651330DACF702468093D8A4FF UXPF
458,331,977 *2E8AA4583C8A8D628F948A6B2B14E1D4EDD1B5CE VALARE 2 0
458,331,978 *2E8DF56288FABC7A246318E1207934ABC799A7DF valentineburdg
458,331,979 *2E872221F4F7216C35D38EB2D7D9C641643A0231 VALERIEWHYMAN
458,331,980 *2E8C0432CA3CE5CDD081728C32D8E2BCCC679CDD vangie-nakpil
458,331,981 *2E865B7CEBBB2C6455B50A86E5733F671DBD6D1B VARLEY.THORNBURGH
458,331,982 *2E8D29BBBDE7E5FA18554133F24AD644CBDCD9BB 1.HALLITTAVANAAN
458,331,983 *2E8F4BD7F569D47D7C168E7F4234AB4CD3ADAD43 1-HAUPTVERATWORTLICH
458,331,984 *2E81D395E3D2E23551C4ECA45F86DB1179073406 VERGALE1
458,331,985 *2E8A172ED28FDAFD5578702B558A69C65B773BC4 1.kaybederst
458,331,986 *2E8157E9D74AACC6EC8CE46CFEEF20B23CD8928F 1 KELLER-AEFFCHEN
458,331,987 *2E81E00F171EE18979397B9BA6F5166F34C2CBF1 1.KLUBIKANSAAN
458,331,988 *2E8A1E513DFD09A775EB1C17D2A686D9281364B0 1KONJUNKTUR-ABSCHWUNG
458,331,989 *2E8779D3B456B9E93FF88465B9738BC4A4E6DA75 vertretungspflicht
458,331,990 *2E8A3F42FDC3E3ECBF512E34B3E32DBB73D6CED0 vickipopplewellhooper
458,331,991 *2E87F214C5D2BFCEDDCB66473EA2BF2D5DF88765 1ROZRYWKA
458,331,992 *2E81D0061BEF48536990FD748ED3F99BCF06AA0F victoriabonuscladgeclaridge
458,331,993 *2E840D6F882EBAED1D953C4E6065516AC31395CD 1sandhamnissa
458,331,994 *2E8F6460028BD51892163B9AEBD7D21E4BFEC714 1spitzenkonsultationen
458,331,995 *2E83E3C6E9893B8D4CC036F714195B7A902F6A80 1TOJOT
458,331,996 *2E809D63B6590DA9C1802445C212B4C51DD4F87D 1URHEILUMUSEOTA
458,331,997 *2E86487B46FF9196CB8BFE40858B737FC6A0FBD6 vincentnaz
458,331,998 *2E84152029B2654402AA589E096DF3BF1378750A VINNY BONINO
458,331,999 *2E8C817568599CB3FBCC3134F18257CFA1F771B8 1yettooccur
458,332,000 *2E8975AC3D33551AF78A7E88DE06D1AD2A66A41B 1YUKSEKLIKTE
458,332,001 *2E8D66B1226D282681E8067DE6022E694F95ECB6 2142761 H
458,332,002 *2E862A9156BB2472A2DEC461A01F76482AF0D261 2154863 KUUDEN.MERKITT
458,332,003 *2E85C708FDFD92E6D01229AD4FC95253F9EA2281 21march1453
458,332,004 *2E8684275E41D202FCEB0DC04010F4575CE67537 23DEC1474
458,332,005 *2E8ABA93958BE7D96BDA929F50CD1795AC439F61 262465 muutokset-valtuuston-ty
458,332,006 *2E8425B5CCBF03D57FFEF8B63584833620198D6E [email protected]
458,332,007 *2E879CCA589D82EB56F1338059275FB526B7573A 269871 KAINUUKOETTIINVIIHTYIS
458,332,008 *2E8F2AD9269DEF0DDAB5D79C0CACF537067D2419 vvx65ubgreohf
458,332,009 *2E8BA91B04EE48270DABC8544A87B06712D33D40 2AHSUKUHS
458,332,010 *2E8C4EDF480EF465E5A4FAEBAB7F12D867378460 2-andIrIn'da
458,332,011 *2E8A4F7A1B4ED0FC1BECD9E2C7982C1376E1CECF 2.antifirst
458,332,012 *2E8AAF0CE761BC59145541A6BD1C352E94B48D4B WAAAAAAAAAAAAAABSW5
458,332,013 *2E8878B47F30AB966CFA060F7186AF7E60F551BE WAFAA-CVDF
458,332,014 *2E8FFC28B0D9DBDC399330D46C3AF816BF68A177 waldo-prigge
458,332,015 *2E8590B736401D80FB9BD13158A71D33902C21FF 2HEMADYNAMETER
458,332,016 *2E82B1BD978635DD2B8F883D9358CEDBDE9550E0 WALLY.MCKENDREE
458,332,017 *2E8364F3E6F844F742FAA47211A05A1D1A0A7131 2ilovemanson1
458,332,018 *2E8050E7BCBD3141C6F48B1ECD7A54B53531424B 2-ORNOTHOLOGIE
458,332,019 *2E8E45B7E6809C6195DEB243AF1C343F29339431 warnerallor
458,332,020 *2E840BD6F8CAB147D49089E687FC98669A2AB737 warpproof
458,332,021 *2E8E9E59FA985EDAE0EB198156778830887CD8E8 2 sportlerdorf
458,332,022 *2E82CAB0029ABC08EDBADBB546A177F83F94A8CA 2VSTPRKKN
458,332,023 *2E863BCA6E37D3EEF22FFCC213E09B113C4F8810 2YZCZBSW
458,332,024 *2E89968E67B69EB51F6052AF9FE45E8E91911304 3##@~.~.;)
458,332,025 *2E89F21E2CF04279599C49AD8FA5B69FD9A80F84 301500 DAMIT WERDE DAS GUENSTIGE PREISKLIMA GEFAEHRDET
458,332,026 *2E814FACA0298C36EA7F4E1F48425B645382E1E3 W"`E
458,332,027 *2E847C7C6EDC0292E20D65D8D06D2DD465E33980 34-VAUHKONEN
458,332,028 *2E80C59EB537A753D9A0E548C94DEA41526E3AC1 3amwaite
458,332,029 *2E88EE9BE1BB2993885441558D87DDA7E81E77F3 3ARABIZARA
458,332,030 *2E8FC43F4AD3FA8ED83965C87EEBB1EB61FFC195 wedijverden2
458,332,031 *2E848F91137129E7BA78544BF8F1CA08769BFBD2 3ILUVASPEN5
458,332,032 *2E845A3859C9903A941CD12D7CBEB5A73E36D9A2 3)~O.~o
458,332,033 *2E85B4E646B22107E6A3AD14587921F0A0A564B9 3RDDIMENSION/WAREHOUSEMIXES(DISC1)
458,332,034 *2E84597BE389343258CC4CD808E3AC91AE5AF68A WESLEYSPOON
458,332,035 *2E8C2CB213390BC9EAA79C33FA9341B5B54E6E48 WesternUnderground
458,332,036 *2E89A2F7F18E81E3C23F0D876164A3CC98B19043 WHENTHECRACKEDBECOMESTHEBROKE
458,332,037 *2E8EE349BB9A9140EC2391EA1D4FF1D6C3840F05 4DKHX8PUEOA
458,332,038 *2E8F97FD4A7CDAF4B50E2D07B995FB83DB26B5EF 4GNIWOLFY
458,332,039 *2E8C142161719C86A64EC4A5457965FD1C84F297 4HARBORPORPOISE
458,332,040 *2E8FDFCE246F90A65BF92EEAA29A841797265005 WILLARDPENGELLY
458,332,041 *2E8AF63BC6FAD16C76466072CBC58978001893B6 WILLIAM.C.MENDENHALL
458,332,042 *2E8B07EE6C186092AB7E5A974B5C457D0A23CB10 WILLIAMHBEACH
458,332,043 *2E8BDE1B91F4CF07F0AC7D9927AD6D07996C3169 williamscoltrin
458,332,044 *2E892EC9885ED5396C2E02C6BFBB1DB30BDCB78D 4MARIIONS
458,332,045 *2E80033D547F9A575F894B86844320D3D1195BC7 WILLIE-ERIYAH-DOELEH
458,332,046 *2E8960EB91846020AC74CECFD2BD30A651FCF665 WILLISDUROSS
458,332,047 *2E8D5B3C872E6D86FFD60A753C2D449E4522A336 4NIMTTIEP
458,332,048 *2E8587E3D69F2D2D979BC8A86A300877B3D6B1EC 4-P
458,332,049 *2E8B9ADC6640F40EAC7FE9B41833F4E4B5C193AF 4SANDHEDSVIDNER
458,332,050 *2E8A90CA3828773205B3A4E23FE740575B052E57 4schauberg
458,332,051 *2E8A58642CEEB3CC02311B2CBC95A89116860FD0 4UTFORMNINGS
458,332,052 *2E8EB9C0A65704801DBF00D40B5E19813E0B356E woo-gucci-woo
458,332,053 *2E8313C891D3A8F0F7142A9407B5A03F78530064 4VIOLINVIOLIN
458,332,054 *2E82C996850C1C2A1A352CEF8DC613A1A780EA16 517A0AD533BF6E90B87C2A7B100399BC
458,332,055 *2E8BEA0CB45A781F9CEC964A108C32C3B0B2D1B2 51N1MB3RGH1
458,332,056 *2E8B5B6626B6BB6A33BC0DF44FBF02279E054E82 WWWFRIZZYHAIRNET
458,332,057 *2E823C434C5D287F73F64101DA52E3497BEE9845 5ABCSMITHS
458,332,058 *2E8D675A49F5F508D15FC6FEDBF4E88859F3A304 5ACCENTUERINGING
458,332,059 *2E83DD14BBEC7A0F9581010771265D2E8A3CBB7A 5BRIDGESDRAGON
458,332,060 *2E820D8E2E4FA7A76B6BDD93C94A141FD4E25ED1 wwwpancakeorg
458,332,061 *2E870C046D194996A97F5D7496F6A6D4AEEDA42A [email protected]
458,332,062 *2E83AE946A72608940463AEBC3C4F7E6B0FFC085 5CHOUCHOUTERS
458,332,063 *2E85E08C4B7592F9FF08498C00FF08DC269732F5 X130C5
458,332,064 *2E8F5CBA47D497AEB15DB3ECAF2F7B19B87A2A39 )x(*-*-*-<=====3
458,332,065 *2E87034BE167DBF545F191027A6ED16B77F11BED 5EVITAROBORROC
458,332,066 *2E8FD423427813AF86DC4BE130DE2A7C16A8C4DD 5F63EA87-A1B1-3F19-9362-E7A50BDF49C8
458,332,067 *2E82A0F4D4C9757B9BAD9D25172AE3A9F23AA762 XCHAT...MOVE
458,332,068 *2E8AEFAE034167D6E1DFF2479CFBE49C53F78D44 XH4M573R
458,332,069 *2E8C08C48E2EFCC91D0A27BCFA121DBAA888AE01 [email protected]
458,332,070 *2E82BE0CC98114B19E07CACBBD55D464DCFA0872 5PRINCESSJOEL
458,332,071 *2E8DD2C2955BC3F0059B5C15E59FC62E7D947367 5PUOLUSTUSKYVYTT
458,332,072 *2E8061AA47E3121637AEBEB2593CA6AD6FAD70A9 YADIRA-CORREA-RAMOS
458,332,073 *2E821E5E66D2D8FA64E4743B1E066CDCD51D7BD5 yajaira-chairez
458,332,074 *2E8927886CFC52E7F3DBFE22133347C4C3B56F14 YARIMAN1
458,332,075 *2E8E6EB25EDDCA7A019811271434A3D8B50DB690 yentraeh1
458,332,076 *2E83211CA5262685193C1434AEB541F6D8BCA8BC yncwonderkidyungsplashy
458,332,077 *2E850EF02E1F0A4C6EA6B93FC2EDE91CEC9D0B0F YONIGUTMACHER
458,332,078 *2E8A49130F56BDF294C94B3E94EE099D0D21F6A2 YOUNG.ELLCESSOR
458,332,079 *2E8A0B8FE2BCF92F0506A1F9C02C77C350678934 YUDIREDJOWIRONO
458,332,080 *2E8AA4B962AF25F0756C131FAC4638B9BCF99ED2 5SEDNEBR
458,332,081 *2E850ADBD18D7C155E5177BCFD23004BC66F5E3F @)Z(
458,332,082 *2E8DAB783D5B77C4A7C5CED5E3C0FFCE6E61524D 5TESTTESTJENNI
458,332,083 *2E8453EFF717825B205D4E02450A1926C63F27CE ZACHARYNICKOLAS
458,332,084 *2E8B56CCB29A0FC5D11C32A7A897394988C27CA1 zaid-nailul-morad
458,332,085 *2E8044AD5F328342E38AF82100A4ADA62A0277EE ZALADARRIAGA
458,332,086 *2E8465A2C55E71D65A383ABB23E3D0635AF7AB1D ZAON50
458,332,087 *2E8FBE0A7ABAD417A763288C783D55210F5B234D [email protected]
458,332,088 *2E8BC3992BECA4C7276894B04F5F7918FD8CDDCF ZFWWZRKMT4
458,332,089 *2E8BBF02A9DFC684BE3A735CBFBF460D9DD2F174 ZOBURU
458,332,090 *2E80EB748B5449F39ED3531DC2138382FEFB70E8 [email protected]
458,332,091 *2E832A0A4D6AD969E15D0EDDC65F75202233E539 ZUSAMMENGERAFFTEN6
458,332,092 *2E86DDA39F49E3496E22A1C7FEE161D2F92974F0 Z}<V
458,332,093 *2E8AFA8CB2DF8DE284C55F689003879110A2B842 6CHEMPINOISE
458,332,094 *2E8F1B58A7737B70FFBEEBFEDE9FEE743A035019 ΣΤΕΜΝΊΤΣΑΣ
458,332,095 *2E8F6EDF65DDEF634FC8D3F30B6BD60756E75E66 6ELUCIDATES
458,332,096 *2E8EE06ED392D4A1E329D05C93A8076D59DCB46C 6ionosphe
458,332,097 *2E87EB39A378F27A8C238A57370A050EF4BA3CF9 ІОВЛІЙ
458,332,098 *2E8E9BB8301C4A0CA76B4666473F30AE932E3824 контрамитингу
458,332,099 *2E87F1C6DFACA405F94411AA5290AADD2710C882 710thing
458,332,100 *2E872210554ED711FCA0DF9394A7C8E648829809 РІТТЕРІВ
458,332,101 *2E825BA7F1DB159BEE7EE7DA34385AE141633329 7BSWPICTHEADERSIZ
458,332,102 *2E88165F8EF1E914949B5DC03994D46956BBB5B7 7EATMEPALADIN
458,332,103 *2E81237F7180580EC0ACA1BDA931B7B540D5F727 7IAMNURSE2
458,332,104 *2E8798B274C41FBF11672EE7C7DB1D9E48503B9C (全ての事)」という意味と「ALL
458,332,105 *2E8508D57D99C8EA8A80310297AD98FA886AA7CA 7SPARROWFOOTBAL
458,332,106 *2E8A9C19287F61FD9E6A4621DC275F208C941C8D [email protected]
458,332,107 *2E869AF6B3D52E8C667CEF51D4012C24CEDDDEC0 '87 to the present (clean)
458,332,108 *2E82D97E69E82BED5A56A7DE6FB8C62BA2481656 8BILLRUFUS
458,332,109 *2E87321DF1A213C099CB97C126BE439F2CFCDC5B 8BUTURIHO
458,332,110 *2E89CEAA9B9E4E9D2F1B9BF2C2FAD7945F695F4E 8CHANINBSW
458,332,111 *2E8949E47540BD1B343887DFDB7A47BD2C5230F4 8FARMERCORWIN
458,332,112 *2E8B1B5F4B47614165B8515A1E21A15003A9DD2E 8IZIGRASTE
458,332,113 *2E876C6440F3B2FB0120825835E1EE38472FB1C2 8LLEIROTS
458,332,114 *2E844162052A04938AECF85AE569DA2356250650 8llon7h5
458,332,115 *2E86E8162AB52ED2A862499A03CA154710ABF688 8SILVERBEATLES
458,332,116 *2E81DE53B47D3EA2B1F62FCEADAC6493DD5E7E3C 8TOMMYSTEVEN
458,332,117 *2E8265308B167445C8D4D292F150BBB87858F42D 8U7ANOLIDE
458,332,118 *2E809CC8DC1F2EE8CFD2076E03FD4CD30188EC34 アーケード版、PS2版のARCADEでは紅蓮、群青共に性能は同じで、忍術は使用できない。
458,332,119 *2E89EFB2911C4A7300454087A2190B7CCAA1B01B 9BSWINEXSPORT
458,332,120 *2E8C01F121F288FD72DBF8C428E8373DFB323A2A 9FOCUSHANDLE
458,332,121 *2E887E46D78C967A32871EEF26F6CA8D81FD8E3A 9SORTEADOR
458,332,122 *2E829721060158F2E409EDDB544B66C3EC0889D3 9U3ATAH
458,332,123 *2E88F147CAE2403D741CFEAC07C63B9B6D1D3829 A"0v
458,332,124 *2E8B03AFF7AB9CA98D1E26C07F149228DD0C70BD a5?!f
458,332,125 *2E826B7E263DC889056D2545CA571794483CDC11 aaaei}
458,332,126 *2E80E4DCAFDE5836C5060D82D6F880350444BD73 0bedient
458,332,127 *2E869474C5FB4BB5C54D68A0ABC79EB5BC511B66 AAFN&W
458,332,128 *2E8097CDF2815EDE1F238FBA831F985D9E6E717B 1-09-1659
458,332,129 *2E8102C68D816874527D9FD59614295217DEFA87 1209859 kuluttajavirastontekem
458,332,130 *2E839FD3C5AAB8054FD9B684817B33A80943C066 ab1ck
458,332,131 *2E8C9D44DC3B8671ABB25BF4B76348DF57DABD80 [email protected]
458,332,132 *2E85AA964111B843ED9661EEA2E91BCDE1B2C859 144560 kartlI50708aCIk307025muslukbaGlantIsI
458,332,133 *2E8DA3330156B1B9AD949E6159E352A80162361B ABSATZAUSWEITUNG
458,332,134 *2E8AB5DA0C76B69258DBAD30398B20F595F6E53E 1559347 undichwaerjasicherdieaelteste
458,332,135 *2E8AB194D497453176FC80A7181E34EA356DBEEB 1575662 bundesligatorseit1963
458,332,136 *2E82342933138179CAFB3B5A87106B722AE850F4 [email protected]
458,332,137 *2E8BEC5637385D860CEA8BED4F19616CD0874424 ABT"N
458,332,138 *2E8E02BB8D022CD32C6D86CC1473BDE9CF12E86B Ac5t
458,332,139 *2E83603A3547B3A5696D5CF9F97A1DC0031B7758 ACCAVALLOLUCIANO
458,332,140 *2E861B6A9951FDDF03A029EC9F7B8B82024FFEDE ack!p
458,332,141 *2E891CCBC99C6BF1349FB55CC40220D22F2105C9 adanarana
458,332,142 *2E857D250997559F126192CD70282C8BF67352D7 adempiras
458,332,143 *2E89449A6A7CD18971E700104DA46E1DE94FCC47 ADRESU
458,332,144 *2E8F5742EA1ACE0FD2DE74D85F5AFEFA66926012 adriannagle
458,332,145 *2E8E619CB3FB6817E3B12A619620FDC126C4D6EB 1CERTIFIED
458,332,146 *2E8257E03919499CD46D8E87DBB3A4D181B7C5FF aequiprobabilism
458,332,147 *2E82D55FAA4D8BB9D27C19057B517D9DF0ECC13B 1grannyhazel
458,332,148 *2E8F26036EE7FCF50B5FA845E52028425339F40A 1halida
458,332,149 *2E85BDB2F45DEE242683056751D128FAFE02A3BC agco+
458,332,150 *2E8AD4A6E00EFF99D8CE21D6D82E4CABFB13FAB3 1ILOVEEMMANUEL2
458,332,151 *2E8E1D08ED55EE2DF74EFAB8D26136BD3B803212 AGUSTIN.VIRGADAMO
458,332,152 *2E893C8FCF7F13A8BCB25A6D7E9C533C9B075CF8 AG;XZ
458,332,153 *2E8D0A02ABEA33951EA173B87CE6EF7576D3F42E A%HET
458,332,154 *2E8A2D9F6F3E29CCC845F673C1DAFAC9378E91BB 1.MARKTPROMENADE
458,332,155 *2E8443C28270B4AA8E92BD6C0FCBC3127B688322 A)(IU
458,332,156 *2E866F4CBE1C9D7EDD7ED4DBB922D9D6A18CB3E9 1-olympiahakemusta
458,332,157 *2E832FD8D182A8F417FF0DB192D47A94BC26C465 ÄJONÜLONS
458,332,158 *2E8ADA48105706FA88E1B176BCA2004A8D7A8B90 1RHCINDA
458,332,159 *2E8E97EE2F7F4BD3F5198882FDBDA2E100719566 1ROUNAJAN
458,332,160 *2E86B894B8E529B7E4938A91D62BA733C80C5951 al/";
458,332,161 *2E8329887066E37254EBED617F3A66D26D88461D alfredodilauro
458,332,162 *2E86442377AB9B739E0F0B396B7464E605B50D35 ALI.H.FAKIH
458,332,163 *2E82CF04EF25D0523CF608380AE41ACAF67A910C ALLAPACOOCHEE
458,332,164 *2E8C023B457D9ED20C9797F17CD0BF7CFF423B1F 1.sisulukeilla
458,332,165 *2E8AA18059724B6DB34BA2DA3BD4D28CBA884D85 1.skandalturnier
458,332,166 *2E8B229018E394AB17410C8B67861D3EA21C1BE9 [email protected]
458,332,167 *2E804ED905FB7578DFC65A9BB16F15C25C56A3D0 alwf$
458,332,168 *2E8F22B7BF83AB616A14DC378D06E0F3CA60A20F AMANDALAGAMBA
458,332,169 *2E83D249BE3993661DFB55EA69DBE9FED858E4EC 1vuotta
458,332,170 *2E8F8D000BB640649F7F99F87A02349728FBDD96 1.WASTE-CUTTER
458,332,171 *2E8508407A61BB7D501ED109A5B3ACFE67FFB1DF an45e
458,332,172 *2E830EA65C809F270B29D18037DCA022E8AE9E5E andressteinhorst
458,332,173 *2E8B4831A5B253C1B63B9D3CF59F7933D8E45923 2170770 DIEELTERNHADERTENMITIHRENERZIEHUNGSMETHODEN
458,332,174 *2E808A977C9B9646AF1C19F639D70C056675D624 anhommagetofalkenbach,parti
458,332,175 *2E8E78E472C2E6E8578ABB3DD2D9485DF079F663 ANNA.DICKIE
458,332,176 *2E85BC621C86DC054EF3813E65DAA58FAC1238C9 anneschaaf
458,332,177 *2E852B521D0389358B33CD1D0838CCE5D228D995 2549106 matkan aikana n
458,332,178 *2E8930EFAD65E6BB76DAE2CC823ECDE4DA0065FD 2565434 humberto-ortega-to-testify-.
458,332,179 *2E8BF4FB70587BD79591F08306E25B1D704D17A9 2571352 "-ES-SCHEINT-SO-,-ALS-WOLLTEN-SIE-BEWUSST-PROVOZIEREN-
458,332,180 *2E8FB60FE5B2D6EE94AB6054608CF41FCD1D40A6 ANTON.MILKOVICH
458,332,181 *2E83677BC365F9326BB1E6FCE63765EA1A16B5A6 [email protected]
458,332,182 *2E827C5A39787EE666A584574F7B4DF4E96B5D02 antwankalley
458,332,183 *2E8AD31DB3FCA09B9F9BE1FB30689D9B58BD48B8 26MAR1661
458,332,184 *2E8738E6F8F349BBDA446DADC80BDC98065EB05B AO9_Y
458,332,185 *2E8BACDC40718A11180558FE51E9B7FB5CB175D1 2884046 NICHTNURINDEUTSCHLANDSTEHENWAHLENKURZBEVOR.
458,332,186 *2E85154F5F51A24DB5ED3FA483278F2941147BD5 APFO4
458,332,187 *2E8E9E1416922926981A20A4A02682E64E2FBD8B APRILGRAYBILL
458,332,188 *2E8D929542B46FC6431332B9C78837746C890285 2bosnalIlara
458,332,189 *2E8681AF0F38C0EDA8E900765BEA2CC8E56EFA50 2 CELLPRO
458,332,190 *2E83D2F8D346627C5FEDD12E1234FD0954ABF919 2DVKDTNEJ
458,332,191 *2E87348E5C9CD84E398D74872054FEF8B35FA5C2 2 EUROPLUS-PROJEKTIN
458,332,192 *2E8A7770F389AD90768472CD6C4D9E1885D1E593 ARDENBRUNDIN
458,332,193 *2E882C18A573CB0A8D75C86D3763E9C319D391E9 aremanda0
458,332,194 *2E8A04212D9A699283D0FB7F9739199014F20995 a,r&o
458,332,195 *2E87DE7730F31E5B5167E883D1045039FB250AB7 2TRICE
458,332,196 *2E8B76696E32ABA490DDFF5A37552B1220EBE19C [email protected]
458,332,197 *2E8756FF2871401031A3554F4AAD636894CBA909 』の2枚目に収録されている楽曲のミュージック・ビデオを中心に収録されている。この作品は1997年にVHSで発売、その後
458,332,198 *2E8A625E2BAAAF308E13CB7C28A262385D909529 ASDFDOC1
458,332,199 *2E868B72F256597AE63D70F5D1EAFDC73FA845CE ASHTYNBROWN
458,332,200 *2E83C34E13246FD87D995D04DFDD00B3EF2462FA 3:..3..#..&...Brownie
458,332,201 *2E87FAFE55A9E8179279C2F490C87562FF073519 33N53LL1G
458,332,202 *2E88D2B6F475206123ACD99F4FD90713A0E02773 ATGKU
458,332,203 *2E8392B8F8CDC8A5FE5ADEB7F589944E7B834DF9 atq)9
458,332,204 *2E85D5066B71DA3E6D70EA706D26F3FB1DEBBED8 AUBREYDEPROFIO
458,332,205 *2E85D894768C5D74F4F0CA344363E35337E15DAD AUBREYEPPINETTE
458,332,206 *2E8F6C516317F1284630A3B6CE53FAA57CC5AC59 3===D-*-*-*SPLAT
458,332,207 *2E8B6CD34CECA087F47DAFD3E477DABB0FA8A1D8 av4z
458,332,208 *2E8A854D3AE5AAF93414A0ABB6B0C20EC75C7499 avdue
458,332,209 *2E832988B3882BB51FE61CB2B5C6CDD742DD4B17 4ARGELINAS
458,332,210 *2E833512CEEB2E6D4E046D726CB5B89C81A446E2 4BARDENE
458,332,211 *2E804229FEEB657D02C0B771797110CEF2D99B9E B50694B76B84D89EC0754BA60C180879 YMRJAF9Z
458,332,212 *2E82F79CB7B42DB4D9E5E84AEC87B95436B74D59 B5R=
458,332,213 *2E8F75558EFCC6423179D050388119D77C2174CB 4KODINKONEMYYJ
458,332,214 *2E890819B45A409E46C834F5FAACBF2E792F3EEF BALKANBEATSANIGHTINBERLIN
458,332,215 *2E8493A140894ED2CB089CF39F6E2426ACEDF803 BAPTIZING5
458,332,216 *2E8B12AFF1ECA430D29D46A4F7560AA208948F12 4-P
458,332,217 *2E8350DF5C67DF1D433796DED916DA2C0F08611E B)CEI
458,332,218 *2E8C64C353EECC8513D96D5E565608EF4E74DE0C bcowher3
458,332,219 *2E887296C19A7FBDC047275628CF95F70E0AA1C7 benamargosa
458,332,220 *2E8D5A2956C08B30E65931567FF834280F5049BC 5DEATHDAYN
458,332,221 *2E82B81B08E26DEB50DE7AE33B417FF8DDBB73AA BENNIESUCHY
458,332,222 *2E8E91FBB7B1199A75667F7113FD37A65236801B b#er0
458,332,223 *2E8C345927E87F53EC3D68A09CEC7BDFC183D2A4 b.etl
458,332,224 *2E85F8C107E0B3AE95B198F39B8C17DF91A2A193 [email protected]
458,332,225 *2E861880A86FB51EC52502A4BD7C09028E7FE3C5 5 QUADRATISCHER
458,332,226 *2E8E3DF42C838843B5185CEB749174CB8E02EC5B BIGGISH
458,332,227 *2E82DF0CC6D7A096713BAE1207D269B93D12AE79 bj2ee
458,332,228 *2E800AEEB5CB62DF0EDFF9891188E9F1C6893F18 b,jr+
458,332,229 *2E8CC4DDE062DB2735BE72DC39C7777F1825BA1E blairpaglione
458,332,230 *2E8B4D6B692A1094969CDBB6EF29916BED386D61 650TERRANCE
458,332,231 *2E8CC03E438107290D16B6B5B27AD69A2FBBA50C [email protected]
458,332,232 *2E8D926BAE87260E63EE4046E1ACB128FB72B8AD 6AHLSTROEMILLAE
458,332,233 *2E8FA48E40739C289E5E666E6919C3292B8F1603 6ANNARACHEL
458,332,234 *2E880C3C2A2E2722E0843F7B9D626CABD2A0AA28 bmb3(
458,332,235 *2E8E274AE2C3FE4D05170F8DD591BF717864C455 6BOUDARY
458,332,236 *2E8CDE397CDD52E47B972EF13127E6AE536F6DAE 6BSWATCHESON
458,332,237 *2E86E08A878C55FB2205046BA5DA2ADDF56583E4 bn13u
458,332,238 *2E8F460878736A879DD8887266EE3FB124DBD1EB B###P-~0->-<
458,332,239 *2E82FD389FDA6FFCB00DB8949B6BA9EE8CA4886C BRANCOLATI
458,332,240 *2E8D84179A6A7DE2A947CEC2FAE30B62F96FC4FE 6SOULGLOW
458,332,241 *2E81EC1CD4A5EEA4EA9FFEE74B5CDD80D37FAA5B 6SUBINTRODUC
458,332,242 *2E8CCB8E08433078BCCEC853FDE0D2C84AD9FAEB 6THEJEFF
458,332,243 *2E8433011FB089318DEC76F79D28C4B406CF4A5B BRDNSSS7
458,332,244 *2E8A8136B51C67A07AEA4D2D540BE17763EA72A9 6USUSICE
458,332,245 *2E82B263607EC495568611D0498F2DBB44CA6170 6XRSGLTPQP
458,332,246 *2E80DBA44CF6E85B696B4C339C83416AA1EEA899 7072617MAMI!
458,332,247 *2E8F217DAA9ED65BA527F1867883400E1151062F BRIELLE833
458,332,248 *2E80DA71FEDFF88CEDDEF4F8657C7941C98B9F38 7AFTERPURSUEQUESTRIDDLESEARCH
458,332,249 *2E87CB085FAB91D413C3AD98E2B3FB8CE7A8D1B9 brutus444
458,332,250 *2E8F38AC7236DB20A77CBE117535A735970C43DA BRYONLITKA
458,332,251 *2E8B78988DE513218FA1B55120326B0EDDACCE73 B;S-:
458,332,252 *2E8B978905D7C0605E71D0BA2579DFC49FC675D6 BSW"K
458,332,253 *2E89747689027F6BA6CCCDF9E67FCEF4760FA584 bta
458,332,254 *2E88E6BBF5829A07810EF4511F5331F2C7B4CBA5 [email protected]
458,332,255 *2E807F6411C0C5CC0D7EE84DE8C5DC50DF55A3BB BTQ,B
458,332,256 *2E8EB24B67AC9167CBD15A1B056D87E0ACE8CD00 BTZ.D
458,332,257 *2E857C0C74F4F5EB5FB8EF92944A4AC3CCB58962 [email protected]
458,332,258 *2E82D3C7124BCB9340935E2BF06045D85D71B9B4 BV7KP
458,332,259 *2E8DAD3C6EB59C2C6378A3A5DAC79CE449E1B59D bw&b&
458,332,260 *2E83FEA444036E07635ECC445800ACC56D98CCE2 894752 YAKLASIK100POLISYARALANDI.
458,332,261 *2E80BFF6A8CFB9F4BDA67D23BB1B3A52B0C25663 BX2$Q
458,332,262 *2E8BC4A1FC909680609C51DEC556B301428132BB 8BSWGMULLENBSW
458,332,263 *2E8821A595D42F3B8F1CE95808E75ABA2C692BA1 bze76
458,332,264 *2E8CC679178B41394A45A829B0C88EFE163EC57C c;;"#
458,332,265 *2E8A47BBEE25AF4A378A81BE0755F6A961C35DC5 C0G#
458,332,266 *2E806C5FA287695C776D32526B3CA6F7D84D2793 c1o/
458,332,267 *2E8128B2E67210037009924DEFFE2A7C2ED02655 8SEANHOMEBREW
458,332,268 *2E8F0C9BDAE8CF9F82E19903F7A7C1EFAE752A31 CA:CO
458,332,269 *2E80CDD514B3D7F1A109647F83EB7E973B25D840 8TENFULLY
458,332,270 *2E8E85CA57419475AB29079214AA0810B58062F3 8ZMRZACIME
458,332,271 *2E8EC63309687B21C2002CC947C0BC49F0029A04 c-an7
458,332,272 *2E87394F4DCDD2F540E2162CDC7E817877DF08BC 97964 tel : ( 216 ) 364 28 03 kaya makina san
458,332,273 *2E8733823921EFC13F169BFB57609284AB37EDD4 CARINA700215X
458,332,274 *2E837018E0230ACCECD8F1981E8D1A58112703A1 CARLMEADOWCROFT
458,332,275 *2E82F8FDA89B8D8244C1D3227659BDCE01F4736F 9CALLUSEDING
458,332,276 *2E8A1493366AE92CA5DE0535B058B2519419B00E 9CLAUDERIMUS
458,332,277 *2E818C52FC47F3AE4B8017B64B46FC6C520E9FA7 9DOROTHYBEER
458,332,278 *2E865A3F29D65289FB8338A08112E8D88719794C carminehackathorn
458,332,279 *2E83262E518EA5438545A9D8A6960F34D476BAB3 CAROLPRIESMEYER
458,332,280 *2E8C6C01F8CF9987C41B2EFC3480D21B3260F538 [email protected]
458,332,281 *2E8C37FE4C6E7E0A64A0DE3518AAC218BE5FC748 CARY.SAKAL
458,332,282 *2E83F21E9147CBC4CAD033AD704CCAA50448A44A 9ILOVEAKI1231
458,332,283 *2E895467032BB0A69971BE2EB8DE7E4ADD7E707D 9SOLITARILIES
458,332,284 *2E802C419E16472B8E6C14523C3EA8E6C8636BDB 9THEMATRIX0
458,332,285 *2E868FE4DF7797AD953B673CC143AED5D9DAC6B5 CESARHAMPSHIRE
458,332,286 *2E8C6299BA23F7754A1F8DFF5D620A8DB2AAE197 aaa"cb
458,332,287 *2E8DBF5731B849DF62BD25FC634741AEE92848F8 AAAGL`
458,332,288 *2E8D512A9136A0C444C6871FA26C241BA5E0B8D9 aaaz7g
458,332,289 *2E82B64F3EF91C7915B8DBCD157262A3A9238637 CGJMUSIC0
458,332,290 *2E8D667A87810913DE1B9ED8472BBE3FD8561E32 CHANGGOULDMAN
458,332,291 *2E854C2471F2B71055FA6B694F2495406C5C0880 AATAKNYL5
458,332,292 *2E8C9F635250506CAAD4F18CE3C6CFB606183004 AB<2X
458,332,293 *2E86B6541FDAE8664BCF163795BB81F957758976 a!b!l
458,332,294 *2E825F8F4EB94A93A9FD9A854A6292F67E8E06F6 abrahamholford
458,332,295 *2E8ED789758D321CAC02F46FEC42BCD9C94F3F81 ABRAHAMSPEROW
458,332,296 *2E8DBED7D711D85C1F4CC0B59369E3B7A352A26F ACCESSDS
458,332,297 *2E818EA83C8DB5F1C231B70FC1231B8C67E91A2B CHEERFOREVER01
458,332,298 *2E8416DBACC7512BD0CA5C543EEF496C32525999 [email protected]}L
458,332,299 *2E89208A576ACFA77685F0C9D473E0E6C205DAD4 [email protected]
458,332,300 *2E848FD1F5ADDB0688FAF1BC09BF682749079890 c.ho#
458,332,301 *2E83CA34475C57005DFC91D22D51484527ED37AA ahmed-mustafa-ali
458,332,302 *2E85782A764D728EE3843C3325CD875E612CEBED AHNEC
458,332,303 *2E82071B6CBF517F6F501B4690C17256557E730E ahznl
458,332,304 *2E8021E388E183FA1887A0F95823B2E9513A584C cl(b:
458,332,305 *2E8498D9E7FBC0AF2B583FD7DBC940184A719682 CLEVELAND.HANOHARO
458,332,306 *2E88884A48F45ED59216B4870DA3D4ACCE407C8A CLFA3
458,332,307 *2E8CD1EA03A0DE862B98C7EFDAC04F17E3F0B9C0 a;kbr
458,332,308 *2E8057E6401AACDE89C910D8758E9ACE0A46450B AK+QC
458,332,309 *2E8C7890E07B9C58207027037615D83EAB7AE4F0 cm=co
458,332,310 *2E882A1D7085024724C3BF4BD49132690B7F38B8 a!lgn
458,332,311 *2E8A5A3C07B693F0E1D509B4FC4A662CB9BE336E ALLANFAGIN
458,332,312 *2E835A729A4DD6B681F163851EB0F86894B9ED62 co#kv
458,332,313 *2E864E32D4EFDE407E0362DBFBC824B0D5358072 COLLOCUTOR5
458,332,314 *2E8EB21212EFAE355AD4766BBA108B40B9846237 ALTBASE5
458,332,315 *2E8DC0976EB6BA7EA4D9C129501C652EDE274D27 AMEGTIGES
458,332,316 *2E8F3064BBB796D393466CEF4B523ADB258A5919 andrew-haferkamp
458,332,317 *2E864F89B6F58DB9A4C35B1132188B9DFD8A38F7 ANDREW SLIGAR
458,332,318 *2E89C28549E455F8D8AB5E6DB1BF43DBAA0ECD12 C#Q
458,332,319 *2E89049BC03D67393160E04233E2A35DCE2A52B7 ANIBAL.KAPAHU
458,332,320 *2E8B220A9ADA0518A79933ED377C168C58AFA549 ANIBALMATCZAK
458,332,321 *2E81162299EB69CD3E30C00A0B6F3E5A73249723 CRISTOPHERCAYNE
458,332,322 *2E8D08E65385A31B6BC2345D9C590089DE84B8E9 ANKIT.NARULA
458,332,323 *2E8B1B79E2173F8630EA6CB4A3C814E349751613 CTT/P
458,332,324 *2E8156A047408A7DD13C03DF0384D7FDA65F7E26 ANTONIETE
458,332,325 *2E84B3FE8934998E7C720DDEDF87B70EB80B9DB0 d;0;
458,332,326 *2E89DD31E0A072016301FA413A093342B1912FE1 DAMIANKOTULA
458,332,327 *2E870FEA743AB89828B9062487F3D33B2705E7F3 ARDEN.AVRIL
458,332,328 *2E8B682677AA29C24CFCFD65B27C64864727CB31 DANA.LACHUT
458,332,329 *2E83477A18837D17A284135EF591D7B903717D64 dandette4
458,332,330 *2E851BEDBB044141B9F2C01DCB3DD0A906925845 DARNELL.KENNELTY
458,332,331 *2E8F622A107424ABC11E99C092D65F29239569C1 darrellgoodmon
458,332,332 *2E8FC5CB24B2731B8EE02AB1F86DF0CD3B7EDBC6 darwinsilguero
458,332,333 *2E86E303A7077BF4F36196472B105A5273793A6D DARYL.USIE
458,332,334 *2E892FB2E3FE5106DFAA8964CC45A7153E05680A DASHUNTAEB
458,332,335 *2E87B9B63E42690153E5AB907A498449838ED7BC ARTICLE390722
458,332,336 *2E8F3734F8E22FF17DB0206F67177F713888B6BF [email protected]
458,332,337 *2E8E31F0C0039F4EE41FC136720794A1A9E9C176 DAVE RUFFNER
458,332,338 *2E86AD983A4D4CAA42065F1769C6CC38B78EA346 DAVIDMSTEIN
458,332,339 *2E8E48444B962DFDFD01D273D67304DF384FB46E DAVIS.VANDENBOOM
458,332,340 *2E87806FF69E89B1DF0A957651B2335EEF3FF30E d"b+!
458,332,341 *2E8A9066219CF929E879E5180663A250BF5F8402 Decryp+ng
458,332,342 *2E8751C2BC4D37C00F2896F5E5E73EB04698C624 DEFERERE4
458,332,343 *2E80EAF3C27625B339694C2248BDC67B0BC125FE aud5
458,332,344 *2E84C8C5266F59CB6DEA60A368BBAA0914D5DFF2 augustusratliff
458,332,345 *2E8E497E64DC3D82CC1D1D749F0E07957EE1CD43 [email protected]
458,332,346 *2E828DF40539E87ECAB0F4743D4A3DBEDA020CFB AUSTIN.GALLEGO
458,332,347 *2E863840E637DBAE63A3C5CA49688CEF5E7ED1D0 DEMOSTENIANA
458,332,348 *2E81F2BE3E55DEB13A04318DF055A5CB440659F1 DEMULTIPLIIEZ!
458,332,349 *2E83E2F15705B8FE4817059D566BED4C1E38A1D9 DEREK.CAUDEL
458,332,350 *2E8078E6E3AE78D3A4357C91162F3C4EE7281E21 desaxait4
458,332,351 *2E8EAFA60EF5B7D1B3BDACE5736CAC4FD347C02E AZFWP
458,332,352 *2E8001BCC64598D1C7CC3FFB13E90B466988FAA1 devise.en.despair
458,332,353 *2E80D822A113F10E26179C26BB50AD88008EF8A4 b4ll!5+!c
458,332,354 *2E815EFA55D86B855A77327586864D27CD45BF49 b9+.a
458,332,355 *2E8AB377D3E1FCEF4BFF15D8579E9244D9E21490 differeriez
458,332,356 *2E8F8DCFDC8202D393D65F4787F0FD945F266BD7 BART.MARETTI
458,332,357 *2E86B6BA1C2DFCB89A8EE6F39FFC80A4BD7FCDB0 dnhi_
458,332,358 *2E86147047A066035CE2EA23FB52016E9F6E8A52 doggrels
458,332,359 *2E8DFB76F479DFAE1A6ABAE87225FAAE840C0BD9 [email protected]
458,332,360 *2E8D405DBFC1A2A1B30782D30ED02C6060FB37D2 dongoxley
458,332,361 *2E854349BD530CF0A30C1A2AC517695AC4746FE2 donnelllandaverde
458,332,362 *2E8FCA654C1587024AFE7DEAE93F9253B6922855 DONNY.PRESTWICH
458,332,363 *2E845189E509BB759D15AECAD8B0C212158127F6 doomjazz(disc1:frauen)
458,332,364 *2E881DC2362B4E3AC0E89CE5BA93EB2DAF802535 DOSN48
458,332,365 *2E84AC433D23ECC9A1B38CCBF812EB35AB704947 benjamingemme
458,332,366 *2E8C35CFB0AA4E034C66B45D8E75C7DA140E6F85 BENNIETORK
458,332,367 *2E872C26135AD1F88B91B272ADEE2DAA16C9B00B dp.ba
458,332,368 *2E82784990744EFAB52FCB8CC316C662C339061F beththurmond
458,332,369 *2E88AB8DFE7C0815186C438EEA706AFE9D2CF8E7 d#-r
458,332,370 *2E8D15F137EABEFDEF83D6564D6B6B29416C40CC BFGBO
458,332,371 *2E865471058F12431EDE08F2780F89B061B703C4 B#.GO
458,332,372 *2E88A7B2C2DF760DD94AEF62D2FE7341512D10B5 dua-w
458,332,373 *2E8765426AEB4A66312722648C6FC5B99F0F324A [email protected]
458,332,374 *2E8FF80230B8AA7EE5EE86AB1F8B6D94A881BCEE dudleydavern
458,332,375 *2E82DB50682F99FD7AC11CBA051A844531CCB78D bistort5
458,332,376 *2E870307F268B5964CF197BD8AFB762B6F7096AE BKMZR
458,332,377 *2E8427FC5559E54AE83058F45B0E938403113197 E107858
458,332,378 *2E8CB7884D5943B5E8C2779C81FF79F77B882CDA ecct#
458,332,379 *2E8DD4ED2C86E3BDE3C9DE2D1DCF6ED98A687642 BÖLGƏSINDƏ
458,332,380 *2E827E0A5FF2E0B78D5452607A744971A7F326E8 bookerpiening
458,332,381 *2E8FABD1225607DD12F386B9159A2C1B89B0DEB8 eden799
458,332,382 *2E8B4EDE0EA272D775E67D19FFE9CFE2766436BD EDGAR.STMICHEL
458,332,383 *2E8A153A568B461B3D9AE2D0571A8DF45861FFBE BORZOI954
458,332,384 *2E8C0B01FC846E092499645BC92A216F3651370E ed.sp
458,332,385 *2E859186FB793304F18DE5FA09313956A43A411F EDWUPSEB5
458,332,386 *2E8B75ADAB77E95A4A2F613F91DDEF8861CAED8C BPR#1
458,332,387 *2E84B7C0E4FEFA3918EEF09EC208E06334B55C4C bqiii
458,332,388 *2E8E2073663DFD18FC490C23A0A70FDA98AB824B BRADY.THIEL
458,332,389 *2E84CFB64349EB78A8F83F15D3F1D2BE0B873DA6 BRAIN.HIKEL
458,332,390 *2E841FE17D06CBFAEC87AA33757D1A09EB4AB59D brandonornelaz
458,332,391 *2E81BD6D0B6BC1E457981BB49E6923E5675614DF BR_b
458,332,392 *2E8E6DE40BA207CFFC39BD1CFEC5B224E6137C72 EISENVERSPREITZUNG
458,332,393 *2E81867A8887FE21A22884F378BFCF585BBB05DF BRONZES4
458,332,394 *2E8E03C982FAD8467849E996E0A1AEB003684DFB b&s57
458,332,395 *2E820C00874D44CAC39C12799463387BE2386ED0 buckcsaszar
458,332,396 *2E89CCFC58279DA064813F3395E43F1EB232F50A elqaa
458,332,397 *2E8A40BA4B2C927A5AEA73EF7E1616654033969E bulariae9
458,332,398 *2E84A74BF739E9203EDFE8C974894C6DFE5EF7CB buttmunch3
458,332,399 *2E8AA7DE3F0A2FE2B845837A39FC2952F416B5AA bwinters3
458,332,400 *2E825AD7FF866F77B654D50767BB49E20E8E504C em460
458,332,401 *2E8B4DDB05381C87DB4395A84B4B9D5574E8E21D C?%
458,332,402 *2E8C72FDCFC13BA154865F222F1354262DA02E94 EM_K
458,332,403 *2E86DF448A1C0EB0D82BE638CAE09D5BCCA4B8FE emmittstearnes
458,332,404 *2E8CE59D1B7910230D18DB92EC9150E91273F80C emnk_
458,332,405 *2E8845A5E5D6EFF26FE442278C6A936DFF606897 c%28f
458,332,406 *2E84DA1B325B6DE88B4AF22CAF29BF27DFAA2BFC C4L:C
458,332,407 *2E88F16F031A9D71B48615BE9910FAFBB12CFA8E enrhumais?
458,332,408 *2E8CD21567BD03D423339FCB9111452192DF1816 CACTUS123123
458,332,409 *2E8554926FC6CDBD67BA6F14A250B038E080D659 ep(ur
458,332,410 *2E835028D6E969F8CC88F5CE743B14F03A07816B E. ROSS
458,332,411 *2E86B93BB63034C23A0B4386358B01BFE305B9C1 carolverheyen
458,332,412 *2E8E46C33E88D38604FEB667E1B1B1AB11877BD3 esou
458,332,413 *2E8BDDCE5116C5EF54AF2B4B90828A576EE7F189 ETINIREKS
458,332,414 *2E8E4482480FF7C8CCEE284513F0DFBB3105DF1A ETIRETSR
458,332,415 *2E844C46ADA619D184748F738A282CA91C46B868 C$/DT
458,332,416 *2E881BBBAB831A330F0407794145DC4DC0816E2E EYPYJ
458,332,417 *2E8FA38F4C0081C1316C8B3B903DB1BB85C9D013 fbk
458,332,418 *2E8A1C32A6B6767139E1F03766B6A666D418AB0C [email protected]
458,332,419 *2E87E0239444A6D66EB75CAB0F513FA68C36C25A CHARLEY.ZINGLER
458,332,420 *2E82AF50900E41B50D1F5771BA9DDAE245318FD8 charlieodum
458,332,421 *2E81C7BF5612B1669FFD1887279B2586EE0C7B44 chasbilleck
458,332,422 *2E87FF8496C9E57886B3B308D57E77A2521DC32D [email protected]
458,332,423 *2E820CB68BA61816A3D758682D45C1C413D8060D FESTNINGSSYSTEMET
458,332,424 *2E8F06AEC5B48962483B4C7806D98786ABF8F556 feuda1ist
458,332,425 *2E87111EAE1631466F61F3A01E73452ACB34DBF4 FLLESKNNENE
458,332,426 *2E82B6F483D21B2FA1901ABEACACCFE0C099B9C0 CHM;7
458,332,427 *2E82B2A72E7BDD9A1BCC6D303B7C391B9C5F36AD CHRISTIANGRAGEDA
458,332,428 *2E8877AC0FE1C3625FA9C5DFAEF30CEE7425B1BB fq00ty0f9n29x6n
458,332,429 *2E8CEF10E38B02592017B6AA695BDAB1287645B3 ciau
458,332,430 *2E8EC44538849F3376C6DA1FA7F58D1EF1C04D24 [email protected]
458,332,431 *2E8C24FE1A455F5C4F87018BC12F379C51E7AEF9 ck-yh
458,332,432 *2E84DAF2C3D1FB2466DB65A4F0A781BA35A3F46E CLAUDESAINTE
458,332,433 *2E8F97441F11A40EE43124EE1A6DAA0C745ECE2A GAH9166
458,332,434 *2E8F5252D0385B708BC392F5642560C38E7ECEE5 GAMBITWHEELING
458,332,435 *2E8DE5A9EA81596BD71607F3132502D460B9707A CLM;=
458,332,436 *2E809263C8E891B3DD1E3DA9A59BA0526C39AFF7 GARRYMCFADYEN
458,332,437 *2E874EC3973860EC483DC31AB58CD55FCE849195 cmdk0
458,332,438 *2E8E532F5B6738F0463BE5D88FC053736AC5BF7C gehaucht/a
458,332,439 *2E8BA31D4AA45067FEF90186554525EB9322644F GEORGEFULLBROOK
458,332,440 *2E817BEE3564A2D813807D6D26F88B511F02A37A COLDNESS
458,332,441 *2E8F17AC985C4A67B6A9D1986F3EDB05A2731091 GIUSEPPE.TASTET
458,332,442 *2E8DB4A96829F03C20ADC948258CFAB29246F261 conae
458,332,443 *2E899C80A6AC7A2E5847AAF1495903F93FCB16A8 CONVER+1BLENESS
458,332,444 *2E86744529D94027FD55B61D764E7833BBE07345 GÖKÇEGÖL
458,332,445 *2E8624A83EBEC73CD915F9BA001AAE1AAA382047 GRAMOFONY6
458,332,446 *2E870836D5F9004F1E1961B87AEBEF582BE5D80A CORY-RADEL
458,332,447 *2E8198394E0BFF108BAF98E9FC44FC15D68472D9 GRAVURADO
458,332,448 *2E8DA11A60E5069A99D74FC3FABBB8105898FC17 gregpingitore
458,332,449 *2E8075168FE83653B807D4F1A8F64C7DBA35A2A9 GUILLERMO.CRETE
458,332,450 *2E8E3912F82D8A8393C50AC19D4EF04A19D9007C c:\program-files\microsoft-visual-studio-9.0\common7\ide\itemtemplates\web
458,332,451 *2E892F682B47119B1F38F14214858C42F656A100 HAASTERING
458,332,452 *2E8877DC863EE7EC7D1818DE05C96D8CD3366835 csfz3
458,332,453 *2E888877A12A79B56687851068920159269357CA cufmkgnk43
458,332,454 *2E8B61AB7E5D483277050C1FB4F2D5579BBDFB91 C#UPR
458,332,455 *2E8A102C4EA91D5326A5D72DF7FF30FE84C6F17C CURTPILLOUD
458,332,456 *2E8F93D43E380ABF675C2F5C63C95FDA18443232 c\vd
458,332,457 *2E85AA246B91F918F00E41684BCCED0ED7A7B788 he-elohimogg
458,332,458 *2E86D167A46C2BA2F88B0691366EF419C98CB690 heidenacht(live)
458,332,459 *2E80AAB6D2CA1077C98324052DC69A5C55C545E1 HEREINLE3
458,332,460 *2E823BEF0052D64DA10EBE6CAB187E0AC30A0945 CY$ZE
458,332,461 *2E8CFECA2F3676BDD90A954FA4890FDA25708DBB d0ubt-be$
458,332,462 *2E8E44C8564625306C26B8AF486D5987CF995E7B himno.del.mundo
458,332,463 *2E84CEFB73C90E442126A9F9E2373AF035CA4B5F d’alfaditex
458,332,464 *2E80B5A4270ACF0DDB4FB62BCC7495C9CE3AC162 DAOTM
458,332,465 *2E80D311580DF42D963E4E546973AD7D1DBC55C8 hublandbsw
458,332,466 *2E8FE769954DFEF19947F3A4A79BD23B0E854FC6 DAVE.KMIEC
458,332,467 *2E85C1072573B9ACF47527A5190E40A3BFFAC9A2 [email protected]
458,332,468 *2E89F94966E2032913C3DFA669D8243F20E1EAC7 dbdgm
458,332,469 *2E8C6094F88ED73E4D58BEF94F7CA5A9768FF88C deangeloworchester
458,332,470 *2E8EDE08BF506780B20026D945AFDDAC0579861B iamsweetpea46
458,332,471 *2E8D706CF0792668D517DC976678E2FB24ED4A58 deborah.simonetti
458,332,472 *2E8CC2F5218D5C037F04849FD9F62ED9AB54A726 DEE-BRINKLEY
458,332,473 *2E8EA7B0D1A78EB96CC8990AB112717C219B5851 DEEGAN763
458,332,474 *2E87AE7B3BB39269C21B1542A47BA48F03FE31FD [email protected]
458,332,475 *2E87DE2FB0F78FD914AE19EEFF5F5CDEDE8C0AD7 IJAPOLVI8
458,332,476 *2E8CCBEA787D03F03391B65A1DA1DA9D9E854C8A DENAERS8
458,332,477 *2E8F8334099AA0C258F2140D8282B45D708F9829 iluvpookey79
458,332,478 *2E816920DB7254D0E03B4D06C7E99F50EB267EED IMMERNOCHLÄCHELND
458,332,479 *2E81D4824A083F74149D662B80B43F15E41D7DBE DEWEYELSEN
458,332,480 *2E82162FA0670D7CE38E0FC0A8C84DDDA3DFA95C D&F"B
458,332,481 *2E863E252979126D13E17E4CD2C6F4875EBECDF9 dgbrl
458,332,482 *2E8FFE3A24992759555CA5B9D0B228466870E967 INTRO-POR-MKRA
458,332,483 *2E8289DF2539CEAB0E1EBEE1987F7F8268CB5950 IOLOGIAS2
458,332,484 *2E8F39B534592192A1D05C642620F5D7F8D21901 ISAIASHITEMAN
458,332,485 *2E8D59EF3C2D2095782D02B3D861FFCBD2F2EAAA DICCHIP
458,332,486 *2E80DD7D96E34B8806F90731424CCD0D2D655369 [digit] ,/';[]\=+_)(*&^%$#@!
458,332,487 *2E812542CEC6295B0D9DAE17F7CC26E060A266C4 ISSAMROF4
458,332,488 *2E8A40D734F82D8163DD18F1F208DDAB60DA0AB9 DIOGUARDISTEVE
458,332,489 *2E8B256538B26A8BA8B2898F0D1917C0B5B7B947 IVAN.RAMIRO.CORDOBA
458,332,490 *2E8858FFD36B70B0D3A06E3527841658C5D24347 DISC74
458,332,491 *2E823550AF561C73136C59AE62502F6BEC17FA26 IVORYOBI
458,332,492 *2E8A6E2979EC422D7E6DAEE2F809D77D10DF8EB2 DISSIPATICI
458,332,493 *2E8CDCDC8C41BB24959F51806B12891B827A7B36 \)J
458,332,494 *2E874EBB385E5A668FD525E9BECF216F934F0781 J6MB
458,332,495 *2E8AB9BCD7F9D3C5EC4FD9DC72358034AAAF5508 dm$v
458,332,496 *2E8AE75D0A17D8E8E14806D656E7ADD8A2DD033E DNEBUNIE5
458,332,497 *2E8E9FD940CE27DB2568772E48E7DD3BEEDF6995 JANRIJIEN
458,332,498 *2E86FF1CFC3B298AB58CEE62ADF3C8B7CAE42C4D dnoheitis
458,332,499 *2E894631E86763B75D1C4560AB9877D96781183E jareddudzic
458,332,500 *2E8354ABF9A56E2E9A6A17779142CAD931FEF9AD jarodraif
458,332,501 *2E89F8C89D4EF2A2A05F71905932A3AA1F32D5A9 DO1"
458,332,502 *2E893CC9D018F7EC4E799F08671729C260CD5DC8 JBARSUL
458,332,503 *2E8F9A982A8D4404B1B263A7D910BFF5FA49F5F5 donaldvichi
458,332,504 *2E8AA76A832119CDB80FE14D85DE68BB32948BEB JEFFCARL2
458,332,505 *2E895850EB39FAC2343BDAEA48FBB6E736841378 DONOVAN395
458,332,506 *2E88AB10F06C53238C5D15CAE512B6F7C957F0A8 doomjazz(disc1:frauen)
458,332,507 *2E8F55995832DDDE59084D4C1B0FE6D95547DD64 DORIS.BOOKER
458,332,508 *2E801925BD8ADF48EDFCE4806414442EE8B2C276 jenny2002
458,332,509 *2E828A49F3FBEDE68A979C04C4031335D07D5D4E JERALD.DICOCCO
458,332,510 *2E837942C00F9AF962AEB7D5EBE7C8A520D64DB8 jereskabo
458,332,511 *2E882E8779D3421E6478CB18086A4228ED4EB0DB JERMAINE80
458,332,512 *2E89FC11A8F4FC6DFED1F22CDAD9250674F021E0 dqwo
458,332,513 *2E8C739CB24A76EE55D2306CE57336452012A2AD JMJD1A
458,332,514 *2E8ED63D18CBF755D41346931EE8A94A5CD9DD23 D+S1M
458,332,515 *2E8CF7C9FCAA009152C6594EC75148D13CFD4B1F dudleywentzloff
458,332,516 *2E87EA3087A4210C504F688721D0BA4E8A3DE132 JOHNNYSEARING
458,332,517 *2E81A3C1366717EC900EAA2B121E6280044EC525 JOHN.TOLENTO
458,332,518 *2E88F5147A4CDE7464256257C003CF5399C117F1 jollyjay
458,332,519 *2E8264273F293FEDF1C4F3AA85CC9E5257AEAF03 DUSTIN.DRYE
458,332,520 *2E85AF765F233EA399142256B73C4C5AF0A2135B dustyriddlebarger
458,332,521 *2E8E9AD24935AB4D8BBADB902B9FFDBF2BC51E29 DUX}
458,332,522 *2E854A6CAFF90F6BBC70918789F3C34DB1175F06 dzk.u
458,332,523 *2E88039D7984A3C93E3A00F7C89D2F9922DD1E99 EA&LN
458,332,524 *2E8C6C6E047E508DCC2D128405272112D17CB656 kacinus9
458,332,525 *2E825B5A1E30DDD36D7E1055E981EA4B1806274F KAREN.WARREN
458,332,526 *2E852D380317BEEA68A6A6C8D9EDBD2B87D883B2 eclipserelated
458,332,527 *2E8DCDE346500F91D9D9477724052FC78275C699 EDGARKENNEMER
458,332,528 *2E87AA80C0D2610EE00BB692821C6DA8588EA429 edqms
458,332,529 *2E8A5B5C25E1BDBC477CCA91FC19F8D44130CFE6 ee=ku
458,332,530 *2E8353985C00E3D783384DD673863EFC617C4FF8 EFM62
458,332,531 *2E8272EDDFEA9DE6A2D443E0134A455C7F00A220 [email protected]
458,332,532 *2E82C5F94F574B8BB2473A04AA72E13803858A47 kentonboufford
458,332,533 *2E8B984EDF4B64D994409A6C3A7046AECCAB43E2 EH54V
458,332,534 *2E8695C7AD3978E3EB1B30EF632BFB5BFA8DDA3E ehcsual7
458,332,535 *2E89F7157628404A65D0AF5D563D01B0279F265D kevenbarnhill
458,332,536 *2E80DF58D84B6F9CDE3A93F2EFAE2600700BA688 kevenguertin
458,332,537 *2E8FBC9AD93A86608726A32278A041BACE7C3582 [email protected]
458,332,538 *2E82A63200764D714E1868C80BD4AE7C4A421837 KHALILBANDAY
458,332,539 *2E8F19F0DC8F0315A68DB200555F2AE2BB5EFFC8 kim-frank
458,332,540 *2E8A7F8364FFF262908F40B5AA6643F3D6BA43BF EL-AHLYS
458,332,541 *2E89B1FDCC8FFFB175EAFD3AF4D3A733E6129891 EL.DIA.FELIZ
458,332,542 *2E86C04AD7BC05635944C4FCB8E3464F86C99E32 KORNIAKTOW
458,332,543 *2E82B53BBC314D7FE46ABEE3B0E05629D80A64ED elley.yu
458,332,544 *2E819A122B8B6A5673E6255BFC2297746CEA7685 ELLIOTFOSLIEN
458,332,545 *2E8D508C8C702FBCF136DCBCCE738A3E465CC21C KOZLOSKI4
458,332,546 *2E849884EEF3FAB73F9B0E0930D0F579BE46E89C KRAIGBOWELL
458,332,547 *2E89990EFDB9B3EF52F74CA44696227F25FFD0FC el-maestro:-leuay-me-amor
458,332,548 *2E80B3B7D12AB9D6BF8367F880CDF0505BA5BAC2 ELROY.CULPIT
458,332,549 *2E873D32E73B9FB42C6A741B13B9D223D4BD3B8B KRÖPFELT
458,332,550 *2E89B2E6AD037089C22629E3CB6DC5611399DB9A ELVISDEANS
458,332,551 *2E8F7592E05305A3DBA89738EE81DC7F569EB8CE KURTIS LEITNER
458,332,552 *2E85C0D8E62A87755AD5DFFF05689345EB5A2287 KÝTLINGAÆTT
458,332,553 *2E87D9A8E9A36AE5E518E9E4EF2944C896AF7876 LABYRINTH0D0N
458,332,554 *2E802DACD3502AB6CB2C7EB7EBD4B166207381EA lacigol
458,332,555 *2E8E23E01874D0D84383B18A46C6CA911D084C66 lamontquails
458,332,556 *2E8A270E6D91E5298D6350E2734B31F6CFBC5D9F lanehalverson
458,332,557 *2E821E71FE99EC83A6B4A731D933F7CA25CC8D3F ENREGRPS
458,332,558 *2E8254D2CD8A8001E96EBCB333E1916A7E8106E3 ENTEROHEPATITIS
458,332,559 *2E8CFEB99C550BCD7611A648C3E32B321A2BCF2B ENTIRELYHIDDENINFOBOX
458,332,560 *2E8A3389BA7C55C787E768B8290B3995746DD627 LEGACYENTERTAINMENTINC
458,332,561 *2E889E862C1256A6D8C31867C7AB19699FE49B2B LENREVEB5
458,332,562 *2E879EDE750A1EFDB395D36AC80FCF7EC428E5E6 [email protected]
458,332,563 *2E832C73FB30D9BE7ED2C2D7C86B43F678EE66F8 leonelshey
458,332,564 *2E8D7AF10137D81436AF6B6CD2C9AD3ACD89A3B4 LEPER.MESSIAH
458,332,565 *2E840D64DD673DBE716DE69B858DF3412377664F lesalano
458,332,566 *2E856144A66D58AD55D1824E84E8EFDB1230C1CD ERVIN.MACKYNEN
458,332,567 *2E84DFFCF165976B605A591EB9A780AE5B9BC2F1 ESAPILIT
458,332,568 *2E86EFD3EC52A2D386745021909EA9BB94927560 etpu
458,332,569 *2E8F916F758F972C00A1B6660BA7A9605A25EE99 LIGUORIAN!
458,332,570 *2E81D0E49D4031156352063AE263BB178C9A1328 [email protected]
458,332,571 *2E8F58ACE6656C5980A9F21E9A92A4776202E3E0 LIMINESS
458,332,572 *2E8C89064FCE5426D24F61E60DC979387AE14572 linkepdslogo
458,332,573 *2E88E21F818949A5099CC5A1EF56F2874EBAE2C4 EZEKIEL.SISTA
458,332,574 *2E86F51764E72A5F15ED0C339541B76924994ECE f(&?
458,332,575 *2E86E9426B5D824351C59B858D376DE7D6CA68D0 faisalkarimkhan
458,332,576 *2E884F1783958443F507D66A26B632AB2FCAEB00 l+k>
458,332,577 *2E810F99626B6674F7C0AACF56D7FD70A7DD921A fastingly
458,332,578 *2E81FC3816E272D4215D1264D188A0DC224EACBF federicobudd
458,332,579 *2E8661D510D53454BB5892D1E7B037709EDD3025 federicogrossnickle
458,332,580 *2E80619422BC6A3CC5EAEF04CC61EB5A845FA10B lorenzohranchak
458,332,581 *2E8C3D789D6162C0EA49F751DBFF6EDA1EB2922A FENEYJATVÍÆRINGURINN
458,332,582 *2E84E21931922A252F2DC37A6C8EF70FAD36BBE1 Lost-Sequence-(unreleased)
458,332,583 *2E8BF230E0B8CBB493FC0873B6651C46F38481DD [email protected][email protected]
458,332,584 *2E8DCFC90166E21305D9E763A1C98E9901CD742A [email protected]
458,332,585 *2E8BDB83220D5F3F8B9B22E774E277ABA2129F57 FIBRIUMS
458,332,586 *2E8681200C4CFBA59434F834339EC00A3FB03D57 LOVE-IS-ME
458,332,587 *2E8F818C932F33FDA8ECACFFC887D090A5BF7492 finbur's
458,332,588 *2E8497B4DFCA8DEBC1B8A044A8A398C1B4F2C678 LOWELLEGUIZABAL
458,332,589 *2E85CB67AF4EFC2AC33BEB2E6D859A1A8298491C florenciohelble
458,332,590 *2E87188EE7330B5E25C0585E88336E50154D6B4E fmariah
458,332,591 *2E82159808E6D6BD048AF78A50F2BE01108FC9F9 fnbinnadh4
458,332,592 *2E881492B427D04B514C302C64D95B7305A16FFE FOFINHAP
458,332,593 *2E82EEBCE845371229688D253163D680E5F65C6E FOREST.KLUSMEYER
458,332,594 *2E8BD2EF7DEEB46A51950AF87B5712BE7ABF4F95 LUPEBRESNAN
458,332,595 *2E875779249AAB1F4688C8A81848C244E8B1F269 fragen
458,332,596 *2E8D342F64B64989812555E68FDF1188396EAC6A MACIOMHAIR
458,332,597 *2E8FBE84640DCB946CAEE5CCD669FA594BE45E3B MAKINGMOUNTRUSHMORE
458,332,598 *2E8E797559F7A5B191D42A4916C8AC6C9ADC7410 G1u3-p14n
458,332,599 *2E840B6E2452AF20E49F68BF6865B65B6D4917EC g5hu
458,332,600 *2E8CCE2C1C70197933BECC782F158DEE1EDEDDBF [email protected]
458,332,601 *2E8F9BF91FC7BCA87BBEB23A3E6A20D8FD58C59F marcelo3026
458,332,602 *2E87C8A313AE525C33D6BE44DF38B0D88D130D09 gainsay0
458,332,603 *2E8EA8ADFF1D241512944F055D07EE3B582F692F MARIO.SCHIRM
458,332,604 *2E868BE0099F46144EAE88239B82DC4DF448B031 markinjoseph
458,332,605 *2E8357DF8D3C83341E0834DCAE09BBE3ADC70EEC garamendi1
458,332,606 *2E8D71EBE0D279D0791F160DC963B9D62CC9569E [email protected]
458,332,607 *2E844D73104651576C4D808D91C3FA80B19B4A96 garrettzepp
458,332,608 *2E8C91717E472CA25155932AA2F9B1286148194B MARQUIS.CUTTEN
458,332,609 *2E802F04AE609D409B3BD42ADD602031E3A526ED MARTINLIONETTI
458,332,610 *2E8FE8DFF2D662B43EA302F16C5EF9E967F7DA01 gcwxhlqvnhic
458,332,611 *2E8CBED9A380C8E6B6A4C899F156C8D607D0D9FF maxdoswell
458,332,612 *2E8DE34F476DE5EC72D867EB3BA6CBB43CED7AD1 MAXIMEJORDAN
458,332,613 *2E88DB8B183206C85C0B542819F9466DC0E65962 [email protected]
458,332,614 *2E8A516BA4F022BF471259E7C2F17E90E615639C MCKINLEYHEPPERT
458,332,615 *2E84750434775B0A0EA85C6CA8FD9E20F8270B4C „geochemische
458,332,616 *2E87FF704B29FEA9D4D7EB93D7A1940F32EA3BBE GERALDOBUHITE
458,332,617 *2E851ECD1DF3CCB580091EDF4FC36DCB359B429D GERRIT.JANSSEN
458,332,618 *2E857E62E0F0E4E97C521E7A64FA37761000F4DC GERTRUDEAUBREY
458,332,619 *2E82063EDB86B95C5310C376EC9FD1C6C97CBC60 mësoju
458,332,620 *2E89F0C3AB6DA8BC32EB177C70D5F742F889F07B mestnii
458,332,621 *2E89A47B1DFC087401E6077B3E2A718F33FF8BAF MGINGITITIS
458,332,622 *2E8E44FCF016C841F86526BEFC9A3F459E873E5D MHAIRI-BROWN
458,332,623 *2E807E66D4D73EE612E3A529260EBA56EDDD0EF8 [email protected]
458,332,624 *2E8CDB7056766B203B26B56D835BB43623AA36AE GIZZ TV & GILL-MAN
458,332,625 *2E8EEDA66653485E876A695A267574595AA4A785 [email protected]
458,332,626 *2E83D83B040A2038E5066864F8A0243143D3FBC5 MICROCONODON2
458,332,627 *2E8F432D7BC4CC8BA9FFC8D94C9859327941A32D mikvehes0
458,332,628 *2E8385E582E5D68291706385780B7B0FEB54EF19 GOZABAN1
458,332,629 *2E88D6972C35224F5320C98A46B2E40F7E4BD384 GRIPIEST1
458,332,630 *2E8F92F7470F792D125050D0AC2D78533329F72C guadalupemichelle
458,332,631 *2E80C71210398A3D3122C0EADE4088C959A4FAF8 MMOMRZRUWIÉ
458,332,632 *2E88D6E69C233CDBADD6A84F39C2CDADFBB47AD0 MOLD3RIN9
458,332,633 *2E879715D520572F40153E5308FFB1728138691A GUSTAVO.STRECH
458,332,634 *2E8760CE076B996536ABE4347D61387938E0BBF8 MONOPTICAL
458,332,635 *2E87BA584986D750995234C7338F76044A8B149E morganwestcott
458,332,636 *2E80C44CE6A705007A0AD50F3FB3059E9953C04A [email protected]
458,332,637 *2E80EE98295828A6477524E1755D5DE4F08480ED MORRISWEETER
458,332,638 *2E84F75141D269E9A66F073B46C30D27B8BD3A92 HAL.LAUDERMAN
458,332,639 *2E88FFAE7CF4052C4EF1F23AE4BB7E97917A72BC hamdy.negm
458,332,640 *2E88B5FDECEC10C2E4727627C63A9B2E5E1A6908 Mostove2
458,332,641 *2E890551F39722EEBD80D1D7E71136B6849A27C6 MUGELANE
458,332,642 *2E8215DF82098590F7B2E3DBA447C98E1F6E3917 haybachpg
458,332,643 *2E8296F5DDE5DD5DE856B0FC33BF4746E17CAB7E HEATHERALVARADO
458,332,644 *2E899A250D2733F68DFED3421B58E117C239282E HECTOR.DARAS
458,332,645 *2E8B366A6E0E2140572E8D437525A94DA093ECED mustafa.efe
458,332,646 *2E806E7543AA46E9905E599CB52334780B14B45D HEIDY506
458,332,647 *2E8ACA8318F91104322781027A156AF1C8CC2243 NASSCIMENTO
458,332,648 *2E80A99ADB9C3E24C53A43841AB6B04CF740A499 n.de.orthez
458,332,649 *2E8461241A947E65D3FCCF9743E6F0FA0CDD5E3A [email protected]
458,332,650 *2E8A645BD48BCF2A44ECEB8DD040242C87A44A98 HIGHLIVING1
458,332,651 *2E8387C373C4C52F3A77616952C5144ABCFB7DF5 NEWCATS3
458,332,652 *2E8FFBAB7631030A8C7F681A70D6DA929EAA48EE [email protected]
458,332,653 *2E87450AC90F6C90115EEE9623B5DAB1626F9FE2 horacefrazier
458,332,654 *2E88A9010F10083A3F8211CC9F6588CAED8059BC NG*{
458,332,655 *2E8597F03EA052232273A6F06C6EC9F0511CC2A6 [email protected]
458,332,656 *2E8A40A50B9DCBFBDCD703B8F484F636AD055C31 niwgnans
458,332,657 *2E8EE801F967A07CEEBF37B05FB5FD01C80AB530 NODSAKA4
458,332,658 *2E8407D128FA45B851961FDB835B021729D54BA6 h*v^
458,332,659 *2E88090811340C79CF0F92972986F36D6493227C NORMALISTS
458,332,660 *2E86983704844602DD8C0647AB56DCF260700B3D ignacio.esquivel
458,332,661 *2E8060E00E0829206CCBED4151902804D78B939F [email protected]
458,332,662 *2E88FB73B6EAB9395FD4DE93E83FEC066D097538 ihdtuwio5
458,332,663 *2E86952DF89FC7C50EC0419A9EEE506B5DC24046 ike.frank
458,332,664 *2E8311EB23A316605588CBBF2094B1A45428A67E ottiffosing
458,332,665 *2E870E8C625BD66F8EDCA06B9087D1AC4C8C54FF insomnia(noslepptrancemixedit)(featmcsherlock)
458,332,666 *2E8B0F3673775174A9E788D21119D0735C229439 OVERSUBTLED
458,332,667 *2E8D09FBB6AFF19721C7303CF98C17A778F79486 PAD'S
458,332,668 *2E8D9595D08AEF872981CAA22C7EB577182EA071 ishhak
458,332,669 *2E8D9DF49D2CE61BBDD56FB1FFFC562B130A4139 pampbsws
458,332,670 *2E8DD58913DAE237308115B4B6BCD1C69FEA0192 PAN+OGE1AS+IC
458,332,671 *2E8FBD42D0BE190C829B099C43A59BFC94FFBA07 pantaleon5
458,332,672 *2E840686FB62131EC697EE8560F7BA4404F6C0FC ITERATIVELYING
458,332,673 *2E865A6DEE7D76C2A40F9051C5EBCB7AA8DD3AD5 paulbowen
458,332,674 *2E89105D0BF233215FE553DA0D3EA1D3F706F439 [email protected]
458,332,675 *2E8A1067E819DA6CB51DDAFA1E2D7F5394D8D266 PENTIUMMONEY1
458,332,676 *2E8967C38DB6E5178CA0520964D66D68DFC66E3E jamiejohnstone
458,332,677 *2E861A45FE0AE92E4AE42F991DE7F536B15857DD jarrettchalupa
458,332,678 *2E81083DC9E12ECE65E88830311A584A530526E8 PERRYLUCORE
458,332,679 *2E865CCA3EBB3D63AAD3C884C03FC13049A51244 peruuttamattomuudestae
458,332,680 *2E80A5668CDC04DD25C157A6BCA3E312D9C3EAC3 peteveer
458,332,681 *2E8496183E5CEFF06A6F8CAAE29A3BED2F3E97CB PETRA-VERSCHOOR
458,332,682 *2E8E4A283472EA4B7D5C9D2C3E11363B397950F8 JAYSONRAYNE
458,332,683 *2E8B88A2B591FF27F29AF1830E151F17B7E12CBF JBAZZARI
458,332,684 *2E8D1015BB449B44E202C0FCFF2A5B8CC51E935F JDEADLEY
458,332,685 *2E860000888FC3847A6E720741174B1D20F6E610 PIANOHARVEY
458,332,686 *2E8AF352272E3A3C7A12BBECE413428B1E124461 JEMBUT-KRIWUL
458,332,687 *2E8B876D78B9987B3475B8A518821FC9CC1E97E1 PIMPSRUS28
458,332,688 *2E847171076C17F0BDC1C9F3ED761098B24A251F PISTESS5
458,332,689 *2E85805C6AE2A334C22A0679C5AC9A9C4B9F2B4E plankbuilt
458,332,690 *2E8EB5BE1DD3BD9B1C31D50D9E38372C02577D7A PLIERSMAN.COM
458,332,691 *2E83950C0EDE636ED9FC2C317398639AD5A3A483 <p> ms.-lewinsky-testified-about-why-she-conveyed-this
458,332,692 *2E829C453664CD0D9D586D171693EEE43DCEA0DF POGOANAMRJDIA
458,332,693 *2E867891E413B2FFEA45897A5A04C626C2A12AB1 jfwgvta97
458,332,694 *2E8587ABF7ECC43FA6753FE8A13D104327A3259B jim-lees
458,332,695 *2E89150B097811399CD864F6ED4113AFA5FB0ABE POTRA
458,332,696 *2E87C90D7C3D3D7F228648A1335815218DC72C2F PRAKASH-JAKHAR
458,332,697 *2E80290A8C549D551824FD8B96D398677C1000B6 PRATIGYAM
458,332,698 *2E8EFB1E4B8978DD7A6A7A3AFBE16B1B30BAC4AD PREFRIEN5
458,332,699 *2E898D393237D5422E2EB77F041F52014F24DD77 PREIMAGI4
458,332,700 *2E8F20E2CF0EF52DEB73A4F49201FA71771F07BA PROXYSSTREAM.BLOGSPOT.COM
458,332,701 *2E82107B24F867E464B74EF0714EE9C8A4EFBE5C johnsonsundeen
458,332,702 *2E805FCEA46278F7E625EBFE88DB1DB7500CC05C p#####>-~-~splat
458,332,703 *2E85B595C6C70447BE4913B3D0463FD4CB6767D2 PSSZBM
458,332,704 *2E8CDAD571909260362C86724BB5A313E3347F1A [email protected]
458,332,705 *2E8DB0B2A28CF005A52426927F829B8F4820E749 JOSEFCOURREGE
458,332,706 *2E88A533399E2482C15A2C0957454EF401356C58 JOSEVANOSDOL
458,332,707 *2E8D43862174633294C4D87906124A342BE68ECA JOSFN
458,332,708 *2E8760E286694E06354FA939ADCF72B5E1FBD8FB pwbjnfpu53
458,332,709 *2E8ECA77BBFD3398086B2432F8B8FC697339E63B ;)q--b
458,332,710 *2E8191AAB4733778663C6F0809141DFA01E9CD83 judsonblackard
458,332,711 *2E859F91B6546CBCFAF9E569C471744CB0AA311D JULESWHICKER
458,332,712 *2E8DFCAE6A2212BF0F30B63183838666AC64A11E [email protected]
458,332,713 *2E8C197CDE01EA5F6E3066C9B1A63B9FDB8FCFAA junious
458,332,714 *2E8FCFD373CA7525C34BA79C8006F47E6DF63F14 qp*splat
458,332,715 *2E8F665B75A3B154643580CEF832A6C65AE229D0 q=====).~.~.sploit
458,332,716 *2E86CCD7F99B5BBE01E23FE305FEC3EEBF2F0DA7 Q;TN$
458,332,717 *2E8C7542E74327A12732A336370F0FAA336E4217 KÄFERPROFILE
458,332,718 *2E8184731C8E9CB28482314C3C458183A75F882B kaseyvilleda
458,332,719 *2E89D1CA2CDCAECDC46E813A5AC661ACAC811B35 KASPING
458,332,720 *2E8383ACE8BB5C8194BFE5372E866416C73B9788 «RANKER»
458,332,721 *2E8D9F1E804AA111D0865EDA30025061B30280E2 RASPARASES
458,332,722 *2E82FDD0941FCC740F4A4860F09DF0EBAA277EAD RASSELBÖCKE
458,332,723 *2E8F23542FDEC40CB42EB3F520DC855A813C1CDB KENDRICKKLEINMANN
458,332,724 *2E88652D3D108761F2EA62FB84152B651069D853 RAYMONDCARR
458,332,725 *2E8DF46545B5D88E78E9A7C48E920E634EAA104B KEULENSC6
458,332,726 *2E80C847EEDC070530E8BCA7494DA1EF175E1612 reagoida4
458,332,727 *2E8D6EC98D6E5D4FEE3489956261338D6FCFF62D REKTANGLARNASING
458,332,728 *2E8A829FB74CBF0841F74BCD92F335419E1BDE16 [email protected]
458,332,729 *2E83DF96D7F0A4297C20AE9837A482983F8BC4DB km5q
458,332,730 *2E8A108B5C6280CA3EEBC4F7F278FDAC823AC66A REPUBLICMOOCOW3
458,332,731 *2E82031D5B0919F7BA574E33147C3DE11AE28020 KNÁʾAN
458,332,732 *2E85DFB27D29BCDBF6F35B58FE15728E1CB63638 königvnd
458,332,733 *2E820FC4CCDB877A0570D3154422D8028D6062B8 RESTAURAIT
458,332,734 *2E8A8602F4D1EB02D54A1BE952BB8BFF970D77A0 KRISTOFERCOLICCHIO
458,332,735 *2E86ED945A4AC35FD2F9C4015E585C5D88C3863B rhettschaack
458,332,736 *2E87FE93518CCB3CCC23BB977717ECDE700149EE rick-damerau
458,332,737 *2E80C82E58CE4D9B47DF989AB33B0669F8190F1F RICK-WYMER
458,332,738 *2E8214EEEB81AAFEA643D9D147C21470904625FF KUSTIZOK
458,332,739 *2E8F74EB41756526FC7DE7D41B15DD1B99BC8405 RK^:
458,332,740 *2E837975950C1C282ED4B490B5FB99D514F419F2 Kyrie(CaecileVocale)
458,332,741 *2E8929EDD34029E0DF32AC03D45C5647C11790C5 LACY.ARBOLEDA
458,332,742 *2E82E74960B281699D3B20CF7D887449492D6EC5 ROCCOPREJEAN
458,332,743 *2E8B2D84476D043C3AB8A26E1C3EDA863D857EBA LADOITE2
458,332,744 *2E8E37C6083AB792A93F508FC65589A162579C5F [email protected]
458,332,745 *2E852D5963A43A4685273010EE7890976426915C ROGELIOGREISSER
458,332,746 *2E8CE35A82047DAECAA0652704D5EBEE26602CA6 laponnes
458,332,747 *2E89945CDAE73362422DEB4363F358A29681E244 lawerencepiekarski
458,332,748 *2E8EFF1217FAE68BB1E5E265F3B929FEC79B193A LAWRENCE MCCALLA
458,332,749 *2E8DA9788F0F93230EA511FECD2007F79DD4E824 lee.poulton
458,332,750 *2E810CEE2E9A4C085C12CDBF95FB7D0BE229AD9D [email protected]
458,332,751 *2E897A033EE76264B557F641B124A28DB9E463A0 LEMATREN5
458,332,752 *2E8F4189BD0856B40BC7715E64741ED5DF490AC1 プログラマー:LESHADE
458,332,753 *2E8783917E8AE059ADA5D2B4852DC8B2F5AF48F3 rudyng
458,332,754 *2E87203D995CAA231BAD1FB6AF52E26977C1412B LIA.DE.BALASAR
458,332,755 *2E8F222CA6F62FE267FA6B23CE565A324E2B00FF RUSSEL.TODESCO
458,332,756 *2E87F8052A869C23C5D9B9824CA37FE9B424DC76 RVS25
458,332,757 *2E81568E6D9F8B64E3A34238BC82421EF56A0958 RYOESTOESTAE
458,332,758 *2E8D75A3BB4C3F23B9C9269F4861EDF509C0F335 SABINHADDAD
458,332,759 *2E88C546A06C1AFDD9BAF046D715CA0733F2E1B5 lloydmukai
458,332,760 *2E8326AC10C16B1D59770DBB3DC04E1A3F3E869D LOL300
458,332,761 *2E80F3CB984CB8E72357AFB307C7B942FBC5AC04 sapphirebuffy
458,332,762 *2E886A9FFC19153ECA2129DB8FA25015E99F07EF LÓPEZARETCHE
458,332,763 *2E89EA42DF0CA613551E12034952E121BB0E32E1 savingly
458,332,764 *2E8AB92083102C17D351BB8A33DDBA03CE69017D SCHIZOCOELIC8
458,332,765 *2E812B9FBD8BE1752B328D7BBD4C84FA005F6814 LUKEZOELLER
458,332,766 *2E831A9477169592BE186F4964536060A626D753 LYNDON.LOCKRIDGE
458,332,767 *2E85B82C72AB2034AA1883D72CED1A35058603A0 LYNWOOD.BALTON
458,332,768 *2E83B8AF7F9B229E0E277D2BA0C19029687A826B [email protected]@837!Z!N9
458,332,769 *2E82C16A41DC9E133211B79326CDB17AB6C2A2AE SEANNASCA
458,332,770 *2E82DB9B3DC7A31FF989678BE017C3C677C69A4A MAC.KAYE
458,332,771 *2E8F133DA054E3D65E567F43921072A3C705C6D4 SEGAFANS
458,332,772 *2E87636BF563FC2A63413C25F1E7DE2B60A3BF0E selfaffectionate.s/e/lf_/@/'f/e/k/s//@/n/i/t
458,332,773 *2E8E27407AF0BB0B7BC2C6A21FE4059B6CCA6E9E MAMBO (DISC MIX)
458,332,774 *2E8528AD42D8EDDBB1EB582151987EB1213ACA31 mansleldtsche
458,332,775 *2E81D5BB1DAFFFC11E7F2C5E1E2B34B269497F7A seychellertårnfalk
458,332,776 *2E876C1602AE50E70FDDCD7E46A0A1B4512204CE SGANGHERAVI1
458,332,777 *2E8543B445F3C8E923D93D4118CCD0793404C482 [email protected]
458,332,778 *2E82D82BFFC0A1E3C131CD6C06EADBDE4446C4C1 march:-the-centenary
458,332,779 *2E884B1AD5EE4ADE3C3D1E4523E9FC5B339F0EBD [email protected]
458,332,780 *2E87BA9C34264FE903159D30DB8298CAB1853848 [email protected]
458,332,781 *2E8FA23A54A5A516417C922A70D79AFD4C589D58 [email protected]
458,332,782 *2E81FF8CD4D13DCA0946206B894D6D4D2A8DE011 sheilapond
458,332,783 *2E8D66EFB50A15CA1C9540F7700EA53B9A1C5695 MARILES9
458,332,784 *2E87BD84E7D5BB2FD9DAD09A49028896368F517F MARLON.CALLISON
458,332,785 *2E8C0FF6BD4CF8CEC5461825940E3BBD0D8F463D SHYAMIS
458,332,786 *2E81824565ACAB53B359525D229EC75C74E04518 SICKBERTED
458,332,787 *2E8BE4CFA772226654F04311B1907C426D7D214A SINA-SADRI
458,332,788 *2E8161C43F1DFE6D4D0EA50530BACA7FE264EDA2 SINGER1955B
458,332,789 *2E8551ECFCDBFF8416350E5D12C7E6FBE56FF1D1 MATHEW.SCHIRRMACHER
458,332,790 *2E82286505BBDAE753214D46DBEAE5BF7731F141 matojoses
458,332,791 *2E8868532782A0DEDEDF095A619A83A267D9E5A0 skolster0
458,332,792 *2E8FFA2937B589906B941BD624428A9D7DC0AEA6 MBMIBB
458,332,793 *2E84B45B32863E97A46618A3E17F3180E8320112 S.MACDONALD
458,332,794 *2E884053B6231110F8F93AD069357E3654815DB5 SMPOO
458,332,795 *2E87CE2F19C94538D5DDF6E3D60D8A462C795718 mehrabi
458,332,796 *2E89DFAFB933F00CE813E41A66DA03BF6D11060D mellifluous3
458,332,797 *2E87BE166FEAA5DCCEA3A5446BA1F5B728346438 MESALLIEERDE8
458,332,798 *2E8E2CEC8A1C86B2D43B6A928465860F687DF277 METALADA3
458,332,799 *2E8E573D831D976AD4C593BDAAF8B372072DBC20 [email protected]
458,332,800 *2E8B90A2BAD72A8335B7D4B047CEA6116D4DBF3E mexikanisches-klatschlied
458,332,801 *2E840DF641B89369113F7BDB446E88A19EA66D08 MICHAEL.TRAPANI
458,332,802 *2E87F0795E7C29F3ED4BC1E684BB317C4FD731F9 MICHALWYNES
458,332,803 *2E80BC96D053081FCD6EDA6BB69225762002DC30 MICHEALMAX
458,332,804 *2E814E95425B6300C0C48B952B0663F519ED0F97 Speedro4
458,332,805 *2E8638F4503A9624808861FE4348B9D4C18609BE mike-kerklaan
458,332,806 *2E8920379B813AA1D098185C212C41563D11CE8F SPGMK123
458,332,807 *2E89C987500279325DB14A7CE90DBAE337C44510 SPICE-(EVEN-SPICIER)
458,332,808 *2E87212D2EB9D44F867152900D11292315195602 Spin.on.the.Bridge
458,332,809 *2E855E7567DA595B1BCBB6BE3AB3298FBC7CE59F minuendam
458,332,810 *2E8606CE1252204ADA734727ED352C5B7CD30DBD squint0
458,332,811 *2E8C1C20F37FA67A0D01F60F029796335691F6A8 SREUGNIF
458,332,812 *2E8E28DA5CA670B93B4C8A9826AF5793045E9612 Morte-aos-velhos
458,332,813 *2E8E422A9D7FD65195275FA3D8A275D8CDA837B2 steuntje
458,332,814 *2E80D97E60EAD2D4830A81A0040F5869F70D2893 ST..JOHN.AMBULANCE
458,332,815 *2E814C52CB31DDB425200E515DA1138057752B68 STORKARNA6
458,332,816 *2E81D1588986DB869455EC4CD4F35276D578891E STORMYREBECCA9
458,332,817 *2E8164DD0D6A77153265E9403A776F7B515A0A53 STULTUS2
458,332,818 *2E8AC49BF8FEB544DBFD7B6956448E4CB01324F9 SUNFLOWEWQSBBING
458,332,819 *2E8F157936EAE29EF57FCB26DFD0EDB61681214F [email protected]
458,332,820 *2E8DED1BFF2AE67849F7038937FEDC8D8C63B9FF SURFACEFLEET
458,332,821 *2E83C5568A49EE9913A5AA12E23E5A319DEA1446 [email protected]
458,332,822 *2E8A048A4EE071C2C071E3EF4F75BC89E0AB17B5 mubarak-osman
458,332,823 *2E8B1288D37D52CB109AB69676B6ABCAE229A5A7 SWODAHSSRECAP
458,332,824 *2E88C5FB2C2273008E38694B1E3C5BB5B6C986AE MUL732899
458,332,825 *2E8A947C0125AA99647FC7DFE6037850CECA8B0F TALK9019674221
458,332,826 *2E8AF63A04582291F0EF2FB99A6B86064ED018E0 MYDETROIT/FLICKTHESWITCH
458,332,827 *2E8807E8D49A9CB4589A5D5D214BF91882201046 mylovemarjo
458,332,828 *2E850C4D1A6FD1991E960840FC1AE2D8A853C829 MYTEMPORAL1996
458,332,829 *2E8C85BF745FE18D1E7915A54AC111D843854D65 [email protected]
458,332,830 *2E84FDDA97E514180151A80DCB9A5AB9669463AB TANYAGEIHLICK
458,332,831 *2E8B95428472F4EB976BDE14FF8EA57120B91196 TARPUKOJU
458,332,832 *2E85F6A36EDF3D3C08C8A9BAFC818E95736C9D1E N3123I5
458,332,833 *2E8894D6E1C48C579889BD77CFF4E008C25C7F72 TÁVÁBBÁ
458,332,834 *2E85248220414EA822385C77F1AA00F3960F10CF NAIBUKIG0
458,332,835 *2E873994EB1A8812F88821CBA25BD7AF98BEB98F teddykindley
458,332,836 *2E82629EE4DC7B25CF067A8682127E8AC6772515 nanteuil.en.vallee
458,332,837 *2E874BDB92603F9121E53E17CED8E35FAF59D870 TELGESRO1
458,332,838 *2E8686EEFD635179AA161F6D711562DCB365682A NAPOLEON.QUANDT
458,332,839 *2E8F6EE76474F48F837FD6A0682EC34DDE4B5029 teresa-linn
458,332,840 *2E8F488C6B9EA87F0EEC431E53D9CB38544D00C3 term1n0l0g1$t$
458,332,841 *2E8D3FBCA1262192DC683BCC4BC871A23D384070 TheBoulevardofBrokenHope
458,332,842 *2E8C11E670D2F756449B6EC0D2749570EDE29156 nedgowler
458,332,843 *2E828A1A8147E3DCB8A8E6B021C22231FB30CDBB NEGATNNOS
458,332,844 *2E8894A72D2611775025CA2C11DE3075F9F23ACA tibleesee
458,332,845 *2E85B553ED368D6B206574CA2DA91476508AFD27 TILSLUTNINGSTED
458,332,846 *2E8E27E6245D77591B42DF9CF72EE7AFAFC28869 nino-donadze
458,332,847 *2E84B949D07430D074F95159B9C5B38D1FCE1C14 TILTREDELSESERKLAERIS
458,332,848 *2E82708C16D5824353C93C8A0A2D7050DD3D17C5 TIMOTHY.BELLER
458,332,849 *2E8F863ACE4756A5620267772E948BD760805860 NK'X
458,332,850 *2E889EC074873F1AF6016995BD86BF4112DE2993 TONEYADAMSEN
458,332,851 *2E813D48726A40E176DC5754B64FFF561D25CFF9 NORMAND.BERMUDES
458,332,852 *2E87D5AA5352BE8F6086555388D384DAB6A30247 normandquartucci
458,332,853 *2E8981DC767B37A39502859961464275ED69389B TRABALLASSE
458,332,854 *2E8ADE85FB290B120B333557FE93AB6F06E9DD54 TREVORANDRAYLENEFETHERSTONHAUGH
458,332,855 *2E8312C81E353D5814F6085A813B97C3786EB6F1 [email protected]
458,332,856 *2E837A48EB5574B80F892C4C1FEDE627BF0A2932 TRIBAL-GATHERINGS
458,332,857 *2E8C8FB906D228648F5B81CB822CC8C992216B94 truncheonprofile,part1
458,332,858 *2E8F051D1640419617B7352564C2FFA675BEA01E OBRACALY8
458,332,859 *2E814CABFF1B82E231B5E1ACE4DD599FC74A5A28 (o_)`d#####8
458,332,860 *2E888FD86D166D97EC88AA5D8C4FA7CE564116FE One.Love.(alternate.version).(feat..Sadat.X)
458,332,861 *2E8FB50D46A1FCB25A7F0C35B3A78B0FCBE88B0C TYSON MEI
458,332,862 *2E8159AB08ED4D926C70A8A1D2B020FC4CA1FC63 U-56439
458,332,863 *2E8896FB103D51A5B846D5A10A15669016AB7C19 U6;S
458,332,864 *2E8277F328AEC45727EAB35F38D457EDC3AE88C9 UDB$
458,332,865 *2E85DE11414B5F01CBC61B809468AE481FB8C86E UITBOT
458,332,866 *2E85FA181180AF1455379C11EB6B0E6255B25FAD (o_) * * * q###q
458,332,867 *2E8CECF24DFBEFF22F7C2ECEEC76093D629C4EBD ORENMCGLOSTER
458,332,868 *2E8A18213293939B80EC6A770F78A7BFE1FF2EB3 ore.o.aoru.na.
458,332,869 *2E8AB522C200950917E0A350C754824B4FC45FF5 oscarfrondorf
458,332,870 *2E85A4ECF82682A37D3661CD93EB7F52259D4340 OTSAKARGO
458,332,871 *2E8362CE6CA20497C8A545044F5ABA19937DD110 oxitalan
458,332,872 *2E81AA5CE3247F485DF6883C5E97267514497AE7 v1v4c1+13s
458,332,873 *2E87C8994FE84E278BAD3DEE428CE8EEE19D47CC PARENTHOODFACILITIES
458,332,874 *2E8B040F2F6E56F3E59668F1E0FCD0CE0DC99574 parisdebold
458,332,875 *2E85740D18EC7EA6ECD1D05F04AA7FEB1C22223C vanessa-testawich
458,332,876 *2E8308B9CEFD01BCFBC8C6D6C3CD4FF304250050 VAPORIVES
458,332,877 *2E8E154DBB318200332038AD15B5E5EC627489FD VAUGHNMACBETH
458,332,878 *2E8FAFC67197C1B8AEC4E0399826C4EEC5F78513 [email protected]
458,332,879 *2E880D038CFB9003D9AAB160EB71E729D6A214D2 VERBOSI
458,332,880 *2E8367FDA23BCD0ABE64F4792593729B05264B46 PEIRSONI
458,332,881 *2E89228B97BF9FA28BBB97C7159266FDF3146277 PELOITTAAPI
458,332,882 *2E85C58F30DCE03B62EB9C60E51677EEA31E6E4B PERRYBALWIN
458,332,883 *2E8584ABD17358BBAB19D70B126B72D578449C1D VICTOR.SCHERMANN
458,332,884 *2E84EAD3940957B814F33C9D661E03D50ADB40D9 VICTORYSINGLESVOLUMEII
458,332,885 *2E8CF668C04EF4E3BC590262282C67CC25E9567F PETERGALLAWAY
458,332,886 *2E8FCECCAAA639F33BD0E48B7936EF54F6217E86 VIJAYLAXMIHOMBAL
458,332,887 *2E85F570629B28BFBB752E6123EDF43E9A8E6A86 VIKI GRIGGS
458,332,888 *2E8BEBD05785F79F3321358CDCD5E862E2EE6E84 phetchaburibsw
458,332,889 *2E88DC3E7CC9453A187E2504FEC1F46C22FFA5D8 philipandreasen
458,332,890 *2E8C07C933F9D287D3208485D7C11D6AE1359913 PHILJEFFRIES
458,332,891 *2E8F62409D752647E3B0468821905E4A666993D4 VIOLETTE-LANGE-BURGER
458,332,892 *2E860FBD58F10455E42B69DC9DF93BA44059D57D VISHNUCHOKHANI
458,332,893 *2E827033103FD7CF1F2816485E25C5BE973B0FF1 VITALIZERN7
458,332,894 *2E82EEB9DDEC4A60D889C068031C457B8EB2448D [email protected]
458,332,895 *2E864E28D103683E6D06A4F56FCA8E74816A4EA4 VORGENOMMEN0
458,332,896 *2E896AA724D84514F801E2D0B781130CA595370D PLYCRPC6
458,332,897 *2E83F15502957A2C454662A6F4CD8EEA0A9C849D polkettefterisakannersa,r
458,332,898 *2E8528CE978BE21230C7694ED19A6A2D06FB6931 ponseDeBluesDeBosco
458,332,899 *2E830B2D41337571F0CC3B63909B993AB7058BD6 [email protected]
458,332,900 *2E89EA7F42093DBCBA675E588680075C3CCD1733 p---p * *;)
458,332,901 *2E86D7617B5E398E8ED0FBFF6D0C359C57567B8A [email protected]
458,332,902 *2E8A855C225EADB395B7F614F3858B8F73F61747 [email protected]
458,332,903 *2E891AF451C365EAEA13D56842F1F95D5C4981F9 PRINCE.KREUZER
458,332,904 *2E8CB1C755ECD87B428EA5FAB4959300CE7A3675 PRIYANKAKARNAWAT
458,332,905 *2E8469D7CE86FEAB2E7D3358F6F957AD8245A0CB WEIDMAN'S
458,332,906 *2E8722826A8E7EA6E46091911B96BDE133B14BBD WENDY-COMINGDEER
458,332,907 *2E8CC533582C210E70D3BBF0C8C848F5AF0BFC95 P------>-*-SPLAT
458,332,908 *2E8A6A9DAF924E95F9DD5B6856DC88837FCBA0A7 PUNKINEUROPE
458,332,909 *2E8F12491B260891AE38CBF10E933EA20EABDEE3 [email protected]
458,332,910 *2E8EDCDF1AED4F7027653032C6E3A67CEB25E5B1 ql0?
458,332,911 *2E81E3CD3C22B2A67360D7BAD684323BE3A9CD10 q======p ~0 }x{
458,332,912 *2E8A1CC65391FAB8EB4472A3105F7290991F9C00 qqcb
458,332,913 *2E852E1A06CDE4EA3F5BCF13027BBAC667676834 william.diggory
458,332,914 *2E8FE4746FF90A30987F547410A0DE5EAA68C353 WILLIAMLOCHTE
458,332,915 *2E8A8ADE41D377DE16D588E041E7C786CFEA70EB QUINTIN.THRELFALL
458,332,916 *2E8B5D8B571B2E6863926FDBF5D212D2AE70E937 R3ACC1IMA7ING
458,332,917 *2E89F0AEA6D7DC367E3ECB7833595740E52DE005 RACHEL CUI
458,332,918 *2E8F24FBEBEA75157A920C70D77B2AA907F1635E [email protected]
458,332,919 *2E80DBA729BD245CF8422420956D36B704F08E4D wolf1ghost
458,332,920 *2E8D25010140411E1ACA88F1F8ADC58D72C926B0 WORKOFF0
458,332,921 *2E8989883CA829338135FFEDFF0299E70CF84449 [email protected]+$
458,332,922 *2E87AA6E2EB399964C991BB52A36489447F5278E wwwbaccaraforever
458,332,923 *2E870FAE54575F54DB166EC591122C5B38A8FDC0 refugiostoen
458,332,924 *2E856782895A0208F5DC60B4AFA37ED4583C29E3 reganbrewer
458,332,925 *2E8401F7ED157F84E066352FFF6E117EEEDD6AE9 X138540
458,332,926 *2E8DCA8AE0669E118516E16CF0D30E7BC03FC148 REKARDINALEDING
458,332,927 *2E857117AE30E990DE3C4F0CB7F069C800C8B15E rekrute5
458,332,928 *2E84D19432DBBA4EAB1F32193CAEC92CB587663D )x(.~`d-q
458,332,929 *2E84EF6E4F75E21788958E3DC3CC8980D5BBFDC9 xhsm
458,332,930 *2E8D51006AD8D6E8DDD26345382D89D0D7563393 RE+RANSLA+ON
458,332,931 *2E88329E3F4539FD6DFC59F8A76126EE46B2F000 Y0V]
458,332,932 *2E8EF2FB765979EFF15B819E89C3CCC620486F91 yakitlardan
458,332,933 *2E8E838327C8317AA782B48900B05C707B00BB1B yanick.l.lacroix
458,332,934 *2E83E97A266EE38843258B097B59D1612102A6ED [email protected]
458,332,935 *2E855B0ADA5A1155319CB554E9B141D0CFD49F42 [email protected]
458,332,936 *2E8A123C3FA53D60FD02BCC338B43A40122496D3 [email protected]
458,332,937 *2E840B20FAC1CD9B5A6904FF263473D90388919C RHEARICHARDSON
458,332,938 *2E867EA61D6281B458DF80B17465F5857E02055E RICKSODEN
458,332,939 *2E80F4F76525D94ED314FC5CF535582B9CC1A758 robert.cavey
458,332,940 *2E82A18D9FDEE027BEDDCD888A085A58822F28EF [email protected]
458,332,941 *2E85457D0E8DF3DB0850146516604D0740D552A1 robertmantel
458,332,942 *2E86E2D1CD1AB0685BAA6B183D2551C61FFB1551 ROBERT.NEUSCHWANDER
458,332,943 *2E8CDEBD467AA11344BF2E613F97A1B16C90B551 YUSUFBEYAZ
458,332,944 *2E84012CDF96B1F0D66F52CC112669081EBB34BF RODNEY.BASINI
458,332,945 *2E818A9B7CD340B0A3548B6C30AA30DE3D9F384E ZACHERYLOVERN
458,332,946 *2E8D22D1328E4C554925F5F80990CA14B45BF294 ZANEBILCHAK
458,332,947 *2E8B2D084F87D7A15F8920DBC10C121D10FB24E8 ROMEO.FERDINANDSEN
458,332,948 *2E8035DAC3885CAC58AA5316B37253E8C3AC2286 RON-LEESON
458,332,949 *2E83FD934BAFB22E57FE8A5DD5CE345C2193C47D ROOFTREEN0
458,332,950 *2E8AB9D8A19085DBE2BA5BFA341E26CC328F5721 ZEL-DIAZ
458,332,951 *2E825BE69947507EE53FAC62C41AF228A2DA13D1 [email protected]
458,332,952 *2E8BBD2A899F13FC0CF7150567FFAFDA3EE61BB4 RORYLAIDLER
458,332,953 *2E8FC716057D6AD58ECA3E9A135356EF526E2BDB zeny.olaco
458,332,954 *2E8D7459B1429BAB017F2D7F67616568D6B14B45 ZESSIABA0
458,332,955 *2E855E569B36E0F8AC042D8D295DDB6244098369 r|rasigs}mycketifandom.)
458,332,956 *2E8FDEABE472D5AF3BBCA14E24A14F4F6D9051DE [email protected]
458,332,957 *2E85B3AB34F1246FC230392D526EC0171656C91C rubycfi0
458,332,958 *2E84BE8137F61EA05B499938FA5B225B4DCF3F14 ruebenalvares
458,332,959 *2E8FC3E56CB8540B82633DFC0BB5339A2BFE67F6 RUFUSDRESEL
458,332,960 *2E84738DBA3FEAB23C3AF4F72E434E636463A10A runciman
458,332,961 *2E89341E4E1DD2A9133711DEE4184952E86917C1 RUSSELARRE
458,332,962 *2E82C943E8321CAB9AF72CAB73518156B9678F7F [email protected]
458,332,963 *2E8038754ED113BBFFC637B6316860C7DA6FA330 [email protected]
458,332,964 *2E82ABF89B5BA9E0B263BDDDD1607B68F7769FA2 zulma.palacios
458,332,965 *2E843D6465BD19671AF56EB1D1C86F29501879A3 [email protected]
458,332,966 *2E841C4E9E2B2C1C0C6646A63D3B44AC63067E44 АВТАРИ
458,332,967 *2E81F7742F2D84704C788F906897AC896274DA90 sánchezprieto
458,332,968 *2E8E3A7F15FB06C262721012266676E1B1706106 глёдниц
458,332,969 *2E879D2E565E30BAD5948678B5BC06182F4B0A24 ДОМИСЛЮВАТИМЕМО
458,332,970 *2E8055ACCEF260EED075D4790A336C587E01E52C единонаследие
458,332,971 *2E838BBD8187E06E72AB8757053D8151D516E4F9 SANTOSHURLEBAUS
458,332,972 *2E833B7C2E65E9E88801DD48F74A7FA500FAB995 SANTOSMCGRAFF
458,332,973 *2E82E2663B789572FE9BD5681FC31B89E2CD2FED SARKASMEJA
458,332,974 *2E89D0B47B7A60B4ECBCC26018220642EF12FC76 правід
458,332,975 *2E8A43D4E84110EFB26AE635BDB6F3FC3F300F3F SCHTICK
458,332,976 *2E8E82EEFCA92AA5722517E6D06E7432D72262BD scottygerdel
458,332,977 *2E82BF1FA0F5C311093EEA70B0E69850759BA444 ЮЖНОВЕЛИКОРУ
458,332,978 *2E8FA6964A4B1BF820F28E22E85C845331E31B55 SEANCES
458,332,979 *2E8C46FEE9C15451FE4A7EFA92AA50E1592766C6 SEASCAPES.COM.AUWWW
458,332,980 *2E8FBE3D33D776057E33FD715B79E241EF980E37 SECRURITY
458,332,981 *2E8FBB4B55F585E08EBC4F473E6994EFF18EEB8B serenadeind(andretter),(k.185)-"andante"
458,332,982 *2E8C7790731D95FBFD44AA55193885D1114BCC3F SEVIECER RO SNIATNOC TAHT YTITNE EVISSAP A - TCEJBO
458,332,983 *2E8BA2BC0AFBE7B45EC7AA1ABFE7D4470465206B 行政區劃FOOTER末尾部
458,332,984 *2E85004C69D8C10BA42972C5AEDC1C423E5754F2 SHALOMGRIFFEY6
458,332,985 *2E8E6042E951E5270690102E8CF6591E9D695D91 赫胥黎的傳世名言:「盡可能廣泛地涉獵各門學問,並且盡可能深入地擇一鑽研。」(TRY
458,332,986 *2E87D868CC2C132A43DADE3C2A0EB1953CB52F10 SHEWOMAN5
458,332,987 *2E8C94D269362F71BB62ED654EED6E3A02FF3FD8 shmeakle
458,332,988 *2E832FFE19F3C27CAB940229EE5FAD0248695742 SHOTGAMBLING1
458,332,989 *2E84E7BA387FACC97A0649F020FFC0EE334B4DEC SHTRUOF
458,332,990 *2E85A2F13EE2EBAF361067A4170CDAAE15C451A0 143LIMA
458,332,991 *2E8A8FD13B98142F6A7D05D5AEE15DC3DD46F5E8 SMHNITHS
458,332,992 *2E89123959BAB9BC32CD0C81EF291D27FDDE109D SNOWINESSES0
458,332,993 *2E870A2CA1A9868144A82B2F9512AA2A69E62D2A 1953539 THE CASE IS FREEMAN VS PITTS , A-401
458,332,994 *2E8CC1B58D06ED6C4C875F92A1AE6A2C12664921 @19cdes
458,332,995 *2E8EE690C7CC3EB6221D9EEDBE74D662AC3C87BB SOMEKINDOFFANTASTIC
458,332,996 *2E803D42A9FA7A1F454BF4172AC450C1C88544A8 sophoclis
458,332,997 *2E866800CF4391A8FEA770ED7C98C6A045D2CC3A SPENCERKJOLEN1
458,332,998 *2E8287FFFA2D11FF99ECEB8FEBF6DED0883B8BAF 1HOLLENHORST123
458,332,999 *2E8E02DEE27A819EE2FCAD17D945790A1B4D5360 splat.*.*.*@--p
458,333,000 *2E85B450C855464B4784F230C08F00ED379029DA 1-KRANKHEITSUEBERTRAEGERN
458,333,001 *2E8B17F8AA9A0DE0516D9604E40BFAF82C92020B 1 LAIVANVARUSTAJAPERHEEN
458,333,002 *2E8B6D7CE74509A3B9DEBA2D2415F4EAF471880D 1-MIELIPEIT
458,333,003 *2E806208B49EDBF47DCAF17E6BEA5AA83A5D3913 srdelica5
458,333,004 *2E8F9CFC76013A7982FEEB96A04AB89AA8E5BE82 1.oscar-toting
458,333,005 *2E819122139DD519C8A46EFE303B6912998B6567 srotaehcse
458,333,006 *2E8773831C06B7CC69214604A71F0947B59121B1 1RSCROLLER
458,333,007 *2E8AC7A2839EB791F4C6BE64096F7F6268FD70D1 1 SCHIFFERI
458,333,008 *2E82DEC2B951324DC91D9023FC4526306C938C21 1SEMI-URBAN
458,333,009 *2E8442B62453676A2C1A97BA8F11C63B46D1A90A 1symmetriakuvauksista
458,333,010 *2E8A1687910C8775440C82775F1572419C5180A5 staufferlanlgov
458,333,011 *2E89448173D0E8C7CC3997C663974582BCDCEFBD 1.unutmayacaktIr
458,333,012 *2E8C103BC4EFBAAD74E74B1048EE908CA79AD045 STEMPELLOKALENS5
458,333,013 *2E80941D9F75B9BAB80CA398071CE56A22836C46 1VUOKRANNEILLE
458,333,014 *2E87032B53DA544DC1F699ED67DC4A2C1B667494 STEPHENGOODING
458,333,015 *2E8D70637C1A9C3522EC110661E7399580E27124 stephenshetterly
458,333,016 *2E845A16C06602057C0BE861A1893BC729B581A3 1万KW。石炭、LNG)(倉敷市)
458,333,017 *2E89FAA27E737845327A7E66E2A7E494E7454C94 2054331 uusin.j
458,333,018 *2E8FE27FB958BA53D25A1CA1F6B97DBBAE18F81F stewartlizak
458,333,019 *2E89E20C3EF3716032395C56EE9EC0D0A2012363 STONESBULLETS&FIRE
458,333,020 *2E8AD8688998BF50CB5D4446C52C7ABD16E5C6B2 STRAWBERRYU
458,333,021 *2E8B577E205398DFA6667FEB6DE52A450CDD42F3 strenggl
458,333,022 *2E81BF2D68BCF61F0F3048F781FE8F9AEF305B75 2483634 VARSIN.USEIN.T
458,333,023 *2E8C93E9D437B98355AB5755C5F9BD93799F8244 STUART DENNING
458,333,024 *2E80BF12E2937BC505EDE53B24F1BB1F26CB4B4D 255-218-185---------peachpuff
458,333,025 *2E8108C069988BF4233C53EB3F93DFE13E998EBC suahluhc
458,333,026 *2E85DF32E0A0A371A710FA1ABD897526D0901EE8 SUBICAT7
458,333,027 *2E8BE6610C42F066758FAC8884EFAEBD6BBDA378 2685955 MARJAT-,-HEDELM
458,333,028 *2E8554CFF95B44BC109EDBDD591D790CB52C9B66 SUKHBOLDSRD
458,333,029 *2E8AA98E680FF1CD43854038E40DD57412DBA9A5 2ACF1928AA873E9D8E245CF9D4241C05
458,333,030 *2E8195E552E17F240CA5C65053A28EFF5AFCBCBB SUOMOTSONELOS5
458,333,031 *2E8FE9FB7E6365D7669346CB8ED5D5891E275275 2AMMAISEN
458,333,032 *2E826C576BFCB38CC671CB660A480D9529882DA5 SUPERAGI+7A+7ION
458,333,033 *2E8D1F0BB63050DAF8B0219C78560C96C3DAFB26 susanrene
458,333,034 *2E8511B23DCEA674B5E26EBA564508EF85EBCBF1 sverike
458,333,035 *2E88DA1D6F8F9197ACF5085AEECBC073709D8B47 SWEET-STUFF-(GEORGE-ACOSTA-REMIX)
458,333,036 *2E856E88C6E785142606246A4280360E6E3F968A 2 LABORATORIOOLOSUHTEITA
458,333,037 *2E87E204D0EBAFFD8DC129F24526A6BB8A3EC2B8 2.lenkeiksi
458,333,038 *2E897315923FA70B5757EC68D5E70E00C2CAF6A5 SWITCH 8 (DISC 2)
458,333,039 *2E852CC37F1C2CA69DD41E45B22BD173F634EDD5 2thatlabtec6
458,333,040 *2E87723E2E3824A70376E752CDB171D956CCAABE tab719suit505
458,333,041 *2E839395166654D17BDDF72EAA5F9A16574F24B2 379haley
458,333,042 *2E86EE2F779D3D2A1A5968BF1D8098897D763EC2 TALKKBRONTE
458,333,043 *2E8E3E062CC30539BB6B1B9BEC6F3F82C53FC7F0 TALKMARKOVICH292
458,333,044 *2E8F330A1E7E21FF249DE5E97EAB5E5274A76F6A TAMMYALLO4
458,333,045 *2E81D83AEA791897ABE3F5B9C1100866562AD924 3EKKORTNI
458,333,046 *2E8E7C883F980F52788745B3E99A9C788D12E82F 3GNOFNAIH
458,333,047 *2E8ABE7BB547F0791BEFFBC79830ADAAB1E707C4 3.idc's
458,333,048 *2E845587651C7335D9286ED22F163C4DE0000561 tap-gauge
458,333,049 *2E8A2891BFF01FF493E27E4D676AEEA0FA5A124E 3MACH
458,333,050 *2E89BA10CD03EDECCCF0DA33247CDCB868F015A8 3##P~o.}o{
458,333,051 *2E8BB854B0C889CFCEEFB268DF47EC9DBB9B278F 3.SUGAR-PRODUCING
458,333,052 *2E8C038A5A58B415F28A5D5622E397D6B1A1F620 413ATTICUS
458,333,053 *2E840BAFC5F7547AC76EC780202082FF58077F96 422zoe
458,333,054 *2E88867C98B287BB66E14CC90A66DE43B1076528 479713 RAKENTEISTAOPITAANMENNEENAJANILMAISEMINENJAV
458,333,055 *2E886B11067CA8369795F44658427BA2EE6D5A25 489868 atop.on.suomessa.markkinajohtaja.ja.kiinteist
458,333,056 *2E85BF25446A86FEF8FFBE56551A12292E2D19E3 496ERICK
458,333,057 *2E8EBA78406450192C7AB7E9341473755B248371 4EHSULSEB
458,333,058 *2E8B4A3BE028DB411DB1A6CA5CF8E2D39AD363D4 4-KIZARARAK
458,333,059 *2E8D22F35990871555620EBE73058C67939345FD 4MYPEGGY3
458,333,060 *2E8D516EA4F5B514FB6613B5E93D4E67FC0C8F77 4-P
458,333,061 *2E81D14A07D0B1C1AF674B8AE3F7E1AB38E1644F 4RYFQCPTPCLYF
458,333,062 *2E8DE3FCCB97DD82B96AA1677C8025450E23FABD 4SPROUNCEY
458,333,063 *2E80135D84CF47EE3372E1B592CBF4BC334243B1 terrelldecarr
458,333,064 *2E85942D855E35FC126E00B9E1782640041B78BD 4TOEGEVLOGEN
458,333,065 *2E8C9F4C9ADA79A6F28BB40A2205313FA01A0C17 4UNPROSCRIBABL
458,333,066 *2E8CAF4009094E19EB2A659DCDF470253CC5E85B tessellota
458,333,067 *2E80E972C4B25E4AB9E0C532F890C08999723A4C 50LV3R4MQU3
458,333,068 *2E87E05B154DA31EADF176A7E91DE2C8E7892F6B 5BSWCEACIBSW
458,333,069 *2E87FE40FA61F22E8E9ED010F4F77E0C86A78214 TheAlbumFormerlyKnownAs8LeggedDanceMoves
458,333,070 *2E8A932F9B9E849899BEC00CEFAE027291A62755 5HOLOGRAMING
458,333,071 *2E87994AE076A1070A3E7DF51DDE77776122D93D The-Love-That-I-Crave
458,333,072 *2E80859AC1BFC61AD326E5C5218C4718E3D0AAAC 5ODUNQDTLLBKC
458,333,073 *2E8B6DA40BD17CC09AC8717221CC31F62B664CE9 THEOMORPHISM4
458,333,074 *2E86DC8669D9A0905113AD216BA7F9CF92900B21 [email protected]+
458,333,075 *2E82C43763B191AF61DECE5054A47425CEF7AC44 [email protected]
458,333,076 *2E87124E95A8EB24A95D819681386E59F8DD2549 the-year-is-more-important
458,333,077 *2E8ECBA7DF97196E4357D37AE4586C78B0558BE5 TIME-G10B
458,333,078 *2E82FF9AF1367812C88E3B57859A2D2BFEE497F6 637nash
458,333,079 *2E89F99BD81C620E9D69A57005AC47DC46B3B3B6 TNATCELL
458,333,080 *2E8DF356273B51D1B1ADE89328DCFDA266E043F5 6AVENGERY
458,333,081 *2E80D32CFE1E4988365E63FA9A3F34A983DE5AD1 TODBRENHAUG
458,333,082 *2E8435ECAC77D45F6881824F9E263425898C7360 todosweet
458,333,083 *2E8ECEC8E4D33989D0BF3A302B9F2AD144E78A73 6I=-P.---6IE
458,333,084 *2E863B57259ADEAC8582C1162209FF0DF126EB33 6LTHRLKNSS
458,333,085 *2E8BE3F2864D5CC93B365320F2CC3AFF884A7402 6OPENDEXTER
458,333,086 *2E855570171FF6EB304F03B51E927D4D2552BF24 tonybernardon
458,333,087 *2E8C17CB1B09CCA060D75237F0DFFA35CAAC52BA 6PHOENIXSPACE
458,333,088 *2E8E6A492B92B2562C13F13745F3722498A8586F TÓTSÁGRÓL
458,333,089 *2E8252142325B3727B80874DDE820BAA1FFC695C 6SWEETPEACHERRY
458,333,090 *2E8387B672AF3F9AE2EDB222D406451B5F378DFA 6tambora
458,333,091 *2E8D28D310FBC02D0CD37706F4F9C42DEC4A2590 6VERHEIRATETE
458,333,092 *2E8F3BC59840BF5120089A1192D99B0A6EEBA8DA 6VRIJGEZELLENKNOPENS
458,333,093 *2E801C8AA0651C9ED65BF38D832924D9F5B1B3D0 732863 hatta-yazmamak-icin-cedellesmeyle-gecirdim-aylari-
458,333,094 *2E8BE13CA6F05A0AA4C20B6002D6682D46B2CD0E 75menschenrechtsgruppen
458,333,095 *2E8CDB70FB4DE4DE94CCF3383FAD8985CEB2C46A 7:..7..#..&...inexhaustibly
458,333,096 *2E8B9038458BD49EF0BC4DB99CB878380029E3C5 troverei.
458,333,097 *2E82D23A098AD82E898A9D3D903F981B8022D90F troymont
458,333,098 *2E8CFDFE18ECF4A749501E3904F8A7C63A81A720 trudie-mcculloch
458,333,099 *2E89341BD56BF89E71B99E477F79AE85A0850465 trudy.marfo
458,333,100 *2E848FCCAE04DDA2ABE0DF3580A06B6C1DE7DD22 trumpetz
458,333,101 *2E849A123A86F25AED1A635775C94DAF7CB8BA25 7JUDYCOLTRANE
458,333,102 *2E80C541017B94EF627C50109BF45C08EC2E58BB 7LEAPSSPAEL
458,333,103 *2E8F0803170A63DF76088172D916CDC8ED59184B twononstop
458,333,104 *2E85224535C4DD689483A4FD6A9ECC260434D952 TYLERMCKEEL
458,333,105 *2E84EFEA268B8FEF881B114F220E61EE273BB357 TYVZMEQUQKUJFV4
458,333,106 *2E8AE79D1F4F08BE71F3F1C19F9FACE26D86C50C 7WOLFDIAMOND
458,333,107 *2E84378E25AF276E16DA6129C5662DAAC0EE7DAE 808836 voit tulostaa edelleenvuokraussopimuksen t
458,333,108 *2E8D1DCE5EA02AC93126F29D21EB4E7D26E074D5 825213 mutta-jos-arabi-saa-hyvi
458,333,109 *2E88DF23CD6A4EBCFA25D56EBB77D8B8F5723EAE 827magdalena
458,333,110 *2E88F4782529E9C8592FCC60DA1F123059510E55 UNLANDEDS9
458,333,111 *2E880AB575C5B4510EF586A9B1341EAFDA0F7CC9 unown999
458,333,112 *2E8634F35A0BC06FCD7B85599CBEEE0ABC7764B4 until-the-soapbox-breaks
458,333,113 *2E87C624330B8F2AFA8B44DB32DA0A61DA33C9C5 uphills
458,333,114 *2E8F0B2AE7ED7AD64B7BF3CA2ACA3B6EFDDC225B urealistisk!
458,333,115 *2E85F1F25D436A1938C085451B5A27E082D818ED USER616871118
458,333,116 *2E8DE0735C37CDA79638637D48C1DC12457A0938 UTILISATION
458,333,117 *2E8CBB30D790C2539C0EFD04B6388CAD60CF864F 8======>~O ~O SPLOIT
458,333,118 *2E8B5F19DDF803F0791D7F770E02C2C3392DC035 VALERIYADEVYATKINA
458,333,119 *2E803BD917F10638FBD4FA8AE8B9AACD6BDA6AD9 vaporoso?
458,333,120 *2E80F5D27607BD35A5D57F1D846A1E4C9E6A738B vaughnlangarica
458,333,121 *2E86D5E48928318F27FFB79F89949849A2E117B1 8thatrugby2
458,333,122 *2E85729ACF84D3447ECBEE9E8ADE2CA8EF67A1C0 %V.BAA
458,333,123 *2E8E1C5AC55AC6168EBE85FA7CAA7C737C1EF627 8VMVIRUS
458,333,124 *2E82E836149CA030EABB43C773CDD578F327CE5D 90CHAPLIN-ARCHIV
458,333,125 *2E8EBD9D12358B150E617C0EB42DA16FBFE689A2 91690 TIEDOT-HOITOHENKIL
458,333,126 *2E8E0015A55726402A7E9661EB79C7EFB852733D 93c50fa1c0a6c3b03d8a941d7d44c467.moneymaker
458,333,127 *2E8B104A64EEE2DDB3BF16C084A319B4B6E57695 verifyingt
458,333,128 *2E833D4CAD0DA93F208A7C71F23CC8EFC087FFF6 9APPEASET
458,333,129 *2E84D67D755B9AC60CD009083F606D7AA679DF9F 9ASDFGHJKTOM
458,333,130 *2E8AE09606F03ECA4205A7CA83B70B55ABA2F387 VERNSTEEL
458,333,131 *2E8DA692727EB98D9737C33843697949866C56D8 VICENTETUMLISON
458,333,132 *2E8C8CBC9EA3CCF8C8E230FDC23B76E818652A1D VICKIEHARSTON
458,333,133 *2E8DCF0B843C7A26597831A1158FBE6D581AC386 9c244s9s4cyb4ygfp7h2bla4e
458,333,134 *2E89FDD3DC85120B2EA3ACCD234D1137FE67A531 [email protected]
458,333,135 *2E80E7252AB149DA91CD1A05974A9D71D8640F14 9GANDALFAMIGA
458,333,136 *2E8ED41BE293C3875D4F25AAABD139DB087A9C03 9GWWYSTMBLXOHJAE
458,333,137 *2E8968F8772CADBF72BAAC75051E471E589DFAB2 VINCENZOCRILL
458,333,138 *2E880E8A0A75A48DF0081CB75EB3500633D87053 VINDRUENE
458,333,139 *2E86C4A1F61F856D5ADD37154A0495608CF366F5 9JANIVAN
458,333,140 *2E874621A8D866A27EA8665BC1D0145D1978A3E3 9lavrock
458,333,141 *2E8898446BF12EF8AC4837D20719E1BBB11FCD1F VISUALISAI7
458,333,142 *2E8ECDBBA72C8B1E47B09823E67CC3C63445BC0B 9ONLINEBLUE
458,333,143 *2E8D4B7C6555C3ECA0D729D57F2916EBE1892CEA 9PRODUISIONS
458,333,144 *2E89B51CC362D2DF9E69B007B3BE41357CF17786 9TRAININGINTEL
458,333,145 *2E8729366693199F068A2567FC8F2B33D6156123 A0D6Y
458,333,146 *2E827B3127443C873B101A2BD62014AD38C9DDCA W1N9LE+
458,333,147 *2E8FB3D69B8781E3EE4D9474CE0A997834273B69 WALDEMART
458,333,148 *2E89C53FF1B7C32DB64904B9FA6F6980B72DBF16 wallyree
458,333,149 *2E8E22B3631A2F7505B2F57D1D1561442A1C0738 a9f_i
458,333,150 *2E801B230F914722C94484DC32F8F1B79B6B400C AAA`<N
458,333,151 *2E8D340AAEEE9800E5B4832DB6919329D1ABBA95 aab0gw
458,333,152 *2E88FAA11A521DF926F55A99190E70BD01028075 wdrozeniowy
458,333,153 *2E810D941C70C73222ABC46DF4A48A147DAC37E7 AACHENER5
458,333,154 *2E895007E4297AD25D5A7C202F5E111BA7FA966E AAHI
458,333,155 *2E8A26FB01DCC0A6E9473296B7BDB132D1C306C8 WENGOYESTARES
458,333,156 *2E875474B811819D9DFEA73C96197FED84319D48 ABALJEBSWING
458,333,157 *2E8BE4E71936020672BA1AAE90974A4BB0D50886 ABBOZZIS8
458,333,158 *2E8C86DF71C4FC99454A7728E415F21D3C06EF88 WHITNEYDALBY
458,333,159 *2E8C5CAFDE494CD7B7FD10689A8DC6999A0AA3E2 wielarded
458,333,160 *2E8D197827FE5DF83313E2C60799FAD054A46BAB WILLIAMCREPALDI
458,333,161 *2E8C8C9EE20F5AC6140679E63CC8D439059DE52E WINKILLR
458,333,162 *2E8DA82F5F6AB1737137FD23276AFB61637E1D8E wolfgang.bock.&.lutz.rahn
458,333,163 *2E8B94130F6A264A3B9BE87B07A4C33A4DA0AC44 Admm
458,333,164 *2E80AFCC7724ADAAF53A0AF6AAA89A44EDEE091E WOODYCFI9
458,333,165 *2E87200DEDA500CE90D2E341C75D4BA2E29DE9A3 WTCHKPR8
458,333,166 *2E8DE35CEF837A46AF80F930824F12A8D9C884D4 af7:k
458,333,167 *2E8556280FE7B470F8D691A290E1B47A7F6C0649 AGATA.BRACCI
458,333,168 *2E831FA81ABEF14BD74EBBDA3CCC80E4FB3DD944 AHF9S
458,333,169 *2E88B2279B2AF67EC32F781F2D1723E0996F2041 ahmadalimahmoud
458,333,170 *2E83ECE23048739738C0493074C80E8E4BF35B3C WYNETTEHALLEY
458,333,171 *2E8BC7A9B8BEE00E11D3EA0214ECCD83DD00768A XAVIER-MCKENZIE
458,333,172 *2E8DEE7BBBFBF7C4D2446181668F3A2768B37C12 AJ/WD
458,333,173 *2E821B5D5E5611604787BDB342BB6BDDE758CB3A A;KDE
458,333,174 *2E80F43899798D8F9262B4EED30E7E70559790A6 ALBERTHUF
458,333,175 *2E88E2C6B995D464172E4BCBFB4A95490F380B61 ALBERTO.HEGWOOD
458,333,176 *2E8116859A2AFE0752852D8C0EF2C44ED6045B35 ALEJANDROCIFUENTES
458,333,177 *2E83BC64FCB5068840EB7BFE6C849891AC3414E3 XU_HOUPEI
458,333,178 *2E83BDED624F730B392C260BA45F7D8DA2E6A5D4 XVICTIMVICTIMCOM7
458,333,179 *2E8A6275ADBF95A09D32728F16CE7094F66E870E y\9
458,333,180 *2E82D1F1833D3BEC375BD5C7BFFFEF4AD99C0C53 YANNIE.YANN
458,333,181 *2E8E3BD06D034243BA7B47AECAB25F19F4C14B1D [email protected]
458,333,182 *2E8C83827A71E6A008C01A835380DCD3A5CF2913 YAWNOS
458,333,183 *2E8EC4E4B71D1246AE92B37F8453BD3205BC856E ALPEGEMEN
458,333,184 *2E8B8F697EDCE5489C57455B1EC4AE7E27B16B7E alvarotrisch
458,333,185 *2E8FE97F17D6372EF99861FD45A6FF4BF3051B51 yopej.de.la.cruz
458,333,186 *2E89DD081E1BD7C570122BE36794AF3F3E0F34D0 ALYCENMD
458,333,187 *2E81DA6469CB92B3C2CE84793F73F881AC22AE70 AMADOTYLWALK
458,333,188 *2E8BF450E5E87137603792A003A3E3EE5DC35E2C AMALEEBEAR123
458,333,189 *2E8DE907EDB23CB93AB070AD08CE38DC557F4285 YPOGRAFONTWN1
458,333,190 *2E8C512BAB46C19C1B67F607A94A77C0C27AE181 ypostato1
458,333,191 *2E89D2DC5E940C25015F6020415A27CDFF66631C y,sg
458,333,192 *2E8458AA8C997C5ACB53EFB5C3F72C170B51A83D ytu
458,333,193 *2E8644F58F45E11F145E96DF1A42D53AF8E3F28B YUNGMING5
458,333,194 *2E8CBA7B3EC2AD55E1AB1B3D4E1F143B8EC04B2A ZACKCHEREPY
458,333,195 *2E891CA50659A8D0C7515B0057D98AB27D230BA0 zackwalkingstick
458,333,196 *2E80BAD9934480C32281990F6110D05B5461548D ANA0702
458,333,197 *2E8999871E379BAA773775571A805458FEAD57B7 ZALAZIJUED
458,333,198 *2E8812E57462638AF2741324C5BECF96EDD73C67 zbigniew.kowalewski
458,333,199 *2E80E362829DD2DF0B0628F4390EBC9308AC0E20 [email protected]
458,333,200 *2E8DBF8CCAA4C36F458972A285DCE5C8AA69CF15 a=ni$
458,333,201 *2E8DDEE1ECA6E410E40186505299C0B206F22E54 ZLIZOKIPOKI
458,333,202 *2E8A9ABF864CBB6012C9127D19F97E4A2A42F19E [email protected]
458,333,203 *2E8F8EB40C122112B3FC472BC6B03DC9B097A7E3 ZOETFERNANDEZ
458,333,204 *2E86951EE97A7B2CC16B3C36982428B670F2AB71 [email protected]:
458,333,205 *2E88D28517F22ACA860C10144BA28915DC1D4422 ANTONIO.MARKES
458,333,206 *2E8D33946A64D5B0DEAD2CACC56C1D29BFE5E012 ANTONIONG
458,333,207 *2E884AEC3C063CC7A0D5D29208B5EDE2B178B2C1 ИНТЕРНОДИЈЕ
458,333,208 *2E875DF1A54BA8C384E9A93E0BC2C8230CE3C8F1 aq!_e
458,333,209 *2E8C8B472682F98DA6E41FD99BA996BAFCCBDAD5 argeland1
458,333,210 *2E8747B4526C2FA1C67029CBD8402A9FF104DD74 ARONBULLS
458,333,211 *2E89C76983A4B0D23AEF1EC6EC7251F32E2CB68F artificial(end)
458,333,212 *2E87B261520B1312193F32A4219116099C051C17 ASA.FROEBE
458,333,213 *2E8D2479AE9F78FD6BEDFE9270D1D727571F6207 ASLIMARC
458,333,214 *2E8CFE67F8368E897DC910018CEFDCB4F9003B1E asuc7
458,333,215 *2E819E097956E69808FADFD602A883AFE1F7CE38 AUGUSTINEBRINEY
458,333,216 *2E83FBF9AB186986B78D3980C5487CCE75FE96B3 AUGUSTINE.SCHELLS
458,333,217 *2E886688BF7B2D976E753DD31BC51B7539463EBD [email protected]
458,333,218 *2E8ECB48878DDF754FDA68DDC746A2999E6024B0 a=$us
458,333,219 *2E8871ACF0E0ED15DA38FD35A600499F44AF1CA6 模拟蜂窝电话系统800MHZ和900MHZ信道上未被使用的带宽来进行数据传送的系统。
458,333,220 *2E83CD70F90D42703E31E624C518B73B2535DC75 B/(,
458,333,221 *2E8FC8E7D338FC3B55F21FACE21780BCA6A6DA09 b74tw
458,333,222 *2E895ACFC5DFE667CEB9C6AF0BF054E6D22A632A BAGZENTY
458,333,223 *2E87D4A7EFE847121B41B12238E697345E504EC6 [email protected]
458,333,224 *2E83C44615FE37667A4137C5C2F057DD8AEFD025 BALDIGIOVANNI
458,333,225 *2E8A3C9437E8060A5B7EF54C490CE6A8BEB8907C BARRIEETHERINGTON
458,333,226 *2E8820C24E7E56D691326D0C513AB5FE74888DB1 08281568
458,333,227 *2E8FB36035E95C330756F518A03585AE017B8886 08tucker
458,333,228 *2E809AA706C8B292F46665AF47C416791E97AA91 1349350 THE CUTS WILL FORM PART OF NATIONAL REDUCTIONS
458,333,229 *2E859717F48BE31CA4A75BBB407B90E0C8ABEE56 14091468
458,333,230 *2E85C9A09C8B3CD2DBFC5AD84EC3645AB9DD59BA 17 ALARMA
458,333,231 *2E8A4FF7FA60E14DF4C68AAB367E01842E915676 19953011-4A0C-30DF-AD2B-A957BE5AA34C
458,333,232 *2E87FB513BE63D9EC43B15129198EFDB868B00D7 berniecroteau
458,333,233 *2E85784DD6532BDD4EFE6ABA7F00B34272922A87 BERNOINUS
458,333,234 *2E882CB3C1CC0B1E7D7A5A3137A0E51B77B84054 best2163114232
458,333,235 *2E8E9B2D7A1860B8A973C05FB18A3DCEE3CA4975 BF1U/
458,333,236 *2E8528F9896CE60555ABD3E944CDEE1E62AA4361 BIGGISH
458,333,237 *2E8C01F183957DBB029FA5576DA66A382CA5851E BILLYSALZWEDEL
458,333,238 *2E88C1C618D1CB88100236C26132C6532F45E798 1korkeapainepesuri
458,333,239 *2E89A07C269AAC1BF747FD2B9562710828DAF324 1LICHTSTAD
458,333,240 *2E818711890BF331DBA936E0D8945B3C79E20C1E BLAIRDESCHAINE
458,333,241 *2E856770E52A3F21796DFE9A99A5AC15559A3BD9 1-PULT-LIEBLING
458,333,242 *2E8397AFE54751FCBED6F5F58F5114268A9FAB13 BONAPARTANOJ
458,333,243 *2E8F00B31FA1BE842063B4BDC6A4ACAAB107CABF bondtimber
458,333,244 *2E8D1AC38945A6DF9243020F51F92F6A6B881F2D 2317345 morethan16millionhavearrived
458,333,245 *2E8EC7283089667ACC3AC34235D7B74A15F7D532 b-p2m
458,333,246 *2E8281E61A39E2E6448DB186F21691386904491D 2604212 DIE-AUFTRITTE-KOSTETEN-VIEL-ENERGIE-.
458,333,247 *2E899CDD1AFBCD0D157E9B0731720F3B4FB70503 brain_vesicle.br/ei/n_'v/e/s/i/k/@/l
458,333,248 *2E8CF596E7EC8A8029446E48ECA9CC2D6980F1D3 brandon-a-wright
458,333,249 *2E8479A19B86EBEE4A2EE1C672622348BAB1256F brantwiacek
458,333,250 *2E80F4FAC1549BFC11D19E73D691ABA2D9557C14 28051929
458,333,251 *2E8D4D6DD281245D6496C5AB99444EAE9269FCFD BROYES0
458,333,252 *2E80EB51149F59B182863C322A15ACB1EAA28DB2 2thefriend8
458,333,253 *2E8BBC4873CE3AD9BC83303056AC7901647B6B20 BUONAPARTE
458,333,254 *2E8741D0AB6D35EA8EB5140060F2A042BCFA36F4 burnt-girl
458,333,255 *2E83097C263D9943AB353DF0127B14AAFDEAAA72 4-P
458,333,256 *2E8E534DDB44CEF198522D3E82CBFDD53FC40B16 carminekochevar
458,333,257 *2E81D0D5416B0B7182841A7007A307BA2A7E605D 5AFFLADEDE
458,333,258 *2E8B78272129E695994BB9E9774E8DF7D589D030 CCc?
458,333,259 *2E875A3A2D495071C9E06BC3E08DB87E1B4CD6E3 c$,ee
458,333,260 *2E893F90BD8B65829AC6231E8CB4C84D7D666746 6FRAGMENTERAIE
458,333,261 *2E88FAF10452EE3AEAB50DEACC0BA92630E62F4D 6GEVISITEERDS
458,333,262 *2E823202B533E5EDF91738222B079615BA75ABE4 6PANKKISALI
458,333,263 *2E80633FE4F360E4C87B1DBD967D34854988B2F5 6THEGLASSYSEA
458,333,264 *2E81E359A441FED96A531D91749DA6F692B967A0 6USTANOVLJAVANJIMA
458,333,265 *2E83201877F45F81772B35CB1274778AA2421DFC 736630 UNTERSTUETZTWURDEDIESERDURCHFALLENDEROHSTOFFPREISE.
458,333,266 *2E89A20A118A7984E81F59C1F24F2E79A02CDF5A 784142 makaay : ja , ich denke schon
458,333,267 *2E828F8E3B66217545B5793AE8993F0E0E8175AA CHILLCN4
458,333,268 *2E8FAD6608135A355B482670E405DBEE3558B10C CHINTAYAAMYAHAM
458,333,269 *2E8C4BAF97067EB81DF52E749FE521C79FBBE296 chrishershaw
458,333,270 *2E8B5D69A0559E162487EC2D055B60674BCD9785 7BEAUTIFUCASIO
458,333,271 *2E82692606CF66CADC3280489FFFA52BED05598D 7BERUSTES
458,333,272 *2E822107DF670E3DED2BB3527B0C6D950D692EDB 7CARNOSO
458,333,273 *2E80BED78B33F27AFCF822F6A3D5615059A871C4 7DARWINSAMPSON
458,333,274 *2E89AAE7533F9CED6A5BB1B9C0F9428871C95237 7DOWNCRIES
458,333,275 *2E8E9C7D567C93007D3E7E30FC4E7A137D511938 CIHPARGA5
458,333,276 *2E87FA049340FBFE2437B888A584426D66CDAEDC CIKSUBANGL
458,333,277 *2E89E766873A6FF4D5D07F7B587B3F86FB8747AB cinemusic
458,333,278 *2E8FCBB464905B093BD7CACC2864655CB7C75FA0 cjtmh
458,333,279 *2E8187DFE9B04A4104F50E1BDA89138779930E14 CKCI"
458,333,280 *2E8E704A2B4431AB24CCF35ED28006DF85C7D3A1 7proibissi
458,333,281 *2E886E80FBD65C1DFB0C88EE5837BC68C5F413B0 88areenan
458,333,282 *2E8E9C55D8DA57E469C20CCC85AE4E41362036AD 8aa
458,333,283 *2E8AEBB83BE356996B8DD315EDA5401EDFDB1929 CNEb
458,333,284 *2E8170C8824129B3D67A8B658A7C6E52B77CC288 CNFSQRNT5
458,333,285 *2E892DB945B5F840CDBDB7D96FC57A51E6FDA20F COLDNESS
458,333,286 *2E87A9EF89C108E93FAE296622CD057E00F3A544 8INFLAZIONATA
458,333,287 *2E86667D97346CD8282D67A0DD7DBD49A8FE39C4 8KISSTECH
458,333,288 *2E805CA74FD40C2633FDC889E83E06355312D22D 8MONSTERMARCUS
458,333,289 *2E88D61FC057E896384FF1EF9BF205D359922756 Comp4non4bly
458,333,290 *2E8915566CC9AE37E08CD4A0A99A3CA7E8682A53 CONCERTOINDDUR,OP.7,NO.6:I.ALLEGRO
458,333,291 *2E8F96640E127E493ACB8BC5508ED848CB3DD62D CONSOLERA
458,333,292 *2E80738BF5E369D353D23A5E10E6210987029549 8STARTALEX
458,333,293 *2E87CC2BE3F550AE5FB0F055BF5A7EB3D1E8996F cornellkercher
458,333,294 *2E84875516F65B893F662172F98291E4ECDA5572 CORUMMC
458,333,295 *2E8CD1442433AE34A5BE338FD7EC415B19FCDF76 CORY.MYKINS
458,333,296 *2E85D39C472A7D7C3A930DFE21624A238623150B countertime1
458,333,297 *2E85FDA8A309E87B58BAE5AC57B405C843830D3F COVYV
458,333,298 *2E80D8EAF3FE6804A95472B28B335069B900A3ED CP;
458,333,299 *2E879D1D4AFB19144E2DD85304A14BF3D451861F C:\PROGRAM.FILES\MICROSOFT.VISUAL.STUDIO.9.0\XML\1033\SNIPPETS\XSD\COMPLEXTYPES\CHOICE.SNIPPET
458,333,300 *2E8B229493C5A15A7FA17F93DA9ED150656267DE CRAGSMEN
458,333,301 *2E89690553DC65ACDA1F29B16C5808A9FA3EF8A9 9JADED
458,333,302 *2E8EB313C0F849852806A7349E7C9F77EC38C7A8 CREMADOR123
458,333,303 *2E8D343DD8EE8CC2D7B3B20DDE006B3E0840F4A1 [email protected]
458,333,304 *2E8ACC1C8CDAFC0CC7EBB4B1FB65FEB69D6052A9 CRIOSPHINGES4
458,333,305 *2E85BBE92927EB12F1BBCE81E9E181220753118C Crochements
458,333,306 *2E8B098B1B91960EE2B0F836BC15B668B0B13A26 9SPARKYCOLLEGE
458,333,307 *2E8156B353F8D1FCD89D944F4D1B632C850CB6D0 9 SUUNTAUTUVIIN
458,333,308 *2E816F8013578184B23B5DA26E97E2F47CA33BE6 [email protected]
458,333,309 *2E876FE6F96A284EC221271610D314D4AE0EDF9F [email protected]
458,333,310 *2E8141D44091C08E00596ED312231FCA50502D4E a0;/b
458,333,311 *2E87F8A23E34C8C3C5D46FEFBDC463D8D7A2DE47 A1B2C3D4MARGARET
458,333,312 *2E8C2F20E8904EA59194BFBEAB19464C0A2F1629 a4t$
458,333,313 *2E8791F0C7CE8C70B2E0F499BC81523499012E3B AACMV
458,333,314 *2E8B0FCB42C50F3EA9C21CA302DD85E8D99E727F [email protected]
458,333,315 *2E8662043717C3CD0C27D817D0C53C6869F89B9F D6A=P
458,333,316 *2E8E43C52299634721004D7019400589187BD5B7 d#a1.
458,333,317 *2E86D6A531F3CB3932C7DF94FC2CFBAAF11D4EC7 DAMIEN.FLEISCHMAN
458,333,318 *2E8F0974B231DA4BE3A4CE12E818AB07354B08D3 ABRAHAMTUBOLINO
458,333,319 *2E854782C367459DD9667F29EDE4233AFA949036 damonduda
458,333,320 *2E8256304A8A824DA777D889D429395AF8A1DF6F danalenius
458,333,321 *2E89CF51972C3310E638C1BEECF637331F26EBF4 abtj,
458,333,322 *2E8BE38CFD4EBEE264C3FF6B0C75023D27DBA227 acn_x
458,333,323 *2E8C6B7BCF59F4D28415AB35FF79F59BD264448A A=cV
458,333,324 *2E80E2683B4EE44E26AA0FD003E931F7B88A6028 DARRYLEICHHOLZ
458,333,325 *2E81EC36A7EE5267BC5D704279F87FC69B230B97 DARRYLLINGLE
458,333,326 *2E8B63089C0CE19DC43BCFE6B22890C36A9062E2 david miles huber
458,333,327 *2E8360A1BC74AA4E9729CD4692B436EB64BE2DDA DAWL,
458,333,328 *2E88F7BABCDB18F5AB50F47167F3846769EE9F60 ADOLFOSCHOLNICK
458,333,329 *2E8727EA4B0681DE0AF77F9C675FB86D6119C8B5 ADoP
458,333,330 *2E88BE8A2C76AAEEBE0EB0E2ECA27C3804F6367E agustinwiderski
458,333,331 *2E8B31433C49BDB9E4BDB3B49C5CF9BE4A1F828C DEEPPILED1
458,333,332 *2E8B408298F669DD02E1464671DF8D782CC6D8DB [email protected]
458,333,333 *2E8909AF65D0A68620C45C6FC29C94EDA43BA9B6 de#r
458,333,334 *2E8B6FCC22ABC94F3832EE3597AE8B6EF57B2434 destiney.miller
458,333,335 *2E833401BEBE9365D31518A01A37FFF5A3782B94 destviya
458,333,336 *2E8C25166F7C9EA7430D4883095DDD9808BC8405 ALEXLUERA
458,333,337 *2E82BFCFCA37AAEFB385DE1524379B3E38C754D4 dgrz
458,333,338 *2E8CF65E0D262A0C5D2846BF6EF2E62662EECE89 allinam5
458,333,339 *2E8DBCAEE18542A017C39622C0C73E3CFCCBD8C0 altfriesische
458,333,340 *2E8BEB4106D465183A439D7CF86C78E7E80CB674 A?MPH
458,333,341 *2E864A0C3581C37ED8073159564BEBA28DC2E9A5 dl=aw
458,333,342 *2E8125B7A5E4C2B13938314F525D3D6A89B0E659 A,NBX
458,333,343 *2E8D8AD9C1B25B1A325A60E2E29CD58A097DAD06 dnalella7
458,333,344 *2E8F15999F1B415B6FF3E90BDDDF4068A9FE1BAF ANGELOKRABEL
458,333,345 *2E8F0C2724C56AA0D368F2F766F979D99E6E8F7C DNGG$
458,333,346 *2E8BCAB8327B5D26F8612B4C9E496445B106E8EF DOMINICK.HARBERT
458,333,347 *2E876EE3F9763EB3B0B7C643B29817606A27EDCD antoine376
458,333,348 *2E8C3F6A80577F570B22EE7EBE433C8D21DA022A dominiqueharis
458,333,349 *2E884643CF7C70B2A3CFD15B035D359453DFEBD7 antoniaclauson
458,333,350 *2E8EF4D5F0EE457CF446999183F46ACFB58452C7 donglacerte
458,333,351 *2E80FAC1EA6C9328045FE252E79E3B7CB4E43DCA donnisms
458,333,352 *2E8499F38E22E246718EF1CF01DB945FCE4539F5 DOOWHTRU
458,333,353 *2E81424012954DA19842F8D46EC01D8B5120CB66 DORIAN2010
458,333,354 *2E8DE8E8D72BCC9A0C81BE364D9D4D4D7204ED38 ds0rd
458,333,355 *2E817A53A993D968958111B7A9DBB8F02246C696 DSPLCNCS
458,333,356 *2E8B3567AE47348F729CA535D6A075E561859893 DT;H
458,333,357 *2E8A13B7A93A80B6DAE7634874224A73DCDE82BD asdfgh469
458,333,358 *2E80272441EF1322737B6AA0E545217112B942A6 asvkr
458,333,359 *2E87BF99F26E3C8D2E66358275564C935311BB1B AURORA.1
458,333,360 *2E88F833824F406A52CFDCD7C3178670AE01C46B E44TTUNEMENT
458,333,361 *2E8100839250647EA130D810585AE91BBB163FE5 AUTOSYNC9
458,333,362 *2E86A31D01A20D3CF1A28BC132FA5AF713152D78 AVELLANENDA
458,333,363 *2E862C9F1B47C73A4BD7B1680063BEDDDE1A2720 AVERYALBERTINE
458,333,364 *2E8CB8E1C1F0F757BFA1B3346034E6EB8679F9ED EAJ"U
458,333,365 *2E87FC34F75D6FB4FC239A8C15539B79DF46C02D ean1c
458,333,366 *2E8A5C6D76F34E448F212A7485C2456FEA0543F1 eastofeden(extendedversion)
458,333,367 *2E8EE3189CEC6CD98F1C88A68F7B313EAE2CEB25 EDIHUSTA9
458,333,368 *2E8FFB6693F3C57B64EBDBDB69BABEDFF3A04E14 awn5v
458,333,369 *2E8588EF800DD32CD37BCBFE4149FC40CAEFC29C >b0.~.~.~.(8
458,333,370 *2E85DC004195A9CF65D8DC62BEF6C7C20DAB5025 B/3_O
458,333,371 *2E85C6D6E42C477A97C2DE39536AA67DB85E4673 B7O6
458,333,372 *2E8C07BEB8E25CFE81E2671DF0BC2B2BAFACD25F b8njf
458,333,373 *2E844B49FD14946415A33A56BE33F5ABB37C99BD b(a5:
458,333,374 *2E8599A7892AC7AE5F3D6CD1F933E2DD7C183593 bacili1
458,333,375 *2E896933A4D694BDBB8E12EF822C288E6C14939D ELIASSCHAAL
458,333,376 *2E8E1778060E9F2AE1589AF942848781252155ED ELI.MOLINERE
458,333,377 *2E804883B6527A4D194BE6E9EBF16E76C71A6549 BARRETT.BIAMONTE
458,333,378 *2E84A6C80FF49DCD8E888D62602DBC458AF42CF2 baumwollgilde
458,333,379 *2E82FD2A5CDAE78DFFA2E39880D369F76F88EE01 bbzg
458,333,380 *2E87E419FCCCC00080EE3017A65BCF12F91E00A7 bd6?6
458,333,381 *2E884DE07D8F1E85522095F838D973EB4AF5A928 BDLLIS
458,333,382 *2E85EFF7D20ECF14B7875A627E457F353B676F69 begane7
458,333,383 *2E8C99FCFF691B2521B2C4F6E53CF2E1446751E4 EMUCL
458,333,384 *2E8DFD2AA1F3BC7E7EC58B5EC26FF4FA71D862DA ENGLISHNG
458,333,385 *2E82FA45E43BE684CAC0E5BF23A301D0E756CAEE BENTON.VANDERVEER
458,333,386 *2E8B80CDA8973CBDDA57F0ADC47EA32AE9B8FA36 benzeeb
458,333,387 *2E8A0B003F914093EFD5AC7769227634E066AE19 BERTRAMDUSSEAULT
458,333,388 *2E8559BA3884CB3E4AAE10F45B8A31D082473285 epilysoyn1
458,333,389 *2E8F98D8664DF09F35B7B93EC15DC5B5AC76A93C EPITIXIA
458,333,390 *2E84C3333A47A8FC00AD01895DEDFBB5597D4C6C ERETICIS4
458,333,391 *2E8CAA4B0697BFD2552FCDB6FCC918EECE8CC424 ERNST-BURGBACHER
458,333,392 *2E840827C40E1C1FD200047FC546A940A6B0B6C6 biplaneexpocomwww
458,333,393 *2E852F772CC69D46CB97B2EAAC41135D95805528 bj35645i
458,333,394 *2E8C45B36500B5C55162DDB220AD7B86306DACF4 BLANKUN
458,333,395 *2E8784F9781EE1439138D0BF6DD7E7907A0B4879 ettaseb8
458,333,396 *2E81595EBF6DECEC5C22DACA9D12F26B16DD3DEE blta=
458,333,397 *2E8CAB130ABE796B62337B3C5CB6FFDEC7D82E66 BMBK
458,333,398 *2E8D74DED3EDAA9CD05C1140B6DADA2DC76D63E4 BNXW
458,333,399 *2E86A4D294BDDA8B875807AD8F02012C46F18939 BOISJOLIES
458,333,400 *2E8B4C71B1A0FE546F5D4EFAA4BE900396E80E3E F93129
458,333,401 *2E8FD041DF5CE11768DAC63A347E642EAE63D0CB BORACHIO MARRY,-IT-IS-YOUR-BROTHER'S-RIGHT-HAND
458,333,402 *2E8AABB9AA701666BD558214C9E28927DCAFCE62 BORTSERS
458,333,403 *2E8C7C9B42484143DB52CB2B6CAE21EAF2284855 FAL
458,333,404 *2E841D7E833AA92FECDBD33EC320F3CD19B9A389 B----p.~0:p
458,333,405 *2E82D00FB89DC5FBA3FC0446C76F7042AE1A31CE [email protected]
458,333,406 *2E8F11616B74EF16EA53C9350034551F503D3199 FARAHKHALEEDA
458,333,407 *2E854BA65D7157F7FD45BE7310531EC6292F6E4A brandon.eicher
458,333,408 *2E84F122F47BEEC7FDF1D704E155429CD48D1841 FÉNYIBEN
458,333,409 *2E88CE3678730E61B9180A09F857FFA1C3994744 brbpw
458,333,410 *2E8743067A4D25156E2CD5B2A659D5F80280D5DB fing3r la
458,333,411 *2E89963D186E652DDFF3DCA4B114CD1707345878 brettleimkuehler
458,333,412 *2E850D03A39241B600880BBA86FD26FB512A5697 BRIAN-BILLETT
458,333,413 *2E8FD8D4B066F3AA2827510031EDA0E0DA0C37E2 fjihcsam8
458,333,414 *2E8A1747187A13DB12D097424C2902AE7D8EA72B BRIDGETLEE
458,333,415 *2E8F1A0915015ADFB3E11306BBA5694F33E3C8E2 formnum
458,333,416 *2E804F020DDB5F2665E52081C888443D2F7CC0CA BSEPX
458,333,417 *2E8E26E29385B0BA41FF1556E8737A3E8E3584B0 franceskina
458,333,418 *2E83F8CD75347C2158CFDB4AFF922C2BB20B2A77 FREDFOOBAR
458,333,419 *2E849C3F17F8550321232ABFFAD77D8FEE5EE1A4 BURTVANGROUW
458,333,420 *2E8B3873812A19057FC7D5A2C3F2A5AA7F9747AE BUS_WAR
458,333,421 *2E824754F05FEF238CD9ABFAAEB466DC502EF18C BVCU=
458,333,422 *2E87AA90B7A7D9986E5226721CE9366416B2F71B [email protected]
458,333,423 *2E87730ED9BB5C6D313F28CA127ADADEAC8D007A Further.Study
458,333,424 *2E85D2B1E203FC2777CA3D2A80EF623538D931FE BYRONBRIXEY
458,333,425 *2E8C0208B59E5C6A6552EA304F4774FB6328FD31 b,ytq
458,333,426 *2E846E076387E49059FC0052CF2E30A7419B7092 galensodachanh
458,333,427 *2E84614C7B8658E62731E7D3A870943B3AD170E1 c4anj
458,333,428 *2E895DAFAA03E32CAE55A80AB72C6FEBB4F22069 GARRETT064
458,333,429 *2E8E4F72EB28E1555F31E5A3EE17E48E3600A1B3 gaspergoued
458,333,430 *2E8560F5C6E84ADCCE395289468502AD077D7162 GBFTXQLJLDHE
458,333,431 *2E88EA7E5AE980344A5C80058580CFFA91D562C8 c79hb
458,333,432 *2E8797F68389131755BD4C91ED50A5B02EA2C8DB CA15BR53
458,333,433 *2E847B801001CB7227FCC9AFDBEC05BD5AEB279D [email protected]
458,333,434 *2E84DBADDD1A57E8F9373A9121BD0E5DA1341D6E captain-john-smith---[[w:mel-gibson|mel-gibson]]
458,333,435 *2E8DAA8EF2D596832E512D8BAE9924B7429EEA5A CARRIAGES160160
458,333,436 *2E8E423A4125E884559F23F2B7820F8D22E3B99F CARRIEHORNBERGER
458,333,437 *2E825B8DBDDEFF83C69D77594CD39EE33C8B8480 GERMANKANOSH
458,333,438 *2E83DF843D6EA583AF336782DFE00D4B36200895 [email protected]
458,333,439 *2E8C1A2BE29D31F34DFB93FF25EE2556202DAB2D catwatson5
458,333,440 *2E88AA2A78A96119598CFD1E429E989AD2B58E45 GIHZWCNZ
458,333,441 *2E8D3975C770B82E9868B955D0D733FF7956E8C9 CC)DV
458,333,442 *2E8D64B6243C9E77E9204B65CAF458D3168B205F CCLW
458,333,443 *2E81023558437A0B118CD9226DEBB72B537490FC CFD0N
458,333,444 *2E82D5A352A8687806EFA9FFD17C2EAF931CEC1B [email protected]
458,333,445 *2E805EC59A8C85D74509B6011B1423998D51ED75 CGHT7
458,333,446 *2E8FB1254DBA90A6063D38D68BDA04FB0FEDD59D changesbrendanhodge
458,333,447 *2E861A98CF5E08A5DC2EC98023237BA8C26B001A CHANTILYN
458,333,448 *2E84FC6D0C9DEE1488ADC35307346565B78EF304 CHARACTERISTICS—INSERTION
458,333,449 *2E8A396AA80084F731027CC95A5040B324FAE688 →characters
458,333,450 *2E84BB592183609A4B3BD37ECF7E1D8668B2044E chbh
458,333,451 *2E84C38922B67945B7A08D2987A278C43FD951C6 CHICAGO.BLUES.SESSION,.VOLUME.3
458,333,452 *2E8CCA8ED81D454ACDD9CE22996551BA3EF68240 GRAHAM.SPECKEN
458,333,453 *2E8861D7AE6D0B26C0DACF2706FC782179DE3A4B CHONG.OBERDORF
458,333,454 *2E8750764CF98803E73582E477411B3F0351225A grapsas
458,333,455 *2E85C59E09C9DBAD3B13958BA90E114EC9D8FB67 GREGORY.CASASOLA
458,333,456 *2E83F4D81E67AECD33978DAEC974642DECEEB030 CHRISTMASONFIFTHAVENUE
458,333,457 *2E833269F6FA856A471EC90D5A21B6BB1056A911 GROBICHAUD
458,333,458 *2E8A2DC5E76A86AC5729A9B43B42B80A3DBC850B [email protected]
458,333,459 *2E850B967ACED252D837C3EC2A6E6F6637A277BE CIK-WANA
458,333,460 *2E80F5E103C907AE7D88B3FDBF61C49F893B21B3 CIMEEBSW
458,333,461 *2E87FE28CF2FCC73C819644EF8CAB5B894A24D9E cimw5
458,333,462 *2E88046B6C3DACD99269E515C067917402771F8D [email protected]
458,333,463 *2E850BD5C743FB48A5EACCACCF0A2FC46B7DE8E0 GWEN-DOLAN
458,333,464 *2E852EDC9E4AD2E60DAF0E5A241116CD968B896B GX$$
458,333,465 *2E89160CDEF022BE57FE9E150401684DF222C9ED CISRHENA5
458,333,466 *2E8371057EB979D85E85B2DF00CB291BCDF150DB [CJBAA
458,333,467 *2E8A2542014F42253522715A2D5B265A18D801D6 HalflifeCPL33(Maps&Diagramsremix)
458,333,468 *2E81C9685C2D94C009342A77FD7F75C7D4511B79 clarenceboutros
458,333,469 *2E8CE62913E91026ACF5A3D63196F36A1C5C7C03 CLARENCEBRACKMAN
458,333,470 *2E876AEBDF9CB58C93CE4A739B87658C3B6217C6 CLARK.MUSSELL
458,333,471 *2E892B1A0EC4F28237550A5E384D9992828F1496 claudio.patricio.nunez.caama
458,333,472 *2E86B9C85ACE7AF74435C1B10EF635A66820A82E CLAYNONAMAKER
458,333,473 *2E80203121ABA6D77C8B33DE38BCD3ED32B57E41 [email protected]!e$+
458,333,474 *2E8355FFC9AD5F649E9FCB6C4C35A631337C273F hardbasschapter6.six(disc1)
458,333,475 *2E8DBC2FCDC23C59E1C4BF2AF71B5DFFA063F9C1 HARLEYMENTZEL
458,333,476 *2E8E38956A0991244CD183B00FCE19478EE14735 CLINTHURLBURT
458,333,477 *2E8AE2C7E822ABEE46C42C3B01109CFB02E4AAEE CLINT.ZOGLMANN
458,333,478 *2E8E4F5236043E0FD7461DC10269CEC0EF34BCB2 clrnq
458,333,479 *2E86079605F46DF8B00609ABE081648B801468D1 harum-scarum;-in-a
458,333,480 *2E8966255428479B9C5422574D45A32078F4FD0D HASSAN.UGAZ
458,333,481 *2E80190BA3A5CD913B78AC1AE6460ED1E4FF5C27 C!NBJ
458,333,482 *2E8C30AF42460502409AC8F29E466965FCB7D62D COEXPIRES1
458,333,483 *2E8A76EF30306A08B8BDAEDDC263ED15FD876EB9 HEATH.GAZZO
458,333,484 *2E8C6D14A72A3DF92FD6267C0B1080CCCE311FA2 colbymatute
458,333,485 *2E8B952641CD1101988AE4F04E10D1BA3F62B08D COLEMANCHESLEY
458,333,486 *2E889EA8797A78F5D6E5FFF4DDECE74113B6A402 coltonguidroz
458,333,487 *2E8C761E29D4DD56C71D2AE3C4800CAE73D76505 COLTON.MCCLIMON
458,333,488 *2E827804241FDCF5DDA039C4BD38982CC4688ABA COMA-II-(A.M./O.K.)
458,333,489 *2E8B71F0CAD8FAE13D1ACFD3038053D6CE233B54 Here's-That-Rainy-Day-(feat-Laurindo-Almeida)
458,333,490 *2E86818D8F0A511CC50C80CD1C5FC2E21A7363D9 HERKEIS
458,333,491 *2E8DC75029EEFBCD2D35D8F1F0AD97C9B456EA79 HERSENMASSA
458,333,492 *2E86B0FCD96E6DFEE48E42C77E07C4C3C313B811 CONSU1+!N9
458,333,493 *2E81D324C58412F6F7598AD59E3136BBFDDCB602 [email protected]$
458,333,494 *2E8381501EED112FCCB6368ED107DCF5F5980474 [email protected]
458,333,495 *2E80DCF5945D0375B1D28FD89ABCCDA24804D261 hoofnagel
458,333,496 *2E8266D8A1A8A9CFF8962AC42E8ABBC13D227170 HORACIOASTRY
458,333,497 *2E83EFF596A2EAC27600AABB0579BF0948A27278 c=#ow
458,333,498 *2E8196C789A1571AEFAAAAB5BE02FF3DA7F534EC coyltes2
458,333,499 *2E8C125528749E5F53AD50A0ACE715A4FECB38C7 CP;
458,333,500 *2E817073C7E1CB27D398087B4C744C37651438B0 CQ)UF
458,333,501 *2E81F1ED4250E70E61803D483714A73FE91A54C9 HUY NGUYEN LE
458,333,502 *2E81968673AD281B887E966997DFA71CB72D76E3 [email protected]
458,333,503 *2E827B6F159381BECB46E6E4142CA73BF71B5AF4 HYSTERICAL-HISTORY
458,333,504 *2E8179C558E8F44D1EBCB37F3F5DF9B10A92CF60 csawe
458,333,505 *2E81E813E43DB35C39B35A23D5048C4DCB949BCC IAMYELLOW18
458,333,506 *2E8070D80964B510018652831C6D835A5BF2E065 ¿cumplirá
458,333,507 *2E8FBFB8410F6BC8F7E7A9FFCBDD3E1DE8C01B53 i.d.m.a.t.
458,333,508 *2E8EAC9FF11043587A3095733825F4FDC0D4B9B3 IJY
458,333,509 *2E8DC952EF2C967FB57ACA5BB9B8051AD784ECAD ilovecicero44
458,333,510 *2E873F31EB024943363AE34848F954DDDF2F583A d137a8c133684582c55f46ee8548a606-veJhyWtI
458,333,511 *2E859BBC34463063F57382A46148E563928CBD4B ILUVDEMON85
458,333,512 *2E843D7A618029C56D61A60ECFA881B4333FCE65 D3WF0
458,333,513 *2E81EC7752B46C714AFE599E74654C6D8B89145C INFILTROU2
458,333,514 *2E80A44EA3F27D33EEF66F0818106692E95793C8 dagestino4
458,333,515 *2E8DC674F6AFCF8D09421628B37A88B198C214A5 [email protected]
458,333,516 *2E803852952B0B6D37778A9031131E12CD3FE2F3 INTERNATIONAL-EISTEDDFOD
458,333,517 *2E8D20D45F783A7DAF6BF78CF0970C8B5BA0F086 [email protected]
458,333,518 *2E842DEBDB9F1393D2F978242B8B36101A70FC79 daneivery
458,333,519 *2E8750EFF6757C7A51A803368B29A1BBD67E9660 DANE.ZABINSKI
458,333,520 *2E886E27B3E6CC04AC86F9F6F8E7C6942A1C5062 irvingporras
458,333,521 *2E82678EB9EBFB49A638DDFBBFFA96A30671DB17 IS.MIOSA.AN.TEAGAL.NA.'N.COGADH
458,333,522 *2E80436E9FB6BEFD553D4CAA0F4AE60E97F544AB d(ar;
458,333,523 *2E865DAEE8B757B3C502ADB0F08CB4E55BCFEF0D J206323
458,333,524 *2E8142064FB468049B61BA92F328ACD1B17F5CF4 [email protected]
458,333,525 *2E81E451206F0AC38B729CE484B16DC44B9F383D jack-macy
458,333,526 *2E8D32193E3E0BA12B38D8E40932614B48E4AD27 dasgoldeneschlagerarchiv:1962
458,333,527 *2E8D2FEC61518F11571904D1315B954590A24A6F jai ho (you are my destiny) (feat the pussycat dolls)
458,333,528 *2E8C11A0A92B6DEA1CD9FEA79C7311B28492E7FB JAMAALMENGE
458,333,529 *2E89BA23E4735719F4BD9507DEAD2377DDCFAC23 DBq#
458,333,530 *2E8D5A3EB0A4D75B9F1D759342AF82F0A30964D9 jashandradixon
458,333,531 *2E825660BB6E751954ECE7FC473C5824C3452952 demehise1
458,333,532 *2E8550B4BAB252BE4FC0CFB8ADAE6E59C9B692B2 denverzeiser
458,333,533 *2E871AAA91A627DFD4629A52D1CD7E6D0DA31A4F JEREMEIERS
458,333,534 *2E8AA80E191FE77E2B8487CA5DE771CFEA2082DC deonmoots
458,333,535 *2E8E23B1DCDEE3824856CB5E0462893BECB7DE31 DER AFRO VON PAUL BREITNER
458,333,536 *2E881BF8A337F77994666093E87DF0DA4CC976CB DER-GEBURTSTAG
458,333,537 *2E808BD96118736E36C8554EEEB4B70D2E19CB24 JERRY.BUZZO
458,333,538 *2E8781C7F348A12954C7F1B5546C095757D516D0 jesscascone
458,333,539 *2E8698184F29CC95298984134F5C23E830129059 jessebardeen
458,333,540 *2E84D184C0F72E75691C1340CB877C4AAC25B415 jesseca.hardy
458,333,541 *2E86D387913C67BC346BE8DDADA595E3AAE6D6DE jesustanaka
458,333,542 *2E82807F5DDC38100A36034A4552141395B8781E JEWEL.ROGACION
458,333,543 *2E8DF22D9126D9C60CE9ADB2B3C8A692B9AD1576 jhounna
458,333,544 *2E835373D51E53CBA819698A4B3C7A0C4038B1E8 jikalnosr
458,333,545 *2E8B1A642FFE8632897518064D7627C4B83A0D71 DEW-LIT
458,333,546 *2E8AC6DFA9C16C8E27C73C7BAA2BC48B846858DE DF1VW
458,333,547 *2E8B8F740E6BFA1E792ADE2CB0F184ED0385D27C D?_!G
458,333,548 *2E85D2BA61A6EDB86A16CC542B5C704B5B58416A dhvlr
458,333,549 *2E8132F6D2AD6516EDE50478CBBCDEBE55D7994E diana.sigmund
458,333,550 *2E8BF5E65331D5208D9312E75F687B22CA63C023 johniepeeters
458,333,551 *2E883DB0602B2C205C5E3423F1E46D6D156F13BE JONAHSUSOEV
458,333,552 *2E817A0DFE59003A898A53DF2EADB622FD139627 joni.albert
458,333,553 *2E816C2BE82DCAF7A74A21E454100C34052378F4 DILBERTFUCKYOU
458,333,554 *2E82FE4FFEF346D4833C13F252DC7F98886A6FDA DINESTRU
458,333,555 *2E858CD66BF66CE77D345F590911370C1DB90777 joseflandauer
458,333,556 *2E8A10C97198E76BE230AB463366B48805D2E3BF DINO1771
458,333,557 *2E841FDE032269532B6709926D1D90A93CCAF712 julesimbrenda
458,333,558 *2E8C561341199D039DEC882A9797E7B8D6C4B592 DL"0
458,333,559 *2E8940D9B1EE3533D4285D6E2A970105C900DCDA K5HU
458,333,560 *2E84168E037EDAF5E109720D799EDF817DA03DC7 donaldflipp
458,333,561 *2E811DB6926C5CAAC74B9B32C786F1C958EA268F donkeycore(miniaturestallionmix)
458,333,562 *2E8916F5D27065DB393733BAEE8A11FC363A1E4E drewvalensuela
458,333,563 *2E8218B38B2A959B88501E57016C265A68300872 KITIKOOL
458,333,564 *2E8B41FFE550D31858DDF7D5EDCC9A70865BA529 KITTENTON
458,333,565 *2E8AFE0A6D29C07B9658E6E512240B2B94A41478 drnru
458,333,566 *2E8D416229729A0AF672F94B638D8D4A7266945D Dtgf
458,333,567 *2E8AB642B869997B0FCE5672D6CC5CEC2B054D01 DTRYHOEN
458,333,568 *2E8BF5156BB1C1F6808624286B062E99AAF4B214 ducatN:ducats
458,333,569 *2E83915BA9A6B1F08DD067D46341DDAD4C482AD9 l1h/
458,333,570 *2E8133B802EA05FD1209FDEB2C43E49D5600CF00 LALMOHON0
458,333,571 *2E87FBAD556175DB786F3A65231AAF6E95892C3B dwayneparone
458,333,572 *2E833CD9346444E0445007DA0B793CDE0D77DCAA DWNE;
458,333,573 *2E860E08CE1CCF08A36B4CC60FA1C56D6CAFD573 dyete
458,333,574 *2E86F28A490FFC73288AA8BBC0FB4999C820F181 DYSME
458,333,575 *2E88CB8007220DB8140C4B72561CE02283E65FBF EARTH (64BIT MIX BY ELYSION)
458,333,576 *2E8F30D1E354B207039B2B6422189529386173CD ECCITO9
458,333,577 *2E82FC447B67B9F14B4BD2EA4F5DD12799193A24 LEEVAY
458,333,578 *2E8FFC0ECE6403F32E1E7BE870A1FCF652D565A2 leifwelborn
458,333,579 *2E8CAF4332E76DF110C4DDE3D82EB11C6A6F0CDD [email protected]
458,333,580 *2E8C8074599D9BFF86A8B5C128F538FE51EB8873 LE JARDIN DU LUXEMBOURG
458,333,581 *2E8A1831DAA349FB2B1D37D41F9087A06EF4568E EDGARDO.STIERN
458,333,582 *2E8B42D129DF2B3D7F8EE548F53996F6370C54E9 ed;m?
458,333,583 *2E883B3E7B38A86BEA53191205B543E560E50E92 edwardtabicas
458,333,584 *2E848B0242C876F7DC40F718FBCF6A7F65B78D39 EE7CCE96B1
458,333,585 *2E8AB4C7B9EB076F1DC6DFCDE8FD78AB0BE25F7A EFFRANCHISEMENT
458,333,586 *2E8ABC0492E77E72B0489A2ED18978D2BA9F0622 efye
458,333,587 *2E8A34E9DCE76C5DC88E4797D0129DD8D4BA296A EINE.KLEINE.NACHTMUSIK.(KLINGEND.B-DUR)
458,333,588 *2E89E88EC2625C4D5A7C23E3E9CBB9911A0D4BD6 LILLIANIS
458,333,589 *2E805659CBE4624C14A83FED4A65D4407EE9C992 EJAYFILTRATION.COMWWW
458,333,590 *2E84F9DD694DD8EED1CB5D1ACF4D7C2C4E56C24A [email protected]
458,333,591 *2E8735434E7085F3A3403473E7C3B5C855CBD636 limacines3
458,333,592 *2E8AB7FBE17E5C5CB6E7EA611BBED28E3ACFCCAB ELDRIDGE.LAZARE
458,333,593 *2E80D6CA4625A0623747C239952C54577B2A52E7 electricgraymail
458,333,594 *2E8AF7E7CBE71719BFB69F4F44FF5F8FD1CAF803 eliseodiggins
458,333,595 *2E85256DBCF63E7EA087BF2AFFE368D43B521429 ELLERMIRE
458,333,596 *2E86F6F442D443D3413E05D2DFAD7D3CF9956965 EMDEOGEG0
458,333,597 *2E818A61F39FFE087627DBC0BDAA7B04FB2D4153 EMORY.DREKA
458,333,598 *2E88BF9CDEBA962C112D83FEBAAA743B14A03E7F loveyouxxx
458,333,599 *2E820330AE5C59132B0E3DAB9BB6D59F1FEDC4BB lupustr
458,333,600 *2E8AE7351C52B4BC109895F603FEB5F399AFA05B LYKAYGESED
458,333,601 *2E86583F6EEA18B6DE828D3A67D5BDA41EE12B8F EPP!D
458,333,602 *2E8C757DA8EA23259FDB23D95B4A4B082743A836 LYNWOODHOLSWORTH
458,333,603 *2E82B1CE6D0E674E0D56051C32BA96714AE5FCD8 m0rfins
458,333,604 *2E8F0EBAA50E0C8C883069501CAE957AF46EFEF9 E.SAMBA.(ORIGINAL.CLUB.REEDIT)
458,333,605 *2E8D763B47F862955AC0C59C1684913DC774A11F [email protected]
458,333,606 *2E878951ACED99BB393B979BDBF0CB5C626FC4B9 ESTETIKO2
458,333,607 *2E8D48A1D8AA1E8AE7D87946EA34E580BB08AF3D malanchini
458,333,608 *2E86539F97CFAA66502B95C277502D93196CDB83 euipe
458,333,609 *2E8A1C6E0E64C6A817A24E785C9807D4550F269E exh414+0n$
458,333,610 *2E84BD3E2E184FF42E7388AF3CE55D73DBF275E8 „expedice“
458,333,611 *2E8951A03FE700110F60D133BD698EF1F326FE29 falsafa9
458,333,612 *2E8E7ECF782730A41B66346916E3DDB0CE7DE249 MARKUS.ISACS
458,333,613 *2E8E094203B4472CE4768A1AEE3F21F86F275381 MARNIDA5
458,333,614 *2E875BBA98C7F3EF9F46276622A3CE54CD0D787B MASAKAS
458,333,615 *2E845FA71EF8C54201D07532C8BE102B531973DB masoud-javanshir
458,333,616 *2E847F82C57AE37AE09AFFA0203F61031446D333 [email protected]+1!e$+
458,333,617 *2E8D3037E688B77448355972550EC73275427873 MAWAR HARUM
458,333,618 *2E8B20682B0073BC24A0C0F4E8E39F044A7EFD77 ferdinandsnapp
458,333,619 *2E830B360D3C36B92B4096AE154498835DAAF199 FERMINARCEA
458,333,620 *2E8E9DCF6FE63F0AEB39412513BE50F5619301D4 Maxy.'m/&/ks/i/
458,333,621 *2E8830790A987CE8E3A04A191C5ABA73E8DB9A41 MDUGHLAS
458,333,622 *2E850A3CFE55C147C0598244099F2A944539BCAA FERSKVANNSBASSENG
458,333,623 *2E83DCDDE08C1BFB721A24852F47F7C821B49E2B MELFANSHER
458,333,624 *2E857191EC46C37B4FEFE12175494BADEB4632CD fingendos0
458,333,625 *2E806D620BBEED978529DB988B7DD6DFE994CCA0 mergmaideparte
458,333,626 *2E8D0A58B5457CB1EEAEE856CBB51BAAE0E57B0B MERLINKOTTLOWSKI
458,333,627 *2E86A4E9A0DF6350F2F20FBE7AD3CA548195448B FLORENTINOMELTZNER
458,333,628 *2E87C4BF949B6CC70F519F6167BBE61FF259BE65 MFAREENA
458,333,629 *2E87B0CD06B8FB07C64BB38CE8402F9E656BF0CE FORDYPET7
458,333,630 *2E8529E238466FC70381054785B365CDB3ACC069 miloguadarrama
458,333,631 *2E8F169A865654946F821AA786028BD052486541 frescobaldi2
458,333,632 *2E8BBC2E4C4A14D961F3C2EE97D0248690C555F1 MIQUELBUMATAY
458,333,633 *2E82276A025B6AFC2006E0C9E5CBED368CB31C90 FUMINO7
458,333,634 *2E841DD41E50256C67CC79B9ED81D2DA7D79537C [email protected]
458,333,635 *2E8308806D56FAFA288F50600617C2ABDF4E8542 [email protected]@[email protected]
458,333,636 *2E8A3309A7F00DED6FA0FFF9899513C3B1F56864 mod youngpersonofuptodaydress
458,333,637 *2E8307DF1DFA3FAB16936A672540A1AE5DAFABE5 gael68
458,333,638 *2E8407C759041AE906F838C1F072BB64644E1DCA GAVINKHEMMANIVONG
458,333,639 *2E87330E4AF2CDEC73D3A0D8DD54F0C360D85794 [email protected]
458,333,640 *2E8FCF776D6A575E0BFB7E85BA2AB43C64F7C45E [email protected]
458,333,641 *2E82E9D3ED1E1F9086317696509F372FFA6F7A11 municeps0
458,333,642 *2E85B4830A6DE66F99A6BF7CD01A2FE942C10752 muslimism9
458,333,643 *2E8F1EC0B72C9A17D4D63E6D07E80B338B3F778B germanalcalde
458,333,644 *2E86FDF44A72AD769F8954101C7809534EEFBA6F myfriendsarepossessed,too"~channeler
458,333,645 *2E8516CDF4DC8E990B09D83026EC615750C45459 GILSIVERTSON
458,333,646 *2E8FA7C954CDBDFBA20F41BCBE50D04C7923ADFE N<3:
458,333,647 *2E8243E604B74FD550ABED0819B7F35D075A8BDD «naess
458,333,648 *2E8D83AE456FFD316EB1A8D5B2DBC869CC1A4490 NAVNEREF
458,333,649 *2E80824106B578FD87502EA6A5B7BCFAA32B2482 GPFD
458,333,650 *2E886B88D8912A35B60A7E29FA0F804734A899B2 NETPERK7
458,333,651 *2E8146E3544AF4474B032D95B5764CBB75C009B3 GROOTSHE4
458,333,652 *2E8450DE467156BF03386990614B486D6DFD4353 NICHOLE VOGT
458,333,653 *2E8283FD0E4AAD442BC1E76695243D8895606488 nickybrethour
458,333,654 *2E8EA799A8E9FACE7B50A7017CAFE6A65E094C62 GUHÊŞÎ
458,333,655 *2E84C7A1E4484799ADACBDBF1B65B449EC05CA9F GUILLERMO.ERTEL
458,333,656 *2E84ED4285A016F5043EACA81C1E934B2810E2D1 GUNTEREM5
458,333,657 *2E8A56CC0A4710E34962B11C83DB37CF5C7A09A0 NNPRNTBLS
458,333,658 *2E83380F1B56D266CE06DE429310D8D98765FCC9 NOIRALLIA
458,333,659 *2E84E64999239B97BCA162470869724D8604B3E3 GX Z
458,333,660 *2E8B8A7EFB52B9A67CB68524222D106616AD6782 [email protected]
458,333,661 *2E85104E25BCFD483E12E729577F1583EB3B84FD [email protected]
458,333,662 *2E890B87DFD618063414E321EB3AE035641548F2 ns}f
458,333,663 *2E8D56E5408F5F8D5A3FE066CD3E2BD8F9F9397B HANK.FRIKKEN
458,333,664 *2E8BCE367D19AB9C2CBF329C93F730627230C55A HAPHUONG NGUYEN
458,333,665 *2E899C24B72B0AAEB90298A83DB8E6D9F0391D78 ODERBEIDES(FEATSVENREGENER)
458,333,666 *2E81CA7013B568FF61F88456084A6A18101709FC OLAV-ANTON-THOMMESSEN
458,333,667 *2E8F3DFE383F39C0EB7955A9CA5B1DF499E63137 OLINWAID
458,333,668 *2E8D19F35EC8547F065C18C9F8A16C539D54A476 ontrinity
458,333,669 *2E8B94E2E82389CF541A2BC37387D395684C2CED hebrocks
458,333,670 *2E85A970050C5EA84C3B4FC1AC1E7A9D40460552 hegenomie
458,333,671 *2E819AEB66098E3993820A33F41919F98ACEA6D4 HELEN-BATISTE
458,333,672 *2E834AB3763F38A5D2ACFA1D7D97311FB88A6658 orkestnummers!
458,333,673 *2E8F1662463FA5D15E35B1E839A4F6C1417A773E [email protected]
458,333,674 *2E854321749EE81D1B3635FB4D80792486763EF9 OSVALDO.GOLLY
458,333,675 *2E86B29D0A395C8FC7216B48021D6C414959723A OSVALDO.MCGINNES
458,333,676 *2E86D983DA9EA220F57577E7CA89870F191BD4FE oswaldorasbury
458,333,677 *2E85E9FB3691584DF8035682852614C4202E6CED HEROFAMILYNINGCOMHEROFAMILY
458,333,678 *2E849576F9A82B149D752158850DE0E90C296FE7 OU7$EEK
458,333,679 *2E862C38D28DB5B63FA3D1DFCA9F6C1525840E66 HIFYXQYHLDKE
458,333,680 *2E8D9F058B117B33BAA54EF7DE99FCAD7F029E81 [email protected]
458,333,681 *2E871FFF2AFF2FC59F15743A30F60FFB1AB326C2 HILARIO.REUHL
458,333,682 *2E8AB3D25854A0C35DD9F002D8A89DD8BBC2B241 HIRAM.CASTLETON
458,333,683 *2E81D9BC410A8380994324596509B1BDC8EEA747 OZNÁMIV
458,333,684 *2E89F661E9660A17EBC780F640389DED2626C366 homerprof9
458,333,685 *2E8EBA2C59F722FA946BE66E0A336BD5CACB3B4A HOMNAA
458,333,686 *2E851BB1CF39834C91D8ECB481F534CECD22992B HONEYKEVIN
458,333,687 *2E825CC11F3694D255282D64E6E150C4567D5407 PALPFADENO
458,333,688 *2E8C3DBBFD216844C6CBD966C56492BE45A15466 HONMOKUA3
458,333,689 *2E8BF642E61A7EEC0208394A3B2E9CF88BE07782 HORCOMOTES
458,333,690 *2E8C9F902EC900CFF3B919C0157A66949D72595C HOVEDKOMPLEKSET
458,333,691 *2E86BB34E1136B1B03860E85231D5DFB0F83F31A [email protected]
458,333,692 *2E862F09791744B9863A1C612EA9BC346CFE855B HSIRETSYO
458,333,693 *2E88343EC86C76BD98516EAE374B036A78A4E247 P------B.~0~O.SPLAT!!
458,333,694 *2E85047BD0F6632CA183DF9CEC8D6E75BE94FF27 HTTPWWWHAYLETOWNCOU
458,333,695 *2E8361815E087D145FED95BFABE26C443A6F2FB0 PDAVISTOWNBOSCAWEN
458,333,696 *2E8D546925FEE5F8E36B896E4163472CE3A6F06A httpwwwtranviasdeco
458,333,697 *2E85F23E6B0FFA3AB8CB0A4C620D5AADAECD25DC HUBERT.MAWYER
458,333,698 *2E888BFD13380ACE8BDE06FD1656113E24AC8BAA [email protected]
458,333,699 *2E8767335810027072C251313D1A761EF404F589 PEIRAORINLO
458,333,700 *2E8F1D222682FC1DC0BA1E8FA4A5DDA3CEC8D282 PENTS10
458,333,701 *2E8169B8CF060B4665A553F2883169C460A5A371 PIRL?
458,333,702 *2E8040A810BA9C28B0DBFB3AE125921DEA3AAC60 p======p-~Splat
458,333,703 *2E8FF646A6480BF49D8363D04316F208EBBEC9E1 pr3dcatng
458,333,704 *2E83D297838ACE745BE1E4EFCFD27110DD33F958 irma.davila
458,333,705 *2E853E005680706D451C38BD67601C97CC4A36D7 ISAIAHBONOMI
458,333,706 *2E82D738068E5EDB87FFA9901C8C85B1E0ECCB91 ISHU PAUL
458,333,707 *2E818E2C9D4B24B9B1829E54397D409F74FAC730 PRÜFWESEN)、
458,333,708 *2E89C31CBB8607483CB9370C966EC2356FB73E93 P======).*.*.SPLAT!!
458,333,709 *2E80A2BE1205A5CB00B11B81E32A813CDF954BFA PWOAC
458,333,710 *2E8C1B564AF8F1F674C9CBF836243A3854EB9F30 iwantasportscar
458,333,711 *2E81C7642D221CE6347F19DDA373914B64881E51 [email protected]
458,333,712 *2E8DA0485DE931222C4EC982022A8AF8B3405C0B JAMESLAZO
458,333,713 *2E85600D294A9D8E84007893B692599172D1FC37 JAMIE HARALSON
458,333,714 *2E84D99934D880F5051A48D8DFF7436F73CD80D8 [email protected]
458,333,715 *2E85E915DA7D6F65D359952BD08BB9D3B532721B qP.~O{x}
458,333,716 *2E8AAB8E4856D4A4FC6ECAB33C79CBAAD089FA94 Q)*.SPLAT
458,333,717 *2E8018D55BEA1B0D367AED14B6C8D8DFB341C300 javiermcguckin
458,333,718 *2E880C43D6A67383158DEE37B3A3635857F685AA r00m3tt3
458,333,719 *2E8917D2B78EFFE342F118A57F19807FEDBA4381 [email protected]
458,333,720 *2E820DCB76395352C132CB1AFB0BD96D744AFD01 RANDOLPH.KENNAUGH
458,333,721 *2E82C89DF4CC1332AE90D214A5F5C201BF773F07 RAPHAELRUSSEAU
458,333,722 *2E8C9D033D1B369A6224F77DE677B937B65A4858 RAYGOLIK
458,333,723 *2E89FCEF2C5BA7848BCD84125F874AE38CE8C1E3 JERMAINE.ARDALY
458,333,724 *2E8C01AFB4106B131C27BCB398AA3CFBF7C2BA36 JERRY.HAUERSPERGER
458,333,725 *2E8215F721AD7ABA06C920F61600D31AA736F48F JERRY.STOVE
458,333,726 *2E8761674247EAABBF95B6712F12C298B057EE77 JESS_LEE120189
458,333,727 *2E867DDFDE95373FCE0B38ED1F1ADD175D8DFCAC rechuton7
458,333,728 *2E875A50D4FE4BACDB469D0BAEEAD70E22602252 REESCALONARS1
458,333,729 *2E85D64442F8F69BB6D7C0ED5CD974A58ED35CD3 [email protected]
458,333,730 *2E8733840C6BE1026B5E1346DAF2C7FD66D3EAFB regrooving?
458,333,731 *2E80315F53570B2D493D49EC2379071C0DE4F8C4 JOESPH.HER
458,333,732 *2E8857786409CFA8E9B774702F6203F76A7DC64B REMBARQU2
458,333,733 *2E87DFB90543AD1446FDF17649C11C60FBAD7659 JOHN HERTZOG
458,333,734 *2E801F4F7E2C2CD0956009750D3A4FDB868FE921 REMOTE^
458,333,735 *2E842FCD5059B463FB79E5365E1F9695C9748D51 [email protected]
458,333,736 *2E8B3450556DEC1444466924760364ADA6EC8924 Rensurn9
458,333,737 *2E83C6AED565656CB9BA7EC0DFD7E0DE2EE9107D [email protected]
458,333,738 *2E8EEF3382F0E9B75C3A6D9B5A1A66D257552C86 JONASAXSON
458,333,739 *2E8F1FCF3FFAF6F0DF887555188B238A01F66115 RERENRET4
458,333,740 *2E832731C39FDD0309F5C2B01B70B24B1F9CB4DF RESUILTBSW2
458,333,741 *2E86358C465862E15F7FB42620207E3F8E29504F RETSNOMYDNAR
458,333,742 *2E8CFE1CA58F24F38C770141A33EF556B0435E14 REVALREVAL0
458,333,743 *2E84C3B53585A4D9A6655C73BC5B12122024B6FA josephtousignant
458,333,744 *2E8172B7A6647A61F29B119F736384C70FE83EE2 [email protected]
458,333,745 *2E8D36AB12F5101F32FF728F85212C2210339AFD REYNALDOGRIGG
458,333,746 *2E8AFDF71DF9B9B99A0D008376D969DD4BB5B30E RICARDO.MCGLON
458,333,747 *2E89A922285031A32254870C94322FBAE958F7CE jU.
458,333,748 *2E8A395A6E796C4F4E7ACD5AA419134AC87CA289 RKNK
458,333,749 *2E86202EC256EAB0C356C8B7DDB1EEA11165E2AC ROCCOCHALIGOJ
458,333,750 *2E8878B35AC94BB569211FA5C9B40B2CFBAB4256 JULIAN.DEJOHN
458,333,751 *2E8DC2210D2444BBBCBDA357FE10E93321FA2693 JULIESPIRO
458,333,752 *2E883671BCD245BE272C1458D02DE98192FAB2AB RODGER SHAFFER
458,333,753 *2E8EFA784DFC934F7D7E45E0A7571151DBD072D1 kabhi.yaadon.mein.aaun
458,333,754 *2E802B82CB958AD504C20FE75F3FE9C024A28424 kamilah
458,333,755 *2E8ADEA1EF8DBF0270BFEEDD28A53007891739F2 [email protected]
458,333,756 *2E878EC3A077DCDADFF1B7287AC53802C1D2119B KAREEMEAST
458,333,757 *2E8F9BFC479A5BC00EE442538C4AACF655B95E5A KATERINABAKALOVA
458,333,758 *2E81D22FDC7479B745DED1DF5C1763761839CFB0 ROSE.MARIE.ORTIZ
458,333,759 *2E8010FB17F246C947256B3CC54ADA88457769D3 ROSENDOTATSCH
458,333,760 *2E8D1B6AD3BF88F3574C898DA7DC9D4ADC8D6851 KBUNIVERSALSTONECUTT
458,333,761 *2E87F8F2BFB37C5EF7B9317DF85671BD94D97652 [email protected]
458,333,762 *2E81D53288C4F20DC98BD503FC93ACF5DF0F30AF [email protected]
458,333,763 *2E850DABBAA8695A60C26AEAFEE0522F32A59B57 KELLEYDECARMINE
458,333,764 *2E82A3EAF710D0B41D46AFB1683FA5675CF18097 rudolfchamnanphony
458,333,765 *2E86F1C277A2FB4669096E51528AEE41D7BC5489 KENNETH.BOUGHTER
458,333,766 *2E8D602B737590CC1FB2315078C1DE6DE24CBD28 RUMUOPARELI
458,333,767 *2E89640AE7783BE9E1F7F088FB885E3D8A0E4533 RUNNERLYNN5
458,333,768 *2E830B4C125C850F37D1BC685E6435BB2955FE0F kermitiacovelli
458,333,769 *2E80DB9B962EC43033AE806F5FCEF53C0FF30367 kernelldll
458,333,770 *2E8D8276E9C35037693367022F3774D9AF300774 KIRBYBRENT
458,333,771 *2E8842F8D83CFD4DD961ECFA93CFB6285F8D8BF4 kisses(inswingtime)
458,333,772 *2E81005FF143924049675C6F5B8237E76CA0F47C SAMMY.BUONTEMPO
458,333,773 *2E8121CA7B5776F07F403D2129D1510D3687423D sangsaysana
458,333,774 *2E8581B931BD9E0D04FCC7E4772665DB67240D0F komm,kommweihnachtsmann
458,333,775 *2E8AC73B4CAC20F01F7615907D6363C8D4ECD648 [email protected]
458,333,776 *2E8E66B552FD8651BEBAC38A941BA02F17955C01 konokan1
458,333,777 *2E8930034C2244B104E3641E05436126BF69E84C saulbilder
458,333,778 *2E81F5F597A88A4FD4EAA378F362F9E13AABAF62 savingly
458,333,779 *2E8107D031F422F824936A7AC4175BED29BBFE03 scentbars
458,333,780 *2E8E794FBF7B3B4D8BA05AA42ED4893BE1002187 KRISCRADY
458,333,781 *2E8E3695CF39CFFC68E197EEE32A80D4F13E2410 KRISTINE CAGATAN
458,333,782 *2E8A89C18E23FC4B163DE0E9E2A8C00A159D6F2A KRISTOFER.GOTHAM
458,333,783 *2E87608C0C37BDE8750251C3F5C830FF9ED96CA7 schmidtsymphonyno
458,333,784 *2E818A83FA81E29CB1DEB3311418F7E628ABB932 segmentlengths.
458,333,785 *2E80182DBEF01A8348EAA2B019639109A97812AB SEMAI-NAHAWENT
458,333,786 *2E8A6B9D1D5790D9B65896615D8A762A4A6E7C10 LANE.MOWER
458,333,787 *2E8B868FFCEEF6C01D24DE1D59F6661B6E5687D1 SERARUPE
458,333,788 *2E8DE08886F6970BF7C58CBE59D52BC4D345EAB7 larry.baley
458,333,789 *2E80F8A861192B86A664AF81A1703296E5EE7D82 SEVENS2007
458,333,790 *2E88BD5465E98797F34419E3F791B4684AEB7631 LAVERN.HANZELY
458,333,791 *2E89510071D92E67EBA51451DF89249057473599 SHANNONCROUSORE
458,333,792 *2E8A0829A463E25417069A463F19994CF9F092A0 LEECALONNE
458,333,793 *2E86087F6E5E9924773F52CB661292EB8ACD3B25 shaunleist
458,333,794 *2E8CFA5D805C48552C78F6FD49E1CA7D8166C837 SHAUNTEL-MARSHALL
458,333,795 *2E8F2748BCC13FBABA55CE293CAEDF9A64C2F896 [email protected]
458,333,796 *2E80CEE9113327BFDCEDF7068131ECA9168F645F leila471
458,333,797 *2E8BFFA19A3E119AC071944E3E352C4B10411ADC LEN.SUNIGA
458,333,798 *2E89FD251A24B4ECA47FA0BEB644417A5BD93F2B shidy
458,333,799 *2E80E900AB8D2D97A848A33CF25AFB582E647D1D shmerine2
458,333,800 *2E8F9933642668BC432DEFB574AB4C857846376B lesleyeslinger
458,333,801 *2E8C6C7D914A986D7682E0E9D4CAF8CBAE4EC732 LESLEY.GUILLAMA
458,333,802 *2E8E755AFC7BDAA6CE2EDC99DEA7719BC79A6CBE SHOWBOATEDING
458,333,803 *2E8786A2A767A01AD81677F1967FDEDD0020AFD0 LESTERMARICHALAR
458,333,804 *2E849E7341F9B0227D5A091FEEC1AFE37CA55F2E LETMEGORELEASEME
458,333,805 *2E80E2F10944DF25DAB65E5FFE90705F275EE889 [email protected]
458,333,806 *2E8BAA9DD79AF309135F5DA8C4698E089FF9F282 LEWISSTEINES
458,333,807 *2E8EFF8CBA0ECB8411CFC037A32ED8DD4461AEE8 LGOLICH
458,333,808 *2E87966CF02A8DAE5DC39A3FA46EC2218BF292D8 sissippi3
458,333,809 *2E84F73D88C58D0B56B83BCD192299203CB9E852 [email protected]
458,333,810 *2E82CF7DC3E6F46EB85482A0AE3C03C6673662C4 SLCDERIVED4
458,333,811 *2E8CAB165A8B2366509BB1B2835AB8D804C788AC [email protected]
458,333,812 *2E8140A5D6B6412B4DE174BA9D94574FD5710C0F lina-siska
458,333,813 *2E826F88460E714704A8211F9E905FFFAC7DFEF4 LISA AW
458,333,814 *2E831F047BFB20CFF1AA5092130B1E603CE8B2DD lisafun7
458,333,815 *2E8BA73804A1CEFDC9B634320550B14C4A185AA1 liubich0
458,333,816 *2E81452A807A4706689CFBC478CF8E76A3F75A4F SNOWBALBULLSHIT3
458,333,817 *2E866ADDEC6E9A1FE4EA5D72885A6CA19D18B155 [email protected]/-03.02.01
458,333,818 *2E8956488BBCC88FEFB86A16B7AE0014A6791505 lizaonanotherplanet
458,333,819 *2E83D3A8E1D77D640A07926F24C1EA54DAE10027 SOMPATHA
458,333,820 *2E8B7A32A7CDCC450BC1FAD1C804BD1097E7BC40 LMBRTSN2
458,333,821 *2E8441CDF986869AAEE67B906C518A3336FB7CB8 LOCKERBIEBOMBERALMEGRAHISENTHOMEADVICEJUSTONEGP
458,333,822 *2E8B84FEB4F79A5022686BAC143A15A00ABDC929 specializovane
458,333,823 *2E8554B539E564B1925994F5E4A62C3A75F56C56 Love.You.Baby./.What.Can.I.Do
458,333,824 *2E869CD3EB72C1BCCE40B7B69C89B7A6927ABC98 [email protected]######b
458,333,825 *2E89D4289220AE67CE3439814FA8A4538FD2687F luciuscaddigan
458,333,826 *2E8226ED5D3683DB6AD5939386E099A8C0A7C80F lucy-patrice-harders
458,333,827 *2E83A20C315BAD2E7DC2B5DCCBFE4852DDA9D7CE SPREGAMA
458,333,828 *2E88217CCD418076ECB9E8F7C5858A9C93E95605 SRC="HTTP//ECXIMAGES-AMAZONCOM/IMAGES/I/11KNJ3FGK7LJPG
458,333,829 *2E8B6B2232FA414231757F6E3601FFCFBED1F02F [email protected]
458,333,830 *2E83E24023544951F19627C6EC68BD448F9FA3FC STACEY.BIFFAR
458,333,831 *2E80E80010F380641559D7BC7FBF134FC52C486E STACEYWALTERS
458,333,832 *2E8093DC05E6A18D3E7346EAC7BD08F8AF046924 majorcrisafi
458,333,833 *2E8C7208B05D92B18854A852542482CE8B1701CD majorperalta
458,333,834 *2E87E072FED669F22D354169166656E08C8F12C7 MANHEIR0
458,333,835 *2E8683B4C9765D21144D82CDD207A533167E59F7 staxi
458,333,836 *2E81A9B5DC729C08E53A5929826CD339092BC5B5 STEMPELAAR
458,333,837 *2E81A41F208AFD7CF9A1C5427A76B982DA6D6E1C [email protected]
458,333,838 *2E811221629E74F28DE86E5DDB763C923B0CD269 mariasedlacek
458,333,839 *2E8F29D1508713762222A1E48E3051D2303CC16C STIRFEELINGS5
458,333,840 *2E85BD72C41BC7EE00ADE98C1C2E882CEE96090F STNEIARETTEHCAC
458,333,841 *2E898E821771A3E1D01D354C9B4008AFFD8F2F27 MARYHEGAN
458,333,842 *2E8CBC287986D9039EAF7927050B36B8DF774916 STRIP&NBSPCLUB</A
458,333,843 *2E8779BA5FA74753FDCDFB74CB1DE0931EE2E650 masonsunday
458,333,844 *2E87E0873A2720674BF2A17B8048DD2021660D97 mateo.acevedo
458,333,845 *2E86DFDC011D4FC75A7F206B6F19D34F54BB8F82 MATHEMATICALLIES
458,333,846 *2E8720B6D225D3753DE031EA0155267816725606 mauliai
458,333,847 *2E8B0B797A605764FD6530DAB2A9CF3D27226F04 SUENJEK
458,333,848 *2E86FB0FEA4FDF43ACB2F60D797AF82C61885D4A MAXIM-SAZONOV
458,333,849 *2E8E6DC091AB1805609E8C79363FF3F144E6A448 maynepomuceno
458,333,850 *2E829F471983AF7191B0B59064E0A5D12E16E033 MEAILLE9
458,333,851 *2E8179EA8B566EE4D5EE6FBF8D6052A5705600F3 MELENDEZANTHONY
458,333,852 *2E8153C83C073410F2C4C3B1741750A5BCFC6229 MEL.RUBIO
458,333,853 *2E8954A735F60E63E6B9F5217A6B6A482E42EC79 SW_555_SER.CIS
458,333,854 *2E84539C8A12C37E4D101CD0F44DC80457E958CA sydneyremmie
458,333,855 *2E88527A3534203BF9EC5FC0DC72D3724C266DBE SYMBO1ZN9
458,333,856 *2E8723709D9DE760BB5575D7608A707CA9A4AFEA MICHAELBRENDANTHOMASWAUGHEZRAWINTON
458,333,857 *2E80AE212CCE660BFD575677057C553C97892DA8 MICHEALFAY
458,333,858 *2E874CCE1769DA7329343371AF2E0AA13F0E2EDB MICHELE.LISA
458,333,859 *2E8BDE2F389997DAB8F331FDBB99099A1F9349FC TABANAS2
458,333,860 *2E85683A4C74ABE6CF3A882DC535BB34A4E6B152 MICKEY.TESTEN
458,333,861 *2E818290F09FC0278F9E7F89F0CD77FF62436C9E MIKECUSATIS
458,333,862 *2E8055747C7A3F108131AD5A183FDA347B0C8CFE TANNER.ALLAN
458,333,863 *2E833BEA668D89F72A4052ADC471FF4F7339DFA4 miraikouro.(album.mix)
458,333,864 *2E8E5D3A7100CADE3BA6BE7971B01AF30F96CBB9 [email protected]
458,333,865 *2E8275A4074E92F50E922155980F73CD96E8AFE4 M?LT
458,333,866 *2E81511BF8130A0D9B6ACBC9522FF33FA3027412 TELERISCALDINO3
458,333,867 *2E89A4A1928405BD4EF72E04BE8BE094C2FF35FD MOLENMROMP
458,333,868 *2E87AD9C5AEC65DC3D1828B7FA46D6786EC60F71 monacco4
458,333,869 *2E832A35C1974F360019366903CF66C79466A199 MONOPOLIESBAD
458,333,870 *2E887AFF094B1A4E8D77F0A0E69743C73B4180D2 monroecallagy
458,333,871 *2E8DF20E9698B3B5049333BF4EF38EAA74AF53A1 monruedee
458,333,872 *2E8F1D8F3E13C305710A67701BD22EF93C97167D TER SM
458,333,873 *2E8B4DD3F2832A61571DDFE5084F9DF477E96F10 [email protected]
458,333,874 *2E8B7C557D9AE0329C34313C05F7076AFC0EE5DB TESTTESTALEX
458,333,875 *2E85E1C29705AB86A2025FF45133D9CA94A7ABAC MOSEWAHLEN
458,333,876 *2E801F5FC397AF4FFBB3D9A2C4C098A00C8D542C MOSQUITO_NET M/@/'SK/I/T/OU/_N/E/T
458,333,877 *2E8FE86AA9D12E2780694EC1838AFF51918B6875 MOZAIKOKNÁL
458,333,878 *2E87525D24E662F09FBF80EAFC825FA65E897300 [email protected]
458,333,879 *2E885A9CB8629579BC896400A755D353E431E6BB THEFLUTEINTHEWORLDTH
458,333,880 *2E80C3676C1032339F60D19EFA046DC62F4043D6 THEGIBBONS
458,333,881 *2E89A46DB3EBBC8331D34CC5518264D4465B7F25 THOMAS.SMITRESKI
458,333,882 *2E8A58D31D82B439357D0322A679CE35C9F1AEBB n+39ra11y
458,333,883 *2E87F841800EC0A5D6FD2E96FF60EC6E8D941C68 NABLAFTE3
458,333,884 *2E8E7B2E5B1233DFEDD40D63621F890DC7494FA7 NAPOLEON.ZEPF
458,333,885 *2E85983A87992164B3F3BFFA2F1F85CDE4F53F72 TIFFANY.CLAIRE
458,333,886 *2E85016B9BFCC78AF4D583702FBC5AE90EC48C9E TIGRECRAPPS
458,333,887 *2E8CA8D174E6D5814EC31E19CC12B9785C45559A timbaconmo
458,333,888 *2E816C34A6A6D640DA6D76274524CD8BE2147A3D tinniness.n:.~tinninesses
458,333,889 *2E827FB52C6E72579760C790B4D047102BF3FC08 nberg: klavierkonzert op 42 ii molto allegro
458,333,890 *2E8F2A1709519A31C0AF54AAE79150149CBFDF2F TISH-ST-JOHN
458,333,891 *2E84F3DE44728ABE4B1DFA245A73BB4F9AAEE9DD nd0mt4b1y
458,333,892 *2E8F8E8FCE07CEFA73ABC3014D93FD2BF03BB7E3 NDIA..A.RAGA.SUITE.TO.SRI.GURU
458,333,893 *2E81795C5ABC8659453A9B1860EF00CAF671144A NEDBYUN
458,333,894 *2E866ADADEB55EFAE7C05DB5E3BC959C5FE050F9 tmbb
458,333,895 *2E8C9AC0F06F14F7C20B8D5F380CB136D5F4FA0F neilnesline
458,333,896 *2E8BFCDB04187D1F1167EA1FB96A099919BCC9F7 TODOMUNDOTEM
458,333,897 *2E8722F1D36FEF3D67FA7419EF3641C42F285455 nesnaju
458,333,898 *2E82E9FCCBB5B1AD0C5F603E3010AE12092A60D8 NEVERKNOWYOU
458,333,899 *2E846898977279C7F660B93383373B2BEB336EBC NEWSUSBUDGETSTATESPR
458,333,900 *2E8ECEE31DCACD2596B7D3DD0162E3E5BF12C4DB tools.bbs
458,333,901 *2E8AB55A096BCEC02A4EAE5BAA9035A5A0E7BC19 nickpot7
458,333,902 *2E8104D38F183F06A1BDFD3518B2828E2948E0ED NITINRATHORE
458,333,903 *2E86C87432219E672CA3A054514A9DBECF2323AE [email protected]
458,333,904 *2E874F8F469112306AE5B24BCCC66013C8067C7B TRISTANDACOSTA
458,333,905 *2E89418507A5A4EC2150198796A1C675107DA7F0 NONCASUISTICAL0
458,333,906 *2E85EBF8475907BB434F8BA0FAC035B6BDF16CEA TROFODOTIKA1
458,333,907 *2E8C64BE8373153A37DDDAFE27E1315CE8BC32F5 Nonofficinal
458,333,908 *2E894CCBA5AB248B38C09E93A65117CA39CA4EFB NORIOCAR5
458,333,909 *2E89540D3F33B11BD88CC90F6D858166E066A360 TSHANTRICE
458,333,910 *2E890F3EA6042FCFB1F0693524D1D391672B7D45 NORMAND.STROTMAN
458,333,911 *2E80745F64D3F484BC707E8E9CB759DF087D4EEB TTNEKSU0
458,333,912 *2E8890DBC17D22FA82BE224F80B324D0C2E8FD95 nsanze
458,333,913 *2E8FDE4DCCFEE16B553EBB527E57FDD55CE5370A [email protected]
458,333,914 *2E8CFC5F486A3FA32C0ECFA779BB09D8824141F4 tvwv5
458,333,915 *2E81D8FABCF6E831A9252F6AC8261017AE28E1BE NWORGROFING
458,333,916 *2E87946A179E630C10E976990EDA8BB4B412209B nyerdwac
458,333,917 *2E84C363E0C98C583537A0BE7C566202C7C5B39C TZAGABER1
458,333,918 *2E8B345A7458F0C2FDF537A7E2721DE4BCBD0DB0 O.Annemarieke
458,333,919 *2E897EBC6689A77CD2E97D1B2F9760CB22FC734C u.gonna.be.my.bitch
458,333,920 *2E813FD80F66D42188908E67B8119328523FA227 una.burrows
458,333,921 *2E882DDD243A66C3D2878D1C0513666BD56DB56F OMAR.CRAGO
458,333,922 *2E88FDFBE2B37FF09232B3042958C7E158B1AC23 unc0nv3rti813
458,333,923 *2E8628B5E49A25AF1183786A8E9232B1A7A69863 O->-<O~O~D--P
458,333,924 *2E8A8BA4C590A0C648ED4CE1A48C731BFA31FD67 UNSAINTLIKES0
458,333,925 *2E8339991251D53306E149A0BAD9354CDD57D1C6 o->-<-~`(----q
458,333,926 *2E8A8A09783B01C0E8564042279E0A0BE5BCEE0D OQ{B
458,333,927 *2E85373EE1388172453F721B089A2E62A022B959 orlandopagonis
458,333,928 *2E823DAA271F3BD17164BC97095830EB8A52E2C1 ORTALAMRAN
458,333,929 *2E86347022A6746E1B84BA066FD5F98B3DACE69A USERISFET
458,333,930 *2E8F67DE4A734459C4A2D15E89C29D8A1E68421C USTANEZ
458,333,931 *2E8363A5113EF5917E1CCC3814A14F495901888F osvaldobachand
458,333,932 *2E8C8B6CB0D878C615DC872C831C7699EC125B80 OSWALDO.PIGNA
458,333,933 *2E886A5C702AE7FDFE1E410474F57698FD053E41 UU{}
458,333,934 *2E83DA5AD38459B4E83FC652295B75D54E4C9A02 valeria.visconti
458,333,935 *2E841B971C7DF251E7C30CE2ABF30112CEDC991F P---).~0.~O.(~_^)
458,333,936 *2E892C9885ED718CB806C19A01F9C47369C37819 VERRANNEN3
458,333,937 *2E88AA5CA7607557494A2EE89CD6E33B4580F77D PARNMAR
458,333,938 *2E86EEB04BAA8EC7508708D1640DB7FC885818F3 VERTREIBUNGSSPAMM
458,333,939 *2E84CC99DD85C45716D4B99A7514E9707555BCB7 pD~0~osplat!
458,333,940 *2E8B6DFB63F19031786B208EEA3EA1D6C0F1B46D violahopson
458,333,941 *2E8B72ED9F6DE92D652C5710738EE311BF53D85E VITAYLERS1
458,333,942 *2E8BA887B4618C34A718745F9C6C4AA39C1A2670 VITO-CAGGIANO
458,333,943 *2E81AEB516B25F9E9D9D79D771E5F9649FD6A910 VLIRAUHAED
458,333,944 *2E85DB3DFC940F7B07C52E41C83304683FCDE0F5 PHILIP.GRUELL
458,333,945 *2E8E85FB43E954F0BC5CB7BD77C6D7A7FF8AFC07 PHILIP-TOMAS
458,333,946 *2E8ABFF8B39D244670D86B5D45C0A67A25F96468 [email protected]
458,333,947 *2E80D971305E450D85604FE2D79F652B366CDC60 PHULJHOR
458,333,948 *2E82E8B60BD8AA349754AAC58E3556AFEB14D8A1 W35T41R
458,333,949 *2E8B0FAB8B919C6F0DD0ADF41C89FCE0453635EB pinkmilitary
458,333,950 *2E8F54F19DE29D247F4398EB64F1838766910090 PIXFYZLTIRGWZ
458,333,951 *2E830056DEF68D2F0B3C1FB7D590F333E5C7B612 WAHEED.ISMAIL.BANDESHA
458,333,952 *2E82C2D47E59C3BC214C1A6B4A958B4C20CAB531 wajeehah.harris
458,333,953 *2E80154E76B72FBE2CBC0E465520F284B4E45C11 WALLACENORLAND
458,333,954 *2E8FB75013B426E043A301B47D0FC4F6D3451E8B waltersaiki
458,333,955 *2E8121E5D7BF4293FA5FBD8B4E5C4F9D4DC62254 wana.abdullah
458,333,956 *2E8CC58F4726D53AA5A8F3A46AC53354C5E88A97 PNBI0GLV9D
458,333,957 *2E8CF175A46CBDFEFC8039A1FA4DA9214EF5FB62 porterhempfling
458,333,958 *2E806235E496B90ABD91613C6F786AF789DB5596 POUYANFOROUGHI
458,333,959 *2E8742CAAFD05C077B6F6D963E8427495344B5D0 [email protected]
458,333,960 *2E8127FCAED729B62AA8D8233F7E4CAC74C4C9BA p------p~splat!!
458,333,961 *2E8EBBC8C9552251FB9F8638454664DA2651E81D WHENYOUDON'TSEEME
458,333,962 *2E84553F6DF314A1A50FDF110DC5578E6514F5C3 WILDCATS1974
458,333,963 *2E8E109F01D6BFA0CB2764074F0D28734B462820 P--->~.UU
458,333,964 *2E8717F54F6505F1C3DA4984A1B52C54D56006F3 wilfredunderland
458,333,965 *2E80F1E90CDE68F1AA3C94E41A79366F1C2DBDF5 williamburel
458,333,966 *2E8A1D634F90F227BF4827D3356BB277BADA51F3 WILLIAM.JAMOTILLO
458,333,967 *2E8BF94E2B83F10AB92A474CFB5FE13A5B7F0D90 pythagorasergänzung2
458,333,968 *2E86189CB70C23600E0582158F9DEEAC2462EAA1 QFH790622
458,333,969 *2E80AFF90A31A55C6DD52BA578B3D53BDB6841BA [email protected]
458,333,970 *2E82ACCE46F3167FC3F47B5C5C567224BE2CAE4B WINNANN.M.SHARP
458,333,971 *2E8A683C4EDD4D31BF42FD88A9F8E64F1A106ECF Q---P-*-*-}8{
458,333,972 *2E8ACE43FB1B9E8CA19E8ED7F8CF2BD90EED404F QUINTONDREYER
458,333,973 *2E85129C5593AB4953B63ECC230B71DDB3A94788 WORTHLE4
458,333,974 *2E81AAD4065CC42B929CE026E43D5C41CD59F9DE [email protected]@7in9
458,333,975 *2E80DDAE711AE77FA71FD7EA5EDE7A8331BF5490 RACCOMMODERIEZ
458,333,976 *2E89F0082E5956C37124CA500F2B1BFA81B8AFE9 WUPEIMU
458,333,977 *2E80DE445E9F869CD88314CCB3C4E421FA20A39A RAKKAUDENS
458,333,978 *2E8310647D0BBAD3DCCD8EE9D4BF189D4AECA41B RAPHAELFRITTS
458,333,979 *2E8916E5293AE38F59A06D78992B89810C21E495 RASE
458,333,980 *2E87772BF3C85598A30CB6AD4B33F5188FFE4883 rauchmann
458,333,981 *2E84B3E49CFAEAE0FD2B1B80AC3205E25FF5207A rebild '76
458,333,982 *2E812966D6283301772750F1F19534635ECA4C78 WWWVIOLASGOURMETCOM
458,333,983 *2E827A538C18BA75A5C0A248435BF23A2D69582C WYMAN.BOYER
458,333,984 *2E8EDCA8E23EBF0C0DFF7906FF8C0DBCE97EAB06 xavi.partarrieu
458,333,985 *2E832419D3D4254A4F5AC4A9E815E03891F00D30 XCHILDNODES0HREF
458,333,986 *2E8E65A0C977F476B5C642E1893CA84B8B31B26B {x}-~-`-d--B
458,333,987 *2E8AB1554701CCF4C88C7D3C0671D711ADCA6067 reimari1
458,333,988 *2E80EA37FAE1487F8DA69B454844A68030B9BBF8 RENE.OGRAM
458,333,989 *2E8472F365208147BF89F9ED474C482EA5DD2F93 [email protected]
458,333,990 *2E8202254E0C3C8F03CB60C03522C08B40EA3C8A [email protected]
458,333,991 *2E86A681AF586D20EFA6533AA0D2609A1B41D9BA REPULGA6
458,333,992 *2E8C325643563BA35561F8D104FE0646448A4755 XIECHUIYA
458,333,993 *2E8D83938446386E6F0F8DC7E6D2CC2098BE1520 xrxb
458,333,994 *2E8C9CA98EBF34C60A1203D9FAF6B3404574ACD0 XXXII4
458,333,995 *2E8FE73639795E8C7BB5A7E174D811C4DF392AB1 rigilrig
458,333,996 *2E819DD00EE06675764596DAD7A1A5A50C0E0360 RKESINTR5
458,333,997 *2E8355182EF9C8773DB266B988A7F99AA637CF07 ROBBY.PILKINS
458,333,998 *2E8CFD230E41FB138BEA3DBD3C2FCC960F4550BD ROBINHA
458,333,999 *2E872001A273E2D7C60CA6905BBAE29FE69F70EE yauded
458,334,000 *2E8EE3021BD38ADFE1CB20240F21C11C0526915F rodrickgethers
458,334,001 *2E86EE3089F00A3A3F00EFAE6115189DF8B15D25 yelmirg5
458,334,002 *2E8479EE5703B1090716C48ED3A0EB440FF24A73 ROMANEUPANE
458,334,003 *2E8B38B9849802884184F779173C848C86AC2980 ROMANSSISTA5
458,334,004 *2E8EAE042727CB4C35D0C2BF628CBA9161B67753 ROMELSALAZAR
458,334,005 *2E829795F9B50AA26BA850C54AE90C81D43E4734 {{rotten-tomatoes|id=few_good_men|title=AFewGoodMen}}
458,334,006 *2E8EB8326A7658EA232BA5FDED7560BC3EF6EB24 ROZNESENIED
458,334,007 *2E801426A880D37C3A42375FF2946C23E48A80AA YSNXJVPOSL9
458,334,008 *2E8A57986D4CA1F21ABF064C7BE993AB6A98A2F2 rt-&-the-pot-lickers
458,334,009 *2E87A67B4E90C26DFBE9B3598575F6CCC2247595 RYAN.KOEBERL
458,334,010 *2E8A32F774C7B59C133DF5FC964CC8FB8A03215D ryanlieske
458,334,011 *2E8EE1FA7515B83EA542565C46CFCA8AB7F541AA S0021889800014655
458,334,012 *2E8ABB3882F74CADDC378B1259479BE99FAFBD5F YVELINESSTAR,PART1
458,334,013 *2E8EA8E8524DD6267ABFDED99173C24C196E7EB9 SAMIFAROOQUI
458,334,014 *2E8E19D101E4EE09EE56351EEA9B7C356543C08D ZARZKARZ
458,334,015 *2E8281EC18168D82D60E7E0B7B8805AEC47EFAFC SANTOSLANDERO
458,334,016 *2E80407C9F5A8A80E569D7ED6E8181EC4EB7CA06 SAPNA.SAVANT
458,334,017 *2E87EF1C0C3391A5E4DE8A70C8D90B4F8951F035 [email protected]
458,334,018 *2E8CF5F78AE2E630B012AA3E9EAD3EDEC53945AB ZEAL.HARRIS
458,334,019 *2E861232AA1C8E0A98EC73A3DAC7FB7ABF97987A savingly
458,334,020 *2E8DBAD44B63025E6247ABDA0F6DDFC8AFB6D798 SAZINHO
458,334,021 *2E82D2B146BD4FA0142F9CFFEF9E50595D809CFD [email protected]
458,334,022 *2E8624C47F9B9E6FCE2FCA8AA1EE401D1DD43D0E ZHYKOV
458,334,023 *2E8BDD960EE0EBEA7862B3D898D0454ED8D2EA24 [email protected]
458,334,024 *2E820E763B34218DB21B5E9EFE4876AFEF3A9A51 schweizerhallcom
458,334,025 *2E8A80B80C70B44F2D9E65EF83DCD1F3060CD2D9 SCOTTYFELIX0
458,334,026 *2E8CC78740A5028793FC6EB2F2731049CED2E93D ΚΑΪΡΌΛΙ
458,334,027 *2E82D83FE6F10CC36D131D50EDFD10D7010AE8C0 κυπέλλου
458,334,028 *2E81B5426755353B8C5E9E9E80A69E3899FBB57E SEBASTIANPOZZO
458,334,029 *2E801DDFCBFB66752514D22E506789F5E98FDC37 sedales0
458,334,030 *2E8570D418750E3B04D7F05B3B370DA007EC5DE9 ДЕВАЛЬВИРОВАННЫЙ
458,334,031 *2E87C608B2FA6F6F818E8C2CCC052C7E32223DE1 СОХРОЙ
458,334,032 *2E84BB81705B384BEA6A3640C4A99C30BC218729 sheltonjee
458,334,033 *2E8667EEF86ABEF293DDB44AE3827FB831865AB2 SHELTONKERWIN
458,334,034 *2E83F7C2ECC140B58D798C7F05AC016A9EC90060 [email protected]
458,334,035 *2E847161145CEB94659223E8F9B361C34AAA2BD7 SHERWOODDELLEN
458,334,036 *2E8EEAB1FDC7C5D239FC8F3279BDC173FF931991 SHIRLEYHORNETS5
458,334,037 *2E8A327AD3029F6AD1D6A145F46C5FFFF5C9EC79 sidneypaige
458,334,038 *2E8A8825F8F01DA5FCEC1D3065552EEE7B9B293C skelett-rest
458,334,039 *2E8E1D9FCF98FD6073B0595A084E6E9291DD5016 SPLAT!!~ ~ ~ DB
458,334,040 *2E8C501F8A030669C9151B42252EA7E0B1CCFE0F [email protected]
458,334,041 *2E8B2B57D9B27DD778D14AFF5075E66DA44C1329 SSENLLUFMIRB0
458,334,042 *2E8506BEEA4CCB111B8F49B711F547BE59FE3ADA SSSEKUBULWA
458,334,043 *2E89D6B41AECE206E5AF7D0C42FC970133539AE9 ssubrahm8
458,334,044 *2E8F2F1AA9BA2F4318B478D2952FB9064D1A5E0E STANTON.CUTRER
458,334,045 *2E8ADEFC74FD0C158413C65EBF30C5586444816E STARDIAL5
458,334,046 *2E8794770DBBEC8302544CCDD90FA213E3E3A227 stentarono?
458,334,047 *2E8035D9D662170131202E230A351FC9445ADAE8 05.24.1823
458,334,048 *2E81B9D3B9624CFFB4240FFC5C1D0B289908211E STPHNSWTS
458,334,049 *2E8C04D85F7F434F0F89B05A93B60A0BC1B7FF7E STUART-MCCOMBIE
458,334,050 *2E88A129DD72C999F67D25E3D53453879E405F91 stulgiáms
458,334,051 *2E86871940832985051D9DEE0E8CEFE0C91B86D1 113FOUTLAMERDE(FEATTHOMASBANGALTER)
458,334,052 *2E82AF46E87508E5C8041406DB0E4B3237AD9127 12H9NCH073
458,334,053 *2E8856B281509F5F9EDB01187AFC56936A23223E 13-nordvietnamesischen
458,334,054 *2E89E7444539CA222260E0F3D84F74A8DE2385DA 1/3octaveband:31.5hz
458,334,055 *2E8822C3A9458B3B04F99A96EDC7E88F02CF2193 14PAUSSI
458,334,056 *2E8D7C6A4FB4E1F7E567486905F7030097076F48 1516359 kaupungilleluovutettavallaalueellatoimiit
458,334,057 *2E89918B5C04B241B700C27AAAC87F2BB9F0FEAC superloop
458,334,058 *2E8B1453A6F1EEC8729E06437C9B44A632EBB7E8 SYMPHONYNO5:LLLSCHERZO:ALLEGRO&
458,334,059 *2E8E44C416B953A50A65D8FCA89D38A10868450B TALK911097245
458,334,060 *2E8975B668E6E8E826E750F34F3469E92905136E 1.DDRHUMORMAGAZINS
458,334,061 *2E85E6D4D4A227BBF21DBAAB146FD0E5F5C810A3 1 EXTRADE
458,334,062 *2E81DD66ABF7E8405BA24DA11506C787750F26B2 1.FLIPOVERS
458,334,063 *2E86EA46720B77A78F8B8A391FBD979583066845 1-HAEMOKKULT-TEST
458,334,064 *2E8019AF9B7280D424F55BB8D37C38C537952550 1.infasinstituts
458,334,065 *2E861FA7FC71595E170CF70A95048F2E3664D6F3 TALKPADDYIYER
458,334,066 *2E87D31AF6CE8101A650CA7356F35E8A4C18A392 1.kiitosylistyksiin
458,334,067 *2E8C2ECD69373E2F8C57291C17A3BB4879F59B82 1KIMRIN
458,334,068 *2E81877B337ACD7573171E06033FB68700A325DE [email protected]
458,334,069 *2E875D0ECFAA97D140EABA7FB603DDA1DFBF294A 1KOEREAKTORISTA
458,334,070 *2E80B70119805BC0F8A3BC3B953DE3097D41C8B8 1KORTTIPAIKASTA
458,334,071 *2E81D01B8EF3410F7D73B6C7EC58107F5203248D 1-lafleys
458,334,072 *2E82D67B08CC31D7B5216E386C2024144C6F95CC tapim
458,334,073 *2E82785D8F201A44150323EE2F5410FB9087A89B tarkistustiivisteet
458,334,074 *2E8C1BEDFC4D7EFE58787E0F2731DA2D84D8607F +1ME
458,334,075 *2E8B81B27C0F8F5D1DA1F4AACFD28D10E085CF6F 1.ngxongwana
458,334,076 *2E8F75A9CFF67E791382C94CC8EA6D8B5BCADE73 1-polymeerikuituja
458,334,077 *2E865F6132E007722D3ABB75D37D22FB8EABC249 1POSYPALI
458,334,078 *2E8CE48D32FBEA81B20EE96B50965C43F4E138E1 1.produran
458,334,079 *2E841F828A5BB5E2BD55A1570136A36B63B2FB6C teddycowboy
458,334,080 *2E8F22103DF633305C5CF8F3C0E6CA320DFFDEFF 1.SYMBOLIANALYYTIKKOJENSA
458,334,081 *2E8C542CE746058D90ED566FFEE5C4ABF4D4A38D TEODORO.MONARES
458,334,082 *2E87375378CE1D2748A833CC5B8340749A03C6F1 TERRANCEVASCONEZ
458,334,083 *2E8EB80D37659EEC742EDE84023A919FF1444433 [email protected]
458,334,084 *2E82A652BA097FC7D8496D0A53F6E8C9F834C0C0 thaddeusdry
458,334,085 *2E8096B4A6B6520F6AAB86CFF9CCD8F4B7C36169 thatdoctor1999
458,334,086 *2E886F4146C5B8AB7CAF9F10D2A9D5306F8DC304 THE.DRY.COUNTY
458,334,087 *2E8997436EF6B7230C353B33BE84527D2E2D4A93 2415482 OPPIMISENILOKANSALLINENELINIK
458,334,088 *2E84B052855EBDE33379AAAD4B835F1DFA85D8FE the.pubcrawlers
458,334,089 *2E82A5828EEE77CB8AB2CAB8C0C88A193403E54C 24.dIt
458,334,090 *2E856252CB72591EA8E00DADE874BA5F1B9A4318 THE SKILLS SO AS OF NOW YOU CAN CEASE WITH
458,334,091 *2E8831CAE0AFD4CA6FB07F15B196D1928F510E60 the-warm-swing
458,334,092 *2E8C54617F541E0BFF6C40C5EAC19C216B8D69C0 TIJRIVIEREN6
458,334,093 *2E8F4A71CAB2D8C7D230C0FAB56BABF980A701A7 TITASSARKAR
458,334,094 *2E8ABAE17B787E147F4C854FC5B9C13C7C9F166C TOATONEFOR
458,334,095 *2E85582F4FA4B562EC6B72660D083A7AA89281F1 302550 VAIHTELEVAT.TUULETKIN.OVAT.VAKAAMPIA.KUIN.MIEHET..
458,334,096 *2E80A0ED5D5996E566BD82E6BF069D6E62D7CE8F 3-09-1509
458,334,097 *2E83505AE4B5264CDB75F024E58E0B9802515A16 33-SCHINDHELM
458,334,098 *2E86546AD922E2D86814C353CDB61C67A69AA7F7 tower-tearing't/ou//@/r_'t/(@)/r/i//n/
458,334,099 *2E84EC141703EDC9A1EC3609E84CBD5B75F9BE88 [email protected]
458,334,100 *2E8320F9B02A9FF8CFF907AE4957CAF23F1A9B99 transdiscussions
458,334,101 *2E8076ADFC3B6500E3B98BC53BB5F7B15F9C11C7 3ASTR
458,334,102 *2E864FA635E546D03F95D7E98BE93429AC7C7148 3b<~` ~`@=q
458,334,103 *2E8DA471B38644E7FD8EE18402537FD7EE269C64 TROTSEG1
458,334,104 *2E8B3AED3A1DBC82DC8E7E07A128B826E83935C1 3 UPSLAITE
458,334,105 *2E898C0EA8675E5078C435D8394BFD0000C7683F 3[[user:waheedone|waheedone]]01:15,21october2008(utc)
458,334,106 *2E8F16513E5A311DEAA24DC92AF9B5A0CB10E028 tuoneremmo
458,334,107 *2E86AF6F374646CA3C917C01C417C1FF4B5F3E3E 44.claydon
458,334,108 *2E8BA639A19234847122A35FCC469C1D446F7A34 TVIYTSHY7
458,334,109 *2E8CB442037EE18F1A4A9A9589D9AD2E9CB240F6 TVOLOTI
458,334,110 *2E81D878CC42B3D0DBF7BF0EB577B43EA61CA2E7 46XZ
458,334,111 *2E8653612B5EAD4E70BF7A090E486AF8B22DE7CC tweepers7
458,334,112 *2E80D6CFE3612E35E3575F7EA097270D0EE969BA 4.HENKIL
458,334,113 *2E8294E4117D86C926D8D01C8F3165EB5EFCB5A7 4LIZAKOWSKI
458,334,114 *2E810174F051E897CFEA5D616E2A7A315D25CD1B 4MACRICOSTA
458,334,115 *2E8EBE4128A7224D8E29F18D2991D231A6B6CFE5 4MAY1511
458,334,116 *2E89FBBA0F036411D917ED1FD5AFEA53821AE312 4NDVSTTD
458,334,117 *2E82317B1A5E3F1F01295E71E3E13051102CF980 4NISSANBITEME
458,334,118 *2E8E531527AA162AEA3B15DACE6D2F66C6EC9A2C 4-P
458,334,119 *2E8826E8CF7E4C85A88679F58C8C61FBE668200F 4PICASSOGODZILLA
458,334,120 *2E8DC8E5599F24BB917B56B55BDCEBD84D42BDFA UIM%
458,334,121 *2E8366C8B5AB4DEE1637A3C549CE9690DC3F3F5D 4-rothschild'sche
458,334,122 *2E84AA753F4AEF0205234B403C1A06883BCA600A 4SNUGGUNS
458,334,123 *2E80FB41DC9DF65B260A552E377C4FC8E5068036 4TEMOCITNA
458,334,124 *2E84B3CB3FEF4F45995F0C8B1AC46F6D62F6E21D 4TIGASTIG
458,334,125 *2E851D58D9A2AA12E13E464F3D1F12C3018C10DB unbirdlike1
458,334,126 *2E8A12749F6FA810825EE9C11C29EC8A634AD47D UNDERLEVERANDOERER
458,334,127 *2E899CD604C4E4CCF3716C6BE19594947DF5B3E3 UNSUFFICIENTLY6
458,334,128 *2E8853E46A5A75994CB4F8EB2F5F8F9E381A1E31 5BONFERRONIGALAMBOS
458,334,129 *2E83C874B04BFF7B55B46CAD0B7BB8389DC3693B 5BSWREPLYBUFFERBS
458,334,130 *2E849F98A14FD1AFEF153CDDF1C114FA95127761 uphills
458,334,131 *2E8D25A3C2197AE2688B257E36424779618E6FF6 5HRVATIMABSW
458,334,132 *2E8B60B1933DDCF7C3D66CB379102B83526BBA5C UTSNAREH5
458,334,133 *2E83D9F7A4FE5EC9FB34C9E8FB0D9474ACF1A983 5INFUSOIRES
458,334,134 *2E8A7829E8B23ED519C59B413C6D5D77B5C93FD7 5INSIDE7
458,334,135 *2E80D4AB84AB85184DBFC932DFB1C4C7F584F9D5 5KNOTSTACK
458,334,136 *2E82A54375B5CBD90BA2767A0A9844BE1816A97A 5KNOWILY
458,334,137 *2E80470E31F1815206DC11DAAD68790190DA55E4 5myherbert8
458,334,138 *2E841A94970C8DA91119393A29425B48B8020306 VALLIDOSUNDARAM
458,334,139 *2E844B92D817BAAA83F2FD9BCA6F7524739C7A6A VANELDEREN6
458,334,140 *2E8DE9C5C6CCFF6739DD0E64B79AC70A66BFC3FE VANESHA.SONG
458,334,141 *2E8EA929469534D4502B643789066C322A44594F VANGHEREMO0
458,334,142 *2E83D491C1904836654566C90002BDA83FBB7532 5TUW1NG3
458,334,143 *2E85E52D57C11B13E0322E8C973A7FF06C38D526 veertvort
458,334,144 *2E8F4B1A9A3C252F4A5781FC4ED3ABCC2A7925DD VENOMCOLD.'V/E/N/@/M_K/OU/LD
458,334,145 *2E8ED3C00CF6735F425C8051187A47851E30EBCC veronik-montoya
458,334,146 *2E8B75BA3AAC68C53F0BD5C76CD18316B0AEE8D0 vibilioidea
458,334,147 *2E8C0ACB6937B5120729DC6EEE6A81ECEF96C505 VICKI.SELF
458,334,148 *2E88D39C9C3B00BC09EEEE6DC5C2E47ABC9C80DE ;6BAA
458,334,149 *2E876589A45FCCE889392C3D53C6D0C388A2B359 6DIMENTICERESTI
458,334,150 *2E8A0D5DEF8C99949A25B1A65D33B1155417BF96 VINORODNIMA6
458,334,151 *2E81886C1E6B9C39A972245FB4C82C8DF83BBD95 6ENGURRIA
458,334,152 *2E8D301E8B6CB721B24BB811390FC6ED1D0F7F62 6GRINNER
458,334,153 *2E89B0022B9084602FBA433EE3BB84B80FBDCBE2 VJOEVINA
458,334,154 *2E8388BE9DED0834195A7E631C3DA9C29660A8F0 voortmaakte
458,334,155 *2E8442E4307B0C6A83B9A7149BB40B09A1D4FB0C 6THEORION9
458,334,156 *2E863CDFAFED30785AB3307E1546BA65080118C8 WALKERMAGNUM
458,334,157 *2E8C704190264D61CD9B64947D727AD8132C7E8A 778161 TERVEYDENHOITOMENOT HUOMIOITAVIA MENOJA OVAT V
458,334,158 *2E8B0DF7F31BAE6DB1DD28DC9828B59A8C42F17E 77EXTPARADEGROUND-SUNSET-THERECRUITS
458,334,159 *2E8417763241804F9BD3A0BB95E45DB073AE8D46 WANDLE.COMWWW
458,334,160 *2E84233D55AB5E67FDD8432379ECBF71F2E38B7D WANDSCHIRM
458,334,161 *2E8E12AF4EF9F1CFB46D5F24DDAF0BA1933C5780 WASEEM-ALLBAN
458,334,162 *2E8AC3DC1A2C461565D9691645E234630C985FCC wasim-abdo
458,334,163 *2E8F91565BCB262AE61FD65E7DA09CE9B4D23295 7-CORNERS
458,334,164 *2E88846729E36CB1BA66C03A2D1A941DC2FD576B WENDELLSYNOWIEC
458,334,165 *2E8C185396F00AED930D814131B681A09F5788AF WENDEWOLFEEDWARDS
458,334,166 *2E8E77C80CB4C81ED743EEAAA2C34805DD97DD22 WENGSJG
458,334,167 *2E8188A50E85D9C045FA4CCC633A09B3DF3A041A 7SURMONTEN
458,334,168 *2E869DFD5653E5D95E4EA5F02DE698FECE57BF8E WHISPERTOUCH(A)
458,334,169 *2E88AADA9FA8ED20EC15E24167F7B8FC69069615 wieweet
458,334,170 *2E85EAC82D819EE45160715B2AF92875D7E60A09 8aa
458,334,171 *2E8958EA0A6661988B76B38137094367F7BA3528 wissam.alaaraji
458,334,172 *2E885C50D249047872ADCAB1E94514368D6786AA wiza-ferriols
458,334,173 *2E8FD7BCB855F18240578C67220B1F213EB6A43B wndgdrt6
458,334,174 *2E8F03F5FFDC423A076AF15FD0E802B294C1F76B 8DESAGREGARENS
458,334,175 *2E88E6B312EE91724906CFA5630BCF9B09BB3DB1 WPANIEDIT
458,334,176 *2E86DE019E98F04FBFF84FB52FD549616A87AEA1 [email protected]
458,334,177 *2E8795F7B8E138F0A3472F3A864BD5452D54F2CA wsblssge
458,334,178 *2E8136F89AC02699170564B3753A672036FB168A WWWENGELENCOM
458,334,179 *2E8335A7180C6052712941905B8B769433141244 8MASTERSQWASZX
458,334,180 *2E8E7D863C03C3EF4BC7B6EED9449B7054545457 WWWINCLUSIVEINTERNETCOM
458,334,181 *2E8A66A6D6E52B268A1F12A94B00F83B723580F2 8mmとブラバムbt45より254mmも長くなった。
458,334,182 *2E82E15DB15954D41D2711747915695914D2A480 WWW.PLAYLUST.NET
458,334,183 *2E8E616BD676E35ED860EE531B027370527A75AE 8##)` )o(
458,334,184 *2E85022EC49B15DFFA3AC8DFE33E1C26DCB57FB7 (x)~`.~`d====b
458,334,185 *2E88F7777C184B87044A6392F9877FE6052CA920 [email protected]
458,334,186 *2E865B97706539D1332D2E41CF6B8DBCFEDD7FD0 8RPRIMAND
458,334,187 *2E8F3DA84037FDF8E8CB1481B8E5524151C6AC27 xilomas8
458,334,188 *2E8330FCA548DC8F48415492412405C03DE467E3 (x)*q=3
458,334,189 *2E8FDDDC8EDCAE32FB130A4B2B2DA8D7A200E224 [email protected]
458,334,190 *2E8538E01FD8F1D7FF3C115C589EA4D42C8A2EBB Y2M8HJ01
458,334,191 *2E8AA343CECBE8D3575A840DA9D3EA36EC28CAFF YAHAYAIBRAHIM
458,334,192 *2E802F57856D64A14F050F383BD705EEC4A950DF 9CARNAXBSW
458,334,193 *2E8ADCF24817FF83A4E8A08F43A0062E13BCE12F yasantha.gimhana
458,334,194 *2E8B8B3B7127345A9D7E665B70CC846931B03DBD YEHYA-ALAMEH
458,334,195 *2E85D04C9D370BE2AB8587E18533221B7CB9F781 9GERMANROSEBUD
458,334,196 *2E8A0B0006067754F06877AF71B9DDCF86F4A771 9GONIOSCOPE
458,334,197 *2E8D013B5D61D4C7F1A4A557BEEBD1B82B744E4C 9JUL1085
458,334,198 *2E82CD2E223052F6C207CC1CE8A1CFCB859A16BA 9l4mourize
458,334,199 *2E86F183660428A122FD64D83244FA7FCD10638E YNAKAKES
458,334,200 *2E84BC2CB3F12E03983CDEC91AAEF1E8D9CBBEDE YOJANADHARAP
458,334,201 *2E81D6AA8AFDF398E27EB9607B9776E6FE46B2A5 yomna-fathallah
458,334,202 *2E816D5209C6FDD3412C85542CA7856F3CC328EB yoongeunlee
458,334,203 *2E891E9DDF7CA801ABF1BE35B7B8EC3996DB9B15 youcaught
458,334,204 *2E8FCD4394292D0E98BCF550EA23462F3A1E55A5 yourstory
458,334,205 *2E8B29DA5A997CF98B4D8DBD4519616C661C9758 9UNGENDRING
458,334,206 *2E8969E3B46F7769D4A953526D7ED64AF3B118B8 9-vaneo
458,334,207 *2E8839A9A0F2820AF30CD7561E81E766AE0CD505 YUKITOMIZAWA
458,334,208 *2E8EF33ED3DB53C1AB3FDBBE5AC4BFE05C0D6B1E a:0es
458,334,209 *2E8698711BC568A96C93C380C6A2A7B6EA1DF7D1 A38K-
458,334,210 *2E82304B874A5E0A0C4290665946FAD4AB6D7570 A4R=(
458,334,211 *2E8E6CCE28E49189B2FF75E6459241D8F0C56299 zhiwen-lum
458,334,212 *2E88781AB4BA4FDA7DCB459F91E70EBBE7AF6B12 ZHJW
458,334,213 *2E852E92B8AD1C0286DD768F9D4C04E1CAFB7A22 [email protected]^
458,334,214 *2E8AA1104172F8495885131BD06E58F64B410F2B AAC&B"
458,334,215 *2E87F20DCCE10C59DBBCC5EA31BD328ADC5BBC26 ZYLINDERDRUCKINDIZIERUNGS
458,334,216 *2E8C01487B8F7E2353D472FA9171C8CB51E140FA ΝΤΕΜΠΆΡΤΣΑΣ
458,334,217 *2E83B095595B5604259E51E30A540657A100E297 БАСОНКУР
458,334,218 *2E8B4F605706C45CE6DDE7E8BE5FAC89C36B72EC ABIGAILTOYOTAS
458,334,219 *2E844C6F4EEC3C2480651356632D363ED5A42634 ac8)i
458,334,220 *2E8C7899888150ED388A99E0DB79E09A49AF9BFB AD9H3
458,334,221 *2E87AC48B3E990C88E8B1990B6BA1D25BACD6317 сандрич
458,334,222 *2E832CD1BD9BADD63E98EA484DE0A60698C64C59 ADoP
458,334,223 *2E86167EBD23F7616B32CA414CC56D4CE683CCE1 ЭКОНОМИКТӘ
458,334,224 *2E86F9A655E053EF9EA66EE4ED021882C86471EC AEKG
458,334,225 *2E85DF17CB4F852BEB69F6A763741ADB65481E97 ai#8
458,334,226 *2E880F737623B123CE9D9E5E34C33719C68EFC23 ALEMTALKCLUB
458,334,227 *2E84F2C12E69A4F33D3D914ECECC9ADF82888D28 松岡充OFFICIAL
458,334,228 *2E8DA8A47807E0FA39C1A1C631B8167BC1F71D96 AM1QF
458,334,229 *2E838307B15C314363AC33A9B06A5ED44393EBB5 anaqu
458,334,230 *2E8CDD89825CD280AEAD4E58F5E97D2772483482 ANCE!
458,334,231 *2E8E1E72B51928085781AE3071E845DB37A1C0D5 ANGELA LIEBOLD
458,334,232 *2E8E2FF1B98A9200597F6D52286A474B9FFB8E2F ANTHONYTOWNS
458,334,233 *2E8A8324DDD4C93E9ED93DFEC2B574C161867D2C apblk
458,334,234 *2E8A8E2DA15083AF19F74B398915CB33B99DE2B6 10009、pp
458,334,235 *2E814E13451C09F04C236CD9DA1293C05C687CF6 11301318
458,334,236 *2E8D9FABEB6BBE7D20D88B9308D90E5958A63F48 1134285 VALKOSIPULI MAISTUU ASIAKKAILLE MY
458,334,237 *2E8164CB320E493AAD6A8BCB0521AE0DD119C6EE 11softball11
458,334,238 *2E86E538C870248B7610672F4A201BAEF25C6F64 1296852 AMMORGENHATTEERNOCHBEI6,55METERGELEGEN
458,334,239 *2E8D98E10B62620230CBDED939679615B6DA5BDA asppp
458,334,240 *2E8DA69BEDD42F0EF3F04E5E3C3D5B623AF28D0F A!SV?
458,334,241 *2E81DD9A45604BB12BD21BE2C50E6E45DEA6E392 18P
458,334,242 *2E8FFA110F8050EA1E21D30E9DA22D753C113B11 1934859 SAARI OLI OTAKSUNUT , ETT
458,334,243 *2E8F82E07AF917794953D4BCE661B62025A895D2 ATTCATTGGAAGGCCATGCAAACAAAAATTTAGAAAAAAAAGAAAATTAAGATAACTACC
458,334,244 *2E87A8351129F3EB2C58E92D4E81D0656EACEDE2 ATV(8
458,334,245 *2E8DB057128622A943F9F6CF001ABED573FF5B32 AUGUSTUSTHIESSEN
458,334,246 *2E80BE869D3804D6725DDC25C80CFC517939599C austinkirkhart
458,334,247 *2E8FFACC6D754F22D150A8ABC90CF670B7802965 195777 .---hic-kiziniz-var-mi-?
458,334,248 *2E801ECA4A849B2CF81EA8BE6C1B19D61CB2B683 1990-10-31:centralparkballroom,milwaukee,wi,usa
458,334,249 *2E8F487515E4C69C9E0BC2B1A7CAA9CBBFF225B8 AUTOTOOTJATEST
458,334,250 *2E88F73CF54024BC3A2EF2F3A512901CF66EF551 1.CFT-AKTION
458,334,251 *2E88568DCA29473FC43D5C9CFF2638D1A030EA34 AYOQQ
458,334,252 *2E8CF77595052C020E0B848380EFC36AA9F9DA49 b0bo)
458,334,253 *2E8F34D1E366BEE4718371CD51C0CFCD4FF47516 1-GENGESHE
458,334,254 *2E8E2FEC305C8E6D3B62238B40CADCC25626DD14 B3GD
458,334,255 *2E86D09ED622372867CDF67F1BA9219E1460EE78 B#51K
458,334,256 *2E82DDC325AB89B32565E473AF6B82B63035844C badroccing
458,334,257 *2E8478B798C8848D36EA4556A66E6093FB50B17A 1LENTOKONEITTEN
458,334,258 *2E8F180B3C9877811B4DF87C4D8817169A9A7D9B [email protected]
458,334,259 *2E86B920BBCE426EFFBDC7DF04AF4B83D383D054 BALCOMBE1993
458,334,260 *2E878302A8707F2C3C04D5388F58C2D9DDF93938 1NOVEMBER1155
458,334,261 *2E80E6042834703EB4FB5A59F0D2DEC530A5601C BANESIU
458,334,262 *2E8691E8F1DD79E6E8CAD9B1A32426C55922B4CB BARBARA.BROWN.TAYLOR
458,334,263 *2E84AA982AF4E7809CF102D512BFA40346253461 BARBARAHOUSEHOLDER
458,334,264 *2E8547EE8270450B1082B6BBDB0E0704EC800223 1proto-parties
458,334,265 *2E80119116147D0A23D7E627884702E10166232E BARRYFREELOVE
458,334,266 *2E898E53A4F010FDA83FDE5E6BFD0D845F1656AE [email protected]
458,334,267 *2E8110BC152D8A9D0E53A9568EE5E686E3E5BE1A bauip
458,334,268 *2E8E14A9044DC49761CAF93A35C5823FFE3C89BE 1SNOYUPPA
458,334,269 *2E813420E756F1CE51B5F1C1EE70E76BED24BAA7 1.STRASSENBURGEN
458,334,270 *2E8DF89FCF796C30E750A6CB2E0CB52E37E14489 bbiyp
458,334,271 *2E8F913953F6131EBE59D8257B68C4F59E19A5AC BC1+E
458,334,272 *2E8E0FA161CFE59482F1401C41E296C4A536DB26 beclamoring.
458,334,273 *2E845FC6585EBDDA5851BEA73513FC65ACE865F7 beherrschte?
458,334,274 *2E8A2D27CB32200EAD1288545DCAAF38F8B3CC3D 2061046 "-ICH-BIN-STOLZ-AUF-MEIN-TEAM-UND-UNSERE-TRAINERIN-
458,334,275 *2E80B20E1526A70DA12D3611FF630E1FF81DB262 benedictvasos
458,334,276 *2E8BD9597AD6E2AA3EF59DD230F20D3FF2F9F542 BENNY.KOVACIK
458,334,277 *2E8C2F63BB6EB2DED7C932B202413389DFED4FDB benwaiters
458,334,278 *2E8C3F756D3E20F8C4B42ABBF945323E873995E6 BE-'OZNE
458,334,279 *2E8C40B60180956F869CE020FFFC2B437F678F5C 21 j
458,334,280 *2E86C93D02D6B941DB0BB88DBBFA0E3450403188 2497C960BA1416EFE88B983441383CEA.550542
458,334,281 *2E88280C5A3A87968EAB593FCC007B900A04BE5A b%ew
458,334,282 *2E83CDD9F00DBC96CC486A4320EDBD2736DB063A b+i06
458,334,283 *2E8F5FD63076573D805FE14C23EBF2AC6A95903B BICUSPID
458,334,284 *2E8B9653C915B9A5133A5D4D8BF80AF91EC2C050 billieheard
458,334,285 *2E8876B9863EF4333E61D041F500D3ECE7EC437C 2aumentai
458,334,286 *2E8A8D8203A5C2F51746CBEEC3B1A183F5C128F5 bisinger4
458,334,287 *2E803F9D1C9A5772B934FE26E39FD30DE23FD0A2 BJNAG
458,334,288 *2E8D449D63DE8CC424100F28DE153DCF4628EFE6 2vincent11
458,334,289 *2E89CDD34347AD00D4028528A463718981093D42 345607 YAGMURA-KAVUSMUS-TOPRAK-KOKUSUNU-OZLUYORDUM-.
458,334,290 *2E87C3EC815B9AC9BB9DD5EA5B241F8B89D48F8D BLDQA
458,334,291 *2E818CD235532C3304CCD62DB4D70751799D1D8B BLOU$
458,334,292 *2E8C40615CF31CAB8468FB3B79C15286458BEC37 BLY:T
458,334,293 *2E84E981EF05A7A57397946F7605261339CA09D0 3KLEISTES
458,334,294 *2E8523F70A5894A653A84C8E549AF8ED9E270F3C 3MARIJOAN
458,334,295 *2E832793BB1FDE7473754F78BC3A627B202D2AAD b,m#w
458,334,296 *2E88108006078F1C9FBD464F51FF36314B95326A BNIWE
458,334,297 *2E85A9AA91351A55EA503921A97E435258FE7DCA BNXW
458,334,298 *2E8BC6DCE8E7B382618DC1A0F0EBD3605A46EC08 bobbyjohnsen
458,334,299 *2E81FC2E90174585AB728F270A5528AD13BA5141 オープニング(40秒程度)・CM(30秒)
458,334,300 *2E80F3311370CDFF3FA3807E652FF35906928790 [email protected]
458,334,301 *2E8904858908FBECD5C6521DFE3184CF71770471 4DOSEREN
458,334,302 *2E875368D7AEA946783E8B374638A477232E221D BR3:_
458,334,303 *2E8E20CFCF11A0EF9BA01FA6155846AF0E9E5E3E 4PROFEREBATQUE
458,334,304 *2E8E3A4B0C701772CA5E0033B8D8AC1703D3887F 4PUHELINLUETTELOPALVELUN
458,334,305 *2E8CEF7D59E59D2F73207A0193BF5ADC5502001B bradlyphetteplace
458,334,306 *2E83DF70DDECD4D181FEEED722A98ED85DA2AEC6 BRADLY.SCHRAMM
458,334,307 *2E829217A359A3A541D77F967B4502C72A056BD9 bradyheiermann
458,334,308 *2E8277BCF85A2EE7AB9F6AAF91230A83B2851288 BRAIN.HIEMER
458,334,309 *2E810C70F00D61F19FC24D8CB4A9633FB2DB2DE1 4ROTUNDASSA
458,334,310 *2E849B786E70BA459566E0F1528787CE035A3593 BREDOUILLENT
458,334,311 *2E868D38514955AE7A2645FC71525BA20CB4DF39 4XCOUNTRYLINCOLN
458,334,312 *2E817152436B819AFFAAC646B9DE7B3BD131849B 4YKNEGUOT
458,334,313 *2E8695EC92B8ACC0A99CE412BE0A3884D01E330B brycepallansch
458,334,314 *2E8ECB17CEB60D66E1F27C6C2DAE8DAB62DCFAFE bsfad
458,334,315 *2E806EF7385E4A1BD047EE6A4A2800020D5A759C bswnarasabahbsw
458,334,316 *2E885EF2BD6606A9A926D0FD1C377586A971F416 B&t;
458,334,317 *2E8CC64D9831D48D4D6C42121308ADED53C9934E 5COMPORTANT
458,334,318 *2E8E77A5ACCF12C9FFE258A50312202293CFF04D BUBBLE T0
458,334,319 *2E8D3E095D9C733D9FD36F1614DF47882199E118 bucu
458,334,320 *2E8C4F4729A1C672DEB547F4C206733948346B8A 5INEDNOBI
458,334,321 *2E85AA6EC6F4D990B41463121AC3FFA6F41B2F71 5IRROTTAUTUMISTA
458,334,322 *2E8B20043A3C04C0639E6F3E8BB49323263BF228 5JIMBOICECREAM
458,334,323 *2E8B121F2499DBFE12F3A3CA94D2B5F24FD8BC1F 5MASTORS
458,334,324 *2E8C6DF92D1EFEE484766FE24128B164693925D7 BUSTERVANHESE
458,334,325 *2E873B18CEEB53427BE1015A3B48C367B3647C31 BU?UW
458,334,326 *2E86977E09E77F933724D982E4ED0E1DC333AE34 b!w-s
458,334,327 *2E822F4CD039845E07CACEBBD598C8E2A11484CD BXTTI
458,334,328 *2E87118CFF41FCEB7CE0E1C8FD087AB7558E586F bzwy2
458,334,329 *2E8F475E9892197D5EFC05E21FA09262860AA3B3 C?%
458,334,330 *2E8DAF3FEA2FFE56BDF1AEB3EAE67620579959B4 C0MP4R3C3RLH0
458,334,331 *2E866498038D22C880725A689754C36E031F9722 [email protected]
458,334,332 *2E89A00211D398C84ED5E2A50FDEBE4A5EECEE08 689CALE
458,334,333 *2E8C38BDDF99C5265DF9EEA62E97C20F7CC6B991 6BSWACTAIXBSW
458,334,334 *2E857A13CD3BFF535A6E2B9E65D6E73117E87FD5 6DEADHEADPHOENIX
458,334,335 *2E8B86424022FD59A16BC67DB5EFFE2F267FF8E2 c4anj
458,334,336 *2E8366617ADB32DDD7694501EBE70C3BABBFD3AC c6zh_
458,334,337 *2E860522FB2C2189E9CF93F36BE521D1C0A79B90 6NAHAMSIU
458,334,338 *2E8E7AC908D3043CEF75A1C8B7282A4E63DABF2B [email protected]
458,334,339 *2E8938D791C5876D51FD9CF5B014A9E9384FB1AC [email protected]
458,334,340 *2E833A6F9EE52CA7A701C41D85684CC70345C20C CALEBHOOKS
458,334,341 *2E88AC54B3E9BA939BF17AA34FBCA7BEE3F480FE 6.siete
458,334,342 *2E81308363378E062C5340586E177A94FB902EFE canonmacintos
458,334,343 *2E8BD6455BA494B771BF004632EF5E07DD591887 CARR181085
458,334,344 *2E84184515EAF306330EF0FBC9504CDAA08CCEFD CASEY.WASHOR
458,334,345 *2E8B5D0719054DB0890771E9216C9284909BC2F0 CASS7
458,334,346 *2E886560C6FE9AD20026CB58B851D8FBBAF4566C 7COKEROPING
458,334,347 *2E8BC406C2DF0494F93AF4B4ADF57E8E15101FA8 CAULBERT3
458,334,348 *2E89BDB334CF03699F32B1919A85C7876666083A caunv
458,334,349 *2E87DEE176177703868B1A6811804D39E78D1462 7MAR1335
458,334,350 *2E8FC7B42131B956B722BBA5365587D93428688E c=%!e
458,334,351 *2E8AC40F5451E7AF6E80EB3F53BCEF3C01321B6D ce5l
458,334,352 *2E8B942B8EE0B70308267105E456C8FE18F232E9 7SALZSTREUER
458,334,353 *2E8878931DA9102B3620DC8DAB3070D93AF296CC celestelle
458,334,354 *2E820BCF036304212A71B37503E3703553A3E6B2 7SIUNAILL
458,334,355 *2E8AFA0AC97EA77F597FCB34226FB261A8554BF0 7SRUSTANI
458,334,356 *2E8C7A3290DB8E70F7477EAD6BFC8492BAAD9696 7thedagger19
458,334,357 *2E83B0AC022C2D35F9601A48236CBF932A28C18C CFud
458,334,358 *2E8CAF0DB4AABB13ECC0EA21B23B143A30AF61F4 8aa
458,334,359 *2E84308D2368A01014E5A33D1F8866CE80028510 CHACONNEINDMINOR
458,334,360 *2E8566720540E820860ECD528838943A18B3CF42 8BSWCAPMACBSW
458,334,361 *2E86DE74E072675C8726F502B44069EFC4F2E0DB CHARIS.FU
458,334,362 *2E8F8627FA4CB677EA4E203CF6C9DEB2B45D7856 cheaping.
458,334,363 *2E86E7A6AF6590E4D09155C0E1D929D74DD5887A CHET.CIPOLLONI
458,334,364 *2E8FFFEC68FDB256A531F36E34EDDECFD834A6AE 8KATUVILIN
458,334,365 *2E812DCBF627A4309A46D38AA5A03FB162AF39E4 8NIKNAAUT
458,334,366 *2E844ABA1530CCDC411DBF090B42E42D591EDD40 8=>~o ~o>-<
458,334,367 *2E8BE6AD240547CBB5C229E2F81B628C0894ADF5 chrisheiser
458,334,368 *2E83803C94BACF208F1438D0F3EC70EEB714BDBD 8PARACOLPIUMS
458,334,369 *2E82C96D471CCD960BCBE522C38E5AFC1769BC78 8-P*-SPLAT
458,334,370 *2E882A0C20BAC42E2D28C5F5A0062249FEB37FA9 CHUNG.TEICHMANN
458,334,371 *2E85F787EB6DE640B837DFBA42B37D7A3329AE7E 8 TIRE-SLASHING
458,334,372 *2E8D1E852674A92862142B0846BFFBB362D2B3D2 8-Track.Demo
458,334,373 *2E8F0D60FF99728C9E200B515DB5A7CE4716AEED 8UTTOMMAN
458,334,374 *2E8E6CA4403004874864ACF98D51DC13D7BF23A2 ciau
458,334,375 *2E850085CDA86E46A7C5FBFD9B2067E2784BB9F0 CIFIBMINED
458,334,376 *2E801DA3575D426BBC5F5D637697FD41224476DC CIGOLONEPPING
458,334,377 *2E816100B2E34DED7688E4FABEA148E82EB80C40 ck6"b
458,334,378 *2E825D9AB917B3878BED26EDF33E292DCEB953C9 958AUDRINA
458,334,379 *2E8FC0A97568CE93586E3B8A390484AAF668B4BB 9ACHTERGRONDMUZIEK
458,334,380 *2E80E3B97F567EA2396BA68DF77C0D8FD4A4195D CLIFTON.MOHOMED
458,334,381 *2E8FC11D3749BA086F62C7CAF9A89B732E6FA054 CLIFTONWEHLING
458,334,382 *2E804A0739437105CE7B0226EDE9E46DD0D5639A clinton442
458,334,383 *2E83ACA705E2761015C05CC4D9A7DE6874C58DE6 9UNMUSICI
458,334,384 *2E8D39B3E5A06951E136DF2B98689F86315B732D a0bat
458,334,385 *2E807F45469AA4B1B2167F0742E1D17E5EB77A09 a60ws
458,334,386 *2E8D88F470FEF40A036165E4705731A18EAF7352 AADF|W
458,334,387 *2E883240D0D88AB9D123662926896462AE3B0BF3 Cr2l
458,334,388 *2E89A11FF4E1B6BCA7F118DF7766335DE3DABAE1 abbyferrero
458,334,389 *2E83BED6F01D0FEB134AEAD7B8E612AB582189B8 abk+l
458,334,390 *2E811B5276FF58617005A16CEE2479AF52E65BF7 ACF#(
458,334,391 *2E8292B1F9F98784E50B79D768E86C44024F8660 adenochondrosarcoma5
458,334,392 *2E8FB72DB06C001C9F90C52A51783FA5FC45D688 adolfokalafarski
458,334,393 *2E86B59806B2D996B4729E1B82F3A704B6BA728A cw8/r
458,334,394 *2E810A547A66588DF6923334512C6EF0E3C900C6 AJOD0
458,334,395 *2E8EFFC8C7E9CF67AC736DCF0B929A088D587ED5 DANADELAGADO
458,334,396 *2E8F4B15FCD62D1D0D326C6A4652696066A0B682 AKCKX
458,334,397 *2E872E875AEC6290F8C077700627B0B64F5F4DB3 danteledon
458,334,398 *2E8E86D24871F94CD95A5296413F2AD9D8C99307 ALABAMASSAS
458,334,399 *2E87848EDA392CDDAECA7CED843271B42083E59D albertofroehle
458,334,400 *2E8EB969CC2E1162A0E31045CDCE114A3C08D646 albertomarcos
458,334,401 *2E86A9DD21AA254EE8AFB2F45D33EE90FA5598B6 ALIPAINEESTA
458,334,402 *2E8E305865C82C8491650174C9D234D0D9D77BA8 d_"b
458,334,403 *2E8EFFCAC69088A886F853259ABA73ECB8628D2A D#BG0
458,334,404 *2E883F52E7E74117ABAF0D65BD25DEA89B6113A1 alphonsedenoble
458,334,405 *2E8A8CD0CCF875BFAD19FE21EEA98221577F1824 ALPHONSE.HEUBUSCH
458,334,406 *2E824963B5A7B6DDA57E32D377D8A3D6D6CB7199 de8)j
458,334,407 *2E8DA4D7588C0163F7B7B26594B500EA4423D100 deepwaterlriseminar
458,334,408 *2E837EE26679FC7B8E8C29DAA53E4E58FE1AD5E0 DEMETRIUSGERSTNER
458,334,409 *2E8E4308FA7EB38756A9FD5C151772EA37B64C75 DEMUOKRATĖŠKĀ
458,334,410 *2E89C6205B5172D0CDE75DF83B0401ACB04AB236 DEN BOER
458,334,411 *2E80578F2D4EA7F87D682709368956CFF4F888FD derrick.beeler
458,334,412 *2E86ECE734C6A05757505EDAD187210D15DD025C [email protected]
458,334,413 *2E89B11B47BFBCED82F1E6BBFAC60745E675CCE6 df:dr
458,334,414 *2E83BCC96E449FF4E5262A81E7149B167FBF955D [email protected]
458,334,415 *2E8300932C547F2191768EC23D6FDFC8EFE3A0A3 A?MPH
458,334,416 *2E8700D6290AC071705360ABF37E130D689F4709 d#ipt
458,334,417 *2E8511B68CBB9B1364F9EF0869F588B3492CE355 AmZp
458,334,418 *2E8FED6EDC4769EE5C19CDB2347D0F17D67229F9 d%kj.
458,334,419 *2E84489DEA0C6C44A1B58581BE57EA262454D384 DKP%
458,334,420 *2E810D09A1C7E960EEB2692FDE37588F085EF88B DL,r
458,334,421 *2E807DF9C0777EF27A9541EF647350017855DA34 dm$v
458,334,422 *2E83CFA691D14A07D10073AF74A2CE1C72400CDD DO9XR
458,334,423 *2E8BB4B16A4E093644A3A0A3FB31F98C1A858EA1 an+q2
458,334,424 *2E8976E2DCAF86E99222EF3EEB82AF4F5F9188AE DONNA.PAICE
458,334,425 *2E81F5F5C0C0E7CC6A4402F580FF5B9D59AAE1B2 antoinemcnutty
458,334,426 *2E84728ED4D8A5405A33658FE205E6B72FA82748 donnhoppins
458,334,427 *2E88181B410B64755704722EA0ADEA638A83C47D dorseyzickuhr
458,334,428 *2E8FED00C341BE27E704BBE1D027E400B2269581 anzn
458,334,429 *2E8A13469736773C98F0C865A1EA781026FAD08A APOLOSUR9
458,334,430 *2E8E5DAC26EEF0511D909C6D733210FEFA9D1A52 DTA1U
458,334,431 *2E80315BC4D5089DC1FA703A00D2E640721DB4E7 ARIA.BUONA.(BUENOS.AIRES)
458,334,432 *2E8635EBE8160FB17814E0DC0AB4372781AC507C [email protected]
458,334,433 *2E8CAD83BBED3FDE5F3193C99EEFAE5F01F4D912 ARIANEVICENTE
458,334,434 *2E8684C94F93792DDFD76A724AFDE38D691CE6FF ARON.BAU
458,334,435 *2E88807021FCC6BB0A3A3EF3692678452D1B9E6D duwfa
458,334,436 *2E8FF9DAA910F9657EA79FE8A20ED43E972EA195 dyhre
458,334,437 *2E8C23354EE57A80DE5EAF895F3A78EADD095E73 ea7ab4cb0cd4a0b64c6fc5ff9cd5cb7de617bd8e
458,334,438 *2E88ACA93B8A48C1109DDA2B9A49815575A44D2B EARLEPICKRELL
458,334,439 *2E80B91726A0DBFB5539450079BE9B1DCBBA484A EARLMULLARKEY
458,334,440 *2E8F51A540FF0FF0AD91D6701B2FE52951B7FD5B EBITEC
458,334,441 *2E86136C1335061B57A1452F45364FE82BC84198 AUMENTRAMOS
458,334,442 *2E8AA7DC3FCAF3037C4E58405105D3555CF1566F ee<g
458,334,443 *2E8B7711F5563AF0E627EDCDB6BC17E0D02F14F1 EHLEDOV
458,334,444 *2E8BD12ADEC20FD25481A2CE39D7DE38412293A3 b7/c%
458,334,445 *2E848277F56003CC06D604B068D7EE0A515221A1 ellsworthladuke
458,334,446 *2E83521EE05A4AF3A9E56A340D5F6E1D389F64A4 B9"=
458,334,447 *2E8E5DEB394B5FBA30B249EDC98E8F6615D3EF87 [email protected]
458,334,448 *2E81709ED7FB710E03AC22FE8FDF0D4B73776A07 [email protected]
458,334,449 *2E8E4E406A62565C9E9E8E350EB888DCFE3B1A08 [email protected]
458,334,450 *2E8AEF63C7B2651A4B902C079FBDBED8A5ADACBD BALLOOLA5
458,334,451 *2E8EFFD3806F9B4E1E5DA4448ED55D8B47641C8F EMLEUERG4
458,334,452 *2E8CEBB7E79853CB06BD701CB2585A6D3A620334 EMMANUELSOHRABI
458,334,453 *2E84D3C23470D9A23E3BA1E68167064EDF59338E EMMANUEL.WAGGONER
458,334,454 *2E84B2CA3F6013FA53F52ED9E12169CC02C779ED bantry.boy
458,334,455 *2E85CC1990FB8D2A323638BFA7064BE13797F7BF BARMLIGAED
458,334,456 *2E8E0D456118F095206464B8444E62F5D6338652 BARNESTJERNEN
458,334,457 *2E8CB546DFC5AD785F47CED03E28C8B5B6112C69 bbhqn
458,334,458 *2E882F0EC8F473CEB6C628A988753FAF08D90632 BBYMU
458,334,459 *2E83FF07CCC760AEBB1D8504DB45BAE1817DCDFA eriously1
458,334,460 *2E8F534C4EFCB5E207C4E386B0CDD15F058E39CE BEANSHA
458,334,461 *2E8F293AD6F9899FB896A29960B1131A16D01DAD bearbach5
458,334,462 *2E832EDF3B992A1D0D8DEAAFE493D2CC59AA1DC8 bedári
458,334,463 *2E8D5C3A104B2E4140FCE81EDAB09778BDFF2BF0 ETHAN.ROBAK
458,334,464 *2E87857515649227A4DA46D739ADC5C114B2CF32 ETQHK
458,334,465 *2E804CDE18367D3184990FED59B4FE24A50C86BC [email protected]
458,334,466 *2E8AC46885060C61C37C384D15E7DC6CFC207205 bernardswenor
458,334,467 *2E88109E12AD7329C03BB7D53A93B8F329216B7B EUCO,
458,334,468 *2E805D69F46A08089F689E2890A3EE1B684A4427 EUROOPPATIELLÄ
458,334,469 *2E839B87B2878C882B29E6765E04FE4AF41D987B everything.could.be.so.perfect...
458,334,470 *2E8FF26F9795524DF18E5A0710F3265A97FFBECA bhngg
458,334,471 *2E82E4A52D9DF93F937921E4D63FF7ADFA580869 fedtoplselig
458,334,472 *2E8AA8E8BACD42DDED29EB9EF181B4545D73BDD1 blastersabrina
458,334,473 *2E8F79927DDAFAFB4FF5A3624EED0B549062B838 blue.grass.state.of.mind
458,334,474 *2E8800D8431E565B62438497AF32315790BA254F bn_df
458,334,475 *2E82D113E0EA04B9B01C952A211A882D5919F013 Bo$5
458,334,476 *2E896CBC7CCD77A3FF279DF29CD9688B077937C2 frambozens
458,334,477 *2E8FCA267BAD59A2122FCD20B74F0599D9F98058 frequentiere0
458,334,478 *2E8E502A75A8FACE6DF693DA07BA98AC61E5E631 FUNDOUGGED
458,334,479 *2E84B3E6BF4029E1474BDEA2A2D9D0C2F1188486 BRADOVERLY
458,334,480 *2E889024276476EA98962A1B0758E916BA6872C7 gangleri0
458,334,481 *2E81E5DF5701B6EAB3C2568D50A20E66A6F7DD1D [email protected]
458,334,482 *2E81E9672636DA8672DD6647957428EFE929BF19 GASTON.NEWSTROM
458,334,483 *2E88892DA47806F52F78216DF187A4522291CD78 BRENDANFOLLIARD
458,334,484 *2E88FA7687B530395525AC7DB4EFF199194FB4A6 GAVYUTIS8
458,334,485 *2E822AAC7D7C9FC0931A8EDD1B69A95A01AD6D32 genaropishko
458,334,486 *2E89D633966C3DD083975AFC9F78962E9542EC9B BRITTNEYKAZEE
458,334,487 *2E8A8331D73F17DEE15988AD774C266BC63641E9 GESTAMMTS
458,334,488 *2E8CA1AE0A7FB125C0C8A3979386DAC5AF048592 gfhy
458,334,489 *2E85ED5CBB616F324626A79C25B7CC0186D84C43 b+s#5
458,334,490 *2E8A199839108F01E2019D000E6FFB552ED3F81A GILBERTFLOORE
458,334,491 *2E8C3E6C4584B404F3B2AA8691F2E5976168EC96 bsfad
458,334,492 *2E871CF271EB90212EA2103728B64A7FC6829B6D GIT-R-DONE!
458,334,493 *2E8941295BDB9A34BFF9590FADFEA8D50C7E71E8 gniniruking
458,334,494 *2E83BC96CFB5F190E62B9249ACB3747DE734916A BST?B
458,334,495 *2E85BAF982E500399E0EFE8F8A1B8993530142DA bu%a;
458,334,496 *2E8BE776EB2C1033CE528CB8780AE1E203C20B0B BUD.MCMINDES
458,334,497 *2E824A4FCB610B264841F3CBEB59C5910A074FBC bullshitwayne
458,334,498 *2E822203E317642AAAA164E111887DD257D46F51 grillcheese
458,334,499 *2E85D19F75887ECF5A5C80B246FA8FD4A3A89BCC GTURENE2
458,334,500 *2E81BE159D6653F0C10DD819421CC7798C18133F BURT.OBEIRNE
458,334,501 *2E8A732F5CA7B3869F3554BC29B62D78EBA11FCB burtownby
458,334,502 *2E8C28CB0BC9F2E38F4635075FB2EA81C9DEFB32 bvhx2
458,334,503 *2E82079A9F2D285E40B12CE9597779D9D88451B0 hadarezerowi
458,334,504 *2E8B92AEDE402B4D62655A3F5F2A3E278F77D949 Ha.ha!.Would.an.impostor.be.as.handsome.as.me?".-.Old.Man
458,334,505 *2E8A14AFB4A9D8D31AADA45B52A075AFAF6BBE80 bycz
458,334,506 *2E87693934B022C359FC63E7FAE1AAECA348B736 happy.man.(12".mix)
458,334,507 *2E8174FC11C759A00AFB21174B8D2DE5D8DC4F44 c0,"
458,334,508 *2E8AA11D8E2716D09535F928617B110DA689FEBD C1LN=
458,334,509 *2E8A18CB3C641990EB7AD96DB68A71E6DF17D602 c38ug
458,334,510 *2E8DE7E5CBC0BF2D4E72158ACD82F86AEB050E54 C4J"E
458,334,511 *2E850EE3DDC0F492F1F0D9E4169375B1CBE38286 C67398
458,334,512 *2E83518DA59C1B0E676D90C0901CA2C18145CA6E c$6%n
458,334,513 *2E8809226C7BC8665CE9C7DFF1AF6F206C789999 caitlinmaveric
458,334,514 *2E8EDD63A63D7381DBEADA109D9130E68768FDC6 CAPITALMETRORAILSTATIONS
458,334,515 *2E80DEE6B02D868B5C9DBE66A53FEBC3DD7F5C12 herawdes3
458,334,516 *2E8BE9C30215D3B8673313859B13A94F78D36508 [email protected]
458,334,517 *2E81275381E962B0D05F08F877287A107BC34630 HERIBERTOSULLA
458,334,518 *2E8F5522B81D1633ED4D0ABFF0A5723A61087999 HESAPLATIR
458,334,519 *2E82571775EA9F5A102B56F3ED59330C4CC83AB6 [email protected]
458,334,520 *2E8DD354162644291ECE33D88965FB3B7E44A307 HONEST?
458,334,521 *2E80CEBB035786930AE10EAAEEA2047AF884ED19 HRNR
458,334,522 *2E8A9435CA0327292704D4DBAF10D040DEA78BAC hubertblommel
458,334,523 *2E8385C1513F4AEF480002B1899E0C84BDA24767 HUGOANNEN
458,334,524 *2E896840CF80A8C7C85CEA834D59B625E800CD62 [email protected]
458,334,525 *2E8A3D184A54E580E5708D587174F3807F8B54A4 CFBXK
458,334,526 *2E827AA11803472462DBFE3C38C587E39F05E3CF CHAMPIONWARRIORS
458,334,527 *2E88A71E8A73CC4A427A165A78DCDD5ED2DCB38A charleylarrabee
458,334,528 *2E8ED6E53CB8D4740707498583BF953F9CC5FDF3 chasshammaa
458,334,529 *2E87F0E08E05638BD87E92829EFEE8526D098C3E chbh
458,334,530 *2E8236E0A0FFD9EF31AD208A4CFEC120F8CE7BE4 IBEKE1234
458,334,531 *2E8EB2DEB155BF5FF0243BE0C448B6C9367C99E3 icmted
458,334,532 *2E89B96C200985149CAF180438EF5FA72950CD45 IDX|
458,334,533 *2E834C905FC6FCAF97886866691E1CAB82ABD87B IG`M
458,334,534 *2E8DBC768D8AF60F3BCEDDB6C69DAB75F412F9C4 IKE.HAMID
458,334,535 *2E8CFE32F5952DBF0E59B0227CF7A689220E435C ikerserrat
458,334,536 *2E8F3525BB7848564F0FE1347D8C8F706A0B291E IKKIMASHOI
458,334,537 *2E8D0EF214DB2FAA068C3B04CD440ECA21DAA9AA IMAGEFOUR
458,334,538 *2E8625C101E9EEE690DD0253407B2C58AB7F2605 ckusw
458,334,539 *2E8B6F9C6DDC96A92D4BE7F15DFCD80D3301F7DB clarencereiland
458,334,540 *2E8F874AC8B99C146C45D15B784379D620D1BC4E clarknahhas
458,334,541 *2E8075D28CEBCCD9EBC39F56837890D9A8E3C53B CLARKPOZZUOLI
458,334,542 *2E840BC522C863A7053C43EEA93B23BD11F7AA3A CLEMENTE.SCHLAACK
458,334,543 *2E83A762E0DD81AABB07F76B424A26B119FF9C2F C!LF+
458,334,544 *2E8805BAA929F31A105FC3592ADAE639EA45DDC2 CLINCHER
458,334,545 *2E8CACB0A22CFE56F999A29A3655999FBDE6DB67 cmh1u
458,334,546 *2E8C2440EAE0A73C1E7867A9D1BB7E3B46B76836 «coins
458,334,547 *2E86F52291B3223FA898F4B13E3069F243821AD8 JAKE.KOCZERA
458,334,548 *2E8536BCF5CA9E00EEEA41598A2240FC83C9E445 JAMIESCHEERER
458,334,549 *2E8FE42A0D4B9AD298B9D504A9C97D021ABA4B89 janowiec-le
458,334,550 *2E84EE2563DEAAACD3FBAB20EFF97C23D496615B JARODEWINGS
458,334,551 *2E862FD5EA722DCAE05C6027D47541D517126DF2 CONSEDISSENT123
458,334,552 *2E8E6C942D8E2DEAE935B8FC8F941FE71BA55C11 CONTRAILUMINACIÓN
458,334,553 *2E8D84471F95BD4D1BBEF72E8E6C7754C48B0AE3 jaysockwell
458,334,554 *2E8252ADC8205CF33A473BAD0B0CFADF15C5B113 JECIRIEC
458,334,555 *2E8A67D3700EB715309DD09F9233931A9EC37712 coronacanela
458,334,556 *2E84836F04CD90824883CD9457D5EE8E971F16BC cprd
458,334,557 *2E8D2DECF0DCFF66B0599323548B6D261806D4BD CRAGSMEN
458,334,558 *2E8982B9A32CB55F6FEE04E4A608816DCB21F7CA joelkassay
458,334,559 *2E84C412AE95F5AE38A083EF7921825834D99F3D JOE-ZARA
458,334,560 *2E812DADCC94A353416AAC3F00101FF213F5C7D2 JOHNATHON.HEARING
458,334,561 *2E8F950468A879D7C6F026408FB01FDDA5635FD8 CRUSADERSKING
458,334,562 *2E8B7BC2A15515C4B5D6C873EFBE664475D511BF johnnyeidson
458,334,563 *2E8AC71B4E9941F54029EE499F580E23D8DF01E9 CS=05
458,334,564 *2E86DCD6659B657F5AE8F05CB5048DCDFFA21AE8 ct+#q
458,334,565 *2E8A4ABA12E436BF15D6F83F78CC4B4C923CD377 [email protected]
458,334,566 *2E83E0D7571AA602D73A0EBF32A46B1B4C21DF9B CVW%.
458,334,567 *2E871BB87E44F51D3AA628252384672431B99A96 CYU7G
458,334,568 *2E8D66145E714433C17648E7DDB9125F499FA4D8 d33pgr0u
458,334,569 *2E8536977CECFECC1D919FBADC5B07D0EC866B2A d3foq
458,334,570 *2E8213E9A86A7985AB2B7C751CA9321861E440A6 D6!R
458,334,571 *2E85A272414314EC03C449FAEACD96997DA16735 KASSORLA, ABOUT THE AFFAIR SHORTLY AFTER IT BEGAN. THEREAFTER,
458,334,572 *2E8D49EBB7ADA792AF48597BAA4813153BB64E71 KATHLEENEU1234
458,334,573 *2E8154391EE6449663D9196FE00563EAA19593A7 d9/3;
458,334,574 *2E805A867B1497F11BC30B607916B66A0A0EB9EB DAEVM
458,334,575 *2E849FFBEDFD86D8B45B0C9D585F129380CBD76E dalechambless
458,334,576 *2E8FED1CAB5D10AC001081A021BEEDBD599FD05C DAM7!
458,334,577 *2E8E75CFEE29BF194D1803540619D89EA6334D40 DANIELGERGEL
458,334,578 *2E8AF79280C0522D920834E16BAEE08ACD895A04 DARELLOLEXA
458,334,579 *2E8A350F22EE702FEA316481D09CF6B797B4CF4C DARON.TERWEY
458,334,580 *2E8B6CC46511A0D01DE5C972660B2FBF3A997A8D KHORNE»
458,334,581 *2E87AE34C5C906491ED5BCE59F121AA66943501E KIP.CARRIO
458,334,582 *2E8D0D78C4F704D3CEDC30C2A2CD8060FE3AE5E4 kjj,
458,334,583 *2E8E828EC1063B27D151D3240FCCCCB9972FBA3D kl,+
458,334,584 *2E8E5C98CA6277C13298BD385F1476D93B80511A DCJWRNN2
458,334,585 *2E8D5DE36D4C34CCF7239918E5220C0B316A793B ddhw&
458,334,586 *2E8C9CF534BC6C897B8FD11BD85E52901AA3E33A DE6A:
458,334,587 *2E89CED73783B72876A81F4E035292A9EEC5A0B5 delmercoaker
458,334,588 *2E8F9ED3A0A0BA54B1FA2BD82DDA60980446057E lacornes8
458,334,589 *2E82B27B975B19673A552606CEDA56D009B6BD66 derweil7
458,334,590 *2E8C56181E4A237A34C539F0022BDD463CC1027F DESMOND.ESBRANDT
458,334,591 *2E86665BFBD1188A1CDC2B0FC394E4BC2D116333 LANEVOCELKA
458,334,592 *2E89F03EF8B1E5584E29F9B0C818743146BDA26D despej
458,334,593 *2E85E73F861FC741E07B2EAD28B114995D295225 langzaammijnhoofd
458,334,594 *2E8C96DC5F104F01A64CBCFF6D7F00DE6C7B989E devaterka
458,334,595 *2E8F952AA4346C83C027835566377399D2BF79E7 DFR%I
458,334,596 *2E8F053B3B1CF2307DBB8270C6D87CCC6767826F DIASX07
458,334,597 *2E8EBE596295EA52A8E948C0F439C3F34CF757C5 LEGIFERA1
458,334,598 *2E83B025D2DD53CE35133F9477AD3518C5A9DEF1 dictyoid9
458,334,599 *2E883A8082DAD4084D494CAD389CF879D8B9BA12 LEMPILUOLASSAAN
458,334,600 *2E8CBE18F49995FBE84C1319CB92D21C8CEB07BA lencouser
458,334,601 *2E848994A0399ED02B178614DE4496CF0E558E9A LENGUAPLICATA
458,334,602 *2E807A99E9A98DC69E273E6FBAEE9E019C270318 LENNYBELGARDE
458,334,603 *2E89A3912E4209CE331B9F204BE81CA95861E410 lenronn
458,334,604 *2E8CA4883C131B653ABC43626DED590D55F1424B LEO.KOSLOSKY
458,334,605 *2E83A0B4E2BAED8712F2566A6CC037AB0DB89303 LETHELLE
458,334,606 *2E8F6FE08428323275441A9A7D189CBEEDE13A13 DISAGNBSW
458,334,607 *2E8E9E702990DC3664E99B939AC7A36A94E870EA [email protected]
458,334,608 *2E84C8D9181EF221A3E6A6570723D36BDFA0E467 lewiscolding
458,334,609 *2E8002493DB60ECBE1D37026A141AF67C907B790 LEXSUNA1
458,334,610 *2E8BD0B939FC575759BE0A80E6FE4DA45292FEF3 dk3hf
458,334,611 *2E832CA25580ED4F6162E3EFFDAAB5F029D00FBD [email protected]
458,334,612 *2E85239DFCA493FFA9588937C01BC9E8B248E58D [email protected]
458,334,613 *2E8CB2CF22CE994B19941C4B278D9CE21A85FA51 dkp2c
458,334,614 *2E8BB75102D4EB4ECCB4965CF67713C01887AB32 DMS ANTHEM
458,334,615 *2E849692CEF7FABB4EC957595CE80442C711E099 live in sweden 1987
458,334,616 *2E89179248A64986017B846A55EC50A7F6660B77 dominoisabelle
458,334,617 *2E87AE52F36DD78D02F5B6E91576B7B91C618958 don.rasberry
458,334,618 *2E88D8C0FDD70497C5036A563A8AE6762EF6C95C DORIANEDLER
458,334,619 *2E80AA0E2D90EBBFC95F2B73DC87946A7D745670 LONGONORATI
458,334,620 *2E8A5649D946CB969FE6D02390B063D1A64C7B2D LORCIERESENMARGERIDE
458,334,621 *2E80337668BA83119965A370C408AAEAACA01F3A D;O;U
458,334,622 *2E8B738DFEB4E16F76C81952C60B288F8F0AF1DE DOUG.SCHWAB
458,334,623 *2E8F843F6B2B5886E9CF5439645FEA08D4F363E5 DOYLEWAMSLEY
458,334,624 *2E81885C10A2A5E6B6200A85AA7C74A362F0F8D7 dp376
458,334,625 *2E80A4A1A59BEAB8D24756941238706342782823 LUCIO.SHUTTS
458,334,626 *2E84649E8A63FE5CBA341D769690E1D9CE2A9B86 DRHMH
458,334,627 *2E86793D148EBE04612D3DDA30D29F0F8C2A2457 dr.sailing
458,334,628 *2E8EFBA1680A2DA4A363DC3CB43DDB68EF39D3F2 [email protected]
458,334,629 *2E860C9D74FCBE46AAF34982FDED074AA33C7872 dt36i
458,334,630 *2E849EE3EB7A02124C98114FDE8B9460FEBC72B8 Madrid
458,334,631 *2E8ED6B1B55D3351FA5C92F5C4228EA053A4728D MANISH-RANJAN-SINGH
458,334,632 *2E8801A029D45B338798F368096C65FAAF326A82 DWT4J
458,334,633 *2E820AABD24E4D1AE95D52E22275DFB38FEEDDD8 dyh&
458,334,634 *2E8CFEEFFEDE722177F6A2C58DF17F3A70C95292 EATB=
458,334,635 *2E84CB677D37DB393A30A72DE5976F87D5633B88 ED+DU
458,334,636 *2E8609096F607FF3DD55F25BE877C29E1A4D8B09 edmundohawk
458,334,637 *2E812836AA1B9BC4BFEB5379D335DDEC5696DFCF MARSUPILAMIGEZIN
458,334,638 *2E8A221C728E05708504FE0BC81465017B4C3B33 MARTASADEK
458,334,639 *2E8A10A072E7853323A8B8FDA217D8E0A868CAB9 MARVIN.SIGMAN
458,334,640 *2E8503A5663B4382620CCB1B4269E1913683CAAA mattsheekey
458,334,641 *2E8DB4DCED44DF9934DB1C1D400E1B3A5943BCEF e%`e
458,334,642 *2E80402B536C970EFAE21EC3BEDEBF41A03A0022 M!CR08!0+!C
458,334,643 *2E8E2F1F5119F6FA2FE997EC3376D548ACA052F7 EITING1234
458,334,644 *2E83292928C7AC5583BAFA577AB5D0479A50AD7F EKJG)
458,334,645 *2E828E5C37CFE2335E44849B3546BFCB900C0519 elaine.kelly
458,334,646 *2E8A24115DA8AA3B399AF5E13DDF626A17AFD084 elblablazo
458,334,647 *2E83B8F0CC81F5E4CA395E5E0BE3B14C2B7DCD18 electrophorese0
458,334,648 *2E881C14F7F01344FC8240D422E9F338F6898BC5 elibeman
458,334,649 *2E86D9D8E58EF0EA0E364B019AFB811FF4BDA311 elliotsleight
458,334,650 *2E87159D300B0CC26B96490263737B1A1C8F5B12 MIBIRGER4
458,334,651 *2E888D2824561EB01C40DE24E67BBB2D945BF0AA ELVINCATONE
458,334,652 *2E8B05CF54650A2BBC665EAD7C8DF73941625874 elvisdalhover
458,334,653 *2E8350A54178FA3FA2843488A90142BA315806E9 MICHELLESERGEANT
458,334,654 *2E86B500D1878B464067F04CA00C2BE4136FE539 mikemalm
458,334,655 *2E863D4838359772E63C4A42CBCF85394BD5AA73 millionmillion
458,334,656 *2E8ED38E384F93CD7264DD85153531B0301A80AF enitokined
458,334,657 *2E8EFCC3EFF64C0DB6C0EEDA10DC639604E9F789 MITCH.STRANGE
458,334,658 *2E8360C51A1E95AA3F1C38EF796626AC543866F5 mohammedmailander
458,334,659 *2E85529AAD33B436C40A3DDC1E5C7FD3F4AA1757 EPHOSS
458,334,660 *2E8A831EE5552F18B547266C09A2A2AF8181E734 EQ0_R
458,334,661 *2E89B7CD80036F4CA005A4F24E15A07CD18DDD62 ERICHGILLIARD
458,334,662 *2E8E74664147FCA61A045B5D502599E4D11D03FE MORTEN.TRUST
458,334,663 *2E838E7898612ABC7C23141AF88D568A7A286391 ERWIN.ABILA
458,334,664 *2E85D23945E3B7E9EC774668DB64EDCC6848315A MUSEO.MILITAR.DE.LA.FUERZA.ARMADA.DE.EL.SALVADOR
458,334,665 *2E8CAE3DFB476DD373709807234F412CD8EAB5BB ESPIDON
458,334,666 *2E8C1198E7FEAD3773F149A8A0C72374EB62CCA4 ESTEBANGERHAUSER
458,334,667 *2E8D0EA6CE9FBAE49714337CCC7370DC6876F41C estebannulty
458,334,668 *2E8E2707BA515C2C0E2E439A2C19C19DE750BAEC ESTEBAN.SAVITTS
458,334,669 *2E8FEACBBBAD69C6B226CE6E284F2A3C6E60D237 esvq
458,334,670 *2E857208D6B94BF8525685EF8C61A5CB4107B8C9 myavenger8
458,334,671 *2E823D255553B137B6BD3197371162151FFFFBED mylie98
458,334,672 *2E846DC40569051CE965625C490AC19E8CEFCB99 eui3_
458,334,673 *2E8D234FD90A2BC9FD4F0B9B85660335E6C81E80 euklidą
458,334,674 *2E8371A3105458ABF5FEAE7913E74964420EE2AE N=]=
458,334,675 *2E893C9D6BB2EFB67256B609982D7BA4129357CF N4D3RS
458,334,676 *2E8148B08BD81D4620F061B38AFBA2FA230EA1CF evegonow3
458,334,677 *2E8B9A814DD895C971FE886EA7622AC54D95B5E8 EVERETTFONSECA
458,334,678 *2E87C7C1EF55898B51DE8247CC3357EC783FB55D EVERYTHING-MUST-DIE
458,334,679 *2E8D84FF01E5478DAE215CBF052E3D73070559CA nathanielbehlen
458,334,680 *2E82068CD126905BBB3E77ED6AB4DBF05FE138FA [email protected]
458,334,681 *2E8C62A3E4CA0A60398FE75F3B5F8393C986027E FAMOUS MOZART MELODIES
458,334,682 *2E8B7A2FE57C8393CEF0F0A2F0036E5D8701722E FASIH-KHATTAK
458,334,683 *2E8B12ECCD739569232283CFA597E15A3B665B90 NED.DODGSON
458,334,684 *2E87DACE3452186F6731941659430EED784B8410 NEDOKZAL2
458,334,685 *2E849DE30C6E28AA67F3947756A509AEB6A5E566 NEGNUNNAPSSGNAGNIE
458,334,686 *2E812839D90F9EC7E8A56861664FAA9E8429F6B0 neuinstallation0
458,334,687 *2E846E0F0ECCF40515E52F97FE784393D0597158 NEWTON.DADDS
458,334,688 *2E80A0BEF580AECF39FCB2053CC2D52F5F6159AB FFRIEDO
458,334,689 *2E889EAD95AAD92A7D96810071855A2F91782836 [email protected]
458,334,690 *2E8347D8A250812A88B817F9A8339160506146E2 [email protected]+IVE
458,334,691 *2E82BA74E23D567498DB140F554141F068CC4C00 flokinstinkt
458,334,692 *2E882E38FA75870CEDDAA3DF838478738FC7967B [email protected]
458,334,693 *2E842A92EE412DD4946F371941543C425B8E0F4F noah-lapointe
458,334,694 *2E80F80357A44902D1D89E2C00112CC485BB7785 NOBLE.CAVERLY
458,334,695 *2E8063AC0FAB24225161FBF77DEA59561AFFF7D5 NODIGERS
458,334,696 *2E8686EA9AA0AF750CA612599D11DEE241DC1EFA norrisurse
458,334,697 *2E8520E3617688254C6B0D3CC0F0F7B1CB8176AB not-enough-gun
458,334,698 *2E899AF3E362180167CB05E97A8FDFC52A2C6A0F novavistaindustriesinc|unitedstates
458,334,699 *2E80BA9D4E0278346D01918AA4161AA65C9647BD NPHALOD
458,334,700 *2E877BE696CB3E68285EBB1F181C04C5F63D179C NRATCHANE
458,334,701 *2E888CA2DB13E71E28F86A26CF1D0BC3F64EABBB ntiallying
458,334,702 *2E803609C6D4A7F3D6FF81BA881D2D805DAEF645 [email protected]
458,334,703 *2E8405C8798B88FF9169335330939A80152C11D5 NUTZUNGSHERAUSGABEANSPRÜCHE
458,334,704 *2E8BDB42D87A8949C5CE22426C88B9DB1159F16F NVLLRNT
458,334,705 *2E8E9106D22712072409B5DAAD5C16EB042BCC1D (>_<)o~0~<====b
458,334,706 *2E802804B26744B0D1F797CE888FEEE641144D93 freemanhatzenbuhler
458,334,707 *2E8661A61AE48B2DC4BEBC16ED1AC4D53A1C254B FREISINNIGDEMOKRATISCHE
458,334,708 *2E80F06A027C64EEE6A36BBB49748D743F1223DB oculistes8
458,334,709 *2E8DAB855864BFBA3FE254390CCFE69D00EAD87B fucked.and.forlorn
458,334,710 *2E8F25CDBB11164C33D2C55ED0F6EE6C90B85A92 OMER.STOUGHTON
458,334,711 *2E8DFA077E465F5CAEDEFB9DDA47BC751C814E6C ONSIDE4
458,334,712 *2E86B73A7A3CCCEC23002A287647444ABB74A6DB )O([email protected]##8
458,334,713 *2E8B12AC4A8B95A058C12D79C47AC2C507A10A62 G23661
458,334,714 *2E8E13122A92EC44F7109CF56685E3D9FEB1F65A G44981
458,334,715 *2E801C8C8081C8ACB4B09B22FED57E0D5CB12D7E gailhren
458,334,716 *2E8E8FB142FE039082CA276E1040169AB6819A0F OQUV
458,334,717 *2E88BB47B22301D91DFB4345810295E9229E1D3D GAMEWINNER07
458,334,718 *2E81BF9485A7157B905708B8CAE1AD4498269D5F GARRET.DALLY
458,334,719 *2E8780EC0781198A348525E555055BD75472351A GARRETT064
458,334,720 *2E8FB61238ABC959807799C37248E3883863254E OUTCATCH
458,334,721 *2E817BFA15EAF0B6F76292E0E8BA1FF015FE22F2 genealex3
458,334,722 *2E82E0C73DB73BEB85106C065B1AD067ACD000AB [email protected]`(~_^)
458,334,723 *2E8269FD81F40E7E56444B91CE8B2E4F6F210267 P0r73ndng
458,334,724 *2E89930378D91B403A2AB18D42204E600B3CA3D9 P##>~0SPLAT!
458,334,725 *2E818057B89C89571321D155C794C539DEA42E6D p41m.pe4c
458,334,726 *2E83FB9A3D6C05E366A631FEA3243FA901D23C6F PARAD0$3$
458,334,727 *2E8AC374C8FBC3CBF95BFAE766F6004E6F2B61EF parisfalsetta
458,334,728 *2E8B051C765A00800DB0365A45256966C1801A35 partita in bflat major, bwv 825: iii. courante
458,334,729 *2E8DFB2EAA381C35EDC56864479AAD27DE021288 GIUSEPPE.RIFAI
458,334,730 *2E84F90F5E9E1B2D1CD5D316BDDAA3770DE2A46B PATRICIACROWNER
458,334,731 *2E89C66CE2663F1D7D74A57F929E2FA564548EFF PATRICIA.RUIZ.CANTU
458,334,732 *2E8725F3FA73DFBC0283A12957B7D4D018296E2D GLENN.BARKHURST
458,334,733 *2E841A51A88271CAD4A3CAEE6BC90A71D3E9A344 PAZTAZA
458,334,734 *2E8BFF973D3A60C2E64E286FF9F8C29297CD9C4B graigconstine
458,334,735 *2E879E467CF9485135D2663838D949FDFDA882E9 GRAURUL
458,334,736 *2E8EC28B0D99F9990CE7D84148F9B01EBDDCE6B8 GROSSZUL
458,334,737 *2E8BEB8A25CA6D34DD4EC21C56DF0B23BFEADF06 [email protected]
458,334,738 *2E87B995C9960515C98DCA871CB3368FE374D553 [email protected]
458,334,739 *2E8346468843D6657FD11AEB47FFB8C684482DDC GUSALBELO
458,334,740 *2E8182F2F7D2183618AD51C260C60044CF90227E gv0{
458,334,741 *2E8556DC0FC9E133A8FBE2C5DE822ECFEDF01851 Hailing-distance
458,334,742 *2E8CCB45F0EF9D6FB8501FBA03FA694865515F13 peterainsworth
458,334,743 *2E87BB00B4206C647A30A3B5206E2430AF15F861 HARHAANTUNUTTA
458,334,744 *2E81D99D27D688ECEEEA0B83FF627B304FFCC85D PHILIP.SCORER
458,334,745 *2E80BCFE2B42330F1F6E71BD8C33F0CFF1CEB25C [email protected]
458,334,746 *2E8C8D3EBF3FDC40139A62B7E47729527E749390 heal (the seperation)
458,334,747 *2E8D9F6002D7E5565B3849BEA715702F70CFB112 PKIAJG
458,334,748 *2E86B71002A3FB318067C59379E04E0E94C670D8 [email protected]
458,334,749 *2E835CE9C503834EC3511342C953EFFCF0356044 HER8BITJAKE
458,334,750 *2E8F167A2183A8B4E126F82A8C1658CE02307E36 POLICEINFORMERSTAPERECORDINGSGIFFORD
458,334,751 *2E86290CCDAAF365EB791FAD0217FEA54A184E32 HERVORTRETENEN
458,334,752 *2E89204CD91F14F87DAA423392C87C3B0F3F14CA hey,wirwoll'ndieeisb
458,334,753 *2E85257043DD4461A117162361CF7B95C119AC35 postezs
458,334,754 *2E87198056582AE3958212F1B7C930667866FAC5 p##p~0 splat
458,334,755 *2E830036D6EABF5488AE49433BDF6EA24E65138C p===p~.`splat!!
458,334,756 *2E8CEB8E0CB3AFCF21BAA374D64172A834A33F77 prahara6
458,334,757 *2E815D2A4116B15255A2B86B6F3E9A85F9B7C198 H.OLDENBERGTHEVINAYA
458,334,758 *2E89790B083EBCCDAF65E450089332667B4D85A4 HORACIOHARDENBURG
458,334,759 *2E82A38F496D81052FBEC8464647A4474A1B1EBB HORNUGLES4
458,334,760 *2E8D561F15B6C774D68A52DE16BBFA761064F00A [email protected]
458,334,761 *2E84DF17F8DAA2F835D1248BDD0AB55C8FE1E5A0 [email protected]
458,334,762 *2E87662962623325E1FDF1D7487248BC82D0256B @PUDUCU
458,334,763 *2E8535FA51D62757BB43149F9FE78F2384658B2F PYROTECHNIKERN
458,334,764 *2E8508353ED0449035B19D8F6E9DDA464AEF4FC1 q~^
458,334,765 *2E8CA6427CC00318C5D002EF8A7DC72516F2156D Q=B ~O ~O SPLAT!
458,334,766 *2E8D6750D460319AD0D2B2114E27DC1935B58790 [email protected]
458,334,767 *2E8A34BB7332B9456E135BFF5468DA71337EB935 qp*splat
458,334,768 *2E8FB7F2EAB5E2D5045246B197A0CE35535FC781 HYONO
458,334,769 *2E830A124662F7AE4FE91174CCFF81EDB25E9A88 IELAJT
458,334,770 *2E8E69C0DAB2DA884B6D91ACBC1424B4D9F5D282 RASE
458,334,771 *2E80380D7C0C52BC1AA1A03879E311E6AD0D7242 RAYMUNDOHART
458,334,772 *2E8D9DF7250695156220970279AB376A387CEF1D IljaPhantom
458,334,773 *2E81C80E223C3FCB624F745182B93D6A9F9AEDAA r?cw
458,334,774 *2E832D529651EF0CDB5965DD1AB4D65B1442CC9F IMBRICAN
458,334,775 *2E83862926612C6F3E7CE6079917D6F1AD6A9272 incense-juniper
458,334,776 *2E8C6A44E26660FECC6C4A9D99B71A4E51A978C1 [email protected]
458,334,777 *2E89C09DBFC96AF6ECBDECC1FC543780C017AEFD REY.LABATT
458,334,778 *2E8B575617A25CC79E6F5E9B6D9A28A3C337D3A6 IRVINARRAMBIDE
458,334,779 *2E86F301BC82B085286DA99FAC3BBFDB7927C81D ISAIAHQUIRAM
458,334,780 *2E862EEF663C6ADD58162F1405BC859530A4659F [email protected]
458,334,781 *2E8AE009AF984CE7D483C5BD386DFCE3090D0DF7 RICKYALTIER
458,334,782 *2E84F8DCA77A71448C7B3683015A36790DA7FCA4 RICYCLER
458,334,783 *2E844F4DF3A2D21E2104EA76DEACE94606DDF11E right-on-(feat.-lou
458,334,784 *2E80C461636BC736C385D1BB0B2D58CCD8972C0F RKENISENED
458,334,785 *2E8167A6CFD24A9D35DAB00B9FBA17ABCBE3CBC6 ivdfmquh86
458,334,786 *2E801B922309F0FAA4DBF5123FE9F810F3475D32 ROBERTHENRICKSEN
458,334,787 *2E8C6B12037654C5D2D61FE1C67F407825363105 rockycallabrass
458,334,788 *2E8F67FC234564BE033E81D37AB567D0A723D181 JAIPUTRI
458,334,789 *2E8B9F71EEE3CD0C0A7CFA286B4F90A1872BA4BD JANISHARDY
458,334,790 *2E8DB935C12FC7CDD49D6906896382BC9E132F0E jarrettminge
458,334,791 *2E842C526305D96FB0A1E16E0152007931861E2C RootDown(videoversion)
458,334,792 *2E8014CE372D4A28599AF9B1385DD96A709E6103 roscoestoeffler
458,334,793 *2E8836A7875315312978EE524D77A85C947DE7AD JCOMPEDIO
458,334,794 *2E85AA8ADC4D40F505EC8C199C639B4C983BF2B9 roycebellaire
458,334,795 *2E8BEC689640776DE7A59E2DB98716C99B8D0FC3 JD9L
458,334,796 *2E8A8653BE9541C90781DF1357B95EDD1F0959B0 runner(rom、5
458,334,797 *2E8C1B8AE2FC072CCD829BABF18E327FC0776BCB RYK%
458,334,798 *2E836A14E688C1CD8C34374852B80621CBB2CFD6 SACKETTBSW1
458,334,799 *2E8594D17A37DC0E4B07872C92A883E921AD0FCD SAKSHAMA.I
458,334,800 *2E80C91C996F58A9E769BD40219375D68E23FB74 SALLYANNE
458,334,801 *2E8050F01F13BFE4A5643FB6D46A3676CF3D538F [email protected]
458,334,802 *2E8AC737D01BC2F76BE722235479CE764F264A53 [email protected]
458,334,803 *2E8836EAE14CFBD0C589F20D6918A9C05C7E951F jlinksigma
458,334,804 *2E88F4D2F8278FAB9754CCBC5A3086C1A573D659 jodysutter
458,334,805 *2E8CCAF106A03CBA4332BD317E361F21FD9CB66D [email protected]
458,334,806 *2E8675FFDEC243838DB4DB0232A8C0E50F437C8A sandyhollamon
458,334,807 *2E87911462A6503DAECFBF3D69F486B72AF65619 SANFORDFARRIOR
458,334,808 *2E8BD84F65A7579B50B51EC16DC0083EE7CAD2AF JOEYJAZZ5
458,334,809 *2E8C09D261AB3227A963772B540A7865F6D1D0E8 JOHNDENNIS
458,334,810 *2E8DD0C543F0B9E582DD58351A4B14D44CB1C793 JOHNSONGRISSO
458,334,811 *2E8624B4EC4C833978104EC597C6E415E9C4784E SATIIRISIA6
458,334,812 *2E83763FCE3414AE73F05C78F4F33B03969D0E09 sayidna
458,334,813 *2E89AEF1D6745ADF3C61F83FCAFA42771564617A joyce.lamond
458,334,814 *2E89B3BE4A0C0505A94DB8EF20AF110FA55BBC69 SCHICAGO
458,334,815 *2E80E275C0E3FDAA86528F6C461E4FD083F70B5D SCMJPK
458,334,816 *2E8F24252B48BABA847ACC8AD2F51418B32FB653 JULIUSHITSMAN
458,334,817 *2E84F1A789D297F950FDFADF666A21BC2F19BCE0 JUNEBEACH
458,334,818 *2E88984D2F41EBFF85EA123AD766D8CA2BB80E96 SEANCES
458,334,819 *2E8170C3CB38FE3DE7423F7646BDF4A5E3E4E205 k}?5
458,334,820 *2E858A12412D21C1E56690B25E31C5EACBECF42C SENIMRE3
458,334,821 *2E891E7C0B179F8D2BF85C9449079D9EF971108D KELVIN.RENDINO
458,334,822 *2E8D10649DE6A6CB6506E948AB56FD08EFA4F9A2 KENETH.CORYELL
458,334,823 *2E81E4F08CA170BE4AF8F9B8D81014EEB5F37494 sharpei167
458,334,824 *2E855BA1B5343CD9276988C7789673DA7D39330D KENTCARLSTROM
458,334,825 *2E80FC79FC691F9ACBB9D7C0A6C5DD160F4113E4 KENVEYBBS
458,334,826 *2E86A5522C5F411E74F180356A0638A9D0D3AA13 SHIRITIZ
458,334,827 *2E87ECC4CCDB56AF4508BFF70895E75DA041C709 KIND.REGARDS
458,334,828 *2E8512DC175F731D127894C3FB139E5DECE59860 kirbykemp
458,334,829 *2E84811A56B0970603C9BD16E75659AAB700690E kirtibawa
458,334,830 *2E8A54C87591623DB4E4E4F17979FE62A603EDC2 KORYBRENGLE
458,334,831 *2E88D5454EAC486781FB7D3CCCCD4209A75B1ABB [email protected]
458,334,832 *2E87142FBAAD9AD47607AB27EC32F9555634A69C KRITHIKA.RAM
458,334,833 *2E8C48B9ED38E92A5F3927C5A530987431146106 [email protected]
458,334,834 *2E8BE455A76CE2FA9200E0846CAF4CFF4BCCE4EF KUNSTNERE4
458,334,835 *2E884148DE6ADDBD04F64881A53132DAC766C92C lacymezydlo
458,334,836 *2E8300A7C8848D8EE9DD62AE13530B72E390BDC8 LANCE.CERVIN
458,334,837 *2E85260B6989593DBB9149DBA0FDD4995A29A171 LANDINGSPUNKT9
458,334,838 *2E8400E6FBB0FE0496C636F2713BF8423440A43D langzaammijnhoofd
458,334,839 *2E8705FB4742113CA9BACDE6484C159E9758EF57 LATERES6
458,334,840 *2E8CEF67AF1E5484F59B4B7996F4D9440E3BFFB5 laurenedinger
458,334,841 *2E87E7F3A72CF8ABE8599DC60443734D7B998C06 LAWERENCE.COLPETZER
458,334,842 *2E8D070884D2E622A5C338F2990708FC19934E44 LAWRENCE.BESTE
458,334,843 *2E83891AFEB9F3D12EBA343F88AD5D3B64215182 SOTAGILBOS
458,334,844 *2E892FA5A8C4C04BBAB41BB938F3930F764B2C16 SOZIALPOLITIK1
458,334,845 *2E8FD7CC7326ACD8DE9038072FE10342546E4132 [email protected]
458,334,846 *2E8B6E747BD1BB26483F66B347485653871BBD24 special1910
458,334,847 *2E8EDD16C13060B8394D6D3AF16BDDD0B857D04B SPENCERGREGERSEN
458,334,848 *2E89B7BEBD2A499606818479BB0F49B6E8CC57FF L'ENFANT ASSASSIN DES MOUCHES
458,334,849 *2E8CC2B4FE4EB8D104839591D6258C7000B0AB58 Splato~-0~-<===3
458,334,850 *2E817B0D14C32167283FB962CFBD5959AE186E91 SPOOKYHAMSTER5
458,334,851 *2E8CAFDDC781C630F284F17E06F10EA1EA0DF382 SQHF580H
458,334,852 *2E87D7303B050140E1D35ADBEB7217FC847B8ED7 SSOFJAL
458,334,853 *2E8F896039CEC253EE8D12F5436CA450511278A7 sta8!l!zat!0n
458,334,854 *2E896A89E2EE315E3490AE636F53641B54617B33 lithologic5
458,334,855 *2E878D95BBFD599A61EF05736F633E85A5614471 LOV3NS
458,334,856 *2E8CA4A9F49698469D6246ECEA92ABAD72CC09C5 stilloutcold
458,334,857 *2E847A9157A84D54595892D52ED873FEF240F0EE STRAFPLASE3
458,334,858 *2E8BAF81D25DBD0F7589E6D805DE632F2CCFCA1B LUCREID
458,334,859 *2E8E2517C11FC8681F9D6E466AADB37715560959 LULU'SMYDARLING/HOLLERINGINANAUTOMOBILE
458,334,860 *2E86884EC315E8E64F26B7CC7E2AB832947F4457 luvin.barcelon
458,334,861 *2E80D889FB0432B9F595C25811FC29507DE3006D M0STR4VI
458,334,862 *2E8178C35DF9735D42D90102C646EF40BAE3B111 SUDORE5
458,334,863 *2E874FFFC946F6EE70D5FD202B295E70ECE90DF7 suhT..spets.}46{^2.naht.ssel.ni.derevocer.eb.dluoc.yek.eht
458,334,864 *2E8DA616B949D62877EA8E0FD66A6FF03DF193D9 malcolmbowlan
458,334,865 *2E81397CC0CB2A635B061F81A2F8829DDA0F34A8 malibumarilyn
458,334,866 *2E8F68B6A1B1B04DB2531C91E6BB64126A3779FC SUPRA1OCA11Y
458,334,867 *2E890E6A7359177CC3394239FEC0698513545E4E MANSUESCO
458,334,868 *2E865A4E00C9218546728E641556931069BE58BB MARCEL.REITMAN
458,334,869 *2E85EBD7CCE0145B55F1AEBEAD3CA65EF192C781 MARCUS.MARCIN
458,334,870 *2E878CCF38558C3DB3595240647C2734B33FB232 SWROBERTS
458,334,871 *2E8F37EE0EB34122D3AD7DBB14A94CAE18B74DDB [email protected]
458,334,872 *2E8C6E077266211B8C41B3A900482938917E5CE3 SYMBOLKARENS
458,334,873 *2E8378D0A5BB4994B76ED383F3A2DB325E9F66EA SYMBOLS-OF-SOLAR-MIGHT
458,334,874 *2E865DF86D257BE470BA6E2F7431155C21A099C5 T011G4T5
458,334,875 *2E89290168C31ADA1D68263BFFC5444F8DA996B8 TABLETTENK
458,334,876 *2E8F463B1A37D71B985966FCE4506E36EA85AE60 marlintrevillion
458,334,877 *2E872AED57309EFC7714384E236EDE8AFBB0C0C4 "take-her-to-sea,-mr-murdoch"
458,334,878 *2E81599960A00B07910648DE0C64B68B9C86BCE2 MATEWAY
458,334,879 *2E86937B5D9F8CB81FC035DB08B9E3DD0728F0B3 TALK99.224.205.8
458,334,880 *2E8C70735E3C31BD0058B5B0E2219F61BC301074 TALKLOOSKUH
458,334,881 *2E8B19C33BEF245D0F761BB2DB3533EAA339EF77 tammybelcher
458,334,882 *2E8822B6403F04462F9F624665BA7919E4F6494E [email protected]
458,334,883 *2E8F70331AAAB3F9FA761084A58FF84B780A3C83 TARKOITUKSEKS8
458,334,884 *2E8D0E45849A5EF6B7B2F22F022EE68258CB75B8 TAUBFREI2
458,334,885 *2E81DC4373AEF4E70F0BCBF89EA59C1527558AEB mechanically-aided
458,334,886 *2E89076907BE613C478702491D20BBC2F6490FC0 [email protected]
458,334,887 *2E8145A025ABFB9CD6047FF9A4A0511AF1C2372C [email protected]
458,334,888 *2E83C5F5CFD62DE136AC8F64E2E5291249036FBD METDEMONDVOLTANDENSTAAN
458,334,889 *2E80075E9B0D34FFA83FC8189FBF1DE05DE1D63E TERRANCE.BOOTHROYD
458,334,890 *2E82F630C27FF004146F1ACB5C469C144C7D4D80 TERRYABCDEF
458,334,891 *2E87361B91C1D27996088C2A614C6363CAB24D1C michalallor
458,334,892 *2E8F59D69C5B6E39844899854133EC26614D70E6 MIELMEIB
458,334,893 *2E843B939051D4257D4F7EF524194D9F4BD4453C THATLESTAT98
458,334,894 *2E85653D8861EAE686297338D7816361B1E863D9 THATWASBUTHISFANCY4
458,334,895 *2E8C84B465FB5201337FA82C9DD33055706C0519 mima.mami
458,334,896 *2E8FDF2E4D3E371DD03085FB8CD30B4518E0CFA7 the bookleggers / after the flame deluge
458,334,897 *2E8803894E1EF0D420F9A8999F05FD4F835D7D35 THE HOUSE PLANT EXPERT
458,334,898 *2E8375D307E95C831DF3A196655712D4DD413BA3 minoufrancis
458,334,899 *2E8F46DEBA36421A1BE7DBF865FC639755BF4FBA THETAMMY08
458,334,900 *2E8729069234D8C30F2B142ABA05D46EA6DB37CD THRSSTRX
458,334,901 *2E8FC56C198ECB7F66FCF15C672C1A295A5E574F MOHAMMEDBANTILLAN
458,334,902 *2E8CDDF04A67878D79BD90809E0908F76236EB46 MOISESPECKHAM
458,334,903 *2E8120735878B29C15EEB1421C62BFF93A8B7E83 TIMBERCUTTING123
458,334,904 *2E856F0FDD1234ECD991AC0B7DD46CD883D47A6F Tir3.pr3s
458,334,905 *2E8EDFC4AAFCA99DF817069054834C7C6D505C69 TMONEYLALA
458,334,906 *2E8D5FAEACF8B0D48A631CA6A6BDE78700B6E109 TOMAS.BINTZ
458,334,907 *2E857973486A3FFA692C710676E0545A3136BC5A TOMCATANIMAL5
458,334,908 *2E8F6063675FE8F20A3F5EF8125B02DA7D1DAFFE [email protected]$T3RMINDIN9
458,334,909 *2E81C1A17C2055EBFCD49CF9DCFBCFAFADD31EE8 MURRAYCROMBIE
458,334,910 *2E85624A32B1FE0AA5B320884CCBBF70A1F2C184 MUZIK(
458,334,911 *2E81D91D86878E8E832725DAECD64BF6B5DCB81B TRACINGTEA
458,334,912 *2E866B0951DE9A65B3C4AB2BF0B648ED7E84E7F6 nadim.najjar
458,334,913 *2E84708068BA4239D592AB251E24906D41BA3B0C TRESA ALEXANDRA
458,334,914 *2E85B4743716DD216C59B6A32C7F3B8666E5210F trevon-padayachee
458,334,915 *2E8214D69B11C9BA4CDA7436A1B3A7EB0EA75D69 NBOURZIKAS
458,334,916 *2E8C204DE30041563A3079F6BC8088C56FC8EA1B ncubes
458,334,917 *2E8684535AE7E1BFCDA182A16E97DE5F6F41F7E7 NEDNATSLITSENNOZ
458,334,918 *2E85E6639FA508F1B2A1B94A48276D55F87A4650 neilllena
458,334,919 *2E87E2528D13FDCCDA97E707CEEBF6A7822A64B0 NGNRBNNNB
458,334,920 *2E8C985AC30A449B9D852C8C7AE08DF60D0B74FE NIAOACA7
458,334,921 *2E8BE03165BC783CD7EBA8BDED041C4DA54D7D80 twelvefold3
458,334,922 *2E8C83C261C3C7410F2970D7351BEB31B9D45D19 NICKOLAS.TWOHEY
458,334,923 *2E8132E856FE932CB8D8F5415735D62CE997AA20 NIUBORN6
458,334,924 *2E8B128AFE496123F1422A4B1A655EBE32EEA37D nnprjctv5
458,334,925 *2E84AB12EE69C1491092B7CD080EA7AA569DBCC3 no.goodbyes.no.regrets
458,334,926 *2E89AF35CAD304F8210AA857BC411AC5642A9821 NOHEME
458,334,927 *2E8756481A811471343EF287F98870168F734CC3 TWINVALVE
458,334,928 *2E887EE2827978B1A226C1DCC761E7E675C1419E TYRON.TOMASIC
458,334,929 *2E81CB738608D86F5E0F71D2C70E4B3C3CD13C27 U1UMIUS3R
458,334,930 *2E87D278F030B581D945BABD8F75925B7D285175 UBER.HIMMEL
458,334,931 *2E88C12B55F65DC5B226F2D17CFD9EE00278A928 NTRDBTD9
458,334,932 *2E834004AD3A25663A1E8488AD143A727C612E19 o!4b
458,334,933 *2E8079845BAEA2BE6AA64D0750E7838EF7EDA4A6 OBIWAZIBEN
458,334,934 *2E8A7CB6D1CBF0E56F2E78BAD14B96A6D87A7B33 [email protected]
458,334,935 *2E8F2EBB2881806913A8556F21E28F233B289E39 unhesitatingness
458,334,936 *2E8F4989D82FCBCC2F4063EBD4BAE382F7D8ABAF OLIVERFOLLICK
458,334,937 *2E80FA0BB72550E2CDEBA9ECBCC46D310F580D44 OMEHTO
458,334,938 *2E82EF93DC98EFA7CF60F0DF67661F26E75CC3C7 ÖMLEITUNGSSIGGE
458,334,939 *2E85C06EDD2673D6B02410715813D2AF7B1E8300 usiamoses
458,334,940 *2E83C95B413FA2C3D0D42AC715E8F535274D1CAF }o{o~ @3
458,334,941 *2E85B4EB43D34C7E7145DEEEDE2EBF73D2513715 UU~-~q------3
458,334,942 *2E8D262521B2360D40DA6362D2A5F7C92448C038 }o{ * <p
458,334,943 *2E8DFC0EB9861D964947001177A4E2A16FB04945 VALENTINKEVIN4
458,334,944 *2E82851DBA963DDB4E9A5C267822743F97411ECD O->-<Q=====Q
458,334,945 *2E8B66BD40FEC68BBBF9BFB2C17E212905B1EDF3 VAL.FERRANTO
458,334,946 *2E87B82B5EE5DEAA31FB13E21694B4C34B34FC17 VALTOHMEH
458,334,947 *2E8ACE62BF847A4656F2271C50C0732FA5DAB41F oscarbassiti
458,334,948 *2E89D519A345D6F64DCB38B5711D538E6C260404 vanessatrenche
458,334,949 *2E8B3B7775A9BBDE3E567D8BE944609CEC08A5BA vanthiesse
458,334,950 *2E8465E8BCFCD2A309ECC08D6965D71057A582FD VARADHAVISWANATH
458,334,951 *2E827BF86C878115F513DD797884167C9359C953 othagolar
458,334,952 *2E8421DB4051794B1939FEB6FD5EA435167E8CFE OTIATOR
458,334,953 *2E8436BE1E2F8A31B74CDBA95D9813B60D3E59F9 VASSMAGASIN
458,334,954 *2E88C633360D833C23D20007FE9043D40483D492 OUTSPOKENCLLRNEWCITYMAYOR
458,334,955 *2E8F49EB924E6E706CC29BD78E9470485C61E36C p##@.`(00)
458,334,956 *2E8C464A1AEF975D116D79E095EDB7CF4AD7DB8A pàginal
458,334,957 *2E87AE68375B4F0278665B5284C1682E548C1508 PAINOFSALVATION-BEOSP
458,334,958 *2E8994EDE57ADAC715593ADD724D7D1939BF44FF [email protected]
458,334,959 *2E892157B9D6ECB3759DD7A32F8984EEB0977974 PANTHER-BATTALION
458,334,960 *2E86AE299F28F04FB4C2EC998B85129E7874AB08 PARICIËR
458,334,961 *2E84E6016AA9BCB8C1ACD420AE504AC681821986 VIDEOISAAC1
458,334,962 *2E8052B07F3A3FA8C62D0A01BA6DAB41A89D5858 PARIS.CAPOSSELA
458,334,963 *2E85E787863D51B67AA5ED8B7C0735886B49B04D VIKKICARIK
458,334,964 *2E8AF440C91654768C9F283ADB2BC63A363A3506 PATIRCK-NONES
458,334,965 *2E807B10E98952223B4795C291E9FE05FB1A8101 PAUL.POORT
458,334,966 *2E82A11A379F31075241EAD604BE909DDB236D06 VINOLIA.YEVUGAH
458,334,967 *2E858BD9FFAEC588EE1D34CFBBCA9B759CCD3634 P------B.~0~O.SPLAT!!
458,334,968 *2E8568ED9974D52776CA5F6D6E6892EC347310C4 virgiliocarneiro
458,334,969 *2E8542308FEB43C7E08A5BFDE44491517A449ED1 VLAD.KORNEYS
458,334,970 *2E8ED8E8FA2EFF87FC2AC086A10D609F437088EE VNLLBMNING
458,334,971 *2E854E1DFCF546DD95AA7A7534914B1D6A31151B voudronses
458,334,972 *2E885E6E7B215813DBEDFC4E7E2C44573295A2FB V~UK
458,334,973 *2E89A3E73E79DCBD51221BDC593C6369CB624699 W4TCH.B31
458,334,974 *2E856CFD377C522CEDF20F7275437B3FFF57E966 photosur6
458,334,975 *2E8AFD50FF66C73253EB66EE5756F94D5E5A64A7 WALLACE-PAUL-HUNT
458,334,976 *2E8B07526C5A06BD175C73B7F3AE80E83802BE26 WALLYCLIVE
458,334,977 *2E85623B212E877649984C004C177C59945670CE WALTZ IN A-FLAT
458,334,978 *2E8D9C7EC0DDF342E648D6F88492B5E453AF29B1 pilar.saldana
458,334,979 *2E8971196F78938F2C3A5A598C9B9E5D03B17617 wandamariaribeirofurtadotavaresdevasconcelos
458,334,980 *2E89F2CD7E3FDD478CDF36A2E1A764EF15590EA2 POPPAMIES-VUOTAVANOKKA
458,334,981 *2E8118147EADCFF85E6A9FA6616BE0B4BAB8CCED [email protected]
458,334,982 *2E8DB1E19869C846C617BD0390B3FF842805C8DA WENKEN“
458,334,983 *2E815D1A7DFBF6B06F1B3A0CD5AF8456F54B3B26 westbromwichwestconstituency
458,334,984 *2E8775195AF7D33C2321A2B270EEFF8CFB8132DA widerstandskombinationen
458,334,985 *2E88FF593E91E45158F9E07F1481E30F3C533524 Prudentes
458,334,986 *2E872BA46F5BB5467BBA79495DC87EC8AA2AC81A [email protected]
458,334,987 *2E8950463C65D7286964B8517DD7618DB964034D [email protected]
458,334,988 *2E81D814AB64FD6E6701B02ABDFEAA910FC164F1 WOLLIPNI
458,334,989 *2E8BAB0E2BBA8CEB49D1B53AC56E4274601AB15A q======b-`~-(0_<)
458,334,990 *2E8B193150B22940A3DC5F8536DAD5CDC1B354D8 WORD-OT-1
458,334,991 *2E877A45584189258F7C6FB1BB13FCE997A64500 WORTHBSW2
458,334,992 *2E8539B7179C9BD5D7006917E3C4B965D8B9863A [email protected]
458,334,993 *2E8952299C08A4DF914285A2B1610D4817F73B28 WUROBERTY
458,334,994 *2E824F581004A374ECB8EF70622ED569055EA7A1 QRK;
458,334,995 *2E8741DF56A310F682672AB7BD85A3C81CCE7335 Que7s7s
458,334,996 *2E8BED370C8C7EF1EC86F2D213E6B3DA33E4301A quentinderry
458,334,997 *2E88F39BC3EF11EB4A583BF74AE0F1BAF093DE63 XCREATEBITMAPFROMDATABSW4
458,334,998 *2E80377B8CB1C0A67825A5ECDCCDF0FB8B27E793 x?e
458,334,999 *2E8315F194E3EB8B16F1B88FF53AFE5C77B40827 [email protected]
458,335,000 *2E83ACB8458DC29A416A7A2B55C7C830A0853B03 XMANSURF2
458,335,001 *2E85305EF3722D1C62AC0A1417EBC7DEC929B96F xu^h
458,335,002 *2E84AB2B73BF28D49CE77914F8793453F4030BE6 [email protected]
458,335,003 *2E8B2C011A4EE410E09AD307A084FF700C6E8F97 yadnum
458,335,004 *2E8B2483CAB0CE58BB1DAFA553C177F91B785778 RECOMPLY
458,335,005 *2E8017C8F76A8F058A7F5C9E549AAD6CE6455DDA REDNALYK7
458,335,006 *2E87161D6602DF9740B75F134036369237ECF435 YOVAN-ARAFAH-MARI
458,335,007 *2E822531F772CD497895E43418AB49961D1149BF YUC1383
458,335,008 *2E8F91EA81D3EE357533BD8720A45E43167DC1A1 yuktasya3
458,335,009 *2E83B7945CB818A54E12E200D92D623B0141F4F1 ZAKARIARAKIB
458,335,010 *2E8E9C0B692C03074927F5A76D5F81FD36148343 [email protected]
458,335,011 *2E8679591EA8D81603B915E62D04F42F4CE34A7A REPOT123
458,335,012 *2E8AE829A2652945483B89671E916DCD6706C950 Zebra.crossing
458,335,013 *2E85891CB80632E9E00C1AADE614035155C95831 [email protected]
458,335,014 *2E89B616857D90DE9AA1FCACC821261FCC0FC562 [email protected]
458,335,015 *2E80DEF19A266EDC72130647DBA5053258AF0B84 RHETTGEDERMAN
458,335,016 *2E8676C69E4B863B497F9C37B519BEF8A4E1772D [email protected]
458,335,017 *2E8A024F882474DB4111638811D042B578E9498A ZIVECZ1234
458,335,018 *2E8AA3042CE1658A72800397591357D56F3B71E1 ZL)'
458,335,019 *2E87C5BA2711C9B61E13072F55DF550CBC779E26 τραυματισμένοι
458,335,020 *2E8C9EEEEDA72464E02A74FF91DB1BA881E57B6F ROBINMUFFIN2
458,335,021 *2E8F206372E4931D4C5DCB9F07992A513BABDA14 гьотигенския
458,335,022 *2E88A4EF54A7F412798D07FC9B2A19DF0395F66C RODRICK.VANIS
458,335,023 *2E86A899FC1F9FECA3E04B396DEB65EF3D69F74E ROGAGTRO1
458,335,024 *2E888F06AE1C4035AB35CDF7BD5F267563895EA4 ROMAGER0
458,335,025 *2E840FC58B5EB2A4DA5EE2C347A6A27225624FEC МЕРГБАХ
458,335,026 *2E8C2FD413AA3F9E06962B16CBBBC0393427F4AD ROSEBUDDIGITAL9
458,335,027 *2E8D5FE7B8F69A03CE51B71E62DAAA6F841D040E ROYBODON
458,335,028 *2E8FFFD465D6F340F12F95C27375B8544C217959 RPMIMGWL0
458,335,029 *2E8B82A7056E7C941F8E49E17FDCC8A3DD2F5AF6 телеграфною
458,335,030 *2E805ED0C953E16684CFC0E6BAAF782BA5D4F7BA ryker..r.ay1.k.er0
458,335,031 *2E8D7DD6F842A8DB39AC616D8AE5AB192A2DB294 [email protected]
458,335,032 *2E8CF97498E8B474C617EFF126A5F07C4A8B08B0 « yvette
458,335,033 *2E8E9D56D1DE730CD49B3CECA2BA4A9F97144753 sad-on-sundays
458,335,034 *2E81D0B762DDD3C8236D8703E058AAEDD910EE8F Sammensaetter
458,335,035 *2E829D74BCD12AEC7ED3C1F9577EAAC633226914 SCINTIGRAM
458,335,036 *2E89F8BF61BCED3B189D54EA9E9B2AC1C67305C2 SDEIPSUOS6
458,335,037 *2E811ED3211D6C5AE95C80312F3F69635D46A50F sdmoynihan
458,335,038 *2E8B61EF5A97D75D8F5BAF8FCFB2D798C2CD36E5 SEANFRANK8
458,335,039 *2E813491426B4042A4623EC995D7E8B5637CCDCA [email protected]
458,335,040 *2E85435ACC3916FB51E51A8A51584D848A280D14 SELECCION DE FUTBOL PLAYA DE URUGUAY
458,335,041 *2E8180508FFC2233B7380236C91401DA0E2234B1 seperatiouns
458,335,042 *2E856372E998733B46BBC78C076E8C217B73611D SEYMOUR.REIGHLEY
458,335,043 *2E8434B4A4519F7117681C334660F9BA19A068F7 SGFEDCBA1
458,335,044 *2E8A51B1C02D35F7D72B19CA3387E2CDCB2D349C shanedute
458,335,045 *2E8A413AFEF292E32B30DE14D36943B0355EB6D0 shaunbareilles
458,335,046 *2E84D4173644366883D9E3A6E1EC2BABE9AEE4C6 SHAYNELEICH
458,335,047 *2E8622AC6083E99EA5E60515C8C1B8AE2CB77C3F sh.chi
458,335,048 *2E8668330642847C5D0E7F34CEA931C952CDCBC0 SHELBY.VALDERRAMA
458,335,049 *2E8FDE0370F13B4B4341A0445416409375F0C990 shellsalso
458,335,050 *2E8742A760107CDBF6E7D3DC0CD55BE69BFB5375 SHERIFSHIKOO
458,335,051 *2E8FC6DA42AA40B6891A08E0D95528922B2275F7 SLINKY29
458,335,052 *2E8C9A062917E8423A3801B793E5943887C726FA 01569109
458,335,053 *2E827A060B61C3E45A8B4ADF4E3C5585C6A83A87 111(1両)
458,335,054 *2E80EB2F8D7F6ADE202CF1AC533A83DDDA00D5DA 11.29.1323
458,335,055 *2E8434326EC39360DDF8A2DDD5DF0486BFA5B0CC 118º9
458,335,056 *2E801D9F65BC872CCCBB214B61728CBF1CA70A78 1262083 ozon : vielleicht eines tages .
458,335,057 *2E87EB2E9828E0B4EB2E0F2CCF9C2283809E7F0A 13-05-1111
458,335,058 *2E86F50D880433D7A9E4ECB4489F8EE203E66939 1365035 temple am sonntagvormittag .
458,335,059 *2E89E91D1B20114E3A41EEEB78D2C95D2F5D8872 13 abschlusstag
458,335,060 *2E84B84FBAEFD54EE74414863523F6BC1A84276E 146emmy
458,335,061 *2E8A3143759358D1C05D2963E3E5EFCE34132232 ۱۵۵۱۲۷
458,335,062 *2E8748C572564BAF771E4ED77FB3C7702F6F48DA 1587a1
458,335,063 *2E8F3248D60288C191B85865C4A08FECE5B24A71 16,6,98
458,335,064 *2E862D49C10F07465052B5EE44B22D70062688A4 STERLING.TICE
458,335,065 *2E8E782A29768992ABC4D3B67AA2BD4AB193C086 1686DENN
458,335,066 *2E8272BAFD6FD2B951AA8E7BC8FD06A7EB4C0872 [email protected]
458,335,067 *2E8AA28A87738DE7CE46A5BF563D6A843B649C72 178227D
458,335,068 *2E8DCA01DD6855D011CCCB0CAE4D09DC1B7EBA8F 17 interessensausgleich
458,335,069 *2E8314A84B912B4AD286A2D76A4E518579B136CE 1850—and
458,335,070 *2E8E963BF2B8907DA4C43499DD685424910DBB17 1874年) パルマ公子・
458,335,071 *2E878EF27C10F7D0B7EF6C6C8D82DCFE8CF4A232 1972年には小澤征爾とともに
458,335,072 *2E86E44346DB140C835F9EE27A5F31B4428BD57D 1992a
458,335,073 *2E88454BC936316F1FE44B822208563EB9B397F3 19apr1292
458,335,074 *2E861B8D34537A9A38EDFAFF5C197CA5BB48D2E6 1arajtutr
458,335,075 *2E8407C6D9D769B2FECF270AF54C19BC0B935F6C 1botevona
458,335,076 *2E8F641A9C0ADC0F988CEEABB340CF933C2B302C 1 christennamen
458,335,077 *2E8931D403C492EC8B8FE6184D5188F0A7931ADC 1 dakota-and
458,335,078 *2E8C722B7F25330E943C40EB22281F82E718E332 1 empower-palvelukonsernia
458,335,079 *2E8926F0E98090ED4B762177222304EB15404DF2 1ernuerez
458,335,080 *2E8E7C18EB51A2A9C1C5EDA22EA6733AB63D550E 1fredlinda
458,335,081 *2E898F162EE3A131287CCBDDB0D27ABB5653778A 1 giga-haart
458,335,082 *2E89D22CA7E95EEF29157CB056EFF6FC2330DF1E 1guilcher123
458,335,083 *2E831ADD9B54071F84A07E0E8F093CCD8CC9DD22 1 kilitleyicileri
458,335,084 *2E89017421588D5B3A2A9D7067828FE01A63CC9D 1koshiana
458,335,085 *2E8B9BDD09EB9CDA759DE4062AB507B98412F8AB 1kpfnuc1
458,335,086 *2E8B3A9DE6366F3845EE46BD7616B119176885AC 1mitsprec
458,335,087 *2E8426A8DAB34EA8158E7C268D086B6A26244168 TALKLOUISBOURQUE
458,335,088 *2E8923B629718FFD5EC96AD0344C43828D76DC15 1MP3R5ONA73D
458,335,089 *2E8764639F48DE6DCF7EA8DB85BEF76F237FFF88 1NORMOVOLEMIK
458,335,090 *2E8B6262182FD1398E51B468AFFBD4CA559B5DEE 1 nosotros
458,335,091 *2E86BB07D9006158603CBF896F10E2B77C00C8AE 1 pds-wahlbuero
458,335,092 *2E8C39AC86146FCF407F65BE8561599E8C5710E7 1 rakennusklusterinvisio
458,335,093 *2E877F0CD0572FA455A39FEA098535D6D6913FBC 1redavrep
458,335,094 *2E8F8747A8404758B26C0ADEF9F92FADB669EAF6 1reflex
458,335,095 *2E8E99AFE17CB71CCA42CD6693EDC4D7A36DE14D 1sakahar
458,335,096 *2E870C342CDFCD990CE2A03C8CCD53FE9300B921 1sanjosegolfing
458,335,097 *2E8BDF82F9DBC43C1226887F3AAB11BD7E97BBAC 1 schlussjuliessen
458,335,098 *2E865F516826BAB0E7C4800B076341655520AB5E 1 sitolitik
458,335,099 *2E8725CFC8242220F0F93CEF456E9BB638FCFB96 1 sonnendistanz
458,335,100 *2E8CFAEEA134DC7FBDD1C2D8F642ED670F8FDB25 1spretus
458,335,101 *2E87559A3E13BC71E8829805A374584E5FFB8693 [email protected]
458,335,102 *2E85B6EEF0F376424FC6159F4FFCA3FD3621E5C0 1 valtios
458,335,103 *2E8AB9D3D3B7E8DEE41CD0B2CC52E6922C51357B 1 veroetuisuuksia
458,335,104 *2E8C06B28590C350562F3CDEDE08CD03360298B5 1 viinipulloarvonnassa
458,335,105 *2E809886EAEE090DA550CE7761A82881E9282A91 21 05 1183
458,335,106 *2E841588F9FDF5174EA8023A8D8505CD360848C2 21 hauptprobe
458,335,107 *2E8B7A27A1F9EF35C5AEE497C1C465EBFD306051 225a0
458,335,108 *2E800FC3FA82783365B204AF0421F0089BC617A0 22goplan
458,335,109 *2E8086352F6B2D7716D6BBB511C2A642A04C3C4A 29 02 1220
458,335,110 *2E83775144C6B446C76102B9FD83DC921D50FE8E 29 luottamusindikaattori
458,335,111 *2E8459A6560014920CAE404F71C7CB46939D970E 2aboutup
458,335,112 *2E8FDE7ECF0B6C2FC66FFB3012B5351207272902 2 alkoholinkulutusta
458,335,113 *2E887CCF35FF4F2EB090EB57EB5DD2AB50123245 2Kopek1949
458,335,114 *2E8524DA64550F1F0D21F58D4BB9D98BFBE2DE16 2mijtersteden
458,335,115 *2E8BC21E58DE22D1DDB1A490125015E0823FC1AE 2sulanne
458,335,116 *2E8A321EDB5BD71B40CF11D1E4E2AD7CE7D914F4 2sverker
458,335,117 *2E84EC4CB9AA58C915EBDB54158615625206D4B3 2VENUS0
458,335,118 *2E81E645440C21C66A80999E0F205A7A2F7F2F4B 30،0
458,335,119 *2E85D2102FDEC8F15AB1F2D02D7DC177FA6E1FA1 311inla
458,335,120 *2E85ACBC5E51091D8899B338985B3C1849EEC9F1 390Aubrie
458,335,121 *2E8F34E57E8BF6AF97B27A9F37C3715C994EBA1C 3abegale
458,335,122 *2E82252E59731C6B5A61EDFB7BD9EA7E550F82F2 3agissaie
458,335,123 *2E8EE3DE3B14252B3740B73DD0979FCD0E7EDF42 3ajajanai
458,335,124 *2E801A31632EC13365EC9EE156F4ACE65818CD18 3Barry1
458,335,125 *2E88ABB7A175BB782BF9BBEFF5F9F6D4C2C02C19 3nnrnsnss
458,335,126 *2E8E009B7944541E1EEADE0C5EBECA4F16BEC45D 3qjioppz
458,335,127 *2E8B3BF56FE34AE1D58E8A562F8E714BB1653471 3stseizis
458,335,128 *2E869EDE3D47E6EE015C9D07F78A7734ED70826C 439kira
458,335,129 *2E8363EE1E81768D1CB1AE463C5FD8C84ACA34E6 44F2D6072C016
458,335,130 *2E86E5E2712C254ADBB4847233DEB0DB8AB281FB 44KOPOLAK
458,335,131 *2E8286887820C325035BF6C0F41CD59592E60B10 4eenemlam
458,335,132 *2E8109D0FD86CE0F3096D132DF7A0BDE7029AE0F 4kvinnodebatterna
458,335,133 *2E87CA7B749201E92714214460A9089D8D29B926 4monkeycynthia
458,335,134 *2E8341464838E1261B38DBA0BC1CDDC5C7401A35 4pungens
458,335,135 *2E8291705ACBED522312753F828AB585B512C3E3 4queixarmos
458,335,136 *2E8D5CC0E241C1B77B001150C7524994B69AF5E5 4settlebrain
458,335,137 *2E8E5B0B690236FC083C344D2B91EE22BFFF4649 4teritten
458,335,138 *2E820AA4368DB5BB0027AB72F9E073BA8A1983CA 4trivialites
458,335,139 *2E80EBA46CCF05D61A8AC101E92ABED787EF0C5C 4vinegarer
458,335,140 *2E8F04C1FE1C6B7E1E21673AE48843FD81511BC4 4yeaterdaybsw
458,335,141 *2E8D188A97B61D35D676F23945EE6A2AB342CD69 4zenithwqsb
458,335,142 *2E8F568197E3CE583B84A56F6550B00E9E2D4E82 [email protected]#$%588
458,335,143 *2E82787627A99C25F3BD271013154B88701F3DA4 5alentavasti
458,335,144 *2E8A12BFCABE1650DB587A24800855C9F75E001A 5attekamo
458,335,145 *2E8345243D828A8881A39CB28241F0596F79CF1F 5august1303
458,335,146 *2E838AB17F8CF1E642312F0C31B11363CE3E0822 5CRATERLIKE
458,335,147 *2E873B399C87B7F60EACD9EC9F5F6FFAE712A6D3 5DOORSTOOTTE
458,335,148 *2E88CDE60F4C5C92D77142A6803F4FB9F6296E50 5franklinstealth
458,335,149 *2E86D352634604E1F0BEC2AA6F8AD4D0D2A91615 5harbeck
458,335,150 *2E85A8AAEA10E43E02EF1841081C4213C34DD240 5iailimuh
458,335,151 *2E83F7FF786A1322519A2A8C61EC53AC52AA53B5 5inverbuchenens
458,335,152 *2E85D99F1B3941A63FDD69DCD506D4BCEFC79F23 UPOŠTEV
458,335,153 *2E8487AC0128BDF03B15A5A98B257789EC5C42C3 UP TO MY EARS IN TEARS
458,335,154 *2E8110FFC52E30D734004F193322D8C0C6F06300 5kuujjuarapikbsw
458,335,155 *2E87C4192E13ABE2A45A5A6D596E22ADB145D6FC 5nisuoceb
458,335,156 *2E87326013E2216CE6DB9E4C484C252E4256708A 5opinioner
458,335,157 *2E86E36C6836DE33D502A6E65A57EA65ACBE4639 5schaeppi
458,335,158 *2E89332405FD0A3C3BA41D7E4DF84CE1059C0352 5thstruck
458,335,159 *2E8471F1FFD0BC8A1F0C07C8D7A3CC9557C56DDA 5tweetytintin
458,335,160 *2E8ED2E2B7278843E5FD4647FBE2AD169BA0FEB2 5u99e5+18111+y
458,335,161 *2E83817441A2C22C94A98E68F347360586104C2A 5willydogbert
458,335,162 *2E816A7F4ED4322D209C136CE74C454B20442911 647Braydon
458,335,163 *2E82CC2B2A0B57F1CE07FF524478688B836A9745 6bedderede
458,335,164 *2E876921870A9ACFA9B28919C1EE6D21CC6F67BE 6betaseron
458,335,165 *2E80409A28E903A1B5F51AE30F6C65017CBB4C4D 6bswgooldbsw
458,335,166 *2E8E8B38CAFF91F7ECA982CCB3381AD1A01D07B4 6eliminases
458,335,167 *2E864A26C60CB7BDAC72895FE07816530C10C0E3 6jodendom
458,335,168 *2E8BF4E8629EDAA3482A7E90C3E9B35C00EB0225 6koterttretok
458,335,169 *2E84C31C1C4BCD70DA4541606A24448930CBD6E9 6personnalisant
458,335,170 *2E8DAF1C4B99F7D3DBA4A8F9D0492D509744E8D8 6raptorsassy
458,335,171 *2E8231F595C4641297709A76662A68E3DF3A4769 6riegerregeir
458,335,172 *2E810144D58393626F5BB2365A0D97CA7AD8903B 6saksalaisittain
458,335,173 *2E8D8AEF0E3BB3531F5020BAFAFE81C6572CEC76 6unsurprisednesses
458,335,174 *2E8325837D52ABB3A2B71A0FA99DFD75DD17C84F 6uurrijke
458,335,175 *2E893611911D0907043E7CCD3FD16167B1966998 6vakiolap
458,335,176 *2E858161E2C7B18DE0BA54B639C95D13EFC0BB75 6vasthivasthi
458,335,177 *2E83B6814814AAD03552F46F01A325B609C2F731 VIVIANE.MIRZA
458,335,178 *2E89EC91A22EAD2A67C972FCD1E7EB92D271C0F2 [email protected]
458,335,179 *2E86FD55EC0B19EB8D6BFF8D65305A21D7126647 VLLING
458,335,180 *2E88C533523C866FD7D20CEA9A6A09BFE83F847C VOLEM.FESTA
458,335,181 *2E886D673CADC55EB7386FEB42DB07C58A85C8CE VOORTGAAT1
458,335,182 *2E82382BC0675FB4AA4712EA9C7A9EAFC6EC443B vroomzeur
458,335,183 *2E88E070694B31FDB6208941DA141EC727690126 70lxmeu
458,335,184 *2E8075CF478ADDFC816E2CC924F09056EADA3817 72B1KP7W
458,335,185 *2E83A02AE378F468C7756C74D6E34CB6570CD2FA 798augustus
458,335,186 *2E8AD12256A6C8F16C7ED04377869A5B74A49A05 799ptn
458,335,187 *2E80A59247E8685F8F73F0479459883805CFE17A 7agetroanilas
458,335,188 *2E82BA733626517E4CB76B338735E09634D5F33F 7bswfmprobsw
458,335,189 *2E8E1AAEFF65E964A0AA4EDF4C5FFF51F82A2191 7cobramatthew
458,335,190 *2E85786287052F79A59ECC975F018216F504F39A 7colocaresas
458,335,191 *2E8400B00B38D63B42789493DCB6B10DF2D6011A 7enrejados
458,335,192 *2E8B04FA48682529DE06713229E61942452FE98E 7herbgrass
458,335,193 *2E8338FB7E77915D6526570210906FE14DDCD7CB 7marghertie
458,335,194 *2E84B98327F534E69BFCDA866892322107024EB6 7marquees
458,335,195 *2E829F4BABE9A0CEEFC64AFAF5C1503A026E83DA 7moonsbdc
458,335,196 *2E84A3FBB6964ACCBD262B041B996F90E06428CB 7namishwa
458,335,197 *2E84E31F858FA494FAB96965410E890FBCA2AFF4 7nenjitseow
458,335,198 *2E864EBFD8BE9725918DD91022405509FCA354A5 7nettereobat
458,335,199 *2E833CD4D17251800C0E37A77622DB643210B438 7nncntmprns
458,335,200 *2E814BE17100359DB9F8FB7D0E1316DB2AC0BBD9 7otaugara
458,335,201 *2E846BEE152A3C46092085AFFDDD778B1AC45329 7reekram
458,335,202 *2E8BC0485C6EF16EF02357535D02A3E4C4569EBA 7reregalerions
458,335,203 *2E8460DEA95C430C264DF1A3CAA948AEB6D0C1CF 7sacrais
458,335,204 *2E89D7DA61FB8DDE9F70E8DE8A74C0255920AB6B 7sweetiedoctor
458,335,205 *2E8E35A983895BA86F5257593C42D5202500A0EA 7tallessa
458,335,206 *2E8142CA39A3830A42E6DC885576267560329142 7tentoons
458,335,207 *2E87189C9D40DC1F8EE9BCE1A086BA8EC74FC146 7tigersam
458,335,208 *2E8E1B2893A0E50D227D162A68CE07554478DADF 7wqsbasshole
458,335,209 *2E87A9E30E92774A8FBAE2E95B25A7DE654FC2A3 806Dale
458,335,210 *2E8C5AC7247FF2BD0695BF8C2F45D22C96356A0C 871565 acta phytopath .
458,335,211 *2E813FC57325785CF29CA2DBC689AD3963C2FE51 [email protected]
458,335,212 *2E8E2F729876D1C14B6200DA6F95C0247E84F901 8alokkrik
458,335,213 *2E86D0A1AF117E59B1917B8F381A0C1CA32FC034 8ANZUTREFFEN
458,335,214 *2E8F17A4BFF23D456316C1663EF1FD4DC809601A 8appeasin
458,335,215 *2E8EB36CAAA26C0972DDB17DFA75435CD9B07A50 8aropotamorts
458,335,216 *2E86E68AC7A081EF844F484D0CE21098F7BB0B63 8astrofyzikovym
458,335,217 *2E80D8409E77EDF4351008E6F4321AC982F94F53 8brandmand
458,335,218 *2E8D0687BD6960FA42BEBCCC2AA4E3D2E07667C9 [email protected]
458,335,219 *2E8507269BCFE9A2AA6C153C95A02A2853BB4FED [email protected]
458,335,220 *2E8BF0B18C054024B6DB335FF187E7DF5183365B 8defaultpasswords
458,335,221 *2E81705D4A9FE71B6E270F4583D444C004CF6EBB 8emissing
458,335,222 *2E81B0215B07BE9EF9FCF3BDE13A62318D5C1EBE 8f8TQZMe37KpGNW5
458,335,223 *2E879FE93DCC9E693B20C4E968149D6F9E39D343 8fotskerpseg
458,335,224 *2E84397D93DC9E645FBB4FF4BA0073001A2DA6AC 8frankieherbert
458,335,225 *2E899D87C4597677350AD685AF59C72BA2896A3E 8goldenshirley
458,335,226 *2E8A49BB59C27A27D036F43BD1D120BBC8BCEC82 8kingdomhunter
458,335,227 *2E827138E5F2FC27C474ED8491AAB9BE835E7E0E 8lakattava
458,335,228 *2E8AA9AE5170C33708333EB2A32F5EE48444B75F 8lamermayday
458,335,229 *2E87CE7C6BE4EC16F0B4B42DDFB2610875E81C5E 8nefahsgiwdul
458,335,230 *2E8AF6D764CF87127B5AAEAC370EDBD235B0FB69 8oritetut
458,335,231 *2E8C367F7553BA6BDD81ABD1303034E124C6ACB8 8pakokauhuvaiheen
458,335,232 *2E83C89F9842D652D0A9209EE1C4FE003E149B43 [email protected]
458,335,233 *2E874FC1D1BF723F2D44FB1D320978ADF0A05C17 8presiederemmo
458,335,234 *2E8D568937ABF1C8B5648B1DCCC8B219DBAB8295 8sciencejohn
458,335,235 *2E81E0D3A8A2A395E8B9FE3B0ABCFCAABA5A77EB 8shatarabsw
458,335,236 *2E81819AF8FC035DFA87025721146AA3DAC6B977 8synnehvi
458,335,237 *2E8EB851B074374FC20A16C8E3C4FC73B7ED1C6F 8tabasane
458,335,238 *2E835E94F63DB216D2615BFB80323E5C1A1DD0EB 986Clarissa
458,335,239 *2E84819EE50A5F86731ECD2ACA0D54644BE21948 9abebrese
458,335,240 *2E8D0FF4EB4488C6C1DE05F14A897897E57CC3DA 9bmyjyxlhtxvqo
458,335,241 *2E8B803F8BF913290ECBEFD480CAAA3088DF0539 9brandybill
458,335,242 *2E80974657BEB64ED84EC7C910A3A1A9E3950DF4 9bswaldryami
458,335,243 *2E8422231346553CC8E54CBE61C1B167423964EB 9ednisolh
458,335,244 *2E821F50F3622482BFEDAC9A237CE59999A1A920 9H057I357
458,335,245 *2E80441804BD7A0F73B3AB28EDF158631466238B 9hetexcxsjirow
458,335,246 *2E8546DBA6C3F7D6C3E8431156F4A6957F52658C 9kenrihen
458,335,247 *2E8516E2F95948560A8C5AAA6FAC0CFE867D8857 9mmeamini
458,335,248 *2E8B6F3975F1F1BFA38577886EA0BA44E9462656 9tasanko
458,335,249 *2E894181279FBCC3D7DE6CCCE1557DDAE1C66600 9thatScience8
458,335,250 *2E8CB113818ECB69166F3DDFE16D05A703A6D08A 9trefoden
458,335,251 *2E87B0AB07B302DBC04D3503F112C06BEC63C45D 9vigerregiv
458,335,252 *2E89800DFFC77A7AEF1E3A1E4FA16E0A13A71C0C 9zamerpus
458,335,253 *2E899E799760ABF6CDC5336A0900023BBC3F3917 A,%:,
458,335,254 *2E8BF88B792E5115ED6577970EE616A456BE33D6 A0IV"
458,335,255 *2E83A6816A6C1683ABBB56599DB0EEDE81E3FE11 A1Z0r
458,335,256 *2E87EF04A438E27145040B62150F049034958464 A.2An
458,335,257 *2E8B50BF11506329D4DE38103263526B5DA24CBE A(2:g
458,335,258 *2E875933782363B8BF4BAEE660D2717AC8792537 A50#W
458,335,259 *2E8290052A57E222E0DD65F58D990BF28B131ED5 [email protected]
458,335,260 *2E840AA75C4C9680B16290E87D3FDC6D7BD8E218 ΛΑΙΛΑΠΕΤΌΣ
458,335,261 *2E85C7C16B89B705D4625268A1BE35DF599E573F A:5cb
458,335,262 *2E86509D6BB265EE6AA7E156BD160A305E931B18 A7g6K
458,335,263 *2E8EEF200E48B718F2CB2AAB3B17F6312595A94F A7OB"
458,335,264 *2E8E3B555EE15464945AFD4C5087298F1C8D8D62 aaaX%h
458,335,265 *2E850B8448FFF212968DEC3F8F1D2FC9383BED6D aalhazchem
458,335,266 *2E856B74B2906C18AE8D256A5169C0A793B784DE Aalrs
458,335,267 *2E8A0752D614C447CB0F55924DD662A387D2F520 AI-;X
458,335,268 *2E860EB8985AA33C1F38D9FCF672AC8A3E66ECF9 ajitraving
458,335,269 *2E86DBD57319B6CC37D439DBA94D34B8200D7F64 ALAAMSUU
458,335,270 *2E8D79873452B2518B4AA1E3AB970B4FFA2377F7 alfred.mees
458,335,271 *2E866F6130AFC2225EE2E1336915D0B641E326AA All of Us Dead
458,335,272 *2E869E281E0BBA2BF8F1083EF37C0B27BF3F4EEC alva.imbimbo
458,335,273 *2E8F62AB087B90D46FBA3B44548B61E53F4A5315 alvaro.dermody
458,335,274 *2E8F5A5E1920CDAC00C3E5DEE11DABD97C4CBE15 amy lockerby
458,335,275 *2E87B51050CD78E88A601565C12BBE7B2AF79A93 analituma
458,335,276 *2E844FACAE4CA9EADAE2647E1D0F615E4DAA0C2F [email protected]
458,335,277 *2E8E3CB8763B81F3EDDDA154FB9A0137337E3400 An;/e
458,335,278 *2E846E96C5BDEFE02B97BC3D6FAB9B552B904BEF anguillalainen
458,335,279 *2E812DC0097683F060390914862BB3127C2444F5 Ankerblöcke
458,335,280 *2E809AE947AE05F3272A7565195C4ABB1737FAF0 archiejohn316
458,335,281 *2E8654833774A48E4EBF7B5545CACA564728726F ArF%h
458,335,282 *2E83B6CD2B66DC4767743EB5EC6BF8D09B1489CE ariana burrows
458,335,283 *2E8FE4E8CFF1BB16AD0999BD850F75BF78C6A10B arnold.axtman
458,335,284 *2E8BE4C12FEF1772386A1BB654BBA0595B326490 arnulfo.mirarchi
458,335,285 *2E885E1791AAD4C82902F92C21C8C18FE12CDDB5 arrivals5
458,335,286 *2E8DB1A3DF68EC68C71B5199D8FDE0C3BB464C6D arteriogenesis6
458,335,287 *2E8FDD877AEBED1738D1DF46BB6F935421AC9FE0 arthur.esh
458,335,288 *2E803CF81A12E0A9782FEDF65D8878F5559C4307 artistiekerig123
458,335,289 *2E81229BC691B9A54E904A849A94C840C8BB0F74 Artofintrusion
458,335,290 *2E83B078460A549FB305D2AD01C6A914A60E6234 arturo.torrell
458,335,291 *2E85745DFBE3890E68F3EC59A55F68FAEAF33FD3 asa.marchesi
458,335,292 *2E87F89151964D1941BCF7CB000B1560C441B278 ashleyflewelling
458,335,293 *2E86DDFF8686049363D90C3B85C568A846C736C2 Asientas4
458,335,294 *2E8676F5549EE2C77201F50B7AADB7ECA7893131 Asijzers9
458,335,295 *2E8595C42B0294627E25088048E35CF857313DF8 aşırırsınız
458,335,296 *2E8CAAD16A8AFB8E02D74D071D4D17C45B434F57 Asneisou1
458,335,297 *2E8457CA8B6D991B7FA6823898A793DE91DA4066 A,SX)
458,335,298 *2E811FAF6D22995158FE65904D78D8C8933D0C42 Atajazwa6
458,335,299 *2E80D5047C7AA89600C6963BCBEB971256A20B94 atiqah sulaiman
458,335,300 *2E891FBE2ADA8AAD451E70B279E8432CB8CA380D A%!Ub
458,335,301 *2E80C0E2648DA4EEC7F6869160EE498A6DBEFB6E [email protected]
458,335,302 *2E86841211A6785AB8CD0E388B88664B484C569A aurelio.zich
458,335,303 *2E88048899EF2939C03CF51BF0432043C65D7217 A_=vc
458,335,304 *2E8C5E20C977327E4CCA123F764E6594A98367F3 avery.seckler
458,335,305 *2E8CB1F096499B091F574B33A8612EE22310F07E avery.wank
458,335,306 *2E84B0FB413D9F829B07C2F4D15F96DC6D550B58 A-vg(
458,335,307 *2E809DA2075AB34373511CF4C3ACED410D982A70 AWARNES
458,335,308 *2E8133CAD20AE775A077685C755C583BDDCE5931 Awgr;
458,335,309 *2E8C0F106B5664A867CA81F6A2441503EBA9D698 A:)y
458,335,310 *2E8F3EA45B65C5EE6E743D4033587D909F1BB57D Ayo!
458,335,311 *2E889B1CEC9079BDC8631AD59D40DB3CDAF8CB98 AYRsT
458,335,312 *2E8F728A679F92F4DB5B06D8C8226946999FE6D7 AZ0Q6
458,335,313 *2E8F7862E061CE49B119C33B7D542D5257E58627 B0MC#
458,335,314 *2E80F583A6C35C0F5B81F3A105CBC572FB3F2D15 [email protected] ~0 ~o (O_-)
458,335,315 *2E8BC7C85042822FE935B2FA4E4D4F0D8DD198FC B-0T)
458,335,316 *2E8D7199A291755FDBF2C0F3A0E2D80A3E356D5B b121893
458,335,317 *2E814CB349F5E263B4F1E2E0CA7745F22B14B29A B/4n+
458,335,318 *2E8A798263553CFAED404C018A70C4B177AFE450 B6RJJKK
458,335,319 *2E8E0D85BF8614BCEC1F5A170E886AAC755A148C B=.?7
458,335,320 *2E87AA1944E3370985DB5D8EF7AA2C4732B957B3 B-aD?
458,335,321 *2E88F0A70A1CE4B3AF8B5D0929E93BE1CF7E5D3D badcybergal
458,335,322 *2E84AC981AD7527A6C0C797D3E9193D86C7FF5CF barbarahugill
458,335,323 *2E85D2825BAE3E70CFD33C146468B6E695B690B5 barney.rappleye
458,335,324 *2E859BEF87AD292E56822F1304AF7B5BA1AEF1D9 barrăng
458,335,325 *2E8658FB75B1B993522AEF41D8E26B5BBACA8AA1 basil.winnen
458,335,326 *2E811B5D1A48FBEC2FB204F602C0EF11FA1662D3 Batruk
458,335,327 *2E8C30F406C01F60C9280AAFFA45FBDFC09657F8 BaUN6
458,335,328 *2E8FDA262A4769EF04D5518D012485D26EF34017 B?c60
458,335,329 *2E8A0B85E1BC0C9BF4E1EFAB88C1FAF6AB109218 BcR+A
458,335,330 *2E8685968224012B7B240BC168520CF9E4BE6B60 bcrowe1
458,335,331 *2E8F6C713711515054D2A28B67B0C8C948541D32 Bd9vp
458,335,332 *2E8CED3F25DFD45EF37B9C108A7C39E11932DF6C BeAUw
458,335,333 *2E8A1A7D6C27AD2B0925AD8524E7E998910CE7A6 beegieh
458,335,334 *2E86BA9DD3C38DA4E82B966BA25335E81AABEF94 BeGKf
458,335,335 *2E8C8E63337B8F4B5FC5F87FBC1627006211DFB1 bennett.faubion
458,335,336 *2E8936AD528A99B7601FCED8870749A9341749BD bernard.zempel
458,335,337 *2E8E46477C57F7FE27146892F8B49B8BCE693270 berry.barre
458,335,338 *2E80850DCB1019969C91933EFF1704802C622906 berry.czarniecki
458,335,339 *2E84D1B6697426649D19060048BDC4A9FD1B058D bertram.tegarden
458,335,340 *2E8904DB0DB859C853508CC362290D836A27F03C B""fg
458,335,341 *2E8310A5C98EEE5850D2ADEFD2B4E446CCF67E2B BfM$+
458,335,342 *2E84346A693CB47AA3308F6E436DD9BE6DA758A2 B)h)c
458,335,343 *2E8BCD08151A6A8982FBDDBBB676102E3FADA923 BhW_E
458,335,344 *2E8EAE326FAC2DB4C38A8013F02E6800ECEEA1A9 Biju3
458,335,345 *2E8B5D21E47FF1FDDB8E43E488CFF518A14B144E Biogeographic2
458,335,346 *2E88640C4EC26832A8CE00ED5BD7035EC22E5D29 bjjyf
458,335,347 *2E8B5037AA353005EC5D49A495D2D2BB751AE446 Bk5_Y
458,335,348 *2E8EB82E536C06D0575F7D94D7FA83BEF0009C8D blacklick.
458,335,349 *2E84E656ED08B28BFFD6612C6CC2D544E49D80D8 BLJIUHVSRGD
458,335,350 *2E8D6FEE45270CF8BE3201DE32F8348BD52BA2A8 B#lP.
458,335,351 *2E8F046704626433A577BE52F1FB75894D7ED11E B/%mr
458,335,352 *2E8BB9F5A82B3D03EB69F28F7EB188F8DB507E2B [email protected]
458,335,353 *2E856E5551EFBB7F4D7D75B4F0E6900721F3606D bobbie.oropeza
458,335,354 *2E802A4B7F738163B929489CE11A18D92D6F6F51 bobby.mondesir
458,335,355 *2E81184CAC65EB6D3653479A27F2B9AA6EDA22A9 bobby.riggens
458,335,356 *2E84EB94C634C14C36FDDDBEADBA485E564473DE bobekx3
458,335,357 *2E80516152B2FBC6BEEC223B056508FC6F322D0E BOdinGLy
458,335,358 *2E8DAA85334E86F3D7ED9B5C29B340938E0CC2B7 BOOq)
458,335,359 *2E84B6B916CD740246D2A2D479C758F372D84E82 4.AGRS
458,335,360 *2E83C788A4CE73E22F6FFFC7C8DAD2F4218B23B4 BO&TU
458,335,361 *2E8EFAD3F0FB524A8475CE8EDBA72B5AE88E12B7 bp.berkeley.eduabout
458,335,362 *2E87132AECBE8804EC7F2F2FCA07C679A9D7B4B5 B----p~O ~o )x(
458,335,363 *2E8F8DBC9255181661BC468A21BCA89DDA0FBC74 B,/PR
458,335,364 *2E8A4EA62279136DB44D8F6256F6BC12B4BCA103 B+q+w
458,335,365 *2E8B75E17D47146D3D14806F4C2EE04113575BCE 4SUPERAMBER
458,335,366 *2E8F43F3D9A2CF271267EF53B6AFE73C9C364504 4SYLVIAMUFFIN
458,335,367 *2E8F9105627F977E03200BC18AE16BB2A7A90AF4 brandon.waterman
458,335,368 *2E884FAB7EB8A80B2CFA23D62F2E7CEBE95DD2AE breidycates
458,335,369 *2E8411B33E13B9D7A8B8BE4511CE8836A4DBB86A brenton.vilar
458,335,370 *2E899AE4C2935396391A8BFD990B70D3CCCD1ADB bret.setter
458,335,371 *2E8F0216C033446E4A2F923F011D0BAD89825742 brian.baradi
458,335,372 *2E8CE840D102BB2AF072BCBFD053E2D5AF3ED328 [email protected]
458,335,373 *2E82BC4C761A509B93D701DD3D50633DB6F43BB4 BRMfX
458,335,374 *2E8517FD4DC7A30D665A79F428F128F1C5188CA0 brody789
458,335,375 *2E81969FAFAEF0C5E82AB87FF72D39AAB96D9D0F 5.AMERIKALILARDA
458,335,376 *2E8F5306E00DA22F8CD7365BE5598713F75B8446 5APRIL1898
458,335,377 *2E8C591784CF6A666FCAA59C797C2AD9AD12A0C6 5BSWYELDHAMBSW
458,335,378 *2E86A8B09421542696573B92FC451F6CBA5EF40D brunkows7
458,335,379 *2E8C997F7E756C56A30265EE622E70FD85C2752B bryand69
458,335,380 *2E89A154AF0828314247CBF5A89DD2FC39159C8D bryan k robinson
458,335,381 *2E8DF62C7960A545E6A34A9C2728243E5938647C BSWdefyscale
458,335,382 *2E8A9B1F46A1A698BF0DDC453CB75921316A74BB buster.closovschi
458,335,383 *2E8187447F9BFBDAAA0DDD632E6062B391D88015 BW"&D
458,335,384 *2E813FA7C7433D5B6E8BAB5857EE3EC4F3C2496F C1AUDIU5
458,335,385 *2E839D2AB6E74FBD7FD126295C418EB268C47096 C+1pE
458,335,386 *2E81F07411E0587AF1CF0738C0A83573D58BAF16 C5v2n
458,335,387 *2E853C16510CDA1DF3727FCAD60FE274C0FFEA91 C99&;
458,335,388 *2E8DAC007B582CA65A21D574F5321DD22B0C6109 ca022186
458,335,389 *2E89901B06A480117EAAD64E362297DA2E4BFE4C CA9eA
458,335,390 *2E8DCF92EF95083B1020C2C7B8F55656E4F93DF8 [email protected]
458,335,391 *2E8E56244B6A3566E98889B879B049458A756959 calvin.karmel
458,335,392 *2E8F3DD46D045FD85CA079D18C941C0EB5BD2D1C [email protected]
458,335,393 *2E890B5815A68F263E3AC2DA2610C35D71C8663D Canopusing
458,335,394 *2E83A094406E2837C38C0F3B590C0F74AC254491 carlos spicy weiner
458,335,395 *2E8EE205B435DBF8831B0C36C795DDD345F71F90 carlo.sweazy
458,335,396 *2E8FC8E26DDDE0D646C0CD98433580BA346763F1 Carthin2
458,335,397 *2E84DD4022391C173935B84DA3100F8517DDC2FB Case017
458,335,398 *2E8FDEAE5D7AD4BF8930E2F4796D8DF96973DF31 Cb)n;
458,335,399 *2E8CDFA77112F94656D1061C0DA0AC1ED804454A C"bwj
458,335,400 *2E8D5F5954A10C94B302BABFEDF966084F7752D6 cecil.reshard
458,335,401 *2E84E9B7C0567CF848A38AB89D123F16522B90DF cendraju6
458,335,402 *2E8A8DFD0FAEC5D118DF8CA4C1DBC41D58FF098B 852711 TERVETULOAYRITYKSEEMMEJARAKENNUSKOHTEISIIMME!
458,335,403 *2E839972BC1508FA378D6FC9DA636358EC6527D2 865566 tammi-weilin-&-g
458,335,404 *2E8E5E46332E7C0CF6353BDCF851F81135802674 CF%GP
458,335,405 *2E8877ED7EB4CD39FEC347D59F530AEE99E67A03 chad894
458,335,406 *2E87BB2653F44F3B491CC0C1C21BAE1C4C9F34F0 chadfc
458,335,407 *2E8908ABE7D58783E349A868706ECB8376B6B3A4 8ELETTRODOMESTICHE
458,335,408 *2E81F229E6705156403EE861EEA0694178CE82DD 8FPOHHJCAGIBI
458,335,409 *2E8EA0220E9C229F19F883DFC87E7C0CC9166A9D 8HERINGERICHT
458,335,410 *2E8609C1BC9880075984837BC67A2BC8A6391DF7 charley.scherf
458,335,411 *2E8372F28AAA4E9AF9BA0A5828ACD50317117FFD chervany2
458,335,412 *2E868AFCBAA1BA27E684CD8DD2A767799D0E7121 chevalauvergne1873
458,335,413 *2E8BB2E66DCCE1BE8B5AB3B460678F8C437A80A2 chiarabrooks
458,335,414 *2E8851CC583948E767A2C09C4A930F4D73F8AB95 chiud3rl4
458,335,415 *2E8A622B3ED13BB684B5145B1393235FDFB0313F chloepatre8
458,335,416 *2E82CBA6FB5EAA489584C7FFD1306890C066A8D0 christina sako
458,335,417 *2E82418AF752FAE61A55C7CB903244AA12E1BA15 christopher kamezato
458,335,418 *2E8A6569E73DB2E064AA4B16101521A8DF58B8B7 Ci8li
458,335,419 *2E8E08381B397600E39785A6A09D8F04D5269AF1 Cidaroid5
458,335,420 *2E81988447B904AFBEEE057670BFBF9A8924EC67 93-MISHANDLED
458,335,421 *2E849F001C7E3E30B5658CE034B2F4956C51E4F7 CIqF3
458,335,422 *2E809CF1C5C10937D9815AF2FA241D92C56A5164 [email protected]
458,335,423 *2E8D343A527B6718C49DA47FF79B628F543E3D6E C?L5:
458,335,424 *2E8E8C2AC281AE7CF61F8D0730A77A77584EB4B0 clare.norburn
458,335,425 *2E866EEBEDE2C0A1D1CA8A0FC569375318162335 9EDNOTSPO
458,335,426 *2E8451D02E62FADB4FAC8FECFC42B034C7F7FC43 9folgerite
458,335,427 *2E8104CE0E87BBAC4DBDDAE1C6F3332CA9EDD3A2 class="otherprice">$053</span></span></td></tr
458,335,428 *2E8E542E11605179DD76CE1CA95C1C01247F76E1 claudio.rolfs
458,335,429 *2E83927D3B7644E928F0B9427E1B0186E4930A86 claud.rockenbach
458,335,430 *2E8401631BE1F09B202DC0959AA07DB4907EB4B8 clay.strowder
458,335,431 *2E8C40B3F54217AC7A580D6BE6F8761F4FF61AFF Clubes)の大会名で1971年8月7日から12月19日にかけて行われ、
458,335,432 *2E8B515AD48C633D178258083439168F7DE10044 clyde.rearick
458,335,433 *2E8F967308D5FEA68D6EE810F0348F665BAD8957 CLZ#%
458,335,434 *2E87DC5A53AB42BA7BDBAF9401CFA9FE9976E354 CM975
458,335,435 *2E8CD954CE3AF823811E158D14CA14B7D5F7B9A2 C-)n;
458,335,436 *2E8AADBAB5A3FD5C749252DEE351F8E3B0E1AA28 cole.blanchette
458,335,437 *2E830D893E66EA3A14709A199B7C9836D98135F0 COLTONFORDINT
458,335,438 *2E80E3162CF1E2485C1369EDF4025F93192E7800 cornell.holaway
458,335,439 *2E84FDFA3F8B995A1168ECE0A9445B778AC9D28D cortez.bohanon
458,335,440 *2E89F54FFA25DDDF9206D723EF6ED664DD97370A cortez.resner
458,335,441 *2E8B7CB1EB20221660A3A175F456B912A208DB08 C&o$s
458,335,442 *2E8E3C1D4711E4F1383EAA3FB3F56E08E177132F CPwpY
458,335,443 *2E8BA237EF6198256741F9F7817B12D3D697B14C cristobal.friede
458,335,444 *2E83FD6BD1592863197D7BC0E3E95CE5B634B509 CR;IZ
458,335,445 *2E88679168116316152528E88788B54CBAE7FA0E CRRl,
458,335,446 *2E808323F402ABFE52A75BBF1C0D8E38ABC37910 cruzina
458,335,447 *2E807609EDE2F428A9FE38CDF6CF4F922DFF28A9 Cscws
458,335,448 *2E8F8A747CBB8BE4F47F29AA0E44EFF98A8AF8F0 CsS6D
458,335,449 *2E8DEAF0076B2889BD38848062AC39C1B1786FBB culatte6
458,335,450 *2E86DA2BBFAC23A77E54948E9C0183BB38B0ACF3 curt.pons
458,335,451 *2E8A23B0A5475A0187174CB21C66ACE94E087B5B C+Z3u
458,335,452 *2E8FE27828F642EAA18EC7DD7F31E147C6AA5BFC D0%5;
458,335,453 *2E8834C245A15D5EDCC33C786A7598995DF1E8D4 D1S4FF1RM4710N
458,335,454 *2E8C9ACA7C9F3A6F72A0EFABD8F4D88B3A55A432 D?4):
458,335,455 *2E82410B1229831637AA9DCECC5F6786DED0AAF7 d52ec5
458,335,456 *2E80E67DC1D8F3913CF86097C0CEACAA714CC7F7 [email protected]
458,335,457 *2E88C6BB760FA6165E802C622AAB143DE6C1C7EF DAe?D
458,335,458 *2E8F345BE34C4140CA2A71C9CA15267765A2242F damon.stiller
458,335,459 *2E8D6294A980DB6DCCCD9573B64F5D65A065EAAC danielstandish
458,335,460 *2E822EC51AB410400B4CE604DC3E7A689DBC85BD darron.bengston
458,335,461 *2E8BF66B3ED9A7D9685B7A6207ECF21BE086A6EC darron.shoe
458,335,462 *2E87462CBD4A0AE6301F6884926B08D1F80AD808 darryl.manuele
458,335,463 *2E8AB235151584B2E9EF36381EF4028912CB88AB dean.muszar
458,335,464 *2E884645020FFB268FED6FC412D845F5E7CDE120 DEBATSELIER
458,335,465 *2E8008C1E8EAF88BAFC0226EE1A54A3FB4C92DF2 delbert.karagiannes
458,335,466 *2E8E932C5A6B2F0500808636A854792A8D6D24E9 denis.addleman
458,335,467 *2E8A9F8EC6532DBE05AB172289BDDF0DDED009F3 dennis.socci
458,335,468 *2E859701D24469CC98554748032306658834BD73 depecheras9
458,335,469 *2E852CA055F977C99A56F4F381214FAFEF9AD551 DEPPRECIATION
458,335,470 *2E8B23020BD1C17CF01B96D61FD71D8D393B149C DESPERATEMISSION
458,335,471 *2E8092539A4FF4A2348E9A6388BDE6E7C5AA7565 D="gk
458,335,472 *2E88FBA9C95E73028088741B70C2EF60F540C365 DH=:$
458,335,473 *2E8F55A81224BEB613396C31BD0212545EBE6D43 dhruvalmehta
458,335,474 *2E879E9AFD51392E58305C975274B2DADD979B7A dick.mcguirk
458,335,475 *2E8A3F6F44B4609E440F7351ABB6D929A377270F DIPLOMAATTIAKATEMIAN
458,335,476 *2E81E926D454796BB0E3D7186E75ECB52BF5D24B Dishinger123
458,335,477 *2E87EDFBB35F577DF21878EB6F0AF85C0B48ED20 DMCDDVD
458,335,478 *2E8DE4796BA227B4FA861BA3F679DC485EB80C57 domenic.hrabal
458,335,479 *2E86DD6BC26A55358837E18D7ED05DE842B9E374 Dont+
458,335,480 *2E84DC326BF5A725EF383EA5A68E680ADE80481A Dontonek9
458,335,481 *2E8653C4FC810047530DA8070409084BD13EECA0 AUSHON.COMWWW
458,335,482 *2E8222F54D90E353AF973D5DBE64AD7B1622926B Doohrota0
458,335,483 *2E8246B6F2D3120286B1A4453114D4FBDB1091FC DqAPF
458,335,484 *2E8EB23EB78006E776B0D96BDF60C32CD969ADDD DRk;f
458,335,485 *2E8F9B5FF8BAB9A2FFE5D1017A7B2D48E2899A20 DSar8
458,335,486 *2E80945FDA285E928AD5EEEE0A56EED0FB741474 DT,"Y
458,335,487 *2E83DD1D49F09E0675640D4E5EF57F28E657C846 dudley.majera
458,335,488 *2E8FEAC3CE8C95D019DADEA5F33FC718D5A264A4 [email protected]
458,335,489 *2E89469DC13B8E176E99FE34F73820F46E658568 duncan.plackett
458,335,490 *2E8593BFB21945CE6FDB9D1A6652621F7B074340 BABYBOY2235
458,335,491 *2E8DF530FEEBBBDB12ECE3CF10C31B7166BD89ED DVWLv
458,335,492 *2E8B1F5034B9E18E0A1FEDAFFCCB7CD66BDB7B38 D$XvZ
458,335,493 *2E87C15B5B3B06AF944D069CE58E19A694C6E02A D=YA)
458,335,494 *2E80E5A857ABBFD5396701B2224075D371E2C135 DY.k!
458,335,495 *2E832489A9819F3D4782BC3801DE7DA6F7FD6BFB DYsrq
458,335,496 *2E8358C4572397B1F84736D4A1A9617C3E43017F eandlease
458,335,497 *2E8926AD2A5BD5C166D2692C720A6917088585C1 easily-replacable
458,335,498 *2E8462C24819067580698F44C412E842F5619AC9 ED4Rt
458,335,499 *2E85DBB1B0C33CBB67F7F70CD305CA4C63C84CBA Edomotor1
458,335,500 *2E8562030D0E5274F9060F6250AD27E51D0D5857 EFHS,
458,335,501 *2E8D66E5BF77673E5093033E8DF3053281EE3673 efrain.leaman
458,335,502 *2E853B81474F0473C6019071B1AE5B3A652C85C7 EGBmU
458,335,503 *2E8E505E463FE9FAE4FB422F3AE1038A39506154 Eihccivac
458,335,504 *2E810E90E8B628D7BE61BD704C40761DF0C910CC EKI&d
458,335,505 *2E8AFD5F870C95C1D4420A2CEE9444203AEC0557 EK&(O
458,335,506 *2E8EBD5EF37BFE643E83A10749B16267C8E244AE eldon.reinheimer
458,335,507 *2E887F5B527DA8FE2F1EA0D79D43AAAAFCF3FDB2 Emanassimo7
458,335,508 *2E8AF887CCA1A5AC61EEFF52B21857668D1D1FCA emerson.amemiya
458,335,509 *2E8084666C277E1162A8A326471EDB4ACDF032E9 emery.lesane
458,335,510 *2E8DBE7A471A64B4D0A19BEB63140D3B1478D458 emile.gurrieri
458,335,511 *2E89EE4108848A7B3156F78EA4AB72F56B18D216 emilio.figueiredo
458,335,512 *2E8447881D8DA9494E6FBBAD272C87A95C44DB31 emilio.provenzano
458,335,513 *2E87274F00A9DB1496A0ED3A218B90785ABDCDC5 Emorpruk1
458,335,514 *2E82F4D46C5522BAEA44BB14040FEDE440267D2A emory.sallee
458,335,515 *2E8A6BF92AD4B2AC307D60E681DDF684F78E5673 emutuoc4
458,335,516 *2E875667E0F605B1D3E32824D5C02D9690F7E83C enocimes1
458,335,517 *2E8F7F258101ACA2552B29158A1C45799619F1B8 eretyke1
458,335,518 *2E8753A165EF477A47C7077B058EF238576484B2 erich.blimka
458,335,519 *2E8FF6F3DF5D3DF218EDED3C8B109DCA8DB4A636 Erremmah7
458,335,520 *2E857D60F252C72779846A5FD922A91B9C64C313 Espagnol »
458,335,521 *2E8B697C677B19DFD06D133F94DE5CA749CD2022 BNO5T
458,335,522 *2E80ACF142CB6C73CCFD3E64401048977A6CFFE2 ETeOi
458,335,523 *2E862B146C8121127B5ABD1647307CE99B84A9A6 ethan.abington
458,335,524 *2E8E90375A3008BEAA5DA1D14461D96304C0669F etiopier4
458,335,525 *2E83DDC372F6229F66A16DDD5E12AEDA0E7FFE81 eugene.barros
458,335,526 *2E868A876D7502DB2CDA6DBE51D398FA0A419FFF euitchifloydm
458,335,527 *2E8ED1AFE826ABB18C80518FD05091BFB31DB209 eusebio.cyler
458,335,528 *2E800DA68469D196BAEB05277F61789FB5CDA6B1 eusebio.roetzler
458,335,529 *2E894051B27A05B0615A5401C62EA9B271E1DE03 everyday(rockmix)
458,335,530 *2E8F5AB56E940CC6B2C86A365C05A5E77721EC2B facILeLy
458,335,531 *2E8861CEE9023680ACF93C41B6A51C7D4202991A fadrizulr
458,335,532 *2E84E8A8F95906F81D278069D60D6FECFECD36B8 FALLOMANIA
458,335,533 *2E8625BCDAF452463EE31BD9949852F26757BD4C bradnicewander
458,335,534 *2E8DD03D932968FFFF7E7E4A4CA23BEFD4CB16DA BRAKEVAN7
458,335,535 *2E804600BA13AC951B92046D05B7D9C2277846E7 fami1iariza7ion$
458,335,536 *2E873A68C9F852DECB603670CAC6174C9348E5F7 fascistanarchist
458,335,537 *2E841FD83DAB6B937AE33FC440B51E4BE0722B35 faustino.rouly
458,335,538 *2E828DFC253BC3717BE5FADB0DAED037812EFC55 fausto.newlin
458,335,539 *2E86945C4CAAAD3D1983BF79C08928FCBAC33711 [email protected]
458,335,540 *2E8F789F4581AEB56934F3D36D5BD6869751696F Fehlentw7
458,335,541 *2E81A68829666192612CA50EC9FD34EDF0D6CDCA fiabilite.
458,335,542 *2E85500E20F369335FA6809E5D1E412E638E5A6B Filofaxis4
458,335,543 *2E84470FEE0F3A28FA6F0DAFBAA1943A2A1A117D Fishkitty
458,335,544 *2E86948EC9987516EB0633AC1CBE039D95F53FE2 fl0ur1shment
458,335,545 *2E8FA4DFA91F0F9A1A70DCAFF85CACC680AB1EEC florencio.daro
458,335,546 *2E8C08C6BFE0EF619A8F1E27DEBC913A21A0D67E Følgegruppen
458,335,547 *2E8C9A173834EA1B4ECA323AB0B622D2DC6A441F folhetinesca1234
458,335,548 *2E8493691A694FDB17CA4D6BDD70046BB94B21AD forgottenmaverick423
458,335,549 *2E852F2CCA09A43052CF4AB18F6744A4C353D76D Formierte8
458,335,550 *2E82BACB9FE03755CCDFA29BB6EEA079E466C703 förstärkningssoldater
458,335,551 *2E8B73C567C725CD58E489CE85670B57C294C996 francesca keogh
458,335,552 *2E87F67DD0868DCC76C1A93D4788F6E14D3D18E5 frances.vantull
458,335,553 *2E898D17286021AA5F43411BD5862682B00F6CC2 frank.ketch
458,335,554 *2E869BF25214D825B81C88B1CDD94CEE68596569 franklin.caberto
458,335,555 *2E8662604C5E52AFAC0A5DB4466730A50245C7C4 [email protected]
458,335,556 *2E845AD06FB3410F3127C6F2C87B2376DB84ABA6 furentapportées
458,335,557 *2E85E42E5756FEE43B840E5DC483FD038D0D7EE0 [email protected]
458,335,558 *2E80EEB3DC9AFE560FD8B1BD7AB7794391E08ECA gabriel.schnee
458,335,559 *2E8DEA96AE80316DACFC7229A347CC34139CF9F2 gail.bonomo
458,335,560 *2E8BF445300DF05C888B79F373650CB9C008BA2F gail.drinnon
458,335,561 *2E8E81C57A2471ED30E48A55F9A36D3F32FC1831 gale.canady
458,335,562 *2E88BBB3911BC8A63C56FD308524676A6F6EDC3E garry.cosico
458,335,563 *2E8481750130234BDF90DEF6E1B47259735C2631 GATERECORDS
458,335,564 *2E84AFA2E2AFAC0C58502790C6AFFFE241F3C67E GawKieSt
458,335,565 *2E82E01C78622F5F37A43EE59877EDB80B8B3DC2 G-AXKT
458,335,566 *2E8267E1863803954C48FCA318E62B722BAECFF9 gene.mcgowan
458,335,567 *2E8C25A66E1F4A99F36C905D7E58B774489D9407 genibrouse
458,335,568 *2E83B01B1E005F31CD1A5017956A8AE29C61336B geoffrey.eapen
458,335,569 *2E8BFE46D98D6566D0E03688E12A3EEDF7466654 [email protected]
458,335,570 *2E8F5E967DBDAC8185061B10A24720294A1C181C Giennie3
458,335,571 *2E8B5EE2C968174CEDAECF96AB9B83D9D531DC03 giftefogeder
458,335,572 *2E84A8D5C155ED97D6A6C207E6EF388C0298E8A2 gilberto.mazzanti
458,335,573 *2E85ABA091F81ECB2395722E03F3DB7F143092B2 GILdER
458,335,574 *2E868AD4D3E8602389CB66E109ED04FDD9F656D9 giuseppe.amejorado
458,335,575 *2E88EA1BEBE6D8A31DC86AAD19965DED326DC4E5 glumakov
458,335,576 *2E85AD80963625D6AF12CAF95D7323897121C6FF gnage123
458,335,577 *2E8773964CA28F1A0D6AC26389D54CEBE9AF8727 golbamoussg
458,335,578 *2E8074BEE874F2A27DD2E0AEAA666B503A071625 gonzalo.mccarns
458,335,579 *2E8746BDAEDA77295FC9DE6D12C38A9A423BE641 graham begg
458,335,580 *2E8C03D0C5880C3AD6AA88579328E46478CDBED1 graig.gabriel
458,335,581 *2E806D0819CA7028A1041825D546409BA742A30C greg.naegle
458,335,582 *2E84D4286CEDC8109B6D331BA9FCD8053BDEDD5F gregory.copps
458,335,583 *2E8A430013E822F5202A09DFAAF924C8332B7F60 guilalo0
458,335,584 *2E8D31B6868DB63ECEC2DE93BA1E19CAD0FCF9FA [email protected]
458,335,585 *2E88A83A0D22618B826EFE8E62B926C38D1E7060 $hah
458,335,586 *2E838591CB7CBC7344A1961C6724C9B5C8897872 haleylandreth
458,335,587 *2E8BBB2D04D770E0669101B40DF03912E61A4A2F Hallamas4
458,335,588 *2E8966BCD7E6736694B239654555876A13A7C6F0 Hamburgerkette
458,335,589 *2E840E41E35EBE3927AD9C245451DB42E3FC7AAF [email protected]
458,335,590 *2E8F8D901BADFDF52E7C487EDA1A3502BCD013FF [email protected]
458,335,591 *2E8F3D266946D5A346DCE2D2AB9F4508BF5CC5BB [email protected]
458,335,592 *2E872687B606877FD2FD4AA5EB5ECF7175B0FF20 harmfarm6
458,335,593 *2E8A43AB9FE13EFF4029EC63A77A8933AAE12481 harmonyfriend
458,335,594 *2E80A4ABDF567CF1E6B3F3BD0CDEBF3F4BD70848 harold.feigenbaum
458,335,595 *2E80512520E1CF5F8F5F9D68522431D75E3B4CA0 harrison.shotton
458,335,596 *2E8B51D43E624ABBC34C1B6EFA3A0264A9AFA0C4 HERC1418
458,335,597 *2E803D889ED986EB2BD4DFB30E1AC0A92FB09C74 hershel.decuir
458,335,598 *2E877ABD7881A9C9AB4A7B4E28D02CFAD0527845 Hindiurdu4
458,335,599 *2E88965FC958EC76FAA3504CC74A23B01AED60A1 hindu-pilgrimage
458,335,600 *2E889A751C6BCE8E248DCF911580E99630D3E08E HL#J
458,335,601 *2E88AF4371F70D281D7F818A3BE5BA3202A5F075 hniine
458,335,602 *2E82BD27DEB278EF50E2412BDC8F2013FFD1B71F hokeydoke
458,335,603 *2E8926D161F0C6BD5A77D96E59F82325E6E2E5A3 HOLA8675309
458,335,604 *2E87FFF492FD2E022C23BA133B38F4CCE25F2363 holmströmiin
458,335,605 *2E8F5C2B2CCBBAAE32D2999E9B1731CD9A1FBCA0 homer.mock
458,335,606 *2E8FF9692577E66965BE359249450DBF96497721 horacio.vankirk
458,335,607 *2E8492EF1EC9AED4E64D22818D5B4FF1A86728AE Hostess/P
458,335,608 *2E8FAC2059FBBE1160BC5C15BE4EDFBF71622938 HOuNdeD
458,335,609 *2E89F8815F45CEF12E20CD767965D1E4C2190FC4 howard.michelli
458,335,610 *2E8173ED35B5AC4853B8CDAEA0DF4C25CD588EE1 hszndnwdmed
458,335,611 *2E8EA56D9A5208BD2EE50FC63DC3BBCD13E198A9 [email protected]
458,335,612 *2E8C2F0A51F8789DF3340BC34948524185C7C78F huictjours
458,335,613 *2E830855521A6A610579C369D2AD33DE51AC0E62 huolikkaasti
458,335,614 *2E847B7336AA19D8EEE272A66669D298C8E9F384 ianbushby
458,335,615 *2E8D569AF97323F68FBF9F7687CFE9E585F52C8D ibitztes0
458,335,616 *2E8E4311F9A4825B25ABBBB1A2BE6B6ADC3ED145 Icinreved
458,335,617 *2E811AAF473BBBC3E39D64727569323EEA7CE1AB IDon'tEvenKnowYourName(PassionPlay)
458,335,618 *2E89B1710B15352C2AE84024D598C6B5F1BBAC85 iglesia de san miguel de sanl
458,335,619 *2E8374A6D1B390ED129220C326E7A1F3A953B08F iheaderi3
458,335,620 *2E811D8C545351B98C669FB65BB5A273BA2A7D9C colin-rothbart
458,335,621 *2E8C9EEF2E8F75B1B994606952911941467E192F Illventi1
458,335,622 *2E8FAA34A75E5BF98610D9C3EF58715EBF388EA7 imagetynda
458,335,623 *2E83EE6A156B64D4247833FB8B0184FDF06616A0 {{imdb title|id=0286486|title=The Shield}}
458,335,624 *2E8537A65C7BEDE4562CDF0820CD1FE87EBDBCAA INCOLPASTI1
458,335,625 *2E84C2EF3A38EAB13370A9CE0D438A8C8ED8BFB5 CORTEZUNDERDUE
458,335,626 *2E8917774D39FD7191FD9910E4820922C43EA128 indiaglitz.co
458,335,627 *2E8FC10FFAAC1EBBD05E6121B4F8FC45D7348787 Ingkabaus
458,335,628 *2E8823AB247B6E6EB365B151619107435FCBB59C institutehalifax
458,335,629 *2E840D192AE106F7A11F471F0EDE3A19CEC63E4E inund4r3s
458,335,630 *2E8E494D47389A4901CDB10321E8F72F5ED442C8 ipjD
458,335,631 *2E8458CD82E1D40F79803F473AADE3BB05152FCE isaiah.havermale
458,335,632 *2E8FF4B26AFF1981F39C781C1FAE9389DEC8C5DF isaiah.tlatenchi
458,335,633 *2E8D5F9A8693B73AEB820537BCA4C7CDD4331171 isaias ibanez
458,335,634 *2E82301B77E4EBE22BF532DDB1B58D3867455F83 israel.zella
458,335,635 *2E8E07D5F20B10C82531B21D202C49BBBB35B94B ithenumah
458,335,636 *2E89DDB4EDA897D8AB3992B6D24C55573FBDB8F7 ivan.zasso
458,335,637 *2E8A824FD3BA5A67ED70F075FFEF6DF53DBF849E ivyhoho
458,335,638 *2E83365F09BB8BB59A2A952F58A7FB3550CB0515 jackiejanecek
458,335,639 *2E861460A95D9C37252AFCE11F0F71BE4C9FED95 jacob.schnell
458,335,640 *2E864E191639851CAE49F9935D6F39247B60FC7D jacqueline monaghan
458,335,641 *2E8F2F841273731810041B95CA72213F5342190E jacques.dreben
458,335,642 *2E839A996E8B58B607F7D26485B46F93D8083C8A jacques.knisely
458,335,643 *2E8035D6FA8BB57FCF5C57FCED6C44E0DD7E2CD9 jaime.stanzione
458,335,644 *2E8AAF8A8BFFCE79759E083D1C401A47CD084FF0 jamar.dire
458,335,645 *2E82681718CB900F6D8E505CC736162BC5EB9187 c%vjp
458,335,646 *2E87E1EB61F29CC2662A1F255BADF9AE3262EC7C jan.nasseri
458,335,647 *2E87A1548DA8DDEF18EC9F7CB941FBB424E55D0E jarrod.lapham
458,335,648 *2E880CC698FA3C615EAB932A0AA30221643DECE6 jay wilson
458,335,649 *2E859DBD51F4F53F6D4C434A403BF618C3191FEF jdriss
458,335,650 *2E8C507F26FBF78E2C997B33EAD82B08A0F159F4 jerome java
458,335,651 *2E881704B0A52C597273B0EA24B527EA207A64ED jglndls
458,335,652 *2E87F57EAA4CAD6333751F2F6382F05533BA61D9 jhounna
458,335,653 *2E80664396CA31DD3BD444C891DCA67E5AE73F69 JKrj
458,335,654 *2E8A012A8F3B94E566020012BED2F670EA069C05 jljbcgame
458,335,655 *2E84EB42272DF9F0BD4FBBA69DB0C47B7790686C jLw6
458,335,656 *2E877B34D8D19C181D2E77E83CB71F842843D09C jody.zellner
458,335,657 *2E88575173856F172C66149B4A6E5A0274F001B1 !JOEL25!
458,335,658 *2E82AE7D39EA1DA78573FED2866503C914E51442 joeyrux9
458,335,659 *2E875D335FDF46A883F055EF5260402A45BCC72C JOKER442-
458,335,660 *2E80B971A7A7EA95B4FD3585D2D2AA5987AB4F9F jonah.geoghegan
458,335,661 *2E84EEC031B00D71E3C6AFD6281ADA7DCAC67F54 jonathan gilliam
458,335,662 *2E821F0F08D1192857138D70D7A419595FA47A7F jonathan.sickman
458,335,663 *2E80B302AFCE635722504731CA30F5725E97BC11 jonathon.gremer
458,335,664 *2E8A1BE5F29D568FAE3420D9EAEBD1AA75F32FF2 jon.liehr
458,335,665 *2E8C7F3F021CAB9CF2382CF068908988C47130E6 jordan.grav
458,335,666 *2E8B64B4A31256C62F7FA2F981270A68516B7FCB josue.kanney
458,335,667 *2E83BCD228D8271A093AED4B8572D1A70328D3F6 joyceborman
458,335,668 *2E8A5B055FA5517AC873B43B6C734615DFA86DD8 jpurplez
458,335,669 *2E8AAC7412A71886ADAE53CF86C45688BD0E8639 Jpxo
458,335,670 *2E84D888319C2CB85C5AF0F6935174F723E2312D jsiewerd
458,335,671 *2E8DA6657E7FDBA5A2211A26D86FA17D8C624F24 jugation.
458,335,672 *2E8A53D2F44E0E7ED1A940535F55BDF145549812 kallianas
458,335,673 *2E8B9E4991E509281E197AB131768AFD04E1871E Debatt2
458,335,674 *2E8AE06CA117C22D67CEBF05FC0B5C9D930FC88E kassei”
458,335,675 *2E8F5FBBB1D143DDFF0041F7F70AB557B00519D3 KATE1989
458,335,676 *2E85F1CE7631AA38D5A1421F9AE9F7C6961DCC41 katholoschen
458,335,677 *2E8040FE2E3074ABDC65988C780E0476DEE0DDF1 DEMARCUSHENAIRE
458,335,678 *2E8306ED6F6D8CDEA3ED4926D26C7F9E87B7237A KbCKBWI4
458,335,679 *2E8B0ECFFBF605549D07CE2C9A3F1B53B4601A63 kcstokes
458,335,680 *2E88C2161C8F173787238722F0AEE24E35968CD2 kE<4
458,335,681 *2E8AEFD9C7FFC9E17DDD06CAE2D3D9DE41EEDE91 keith.strandburg
458,335,682 *2E80E8CAAF49DAE27E4F57C8C72553489CDD8539 kendall.vigliotti
458,335,683 *2E8B0171829CB7AB12A8D57B9D2C7C953CB6627E keneth.bossenbroek
458,335,684 *2E8A83260DEBA782435E054C74A79B029DA16FAF kevin.jirasek
458,335,685 *2E8AED1232A3F2B48F29DFC61127FEFB59C911A1 [email protected]
458,335,686 *2E87EED4B5C41F63EF84FD92E2362CDF22D59A38 KOBI1999
458,335,687 *2E80B62D9DE6767F4CA1210F92908CF6D4B4292F [email protected]
458,335,688 *2E8290D5B75DDFD71DC997A8AFCF8433EFCC0C57 konsuls1234
458,335,689 *2E84926E45D9DCA4225E5DC63D9286CB9BE56F0D Kontrollrutinene
458,335,690 *2E8E31ED28277813D547A785B60A9E7BE0B7711B Koolgrui4
458,335,691 *2E87A2A1FECCB53C88B23C74B0C3E8AB7631DFBF kriggs00
458,335,692 *2E8F28B6703A52CFD5DF022D1A89107AA18EAFB8 kristopher.schwanebeck
458,335,693 *2E814B84869E4967DF29A48CB91341B877FE743C KYLDEX
458,335,694 *2E8282884BA99EC0331A6C3B70021F315DB88091 Lahdenper5
458,335,695 *2E865B463AB18717EE8F8236FEBAC5225A01C69A laivastonpäällikkö
458,335,696 *2E89CD3B88BDC30A1A5CCB3E7A65D46F74641EC1 latifolia.6
458,335,697 *2E877718D08EE01C0848E109FA1C7A008FCA2809 lauren.yagoda
458,335,698 *2E8140691C7D76CDC5F93CB714DA98A542692826 doe+h
458,335,699 *2E8B8D1ED70D30FC780FBDC7A5E880FA4A62AC22 DOGMIEN4
458,335,700 *2E8DB1C2434BBF5C4BE0FD0C142608812F0D2AB6 läutesignalanlage
458,335,701 *2E815DA58C6578F5D5EB89F94B1FFD2A79D0847F laverne.jarels
458,335,702 *2E8D46AC4B36D61181CBBE8466C02E0CBF9901EE lazyriver1
458,335,703 *2E891318612B6964F714E9F00F620B893BFCA130 [email protected]
458,335,704 *2E84E99BC0C0CF8283DD55E2AA95B6561404A673 leigh piggott
458,335,705 *2E89E7F0FBB7CF9B08727181EE411ADB1C6937B2 leonardo.hauff
458,335,706 *2E821C7AA6A15AC0DC0741D1A5A8C8B01F0B566D lesliensdusang
458,335,707 *2E82786205E746B8A941179FD46DE64F131019BE d_rmr
458,335,708 *2E8F86395F4B55EFD0C9B932C7B6EF9B2E4178A9 [email protected]
458,335,709 *2E8152FC9C67FDB1047555C34ED6FCC72874ECE0 Lirikët
458,335,710 *2E814DEA6054A3F97BF413FC8F3999F46BF05A7B LiST 2 OR MORE PATTERNS FOR FULL CREDiT.
458,335,711 *2E8065D9DD375F966FACEA84A86CE47F0E4823B1 Liudvika4
458,335,712 *2E8B57737139FA7300A99D95AF4A52DAA945C095 Living a Lie (unplugged)
458,335,713 *2E82E80452572308FE0EAE18573527B72B728EAC lloyd.sadowski
458,335,714 *2E8E1F9BFE133FB3663F01BB75CA99EDBA38CE56 logan.bye
458,335,715 *2E8075A0477F963D6B62385CDE19304E06CA84D5 [email protected]
458,335,716 *2E88698A91EF9A935BD0476993B547BB16CDDB40 lorenhickman
458,335,717 *2E8643087317F28F2B8B9861F63CD5ACCE043FF7 los santos provincia
458,335,718 *2E8FED98F4BE2A20226431A495CFDA6A327417A4 Louisewalker
458,335,719 *2E8F235EE7930F7AED9B01D19A6D286E0F5509AA ltellios
458,335,720 *2E8658BE55409CBF0AE8DC2711D36172D454F627 egnealk1
458,335,721 *2E8907B97132F049BEC9AAE4E7E753025F21CA1B lucien.evertt
458,335,722 *2E845A01400DB041C69710FC8A464B17FF3E218E luigi.brobst
458,335,723 *2E8BEF538D98C06CCBFB3305E71F06AD8796A19F [email protected]
458,335,724 *2E8E7C281B367CDF89A0D517CA35A78ED1D1BCAB luther.delcolle
458,335,725 *2E8D8386DE72F135EF012FCA7968675777DA4268 luther.moutray
458,335,726 *2E8E188DBAA4FD5691A83B2930DAC8F8FA6C9D96 lyman.schwertfeger
458,335,727 *2E8E8976E4487DA2B3D4E8F523E86A1C94ED2C44 [email protected]
458,335,728 *2E8B50006AD72FFA3CE665ECECADC1D29EA4F656 EMAD-JAWED
458,335,729 *2E81C7E288A4D6AEE4AEA7BB79A185D52294CD11 emcfs
458,335,730 *2E8DA47AC774B086ECD543B65EE6B86AA07A4B0B EMILIOBEAHM
458,335,731 *2E8274BC16AC3D24CE47AB0D807C530A15D0B16E EMQ"N
458,335,732 *2E8193FF5B536D5B0870E085B6E1CA69DCD4A165 enohpesr1
458,335,733 *2E85ACBDF8BEA22426257DDA5877DD55D103691B ENTRANAREM1
458,335,734 *2E80E4198B39AB20C51B34B0831C32CC62883FBA eocgb
458,335,735 *2E87B365D6A4A3ED4669554C66F3F5AE5BEABE8F EQT3-
458,335,736 *2E836B6E32655CFF7C6887A8C9AB523AE4A5E6CE Maciejach
458,335,737 *2E8EEBE4CCB6DC5D8F92DDA96CF3398558BAC8FE madhu goenka
458,335,738 *2E87277F95713F15C22C8C5A2DB36CD15544C1FA Madilyn595
458,335,739 *2E801E5516C9C7CD942A28E01C71839916555A89 maeshori0
458,335,740 *2E89D24720B1B908D0CB0A8FD5BDB58CC501D639 magdalenaschmidgall
458,335,741 *2E812A50E9F4BE8699F71F7B867AD2A9B02458C2 [email protected]
458,335,742 *2E8953AEB0E227118E1A7A6A0E753F11EA7D1232 malcom.muchortow
458,335,743 *2E8E5003C59AD774F174FCF3DE67E6767F14B4AE managuans1
458,335,744 *2E81DFC86403A814117335204C02EE66393BDE05 Manufakturbüro
458,335,745 *2E84FBB77E994E095D643EDFAD0DBCC6DD110245 marcelo.sass
458,335,746 *2E886BC813DF3151027637396A0BEA1D75AD305F marcos.jacobsohn
458,335,747 *2E81FB103C11D8C3CDAEA98683F498B6AB53A9BC margarito.cassatt
458,335,748 *2E8E7F6B9F71258A6A448699FDF6F0537E59D7C5 maria.ambrosini
458,335,749 *2E864A544CFB4F393EBA1F3650B2798FD63AEA17 marinda mulder
458,335,750 *2E8D61F7939D09A88E8EA6D408221BC4D3D1EEBC MarionCompReport12
458,335,751 *2E81C2E1A08A156C3778F3ABF9E2CDE7A02452EB Marknadsföringens
458,335,752 *2E894802F06DE739F4949935C4FC26AB16329BDE MartinChuzzlewit
458,335,753 *2E88791C2DFD2DF3B8BB3FB7ECA6113989A1B41E maryransom
458,335,754 *2E8F870B0D9373A59FBE62F0F6D0627E39FCAF44 Matrones2
458,335,755 *2E8984F6452BF6B03ECAB970886F591BAEE3A181 mauricepriv
458,335,756 *2E88C512D5E653FB31CEEE33EC8275D7DE511EFE mauricio.blacksmith
458,335,757 *2E80CD72EBB34D0A8CF9B348F10BED7BCDF3BC33 mauro.sester
458,335,758 *2E80C280D3D3C1911CB8B918C9AEE37950E1FA1C mcaeonr93
458,335,759 *2E838ADF19346C212A56FE34DD53B441D3377001 menorhagy
458,335,760 *2E8B78A8488B94F3444D1C9E462E51BD64E89AA0 merrill.calcagni
458,335,761 *2E8ACA36DE8770B76225813E55A7A954973C90D6 METASTASIS7
458,335,762 *2E875A786DD64F25443D14682965B22958D4FB7E mi+}
458,335,763 *2E82ED0D370581F6F24DB3EF8E27A1FA2F190909 micah.brierre
458,335,764 *2E8F4B249D5B32F3B125C1E8EB963C31209A44C8 micah.rossel
458,335,765 *2E89B4E0AD8B447C26C8F975F2C796A7D4400908 [email protected]@l
458,335,766 *2E8EC5765C383209E85B58517886662194D1ECD3 michal.depont
458,335,767 *2E815C4A4B6CE05248F1F4DCEAA144C932634FE0 michanned
458,335,768 *2E8E9BCA6D75A3F96E1C4D988978F8A5C8AB02EB MICKEY0531
458,335,769 *2E83E567D8A18B7E4F36B28095715F76973E7D1D [email protected]
458,335,770 *2E8459B3171FC7BAC79B19296C235DC9F48C8844 mikezieg
458,335,771 *2E8965459A6646B257AE07E401D6C10F23CB7D8A MILLION-FOR-NEW-SCIENCE-FACILITY
458,335,772 *2E86B41DDEA783DED771CAFC6B82504BC07ACD0F minh.bittle
458,335,773 *2E88CAACAA814701818DF51536ACA93714D3FAF0 miriamsouza
458,335,774 *2E8FB751E6FECCA3ED712568D9D43DA4011DB7B9 mitchell.hruska
458,335,775 *2E873F5C1826F2F58A2C56707B75A92F8F226F3A MM80457623
458,335,776 *2E80E76D9F1C4C98DB854DFEE43456A6132B5E10 modelkootool
458,335,777 *2E8D1C715D1519D6574BDA1888FE6E65D0DBD04E modmyprofile.com
458,335,778 *2E8A33B74613864CC2ECE3CAC684C59F6732F541 mohammad erekat
458,335,779 *2E85AE816DCF7DEA3BE500EAD23B0D096B949CAF moses.dockus
458,335,780 *2E8AEF8EF5183EEB19F54D4F687E1B1186796FFC mtodurkar
458,335,781 *2E81A363744FE97EA0C00C5C198363838D906786 mult!n4t!0n4ls
458,335,782 *2E8AE32FF5B5A84709C74DF322618F32B92CDE80 mvinande
458,335,783 *2E8A0C8FECEF034077C5D21389417BA3765CB499 Nadobudnoga
458,335,784 *2E8390D1D67E14FA5B0E24E5F32C436EEEA0763F ncarella
458,335,785 *2E82E5805E2773394C4A8DC2A8EDC786F7C9EBBA nebojsaivanovic
458,335,786 *2E8FB47C208246E9165C905F9643D19DE6C723B8 neilespinoza
458,335,787 *2E86EA03A87511043417A155D654CDE39D71B06F neil.hauxwell
458,335,788 *2E8AC7C748E9C4637169784484FB0E79D59DE9F1 nestor.conti
458,335,789 *2E85D08E9AA7B25AC70EABC2AEFC554797EB3788 neutropenia),因為感染在低嗜中性球病患可能快速進展。
458,335,790 *2E8CD82903951EAB75BFF3A66E5CEEE47CC3FB0C neworleanscarriages
458,335,791 *2E83D10ED46AFEAE266DE43C7431159D67BFC9C9 nhFaaa
458,335,792 *2E812CEC73626117F410EF58DAE349F07998260A niezachówka
458,335,793 *2E8715130AC7F5285441C0488C2571E3202C88A1 nogueira-has-sever-staph-infection-ufc
458,335,794 *2E8A119E877F367A699F3846C8E2E8FD726DE5C2 、HEEWON
458,335,795 *2E85DD8644CBE14C71BD8C3E5CE43DB0DC16FF13 nowenowe
458,335,796 *2E88DEB584AEE372FAD4FE4694145C529BB36371 nT5y
458,335,797 *2E845898C98EB072A84F92E7C747A138498B36C9 Nzwrshls
458,335,798 *2E8CA86A240D869AFEB4FDF23283A1364FB18E00 O\}&
458,335,799 *2E86B01DAE2D5488ABBC09B597CC1C8859237E75 o3295
458,335,800 *2E8EA6E70A84875629AE7D3BD0C6380302BBA7FA .ocheltree
458,335,801 *2E8E7135C52A6C90E113BEEC5297748C6CCC9A02 odell.draine
458,335,802 *2E8828A31070AA281AEB03BA21E3621A84DF7595 odis.etkin
458,335,803 *2E896727E2153B9AA1C11E13AD222BB94CE2A23D oFee
458,335,804 *2E8F39828B5442EA32D04FBE0322D71DFAE994B7 OFEVERGREEN
458,335,805 *2E8E1B83D88D1B0A549D69A63133BA9D3A4494E8 oktafiaa
458,335,806 *2E876D40DAB2CF63899FBD2ED5CA0AA55D9CC36E olen.franco
458,335,807 *2E826E4E1FFADA26C1C488C927B78FE700042711 olin.pintado
458,335,808 *2E8E9EAAF375A121A3428FADFE8E4B919DC3E5ED oliver.jufer
458,335,809 *2E8262184C259E5DD3E8B8E30BA0337107129088 oneofthegreatestmandolinplayersinthewholeworldrighthere
458,335,810 *2E8D8F15DAF1DFA4709896FD58F23C7C4994A09E [email protected]
458,335,811 *2E85B50487E0BEA31E0289965971A8378C30A477 )o(o~0~ @######P
458,335,812 *2E80DCB11B0B222B23CB0A292A1A5982D25473B2 oqQa
458,335,813 *2E896286F064EEEAAAC5EADDA54B895A8A768D32 Orkadische
458,335,814 *2E89BC360985B774DCE1DC01B11A963F1E9C65FA orval.rayam
458,335,815 *2E8003DF4E17FDBA932576CBC48453DCD54F0EFC oscar.homma
458,335,816 *2E82E4EF56ED3B125605059B2A28CC438F58A6BB OtherSideofAntarctica
458,335,817 *2E84C315116155C9415A6247481131D903654DB4 otis.kevorkian
458,335,818 *2E8050053244562DB36AF876CF9FA8785BAB347D otticianfao1
458,335,819 *2E8D2146F1F67C79F764FA3E09B496872F93F322 otto.culberth
458,335,820 *2E89ECE652FFAA2949B97DB787E61176A3A6B30C otto.macmanus
458,335,821 *2E8159595B20E3F9528CBBF9DCA46F3E0FE0CD76 out of madness
458,335,822 *2E8C749F10E742D58395E96F9D8A3DFB80A469D0 owen.zschoche
458,335,823 *2E807B5FE3FCD944EEC4E084EA53BB91BDA4BC8B p----->~0 ~o UU
458,335,824 *2E87B6CE961BD20CCD28E4BC2A2F8697105E7976 PAASKEDAG6
458,335,825 *2E849BACBDC5148D85BE98E99E352326F0B1DCE9 palmer.melberg
458,335,826 *2E81044BEED6C9AEB8465FEC989B27DD2600FBB8 IBROLITED
458,335,827 *2E883216619D8AAAD586F0E30B50ECAE527BED1A [email protected]
458,335,828 *2E885DF31E99310CC520FA3C2186E17999158ECA Patuparni
458,335,829 *2E82100DB4AAEAEFD28F4DDE4A6769D3CEA29906 [email protected]
458,335,830 *2E8A0CFC6E34BA68243B9B29D01B1175E72A1E1E „Pep“
458,335,831 *2E8D119FCD5418E2A0A8B2D18768D3F3F427AAD9 personal usage
458,335,832 *2E84BF44D3D685110FD213C24CC306BC1CC7A031 petechi7
458,335,833 *2E8E5D42A540378CA77AEC626F952A02273D88DD pete.pilotte
458,335,834 *2E80249549F8EA04189834980CDA4F669C3AB57E Pfaffen6
458,335,835 *2E8A63421D26CA291D4C38EF556BBF35543CB72D phouthakesone
458,335,836 *2E883C7BE4AA8D44FBADB8558523D9631972C6AC [email protected]
458,335,837 *2E83F6B003062F5584924FF4EB30D41CF3BD5EB2 PLA1N+1VELY
458,335,838 *2E8DAB86CE97101E2E60E2AAFC1F00B642CB741F pmc1566439
458,335,839 *2E840EF280A4C2CFB8027D046C31B3C2ECA03BE9 po.[
458,335,840 *2E8DBC17EF3CD084CA7540303F1FD46D53A83349 IVAN.SCHULTHEIS
458,335,841 *2E8C88986994AF866B311580D5B276383519A387 pokken6
458,335,842 *2E8B9DAE0991A870C909BC68C9DB5B44C5BEEC08 porzadnied
458,335,843 *2E8675963978C4578D244219B9CEE163F84D3BAD p----P* * }O{
458,335,844 *2E80071D5E10E962820B73C13B6862392E91BA9E praestansque
458,335,845 *2E8174FECEE0B6462267E6DA18C65C5B33D2D126 Prdscrtned
458,335,846 *2E82C7E196A2E918B555E212547246E533419927 PREFIL
458,335,847 *2E8A9FB56FDFA006ADF812DE449690216242B91B prince.santheson
458,335,848 *2E84521392B2E29DD98862D5C907DA9A2CA6C453 princessquintos
458,335,849 *2E8B20DDF724BBDF02477A3ADFB09C2C79802BEE ps3ud0p0rphyritic
458,335,850 *2E8FF239F0C8826229CFE246EDDC6EAE316BB619 pSto
458,335,851 *2E8B4F2A428815BAB59620155E1CD3A14C2015DD [email protected]
458,335,852 *2E8EC9F4A4ED1265BB60D29A367E1C303540E49D purshia?
458,335,853 *2E821028CAC1D35CB3C8949BEF1162E86C498D82 [email protected]
458,335,854 *2E80A00FF0FB28129CD2D0B3B3507DD463056DBF pustno
458,335,855 *2E8AEA2226ECE14E8C9D5D9A074BE9673974F3F8 }$Q
458,335,856 *2E8918F7551CCDF01C3B5776287789D57BD11D04 q102326
458,335,857 *2E89740D1CCF3D2018ED92B351783089E156E82D [email protected]
458,335,858 *2E848090D4B1AF7DFA22521127F4D35C72C34518 [email protected]
458,335,859 *2E82CEE6A6954D72391EDA779912681CCD80D545 [email protected]
458,335,860 *2E8863FADA9EAA8386603B5255E589C0D6D696F2 qis2cute
458,335,861 *2E83115A5E62864687FFB3972B536FD869F5DBEC QUARRE1ED
458,335,862 *2E81F4FE7529547E2BEA16A1553C2748AC605191 Quotatosed
458,335,863 *2E8DD5108306B5A7E9A6B0DF4011492776E3079D quotsn0wflakequot
458,335,864 *2E8DB92DC983B41850A1A6D6C7A821C07F18E3DD qxybl1zzehq7svn0
458,335,865 *2E81F8AC941BEA75CF1770D1F6F601D4E6D8F013 rafalafena
458,335,866 *2E850755C66EAF838D7923082C9022515F66CA68 randall.guffin
458,335,867 *2E85204F49914C14632CBB2C6601B660D14A258B RantovanKarantzits
458,335,868 *2E83B9F98582FDF6D1EBEABCCA2EAAE081751462 RASAGOUNDEN
458,335,869 *2E8C48AE6EC2F48C87EF8F69B60E7EA2108E3012 Ratsvan5
458,335,870 *2E8478D2BB8D85C3FF33A449BCFC90284C1549D7 raymond asher
458,335,871 *2E861511B0C9F4158D3D326761B1437716146268 raymon.lachowicz
458,335,872 *2E863D8325DDDC8D5C8DFFE3B574DFE5E6880695 ray.rethman
458,335,873 *2E8224E108ECDEECB7411248C2C7E275718B64CE ray.wiswall
458,335,874 *2E88C99B8F74FC33C54DADCD7EB3B4F4CC29BB3E [email protected]
458,335,875 *2E89BB80E42EE4CF0320439845D500953CEA6847 JX2K
458,335,876 *2E83CE31855CD707B3844702E0F1AC3A469B4F14 reemwd123
458,335,877 *2E8D70DE95DDB09D13AFEC215BAEC77B8E470C88 reginald.mascari
458,335,878 *2E8BAFDB244FFDD32F90AF69189DE91459888059 reid.bouwens
458,335,879 *2E8F9B83430B697A732726ECDE9170D6002CA46B reiwroov6
458,335,880 *2E86F54FE00958B0E06491BAD46C376CAC3766BB remark.countmippipop
458,335,881 *2E831EA40A961322E4833266F5D01D1E131D1C2D rememberdragon0
458,335,882 *2E8A8CCA38F5C275AA626B2C50D55085342BD844 renato.sane
458,335,883 *2E8A8DBD1216D7A9C0425A4FDECF7F49B4FF34CA replacented
458,335,884 *2E8546668678DFF4D05F3FA32ACBA39EF947E24B replacetemp4041
458,335,885 *2E8B7CB8A1EF421C14B7FCCC704194D562E7A8AA reuseabnessn9
458,335,886 *2E82C8572057DB45FDFDCCA8FA5FE0CE89755F86 reyes)の出身地でもあった。
458,335,887 *2E89F54EA7ECBC97BE80301461B446EEA09FDC59 Rhianna146
458,335,888 *2E8380CE0780263D8B7FD768C46D1E331DA40B45 rigoberto.yousef
458,335,889 *2E8ADFC59F016CC730777E4F75E4FB69947B6B2A risogna
458,335,890 *2E87D342B177FBD977A14E29027C96FF766EE3DC riversun1234
458,335,891 *2E84454E14AC82BEA5648DFB4423D3AAAE9CC2FB Rixdale4
458,335,892 *2E86F39E482602D7FF2007268C7B7895E042F0D2 rjhamonr
458,335,893 *2E803F3F92C84A828A111C1599F891F5AF6865E8 rltynmbr1
458,335,894 *2E8ED7047E76F6FE72E0649D14DA31778803B5C0 roberto.castine
458,335,895 *2E81DBFF2350848D0C1DC8C807FAE8DFE7E043A8 rolando.wasp
458,335,896 *2E8A9BB29956D280195F27A1EA0589E141E5E689 ron.amsinger
458,335,897 *2E89F02E08F5A1FB3F5D1146DBA31066C792F20A ron.lambe
458,335,898 *2E87FF40C8D2198E480DF28B621025A5B5A559BF ronny.tibolla
458,335,899 *2E8C6A765145781CB56A2F3B15DC8040D1BA1763 roomtoiletteurinalwashroomwater1
458,335,900 *2E8D7B99F6D1F39DE7FBBDA4CCFB4D980D4E6F44 roy.colberg
458,335,901 *2E850CC7DD9463D1A74D8D0C0036F6C1C6037F30 rtrd1313
458,335,902 *2E8CBE272F25935AD056BF7F0EB25F9FEF24D13C russel.pirolli
458,335,903 *2E8DA78738000DF0BA6FBB9E993B13CBC3649938 rusty.mega
458,335,904 *2E88C6278B70984A187F2183952B0FA20B83856F rvn?
458,335,905 *2E87C51AA0CC30E51635AF8A70D44D8BCCAAF91F rwa6686:Orca6686
458,335,906 *2E8E3A4832873E3DA2B724661275209B4FE28DE1 Saalbühnen
458,335,907 *2E8E86BBA4DF5A9C895D30CDFF58DE61609AAAC2 sachwalter4
458,335,908 *2E81A02BBEDC9D3AB5B0F235816501E845BD5CC8 salinitet
458,335,909 *2E83B554C670BFC680D744891F3FC20E54497E06 Salpingopalatal.
458,335,910 *2E88091789881DA55E0B9CA22DB8022443E595FF Salylim
458,335,911 *2E83A3ACD690394E6E43CDA5AAD26E194F1E2C76 sandasi7
458,335,912 *2E859CAC28E2543B9F43A0F39C3AFCB704327B9B Sandin12
458,335,913 *2E80D73861DF2CC3F62E8064F2F9B32DF3EC435B santos.groman
458,335,914 *2E88AE6E143EF9829838626EAB7153A80435B484 santraal8
458,335,915 *2E86172B2F816F7F32B3E9BE900B5C50166B8DFA sarah el hajj
458,335,916 *2E8E29130D93D25B54DBACEF2C2F5E1C5E26E216 sarahharrying
458,335,917 *2E885A7D9C305FF141A5C5CCD28E9D88EF11A88B SASSAMANSVILLE?
458,335,918 *2E89E032623F8694806A4CD43EF273C70B96499E savannah soria
458,335,919 *2E8DAC1D14DC7334B28E5348E838A0B125BF1B38 saymeln
458,335,920 *2E8050A22F2ACD971D3AC784AC5956C39F3278AE schurdakbsw7
458,335,921 *2E8EB5415131246F86FD1860F4A10770971E7E7F sciaguras8
458,335,922 *2E804CB6EDC5D3B3B79960781E4BB7BC6FF240E1 SCRAP
458,335,923 *2E8EC506ACCFE5809F228B7AA33C09B879B95FF6 sednahcring
458,335,924 *2E8103BD0F8B901E1A30EB2395F3A5F4DE0F2E56 seiruoleD
458,335,925 *2E87D779DB3E8561CA4C9B95217EC64E786615E5 selfworshipping5
458,335,926 *2E8E8919ACBD8B07828ABC4FDA2679BCAA64D146 semidivision1
458,335,927 *2E80D2370BE35F98193C91484308A7026E842CB6 seriotargim
458,335,928 *2E830F7D738EF6CE52BA921024E7E69FF1BD0467 shadwife7
458,335,929 *2E873DF93C60DDBE5E7709803497D9EE04A5F529 shawnjensens
458,335,930 *2E8B1B2FCA374800C156D30A77E8296B4293C7E5 Shitdoom2
458,335,931 *2E83403FDE1B72FBB01DA0BADBBE9A193DCD4399 shoespaintered
458,335,932 *2E884345CC566116E73E8DEF14847276B35140E8 Shoujiku4
458,335,933 *2E8016A400A4CA76AD7AFC3EAB0D7B7E6391852C showbreads4
458,335,934 *2E8B4762ED0A1E1D608C8EA9871D33D2A144DC97 showsum
458,335,935 *2E83DA10D4CF473D8398E77BA6B241762C331D41 shrdruttjjiving
458,335,936 *2E8FA6907DFA778983D6309FA911802A3AB53D50 shweta sahay
458,335,937 *2E82965BBA5C17459C9CEA0DB7B62B9801DA644D simon.rieb
458,335,938 *2E8C728AE29444459EB5FCD6E246BCAE24B81626 sinagogge
458,335,939 *2E845B066DF912135F153BCAADA55BC6100A7D1D sistematikako
458,335,940 *2E8F753A044D52D070EA8F85002222FE612334BF six60
458,335,941 *2E8401EEEED9B04DF8E6C9DC1BC3F035227B3882 skyandtoni
458,335,942 *2E89D2C11FB7EADAAEF3884C1E4E6B524F98C1D1 smileiguana3
458,335,943 *2E836D742EF28CE35F482AB14396974D95712D8A MARCOS.WATER
458,335,944 *2E899484045F1B262CC0E1310753369306097047 MARSHALLCHINZI
458,335,945 *2E8F5E9C8637623B451F91B25AFDD63431F69B93 MARTINDUBUC
458,335,946 *2E8948ED8C121C3D4435D63C0C6F31241325A1B4 MARYBELORTIZ
458,335,947 *2E85AA824D24CB38164B57B1A7D6152F48886E3A matthew.laurie
458,335,948 *2E86A9C4E734C25E1700D8768D10EF1D2D549003 maximohenn
458,335,949 *2E84CA1420EFE3CDF32373445069991C743FC870 [email protected]
458,335,950 *2E843F92F9D00DEDCA420805911046B9CBE19C1A MedievalDances(DanceTune;Stantipes;French)
458,335,951 *2E80FB24BE5B74245BE2EBD9276C6702A7981584 MENTIŌ
458,335,952 *2E890613FDF56B095201627B3C2E72BB8CA3D6CF smillarr
458,335,953 *2E8F03911ECCE664E70CBDA7D18AB5EC60314365 snickerslindseied
458,335,954 *2E87F126CBF06DA7201BB6ED626334EADBBA0F33 snskrtz
458,335,955 *2E81B1DD698E1205A4E8FA7EF1B12E894FFBC996 SOHKDKDLB;
458,335,956 *2E8D07E320C80378A8726B9BDCFAE49F11AF8583 solidists
458,335,957 *2E8D4C2D674A326BE6568A04DF50C1ECDF04A7A8 mike.braga
458,335,958 *2E8E1DCBA2501A0C75231EB15141239957A88E7F songofshadows
458,335,959 *2E8C9E200C61E661EDECC6579AC0A596D34F1657 Sothiacs0
458,335,960 *2E8319ADD5C2D08EA398BF71EC4450CD5D6EFDD5 Spaceboyz
458,335,961 *2E81F92A9B9704E1D0EA6C87651629C2269A7EF0 speakerambassador
458,335,962 *2E806D9B0CB776C6669C0CDDBE36F18F88A22D1E SPINNING GLAND
458,335,963 *2E8A76D4E83218998597D2DCEC8BF5F757EA520A MORTON.COLIER
458,335,964 *2E8E5DF91FBA1C441A591F9D24C434B6C2602134 spkyswtp
458,335,965 *2E82BC5F34C23B2CFEBEC3089461D6C8BB3E6C24 Sploit* * *<------B
458,335,966 *2E8FEC304833EB73383CF3CAEEB9B8D304B85C11 sruesiruas.
458,335,967 *2E8AB06900C0BEA9EE454ACF52524E84619CDBE6 ssecpmhz8
458,335,968 *2E84E358A003A246AD3FA87863DDCF7E8EB17E32 sslungs!
458,335,969 *2E8F971710B23F9A44EA8CF7A223D238C2442C21 stacey.hannigan
458,335,970 *2E8EAFE86FAA497671C9048AFA51968D6D16AD4D Stahlguß“
458,335,971 *2E89738648E83D0B2F2CD6074B40F235B583A2C5 Stanley576
458,335,972 *2E8598E0179CC37BEA5981E4D24846829B84541A stan.theil
458,335,973 *2E84E562750765CC0A814FC0C1651D70527003AD natappian
458,335,974 *2E844807BBF2CD4961C2C6EB7B00CAC0974534EF nathanielburgos
458,335,975 *2E89CFC8235920602DEEC4519F435CC4AB7455E1 stephanie del aguila
458,335,976 *2E80AA0A1D6D4DFF57E2E2D41E65998E93AD3691 stephen.deblase
458,335,977 *2E8C92BAD8BFD6D54984F327E2864ABDED68B78B stephen storey
458,335,978 *2E89DDFDA4F2864697DEFA2FF70F317B73ED0518 sterling.boecker
458,335,979 *2E855801BEEE1E870200CC6AD487D49765E5C19F STEVENSTONE
458,335,980 *2E853EF6A66E995358B7E8447D74527360618862 steverpascal
458,335,981 *2E8BEF1518DE1A43E80FFAC30E205EAAB569018E stoksielalleen0
458,335,982 *2E8337BADC10E6C78AF6C4BE8FC444C189BCF5F6 straike?
458,335,983 *2E8C4BC3EC2817C3EB0945DFF62C1080E4EBEEC1 NJZJTIYQHCOOOKRFJJYD
458,335,984 *2E876F3CD96E8778BB412D8DA043722BFD747C10 nnaear
458,335,985 *2E86A754954194C9878F691ED158EE77DC15BA31 NONEVEA
458,335,986 *2E8DFD5AD05D6E326D8BE6A3FFA9C75BC16545EF nonshredding4
458,335,987 *2E84E30A0389D5DC402E44CB3F6F2ACB48522FBB NOTE:ACCENTSHAVEBEENSTRIPPEDFROMWORDS,EG,'ETUDE'
458,335,988 *2E8D55ED6D8F64F97CF3FCEB4D1604187613C885 NOURHANEID
458,335,989 *2E8059AB4A3D3DF541398C27C5A8FA14EE47EA47 sudanskom8
458,335,990 *2E8A839CCB8DA1F43562464DDD5BFF2261733D0E sung.pleau
458,335,991 *2E8F66C1FD9A7161E006760B770D44700885E6DA sunil pk
458,335,992 *2E8DC0A2307619DAA135D2AC978396324E735F0F suonigitepmis
458,335,993 *2E85DDF07185872208BB220A510DA18EB3F2282C supercentenarianslis
458,335,994 *2E8C11CB9256ECFC5C8A52DE5E6D1993F22E4698 superglobal3
458,335,995 *2E8F11ECFF592395531737769E2A403402B4492D suplicandoed
458,335,996 *2E81998D231AF2C57F17392761C6D6338C038A95 svaleganges6
458,335,997 *2E889B8CD651D8863C2F289F0BBE4C4CC99D4A30 t4t4rurox4n4
458,335,998 *2E888785BF55448DBE434DBA8E1F9E2FC2E975D0 tahitt
458,335,999 *2E8CCAC15F3FAEC905A623146DB9C4FAA23E069B talk97.91.156.41
458,336,000 *2E841B7B80A2420A2A8A9EF2913A4EF9F3734C92 talkbeckeykane
458,336,001 *2E85E62FC83087919BB348DAECE866C323313EEE talkbobdole360
458,336,002 *2E81BD91458BC53C6B1CD9EEF60AD9ABB203BC11 talkbreakscore
458,336,003 *2E8D48A7FE735E12488BCECE592CCD8D26752A8C Tamiimated
458,336,004 *2E8044B9DF9D4D03B400FFD1E33C8D9EB405C9D9 TAMOX100PRE
458,336,005 *2E8644124338D6BB94D8A803A21C4768BC2672B5 Tandem (Yucali Dake version)
458,336,006 *2E850DE38BCA1A221BDCBD7D3831C7AE455D93F3 [email protected]
458,336,007 *2E8962E47B26F74A6A89E96555389AA4B226104A tanner.moffet
458,336,008 *2E88037BDC90751BBD8A55D2FA87F2C39912F800 tanyadilbert5
458,336,009 *2E803024ECDB0CCE48E29D7912F8E0DCF8D6B8AD TAPHYSIQUES1
458,336,010 *2E883CE6D19D3EACA75D50BD7BBE95EDA667E782 tapz18
458,336,011 *2E848725F8E999F843B608918E7C708F0B07AA7A [email protected]
458,336,012 *2E80C9299F128569FA05CC8A242D2486AEB4EB59 tcargill
458,336,013 *2E81C7AE5037219581F48401E485DBC356CB0E06 tegan76
458,336,014 *2E88D3D21D1929C634CBAEA3C80E1CFC173F5964 telephonical3
458,336,015 *2E8C7AA4FD4A0216485A1FA83AAC9A34D5372EE0 templateaustrianchan
458,336,016 *2E8A335421311ABC507E0AA4A3142849EB3B4AEC TERISOLASI
458,336,017 *2E84FFB093504DD568CF4F87A751466C365C971F terrance.fansler
458,336,018 *2E871E86667D57293FE040D5FC58D3130B03D375 texera7
458,336,019 *2E88502CA3F498EBB5E72F8E3111C28F10FC135C thanh.pfliger
458,336,020 *2E8DCD0E346F4718AFBCCCC19BE07A9BD16E8DFC TheBestofNewWaveClubClass-X,Volume1(disc2)
458,336,021 *2E8C8F7F386624506DAAB32A31E7E802ECE488BC thelma nixon
458,336,022 *2E8123C25868C5C5BD93E9A07D36E837215D2CCD peter.hayton
458,336,023 *2E8777758610F3685F4C7BDED628C10B5111DA4F theTANYA4
458,336,024 *2E87D84198ED837969A5EDBCFE7CE52176CD1E4F theThelorax2006
458,336,025 *2E867E157A3D30F827D27FCC35F397D261003C68 thirtytwomo3
458,336,026 *2E8BA320955F80D49464C1CBD5E71532E633C86C tiarehcaf4
458,336,027 *2E843EAF8AA7A950FB80E53C2AEEC6A2D0FFFC7A tim.caravetta
458,336,028 *2E8B47677BDB302449E3417C0B8444DE3225B70E timmy.bramblett
458,336,029 *2E8A1BDD6AFC60390D5C69B0AC9A88026A16F092 timothy.emerson
458,336,030 *2E87C3EA9D44813A8FBCF7822E09476EC0DFB370 timperrett
458,336,031 *2E8EC359EB9168D18501225CCD06C0D79920F9B8 tioinnuk6
458,336,032 *2E859FE6C6F3967CF92AB8AAAC77821533BE7F0E titus.mutherspaw
458,336,033 *2E8C51DFEAFA0B1591D850F2218AEC62221AE71B titus.spivery
458,336,034 *2E87CC1728C485F6CD6F2C0729418BB2ED1436B6 tiverioy3
458,336,035 *2E895FC0D5C5D45B54799D12DEC39792DA1A210A T'L'DFFSR
458,336,036 *2E86A128308814547A4B9AFCFDCBC0247BDC7ADE Tnegnatcra
458,336,037 *2E83181F277001D87197F6343ED5822FD91C1F8A toney.chrisler
458,336,038 *2E8F3C2E76679957B08C3F5DD64FB93D32665E72 törödést
458,336,039 *2E8D6FFD208E60CC23AA60F5195F82CAC2C599DC tracy chapman album
458,336,040 *2E8D85A70DBE79C55B33F1B4DC4C3D15A2FA1ECE $triaria
458,336,041 *2E894B0B21DF25F24D9E9838F185F874EAC2E034 trinksprche2
458,336,042 *2E87D4603CF87D9F711AF629C92B9B29EC1CE7BE tshandlens
458,336,043 *2E89B929AE471092A0027AE0AC5E1E5A9FF21BBC tsuzysemlee
458,336,044 *2E805EC7A42A2E7AB7FF3256ACAEB230B99BEBD0 tvillatora
458,336,045 *2E898404B811CD312592B82AAC3973E18A0349CF [email protected]
458,336,046 *2E808626805F41AD3DA5346BDA688C4BF1FA62E8 ralej.yetty
458,336,047 *2E811B42F99532C5BA6643CF93A9887E4355D408 tworoome2
458,336,048 *2E84281224D37FF153B0C6EAE5916EB58288AF65 tyshika perry
458,336,049 *2E86E8B4A7813DB2ADAFA3BE7C5B27DA9B32103B TY|SKENTELEVILLE
458,336,050 *2E88A86CA69DD77A16B874D0A2DCA141C3ED8A36 @u9u571y
458,336,051 *2E8A1DE3615DF6CA0FC93239E9A62CB87062C295 ubayubet
458,336,052 *2E8DC62961EFFD90BAC499A2227EC9CBA8C7B23A REEDIFIQUEN
458,336,053 *2E8F53A7965A4244FF0AA0D718677E2E61FE24AC udatha venkateswarlu
458,336,054 *2E8C4F2B933011263ED8EB40A8B824176C108143 udstikning0
458,336,055 *2E8F7007DF4EA0694D9EB85FB7CB970DB4358818 uettelnd1
458,336,056 *2E8FC1F7428DA1B0914B0ECD1613FF285F166724 U!Fbaa
458,336,057 *2E87B3F9B332CA8667B20C19D14C0312CD87A25B umi nurul najihah
458,336,058 *2E8DEA81518D4923F7D01144F2538B0BF060B05C UnARtful
458,336,059 *2E85F53877A0DE4942E2885E9D9008AE57231428 und die flammen
458,336,060 *2E84B9F7A7DED9CB85DAEA759890370EB4105BE1 undersoiln6
458,336,061 *2E8CBCE646BF0B3796B87AAAFD10239BFCA31B55 UndertheDome(disc9)
458,336,062 *2E8B686A9361161A9C9EBE1EF0A77DA94E0ECE5E unsubjecteda
458,336,063 *2E8BECAFA1DB12D18C54E5DA64117D48BDDFF9C6 RICHARD-YOUNGS
458,336,064 *2E8B2671D9781B3A2EC889B7A697341414058A5A user65.35.118.23
458,336,065 *2E874CBD0B043EF3586A74B6960A56CC3A3CB2BA ussini01
458,336,066 *2E8C9A6B9A1C05D9318AD56E1E223EACFAA10426 ustin sua
458,336,067 *2E8F5EFE48B530A0D9834EA64E98B8B4079F6DEE UU ~` ~`@===q
458,336,068 *2E8C3D496CE0734881B788C30D7358A5CD03E43C v>{0
458,336,069 *2E849CF28DF1285B45FE97EDA1570EABC7BBA9FD [email protected]
458,336,070 *2E8C0D5A75B3703E2F4528A89F2B8C90EC532EFD valentyna009
458,336,071 *2E8938477249A7C30F8BB138DEBF1306B97DDBE7 rockywaite
458,336,072 *2E8B006E35C6E817CCFFC47B61679825D10F9737 vanciebattle
458,336,073 *2E8E5274FE5D295C4581B500AD06219A466EACCF vandinaclarissa
458,336,074 *2E8EF7E0565E16AC178F5A2AAD73365263C2A0D7 vanshika singh
458,336,075 *2E84ACBE7367A488A7E3610CED75760B2B0DA729 Vasukinath
458,336,076 *2E8209088042FF3F11A0E90D54EE0C668EB6CA41 Verkoude8
458,336,077 *2E8EC9BEF5A16B1767C2AE5ABC168B7EF7552BEF verpleegpraktykterreining
458,336,078 *2E84835E8D87BF3FF73678F6576D97548E7B7454 veterinrlovgivnings3
458,336,079 *2E8E1174FE97841468DA050D746EBF30EBCC4C79 vfvV
458,336,080 *2E88ED715A62886B80562393E761E0F29F3B619A vickie elam rossell
458,336,081 *2E83F09CABCE970312CF9D3E8A3FF41CC8055DDD Rumilly
458,336,082 *2E80B241E218285D4C3594CC7C8D78C6026478E3 virgilio.roser
458,336,083 *2E8BE8507DF13F1512BA4173ED3322C5F0E9997E virgilio.wellnitz
458,336,084 *2E81DA26449E126FFA0A8F7C9A025481E5692CC3 visionsweetpeing
458,336,085 *2E8DC3025C07F1D8599F0F7A850899AAB91F68FF SALLYANNE
458,336,086 *2E8521312AB8EDEDCA6E72FEA6AEA79B7BAB723B Vlchnkld0
458,336,087 *2E8BAF3589F8CD12FEA6FD43AEE9ABBCEEB0AAE0 vlerësohej
458,336,088 *2E8576A3FC18F3B672EA45D65684EBB4AFF00BE7 Vo!dance$
458,336,089 *2E8A5D01B9B21954C7154808989252A740660BC0 volumengesteuerte
458,336,090 *2E88D0E778D0FB60DA954A841BC92D598148FD8D sanfordtempler
458,336,091 *2E83B9AFD33172207443A9D2BACAF898A43E79FF Vorbesetzt8
458,336,092 *2E8A8ABB21F748A40EAF8974407E9AF8A4A409C2 Vorrechts2
458,336,093 *2E8A02D72579378FFAEF6CF5B0CCC9C8129EEE26 vostokis
458,336,094 *2E8E500B8AE8276F07A984A506559F8B27C59CB7 [email protected]
458,336,095 *2E8B7F8C86C34B2BFDC37E4473830F68AD0CBF57 w108478
458,336,096 *2E8D446967339B3E475A0B1EDDD177586AD5FF10 WAHNETAH
458,336,097 *2E8436AD79DE3C2287187320CA08281A3B9B8F99 wallace.yacullo
458,336,098 *2E8332894B1CBF9DD6B7E599342F47378E6FF3F1 wally.henderso
458,336,099 *2E8607DAD7229E8326E54C9A21380857B9441958 wanghaipeng
458,336,100 *2E87A4D05C6D0CE026A347FC399B3C3D11C06EAB ward.bradmon
458,336,101 *2E8707AD112D286DC189D0773475B2BD3A4567B2 ward.coldren
458,336,102 *2E87443DBA1DAC0498B01FACEE1C5E6D57AC7D30 warren.branscomb
458,336,103 *2E863301C3F94BB76C866F3F9F3DD32337ECA6F3 wayarboreal
458,336,104 *2E82A1B4F40DD1F8EBE3748D31834A95E3500A99 wbcomtax
458,336,105 *2E8A0EEAA899D81891B9492B0916872EA086AF93 [email protected]
458,336,106 *2E8294A5C6EA04D24DEC4AC27D15D57F199978A6 wendybolar
458,336,107 *2E8DC6DAC4289CFE95337CD263A89B332191E9CE [email protected]
458,336,108 *2E8D3F74579BC0432F14B36F05611702930760C3 [email protected]
458,336,109 *2E80833CAE7D5E5F3CD8EE088A4BB2CE18018986 [email protected]
458,336,110 *2E88A45D024CD6D9E8A91887EB1B09EB022A7CB9 werkverschaffing0
458,336,111 *2E85554AF8206F787905FF194936F6873E8D0054 wesider
458,336,112 *2E8E0C046D0F7CCFE88395EDD986EF076F4769AD westernised1
458,336,113 *2E8B9AEF29399B412FCB5FF7238999480861496B where[1].zip
458,336,114 *2E883CC4D9C201A998ABC85CC712A3B3A9C96855 widenergirl2007
458,336,115 *2E85D94746971C31B95D16BC46BF85E17BDF9A2E widyastutysari
458,336,116 *2E8D03467DCE85A473A3721A154257375C4917BA [email protected]$
458,336,117 *2E818B48321677E56A72F4322DDE90ACD0086D21 wilfredo sandiego
458,336,118 *2E844D3ECFA9C1AE989D1A65C6803225BF6FA9FE william hooker
458,336,119 *2E898DD89EBCB6014F491B1D043BFADE753FBEAC williams.athans
458,336,120 *2E8298B9647B1F180A1BD4B4AEC5E91669FAC233 willis.whitmarsh
458,336,121 *2E80A2E1A2E2772A4AF62A3ED63893D9A67AB7C2 willsierra
458,336,122 *2E80E3B82D5E22823322971F54F14984B070257B willy.bumbrey
458,336,123 *2E8D3060AD7B4960ED0C48A9853D291A78E36251 willy.koss
458,336,124 *2E8DA6303C6AE2BC0C882866BA77848499A58AD1 wilton.acencio
458,336,125 *2E852D8358DC48E2EF431549BAC9B8A6573A4D90 winston.cornelson
458,336,126 *2E8FFCFEB49340B66F2AF80AB8324A8B265D479A winston.putt
458,336,127 *2E893557234ADF778832C728185934229A278A5A winston.right
458,336,128 *2E8E7B6DEF3414B5C2ED72610AF34073060F3158 winterwinter
458,336,129 *2E894721978F2604B05306D02E51230C18E37232 [email protected]
458,336,130 *2E834F4020E0A3D8460D60920C049DA905ADAA75 wpne160
458,336,131 *2E8260F2906F46AEABDAE29E7C635DF10C719132 wtmcdvwxvhgo
458,336,132 *2E807FAD6E5E13AA0CBC32A736C1C38DF35FE88C [email protected]
458,336,133 *2E890981EDEE720BD89297A036122EBDE420C0B6 Wuschtolz
458,336,134 *2E822A351F17E2BD6B75161936A550B91EBD0CE9 www.quick6.com
458,336,135 *2E880451A1A6351DD75DA78C0C49D4244518B0E2 wyatt.bryans
458,336,136 *2E84E4A4591BB8353A54084342227323CEEA5AD8 xengel
458,336,137 *2E8AFB86263035BE826569D7B7387AFC19A1CF64 xgvmh
458,336,138 *2E893AB63BB8E7F71594A01C19262F795A18E1A6 XHnhZVps4EQC
458,336,139 *2E8273672DCEB3D41571FA24BC3511DFC955E832 [email protected]
458,336,140 *2E83859CD690FBF74327A91030046607363DDE02 [email protected]
458,336,141 *2E8B950553BD55C68FB721EBFAD773D3F8B22BB0 xuvnnssnous
458,336,142 *2E8D5FDB6573F6D80A1B4CCA1DC84215EA0DAF59 )<y$
458,336,143 *2E81F8E52368774EF3ADE9C620A82A2B5CB11791 y101054
458,336,144 *2E89B48FC5E8DE03246565E6D7928D2E9165B8A5 [email protected]
458,336,145 *2E88A7409F6E37B526135BDE7556751616F3A834 [email protected]
458,336,146 *2E8BCCCC8AC9498119853B444AC868F7E5AD5217 yatonda gomillion ball
458,336,147 *2E8881A7D47EF8460A89316E24AA2941B1EE69B1 yatsiriv
458,336,148 *2E8AAD5B57C7AB2793FF20EEC156B8D9314387A2 Yeearrrg... It burns with the power of shark
458,336,149 *2E84B06745C336AE08F7F5EB0E4070AE27D3C045 yelena crosston
458,336,150 *2E82072539BE34954228D64954140000AAB29B65 yingerguang
458,336,151 *2E8A511293C9B18218581438EF23EB9E420751BB yiota tsokkou
458,336,152 *2E87C1F8C22F9E015B6B6EFAF2E93280C738D777 [email protected]
458,336,153 *2E882C24D67F4B9F67CB7F02AE6C8B022805CC82 your reflection
458,336,154 *2E84F0CFF6B14A300779AAE4FB48A66EEAB9112C [email protected]
458,336,155 *2E8715612F6A32399CE35F9181F0027ADB01289B yunioshi7
458,336,156 *2E8B750F89385D9063D835090221C7BC4B094752 zachary.baksh
458,336,157 *2E8BA970C3E4194AE7EE3AAD6F44A68636BD05CA zahat-to-ko
458,336,158 *2E8827F1A12868DA8921C05DFE965A50BE92F9B5 zane.bowring
458,336,159 *2E8E2E2222BEABA00A628E5A639A59C66648F416 zardakis
458,336,160 *2E8AC8340468DD42853CDDAEB01C6B3A3201FE51 zatucanije5
458,336,161 *2E84D23540B831246CB2FDE90C71E1331ED607A4 zenkoan112233
458,336,162 *2E80B95C1B1A896FEF99A4DFE8F4C657B4E38E9A ZEROLICK
458,336,163 *2E84012FC459E73664E148C276EED92FEDE32976 [email protected]
458,336,164 *2E884B0828D1556E2099C3DB30003D52A3D5D9B8 [email protected]
458,336,165 *2E829BBD3CF2DF2740207E7CEB73E633871C4C5E [email protected]
458,336,166 *2E88EFFFB78694C880E282D33108E8402FF55F7A zmodemf2
458,336,167 *2E8FB322EB7E6EC9A708AF12CEFC2C64F1654683 Zora
458,336,168 *2E8A37AA211FFD09ABAD0BEF5329F1209A2A043B [email protected]
458,336,169 *2E82843BC49B275DE7FE3BB2B59B9DC05ED8A21F zullukman
458,336,170 *2E8D11AA0EA53B6B1CCF719CA7C601EBF1951E46 zwriflung
458,336,171 *2E8DBD9D4AD31A10ED61695DA1B86472FBAEDB86 علقت‏
458,336,172 *2E83CAB9797A925B5B97DBECF97F140F828848AB Колегіальність
458,336,173 *2E857F8260CDE0F835227DC2250BD298A1052120 Литогра
458,336,174 *2E8A46EAD726C54604121E63E1A009E64206FA5F мікрометрові
458,336,175 *2E88E1AA3DAD9591D03F50D9AD4624AF8B356CF3 пробивающиеся
458,336,176 *2E8926B6753EEE27B30B45EC6F03B1C13F3DF16A Томином
458,336,177 *2E82080FF2B7BAE76877514978C8310E1A804581 Щукель
458,336,178 *2E8417699174A057970E30559DA94747C7D98122 պակասավոր
458,336,179 *2E879BF14466F15C261084275410C5B93BE3C429 (ただしこの効力は
458,336,180 *2E86AC82A14CC1CC7ACF32F25C897B3BDFF4C186 suranga
458,336,181 *2E8F96C960EC2DAB27DE13403B316CED2A86A212 と呼ぶべき組織が発足するのは、イタリア統一を果たしたサルデーニャ王国が、
458,336,182 *2E82EED1E959D26132ACFE047E6E835C2862DD93 オトナのための昼マンガ
458,336,183 *2E85117488083615A008D6A5F213380179BB2B0E の東スーダン語派とされている
458,336,184 *2E8366D519799F43C491CBCF2365899777C5BBA9 シングル「欲望」、ミニアルバム「KILL
458,336,185 *2E88E3A8D9DD8FA731DE06F7CFA1691CFF75444F TALESPINWORLD
458,336,186 *2E8CFC815FC05499199501576CD0E112BD89E3D4 TALKGOODFOUNDATION23
458,336,187 *2E824C8AC069F8E21771E6A81F44B3BAB8ACFAF8 的三個衛星校區。
458,336,188 *2E8C32CE386F703625BCBBA62FE490244B438C28 章守仁長子
458,336,189 *2E88C327D869D262C687D504C45A40B66CA3F611 teizmom2
458,336,190 *2E818BE35E2C7ADFFC428715F8317D57DC9209E6 として輸入されて来日する。
458,336,191 *2E8944E185BF51456496E8BB44E7CD88986F024D TETRISCYCLEBSW4
458,336,192 *2E83BD2B883B0EF35692A14B91841B066CD87070 THAD.FROHBERG
458,336,193 *2E84C271EB28BE4A6D986C17B07832F11CD57F5F THATMARY5
458,336,194 *2E8B74C96E3AEF9D3A240B0FB4F7E2AAC11B202A THE-SHIP-OFF
458,336,195 *2E828B1C43C877506F9F67022A92A484F0CEEB31 thurmanreadenour
458,336,196 *2E8A524266BFF4AAA39BE314A2849DAADE97B174 tigrworkflow
458,336,197 *2E84011A95E706F68F1549E87E00F82F93AF68D8 01WILLIAMSONA
458,336,198 *2E8B5E8A814F9F2BF4CFD8D11470562D8853CC62 TOMBALBAYEFRENCH
458,336,199 *2E88548EE2041CB809A4E8A3730A6F46344571E0 TOM-CICCI
458,336,200 *2E8ACBE72675622DA7FF472F8B1447694F4DBDD3 TOMWEE
458,336,201 *2E85B2673A53283EF569A153577F22B0018C6713 TONYBILLEAUDEAU
458,336,202 *2E8D9D2A1BB0F590D708E8723B77A9AD112467E2 [email protected]
458,336,203 *2E8670A502C6E4F350018F7FADED79DCF7B9A48F topherasterix
458,336,204 *2E80504994C7F497D7A18482210441693B611BFF 1167771 localworkerscutandpackagedthematerial.
458,336,205 *2E8530DCF6F370B620DF32EAE86830FB64860F8D tpotsjib1
458,336,206 *2E8C91C152C4FE132C84A309A8B8D3698C0B9315 12september1028
458,336,207 *2E816C3791F6AE49CBB2A2EA28AB4F15802E983C 14.absorbency
458,336,208 *2E84983CF14E90CE2FDABCDCB368E6F9137AB0C9 treated
458,336,209 *2E81EAA380D5910C2565CA03A3789F5C3973434A TRENTON.MAIERS
458,336,210 *2E8638CB8DEFA75ED41177E711B65610DBF5BA80 TREVER ZINK
458,336,211 *2E864C4984B9618656273B122A7737CD60B76902 TREY.FURNISS
458,336,212 *2E848FFDED08213B910D814D93B5A07336EE7307 1649540 THEIRUNEMPLOYMENTRATESARE79%AND12%RESPECTIVELY
458,336,213 *2E8152D9A51AD86387B7AA642FAED81C70B45469 1656837 SAMI.KORHONEN.1225..
458,336,214 *2E8C95B5FE392FE342243E6EEC46C89F01CF4F98 1681786 NORPOWER1250SOKKELINKANSSANORPOWER1250SEIN
458,336,215 *2E838489E185C4050F7F3B9CD654AFB58D126C84 168davian
458,336,216 *2E8512B114A2C178D6C48764DFB13A11724C8825 19811002:London,England(disc2)
458,336,217 *2E8B93154058D9D15AAB94964A716E03E94D6B1C 1ATUBIA
458,336,218 *2E86A42407A1D0C2B32D697E2F1C737732A561EF TYB*
458,336,219 *2E82158FF264BC3E1374A034DB40514DC0B3AB96 1ILOVEORVILLE
458,336,220 *2E88CE3EED257363A8B02216171A76508E00C6C6 1.kokolasiset
458,336,221 *2E82B5F628C91DAA82C08D347A668204E3B86EDD [email protected]
458,336,222 *2E857BFB546095ECDFFE51BD9D8EB58CFCB7F1EE 1-MUISTAAPERHEYRITYKSENS
458,336,223 *2E8559BDE861D38FB7B4EEEE6CEFF2326A41A2E1 UNIKMANSTEAUA123
458,336,224 *2E841F52913BAA99BA4519317847468F5827DE41 1.PRFEN
458,336,225 *2E887C3DBB84AB7075645254C64A9C56C3DB705F 1reportermarkierungen
458,336,226 *2E8EE3D2C83E21D898354F6E50FE6B57C7BA6D5D 1 SAINTSULPICESURRISLE
458,336,227 *2E8E71F4CAC55D6BF1CD7711D0693CA20712CA44 1-salassapitos
458,336,228 *2E8930C97AB6BA1296244B890CC5BDCC8DAA4081 1.S-O-N
458,336,229 *2E884AA1C92C439B66CB7EDA1A59F2C068E41611 1STATSMINISTER
458,336,230 *2E81637D2103CB6744700F890D7858CD12B31135 utaelewa
458,336,231 *2E89DA07626A196D52E601A71617812FCAE25E25 1toerolde
458,336,232 *2E83A4D1FDDEA6D2B6CCF19B12E309209CD59B6D V34.
458,336,233 *2E8BF4CBD80E3F9F011FFA0826B2276AC3539D27 2001-03-10:knittingfactory,hollywood,ca,usa(disc2)
458,336,234 *2E8F5BE34FBB06A1ABF37A5DFCA8E33D69844E1B 2168045 YKSI-VEN
458,336,235 *2E84E8D05D6F31DCA79F2894EC31B9D4CF0650AA 2205148 PUNAINEN-VARATTU-VALO-LUOKAN-OVELLA-TARKOITTAA-SIT
458,336,236 *2E8C7FBD15579849E47DEB0B68B6AD7D40991477 VEAGLORIA
458,336,237 *2E859C1C3F322EFD3DBEDC12B3D2007847E31164 VERLIERBRUNNER
458,336,238 *2E8000FE7BAB16CEE6AA114569175253C3BAA7CE VERPLUMP6
458,336,239 *2E8CE8C8AA2BB0FF67E354DD028DF006C4684DB0 VESIBUSSIRISTEILYT
458,336,240 *2E8E06DEA199A14BA0FE50CAF49521171CCE4D9D VICKYCAPA
458,336,241 *2E8D9D47E6641403DEDA65E726DE512821923666 victor-faletutulu
458,336,242 *2E82B9ED18B7EBB45C7411F00A84CDA4B18706BB VILDENSES
458,336,243 *2E85CC76D1F9777144BE384BAE38DE8AFCE28AE2 2CLEPENN
458,336,244 *2E81B1AEDD4185D57B2CF3CBFFEA345830D77EF3 VIRGILIODEEN
458,336,245 *2E8027C465C143B795686C5441BD97CA1ED06D42 virginiacvoigt
458,336,246 *2E86C82A2ED78FBFFF71B02CCCC675FFC4C7E0A3 2FASCIOLARIIDAE
458,336,247 *2E8D9DB8952D8761CAC974B01903CB3B91674F17 „VISITENKARTEN“
458,336,248 *2E80718DE5DDCE913096B5685A885FD081D9ED1F 2ILOVEZEBRA1
458,336,249 *2E814137D76737A13F96753986FBF5DBD2722073 2RAUCHVER
458,336,250 *2E88944853CB1521D116C4A6B5DB69032F0D3F8F 2-SHORE
458,336,251 *2E8107C171297A3F445693736B50DF88E8AAB007 2.WORTAUSSAGE
458,336,252 *2E8D2C110914402737D055E2637882D2C803CF53 WAKA.FLAKA.SWIG
458,336,253 *2E8C0B319EFF0522853B171B0C1987F138133815 [email protected]
458,336,254 *2E853BA1244436BDBDC7FF0056445689CE7FE1E7 374197 barissemboluydu.
458,336,255 *2E80FA824C5341320AEC352C138144ED72453598 WALTER.TEEPE
458,336,256 *2E86BB34C0E864640BE88927585435D97B127446 walther.hetzer
458,336,257 *2E8A344E910109A5F8F9F7AAE6F87009F624FF29 3BLUECOKE
458,336,258 *2E8823DD409F366ED222550742C3E7EEABA265D4 WANJALA GERALD
458,336,259 *2E8F9C7FDD3ACB2559FBDB5784A745B71B04185D 3D94470
458,336,260 *2E8E8B4F7DE033F67997BDC8E0C70F5F7920702C WARNER.TOOKE
458,336,261 *2E866810BEF608984862B4FC069A8DC79B4E853F WARNIERMICHELE
458,336,262 *2E8F6A84F21436C44557D6EAB5CF4A656F105688 3IAMADVIL6
458,336,263 *2E8BD19BC693BDE681CA4BBC392E3CF0E093B01B 3kunstwerkstaetten
458,336,264 *2E8FA471F71EA89AEB1795B95ECE0DE21C2AAB98 3.KYT
458,336,265 *2E8B4CEC43C23D85ED18F049EBB1D8C305CBB672 <WEBDESIGNBYVNCCOMPUTING>
458,336,266 *2E8F14D779B42840FF8D933B0FEA009DBBABB201 WELILEMYAKA
458,336,267 *2E80425B9112EEC8215E595D108BB1B19A4B37B9 WENDELLZASTAWNY
458,336,268 *2E86F6BD63E5A04CAE1AA75F14166F485F4F76D7 3THATJULES
458,336,269 *2E82803FE60EB44FD946B678476431F4EC5847AC [email protected]
458,336,270 *2E8F615C398E09D667D76DEB751D40B31900C769 453SOLOMON
458,336,271 *2E889C65778206115586436993F9DBD193398A3E we'refrombradford
458,336,272 *2E856F5C5F068A8168AE898C07B062132B40321F 4-dai-vorstand
458,336,273 *2E859BD431162A466A7CB859CC56B50186D3D18C 4HANUMANSP
458,336,274 *2E8BA63A1EB78BD2B49A422BFFF35E1CD26DE2F1 4hautomaan
458,336,275 *2E8FAAC97090BC95C578B8B55304748DBC9D0D99 4HELLOLEDZEP
458,336,276 *2E80E01DCAA65C1C704E493528B5D0EF0189F328 4IRRITANCIES
458,336,277 *2E8BBD1426339F4F2DFC64A7BB38DB73EEEF8C3A WIKIZFIERT
458,336,278 *2E8341E6590592DF278DD6590C4DE07C44E0AA4B WILBURREUTHER
458,336,279 *2E8B058A25CA8112E2E3F2596A6182D90DDE39F7 4MILADINE
458,336,280 *2E816AFA0C46E6744049EB69BC1B880B5229B736 4MMEDE$
458,336,281 *2E8E3E8601780BD124F466FA4C212E3454E25B68 WILLIAMS.LENIUS
458,336,282 *2E8BB2E471986B342DB0DE267AD3FA562BC04112 4ONTOGENE
458,336,283 *2E880D7E165120FE424D5BBEECC256B95B31C2F5 4PPR3C1471ON$
458,336,284 *2E810CA6CB8DAB0F91279D064FDF9F34AE6905F4 4PRESATISFACTIONS
458,336,285 *2E8F61314858BE8D015A158AA064286D24E7A448 WILLIS.SIMMS
458,336,286 *2E80F64126C83E13EF6553ED5B1DAAB29F826D9A 4TALLENTAVALLE
458,336,287 *2E82F6AAE7593C2E7582277B9D7591E96FD7BF45 4UNDEADOBIWAN
458,336,288 *2E85DA0E76632FC53305DA4772F97347A3A4C298 witimu
458,336,289 *2E8ED3F86BFF85FCF117D21B238E82035503E38F WOCIRROW8
458,336,290 *2E8DAE808C79BE29291ED73F42B5A2361237A863 WOODROW.RAPONE
458,336,291 *2E840CDA009B1B038B2A405DBD63C027590C1E13 WRIJVINGSEIGENSCHAPPEN
458,336,292 *2E8661B2877247BE51593655AD140D08522D8D4A 596LARA
458,336,293 *2E825C4E8F6C14B28C3600F64358D915AF71F281 WWW3L3N4PISICUT4
458,336,294 *2E88416CC95EA281AA3FB05C7791FB2D2293AD57 WWW.TARRANCE.COM
458,336,295 *2E8CFF54216E165F1A166018A09EDD83CB4C1D60 wxsf
458,336,296 *2E85065D9900F578ECBDC5A951A07F0B94C3919D {X} ~`(######3
458,336,297 *2E89F3755E2A3EBDC991DD57B955AE910584A92D XD8$
458,336,298 *2E87413CC95825E30BC353FA7A53063B1572F3DC 5morceauxdefantisie,op.3:i.elegieineflatminor
458,336,299 *2E8F1CF93F557677243748E0505A2F99F9F3338B xingese
458,336,300 *2E8BD40FF9CC86A971115C60E1C50E12D6FE60CE 5SHOUHIZA
458,336,301 *2E8B78D7E7113219B19D2BBD73F5257A5787A083 }X{~ ~Q-----Q
458,336,302 *2E8DAB41BE6D9EF88F8FC63CE7DA4CD1AE0966BD [email protected]
458,336,303 *2E8170A2A344AB91F8983C24196E18DA6B6E0573 [email protected]
458,336,304 *2E8F55DFA26504D0630EA3CE16F552F7745D63B6 xuyuncha
458,336,305 *2E8D21CCA73CD90F56FDFF8B5796A7C1F2E7D0AB [email protected]
458,336,306 *2E8FDF3CD5370FB582697467C7383D8C75715AEC YAMO MIGIDY
458,336,307 *2E888783C22BC98C07B064AA8D0E1A3A2C8C9C4A [email protected]
458,336,308 *2E8865198256239263B0B0814EE0CE59D3176EA0 [email protected]
458,336,309 *2E84978E3D4A2B2940ED73BE919598F29D8E32AE [email protected]
458,336,310 *2E8879AB937A1AFBD5456C902AC4BA86B668C94F [email protected]
458,336,311 *2E8789B43E8C1693926ED95C733BAF6FF5005D2D YANKEESHOOTIE2
458,336,312 *2E8C9B9414A7949B8EC2305CD2A1807AED3EBCAF YAN-PRESTON
458,336,313 *2E8F986FA9D61EF134F17AE64A898868233633B3 605.UNDERWRITER
458,336,314 *2E8535A5370225C81430FFB9B430724F64F082BC yasefkhan
458,336,315 *2E847DFF2A5329970584B8CDD76377E769B90992 YEAPMOR-1
458,336,316 *2E8AFA57F6A84BD4CCC565E6F30CA2DAB97AB011 ;6BAA
458,336,317 *2E864E385E824BED09D1D6CAEB24FB1741087A35 6DEBBIEBILL
458,336,318 *2E89FF6A4CF413992D79B0BE6F98D0DFD2B0C217 YLLUFHSUH9
458,336,319 *2E83A284489AAA0A3050F0F723C4872057FABA7F 6EPITHELIZATION
458,336,320 *2E865FA632B892817BA5AD61F00F748075DE54E3 6INTENDERATISQUE
458,336,321 *2E8AB3142F4F9706F599B28F91BAF368876A802B yta.tyan
458,336,322 *2E8A9ED1839A866F2EDF8AA463C17DF85F772F43 YTSURCEBEUQ
458,336,323 *2E8495A97E0FF5644C55817008F55FD5D207E0FD yudha-wardaya-putra
458,336,324 *2E8A40A55F0FD9FDDA0E39C9FBC9FEF1D077B92C YUGHCSHBFLLTA7
458,336,325 *2E81C17D147D4AC26CF5C16113072A737338871D YumiHanama
458,336,326 *2E85F38242F7C96A5E94C36C0413F1CD9486647E Z520454
458,336,327 *2E818AFE06A5602BF584B407B49922F9F0A21FE1 ZAAN-CILLIERS
458,336,328 *2E8F95F6E476F75DAE0830F1F33BB9674AA57996 ZACKARY.AYKROID
458,336,329 *2E853D8893595BCFFFEB89CAC438A6693CE7E590 ZAZARAMISHVILI
458,336,330 *2E869D02C82FFEF56521F58EDA938CA0D468671B (ZEBRA)
458,336,331 *2E81D211DFA09F28D4036D668A482DE4F15EF77A zelinkovice
458,336,332 *2E85883B9480677CB71D082414B6D0BF89264E43 [email protected]
458,336,333 *2E8FC0E98D76A5B328B4521933E43CC0038076AD ZHANG_HONG_YU
458,336,334 *2E8AD2ADB69829B7FD98E832C7D8F895A5DD31BD 6WELTCHINK
458,336,335 *2E819900A6136548AED9E9A3520B55EAB338BF74 ZK8
458,336,336 *2E8DB24F3DAF58473839059D6EFAC5BF3DE8F463 7baskuulbruggen
458,336,337 *2E875C4584778325ED87CCD0A51CC7EA375E4314 ZOREAHBSW2
458,336,338 *2E85685490C7B7E50A08B7E12C5CEC78410108C3 [email protected]
458,336,339 *2E8860F1A84AE34F5B923735D9E4602734B055B0 ZSOXLI5
458,336,340 *2E8899AC1F67DDEFB290E59CD99385E413103A1B 7COWBOYSBUCK
458,336,341 *2E8EACCF57E391AD35B77DAC9E7F28D692049CD3 7FLOYDROPING
458,336,342 *2E8228AC126C1725D6AAABB919D654D370356D60 7FLYVEGIGTS
458,336,343 *2E84005200265B8DDCC7103AF8CC131CD4F9F649 7FROGCANCED
458,336,344 *2E8FF8EA78384AA1534F8E74B1ACB69BEE749A28 7GONECONRAD
458,336,345 *2E8C5A468CA5E026CB7AC26F050F559EC48033BD 7HEATHCOTT
458,336,346 *2E8ABDBEDE8A6601B475DA34B6E4A087F09F56C4 7HLEIFEND
458,336,347 *2E8E5E881101E8334E12E078DCF4E311C3B31053 ΖΈΜΙΝΑΡ
458,336,348 *2E8D25799A0593952A4869931190C471F314892E «БАНЧАР» —
458,336,349 *2E82292FAD0F6465FE199E08C41C94673AAC6FCC 7NELOPMU
458,336,350 *2E878ACEBBB42B6365D2F451B8A06ABC1DB90F5E инçекуравĕн
458,336,351 *2E81CDD95C079CE05D7566978602221B0B222A5E КАПСКИЯТ
458,336,352 *2E8F1F31797C483BCEAD293F1C8E5260658344EE 816603 OPPILAALLAONHER
458,336,353 *2E8339D536D9D5E10872BF5AD4522354F5A2F977 ПАСКШИН
458,336,354 *2E88B562AE8BC17EAAB22A2519EB0DC5F67FD9D7 пяцюкониса
458,336,355 *2E8A66C6E86571A48D8D3E7A33C728C9411049CA 8:8-#-&DUDERANCH
458,336,356 *2E82456A9A648F64E335F2B88F33556F8B7F598B «СНИТСЯ»
458,336,357 *2E8239562AC63027383194D8F38418BCCD5A9CE5 тermotuumarelv
458,336,358 *2E8061D6A9689F43F110920B63610D04C355AEFE 8GEKRISTA
458,336,359 *2E8F90124F01C51DE5F0049B1ED9C67402B421DD 8ITALIALAISTAITEILIJA
458,336,360 *2E8D8524093B051D21A4015F502607DFEC9A3560 8IVRESQUE
458,336,361 *2E8248DF102384B14DC82C125FD53A8018AD4861 と呼ばれる。EH、ELは
458,336,362 *2E8F5CE0BD79F9B7328837D10C41FCB63E514E3E 8MUITMUIT
458,336,363 *2E83A55D8C9C8321CCCC86DD29B135C43B63DB81 8------P~0-~o-(0_<)
458,336,364 *2E88E113397BC4AFF609B0984685F3638F97B706 8PARFUMIEZ
458,336,365 *2E80469DD7B7BCBFFA9CE08C2E176598ABD2E824 8==p~ splat
458,336,366 *2E85FBD9D2335A3B5B769EFE3BBA1A20D188E8AA 8RESUFFISANCE
458,336,367 *2E82B96D9B7EF7669C0BBAA29FD1D11E640135FE 後藤理沙オフィシャルブログ「RADIO
458,336,368 *2E80231C410ACF93D81E8A022F922D9E7DD87B72 9BLYANTSSTIFTERS
458,336,369 *2E84B3F6EA1AE9CC1FBD1281DF7EEEA610720F9B 9concessionary
458,336,370 *2E8636FD38BBE0C8292F6CB4282A568BE024EAFB 9HCILHCAF
458,336,371 *2E864AA203F9BFCD30EC50E2F1C0A168F9F1BD21 9MOTORBRI
458,336,372 *2E8ADB4146C74685B9408A9E18839C20F5238470 9OTUALEKA
458,336,373 *2E80241343C0F97821E7232574156AB62948C80C 9REPPAMTROPROLOC
458,336,374 *2E8BF1138AF5E715E3638EE5CCD42B090EE2A551 9SAILINGSCOTTY
458,336,375 *2E8191D377413AB9FE012F84D1AAA6628800449D 9SELVMORDETS
458,336,376 *2E8B9F3074EA5E9FE0A106B25845C6464C62D3CA 9SENSESMACKSMATTERINGSMELL
458,336,377 *2E88FBB29D1892D61EDC285E3B2C21DB7C2717F0 9THEOLOGICOPHOBICS
458,336,378 *2E8A1E768B18B5AF712347FAF01EB3D573B9DD50 9TKV
458,336,379 *2E810349D4A64EE8752C7AF0600ECC241D3902D0 9UNORDERING
458,336,380 *2E8C3A031E560BA456B02EB6E3E008BE249A269E A?%
458,336,381 *2E8C761AB7903FF688E354E93B3764C0B3C9831D AC>@^
458,336,382 *2E8120B01057358FD21D6F2EDB24FD27DF54EE0F ACC11V1713
458,336,383 *2E852BF09855314B474F81BA63DDD4B4CAF13332 AC$F+
458,336,384 *2E81C5257FEBF65F036BA555F86B26108E7A3E97 achtergrondmachine
458,336,385 *2E86A57193D05697841F0ED2780221DE3D33CA91 1341809 senpita-alaansopisimontasuomenkokoistaaluetta
458,336,386 *2E8BD46F06D1F07931C4B23EF65E879D3B910AE7 [email protected]
458,336,387 *2E8A7003CEAD32826E908B701A8BA48D13664BD3 15-ungleichbehandlungen
458,336,388 *2E8FE107DB1CE51A812BD396E67BDD271D20C319 1660432 MURHAAJAT.OLIVAT.SIS
458,336,389 *2E8B54BFB140EAD9CBD069AC433DB81AF951ECF6 ae+57
458,336,390 *2E8681F236C6E0AEA1159DC739D819547AD52F06 1888179 DER ALLTAG IST FUER MAGENS VON BILDERN GEPRAEGT .
458,336,391 *2E8903F94AE58075BA5B77FB81685DC939EC18D5 A?FQA
458,336,392 *2E85262A2B62B1CF6D179264CB31698AF3E19E08 1CAROLNONE
458,336,393 *2E8999BBCDA0349445E0E6E0C3AFA76285ACCE17 1CERTIFIED
458,336,394 *2E8675967B4B26EF80C5838891AAB5F7BCF92EA6 1-delegate-clogged
458,336,395 *2E801F96E2A66C013D0113B3996AECDF2A961E31 1-dsp-ominaisuudet
458,336,396 *2E88479775BA646DB0549D83997007F24438FFEA 1dueto
458,336,397 *2E8BAF5314D7FB34349CEF23DD4C6870E01FA9DC <a.href="http://www.ondapix.com/viewPhoto.php?fileID=80718"><img.src="http://img29.ondapix.com/80718.gif".border="0"><br>OndaPix.com.-.Comentarios.para.hi5./.Myspace</a><br>
458,336,398 *2E8E278CC5E07537071CF52C77B9D0BE863E9E25 aigvp
458,336,399 *2E880497C6C3EA3CA7B825D9F7D435B55E41BED4 1-koneellistuneen
458,336,400 *2E8C598AF8336DC2E9F1E45EB45B48E9FF3B4F5C 1leib-und-magen-magazin
458,336,401 *2E8A92837D84516E2420EE8844BA5D608A3E8F32 1 LEIPZIG-STAHMELN
458,336,402 *2E82C0A82B612BEA65FC72AFC720D6174B136771 1.MAHDOLLISUUSPROJEKTILTA
458,336,403 *2E8E93F1B1F694E69DBC8A57FB7535E2372946CD 1mainitullatulotasolla
458,336,404 *2E84447DE7A826416D86332505B090A54EBEEDC5 1 MAISTELUA
458,336,405 *2E8D223B08EAC4B975A2E3242030368150661DC1 1massieven
458,336,406 *2E8A10E188F09D5DF9258EED7578AC56749300F9 akbashdog994
458,336,407 *2E8C4BA39B178B3AA84C68F7D5B2A7E7F01DCCF9 [email protected]
458,336,408 *2E80DA86AB8F49B0F3939A183A6A39E26A06DEE6 ALDOTANDY
458,336,409 *2E855AF3802B6E00353590EBE1489A70C181F707 1-SIKORSKY'DEN
458,336,410 *2E869BAC9AF681DF9AEEE09B37AC106E34C7337F 1-SPIEL-IM-SPIEL-CHARAKTER
458,336,411 *2E88A583A90A80DAD825853E8113F6CF57C8F9F2 1 suomipalkinnonkin
458,336,412 *2E8573D7A736DBF83663CA340A6522153FD55A76 1.TENNECO
458,336,413 *2E8E4882740E165BCDAD94F3C2660EE076D6AE65 1THATDOROTHY7
458,336,414 *2E892C782D58EE9EB83FF86A53A131F08546606B alisonbyrd
458,336,415 *2E84F2E5569ABB7BCB903222797166FD449180D2 2026620 anestesial
458,336,416 *2E8784941B0C262B3F4CD0D432587F81F0F07AB0 ALLOTARAS
458,336,417 *2E813C03E30D9B7FD7E82A10B1CDA6A108622099 [email protected]
458,336,418 *2E80B6418FB72BA24A497B652C4A222026216914 alpha-hydroxycholest
458,336,419 *2E8320C5CB4D2CE6ED73BD71DE081959AF975861 ALTONRAYAS
458,336,420 *2E81CD15CFE55DCD643A92E95D0B90C4BB157874 always.on.my.mind.(alternate.take.2)
458,336,421 *2E86C382B8341550DA783CEB922F95C1936DFD9B 2529505 PELICANSIN83P
458,336,422 *2E8E4FC547F5808380866F96CA6238BBCECF1DFD amjadfaheem
458,336,423 *2E8BC2638A0A65E0317CB55ED3388B552FA8C2B9 270839 thestockdroppedtoabout$2.73.
458,336,424 *2E83CDD6EAB81B33E4A9A2E725DCB8977D2F392B 2853737 pinjassa-opetellaan-kantamaan-vastuuta-itsest
458,336,425 *2E8D0049629C6329FAAEB11BB6FD5F206B3F46CD $AN71ER
458,336,426 *2E8602634C7486679520CB6A29883CC230CE259E an911c1z35
458,336,427 *2E808DBA43456662A2C4189898713B6608E168CC ANCPS9H
458,336,428 *2E8D0C4D5794234DD5A6C7B2A8494E9EB92E8A9A andantespianato&grandepolonaisebrillante,op22:i
458,336,429 *2E8E85D01BCA77FE3DE10131BD715DF22BD4AB26 2ELMASSRY
458,336,430 *2E8DC95EF7C70ACDA9BF12AE56CBC82FF1183607 2f16694
458,336,431 *2E80282893D15F94D916B4B049FDF7EACDF09320 ANDREAS.TOWLES
458,336,432 *2E88A554E7FA029CBB3B5984BEAD626632BF78A0 andriagray
458,336,433 *2E8FC61C919C13290A65895A7711270615EF12C4 angelguardscomwww
458,336,434 *2E85228E848184064A9B0CF2FFC5E2D1FFE1529B 2WINGSTEM
458,336,435 *2E848566D6BF0CE90588C0A4E64C5FE00CD00F80 362845 DEVLET YURT DISINDAN VE YA UZAYDAN GELMEMISTI .
458,336,436 *2E87036F1413650EEF1CDFD4FC262D1F817835DE 3BAHIAITES
458,336,437 *2E870FD1B9EA162CBD47A59337C6FC6AC5EE3E3F 3.DEUPREE
458,336,438 *2E8115D90F39098DB73E5EA8D575936127E5A8FD »ANTONIO«
458,336,439 *2E85649F7D298A3A3D9BB53016669ADF8047FFD4 [email protected]~O~OO><
458,336,440 *2E84E693AFF9F5FD9609E1C26DB777A4C3FFD7D7 ap5ac
458,336,441 *2E8E033E925893307C78001B592B80C92E96C051 APPROBATING8
458,336,442 *2E8365F57858B0764282F7F1E18BC7A1883058EA archieendito
458,336,443 *2E8DB27C0B8C6CA4EAEFBB9925989106F3C4B097 ARCHIE.YOUNGQUIST
458,336,444 *2E880FB3C297A3A4946EDA166975242B95A81751 Are7
458,336,445 *2E8CDFAD80E8ED0CBE59C4FCCCDF691E31B8FCA4 4HPOENLAB
458,336,446 *2E8086349DE40A705D1297FF83F90CCA43A39925 ARMANDO.AVITIA
458,336,447 *2E86CFEC85881C69DCA256B3D7DE4C0F653C7EAF ASDFGHJKESPANOL
458,336,448 *2E8C5BCC07BA7223336DA4271DB98DC3C869DC66 4月にかけて実施。運転台のブレーキ制御弁を交換し、床下にb1電空接触器とno
458,336,449 *2E839AE023DCBF225C026FD1B4B8A0A64C32D699 AU00#
458,336,450 *2E8FA0FB144AA675229644D51C242A865E3F3FDD 5ILOVEPOETRY5
458,336,451 *2E8FFF462DD49BCCE55D3569886073A86246C30E avhrr
458,336,452 *2E8192FE8FDD865D6431B6F2C03843AB9AC3FA4D a=zf)
458,336,453 *2E88483990E62354B82A26C6A2D7D1C5C3487962 b001202
458,336,454 *2E8CAE2D064B6A1FC09632D9DB328904A5E62361 B===)~0-~O(>_<)
458,336,455 *2E8CF88F0404AA64D15FD89FDB9DA271F48AA40C >[email protected]
458,336,456 *2E892B2547654FCFEFEDFFABAF1C8DDC8237A903 b1_6m
458,336,457 *2E86AAE542060D23BF71CA9E7749E59306C9039C b&1!i
458,336,458 *2E8C69CA1D82E961A8F8A7AC518AF944BCE437F7 b4ji
458,336,459 *2E8E0CB9A7E2F73B64120F246FE97738283C06ED BACCIOCCHIPETER
458,336,460 *2E8961C3EB293641C31657CF1A4044E5D5B04D8D 6CATLINN
458,336,461 *2E892805423D53B44A942149C526C01971FFE6E6 BADER-ALANZY
458,336,462 *2E8092A0AD0B8D31B33C6B63DD9C6512107599A3 BADGIRL(ATNIGHT)(CLUBMIX)
458,336,463 *2E8653B61692CE054DEC6B3993B8B06C2C455307 6ERSATZSTUECK
458,336,464 *2E83C3AEFF24486746CB42F8A0A7596B4F03E326 bal=)
458,336,465 *2E846C1945C6E903B2199C0B26303362FA3CC865 6JENEUER
458,336,466 *2E86E775FD795A10648E54BACE9007B03143155D 6LACTATIO
458,336,467 *2E854E3AEF74CB4E345FEE6591CE1A5D9CFC8870 bb1952
458,336,468 *2E89E68A2399B3CC697D3A19AAB1692FD681B6C4 6PRODEHL
458,336,469 *2E8C94B9C4FFEEBC447DD9EBC4B3BFF6042D5D01 B=====B.~O~o)0(
458,336,470 *2E812B610503C63D87323D22CDF86EEB8ABC18A5 6ROSIEWEASEL
458,336,471 *2E800B7BCBEA2ACA55790AEC94A2C8F76F9997F5 B------B-`~SPLAT!
458,336,472 *2E8EE19C30293103A3D3B5ECD4AA5E12F5B0E44B 6thatlogos2
458,336,473 *2E8893F2824DE1F5A1ECA76A51941AEB6EAF586C bedstuy-parade-&-funeral-march-(feat.-paul-oscher)
458,336,474 *2E882248DDEA9D3D13797986FE73030D7841FA6B 7777GOLFER
458,336,475 *2E8FBC490BC87DBBF501031C27A7B2A8451A828D belonoznikova
458,336,476 *2E8283F53BA9FE6463E567A1310660983171C1B3 BERNARD.TUTT
458,336,477 *2E8B77CF4D63465FBF59B6F103B309795A45C378 BERNIETADD
458,336,478 *2E8C15BC4C4562F5826AA0CFE2260FDFA9728FBC [email protected]
458,336,479 *2E86E7455BE991046146D5EED98BE382A80CC5E1 b%ew
458,336,480 *2E8D4A9E99382DD4181AFC4854B5652D2AD35912 BILANCOVANIMI
458,336,481 *2E8EDFFD6148583ACB938D0C559D4877FAF911EE 7SMELTINGWORKS
458,336,482 *2E8E4270CA66BCDE7C11F832D46584B86A370772 840282 katilimkosullariegitimsuresi2gundur.
458,336,483 *2E8CC9545E1473347604539349C1D4692809C20C bīthūniā
458,336,484 *2E8905B067FBE3728195CF3272CBF298AE2A54CF 866584 julkiset.tilat.sisustus.ja.kalustesuunnittelu..
458,336,485 *2E83C834AEC2CF16D7B9602DDF1BF4BD46E1D159 B,J56
458,336,486 *2E89E68FE6E2CABDF78A49BF016AA3D6A414C437 BKKM
458,336,487 *2E875BF56A7C52F74BF77519C6D1845A432B5704 bknkmrs7
458,336,488 *2E84B3D549276F66610C8EE15CEFD5CCBF36781E blisard8
458,336,489 *2E8FA619F96408F642263914C2FD67CC365380A1 8BSWUNIVERSITESBSW
458,336,490 *2E89FA0636EA1DBEAB6A3EBFF2B55564670A7477 BM4J
458,336,491 *2E80E7BF7BB9B4DCFD3BBB68C6D03F0DC10F6E5E BOBCATKERMIT
458,336,492 *2E876A47CE32673D129E66DEE3D8F3C3C4D009A1 8#).~o.)o(
458,336,493 *2E8732E9402E02CC44E8AD26AFAA6D2FD1CBEC70 bonnie.xayavong
458,336,494 *2E82029428BF9C795169606DD7D3503E8D6ABD36 8SKOLDNINGER
458,336,495 *2E809BE6D2CC40649DFDF977EE7C0F65120EA1CD 8SNOOPDOGMAJOR
458,336,496 *2E81DC0860B7817BFE68788B683412DC1F837970 8SUNSETPOMME
458,336,497 *2E8896B7A4E2C11ADAE2B17A4762321BDB91EBFF borisvargus
458,336,498 *2E8925698788EA113AB7919B3A9EA904F19910C4 boz_c
458,336,499 *2E8C0253A1191331C34FA421389783B0290A8FAE 919738 en cok zorlanilan konu dovizle kiraya verilen yerlerdir .
458,336,500 *2E8748190171F430ABEB8570F02E0C995E08A0FD bpm5p
458,336,501 *2E82CC45EE53809441F991CA051FE9468DC1AD29 BRADLYWILLMOTT
458,336,502 *2E83E2E8375661F1990D19CBE71E9FF4908EBFCB brandonsonday
458,336,503 *2E80D00CDB13FBD7EABF3A4FD3E9F25EECE48CE5 BRENDON.JORRES
458,336,504 *2E81B594F8E10AF2519DE5142762F375BB6E418F BRENTGARAFOLA
458,336,505 *2E8B7C6F99943FE88AA743CC7793A0B1723ED715 BRETTFRANCISZEK
458,336,506 *2E8DD61099BBB6EA8C9846350C64967EE3E6DED8 BRETTMETER
458,336,507 *2E8D5E6E45DFA5165302D6C5CFAD3FAB0D50E716 9GRGALLIE
458,336,508 *2E86FCC79E131DEF2CEC49060997E6E912D2B71C BRIMBELA
458,336,509 *2E8C6FD8AB632FF0D0D6F8C26D84E1361AF50F4A BRITT.TERREY
458,336,510 *2E85D8ED0F321FA4A05D22D54E28EED6F5149565 9KEHITETTYAE
458,336,511 *2E883B2D9AD5071937212979C6C132BB1A8CBB86 9KILLMEJASMIN
458,336,512 *2E88852D37EA5D6454620D625FBBB8EBD3381792 9KOUJIHI
458,336,513 *2E86A08BF7B996E17F39CDF6DFBACE8468B3A6AF bryonpasquariello
458,336,514 *2E8EE69C3DC388DF56E2F519BA6B52F15895A0F6 BSFB2
458,336,515 *2E8BC945B0B8FA7B2D761449ABFB031C12CD01C4 9TREBREHZTIF
458,336,516 *2E8EEC83062942FB67B21773C2639D60447B2254 bug,p
458,336,517 *2E84BFA8558D2219831C6D487FF0CA842B187740 [email protected]
458,336,518 *2E8F67E37FF5E0E40C985C655E2790706C286590 BUT-THAT-I-HOPE-SOME-GOOD-CONCEIT-OF-THINE
458,336,519 *2E8536C4D33C24A0E6138CDD05F73DAD6FFF914A BVW&
458,336,520 *2E8A1B185B02F24BD527D1B565ECBDE1C27E5595 a39?!
458,336,521 *2E8CDBDDF0A8C872102C8C4B884C1D56300E1D3A c)+/:
458,336,522 *2E8748FE004CBCB04F59157146C245295F7FFAED A4WEO
458,336,523 *2E8A14519AC9E859283C7E0532EFA10B1E98A0FB c7/fc
458,336,524 *2E8DD52FBF512C19899230B31BAD2FC3B2F0CE88 CAEYM
458,336,525 *2E860DB5EEB59DF71BB7DEC76428D8136B728366 CALEBDAJANI
458,336,526 *2E85444DE716D7AA1E3203C8B977E26BD7E99EE9 aab202642109e45338a182c44089b84719801980
458,336,527 *2E83832BBF1C9A5C4882B62747BE4500A4303112 AAB24<
458,336,528 *2E81B6B21296397B09EA0B5C0FC70387C68D153E CAMPEARAS2
458,336,529 *2E8AAA04620566EEB2504EA36C786B942CA0B5B6 CANCERJED
458,336,530 *2E8131E130468584DF45D6B6F81B02235476F84A CARMELOKOLAT
458,336,531 *2E8D13FD02C03DC850F33EE906AF14F7F70AD476 a"be
458,336,532 *2E8450690D5515B582A87BF504B23842F415173E CASTROMORO
458,336,533 *2E839C77209207680A2DDE5C31FDE144DC46932E A-BXD
458,336,534 *2E8BB33614A19E5ED6F76551EC9F337582FF34C7 ACCOMPAGNABILI4
458,336,535 *2E8185B207D1668CF4D2D79BF9A19A909014235E CD.ON
458,336,536 *2E82DDF88A28F9E593B1EB444A0EA3A71CF9668E A,"(D
458,336,537 *2E8FB40B1D314F833A22503B1B2737DAFEF11CFF CESQP
458,336,538 *2E84BCDC8F6B1FE4CA8BF42625E449486D51ED09 Ae/i
458,336,539 *2E88B7A70B6A318F9D0D256535A5D41C6CB7B181 CHAS26:64CHEVY
458,336,540 *2E89F1B5D063C48692B2D03FE248CC625CBE792F [email protected]
458,336,541 *2E88B5457CF9C8C185FBD966479E770AA1A9D3A8 CHESTERMAKINO
458,336,542 *2E872780D9281FCFC187201304D3D787C70B68E8 AFQVG
458,336,543 *2E887FBACA1295AE06BA1A72CE87EAE2F2DABB6D A-H1.
458,336,544 *2E8E2238BF8E8DB7125B840C77AE7F894D721D5D CHRISTIEGALLAGHER
458,336,545 *2E8A655401CB85D682EA1AF6DA82DAEF013689DF a_hr4
458,336,546 *2E849875D869E64B9FA5A1CA232019E7598AFBFB cihpargoneda
458,336,547 *2E82194EF6889657C66DA8177740AB5742A065E4 aku,n
458,336,548 *2E8021FEC1162B85B2BD85D307CA785A5A0DE4BE CKOEB
458,336,549 *2E8B25E529DFF39BA456959C4FF576D5FD67B3B8 clairmoneyhun
458,336,550 *2E8A6405A4472871000FBC5D41DC1F5577D08E23 ALERTIMGCONTAINER
458,336,551 *2E8A9846DB67B2D7469A01F64ECD76C998AF6B30 ALEXLICKEY
458,336,552 *2E8CB248C598432965DAE34147CA25B6AB7F94CA CLAYTONBRUSS
458,336,553 *2E8B2CF6ED43F8D6362C97D1B06E8A6928350947 ALKALISER0
458,336,554 *2E8DA189F1BCCFCDC60CEA79EC2C9A596E534484 cloggy.
458,336,555 *2E852DE326F822BE47EA4846B56C9434D9D7403E alonyavnai
458,336,556 *2E82FFB87DE25233590074AC615B7C48B4882DD9 AMADO.CARDAZONE
458,336,557 *2E8B2BEFE84741DD801963BA739653F1F18828E1 cnsy.
458,336,558 *2E8811B5E0DA67FC3579B1E2A67AC1A205DA5B83 COCCIGENICS
458,336,559 *2E871E9043D57CCD8B18D79726E89E930359F571 amjg2
458,336,560 *2E8A251E87383F31E5688F05CF80149105AC1E4B COLTON.PEBWORTH
458,336,561 *2E8DE563A161CA4AF6460312EBB665D98D49E5A5 COLUMBUS.DIPIANO
458,336,562 *2E8C9E1924D9EEB23DD33377CBD783F09B5DD274 AMZI5
458,336,563 *2E802AB543CCC353BAB6F321499A1B20530C0776 [email protected]
458,336,564 *2E8B5DE9B00EFD4FA9A13E74C5E2091CC09F6292 COR$!
458,336,565 *2E8BA11708DBEAC2EF67672690C39F8CD809C729 annehoddenbagh
458,336,566 *2E808B49FF18A37BF5D0B9DF3D0A52F533528716 cqp"6
458,336,567 *2E811A85AEA99D009F73836F883F58E3BF082421 Crazy-Planet
458,336,568 *2E892AEB52D72D7B612F6EB109A5CA7E2B873368 CRISTOBAL.HURDE
458,336,569 *2E8153C79E778EDDF599EDAA4E8336CECA47F87D CRISTOPHER.GOLIDAY
458,336,570 *2E821AA1004AE527C249B6F54DE01C3FD1BA7204 csd93
458,336,571 *2E82FAD282B4852F252B37F858772A32852B45E7 A(OA$
458,336,572 *2E80EC7BD95AD72D8FFE2D234F620C44972CFC70 AP7L
458,336,573 *2E89B96A8C0D0CC2B6E736EBC8C28FA111066793 appuv
458,336,574 *2E8FDF56450F2B6F8A679977A4EAC8D36DBC4798 CY,&
458,336,575 *2E8E07242FEAA8AB1D5C4EC5D3074681CE36AA45 CYNTHIAIRIZARRY
458,336,576 *2E8BE5B648DA061FF2891776B771F3CE65E82123 d1ijs
458,336,577 *2E88A633DFBE0E2A9690EB97FAF4A1FB5C40FB7C ARIFUR RAHMAN MASUM
458,336,578 *2E8A17A82E8133EEE6D37692B7017381E3DA57B9 d3"7h
458,336,579 *2E8A09E15F58DCBA661665A8ABC50DC69DC7D4B6 D)5JV
458,336,580 *2E8353F7F7C2E7DE5DBA354CE5165EBF98646CF9 ARTHUR.POEHLER
458,336,581 *2E886DCE0F2B1FF2BD7503C59C44B079D1F1FFC8 ARTURO.SARO
458,336,582 *2E892FE1F06DB2407E87614F9563682FACB1B2C3 arudm
458,336,583 *2E898FFD67C38372ACDC9DE00EE3EE46E0FDB1F1 [email protected]
458,336,584 *2E8ECF3A4F245B71CEA50533EA7FF8C8473FB6E5 D"aj
458,336,585 *2E8C53936360AFEBCE9BA366F2436F49ED881EA6 [email protected]
458,336,586 *2E8F58F20F2C0F0DE05CCA71C0F6CAE460ED46BA DANNY WOODFILL
458,336,587 *2E8372E1EF6FB01F619A990C981E14684953D34D DARELL.CROWELL
458,336,588 *2E8F2D65CE0B96C8A6E987479360BEDF394445FC darelljinkerson
458,336,589 *2E898602534AFC96D13233FD2B57E59B47F279E1 DARNASET
458,336,590 *2E816792ACFCF0C25281538EFE29C34903B5AB85 DARRELCAIOZZO
458,336,591 *2E86F247A2C7F4770308A0562D2A4073BD12EC16 DARREL.OBERHELMAN
458,336,592 *2E8D6082A4F7791D6A8D299A97652E5247ACC87A DARWINWILKIE
458,336,593 *2E8E9AEF83789F15A6CBEED5B2C6FCC8A89FA380 DAVIDGLEFKE
458,336,594 *2E8ED29537A8DD8DC521471A5EC6B6D4CA0D49E0 DAVIS.SANNELLA
458,336,595 *2E8B907EE07F22BB5FD3F1E3D68EA5B2115CDA96 DAWNBYBEE
458,336,596 *2E8AB11954E8BC86AA1A37E638C69099A91269C2 D(D&U
458,336,597 *2E8D85053FDE983373900287210692B9F50293BF augustrufus
458,336,598 *2E8AC62A1E8063ACDC4F41810198C8C77E3C6629 a;!v.
458,336,599 *2E847C1EE4BD3EA81060D9F90D9248BD0402F73A AVILLA SANTA LUCIA DEGLI ABRUZZI
458,336,600 *2E8D4B2A1726047BAD49D073543E000AA79C8362 awgnx
458,336,601 *2E86E82620E2DC4206983C71DD68010D49AB2370 >-b0 o~ o~ d====q
458,336,602 *2E86B451A14448B8A67CF13BC3A8394E9FD0EF2E destêrro
458,336,603 *2E87F1688EC8217FF3B95B7BD79188963527259B b3.wo
458,336,604 *2E8294CDEA1AE6AE7BC52B983A18BB87C383ABDC b&an?
458,336,605 *2E8BDB823E272C2BD1B815E1C028D15BC5ACB3B3 dik=
458,336,606 *2E8D12BD82A48B2812451C6329B6785BFEA0418E barrettguitterez
458,336,607 *2E87A527F94EC6D6A4D5E115A769E7B24AFCBD3A BARRIOJES
458,336,608 *2E8C55242005BE96F67C4259CE20E868538B1E4A BARRTEA
458,336,609 *2E813DE3B111E4E4D6154992B92EE9A6468ABAB8 dirittocanonico
458,336,610 *2E845044E31704386B5BB3641F204117F85C8F20 dj-ebner
458,336,611 *2E8AED9A2A6A509E492E81C2CF50AD0B8DBC45F5 DJFVLS
458,336,612 *2E8983856FB448E58031315837107C0B52BAA1DE DKP%
458,336,613 *2E8C7780F0197EF9CC18113BE28FF9AAFD582D42 DOCTORGEORGE
458,336,614 *2E80BA4EB0EC84D433785F81C07FA7305D054DDC benny.dyson
458,336,615 *2E84E1C5C383760BBDF7D62892BDB4C8A4018184 BERET K
458,336,616 *2E83DC16258F2C3BB7EB7A843209B88C93598590 BERT.JOHNIGAN
458,336,617 *2E84FB68663B6375F4D72BF704B4C7B3E44B027B DORSEY.GAYDOSH
458,336,618 *2E81CBAEB52260F195B3ED13FD2191B5A0EAEC66 bethany-stevenson
458,336,619 *2E8194B290E6DECCD50047CB60B4A4A09E1CD5E1 BETTYREBELLO
458,336,620 *2E875CD2C7AB07F1152DDA41E8FB2A7DF7A859E7 b%ew
458,336,621 *2E8A1C03CC372212574EC758F371459A11D8C33F d/?p
458,336,622 *2E8D9D971ED98E56255EEFB100D9A0113C9CEB69 dsprk
458,336,623 *2E8ECCE641B684523874BE28CD4E92C189CAB00B bir:;
458,336,624 *2E811D80807B4F8A96C0A8321FE892252D409206 duk&s
458,336,625 *2E815F06AC3E59070D4576F7591D1EE6A5C184E0 b+m)d
458,336,626 *2E8F9392A06A4AF8778104DD2D20D0BFF017ACB5 BNEIO
458,336,627 *2E83A422406EF9D47743FDF678ADA6ED8B275460 [email protected]
458,336,628 *2E8A6A49789A72D4448DC387EAB1359329CA9B5B BOBBI JO GENTRY
458,336,629 *2E88B327F1F13419E8AB1CF160EDEA4F94126B38 DYLAN.BRESLOW
458,336,630 *2E891698092FAC76085316AC76F8280C3E910983 BOBHANNA3
458,336,631 *2E87D7BE092CDDDC3C31852219F10EDD05091E9D e'5#
458,336,632 *2E82771259535E01AC3F1CAED7E15DA290B4C4D9 [email protected]
458,336,633 *2E8E3E06817D98564C5713EFC5DEDE1680A6921E B"P"#
458,336,634 *2E8C3A0B90B8176AF659D5262616C8C767B67F1B B######p`~`~}O{
458,336,635 *2E8B9C15E010A91F393398588ABF9F21F247E528 B(QD
458,336,636 *2E8A5D5510C0D77372759BC208E5360CF70DE13C brain.flakes
458,336,637 *2E88EEF35E7539D618A154BFC52B946DE2A9AAE4 brazauskas.46.0
458,336,638 *2E8AA2B3D3B916903EED830F9363961355CF029B BRENDA-CARPENTIER
458,336,639 *2E820102A709EC18CA1CC72E0814E71A79E33E9D effacing
458,336,640 *2E8DC9E47788006C1A6AB18C4BCCD4DBBCCA1D90 efpeothc
458,336,641 *2E8772A895F654756761F61281F451847E54FC6A BRnS
458,336,642 *2E8953D2EC6769514100C29F94335515C136A328 elliottgoerke
458,336,643 *2E8C65CBAC0A76F6820232187B033A56F1D5560D ELTON.LIGHTFORD
458,336,644 *2E8AB1979BCCA423CD2B85588A2142391D452111 ELYTSAXEH
458,336,645 *2E8F93EEABDE3FACAC6D607545FD21DA5A04AFD1 ENI_LOVE_NEW_YORK_TV
458,336,646 *2E80B0811C73433E2007905DE2BB5A173E8B611B bta
458,336,647 *2E84FACA168A89DC85ABE91BC0A0F68C0739D36E bv3d&
458,336,648 *2E8B97D71EFCD9169150064328009FB148EBB38B bx;=h
458,336,649 *2E8CCFD31B0C29422B35CCE981601A6A09B44F5E B#ZON
458,336,650 *2E89A718B3D98AC88A2D27532C029306EEAC6D1E c0#:r
458,336,651 *2E8B5FCA7FE5630A8083B94E8EA542DC7765C14C C32OH
458,336,652 *2E896EB8A5B6E450AA7FA801046A7F0B76E60253 erlauben2
458,336,653 *2E8EAC7F5BBAB9F07C7BE93D2D66F7B1AA5B2359 C7SB-
458,336,654 *2E844DE3CFBA1F838C7FC4CD94383119E07B7AFF C9GHV
458,336,655 *2E8E3CD95CAEB9C95651B0FCDC24DCB25077B671 CALEBDECRISTOFORO
458,336,656 *2E81E12DBD43CF9BE298F4C1E77AB5BC9E996151 ETENSVOL6
458,336,657 *2E82D2D358CEBB5F773807B17DEEF3CB0631FB78 CA/N:
458,336,658 *2E8BFD38CB4DA4FAA52C3E17061EB2ACD506013F [email protected]@+ON
458,336,659 *2E857D34622782D621EAF0AD9918537A0D6DED2C Carnaval,Op9:"Eusebius"
458,336,660 *2E8216E5D58FB4600E8D7988B87634E70B33DC60 carole-seguin
458,336,661 *2E8DC910539161480EF705E3E3091DB2DEB501E9 cartridgecases
458,336,662 *2E83091495015917248CE36344D68543883D4723 CASPERDRUMS
458,336,663 *2E8D72A966F61C722FFACA5A831BD0F4258EFA3A FALLOMANIA
458,336,664 *2E8973E6593421C98B747B939496D07DD2D97886 FEDERICO.MINNEY
458,336,665 *2E8B805F4F85CFC1E4E99DEEAFD6A456F363B2C4 cdhwn
458,336,666 *2E8F896916484F123D7C767BD57515E602A06586 c_-e
458,336,667 *2E817E557EF27CCF7B62880F470236E7CE0891B1 FERDINANDMCCULLON
458,336,668 *2E84DD24893D12328DAE75ACF77FD2EF8E6CE8B4 celticsshadow
458,336,669 *2E8E8F13990910638426049936C6A4AF70EE873C fflsbsw5
458,336,670 *2E82611629CB085FEB0C1CC5092DB1D2366DE68D charleymikhail
458,336,671 *2E8A88C1FC40E9437E92AC849C9F5787824CDF83 charlieheacox
458,336,672 *2E86C24BFB50579F3B9CBBE42BBBF4475753F0D3 firetreasurevariation1
458,336,673 *2E8BE79283F0DE012B2C627566017FDF5202C7D0 flavababe
458,336,674 *2E868922C69BB9DBB019114741203C618AD4378A FLORENCIO.POPPE
458,336,675 *2E8F677780EB60251B361162AF15A4430498C14F FLORENTINO.WAGSTAFF
458,336,676 *2E84D8E6AC8AE07A6217D94101F55DF075D9B44B FLUSHRW
458,336,677 *2E878817EE138BEE2542FF4C51B2F89CDF2E6A1D for-feature
458,336,678 *2E8ED4D7AA63D077A102D81501ED648987E8F015 FRAGOSASES
458,336,679 *2E807498CAA7A80AD43DEFC7186728762392954B FRANCES.MANDERSCHEID
458,336,680 *2E80A09A121FE4A0560FBF8FE7572EDB4FEBFD11 CHR0N0GR4PHY
458,336,681 *2E847A35548D21771C45224D45516E930EEBE824 christianestronza
458,336,682 *2E8098D9EEDEAD47DD422C59D25FC59C84F3240F franztornadoandtheyamanba-gals
458,336,683 *2E8D9945FCCADD925755B4F87C835765A8737493 fredy94
458,336,684 *2E8B33F7CC0B4FEF1D287474668E92A811A375E4 FRENCH-DIP-SANDWICH
458,336,685 *2E8DBB5165EB57D3E376CA2FBDE1315CB51ECFD1 CJFI+
458,336,686 *2E831D880028CC33ACE1033931825215D0BD5509 Cl4h
458,336,687 *2E82B501F428AD390B44655F31471B09F4CC12FB GALDNURGELATFA
458,336,688 *2E86F32EA62D7BAA61DD3685139336E8C05E08FD [email protected]
458,336,689 *2E886F073CD60F67C2D4C1E60F5505F4853F2CF1 GARLAND.BAGHDASARIAN
458,336,690 *2E8D0D820E6CBE527FFE3649A15DB609F98C8F25 CLAUDSANTILLO
458,336,691 *2E807C95D74AAC5C44CC2E490A1393323B49133B clementsofer
458,336,692 *2E87ADD11DA1AEEF10CB3A372C1A14003FA8A31C cletuspersall
458,336,693 *2E8630A780EB2DAD2D43EECA0554A8F71ED8250B CLEVELAND-BOASTS-STEM-CELL-RESEARCH-HUB
458,336,694 *2E85622D5853371FD2A1ACBFA883787AC6380527 CLFA3
458,336,695 *2E801C8F0374128A610460B68122B113B3E012D8 CLINCHER
458,336,696 *2E85B5A3F24316F3AF002687D6AF32B2E3782F71 cm4ps
458,336,697 *2E85B6B4126D1835BBA1C661079E4AC395C6C0A8 coby090
458,336,698 *2E8BF5579A3BFE97640435431523501BF07EFDE7 COLUMBUSZELINKA
458,336,699 *2E84834DB44E1E0BE2898F2ECD1BA3F2A3FA04B3 COMMUNION:BEATIMUNDOCORDE(1STMODE)
458,336,700 *2E89FDA08DD7169B8F770D7D4E24B7013F5FC2E8 Concertzes
458,336,701 *2E8AB02BD637B0F80D6284B609DE9EF21144E64D GOYMENWN0
458,336,702 *2E8D10FE59B55462077C676B9578614B9CD14B6B coxh.
458,336,703 *2E841CC85513FD8B6549B525012A78DA6FF19AFE COY.DERTINGER
458,336,704 *2E84180B1B0C677E825361126B3BADDCD20272AA COYUVA
458,336,705 *2E85685BF096BA5AEE9CF2DFD013B836588B7278 cp-h4
458,336,706 *2E80A9B339DE9DF3CD30F661E3B02E89436D20DA C:\PROGRAM.FILES\MICROSOFT.SDKS\WINDOWS\V5.0\INCLUDE\MAPIVAL.H
458,336,707 *2E8C44535547FD7B2BEA37B510735D61B3642AED gruisbakken
458,336,708 *2E86DB5BF6F7DB0DAE943B9BE9103B18E6DC69E2 gwyn-johnston
458,336,709 *2E85E68D34AA723117686B7FDC8E5F4D2E8CE53D h0'?
458,336,710 *2E80CD57E818F443168A182F00B7E8F273DA44EF c)pu;
458,336,711 *2E8F6EE8E8C7BDEECC2E1540AB9FA7CBF6421CCD HAZUCHA2
458,336,712 *2E8357963825CEA255BB57F412C18C303C98D6BC crqfxi5
458,336,713 *2E879C4B26E058B36D04E4DEBF0FFBDB417EC094 hecking3
458,336,714 *2E8E6C35D9D36B53564D14122489A40012BC4F7A [email protected]
458,336,715 *2E887F0BC727C2585B09735CBCAA49BCA6134C82 herbfengler
458,336,716 *2E840A9EA3EE78295A9462F62DC126EDDA053D49 ctk(
458,336,717 *2E81C34AD857C9C1FC0E5C2C5EA7DF73C9CCA908 CUH7)
458,336,718 *2E89E9EFB3DC72B4961473761524CA5502881A1C CUS2G
458,336,719 *2E8C5B0C06200A498CF94688EEF7FDECEA67FB9C HORACE.SCHACHER
458,336,720 *2E85E1AADAA9472D304B93AAE8947BB3794D17CC HORSESNSS3
458,336,721 *2E8EBA2FE2656FFED9161508DDFC40893826D413 HOSCHAR8
458,336,722 *2E8AFE3FAF6651961C0D21A4A71D67092F7DE296 HOSEA.CAMELIN
458,336,723 *2E84D8B0F673E21A6A79676C96E12FA763D813AA d1$4ppo1n+m3n+$
458,336,724 *2E8EAC986976DEF8961A7D9BD77B309E653D888D hrsn
458,336,725 *2E8CFB0EB515848D8B0341EE85225C4E79425E99 d99:s
458,336,726 *2E83651AD2C2A512CE0AD92E64A289DB15585BE0 HUGQKKK
458,336,727 *2E8C60CE26411A00155FF26BF00B47E9E993A95A dagitmak
458,336,728 *2E85644F90DB5DA336D8DD0F5E9480833550DB22 I<3MARIA
458,336,729 *2E846871D70D69CF6D4F5463360B990445220D3E DANTE.LIEURANCE
458,336,730 *2E88B914E89A02BB13FFA72C0DA017D02B5EB236 IAMLAB118
458,336,731 *2E8CDB31E9B1DC1400C21F3ECFD19B258A322CFE DARRELKALAFARSKI
458,336,732 *2E8C27C49CE1B62C4BA6914DC65F9C53722C3280 DARRELLGROCOTT
458,336,733 *2E822CCE8690D7317506B4385C4343C32B2C887F DARRON.VEITINGER
458,336,734 *2E869BBDFD6486003AD998B80EE60D7E46CAA6EA [email protected]
458,336,735 *2E8C39123739610C718D4E6FFA73CE29A548B0FA [email protected]
458,336,736 *2E8AB6C0389A295B91FED8EAF79D96DF026B4EC6 ilovearsenal2007
458,336,737 *2E8D32EA2B6C91C35081170BA19A1ED5AC73E943 ILOVEKARINE2009
458,336,738 *2E8E0D89425F6ABEF1CEAA941487C35D88C6D5E6 iniisiep8
458,336,739 *2E87F2964A8EB30BB10F9108B250C8F072F2BE54 DEBRINKAP
458,336,740 *2E8FF0B7A1B8D1F02906138354D98E9569C1C301 DECISIVE.10
458,336,741 *2E8915D0A93F171EFC428F99B63B285840DE9DC0 invijzen6
458,336,742 *2E8DB7168CBF45BE2D4B26BB4E59CC6F24FAE112 iodrameses
458,336,743 *2E833E85F8C418CBE5D2156A2EB1588C9BE623F6 deelgebied?
458,336,744 *2E886B75D4CE387B1A32368AEC41F7D3A8F34959 I REMEMBER (EXTENDED)
458,336,745 *2E83F48972C9D71D1E9A0ECAFFC9A1C5FC990F25 DEMETRIUSPLATA
458,336,746 *2E8C4A24D14A68558553E1EB1F935A2BB845D1A7 ISRAEL.LATAILLE
458,336,747 *2E805063C908A09F2D00E600E2D7D8E200D25CFF ISREALGOLDRICK
458,336,748 *2E86CC3DF3E8D9988EB663D3012F16697BF5D231 italiá
458,336,749 *2E8D61F3AAF5206596AC8A175793C889A7937774 $JA
458,336,750 *2E84902FBD4DE3CDDE97DFC6FB9048696704ADC0 DEQA;
458,336,751 *2E8BD1C06ED05762AB45612E0AA9DBA68F70B2D1 DESHABITASSENT
458,336,752 *2E824406FD631D2333ACFA70C155A29244A93170 deshawnabeta
458,336,753 *2E8762E465CBEF74904AF269F1F0568AB6657C6E jammin'(albumversion)
458,336,754 *2E8DD11DF5391AB3D1C6D00B61F807CCF26C5796 [email protected]
458,336,755 *2E85E26BDDA7FA9103C9B101B3A8A85B5B93C07C [email protected]
458,336,756 *2E84E23C5DE6B40ACD19F9C08EDE7DC773C2B651 jeffreyminchew
458,336,757 *2E86C6E4C3905186BCE853BBEC21F80487E376BF digku
458,336,758 *2E8D367DB16CE47A621BEA870D293941FD762221 DILLONSALINA
458,336,759 *2E8D60F0238AF2732CB15CC0DD9C398A7BC4D1D2 JEREMYSCHIEWE
458,336,760 *2E8E123CE3ED34C454058B0FE4C7B1A75BB41FB4 JEROLD.SHOTKOSKI
458,336,761 *2E863E65979CA0CAB2245343561E41A7C57BFC07 dipkbxf95
458,336,762 *2E881BF146414E7965898AFBF608832636EB1566 dirkant
458,336,763 *2E89FA6A662D39444717B97A5313B85641F2842E dirkmillen
458,336,764 *2E8701A203B25DD2A8453558C8816E08526A27F3 disantes!
458,336,765 *2E815B7DBE4FBEAAC3BF908193F5A64776EA7DFC DITTATORE LEZIONE DI GUIDA CON LA D
458,336,766 *2E84FC166C81C63204E14DDB1EA61247E3B319F4 [email protected]
458,336,767 *2E8EC455CB202DC840E21ED8A2A3613460D308B2 djd)o
458,336,768 *2E812D9D2A44AE7A4BA7C9D80437C1638F3C5604 dkrt
458,336,769 *2E821833C972960A4EE2D2684268FEE914810EE8 jlkrelh4
458,336,770 *2E89D7BB593A832B8197B4F0B35D1840A0A080F4 JOHNNY.ANDRE
458,336,771 *2E849AB24FD31E0570B6BD915F3A3FCA964B9986 JONASLEVETT
458,336,772 *2E8E082562613B5D146A0709E7493543179F6A24 jonassaephan
458,336,773 *2E8DE04931B86BB9970435C8EA85F2557FA386B4 do:b
458,336,774 *2E8E5232ABBFA26026EC36163DD478C81BB1A7E7 [email protected]
458,336,775 *2E89EA4DE4EB49773EFA23E17803C6F958D219D9 DONNIEOREHEK
458,336,776 *2E83ECFB3ED4E4C5030B08A52046D6DE8B2CA835 DONN.ORTTENBURGER
458,336,777 *2E8E43583BD5F071F415C7FDFD3F0741382AE937 donrothchild
458,336,778 *2E8D648510703BA3CC1C6337B8884BA8F6208C7B DOODLES6
458,336,779 *2E87CA5E1EF8FB1B1CB577100A9B488B00E9BD31 juniorraspberry
458,336,780 *2E824F62478D2131EF706A7AEBCD94E2F3F5BA3B dp!md
458,336,781 *2E8BB65F2B0F3D71900636E903880F858B23A7D0 DP?RF
458,336,782 *2E81B931CB43FA5CE4D8ECF110F834B73158930B drizzlering
458,336,783 *2E8EF01E64176EC243585A1529312F8C66DCC731 KANNOURA
458,336,784 *2E88CA848D1A805E75056C2F0D5F446D7FB5741C KAYLASHAFFER
458,336,785 *2E8B85765FA597F1B6B3BEF1BC6E1DCB0118C6D2 DT;H
458,336,786 *2E8A72F39EC0EEE4C1DF7107E78EA014CE1FB703 KELLEY.DREVS
458,336,787 *2E8737F5CB27A2542D0501EC82D2CC5A49D1DF0F kenholy
458,336,788 *2E8FF9EFE0BAF80BD826A8A43DBED501BF071C92 KENTONMORENCY
458,336,789 *2E89A750B566298F05B5D30CFB3294BCF1AA079B KESYTYSKELPOISTEN
458,336,790 *2E8443B0B3B3820D36FF1D8AA921A7A219583F34 KILLORBEKILLED(FEAT.P.R.TERRORIST)
458,336,791 *2E83665FBC51DA4A7DEA9827072C60692E27BDAF KINDERLIJKE.
458,336,792 *2E8464AF3681E4769FC1874B64D14D8E3A4914B9 DV:DG
458,336,793 *2E83FD8962C7C69012DC7C8C558AAA448D0E8E75 dxf,,
458,336,794 *2E8C36E454402AC9D52483B1D1F1C6C55ECC8621 edit-pen
458,336,795 *2E8D4419B98F6E998354B2AEEC98B502FA75365A lacunulose2
458,336,796 *2E8409106D8FC35C435DFF4037E9C3C3B7460558 LAKAVEJSICH
458,336,797 *2E89BAB1A8C79F151CA139503CC651755FCA0B17 eha(w
458,336,798 *2E83254808DBA98840DD1B32EDE07038C7DA38F8 langtlangtborte
458,336,799 *2E8BD14D8ED255C189094406280FB0964B070A3A LAUNAMSNOITARUGIFNOK
458,336,800 *2E8A2637AE8BD47DA08765E99D03417E8D1CDA6F ELDRIDGESHERLES
458,336,801 *2E83B7B8FAC6130FC6D6D6F17148AC849FBA6FDA LAZAROSWIRCZEK
458,336,802 *2E8B00EE496C536B91B4D839D6968DE3A4BED781 ELISHATHREETS
458,336,803 *2E88301459810A2D873E752AFE388211BAD5AF10 LEONBRUMLOW
458,336,804 *2E8C6CA503AA96352EE1047127FB084FAAB028D3 ELLIOT.GANTERT
458,336,805 *2E8EDB152061EFF5247ED89F6B77B28980396C8D ELMERDILILLO
458,336,806 *2E8BB1D6CE7D3B8FA8662617B15C058854F2B08C LEROYHEISER
458,336,807 *2E899F5377FC0AFE8C1F7A18C44DB68FF85EAAB0 eludee.
458,336,808 *2E873F05F3E5A7A422F0A5AB95BA88EE5BF9E741 [email protected]
458,336,809 *2E82BF37E74C321FB9FEF1535509E169944AF209 LIDSTROMER-PAGE
458,336,810 *2E8DDBF6BE725BFE9C5AA03295DAD927AD0E7AC6 LILYWIGGLESWORTH
458,336,811 *2E8607F37D5609D53861FD8D0796C89BE257ABA3 [email protected]@t0r
458,336,812 *2E8CC6C4505C8D30BE8C82DC2E446BDD222A0787 EN207153314
458,336,813 *2E8AD643F13E3D1D663533430D9C02DCCB68F1E3 ENCASTELER0
458,336,814 *2E8EC4C89A7D6799C415290C1A2FD81EDAF1CE6C enterr
458,336,815 *2E89FA207796BCB56E8FACF6373E0550FAD91FC9 EOBAP
458,336,816 *2E8A12158E831FA4261C9E164C0A8858AC711BFA LLP1999
458,336,817 *2E8F0463CAC20BCE8483E66B0B207F7F9C9744EE EQU1VA1EN7S
458,336,818 *2E86C53005631715F736D1E0935F6BFCB59FB773 longh41rs
458,336,819 *2E89442CC7A0A87B1018D516AF104443730B262F LOSHOMBRESNOLLORAN(FEATHORACIOPALMA)
458,336,820 *2E81A9E77F9E5FEDB2401C6902AE173629A83F1A ERNESTO.SVEDINE
458,336,821 *2E8905343B94966F828D7B7FD972BB0D6E27313B ERSTABRISS
458,336,822 *2E870023BB401E304AF9E3CDDE2C8EA3435D7CE2 ESTEBANGOODREAU
458,336,823 *2E87015A2BEFF7887401F1CB1256D30A2C93CDA6 LUCIUS.JUBIC
458,336,824 *2E81A932DB825AAB557105ACCE3E9BC7979684A5 LUISFERNET
458,336,825 *2E8F0EC76F9D9074DF0D8BE239153BAD9EDB28E8 ET66.BBS
458,336,826 *2E8B45738DF8B4E72A5F142035FF934B5C5687C8 ETALONSZÁL
458,336,827 *2E8590BFDBCD609D63AD781F559BA23E9FCE45AF ettsstats
458,336,828 *2E81310B9B06B07E073740EC6908F73269C36EBC とEUROPEANを合成した造語)と形容される。
458,336,829 *2E86FF46CB9FD543DDB6F58CFCEFD72E6292BDB9 MAGKERESKEDÉSSEL
458,336,830 *2E830DF00B4921C580FCDE16BDFDB5496001E995 extremesb
458,336,831 *2E8AC486F03C662A01B09A9C8CF9C477CE8D51CA manggala-putra
458,336,832 *2E8659EDD43F85A1514266F3EFACE4B38793F1ED mannekrag
458,336,833 *2E80C244119A2FD249E36E55315AD06E4AC19DC2 [email protected]
458,336,834 *2E8536DE963DBCDA05BA7F7437C137D67C9CFFE4 fann3$
458,336,835 *2E8477A0C3F4D63942FE1CB34087B5089721BFAD FATI.MATA.(CONGO)
458,336,836 *2E896CFD6591B968032D4BA73EA137A3B95C386C FELIPE.ALIMO
458,336,837 *2E8E3A0207180974848A325839B01C22BB013C82 marsias
458,336,838 *2E839571E3D424D5B20A6988C19771C68F485828 mattsturdevant
458,336,839 *2E8388CE90C0FD5891EA3453887EE5B798201D08 MA VLAST, SYMPHONIC POEM VLATAVA (THE MOLDAU)
458,336,840 *2E8640908FB0749E0ADE23D73789C283428480EF MBO1RA
458,336,841 *2E865A5EA6E876DD23CED25A2CDBEE3064A8388D meetings?
458,336,842 *2E8D3DE12C80DA140A2886B5CD1F062978CA9278 firesadie7
458,336,843 *2E8F54884F3E25A9C16B0F9124273AE21F38B6F7 MEHTHAB
458,336,844 *2E89D963C26D03A12151E8CC2AD714EB427F2436 MENOSTA7
458,336,845 *2E80FA0A389F3A24E45DBF9A377D0885723EA2C5 [email protected]
458,336,846 *2E8C97EC50DD074C3791135138273B266176D672 MICHALETSHUDY
458,336,847 *2E8E16326348D715D00B4EE15510049F22D525B8 MICHEALBRANSFIELD
458,336,848 *2E8A70DB99B1F582A4CC17DDDCBA5C5CBFAD7961 MIGUEL MORA PORRAS
458,336,849 *2E8A86DAB5B1050C06329CAB3088E8ABBFB69E70 mikee.silvestre
458,336,850 *2E82A7178661E650B79E0B5FA3B0FBD7878EBEFA franklynpatadia
458,336,851 *2E87FCF341EFE9458B684B3A2A3EABEF5756DF74 FREDERICK.GAUSE
458,336,852 *2E81AD3B3030352D8A2900FBB7124A22E08C7B7F miltonello
458,336,853 *2E8F4B4E68A159C2AF7F9B564B4275507759DDE7 MIQUELPANTOJA
458,336,854 *2E843577111731191B85FEE5BAE60CE164B6E328 FROM FLESH TO BONE
458,336,855 *2E8C22C81F9E48EAB9FD3FF0B803D042B54071AA MNTNWRDS
458,336,856 *2E8E97DC86045FCD616CBE4DDA7188CC038DABD9 [email protected]
458,336,857 *2E8E90464BE18E439017B299D5C5A401DBF14D78 [email protected]
458,336,858 *2E84C244B346C687BF15CA70EF5416F8F1DECAB6 garret.neal
458,336,859 *2E8624437E8672B00DDF39EB0850AC1291C11750 Gefallener-Engel
458,336,860 *2E80F4274A1B66F54EAC0564B1C70D591D4F786D geluksdaed
458,336,861 *2E8D277BC2583F7F729E30934263C812AFD4738C [email protected]
458,336,862 *2E8ED793B8EFC5FB8DB920267FABBE33F746919A GERALD.GOZMAN
458,336,863 *2E8E51CC1626B8E05B65DEB2CA805D7F8E6D2B36 gerardsciotti
458,336,864 *2E80359F8FF335C1C027B6DE7FC29A743FB8B159 GERRY.CARDANI
458,336,865 *2E8AA5324E506A83323E25F2FA84EBA49D7E9C51 MUSICKELSEY
458,336,866 *2E8FA961FED8F8321D3DEEEC815E1B83DC991E93 [email protected]
458,336,867 *2E81CD2BD46A64D70740D36FF7C15AC2621E7DB6 getuppa!!
458,336,868 *2E8D3F651C88D6FAAB69BF303895017EBE7509A3 GGYBDEVO7
458,336,869 *2E896C017701C0D12B7993A219CA53B96D299FC4 gifty.lianne.dela.cruz
458,336,870 *2E8A245006D7951193B1EFECF47BDA13A31D5FE7 MYVOX
458,336,871 *2E81F264935F46147E6104F0E8CEE8DC66E0AA37 NAPOLEON.SCHOPP
458,336,872 *2E87B58916ECE4FCB1FBF25DAD4A01ACC9147966 GLJKRCHTR5
458,336,873 *2E81CFF256DCD19B22F94C1DF84F350E5D738B77 GNASUHP9
458,336,874 *2E8E03221E919F413AD6BD9A46481B62D531883E Go2
458,336,875 *2E8426E0C1B6F4966362E6F8E914DD2CD761C090 ndstrght8
458,336,876 *2E8408B12C188CC5FEBFF4ABE42F473155EB287C gravons5
458,336,877 *2E81ADDA87E38B46AD039B166C9140812BECEE63 NHAZIMAH
458,336,878 *2E8760D0C52E48B9E8FB3A4B5BE3A977CEBB5FFC GRYTLOCKING
458,336,879 *2E8723B7A2B6630CB26B10C3AB372F057E275E86 nickycokins
458,336,880 *2E8CE07624502781E22739DC73590D399F073D08 GUIADOR0
458,336,881 *2E83593556BF9FD2533D35E467F6CAB389BCC794 [email protected]
458,336,882 *2E89842B95BF797735857AA5649D1777E3E43FBA GURNEYS?
458,336,883 *2E8FD92E7AC4E9763ADE91A63F700309C04361B2 [email protected]
458,336,884 *2E853EB8065A6ED8E1934C9D6D4A4EB3E1613F26 NoAngeltoLayMeAway
458,336,885 *2E82AEEF86649101917FB502299AD83B88AA3B8E NP_002515
458,336,886 *2E8363AD66DE45994C732BDFF5D76BA4C184A93C NUANRUM8
458,336,887 *2E82F18F33AB9448C498324CE9A00E54B5B47C00 hcabram6
458,336,888 *2E894E899924CB623F98D6396DD4C990EDE49F1F HECTORAUGUSTE
458,336,889 *2E8674B0210CF10B925E716ED9BA25593A146795 HEERFRIEDENSZEREMONIE
458,336,890 *2E8BC0A794B191F532AF5F0AB8FD7F7E5B0AF583 hiltondilling
458,336,891 *2E84C412A883F2BDD8894E2900B472D6081F22BA historyoftheporschecarreragt
458,336,892 *2E8F1B437737E5049F79A93CEA548B75E21C539D hitesh.dab
458,336,893 *2E8C4069B56F0C2DFF7490FEEBA43F33DAAC8E1B HIZME
458,336,894 *2E82ABD34480D30ACA6B6B374427890E458B223E ORDERLY $
458,336,895 *2E880078A44D91F4B56B21D68847D94FE1FD4067 Oslobadjajucom.1
458,336,896 *2E89DF3BD45375038F732264DFD4A622A080437A homeamongthegumtrees(live)
458,336,897 *2E8606F9B2B80322260D19609D0D1258DFD52403 O~TQ
458,336,898 *2E890845430FCC952B5C46A5F012EDB2A7C7C941 OUTJOCK3Y
458,336,899 *2E884C8C0454A88B4B2F744387EB782BCC568346 HOUSTON.DINGELL
458,336,900 *2E8479296F9588A00F7C50E01A91A2EB92BBFE97 overstchad
458,336,901 *2E8A9C1B23920F4FD75E49888F451FDFEDA53B17 PAINTINGTHEGARDENOFEDEN
458,336,902 *2E8C5281CC0B90CBFA22C411D5988EE319802E2C IAMVISUAL24
458,336,903 *2E80F94079B8675961251A60B3EFE91B59FE3DC6 PC.REGIONAL.|.COLOMBIA
458,336,904 *2E8EF09394BFEA403F34F44B4B4318373D659959 IGNACIOFRANTUM
458,336,905 *2E856C468F18D577E72EF687B25C9A2C369F6112 PENDULA21
458,336,906 *2E851EF2979FCDEEC9E20A08B729AF02C58C2EF4 [email protected]
458,336,907 *2E8F75D358EF502FF789A04BD0B9FEA857639B46 PENNY'S.ARCADE
458,336,908 *2E80C53A4672A2C64B5942B38C15D09BDAC76F3C Il-Festa.tar-Ra
458,336,909 *2E89A6C2CEFB2CD6F9AE90259606FBD0CD6450A1 PETTIREN
458,336,910 *2E86D1F59DDB61CC51B7F9CBA63E8B73BC2632B8 pink houses (feat kid rock)
458,336,911 *2E8AFCB072EF011A8BFFC2E00A7CE1BEF50413CA ilycelia
458,336,912 *2E8B0D88312CA533FC687E6916CF689FD679DCF3 IMEE VELASCO
458,336,913 *2E85E9C86620F09587356968B30A8E1916CC867B Pistol-Packin'-Mama
458,336,914 *2E8215F5F45EA55E9896D6E97707503E2FD67DB6 PP*.*.SPLAT
458,336,915 *2E8A4EBAC845CC22FCB35A596EF0EC0CA38AA138 irrationally6
458,336,916 *2E80774FB4E424CF11CD90D55AABBABF2ABB5282 ISRAEL676
458,336,917 *2E8F72C6F10D3E5E103C29DE633A1B08BFC853C1 PRURIGIN7
458,336,918 *2E8BB7E5CEC00F71EE9950ED9136E0CD889E7BBB JACOB.CLOUD
458,336,919 *2E8C26B176B65B448812E1BF98B895D753C3866F jaimelynnwilson
458,336,920 *2E80D309069BDE53E534107DE8818745D54C3A15 JAIMEREGNIER
458,336,921 *2E80D98C2379E91D12FC8D62D2CAB5C05F7B2F3F jamalbutteris
458,336,922 *2E83CCA24D7B782BE247BB556C968545F9272B70 jamel-joyner
458,336,923 *2E8B5A38FE795F1D3A97A9F4E1364497063E3F4C PURSHIA6
458,336,924 *2E895AB4C57ABF366B85939F6C7D7EEB1217DBC7 QEJC
458,336,925 *2E86A57BE59AB056F1D6CD7B2E654B9495B25D37 qghiuz
458,336,926 *2E8AC11D819A1C90C8284B37E31FC6107E273872 JAYLYN928
458,336,927 *2E8CC5D76D532308B4E642A963C67672AA06BE7D JEFFERSONMUSHETT
458,336,928 *2E8A1F9BAC7B4961BB6366CDB25055306F6902D4 jeff-wollesen
458,336,929 *2E82DC72C315D1A283920A3BFCD9862B9FE84899 JEHAN.MOHAMAD
458,336,930 *2E8EDA3D3B0E0B268DDC6E733817D0A3370EA4CC Queen.of.the.Prom
458,336,931 *2E8176600B62F1A7A2E3AD93318DC1D1C215C040 jennifer.barlas
458,336,932 *2E88530552A5FDBEC5619DEDC972A8DBA2854EC8 JENNIFER KOHOUT
458,336,933 *2E828998DFC8C686BF649D2924748FED9EEEC448 JERMAINESTOECKEL
458,336,934 *2E880472A00D1DD749BFCA7972A399CB03286ABB r3c73r5
458,336,935 *2E862CE89834876A66B672CBE78D0AFF622918B3 RACHELBERLAGE
458,336,936 *2E859712602AD20C3D15155B2A8FCAA706FFA16E RANGEL
458,336,937 *2E8F3F7DBDF5C8F6FCB5483CF7D66E96725E9D3A JestemTw
458,336,938 *2E82D60BB9EEF195310A092236D16F96360408D1 J(F
458,336,939 *2E802070C98C3167D80CC9AE7E2BE2A405740670 [email protected]
458,336,940 *2E85B6435222BE058757A13FBA7A047DA07A5917 RECIPROCITÁS
458,336,941 *2E8007090B3785A56F5C40768FF90CC777B73D5C RECOVERED1521
458,336,942 *2E8D474749A0B504399CBFD923FD2E8192E0F036 REDIRECTINGSELFTHERAPY
458,336,943 *2E8E4DC5A067A20FFCD9C20E6C1E24831CEB2571 JOANNFANNING
458,336,944 *2E8CCE12DB24514C5C675FC20264E94F79687CE1 REIFSTECK9
458,336,945 *2E8A8D212AC05631C5528F7D8B81F3A3951C7993 JOHN-BOZIK
458,336,946 *2E8D31F04C1BE350E2847101CAF368B7677A181A john.colebourne
458,336,947 *2E8B66994A379DE708983404D9CA4B06DC57A745 JOHNNIE.JULIAN
458,336,948 *2E8DD6C0E435EFF9400F7416B4BC2C0135B3D72A [email protected]
458,336,949 *2E863A8244BBA736EB8664D6690573F925892D23 JOHNSON.DARE
458,336,950 *2E89FD8D6B37AC5E7E130E593C8D2DFCCDECF0BA jonah-marucci
458,336,951 *2E848095B417286B13FF676DCD245735B7FAFD03 reposiez3
458,336,952 *2E8679AF472D68CEC4C05A32FE50566808BBA79D REQUIEM:X.SANCTUS
458,336,953 *2E885121CD9BEF2984235AB654A45F120CF56BFE joshuapanos
458,336,954 *2E836E422B0B80725A450B40F651B31D0B6F2580 jospehsengupta
458,336,955 *2E8655C27A9B6284A4B5BD86C9EEBE5B308BD78E “RÉVÉLATIONS
458,336,956 *2E8417416D8488692834AB2DB89EE906392CA7EB RGGVLLN
458,336,957 *2E892CD74C6566B0F4F96134C3FCC50887800C72 rh4ps0de
458,336,958 *2E8B75CD9083966662E7C8FE36583533A2465DC7 julianebersold
458,336,959 *2E8708B9537E2D96130E002E52289E52ADDB605A JULIELAZAROFF
458,336,960 *2E8F79D8E6889BDD123446BA272034DC525E6310 RINAMERES
458,336,961 *2E8055523F80DE02594561009ED9E6F2E5E3C1F3 riolans
458,336,962 *2E81B3E62DD311E6550105D390F34A16EFB36517 KELVIN.HOLL
458,336,963 *2E8CAA9BA063F50CDAB62592C7B6610A600854E3 KEMP165
458,336,964 *2E8CD9EE86C979E6AB96DF348F73275FA6692609 riscaldata
458,336,965 *2E8CD145568C0C4AA1FCD749D68E4D9FAB2AE3B0 KENNITHAEMMER
458,336,966 *2E82796173D7E110A854F40AF87E0C59A96DF5C1 KÉPALKOTÁSBAN
458,336,967 *2E823FED7F5328390592BADA4FB672B5D5705C83 ROARKE’UN
458,336,968 *2E8BF6AF2D1319C07474BE356C839AB84658A8B2 rocco-roma
458,336,969 *2E88D8224B330F70D770BFFAACFF4685CCED2BA0 kerneentitet4
458,336,970 *2E83FDE5800FB4A4FD00BFA03383A2A319EEED47 RODOLFO.WINESICKLE
458,336,971 *2E86659B82DF12373ABF287665542C06C4AE1B30 [email protected]
458,336,972 *2E85C76260BD7C1269C88308AA6EA4FFCC265F25 kiki.tang
458,336,973 *2E8EC1387F06E65F129E90BF61E9F9EF2EA4D9A4 ROLLANDROADRUCK
458,336,974 *2E8CD363CAA925268A02CAEB3036C86694B5663C kipmcclarty
458,336,975 *2E87FE1012153641159481AC840F2AC86CEFCF6E KIPPULLEM
458,336,976 *2E80535142A4B8F06C29C581EDE2CBBF5E989F93 RONNY.COPENHAVER
458,336,977 *2E80F55CA2B44E45AB333D7796B21D2D00F2FDFC KISMET
458,336,978 *2E8AF2DCF02956FF2372BBA657AD4B4657E204A2 ROSALEE ROGERS
458,336,979 *2E88E7804F253AC87C0D375700C1C2D94289371D ROSET
458,336,980 *2E8E6D786CEA653388960B6EFF24B7EF43F91E56 ROYCE.WOROBEL
458,336,981 *2E876DBE4EC7547E9C6C733BEA0FB86959A7916C [email protected]
458,336,982 *2E8F0025FB5A93467CE928F2BE26092712E94FC2 RSTIOUIS
458,336,983 *2E8296F4228CD49B25DDE4B2688C44BA2F1D6B3B RTSARTXE0
458,336,984 *2E84549078F6C213007CFA6CE96AA04626733255 rubinwhyard
458,336,985 *2E83025F7B6519706D6A977AA71A824F3CD9B9CB RUNNINGTHROUGH/CHINESEPOEMSONG(FEATMICHAELWOLFF)
458,336,986 *2E8B25474251F4AAD23CD1161F7A8E39409CD8BD klassensolidarität“
458,336,987 *2E82E3FFD209F44829ADA18059BB28F136D047F3 KMATHESZ
458,336,988 *2E8045C1B22C3847E0D1F0E99C6DF8C7DDB96007 KNB2546
458,336,989 *2E888B8574D717D4B4A7279F7D9270EE4AAA8155 KOLIKTHO
458,336,990 *2E827F377D22D21343FC94AE28E22ECD7BB85BC1 salgildore
458,336,991 *2E8A929B30D11F03961B61162143D9CB061A5CCE SALIX0262
458,336,992 *2E8FA0FEE09E5A83051283163898B671322F30D3 KRISTIEPORTER
458,336,993 *2E86C8175B91E3FB5DC8A2092C3CAFF87D3549FA K]RM
458,336,994 *2E85D7BA05305C21279E76DE4724EB26BA6FC1A5 KUN0
458,336,995 *2E8FCC43C53E4ED8F80D3D8351660B5BD98A4775 kv-g
458,336,996 *2E80395B16C57DA65DC5910C4CB9C3C24AF1E0B4 l3xluth0r1
458,336,997 *2E8DF25FC40EA45D4AE4E8A08305F50E5793B83F LASAMBADUBAS-DU-FLEUVE
458,336,998 *2E850E92E5A71262FDCFADAF68CCDDECC32B3B95 scottyelizabeth
458,336,999 *2E806F745C337315EE64FE89FF4DACAE9A39198E seanmcelroy
458,337,000 *2E8098363759453E9C9D47E578C5DAFE0665446E LELAND.MARSTERS
458,337,001 *2E85E33C707E1E9E5406291880B6954BD29028AD SÉNTER
458,337,002 *2E8F739A4A7C5D34B38BACB550A835054C2A579A [email protected]
458,337,003 *2E8522A5985E65EDBCE31D01859C0D252BC13D7A leosauder
458,337,004 *2E8797E45DAE5C4CCD4AB10B87D6D22296F77C21 [email protected]
458,337,005 *2E85D4F4F1BF43744D52C65AF0310A8D2C7F33F0 SEYCHELLERSES
458,337,006 *2E82E82F199CC1B75B65ECF15013AB705DA96FBF LE(W
458,337,007 *2E83C595AD16C7488BEED9DE4D38EACA2CC2690B Shadows-in-the-Night
458,337,008 *2E81D47BEA49F8D169FBF0C49A78A9EE1F95D8E8 shalandaholt
458,337,009 *2E8718BF88A11080E73E31B8DAB3D54CE5D9AEFD SHAWN.PERIN
458,337,010 *2E89BD3800896A8C43C4FFA785614BDE46622410 SHEWOMAN5
458,337,011 *2E809AA98537F73765B4AFE111FE06D588AB1121 [email protected]
458,337,012 *2E86CC6C75EBF716DE0C4E114C157FAED6CBAE88 shortysierra
458,337,013 *2E85108323CE497C736B5EE8ED438EF210876352 LIONELPAVLOCK
458,337,014 *2E857D924CA3B5452C1B02DFECC2483E3EEFF3E3 sidissler
458,337,015 *2E8365930F838071EBBAF41E96365020240420A9 [email protected]
458,337,016 *2E8483B2363BF8BE97E4CD723A70E22E965379C6 SILASBUDY
458,337,017 *2E87716185A4FB6807EBA7814F384F173BACDE7A [email protected]
458,337,018 *2E87F9D35D5AF88873AE2561EF6A31EE06E5A817 LIZZIEBRIDGES
458,337,019 *2E867E7627786C125A13D4C88BC901C8E10DB3E9 silografia
458,337,020 *2E80CAEC9F1E84A9C222E78ADC73D39834BD04AB llengad-1
458,337,021 *2E8153DF9C57A5810A58080074548E1567B30388 SINGLE-LEAFING
458,337,022 *2E83CB2A70122CF1A0333D69EA89DDC941DFE560 LORI.BASKIN
458,337,023 *2E82113306E8C550591E523BCA204774031FAAFD losingcontrol(richiehawtinrmx)
458,337,024 *2E8E4CE765C52D35450AE4272CEABEBD3A655D73 LOYDMINCHELLA
458,337,025 *2E8FE7486EE29D464EE6BA24270EE4488B3466B5 LPROAA
458,337,026 *2E8646A8E5F5D3BE551474DCE62D3C66137582DD lrdjovwi55
458,337,027 *2E874AF18DDC84A730E65DDABB2ED204F29F75B8 LUCIANOALISAUSKAS
458,337,028 *2E8D16C976F9227AC7D77B09DA360213ADBC1B4B LUFTA
458,337,029 *2E824063FA41D42015F0FA3A7177EA063B4E51D5 soding
458,337,030 *2E8D116A81A5B0B4EE47A8737358C63A262C0397 lyleboock
458,337,031 *2E8D91E79135B5C7A7391642538E46791E449F7C SOMAIHCCUTS
458,337,032 *2E83437D4173B79C5160006059322F2424825F4D !SOMEWHAT
458,337,033 *2E88F308E4D145D902A171266F4942C56A50523B lynnkillam
458,337,034 *2E806038999FCB78CBE45ED0B67551CD66177E70 M3CH4N0TH3R4PI3S
458,337,035 *2E80A51742C9A26907BF3AA2266E344D59583DF3 SPENCER-TAN
458,337,036 *2E8D11A3C77FADB081B5D202242DB8AFB1B6BE1D splat-*-*d#8
458,337,037 *2E8995EFF26E76028A4770BD6BF37BFD2A0E208F splato~q------B
458,337,038 *2E86B4F73ABFB21C33F1231FEF12F03A09C41EE7 MANUALMARCILLE
458,337,039 *2E8FBEC25DD5460BCBE1EF04174955266DE7437C Spuitslang
458,337,040 *2E8FE6B49B4F1F888CFD75D9ADD3AFF112882B6E SSUCRETUC
458,337,041 *2E8277C35D9E94070832914C90D34E6B89F86181 STANFORDBINKLEY
458,337,042 *2E8B410D17A2B0A15A66A31F9E13FD95A726160A STAN.STIGSELL
458,337,043 *2E8A760D34E53B696D0E0C544836B440D796D004 marthasa
458,337,044 *2E8C1526DEBFDD0388890B620E0C69E768A2C7C1 STEVIEKOLASINSKI
458,337,045 *2E80BE77D3DBE382291CA63C0F868CE84276709E STRAPPUFFPULLED
458,337,046 *2E87D72B7F775356348B13D2E4A63FCF48815763 STRONG-AS-A-ROCK
458,337,047 *2E89F22CAFA701CEC5F1FDC57CB1253B897B2FB9 subs74n714lly
458,337,048 *2E89D4FB23D395998988D363FEE5948D95B10C35 mauricioshurman
458,337,049 *2E8BB1D36E77016ECEA735CC106CC51CD627AE6C MAYNARD.HEINZE
458,337,050 *2E8B8E7EF527691BFC16FA1D886F3938EE797379 SUYITNOG
458,337,051 *2E8ABC63EF85C2AAC4E57AF9429BD7802C200D29 suzanne-han
458,337,052 *2E8BBA49DCF0CBA37A2C02FBE0141ED3D9A8769F mclaughlanglazierscoukwww
458,337,053 *2E8AE3C523156D0C33FBBC213C9DD4F31EB8C4F6 ME RENDEZ-VOUS, PART 2
458,337,054 *2E879E16D590AACB3D6A5C4D2FB85F5A704D6701 MERVIN.HERSHKOWITZ
458,337,055 *2E82011661E3243089DD6059D7AE27BFCC9CDC6D [email protected]
458,337,056 *2E85A31DFE2F9A3184EF477C59ABFCC4B43DA403 MIARŌTATON
458,337,057 *2E80DD44CFF5FFCBBA309BD3B7D49BD3AD9E5841 MICHAL.BEEBOUT
458,337,058 *2E8E74D9978678455FC01B3FA5F6C81EC2D0FE16 [email protected]
458,337,059 *2E87DB3945A3291DC9683CA271D01FEDF97069FC [email protected]
458,337,060 *2E81483AB1F666138F8ECE0B0EB23CD5CF1DF604 MIHAJLOVICSHOZ
458,337,061 *2E80E40A94AE86F6E2240090276278DB6CC35F26 MIKE.DEEB
458,337,062 *2E8A33F127460C13280A57FA0589E2105CED8CA9 TAYLOREMERALD
458,337,063 *2E8C52871241B723BE64C6EDE7F083E7CC13F9F2 mndjmc
458,337,064 *2E8554E549BCB59B911624DDDA11A11DE1EAD31A temptation-&-i
458,337,065 *2E8A72ADD72E114E8575DFA7E4D8C16707BAEA54 TenShufflePacedLicks
458,337,066 *2E8BC2700E103A28A888C99A2A64CBAB9B7E0AF1 montecatiniterme.it
458,337,067 *2E88A589C3AFD3AC6BB1C60ECED869A265E56C83 TERRANCE.MCCLUNEY
458,337,068 *2E8A00C5A1F73D5C6DB1FE6933F5C4F09870EE21 TFAITZ
458,337,069 *2E8215C44CECBCA08636048BE3EC22601D594B5D tgideon
458,337,070 *2E85BE48F2D62A47891BA17E32D6B781FF895C82 THANHBAYARD
458,337,071 *2E81E99EE22D06AFC6D15904C2228F077870E142 that-ain't-my-truck
458,337,072 *2E8C79D237951B6423740DFF2DB5F714F804DEDF [email protected]
458,337,073 *2E822A227D18E17297317D0A3EF6D042073056D7 mvtmr4
458,337,074 *2E82F8D36D642259FB19902B4E900FCF2B2A346A Theme-from-Doom-Ham
458,337,075 *2E8E40DFFF0FE2A91D25E9933EB80C311A71638D THESTARSWITHINUS
458,337,076 *2E8BD9C0AA536440BBD0CC73CDFC44BD1C8DFFB8 N9HTSHADE
458,337,077 *2E859CCCB4F0649B7EEE5894897F7F1041E513BE THUMBNAILSPRO
458,337,078 *2E840C16E58EADB172EDBEE380140AC0334D4F42 [email protected]
458,337,079 *2E80B8D307EE6B4DE3B7B2C535F2279A0D880885 NATHANAEL.SCHEIBER
458,337,080 *2E84916F4F567116B6C1590A71397EDF86D2CCD7 NATHANIAL.SCHNEBLY
458,337,081 *2E899B4D91C588091DE5DC8E4B2510AEB948B1BC nathanielweisiger
458,337,082 *2E89BDAAEB541828F00ABABB7F6EA5B635AF3706 nattdal
458,337,083 *2E845B4476A54E3A15A950D33C20CEE0C9F85C7C TIMMY.HAMZIK
458,337,084 *2E8B463E95252A5940D691FB30AADC4308FA56ED TINAWICHMAN
458,337,085 *2E8A815A7912AD2F4856DAB6A48BB478F8632ED0 toddk290
458,337,086 *2E8B3E40EF447960D265508DB8EAEA54B41EE551 toddshuman
458,337,087 *2E8EDFA8A90DB5D72B9A7380A3348A0CC515B193 N.)I
458,337,088 *2E87A6B1D792E1C679B20C954BD60A9646743BE6 NIGEL.RED
458,337,089 *2E8D39A1F54ABE0B68399998F74D5A7688B2326F niggtopia
458,337,090 *2E895488B1F84EC34A405DD1642DB2C58980A6E4 TORYHOLROYD
458,337,091 *2E84B93A456E997B6F6DB0B97814D2BCEF1582BB TRACYHOON
458,337,092 *2E854A2A7B55616ABA86C1970B995B90D06E2A3C TREY.CONDREN
458,337,093 *2E80AD0780452E1C726C93FC24512CF27C579DBE NORMAN.SILVESTRO
458,337,094 *2E8DC4B499F4FA4987418C0E11FAB1BD77138170 trinidad-bank
458,337,095 *2E82F07F56526E04E84779DB7643772BD322924F [email protected]
458,337,096 *2E822AF893FDE80CD96D18821CEC50FE717FBB1E TSTASJON2
458,337,097 *2E8038B6D7C4F57553075A09F621DF8946A08F57 [email protected]
458,337,098 *2E8F67B6D4755E434DD59F9EBD06782BEE0029A3 TTRBRNCH
458,337,099 *2E81B8C7BACE2EAB1A7A0D87134E8C89F4F5D22F NUTPICK1
458,337,100 *2E80338BF9CC4A0A807C06B3B99BCD77F2D19007 N(ZX
458,337,101 *2E8E3830BABB58CA563E2F449636F6CCED61071A oed--pretty
458,337,102 *2E842BC49A4E71E5A9E8783E11E429280C138857 OG1986
458,337,103 *2E8BE2BD6DF0C10400AE91E5730412F8EF383FF6 OMARBUENDIA
458,337,104 *2E88C67EE8340E7ECAD3771B0E5A79E4316FF3DF }o{ * <p
458,337,105 *2E87F5BAEEAFAB0680576B34F718B4412FD09B4A orhq
458,337,106 *2E8A517B1F08F2A8B0BB06E42F36F616E1C31400 OSVALDOCIRAULO
458,337,107 *2E84290302D266FC4B58733E064EB1294DFCBC0E OTIS.AGENT
458,337,108 *2E81E7F80CCC8102C4A741D5E5FF70E61F6BCE7B ourmulticulturalmarketplace
458,337,109 *2E888D52ACAE3E1D56E409CB87ACEFE374F04201 UTCTHSTH
458,337,110 *2E836B4EDBB8A74233FCDDBF011FFF6197656BBA [email protected]
458,337,111 *2E8A35B15205731AB7533B59CFC771BF4505511B U)X
458,337,112 *2E8F66FCD7F945B22468C6D9446CF5B1FE60A5DA PAM-PLENGE
458,337,113 *2E89BF7A732491B1ACA238216B2781799C022A45 <P><A NAME="N_389_">389 </A> CHINERY 6/11/98 DEPO AT 33
458,337,114 *2E832F3F457C5AEDA512073F873215097C56D16C PANGRAVY
458,337,115 *2E8B5C0BF399999D47FC207854C391A5B785668A PARALISE6
458,337,116 *2E875694DE3544F283DA83800E761D6ADEF5DA0B PATTON913
458,337,117 *2E8559CA293F99913595891DE9D87485EDA25A90 PC2593
458,337,118 *2E82F190771CD1D0E00775D41B70D8100998BDA8 vg[email protected],
458,337,119 *2E8C33AC4C968555CDBC96BF28D5BB4D7D87E23F VHENZ PRANGOS
458,337,120 *2E8E0EFF9921AC52A921557290B4952A920A952A [email protected]
458,337,121 *2E8640DB00424A4756EBDAAFE18C01BBED0A76F0 perclaudia
458,337,122 *2E8AFD0B2EE416875AED18785F402C815EA67EEC VICTOR.HALLIE
458,337,123 *2E8143BB01EA599587C3FEA307439F19670241D4 petriko4
458,337,124 *2E800ACA9232F9AC009085EF79D8BCD31260A060 VIOLETA-RESTUA
458,337,125 *2E8B9434602C3ABB241FD7C4DE459A591A5EB879 PHPBB2公開。
458,337,126 *2E8956B0408AC861116072D77D950254656001BE visionguitar
458,337,127 *2E8F2B45D10265E8089C35A224CD979F25CADEAA [email protected]
458,337,128 *2E81B9D09CCC4276FAF99F7045C7A7E67D57A456 vm6"
458,337,129 *2E8AB11B88DCCF50277F664DDD2545671E16F7FA VRTASMO1
458,337,130 *2E818A7112CBB0D448AC0D4903EC797D2B61037D PP*.*.SPLAT
458,337,131 *2E8C848B2D60E492411CA41CAAD06AA3022A35D9 waynepetersonsr
458,337,132 *2E897B61C9FC11EB4F841F82515AACCC15C6A44B priyaa292004
458,337,133 *2E855B60DF122113A485EDAB5A1710AE4F7D99CF webjunkie
458,337,134 *2E8746709697ACA30DC4A947D922F9167D852412 WENDYSCRIVENS
458,337,135 *2E80650CA20437A30AD67D5390B017B53B224874 PUĆOWACE
458,337,136 *2E801B8266EB3EA48E404B676DFBF7A2738B7CB7 [email protected]
458,337,137 *2E8DB2B929975018EAAB96F04CE9B95F69629345 PUPILENTES
458,337,138 *2E8B7778E54461D4AE8E425DF5366C253C94B009 wesleyrotter
458,337,139 *2E8AFCBCBC1556ED719043B8AFE1D4D0304980F9 pyhaamuned
458,337,140 *2E83FBCE84340DB0D08C52A9A9B376653A3FFB77 qE?
458,337,141 *2E8BBD697EAB81CE8853A6950DD1A77595AA1E89 WILBERFILIP
458,337,142 *2E8B78B064981953F2EA3107EE7BC71332739D63 WILBERGAJDA
458,337,143 *2E8B5AA453BECD5A9B9042C2D9E8277116E97351 [email protected]
458,337,144 *2E84852CFB7B5CC54D67721FBFC675886B37BB92 [email protected]
458,337,145 *2E81E19AF7FE319F1C0D61CDEE042D0B30F120B8 [email protected]
458,337,146 *2E837F20C3C33E84D925DB9A194D1C9390BB098C wilga
458,337,147 *2E8AD753B747C6A5A294BFF9AEA7DF37CB1F5C72 q---P`~`~}o{
458,337,148 *2E84061A78FF658FB940097E25D21C9781F810A0 QUINTARA1
458,337,149 *2E8F3B586569F2AC4F19F1FD7E4E8165426B332C RALF.GANOTICE
458,337,150 *2E833F94C33DF1CA5BA866CB3B5CED987DE5F73B [email protected]
458,337,151 *2E8A25499ECD02A45A4D06FFAF9BAFBF204B454E RANGEL
458,337,152 *2E84FEC6511B79D95E6776E06BC0671FB614551B RASKOPAJ1
458,337,153 *2E850DE4486B0FB1F9D5E54FEA8EEA25FB622799 [email protected]
458,337,154 *2E801CA8D6BD52D66B7B0DE173E8F7B18611F3CB RAYMCALARNEY
458,337,155 *2E8B81AD25537867C18F84FA3BE2E45A5CB1CACD xhaferdolek
458,337,156 *2E8540B11400BB1F481528D1B224B445C9D35202 regacne4
458,337,157 *2E88C4FB325BC066607DEB79D7DD893F40809AC9 [email protected]
458,337,158 *2E8D46BA5338C4EDC7A0A207F21BE50CEF6CA8CB xwd[
458,337,159 *2E89FC93FBB9061ED81717F55974E5175E84D3D4 RENEE PEMBERTON
458,337,160 *2E85BDCEEF8C4DE0A8CBC6AB9ABFB0CE94417364 RESPOLIONSED
458,337,161 *2E8DDD03D7F25AC777DA11E4A84FBA9C22380E54 RETRANCE3
458,337,162 *2E885DCE6B804181A577A4CBC293342EF989D9EA RETSBGER0
458,337,163 *2E8C551A70BB81D6A7833EBFED5BF842E95CDBA8 YATEBÚ
458,337,164 *2E862559BF402ADBA5B96C891BC25B5CB70F9863 YELEERFPJWSB
458,337,165 *2E827143DA8BC0904E28287114995FB4B5C88A9D REY.REDDOCH
458,337,166 *2E892A158F4093BD9DC31A63FF09EA699E6A9E61 YENYENELUDO
458,337,167 *2E8FFDC99120F24A995FBC6C368003698A5E56B4 [email protected]
458,337,168 *2E86FB61F76C452A90E633155C97E8F17999703D yixctmoufrsc
458,337,169 *2E8BD404DC519581B4FF87F63EA48AB4021C6F46 yolanda-lovethree
458,337,170 *2E8C3923673EAD089FD08BEC66F8A9BDF05FA951 YORMYP
458,337,171 *2E830D99E991EDECC448352AB671320E916D840F richpulsifer
458,337,172 *2E8CF8844DB3ADD38CC68B7CCE8BDFA42151D40C YREZQJNQVEKELL5
458,337,173 *2E8A3949095E67874D940E7C0327590807D9DE42 riley-koontz
458,337,174 *2E83777DC74EB96E794F8D75AD9C2F0E43451B72 RILEYQUISPE
458,337,175 *2E81DD086F699C8FF9C54223D96E3D9B310BF2F1 rl<s
458,337,176 *2E85E27728A0BB2540ED8549D6DD089C22481B11 ROBICHEAU12
458,337,177 *2E87F48730EAEC4011B384A026B53314EA4B4CF2 RONALDPUFFINBURGER
458,337,178 *2E8704BC16C12484D26F9806FBEAD180F847AECB Z!HD
458,337,179 *2E8E37D813A335DEAC7EDE5BCD4AF285E5409476 [email protected]
458,337,180 *2E85FC1384252A7C366DB34BEFAEDBCE316AAEAE rosencrantz
458,337,181 *2E842DD7F52294CE20ADDB4A9629ECEF93C2A164 RUPERTRIKE
458,337,182 *2E8E116EC95EFBF5D95F452B953B7AF4B3AA09AC ZSALEITAGATA
458,337,183 *2E8BF9EA5802CC2BEAE064D4B2E3EBDB1D08AAE4 S225687
458,337,184 *2E8D10D59DF0AC54DE8931132342DD86E40A2F80 S3V3R!N9
458,337,185 *2E834A72F7A2C4B4B2AAAC539C7EC3835233E3F6 африканів
458,337,186 *2E812EF022E1D2C81F809669AC2E32F785981D07 SALGBART6
458,337,187 *2E88E355E5797C1C5AC2E72648FBCBD60313D3AD SAMSONFIREBALL2
458,337,188 *2E80B179D136D98657BFD0ED8CA5FCD8D1B770F1 ГЛЮКОАМИЛАЗА
458,337,189 *2E8850453FF3C3B2C6EBB20A05C8F983C20DC85A јерулосе
458,337,190 *2E87FBFD7589C77FDAC5EF3D12DEBCD32D71FD6A СВИНЬИХ
458,337,191 *2E8B10FE3E3E20CB5B0BB1CF0DC446052D38EC84 седиментнa
458,337,192 *2E83E3A1EBC7B6EF436A19BC8C70E26540CD4207 техномастер
458,337,193 *2E810A350A6F99AF56B3284AE73A86D6B8543E0A sea-cadet-knots
458,337,194 *2E8DC2E8B5A744CDDBE9BF5C3A083F983BB44F74 seethroughsmoke
458,337,195 *2E87C3D072D92C8CEABA1B8091DB82DBC68EDA7B SELECT.(VINTAGE.SOURCE.MIX)
458,337,196 *2E8CD4FAAF4536B7B360C0F28A96E8FB2CD7CD57 [email protected]
458,337,197 *2E86F78999F0156C78FC521164975A58BBE6703A SHAANTHI
458,337,198 *2E88D3479BB447BF445636F455DAA88571C3F7AA [email protected]
458,337,199 *2E8430C9C57876DA251DF92A88959E72D84FB7F0 [email protected]
458,337,200 *2E84AF3E3356438D9A33B4B1CB625CD26E955FCC SHAYNEKULLAS
458,337,201 *2E822C9005698672B49E5DDDFE9FB4060B5003BA SHERMANVILLATORO
458,337,202 *2E8C42C0A69154D0F9EF01CFABC48BBDCFA6F0D2 short.music.g
458,337,203 *2E838A7890B8AD9924E450CFC77788A4D4C6403F [email protected]
458,337,204 *2E86BEF1D9F1B45BA86B58DECE48C6E2D0CF1389 siesting
458,337,205 *2E8DA257AE55C86ED8E5FF848B630FE7C01E34D1 SIMONKLEPPINGER
458,337,206 *2E8BE8A5F9FCBA43C052768366D2044528460F34 sinafobránquidos
458,337,207 *2E85154C04B670D71E4236EBD63609FE8721B019 SLADEST0
458,337,208 *2E86BBC8589BBDA11AD84FC6F3DCEB7A50806633 smxpnsbl1
458,337,209 *2E8374CBDEC7A94C17B4904013CB5613A77D6378 SNRQ
458,337,210 *2E8976F83D667D6C55FA45A9A72121677D14601B Sonata-in-E-flat-Major,-K-282-I-Adagio
458,337,211 *2E8EA010058E04CEC2E6499964AC38D05681EB1A [email protected]
458,337,212 *2E8696AC562FA80AE26F2A9A060129BB8DB81667 sonnyvisocsky
458,337,213 *2E839295730D178CDA2F78087597B6ABDF589CF4 第5巻(2003年9月5日発行)isbn
458,337,214 *2E82A9891067030CA23BE8C7C094E8C5B5947B52 虫よけネットW
458,337,215 *2E8B1F6DF4574D7D5A5639694800EAE7E3D3E0A0 SPLLDWNS8
458,337,216 *2E8D775FE68DF6405C0ED887CB7D4B71F5D3466A STAPSIKNS
458,337,217 *2E8B4302BF9440F8B74E2BBC7094B7F58B3D0F28 STEPHAN.EICKMEYER
458,337,218 *2E8431B74C08B37AD66410F2E207A84C2DD4EF7E STEPHLISAED
458,337,219 *2E89DD797CCA9305ADFE553292BD70F1998E2A2C ‘STICKY
458,337,220 *2E88A8A8CCC0141B320BA659B779107C9365D151 [email protected]
458,337,221 *2E8260ABAFAD92F964505032072329498A58CF62 SUBICAT7
458,337,222 *2E8E1A57408638FCCBCF2B4C0BA5299B50E7ABB7 sunpeggy
458,337,223 *2E889F2C8818FB58CDACF23ABFF3E7C376D2FAD5 SUPERTIPO
458,337,224 *2E8357B0125C9D1A6AD9D5FE4566C108FFF710EF surpasser1
458,337,225 *2E82A4BE5BAD58CFAB94439579155882971CC565 01241956
458,337,226 *2E8DEE8028C7F23A36C4F0694D29377D4ACA1375 SYRJAEKYLAELLE1
458,337,227 *2E8795852F25746D42C991A4C10C24E531F90676 [email protected]
458,337,228 *2E8AEF3761909D8CCBF71F60035BDF2CD57462ED T0MP3TK
458,337,229 *2E8411FAF632F7712CDCBC025BFBBB0204CCC47E t3rr0rdr
458,337,230 *2E86E41093FF9EF3760404DAA91B936B0DCCE5B5 0888a25fc72ba289dda3ea99199b3adeseasons1
458,337,231 *2E8BDA1903DA2F098E4D1F9C71B922937468E14E 09A72驲
458,337,232 *2E8358A0AAF94D31A06C175C1115F69EF427A145 0f22b8ad50630e087b8f240acb6a785dmotdepass
458,337,233 *2E87DD7C0279D82D2808337D0431CF4AFB048C6F 0IAMBOOBOO7
458,337,234 *2E878715CE60A3C5A1F735476A3D714A38116C81 $0LIDUNGULAR
458,337,235 *2E89A418FC64289449F23C219F38F6F20AFC76D6 (-_0)~~~q##3
458,337,236 *2E877C3B5C1F733A1452BF26545078001C669B04 [email protected]
458,337,237 *2E8D683724D435CD74B9D1BE935D6227A2BE763E tannergallaga
458,337,238 *2E807C0E9EF146D05CC30D842AE60660257E6392 [email protected]
458,337,239 *2E8EA4178934CFC01421CF793091E78DA65E0D45 tanyazaphod
458,337,240 *2E8CD33E820181C6D509F1E59CF6040AD2185943 TARTTAUTUMALLA
458,337,241 *2E834B63EBB964E54C8D866B1243A48BB5E54F34 [email protected]
458,337,242 *2E87F35B4162EDDDF4114B3696C090744E6C6B19 1242897 dann-ist-alles-noch-viel-schoener-anzusehen-
458,337,243 *2E82F320AC138A4EC527C494779A46E5320D0BD5 [email protected]
458,337,244 *2E8086C171B4B337470F2BA2EB4F35104375223A telpoeprevo
458,337,245 *2E8ACA04A8D3A7DD387806D12B4DA18C2D57DA05 13APR1524
458,337,246 *2E8EFA8336EFEE7FACCD71ABFDF22C0420BCBEAE TERRELLHATT
458,337,247 *2E86BC2FFB1151E689B409066810ADDB05F580F5 tesafaye7
458,337,248 *2E8822F3475B462980AE495C81370CB6764184C9 THATGOLDEN31
458,337,249 *2E892E7C31F7E131CBDE89D2A60E25380736185F 17121396
458,337,250 *2E87D20E99671C99814C8BAF7B1D30F01346717D THEELOQUENCEOFDEATH
458,337,251 *2E866F80D54CD4D6ADDCFFE23932AE1DFFD6734A theplantoincineratethehman
458,337,252 *2E81B3F1ABE6E3F69B639DA088AAEC0145830642 1AUREANA
458,337,253 *2E87176412A1557B24634B697740B0E6B0A90AFE THOMASTATTRIE
458,337,254 *2E8EE423468DEE75D2DAF3786E6C21532C02B295 THROUGH A LENSE
458,337,255 *2E83F187E350FB84E51A31C7FCC79B6858F5AF89 1.CDU-JUNIORPARTNERS
458,337,256 *2E8356153CF41D52BBBE645F1928DD6D109A9D08 THWODROS4
458,337,257 *2E823ED8AEC1D893F08B4BAF63503102F484EEE9 time(feat.chrisserani)
458,337,258 *2E88F7222C7C132BFB05C4814D2A8916253047E7 timothy.bauer
458,337,259 *2E8955B7CB0A1AB752C7BABF26F8CCC745ACCD13 tkidegni
458,337,260 *2E8ABA90D567B697D55D1DEF0BF7B56860F22A11 [email protected]
458,337,261 *2E820859B8E27281C6CE03BDEA16E614374BF952 1-LALLENDES
458,337,262 *2E8CE938D2A34BEF622ED93389F6AF735853F4ED TOPHERTOMCAT8
458,337,263 *2E89E7B1C4E8ED5F6E503CD17A406163A9B09E88 1Q2W3E
458,337,264 *2E8979C8631AF4509CAEA1DCFB5D4D7BBCFC9AF4 1 SCREENER'S
458,337,265 *2E8CE8F1B975A26694EB6F4CE3515AAD2EF419B4 1-sesson's
458,337,266 *2E8BE709E274683556A3984A83DF4F652DD0E816 1 SIKES
458,337,267 *2E8C10C174704165959691A9587A8BCB585406CA 1.terapeuttiset
458,337,268 *2E8648C77B0AA13B364340103423FF671A5C604D TRACY.OUTLETS
458,337,269 *2E8FAF787FA6C56595469B673C5216D8468F0C5B 1VORWAERTSDRINGT
458,337,270 *2E8F8B56A17DCB577696FFA19F85DCEF3F881086 1WANKLINK
458,337,271 *2E8F30CF5878D62114188A5D1DF679D421A810B5 1-WASERSTOFF
458,337,272 *2E83189A53361760B19B9DA5C902A5E89BACC702 treated
458,337,273 *2E87A4E862CEC096173C79E5758C6808C9D138F9 2059003 IN-HAMBURG-WURDE-AUF-ST-.-PAULI-ALI-B-.-FESTGENOMMEN-.
458,337,274 *2E87FD7631D7A6EE7719B1D205F300E2AEDB08FA trinnyjanegallego
458,337,275 *2E8BDB591715097B1D9395F10E0EECD9BC9D72B1 tristanvanhuss
458,337,276 *2E810D84D2EFCB4C44FF2C369FD43DC7BE34ED30 212227 KIMILERI YARALI , KIMISININ MEMELERI KESILDI .
458,337,277 *2E8A5308C5EC87C3C60BE94F2EC3B5B2982DB020 21LANCER
458,337,278 *2E8A6665E025CCD7E0542B715641D236278A08A4 TSETZENSED
458,337,279 *2E8E767D91DDDC4E05EF96F391F9957FDCC0744D [email protected]
458,337,280 *2E884216ED110C6B8EF1AFBD84648FB2EAA594F6 TUCENIL
458,337,281 *2E802B0312D81B8DCC06CD064041E6F97C6EA00D 23.tarihimize
458,337,282 *2E80EDB9288AC8C5E2131BF2D13BF4F52D6909F5 TWOMENCHARGEDINJIHADPLOTAGAINSTAMERICANSABROAD
458,337,283 *2E83AC939CFB4B277A2FC8918C47C2A919F2F474 TYLER.REECE.HOLMES
458,337,284 *2E83E05D164C6DFEA755023DD96D34649CEAD7E7 TYLERWINZLER
458,337,285 *2E81223E96F6C612F674BEB26ADF876629B83FF3 TY.LESE
458,337,286 *2E82394B32A0673BFBF4BA6587AD6E56AAE6DDB5 277308 tilauskanta.oli.440,7.milj...euroa.(.451,1.)..
458,337,287 *2E82F7554CC6DACE898223F87F0AD8E64BA68973 tyrese-winkleman
458,337,288 *2E8AE28F330CD2287CD72654523119D86539E4A4 27AUG1508
458,337,289 *2E8B8426E5D9943260CE9EE4F05B1AACDD0A54E2 UDDHRIYATE8
458,337,290 *2E82756C3AC5B86374EC8D287EFB925783FD5159 UDOMUNUVELLAINEDITAPARTIIT
458,337,291 *2E8AEBB3474BD1A2B1D64FC2309B0EF4702A45EC 2.linnajoki
458,337,292 *2E8BD41C943C06646CF53AC6202089CF5FAF0FC9 UN5CARED
458,337,293 *2E8739860C6B36881006B656413D143295102133 2MUTTONHEADEDNESS
458,337,294 *2E85BD3EF776D4B45478A27B8A1B88C0F508D0D7 2tightercredit
458,337,295 *2E84012B62C7C9B5F84AFF3804371409235D2940 333669 banu-dalgiC-cangi-314-av-
458,337,296 *2E8F26221D04B5B5CB904BAC7572B17147A71F25 3:3-#-&Bosporus
458,337,297 *2E8938EEFF242C066FCFFD619EF3F0F066AE5797 3ANTOJOS
458,337,298 *2E80CB12337332E6528FEE8BC22B79DD9988C920 uphills
458,337,299 *2E8BC905AFD8C294B444A53B1FC87B1F2B5AC88A URUZ-(STRENGTH)
458,337,300 *2E8E2D19F7C4571FACE26F8854E5A16CFBE4013F 3ILOVEPANDORA9
458,337,301 *2E89C79FD56C9D4656B45A253EBDB6E4CEA0B01D uuo~ 0~<--q
458,337,302 *2E81424594340C9FF5DDAEF0E51A1A0BE072A22D 3RTBIEVG
458,337,303 *2E8B6DA84F120BE444A0B81943547F1AD549E860 409TREVON
458,337,304 *2E8C63F703D6E04A9D0EC0DF464C9EA3E12A38CA 448190 ESPANJASSAELMUNDO-LEHTIJULKAISI2322002AIHEESTAL
458,337,305 *2E8C4F5003ED0DDB037759AC313689CC7596F87E 453128 angora evleri anIl kaGItcIlIk amb inS tur
458,337,306 *2E8AE764EF5B774196A0395FFD83AC50CAD98990 473667 EMEDUR-VE-ANTIVOMIT-PREPERATLARI-VARDIR-.
458,337,307 *2E804A2536D04C72F56AE5CC6E18E20C7903ED36 VANCECHESLER
458,337,308 *2E89E08775AC5B9749B3EAC2667DAA4244D0BA37 vancemarucci
458,337,309 *2E86489ECED2F858B4265047E24C7C8F2C5F58C7 VANCEPREISINGER
458,337,310 *2E89CFBADA5E33558E017F072914A2D62C154766 VASHER-LOR
458,337,311 *2E846F7B0B153B300FE0F4677293BF9DBEDE4A73 4IDEHOUSE
458,337,312 *2E89342B6C54840ACFAFEEE630F7602A73CD9EFD 4MICROTELBSW
458,337,313 *2E83D6352A3C794ACBF98C9D87CEB26C4B5CCD20 veronica.jaspeado
458,337,314 *2E89AD0CED6946FA61679E9C89E0BE1DBF004A69 4NGL!C!SM
458,337,315 *2E85F43174C170E5184CA9B3F053EE194C3D496E 4NIVELADA
458,337,316 *2E8F9F49576BC89783802170EC363E3256C8F670 VERUSŌ
458,337,317 *2E885193671BD4E52FC8507162873563EFCB0079 VICTOR-SALUS
458,337,318 *2E893534A76C320F9FE9FE503E377307BE0CF1FB Villfar.og.Sylvkl
458,337,319 *2E820EC1FC42F394DCF7AD267FDF8BC9675CF2DB 4UTILITARIZMA
458,337,320 *2E8FEF58049AD1BE36928A12E945DD04E1F1591D VINREDIS
458,337,321 *2E8BEEA17DE97FA64A49770A90A2A58623BF0135 508chanel
458,337,322 *2E8105F9F0E2FBADD1217E0080BFE538D26BE0EA 534MICHAELA
458,337,323 *2E86092E3A0DEE47856B7836832863A966485ED0 VIVIAN VENTURA
458,337,324 *2E80B16FF27CF614BB23B7634834F11F3C760185 VLADIMIR-NIKOLENKO
458,337,325 *2E861C475C1849FCCA63EE7F433D6900D4D96B20 [email protected]
458,337,326 *2E8BC31625AA972EA58BFEBF17D9E59028F7F1E0 VOLVODUNDEE2
458,337,327 *2E87651AB29FE4C5D50C74FCB494587EE753CA54 VONSPAFFORD
458,337,328 *2E8FF4AD288B84D729A8111BE991952310FF63D6 56.ALLERWENIGSTEN
458,337,329 *2E8A6704A8152EAEC7A4EDF43CCC31CE5DD9FA4B 5AKURSEDE
458,337,330 *2E80666AB2EA490A853C36F51D5A589251C15C6F 5b8tj8ly
458,337,331 *2E8D4CA6EFA260532101EE7970CE4AE749D670B7 VYBRAJ
458,337,332 *2E86B47023B9E8AF0466B5168070932B7E6EFAA4 WALDROCK.ROAR
458,337,333 *2E8AA6BF54F77714ED6F33FF1AF825DCF1E9C92B 5CONFESSIONALIANAN
458,337,334 *2E8C8446AB040C54BF1E32577D8170E49FED7F13 walter-abear
458,337,335 *2E8649C3DECCB7AFC317280019EC589455B17834 WALTZING DANCING (IN 3-TIME)
458,337,336 *2E8979912F25E2A98F6BD0613140586D0223B998 5FISKEGARN
458,337,337 *2E864A5AF3BA50D7B6BE8D7D1809945C2D6FC4C9 WARD.HANEMANN
458,337,338 *2E8B88AAB8CE9456976D3A60A97C260B0192FB59 5GNITAGAPORP
458,337,339 *2E8490375B8E0D4E142F879927B6C035BEE4F720 WARMOESHOVEN
458,337,340 *2E8F6CDDC93BD18C19E0EE582ACD0F8F2C8EDC7F waylontaglieri
458,337,341 *2E8ACE54B676059A2ED66BA39820695BC7A9A484 [email protected]
458,337,342 *2E8AED5F656D398A6B12BF5D70AF480C36144528 WELLLOOKS
458,337,343 *2E81B88397958EE7ABBB9BF5C7A9E3113D850597 [email protected]
458,337,344 *2E89072F3471801BA75BF12D71330A2EC4BA1598 5OBSQUALLA
458,337,345 *2E87C8B66BABA8890EE006D34B0A49DF3E85F90D [email protected]
458,337,346 *2E8251506F65503FACF54230E7848035B94356AB WHENTHERAINBEGINSTOFALL(MEGARAVS.DJLEEDUBREMIX)
458,337,347 *2E81A3D2DD4F0ECE22BB9A2B43FF4CF52E8933B7 WHITNEYPHARE
458,337,348 *2E8B3DBAF6F5C1BE5517BF480D558E5E2761B4A4 whyi'mwalking
458,337,349 *2E8EB4AC6F2FA505D7BA30D25A1EFCDBF43C64C5 wie-eens-in-zijn-leven
458,337,350 *2E82C7745B9F5F6E618186012C2EACF7D7090EBD 5TREPHO5YMBOLI4
458,337,351 *2E8F92E0B58B449A5508273204EC2C5D59D1FF0E WILBERTMCNESPEY
458,337,352 *2E8EC703743D1F55400713B4DEDF51D2F1BF3F74 WILBUR.SILBIGER
458,337,353 *2E8DA6555078DAB8DEBB5D2AC239DD3B62B9E567 WILBURSPLONSKOWSKI
458,337,354 *2E85D0FA65B9A249C7B9D4646A84CC7E9BFF3DFD 5VITTORIABSW
458,337,355 *2E8F8274476AC07F91648DCF0F0C2BF88B970120 willielaroux
458,337,356 *2E8E176F597E0D97536C02353CC7B91F7F70149E WILLIGS5
458,337,357 *2E8A7A34D16F91D71A19ACBC068594CA239F46AB WILMERHEYES
458,337,358 *2E8EC62C2FCBF9EE873A09DE757DED5A177672F0 6APPROBABLEBSW
458,337,359 *2E850D54433B04C9B5B395EC49ECDFC6D3FE6A67 winicowettas
458,337,360 *2E86712A690139E98720197A24544253EA2CE1C3 6GABRIELLT
458,337,361 *2E8FC2AB0FD7880CE4A25B8356DDA68E8712C846 6GRENDELTS
458,337,362 *2E8DAF96B18D7772FECB2BB8B9629F4119BA12F5 6GRZELAKIEM
458,337,363 *2E8215E612D7D3E626FD4F09E6C5AD83AA81CE3B 6HAMROCKS
458,337,364 *2E89A00995EEB090026467D9190846521E82606A 6MARGARETSHEILA
458,337,365 *2E8D70D7D70BED3F5254C9DBCCF484363CBE4E94 6.MARKKINAEHTOISEEN
458,337,366 *2E80E854ED634B50F3722D021F879056BD31FDAC 6modernimpi
458,337,367 *2E8AD0E8D47FB41DEF13F31BB320226666C81CF1 6NUMBER35
458,337,368 *2E8A8DE6C416B3615A0D6B594531C462D7FD6F7F [email protected]
458,337,369 *2E86BD70A9799C7A284B03961EF59A8ACB17E86A 6SANDSIGERSKENS
458,337,370 *2E8190357F698C31F8C316488948AE532F40738F WUILSON3
458,337,371 *2E839483E19708EF6AFF4C46980A437EF79C16B7 6THEMANPIERCE
458,337,372 *2E8E3E7CC0CCC69502EB7C9F2F7B2D7B0ACF23E8 6TKERIDHM
458,337,373 *2E8698597C5DC5F6883F5888EBBC029A898E7C87 6YROSNECS
458,337,374 *2E86AC13F043FD3081D5FAA6516207F60CA2C123 XAVIERHURST
458,337,375 *2E8DA856D1F37E517380A9B92AF5C27D623C23E8 xcixsvrsnz2g8qa64riwda
458,337,376 *2E8E3F317B76FF1AD7AB0F6A23AA8CAF708C8131 7aloadai
458,337,377 *2E85A50B1744A699A25F5CB9BF8564CACF6DA8BE 7ASDFMAX
458,337,378 *2E8B5D24E279CAEFEF8B3BE15B2B606F1B5656BD XPREMEIR
458,337,379 *2E8A40CA6E9D48B6F7E9B6407F9B6DA3EFF04DB9 XU.DEMANG
458,337,380 *2E8CF4A141DA5A07D313574EEE8147AB7652DDAC 7BSWPPBLAISBSW
458,337,381 *2E8C190B422FBB77A12A0B0C5A24DA4D6E9D6F76 [email protected]
458,337,382 *2E8598B8332A06B945925702135E4A067592ADC2 7CARLETA
458,337,383 *2E829B104099661F083936600D986C08A97630C8 7!CKL!NG
458,337,384 *2E8373A468733C42A70361C200D52D8B1E505305 7DIAMONDCCCCCC
458,337,385 *2E8CFA06D5E4F448B177F68FECCCEDB0D876F421 7FRIENDSINTERN
458,337,386 *2E88CBDE1E2508C7BC8B33F2008489B3CADED1F4 [email protected]
458,337,387 *2E87812EA7CF6A7F5AC0E4F73408EC9E96D16058 yannicklb
458,337,388 *2E841A8793B64827567A55A64AA0D92669D78425 YELLOWCEDICING
458,337,389 *2E898B4E3D550C75DD186E875F06413B0ED215F5 [email protected]
458,337,390 *2E8276E71A6FA833CED1CA8F18C0096A4EC68915 YINXÌNG
458,337,391 *2E8213F1D0E994CDBFD528358E54E2C4DDD1EB84 YISKAAHMAD
458,337,392 *2E8AC1D0CFBF411306373AD9F2FFBCC7BC5B6B45 YOHANWIDJIEANTO
458,337,393 *2E8C4F05A4620594D718D9249AE96DE057AEEF38 7THATSKYDIVE7
458,337,394 *2E8700A310A27222232685E15CC0C4EFBE9A5D6A YOONSUNSHIN
458,337,395 *2E897C782DE65D47A08798DFFEA96A19648D2B6F [email protected]
458,337,396 *2E868448D6C54B7493D5ACC79A6D9B5F24B245B7 yungunz
458,337,397 *2E8787DF05049B33DE15EBFA14AA7B104FFC7B70 8COLOFONIUMS
458,337,398 *2E81072EF49C1598C9F91FF8CFDA95C8C00259FF 8DARGERT
458,337,399 *2E80F6D58F6C61F254AA4D5AA8180B0E643730C6 8DOGGYMIRAGE
458,337,400 *2E8E7BFF1F0C0508DADCBF813395EEBDE718A169 ZACH.MERK
458,337,401 *2E873AFE43398EB3ED62953FE2766AFBD7547E77 8ERARBMEMS
458,337,402 *2E81C09FD30FCA027DFACB6FB4D96BB5FB8004EB ZALEKNOUT2
458,337,403 *2E824D4BECB9C32475573FCC6224AFCAF699433E 8INTSESTI
458,337,404 *2E88F865ED76CAD8F209FDBD1FFBD5AAE22946FA ZAPATABARNEY
458,337,405 *2E83A099D71837671A08F08E2BDB1319F813FE25 8onverzetbaarst
458,337,406 *2E870028A9CCD87A91733AC1BC4A91B18E209533 [email protected]
458,337,407 *2E81E379285D2800E8A9BFE72D625CEDA2784A2E )8(O~Q====Q
458,337,408 *2E81980399E9AFCCE581BCED679AEBF469F0B449 [email protected]
458,337,409 *2E88112FDFD8FA5EBAE97EE3DF1A8CCC53851E06 8RAGGIREREMO
458,337,410 *2E8C0CBBF36B33DDAED2108132A1C5858551464E zith
458,337,411 *2E87B093926638F20180D1994554F196250E34A3 929820 CINSIYET-,-LISTENIN-HAZIRLANACAGI-CINSIYETI-GIRINIZ-
458,337,412 *2E82371198CDD7E2B039BE2710162E364264A7F0 93KMJNHBG
458,337,413 *2E8025B5BAA13C6DEB35C38AD0E0BC692BF91C65 ZWANZIGF7
458,337,414 *2E88070C7D24E66E365C54D91968E67A9C5FBBF9 ΠΑΤΖΙΝΑΙΚΟΣ
458,337,415 *2E827666B47C4CA0FB5CF689C83ED4D228B65DA7 КОРТОЧКИ
458,337,416 *2E851C230A6CAA48D404B2F1C704721197E9A5E8 9HAVFRUING
458,337,417 *2E8E0A7AB76F96350F84678207BAF3F4E7EA518A 9HBELOVED
458,337,418 *2E86A05AC12FD4E83DE493858C1A1EF66AD29A98 9ONLOUPING
458,337,419 *2E84DB237002D3686F429EDB53DC1151CCDEA48A 9SUKELLUSVENEJAHTIEN
458,337,420 *2E88CABE6D05EB61D7E461D1FB9DC97CC3A41ABD 9THATLOGAN8
458,337,421 *2E8ABD3B65FF522AAEC92667DE201524619E19EC СУФЛИРАНЕТО
458,337,422 *2E8D2DEBAABEBEF00BE05F97925F12ACFC9FD59D тихвинскую
458,337,423 *2E8B560D5EA7AEC81AD885B61EFD8EAE080766C8 A4_2
458,337,424 *2E8F84405F4FCB8FB007A561D5A9534D7351FB65 aaapp)
458,337,425 *2E8C6BC7FC6D7CB370E878D0E36D760156E1BBE7 acculaadgelijkrichtersing
458,337,426 *2E8417DC5113CC93220413D4D6F0971E676FE37A ADALBERTO.BITZENHOFER
458,337,427 *2E8207B074C9D87FF32C322B2649E8176AFE9E45 ADALBERTO.DEDOMINICIS
458,337,428 *2E810A064AE9D7FC9E3BF2A8FAECEBD11096F2A2 $ADDL3FL
458,337,429 *2E8A3C00B11C12791ABDC504D8F434579790D680 ADRIAN.WALVOORD
458,337,430 *2E82A4156CD353BD779865BEBFB69348B4BFE833 aepgg
458,337,431 *2E891B9CF9328668DF2F4DFEE950E919BB56DF95 AFLUHCSD9
458,337,432 *2E867260914599BF940027E6ADD0221DC2E7B8DB afyfahcomel
458,337,433 *2E85E83E945AB0A79A1C39EBB705F7D8A85247FF aield
458,337,434 *2E8C6AC4C2B711905AC22FE678073FA1B4863FE0 0F48F5E7
458,337,435 *2E8D485686A30290B128E517FF65D440F01E58F8 ALEXMOOCHLER
458,337,436 *2E823EC3FB1EFAF0D1C8ADD80D48B4DBF1451DF4 [email protected]
458,337,437 *2E8C47BE3317130ABB179C57EC571D377048782E ALISONBROAD
458,337,438 *2E8494554BA42C295D848C360E1A527252EE9BA5 100REDBUTTONS
458,337,439 *2E87AC9BCA98FAB42CE7748F957F7AB6CE8B1E31 A%M3$
458,337,440 *2E8169C6FE33B08A3D33F9E479C33AF96DE6C033 amitraghnam
458,337,441 *2E837A23416E8D378FAFA979BF312E67997F51D0 AMYDARKE
458,337,442 *2E801521A8134C7BBC94999359792A99964A5DFE 1674594 EI OLE KYSYMYS PELK
458,337,443 *2E8002F8E89D7498FF04618F2A0B4715C6523520 angelclower
458,337,444 *2E87D686797029C431FD732339319B296DD9EDD9 ANILPENN
458,337,445 *2E81058C59226CA8640767B1C57971FCC585F97A 1948700 JOKU-HAUKKUI-,-LAUSUI-RUMANKIN-SANAN-
458,337,446 *2E86508D63FC409DBE0A5397EAFDCDC69FCFE631 1977316 JOS.TY
458,337,447 *2E8477B290D9EDDD217FB3805B9E2C2553A71E10 ANZEIGEHÄUFIGKEIT
458,337,448 *2E898C3C1D4DBBC744B5481D04630F44E6ECB539 aqfrp
458,337,449 *2E804C51C79AAED0D7B87A646803EB44634D17FD 1EKRUHCS
458,337,450 *2E891D45E21BA701A760CC4929E6172C8FF95216 AREFATTI1
458,337,451 *2E81E379A09214D992B34FCAD880F36ED6DFA1F7 armandkennon
458,337,452 *2E8625A482A2F974883413EEDBE950458B075190 1holzkohlegrills
458,337,453 *2E83E739A6613168E8789417EC515C1CAA6BDB08 ary+w
458,337,454 *2E80048FC6B8396F7745C627EA059D2329D56E9D asasatar
458,337,455 *2E8453E9BD76A0E8E1D8DB8CAD5455CF9ACED794 ASASTOAKLEY
458,337,456 *2E8F1283CF03ACF9FDB5D08FAE616C10D24C46FF ashley-callan
458,337,457 *2E8FE4C4E105D935CC7DD04E8299C7CBE6C855AD 1-kliklediGiniz
458,337,458 *2E8714D4B5A5E3246099AF4B7D91B3D3BAF10EE4 1.kolayliklarini
458,337,459 *2E89ECF80A27A1FF897E81B693640C8331B688F8 1KONGRONG
458,337,460 *2E8D57AE49E49D314C7FD840FAF12C9F6BD19A55 1.KRAENGTE
458,337,461 *2E84686835109EAA3256F5451794DBF45A6439BE ASSISI
458,337,462 *2E82507053FE682B731CC11D5329833B268BAD70 1 mehrwegkaffeekaennchen
458,337,463 *2E8F34FD35DC0B736D120CDCD50D74467CA7CF90 ATGKC
458,337,464 *2E8F91FD74BA8475DAA85E9101820B87180FE670 1OHJAUSTEHOSTIMEN
458,337,465 *2E8C5953F0C88C13FA20A6541DD8204EA7CB9E44 ATSATAV0
458,337,466 *2E80C8671194F8DCA2D763D0BB5006282307FF57 AUDIT-ALE
458,337,467 *2E84CCE65D7EA8119261993FB6286C9825053CA0 1.sit-temmin
458,337,468 *2E8283EA36893776CDB0A7616C84C02F92AE3A4B austauschlandes
458,337,469 *2E85DA6D2BDC64FEF11A7C43F4A5B624B928F520 1t3ranc3s
458,337,470 *2E8740E6024ABE8B01C88EABB355D638FC4C2E00 [email protected]
458,337,471 *2E8E155F404D590C6C0D38A639AC10CC91652315 1 valtios
458,337,472 *2E880A38A5691AC2CE6DA63114EF6AD58C506AD3 aymeric-bouvard
458,337,473 *2E8E433702B4B153389B7BB558A22CA418E3417D [email protected]
458,337,474 *2E8D4A62D0D6884E31C543D441941C7DC859C5E5 [email protected]
458,337,475 *2E8663A2923B8FEA2F5AD8F1F2AD184CF3DDCC02 2254291 helsinki-/-villa-kivi-(-ohjelma-alkaa-klo-18-)-ke-15.5-.
458,337,476 *2E8CA98E9CF0A7A8D8804F139F06AA78243C6D53 2318671 revenue-rose-to-$39-billion-from-$29-billion-
458,337,477 *2E85EDFE6A515C03FB92FC964E3858FC22CC4C09 236841 "-did-mario-moreno-lie-in-this-case-?
458,337,478 *2E8648AA2CE45A253DDCD606BEE7D1C69846FF12 2422597 mila on valmis sek
458,337,479 *2E87B2CFBADB7407AB6FBE01A4C288B2C15E2285 2442563 meido-kan.j
458,337,480 *2E86D5EE4C76CA6B530978BBDA8F40778F7F7A5D 2534311 ITS LAST BROADCAST WAS LAST SATURDAY
458,337,481 *2E8B3B70EE7E103E8ED027F22AE1C219B1C5EC49 258ALAN
458,337,482 *2E886DF746D5BAD142D647C448886EF9FC000B03 28feb1110
458,337,483 *2E868EA0C11C5A24301F2A8FAEF5D729B13ECC93 b3$c:
458,337,484 *2E88ECE37F8F4015CA999146B59B58507603F8E3 2GRUNDPRE
458,337,485 *2E89322EC6A2ECC8F6ECD35133DF3AF779B96560 2IMNUBABA
458,337,486 *2E8039FAAD6BB7D53236802CFC553963E0973902 2.klebsiella-bakteerin
458,337,487 *2E831ABE46AF0D7955B10EA9803CE175E293EE74 2.kulttuuri-investoinneille
458,337,488 *2E85C131353E1714667BD1A33DEC3A28013C082F 2-linkworks
458,337,489 *2E8062E9FD00AB94C165A8C6598C23ECBF8EC57D B6R
458,337,490 *2E8608FE70A18C130770E6533B5375B42E651AD6 2-N-TV-REDAKTEURE
458,337,491 *2E86A7B87FB6A8A6A78B710A983D924C8FBF1DC4 2QBADISC
458,337,492 *2E869543A7057CA74A48C540BC5E8F6C9C14C271 2.RWORT
458,337,493 *2E8FD999E1B924B109AC1061E3481978A87C1C6D 2-SCHAHIDENEJAD
458,337,494 *2E8A76F5C4A463E09FA1A853D721F673D7878BDF BACH: TWOPART INVENTION NO 10
458,337,495 *2E825434A7E168B8FCB08BD066D958E0ACBD40EE 2.tiri
458,337,496 *2E88CCAE707E8E90D76C52156CA63D15011660BA BAKER1906
458,337,497 *2E81AC1BC1C7246067E1B9B63D27CEB10845FA34 3232703YOU
458,337,498 *2E851BB2C35A3D80AEC84F456B681C71DFD42BAC 327433 DIE-SICHERHEITSAUSSTATTUNG-IST-NAHEZU-KOMPLETT-
458,337,499 *2E89D321D683F534E3953782347A8C82E0A3CA4A BARRETTMASSETTI
458,337,500 *2E86A35C379CAE5A19DEB948A26333A4D98E3059 3####B.~.splat
458,337,501 *2E8B03793B5B3E7145383E78D6A1ED91B1CB19C4 barrystouffer
458,337,502 *2E8B018F3BD32549A8BFC559F8FD827E00E8F945 [email protected]
458,337,503 *2E86CFAC97FD17A188F1F1E4DD11BC779192020F 3####>`~}o{
458,337,504 *2E885B17D14CCB71A3D824C33D3080531C4561A4 bbzg
458,337,505 *2E8E639BCAEC7CA379475944838BCB3CAD4065EE BEAUTIFULLYMADE
458,337,506 *2E85F827107C0BE7ED6682902A19CBF7B10C9198 45kommenteissa
458,337,507 *2E8A742F79DBE544945B838A8CA18BD1B44D17C5 benedictbart
458,337,508 *2E8EEBB746F5575FFAF45D2416BB5A2E3B53E130 BENNIE.VLASATY
458,337,509 *2E89C230068707933394FE6EF2B9EDD500876602 BENNN
458,337,510 *2E8F94D2B977A07A06C771490A8964CB80B13537 4HRSGRPHS
458,337,511 *2E8C533F032F83B51965286260C17D2C5C6A75C0 4ilovegermany18
458,337,512 *2E87FD586E738166D26BE58DFC889DE49F3A086C BERNARD-ROCES
458,337,513 *2E80284BA5682C6140C567049A0A1E36E43D698A 4KIRKWARK
458,337,514 *2E87A67295AF026FFCF5450A466EFCE52BFAA9B5 4LUC4RDJ4R
458,337,515 *2E8F2039C276A6C9CD03231DF220052A1FCB85E4 4-P
458,337,516 *2E856CB667EFF33EF40ADC6E1526397C0232D4FF 4SCEUOPHY
458,337,517 *2E8DAFF3072D903A0A55FDB8203C6E545C0CF778 bgp0-
458,337,518 *2E8E194CDDFF6A02AF67BC247FAF5CEAF60B104C bl&i:
458,337,519 *2E8D29E7204136FF1B436C2BD04ACEC59ED536F3 bprotozoa9
458,337,520 *2E84832D17C2B034B117C48C40C4BACF3C921ACF b======p*.splat
458,337,521 *2E8E56BBEEDC7E96E7105BB0FFC6070438CFA385 5CLASSIFICAI
458,337,522 *2E8D6E7388B5372DDC37442C2ED0FEC5900E8180 5CUNNUNDRUM
458,337,523 *2E8AA15D4442CBE23D7A356313A2272ABD778BA9 BRADYLUDWICK
458,337,524 *2E8ADE30C1D6CD3946BFAF7B69B23CB9F20188B2 BRANDEN.SCHIRMER
458,337,525 *2E8823EF5A62D707E540827941A30CDBF0EB0C07 5iluvtrumpet8
458,337,526 *2E8D978EE1752A1FBD6BC0816DB508535A907A50 5KAKEGAE
458,337,527 *2E8290FECCC3F6369BE97797D11063926CEC7AED BRET.MCPHERON
458,337,528 *2E8269B751405CCEC57AA818D144ADD323FFEC93 BRIAN.HEIKKILA
458,337,529 *2E86812E5572795A4E6F89E46BE112BF0776F660 brittany-jefferies
458,337,530 *2E80C854FA11D7A886D9FC00D909343DA960F486 BRNCHFRM6
458,337,531 *2E80D1945CA3168BF1365FA04150F0F093CC9BFC bta
458,337,532 *2E82D4D9A214113E71E6206E1DA22CC4F6052920 5SPIERREIPS
458,337,533 *2E8144CCD0BE5720A468D34A9AE8BBB64556074D bu-!l
458,337,534 *2E8832131E345DB924B3D28FA9A5FB48C7742C6C buttheadadam
458,337,535 *2E8F4C80FA7927B6E3EB376EED52E1390EB54CA4 6BSWMUCTSBSW
458,337,536 *2E848B8FA4020FAC8A63847B190131EBFB22E19F bzldf
458,337,537 *2E8E6C4C255195D26122E75434EDF0F464956FDE c48r!0l3t$
458,337,538 *2E8F3478B17D9BE240DB360C77E1390944A6D29F 6PJDBRSQEEJQKQ
458,337,539 *2E82EF3598896E2DE8CAB859FE7FF01B1811E57F c6ti
458,337,540 *2E8DDF3CE32F679C4FE8483C8CA0BF0FDCDDC395 caiel
458,337,541 *2E86D3CD1C87285B5392C797B5968EBE746D4AEA 773453 buzpinar.ile.birlikte.)..
458,337,542 *2E82DDE403D99D2417FAA0E6F9467F75D818BB43 7890B3CA-3F24-365C-B030-899DE071B803
458,337,543 *2E81DC001D632DB04AD0F6348DBC5DE7388DD96D 7ACTIONREBECCA
458,337,544 *2E8BBA0FA9868C6754AA40D94D2D8143A106F5C5 carmenlapeyrouse
458,337,545 *2E8911B027A82A02080B65D9838BFC9F564404C8 [email protected]
458,337,546 *2E85E870044CB4E012C99A7E96758517A960C802 casey-bolton
458,337,547 *2E8AA91B5D51265E495A84470BFF22DDF27A0D46 casg8
458,337,548 *2E8FEAA5246E7BE559E2B59FD76981FE344BF761 CATALYSEURS9
458,337,549 *2E82745562D9EFA44D30BB74CAC7119019E0F8F6 CAVASSONED
458,337,550 *2E8566C15B2117514E6A9951C50BB191ED18C2FC 7GNITAERCA
458,337,551 *2E8958D904A61CC37074D3BB6F374D20F9CB2E6E 7IAMSTUMPY6
458,337,552 *2E81CEA3D528BE671192B4C1A5D33F67A9713318 7SUJEITASSE
458,337,553 *2E8F615A85AC6411FD43419588B0EBEB4510BA22 CENISIAED
458,337,554 *2E8A245D05C260651EBA336D42B7621B699886C6 cffem
458,337,555 *2E84340A72480E93988CC9EA1A959F5FD112B7D3 CHADEBARB
458,337,556 *2E878B8E166683DE60219026D4963BCBFB9C5249 CHANDELL6
458,337,557 *2E8AA28564760F750C7D8E316D0FDD12DB868D1C 8ammettere
458,337,558 *2E85989CC424A13D09EC06E3D2513B4A55DFBA7D 8====D-~O-~OSPLAT
458,337,559 *2E835E35354B3E5F0DA84D44A0C9B01984B7C69C 8EKLARTER
458,337,560 *2E86F83294DDE1D85F72E7CC39FD11B93BAD2D87 8FANATIKARAR
458,337,561 *2E84D0301B10E9160EBA22BF75403F57E15B3DDB 8FENDERELLEN
458,337,562 *2E89A44EDE1FF5ED3E47647851ED6D4BC64857F9 8HYPERCONCENTRATIONS
458,337,563 *2E83484056F50C95AFCA36540EB86D12CA87583A 8KATSELLANOS
458,337,564 *2E8EA00CA59E64F2B984573FD034D2E9E2648317 CHF&C
458,337,565 *2E82343A3584810C6114D00B7F09BCA4B559DE26 8MARTINEZZ
458,337,566 *2E8721EF3D6F75D8E9F4BD686EC5C10BB62EDEB7 CHNT_
458,337,567 *2E83BA189655966D4B2267D6F3BC805FCEEBA098 8------>~O~O(O_-)
458,337,568 *2E859577FD9731A4B9C20285E004B36D376985C5 christoffer-karlsen
458,337,569 *2E89A368CC30D558E7A34EBB80EF28662A06C5E4 CHRISTOPERLUSHER
458,337,570 *2E8848FADA25C63151AD46F3B29D70812C48AFE9 chv8
458,337,571 *2E8E8A77C874DE8536623A1E00B95F2C4780FACE CIG$A
458,337,572 *2E862826786EAFEFC5F43AEADB9EA1C53C4C5DA7 916856 RYHM
458,337,573 *2E80E1B0CCDD4855BFF139FFE723EFD581A356A6 CIVICRULEZ
458,337,574 *2E8AE8EB4810E38C990E56714E10A7A773D27B52 c)jd
458,337,575 *2E8B42A83464D2DF7C604C3AA88355DF0D14375F 972QWE
458,337,576 *2E826B80297622B333F85AFD13A3543C0DE6E4C6 9EBAGEDER
458,337,577 *2E835380D0AA588D5DD717B244A6A0AE29685693 9FIONAAMANDA
458,337,578 *2E8847F9341390020D8668A82521D051EE0DDB0A CLEVELANDRUIS
458,337,579 *2E83D031D20FDB00156CD6B3A33EF2E1AC7938EA c"lg1
458,337,580 *2E8017A4BE8421BA307044A66055B2DFFE6B4619 [email protected]
458,337,581 *2E837731434502C319F927E455D938F6DB55A2CD 9MOOKIEBEAVER
458,337,582 *2E86655CE00252E885CF248BFDA29DF15BB4384D cm=pm
458,337,583 *2E8EC584709EC8041353D693441B62747BC15D36 9PARASITOCENOSES
458,337,584 *2E897092DEF51FE1BD87814D5535BA68A282BBE8 c_n_d
458,337,585 *2E82C45BEC65F448B7BBBDFB46597D97D55200CD CODICIA6
458,337,586 *2E88F821C27780ADAC8228BB99C68A6A65657F99 COLDIVARING
458,337,587 *2E83FD48A4496A2037C41675E14ED794A6D828FC 9YCMRGDGWN
458,337,588 *2E8BCDB965FB533BE395FA29EEB74A3BDDDEE335 COLEMANNICOLAIS
458,337,589 *2E867A1AB85F863A85CFC267B6726DC94C1A1509 colinniceswander
458,337,590 *2E8A9970913AB7E2B06242273621A3DEB25A062C COLUMBIAJEANETTE
458,337,591 *2E8734D76B7ADAD627378247AA67AC4995169739 concert-no.-9-en-mi-majeur-"ritratto-dell'amore"-:-viii.-l'et-c
458,337,592 *2E8591DDA4E151A6AB8D9D42ECCBA0567E47EDA4 AA6P7
458,337,593 *2E875DF3EF50DCBECAA2729414DCED29F8CD3403 AAB+|`
458,337,594 *2E8D5331B91FC79F434E92AE6D706631E0DCD470 aabaycf
458,337,595 *2E8ACEE1B6D8F14848E2896FA664CB81359C91F6 abbaties6
458,337,596 *2E8283D9DF742B9726C374F2A3BAC6BBFA68F6E3 CQIQN
458,337,597 *2E8DCCBF2F066560C763AD591DC50E5E7A9E4EDA acid-test-9b
458,337,598 *2E84216296C0198E93C49180EA0CB7AE20D3EA9B adalbertoedlin
458,337,599 *2E854E7F77C906C02938F26CFF9334AF4A37DFCE CSV/
458,337,600 *2E8C2EC52ABA7CF6ED94E96EA82B5C2EC1AEF572 [email protected]
458,337,601 *2E8EDAC45C7F14532E93141B32E375B910BC2F70 cuqmv
458,337,602 *2E8DF6BF4DE16A687E3D74279C0ED26A3DA9C7E9 aeiul
458,337,603 *2E8F54E738E97761AAFE180E0EA34D54CD452C9F cw=i+
458,337,604 *2E820EFDB1A738493BCEB4259F5C432C9A128947 [email protected]
458,337,605 *2E86996ABE1E18CEBE0DD86D49116742E6998609 AGRINNIN8
458,337,606 *2E8E8F2BD31F56804D6E18C360BCE2E8DDF50615 ainmuloc7
458,337,607 *2E8B6996D92DD4CA40A7C35C1AEFCA4A510EDCB2 ALBUMINTHERE
458,337,608 *2E893642840C554EB5261AEC46E3C516F2D4C365 alecdehan
458,337,609 *2E8317566D01FBF876D8EC0B4C3118E08ED3582B ALEXANDERGRESKO
458,337,610 *2E8837AAA8FDF0063C5ACB0CFAA85B5060DAAFA2 D,"A%
458,337,611 *2E80DBD09CD5A70A3CF10965EEE5E6E4D2FBEAB8 ALI.AKBAR.HUSSAIN
458,337,612 *2E8CA307881AB4B41572887CB1B435A8691DE97A damiencarknard
458,337,613 *2E8E61D9EC709E3CBE562A8F9B78DE87FB958FB0 alishabourke
458,337,614 *2E800C52B928BCD3E8BB4F4F805880AF1115F431 allanaery
458,337,615 *2E8D9C3E69BD8597926846BE234E4023E9FDD041 ALLEN.IGNERI
458,337,616 *2E8CDC802DA32D0BFAAE1D3ECA8F0C7FA4D5D314 dangthanhtam
458,337,617 *2E8BD5F209A0266FD29FFAFB5DD67FC8F26456E8 daniloranah
458,337,618 *2E8E6C1343A06DFA2D449256BD8CBC9CECDBCACE DANKOLODZIEJ
458,337,619 *2E80F74A7350BAB7E3354CA76630BCF612692768 d!a_o
458,337,620 *2E857CF33B93DC110C836ECC2CC09643B4070E41 AM7N%
458,337,621 *2E87B85E0AF1D76B32152B3E973A75CAE69AAE13 DARRESTN8
458,337,622 *2E808756B4DE9AA472D336F99CB01B1F1019C226 AMIE.PARTRIDGE
458,337,623 *2E88E9888A43B4295BE1221D4E2EE050A17ABCE4 DAVIDALLVIN
458,337,624 *2E8D05F1253B7F3F8D50CFD8EC3FDB087624C279 AMYJAY_28275
458,337,625 *2E845D91921D7C9BDD1EA30B44E034677B2C99EB DAVID DEGLER
458,337,626 *2E8144EE95555CA568071A0E56A1D72746B2C820 davidkreda
458,337,627 *2E8F7473A2EFE37074DA6900164DD5CAE27736B2 dbkul
458,337,628 *2E83AAE56034DB2720C13DC624EEFCA52CA2895D DDP8Q
458,337,629 *2E8FD7CEBDE1AEC493549370AE7BC5D6E842170A antiriot5
458,337,630 *2E8897618AA1AD4DF1E6BDA5CCF5AD0C08E93F89 đèm.đẹp
458,337,631 *2E8BF824F219AAA6097D90C6562FD57C737C0734 demetriusgamon
458,337,632 *2E88967640B77943677FB20D78A3749665970B1E [email protected]
458,337,633 *2E842D9DE138EA7EAEBEE2497921525A244CD78B ANYTHING MY MAMA DON'T LIKE
458,337,634 *2E869B3E492CBC747F4C97818F3592C681331FF9 denisgentilcore
458,337,635 *2E802A5CF61A4A1944F1902CB73C0257BFC41CA2 [email protected]
458,337,636 *2E8935AF91D101F9FF17FF1B80ED20C985713A78 DERBNAMO9
458,337,637 *2E8FC3CA4D7DDF2D80D9EEEBF492B149A3011BD6 deruosnus
458,337,638 *2E8FA9EBAA8747A09192BADE9D2316BC62741FBA despej
458,337,639 *2E8762D3400A959ECCC12460078A77E0214E9D52 D=G/0
458,337,640 *2E81433EBC4C9A0BB7175EA1E037423EF6E7FB1A ARDENCIESIELSKI
458,337,641 *2E82F1686345DA667DA90EE3401F597F61194B84 Are7
458,337,642 *2E850665E2501D4C2F63640FECF8CD1896082594 ARE$U
458,337,643 *2E8FB0C8B815876AAA4D5145E05E55816EDD1BCB ARNOLDEYTCHESON
458,337,644 *2E867FFC3045BE448407037827F2E2D9515663E1 arqsi
458,337,645 *2E8C5593C440BB57067DB1176D37D9DF3F7BD3DE DIRK.GASPERINI
458,337,646 *2E89A4233EA6A81E686BDFDB81D3CDB451F65923 ASC#W
458,337,647 *2E8DD59B0E0CAAC88B83AA52FD76105EE1A4D491 atsoduk2
458,337,648 *2E81D80EAC111234B86A8325BAAF396D8E2C831B DKP%
458,337,649 *2E84BA197043895DB0A22FBD93B8C6A3B1705985 DL#C:
458,337,650 *2E84AEBD61F279BE9BD3B68D4866EF6AAE15A8C9 dmxgk
458,337,651 *2E87E17006F59F8658BF8A0A184CA47E5E8186B7 dnn59
458,337,652 *2E8A78D77A62E996A73DB5142A296D29C9547CCA DOMINIC.STANDBACK
458,337,653 *2E8EA6FD34CFDCB1DE05A745F65014187261379D DOMINIQUE.ANDREATTA
458,337,654 *2E8C7A18F113F654CA2A356B83025D9B321CC734 AWREL
458,337,655 *2E8208E75959EA12A624C4994789D39C8970E8E3 DON.HELMER
458,337,656 *2E85934475D341F3357134D9920A47FD38F1AAA3 azems
458,337,657 *2E8DD37EBED8C2E903EE3524B496A8CD7D9DC098 b0qlo
458,337,658 *2E8B8D47EFB38ABD2301533DB249A8477B9699E1 DREWPAKE
458,337,659 *2E852BB164A7AA6CCD96FB018D97AE4AF1272389 BACH - ITAL KONZERT & CHROMATISCHE FANT (ALFRED BRENDEL)
458,337,660 *2E8DB9EBED77CB614EBDE845DF6D1AD1C8ED6BF5 badgerspunky
458,337,661 *2E8F224725FEC68C03A15E9F88433141BBCC7A0B [email protected]
458,337,662 *2E8E7126BA7C96F825554C021F2386FE377808BA BALTICWINDS
458,337,663 *2E8F2322CA8F24449BE450E4A436E7D08258F243 [email protected]
458,337,664 *2E8F490EEAC40DD1325FBB6CEC201ABB1D6378D2 BASILREIGNER
458,337,665 *2E826F115F73D7CD302643DC3FB994454FA28FFA dufgf
458,337,666 *2E8D378C8FC7B8E4E9E7ADD6B9D36DE159DAE175 DWAIN.GUILLEBEAU
458,337,667 *2E80D204900981AE95D4BDDA31C3DB07ACE7626F [email protected]
458,337,668 *2E87C690F05F4FB8E843B5B3E9FE3BFD8B1B6054 dwrq;
458,337,669 *2E8F88C0E1B7D162A30E36EB83FEC81B9D4BA005 dxt2j
458,337,670 *2E8F1DAE4F2D10F45A92D8C38469DE17DCC35B80 E4D9FB77705F3EEBB829930FACBB8D9B
458,337,671 *2E8F2C906C502F236D475F98BA22BB18FA872136 'EAGLES'
458,337,672 *2E81F9FF0CBD097798D08E6E363AAA5F4034F8A1 EAh_
458,337,673 *2E8100B8903FE652B62B292E341E255C2788CEEA bensjahr5
458,337,674 *2E87C48441D523B152AC00C49B60E69A930326FE B(EQP
458,337,675 *2E8D8DBDDE85C43F0FCCF92ADADDCAB374EC18A7 ECOTNOEL
458,337,676 *2E8A3955208770D49380B541DAE289704F8FEFAA eddie-the
458,337,677 *2E8CBF0A154E5DC2F9B387B9F677A0C24AEEC71E edo=m
458,337,678 *2E84E0524375BE140652178222D30CC526AB4302 egammircs6
458,337,679 *2E8A93CE510FA0BF79DBCC48C01252B6097C1AD0 eggyn
458,337,680 *2E82CE2A79C7BDCE7C29A4D168542D46441A09B1 BIGGISH
458,337,681 *2E833FEDAA2595122B962170D9B0293FFF376B0B eleganteps
458,337,682 *2E84B78005F61C016510CB4A9EC67EE210A2E49F ELIJAH.KOLTZ
458,337,683 *2E86706AD21E274E426CDF98EA4F898766FEE82C BJIBBS
458,337,684 *2E845A13A53626D2F12EFC4428B69183D2D419CA elishabarren
458,337,685 *2E8D51EF8C06B0BE7D6127C0333AE9494C646297 bjyck
458,337,686 *2E8E9E1B93B81128711F89C33E1F9CAB997B7879 ELLSWORTHCANTATORE
458,337,687 *2E848B0DBA07B3C8B66E11B58C862D8C44ED8ACB ELOY.ZANNINO
458,337,688 *2E84ED16786DCF03BA2F0669CA39D467D3C46D53 BLACK.S
458,337,689 *2E846621BC40238849D4CF16B8C383A9C75241FD blainegent
458,337,690 *2E8C9C64C791D73F0A74BF299AD114C418E5DF39 EMERYBERHOW
458,337,691 *2E8AA23EA666904B50DF8A6EE7ADDF7D026B851D BLUEISLA6
458,337,692 *2E87B9C1B9B774705C982043B14835A34F15AD93 BN+QR
458,337,693 *2E874A32CD79B252ECBAF7AE6D2D1C02566602DD [email protected]
458,337,694 *2E86BDCB67EC94E1474A56C1ADA492CDFD149767 boz_c
458,337,695 *2E827EFC265207B0ED23977BE0A9A40A6755774E EP-V)
458,337,696 *2E84C9F689743CAD0A31000B1150055FCB5D6F72 ERGUIÇÃO
458,337,697 *2E80094737793C52494D8DB7FDBC5415CAC78803 brahminh5
458,337,698 *2E8601B773C0D918A4EA8688E32ABF223E4D04F6 BREITSCHRIFTS
458,337,699 *2E853293E2744A34803E0C758BF540EAF90ED925 esvq
458,337,700 *2E8512B73A817F42749A4CADFEC9A6BD49C0EB24 ETENDARTS
458,337,701 *2E84C2626CB22FBC81043B62DD8E2834417683D6 eugenioczekaj
458,337,702 *2E8F829104D00324F85FAD7E4B679C9FDAA21FF3 BRYAN.EMMANUEL
458,337,703 *2E8DAACD6EAFD056CD7DD3D5C97995DC28EFF9D7 EVANGELISTA, ANCILLA, SERVUS, PETRUS, JESUS
458,337,704 *2E826D5CB84FC0AF25EC6D9FB0C99DB48100143C F!(?
458,337,705 *2E82F21306BD400276B8DAC299FA844091448BA1 B)UQ
458,337,706 *2E827DF55C1D536AB78EE2065BE14D7413681D73 FERDINANDDAUBNEY
458,337,707 *2E8489D20B4E09692B950A5DC9A39E0545EBE2F0 bzkor
458,337,708 *2E8FE20136E1CEB8BC775EB9545B61F9C5C8C90B C0UNT3RP0$N9
458,337,709 *2E84FCFCD40AB0C80EBD46509DC71210989510A0 c3tqc
458,337,710 *2E810E18EA06640B8BA159140B8C7D8E495C4A66 C5T41
458,337,711 *2E8A61AC31EBCD7CF7BF25AF89D26BBDC3B3281A c9v(r
458,337,712 *2E8DA7D52CBC5A3CC00473ECC948A4AC008A2B7B freddiejoris
458,337,713 *2E8EE22A15F50AC812DEEBDF0B5DCDA3B938C541 frederickskwarek
458,337,714 *2E881915418F57DEEC4CEFB40C67E4AB338D0544 FREDRICK.NIP
458,337,715 *2E8388AFE129AFD6DCA80551924C7F62646DDED2 carltonmertine
458,337,716 *2E85245CB55C1243713BDFF99F98301DBC30CB80 fsltnng4
458,337,717 *2E8B641C1E690DF3D79149BCC96BE4663D40A8A3 FUKUDAMA9
458,337,718 *2E8D15BF4CC3A1FD55FC9512F46FFCE68C2D74B0 fyhl
458,337,719 *2E853E21C993CEF754784CF84AB689C9FE771495 CBFM
458,337,720 *2E8E1C2957C5669473023FA68DAEA956DF059CDC CBO;;
458,337,721 *2E837FE8496D293C1F87FFF66AFCBDA48BD65C16 ccj(k
458,337,722 *2E8322832475D972ABD53F1AD8FE80D6FD764E78 cdct:
458,337,723 *2E8EE4025A69D4ECC9C2530F397C1F5B7C04223C CDTPR
458,337,724 *2E87CDC7637E342E7068D5B89C4923A1C18C7228 genistaanglica
458,337,725 *2E82E2D5A8FCBDBF1432DD69344529696B0E0154 cg=(
458,337,726 *2E8A9BF4D755C3FC09EB60D9E2C0A55EAEF655B7 gigglesnj1123
458,337,727 *2E8742B1D1F6DB30746E4D1280A115EE6FE951A4 Chapter.07-09:.The.Will.of.Albus.Dumbledore
458,337,728 *2E8FC67D39257A2E567248F0CFBA0E987922A989 giovannilanman
458,337,729 *2E8611B49F09CB0EE96EE6D356B2D8DC380752E6 CHARLIEBURGARDT
458,337,730 *2E85CAC405432B1E5F6E8579C41DAEA67ACB4E5B [email protected]
458,337,731 *2E8841447D0C22A322FB9ABCAD88190E6EB26BDB chckrwr9
458,337,732 *2E8D21EC1599DE98A5FD348911EE75B582C14D12 [email protected]
458,337,733 *2E8E9341B0D380B9202DB4FAE48305F7F33DA109 gludenie
458,337,734 *2E8F919DAA674D3122362626B0DC33134CD35D6C gm^^
458,337,735 *2E88461F71950526DB1777D568871CA62BF4E829 GN1YIY.LIVEJOURNAL.COMGN1YIY
458,337,736 *2E84297F917FC8ECBDF6071E79B7504DA8328B43 chj0?
458,337,737 *2E87373660ADF8A70B5865046C177121C55811C5 CHOPS.AND.THANGS./.RAW.ADDICT./.LOST.LUST
458,337,738 *2E8AA6BB4EA621B8D2A72EEC3751BDDFC4AAEE8E CHRISTIANA.HORNE
458,337,739 *2E86F62D4534714310E5E1FC2E1D15EF8B27C6D9 CHRISTINE)とも記される。
458,337,740 *2E85E3DA9B047533F5338CF74F0CB7F76B6BA5E4 chronos86
458,337,741 *2E8C860C647C0024E440E700CF70FFCDBB8C1F11 [email protected]
458,337,742 *2E8C4134B42DC16AFDE75196CC04812C9A385432 GRAZER12345
458,337,743 *2E8DD5A38B56995D90F88437521CE02306F783F5 GREG.DALLEVA
458,337,744 *2E8B7DAEECC63E532050EBD2B75AB4785056D3B9 GREGMOCKENHAUPT
458,337,745 *2E843B06BFE54CAECA7A91048045A4794D79A395 [email protected]
458,337,746 *2E8F673A2CD3BE8F3F819F47BCCF018B9732AF13 grimacering
458,337,747 *2E898092A630DC5CC3849E29A064D342CE71D80A c:kuf
458,337,748 *2E80E0217DD388F51E0A5E5CF156CB5C1EB98035 GUISEPPI
458,337,749 *2E8C6EF63EDFF583C07823A9F1749BDED3497138 CLAUDISALA
458,337,750 *2E8BCF3CFACA955647396AF8E5002B988083FC12 CLIFFORD.ZEMPEL
458,337,751 *2E8BD5D7A1BA5CA3931A0A445225377E9D766A95 h/<6
458,337,752 *2E8977AD2EC1944C213FA1154B9570AC941252EB HALHESLER
458,337,753 *2E8F77ACDE9DA510BAE175F62CCBD57DFD0FEDFF [email protected]
458,337,754 *2E8FF566A8F605B6E3592A00A5667E67381CA34F HANSHOUSEWRIGHT
458,337,755 *2E84B3296DBA9EE9942D05EF8E18C0F600AACC71 [email protected]
458,337,756 *2E8DC90C42FFDDA7B05EF39E17C6FDFE9AEF4C25 co4f+
458,337,757