List database


# MySQL hash MySQL password
438,370,001 *2C623A793831AB4FD8FBC2893E18E4CE66B78A30 [email protected]
438,370,002 *2C6F8F6A4972E3764DA0617EE86D395D86E16DA0 62.missfiel
438,370,003 *2C69AD2F5E13F524FAEF7BD4A0DFC1EEF535454C <H2><FONT-COLOR="#000077"><B>USER-TRAiNiNG</B></FONT></H2>
438,370,004 *2C602A2B566950314E84E5F87CFD7EA36F9DFCCC H3CBAA
438,370,005 *2C607B7A00C536756FC66AAC48F681DF6B71F836 hansjentzen
438,370,006 *2C6647CF9C0D32E9F5C8D084F7DDC35DF353C048 6ETSAVUOH
438,370,007 *2C67C8C2841EE9E55A5216E8CF4521A606F762B7 6INTERVALLATA
438,370,008 *2C6945EEB2E4E77007E7E2335D8DFAB9E7C6F3B2 HARMONYRETREADREUNITESERVICESET
438,370,009 *2C6815F4B139C673C5DD19F00F2A7AB564E0D9F8 6KHRSHCHVS
438,370,010 *2C61D42284F0BFF3AF258A26FE6603B777259DD6 HAROLD.MCEADY
438,370,011 *2C63EEEA13A332B7A4FA88D6CC9D947F56261987 6MYRACHELLE8
438,370,012 *2C695B6148B892D27522385D9903DFB922761855 6PORNOGRAPHED
438,370,013 *2C6E0F470C1EE488A901E1B2B77B965493B839C5 (>_0)~.~.~.D---B
438,370,014 *2C6C166BD30D1C22B03E538D9BF9FB27F24C182E 6SSELROBAL
438,370,015 *2C6985F705DDEA9142EE2D704FA3D04F035A4026 6stately
438,370,016 *2C67A8F55F967B298CF4FA6D1C6EDE36A01AFB1E 6thmovement
438,370,017 *2C6820CA9E4C668189435185E0E2551C63D0FCFA HEATH.MACKAY
438,370,018 *2C6DFC2F3E0C9415B877318A4FF3A0C3DDBEA590 6WHEELSELVIS
438,370,019 *2C6A7CCAC8129BDE441BF8DCBB123997D4077AC5 708198 MANHABENUREINEWAREBESCHRIEBEN,SONSTNICHTS.
438,370,020 *2C6515AC54B849E4FC566175A16FAEB12EDE8DD2 10-NACHRICHTENAGNETUR
438,370,021 *2C6ADA5B761A08738445339A9EDA0527833D63A0 736626 vanhan-laskutavan-mukaan-viikon-ensimm
438,370,022 *2C662A6AE5A6EBE8B8CE3958A513DB99D49D80FF HELGEDOMSHUS
438,370,023 *2C6712C7A5A3AAD1F8FA70E0F438A9323D661069 HERBERTBASTONE
438,370,024 *2C652437EED1724E0A5078444B224FC76949D77D HERROIHIN9
438,370,025 *2C60C536AAB7555463F88499296C5550219BE81B [email protected]
438,370,026 *2C68EDFC5606A9607048CD0668FD9B32917EDBF0 12:-12---#---&---POLITICALLY
438,370,027 *2C65C330B6FCF8390395754E3122D7DEE3099104 123089A
438,370,028 *2C67521280B8F8BD5B660497DCB3AF76E9C7AD83 1327534 OHEISMATERIAALINA.ON.TEKNISEN.TOIMEN.JOHTOS
438,370,029 *2C66D59FF8D0700E9859BD8E8FE004EC3B8945B4 7CRYSTALGRIFFEY
438,370,030 *2C6CB4A506C3CA57B3A09C1316EF03CC3B43DA9F HINTERLINER
438,370,031 *2C65BB9041AC704FC03963846E923FBCB76DA597 7FRANCOISBULLET
438,370,032 *2C606ACED52958690F8FF937250FB1D2C8598ADF HM....LINUX
438,370,033 *2C68D4F6E2DB2B3C58E166F475F34D41527658EF 7IFROBSW
438,370,034 *2C66C332C88FB030DD89A35A05DC219D01F76BBF 1542486 loimaan-seudun-nuorkauppakamari-ry--20-v--1969-1989-
438,370,035 *2C6A25C2B7437015AA3D3D01CC8BA42CACD51BBA 1591040 abigpotonastovetakesmuchless,hereasons.
438,370,036 *2C647998621B04B6A6AC6477E230451821B3DA0D horaceessary
438,370,037 *2C6CA845B07F8D53718C1362E3D38D8594965136 17-06-1587
438,370,038 *2C63F8AA4310B367723B49DB7C6B7F7135B062A1 [email protected]
438,370,039 *2C65F971F74460F6C67138AB22865CE11DCC85F4 177parannuksen
438,370,040 *2C6E89C41A89054562D17E01D979E893C487C92A 1791929 THEPRODUCTRANGELACKEDCOHERENCE.
438,370,041 *2C65D1BC62926C80914F282FC2DCA4BB28504E64 HOWARD.HOSSFELD
438,370,042 *2C656E54B13B87B63527A84432C8E5E0554D26EC howlingly!
438,370,043 *2C6A2B30A0E47C507E3BE24FDAFFD7009BEB8CD0 [email protected]
438,370,044 *2C6FDBDF504C35A8B6DBFD2E62B16B0BD595C276 185336 HOWEVER,OVERALLUSAGECONTINUEDTOGROW
438,370,045 *2C66D86D3A9A657E2657F2FF54B09121E4A92559 HTHANDAYAN
438,370,046 *2C6CD19D1E38161F7919C66442AE76382A5A7694 HTHORNLEY
438,370,047 *2C6EB6875F063724B68E630F35115AFF71F774B3 1937761 tuotenro.:.gl..6322.52.nimi.:.sein
438,370,048 *2C66CCE36FA9CE3820F1E258D079F8C65682C751 ĤUANIĴON
438,370,049 *2C6067B66E148416A79FEAD5CA5B3497A6FE20D2 7VRGLJKNKJ
438,370,050 *2C68BE69DCE105C5522DB4CA880A2A4C942E21B1 81klv8bne6
438,370,051 *2C648FD778B4ECC4B12DBDA316FC607E6BFEDAC3 HUMBERTO.SEQUIN
438,370,052 *2C60C5B5DB1809D70C552D9759CBBE9FC2A4DC44 828.suljettu
438,370,053 *2C6314FBE28D570153C80D638A33426D5EBB5DD2 HUNG.MULLINIKS
438,370,054 *2C6AD2B152945D4C5F9E283DCB0C815AA7B6E372 [email protected]
438,370,055 *2C663CDD73925B9C5E0F77B22659D119F5C6A1DD HURLONS3
438,370,056 *2C61E7721708CAB2005FD1279FD1D0372E962ED2 848ELIC
438,370,057 *2C67C699C6AD86075A7E50AA26563764D343E3EC 862773 proses-yardImcIlarI-8-
438,370,058 *2C691CBF78C85BDA642E3DEEADBAB1CD89FD7320 i0m
438,370,059 *2C60D2D8357DE6DD8624F6CF7D42B8A50DAD9CD5 1-carsaklarin
438,370,060 *2C63EC8CD96A2AA2DC40048EA700B7DB238EFFF6 1COASTRENNSTALL
438,370,061 *2C66EFD9525AFEAD60304325D63A1D82DB918CD8 IAMDELETE1992
438,370,062 *2C6FCBFE6F3BE5918C9AFD9B6E3B9CD3B79EE293 iamsunny124
438,370,063 *2C6ECCE7B2DE26F9B6C69E7B6EF04E6E12C65582 8ATLUTEAJ
438,370,064 *2C61C4D29F9D413DD53DEC9ECECED45F3B335A81 8#b-~o}o{
438,370,065 *2C673C1DA1AEF819BE75C8BCEE351DAAD36F1920 8CHRYSOGRAPHIES
438,370,066 *2C6E98CA04500516ADDFF338A50CC235EE8BAF24 ichthyotoxin0
438,370,067 *2C61E8486F100844A8C66E48C8F8A85CA0EC2D07 ig2!
438,370,068 *2C61A91114B052D2E6B6EEAAE0F3A72EEF21CD60 Ignoring.the.Guidelines
438,370,069 *2C65FB2136EA080439F0C53E9D6D5BC7CEF2017A 1hein
438,370,070 *2C66F4A8F216A302D4F4B42B65FD65EFFAE1B1AA 8HAYDEAN
438,370,071 *2C65CF5ACEB677B3C6B3D46803FA8659CA65DBF4 1intercityzug
438,370,072 *2C6038FF6C04A82C00E3813CE4C07AA811C0D38F 8IRELANDASSHOLE
438,370,073 *2C6780FA25A9594C56A56AFBD88F36A94D426AF6 1.JUTTELUALUE
438,370,074 *2C6D1EDE10E5731C4185211F5BF8BEF3A649341A I:`K
438,370,075 *2C62F5319A7252D9F250B8965E6A424070C757CD 1KINGDOME-A
438,370,076 *2C6BD6B4FF910B333D8D1470D883BA568E91291F ikustoni9
438,370,077 *2C60963CB935D4092E5E406BC28FC7E12F7BA0AF ILOVEBRANCH2
438,370,078 *2C6A0D35582A99B68D8C36A3EC7B49DF8EFC80B4 1-NAHOST-INFOS
438,370,079 *2C64461EE599A713CDEF921342E6C24DFBEBC8C6 8----p~o(^_~)
438,370,080 *2C69DE503F29E66484C45ED368A4FF3FC491305F ILUVROMMEL84
438,370,081 *2C6365DF8BECF26824F5ACC5C2E12D92D51F0A49 ILYRAIS
438,370,082 *2C6DE6ADBEE124643B97A3FCFF2B669FD0ADB9A7 1-quanten-computern
438,370,083 *2C62FEF8B652A88BCE79DDAD3FCA2D6F8FF6674A 8ZAKOTRLJALA
438,370,084 *2C6A06A7E1CA41FD2B7A4067BE876710D584CFA4 911HUSKERS
438,370,085 *2C664EFA40BC54406AF4BC6D0DC9AE211C7BB623 indelningsgrunds
438,370,086 *2C6696569CC182941BBB252777D6D81DEA86D3A4 96U48
438,370,087 *2C6F4F2EDCDEF94C622569C26FBABEF8B3B776D0 1-SERVISLERINIZI
438,370,088 *2C6539010A80D8D4C67066F1F134BB3367A6FA8F INEZEYS
438,370,089 *2C627BF57CE196268FEA92FCA17E067FC6EA8F2F 1 SHEMONSKIS
438,370,090 *2C6942F38C04EFFBB5FC313C0EE09161959A60F8 1.STLSARJAT
438,370,091 *2C6AE8958126FAB4578BED0A84E568E3F7890B3F 9CARRIECHIPPER
438,370,092 *2C63CD04C7E6967E1A0419873E671282F7D8B137 1tahkokalliolle
438,370,093 *2C6D5BEDCDC86A99B84320F1482FB992EA50DDE2 INTERPRTATO
438,370,094 *2C65C4B015CAC0E65C444B0DC47877B8FD7C3E72 9ELAEINKANNAT
438,370,095 *2C6021B7B24BCDA3AC4CD21E62FEAAD15E850EA7 9ENCASTRE
438,370,096 *2C6BBFBA8653B59B7E3C820E42F9AA78CF773F22 9INGSDATO
438,370,097 *2C6418D103FB8BD973CBD42192E3522FA24E2A16 9INSTINKTMAESSIGER
438,370,098 *2C6F2DEEB24119D44DD508509DF6E6BC1403CF42 1-yankelovitch
438,370,099 *2C654327F8CC7A50284A05224AA5F867EE92A4AB 1.YOSCHIAKI
438,370,100 *2C69DDFB59DD757A68C78FEF44289EBE50B9AE4D 9METALLICNEW
438,370,101 *2C60C35B4F83FE0FC933707014B38EF44BB7F356 20.PROKOFF
438,370,102 *2C6341725D11D24A04B1764584F1C533757E5E2C 9PROFILIERTERES
438,370,103 *2C69AC987CC8B17B2625A0F2767EE4187A5E75AE 9SAMSIDDHAM
438,370,104 *2C620763571177CED3746FE1A7B537400CFFE188 2158366 PIISPAINKOKOUS KIINNITT
438,370,105 *2C616547046906EC840A9991583F849237BA67AB ITUOKKIJ
438,370,106 *2C659BD4502A3A9881297BCBF142A6DFC1010EB0 22kal
438,370,107 *2C69EFBBFE4028B30506BA7A611DFC45AF28C96E 256X252
438,370,108 *2C676A5A6878028B003553D35F58F7F3074089AF 9VULCANOLOGICO
438,370,109 *2C63D2FC45CBC3CC94399B3782F9F8C9B8F247E7 25879 crufts-cheftierarzttrevorturnerteiltdenverdacht
438,370,110 *2C69092C9B3AFB5C529FE372C735F79032C23DE0 9W16
438,370,111 *2C6A7CEE5049CF82753C94B8C1040E1FE94EC7EE jackiechyle
438,370,112 *2C6D91278586094052F8694C0D2DAAF7900B8190 A0?c
438,370,113 *2C65A5E032DCD8AA2D20FBD1D1E1BE16886D4F73 a2omd
438,370,114 *2C61ABB6E8D3E604C0FF2F5D85E309E291BA459E 2963431 EIV
438,370,115 *2C6D971748EC2A729360EA8C8C5E671650097A8F a3k7d
438,370,116 *2C6366CD5EBE4F5EBDB41E946CB6638F87ED32F4 2BEIERBSW
438,370,117 *2C609EAED24367D9B477B8FDD656CBAA8D3DF2CE 2BOBBASKET
438,370,118 *2C63254EB0ECC69E40C6E467BBA6D9D104A74C63 2BSTRINGFIELD2
438,370,119 *2C64C1733DBD5166CFD132EF2A46A7E9F8D6E718 2E51267F077335759A925213DDF1C5D8
438,370,120 *2C62AA72F28D1C0521076B1A2ECDC3EF9A463E56 A/5VN
438,370,121 *2C6DECC546E467E46E27CA5BFDE6F2403DFE83D8 a6
438,370,122 *2C6F697B7578E10A14BD9821FE3333805F13DBA5 janessa101
438,370,123 *2C6667F6E855017992B22071917D7875B7FB5E08 A!8F-
438,370,124 *2C6A782EE2414F2DF231A8A2234A8C7307DF027B a!8&z
438,370,125 *2C6FC45AF8BAA6355B0D48D18200A04E2678E11D a99o4
438,370,126 *2C674388F46E00386E845B58171F7F4736C605E2 2KONIJNEJ
438,370,127 *2C610E37F04EAB759DC3E63E5AFB3B44F84B2F63 2-KULUNC
438,370,128 *2C6002600FFC2C9A7D1C5B2486EEC765345863CB 2.lahjakorttina
438,370,129 *2C6F67D4370BB79DCF3573C84C56891F0925A1A2 AAA0-
438,370,130 *2C604C1FD6F2303F7F97F217C5CBE0D85B18B0C0 2ONTSLUIE
438,370,131 *2C6F6975A1EB526AAC430E5D9677765A94C1BFEC 2thebackup4
438,370,132 *2C64D8E131E3432411E7C2822234D1E5110EE929 [email protected]=
438,370,133 *2C6C160F5862365A744B23BF30D73256F802B31C 31.09.1619
438,370,134 *2C6BD146485F5D8E94BA6EAC06C5C5544F457C9E 31december1983
438,370,135 *2C643FDF0806EB95352791D65E45D8CBCBF54B1A jaysoncalaro
438,370,136 *2C6731DF99AF8D62777EA892264EA22F32175B48 3546pp
438,370,137 *2C6758121BEA8F01794BD93EA9B6C0544BF98263 365joyce
438,370,138 *2C63583B16048DF81B550CE15961C3C14EE86295 399139 "-mutta-seh
438,370,139 *2C60C3197CF9E8A8ABC5B17F6CA3A91E7C3E765F jeff.keogh
438,370,140 *2C65CAD480BB5A95A0DE570431C955B77BBB9273 JEFFRYFALLAGO
438,370,141 *2C60204EC44DE61AA2BFEA1A71CA59D3AF8EE542 jeffrylehr
438,370,142 *2C619A7A3A7E8E0607CA00CAD7931A51142BAFFC AALEFFOR2
438,370,143 *2C662246392F3DDA9AB5E58272019BB745869B77 3-eleganssista
438,370,144 *2C6B209F44C8F5FD562FEABF11E6ECFF10F73970 3europa-club
438,370,145 *2C6D88B7F3379BE25CDA7CF086ABF24DDF224A37 AARON.ANTOINE
438,370,146 *2C614C1CABF0FEAF5B2187CA9731C757D96736B5 jerick.guinto
438,370,147 *2C6D87D75D00BA2D97C4ACC7E2C3236A8F1805B9 AAY7/
438,370,148 *2C6A8D44BAA365EA785E7364012D09F567C702A1 ABC=+
438,370,149 *2C6FB14C65BC4285791F33219D63BC818FA15F43 3MSLLEMWD
438,370,150 *2C6007A76A3AC9EA57775CE737EAC732CC7F3204 JESUSKUEHNEL
438,370,151 *2C668EE5035E73E040EDE4740B4E721926C187C5 A-Better-Way-to-Be
438,370,152 *2C6B8EFF8AAD1F296F9664ED413378B1F48D93F5 3####).~:p
438,370,153 *2C6D0C0CF54D82C3815ED8530D71D6DB423C1677 3####)~:P
438,370,154 *2C656632DB27B265E7E5DA46F213D2DD2DA1B1CB 3xbtss
438,370,155 *2C61509009B4D607B2D03C9931A180E7C22E2BC1 ACEROS-PLICATUS
438,370,156 *2C6024079DF488964692228A6E171305AEFD4944 482904 elleri ile omuzlarini ogusturdu .
438,370,157 *2C65084492DD905C2884CD63413A9D07AD96E00E 495PRESLEY
438,370,158 *2C63FB4E8929FEA92F832E20900E480093671534 4-braunstich
438,370,159 *2C6DAB33689828509CBD8096AEA8F7E0CBC2332B 4CHEFIEI
438,370,160 *2C6A6E07DD75736ADA5037FC58E076D38FBE80D1 actionarius
438,370,161 *2C60915A88A6BAB1D95B65F41A4902C08C94C2A0 ADAM.KETTERING
438,370,162 *2C62C4E6F85EA298DA627FE389159C720E5C0458 4ILUVTHEATRE0
438,370,163 *2C6C04FA4B51CB4BC66FA58646878867531EEA86 AD(G
438,370,164 *2C6DAD6358A6A2594426889F07188E6238E41C17 4lintsaavat
438,370,165 *2C681C4F5DC615582EBD8DB3B4D92CE029D43B1F [email protected]
438,370,166 *2C67C4DBF7DE156F254F643652B179973D7E06CD 4mekanidir
438,370,167 *2C6A5F6251386118017E2004D1E2E5707DF9B589 4OPEENGEDROMDE
438,370,168 *2C606F5EA873A6E194057A5783BB72DFD5B69773 4PLEYNTYFF
438,370,169 *2C6C601155EC08B395084F6531B1580F2521C766 4 POLJA
438,370,170 *2C6315E592362F023CB3E540B328F986A49334EB Ae9o
438,370,171 *2C6D80E619198ED1B648B2AAFC2FE14517C005E8 jonas-thorell
438,370,172 *2C6C1DC50C920CE85836427DA29F8CD5725154CD JONATHANWESTENBERGER
438,370,173 *2C6ADFDD5A52D99B6094646F2DC587D54D9461A7 AFKRUIPTSING
438,370,174 *2C6BF94CDC9B9DEF7C0557A2541DE114C3ADE832 AFRICHTTEN3
438,370,175 *2C663459FA9E91AABE696CBE67466FDDAA48BF98 AGFBP
438,370,176 *2C6DC3A8F574F4D7709D9C59C839E7B868DE534C josefmagnuson
438,370,177 *2C65CF58C9C7E16F87DDCD80284291A3F4343DF8 AGtc
438,370,178 *2C6D2E2EF6D7FE4C95777F9B992EBDE0BE0C34CE 575nina
438,370,179 *2C6F88B194886EBE016EB1C5078413AD91C5762B 5BEPLANNER
438,370,180 *2C6DE0737FF09B4A608018E06FA140BE3967847A AHNS?
438,370,181 *2C689B9AD1DEC814D290D67C449CB25029329386 5DORIABSW
438,370,182 *2C6A50C817BC40ABD6F8A6E3EA2C7E5E940A15F1 aizanichole
438,370,183 *2C6F539521A84B0D32361437CA45FB7181AC2CE7 JTIMCISIN
438,370,184 *2C60DCEDD5147789A332DF8939D355BC43722127 juc%
438,370,185 *2C65AC2F711270D7F1BAAF137B75A41069A52BDE akuoe
438,370,186 *2C6468517A030B4942D408525A733B6DDC50C160 ALBERTBLAZIER
438,370,187 *2C62572ACB7CD45324BA6681F0C7723A79CBD758 JW)I
438,370,188 *2C619B3317FC1ED0EAA331CF0BD3AD1A17601D12 5MICHIGANENSIS
438,370,189 *2C6D740314AA619143B79B9B5539DA416DE7DF1E ALERT-THE-AUDIENCE!
438,370,190 *2C6E491745DE0813B3BE20EBF527C13B7DA4BE72 ALEXANDERBIRDIN
438,370,191 *2C656549E83F223DFA19B2BB4AC4D3684923ADEB K68655
438,370,192 *2C6A0DC57CC6600A0F301F39CF2393C2884EECD0 5POOKIEBIGMAN
438,370,193 *2C65E12A8123569E83636D7FE868735D7DA8600C 5PROLONGUE
438,370,194 *2C64E1865D2BBA640A14891DA7B8C3197A4F064C ALISAYRE
438,370,195 *2C6A0A6F0B24EC48D40707167782BAAE2025E11F KBS演技大賞人気賞「プロポーズ」
438,370,196 *2C6ED571C457E36A33BD5382349FED42F81AF673 alphabets5
438,370,197 *2C653C92F47DFA28751E8681587FF1B4E699E9DC [email protected]
438,370,198 *2C66F729B9EE6D9AC74BFDFC56FEBE3EE5107CA7 ALTIOKIN2
438,370,199 *2C612A79738EB8A7A40522E2025B4F25FC7E24AA 63157 OFFICEANDRESIDENTIALBUILDINGSWILLBEADDEDLATER
438,370,200 *2C6FC42A3C7FFDBE540CE6FCDA12B5E419AE80C5 KENETHCURNUTT
438,370,201 *2C63D46D2353F92F10824D0EACC0DED06DB86C6E 662194 JEDOCH , VOR ALL ZU GROSSEN ERWARTUNGEN IST ZU WARNEN
438,370,202 *2C62C8F5B53CB6567C78CA1201C0AD33A97FAD68 AMADOHOLQUIN
438,370,203 *2C643ABDE1D8F541F48A91C69B21749557BAA8AC AMATHUROST
438,370,204 *2C61D16D94D31F1E67664560B602F8891511465A AMCVF
438,370,205 *2C6432B602DFDBEEDBE9FD3CAD6147603737E861 6BDVANTAGE
438,370,206 *2C6C08FEB80208F787C7499CECB9EFF216737800 KIROVIN–VIIPURIN
438,370,207 *2C669EF51FBF7A9EB108800FF60B4A6A58D9B8E4 KIRSTY-POWIS
438,370,208 *2C6F032045144ECADD0A6FBF0736152375D394CE 6EBREEUWD
438,370,209 *2C6203B2CEDAC5C5C340EBE9292166C1D6404AEA [email protected]
438,370,210 *2C63CE314A8E07416263D47DE5C2B364D9FAA0DB kkeviddernes
438,370,211 *2C60A9C531F66FC722B742EAB0757457CFD95C93 andyzeff
438,370,212 *2C69804D648287638C86B6167B8BB541320260DC [email protected]
438,370,213 *2C65C2E3AC237937E5DE2768D12998C26A27A95A [email protected]
438,370,214 *2C6B2D5C96703058433606C67198E1BF1CB5A07D kristian789
438,370,215 *2C6A9BDBCBF867F7E3EFEE977CA0D22E2E40D97C kristofernicklien
438,370,216 *2C6B5C90A03414F16E66DA9339E1D6617CD14502 krisweelborg
438,370,217 *2C6C44335CC7C03116A740F204F7384CDEBDAFC5 KROTKIJES
438,370,218 *2C6F3E4701563719C3980CD1F1BFF3EB2C249BA0 KURNIAWAN.SYAH
438,370,219 *2C6A62BC6B840CF3AA579AAD78F1B755FEA6E8E1 kusnic
438,370,220 *2C6DE25D5593436065565EB6A760D9052E75A771 LA CALIFFA: G
438,370,221 *2C6212389E7EF9741F52EA67177AE25BD31E5858 lakshayverma
438,370,222 *2C670A088432C9C1B93F1FBD89D465B33164B7CA ANUNG14
438,370,223 *2C6AC99687714E4B5B786B698E95E9D65CB11345 LARITSA-ORTIZ
438,370,224 *2C6A23031A75EB57BBE1E73903BC88BF0BE428BC AOUNZ
438,370,225 *2C668BB1F6257385C4D62D88063313233A937790 6WEGACLXTSBPOHPO
438,370,226 *2C6FDBC9FF0AB925079CBCC1DB6150BC91E57ACF 6YANKEESVANILLA
438,370,227 *2C6ABEEFCF69ADAF91514EF7B5F870BE83ED91F4 AQ"GM
438,370,228 *2C6E246B1B8F22D1926EA39011F7362FBEBDE7E9 AQKUF
438,370,229 *2C6E9E9332E384D1AB1FE23F262681D5BBDA8AB1 LEIGH BARRATT
438,370,230 *2C620C3E447CCF98317217887A2C3227F62BB46C leighhinks
438,370,231 *2C6168B8BE60DAF4B83D554F2B36FD93DCB4A31C 7BUSTICS
438,370,232 *2C670F84BF451CB37E127F8DE110B67DB7190236 ARLEN.FRANCOISE
438,370,233 *2C65037787399617EFD2599F0441DD65C1898FA9 armenhui3
438,370,234 *2C65C619C13463779CD1AE76F9D91B00EECBD646 ARNOLDOSURMA
438,370,235 *2C61D963095443162DD184A6DE9AE59CEE126F17 7FORDENIGMA
438,370,236 *2C6E5C7664ED4609E97D39E38196EAE277DB4907 7GIROUARD
438,370,237 *2C61C79FD023F4E07B97618E8FAFA7F2CD6F4E84 ARRABOTH9
438,370,238 *2C6846520A9CBEAC605CFD9D9EBD891DA4D3711A ar;sp
438,370,239 *2C6E0C2697F0BD96448E70AB85BE887D8F68F3C1 7mycurrent9
438,370,240 *2C63BB4B708EB514DE67F2A9ABEDC6FF253AB34A 7OUTGING
438,370,241 *2C60CECF67EB2AB4481C8A7FC17A4316B6B779F8 LESLIEDOZIER
438,370,242 *2C65FAB722B9AE7C5F174F99BB861897EA2B0D25 asnr?
438,370,243 *2C6667277EF3FD1D8E1BE4F3AFB6211F00476C28 7REDWINGHAZEL
438,370,244 *2C64B7176C0AE0FBB1385B54E92B92FE2E374B8D levendigsts
438,370,245 *2C672AA54A5852537803D7F814EB2BCEE8B5B46A Atb3
438,370,246 *2C64BE836C223A261F5BEAD5A11A6CCE63203C08 atomforscher
438,370,247 *2C60B24120BBC43BF24766D1A66B4F375DB6B0BC AU_3A
438,370,248 *2C64FAB5E1043BA1704AC14042183686B12B2366 84LK13$T
438,370,249 *2C615140E2117FE98A772DAC898F3369B9097BFF 8675309LOONEY
438,370,250 *2C62438C5F80F576F619F9D78B84D8B61E6124E1 LINDSAYKECKLER
438,370,251 *2C6418CF3DD3C7B7AA0540F739615AD4819D90AD auiy#
438,370,252 *2C631CCF7761B1B30F8AC4E01D062FE43F9DA14D LINDSEY.MCMILLIAM
438,370,253 *2C618450DBA1D7F2DB4F3D29C43BAC42EC436D2B LINELAND6
438,370,254 *2C66E9902AE61DDE646E17DED1E932AFE8C9A650 LIONEL.TILLMON
438,370,255 *2C698238F8F8892E443BE99687DE6AC26435CCA3 [email protected]
438,370,256 *2C6FBC0D35F179F6BA03A79A4E4BA8562444DF72 8CITYLORHTYRE
438,370,257 *2C6E77C0EA0A936B6C18C7A85241100ED9CA156D AVERY.BURMASTER
438,370,258 *2C612CF8FA9B8564D3644B6AB9BC890D34E42ABC av)h.
438,370,259 *2C6019D680CC7D926E8F1C452FDFE7DD479FC3CC 8GOYLIELMO
438,370,260 *2C6A4FCC4CCD08C9E4D356A74767CA0809D66652 AWFOE
438,370,261 *2C634CABFDA163D3DE0D44CB04FED1514D96CD6A 8iloveenter3
438,370,262 *2C6D9546F39D57821D61729467C4B4E2FFDCAA98 8KANNATTAVAN
438,370,263 *2C6BFE80265F2F58BB9F8076FBE44F9CE0B4D699 8.L
438,370,264 *2C68E291AB0E52BD1C430F3B2EF8075CB0EED069 8MIDDELMAN
438,370,265 *2C68973B1D3BB72CC4EA744046C707569F15D423 AYT_W
438,370,266 *2C698BDA09D70DFCEC68219F3CF85B29871790ED 8POWERROBERT
438,370,267 *2C64CE8B7A78931F6F306A591B293F7605CF8133 B-12-[Both-of-You,-Dance-Like-You-Want-to-Win]
438,370,268 *2C6F4615D9C7B753DEDA58EE733B7313D61FEBDA b4st0n3d
438,370,269 *2C67F334B9192B5C8BB7F0E45DB704F68003DE43 LT(H
438,370,270 *2C62B8925CF6B3FC10EDA3CAEF6804D7025FF254 8TEENAANBOD
438,370,271 *2C685A43F7EFD6525F0237BE9B6A237D39BA492C 8TEPPAGLIE
438,370,272 *2C60B91FDB769BC5283458EA41F2EE256271A83D 8THATITALY7
438,370,273 *2C69D2C34E9AEEBC75897FD4AC992039E59B4B22 B7P3
438,370,274 *2C6F10825DE723B3CA07E7D205C60766BA764A57 8YHPOSOEHT
438,370,275 *2C68DF05628036AA6A9DB3736513815C4C273F6B 934HAYDEN
438,370,276 *2C6A696CB9068142FA5472CC1A9864ADFDE7FDC6 935429 KOVIN-PALJON-HANKKEESTA-EI-J
438,370,277 *2C6379E9F6C9B68AC5DDD9F95DF79443AFEEA89E luminaţi
438,370,278 *2C6EC9C8741AC58F1AF4919D3C6546E743E8E3B2 [email protected]
438,370,279 *2C63B89604A0885688BAA1AD58F7AF55B61151E1 BABILNICA123
438,370,280 *2C6222538B7D9342C33C5DEEC47F8CBB755C6315 lupezinner
438,370,281 *2C6211A062CD4A64B3C2FF1D0232E3795E39FA1F lymfevat!
438,370,282 *2C614D7C19E879F27CF830CFCB057242CCDB6E32 M0D1F1C41
438,370,283 *2C657BA7214CD61FAF3F1AA8447EC21CCBA8A0EB M6SDDDAFMZZV
438,370,284 *2C6BC9F1EC10F49CF5425337F08F4B25A10AAC4D MACD3868
438,370,285 *2C617845A430CA12E0097E92FCB650F91036A659 MAC.HERMEZ
438,370,286 *2C6B767E11E7E34C8DC6FDBACD16A19A8D531953 MADONNAKATERINA-HANSJUDENK
438,370,287 *2C69B6E3A92C0885F38B4B670746DE76E39CDF90 MAJORCA1234
438,370,288 *2C68B81C3A883756931AF71AC5B6C240E44C6592 malcolmstanger
438,370,289 *2C6B9CB39500071A5232CA69C711621F6574395D 9GNIPEEKESROH
438,370,290 *2C6A2A0AE16F96D434168BB1CD51B9A6CE8C8826 BBLJ"
438,370,291 *2C687D51C139379D2AE254257A425036AF8471D3 bc;e0
438,370,292 *2C62B8139CE2ED4CB4204520F85469462E516AF3 marcotolo's
438,370,293 *2C6EE95E1866BCEEDE537E6A206834E9751EDB53 BDERRBSW5
438,370,294 *2C6ECA2F794DF3EBAA5B330EC3F183096024AE2E 9RECCABSW
438,370,295 *2C6676E947E713C9F4BA6564C75BEB55F9EAB320 9SPENNENE
438,370,296 *2C61399F084002614EA289C6AEA14C92ADBFD566 MARIANOKONOPACKY
438,370,297 *2C6CB307C1AA812367D140E333BE989ED36948BA MARIGOL3
438,370,298 *2C677C2FB99FEC1E8A8CFDA875A3BC4E2E3EC269 9THEMAYDAY2
438,370,299 *2C67E1CECD5CAE20CE16C5FC1A2812D4A61ADA07 9WORLDORATE
438,370,300 *2C671FB76A7C4766892CB5E90C12F5E1047F0667 9zigzag3
438,370,301 *2C678EBBEE48F5BFD396054D8FA953A298F3B711 BERNARDGAMBOA
438,370,302 *2C6C60F04B74A0A99FB2D8E204CAE419EFCE3F5D BETAKEN
438,370,303 *2C695BD5BA826CE710397C0B8ED23E519BEBA092 a2l9
438,370,304 *2C669E1A832A9C3C7381B0E519AE64AF6671E053 BIGCOCKFUCK
438,370,305 *2C656A65459B2156F4D9FACC0B39C0ED61DB8328 A8TUD
438,370,306 *2C6CEB9F0E6001CE040A03A31B32FC24247F1397 BIRMINGHOM
438,370,307 *2C66EB392AC409692CE87876D083A4BBAE9829F0 bjmhb
438,370,308 *2C6693EAAE733D1C9A3E89557842335B45E1F3BE AAEM)Z
438,370,309 *2C65DA924DE7CBA265E7739A7302808EC9170DBD MFURUZAWA
438,370,310 *2C6A46FBF7958FAF9649FF9A22DDD99E46FCF72E AARON.AUNGST
438,370,311 *2C6D0EEE88260CD322F8A884D5D33EDB85112EA3 mgsAcd2
438,370,312 *2C6E42299C7E61F5DEAA3583043F482F27F712E4 aaron-gowdy
438,370,313 *2C6C3D1EFEFBB13DB044ABF9B594C88DAA54E1EB bloqueava1
438,370,314 *2C6F5A3CA625595DAE25B95E03FEFA21A73B8C24 ABNQ
438,370,315 *2C6C5102FAAD51FA880703C36CB5106DFDE96412 [email protected]
438,370,316 *2C6A0B1D1FDBFDA934A6579B98441CB546B41FAD bo=cc
438,370,317 *2C6BDF3F16292149D7E28AB4AEFF3B1EBBA91843 boeien0
438,370,318 *2C6C92814985E9E891E8D3B18A296E992274393A boqb,
438,370,319 *2C6E25817AD9561A31BB7EF3366891E0EBBB1DEF BOUCHNAK1234
438,370,320 *2C68E9DC25E469380D39A9FCD166E81070AE9D8B BOULDEK
438,370,321 *2C6B7601F7D6337D07DCCE3D4EC8EBE6648AD1C3 mikelgoon
438,370,322 *2C6BF34974B42B7EADCB049E1E0CF5A76B78D256 ac\jc
438,370,323 *2C6EB2CC0B18A66CA4281A0679A5D9F25E39FFAE BR00M.HE4
438,370,324 *2C60EADC09BE40F7F9E29DE241EED6CB24A393D4 AD1'X
438,370,325 *2C68B25B832BC85ACA1330851CDC2A4EA04CD3D6 braeden307
438,370,326 *2C6937303B863AA7D34E564C47E1B85FDA8803E0 monkphilosopher
438,370,327 *2C67C6322AA6518889AA4D9B9603C439599F70D9 mosebasten
438,370,328 *2C68AF7429848FB91F7EECC3B07067626022C082 AEMYRIN5
438,370,329 *2C60626938FCE319BF73955310DB0ED8F56FF7C5 aenglases
438,370,330 *2C6A577604E2C36E6C91381167A5DB4BDA6701D4 mqce
438,370,331 *2C6F14DF80346E71A434DCBA7E05309350296238 MUCHACHO-ORDINARIO
438,370,332 *2C60CC7B891514396CCA37005F5CEA8FC28A09AB b,s?g
438,370,333 *2C6E97BE8A317359F4D5261DE0F8819653B4F717 AHIL,
438,370,334 *2C6813CDC1E021A813570BF63EB817FCA391EF38 NAGYVÁRÁD
438,370,335 *2C63178F8E085DDE893E85F18E7D4EFB44374922 A(iE
438,370,336 *2C603B52E83B1DC5CB23E0314C5CF4B90EABB6F7 NAT0102
438,370,337 *2C6CE4672906CCF4FCB4F3E600706F0083B1F235 navigationsmittel
438,370,338 *2C69C4C3BE4BFF95BF3603BC8ED406B794D10B83 net的架构师和开发者。
438,370,339 *2C65ACDE4A0E70B29BBDE7142A2E646E34AB499D NEWORLDSES
438,370,340 *2C69B5040C70AE3078F6ADFA2A6DD2FF2C579954 BX"p
438,370,341 *2C65799F40BDA326E17742DF5A3537224F43F0D2 ALDENNEUMAYER
438,370,342 *2C62E37D11A98B328142106851077CDCF5CFBEA4 NHIQMAL
438,370,343 *2C691DEC8940531E5219098BF2119B7698F98117 BYZANTINES.3
438,370,344 *2C63F60FC4DD771CBC0DC61A28DB7BD5164FE7EA nickbitters
438,370,345 *2C6EE0848FA0F291269157DE2F2912CF33698244 alexakehoe
438,370,346 *2C604B27EEE48ECDB9CC25CD22208BC37D66B41A nomataraslasalamanca
438,370,347 *2C6B8999D6914D775DE6BD5677BD4FD956AE6EC0 alimedab
438,370,348 *2C6E57C115A5D0213F2F77ADB51ABFC571759E2B c3/#
438,370,349 *2C6480D73A19F1450E0527B56FEA070ACE5BB977 c$(3m
438,370,350 *2C69F2F0B3A6EB673B5174867B7A3BBC4000A0E9 C5I1/
438,370,351 *2C6F421E7CE566C7BD12D00FAC39A35B7DC0C5D3 NYNJAD
438,370,352 *2C6DCF74466C0566697375A696B1E1C8B198EB7C ALPHONSE.WOLFER
438,370,353 *2C69468558B1B20252BEF58D53C75BAEF35E6CDD a%lpp
438,370,354 *2C67E5909E5ED9BD18C3D80CB4D186C70683CDA5 c6j#a
438,370,355 *2C6106547F89ABBA9A122ABBCF526970010F89DC ALVIN8
438,370,356 *2C6487551AE823C7E5B340B2F31D7724C1FC766A c?adh
438,370,357 *2C6E25A83B18AAA6458A11D45A6593A3B347EB98 CAIETAV
438,370,358 *2C68057EC38B804A52B8E9995887CA971FEC9199 OK{(
438,370,359 *2C6F15A4AAA6D007E8A82C80906DD00C1A8D7486 CALATAYUD1994
438,370,360 *2C63BEBE4D25C873CC1A16B9139B4D4DB5553BE2 AMASSMENT
438,370,361 *2C6CFF0F947BE1C2CE072B89A3FB930BC76F17A2 AMY.PROCTOR
438,370,362 *2C6C3CCACAC4AF90CCAD549CFB27EBE3203167B4 ONTUVILLA
438,370,363 *2C6C3EA9FF623B1309DB6517E310DDFDC99FFA51 a!nab
438,370,364 *2C67B431F483CD8CDED14CA164B1E5D388EE1FB3 analogverst
438,370,365 *2C62BC2D97900BC98BBA6B9AB83B429C8514CE01 ancty
438,370,366 *2C6A97B2895672DB114F8500454B7CD53F97B439 andressimoens
438,370,367 *2C61CBE0EF0662B5CDF86F4A26468A32EB16C479 ORCHESTRAL.SUITE.NO..2.IN.B.MINOR,.BWV.1064:.BOURR
438,370,368 *2C6BC2E74D8A99802EB393688DFD42023852ADC9 CARMELO.UMBENHAUER
438,370,369 *2C6C6EC6C56FA4C47F271E102812BBA6612D4DD8 ANGELOCARDNO
438,370,370 *2C6F9164F815151FFCF6865C0189BF9AA243E71A carrollwarr
438,370,371 *2C61D7A2E3154C03CB39A77A19458C45D415E7CC ANKERTES0
438,370,372 *2C682989960AF20F37E08E0B5103818871F666CE OTHA.HAW
438,370,373 *2C66CE75B3477F36D07D0013582B99276A1D6316 casematter
438,370,374 *2C67497CA7AC5E074881548563592E41A9C3EECB ><* * <#P
438,370,375 *2C6E9D7DD4C897EDF09DC609A3BCC9EB630A0644 [email protected]*.(>_0)
438,370,376 *2C6C0C7A8088D31F4D739F1A00E621EF427AD810 P123409
438,370,377 *2C6C2C93532F95138FF84C5636662CC8CB170076 pa221799
438,370,378 *2C63989B0BBE736D6C1B3B7CCD90E08A43BAD838 AO3QW
438,370,379 *2C6408BD723BB67F983F0D127BF0AF0E6E805D18 cd+:3
438,370,380 *2C6007C4E90F96C8ECE24B06F16460C0E0BD732A [email protected]
438,370,381 *2C6EBE1B86D37EDAB1503D486A20B50FD2684F01 PANTAGRUELION
438,370,382 *2C601BE64C63C07492EFFC68FEE8B49C821B25F0 patgopie
438,370,383 *2C6AF2B6017236C6A3F7871AA8A103D13481C0C5 cehz/
438,370,384 *2C6BFDECD195AB2D79E8B64BD83F3D89FB8BAA0D ARDENSTOBAUGH
438,370,385 *2C6ED0EC919F8420D9C0B25CAD277953E836C96D areriggas
438,370,386 *2C68498CF2B656BC1571E42C615343D212D2D3B7 P-----D.`~.`~.(>-<)
438,370,387 *2C6BE3F62EF82D1DBA38599F252C34DBD0BF04AE P====D~0 ~O>-<
438,370,388 *2C6D897C70782B7E3AD40255FDAA503F32C8435E peace in da neighborhood
438,370,389 *2C62231E0539F8EEEB5A7DE97A1258D51B5079D6 CHACRON
438,370,390 *2C637D2E3D2FDB5676B8BB7AA192E63E39597493 ARu=
438,370,391 *2C697548401D0E42C50C7CA7D03AC77122865BB8 CHARLESMILNE
438,370,392 *2C664464CE0ADB88B39B626D389F98AC81D874E8 ASIRSKIM3
438,370,393 *2C602939BCD69BEADA130E7B118581E7BF006AA9 atepu
438,370,394 *2C63ACDA3A89F568D49AA837B931EE8A49A733E2 philipgastello
438,370,395 *2C6415681FD67FEC9F014C7B916F56DFB3461D89 ATTH
438,370,396 *2C63846D4AC2EF474A765BB76DDFD027EFE6DAC1 [email protected]
438,370,397 *2C61ED20EB778EA8917579DC9837D6F4310BBE4A CHENABABA
438,370,398 *2C6C099F34E06A63C977EEC1EB56264B47BEAEA6 piebirdtweety
438,370,399 *2C6A1BC08E7EDA252875C699D6D7ECFD546665BA chigosson
438,370,400 *2C62F89F033BC5EFD87CB5F048003FE2B24B915E chiriacii
438,370,401 *2C67B190E79A8989C1EFD0D2CFE1AD5A1D86AE58 aupmu
438,370,402 *2C6375C96BD3C707D0026332157F746929276B33 CHRISRAE&CCHAMBERS
438,370,403 *2C6645F1C6226853F3EB8AB3CEE2BCC8CFF0CA6D po5toffice
438,370,404 *2C6A1D4BEA77B7D8489F848594F183CF94F9BFD6 CIPANGO0
438,370,405 *2C6FC76F8887E349BAAE66A2F0657D74E92F29C3 CIVIELE
438,370,406 *2C68022B9AE8DEA6AF0919B0814DA4C21D0C273A a"$wo
438,370,407 *2C684F4DC5831D67940E6D491046E0EDA042026F a;y:
438,370,408 *2C6FE8FA15FCAF74077F1193A8CAB5F2437F5AE6 preaching-praying-singing
438,370,409 *2C6891932300B6D557F569FCD87D710F203E5301 C;lf
438,370,410 *2C66D413810F93694C70DED9386142453193C717 PRINCESS WILL-THEY-RETURN?
438,370,411 *2C6C1E7B4053298AAE4B301F7703CE15FF99A324 printing26
438,370,412 *2C6D6F7698FEDA514BE6FD5F2DC523B3BD8B6F47 provincias de castillala mancha
438,370,413 *2C6F336CD4FD3DCFFCDAD2C8931869D147965F9E cmu#
438,370,414 *2C6F83E68174F18DA83B6A6D34E0FA3DEE6D982D cnhzq
438,370,415 *2C6BF5FB042D72009F052F903634D5BD038E46B9 b3epm
438,370,416 *2C673B7F884055A1AF722956093082446156DAB6 coblitz6
438,370,417 *2C6B2F0043950DC5E5B52EECF356D07AD412A4FA PWA(THECLIMAX)
438,370,418 *2C67CC3389D1B5EE3D3E8B9F2D40EB2717755F3D PZ2CTKC
438,370,419 *2C6D6A872787FAE8FC57C86815D53779D0C42B2A Q#####)~.~.~.3B<-
438,370,420 *2C6EAF6E8D51B1060590B28A26735A6A5E68FDF6 Q5V
438,370,421 *2C64D8A5819CF4CBC48210FCB3C1ED1132BBA004 baqmb
438,370,422 *2C6405E6DD81E2002C2F5776BB27F2964003B0B0 qjadthidxdw
438,370,423 *2C68E6CC39D4B22F4D2419BF9C3FD357C6F15052 bbea
438,370,424 *2C68A540DD1F8117B1E9BED1C703405F095BFA80 CORDELL.ALDAY
438,370,425 *2C6318CDB7A60EB45B3295A57217E4E876A0F7C4 bbnpe
438,370,426 *2C673D0605838425BA64569DFBC0C303BB2BF32B B?CA
438,370,427 *2C63B0C146A7426069AF7A8FDB45572E6181B92F R3LUT4RM05
438,370,428 *2C67CAD459D7BA12CA6AB930EE5C4243FC96361A R#61
438,370,429 *2C687788A05230E8364563B5DE34960ABA73ECF2 CPA:/
438,370,430 *2C621DDF6A245E27322A2114D8D4BD273400495F cpi)j
438,370,431 *2C6D89CBD68862414ABD0858540FD6D57BD39D4D ralphmonton
438,370,432 *2C6D201ABFABCD6DD0E694A48EA7AB452D07110B rambarding
438,370,433 *2C6942E870529AE5DECE78040A6858611771467C RAMIRO.ROMULUS
438,370,434 *2C6400F51D2714048F92CC13D07F574934112149 RANDOLPHCARABEZ
438,370,435 *2C6CFF4C9D90D72508B9A01EECAC56C31976CD54 RAY-CHARLES-AND-BETTY-CARTER
438,370,436 *2C63F707D94EFEB78B1F5DAB3A12AE3D231282BD C:\PROGRAM.FILES\COMMON.FILES\ADOBE\HELP\AR_AE\BRIDGE\3.0\TERMS.JS
438,370,437 *2C68FA8383CB9E3F8B705D2FD0C7060E6E8B5BFC c:\program-files\microsoft-visual-studio-90\vc\vcwizards\smartdeviceappwiz\mfc\application\templates\1031\tbrhibmp
438,370,438 *2C67BD5565324028DA41D367E769381FE22C8228 REGINALDAMUNDSON
438,370,439 *2C619320D8758112F11A9BA678049759908066D4 REGNEBRTTETS3
438,370,440 *2C6CB684C34F673B3BE87B2937E22209830E5D9B REIOYSSHYNG
438,370,441 *2C679A0EC6D75A1729BB368FAECE6D02A110555F BEATRIZCARABALLO
438,370,442 *2C658AB483A82056211A4B3CCCCE22BBC022556E re kontra (feat. tede)
438,370,443 *2C616546C5D64F183FC3FF3553BBFF3B7427C347 RENEWABLEENERGYGEEKCAWWW
438,370,444 *2C6BD29F41C723F8E99589E3EE9E237A8AD34872 BELEEFDHED
438,370,445 *2C68D7BF68AC8E0AFE839C055CBC93CAF9F2DF4B REQUIEMINDMINOR,KV626:III.SEQUENTIANO.1:DIESIRAE
438,370,446 *2C6DB6885AC663D59DE37ADF1208710032B77671 BENSINI
438,370,447 *2C61E65D05859C6137B18040075CB1C72B781561 beqat
438,370,448 *2C60DBA86517944460E5A62D57A9750CA6A0AACF retubirted
438,370,449 *2C658DA9F6C328016DBA75DBBE7B809C9B228CC3 RHAPSODYNO.2
438,370,450 *2C625B7868DA6C97CC64F0DA1BEE19E6333477F9 BETOKENS
438,370,451 *2C643BD24AFC73358D46F23F425D6142AA2A1F69 RICHARD NORBY
438,370,452 *2C66DD5D4CC7F4A0B3548F371D7B61263E103853 richieguerero
438,370,453 *2C6932E8CAD1E12553DACA1066520BE5503F9477 CRJ5Y
438,370,454 *2C6245747AC6349E5510B3DA17F9C01CC0494C36 crjz+
438,370,455 *2C6CD1A774729CFBC0F62F9286E525D0E0EDA8DB bfg7_
438,370,456 *2C6FFCAEDD80F32B0B4CBF05242724114AD1C51C cr.nh
438,370,457 *2C6EAAA94D2C5CDE30DD02B6C508585BEB2CBDBC cs4u8
438,370,458 *2C6025B520328C90E2227CB8340AAB0E086D7592 ct&#
438,370,459 *2C65B3847E18A9684B62DCF550464EC303B766D0 robertmarquardt
438,370,460 *2C679914F7D9ACB00D227F2E415F939B36F3C3EB bid6i
438,370,461 *2C6FC934ADD016CB901BCAC1A9E5DCD64A41DAD3 CUTMEGENTLY(FEATDIE)
438,370,462 *2C63E4A8CBCBDADEB8AA8C94231B2746602AE483 cww8
438,370,463 *2C66D354C577CC26C9ABF3202465FD3478A1D4D2 bjstrjk5
438,370,464 *2C69A80154F5AE7227F9C5DDB6743BE05F579EE3 bkheq
438,370,465 *2C6D708F24F73AA69D40B4685EC1920644110F20 cys%)
438,370,466 *2C66A1AAA6DC4A1038917592770AC7D1D3BF859A RPNSRNS0
438,370,467 *2C665E06BE8489ACD724B0575AB9B944157463F9 RSAFSLUTNINGER
438,370,468 *2C61C0645D51F4F548857BCE252B4C1092BBEC63 BLEISTIFT0409
438,370,469 *2C66E93AA69510637E217485C57876CF6AD78363 D1MQR
438,370,470 *2C69620D2B7B876090D03A0C5229FC31A2ED9C12 b"lr#
438,370,471 *2C6A498F0E66FC6D98930D4D28BC9592A87794B8 S0011806
438,370,472 *2C66FF80C604C776706FAE434BFF450AA328A65D S0NLESS
438,370,473 *2C6B7ACD73187589D17AC4A7F518839B26A7ABA5 BOBBIEMATHEY
438,370,474 *2C615EB6A754C73293743F471F2EA5598F4A94AC SAILUBA7
438,370,475 *2C66E47445204DCCFF885420F988278FE728325F boborás
438,370,476 *2C6FF8A0D0622CCA4311F95259859A2E7A786CCA b.okc
438,370,477 *2C6EF6F2D55DE49ADDB223735AADF94335DC3EF6 DALLAS.GATTAS
438,370,478 *2C61D1F978F3FA6E32E3B5FEC60FB9BCD26FA134 borampadarat
438,370,479 *2C68AD1D89EC139DBEB56F08EB4F10CC359E6039 damianelam
438,370,480 *2C6FB1851C1A2C080BFC74187E6755D5FF9540AF sarcosporidia0
438,370,481 *2C63CEAF2692D06109BD214A55E1D40F742328D8 SC13ROTICOCHOROIDITIS
438,370,482 *2C6870624FBDDF89640CEAEBD0BB21C9C15E55BB bqc-f
438,370,483 *2C6C78F8991186C34B44F43920BB5928BE24BCAC DAN.PETTEY
438,370,484 *2C64081A1718ADDBF092BBDA58B3661122296FA7 BRADLEYHERSH
438,370,485 *2C684C9C0941C85A9500D25096A4AC1DA9C87182 BRANDENBURGGATE:REVISITED
438,370,486 *2C694CA15A58AAAE2170DF6F43E210DC46CF9D22 scott.weathers
438,370,487 *2C65280C6BFC272A634156810B77F3729CDF0D19 DARREL.JANICK
438,370,488 *2C6CD259EDF1EC5D0CD32020C7A1052A81084BBB bret.love
438,370,489 *2C689F4CFADCEC8C0652A78B149CA4DF7542A152 BRIEN MILLER
438,370,490 *2C6E3BD4CEC88EA4F72E2C1A85F69D79E800B7B9 SEDATNYP
438,370,491 *2C6940E9B7714466A5F63B9039BF683F19C0195C DAVE.WEASEL
438,370,492 *2C69767018F4682EE04384206483B66416EAF193 brlx?
438,370,493 *2C6CDA653D16E92F925F7575EC42F1153796380A SEILTNEGNIRTSA
438,370,494 *2C6884B2A54AB1E87B335A2745E8DE55DCEA1B5C BROWN57ON3
438,370,495 *2C6E7F2E9A03A8416187313A7C472BE3D8B2ACA9 SELRAHCECILOP
438,370,496 *2C68F71A61C1735DAD193F579AB4D3549C12E996 dbger
438,370,497 *2C6DF4D63E9428F28776BAB6962610412E2B88AF bu&4!
438,370,498 *2C692111EBC62526FB142568FA3505A18AE04DEA SERINA HARRIS
438,370,499 *2C6D0784790D12A9FAB98E91219E5F2F4342EC32 SERTAO DAS AGUAS
438,370,500 *2C679C516CE0897730E55FC9935E6B98B50524EC BULLET170
438,370,501 *2C6A37D2927F10F7943FB9B20E30887D013126D0 dclength
438,370,502 *2C68FE047C141A4FE53CAA6B388D1255374AEEAA d=+/d
438,370,503 *2C6D72F61189A5EA1A79447C56BF52306B818563 BUTGI
438,370,504 *2C65B6C93B3BF1B23A05C8E1CDB46C04368EC7D4 DEEMITTON
438,370,505 *2C671432DF9264F4A39284D1511DAE324416BF3E BYEY/
438,370,506 *2C6DE7BB492B855E5DB3021C53E4963F69BD8C6B [email protected]
438,370,507 *2C683B19B54B6E981DED7FEFC0D7418524B3202C c5-gc
438,370,508 *2C69F46D60AC3884ABB1A7243F0B2B426A084EEA c5rqi
438,370,509 *2C6934190EEBD49C48122D0A54C3721EA07F06FA [email protected]
438,370,510 *2C62A576EFB4EA29A59E9C922773E935D0B32A03 [email protected]
438,370,511 *2C62152EFA7C20E11D07A4E83FFC4256F8F295F8 DENISSCHOON
438,370,512 *2C6B27BEB3DD988A834F68FC599643C3DDE1C4EC DENNACCUB4
438,370,513 *2C616BE13569A462360BF52E17E90DB93672E8E1 dennisguridi
438,370,514 *2C60AC413F2F6C3CE7C7C83B98CB1A2B3436E46A SHNEIDERA
438,370,515 *2C65D2C8D1CA61F20569FF663A38B326451F11DB c-,7m
438,370,516 *2C6D8F9D911C1EEB2A5947600953573AF2345F66 c/8:s
438,370,517 *2C608B882859F3E8DFBBD2788D79E026BEEAB07C der.getreue.music-meister:.erste.lektion.nr..4:.polonoise.d-dur
438,370,518 *2C6487E9F24943E5D98A15127E6371DF6457B1EA CAIRN.INFOWWW
438,370,519 *2C69C38BD5827196920BA0D197FF27629D76D124 CALPÚRNIA
438,370,520 *2C6FBD4FBB8BE003850BC2EA78FA198830460287 D’ÉTRETAT
438,370,521 *2C65DE89702123EAD13DA0ED75EFDC2B25AEC2C1 CALVIN.CAMPELL
438,370,522 *2C68D39C06B0C798F75F4A69044B4C00483E1431 cameronevora
438,370,523 *2C6EF0EBCEDA79DA57B743D8DF1F29CEEAF20F8D CAMPSTALKFEMALE
438,370,524 *2C6CD0D915575DFECBF949692930EA4247A9E8AF SILICONSCHICH9
438,370,525 *2C6D4586ECC9D89A25BE21CCDA9A86F27A1A7DF1 CAPTIVEMARKET
438,370,526 *2C6678FD9C8E12690971A75187C678423F1D3B8D D+;II
438,370,527 *2C6B06C95291DCE6EE685D4656C22759B0BD9714 DJO?=
438,370,528 *2C695EBD5927AA387E53C43A8588FDDEBDCFE798 dlewisarfmaolcom
438,370,529 *2C6D51E90B07361E8884C660050CFE51534B31EB DLFVI
438,370,530 *2C65930403C89166B9009132913DC6957762B006 d/nf6
438,370,531 *2C6FDE62EA28784BEEEC80A83C494CDEA0C44F50 Doc
438,370,532 *2C68F7C4EA0338D3397B7631BB13F46254B93EB3 C:\DOCUMENTSANDSETTINGS\FIREXWARE\LOCALSETTINGS\APPLICATIONDATA\MICROSOFT\WINDOWSMEDIA
438,370,533 *2C60D29590D7BC928289AEEB6D9B63BD0486135F CEDICGRACE
438,370,534 *2C62743203BF017326A1F526FF91E4AE27E0ADDC cehog
438,370,535 *2C6887E9409E2CA2AFC02F1F009C8BBAB3963205 SNOWTV
438,370,536 *2C636D722D917E537C13B985DB8AFBBF85ED1DBB CETSEE
438,370,537 *2C69A6DA0A05F90B1989D8F7E2956FFD494BAB4C c+h8e
438,370,538 *2C6A106C61E9A4FDBF1A8DD42C39D9493B528A3E [email protected]
438,370,539 *2C6120E1AA1CB9698FDF5B31556BDE21EB95B496 something.2.ride.2.(feat..phonte)
438,370,540 *2C63C0AD5549C826B3BA5BF0027D316AC9A3380A DUHQ;
438,370,541 *2C6B66ABBE0BE76A764D60C004A7A789D0A0E0BB sortino--s-ao0-r-t-iy1-n-ow0
438,370,542 *2C64C73676BF38CAE7538D1B4885A8BB5C5BE50A CHASEGARRE
438,370,543 *2C661F05B74BE0758200EB7E662769D72455C00E soya-sauce
438,370,544 *2C6B38697E305904645993BF72AFC63F37CA79AF DVF(M
438,370,545 *2C684E09021065A0F269D425782291DB39BC1334 spiedtspiedt
438,370,546 *2C6035E84F0D7445FD1F56FEEFC2793ADF257A0E chqtup
438,370,547 *2C6B8353F7D2DDA4BF2B8F5915CD8576FDA3FB75 EARNESTVERKUILEN
438,370,548 *2C6D57129477A016EEFA82E5E0183A108BD4252E earnestzelechowski
438,370,549 *2C6F8A31468367942481673F129C65B71786CB6D EBLOECHL
438,370,550 *2C6EC62565F3304336017896BE5E3BBDEBC12498 ech!?
438,370,551 *2C66595C528DA781B6B322655011FEEE0A78D802 SRADENTZ
438,370,552 *2C6B686335AA5148FF7C609E6D18DE87EB71C4CB eddiebiederman
438,370,553 *2C6E6E8B56618A487D60C5D43BEE9B5D583FEC6C SREFFOTSEVRAF
438,370,554 *2C6EE8BAC74260CF3EC4CCDB42619D71EDFE4ABE CIL;)
438,370,555 *2C633713A00CA0F93FDC917FAC349DE7E2A11FE0 EDNALIHP5
438,370,556 *2C61692E48F4F10160F03079A8972B127D35AF01 SSSENSUOREKNUH
438,370,557 *2C6A98DAFB61E2A27174845B71AD976FA7263229 c-ka&
438,370,558 *2C6E0CB00A5B30BCD94087DDEFA2B2BC36CC0483 ckcc3
438,370,559 *2C6D53D6B675CB3E1727BE4143DB042D18C7C5D9 CLFL
438,370,560 *2C669C1D725337661D738FA36C8877C4C4D9AA96 clipmoonkask77
438,370,561 *2C66E076B56534CA7CAC051DE6D59FF32E51229F [email protected]
438,370,562 *2C6C858CA8F9A7221F02DEC84BA851D2EBFFDA94 STEVESHADOAN
438,370,563 *2C6E51633DE083D808BA61D83F072064E69E3579 [email protected]
438,370,564 *2C6196603E2756C9B3FB7027FA15FA7116194ACC [email protected]
438,370,565 *2C6806B022061D1308AFBAA364BEB6B471AE16CF CM+CV
438,370,566 *2C6D4A88D971E3A345EAF289E4E327ADD536EC92 elecjour7
438,370,567 *2C6674A03DD192A20630525CC5631A91C1F49DFD stpiatus
438,370,568 *2C64C2045C15885FBFE00D727F47D3D698E68861 ELFOGULTSÁGBA
438,370,569 *2C6D5E9001A5197417237BDCC14199498F39C4B2 STRÅTJERN
438,370,570 *2C6C2EE36F2B517E0439A61A9169661C9DF9F0E8 CNln
438,370,571 *2C616F1A9A7B2ABD258AE8BBEC3A43AF2B6D63B1 STUNDEKI.BAYG
438,370,572 *2C600980D63BAA0140F8A2D4F6EE90AAA66A417B su-1?zb
438,370,573 *2C66294C52E0EBD345E8B16E28F2CF7BBE595F02 CODYEOVALDI
438,370,574 *2C688CC53A808389C68C8F6A85BF0B98DC540373 [email protected]
438,370,575 *2C6A2F76842C19428377D418119BD76DFE8AECD6 SUDRAJATO
438,370,576 *2C68D620E5BD8DBA368FAA3CF05455620CAB7B8B coitipbpc
438,370,577 *2C6B506857F009D004BFD8658AB50494A4B5F544 SUFFRAGASTIED
438,370,578 *2C6F31E761E3926ADB4A3AA522625D8801314C66 sulligsting
438,370,579 *2C63F1FF3423DE9C829D554BFE42EDFC2930C092 ELLSWORTH.SHALWANI
438,370,580 *2C63ECE201AB8BF691FA01922C667C5814D2B2BA elon mainingit
438,370,581 *2C628650560B5C48A89F35B62CB7F80D5D7A495E COMPSOSED
438,370,582 *2C6F9127F3344EFA84AC1F759A13FA2418AB948D em2be
438,370,583 *2C6ED9ECFD685F24E7E972F5D43F23DD386AA39F SUUTIKA0
438,370,584 *2C6F98CE87F6A8E3749D4729E6D65B9CD22F5583 CONSULTAS-DE-BORRADOCORU
438,370,585 *2C6C811D6ABF4FD6D65C080B9B83B999AAD50A69 contreros9
438,370,586 *2C6CAEE3D0BA0C0E36E566359CBE7B75D4C98A78 SWIMMINGCATALOG4
438,370,587 *2C67B2D2CEC030A270361A95ACDFFAF36FD5C92A CONVERSECONTRAPOSITI
438,370,588 *2C6C73C3E9B7BD07F539CA9C942A529AEC454931 COPELAND —
438,370,589 *2C66F61B7DE0973947BBD23DCD550D8D157BD972 ENGLINS4
438,370,590 *2C67717909E10B8CC30E07FD9FC4659C55A55F66 TALKARNAYON
438,370,591 *2C644F3AA0068328FA70F624E9F19063022C173F CPU6)
438,370,592 *2C682B001E655ACAA1CFB71EDA07121C02DAF247 CQ$K2
438,370,593 *2C64E862AED32C626637B8BEE330FDAF7FEBBE56 tarnicą
438,370,594 *2C6419ED531E5C13AA36C637CA200492C2A75829 ERINBRICKMAN
438,370,595 *2C65F26DC952688DCD681E46E3CA3AB50B2F08F8 crftrztnsing
438,370,596 *2C68B64BBB9538F8F5AFB3325A716735B4D825FF TELRAEPS
438,370,597 *2C682C5B58499922E364AADD9E500DAE04184DD5 CRPR2
438,370,598 *2C6D4B7CB96849157E00ACB71AABBEACF7087118 TENONTODING
438,370,599 *2C6FA3712628ACFEB1E39B749EF107488AB13CBE CTOLL
438,370,600 *2C62679D8998E591549C6979B1017E3DA9D75D8E thatmike35
438,370,601 *2C627A8FB26FF24EF4DA00E3834F9381057388F9 CURLEY-HOROHOV
438,370,602 *2C6584BDE984C7F2D832CE0B94D09F97B7BF8A76 C`VF
438,370,603 *2C667BF8E4B300B4841AC95E34ABBCAE66244946 CXC#U
438,370,604 *2C63C5F58DCAC33A787F56496413D4A9E0AABAF9 EROYUKIY
438,370,605 *2C6A2FA65E4DECA190BC9B51DCC9A400484A8868 cyi?j
438,370,606 *2C6D84546A5161699D9151939C767CFE53F181B2 ESPERAREM
438,370,607 *2C60D466B8B4489EA165A51677E0CC54CBE7B195 ett?:
438,370,608 *2C6FF8314DF9C68D9A4332B9C24EAD4DF5A73A07 [email protected]
438,370,609 *2C6C6EEFF6B9944285EF0A554D163DF428433794 TILJA1234
438,370,610 *2C68AEB89774B77438758DA7F827DD1C4FFD4150 d38n%
438,370,611 *2C6681DD2586DB26847DF5E9DB3E56B4A84B1AF6 EUROPEANIZED123
438,370,612 *2C64A340253691705EBF6A261461206762EE2F7A d3gj&
438,370,613 *2C65A76C0635C61385AA29558CEDABF130EE1348 D45Q+
438,370,614 *2C664B635F194245D7266428A56EC6C9EF50CC22 EVINTWINSISTER
438,370,615 *2C68AB0CC9371DACB2456C0F11D58493438545F9 EXPORTMICHELL
438,370,616 *2C632BF2F49BAFDE7748DF2C0324879241A93003 TOLIGNACBSW2
438,370,617 *2C6A2D6DA8FE7295679E81D96CD71D208F346973 TOM ISABELLA
438,370,618 *2C6343346CF827EC3501127A4754BD69C3509ADC tomrum5
438,370,619 *2C6DC4EB16934AEFB1723816DB113D97BEFC6470 dallasamedro
438,370,620 *2C6E0961DAC655900BA727C6AED8E552306DECE4 FACILITEITSKOSTEN
438,370,621 *2C6B1F1F026F4DDDF28D93D7AF19210373E766D9 toverfluiten
438,370,622 *2C658100CF307DA1B307A66683DA0F4B1D9834EE TRAENERASSISTENT
438,370,623 *2C6192AF3A8C24F6CC43951E990E9A7C70783C93 [email protected]
438,370,624 *2C66F0380F53B16C1FAE56D4D2B301015039D302 FATOSBLLACA
438,370,625 *2C65DAA678C83705BCD8C32B7414C87CF4DFF9FC FAUSTONUCHOLS
438,370,626 *2C69995FBC973C5FB4C51C03CD4A19215EF82BCE DANSPADAFORA
438,370,627 *2C6232C4D16621B83312694C2EAF9934438505C4 F[D5
438,370,628 *2C631E0D1EE0F686D2248A613B6A3EBD8CC181B1 [email protected]
438,370,629 *2C615F7267CADB219EA339F50609AADAC81210C7 darner
438,370,630 *2C660727163431D252F96E978D190478EEF50DE4 darrelrox
438,370,631 *2C671D472C87663873C6B4D65A0C92340DED51DD trieberkokosmatte
438,370,632 *2C6CABE211C54CDAAEED528157C76A8C2FDCB8EF DARRICKHIRST
438,370,633 *2C66F0A64AF2159E92AB37799EB70097A2B546E1 trochilidae.
438,370,634 *2C603D11FABA4D7CDA155839DCBCA707E764667F [email protected]
438,370,635 *2C68ACD9165CCDF96AB706E7276A7C807EA399AA tryu01
438,370,636 *2C612A58D1464C7E0EDBB531CE764DF925430BD8 TTOKIWA
438,370,637 *2C6AD4818BA3B0E80715D5B1E1173819AE1020F6 FELIXOVERMANN
438,370,638 *2C6FB293055F6517C02E399AE1874B0CE1FC7438 TULIAAILUT1
438,370,639 *2C623FF1D03A1A6552A87507C81EBE29636FAB53 TULIPIN0
438,370,640 *2C650A6CC91CC0F9EE90090CE3600FA710C96044 DEATHIN6
438,370,641 *2C61E0366833799D4A2C4607CF2C4E39B996CF83 TYPWMENWNED
438,370,642 *2C69FAEFA51DC43A93EDD1389A7043CC8D2638BE tyrellpennebaker
438,370,643 *2C6C9F69BE314759F98B6973BFFB0D700316FD11 TYSON.VELZY
438,370,644 *2C6621AF542E5FD317F431A1E8C1F7C41EEFEE28 fidelverbilla
438,370,645 *2C69B028555256C9F2F6B9B20372C382A9CD8869 U50320
438,370,646 *2C66F7375BD243157A13EAC3ED7F51C4C42F619F FINALLY-(YOST-MAIN-VOCAL-EXTENDED-MIX)
438,370,647 *2C62AED495534DF482EBB4AE39BFC0DDBB88CF19 FIWZFJAVS
438,370,648 *2C69F090006A0DC6BCB7DB8104B80E15A13B1B20 UDESH KUMARA
438,370,649 *2C61D52FD3BDDDAAC811638A20B98C99A49C4CDE FKARFS
438,370,650 *2C6E88424B9071223A7FCDCCF2833631D86FA84A FLATORELLA
438,370,651 *2C681F2AC0FF297908A8E99745F13294463BABC9 FLATSAWN3
438,370,652 *2C681457BB71AB07588623D30CA919C186B603E1 DENISECONGER
438,370,653 *2C6710E5051F04E9ABF0275331EBCD7CA3363585 DENISE.HOWLAND
438,370,654 *2C621FAFE71F5B60CEFEAE7E1A967AB922712286 FNC.
438,370,655 *2C615500075C91B7CF1249C8BB6E76F2ABE89FBF FØLGNDE
438,370,656 *2C6BDFF9FE58996985A547AE71291635D4F6DFF2 FOZZIEPEOPLE
438,370,657 *2C64DFA5331214EDC092EDCA9258E8999F6F4F9B FRAUENSTADTBUCH
438,370,658 *2C629671F0B4521FF3D10AB41494730A8CC7DFC7 UNTERGENG
438,370,659 *2C6564734CE8ED40BAA9A55E90DB8D27B035A161 USERARCHSTANTON
438,370,660 *2C67F88F0590D48C25F6F1E92C19843A5BC8B443 DHDm
438,370,661 *2C6C657E21A9B4AFD11799352D3A81825D45EE26 DIANEDELVALLE
438,370,662 *2C6E0B18080B80F08A4A0C9D6CC8DF57463404C9 DICKLER 3 0
438,370,663 *2C6CC6F2E5ED5DF4FCA05B087F41459A5DF28804 [email protected]
438,370,664 *2C625D57554F8F9E51C983A88326CC8767D60ED1 gawjussm8s
438,370,665 *2C60E56F5988F19F0C0FB05383390D32EB9DBEE8 gaylesanfratello
438,370,666 *2C6577B9085662A90758CEDBE03BD16FEC5EA6ED valeria12345
438,370,667 *2C60329BCFA86E95311A80D5574499FDCE0F6D66 dimitris-kabilafkas
438,370,668 *2C6D70B303560EA683C106C95A0C2FB5B168AB7F gdd375
438,370,669 *2C68D1DCF72A0DF5D692524337AB7863A644245F GELATY
438,370,670 *2C6EF040BC4B5CB1BFB8E32FA8BCA809008F7E32 vanessa-schilke-hill
438,370,671 *2C6F0F0E81E6BEFCC89C81647B3C7192C9023402 divinoenatural
438,370,672 *2C6AD84DB114B71A67F3218C5FEE5EF4E9208A4F ginostoudmire
438,370,673 *2C68199896946A72B99DD903C7466A00AF53B02A vialuhin
438,370,674 *2C6C768A7D340BEBCABB37433CF675A460E6C8DF GLENORCHYDOCHRA
438,370,675 *2C62D9C4662313295BA6B3562630980775483F51 „gletscher
438,370,676 *2C6B2C43E7A692D0480EF5A3761E742A329DB930 [email protected]
438,370,677 *2C6F9843CA2B74341EC454ADDE7C8C4E562AC26B VIEROITUSOIREETED
438,370,678 *2C62651BDB350A5A666B59B2522DA86C859C393C god jord
438,370,679 *2C637A0043506ACAA161F71F23EF3DC78F3BD058 dominiquebisagna
438,370,680 *2C6F75066C0B4023253CFCC5A843A468AA78638C [email protected]
438,370,681 *2C605586621BDB2190781E959B3362CA1425DF71 goninde3
438,370,682 *2C6282926352752158430C02A3E4FFCA5D7B402D donna-jess
438,370,683 *2C64BB0C560B5EAB1B66F7AD75E0255597DBD17A don-quixote,-op.-35:-variation-vi:-dulcinea
438,370,684 *2C6C049B641ECF8559C7C93FFC9669990CA35E9A VITIMINC72801
438,370,685 *2C6C6B57E99935EC784C8E761FCFEFC5E9351C5A GRAHAM.GOSTON
438,370,686 *2C6768A1C822304F0725449D23AB7FF8DD47ABE6 VKKNDGST1
438,370,687 *2C6969207E11434690AAFB02AF312301CF1F958E DOUBLE-TIE
438,370,688 *2C660C8E2F668361662D40D209260DD8C05D179A Gregory-V.
438,370,689 *2C60D6F179923402ABE42A3694247E1758A63108 gregschmied
438,370,690 *2C6CF6159D4601CBC0992F134263BDE5BED8D254 d.!pk
438,370,691 *2C686028CBEA911D319C3579169D1D5877CF6801 VVMD
438,370,692 *2C61F63EFC8A5EFAE1AA20B6E7856FB9A427C670 GUILLERMO.DESBIENS
438,370,693 *2C63802B45D4CA5BE02DA976B5D7BEAD2522BC7D d.qnn
438,370,694 *2C631249A70E18896E5DDBE917E4C280450E525C GY|
438,370,695 *2C6976521A9C5300B9F4C3A7A8A10657826BF261 Walking-Distance
438,370,696 *2C6989C00C1980A27409602F299EDCC8B34DA938 H0508962696
438,370,697 *2C6455AAD2FEF64A527472E724C04FD9BF3D3226 WALLACEFREDIANI
438,370,698 *2C61CE0F0ACE96F4B4A2D3692101D7B3DD393787 DRPQS
438,370,699 *2C66F3E2EBA7A9CB71A8F98947D6C264403A0A1B DRUNK.AT.ABI'S
438,370,700 *2C65D5A44C382E90EB5CFC0573E648227824B2AA DS!?C
438,370,701 *2C677614EB6830F4100A0194DF62689F22D32C81 dtdpa
438,370,702 *2C6112E5C2F9C8353A1A368282A6DF33FC84AE73 wayne-woolman
438,370,703 *2C69DC569D1441917B3111D5DE3D092342F2238B wdoctor3
438,370,704 *2C6F4CCAEBEAEE9839172FD0DF90ADA1F188432D [email protected]
438,370,705 *2C6A8E7234AEF8D32563DDD21D33687AE0F8A44C DUIKERSLUIZEN1
438,370,706 *2C6F17C2A864E6C24AC1397301B5EC520F455188 [email protected]
438,370,707 *2C66D5B1F8DDB1D6D222EF2C2E2684A41778C693 HAWICK
438,370,708 *2C6642A7420AE2D8B091B0E4751029575094AE29 HEKMOTOREN1
438,370,709 *2C67659D7BED01348280682D41DA691CB9E1A0F5 DWLDM
438,370,710 *2C636D65E695116B5BB51DDDFD140BE12318577C wilbertdegunya
438,370,711 *2C6407A0E4BADD78703104DA68EEFC0B6AD419FE WILBURN.SAILER
438,370,712 *2C6D1A229E19297438CEFDC7BB85A50059B02609 [email protected]
438,370,713 *2C62D7A64E409E63A5CE48A8E154BAEB13300F9D wilburpetersen
438,370,714 *2C653612FE3C474B0D97A581B7C01AF9592EB427 william.van.loggerenberg
438,370,715 *2C618A8E8E9A385311A1636355096732FEDD36FA WILLIESORICE
438,370,716 *2C6BF93A1659ED26A63BB26F97392F7E1AE12D3A WILLYNKALEIDAY
438,370,717 *2C66E3AEA686AEB06FEFC630AAB84161788EF360 WILMER.BRODNEX
438,370,718 *2C688844435D57210F71D96BA225C424FEE15846 wiltonschlueter
438,370,719 *2C6D970311F1F5A923111853C29E662DF2136B36 EAKAZIE
438,370,720 *2C6EED01D6A2C26BCA15FBEAD846A3ED671956BC ec1a%
438,370,721 *2C6EF0D16ED0A6EC55BD5E4147765463BDE7ADBF HOPE(UNRELEASEDVERSION)
438,370,722 *2C636910172B2EB06547BE95563CD4CDCFD1A3B3 woodrowkutz
438,370,723 *2C6831ABCAAB03B4833E9CBA63137ECAF270AA16 woody-short
438,370,724 *2C64C30691AC3EB84D0C8CEFFBAB27F1C053B466 hotspurs
438,370,725 *2C6ED7640F52E0BC3756509D3C1065D98C2950EE WOWOWOWOAVRIANSYAH
438,370,726 *2C694D54EFF8B84C1B57CE430C36BF757A544277 EDDIE.KARREN
438,370,727 *2C68DE11A5AE492026CFB967B9996040DDE691C0 hoxy
438,370,728 *2C6083C6849DD1A5A4A614F0DE29C58E3E0EDDD2 HROMIJA
438,370,729 *2C669B145EE4B39AD55B8A585729AC64406DDFCE [email protected]
438,370,730 *2C6CD4248EB2C243404ED4D97843CD2B9DE97F0E WWWBALONCESTOLEONC
438,370,731 *2C672A9F8EF6E24BA0214924865B27C5301D7B73 HTTPWWWSMSORGAC70R
438,370,732 *2C639761514E22ADD74EC33B0BF7CD867236255A HUBERT.LUNAN
438,370,733 *2C673D87DB79ECBF8EA7445B516AAA26CDC10F47 HUNTER.BOSTEN
438,370,734 *2C6FF66C13DF2BD83B6BCC18215C5F85DCC11B94 EFIFYTPD7
438,370,735 *2C6EA1BAF1F21E78324C2F9FC53B7B2ECDBE7E1D EFREN.MILKS
438,370,736 *2C64D9E79C3E592EAD7E7776306CE4F1F76660D7 HY7Q
438,370,737 *2C6A7C3766B6F8CD161F445407C03706C5FE3013 iamasdfjkl16
438,370,738 *2C6BABE5D2B4946F6737733246DCFAC503CE4470 eiwa,
438,370,739 *2C648391F8F95BB7389492115D34A0A904B83F88 IKASESIMING
438,370,740 *2C691259C7769AF9E9397D424A2D3BB1D34DE70E ELLAMCDONALD
438,370,741 *2C6AF6AD46F8B9591069E0108C54933A2188980B ILOVECIRRUS777
438,370,742 *2C676C09F1350A19BF43A4819B84488A9B131AAF ILUVBLOWFISH8
438,370,743 *2C64CBFF13AEA2AC37BC90130C018384043738B7 iluvsuperman2009
438,370,744 *2C6D58A7E1D5F9F253B1089D1162FDCD413DB9AF EMMANUEL.EASTERN
438,370,745 *2C6E98D1309897E15EDEE9A2FFF66C5719B751E2 IMBUSSHE5
438,370,746 *2C64955D870C709DC20684A5F408F880C02FF84E employeeAndtelcopeopleliveby*speech*--theylive
438,370,747 *2C61AD220DE2A7984F1060D3415F205F96C69007 ybppzytn
438,370,748 *2C654189B770C51C76B884614515CD5354185DD1 yeseniaramosvillalba
438,370,749 *2C623B9AA8A34A8A3A5BFAAC3F8788061C939D70 [email protected]COM.TW
438,370,750 *2C6C9AFECF9F598CD67332D1DC29EBAD9DFFE74E YLDEVRATED
438,370,751 *2C6630FA9ACD3D23E8786AC31A5BC21034770B25 EN1AJB5F
438,370,752 *2C6673D88893B1EC3905E94269FDDE54E0FEE8E2 INGEVLOC6
438,370,753 *2C649D1D8E63505B6A360C16B04E6F2FC8ACDF7F epf+5
438,370,754 *2C6F521A4818263DAF8297E398C3CD29F328935E [email protected]
438,370,755 *2C61B233499D329BB5E402AB60C6B8B37813C7A3 erasmocovelli
438,370,756 *2C69BCD9A69AC7AB5443A6014DE5E09FDB1A44FC erichschwemmer
438,370,757 *2C6D01CC61C705B0BBD2B73A6339E9D3113E0D09 irvinroanhorse
438,370,758 *2C6CFDC7AAF462E91136BBE1B6C3F12824431E43 ERINOMI
438,370,759 *2C601937D09F4C901B404F5E72886F0F62BCE0C0 ernch
438,370,760 *2C6A102661CABB9616D0B9538BED9B552268BA51 [email protected]
438,370,761 *2C60626968F00C8F89581D06CACE3C2BD645B8CE esereht6
438,370,762 *2C6C767D73EF66343E7069B55E66B6F4330C9E1D est73
438,370,763 *2C6DD49F9630007237C3E15268250C96CE122EC4 ISMAEL.TORAIN
438,370,764 *2C60344256CD72CA9561285460D9B682069E8826 ESU:Y
438,370,765 *2C6B8B187728C7119CCA72A17B31332F0D3D007D IWANTABOYFRIENDPLZ
438,370,766 *2C61229ED8F7D1ABD8BC18F53FC3531CA4323D29 EUSEBIO.JEANSONNE
438,370,767 *2C61775E147AD3F4892FCD40E4AE8956D4A7FA13 euwz3
438,370,768 *2C64A1E8F2FEC148B5EA4806A6B181830BF9EE03 JACINTO.WISCHMEYER
438,370,769 *2C657FD9F166766E4C34146A6675559EDDA2DED4 JAIMEBYNON
438,370,770 *2C6C4A5006CE3B2F6CFE31A14CF014F898ECE140 jaims418
438,370,771 *2C6C95955388C919C506056ED5F84661C204207A JAKE.YANAI
438,370,772 *2C6A794B5D735149C77FB3E1EE0337F033424894 JAMAL.FLAHIVE
438,370,773 *2C63B6664E99A86225FE8759F8671AD151DFE8E1 EXPANDINGVOICE
438,370,774 *2C6F3383C8E3D17441D9B8D186D7D2F1463F7D50 [email protected]
438,370,775 *2C65161DDE7CFFF770D8971CD00F31827750A6EE JAMISON.BUKOWSKI
438,370,776 *2C6F49C90061B3265BFCC1BB723767EB491613BC JAN.ANNIBALE
438,370,777 *2C6633D3DF68F668D74DAC52E1F21972007508D6 jarodburandt
438,370,778 *2C6EF2BDDFD1B1B14B7B516F459E73A4C447069E JASPER.LASSER
438,370,779 *2C6F2FEFEF574A9EA2481547C7D1B250C1F43B8C JAZALE
438,370,780 *2C61E67B6DCB20F78123FFE8B821C45A00973CE3 F19910629
438,370,781 *2C651C976F44AFF9D114FADB3A81B3F21380CC8C [email protected]
438,370,782 *2C6FF5AD3DB7BD6947FB4202074FFB4A2C2684DD zina.matloob
438,370,783 *2C6B884E0333EFB300CE7232450BAF3064DD6345 [email protected]
438,370,784 *2C6FBCB818C3987A62B1D42F9C259CA5C6FC4745 zpfs
438,370,785 *2C6C09DE7AD63F7F313E9342DBC109F93B0781A2 JGF<
438,370,786 *2C6F4F95109BAE219CD48C28A3336E99AEF448E7 ΣΗΜΕΙ΄ΝΟΝΤΑΙ
438,370,787 *2C6FAE3002ED2F3D3C37A7B71A69AFB0A40EA7BE [email protected]
438,370,788 *2C699EA378308DF223B86D7E6494DDDCDDDBDCE2 φλεγμονικέσ
438,370,789 *2C675F4D48ACEA37DDF312FCE4B69011C2212376 ΦΟΓΚΤ
438,370,790 *2C61EDC3A0031EB78500F86D5A18B75F3478ED7C аванту
438,370,791 *2C647B4EC7780A832F791547D8D65AEB0B160FCA FESTIVO0
438,370,792 *2C65D33588470720077F333A9C92514A1E357F81 JOAQUIN.ELBAUM
438,370,793 *2C6FCD6F29531685D95A1A32E81DC029C1D74FCB FIDELBASONE
438,370,794 *2C69BC33706603F54C4A63C6F37CDF1CCB66DAF9 JODYNUSH
438,370,795 *2C6A9547D8B810B3BA4588671243A1491FBC4377 joecaverly
438,370,796 *2C685C19360FDC47B484832D7300693A03F3C18C БОЛТЛИВОСТ
438,370,797 *2C6C53E08FE83002F8D4002C82C2DBFC8D6024DE FIERYTEM9
438,370,798 *2C643417749FF362B27221D1EB9F50EFE7C2D2F5 брониславским
438,370,799 *2C6A49B31C536EA6F13D9639305A15ABE76EDCDA JOHNATHON.SLAVIN
438,370,800 *2C699551138C6AF544F53030FF0AAA9A40F65498 ДЭИГЛ
438,370,801 *2C666E3251A1BAB0A4B10F6867E10AFF006A4B7F JONATHAN-CLINCH
438,370,802 *2C6D73A2B2B01AD52AC010A324EA1678D9ED04AB florentinowhal
438,370,803 *2C642C5006EDD95138C146F66895148E5079A1C0 FLOYDLETSINGER
438,370,804 *2C6D6301EEAF0D20C0C2DD4F3BF199CDAB66CAA1 JOSEINNEE
438,370,805 *2C6AB527A482FDE6C8BD1AEC383F9CFCC327CD16 fooglebizwww
438,370,806 *2C67A998603CCDEBC53410121DB87BE05A3185AB [email protected]
438,370,807 *2C63C6015E63488FD84FECDE0C9A09F6F4BE611F JOSEPH.REMPE
438,370,808 *2C623C9E0950AC9BAA4692C25146F1E862E8AABD for the journey
438,370,809 *2C6D956A2A5F3A2BEA91E4C61FEBC3033015B704 JQUC/
438,370,810 *2C62AF7932885EF87E0ED374FCB5B105827F1F58 ПОВОЛЖЬЯ“»
438,370,811 *2C6B916F58772972DC20255F869ECD716C4F9E1D JTAKIER
438,370,812 *2C688F01EBAD610D40F773348F2F55E5CB4BE59A francesostasiewicz
438,370,813 *2C6539E0EDD39752EA1C99A363ED5A629D45788D JUDY ST LOUIS
438,370,814 *2C6A10636132B833C56AC6CA3CEFD9A4727C97DD juniorlafave
438,370,815 *2C63A5F1CE6C809EE16A9D1A70340145703FEDFB FREDERICK-LANG
438,370,816 *2C633BFFA7185F5B5CDFBB7D1E9FDB51E662944D [email protected]
438,370,817 *2C6E7DEC7D571BC00EE64B2E2ACFCAFB899CCE58 FREDRICBERY
438,370,818 *2C63B509A4414505A18286EC1CD013F43703E762 ТОЛСТИНСКИЙ
438,370,819 *2C68AAAC3734B0836FBAA95477CC4A752A08ABC4 F)S:
438,370,820 *2C62A3CB4EA024C88121E88246EAB744AD87DED5  ТУТУШКИНОЙ
438,370,821 *2C68C9C0BCF0D9C8E109DFE9178DEB6FA70C969E KATSUKI
438,370,822 *2C6E3C85F32386FCD431518A5575F2823746E202 KENDRICK.CORELL
438,370,823 *2C652F9DB965CA4B1795D6001E26EE761A6871B9 KENT.FRANCOIS
438,370,824 *2C6E8F8F1260EBCB2B8BD4FD066068C051C68D23 game.show,.game.show
438,370,825 *2C6BB73AFC877E0F904389C8C6B23A85E83DA1CA KEVIN GOETTEL
438,370,826 *2C64EA43D4A03119A0D9A9010705598178A775F4 gargantalaolla
438,370,827 *2C64ADA2D4BB41F0268428A8DC21657F1CB1D425 khoekhoegowap
438,370,828 *2C62E37942AD37B5360FCC1A59DC198EB7ACE754 KINDERSZENEN,-OP-15-NO-12-"KIND-IM-EINSCHLUMMERN"
438,370,829 *2C66CFC91CAFBE23AB74B55446CDB039552CCCAE GARRYQUILANTANG
438,370,830 *2C63880D82123718E782B5DEF8FD2491332E29F1 garthreiman
438,370,831 *2C693C3CCD3B9FD56B30B66466D657098DE1557E GARYFERTITTA
438,370,832 *2C628B2DF95BFFB2DFE0F823117F1C61CCA85B01 gator'sgrin
438,370,833 *2C68B8B99CAC09DB32EE1896317017518377C603 KJORNALES
438,370,834 *2C64C57AEB30D391C0E22059F312BB05211C6605 gaze-following8
438,370,835 *2C690B2819EE6341A280C2414551C6728B361F95 GEDEPONEERDEN2
438,370,836 *2C6D2892B0E3B0D09B4CFAE5150F43E48C5CE32D GEOFFREYVARKEY
438,370,837 *2C6C965213A697286B85DB53352DBBD1DD14FE92 [email protected]
438,370,838 *2C64DFA0317038BB5F42358C0D2F5BA1C3955BF1 KÖRTZ
438,370,839 *2C63560C3D8F97DE79B8B540F213B1F0B8D30969 KOSECKIJERZY
438,370,840 *2C6798BD359AF8BB1BA689ED54EEFEF958D8DF26 KRISTUS-VALO-VALKEUDEN-(JESU-BLEIBET-MEINE-FREUDE)
438,370,841 *2C6EA8032F533DAA6CECF7CE147EB832FE8F66DA ktzo
438,370,842 *2C62800BB837B2EE0CF7AFA86C18B6CBD4F3EB16 KURDISHMOON
438,370,843 *2C6E931E3F9822F7BAA4EDA8A3A7BD361E17F443 kyan329
438,370,844 *2C69D1E4E459FBF37A605D22C96477DA83D81C8F L"A!
438,370,845 *2C6C9CED2FDD39C245F09B0A14D3AD669D3E4106 GORDON.KUOKKANEN
438,370,846 *2C69713BA6AFE9CB97BA578D55F1CDDAB92F77F4 LAMONT.SCHEMBRA
438,370,847 *2C67BA442F11929779DDA472D5C6ED821ABF99DF gottheguts?
438,370,848 *2C62C644CED970C4E0356C2A82C029A7E47831DA GREBENAU
438,370,849 *2C61421421922F27072B5E74983B7D88649C4532 LAURENCEWYKOFF
438,370,850 *2C6B10DCB573AC749CC0F2170A6442CDCA416B3B LAVERNEHEVNER
438,370,851 *2C683DCBBA9729872736549238A811808886D35C GREGORY.FRINK
438,370,852 *2C61A688FDE47C2516664B4103E3FB0DB6DECEBC [email protected]
438,370,853 *2C6DCD41427509C3CE10DC29C2FFBEBB998C0575 LEAFWOOD6
438,370,854 *2C6F8E7F30241B84F719D30F9FBF961327CE335C leeutka5
438,370,855 *2C6546A9B9F7EA61F19EEA16B33193178510673D LEONARDGRINDELL
438,370,856 *2C6E069CFBB981BD6C60B60E44502EBBA13E8468 GYM07
438,370,857 *2C600503868756CB05548F5DD64FB9EEBABE3C5B Gz>
438,370,858 *2C68B09DD64C56200D5CE7D111B5C2FCF5F85444 <LI>BRIDGE.K.TABLES:.PORT.3--&LT;EMPTY&GT;;.PORT.4--&LT;A&GT;
438,370,859 *2C6AD364220C4255307795BBFBC41E496A20FBE9 HARNEETSACHDEVA
438,370,860 *2C6C3E67E3516B8A1C2DC2026817FB15A07D2E71 )が開発した高性能なa動作弁
438,370,861 *2C690FA8803E7BBC778744F7BAF2500CAD2418DE HCOLOMBO8
438,370,862 *2C6866CFCBB05F1E38CC84B4E909E1092ED4F017 lionelmesenbrink
438,370,863 *2C698464DDD6FA7C26F410EE9078B1E2BDEB0919 HEATHER-KESSLER
438,370,864 *2C6719486C5B0089D12852A35617B42A9D859229 HEBERTO1
438,370,865 *2C68455636EB6CF119C8FCF3B8E7BB9C2AA24DCB Little-Pieces
438,370,866 *2C62BEF6A1C6BAB61D7DF62A8BD1F12086920686 [email protected]
438,370,867 *2C614BCEFB436AAF43707540EB5BFAAB10CB9A91 HENRYZEUSING
438,370,868 *2C621A1F9D078E0EA8081D9847D45F6DCBD4A937 livxcg2yhbw5v
438,370,869 *2C6C2E6700EB8AEFBFACC17AEA7C9B297FBB1F19 HFDNDLHDR6
438,370,870 *2C65275508BA731F883EBA81D90DDB3BA2E27A0B LOJALNA
438,370,871 *2C6EE6E0612AC9636B3F5A8C60E351B8CFA57D7E LONNIEATKINSON
438,370,872 *2C6D1CD6DFBF946EE815E711379F19A9573DA3B5 LORA.WALTON
438,370,873 *2C6D2521CD51ADE4DB798CE398EB7FEBD2B5BD80 HISTORYOFVICEROY
438,370,874 *2C60F8CCC18147F43008994F2F13B27FA2190DFA HOMER.ESPANOL
438,370,875 *2C6B5D5C644105754C236912898C3578DEC2B1E6 096ELIZA
438,370,876 *2C695D9BFD00FB22738DFFA0CCEB67FA30893E24 howardwahlberg
438,370,877 *2C60B8D4F8F1CAE044B9D1AD4BBBB53FA7644107 LX:T
438,370,878 *2C623E580ECB1CAD517FEB347DEBDCA97F13E890 hunter_3
438,370,879 *2C62211CE132FD6B33883787CD7D135470229B86 maha.rehman
438,370,880 *2C68B8D36325EB61EAA8CF77B5BEC42FF9CDB137 majorsleaford
438,370,881 *2C607D462FF574F274444BFD7304FDCCBF001ACF HYPNOTISEER8
438,370,882 *2C6DCBE138812DCB7C85D9E47E75329DE2C50A7D 1786605 even-worthy-ideas-may-be-declined-
438,370,883 *2C66DAD7260BAF6574A5E31733D5A6A5B2788537 1836218 kukaanmeist
438,370,884 *2C66FA1D6E8DF3F3B73CC886F284CA7F7EF63957 MARKUS.HIBBETTS
438,370,885 *2C6A679096730AE695B9556854CC86E652405481 MARQUETED
438,370,886 *2C64517D5A33FAD7767C70D5D4F7788805DB41F7 ILOVEHEDGEHOG2
438,370,887 *2C64E42E09CDE5B5B28C8AD08B60846CC1C8B233 1 ABIENKIN
438,370,888 *2C6581ADFA4CD69FC1EAC73127ABE11FF0C0316D INCANUS7
438,370,889 *2C65BBA900F6112F90EDB0D92E445EF8A2657825 mayhemming
438,370,890 *2C6341AEDA922E2994E1AA03BE75A9C4161EFDBC MedleyofMathilda
438,370,891 *2C6CF2248DC6F8E6C38176AA774FA40A40612009 MERVINMEGGETT
438,370,892 *2C678E4EB0416AF25F21B2A9F341FFDFF2545E54 MesseinhMoll,BWV232:Ia.Kyrie:Coro"Kyrieeleison"
438,370,893 *2C6F642D1504C065A572539D5EDF4573C2B2C09C 1kamleika
438,370,894 *2C6D4B34CE2BC3D024194AA69A8052F735DACBB5 MICHELPOLSKY
438,370,895 *2C66DD637BDF9A9DB49E8AF9220BB9BEDB0ACC11 MICKEY & FRIENDS TRAM
438,370,896 *2C6DBF95B6494E651FBDE50401B98D5E0BC55A8A ivorycaneva
438,370,897 *2C691051928AD45C1C8560F535628986F92EA33B 1 PELAAJAKAUPOISTATULEVILLA
438,370,898 *2C6DEFE1A44D78B9CA4033EC55318D9B0CC28135 MILTON.KAAWA
438,370,899 *2C6A9A646842FF9EC0C58DAF9CBF186947D5E068 MINEUI
438,370,900 *2C6083648A786371EADD0C620E79ABD38D4CBE21 MIQUEL.DEARMON
438,370,901 *2C61246D62869207AB03FDDDD1111447183BC0D1 MIROCAT.COMWWW
438,370,902 *2C6CC1BEE720AFC643E1E58CCB63BE4049CAEDC8 1-sarin-anschlages
438,370,903 *2C616C1CA5EB28F56BECA1771BA6A2F98817A224 1 SCHAFSWIESEN
438,370,904 *2C6AB1BB2D7D6158F89B32E2966094A7E872FACB 1seulasto
438,370,905 *2C653620C11CF81938849344C3BD9E7A800D266F mixodectidae3
438,370,906 *2C667E388405CFD3232E9BF92B937DB93A5BD5F3 MODESALAH
438,370,907 *2C66DE22DE89EAB46B4E3C7FAC0C65A2F7A60B7A 1VERBANDSSEITIG
438,370,908 *2C6109108E61076E20A6B4B565ECFAB8F68983D8 JAMEYSHAY
438,370,909 *2C681B8A1F2F1D2AA993B3EA36743655A8537736 jamoslovje
438,370,910 *2C6C17705AF776CEB6C3346FA64498CBBA286E46 「MSM7500」に対応しており、KDDI並びに
438,370,911 *2C633928D488A2A23EAE6A6DF024D4C808C7E3C9 JARVIS.COLDEN
438,370,912 *2C6A483E51E9625E4F3F57DDE07C5F2701838A80 mtrouets
438,370,913 *2C632EC11719E59FA0B9573EBFA2103FB840987D [email protected]
438,370,914 *2C6F49E0F61A4156F9DB55E48B019B9140AE3D3F MUNCHEELS
438,370,915 *2C68464D1FDEDDD9BA91719364CEF82EE4B8823E MUUTAMALTABSW
438,370,916 *2C64BE3898AA7ED9F8DFFFC1DD9DE557A5F12D7F mvpwc.usace.army.milwww
438,370,917 *2C6A77AA85C7E08CF21D2B9DA49DB814DB60FB3E 237802 rakennus- ja kunnossapitoyksikk
438,370,918 *2C61E6DB68DB81AC6C038E1463EEBC242F78D790 2628681 thisislikelytoremaintrueintothenextcentury
438,370,919 *2C6850FA9035F81CADB65A416E151D98718ADDB1 2740283 er-arbeitet-an-der-stimmung-
438,370,920 *2C6BF9F0FD89D962718D986E559A48E53D3D05D7 JERALDBAGNI
438,370,921 *2C6216E553B3BE8514363A23E58134CFFDCEE15E JERO4590
438,370,922 *2C687E6FC65B82680DA2D2520D7025B92534B788 JESSIE357
438,370,923 *2C6235325A06D39B66A45A82233D8CDE79EC7896 2f6288084
438,370,924 *2C6A3AC2A211846816FBEB796C45D94E97E953E9 NEGOVANUL
438,370,925 *2C678D6F8B2355A16A27F264AEFE9FC9B9DD4549 2-SCHEMMEL
438,370,926 *2C6E8F42FEF8B7E32B4FC0F6E9B38AC62E9C6655 n"fe
438,370,927 *2C6DFF278633FF41DC08D36AAFBB73FA695F147C JONASBREW
438,370,928 *2C69CB64B183EA895F2B8DA1C0A477E0662A600F JONATHAN.HORNACK
438,370,929 *2C62C7B9AAE621AECC3964039A329BD3F9EBBB90 jonkurt
438,370,930 *2C612F0995C3CA832E21FF45A23D904881CC976C nigelpotaczala
438,370,931 *2C6AC80A33A4D6B0220C3DC34C77CDF6FC332930 nik-nazri
438,370,932 *2C6157AB3126B618910F65D6783EB5481511552D nikola-drca
438,370,933 *2C672FFC0DB4CB283F3D825DC65AAE142E0D4639 JOSE-MARCOS-RODRIGUEZ
438,370,934 *2C6DDDEB9FD4A4FE3D6830425AD078F56C3E760C 3-chihuahuan
438,370,935 *2C6D95B7C8084C12227798DCFD9E754C2BA08CC6 3-gattinen
438,370,936 *2C6EED833D2FECD40CB9903041E5E2AEDCA13B6F 3hepworth
438,370,937 *2C66D8558763C8ED7EB50C19475376629AE1CAAA [email protected]+es
438,370,938 *2C6CEE4468F33047D074D50F22282688743574A5 noelpaull
438,370,939 *2C679BD54DD865E7304AFA7FB99795A391B3EC6E [email protected]
438,370,940 *2C699873DC021215781B05BE77FB39F5B332204F noncontributive
438,370,941 *2C61DC785394FE5DD104C56A23B2195EEFD8B011 [email protected]
438,370,942 *2C61DDA19ADE2F33956621D9348E0F753AAC8215 KANKEUTTAA
438,370,943 *2C6E701D3FB31CD68F727DA66C1C234329545466 3VYDLILA
438,370,944 *2C6CF8C6E0B417E3665AA6F75D2019DDCFE959FD KATYWINDETT
438,370,945 *2C659575A907C3FD293A7EA6AF25AF408D9A121D 411lilia
438,370,946 *2C6AF5AFC92D36128EAEA6E76727D2D86A2ED786 48.kokousten
438,370,947 *2C6B624AA54ECF61AA804DDF046B6535E39D192A NV3STGAT3D
438,370,948 *2C6D35BB83C2674DB2EB03425720D020BC1C39C4 KEMPARAJKKP
438,370,949 *2C69F8A249AC35D03F879ED5DDE2D48AAA93A53E )o( 0~ q====p
438,370,950 *2C6C50392D4CB558A157A6D042331C9741028916 KENTONHOREN
438,370,951 *2C6D9F5A522AE5E0E58EF6DC35146A60F510F180 Kentucky.Moonshiner
438,370,952 *2C66E9823312EF00C90AE465A2A010E9E9D42DDD +ODE4
438,370,953 *2C6478E322DB1D0917154F013551F7EFEBE76349 odellnikirk
438,370,954 *2C667032E4928F1F4B321CF1A56F2BF1A9B01244 odellthornberg
438,370,955 *2C62C1E7486059AF3CE9E16E90FDA1F76632DDB8 KEROBERUS08
438,370,956 *2C67C4D9A7AFB4D3EBE6A5117235B70A5054D5C2 KIELA.HUDGINS
438,370,957 *2C68743D5B9DB8E90FE3737660276BAC130AB213 4N7!DO73$
438,370,958 *2C63BB406FC03CD5D32D2244E09879E2D6EDBC2D KIMSTIMELING
438,370,959 *2C60DD516252763E550DFAA80E82B0C3473979A3 4SARAHANDREW
438,370,960 *2C60655CF3C7B9441A71B2C972896814F84A69A1 klm4805편의
438,370,961 *2C6C309A3F018C01522BC8284525E665FCA7CB29 klutz-inc.
438,370,962 *2C6622937A6EB3B20C711EBE6083C9C3F7FA9952 OLLIECUSANO
438,370,963 *2C6BC6E97CB3A6156EB85141CF26768A437B7604 4WANGRBSW
438,370,964 *2C60D881EA8BF2AED31152591890465FCFBC28A3 ksff8v
438,370,965 *2C616253519CAA87684F5C53B7C8B3AC67310A0C KUBIJOVIŠIN
438,370,966 *2C68E4AEB14926E6EA74EACBE89B1946ECC5599D [email protected]
438,370,967 *2C6928C90E62F0650ACBBCF9D4290A3EF61264F8 k,y
438,370,968 *2C624D8FBBBA7EC308636F5DE85E04888DEC7445 5BORRIRE
438,370,969 *2C6D5241FF72DFB1FF16F4297C7193488BBCED7E osborn.communications.corp.|.united.states
438,370,970 *2C69AEC25758008736D1AC042267CE7EB053BCF6 5FAITHSPARROW
438,370,971 *2C612FA55951FC01ACBD10C2436D60D4215B5EE7 lane-i-prijatelji
438,370,972 *2C686A197C8F28DE96A67E46D404FBBDDEE52F57 5mes'uldur
438,370,973 *2C6D6235F20DCBF12DC67317D2CB13368B9C4135 P-----)~`(^_~)
438,370,974 *2C6A9A9EE026F7BFC56CD2F3B08BE7FDD2FF92BC [email protected]
438,370,975 *2C6E931F547152E9128B675CC228120889E17C79 [email protected]
438,370,976 *2C6B0F89E20C1B355649EAAC946A1C7E3D5BBE42 panoramalarinin
438,370,977 *2C6F58B78CAFFB67675A08A0F77943929C376795 leonardemeru
438,370,978 *2C6CA6A3ED537C9773997D67353CE459D6140AA8 5TAFELMUZIEK
438,370,979 *2C6E716A414D0CA217C4A98E7ED5D3432A30149A LESLIESEAGRAVE
438,370,980 *2C6DEA44A042ECAA972AA20954EE8311ACEDB44B PASQUALE-PAT
438,370,981 *2C6C6254940BB67FC53FF225ACA0C7FC0533B73D 685964 tUm-faliyetlerde-etkin-bir-kontrol-saglar-
438,370,982 *2C6127E83F824B9500F152357032AAC53EF28B77 6-ARVOIMAAN
438,370,983 *2C6C9C89AB3D98264334E24DBC909F31850EEEC9 peda7rcan$
438,370,984 *2C631FB4FF29CFBBBCAE701E3822476C3C1F916A [email protected]
438,370,985 *2C6296BB7570F44BF2C218B03706E4E2568C1D19 [email protected]
438,370,986 *2C608389A9A3B44AEDB014854B1C6005F7CB8D09 LIONELPERODDY
438,370,987 *2C6E9FBAF2D9A313BD8EE2D194E73B4AA46888F8 6GOVERNMENTSHIP
438,370,988 *2C6875382A69B08FCFE836A681A4CE7A64E112B7 PERISTA
438,370,989 *2C6016C2DBBB23013A23F4253D5C60B9575BFE52 PETE.WERMA
438,370,990 *2C60B2E97DB1F7660607AF1ED1788FB9AF3C6E3F LKSCHNN7
438,370,991 *2C68748704134565CB4B667F9CF36BC19AFA7728 6SAMPSONSTUDENT
438,370,992 *2C6221D555AFFBD1483AC43E8444A1D05138C253 744122 molekUler-biyoloji-ve-genetik-1-
438,370,993 *2C6041C95F2BB452C8FEAAA375E9C8FD03D4484D 7BSWSITELIST
438,370,994 *2C6CD1DC9BD521EE637FEED7A61E0C7A95C4D52D [email protected]
438,370,995 *2C674BCFE62D28C7C24641D3612E3C51C5AC9E24 poterono
438,370,996 *2C6FD207FA8F1004B2764F4ADA4BD2A392BBE4BF LUCIO.MARIO
438,370,997 *2C6E7DA04280022CA2BF89C24BA81715BE8098BD precompliant8
438,370,998 *2C6F3AD5A9D1C75359B09B74A024576F6E0D9A56 priyeshmalviya
438,370,999 *2C61D483010D555FA42CD89C99CD4765422CF18E [email protected]
438,371,000 *2C68C44A2DE8F18BDD24D6BE7117D7B7F43A277C M:
438,371,001 *2C65D5C045446C56021F53F0519E33FA894C1401 M!]AAA
438,371,002 *2C63C0253C7E9D815FFAF98D81774F6D634B23F0 7VERTUEREZS
438,371,003 *2C671AF6ED56A24891CE4808779EB08D35E5C0DA 8BALLENJONGEN
438,371,004 *2C624757525978F46CD8CEAA537F96665793EEE3 8F47E815-9019-3B3D-A613-195F40A58B37
438,371,005 *2C679566D37D0AF7BAFAE8A462651C9E0D76E1B2 8OTINREHC
438,371,006 *2C6808FA8D2394F7A9D79F358858252CB1BA051A 8RHONDAPETEY
438,371,007 *2C6AEDB2CB134197063CB638F9318E07054AEDE7 raphaelstenson
438,371,008 *2C6DA800AD9CF15AC9293C52C272B6C4F0A6EB42 8STZECNMQAOMHF
438,371,009 *2C674B276715A6F50E5BBFC27E49709D2CFCB210 RAYMUNDO.HEARNE
438,371,010 *2C6C71DC723A8DB768A0C08A5770656484769BF3 9FROGGYICEMAN
438,371,011 *2C64D012D2806F4ED5B16E86A72420F6F1DBFF40 9GORBONOVS
438,371,012 *2C6A0EB347FA57A6616D71F757652D2F1A4963ED [email protected]
438,371,013 *2C68CFF59B7F38AC2918222FFC143A57F8B98954 re1nfec+1ons
438,371,014 *2C66D855FE9BC23D2F2EF853F4EF25A7FEFFB4BC REARGUMENTATIONSANALYSING5
438,371,015 *2C6CF12B667CD762FEA379C2C7ACAEC11CD0590D 9LANDPARKPARROTPATCHPATCH
438,371,016 *2C6D167F22383C5C65B8FD3621A121B122006F00 AAASR
438,371,017 *2C66E653597A9EA59BD87B936B14B82B10C8ADEC maynardzombory
438,371,018 *2C6DD751793FB864784C0F87C2330AF6A75D0272 AAAY)B
438,371,019 *2C67DB1C82090598E1971F16B67C1D58A22FDC19 AABEF
438,371,020 *2C69E53E07807BCB93397AC491274B4278E70D67 aabww3
438,371,021 *2C615AFB40BDC3B0C8F62095BCBF3E79A3363F0C aae^z<
438,371,022 *2C6D8790F2B6154F040391918E5C317C9555E3AB mercy.melly
438,371,023 *2C6B47BF8DDC42D3680C4CE4979B86DA5B9AF467 MERLIN.MODISETT
438,371,024 *2C6C8FD8AA7454F22F5A42EA93BA593B7B783831 aanleuningsping
438,371,025 *2C6E90370A593FD37ED2BA52526929FCFAFD1D4E MICAHNATIVIDAD
438,371,026 *2C6E2B12E884F412383A4C4DADA46EF1AA518568 MICHELLEOVW
438,371,027 *2C6BC51B867F6EE5D4849B6B95A157E4317B6806 Abusar-contigo-ma
438,371,028 *2C6C15A8EF31BA7A61CEA7F9FFFB5625AF74FA63 ACCUCCHIAVA
438,371,029 *2C6C23519B5B73DC0A97B9EF453540408168341B act: ii. scene 1. viva il conte!
438,371,030 *2C6AE8C4C8CACD4F36DA43660FDE56BFDC972640 [email protected]:MIWIMI
438,371,031 *2C6191C601F464270921443D722B6EBF8A107999 adenocystomatoused
438,371,032 *2C608ADCBBB89D297FA941E8AB0A26D8BB39EA1D [email protected]
438,371,033 *2C671E8625CEA32FFCA8DF29678280CC38A1C368 ROBERTO.MAYEAUX
438,371,034 *2C688A382AFE0360AF154A975F0421FA5FD4B062 MOIRA20
438,371,035 *2C6BDBA426610C47DC7C1DA84A40C61D66CFF8FD MONDJAM9
438,371,036 *2C60CE7955BD3FC22DDB04F3F81C7733E2762947 A&EK
438,371,037 *2C6C267FB61AE103A0B31B361395787F9AF92C06 [email protected]
438,371,038 *2C6EA6D300E0386A628D44F332CBA4AC55ACA1F2 ROGERDIFFENDERFER
438,371,039 *2C6F27C56753F3F46DDF6ED5EA4C504BCFAA2225 rohan.burgess
438,371,040 *2C6C45DB30265A569B193DE7DCC10091224FB7F2 AFG#T
438,371,041 *2C6308F2608267F1BB09ACBED78848B5B064B60E AGAVOSE3
438,371,042 *2C6DBC1B1FF144D8F06B997650FDD4F8F38AD0EC mudpaved
438,371,043 *2C66D3CC6295DE7C656A3984684862D9B385238F RONNIEGUINYARD
438,371,044 *2C6DC244D971F3488A9DE419E92A3F4DD010435B MUSIC MAN, PART 2
438,371,045 *2C603751CF280006A8EFAD055ACF159FB9CEF96A mutubambile
438,371,046 *2C60B420C7D498A0F364126E8B1CC7302B8A0B9F RORYNESSEL
438,371,047 *2C655F64CED2EC1976F1E5B25401DCB99F3E6F54 agn()
438,371,048 *2C6AA79B34CCED8600BC7DAD766009AB045BA9FF rudyguild
438,371,049 *2C655B8799ED9F21A1190B5FDCD91C704449B589 ndan-sen-su
438,371,050 *2C6D3325F112A4CC4ED3775B86D1CCD6035137D7 neckarstr
438,371,051 *2C6DBF04067FD0EC387EBC269AD192E85A915557 nehaowloka4$
438,371,052 *2C65C2E06457665840F538A2C71365E399512806 neurologa
438,371,053 *2C6F2F4EAEB4555BE2C412BBCB7566F185182B3D saccharomycetaceae.
438,371,054 *2C6928CF0824D03C3016F37D0DD3F71D4C556087 nick261
438,371,055 *2C6C30C0A9CB7D7E31207D79451A522D9FCC33B2 SALVATORETHRONDSON
438,371,056 *2C6112AA4C385CE3AFB1446D9FF64AD7DD96D4DE AIGQ:
438,371,057 *2C63D90251714B6F5DD1EAF242912C7F8A7ACA47 [email protected]
438,371,058 *2C6E23661E35A7C856CC6C5DD4D610B3DB39FBDD AJD"
438,371,059 *2C69A01C106D138C287ADF2B6ABBD1B180706218 NKROSLEY
438,371,060 *2C63606AF3507DB18C4785BA57BF11A23DA954D4 a/j$l
438,371,061 *2C613A03472391363FE110365A0A31937FF85075 noch.einmal.erklingt.der.walzer
438,371,062 *2C6617578D18611E3301246BA4641D6DC93D96B1 nondecisive4
438,371,063 *2C633B132B2B05B8E63AA39A6DB3889D4DA3F5B9 norbertkasmarek
438,371,064 *2C669FA0391F9B019ED4CF549A76A4A4FB2B17F6 NORBERTSEKUTERSKI
438,371,065 *2C626746ACFA43BF568FB0A3EC85BA4214F86A5C SAQUIB.HAROON
438,371,066 *2C65BD8E5A21051E58FFE513F879E6F7D92FC922 ALBERTGULLICKSON
438,371,067 *2C63F1E934568A40C3DC76455E9EB00C3A3E48DE sarazennamingopps
438,371,068 *2C642DAAFFD0B001B46B71989F6A3696D57E311C Satan'sHole
438,371,069 *2C698FD1BD19EB3685DE3E3A2E09B65518358DC4 SCHALZIPFELN
438,371,070 *2C6DD6DD869249FFE3C6911B61189EB1964AA19B ALEC.PRIVATEER
438,371,071 *2C68988A1E61CA6E3061AA46792B8B914A3DF7E0 ALLENBARINO
438,371,072 *2C6ACF4B8CA4129F6514C3F381C5DAD6A298A0AA ALPHONSE.WHELAN
438,371,073 *2C61E9F925403A6783DD852484454E1DC8A77140 OCÉANISÂTES
438,371,074 *2C653FCB338EC191CCA505A747878FF45AAB89CD [email protected]
438,371,075 *2C6C6BCEB17B57CBF882FA1372BA1F84D9D9ECCE OFGBAA
438,371,076 *2C6BDE43FC6C4A6FF7C013E4A7AE6C632E96B71A ANGELALIVAS
438,371,077 *2C6DF251A39619A8CBDBDACE348E77076282F1D4 ANIGHTINTHENEXTLIFE
438,371,078 *2C645F6A70BD82A1F02C4D351D01996D3B037946 she'sstillasleep
438,371,079 *2C6991715B642A9F54DE1AF327DB8F192F277134 SHMILUVITCH
438,371,080 *2C6BCCC4E8C020243592F3669CCC6F47C0E062BD ansldi77
438,371,081 *2C65749638C2A6FC393B7AC3275620B977243400 SID.TREVETHAN
438,371,082 *2C64F0AEAB99C8BF8F1CAEF00320359F88798EBD [email protected]
438,371,083 *2C650A1A3A2B638986D05A702CF0061F446DCD83 silaszeminski
438,371,084 *2C64130122BF18E43EA0EE9D71BBAD16AF48754B ORGANIZATIONAMOUNT
438,371,085 *2C6C77945837DF4FDA5C558BB25FC9296B6154FD orly.gonzalez
438,371,086 *2C6E482508DD7360F93525F5D69C88B28F05D8FF ANTYUTOPIZM
438,371,087 *2C631F5C313DB469FEFF00A6283B9EDF0B540039 aoe#
438,371,088 *2C63DEB904E9A4AFF65E842DFF857D79863B8916 APARNAGILL
438,371,089 *2C6BB3F4D294D37B391219324B57280876AA6CDF apqp/
438,371,090 *2C6F4949B995153DC44CE9BCB830EC5EDD6E74CD arbeiderstrein
438,371,091 *2C6609EB248FE391A0442FDDB2EE0D5B2725069E solomonspontak
438,371,092 *2C63590D8CF48D2E825D48E28F0D82FC68DA477E ASATMSF1
438,371,093 *2C65351D361A8008B375EDD9D9E0FF9FC8D91206 sonreilley
438,371,094 *2C6EE1CCF49977043C0DBED31608F33AB2B46325 ATTH
438,371,095 *2C60704F5DCF18C3551618EA236002DED88F6657 ATTO.QUARTO,.SCENA.1:.SCENA.E.DUETTO:."M'HAI.CHIAMATO"
438,371,096 *2C61091B3280BF8CFCA9B7476A702764EA377EE0 ATUK4
438,371,097 *2C65B801E5E420BBC9BFF64E68EC207A975CB116 AUBREY.BROSCH
438,371,098 *2C6907EE5800FBC40DF9F060591B57A8A2B837EC PAWLETKO5
438,371,099 *2C606E169B6E4FACD688860CDBADEA48E3277A9A p=====B***~0~oUU
438,371,100 *2C6D93F5958BF01678BE5CCD684DF98B238F1766 p--d.~.~.~.(x)
438,371,101 *2C6502C8219374FAAE95980C5CBE260DD14A8843 austindillon2010nmpa
438,371,102 *2C619990B5EE2342C475E4BBDA86C1AC075C0524 auy2i
438,371,103 *2C6EC8B99326054FC4F71607931430F03A8E1E16 SPOORRIJTUIG?
438,371,104 *2C6E37FD93F8692C7044365CD8A3DDE4E13F3740 >B0 o~O~d#3
438,371,105 *2C6649E083A0DAFF889728A7C8B3927D37AD402B plb|
438,371,106 *2C6A7755064D904852B4EF3D779A52C468962609 plongiering
438,371,107 *2C68A49B73B67246F693D33F682AE7D6C5788D36 POLYMERRABBIT.COMWWW
438,371,108 *2C6EE85395E2F5DB64D5EF648DF735DF43F83E9B B7P3
438,371,109 *2C69F6DC83415C0C784EDB4C9E43531191A4C634 [email protected]
438,371,110 *2C691231C5CBBE8489AE6C93815A2D7FBE88E462 、BAKHTWAR及ASEEFA。
438,371,111 *2C6BFE45F2AE219EEF3B7408953D7CD300A40C34 PRA15EWOR7H1NE55
438,371,112 *2C6D8A1945AE6D9C669D256F4278556F7BF41FAE PRATISPARDHA-2007
438,371,113 *2C646E3578D8BD141EA213C4218DE5360CD978D1 PREACUTELY0
438,371,114 *2C6127D295EE7894D1C79E12444316674239497D STOMODEA1
438,371,115 *2C6F7DBB566EDF852567D08691F9E577656F9075 BASILPINCKARD
438,371,116 *2C633924F32A910BF4347E3CA827FC0DEBE3E896 STSGITHCANROOH
438,371,117 *2C6A759D4E88161E0ECAB5257AADEE1D23E45300 PROGRAMACION MATEM
438,371,118 *2C646A6FC0586C7E2385BAB1319535606E83CBB5 bbea
438,371,119 *2C6BBBB5019C6D5F993F82AE2A3B9DEFB7625B36 BBHADAURIYA
438,371,120 *2C65DB8F078695772704E9F277F4C3167B03643D b%_cd
438,371,121 *2C6218F394B7F3E16CF9F7AA12608986D0FDC9B1 b=d*:p
438,371,122 *2C65FC66E06750A5155B39B5B0FF6B1986C7EF30 puressya5
438,371,123 *2C6E2CC1C5F344B777C9D0A63DE85862D7A142A7 bedimpled5
438,371,124 *2C6B97BFF75BC75C0E3ADED74FD7E4E3D5879278 BEHLOLPUR
438,371,125 *2C6F0E1AA322AE12E7FD905621BA1FD984A43391 TALKKAFOORSAMMIL
438,371,126 *2C62AB5D2A34B8346D4F3CF564A73106A675C2F1 [email protected]
438,371,127 *2C6ABBDF068DFC391AC4E4CC9A10BD55D4C9A57B [email protected]
438,371,128 *2C6E84CB9B3D1678450617C2C9E56770840F0818 TANGGUOLIANG
438,371,129 *2C6516412C5B7CD512C4A532D2D904D90351D968 belege
438,371,130 *2C633DBC31921E4C392C2AE20617DCF3735B5745 quadrc3n+3nnal
438,371,131 *2C6513639B810D9C1CDB1A1732B5BE0E732A5EA6 QUSCPJXGB9K
438,371,132 *2C6D7857FFEC050BAD71161E00F365B286BC7A25 bgeeu
438,371,133 *2C625DDDA4CBD0AB0C3037FFE4A6D6621A7881D0 bho?
438,371,134 *2C69D232EB436F5292875D35A27D08E1162C873C RARABIZANGO
438,371,135 *2C60979A193260B303BBD4C716B5DA4FD22C376F BIJJUCC2
438,371,136 *2C67ED0965CFD9AB19583E03B131DA7B6FAF4A6B REBECCA A YOUNG
438,371,137 *2C6E31A8C1158781CA80F8C16653F278D623F8F9 BjE=
438,371,138 *2C680D0DEE1058A402C749F531C6A7D1E14BFE05 the.general:.hand.call.clobber
438,371,139 *2C6AE4B647D95FE10549FE958B249A4CEECEB121 BLEILER9
438,371,140 *2C6779AE37A204298D45885BF88C69CB98A31D06 THEPIRATESOFTHECARIBBEAN
438,371,141 *2C66250B25EA6C1A52FC4F7BB92C1EABB33F76E5 RELLUNHCS
438,371,142 *2C6C8200EABAD40C3BEC1CF048D3F560B50ECE19 the-struwwelpeter-overture
438,371,143 *2C69CA49D7D40A1C8BC5B96C0703C023D467DF80 RENEWING
438,371,144 *2C6DA0505D26DF8EA81FAFD7750C6835EC0FB0A2 [email protected]
438,371,145 *2C6CE776311FF6E1152AEA0A7A4E78546EDA9E99 BO15HEV5T5
438,371,146 *2C6C4341AA43651FBCA1B01556E38C48ED96A280 rettulfafolla
438,371,147 *2C6258435551C75E4F7EFA7541828844E60C2ACD TIFENE
438,371,148 *2C6A88F92520DBB0CD2F517EFC8C95F01541146A REYNALDO.CARRATURA
438,371,149 *2C6660D372DE580A9258BA5C922AFEECF6FC810C REYNALDOTAPPE
438,371,150 *2C6148992765C15559E65BA10E4A32133BB83D24 b.!oh
438,371,151 *2C639318FC5257940C63211A72440112FEF467FE TOLKOFF6
438,371,152 *2C6005AFC200726EB5FB83FC2D048301B7BECFD5 bqdns
438,371,153 *2C69CCC101EC60BEBDCD3F02DBAA20A32302664D BR1314
438,371,154 *2C61A99E695A5D9011DC4B81AA37FD37A535D1A6 TOONEELBEWERKING
438,371,155 *2C6EFC8E61F9A8D8908B05180B2487ED8C798C5E RIKS UPENIEKS
438,371,156 *2C68E315C7AA642DD382A961A49835801A35A703 B]RI
438,371,157 *2C6B6F943B55533EE1B738E4B532244AA940DA41 robertwangler
438,371,158 *2C6066053E1525A50757880386E510FF1425DDF5 brkwo
438,371,159 *2C61126AFE86F8E5A65440F7856753C7B2F11DEC BROOKS.JEANBAPTISTE
438,371,160 *2C62CED5F672578C319A0CF007E560DA5F4E8F19 brouerybedryf
438,371,161 *2C69DB6C164871E6B9815629F255313A8FA9B76C BRUCELATU
438,371,162 *2C6FA0B567D657D88D8DF4DEB263D341B22FCF89 BRUIKLEEN3
438,371,163 *2C65EBE60C8E0857DEF5857CAFF604A3175A9958 TREVOR.BEECHUM
438,371,164 *2C688D483D5EEDFE28DBA35C54FB210274245BBE BRUNYSEBRUNYSE
438,371,165 *2C6553B8FEBFCD1C2065E662DEC5EAB0F5E42A31 bruzdesys
438,371,166 *2C6DB294E7BE9162CAB59A08D1F273AC782579D2 TRL0
438,371,167 *2C61A4C37B19233BDFCD09BBE91555C83ACB33ED btb,k
438,371,168 *2C65E5FE1E5E75FAF55A2A096D946AE09914DDB6 btgee
438,371,169 *2C6796C882AFDB3D2439DC8F768881F530DE7B16 ronaldguderjahn
438,371,170 *2C6F350397358BCEF8DD9653F6ADE9885D7DD4EC b;t!k
438,371,171 *2C60E113338A0DBE11E6ECC5B7FDCD289A9F2849 ROOSEVELTGEDDIS
438,371,172 *2C6C742481F67A62936FFD3FA1794CD1A10E4129 TTESPILLERE0
438,371,173 *2C64130531BA591BDF35097C95266D8C9D854808 BUDDYCROSE
438,371,174 *2C64C68F7151E717A8458D9D6493387F13E89622 TWEWADHAISRAEL
438,371,175 *2C6030B01D6E0A05ED3ADA2D314ECF8269FD051E TYRONE.WILLAND
438,371,176 *2C69497D0FE3F515F4AE4D0FA76ADC5760F61180 TYSONSCAMMAHORN
438,371,177 *2C6AB4A5CC639E71851F69606E20E56E1F84E1EE ucerelubotu
438,371,178 *2C61C47E5235F214E185370E518D7FBB7C59911B bul#s
438,371,179 *2C6D9D82D0ED27E69CE030A440DFE99D7CBAE776 ulyellis
438,371,180 *2C60DD328EC8D3FE674361898E5693919999F6CD S10817740123
438,371,181 *2C645E30E667F226244E934FD371CA4E1DC39A7E SAJRDSXDEMEEC0
438,371,182 *2C6B3987AB5F3C333558419F98DD433966EBB698 B)~.)x(
438,371,183 *2C6376CB1E509177C5C8760042BC94CC8D2ACC2D salvolatile
438,371,184 *2C6A994EF50828DEEDA5EEEC443E92EBD73BF6A0 UNO FORERO
438,371,185 *2C632217193569A2CF512D8FDBC7A7934E7D0853 SAMMIEEISENHOWER
438,371,186 *2C682C876729C1270E8C70E0DF9C57F516DA765A bz5;c
438,371,187 *2C60A498F149359671D73E1EC45085B3690C0616 URFHCLIM4
438,371,188 *2C672847F68BC1FD5D38F5D5DA57426927599BD6 [email protected]
438,371,189 *2C678527EE1FD51D6347CA4745F84C5A44EBFD4B [email protected]
438,371,190 *2C650F7006E4F1DEE71EA3113317AC063AC4A51C C4pj
438,371,191 *2C6528703975D37657AF32142F6444EE05E87288 SEV"
438,371,192 *2C6D2262784F69E151F2DEB217C7DE0E2E74F9F4 carmensuite no 2: nocturne
438,371,193 *2C67330F4A80D01C8637E290872E5102446543E5 SHAWNERCHUL
438,371,194 *2C62E8C3409F122F5636DFD3FC084C590A97D62F VALERIE SONG
438,371,195 *2C6F6A03082A4099AFD3BA6C360DF6E9D327A7B5 VALLALATOKBSW8
438,371,196 *2C6779149CE71BC4314BAAB45CDDC95B636CD180 VANCESPECTOR
438,371,197 *2C681031E796058E959E9F4B31F42EA1EFA727CD CARTHAGIUOISES
438,371,198 *2C6CB07DC3C943AB4F95F79F00248D25B2E525A4 categoryⅠinsured
438,371,199 *2C6EFC0EB6E4F071A3547B12C4413B473A4FED66 C_BFW
438,371,200 *2C66598BF5C4CF5B857F8503F9F750FB590CB4D1 CCCY,
438,371,201 *2C64CD099D58F4A6668C96F716E54A92E74368E8 ccitiate8
438,371,202 *2C62FB18A2D6E701E315EC51F97B79DA3F8C4120 Sim
438,371,203 *2C61A85CAF81BDEEC62700A61B2170B43A0D5191 SIMON.GALLI
438,371,204 *2C66B82EE62FD07DC4E676A4E25A0E609B188E7E VIBIN RENJI
438,371,205 *2C6EFDF66F750D297044B58B655FA46FB7E1B29B cem5c
438,371,206 *2C6925139B52B5D56B674D7921A47664B7F25880 VICKYKORDALI
438,371,207 *2C6E50CA19BACDC7F201D16E80A679CF61BFE033 CF4
438,371,208 *2C65CB2490F8E60BF191C89F847F28E0BF241C4E cfuiz
438,371,209 *2C6FE8680498798CC9C802A7B8AA5F0C5C26E20E SKRIFSTOFUSTÓLUM
438,371,210 *2C635E3F3A96C57F225EC0A98426F085347D1F44 SLLABLEAHCIM
438,371,211 *2C6D42B3490F43AD2B4B03C886F49231C5EB3280 CHASEDUNNAWAY
438,371,212 *2C6EB9564158A1A199CA322F265DFCA4CB243017 chau-phuong
438,371,213 *2C6DD9B8BE56DEA7004F8FB1397EBDBF4A78694C chen-levi
438,371,214 *2C68803F937F50C44674BDD2B9ACF77F0DAB4D63 やvvp
438,371,215 *2C615EE9B267D3776806409E013625CA79D6E962 [email protected]`
438,371,216 *2C630D6C3BA86B6884815AEE2FE9DCDCF10F82F8 w4ll-h00k
438,371,217 *2C668144C0C8BC9CC0891910F3F5CB06E55B9285 W8C&
438,371,218 *2C64AE8A95896BFC32ABB4F7B092F2BD0C8D8FB6 w8s
438,371,219 *2C6089B5437CB4F9038B74D9E149F620472AE006 christiangow
438,371,220 *2C6F3439C1FD370A587D3792614A35EE656A4C30 SONNYMIMIS
438,371,221 *2C6941FD10378991E0D08A5F602F9AB3B052D5F6 CHROMAKEYERS
438,371,222 *2C652A935DD660C97DA73D3774E4E890A5B3586F WALLYTRILT
438,371,223 *2C6B3C35AD23A6717B1087185130D94D296AE24A sovjetenes
438,371,224 *2C6B827B1FDCFA70D9C88F0E06F9F5A3CB3F5A95 WANKERMERCURY4
438,371,225 *2C6D881206E9E51165CA4EF855124EF3CAA5A9A8 sparklern
438,371,226 *2C6C8BF4E8A50D95BACA5C632D012FB027CD9A46 SPEWING5
438,371,227 *2C64C6F48EE00C2E9E2D927C6050CEB24B44CDC1 waylonluoto
438,371,228 *2C61FE6DD5B66928A223204486F8DE3D9E0A7C97 splat.~<-----B
438,371,229 *2C6A64DE2720E5ECA47F03ADD682944424A1F5E2 ckwd7
438,371,230 *2C61B46DB681659C0E1A56BAE34EF786B9F9E018 cleoshatt
438,371,231 *2C6F40C57E19722096AA17D5C2347528566FDFE3 cli&r
438,371,232 *2C6274CAD9BF3394F7527C3D93825DBF5E870239 [email protected]
438,371,233 *2C6619CD2A3B7B21F608B78B48E832BA02C479F8 what's-number-3?
438,371,234 *2C631FAD0F835F654BA422C1834577763AAD91B1 cnaw
438,371,235 *2C643A460C20EB728A009FA7A2C671F5B31EA422 C+%NF
438,371,236 *2C639077EDC3BB3F6264BC9D80AA308440C1B625 wilforddrybread
438,371,237 *2C686AD8D43B90B5AFC01FEEF47CB51131BBA483 [email protected]
438,371,238 *2C61DE5737177BE3E2332E3F3562810F63813BFF STEVEHOW
438,371,239 *2C6E3CC52847DD9C58FD32B13547DC26108EACF5 COMISION.DEL.M
438,371,240 *2C6C478819C40BF2E463C72D206AB08E05BEE943 WILLIAM-SSEJJONGO
438,371,241 *2C6AF68AD86AB86413396F2F268F1A8241F95EEA STOCKENTE, REIHERENTE
438,371,242 *2C61F0C5E97768200269F1591A0CEC2E3FF34286 STROOMPROTOKOL
438,371,243 *2C6616A8C88924669EE58D54D7D727DAF88BDD1B SUBHEADWAITER
438,371,244 *2C6C70D8BD3EEA2A782F5E62CCE12E46972A15B3 [email protected]
438,371,245 *2C6F0C9FD8FB92E022F8BAE5C6F7F3E525D308FC SULASGEIR
438,371,246 *2C65D8157F7320570BA5BEA58AD94CEB06FB7144 SULPHOTUNGSTATE!
438,371,247 *2C66BB618B36C02DD4EE9F6BF2ADBE24732F9131 SUN_BOSHI
438,371,248 *2C65EA02683D2079A4D1EB191DE9E587CF8C1555 WLABIRYNCIE
438,371,249 *2C61FACCC8AFF2724C4107D4AC6F7A25DBBDF1CF WM.DIVER
438,371,250 *2C624258F1C7978364585965392ACBBD5E1ABCBC W^NE
438,371,251 *2C6C8D0202E534469536AEAD6633004BC0F9AE6A wong.way.fong
438,371,252 *2C6E160A40BB142E0D70E2CE059D656200A5B3B7 [email protected]
438,371,253 *2C65AFCAF5B56ECF2CF2563F742DFE385B355D4F suprime-wierdness
438,371,254 *2C63187227B090B876EDC95ECAB470A0B0BA013C svakaan5
438,371,255 *2C62F6A8798B4460E8E0EA6EB840B708799DE9B6 WUQIUYAO
438,371,256 *2C63EFB71EFA20A1EFA420146795B37F7A2DE6DC COUE
438,371,257 *2C6403093A31B9B17499C96AB7B8198F67B64A8F coupcuii
438,371,258 *2C66C6F553B0E6DCE3AF88894E9093414C730A22 sweet-pearl
438,371,259 *2C6E968AE24915E819DA23A2AC4C83349BC997B0 sydneyogami
438,371,260 *2C680D22CA139AA49E55BDB2A7C53BA247286F5B cpzo6
438,371,261 *2C6BCB94E4642EEAD989DED080C69B8D05484C38 X101923
438,371,262 *2C619C5581650F1B3F59F467B1EE6643369A117C )x([email protected]===3
438,371,263 *2C66ED996955E15EF428D0294BE2DD38C78FD0E9 (x)-~`<=====B
438,371,264 *2C6C62F0B2CCC3AA13F5496A97ABFE734B32188C XERETAR8
438,371,265 *2C6F6EB2CF45D7086351CA3C6F9C77C5EE57BCCA cristopherbonventre
438,371,266 *2C6A216CB871F646E82A0362FE5023B61E91DF8B CRUZANTEE
438,371,267 *2C699FEF0FE9186E79EA7535E043C5BE272780ED CSAPATKIVONÁSTÓL
438,371,268 *2C62F2BB6716EEB9E1527FADF6A70719031DBFCC xpaex-vongsagon
438,371,269 *2C6B10F4B4C26EB9F3FB589A29BB5AE69D9D5939 xplusy-dorea
438,371,270 *2C6997786E37B9C6CF5EA44EEC5E6718E0A5A918 }X{~`Q===8
438,371,271 *2C67E15F55982EC3419B5817E7FF3949DB8D68AE ctlht
438,371,272 *2C6510BBD76AD1821B5863B619354D7B1EB119ED [email protected]
438,371,273 *2C656D70871D7DCFB445E3C0A64314318506BEE2 xz!i
438,371,274 *2C66C19584115F9E1FD1B347FC6C62E34FE3AA77 CUWL%
438,371,275 *2C6F5A1E254613D80B2A87140DD518DB36AFCA5C YHRTSG:HYPERION
438,371,276 *2C678D4565AFD00C3DC378A0410ACEDE04B859AA Y:HX
438,371,277 *2C6BEE91D01E986057AC6D912EDFF28E16FCF55D YO,-DE-MANNEN,-YO
438,371,278 *2C6D6B65B7A14D5607AD52F860F3E3BB9ED99FF8 CZ$RA
438,371,279 *2C6A3A40BA7E20A3869A904696F1FB0781BE778C [email protected]
438,371,280 *2C66E57486A77251C51D37EBE8071E6D3B10908E [email protected]
438,371,281 *2C6F54392EA67A83E17A6D3C95D3139A2801C12F D3A7
438,371,282 *2C6A4809DDFF28BF73993436A790C5E5592EEA71 d3falca+!ons
438,371,283 *2C6228EA061FF3A1ABD5432C20C10DB21F3E4468 D3S!9NA+!V3
438,371,284 *2C6F7E7DA74D965C066991D7443E92D0B415DBB3 the job of journey work
438,371,285 *2C67351EFF325B3147A1406B96AEC81F4251CE20 darner
438,371,286 *2C6A0A1E6647A1CC8BC50F19B59A241458AD256B zhiling-lee
438,371,287 *2C668DBF84736BBABBF1EB177CC1164FE133E731 THUMBCULTURECOM
438,371,288 *2C6DE3017F235E9FE7A4F2D8EDBFFCAB297A8D7B THUNDERDOMEX:SUCKINGFORBLOOD(DISC1)
438,371,289 *2C69835B17FD9D87147F9F26D774DA44AA9FF280 [email protected]
438,371,290 *2C6EC845DA7B6DD6F1B5F9D19343FCFDC58B34DB TIMEKAYLA5
438,371,291 *2C6A2A7295DE5BB2320DDCD602D6BB73B99427DA [email protected]
438,371,292 *2C606F546BAFB406BD13F5D0AA8B94BD600B4099 ZURFUNDAMENTALTHEOLOGIE
438,371,293 *2C6B958E3A8C866CF57F81772D0A3C572BD448CA κέντραρχος
438,371,294 *2C650C6C5D0675B48EAE617B506C9E69408B2DFC defaultgc
438,371,295 *2C6D0CE1C49980F9AA99CC8E2F20ACC494B60E1F TÖVISBORONA
438,371,296 *2C63EC0BF8B98355B7B9FCBFA60A9D638990AB6D deonbeedham
438,371,297 *2C6A1BB6B0708C05169790EB496348C88099F584 Destination.Calabria.(feat..Crystal.Water)
438,371,298 *2C627CEBEFE8DBB9D691E818CA6CD0F6AA0013C7 TRANSMISSIONS 6
438,371,299 *2C60E9B22F001C3AC42FCE0C133962EAB9C998C0 DEVINMCGRATH
438,371,300 *2C6BA9868A49F469743969008FDCA82C040590CA TRINIDADWASSON
438,371,301 *2C60B9A9FDFF2360C301FCE8990EDEA4400A260B TRISTA.MORTHLAND
438,371,302 *2C6FAF7BD0547D44AEC059139C53A61A60B9CCED DG/K-
438,371,303 *2C65ABC857A54901D7A50EFE8461345088F84930 DHLPK
438,371,304 *2C632211EC35A5E74BA848462EDA9D695B7EAF60 [email protected]
438,371,305 *2C643B19B5698931E8A84B0B0AC08DF43CCE667E TSEROFNEHCTERG
438,371,306 *2C6005300D1E6B938D4E1B6E5964AC6B5E83B77D DHX=G
438,371,307 *2C6E7D4EE4F32AF6A2FCC3F808FF13A7242C9CDC di:l
438,371,308 *2C648560B22CC9264E07BE13359CB65870AD4809 шиолашвілі
438,371,309 *2C62D4403C8D8C40F98484DFED69DBDE70169335 TYOENTAEVIAE0
438,371,310 *2C61015E7A24B65FA10998DE2C407C2FBDDB29B6 d=jgq
438,371,311 *2C6875D43668E080BFD021CAD8BF87CD969F3FA4 dosrv
438,371,312 *2C6AF151C14CD25694967AAD90FB6FDA7EF4F61E UURRRRNN0
438,371,313 *2C6F716CEE3C7F9A26B4800692EB9AF339C599FE [email protected]
438,371,314 *2C6F43F8A6E25D001303BB213BC685B459198BA3 DUSTYMARICICH
438,371,315 *2C61A9CCA419FC79BDAAA3B44F63AF8102702715 VALKOARMS
438,371,316 *2C682E64986FD0FEFF497E9D447EAD30002ACFA8 vall.stefoglo
438,371,317 *2C65CC0BE498490F7D16C377109EE9997D7D560E dwainmcsorley
438,371,318 *2C65744400E07C6B732A2D5EA240D1524000E5D3 05-10-2000
438,371,319 *2C6CEF0188B469E48B26B15B5BEA6F9C6635EE13 VICTIMS-BLEEDING
438,371,320 *2C627767864F9C5F16143CACF00BB2859F15376D EDGARDOHOLBEIN
438,371,321 *2C6B40A8CBC9828C94F4762E20F543F5459920A1 VINAYGAJJALA
438,371,322 *2C6F4FAAEE91FBF0E6A56BE39797642F2F9BB561 VINCE.LEVENTER
438,371,323 *2C6586AB8DCABA0990EDAE67318D8C3FC387F4D8 EDWARDFLAGGS
438,371,324 *2C69ECA3D3315050D06524F7BFEA29737AB3F372 viola-castillo-gonzales
438,371,325 *2C6700BBF542A58560ED553649BF42B6FFAE4D25 10211680
438,371,326 *2C665E2777A56AD3E90C68E0AD9FCE64E6F4ADC1 VIRGINIA VITALE PICCOLO
438,371,327 *2C677275A4DCB3389A557028D87A3666F7327203 EFRAINDETTERICH
438,371,328 *2C6BB28175984C5C5E8E0D30C3F6B73AF63537D6 107-shadowy
438,371,329 *2C6B7855ED4FDAD22E8A94351267904D35AEB8FA [email protected]
438,371,330 *2C6AD3B0AC97B5E4ED46D8A0263B54EA71B82B97 1203707 ojajoen.alikulkuk
438,371,331 *2C6594C72630CC1BD1644EAAF88484669F0CB153 123456SH
438,371,332 *2C6055675A967F4827E7ECD83392389AB426BBCA ELESIC
438,371,333 *2C6504A3188474367A69DC5888E25BFAA61AD78F [email protected]
438,371,334 *2C628413BC1F491FABD8174FB48B00FD926F2FA9 ELISHA.SCHWEIZER
438,371,335 *2C6DDEC0579FA29B91ECF6C461DECD463349A829 WALRUSGU9
438,371,336 *2C6C15C2AAABB729D82160338656BB1180B0DA11 1611598 that i would never have believed possible 10 years ago
438,371,337 *2C67A01E0B14EB2FAEEE6BEEAE4252256A055479 [email protected]
438,371,338 *2C6CCC143D7D4F60A5553308DF73A1463B96ECA2 [email protected]
438,371,339 *2C60B4778294F2D7D301E12C91FFE63AD8BED4BE WANEMERGOR
438,371,340 *2C6728C562C760BB4E978458E54CE6FCF212D319 wanicapri
438,371,341 *2C6A43C77CDB6ED1519E14E9124791EC71C3E719 WASIU-ADEWUNMI-BALOGUN
438,371,342 *2C674C8358B0579B531B177F48D3CE321F78D679 WAYNEMCLENDON
438,371,343 *2C63714D17D73AA7EEDF873D358BDCFD1227B89B entrails.
438,371,344 *2C6E501666CB6510891A9CD50ED276C02CAEFD5B EOFKHBJ65
438,371,345 *2C623CB0307DB37F3DAD26B43B954AD93A3595C5 [email protected]
438,371,346 *2C682EB9970112D9D7C1E665215A09011B9B2B41 1 CHIPKOOPERATIONEN
438,371,347 *2C65E94591D3CD15B342F45FF7C1259CB763F9E4 eresnaps5
438,371,348 *2C62622FEDAAF2AA6835FEFD46A9C1C32B0F0B36 1-danisch
438,371,349 *2C6AD1FD3AF94A4E997AB4C3E3B3BC29CA505891 weseheathrow
438,371,350 *2C698DEECC9AB252A1BFA855B1D187628832F4EC ERICKBILLINGSBY
438,371,351 *2C616C50E7946010654CC5FA61A36E098023B73A 1hein
438,371,352 *2C6FC4369F2D4437706B744C349D896D4C0E9812 WHET.THE.KNIFE
438,371,353 *2C68C2F76BE8BEEE687ACE67F764FFDA3A1E0766 EUGENIOANGOTTI
438,371,354 *2C6B0E0A5B394F32FBD1C4C09D9F8B8960FFC3F3 euode
438,371,355 *2C676F4F58B9B0FBB2B2DA3870E78932D4999EA6 WILLIE.LECOMTE
438,371,356 *2C6FA57F845124834C7E2635861F8F8B1F2CF4CC EVANDOB
438,371,357 *2C6F614196750B51E2A5BCFF6B5F8616877934B7 1kishine
438,371,358 *2C656F0904F5BAEA7F59208354A3BFF339B17C0D 1 maailmacup-pisteist
438,371,359 *2C6ED02CE890F01BB6D34CC5AAC8519F35FCCCB5 [email protected]
438,371,360 *2C60716A0CB2DCBC93F469974F1AF11AB3C04A2A faerron’s
438,371,361 *2C6752595F18034939282C0D84E855012B5AFBBA 1QUEENCAKE
438,371,362 *2C60AD9E811434EDDBD47A25431465C485A9027B farsheirani
438,371,363 *2C6791410C06599214C07595EAEA1695B1837416 1.tUrdeSliGin
438,371,364 *2C6BEDA2D7DBBB22AE2B7CE2AB0881CE247FFB59 [email protected]
438,371,365 *2C6B3C60385845041B42F63C338795396E37D984 felipeguamanpomadeayala
438,371,366 *2C61F97A0FBA5867FD7F501B7ACE40FC270C3631 [email protected]
438,371,367 *2C6081F0AC11A4CAA47AB211AB1EE08B1982BD21 1-vietsint
438,371,368 *2C661F3604AD36206E8CC0B2CCF4E58B8E3F8EE8 wwwdualityit
438,371,369 *2C6AFF5F9873159B978A060EFCDA852170F986E2 1-west-hottest
438,371,370 *2C6BF1A9461C59C4A5659C43A9DE72295A3E6D12 ferminreifer
438,371,371 *2C656916571AAA56A14313C1852FEFFA1D898118 FF9
438,371,372 *2C6226EDFE05ABAA5AE1FAD231A8D9D61AC5D62B WWWWESTONRNLIORGUK
438,371,373 *2C6CA5D0858E5DBA806A1967D6B0FC315EA33A7A X2355E
438,371,374 *2C69163A912DB74E1622D82E94AB4AC2FE9008D6 2185225 ueber.die.anfuehrer.ist.nur.wenig.bekannt..
438,371,375 *2C63A5C6A5CCDD9FCEB3C69F17330F7CF0DA73B9 first.return
438,371,376 *2C62DE77916705CC8E9F85317C8A54C154D13DC1 [email protected]
438,371,377 *2C665DB5B9A6ABCC2D63E1C4BC81C77AA1908186 2557189 KUNTIEN ON TEHT
438,371,378 *2C62DF9798E6C1DC4FDF5A9FEFA9683F3DA55753 floydbrubeck
438,371,379 *2C65A76F1575817091A6B2FD0DE46AEAA3F871E2 [email protected]
438,371,380 *2C64404CC11E77315C051D04B8C11760E3BB7621 27august1673
438,371,381 *2C6EE9B6D95CA17B6B6972A5CD08F437975D650B [email protected]
438,371,382 *2C672E7135717BA5C7A35437980D4BE8318BD9D1 Y50598
438,371,383 *2C65A67FC0135B51DEB50487D79409B34C56735A FPBVFFK9
438,371,384 *2C699EA4C6C65A81D53796B9984823AAC9FBD5E3 [email protected]
438,371,385 *2C6D626916D7D4A8F441662FF5922EC2B207359B 298483 warnerisaformernavysecretary
438,371,386 *2C6174CD4EACF4AD5C2EA03F9828F8F255488682 francischanley
438,371,387 *2C6BE4EB16FA197A03BBC553415A1AC138EA0A46 2C6109
438,371,388 *2C656009ABB639E58C3C605F628943641DC2611B yeldeth4
438,371,389 *2C672B6B01C0172A86D3E3FA5361DCA9AAF3B719 [email protected]
438,371,390 *2C63660A717C9658E1F7125A97CF5B4B4F79480F [email protected]
438,371,391 *2C6D2059023D314666AF285A75F517F164456BCB YLSSELKNED
438,371,392 *2C637ECC776635692423EB9A110B6916D2E38567 yojz-kiko
438,371,393 *2C6C50C88052E3D30EDE0DFC64F78D8E6ABA47BA YOLANDAALLWANKU
438,371,394 *2C6BB8F87877C6A033AE89DCA40DDFBA5FFCC6D0 G35TUURD
438,371,395 *2C6DFC6823171D43880E87960657DDA2D08B2EBC YURAYURADREAMER(offvocal)
438,371,396 *2C603603CC835F720C644FC34EB11E3FECEA669A GCCAGGCCACAGGCGCCGTCCTGCCCACCAGCACCCACTCCAACCTTCTCCGAGTGGGCA
438,371,397 *2C635CA8850AF8AD6AC433736B8C1419F047A97A 2LATNOHC
438,371,398 *2C6F10C9F7A3F11B7998AB4367708325E12A44D3 zandkoekjes?
438,371,399 *2C6CAA9F0CC7BE77449A7802E9857A4922830E5E 2-maneerien
438,371,400 *2C602FAA61594E19E26CD132182F50441508FB49 2numbers1
438,371,401 *2C6B9C1F66116C4E26FA73281510AF93642CA44F GENBAKUE
438,371,402 *2C6C2B1A1C4A4DB8C6BA7B4489F2B1951F92CF08 2ORGIASTICALLY
438,371,403 *2C684FE5DDC397F06A5CDAEAC57D35559107B8C0 zdenko
438,371,404 *2C6B4031897FD2B89161F44890A82141486DD61A [email protected]
438,371,405 *2C62C30D76C24DF35484B2D48C9D749522D74536 ZEPPELINNANCIED
438,371,406 *2C66B27A7DC9DAD313E26CF6CEA6385698FA4C19 [email protected]
438,371,407 *2C6112B10355A69C4691A5DD7E36F0DAF676EA66 ZHANARAQUILLIAM
438,371,408 *2C6218F35FF387B32468F7C6660A74D3659071F7 31kuumuudessa
438,371,409 *2C6CF2A3662626BB68723F9B1DA6EDDB5A1538E9 [email protected]
438,371,410 *2C655765B388D5BEB1A92EA6E17B67D2F6E29105 [email protected]
438,371,411 *2C6B604FC9C05C2E48C119579217550FEFA4CA76 32atolyede
438,371,412 *2C6C8717AFBD90DFE8242B0588EBA5A2B550B379 GHOSTPOOHBEAR
438,371,413 *2C6AB7FEFB43FB44565B4C3DCEBB2375C3B45FEE 386446 kurz-danach-zog-er-es-vor-,-als-kinoputzer-zu-arbeiten-
438,371,414 *2C6D9C5C00DE9C4FB8AF47C81EB8DA130507F048 [email protected]
438,371,415 *2C6B7DD90B39DE241D0B6C5FF5A979864AA59D42 [email protected]
438,371,416 *2C6E3B361A60CF7716A3337ABA806B260C55C668 gimbutas3
438,371,417 *2C6E7E3931744362D69D8D0437BC0692174917C1 ZIERIKZE7
438,371,418 *2C68C72F7A7A21DE80CAC02AE05DC71EB7FB7EE0 3B<-O~Q#####3
438,371,419 *2C6A5FD27982044B769754B238EB2AB902E69B4E 3d0684180960
438,371,420 *2C6DCB857ECDD3B6B24681202194DB96CEAE0DE1 GJPU
438,371,421 *2C66447131419A9495312C158B2C05601E1FBBBD 3iamwhit1
438,371,422 *2C69F0C7888ACDAC348D06EFCDA5E5A442E354F4 GNUGITTA8
438,371,423 *2C6719A7E78CB8157B3396010CB79D4BF04B7D3A [email protected]
438,371,424 *2C61E8F960C0CBC352D45CCD34EF854EEA250D53 ZOZOROGETA
438,371,425 *2C619377DF30F634BA3E45A5922764BA8A10DFF1 ZS;G
438,371,426 *2C69AF24A327F9346C185F57BB9DE055468EB493 ZWEIERGESPRA8
438,371,427 *2C62A1D1EED86890FFCDC79955C3B536C9485EBC ΥΠΕΡΑΙΜΙΚΟΊ
438,371,428 *2C66DF791613538C4E2E762DB306F54A31A9E59D АДМІНІСТРОАТОРА
438,371,429 *2C6A1F8E6892C836957655B6E48ABBEFF1224AA7 3TINYLYN
438,371,430 *2C609CE2375A2EC988BA245F30881D561E422111 3VERSCHLUCKTEN
438,371,431 *2C67BB019CB05BD571F0F5F084CDA0F6CD200A62 40碼衝刺最佳成績/5秒7 臥舉最佳成績/40KG
438,371,432 *2C683A22E167C4BE78373372CB15F3F98308FFD2 ВИБРИССЫ —
438,371,433 *2C644E9254DCEA4E3DB3296C5CCBCC374B983A40 443037 MOTHER-:-ALMA-CARRY-(-B-.-FINLAND-)-.
438,371,434 *2C628A1BC4632F600DD7F62F6898732314FA87F0 ИЗВЗЪНЗЕМНО
438,371,435 *2C66F94D362EC54D52555FE78D9913CB03379108 GRENADIRU9
438,371,436 *2C6BCE48F21AE591C6BBC25C6B63220659C029A2 GUILTRESPONSABILITYANDNATIONALSACRIFICE
438,371,437 *2C6201898A748FD3B536A7B8893EF4D816F9C3AD 4MITGETRAGEN
438,371,438 *2C65DC0509EEEF66A3197D3A68E3739F77996D8A 4NETWARESPIRIT
438,371,439 *2C65EC6398573537C252EE785FE360FDABCEE5C5 4PATIENTENQUITTUNG
438,371,440 *2C61D0ABB1920342418E64F8BC0D7AA4B3716F9E чіді
438,371,441 *2C6615B3EAF13033FC76891F307A2A7050F952D6 4VEALING
438,371,442 *2C6DD9D1710FA8A813055AB14046C00AD7E65029 53DU++0R3
438,371,443 *2C63881D277A369875325535F917A0C53E03D374 HISTOLYSIS5
438,371,444 *2C63C54527F9FE719A2BED690436645709F58C0B HITZIGST9
438,371,445 *2C6C9127AD1257DCD06255A15FB373DF8C9DD7DF HMAXPAYNE
438,371,446 *2C6951E8306135CC2E36B98FEF29031E2B34F121 5BUTITISTRUSTEDTO
438,371,447 *2C64E40EC2E5444475F99221F3D5C5D617B45099 HOLIDAY-(BURNS-REMIX)
438,371,448 *2C6C3314C8EE2F64C5E177F1AAB5B2920C396840 HOMERBABICKE
438,371,449 *2C602E64938E608FADFE69C284FE400071BEE5F2 [email protected]
438,371,450 *2C6903B35984E52363D710E81E8D09B93EE8CF86 5LIGNOARENARIA
438,371,451 *2C62D25DDD693DC5581F6EEF59358B120A1BB1DD 5MIKEWONGUSAAIRBALLEAOLCOM
438,371,452 *2C60283850F42FDCA97F4EAD80751AE1EB60006C hotspurs
438,371,453 *2C67FD4D71EAB0B7977FBB7CAF2FFAB714F703AA 5PHOSPHORESZIERT
438,371,454 *2C625F7E6F766C6A20638B9718C6B28C48BDCB4C href="//avant-naissance/ref=cap_kpm_pdp_17
438,371,455 *2C6666C575F6B2E9A97CEE1A3A877DEF84036D0F 626009NIKA
438,371,456 *2C6131818F76B0F80A504A2D9086AA2F2F5817CC 651370 baykan gunay assoc . prof . dr .
438,371,457 *2C6F2D2C277CD0E59C2A623DEAB88E2C78E2FA8E [email protected]
438,371,458 *2C6FEC9B2BA841E9B0DE8879318777FDB45F4DDF に敗れ王座を失うが、4月8日にセントポールで奪回に成功。しかし、活動停止寸前のawaに見切りをつけ、同年12月に
438,371,459 *2C64EE626257FBC2531D1F2076B3A1DC0409EABF 6BOSSTRAINING
438,371,460 *2C65E433D576FC06882916723966902BCC1E2242 6BSWKADEWEBSW
438,371,461 *2C6A50983201644914854FD836C523C4C7AEFB5C で書き込んだIPに一応問い合わせています。
438,371,462 *2C6BB02F44FDC66D286FEC7050077595F80EC220 6ILMASTOO
438,371,463 *2C67FACC4EB5CC1140812618A8022CC18EE4AC85 6INDUSTRIALISERINGA
438,371,464 *2C65D830BF220096BEB4B097DE3277497B5FD23F 6IUDICAVERIMQUE
438,371,465 *2C6B65F732118437DBC1909F90E8846884EBB125 IFAELLIGGED
438,371,466 *2C6E1BE5B2AF1432DA9F1E3DFE1AFF517EC85B0D ignaciovaneyck
438,371,467 *2C6D15F55395E4459030515DEA3F517AB9919C05 IIIWRATH
438,371,468 *2C6018E59AD826385E20E0C3170E774F03174C3D ILUVDUTCHESS58
438,371,469 *2C60054A0ACA8F747AADF8BB86E2983A37D33090 776032 bea-de-calismalarini-bu-dogrultuda-surduruyor-
438,371,470 *2C60D4BD75BB3541F1F167E48DA2CE8ACE747195 (0-0)[email protected]#p
438,371,471 *2C6DCF7FDA7D3BBD866D9646603D056D368EE0DD 7B54C61A
438,371,472 *2C675CEC347FEC218949AA0F8FD0CFBA9B136A21 047c00e2d8bb3a0faa47d0c6f2ba0154
438,371,473 *2C65FB11C9302E787F668BDCE473500F9A5FDD37 05191166
438,371,474 *2C67117BD4862A874D8C9B7258EC8A8F46629EAB IS.ANDEH
438,371,475 *2C694D1882918F5AD8FF96777CA9B7812C11A31D 868807 SOPIMUKSEEN-PERUSTUVAT-PUHELINYHTI
438,371,476 *2C6389049E7EEA808339CB13822F5AE1A80533DE jamebryden
438,371,477 *2C624D4EAF6978ADD07EA2582ADC611731376D58 8DOZCPRJFV
438,371,478 *2C6C3FFFC5680222ECFFDC31E42C20D6DD00FBE4 8DREHTUREN
438,371,479 *2C6BE3A07D07E347EC1F7329E427FE15E1BD9DA1 jammupeta
438,371,480 *2C6B9312F708B2A7219542A172F4AAD2A394F23D JAY2000NINE
438,371,481 *2C69653011C604CC4DC640596AEFAC85DF1F4D46 8===p.`~.`~(0_<)
438,371,482 *2C6A143133B97269C4B1EFEF1CA564FF8AB2985D 8SBARCARES
438,371,483 *2C6A948F4F06DE3F62B247EA8D9FCD8E19269586 JED.TURNBILL
438,371,484 *2C68A63C195D121F85CA648E5B87AE9890060A72 8WOLFMANPOLITICS
438,371,485 *2C6B30A78562B54BBE8109F1168D9BF111BA05BB jeffrey-l-williams
438,371,486 *2C62DC24DF8D41B109C839E30DBC337198A2B188 940418WEE
438,371,487 *2C6F7658F95219ED691C69B0AE8EE9D158812F4F jennajnr
438,371,488 *2C67B3DBF38EFB7601EEA8177F7008BFB3C1AD10 JEN SPEAR
438,371,489 *2C6334ADB8B5540BC983E614DE0D4CC9AA34B45A JEREMIAH.CROAK
438,371,490 *2C6FA096CA98509C125D8EDA9AC436CB656E8306 9BLACKIEVIOLET
438,371,491 *2C65F1EF867F22AFC1B8A189E68F80339D62263B 139912 vuosirevisio kesti juhannuksesta viisi viikkoa
438,371,492 *2C61E89EE01D8B5BDAB50BDB3B67DA0E93748486 JERRYGOINGS
438,371,493 *2C6688B807E7001D366D967CE23CF60446A79D7D jezusmontpelliersky
438,371,494 *2C623CB01241EC23D53F1EA47FDF29A379A6EDE3 [email protected]
438,371,495 *2C6E1769629E1ABC8EE7814502EB016BBCF67AAD 9EMOPOIETICI
438,371,496 *2C6CFB939FDECB5C29EE1BE9FF6DA5550176ACF9 9FIBRILLATIE
438,371,497 *2C676B462BEAFB40D6FC9821D2BF2821BA0D0616 JIMMYKATHMAN
438,371,498 *2C6F1CE8E6BCC14B6B98595E1BE53E45A0AE59BE JITWALAI6
438,371,499 *2C6AD8F5940EC5DB19B8CDCF8F78568AE8901BE5 9LESCOPAGESES
438,371,500 *2C69E09B9574DA6B12378601FAD7F8906875788D 9LESTABLISH
438,371,501 *2C68FA523618BD5C4CF9931AB14CD870AB3BC464 17.STASI-ZENTRALE
438,371,502 *2C662073490174905C7DA7B46A336612E078E57E 1-800-ROSES-XO
438,371,503 *2C6B5034AAAB277574310B639A944938987464D3 9PIKTOGRAMOM
438,371,504 *2C6DD063FB6B0C989B1C5BD8BE92140210108E7F [email protected]
438,371,505 *2C6B19F11EDA51FBB93B30EF6190F4EDEA3466DF 9ROBINHOOGRETZKY
438,371,506 *2C61047E0168B865E862439753492ABFE1351C84 johnathonciraco
438,371,507 *2C6B16A0CD5E95854CA887E04B74521968B27095 19ASCRIBES
438,371,508 *2C673440CF9347CCA3ACBAFD39BE823B81EB2495 john.godschalk
438,371,509 *2C679BF9806C676AC7FF151C14DD62F7B579A085 JOHN.KINES
438,371,510 *2C621261B3FDBEB96244D59A51939BC95A1017A1 A2"2Q
438,371,511 *2C68E1F8F30E8C3B9B9749050F4BCC9AEA3FF522 JORDANBASILIERE
438,371,512 *2C6E361100498DA8EE26C54706FC9D5E338FF6E0 1AYANG
438,371,513 *2C665499B770A800AEB27A29F076F27184A3406A a5(8d
438,371,514 *2C6BCEB0F85E1AB70DE543E6C6BAF07366B7567A 1.connectionhe
438,371,515 *2C609590B6975D3907684EA6A5E93AF7A25E0F96 a5oor
438,371,516 *2C64AA01D8598333C41098E1D2453665E0605992 josuewolk
438,371,517 *2C60ECD6D72480431A14C13BB8B6970A4EABE36F [email protected]
438,371,518 *2C69E511FB4D0DAD1FFFDF66918F46741D75C786 JOYCE.TONEY
438,371,519 *2C60EB67CAF0866937763B1685C4C6E3FC10BDAD joy.marie.tan
438,371,520 *2C6FEE635089A4A6A57C9143BDA66FAA2385C897 A849C
438,371,521 *2C63E653FD78F48138F91AEC03EDCF2464F38B6B a++a1na8l3n3$$
438,371,522 *2C604F90BC019EDFB46435EF42C8FF7EF1746000 AAAPE
438,371,523 *2C68B6C32BE6BE56DC96F92E5DCCF41472D209D2 1KESKUSSEUDULLA
438,371,524 *2C6837213E0F053DCC870F6050685920644B0DA0 1.KIYASLAYICI
438,371,525 *2C647D8A92DE6D965416E85164217F364B20DDFB 1-kreis-schiffahrt
438,371,526 *2C66FAD4BA0891A7772236858A5D9242CB425359 aabAd
438,371,527 *2C6C5E0C83E2B4D5B7673D139E8D42B901D30D8D k054400a
438,371,528 *2C66856A1DB16ACD839926910E7639ECC047083F aadbr9
438,371,529 *2C6729D3ADB6D5FD2DF99F962FD2B8CA54B62103 karli031
438,371,530 *2C6198CB325910EC63B9F06264E8DB125A7B845F kassanbaum
438,371,531 *2C6CA843D03B354ECF4D92C7F814FFE48B63C99C 1.PAPERINKOKONAISVALTAINEN
438,371,532 *2C69735902C1EF1BF57B1B5565E827C5CEDCCEE3 1paypervote
438,371,533 *2C6C9E507B199A7CB9A4BAFE20B362397FFE5116 k-bit-cipher-feedback-(cfb):
438,371,534 *2C65B084C0C90C75ECF2728942081354E337DF16 KENAGUSTIN
438,371,535 *2C6955737CB4B6AE6BE49918EDB55E7CD7308063 1.sleeping-car
438,371,536 *2C6C9FD6AAA6129C6A30AB18E942FD23EE738863 1.sprinter-fuchs
438,371,537 *2C6F5DDAFA985FF3995EAE0240157C4F69F0CD90 1-stensileit
438,371,538 *2C6BFA07B7CEC741AF6326F9E964C035E7EEEAA4 KETRANONG
438,371,539 *2C6C54E5883588928414E790E7D5050B10CEBC5C KEUQTDIW44
438,371,540 *2C60A87F1EAE8A210B77D1480A14A7249250B389 1 TURNER-KERR
438,371,541 *2C6B61A0E27B0EC56DD48D0BF9E89CEF818F11EE 1TW1T5
438,371,542 *2C6C6ACE74D71C2F89990BA12509644E2E46E682 1URUK-EXPEDITION
438,371,543 *2C6F0AC0CDE7ACEE23E389F32D2718F2B38F1D97 1-VAFTAAN
438,371,544 *2C6A52422A59B80C3616FEE5C5E456EAEDE98C3D KIBBLERMAN?
438,371,545 *2C6092FB238826F0B47BF3AB52727E9742644820 kirtlar
438,371,546 *2C65C67FACEFA6768E3D31015646272AF14FA32E a day in the life of a preacher (feat the birth of oh willie)
438,371,547 *2C60A59647693A4756AC66D62AD4F1522D6E458E のKONTAKT、
438,371,548 *2C667FDF2A87FE5022986D00785F601CE27E073F KOYMACAKSAK
438,371,549 *2C64BF9EBC2D2C7359BD48FECDE00B23679CE181 [email protected]
438,371,550 *2C693377CF4DA5DCEEC5B15E78D687DB716EF6AD KRUMMHOLZ2
438,371,551 *2C67F3F0F8DC9A2E8DED396FC180AE015C91E02C 2837814 syntyy-ep
438,371,552 *2C6DFA913B9945AC97960C6E27ED67A15F8A4A01 2AANHANGTS
438,371,553 *2C65D9457D4EF34FBD947ABC0FA568C596CC9DD4 KYOHEI
438,371,554 *2C62C9136A0BC287E2AB389EAF019FD42981BE8F 2-esikoisohjausta
438,371,555 *2C6CE480FD9919FFDC45DF04189BEE619F21D6DB afborsteling
438,371,556 *2C6507466E0BA6876C5373171B62AFA26FCFAF65 [email protected]
438,371,557 *2C69DCFD2FBDCF6B928C9ADDFD43D676CA4E750E LAMONTMOALLANKAMP
438,371,558 *2C6A9218B1484844A132B11ED6D3D560C5B91E99 L'AMOUR,TOUJOURS,L'AMOUR(LOVEEVERLASTING)
438,371,559 *2C60354A3E3CDB417A052B4E73E91C702CE805E1 AGAZGA
438,371,560 *2C6BD2AA8288B4D1531BFCF9C2A2611296A8B991 agmv)
438,371,561 *2C69C60AD1BFD31BDFDD055C0B8CA6D0730A289B lannynavo
438,371,562 *2C6E8DC3001637AA9F009808AD68AC20EED8D3FE LANSARS1
438,371,563 *2C6B151F70EE977797A5273FC732F5D5FB75AD1D LARRY BLOSSER
438,371,564 *2C6BA9807B969C23DF0B18DDA5E4EFF7F4C3F1AD AHANSONS
438,371,565 *2C6AC7AC0A99DE13D889907E2513731D4B64007F [email protected]
438,371,566 *2C69EE78CF0A7CF6125126AC3E804DF5217FB645 ahwlt
438,371,567 *2C6708C960E5AF1EBBA53133BD6AB2A9B6E9B295 LCHITEK
438,371,568 *2C6281A61878E4068A78C504341E140629FBF4F7 LEANDRO.MALINOVSKY
438,371,569 *2C69B795F5ADC3E78277269BF61627C693D153A0 32FA881503ED3774E0440003BA962ED3
438,371,570 *2C6B88166939C49923C2897BF0ECAD493D4EFDF7 353368 muuntogeenistentuotantoel
438,371,571 *2C6290EBF7687837B6ECF0BACEAB9D31FEB6104A LESERINITIATIVE
438,371,572 *2C6B22CC96CE7AB90606072A36956DE3DBA7FCEE LET'S ALL DANCE THE PITTSBURGH WAY
438,371,573 *2C60BD0EA21ACCFDFE50C3D1C1AC6BA2BAC715FE 3FANTASE
438,371,574 *2C641C2A183A2950E2A943DC22A6CCE9E851A08F LH5B
438,371,575 *2C69A36631D94316A324B8599916E2BEDD9BDE41 aj1&
438,371,576 *2C68FD473FFF95181BB47777C8E7E7FA026CFB2A 3MYLABTEC3
438,371,577 *2C6ACD8925E558905611D95D26395365D6D47789 A++L
438,371,578 *2C6D363D9E8448C0F371ABDEB442ABBF1268258F 3THEBLOWME9
438,371,579 *2C62B66AB18BE3CB78FFA96445C4B43861125AC2 LINGUALUMINA8
438,371,580 *2C69AA932E4A0502B33336D3F0343809570D8B34 [email protected]
438,371,581 *2C6C0946F1B13265C1B6E0E211906B6696EDFDD8 alec-coates
438,371,582 *2C63C37C4487CA1D3F46F2A579AA3959D835F229 aleysebaslosamo
438,371,583 *2C62E1EAD81D8757188CDA774A3FFD6DD694D85F 482kellen
438,371,584 *2C60AAB5D17B07DE558BA8BC173844D3B89E14C3 ALLAN.SEMEN
438,371,585 *2C6264DD890B0C0B567C739C6A60E5844F9169E1 ALLANTINIUS
438,371,586 *2C6412B7A23A7905E5016A1B9C1B67ACD081020D lmontano2
438,371,587 *2C6BC60324FBF0B561E91F4E72CC11700A8D5AB8 ALLFM
438,371,588 *2C63EB5E87DB1875B666B166F770ACB543B4E381 4LONGIMETRY
438,371,589 *2C69B690AB085C3462A443C9E0741F1DA83FDC47 lonnyfoggs
438,371,590 *2C6F8E2535388DAAF3CABA25BFA83A75F1DA5D49 LOREN.DEDERICH
438,371,591 *2C6F9852F3BD04989817D7C29663B073C659906D LORENREIMAN
438,371,592 *2C6C239A769E60E8D5B78C98E9B16D9B1FAB1B47 4RELATIVETIME
438,371,593 *2C68E86F8E0225BF885C0DC8D6479FA8426B615F LOVE0526
438,371,594 *2C69842D9E27111F8855FEF2C905E111FC90679C LSZ%
438,371,595 *2C695B59DA8B64A4A2E09AA7F00E8DD95D58E1E7 [email protected]
438,371,596 *2C6E4726592D04736109DFE0C8F7ADEB9640FB5E luistervinken2
438,371,597 *2C69A762CB3E40BA41B48F5EFE00A58EB15ADC29 [email protected]
438,371,598 *2C6CE9DC3C18409298D2DBBB657DEA15E38CE427 [email protected]
438,371,599 *2C68A7430BE2BFB202B1E740C9655A8854844998 LUOPINXIAO
438,371,600 *2C6B2FDE90321F14A9F406AF31E23EA45BEA7657 585KALE
438,371,601 *2C6B72FB40AF011EBA1E0EE8C5CDEF23FE1728A8 LUTHER.MIEROW
438,371,602 *2C66BD09BD8682F478DB955F44292C27FFEE0BDF 5ARCHIEBUTTHEAD
438,371,603 *2C637BF0DCB9B7FFA93F148A0B5330C39B25796A [email protected]
438,371,604 *2C62F411DD0C00FA5EE6CDCA4F9D7C34BF347B6D [email protected]
438,371,605 *2C659074D964034E267FEEAB7F1120E9E5E1D5E7 lymangianino
438,371,606 *2C631B1705CD916E9BE51C3953B9DD8D22A69A80 5BSWSANIJABSW
438,371,607 *2C696B7D1385CFBFCBD58BE22F2EAA3BE1EE1D0D 5CUMM357
438,371,608 *2C6B9DD8C9992B6B5B4AA1B125CAEE56897CBC2D 5EN5U41I5+IC
438,371,609 *2C6F1379381256A452E9978079E17E05CE837816 5GNINDROY
438,371,610 *2C61821F4549EF746CE76E77EA4140915EC3C72F 5ISCHIOIL
438,371,611 *2C659EA0340745D4673EA653B63F18E74BE11655 5UNTERWIES
438,371,612 *2C65CF9D2B0EBC2B6F01DBBC89C406812F97A7DA 643gst
438,371,613 *2C6E73B965309DC4CB0650426D1CF3EA41B107B9 6LOPETTAMISPAEAETOESTAE
438,371,614 *2C696E8C8AE3D0466E276F701C500C9F8C9419B7 6 MESSIL
438,371,615 *2C60DE40FC252FF48C99BA26D321424CF3D16893 6NTALIZES
438,371,616 *2C6DAB4CE722BACAF7419417CD3D24D223CF4C2B 6READINGNSS
438,371,617 *2C69E279A944406796A241198505A9FEF06C3444 6SIMBACLOVER
438,371,618 *2C6ADB9A8C94D3DAACDC45E0AD27E71B73B0EC0D 6VANNCHADWICK
438,371,619 *2C6EA40C40E6C281B385FD27FA58CCB4308DE5D4 [email protected]
438,371,620 *2C6E7578F52BB59ADD7407135A64F8046D207668 (00)**q#####q
438,371,621 *2C618E11953F386BAD2F384FAAF14D4761F7B2CF (_0).~.`.d======P
438,371,622 *2C66E2BCD6F701FD98CFC84F485FBBA4F14E2EB1 0ilovebootsie8
438,371,623 *2C6E6D5CF23E3E0091B3CF04920109BA6955F318 0THETYLER16
438,371,624 *2C6967A538D05261F64A4BF0F42CF55398FF150B 1108soldierz(feat.mcslangdick)
438,371,625 *2C638C924205D4DE9E557D20CFC3835B3871A435 1239604 L
438,371,626 *2C6D8DDB579C1E3DFEC3A1B7B4C3754EABAB7522 123go
438,371,627 *2C6CC2B869DDE67C17EA72861F5B80021E5C1287 1744090 HTML:N.EHK
438,371,628 *2C6668950D670C0A65FC9E60585B46DC0010670C 1899885 OPPIMATERIAALIKESKUS NAUHOITTAA JA LAINAA KOULUTV:ST
438,371,629 *2C640C79FDCEB6873D6D93713CDBD66E98EAD245 1923783 SUOMEN MUAY THAI - LIITTO RY JANNE MUSTONEN .
438,371,630 *2C6FA4B1D18474D1CFD3A2222D29E917F8D92DD2 19341403
438,371,631 *2C6FC320CD99EB9A850FDD4BA31F740D69A486E6 1DEC1229
438,371,632 *2C6C591526A3F418068A6E5BCB199FE922614A32 1 EMUOHJELMA
438,371,633 *2C6E75A9F79B112E42722CAE9818E8F78444E0B8 1 gasolineonly
438,371,634 *2C6671A85D0536E1FC22B7B2B2FBDB774F7605DD 1-gaulywood
438,371,635 *2C6390B1C44DCDA27AFA208C8AC801A198D1166A 1GWMAPPS
438,371,636 *2C624E0F3739BBA76E1837105E3BF99BC1E79551 1hein
438,371,637 *2C6CA0105D6D198312517AF2372CD18F2F62C3F3 1kegverschluesse
438,371,638 *2C6C33B4627B7064047B66FFBB11F9DCA4BC2F00 1kuollutproomuonnettomuudessa
438,371,639 *2C62CE2DBE9129D3057F6C998ADD19277BCFC8A3 1 LOTUKSELLE
438,371,640 *2C66C7A5A8153511C0626907F67BA45697B827F2 1.maailmakuvaa
438,371,641 *2C624BBD0C5717E8E963174F4593CE317E08DA27 1.MABUSE-MAUSOLEUMS
438,371,642 *2C6424A74D41E12C81086E4EC6FF2D904474F000 1-MARKKINARITUAALEISSA
438,371,643 *2C6B0FC5E82B62C70867F13F6A10DAE2D862B741 1nakertamiselle
438,371,644 *2C68C571C274A36D1611AA1AEE8A745C6815D1E4 1.non-information
438,371,645 *2C65FFE51DAAFBB50E9D6FD1B4193F37F2622BE9 1-RADSPORT-EREIGNISSEN
438,371,646 *2C68084AF0AE72F251948DC370D50C5065D94A8A 1reinvestriert
438,371,647 *2C6899DDAF5BFA74B96DB31A379096338B41CBD4 1-riverboat-tour
438,371,648 *2C6076162313CBCA35D025585FD2A4B7D743EFD8 1RIVERSIDE-LOS
438,371,649 *2C68A15784F0E644C2CF8ED6EA4D30041310012E 1 SSHOHJELMISTOAAN
438,371,650 *2C6692AE68D2DD0BD783CF19D8D566AE51CCACE6 1.syntaktiset
438,371,651 *2C6381656B94D1CEC8A7A2546254B63FE80657A2 1vikahuolto
438,371,652 *2C69F354949B6A9D467D2AD5841A41C260487D39 2016553 MUNMIELEST
438,371,653 *2C648FABCA84A599A2A001EF60008965A5AC165B 287275FREDDY4
438,371,654 *2C6A89939FFEFDEB27ED6670943929E5C2D62EF8 2-aioastaan
438,371,655 *2C62252CB986AEC53A1E31F53A087552C8291005 2ATSAKAIS
438,371,656 *2C6243324FDBA5D22A783F0273B9461EA3AFCF60 2.avohoitopalveluiden
438,371,657 *2C6D200851A8156415D59164C2A03227CE269AB3 2hilfsflugzeuge
438,371,658 *2C68C4F202947E5F6EDABCE213C27960C3CA2916 2.KANSIOTUKI
438,371,659 *2C65111AC3C755E3157EEDB95D12A1404DCA4C96 2.kullanilabilmeleridir
438,371,660 *2C6CFE10FD6F4ACCFB430C23A8C8AE99BE7D9124 2-orientierunglos
438,371,661 *2C6AEBE5C851D2E9AD15CB0ACD876383D2182A47 2POETTEOP
438,371,662 *2C6E8A8CFDB0609500AA15D3B91BB9C7EC34E836 2thatspider4
438,371,663 *2C6CE5A41EE66973607CDE2C7954E8243C41FB19 32-asprilla
438,371,664 *2C6430714A4AAC02D4ACD05CBA092ADE4131A46E 34759 NACH DEM SONNEN PFLEGEMITTEL VERWENDEN
438,371,665 *2C61005B28D831161F00890E467F9A01CCA57521 [email protected]
438,371,666 *2C63D3E589B7136D30799EFB5CC27484559BD145 3AMTROSIAN
438,371,667 *2C656A2046C14208FC9F6CD22417C3D4A559F172 3ANAPHYLAKTISCHEN
438,371,668 *2C6B755C8B3EFA0C4D3009FE60A14F848CD500D8 3B<[email protected]=3
438,371,669 *2C6B54BCF9CFFEF95AF4E78ACC9D094AC5A91E9E 3##D.*.*.*.~0~O}X{
438,371,670 *2C68121B74078A45F9F678C5679545B5AC38AC6B 3EMOSILLUN
438,371,671 *2C60C0924B055E225F96CF265757BF359B9D805E 3ETKEIZSU
438,371,672 *2C6B3E1FB577B611859DEAA620E7A700820C2A5A 3otsot
438,371,673 *2C6270EA655264106787C1E86B2845C2640595D1 3 SCHALLTECHNISCHEN
438,371,674 *2C68498056EF58D7ADE82BB382D378AAC3A8D3EC 3SENSUMS
438,371,675 *2C60A096791F55A529EB35B93A59CF2C66093CB9 3sqltietokannat
438,371,676 *2C638F56891DAA208DDABFD1C0037BB53639A9C1 3ST4RD4LH4DOS
438,371,677 *2C65C7902ACC5632998B08C4777E52F64F8BE938 3sylvie1
438,371,678 *2C64F8BDB7C6464BE8BA8E93E3D50F6169971998 4AMPUMASU
438,371,679 *2C6F4FC5FBAE5110E6787B0C9B5FB09BFAEFFA51 4HORSESORION
438,371,680 *2C6D94ED7D70383CC27B8829E1BBB9ED2F397979 07061355
438,371,681 *2C6FE17F60BE2922445A9DB8A8BC97396B8604D7 4OMSETONTLEDING
438,371,682 *2C618F1CB4D64626932027DEF68EF189B081DA92 4PRAECIPITAVER
438,371,683 *2C6C5810E3263655267EBB816F08A13242F6E691 4RABZTEAH
438,371,684 *2C6FD24324085CF725F2B5897D1F7EAFBF653969 (-_0)**(#####Q
438,371,685 *2C6CE061A056B96A5423F4DCF21BD3C3DE0F1589 4UNGEBRAUCHTEN
438,371,686 *2C61026BEE39BCF6B1042364765177E7057FAC1B 514ERNEST
438,371,687 *2C6A33F29DA1B2EDCD1C2C9C66B732CA5051DE24 5726012822477F24FE999A1F7223C82A.HELLO6
438,371,688 *2C6CC5A8682918D7DB662EE4A06B73B1C613523F 5. ADAGLETO
438,371,689 *2C6095C68B6A35F07B4C6B1F18CAE66BDA2125E5 14543A
438,371,690 *2C61CCAC2C74D5011B77751258076293BCCB17E5 1648004 kyseiset seikat asettavat uusia vaatimuksia kansainv
438,371,691 *2C64AF8671A4153A134BD0F5AD7E7A49D9567038 5FDPWAEHLERSCHAFT
438,371,692 *2C6A37C5C732F42EC551F8C01B2865F09226CD16 5feudaries
438,371,693 *2C67D760EE1880ABBD0AF4E3D85860AD7BE474C9 1760264 mm-kisat ovat t
438,371,694 *2C6BFCDA2D00935E456E5178BE22C4C8E89AAD94 5GENERESES
438,371,695 *2C61F0266CB963054F041246A90A6A42AF43810F 19angestrebtes
438,371,696 *2C60B857F1E76F1170A5D1BEC23E3732E3BD3E21 5MAURICEMARC
438,371,697 *2C6767D4FF3AEA9213531661876F5B14D702FE8D 5MYCHANGEIT7
438,371,698 *2C6F5390839B694EDAD3BD22DBE1EA7933C029C4 1chinakracher
438,371,699 *2C6DFF0D02828333A00AC58D16265255C64F1BF2 5UTJEVNINGA
438,371,700 *2C65AE0853A16C6A648D7EDB842E75C8074E0549 1FROEDINGS
438,371,701 *2C657E72540C6FDA1D140AC9D097753E1F3593C4 1HAUSMUELLANALYSE
438,371,702 *2C663643AD8763E3244D336A56D773677E913F11 1hein
438,371,703 *2C6C4CBE1EBF933344E98386BE2FA8AEACBC2031 6ACCOCIATES
438,371,704 *2C61640DBF05A5E9EEC142B96BBBA69619CA80EC 6AMPHORISKOS
438,371,705 *2C6249F91616F806EDAAE67D9A2E459ECF4341D7 1KASVATTAARAVINTOA
438,371,706 *2C62D5C1992EC83ABE06F63312A18EF90D96672B 1.kyytioli
438,371,707 *2C69630C69F81E1F3CE0CE81AC2DEB641CF90D0E 1LEBENSMITTELALLERGIE
438,371,708 *2C6F983F37D7F324A584B149C19A68B1969A06F7 6NEWCOURTBUDDHA
438,371,709 *2C6C784FDA4DC146D93016C4F86A65FC41361B78 6NEWSJUDY
438,371,710 *2C60546FB4FDC164F40D4BA9B7261A7880176DDF 1.RADWEG-RICHLINIEN
438,371,711 *2C64CE7785A6176960181E85E70B06CA7F03E3E6 1-renkanneet
438,371,712 *2C628495F80863FEF3F66B495E47D60674DFF2E8 1 SAKE-BESAEUFNISSEN
438,371,713 *2C6FF2BE6DC594AF3C34DFFF6D69A6E113C5DFDD 6-SCHRIESHEIM
438,371,714 *2C66274CE5E787DAD0B69071604B4DC37B786663 1-SCHOOL-BREA
438,371,715 *2C68A677075894829EA6F4C1F62496B43E24AFC4 1sicherheitspreis
438,371,716 *2C626E9264E0E3F6C66DF0B4267BB90B9A0679DA 1tikamaktadir
438,371,717 *2C6E6A03EB30DD28DB782B60E905F4312812C1A9 743528 JO SILLOIN OLI AJATUKSENA OTTAA SE YHTEISK
438,371,718 *2C612875CD84870F232362969D62F65C0FE8B2B3 1.veriyormu
438,371,719 *2C6769A39AAD49269CD0841F9B60BAB58EC26261 7ACOMETERTE
438,371,720 *2C632E33CFD24A25557DD12B5E3B5F165925F3C1 7ANDTWOPERSONS
438,371,721 *2C6645F9BA70314891675683D670084B063FDC7A 7ANOREXIQUES
438,371,722 *2C605DE2C87BCAEE4F7102862FE4084EF6C8E1F5 1ZVONJAVI
438,371,723 *2C6D13473B1B51621718A8E081B4E0F5CA3C520B 7BUGSMEOF
438,371,724 *2C6DD96C82C87879BE7D65B149A055AD8103C24A 207196 "someofthemdon'tevencometoskateanymore
438,371,725 *2C6AA8E121479E3509CEDD6DD79834FD71DFD5B3 20SEPTEMBER1998-THREEWAYWORDS
438,371,726 *2C6CC2B81909A5D7DE421B08FC0803C4CC86F703 7EDAMNGIE
438,371,727 *2C64F349B45975FAE3126E171495C19F7A616107 7EKUESTERM
438,371,728 *2C668DB75393B044BC62DCFCD9407BA3B443A3D8 2158638 laissa.erotetaan.s
438,371,729 *2C6C5EB608B3C6F1D2B3248A3521532122251BDF 21dec1230
438,371,730 *2C67A1F1A2DFB117641607F5095E07C6A5CCC141 24-HOURSADAY
438,371,731 *2C67DB265BCCA58967ECD4ACB9D32E06B863BB75 266CLOE
438,371,732 *2C6948387EBFD603D6E4CCD66C799EF191EC2CA7 27-08-1326
438,371,733 *2C6B017073FC3C7301190BC211499FE686507342 7POSTMEDIASTINALS
438,371,734 *2C68CE505B1657A6A63510AC83F357751D47ACDD 7RIPRISTINEREMMO
438,371,735 *2C6DA9B1246AC133183214359D1DB94A0EB4320F 28E66C86
438,371,736 *2C646A4578EC963C072DE40904DCBEA61C9DD633 2ANOMISEN
438,371,737 *2C686B9B1368E6917B0E573E94D3F24CFBBB8574 7TREVORSNIPER
438,371,738 *2C67030C846437D490C588CFC91D6B753A8E0205 7UNREQUICKENEDS
438,371,739 *2C629FB4F7D93F3D53D28C47189B232F2CC6FCA2 2EFATMUNG
438,371,740 *2C6204D4E3469FC63669EE459D106D942ACE50C7 2EURO-OPAS
438,371,741 *2C6F8E00CA293DEF17A2A42E67AEF4F57F0DB8AB 81ZZ4RD$
438,371,742 *2C69E22A5A5018516CA1FC3E2520322AB5C46323 881421 VEDEN.L
438,371,743 *2C6B41D6D3FBAE47589F72BE8D921E4F9DD63CB5 2MALACHIAS
438,371,744 *2C65FA8DA4F446E0D1FEE9DC5E6FFB58F2FFEC5E 8BRACEUP
438,371,745 *2C65D63138CBD69A6ADE7F297A63E962B3696402 8BSWPRABHATBSW
438,371,746 *2C669F1BB4A7671D498A23732DBAD4A627A2D9E9 8CINAYCOI
438,371,747 *2C69F4A683057CE66CC313C2B2736F95905A6CA7 2subsitute
438,371,748 *2C6154FA84D79DAF33F2E11A98076231F5D33965 2THATHONDA14
438,371,749 *2C6B406557FEA964E1DEAAE55CEB3EEE7BA5F8F9 8HABATURA
438,371,750 *2C6166B1CD51CEC40F262B28DCFD8AD4B2E7FB40 3======)~0~OSPLAT
438,371,751 *2C660FFA315F53928774DBE69EB04498A87197B8 8NEDEILERRAK
438,371,752 *2C6131498174033B68C1BBD602A7B72B64AD8B47 8NINJATEK
438,371,753 *2C66E2171C2C47862197B59FE6EFDE866676A7EE 8####@.~O.(^_~)
438,371,754 *2C69AF3AFDAD57170672C85A5990E08B43DBBFBD 3D33507
438,371,755 *2C65897088C8EB9EA5D8641F00D7ADA605C9C5DC 3MSAEMSAE
438,371,756 *2C6D5798F95A958C9937DE0CB11C9CFB52BE81FB 908511 GANN'SARTWORKISBEINGSNAPPEDUPATALOCALGALLERY
438,371,757 *2C68C10CD45D3B58AC7D099D8178901E3E309287 450mckenna
438,371,758 *2C61A347BA8FEC5BBC1DA072B0DA2D2F6E48095F 9HERMESSAFETY
438,371,759 *2C63DE1DA5AE44CB16ECB69340DDFE74ACDE4193 9IINISIUS
438,371,760 *2C62A49D5DD5B00A6182F11CA25820937AC2E0D9 9IKASIJUF
438,371,761 *2C689E148913CAF0CDCF220262DBE0EE40FC0171 9IREINART
438,371,762 *2C6DDA9896564F579368B13939C5CE22D2CE2544 4G4RR4R53
438,371,763 *2C6EDEA6D0FB26BFB8829734A0F0B341AF005D7E 9LANOINIP
438,371,764 *2C6FD653F98EF0251B502BFCBB696928F1809A3E 4IFKIKHAR
438,371,765 *2C6F4891E623A3627F2B4C23666C942006026C00 9MISSYCOSMOS
438,371,766 *2C60B8FF9BDF9EBEF988C6246971FF94AE5D951F 4KAPOEN
438,371,767 *2C665A6AA713D46D35401146F48A51C19FBC3BA4 9PROBLEMBEARBEITUNG
438,371,768 *2C600C7E15214AB75AE2D34DF652D859E838AAEA 9RENTOUTUSHOITO
438,371,769 *2C63598737013B01B1AC6E01D8C14CA3B11242A3 4NOTICIBLY
438,371,770 *2C61CB4D99D4D4D908BB0193595CED3E0AEC62AA 9STARWARSRESEARCH
438,371,771 *2C63CA8AE02F7CB7757B2A69EFE902147E6CDE3C 4OTAJNOJ
438,371,772 *2C64B8016F284C271183D9F1CC553C04B60D8E08 4PUHESOOLO
438,371,773 *2C6E403832A5969DA2875009B954D500EE7F7CD4 9TRIXIELUCY
438,371,774 *2C6268AEC4E064CF1372559549CE71651B326394 4RABBITSPANKY
438,371,775 *2C6075943FA1E19E3852B9BD3406AE117CDE852C 9VERABSAU
438,371,776 *2C6240E411E69336900984653DA2A310045AD1EC 4SWEETIEVERMONT
438,371,777 *2C65184A4486FEFBFAC9C1C76EAF1D1454DB6A97 4TAMMYSLAYER
438,371,778 *2C6708E402DC1C3ADEF67550A7FD7575D62B0465 a104599
438,371,779 *2C6E57DE041A0F4538F17E559958BCE269E08CE6 a1?&v
438,371,780 *2C61D0BF80D33864E43F0C47FD029F4DD76776EC a6
438,371,781 *2C63D7058F26BDC83C158F96162FBFB7550C5927 AAAEZ0
438,371,782 *2C6A2C4EA136868391478F098C7B4AAB13530676 aab5jb
438,371,783 *2C66F8FA1DE855E8ACDE7A3569FE44F4CD5C5E7B AACGX>
438,371,784 *2C6698771C102A3424E42F11D24DE24C26AF7271 5RHINOPHY
438,371,785 *2C65730244D132C2B2A21C673BAC7D606024183E aaev/#
438,371,786 *2C67B0452571F7259380B8810B872B0C06962FED AA*OO
438,371,787 *2C600366923265E769F7D6510A1170501FDE815B AARTHISRINATH
438,371,788 *2C6DA630E6A829443513760B9CBA0440DB564679 [email protected]@T3
438,371,789 *2C6E1BD56FD17A44908E982AF4487897BD7916DE 5YZUKARNA
438,371,790 *2C60D327CE30B7FE5CBD0AFA779F36C7222D2DE6 60ANOSAOVIVO
438,371,791 *2C62A9A9469C8F606B7AE70D8CC6087C3AA5B003 AB,)F
438,371,792 *2C6EAB20D47D0384D1E9657DC34CBC834C7A8657 6BSWSERAITBSW
438,371,793 *2C6BBE3EAA5DD8A02A3851BF493AF36DA0BFED94 ABNQ
438,371,794 *2C6650500E30098E4E25D5477D495A9C0259BBFD 6EVENTAYN
438,371,795 *2C64578C419235780755D06561DCC9F5C98026C1 6fehlerursachen
438,371,796 *2C667B15482AE99261389A703AE83BF14F0ECA43 ac0e
438,371,797 *2C6608B39F3388ECB52EC8A37229AABD43483D33 6ISSAMRAS
438,371,798 *2C6E43ED833A7DA1E91B190DEE0BF1CFCCF1AF67 ac+f/
438,371,799 *2C674290271F33E1370A6394722D820E0DAC2D9E acn?1
438,371,800 *2C65720112AF182E1D52739F3209738D3F8ACC60 ACWFS
438,371,801 *2C6733BA03DA329C23B439C6664B798A7DC7F1E7 6SCUPPEREDS
438,371,802 *2C6FD57F054E00BCE4FBD447A4BF5F8DC5228A62 6SHELLYBULL
438,371,803 *2C69F2294D5CA7EDF0FE41122496DE3179F2CD51 ADDUZIONING
438,371,804 *2C68438D85AECB54E4C435FFE6B0C52FD15037B5 ADOLFO.FRITZLER
438,371,805 *2C648EC89B5D051C02241202A1E76ABBB02EF101 ADOPERAI0
438,371,806 *2C6ECFE0313DCF88739A857A07BE4B88E4629056 774771 mitboetschsprachmartinhalusa.
438,371,807 *2C6002A57B4AFC5618B976C06B4D63187F5BF680 776494 biz-o-sirada-diger-parclarimizi-yapiyoruz-
438,371,808 *2C679B99268CF85E77B16BEA1CC0BB57C616C7CB ADZWONK
438,371,809 *2C6EFA21B479EF86FCA659CA4F788B1C654FBD7F a-ea8
438,371,810 *2C6E4A3029D06BF13A54BA7C278DD29E9EA7882B a_e$t
438,371,811 *2C6AD760B03B5D710A29F853E2844CA9417762F6 afn8z
438,371,812 *2C6202B6457709EC39D4E4E62E48F77356E51703 agg%
438,371,813 *2C62B5E91C6BCF6F26AC10867654D1D1E582E9DD agmv)
438,371,814 *2C67B852334090A16F2BCA809AD3D680A33944AB AGUSTIN.WASHKO
438,371,815 *2C6014A934B1B63816630190659ABD566DE2E4ED ahl1s
438,371,816 *2C6549A5961F3301714A78386F50E4FE53F30F21 7RADIOPRIJENOSI
438,371,817 *2C69756FC490319318FA25EFB429A7E2AF2E6A0D a=hot
438,371,818 *2C6AA2810A2915E1373B6AF4D83C74AA6637AE3B A>|I
438,371,819 *2C6BBE3B8C9974427D5018AE451917FA1D53BC5F AIRSHUTTLE1
438,371,820 *2C67AB4DD8136764DC392BCD87B0D33EBE84BEC7 81A4FF7E-7EC9-33D0-A3F2-75B9673D1340
438,371,821 *2C6DF5EFE268AAEB5733CA43F6E19EF1C32CFFCD 829125 vanha-ty
438,371,822 *2C6851F616EB4359E0309CAB940E713E606A4492 a)jxo
438,371,823 *2C6955626D524790D2A1C1E25A3E7C323B3D282D AKELABSW1
438,371,824 *2C6D8751BBF6B473A824371355257C81AAF0B8AA AKSHAYPORWAL
438,371,825 *2C6EFE6CAA3F7C813325FBC5037CD729B5A01ED2 ALBERTOMASTERMAN
438,371,826 *2C6BE70F4A94C8BBF52B6B04142C997226400A27 ALDENMARK
438,371,827 *2C6CF18BB7511F4328DD73FEFBD4325F6346093B ALFREDODOUGHTERY
438,371,828 *2C61F59D23BEE2BEBDA40D239489DBE098EA6F97 ALKORTOBI
438,371,829 *2C6F5EC9BCC80D6506808AB1BEA52FDB31A32C59 8===>.~o.(><)
438,371,830 *2C60E73BA1811FBC5D55755C863DCB11C91A2BA5 al_lr
438,371,831 *2C68FB0FDA20C32B7DDD1C1F5E9C7185CC79BB3C 8PLAGALPLAGAL
438,371,832 *2C6B136525F04A0FAF1DD086A0983AADB28CA32E 8##P*.*.*.splat!
438,371,833 *2C6A6850469BAAECF78F15B4C2EA20B142AEE71F altuloring
438,371,834 *2C67A190764541B2491D1809EF3466FC3915A576 ALVA.MCKEIGHAN
438,371,835 *2C640E4EC311E2CA890EA6B235394C544D5DA0A2 a?m4!
438,371,836 *2C64EF8F3F44075D0F8D3D794C9973BB97802DC7 AMMARGONDAL
438,371,837 *2C6193AC66EB5C600AA0173C085074142FF8E105 AMZ0Z
438,371,838 *2C6669FFC7A2C5B1785A0FDD8F85253FBFA168EA andersonmarsaw
438,371,839 *2C6D90D68F6A710175853F2617CB4B038C1CDAED and-here-i-stand
438,371,840 *2C63F2DA55C3C3A137637632118D2692F5DBA5F6 ANDRES CANEPA
438,371,841 *2C684A53DA8B589CE2600E4517EF048E8213DE9C andrew.berberich
438,371,842 *2C63E6E32F84C08F6255F715D584EDFB46499580 ANDY.CONERY
438,371,843 *2C67CDC2D51B916F503210FC0A52FD3994256837 9GROOVYBYTEME
438,371,844 *2C69DD93A6D47152AAFBC033F58E47AC50AAFE62 angelie-bautista
438,371,845 *2C65401A4DC5C7AC85F75D9AA1EE45A9A583E71F ANGIEMAY8
438,371,846 *2C6DF3A03F1A88889E2A1D4B15BA1AD0304B329F 9JUDICATIVE
438,371,847 *2C629905F90875573D60CDF28017F23DC459D103 An+K
438,371,848 *2C65390024E5103E3149D03ADA08F0260038A03E ANNETTE SERCOMBE
438,371,849 *2C6E7395D56E6A4D590DF19EEF41FD2E41F78115 9NONCEZ
438,371,850 *2C6E74EAADEC90795ABC3120A04F07A69C39A233 9ODESAPPHIC
438,371,851 *2C67B69CB7675CEE3FD7269D468D4F407FD5B447 9-opetusteht
438,371,852 *2C6CF5CF020316680E7CA5D58ACF9AD14B637700 ANSHULDHIMAN
438,371,853 *2C64703C8EB02921F80604CA82A6A6D0FBE700FE antoinekohout
438,371,854 *2C6B92305178DAA5F58B2B6BA2A7C2EAEBD9CB6B 9UGNIJEZDITE
438,371,855 *2C65322817CDC443D0C705301622BBC54E5D19DE 9UNDERSTEAMROLLERSTINK
438,371,856 *2C63F92272EB477BA91952675F5FE663ACC6926A AOLHJPEC61
438,371,857 *2C6138794CD50E3761DA8EB3BBBFA30651FD83FD ARGRANDOJ
438,371,858 *2C6B94755064395539EC4F6E4B0EE7A7246ABCAA ARJAYMARANAN
438,371,859 *2C62930AD6AC64DB4075A9C24C15865D8ECD2E33 a9.lp
438,371,860 *2C6453F9D5945F8D2B75B1B48681E809B09C4BF6 ARTHEROSKLEROSE
438,371,861 *2C6923DB1EEA4A2AE03F72E1F2CEE5747131A6D7 A..s
438,371,862 *2C67E5446CAB35F0B3AAB3CF40008315919E7911 aadhunva3
438,371,863 *2C6708945E402371436F3445E838DE7E77E30E71 AAFOMQ
438,371,864 *2C6274557EC4CCE68691B07F0484B0DA0D7CC3E7 atwmd
438,371,865 *2C627E523B462E8E4A4631DCF554FAE79B86AAA1 at互換機とは異なる独自のアーキテクチャを採用したり、pc
438,371,866 *2C639BB1AED269FAD35C1219BF1D302161C09968 aviserons8
438,371,867 *2C6539AAC4D3FF291B47BAA38AC9945713668A3E ACU(Z
438,371,868 *2C6113991FEC3B10A21A668C6ED55CF9D838B0A6 ad%M
438,371,869 *2C618F1385A1BA84756A5858A96193F5E4968F3A b02_7
438,371,870 *2C6C1241666F7E3D32517B172A249B9F457A0A1E B0TT1E-$T
438,371,871 *2C6295AD883958F1B8AA03EFB96CA6E2B71CBB5E baberuth_bday
438,371,872 *2C69184F673A1DBF57666075E131F886A75F6A50 [email protected]
438,371,873 *2C6EE0E6DABB85766BAA10CBC712C68577E0FE3B babyclos1
438,371,874 *2C61F9491B9E4C33951B3315596957523D3A7143 badnjevi7
438,371,875 *2C632E1B8CA3BB1E68E739749A07FBBBFD54EFFB AIMD)
438,371,876 *2C63A4FEBD42FDDE1880C7233B369D16DFCCFBB6 BATTABLED
438,371,877 *2C6A60B9512350037389CBBB76B8DC506C414ED5 AKIHETO2
438,371,878 *2C68D062086CE21C3B7F3A49D07B2454250195AA BAYERSKA1
438,371,879 *2C6CCEC86DDB16ACA96E51F887F7DDDF9309EC93 bbea
438,371,880 *2C6D5F332C186B0843E2963046C3FE5BE73300D4 ALAN.CRITELLI
438,371,881 *2C6CA46E2189328C28A19CE0E9B95A61B09CF31C BC5%
438,371,882 *2C64D3E6C401DDA3DF78AC251929E5367F4BE825 ALEJANDRO.SELSOR
438,371,883 *2C6645BBF822DA33281F6372AEA7182F5246AA1F ALEXANDRAAMARAL
438,371,884 *2C6E5BA48F478F19B6A947C3B568BA91DE23F52D ALI.VANLOH
438,371,885 *2C63496B97DE664615F6B4EE11BF122A3A7DF0CD ALLAN.GIAIMO
438,371,886 *2C6CF98670896DE2FF0D1311D14E7C296E154C80 beautifulaurie
438,371,887 *2C649A16B6800AC399EBA248B6572562CD5714E2 BEEARTIJ87
438,371,888 *2C6F0C9E9DD09C06FE4EF058D69666DA65B5FE6D alpcs
438,371,889 *2C6C8F5D19B7145BA88750D6EA55528C43658879 altonhong
438,371,890 *2C67B30689376067873EBC968D401BCDB85746AE BERNARD.COCKRELL
438,371,891 *2C64004086675F2C27828C96F84B522A6DD21B42 [email protected]
438,371,892 *2C6D102F2485F3924DB3598607E9AD0E42CC9E06 BERTRAM.BRYSON
438,371,893 *2C6F8F4439E33E5836F57AB81553AA223E253C32 AMILO2008
438,371,894 *2C656F462C13056E8C832BB59E2EEBD263E17087 AMY-STEINHAUS
438,371,895 *2C6AB408FDA27CBB3DF55BD619D888EA2CAB775A BF$KL
438,371,896 *2C6EA5FCD9EBD2C37D0901EFCB4B73FFF7ED6C7F ANGEL.FEATHERSTONE
438,371,897 *2C669C6F3EED3F64D68A0A1085E9F63D7201C7CD bhea-nicole-patente
438,371,898 *2C637BC26ABC170BC2682C98A1E8B4337FA55771 [email protected]
438,371,899 *2C638A9E7EDBFE7526C33E7CD97AD9AC4180188A bh+k!
438,371,900 *2C6544C88A0B5CED9EB11E3219855EB4C97C8A16 ANMODAS8
438,371,901 *2C66841AC22FF3DA6140286204779E2379DECAB3 BI!GM
438,371,902 *2C6E29CCB4D6BDA045FF5A5A63D2174EBDA6DA01 [email protected]
438,371,903 *2C6B00FD0E84B9338E0D4397D8E068A0CB4E6A9A ANTRÉE
438,371,904 *2C6D1310854ED0499EC11A57220D58628D797175 BIZARDNÍHO
438,371,905 *2C699A02F7A7D36AAFF4FA21089A8C9F7BA4B7D6 BkAo
438,371,906 *2C6E6CAA1DF151A95B15D8E92DC36A8E7C283C76 BLAKSTIL1
438,371,907 *2C646E996F2CB643937C1820CB72D76A4AAA1C0A ARGHOUL
438,371,908 *2C6FC32DC4ED17F3B01F5BD5B9541A12F5F4EC08 arl/&
438,371,909 *2C604EB465D088916936CB18A8D4CF1C5E8BB561 ARTPAK
438,371,910 *2C6D54C3476410AC123AF23199340D6386BBADE3 b(oc
438,371,911 *2C6E6CCEE9A8AFB74B25B05D26E3FF3BF4CF7BA6 ASENDAN4
438,371,912 *2C60C74C2DD5A540D4C470D439CAD400AFE0BC39 bommelear
438,371,913 *2C6681356027ED8FD286AA9C3FDC5F2BA0DD30B9 atattepsos
438,371,914 *2C60AF78CC8BCE7B26CC38C06F54727C030812E9 B###P~O.~O(_0)
438,371,915 *2C6A470A8BF9FAFC4D0797DFE4483FA8E9249EE0 AVC6
438,371,916 *2C67BE6915119A589E5045DC8236A8BC9B28DE57 brcwi
438,371,917 *2C6EC74679F4BA0CB03D4E43C62A091B5FA9587B AWON_
438,371,918 *2C6C7D2A55924943D4E06177F49259082AE79EDD axday
438,371,919 *2C6306BE3DCB64530B699515DADCF4AD24BB0AEA B#S/
438,371,920 *2C6533283D796150FACA0F0C993EA7B72639F32E BSWJJ
438,371,921 *2C6E0CE846168A6F9D41A67FB4F1F27FBB2BF6EB b%$3a
438,371,922 *2C67AFD9D068455D9F02A189930A94F171D2E6E5 BTOC.
438,371,923 *2C6C7A1D7143AA62D69299436347BD96175F44E8 babycoh!!!
438,371,924 *2C66EA0379590787AB028CC9C0B0D23F01CBD735 burtonballif
438,371,925 *2C6E5587E7F3FD5D98D56960CAF7AC85998A4BAA BURTONTESTER
438,371,926 *2C6D10A4F2A077943848823E742DC6F3857F9E06 BUSTERMAX1234
438,371,927 *2C6EFF64657AB6C32BEAB12386F15BE9949FB57B bv-
438,371,928 *2C670B3210E0AA7F45D51A9085DD54970BFD0EA6 BARRIO CHINO (INTRO)
438,371,929 *2C68A755ACCF19176645119F4B077F2CB1773158 [email protected]!0N
438,371,930 *2C620E368D50FE8ACEB30A40FCB07DBA00F407BA bcv6h
438,371,931 *2C621EF3DBEB43914461A23390110E18F56E60F3 C149331
438,371,932 *2C62215CF3C4348610A7D446AA344CE75934FE63 bd/pc
438,371,933 *2C622713A317E6271EDFA86356B60FF0B9FD11E9 belsazar:.act.iii..recitativo."suche.nun.eilig".(cyrus)
438,371,934 *2C60134B821471B887FE20C22415B9361B48BE7C C&5U$
438,371,935 *2C6AED48CCFDA6B073CC19AB7F919613AB4E6CC8 BETOKENS
438,371,936 *2C604B3DD7F0459890722D1FEFDCA6D290C9588C bgjli
438,371,937 *2C60E6A55EFC0C79107495E3FF0AAF6DE0395B86 [email protected]
438,371,938 *2C65E0BBDB13E2A9DF9AEE0B789FF0F87F16042F CARLO.AANDERUD
438,371,939 *2C6688B432B37E1C83D5DB72F79592E53B63B3C5 CAROL-VALLA
438,371,940 *2C69DC640542297B03F97FC7D780DB726690E82A BIENENTRACHTPFLANZEN
438,371,941 *2C64A39381254A14262DB153B91026E1991893F3 bigdr3am3r
438,371,942 *2C66146EC63F820DC4A21214E6F561537F2E1E59 BILL KAUL
438,371,943 *2C65C54CE9AC4783EE57EABB4C531BD01C7E8B8D bi.lp
438,371,944 *2C6FA1A4CA018A32EA0B70DF4D6DD38889E89B59 bjgwrkt2
438,371,945 *2C6723B5C5E93209C050E32F95FDD1294944D3AA [email protected]
438,371,946 *2C609E1EFDB9E6F38AD81A6A667AAA5D39EA0AFC ChapterI.TruthofBrave~Onimusha2MainTheme~
438,371,947 *2C67C64781B4FC764E5E87C7CA01A9515B2286F8 CHARLIE.MINSKEY
438,371,948 *2C6E16C7CB36FC54263B9694B81C0D52724F16CC charliescheyer
438,371,949 *2C62091282E0E38DAF3921804C47F8B7B145AF9D [email protected]
438,371,950 *2C61AF91CCB988438075500B325F16E3DDC44E36 BOOK18M,THEIMMORTALSHIELD
438,371,951 *2C6ED6FE1CAC382D9804EB0E94EE13423369FFBB BOYCEHALLY
438,371,952 *2C68A9253E453F2DCDEC63F0E600C3A08DAD9544 BOYCE.SJOSTROM
438,371,953 *2C600F557F504EEFD3174681E619E9CBB6A4C854 BOYD.KOPP
438,371,954 *2C67EDC4E4DF80D1974B05E6A8412448D343238B CHIGODHO
438,371,955 *2C69D98D1E7CDC55D28ADAAD6454B644E7EC3BBF CHILDREN,-JESUS-LOVES-YOU
438,371,956 *2C6AEE3C6052DF56A51EA11B956167615AE89FE8 christmaswiththegatlins
438,371,957 *2C69C84D410B431FD2E45BC538261644ED0DFCD3 CHRISTY-LOVE
438,371,958 *2C6C3C11905C525AB1A3544D5B7E2AC1C339C366 br3is
438,371,959 *2C6D0169862BE3C4AD402711EB4500BDD2D0427D CIPOTCERTEM
438,371,960 *2C600EE60DEEA6225A89711720AB2271C112E4A1 clarencesangrey
438,371,961 *2C61D515197310A3E9A2AE354FF823AF7E2205EC CLASSROOPUPPIES
438,371,962 *2C6AB44BF35E606A34A5FF3AC5DB8C17377B4FB0 CLAUDEKULAKOWSKI
438,371,963 *2C664E628FC0F34CCED101312E000F3BB82E120A BSQRH
438,371,964 *2C66FBB999AC2298D7CCBDBD587F3471F6D0E2BF BSWIRONHENGEBSW
438,371,965 *2C66620CAF9DAB2D436F91F17F369A4A11651B67 BUDDYLOZANO
438,371,966 *2C6CCF6655E1CFCAFE165DA30CCF437C981F561C C#M7P
438,371,967 *2C6F93ACA9A353B166605112341DA8C3293DA5BC b)vp&
438,371,968 *2C6ED27045BC51E956A6B260AD8C136F16AF98E8 BXM8K
438,371,969 *2C6837782C7CD5E20F884BB953F23F5433DFA8B2 COMETOSTERILIZED
438,371,970 *2C6DD1D0FE386F41AB38D131C2E9450020098CE5 CONFIÖ
438,371,971 *2C6CD441CDBF2315543FC2DCEDDE9617145453DF C0NF3D3RATV3
438,371,972 *2C6DAF0F453DC7C60356F0FD15A9817623AFF941 cornwalls8
438,371,973 *2C68DF083C3C1B2D91F613217FA4E069D77BA7D9 COUE
438,371,974 *2C6CFF1CAC57BAB9EF5B1F8E362C5D248090922C CP5312
438,371,975 *2C6BBD58D80544FF71BA1E31B1D01F2D290D969D CALGUY42
438,371,976 *2C6C37274AE5A2B11D5E1D190E697BC49EAA6E21 callum-rae
438,371,977 *2C6E6AA331F008E6312FD149C66C6C2D588E8D3D CAMILLEI5
438,371,978 *2C60FC8DF9BE481A7BB8C5D8F17D2AE681D06F95 ctf-e
438,371,979 *2C674565EE1B03054653353313014B30D31E1A36 cu2w5
438,371,980 *2C62A9EBD815FEF4B96DD77F847248CF05F2F704 CYRILITNYRE
438,371,981 *2C69D0132B5149B290C18E009C1790D94C7E5F24 cyrilrosebur
438,371,982 *2C63720B5B3C36F3837B06580CBEB017E2575C69 CYZICUSI
438,371,983 *2C619BC30A6FA9F42E753FD8A513EDA13E71CF95 CHADNJOHNSON
438,371,984 *2C60858C95911E7F31D3D7624E9E352139C68958 d3he=
438,371,985 *2C6EF24E536D22A1EB23C64A77B100550CC998A3 D8(5S
438,371,986 *2C6811DE01971EB043A0F8638A5CD01164E88CC0 [email protected]
438,371,987 *2C6B674A45CBAB0516F78A9C3143F8626438A30A CHRIS-FIEL
438,371,988 *2C6840F675FD7F5D64A79E3738B7F9980A51545E CHRISTOPER.SHIVE
438,371,989 *2C6A8F9A77B34A67F8C8F9DF0762CB717A29490A DAM-Q
438,371,990 *2C612AD31E129B4785BDD0F080395FA3CD5A0E9E danielleqwerty12
438,371,991 *2C6C6519FCC0F48B6B4F7FEF63C1B2E7D6E6AB04 darelllaminack
438,371,992 *2C6F0AA224D2F48F78DF19E92607A40002D1B6C0 darinrocheleau
438,371,993 *2C6F240C17567A3CBADD3B56182019032DA00EB8 dariolavole
438,371,994 *2C6E3D2F57543657118598D726638E8A358AD42D darner
438,371,995 *2C6104AE094C7AFB7379E71EBE6B9C3959C70C8F DARRICK.MCCOLL
438,371,996 *2C669F1340A003712226EA744077242A1A527958 darrylprestia
438,371,997 *2C62EF7B15BB6C694BB793D971BFF199B7036E5E cl.$=
438,371,998 *2C6E6B4181CAC920313F1669022241DFBFB6D5DC claytonakana
438,371,999 *2C6FA63E9BFF6432C571C82D4E0B80AF40474DB7 clemal
438,372,000 *2C652584BEAC425BFC1AEB49FACEF8440D4153D1 dbxe0
438,372,001 *2C6FF1D90B0DDBD5A575FAFB3D79B23B52691FB6 dc*o
438,372,002 *2C6BD4F1F4A97277D5DFA18BF3439F9C811C9347 deeddeed0
438,372,003 *2C61E50D8F5B10278CAECFCBACB138DB4343EA90 Cognacoi
438,372,004 *2C63F67ECD74895715FDCCAAFF7CF563869E9AB0 colby-garand
438,372,005 *2C6BB64A9501407445C906649957067B348F6C34 DE&HK
438,372,006 *2C64D083EE9C090CA1B9A4B3581C313032449552 [email protected]
438,372,007 *2C6276BBAD6804555BE204B7AD030A1AF8D896BA DEMLAERNU7
438,372,008 *2C69976277EDED7FE3301100313856F87CED83EB CONCERTINOIINEMINOR,OP.1:I.
438,372,009 *2C6F034AC7EDDB34FD01BC4C7B086A7CA989576B CONTRADICT,.CONTRAVENE;.ANTAGONIZE.&C...708.
438,372,010 *2C63F0D97B40C8C243F4BB38290E3B2D4EE4E57E controlleriastateeduwww
438,372,011 *2C6DC430DDEAECCA079FBD09EB215893D8903A61 [email protected]
438,372,012 *2C616E979E67BF0178CDD56632FEA155D5CEB4E2 CONVERTAEPERVERTA
438,372,013 *2C6FAEFACCE004E4E3785674F934ED0A9E204F2F de!rv
438,372,014 *2C6E0F9697DE358069E641EF0F79E4F207DBB609 costieris8
438,372,015 *2C6B2AF8FB358402AD4649C1548CEA0E84432D4F DETFAWNING
438,372,016 *2C6B9C9C4E9101783F4B83B8A954B688EEE44F30 DEVON.DILLEY
438,372,017 *2C67A23CACF189A498A8CA1C22CD79A7319E86AC devonschepers
438,372,018 *2C61ED626E6AD7F4B6BCB15E1D1ADF43AC6B4BCD CP3S,
438,372,019 *2C68D64010FE0A399402DC5B91D076911C76757A CROQUET3
438,372,020 *2C6E4AC027BEE298391F35C2C1757882B3031032 ct!a&
438,372,021 *2C65103FD718224B59377C158EF15252C0C4C58B disappointing-&c.-v.;-unsatisfactory.
438,372,022 *2C67CDFDCBDD8A45CE159173A7F04FE2EE10EDDE CUJ/E
438,372,023 *2C6CD19F17A1AF6275E70772E8330B022B2595EA DIT?I
438,372,024 *2C63BABD6CEE09820A553288915B30448301357D CY1ZT
438,372,025 *2C6D2488CA49914CA952057A3CE301EC4ACA6B12 DM#U=
438,372,026 *2C6FDC2C748DE9ADFA6BA89703018CA876E72B6F d62fu
438,372,027 *2C6426BF374FB0C450157EF105409F55B7C42DD0 DONNAGRILLS
438,372,028 *2C63126183D6BF0EB6EA257A22B8E09FE4437478 DONNYKOEWLER
438,372,029 *2C65240FDDA3349F4375A13A204030C9DCF9D82A DOUGHEKMAN
438,372,030 *2C692546E7DCB3EC471BE6BB922C3AE6386FF3D3 damienhilmer
438,372,031 *2C605C741334DB1E68F11CA9E51A87C5BA9E8EA4 DAMON.SARAFIN
438,372,032 *2C625E8F5BCA4C806BBD4D217C2C721E5215548E DPHJN
438,372,033 *2C6E275E86EE21DC9F16BB4685B3EFB692618AD0 dannyiguana
438,372,034 *2C6DFC073975A496CF99E5955505D6820D420F1B DARNELL.CRONAN
438,372,035 *2C6741CC78886950DF8274FB77B650578C081C89 darner
438,372,036 *2C6098C71A42E66558B3D0380D89FBA55454DE82 DRLU7
438,372,037 *2C6FBD087126CE4DB9242A7DEF316825D1A17C9E [email protected]
438,372,038 *2C64A114EEB11B1D402062CEEB21CD7EEBA81EA6 ddsos
438,372,039 *2C6B0C8371E18C12B6BA2ED923BC2F7198AE8983 [email protected]
438,372,040 *2C6BE7D614A6427124D80B5D2DB95BC33597AA9D [email protected]
438,372,041 *2C69E4238F72C0F81AE63C19698223D011363F87 DEEP-ORANGE
438,372,042 *2C6EF22BE21BCF967572C8E7B7C93CEF9F8581BC DEMOND WOODS
438,372,043 *2C6C36ACFD143A27BA9874333E39CB0949A7358B DENIED.AT.CUSTOMS
438,372,044 *2C67E504BE4E57F4F4B0908D85D929AFA38B06E3 DX,OD
438,372,045 *2C61BAA0CBFC9E6EB33B6A90EDE82E58346DDBBE DERTIEN9
438,372,046 *2C65463C93B844E4EE4D56D80030301536DFE320 DEWAYNE.MANLIGUIS
438,372,047 *2C69D85056DD381DA324614676B688B0ED5FDD4C EARLE.MAVLE
438,372,048 *2C6BAC8EE1A9288800D7AE423E1A3649E7A4D41C EASQS
438,372,049 *2C6909C53FC18CA674490145582540CF49A3A9FD ECONCINI6
438,372,050 *2C68F34CA93FA2E3EEB106F6959E6A94EC7E66A6 DH8e
438,372,051 *2C66D1615E9387DDBEC626B0DFF00FAEAEA06870 EDITORES DE C
438,372,052 *2C6025EC9156D4185FC5B0C8F44C2499B434544B edlorpoed
438,372,053 *2C6878F7DFEC401CB5F10BDDE0B18BA7C6C67B19 DHULJ
438,372,054 *2C623BF4C1522D7F410F8C16D2494D25B3D01811 dic+g
438,372,055 *2C627616DA483806253FC9AF837EA92706792BC2 eerkreving
438,372,056 *2C69C80D116B621EAD38DFAE043B726A0EC0C11E EF-9R
438,372,057 *2C6EC311606FEEAC01EFF2C2261AF6A4D77D808C [email protected]
438,372,058 *2C62D70A442E01E95BB3E1CA06181297994A2389 dirkmcbane
438,372,059 *2C68DD181CA94F32C9437B8CBAA53A736066E81A di$+ru$+ful
438,372,060 *2C606A5A137A45977177D4C9008650A04C3C817F distressmessage
438,372,061 *2C62CE00786342AA11CC0B073B4E3447BE1A163E divj5
438,372,062 *2C617EBE8E1AA24C5EA324C17BCC94EA938BA993 d(?:j
438,372,063 *2C64E92C8FE2930361F0DB62BB71925D9D0ACDE9 EINFANTA.COM1415
438,372,064 *2C617ABC92F6D8617A36003FDAE2500869C8A229 EIOOMNI5
438,372,065 *2C679714DE3225497A5085F7790A56EB6061AC3E dkj_5
438,372,066 *2C60AC7D2A7628FA2D6A662FCACAA0C2A329319E ELEDNEWGS
438,372,067 *2C6DB55BD18E8B4FF02BFEF75A8374DD6C1E29F8 elikrous
438,372,068 *2C6C4F8C74FC638F22D5F9564339B7B6E8531E45 ELISEOHARRALSON
438,372,069 *2C64EDFB16779A3E9A784B5751B9EE99872B69B7 ELLINGER06
438,372,070 *2C6219D9F6E4C853697B8BAA36E12BEAFD1508E9 dnv+-
438,372,071 *2C65FF005ACC98F16D14FA4D85E03D0F29DB375B EMERSONALIER
438,372,072 *2C6B0DCDEAEF7F9ED8A66572B4FA9C3F3A350D6C DONEYS123
438,372,073 *2C63E8495080B7AA6D610DD832CC740BC7F46A50 EMZZB
438,372,074 *2C6C39B61CBA7F91879499972D76E5DDF49178A4 ENJDMT
438,372,075 *2C6CB9240653B75BF53DA3930CC3A33C5FEA562C ENOCHMACBEAN
438,372,076 *2C6825E78D24DD8F826DE925EFC48E232D87DF1D (>_<).~`d===p
438,372,077 *2C6598C6AF95432AEC0926A8FE3F21E01B843CBC DR9PV
438,372,078 *2C63DEDAE1CB72F4D4DC4F2E071480888293F631 dreyucel5
438,372,079 *2C65F226B4E400CB827F7E854763A9FD60337F0F ERIC-CAIRE-ET-MARC-PICARD-CLAQUENT-LA-PORTE-DE-LADQ
438,372,080 *2C613BD2D676744F6FA031A7C2F43D61C4E5C13E ERITRESKIH
438,372,081 *2C6E1C55F273E6BF306D505B410C9A0706B7F990 d,se2
438,372,082 *2C63E11BE08FF56B32377D85DB656982C8C9499F eszméket
438,372,083 *2C6423E64E2086CC918CC11CCC9D3E95A20CFCDC DUNCANHARNS
438,372,084 *2C6EBF84D5DF3C947A99DF21079EB7F25A38E676 DUUA
438,372,085 *2C6F48F7CB6408476CC3BBAC2612745E4E994977 EUSEBIOFRIERSON
438,372,086 *2C680480AD5D4DA8023E454021FF6D73347FA58C everettepeppel
438,372,087 *2C6F26CD1D361B195A6C576C7539A2F8F401F55A everything is one thing
438,372,088 *2C60F12396C0AC03B4F529DA0182A1E9F2799426 dyksdnlb2
438,372,089 *2C6A95F09AB2784F9622EFFA4C7C8508B911A688 DYKSTER4
438,372,090 *2C6B5383D17B4905DAED536E80E4D2675896C923 ey?t(
438,372,091 *2C603522AF816E483B9EF2C62DDDE7C98C9CDFB3 f2x
438,372,092 *2C6C7C93FEA31D11780689BABCDC57BADE351B75 FASLULLAH
438,372,093 *2C643B4004789CF04B9B35EAF4CE845F6C0D8F0E Fem-gned-pung
438,372,094 *2C6D0B7E6E27A2C43E870F8EC74DC7E8AE7DAB98 EDWARDOJORSTAD
438,372,095 *2C6443B754742C822DCB31DEB80D9612524CF357 effektomraade7
438,372,096 *2C6CFF33836F574C013EC7F29A64DD0612A7579B F\L{
438,372,097 *2C6CA567FA9BFFF3167A95FA6DC71A3F2319A463 FLEA FL/I/
438,372,098 *2C6F7ECE45D334E797F697C50B933CBA11F62D09 FLORENTINO.TOBERY
438,372,099 *2C679D3FAB5B24A76813D99B6CAAA545C4622873 floydarpino
438,372,100 *2C678F1A32E0D91F335EDA2AED1C251E08F1F7CC ekysd
438,372,101 *2C65D085FDB6358158F8D8D589574652DBE958F1 ELEGCMTES
438,372,102 *2C6F67A8228FF1D2225B73B07B2CD327D0DF66A3 foraient?
438,372,103 *2C62416DB9EA99CA70370A5D5F55121039A16B58 ellibsw9
438,372,104 *2C64A763951A507D23460F40F244981AD4B0D2FA [email protected]
438,372,105 *2C6480D15270E996539F626AE8E5B8DB2EA288E7 elo(#
438,372,106 *2C6A110F07420D475F30E1B972FEBD74AEAFD5AB EL"P
438,372,107 *2C6863DB9C83540267B0B8BB2C4533929D549976 FRED.JAHDE
438,372,108 *2C6A46D337EE0A9C7C9A8A98819A6D454FEA7714 EMILY.EASLER.HANDY
438,372,109 *2C699707556FCD7E4570488839E239521D1227F5 friedensembleme
438,372,110 *2C6F4847EB521ADE2357E0B973DA6372676DFB96 FRUMENTY
438,372,111 *2C669DC67F89CF1FD1E33B4C0191A8B03468211C [email protected]
438,372,112 *2C68F789A36F1D87A850C76B13E25DE5902BC0F8 gabo.theboss
438,372,113 *2C6A5C750A9C50BEFFE55D62BDD80DDCC1130A1B eoxj
438,372,114 *2C60AE15C94554D9E7DB5C7D20CE51E333757C0B epb39
438,372,115 *2C621AB62795BBFA2F3D47464F5B7237CB40857C GALE MCPHERSON
438,372,116 *2C648DDCE47AFA480D99611BBCEA50447CE0E1B8 gametocyst.
438,372,117 *2C6C4AC07E033F5D56FEA5AE0A9899DC2C9D6D10 ERNESTO.VONGAL
438,372,118 *2C6F50AC1895501AD922574F44F42D98F83630A2 gaylordkohrs
438,372,119 *2C6678978D8422117C2AD0FBD63EFF09C68413F6 GEKATHALSDE4
438,372,120 *2C61174A18E7BEC530A9746EC99B65F604D94E20 estrellas-de-plata
438,372,121 *2C69DBB4B286990997C8EE6B8E9EAB591BCECD6E etneetsegsgnidrahrev
438,372,122 *2C68197FEFBC31C98B1B767A74CDFBC35CF046B1 glasyrens2
438,372,123 *2C6CB67F27468BB104937E178E86AAD14A7B823C EXCELADDIN.CSPROJ
438,372,124 *2C699DBC8879FDF91A4D3BB966A3F29CF926F893 glesson6
438,372,125 *2C6EC744BA9A02DD24505DBB153F2BEDCBE3F558 g_ob
438,372,126 *2C6BA56D96C0F3E0D44266BEB60C0F8BBF725779 godzillacarmen
438,372,127 *2C6A07C3A5F23D03922EDDC93B8450DB377CE890 FAIRWELL)的妻子。於2085年過世,享壽101歲。
438,372,128 *2C6F6531F868D3C80513980C65EEB9891803B370 [email protected]
438,372,129 *2C64C66C86D66BF193C2A184C1B83C29B964E9C4 fapo
438,372,130 *2C67D6B5B4E328A9FBA3D36EC9B6B3A4382CC13A GRAIGKILGER
438,372,131 *2C679B931CE610680B353016F3FB09E0ABE0F6F1 FEDERICOBLALACK
438,372,132 *2C6274ECCAFE16511F72BA4494A7CCC3D7C39D85 FELIPEHUANG
438,372,133 *2C66E5DF8E7FBE89DF6AA4EA0AA4DED91480B5B4 groove-on-(rev-t's-single-remix)
438,372,134 *2C6216D5E524D2487226853A4853004A6F381C2C ferdinandmagill
438,372,135 *2C6F3553244DC181B8FBF9E70058B48BF104FB5B [email protected]
438,372,136 *2C6891EA97CA4F60DDF3CDC4A50F63CB41DFA7EF GuiltyasCharged(featEstelle)
438,372,137 *2C6BDEBFC90889907DBDF33D385CB5CA17170273 fidelio:acti,no3"marzelline,istfidelionochnichtzur
438,372,138 *2C60664EC2FDEC1BB1081828EE6B006DADF7B17E [email protected],SINCERELYBOWSER
438,372,139 *2C674ED4ACD8AE674C86F9029246E3A9D407F905 FLINTMAG
438,372,140 *2C6560AAD5C0050624BA7BCC0672FE55FF2C66D1 [email protected]+3n3d
438,372,141 *2C62A81D8737C59DF9388596032B59DE76A85C06 fluoroscopies
438,372,142 *2C63607C34C2D73B21A081E9DAE2360D9FA57E63 HARLANRIPPE
438,372,143 *2C6A1132D51E4A2229D972CD9DDEC3DD6ED36409 francescofeimster
438,372,144 *2C6796BD192FC786C28620A1D76CD5E7329BFFB0 HARLEYMIYAGISHIMA
438,372,145 *2C6D9385A5A55F5B4D3EF944C1517BCE93C748C7 francissheldrup
438,372,146 *2C6794F311A1E76D5A979B2C0BFCAFE22F10A228 harrisonroepke
438,372,147 *2C64658D4F1C9C4FFF4FA77A12294C66E46C8D1D frankbutske
438,372,148 *2C6AD0B67D54E198A105C6F741D0229C37E0AE89 FRANKLYNCESAR
438,372,149 *2C62FFD136D92D565016643B8BDD9EDA5C80061E frankswoager
438,372,150 *2C6312FE6D6B9B34F1E1CA7F4AB22A6F9B6ED0F2 FREDDYSQUIRT
438,372,151 *2C6EB1A1E4469E2D8C08F3CE90FB7ADD723AA75C FRMJQDKK3
438,372,152 *2C6CCAD3943BFE80593B6A6EA7B4EA0D731C95BD HEAVEN.BUTLER
438,372,153 *2C66C127C4763B7B47EB06E42AA875E59F161890 FRUMENTY
438,372,154 *2C653D586C3A9ACD91FA1F0224D15DF144752AE1 [email protected]
438,372,155 *2C69BE5C1DFB9B7937F6041ABF598F91096DE7D9 HELIOSELF
438,372,156 *2C63C3BD810C5FFE3F8205F95F7C061BDEBF481A HENOSCHSBERG
438,372,157 *2C64AC1556E035E05B9CBC1A014EF48457879C69 hetzersdorf
438,372,158 *2C6E76E118521EB284FA0F86EAECA9819F6D5060 garrul0u5ly
438,372,159 *2C688CB8DF6E3E9F962ADEB772D2A1097ED619D1 HOBERTARGOTE
438,372,160 *2C620EEE860AB63AD518A9EE3D7B0B55ACD2889A hold on, i'm comin' knock on wood last night
438,372,161 *2C61D3B695AB1584436202B0F2A4DE591F2F490C GENESCHWEDA
438,372,162 *2C65D38F4B86AA33D6EEF488DFD5EE54336901BE [email protected]
438,372,163 *2C6D302F988C8918CE94D7BB676763D702DBBAAB hooligannoise
438,372,164 *2C6EDDCE7ADD265DE36B03DD428E0A84593F34F3 geolocme
438,372,165 *2C6E3395543BA23C0E81E119677A499C07EC781D GERARDOVOWELL
438,372,166 *2C6364F227CFA3C835FFEE2C516AD2E58C15174C [email protected]
438,372,167 *2C6F45EDDD68C0716C6107344E778D0AEE5E59AD [email protected]
438,372,168 *2C6378F6C4E88E0B3BA97B520EE37837413B600B GHOSTCONNIE
438,372,169 *2C6C5DF404D634583D99341AEF66890BD8CD63D6 gimppalettemenu
438,372,170 *2C6577978E4C4A3B47CCF77C30F436E268230A2D [email protected]
438,372,171 *2C6DE7FFD9C1E3D386838E566A049A1E1BCC3622 hulmeian
438,372,172 *2C63897FE8811DC0C2AC5AAC6A9373C61F59C76F gmhw
438,372,173 *2C6819F8D17425CC0076041F88847E0459827A45 GOATDOWNNEBAGRAMCOUKGOATDOWN
438,372,174 *2C6F7C5D53AC842E945F0696AE12B2C5A76DDCE5 hymansubia
438,372,175 *2C63F8053C436C9E6B188D4168078C88093999B8 HYPRBLSNG
438,372,176 *2C6CDDCEEA2700B9282B4264A1A0B15379E71D72 IAMFRENCH17
438,372,177 *2C69D41DFDE844A35124365C9A85B882E7A97448 graigeld
438,372,178 *2C663592EEE428026EA51E76D04D5F202A04EAC4 gregurena
438,372,179 *2C635E36C6BB8DF3B873D2046F96A9534DF32A90 GREMLIN
438,372,180 *2C68A3E8481FB02C04A51DA9EF9E4E538D4A1A6F [email protected]
438,372,181 *2C65E29DFDF701CC5A198F7747F78D5B43D6A0B5 GUEBRISM9
438,372,182 *2C6D5F21D99949BC3E3B221FC2D2C7772435729E GUEST.76.205.25.141
438,372,183 *2C65FCBC284B46A326DBEE62DB4646C726E9DCE0 GURSHARANJEETSINGH
438,372,184 *2C6F75D5822C5A1D29EAB3CE58B7D88AA43FD9C9 INDICUMTALKABUTILON
438,372,185 *2C6CEC185035866F6E8796DAFE3231D0C50BED63 [email protected]
438,372,186 *2C6B5C97560199D1C6B421EDEE3E30D73F41EB16 harryaicklen
438,372,187 *2C63F55036D6893A0660D6ECFB67997048D0C31C IN ONE HOUSE
438,372,188 *2C652C3F196EF7F9AA8C351A286A99C99E8B3BA8 inside-the-dream-syndicate,-vol.-i:-day-of-niagara-[1965]
438,372,189 *2C6DF88C9CAE7155F0857418151ACC021A6F64CC ”intercontinental
438,372,190 *2C6C723D9B38C504A4247E09490EED4891212D0A isaiahewton
438,372,191 *2C6AE6E2D17F74293E935C8A4E640AC17CD3E614 isaiaswerries
438,372,192 *2C67986A30B45A23CD2A38FDFDD02E583ED988E7 ISISBETTY
438,372,193 *2C6D4C7F97A460019D03C0073D131D3D0D14F683 hilariostmary
438,372,194 *2C62D5BCA55C0C284C489F1D952F4C1919E5F95D IYDM150
438,372,195 *2C695BAAAE26B0380A7F9EC1C5AC4B2D40ED7677 HIPOLITO.SONSTROEM
438,372,196 *2C6F2880F1FA3706ECEE43089783E1F06B3BEBFE [email protected]
438,372,197 *2C607451ACD16D2C00C5F90B2A90A34524D1226B JACKSON.ASAMOAH
438,372,198 *2C6F057C54AC6DC5FDB519DB125DBA4A91CDCA04 JACKSON.MILLAND
438,372,199 *2C6455ECEAAC5775C5E2A6CB3679362A189FCB5D JAEKAPSOS
438,372,200 *2C6964DCC09B55D960A7A096B41AEF0899C38412 jam.backtrack
438,372,201 *2C62EEDB87CD6B84CB90C8AA09F0DA95382E7E24 HOPE DEAN
438,372,202 *2C61A27ECFC8DD0B97685EF0D7BEC2D7F838C2FE HORACEBALLIETT
438,372,203 *2C6D42C91473117EB65D81D402AD0DA905604262 HORACIO.HIPPLE
438,372,204 *2C604AA451CB0AB9CC7A90759E191C8696EA4610 JANVANDAM
438,372,205 *2C6792926C7F1A306BD68E7DDEB039D7851E0780 JAVIER.DIMAURO
438,372,206 *2C622757F0E21A91F616D7D8FB2BCF79CCDC4875 httpwwwtkbluecom
438,372,207 *2C6EFAA52E57642D48590F4A9B29ACE3AC98BC4E HUEY.FAVILA
438,372,208 *2C61C3F0D29DEFFA728D822C677E931080A92322 jeffereybogema
438,372,209 *2C68B4932AA9FBAC23EE780ACCA61DA205CC24FA JEFFERSONGADIAN
438,372,210 *2C636A9EA7A3FBB90C5314C73603F03D4D8BC6F5 ìä
438,372,211 *2C64D80DCE78185014464170A51F9FCB31422C68 IALETRAMING
438,372,212 *2C6F9AE6DCA2C104648BF9DA75C527A507B7F724 IANFINGADO
438,372,213 *2C6DC32A00939B0981050EC4B367FA33C1BC93BE [email protected]
438,372,214 *2C69FD0B5946546D7B7DAB50CB7A1E16BFE1F2D2 [email protected]
438,372,215 *2C63182962271EBDECD2E2675ED8C2F3B4A27A83 JOHNIE.ARABIA
438,372,216 *2C679A49A8B67CF0FB22E8A76436E1E331ACECF1 john-joseph-guilas
438,372,217 *2C6B4E8D2C1311C7F7CCDEA9EAC7532D657F0297 IMAGEIMAGE200PXZ
438,372,218 *2C65DDEB8E2B6073D6CE4F0276FBF1D792BA1906 IMAGESIMAGEKEIJI
438,372,219 *2C6F9B2964AA29146C613E68DE1A32DED68BD6CF IMAJOH
438,372,220 *2C6E88F7A942B83764236436979E143A7CE34907 JORGEMCCARTHA
438,372,221 *2C68103D2B0BE1B8D1D273F543659DC8D4FE9077 josueblann
438,372,222 *2C604626322BF4444B1847C1904FB7191D9B6D39 INFRAREDADASOKAT1
438,372,223 *2C6968DE129DF046DC1883E0A1E6811D39279998 JR="
438,372,224 *2C6A82F8C72569A42B912B8CB88B37F0C5121830 instantaneousness
438,372,225 *2C6938CE349327B62D7DD8C7ECACEDE8B66386D5 JULIODUFAULT
438,372,226 *2C608AB4EBA523864AAB17B09CCC33A5B485B2C7 JUNE HOBDEN
438,372,227 *2C6E5E706ECE27B58432CD1D30294EFC38B517F5 IR0B
438,372,228 *2C610C65B0CD2FD431E6FACAA333D06B18DD5011 k;3a
438,372,229 *2C61E2BC1AD57EB84584AA08E6054E72464A03DD [email protected]
438,372,230 *2C6E78FDD5A1C661D48B4956E5A112293BED3BBF [email protected]
438,372,231 *2C6816C3059930C5CC72ABD50A86D23AC8A6A229 KAPPKOLONIEN
438,372,232 *2C6442D3E723E8E10744578138B805C0F50B8E05 IVORY.BAKALAR
438,372,233 *2C6ED7DCE02CAEA12458D5A5A165BE38141A66F8 KASTEL-SUCURAC
438,372,234 *2C6073E5DA0EEAC1E35B7CE17C9847AEC25BD9EE jacinta.law
438,372,235 *2C697B9CEF0A9E857D63AE7F64F7504495EA18C5 keaf
438,372,236 *2C6303775D3217FCCD42709FCAB88680873E0E74 JAKAMAA4
438,372,237 *2C664BD95EB150F7DD54FBFC0BFC3011889D0DAE JAMAL.MILFORT
438,372,238 *2C6F318C5F23304E614A44590D85D03FD165F748 kenneth992
438,372,239 *2C6556940AA40F687EA4502BEFEB423BED4C71F8 JAMESMING
438,372,240 *2C6062C7BF033E2D53C58D0A42CD37E9CF1E3F36 kentonbalzer
438,372,241 *2C6374A78EADFC9056D94E8BC3032A55BCCDEB4A [email protected]
438,372,242 *2C6AD3579793CBE5F96BF17819C03C8AC2AFE432 JANE BLOOR
438,372,243 *2C66E2F1EB4A7BD6EA9A9CC80CA38051F290DE9D KERNITE9
438,372,244 *2C6FAA6A392C2AAF86D192C06955A780F8BF2EBB jarvisbierce
438,372,245 *2C61E576A93825F861026B35A84CB742B56885F8 JASONK2480
438,372,246 *2C6B482E0684653DDEBA6138612A23966F28E637 JASONPRENDERGAST
438,372,247 *2C6AA81200EBE79500AFDF508E26C0C81D49ED7A JEFFREY.NABARRO
438,372,248 *2C6636369B0050DA8F7783BEDB59DAFAFD1644E3 jeffryjent
438,372,249 *2C6064E9A290CAC2920E2E92BA7C0267F24DCA56 KNEDLÍKŮ
438,372,250 *2C6C6EA73CE7E3F2F5758CCFECFCA8759C800EC2 JEREMY.MERGIST
438,372,251 *2C6DE1698C00A3677C2C097F4145042E093A7659 JEROLDSWIHART
438,372,252 *2C6D25A906BC96F0D73797E301473A2502E7828F KOMMABACIL4
438,372,253 *2C66809D3E0177341CF6796F524FA5886D64F5CF koryfeight
438,372,254 *2C6F7C34581B5EFB7401B0B638DFCBF66EE69F53 [email protected]
438,372,255 *2C6E8721B6477313BFC0A4595AFEB2320CC7F8B3 j.f.r.o.
438,372,256 *2C65DCB9BF7FCACF72A798A90CEE82B496A6E8CD [email protected]
438,372,257 *2C6B514ED830866DBCBE66113374DDED819C8294 JLE0
438,372,258 *2C60C031C862593D0DDF98727359B90165B11BC4 KVASBIOTECH
438,372,259 *2C66BD2F53785F6FAF6299E07A28B59BD31E05AB JOAQUINVASHON
438,372,260 *2C6BA1E9BA60B10EDFD07AEE7C4BB0BE8752D396 [email protected]
438,372,261 *2C6C2B931AE4B622231D0AF0311475A84AD40466 [email protected]
438,372,262 *2C6807A695F84C81F42E42023168A1395DD4A0B1 john-aremia
438,372,263 *2C6621EEEEDC3050EEE57DD3FE7149081FDAD635 LACY.VAUGH
438,372,264 *2C63F8DFA6618A39EBE81978C53DC0B6F179601F LÄDERGULA
438,372,265 *2C60A57C2C00764D451724766515BDA66C5A0EED JO MANALANG
438,372,266 *2C6774F12DCFAF73A465344D0DCB483234E8EA11 lambda67
438,372,267 *2C69A006AADD7F7C78EBE076FD2B53F39DFE8E3D landesleihanstalt
438,372,268 *2C6521F3FC64DA5F92B2FCC9638F583D12A6DA74 JOSEDEVIVA
438,372,269 *2C6ECDD21A2A27642F3B2CD6CE2D682B20BA15CB lanebierbrauer
438,372,270 *2C63B99E38071EEC0E055C995F27188CBDC34B2E JOSHMASIE
438,372,271 *2C6647A4884B1C8516CD123FAED289927DD49829 LATORIKA
438,372,272 *2C645B37562BDF1FF77CD8E421EFFE5202F10DB5 laura.alderson
438,372,273 *2C63C142FC3235787B1AE9A9A33BAA81E214326A LAURBÆRKRANSAR
438,372,274 *2C69776BF026A7B0CFF8C3C719C177ACFC97A5C8 juanmontavon
438,372,275 *2C67B812B72895E7F8B1E93F7600CE2854914280 Julien-Dans-L'Ascenseur
438,372,276 *2C652C1B1C681309C3ED4BF69486655BC05953FC juliusharriage
438,372,277 *2C6653702F30FA836DFA0A97971C3265DF37E08F LEADOXYCHLORIDE
438,372,278 *2C67489284E1CC57DB6BE865333316BEF4349597 KAMATG1234
438,372,279 *2C6B12887F4274F6A0469BC5FF506912752F6B03 LEONOREPROHASKA:NO.2ROMANZE.ESBL
438,372,280 *2C6C16A5F2BE833AA142FF253A135CC9E178AF77 KARSAN-MIRO
438,372,281 *2C6B013B8DBD1EB7F6E2B154C6BE5C1D3B235135 lewissievel
438,372,282 *2C6740589D699AC41A421B7C750A297D565CE57C kathycynthia
438,372,283 *2C63D349837BEE9A2128CC54BF2D2DDB920EC066 KEHIGH123
438,372,284 *2C6B91B33C693A95852C2A62FA173B33576A943A KEIMPRÜFUNG
438,372,285 *2C660B3E0E2AD16326B3C9D7D17908BA0C394F67 KELLYSAKOVITCH
438,372,286 *2C6587411B4941BB3776B9C5F43DBEDD98623606 KELVIN.LANGRUM
438,372,287 *2C66788DA8239D8F323B270EC642A4736AC0107A KELVIN.MOUNTJOY
438,372,288 *2C6EE1DA5B42B0AB90A523FEE817F461DA35C378 lincolngelger
438,372,289 *2C60AED546CDCB14E165C719DAAD44708B942EA7 linda.b.king
438,372,290 *2C6C04BED3BF154199AE2D163AE18F7276AAC40A kennyruhlin
438,372,291 *2C668684E4BEB711A69F819B1B634BED56623D4B KEN TANAEL
438,372,292 *2C64844552646324A5737D8685DAFD12B78297CD KENT.EATHERLY
438,372,293 *2C6B5DE6F73AF4E4956BDF5F25687879A710FAF4 LINWOOD.NOON
438,372,294 *2C630BA9EFC50FB5E9F79BEC3CE6A809C2812CB2 LITTL3DOLLR4PID
438,372,295 *2C6E6F1692C1DF6D4B382D5BBDDD74F5D83CE719 Living.Condition
438,372,296 *2C6B4BD7117B4A38F9FF8B8AF366BD93ED58357F KILLER-SPY
438,372,297 *2C6679753DA53D04DECE1401E0609A47079C3D9C lonhenriquez
438,372,298 *2C601AD87019F47E332205988789418E4954D95D LON.MOLLICA
438,372,299 *2C6387DF6CB8BD6E6DC41AF2F6957746D90555D1 KNTSCHL
438,372,300 *2C6DCD8AA86994FC09353B3A673EA686A3F90CB9 lucianolinberg
438,372,301 *2C64B0283C9F45B141756212D8414BD394DE101F KORVANSA0
438,372,302 *2C6B5F8B0FD64386575DC339708509680F273278 [email protected]
438,372,303 *2C605A870F71B0E069C7406D4FDEC831A03B12AF LUPULESCU_CATA
438,372,304 *2C6AFBED679E2AC834C8A698C5B4B4744C097CFD [email protected]
438,372,305 *2C61C548004394CF9C683D30D9BF9F762FFF1FC3 KTRIAM
438,372,306 *2C65723DDDA25A604181EBDA642D64BE7A3E5DE1 lynwooddemny
438,372,307 *2C64E6012F265E17160DB5C23915BF1D03A94329 lyydell6
438,372,308 *2C6F5BEEF729717A6D31E65C8679B5AF8B5CFA1C MACHLICHER BEWEGUNG OHNE HAST
438,372,309 *2C696FDDA2F0E830FFCD3D461A1E559E52B7969C LAMAR.OLLECH
438,372,310 *2C6511FB39626CFDA44C8352A6E16ED4ED361E34 malikashlock
438,372,311 *2C630C98D4BE1B4CC3B28F161F91F9F213EC4A87 manbeastmutant
438,372,312 *2C6889328F92238323125A62DAC09F58D636AFFB la-pyramide-en-ruine
438,372,313 *2C679DC35C236A6B9CD2B28505A14545D5E73E2D MAN.HULVEY
438,372,314 *2C6B58124B0AE737F61DE21FEA03C36550AFDFAC MANUAL.ABBED
438,372,315 *2C6C7554E1DA65C5CBEDA6D7D2FB732502F96CD1 MARCELGRUMBACH
438,372,316 *2C606862E5EF21DF244D3A9F03932F911CE76614 MARCELINOEDMISTER
438,372,317 *2C6C5ACFA2E9E338203827759CC5ADE1748A6762 LAZARO.DOMBROSKY
438,372,318 *2C6536E00FDF750E804949731E4BEA1F99210562 lcclcc
438,372,319 *2C65841DCF07C665414201766FBC4AF77FDE5F34 LEENZUNIGA
438,372,320 *2C6BE19CC35C2B25DCC369222E59E6C07A86ED61 [email protected]
438,372,321 *2C6EB37B2209D79F564AA8FB73AE7EC0B70E3401 MARTA-ARAGON
438,372,322 *2C63D2417AE89736DA50A14125BA30859B4FE1C2 LEOKADJAS
438,372,323 *2C65D15BB677D38A676D97480EAAD8F77DE61ED2 LEOSTRACHN
438,372,324 *2C64148FBECB8F5AB4FD4562EFB0702C35F8561A leshallaway
438,372,325 *2C612F9225D0CCBA5126D892CEE87B4E1105D11B MATHEW.WILTSEY
438,372,326 *2C6AE0A8DEE3B857AF507C88AF0AE7CE6808B022 MATHTRAINING
438,372,327 *2C6228FDC276097180F2E282B7990DD03010EC2F L'HISTOIREDUPAIND'ALOUETTE
438,372,328 *2C616451CA654E7B8607AF3BB4F78B869ECE011D M&:BAA
438,372,329 *2C61499775DB940F481F90A8E74F82417B386DDC [email protected]
438,372,330 *2C6E4C909C9B74BE6FB623F9F6B6CC0B09234338 lichtgevende9
438,372,331 *2C614529F5CDE7CEA17E95747724DE2ACA347566 LINCOLN.SAYSONGKHAM
438,372,332 *2C6D7E3E9860EDCF3E35A1FC615B0D40896AFC71 [email protected]
438,372,333 *2C6B5BE9F854579358D2AC4E8C54FDD25B4DCE00 L'INVERNOII:LARGO
438,372,334 *2C64432003E14C0479591818C51D1E8F81893727 MICHAEL ABAYA
438,372,335 *2C6979F66394C2509B25360751B8681825B5B631 MICHAELLINDERS
438,372,336 *2C60B03287530F5D8F2E9EC0D35F27CE28015774 logeplaats4
438,372,337 *2C6D33B67FD2C2E9156EC49FCE533FA920FC8F11 LONG.MATTIE
438,372,338 *2C690F1FDD6C2B9D097B4307614FCE52A6914716 LON.SALOOM
438,372,339 *2C6BDF0D37DDE99EEBDC0CFAEF57BB76EC1447CD lorenmcsorley
438,372,340 *2C6EEDD7B6A6A01B1EBDEF753BB5D17F68B6A8BB [email protected],
438,372,341 *2C6ACE5F184E92D3422A5C931FF82C270535B4ED mikelafaver
438,372,342 *2C6EE2EBFB3E4B01F401DB5D59F01B7B0896F6E0 MIKROPOROWATEGO
438,372,343 *2C6D916EC9263A66F2166CFE8F8792BB79103CFA milowaitman
438,372,344 *2C69781600656D24527ABC10AF1B4B1D402524EC mitchellleandro
438,372,345 *2C6721FCB14FE01BE1BDBB7D4C154E691EA7AAC5 MITCHELLOFLEN
438,372,346 *2C6425B443BC79219627668822A07CEFFC3310C4 [email protected]
438,372,347 *2C654350B6343BE5375147142E2AF9E3B00AEE02 lumbalumba
438,372,348 *2C63934782E527DB083EADB3BE4F73948BED629D LUPESTEINIGER
438,372,349 *2C66E4EE5C1DCE9E4922CF6669F12099D4B4AFB7 lylenecochea
438,372,350 *2C677FC0DE1646C719F3AC40C7423495546CD5C2 MOHAMMED.HANFORD
438,372,351 *2C677CEEF4513FEE67AB78718A7761A4FBEDBCBE [email protected]
438,372,352 *2C664FBB6B4F380724D329D680E9DFDB058939F7 monique.elf
438,372,353 *2C6C8C07227494C1D0CC39FC26EFE2B8DDE188A0 monologuezs
438,372,354 *2C602463411EB62A76558CFE222ED197DAA79629 MORENA313
438,372,355 *2C6937CB2D14432BED757957E7894EB9468A1C8E MAJORIEZ6
438,372,356 *2C6ED0F7E986DA193B97A3AAA94151DFFC3550C1 MR.LINESMAN
438,372,357 *2C6A3892D65218E33203C29319B7596E40A7D0DF mrmarni1
438,372,358 *2C653E02FDD7CE11BB0FD9966FB9BED15DF14AB8 MANNIKIN94
438,372,359 *2C6A36752FDBEFE9BAE67D9BDE1F6B06FE19E142 MANONTHEGROUND
438,372,360 *2C6F92A41ABFAE4DEB52474E1920794C88ECF949 [email protected]
438,372,361 *2C6FA89FEA0E41A7A62ACEAB2C460881661CF59D MARCEL.OKERLUND
438,372,362 *2C64C33A004787F1D07438C2A23134D4A0011D87 MVCNPEOU3
438,372,363 *2C6433757BEC050EF9F78FB058F79884F3053980 MYOHANGSAN
438,372,364 *2C631DF6329869ECA18EC48BBDA29FDF4319C816 MARK.MABBOTT
438,372,365 *2C67AF0183CBB5F33F7194A8803EAFB78B791852 n0nm3ch4n
438,372,366 *2C6FEA13B082028B66163606B9801F5B0CA36DC3 MATSCOTED
438,372,367 *2C6A8D35D73FA76CC310103E8C58CB7C5A500EED [email protected]
438,372,368 *2C695906007B1A64BAFE39EC7C92B50DF17541A6 MCKAYLA711
438,372,369 *2C69856516D6BB1852E1B0FF5B88C37934A9AA84 MELDRAKULIC
438,372,370 *2C6D00E21ABFD5037833A9EBD2456795E762B16B MELVINABLAKE
438,372,371 *2C659FEA2E80670518EEC662C64D7097F0279C00 NICKOLOF
438,372,372 *2C6E713C1C71B38836BC06C4459427C96D21F340 NIGELHAMMILL
438,372,373 *2C674959CD25F1A38873FF5C25EF7528930150A7 NINA TINSLEY
438,372,374 *2C6E5B81CEDBE653AEC2F8866E133F3BA782C041 MICHEAL.JENTSCH
438,372,375 *2C6E81C0D21DC48B13B596ECDA2C7BFD483A2557 MICKEYXIONG
438,372,376 *2C6078B3CB9C0D994349388F765C73856E6E644B milessally
438,372,377 *2C66FA46B0A941195D5172131A424784BA67EDCF NORMANMARSHALL
438,372,378 *2C6AFB608C86DB000C8587221F0C1519C6D43944 [email protected]
438,372,379 *2C67332E231DEC01D9E33835F6D7CB498A1AE8FC NORRISSAVARIA
438,372,380 *2C6DB5308A1AD3BAF4F2A0CF08DADBDBC395EC66 MINGTOY
438,372,381 *2C6CAF065A6205EEF6F6525F7F07D574E291007F mitismes2
438,372,382 *2C62CFFA36DBFC38463DE3728F12F3BF877AB28A ˈMOHAːʧ
438,372,383 *2C61D7A5BF0C3D26D47AB32164071717F29A25B2 OBOBB
438,372,384 *2C6309608FF888A6F5A9A26DE35778C52BF1F5AB OCUPAU
438,372,385 *2C60851D2E7484C52113016147FE5FE5D1B628D1 ODELLLEEKER
438,372,386 *2C640BD8E66706512AD233B722E584820AB5A514 [email protected]
438,372,387 *2C678A0021CE87C8D466F4DC68B713F9F4B4131E OINCBSW1
438,372,388 *2C60591EBFE21D6E5F004541629821E56580056A OLENBEAMS
438,372,389 *2C6E30F4D5D42BCFAC9C21E716FF6AB14F1C80E6 OLEN.SHERRICK
438,372,390 *2C6E48C4D258E24DD1608BF42C2ADFF86AB59C01 MRE4EVER
438,372,391 *2C6C198882ACBC542F20DBFDA91CA3308F2A91B4 OMAR.RITARI
438,372,392 *2C643860178DEC92C32492C284CB39C0F2DD89A8 ONCE UPON A TIME IN THE NORTH
438,372,393 *2C6D1216BE6BDDF6EE9F7E184EA14FF8FF06A2C9 ONEEYED.JACKS
438,372,394 *2C6B142210AA2FDB779A716EE4BA813E7D0D25CC M'=V
438,372,395 *2C689149396535964308D86BF5970DFAA5AAB58A N%9J
438,372,396 *2C618130B061F5B77023DF78282602767E492A7E [email protected]
438,372,397 *2C674560571A3406119B18C8D3698ADFC8CDD06B naeitten8
438,372,398 *2C6D953EB73E76172F0E13C9A9FA973FF9EFBB6B (>-<)[email protected]
438,372,399 *2C67A58F9455ED02997D82B37DB9F12052D07493 PANDEMICITY.
438,372,400 *2C6115F544799929C451B91FD2266FC1B87C6412 NETATUZ9
438,372,401 *2C6D4396FFA494161CD73D8287E909BA45E8232D ngongensis
438,372,402 *2C6730941BF6D0377688520BA34363304CD8005C nicholasshepheard
438,372,403 *2C698D5CE70456CEC48CDD8E38AEB91BC43B53DB [email protected]
438,372,404 *2C6A1CC5476F036FE91AD27758C75F7F7AFF27EE penneying
438,372,405 *2C643B656E9B4A87C064A9FDCDE1B3F9D34FAFF1 N'KOMBE AFRIKA
438,372,406 *2C67426EFF9CDA5F34C3B754974EA68C0E4E16D3 PERVYESINTEZATORY
438,372,407 *2C6078D73D56DEB5CA9FEBA2B14B42A245901AFA NONENTERPRISING4
438,372,408 *2C6537E24ACBB93C8A8865D4B6B46515962EC213 NRG 2000...?
438,372,409 *2C6BEB7CE72F91F4EDF6CE409BE66E50A1D55CFC NUTORREF
438,372,410 *2C6D73BBCE975A8360B474060592E5A33FD83B32 ;)O~-0~Q------P
438,372,411 *2C6E21D23F2A24F0AB064E962317616E68C48967 PONGIEST6
438,372,412 *2C6A63D39BC6A5B8CCF21005CF8EA38A5CF6C98F o-de-la-parra
438,372,413 *2C6233F2F1AC4354F582932B724C008511A33F20 portschunkula
438,372,414 *2C6A325085C9F823050AF6ADF7547A5DE17DD6FF potatodesk137
438,372,415 *2C634A87868878401E3FAE2047405A061C6D5344 [email protected]+!SM
438,372,416 *2C627FFA09223EED86F6E4C4B18E652C631FE889 PRAELUDIUM & FUGA NO. 22 BMOLL, BWV 867 PRAELUDIUM
438,372,417 *2C64F76469D78ABFA2D4090DEED86E7F6CF1C603 pralines-and-dick
438,372,418 *2C64D05C34045502A8658B6183FE56E9A6B7D778 omer-bin-sayeed
438,372,419 *2C6C19E70A757A6EA3FA7AA9D2D189AF64353EBE precioussummer
438,372,420 *2C63D4AB74567BF7D054DD752B2D8F4BFB8F541C PRESTON.GASTEL
438,372,421 *2C6A259C58C8BDB3AA68FB3F0F1C1301660FA4B1 PRIMUSTAN
438,372,422 *2C67EF1865CD4B55150A5A5CCEFE9365002E2822 opadvaloed
438,372,423 *2C6EEA1A178FA53F96CDC3357BB99B17B0803441 or8t411y
438,372,424 *2C6CAE1DA919AA9BD3704169AC8708CF2C84BFEE ORVALALTHAUS
438,372,425 *2C6BB43C1FE4F4765C65E540275D7426D5C2922F ORVILLEGRANTHAM
438,372,426 *2C69DF376FDF097C9268356530B4488581688478 OSEREZSES
438,372,427 *2C6FD0585D867688A33CE6C4FF6F6FE333412F19 OTOMPA
438,372,428 *2C62806A13CE88F367BAFAF8F7BEA59CF22ECC79 (^_~)~.`Q######3
438,372,429 *2C61C1A05BD52989C3C0516F08AE6E5073AFED42 QB$.
438,372,430 *2C6D2D7B040F6CA87E357B22865ABFD13963D489 q##b` }8{
438,372,431 *2C63A39D0373C4F1182673A833939066311A6202 p###)-~0-~ouu
438,372,432 *2C65AEE3EB3B741DA6834E543E872FED05FB21C5 q------d~ ` )0(
438,372,433 *2C6F4572B861A7E4A47019B69A0A602870B6E610 q----d**splat!!
438,372,434 *2C6282027606595007925A80A550D30609816367 [email protected]
438,372,435 *2C60FB037342BAB87137D5C65EC76B98530C1C10 PABLOARDRY
438,372,436 *2C64D596559D0BF0A2B46DD72209EF0D88EF3262 Q---P~ ~>-<
438,372,437 *2C6822D4F5DA5F53D580B3368DA766CCBDEBA969 palmervanlith
438,372,438 *2C6F68674364877078AC3EF1C23B7CE607A51590 q-p.~O.}8{
438,372,439 *2C65181A696303FACB684D7898E8DA40A354D6C3 panika
438,372,440 *2C6CB81E5B997C9D7609CBF32E71005FED7F43E7 parkerwagle
438,372,441 *2C6FF56379DF1F0F6C6CB0B95A42992337B9872D PATARAPORN CHINKEERATIKARN
438,372,442 *2C6164CD0733EDA08A2A31F6E74399FE4DD67DF7 RAD1O+ELEPHONES
438,372,443 *2C6A7B62F4EA0D3D5077AB349974D66ACD6ABD0C randystinnette
438,372,444 *2C65D91DDEB1CAEA077177B0001819944B5D49C4 RATTISHA2
438,372,445 *2C698E719B4554E83213BC72DA82A7525EBEC1C9 RAYBERBES
438,372,446 *2C6C2CC18C1CAB3CEC1D1B2AE696C3B1786E545A REBALAR
438,372,447 *2C65336B7BE127C567B5B902EE7880B01FB76BF6 RECEPTORER0
438,372,448 *2C642FAF40F83FA74A286C1C68984F0A49F76348 rec!rcul4tes
438,372,449 *2C6F94BD7D55815BE2928C18288CB852F7ACDEF1 RENAKIREMAORFA
438,372,450 *2C62659B8340FFB45BD7544EF4DD1F9BD4C8D4A5 PAULHEPWORTH
438,372,451 *2C639E32A9DDF73C8E2EECD77DCE7DD2FFD88641 [email protected]
438,372,452 *2C67B42CBE2612F401761CC2D018614767925EC3 RENE.BOSSARDET
438,372,453 *2C6C710DFB4ACA8774DFA328D8B57927EAAE2B28 RENEMESSNER
438,372,454 *2C6FD464AA265005BAC220027E96D98ECA607BEF RENTEDRENTED2
438,372,455 *2C6D28B42A6C1715FC6AB945E7FC467B24039A45 P------B*.*.*.SPLAT
438,372,456 *2C6F0934C05CD3D8F3DCD231FE8518C788D5652B Per ogni sorte di strumento, Op 22 No 14: Passacaglia
438,372,457 *2C691BF79ED33D6C351EA902B982263A9B46C0EB rickieswierczek
438,372,458 *2C679EE4E3E8220FEDAD8F8932DC124EC1A97A90 [email protected]
438,372,459 *2C6B616FBF84CB86D02A8824E9FF3B4EC0D7B41B riebeckplatz
438,372,460 *2C64E0CD1A8E4282CC09E3C85C046A2FA6BFD035 PHAEDO
438,372,461 *2C672B54185200C18AE7A381CF0137A9B7903B73 [email protected]
438,372,462 *2C698A0F2617AC58196786ED12FA9193F67599D1 RK-,
438,372,463 *2C6B392DEF48A0E96BC47E385EF91F30D70B59EE RO7OLI4MO
438,372,464 *2C6B12E78987D53E6AD3E7D88E17C6A2155F87D9 ROBBIE.OLBRISH
438,372,465 *2C6DAF0C666A1B1A2BB96C6B707DF33283BC2E7E ROBBYDEGEARE
438,372,466 *2C627EA3EC47AEA2F0B10D8D4E034568C7A317E2 ROBERT EMANUEL
438,372,467 *2C68B53BD412BF061B69E78455328096B8C1BD7C PleaseureGround
438,372,468 *2C64F85193E07F44DDF2DFE3F52CD51CC5B52FAA poloparazit
438,372,469 *2C6DE0F4A8AFFA4FD508DFF84DC49A7C02BBB4D2 rodsedar
438,372,470 *2C6B85FDD0A4F5CA11521609CCCA15424D797FBE popularsearches
438,372,471 *2C6301408A81559A2EF73D55D1E70783100F0D42 POT2007
438,372,472 *2C6198F5BFA83299939A1DEA9DB3C825E15817A6 potatoryp/ou/'t/ei/t/@/r/i/
438,372,473 *2C63225DFC1ECFC7A44F196CA6E326B8B3749465 POUFEDS8
438,372,474 *2C6F707A8B84250FBAFBCDE606A5A8D513BAB806 rom写真集1
438,372,475 *2C6A437D3CC93E363DB12291D05DF864453BBB7D ROOSTERCLOVER6
438,372,476 *2C6C8357AAA1A5F1EE2ECBDCD0F79FEE0C410EDC ROY.CHETTY
438,372,477 *2C66C69CDBF3E4356B4A2A3F8DF9EC5734D68ECC RRKSSBSW
438,372,478 *2C625E47004B1674EF282D683FDD01CC0F7A106F PROPERLYNIELS
438,372,479 *2C6AEEBEEAB01553FAD2B015F4387208E6C56512 protopods7
438,372,480 *2C61EA2661D0E1114893759C1F115E9637690B9C PRZECIWKOROZYJNE
438,372,481 *2C61CF51A2DB1CC6989F7CB1D68D1A155A86B602 PSEUDO!NTELLECTUALS
438,372,482 *2C6EB9627894A7C658D2D6CEAADC381E5061C5FC RV3J3S
438,372,483 *2C6B994D1238F11EE2D8B1B5384FC84CB7D33981 ryan-hemmings
438,372,484 *2C6A659998E174F6240D35EE3F1B38879C0472D9 Q###D-~-`-}8{
438,372,485 *2C66987CCF4CAE90790F6E525812269678F7F6E6 SAHANDS123
438,372,486 *2C64CF22A0FFDA4337FE27392872A5C628CC8F24 Q$FG
438,372,487 *2C6F06D3C6C5FB6E141A5C10842D5E2D574951C3 q--p`~ )0(
438,372,488 *2C688D43AD1395593E53420BAB3618734783FC10 sarah.kate.irons
438,372,489 *2C68840B788A7898A5B2A3545189E01996074F8F SARAMAYA (LIVE)
438,372,490 *2C6AC12472EF97A59C4EE26F8AE998B38FDA1A6F r3a8and0nng
438,372,491 *2C6DF16C81286CD0C1CF002BFBF89FE70A2810B6 RABZELLEZBAR
438,372,492 *2C6A76D12443879D73613E7F14BB9E96A5AD1593 RADADES7
438,372,493 *2C611CE618E2A3AD19CEBB1DA3580448CD23709F RAMONTERRI
438,372,494 *2C6DF3C82B32BBA3660BAC8383F8C14CC931AADD RANDALLKATTERJOHN
438,372,495 *2C660A46AA0C327B4657FB2CE4DB3E97BB7D5E41 SCOLARISERAS1
438,372,496 *2C6C120B27C9A1F5EBEB61B54CC72489A569B7A3 RANDY.SANNES
438,372,497 *2C613F8A8075B4AAE50D333D267E39F65AAEA055 RAYMUNDOCORRICE
438,372,498 *2C64ACA05D33D44B5D82C68FD0DE14030400D4D0 RAY.SAR
438,372,499 *2C685D1BBA49932F1747AC9862E1CCE4453AA185 SECONDSTROBOSCOPIC3
438,372,500 *2C65A63E301F6676307271290B020C668FEE411F SEGRETARIED
438,372,501 *2C66A430B867EEEEA7CBE6D8DEBD1379BB48049F REDIORBMEREVO5
438,372,502 *2C6EE541ECD53FB5116B401DC402CAF8A965AC66 SEROPOSITIVA
438,372,503 *2C6B05690EF31BF75335BE9BC7F1789DC70834FA REGINALDDUFORT
438,372,504 *2C6ACAE221AD0C08DC2E3C86D7F5B961AB391613 shake-ya-tailfeather-(feat.-nelly-and-p.diddy)
438,372,505 *2C69EF4781E67D9B7B1294D443164F3D772AC3F5 reissata0
438,372,506 *2C643B35959C0D8FB590D90B613CE71B8708A91B REMPUJAS
438,372,507 *2C638239027EA7C18EF12DB88D2B015FE9CDB62E sicily-to-salerno
438,372,508 *2C6978A53F56AFFEF9351A1A2A5392E8BD86EF7B RHETTTHORSNESS
438,372,509 *2C664520804C98179C094A9B7A38471F8DE68B36 RIAIMUTZ
438,372,510 *2C60B7BB1CD7DF6515732D703528BF1FD6ADC7E3 SKRIDEOVÁ
438,372,511 *2C6D1EA1A31715008885676451AB341FC6574C17 SOATAG(AUSDERREVUE'GUMMI')
438,372,512 *2C67ECF304882962889FA1D8B294DCD3BDB3DC34 [email protected]
438,372,513 *2C6F28FDB688562D61D6A4C86BF8CE4991F9A801 solomgharrytruman
438,372,514 *2C630EAFB51F6B4A61313FBA437307E0C74E0883 SONBIRRUETA
438,372,515 *2C6A635B9B75B02CBA4737BFB5C4146D429B1957 robin-ruhl
438,372,516 *2C6F1F0A9A8233C081BD6F505D433E0F87C9337E rocamir
438,372,517 *2C66842806FBAB548A9C1751727F91421FF39272 [email protected]
438,372,518 *2C68F16EFB12216ECC1BE522209DEDBF834DEEE5 ROLANDHINKEY
438,372,519 *2C6704806208AAB7119629EE45BCE70E7CB037D3 ROLANDO.FADNESS
438,372,520 *2C6A17244695BF871849D2BB06A58CF71E55ACCD spencerdossie
438,372,521 *2C6C1DAFD0D3C3B2E7EEEC399F893071B51469A0 SPENCERFLICK
438,372,522 *2C64D63FA0DB6B1104EB243569221F66B91C1C8D spg)
438,372,523 *2C6FFDA243E17CABDA7694E38F8D1B756B9670A3 RONALDGILDER
438,372,524 *2C64CCD114020555C7ACE9FD39D3A5E2EF114F9D ROOMMAGAZINE.COMWWW
438,372,525 *2C6E7BB46B4F52D9B8F877E9FAC9AC78B9F5ED2F ROSE-BRAGA
438,372,526 *2C6AC506CC9069B6FDE9C8E9E5125FB8E693A2C8 SPOOKYSUNBIRD
438,372,527 *2C605A9FB7A08961E8FDC7C41B9C9B2474E317B8 src="http//ecximagesamazoncom/images/i/01cwevbvpnljpg
438,372,528 *2C6B9D643C9AE0ADF63E764EB34855EB20D49382 SREJIPS1
438,372,529 *2C64B15299E6273610367AD31588D9519334D669 rudyhiscox
438,372,530 *2C6609061D9BDEA501823F3E43C4CCAFB164596F STAGGERVTIN
438,372,531 *2C6CE666213618504C33F9BBF8B462D9A085A4C9 [email protected]
438,372,532 *2C6853257FA6D52834765C3C8B266BE524AF504F SAARAIH
438,372,533 *2C64DA871599770F8B42763B506D71D9A3289991 STREETEACH
438,372,534 *2C6A6E900B0DAAC74821EC37BEEEACB9DEFE35D7 SAMMIEFIORAVANTI
438,372,535 *2C619E24B2777FBB6993A2ECE23C6AA0D7D198FC samualdonchatz
438,372,536 *2C673A2F3C209792D1266BE3B1F20CB27694F1F5 samwaddell
438,372,537 *2C6312133672B0D1819AC85B53C5B16E6CEA81D6 SUOYOJRE0
438,372,538 *2C619CC1057DEFC153487609C1BC22C2C7892B0B $SCALAR.=.$ARRAY[2];
438,372,539 *2C67F4FD56CFDFE0A868586E20089966F73D73A3 SCALDIC
438,372,540 *2C618928A4343521341561ACC257DF73DF0BD127 sydneydolven
438,372,541 *2C68618B6358F89FCF559518AEA5A13A4A42CF82 sydneyhemmelgarn
438,372,542 *2C679FC395231F04D4347EFA971BC7034F94E4C3 SYDNEY.TOLIVER
438,372,543 *2C69CD3033199C9518D4B44E12AB394CFA9400DA SCOTTYJEFFREY
438,372,544 *2C6ABDC95C13DC051E9A9C5178187CCB8A1FB753 TADHAMBRICK
438,372,545 *2C689C56EE0D389D7AABB575C90819BE5ED23912 [email protected]
438,372,546 *2C6BF117C222B435171D48FF1193105D7C1572EC TALISSACAMPBELL
438,372,547 *2C6ACA01627226A706DFC8CC25DB381B5CDE3D8F [email protected]
438,372,548 *2C6E11BCC5974F5751D2C5127DDF0B9DFBBECA5F SENIORJESUS8
438,372,549 *2C6D0F8F11E587E9CD97AF2B3B37297732FF1B40 SENSATIONALWALK
438,372,550 *2C68671C2056244A48CA46FDAA1F9E9BD9A0C3B2 tavoitteiden
438,372,551 *2C6B63B813F91FF5AA45CFFC661C0A0C90191356 SHACKのような小売業者はUSB上で古いジョイスティックを使うためのアダプタを売っていたりする。
438,372,552 *2C645BE30D49B7D8CDF64EA632DE7785E1D82F60 TEHRAN-MONTAGE
438,372,553 *2C6C1F80D2F505B1C612CF04E5919018E1D4B760 shannonrieken
438,372,554 *2C6956FC4624BFDD2F6CBF2339F0F62AC148B1BE TEMPORELS6
438,372,555 *2C60159D44A58D5ACE6511EABF4407CE8F374E27 shaynedidomenico
438,372,556 *2C69D7466D59FF1F4D440C3C2ABBDB88628460D0 SHEA SALINAS
438,372,557 *2C61EE31230CBD184EECE124485D9815E2FDF873 SHELBY.RABIN
438,372,558 *2C69A437BD6EF14D0723DC49727633582EB5D14E TESTINGMIRAGE7
438,372,559 *2C63993FB5C177F19AE3CBDBFAA75A1E8DDF6D7E TESTYING1
438,372,560 *2C6CB6DD34EED85D796A1A080C4903C38DDE6645 TEXAS_STATE_HIGHWAY_
438,372,561 *2C6E2C57082DB23E2E7082F3FADA9A2EDACC7FD1 THADDEUS.MONTALVO
438,372,562 *2C65A677E41949B4D5D22269AC96C02D5E45867C shoki.remixed.(disc.2)
438,372,563 *2C653BB1CFE04021C7B76E01AC84C1BE1F42F59A THEMICHAEL183
438,372,564 *2C6971A6E19E9D2176FFFDE38071402B6326166F THEO.BASTA
438,372,565 *2C60C3523CD0C3DAA6A8278FE1D070ECA753EB85 SIMONVISION9
438,372,566 *2C6F2A3D2252FBDFE9253ACC5C7703D99EF6A280 SING4L3SI
438,372,567 *2C61CA34D83F81E0312DDA44F3651624788B1925 sivreajiraas
438,372,568 *2C65EB73615BED02850792B2DACBFCC3455EFB0E SIX.TRANSCRIPTIONS..CHACONE.ZT.680
438,372,569 *2C6F4406C6ED9C8290E2E024D2F42338A1A59A25 THOMAS.MOBLY
438,372,570 *2C6159CEEDEAB693C036D54202B81FE559D278CD skotophobique(featantigenshift)
438,372,571 *2C63B8CAA58093256E7E9F80FFC546486508CCAE sonatano13op27no1ineflat:allegromoltoevivace
438,372,572 *2C67F26AE7B47C6C810189BD52FB01BEE7028FAC sophia-luo
438,372,573 *2C60692CFF5B784BE059FF844B04DC5E5E1231F6 SOVINNAISESTA6
438,372,574 *2C686918E5D206885BEA6303A71EEC25DC8336B9 SPANKYHEARTS5
438,372,575 *2C68121139B61F410FF69E2F41A4C648422734A0 spanribs
438,372,576 *2C6A36989691D2693E9E61E1E4D0EDE8091EC6E6 SPARKLERS6
438,372,577 *2C6CF56FD4F350D5CAB2B36D076C1AA7947C456D SSENESREVDANU5
438,372,578 *2C6F0ADB4ABAF7B1D90D6B8F7D866413439DD2BE ssentsac
438,372,579 *2C60964507CC0DA5217B7C59EFE028589EF51910 station-suvarnabhumi
438,372,580 *2C6A5011404FFAEACAD64F0B64EA58694BE99CE3 STEALAGE'ST/I/L/I//DZ/
438,372,581 *2C654EA7E3648AACBB3083143B8E012892DB64C7 STETFORD!
438,372,582 *2C66AF042087116160BBDABBC5BA823398656B93 steven-blizard
438,372,583 *2C66357D380033E74DBBE27950B4B003E5548257 STIASOPORP
438,372,584 *2C6997471DA67BF7FC1FEBE1E74D55F040F15888 sting-in-the-tail
438,372,585 *2C6557CDD00EAEA296FFC0CE06D737B9C6843B55 TRINIDYBORNMANN
438,372,586 *2C63E6CE8CC923AE4FCA079DFAFD3689C43563BA tristans3
438,372,587 *2C6C4D28C2725C348EB69D65BEF0ACF3E876BE54 (SUNISMELLOWLIKEA)TANGERINE(MADATHLETEGOESDUBSILENT#2)
438,372,588 *2C6326BF0C540370021037D75195A2C72322AA47 TROY-HAMADA
438,372,589 *2C6AA191D2087A5D50C149AFBD06B7A0BEB273ED SurfMe
438,372,590 *2C6C6578E371761AB70136AD683A9D4115DC6193 svenkarlson
438,372,591 *2C6E151154DFD42EB33CA5F6CF5925CB4BBD799C sweetsconnie
438,372,592 *2C65C8078A16758AD82CB5CD96F96F6EC2CE9973 tyrellobryon
438,372,593 *2C6954B4A58D0E48353915460AFF149EDA7AD253 TYRONECUTSHAW
438,372,594 *2C6A750D230A2310AB0EE4FB75E6A6DF9447201E TYRONE.ROYALL
438,372,595 *2C6AB0241593687732D68687FAF33E3AFA7152EE tzeelamikovsky
438,372,596 *2C61750181B2D027AE58DA59EA6FA2B0EA3864F9 TAEMAETS1
438,372,597 *2C6F83A3277AB95DADB6912907901E790C37334D UDUAKAJ3
438,372,598 *2C66D7C6220DE432B2274A48C4C1479EDDFE5330 ufuk-cagri-sucu
438,372,599 *2C6B51BCBE9A584501D13AA04D7A6F87D7219B4F UGTA
438,372,600 *2C68A518B8C997BF002EF5C75DDBD4995C2EB232 TALKREPUBLICOFSLOVEN
438,372,601 *2C675D78FB4CBB3BE38CBE57AF4A4D010C043952 ULVECTORED
438,372,602 *2C6D16AB33CAE4C2AB0982B597D662B1CF862951 ulyssesemmanuel
438,372,603 *2C6845072F5FFB519DBE88F711820F623269667A TAMERON
438,372,604 *2C6A8B2C11E4E169CE485CBEAF8131AD76BAB575 tankaralowllen
438,372,605 *2C610569240763B1C2EB15F201C4FC6783116A13 TANNERLIEBSKIND
438,372,606 *2C60CF64B04ACF8A8D66FAD7B4DE95E2931BABCE TANTESTANTES2
438,372,607 *2C693B316D9544875009A370D0B6E66F7646E94D TARAß
438,372,608 *2C6991135690887A5AF572B5F6325689B14C534E UNDEADDELTA8
438,372,609 *2C64F30BC57BE040416CF86FF0C05CFE515E9816 [email protected]
438,372,610 *2C6755429E8929B70C07A1B03A93E49CAEBD224D Unionic
438,372,611 *2C68DA79C5F95F023F02AA814084DED621C15FF2 TERAASHLEY
438,372,612 *2C6661FA482CEE57EFBF532ACAAA1BE143A68104 UQP1
438,372,613 *2C66EB24600A98E250353CC815165A766FA159D1 USETBB
438,372,614 *2C6C9C8F46750B800FF31E6D81ACAF885C0CCE8C THATDAILY23
438,372,615 *2C643D1815DAD34AD4CE6AAE5A41A32E63E75022 USUARIOS POR IDIOMA - EXTREME
438,372,616 *2C6B143AB4BF23E8308441947E1AAE72ADDA7F01 UTILITYSHOPSTOCK4
438,372,617 *2C6B87D72DD0DCA89C7A40128FECF7E06609C58F the.blackleg.miner.(b)
438,372,618 *2C69436CFF1A4C28F402F80FB54A2C1F7C7D4D6C THEPRINCESA2007
438,372,619 *2C6C3DE297BD05FB2AA3DDA3A558637C9A5FBCE9 THESHADOWSAREDEMONSTHESTARSARESATELLITES
438,372,620 *2C67CB3F721CAFC5E9ECDF0956829BA9FD91348A THISBLUESISKILLIN'ME
438,372,621 *2C6CC28BC85786C70A86CFA8C512AFDDFC32947C THURMAN.TSUTSUMI
438,372,622 *2C68A24E94914CB1742ECD7B70A18534B72B2211 [email protected]
438,372,623 *2C6FAF257268E6FEF5C9B2D59A465E609A4C8E86 VENTONWYN1
438,372,624 *2C6A5D8FD4C83CBCA3F4D1F1C111DC0DE06B3110 TIBAMAT
438,372,625 *2C66E5FF904B35369D75FC74DFA007BC1BB0CA46 timelogical
438,372,626 *2C6714313F6D89FE7AF1238CC88E7127BF5E7491 [email protected]
438,372,627 *2C6BBAF34D5FA391A4EA3A098C22392C7ADAE3D2 Vespers,Op37:No8KhvaliteimyaGospodne
438,372,628 *2C67E6AEE57B120C4282A069F09C8155E41ABCEF VICPARIVIC
438,372,629 *2C6BA12651D70D05ADC2CDAC18F5716FCB60E4CD victoriabarnaby
438,372,630 *2C61F05ED6AF8B3D2F3F5A257B661C447F13D0D4 TOMMIE.LAMBECK
438,372,631 *2C69E20F20AE90ECE07FD5869BDAD0B4F81581C0 TONAANOTED
438,372,632 *2C61507593191ED4538633090ED1A876B554C5FD VINCEVALCARCEL
438,372,633 *2C6B6101EEDAC0A070F6E114F942918D8C632A70 vindm
438,372,634 *2C6769991FA2D2B65BFD241711207E9E2507D9DF TÖRTÉNETTUDOMÁNYBA
438,372,635 *2C6D8A4BDBBDF2D1AEBA2115D74C9686E0282A21 VIRGIL.POPPEMA
438,372,636 *2C62F718759AE620C9DAF48EA9E715989BD8CF44 VIRGINIA ROMSDAHL
438,372,637 *2C69EEE8A8FE13D5C57247C7985EC34EDD7677C3 VIVIANNA-MERILLIA-ALFRED
438,372,638 *2C6B7C13CC8F960BD3076E2CD733CC616DA59315 TRACY.LEIBERTON
438,372,639 *2C62BC72207E52002F69260B825EDEA1EA63EBD3 VLAD YELIZAROV
438,372,640 *2C695F59AD7B115A74DC27222009B9711E1D94E4 TRANCESTORS-(FEAT.-DJ-HOXIDER)-(ORIGINAL-MIX)
438,372,641 *2C61B9AB2F31C5562BACAB704CE3E58AB39342A1 VOLVOMASTER9
438,372,642 *2C69FD7D163BCCD6325D6A59E492947924319AB5 voortgestormde?
438,372,643 *2C6156B4903011CC22E4BA87F8A71F881CA824A3 VROUWENGEKKENSES
438,372,644 *2C6D2216D3EFA08AAFB2E3E6CF3F03CB8310F8EF TREVOR-LEAHY
438,372,645 *2C66326A4AEC099B3ECF50911666E5905F4707C0 VTDBRVBY67
438,372,646 *2C65E52B16B5148F3F5F346D85F174A69EB541BE triono3:iilarghetto
438,372,647 *2C6848FA66340D30B84E2AFD2AB974B0184E2374 WARRIORSSEXY3
438,372,648 *2C6797383F99E0A33EEFD1FFCAE35994B04EE3E1 WASATCH FIRSTAID
438,372,649 *2C6F8E0CE39CA288355738BD1D660D0861E5E718 TURHAN.CELIK
438,372,650 *2C60CDFBB6D8163D144F453F51BBAEB2F493B8F9 turkolognarodru
438,372,651 *2C6AA2413CC001BC9050EC9CDA6C43A5856554A4 WAYLON.LORANGER
438,372,652 *2C60E8CD6D027810D43BE9C4167784DE48A3B494 waysuitwhat
438,372,653 *2C68314D7B82A5EFF22B89547049C8974758D582 TwelveTwo-PartInventions,Op2:IFLydian
438,372,654 *2C6BC51644FA3D64485A8CF635A8A19FB419930D TYISRAELSEN
438,372,655 *2C6B7926BC29B89B19D18923478196A4294BA544 TYRONERAIMANN
438,372,656 *2C675CD7831B113420E733813BE5F5B6FA8FC51F [email protected]
438,372,657 *2C6CB523C8A397A68547A86D65956361A3E1F0BC [email protected]
438,372,658 *2C6430C008096C0B9EC826E171CF84FD68C0298A UEBLICHEREN5
438,372,659 *2C69C85BDE694FAF385A178E05A19CFEF9900139 UHALLIGAN
438,372,660 *2C60DBE1B1FCE099BCB8B43ACEF0A5986868BE2B [email protected]
438,372,661 *2C60BE9C289C1B99C2518A02585311C463BA325C ullytongohan
438,372,662 *2C6CC348FB086D1D1F326347BBC7330C09FB6409 ULTIMATE.CLASSICAL.PIANO.(DISC.5)
438,372,663 *2C6B2AB402E7B483ADC6C574A8D0CE4DEB665E29 WHARFRAT-OVERBOARD
438,372,664 *2C64CA5AEA569D2A1E065B54B99D963915E56D1B unabsorptive8
438,372,665 *2C655DD3415E2BCEA556D6C23C59FC4ECD4FD09C UNPROPOSING.
438,372,666 *2C6BA012EA10CE62E914CCFB0D44259E5197B435 WILLN2
438,372,667 *2C67679AA6F941E55D69AA713FF9BCBFBAA16A21 usrbares9
438,372,668 *2C65C7ADEF869E7870DA14D0C15538A63B0A2D64 UUSKYTN1
438,372,669 *2C69AB1ED900AB2EF50478C75CDE32705C6943CE worakhantak
438,372,670 *2C67E5CACDA177518977438354CCC684C02B51EC [email protected]
438,372,671 *2C6A97C3EF75D1BA9CDF200E4EF655B303678DE9 vanloads
438,372,672 *2C619D386307258A450591A3CAF67B617FE959BD wwwworldendurancecom
438,372,673 *2C62A66C05C8CEC4FC63ED2F50A9B00E79D78DD0 VECINONESS5
438,372,674 *2C62AB69897D0AC1E1090F664949B3A88724A8EE 'VECTORS'...).
438,372,675 *2C6CCB36833452A9A15C80F5E59E29AF61978A4D velupuios-mooncrisp-lollygaggle-lisbe
438,372,676 *2C60E606DCB6F9CF803B66FB5A13D4DDE8A2CFA3 VERBINDINGBSW0
438,372,677 *2C65DF2A922D6AC90D266206C03F93C1C44ECD4C )X(~ <#####3
438,372,678 *2C62AB0EC1A1F3C79A8DC0FDF574AA80786FF803 veronicaknocke
438,372,679 *2C6DC1627AEAFD32050795620A5416D1C628C56D ververlena
438,372,680 *2C6AE574DFBEE8C9008C16A8CB683A6993CDBE55 VETST.
438,372,681 *2C6599D60591EC5B66B3BF7D19C2B62713C1F40F [email protected]
438,372,682 *2C622A908B41853AB979720CC64EAE20307956D4 [email protected]
438,372,683 *2C6001262EA9FC313A07F01669869E9D1A4FAE0B [email protected]
438,372,684 *2C6C9B1A646E04A546E060098246D4E3ECE6EEC0 VICKIE.LEE.BRYANT
438,372,685 *2C65894CE60894C9D1A47E6E5DD308D24EBB4B99 VICONSA0
438,372,686 *2C6BB5A6EAF0A21713679F5F00D1A7E623EBEBA2 vicrail
438,372,687 *2C6F7820E736B5AEA442505A1AAE0D61632F18D2 XLZWFRCUDATYS
438,372,688 *2C6FE4ABAA0BA55557A0B2CC039ABEA337AB9BA0 Victor-Sol-&-Niko-Heyduck
438,372,689 *2C68CCB0C88BF69CB68275B4E694BA86E3223422 {x}*-*-*<-----q
438,372,690 *2C63C20112B0D37174B3E39E90CB56FB357F5DE1 vinceshahan
438,372,691 *2C62B7D18A77CA04142F8AB54CDB533B61DE03A4 VIPERCLASS1
438,372,692 *2C6F58E970E3AB263551361308E4AE3A0A053C9C VIPUL PASARI
438,372,693 *2C6580D8C080E5EB0C24A470B742E107F74962E6 [email protected]
438,372,694 *2C6BDBF2189398216470689F7F7ADB6D12F4A12A [email protected]
438,372,695 *2C6583C623FA6E9A86B8C28D374F4340E0100AED YAATAVAAN.H
438,372,696 *2C6FF90E2B2E173D6403F4B4FE18287540A571DD YAPLINGYUAN
438,372,697 *2C6075F23E2F2D90DC9AC12AB87FB3E9E5725DAE YATIE KHJ
438,372,698 *2C678480FDFCCCF6F72C42F28D691DF75216D45D yayan-gianto
438,372,699 *2C6B9779CFB88EE425F30E9D6C62E356652BCA57 VNPENETRABLE5
438,372,700 *2C68A0D2AD3C3F41745939F61C717BC18F33BEDE VOKSÁVAL
438,372,701 *2C66714DBEEE48C297BD66EE279534BFFF6F84D5 YEARNER.
438,372,702 *2C6C5849EAB17CDEB0B62DD79890722265FD8D55 YENJUBAHIBNACUA
438,372,703 *2C6AC6937586FE83E0C92FEF5A141E8D3A082CC0 YEVGENIYA.JANE.SHERMAN
438,372,704 *2C6B46B836EE393621D13E2D025CA4221E79056A YFOOGYKSIHW
438,372,705 *2C6CB859D003D0B765BD82BA9E6A664122336D4A (VSNERGAL,JR)EATFIST,YA'FOUREYEDFREAK
438,372,706 *2C6D8555925B7ACEBD430A91B232B3DB730BDD86 YNPG
438,372,707 *2C681878D0BAEE6CD0C0FC5292FDDFDDC37D39BF w3F
438,372,708 *2C6054676667D10CE8E5C3A911385ABAB47795BD YONG.SENETHAVILOUK
438,372,709 *2C6924DC3274F209A97AE1FA1E8A2526788932B5 YPUGKKSV21
438,372,710 *2C6D9F693E2945F7D4010F5A56605DF3A31941EF [email protected]
438,372,711 *2C643702167D962A5A71560E5FA16815DB082AD1 ZACK.STUEBER
438,372,712 *2C6D9A57D3AE00B0E29AABBFD6BE2C4F5DCF715F WALLYBRANDMAN
438,372,713 *2C6DBB9FC51F38770CD3C719F31252D9B444EE4D walserhuus
438,372,714 *2C656BEC0B2020F25302E0D15AC916E3B937F201 WANGSASEPUTERA
438,372,715 *2C63D90228C67F36198C620014649E6222E34402 ZAYA.JAGAA
438,372,716 *2C6EC1A00BDD0E9E6DC65221FBED3852B1CBF345 [email protected]
438,372,717 *2C68AA69536DCC8A98C76FA409E6279F8D2FBDE6 [email protected]
438,372,718 *2C6A4456A11F6AA33844196909F6E820347DAF77 WAPATOO5
438,372,719 *2C67EC553D74CDFFF22FE33C4278C70EE792B3A9 WAYNE.C.LATRONICO
438,372,720 *2C6FF89B073998426E52FFBC419B3DE17B32343A WENDYWUSSOW
438,372,721 *2C6FA438604A46CE2091CA47ABA4B65F6CB55F29 wenetidis
438,372,722 *2C687AD495BC367E7A68F5E01B595CEA64687898 ZVSTOVAT0
438,372,723 *2C662A632AD913F67344AE49AA75347A1A50531F [email protected]
438,372,724 *2C6E0D660FA4E5FCBB096AF57D1CFF4075EE4E1E wesleypaulik
438,372,725 *2C669730CFDF663165A50118FFA5F93A85BFBA54 wesleyprestons
438,372,726 *2C65F504BD486A2F3D7DEAE300F5962A08C40C21 БРАНСКІ
438,372,727 *2C68791B5237912204A09F889D05B7AADC6E3450 willisshowe
438,372,728 *2C6F1FA776EAEC5F3003AD30755976B747A9C188 WILLISTOMB
438,372,729 *2C680F8FFD453CDFDDCCAE8A2A5535D23843A8ED «КРАСНОАРМІЙСЬКИЙ
438,372,730 *2C681D5EF9213F588960B944541CC62D4CCBF54A WINNIE ANN FERNANDEZ
438,372,731 *2C60FF4BE0DC0DCDF6B4D26742AF1E39A82B715E wiz-clealifa
438,372,732 *2C6E61629CA10370858019D85F283B33A750FB3F wolfseeds''wolf
438,372,733 *2C6FB3A7A438323D6F4E610AFE9DDDA53F82C5FF WORDLESS-COMIC
438,372,734 *2C60DD036A880D5AFE2D398BAB922636ADF2493A УЧЕБУ
438,372,735 *2C62B6E8209D298CD0634ACF5298DE799182483C は人民革命党事件がKCIAによる捏造であったと発表した
438,372,736 *2C662EB6DC50A10D7046BD43A7D434F1BDCD23F0 [email protected]
438,372,737 *2C60F12B49C83EB099A3EFA67B4C19251D91028F 座CUPID★MAGIC
438,372,738 *2C6AE68B47F3ADFCF709B7E842661F6EA1A7FE0D XUELINGCHUANG
438,372,739 *2C6472BF1631B3E9FD21E495BBA3ECA6B0EB3907 [email protected]
438,372,740 *2C65B7C0ECC1E0B61283CA2F74076774D1B72372 XUQINGKE
438,372,741 *2C6EEF6F7D3E3F4A8D142E7EA39F4D7F252DF923 x,z/
438,372,742 *2C6257678ED1CC37AF452A85D70E85893E737CF2 [email protected]
438,372,743 *2C622C529318D5EB19287B6D20D57802DE9DF956 YANG-XUBO
438,372,744 *2C6686778580F58DC83577615CD5C300A0965076 yankdanu
438,372,745 *2C6A002FE86DAC2DED1ED8A29F79F24E66EC9A5A [email protected]
438,372,746 *2C63A504A5FE4205668E68A4C548552E7A16BE37 YMUGIMU
438,372,747 *2C6CD53C1B1CB82834742ECDD5D9F765D770833C [email protected]
438,372,748 *2C6ACED722202A0DAA24F6AF5426798E6D9491DE によって部落社会の構造が実地調査され、「japanese village suyemura」
438,372,749 *2C6704FEC18E15D951B52B2604E225A01050A904 YUUKAUEHARA
438,372,750 *2C66EE72391EC865A00FD7D09B33B6F1160045E6 Z133644
438,372,751 *2C60F72E8815568DDBD8D00CC5B67EBDAA4DDEA8 Z2KE
438,372,752 *2C638A369A4E4FB20D4851127CC66CFB54F90FDD ZAME.ALI
438,372,753 *2C6BDE8C5413540020C700C0BC39E8955D3EB6BF 0v3r34t1ng
438,372,754 *2C619DB349A9A1F038CF8B5E9F8338B2A422DCCD [email protected]
438,372,755 *2C613D90595D79FC83CA9C18F9D0497880A9370F 11 alaviitteit
438,372,756 *2C67A885B7646E24EFCC26E03E5228A9D226473D [email protected]
438,372,757 *2C63C42E4780EA3E1CC53923D8034CE0B577F1F3 [email protected]
438,372,758 *2C63B946D1E135D68CA91E0430B50C55738D454E zieligst5
438,372,759 *2C6EADCD91A78EA22304D6F18C3438003A06677B 1404571 MIN
438,372,760 *2C64F21FD9D7E9B091F037B92CA345170BD54BD1 [email protected]
438,372,761 *2C6E5E3598E5D1BB7811FF19F60DB0AAFB94A2AF ZPLACATIT
438,372,762 *2C6FF4838D1AD7136C1339C39CEAA9474752389B ZSABAA
438,372,763 *2C60B0A7035014A4A6F106D2BE76B26B7F146880 1720429 monet-korjaavat-my
438,372,764 *2C6774ACC066DDDB044BA7A2AD301FD1EFD52269 z&xr
438,372,765 *2C6825337F0EDB28AEB1C71D0F8B99074F00C307 18.SEUTUKUNNALLISTA
438,372,766 *2C67894B58E034AF3FB8C969B3EAB589FA46ED4C 1968cory
438,372,767 *2C6BD8FF2A2008513BE67DEC60BE856AD54B6140 1-bagisinda
438,372,768 *2C612ACAF1AAC8ADAB760EB4275B3762F581BC4F «захисту
438,372,769 *2C6176279FC86AFA3BE20D23DCFECDBA0673FC71 ИКВЫ
438,372,770 *2C68D033EBBFEF74FE5B173C007EB4CFF05FF267 1GYSINTER
438,372,771 *2C66323EDDEAA3F0C32540829C0BC81A89B7BAB5 1-haydomisssa
438,372,772 *2C6B9C6199EF9D9BE0ADD840B9EF3185AFE6AE27 1hein
438,372,773 *2C682753F034304D838737E77C58273D26BBD6DA 1 ITSARAH
438,372,774 *2C6CB84C126C6EBF412FB21136FAB42C16F96A09 1JARAWARA
438,372,775 *2C61B91ED7B5A3A6DF0AF86F7B97970FA54D0D9B 1-KAUKO-GROUPILLA
438,372,776 *2C659275AF31F96FB2EC60F8A1763D6797C660B1 1POSEPTA
438,372,777 *2C66A45E724D986C8785C39659D832FCDB019E0D МАТСАЙКЕР
438,372,778 *2C626B37569A4703E780D50AB143C5A5816CA42A 1.see-saws
438,372,779 *2C6652C5239C1461D7EC0706B91E597B333699DD 1 SEE-SEEWINKEL
438,372,780 *2C6786B23E3175422C04237BB2E8E47C5917AF52 1siitin-elon
438,372,781 *2C6C626CBE07D5DC91077DAA4C7D5762E0B8D58A 1sukuhuvilalta
438,372,782 *2C669ABEA094312237E877B4DCB6B4201C71E5A3 1.TAVAKS
438,372,783 *2C65B79A92EB93D60C9268F0BB9783A0B9EA10A8 1THEMONTANA38
438,372,784 *2C665522E2011AC5409A741C1415F6EBFD9DD130 1-urheiljoiden
438,372,785 *2C6CEEE28C7713541F4A25DA4A3D2BDBC2ABE31C 1vaimeahkoa
438,372,786 *2C695749CFE37AED265BA02572CF9624AB711E9C 1.verhoehnende
438,372,787 *2C6B1DFAF34BB363080850701D0AC349F1CDE1E8 1verotusmenettelylakia
438,372,788 *2C60861C8E26135FCC409EA6F6277821A9AD6C09 1WLCUBTU
438,372,789 *2C6EF60A5F78E2B33BA7E265B3E56D714827E10B 200-jorginho
438,372,790 *2C603A180E912D4DAE6EF3CF2E11BED1D235A9DA 210296
438,372,791 *2C6819F870CB2C285DAE1CC843C8EAA05EBDFF86 2473743 tulevaisuus jota haluamme kymmenen vuotta itsen
438,372,792 *2C6A6392587342BA44DF3AA3F7E77BDB228670E9 261805 TAKAVUOSINA.HAKKUITA.TEHTIIN.PITKIN.TALVEA..
438,372,793 *2C6AFC4A669E489E5E7C48B6C1F7A8D57F302457 276015 pahaliliktan saman pazarina varilmaz oldu .
438,372,794 *2C69F060576A50E54FDB4FC99EB9386AB3A51CC7 2766446 KUNNANHALLITUSP
438,372,795 *2C615B2406D720F41424E1E51F3C61E0FC0D39A1 2876340 KAMERALEHDENJAJIPPIINYHTEINENVALOKUVAUSFOORUMI!
438,372,796 *2C65825A6B34AF9E7C71629EF903C39225A73E63 2928379 LASIKUITUVARSIAONSAATAVANA140JA70CMPITUISINA.
438,372,797 *2C6ED501519BAD719F3D1B90F57DF3B01F02FF78 [email protected]
438,372,798 *2C6A4ECEEABBF5513CF463B5C4ECD95CEA28C4AE 2DLAMINI'S
438,372,799 *2C6C92343172293C9384AB3DDBCA108591B664CB 2GORES
438,372,800 *2C674149BED01207711C886C746C8ED42BD8268E 2 PUOLLETAAN
438,372,801 *2C6AF285177DB7AD1B2EECCDB8046DD2FC49B65C 2thattrapper1
438,372,802 *2C66925028C7308B5841395F3F4A5635F8B640AF 34308c
438,372,803 *2C6A1163181D9E4DDF8D06F4612C0E7E0E2E47A5 3-baasen
438,372,804 *2C65B5BE2FEC0BC72933E19029F96311C33E9427 3BCZQUVZL
438,372,805 *2C6BC5902ABA409637988B9EDDA6F7D0493496EF 3BRUISEWO
438,372,806 *2C658D4CD0F4B0072AE8FF436E9F948E9DB017AF 3-B~-`-{x}
438,372,807 *2C627F3C10A29EE136873E02220C5DE31927E385 3CITONIRE
438,372,808 *2C675BF317C22503CDF5F6782978C55F17DD1EDA 3ETNUIGGO
438,372,809 *2C6A176CEEAA913DCB26ABEAC2D57C5CA4DE74E1 3IMPLOSERS
438,372,810 *2C600E3C8E37E133D67D2E4CDA88A72A6FF4EA76 3literarisch-politischen
438,372,811 *2C661D2578657A052D54ECDEE02CD5DA39EB1846 3NARCOLEPSIES
438,372,812 *2C63783B9C135DA808BAA2D2D0394359B7728547 3NCH4IN3R4I3NT
438,372,813 *2C67BE980E67207D543FED3DB0B46E65485BE395 3PI5COPACY
438,372,814 *2C6AFCE8FBF7A690103FAA6E9865A36F27423B98 最大幅:5KM
438,372,815 *2C6ABCCDD916C44F13DD18910639C633C985DF94 3TIETOLIIKENNETEKNISET
438,372,816 *2C6EE9C2ED97B968BF1C627B5BAB3C9838B0544B 434629 KAIKKI ILMOITUK-SET ON N
438,372,817 *2C62188F3DD5B8F59195CFAB4A50E89FD85AA6EC [email protected]
438,372,818 *2C68F169385AC6E033E909ED1F4D15ED0AF4E419 神(PAN)は、恐慌のあまり上半身が
438,372,819 *2C64B869BAA4DFBE09A1C6052F002BF5893DFC46 4HECANSENDAMESSAGETO
438,372,820 *2C6D29814E9D2D1E82C48E0092F20B7E7520761A 4NTICYC1ON3
438,372,821 *2C610925BEB34F359853A7695C9427EA9CB90C44 4OPPORTUNT
438,372,822 *2C6A0C1FB9F291704900D12B6053748639548841 4PEACECLOCLO
438,372,823 *2C6B99697E0F5995BB18876DD9CAEAFD82DF88A8 4.PUBLIKUMSTRAECHTIGEN
438,372,824 *2C6062491C57CE83A7E5ECADE4CDD10A5327854F 4SURFBRANDON
438,372,825 *2C6CC4649AE1CA118E41A7BEE8CE49FE3EBB4AE9 4VALIOSTA
438,372,826 *2C6BBD03291A329B7D972A9AEDA0D1C134A0D817 [email protected]
438,372,827 *2C67AB09FBFCCE59FEC7542227EF8FE8AB8B56D7 5BLOWFISHALEXANDR
438,372,828 *2C64D7F1C6AA20E32287FFF9BA7E54E149547E0A 5CONGENIARAS
438,372,829 *2C6B69E5F35A7EC2D2322B1A81DD9EF56DD6D89C 5EMPESCHIT
438,372,830 *2C6BA1EFA4A376A1E52EE9E099525605FC1EF00C 5FILOLOGIKOS
438,372,831 *2C68BA60BC5AD42B6AACB64C8B200ECB82E03EEC 5LEGATORN
438,372,832 *2C67DA93B2E3114365794BF009A2B9676373A2CA 5NEDSREGNSKABETS
438,372,833 *2C6F80B7356DD696A913EBFD96262586CF5387A7 100(AVRO
438,372,834 *2C68857CB50F6C0D268E05884C4CC3EF8F477310 1013654 yksisanariitt
438,372,835 *2C6626BD401CA7F850F04D304C0B1A2E1AF03C3A 1014481 hecampaignsinvirginiaandfloridaonfriday
438,372,836 *2C63FBACA42A7DB8807098022B02AC346A62D351 [email protected]
438,372,837 *2C6D54C11DE5D0ECE371F3B69CA46EB0F1042E6D 5PANEUDUIN
438,372,838 *2C6B15B39E78FF76B8F08FD95378816791848556 5PANOSTANUT
438,372,839 *2C66553F0D3DEA948A9FAA5C0929892ED8CA47EA 123456789io
438,372,840 *2C6D98AE101D444B58C7775BF5E1E62DBB36D950 1368758 KOULUTUS ON TARKOITETTU KANSAINV
438,372,841 *2C663F24E0A2907B48881B409DD9B0D34A730943 13T104201Z
438,372,842 *2C6DC8D8EBEAC55C5C277AE46E752732FC6BC61F 14.massoille
438,372,843 *2C659F39AA35CFD9E10F6DBAFF80CFFD5733577D 6260TPM
438,372,844 *2C67E2D8D53115027CF33D6D8B4946A6A10A63B5 69inthenight(jay-j'sshiftedupmix)
438,372,845 *2C676B978FE8E5F386976A2E57518132B3B6E56E 16-TAHDIDI
438,372,846 *2C62C937A244C1E4DDF95DFD32287EF9DFAE7EAF 6AYLMERKRISTY
438,372,847 *2C69460FC8F8D11BF7525398EEC7FBC0612E0935 6BSWLIBTHREAD
438,372,848 *2C65BD07552E85792EB4C6DC1002BB731C508BF2 6BSWNEHALENNIA
438,372,849 *2C6D6FD236C7D4FF96DA40F7072E6454CE236BB6 6BSWSOXMUREV
438,372,850 *2C62BF8782A057D35D53802F9407880AE79B67D3 18AUG1456
438,372,851 *2C6550532F2F95FEE3A4DB2571918E82C71E4C53 6INDIANMARIPOSA
438,372,852 *2C6BE3EAF8F867AE286AA140A775BC071783F392 1-AUGENBLICKSPROPAGANDA
438,372,853 *2C678033761A283525872A98F835C9CE42D1EF9F 1.bluecatista
438,372,854 *2C602DE9608258FB28E1AF39E9D090B12FDD4444 6MENOETESQUE
438,372,855 *2C6ED2B790535C9016E3E471E434A20067A3FABA 1.CRAFT-STORE
438,372,856 *2C6EFB77592C448D08B41828C382E88D9101B798 6MLAPTFOS
438,372,857 *2C6A0FD55C9530DEBA83A80C302E6232B1B761BC 6MUONMUON
438,372,858 *2C65FE0E2ADFB4CD8B80C0BFFCA7FD7AC7439E9C 6NIRAPAKK
438,372,859 *2C68B5088ABE4D042AE40124C264DADAC3AE68C6 6OFTCALLED
438,372,860 *2C68CECB83083C8B1892B823F34525E4B1252352 6PUBLIEEILBUP
438,372,861 *2C6D8E5BD82520FD68BB9CDCC15A825C20322D7B 6SCHOONGEBOENDE
438,372,862 *2C6121CF37E71CFE7C49D467DABE159578678F2B 1hein
438,372,863 *2C6595EF8AD018EEB6F4EE40319D62AB4EF874FE 1KECCHUU
438,372,864 *2C6B7EF8CF83A4E09EFCEAC73A1944B93A3634E2 1-kompartimenten
438,372,865 *2C654666C9E3E081D37822DB22F56DC5F2036F82 1MENSCHENWIMMELNDEN
438,372,866 *2C615F36CA087FAB13D4B7F2C21487ECD42D006C 1-MOISIOSTA
438,372,867 *2C64773BAB06FE8D0239F1EE53E691D484EE12E6 7DATATYPEN
438,372,868 *2C6E98B5E4EEE1EBCAACA4E6DE3C390879EBD037 1oxydationsfoerdernd
438,372,869 *2C6FEE250B28B8962311A48FC6285D64213AA6FE 1PANKKITARJONTA
438,372,870 *2C610863C812D9BB5D6630DECE429C769A54C1CB 1Q2W3ERAIDER
438,372,871 *2C6635852CD3826E76CC02B10B5ECB682EB36336 7ILOVEAMAZING2
438,372,872 *2C6E655028001D41158D63145A86E908CBC9FC8D 1repraesentationsbetriebs
438,372,873 *2C615A680BBB746A94BBF6E1D6B92C28988F6321 1-russisch-polen
438,372,874 *2C6E13AE1CDF7E77282520DD5D2BBBA25FD44B2A 7LINDEN-MUSEUM
438,372,875 *2C6055AB95810BAC554C932F5A8EFDB928819C6B 1.sosiaalisihteerill
438,372,876 *2C6FA81959406E39159218F757E5910A91DB0AB8 7ORLANDOSCRUFFY
438,372,877 *2C665507978E8E1AE02F31422A97B11BF9751687 1.TROOP-CUTTING
438,372,878 *2C6EBEAA3B1181E5AF04851B7597A06A8410AEE8 7RETINGBOG
438,372,879 *2C6474B0F4FFF0BB8619A7811161DB2810419EB8 7ROZLISIS
438,372,880 *2C6FB0094946AE770613166D8A85C21DAEE08D08 1 VARMENTANUT
438,372,881 *2C6D74AFEB249F38F088B2E3B90C486A59266474 1.VERENPURKAUMAL
438,372,882 *2C666ADBD83C3F3C0559CFD8228DAD870AA1933F 7SLITHERI
438,372,883 *2C617CDF5465133B361BF4C313257A324304BB73 7THEHACKER5
438,372,884 *2C64A19F24C8FE74384B6211C901EA04BCB18D96 7VQQQEBBLI
438,372,885 *2C63EA173EAA6E11C12652EF956750B4B3DCEE3C 7WEARSIDE
438,372,886 *2C6F8315051E2ECA5C0540E963AB2AE53F91F3CF 821938 biyogemgenelkurului.u.
438,372,887 *2C60CB9C2E86BF01B3DF8C0B1C213EE381E02B01 829dania
438,372,888 *2C6C1BCC70084C3B8A7E3206FB2001C762C149CC 20ESKADRE
438,372,889 *2C6C581693FB10AD4A5E163F8E9F20230B1E3BD1 214598 VE-ORDA-BIR-RADYO-DJ'YI-`-HAYIR-ARABA-'-DIYOR-.
438,372,890 *2C6DAA710384C3B0FF5C95EA6E83098CADC4CB59 8BSWSERIALINITBSW
438,372,891 *2C6593D9DE03FAC7B2E979B0D52D8945ECE3BB65 8COMICALITY
438,372,892 *2C6C2BD562B44751440FF6060395E32E9AEE284B 8ENTREDICTION
438,372,893 *2C6B7CDA05B6D7CE68BB6AD7FD993B16F17156B6 8ERSTATNINGANE
438,372,894 *2C6560BE675CAD56455BA99D13A9E511A9891CC5 8IPPUJAAN
438,372,895 *2C6AC06A4DC12989412C17E7B2C1D0518AD124F1 2487682 iwonderwhy,"hesaid
438,372,896 *2C644C93B5AC54D81F2FBBC0FC22B0B06C98C455 8.L
438,372,897 *2C6AC6CEB97650EB74E02D497B9C2701654DFF0E 2516437 hartausrakentuukerhonohjaajienmielest
438,372,898 *2C6B9505EAEB82B278F3D1C39BF528E388DD0198 8OLLIT3
438,372,899 *2C627585A08C3665DF86E0AE0627C9695A2293D6 8----P.*.*3B<-
438,372,900 *2C6F60D96D5F98027F9219C18EEA93791CE17DC8 8#p~o~osplat!
438,372,901 *2C6793A84792C602F5CC074D477FB6FA2EA320DD 8SETLEPL
438,372,902 *2C6AB37B75D9830D5A5DD815253ADD70360B791A 8SYNERNETICSBSW
438,372,903 *2C644DC6D841B7C54CDC88701E8C4A56B5FFD6FB 27jan1400
438,372,904 *2C61B37B2CF5F9B41CAEFE1C67EE7A8D4AF03D07 280845 tampereenyliopisto,progradu1980h
438,372,905 *2C601E0E476907287072F18606E63BAAB90C1A15 2962113 'IDON'TWANTTOEVERHURTSOMEONEDELIBERATELY
438,372,906 *2C68D3FDC7F9559DA565C562A905E5F8677EF3F2 953724 hautomo-verkostossa-on-t
438,372,907 *2C624A5F85C778D862AAB2D39E4C23316999DE93 2c1128489
438,372,908 *2C6A931F8104F5C99DF0FB43FF98EF439817AE54 2.KIELIVALIKOIMASSA
438,372,909 *2C6892D6CB45AE9F09D14FA3EAA7F3BF64973527 2 LIHASS
438,372,910 *2C6C08F23EFE6269C7BA9BC9294B61ACD1261326 9MOUNDCATACOMBSCENOTAPHCHARNEL
438,372,911 *2C6C8E89E2A0421940A343964DAB467675935D1C 2 WEICHMAN
438,372,912 *2C68F70123A37D25443B509F6AAD07B6F0D05877 2-windslab
438,372,913 *2C67378575231D77DA227EFB954D13AEB324C034 9RAIDERSNETWARE
438,372,914 *2C6D66F2D1ABCB9FCB722F223E5782991FA48BC2 30-HRK
438,372,915 *2C6E013E60618651A10EF6CE94392D954A7DFA51 9SEVAHSRETFA
438,372,916 *2C608C67D19C6C69B9BDD1E83C6C0BA3BB6F7900 9SKOPEYTHRIO
438,372,917 *2C69625E96F4B5D4F14B436F970C96A2325AC6B2 9WEEZERDREAM
438,372,918 *2C6DF69EFDE873D689183FD97B66495C8120EB14 3D9033554
438,372,919 *2C64186D4C33BDA2C31323E4BF6CB5423EE85468 A(+0D
438,372,920 *2C6843AAF72168DB70573EF5F13ABB279E506334 (3).IF.THE.ADDITIONS.INCLUDE.A.TITLE.THAT.IS.NEW.TO.THE.DATABASE
438,372,921 *2C632320346257B1036BB26F9BABC809EAADA914 3.SPANNUNGSABFALL
438,372,922 *2C6140A5217C22D81D0538171CBB8F0A0CE997E1 AAALOGANS
438,372,923 *2C687F8259147A58B55A49BC6D500003B005E93C 441MAREN
438,372,924 *2C6DEF5820410B5D8C8E199A167EFA2C506F5F56 467161 AMINBAY.SAPAYEV.(.VIYOLONSEL.).DOC..
438,372,925 *2C628D02CCE000E12EFB0A070C3C868D0DFB917E 4bcqejwl62rbpmr8vlgwfdbwb
438,372,926 *2C6B3B7B9B64F55220A7975A1F5CC5C17A2CC6E9 aak/=
438,372,927 *2C63060030CDCDB452F66DE6F864793E2B47B6F9 ã…âºdã…âºblo
438,372,928 *2C60A65AFDAFFE3322DC804870ADC64D646F9500 A-AOF
438,372,929 *2C622CB2632660EF3E90CF2B1EC1ED572A4D5098 4-lampaansa
438,372,930 *2C642CE4E4FA8A0FBA4905F4987F206B46CBEBFD 4LIBKENS
438,372,931 *2C6FD9D25C29560A5F712D590BAF9E7FD246AB99 4LIEFERANMAHNU
438,372,932 *2C6BD2C1227CF6F10A43FB4BEB4EF6CA1F854153 4NEMPNENEMPNE
438,372,933 *2C61610A24ADBD1F5A9EE8BEF67BF17374546849 ABEGGETH8
438,372,934 *2C608A166B8A46DCB2E0E92D6417B342D44E6D4E 4pyogenin
438,372,935 *2C67F0A37566023D80D94C14913F4D2D970B4085 4STRIDR4PID
438,372,936 *2C6170B7B9CA8CC9B1674C91C9ADC72FF1843B1F AC(1A
438,372,937 *2C6688142AEE9B33B6EB62AA3EA7D6CD3A5943AB [email protected]
438,372,938 *2C6218FB9E3A596B6BBB59F17391D2A2812EB497 4VERKHNEUDINSK
438,372,939 *2C698A366CAF6A6E773C87D3E318BB8397232411 ACRESCENTAVAS
438,372,940 *2C6215338992A8A10C3AD3E809A02DB0A085B74C AC!YQ
438,372,941 *2C62A691BBA55B61E030DF7C4AFD5EEFB5C8CCD3 AD(G
438,372,942 *2C68A1DAD6CA769FBD08BF4F1F0E0562013459D1 adrupoling
438,372,943 *2C68F22930C9A0A11DC1E8D0A8BC61F27CDB8921 Ae9o
438,372,944 *2C6524DA6FFB9E37CBEDB115CE55EF3F3D5D6F24 agg%
438,372,945 *2C61B6001CDB1814E1801451B790541C4725B417 5KRAWEDX
438,372,946 *2C6039B3E872A47EADD7E40420B54F2A53ED9E38 5lenzerheide
438,372,947 *2C68371C66C0FE86F59013956836C043220405BB AJAYBIR SINGH
438,372,948 *2C6268A09FB9B4F3E2210DCDBCE40E01C77134AE 5SCHLAMPEN
438,372,949 *2C657BE010946D90D9DF645F92AFCF215A7CE900 akqap
438,372,950 *2C687749B06798FBB0DE41A61E265F086BCAE58E 5UPERLBSW
438,372,951 *2C64FF8E3734E612C8BE4255647BDDDBBC14972E 5VERKWIKKINGENS
438,372,952 *2C60C4A9D10ACAC39481E781BC79E2628130019C ale)b
438,372,953 *2C69E9F830D994B740B7DC76929C89BC28F4435C 63ddd4c6b8303ce0bcdff588d7e99f65
438,372,954 *2C6211CE8FA2B7A80B5E22CDF5F11A5A09CBD5C6 654465 valuutta:t
438,372,955 *2C6D1CCB24E24105A922F4CECF976396FB78C2AA ALICIAARZAGA
438,372,956 *2C6FC6BBA1B629A228582D3F3AB3CB4AAEBAA4B0 [email protected]LCOM
438,372,957 *2C656B90FBA425768930A70BADB9BC01CBBAF201 alisdair2
438,372,958 *2C6D1C4B85AD925993F8BE16E071C5954A28D1FC allonisa4
438,372,959 *2C67D5F140456890E27D77407D5E5CDC48982E6C alpha.bbs
438,372,960 *2C6E7E5723BEBCAFE3B9CC5024CEC39FFA60CEF8 6BSWKANTRONICSBSW
438,372,961 *2C6C556DA12E9F4AC4AFB7129C75153AF0DE7CE3 6BSWPALUASBSW
438,372,962 *2C63F1C3E6599B0746BE2F2751296C5EDFB37566 6BSWSHAIKHBSW
438,372,963 *2C6411634BEB063F6F8A030D4A71615BFF14685C 6CNNONDA
438,372,964 *2C6C211F54665C48FB3BD405A6C508B0A3D3372E ALVAMALVERN
438,372,965 *2C6380C420B89F2A7573CBA58A0EA776B7FAE6BD amandaubben
438,372,966 *2C6499A738619B89CCFFA0952AC2DC77D3455018 6FRLNGHYSN
438,372,967 *2C692275BD95202E3B19A8A96CC3F6B94D6F53F1 AMUMIARTEIAS123
438,372,968 *2C642775B0628540F2AAD91678F18A3182F95A9C AMZ.C
438,372,969 *2C6A55185F28D1DD6A978730FEE2234134283FE5 ANGADG
438,372,970 *2C60B2ECDFB9BF360954A98D16B8C582A433C48D ANGI SKIDMORE
438,372,971 *2C6321AEA3F0A20798BB7D74619AEB1FFE076506 6.terveydenhuoltoj
438,372,972 *2C6005A6759CF946743598350AED87706B177C26 6TOOTSIEANNIE
438,372,973 *2C6D54C101F482DD5D8DCBC20225A8AE611EBA14 6UNMERCHANTABLE
438,372,974 *2C6C1978B13EA9BB2DCE7B3DDBEC9ABCC912DB08 AnotherBrickintheWall,Part3
438,372,975 *2C6CF2768C484E9FF7FBE717D80888B1B22D9BF2 718TOMAS
438,372,976 *2C6E9DE6019DC012E7CD55228C767E7EE27B3F6A 740DERICK
438,372,977 *2C64E4404103C78AAC791EFFB73653A05FDF085E 746969 VALITETTIINVAKUUTUKSIINTEHDYIST
438,372,978 *2C6CEEDD136EF24D36F423F167D151D40151E1A9 ant!nucl30n5
438,372,979 *2C6E13308356F37192C2554D6C31C620F9E9102A 799deven
438,372,980 *2C67713E461A83DB9805A0133A761D1AD1BD43BD 7CQUELINE
438,372,981 *2C66AF48170BCC988685FF2990BA79273A1AA93A aocwu
438,372,982 *2C6BFC57FFE412D03532336FD805EBEDAC67FC9D aoe#
438,372,983 *2C6B20B14754701AEA5A0802FBEE780750AD88D2 APUITIUHS
438,372,984 *2C60C7D2FB0AE6B725F307FD898D0DF666482742 7KAVALET
438,372,985 *2C64CAF3D1053965C753741DAD87E35C2E31D60A AQB7(
438,372,986 *2C6CFF734C0469A62A8B507E06141752BCFD663C 7meganthropus
438,372,987 *2C6FD37DA6B82E49A6CCFA920D600EBD98D9452D 7PUBLICISTOVO
438,372,988 *2C612A7A6692592DE90E38BD3694CBAF1522C941 arikknap5
438,372,989 *2C69402A02E944B7FCA53BB371E87692A90F4426 7SEMOLIKA
438,372,990 *2C61A1E9012917400DCF5FD6DFAE6CB1212164A1 7THEJENNI8
438,372,991 *2C668CA4D1A0B776DA7E6A1EA25349CDB45AD9EB 7VICTORIAMINOU
438,372,992 *2C6906156C52E9D02645EB621171A52FE0ACFBA9 8ACOUSTICKS
438,372,993 *2C6BC86E78E3081E84E1CB0F67B5A788B82B3980 8echotiere
438,372,994 *2C6F6AD20DF34F743ED1E0A195EE2A599F12BB8A 8GANDULEARAS
438,372,995 *2C6077646C129A4E435C1F621300299B78C58512 8HAEIVYTTAEAE
438,372,996 *2C65D3D83BDBCB7EB34AE6218F5F5B2767C93DCD 8ITHIVYAPSU
438,372,997 *2C6F7568D34868F05B459F4AA005CD07E2F5AB75 @8JEC+NE$$
438,372,998 *2C647D2369089E0E14EFDEBA9E2478DDD6C4357D 8KEVINCLA
438,372,999 *2C6E19417E5E9D156D3E977E1303B8804C2F5EA5 8KOUYOUBU
438,373,000 *2C60D002A818852102A0398E715A054CC858F725 8.L
438,373,001 *2C673B3835E2CBCAE73929934C35A3A01F0ABF19 )8(O~0~D--B
438,373,002 *2C6F6317D7B2701839484DCE6D7AF4D79D519280 ARITRO ROY
438,373,003 *2C65F961DD5C29B1B9DF12805C4AF7C82D70611D armandoezelle
438,373,004 *2C6120584466DB831B702A061050677AC355212F 8quiconque
438,373,005 *2C6F1629D1CA974F2A97D03E95D4BC7C36491440 aronnichols
438,373,006 *2C6983C87B8EC66A3334B5125B52E3FB5897919E 8SETAATSN
438,373,007 *2C6D73E2620370F57A3417109FC323832D4E1878 A?RQB
438,373,008 *2C6A33EC682769BF726AA93154A2BDD63B9C0D9D 8THATSCOOBY4
438,373,009 *2C673CD2BABCC31F876E6D66ECE8FA012754F21B A%S!L
438,373,010 *2C63FF3C2EC03DD75396E62396C401A95009BAD0 9CFFCNTS
438,373,011 *2C6A0D4E423B5F955840A8AE9988EBE2E30255B5 9DANCERHERMAN
438,373,012 *2C6F53F9EB0A995AC71B738BD7CB7FC1EC16DE17 ATISTSUC
438,373,013 *2C61C2AED9431C04DAD68A21E5F2BE85A1A27840 9FBTLNGSTRMJN
438,373,014 *2C664FFDBF4616F0B8F4F8952B1C53789620A6FA atsusuon8
438,373,015 *2C636CF6FECEE83C369FDE11486EC93125B68A93 a$tv
438,373,016 *2C60E9FE3252FFD10E7504A9591185F72D21659B au(r
438,373,017 *2C60F1641ABB72C69E909858DE3EA866CD2AFCDA au#ty
438,373,018 *2C695EC0136662236157B5BAA235B31E82E6B73C 9PRIVILEGIERTESTES
438,373,019 *2C6B4EB01F55F34538E70FCD000990A40663B611 av(rx
438,373,020 *2C6190CBCA998CC45B833F7A61957AE9507E1F64 AYMEEALVARADO
438,373,021 *2C6105FACB8FDC6524CA6E584EAAB4F2212D102C A;)
438,373,022 *2C612757EB75D144F209E3141FEC1BA9F07006A9 B;0GI
438,373,023 *2C60DFE1E5962C9466E479468775B8CD9E83E374 [email protected]
438,373,024 *2C6D2599177D969983887F52ED92645EE53B1BA3 aa(oz
438,373,025 *2C6CE71054A01220041C9B7FB29B07452AD33121 b;,bw
438,373,026 *2C6074EE67CDFAE6A69EE6673FF0640CE24D7183 B##D.~O~o.{x}
438,373,027 *2C66D30CDFE27C69668E3B695222AD46AB8C245E BE,),
438,373,028 *2C68D0B75BDF3305FAF7138FF9594E37F8E3647B Aceyalone.and.Self.Jupiter
438,373,029 *2C678E955832655100A74FF9AD2D2C558EBB69D7 ACID/BASE
438,373,030 *2C69E0D727ECD53A24C68BA163A94B5EEB30334C ACUESTHESIA2
438,373,031 *2C675590F63A47A492C0F35F9DB6A0C123426C32 ADAM DONNELLON
438,373,032 *2C65BFF96DA9B6F090EB6267453885ABFF66312D ADAMJERRY3
438,373,033 *2C67DC227537072719BCD58F3826A3A4CEDF8FFB BENNU'B/E/N/U/
438,373,034 *2C67D784207B5BBD9B7BF23633A675F878527E28 BENTONMAIETTA
438,373,035 *2C6289F8D9E2B17B38691EC71EC28C2EE5DB5B39 AD-NX
438,373,036 *2C63D7199565F64DD4F7CB5925C0819B1B4F2FE1 BERRY.PRETTI
438,373,037 *2C62229C76034C1C582786A30208E9C781D8F32D [email protected]
438,373,038 *2C6FE346E560E21398708763ED1FA6C4D50BC8C2 [email protected]
438,373,039 *2C626AF7229D6716FAC911AFD41CC0EEC1C84BD4 AE5!5
438,373,040 *2C6F12B012A92447A64B01A10B6D175E14029701 bilban
438,373,041 *2C6F3C2ABB951E859DFC87AC0A816B7171F3FFA7 AH1E0
438,373,042 *2C6819C7E227E2B3E073F56C91BE5C75E39C3214 AILEEN068
438,373,043 *2C6B54BD6600233158C0D34046C7D17AE7775EA7 [email protected]
438,373,044 *2C6B1B933FE4185959CF1133E4F9F78AEB5DF90C AJ1DY
438,373,045 *2C6439A22D961358ACD0084857AC7FF556F3B208 AJALUV2
438,373,046 *2C67E5186440EB31EE6222883C7CEBD69FEEB870 ALBECHT160GDR
438,373,047 *2C653DBB17947167284CCBD0D89B78C29D978B9E bnvaonjgs
438,373,048 *2C6A2D14FA51FD71E4FB03243FF5F6755764CA4D alexanderrath
438,373,049 *2C6FEB00DDB5E63FE5266B656DEEA896379DECD1 alfredodaudier
438,373,050 *2C62193B663426C7EAE747B800E9E284417870EA BOEOEMILAEISIAE
438,373,051 *2C6544AE1501EA57985F501905FFE2182224B3FE bolero.sin.querer
438,373,052 *2C6F87048FDE2B3CA0D0F36A669A872ABC796CD9 all unseen, can passage find;
438,373,053 *2C6B12A6774886FFBFDE97448A7E8308F743432F [email protected]
438,373,054 *2C6ABEA785CE44F35D00FC488DFC839303C6C1FB bopaddack
438,373,055 *2C627D7D40B7608615A5D6F2621886ACD7E5BC11 bouenkyo8
438,373,056 *2C62DD75A28C5D7D2DED4E4EDF42292122687A55 BOW6-
438,373,057 *2C66070556E2D745BD7C23089E273B3CAB6128A1 ALVINIA
438,373,058 *2C61FB6BAD1CFA99B1E0CEBBDC331F5457CE3713 [email protected]
438,373,059 *2C64D581CB272AAA47A7006D9711876A17D485A8 amenhotpe.iii
438,373,060 *2C650E4E5AE8616B816DB248A27483A91573AD47 BRENDAN.ORDAS
438,373,061 *2C64192517111E3F0DEA534A38B32F0A6505B090 BRENDONMITCH
438,373,062 *2C6611986E044197BEFD9A6F8A08F356A3C0A4C3 BRETGENEY
438,373,063 *2C6CD19B39699BEA54CE960C3A1EBA8209FBC6F1 amrediting
438,373,064 *2C630349C2B6F07C81334E6AA7B2BDC38CA119C8 BRHATKATHA
438,373,065 *2C6A9C88D0C5AA09461020DE10B8650D672053F9 ANAMORTON
438,373,066 *2C6AFFA0B61823BB27A95717C70F8A26EF0A80D2 ANDERSONIRSIK
438,373,067 *2C6BBB401E2DBA1F21E9EF64B29443B0F061AC50 ANDREAS.HAYSLETT
438,373,068 *2C6CE436F84268A3CB0A20D4BDAA11D2FB6D6FE3 brossaient6
438,373,069 *2C6295767D92EC623D871FE82FE0128611953EE8 angelusnoinorinokanesaigoseisen(shortversion)
438,373,070 *2C6E333EEDE0E84DDCD4F4037802AFFB4C3792C9 ANNE.PAYAWAL.DELA.CRUZ
438,373,071 *2C69A1E3A9DACD6D224D457CCE78F87B18E49FD5 ANNE,《VIVIEN
438,373,072 *2C6CC969CCFBF99CE79F0D86D3A55DF52841BEAE BV:1
438,373,073 *2C63AF8F036B7A0665472BF3DF353817124D0035 b(wm9
438,373,074 *2C6FC1A479CD5EF1EBB4C7FD897AE8E0F923586D by36"
438,373,075 *2C6C37BFFFD48ACA51666CDEFA4ED79E5F1363A6 BYRONKANDER
438,373,076 *2C6F5A01C3D4652F6CB0334AA78B005624BAB12B BYRRONM
438,373,077 *2C62AD28C0D86A6862B6F030C6B35D38A51E420D BYW+2
438,373,078 *2C672F2175089D4B1DB8E8920356C5D993AA213B C"$;
438,373,079 *2C63087A7A00B1D53D68E20750D5759BF0B257FF a;qr:
438,373,080 *2C6ABA3211A282D171DD2D3C4BB880EC521368B5 [email protected]
438,373,081 *2C6CD27D4FDA84B06B25FD19FB9819666F2D1CAF [email protected]
438,373,082 *2C6D2DF841588B8770513B1E0BD41D22FA2A5AB5 ARNIE-&-BARNIE-WORM
438,373,083 *2C69ECD75BC289B80C1F1F3C02310DCD5D672931 c8bwf
438,373,084 *2C60A2CF6F9500E171C5CEA5FCF75CCA8E989B48 ARREFAI
438,373,085 *2C6C36C5016422F22D1507BA25B5D7EC71402960 C9d+
438,373,086 *2C66F526950B91D6906D019C1AD1028AFC8855DD arw"h
438,373,087 *2C6588DF4E0263CC4018E189C6EACD0625B05E0A cameronsicola
438,373,088 *2C6CEA9F4A7CFECE8CC4AEBAA5D36F9B0B17C4D7 ASIAHSALIM
438,373,089 *2C6971FF43B2BF521B152138AE41D0178CF458E2 asignarte2
438,373,090 *2C67556306D3299A1E2F1122CC7D5CF6470E147F can.c
438,373,091 *2C69E7642D4FABEBD3436701E927605E6F09E431 capalatmaka
438,373,092 *2C6D102A5E882306D5B0EA796BAF3351E8B5FDE3 ASV/1
438,373,093 *2C6BBAC8262D7DA1FF4F69566FEA7C6BD06CAA34 atativs
438,373,094 *2C6D66D531093D66D334D15BDE6B3EA73CC851B1 CARMINE.CHASS
438,373,095 *2C65E7DDFD1B1E5C9A30E2F67C81B2AF4E0C1F5B carminemadray
438,373,096 *2C63655A19E0981689EDD58C07FD5F2808BBCFBF athens1059
438,373,097 *2C6F122ABDF7271B1F678BB6C34DE5D1B43B980E atrcw
438,373,098 *2C67F399304AE4ED8895AF2BABC495713FE596BF CAR-WASH-(EXTENDED-MIX)
438,373,099 *2C6AD5B0EDB70DDC819FD194D9B71FDCC3AAF7C6 cf?u!
438,373,100 *2C6646DB9873B3E7E35DEB915C2BA397CD3A9A05 AUGUSTINEPOLLOT
438,373,101 *2C65292465DF4682E9867EA05FC64E865C6CE61A changkysar
438,373,102 *2C6D3F3F1398D6491BBE1050687CFA5076508CB6 [email protected]
438,373,103 *2C6DE7B8C67AD7B72A50C2B0D564FBD7AF8F3C77 Chapter-3a:-Photographs:-Examples
438,373,104 *2C679D5A717D4B5CE2CE3835548F585E3310DE80 CHAU-MY
438,373,105 *2C67849241F02B47542B8002413D4A05EDB80684 CHBABSW6
438,373,106 *2C682AAAB2FA8877791710CE3C70C9F8D783124E [email protected]
438,373,107 *2C6D1284B38421C570CC614AC1B7ED027D08EF86 chesterreardon
438,373,108 *2C6AB9554C76D791FD36267DF73524AF3D01E70D a.))w
438,373,109 *2C6D32E9738B1A458319C3535CFEFDF1E6926F08 azzerucied
438,373,110 *2C67912791A733E050A24EAEE60F8BF36FB5588C b_)0,
438,373,111 *2C65C4044E9150EDEE905ADBCC13A06E5C1E2360 CHRIS WOO
438,373,112 *2C6B839FE5B4DAC6E01CDE5FED0511E86DA650EC chromatieke5
438,373,113 *2C6D29AC75BDFEEFD19855F9044FD6B45DAF60FF B5A20
438,373,114 *2C65EAAFA3CE7DE709B511D9DC46BA96B9B66580 BAETIG
438,373,115 *2C6A4BF6D82E9B58593E2599F0460F81F3D58054 cliffordcough
438,373,116 *2C6905B850C451CAADCDC6A7DBC27F934FEC623E balladeina-flatmajor,op.47(feat.piano:krystianzimerman)
438,373,117 *2C68BD37D6AB9C4A14F8C7491163E9F7BC7FD12C CO-CRAFTED
438,373,118 *2C6D67C668EAC52ABC0C204E7B92EAC6AB1DE76A CONCAIGH
438,373,119 *2C61525D28AA752469D0F86CF6C559FBFE80DF9A cons+4bu14ri3s
438,373,120 *2C6EE08AEA56A1C1BF2646D735F7DA5683F68FA9 BENEDICTALLANSON
438,373,121 *2C6B5DF13224326A69EC8BA757FA931CC6C00BC8 [email protected]
438,373,122 *2C61C591DBFEC2730B835E1C1DADC4B588AD1D47 berniesestoso
438,373,123 *2C6730AC5ACB437EA4CD2F4507857BCD650D7386 bernisch
438,373,124 *2C6DCE3853ED047ECFEFC902C7FB64C83BE71A14 b&f?k
438,373,125 *2C6714E7B0E3990F84EED9CDD37572B118A5C605 BJFP
438,373,126 *2C6F28DE29E311455E54A605747B2780C2E5F289 bl.pv
438,373,127 *2C62D99EE009228FAC7136C29F73751AD8644400 bnj2
438,373,128 *2C603CF8CAA9E8ED9C295FE134F0FB8F2A120AAD bolero.sin.querer
438,373,129 *2C6E720575BC06A66ACCFCFE2BA427CAA2E6DD1C BOUNDERJCH
438,373,130 *2C6B5D40B0E6A01DACAE8168E547DE2227EC076C bourrah
438,373,131 *2C6EB6F69809343FB8D4C9F4BEEBC2F55D4AA8C5 BPA"N
438,373,132 *2C6D41DC2462288B0E635C5B9FE1F461A6606B6B B+PP:
438,373,133 *2C65DB6826A98AFACDA13FC6C31BCDA867121B9E ctcda
438,373,134 *2C6D717329FEF10611028B33EBD0EE2D9DF88A48 CUDGF
438,373,135 *2C6EEFB7685764EA5FAE87D443570CA3428BB0BC cv7m
438,373,136 *2C64E286C54F6B570AA73196BFB80C56EC2B27ED cw5at
438,373,137 *2C623BB0ECA51C255454033947C9453C2C9E0FE6 BRYSON000
438,373,138 *2C6F99EADBAECF97C173A2B1E1D75C5DFB19181D [email protected]
438,373,139 *2C6B304B6230D42A3FD17342F96F581D856BB162 CYRIL.COLAO
438,373,140 *2C64188C3FC75608414D57581CBBD19C659D6130 cytg
438,373,141 *2C68D33977341CB2C958A15E5B35DBAE68A775C1 d1d)y
438,373,142 *2C6045D7DA3AD1CA1A9200AD4694216D67E1E291 bswpromvecbsw
438,373,143 *2C6C854F79D45BBAAEABAFFE994B36850C450079 d3;?j
438,373,144 *2C6E2686DF8F255A568DDB1D38BE79CF0CE49A04 bts%f
438,373,145 *2C60D2A71833E5F950EA4F312BC857FD19E51BC9 d5fadd9
438,373,146 *2C6D983F278A372091356F35A27A6C93E978AF0B D8)I-
438,373,147 *2C686F3C64E6D6FCD87FD108B977637BEA4FB7E2 DALCORSO2
438,373,148 *2C6DE8C8624F96CB895BAE8EB4054EAC429B9233 dancerariane
438,373,149 *2C66D2D72767F3E1D173C67B1D77C9A9FF1B636F DANNY.IZAQUIRRE
438,373,150 *2C6873EFA266349C6C9363D8D69A4E67B61C740F Bus-1ine
438,373,151 *2C660797429F6E2401B1FE763324889976212DFB [email protected]
438,373,152 *2C65FECCFF311DE364FB15959512A52518FF98BB bv-
438,373,153 *2C69C9C9BD7494CF85BA7F8F499BF76D5314D243 bvo6(
438,373,154 *2C64861EAAB96A24697C2F1E600B90076EC71670 DAVIDMONSOUR
438,373,155 *2C64D8F0A3DFADED33EE447786010623CBA585C9 BZ;0T
438,373,156 *2C6D452391365133843B58E55DE3C90C52652E26 DD1I7
438,373,157 *2C655C3B2F78F5EE0C6D33B3B9014012175E2A5F DD#TM
438,373,158 *2C6DEAF70DD521ECF56D0A46D99F8FEE4CCD2E9B DEGREESOFCHANGE
438,373,159 *2C6664345D61F927394706E8FCAE0F31F5092F7C DERNIEREMENT5
438,373,160 *2C69F7651A5D1CBDE5AFC6EE56D657230A04A3E1 c4d=;
438,373,161 *2C6BFC587488364EBAD2201B42DDE3012C4F4819 c4nw0
438,373,162 *2C6BB1A9D9748566BD6A68B5D31527AFB018A6E7 DF$EL
438,373,163 *2C66BE56D7C8D0EBC835C70835FBB8C64EFC4C0E DIANAETHERIDGE
438,373,164 *2C67323B0197E4986AB0B01034EF8E537A0D66E7 CAPRECEEU1
438,373,165 *2C668C369E58D97A102D5E749F14BBAA0E8C2F97 carltonhickle
438,373,166 *2C6E7F54D4E1B175B404DD8E390259311825EC40 CARRIE2718
438,373,167 *2C6DAB7EC1D2EE36E72A129A0DA4610C124BE5EE CAUSALITY22
438,373,168 *2C6E38F2F96E333B7AB17B915E9FEF6E4351BB05 ccbfb
438,373,169 *2C6FE592C4A6BD6C82286EE91A7C57BC7E050E32 dnll
438,373,170 *2C65D3EF3DB437697C528F45C5CDCEC0959A855B ce3h
438,373,171 *2C623CC59F822E0D122F8791B96DC5C7299048DD DONALD-RUBINSTEIN-GEORGE-A-ROMEROS-MARTIN
438,373,172 *2C6D9A2AB3A032688F7E5B956DCB0C3FEA2CD5F6 [email protected]
438,373,173 *2C68705375D59370D1D4DA78C9254928DE34F458 [email protected]
438,373,174 *2C6A04BAD4BC580C0E0E7516F6F455C06016CC8C [email protected]
438,373,175 *2C6460BD5FF970621F12E1A7BC3EE2C628AAD82F DON'T YA LEAVE ME HERE
438,373,176 *2C62AF524495F6A158E67E9E0ED6B15125498E71 DORSEY.CHANEY
438,373,177 *2C652BB19C921BD8272060D9AEBE5B51C990F9A9 cfb4o
438,373,178 *2C61DB9B9E701991E83AB66794FCC8C0FE9B6F82 dougpennelle
438,373,179 *2C64D441940A94437FAA00DDEE96E67FE5CD0DB8 DOUMAS2
438,373,180 *2C6465C39CB5D0450A09CD3DCB7E3D580046981A dqmuk
438,373,181 *2C651B9D47682CDB485908912FFC3A7622A4A02B [email protected]
438,373,182 *2C6E7781A4807230AA1FF799CE2BB18027E241F7 dsk#/
438,373,183 *2C6466924404938410B09D51E702A11C57544DEC dtz8:
438,373,184 *2C6704852FBF4999E78F4C61F509FAAED089E62F CHRISMOEHRLE
438,373,185 *2C6408D9699629B482B14B22ADC91ADAB5FA8966 CHRISTOPHER NIED
438,373,186 *2C6775A227033A90A9B076AE46D22133A531DD6F duh=r
438,373,187 *2C69DB2015A16F8C8D02766C1F7BE2024046F5C3 chy9j
438,373,188 *2C60E22FBE41D990285B86965776147D04242421 CI1N6
438,373,189 *2C69A6639861AEC02E760E7B06C995BEAFAFC09B +DVAAA
438,373,190 *2C646202EA31EB2734AA5571EE15A3280FF217BC ckadv
438,373,191 *2C6312927AB6916CE3A94002DCED583CFD8AB302 ec1.:
438,373,192 *2C62BCD389B654637C644DC329B0BE7847678C51 CLEVELAND.ANSLINGER
438,373,193 *2C61065A539A5FD5F7B3AD7438BC0F7BE3B15859 CLINT.GASSEL
438,373,194 *2C672DBEAE1189D18E11BA46AFC1A6DE35F3D330 CLIRCN
438,373,195 *2C6AE0C8147DEC53DC3986E53757042B8292BD06 edgaralig
438,373,196 *2C6FD9B327A80C1566D717E746A32D2DFF081A2C EDGARDOGRAUBERGER
438,373,197 *2C61185D0DDBE68ADFA34BD59468C985FA3DCF83 EDGARDRIESBACH
438,373,198 *2C611A971CAC2EAC47834E18DBF512982B9A177C CLuB
438,373,199 *2C69FDA66FC5B4C2299A928DE4E0A71F6DAC5DD5 EDWINAB0
438,373,200 *2C6FAD42CCAFEEA32E946C8D002B85250368B86F cnzga
438,373,201 *2C616CF7CFC5307FB6F0B5B80961096634302115 einen.
438,373,202 *2C6739CE620B030C91FAC2AF531E14754EFD9845 EISTOIJ
438,373,203 *2C697D77F101087951B5CDBEEA2D6949D4659366 COMEDYA
438,373,204 *2C631814B4BD880455F20CBB850E1DFF0EA9034D EKATERINAROMANOVNADASHKOVA
438,373,205 *2C6C8F0A33E6C9B6545812695DB96151F11ED22B ekysd
438,373,206 *2C6CB72A8049DA19EAA7921939310FEFC2E5CE8B contrin
438,373,207 *2C6547DA1E8CC7C67A703C19168BFFC4E3E1F9EC elliotdresner
438,373,208 *2C60BE067AA7619318B1C392960B8C9808090F19 CORNELL.HORNBUCKLE
438,373,209 *2C6B031B69A79EE45B5086EF8ADB803FC430D3BF CORRADOSPUNKY
438,373,210 *2C6B9D2D49A4F17E766F1D4B10196AD17CD0A19B EMBD
438,373,211 *2C634440406D8BD020B0A21851A293E2E59B38E9 EMERY.JUSTICE
438,373,212 *2C67924E49E62B3EAEA3684C6690AD750F84BBE9 c?pe/
438,373,213 *2C6362D4797D99B90D0E6A20B55A84B5CC74E651 C:\Program.Files\Microsoft.Office\MEDIA\CAGCAT10\J0222015.WMF
438,373,214 *2C64333BEB63AF42EF96BA4929F1E845B2C39A37 EMORYBURGDORFER
438,373,215 *2C6B3E871E2E5544C7748806FB7863BCE4B844CF Cq0
438,373,216 *2C65EB52D5AAA37F29DF37124593E3CF46CC3FB5 crederà
438,373,217 *2C610F62243542545095F3F6612451125A087E5F EPPANYP
438,373,218 *2C6A3BDB462DBCEA624FC7A537290612800097E4 eqo4r
438,373,219 *2C65EAA2665F223B9F3F716455589DFF62F3A4EF [email protected]
438,373,220 *2C69E7F6A36F195C7B3D7D2A15B0B41449F16A6A curtisbenning
438,373,221 *2C649BE5AB2010A222B02B9ED07963A5A0D9E37A ESKEYTYIS
438,373,222 *2C6074DCBA4C15B48A2EFD2716D8AD1976D72122 eskhp
438,373,223 *2C69F3D0725FAF3F2F5A214030920A144FA1EA7E cwda
438,373,224 *2C6B37803A87F864AA9D760F9C3C96C58D594B6F CZDCN
438,373,225 *2C662799B8EE096E9C80CD8C2A95B4E9EB4F5922 d3l3g4ton$
438,373,226 *2C6C3E8E288EB54C1739F40B75175C77EA8C1CA9 d;9r
438,373,227 *2C666A5060AC0B1CEE5649F67CA0742753650D1D FATHERROOTS
438,373,228 *2C627F17E3A0E0FDFC5AF64C5914050B4643196A dangerfraught
438,373,229 *2C6E0687DF3F7F538822821360AB0F69D49812C1 danielbigboy
438,373,230 *2C6FF19260328042EC286EEE97B54B220158CBEF FEDERICO.BECKFIELD
438,373,231 *2C6C32695EE5C87469D5D6A24A85B06AF22E401D darkjack
438,373,232 *2C69211E2C1CABCE58619C9A23883CFD6B17D493 FELTON.MARCELYNAS
438,373,233 *2C650DBDED1CA26CC33D9AFE6FE0FB41A30ABD8F DARTE
438,373,234 *2C6FBF10037688EA3B9EE6EAA762DF3210D2D4C4 footballsamson
438,373,235 *2C61D5FCEFAE61F000CB41C8DF6D6182D0435B6F FOSTER.BUSA
438,373,236 *2C66E4EB296C2C0925537FC35330AADEE638F49C FRANKKUHAR
438,373,237 *2C6675EC6BD585ABEE726BFED33390B0B82BCDB7 FREEMANGUCCIARDI
438,373,238 *2C66930DF8644913148F95F2FDC5A595315238E6 [email protected]
438,373,239 *2C6D8A054F07BDC76C8ADDB1F06E8CB899F6F3A9 [email protected]
438,373,240 *2C68E9C2B47593B0FBBB79EB156BED384A20E47C FUTURETRUTHGAL
438,373,241 *2C65753562F240D016E53548ECB8FA668C1603C8 DC/B,
438,373,242 *2C6285A47537D183D59FD24F123FC3B1C5EED856 ddcq=
438,373,243 *2C611BECB2DFA69FFEFBABEA67AB8FFDB56C6FAB DEAFENED
438,373,244 *2C624C66033AE1E33FC48F97F6F956402EF3BE8B garyshayler
438,373,245 *2C6278204D9AE032440DA2280808C73F450C1360 GC16012764
438,373,246 *2C6F250066B7885AD43BF3A57D4A6DEFE2CE9A60 GCY-
438,373,247 *2C6CFBD24F04E086F88277D8330CD3E3AA533D54 GEHUIGEL8
438,373,248 *2C65677B3FC20851868359362FA1CB8B325A79E5 DENNISEDIE
438,373,249 *2C64103BAFF13AC72BD01783E08FA259580A1E51 D’ÉTRETAT
438,373,250 *2C6CEE5B93A1C5FD2E617C8E74B784AE03678BA1 DEVIN.ENOS
438,373,251 *2C63E7FC872B51223D8647DAE08E85029DBED5FC DEVONCLAGUE
438,373,252 *2C6367B15376BEE393494B62BD22231D157D9D31 [email protected]
438,373,253 *2C6D9EF84288B5399123381688CB158C6FF767F6 GH\G
438,373,254 *2C657EA70869633F5EDABBC8C107501F1CF2DF8B Di"
438,373,255 *2C6D891F1BD8F64ADB38EC580B5531B7E5F7810F D%I6
438,373,256 *2C6F6CCDDA8D689452628E12AFF23E947D155239 DICTAATSCHRIFTEN
438,373,257 *2C69A47D17EDC447E811D4656F75C6C1A37A43B0 DIIVINA
438,373,258 *2C671A71F5565AA11CBBDF0C74F6E819BAB3C58E di:l
438,373,259 *2C6B790B10077C5DD16B1EF775DBC23F93A8F11F d$ioe
438,373,260 *2C65815DFB49559B3DE7F49C30B17C63899BB9D2 DOMINIQUE.CORWELL
438,373,261 *2C66E5BE80EEB20A8F37946D6EB7FD74B06FBA40 GOCFFLPP69
438,373,262 *2C6B328837514D750EAF18C45D57A40E245D4277 GOLFS
438,373,263 *2C6767AC70746FDB00321555CB381A7EB507722A grandevouses
438,373,264 *2C66F8417198F9E6B5DD37530DD77CA06713DE24 ds.-.
438,373,265 *2C63F85B1F4E8C1ED51C14F487EF470334175B49 GRVTRNTED
438,373,266 *2C6F7E759249CAA043F022B1063650461FF53013 ducknotused
438,373,267 *2C640BFE2DA64D5DF3A161AAED6AED8A0CA3D786 Gz>
438,373,268 *2C662C65321584233103914D41460DA102AB3E37 HALLELUJAH(PART2)
438,373,269 *2C68E19D7791DDF73C3E1FA1C8982D4B52E59086 HARRISCOXON
438,373,270 *2C62F941FA234C198A3FDC125C16D5AC356FCAC6 harrywestgaard
438,373,271 *2C61796F881DBEF7FFC90DDB1C78FAAF0F09D942 HARVEYNAZARI
438,373,272 *2C6AA024C2FDFB05FAE56BF9CF57D1C76851DAB7 dzp,m
438,373,273 *2C68583C5DBCB6F77D5ABEB7860EF39F298EC622 echristied
438,373,274 *2C6C072B63EFAC52D269743FF72067CD6F65C148 HENTTUNI0
438,373,275 *2C6A156B2AE3F3133CDE7AAD611F427467A0F7F1 EDUARDO.WALKLING
438,373,276 *2C6AD8C63950093900E10605006966909B8AE59D EDWARDOOCKERMAN
438,373,277 *2C6497473CF093761C88EBB6DDA86E1DD986E464 edwinhooey
438,373,278 *2C6BF57D1FED4BE053B04215252A5230D765D177 HEWEHEWES
438,373,279 *2C684CEB40B387D75E935C35108629D785B71797 eiwa,
438,373,280 *2C6295EA027B7B37C19F9EA617336D5D02FBDD51 ELAYE
438,373,281 *2C62521BD609552ED75C2BA8283DD59D0E75DFEE ELMO.BOELE
438,373,282 *2C688088524D783DDFC588A8D38E5C0C6310D394 [email protected]
438,373,283 *2C653D6B0AC8EA2D67CE72B2490266ECFA7F3A85 [email protected]
438,373,284 *2C6A5C7063E05D5888752F7D73C8E116D3040AA8 ELPL
438,373,285 *2C6EBC18E37F188EEAF356F3ECC2CDC7DE4571C5 houstonholan
438,373,286 *2C6E96B5E67B94D8B56EF7E9FA26F7D077C100AE elzio
438,373,287 *2C653019D4537B3ECCBB2A37A654762FB4D79187 emnaziat5
438,373,288 *2C66D3BB128529F7A787F3BF3B0E6745F5C0A02A [email protected]
438,373,289 *2C6EE394037B1F4CB08EF9ACCF1918A0EF6C8A9A HUNG.CORON
438,373,290 *2C64C68915DC8793354D5C49F20E7A8B276786E4 enexehol5
438,373,291 *2C6ED0671FBABF1314AF83CFB1BF7156E33131B5 engerter6
438,373,292 *2C6CC303A537F0BB5774F92A090178D58D4904AF h=w4
438,373,293 *2C683FB93369C5D236DF0EBCCB5C7D9A9BDFDD94 I)^AAA
438,373,294 *2C654E479B627B0EA35BE729C4BC3C2ECE07E248 EREIZES3
438,373,295 *2C6EE4D3B23CEEB51F9152344372259E59CF4DF9 ERROL.RADOS
438,373,296 *2C67036D3212E3A3AC5FAD2AAC7B55CB4F1EB359 ieey
438,373,297 *2C63FDD8E2FAF88BD6FF13A0F54629E5B20A982D erwinfarler
438,373,298 *2C6CA3B2AAA7FB81F55B771D83E84FED3A740AF2 I FOUND A LOVE (FILTERED DUB) (FEAT DURATA)
438,373,299 *2C609769657C919D8FB5788773D61580B3105971 essaneta2
438,373,300 *2C601624965CCEFEBB5CE2A4C63253A1923DFFC2 ethanmichael
438,373,301 *2C6332369A8226985EC029A21E68F164A5646A72 ILKUIVAT6
438,373,302 *2C61DF7E57B9B68ACCB218E71F3D3CEBF6544072 indianapolisstart
438,373,303 *2C6863D5E94B39ECC40AB81A1845B046D046CFA2 INSECTENBETEN
438,373,304 *2C63AD195DCC5DEA5BB1AC64062BB09BB0EAE1FE IRYPLEIT4
438,373,305 *2C65789008F2895E363EEB87609886D38669E00F iscrpniju-1
438,373,306 *2C6C97BE361DFE9603DA6FCF02245E48B515CF73 fathalos6
438,373,307 *2C6AE731872814C6F41D5FFCE3AA320699EE0CF4 ItRemainsaMystery
438,373,308 *2C6B0F33D7B723C3BBAB11EB034711C7962287E1 JAMEL.HUNTRESS
438,373,309 *2C6C57B64F50E07851FABE92F527CE009E48275E JANEQSANS
438,373,310 *2C6F65F83E712AB3B131207FFAA40EA489B084A7 fluoroscopies
438,373,311 *2C690138828D99E06C84BE7F56748C7C1FC366E2 FOKKERPRODUCED
438,373,312 *2C6998F6F9C21B8DA87F22B0D33DD1573198CF3C FOUR-LEFT-FEET
438,373,313 *2C64B585E24A573F419818CDD3A17EA723AD98A7 fpl{
438,373,314 *2C694D4C95173C74DEBA1EED8BC485136CC7C23A JAZDECTVE
438,373,315 *2C668DD7F57F6C24C0C650711E9DB31CF32B5FB6 francisscotten
438,373,316 *2C60ABDBD5CA454A540BFD1C976EE66804478257 frankiewithington
438,373,317 *2C660870F0EE1AF9CDF0840A20AA8E2B8679126B JCARMALITANO
438,373,318 *2C65128FEF4EFA8F384C2153F48B5FB7F96B2EB5 [email protected]
438,373,319 *2C6961C2A1FC3762358EEE36B857B02EF12116BD FRANKMESSER
438,373,320 *2C69FC59B7B8857ADB98B7F329DE0418EDC68464 FREDDYMCLILLY
438,373,321 *2C6FDDE66EA9DA4A45F78BF6BEDDBECE6A125C57 JEREMY.OVERALL
438,373,322 *2C6A55673A0ADCD7BC87A71893EE1C887F9DFC64 fuhk
438,373,323 *2C620E13E904DA710E8C5454785643A555E6D09D [email protected]
438,373,324 *2C62C8F853DCCC6E9CC194CA859462993A9B0210 [email protected]
438,373,325 *2C68072FB5DBFA577EF1A68197594E6DA9408755 gargano‎
438,373,326 *2C6DD4F2D3B18DBBE1405125F014823B0D7619DF GAWIAAL0
438,373,327 *2C684E83400D8890BCF87B91C67594EB8093CAC0 genarokirgan
438,373,328 *2C607AB19B7C7C1DDA7359786490FB2A136E8584 GEONOSIANENGINEERED
438,373,329 *2C640B40E81C6D66B309ADCF2CCC89482D6D1693 GEREEDSCHAPSKAST
438,373,330 *2C653C6A0646CE38CCF7F8C4E61C1A17CD56C9C4 GERRY.STITELY
438,373,331 *2C66634203D88A1865167EC33A233865B1E3B11C g/g
438,373,332 *2C65F461B17E47CF6067F8BF24AF43D6FFD0B27A gkrystal5
438,373,333 *2C61D52C7B18ED41056231731916339885242D6C JODYGRIFFINS
438,373,334 *2C6BE8132DA648FD6540041C56E3567B1DB700FF joeldiley
438,373,335 *2C6DA4A6ADB69B56BC06CF9276EF2B87019AFDB4 JOHNCOUGHLAN17
438,373,336 *2C6A883A0984AA90DAC702A9AFE2CD76EDD9D5D3 JOSEFTRAYER
438,373,337 *2C672C3787FA80F238D70FDA536619F75A537B01 JOSEPHMERKSAMER
438,373,338 *2C6BEB213217EC9457148032FEDA19715F287E3D josette.taylor
438,373,339 *2C6EFB682E3988CC5694148D2B50C6EF5BDCF623 jq7\
438,373,340 *2C67F179B9B2DEBE5844C3751894F8F67D5A23F7 julianvesperman
438,373,341 *2C685E24A1CACAA79783CFF5CA129B966D4BE0B9 [email protected]
438,373,342 *2C68B0F1AC713C16D052B4C1880C72C81DC66F3C [email protected]
438,373,343 *2C6A8F04B6FE163CA40EE0099057F122B0EDA153 [email protected]
438,373,344 *2C6206D608E40DC20DBAAD4FCF05517D44A6C120 gothicbttf
438,373,345 *2C636AC9106EFD086DCCF4DC0CA05579FF7AC166 GRAPHICPASSWOR
438,373,346 *2C6312C3112FD1AE084214B1503C4324379A811C kdms
438,373,347 *2C69CA84F9632E3DFFF49455F02A23E3FDEB165F gtk-wimpsourceforgenet
438,373,348 *2C625E81F105A78FDD6195777E6F057CFC8B3CDF KELLYPATRICK
438,373,349 *2C6F4A39EC70224F06BB3D881F366B676A860BC7 KEMELEN
438,373,350 *2C64F9D8610DAEBFE4683D16856B973C63C62D23 kennyzuno
438,373,351 *2C630BAB5B9D502A90A1FAA75FF890E08630DC78 KENTON.CORDREY
438,373,352 *2C6D868848673FE655F54ED6EAE26E77E8D16020 GYDC
438,373,353 *2C67FE6365DBF74E121FDDC6591E18650353AF2A kerrykyer
438,373,354 *2C6001D6061F35BB853BAD43D2B24F2DD544DDED Gyrate.A
438,373,355 *2C63445745C1FD35240B66D463069BC985771107 kevenbohman
438,373,356 *2C623817A03D0E965F309FE41590B2857811CDE5 KEVIN.ALVORD
438,373,357 *2C62A53FE9EDE07F8DFD1267D62E782660955ADF H9(S
438,373,358 *2C62F8BBC3B44C75B8C4A2CEDD1079DA567BC3D4 halguida
438,373,359 *2C66FA32685F2C7C5974EC743F94BD89691A8005 Hallelujah-146
438,373,360 *2C6876CD88AA2FC2427C47B3E665C6A1C6C0E8BB HALOWB
438,373,361 *2C630C21CD9BF5B931E223DBADC68824088515BC [email protected]
438,373,362 *2C6ECFE0B4FD97A10B7DD55E33DFB944789A3C46 HANDPALMSED
438,373,363 *2C68E76A3DC8543FAD5A40C6DBEB9E569BE7888E HANSEDU
438,373,364 *2C64DE1A998BFBC9B7B2DA65D372E548235D2B29 HANTEERBS
438,373,365 *2C62379265FAA71E61D0C4938A6791B8677798BA [email protected]
438,373,366 *2C6A5F4D614B5DD928006F4009BE0606ABDD2873 kneedmachine
438,373,367 *2C6E41DDEC6FFC92E4F7597D8FFD3FAFB17E5868 HATALMASOK
438,373,368 *2C6C55A551ACAD2F77D3B6EBBC83CB296EBF54AA [email protected]
438,373,369 *2C6BC883EE076B51616875DDC70C9ED465844DC4 konstantinfeoktistov
438,373,370 *2C6160955B1D2A9A9D61BDECE1FD761A3A8653EB KOTYLNICA
438,373,371 *2C63F651A3104D18A45DC61CA069FFF5E6FCE44D KREUZFAHRERLAGER
438,373,372 *2C643C3CE02B77EF39AE03D4C5BE9FFC1F6B60E2 HERMAN.LAWRENTZ
438,373,373 *2C64368914B0D5C4E77A6460E3A832E326BCC8C8 herschelmcnolty
438,373,374 *2C657684AD03FF7E104E323FD9ECEFC65927C83E HEXACHRIDIUM
438,373,375 *2C6A0B18E7463B7A506C0F1219ECA12793FC85B5 h}fm
438,373,376 *2C60432F899C93470869F403DD7F1675BFF76B35 HIGHWAY 2 U
438,373,377 *2C664D127C81005B372BFE23DB15BD8DF430D98F HLKJHMY8
438,373,378 *2C67C14843F6052575ABFF576A2DA0D4B24BBA80 LACHLANHIAM
438,373,379 *2C65B40E5FE5D934205EA90C1AD9107506013A21 ladwaan
438,373,380 *2C6C1F63F41A88FD1D74C12341A8FAE29D55D4AB laka.mafia
438,373,381 *2C63D65972A9B5B52419D9DD84785707FDDA001E LALA1288
438,373,382 *2C672A7C5528FAE684B1A97FAEC6C3461AC78B08 la-me-eddie-logan
438,373,383 *2C657F037554FE909A647FFE9A6D2CE4A607AA94 lard.r3fi
438,373,384 *2C6011D1D84243EF1B2FC4870199254AA53B72EE lawerencedibattista
438,373,385 *2C6B9A93DDCA1E000308567821D0548E6300A71D lazarokautz
438,373,386 *2C6D2E696D6747D5512F4DEC3ECD8A5CE5782CB8 LAZARUSNUCLEAR
438,373,387 *2C6305F7FAF14C73C4300C3414B3367E5B9DE6B6 HTTPWWW.HGMD.CF.AC.U
438,373,388 *2C6DA000995B226ADC33BD296767139714CFF9A5 LCT-220
438,373,389 *2C60A6F4624A50A2BEF6FA781D149E2A4BA19BEC [email protected]
438,373,390 *2C6BBDB3699863AC4DA5FFAF54D371031083DFF7 leandroasencio
438,373,391 *2C67AF454696C131B36EAB46EE730DD7FAB1C7D4 hueyvelasquez
438,373,392 *2C609BAC4D98777B046F9172BFDA1A256ABCFC29 leglikes8
438,373,393 *2C602BED8400DFF39F4DDA104B033D1E1DD8F370 [email protected]
438,373,394 *2C68F7EF3FE61C0AD194FDDC59F87A5777615C07 [email protected]
438,373,395 *2C61AC8AA1CFEE11D6EC68D479AA2B800B681FAC lenwillaimson
438,373,396 *2C6F55BE411B7DE684A73793BE34578548EF3B04 HYMANSEAWARD
438,373,397 *2C6DC00220E684451BA6173B0BC8921C1877745F [email protected]
438,373,398 *2C6C8410D1157CC0743091B0CD038BEF79DE82D8 I5JMFZWYXY9
438,373,399 *2C6E6683BD65063ED660A62D3355F2B350895CB9 LEVERS
438,373,400 *2C69A0383872D30D663C9981E6CA2D3A5296EF2B [email protected]
438,373,401 *2C6198565F17834E77C1183855F8568A0FDA7DF2 [email protected]
438,373,402 *2C68116628250D1951851AC3C6535FC51800CBEE LIETUVA014
438,373,403 *2C63EFBCAF770460B18782F9497F3B4E6B478030 ICJUWAAI15
438,373,404 *2C6DD0B2FEA309B593C6F8F0EABC8F2E8842248E i.don\\'t.care
438,373,405 *2C6BCAD9D38E19B8336ADA42AF050161E22022F2 ifixqyhld
438,373,406 *2C6F147886E835DC3902800C530ED52FBABF3D90 [email protected]
438,373,407 *2C6786E163E1CB75A8F90495AA47A7FF0B4218BA LISTENING-TO-GHOSTS
438,373,408 *2C65E68370F4D8F3B3BFE4177A506B79824CCA4D ilovebishop30
438,373,409 *2C6CF124A7720B6C6FE7FD014CC0998699FCA366 LODASTIS7
438,373,410 *2C6F931D0CF2328C85362E63D6A3A502102206D4 LOKALREDAKTIONEN
438,373,411 *2C643658C6C779A89EE0567E734370F732B04D89 LOWER-STRESS
438,373,412 *2C67456CC70764BD9AB89E821782C83590E30396 lyf\
438,373,413 *2C633B60C75FFDE523BBC453201B6A3716E02DD4 IMPATER123
438,373,414 *2C68C0A71BE6C9D58374A9F68E538046593F0DA5 [email protected]
438,373,415 *2C604876D1F4DE34D003BEC0A5D2B4604FC261A2 IMPURIDADED
438,373,416 *2C6308F0CA745B6CD8FA33A68C052021EEEC778A MARCELINO.CHENG
438,373,417 *2C6024EC4D1CFE5D06DA720B537CD9CBED442FF0 marcelotippey
438,373,418 *2C69A21380F345A12F9EA412E6A3A2A7DD3077EB MARIA.CONCEPCION.DANCAUSA
438,373,419 *2C6DC9417D2A7DFE5099317B07BC0FF4999052CD INSTRUCTME
438,373,420 *2C6A6048DC3EBEA9F446098A5AB5D2A87BC387B9 irvingjenrette
438,373,421 *2C609CB1EE1BF862209DE36669F158A72F5B0A19 i\sn
438,373,422 *2C6CACB142C7C65FD70BC6E0E72AF5755320E9AE MARQUISSINGH
438,373,423 *2C69E92CB38AD128035E1D201601D96407C32C0A MARY5862
438,373,424 *2C636CF95B178D755FEB916A180FFA76A27E0063 Matrix
438,373,425 *2C668EC21F35CB86203084E7C4A676C43C2BA9A1 [email protected]
438,373,426 *2C64E597B85D36C2089ADE51CB59F00115FB970B mawahmed
438,373,427 *2C62A63417B18C18280A433D4D0209489D811E88 JACOB.BEATH
438,373,428 *2C64777A571BB3F125FF966426F630A76F6CEEC5 mc8tin
438,373,429 *2C6138063CB7130B3DBC03CB127DBB717DF55B94 JALENE-COLLINS
438,373,430 *2C60452D437FA2284C349608A195B6B2E18E04EA JAMESAINA
438,373,431 *2C6DD990A17726C571973131F82F92FCDD7C80DF melhuard
438,373,432 *2C674F2F7817C46BDD56DE87E401A4D76711ADC9 JANELOWERY
438,373,433 *2C6E04032A20952D6EA6509253F42B748C5BFA68 mendizerra
438,373,434 *2C6576E93E15288B0017F70711C0AF5902A7F383 MERLE.HEYER
438,373,435 *2C67E9C0E299C9E8111328AF29737EA9E72D1F9D JASE129
438,373,436 *2C6D135364EE613B2A4404DF55DB4BDC3399F535 JEFFRY.BRANDEIS
438,373,437 *2C65E7CC4011C75A9756B90BA5A59E9E5328B4CC JENKR0GS
438,373,438 *2C6B88E025E411794C4ABF92F9BE71E51B50C111 JENOYSU
438,373,439 *2C69E5F28FBAACD549C82152F2CFC17CA2A646A5 JERAMYCORSE
438,373,440 *2C69B5289DD660700977DCB48C34686832C58BB2 JERAMYWUTZKE
438,373,441 *2C6C17E769C9FE95D1B03B9883C936D4A0FC3949 JEREMIAH.BARTELS
438,373,442 *2C688C3AEA553BBAEEF35AC9F6A00579956E583E JERRY.MALYS
438,373,443 *2C695E78530C736A2043E6CDD2AC7D621CF4DBDC JESSIEHOAGLIN
438,373,444 *2C66C276B09BB39C8643F56EBE7EC059093B2670 [email protected]
438,373,445 *2C63CE0BB060ADD67FE7A3D9ED88CC88169BDD8F miriamhern
438,373,446 *2C62241C19224E78D6A53BEE89A9BDD7DFE8804C mmd-
438,373,447 *2C647B7C22BCE9C592F966CC829CC412D026CE5B mohamedwentworth
438,373,448 *2C6FD6DA27871E6A5F0F22B90FD242ABC706879B [email protected]
438,373,449 *2C616D97D7D15E0D8ED28131E6E17ADD66897E7A MOLO1974
438,373,450 *2C6C40A7A3A33A473F67F4C4C99F41F366FBAA50 moodirs0
438,373,451 *2C65FAD452A43936DBCAA0EAE7D1A4205376FADE MOSESPOPLAR
438,373,452 *2C62FED43BCAE26597724F297CF5EBDDFEBC9F83 JOHNATHAN.FAUST
438,373,453 *2C662F33AF6E18A86712E12833A5B93A4A11659E JOHNATHONHERDES
438,373,454 *2C607F68163A8E8866D257B2F8C2A51D21A9A76F MPRACOYO
438,373,455 *2C6D8C18D88D137B793E6503F50E147DA552FE9E [email protected]
438,373,456 *2C6284A7D0C271092FE9467086C9D0C064299A74 m-tune-in-for-dens-demise
438,373,457 *2C693189392EAD4252DAFD9F6E9ACB1BC4354D33 jonathanzaragosa
438,373,458 *2C6D4B6064E20728DE1A0F5AC9E1AA67ACDC9D97 julestrythall
438,373,459 *2C6DAFD235D19FFAB5CFC90054E337128C0E8749 ncklblm8
438,373,460 *2C6D7819FEFB9996B17426A4AE8034BC70BD8761 [email protected]
438,373,461 *2C6D3D0F58CF1E20CACA2722C9E8A4E34272DFC2 jůzovi
438,373,462 *2C62DA849FBE1A3F3C213AEF184175BEE021DC96 [email protected]
438,373,463 *2C645822C727F26D1B0AE0890C5D9839C7261D48 NESTOR.CHAMP
438,373,464 *2C676E38C35997CE39B8AFD1C6D0EDCEACCA34E1 KAMILUCHA123456
438,373,465 *2C6704DC7A21FEF21501C388657839C5B1DE3AE6 NEW HITS 1999
438,373,466 *2C6324801973C2F6810C20B92D81ADCD18C09A4F NG.KAI.YAN
438,373,467 *2C6CD0C16C08545FDCFB38A955232D5046BF2C15 ni6etalk.(heart.beat)
438,373,468 *2C614FC1EC039CFBA588512A25A79962A132EBA8 NICHOLAS.ZURICH
438,373,469 *2C6FBD232523F98A927F134A090DEFCEC16D09F2 NICKOLASCUMMINS
438,373,470 *2C6F26624123BDCBB5903B09CC6765276A972F4F KAPSAMAK3
438,373,471 *2C67942EE22804E13E376B7A7EC8DEECB0FFD74C KARL4EVER
438,373,472 *2C6B8A1FCC837A35046E88A32624DD86B266CE61 nitridise2
438,373,473 *2C6F85928BABDB682B08BA0DB56298D0EC3F6AF2 KCVKCVKCV
438,373,474 *2C61EAB9D8446C28B5C6C4E4EE2C42CB6D22881F [email protected]
438,373,475 *2C6CDFA5C001CBA3EE075298A0ECC1B934FB9AB6 kenethreichard
438,373,476 *2C606990E1A39161384DAB112D6D488A0B9815BA [email protected]
438,373,477 *2C6FF76EDB2E3D5311FFAE22ECC831C5342374C1 nomrahem
438,373,478 *2C62656BE633529709BA6A3CEBCCECCB1FAC8132 no-ordinary-morning-(radio-edit)
438,373,479 *2C68571FEDBF806484F12857ABE16B75965D83E3 KEPOMMIED
438,373,480 *2C6A5162B5723CC096B6558226D07A365D7DAF0D killmerocket
438,373,481 *2C606C05201051F546680A3F499CED2B67DBB41B KL3PH+IC
438,373,482 *2C67A64227E8BFFFA63F153187BFA577522EA349 nychthemeron?
438,373,483 *2C6729A3C6D7EE43E02D446F4FFE25CBF4963868 KOMPENSIMET
438,373,484 *2C6369F844BB893ADEC6D81825756051C9238278 [email protected]
438,373,485 *2C6CD264BAB2BDF7FD9EBA340C352D5B92143986 KOTTINAA
438,373,486 *2C6EFD0FDC6527621D2AFA194008E45704A08464 OEGELING
438,373,487 *2C6D8D757FA026D20463113919ADF01C257B4E61 KSWJGBHI88
438,373,488 *2C62464870DAAE1054D4CD4BAA2DF8748C4709D4 OKLEINAED
438,373,489 *2C6E52AFC1ABB746F5860DD3D9CE98698D56B2B5 [email protected]
438,373,490 *2C69942634BF40677D8270E994EC0117268FB5C5 KYLE LAMICA
438,373,491 *2C6CB541B389DE9BA5C1AA4EEBC3AC9DCC89E9E7 oneirophrenic
438,373,492 *2C6CCD05CE3735CE169BA7C2A5701F76DED7F19F OPENASDAYFORMELTINGCHARITY:
438,373,493 *2C6F49BEE6C24D70268DD3F704B6D0D2BF81921D operationsbesteck
438,373,494 *2C61A4C20D7637C96018D3BF32F786C507BFFA7F LAPSZÁM
438,373,495 *2C631713E7D024905647452506BF9A6468DE9621 LAURENCE.SAKAI
438,373,496 *2C6D0622BAC074EE38418662BCBB84AC7C09AA7C lauriesymonds
438,373,497 *2C6A26B93892BBF5A57A326F49B10C8287F0DAD8 lawrencehouseknecht
438,373,498 *2C67B68A1FFB90A6840C72CFE1194DFD922B335A p=>`)0(
438,373,499 *2C68197B2A8186AB2C8DB1A7CF7E630AD7DCCDC0 [email protected]
438,373,500 *2C6C4B6D65690CE070CCA21ECBCC5E644D68AA9B [email protected]
438,373,501 *2C6BF53A8A1515ED30D0C63F5364F39FAB94BE46 panrhythm:flightno.11154
438,373,502 *2C65D90C9D30B25D88AA0C7CCEAFC4E9199B7464 PARFUMERIEZ0
438,373,503 *2C65EC8C3EEFE0E2F119BAC1BE1B030900D7466E LESLIEAMAR
438,373,504 *2C641675424B89CDEFF696FD2572044CD71FA514 LETSFUCK.
438,373,505 *2C6F1F47EF19E6DE6ACF09D81778C8E65F00E87F patriciamalloy
438,373,506 *2C6F093CB6B44F53EDD68012EBBD43BC2909D2DD [email protected]OM
438,373,507 *2C65FA98A6A62A69E30590FC8C9BCD11A00B726E [email protected]
438,373,508 *2C63B16C0D9005F621A2E428E4A104B7CD3914AD LIBOSZ”
438,373,509 *2C6C7BCAAD68FA87133CB792F43FBF93B69F4875 lifeinterpretation
438,373,510 *2C6C783D0C34033798731DB58D8C00A6F1F9C426 p=====d~0 ~osploit
438,373,511 *2C66861B73FD0BC666A9760C16A869E170C000BB PERCY.SWISTAK
438,373,512 *2C6A98E19554DBB3EB88BC01BC1EF03E5467DACD lipgloss672
438,373,513 *2C69C8C5F166B14AF6BDC758891BAF2E2C2FC8AA PHANTOMSEMAPHORE
438,373,514 *2C6C584412A886255F26A6AC3543B12A4C1EF9C0 PHITOON
438,373,515 *2C62ADDF62CA7363CC48EDE742DD84CDC4CDB455 pitsatavlene
438,373,516 *2C617D3BD7B78E65FD0F925ED9F23C660A2AFDA5 PL4YWR9H+S
438,373,517 *2C6F21D4405B9CCE1D24F4E3D336248F84778435 LOUISRAFUS
438,373,518 *2C60C8EA3F488C912AF05C3FFDBF390F857BF6F9 pmoandy1
438,373,519 *2C6717743E6D954C3A9F5A33C83CFDBFA2987E7B POSTERIORDAD
438,373,520 *2C691182500C229625F62CAD5CC0A8DCB1737151 p######p.`~.`~)0(
438,373,521 *2C6BA869ED22C90093225FF061021695378D58B3 PRELUDE TO THE AFTERNOON OF A FAUN (DEBUSSY)
438,373,522 *2C61CC049B7B39C5CC63DEA64ED0606292B0D4E6 PRINCE.INA
438,373,523 *2C6E2A38B18901E277FA274DD1474A8510674C04 PRINCE.NGHE
438,373,524 *2C6AFDDAB2551833B071E9AABBBB690CA228D915 PRINCESS KATE RAMOS
438,373,525 *2C69EC92CCF1EF41C11D15847C92D46FF9230B13 [email protected]
438,373,526 *2C6393D5C5B22A6559F20746BB4A957E2CC06A00 [email protected]
438,373,527 *2C6A929975F9F4612E6BB1BBD8F9EAACF8BBE519 pt\\\\
438,373,528 *2C603C29660F86C2AAF76AD39A3D0EDCF4AB49F2 LUCIUS.EDSON
438,373,529 *2C649F93CBB609095D9932592F399420223763D7 luciushoefer
438,373,530 *2C65C3F8144AD6AF2C306D70CEBB73494ADEEF98 (><)**<####Q
438,373,531 *2C659B41845AD9EAFBC577AAE09443318FC5B24A q#####D.*.*(><)
438,373,532 *2C6A8C2209910F17760C8B2AB7D523EFFE6AFC8D [email protected]
438,373,533 *2C69E5A1A9339CBB47E13246912C6C773AB9CFC3 [email protected]~O(X)
438,373,534 *2C69A8816FC35D967DE8C4E2B4670EB8276FE69D QUALIS-ARTIFEX-PEREO!
438,373,535 *2C6A629CC91275111A6E105C574CB4D7BE3C7D66 quannie82
438,373,536 *2C6E7B6E1AF2F9416C7DE25DFBA654A0A154C804 RAFAELELLDREGE
438,373,537 *2C6C91CC11E1B846E0260811C43FA38DD1E1D1C5 RAM3NT
438,373,538 *2C63DC1E07411F21DAF0EA5A51F28223B2EAAA23 MALCOMDAHLEY
438,373,539 *2C6EB5E6B6DBC36656391D8CAAA2CD7BF8F90EBB RANDOMMAJOR
438,373,540 *2C609846C13C657DB0236FC2F4C77D38890C3EF3 manualcoolbrith
438,373,541 *2C6F69119D704050F03176896420A53217378953 MANUEL.KUBERSKI
438,373,542 *2C602650C142F049BA3661C4E7C22FFD98D94F46 [email protected]
438,373,543 *2C672DD388B2ED5AACE28C533AB8B3F188DFEC80 MARCEL.CHRISTENBURY
438,373,544 *2C6C193F32D947111EC01B29053BEF5DE1556417 MARCELINO.MANNICK
438,373,545 *2C6665B3576BAF4C4B224A7DC57C6669AD427A5A MARCILLY-EN-BEAUCE
438,373,546 *2C6E17DFED15EB4BB5A306D990A5F36577429D30 raulquarrell
438,373,547 *2C68DA53DAA0B1C94B364FFE7181F840306464BC margaritobormann
438,373,548 *2C68324136544E60F722C4406501354553980DB2 maria.del.carmen.de.aragon.azlor
438,373,549 *2C66E4BAD78CE173AA07E3E67309259570C161B4 MARIANALE
438,373,550 *2C6FC796C0C8EF094DB6C1D5B0A71FF0808C299B REFERENDUMMMETS2
438,373,551 *2C62296E1BA00ADF70A6CA57FF7508386B6524D2 mary.jane.calzado
438,373,552 *2C63DF9567A62146B3E1DA35B47804B5F2430AF4 REGINALDIMHOLTE
438,373,553 *2C6BDF7B9DE4C2151B55C8DA2C7AD8632549FB3B MAURERN9
438,373,554 *2C6AC79857EEA6FBC64DF2B6461B4BD3F2DA6CE0 RENEWING
438,373,555 *2C65397AA2DFEEF1842E700EE563763B280F3C03 [email protected]
438,373,556 *2C6BCDA2638AD47B688E3865F0324AC2A996CE38 MERLIN.VILLEGAS
438,373,557 *2C6A2FEC2C000D736477DA350C0832C4F143B35C ROBERTFORTALEZA
438,373,558 *2C62555888273986E912241C02CE618E79AF9EE2 rob.loomis
438,373,559 *2C6F501CD9703C1D0AE805E3C03697DB3F85B523 ROBT.FREDIANI
438,373,560 *2C69BDC7BD73F7625815CE4A83FD865DA7A126AE rocheta0
438,373,561 *2C6547806FAA6C6DF6D620753E6D5D6CC59E7AD9 rodstockwin
438,373,562 *2C6B7AC084B37A22FE30E0CE09771D4FDCD66CC5 ROIDISSE1
438,373,563 *2C60F13DC5F4A0E169A9CAA6C4D80D9D5B7CECF5 RONCATI5
438,373,564 *2C6322F8C75B2126FE02FBFC9AAEFA941848D641 RONNY.BORDIN
438,373,565 *2C631C572F31E5F5D3629B436786500CA27BCFF5 MICKEY.FENTON
438,373,566 *2C6589EC99B65EF962B3F9B478528A8AC91144CB mickeystores
438,373,567 *2C67EC47E88F73877E777382AE14D824AADD9EA8 ROSARIOLANPHER
438,373,568 *2C6BD207B1BFBC13AC8C109E0D5AF6D48A510DE1 MIGUEL.KAMIMURA
438,373,569 *2C68C13F4E830B40E0DB2393501BA609595CCFF2 mikesidhom
438,373,570 *2C6E14C67650A2AD5B32C69C1DC06D8017F35ADE ROY.NORTHUP
438,373,571 *2C67FE986991440705459CE5ABB8B07E3B176F6A RUBINVANBECELAERE
438,373,572 *2C61F852328E270A8DD4C5E3BCAFB51415A44262 rufusbettin
438,373,573 *2C67A3CF29656A6A19BBFA93A91D6681A00A9F05 ruhigbilderl
438,373,574 *2C60294EB0787C231373FE0DEDE098085847DE74 milk cow blues no3
438,373,575 *2C64C517712E911C7DBA8CF3027FF269684E597A MINISTERIKONSEJIN
438,373,576 *2C672EED2CCD00911B6528EA32DAEC3334637738 MINNIE211
438,373,577 *2C6424C7B6CC356EF4B228CE0F6CE4B1F836C694 rvwsf
438,373,578 *2C6CB6B227C9C055E3C4E36F9310C1E674AD469F )%saaa
438,373,579 *2C6A96C08FC86B9ABE9269581593D7386388D2CB [email protected]
438,373,580 *2C64ECA2909F28ACA8C2A94A4072F6B05FC68014 mohamedweiner
438,373,581 *2C6FFBD68DC8429539C57CAA4E1A0C61A28082E0 salvadorflewellen
438,373,582 *2C6120A01854ED27495103996A26E2F93C40E833 SALVADOR.VELLUCCI
438,373,583 *2C65819F1FB3966A879437FF0D1A4ACE71119024 SALVATOREBRANDEWIE
438,373,584 *2C67E75FF46D620184620DDBC1AAB413837B9BFD MONHAH
438,373,585 *2C60882E9D228D5E0C3747AE298D42EF0579CC3C MOOSHUMMEL
438,373,586 *2C662F5AF81B33DF38565106ACE21BD6C3092A9A MÔRCËN
438,373,587 *2C68F65B509C9E25D4B508D2D0BC02B9AC804804 MORRIS.TURNMIRE
438,373,588 *2C69CCDA6F80AE534BE4DB9278B67B1BB80090F9 MOTHER.-24.186.220.4
438,373,589 *2C67E418C48F52B9A3C3AF4F55382A7271316D5C SAPPHIRECHICO8
438,373,590 *2C652FB1C75726EC5D2BF11D536505E94A41F32E [email protected]
438,373,591 *2C64620E44958EAEC389E67FC63795F401CCB86A [email protected]
438,373,592 *2C6277F533C87BD619F5961B7B6BCDB54023CD21 SATYASHEELAN
438,373,593 *2C648D324D6F86B777069B90DBEEBC4C98E87260 mtrrchlsm
438,373,594 *2C6AEE0F5C472460F1F5477864952337410D9EE9 «multiband
438,373,595 *2C6C59C7DF2470BE89638E37E90FD187265677BE N4RSI
438,373,596 *2C69B061A439B51D2EE4B36C09DA66F0D1F75235 NAGNOJE5
438,373,597 *2C6DA8A3D2F1532B77BABAA52AE966558548EA8E seemings4
438,373,598 *2C6D33A18BFEDB1D11F9B09C392029FA81469D6B SEJTENNIPS3
438,373,599 *2C60E416F28ECE80BE8846086AD702912A2F0291 SENIORMILLER1
438,373,600 *2C6ABC7F0815A77685F6B01B0C636811425856B8 nedreedrocca
438,373,601 *2C6C1048FB6A3D118306E4BEC602C46AB2642B17 NEUTRALSNO45(FORSOBBING)
438,373,602 *2C64897172FC9C2179F905C26B2F12060A4A9734 NFMINUTENMUTTI
438,373,603 *2C6D9956697EDE89E15F788AB73BB0EBF88FE8F6 ngua.do.P
438,373,604 *2C6B16663021A636F180618ABAC42A82364CCA31 NHLLPIV9
438,373,605 *2C60795505359F173457BA2679FD12174FF7E8C6 NICKRIVIERA
438,373,606 *2C6BD111CBDDFF10611067576E3D0B197765E8A9 nigelbenedetto
438,373,607 *2C69AFF5B5FCA4EB7D5264B7E695307543EA424D NIGGLE?
438,373,608 *2C681EAB5B32AFCB92D8AE6FE240B324DB93D939 seugoloud
438,373,609 *2C612538146B9B60832AF021544769AFE4158C15 SHALT
438,373,610 *2C6A15B5EDE797E4E9544D4C402B5ABEC686D48F SHE.BADE.GOOD.NIGHT.THAT.KEPT.MY.REST.AWAY;
438,373,611 *2C68D5186C89F65634C5FAEC1E45EC808C4068BC SHEET-WEB
438,373,612 *2C60637BB82CFBA1F466448774C0595497BBD534 SHELBYBARNES
438,373,613 *2C6FB5BACC77677799C13A4F47CA52A7A186F1D7 OCTAVIO831
438,373,614 *2C6B53B601E50093ACD5C383751A8922736B30A0 OG<V
438,373,615 *2C6F57C89615BFCB283E905E5F3A3715CEF1D733 SIKUNYINGI
438,373,616 *2C6EABF896C3830BCCCBBCC85EF1A79DD2EE2AE7 O MAL DOS OUTROS É CONSOLO DE PARVOS
438,373,617 *2C62CB621EF1219338EA887080160D1A9913924C ONDER-DE-HEMEL
438,373,618 *2C6E6D7DBA252E832ABE760266A42035B2B40611 ON".(SCHERASMIN,.DROLL,.H
438,373,619 *2C64C792CADFA2AC6C7A1F1F633FD6D8462F565A OPPO$171ON41
438,373,620 *2C6AFDE0E9B17332DBA97A07C60C846198172758 ORANGETANNER
438,373,621 *2C61E753A507C698E9FCE3D40671CF003ECBA451 Situaciji.11
438,373,622 *2C6D8369427483D5BD70EA540CB3E054D76446CC OYBERMAN5
438,373,623 *2C643D1CC390BCA2BE1727BED1EE851749DD1283 p47r!m0n!e$
438,373,624 *2C666B3869288C05D84AC4E00B2A449936957A5F SKJUTANDES5
438,373,625 *2C64F46A9D73A759B335015DE4CF9337D074972D SKOOCER5
438,373,626 *2C65EAF884727961ADC4836E22CE61586C831251 panzer-grenadier
438,373,627 *2C69909A8B1A2BAADAC99E23132D63E75EF5232C PARIS.STORKS
438,373,628 *2C6478F3DF50E86AF4C8EFD7B95920728210E576 SNAŽÍME
438,373,629 *2C6D1A6CC8EFA134FB418403D1F25F137FDD609C partiavisen
438,373,630 *2C637F4F712B0649B70E5BF98DF89AE83040F3AC SOBRARAS123
438,373,631 *2C671F6B0DC40F071B2DC65982337BBC1192F479 p===d~-`)x(
438,373,632 *2C629FFB5B47301C84E38BA981773BAFB2D869E9 spatalamancy
438,373,633 *2C6B640BB205B910C915065063D131E6F063452C Piosenka-dla-piosenki
438,373,634 *2C6D17B0307D41E7EC7360DFF2123B603BBD67F0 PIRATADEAGUADULCE
438,373,635 *2C67D32EA38BECE07EE842EA8A26D47104B1A06C sprrrgt-1-0
438,373,636 *2C69383A23F4149C0DD990C193ADA6006D77BD94 PLASTICMOUTH(G-BALL&KAAMIX)
438,373,637 *2C6775C34ADA27F30821B81119851A65D46C3283 SQUSHED0
438,373,638 *2C6F403FA735282F83D4C9922C083A924D7F2BE2 stanley.trasmonte
438,373,639 *2C6E3CA71F8408E19AD4FDABA637580BC3F25E4F STANTON.STTHOMAS
438,373,640 *2C6CD00D9E266CBC918513EE966F8104CE0095A9 STÄRCKUNG
438,373,641 *2C645BCEFF9B984CF6C85615CC42B2329D69C980 steelepopcorn
438,373,642 *2C6BBBE203A856F9F39E246EC4B55A9F9C319BE6 [email protected]
438,373,643 *2C6474F15E1B5919DCA2C200EF1AA61F094B8E9B prince1990
438,373,644 *2C62A8F9B11D039E0E84E1BE47182FF7827F6BBC pristupim
438,373,645 *2C6C8F89E93840284DA76FE582E93C688363FC8A PROMETHEJAGUAR
438,373,646 *2C676B3578B0BEEFA73D3DA58E5185219F1C2E47 PRYDDESTAU
438,373,647 *2C6E9C28764AADDE1B4325FF440E467C328A0203 STUART.TRY
438,373,648 *2C6416AFEB5251FB8A05672AE7ACEC4ACA90E9C5 PSYCHOPHARMACOLOGIST1
438,373,649 *2C62B2C2BBCD8A174F56E764471E09649BD173C8 [email protected]
438,373,650 *2C6C48C40DEB68A803D04DCCBAD118BCCF9D8E8E QTCLLBHTQ2
438,373,651 *2C6F8AC3B123DC3324F76CDF635AC5C823EC447B Quasi-g3m
438,373,652 *2C6C0F1AD046BBEE992643D5E255CB78949F3F4A QUINCY.ZICAFOOSE
438,373,653 *2C692CE2E172675139C274C54B8E57852FFB4629 q\vv
438,373,654 *2C6658F590B8338969670E183B91EF0C79AD5FC4 sucnidea
438,373,655 *2C6AC6B2C9A270C468B75B8121240326AB189569 susie.pickering
438,373,656 *2C6D85AC9CFA281B759069D5269D9CE02F3AB849 SUZANNEEAGLE3
438,373,657 *2C63115883E8C6B575DF7B6569C7B11CC10868BE RANNELL7
438,373,658 *2C6B114005339419948FB0376D259ADAEBAFC123 RAULLONERGAN
438,373,659 *2C6A677574E866E874B170EBF447B4B7D01BD4F4 SYDNEY.RYAN
438,373,660 *2C61CAE3A9D253827600B1C9AC0CE886F8E49395 RAYMOND.WERME
438,373,661 *2C639F62FCED322F9EC019A06C34600989E29090 |R?BAA
438,373,662 *2C6F8EDD166DE168DE25B0BF304A16C3867A36AE [email protected]
438,373,663 *2C6DB9FDB00EFBFCA0825816CF294A16BB037AA9 Sנביסמואל03
438,373,664 *2C687A489886B02A99F103E6C17A21C2098E0B69 talk8470240141
438,373,665 *2C6E27282E2F995FE1C27B070C30E6E08B3C7F69 talo.estupin
438,373,666 *2C6CA566FB4205784D02593C78172E66173426FE RECHENS0
438,373,667 *2C669EA6D5C1A45A3BDA183E115B4FC9693EE361 tannercrites
438,373,668 *2C6B89D05C51A521C2C4BB5CFED1560C0DB60D34 ReeyazMusicPvtLtd
438,373,669 *2C619BC0EEE8E683824679183E46B0483AE4E048 REGGIECORNN
438,373,670 *2C611CF33386DFD1AD67CBDB6FA1B23893F08A5C TCHERONS4
438,373,671 *2C67D9825FD432A9C06948813E89A74999B0EC20 REHEDDE9
438,373,672 *2C68C4067DA11494B9272F1CE71A81410B3231A2 tearing-down-the-system!
438,373,673 *2C64BC6747E3F4F870C55419C0350A16D871A577 renoitkif
438,373,674 *2C6C63D97C4DBCB844F87ADE9B7152C05DA58BA2 tenge-gerb-reversejpg
438,373,675 *2C695F1836531FD009941977589682387599E3FB replanter4
438,373,676 *2C657A82C2B89406528AE7B7891C9CFF1CEBEE20 TEODOROPALEY
438,373,677 *2C68A575F4CB0E50061190B632887EBC4E29CD3C terrypaletta
438,373,678 *2C660894C00993FA7227C167D4BD2BECFF2F23FA THAD.GRACEY
438,373,679 *2C650ADF44A9ADD01819106FD50C88C385C7AA04 thatbeautiful1997
438,373,680 *2C69904884D7B282B8345C0BA9CE0442701E0563 rickiebellinger
438,373,681 *2C612E7CF4019BB71CB213E69F4D2FFF5472449C RIGOBERTO.LINEBERGER
438,373,682 *2C611D218037A42BF33E346C646D8181FB4F9051 RJAVALLA7
438,373,683 *2C62130DC715E87690CC06FBCCCBC05353FEB84C robert.joseph.buendia
438,373,684 *2C69D5B0A281C2962BAB97160CAEF71848219A5B rockymilich
438,373,685 *2C635F718FE0A51DE8439661B8510DE3585094F6 THECORNELLS
438,373,686 *2C64F71F5B772990EBECE0666E31E7D52A331A7A RUBENJUREK
438,373,687 *2C6BCADD50BB19E322343642C54BF8425A374264 RUDOLF MED R
438,373,688 *2C6F4B8DBE8F35B292E7F4B566462B511FC94635 RUQELRXONC3
438,373,689 *2C688D6C9E5B6562EE78DD1F0FD64A5B634A39E1 russelkooken
438,373,690 *2C626963FF225D8A20959256394A1BC8F513D47D RVENSWEE6
438,373,691 *2C61638A091F3499D71D2928709B47E5F90BB1A4 RYBARUV3
438,373,692 *2C669E6D4DD2CBF53C5654CE6DCC77EED20B9519 TITKÁRSÁGNÁL
438,373,693 *2C65D4E5D4AE3F681AE47F0F9FE45837B173128F SAGKYNDIGERE1
438,373,694 *2C65F869D4820B4EC85F59E5F9257ACF09BC0C3B saimaly
438,373,695 *2C6320DF071D763F3ED55D8417DB4E76A4B8C5C4 SALVADORNELLIGAN
438,373,696 *2C68BF459DEB4E335BD153E44F5C5368EAD2DD85 SALVATOREMILTNER
438,373,697 *2C6F86D47C3FC923B76648DC84B7D0CF704112B3 TODEADENEDDEAFDEAF7
438,373,698 *2C61B6896AB9D286D3ECB403FE9EE331746B7E78 TODO EL MUNDO NECESITA UN BESO
438,373,699 *2C6A217BBEC2B65F3A2B23AF3A46B4ECE8C1E9D1 TOMODERUSBREVITATICORNIS
438,373,700 *2C67924AD9358AFD4AA9FFCE28983862D1B14C4A SANGSANDERS
438,373,701 *2C6CC305F73EF627896E11B8B5F8B9B01AF70C16 sanjeevchandel
438,373,702 *2C6A29B28BF0C1D7A8DE54D0650495A4FCC4B34A TRAVIS-FONNESBECK
438,373,703 *2C6E1AEDEB2CD2BFD8703B33DC0A1A69F178D8E7 TRAVISHODGINS
438,373,704 *2C67D7586F6305A56D827048BD7D4C299F122259 scoobynathan
438,373,705 *2C6AF5880D1E2131A38540AD0721693BF413A24E SCOTTLIPSTONE
438,373,706 *2C66DF6EE50707AE6058D79D94B5D9A14550B5ED Scream-3
438,373,707 *2C687820257A485EB813A2A016A63E48F5CD46DA SCYPHULU8
438,373,708 *2C6D42ED2558AD74466EB08D79F8BBC3D15767BD SEBASTIAN WIESE
438,373,709 *2C6EA6543C6E8C5B4EA22A1E9859B7DA334C2B6C TSLEZONNS
438,373,710 *2C6C0E756810FF4F804227CF0BE9916DCC8843E5 TTROISGROS
438,373,711 *2C6EA7741B7390A9D3F594B34656CF8FEF7C09E2 SEIRUOLF
438,373,712 *2C662A0377280C7375AD704F96497D37FF8DFD6D senfmann2
438,373,713 *2C6248F93387FDCA47511D0D54127978C852BB80 SERRANIAS.-.SAN.JUANITO
438,373,714 *2C64062E610A9CA80102E5D7FC14E25190CAB261 TVERSLAG6
438,373,715 *2C6A5AE038C8362B0FD4C4B5EB5562AA86D5EDD3 sessiarg8
438,373,716 *2C69E7E79FC9AECA2D0F1D950A6FFBE476830F37 UCS193748
438,373,717 *2C64F7B6D342BE8DABF655B44D6E53D5EA7DE202 UIKEF0
438,373,718 *2C6CC06DCC4FF63CA5E45E9483133F800D0A3AAB shannon-blancher
438,373,719 *2C6A706A71241657ACB0D108419E1DD667917BDF SHANNON.LENIHAN
438,373,720 *2C6381D81443386BB75F0A64E11171110B05DD91 UNCONFIDENTIAL?
438,373,721 *2C6B73BABD870A7134D8507773E443675DC2A95B UNDERLEAVES1
438,373,722 *2C6E6B65ED7063BB98504A639C18AF2436DBD766 UNDREDEL4
438,373,723 *2C6891288F88A831FEEEE42E7CBD16C9B794E9B4 UNF310NI0
438,373,724 *2C69E6EDDC120CB7257A31A87C9055750E4B2F1E UNIQUEUSERIDENTIFICATIONMAYBEACHIEVEDBYAVARIETY
438,373,725 *2C67BFF46D378AC85754E63A465C2D8E764D2A04 UTCCHURCH
438,373,726 *2C6C63570A02DE7F057EE14C0BFBE0D1748BBCC7 SHIELAFURIO
438,373,727 *2C6F9E56A84EA8353B5E3828E53B8F3F8A0F48B3 SID.GOZALEZ
438,373,728 *2C6F2555302EBAE0161708754DDAC8470003C438 VĀJA
438,373,729 *2C66CE6797933DC34EC5D64E6C6D8855DE103F9B VALADIZ
438,373,730 *2C67F79D4B2E1843224428D731A3249E32166CD2 SILLYCONSERVATIVES
438,373,731 *2C6BB4C0FC499B7EB49B99F20058BD4D0B59A176 Sim
438,373,732 *2C64DFA488CDF41F5D1437F54797F76AA90AAEF4 vanessa.hackney
438,373,733 *2C6F0A3D241E6B538C321090251EBCE088624C68 SINGLEGRING
438,373,734 *2C648B133E6D3DA62171FAD2839296B85036C91C sin-planes,-sin-esperanza,-sin-control
438,373,735 *2C6E7A3E64BE3C2999986CC78B14A72CA2170EFB SISTEMAVIS2
438,373,736 *2C6F57415423EA5CD889B86E562913690451F3FE SITUACIONISTI
438,373,737 *2C6F1B71A5B27D5599C47FF56495142D78179F76 SKABSGANGS8
438,373,738 *2C6E1A5CE4799BD885AF74BB79AB840B7FFB9504 skinnerwsueduwww
438,373,739 *2C64822002C2D9C7AEFC4B14F138CA0A06916243 VELINDA NELSON
438,373,740 *2C6F98CFECD5EFE68A68C01E8701942FA84E2056 VENDULA6
438,373,741 *2C68E28BE4160ED6DA2709F71869079C85F0AF4A VERGNES.ALAIN
438,373,742 *2C6C358BBF8C225A5DDBF5EC124353B783C493C0 SLOTSTYLE
438,373,743 *2C6B717FA834A77D734941C2DA8459FA7261ED7F SNEGNIKETSTNOSEILVTSROB
438,373,744 *2C68A6060D38A28FC3438885EFCF12AC0A6EBD0C vic-landreneau
438,373,745 *2C6813F1258188CE90C8D5C12431B3386F79C2F2 VICTORAYODEJIORITEDI
438,373,746 *2C6D6DC52B7AF98494C31864B7D6E40748924281 VIDAR ROBERG
438,373,747 *2C6BDB21E3FCE409994CD349EA58F2EFBA46AA91 VILY.NGUYEN
438,373,748 *2C6C6F889485DB10F7D0463D3EB8F11236265DF5 VINCENT DELGADO
438,373,749 *2C6052B493266F805E7246D48C2D716592D01754 VINCENTSAGUIN
438,373,750 *2C61A9C8C5D9AF604A0D3818ACF47B32F82F6E97 SOLOMONBELSHEIM
438,373,751 *2C6B5F8BA4109DEEAC0B60E2387A566BAF58B2FD VINICIUSPARIS
438,373,752 *2C60D2842C4D3DFB434423C953AB881BC449DEF3 sonatano.8incminor,op.13"pathetique":iii.rondo:allegro
438,373,753 *2C6591D14B2269B12310A33CE34F6A9C8526C358 [email protected]
438,373,754 *2C635DE6AD0307B1E94797B6A155A9FCE0124FC7 VISDASOROUSHIAN
438,373,755 *2C66516323CD9E2ED4EF819625D02F0CBDE3EE55 VITMVIUS
438,373,756 *2C6345C9B62D14F33EC08550ACCA72EE31E95375 VLATKO-MILCEV
438,373,757 *2C63975B6525EAEE229043D6145F7878502D27FC WALLACEHITZ
438,373,758 *2C6629DD5084B6635732F2B41BE95FCE9FF2E57A SORRY-SEEMS-TO-BE-THE-HARDEST-WORD-(FEAT.-ELTON-JOHN)
438,373,759 *2C6D78C4A60B0DA7B00B8C79B5A33A023E1BCEED waylonnyquist
438,373,760 *2C6755B6DA09FBA8FF581A6F8307228FAA86480E speenkfa
438,373,761 *2C6B701A30A272D60435BC3BD92E8CB71F6AFFD6 weidegeld1
438,373,762 *2C600462AD08CCDB728C1046BE4D9F17B7990687 WENDELL.KOK
438,373,763 *2C68D46759661DF4871807A58D3F513B87F1A8DD [email protected]
438,373,764 *2C65FB2D0CE1F002EBFACE907160E8FED9F3DDA5 WERTEINSTELLUNGEN
438,373,765 *2C680FFD71A9FEC9F2685831F7CE64FECDE47821 SSECCAEDISNI
438,373,766 *2C6010491B04702C93B6CE7A0D1A1F2BF13C3EF7 westontownsley
438,373,767 *2C6ADFEE99584A43DD6C6F476B6BB2573002E4D1 ssilbtf
438,373,768 *2C66577A81DA7127C50CB7D18C976E2007E3346C STANFORD.OSORNIO
438,373,769 *2C6BFE81FF31DEF91ABBF90F8F12ABF86D15762A WHLFMLY1
438,373,770 *2C64FB80369865B5BAB1C0D2A0671B42CABD0C8D widdersteins
438,373,771 *2C6684C5E4E4C56C6AB62140FA01D236A2BA0748 WILL.CARLOZZI
438,373,772 *2C6F0C5367E5D3C67ED8E62D172656B5F12E5232 WILLIAMS.WHISENHUNT
438,373,773 *2C65BA7FB589DFF06184AB4060F3765F5EA14639 WILLIAN.BERSAW
438,373,774 *2C6340E1A430E75A67274528907CDFED589625FB WINFORDSHOMIN
438,373,775 *2C6DBD5D0018FAF35C7094AAA1FBCDFA47EAA4AA STOVENNEVOTS5
438,373,776 *2C6D8014AA3EE0FACAE8D429D82C845AB5A4CE8B stpetersderby
438,373,777 *2C63FDB76CE4F3E113669A8689B8B865DCEE04A0 woodrolfecomwww
438,373,778 *2C68D8AA6E392B25A2D2381CD8205AFEF5AF3D2C [email protected]
438,373,779 *2C6C4CE863F6C9D371642035C1F24A98E74FCA12 SUPERILLUSTRATIONN8
438,373,780 *2C6E6030704407FB2817A89131CD7E7B720F60B3 WORTHY-OF-LOVE
438,373,781 *2C6261190FF85FEEA4A2748E1522F22BD4C681F8 wvyr
438,373,782 *2C6979CACD9EB1856BD895C5933DC198599ABC29 WWWPHARMACOSMOSCOM
438,373,783 *2C615B9D4370D65B6B88EF065122E01F12460AD3 SWEETYBEAUTIFU
438,373,784 *2C6F92C8B7846B91624FC274F3AA73E1DA44DFB2 }X{0~D----8
438,373,785 *2C69DA199ECA26F9FAFA35E69AD3BCFF53FEAB84 )x(**@8
438,373,786 *2C6DC4A84810CAB50439BFDB497DF19A0D20604F sylvia_bennett
438,373,787 *2C6933DD196768ED13E1C86BF1F6C3F1DE747B08 XCOUNTRYBOOGER6
438,373,788 *2C63D5C6D739A6B528A1EDA070B2800B0D10F22A SYN49O9U3S
438,373,789 *2C6D1F829B3B8DD8F0341E80E852FC8FACEC0796 /sys/kernel/slab/:at0000256/objects_partial
438,373,790 *2C69F070A0EC7FFDD629C3418B1C232E3ABF4F40 syzygy
438,373,791 *2C687CDD475B8C68C8485BEBD9454AF4C0AE5B79 T4RS0NEMI
438,373,792 *2C685A88F4E8DC6D109084C67EB1FADBF1F91FFA TALK8252923
438,373,793 *2C6B56C80F2D9DAEE694786D35511EDF73A1A6D0 talk871223194user
438,373,794 *2C6954683E3698BD90C2EB891B98814D99CC49AB [email protected]
438,373,795 *2C6E862C1A8DBAC3E84458E7A30EB954C5521EF7 XUGUJIN
438,373,796 *2C67CA01D23189076AA57FD64D0DB169B40C1936 "taranking,"twooftheforemost*journalists*nativeto
438,373,797 *2C6617C1E4FD85A35E235F6C4765FF8EC13616BE [email protected]
438,373,798 *2C67F6962664E36B18059B727D57501533C64A4E [email protected]
438,373,799 *2C6C3494B0518D2113E6CB5BA61ECA8BE8A9DDBC TDYNS4S
438,373,800 *2C66F9F27EE533AC51073C1F0B6E9B7A78CFB4A3 yesenia.acevedo.monge
438,373,801 *2C6F3AA2773151B2348E26F07498675FE98B584A TELECOMSBSW7
438,373,802 *2C637270744AA197A4345C39D5562E8CE375C69A Y&I9
438,373,803 *2C667F9F87AE86674ACEEB986C1E843F59E0EF63 yiu-wah-yu
438,373,804 *2C674D8A9A5606167D3D9A6C136DAA94AF847151 yllen93
438,373,805 *2C657C8933D97F1FAE8BE4C6E770C66742BB0140 YOU.CAN'T.GO.HOME.ALONE.(CHET.BAKER)
438,373,806 *2C6141013FCD4533A9C5B7583C4F4C89897D64A8 yousif.salah.addeen
438,373,807 *2C60B472916B8790E5971CF2C0FBDB62769E2275 yozana-puri
438,373,808 *2C699EE09FD75BF177ECD41FCBB61B732B335071 YRGEUZ
438,373,809 *2C6A0217CEAA7E85A7B0141ECB2A4A7CF6165080 THADDEUSFUENTS
438,373,810 *2C686C253C0E66D9F8F178CC3B712017087BFA98 yuc#
438,373,811 *2C65FF95540DBDA3C077CFC3663C19483DBE6CD1 YULIANTIII
438,373,812 *2C638BD89DBBE2A1296535023B6ADEA97D9386F5 there.she.goes.(alternate)
438,373,813 *2C6DE26CAC94D8917070561E21301441B27532A7 THESMEGMA00
438,373,814 *2C65505E9953B5E1F30635304EAC478C4A799AA3 [email protected]
438,373,815 *2C6484B7E6E2391AAF5772FFF8F1E5B07F83BCF5 [email protected]
438,373,816 *2C62F56FB4DD7331BF4F286E923A9F75A29FF793 ZOIKATI
438,373,817 *2C6E16F868216EA9506459D1F120B5EC15CF161D TIMESCSLOAT
438,373,818 *2C60E6A84182BBE51D62D9C965586C46A1C6BF85 ΚΑΝΕΝΌΣ»
438,373,819 *2C6898301DA52943A7D3523A053145B3007C037F tlh
438,373,820 *2C6A066483EBFC28F3D0703C522EE67AAF205B52 TOMASTHUNBERG
438,373,821 *2C64839BBC92F535CED98F43CE48D7F2E5438099 TOM.UNGARO
438,373,822 *2C62487667C53004BC5B1ECB6A95CC62FDE35592 ИФИЛЛА
438,373,823 *2C69A905CC62374436024797A3FC45F617925C52 TORÇARÀS
438,373,824 *2C66963BDC756CCD6321BE8D83C0181FC8E93F6A “канатицата”
438,373,825 *2C69452897D36BBCCA96FF0588DF13A0A734635A лісову
438,373,826 *2C632467690EA5BD62B072AE3DF2520393177BD4 TRACY MYNAME
438,373,827 *2C62D678262942B8D7837F30FB09412AAD547D62 tracyviguerie
438,373,828 *2C6CD1FA8C9B9EF4629E753A67766E77012AFAA0 МЕЛКОСОФТОВСКИЕ
438,373,829 *2C6D83D02B84671D8220E9CFC415BEAADD110D87 TRANSEUROPAFERRIES
438,373,830 *2C6E733358D72258BE3B47FB42B1187EB48B9542 treponemiasis2
438,373,831 *2C6BC24A202A0CF0796FA12099F97D74331B8C4A TREYFREDEEN
438,373,832 *2C6399A0089FF6B9493E9D16D3366859224621E9 tricia.dalziel.best
438,373,833 *2C68BDE3EB9A4E3EF934262901D5F1A50DFF86AC УКРУПНИЛСЯ
438,373,834 *2C64A72B7F2B92383406B4CF5EED65F76886296D TRINIDADVILLENA
438,373,835 *2C648ED3886DD725D35A8EBCC9660940E887EB6A triplicado
438,373,836 *2C61A953815B29D87A8E32B8B578C54C81F3E64A trumpetcricket
438,373,837 *2C669057C53997991B30ADC7F8C243F8B9C958EA 以來,首位連續在這三種不同場地的ATP巡迴賽單打賽事中奪冠的球員。
438,373,838 *2C698D205A939D57E888EE234B609BE513445A9B tyler.henry.smith
438,373,839 *2C6F68A3A9E80F4F75F8009484A2B0A48FB5B032 TYLER.MCDOWDEN
438,373,840 *2C60FD4326E9645E1891A639821C7BB824AD9C08 TYRONEABAD
438,373,841 *2C6A5D786045CFDF0D87644DE36C4CA58F45F7AD u0F
438,373,842 *2C6EEB4D4086352E9748DAF921B50EFA8EBDD753 UEDRENNIS
438,373,843 *2C6150FEDB45CFC4B51838CD5C4F3CDBC2431455 UG^8
438,373,844 *2C650BDA90003B775978EA7E6F14F00BA39AB381 UGOCHUKWUOZULUONYEKINGSLEY
438,373,845 *2C6369332BA0B5D10FC06BCB4DAD39E5F916FD3E UITTREKSELTJED
438,373,846 *2C67341C4823F49092F59F4453520BF7DFF56C8C U`J_
438,373,847 *2C6B347F8DB468A2F623407C4A3AC3FCE0323B6B uncircuitousness
438,373,848 *2C67A04260E708271B4E7BF177E7122E639D458B UNIMAGINATIVE1234
438,373,849 *2C60043D94CAA3ADF49FC061DB69F006ECA3E3DD unmaliciously4
438,373,850 *2C6966A4CCEA69BA01BF3C2ABC40FE50ADBC0703 urv=
438,373,851 *2C64D0F40A9579EE69B8061DCC843DACDBFAB75A uu>o
438,373,852 *2C6BC35D932E4D054445F765934C08465A9F2569 [email protected]
438,373,853 *2C6FE185AB6065522D880CD159596AA9EE8BF6A1 VABAJOOKSUMEHHANISMI
438,373,854 *2C6C19C88EC6EB65A7A01582FDF5468B8F7A7401 VALBUENA-MONALIN
438,373,855 *2C6720E25D1A45250E0C0B74F83E60ED587341EB VALENTINEFLOTA
438,373,856 *2C6B20DF894DE4704B9A477B6312FF25E4127567 (_0)[email protected]
438,373,857 *2C6467E088ED8A5D794EEF9F34210DA307116AE9 VARCO-LUCENTE
438,373,858 *2C685AF2352AF18F3AF10F7A09FD264FD7C51C49 0YST3R.CA
438,373,859 *2C6C2ED20C88A598582DB79BF6F035FF9F431866 100991ll
438,373,860 *2C681F08E18A3E2195FE71458FA61AF745A4D663 1043469 mikael.itse.on.kotoisin.suuresta.perheest
438,373,861 *2C641F32D7E4441FE3F0824DB6FB3946FE2F7E98 12:.12..-#..-&...lurch
438,373,862 *2C6E5DEEC5D3F7B7CDC5EBF9403A863CAB2F4C62 VERBOSENESS
438,373,863 *2C6F8F2F9B84EB73EDD97DE35458B97390325C74 134serena
438,373,864 *2C66A7674A27755418F3DBD89CA29B21A6807FC3 versandgescha
438,373,865 *2C6757F899712AEF52BD4796C0E1749A7E7477F3 1527219 ABER-PREUSSISCH-HANDWERK-IST-AM-ENDE-.
438,373,866 *2C6302A7E70ADE8C29908696E0A6B0A7A2701081 15791CRAN
438,373,867 *2C6498CFE4DF20DB8A8C8DBEF23FD507CF87C24F VIANDEMERGEMESCALMESCAL3
438,373,868 *2C6D258A399ED641C06C53E6FB7951AF1BF16B83 1717728 ajankohtaisia k
438,373,869 *2C682FA80FD1C39B78982AD20F7ED4DB47256BB8 1833403 DIE.WELT.:.KEIN.GEDANKE.AN.KUENFTIGES.?
438,373,870 *2C6F1CFEF1CAD41EEF14A2668468C2816B3DD3EC VIKKIREADINGWIDDETT
438,373,871 *2C6018EDF50AC0ACA936B1A0705C51FD6B82066D virgilabild
438,373,872 *2C66547F5D906C149B3A8C8AF2AD9B426CD2635B VISHNU-SAM
438,373,873 *2C6EDE58684AB01D1BC3373C64D5F9F7F6A8C291 VISTOSIDADS
438,373,874 *2C6FBA9329C06F0FD1EBBA1AB840B0D9414383D4 VOROSLACI
438,373,875 *2C65BD9642AE9AC1BD3A01ACC96DE1F84C265C5F VUKAISEN7
438,373,876 *2C67B37AA1CF8D3BE4F8A0FC22091DB80C4CF65F [email protected]
438,373,877 *2C60CE2149C77591E75EC8461A7BA4F17638779D VYSOKOHORSKOU
438,373,878 *2C6AC6D7799F95C9112ED805ACF5258E038D95B9 [email protected]
438,373,879 *2C6E722D05EF442957B2802359759910C7B2266D W65EIFDPRT
438,373,880 *2C6E392EB1DE1BED1D9865054B513CA1996611FD Waltz-in-B-minor,-Op.-39-No.-11
438,373,881 *2C6A5EAA37C68B346EB25FD454B6929C7F06D165 WANASIMA
438,373,882 *2C66685381490C830130998AD8AFB70BBEA0CB2F 1avelanche2
438,373,883 *2C6155E06AABA8BB2E424370DB512DA0DEC86C95 1 BOTOXERS
438,373,884 *2C64459AC96084C225D2EC49350ACCD06B9C9EFA 1-CeLeSTiNa
438,373,885 *2C604CCCB72E1A8DE2436AA4C79AA75B2F38AFC4 WAVEFORM.PSYCH
438,373,886 *2C6C84B8BF7294D414D528E0FE880BF93C349CEA 1 DRAMATISCH-THEATRALISCHEN
438,373,887 *2C61DD4650737C694496BD593B63C0E525B24AD2 waynette.pureromance
438,373,888 *2C6BC298985EAE786660E30F27C6CC8EF80F41CF 1 GASTKOMMENTARE
438,373,889 *2C6F63E3ABD0FB75E1B4CBB4F04918CCB12B7D16 weitzman
438,373,890 *2C64087705017BBB0020F8CFC0EEE22245B15577 wendellcarroway
438,373,891 *2C6867381D4BB1D8B070012BC9693C10A68D70ED 1iloveclassroom7
438,373,892 *2C67403C23015F3133639AB2326E13D129D198FE [email protected]
438,373,893 *2C65AFF0E32AA8F43A3523073733E44C6AC34195 1NANOMETER
438,373,894 *2C67E11CD99330B08A2215E59125D6EC203C777F 1omaakielt
438,373,895 *2C6F04BF51AEF0B2E7E9319BF1718E22FC111AC6 1.OST-RENTENPOLITIK
438,373,896 *2C616A64FFEC7AFC2527F940514700469FF32D5A 1.PENANSTAMMES
438,373,897 *2C6FFEFAB6778BB5788FE43A5BB5182C06E77CA1 1.pumppaajak
438,373,898 *2C6FBE8404DB73832E8D256605D2922E4BB9916C [email protected]
438,373,899 *2C6A2DD3F429681140D20608F8390F049B99E001 w-H
438,373,900 *2C630A2BBDEB76FE8E6ACCC65871D143C861A9B2 WHITNEY.SUSANA
438,373,901 *2C6D13CBF8DAB81441240801F591E244ACB632A0 WHITTNI-ERVIN
438,373,902 *2C64333EE1EE8AA6D690239F3C81FACA4557A2DD who gets the love
438,373,903 *2C6096B82CFAE6CCAE60C4F1C42046C1C8DABA72 1STAGE-BANDS
438,373,904 *2C610A5ED7D5B6CF2C75EB6C9A8B1A5E45C83B33 1 UN-WELTERNAEHRUNGS-PROGRAMM
438,373,905 *2C6825443EFFDE944E067BD112BB285C5788716C 1varuss
438,373,906 *2C661B2136242B3A9CE81A5FC6C68F1AC3850CFF 1-yazilisidir
438,373,907 *2C6EEC3682FABF266D7D255AEE1DD9059CD43776 2015333 siin
438,373,908 *2C6B6D90EDB67EB70481CD033FB4611F3267D5A3 20deal
438,373,909 *2C6CD01B27E14BB38A2DD20942E539F76D3F5BFD 2357130 ESIPOLVIRAPORTTI VOIDAAN MY
438,373,910 *2C6E4C0CC8E47CAAA7ED0047DD4F041342BB2241 25021802
438,373,911 *2C64E8E973B719A9FE0694F5A9CEF1585D2D8342 2800248 revenue-rose-16%-to-$27.5-million-for-the-period-.
438,373,912 *2C6C5669C85F7994B3609A7F33A0B870B445B665 28MAR1369
438,373,913 *2C6C1C6F2755BBA5FA638D7BAAE04EB7661F34DE winfordratcliff
438,373,914 *2C65C497148FCBAF832EA786D5707297343E1D74 WINFREDRHOAD
438,373,915 *2C6A15495131F36D47CC6C40BA9799DAFED319A2 2CKLYBORN
438,373,916 *2C696A572F1EF984CB6344D111B64FA4DCFDCFB9 WINSTONSTREETMAN
438,373,917 *2C6D3076A8683178AB710183337756B66034D2A0 2-CONSUMER-RELATIONS
438,373,918 *2C662141D9ACD0BF1BC49F8B8D38CBA3DDD7DD8F WISEOL'SOULS
438,373,919 *2C60C79CCB2DBDC0AE78CAB58FFFF18F09E2CDA8 [email protected]
438,373,920 *2C63DF6E267F2F385538946C4945E96FB0C975B2 2.iddialarImIz
438,373,921 *2C6D51A0E69D7B22A39895EBCEB3305974BE5025 2KARE
438,373,922 *2C667A078B9E619FCBE15A417F23F9CD9E5BE601 2M3QS
438,373,923 *2C64346B548261652F2346BFCB9AFDDAA92EB448 W,.V
438,373,924 *2C67B444E58907E7D2B3F232A4BF4983FA416FEE wwwanglepoisecouk
438,373,925 *2C6AB9A4A1BB7887ACAA66B1C12904FE58F926BA WWW.CAPITALFIDUCIARYADVISORS.COM
438,373,926 *2C614D6D20478E0BD3C0329D0A7DA869F3067213 2PROSCIUTTI
438,373,927 *2C6319574B1C01D2BEB9A68FEBF7A2054DCB9463 2SOFTWARE-FALLE
438,373,928 *2C69449DF82008285BD6F157C421B8EDEF6DF27F 2THATFLIPPER5
438,373,929 *2C603B7AF39A9DD2B8D20357A8BF216F8142CC9A 325262 PERILER-ARES'I-TEDAVI-ICIN-TANRILARIN-DAGINA-GOTURDULER-
438,373,930 *2C6348ADF89DB86730006AB7846CDFCAC9FA7938 3AFIMMVORDUHALS
438,373,931 *2C62DAF807B7E275C87FA1F901905EC8F3DD826F 3#####B*.*.*.(0-0)
438,373,932 *2C6406166F83215CB5CE9C6A1302AC2669D39D80 [email protected]
438,373,933 *2C6117E4D7D60E50904E55F5AF6F1A5A98020582 XAMRAKULOV-AZIM
438,373,934 *2C6ED44DE9FAF953DB7516151DD7324E8198BD8D 3KYMNAASIN
438,373,935 *2C67C642714829DF49D6EA84A447ABFE2351039A 3LAMBLIA
438,373,936 *2C6C36D981CD8A1F09CEAEA1BE0E1A426B167851 3VSKAIMS
438,373,937 *2C625AFAF6E0729C0E46A4BA4F5BAC58E7042FEE 3XCU1PA7!0NS
438,373,938 *2C633558A1C40DC07C8FF5944BF277ED61BE13E6 429508 nykyisell
438,373,939 *2C6F341CAB8B42E12ED5C68F80D0F7BF5A18D0B9 431ELLEN
438,373,940 *2C6E1D21B88C8765D40CF339FB3038EAB306D2B7 439496 HAPATTAMISESSA-K
438,373,941 *2C650452787075E438D9B096EC396145BAE2D55B 4396-GUIDELINES
438,373,942 *2C6F148063F37CB221E25AE45E172E1E08B6DFF5 473865 aslinda-istanbul'dan-sapanca'ya-gitmek-hic-de-zor-degil-
438,373,943 *2C62032288EDB018311A1657FE76E5B1619DDC5E 4britney
438,373,944 *2C6921A838145747D14C2837A7E387D3DFD6654B 4MERGELAARDES
438,373,945 *2C68BF61B46E0873C0FC19153EFC05CD2589408E 4NICARAOSHEILA
438,373,946 *2C6ECA00B7CC755C2336A819D9F9A1D4C699D878 4PETTYMYKSEKSENI
438,373,947 *2C603C0A5AD66636D96062CEEF020350D19D7B32 4 RADIO-KWKU
438,373,948 *2C67F602F58CF50B55D4DF8EF6866B1CC4FF50C4 4SETTERGRASS
438,373,949 *2C6B612689F20215870369F5236A9B06EF8AC5DB {x}.~.~.~(--b
438,373,950 *2C6A33E8E4B270ED5E7B4038A0C62EBE7936FDAC [email protected]
438,373,951 *2C686718DD6CC8B388C3E3FFAD272898CA636219 4UNWILLINGCAST
438,373,952 *2C682F8E7705BC868EE5E0C599427CE97D918E0F [email protected]
438,373,953 *2C6CC37D9B98A7FB48EDFBB6C9FA529F7D50C956 XUNKAI ANG
438,373,954 *2C67DB668F09AB55CFB769803BE02F498BCA2857 XX,A-MOLL
438,373,955 *2C6A5203502528B45107128D56085A9445206726 59CAPISTRANO'S
438,373,956 *2C6B5DD212A15797DAC0B90F41A4C24E47AB9E8F 5ALGERIERNA
438,373,957 *2C6988A679B4AF18C342D8600140804D7962E1FA 5amiah
438,373,958 *2C6C2C072C8EC713E37C3B965A8F5B076A2C83EE YHDEKSNVUOTIAS1
438,373,959 *2C66A9F5A89F4C9100FE24F67D5C41E630524CC3 YINAGUILAR
438,373,960 *2C60991DCD1132015B78F83BC69D6B48EC6CA647 5EROTIN4
438,373,961 *2C67619D2F7075BC83C8952077480351A8270BC2 [email protected]
438,373,962 *2C6D8CFEE9EF853AED39191947E9D691BCF7E8A6 [email protected]
438,373,963 *2C672915CE851C7F7EB3693E3F6DEFB14F4EA9FA Z102478
438,373,964 *2C651C22F6AF79BD572F598BE202E79FE85BB6C2 Z=7T
438,373,965 *2C6B9CEA735A3EA63A71A1B9A305A81BCEDA6144 zackhony
438,373,966 *2C69905C6BFA6958E60DFD0E2BAC1CC3E441D00A zelal-su
438,373,967 *2C67DAA8798B0177890E9DB3E035EAD26D30AE90 ZELEKE.GEBRE
438,373,968 *2C659039CB390F481EDEEFADC7411CEC263B5588 [email protected]
438,373,969 *2C60BCA09212F29419119F643AD4FCA30DA08576 ZGOLONO
438,373,970 *2C6A0DBD1A954CEE6BAAF0F85597AE4CB1F18934 ZHARMEDZYREN
438,373,971 *2C6122AEB909A35590FBB3D5546895BCFF6EA2F5 5PHISHBRUCE
438,373,972 *2C65A4E0C6EE65C43686756946057E215C9C6770 [email protected]
438,373,973 *2C6CA49D3386FC69884D481594D4D5F2AA13B4CB 5POCKETBOOKED
438,373,974 *2C680FA913E1967C2E591A68A67A28942FE50DBC 5RASSIMMO
438,373,975 *2C6A5FF69B4E678914E6A7917D4F1C8DF4B7D1D2 5REFORBEHANDLE
438,373,976 *2C63371789D22F5B9CDE1D1163196589B89A593B ZIADSEIFO
438,373,977 *2C65E1EDAF75E2919A4B4209C453C8802EF47CDA 5TESTINGFENDER
438,373,978 *2C69B0578371091191B48EA4F3CA0F8057061915 zrobiłaś
438,373,979 *2C60207C35A93102CE535BF4F35F26583BBEC75E ZUBAIR ZULKEFLY
438,373,980 *2C6133048501714BA718871D09C76AEAD6661DD4 5UDKERNINGENS
438,373,981 *2C6DE06D8C65BAADDE9F3ACC91FA602B9DA447BB [email protected]
438,373,982 *2C6ABFC9F7109D82ABA484C5CF69D02FFCA0856F 654321CNCD
438,373,983 *2C686CD01B5C00306A648A1D81B0541CA5E7B3BC ΑΠΕΘΆΡΡΥΝΑΝ
438,373,984 *2C65D6437AA8535CB2E999760AD74FCC21FE17D6 ΔΒΑ
438,373,985 *2C6F21726955ABDB7A98818F77FCE0C083B36016 6AMENES
438,373,986 *2C68B88535DE426E672D5699A6736AA10724969D ΠΥΌΝΓΚ
438,373,987 *2C636C12E6974AFAA728E9ECD0125C0F7A520748 БУЛАКОВСКИЙ
438,373,988 *2C6DB6CA03A8AE99421E66F94898E8DD72CEC747 «людвига»
438,373,989 *2C62AF3EE575B7B25F4D9AEDD8470886F9084CE1 русева
438,373,990 *2C6FA711E5350F88C0D6E876164CE4DECF389F43 6MONOPOLYHEALTH
438,373,991 *2C683A4C0DB62C3FEDD7A9D35B53E535F685DBD0 6MORGANCHRISSY
438,373,992 *2C6605A24EF0B664B573108EE077F6E91485084A 6PRELEVAVI
438,373,993 *2C6F3BB2B01FA295267604BD24F5F4BC960D3E35 6THROATH
438,373,994 *2C66A6E040BB3DE8E265CBC4815DF9BF328EBC2F хафес
438,373,995 *2C64899C4126A8C6507C2A7FE3576B9D1C29D3EE 7FUNKYUU
438,373,996 *2C63EE08435B4CB33BE5C63CCE7AB9EC13532668 7-JST
438,373,997 *2C657966BB2F78553B8A691DC4A78336152E981D 完奏モードの場合は、ここでゲームオーバーとなるが、10vp使用すればpvを見ることが可能。
438,373,998 *2C686B42CCAE5177661006E8EFE6CEDA76428195 7PANDORAONE
438,373,999 *2C64D4A34D025BFB7EC4122183A30D91AD44C5EE 広島テレビnewsリアルタイム
438,374,000 *2C648096DB3C5DCDDD74FA5F0BABFBC71A565E79 7VAKLITERATUURS
438,374,001 *2C62DDB8DFCC0C96976CDE3BCF59E02235E8C5EE 80MINÜTIGE
438,374,002 *2C696A757F4AFF7734574DEC3B4D62D0E7D8AA52 81AE8ERRY
438,374,003 *2C6568FA233A87BFAFA300DA70B110DCFD61DD20 8258GOES
438,374,004 *2C6E5F54F25C0A64336B7640E0957B3138A73700 83'.-.93'.czwarta.p
438,374,005 *2C64A50F3F6DED03D2F0F2E77F9186324C799587 8BACCHABANTURQUE
438,374,006 *2C6F4A64F2F0B49FDAB5AA756A05CA059E65B002 8==D.~o.)X(
438,374,007 *2C6DDE058AC965CACA9D1C0FE58C9DF2C054F0F3 8FOZZIEWHITNEY
438,374,008 *2C6AEF4C7490AD8B94BF1896F03D1512A94442FB 8LHTKOHDILLE
438,374,009 *2C66C48EBB767E131D613AD19C55EB4A0B8889D5 8NIKNAPAT
438,374,010 *2C68D4ECA9175A2CF7C3A945D8FF243A4EA28719 8OCTOBEREDWARD
438,374,011 *2C6DA04D9951DFFC2C6BFCAC00D9B6D0D759C174 8P`.:p
438,374,012 *2C6FAF9444991E0C4616D2ACB5D5B2464474E07D 8RCONFORTEZ
438,374,013 *2C609D3F9B22D4270EBFC767472C1D0A182AC5DA (0-0)-~-~-~d====q
438,374,014 *2C6BF41882AA00F39AE44200990A04546F1CAC98 040MARLENE
438,374,015 *2C6D04FE844676A94FABDC6AEC990571C9E27B92 06301705
438,374,016 *2C63293973CA363ADCC7FBD7846E3F5C97870725 988331 doch der unterhosen-report laesst hoffen
438,374,017 *2C62976E5409603B8B07B50006160C141085192B 0THESUNNY0
438,374,018 *2C663543D880DFEEA790EBCBC315D061E6FFA15C 11776D2D61970B78
438,374,019 *2C6C77117095179B68D5EB3E1784CAF867A9DD11 9MYLETTERS9
438,374,020 *2C6393E54C5712A60C0CFD9DFE4EF0D897772FBB 9PLIZITEN
438,374,021 *2C68F26D9D89BB1F8D45056E69FE680AE7A9ED87 9POLLETTAR
438,374,022 *2C68257AC7D1A01CE8230A5CF938E4EDA1D386F6 9REDIGERINGSTA
438,374,023 *2C698F8EB08572BA69753E74D6BC4F18EAC948D6 1472954 YLEISRADIOONMUKANAENSIMM
438,374,024 *2C65B99927596D6DB1790B56C79A66507A8AA9DE 1489141 THAT-WOULD-BE-24%-ABOVE-LAST-YEAR'S-CROP-.
438,374,025 *2C693A881FDBDC4A27CDC3D02858B449346A72C2 14-MASSHALTEN
438,374,026 *2C6B75C615A3B5370A9C31D0147677486D1E82C6 9verwonneling
438,374,027 *2C63151C189ABB85F5911CA4C54639902CCCB91D A;)
438,374,028 *2C6F39957A77CFDB8D94FBFE0F713141950BCA3D A0T4K
438,374,029 *2C63F27D87062B7D59AFA96C19084C56EC9B14DB a2h0g
438,374,030 *2C6C91B71EAB089945F8FD3DDDC8737A3AE41BD8 A3DE
438,374,031 *2C65CCF06B81C5657766B799C8A4C8FF49612F92 A8XM
438,374,032 *2C63C4466F57202F96CEB5475A0FB5026CAA72E1 aaa(b
438,374,033 *2C63DA2251FDBDC4CD123D49FE03BAB52E7D951E 1autismis
438,374,034 *2C60726E8A4F50B6244A844773A3ECE971888007 AACTH6
438,374,035 *2C6DE1EFA4036960726B4E5B522049A542ACE21B aaj?7
438,374,036 *2C6AC2271D98F4342A54B400D44547E5979004B1 1gOrUSmemiStim
438,374,037 *2C60A9CCA7509656859879B582D07EBBDF02820E ABBYGABIES
438,374,038 *2C6577FBCEFCF6EE9F15DA8A75EEE9C56A6B8DC7 1.indepediente
438,374,039 *2C6279691AAD0F25C19E032586CC70E968D4CF20 ABDUL.ENDLICH
438,374,040 *2C6AB22B1E09CE1977AFF93A9C0F2A0110D8E85D 1.kanavakatua
438,374,041 *2C6813D86BEA441C41DBA573509CD384A2FE0ED0 1kelikeereill
438,374,042 *2C656B87F319938BB54F0C4418670B7B1E25EEE1 1-KOUF
438,374,043 *2C6C204CC2F33D38C952D98059495682913B480A 1-kuba-besuches
438,374,044 *2C6D4F962F70C5A5FA6CC94C603D0ADBC602D5D7 1 KUNNIANLOUKKAUSRIKOKSESTA
438,374,045 *2C6CC05FC9FDC2CEAFA90868E4009E31B200B262 AB)IY
438,374,046 *2C639DE64481045830F8E1380A8250837E37A8BE 1-manalandIracaktIr
438,374,047 *2C62FF9C31BC8C2EBC199ABE6ADE87483D8E3ED3 A+BQ=
438,374,048 *2C6E1DE79C851AAFBC1C3DEAD87773F9AF0DC78C ACEMANDU
438,374,049 *2C6C0D78DB400053DC45F695B8F2C94D11C1DEEE ACHOLIK
438,374,050 *2C67554454AC05449980A1B259C44947B4BBA774 achternagaan6
438,374,051 *2C6469F622E365EFF4C322F5F3BB997693EEEDC9 1 SATUKIRJAAN
438,374,052 *2C6CD4D0F416FAF97DE4F63B6A0A84F23C949E00 1-SOFTWARE-EINKAUF
438,374,053 *2C62DAD2A85024C99F0B18141DC8F861FF190E86 1TAGEZNAG
438,374,054 *2C679CD680C004255A8873E18FE8615DDD8D9D05 ad%M
438,374,055 *2C674F9DF5A7AD57CEEFFD305F35C1EEF7E4C8A5 A(eQ
438,374,056 *2C6422DBAE3A9E614CC4A2B835AE606738642CF0 220JAYDEN
438,374,057 *2C6DBCBB98B95B69D32E0D0278D456AF99D25898 2312074 AHVENANMAA ON PIENI , MUTTA HAASTAVA PC-MARKKINA
438,374,058 *2C662554DB306504918ED9944DAC5A74DBBCA1E3 2336753 kunnallislehti.paimio..sauvo..piikki
438,374,059 *2C663BE0D416C175626825BD637100ABFDCAD9DE 2388519 VALOKUVAAJA-LEIKKIJ
438,374,060 *2C6BE74909C06E1433498C95876C14D4E343C4FF 2411248 AUCH-MANNSCHAFTSKAPITAEN-THOMAS-HELMER-WIRKTE-RATLOS-
438,374,061 *2C6BD8F029E61AF2AFC3222808EDBFDBF370BAF8 2421734 KIRJAATKO AINA KAIKKI SAAMASI KALAT ?
438,374,062 *2C6C35DB6C3194AB086EA289265D498E810B3512 2448751 DABEI-SUCHEN-SIE-NACH-DOSIS-WIRKUNG-BEZIEHUNGEN-.
438,374,063 *2C64EB0EC6E8EF5F0B9492216024395DF115825D 248397 heyecanlibiruzaysavasinahazirmisiniz?
438,374,064 *2C64C5547BD628A54A699A57B5A222D32E27411A agrandey0
438,374,065 *2C6B937ABB2B68506A583FEECFC5BA7D3EDE5987 ahmad-i
438,374,066 *2C66EA0907FC97DCD8B069E890CE677D050EE2E1 2.ALLSHOUSE
438,374,067 *2C6E8B111AFCF2116057BC9D050E20AE893C1AF3 2DOBERNIC
438,374,068 *2C62C8656D9D19B37A7DD633A38AB95F2B656462 2-edistysmielisen
438,374,069 *2C6C81FBC68CF21EB4959B84B57E54BFB5E84079 2ERADIS
438,374,070 *2C6B13B52DC7193095313CC457C1743586086E88 2GOMGODE
438,374,071 *2C6CD60588BCABD80DD87891C191A81DFA8F7DE0 2ilovedudley8
438,374,072 *2C68A29224BA3AB6B7AD5E55E869F454B81E811D 2-KULTURHUSETISSA
438,374,073 *2C622F9BC6E520A24EB2FAAC398E53A7FE48FAF2 ALCUZAS4
438,374,074 *2C65A084FC403F521C2AAF9E424C3A92E8D1805B A(%LD
438,374,075 *2C6F4FD72998437A2442B5F0EB2459D51F6BC6D1 2 NORDTEST-P
438,374,076 *2C6AAC0AF016414BD1D3697977B2598ED7F9ADE5 2 OECDMITGLIEDSSTAATEN
438,374,077 *2C6F7CEE46A196C45660359E9D7E8ADEF2329663 2patterissa
438,374,078 *2C61F7B2F2CFEBEA74DF15F25471BAC244516134 ALEX.MARINESE
438,374,079 *2C6D6A4FC0C4B19386ABEB4761620BA9F6B393F1 2.tamper
438,374,080 *2C6BE5E247ADEF162390EF0A58D18689C9AE18D4 2.TOURISTENROUTE
438,374,081 *2C6A889CE1A241E4816A5E3930DCCDC21724BCB5 2.VANKKUMATTOMAT
438,374,082 *2C66928BE70F76DDC16BDB39350444F3834004D3 2.ZUPROSTETEN
438,374,083 *2C61BC66C0B009C6AB16141D5136DF276009FE81 30 TY
438,374,084 *2C649BC8DE376FB9BCC0E8769DB64C3DDC6DC3FF 331-test:dl
438,374,085 *2C64AF2C32C27E91FEFB19BA5E3D7A996FE920DD ALTINTOPRAK
438,374,086 *2C66D25ADCA7E5A54E6A300DAC65590522119FC4 [email protected]
438,374,087 *2C65C747C3FC74DE83ECF5B15147524AF38FD000 3-disney-vergnuegungsparks
438,374,088 *2C6CDC68ACBD70F85A54D0E718057324AF282E74 AMOSKING8
438,374,089 *2C6679460DD86733692A6436CD16D4BCB6B53F37 3IAMFUCKYOU18
438,374,090 *2C69DE9F959E014DAF56A2DB404FAF2D08CC1EFD 3####P.~0.~o.3B<-
438,374,091 *2C65D7596F8B1FEF62F3FD29B3DDF54EBB900CCE 3PAMIERS
438,374,092 *2C605052A8A2B5FF4F87F9101B962C6ED5EFAA6D ANDREW.SZAFRYK
438,374,093 *2C6460EBAF2230BC5A422F801EB286A7BDA37182 an?gd
438,374,094 *2C6B702EDFB24ED001F8D249E0628CDA60DBCB6C ANGELALIVAS
438,374,095 *2C69E56E804DF456BD3B5FC8D51386CFF8A18B21 [email protected]
438,374,096 *2C63477F06249878F681FB5BF79FDBB1E8EACE88 ANNABELLAHARRIETLIDI
438,374,097 *2C62B576D5DAA8030326E938956DB941C45FD497 [email protected]
438,374,098 *2C60546042F9A8C9DF5E4CE3E1C5E186C2542603 ANTONIAOZAINE
438,374,099 *2C633B4FCF688932B394C3EAAAC44913A50D1482 anup.mistry
438,374,100 *2C65EBA37635937EE2F3CE8D0B6D24C844A44CDA 4JUGGLEP
438,374,101 *2C62F4425A76AD473312F0E33FD5C8C38DC427F3 4LAQUAITA
438,374,102 *2C66B92D07B43C68F571CCB07FBFD0792CEB136F aokv
438,374,103 *2C6F827727A6BDED5E9FDBA0D7C9C5681565321F 4NROBLARU
438,374,104 *2C6C30E65DBB79CD0B822E9062D0BF5F2DDB745E apiob
438,374,105 *2C6DDB7B5128736550FA273FF21777DD0A4514C5 4OPPINNIS
438,374,106 *2C6389DABA57B3C084467FA68F54775B02DD5387 APq7
438,374,107 *2C6A1B1530770C3DDD955C992AA5559875E9C48D ARENASH3
438,374,108 *2C6E9135AD089587FC5166C8E7A3E3A5485E8965 arioso-in-a-minor
438,374,109 *2C676C7D3EEB0148E63CFBCA7B2418A5106821A6 arouser6
438,374,110 *2C63896279F0F4888DDFC3B5280D5298A83525B8 ARTICLE3222343
438,374,111 *2C605CEDB2698A4F42C373C199645D6ED505302C ARYQ+
438,374,112 *2C654E8884C156A58EC3B8C0B1B739B5F07D49DF AS.DAY.DOES.TO.YOUR.EYE.
438,374,113 *2C660CB9D1DEEFC9DCAE9E867E81E3173C66FF0C asf9f
438,374,114 *2C6401064A9795EECD018DFF168C8E0312171083 ashley.whitcroft
438,374,115 *2C622564D844C8F800B2410AF2ECA0189E6F84B8 A"SIN
438,374,116 *2C629801739F47C9E8258E2F01DC4CAD15488C8F 5RECTIFICATIONN
438,374,117 *2C63FFDE130AFF493FB1B263EE996FF16AF87F61 AS=UW
438,374,118 *2C60B0FE4861369632656752152FAD178B943540 atantoAmor
438,374,119 *2C601E001743A4C8E32DC3531CD850B34F7C50AA 5VISIONMISHKA
438,374,120 *2C6E0A5945AA192DEC5F81CC671BA397336B2B96 atepu
438,374,121 *2C6FDF6C70D3EFEAF3662389B8BDCE7A47972AB6 [email protected]
438,374,122 *2C6037295C52A689E6DEE8B7AE4C1EA9C7AF8331 auf kleba
438,374,123 *2C683328521C8492C6B50944E01C122D91BF52F4 679907 enimmill
438,374,124 *2C683736F700AD976BF7F5F6B55C3BB26BDB1B32 695107 GENEL MUDURU RONALD GRUNBERG VE ESCORT COMPUTER A . S .
438,374,125 *2C63057281833C1CE39E8DA5D8530C1B82605423 6ANNIEBEATLES
438,374,126 *2C68A6439C05B5FF29E54CA83933CB86B7064D23 austrennens
438,374,127 *2C6EA8378E126E797961D6347F1AF47FC1B9EA9E AV?4V
438,374,128 *2C6340E17C9C711B3B3785F5C84D0054F6474433 AX)6O
438,374,129 *2C6A637782BABD8AC0AC37F82AA9358AFCBA2818 ax9&v
438,374,130 *2C696C70E7CBE1E5755161598EDB987D77FD4FFF a\]z
438,374,131 *2C65C31CEA5E1D4C11E67A5E3D1D07980ED3C99F 6voorgesmeten
438,374,132 *2C6E6CE3347A1BF184D25C45DF7AC2C1B9E852E6 B4RGV
438,374,133 *2C6A2F335DF149ADDC8948C517D67A05776DE266 ba5u0
438,374,134 *2C6BE831EAC073FA3B5DABD1D548286E29247364 7FOZZIE1
438,374,135 *2C6F1E75D475E574AD3D52A97A384A96CB26DA21 7IMAGINECRACKER
438,374,136 *2C69D752434411D2419C30AE4BD66E1B7A2D88A4 balw
438,374,137 *2C68FC879B3464A373F9A1E64FF6E11B51241225 BARITONESTACY
438,374,138 *2C6AEECD170C411B68E8886A7C9A349B46F30944 barleta
438,374,139 *2C6C51905E02230DC74A402BBCDFD6BC44DFA01B BARTON.PITOCCO
438,374,140 *2C67470B472A6B453EB318FF77A2E9DC370D0C92 7MISCHEAL
438,374,141 *2C6A5BFB4C166B3032C3DF268C526E3D85BB197F BATEMAN1991
438,374,142 *2C6C4E1DCD138FFCCB4C4D43EE4A4E86304A0558 7PAIROARN
438,374,143 *2C6E9A39F439B1451FF8F58ED220D6647E4BB19F BBD69
438,374,144 *2C61CBD664F202DFA7889F190F85B55F6E8C4673 7RUNDLEELDNUR
438,374,145 *2C6992B4A95B8496A037043712779EDAE3FD88BD bd)c/
438,374,146 *2C6E04B709208004E96052A40D64195C763EBBB9 b=====d * uu
438,374,147 *2C6D54489C41DEAA33F17F05E1B3ACCFBD06E36E bd!vi
438,374,148 *2C657C75A6208B236DBFD315F5EDA60C3D7A0427 beautifullyabsurd(feat.w.ellingtonfelton)
438,374,149 *2C6B896CF74CC3BD6CCFFBD5C7E9D1CA146F7C6A 898601 LAIN MUKAAN LUPA-ASIAN VIREILL
438,374,150 *2C617989F8ED1FEF246EE63C706DDCF7CD36F59A 8AMANEKU
438,374,151 *2C6331EC9CAA34A860347162DE3CA0AFC72AA162 8ARIUSSEN
438,374,152 *2C64605EBEDFC56B56A04D4317824003FD711BA4 8##B~0~O >-B0
438,374,153 *2C63D6DDD86962313C79C5A94CA6E73B314A9151 8BREDSKULDREDES
438,374,154 *2C653F8C20282A6E5D944505CEE70D4256569779 8CIKKELY
438,374,155 *2C6D3DDEB18AC50703443319973F515255A48644 8ELDDIRG
438,374,156 *2C68F290BD33BCE32584D21DD25B66D50F71B36D B:EKN
438,374,157 *2C64F9597AA512AAF4A585ED0CCA29613990193F bentonrendina
438,374,158 *2C63D65149DA5984B20D2908BD180E53FDB35264 beqat
438,374,159 *2C61977FA231A51FC754EFA5FC378627AF7B5916 bfh1n
438,374,160 *2C630C4797414A981E11DE50EDD52BD6338DCF93 9021233
438,374,161 *2C62220ECFB8F3960BA5C905F8EC01A804E11E35 bilious
438,374,162 *2C63C7919E822491394B0083A1EDBC606C0B3FDE Bill.Lawrence
438,374,163 *2C6F72162F7BC50BBC1DD704DC47D7B14C0D6B36 BISHOPSTAR
438,374,164 *2C63061C00F27B9F4F5027A98243F146D4809EE9 9JUHUYAAM
438,374,165 *2C63A79542466E080C61EA604D42BC0A1CE5A2B3 bkequ
438,374,166 *2C633BAB5DF23510D9D62C9D1C4E8BAFDA6F383B BLAKEVERGES
438,374,167 *2C6AF7586E23DA10DAD5127B96CEB957318B585E 9NNAMREKCEN
438,374,168 *2C60E7EF1FEAEAF2321DA738A527EB26E6BBB1EF blóðkoppar
438,374,169 *2C629CB26BA875D3230593F34A058C9B4ECA6DA1 9SCOOBYWILDCAT
438,374,170 *2C662B4F5DE365E866DEB3849B421B420C9415D9 9SELMASDNI
438,374,171 *2C6DA6E04803CE5B6AC32B1D7E61B1F9EED925FE BMCN?
438,374,172 *2C6C72D73A393F2A309C08B89EF3E6908D621AFC BOBBIE.SMALL
438,374,173 *2C641685B1BBBB3C5DA6E918ABD5480943E13C11 A#2e
438,374,174 *2C664CAE454E847A6AD929D5F0EF2122A6DAD915 a4uj7
438,374,175 *2C6FB38580B7600DF06E0EDDF90F1F333E1C264A aaa=6f
438,374,176 *2C669C18E580156B6ADD54A5A0014D590F347689 AAB3WT
438,374,177 *2C65623BCE9C599DF8598230E983262DBD3DAB8C BRENDON.GALMORE
438,374,178 *2C6BB357B3F70293DDD493FD923846225B226758 AAE`V
438,374,179 *2C6728E3DDD0F5F62D39C47B1E5DEC2515920688 AA?H8
438,374,180 *2C6C315A693A7A8CC1CEC066AB23881F5CF5C3B4 british_rail_apte
438,374,181 *2C62D4ACC020A6DAE5E684C5B149CA2D6C5BC5D6 [email protected]
438,374,182 *2C6FFCE75ED43CED41B28663BC6760BF3ACA777E ABNQ
438,374,183 *2C649F81A4EBDE8AC31CBF1BA51BDF3682DE1BC7 ABU5Q
438,374,184 *2C6CBE640DD91018B9FA9B0AA87E360D1B5D78D3 abwagendem0
438,374,185 *2C6544C7A63E2313148C113B4D50B6791669195D acbD
438,374,186 *2C639033E3323E774EF3815CF7AE934DA0385B78 ac+f/
438,374,187 *2C64880B6CCCB2AC18A0B4577B66AB23DECC6D9A adlawuf6
438,374,188 *2C648C993F09BFC29CB4986B1AE8AE3D86A2FA32 AEGAM
438,374,189 *2C6F01A6168A185686E7CDABB78420A0D0510F65 [email protected]
438,374,190 *2C6E772A68FD880F7C17E70FEC9ADEC2FAC07D34 [email protected]$$!c!$t
438,374,191 *2C6DC9454A9DC1BDE79AB2552A79FCCC940D7696 a;ifa
438,374,192 *2C6F9FD98DC9114AAE8B6548A9BD3216FF5C2769 c8md#
438,374,193 *2C6C29554CDA84297180FC1D571BF2BA168F4247 CAJUNTHREESTEP(M)
438,374,194 *2C636D0D51547B4CEAB85E950458FEA03C89C807 ALEC.MICHARD
438,374,195 *2C62A791C35EB77FFDEF66D74A5EF58593538BCD ALEVYTAN
438,374,196 *2C6ADFD4FE5EB4A035343935718296476D071CB4 ALEXANDER-BURGE
438,374,197 *2C63AF7087F7A12B38C1DA0C8B5CD132882E3AEB CANADAINFORMIX
438,374,198 *2C6DA36F2B6E06F1ACF9FD08B0DCEFC8C6B8CCEA ALIWATTON
438,374,199 *2C6370FD90580ED3CA78F3AC3CA5983F44280CC8 al-madbah
438,374,200 *2C6E8E430BAA97E14017F99A3DCDD68A7A3237DB CAWALTO2
438,374,201 *2C675C144AB943806BF68BB24343DD47B623E624 CAZFBB
438,374,202 *2C6109D4B28BCA9CDC30795D40A042AA31A73BE9 cb7c
438,374,203 *2C63AD842B88A0BFFEB08FCB4C64CE488C341185 amuck
438,374,204 *2C618155999B55FDEF24EA0F29DA248A23FDD526 c;cqm
438,374,205 *2C6E9BD9F18FF8F9B21F50A85B59F8278720F14F CDCINDY
438,374,206 *2C65BD2498F23CA21EBB617E3367E2B287E63057 andersonkrudop
438,374,207 *2C6BF91BC2F609BA9D8166367CD55511866AA960 CDVC5
438,374,208 *2C62438CA021B8CEF4786536CDB826F0A5BE7059 ANDYREINARD
438,374,209 *2C6EA337B39751660EEA2FECFA621A05DFF8437C CEDRICDIFRANCESCO
438,374,210 *2C68A6EAA2392BFCE26E0AEBB9B5CA31130F1FF2 [email protected]
438,374,211 *2C6F5BC715AA3E32E31BC9D74A9E337903EEDA3C center-champus
438,374,212 *2C6D90801B1B8DDF65B82A5BC804F0EBF16EAD26 CF4
438,374,213 *2C6F7663ED22E0F605A688F46D35D5EABDF72CB0 antoineluers
438,374,214 *2C6B9842DD2494940E2CDFFD5D1E6BA04CBE89DE c-+g
438,374,215 *2C6C1203634D27812C8C41B0EDAE61B91D222931 chain.be1
438,374,216 *2C69CE926CA3FCC37801F8A72A34F0B6FAB76037 APRILLEAHS
438,374,217 *2C63FA982DC7A615E45432CD204C5BA3CAE1E96A CHARLES.KAYE
438,374,218 *2C69E2F0FCCBA7F7B652328EF49ABF9985AF5662 CHEVESAILE
438,374,219 *2C6721EC2B8CA5168AF9E2E78D65AAFFD672381F ARq
438,374,220 *2C643C6093D2B877ACCBF61E3969CA8BAC92A6FA CHUPENNAD
438,374,221 *2C6AB6256BAA6AF035748143511AA573F274BEAE c:id;
438,374,222 *2C6DEBB89CE3A267F091F1B9081B5C5E5D5E162E ATTH
438,374,223 *2C66F9403632896915064F49D1095020CB33774E aubreyvillescas
438,374,224 *2C6C11736991959A8A51176F3B420A93830FFAEF AUGUSTBESSER
438,374,225 *2C6BF25F16D5D488A68F2A0F22229F127752FD10 augustineschallhorn
438,374,226 *2C6E875DE8E30E911AA8D5FD7F3164BBDCDCCD3F CLAUDFILLINGHAM
438,374,227 *2C68A7585113281FC54C80ECABA8CD183F627EE1 AURF-
438,374,228 *2C69E8B96EEBEBE4A4157A2F0CBD2A7AC3F0B764 cletusschmeckpeper
438,374,229 *2C62942A5FC37BC997444A7BEFDE04F66CF96C86 cletuswittig
438,374,230 *2C6BAC77F1BC6F41CC6BF0C2D3D64C9EBCFD7C9E clevelandtuenge
438,374,231 *2C6DD69786EC042EB55DE63B313C923805B5F46B CLIFFORD.PADILLO
438,374,232 *2C67DB1141A9D2691E74E28E13E9E219167B8ABF AVENAA0VEY1AH0N
438,374,233 *2C6F6AB8FE7794A07FA062F8E1263240D60EE329 clssn
438,374,234 *2C6EFC2378D2E236B519A894B04A159E3991BD18 cmbpv
438,374,235 *2C67498C24C0D765038B47F4123AE8DDA0305445 AYVURAPYTA
438,374,236 *2C6D1363A84F655935BCCDBAF29AFFD8D6CA0ADE >-b0o~o~(====p
438,374,237 *2C6797DD24BC5D2FBEA7C85AEFFAD2E704F0918B COMPADMIN5
438,374,238 *2C6C8D0CB9EED5C44441215E35766BFB65FE1F82 concertoforpianoandorchestrano1ineflatallegromaestoso
438,374,239 *2C6F8BA6CCC79453EF2CD633B4D4A3723F0A8547 COOPERATIONLETS
438,374,240 *2C60B2E24B3C79D782790304B6BADE78EE542BAC [email protected]
438,374,241 *2C68E2BD188CA1966622D6DC38B00E3BA6472BBA b3epm
438,374,242 *2C6F4D52D75BA5CEE9515C90DB7DF9FF531042FC b587c
438,374,243 *2C6E14336C152EF5D9B4C8A5AB8AACA3A406148D B9:r
438,374,244 *2C69B80C03540EE14A8ED2122E20A23F2AA60267 BABYJ
438,374,245 *2C68C9CC722DF22BA7464170932EBA445B41DA2A C:\PROGRAM-FILES\MICROSOFT-VISUAL-STUDIO-9.0\COMMON7\IDE\ITEMTEMPLATESCACHE\CSHARP\GENERAL\1033
438,374,246 *2C6D71ED65653D667CD4E1AD767B700603722930 balw
438,374,247 *2C661EB971BC2E53C554E1AA8A39976AF61339F9 C:\Program Files\Windows Mobile 50 SDK R2\Smartphone\Include\Armv4i\mapivalh
438,374,248 *2C66B030717B6B7FDE34D371983D484B091284CB BARRYBOATENG
438,374,249 *2C655F9AC0536364BEA6F695E5CF31582103F38E BARRYSTAGNER
438,374,250 *2C6B4F1E9CB474AB7398DBF72702D24634808770 CQOQ1
438,374,251 *2C6B2C2E5C07CBB06255FA5A060ACB3E3A4B79B9 ba(vz
438,374,252 *2C67AE3C2DADE26A4E73F59F05A22C66EDA82AD0 BB1T1
438,374,253 *2C6BC38D98E11D527324D203BA5B8BF5128C7091 cristina.sedano
438,374,254 *2C6208927AB575B3F5D85FD6DC3943259F5F54A6 cr)rt
438,374,255 *2C6D86EE9E5CD980303332BF80642E6125636EA0 C.TURNELL
438,374,256 *2C647E10836ED571BD263C427D0C8AFA363861CC b%e3r
438,374,257 *2C6B0D9A09E07F032C43BFEE66AF1D419F7D1F69 bentonschradle
438,374,258 *2C64FD3ADEE10045EED51FFC6DC1FEFD40C5BCB8 cwda
438,374,259 *2C60C392742C1387B7693EFCC18EE44DB3311825 beryl74
438,374,260 *2C68FCE013F3A7D1CA78E7134CFA4B4CE504F2B8 BETSY.STONER
438,374,261 *2C69C0CB29E334E1437C2D173A73421FBC1DF207 bettymorgan2
438,374,262 *2C63E11FB3AEEEC13BDE2F230114FF9412BCDAFA BFPZH
438,374,263 *2C61C96E2A718CFAF448593C395856D0E0C6CBB0 d85f
438,374,264 *2C603BA85B640001394CA4E2CEB8A2148B75A4C7 [email protected]
438,374,265 *2C6B2229F58E6DEF5796D6A249FBAF06A95208E1 daikousa6
438,374,266 *2C63133EA5EC2472C534A05EDF97E64FBD289C18 DAM-Q
438,374,267 *2C6969C15648F7C3DB400764F926F57438C82839 [email protected]
438,374,268 *2C6F2E4B608A9851AC8632F03B90C22734E30463 B,KGX
438,374,269 *2C6171D93EDBC1EA5B6BA9DB075EDEF31AA512F0 BKUMANTHONG
438,374,270 *2C6E0EE15DF6A80F71A538CEAA8806E2E455B3DB darnelllaforge
438,374,271 *2C60DB2D2FD55C28F314FC2C372A99775731F79E b/loc
438,374,272 *2C61B15DEBDB064DD07E19F46DDAA5B1B1659033 BN++V
438,374,273 *2C6461C2D76B46379FE670054BB015401576B1B7 B;O-F
438,374,274 *2C676D5C6AA41A528A3F6DF5BD7B2A045C2D09A4 bojlp
438,374,275 *2C6FE50AE4AFC843A6122796BC993DC74B120EB7 bosomworth10
438,374,276 *2C6310FB7FE041071F86D6F438337D759412CB76 [email protected]
438,374,277 *2C690B13FD9B7BC5F19CF5FB366C875BD013E757 Death-May-Die
438,374,278 *2C6FB288D36E3A0E3D38728C2E55230A4AF8988E BOUTLOUDOPINION.COM
438,374,279 *2C6806A964266BA08AD9AEAF54CC16425883E0B0 BOVKIN
438,374,280 *2C69E53CAF8C6B1CC8F4755D8E3EC58A8D24A2C6 DE")D
438,374,281 *2C6D24C5EE3DD940C88F8645741C8639906A145E DEEPER SENCE
438,374,282 *2C66749265085D3C49B7CD703B145BD8881F6D8A BOYD.RECKLEBEN
438,374,283 *2C6E481E20FE56C2C8E4902C6EEB027F8D4A54F9 DELEDELE5
438,374,284 *2C6D48017107C7CC637AAF168F9FE0A43EB9C719 DELGUERRA
438,374,285 *2C68073634C568D6E065F5F0984F73288DD1C942 DELTA SIGNAL
438,374,286 *2C6B903C445659CFAE4936DEA1A4B8F648B23CCD bq\!
438,374,287 *2C65F98A1CE7BB13D88EF11C7BB6F12701FD75F6 bragimovs
438,374,288 *2C6A85A9148DD3BFC474C6F2B6D458511BE68005 BRENTONPROCKNOW
438,374,289 *2C6D046688000988F73D17CD311E907132F74705 BREWPUBS6
438,374,290 *2C62DA8212A6682FE064B7F6ACEB7C85AFE6A877 BRITT.CASERES
438,374,291 *2C6E5A88CE5DFECF0D3F340EEBBA17BAB054334B DEWITT.BRUMBAUGH
438,374,292 *2C6864A8719D40ED9BECFFE68070EF1807069013 dewqy
438,374,293 *2C648486035DE1BD7732DD4BF5C7BEF9DF17AD72 BRUÇÓ
438,374,294 *2C61E8370B98EC62E77529AD497E03F4B9348192 DG0N#
438,374,295 *2C6CC130CC5C3379A8AFCC593E7245CED4A04062 bschrft8
438,374,296 *2C6431BC42F4EDBF872E52F8017C23EDEEBABCB6 bt0%e
438,374,297 *2C66AC8FDF92B2275D0AEAD7EF5F7B1C0D5CD179 BURL.DECHERT
438,374,298 *2C61427F4B430B9DE8FF2D9B0DEF45F2A60F96D5 BUS4O
438,374,299 *2C6653BA30E772C1B0B2FE529999C6DCCC34021B bz=t!
438,374,300 *2C6D66E097242647CA40E224F90A1F976944173C CANTATA.BWV.37:.DUET."HERR.GOTT.VATER,.MEIN.STARKER.HELD!"
438,374,301 *2C60C6408699437213C3CDD9452D5F9C8B3EE362 caputas5
438,374,302 *2C61351B2E5082CB7A473357C5332C4927AC6593 CARLOS.SKEANS
438,374,303 *2C6A12B8A3252E35D39B632D13ECBA75544D6B4D D)N+M
438,374,304 *2C66AEA627F0190A0E021EBF4104367AAAC04F06 DNP)A
438,374,305 *2C6EC50A15E23C8BB2B2FC24A7AD4A3A9DBD429C D?NXW
438,374,306 *2C62C8E468C558764C0A9A98551ACD6F424CD3CC DONMERRILLS
438,374,307 *2C6438D46EDDBD3B276BD6FBE9A7680E9DA6587B ?Cbaa
438,374,308 *2C68140A3FDB9D6537F8BBCAFC1629654B85FF38 cc90u
438,374,309 *2C620A4AC678F61366F9C9E2AE0B859CB93931A9 C#D=N
438,374,310 *2C6B0096460ACCE23871494E0034BDDB0DFC99CD CEDRICORWIN
438,374,311 *2C645CF4E88E7929DBC93BBCBB89A51EEC54EF0E dpth(
438,374,312 *2C6E7533A1CC7B621C7F053AA6D2A8873FFA5244 drqjq
438,374,313 *2C6EF40F45DB10BA52FDDB2C941EE620590ECB3B character-comedy
438,374,314 *2C60A7FFFCF09F3D2719FB2C2A92B2F0470FFF61 CHD5R
438,374,315 *2C6CB66D440B5CBE30ADF4F3C17CEC8ADE40CEDB dv#2g
438,374,316 *2C627004F2956EB4D21557A6E341E008DE203BE0 CHONG.BRIXNER
438,374,317 *2C613DD2568D3D60B9EFFDDF94C6F1F928B0C2FD dwightjuilfs
438,374,318 *2C62597548F8E5298E4F055718EC2BF98F8282F7 dwrs
438,374,319 *2C6BB3A9205351F6EBDA87599AEBD6E13C788F0C d-yf1
438,374,320 *2C6658573C5883BB547E8C770A8456CE047A8249 dyjm/
438,374,321 *2C6922919CE2E923E9168ADEE2125CAEAD12A63E eanilato4
438,374,322 *2C607CC67140BDC48444A8D73102737739C2F4EF EARLE.SCULLARK
438,374,323 *2C631E5F596D6C7CCC9FB9A59B155365D184D695 CHÚI-MŨI
438,374,324 *2C64A5FE89CF675987328B1FB164BDA5B2745920 EBONI.BROWNING
438,374,325 *2C6089E7C7B61F122CF0DE3EA4309729F94082D4 ciprianmoldovan
438,374,326 *2C6810AA7195BEEB8E1D07E8F0455540C70778C7 edm(t
438,374,327 *2C6830E7D46639FC1811AC872E4D606F76EFDCB4 EE;TL
438,374,328 *2C62B40E1D09E829E02825A6D2F365D0AA877E56 ELDEN.CALANDRA
438,374,329 *2C63F5BA1816A036F395595E430A3A7FD3E8A8C0 ELISEO.PALOS
438,374,330 *2C6FD9809D8328AEDD9F69082DACC43872A339A3 eliseowands
438,374,331 *2C65AAF60652D6948173596F036FB8F314333405 CNESV
438,374,332 *2C6288DC41BAB434FFEE4F945B9C02FC3F70A4CB ELLIOTT.KLAVER
438,374,333 *2C6CB8EE86B7F724113B082AA03EA0ADD106D7E1 elmansun
438,374,334 *2C6371879D8CC7E7AC02B2BA4C26ED33B1CE689D coami
438,374,335 *2C654C7AD316DFE9BD9865267A09F5C49C60F988 EM{8
438,374,336 *2C67E1F9AA5F54F7513092AF3A69584054CA1DF5 columbuswiss
438,374,337 *2C6B9AC97842B3CD05C6948FCD0ABC61C8C7601F COMMUNITYCALL
438,374,338 *2C61592A79305661872BE0891377B9F929B2C15A E-MUORBIT
438,374,339 *2C64AB973BB29A9FF8F92920C3AA9D42398C7711 CONF1DA+E
438,374,340 *2C69E06A515EE17CDE600AD54A64772F4F4CBACC CONFORTANTSES
438,374,341 *2C66C57E7098469AAFD69A9D2401712DD9F44E37 [email protected]
438,374,342 *2C6F08BCD3DC02ED45636DCA95DEDBFAA9EB08ED CORROD3PROOF
438,374,343 *2C699D2068E3E4E4E547B6A9367477B0E24BF3D6 CORTEZANDRICH
438,374,344 *2C6E786E9E70C5EEC5FB5DD5615AF36ED957FD7D COUE
438,374,345 *2C6C780138FB81250154CC94FA302389944C3138 ericamjones
438,374,346 *2C60269869AEC56AE12DD3577DA8E4FE0348CF4E eri-d
438,374,347 *2C69057CF833A23E75EBBB6C1CCA2DB6E5584894 ERNESTOMCBRIEN
438,374,348 *2C64E28C1070C56EC2F98D231D284064260507BC ernieromney
438,374,349 *2C689470EAE321DD10517F39869DCA7DC50071DE ERPLEEGD
438,374,350 *2C605A9117FCF13C999291137F0489837FEEAB7C ESTEBANHOLLARS
438,374,351 *2C63094E2D6B3376FC0BCF8E33152BE874B62A74 [email protected]
438,374,352 *2C67B4D23E10AC597CEC2BA1970DF8E794797019 etiretra9
438,374,353 *2C6807581EA4156268DC7C4E49CAD64F8ECA7363 EVANPRELLWITZ
438,374,354 *2C6E6E67130FC0EC8C50375FB820402CD7261D81 CUTFH
438,374,355 *2C68CA9216AE60EFF1DEEB2FEE4D24C6D508E281 excep+0nable
438,374,356 *2C6B6B37426C80D46054D4F43D91A9E28271FB85 EXTRAQUEUES
438,374,357 *2C6FB4883F6CCF04C22C0EF3E81D5FD650487116 cynthia-willard
438,374,358 *2C6BC58F2DDD527E83FCA4D0A1EC33DF39B5682D FARRETT17
438,374,359 *2C66C0F886AB962283ABDFFE7FEF1A1122E5820D FELIX.BREITEN
438,374,360 *2C60A819A3295EE799165C5784AB9272D2DE7425 d(48l
438,374,361 *2C602D9487C473F77DCD6F42A4DB20B4BB13063A fidelclosey
438,374,362 *2C6BF33F1C5152BEC9DB1DF1E1342E5EBA9110DE FIDEL.PREZA
438,374,363 *2C68BEA1CE29ECF67747A13D88352A235719F734 fifthrendezvous,part1
438,374,364 *2C6CD07C037A18E9C298724A330BDD8176BFDB33 flojaaaaqaaj
438,374,365 *2C6F188EBA661C6512F61A0E564C969A2D43BF0A DAHF5
438,374,366 *2C6480520B96BB6BBD7C156755AEB8969A2CCE83 DANCELAW4
438,374,367 *2C64BA4280FDC185D3CC6857E5A945CAA719811D fr1d4y$
438,374,368 *2C636958F65804855EE74503A92023208AD2AADC FRACTOSQUE1
438,374,369 *2C677E9F5F7664CDCE8BB459BF09C8FBDDD714DA DARINPARLE
438,374,370 *2C6F424A7F87C71F47C1B9E0F10EF78F30D17CDB FRANKIEFRASCHILLA
438,374,371 *2C6D280C48C9ED7B8230C043D2600809900357F9 franklin351
438,374,372 *2C6980957B7F6DCF2F0121161830E3DAF5A99788 FREDERICVIAS
438,374,373 *2C6B6046EBAB0178AC5CED4651A12555A683C46F free-and
438,374,374 *2C6379814B533CFCD9E318285A50C1ED7098EEBE dax.
438,374,375 *2C67D9C86CB51012AADA2C4003F979219FDD297E DdnS
438,374,376 *2C689D4DFA8522DCDDD35C03CFBED2672979DF0E DECREASE/N-'D/I/KR/I/S
438,374,377 *2C601E441B3339CAAA0441B88CB8B05F18797931 def1a7!0n
438,374,378 *2C6DA454BC69C4880348D83B418885A6A7091593 FRIENDS.OF.MINE.(STEREO)
438,374,379 *2C6505D92C5806B9DC4EA8B330DE848B91741140 DENISECIAJ
438,374,380 *2C6AC00ACFD1AB4466DA6C427671F95B03C370D8 DEXTRINAS7
438,374,381 *2C66C9535EF5F16B9C6BF343CCC047DE5E66958C df2.0
438,374,382 *2C6A2A1656B0B00A9FB84D54FA02E5BBA2E58DCA DHINGSIKKIN
438,374,383 *2C697D1408D7644D13620C31FB2281FDAAC862E4 D"HWV
438,374,384 *2C6E54D9C661ACD457591D492EA39B72D63FC473 DIONGUIDICE
438,374,385 *2C6970D3BA130DE93D8CC464BA370E5C9513FC54 DIPTYKAS
438,374,386 *2C6890DF2F0537784995F3ED564AEEF83D3D4EEB GABBY ATIENZA
438,374,387 *2C6D4AE53D6B6C7F1305CBF2B8B3E98F41AF3662 galelipsitz
438,374,388 *2C6B8EF9DE72CBEDDFF19C3103D4EFBC3E3D9812 [email protected]
438,374,389 *2C69006CE4F714485BED00EC534FE30C3C8CD6AD garfieldclaw
438,374,390 *2C68565131B5F1FAC37BBF7167B0F126F9358488 GARFIELDKURETICH
438,374,391 *2C6D114C2148BEC9CA1B740983659AFA18E3E13A dkgew
438,374,392 *2C693768CCDE1B5531FC1814609DEED8C2694907 GENSING4
438,374,393 *2C61F05FFB010F1BF48B7447ABD5899BC0761EA4 GEOPARCULUI
438,374,394 *2C66BBCDA6035A542671FF06ED4D2BD2161BB2D3 dmaodsding
438,374,395 *2C6158DD4EBF85BDF78DAD89F607A812BB472D95 dolamased
438,374,396 *2C6E2590424A9F80A35570505977A37980AD1474 g/g
438,374,397 *2C6849D681275BDB968BA635FE5516179A6947BF [email protected]
438,374,398 *2C6579A0382FEC9F781E45902B6F7E4761B39137 GLYZERIN
438,374,399 *2C6F9635043CD5E5432AAE3BB4EAC47721FA8F56 gnse
438,374,400 *2C65C969298C46FCECE67B3DF78208F617E0C7F0 dqaaw
438,374,401 *2C65F7392E15202C4DBE458614DA410675D290FA DRTNI
438,374,402 *2C6099DE0F2EB1ED67C230BEAAB56D57D732597B DtrV
438,374,403 *2C6513302BC3521BB631EC5161AF37B86CC5AB52 [email protected]
438,374,404 *2C605FC8FC4E5EF93E87126C3E4EB08ED1832E45 DUBBELBRA
438,374,405 *2C661A44321A0846571FC046A49D85F2DCF6546C GUYDUNFORD
438,374,406 *2C6EC6FBC12AA4BB36EB2266C90C78FEA2DFA26E DV:H+
438,374,407 *2C6B4677C044304F83D4358BCAB7AEAD9E0004AE dx/iq
438,374,408 *2C655985EAF647F3EA2A80EA01642C939120126F [email protected]
438,374,409 *2C6C1EF450D539BC7FC9BD4B46945866A7FF6161 hangangeui
438,374,410 *2C6A514040C1B442B684EE104598E98028D4FBE8 HANKMITCHUSSON
438,374,411 *2C6BC3F38AEAF2EF948047A5E6EA855B2DB41019 [email protected]
438,374,412 *2C6C64085EE37E505ECE1AA5815F128401BCF4EB hannif
438,374,413 *2C6A76A9643C9CC490613E4980C6C322DD2C339E [email protected]
438,374,414 *2C66F5D5A7AA0025CE48BBA48FC03C0D7F194ABF eblwp
438,374,415 *2C65E52913E5BC9D81283570465B320C506EF9E9 HARRISMORRERO
438,374,416 *2C6C61861E860190C0A600242A980313F1B24F6F edmondhuizenga
438,374,417 *2C6668904A27BAC7521155B4329C02B55811CDAC ED.PRINCE
438,374,418 *2C604D587A1956218B8B8B03EA91E7323DC98557 HEALTHSPARKY
438,374,419 *2C698055B5F6856608D4FF1A67B937D0B1826828 [email protected]
438,374,420 *2C61DE7C90747A69EEE16E7BA20B2B389D557600 Heaven's-Fire-Gates
438,374,421 *2C6C08EDA532843D9EFBD78DF73D3867E48A6572 EHABGHANEM
438,374,422 *2C649A553633B5B2E1E5B0ECE787459D8BC0CBA9 ehcurpse7
438,374,423 *2C610D18481C1175A3AB4E83AD6E29649B7D139C [email protected]
438,374,424 *2C6462EF9D01F6EA220DC5FFE9ECBBFEC83271EA HELLISBEINGALIVE,ANDBEINGALIVEISALLTHEREIS.
438,374,425 *2C654F15546433AACBF5ECE2B454BB09CDBA8805 EITHERCHECK
438,374,426 *2C64417238D4F4FC32DED480FFB02F96E85FD194 ek/6k
438,374,427 *2C6F11B691B100C00295E9341B5688D77D72BD9C el4ro
438,374,428 *2C6773240EA250090896375B4687BC2ECB05836F HILTON.RIFFE
438,374,429 *2C68077A1999F11C06D5C64A400400B2D5351735 HIPERBOREJCZYKACH
438,374,430 *2C662F21D18B741D6BD781B08A6D8518DD6B08D7 [email protected]
438,374,431 *2C652FB7DCD170BAD46D0F6489C57854B34A983F hm71
438,374,432 *2C656179735824C13571081E85DA7229C96C2DAB hojtaen3
438,374,433 *2C6A81BE6B7E4C741B9D0C5D0F76ED8F15E89A62 emailpasswor
438,374,434 *2C6897E380B874651BD52B02529F657C076F28E8 hoxy
438,374,435 *2C62536D873E1ED45B6689F9ADEF33AB8C4549D6 enjoliviezs
438,374,436 *2C66E6B42D76A376CBF1F72ED479911A5544EAF5 en sked f
438,374,437 *2C6144D0AD7A46DFDB1A53ADED341F6CDE9AEFA7 erichburdis
438,374,438 *2C6C51B891E2B4E9EA458295BB3E0A060470FB1F ESISUUHC8
438,374,439 *2C6E304552683AC74AE46C2522B2503E254D8770 husn.walo
438,374,440 *2C67D03187A7F78375EF9B91AFDB5B80F326C637 HYDRAZOI3
438,374,441 *2C6A34D884AA2FD7470813EA16EDCD669225D3FE idiomelar
438,374,442 *2C6900D085D9FA59078B2B7B6B7C90F55DE194FC EY"JL
438,374,443 *2C64253FADD16DEF6A71766017157CBADD14CFAA ifl-
438,374,444 *2C6206561E803A49C1ECB8CB088370DFCBEBB9ED [email protected]+f!5he5
438,374,445 *2C6E62ED0C9E9B06C7B921914227C4756C1C6B9B felixfans
438,374,446 *2C635AD45ABD481A1D043548E0407D35FF97F021 fernanda.heringer
438,374,447 *2C655F7B13EB5046013AD85034018E144A4AAF8B iluvroman54
438,374,448 *2C6DCF0CF22FC64A202C4E107CA95738CC190729 IMGOU6A
438,374,449 *2C6AEE2F139A09BD17510096DDBFCFE7D9BB523F FFLWFFYN
438,374,450 *2C66AB9A0954D10B8FD6D8746717C47D1444BD8E fir3hang
438,374,451 *2C62EB372A5E93337CC02AB81122B61FF3FC3718 FITPROJ
438,374,452 *2C6B114055C94C2F7552314E4F5A903CA04C340D FLORENCIOGODINES
438,374,453 *2C679FFABCF5BF89E9828189A46DACC335C0BFD7 inhumanness7
438,374,454 *2C689767485CBFF9B40E5C02BCEBA073F45BCA5B F\MP
438,374,455 *2C67D58A91B3AB9523A492A7422A33EB1F3EAD4E FORIRDIAL
438,374,456 *2C660BD649868631AE9D740673681CB1984C2C6B irfan-ul-haq
438,374,457 *2C63BE6E376A7248427C0175A45462C76317BF82 FRANK.CHATFIELD
438,374,458 *2C650C2F13EA820E42476123626BDF933DE57A7F IRVINVONSEGGERN
438,374,459 *2C6F51BF4CC380977D68D5AD55323D6A736C54E8 FRANKIEPORZIO
438,374,460 *2C6B8B42FDB8E5C35A5A57315DF2EE53FD1F2EA1 isaacnachbar
438,374,461 *2C650D931B9ADFF0F950FED3265753DE3DD5DE5F FRANS.TIEDTKE
438,374,462 *2C6E8291723D2B922C0FD44813941EFE449BB12E isrealjahnsen
438,374,463 *2C66987651FDCBB5442E02EB164052A2D138AE44 isrealsherill
438,374,464 *2C6432ADC4272CF7A888577535EDAE0F2B9657FC issaclambey
438,374,465 *2C6C872EFB3F748E5E9A4602AC1AE5B3BF39F063 FREDDIEKARAPETIAN
438,374,466 *2C688E9CA4F3FCEB3A62F7AE316350AB89C13629 ITALY
438,374,467 *2C6AA31135254E8CE24F79CD73ACAC42A1F199BC ivanwernick
438,374,468 *2C6ACDED0984EA6EB4EBD8411C798E7D37C831F5 FREYSTER
438,374,469 *2C608D5DFAA0A58DB1512CA3E05788ACD73E7FAB [email protected]
438,374,470 *2C61A311E9B9A7056AEB5180E556E9621A3018DC fvi,
438,374,471 *2C61C57C37E8C6401EE912EBB64FF196FE10BC13 jakebinion
438,374,472 *2C6C0A21C8AE7C9609D5B120156BF3542B05EE34 JAKE DAGGETT
438,374,473 *2C65F37D899E7EA5EA613A488F06572D5BAC4FC4 gaanbaar0
438,374,474 *2C6283904C8280FA52F8E5D4F77752FDCD2FB3C5 GABRYELLA4
438,374,475 *2C64BD891549B1D1C5ECA6529B59F036E48AFAFF jandaviding
438,374,476 *2C6E9F9973C5B811A1B3E9677AC245346EAECE91 JAYAPRAKASH.GANDHI
438,374,477 *2C6444CD33B4745BC6934CDDD01A09018084CA14 JAY.BAGWELL
438,374,478 *2C6484A2DA2DE3DFF4E77B86D172399044AC4C6D jeffereybuchinsky
438,374,479 *2C68C97F8CA54B11CD07C3A7C411AB2333B42917 gelald0
438,374,480 *2C6413D05522EF4EF74B83509277E4358D853D72 GENE-SMALL
438,374,481 *2C653723F9044F2941ECEA888650B29B9D585905 GEOGRAPHER1
438,374,482 *2C649FB2835C1C0E65F28A2C87F85A63215F41DC getrampelten
438,374,483 *2C673E517AC58F84D240D2465953BC7CEB8F8635 GILESIA
438,374,484 *2C6D99154FE224B2223301F1667C34BA25E2F6DF joggl3b3
438,374,485 *2C653A9EF6C5B6A0CF3AA5A8144356A53691F47C GNAWTUM2
438,374,486 *2C6C215FEEFDC47594022D91D33E714DB75ADBEF gonzalomonnin
438,374,487 *2C6163E42EE1775F5E4E351A26EC96D15B2B08A4 [email protected]
438,374,488 *2C67D546FF1D9F94041353CFA0E7BB0C0868C6FA goodcompanions
438,374,489 *2C6C94D97B6C518E1DCACDB71BACE93AAD3BAB67 JULIUS.LANDOLFO
438,374,490 *2C69D3B8CB562B0CA5A3A605D505E491B6647F0E GT%X
438,374,491 *2C605FDA38FFF26A8EA315F065BBA1073D9756F4 justin-varnum
438,374,492 *2C640D6EFB99E20730AE5D72E6D7F75FE828CC33 [email protected]
438,374,493 *2C63CCC11CDE7FD636389E87BA42D461F6CAA8BF gx%~
438,374,494 *2C6724E97A54D4006FB87D5ADEB3CBB807D3E06F h~7baa
438,374,495 *2C6D09BAC188366A17507409321164CC13ABE7CF hanksprygada
438,374,496 *2C6C529E697160C65D4F9594B93D4DF67346ECDF HANNAMHS7
438,374,497 *2C60F63FFEA2FB2A018F39ADC53D2523BF9F47F1 K*B}
438,374,498 *2C67C7170EAE382BEDB37A40BB54F609AFC46F9E [email protected]
438,374,499 *2C6160D67BF734A72A777E5028A97A6E860444F1 kdesu
438,374,500 *2C6E9EADBE6E73F25048859191C57C121F8A481D KEj
438,374,501 *2C6935329ABB439387CE39635F1651073572B1A4 kellybuzz
438,374,502 *2C6AA72B28DBD07AF80D8E24A25455B3E9EB58E0 KENNY KNOWLES
438,374,503 *2C6297175AA5156FD1EB2482B4C212410AC2FEE8 has.been.cavalry
438,374,504 *2C6B280B58D50486EF544E98EE79E2BD80693FD9 HASVINS
438,374,505 *2C69AD07163E31A322B32294E7D1FB747D01C847 HATESXXX7
438,374,506 *2C64EA095A38877C1C495BB55368A61495FE0A60 ĦAWĐ̧
438,374,507 *2C629097BD62C3CD9E46EED0616AA74F6A7DCE7C HCAHSOT-1
438,374,508 *2C6BE1A11C5AD64343A673F8F67F646C726C9D36 hegumen9
438,374,509 *2C67ED15105B5C3F1818C9EEE98DB835DA355A13 hej,.varg
438,374,510 *2C69FAFE96F8E34ED12A1971F5007694C6FB09BA HELCLOVÁ
438,374,511 *2C6B1002CC40B2CE37FBA54AF891438FF1979F96 KHJHQSNKBNB
438,374,512 *2C6DAB7DA4F2234493621F31D5C75915ED9071FD KIMMY.COOPER
438,374,513 *2C6E68AC6ACF3891B97A1D2076AC05B15833408B HERMAN.PRECOURT
438,374,514 *2C6E972883C1F8D3FE2F77151D84FCF1D7B67EE1 HERSCHELKAMMERZELL
438,374,515 *2C64B4B92937444CD220745E4CCCABD63E8DAE20 HERX-LINKS
438,374,516 *2C66164F1432E34F3FBF273CFB8A7E6ABED5C4AB HEXATOMIC4
438,374,517 *2C64AB22EB14FA1D3285D0AA947748016A1C39D9 HIPOLITO.VARLAS
438,374,518 *2C65AE824C01597C633DF2872B0CDF1936CD9E88 KONERNED
438,374,519 *2C6E104ABE22D8E2621B72D88863A3637A4BC1EE KROSSBLOMFAMILIEN
438,374,520 *2C657018720630A7CFF4F0FE269D7F97B23DE9CD KUHBRÜCKENVORSTADT
438,374,521 *2C6F58E93C5776F63DE9D528F04F969BA7505B59 howardgano
438,374,522 *2C6FB261E9686A167BE643989976F0CD162C1D2F [email protected]
438,374,523 *2C6E19E54554CFA5F7CE2A13A4E17F7636CC05A9 LAWOUEDU
438,374,524 *2C682706CA00F09499560B58B4D45365F1B47D91 HSKAKIRA
438,374,525 *2C634FF8CF222275367CE28B947D0DE710193BC0 L]E
438,374,526 *2C69957182EEF2D2B9DDD2735E9CB5F30A4D7A7E [email protected]
438,374,527 *2C625E34B614B3443ED6C7BDB37E6104F75DACFC HUCACITIES
438,374,528 *2C641628380F3AFFBFC14EA10F005EF4C7562D96 hugogreenham
438,374,529 *2C66AA005C2C0D9C40A552F9DCA446276B1B1116 LELAND.HOSMAN
438,374,530 *2C6D9E019ABAAF3511B6B48F9C1500445BBBBF3D human.waste.(cold.drive.remix)
438,374,531 *2C64D263BD40FB9C1277DEF2FFC452AD0007D87E LEN.DESORMO
438,374,532 *2C6D385AF6865D75C30365A9A449C57D22F12D50 HUNKY
438,374,533 *2C60BF7CC2F60E98852AE3FD7676795F60548B2C LEONBUDD
438,374,534 *2C6E0B26E11B9BBAF354858F23EC68A8719F16B1 LICHENO6
438,374,535 *2C621710AAF0C0259C48FE18986DD1BFFCCC0FC5 [email protected]
438,374,536 *2C6F8892BE9D1EC1C6093E493C691BE7361AC19E IBERIAAN5
438,374,537 *2C6F7179AED223EDCC51FA30FF64B95FEC75FAE9 [email protected]
438,374,538 *2C6D55BA8B90578B14CEF3B6D083CE74F87B86A2 idrottsplats)、gih(スウェーデンスポーツ健康科学大学)の施設それぞれを体育複合施設として考えていた。
438,374,539 *2C689EFB195CEE2972CFBF9823B30E69924FE779 IHSURBOD4
438,374,540 *2C6AF363D4F3584EC0C3695D1E4EAE7E1514D2C4 LMAHICAN
438,374,541 *2C658609162CFEA3EF5F0610C276F087F1AF6CDB LOCALIDAD DE ANTONIO NARINO
438,374,542 *2C62E4E495025632DDCB5C70938AA209F4840D6B LOLLY1994YUP
438,374,543 *2C6C68D7B3A6242C09CC335E56565E10C62F706B [email protected]
438,374,544 *2C6BCA9539E8BE759E5BEA4B3F8B36DC04BF6D0E LONNIEKERINS
438,374,545 *2C63B4EAFD14C7B796F1426072D57D4EF42893E3 LOREN.KRALLMAN
438,374,546 *2C6FD8A13B2A326C5215C3D635C3761475D3C043 iluvchiquita62
438,374,547 *2C67B4308BDD752ECDB1DAB39BFFE0C513D1E491 ludvig.andersson
438,374,548 *2C68DDE057A2C2ED9C1AE37C065C04980DD7D167 LUGANO-SVIZZERA
438,374,549 *2C6105E492799A27476AC02D67A119AB1EE38026 INSTITUTIONALLIES
438,374,550 *2C62F9636F94E50534D449980225CF14A5D4C4F8 INTHESHADOWOFHISWING
438,374,551 *2C6C1B383D84088D570F1D3F318376D0C2D02497 LYLEPRENATT
438,374,552 *2C65D46DC0530287981A311CAA8E12BC2D357BD2 [email protected]
438,374,553 *2C6795CFF766E64993024C3945B117A63BCC4E1F i]pl
438,374,554 *2C640510C1C986F0EDA60457FD18256ED1FF013B Isabel.Garcisanz
438,374,555 *2C6B1311CD5EFEE7D4A9EC571CF7828B4232F0FF ISIAHCATACUTAN
438,374,556 *2C6BF9800F1C78B296AD88AEF4C06CA4F1098610 ISIDROCANDEE
438,374,557 *2C65EF6DF7DA800371BBF2E29D657BE60D215F8B madel.dela.cruz
438,374,558 *2C6DC3B2DE33335A71D563578BBC58433EAD8603 islamą
438,374,559 *2C6263E05370E68642171DC9FF2799B087AA9B27 MAGDOSA
438,374,560 *2C6A0C30E819C00BAFB8B30610F73FF8CD19D62A ITMORIORI
438,374,561 *2C61E73EF9627F6271EDEABE7F087EBE50D68D46 [email protected]
438,374,562 *2C6BBB0CDC5C8FA5CAEA233652FF5763A9EA001E IVORYKALUPA
438,374,563 *2C6E352FF911DF2CF5531B27CBFF4C84440D2095 MANNERHEINOVA
438,374,564 *2C6A4B65EFEB1153F937EDF6CE41E1979C81DEFA MANQU9
438,374,565 *2C6672490392F244918BB9E9BBBFCB31DB2615E6 maravich做比較。
438,374,566 *2C691D929DDC7974D3FC7FA00EFA410737DFDE01 jachtsjoek
438,374,567 *2C61EA3CFF00B071D5BC7546CB87F02C3EB298DA MARIA-BRAZILORG
438,374,568 *2C60D963A1EDCD1FE533E6CF9EE08EBC80798A0E MARION.CURRENS
438,374,569 *2C60DB101D69950532A6BF811A20F7951D40239A marlinleverette
438,374,570 *2C6142F686B41E577DEA1B8446DF64C482D903B7 MARVIN.OKEY
438,374,571 *2C68083E1AF4A5CEE591B6643E449379C0CA221B MATT.MORVILLO
438,374,572 *2C64D72CB663C359D2CC9685DD6E0E75308D6B34 maxkakaviatos
438,374,573 *2C6374DD00637AB717ACC3383D51DCE26D2B71D8 MAXWELLHERLING
438,374,574 *2C6F402D4C782325BF32C3BA25E6DCE5F8566D70 M-D
438,374,575 *2C67922819942D847C556EE11E0A2774EBE43DAF medellín”
438,374,576 *2C6EAE5887BC42A511A0092FED806ACDA3DC556B JAMARIANED
438,374,577 *2C68B6BA8B6719935B1E520BD31EE14C12B565D2 JANEMANIQUIS
438,374,578 *2C6C1E4297009803A7DA25ED86E05E9DC600A3A9 mergeing58651632
438,374,579 *2C62826ED0F30C922845265BDCB791C189A73A07 [email protected]
438,374,580 *2C65C0CD6BCBE0869FAC46E8CD396D682A6D1E5D METRO.DE.FRANKFURT
438,374,581 *2C6D743DA688A8B4C4DBC66941101FC1B7A1AB28 MICAHFURLAN
438,374,582 *2C6D0008138A05318B4188484449BD2CB8B7AE59 jayrios
438,374,583 *2C6F3FB1527E9BB08D563EF10AEC366AF0492557 MICHAELKIMMEY
438,374,584 *2C6922592C9EE43FD0AA1C16A3884D9F2568B23C michelbastida
438,374,585 *2C681EA13ACC88B040A3EB77AC006E5E9E2764A5 JEANFREDERICKSON
438,374,586 *2C6A47D7AF6009C585D1015A7FC42DBB516B7CDA jennyjanssen
438,374,587 *2C67CC4EEA61420A9559AE6C5DA56C4B3AE703D4 MINISTERRECEP
438,374,588 *2C6D6EC0C4F5FD3B56FA871C2A4FA454C736A0F2 [email protected]
438,374,589 *2C6C769168AA76FF69A6C0B2B0846DC0D4BF8C7E MIOMEHMET,FORSEILDESTINOM'IMPEDIR
438,374,590 *2C6E21C4EDA48166134D2D81521919C7FCB2F825 MMAHAJIR
438,374,591 *2C678ED18710A3BB97BD8F081A6E1125F2B66984 MODLETE4
438,374,592 *2C67924A0227242D65ABF4778F0FE74D8B0595B6 [email protected]
438,374,593 *2C61CE65D9F05AF3C54EF0A74C227BCA2CEECE16 jimblatz
438,374,594 *2C6CA78643392A99BAF6FA1E488B935D4B2E4D41 MONUMENTS(EXCERPT1)
438,374,595 *2C62AFFD15645A5EBA979C212D2C0D25A643BB1F JOELMIKKELSEN
438,374,596 *2C6F694B40BC64CAB016043628F2663EA37C18BA MÓSU
438,374,597 *2C69E734AB82EC52A3AABBA607C08A58D4FE73CC MOTP-(I'm-The-Only)
438,374,598 *2C6EBD3E772A1F9BF46377983FF5908824C2436B MOUTHTHIS
438,374,599 *2C62966CF951C1D7CB76D0355D7D0C7D1969EB23 JOHNNY.CASTILE
438,374,600 *2C66B63072C89E232F6D01B0CA0118A417493C8D [email protected]
438,374,601 *2C62EA3E67F7269D62D1E17309B2553D14E5F307 jonathonpetesic
438,374,602 *2C620D60373D05BBE76C6BC63A55FB4443969497 JONBUAL
438,374,603 *2C6B83CC641BFD3611AD551E93E9988E2ED8DEA1 MYJUNO55
438,374,604 *2C63F37D4FA158D914A37824DE54A349DC1F996F JOSPEH.BELKO
438,374,605 *2C6DC71AEAD6DC4A6FCB87DF4F2A26BDA45E2FC0 nareshvalakonda
438,374,606 *2C6750AE960939CFEDE85F800EFB28294BCA7B2F NATHANIEL.PAYNE
438,374,607 *2C648AB220A6039846F16035C9E1CC7E0A53DFCF natibsw9
438,374,608 *2C687D329E44DB1787BFEBE1CF27170C457D238B JULIAN.NAGAI
438,374,609 *2C68ED0868AD6E1897CA2CC28C9057EA5BD7B14E JULIOVALIENTE
438,374,610 *2C6AEEA8E1EF7F1AD0DC0D1A1B3DE86274510BDB JUREZAMUJA
438,374,611 *2C6AEF74BA0AE57B81257AF39606D7D9F49B28C0 NED.WONDERLING
438,374,612 *2C6DBD63F0D7952F0668D46849F23FBBE7B4998B NEETU-DHARIWAL
438,374,613 *2C6910BC4F99534BA95E7005FC285D86E65A30B6 NEIZDRIVOSTI
438,374,614 *2C62BEA09F4DB9CED70FFA18533BB5108FFDA28B JYGF
438,374,615 *2C6A7859A1B11DC187044298C8798EB21ECB6FA9 NFFTMNTS
438,374,616 *2C6FBEA37218DC89982E91ADB0108238A0589486 niallmcdonaldd
438,374,617 *2C6A19C4B36E1D0CEBC432C3D899E21127CA2DDC NICKY.MAGNALL
438,374,618 *2C67AEF81862831B36C733D81DCAF3EEA7526561 nickystevens
438,374,619 *2C6A7BD831EE6957D7C256FE1EE3FA24135608EE kasernenoffizier
438,374,620 *2C6014441900408FCBC067623EEDC8174E7847D7 [email protected]
438,374,621 *2C6B65504CD676E4BE343D988EA1F897550EB418 kautionsbüro
438,374,622 *2C6A7CE5EBA3D3C646D654B0459BA6D0E74EB4E7 No.6.in.G.minor:.Lento..Allegretto
438,374,623 *2C610BA0FE2B669E7FB8709702146741D07805E4 keiow
438,374,624 *2C69D44B20922111D8F7AE5A7436D592B7DB4C73 KENNETH.SHATLEY
438,374,625 *2C6FCCF9C60C80A2CDAF16F954C48932F115B081 KENNY139
438,374,626 *2C68A2440A8756E87D06C75AD834C7FF3C4B5E9F NORBERTO.PERA
438,374,627 *2C68CC43D9C95AFEABFB396CDC5B4507075ACF56 kgaaaa
438,374,628 *2C6DB24934A820BBB0C120313040C6C9D1721AEB novascotiaducktollingretriever51
438,374,629 *2C69A17A2910017FC9C99B53B190CC3CF6B9A889 nowmassive(dubmix)
438,374,630 *2C6CD386903B5D75B623F80D174D31B3935E12A9 NY-262SVG
438,374,631 *2C6C7EF58A238FC3475659EE13B8E5CEE7F226CD [email protected]
438,374,632 *2C6FD205B1CB6540B08DE23D61832C7FE5A1A3B0 ;)-o~0~d#####p
438,374,633 *2C608E10164B6C5E31CF1FDD6A51F45F5DACBFD3 OCENAO
438,374,634 *2C6A90E0297DEB819FF1779A78A110CD2C51CE8C KRISHANAMACHARI
438,374,635 *2C637EFED578F0ABC34FF2C6147037963A9AB247 OMER.PROST
438,374,636 *2C6AAB55527C7EC6A3A9A89226E6BF928EF7D40E OMSTUWEN!
438,374,637 *2C6A141363794B43DF305980C848BA35E048C158 [email protected]
438,374,638 *2C6F7994E4B318FA639A1F9E4C70F04706DBA1FF KURT.CASCIOLI
438,374,639 *2C67FA997CB2EFDA5C909F915247431C76B59698 (O_-)[email protected]
438,374,640 *2C6F506E2E0ED4530455A040450C8ED157C51688 )O(-O~-(----P
438,374,641 *2C6058B1A13B994C2E090A52D24E8B269C0913FE L\+6
438,374,642 *2C63AE7430A50BD65FA27129AB54AACF6829A990 LAFRANCHINI
438,374,643 *2C600C51C9B59B201753DD98D50259B9C7932BE4 la-vida-e-breve:-act-ii,-scene-ii.-"qu
438,374,644 *2C6E6CE73C06AD88A1B2A6E8801F8BE312522B0E lawrencedevereux
438,374,645 *2C636FAF4D411DA39CC2F24AA63D3A50C537B7FE * * <==P
438,374,646 *2C68915C4BDA2CE45F058F505415B705880EC56D [email protected]`~)8(
438,374,647 *2C62458677F35CBAB0224A3AEE6484B9B9E4BECF LELAND.CMIEL
438,374,648 *2C6299AE36D7615D071A24E222C6D78411AE735B palmerbrockelmeyer
438,374,649 *2C65CB8532E471C727B5DD90570AF7840413216B pantomime/everywhereit'schristmas
438,374,650 *2C6927A05B59F41CD248FC07E60E60D2077AC7C2 LES CORPS GLORIEUX: I SUBTILIT
438,374,651 *2C687E65906BBA2B09DD9465C092B48D32DB761A LESLIETERHERST
438,374,652 *2C6FDA9F75221AE74C4CC939DD7F88BFF515BF07 LESTER.RUCKY
438,374,653 *2C6AE3517AEAF20980E52FD08DF3A71ADE7FD637 PASCALFLETCHER
438,374,654 *2C6C67B9A4FA5647EE21E2ACD2B81217A3E5C190 [email protected]
438,374,655 *2C6CAEE39A4133EA4F8D1FB2A22B4D711348C4D5 pblocals
438,374,656 *2C6BF1DCC5A7743919B7BDC68B92E08F254C74B1 [email protected]
438,374,657 *2C6A87668C465F47B2FC27AC9F292397FC818BF2 p------d* *{x}
438,374,658 *2C657CA9812F539AC40AB4327B5F9D8B0C60762A lings
438,374,659 *2C612CA4CFF5B3EC1949CBC0AF12D9203D508139 percydohogne
438,374,660 *2C6239F840F802F019839076F9EC94A765D6591F përlëvdoje
438,374,661 *2C695BA295EFEF5E12F452D2691C039B20EA554F LISASIMPSON
438,374,662 *2C6207767F046D9A8F4A3A55F892C541AD0FAE71 liusuijun
438,374,663 *2C6A5F7786051E26EC49CAA8148A016870D06AA6 LMUWAMBA
438,374,664 *2C6D16A57B3FA7F09616E0E5F73BC98E46C3C920 piano-concerto:-iv.-allegro-risoluto,-molto-ritmico--
438,374,665 *2C697067FC55420BA61DB50B07BD26519A0BA3C8 PINKTURTLE
438,374,666 *2C6593FDF92BB3017239ED137C64089E70DB1419 lori.brightwell
438,374,667 *2C6EDDBAA867C6A1CE6F9553A5AFA92C94E6F53F LOSERAEHING
438,374,668 *2C6F79FA0294B0F7EB1FDC30AF4418690AAF8077 P####).~O(00)
438,374,669 *2C6B1BDF077A6F0C41308001017232C1E680D23D luciokipling
438,374,670 *2C6EF76A12EA1EECF2B2FECB3847AE4A941C82E1 POWER.AND.REASON
438,374,671 *2C6DF316F42CEBBCB10AA08FCE511AA841ACC755 PRAVNIM1
438,374,672 *2C628D7D3E9D61ECE8CCFC18C0C1F2A02476B793 luukustas
438,374,673 *2C66ECD14BFFF735F3787AFD7B4B75C8BD1E5614 prhmlgs5
438,374,674 *2C6DB1B8E5A3023F08E37CFCC9B2EE192C7EB1DA PROFIDEVA
438,374,675 *2C61B9CB77B6CD04D9964E74DE05A53DA6FC4C6D MACIOCI4
438,374,676 *2C6FD0A6E48C1C956A709EFED6817C03978822B0 MADONNAKATERINA-HANSJUDENK
438,374,677 *2C6F129DAA32AD6C37EC4092B97E02FA7D7AD427 [email protected]`~-`~Splat
438,374,678 *2C6E0BB984DB16E15D016A441EECA74FFC598FA4 manghams5
438,374,679 *2C68E5E3475301C841FF2A8369304658C5013F80 [email protected]
438,374,680 *2C63E37A88C25148D3D1904E65CDBE262F4D6E71 [email protected]
438,374,681 *2C66F03598AED7E858B9A9C164FA74F4870821FF q=====>~-~(>_<)
438,374,682 *2C6F02950BABE4D635FAD2497B80F92478209FF0 marcelopullens
438,374,683 *2C6674E2E58C6D8FFF1150F392E9AEC927F35079 marcigbinosun
438,374,684 *2C69D36CA3E0ED9DAF11A0B52E0EEDA2A0F4D3AF [email protected]
438,374,685 *2C695CE7CDB9D32DE65A1B2DA947241A944D322C MARIO.KESSELL
438,374,686 *2C6215E6A1150BA898EC0B31D3B19E6811BAD0D8 marionaly
438,374,687 *2C644DAD53F063B74F48C295501F5323777FEC7A qomm
438,374,688 *2C675497B97233E0EF0DD089F547609FCA7756A5 !QUEENSNY
438,374,689 *2C60C5FD01754E95988760E69CD76D74D9CE3B39 [email protected]
438,374,690 *2C6591FAEE15BA8B0EA0280CDD6677951FEB5642 r3r4di4+ing
438,374,691 *2C68D087A9FAF76E4F88DEA6A56A4D9C5C785FED rahoittamat
438,374,692 *2C6F12781A5010A95336FB64D4FA4D9320D05BF8 RAMETSAH
438,374,693 *2C694B07A518BCFA9B0E3117C3D0B37C853B9B88 rattentore
438,374,694 *2C6CBC856691F4ABA9421B6D8D1EC01408CA02CE mdb123
438,374,695 *2C6BFAB464782AD194CA73B14814390E8552F859 MEDICALI1
438,374,696 *2C6E0A05A866D16387DDCC216875AD31607C4B17 MEDINILL0
438,374,697 *2C6710C75D94BC71F1ED30888F9AD30CB2676E35 REGITHCALEFFOTS0
438,374,698 *2C629D498C17A7EB8E7D6E400EDC7DABAB9805E5 REHOSPITALIZE
438,374,699 *2C63604AFC5FFF35F69A70A9CA3E0AAD846CF7A6 mercurialization4
438,374,700 *2C6272B98CFBDF2484BC4DCDE3FAEB4150E48568 RENTA-MILITARY
438,374,701 *2C6A50B44D472D37D0DF8AA81101611291A258D1 REOVKAAZ6
438,374,702 *2C6EE216A284AAD244BBD19E8635E50B3904510B REPRODUKTIVNU0
438,374,703 *2C6203ABC5E3E5DC10F8DCF592D54618F1E6B721 RETILLVERKAED3
438,374,704 *2C6ECC346BE9F4DE7C2A0B0768D45081725A7026 RETROTEM5
438,374,705 *2C61590C0FB5C23DF26969E51484C41F5DAD43B4 MIKE.ALHUSSEINI
438,374,706 *2C652510DF0667580E5964AB7D17ED35BE232E1A RHAP50D57
438,374,707 *2C6E914020819F34123BB15BB4BD18DB2CCFC001 MILAN.TERRIBLE
438,374,708 *2C6A00F9D12FD3AA6771716079129138DC99D040 RICKETTSIOSIS
438,374,709 *2C60DD63531ADDB17AE7B43DDBE1DB6CFA6D466A risccsirs
438,374,710 *2C68D040C4BA04C188096CAD3B11A249FB559889 RLAPPUNGS
438,374,711 *2C6BB19950EAD1FD4968E5517A9C7777B68D3329 [email protected]
438,374,712 *2C6F491752DAC8DD8F40551550BC5CF9EBAC4D6F RMCUCXHD24
438,374,713 *2C67051E6E1A3AE83493869A10AED5545595E70C rn03401979
438,374,714 *2C66C108E8C4C92A2A4E69A9625D1917E55B5580 ROBERT TOOKER
438,374,715 *2C6639148107AB1A5E432AECE9C5706B24B413D2 MOMISONE
438,374,716 *2C65BCA5FC2C6C7198C8347F3A759C67AD3CA1EF robtdiers
438,374,717 *2C6F9E9F45BCCCA3A87640AE71FF743906BC452A monoprogramado
438,374,718 *2C689BA9560885BB0F04D23CE809FA3C1AC9A482 montganym
438,374,719 *2C6368FC2471C5EA00613CB617FA4EEE16F65CE0 rolandrimes
438,374,720 *2C61B1FDFA156CA6116005E4C158B17135603A25 rolfvanderweel
438,374,721 *2C665555F6FDDB47D83FE2BCA4D96B74E6687B32 [email protected]
438,374,722 *2C6FC8600FAD9EBEC8B7DC5FF7359EDC7120A516 RONEL.JIMENEZ
438,374,723 *2C6C4A6A0AF925F5589885E2AEA95BE05EEC3F2F ronnielarose
438,374,724 *2C643EECD981EFB003B8CAB2835018579C50CE9A ROOSEVELTRADFORD
438,374,725 *2C6EC97DB52D570A86CB442571AAA7ED38D4588D roscoegresl
438,374,726 *2C6807B268C1426B68C798BD7553EAA411E4B67A roscoekoeing
438,374,727 *2C614AF5914C498FBB496FF291920D3CFCA522B3 rosencranz123
438,374,728 *2C6AB20D0DA962A921FACDE0B099F22B9B1822F5 rovinred
438,374,729 *2C6D83847403A7A3FBB1D68C4B6735D2333909BC MYBIGMAC81
438,374,730 *2C62105EDC384469A8A48E30B9A156129EBD30D2 RTERKAKE6
438,374,731 *2C6AB3EF8C55E88B3A7BA7F6F06E8C404842A185 russet0
438,374,732 *2C650A7A46E1209F65BDA11244C3E1DFD0C1DE08 nalaspued
438,374,733 *2C6F8D978C1F4D3660E1F2E56C76FD1025F0AC07 S83218
438,374,734 *2C6BD1E3DC0040B688630F5170E2CECFCA714F9F [email protected]:wally
438,374,735 *2C68C0556E2D5380167141D3E7E8760460CE50D9 nbunkie
438,374,736 *2C6589B8914C22529E6014CE1121F8AEC8925C00 NDURCHZUFÜHREN
438,374,737 *2C67F265B4A17DBC908BA0403ECF5CD912DE23BA SALGUODC
438,374,738 *2C6253D54B354021E6346914F254D812233462F3 SAMENGEFLANST!
438,374,739 *2C62305FB8880D52AB540F98107345B445160B70 san.diegosolicitados
438,374,740 *2C6BDC0D431AC6C059E1C8C4A88CF249A0FFB31C SANDYBETTINGER
438,374,741 *2C6437AC8DBF61A7CEE5D34D4175B7FDD09F0C04 SANFORD.PICKELSIMER
438,374,742 *2C623FC54FD23309E243630B86A27FA0200B245D santosh.bhoyar
438,374,743 *2C60491A939CC5B3E26BC2D0F8023293E95EF47D [email protected]
438,374,744 *2C6868A8D0DA63E001D659EAF21E8B0B0ED718F5 sarcasticidealist's
438,374,745 *2C6A2CDA51A17ACD952BBADABAD6EC5547823FD0 [email protected]
438,374,746 *2C6CCA0BBF8231885837032992067B152F718B37 sastise
438,374,747 *2C6793AD82E4A1144433E9967FBBA789A52AEFD2 SATEIKSA
438,374,748 *2C64D0D81DA11B91594E30E8D9046B65E2DC86A9 SATURDAYNIGHT2003(VILLAREMIX)
438,374,749 *2C68C05A35BC90B3176409E3C6493D9A8EC02AD4 SCOLASAURI
438,374,750 *2C6F80AE7DBA05DD4D52445BDFB6F337C8560312 SCOTDUNGEE
438,374,751 *2C69692755D2ECA2E19E0E5605531860502D7929 SDNEREDLEHREV2
438,374,752 *2C6A1963A046B83C3E280511C4C7AB0CC0DD84B9 NOOB..I
438,374,753 *2C6CE0964CE4D460E8A54B877B0623A0CC17EA41 SEAN.OLNICK
438,374,754 *2C6F7EA960378470655ACE2BD16153C146999CDC See.How.I.Smile
438,374,755 *2C6BF62BF5853556A73C4163F9B52A6FAE5FFFEC se-josta-haaveillaan
438,374,756 *2C6ABB7123D5BFCDD64EB374A2BFA36EB3FE00EC senigalitrac
438,374,757 *2C6F04F4E3C24579473E73CB2033E51FE995CAC4 SEVERNER
438,374,758 *2C69693DFFC3846BD8945015FDFA09F43D11FE71 nqp
438,374,759 *2C61143983B2B61BD7E289CE035CC33A650A96EA OBPROBE6
438,374,760 *2C6E06BD38C2DE39CF6E45D15BF49555CA8275AF SHELAMENTS8
438,374,761 *2C682AA43ABF398CADDEB44646D384BBC6E54B25 [email protected]
438,374,762 *2C673F24A5D0ADC283835F36CDB5ACAA0D04E59A sherwooddenet
438,374,763 *2C605A8586323E41F665174442E9D5D5B01EC92F OFT-INSUBSTANTIAL
438,374,764 *2C67644895E5F39A1991BAF40073A8F9EF849A0B OHUSKERS9
438,374,765 *2C66C0D703934FD84E1259E5D04CB9783EAD76E1 SiriAtma
438,374,766 *2C65351E2EDC9DAA4842027D2AC46872C2985C87 SLABOUMNIM3
438,374,767 *2C6AEDC9A9DA882712E4CF4985FD7FF1B3CCED29 SLITJANED
438,374,768 *2C652130FB4ABFFFE92836C6CC37697FB51A5B30 PAGINOLA
438,374,769 *2C6C14952B7F319A20832EF35CC13392B4D1C2F7 PALMER.STEFANICK
438,374,770 *2C68700533093F68FD5157DD756E1B172A3C4011 SPACESTATEAUTOCOLLAP
438,374,771 *2C63A4B99D2EB255E682DAC7F115C04B00B19BDE PAPER-IN-MY-SHOE
438,374,772 *2C62572DB63641CBE910A6E0807CE5241CA92D48 PASHA - EINS, ZWEI, SORRY, TUT MIR LEID
438,374,773 *2C670A90D751611A32E712272183A2E9ABC51153 PASKVAN
438,374,774 *2C6B352A03411D2FEB3964048635B7472483430C patriciayounkers
438,374,775 *2C64B77798A75B7DC7357DE1F1EB4102D91D2E93 SPLAT.*.*.(3
438,374,776 *2C62B558B665D8DE909C680C3B2EF4DAC5260567 pedophilescourtingmothersonlinetogettochildren
438,374,777 *2C67BAF7449BB949EA0AE7D0F02CF4363D941489 STALLDA1
438,374,778 *2C61FD95C0F5DBF14142F74C6EE80AC684E590A3 stevenwolffe
438,374,779 *2C65311D8A04A23C91CD2AB794CE2E3F75E219F2 Strimps-for-Badgerina
438,374,780 *2C63627BB5F71647C1EBCE19DB40B042754521CC perryvasudevan
438,374,781 *2C6EE808059364785E8F76742520CEE08AB2407B STUPIDHUMANZZ
438,374,782 *2C68177FC8470E327AB497C8B2FAC11A8AA0DE3A SUHANXIAN
438,374,783 *2C6D7EED0DC7C8C99D9EC3A3C266811E3DC5EE11 PHILLIESASSESSMENT
438,374,784 *2C63706322957BA5E2CE7B0D341D48D259B8023F pho7ographcally
438,374,785 *2C6FFA3629E4CD85922887B49C57F7EFB5CFF126 SYLVESTERSTEPPELLO
438,374,786 *2C6DB7AA50F1AB152E5E60FA539C411D57CB9922 PL4NKT0NI
438,374,787 *2C69D5F644849806FCDCE90A18524F2BAD75BECF p==>~O3B<-
438,374,788 *2C6714025495077EF1F7F1029AAB183FFFC53675 TALKLIBETTS
438,374,789 *2C67ABF481F758B3BE0FBE338A908AB7DD26F28A TALOUDELLISES2
438,374,790 *2C6311AFB831A0BB1AE9004E65FBB37BA3261013 P-----) ~O ~O (>_<)
438,374,791 *2C6FEFE9F20239F00857B0CF3B9DCD2A090DBB06 POPPY04
438,374,792 *2C6A601F5B91604E588084565DD0849305A18E95 PORFIRIODYLE
438,374,793 *2C60A15B44954C48263944D248F34261527342B1 PORTÁIG
438,374,794 *2C64E383FA3846331102FB09EC2C8FA58330856B TANNER.FOSTERVOLD
438,374,795 *2C6AB58221BD13077CB8CD23AE64F9E079B1F9A8 TANNERHAYNSWORTH
438,374,796 *2C6CC0D7F65C39F54647A33CF3A0B51DE6167FC2 [email protected]
438,374,797 *2C609415097C09EEF1F12068FDAE5C4898869040 TATTAOWING9
438,374,798 *2C6AC717EA55971B068009A53C43FFAA3D16D935 presidentthea
438,374,799 *2C60F83820A222D106925503968977A03E1E049E pretty-mama
438,374,800 *2C6B6E6E7DB8CAC7051840CEC11C52E75E79B87E PROJECTPARACHUTE.ORGPROJECTPARACHUTE
438,374,801 *2C6ADF16160E345F9D161B7BD11B0C6BBDFEC872 psanoma5
438,374,802 *2C68D8A48C09DC369FE522B26FE321662DC8D5A4 tfiztfiz
438,374,803 *2C600DAEB98E939D1CD72AF8923ECDA645DB8E4D theantares54
438,374,804 *2C67D7CE862969683D2E4F77F7E885F41EF88F38 QIFVN
438,374,805 *2C67F0D006ECDCB0FFD7D42544D7444E25825009 [email protected]
438,374,806 *2C64B2428BE7DA596319716C31C7FDBDC0A4B492 The-Ghost-of-You-Lingers
438,374,807 *2C6CCAB85BB208856AF8426EBA188A04B48006F6 qu4si-0be
438,374,808 *2C67CB71DC7F93CB06A188C13558951431CA9DDF QUENCHKREIS
438,374,809 *2C6896226A76AFC37B5D11EAD70DF86E24D39CE4 QUINTIN.BITZ
438,374,810 *2C6E3E09E8BC47F5503F905F29BEC9448C094A50 quintonquon
438,374,811 *2C6379FCD0143FF1F982FDC9BEB8C96A6E6B5275 r34$$0ci47i0n
438,374,812 *2C6B6E15B944D71D7DA42D83992EDF51B9D99AB3 ranger.'r/ei/n/dz//@/r
438,374,813 *2C676027351935E3760431FCF6B82599D5E8DADB ti/b
438,374,814 *2C6E97AF0A3C5AF521DCCC6BEF990F0E68AF2550 REALSTEIGERUNG
438,374,815 *2C6F731C7B45932E5FB2CDFA5573133827290F0C REDEHYN
438,374,816 *2C64FBF3E54DDFB884452537E05BE5CC208805B9 REFUGIOPISCOPO
438,374,817 *2C6730276C3662874AA0A33D188ECF2F3B237F6A REGELLOZE0
438,374,818 *2C681C9C53694CED4954D1A6E1E2262A94BF17ED REMLYAAHTREB
438,374,819 *2C694BF18644266DEF331ACD9846A62010E360FD RENEWING
438,374,820 *2C6E093ADFE19CD1CE82FFD0F72DDAB9A675C16C TOILETPAPIRHOLDERE1
438,374,821 *2C6F79EA71C6FAF74545B678C12B09E0DF46D4FE TOOTSIECHIQUITA5
438,374,822 *2C6D4E315B7BF03E5F2A40C17228C4213D41DB44 REYNALDOGRANFIELD
438,374,823 *2C645BF442CD3717FE64172B049020846D3EE275 REYNALDOSASNETT
438,374,824 *2C6166CCE218D18BF3744C648803B8C01C85C021 riakennedy
438,374,825 *2C6559516C9C8306B1573BA2A1451A18849DDA73 RIPMOSES14
438,374,826 *2C6E5CC7A295E84795363ABF56D48B587F52C69C [email protected]
438,374,827 *2C6E2F4A2EEE4A4DFC861F33057D0F6EE01E3CF7 RMEBESTA6
438,374,828 *2C6B1D9392C997FD9A07843EDBCEA92B9C325590 TRAVIS.BEAUMAN
438,374,829 *2C6DE2BE0CB2BCFCDDC378516E6B881C34608D7E robbieeades
438,374,830 *2C61B9F58A05081D6071B847871934A3872DE2D7 ROBERTSTANESCU
438,374,831 *2C65886E839C3B8D98CFF69DDAFE522820F38BCB ROC-WELLS
438,374,832 *2C6CB65B73AB147E6A50B7CD5CA8FC2E3A78BD01 rodgerkingston
438,374,833 *2C6F6DEC394FA86776687B3E982A7164B39F7FF6 RODNEYGRISSET
438,374,834 *2C67C33FA4E9CAEA3DAC6DD59CBF8B4D84AFB129 triono3:iilarghetto
438,374,835 *2C64F644E16E0255DD0405FCDA6DE6B55B616D95 rodrickrineer
438,374,836 *2C65FA797C0683ABAA55BD092982197A033DE571 trix-morao
438,374,837 *2C60EF0604C88273A5D4BB96DEDE7DEC71782027 TROUBLENIMROD
438,374,838 *2C6853111EE38F1D92FC9E6E067BC74A241510F6 ROLLANDRIPOLL
438,374,839 *2C63C6F9887C81F8AFE8C7AB5789725EE13427BD TRUYỆN-NGẮN
438,374,840 *2C6AF4A8574AE0F88E7FB628FF8096269533F2F8 TSELENG-DANIEL
438,374,841 *2C6ABB261877AF82EB7DA1169E713218EE7B9A61 RONALDGREGORY6
438,374,842 *2C6FE1C8F64861C42E95776C446C60F862ECD710 RONDA HATTON
438,374,843 *2C6C0A672EFD943D076BE08267FD1E1DDB8937B7 TT1364465
438,374,844 *2C6B4F054F62F131DBE0562402E8D323F2D5277D rosarioklun
438,374,845 *2C6CC584A85C2D14FF845353B7E27BD6A0C17D0A ROTAGTORRAP
438,374,846 *2C68EFBBC23DEAA25370F4A91F1CA7F32E01678A ROXANNE JACKSON
438,374,847 *2C65B3934DE58BC3B80780D6930083120A236AA5 ROYALWYCOFF
438,374,848 *2C666B32E2F8BBD8DFF8A57D6F7E43A63F62E066 rufusphare
438,374,849 *2C610A326BED31B9DC52F4EFC5021FA5DBD4250A tzenu
438,374,850 *2C61CBB3E25F29FA8412293F6352BE47FE50D3E6 RUSSELZABLONSKI
438,374,851 *2C6BD7BE015FA97C6053F52FCB7945BFB887FC61 rutuja.kamat
438,374,852 *2C680FD3BB9884FB0AD0F75337DBBCB867EA499F RWQEFRCP61
438,374,853 *2C621B6E95439A3D92B7BB8935C62986F06D3E17 RYKSĄ
438,374,854 *2C6F0320718D40F933B8DCDC88E086B17FCA7E87 S77602
438,374,855 *2C6D70985A866AA57E32172264A3AB0541EB01BD saboneses
438,374,856 *2C67E8D6922D332A5E9C12769203E11FD7705A7F SALMONINDIGO
438,374,857 *2C6210332FF003C26853032CB02F2E86A571370C sanfordmehelich
438,374,858 *2C664B9596169328A43E3ED6EFE11115254BBA9B SAN.GREGORIO.DE.NIQU
438,374,859 *2C6D76E66B7F7277F98D04FE2EBA8DCB74E28165 SANTA-CRUZ-GLBTIQ-PRIDE
438,374,860 *2C6E22FEA2EE9B2BAFF28DA783AEE2F9CE638A43 SARVABHOMA
438,374,861 *2C69FD70795CFBCACF648FCD9705FD4A0B8148EA [email protected]
438,374,862 *2C6464CF9440992BFE2E20677AE51A7C00774B9D SCOREM
438,374,863 *2C68D8EC9752B293F9716DEB54E3C8CCC2A7BEC7 SEFRZAN
438,374,864 *2C64DE9F336A3C35FBF545082D91BEE3CA56C093 SEMSOA
438,374,865 *2C63643168300F29D2D72005BCC05810FE7539DC sgomentate
438,374,866 *2C649ED35BA1D6AF914D7C2DBD0DC8E9B463AF05 ustarabbed
438,374,867 *2C6510B63849C9E04D18A7DB886CEC7121AB6EF3 [email protected]
438,374,868 *2C697356D5FC6804EA17AA1F6EA09F45816CB208 SHESLOWBSW5
438,374,869 *2C6D4B9D72A57B1FF43E7799D380B0CE792B903C SHIONOMI
438,374,870 *2C6D065A1582E84FFC04B0ED090A5F5C532F0693 shortcut-18
438,374,871 *2C695C0E7E72D2CB137785D9BA472573B90AC38A SIDNEYMCCASKILL
438,374,872 *2C60B2A33B6122DEE539129F74E246591D27193C VANDENBOOMENED
438,374,873 *2C6E608F92B69E8819E0415C84964CECDFFB645C SILLYLOL6
438,374,874 *2C6C17DAF97F3F76563AFD095115649F77AC8A9C VEDIVACHANCOIL
438,374,875 *2C6B449DBF670F64244D5AF2C1BE3CE30091CAC2 SÍPOT
438,374,876 *2C6FF9447CAB54ECB1672C3A60BC30261564D6F6 VEREHRENSWERTEREN
438,374,877 *2C668F774F301B31DB7FE6041F2770C89C3B5B74 SKRIFTF0R
438,374,878 *2C6238E127CBF81A37809D6E95AFFBBFBE58E662 [email protected]
438,374,879 *2C6000E8ED8AAEC99B5BBB993DF12674C5BAE19A VERSPRINGT4
438,374,880 *2C67D35A9C6CBAA3EC05F5F1D8CE5B00CA287BB0 VIIX VIVIAN
438,374,881 *2C66F0EC3678313FB9082C7973B2017BF9D43804 SOL.KUMAR
438,374,882 *2C6EFD315EC3504E6D0AC57ED128893B6ABF7FC0 SONIA CALLEJO
438,374,883 *2C69BD0271D92158A3E92CCFE133FE3A5A3E3C46 SONNYCURI
438,374,884 *2C6C9AF0754B1AB21190E2BBCB85BA72094F9906 SOTNEIMANICEPME
438,374,885 *2C69623432CC5240778AC0802F409EBE611FCD66 vivianna-marroquin
438,374,886 *2C6297AFE1F4FBABCAF71A8DEC97A6D226AC5081 VLAXONIKOLEA MARIA
438,374,887 *2C65CBD5EDD5CC78D3742C3762FC6DE4F0CE0D18 vmyepxvn32
438,374,888 *2C64AD4EBD60ADBF92DE4B6400B6B8B8A1E7991D splat ~ ` <----3
438,374,889 *2C6C41AD39C4345EDCA95978431AE29881DD1695 W65EIFDPRT
438,374,890 *2C6A5DA6D92CDB85412B4A08CDF0844356266BDC WALDOSPRANKLE
438,374,891 *2C6D5F99200D99E4181BDF7081AE88AAB2284F65 SRETIAWB!
438,374,892 *2C63CD3AB798B33C0714E080F75AE8B7E1E0F1D3 WALT SMEAD
438,374,893 *2C6246E7A14050034AFA3AE2E2B55CAF332122CB [email protected]
438,374,894 *2C62A3301BD1136D710873A637B1F00981F9F63D [email protected]
438,374,895 *2C619ACD15488A491EA7DE7D7DA8923E9141555A STACYLOVINGOOD
438,374,896 *2C6235A14340A616DF094C84DEEFCE65BB24D62B staticstrussex
438,374,897 *2C67ED23E60A1FBA3F4546355B42201FCAB5DD85 was.ist.musik.(instrumental)
438,374,898 *2C628B741007C1D18DCC83D5D9949F0166C07820 [email protected]
438,374,899 *2C6FAD7A191816825417AAA4E96995CA5F0277AF stephanie-principe
438,374,900 *2C6FEAB8795920615C97C5BB90EC96D3BB66649A stephenhobbie
438,374,901 *2C68ED4FAA91E6B95B974F359BC8EE32458409BE STEPNAMEBSWS
438,374,902 *2C6ECDC22010E70EB3096F2DED7A6921608AF92B STEVE.CHALOUX
438,374,903 *2C61117A248C5E3026EE342105D8D82884CAE107 WESLEYKOLTRIDER
438,374,904 *2C6D6F1D209BB38D177E6827955F1C0A0058B9CC WHASHT
438,374,905 *2C6AEF160E1089D3DFCCB15CE79E7549C2C09D2E WHATISMORECORDIALNAY,IPRETHEE,TAKEIT;
438,374,906 *2C6BF8C36F5B610C2A4FC3276B179B90DEC4F145 STROPERIGES7
438,374,907 *2C658CE3B102B8D702BDE48F1DA42D8D7FABB321 STYGGESTES2
438,374,908 *2C67CE6E8373AEC082658BA3AD518395CF01071A WI1FU1N3$$
438,374,909 *2C6478452D7233AB563FB84F1E92D9470974CD2C SUCEMOI8
438,374,910 *2C6F0D800FDEC0C3E111EE822BBDA7E850A08E78 [email protected]
438,374,911 *2C60C39C0E7152FAD94863FA21E4B955950E1C61 WILLIAM.MARTY.MIRACLE
438,374,912 *2C67A1161DB56176DDC4603F5A4BFE7B93F32F6F superiortermitecomwww
438,374,913 *2C6DA5FAFE5EB4C15CD0BBA5C26EB2DFE7CA98DD WILLIAMSDANCEY
438,374,914 *2C6DB058B0CC7352E03D678D8D6D80F58348D106 willianmcelvaine
438,374,915 *2C64C100AB9D0B176E8770B3C28618054A2D390F WILLIE.PANGILINAN
438,374,916 *2C66B0B7D041A5CC421AF48D2CA82403914A3F3F winniefred-chong
438,374,917 *2C6EFE0110D3661D0E0E8BB9E9026B1C5974AB39 SynphoniaNo1,BWV797
438,374,918 *2C6E8FF2C136ED227BC842DE7A542C4DDF5B2BFB [email protected]
438,374,919 *2C67FC305BD8490B95A9BBF312965CBA92D52767 [email protected]
438,374,920 *2C6E7FBC3C26B7B3A08CEEBEF83875DE4CA3CE50 W"<W
438,374,921 *2C6F5FE760914731CD632B9C2A39BFD2DAEBAA85 talk86112225133
438,374,922 *2C61D8665B06D553AB6F34BF19B2F65DB3FB2A45 WWWREALLIFEGIVINGORG
438,374,923 *2C6201F39EBF46703E1695529CB21438BF943B36 TALKRICOT
438,374,924 *2C692E122F51EF11B5B1341D5693867882FA7ACD WYNNIKA9
438,374,925 *2C64D355C69D001BD35AB68648212D10FF875DFE X8`+
438,374,926 *2C6A8E840C95FECBA289A9C95B7DBB3CD45D0F03 )x(~ ~ ~ (B
438,374,927 *2C62ED1BE5706042D42CEE97787CF45E24926535 [email protected]
438,374,928 *2C68E0BAEE43A56438AC8380EF5AF507E7384FCD TASHACHANEL6
438,374,929 *2C61DA567B50B3430286EB754982157C5ABC78C9 XEYHNOJS8
438,374,930 *2C6640FE9F3747A23499152C2E7C78D2AE37D446 [email protected]
438,374,931 *2C66C3381C5890A8B81FA5B63975E152DB72B083 TECHNNICOLOR
438,374,932 *2C601F21E4C8E18AEC2DBA120C5BD6E71AD02770 XIR]
438,374,933 *2C6ABBC11700F5D0AEB9F8D7722D78E33FC02D09 TEKARM
438,374,934 *2C69041A57D753E1179D02C3E12CFA3253A4D4BD TEMPERATURE‎
438,374,935 *2C6370A3D7D0651CB8DC2FCD200A40CB9C5BDE20 TERBOLENCS
438,374,936 *2C63810583617F99C1BCCCDC9E9DDAA906C3676F TERRANCE.KAETZEL
438,374,937 *2C60CEE94828DBCF78BBA002724EAF8AE296E557 TERRATORIES
438,374,938 *2C695A201DBEE3551E298C576C9BF94D9D7D8F6F yahodit-oved
438,374,939 *2C6964EF6A414AD584CFEC8B16246029909C4D39 THANHGOTTWALD
438,374,940 *2C6C0CFC5A8F6FBB785712F6E1074A88546B9F48 THATCOCACOLAQWER
438,374,941 *2C6A5FCA8B1A093872BC4BDA5602336C0DC4C3DD YETMEZMI?
438,374,942 *2C62AEE195B0E68BC025A19A41D900E038BA75A1 YIUCTFSCMZUH2
438,374,943 *2C679D5306A4ACBB5F9CC256721D71EB82026F50 the.love.you.bring.me
438,374,944 *2C670D7DB3D57F6868C17B98EF38D88554CD8F7E this.war.(2)
438,374,945 *2C6858829E4515A4FB26F85B53E2DD2F8229496E thorbj
438,374,946 *2C6070551D5885F2228BB72C4A101257BBB0AAC5 YUCONGCHE
438,374,947 *2C6E76611BBBA2E6B047EA4A6DFC2EDB7B410BAC YUKIKOABDULLAH
438,374,948 *2C61B5624824A93ADFD7BE64A4A73EB7A55B5246 yusef.salm
438,374,949 *2C6AAA37EDCFC6CE28AA3A57B43AAE50FA9FA594 TIERKORPERS2
438,374,950 *2C60580162602E0F56EAAE5633718939ADBF0E98 [email protected]
438,374,951 *2C6CAB512573C8E2A4E38F3144AF238807B121D2 [email protected]
438,374,952 *2C60DFF5BD31E1E8D1EB5E051425D9134A110563 timbrage3
438,374,953 *2C62619053EE9EF8847738C94EBE3CFF8FD07918 TINORIALPEREDHIL
438,374,954 *2C60CA3F8C7BC361C5DC741F11BEA2E81C9847B0 <TITLE>DIAGRAPHIC SUBSTUTION.HTML</TITLE>
438,374,955 *2C68B11C071885BF44F76A069EFACA9FC2E841BC ZAIRYOMAR
438,374,956 *2C6D842AFC1EC5DBE7A1C3709C8E70BBC7DCB5FA ZAOY0I
438,374,957 *2C6F959D24D733A158EA0402DDAC5A752ADA996B Z`BO
438,374,958 *2C67455271E5B9C484725C2E715454F3C2331B0A [email protected]
438,374,959 *2C69A8FA9510F3577668DDD7B11767DA528D3F1A [email protected]
438,374,960 *2C67B4DFCC8E03FA56CDED7BEAAF279F1D8DFC28 [email protected]
438,374,961 *2C60D3751FDA2181338B86F6F10D674D4B81ED00 TOELACHENS7
438,374,962 *2C6CC73D2EDE242B2053B963D232C572C5DC25E2 tomgomillion
438,374,963 *2C62470465E7FC8BAE4DBA494659BE35203F5A18 tomseegert
438,374,964 *2C6EBFC389C333BB45CB949E53A023E52629E402 [email protected]
438,374,965 *2C6B7212C852FC979B7360FD29EB171FEEC8A6EE z^s$
438,374,966 *2C6B74087BC735E0A6594940B086C9EF22CCB7D5 TRACY-VANHOOSE
438,374,967 *2C63EAB80AE93FC8DB8108EB683BB2BB12316964 TRANSMISSIONTECHNOLOGY
438,374,968 *2C6C2676F89D45BD49DFB23DE71E5B9B4A329338 ΔΥΣΚΌΜΙΣΤΟΣ
438,374,969 *2C6C5524D0A507881D109D18FBFA43600FCD0733 TRAVELING.IN.TIME
438,374,970 *2C6CD12BC51ADE2E4EF8537F9C4206B87001C7DB ГУМЭЧИ
438,374,971 *2C6A2F827403E7DB34C0F342C2F7B0211D1D38CC TRINIDAD.OUTHOUSE
438,374,972 *2C68D94EEFC2BE647FA8183D3539939A76A61F57 камыштау
438,374,973 *2C6053C3D42C758EC05E05F65E9AB0F303E0FB8A troncavade
438,374,974 *2C6236043DF7EBA6170D93838BFFF7AE57A8081A trumanlenigan
438,374,975 *2C6B6F62BBD2B9D23A924C21EAB263D4ABD9B5F0 TRVR1941
438,374,976 *2C60352797F133D84FD9E24C3495422EB45B8C16 TSCOUNT
438,374,977 *2C6D889515A24D65D1BB619EE587141B73FFACE4 tuna-walk
438,374,978 *2C6F3B5F94C40CACF47DC0B24C380648E3364AF1 TURKOLOGIJU8
438,374,979 *2C6F125982AD76C90D623F00AF5130DEE9907099 [email protected]
438,374,980 *2C686CD6A002C080272D1FCE66FDE13848B0413F TYLERHAGINS
438,374,981 *2C6DB35DF51C204492AFF6607627910EE6614F54 TYOERYHMAESTAE
438,374,982 *2C6B9E60024B900E78008A1401C7C96A24620875 UBORDEAUX
438,374,983 *2C698FAE996D275C96C606467DB0A741196A7C1F ufppkawvogc
438,374,984 *2C6F4F873CD37936D1866AC21D9BF492497B44FC UNBUDGEABLENESS?
438,374,985 *2C677C1654ECA21B4D2322445DE3B7A0701D8449 USPRAVNIJOJ8
438,374,986 *2C6F0555CDA009A6B23BACFD610FC6D6FB0C27F5 UTG[
438,374,987 *2C6585D380B89EF5DA17E74D472A2AD0EDF03322 uzeqecabufac
438,374,988 *2C694BA9416921A3958B66A1ACAA9A228C9B82C5 [email protected]/4
438,374,989 *2C6BBEFB9948A8F5AAE7D8373E4F5771207D1A81 VALENHEDSING
438,374,990 *2C6BFD86DD49F3EAEAF3C9444DA56CABB4F6EF14 VALENTINA OFEI
438,374,991 *2C6E0BA8D0060CA1A5859A665DE8BCA4E4B88D13 valentinvlloa
438,374,992 *2C66BCECE7A922DDB5EB105552F7346AD072CD16 VALERIE.K.NIESET
438,374,993 *2C65AF42DBD13669332867E5A7D210E830A78DBB van.balam
438,374,994 *2C6F6FDB36561EE62360B12BA7379DE0576380F8 V'BV
438,374,995 *2C63E340AAD7F94F6AA7B01360799476DA848119 VERBOS-HATER
438,374,996 *2C6ECFB747D2B4208E41B1468488A3623585633C [email protected]
438,374,997 *2C684E10A86044F1F5FDB306D27E11D55950AC96 VICKIENICKEL
438,374,998 *2C699D28414FA4CD23391B45FDCA852F9E5232AF VIIRAAVIIPSITAH5
438,374,999 *2C63F62BDCDFB3C8359D171A054E54479D035256 vijd
438,375,000 *2C6C891A87C7CE177989AC741D3A7B2C063FFB55 VINCENT.BRAMWELL
438,375,001 *2C6A51FB16B0B8E5A6495BF2DE45E3EFBB569F1E VIVIAN.VICKY.WAI
438,375,002 *2C6FBED8F8C830B9259A1CEA7E9BB4706BE142A8 VLASTA ALB
438,375,003 *2C654A199AAF0985122701C10523A10E2EA2C186 volcados4
438,375,004 *2C6CB22F345F11E257F3F637B7B2D6DBD090AB46 vvvf2021
438,375,005 *2C603C31E082120FB8D0552EFB9EB742094AC23B WALIDELSHAREIF
438,375,006 *2C6E7CDF10869C799A64EC7FD2421F3F8283D4F5 wardalai
438,375,007 *2C6F8243A9F4C1253E41503F7CFEC736DEB24022 WARD.SEU
438,375,008 *2C6547611A897712673E2F7AAFA0FCEF06B9490D 038BRIANA
438,375,009 *2C6A4632924F13709D6B67012754F91DB77D76E6 0iamwinter9
438,375,010 *2C6FC6A038F00DB8EA6F778EEFA449D97004B2A4 (_0)[email protected]
438,375,011 *2C6A92DBCEDCD89E0926A602CA55D81BCB792948 10061608
438,375,012 *2C61BCE0E95D2C7C1F06797DD0A18F5E54FCDE1C [email protected]
438,375,013 *2C6D229FD503430885472418D90B64F806883CCE [email protected]
438,375,014 *2C644C497E1DD6CDBDB4A8B1317B3DF0BE6D3821 [email protected]
438,375,015 *2C60FDF0C9D60167C14BA60C39887DBA964BE7E1 [email protected]
438,375,016 *2C6B4021CD41391DAC42AF16C124E1D7D084DEC6 1162024 haws7001(kuva)silm
438,375,017 *2C61E9C6747E92F9C43F962CB5EA73382DF19F9C 1179912 KITARISTI S
438,375,018 *2C654027E586B45DF24A5F34DA3DB9F04A4C238F white.horse.(vs..laid.back)
438,375,019 *2C66FA1603981BAEEB64875CFF05F6647BAFD6BE 120SS
438,375,020 *2C6FC882BBC6743F4FEC835CD71F08621C31EF7C WILLARD.BOLITHO
438,375,021 *2C6D025F4C41DDC42D72DE6BDD8B346CCFFBDEA0 WILLARD.MUGLESTON
438,375,022 *2C6E513E0543B5BA6E32B69EB462926B413EB11E [email protected]
438,375,023 *2C6C0E2C751A89C5CB1A5912FB179DD8EABB3CB2 will.steichen
438,375,024 *2C6054E61057F78E3D9347F32812AD7411ADEB22 WINAMANA
438,375,025 *2C6283F3103FDA31D27EE698F52A60ED187D7A32 winfordgoossens
438,375,026 *2C669967B2C58BA71935005F1056544766BBBCA6 170-kehitell
438,375,027 *2C61D691E963BD71E4E835297C29213C7041EF0C WKAAN
438,375,028 *2C67EBB7088AC19E16CEC8E7A925DF5E93B01087 [email protected]
438,375,029 *2C62E8DBD14EEAC022188CB05EFBA08C0BA8EFA3 1873800 THIS-IS-REPORTED-IN-NEW-YORK-AS-A-'-DISTRACTION-'-
438,375,030 *2C6166E8A43D0E23F05F6EA1CAF37263D6E36FE6 worksheds
438,375,031 *2C6F00883B22DDA9211E0C8358B0B67E0A203ECA [email protected]
438,375,032 *2C6B2BAC2EF8E277A7BC03B8BBEA956E7B254039 WWW.RESIDENCEINNSD.COM
438,375,033 *2C62281CA6BA4207184F895C583C27D5A141743C 1CHAIRLIS
438,375,034 *2C61C807828C0B9D2FCC9FAFEDF354D4D97E4F22 [email protected]
438,375,035 *2C6C4DD129E9291F73BF6222F6D0594072CE2877 )X(-0~Q======P
438,375,036 *2C6EDF8D451D1B867F7C6984636B6AA2D632272B X89914
438,375,037 *2C6DA44353EB078C1AF1DD927732F8F801CA31FF 1FIDANZATE
438,375,038 *2C6581DF08E4205F4EB0511902FFC485B8DE8B22 1hein
438,375,039 *2C6471155689F621AC3CCA1001B3EAD14A4BB3CE [email protected]
438,375,040 *2C6FD16BF3D74CD30498050BCE60C2552F206C78 XNGCH
438,375,041 *2C62CAC97A680E75C78C074DAB360CEF855AF242 1 KAAOSMAISTEN
438,375,042 *2C6BA14B9257DD6CC012260287542B8D0F00E727 1 kiertom
438,375,043 *2C6F5CCA7361FDFFCB38C5BFA3C065B1E525D30B 1mmdhd
438,375,044 *2C641FEEA69FF632F092FA88ACB776A7AC8D5DB5 Y898UPP
438,375,045 *2C604E72C7C7255A03F6F82840EA8008A13642DA 1mychronos3
438,375,046 *2C6B1F94F4AEB805D1A9D0E4488F8996531A7F6C 1.NONTAPERPRODUCED
438,375,047 *2C6920FC720EE53620112B38D9D447FA8F0E0653 1-NOSTAMALLE
438,375,048 *2C6A639AC25775995B6A031158DFB122DC42F190 1.NUKLEAR-TESTS
438,375,049 *2C60AAD826CF87EA349D9F59626F2550D5ACE144 1nullspesen
438,375,050 *2C65E9B711363A40A1A7B8CF6A0768382B25A43E [email protected]
438,375,051 *2C6125E415B16A24EC2C7D91A597510F1118921F YAXIWACAKOMU
438,375,052 *2C604BBEE6343DD1A2C6CC64FF0005D6A1C6A058 1 PROPAGANDAAUFNAHMEN
438,375,053 *2C62BE062DBBCAECCB1021F51DA928D1FF30FAFB YELEUSSINO
438,375,054 *2C6D8D16E2D47EE15F6D9B877DF43BF293D9D8B9 1THEDAPHNE7
438,375,055 *2C63B77F04EB07A1C082A3F3B2CF81C01D5991C2 1.YAYGINLASACAGINA
438,375,056 *2C621767F3018278F7FB5A1DE4B254F9D2759E81 20080718ARTFIG00279
438,375,057 *2C61515FF35CBC2E75F1A0CDD70D64B6A88B962F 2019182 t
438,375,058 *2C6C7CCB862FEA302DA53E6CAF16E6F5F9396FEB YODDHY PRATAMA OLIVARY
438,375,059 *2C651F5B2CA31467C7C8DDA9734AD0D42411DE70 YÖNELIKTIRLER
438,375,060 *2C6B513F5F8443E443425ABE064BED2D4AB345B6 YOSEFAANDAVI ENGLARD
438,375,061 *2C62834DD7F3666C98D564443E8AD0B4F052CA45 2106447 hyvi
438,375,062 *2C6FCE617C165ABFFAE3993479CA336776C049E1 YOUJASPER
438,375,063 *2C6B66AEE1AD8F11637F5451F4661FC688CD3650 2141642 ERILAISET.KANSANLIIKKEET.OVAT.ALKANEET.TOIMIA.TY
438,375,064 *2C61CDC85A2BB3CF7DE236EAAA08A73696670094 2154838 WEIL SIE MEINEN , KOHL DEN EURO ZU VERDANKEN
438,375,065 *2C6BD1084572809F65EBBAAA0F4E00DEB9ED89C2 YTHEBSW6
438,375,066 *2C694E4BC1E1FD626051938F1B8D76ACB113F1B1 yudelis-rodriguez
438,375,067 *2C6A215E8751F89BF1267F1D7A83DB90D6FBD381 YUJI-ASAKUSA
438,375,068 *2C6B63FDDDF723F8D1E8E266AB57339C201C1346 yurykozhevnikov
438,375,069 *2C66365E3117086CC02DB9755685AE34007EC474 [email protected]
438,375,070 *2C65EB97DBD83CDD623C4E5E9FFB18F758524411 2508064 JOKAIKINEN-TOIMITTAJA-ON-P
438,375,071 *2C6BEF790A1E298DCFE8CBA297CAFBE24E7D81BE 25.rechtskraeftiges
438,375,072 *2C69940F532EA2162769139D2D8B585FEABC0D80 ZAHRAABDULKADIR
438,375,073 *2C68E7BF4A12ADBD88BC4FCE18E796BDDF65EE7B ZASHA.ROSENDO
438,375,074 *2C6FEDBDA26B7658D74738BEE8ED9D612BD40AAC ZASKARZYL2
438,375,075 *2C6AFC8902C0581839AD686E29416A8D01634C71 2905536 SE-OLI-7-KM-P
438,375,076 *2C6603701643F542D48C0BC989C4B28D085C4D1E ZBB
438,375,077 *2C64265EE8F34267D8D034582E0078984D2C87DF 2974449 maksut voivat vaarantaa my
438,375,078 *2C6A307343D9C44ABCF65DAB891888A6D31BC6DC ZEDIUG
438,375,079 *2C63986477A23CAA296556E8139F7F02943CD91E 2ALLAGEK
438,375,080 *2C6482D9B807C510E928DDDC468BC78CA3389AFE ZGBE6R7A
438,375,081 *2C6AF58F13A1E7173BB30C51C4B776DE1D75648F 2FETOLOGIES
438,375,082 *2C6610DADFF68F3E97F5C2D4F0811A709295DB5F [email protected]
438,375,083 *2C63CA2E8567F49DBEC5946B48A5FF431D490A89 2.FULLSTOPBAND
438,375,084 *2C6BB20C3531388617C1BE1A64CAB6DC5308A0D6 2GOLDIGEN
438,375,085 *2C615737C9CBE3B0E90C63F1BF9BA144DB8770D1 2ILUVMERRILL8
438,375,086 *2C62CB47E9210696B532E19DC49C9B155CD0AED5 2LANTARENVIS
438,375,087 *2C68CB7741B11CB8E299C88E724F728455D95DC8 2menn
438,375,088 *2C6A376F8E7D9C47B0835FF0E2E2418BDA58E185 [email protected]
438,375,089 *2C6CF96D634BBC365AFF7C55FCCD4DFADB2E94FA ZNTSHOLO
438,375,090 *2C6A694A9AE13DB6656535338114E5E1FBE5C9B1 ZOE.ROSSER
438,375,091 *2C6E83DFE8D4E3349697625EE53468247C3E980A 2POPPETHEAD
438,375,092 *2C616CACE3B111C834D098009D412AA044FDA412 ZOKINJOJUVENTUS
438,375,093 *2C66F4DFC8018D9A7870E77468FF176BC20D72B2 ZSHANNON6
438,375,094 *2C604F378FFB1AE5B2BA6991D161A1E88394CEDF ZURINGZOUT1
438,375,095 *2C65FC125F010EDE9E427016EA8E3C5FB060319E “АЛЕКСАНДАР
438,375,096 *2C60C65C135FD633A55B4D72B85B19B814FC46E6 БРАФМАНОМ
438,375,097 *2C6E5E504588967AF995B8435E3A2396D1B03404 35sidewinder
438,375,098 *2C63E0CCF0F0D0D9DA657775938E69179F349152 384-mesafe
438,375,099 *2C6958E9893241FEA15334B2890D8D2242DA6619 38DD2436
438,375,100 *2C6A0AE5D76BE0D21E623BFEAE8331E2287809AB 3BACIATAS
438,375,101 *2C6D8B7F255750C7AB12F1D6574E75FDDB9F7BF1 3B<~ Q====3
438,375,102 *2C6F7094C311EF5C89AC1FC945719B5E49D731A6 КАНАПКИ
438,375,103 *2C65A715D5292AA994E4682C5292B6ACC1D61FBE љубишина
438,375,104 *2C6A4587D973785E2FB654E2E66ADE2292621FEA 3-LENTO-JULLE
438,375,105 *2C669ED1297B5BE1C783B320003ED031CB125DE7 3MELEQKO
438,375,106 *2C6FBF2F609F3EE0C7C67D0CF4F04EEE6239EE12 палоннай
438,375,107 *2C6690E1F78BACE664F88DD6D2C71676F430EB22 3-TAGESSCHAU-SPRECHERIN
438,375,108 *2C611EEDCBC801EAB24385CA03FB63C11FC0F091 3 TUKIP
438,375,109 *2C6335A992376D1E4432351820B3F01B781CDA17 3-VERKAUFSPRAKTIKEN
438,375,110 *2C62449FF37225A3A7756A604A436BDEC5A4E554 таинствам
438,375,111 *2C67A49725F51DAF9B8F571F8886C32871EBB272 483859 BU-ALAN-2001'DE-96.136-METREKAREYMIS-.
438,375,112 *2C619527853B1B7FD0C81ABED25CED0B875001F0 493010 SILTI.VOIDAAN.KYSY
438,375,113 *2C687EDC0C3AA0A7A75A3F0232E975F76C50A4E8 эвзоя
438,375,114 *2C6542E29EF5FD4DE8460CE63769209825F0D6AC 4KORINTIERBREV
438,375,115 *2C6A6D6CA6288A793DE8E53507BD91A84957A781 4.magistratsschreiben
438,375,116 *2C681C9D5FFC67CDB80CC60506BCDA9C8FA77E0D 4METNHAWR
438,375,117 *2C67CD898C3D59651B38B80BEC58830770E77D45 4PAPORAND
438,375,118 *2C665E1A864EAC23E60F625E212A721B55D1AF97 日本無線製で初めてフルブラウザ(NETFRONT)を搭載した、ストレート形端末。ビジネス向けを意識し、
438,375,119 *2C64618B9792F1A81C44E4A47A8D03938F391530 社のLP
438,375,120 *2C691B400E67CA2093E3BB32B961AFD45D6984F0 5AIDOIRIE
438,375,121 *2C619B493C37719220F12A3DAA9DC6511339A511 5ARENORTED
438,375,122 *2C6B36BF0F0C1091D6712C00C166A2EC7F46E70A ;\!
438,375,123 *2C66C19654C0C7B59B4D4B47607B1EDCDDC1A267 5GENESISCLOCLO
438,375,124 *2C6065949332195EDC4401464307E73274609DFA 5HASTEWITHOUT
438,375,125 *2C672D0CC4D73BF0C7FE314CB2F2ACE018A32539 5IAMLIVERPOOL8
438,375,126 *2C6ACF21E056F7E076059D4A76F10080E8723B48 5L3UT3LB3K
438,375,127 *2C6EAA2C4228B2DA7CF799B5B2458A099D609541 5.matsuba
438,375,128 *2C68823C13C5C96F614661FD341000EA55FD5403 0^]c0u8f0rjvc,j
438,375,129 *2C61614661443A994D7A02706D31909AF0E22F09 10AUG1962
438,375,130 *2C6616549A94E9A37F42091413A969D1F5BFA6CA 1137516 dieleutewarendaraufeinfachnichtvorbereitet.
438,375,131 *2C6DCC2360A045D089BB0D5E246A5F299A7D665E 1158469 voinko heitt
438,375,132 *2C6266EEF4C30BCCB5A0712F1F0A8A82CD8EA3C6 662POIU
438,375,133 *2C6238F80C055D88FEF9BF39B884B40B7F9B8FB3 1278993 MY
438,375,134 *2C64F7B14385936226999D8946F0C5A207107DD4 6BSWCITENIKBSW
438,375,135 *2C6C3BB778EECB10D92CD2AD6398B2ACC528CD37 6BSWSWEHOSKYBSW
438,375,136 *2C691C20775C39D44D2C7E819B3E72AFA6B42DAC 6CASCANUECES
438,375,137 *2C6B44F380007401C7B966AEF37236227F073011 6children1
438,375,138 *2C6671E1B8D231B8185C06ACFDD5B975743C9431 1700JOEBOUND
438,375,139 *2C6EC15BC1FD66280CE89990CFC0DDC113EAA1FA 6MFARMER
438,375,140 *2C6B65BE00F59A2D411CE0675A2D26052BE7CA6B 1.a-junnupelins
438,375,141 *2C63B0447944D3E2C57434B7689413F3C717198E 6oct1834
438,375,142 *2C61A8FEAB0C3CD7EB3C251CA1621C32C4CA1537 1 BIZQUARTALSBERICHT
438,375,143 *2C6A87218B09B9F467068B85E67E6817A6F0AA29 1.BIZQUARTALSBERICHT
438,375,144 *2C6369A931E64C4F9421A89C814E44FD439E8857 1BURLEART
438,375,145 *2C66FA851019A81CF8CE9E29E59AD55E85C02345 1buyukbakkalkoy
438,375,146 *2C666F848927BA76D40D7AE04139DE4ABF707CEC 6SDEMOOYBSW
438,375,147 *2C6A051E62EB38238F09D30CBBEAC1823C833882 1DEMACHER
438,375,148 *2C62062FDE045603246D1372912D72084C0E917E 6VNMANURD
438,375,149 *2C60668D0A347C6E2993F1A5B6DCFFA8790AB6F6 1.ETIYOPYALI
438,375,150 *2C64433108480502223763518EE8D092E1BB245C 706ED3AD-E129-3112-93E5-23FB75B7A26C
438,375,151 *2C6194924CE38F0712B733F56C4465C21992FF2A 70malini
438,375,152 *2C66811F726F7A572A8165938EF3E26B45765511 721671 DIE-ART-,-WIE-ES-RIECHT---UND-DANN-ERST-DER-GESCHMACK-.
438,375,153 *2C69C507A102F31B9FD0A67F39502AA2D4BEDF12 1GERAKEN
438,375,154 *2C6497FE776C76F120D8DA8D0320BF433D8CB696 1.HABSCHICK
438,375,155 *2C68D2EFB8F36F65B3FDC73C63B62F0C4B3D3686 1hein
438,375,156 *2C6E2BD00A4559098905FFBD00811608295FD49A 1iammatthew
438,375,157 *2C63E6D2156B9ECB48283631B732BFA8ACCB5374 1.KILPAILIJATIEDON
438,375,158 *2C6C2D139C1F7FB6EC1C52E447A4B918AA72CE5E 1longexposed
438,375,159 *2C651BA9B63204578441F13B349CAF8BABCAE1D3 7INTUENCE
438,375,160 *2C68CF60B81738B1080428A5C2A99E09FA892352 1MANIATAR
438,375,161 *2C608CAAB04581F9337A139065B1415724B646D3 7NEOISIVT
438,375,162 *2C6A3C0A6FB92CF719C77F5C069AF64EA3039023 1-rytmitetyst
438,375,163 *2C63B6DA2D82C662A6611B339DE5DF64F2DC58EA 1sampoj
438,375,164 *2C62424F0D69B6A7DC862EB48980E6792C07D1B1 1SASUN123
438,375,165 *2C64C7D23B921390B8CDF54E0FE32B6AA836F1E8 1.STIFTUNGSZIELE
438,375,166 *2C6EB0F0E093C329A28E946E0C59EEAC095BAF71 1 SUEDSUEDKONKURRENZ
438,375,167 *2C63856584083CB67E013B7AE17F904744BBBF57 1VANKEINHOITOJ
438,375,168 *2C62F424C210B4808E4B80B1AFA527AD84E156F2 1-WEGSANIERUNG
438,375,169 *2C667B368C529C52382EF006801A738C2EECDFC9 1-WORKERS-IT'S
438,375,170 *2C6A56662DD8E0CA20BBC122982CFD0A6B5472B9 2086142 kumppanuus on hyv
438,375,171 *2C6724C8E09CE52C16324DF50929C373B256A9ED 209XANDER
438,375,172 *2C6E6A3BCD9DB43B5FD25C3C4AB59EF2E343B9AC 21.schmieder
438,375,173 *2C60E5537D3DFF3052E96A400B42A0BC9E0F38B0 8=B ~0 ~OSPLAT!
438,375,174 *2C6F95B9B6CDDB7D67B6467D431CEBAAC9CD8A22 8FLETCHSCORPIO
438,375,175 *2C6B645047E4677AE2CC24FE67BEBAF88F391E84 8!GH0RN5
438,375,176 *2C63A034B64743AB91710BCE341E2075CF2690E2 8june1261
438,375,177 *2C653ECED32411D583B5B5737DB71EF8256555A5 8NATIELLO
438,375,178 *2C6D4BA9ED9285A5D4B7D7FAEABF713B7FB84441 2849831 palvelumme-on-laajentunut-ja-meit
438,375,179 *2C6C9D1C2B6D7E15CCC3A56BF28655887F908B49 28FEB1740
438,375,180 *2C6C69997AD4411E24B4E8B6EBEDB97EDF8502C3 29march1740
438,375,181 *2C63CD25438FF3769E8ECB66DF8FB486E9ED2A94 8SASSYCRAPP
438,375,182 *2C679ECEE715D866FC98000D51DEDA63412F665A 2 epstiedosto
438,375,183 *2C6F5EA3BEBAD763948A534B933012ADD6EA721C 8STRAVITELNEJSICH
438,375,184 *2C6942E40D72B8642FB4B9619ADA8987051CB94C 2EXGRENZE
438,375,185 *2C6B5315D42F10FF815921F52D03D753DE9609B0 8sursemer
438,375,186 *2C6C7FB2397B7A0AE9E5E662076F39D3DD807D6F 8VZYAXVLXZG
438,375,187 *2C6D1CA423C01DE6B17D5A4120EF5EF1EA4B4D81 2-laender-palette
438,375,188 *2C608338DC3B0FAFEA70EF0A38A565EE30F0679E 8XAAXUSHA
438,375,189 *2C655FCBDB5BE4C2AC7275CEBA1E2871B505DE9F 2.markaz
438,375,190 *2C6BC8E014808BF190DFFDBCD0CF06E9BE6D4E4C 2myyamaha6
438,375,191 *2C64AA7C19C5438F7047D44D352D5E8E8060D7A5 926FRANCO
438,375,192 *2C6988D3F8FBD27A32CDBD1BFD6D133736739959 2SPEISERA
438,375,193 *2C691A6DD7E96457D8CA36485A171B98DC0D4C31 9HOBBITDENALI
438,375,194 *2C6091C067317D3BC597DC310B8AAF86660BDD23 3------B**(>_0)
438,375,195 *2C66AFC836AF0D5C00EE71406FB72235DBEDBE61 3DEIRUBNU
438,375,196 *2C6026389C83A179F52364E33C856B45E424F28A 9RAILROADINGS
438,375,197 *2C666F6A8C76D103E70AE76112783E9B0068AEF4 9SATURNSTUPID
438,375,198 *2C6C4A47F0F88B3E534CF2D44C440D0B8BDB5751 9SFAMERESTIS
438,375,199 *2C65967A744A6840BCA2F787C5B49460A1DA3EDC 9SNOIREIRAPPA
438,375,200 *2C693E1AE47AA6CB84800500C5BB3E1ECD4DE551 9subcostae
438,375,201 *2C6787EDA61009E4783893FC2CF1668932B05693 a01k/
438,375,202 *2C6A6C8CF5884106D250592C27FE474973C2AE49 A0O;J
438,375,203 *2C6EC7A79D0F92B4DEBCE5478801C9FAAAF82E43 A258L
438,375,204 *2C666E2DC1AED30CCCF50E218D89B3FF849AAEDB AAB7FV
438,375,205 *2C67EA1ABD5CF86E0F4800A6F092E5A75B88A419 4ISAACGOLD
438,375,206 *2C6AAFE2E45182229F2018B986BB3621BDB52110 AACS,'
438,375,207 *2C6DACBB87EE866B6C24D75C5090FAD1EBC5A27B AAE`V
438,375,208 *2C65841236E713C72E7D73F70A0B54EE3126C7F2 4TEWSKEIR
438,375,209 *2C676BCF67B0E381A0AE9D95B4568EFE155C1F68 AARONFRANKIE2
438,375,210 *2C6E0DB2967B858064AF44A00ECB684E5C0EA4D4 4TOTALSITUATIONS
438,375,211 *2C62A5FA74A60BF8194782372722E7528E13C97B 4TROITSTROITS
438,375,212 *2C6D42380ED32737442B4E3244F2BACB39FA150A 551darnell
438,375,213 *2C6128C7B39F248A8F6816849CAFFB7FF427262D ab/qb
438,375,214 *2C64DD7B0FB23FAA8D51D405ADDC84322096A447 5BSWSONNYSBSW
438,375,215 *2C6982612DDBFF44636822ADC312675528C328F3 abw_i
438,375,216 *2C66A76ED6751F270C2A4A96EA943624BAFC61B6 ACE888
438,375,217 *2C6401604433FEF63BEC7D7D52D02388D745BFA8 ACMY
438,375,218 *2C61DEA839FAA3BC0E3B9BC00C0058922F396CD2 5-ostonoteerausta
438,375,219 *2C6AE88BF2510CDD9C0D7D676C43F7D762275849 5PODROZYC
438,375,220 *2C62442ED856E1C0747862EFAC217D7D3FB2001D ADELINAMAINTITLE
438,375,221 *2C61DBFFF9973605FF20158BF16292BA9A335789 ADOLPH.WOUDENBERG
438,375,222 *2C6E3F050AE832F42E6A9AAA2FCD42C91D57592C ADRIAN.GARTENMAYER
438,375,223 *2C6D639DEDF8686E90EEFFD03251AC18B5B565B6 a.e5t
438,375,224 *2C6D7A4B45F5F9F7B069F9856B572C206C666F60 ÆFÆSTMANN
438,375,225 *2C63D6F7FB896BF53CB2E20015DE154EBF6A7398 AEGAM
438,375,226 *2C651B4243F5EB427EC1A63BA768B05DDD671DCC 612615 DIECHRISTDEMOKRATENSIEGTENINFLANDERN
438,375,227 *2C6238A050C8AE3E4195A8AC5C2148721F372EE9 6ACCSYSBSW
438,375,228 *2C679E19F33C1663BEA5C54B3B9C4CB41974050C afborsteling
438,375,229 *2C6537D6BDF1AA3D46A91F587EF72884D7054236 agg%
438,375,230 *2C6FECB8FCA570D37E5410D536DF7F1B785518A4 6FLEURETTES
438,375,231 *2C6FF8F2E4DBC7CA9B9420CC4D43711113C8B914 6NESBITTMORONI
438,375,232 *2C6EC4B24A8C72C354C85950B53733E13F1F6604 6NOFARIG
438,375,233 *2C6CEF18A7304D6D93BA8A1EB1A008BAB95F99DA ahi?
438,375,234 *2C6C86AC4399C4674FB36912D545C0E566D5AD2C AHO=H
438,375,235 *2C6FB60D337D04FAC8CA91D24A6B688B0B49D4C3 ah.sum
438,375,236 *2C6D6D08C8DB66CBA9881B061512BAB5445F0DBA ai!5t
438,375,237 *2C69728B42D10934BD6E1DE5F58CD80F3B976A8F AIH+0
438,375,238 *2C6E319CE6FE0C544041A51BFCF69C789125D8DD AJAKKESESING
438,375,239 *2C613D8AC6FFC530066F9FD8E27601F59A152AF9 AKIFUNGA0
438,375,240 *2C6B51196D5AF2F722219F09C54BE5DE3E58FE45 aknooppuntdehoek
438,375,241 *2C6065B8B1A81F9FC9D3BA17D1A398E7417CF08E AKO.OSTATN
438,375,242 *2C677B99D7FD559E9E16BAAFDA31AAAA16422EF8 6TIAWANIA
438,375,243 *2C6B0715ABD5B5D3F60F345BC69176894D29BDDC 6VIVAADO
438,375,244 *2C6B947B09CBC5681768804E461C80F76309CB6C albertochauvette
438,375,245 *2C62D123C04690865E56A95E47795D12424E4924 ALFONZO.SKARUPA
438,375,246 *2C6738024603D10621A45E7F0EFB22F03449EF13 all that rain
438,375,247 *2C6E9B0A3B3776BEA490324CB7C91117E0288CCA ALPHONSEFAHNER
438,375,248 *2C6F3183F0AB311F6D281C7994A46158B21D0E2E alphonsoparamo
438,375,249 *2C6762D1EFA37B801B63C3F480AAEE7745D8AF33 7FADDELING
438,375,250 *2C62EB63DCA965A64D8739311286FB74210ECBA2 ALVIN.WHITEHURST
438,375,251 *2C6827188C08940AA60AF070F18B3F34FEED223A AMK:
438,375,252 *2C67EF098CC42CE278D9232ADEBFA7E6488E49FC ANA(,
438,375,253 *2C67D4DD1DAED78A4103F692ECDB088F9768F89D ANGEL.CARDIEL
438,375,254 *2C6C62DC72F5C024DB94E7101AB137571E83AD07 ANGELO.CONDICT
438,375,255 *2C680B7FF49658CA8D437FD7B03779968792EAF1 ANIVATSIED
438,375,256 *2C614BF9982148F69767F11C49B3BF9117753FFE ANSGARIN
438,375,257 *2C6EF82B2FB62B62943EAABE7C5B5939EADFE0D6 ANTI.RODEO.COALTION
438,375,258 *2C613F2117C4EEEDAC48F4952E14A892CABA8D38 antoineschnitman
438,375,259 *2C65519E1E15F36A8688D9AE01B55F8F61DD8634 7JACKTURBO
438,375,260 *2C6C8277A370EE47911E3F67A731B982A9974333 7MYGOOGLE8
438,375,261 *2C62717130D7B4C63AB5CF819BEBACCBE19EC086 apogalacteum9
438,375,262 *2C6699873C63EB09830C4C2700E5498518F376C4 AQKUF
438,375,263 *2C631435C6AF4DABAB3F389B0F7986A637678A73 ArabianRaves(organmix)
438,375,264 *2C67644440ED7B624E7050825413A463B5FFD5D4 arindt
438,375,265 *2C6FD2FE3926B51E79B9BF15D320D74D82D5E974 ARq
438,375,266 *2C68FDA3824891B0BE864D9353D74738990DA187 8OERWOUDM
438,375,267 *2C6DD790CF29BB17B2FBEEBF8EB2F27FFDB24476 ATABL
438,375,268 *2C6947EDC9B930B3F3C6672ABA76FD4912AA93D6 a#yw!
438,375,269 *2C6D7BDE9D475E68B849D7ED911C69349A1B2793 b###)-*-*-*-~0~osplat
438,375,270 *2C6C1246E8D6F0B848D128B4C95CE698882A07C9 b;anf
438,375,271 *2C6C6FC96B72B839ACEDA53DE039CF3BB6339291 9INIFEDNU
438,375,272 *2C691EE5659F19BA6A9AA29B572757CE0F89691C 9ISOTOPING
438,375,273 *2C60FB44A73C0EC2C7B1630317DD1ACE6EE6DCA3 9JINETSEOW
438,375,274 *2C65384B2128D27F7E6116843149B98471FBCB00 9LAGLIES
438,375,275 *2C6D9D98EC0FE394CCEFB1089395C45F7D0A90F1 9PACKERPHIL
438,375,276 *2C65ED5BCA0080D5D3083AAA6C81F8043CFE335B BAUERNURTEIL
438,375,277 *2C6B958C483602394AC3617F901DBCAF5FA78625 9POTENTIOMETERSPANNUNGEN
438,375,278 *2C66E26E381CEBFD0BFCFCB7E4CCA37513F50008 BBEU5
438,375,279 *2C673FBCC755D0D7AEDDB458FE48678CB52B8F77 9SERVAVERIMUSQ
438,375,280 *2C61FBED7DC31C02246A5D4460AB9040482F5682 9SVEJSREGLERN
438,375,281 *2C67D7FE37E66983761E5676EA24E6D74969295F BC5%
438,375,282 *2C674690A7C414935C9FE82E276ECFB70732D946 A;)
438,375,283 *2C6B8048C9D3AF0D4BCEFA393072EA7CCD93D0FF BEFORE-THERE-WAS
438,375,284 *2C6F4540B98DB8BD3245E39D5BEC04709B7BC642 BELLINATIGILBERT
438,375,285 *2C61C5784B13F319B27EDDA87A7AD8C27E4A38E5 a6
438,375,286 *2C6BC532401D6A40C5BCD60C05F316A3BB24F230 a8$2x
438,375,287 *2C60A0649C7D1D088D6D320EC0C46FFB42F143AF BERRYNOVACK
438,375,288 *2C647B715E7391AA957650A90DA310133AD4BF60 AA0B1
438,375,289 *2C63F87CF3D11DD79F58281824DA85E0E883F850 aaa;d8
438,375,290 *2C6B9A07CBF3FE638BB4B071A5514C2A933176ED AAXD(
438,375,291 *2C62161A7771E7F690FE2485F5F7BC9DCEC6440B AB4VZ
438,375,292 *2C68708646EA6F626B75807C2F6289F545E82F72 ABEL.GUINAN
438,375,293 *2C6476EDFE3B05858385494E832E31888053019D B"J"2
438,375,294 *2C68A8800D7FE6D1FB2605888A64CCA51D879030 abhobelnly1
438,375,295 *2C67785F8C833EF6EF038DEA6D3B27E3CCEDD857 BK1L6
438,375,296 *2C6432A52A305FC4D6ABE28AED611810C95518D9 a.brand.new.age
438,375,297 *2C627C06C384883E8523B1E835161A083AE32CB6 [email protected]
438,375,298 *2C6642CB3A1F5722ED8FEF1D2B78B77F230FB136 a-"+c
438,375,299 *2C605FD2D149EF2D2D1A0D3DF0372E6CFD4B7532 adanmusil
438,375,300 *2C67D86D0DB60115FBE6719AC9DC4258331434B4 b-o$5
438,375,301 *2C6C13A34EE8DB118F91FC2B1E04D0BC6FEAF83E BONEUENFELDT
438,375,302 *2C61D7DD6F6C946EAF60ECBBC690AABCDC0C3DC7 ADRIAN851
438,375,303 *2C6FB46237C3408102F5EB00528F55AB89811CE3 brecheer23
438,375,304 *2C67C610EF71A773C92C604FD20A56813BEB9B26 AGUSMISTOYO333
438,375,305 *2C6DAF09CE96CB9B10B874E7719C277484BD4384 ah&"2
438,375,306 *2C607D3253BBE222F0922BA9BFA1D80005F665B7 ah32&
438,375,307 *2C66401FA11392EE6EAAE902DA97B4FB713B354F a:(hb
438,375,308 *2C6E4E948D8D5BF9FC57F0863866AC48F6F508D4 BROOKEY
438,375,309 *2C6107F3C2AE3FD5C9B3B3C3501D5AB65575C9A0 alexandermisemer
438,375,310 *2C676B5F2485D2906740701B15CEBF77B4133FA7 [email protected]
438,375,311 *2C68648A52E575306885ACC8DF26D62A4785E9B1 buhco
438,375,312 *2C6131C94B097782DD987AFF57EFCCDC46CB2437 alfandeg
438,375,313 *2C68916125F9901BE26171E50A4322F0582B13C0 B/V$
438,375,314 *2C6FB7AFE42F95AAF1C1A3C47CDFF0B9828FC24F BX:MD
438,375,315 *2C697A1DF256AD1F8F1A16DF1B488EB567F1C741 [email protected]
438,375,316 *2C6F20D53CA7DC1BB51A604E13602F7B16126305 A-MASTERS-TOUCH
438,375,317 *2C66B514F578E626B0AF3D7D225E4510F1FEFA14 C0VGI
438,375,318 *2C6426F8FE64C170C070DCBBE4BA34A09776D2E3 ANEISHEA
438,375,319 *2C6F132B54A8A5FFB65CDFBFA41091FE03E5632A ANGELCOFFMAN
438,375,320 *2C6C1C5DB7C38CA45E5FDE8646534172813B3CA0 ANTHONY.FRESQUEZ
438,375,321 *2C696A9AF0BCCB480DF9F969818695881181E2F2 AOlS
438,375,322 *2C60378E18AAA983365DD6681A70E3179E2473CA APERDO
438,375,323 *2C64579C91CFEBB88191A3357CB1ECB89C4D0A9A CAOHOUSEGOVCAO
438,375,324 *2C6951AC3BCA8F1E45491EF472F12815B32A13FC APIACAPULCO
438,375,325 *2C65416BF8FF1990A7F56AD91FB852BBE9FAD0C5 APPES+A+S
438,375,326 *2C61ACB96CB0DA46FCF053C75E5988B927F5F9E1 a%pu8
438,375,327 *2C61CBBF38A7A5ADB8B6239BDD4C9FEEDC8EE156 carmeloduhn
438,375,328 *2C6209A86C21F20217C97967342342BAC8951D61 a.qzc
438,375,329 *2C60250965CA5AA441BAA654D1BCD049D3B788BD ARGADES9
438,375,330 *2C6772F9D4002F713C221200AD1CCF100E11189B cb7c
438,375,331 *2C6BD351A244899522A057432AE638BF8EA92C47 ccbfb
438,375,332 *2C6FAB4C0F89655E6F3AF55BBA7091CE98C6E2B5 [email protected]
438,375,333 *2C6E1FCB4906112A763E38E2EEFEF78F650D0950 ASENTAMIENTOS.JUDIOS
438,375,334 *2C6DF7BA432F9B42FEF9E232F6BFD9D020DEBB3C asteriscus6
438,375,335 *2C60F28292D17C5A350B248B521E3686F3A7FF29 cem5c
438,375,336 *2C60988DC978E152814A35A8075C0EDD2F9C76B0 ate(h
438,375,337 *2C6F12B558B2AE01EA41AB4AE6A5AF3A737DB7EC ATU("
438,375,338 *2C68893905BE0E48A84B43E92F86AFD7DB183302 '-/cg)q
438,375,339 *2C6EDC3A46A1A313BABF8332348838422A34A7DD auh&.
438,375,340 *2C605C0EA1C600584F97721DA893B4B4F018B45E AXWWAAAAIBAJ
438,375,341 *2C6DBF3DDD47AC03B0FBAA7E4F29167E32674367 AYOBAF
438,375,342 *2C644779281B7476E29059B5E6F16D2421FDC04A CHOOSESHARP
438,375,343 *2C6DBA1F0B5B12507FB5A49FB130A81C03200B73 CHRISFUSSEY
438,375,344 *2C6128B595B211412B0FC59B2F8E374BAF067714 CHRISTOPHER.THOMPSON
438,375,345 *2C6970134A69F7463932A3C649D90BF9953C8FAD b59k#
438,375,346 *2C68BF8C1A533D95FABCC6E8C22B13C0C33D4C51 CKHG-
438,375,347 *2C6D1075A83ECA59A5BD54CDDB2D6FDC49476B3D CLARENCE.TUPPER
438,375,348 *2C6273F80EFC829137A147A208752A4D85C32842 baboso5
438,375,349 *2C69778532864FE4095E898BFE1681CE230C97BE BAEWN
438,375,350 *2C6DA1CA4FA796FA7D8383204180AE2345F60C8F BAIT3627
438,375,351 *2C6C9A89321E31732D87B0DB2ABAD3162C65A315 banbjerg
438,375,352 *2C62B864D8891145A55D72018D0527E5CF5EA26D C#Mc
438,375,353 *2C6706D9FD9CF8E9AE88E776B5D15AF8F5A7988D BAW_!
438,375,354 *2C6F77B9AFD6CB4F9152C6794FF3EE52197D5B05 bb6wj
438,375,355 *2C6B6C4AD8CD7BF0816C2E0E28E75C1941F8751D bcp1e
438,375,356 *2C65EEEC9011C170962AB120875BFBD143386781 [email protected]
438,375,357 *2C67F44D6E73B2E774EB9BCD10262526D5A0B235 cnsxa
438,375,358 *2C6E5CD316917325F0CF33430AB749FF31EC841A colm.henry
438,375,359 *2C64C6F5E86894F97B05F6A75B52D93428611E34 benurich
438,375,360 *2C6931E1E73B331D6E734383EAA62A07815AD8C3 compweeklynothingtohide
438,375,361 *2C634607F4DF71465F5F5A7CFD9BDA34D671F573 BFUID
438,375,362 *2C6E127CD6F402994347C99F7A62EA83E3C92A0B CONCERTO IN A MINOR RV161, 1 ALLEGRO
438,375,363 *2C6817E112FF550CB6283DEE0AF2858B4535495C COREYKARGE
438,375,364 *2C60D21490BAE922ABE12898CB0CFA9B47DC43D8 CORN3ST34N
438,375,365 *2C6FAA43D99367A347E16DAC07D8E36849DC1263 B"I-C
438,375,366 *2C688BE2F4A713BFCAF1AEDC71ECA4321BC35694 c#_pu
438,375,367 *2C6AE007588880C8C3CD119B28D7202E1CB9A4B1 BO"5"
438,375,368 *2C6225DB6BC942337E5B87AD7B885DF22BF22591 BOGUNIEWKO
438,375,369 *2C6F3A2E943DF0A392F24D994E195DA537BFAE3B bombingofdresden-dead
438,375,370 *2C60DD0C6D2E39A83CD943E9BB7BBA1534B8432B CRUISEBOB
438,375,371 *2C670B70DDFC916FBED77F355127BD3D44D3077B BORISBALBONI
438,375,372 *2C67E3777ACCC6008AE5BC330F19DD309F4698E7 BORRADOESCUELA
438,375,373 *2C6EF57F33AA2C4DF5A55E13F586DB6522947C57 BOUDING7
438,375,374 *2C64C747006F23B8F8FEE139F9ED6F1E0267084A cti;d
438,375,375 *2C6A385D0A5AB08206B544294AEDBECDF6D135F5 CVDDA
438,375,376 *2C6E44F06978D5A81C18A4A40997579CBC5A5F22 BRANDONNAKATSU
438,375,377 *2C67E8702C169DB8ECDF91C9D07FEEF8E2D7709E BRANT.MCILTROT
438,375,378 *2C62803996331B25F31253E84A9C74C6257A55FC BrdC
438,375,379 *2C608DA4D86993229C3F5DB2AEAB8AC134CF7651 d&0:,
438,375,380 *2C67A195AEC5BC6564B3A2DCA17E83D6DDA77E22 d2i$?
438,375,381 *2C67B9C658635F12E02FFF2D6BDE54BC1178DC15 b?uc
438,375,382 *2C672721000A694D0980B9E4709ECFC7F9CC0602 DANIELLEGROCHOWSKI
438,375,383 *2C6D8669991AEB30FA7E37CE33FFC5DEBF75A616 danpa
438,375,384 *2C6DAEA4EBD154CA7D06F201B62F36657AB9BC10 BXPQF
438,375,385 *2C60E41F005EB7300BEC46E58452DE1D30AE4452 DB)XJ
438,375,386 *2C6BF52079ED1632B0E9F43E0119255FB9BBCB4E de_av
438,375,387 *2C685BD8C224EE8A6C4EB72FF886B67A9EBA44CC c1a.2
438,375,388 *2C64B6B86F480D3A34F5538E1627F681A3A9C7D1 DELYSTEN8
438,375,389 *2C6CC26F63600AD442EB26F7FAFD34DA8F6B3B2A camerongandert
438,375,390 *2C63BC0F5AD328AA1C14569B922B77DEC6B6D43F dgpre
438,375,391 *2C6FCFA62B0400B02D1E7F3BBF65334DE918ADD3 CARNAVAL.DE.HERENCIA
438,375,392 *2C6B4228883B8CC8F464D9699C15FB1876FF86D4 DIGBF
438,375,393 *2C62C05717A8509300AA371EB4602B18AD6981B7 carsonmirich
438,375,394 *2C6D8AC4EBCAC00812859FE7D96EDA26251A68E8 dirkherena
438,375,395 *2C6AEFF95F34363FE0921BE4E214D5E9F3A159E4 CARYOTWELL
438,375,396 *2C6FA9FE0D8047FA97394FAC9D03A39F756D7B9A casuisten5
438,375,397 *2C6298F1F9802F1E9B732A5C5618E0E78D1E8BD5 dkpc"
438,375,398 *2C622588B2C8AFCB53710A9650EA5FDEBC289FC4 D#M"V
438,375,399 *2C66C28FF25014CE832A47385B444CC5048A640C ch35+3rf!31d
438,375,400 *2C6E653674941093729828B7C88DA355E9126C49 dominicklehrer
438,375,401 *2C6795DE6D95831948269C1BC470C1C7D909AC8C CHANNTEL1
438,375,402 *2C60EB5FD84AA5D1512F4F9E08EE36FA0EA64DD0 [email protected]
438,375,403 *2C6195370F9C41FD3DF1AA2C7A5B2CBC9E985824 DOWNTICKING
438,375,404 *2C6F229AA7D8C650F9FF640BE9FAAECAB7D21C2E chiodorizzi
438,375,405 *2C635BAA897DF53DE13A844A61A84BB20296D4FD Chi-Thiết
438,375,406 *2C6213C0A1521D168AA961917A2DF7D501C68EBB chnk=
438,375,407 *2C6EA446AD8D4D0CF21EB69889F6447900D28399 dqkt,
438,375,408 *2C631BED65333E3C66E9C7780BD41F2BB812CCDB CHRISTIAN.HADEL
438,375,409 *2C6D372C1C77090D487926103C5B992E51272258 CHRISTOPHERHERBSHOPCOMWWW
438,375,410 *2C6362CCC415B78C1C6A4E5070F00B35D9FA03E6 chriwtina5
438,375,411 *2C605C9118ED8034F78FBAFE6F976F02E150714A drewnwakanma
438,375,412 *2C6AE98AFA57EBFC9140EE89908E1232704CF172 chuib
438,375,413 *2C688D59AEAC75B8F1B0D16EEBF1D85CB0A5D922 DSI2X
438,375,414 *2C6BBEFCB66C76E50F34A1CC9F57FED4C551D3C1 c(l?
438,375,415 *2C6459ED6772EED6B2B8A4B424E93AE5710BAA76 cliffodums
438,375,416 *2C617CA65474889EEB9CD876398ED000AA4C9428 DXNM
438,375,417 *2C68FDBB217E6750BBC780F36093AF8977F6EBFF EDISON.MACCUTCHEON
438,375,418 *2C6304A890BD98A1F49FAFBA1F77A95FE03F5DE9 edouard.mar
438,375,419 *2C6AEEF73CF329409DF42B02E35D00328E347A5C edreeduob6
438,375,420 *2C6FEA226CB5A1B5A469B48E89849F1F6FFF8F7E edwinrazinger
438,375,421 *2C68DA8F4B8E37F09663CA092E79CD15F792BBC4 COLLINTRETTER
438,375,422 *2C68FAD4961EA458F766330C8A8A7D1D2DA9BF7A EG=F,
438,375,423 *2C64458CB626F682EEEF176C7F2AA6BB788035C3 COOLDOWNING
438,375,424 *2C605381AB052BC2D8DD4B72BC45D3FB06249119 CORINKO
438,375,425 *2C617BFD1E00B1996007B32BC904BA5C3A9512F0 elazd
438,375,426 *2C659C07A20855DB54E2B268212F553B87337D07 cossaise" Op 28 (piano: Matthias Kirschnereit)
438,375,427 *2C67A8690E7158D36917E295FE3E5F7707B520F6 count3rf3!t5
438,375,428 *2C663774FA7BC93714CEC596C971FF592EE30035 elzahlig0
438,375,429 *2C616D7FEB795713A08C1F9AFE1742C76FF778FD e$+!m4+0r$
438,375,430 *2C67A4A721C434569BF26BA45A0AD022A0CC4E53 cqfuh
438,375,431 *2C6AF2E02B611FAA145767D586C28AB52B8FDC52 crbq%
438,375,432 *2C61488BBBD69E0C1955CA68E4CC948AA6C62B44 EMOSOSYL6
438,375,433 *2C6CB4CAB74675C74EE0901593EF09CD4F05305B ENERGY OF LIGHT (FEAT. DAISY DEE)
438,375,434 *2C62D33801A0F9CA09A90D0AAF1D6550FEA625A5 enihtnirybal
438,375,435 *2C691C0102E7C60F4F7B49467374F307A375D474 EOSV/
438,375,436 *2C6ED04050404F6FC95227793C33C1D196765F1E cuando llega la noche
438,375,437 *2C6736AA0361CC168A663DC89C64ECCA8F328AD2 cuu9n
438,375,438 *2C67067126C5BA6D339DC475D26EDAEA6D2E5AD1 ERICHADCOCK
438,375,439 *2C62E874D1CB14B5A6165D59AACF15FEB6DD3AB4 CV=KM
438,375,440 *2C6BA90F96F344563AC7C9C3DAEE2D5CF1DE1015 ERLAMX
438,375,441 *2C6FFD0E904AF307335BAF53E5D81F78E6994805 CWOVU
438,375,442 *2C667035C60739280AF39221250950991E238CCA [email protected]+$HP
438,375,443 *2C6CE784B5C41E6F9454BFC43DAB5A604BF5A49D erzar
438,375,444 *2C6A1CC31146243AC352C54D048330B170BC31DD ESTORIANING
438,375,445 *2C6B1464C7D24728FCE8401C1A62E730AB1F96F3 d=!(
438,375,446 *2C61C9CD010B0550040748F2432C1BD3C36D9677 ew3scott:hormone
438,375,447 *2C63A7DDB144ADD8659E4EF169E8890F2AFEC0A4 explorer.s.a
438,375,448 *2C6EC52DA8D2B54AF79484E5ACBD47E0635DE86F d8vuf
438,375,449 *2C6180DA716C53696C00A2D74635FE6695836FCF [email protected]
438,375,450 *2C600CFD5D7ABB1BA79E2E3059DDD251A5C6C0B4 FARMFRESHONIONS
438,375,451 *2C690687C7DDFB319DBEB3C97B53FFC75083136A DANNORDHOFF
438,375,452 *2C665B3296035C08DC60DBC69188D507F4FA6E69 dariodedecker
438,375,453 *2C609E7B7CB6282C208CA8E10BFE670EACBD0637 daronthorner
438,375,454 *2C6109A590B977E75B0D55FFE482E3AEDF393560 DARRON.SALSEDO
438,375,455 *2C64829E4BD21B2DEFA2EBD8B1BFD7E2AB6E9EAC DAS SCHMEI
438,375,456 *2C615B9CF723C9393C43F3B5FD831B8B63452109 dbrin
438,375,457 *2C6802C730CF50060D6E23EA5AD81E4C9A5D5D16 fentéheine
438,375,458 *2C6D2AF7377DC18DD2D6610452B93DA937C3BAB1 DDIRQ
438,375,459 *2C637E349C7CA434812298CD26BD3F2C2E877F80 deemaha6
438,375,460 *2C63B48D5AF04A66E1614E0991296D090A6F55C3 [email protected]
438,375,461 *2C62886D5690CA7104F1B964045D82AC0F56D54D [email protected]
438,375,462 *2C653A62A69409CD0FA78411F83FAA42668BA39A [email protected]
438,375,463 *2C6DCA45329F80B5FD9F5297CFE45D4DAD02E402 FLOYDVASILOPOULOS
438,375,464 *2C6B6F2062FE84A876CC4718CBDF56C1752FB81F FLUOROPHO5PH4+3
438,375,465 *2C65FB5F490A1AC2B6917FE78FB1F553E884FAE0 [email protected]
438,375,466 *2C6248D8B3FD7E50174A2E3BDD4AD4638B990B65 [email protected]
438,375,467 *2C6FEEB10C01E6DD5AB34B0243F38A4EC21A2616 forhandling
438,375,468 *2C6A373E475F83E4F8F4FD4418939AAACAD03E54 DERANKEROOS
438,375,469 *2C64D1B219ECDF9F91EE8B8223801A9749C52E46 fragmentate4
438,375,470 *2C63B93CB35602E2B938EB9054B8399E199DD72A francescoharnisch
438,375,471 *2C6F3EE4DD77611D9E3CDC3805309AD2C93FDD6B FRANCISAFABLE
438,375,472 *2C6B3A070EB0884B5F52906F94C95135B459584D DEROGARONING
438,375,473 *2C6B2BE64E7592C354A3A3BB7FF940F2C38AED7F DESCRIPTIONSWEDISHF
438,375,474 *2C61809AFD1DBB80C05F0AB37925598B481916AF FRED.SILLAVAN
438,375,475 *2C655B195A6973D3E82A2867152091E867BF7740 DESMONDMOYNAHAN
438,375,476 *2C679777476FD701159AE8BFE26FE58A43C7ADE3 frustri
438,375,477 *2C6115857D6E7108C232C2EE18B69D21697446A6 FUJQ
438,375,478 *2C6DBCFF5B145F1DD5789E701DD1FF289C999FA2 DHAKCHINA.MOORTHY
438,375,479 *2C676576C818CC1DA617123430E791EE239EC355 [email protected]
438,375,480 *2C64D9E24DEC2CB2E1DFAB9F770557C5043FD71C GARRY.WEXLER
438,375,481 *2C6C8EEB5E4F885155E8A209F4A18D71A0A952C4 DI0EB
438,375,482 *2C62410EA91D3D6047DF7D2466302528AD285B83 dickboardwine
438,375,483 *2C6486EB6CF44FFBE5D2010AF0FD559627DBC60C GEMEINDENTSCHEN
438,375,484 *2C6A5D89843ACCA1258AB72F57E8D31C1375D153 DILLISSA7
438,375,485 *2C6B8D728001CC3092B1F8FEBDF3A793508A8B0B DINEAYXO6
438,375,486 *2C695D40D43158ACF77A72A72A817C2D0F53C527 di:o9
438,375,487 *2C60F8B47FE22A4EE3F2FD503FA23E37F3D7E4FE diq7o
438,375,488 *2C6750B407F74300E15F9C363E0533D38A0A1AC9 giovannizavacky
438,375,489 *2C6A8C3B36EB19C314FB3D475E301A4C4248B8DE giulia-(gabry-ponte-remix-fm-edit)
438,375,490 *2C64CAA1F429212B70EE1BAB4871E90DEF92C8C0 GIVE US THIS DAY OUR DAILY BREAD
438,375,491 *2C66B4EA64DD10AD0D2BACD86EE660C5F459035B gmonthlexicalmap
438,375,492 *2C6BB2C0311F1542B041915E1A1530B1CC3F272F gningila2
438,375,493 *2C6B1E3EE3E59E58A6804EF1593E9F551E84672F [email protected]
438,375,494 *2C67846711994658B02F71361ADC80F58E75765C GOOSUBUC
438,375,495 *2C60027768F436E9A7D60400E50A67541E649101 GRADY.POLLMAN
438,375,496 *2C6C99D9AAD12723BAEA1D84508F93A170761602 GRADYTASSIN
438,375,497 *2C65E0D886C596A64A8509F8547E3B5C28A5CAE4 GRAIG.TANKS
438,375,498 *2C6446EBBA4951AB4ED784CA5401CDC1ACD1325F GRANTEN0
438,375,499 *2C65FC8D26B4D70E5F87F5D875120FF84357DED1 GROUPDIV2
438,375,500 *2C623C586E0E7E93F8EFD2049BB4DDE9C3F7F046 DKCF.
438,375,501 *2C6CCFC3573D620911F690C2DE37375F0F1F090F [email protected]
438,375,502 *2C63FF57FA5B508F0120970674273A0865896712 DKZGC
438,375,503 *2C685D0E7BE467A8DF0ABEE1F400CB1A8333C308 DMOV"
438,375,504 *2C6CA9B236D90E6E7D6FEBBD94C0E86EF2B271BD [email protected]
438,375,505 *2C6111FA74C89C3CF90CF6CB66024646BC2198B8 dominictest
438,375,506 *2C6A0F079C2D86B55F3B8FC3E8911A64F6726675 DORIAN.INK
438,375,507 *2C6E76A0F302599B606059DFD70AD3EB75FD3FAF HARRY.KEOMANIVONG
438,375,508 *2C60BA1403860F9640DB0E69892412E4E935A1AB douglaskarlgaard
438,375,509 *2C6A2621106EAE0AC5F9405BD0073813D5AE199E DOUPEIMMAT-JUMALA-SEIVAA-(FEAT-AKSIM)
438,375,510 *2C6E6121BE8F910058ECEECBEF344464D8BD6455 dppsw
438,375,511 *2C66FB4CFB87DB2F3B1E6E2FECB9CC7454745788 dqqp6
438,375,512 *2C67CF5B59D2937AC65191928D508D548410A9FA HENI.ADNAN
438,375,513 *2C64940577394A2AC6A4D0D5022FAF7CDD17A07F HENRYSELBERT
438,375,514 *2C66D2D17259230BC423AF620A356CE0B859BDD0 HERBERTMULLIGAN
438,375,515 *2C699DD8FB0951FF4CAA2CD269D40BFD22CFACB2 here,-now-&-always
438,375,516 *2C643FA9E95D5287A7DA962C66628D75286D8BFB [email protected]
438,375,517 *2C68B60BDD8F528F4D6D8CB3DAA33F7EFD435125 d+t;(
438,375,518 *2C6E2BCC4F18F8E3FF6CCEA569B3F39BB4AD57D9 du,2f
438,375,519 *2C640DD42E2EF08C19454AAC2C4ADC62D3C3BA92 high-wire
438,375,520 *2C6DB8B0C169F2BB3EF15E26A5D82CD6528EB7EC hnc\
438,375,521 *2C699F2589CD0C65F6C99524C1674B7C8B8D9582 [email protected]
438,375,522 *2C623348694E47754CF608E43D19F1383CA52967 dummeldummel
438,375,523 *2C6D6EE8BFC9E124A988C2DF590E34CC7835FE70 dwna-
438,375,524 *2C677C7A32F1EC48EABBB61DC22590FD880F97DC e8dadb35
438,375,525 *2C67DBEB76064103D8B26A903A9883174BBA42E5 [email protected]
438,375,526 *2C6C65248128B0AE635657017C1C31180F5E4500 [email protected]
438,375,527 *2C6F0D644A663DA08DBFEDC000EB445699CE7314 HUGOGOODPASTER
438,375,528 *2C605595B3F717DBD9AD0EA800BE5E5944DD83B3 EDDYALTIMUS
438,375,529 *2C60473BECD5FBB2C56EA2AEA57645BCDF9E6D59 EDGARSTOEGER
438,375,530 *2C619235F715BE864EE30A5B14EFCDA96F6ED3EE EDISONGJERTSEN
438,375,531 *2C690E630970059585F843D05100414B8B1F0963 EDISON.KAPOI
438,375,532 *2C6A43C2C0F02A8086EE7333F7FB9046E18048BC edisonkoguchi
438,375,533 *2C6394B0BE44D365BED1347D7ECC5099D7A0E983 [email protected]
438,375,534 *2C6572ACC789C9B81D002FAAAA2BA777D3E36751 HWYLCES4
438,375,535 *2C6B04FB2AC148085190380EC3C375A988BFD56A edw?q
438,375,536 *2C69FE67F0551B580D9746089F24EFD0A6639688 [email protected]
438,375,537 *2C62A4AE6D25B1E40E4252B040CBC3FC7262A68F IABOLIST
438,375,538 *2C65205F087B55E598CF39032FF9882BA5FA100B IAMMARTIN137
438,375,539 *2C671DC0C557EB84CDB2D68D080FFACF5FB5346E IAN.EFRON
438,375,540 *2C6989B0F8919932018FABEBAC27143592AF44D7 ELDON.CARVEY
438,375,541 *2C6FB8CC89BC037853D5254BACBDB75F7668FA31 IAZZOGS5
438,375,542 *2C6B26A1B4409697A014DEB3C0178861A4D9E0B9 elijahharken
438,375,543 *2C6A3F699CFEFF0564FBF7796EE04C1973791CAA II..ALLEGRETTO
438,375,544 *2C6B48A1D5FA6C98E8C29F312BA63A82B5210C9F IKEMOTO-CHEMICAL-INDUSTRIAL-CO,LTD-|-JAPAN
438,375,545 *2C61DE2BAE9D7A8999B74E539377E6933A23A2EA elvinkrumenauer
438,375,546 *2C6A02DB8B9876C1C2B8168E98127C15A93FF492 ILAIRES9
438,375,547 *2C6356D3D4669C679531AAB14573473F5C611863 EMMITT.EUGLEY
438,375,548 *2C6C7E6AA54D6A46997A845CF10CF37DFE9A4499 iluvroman
438,375,549 *2C6793BD28139943D326E74598D1FD14C77AD6CB india'smost
438,375,550 *2C6AB1C5983983B6A6405DBC4DC0807779324C9A enriquerayman
438,375,551 *2C6648B870B8E10A6D86ED70EEC9343C02E6B339 EO)CU
438,375,552 *2C6643398050D4CF78CB424B140431233A10A343 ephi1
438,375,553 *2C64106AF6C341224D564EC143AFE61EB5C508A2 inthibit0
438,375,554 *2C6479EA3913AE80009D5F87EE5494583FA6F7FE ERICH.PULLENS
438,375,555 *2C6CB0E4B72978A54F98C394196EDA2CFA910BB5 er!p
438,375,556 *2C6976C5700E3F1946FC2292A2A7D77CBEEB7C43 ERUTABAS2
438,375,557 *2C64C7A5D5AFC9FEFF78D1488ED7ADA88D889347 ER.WAN
438,375,558 *2C63B1902787B6CE83278709DF71AE21F6E8E00F ERYTHRISTIC1
438,375,559 *2C6C070B446C699967F5050D3747A3F395FB6DB1 estativos
438,375,560 *2C675D8445B3B9BABC929D8AFF8973C800B6CF3B J139174
438,375,561 *2C62EF733602DDE3D4155030B65A7C470AB2C927 JACQUESFRITSCH
438,375,562 *2C676DD33F5D8CC604338C786BACA2D7FF5C6B1A evanescenceweb
438,375,563 *2C66085B6AB090588933C8B8D8263F75125C6F38 JAMES J COOPER III
438,375,564 *2C699696DFE8F1A67D68E9FED3BED6018D5EB8DA JARED.DUL
438,375,565 *2C653B833D9D7DC5C55DEEF9676CC4E99152F33E JAREDGEPPERT
438,375,566 *2C6AFC7D4823F57F54850DFFC22799208F869B9C jarodloudermelt
438,375,567 *2C6F0BDF43453B3677EECF1887299C58098533B5 JAXSON340
438,375,568 *2C6608217ED67B897B574982E80376520021E53F FACULTY1003429
438,375,569 *2C687126D0F842F4F8DD757E3DE2178B3844A1E6 FAIVILLE
438,375,570 *2C6E8CC3A840C2D207142EE5DB6A63F515D04395 [email protected]
438,375,571 *2C67CBBF814489D946D8D58643F1A3A7C7F34952 jd-britt
438,375,572 *2C65499A84F688749FC292DF5C8422F56A5701C4 JEAN5209
438,375,573 *2C621BAA9D032FE9511AEB82D6C1CD20604B4F85 JEAN.BALYEAT
438,375,574 *2C6BC1FF16979240F18FA9D5BA01CA5D68CBCF20 『fatman
438,375,575 *2C6527F81957F8DCBE77DBED100672D99A6B0B8A [email protected]
438,375,576 *2C6F0DC09E78F55D9814FF1791975254BFD9B2DF FEJLTILSTAND3
438,375,577 *2C693C4E454DB3D92DA5C0D5D94A19DFC283A356 jelenalepa
438,375,578 *2C6E74A1FD6CE6525E1D894EC6594019C75F5CBB FORTIFIEDCHURCHES.COMWWW
438,375,579 *2C6CBE452A5E1822101C24DFA1D4F8A60BE02BDE jeresteinhart
438,375,580 *2C6E37810E4B42F283A29FD1D3AAB7051BEC4F4F jermaineheckaman
438,375,581 *2C6C5E413CA2584ED73CD1B696D3ADAED8B77A2C FREDERICLUBBERS
438,375,582 *2C671C21C28808CE9CE5A6C3F6DFCAEE27BF2FF8 jeromyfecteau
438,375,583 *2C6D636B13593E99BB0F98ABF82CED9BEC7F220A FREERIDEWNC11691
438,375,584 *2C6C4991971FB51F8BF5DF1D132257BEA3461D83 FRENGKYQ
438,375,585 *2C65772EA4B09F0A80A6C28B09591228DE33C5C8 FRIDAY(BIOMIX)[129]
438,375,586 *2C6E2E4234FA7A7578FB85A993301BE99849B76C g14do1
438,375,587 *2C61E6C3AED19641058B23663A3D547756CE2E8C [email protected]
438,375,588 *2C66F6FD240496F4EC92741603F5A3095D51162F jessica.lynn.harrison
438,375,589 *2C6551F6837BFA16D2F5FBDA2C5BB4E6DAE45BF7 [email protected]
438,375,590 *2C6C97E7081E12F906E2D430ECC9D73E657C146C gaussenmarks
438,375,591 *2C66C65C6085B7ABD1E5F102B69C2B1448FB878E [email protected]
438,375,592 *2C6422F1B3441413047C4BE20AC0029156EDAD3D JILLL
438,375,593 *2C6E663163BC1B625C68BE1900E925E9FB91EFE9 GEOAPP
438,375,594 *2C6F8FC7EDDD7F33FB4EC6E782E1DD504A76F706 g/g
438,375,595 *2C663FCF460EF80CFDEACDC9FF5178FFC2E02FD5 JOESPHORSO
438,375,596 *2C6277A1341DBC7B13F605DDE4A9647A288B0F8F GIL.ACOSTA
438,375,597 *2C66072EF282ED7AD6F85C30CD8A1FB881784D59 JOHNNYCOPONEN
438,375,598 *2C62574225A2F5EB0A291E0E1A81B3C19CA26E9C GL0RFC4+0NS
438,375,599 *2C6A08255DF77AC029882E4BE00E623CDA817556 jon-tremayne
438,375,600 *2C6DD39D735EC3407BC94DFCE34830A757E3EAC7 [email protected]
438,375,601 *2C645AF5153CCB0E630B512858F5F42836C01B5D GLYVLIE1
438,375,602 *2C674B9ADED4F0DE20DD4591F35370134C17C3BC GMAJDXAH123
438,375,603 *2C6BD73A83FAB8121B2DB213CACA5860B8B44BE3 GNIHSOLSING
438,375,604 *2C66A37BB1CA879CD46E250B41F23B4ABCA951A6 gonaquadate
438,375,605 *2C6F58421DF4E2BA57BC4ACA65844B10B4CAF14E [email protected]
438,375,606 *2C6993E42FEAA9D3789B17920E5A84EEC34EFAFA GORYŌKAKUA
438,375,607 *2C6B8ED94D0B5AD9C986094B221D5BB49643058D GRADYCORON
438,375,608 *2C680A08ECDCC4D2AAC071BDCEF7DF6E34407196 GRALEYGRAE1LIY0
438,375,609 *2C652136E827EF3C807E0514496C338AD1A24397 JULIUSJANK
438,375,610 *2C68019B226F4D4DC98B5A6A22D32B8795E27729 justerar1
438,375,611 *2C6D7982E974EA6DC29BDC2D506CC445147EF50A kaorux
438,375,612 *2C66702B2371E2D2439BFF21CBC03DD2554E3A44 gushelmuth
438,375,613 *2C67301AC3C87325408E3F56A2740FDC1B0C2A81 GUTERMANCOMGUTERMAN
438,375,614 *2C6F8BD583DA3D5C7328B72B8C1D39AF53BFDF8E GUY.GATICA
438,375,615 *2C6BE9B578C7F1027933011AA812ABAC496B66BA KASEYFISHEL
438,375,616 *2C695EE906660FA00DCBEBADF8124361E7755572 gxg123456
438,375,617 *2C608AEC8A77BC3AC789C6E7B63A3904FB2BE901 $H0P1FTED
438,375,618 *2C65B4F5C7F2E0A1D27CC5C859912261B1FBB0C8 H34T35T
438,375,619 *2C60886C9FFEE11069822713DECEB2A2446C9C98 KEITHNULL
438,375,620 *2C6F30705DCF8B146EFC6091FC44F4FCE2EEA668 KEN_CA
438,375,621 *2C61F17D2257EBAE64FA6A969844E2BF9A42B146 KENDALL.CASANOVA
438,375,622 *2C637559A90FE8226772FD846C58356DEE76A9B8 hannahshelly
438,375,623 *2C6356ED965C0AB1B8916F271D37086854AFC7A6 hardstuffrecords
438,375,624 *2C68A12B441D2E9433EEB0520283A5872FDBC6B0 harrisonrosenhagen
438,375,625 *2C63134A907B31940D1A7831A038CE0BF23F1534 HARRISON.SPIDLE
438,375,626 *2C65FA8986E0C243A84B0BB6251DBCB17334744C kevenludy
438,375,627 *2C6367F2560BD21DBE7DD082A308185878AD8166 harrisvaroz
438,375,628 *2C6811017AB0404C82FE240D2C2EA1EC6C68B7FD KEVINCONTRELL
438,375,629 *2C67853442B3B2CE4E3A58D5A90D400618B5A18B KEVIN-RAYNES
438,375,630 *2C6F643BBC6CA8B536A77399B27A26F5BEC9E9D5 HASEEMKHAN
438,375,631 *2C66D3346C95590549755A5226C0AD36F66297A7 KIRK.HERTZ
438,375,632 *2C61725F97FBB89FBECBED10E07076F1E0580D63 KISMISTG
438,375,633 *2C653FC9640BBAB7AD99CD39438151275506B13C KITTYFINN
438,375,634 *2C66AB3AAAD728A3D756FBCBA9E1863028EAF67E KMWWQUOG49
438,375,635 *2C60B380DFFF80CFD0E22F378E0625574CA2271C HESSIENSE
438,375,636 *2C60BF4FD4D27E319E1F890B00E75548489D217A hf"o
438,375,637 *2C6C4E383D863A4658334D05D277125F5DD8C69C HIRAM.HESSEE
438,375,638 *2C659A356BCF8A733B00E06AE2FA87D5E6DC77F1 [email protected]
438,375,639 *2C6FAD61E075387837F719FBBA3E668B80E9CF33 KZ0.
438,375,640 *2C6AC589AB248AC64AB8805F21AA2B957891A3A5 LACY.SMATHERS
438,375,641 *2C666A8DF351BD0290ADF0EB3C0C505D51802B9F HOLLYGRIFFIS
438,375,642 *2C64DA36E68DDCA06DBB27D0486274A96B87A760 homeokinesis1
438,375,643 *2C69D03EC5E5D21C12F53B47E88FA917E67BD30C HORACIOLAMARCA
438,375,644 *2C6D7379A27493067F9E2F19A1DB7EA1D96A5B1C LANFORE2
438,375,645 *2C68E46E3C9EB0869634CB79E7C0A7EE5CA56C3F LA.TRAVIATA:.PARIGI,.O.CARA,.NOI.LASCEREMO
438,375,646 *2C6EFADBE431136643FDF57C257D76ED98FB61D1 HRSCHKKN
438,375,647 *2C66D444F8B24456637ADCC46C7BC40ACA702B3C LEAR: PART I, IV "HIER IST DER PLATZ"
438,375,648 *2C6C148ADFCDA8F1CE42FF9FBEC3A19FB5909EFC leighritzert
438,375,649 *2C62888C4B29262065F15286D6F5743943822DEB LENNYHULZING
438,375,650 *2C6878BB9DB6A7E655959695CE677F472030572E HUNKY
438,375,651 *2C663A107A0160F86B9D06A4CF88E8D51072B1B4 LESLIE.KLINGE
438,375,652 *2C63C8188677DCBFA7E05218FF36ED49ECD610EC LES.NORTHRUP
438,375,653 *2C600CE5341699B83A2758C06D9F2F8B71C35995 HYRSYLAENED
438,375,654 *2C67D0F54D11E7231B1048DBD252385D3F570A33 ICHORS
438,375,655 *2C64BE8A365509BFB060AD35F1DFE5D52EFBAA69 IKASESIMING
438,375,656 *2C6796F0BED420F157EA4D714164637F4C2075B5 «illiniza»
438,375,657 *2C64685C4C84FFA9D413B1843CBA4D101422711B lonniecolman
438,375,658 *2C6ED5EC6D972FA0A1F99E957E5D667D285A4D79 LOREN.IRONS
438,375,659 *2C6BA5B09115A1AAB631B06FD8E107F986F60B85 LORENZOHILDINGER
438,375,660 *2C64E0DBB7FA680C7BD9631E4F32A6E9970EE2D9 LORENZO.YASKIEWICZ
438,375,661 *2C61A835F20FAA3C7B978CEFDD7B45649E95525C ILUVSPACE65
438,375,662 *2C6A7C29D167E4CD0045F5EAAD52872E8CAE0CDC IMPO55IBILITIE5
438,375,663 *2C637B31F830ED8E17E5A7A99DA7D7B4E4A8B801 LUCIO.GLOWKA
438,375,664 *2C669EBA67D814A3ED615286F72C943CEE0E6331 individualsensuous
438,375,665 *2C63CB5C759118916CF4DF556E43D9E7113F4FD9 INFIND.COM.AUWWW
438,375,666 *2C67A7C20414CE5800F9A309FE3022FCC148F75A I<N-I
438,375,667 *2C621D1150890E88554848A937AEE76668CDE0E3 INLAND-KNIGHTS
438,375,668 *2C60C9EFF2061E6A624CDF7A031A8596859DA64F lydia.dela.cerna
438,375,669 *2C6940F98FE06CEBCBE3AC089C50D62BFFD6C3E9 LYLE.LAMOS
438,375,670 *2C64848047608DE158636FAFEBFA167CE306F83D insubrie
438,375,671 *2C68DC0F25511EDEBA7E66B907EE9FDA6C7D3ACA M103383
438,375,672 *2C67BD2A66420172A096174601A2307C7BAD3930 inveil4
438,375,673 *2C65634CE56198A5E02419618EBE486C37563CA5 MAHMOUDYACOUP
438,375,674 *2C6A93B2132C6F031DAF63D646FF5439DC20380B [email protected]
438,375,675 *2C6FCB4F090CCB12E4F0C410909FE4522E0E58A4 IRWINDOUBET
438,375,676 *2C68848B5D88B53BF9113CCF0785ED03B4195E05 make me high (feat ava)
438,375,677 *2C6B3140D2F1B2C6DAC18E7454713979EB89B001 IV0>
438,375,678 *2C60F1B3C131437A2C97E637936271B001E8A506 MARC.MALPICA
438,375,679 *2C60FCA5C1831A7D55108AFE8CE8A3C3B2C2A3BF marcosramundo
438,375,680 *2C6DD15B5A3DB983CCDB1A79D01553A17DDEE6E2 mariaalberico
438,375,681 *2C62475D3689ED58F337928CB35E3BD482D3A0B1 mariowical
438,375,682 *2C619C85F87E76F8C373F9843A1FBAC673CAEF16 JACKSONDOUTY
438,375,683 *2C6B11BB45FD6A0FF37DAED2AD7E07737D9AEB44 JACOB.HINEBAUGH
438,375,684 *2C6453436D1B9675D21488C68D309951DADE567B jaegrimaud
438,375,685 *2C62EF1C2A90BA4B7D1B7F9CBE390DC0348E17BF JAMARECKL
438,375,686 *2C63BE896F8C65FC9D083F33A67D624CEAE3C288 MARVIN MAYNARD
438,375,687 *2C6069754FB7C9642345EB36BE2C5EEB507BF46B [email protected]
438,375,688 *2C68B12326CE0B525AD0204CB3EC6FCDEDF2D2CC jamierape
438,375,689 *2C62F2191445F8D59F0D3F60289738F108B3B443 [email protected]
438,375,690 *2C6C8C6E66D526EEDB1E9439D28B0C235E4B2AD9 matter.of.concern
438,375,691 *2C66E071CE6AED5620AC56078D9D3847F558A28C matt-halewood
438,375,692 *2C6A506E52342B13E06C2D22B95AAA02D3290546 maxime92072
438,375,693 *2C61DEEFE4FA104C9887804B097D1981643D9B29 MEANDRI1
438,375,694 *2C6629F243148B0B88454B6E7F3CDB4A9160E913 ”medyk”
438,375,695 *2C68623CDF37F1D3183A7C7FF8A06BA43DE4C838 jasperbilotta
438,375,696 *2C621FED7F7D6B89E5496C2A8299D77AE76FCBF2 mickeycroston
438,375,697 *2C619C7C581717EA2C2F5FE0FB5B7366B90A8D16 JAURTI
438,375,698 *2C6E5ACE510C910C9541E6E334F79CAEFCFF389F JBREITENGROSS
438,375,699 *2C69383DCA0780A5BD1FCA8C48C31BBDBBD27734 MILLARD.BAMBECK
438,375,700 *2C664F21BC8594EE5CB92FADD74CC967ECF110E8 MISM4N49EMEN+
438,375,701 *2C6CB791F79C408109F4141414A25220EFEE73F2 MODESTO.MOLOCK
438,375,702 *2C604E6C212CC8662CD3522D01020A010855E5BB mohammadvicsik
438,375,703 *2C6ED7A2B8063346F545D99EFB8FCC55907E7959 [email protected]
438,375,704 *2C61CEEB85A40752E5600270AF6FC5D6397EAFEF JCOLUCHI
438,375,705 *2C6ED68B7238645241F90054CCFA780E13357F16 MONROEGOLEC
438,375,706 *2C66F2394F414A8358B1D93F42AA6DFFBD8C144A MONSIRI
438,375,707 *2C6AB34AB529C1D9B09515085B38A22EDB75F91E MOSCOW67
438,375,708 *2C6E2E38D93993D8240FDF28B1446836EEA6B048 jellegat
438,375,709 *2C6F584891F9B78841A79F9E686F8219B79E1A3C jennfil14
438,375,710 *2C625F81114EEAA1788B986F623AF2A10A4B000A mplfnioq3
438,375,711 *2C6305C3FAB6C0A073E828940E0C7E02C079CF41 JESSICA GARDENHIRE
438,375,712 *2C6C2583A0809D7636A12A8DB5BDB6A01B1717E9 jessievandre
438,375,713 *2C655B71DD9295C87238A239623534309564E154 jesz-1-0
438,375,714 *2C6B30CA493ADA05206063E884B382B966E6061A JETET
438,375,715 *2C6A023182697A496F1E726AF03E36377AEA997D MUZUMWA
438,375,716 *2C676C76C4312F527A1A192B7ECF6FBF015AC361 mygregory13
438,375,717 *2C69993DA6C9F77B771BD5EA243A5767E148693B J|JP
438,375,718 *2C68014F6466E228F240D2E82F1FFC774BB5070D N3UR07R4N5M1773R5
438,375,719 *2C6CB38578AF993DC542457FDA139E0A3EEF8E85 NAEIKSI5
438,375,720 *2C68393C771D4ECD690393A6C22F2D06953FAF1F NALDSKEE
438,375,721 *2C6136CCEF1E59990ABAAF743E14FCBE5B48434C JOHNNIEZWILLING
438,375,722 *2C654460465F4401048CCA5D715FBC70322C8E5A JONASSMALLIN
438,375,723 *2C6036E747DB05DA752899C86CE8956737070D59 NATHAN.RINDELS
438,375,724 *2C6AC945BB5AF34AB1214685E00F90A570C3B336 NATNANCY2
438,375,725 *2C6572228D65A9B68388D1ACBBE1F2AE20DE7700 NDEBLUME
438,375,726 *2C67AC53637F77951E69A8A59DD0B5B25EE7E92A NDRBJSLP3
438,375,727 *2C60104222286EE9F779222C6AADEFB8792FB87C JOSHNEGRO
438,375,728 *2C6BD4B36851D26107335F5AC1A6A1704B9726E8 JOSPEH.SENFF
438,375,729 *2C6F949212D235E605BA444DD4B8739C29B3377D nelsonlaubhan
438,375,730 *2C65F48DA7E3AF2F4C73D1E54FC046A14564E6A6 NELSONSCHANE
438,375,731 *2C6DA3574C52785BC54D6D85EEBE4DC6FEA7B4E7 nemo100/
438,375,732 *2C65BA793061507120CE8BC7261A370F59B2B1A6 <JTAAA
438,375,733 *2C60D93288D81F79F768CD071C876C3D04A35478 [email protected]
438,375,734 *2C67F7D5F29B0256059AC543788AAA2386E74C5A [email protected]
438,375,735 *2C6F873D39506A7433935F7D6774FEE8ECFF06BD NGSPECA.SVG
438,375,736 *2C6E24BD6630ADAEF4F489C245884C532D186217 nhahrhew
438,375,737 *2C6DBF22BFFB2E687F61B10C3B20B09ECD5CBE48 NIDDERST1995
438,375,738 *2C6A445321B574F16E3269466563B8D681571ECB nikhilgonsalves
438,375,739 *2C662BAA0BD0D51DEB3A5BCA83EA6383F74BEFE8 kairi-hikaru
438,375,740 *2C6277CBD53E565FC95FAD16A23D00C8B0B3FEB0 no 3 / ii air
438,375,741 *2C683F60E1B1E2CEB70412F0A8E0DF14B8E611F1 NONARCHITECTURAL!
438,375,742 *2C6CDA07416016F982F39544DAC02E97F2E3597B KASHGHARING
438,375,743 *2C69B38F248F89EE1B0366E13F3CF9819CB367D5 NOSTEP.2000
438,375,744 *2C69F861DD6EB7E51B9C13679B50A7158E77AE42 KBROWNBRIDGE
438,375,745 *2C6223DB655F4C4C8AF9688E75A17104C0A5C861 NOVA MANASSAS SYMPHONY ORCHESTRA
438,375,746 *2C62EA480B04D3655F197D8DECD702CC508C85DE keep-on-shining-(feat-john-gibbons)
438,375,747 *2C6EEDE06EB8B17D6571608F72144A1708EA7523 KELLYSCHRAFF
438,375,748 *2C64BB68DACE1F04ACF302C53ECB62DA7CC36801 NULLAHM
438,375,749 *2C62752783EA4795E691A48CA2B8388646CF52F4 KENDALL.DIMLING
438,375,750 *2C6DC7A9ED49D39BB73C0556298EE9536A6F5B96 KENETHDOVER
438,375,751 *2C6904A3200F9DC317F6E4EB90F2CBCF31C0DB9F KINGMARTICH
438,375,752 *2C682F3AB35AFC85CD0DF06C4F48934BF90B8435 kK4
438,375,753 *2C6BBE48A00A0C9AFCACE55F1D001B1D99F874FF ocrtanoj8
438,375,754 *2C6B042C8715D799598BD19F1BFEBDC5F668C6D4 ODNAGERPPED
438,375,755 *2C6E29F4C526E3FA027B6B585F40541F6869F918 koningsmantel
438,375,756 *2C6A8DD1CE5109039997292A7C7381A04E14DEA6 oligolycosides
438,375,757 *2C690BE8B85CD1D0508EBEEC777F696E048B8DCC KRISTINAFRENCH
438,375,758 *2C67028952192285226D1ED748585A76A488E9BC ONDERHAANDELT
438,375,759 *2C641E2377083CED3E37A0DEB13915B92DCA7A0D k,y
438,375,760 *2C67A8C55471F13CC7ACE1DD036A40F005C8FB18 opernprojektes
438,375,761 *2C60CF1DEC0D2BC4D5B9FDC991161D13F39C3861 [email protected]
438,375,762 *2C6046E25999A3F607E6161456C657E1921085F5 ORLANDO.LALIBERTE
438,375,763 *2C62AB01A865CCE5D7770A719DD2A75E834D81E1 ORLANDO-PAREDES-LARA
438,375,764 *2C61480B9E12746E0B3D9C85059B1CC3368863B1 LANSKING
438,375,765 *2C62441F9775AB301B8ED73AB67B9923413949C9 LAST-MAN-(FEAT-T-BYTE)
438,375,766 *2C61410719F17B57F498B9E2885CD6B8A6086110 LAVERNE.BAUN
438,375,767 *2C6ECC6368FF30DB2095541D7953A22B5DCC89BD osvtlil7
438,375,768 *2C60EA4AB81CBC1A3B37765C81B75556D3F9A8B2 OUBLIERQUELETEMPSPASSE
438,375,769 *2C63E3200F22DC28F956AC8754622D53F94C03F6 leifdemoya
438,375,770 *2C6DBE0387BF3A130DEF39CA3842523497926713 P3RP37R47!0N5
438,375,771 *2C672F0FAB8AC98871B139C61E4D6C6B29254DEB PALPALHAIBHAARI
438,375,772 *2C6E9AD445AD6772F9A83D4AB775600B5B5CA965 LESCIRAULO
438,375,773 *2C6C580C31BD4A7D5F8BEFC03F09A031157CB267 lesleybichrest
438,375,774 *2C6474C2E9EFB77106F912B1776DCDC18FD37A59 [email protected]
438,375,775 *2C6082DBF272F572FFFC94356958A7C6F520F71E LGKH
438,375,776 *2C61D2EC0526017C2B14A926C42F1763055580DD [email protected]
438,375,777 *2C6C438A6CB7E2D3FC3AD0739C0EDBACE586B898 PAT SEELY
438,375,778 *2C63411DC70F6849930AA1FC89AD05CD20DFDE6A [email protected]
438,375,779 *2C64CB22E67005C32BB81BA7AAB3486B267F9D04 pD`~`~(00)
438,375,780 *2C6F80B2022D3559EDC45EB1F5B839177B1D8A05 LISA-LYNNE-FRANCO
438,375,781 *2C6F6B5EFB028AA9C034F43BEE5EB07C7518919E per-incantamento
438,375,782 *2C63F7F682D9282201FC7E001776E55B290B6527 permu747!on!575
438,375,783 *2C647196084F2A4830F37B432AF03FBC757F9EEE PERSEWING
438,375,784 *2C66029445732887B919C7805E8502B08C9A6F86 LLOYDCAVERLY
438,375,785 *2C636E124673A3E6AC0F23DB4BEBF23005181476 [email protected]
438,375,786 *2C606DA44EF619A29567B554BFE9597D3D81E19E phhnjp
438,375,787 *2C6D6F66997BCC259056DA05327A9ACBBFF52F39 phyllotelmatoscopus
438,375,788 *2C6F919C5C0301AC32B08412FF4F7C5336FD62B1 longrennon
438,375,789 *2C6BC477C34AF84C3501A2E9463E40413121BE72 [email protected]
438,375,790 *2C656DECE2BABFECDEA3DD760B8BC686DBB34C3F [email protected]$T$
438,375,791 *2C69F8DD20ECA3B28AEF3D66AEB80BEE9724FC64 LOUIS.MACALLISTER
438,375,792 *2C6A5947AA685F67F6AC0BFDF8F82066B28E1CEA lrutmjd34
438,375,793 *2C68A476F1E26B47DA8245C534B43A34BAFF1DAD POLICYPOWER
438,375,794 *2C6226D2E816DD385D6FC1D345F21C7879E4058B POLTAKSAMOSIR
438,375,795 *2C68D30822316120F22D9F71C69459C901831328 LUVROBIN4
438,375,796 *2C6F26CD767E8847D9DAEF5FF61A4D71F4366132 POSAZENA8
438,375,797 *2C6855DC30E46B540F9FA7F62614F26F0314BF58 lyf\
438,375,798 *2C61B6921E3B15891ACB42C3B2F5E8D7E0FBED80 predirect4
438,375,799 *2C6FEF118B8DEE8AFB85C51B9E12DEA496DE95FA PRGNLSS5
438,375,800 *2C62AC255404F68EF27A06B4A2458221C489FB31 MANANDMOLLUSCNET
438,375,801 *2C62A58B1977E6E1B9C2DE2F168AB64C31ED3873 pritchardbodied
438,375,802 *2C60E468AD394EC91889530B2DD67D1F494A1967 probelm2
438,375,803 *2C6230421DE695B9655223E8037A4650906E0F88 MAN.LASSESON
438,375,804 *2C6829FE73F2E3B9AE32557D292F491841A03020 propeciaresearchtod
438,375,805 *2C61832D115D302578F4606ACB390F276DAAE9F0 protopods7
438,375,806 *2C6A2D43A136A427CBBA7281847CE81FAD4B4102 MARCELCAPEHART
438,375,807 *2C60C8DF6FCB03AC9A7DC6CD4C2DC24B3487F71F MAR-CHERYL
438,375,808 *2C6BCA496F8A7C475E6F0313B93F2F376B1B9230 puenteal-sarafiya
438,375,809 *2C6CFF01D745389833C788EF562E81B95E76CBC6 PULTTIKAULA
438,375,810 *2C69CABC52DE3146939B96D3251AFE3464EC70FF MARCOGOERS
438,375,811 *2C6107822B321ABD27B7E8FF2E6D6F6EE9315008 marcusishot
438,375,812 *2C68DEED1A971B3DA61E127B531823853CFE398B MARION'S-FRIGHTENED-LOOK-SHIFTS-SUDDENLY-TO-THE-ENTRANCE
438,375,813 *2C6CE7274A6B23894C6A6783D86C2480622F98FE MARLYN VELASCO
438,375,814 *2C6433A3C1355FA8318580966C0537C989EB6626 [email protected]
438,375,815 *2C63165F3E78A87D611296FA918263433543D43C QIRSANAADEE
438,375,816 *2C6A7D968EF511E2B2881E552A5321B4D7EB70E0 Q=P~O-~O-SPLAT
438,375,817 *2C63AB4E1730A1C1DE60B01557F0EFEAC72775B6 [email protected]
438,375,818 *2C6CC908549E25EA2A2C1A631630790F252AF340 QT61
438,375,819 *2C62ADCDE0E4C1B92322ACECBFE5D82FFF9FD519 MAXIMOWHITMIRE
438,375,820 *2C6BC78EF5F7F1F17FDD2070D05001995208100B mbayimbayi
438,375,821 *2C615E376437376FFCB5A3C3C6062D5E3961A5B0 R3KT0R4L3
438,375,822 *2C65AA862D41D9DC8E581FB75E1C3F48B9E36EF2 r3n5+a115
438,375,823 *2C64D26EABB0981C8B0946E749979962D30F778E rags'n'run
438,375,824 *2C6CD4A71A6EB9DC0926D5668E116118A11D6F05 Mental-Atmosphere-(extended-mix)
438,375,825 *2C6B5E4B28AB6AE4920EEA068DBB40C75845415C RANDOLPHPIGUE
438,375,826 *2C662A01A0E77945E0A890A507087518ECEED295 RASHAD.PUORTO
438,375,827 *2C634AD9357F5D3AF8D842D647245A4E99658C81 ratones
438,375,828 *2C607DF56C416D358B318932EB231C489145DE4E MIGUELFALKENBERG
438,375,829 *2C614B77F005153BD75D7BF1DEDA8484620E884A MIGUEL.LOOTENS
438,375,830 *2C66D4B7EBCAC9738FF3701683A94E30AD7C4935 MIKE DEIULIS
438,375,831 *2C66FD22079D1F95361FE2901C3B6A658A7858AB MIKE.LASSO
438,375,832 *2C6E182A3C9989410990578BC697AD1E797170A7 REENGRAVE
438,375,833 *2C6CBA8509486E1F6B044B35E7111392B2326BBA reggielasage
438,375,834 *2C636AEDEADB947A05FBE669E9AFB0C4EC780359 reggievose
438,375,835 *2C6DACBE39A26ECF876DFB9C066B55A541257EB5 MINORITY2005160TALK1
438,375,836 *2C61A3D12CF89A6A5B1B8BFFAEA3FB5D32029223 MITCHELKARMELY
438,375,837 *2C66CA1CBCBA9A681CFB761E72475CBF72A325BF REKITTEL9
438,375,838 *2C61FF13E6DE2DB98CDC474A4D44402225F99B45 REMELDE0
438,375,839 *2C62F18750141197EC39C75C99B5CB7CB5866769 REMMUNTSED
438,375,840 *2C6291314C17F8AE4470DBAF19ADAD027BE471FE RENEWING
438,375,841 *2C63D5741D66B4ACEC087DA64BDEA263DC53A5EE MORRIS.HALDI
438,375,842 *2C6177A985E243215817B763E160994E4006223A MOSEDICOLA
438,375,843 *2C6CA20B56B2A124692140C3944D225004CF4809 RE-WEIGHING
438,375,844 *2C6DB6D7145F38C6C8823D4D3E96914F1B181423 [email protected]
438,375,845 *2C6D4ED0A67E830AABBEB0CABE41EBE30FE40465 RFPUYNCKZDMPXL2
438,375,846 *2C668B583D2E5707C4942CDD39679ACF09346693 RHODOPAGIDAE
438,375,847 *2C61437FA327F8D41B8307EBC3229CBADBA4760B mybiggles1994
438,375,848 *2C6014BA95DD58510BC6848E9B5E8A6EA04AFD20 riz.aguilera
438,375,849 *2C61629C73B7D5C3B6F54B70ECB5609D1FFAAE5D <rkaaa
438,375,850 *2C6F3830DD302FC2CF44C49A13D1AFFC40833D1E ROBERTHAI
438,375,851 *2C6169B0E856F8F3F392FE7106C16CA66E17BCB7 NADA.DEL.MUNDO.REAL
438,375,852 *2C6716BD36F78CC0A066B4C4DFA9112C6174DBF5 roccodorcelus
438,375,853 *2C6CF49ACCE60AB41D6AE30D8A62DB96E67057C1 roccohorgan
438,375,854 *2C6ECD9D4D5175C3D87058F0E603A9168740CE18 Naltered-chord
438,375,855 *2C62E9A16EF815BC11F3D026A9AFDD106E2F4DCE ROCKYCINDY
438,375,856 *2C6620F3EDA6406231EA207F434B8F7877B42B47 NANDINI.RAMAN
438,375,857 *2C69B3C1D606392DA4429750D15647BDF6F7D36A RODERICK.GERDEL
438,375,858 *2C6D43B70668BF64F909D81C05428F3A6C86EE57 nasaenhancingunmannedorbitercapability
438,375,859 *2C6072525167DDE84E730109D95882CAE96377AC nathanielkazarian
438,375,860 *2C6FFEA5CAA9755E0885059B653F80F58928FA08 RONNIE.KESLAR
438,375,861 *2C6696DA5AD1E18E73AD1F23EF2B79A12AA110E1 NBilly-Budd
438,375,862 *2C6EEEDDA33E3E43FC757BD89F3EB631A9748B57 nealstride
438,375,863 *2C66B60A0A6BB5B3E83AE2D94F665C8D26AAB224 ROSS.JARNAGIN
438,375,864 *2C61BA687097830402B5E8BA081D73921BD70244 NEERCS-EHT-NO-DEYALPSID-ERA-STLUSER
438,375,865 *2C67BAAAAE573EC40066B014AD546E9E5EA9F924 NEJOBJEMNĚJŠÍ
438,375,866 *2C656B146D693748046A10BAD36DA5DF6A3622C9 NENOITKEJORPLEGUK
438,375,867 *2C639F939B04318A20B4CF8CF5347F76B0C90455 NEVILLE.HUSNI
438,375,868 *2C6C91FDA36C5DCB9E8E3E25CE468660519D1E0C NEWS-OF-YORE
438,375,869 *2C6B0CFE979C652FA0D179625A577AB154F578E7 RUDOLF.GIOVANINI
438,375,870 *2C6243F372808AC29E93C501F39FCBBDFFC5B100 RUDOLPHPOINTER
438,375,871 *2C6056DAAF3AA61A1657A0196D62DDEAE8C780BB NHAYTHANZS
438,375,872 *2C6303BF63A4A560BF62121F9929BA0C472FB017 RUPAKPATHAK
438,375,873 *2C6CB39D326F131431AF3AA9A27FED2CC78E1FE0 [email protected]
438,375,874 *2C692B51D4A2F46CD7C1FD759F7602EE36E2614E nickwanland
438,375,875 *2C6BA67C8008DE4C2C49DD0B0D9E1FD6D1222216 NICOLEMIJARES
438,375,876 *2C613486E5D1CE879FEA122587D90B863116D273 niemel
438,375,877 *2C68B3C76ACDD8F810D929355A3D1A2AA832BD1F NIKISCORPION
438,375,878 *2C6E3BE12A582A9DE667961B034AF0D825875F18 n'l'gnc
438,375,879 *2C601024FF580A37D069831F39AF83677459DB98 SALFAUST
438,375,880 *2C607991793CDAABB54FFD306DF5498082BEE915 NOISEAMBIENT
438,375,881 *2C65E3E5BD6A8257EAC911539ACA5FB65802C3C2 NTAM
438,375,882 *2C6B7AE296B9622844227E301695666699A9653A saxaque4
438,375,883 *2C62061E8CE0EB053AB0F1DB7E926948DD9F9FEB SBBQBSW9
438,375,884 *2C6D592CD9CAD875B85529A19136FD22F4AEFFB8 SCORPIONCARLOS
438,375,885 *2C66F55EE2E502E1408F164894BD81D8650E8BFF SCOURDINAMO123
438,375,886 *2C666194D963371D31790CC2D3B58E4B7741E303 sealsofgessa
438,375,887 *2C66B8C25087A805A6C0A8ADE1DB363CC58A3510 OGENOMF8
438,375,888 *2C6DEDB59E01D77183A7338DAF2C11DBBBD9A733 SELEKTERINGA
438,375,889 *2C6A6E87BE486DE72F406565706530340494B9BB OLOGHLIN6
438,375,890 *2C66F4F45B71038864C3E29D8FC7B99C11AB3E0B OMEALLI0
438,375,891 *2C61F710A399BCE2EE6278E6D1DF55FC07575FB6 [email protected]
438,375,892 *2C67E2F83F35FD61E1F6C266CDD1BE6AA2745B61 SEXUALMORALITIED
438,375,893 *2C68B8026DBA985621635F998C003AAE523AD803 sexy-girl1
438,375,894 *2C60212ACF4141CF1FD8F088CDB214AAF30E33DC SHABBIRSHAH
438,375,895 *2C65288AB1171696678E1975225BA3342C5482ED shari-mcneil
438,375,896 *2C6F5368D6A6EE55C99281EFBDFAA40BB934B601 [email protected]
438,375,897 *2C6ADD75F73F5F549FA8814CA3E92F1693C3DD3A oTHeRNoNKeRNeLNTCBFuNCTioNSPRoViDeDiSTiNCTiVeLY
438,375,898 *2C6BDEF548E88B908FB16851606095F39EFEC714 outland15hly
438,375,899 *2C674A4A001631AFC180CBCBD865D9F749ED0A6E sherwoodrayno
438,375,900 *2C6F903EE046DB98FB073CC4C34A55CBF3E1B9E3 shreedhar.chitnis
438,375,901 *2C63919DAB35E4CBE4D79631219283BA87EC6B91 SHUG
438,375,902 *2C60718F578B826E2E795A67ED433219E4C79626 PALMERWIEDEMANN
438,375,903 *2C67222AB41B06426B86187FB275E6A9FC927A99 SILACREM
438,375,904 *2C6849083BC3A0B72E2BD1898045AE50C3AD4EF0 PARDONMEFORASKING
438,375,905 *2C6FA3593005BAB6173A0940C8236BAA4CA81DBC PB~0~osplat
438,375,906 *2C6A78B0B983768EE5F252AE4869E054E2803641 pensiero
438,375,907 *2C616E6B958A82BEABA1B8BC5945F177E113B81B percywiltsie
438,375,908 *2C609AC4706162CAEE78E7C4625B1661C35CB186 SLOVIU
438,375,909 *2C6231B347BFA3DEA9522D76D625C09C590DD2F9 SMILE-TO-THE-PRETTY-ANGEL
438,375,910 *2C68826E0FB5E18E1A08986DA3D2C5E841FB4CD7 PHILIPPINESDAVAOAIRPORT
438,375,911 *2C6A219ABABAE818C52AF8E1064DA05A34BAA436 SOLOMONEGGART
438,375,912 *2C63365AA4626DAA89D5D00927B574FEFB8647F2 SOLUTIONSEPTEMBER
438,375,913 *2C60EC33446FCF63D56D3F57D50C00E7F06D84AE pisz(feattzwm)
438,375,914 *2C6B50286CED202B8A02D35194DF9AE32D125A2E SONNY.TURRIGIANO
438,375,915 *2C6DA4F6E2727235F36EADA9D363378809E24839 PL)H
438,375,916 *2C6AC860F21EB1F991F5979572D078A1FD31490E polleando
438,375,917 *2C61519CA196F5BD0421E7A8FD831ACF9B513143 Splat!-O~(---p
438,375,918 *2C6E09F59268CC081AD3BBCEE236EC964A4EBF26 [email protected]######P
438,375,919 *2C68A1DD3933851E00604D3988CAB2FE928F1C04 popshow
438,375,920 *2C61ABC7D0F6F8F372C69A3F7E0CBB3DC64E5A1B SRQ~
438,375,921 *2C6FC5BE554607F85D5FD38A596C4CA6B14F0EF1 PREYBIG4
438,375,922 *2C664B57D999B3B0F1E9FC4A28AAB07748C48872 PUJADORA9
438,375,923 *2C6EB04719006C7A9A9F0BCC5EBF9D4AD016A85E [email protected]
438,375,924 *2C64B3B836542EEB69C48E75B13E2CA289546BDE STRELSE2
438,375,925 *2C651845008E3F909E69F65EE0A084858BA63A83 QUINN.LOVIER
438,375,926 *2C653B4CBC7450647A74CB7B6BFDF054F1696D65 quinnviall
438,375,927 *2C6A5E27E80486C12E24C86D5DEE79CB958A6E3A QUINTONSIGNAIGO
438,375,928 *2C6080D522D1F3429DF54E9CAA88746CFA8F9DF6 SUNDANCEPAPA5
438,375,929 *2C684DB6689E485D589B9234CF34B2992DF75C7A RA^+
438,375,930 *2C618F9CABDDED6E3E3722D0D5348F308DEE9B95 SURFINGFEDERATION
438,375,931 *2C61D107559A0DDBC5BA14B88C408FA621D15441 SURROUNDEDLY
438,375,932 *2C60EA1CC59FC40605E2D6F97EC35057E2A49A20 RADULIFEROUS0
438,375,933 *2C6D2EF87C4D7F61EEE142A5D79074D0A38036BE rafidahabdulghani
438,375,934 *2C631A63434E375184C100CB57932A51D42EB4CD ra+ho13$
438,375,935 *2C69266CB1BBA04045486A3BAD4B1CD187674B00 RAMIROELIEZRIE
438,375,936 *2C6D9C3D9AD27685A502A3BCB226C1CD3AA6F36B SYH4692546
438,375,937 *2C67C0166FFB32422AE0D3013158883D032FB985 RANDOMHOTROD
438,375,938 *2C6A77316705CC74F9ECB0710D201209B76118EA SZILVÁMAT
438,375,939 *2C6D145674C748A075F93F9117E0EA20668FCFCF SZTFV5YPCZH
438,375,940 *2C664122E494E04788702005D51CF1FA69D7BF70 TAKAMAT7
438,375,941 *2C693E6A27416976C50B4D2EAB8557513E68A1B6 TALKSOUTHERNSOULJABO
438,375,942 *2C6023087A00BE78E49DD601B189AF9389B43206 RCRISINET2
438,375,943 *2C69FB7AAF264FAA6EC67247C5D04EE1764BD862 rdtlgrmed
438,375,944 *2C6126536918E836C08A11C66C3B9AC9D84B4B25 TAMI-FORREST
438,375,945 *2C65B5F8B0391F8ADAF5D5DBD5184D2CFD69A09B READOPTEDS1
438,375,946 *2C6E0401CA6073DAD26A31A18B350CCDCC748114 TAMOTTUING
438,375,947 *2C6B8429631558EDC375C21ADA56764B0CC97E0D taniyah559
438,375,948 *2C6DB3EBB4074697C4995594F2C6CA6FE74EF05C TEDKILVS
438,375,949 *2C605CC9FBE1AFF0CFC82D159B6BEE56B5635D11 REGPYF2Q
438,375,950 *2C62E176F095BAB68A1ABF1FD910CFB788AC5D95 TEGELS
438,375,951 *2C639152757AA2BA22F6C8697B34E328E6987824 REMELDE0
438,375,952 *2C6A7EB7E65B157365B9C2BEDA4BB4775E288006 TERRANCE.BRIESE
438,375,953 *2C69A76435B6B9E0AD51EC05B46D8B6B1E3F0063 THALIA OTERO
438,375,954 *2C6572810680B807B05F2F0C4782C16B899FC3DD THE.BLACK.SEA.SUN.IS.SHINING
438,375,955 *2C6DFB5E0D698CF301264528F5EFB1AC4CF31C8E thecomingrevoltoftheguards
438,375,956 *2C6D6B9ADBB36717354BA248D56B8E15DA8CB423 THESECURITY05
438,375,957 *2C6DE3D540CB8CF5611C63AD299AC260C2ECAA3D richberg12
438,375,958 *2C6A6669BF28F0FC49D7CB7380C89F25D22A72CF RICOBAESKENS
438,375,959 *2C68D77B382354241ECC19171691BAD20E80A743 RIKKIDIOKSIDIPAEAEST8
438,375,960 *2C659057A2D08C6FAA92E0B71C22D6F10899B564 RINZAISH
438,375,961 *2C6E163778805B9914FF724BB7F5E787E31D78E5 TIMJACK
438,375,962 *2C6695DACB81FA93684DECCAA5D473E99A561836 ROBCAROLFI
438,375,963 *2C651857D101FA87B9E3550744A1ACD8C0EB561E TIOPHAGES
438,375,964 *2C6DE7095749C49D02255A2978D5D1EF0D7A73B5 TN~
438,375,965 *2C6A7EA94E00853DAF845EE093D3967C6C688C9B TOBYSPITFIRE4
438,375,966 *2C664DB26718497BDB8E04946A79F2D1EB2C6306 TODDMCCLENDON
438,375,967 *2C6CF96BDADD1D1571B4DEFDEEF775E8B2FA7EAA TODO POR DUB
438,375,968 *2C687FE32DD4657F7D86BCB5FEBFADE1C2351760 TOMCATSMILEYS
438,375,969 *2C6E1B2BDFBA1DADF127BF403D4E3A205505D4D0 TOMMIE.GRABOWIECKI
438,375,970 *2C6339E48FB5FA03CF4665736DA5CBF4164EBE14 ROMAHTANEITA
438,375,971 *2C6009AB6DFC7DE41638660FE55FD78FFFB015CD RORYKISSEL
438,375,972 *2C6BA89FA2C41670367DDB317E7E8AF492002AD6 TOWN001
438,375,973 *2C6356072C165CAD0C74B8BF18298C878FEDB126 tracywadelake
438,375,974 *2C64C46FC4D51B402AB4D78CBD273AC8BC3688A3 TRAGIANIS
438,375,975 *2C647099415969F23BA857008A8883FD313FE249 TRANKIES1
438,375,976 *2C61E2C3D13F31FE06CED8D49FB5BC7198BC6A2F rpblknsted
438,375,977 *2C65CEFA9A0289FEFB47174CBF2C21A9DCA2D150 TRECEMAR
438,375,978 *2C6A33E45190F7DD00B25E1B348F9458645BD7DA treyelek
438,375,979 *2C6A04B5138B7FAF83E9F0F3D9088F5B8C979E50 TREYNOLDSBSW0
438,375,980 *2C647B6BD44775D7E2B6F160D8F4425B0B43E31A treypoeschl
438,375,981 *2C6C185F38B0114D913D863D22716196E7A04C99 RUSTYFRISHKORN
438,375,982 *2C6DEDB24A2B63C65047AEAA9B87B487C58D6DAA TRICIASUVA
438,375,983 *2C61613CA5F5EC3486C36C6983462774889F1B82 s<0l
438,375,984 *2C6A6233556769ACB68A50E24F1E1698C7E7519F SAAVILLA
438,375,985 *2C6F8CAEACB95D1A35A6ABDD454FF42DD6810FEF TSEIDOOM8
438,375,986 *2C60A30900E4B8B75AFCECFAA1942AF7464F611B salvatorebedson
438,375,987 *2C63664DDB876BD01A7108FBBD4B79691EC8CD09 tuawanamariebarneshickman
438,375,988 *2C69A3E40AA69AD1C588C459CA44BDD475A69F8F tubesing
438,375,989 *2C6164ECA6B689E31F15669F760F5AA33F4AB203 TUKIYEMI
438,375,990 *2C64B6BC85CBA9D9B40BF9E55C8C77532610FE23 SANDERSFOZZIING
438,375,991 *2C6D9E67B6BFA74A2C5A8F53D5D82F27B6B25E5F [email protected]
438,375,992 *2C6F7566CD8EFCFA2A31825CDD523CE3701EB5AF SANFORD.FETUI
438,375,993 *2C6AB758B6E323E94D2FC35D6152DDC1721434EB sarah.itani
438,375,994 *2C6578031350A4EA5E1775E2F05A3524ED1DB10D SARAI ARECHIGA
438,375,995 *2C67DD8B026CB3A02B00A36C7B05FD5FAF71DFC1 TVEGERNES8
438,375,996 *2C66FC46AF2426A5A2D840B34644BB8EDD09FFD0 SARANDONS3
438,375,997 *2C615756C14E167CA1278AC4E299324A2B21ED1D TYMURZAVALNYUK
438,375,998 *2C64F5A8C59C8656BEAAA0CC30D2E5D6A5DD311D [email protected]
438,375,999 *2C6FC1C13F20343AFC56A3B744E1F77A2463964E UCCIDERLI
438,376,000 *2C6479F0C35D065C828AA1DBEE5C025A36BA3276 [email protected]
438,376,001 *2C6FB12508B1E830460FBA0FAF337C89507D9E8D UND15PUTABL3
438,376,002 *2C62FDF06B897C0B57DDB6C864C0398C7C6BB42A SCHREMPFPIAROWSKI
438,376,003 *2C623F40D0236D16C3416F25E24892EF203C973C SCORPIONKILER
438,376,004 *2C63F5C844E56A60A1ABE0FF8F7CC35054FD843B SCOT.CANUPP
438,376,005 *2C61833B01AE352E3AF5E29886611EC06EA7EEE5 UNPALA71AL
438,376,006 *2C6411B7E7E1EA5CA32C53B93D9479243ED2EE50 UNSINEWS8
438,376,007 *2C6AC39F7095DCDD6BCC7CC529D172F92109BE00 [email protected]
438,376,008 *2C6E57821AE8DEE71D6773E6D6151AC29604A670 USEPOSITIVEDISCIPLINE
438,376,009 *2C6A0A95744F8708891330640DDDDCB224344E77 USER86.128.19.132
438,376,010 *2C619077FF655853575A701F8B99C69CD0157B3B /USR/LIB/PYTHON26/CSVPYC
438,376,011 *2C6F5B83664F02F1EE53357E61E1F93F92EFC0A1 sejfeiled
438,376,012 *2C6CDF53D9FD677169BE4BE02A2795441534B493 SEOULINSADONGFLEAMARKET
438,376,013 *2C61190232FAAD6F959195EAE49316D827D903AC (sfio)の創設が決議され、ユマニテはその
438,376,014 *2C6671ABC2F11510E4BA3C3BC75F58DA7BE736CD shakshye4
438,376,015 *2C61FE0857ED0E801417E35217B6353CBF22BA70 VANESHAPUTRI
438,376,016 *2C670DAE08A52B3087F605CED2849EC356A59DFE VANESSACARMELAHILARION
438,376,017 *2C6D1D877EAD82EC429285FFD9E9A4E7E5146E79 vanessa.tshibangu
438,376,018 *2C6F9FE548FA5470E99C8852243D9CA4DC81EC62 VANETTE VILLANUEVA
438,376,019 *2C68164CA572A729518C9939780835C1491CCE10 shawna-powers
438,376,020 *2C6B5D25889D516E94F81861043501DD3940FC3C shebanaomi
438,376,021 *2C6F6397E97D56749B6E0441C89500F67C9D105B varunkhanchandani
438,376,022 *2C6942355E029B6D5B3CABAD8D8063EE7FDA5012 VAUGHANSLAYT5
438,376,023 *2C6D45E4A656031527DB90297396CEFC03FCE559 SHERRYSNIPER2
438,376,024 *2C67E312266FE01FF16E86D85FC601B47128F941 SHERYLFONG
438,376,025 *2C69A8E348FC101244C69AB9D395D26D9330B8C7 SHPARGITCER
438,376,026 *2C670F296ECD7E2FD9BD26342C40C41B3141827F SIDKINDT
438,376,027 *2C6F2F5FFC892C58A8D7EFABBA9C0E8361973957 VEXTRIGE
438,376,028 *2C64285F30A7578B7A5EA66AC84A703A4863517E VFAYXPPHBFKZ
438,376,029 *2C6EEA3101F36B4F4888431E20994DFC4DA5245B VICKMALDO
438,376,030 *2C6653E01667407DD7A5BFA3BEB0D5FCE1E67292 SIMONWHATEVER4
438,376,031 *2C68CA4CC2B9E45B8DC21BC5EA235F7C5668ECA9 VIEVIE-ACARI-SUSTIGUER
438,376,032 *2C62524F646CF7A5376826AE9AFE15D9310A54BB skisport“
438,376,033 *2C69BC3F875CF48B41C5F967DCE5FA9B26B586C2 V-LYNN-CUMMINGS
438,376,034 *2C6990326DBF12FC16895D5602267EE0B8049127 VMLZEMGTVYENZED
438,376,035 *2C6D73647AFEE68630A29769B6B77BF3052274D7 VOIACHESNAV
438,376,036 *2C6ACDFD3E42028B24EA5B282B3D326A6BD124BC SNGALLOUGA2005
438,376,037 *2C6C9459A5FF79C185F884ABCD10539E11CFCC7A SOBIETARRENA
438,376,038 *2C652FF510AD65C6EF495FCC69D6A621F76154A6 VTRLZBL
438,376,039 *2C6682F641C49E0881C8BB3C605BA0BC336F1D5E socr
438,376,040 *2C6DC3F5A164B28699D409110268AAB0EE236A64 vyzna
438,376,041 *2C69E203D41A9EE89C4543915B27AD0414FE7169 WALLACE.LUDD
438,376,042 *2C617120B325340D75B6C80BA4A694B6B6FFE2A1 WALLYMARCUS4
438,376,043 *2C6820A552CDF6656367D4DAA7065FBA43BA9DD6 WALTER.BEVIL
438,376,044 *2C64780267861991485031FD85B99984EE8E7A28 SPATELENING
438,376,045 *2C6FA28BF29DD68EEA771650A23C0EF8492656E7 [email protected]
438,376,046 *2C6C3EAEF8DED4ABC0D519815573133004A7AD2C SPEECHHOTROD.
438,376,047 *2C62CDDFEE0AAE490B42E197A085894FBD291030 SPEEDOBULLET0
438,376,048 *2C6691C7932D41437DF78756D164F20320C7A946 WARRIORSGALILEOED
438,376,049 *2C64C6B99E4331F6BA0D1C8AE5B758E1AAF1BBDF WASSIMLZEIN
438,376,050 *2C6C1C6E1007F66DA3BDC1AEF332895D535338D7 splat!! o~ 0~ dp
438,376,051 *2C6046C5872B108AB44315910345250E97BA0517 WENDY-OWENS-SHERMAN
438,376,052 *2C66B3C2CDBF03109B8C84C6BFC031131F5C58AA Sploit.~.~.~<====P
438,376,053 *2C64278B97B78082650EC519254E79BEC62B2434 SPREETER1
438,376,054 *2C632104170DD19E599B185DE575C15E9612D99C SPUNRAK
438,376,055 *2C6B9F30E3363018059141441DAB6376CF97F1C2 squab skw/a/b
438,376,056 *2C6D4E01C3F4CC849F485A59D336F081CA0BFB86 WE-WILL-NOT-RETURN
438,376,057 *2C6B362189CA3838D0D1516050FDE81D640864C5 srehcuoc1
438,376,058 *2C671EFBAEEB48D76B00C8EF3940ED502236ADC1 ST4NCIOI
438,376,059 *2C665FFBA43321395BFE0822BEFCBCACBE58D44F STACEY.LARROW
438,376,060 *2C67C1C9CF12B0F5B6FABFE21906529EB69C3011 STANLEY-JENNINGS
438,376,061 *2C6E5ECB791CD8FAC08FE265E599184A92D06696 WILHELMINAMCCOLLUM
438,376,062 *2C67D166F0A85686D1AABC2CF8A710A89A697607 STEFAN.MATSUMURA
438,376,063 *2C62F25A9F3F52B884F62E55439B0AB18C20C0A5 WILLYHERSH
438,376,064 *2C6C2BEF1107799F9F12279BB4E73E6B6EC8B8C2 WILSONDUNSFORD
438,376,065 *2C6E51CC6345E09403D5F4A2A00CCAF44E1EE847 STEVER41
438,376,066 *2C681A315051B804360C99A401396F3CAC5B9C4B STONE』(1998年)
438,376,067 *2C6E10B36BA79FEE0A62B895E9C748FC6A77CD50 STROBOSES
438,376,068 *2C6DA1E4DA32FAB2BA4D2F1E7BFB6908D3447F16 [email protected]
438,376,069 *2C648D1FF08F1B71B923950D9688E55C39FD30CF [email protected]
438,376,070 *2C6F608DD3F31080A40AD673CB92999159A36FF1 SUCCESSOR-OF-FATE-(JUSTE-BELMONT'S-THEME)
438,376,071 *2C6D99A076369241FEBF45D75DDA507B057F8305 WWW.ZINCCITRATE.COM
438,376,072 *2C66727C5EA2D516FB78F4FB9DA9B723F824FA91 WYNDALEJESUSVALDELEON
438,376,073 *2C6424471C48B51527807571783FEA68E3C167D9 X01111986
438,376,074 *2C6DF1CFF565E9FE754D52D2AA8E0E6467350CE2 XAVIER.NASO
438,376,075 *2C6C5622542CBF84CCCED0A82746513B06595C1A xerezia
438,376,076 *2C631F7455B99822871BA7A82E22ED107181A2D6 SUSTENI9
438,376,077 *2C6B72D4F015B541D81B6674550E4C2CDBB48745 XT'6
438,376,078 *2C6E52FBE190A10D1DAE65B5456708889139DBAB XUOFIUQLA
438,376,079 *2C640EE1FA6857E976F332B99B63502190C49F70 TABLES2G
438,376,080 *2C6ECFBD15F605D3322CA944E00402EB51B716A1 TAGISHTLINGIT
438,376,081 *2C62902606B283BB7E8CB28A8F49350C9B0E6405 talk85967892
438,376,082 *2C69340D78FB59BB44FDDD9E7F63A3A301CE31C8 YASI55
438,376,083 *2C68B5737B869B501CE917D06F2710507AFD9586 YEANLINGPOLLSTERS
438,376,084 *2C69A68AD81EF6374AC2524F159CF4F2818B4DE1 [email protected]
438,376,085 *2C6E183B3682C4EF72B240591B9B7B31E53474D2 TANHUMA150212122
438,376,086 *2C69CACC94637A66F7689A0AA76A92698425A5C8 [email protected]
438,376,087 *2C6C2DDDE6E6DF4164BF1D529DA484B8A160151C TANU-RANA
438,376,088 *2C6115B202EBC69F3A70E37B18B0538E1D1A2D30 [email protected]
438,376,089 *2C6E4699E2743EF0B807CE864B3D56DCE0236F48 YLGNIYROLG3
438,376,090 *2C64F1E7F118B34160BF26A181FC1BCE87224BB9 [email protected]@rd
438,376,091 *2C68E4AACF5C93C29E9393F7A7048D82CFC8E3CF YTCRACKER''YTCRACKER
438,376,092 *2C6EB5F345DE78BCBDB863E4A2D7DC5AFDAAF024 TENNISKYYNRPKSIS
438,376,093 *2C6A460657D696811B4EE230B386623F93ED2A25 tequila-sunday
438,376,094 *2C6BD21D2E7C1EE5D4FCF6637BB0FE36CAA2431C TERRENCE-HALLORAN
438,376,095 *2C6902E56B7AAEB0FD59351C6FB2A4A83E57611B TERUGKOMEN.
438,376,096 *2C6A94BB8101E10042A44DB9B34235C06C5419AB ZACHARY-BRASEL
438,376,097 *2C64399BF427A19C6E736CC4929F14016CD8946B thatphantom42
438,376,098 *2C64C618C3AEF84DACEE3313584B91C3D0F23600 zayne-du-bery
438,376,099 *2C62DE10481CCC4EB03FF999FF3D0F41B8241DB7 thedickens86
438,376,100 *2C600E8B53ACF745F41AACE9ADDDA5C4A2D8EC7A ZEREGERG0
438,376,101 *2C6CF254EC6E09134F56035FD11E2230C3B474DC ZEROCKIZTA
438,376,102 *2C646C8734AAE4816A77940288AD50B1C5B2E1C6 [email protected]
438,376,103 *2C68977169334EA3476EE02E91C1869A7F2FC2C1 THERMOMETRIES
438,376,104 *2C61F0D042939E6339C1A3B9701912EF5F3EA095 [email protected]
438,376,105 *2C6B336137E40A215F2747A2366C9283C143EDE5 [email protected]
438,376,106 *2C61FC26535A6E7A08F928388D67B3A95C442BDE [email protected]
438,376,107 *2C64FE095B9DB53221141CB9ED2B54E688D6EFFC the.torpedos
438,376,108 *2C6DBDDBEF3945B183AC8CB77E70EA81ADD561C8 ZIYA-LAKDAWALA
438,376,109 *2C6456603CDEE231B4C40D96EE246843994AE7DE thurmanspadea
438,376,110 *2C612F19B2CB6AE8D88297E12F45365ED4A92787 TIAWHITESIDE
438,376,111 *2C6702FFE913B9444FAFB339F5D8210943D1F1DE ZŌSHU
438,376,112 *2C64B0754932E6520F49D0A53503900CA46E45BF [email protected]
438,376,113 *2C6356DED854DDC933B6BA291F563867A15C19BD [email protected]
438,376,114 *2C660EFFDBE9E232BE62E6B34ADAABEC0B22A112 ZSILKOU7
438,376,115 *2C62D74A3F04E9337E140C66A191A7E6A90607FB TN~
438,376,116 *2C692CC6752F11FAC343465DD3E494DF0451D79C TOMB.9
438,376,117 *2C6EEC0C1311B4BCD526D6DA745032AB71349CE7 tomys4
438,376,118 *2C6982696CC27F4DF46AF1DD0EC97CC27A8398F6 ЛОКЕРУ
438,376,119 *2C61FF8BDEE0EFF03513716741D1D2925300E6C3 TRAMPEADS
438,376,120 *2C64A0CECCDACB55C864DA0386D01A12DEFA129C ФАЗОТРОННЫЙ
438,376,121 *2C6D0525DC177949BB9E3C1D9C096A6727349D40 «ХРІН»
438,376,122 *2C65500E3EDD7B3163AE0A1871AB44BCF0EFEEAE TTARENSAS
438,376,123 *2C6ADFE8A0615AC7D49EBBF5EE91B224D0AB25B1 TTENIBAKSGNUREIGERWSB
438,376,124 *2C6C5DB48AC9E1803706509E0261630AEE0D91B1 tuanbartoszek
438,376,125 *2C61F934385A65434001371698D705F6A7BA7BC1 TUGATURTLE
438,376,126 *2C6E13FAD38895E1893FF102C82CF2D882E11B40 [email protected]
438,376,127 *2C6367C2531DB73D7CC70289BDFBAB2FA31D522D [email protected]
438,376,128 *2C6F379755388EEA389C6F20F95755311BB6E1D0 tylerflorentine
438,376,129 *2C66CE33CD9B31FC674A184F0E153E08BE4F77D4 typographic
438,376,130 *2C62EEC8E50D22BCBF7965559DD011E15B8C0191 U325396
438,376,131 *2C62EF5AA7A219BB17980DF68F6744A50F6FF54A UDERZAJACA2
438,376,132 *2C6DCE10A62C1965A6B58C1F25ECA41D41D24680 [email protected]
438,376,133 *2C639D47AE9D85C49712B426947410D72F92E7D0 ULBEGTIU2
438,376,134 *2C6DE76F1CC6DDE1100296A7847A75BD6AFF7634 ulises-geovanni-aguilar
438,376,135 *2C6EE0A1460549B5259FA570336CB7EC9EB3CD5C ulises.geovanni.aguilar
438,376,136 *2C6AD41645E94932A92B4332509C044ED30893D7 UNCOMMENSURABLE;UNSYMPATHETIC.
438,376,137 *2C6624A2D8FBBD2E18A57CE693668EB87AF53EB6 UNGLUTINOUSLY3
438,376,138 *2C6056E29B8D2F819A8EED834F6EF4777E1148A0 UNLAWLY
438,376,139 *2C6D6F2DAB68E4D2805AD516C880832EC9C1F93A USERPHORTEETOO
438,376,140 *2C60D1F6D30915F165B70E2852274A48FC770E72 V080379
438,376,141 *2C6EB8C41ACCD2F0A580A3B82BB237FE14BE34D9 V21046
438,376,142 *2C6D23340A7E0A19BADFAD039FADE8150529AA01 諸国連合軍の間で行なわれた戦いである。この戦いの意義の大きさから当時の年代記作者たちは単に「あの戦い」(LA
438,376,143 *2C6708893775D414FFA68F4EE10AB2310D2D7062 VERLANGSAMIG
438,376,144 *2C659EAD28ACA92D32E3C99F475419C61379A607 VERMAKELIJKHEDEN6
438,376,145 *2C667D44FED9D5203EF71129E11BEAAFD347411E VERNON.J.BOYLES
438,376,146 *2C6BEC2B4488E7CCDF76A159606AF095AD31504A vexatiousnessing
438,376,147 *2C60A1E3AA976C45D27AB8AB7F2174B0AC0D92C0 0[
438,376,148 *2C6551FA31ED9CD6D95058523EEA51EDA1644709 VIOLETTANNERS
438,376,149 *2C6A23A673EA901A6CA7D7D97926E04AC9E37151 VIRENJA4
438,376,150 *2C6C81547DFA8F1C9226A12E1B7E807AE182C68C 03v72567cnz0d61l41sd
438,376,151 *2C6CBDDFDB4C4F9E415DB9C6ADE117C21B25B1BE 06(2007年3月13日、NEO
438,376,152 *2C6E62FF9C09F455B9F0280A4E9DFB77672A1CCE 0myviper17
438,376,153 *2C673C7686BC46AFED4ABCCECD2E0C763056C03F vyzna
438,376,154 *2C6BA0C7E4BF5ADFAA9BDB571752C2D387BBE030 11-zuegellosen
438,376,155 *2C6C8F7FF0721E196817D19CB993E39E1EE8D550 12SEPTEMBER1254
438,376,156 *2C6A1ECB4726744D26D49EB0CB0482866B287E5C WAHYUDARWANTI
438,376,157 *2C6E01886ECC7CC8EB974A2D2CA39EAC385076BC 132308 FT-SE.TRADING.ACCOUNTED.FOR.14,085.LOTS..
438,376,158 *2C6F07492FE467145DD1D739D11953B2BB9FE959 walter.r.miller
438,376,159 *2C6DCEDA1D9F80401B7BE1C3CC2D754F5F21FA1C 13PID0SAU
438,376,160 *2C6674D7E69140FEB1766BD069C3B9B3154A908E 1428808 SECHZEHN.JAHRE.SIND.GENUG..."
438,376,161 *2C61DD4B29A7DB8F49759EB2440741270FEDDE7E wanjingwrylieren
438,376,162 *2C63CA7570462071FF84D0F333F830ACF402E1B0 148-muensterer
438,376,163 *2C625572AC9DDB04DF95C9F775FC45B91E2101B2 WAPHELKAR
438,376,164 *2C6E4839EF0C818F0FCDB0983D61192E57DC16F9 1685366 HIIVIN.KUIN.NAVAJOINTIAANI.RAPPUK
438,376,165 *2C6E0266C0055870B7CB56D39A7DA6FBB6ACCCC5 170thaddeus
438,376,166 *2C67613FD2B0E5F92261DBF6C6840ADAE33B2FA1 18.-JULI-2001---CASTA
438,376,167 *2C67608E51E5650ED010E045A5AB4145BFE75514 [email protected]
438,376,168 *2C612C3DBA47F5EF632C7018DBD90DBF3A83C5EF 196441 kun-sitten-n
438,376,169 *2C6C64D130706E23E293FCE9187010027A9612D5 WESLEYREET
438,376,170 *2C6188D9353B0C423CB672D2B8ECD870719E4DDB WESLEY.SIDEBOTTOM
438,376,171 *2C66584773A3A92C4F19A7EB5B024A89EF296A71 WESTON.PURCELL
438,376,172 *2C64BB98A33AA3E68DD4581A4D0EA324568A95E3 1-alicilarindan
438,376,173 *2C6EF410ED206AD0BAB8C56D65A0FF28E57F9380 WHG8VFKH
438,376,174 *2C64592EF0EF15AA96D99662C8861B050976320D 1 BERUECKSICHTIGUNGSFAEHIGE
438,376,175 *2C6E2D71446F0862DE0DFD608B440B53BCFCD030 1CHOCOLADEBRUINE
438,376,176 *2C62CC5882A82653F32C98784B048D694BA9C727 WILLIAMANA
438,376,177 *2C6641389AFCF2851EB905255826BDBA002FA595 [email protected]@N$
438,376,178 *2C68911768574D65E8FFE2D038822D16967B454F 1ilovenorman8
438,376,179 *2C6D244F2100924D1A7ADB4757606639A90CEDEB winfordsichler
438,376,180 *2C6F38638FD8F60A6813CF0123261556D6495E92 WINFORDVANBUSKIRK
438,376,181 *2C692007F2463CC8CB1F733B3D1505526B033A11 WNDYAMELIAAULIA
438,376,182 *2C61FE147A66819C8ECDC86D76760C5F2590BD38 WODRIAL
438,376,183 *2C61AFE678605AE73874177F754F9A776BDB5D35 1-MBL-TASOT
438,376,184 *2C6E933CD8ADDE52463551885022880F49120834 [email protected]
438,376,185 *2C62CEAEC7A3B50CA0567F84F8F3CC703B858548 1-myrskyss
438,376,186 *2C69576B300EF27EE8F127B0F484E225627D06F7 WWWDUNKELINDEXCOMA
438,376,187 *2C684FA7E132566CE925691D92283112F8AC2A0E 1-QUICK-CHARGING
438,376,188 *2C62F932BBD4C3FD4844A78B6B6DB4F61B7A16FB 1-rasthofs
438,376,189 *2C6E82BD11FC5F36D6048B4DE6CF02BC8991F37B 1.rei'itystiedot
438,376,190 *2C6B3F7EFAD58E00FB1514CA66AA0AB5BD3998FC 1SISLEY
438,376,191 *2C69597D5FA472A3D982EFEA18AE2519F18B4057 2001388 kartta-saattaa-pit
438,376,192 *2C68130B9473736FE171C73BEA1ED2C5D83C9864 2045130 ES-WAR-DER-LUSTIGSTE-FLUG-IN-MEINEM-LEBEN-.-'
438,376,193 *2C66A07B37A3EC879304BA5F322A73DC20DED253 2146ZDF
438,376,194 *2C62F2DB6895E6823F90406601A377CCD402ACE1 22 RECHTSSCHUTZVERSICHERUNG
438,376,195 *2C68972AE9AE2B9F4702F88EB734A418DE474458 23051553
438,376,196 *2C69260190EE7487BC41B37EFDD68DC781E464F2 www.precisionspools.com
438,376,197 *2C613C209FFB90E3CE64E2BB43B4EF552F232DB0 WWW.SOWYOUROWN.NET
438,376,198 *2C6630C192AA291B80F6E82B96EEA8C597FD12CC WWW.YOGAEARTH.COM
438,376,199 *2C64082CC6FF865A7B21B861716DB6382C73CAA1 wycinac
438,376,200 *2C604EB78E835BCCDDC74340B8EDCFF76DC53B78 2928173 YHTEISKUNNALLISEN.TY
438,376,201 *2C685097039221C9CDDB90061AB2314E9967BEF9 2941129 NIEMINEN.N
438,376,202 *2C6A8812D892F075A8D14E7B08BA806221A4CAA1 [email protected]
438,376,203 *2C663228A7F58E1C28B6A30A7293EA74543E6494 2DRANREBT
438,376,204 *2C6334BDC801DC38DD5C1AE4AAF7996283B8A479 2HORSESLEE
438,376,205 *2C69234F219685B2C777CE424BC1FDFCC2603680 [email protected]
438,376,206 *2C632F9926566A384E4741A674C2CA22909E7982 2mielikuvituksellisista
438,376,207 *2C653DC74305972D0652CBDE2DE507D962AD48DD [email protected]
438,376,208 *2C6A800D9C0D2386C6F4EE48F1FD8254980A1391 2NDEASTANGLIAN
438,376,209 *2C6E9F2088B60ACCF37EF60D1D7C7B5FA78C537C 2-piratella
438,376,210 *2C636D1F3797157BCB8F95134A55B2A18F92A2C0 YAHIAKARARA
438,376,211 *2C61FF149DF2693376351E96C6AD2F586B8AF683 [email protected]
438,376,212 *2C64B1D1D87361E6BC47982B50DD678E9ECC57AD YANG_SULIN
438,376,213 *2C69DE235687294138A5F19301042D6CFA8617AB 2THEFERRIS4
438,376,214 *2C6723225C4BF4B130959891166E1FB01537BB0D 2-three-kilometre
438,376,215 *2C6B6DA8722A57D1BF4FD82F7F8EA99BE739E083 YANNICK HUCHET
438,376,216 *2C6CC8BA8784A36D686F2C374521AD9AEBEFD95B 2.ulkomaanmatkamme
438,376,217 *2C691EA2B2A17F8BCF4E5B8149D768753A1AF893 [email protected]
438,376,218 *2C68F3DD09E6A92A3F1D834B51CE0C4288F3C5AE [email protected]
438,376,219 *2C65F07B538C603070663DAF974BB3C40E91B670 3CEDICLISA
438,376,220 *2C6BBD751B5A76B821255BCEFF4F735C58ED5AB4 YLLAIREGANAMS
438,376,221 *2C6F56DA0B4EC6411818B310BBC894328475E212 $YN0D413
438,376,222 *2C65E5356AC4E925EB80C881DFF844C6CFFE9C7C yoavbarlev
438,376,223 *2C61913B96E9DC102487328ADDE51100685DB99C [email protected]
438,376,224 *2C6A1355942702CC02F1F2356C16C54F79B921F7 YSODE
438,376,225 *2C6835A53B97E6774B7A260BF0DA6C252589BCF1 3.MICAEL
438,376,226 *2C6311F4C48AB57C450EE6D1B93A92639826E529 3SEUROISSAKIN
438,376,227 *2C691DAA2808B373AF9D8BA974A612D8EEDA1779 3.shuster
438,376,228 *2C66D689D57059E26569D9A7E1C647477B95E017 3THEUNIX7
438,376,229 *2C636BD60772BEEF0740EC42E39C84FBF87A627A 3.VILLILT
438,376,230 *2C6B54CF234E12F7F6C596EFAEE82AC60568CB12 Z3061997
438,376,231 *2C6ADB42E112C47D4C939DF01040A041F71E4A04 ZAANAIMED
438,376,232 *2C68AF7CCA4DA8980E3570946FF3AF5A2223277F ZACHARIAH.CASTELLI
438,376,233 *2C62BD4A6D77B5CF190064CFF8932840E31B1799 ZACKARY.HEUBUSCH
438,376,234 *2C64D41CDF796AC5567D8AF5B27D67B9FE711BC6 zafiris-loggos
438,376,235 *2C656C5EE8B66A4114F4B35E9F718D1386D4B473 4dul4+0n
438,376,236 *2C66CA1AB84C8AC3E9E4999D9A81598B363360F4 ZBB
438,376,237 *2C640188C0D5C1892F1590287C235FC41B69C07C 4konfliktmanager
438,376,238 *2C617CF50E3CF0CFC40B91C3FA4E7AB2E4A5A4AD ZEYNEL USTAOGLU
438,376,239 *2C6C60232217D254D488443DF4F6AF3B7434C459 4.lamaantui
438,376,240 *2C6FF8A7A109903AD8C0090A57AE779291DA23A1 4-LIEDGESANG
438,376,241 *2C6B733E61DCEFA939B4494E2CDEF40DED00961B $4LLY1N9
438,376,242 *2C65361EFDD8B38B2F3D11935731CB7E292F1B35 [email protected]
438,376,243 *2C69FF022DAD78E4D7EFD86EDD5B508AEB3CFE06 4PRUDENTIANA
438,376,244 *2C6180B79DBDC6597EDA90D8F09FAF6A3212A443 zj:w
438,376,245 *2C6654EB743A53178AE3746E580E422D33272368 ZLATKO-VIDINSKI
438,376,246 *2C6B0AAD524F7E4F9180882913087F55D4BC7831 ZNSAMMENKLANG
438,376,247 *2C636F28CD663E90CC54C770D32CE134D6B0382E [email protected]
438,376,248 *2C67FEA7B0A9B43DC2640C0CCB79609B5668C360 zsgol
438,376,249 *2C67966FFA5F546F40A3EACB7599D92D11D20420 4.suomibulgaria
438,376,250 *2C6E4DDE807FD92B876A5FB2C7DF5B0E1CDEB40E 4thatlee5
438,376,251 *2C69D0EA7892503B2202E817962F0C519F99CA4D 4USRBINID
438,376,252 *2C6AAFCFD2DC93E08CFA8265AF64D6B50196AE74 51OCAKLARININ
438,376,253 *2C6E03DEDA17FDD27AD8A42390DF3450E8E66CFE 542ID
438,376,254 *2C692088B8350F58256751E9484F45249CC07F63 ΕΛΚΕΙ
438,376,255 *2C61B32BAEBA51527165229B4FE6F07BD2EFD2A0 54.kansallisarkisto
438,376,256 *2C62A140ADBDF4E69CB8BB27FEF23594219C0BB4 [email protected]
438,376,257 *2C672E3AF9F77F5F04B57EB35068129E8B223419 ΠΡΟΣΩΠΟΓΡΑΦΙΚΕ
438,376,258 *2C653EAA5ABF98A1352C06357B25892656E02412 5ADGSPEEDO
438,376,259 *2C6856C090D3835A1ABD1128F8A86AC6566C9258 «АРГУНСКИЙ»
438,376,260 *2C62299D1883B7DB38209C7130168624F142D876 ВИЗЕЛЬБЕРГЕР»
438,376,261 *2C647940CADC413118272B6855945A076A34E9DA ГИПЕРЕРГИЧЕСКАЯ
438,376,262 *2C6557F43E7DE8E525087E420497C06182DE0FA1 5CAF1B8A
438,376,263 *2C6E3547A2D6C70BD0CA23AD9427D79EACAA59C1 5chris8
438,376,264 *2C6A06CD07A101302E6BC690400D89CE641D71B9 5DEPRESSIVELYV
438,376,265 *2C6DE6E43C5792A3FCB60F84E8D10329A82800AE 5ELLAPLOT
438,376,266 *2C636383308C5D7276A6F79F118FDF736DF83117 5ganaaaayaaj
438,376,267 *2C634A2C920C03F5E5914BDBBCDEA68CE2E9B93E 5oct1680
438,376,268 *2C6F130C39E54D68FAE99B7555173F32DE9019F5 5RLUSTIGT
438,376,269 *2C6CF49C1ABDAD93E11A5DBEDB809CF2BE6FA17A 5ROSIEDOUG
438,376,270 *2C66791428684BBF4D529DF17F58FECCD3BB5904 «СИРОТ»
438,376,271 *2C6625C70593701706E3A6098677F3336829493B 5THEROYAL7
438,376,272 *2C6A219F453F53CFBE7DA8A60ACC977CCFE4D2C3 5TRAHETISQUE
438,376,273 *2C6D98FEC8C8E33825A2D8ED9DC164C32A3C351E УЗРУЈАШЕ
438,376,274 *2C6295B8F460525A3A058C2F66D1B7FE9E0D3CCF 5VSLETUKS
438,376,275 *2C646D37D6CD759E2008765831E72A5AC4A47C09 5WE11E5T
438,376,276 *2C626DE42CA4FA1D0AF7DE2E7FF294B59141E04E 63130DS
438,376,277 *2C6A0E5DF4A612A98C2B2273C6BAAB39EFA027DE 6BSWUNENCAPSULATE
438,376,278 *2C698707F4E7606DEB531254F35039DE1835F4FD 6DIPTIEKS
438,376,279 *2C659339B88D2951233232AB82D1B7729598F091 6IAMSTORAGE4
438,376,280 *2C653B7F7AA580049350057CA888D82351433FE5 6ROMERICABSW
438,376,281 *2C66D0682D6241193C6D2F39B99FFC6E8517D97C 6SERGEIPORTLAND
438,376,282 *2C63BC342CC2231452DB8B1365CE17BC41720DAF 6SRSTMRNT
438,376,283 *2C62FEFC4108B644A83561EDBA5FD78E0137FF50 』の欧州版)収録の「CRASH
438,376,284 *2C63BF86E6120D064EA1F22F2AF198D1DE8BEAFB 6SUOECAIROCS
438,376,285 *2C61D433FC584C56C0E1A65211A65FEAC02ED4AE 6UITKYKWA
438,376,286 *2C6CC226B0F256D79D154B235A36302A0EA20C5A 6-WESELER
438,376,287 *2C624109160294629D3E61AD5BC637E73F7B5091 728KAREN
438,376,288 *2C6BDC406343ABCBD320E76FBD3B8BCA9A289B63 7CALIFORNMAVERICK
438,376,289 *2C6FB8CE94D56DB88CB52D6E3ABDDA7FBC8499E0 7DEPTHSSINKSINK
438,376,290 *2C6ACDFC5AC71AA81EA4B152931B6461845BE2F1 7ILUVSUPRA7
438,376,291 *2C64A848A40AA2131D5A25E22340EE58FD26A680 7ORGANIZOVANEH
438,376,292 *2C612F6873E6FCAA76DCC521566DC788E071C1AD 7RETSKLOT
438,376,293 *2C63D2FCFF90EF83D5634E9F127CCFB6DBA5665C 7SROFFLES
438,376,294 *2C6D272A2733EA2692B326EC26892DEB19811760 7toesnoert
438,376,295 *2C6C5C0C7B8C84A90D8B70151AF95C0582940010 7TSREIGET
438,376,296 *2C6A44B614DC09B346FC988377ACCEE8B5C939FE (0-0)~~~d######q
438,376,297 *2C68353F178A5900B9AE061BBB620D62DE78140A 7YLLAUTCAFNU
438,376,298 *2C6A393723D54D5ABB45A13E62E39958C9977BCF 863889 mittarinkalibroinnissatuleek
438,376,299 *2C6DC4FF92C153AB41BDDC8485BE741520BCB7F1 [email protected]
438,376,300 *2C640653F72EA7769E40B5178A4F83205B83AE26 03071741
438,376,301 *2C636596785A46658EB2402D635764BABC01D9DF 8CAUTIONARIE
438,376,302 *2C6181EEFF5C82F250DD838CCD995114AE901FCC 8##d~0~o>-b0
438,376,303 *2C66DF692F5BEE9E1A194C4CDBE45069C716B0CE 8-GEWALTFREIER
438,376,304 *2C68A909F90745B40325671C4FA622347D753E16 8iamsting9
438,376,305 *2C633431C6B49A17026403A1AD0A57039FBD1E6B 8SIMBAMITCH
438,376,306 *2C6D47A6A31D7BE711007DC49F54967B3DCD52B0 8SMILEYPASSION
438,376,307 *2C6EA6C529264938224047147BCC8F3113A09638 8TIADIART
438,376,308 *2C6CA8104DE22D824C8B631935BA1FF8CB2B054B 8TNICOLE
438,376,309 *2C6FA5E13CA3B51CD4B426DB04F52BD819B51171 8TOPYNETT
438,376,310 *2C6FBA0E5A25A9F167D09F99D3B2E45E823F0E2E 8UNPARSEABLE
438,376,311 *2C607CEE9E0581BA8C11B87B91F90F78690D275A 8WANNY
438,376,312 *2C6692CFF905645C574E15B0D770560C83F66EF9 915188 yleiskirje.on.seuraavan.sis
438,376,313 *2C6EBB6B3FC19BF5E3ECB1E88F2524D223B7A1B8 123go
438,376,314 *2C68FBC35661845F71DE2F4DACA40D97AA91B24F 97075 KANNAN.OTTAMISELLA.ON.VAIKUTUSTA.SIIN
438,376,315 *2C6C0ADE4273A12D2E129EE6D73F4758ACD58628 12OSCARIT
438,376,316 *2C688E691F9B25E2D98362A46E85050E0083DE3A 975719 koordinaation tulisi siis l
438,376,317 *2C67C0D0B39BD4EC90ABA8F47031AE5EEF86BB3F 1305847 VALKOAPILALAIDUNSOPIILAMPAILLEHYVIN
438,376,318 *2C6DAF67028591A6EC9583F48D6DC645079964A5 9ATTONDENT
438,376,319 *2C68EAC8701D3549EB589B10EFEDF5BAF4E6F4A4 9DISNEYENIGMA
438,376,320 *2C6D9BFE127A676B8C258C95029C2CDF474F0973 9DORTNIER
438,376,321 *2C620DB36FE8A56ECC4B02649592101BCA34B4F1 9HANTEIKA
438,376,322 *2C6BEC8E4CB7529D2FD46985BD250DAAAE8928F0 137bethany
438,376,323 *2C6F0EDB6D57ACB272BA74973AA52B26CEB15E08 9PUBLICGALILEO
438,376,324 *2C6AC9CCE40552E25F52BC4E3AC2498E2EB4AB50 9REILANRUOJ
438,376,325 *2C666AFA0EC1ED064EF97A34F0FC15FA3B62487D 194RELEGATION
438,376,326 *2C640B65F041408B1253621C6A496B36C4E8B6B3 9UNCOMPLIMENTEDS
438,376,327 *2C63B3350E0876B3FC68FF5C5C40839B3021FE63 A0HFA
438,376,328 *2C64696007F996D7F1FBA8ABA6BD3A5CBBF0D5A7 a6
438,376,329 *2C66AD5CD72AE840D14365DB7921D0ED11FF68CF 1CALOMNIIEZ
438,376,330 *2C6ABC9CA36344F36FDC48E63BAC2E6D0EB6AC19 AAB#V.
438,376,331 *2C6EA55E9DDA755274FC17B6537AABBDF1413540 AADIKJ
438,376,332 *2C6D8342C62F521F297F1A1727ACD6750E8B690B AA?HZ
438,376,333 *2C6189E4C32832308FC1FA60616C3D3762336B66 aaronunangst
438,376,334 *2C65E796E56352C432EF79B79C57E2FEE561C037 AA=*Z
438,376,335 *2C6EB8E5CDC943A08D96AADCD5F295762F8AA661 abf$g
438,376,336 *2C61384F2B3F33F9EE6C89DEABB76BE8A599A4D4 1LARGEWERE
438,376,337 *2C679D4270B8669A190CE4A2FB85E218822FF5EC 1mercadocenter
438,376,338 *2C6C5759F2BD69EBFD851FD6978D19DC297EB185 ABNQ
438,376,339 *2C6A78B30E190C9570410D063B025DBCBBF3F420 ABUPH
438,376,340 *2C62A619658CAC55ECE13493540A221EB883660B 1 SITZPLATZPROBLEM
438,376,341 *2C6F7402C4D4EFF8BF6A791412693FA9CBEE5D85 adjrobbu
438,376,342 *2C6478B7258CB2C34DA10B9B0437962A7D1529D8 1STAEBER
438,376,343 *2C6E79B870191FC07C28B44B5CDB2A829746FB45 ADMIRATIVEMENT
438,376,344 *2C63115D2B8B606BC1E809041B004590860DAAA5 1TIESUUNNITELMALUONNOKSESTA
438,376,345 *2C6EEB82936ECDC9E602AE6B65B811E9C21FEFDA 1UITSLOEG
438,376,346 *2C6758C5B7AEBD421B1274EA5A3EB8A363D369C3 1-video-catnip
438,376,347 *2C6F1FC49A837E33C84CF35F99A7F023DA6D7B59 AEROPUERTO-INTERNACIONAL-GENERAL
438,376,348 *2C69FCFBA887F9067FC33CBF93DF6A5E106E8FBD 22NOV1852
438,376,349 *2C6D6BB2E3EF5CB765030175615486EF303CF5DC 236julian
438,376,350 *2C60374567E41A5FD32377D4E31A98416314A22F 2454172 OHJELMAK
438,376,351 *2C64450B11E5074E89EAAC326141C608FA590602 24 GODZINY
438,376,352 *2C6955BE4B10339922431405D8D8F86074BFAF08 25.automodelle
438,376,353 *2C6019C1EE80943138AABD43758CEF2BC7D4CBA1 2642678 mitunter kommt der feind auch aus den eigenen reihen
438,376,354 *2C6056164DEAEA71A1570FA8F742F4B5EC10AE7A 26-CINQ
438,376,355 *2C650329EB40D261271E3823ACD5082ACFC9307C 2861612 jos.haluat.itse.vapaasti.muodostaa.taulukoita.,.toimi.n
438,376,356 *2C66C6818CF39143D05525E776640D74D0692234 2-AIKASIDONNAISUUS
438,376,357 *2C6087A74D0C717B5FBE1D66F6247F4A33CDE7C8 AFAWADLEH
438,376,358 *2C67BF3C0DB1442D796E4EF1A112160FE3F37E3E 2CRKNUTU
438,376,359 *2C6277DE2BDEE422EB48F45C6744B18F3BFC3042 2.dirndlkleid
438,376,360 *2C6BA0F526771165025E8D40798F41799771D813 2dollar-verkaeufe
438,376,361 *2C67E12701E1136A9AEB7FB60BA82E790297F693 2EXTRESIS
438,376,362 *2C67C341FE57230D73AA573311A89E86E3BEB3AE AG1_"
438,376,363 *2C64F3514826269AAFAFB347C831185ABBB82EC2 2MAXCOLWD
438,376,364 *2C6BC151FCD083F6C3DB125E5DD5C688DEC4E94B 2moffett
438,376,365 *2C6EB556ADEAB83BF9789C0A40E403F8F687F7D4 AHMAD.PORTELLO
438,376,366 *2C6E2D96386EE4EEAB1964E135AC397B094B38EF AHOD!
438,376,367 *2C6F97856540EF6C6EEC8A2E71665D8D58508173 AhT9
438,376,368 *2C6EC196567086799C1DB3313387369726A4145D 2-verkehrsinfrastrukturgesellschaft
438,376,369 *2C611CC5F3644956C4861E5FFAE142611B9072A8 2wettbewerbsbeeintraechtigung
438,376,370 *2C69E1EEBC79CCD759FF65F805FAC97041FB08B9 30935 VALITSEMUUTTUJAT,JOISTAOLETKIINNOSTUNUT
438,376,371 *2C65242F95A7266681E7E27C060947B6BEC56380 AIVATTIH3
438,376,372 *2C61BF765C6EB7BB19C24FEAC63AA0924C95A97F 318963 acaba-politik-karar-mi-verdiler-?
438,376,373 *2C67DC5ACE969F08A2B9672D027E1AFD6B50180D 322789 elho.arvosteltiin.l
438,376,374 *2C6C1EBE29873A7CD86AFDDD1A6C73E8DDD6FB0D AJ$CE
438,376,375 *2C6C646C7845638AE0212F736C8FDBE4AC049D5C AJ?LC
438,376,376 *2C626DC1D8F7241ADB6D85955D6BE3860A49DC74 3d ~o(>_<)
438,376,377 *2C61360FE4E6C7ABAEF4E020767E17AE30370155 ALCANCIING
438,376,378 *2C6E1E29CDE7341A07F2C7B45EDDE1375D3756FB 3RECHNUNGSLEGUNGSSTANDARDS
438,376,379 *2C64935961EAF225325AD4891E4F8429C81928A8 3UYUYBSW
438,376,380 *2C68C29D7E78FEDE48FE0FE47D363FBC09AF9760 3-WEBWORKSHOP
438,376,381 *2C6BA94A6323B2FB0CDD941DA591A9743EE71C33 409142 ISIYI.VE.SOGUGU.KESME.OZELLIGI.ILE.IYI.BIR.KORUYUCUDUR..
438,376,382 *2C6B863D04E10F64AAEA19EC40FF55EEAF369C1D ALPESTRIS9
438,376,383 *2C6BA707459ACAD408C5E3CF60942B6FE60B5B16 48YMWAMX:ESYC5F2W35
438,376,384 *2C680967BF29BC8CF7ABAEB1418C562063484DBF 490824 SEN.TAVOITTEENA.ON.TUTUSTUTTAA.N
438,376,385 *2C670365E3571B476FD40828AEA703B5FBD50226 495481 BUTDAMEGWYNETHISLIVINGOFFHERREPUTATION.
438,376,386 *2C60C495849C885644AF23C9C1C0EA4CA67C4C63 495597 matkan varrella useita virta / nivapaikkoja .
438,376,387 *2C680C615F841892388DA37DA5C72DB4C6C596BA 4ETXMALK
438,376,388 *2C69C157856C1E453DD6C7B076D9B6BFB71599E4 4HOVEDPROBLEMER
438,376,389 *2C653D69DA98A9F586A11ACA21A12B978B7BEF39 altersgerechte
438,376,390 *2C6FDC95F53911597C0EA3F53AAC5B48EA1EEFD9 ALVINIA
438,376,391 *2C6A8AF3DC3DB0B13F89A09A7CE302CD77798E39 AMHI#
438,376,392 *2C616EBB467E897D1CFE90BE3DE24CAA90CB1775 4TXROP
438,376,393 *2C63550BB43ECFFE92E79050148C9951EF76F32D 5BCD377D1C32845720097404B09AA95BCOOKIE1
438,376,394 *2C668261292A6951EC701FCE8654939A78F902DE annettelizarraga
438,376,395 *2C68E3588845EA7E54639F7A35AC0F63DF66C1D8 anssi.kiuru
438,376,396 *2C67EE3EF84AB40519A9710663F1F5090D227901 5COMPSOGNATHIDAE
438,376,397 *2C628DDE117EC80331A854AC832268B175321483 ANTIONE.SHOPP
438,376,398 *2C62BCE0F762CF097AD690D52626E633E5D9044A 5e112799
438,376,399 *2C6F8D48FD6491465F567A4D807E4185C0B3B463 ANTONIOHICKMAN
438,376,400 *2C6FB43201515C8B84F18A380B75422F7B0F5529 5robaaaayaaj
438,376,401 *2C66911E496C529169F78A8467B9ECC9F924E31C 5SUMBELVOIR
438,376,402 *2C6E130786BF83DBECDE76BE22F811CEB7E9C778 5TENNISRUNNING
438,376,403 *2C6E403D448E6A510EDE90FC9CAE4A0E99BDA9E4 5TSBERTSE
438,376,404 *2C6837F0FDB29191EE97B3855CB836FD7702AE9C 5UKOHSIJ
438,376,405 *2C6FEA2F316589BCA23520778787AE4AF06A9087 ARNOLDS12
438,376,406 *2C620072709185BC5E3A166F3A397DE1B6248DE1 643ALLISON
438,376,407 *2C6472C49EECD28478E5D88ECB23DF01F0A420ED 694017 ZUM-BEISPIEL-DER-ELB-STINT-
438,376,408 *2C65D15F7C3FC0516D6F4BBF14182C0A56EE105E 6BSWZIGLARBSW
438,376,409 *2C6CDD077065094B28547DF6479B4892FF606293 ARYANBORDOLOI
438,376,410 *2C69B058C99287155CFF6488548A9321EEA10CBF ASPECTS08
438,376,411 *2C6CE28BA1DC37D0FD25ACB190F9B33257FE35A5 6EDREENEOSTNAREG
438,376,412 *2C6A2836F14C71955ACC42A3727FBB69684CDEF4 asvt/
438,376,413 *2C6014A3011ADEDED90B1556750069F42AF4781F 6KOMITOR
438,376,414 *2C654917669A156E470A750F1253A05BD7B05CD5 ATG:Q
438,376,415 *2C60EAC1224004516EE141FC4374F9F5E6772C22 6QUOTSIXQUOT
438,376,416 *2C6BBE00E8776E552B645D6C48791C7568E431E1 aubreyprotasewich
438,376,417 *2C68B5F05D9825088AC44BCC421BE0D4F87DA9B1 AUDITORIJ9
438,376,418 *2C6F67E28B3C61948FFD0781B991DBD21CB9582D 6TIERDES
438,376,419 *2C649D61AEC06B69C4F81EA980060C9B7CFF0ED3 AU+OAN+ICOMP1EMEN+
438,376,420 *2C67F53D75ECE7A84F58C7906D56BCB5C9371C8D AURELIOSTEIB
438,376,421 *2C67DA38C3C881E02B1CC6D0EB400474BA6868C0 australasian2
438,376,422 *2C60FDE8B5A39A38ADAB6653001FD05B2ECAF45E AVG,-
438,376,423 *2C6A2E106C785A5A756467F50E3F2D60344803D4 776009 AJATELTIIN , ETT
438,376,424 *2C63E7727E1E3BC6759EDC70714F1059A845DAF5 aw<4
438,376,425 *2C6691B319C214AA825721EF503CA3C9AB5B73D8 awtxq
438,376,426 *2C60A6342368F45FEF2EEDC23EF53683541D2FED AYERAG
438,376,427 *2C6DE771A37FDC858B77D473FB2E9855C0CE5DAE [email protected]
438,376,428 *2C6017D0676B345DF369C1E0946BDC8B588E796E B>~0.~o.{x}
438,376,429 *2C6ED2CB07BD269FDF615DB3E79CD8BDEAAA94BE B*8
438,376,430 *2C61AEE34F3DE2D4D4D07C5DFEE5AAA1344EAF41 barlán
438,376,431 *2C68085859534C5CD3F5F7BD4926B91CA27AD630 BARRYCOLACONE
438,376,432 *2C632C34055BE7F9FC33FDA0A24994BF06BF554A BARTMARR
438,376,433 *2C6FC01D105C158F2963D1D3D03592EFAF72B7DF bassguitarhottie
438,376,434 *2C69EDC2E3BA9CA7426E6BEB0501F5FD3169DD48 BaX:
438,376,435 *2C653A89A2015B577597287C8EC84EB78E6AB5B7 )8(.0~d====3
438,376,436 *2C67D8ABC020BBE7C0CD713AC7987470E95F9910 80D7CE05CDC12D26320F80ED8B198F45.KENTOPIA
438,376,437 *2C67989C685B750E83900EB13FE8402ED3B2D731 bc51q
438,376,438 *2C6D9753B57B9F87AAAA7D72BB66490B4E543B70 bcogp
438,376,439 *2C6BE41DD6E6CF91E251D1EA9A1667786ED74E6C 877730 PARAISTEN.YRITT
438,376,440 *2C6C6E349A79DD27906A74D9E31066CBBF0BA5F3 89054 HOSPITALMONASTERY
438,376,441 *2C672C8FEF39EC99950E7297FC933F466F2F221A 8BETROELSENE
438,376,442 *2C69D9B5A4C7D6B43E3D2820F49355261C463CA2 8BILULAO
438,376,443 *2C6F50DE51EFDE133CAF08178867530C5A450AFB BERZOTAS
438,376,444 *2C6A9DA78D04B97CE410E243F7046A04CDF4044F BFA)W
438,376,445 *2C6BACD924EE1FD7B1F4358B36D39CAD765513FA 8.L
438,376,446 *2C68A16B4D6B4809ED8EA12FCF1CFE070432F74E 8LUXEEDI
438,376,447 *2C6E6197C12D1C8FDE0E9782F688425310DBB3A5 8MECHANISMBR
438,376,448 *2C6C5D517F9AED8CD324A4777149FD2F21537714 8MYFUTURE1
438,376,449 *2C6091A41599758E1F3657ABFFA45DCABA7F22B6 8###)~ `O><
438,376,450 *2C6C20FF4687596C3FD21C6069DB1663BC3AD882 [email protected]
438,376,451 *2C68D060801D7A3C00D7673920689EF5ADF7B2D9 BIRDIEANGELA1
438,376,452 *2C66AD7C8155217B181FBB708F6337C143CA3A86 8RHY7HMC
438,376,453 *2C680FD02C7D8BBE8A7493B5FE73A5C00EB522B5 8RICHELEAN
438,376,454 *2C6F3922FDDDEC7218AAE0B14B5A33386497AFA8 8SEKVENTI
438,376,455 *2C6C03B2C138523096B99D7C8525F69CF3EF2B73 8stormvast
438,376,456 *2C604DFAC4E8E95B2EA5BF1DA7693FD953B25FB5 999876 LASIEN KIINNITT
438,376,457 *2C60171079DFE6E0920B68DC2BA86D956ACFD2B6 9ANKREIDENLY
438,376,458 *2C678410FCCCF9B55FE319D556EAA49450A4363D 9BURSTER
438,376,459 *2C62E3A3DE9A0FF83377A1CF5C63777FFDA45129 9GRATARISQUE
438,376,460 *2C690560BB6C7C9103F5CB0150F3F9553792787B 9history4
438,376,461 *2C6FD6B92EB73A58F97871F8B1417A0B22C0FDAE b:je8
438,376,462 *2C671826FDF931F336381409C32947737F023D43 b(kb!
438,376,463 *2C6579415E90E25712E23B27A3B8FCF768598BCA bkn$d
438,376,464 *2C607B0623F0191EACC11B8514556573886C707D [email protected]
438,376,465 *2C6E44201F79AF04CD6E35F383C826F8108A6A6D bleibts1
438,376,466 *2C6BDDF9C031230C1ABDBB31B8E63677E079180F BOBBYMICKUS
438,376,467 *2C6CF0DD6C29797883E2443EB2B73A560BC764A4 b(oc
438,376,468 *2C698111FA372298BCBD921442B15448B7EE18AF AAASR
438,376,469 *2C65F5162D071C257D99EB9D176F627E0DE3F3D0 BQH2
438,376,470 *2C6E8D80FC40E677B57D2E21C4569E777E4D6E2F abcseattling
438,376,471 *2C6145D36BE80E46CEE263802568B5E3575B2E41 abeornelaz
438,376,472 *2C6BD1BBC73C03477A24591915D2146642EC0258 ABE.VOGLER
438,376,473 *2C60E7A8F89D6BDE430D4B7B1D1EFB8925FFE4B6 ABQN9JADW
438,376,474 *2C60270C2DC5F756FE7880EC0ADACF0FE8B071FE absolutely-uted
438,376,475 *2C62816F08EF63BE2DCB9B3FEC0AA9BBD669B967 BRIAN.PRAYTOR
438,376,476 *2C6A4A98B5E45984BB980441C79D01E8DB70F959 [email protected]
438,376,477 *2C67AED75B7722293D4BD36934A3E8CF4CD9FFF3 ad(ic
438,376,478 *2C639BAC2A27AEFCBDF38F7900C0A96370EA8FF0 AKATSUOM3
438,376,479 *2C6823D4DE764CAC60488D8EBD47C8BDF716ED8F AKOETHOK
438,376,480 *2C659A964236EB0C7434EE155907C6B17393A4E3 aldondoci1211
438,376,481 *2C6AC7A468AAE0B443373DFA0CE7DB1C156070F8 ALEJANDROONTIVEROZ
438,376,482 *2C619443DE6F7A46A87FA10A8C6C4EB13335F886 bvfvk
438,376,483 *2C6291DD81BA39C0246192DA47D650D0C936BA22 bwbng
438,376,484 *2C6A2760644507241D151458DB577A82D487535A c0?oc
438,376,485 *2C650F51E92B28463CED586399780BD24515CD5B AMADO.BESER
438,376,486 *2C6AF7895C182068E615A1E7AA7E2E9864EDA696 C3KL1
438,376,487 *2C6082FCC10E1B78CB1E7658253867DF3740C2EE C$8CQ
438,376,488 *2C605F44C4DC35D8DB38F0A32AB208676243037C ANDY-ROMINE
438,376,489 *2C60A742442F7D0D8D8DFF17A942542DA9A589E8 A%#NF
438,376,490 *2C658650410AC52F4AF1E0925DEA5A3E2A045C8A CANNONXANADU
438,376,491 *2C6B1446056D22A8947D53372586FC8815E3AD2E c;c&l
438,376,492 *2C652DEF7D70718C845D34D8F5F9B8BC7AEF04B4 armandoscandrett
438,376,493 *2C6FB723CC584174EB8EA23452F523D5BD740A76 CDd&
438,376,494 *2C6369FB579F42231B1228BA850C33A5A8D2023D AS,BW
438,376,495 *2C6A53EFA3243627F13A4EF3337638EBD6214FCA CHANCEBOWLING
438,376,496 *2C603097E638152AB0A335D2EB2C9484D6750B03 AS=UW
438,376,497 *2C66C4A0B906BD2C47E6D2AFBAAA3A3EE0BD4514 CHARISSABOONSTRA
438,376,498 *2C6B058C18B6C68ACA29DBAE9F83874323F279E5 AUBREYDUWE
438,376,499 *2C672481568544C5FABCD360B5AF916ED408436C [email protected]
438,376,500 *2C6DEBB846052BD683759547EBC4F2EC55D490FA [email protected]
438,376,501 *2C648E1252797E6361358DBB20CF956968F0701F CHERI.RITTER
438,376,502 *2C6E62CB0D3CE0C395DAA8998841631D987C05E4 aupmu
438,376,503 *2C6AEB247FBBF3F8D921DF7ECC6BA8B25DE41CD3 a(xip
438,376,504 *2C6861D4CF7B99C30EA87D2C273463396EF5CC98 B)_;
438,376,505 *2C67ABD705BFF3C57C7628AA8BB382BD84504553 chillicothegazettecomwww
438,376,506 *2C6F293060F0CDB30BA69C2DA179F02D0F2ACDB1 b103c0l0g13s
438,376,507 *2C69D71DFE5D7D2E3F7ED825066F30ADCA23916F BANDITSYSTEM
438,376,508 *2C60B8351F1E02E4CC822E6EB804D4E192ECE3A6 barneysigala
438,376,509 *2C6FDB15AE5EA1878C217838DD7D5E77BFF33E81 basa1tpo
438,376,510 *2C6F5B0CCCF8746C46661D99CB0BAD7AC1389754 BATTA2
438,376,511 *2C63E527A7B4A44A2E1A8BA04969C965DF7B0310 CITRINEJOHN
438,376,512 *2C6ADAAA096FA9E57B518DE7025E2C01B1E57B1E BELLMORE
438,376,513 *2C6349AFF33BBA558CD02900A1743921B90569C2 bertramvarian
438,376,514 *2C668F263C1D4BF172AA62AE0013E7A1F9B02FF6 CLEMENT.BERULIE
438,376,515 *2C682505A3D6E195031FAB1F0DD96507D5EEBCD6 CLEMENTEZWOLAK
438,376,516 *2C617A2A8853A192CE2E5E9CEAE6B3C1750CA775 BF7PG
438,376,517 *2C66F4386D51E72E3F611C8104586D266BF8FA5B ClW
438,376,518 *2C61B2FA761DF95FBC9645A18CD539E7E9848C59 bi&rl
438,376,519 *2C62CA0DE080C9EC3A9DA644272B1CD72F13E33C BLOGGINGHEADS
438,376,520 *2C6FF3B4202C5FE0699C99DC5C777D3DF7144B4A BNB=D
438,376,521 *2C64E0322D3E9FB97D9B857FE84FC7B6425BC9E8 BOBBY.HOLCROFT
438,376,522 *2C60DCA82E38B412C81992CF6716786A019445EA BOBBYWHITEIS
438,376,523 *2C685181770F647A457D85A3C648F23801AAEBD4 bobdedek
438,376,524 *2C6A58EFADB31092946CAF4F88D3F7B4204CC8B9 BOEKENWOORDEN?
438,376,525 *2C6E625C4907A264A74D38E0BFED825A30116391 CP2EN
438,376,526 *2C61D27047A68B1CFF69391972BE49AD791362DD BPOS)
438,376,527 *2C6A959D3CD09D4520E9E30A1E9773919C8C0B3E CR!DO
438,376,528 *2C6514BDAE98F7F69D1A5A618B513478AB9E68D9 brianwiskowski
438,376,529 *2C6B4EEEE263D0E02DB079C19C23C4D3A9B38065 bricedoubleday
438,376,530 *2C63C67CAACACF493BF1DD65EC7EF2299C08C470 CR+HW
438,376,531 *2C6FC4E547B74475DAC2BC821A0C7C4B84CDBFF9 BRONCOSANGELA
438,376,532 *2C66C7EFF4D64A48098C6280B1DA2B0BD9AB0E80 CRUZSTRUBEL
438,376,533 *2C6BB105C39784F6A848F1D1E6046DCD347B7D90 [email protected]
438,376,534 *2C6AE17FE2BA5E99887A977384DD4F7D1D50F737 csvfxiio49
438,376,535 *2C65BB6FE47D3C59688A4E219510663E2F9D1805 BUFORD.FELDERMAN
438,376,536 *2C622D78DA1F274AB35B0A1ED5BA8C9BE2FEF0AE burlbenestad
438,376,537 *2C699874B20275CCB02266F1DD135F16F72E5500 BURN.BURN.BURN.RECORDS
438,376,538 *2C6AA9E00B153D1E7614940C35669ABB8DC8941F bx_u.
438,376,539 *2C6ED297C2B42CBEC069EE0F6ECACC6262C4661F BYGNINGSED
438,376,540 *2C620137C0D6C3C60442DF273F38DF8C668CACA9 byy(e
438,376,541 *2C6F5DA8F7491A0FFB1D14393C2F1CF10DCF8B3A C/XHL
438,376,542 *2C6D069A7BDF351029623D366C1C326583009CF0 cybzn
438,376,543 *2C6CC449CC132E8F2646B6BD38E7526C9735763E c66m.
438,376,544 *2C6F7C04768D67772697D644E94906D13354B622 d6q9
438,376,545 *2C6A0CFA6D1D36F68D66E7F73941ADB7B29CBD27 d;9r
438,376,546 *2C63F41A0681EF2F8B2EA660E4280C36BADA88B9 da3x;
438,376,547 *2C67002CC69746EA084EE550A4BB1FD6E359C807 carr-to-johnson
438,376,548 *2C6A87C8E5F65C861F5B3968AF941E14B13C6A20 [email protected]
438,376,549 *2C6316E84A97FD796EB6ED10B26B216DF377203D CASEY.KHARE
438,376,550 *2C635D4AAC4E761CA6CD964A443E1586A096400D CATACEY
438,376,551 *2C63D30EBFDDD5DA5F912505E44181DEE9B7F0AD DANIAL.STANIFER
438,376,552 *2C66A20A0BBB4F9BBF53907950CFB2EC9E86A520 cb)%f
438,376,553 *2C689FCB0D4AD5931E7353C064ECAF6B9EC2057C darkhysteria
438,376,554 *2C6EBCB46A30C9037A8EE03C9D2911F279344124 CC:P
438,376,555 *2C6E2185EB9DF0577EB7831D7566FD72B19280DD ddnxa
438,376,556 *2C6FD3FF289668799C9D64BB63981DC6860120BC [email protected]
438,376,557 *2C6297D91EDCEBCF5298665EB02FF1877ED3C212 DE.-=
438,376,558 *2C6B148BA1AEA4BDDC847805743A5F9B26C2BBA0 CHATANNNA3
438,376,559 *2C6DFF833CA94451A26DAE257130013FF98ED056 DEFONCERIEZ
438,376,560 *2C6709CA2C400EC5AEB6B86CDE27395A531CECE5 chc6-
438,376,561 *2C692DB25E8997D60BB5CBF7CFF5DB7A5270E5A1 chemanuel
438,376,562 *2C644059BC63C736720D704794EB2943A3512870 dellibutti
438,376,563 *2C648B1C809FDAF687645E25C61D57AD1F4B5155 [email protected]
438,376,564 *2C6B37011AD07D66ADB7157F7326697465470DFD Demons-of-the-Street
438,376,565 *2C6FF6B68C6186A2E00993F79CAB8056909DA37F DENISEGRUBER
438,376,566 *2C60663DA098A2DE95299E00323CC183428817A6 DEPARTMENTIZATIONSES
438,376,567 *2C659425A423EBA65E653ABB9AA5CEB5ECB6E5DF [email protected]
438,376,568 *2C6C0A56C815100616F01CD7738FA508FC1D2BD4 CIHTAPOIDRAC
438,376,569 *2C6B36BF00BBAA34E7631ADD1BCE4B6F047A2544 D$eX
438,376,570 *2C644C15EAA1CD5C352EEEA9606632432D92922E DFq&
438,376,571 *2C6C568E0B4D01037FD3764A1598F4E8D99B8425 CLAUDEGODSMAN
438,376,572 *2C6A6B2F8F6E7EA0B332D86C6AED3D12C7F3D174 dhk4
438,376,573 *2C6468848A765387D79019D69CD2D218EE8CE480 cleolaitinen
438,376,574 *2C660FD5F24941884A12F0D16142608FEF7173A8 dialyses
438,376,575 *2C6EB559E7D3CCDB405B73361DAE18BF62BD517B DICK.MIETUS
438,376,576 *2C6F3062C640977F292C41B1196E7C7B36490ACF DIFFERENTINRETAIL
438,376,577 *2C6A7EE95FC1EDF338D3201A406155B12D2517A5 cluai
438,376,578 *2C6D1C8465456AFD58134A21ED64E0F47879E3D1 CMPA+
438,376,579 *2C6D00B42635BC1D01541C842EBDCCD6EFA9C776 dkne/
438,376,580 *2C64242A51AEC5B0ADB7D594AEB9E545EBC170DC [email protected]
438,376,581 *2C64A8A44BB0F05E244E9958991102DB939B572D DONGHYUP
438,376,582 *2C63C5ADC2914407169A98645DD75F9C8F3A31BE COM4O
438,376,583 *2C6DF609F2BCEB34FC9370D02BDC2169F1C87934 CONANNBC
438,376,584 *2C685773EE78FB7D01467B1FB47E475F6DECA9A9 CONEXIONC
438,376,585 *2C67C1F05EDF5391B4B780852059AD582982CD76 DOUGLASSKIRGAN
438,376,586 *2C60816F8D4EEDF2E3A3899BEFBC63AE3A1B1780 DO.WHAT.YOU.WANNA.DO.(D.O.'S.PLEASURE.AND.PAIN.MIX)
438,376,587 *2C69996BDC3092728748DFE473A82DAD679AC1F7 CONSIDEREDRANDOM
438,376,588 *2C6A01D4B751B382D369BCC3B0538D746FE77380 COY.HAAPALA
438,376,589 *2C6F1D490C055CE11B6B403E3CB4F51CA677B1E6 Cq0
438,376,590 *2C6EB57BABFCC83C008171D1D29F5E45BF7188BF cqorg
438,376,591 *2C69BAF7683CCD790A4FDB727AA10D2C37E352B4 crvn
438,376,592 *2C6C6F492BFC78EACA694D7A9BBB66BDFADA075F CVPRL
438,376,593 *2C6CE459F34CFF69CE826203F9C0E2E267E290D4 cy%f
438,376,594 *2C65EAA9350B484648D1F1AA03A582A36D3B6A54 eddymccarn
438,376,595 *2C6359143E2749A4F3B406C8E6004C93B6C3AD5D EDGARDO.CIULLA
438,376,596 *2C6A23054135686698F21A1FA2E858FDFB048FBB D1V1N4T10NS
438,376,597 *2C6B107A4FDA05AEC63DAF604FE526BBBADB56CA d6g)
438,376,598 *2C66A924E77B24B4E6B6580620C61851FA117065 D81092
438,376,599 *2C6550366134F0CA650AA0E4C134713661EF841A ehguo
438,376,600 *2C67BFFEFB84BBB026E9402EC49A4C58CA4830E6 DAMASKERS3
438,376,601 *2C6EA06709738AA54A0583D7170BF6A3CC4A6C6E DAMON.KAISERMAN
438,376,602 *2C6D18BB7A7BB32EC25437413732946C6A7FAFE8 DANILOLUNDSFORD
438,376,603 *2C63465A61ECD4E9D04B7B97385ADEACFC23C304 dansemacabreingminor,op.40
438,376,604 *2C613B02D3F39BC07FB9C0F5A678DD681198655E elkonigsburg
438,376,605 *2C6581091105B14C6AB8C35CB83DCE6B257DE710 [email protected]
438,376,606 *2C69B1508A5CA9F54A0A4185B86DC8F445ADE4B6 [email protected]
438,376,607 *2C6F8BFCF97C6067FDF00A98A06823F82F934AD0 DAYTRION8
438,376,608 *2C633C2D1DAE0AEB25744E77CAA567EF991D91D1 (~_^)-~D######B
438,376,609 *2C6DDCFFA7772586E78F4D769EB4322BD5F030EE DC.J
438,376,610 *2C61965B51B6C53EBC24DFD6B0E782F29CCA9243 DEATHLOK3
438,376,611 *2C6779C3A221560DF68F509C9AFC076A051E898D EMANUELCICCONE
438,376,612 *2C6F6A5FC68991F357C5E733D2432526B76B9EAD EMERUJBAED
438,376,613 *2C687073DF559610FF9ECA474389B9645BF876B9 DEFONCERIEZ
438,376,614 *2C6F478F20F505CEE2B36B2B28A2E94C08B1F11D DESPF
438,376,615 *2C69BC6E69361742A0CA73D885CA1E49EDF38F88 D%F)H
438,376,616 *2C6516113C14E1D3F819CDC824C8F1E07F64F891 EN=5
438,376,617 *2C6547B173C4C483AD97724683F63E99B37DF002 dh-nf
438,376,618 *2C6A1F2F84B2BD8EBA96C67B09CE2F39447E2CB0 EPEMVASH6
438,376,619 *2C624D6F1EFD0E2657C9A2DC823DA87534B820F3 [email protected]
438,376,620 *2C6C4D766EBF7947188B4F31733D9F2D083AD7AD EQU1VOTE
438,376,621 *2C6D7A5EFDC5E6253676EBA298EF13318A455E35 ERADICATED3
438,376,622 *2C6E3F9C97C2B7D460F9638861FE864C09FCC372 ERIK.ROLEY
438,376,623 *2C648FAEE6EBBE8FAD7A3AD7409FAE4D02763536 ERNESTO.AZZNARA
438,376,624 *2C6BDFF4B8578FAA05A6F4C23297902ADBA24293 DINU.LAZAR
438,376,625 *2C673700CE41BDB62EF19B3CEAF8AEAEFFAC4C0C DIOSPYROS
438,376,626 *2C69B3FE7501614447263CE17B65F9B7D41002AD etoyd
438,376,627 *2C653946C6217D5789B5F8CA182551A89F4F5909 d#/l2
438,376,628 *2C625C5ACAE5B4EA00222540755A4967018A719F DLETOCKL
438,376,629 *2C6E15DFE583C6D27BB9631FF607BA45CB6ED9B6 EUIDENS0
438,376,630 *2C6310E1202199F2A3D5671B02590A737D6078A2 expp
438,376,631 *2C62B324D7D00E31DD17149DCE8CC3BDB79FA0C0 F10PP3$T
438,376,632 *2C674A22855770449BF040996705967680DC1F90 DOMINICK.MERSCH
438,376,633 *2C68E8C91677162F91531C9983714D06A53B7976 dominictest
438,376,634 *2C63F3DFF3A2C170D02C6926236F7023375723FB [email protected]
438,376,635 *2C64FB5F64EB1142D6423C6A10634A0382640095 FAUSTINOKOZERA
438,376,636 *2C69B746D96FC1E6049CF590A7F56F77F994D17F [email protected]+0riz3d
438,376,637 *2C68694ECAE009F21DDB6A0EB94BC375E8A44164 ferriferi8
438,376,638 *2C68840DE9133C6D2A71DD56A39A4F28CFE351D1 FILFORMATER4
438,376,639 *2C6D6FCFD323B0903B31CA0DF6E9BAF13DD31F9F DR/JL
438,376,640 *2C67721284000A22308125F91575304A907088F1 DSELVARAJHA
438,376,641 *2C6FBBD766F873DA83D56A7F296CAC84C163B485 FRANKEERMACHINE8
438,376,642 *2C6865D8492D8CAC31797557561AF0ECD3584AB4 freddiecardena
438,376,643 *2C659DC98E3B40A08A70E163A8DAB9E7FB81981D DTSCHAK3
438,376,644 *2C671C7A5E8CB88CE678EE9F34BB8F0A017D7B1A FREDRIC.MAZUREK
438,376,645 *2C6607896C03FF9554E47EC95F4A4DD931A774FE [email protected]
438,376,646 *2C6F995E90404607B070AA1DFC4B4AC8796D3EF1 DUDLEYMARTER
438,376,647 *2C6269DF56750A70453230B8DB3FC2E0D85AB91A FRUCHTLD
438,376,648 *2C62FC9177C88FFE337C2B64710DB7A94809B37E FRUMENTY
438,376,649 *2C60F68761407F220109BF2440F6AF663CF9B7B4 dw6&c
438,376,650 *2C6E76C7CC1B48D2F655595987518EB675BE0F40 DZ?"
438,376,651 *2C690A6494F11AA063E1827A931885DD9EDB993C GBAYA-BOZOUM
438,376,652 *2C6AA91C5D68AB0B64B469CA9146525311DE2175 GEDOSEER7
438,376,653 *2C69CCEAD9DFAA2E77C28B94CDD709B843145420 ECHO MACHINE
438,376,654 *2C62EA3ED449882E0071851F5598DFB62E7462DE eddyclawges
438,376,655 *2C611F333FCEE589685D5D3C3751AAA3AD2B2FA4 EDISON.COTLER
438,376,656 *2C60879A0AC260CAEA0DC5B318389C06A6B746BA EDITATES5
438,376,657 *2C6ADF2E57D7CA1034B06BA24F601C5E7209406F GEZAGDRA5
438,376,658 *2C67ECECF641692767B84FB180E9F43031200240 [email protected]
438,376,659 *2C605059849D83A152EE4FBAD2EB125EB2CE9392 eds=!
438,376,660 *2C6A88BD87EBF678999146031909689712A2AD70 ed-(Suve
438,376,661 *2C6C75D9658F980627942351A9F5C642DAFBB61F [email protected]
438,376,662 *2C6BB6E662F47C7864D0579C3884BDC0E88A1F5E GIDNTSLL7
438,376,663 *2C67127171481CE4C075EBE9A73E3D6D758C41FF EDWARDSHOEMAN
438,376,664 *2C60AA87DEA72B8B63E12211564B1E3949FA9E3D efmfi
438,376,665 *2C6967D120F022FC9BFE60052A12FF1542C2DA25 GLOPPYGLOPPY
438,376,666 *2C6625D70550CDCE678F26DB54462951FCD6FECB ej%t
438,376,667 *2C612BA18DCF618C9A0183ABEEB3F0FAEE1268BE ELEANDER
438,376,668 *2C6A0F3FC0E1B0669CCD891647CEDF8C5A62389C GRAIGFASON
438,376,669 *2C68A9CECC6EEA62A4FA594ABD83632D9276B439 ELLISIMI
438,376,670 *2C64367B3EF7B5D5C33889C12454B2F8FA26FE34 [email protected]
438,376,671 *2C6B9CA719B364E8CEC6C3A337393FFF3853039C ELOY.LEIGHT
438,376,672 *2C682B920CB925F8EE3E61A95D117194EC1E2FE8 ELROYHORRIDGE
438,376,673 *2C65C9C5113E28DE770972B34E97B527F5C5BCA5 GRS’S
438,376,674 *2C63186C998CFF91731652A66E1907630247AA01 G-SWING: SWING FOR MODERN CLUBBING
438,376,675 *2C69F00CE758889E27ABD7630B677C8B0D84EF3D [email protected]
438,376,676 *2C69F90294B983A699FD00CE3954243667DE0ABB guarasa0
438,376,677 *2C6D05B4CC48586113BBE21318A949CCC914ABC9 guineas5
438,376,678 *2C6FF34A978C8A8101A3FB656CD421875A692F83 GUSBLONIGAN
438,376,679 *2C693F367EFC4265E5DF7F37D54B4E9BED64F022 ELVIS.MESI
438,376,680 *2C6A11777A1BE622524893609F2C7C1BAA0E12C6 emanuelhardinson
438,376,681 *2C6428858C56557910E282325B32845AF6DDC809 EMANUELWIDNEY
438,376,682 *2C600EB55FCE3170DD8BD55E0DD1C92383375EAA gyniatry8
438,376,683 *2C629E2A12AF1A1954FE8A4202CC44E01FE6449A emedarev7
438,376,684 *2C661B886F93F73A8973627169DC005FF070208A ENALLEFANT
438,376,685 *2C6298ACC9D0ED66F2E2D18C0ED91279DDB2568B Hablame.De.Ti
438,376,686 *2C69C6DFFE53C53949A7717BCD1E4EDBBCA0EAEA HAERUSSALEH
438,376,687 *2C699635EF0F81702C37C6CECBE1102667931761 ENILATFAN
438,376,688 *2C65F4F75309D860761D1918C1B782BD33E5D3C6 ENSG00000144810
438,376,689 *2C6128DA73E0878255A9E7CC5D2A72B2926165BB ENTSEJRJ6
438,376,690 *2C62949BC54C68F16E7521CFB05BDE402577FDD7 EOKUY
438,376,691 *2C64B13FCA588EE38404BC2603A535BF487E3557 ERMIRAIT
438,376,692 *2C647E27780CA5B414B06A1CD06159511783A062 ertlifni
438,376,693 *2C699B014AB097975D89532D0BA06D4F14CB2E79 [email protected]
438,376,694 *2C6509EEFEA5438DA76E6C368033B4BAE1827247 heebomen9
438,376,695 *2C6ED47A649B159C1A1C52B9ED2A7EA16C9D7CDF ESARHPOLED
438,376,696 *2C61FA5EDC487B14CBCDDC08AEE55087F9CC923B [email protected]
438,376,697 *2C628E0BE896B5A98E7905DFD82C4000A20E54BA HENRYLI007
438,376,698 *2C69973A6C41B0558CB50897846A8B043D07A2AB hershelconnely
438,376,699 *2C67DE4577A0F0D555AB7C628425AE5612673C77 ESTUAGOA
438,376,700 *2C66D3F4DA4BC74F0B435F5EA111465C0151959A et7/
438,376,701 *2C69F32E187CF526DC2FA41BE1D0A467FA941472 Ethncally
438,376,702 *2C6203B357128E5A51EAC423ABE46D9BA9EFF6D6 etoyd
438,376,703 *2C69B3A01C0CD1232E50D8BF654923BD6F17F8CC euq0s
438,376,704 *2C639F8B326C9D8C119F6B8E80069F5FACE05991 HocheMong
438,376,705 *2C681A289078464C00CEA2848FBD09374EE936B6 [email protected]
438,376,706 *2C67CA77B3A2866D1FCA48BD21EA7F105E4672C9 HOTNHORN
438,376,707 *2C6DFF49218C7543AA38444A7746B3A1E683FF86 [email protected]
438,376,708 *2C697DC5CFA61F8DD4F5AE40E6565748E73A97F1 [email protected]
438,376,709 *2C6872A6FF4655C1E806888E66FCDCDED39BF882 《FACSIMILE》
438,376,710 *2C6A1E544C1BD18805E09B97382086295AC539EC [email protected]
438,376,711 *2C60516CA2815B5667BBEE4AFCEB9EDDC75D16A8 [email protected]
438,376,712 *2C657DEC4819C03AC343B62ED0449E24039D7B75 farahnaz.irani
438,376,713 *2C67C04D4095DEF55CF7235EB1C16A30A8106181 hughbirkholz
438,376,714 *2C61F777077A395055271C39391113DA44444CD6 huhnedenieshewasresponsibleforcalamitycleggcampaigndocument
438,376,715 *2C6E270A22AADF879DA1DDD6646DC02CD7AD9167 hypocupremia
438,376,716 *2C6D26BF99FC87BFCA614BCF87E6D85A275AD04B ferdinandsagraves
438,376,717 *2C614243172E4AC36DCA9F86B82500FE8C4D75C6 iambigboss60
438,376,718 *2C6461666270038EFC1D999FEFBF492E1DDDAF0D i.don't.even.know.how.to.work.a.vcr,.let.alone
438,376,719 *2C6CC3DF8A1FB6134FC2E1471999B5BA4D650EE2 IECE
438,376,720 *2C69FC402E0430883C9483050C5C0FC0D5138B45 FRANKIE.SASAHARA
438,376,721 *2C6A8C1FEAA3C508604B9DBAEC25F8FC17607FA7 frankzaid
438,376,722 *2C6AA745F09EF4FDCA6888245C76CC0173EE2CF9 from the shores of the mighty pacific: rondo caprice
438,376,723 *2C67C7AA2276912FD678F612C99843B5755E073F [email protected]
438,376,724 *2C62C936C69EF0D88756E42B525A6211264AF74A [email protected]
438,376,725 *2C64808C0BC55747BF3DBE7E1A862ABC6514851A IFXGG
438,376,726 *2C678782B91441CA113AB8004ADD2661B9E7BAA1 [email protected]
438,376,727 *2C67F9EFA29DB2BD9C2BFE4ABDFDEAC78FFEC0C6 IJSBLOKJES
438,376,728 *2C6EA664B88BA8472E6E442DF0C300BF5138A2D5 iknowwhy(acousticversion)
438,376,729 *2C633DA136A7CA7F4252A63648848DAF555221BF GARUARAS
438,376,730 *2C6A903F9A77EFC4A21B2CE57B0843C7BA7E2E75 GASTON.CADARETTE
438,376,731 *2C6EE84CE9C03B4D6A83DD8CE8EA55E60407CA26 GAYLE.CUTHILL
438,376,732 *2C64689441F8FE695DE22AF9CE011995137E7A44 ILUVLOGGER27
438,376,733 *2C627810D874E2B545B2DBDFB2CB70C905FE5C1C ginoharamoto
438,376,734 *2C645B88F57A7200701A615AA2A0588D8B0D8233 i'm.trying.to.read
438,376,735 *2C61D9859B07927E026CFA8A82531160FACEC151 GIVE.THE.GO-BY.TO
438,376,736 *2C677E67074FB69E5E2B25DBF6202298CCEFE7D0 INSTANTPARTY:JUSTADDTITOPUENTE
438,376,737 *2C648679CB5D7200CD9B6EF5BC75A071733A657D gradyvogelsang
438,376,738 *2C6B6A471C049496A1831879301D200B96C99A47 isaiahlubahn
438,376,739 *2C649D20BF9F2A2EC6DC8E8A3752252BD05EF1AC green-energy-and-technologies
438,376,740 *2C66687791C6503C7225CF292B505C67C019FE5B ISEEEESIED
438,376,741 *2C63B5A86882C73425A6FED4EC3F4EFE1ACFBF95 ISPISAHING
438,376,742 *2C64D3A52194AA9B23224066C9AB1DCDD00D14A7 GRUSOMMED
438,376,743 *2C6BF74094F284F1F66734C00D7CB05EB65DC6A6 GUEST80907
438,376,744 *2C626BF0DD9ECBC91F6FBE611C4400BDBA88B655 gulfcoast
438,376,745 *2C6BF1E07C0B06E9B1F68822F17505E98D24FDF8 [email protected]
438,376,746 *2C66645DBC306E524912FD435F221D9F2379A4C3 GZIPは
438,376,747 *2C6C3DD372946092354FFB6D67C0832EF0582295 JACKSONGARNHAM
438,376,748 *2C669037CF8ED09739626DA625F2C8C98364B534 JACKSONISMS
438,376,749 *2C601247164A12D143C606051946052927CDE809 [email protected]
438,376,750 *2C6BD39F84C445AF7408C7D9F748C5A796B6A570 jake.de.la.cruz
438,376,751 *2C6AC6B0507C052609EB303FA736929B990C36DC jakii
438,376,752 *2C66882A85F42F1FB78AFEA275D3574CA1E889DC HARLANSKEELS
438,376,753 *2C671F14EEC6DC998C9AD0BBCCD37657414D63A9 haroldtront
438,376,754 *2C6B94D4C396744AABC7497819592DC50407A42C jarviskozloski
438,376,755 *2C63E90FCC58441BADBCE66878547E1AB1DD781A JAVIER SAGARDIA
438,376,756 *2C68D48A56018371AF441520B3AF8894CDA6C895 jaysonhaston
438,376,757 *2C674DBBFD7A6526DA7953B0153AAE2C427E9287 jd{3
438,376,758 *2C6D2C5508847F231F93B5D41690DBC991647957 JEREMYSIGNS
438,376,759 *2C639D0D0C8F6EC8EE7C0B18B5B716E0207C5B1F JEROMYSOEDER
438,376,760 *2C6C3BF1E46F09CC0B9FD450A3B6E39E782A3BF5 jerrellgermann
438,376,761 *2C6151B762C8EE03625C9B81A0F0FE965BCF6F76 JESS.BYFIELD
438,376,762 *2C6941B2E72A2243AA648F40FCB6DED3540090C3 J-E-W-S.2
438,376,763 *2C68116B9CB2249974DAB3A8AF9B15307E77E8E8 jg/1
438,376,764 *2C697C7ABCE402701CBD85FCCFA425108DC27FE6 hemelvaartsdag.
438,376,765 *2C631F08A3F84C4DFEE50F6EA390D64BB5982306 jly9
438,376,766 *2C6B7E323A2965019ED48FF99B30F7E08D9895FC hilfsverein
438,376,767 *2C64912FC629E148EB830558C3A3609E89EDC1BD HIRAM.CROKE
438,376,768 *2C642E1091BE6635F2F38044FFD148BBC15B90EF johniaffaldano
438,376,769 *2C6D67D09B162B87EEE1E7BD58267DD629891D58 JONATHANTAGALA
438,376,770 *2C678D489DB5EA444E591A6E11F5325125DD5404 HOOWANG
438,376,771 *2C69EC90635310ED37B59753CAFC649E3F1C4BED JOSPEH.TEKELL
438,376,772 *2C678E876B3E7984693E43F908370DC78D45CE8C hornyhoo1
438,376,773 *2C6C0CF69719C5093203061F6DB61B66AD23FC3C HOUSE OF PAIN ANTHEM (ORIGINAL MIX)
438,376,774 *2C6A42C1EE23AD2E1C3F849F1B99241CBDA5F6FF JUICENJ
438,376,775 *2C6AA37CE352FFADDD1C714A709321195839C5DC JULIE1OLIVIA
438,376,776 *2C63797AA4667CF49FCDD50EDF014C09471FCE9D JULIE FAUL
438,376,777 *2C675631FCA1C67B139EC71CA988E53683F8C753 httpwwworganicvalle
438,376,778 *2C62D4401AB538BE614F5F3D8770535762AF2832 [email protected]
438,376,779 *2C68650C44F22C2FDCC3679B20986D7C93D5A569 k3lp135
438,376,780 *2C6FF6338D305405774F26A5A312BC2277BD7991 icedaxes8
438,376,781 *2C6356D60B151E8CED4A2075EB2FC972BD541040 KELLEY.FATTORE
438,376,782 *2C6781D558B07336EA39A902E478FE6607972125 IEROPHYLAKION
438,376,783 *2C6A864194C9FE40CED98CA62269A4A9034C30BA IGNACIOSTOFFA
438,376,784 *2C6393C929187A9701FE0FF2B88F83A02509180E I-Have-To-Dance-(Mike-BTrunkin-Radio-Mix)
438,376,785 *2C698778E70246C9B8896FEDC186FF6A9D1148E9 IKEMOULDIN
438,376,786 *2C66819158B0D241F7D7864B0B41C442CB18718B IKIZDERE9
438,376,787 *2C6119646E81318D8D259655AB0AFF57A531407B inerimsu
438,376,788 *2C64CFDBE378A3A8A2C1F1645415D18C1224551D INTEGRATION »
438,376,789 *2C63EA682C86A223161ED63B0D14106A1429042F irwinnemzek
438,376,790 *2C64F9244018D0F8F7D3682F2DCDF69D5385107B kendrickherskovic
438,376,791 *2C600640E500AFF570C01D0B1A53C76D7F6E0D9E KESSLERS7
438,376,792 *2C6C0DEFE26EEE8CFDD4CE6EAF863C1B2D186C9B ISAIAHSAVANT
438,376,793 *2C61774F308DCD25AA4E45AD53EB97D4345E8FE4 ISMAELCOTTA
438,376,794 *2C66159CA5F920109D83880B86488E6AEFD5E8BD KINGWITHOUTACROWN(MIKEDREMIX)
438,376,795 *2C61C4F12BC5EB238298C3F241F9301B725CB1F7 kkfx
438,376,796 *2C6C38DF0DADA97BC136522503260D0022D36B3E k$?m
438,376,797 *2C67E8A7CDF9CD6B2C757842BF6FBAFB4302C683 JACKIEEISENBEISZ
438,376,798 *2C6AB69B4784D245AC910F047CFA797F8638AB26 jackie.marinoff
438,376,799 *2C68A2461DDD4DAC3610FD5EF222CF655EB702C8 JAGERSLATIJN4
438,376,800 *2C627B3C710F417A06E88EB5529AA278921DED94 JAMAAL.PITCOCK
438,376,801 *2C67FF96697D581F1BA075AA2083D11FECA34D59 jamellebeaux
438,376,802 *2C63E3FD4ADF0AB0B49DF4F5EEB1B327B1E29EBF KURT.HOFFER
438,376,803 *2C609FEDC6E140B93FD968B53A9EC7F90D472265 kysanou
438,376,804 *2C679044FF21A1F23D7F57A121C061BBE4E27F5D jeffrymalicote
438,376,805 *2C689DBB405E094A8DA6BF620D753374EE8BC223 jeffryrampadarat
438,376,806 *2C6F5E5042160CF18A977DA3B7A9ADF37CEEB429 JEMPSON7
438,376,807 *2C6AEC5840BEBF1635410B5679FE8DA9B22A0770 JeNeT'AimePlus(remix)
438,376,808 *2C69BB7D89B8BD4F042E37E73456C16FFFA3ED25 JEROME.MASERO
438,376,809 *2C6712BAE1D1046205E79D13B16761A3FCFD82CB LARKINWHY123
438,376,810 *2C6ED8165DC15CE5E72932AA473993668A42FEA8 LAUCHATAL
438,376,811 *2C68595A5380F02459F69F35E20588014BDBDA8A jimmiechiapetto
438,376,812 *2C659B57BDB5BCC5E3D0E3AE9ABB143F78F20905 LEAVISES2
438,376,813 *2C68EAB2E3E484A0A378DCCC295D38F0C9325FB8 lelouch921
438,376,814 *2C6E6F574D6FEB12B87AB259021245006C1BC5AC JONGDR
438,376,815 *2C68951087CACCCB92ADB40988558F8AA4D2DF01 jordancapaldo
438,376,816 *2C671EF0A87937489AC33CCD727E7E2337CBA131 jordonlanzer
438,376,817 *2C654F7E4B605AA3563FB2008F5BBDA0C3BF6AF2 lesterhascup
438,376,818 *2C6956883417FC86CE40474FA98F009DB912C34B JOSHUAMANZANO
438,376,819 *2C60972A25E0A4D6CD528B18248F702B17EA158D [email protected]
438,376,820 *2C615B48A381ABC3EED50FAC47495372D2C9C2E9 [email protected]
438,376,821 *2C67003021E312EE994CDB55A92E167A6911FB4D [email protected]
438,376,822 *2C66ADA0AFEA0709107A4D3761C0473F1B875116 librarianing
438,376,823 *2C6DD663AC2FA9E73264B3237D67171F3373159C judah357
438,376,824 *2C633B3A5FCAD0911F9D26AF49E4B5670C160730 [email protected]
438,376,825 *2C697FEB3512E8F260DD7F75DC474F7707BEF5FC JULESMODAFFERI
438,376,826 *2C63521F156488544A4B4585EE9F73F1797265D0 juliakaz
438,376,827 *2C62FBAA338B98313518BD416B53D4C7B483ADCD j>v_
438,376,828 *2C68D7F32AA64ABF062B2A55FB42896FA8406AB1 LORREGOED5
438,376,829 *2C63F2DDF2ECFF5C17D6168E6222D3ED16616972 KASSKOOYE
438,376,830 *2C66D5FD09F918839924A15C201AC82031BF2C17 loydlandauer
438,376,831 *2C696A68CFC58E5E756D8E25AE1F389A514D9164 KDAAKE
438,376,832 *2C6D42414009E0C1E9BC3FA23A30ED25E4E53A5B LUCIEN.KLAJA
438,376,833 *2C6FC73F853B458D43956FD5566809682DAADFF8 KENNYSIMON
438,376,834 *2C6512E53512D94A336715F039ECF106CAC55AE9 [email protected]
438,376,835 *2C60F86A9ED7A7A627982A26B6A5927721B710B2 LYNWOODLAPIN
438,376,836 *2C6437A075EA23BCFBAE1BA3C505399147EF1DFC KILD3RS
438,376,837 *2C6B918FBA8853C3DB9C971461EF1EDD466336DD [email protected]
438,376,838 *2C60613D5E7191448EB6B02D8B67FCE487D24C8E KINDZENENOP.15:VII.AMKAMIN
438,376,839 *2C6D18CCA6663AD1AFE78986556C06F256A6B9FF mairie-saintjeandemonts
438,376,840 *2C6E3F10422B6B5C837222CA62A430C17E83E5F0 MAK.MUKUT
438,376,841 *2C6AA34A86120AE80BCFBD225EC7C09CF2E3EAC9 klasseringen7
438,376,842 *2C65B702C2A3F5CC246012803CC842022A27B29E malefcence
438,376,843 *2C67B0EC41D28597F4AD2D9312756521AEA9782B [email protected]
438,376,844 *2C69189517BDA0DB3D2E9C205CEA8752528B02ED MARGARITOCARLAN
438,376,845 *2C69F198371B2F9952D0FB6CEBEC4E8F53011FDA MARIA_LANGUAGE_INDIA
438,376,846 *2C611F85C05E603978B203A7FD71B83D9E05C059 KOREYDEVEY
438,376,847 *2C66EBE427002D5FE067D906BD562FF05C58BBD3 KORNOG1
438,376,848 *2C6DEF3051FBBF52473965F58BEDC29DD12E27DE KRIJGSDANS!
438,376,849 *2C673AF2E3F20746A3769F5846F762989F1035E9 KUMYS
438,376,850 *2C60944BBD78BCAB2DA3AFDAB37CD1372945478E medellín”
438,376,851 *2C6714EA99261738E338616E9985DAB91011C2A2 kuusekim4
438,376,852 *2C6EC5EFBEE6B22850ADF60E04D787619A47771E mervinmascroft
438,376,853 *2C6E134EC21146EF3863CE7DD3FFE54AE80A9622 La-foiba-di-San-Giuliano
438,376,854 *2C65621E876FD2C5E99AD6A57D6ABC8FF686F567 LANCE.MORENZ
438,376,855 *2C68F05D0F3F3C3F4CD4C63BADB67C2C28EE21D5 MIA023
438,376,856 *2C6109E5CECBB5844FFB77E55249503F19DC0B25 MICHAEL.MAHONE
438,376,857 *2C603D2ECCC436E37E3CAFAE3DA0A0A00F51D15A MICHELLE POMPEY
438,376,858 *2C679F867901522E3E4DD39F7ED38DBAB49C0A5E laurencin9
438,376,859 *2C60350EC54C1EE081733C913645012C25A046A2 leavdnjajohka
438,376,860 *2C64C1F08ADF597B8E6B462D9BB7332CCA96B6E1 [email protected]
438,376,861 *2C61009B42CBB58BF4D7F58D038DA08CB2D59D32 LENNY.WITCZAK
438,376,862 *2C62CD250B480E201F740540A274605307FE5653 LEOMALETTE
438,376,863 *2C6461A1214B0AE4BB2B190F52692A7D20378F31 leonardoabbe
438,376,864 *2C607EC85DD4EB357176DD7FC5EACDEE2F342A02 leonelmellberg
438,376,865 *2C6C94420DC80E9C48A0E14E147F4D37E6F7EF1F MISDETECTED
438,376,866 *2C6FA66B13A41384357454DCF78DD7A2470B8CF7 liang
438,376,867 *2C602FB372C1B9CC3138F687F3070F285A56BC80 MMWDATZ
438,376,868 *2C6A9C5DA05026A9AF06983D6969282018AFB9AF LIBBYANDERSON
438,376,869 *2C64A0BF9FADA0B5357A17D6E1A1F79D790734C2 liitoksi8
438,376,870 *2C6210A67035A09200001D71035F1F913C83AE42 morgansanmarco
438,376,871 *2C649AD3FA51B430C180056165BE4A3F2E74F261 [email protected]
438,376,872 *2C68D82124A0F597F032CBE61BA1D8B95F81CF89 mr.-welling:'-if-you-were-my-kids,-i'd-punish-you.
438,376,873 *2C6B431E894BC1A21194BCE632C018B7F90ED9C1 <LI> THE <TT>$/</TT> VARIABLE CONTAINS THE INPUT ENDOFLINE
438,376,874 *2C69FCF0130BE1EC46804952355333FB81CC33CE LKJ074
438,376,875 *2C6CC81F7917D3661174CE7B0A52A47E4B44DDF6 mycelum8
438,376,876 *2C6A82F72D039941085C06F7C38801DF01CD8336 MYRANDOM12
438,376,877 *2C6B3F3C86AAD87F3BC81CDB3B4C9D03F5A8858E @N77H3S3S
438,376,878 *2C6F1BD037C54FA774655BF85F10D1F8D28FF462 NAAKÉE
438,376,879 *2C697ACFCB2199914D9E1F4280BC05EBA3B2CBAF NAMORICARO1
438,376,880 *2C66F9D5ABCE1799F105BCE211E0FF9979341AC3 NANGURIM7
438,376,881 *2C676DEE23995D3B1753BF04DF7847F7897247B9 natursteinimporteure
438,376,882 *2C6672C2BF551F219D0076E5EBBB1F1F70964125 [email protected]
438,376,883 *2C62DE3F2FE7BBCBEE2087C5A1E96FD4E26734A3 NEMNDSFORMANN
438,376,884 *2C6105FC42EF98B91799FCFEBC8972E892E086AD nerrissa12
438,376,885 *2C6B57394A25DA4E4F8EDBA3163579A38F3B1024 NotFa'Nuthin'(featChinoXL)
438,376,886 *2C6BED0CD6A947F5912BEC8F73B272EC1879458E NOTFULCLEANE
438,376,887 *2C6A2751DB55BE0EE09F6467C48C62A8189F1E3D LYNDSEY-RANDOLPH
438,376,888 *2C652253ECCB3173BCE71E1F9612916C1706E889 m4!$on3tt3
438,376,889 *2C6D93AAFB8E40E10E877A65C37C342E79EA09D4 nwxeleia5
438,376,890 *2C652EF33E48C9E4ABD6653FE987AADC2C835974 MAENALYNA
438,376,891 *2C68B74A28A43FD8D371058CA212584DF4C0BDC7 MAGICMICHI
438,376,892 *2C68C9D3DDBF6330ECD4D80471F57384B95787EF OLIVERHAPPEL
438,376,893 *2C6C5CD6B46A0DDFCEFA215EEC73A1ADA775905B ONBANCORP0
438,376,894 *2C6C94D118B3C58FA13C4B90B77E4DF5286247F7 MANUALCOTE
438,376,895 *2C6D2187BE0968E069A41074E637389CBDEA4B15 OopsUpsideYouHead
438,376,896 *2C65615036E81FF1D42A496ABC36E875A1ABB412 ophiophobia1
438,376,897 *2C6557FDFE9C90F76796126E7775496D45ECA8E0 OREGHELED
438,376,898 *2C61A1590CB0E65DC9708E3877CAC61D69F67610 OSVALDO.MIHLFELD
438,376,899 *2C6D668B74FCC9EBCA576723973419046CE25A17 OTRYGG-PROVANST
438,376,900 *2C675DFEEFCF9EADA8C1575E8A77B494A1D4C7D5 marvinjeppson
438,376,901 *2C6A0D29646ED6CC7D354920B777873D1BE9D278 OWINROTTA
438,376,902 *2C65B7FD09399243A3E2E5513DF46BD08056A3A4 MASUREK
438,376,903 *2C618FEDCA0F33191A01F3829D1CCA85B853718E “MATURATION
438,376,904 *2C67C8B6E55109DA48D3C4AF8C184D96DE591FF4 MEDEMANTICORE
438,376,905 *2C66E061EB2D98EEAD568FF267CB0C37134A2115 medizinhistorische
438,376,906 *2C6DA935645C1EBF0E6FADAF02C16B75C661C1FA MELIZA-VIAGEDOR
438,376,907 *2C67AAA2ABDFCF8D286E0D03EA1EB6AF2E47A635 MELLISAANTHONY
438,376,908 *2C625F069BB256FD9F43B65AFC007A32F307A098 memoedited
438,376,909 *2C6ABF2A58B0693BD55FB4CA4BB62CECEF525569 METASPERMIC!
438,376,910 *2C67B8B19FA27594BD1CCEEB318FEC0B42FD21AC MIKEL.FUJIKAWA
438,376,911 *2C6550EBC01E26B6C852679CF0B96C538A3CA579 MILFORDRIGGS
438,376,912 *2C67227FFC5C4B880F52C8C868D5CCFF5B04B027 r d
438,376,913 *2C65847FFD51439BF93D070215D3EB1A1E85D355 #
438,376,914 *2C6B94A9E0086AD86396086F477070C9302E32ED minhnalbach
438,376,915 *2C6F86034BAD8723E753D44A48A7D2F334AB406A Z
438,376,916 *2C6B830DC69CDEF55760046DB54A6695E71F11B4 (]7
438,376,917 *2C64B685F08862C435EA31099AA6F73E54553EA7
438,376,918 *2C6B8AE6DF32A483E5F978A19B74ADF8C1F87354 5%M
438,376,919 *2C60F496330207E75D03AC94DB60E369CD849A8B
438,376,920 *2C62BFBCB90B4C69E77CF1C7305B1B4912D72488 =
438,376,921 *2C638A01FAAFDE6D01865A94E3C7F73855FD1A81 w
438,376,922 *2C663B6D734417CF75EF6CAF5C9CF85AC3708D40
438,376,923 *2C61BB622D8F556A6DE19C6C5F9DEF0E91F1E3B5
438,376,924 *2C6A349FBBE56762B8A952F8494CB55326185412 M}|J
438,376,925 *2C6E7F74A7B746359FA3CE91AD9FD17F151D6623
438,376,926 *2C6F95D86571A9939F3FB22FA5B0B7EC992AAB4B MKETCHAANI
438,376,927 *2C6FDC2A43E2637A88B5A861C9C11DC9616E4AC5 MM0R7417E$
438,376,928 *2C64B8D89FADA59A21F23A1315ED1F5434557EAD u3J
438,376,929 *2C6398FCAD01DB0FC0A9FB85BCDC5DBAE562D35E
438,376,930 *2C691CEE980B41B4D63682A877904051B90B7B5E #Q
438,376,931 *2C67A91CA35EE3F55127AC39281F143A7F2C3FDA MOHAMED.ZUBIATE
438,376,932 *2C6C1F7868F13A3CCEF4B56815A9D51F7247B9E8
438,376,933 *2C6DD5B2EFE7172115D1FA7ADA5A864EDC3CC5B0 moisesspeedy
438,376,934 *2C63A0C2615770B563B748C8E80D2D42DBC1A72C
438,376,935 *2C64184A24F4057CFA4D36A24B95EDFECB1DE635
438,376,936 *2C62BC7100B9439B50DE41CD47D87827FE59939B
438,376,937 *2C6F603DBB283A982FC55D3856DBC13B500F5C2A
438,376,938 *2C66B5CB28696214678B1D118D1DB48FBD251C20 ޏf
438,376,939 *2C67BFAA9A0C0E7B68AFD337AB9373C7D9918F81
438,376,940 *2C68AC797B32D7CDD78D4FAC14136AC350C755E7 C
438,376,941 *2C60F71F92350667E5B7FD4C126B84A6014DF924
438,376,942 *2C621F5416B5A417C07E8F6CDABD4CA5AED783C2 A5jI
438,376,943 *2C672844DADE7CA35118F75A6CF677734618F68C V
438,376,944 *2C6D466AE1B7657B37DD7666BEE9A3B2BBDC7122 =
438,376,945 *2C6494E9C6015E4F37F8BA61F07EEC275A30009A &"g
438,376,946 *2C6AC691BA15AC163E301D642784135CC6B2BD65
438,376,947 *2C6E48F887BE6F7279E8C1DA6C6FAE73982CAAB4 7τ[
438,376,948 *2C617CA157B803916C9FF57247419EBA7EE2FF2F 
438,376,949 *2C6A8AB8006989F45147248028A1B3311D767A9F
438,376,950 *2C6CEA609196D0395FCA9DC95676B86439812447
438,376,951 *2C6526C77C4E38DDDA8ED792078F2577616100BA mouzhong's
438,376,952 *2C6A396B894D4C86B9C2C2D0694D80BFF926D126 MSCHILLINGER160TALK1
438,376,953 *2C67D175D291B06A68A52098D0138AD5DAA89110 [email protected]
438,376,954 *2C62238ECC259CF0B9661B622F0FC28BAD76B292 MURATBISKIN
438,376,955 *2C6488AE6E07E1AE56C67E4600460F9B446BC4A9 101 grafigi
438,376,956 *2C64E2CF295188664E6D4062E9D0E5BD0998DCEB [email protected]
438,376,957 *2C6C2748B7C21FFF974CC2B556F376F07CCCA9E5 1046333 vuodesta.1977.l
438,376,958 *2C6D4153BF9A4629B0C1CAAFFE831DFD4D5D04C5 NAPPYHAIR1111
438,376,959 *2C66B7C822A9CFCF157366E0E20FB4F970945E25 NARCELING
438,376,960 *2C6E0D5330174386897523A81B32E4F28717673B nathanialczerkies
438,376,961 *2C64B3275957900A569E442898466B5ACC60E849 12.29.1318
438,376,962 *2C6324E221CDA82FDF293F4DBED58391B5F1C9F3 13PLATEGLASS
438,376,963 *2C6B3A0B30105F4009DF1452B674D7600AD03F69 nestorrivie
438,376,964 *2C6CC1B4DCCBB37BA09063D09B375653C5E5D06C 1517741 UND-DAMIT-SIND-DIE-BOBOS-AUCH-BOHEMIENS-?
438,376,965 *2C603DB71AB59151CB0C8AADC7E6049E79AA41E1 NFRTLLY5
438,376,966 *2C600A794FC45D306D5655C304503E36AEA90D51 nichtraucher!
438,376,967 *2C665D88A10D3B306FB1F3822405AE8D730C8228 NICOLE-PENA
438,376,968 *2C6A3D7639DA9427E84D5EF3AA380BD4A78DF2B2 NIE-UFAJ-NIKOMU
438,376,969 *2C61641CE310702F49EF43A8E553B42117DA0DF4 NOBLE.LECHLEIDNER
438,376,970 *2C6793C27EF37DA87CEAEE1822D2F9AD8164073E NOBLEPROIA
438,376,971 *2C698BF3F704FE73F489B9CED66469FF4278F6F0 nombres.de.ajedrez
438,376,972 *2C6DB103AC1FBB2FBE921D3ABE8D677FECDC945D norbertmoosa
438,376,973 *2C6199CB056DC4FF4E54184DADACB9DA46FC98B5 normanlomax
438,376,974 *2C6B2B9CE0247386341A4390881F8BB2FD738BD4 1.FLN-AKTIVISTEN
438,376,975 *2C6F6547A88F11D468B123652B8D9496F36361A6 NRATANG
438,376,976 *2C6409A1F7C4FC6948AABA11A2E8F3EACD2AA780 nscinfing
438,376,977 *2C6C325A6203D29AEB110FAE865E6C761591BD80 1-hawgs
438,376,978 *2C63BFCBCF79FAD0941B7DE3AF81DC4186B4D06D 1hein
438,376,979 *2C6F4BE9F57E844669D89B5096B5408097CF64EC 1.joukko-osastokokeiluun
438,376,980 *2C6E51977CB9F68B7E1E043C263607D5DD796430 1 kaestnerschueler
438,376,981 *2C6873EE26AB919F4D9E977B977AF07436C0401F 1.KOFFEINHALTIGES
438,376,982 *2C6D609776575B3ED5FEA98A8296087D77621A9B OFFICIALLIVEBOOTLEG
438,376,983 *2C63F25BAF09EF08F2353C66FE1F4F681EAE6D42 1LAAGBSW
438,376,984 *2C6193D7DE88AFAD1987BEDA9B5ED716A4604EC1 1 LEEDSILL
438,376,985 *2C614FF2F812417A5FF640242696249913DBCFFD 1LINKSBUENDNIS-POLITIK
438,376,986 *2C6FBA10B482625B231E7C24E0414D39D0122C23 okedwood
438,376,987 *2C68A49A26504B506E1AED96B65C2DF27FB5C3B3 1.MESTARIHANKINNOIKSI
438,376,988 *2C63C98DA05EC7396439388F43C9A5D11C903449 OMASEJA
438,376,989 *2C630C0818C2215DAB920DDA8D73CFA744F66B94 1NOYERAIT
438,376,990 *2C60F5634B35861258DD58B86ED29180AEC91300 1 OFFBALANCE
438,376,991 *2C6250BAFEBA407A5C871587EBDB3AED4146DA72 1.palamistapahtumaan
438,376,992 *2C6AE357BBBED42BB365F9B14F679726F11C5FA3 1petolaskentareiteill
438,376,993 *2C6685A87B4F05AD46F2B7C79487133490965B81 1pohjalaiskyl
438,376,994 *2C6EB9FA8D0CEAFD6E7F8B5C3A7083495E2BAD1F 1POLO-NECKS
438,376,995 *2C64FD963580F8D14A1003C37FDFF3E52E07135F )O(~`.(P
438,376,996 *2C6CDF99C1AA24D981AB0D3A0315B1D58B90E548 1stretcher-bound
438,376,997 *2C6D622F9DF00B109FB51D3C37133E275A773D36 1-SWiSTaK
438,376,998 *2C645492E2F28E4477CCFE3504D87E1F68DF7C6F OSPREY-PUBLISHING.CO.UKWWW
438,376,999 *2C626F14D7B4452C8FB62EE32E56EA5621DB9D90 1THIASUSN
438,377,000 *2C650FA5B54736DCD4D18776A9D9121FC6BC4823 (our.pet.is...).happy.pet
438,377,001 *2C64C2AFA3DF740E269C5EF65A7020901434EEDD oxime_group.'/a/ks/i/m_gr/u/p
438,377,002 *2C65CEDB0BA40484BA29AAAC123D717D67621026 p#@~0.~o)x(
438,377,003 *2C6D51ADEA973213D198E70BCF9EA82DD1C6C2BE 206342 bekoticareta.s.
438,377,004 *2C6C45EAC0F8CB5D782874695F9B6E60D95C5FAA [email protected]
438,377,005 *2C67FFFB5B6D06FF67FC086845ED7A8F78F45568 20kkyc1997
438,377,006 *2C6C94C2F129DECDDEE71BC96DEA1B12B39D0BC1 PARTEIVORTRAGS
438,377,007 *2C686B71E35E533F58A824F65CB00B791F7B480B 2533151 DAVONHABENIMMERHIN1530UEBERLEBT.
438,377,008 *2C60C8CB49087BFD2CFF8DA6105831EDF747E7B4 pDJ
438,377,009 *2C694BB0D721D933FF31A946B502B12C0D770940 PÉRIFERAL
438,377,010 *2C6D20A8B28CCE3DD0C926046A510D613404FC5E perlende
438,377,011 *2C638350964847A67151757D002C64082404C853 pet-assisted
438,377,012 *2C6C96E9257C3F5D2095C32143973ADBC09A6A7D 2GDTGRLSN
438,377,013 *2C6C2ED162BCCD7FD8FBC0144D6F8249D5A1F322 pigextensive3
438,377,014 *2C678AA89060806FAAC5C877C566F2375E168FE2 2-JATKOKURSSIIN
438,377,015 *2C6B2529735E4C8E6F85A1E22E58A371C1B814FA 2KAMMIOKULMASTA
438,377,016 *2C6D3C08949D157CD883A38398E93153FF1F6794 PITCHIER5
438,377,017 *2C66AB0689AD78BD7069F2161B4ED1971237B17D 2-pruefinstanz
438,377,018 *2C6ADA9134A034EA54070ADFD6D9DD6A1BEB12F6 2SCORODIT
438,377,019 *2C665D75D60E00922A542B3A1FD7806CB1F5B0DB 2-THEFLOWERFIELDS
438,377,020 *2C61EB34A35A2ADABEBEE74EAA155EEF6A25030C PMCGRILLIES
438,377,021 *2C697159ABC9D4E4B968D479F45988B1B3505D1E pola.x
438,377,022 *2C65541ABCB59079F48814636E66420924D56181 324745 yazIcIdanCIkISIalInabilir
438,377,023 *2C6E53CDF19D20D9EF4EFF262198B967489D1383 328766 bu yIl dOrdUncU kez cebit fuarIna katIlmamIz anlamlI
438,377,024 *2C6DA27C36ABABBD471B8A44C10C84758E1813FC PORPHYRESCENS
438,377,025 *2C6027CA68C5A3B03365D7BAD1806570DC06B37D P=====>~O)X(
438,377,026 *2C69B709CF2C218A40B9E9D14BB391BB114F46D2 p#p-~o-)0(
438,377,027 *2C6F41A82ECD764ECB8FF482E0A97DF538812C05 PRATIKMANTRI
438,377,028 *2C6405EBF68D4D33396CB675DA8620ACA34B5C4E 3==D-~-`SPLAT
438,377,029 *2C63193A309E158A9550D59B10DDB6D9B12E90B6 pricscilla
438,377,030 *2C668413E002C2BB2A5F5AE9AE1965C79EAF8F8A 3MOCHUELO
438,377,031 *2C660343DACFAE9CD3502627941F8EE0091B1EC8 Pronominal
438,377,032 *2C60CF47DA75F3FECBA769FD6844E7B1BDA41ABE PSYCHEDALIA:.RARE.BLOOMS.FROM.THE.ENGLISH.SUMMER.OF.LOVE
438,377,033 *2C690C5AFE76B6702CF45FEF1FA34B35FF943B39 pu5+u135
438,377,034 *2C603B256F4ABDA3414BC61F0185D968286C93C6 q-D~`Splat
438,377,035 *2C679B1468F500E0B33BC0F99E7AE9D2171CCB9D [email protected]
438,377,036 *2C653A1ACC85030D12BD33B0F4493ED6C80F2A84 4L+ERN4+IN9
438,377,037 *2C6DE4EB96E1B65C0539F14655FCAE986B6FB28D 4NESSATREV
438,377,038 *2C6BE9EAF56A083494B935C51898A94E09656E8A QPD7URR
438,377,039 *2C6822C6070D12CFC64CD887C9793A030CD5FA2A quincycorkran
438,377,040 *2C61D28758F5BF00513A620E16FCB083BAE3C066 quipe.cycliste.palmeiras.resorttavira
438,377,041 *2C6EDFD540BC6C1864037C98A44BF8C1D1F617C0 Quotient.ring
438,377,042 *2C6FE53FEDB72BAE08545100D80F38DF3252C6DF 4PLUNKS
438,377,043 *2C6A6AD5F6D9D7C1544EC0A3C16C9D397480DC95 R4MME4FT4
438,377,044 *2C60A72B6432E5532E792B011C487FCB287460A6 RAFAELSEU123
438,377,045 *2C601CE03344EBD4A0988917484C758EB8EEA400 4VOORUITSTREEVES
438,377,046 *2C642B21CEECAF190389570E4C2BD73161FA3874 ralphedenfield
438,377,047 *2C689BC4CDDA39FD2A50519FB9A10AC4C64E7E7A RAMIRO.KIESEWETTER
438,377,048 *2C6C18138D7A654BB6B85480DB51C0F2FDB23F02 507503 ZEHETMAIR UNTERSTUETZT DEN ANGABEN ZUFOLGE ICKLER
438,377,049 *2C6264F7008C089937A596431DA27CF82E8F1460 536077 perunkirjoituksessa.todettiin.pes
438,377,050 *2C60C0B36F23EF7BEB0DA11CC582288A2AF5F552 540032 dusmanlarim catlasin , safam olsun "
438,377,051 *2C64AE4F7A1D952E9287B89ABC2BE31E5F96C981 RANDALWAGATSUMA
438,377,052 *2C6F5A8E747D80942D873354784CF2CCA50B6E41 55568290pp
438,377,053 *2C6F6BC6935C41C9685AB4C26F93037D295614A2 57RAMP
438,377,054 *2C6A1C4286EA346CBDBFE11F21CFE7E46B56DDFE 593028 OHJELMASSA ON MY
438,377,055 *2C653341148FA4C7A01339933E8693944F2C1ACF RAQ)
438,377,056 *2C6C538D0B7DE9C273F129CFED732E909A03E3A5 RAUL.LOUNSBERY
438,377,057 *2C6629E34B8175B5AFF5C8415720E9A52D2A2352 RAYIDRIS
438,377,058 *2C63650F5E5F91E440F95B6C05575E409C952A78 5BSWDELALUQUE
438,377,059 *2C63560A8F412569F01833B2211B4DC197CE7E1E RBUCHTEN
438,377,060 *2C6D042D7DC6C55E58AEB669D4EC865BB8000056 [email protected]
438,377,061 *2C6EF1DCE07BC3CDFBFC7D320C7212453B000E2D REBALANS1
438,377,062 *2C660B7B7735633F7E8ECD5BA0A0EE723CCAA348 5FILEJSENS
438,377,063 *2C64F493E054BEB6E74A75F9D826DBEFD93F544B 5HORSESGERMAN
438,377,064 *2C65CC0DE3BCF3E74F6544AA5DDA141E5D720B85 5INFORMANTCONTACT
438,377,065 *2C6A619D570093EE322372A91FE6E238419D8E98 5.jacobus
438,377,066 *2C61284C45C65CE529BF2624F3F28AC80D8C4985 REFUGIOMEDALION
438,377,067 *2C63D49FE1388ED7127BB68B3C77162CA2468024 5LOWELLTON
438,377,068 *2C61090E85B724DB5ECC02076815939D8FA07941 5MANUSKRIPTBL
438,377,069 *2C6E2C1F494A025AA245B910365EF7B2F4594E16 5MENSENRE
438,377,070 *2C67270761134A5788D6C4DB76D614A3F9E2591E 5PETERUBY
438,377,071 *2C65E96E3266C70640618EE4D723BC7CA75596C7 REKOMME4
438,377,072 *2C657E580E98794482861287E848924088DF0A7F 62KOHTALOKSI
438,377,073 *2C6E55805679C8378F3019FDF912725882453F74 REXMANSIR
438,377,074 *2C61DBE2C5CE70EEF675920F3C77FA2CA1106194 676568 dermedizinerklagte
438,377,075 *2C67DEE51C935986A1B9D14BAB0B116E0544767E 6ADDOCCIARE
438,377,076 *2C6657BC33BBC8BB0B97D787578EFB9882B3BDA1 6 BANKAMIZ
438,377,077 *2C63A62B46B59E67A015EF89F2A66B59A94AA2E4 RICHARD.TREMONT
438,377,078 *2C63BB36B51E506371ECCD8500EF350227D39FF8 RICHELLEALLEN
438,377,079 *2C669CAAEC8B6767947428B7E12E022ED8432A3B 6EXECUTEU
438,377,080 *2C6433A6C1D13825E31DCC91C97A15F7DBF79F88 RIGOBERTO.FORNILI
438,377,081 *2C60D07A6286E7066875339B41A6D76789633294 rigobertoschow
438,377,082 *2C6EFCF658A39C5A40B9501D75F8C7F79F33CA15 6GLOTTALIZINGT
438,377,083 *2C662B37F97247A1CFCCEF4FAA40A2CA75DE25E8 RILEY.ORTEZ
438,377,084 *2C609009B2537F2848C3F2F5E89CA97F3B5A6A46 [email protected]
438,377,085 *2C6E3E6A54BE9A4898D0D146761A8D04AC11E159 6innenleiters
438,377,086 *2C63DFB89BE8967750F5AE1054CC1E05A2170CDB RMNSCNTLY3
438,377,087 *2C648D7D72C5A74CECD93F1A9F7D784973DABDF7 ROBERT-OSBORNE-II
438,377,088 *2C6458831E84C7769152D610A8385103915606A1 ROBERTVALVERDE
438,377,089 *2C6239D8A17F49EE2D76EF19B1DE469B7A94E167 rodakdrumn'bass
438,377,090 *2C625AC28A01D8BE044D1C1EFCFF977961B92D54 6TERRYBRANDI
438,377,091 *2C663CA6FEEBED9DB2158460E8D50B293EACBA82 6THATMOTHER7
438,377,092 *2C6AF31EA582B0225C54E5E9DF30C4C954FAEC39 6WINNERANGELS
438,377,093 *2C6754FC4A61B42B8FB6669CEF827A57C5C33B7A 72720 wietrumanlernte,diebombezulieben"
438,377,094 *2C6A55E139E2C3CD3334B1E6B07EEFFBCD4E9DBE 739409 fuer heute bleiben die ohren dran
438,377,095 *2C670C0D0BDF4EF11F4F847FDA8EC7FAED03B62F 790418 joku p
438,377,096 *2C6975B5D86A373B7422975D412AAEB491F18975 roscoeduvall
438,377,097 *2C66431051C6D072B5DB09DAE426C717DAA11C6F ROSEANNEBAXTER
438,377,098 *2C6B3FA727C1A541E9244B43B1F10B153D585A0A rpeovrac
438,377,099 *2C6D37D431C5EEE20370DA8A3E9339ECF03BB6A0 7:..$CURRLINE.=.1;
438,377,100 *2C6FA42EF1B67A1B9231EC835BF00A72F38DFFE6 RSOCVGDARS
438,377,101 *2C65320D467F0EE26B95DB93096553B9572FD4A9 7.friedberg-giessen
438,377,102 *2C6825FB5BBE5951D127A8967940498516770653 RUMANTIR
438,377,103 *2C6F7B26F5A329D580401EABA71343F3032C550A 7KJETTERSKAPET
438,377,104 *2C6584EB3C31C8A093E0DD058FD23EF7BBD90246 RUSKAMER4
438,377,105 *2C65C8D89EC63E46AE339120F11CF42B16598B21 RYUELL
438,377,106 *2C6A5C479DBDB3A4EF65592A9950D4C8BA648517 saç
438,377,107 *2C6930301D14ADE99DAC385515B76E81682127E6 7WILDLAND
438,377,108 *2C6B50FF8827D7822FF6F48C7409F38380AB5163 SAMMENSMELTETS1
438,377,109 *2C643F70E2EBAFB31D34153B84B8E2FFE0CE948E 896847 MY.FAMILY.AND.I.ARE.NOW.SELF-SUPPORTING..
438,377,110 *2C6609B0BF268819319A4794AA51AA7D8652B8B9 SANJEEVSAKLANI
438,377,111 *2C6CB11B52F5AC8852A49018B5DDE6EA07561639 SANSEBASTIANENSES
438,377,112 *2C66EC77E2AA03665D5070C6DE2E46241B5395E6 8APPIARAH
438,377,113 *2C62A2ADC4F3F93040544E75531747355FF9740A 8======B*>B0
438,377,114 *2C65BE8BCBEFFA9150C245A825604B5023BB2292 SAULBRITTINGHAM
438,377,115 *2C6E2F4435F03ADDF8442EDF43870A0598965ED9 [email protected]
438,377,116 *2C6331CF0394FB3B6954B506EB27693C301F80C8 SCHALTSCHWELLEN
438,377,117 *2C6D7C5595A90D59F40720F3098912AA8A7E938A 8GRUMPYCANNON
438,377,118 *2C6B289C8CE2BAA37A412631D40C7130186DBADE schiller302
438,377,119 *2C68535C3058AD5C089C5A0B8991FF7986AC855F 8HPBELEBSW
438,377,120 *2C61D6C7729B7DC278FC3BCD3AF9718FCB4117DB 8ILUVHORIZON3
438,377,121 *2C616553CFBF40E2CAEBACB33EDF86F54AF98720 8ONDERVRAAGDENS
438,377,122 *2C69491DA4C881B00C673A63C1D88F2793DD5E62 sean645
438,377,123 *2C64A6B1E4C987C58666BA6B82FD3B36F6082AEF 8TIMOTHYROSEBUD
438,377,124 *2C64432C2C5B9FF6232039C051E6E2FD453CDBC0 seniorenquote
438,377,125 *2C6BD47521A021AAEF7632F57FA0E2F9ADDB5B32 9346 YLIOPPILASKUNTA OJENNUKSEEN POLKUPY
438,377,126 *2C62F11E382D2AED8C3F1A2C0DBF9089E97DDE6C 9ADENOSIN
438,377,127 *2C6EE8E5930268A3AC5522F88AC47080656FCA8B 9CROSSWIREBSW
438,377,128 *2C6B7D5224834CE414CDD75FE918DB9A5D4B22E8 SEXUALIZING!
438,377,129 *2C65FD4F42C3716FF98BCC4464777A5D836723E9 sh3ll-gl4
438,377,130 *2C67DC825334B30E1440A826D464E26D71E7E0D1 9KOMENDANTURA
438,377,131 *2C6F2A0092B0047A560E2F7DCEA76EF3323EFF44 SHAWNADAMCZYK
438,377,132 *2C6464654CC5177FDEFE5BA0D415C98D81CD9FAD she's.all.that
438,377,133 *2C6A560883E65F439DD5A1B76E28EF7C71DC7BD5 [email protected]
438,377,134 *2C626087D96AB0F6B49D2375CBD22BB0787E1FA0 9SONSOFCHAMPLIN
438,377,135 *2C66CB96F9F483FFA5E897AAEF780D3F47A7450D 9SPIDERBYTEME
438,377,136 *2C634D30B1F1B41C5D1AA2E9B0136A85D2C18EC5 9VIDEOSYDNEY
438,377,137 *2C647AD9B91EBF95E545B1480E49201EE700788D A;)
438,377,138 *2C68618635E103DCCF3984113CE4281C045B1B70 skreecaseyneilltrio
438,377,139 *2C6C8D508589C94DF8623BDF5BD3AA635ECF7BD6 [email protected]
438,377,140 *2C65C308618D25C8F14950CB11A491D7FA175D9E aaa(b
438,377,141 *2C67BA7F9129B4F438B91BBFAA2767896CB804CD SLYVYNGE1
438,377,142 *2C6A91DAA42B3E487F57E6CCAE8037617BAB3AE2 AAB"&N
438,377,143 *2C6129D1474AACA98C85B50B3A6E21940996DA7A aaca0.
438,377,144 *2C6ADAF28716EEDCF9FE4A70A1C8EDDD6B91CB85 AAE)*\
438,377,145 *2C6708CDDCBBA5EC6F074DB4B4C4E8A62ED787D7 AAE9}0
438,377,146 *2C6B62B531ACBE9D3A360F3D290677B8AB3FD55E [email protected]
438,377,147 *2C641B904414F4CA79A96CB3A2909E5591930F8B abbx8
438,377,148 *2C61CAE4E65EA4BA300B9239E1D81084EFB486E7 ABE.FAGUNDO
438,377,149 *2C6061E37BD3C806B36CE21381DA55C35A918961 abelfriedrich
438,377,150 *2C62FFB249782E069E281A81FEA15E4FEDDFF2F9 SOZIALENQUÊTE
438,377,151 *2C638721A0BD7B2D4AA9C8356B033E4C9BCE78B2 AB(L|
438,377,152 *2C604BF299E224E19E04242BE65F0C09DEAF57AD AB)QO
438,377,153 *2C69EBCE38107CB13F8220323532B1085B72B40A ACCOUPLEREZSES
438,377,154 *2C664A1598D4BCDA46A02EC19845024FEEE96BE1 splat!* * <####b
438,377,155 *2C64E793F58938118E9EEDC7FE37FAC5F0204B6D Splat!!*-*-d#8
438,377,156 *2C6769F242EE8A937962FAE1F20E26A363D4828B SPLAT ~`D=====P
438,377,157 *2C6E0C173516980AFA48959DF99FFDA92FB80130 SPLITTINGPLATE9
438,377,158 *2C6F1843A55078687905178D7EAE12D9EE64351C SPNDINGSFEJLENS
438,377,159 *2C6B9C049621762F1B3AA748C36C47493C2B43EA SRAALEMM7
438,377,160 *2C6DA5747F0939DECB24B80140FC28536DBD0D6D ADALBERTOSCHRAUB
438,377,161 *2C6F4A874779E31DDBAF6480EEE1290031CDA518 SRESNURE
438,377,162 *2C6755862C000F0B49480DD01EB7679950F92ED7 SSELGIP!
438,377,163 *2C6B951EB90928066EA85629CCDA79A3C3654C23 adeste
438,377,164 *2C6B58460C5D6A9E6B47E5D69C50B7854CB404C4 ADOLFONASELLI
438,377,165 *2C65AE9B525B0207B7A3592E3B8D7F673E5C4118 a-e7h
438,377,166 *2C618C3662BAB57149F383E66FF3A262C1744D8E AEBGO
438,377,167 *2C6EDDC1A4F21CE6B195C707B4C3844F74078B6B Stai-Con-Me
438,377,168 *2C6E278B31356799C900601F5E40AE70FC1CCBBB AFTERDAJAWN(FEAT.LAVANDAVIS)
438,377,169 *2C6F9D581FA2854EA484509B7038127785AD9702 AGUSTINBORROMEO
438,377,170 *2C605C621798CBC2239C26771A32EAF7435AB379 AGWH-VEIIWOJ
438,377,171 *2C6588C233C1E7BE83DB9DB572BBBB60E3F0EC4E STEVENTRAVEL
438,377,172 *2C6C9CCD47ED0515A40078646A59A5975CEF68AD STEVIE.STEWARTS
438,377,173 *2C6E332F9BCDEA71750F33F3F4CFE82956508635 airheadsmashing
438,377,174 *2C603E103F7E736D9F90066D9AD401FD3EA44DBA AIV"V
438,377,175 *2C6B8F11A9F7931D1AC0D2B49971F15BE06CB12F suite in g-moll, bwv 996: ii allemande
438,377,176 *2C6540ACE027E2BBBF99732D3FF52A21C27685F0 alexanderhargett
438,377,177 *2C68F30B49C2CA5BDFA19C3CA504111518770A7E ALEXANDRIAREEVES
438,377,178 *2C6931AA3D56D896EAF10B135C21D31E82B00338 alfonzoradon
438,377,179 *2C65D2059090A0A8C0495580BB877E4BF89F25EC ALIENBBY2
438,377,180 *2C60CAE02A1BF7B95A79F79B37397A9D7CAAF2C0 suppena1
438,377,181 *2C606ADAFD412D08302EE4D4E4430C9D3E7DA944 ALVALOESSBERG
438,377,182 *2C6077E64D696FD9048F046A294072673EE0EEF4 ALVIN8
438,377,183 *2C69EB852523F9173FFDC5E185B6AC29D0B6987C symphony.no..7.in.d.minor,.op..70:.iv..finale.-.allegro
438,377,184 *2C6E30996BAC6E797D6AB2860A5D5DD433683AF0 AMBER.WAVES.OF.GREEN
438,377,185 *2C6C3838880969FE47064A0E632619ABA58A252A AMNISTIABAS
438,377,186 *2C6A0C71709A3C79CBFF31BD9FEF24531744E34B AMVM%
438,377,187 *2C651805BA28EEE0A9F0B2FBE9FE50E5CB5C237B an3s+h3s!olog!s+s
438,377,188 *2C62AC4C834FED5F698AE07C5B53618C1170F964 anj_
438,377,189 *2C61F0F322FB969DC81BBA10FAB0287C92F1A449 anne.belhumeur
438,377,190 *2C69840E8D2CCBC7A0CAE5CFC777EF83F890AE24 [email protected]
438,377,191 *2C6F5A79D98ACAF36799A3D7A69913A665A69C29 an"r)
438,377,192 *2C66F4634345C767519EE99E09BD2C05D690F7A5 ANTHONY-SEARLES
438,377,193 *2C639B0FEE021B1B92A49426AF3056184A1BEDC8 [email protected]
438,377,194 *2C6180A2B3084764DE45E62D218B29AD4C76998E aokv
438,377,195 *2C67F9E0C217DF9E2C98C5A215615FE70B66054C TAUGUT
438,377,196 *2C68CCA168C54FEE4B510F87BEF6D3500EFA7B97 „apelacji”
438,377,197 *2C65E702C9519BA7992247C8CC1FC00972E9C29A TEPELVORMIGES0
438,377,198 *2C62C1AF42BC62003653DC3E55194FF9F12FF37F TEST_0
438,377,199 *2C6B9F0CC608F479A9BAC4614FA79A688DF1829B armreifen?
438,377,200 *2C6170062162F6824AB2565A573A08012E9E3DA0 t+g
438,377,201 *2C6DCEBFD5145D3D05AF5EB3DE931305CC97939B THE OLYMPIC SYMPHONIUM
438,377,202 *2C64EDEC8CB48730A8C7336E1251557748399A6D THESCAMBAITERCOM
438,377,203 *2C698D370F9A067D4DE8D02D597A3C3AAAFC04A0 atp,(
438,377,204 *2C69115BFC885665F75289D95DD8E23371D910AB THIS SCRIPT IS DESIGNED PRIMARILY TO BE USED IN SUCH
438,377,205 *2C6E398192933759CC1C9C4E83D2F46A5A7A9B39 TIMWHITEGOAT
438,377,206 *2C6F05A03CEF8DB146A19C078EB7EC60AD8221DF Au41
438,377,207 *2C664AFFE0FCF8F143477840FAC77241B30150DD AUSWAHL.I.-.1970-1981
438,377,208 *2C6911C0846C602401ED7091C194569D85A11C6E TO.KARAVEKS
438,377,209 *2C6BD1D179DB56A34A6BE722B5258D53F1D83E8F averse!
438,377,210 *2C64434D3D676E82976B94DB94E207B16C5456F6 TOMMYJAYJAY1234
438,377,211 *2C6220CBD8FED3F16505AFC0CC9120B171634D70 tomniezgoda
438,377,212 *2C6012768E93888DE32C3D8A2BD6A523F5086F10 TONY BONO
438,377,213 *2C65EC36479B242992510B87EAE93F593B025E50 a\wecmc?
438,377,214 *2C6120F92D9EBFD79A9FFED75CD7A65ED9601B40 axb!n
438,377,215 *2C65BD3D76AF060AFB91255C1B3A674DEF0CD286 TRẬN ĐỊA CHIẾN
438,377,216 *2C6623BC43B84CCE52AA6B1F49AA374764BCB551 AZ19890316
438,377,217 *2C6EF5FBDCFEDE439B420A9BC88B62C8B1796A2E AZN-TV74
438,377,218 *2C68D3B1DC3C5C296219A6C8E587888F141F0E99 azu.l
438,377,219 *2C63CD6E7D40D2E511DCC6CAEE914F5575A35C5B TROSEPOWELL
438,377,220 *2C6B1961E16273566CF6FADA30A1E7F9D5945826 BABE749
438,377,221 *2C6E06381A0278B628F0E090862DA9AE3F0C43FB [email protected]
438,377,222 *2C6AE081AD30D4E9BE7DC747C9F0B11C2BF1F9F2 TUKKIES6
438,377,223 *2C644F8B64D37CB4915D32BBFA8B617D51F96EF6 bannedv9
438,377,224 *2C67C3C50C00045F2C22A9A144D9D34B954361E0 BARBAŠ
438,377,225 *2C6699ED9173C52F96E2769098F80AF4823E3F0B TYRELL.MARZ
438,377,226 *2C62BA671617F1B0A3240FF001C939301F727B40 TYRONE-EDMUNDSON
438,377,227 *2C60EF794C0ABD89A838A44EAB7767684A90762F BARTONBENETT
438,377,228 *2C675DD7086B9ABC1CA2D43E37457819E525E796 U27275
438,377,229 *2C6CD08D2F690B6FD9943983618A1751497E5C8E ÜBERGANGSQUALIFIER
438,377,230 *2C65FFEC4EA705E3F38A98EBB276C588DC4ED8DE BBD69
438,377,231 *2C61B5F39F26367C6F2157F401707537C74831A3 UNSPECIFIED!
438,377,232 *2C684BB8755DF7EB347A8540004EDEA433A250AA bd~~)8(
438,377,233 *2C62A13CC8C581490BA64CEC1ACA151A041A5DA6 bdhm:
438,377,234 *2C6F62C2303D1E3DEED924B13300AD4438F43C04 BE.EXCENTRIC
438,377,235 *2C6743B49CB24E0F9CD928028A47A129E8BF0824 VANARCHYI
438,377,236 *2C6CF0E4D2D2E5483C3348D639D6C123D1F82270 beo$x
438,377,237 *2C68039D4FCB6A30A6AEF6BA9AE9DE6425449FFB BETOKENS
438,377,238 *2C612C464D78F8CFFAD6CEDE3939834F39B4A20B B:FPY
438,377,239 *2C6535C0DF05257F86D3906712C36C894BB9DB2D bigapple99
438,377,240 *2C64BCA1B5B9C5EDD94786D9F4E4231B80139659 VICTORESCANATA
438,377,241 *2C6932E4A02FF74C35A804DEFE297FAD4FED6DBB VICTORIA-ESTACI
438,377,242 *2C6D19F67623B02895484E7A52D74E0843140917 VICTORIASTONER
438,377,243 *2C6F58F517CD7049788BE38BB38AE8BA0A7DB29A victorinovalenzuela
438,377,244 *2C64D155B3802A3F70DA5924CE977D96E7153FC4 BI$U
438,377,245 *2C6F1820CAD9484CF5B6A136BC184E4C5F7349B9 [email protected]
438,377,246 *2C638867856E41A7D8B4FC56BCA035A7961A8C31 [email protected]
438,377,247 *2C697AD2C8CCEB47AB539313DA21442A892F2339 BjG
438,377,248 *2C632FB007254442D8C379E29486170AE7BB34A6 [email protected]
438,377,249 *2C6F10025B3C2C485F6D2A2A700FC3D99E25D822 viljobsw
438,377,250 *2C608DE2AAF4B9F65FFD80A7A6DA62204BF0160A BLAIR.DEPPEN
438,377,251 *2C66F7525DC0A4653A9FB6C929617483BF6D4480 BMCN?
438,377,252 *2C6D6F73C94E5573873A52FC6B749911052BBDC0 BOBBYHOMEWOOD
438,377,253 *2C64F04D8589722A9BBE2BAC252BF31D63953E8B vindm
438,377,254 *2C64E61996594C4A6CDA2A6D07F06FC556B5852B VITOGAMBINI
438,377,255 *2C6217E0C686F203FD7178345E8150BCD6AB8FA0 B-OQ1
438,377,256 *2C670BBCAD5F3B51DB2B6FD68318869DBA7001A9 VONNEICE5
438,377,257 *2C6AAD7966D5D6A2AD3177C46504E8746DF65BB8 bpqs,
438,377,258 *2C67B270760233DFE5B5F7709607F14D05FAD76A BRANDEDCOWGIRL
438,377,259 *2C6C503C88719C0C6DE8E3642EF1F5AECBA7A17D BRENDON.VIEBROCK
438,377,260 *2C6D89DC4C688A0BF0984516922D7DEA6683719A WAIMAN
438,377,261 *2C68FD004971E8F0C7B90CF33B93AF668D79A930 [email protected]
438,377,262 *2C6495A99E43409978B59E1A325BD6B79722F65A WA!NSC0773D
438,377,263 *2C6C0DD1705AB4C35A91521E920D7EA140075645 BRITTNEY-KARINNE-CASE
438,377,264 *2C6E08D8190C0A253E8AA0725CB58433E0284258 BR:$N
438,377,265 *2C602F5D3E883E53A5B88A62055B1F8FC6E57E2A btqje
438,377,266 *2C6C80AA8C9DC51EB2EF62A39FDA3F21A3D81975 WELLREVIEWED234
438,377,267 *2C6282CCC9BB474610018D3295BADE86532AF28D WENDY.LIZARRAGA.HIDALGO
438,377,268 *2C68FB80B3034DF4E7A826F34A11A91C04E1CF56 BuddyRandell&TheKnickerbockers
438,377,269 *2C63D3DAD6659E5F33B59574F29B6635014B4E38 BUMA.
438,377,270 *2C635026DB2DFE8F78DDA75814A8D46D563D2641 BUTTOUTAUSTRALIA
438,377,271 *2C6C0DB8866A725368F16C5F532D2B452BEA5A99 b&vcu
438,377,272 *2C6D333BCF6D7CB0C4772DAF7C618B7E7586D291 WERGERHAYÎ
438,377,273 *2C640174A63319F93E3495F71F44CEE4B6C1C387 B%XI&
438,377,274 *2C6EFE4FA71ED6E3B9F38EFA1079C4465FE6C9D8 BYI-I
438,377,275 *2C680E27FE285E8F6318B68BB13732503160ECFF w-henry-booth
438,377,276 *2C69DE49BCDA1CAAD0F573029295AF41AC1F8BB2 BZSK6
438,377,277 *2C686AA5E8AB0FB17BBC8342A3A804CFA0CA2F88 c3138r735
438,377,278 *2C6A07EADEE117B08F8AE178D15F9B8551FB23FA c4n4liz47ion5
438,377,279 *2C6A7A3032841356487D216F9FA769D1C9979247 WILLIAMWISHEROPP
438,377,280 *2C6D9AEB57832EA75573E2140C391A64FBD6B1F8 WILLIAN.LUBINSKY
438,377,281 *2C6CBD483BA8AE85A5E4ADDB25098B8AE274E032 C6C.I
438,377,282 *2C6C78197D4F931C893936BCF8C9DAE1F689CF0C C,AI
438,377,283 *2C6B29158F16B6EA37E893930C9E30B613FE40EB CamerataCarioca
438,377,284 *2C6E6C68F80387BCBFC2C6D13A5A432F4940B421 CAN"V
438,377,285 *2C60D100271F8DFE1906D34AA3DE999F36487FFB CAROL.ALEC
438,377,286 *2C69ECE0125CB835AE468DAD01327EFCD015C29C CAROLINA GOYA
438,377,287 *2C683F033FEFC8620E145E70EC2CE03241251F21 CARYDECHAMPLAIN
438,377,288 *2C63E2B06D4F5C8E6A7123A8296110851F780BB1 [email protected]
438,377,289 *2C6A10334855CEFE2B1F089EDA87B8A978308632 wort«
438,377,290 *2C64F2733112453E72D508E211CE2AFB6BD2B128 WSTEELE
438,377,291 *2C6F0F5D8073C92055928F69742933FDC2DB7069 CAWNPNR
438,377,292 *2C6579FC213AC6D2EFE563DAC81500A124606359 [email protected]
438,377,293 *2C6BD1792DAC2E82A40385022CEF2B15D82F592E [email protected]
438,377,294 *2C6B835D459D9E49FF912E8A7FD218C24806E9C4 wwwdragonsbusrentalscom
438,377,295 *2C6CCFB920783F3A3E9226A761C8AE93ECA3B93B CCYEFNCV
438,377,296 *2C6303A10A008FF9843D31DA48EED5E0F6A8EA31 cdhi&
438,377,297 *2C6B9A89FCC163157E31C44AD1F0CCDF4C240A63 CF,=N
438,377,298 *2C6985F4E15E6CCA7830342AF025DEB7B3BCF880 ch0ri$+3r$
438,377,299 *2C60E39A617C63D555A2D06956FEDD72A6AF103D CHAINS:NOHEARING,NOFEELING,BUTMYSIR'SSONG,
438,377,300 *2C6DA46C3F47199FA3FC03BD0293F550281D5C7D [email protected]
438,377,301 *2C6A12A7549D87B45847AE9726E525183C810B05 CHARLESGENT
438,377,302 *2C62A0C02B5C81931A131268A1BB6615C294A280 châteaurouxban
438,377,303 *2C61F4E2DC89C477337FDE4E2FDB9C9725FA7FAC [email protected]
438,377,304 *2C6D89D2517C2E952521EA383F5CD60986E8B99F cheroid
438,377,305 *2C6D8C12915FDDA890F39EC886280F0F95CC2DBA CHESTER.GARAVELLI
438,377,306 *2C6294B4AFFADDD9B6027DB76FE07C5A115DABD2 [email protected]
438,377,307 *2C681725425A3C19C2FC01B2DCD22AE3AA5A3AF6 XUSENJUN
438,377,308 *2C60F66B065D15410247B3680C35F767B26F67C2 CHOCOYO5
438,377,309 *2C62B563D1CA5CD4864219E82DD6F4CBA5D6F679 CHOVICH1
438,377,310 *2C6A4C8386DC2DCF3F08C74D47D600880087027D CHRISTOPERBENSTON
438,377,311 *2C692C3A7BA20FF8EEC216EFABFC9B75C41E4309 christopherpax
438,377,312 *2C6C2E59AF9E8C23164573ECE7B79AB42FEF0C61 CHRISTOPHERRETORT
438,377,313 *2C64F8F667F5076FA642E5563B1635409A790011 CI"Q#
438,377,314 *2C6931FD6A2B34BFA7F02299F65E349E40507029 class="srtitle">they're
438,377,315 *2C629D3149CD9BA1190C126DFB2EAC8FAFD9F317 claytontaki
438,377,316 *2C63D301C8A2EE0481A85FC860952970642E5A5D CLAYTONWEWERKA
438,377,317 *2C67F641BA67F9F798F5EFC503FF1E30D67AD7AF YATHARTHMAUDGIL
438,377,318 *2C611256F3618AB54CF85451CC429A32AD7C721F ybabb7
438,377,319 *2C60D381E7C35408FD0E40FE2288EA58F71F17EE Y^H)
438,377,320 *2C6B8984494924F2AAAAD21258F76B9C6697A0B1 cll;0
438,377,321 *2C605D98734F10D31BE145FE0409E08D5885C485 [email protected]
438,377,322 *2C63B24255AF2992609E34CC302102BC2E5FADDE yonda.willams
438,377,323 *2C6EF33A28D25B171BEF257FFB0AC3272813C179 YONG.RINCONES
438,377,324 *2C6E754893C6F67089E59270EA331BE0B426A03C YOUNG.DUSI
438,377,325 *2C6DB39B7D394F02ED046D9FFE68C6D30DE5C1B8 cmwvm
438,377,326 *2C655FC38AB653463E36F20A529F88D3F58F23D3 cnx%)
438,377,327 *2C673961E7ABDCB7EAC622FEB032734D1ACEFB7E c{^o
438,377,328 *2C6B60F9898C3A26A1E933A21944F1ED8438E7B5 COLINKLATT
438,377,329 *2C633B698CD2F88BFA47EA72D1ABA8A32ACC772D [email protected]
438,377,330 *2C652F4635AD6124142956871432998D235F415D COLORGROUPING
438,377,331 *2C6DF8065F6A9A11B07E424BCFCD10C08D3D7532 CONCERTERIEZ!
438,377,332 *2C64617ED76EF04FD69EDC7EA4D2623AA4EDF792 YUVANESJEGAN
438,377,333 *2C62524C010E4C6BB66384E157139E8B5EA63B90 YVONNEDREAM2
438,377,334 *2C623605EC7C3C371C4EA44B7B583C8814EB9FCB yvonne-rivera-fuentes
438,377,335 *2C6C901B3AC4DC655E3CEB826F0D2676D4756193 ZACHARIAH.UHRHAMMER
438,377,336 *2C6F506BCACC385F3AAEB3010D44A608B23F89F4 zalbaheng.malupit
438,377,337 *2C6B0F923A9DCD3C3336B9696DA2BC47E8BD25AE zane.peter.thayne.elkins
438,377,338 *2C64645499030A6164BD62CD91D3A2421D9F4787 zaneschaubhut
438,377,339 *2C68B9C0C19609A78206D3C05A1506AA82B515B5 zeemlappen0
438,377,340 *2C68E130E95832D6A5C8CF10D65E9026DD0BAA12 ZELLSTOF7
438,377,341 *2C62E3BDCC51D50098C3A25C3C8123E3AEFCFA70 [email protected]
438,377,342 *2C6965D6759FF8DC75065E2556023867EEF82DF1 [email protected]
438,377,343 *2C6668948164E6CC9263C83C6B8A106784DE384C [email protected]
438,377,344 *2C64F0806FA20B0DE776A5F8827DDAC6C389AAE5 CORNELIUSFORM
438,377,345 *2C6632319DB561D16B8CC5245C831C207BCD486C [email protected]
438,377,346 *2C6E031984C2F8865FBFF2877C9CE0759A096C0A [email protected]
438,377,347 *2C6CB58601F413EC002F9BDD91EFDA383307B76E zitabanghalmahipos
438,377,348 *2C684B794E771A44B33C6E746806CF95B5250B92 zita.van.het.boskasteel
438,377,349 *2C67110CFC5B3E124879169106DD42D309CE6C33 COURTNEYMATONE
438,377,350 *2C6F1DA56B18B02B2F9A0C85AF91C5A9F61B07B0 ZOEY LOGAN MCGHEE
438,377,351 *2C6925A9D27D472C034617DAB6CCC5D973AAFA06 ZOORHIES2
438,377,352 *2C66A341113B6A0EBC4E2CC37123D624F86251F5 ZUNI-CORN-SONG
438,377,353 *2C6E32E3250D05B83C2CA021830BFBB4A3A2B205 ZWANGSUMBENANNT
438,377,354 *2C6D062E3EBD36542BA357640809E3C5663253C7 cqfuh
438,377,355 *2C6E49CB112FD9BBEA5F11A78DCB3D72701E7FD6 CR)7:
438,377,356 *2C6307EBA2748D935403439BB8601933C51270FA ДОЧЧИНОГО
438,377,357 *2C6AF66F0D242F4BA01C04E78A728FBBF6FCDEAD CSJKA
438,377,358 *2C65AF0551A08A98D9959E8B4309D94D19248198 мерада
438,377,359 *2C693344763DCEE877B861F609ADCA7675ECFE79 D2M(E
438,377,360 *2C68C18EC7AAEAD08F2576D9F0B43D4541C445C0 DAGWIJZE
438,377,361 *2C651D1E0FB107F4C0E62EDFF6CF5B8A27DF9D31 DAM-Q
438,377,362 *2C6239E44EEE5203447E24DCBE8EBD86F76C2BEE [email protected]
438,377,363 *2C69D1E51C090F92B3AB536051059123B4F58190 DARONMATAKA
438,377,364 *2C63219451EE0214E3D0C142BDAE00EFD34C27C1 DASTHAGEERKHAN
438,377,365 *2C6CE07F17B7682E3AE994F95057EB7F3533CD81 db13970d569f3e2bc1256d7f002600f8
438,377,366 *2C6C4998F11791BDA32B4DF6322D40B63E8C880F ddnxa
438,377,367 *2C62AA3A4D0200705205D958D52FB3C4A8366D8B DECKER.JOHN
438,377,368 *2C63542AE6F2954881970AECFDD185D626B83DE9 Deif
438,377,369 *2C6A2EB6BA50D5EA071F93AEE226CF6074398AE8 DELMOORE
438,377,370 *2C68949436746E03802EC7B603A0D3FB80973583 denvercuascut
438,377,371 *2C6EBE6A67966682CCF9F05EB395E23961C0F691 [email protected]
438,377,372 *2C69CF23A9D9187A31AE0A1162D9AAEB5302812F DERUTPLING
438,377,373 *2C65749117FA0BB3519A59F28E61BB3230715714 desanist4
438,377,374 *2C6A165912E7FFBEB038A6C955B9CF57CE9F63C0 DESEMBARALHARA123
438,377,375 *2C6B0AEA8FAEA48332FC9C7EF65C7A390A74720E 西部聯賽甲B組冠軍,附加賽1
438,377,376 *2C641D4D66FB1CEAE92301302A272DEEFA1CDB69 dfbs,
438,377,377 *2C68A909CAD5E17BE9A49CC029FD0BFCD0444DA5 dhk4
438,377,378 *2C65B06F6BCAD356BAD22430B62D4F5FC6DE8E58 DIDY'ALLFEELDAT?(FEATMAUSBERG&SKABOOBIE)
438,377,379 *2C673604E06CE44C46AE40F1E8E000FE41977001 d_j/
438,377,380 *2C6785865EDDEB45C741E3C01947B61981A4DE03 (0_<) o~O~ qp
438,377,381 *2C647E2DA57F8B37699F37248E3C71ADE70AF7B7 DNERETFA3
438,377,382 *2C68A13598874B73ED0B5AF2FAF0E7CEBD7D8612 1055011 COMCAST.SHARES.ROSE.3./.8.TO.24.3./.4..
438,377,383 *2C6CCA92396C9200407D20886AE042448551EB60 DNNWSSLED
438,377,384 *2C67A66C2A9DF9536E4BC31DE94E97C9D8FA585A 10BBYER
438,377,385 *2C6D0A57879F5F2F014CCA794CB3E8B6C086D22B D?o0
438,377,386 *2C65664B1AA836E4EA8FB29CA0DEC9986BDF10CA 1196474 HALUAMMEKERTOA,ETT
438,377,387 *2C652D9EBF95DF08321155ED35BBC85FE6E67B11 11avina
438,377,388 *2C656847357B923319BB83664B5133B7D5D9A2BB (DOGG HOUSE MIX)
438,377,389 *2C6B90A27B9F6267E49087D456A01422325C3582 DOISOTOPE23
438,377,390 *2C65AD7BA78B59EAC510EA44EAD99FE1406B747E DONNA8
438,377,391 *2C6B88D8A2C9405F72082FBF5CB4DDCB85637440 DOSTTHOUHEAR
438,377,392 *2C6D5E5E7265AFE504B3B0E633B66D079CB498AA douglasdesilets
438,377,393 *2C6BD7886D55803A899144DB82AD0354D6354D0D dourogyo8
438,377,394 *2C684DC423D9AA1EF20C230F5D93B396F4695EB3 d+;qm
438,377,395 *2C634AD0654F89F50B8130CEEECBCF83B11F18CD DRIVE24
438,377,396 *2C63BE6625A39EF5434EE26E733F14E6273496AC 1473871 YH
438,377,397 *2C6FDBE5496BD4D24B276F430742CE7BFC9B50D4 14.aylari
438,377,398 *2C68533BBAC94FCB4E050A19C0CEBFC9F20659C3 14 SIJOITUSPALVELUT
438,377,399 *2C6E716419E16577A63411467D41217FAB09CD2A ds5e
438,377,400 *2C62A7AD31D628F93801342CA1017C343ECEA153 DSCPLNRS5
438,377,401 *2C62CC595C8CD0EBC5E1960839D2C972C5BE6F17 1710252 DERBAUDERWAELLEKOSTETRUND700000EURO.
438,377,402 *2C66AC1099E66BB6823966D6B9394C01AC333E25 DSTRBTS9
438,377,403 *2C64609BADADC7BB36F0210909AB8BD558AD8047 DUNDEEBAILEY
438,377,404 *2C61F65E6C0D43457FD42AA491DFF886D454D93F DUSTIN.HUE
438,377,405 *2C60330E0E4CD38E91801C26A892FE2D48742722 1981742 eurooppa-euroopassa-henkil
438,377,406 *2C66A14CF745770292E6B77419780DF34E8C0790 dw/;
438,377,407 *2C6D7AAD283CD321DB51BA052D5B1048F5A571CE 1-ausnahmespielgenehmigung
438,377,408 *2C6AE3F7668A4722ABFC34115A265443AEFDA396 1CHRISTOPHERSEN
438,377,409 *2C608302A3801D2F90269CA9BE33682E1713B516 e0vz
438,377,410 *2C63C4E2520AA55D312B0F378A31ECF8EBE6E01C EBOL;
438,377,411 *2C6A2DECE204BC1FD97454387DBF2E7CBAAB6097 ECls
438,377,412 *2C62B662014FDE6F1A6EFFB5FC0B6ED85AC3634D EDGARWILBERS
438,377,413 *2C6BB36936F586E590C412EC9DE02EEC639ACA70 ED-TURNER
438,377,414 *2C63042E2EEFF40CF5F5683F11C1CBF9D7844B71 1LELLIKKINI
438,377,415 *2C6BFFFC9BEC5B51DFF48BDC020ACE68238BFD83 1-LUISTELUHIIHT
438,377,416 *2C6FD2FE1464244B95A637A78AAEC79A149F1B01 1maissisuurimoilla
438,377,417 *2C6FCDDBF4F0DD6EC70553009A143F2396FECA63 1.MOOTTORIKESKUSTA
438,377,418 *2C6B0F553C3D17FE327CEE857DC6670F8D148F98 1MUNAYYER
438,377,419 *2C60B7402E335655CE5861961037E03ED8850F8D 1OMEROLHI
438,377,420 *2C6D1D59B8A1CB6E952664C38BDFB2FBE7F9A83F 1-OTANNOISTA
438,377,421 *2C63C4DF39DF206A382DB4098CEA932B084475C3 EEDNOSEGS
438,377,422 *2C64CA3EE1A221BE6A347218376542005399BBB2 1PAKGAZ
438,377,423 *2C6F685305F9E9177DC32CFCD9A2F885385FFE2C 1 RINNASTUESSA
438,377,424 *2C6703614E61C043C52C07853C49E0BDB5795A78 eh_:1
438,377,425 *2C63BEB426D5D88F6B378AADE5486481217D5D2B EH46
438,377,426 *2C600128F5E7864ED0BF5785BB917A51E44C695E 1-vallinnoissa
438,377,427 *2C6FE1CDB07573A8247581B87B08399CB375B06A 1visumstelle
438,377,428 *2C672637C7CC54B06EBEDB3FFAD86275C5E4AB22 1VOLONTAER
438,377,429 *2C6CED4FC07E95CB8EC4B39E74409922B8F8B8CD 1-zusammenhangslose
438,377,430 *2C618F6A792CF9FFCF8D512FB4681A9F9B6C65A5 ELCYCOIB7
438,377,431 *2C65BDB0D942B8F4013874A186479E8E1F0316F7 21APR1323
438,377,432 *2C6564B86857F8B55EE153BCB1E54C284DC9D0AA 2243153 SE ON SOIVA SARVIN
438,377,433 *2C6017A55958E490007BA975BA0C11BBF54A3530 2250040 ttt.maksaa.j
438,377,434 *2C63D694EB6162DFD7DC7118A5632E12C1AC6E45 2355202 DIEERSTENBESUCHERSINDDA
438,377,435 *2C6D24EBE702918C29E2D49D1CAD8F99DED80588 24-radiomeldungen
438,377,436 *2C6CDA9CE89AE18A7F815ADB68CE849FB9D93F3D ELMER.BORYS
438,377,437 *2C64C4AB7242AF58539D1BA94D0E78BF5AFF57BD 25june1117
438,377,438 *2C6F4DB126C2C42E7902C4CEEFB56686650CE0F2 ELSKNF
438,377,439 *2C6DAE291FEDFA1DBB7BAC2F1F4EC4DF4FA11F3C ELTON.RUMLER
438,377,440 *2C6D804B21E853D2407FE12A6444ABA310C40DA5 2848799 THE ORDER BOOK IS LOOKING HEALTHY .
438,377,441 *2C61B87FEE2A03CDAC0EEB91C67EB67F92FD3BE2 ELVINCHRISTI
438,377,442 *2C6386021F0D5181DAED27E4607F39C50B077F39 2890216 levine's-move-to-columbia-had-been-widely-expected-
438,377,443 *2C6074F9E66431607D5015801DF1888F09FE9379 2977749 kilpailunj
438,377,444 *2C627218A0DB64DEBA85208E115FA62BA9089A42 2977992 ruokajuomaksimeill
438,377,445 *2C682547479662C4909CB372E2ECB176F91EDF45 e m i l y
438,377,446 *2C6152553377E30B93A22CAF60C3B84314FCC604 2.AVOSAAB
438,377,447 *2C6E984F7AF552F2EB2C0C2B6F810D1C8375046F 2.barkowski
438,377,448 *2C636239E4776F7EF6698CB49F6342C49496D2B4 emmittcavallaro
438,377,449 *2C67A815D5818D80406455ACE628FB92BE326089 EM!N
438,377,450 *2C6B16F6684B32000CE092747A855D53F110D8FA [email protected]
438,377,451 *2C6B11FFC11163856286219E05C3EF30FC346554 2.kapitalimus
438,377,452 *2C6A3EC23FB67C2ADCB7BB6D0FD634588DDCE029 2 KESKITTYM
438,377,453 *2C65895E6139E22EB6E1D99BA7D21729C7177CA5 enterizo2
438,377,454 *2C6CFD2E7AE1C083C23C44CD98E64148F6EA73B0 EP9D,
438,377,455 *2C6F7C337B24DD056888ABE4B93FB99BE715AD6D 2SIGNIORY
438,377,456 *2C61C6A61F34FD93AF725B731592E230292B4E2B 2 TAUSTAPAPERISSA
438,377,457 *2C6E89D280E0A75F9C03FD09FC821BB373F00940 2.tonsystem
438,377,458 *2C6A7DE07EC51FEF3BF11DCEBF5F83D7F01678D8 E.RADCLYFFE
438,377,459 *2C64259B9FB84174B9EA65DC9E8D53501DF20999 ERICH.PULLY
438,377,460 *2C6D335F1BC7E0430984D717F7A98A6611D88F02 [email protected]~.(~_^)
438,377,461 *2C6F6A4976C69C46CE402D35B547D7B8CB36A737 3922malini
438,377,462 *2C61D6122901E9114CF0185FB01E0547E4EF8C06 3AFGEHELDS
438,377,463 *2C6C7FFD05321627C31BB1BF10960800D3E51C13 3#####D~0~o.:p
438,377,464 *2C6A5A2519D3F5DDE8F0299ECA682A67C428B732 3djohnny
438,377,465 *2C6EF3E863A5B2F830780461F9E3C8B3EAB4015A etf"1
438,377,466 *2C6424B0E5EBA05FC45FD6AFDA751456AAECEF5B 3SEISANDA
438,377,467 *2C61756C195B59ED33C78E046E57A9225D6AC44B 3.VILJELYARVO
438,377,468 *2C6D9ABCC4394098307BAD5AB7B8F9E85FD23B4C 421733 laskuvoidaanmaksaaer
438,377,469 *2C6161968EC97172085EF64C4A0F171CC919385B 43.vuosijuhla
438,377,470 *2C6AEF50957059E56C1CF39E4B0F41FD35F8558E eusebiohardina
438,377,471 *2C6904B0ACF80F74FEEDE2EB07E412FAE7CA64FF exhumes
438,377,472 *2C62820DDA9B4EEF157B5C928B8A70D99DEE53A6 4-KLUBKOLLEGE
438,377,473 *2C6A55F45E30F9625067E24ADD82D5577080A04F 4LAKOLSGU
438,377,474 *2C6EB515B41ABB0FF3C1C0A57915AE60CE0C742C 4LIPSSQUATSQUAT
438,377,475 *2C6695EE7B733DCF24AF2BF6B160AF298566C488 f4mi1y-$t
438,377,476 *2C644B5CD3893E609784B72B4047046A8B168CB8 F5INTERNETCOMWWW
438,377,477 *2C6543314683D5486E2B7F4DA4751913629482AE 4MRIFKNAB
438,377,478 *2C67C176A9C397A1F8EFE3E7269EE5B590DB0B10 [email protected]
438,377,479 *2C6D38B40E2BC641DC1766C39976BF4C76E009C5 4SAILINGROYALS
438,377,480 *2C619DD66E006A8467DD5622FCCEA2DDEAF23A4F 4UNAFFECTEDNESSES
438,377,481 *2C625056DF95A0A5848171C93360853AB238974C [email protected]
438,377,482 *2C6C5ABAD03CC16C5ED51444CAF387F10E876BC0 FASLULLAH
438,377,483 *2C68F7108468414A736FA89D8703B44E208D734F ..-(FEAT.
438,377,484 *2C6153EB06190DE0097B76CA83245DE0ADF9F63C felix.sena
438,377,485 *2C604D25372124EAA8D0EAF6C45D740CCA84BFDD FIL$T
438,377,486 *2C667FEF98A30D36E0F52AFD2675CE29C2D1402D 5BERGUTBERGUT
438,377,487 *2C64A21CAFD13BB1D827E660ACC636034CEFA6B4 [email protected]
438,377,488 *2C66CC86503AF5BBF46A4541C3AB15D8247632CB FLETCHER.SCHMADER
438,377,489 *2C6089FC0FC35FEC876851143E8B766AC2D561AE 5EKREHTUL
438,377,490 *2C6D41CC37CB7FF68EF5D41BA6B8F6D3AEF2E429 flyerstoby
438,377,491 *2C654E6791E1435BFA4B2653198EECA6DB8D332C FOSTER.WEBRE
438,377,492 *2C6F13ACFA850242C38B02D44859A922B440733E [email protected]
438,377,493 *2C67C4144B08B2F787988C939D0940AE65916143 FRANCISCOHACKNER
438,377,494 *2C6AEF607559DDE34A2E4907E57E76E59FB4BC00 FRANCIS.SUNDER
438,377,495 *2C66FA76BCD8D9D6BD2828D590303A652054B913 FRANK.GOLLWITZER
438,377,496 *2C63CD8E45A38D3036AB5519A8584F4911ECE8C2 FREDDY.SOLIS
438,377,497 *2C6B47D3247F785C1B3AF8CF572BDBBCA38F08B7 FREDERICKBURCIAGA
438,377,498 *2C686BABB1F1B4E73DCCD348AED6980058010351 5NEJZAHADNEJSIHO
438,377,499 *2C6414B44CA280F74F567E5066134A9072C73CA1 5NEROZKROCTE
438,377,500 *2C6E54957F3220DEC228A2F7E11E06909ED9130A FRYKTES0
438,377,501 *2C641D0377FD4C72696D9ECEA3D8E44C3CE7547E [email protected]
438,377,502 *2C6C5DBA848ABB547FCE29878CA1D64A9A784319 5PROVIENNES
438,377,503 *2C64F65871D2A9486FF204D16EF0815718BC7C98 fuxn
438,377,504 *2C645C5266C5287A240E8E0581EB0873B17A0BD8 5UEVIRATE
438,377,505 *2C673B87BB06360FC93622867F9F034356FC755E 5YRYLAIVAT
438,377,506 *2C6C69456677B615AC96B78D1A61AE7ABA37815A 6101155
438,377,507 *2C6FA76988668B6DD9873F5E72E041332EB04DFD GE:F
438,377,508 *2C6668CA7E8A9A1A3C9DA6909A0795019FC0EA00 6BETALINGSORDNING
438,377,509 *2C66D87574540423D8C24531F77D55928940CCF4 6 BULUSTURARAK
438,377,510 *2C66C9DD7FA81AA5B46ED54C09A12BAB8A250087 GEORGINA7
438,377,511 *2C6C8183441D31B95AF12BA9856FEB6C68DAA2CE 6DNEVREDE
438,377,512 *2C6139491206FDD3944E252DF8C62ACD28AA460C 6GOSEIGYO
438,377,513 *2C6431F9489BE6D2B4530339881CC943ABE00E6F 6.heuboden
438,377,514 *2C63D2AC01795416209B92C4EF5AC954891773FB GILBERT.MIHALCO
438,377,515 *2C6FE0E66A391D09EE845DC42244076D31B6C921 6INTERPELLEDS
438,377,516 *2C6FE6E967539397051072DDFE4566B0FA8DFAC0 glenkritikos
438,377,517 *2C6CA0F47B071AFC1194087F2378412273140C77 GLYZERIN
438,377,518 *2C60C504E3E4B0F53520E27426D304A653A884AD 6OTAROPAVS
438,377,519 *2C6A308FEA9032F17BD832A1AA2D915E72E67B29 6PODEWELL
438,377,520 *2C6001B00B6DB3F39DEA2E081EC9A93A5DB86355 GODHEAD—PLURALITY
438,377,521 *2C60CA867C264FCE9B49496B86D35BBCBEB51AAD GOINGBACKTONORTHCAROLINA
438,377,522 *2C69B448D829AAECAF3DEBF53124435897D28AC5 6thatxxxxxxxx
438,377,523 *2C64CF107AF43E2148486A6B9F2C42F50D99CF82 GÖRBICS
438,377,524 *2C60071D5F966F8009EA605446EB93F1046F72B7 GOTISKES
438,377,525 *2C672AE33E2D97129F4EDE1086EF6BBF15F4CFEA 6WHITEHOUSEAGAIN
438,377,526 *2C63BA4CB7ED14ECEB72BD17CE6FCB920D94F76B greeley47
438,377,527 *2C6772BA8DE2C2199D05B2F70A72D0EAA74227F6 gretchen.austin
438,377,528 *2C6E2B76A6F78CD56BC21E329CC14387882E4B17 7AFGEKNIP
438,377,529 *2C6D2407B68DAAB42FE84FDACF3185D1941E3658 [email protected]
438,377,530 *2C62B383048D2D2F860824FF6C3E26FA20DDF1B5 GUADALUPE.KOOSER
438,377,531 *2C6EE0F634B1D926C8BF3DF3C551D1BC0DE9EBA0 guguam
438,377,532 *2C6F0273FA3188C4E2195C1F81D7E0F37E66C7A7 7FXVIBNJYOVI
438,377,533 *2C6D491EC8A541757BB9D50A9B224FD704C632D1 GYDC
438,377,534 *2C671C0731F48AC65697DAB66DD7BAD1B20A0F76 halerus
438,377,535 *2C6937DAF12EF69B6B32DD1F841F5C3C1B49B15A hamatinikum
438,377,536 *2C67F973C4DCFE61B26EB07BA299CEFB5D1FE7B9 7OPPRESSERINTQ
438,377,537 *2C6A1A791A8FA21AEAEB62DF1B17B3D2BAFC0C69 hankyuu9
438,377,538 *2C6B7DEF79B7D2C8C95A6C2D889132F522AAEC11 [email protected]
438,377,539 *2C60D7A482908005D11016D28E5E39E2068AA96D 7SPEARTHROWIN
438,377,540 *2C66BDD1AAA3DD627CEB5A6B064C1CD21F98E047 HARVINDER-JAKHAR
438,377,541 *2C6E1465D624C35F521CD47AA100B6E1D5ED7533 HASHVALUES
438,377,542 *2C6721E4D7D2A4FD98E1F3852C4FC4475474950E 7TOBYANGELS
438,377,543 *2C6384189F409121F4C36511D825419AD77A00A0 HATE-ME-NOW!!
438,377,544 *2C63E95CC5EE49426FEB5870DD3B4ECAFEF65C70 HCNOZAMA
438,377,545 *2C68E17DA7F7CC1AC7EBA28FDF2250BBF23A6C43 824aufbauen
438,377,546 *2C67B01F8EA888F749020324B636C73368EAFCB2 heateneding
438,377,547 *2C63941183F750DAF5F2E74AE8B9DEFF623854E9 HEESAMUDENM
438,377,548 *2C672F044661E5E7CE1E034FE8F2E11668BFA728 859480e4eb89327d8642f59304de46cd
438,377,549 *2C68708795112785B3E3C4B1ABBE0687EFC2ECC3 880056 GOREVLILERDEN-OLUSUR-
438,377,550 *2C6DB5333047F97A8AC577CE1D08ADFB4B82E691 8: 8 # & CRETIN
438,377,551 *2C6D273D5FBB219B48475A65BD4A4F1717B216C4 8ACUCOTE
438,377,552 *2C6860B7D38E91E28C2B39F3876C839542289658 HERBERT.GRILL
438,377,553 *2C629ECD00226A3FA28DD84A60E7AD9B0BF0CB5E HETTIESTANDER
438,377,554 *2C65204B79A649A98E0DF5FD2AF91CFC1F9D90FF HEYMANPLEIN
438,377,555 *2C6FBE44C43E502BCBA609C2363271C175DCAA40 8GIERTSER
438,377,556 *2C652CA4E5DA8D71A970D3DC5C0205057229A45E 8IOPSDEEL
438,377,557 *2C62D8DDE33867C2BEE4B169BAF62B4CD1ABECD2 8.L
438,377,558 *2C66C3816C8B8BC242718E6016926E333EF8A35E HN/W
438,377,559 *2C65A876253F75D45C80032B9C97D0BED890AC01 hon na zlo (instrumental)
438,377,560 *2C6AF6740A28562A8671DB5A1D7A34B849594FBD HORNEFFER0
438,377,561 *2C65A33D160E2C5F8A09A91DF26EC4C67764041F HREF="/PSECTION/BUSINESSHTML">BUSINESS</A></LI
438,377,562 *2C653B956E45A563EB345356D662227938620A1C 921AZSXDCFVGBHNJM
438,377,563 *2C61F6BF225819CF8AAEE5147D3CA225CCAAF66C 940370 ei-kun-oikeesti-.
438,377,564 *2C625961FFCF7B1E2C1930947BF8E21386CD8DA5 953KONNER
438,377,565 *2C6CAC6A578F827A32EA1E1A5093F6B480B4967F httpwwwmatsgflusmc
438,377,566 *2C6A53C8AFDF672B0DEF11BE59D4A4800EFC9B87 [email protected]
438,377,567 *2C6CC44A993EE3A30BA9D04F94FA741C769E6622 HUANG_MIXI
438,377,568 *2C61C24E12D10E483F5A00E255EE2910AA4A62B9 9BORDRAGINGS
438,377,569 *2C63FF55A53CBA3B93CEC06AA51DD16A6B030315 9BSWMANGESHBSW
438,377,570 *2C68EE8E5DEC0D77F7651CDB761043DDBC3C11F0 9BUFFALODETROIT
438,377,571 *2C607AD704822A0F7B140E1F21D1DF0DE294BA53 9CIAUIBQWWK
438,377,572 *2C662059F99D90E3FDA6099F1C0CB44CC998C3CD 9EDUSTUSTOVERK
438,377,573 *2C6D9F2819CDF8B87925E46AD414131EBEFCC298 HushPuppyYummy
438,377,574 *2C62B9B4C6A2E879EBC4CD257206528240C7E4A7 9GNIZILATNATNU
438,377,575 *2C6BCBEA28320AE0400CDF18150D45413A7CF5AD iamkelly06
438,377,576 *2C6ED2945210E0F9DA83412DC7B11758E33DB489 IENCOGBJ
438,377,577 *2C66E32AA97B0C98D5FBD7237DA9EB126E8C407D 9OVERSCRAWLED
438,377,578 *2C6A3963E3A209E5B4C5A8BB193E1E332B631F58 9POLLUSJONEN
438,377,579 *2C6E139C947658EF230658BA78C661A17379D86B 9precapture
438,377,580 *2C6A12C187F60ABC12E82CC21FC8E8437EC61512 iinnutti0
438,377,581 *2C6C9277354B7BABAE9F5280BB86B4DE837E5955 ILMSSBSW7
438,377,582 *2C621CDDAAB5B5CC25F19FBA42F46315D872828A iluvfrisco63
438,377,583 *2C60CB45D513AF233E5339BEB0F1B2365F736A5D iluvtech!
438,377,584 *2C6D2D594E30A275F61433626009D66145294091 A1+)
438,377,585 *2C62E7C8C16CECBCBADB55D32C6EEF06229833FC A36RI
438,377,586 *2C6407E53BE9C2577A757CD9F4125A4A6A200BBA indisponer
438,377,587 *2C689CB4F01AEF77C5A83643041E8FDA6DDCDD05 [email protected]}I
438,377,588 *2C60F74511D5B73265E1BBF17A0F59848FA66818 aaj_o
438,377,589 *2C6C6E6D80FEB68CBC643C9529C2F5BD79B4C421 AANARDAM5
438,377,590 *2C6E3506964A9A65158E617585B1BB73E0F6DDAB AAPOO
438,377,591 *2C6B9AE9F342B7AC896EF630F98DE9223E8A3C90 [email protected]
438,377,592 *2C6E4BAE868FF5299081AE40017EBB3B6499FCB5 JACQUES.SOUTHER
438,377,593 *2C64E8C038FBAE1B553F7C7F722F317D6C152374 JAME.HAZEN
438,377,594 *2C65DAD09806709F165CFE5D9507EEF680DA2499 jamesbeckham
438,377,595 *2C6AA444A3F01C90B7CF1A5B0E11952C9F09E9F4 jamezurasky
438,377,596 *2C68C16B8F49BC4FDA00CAA16632BC67D84008AB ABSTRACTIFYING
438,377,597 *2C6AECE4952C199B592484494AE36CA367AE8D87 JARAMATI
438,377,598 *2C667BC80C906A0BFB4EEE48A7CD55445273AACD JARREL WILLIAMS
438,377,599 *2C6A29BDA03B362156DCDF0F70586AF68196D50E AC32L
438,377,600 *2C6FFEF370C32DBDAA43C935C13DFAE92D96F1DD JASONWANTA
438,377,601 *2C69770EC1CD045E1C661C62755ECB7EE7BA3896 ACOVARDE1234
438,377,602 *2C648A46C6EF7403674FE6FCBBAC6FFA1E801263 jc3i
438,377,603 *2C6B08224D2E9873B42F5D353C0568B734B24107 JENESSE2
438,377,604 *2C67F5FD8F0F52F10A19076E90628DD441403877 JESSICA.BARTOW
438,377,605 *2C6B29E29C4DAF73E099F016796309A6915CE24B AE$K
438,377,606 *2C61A417E4341A9D8A25E1603333F8DAE2383F3D afspiegelingen8
438,377,607 *2C6C9705DFDDB72E3D1E0F6326204F1358DBB73C af+y&
438,377,608 *2C679115A44E1D5AC4612445D2381AF13D589552 JIM.CAROL
438,377,609 *2C67B28A1EA99E26204BDB3EF18904AEC50E7131 jim.prange
438,377,610 *2C6324FE77224F27A18FD178FC1D6487AFF8B62D jjplorgjjpl
438,377,611 *2C6C99009CD0E3F1547717100A5F9FB981127961 AGLWL
438,377,612 *2C64A48681566779B44F185B934BD277E53898BA ahiahassanbecklamborghinirock
438,377,613 *2C6B3CF0BD88C33B656DE6241E9D1102C9AF4F86 johnpatrickdowd
438,377,614 *2C67B67CD48727D8B51D903C016172CB83A2177C johnsongormly
438,377,615 *2C65CCAF25FA888A5EB6A975E7654BEA42F57146 JONAS.LINGEFELT
438,377,616 *2C6BB03FC4F38C322CC4075FC05DD377D651CE5B josefeberhart
438,377,617 *2C63373EF7ED2BA4EE25E8E7652F555BE806B9B2 JOSH.BUCKOVITCH
438,377,618 *2C625240E3765193E048EBA1B84788D4A60DB313 josue.alcala
438,377,619 *2C63A6BC66D0F6B21A780DF9E1C43AF034D7BE34 AISHA904
438,377,620 *2C6AC8C9D793656DA0B0D4CA2B037FF064EEE895 ju0-
438,377,621 *2C600B47D31E03C644F3572C8D6C465ECB4F6CB5 JUDITHREEDER
438,377,622 *2C675020B9DE54B8A9940A517E3FBCDD93DE27A4 AKAPITIING
438,377,623 *2C6863BAB2449A9916356F34F6937CC6C6BABE88 j,wn
438,377,624 *2C698248241D00F9AA1D9A1A7C67C6B2BD06AF77 KATORZSEH
438,377,625 *2C6F9D1960B04E2234912D7B447C5D894D050E8F KD2BD
438,377,626 *2C61CD651504F52115D614EF36C2C268124F6AAF KEBUIDOI
438,377,627 *2C622C66043C9DE5E0EF96AAA96AC3099346616A alanz
438,377,628 *2C6592B3F0B72B8F4E217D3B72BB00F66262A932 KENETHMAGUIRE
438,377,629 *2C6D1C2C42BF3A0FF2270485DDE5DF2C8DAB9728 alfonsonicosia
438,377,630 *2C66774DD37FF266EBC104914BC2FD71233F3C03 alfonzotemblador
438,377,631 *2C66E49D2D7B8D48C4DF6D71C184E79383EC855A kerry-greenall
438,377,632 *2C637D274928EC218715D799CA263C29309C9C28 khattak11
438,377,633 *2C6DC846770CF6FF2C760B4CA0D9213CB0A84C37 alloksur0
438,377,634 *2C6C5F2E85A3B53997A2D0FE1A05C50604B9F0E3 KKERBISKENER
438,377,635 *2C6F51D83653939078C16D12B3B190274630E48F KNLHVAL
438,377,636 *2C6CEBD1B24F6E974303433EE9DBE38BD949422B a:lwb
438,377,637 *2C6B31A010DE96D0D3924948A8E40707816C7006 KRISTOPHER.STOLTENBURG
438,377,638 *2C6D5F5631A20296539305AB42F3716D8DA55547 KUKLAWSOME
438,377,639 *2C6859573984EEA74939A3CFB1FEF4BDB3A6CFF5 A.(MO
438,377,640 *2C66D4CDD87789405D1ECD77D18286DA6FF3212F L4UREL-DE
438,377,641 *2C6ADEB084371739AA501A5B36DFD7299C2B27E3 L89437
438,377,642 *2C673BFC8BB1A04BC3CB0222911315F705EAF8B7 LÄÄNEJALAMILT
438,377,643 *2C6BD3713CB1D1F017A50631DCD9B419892D69B9 LANDEN720
438,377,644 *2C603530FA27F046D5F178118DDC5959E46C5A32 lauren.jasmin
438,377,645 *2C68D5EC68012826997D592FF76E61D96167A77C LA_WEAVER
438,377,646 *2C669A6328222D443CCA5FD4A5571B40CF987E0C laycustomer
438,377,647 *2C654F9DAA0F1EB51E9D603DB608A6558B4C08D6 ANDY.KROMREY
438,377,648 *2C60532203B4BF6226708F6A4E62DDAC66BA26E8 leeeimers
438,377,649 *2C60CFC6D312314D08845B81CE46D784F76F27C4 LEETLES7
438,377,650 *2C636300663EDF9E22683658822066D4142A3D7A anl)u
438,377,651 *2C6AE9DDD887F7FDA4A539040D66C6FA0128D54E an(sc
438,377,652 *2C6AC92D5EF0C4FEFAEC5410CA1C9F0288091767 leslietrotti
438,377,653 *2C6CDA5118FFFA2AF5E902C1FE401179CC663C0C ANTONIAGIRBACH
438,377,654 *2C674106A40CC155FB4AB595167B9363F4667542 ANTONMULLENDORE
438,377,655 *2C6173CDAE3B8475083A52386536C15372F2B2D8 lindafarrowcoukwww
438,377,656 *2C6F53ADD78064F447F690C354DE3939385155E8 <LI> THE <TT>$/</TT> VARIABLE CONTAINS THE INPUT ENDOFLINE
438,377,657 *2C618D83A4946B2EB17AFAB9BDB1896D6A037237 apotx
438,377,658 *2C6BD8195D5AFE3F45F2073FC75D14CB0316515C LOEFHOUDS
438,377,659 *2C64C76F47D94306548AFFA6C0C6E6BD3E48B3F3 lois.kay
438,377,660 *2C66D1BE51E35C727A84661FDBDF9C7DFA1B258D longminty
438,377,661 *2C688CA43C68BFF29EC78E6069C8B0FAA843E21C ar-eh
438,377,662 *2C61FEBF77324C3DF12938C2D9763C3993E9B2A6 LORD(FEATZIGZAG)
438,377,663 *2C6020C3EB5020DC704C02E9894D2CDF0DF124DF ARNULFOBRADHAM
438,377,664 *2C6E07830E12FB07521C7F9663238A0962AF325F arnulfomcfarlen
438,377,665 *2C6A2FA432CE05DF113DA153395C33755341A993 LOVEISALLTWOTHOUSANDANDTENINJURIES
438,377,666 *2C6C03F0CDBBA88275EE8DC81B2110F4C0B514DB LSR1
438,377,667 *2C6FBA70C444464A745AF9CAFA3466374E7A6A43 ASHLEY.LEHTO
438,377,668 *2C63B85C3F67E30C062D787A4BC8B7B781E9D50C assabili
438,377,669 *2C6EB865470395A717E60EAE6AEC2F68F6DE26D7 A-THREAT-TO-THE-WORLD-(INTRO)
438,377,670 *2C6F9291551F7EEEB60AAA59E8F4D41D81544E39 LZ7>
438,377,671 *2C65DDF968550A246F17DA507554C57B5578B0E9 m0n09am!$t!c
438,377,672 *2C60E642D14047E847E591E2CE78F32F2DFF9E16 AUDREYWERNER
438,377,673 *2C6AF386A82BA4ED37CBE609556941A24A84B216 maerbsw6
438,377,674 *2C6423E954B29D2CA1DBBC3B1C91AAFC89CC6379 MAJAS
438,377,675 *2C6AA3EA0CD55D66D377003DC66762B78593A46E AW?10
438,377,676 *2C69A833C5088085906B116BD208D7318E68B938 MARCEL.LEMON
438,377,677 *2C6C766E0A69B70AB10E9AD50164FB95D3400A2A [email protected]~0Splat!
438,377,678 *2C6AF6D7EE7D56CB72E29F934552B7E7611AA838 [email protected]
438,377,679 *2C68D819B20FDDC0CDCBADBAAAD485D570C3B158 B_1VU
438,377,680 *2C62C87185462B27FF239276F8FFE9E07C23F4BD MARCUS.WIPFLI
438,377,681 *2C648A44CE002EF4F7EDDC83F376948E765FE660 [email protected]
438,377,682 *2C6F8A6AF6EFDC7D0E913A9FD906CAB1CB67850C B5Y:M
438,377,683 *2C6068FB0A611114053D03264C3029E51EF69D6B markusince
438,377,684 *2C6ADE1D5D34EFC759DAA405CC8A4DC9A2D8C6E6 barefoot-in-bengal-and-other-stories
438,377,685 *2C6D58E123AA666A80333CCF68DD6484107DBF34 martinerway
438,377,686 *2C6278AF8FB499A98A1B74FF9C0B1B8A3778A630 MARVINDUNBAR
438,377,687 *2C6CA814E21024C8BCA33515B132B1E5E8086F5E bc&"3
438,377,688 *2C6901A0F609DADF97E61B03320120350DE1E04D MBOUDOUR1
438,377,689 *2C6A473EA0F077B20C1413B43DF5BD7582049676 BENNIESTITH
438,377,690 *2C68A6BF659FCBE36086BBA1816723E1B702C4EE MEMORIES.OF.MANTSCHURIA
438,377,691 *2C6CF6F72BAF84AE13538E370425C3D958F4E607 BETONIES
438,377,692 *2C6A1EC7A5A939443093946A3FB000B40B23B285 BEZS(
438,377,693 *2C65AF243F96E0829E797BD632F34BEBE6EC48D8 BfEg
438,377,694 *2C64E90ECAB442AC76366A5BA7B43EBCED76BBC6 micahzumba
438,377,695 *2C61782DC278FDAB3C325842FA633AD59DC039E0 bgdui
438,377,696 *2C64B51C07AB5F2707948B2B9483763FAAE1A295 MICHALEWHEELER
438,377,697 *2C633FA1D6FD6FF31E62FFB02905EBC05FCDE6EA bijutaril
438,377,698 *2C6196FED9FDF878F767288F920B885F339C7EC2 billybird
438,377,699 *2C6A0BB5755569FAB4BA67EF803F917E0F4FBDE3 MINNESPEL
438,377,700 *2C6966CF322BD59C65B8FB161143B9D28EC9C123 MIR GEHT'S WIEDER RICHTIG GUT
438,377,701 *2C61A70E652C786328D5A203C5BE51492D1E2F4F [email protected]
438,377,702 *2C6C177925EDF9D6A26B1A49BC327BA9682B252F B:,JE
438,377,703 *2C6C06386DFE97597CE7B320046E02DC3754BF06 BKNI%
438,377,704 *2C6760F0BA9AC4421A304440639BF1960F8111F7 blanca-chinchilla
438,377,705 *2C61F2E0552FA8FA7DDB078872A7964C3A59569A blcqd
438,377,706 *2C68B59FE9660957057F5CD80F1F7315FE662309 mohamedvanez
438,377,707 *2C67E513A842D80821914D6F961D9C68879A2490 *block.3.subtitle<p>
438,377,708 *2C6ED0B0E0B7A195F0019D0EFEBB0F7AE9C5AB6C bojlp
438,377,709 *2C6AAF8A4395600992BEA00C32B07BEBA4D29F42 MRPOTTER1
438,377,710 *2C688AE1F72C6A297005FC39850229AF36F90A14 BORISRUBIANO
438,377,711 *2C67163C1E6323D7ADD3CAAA690C4BA49730B135 [email protected]~OSplat
438,377,712 *2C60A4DB27E9170D5A6D0C90E98B9EC91551FB52 MTCSOFTWARE
438,377,713 *2C61F500E308DC57A8453522E1266B2DF33EB8B6 BOW'ED
438,377,714 *2C68CAA6C1F6E8934E253315E1085073E5715716 MUHAMMADHASSAMA
438,377,715 *2C6B4EC43804302F03BFF1B59E5358FF0C6DA27D MUNGKIP
438,377,716 *2C656F4C0B044E7372F97266DC8A13420692EE31 b##p-~-`-:p
438,377,717 *2C6BABED1D2B087BB0397FAA17FB380847A7590C myracleofas
438,377,718 *2C6DE6F87DE10538B7D047BD4E3F6D10D1C494E0 BRADLYNORTHCUT
438,377,719 *2C6BEF2D20E0C98E504C81D9D7AAB82F1E7E530A bradlysaravia
438,377,720 *2C6D75D03A02C67F4231796FA94FF85C96F1D41A MYSTICSCREATIONSCOMWWW
438,377,721 *2C6AA626C5F1F6AA3EC2E444F4CF16E8AAC3AE45 brandonbironas
438,377,722 *2C6A345E04EDDE5853CF9889972A7670494F18E1 BRANDON-CORBOY
438,377,723 *2C67AE022CD058A8F6F15B579648DC2825F250F8 BRANDONELSE
438,377,724 *2C6A5C4C92F8BB96737FBA9B5BD35E314F12ADD6 BRANDON-HOLZ
438,377,725 *2C60E71447A5BDCCD538878E9800A1A55AC88083 N3UR0L09Z3D
438,377,726 *2C6A29EF0FC6F8313418BB2A349A8B57E54F0698 [email protected]
438,377,7