List database


# MySQL hash MySQL password
438,360,001 *2C669D6785B5458F246DB2A229F38C7C864374BE b(oc
438,360,002 *2C649930E4E15867BB4E9F6365961F4571899DBE BOLAGATO0
438,360,003 *2C63A8DC5450D2C2FB92FDFE2D23326B2D0CB15F THATSHAGGY16
438,360,004 *2C614E7A03D5EC1EB6CE238DD7F4A9A1B9A0F011 BORISEHMKE
438,360,005 *2C65FB7EF98485D068919AF0B21AB079F0F72CF1 [email protected]
438,360,006 *2C6C4C239F2D96EAD911246799E13278121D6CB3 THEBADRACKET
438,360,007 *2C6E0DF509F94171C837204525E02DF49D28B810 THECOURIER
438,360,008 *2C6E6790A46486AA2411868908BBD1F306778105 thekathy4
438,360,009 *2C653250A2EA71431FAA23AA3CDDF4B1910F9BF0 1sammalisen
438,360,010 *2C6A4A869584D94A81517D65FFF1A45A59795C02 BP~0~o.o><
438,360,011 *2C64B60D6BC1157A0B91C710E9FBF019077DB090 BQOZ
438,360,012 *2C6532D2BDF2D50E3EE5B343A431F3BE0A0BAF3B ti3clasp
438,360,013 *2C6A9AE9D0BF5E98C67482F5EFC1167736A77126 TIFFANY.PRIOLEAU
438,360,014 *2C636BE573E0A82C175C00D19F6CB44D153416DD TIFIC
438,360,015 *2C6B809FCC5E7F2E0DED6ECA3C9A6C4916C1678D 1.silvers
438,360,016 *2C642C17A53105979C228FA571AF114287A68E80 [email protected]
438,360,017 *2C6E0573D94DB126531F919F0BACFDD323DBA341 TNBYTVAP
438,360,018 *2C69DE524853DB1D3CA219E75F2D4274B590E271 TODOVERDE7
438,360,019 *2C61B0DD7DBF7AE94E197AA1D6CF99AB43DFF0AF TOM.DAMATO
438,360,020 *2C61E47BB0336B35B96E8905FE0F1B74629692EA toni cavanaugh
438,360,021 *2C66BAC2FFDE20F0703DDD864D1E91692C2F6988 TRACYAMANDA5
438,360,022 *2C67D48F20838B35DF6E9162E698DBB82EF58C48 TRANE > 3RD STONE JAM > ETERNITY'S BREATH JAM
438,360,023 *2C67E850E7605A071C23D9DD9F1A76D2294B7ED8 TRDNT14430
438,360,024 *2C6DA9AFDCCA28B592E7D44AA5041070272CB68E TRICIAGRAYMAIL5
438,360,025 *2C682FE1C1557259968083C965356237AFAB616E TRIEBELSHEIDER
438,360,026 *2C61425278A2B61C3125803D906D216588FFD267 20041030:JANNUSLANDING,ST.PETERSBURG,FL,USA
438,360,027 *2C658DBE62D506F321EFFED942E3C9642523D3E4 [email protected]
438,360,028 *2C6330DC6C6E77AFC07A149E46D41B0358878A58 [email protected]
438,360,029 *2C667D910D5F957FE206BDD29D85D1448B750588 2089841 HEVONENKYLL
438,360,030 *2C6F45C11A1B26F4018D056D76D6AE24F65E7BDF BR(RO
438,360,031 *2C62291D6CA8BA4E3F9F24E43BA11999F22656B8 2196980 ER.SAGT.:.ICH.BIN.GLUECKLICHER..
438,360,032 *2C6BB1F2A1940CF3EFAD04667E31DADA96FF8AB2 TROY.SHEY
438,360,033 *2C64639EA8D0C1FC8994D865B67BA7E859169521 21NOV1183
438,360,034 *2C61C4231B93DE0E932824520DB89D7F9B9B39A8 2412504 the.united.states.already.has.brought.10,000.home..
438,360,035 *2C6910B18FBCFFFF4B243B003C76A2E930F0E47F TUBOSAKA9
438,360,036 *2C63E27651657B164C5F5FCB207944D556D62CEE TV.MEDIA.MASSMURDER.CELEBRITY
438,360,037 *2C6628418298E19F70CA20B3EE870AA9BD0ED882 tyberia
438,360,038 *2C65D1C7200135CB592DE7A39199E26A748CCB76 btbyn
438,360,039 *2C6629882C8C65A71797EAEB83817E70775838AA u0F
438,360,040 *2C65374DE985B28AF55926A21E4FFA29D5AACB0E 2856808 there-was-criticism-from-the-senate-as-well-.
438,360,041 *2C61E02AA35FB37DC709B3526C35D3FE5DE4531E B&UF%
438,360,042 *2C6EFDCBBCF658354F980F3C917746484F529EED BURGH7
438,360,043 *2C60517C3C27879B976260D5C47789429B66F8F5 BUUF6
438,360,044 *2C68BF33AE5F331DB9D77FD98CE02C9B72E66B33 2APTAVIQUE
438,360,045 *2C64C0A3CEC3193A821514621C27C11C26DD98E9 2batarlar
438,360,046 *2C6A64EBB2264D76839912DC352CC94A5702AEEF 2BLAUAUGE
438,360,047 *2C68E35B6CD79BC5AD42DC9388801EA7580BBBC1 2DEKLARIERBAR
438,360,048 *2C6FA02A9640B75FBCF100BB6B35734A8AB7455A BW?D4
438,360,049 *2C6A0FF4F298DB079C0C1D1BF85512FFF80F1DA7 unavoida8i1ity
438,360,050 *2C693CCDF009585CD41ED7D10667B72FDC47E3C0 ỦNGHỘ
438,360,051 *2C694DA103D8EF22E863DF73C4BCB0A6F84E955C 2iamlissabon4
438,360,052 *2C6003558EAF11BB29B1FF413C2515EFCF2ECCBD c6x/1
438,360,053 *2C6C7F0C5A0E31AECAC3CBE8294BE4AB51278993 [email protected]
438,360,054 *2C6BECB45559C2E61438693E58343B69B0FC39BE c-&85
438,360,055 *2C6DFAF6BB1AC70B14A3E6709B9B1B80A9E5BA5B c8s/q
438,360,056 *2C60F848ED87746696D76209AE7DC41F214A3819 2RECYCLING-DESIGNER
438,360,057 *2C66D535F89A4B2B4E5864EAAA1EABB7D46EA8FD 2RIVITANSSISTA
438,360,058 *2C68CAE406DF2C8A06C3042FFCA22A2ED215FD6C caisseras?
438,360,059 *2C605B23745C789D8359530C4BAB4C4339953AD0 2STRNGYL
438,360,060 *2C62A0B97AD48CAE61CB74E0C00C8D4D472E8A4C CANDACEGILSON
438,360,061 *2C664969E7E168D4EB75AC44E94C9A52D8098A1B 2.US-AUFKLAERUNGSFLUGZEUGE
438,360,062 *2C6C2EB982F184F35AB81141A8D1ACE329EFF4D9 2yhdistysmuotoiseksi
438,360,063 *2C6B549AF921DA4A1919CD62A106C78B5FCCECAF valencia.hartsell
438,360,064 *2C6B66E0D3A6FD383B96C6B665EF15912E955824 VALENTINSHAWN
438,360,065 *2C6211DF84837F093799B634F03C7488EFCB397B carrollkill
438,360,066 *2C611463BEA7120B559753D1A0A602EAB0B8631F VANTREAS1
438,360,067 *2C60E40BE4C3BADFE5992CC59A5A366246799472 VBGLYIUT
438,360,068 *2C6C63056F7A6F4DA5BA0553FDFD169673E9ADAA V'BV
438,360,069 *2C6C8803E4B1F1F6A5F6512EE9E724E073A69CB5 3D ~O SPLAT!!
438,360,070 *2C61BA1E104C7B7E8746834CA40EF00079856148 velva-smalls
438,360,071 *2C691C61C0C3141DC4F2AF2A286F645A5DB46605 VENESABRUNER
438,360,072 *2C66C8721DFD147E806D11CD6A765DFF05B99F86 cc#rm
438,360,073 *2C61C9F336FD448B093E9B1DC4AA3D1E5D4D3D25 cedricdehne
438,360,074 *2C6B0074FEB7DEA0F1E6BD2AC8B0BC9984F0F58F VESNASTOJANOVA
438,360,075 *2C68AAB5038C4FDD58C0848E26768A70C70E6BC4 veteránů
438,360,076 *2C6F5BAAAE9E0B3087AF5732AC0A4892FD4DCF59 [email protected]
438,360,077 *2C6A90FE5107B12E03E5DCB4C8ACE28B536913B6 CELTICMASS
438,360,078 *2C6E0F8A37F1ED8204CB254894FAAFB8E85151BD 480;barmaster[obs3]
438,360,079 *2C65F651B41CA7A5FED11C7C991A133C88F0B747 cgj7m
438,360,080 *2C6CD3FB235C9DA76599BAFF5A99F34338092E55 [email protected]!NSH!PS
438,360,081 *2C65CDADA727B19EA75DD324FD0BEA098AD2842E 4HOOGVEEN
438,360,082 *2C6A22C6D4E6D1F5F822E1ECB5966C5237D6D030 4 JULI-TAGEN
438,360,083 *2C642592B491A5CB8045279A77E64C7F7F032539 4KUNNALLISJRJESTNS
438,360,084 *2C6CB170B3951E2387CE7A32089397D9F9D6AD46 4LATAARP
438,360,085 *2C6CCA11B0E448F06129F4FF3D33F3542934B057 [email protected]
438,360,086 *2C60BE0F2F704CAA1323C445CD69F45F2D4A4E09 4LIIVEJKN
438,360,087 *2C637AA2E680730B70D2142D74D782184C15A642 chapter-31-01:-the-battle-of-hogwarts
438,360,088 *2C64AE9C16CEA8AC5CB093C2227A2562A9BD7024 VJMICHEL1234
438,360,089 *2C61AEA9E97722ADE3FCD25E6DECF99CFD47433C VNEKRASHEVYCH
438,360,090 *2C6D5E513CA5BE6BD434505119FEE5B34F22FF69 [email protected]
438,360,091 *2C6E3962EC77E3390DF1C731616940D239647CD2 4QUADRISM
438,360,092 *2C6081B171518D3B87CC8DC8187AD998E368A306 4RANDGLOSSENS
438,360,093 *2C66384193F9FC14ED3BFEEA8C846480612A5F85 CHELSEA RADCLIFF
438,360,094 *2C6AB0AEAAB5E74B126EE0947ED2CB578F105AC1 CHERYLBELLO
438,360,095 *2C64EE6796A83344C769EA4FD7BEFD295E928D17 4USADMINISTERE
438,360,096 *2C680B02FEA18C0BE063B0A41C1F8A6F3954DF99 4VTMNRJKR
438,360,097 *2C68DE04CFD5F7CD761F51A6CB7EC9C800F1FC74 4WENKARME
438,360,098 *2C6D77DD6BC885C222C4841AA0379C78490FCCC0 [email protected]
438,360,099 *2C69890337CF31C14764AAA08689EF2F4B985EAC 5563 tiedustelut.ja.ilmoittautumiset.p...310.80834..
438,360,100 *2C61EBF00C64840299391212AAF03E6E8C1F8463 chkx
438,360,101 *2C611B13B7BBB07BE676FA7B89545E7CB7275FD4 wainwrightses
438,360,102 *2C6C1B6A58BCF158FD17F65FDEA2AE258D08D37F CHRISTIAN.MANDERSON
438,360,103 *2C66644836123DF5342BCF11F255068C0C3A2BEB CHRISTOPHER.MOBERG
438,360,104 *2C673118A16B51C1ACB5ECC0CC61578DE7E6D1BF [email protected]
438,360,105 *2C6A43E18E7D5A040FA5EF84023A53FEB1CEFABF CI1GY
438,360,106 *2C6352CE624347BC44C0D5029DD98F73EB15E1A0 WENARDI SINATRA
438,360,107 *2C6EB0104C2A385F0B919E76F341D12E3EA91F62 WENDYWILLIARDJENKINS
438,360,108 *2C6B868621098E85A3AD5D160262106676116DA2 [email protected]
438,360,109 *2C6757836323D96D17967AF6860F73D721B95E3C ck4t9
438,360,110 *2C64DCE57D88956FF3E2AC0FF80B97438CC54F4B CL,AH
438,360,111 *2C662600546E1E971A99F3427CC8C892EDACFAF1 wetman151
438,360,112 *2C6CA459AD87F36BB32F0695B1A214A28315155C WHITECAR22
438,360,113 *2C6BF380A42C222459134E25576A7775080B3B77 WILDER.75
438,360,114 *2C6895A626AD5789E17C0878BDED44F44894E818 WILFREDGROVE
438,360,115 *2C68B5F0BA4E63B8BD9F920628BC9807423A92BE WILL.HANDT
438,360,116 *2C65E1E8D931A1339A202A0F91D919B0D2B8B759 william-usherwood
438,360,117 *2C6920D4BEF16F27E80F0436428F43CE1C3F4A84 WILLIE.MABON
438,360,118 *2C6CB699D540B81A3498727A8BB956803A1F11AD 5GESCHLECHTSORGANES
438,360,119 *2C61037D51041C2F37525F73F89E068EFDA149A6 wiltongreis
438,360,120 *2C6872FE0C51B1E0881262D508D918BB6C9CB753 ClW
438,360,121 *2C6D4EC51FB182A66972F32A2E7BACA05719291B WRAKKE3
438,360,122 *2C6ADC5DE53C0E4C7E96ACCA2E6708DC1B5A15BD wu{
438,360,123 *2C66E47BBF98F062FB96D06FA6C93795D4856089 5PESCHEVR
438,360,124 *2C666B127A8D54C41CE9BC2792FF7A52DF91730E [email protected]
438,360,125 *2C6EDB05B3A1A58B04C79E8A0F25A72B8045223F [email protected]
438,360,126 *2C60EB1B6B696ACB74B3F4A1276BE02C22FC2100 [email protected]
438,360,127 *2C6ACEEEB276DD09892A396CA94CA6BDC3523E43 COLTONMANEAFAIGA
438,360,128 *2C61D32DB2A911FD3A505A0C790536B1134A4E03 5SISSERAP
438,360,129 *2C6A179A64CDAFD501FBDE0929BB601DE8B1D8BA 636648 mik
438,360,130 *2C67E144EC63F6BA600A6ACF01A0747BB166507B 6:..6..#..&...SLOVEN
438,360,131 *2C69466D8D852FECD39029E06D96C0633BC66CCA [email protected]
438,360,132 *2C6F93648AC12BF888A52E2C50D31026169882E2 699745 "-das-ist-eben-das-problem-der-erfinder-"-,-sagt-er-.
438,360,133 *2C652B63CC54F719589F501104703CE31FC68149 6BSWSEIEPBSW
438,360,134 *2C61CB149B83235B8AB8037D2E7442083C0DF955 [email protected]
438,360,135 *2C63B0B374462D038897DA995BAF9FEDC93D2B97 6CAMRONS
438,360,136 *2C6BF6D486165F7F882437798769BAC6EBE925F0 wwwriflebarrelscom
438,360,137 *2C69384E9684FA4AA1C6DC4CD8CC59593933F729 WWW.TAMILPOSTERS.COM
438,360,138 *2C6D125ABA962D9CDACA53A98828EC8FC6E16339 CONCIERTODEARANJUEZ:IIADAGIO
438,360,139 *2C6546E130B9208C6FF32DCA895B55732EA1E5E7 [email protected]
438,360,140 *2C6A3D567ABDFDB964076CAFE758DEDA6F809EC9 6HEMOPOIETIC
438,360,141 *2C65B6B15488A3076BB078A924AF84561171277B [email protected]
438,360,142 *2C6D846A6816AF631CD910AE31BD3F690DCC4E71 xii171
438,360,143 *2C65823C83635D68F48A61037B4D3A3860D08DFB [email protected]
438,360,144 *2C6F0ED373BE730294CEFE05D2AE93BB19E35F61 [email protected]
438,360,145 *2C61FED9063E7E4969AAD973703C9019D46084D5 }x{ * * * q===b
438,360,146 *2C6C45A6F5D90DD7B44276A3637937B265EA2EB4 [email protected]
438,360,147 *2C685B9AD6966EA4B80F8E49D1146A9277928212 CONTINUEIMMEDIATE
438,360,148 *2C6BC36DB97F7E926A5C1C597AB2A90E1BD45CE4 COQUETTISH123
438,360,149 *2C6A99309524F95EBC449E3F576CD5000394944D YAGUACHI1
438,360,150 *2C602ADCC4F0CDE17108F36B3C3C6DAF26A32E64 6SHELLBLO
438,360,151 *2C6556ACF48198388DC705527C1DAE610BFBDEC0 CORRADOJUDITH
438,360,152 *2C67FDF115F98335D7ADB984046110B7129783B9 [email protected]
438,360,153 *2C623B423F93C4B2FE3A8C8C60EFDCF751FBE4AB 6SUZUKIKINGFISH
438,360,154 *2C6211175CC2A6429DB83824C71EB1046BAAF0F5 [email protected]
438,360,155 *2C624DC30B212555843F7443E01DCCD1B306E083 6TOUYPYAX
438,360,156 *2C612427B0E614166004CB084A93DEFF261E23A5 YAWNIER7
438,360,157 *2C6241F00B1A376882CF47007AB066359A52F1B0 COUE
438,360,158 *2C69470402B3137EB681B3171D77778FBE858537 cov3nant
438,360,159 *2C651CC258152E1A03A2609DF3755970218F7A47 COYOTE-SHIVERS
438,360,160 *2C6BA4449139AF124E00B714BF7475CBE81C3E43 YGP4
438,360,161 *2C61B0697AD8F8A718DED87306C53FBD1CF36422 7CHEANCE
438,360,162 *2C6F731EB9515987CDC078DB5A08175B3F1A671C 7F136F81-B0B4-3E85-8C62-3D92C0F8C35A
438,360,163 *2C6083B470685608380C4A9704EC09E8E94703C0 7JUJITSUS
438,360,164 *2C6565CBFD3309ABDE1ACAA3F7A9D85446754DD4 7LOVECHURCH
438,360,165 *2C63C43D6D7E2E05F2B9830D7188D7F8C734247D [email protected]
438,360,166 *2C6F20929ACD2BDA7C40B6CBA99AED7C7A759F13 [email protected]
438,360,167 *2C6C42152966CFAEDD98A9476C298435B95CE808 YVONNEJGUYATT
438,360,168 *2C629E11823CD775155D81FC76785E77C8BF17A6 ZACHHANLIN
438,360,169 *2C6832F926E1FAE8D21663D1665DC96FF1FA56A1 7PREPORODE
438,360,170 *2C60B1550F41959430B9B5BB1B81FBF91A974F03 ZAKIYYAH.WEBB
438,360,171 *2C63B287353388E1CC27AFCDD33E2F3483FA171E 7SINGERBUNNY
438,360,172 *2C63F803BED283B922E9C2D26E46181471A46E15 7SOZIOLOG
438,360,173 *2C6BCF1D7DF051C700840995A2110192F3F867DA 7TONNIINNOT
438,360,174 *2C6D994BDA48B894F510243DD83386FD0D0933AF 7.tynk
438,360,175 *2C6CE8D85E3C8DBA56D54B6F69AF1423CEE59254 7ungranulated
438,360,176 *2C69552400B3417E4BE02DD01EC313D157AC14C3 ZBB
438,360,177 *2C6710DCF189B73566873E5A0A5F01299425E96F [email protected]
438,360,178 *2C65F2CD588DEF297EBDD96EB42220A46823BBF8 CROCKETTJ
438,360,179 *2C69110D22FAABFDE098067597DD8165CBE9F094 CRTQRNS2
438,360,180 *2C6B91AC157329924A7F238D17E6616CB7801C70 ct&bb
438,360,181 *2C678AA01A9B6E2FD351FB697D102C37E1D1D0B8 8AUGUST1880
438,360,182 *2C67A0A81580F0AE52AD9740C02C9F05C709FCDF 8BSWVBELLWAITBSW
438,360,183 *2C61616B4C7C06A70ABC78313B089BDB740F5186 8ENGRANERARA
438,360,184 *2C6DE8838F6CA0F250B18A3BD3AFDFB437B0D83E 8ETABLERINGSUDGIFTER
438,360,185 *2C6EBDC4C14DDE372D8B46CEEE60392B3483D9A4 [email protected]
438,360,186 *2C67AB94516D0C07FB23A641DF8C1657555A6E24 [email protected]
438,360,187 *2C677228C18FA6048C380BD1A2C29F96F21CDDBC cuveriez.
438,360,188 *2C6CFD965EF9C10AE4CB6B1A1B1A350275FC2AD1 ZWENDELARIJS4
438,360,189 *2C6EA23064758B8DA6585300581013E1A0335E0D cxv45
438,360,190 *2C6265509E222E4310A6E2D018299BE50C4C24B3 [email protected]
438,360,191 *2C65A2F104BC6BD50AC775B7A94399471C8D5C85 ÞROSKAÐUR
438,360,192 *2C64D05AA5F451A0FF2C93ED013E30CF811778D1 CY&S
438,360,193 *2C6DBA2FDAC782D2CB5E7B8B947EE61779DDC693 8PANTERANOTHING
438,360,194 *2C65E8FFB752B0F9411C19948CE3A7A2965CF880 αραβικά
438,360,195 *2C68C951C2F0216D6A5A3942591B81CCEFBA46C3 ΛΕΜΟΎ
438,360,196 *2C65431B306530E3E37F38854D2CB362FBECB094 [email protected]
438,360,197 *2C6D0277C751FBA27AE4F726DC0748B2323DEEB7 d4kg,
438,360,198 *2C6D639D80ED142F3EFBB9A4EB2E33AA54DC6AD7 d%.6
438,360,199 *2C610DE60E83FB5BDA142033AE13344C0CEEA132 городец»
438,360,200 *2C6AAEF08B843C2A4DC35275CD13958BC415959F d9az
438,360,201 *2C603129424692797C46E71F14D1E47D22EB23D6 Da";
438,360,202 *2C628B4EAD9DDB1513C11C3A8D23E0EF33DADCFF 954292 ' NIN CEVABINI ARAMAMALI
438,360,203 *2C65B9C33B7CAF5C45333F858728F3B503348556 9ALLAFNA
438,360,204 *2C65D2CF64D371528BD1BA40E4176DA401D642E8 ПАТРЫЯТЫЧНЫМ
438,360,205 *2C62B88A15A9D1CCF598CB9A53C679F97A46140E питейна
438,360,206 *2C6AC3438BA5826E743FA8E06E19BA0D3BAED96F 9ILUVCOWS4
438,360,207 *2C6CA18A7C99EC0A6A6EBF256369193A155E5F77 DANIALSMIGIEL
438,360,208 *2C614E2689177989A17B7CC11A7C5EA5015BCE24 DANILO.MALKIN
438,360,209 *2C613D27779D5841FD4F1EFCEB663267DCC3D143 DANILOMCFERRON
438,360,210 *2C6F9615140F1EF61F273FFBDAE1C6916AC90D2A  ПАРИКОВ
438,360,211 *2C6D1516C55B16B2CB0BFA9DC53BBA9F930B08B2 DAS-KANN-MAN-LERNEN
438,360,212 *2C668EEB7D47528BE5A4D129F11B3611FF1FC4B3 二重REDI
438,360,213 *2C63F6D326797A7309D1AEB7358CFEBF5CC98908 9URBAKENS
438,360,214 *2C6F5DF6D97462DB0313495DB5221815D85E27E5 9VENUSANDY
438,360,215 *2C66A61300DCD7C46A1FCEE44268B54374EB650D DB84F1697C9979A605CA74CEDBA13BF5
438,360,216 *2C6A795EA2C929CD290B31CB2B993553CCC9B1B0 A0.TD
438,360,217 *2C6BE6CB660F203F0100A8F59A2EA154FD5CA1BD d?d6
438,360,218 *2C64F5B79644865D47803986A9621964B8A772CB DELBERTBUCHOLZ
438,360,219 *2C6FABC11F1B8C3D92BC4439FD65720F25D2CCCE DELMER.HOLLINGSHED
438,360,220 *2C6CFF46EF3D6796582854E62FB0318E4B991C5B aaa*k/
438,360,221 *2C63E7044BB43CF055AED0747C28589FD3D021C0 DEMYTHOLOGISATION.
438,360,222 *2C6D5741AA9BCE754CBF7430A5F814679021E5D2 AABSAPNIED
438,360,223 *2C65169B26EC26936AD184C585F949D161004D81 AACZXT
438,360,224 *2C6D1815F1788FD560A5F71150EB0CA0D15327D7 aa=O
438,360,225 *2C6D54AE577F2F67370FC31BE1EE9810C0F582FA DFS/"
438,360,226 *2C6D25ED32AB831EF90B8E76CD9D57F1D043EEA2 D%I6
438,360,227 *2C65760406B411790FF639199C909164201987DC DILLON.SILEO
438,360,228 *2C6E90180984EC28F6B2FA41BA3A61C5B85DDE6F ABSURDITY.BIZ
438,360,229 *2C6CD201BA96E51B9466865E8584697DC996F354 [email protected]
438,360,230 *2C63F490EEC3888BE948CBA3FDF8ADAF425160B6 ACCEPA
438,360,231 *2C646C236C5539809030755DBEA2FF06FC964B09 ACOEI
438,360,232 *2C6F9E9EB342402DE57F53E57C0E6957C224BB88 ACTIEPLANNEN1
438,360,233 *2C6A142B2652C069E463C006FB21D3E7D5EDEABE ACWFS
438,360,234 *2C62F10A6560B53F53B992332E0F893AC60CD7CD AD(G
438,360,235 *2C63113842D4F2F2751AC63933271EE9DAA3D48A ADOLPHA5
438,360,236 *2C647DFEC237BE3FEE2A6E3F6B4A0BC780A6AACA AD$ZM
438,360,237 *2C610A14A5DE64167201FE681D9669497876A6C0 [email protected]
438,360,238 *2C6E01AEB66EB5D6910FCD0073664E1670A52827 AGONACDR
438,360,239 *2C60708BBD8AD7CF3D6E6998165C19DDCF036836 AGRICOLT2
438,360,240 *2C6E0D0FA08EC115D64D7F2661F15650B5206039 [email protected]
438,360,241 *2C6F8345D7E37FB084ABFA25F20AF9E72880226F ahmedflamio
438,360,242 *2C6602656013A9A4EB4E9407298E6F42E9D75D4C AIBARTHA8
438,360,243 *2C63207DBBDF7243742625515A2DD1C1D2DBB1D8 AII4Q
438,360,244 *2C6505BDF05D238266B3898920EBEF5609199438 A_.KD
438,360,245 *2C6AE8971CCD691A2F84A04BA4ADD05F980722D9 DRUSUSKASTELL
438,360,246 *2C6BD376C399D590C054162A0FD1BE008F81DBD4 11518 `next'ileyuklemeyibaslatin.
438,360,247 *2C66401BA4996E6BE4AF0444CD300FD56F589093 d.st,
438,360,248 *2C6A9AEF4D00C6AC9AB89659254700AE5BCEB528 1198064 arkin.verkostoon.kuuluvat.kansanl
438,360,249 *2C6B63FB3761070E9174F08973C1E4B7B468493D 11-BEA'S
438,360,250 *2C63A4033FE4ABBEB69B2C8E4FC960AF7D143A50 11 lefkose'nin
438,360,251 *2C6658FA5A6E27433389F63C8DBE56CF7188A7D1 dt:f%
438,360,252 *2C6CBE58348EDE7992D05287BB76822274BDF936 12650 bunu-anlamak-Cok-gUC-.
438,360,253 *2C6FB485ADE4E5471F3D5473AD54BA52D6E739F2 a/l"i
438,360,254 *2C67DFCB4BD9A039DEBD6C4AE81874C59DCA04E1 alonzoandeson
438,360,255 *2C69C0E91930527128C22CE1D3C5A6997BB420B5 DUNCANCANUPP
438,360,256 *2C671B5FC002E446D8D4629EE52D00BE80E51A81 aluminum carbide
438,360,257 *2C6D5AFD2EEC7824F4278453FCFCCB818A4EFCEA a,mam
438,360,258 *2C607A6738F275044890A2077FE3C65F13DC18D8 1517392 j
438,360,259 *2C60EC3C5520A54E29054FB39A21AA06DEFDA499 AMENO (RADIO EDIT)
438,360,260 *2C63F078C2373FB270066FE666D7EBE3E5B4747D DYLANMOXHAM
438,360,261 *2C67E9337D6A73E39D5B6709B034799B40125488 d?z!
438,360,262 *2C6DE4E70B969918677C5BB128BCA2D0320F1905 1604018 ohjelmassa k
438,360,263 *2C6E4F97F2615C5284A200BCD5436B66A8B63755 E080984
438,360,264 *2C6A91E91AA38FBAE54EE99D50682C2FB0AFD948 1872419 chali osti auton 1997 ja kunnosti sen t
438,360,265 *2C66B2CDED20070FFECB73C4FC3688A620D24CCB ANDREAKAPPLER
438,360,266 *2C6ACEEC5CF95CCDC855868227673FCCE633350C ec+,,
438,360,267 *2C6B94404E696D860F4095BEE650876F4479B0A6 ECOUDLN123
438,360,268 *2C6927336E87696320017730C6B291A7C39F0C4B andreschildes
438,360,269 *2C6F4D8F147D31C6D1DEF26426C1451027CC67BE 19-Horas
438,360,270 *2C6B2DC87949125DEACDF02CF82B37D673B22FAE ANDYPIER
438,360,271 *2C68A706B01AE1A7D7B9E41E9E3A815F2A9BF09E 1antistrophal
438,360,272 *2C6575711C52AACB2553FA2FB2B64BB3D3089862 ANGELINA CROWE
438,360,273 *2C6A5A62B37459744EC991699EF0ACEB98D07C9F 1begehrlichkeitsstories
438,360,274 *2C688E4AFF3B4C58C4C058351FB9D3B26A73B92B ANGELS-CRY-(LIVE-ACOUSTIC-AT-FNAC,-FRANCE)
438,360,275 *2C6F17694062F563DA11928E81D480C6AD35D20B 1Cukurova'nin
438,360,276 *2C670E80A8A9ADC3AA674C0676FADFBB8DE3E44D 1 EARLSFORT
438,360,277 *2C6E5060DFACDC456B520B7A0B51DDC2D8D18BF9 1.ghosthunting
438,360,278 *2C68CB2043336101C0F95FF974C3C2811FE2404C EG(V
438,360,279 *2C6CB7B2E9D21605ABE0506FC28707B7DF9A20F4 1.karceliktas
438,360,280 *2C6A6FC592B28079884F3150F11451FA45B81769 ANTIONE.DREHS
438,360,281 *2C65A36C14D0FAA25BCD0D49B190F67222273328 EKILREKC
438,360,282 *2C630534700492485CB6DC705B283BE9410E2547 ekysd
438,360,283 *2C6B425ECDF93C3C3C0D35FAB335E7394E856ADD 1kisintisiz
438,360,284 *2C6CC9DF307EE3DE18A93C8BA814F7C0CA32FE71 1kotkank
438,360,285 *2C6729B2E1F00F6AE0E2036CF62259A260BAD325 1 lpperiode
438,360,286 *2C6BA595141C7DAF9958F8D277C0FA268D0BCCA9 ANTONYSAMICK
438,360,287 *2C6A5BA07131B49C7247E2E1995814877F13D6C8 1 MOS-VORSITZENDER
438,360,288 *2C6721BFE6032BFAA2FD71AA3DEF81736B803A7D 1MYBEN1
438,360,289 *2C6A732D863294EFD9C002590E3E9037824D04EA ANUKRITISHRESTHA
438,360,290 *2C6614AE154B1CB737884F88569C410BD8A71A21 1 RUBY-SPEARS
438,360,291 *2C61F798AF996A0532050C02147F3BF4EF41F534 aq$ae
438,360,292 *2C6BFF3D80ED020DD27E9FEECFD356373D71F5AC .araaa
438,360,293 *2C6D6C9FB08E5B4DD112B94D8FF2FDA90EB60C2C ENROULEREZ2
438,360,294 *2C6901559BD1D00E8FCB8E756377F1579E19916F eoxj
438,360,295 *2C64FF0A7DE132C28F75AB1A937A22007EA6A4CC A;RGW
438,360,296 *2C6E7EB05E82A953CD1F89BAA6FA5CFAD877364C er5dw
438,360,297 *2C6DDAC74E4F7D0B1773A77B675CFB1B296764D2 arturoseemann
438,360,298 *2C63021C4B9B2D089EFD30CEB86C7EB44B01257F ASA.GAUDIO
438,360,299 *2C65089E10A519D2F720ED28D5CEDDF5D1A9FF6B ASESINATO EN BEVERLY HILLS
438,360,300 *2C6B53BE1D008059CD8FEB1486CAF470C1BE7F74 20NUMIDIE
438,360,301 *2C6131F12EF813F636FA1B3E596BF52AE023D5BB esuuykok8
438,360,302 *2C634CB2458D551A34F7E4A641F53569CD3D2771 asseltsa
438,360,303 *2C6A5AAAC37284781289C123F0CF47A75B53B356 ASTHLEBV
438,360,304 *2C6CFEE784D9FDCC025ADAF518D5DC5DB240A586 as#;z
438,360,305 *2C616BA3FE464D342C9B923FD2649C7548969177 eull
438,360,306 *2C6C8FD9E0D37A0245853B58EFA44034B050D590 eussiyag3
438,360,307 *2C64640AA26EA198CE22D36A8565544C837D8E7E even.lemmy.sometimes.sleeps
438,360,308 *2C6A29E8A0089C78A57DB25E614B51451F3934E9 EXAMINE PUT.QUESTIONS.TO
438,360,309 *2C640612A0756C16F6CFDC10733A5FE58C9EE5C7 EXTERNOPTS
438,360,310 *2C6E8D55CAAB2C6545F801F0F427A3A9D4D3CBBA aut!
438,360,311 *2C63C2D29AC9B98C33819F93109D803FBB92F89E 28may1051
438,360,312 *2C63A3B4E81D5BB50D36EE7EE07FA2B3FD7A93B4 avezvous kaskelainen?
438,360,313 *2C602106CB17BC42A673D14E8F940BC749900FB8 2.DELILAH
438,360,314 *2C6C673482960632788B90C170CA08701CFDD098 AVREAGERE1
438,360,315 *2C61A4F4330BBD330AB31E99412D3F591A9F65E5 avwk&
438,360,316 *2C6253479E21C4D7016E6CE43F77CEA5AB1EF9E4 2FUGAVOS
438,360,317 *2C61D5E496C4CF1E7829578C81233440D34279DC 2fvpl
438,360,318 *2C61F2D33F17BD8DC4480B1C89593A1DAA0BD6B6 AWFOE
438,360,319 *2C6DEC9F98D7A86143E3066588A7262BF0F85B30 fghndiy3mx
438,360,320 *2C64DD8D9ED9F944697779CB2A80220D51B2B7CC [email protected]
438,360,321 *2C6EC120B1F20A8811F9361E25301C486C51D518 FILMINPS
438,360,322 *2C6010458ADD378FE39DF388AECA4A1691810C92 B131797
438,360,323 *2C6E196EB6996CFB7B2A1CEEC6263E7922B7DD9E B28I
438,360,324 *2C635BB63CD5E01FE44A065C778C0A2B3469DF82 b(67u
438,360,325 *2C658E0C829F32174ACD9209AB2312892E8F6364 b8cfd
438,360,326 *2C6CA187E72768A8E29C549A800B0462FC16D5AB b9o=9
438,360,327 *2C6253E1C4BB0DF8D8B8C7ADE141C51558C28A98 b9&w
438,360,328 *2C61393708A494BA70EF2F2CD762762C4079D9F3 FLORIN_FALCONHAND
438,360,329 *2C657193A2184EDDE5559AA9BA174872843F2A34 BADBOYBG
438,360,330 *2C6AC888745249438102528AACE20ECA5E1889BD FMPSBSW6
438,360,331 *2C62683C5F88E07F3D142F6C47A6765EBDC26BFA 3EIDINOW
438,360,332 *2C6BC54D13AAF92DE319E740EDBFAA3D834EE1D6 3ETTHCULT
438,360,333 *2C6479320DD133AEE9F16ECAD221FCDAFC8B0EB1 [email protected]
438,360,334 *2C6CF8366C9B3D9F80994875107F8A6F15E1052E BA;TV
438,360,335 *2C68261630D9C994F457ACB1FB425EE78B84CF9B [email protected]
438,360,336 *2C64833B832EA42BAEA87027476C59C9C81CB3FB frederickloecken
438,360,337 *2C6EB0181C114DBFD7FCA120631B9E948866B2AD FREMDEINSCHLÜSSEN
438,360,338 *2C6CA2841AADB36AB50FB970E9A64F6680AC06DB FRUMENTY
438,360,339 *2C6BA045956FE886C27B6AAB654318873185D0E8 GA5JS
438,360,340 *2C6072FB9E367FDFCF7DBB612D50872FAD8FF3B4 GANTTAKESMICHAEL
438,360,341 *2C6E826FC674756C166E94D088072FCE578E059D 4CHORREES
438,360,342 *2C6FA19F0DEAFEBB86EA5FE6BFBABE2DAD1AA63F GARFIELD-AJA
438,360,343 *2C6C6F39CB2D4A913DBF16D3CE1938704E52FF28 BERNARDO.DEBLIECK
438,360,344 *2C67FF4B90A398351E0974784E9A3BB4F8D63409 4EVENERS
438,360,345 *2C65A5D8C3D6842325B8160075C1B2ECD5B53C2B bestiel
438,360,346 *2C6537CF82B15A4BD4B210339D9BE8E51FFB7BBC BETTYJO69
438,360,347 *2C6E7215F14F8ABD1E37754B5BD898E7B3747554 4kf
438,360,348 *2C6116CA88ECA6E684574174071D03EE5F2B7C00 4.lesekasten
438,360,349 *2C6DC7D3078BCAAF8EA3406FA8720187DFE1E3A7 GDEVITO123
438,360,350 *2C684568537A551C709857FB36E068B351382C13 4NATCURTIS
438,360,351 *2C699EDA5337C17CA6C1F22F00CDAEE2A73D0CA3 GENE.HORVATH
438,360,352 *2C63A8B593B3BFCA507DA12CF7DE23290B586649 4REAREMYCE
438,360,353 *2C689DE59FDBEB977D9B0F9F47A5891EFD6DB509 4REWAXESES
438,360,354 *2C6E39B6905F097DB24DF76D3C961BFF2EA77A5F 4RICARDIANISMS
438,360,355 *2C66F2AC9719A0557898DA7AE1EEC241BA3A1BE5 bhn!j
438,360,356 *2C60807958B5086BE166FA38720B1613FDC9A338 GEORGE WINGFIELD
438,360,357 *2C6A354CF4CAB71EBEA5D2C0BA8A5B3C30723806 [email protected]
438,360,358 *2C6AF419635D96F22A735EDC517F7A102BD34AC0 BILLIEYAMPOLSKY
438,360,359 *2C675896E1BA9C21469BC9C3976811C8638EA95F gerrybattko
438,360,360 *2C6A3C82948C8636A465B54965992D6524700082 bingoboy5
438,360,361 *2C6D716823D4028E5CBE8F15368EE0C944279BFE GERRYKUDZMA
438,360,362 *2C6CA017FCE3CFB7669D7AC7521061FE6DE7D947 gettingthefearlastsaluteflip
438,360,363 *2C608AE025E4EB081411492CA51A996AF2002950 GINNENDE7
438,360,364 *2C6224AF99052A779E1ECB504E0213C95C96BFC8 blaineamsler
438,360,365 *2C6392B2D0BC422C375F195176EC1D7477C15037 GLESSNER123
438,360,366 *2C6BAE3FDE31FBCCFAC9342C7523D95BF81A8839 bm2ya
438,360,367 *2C606D38F29589A1A5F9E11252E6904FD087A490 -GNUM SOURCE-ROUTINGPOINTER:4,8,12,\N\
438,360,368 *2C6692451A1E6679FBEA0BC9BD4E61667091A568 [email protected]
438,360,369 *2C654D4DB24B8BA680512A177EE83EC028A6929A GONZALO.BIGNESS
438,360,370 *2C6AA5DD450013091E81A2B28FE4321425CC522F bndew
438,360,371 *2C6A736A84B164FFD772EF60DFDCF1032973E6D2 granthaubrick
438,360,372 *2C64C31ACF924CCAA537B3AA9363F5E2331B814B bnj2
438,360,373 *2C64A93992B01FBE126D2A94D03C7B5471C12436 gregoryveroba
438,360,374 *2C6A59536EAA78F9861860B83A54D38B05E32BE1 GREINERS6
438,360,375 *2C6C4D555B6BE34626CF4C247C303A7E9D58E29C GRENSDISTRICTSCOMMANDO
438,360,376 *2C6BB58EE3A9976FED2AFB04070CB25B69C72EC8 BOFV%
438,360,377 *2C64617D7F0FD334DE17D432A9BB90158479F64A BONITA.HUBER
438,360,378 *2C66F19BF913CBFEF249069223E90F46EC0130F4 [email protected]
438,360,379 *2C64B7C0C450C89D054D1EEB7467FEFDD2ADBA7A [email protected]
438,360,380 *2C63009961357B32146DBB3C5AF29FC2187ED8A3 BOULTELL
438,360,381 *2C6B409BCF1DE243A2FD893553B0EB2B2550FFBE HANK.COPELAND
438,360,382 *2C6B9A33B52DF00675307FED7DC01BE0952C663B 5SSATIBUD
438,360,383 *2C6E0AA2F1AD651C717955205BC05D83E7AEA056 bradfordscampoli
438,360,384 *2C61FF3F3FEA2BF886314DD4A4C4CA4C7EC4F398 5TBRIWRE
438,360,385 *2C623A306FEE53D3EED66F372895DD6713CC7EB4 hatizur-1
438,360,386 *2C61B19E4E6ABA30A0293460154DD6BDCBC5887B 5THOWTHYNGE
438,360,387 *2C63BEA5FE2D2E4200D6FF5652579794AAF016FA 5TSNENNOT
438,360,388 *2C6DDD0CFF86592AD2AF34D573FDBC5B42B47AC6 brandenzettel
438,360,389 *2C65185A65F6250DA6F4D2A4739DB31990ECD2F4 BRÄUSTÜBERL“
438,360,390 *2C6865D4C1BA17FCA72D9D88FED3A60502AAB44E bronchiectasis-,br/A//N/k/i/'/E/kt/@/s/I/s
438,360,391 *2C621DD55486BAFC5E4E2185AD9BCE5E970CF31F HENNINGOBERHOLZER
438,360,392 *2C6F7828BF840B2450FD4E491DF4F7279A1D6473 highway.patrol.(a)
438,360,393 *2C6364C586EB5D0802E1F1DCBD42713B8BEBFBEE HILASAMAH
438,360,394 *2C6FA22460AB386FC46E12C98C7A99F8769F1ACF 6ALKUPUOLEEN
438,360,395 *2C6BF494EA149AB42B221FECBB8C883A942E9823 bsfr
438,360,396 *2C6D91C03A4F31F7A7B3239B1E2DAF8D5DFB1B47 B##)-`~-`~-SPLAT
438,360,397 *2C6ED644FC2C06230479D359D4808DD3820CE7CE BSWRPINNINGBSW
438,360,398 *2C605D8F685CB0D62CF4E1A97798CB3CA6ECD4CE hoffmannjorgensen
438,360,399 *2C614D805DFFFF7A53E726876A65A3B3551F9D28 bt2z:
438,360,400 *2C652D51160D9EA645DC36BAB95836FCEDB42B44 HOLLISZACHARY
438,360,401 *2C68F12E443A8D298EE0A07D11909553A331A3B0 HOMEREAN8
438,360,402 *2C6707D1F55C64761824B367F5614AF1ECCA6E52 buddymckeone
438,360,403 *2C63ED6C0BE46815A486A731EE2FD71711A328B9 HORACIO.CRAFTS
438,360,404 *2C663F175F09784C222A6B9EAC5DC94B2A0B353D 6ILOVEYOUPORTER
438,360,405 *2C638110568CC996431378BEF3DCD71AD822134B 6ISTIVETO
438,360,406 *2C60DFC83CFA402D8B74A6BAF7688E4AC023D559 6JUN1190
438,360,407 *2C6B79652483CF5483304F82337B62032F741020 6POSTERGACION
438,360,408 *2C6DADA655041F334009F45CC662C2480E9397AB 6PRELUDES&FUGUES:PRELUDEANDFUGUEINBMINOR,BWV544PRELUDE
438,360,409 *2C68B77498BBC6C978A25175ED9F6CE1C206C18F HPALLEGODA
438,360,410 *2C6E9F7C5090EF00728DF84B5E998BE0276C3F29 HSMITHS8
438,360,411 *2C695C8702C3555EF2C03664D84BE9B2DCDF5C69 bv-
438,360,412 *2C6929555E623F245EA72E0A2011885F9244BE23 b)&w3
438,360,413 *2C6509C2EFBB1F0E9A50D6CF889F77A7C9BFF54E hud»
438,360,414 *2C6CC64237217F7D48041B8BE7D0325F34E49299 76.INVENTOR
438,360,415 *2C6AB89741CB77781734FB5315E93907766EB78F B$YD6
438,360,416 *2C607626E167D30A6C0D5E955C1966498E953C1F BYRON.MORANDO
438,360,417 *2C6607F6CFE89E407A1A9723F4E6E2759CEB5E88 bythedoor
438,360,418 *2C6C4D969EA28332F231A8722521D35A9C20E705 BZVT4
438,360,419 *2C60624D6AC8B59A73DF1C92F408941A7F540145 7.ENSIAPUKURSSEJA
438,360,420 *2C61953F3E43CFEE8574021869C9BB84DB31DFB2 h'wh
438,360,421 *2C68DB6CEA04732A783D30AA44F78C136E98C1F8 7MADDOCKNATHAN
438,360,422 *2C6759A701D606B512BC083A5B25A5B26800E3F8 7NMGNBLNSS
438,360,423 *2C636247B7AE7A22047F20C904F2042E724E35EE IAREPPOT7
438,360,424 *2C6165EA90CCE69B1441513F47DC7BF4141B3680 IDIWMATAS
438,360,425 *2C69C82C2F9CDD41CFA546858B44F7EF9985F49E c6j#a
438,360,426 *2C6ABDF6F0C926F94E54E2857E21C6EE8C7BCF82 ILAIXAIB
438,360,427 *2C6A486AF11549F584A93B4A21AA918AA0B681EF c9$rc
438,360,428 *2C6DF44FA2DF756821365CFF4EAE3AC131FEBF64 8=B.`.Splat!
438,360,429 *2C61B76FDCDF2A3C6C04E206964F0B6FF38534A8 CALI-GIBSON
438,360,430 *2C61A7091B1B7F42636F6DB71A6CD795C673FFD8 8---d.~o)0(
438,360,431 *2C6EB41BCE0342CA0E303856B9433B8D43F95CDD CAPTCAPTING
438,360,432 *2C6FD8EE3A70EE5EDDB50D2F51382AB25EAA75BC $CARICHIN0
438,360,433 *2C6F4121C3D772C22900096019A76C09840A9B17 8HEISSBLTIGE
438,360,434 *2C6E6A3E3EAE0633A1D3F9D11FC13408BBF3E9C7 8iamironman8
438,360,435 *2C67F949D9347B5F8431CA7CA8F58E710E91FCC2 8.L
438,360,436 *2C6BD06666B442B15BAEC6F9E33019198185A5B0 8LEINOHTLIG
438,360,437 *2C6720F2BED8C3954CCFD0CE5F5452E98FD773DB I'MNOTANYONE(FEAT.SAMMYDAVISJR.)
438,360,438 *2C6338898C3552FAE53BD18DCF5D8826A47F5FFD 8MOSSELTJES
438,360,439 *2C6C81E82D14E2807A91E9007E721CED04974FF6 CARUGGERO
438,360,440 *2C6001E3A0510BC9B63FD4238BDB5C6121826353 [email protected]~o splat!!
438,360,441 *2C6F8B3DF86728848366FDE1A2179D8A21833ECC cbcv%
438,360,442 *2C6683BAEA90E6854BEEFCCF87916F66B5A14F01 8SASIAIN
438,360,443 *2C6041038B847C145616DB8A38964B0259D54B7C c-ck"
438,360,444 *2C6918AE0C24557ED4412D6AB02C2C52E017105F 8TIGERCHRIS
438,360,445 *2C6275245256A7DC427866CD84DA45B24B1D3A38 8YARABBUS
438,360,446 *2C6B908AEA72DE6E3636C9DA7F536CE2161D93DE 90pxjtjr
438,360,447 *2C6A420484E3C6B8A179EFE4DB405DC0D53EC801 irishsetter029
438,360,448 *2C67DD16579C5CB73F703E032CF2BA0D2FD1AFE4 IRVINMRACEK
438,360,449 *2C6F82E4329B68616F16EF20BC53E4778B9A2B35 9AFBONSSNOBFA
438,360,450 *2C6B72BEBC7A39EE0ACAF9DAB4B6E0BD7F8F3A0B ISIDRO.RADLOFF
438,360,451 *2C686D8E436154F60288DAD87B932D77CA143FB4 9DEVICEMETHODMETHODOLOGYMODEMODE
438,360,452 *2C653468293991C44DAADFDD7197284B21FBCFDB 9EXBOTSCHAFTER
438,360,453 *2C63493DF1CF44C4AFC04C2D35DD053F4E00B3D6 cfn56
438,360,454 *2C6940C63897B3658D28DF5DBE137517E9C60D62 9HAWKEYEPSALMS
438,360,455 *2C6975B8BCB4B9B3193407891B774A7847E83F91 $ch00l-tr
438,360,456 *2C6908602BCA77FE889F1F3F2BEB025068E16F3C ITDOESN'TMATTERWHERE,JUSTDRIVE
438,360,457 *2C6E0B5258F598EBBD7870D9EE5AE57E8F14044E 9IZNEVJERITE
438,360,458 *2C6A2D5581F6A5B781B0E0921EDC44E0B98B0C28 i(/y
438,360,459 *2C61B6796DD5F1EB2B5B749A9620A029D6E5AF22 9MARKOVICI
438,360,460 *2C6C304F3B637E6B459B8B760A7B145470CE157B 9mysquash9
438,360,461 *2C6EEAD30F856DADE4FA4DC3C88AAF0CD115EDBA jaconda6
438,360,462 *2C6BC62BC8E7D4ADC45FFF3749C5401678338EA8 9SELJAKANJIMA
438,360,463 *2C6D7184AC737E8FC028C3112389B2C8D97D5A95 JARRED.LYNCH
438,360,464 *2C65CDFAC38F09C1AE288B48B0EFE5F411E194B1 CHRIS_NGUYEN81
438,360,465 *2C6FD41A6888F9DF91C8045C1084CAD87204A62C 9UNDERFOOTTRIP
438,360,466 *2C6C7FE2ED39F87353A8C64E825489F6CC6AAD44 A;)
438,360,467 *2C6238BC935C7584AC0769862FCFAE6C1AB4BB84 JEANNE CONNER
438,360,468 *2C69D2BE3945141249CF4D1D233D66F21857D08C CHROMEDBIRD
438,360,469 *2C6B6D7C53FAA35045A1B708E15C57E0DD74A47F a#34f
438,360,470 *2C6B7FC9B393FBDA34AD291C406467142D7DB830 [email protected]
438,360,471 *2C68AE362D75534DF5DE5DAB1F92EC9F32AA010B c}_i
438,360,472 *2C61C1931C8DA6547561F79C4CDCD83863EAA562 JEROMEWHANG
438,360,473 *2C643C86EEC91F3AC4932B5DC21CFEDBCC14E86C jerpen
438,360,474 *2C64EEB56CE9DAC41E20D8BB3116B495C8FA0B38 CJE4S
438,360,475 *2C699AD473353E9D488C99D2B100509D999C792D JEWELL.LI
438,360,476 *2C6F427073FEC474A1CC6D2441AC4E14105F9CE9 cl0,1
438,360,477 *2C6EE853D7E9EE711E03553B32CC8ABD0B541EF5 AAD6%!
438,360,478 *2C67142A492E67B38A48D3AFD47A33F210DE386C AADSFX
438,360,479 *2C611A22969AB9CE8BA1760A71A5C564FED2B7EE JN=G
438,360,480 *2C6F2E511A5DB6EB72076940302874C519078312 ABK.Y
438,360,481 *2C66B40089330FE35684B8359280E3E8A31018B4 abstinuerint9
438,360,482 *2C6566AD003A1A97B6790B5180415353A241736C JOSH.ENG
438,360,483 *2C607C6DB4B73B7FEB60713F45064930BCA65EF2 AC64U2NV
438,360,484 *2C600B535BFE3AB04D8723835E9AB09AA6599C51 COLTONCATHERSON
438,360,485 *2C6DDD5E50EA28FE8325D2CEFBA73AB99A616336 com35+1b13
438,360,486 *2C6A90B53A25EC8977AD867B81B21BF8B70AB34B judicielles
438,360,487 *2C6C21A4F5307B55046CB9E0B67781A4BF08380E [email protected]
438,360,488 *2C6346B7EBC1189B868CAEE89E893E599A2BD703 COMPSOP…
438,360,489 *2C6646742BB42A529030651B7D9D6C714D7EF3E5 JULES.BRENSINGER
438,360,490 *2C6F3B3759F7C4C6A54288CFD9048BA733626676 juniorsoshnik
438,360,491 *2C6A6468D2385D25E2D95B589BD9EB65BB5C1174 ACIDULI
438,360,492 *2C68A46497ACFFC3CB64AE71351A2EBB267E78FD CONVOCEERDE3
438,360,493 *2C6A036C9A83291CED7899801DC3AD8B4A9C85F9 kaishibbs
438,360,494 *2C6620AB8D110309B346BDABF371EC9374C6A860 corde3
438,360,495 *2C64C45732218D8DA2FAFDA6F4E04EF2F0AFB9A0 CORTO-CIRCUITO
438,360,496 *2C61CA5374A7958C2B947ED969A800E18BAB1DCF CP%5G
438,360,497 *2C6E273B258E59EE71D8A83C7C4FD5C2682F8334 CRIMES9
438,360,498 *2C6FF5EA688C5689D9D16EAB307AA43207749EAC crqkq
438,360,499 *2C630DAEFD92D26C9A1581720679947A82B61C18 keenanginter
438,360,500 *2C65454E5B967CDD646A5618F75C8D5552BD8AFD cs)3"
438,360,501 *2C6CDC77530E18A0811D1DC46582E40ED8499CDF KENNYFARRIER
438,360,502 *2C61063AB9821FF44C29088E5904380A393B70B8 CTOLL
438,360,503 *2C65FBD7005C866E314503F64CEAA9F18839041A AIGJ
438,360,504 *2C60F19FC2E368D3E2FC01F7396BB10DD11D60C9 aivotoiminnan
438,360,505 *2C6B03FD99461ED68C5FEE9E0A91F023AD055EB0 AJD"
438,360,506 *2C6E9B3A5C5362E9BD7511DBCDB22D8D0E8BDF4A kirikkkale
438,360,507 *2C680072764E3035D48C3D4B246A1837012A5AD8 KISSMYASS826
438,360,508 *2C61B02743458A58E946137C2FFD944FBCA530D4 cytg
438,360,509 *2C622135D553205751DB31EF8DAF1B45FC394CF1 KOMUNALEBENE
438,360,510 *2C659EFF42CDF5F78EE16BC7936B8A6874292335 D4EO
438,360,511 *2C6BB6682B3B9418D7447F4EDB04821E6AC6B8E5 D6-+
438,360,512 *2C61A49FD1B76B675675506705DAE36AF42ADF67 ALLGUERA1
438,360,513 *2C6830DB49364BE2D9F3DB28AF4B34BD207318BA D8DO"
438,360,514 *2C696853E015F7A3E2FEB2A920E6E3C0BE299EBE krump98
438,360,515 *2C6A77EA95E923706680BA98425C0F2AFCE49DDC kumarbadalandabad
438,360,516 *2C63711EFB3FE4291D2E115717E5E6A233AEB1DE KUMELĪŠU
438,360,517 *2C6932A5EBC1886E7F033DED480ECF92444722E8 DA84E53392DC49AAD06405A863C23890
438,360,518 *2C6A0EF02F39EBA4CB03750C0CCC9E182CC20B3A a(lw;
438,360,519 *2C6D020B7E7DEE4339DCDAF1528C960776483CFF KVR=LDNP
438,360,520 *2C654DD45467EE3EAE01661257B6914D9970A902 ladies pay
438,360,521 *2C69AAE34E47765A2BF046DFE2A40EF2027976E7 ANB$B
438,360,522 *2C6FF7F6DFAE409CBAA4700A3949C7B1D3E97477 lanlbsw6
438,360,523 *2C689BEE83E51A646CB438BEAF7B62686C404AF0 darwindinwoodie
438,360,524 *2C6D09D63ABD11B059C7EE1E6B6A8977192742E8 latest.
438,360,525 *2C620B14374BFE05579281101101ED1ECEE41026 ANKIT KHOKHAR
438,360,526 *2C693955B8763E3847CF2143DC4178966ED83446 lemuelbacurin
438,360,527 *2C65952A4D1D9982E848166AE9B7845A373B4D3E DAVERUGGERO
438,360,528 *2C68873AD83D6BAEB06F267A4DCFE64320CBFDE5 LEN.HALLIBURTON
438,360,529 *2C6EBE45BA2BE12D765164640052408CFD5E16FE lenmango
438,360,530 *2C6C832ED65B0B6E165C84041FF2B7FEDD22C998 lenterrel
438,360,531 *2C6C7788352C205EAD83F98FCCFDB1150D317DAC DAWNSCHULZE
438,360,532 *2C6F0DAE30F10D6196002CAECD4FF89035EE028F dax.
438,360,533 *2C69D257C7A4BEC99A1D6B668711FB2C47265BAA LEPE9
438,360,534 *2C68888691072C386642E729830EC92E5F2479E9 lepenkov4
438,360,535 *2C6C730DC647BC611B29660053C61CD564F15AF9 dd?z?
438,360,536 *2C62D4032B92650DCB3FE6252819F9E8CAE1BAB4 anvi11in9
438,360,537 *2C643B0460DB9AAD8D50BAE13EDF4856CF886CFE AO61.
438,360,538 *2C6D3A3853D5BD1E2EED30C0ACF6E7D00E849494 de_av
438,360,539 *2C61A7E02BFEF02D32F39659A4CF8823226B5FEA lib3ra+or
438,360,540 *2C6C118E6FAE7D1056B09E6AC78A67674A7F8CD4 apicom
438,360,541 *2C61EDBFD51BCE82B2880E29960C6A702C42886F LINDA.SHELTON
438,360,542 *2C6D8529F8D18436249F7C2313F49CBB63B6DA7A DELTAVERONICA
438,360,543 *2C6676FA8E1869AA051D93AB3135CF77A086802E a(r+h
438,360,544 *2C69234B9B80E55DB5B68778CF60104E1A2EEDB1 lisande,.op..46:.iv..de.trenne.blinda.systrar
438,360,545 *2C66400A7C7F12A82C79B1AD709BF530F2CE8E77 ARIELFERMAN
438,360,546 *2C63A8DC0F132DD733432CE5BA7F560E23394E6D DENVER.SCHELLMAN
438,360,547 *2C6FD4E6DB687C9C6D36B7612382F43D23EEECAE [email protected]
438,360,548 *2C62815419471F02850C7C32F108A7643F51F829 [email protected]
438,360,549 *2C666281B69AEC210C7A3ACE0B1B484CA453A095 ARMIGERUS
438,360,550 *2C60101A4E2AE4CCD6F5CAA6E719CA66FB14E4F1 aronfousek
438,360,551 *2C6035D4C74E1391D12759A55D86C346B5A1E23F DESACAUTELASTE1
438,360,552 *2C662115B8553754BA73A91E7A809DEB82B98733 Desbloque
438,360,553 *2C6B1648F683AC47D4121F554D31B80F8624D69B destiny(fulllengthradiomix)
438,360,554 *2C64A4F6CF39408EEC6F9AD9713C964D6205414D devinschlussel
438,360,555 *2C6215D17DFE851C3AA9F617A8BAEECA0FA43404 deweylirette
438,360,556 *2C66AAD811661E971AAB05A470FD8C994EBBB484 deweypruss
438,360,557 *2C6AF736CE0A67C084A7C6EE9B2E23E147FB7116 asdfjkl11
438,360,558 *2C6A8A9261A0A093AED4EADE8B85F2F4DE29FE8A ASHYEKINA
438,360,559 *2C6F2363F7897E0B3D1F8F7EAE4DA11AA0B746A2 ASNAG
438,360,560 *2C6A31FA2E1FA9D9AE36CB210FF15E9B4A3EC7D5 LORENDIGEROLAMO
438,360,561 *2C6D2F5B9B5375DBF044A36B354B1AF997C4061E ASSOCIATION FOOTBALL CLUB WIMBLEDON
438,360,562 *2C6457BEC40AF47985BDD96CB7EE8B414CCDDB1F DGDC1
438,360,563 *2C61B2250009A25602135E522610618C0E14D97B A?U4U
438,360,564 *2C626B5FDBF5700EE9F712330CEB68710BB08527 DHZ7K
438,360,565 *2C61889DDCE0A182FDFA3E2830C29731AA325303 dialyses
438,360,566 *2C6B9FC99640496D8BD6FB59333B6488CEF3E4E9 [email protected]
438,360,567 *2C6F647ABE268A94DB52C4A3730FAEBC9AA6CA40 LUIS.BYNOE
438,360,568 *2C6E3B9DBE798760F9802424CE462200A6FA9C38 LUISMETZGAR
438,360,569 *2C62888A12EC38ABA138C1EA5C1850B885239F1D [email protected]
438,360,570 *2C6D8022AD23192E5D4013782C42C48EBA8A9D97 LURIDUS5
438,360,571 *2C6CDD19D6B774314B2A379E28533E99A394E8FE Diplombetriebswirt
438,360,572 *2C6897ABC2CFC872D1BC637B235881CC5A464BD6 DIVORCEDNESS1
438,360,573 *2C69571E0F0E8A6582886019849017BF87460B7B a)%zv
438,360,574 *2C68F94BFA974695055AA8540020793940248BCF b?.1
438,360,575 *2C685B1C91881EA6F0758E0199F04A9FE7BBCBBA B4YONETTIN9
438,360,576 *2C6CCD0A8CF865DD55BCE7C0ED7F50C66427E870 MAISOOGST7
438,360,577 *2C633943CA8C6999D5726CD10A916BA3026C7972 dlrei
438,360,578 *2C6CD953B04881C7691FAB569F2F85FEBEE3D0F4 mant3l3ts
438,360,579 *2C60A2A5324BE9D8C9A2ED25DBE84A5D8A88464F BAP8_
438,360,580 *2C696750B2818FE5FC60E4C3CDE35CBF713600CD BARRRENTS
438,360,581 *2C64FA0B1F2379D2539112A09032C1D7B981D10B MARCEL-LEVI
438,360,582 *2C6086C64A65986DD909E20DEA26F1B498665E48 basa1tpo
438,360,583 *2C6747ABE8750D2833CE5FF849C336D37EF8F12C MARCELOSCHEEL
438,360,584 *2C668E68153134FA28CF84FBF004AFE6E646FB07 [email protected]
438,360,585 *2C67E48D10FA9D300E5B504F414147D6F6B68FA9 MARCLOPEY
438,360,586 *2C6F3DFE0D2E55497C2442401CF370701B441BD2 DONNELLHEAGY
438,360,587 *2C6D4961F3F589549560F80B2EB8B2EF5800F13F DONTOTT:MEGVARJA.1
438,360,588 *2C6538CA7B4236989152CFA5A4FA886E2C248CFF BBFQD
438,360,589 *2C644CDB06B0CF1CA48A49E7C8B5317CF60A21BD doogiemicro
438,360,590 *2C6527F1425AFE0CB9253C11D4AB23C6029B8559 [email protected]
438,360,591 *2C6882C41AAB291CF7C5ED17A70CB107EDE02750 downand
438,360,592 *2C6ADFD8045D9EDA8557D442F3B737465AE984A8 b!c;v
438,360,593 *2C637011382665CF6DF595E1EBB3BE11E42B03F7 DPC&,
438,360,594 *2C6C8A80966884D773CBBB6DBC48090FFFB70500 DQ,IR
438,360,595 *2C67E2A7A501C2633F1BBF516FAA07782686B8B4 d/r.b
438,360,596 *2C61FA7DD29A17BFBAA0B50EA7D107670FB0550F mattswaggart
438,360,597 *2C6CAF05A6CB38C30823908BAA2C55ACD573C933 MAUKINS2
438,360,598 *2C6270CA4A94B0A55B25F3647129598A617C5F4F MAXGERES
438,360,599 *2C608BB3BE5CE06C2A7EF62D7180D7159282C45F BEJAUA
438,360,600 *2C6958052A55A143770B4F7C442006B922DB260C duanestraley
438,360,601 *2C643EAA22D6163558738972E424D992E8460F00 [email protected]
438,360,602 *2C60F22BE0626C09EB50C45159C359414AE15ECE mediclin
438,360,603 *2C69643B2BAFF610128DBFCFD5166FC811620077 MEDOVSKI
438,360,604 *2C629D9F554B226D83E1C1A7A8C277C47D6F02A8 DUDLEY.HEIDBREDER
438,360,605 *2C68D4AE00D6B94C968272004F6B9A0635207060 D%uk
438,360,606 *2C62A0E8E4DC59BA5306317F013FDDFD0E9B46C8 melissaaromin
438,360,607 *2C688BC9E020E37F70B2AFC47F9F92F96A760E46 bertpulse
438,360,608 *2C6A9E65AEC440F1DAE99070703AE68F4B97FEDC DUSTIN.CRISS
438,360,609 *2C67D419A0093FCAF73294E1A5FECB9D51C911A7 DUUA
438,360,610 *2C65C8258E8274C983C01283C5B47084D5864D44 bethmast
438,360,611 *2C695368A51A76BB3F6CF776F5DEE45CA2AA6896 [email protected]
438,360,612 *2C61B61315B6F200C7D665CA91DD0CEBA46A0480 MGNOLL
438,360,613 *2C68F712C37F4C2C0D6CD94B8647536FCDEA000C b+ic+
438,360,614 *2C65575815A5AABB80C0D42871BAE6835F39617D MICHEL.WESTLIE
438,360,615 *2C6B7341359F90EDDCE35CE9B5BF71117FD644C4 MIGUEL BOSE
438,360,616 *2C6096D0FFDBCF796AA4FE60D52652CA92635434 earnesttainter
438,360,617 *2C6C3F5BF7455D7F71F6A9CC1FCA7EA76F5D56EF BILLY.MIKULAK
438,360,618 *2C6DB0DB4F6629C274FCAA0A145B49E3B9E62580 MILAN.DELMONTE
438,360,619 *2C6E0F832EB022803280BEA06C85763F22CB7547 MILES23
438,360,620 *2C6E46EB5C71A8852C70A5D4F362C5F90324307B edi:g
438,360,621 *2C6783B5EBF0987ACF9C22C29C6F19467CFA6FEC Minor
438,360,622 *2C689396CCD398009BBFED6392F1CC8BA036333E missyou(pascalfeosedit)
438,360,623 *2C684C639175E182A5DF1566B1CA8F515B75ECD8 mitrons!
438,360,624 *2C6FCD6BEBEB2353264B9B5CD0EF232C11F0FB41 elcarretondebronco
438,360,625 *2C6DCEEE48545B3C5C6AA89E12E583C69DFB9753 ELDRIDGEKRAGE
438,360,626 *2C6D0446DBAB627A7EB26860803E2D9B98FF1BF3 MUTTISHIT
438,360,627 *2C68F0EC90202D8DF390097ECD67EC6518406189 ELFDWARF
438,360,628 *2C64EDAF89430E30718C962CB888DFFA766AB309 [email protected]
438,360,629 *2C6DA60FE80D07BB1F9D6635F4FCA4086D4974B0 BOTRAINUM
438,360,630 *2C66C45B82A6A2E74A06527A7C9762A6722DF112 ELRUMBODETUAMOR
438,360,631 *2C60BD3EEF1052F72C414D6FD1E3E30E3C2DD5CF b.&-p
438,360,632 *2C64B2023AB0192A749E13AF742BD7885DC3A935 nakia-parker
438,360,633 *2C6D65EBD39EF632AB2CB64201429E0AC5895308 nancy-kouba
438,360,634 *2C6A8C6C36FF3C173F57117AA4069506C9635E61 NAOMI-ENGLAND
438,360,635 *2C6B93E59DA7AE04D99A776DBA2886C5318E81DB B#P~.`.}O{
438,360,636 *2C6E00380EED3E9666F957DEE7324494C95A0B1E b:qrd
438,360,637 *2C685C9EA8D73446324EC1808EE7F0AC599575D0 NDRAGGINGPIECE
438,360,638 *2C6B1279AC6B90AB33FB564ABF1174D84CCD6156 bralled
438,360,639 *2C61C912FBA5B8B9D4D14520DD91734394044D6F EN12514420
438,360,640 *2C61AF7B40E6596F6178263308DC8F402D1FACC8 ENDELDARMEN3
438,360,641 *2C6A086D595A5C9B75712B420D6CAE032DC7649E NENAD-STEVANOV
438,360,642 *2C6D372F19ECE4743BF2EF4EBB4D57050FD9FFAA [email protected]
438,360,643 *2C62E0115DCDFCDADAEC6405B2FD93B87A739564 NES.LICHT.(DISC.1)
438,360,644 *2C65A64BC3D5900B65AAAC0926D6E82328690F81 neutral1ze
438,360,645 *2C633E4E9159164172E8EC20CA3434A6F119F44F nhu-quynh-phan
438,360,646 *2C6C833A822C789D61890480254CB3612D577D61 EP1CH1OROHYDR1N
438,360,647 *2C64A517C277B794B76E0E439269A5CAA5FFE7DC NICKBRODI
438,360,648 *2C62B27688A085F35BDD724F863F0DBA9E5F79BE BRYCEB3033
438,360,649 *2C68EF9F2A58C3BAAC56DBADB18C055FB575A371 niemel
438,360,650 *2C63FA2C5E63201A96B54A30FE3A96C0E0720650 BUCKAHLES
438,360,651 *2C65C9017CBE991A232CB3B8E904CA6E235EF35D noel-dimaculangan
438,360,652 *2C67973106964B2A53E082C816111D9A760F498A BUDDY.HULINGS
438,360,653 *2C6B7255A625847CD81238E07909A3124317459C NOELSLOAT
438,360,654 *2C6E0E076D8F2CAAE99169A4F9582BC48B8FCF2F bufordschoenemann
438,360,655 *2C66D107EDFBBC6B4BA1146A7E4EB4DDAFB66F3C B"UJ%
438,360,656 *2C6F132EAF80EC7CD723FB0E2938D09C3240CF72 bukto
438,360,657 *2C64BE3D41C68B106A758D84FF44CE22A97BC2AE ERWIN-DELA-ROCA
438,360,658 *2C622BB1ED077A197D716C3320351995D596B1A9 erwinzumpano
438,360,659 *2C6C24DD049E806480A1E2A250FFDE517DC324B8 noleenkellypower
438,360,660 *2C67554667E1F99BEF39EAD1E3871B7AD932375E [email protected]
438,360,661 *2C6B0268DB9A1051453672AB76A5F4E09A326C2C BURL.HAWKS
438,360,662 *2C693311A890B8FE24624A0FE80BCFA6DA5878D4 [email protected]
438,360,663 *2C65CEE7863078A21E41837E377331CC76C00ED6 eshu-
438,360,664 *2C6C5084584483EF2A166D7C26AC1EC6E7736A29 bvhvg
438,360,665 *2C64BEB795ABBAAD5DDED63C60C640F113E5D97B NSANNES
438,360,666 *2C65B8CE980F43F2C915C02B69941950EBACC77E bzv5s
438,360,667 *2C6F67673E2BDEC56034907DF27897D1894B3B76 EUROPESYPHILIS
438,360,668 *2C64C4955306CA3C0EE2E52055968C7C28BEFA79 c%_3h
438,360,669 *2C65FB0BB99BE4C1BCD9FFFB24F0DDB3E4E0F9EB EXALTADAS1
438,360,670 *2C651DE3BD1F281736189704C16F77E56685A0D1 [email protected]
438,360,671 *2C6DC98E44B066404744D7DC0D75C717ABC8572E C92676
438,360,672 *2C60042592F1019BFB9DEFB3B40A0A0E5CB46AAA [email protected]
438,360,673 *2C61047F3D84F1EFA00AC6709C86E3737F18007B ca:bp
438,360,674 *2C681F11433E0863753470A734083C5CC2B33D89 olinmitchell
438,360,675 *2C63FE7C50879E0271D96387822E55D7EB0AF546 [email protected]
438,360,676 *2C612DEBF06D814AB6AB59A2708264AD48A83FC1 [email protected]
438,360,677 *2C67A507216C2E91DD587289862068A02B1949F0 FANTASIA-SERENADE
438,360,678 *2C65D134058A899573B05A50C2C1A687C3509F78 FASHION PIXIEZ
438,360,679 *2C692E26E36191A9375B14239CADA17BD7A101F3 [email protected]
438,360,680 *2C67C44B94799AB6B741EC905888559E88A332A1 CAMERONFREEMON
438,360,681 *2C689B06CEC3DDBB2ED09C245C624AE341C44046 On Deadly Ground (feat DJ Babu)
438,360,682 *2C6F91B65D80F5262872F37B66EC8293B02F66BF oneafter909(take1and2)
438,360,683 *2C6F35B162A5D080F7EDCA04BC393A6899CB345B CANANÉÉNNE
438,360,684 *2C6A52D9FAB558AC5975BCC3B29B68EBD7E8B903 CANNONF111B2A
438,360,685 *2C6188ED0FC033289B5202CB67E0DA2F381E18C9 FAVONIANS4
438,360,686 *2C667A9D1447D95416D7F7069CC03647949E385E FDFBA460-C756-35D5-B13A-2B7DC9533822
438,360,687 *2C61874B1C6F652EA7D60BE6E0FF5A2EDBB747E1 FELIX.GEMMER
438,360,688 *2C6CF5DC2979EC19E3B04949E72EC4925061C3C5 caremepastrycomwww
438,360,689 *2C6747F9DD6C2BED94C6941E41C40BB759978F20 FERDINANDVILLON
438,360,690 *2C6E8ADA9618AFDE63E7AF6AE72EC1F5DFB3E7FF FERNANDO.BREWSTER
438,360,691 *2C61E15E973BE24E9DF4A8647EDD56BA1E72363C opgeluchten8
438,360,692 *2C6EFBBC731DC42E868A07C8ECA603540B8A1925 CARROLNIEDBALA
438,360,693 *2C6FCDEED75C267FBA6216113455685F9517DFE7 carterjobst
438,360,694 *2C67D04008DB4160B2E90D6A1C642F83F1DE5410 ORHANSOY5
438,360,695 *2C605E0735157ACB6427DFCA31CB3A44DB59D19E castile_earthk/&/'st/i/l_/[@]/r/t/
438,360,696 *2C67C855769598BFF50B2396D239C3BC42AC4921 [email protected]
438,360,697 *2C608511788A8283C6BB24933014D7B5F0E88BB3 fjf4
438,360,698 *2C62E83603DC25F02C3CC501B1CC92C54FA02A0C [email protected]
438,360,699 *2C6165F61214256C3F70DF59437606963EC7317B OVERNEGLIGENT!
438,360,700 *2C6B844AB03973DA135BF316383CA3E2ACA98C52 CBD"
438,360,701 *2C66DEB120EDC49E044BA540C80F3A2634AB147A [email protected]
438,360,702 *2C621C22A9176018188E08C30F2E09457A97BEB8 cbwa
438,360,703 *2C633D05E6139A44C483E8C61966F26355A93E5F packersswimmer
438,360,704 *2C6B541485E01AAB7777EF86F26DD7913255327B forestheacock
438,360,705 *2C6D6F459478F50E37297E8C4BEE0EB84BD5A990 panza.de.cerdo
438,360,706 *2C6BEED83FB6BBEFE9F7C9842600D3E650D1BC1B CEDRIC.HEIST
438,360,707 *2C6ABF5E41282CE16F3EA2DB782A43BC665F5253 parque.nacional.lagos.crater
438,360,708 *2C6945FF9E6A8199C46B790A00138B641377B229 FOTBALOVÝM
438,360,709 *2C6CE5A9DCA5048650A734E491E5DD3223E1AB6C FR331O4D3D
438,360,710 *2C6BB16B996C035B9B2A4FE93D1B09A9CB866912 franciscosanes
438,360,711 *2C688AD0153A5665C25A0B8D6612A7ACCD7B1ABC francisderkas
438,360,712 *2C6B36AFFDF5A2869538C6A613A0D8E609200ADE PATRICIA.WHITMIRE
438,360,713 *2C6772CF94FE50DA5ED9E7B1F8564A02C79D19A5 CF4
438,360,714 *2C69FF78F2F54F6C92684A74296D9D6E8B4BF069 fremkom!
438,360,715 *2C6911965145B20859BA809E3517394A51C2E369 frieseite
438,360,716 *2C6193A7D9ABA1BC1D27CD3876129BC2E4032A2D PERCY-FLORES
438,360,717 *2C6543867FC5BD7340ADA6603B89B89DD8BAEAE3 FRUMENTY
438,360,718 *2C677C1349F19E0B3D466E46E43FBFB59C81904E PERMUTAB1ENESS
438,360,719 *2C6C075AD8C32B8B786634A38233FE30A1785F49 f$+u10u$
438,360,720 *2C63BD52E050062DAC9E3F79074F15AD1E63E190 peterheiman
438,360,721 *2C607739145DCB7858D58922A51962BA950A5837 CHARGIONS!
438,360,722 *2C66CF2AB9C42810FC2735921E91C7DF1B25AD75 chaserahman
438,360,723 *2C6127749B409FD3438AA0AC14FBA1F541FE3EEE CHASIDEING
438,360,724 *2C6F144F126857D0BA2FE5B51B10E53028222CE9 G5{W
438,360,725 *2C665945C38A9A8D56671A34B929E88CD5246CDB GALE.BOHON
438,360,726 *2C6DBE20AF9C362923D485762EF08AA11A4F3007 [email protected]
438,360,727 *2C6023C7188036BA9032AC5A879AAD7371055CA3 CHEONA05
438,360,728 *2C68D5DB73ECC28AC11203980B6EF632D2D55D8D [email protected]
438,360,729 *2C6606BD203B0976B47A24F9063C669EECC56ED2 PINTARAFES
438,360,730 *2C6C28DBF2B10B30BA6BCA75F9B4513D130FD608 CHRISTIAN-SIMS-&-JOHN-REVOX
438,360,731 *2C6B00E0F44EACB694A529E25B6B650A108FF906 [email protected]
438,360,732 *2C6B4042BC915579B32D3EC1B37BCE578A0B26A6 cl6,0
438,360,733 *2C6FE3B640BF3525C8F110CA0E9F46521D25F5D4 GBLBUFQUO1
438,360,734 *2C6434CA9B09016789AFA782EA61A37772821238 pomoschnikova
438,360,735 *2C6296DE2B1DC25EF18BD7B2A0ECFCCA75BCC3DD pony1965
438,360,736 *2C6CCBD988284EAA6B03FCAC4B60407AE349FEAB porfiriomustin
438,360,737 *2C633B394E2B0466D81A5E5242199507528E040C CLFL
438,360,738 *2C6965B6715376AED9001F9B8B386F01C36C2C15 clintfigley
438,360,739 *2C661AE674442FBC2E97E78E56B8A3691D994BD7 clinthomen
438,360,740 *2C6CCDBB3DD6CC17D3777A25B6A7BEF1A35933AC gerardomaldenado
438,360,741 *2C6968451673DEC1F889B6873A096C3E59B2093F GERRY.TRAYNOR
438,360,742 *2C66DE3AD7818F1360298BA8A27A45C1780A6F60 p#####p~~splat
438,360,743 *2C6DA3F5C5A8F76144CEF62A4CAFEA9D8B4F8D94 pp`~`~}x{
438,360,744 *2C627343CA8108038A3DDB38513B72D3B7C3E331 GIRAZYNA1
438,360,745 *2C6E4B8A33F474EABC66B88C59B38606B0E2C45B proph3t f
438,360,746 *2C6FE52C4E68559A95E0223D727AAB663BF76239 colinargent
438,360,747 *2C618FAC5F9C3B3E8B530B4A02D991346BF0F4EF columbusvenerable
438,360,748 *2C6273B424FFB55CA4C8125F9E2842DF198730D1 CONNECTIONS.AS
438,360,749 *2C68615C10716B7F24B84700F1D7BDE03E63C098 connieneglio
438,360,750 *2C6DFCEC594A343F35588783FC12A56F0C214D27 PSA-INTERLUDE-(JAY-Z-VS.-SOUL-POSITION---STILL-LISTENING)
438,360,751 *2C6D0D3EF67B03D3C935427F9FF8F597F2D0E9AB PSAPKALE
438,360,752 *2C60420F06921FA0F442DF6933C2DBE68000D1D3 CONWAY):英国农业经济学家。
438,360,753 *2C609FF97E9465229370BDCC5A7888D76005BBD9 [email protected]
438,360,754 *2C6B8443A072DDCB1E9D343E24462CF803823C38 [email protected]
438,360,755 *2C6D6D07A0D08D8959B3E7B5B0823F1E5AB5C470 pwvogjwl9
438,360,756 *2C6C6782EE5060D1F4CDFA81270941039C109166 coukb
438,360,757 *2C6BEB5C6F585A8E824ED36C49FDE74C6C2D51F7 GOODBYE-GENO
438,360,758 *2C6A18D3221940A173462DC4E2F1F01919824271 * * *(----Q
438,360,759 *2C6E8AD0762AD86DC74F376EC71516ED2490D69A GORDON.PATEL
438,360,760 *2C6C6A7D4375FA399A018211FDCC6D7C00B01D36 GORIONIK9
438,360,761 *2C6E7CCB5ED8BD87A032F78E42013304EE8C4EA4 [email protected]
438,360,762 *2C6F220CFB9639A5CABE38E241C973AEF0F96128 QENTREPENEURS
438,360,763 *2C6E1C2B83B6440ED3BC6477AEB58812A426964C gregorio.villegas
438,360,764 *2C62BADD08ED7F8BF1859F64229EF30329CF9CEC [email protected]
438,360,765 *2C6A6CD48B55507C721571290ED511586D3DCA70 cqdk_
438,360,766 *2C67334168592E257D3095EBCC5432582ED4FB66 guajiry
438,360,767 *2C6EE3415EA421650125EBF57CF73C85FA0306AE cr8l0
438,360,768 *2C65C56ED7F3C6FEB967373383FE7D48A5C4D336 [email protected]
438,360,769 *2C6EB40E09F661C5035CFC5613AB6BEBE1B23648 QUENTINAGAR
438,360,770 *2C6F110C7F0DF5DD9CB958166D8FDD80DFD69601 GUSTAVO.MULZER
438,360,771 *2C6A6A78C0633A9C78FDE400ACF3CBF7A7D5BF4C cristopherboleware
438,360,772 *2C6EE298B49472967F3450F7218CF64D5752603D crognet6
438,360,773 *2C60F411F38DFA880DCDC4E6382E246D3D9D78E9 [email protected]
438,360,774 *2C604DD4A36B026D4AC50CD6A4F8404922982E2D G+ZK
438,360,775 *2C6EF507054327064D26CF9A14CAADF9CB330C3A ctpaq
438,360,776 *2C6AD6241FD745D4C83FD25FACAB5405461DCF4F RAFAEL.HARBERT
438,360,777 *2C674A4A9F2039E4220345D3BAA143981A968EB5 RAFAELIPSON
438,360,778 *2C64D629EF2DDD417B15DA5459E8B2B00C9A5374 HANI-KHATIB
438,360,779 *2C6F9F1460CD7C5EAA7540FB4BA0ABD7A47520B9 RAGTIMECOUNTRYJOE
438,360,780 *2C60541323FF532A6C1C3B4071AF0B29F17CAE4E RALEIGH.DUTSCHMANN
438,360,781 *2C6E9E3BE621CF1F16D53F68F4E58DC219C9BD51 HAPATSEK3
438,360,782 *2C602A51C3A60DEBF3D426801F16049AFC4B7CE9 cv7m
438,360,783 *2C6AC9CF87153173821025FEC9326E42BC96D862 cy%f
438,360,784 *2C636F4D49DDDC9AA78E639B335DA221D08A928F C)(Z
438,360,785 *2C62857C45BDEBC5BD5F19B15D5802AA1C3D0E17 d3pv
438,360,786 *2C6E36296708AC72B4962E13F915D7EA4C365FB4 REFINAREM1
438,360,787 *2C6C3014E5F388103E8EE5EF972FB00076595E0B REGGIEFENECH
438,360,788 *2C60AD0D5357AC9CF1EA09417E2D915FC05FB088 REGGIE.LISK
438,360,789 *2C6E8948CE6FBF0E09B97B9BB0A2471990CEA05A dacosta9
438,360,790 *2C6CB624DEB56D3BF0794981F3D9A84B4670B02E [email protected]
438,360,791 *2C64B4CD0BEA51516B6BD28945A86B721F8D5ADD [email protected],
438,360,792 *2C6C0EF45FB4F17DF28303FE6EBE11A1A76C48CD highlyplayable
438,360,793 *2C615F0B076B412BA17145E99376C9A9BCA33242 [email protected]
438,360,794 *2C61E4A582D80764E446EA576E4E4686755BA98B DARINNAGARAJAN
438,360,795 *2C6620FB0BB1E37E4878A4E2736FD35D9964EF23 DARIN.RIGGSBEE
438,360,796 *2C648AECE4EB2533CABA24B0500377D0BFF6B7B3 DARRELGOEDEN
438,360,797 *2C6ACFE8593F7DFDE01C2982D2263A33A339895B DARRICKFLEWELLEN
438,360,798 *2C6B08DA7680DD4FBAF8C67518BC8914C6C08C63 DARRICK.PITTELKOW
438,360,799 *2C640A6AA4302DDAC6462E6532AAAFA7485D6126 DARRIN.HAINES
438,360,800 *2C63257B524370DC025953545A446741F81ABB04 DAVEJANSON
438,360,801 *2C64A838687185E57C32E32C04E01EB4C43E5FF2 DB3-M
438,360,802 *2C658B301389F6A91451622799E9C727FAF7B3C5 dbbtx
438,360,803 *2C6827304208C0A504F09E5777F5476F128F041A HLAPEYROUSE
438,360,804 *2C64FB9570D910643C7B8A848DC7886BDBEA422A REYNOLDSSCOTT8
438,360,805 *2C66347F2ADA3E4AA5316A758C9519E7C40EC306 dbs/%
438,360,806 *2C6A5D1894BB8C057623D100BA20737CDFE29ACF D.C4G
438,360,807 *2C6E10F8D98DBE0B08611FED8A1A97F86D3095F4 ricardobutel
438,360,808 *2C69641DD8B3E84BB39517E2D9D2B16999B3F6EE dd0+p
438,360,809 *2C6E3FC75519C54122499571BE9AFD829936E598 rick.eickmeier
438,360,810 *2C685C344CEAAF137AD72EDB8C031511689F545F HORACEFORGACH
438,360,811 *2C647C7CFA0065E1F60501B2233629FA9A264567 ricobrumbalow
438,360,812 *2C6AB4C2726D85CABBCCA5E8D85050985E83913A RICOKINGSBURY
438,360,813 *2C6CBB211159AAD20C06715A7844F4AEAFAC2BEB DEAN.KUR
438,360,814 *2C60720EF6D43431E21A0FE2C61CEA7B1B7F4BBC Death.Ride.Records
438,360,815 *2C6380288FB2B2B4E2DCC3E414397A0D2FE030CD deborahhigginbotham
438,360,816 *2C6E475ECA6F2A721977C1BED1C6F0D0B66D2CDF houstonmcloud
438,360,817 *2C65AC06B5BC7AB68E98799B719779776F0F3F29 rivierdolfyne
438,360,818 *2C6D6F359579C7EA0BFCAFCBEDF54B5A82A4189C rkrenke
438,360,819 *2C6C87B90FB76904060A4CCEDA30913F8DF58490 [email protected]'L
438,360,820 *2C63ECD600987871F918F555F0C0A95E635A438B [email protected]
438,360,821 *2C63BF1B07D8625FA647D1239B957AA2DEFF7E68 demahgnig5
438,360,822 *2C6398D896EAD31CC7F049B42817FF76B0FC0F85 DEMATERIE,PARTIV
438,360,823 *2C611737A3C16EADB0D3AC4ED36CBC96DCC847D1 [email protected]
438,360,824 *2C651FE78E4846C62F2EA723790DA35FE08F14EE humbertomiss
438,360,825 *2C61A65A32D7BFD36A3400B80AB229A8FE8A286C [email protected]
438,360,826 *2C64286E306B61BB4C6A3755F8F0F315300A4094 [email protected]
438,360,827 *2C6F92ADA2C715A1DD2E5CF511C5C8C43F566FDF detroit.1948-1949
438,360,828 *2C688050AB1FEE70A31927F81CCE11C7CC7F4C01 DEVIN.KHAMO
438,360,829 *2C62B362C659F5691AB0FB129B5B329B36E51038 i0m
438,360,830 *2C60E3FBAB2747EFA3F866B92C1CEE1F5220CF71 ROLLATO7
438,360,831 *2C6A4F7CD74A8603CC533E488083517333D8B6ED ROMAN.LAUER
438,360,832 *2C626C756388A3BED668F3F98A38C30F40B9762B IAMREGGAE47
438,360,833 *2C66963CB33625BBFF4585C716E5DACAA810775C I'B;
438,360,834 *2C6775C8CE3140143CB63281BD310F534D6E31DB ICITAMET9
438,360,835 *2C648A27B16D4A08AC1F455F50A0F4E98C19122F IECHIKAIECHIKA
438,360,836 *2C6831125C995BB823DF856C3514B8CDFF09A2CA IFFUSEROS
438,360,837 *2C6B49532047C41EFB7C5BAF2939D0F4A7BB7B30 dialyses
438,360,838 *2C6F554DC0C759566A824B28B71334B9AF9CD40E rublad-familien
438,360,839 *2C657D7D63E9B761C7D09FABB4822394FD09C11A ILOGRAMS7
438,360,840 *2C6255D407DC35E279DA077BCA0B61C56B9E5B79 DIJ(T
438,360,841 *2C6FE81B791F922C96D2F94E35DA60FEC442B34D IL RITMO DELL' AMORE
438,360,842 *2C6AFD016A4B1C777B89E4F1FB1E699C095A1EBE iminute4
438,360,843 *2C642576CDFD216667E37417EADBB01500FF1BAA DJGU$
438,360,844 *2C6ACDB27FD51385CAE9E90EE40EA87EAF8848E1 S155403S92
438,360,845 *2C6138962266C5D3B8DAC4A7ED60131C50728CDB s45k!4
438,360,846 *2C62991E593926298DBA7B831F69D179243F7D9B INMYMIND(POORMINDALTERATIONMIX)
438,360,847 *2C6B1B682AFAE8B35B6411C44A16E8CE8BF8D738 sagashiming
438,360,848 *2C6BD7B03D34AB5E5BF6614075F771619AAF7157 [email protected]
438,360,849 *2C64B74D63982BA313FB7A1DF028DB34B31D00B4 SALICYLISM0
438,360,850 *2C62FB78CD01D9908D38DA5D6CBFACD8426C13B4 SALVATORE.BOSSART
438,360,851 *2C6F5B7A167243CDA74F20B78EA2A60E7477A993 salvatorecihak
438,360,852 *2C6131461E75F179A156A32A5ACA42287E3621A7 salviamo3
438,360,853 *2C6F82CD2DA7A6A1C976A140BB1885E9CC4270E0 DN)_
438,360,854 *2C66098300A805C8582E9EC96E456615109DFF8F dnll
438,360,855 *2C6EAD336BDAE1EF096D1A13C81630D5591C7C11 DOCOTORAL
438,360,856 *2C62DE874A6F15B0199C779CFF3C93CF3E2DD462 dom+&
438,360,857 *2C694CC3C49CD46570AEAFF80CE20704F279653C DONBRABBLE
438,360,858 *2C6C797B1EDC1900DB044B43B365C8EA1E725C83 donglacosta
438,360,859 *2C6B9707D3E5E0B2724DD9B01094B7BBA7B5D58F IАЬМНАШ
438,360,860 *2C6213DD19A70551913D6C23165609A223214FEB DOOHYPPUED
438,360,861 *2C6A5785166BC0E70D45994A1421C3A6CBED7A78 DOOSIES1
438,360,862 *2C696BE2035A0A05759141544DAE187CFA221020 scharff——沙夫
438,360,863 *2C63A9573FCBE1FA0D6B84410F8E1132F63CE800 JAKE.RIDPATH
438,360,864 *2C609C42776ACFD9F5CE0641B46B985F0738A4A7 scorrono?
438,360,865 *2C60EF0FEDB37E58F264A8C887825D58FB65EB5C downtown.(deutsche.version)
438,360,866 *2C6BDA9FC4AC2712725B2C6688D7B2867742DA7D d/p8y
438,360,867 *2C612C30680C0FF9E80F436DF632B8C5D61B5AE6 JBRATAKER
438,360,868 *2C60DE7302A798211C2FF0F8394D255ED38D4A32 SENDITBARBARA1
438,360,869 *2C65186DE6D83D62C7E80E90AA4BBAE5DB66C582 SENIORHARVEY3
438,360,870 *2C6F2CE75693068AB71AE981D9EDDDB2510C151E SENSU
438,360,871 *2C67DEC8FACBB1D58CAA8C6E15E9ADA1BFC819C2 SESROHREHPOT
438,360,872 *2C66AE62F6E27D252FEC083F0161C288583BEAAD jefferyrufer
438,360,873 *2C61C4CA689603D13CD85ABE8373C943DD949945 SE SUPERDAGE
438,360,874 *2C6F346C0E1634E0E40E0ADB9681700EC83F477D SETH.CHESLER
438,360,875 *2C6ECA0F2302E2F2138AE231A44E9F135CA65990 SETSYSTEMS
438,360,876 *2C6240F2A2CE4890560B6C951105DA46AFF829DA jeremykoepfer
438,360,877 *2C6FD669E7C9C4753E4E0199564778C27EEE08BD [email protected]
438,360,878 *2C6CE17EDE04A09F5DA6718008E9BDD6F7F20157 DRSDA
438,360,879 *2C62CB5877B772635B9F2D4B17BA41ADCB2A4FC1 d(s93
438,360,880 *2C601689A41BCC3178F1D0832F6EBDABBA35CA1B [email protected]
438,360,881 *2C6D6265CD04575463F010F515A86119649AAC93 [email protected]
438,360,882 *2C6C559F049798A0909EA67BAC45C88BC50F6B5D jestercyrano
438,360,883 *2C6F37A0384C413C43601BD4FC239754DAD6BB4E [email protected]
438,360,884 *2C6A641DD0A112C44215C5574866573B146A7141 jhamblin4
438,360,885 *2C674F390CE10230CF7CE08FDB5CD2E7DA598D77 [email protected]
438,360,886 *2C684BF177B43BE63C15301972382D6671993A23 she-runs-to-the-crippled-pickup-and-sees-a-front-tire-flat,
438,360,887 *2C61BDA5A8C24C7E8E661FAE2C8A441ADAA23BEE SHEVHANED
438,360,888 *2C66658EC0F197F7DE9D26511E56100554305487 SHITJAN2
438,360,889 *2C682704F238489711A2D8C31BDC7B5DD57ED29A dustinglapion
438,360,890 *2C6C762DC400974EB0ED800DA46911367BCF14CF DV(5%
438,360,891 *2C6D090D8C4269A471AA0FECFBF675BD772E1094 D!VQ
438,360,892 *2C6C1AD425C41D8A34756BBF113286904247B494 SHOORN
438,360,893 *2C68A9A1DB965441D694205CD81E5D9CED8011C0 shooterconrad
438,360,894 *2C6BA68F341389FCA7CC48804EFDFC497ABD6512 d$wh0
438,360,895 *2C61CB2CB13F6178A646A1D14C6A2FAC245AAAE2 d=wqs
438,360,896 *2C6DF5809B0CA228E6C05C35BE1E8450F5B7B623 SIDSTALNAKER
438,360,897 *2C6DC1777E7CEFAF4FE173992069ACB26E931643 d;wv!
438,360,898 *2C6B5DFCA97A36FA19D2ADDF8F2223312B04A3E5 ebonybanksturner
438,360,899 *2C6674C3D8A6B9CE0C0DD9007F18AD53A2D2FDD3 JOSHMCCLEAF
438,360,900 *2C6358D1651CFB72207C0893F2D2F02B58876B23 JOSHUASELLE
438,360,901 *2C66BA3302910E7BD0B036A93E58D8B2EC4620B9 JOSIAH.WIDEN
438,360,902 *2C607D8BB5B23705246A961CA344BE93A180A046 ECNEGLUF1
438,360,903 *2C60CAABBEB4487FB0FF5EC08E04B8E93EEC9911 ED-E!
438,360,904 *2C6BF4505F3ADE929709E51323AC79468F36B53F EDISON.TORTORIELLO
438,360,905 *2C683864F1836734F6CE5877A752336EEB2F74A4 JUDCATURE
438,360,906 *2C61B5F7E8510733E62285CF33B57024742EEBF7 edwardomcmonagle
438,360,907 *2C63EC5FD708935509D5D31FDA20B10E0985C9F2 SMITHSFLIP0
438,360,908 *2C685801C839A74A5F37EFFDFE53FF85BC3FCA8E eedanbsw3
438,360,909 *2C65F6EB31BEB81BDBC0F2904568AF13E3E247FE SMSCRTLY9
438,360,910 *2C6EE08B93A670B85EB7584A346A1B2682FDAD56 SNAGOJI
438,360,911 *2C6D4FBE2C85BA98BF34D0A4CC63EE1E0388A2DC snakepetunia
438,360,912 *2C619AAB584A7772789E1C2AFF155960544D9E24 SNOW WHITE AND THE SEVEN DWARFS WHISTLE WHILE YOU WORK
438,360,913 *2C630A37845DC696CB3CF6F74821F52F178D2708 EGDIRROHS
438,360,914 *2C6A4FCC97E9692CFEF5A624F21C9B8E4C35B591 JUSTINCLIPPARD
438,360,915 *2C6DDD71D48C3C971AC3AD4030280F4BA169782A eggygombo
438,360,916 *2C65CB0B75A4885735D7E7590A9C15972FE0891D K80962
438,360,917 *2C6F931E1E57759DF5A6BEDB24654F0AF2552260 KA8ORIZOMENA
438,360,918 *2C6B56E7222153B887B400FFC5508A0916E19D8A SPECIALPACKERS
438,360,919 *2C67E8BC33BDA7F6E221FDA20C2F7404F43B49CC spitz37
438,360,920 *2C64A852076F74FA159351C90FEE6E24F600B0A2 ELIASLINARES
438,360,921 *2C609C09C10A7C80C53B7C6FD82998C19236E0BD kaseyvandergiessen
438,360,922 *2C65722CD6A7132B3B33FF5ED54C4801A43C8664 katedelgado
438,360,923 *2C60151366D782061D76A9CF32B22C46CD97D1B0 KAUFHAUSGRÜNDER
438,360,924 *2C691B5140BCB8D4866664D396FDB4E944A686DF STACY-HORTON
438,360,925 *2C6CE6FEDA9E61E2E9F9CDCD0000FF1866B77608 emmauses2
438,360,926 *2C63BA1B7BFB6A7EC7BFE109665C5B43E76C2A80 en2168175189x3
438,360,927 *2C6E9AC72A3803E729FC2506B7C929A0FFA9BACE STELLERKRÖPFER
438,360,928 *2C6CEA43A64CA4F1BACF71D0DA1BA2E837858FE4 endorme
438,360,929 *2C6364D5D8FCA8F4FB025DA0F4BAB2CAC1898E25 KESTIRIYORUZ
438,360,930 *2C622D3DDA687004F391D8E7C1C8FD7EC53681F8 KEZHUOAO
438,360,931 *2C660A73B9143E1115D29B4E5FAACEA26E729C09 KIETJU
438,360,932 *2C63CAA1F7811E87804C19A84317DFB719F758BF Straight.Until.Morning
438,360,933 *2C6E5BEC0454F97DD6FB2C491967A6951981DFA0 Strawberry-Fields-Forever-(Kenwood-demo;-demo-playback-w/-chat)
438,360,934 *2C6D6F25DE83C8F07F8F57450D30D4F84074EF01 KIMPPUUNING
438,360,935 *2C65DD0F8DA496F63E2EE72BED940AFF4CF0EB63 EPTE,
438,360,936 *2C6EEF94A2CC0AEE4961D25C461473ACC8994742 STUARTTHU
438,360,937 *2C62FBEEE3AC278160679A2288F1D3A84874A04A KK+N
438,360,938 *2C6ED2A19A7FC325FDCFCD191E24AB7DC5192B87 ERINNERUNGSGEMÄLDE
438,360,939 *2C68C61A9BEECC9DFE1DB4DC2AE56443B5C2E792 ERVINMOTAMEDI
438,360,940 *2C6B72238487F1F9559FA76F94B8AB8581EC7C87 KONVOOIEN3
438,360,941 *2C608B58E83463B8B73A2579A1726FAEF4B4B65C SURCHARGEA8
438,360,942 *2C69E8E1ED5590994F2C3B9289C7C529A15359AB SVIÐ
438,360,943 *2C60F97612F32C90421BEE419F90E0658507FCFD kujbysjevdammen
438,360,944 *2C6D00D26784FEEA3DCC7DDC6AAA62B8406F2938 SYSTEMUMGEBUNGS3
438,360,945 *2C6A34DFA1242BD4EEAB5960E619DF6CBD6EF38C EUSEBIO.REAGAN
438,360,946 *2C69E0D5EE3CC42628F446B24B1DC882C604906E kylepollack
438,360,947 *2C62E0993B9604B7C2B7252B2D38AA3B83618693 exhale-blue
438,360,948 *2C681610CDC763FB4BE8C391C4CEC299BD7C55C1 [email protected]
438,360,949 *2C6F1B0A42AD72A7CF4D86D92CE54FC551F0886C EYE-CONTACT-(VERSION)
438,360,950 *2C6602E0292474B8452AEE734FA11F1625A2A6CF lamarconine
438,360,951 *2C6243D9C62CEBF15B2B33E8D20933BAEC0B78E0 TAMASZT
438,360,952 *2C6A709C66A7FFEBCA0E61394B1DC7D2B9E1F7C3 [email protected]
438,360,953 *2C6EE5591074659255F222DE98853F41422C9F6C tangi8leness
438,360,954 *2C682B71CC31FDACB7E75A51AD539639A46C4504 [email protected]
438,360,955 *2C63C64316ED78A96AA0FC369573DDDF7671B800 TANNERGATZ
438,360,956 *2C68DB25867CD803CF7E0B5039171E0D77A4DA06 laurencemccrumb
438,360,957 *2C6A10C9E3585B66602BF8C76993271280E54585 TCHAJVANSKÝ
438,360,958 *2C6896CDF429FA17B53296DDEECC0347FEA4902C [email protected]
438,360,959 *2C6556BB7764AD1B494B834AD660A56FEB0806A7 [email protected]
438,360,960 *2C68C85FB773D27D7F6B77BD30046E1A9B995919 TDATSLLIM7
438,360,961 *2C66034E2A6F08F2E6269752CAB0983C9EB7D88F [email protected]
438,360,962 *2C6A575CC5A3827B497503C690CD217801AFAC2E LAWERENCE.RAHL
438,360,963 *2C6866CF7B704470BE95801BFAEB18EAA86F535C lawerencesizar
438,360,964 *2C61DB1F239F3A14910C322174A6105B497B994C TED.HARTMAN
438,360,965 *2C65D2E3D6C05FEACA4E0D8C06E8E79C116E0F83 FAUSTOLATERZA
438,360,966 *2C6C92110E0F515DF00BCE99A5A648893293D0A2 FAUSTO.LATERZA
438,360,967 *2C6BC7BEF6BD0C88DB368FCA8DE9AB4F2F26AEF9 FAVEROLSKA
438,360,968 *2C60A06699CE9917F21EBF0A934672A48A107FA8 LEAFWOOD6
438,360,969 *2C6C65D7C0610A1A2150CDE8D3A4852310936CD9 FELLABLES7
438,360,970 *2C69467D2A7FF6B28A93F0658905BC445910A890 leighkozusko
438,360,971 *2C65459507CEF7A4953D9D841058EC97F290A875 ferminherzbrun
438,360,972 *2C64B47A2CFC5CE26C3B2DB298CFE0B692B4A612 FERNANDOOZULOAGA
438,360,973 *2C61B469862BD86DD5A2794FBCD22EFC0B29636D fernladbaren
438,360,974 *2C66A5819DA3FA2CC0CDCA5CD237B3DB1E0DB618 LEOMONT8
438,360,975 *2C6F2D4F8FFE63DDCC8B5EB9E6B5A658033A5106 ficksters
438,360,976 *2C69E09B7DE12B6E916533DBB4253D9BDDACA8B9 LESLIELANGEL
438,360,977 *2C65F49E204899014354195938E42E69BEE0E94A THECHINOOK65
438,360,978 *2C6A43E99B2F8F597402C4F9A2CBE698759D619D the-golden-hour,-part-ii
438,360,979 *2C690DA41BA6FB2C9EDA777E1213B07C20222854 [email protected]
438,360,980 *2C61E8616D07C93B53FC8662AC9CE710A5A5C794 [email protected]
438,360,981 *2C62C291916E33CA045261F025F138101D736CC9 [email protected]
438,360,982 *2C60267EA8BB24A356AB94A37DEA0FF27C65A33D the-rave-master,-volume-iv:-live-at-coliseum
438,360,983 *2C6BD4859EAC7DC254D55C9201FC66F78EA3B5B9 the skunk-2
438,360,984 *2C68A4CC95670E849CB87D21365E8E2669430238 THISISTHEPERLLANGUAGE
438,360,985 *2C6D35C71C5CBAAF7E89BF996D31D97456DC0948 line-buffered
438,360,986 *2C634661A0F71C5814074C81EADA30573A625EF3 francisborowiak
438,360,987 *2C6B43A2D5D56EA42A43E301B5D7BC3F2776E65E tibetischmongolischen
438,360,988 *2C68AC98F47C45F648CECCA2E2B3A5D4FBA16C11 TICA DE PARAGUANA
438,360,989 *2C68603BD7542E53DD68EF54913BEA82DD03E59B TICYATE
438,360,990 *2C6173BCBD611E2A6F676F893C96DA50B0F87244 <LI>THE <TT>0</TT> MATCHES THE LEADING <TT>0</TT>.
438,360,991 *2C6A2EEB9B56A58FD1C759A2EB11370579EE9FDD frankenbergu
438,360,992 *2C6F741402529D12334077CDD80B156C1B3B951E FRANKLYN.DUMARS
438,360,993 *2C6E1C5977E91BAF0E61F9081328993702F69562 FRANKLYNSPERAZZA
438,360,994 *2C695A9089BADD48997A2A5D456794D8DC3135FB [email protected]
438,360,995 *2C6E0FA2AA40CDF0F6FEA1A8F98A925EA5DC3067 FREDERICKRAYNAL
438,360,996 *2C67D146953D1B0C99A84D0C5F4B481B745EB500 FREDRIC.MEEDER
438,360,997 *2C6C722D560A6DD1AB50E9DE27F245173B4D2173 fredrikson
438,360,998 *2C6A91FE17808DAAC3DE6873B3460D00A2E6C163 tnemiarv9
438,360,999 *2C6B30D8FD412893FCB651491393FA54735EC2DF LOKSAIHANG
438,361,000 *2C64F60DA0FB283F52357CEE28450D904089E8D0 frumarit
438,361,001 *2C698560CEDE8C8E8DB0DE255037B7EE176C5D31 TOBY64
438,361,002 *2C6AB27401C302FE03CC6D862F40392EA1F572D3 FUGEG-MOLLAUSBWV535
438,361,003 *2C6C0B5BC9163B4ED452988C1545DB11C91C907A g11+ch35
438,361,004 *2C6905F5D2D07E61224A81A46108C1186FBDA427 galotzy
438,361,005 *2C6CE7469D2EBAE04AF78F1CBEE13D1FDDB9BB87 TRANSSENSUALLY2
438,361,006 *2C6DDCCA5FA8150C853815DE4FD1D29D39E1F36B GARRYTHORPE
438,361,007 *2C61215D25C35867107644D3D2A766F0CA879767 TRENTONNATHANIEL
438,361,008 *2C625B48E05517D830218BA282FF57692F861EDF luzitaning
438,361,009 *2C6A56B523FFD983853A2DEDE4FCCF1420DC43BD TREVALLYN9
438,361,010 *2C6EA87C37B8A2BB248E6E0CF76BA7F848A24374 gastvroing
438,361,011 *2C619A80E8549D5F185EADE4DF1D640985BA5D67 GBIEBB
438,361,012 *2C6E05DEC53CE74FCA4BD0A9865F884FC1E7FDF7 lystfiskerforening
438,361,013 *2C6AD5CACE702DF8082651BC37E76B437C454F14 germanlaue
438,361,014 *2C6E822399F0A5C6AF795111B82613AD9D19D07D GE;U
438,361,015 *2C6FEFFF6C8C9677B2A313666D5875E5BEF6846E MACALERS
438,361,016 *2C6E776F41827B0198A7B484B1ECAF3B34A76925 trudy.rochon.macmillan
438,361,017 *2C6AFC0DEAD5FA4535FB3DE00B6EA0C1CCD06F33 TRUMANKHALAF
438,361,018 *2C6FE346DE373F5F56A22255CA76C7C36D4E98E6 trümmerlawnen
438,361,019 *2C6B9CFD42EEF15394ACCF42277AB4FBE6E7700C TTCOUNT0
438,361,020 *2C6ECD8F53AB74721D18E092C15798B538B1FE68 TTORFOSS
438,361,021 *2C618BB6CBF85286200033A3A154B480AD54C741 MALIK.PELISSIER
438,361,022 *2C6CFD9C5C8917DB17356E62C8124625E5994518 MALKUS’
438,361,023 *2C642648CD6854B403110E2735878D27CD059773 MALLORIELENTS
438,361,024 *2C6108B834F4A4AF9737FA0F932BF44FBF04A235 TUNGEMÅL
438,361,025 *2C69D80099EA73070DD439778AE3ADE273EFB757 tuomion.humussa
438,361,026 *2C6673E8BBBA69409B2ED3496901401FDCD001B0 glassongs
438,361,027 *2C61C5ABF8577796317529B094649BC77218D39A marcbolanat
438,361,028 *2C61F5147A5D9BF29FDDCFE1AE20F6D45EE9C2EE gnamrerl1
438,361,029 *2C62D5DD4570B8B67685B9EDB1FB1B513104F5EB [email protected]
438,361,030 *2C62A352B50E5D8B4B816927EB4BE3E04C2F7232 tyreeboyster
438,361,031 *2C6E6E58BB46239FFA9C8E81EBA70C204FC4BE11 GOLDENOZARU
438,361,032 *2C6739706DE4C9701F5E11F325D824FC292A8E3A GONHELLIED
438,361,033 *2C6A7859CC76E2AF44C3564BEEB5953CBDF20D60 GONZALOGESELL
438,361,034 *2C618F53103640DDD12D3789986576E86BC0F4D1 [email protected]
438,361,035 *2C630F47937A19D24541D762793527BF5B7AD33E marikpe1
438,361,036 *2C6438B0E6E0695A36721E1A561B91DB901BDCE4 [email protected]
438,361,037 *2C63B50880C324E2F4B2DFDA74AFA2A09804453A MARIOVANDERCOOK
438,361,038 *2C62056094BD6030B4635166D37D248BDED7319E mark.london
438,361,039 *2C636DED45A13BA11656D0C8A4D04C7E87C1017E [email protected]
438,361,040 *2C61793A8B84CAF8552A77AD4EF6C7E283CA5788 marvin-whitman
438,361,041 *2C6368041458B8EAB7F014DCA12965A03C4762AA MARY.KM
438,361,042 *2C62B26246EF05AC2E9E0A1D2A25DC7C61BC020C UltimateCollection,Volume1:MasonnavsBananamara+HyperChaotic
438,361,043 *2C64B56608759735223264A5FA979BE148E9A153 UN83LI3F
438,361,044 *2C667C05B17607A483C952F93B2A6DCA093BEB74 GRUPOS4NT4ND3R
438,361,045 *2C6DDED6AD3589D5F4984E53BF69AE2FA1322450 GS+Z
438,361,046 *2C6979AF469EF84A72A52771494E4FA5F6766E65 Unit 17 Listen
438,361,047 *2C6D039EF77E4C31464149C2313AB42CFE6A87A6 MCHAPLIN1
438,361,048 *2C6D8D9047DB9683A099367CD5FC76D0A5C2C0CA UPBELCH
438,361,049 *2C68334DCF7C28CB48D1A838224A200F7776CAA8 MEGAHIT
438,361,050 *2C600EBA03EBF321819D15D644B264F1D67ECED8 uuo~0~q--q
438,361,051 *2C697CD7BBB1F908410981EF0A74F021FCAD1C7C uzmutilo4
438,361,052 *2C6A39E15E07DF0C84A1F3541774DC9175F5DAB7 VALENTIN.MCCRYSTAL
438,361,053 *2C68F462F43BD2D60E9927A4AA5F12D3945871FB HANLIKONG
438,361,054 *2C6578CE85C129DD9AC8A8509D2C26C5966BD603 MERLIN.DILEY
438,361,055 *2C6C8BE1F822E8F03F992211A9CB1A6E59351D34 HARLANDPIPHO
438,361,056 *2C6AE6A9E93281FD948FAF25836EB00B61D13C58 vanina.torgovnick
438,361,057 *2C6939D3FD51E6F0672C13DF73FB50704A4E5D6C mhotq
438,361,058 *2C6399C2CD27E385FE119EE12E3AB1ACDFDA5ED5 mi$c4lcul47in9
438,361,059 *2C66B3209C846EB26BA93C1E7233A06B152E670C MICHELLE CLIMENT
438,361,060 *2C6423DC144B1C79B4FD4FFA322800B99D817101 michelsorin
438,361,061 *2C61A8C4CB2C6FE64FD4AA9C0DE9B8DB2F8E53A6 vauc
438,361,062 *2C6D4FEC5ABEF279FCE4F1426C6D2D648A0A64AF MIGUEL.CROCKER
438,361,063 *2C61EABE0167944F226CB82625E3EADECF119118 mijnvlaanderenland
438,361,064 *2C6C2E3B17A558444E7DE5431FF1635A035176E6 hear the sound (gavin & nox remix)
438,361,065 *2C6134B39A5746B12C192AB7B3E81A7EB4470503 viandanti5
438,361,066 *2C6AFA84511F375F5996F87EA745FA430ED6F7E2 HEMODIAS8
438,361,067 *2C63ABA92DC87D99B36F02B9942C3D59044C6480 VIDYA
438,361,068 *2C67A7CD8EBFABEBEA07D41D1C8F12F390AB9397 HF[
438,361,069 *2C640BF283977B5739BD6EAB9AAC7F42906DAA6B HINOID3OU5
438,361,070 *2C6F0F4D4FED86CCA2EB8E2681A72DBED91902D7 vinithakartheepan
438,361,071 *2C6AE54315F77313E915B949D2286D51E3A60C2C virginia-field
438,361,072 *2C697EF4367BFDC88C9D7F32DBF4A6039C08F50C VIRGINIA OBANION
438,361,073 *2C6319E15727C6560CD773D0AA15B3F2772B22BC monsterwalksthewinterlake
438,361,074 *2C6AC4BE5E4E09D94EC3B81F144DE992061EBE97 VITARABOMBONG
438,361,075 *2C62DA28383A8E091027BAAA5765363CAE99EBE7 MORDELLISTENAINSCRIPTA
438,361,076 *2C66C567A19BFCBD165CB8F8508797654C2229BA MORESTORECOMWWW
438,361,077 *2C6A085B4D3AD7BE4E6DA1EFABFCC4FBEC0149D2 MORE THAN A JOKE
438,361,078 *2C66726E23D092ED535359C77EB8BC45EBC46264 morire-domani
438,361,079 *2C6F18CE1B6B845FFD37F22378CD9947656579AE MORPHINA73
438,361,080 *2C6214AC640179755A36634FD24FA97D3DC48CC5 mosesdevalk
438,361,081 *2C6E81A8D69EB61452854756AE9AA30981113151 MOSLEY
438,361,082 *2C625AC7507E29FB8697C72BEBEEC6706BA01DE7 [email protected]
438,361,083 *2C604C5C06FE17415BE120296B4809FA9D38C564 HORACEWASICEK
438,361,084 *2C6A09EE33FBB9B7720247E393CF32B732FC5BCD [email protected]
438,361,085 *2C6105E1F52F70F7B221B3C2073B3FE80176B006 VRNSCHWLJKNG1
438,361,086 *2C638AB27DDBD369B31CC40C4B04A9D41482A12C muni-love
438,361,087 *2C6C50FD2FAC4D8F1C31DE211FC80AC0D31421C5 MƯOI
438,361,088 *2C6A2B64543CB8B749AECEA05AF988D7394E8F82 hotspurs
438,361,089 *2C64B0C2C3B8E0E7E15B82D74995BAFDF17C9BEE [email protected]
438,361,090 *2C651116D0EC1246773DD23A71009F45822AA503 M-Y`
438,361,091 *2C6ADEB3843142429D8145A69DCB5D9B3DC4278C [email protected]
438,361,092 *2C67D1874D54208E001F3955B55754109D1F7F4E WAHH WOLF
438,361,093 *2C65A3122E692DE3C1314244B5A1037502198F6A waleedalhatlani
438,361,094 *2C6E18D0B0AA8585182A6A159E44159C09D6E7D6 N47103
438,361,095 *2C6C9F07381CC633F9B3FCB5757D17DE848A5540 i8!k
438,361,096 *2C6D27B49E4F1D5C25CEFE8CCB9FD207C9668EC8 WATCHING A DREAM OF THE SEA
438,361,097 *2C6367A3933B69C51A12F978D89EA9D3C13F8B6A nathan.tracey
438,361,098 *2C6AB8A73BF0A8B4A531F6A207045EEBD19C4FC8 [email protected]
438,361,099 *2C62235C11F4F3781C041E52DDC786F42B78A6D7 ne-7.-ritournelle
438,361,100 *2C643E4694F38FC13DEC4CFF38A0BAE39BB796B7 neversawitasunion
438,361,101 *2C698C43B59BC1FA83B4C2BEFDF4E482BBE64C0E WILDBIT.COMWILDBIT
438,361,102 *2C6E22B1636747430D1A1607D44E1695D4CF5C87 wilfredozeni
438,361,103 *2C62629C444E1A75BED12DE407B2686621214853 WILKK
438,361,104 *2C67392CD5C66F3702A4BB9C852B40C21AA9552B WILLARDBLAKEMORE
438,361,105 *2C6B7D910040F80A901E4187CD0C6BEC7F7B5743 [email protected]
438,361,106 *2C6DDD91D08B2352346745B3FE01241BC7EB0C08 ILUVSYSTEM1987
438,361,107 *2C63529A993CC02F9D8DC9A6B6D2C474705757BF imperturbables
438,361,108 *2C61A6ABE1E802CF7E395E5EA73531C196DEEA15 wilmariehallcotto
438,361,109 *2C600F467369EBA9BD9DB3F62AB6A4737FC368B4 WILMERHEMMES
438,361,110 *2C6FE719652EE54BA4C53B8B16D72CF65AF19E3C NICOLEHULST
438,361,111 *2C6A655B96332C8FFC3D5E655F533F89B28BAC6A WINFRED.ANASTOS
438,361,112 *2C6BF356903355CAC87908C80814B0C4B244933E WINSLOW TECTONIC
438,361,113 *2C629284A139702460FBEF83381F2CD216B62159 WINSTON.COMER
438,361,114 *2C6F0F04B733FB83A205A7542A6F39BC2E68270B INNIVADAS
438,361,115 *2C6FB3E21DE6DE67CFA44301E3CE8946A8CC5F2D no.cơm.ấm.áo
438,361,116 *2C6ABD6FDC73B6F6319015AE1879EFCFA4EA10BE WorkingmanBlues
438,361,117 *2C6BDB426AAE863F33AC3E6C71CCF2ABB33B3192 IN THE HOUSE (TEN TO TWO MIX)
438,361,118 *2C63D18A40A7D13EB46AAC85A84221E68BADECE7 WUTHLESS3
438,361,119 *2C638134AF749BC5604722657A45695156E5837C WWWLUXURYINSTITUTECOM
438,361,120 *2C639D0E06C653144F4F0A15631F42B9BF505E2D ISAIAH.SPALINGER
438,361,121 *2C6C02B9CF0820721466931E4FB3D08456E6D610 ISAIASMAROCCO
438,361,122 *2C65F35C1A09EEF5A6DBAEF3C26AF65770F7EC78 ISIDRO.ROMBARDO
438,361,123 *2C634D76BC1AA1DAA21D898FA4B5CF4F10ED2DBE north_dakota_33svg
438,361,124 *2C64DBF152D042911FB9C97B67BF969231CCDAC3 [email protected]
438,361,125 *2C6BF46D5DC385775EC4356FC87453A25AB46E7B N~Q
438,361,126 *2C66BFB579EE373A7CCE3EC498918F48169BF967 iwmycar1
438,361,127 *2C6E3FB3F3650D4DCD1F9C0D2149A8DAB11ED2CD IZDANJU
438,361,128 *2C6C0A63F917EED9ACE54F972B6261E84F96EE06 xhelazz.-.c
438,361,129 *2C6F337B0D598CD9FD72DE45B138DDCE24D933AB [email protected]
438,361,130 *2C6E5FE7F0449F02E22ECBCFDFA174E93AF70DEE [email protected]
438,361,131 *2C6A4F4108496F8A9849F6684633AD3F7280B941 [email protected]
438,361,132 *2C6DC344A81FD2D394EA49802FDA53D34CBCE5AE [email protected]
438,361,133 *2C6F78DD61BBFD65E04CD19A56744AE2B0CE9B0D XIIVIVYSYAGXREDAWLIESH.LNDOTERS
438,361,134 *2C69143813CFADA6FB1E2B479F161E69D3368569 ><o~.0~d##q
438,361,135 *2C6E5BC133D5F64E51FEDCC9C58E107E080A9864 XIRIM
438,361,136 *2C62CA1D113A1E17A2F3B2ADFA80D19E62A187D6 JACKDAHDOUH
438,361,137 *2C636426E0E8A4800EB9BC9A86F7E0DEDDB3DA9C {x}O~(-P
438,361,138 *2C687AF10FCA9ED0471584AA71C74C3F3044C929 ODELLBORROTO
438,361,139 *2C6676036FDDBF9843B2E56EEB2AE775473F3360 JAMEL.SCHONS
438,361,140 *2C60C33FF6BBB1EBF6720775CC3950017DBD14AA JANICE-GILBERTSON
438,361,141 *2C6313570A50036C32A17537646C01D47E9F458D JARED.BATSON
438,361,142 *2C66F700C871FA7DC4B211682104AB91A6B0576B JAVIANNM
438,361,143 *2C6B01223B871AC172A23E3CDD9864C147DA7FF8 javierreisch
438,361,144 *2C668FDBD6D6A0423676FA91B520DC900F415B83 okinawakobudocom
438,361,145 *2C6D2B28EF5ABAD21C6F86042CC5C9A39ED6EEA3 ol_
438,361,146 *2C63A9F2F622EFA04D4CF3602445E72F7261E6A2 [email protected]
438,361,147 *2C643963BC74399B4DCAB67D4E71B4EA108E7E71 [email protected]
438,361,148 *2C6BD2316E2EE15B5FBA81DF66348927600BD22C yarixa-l-cintron-diaz
438,361,149 *2C6217B262E738F5F1D43E33403AB720EF6CCD97 ya-ua-nguyen
438,361,150 *2C6A69AB7451162E76816726DCF35D5789208543 YAYA-DA-VICHI
438,361,151 *2C6CE8EA9816F93FEF1C982477EFB729DA88E9C4 jdfw
438,361,152 *2C6692B2EE8E67CAE6FF3A6BF6806644C15973AF JEFFCRUMBAUGH
438,361,153 *2C6060868584BC3274613DC8B3C1EF6FAF21C749 ONERVOLE
438,361,154 *2C612E8B7FA626978AB7C3D691A95505787936B0 JEMEL.LITTLE
438,361,155 *2C671AA711F881DD5932B26B056F8ED03DE36FF6 [email protected]
438,361,156 *2C6FB02B5E71F64571682150F5B74889252DE07B JEN.RINGLER
438,361,157 *2C6CE3357073D6F6DB6403CCF807D760496D3676 oocrepus
438,361,158 *2C6F5B1C8F5AB43107A095175D043D4C6D37CA4B yodchingchai
438,361,159 *2C658952F126EE01E7D058455A81A3DCE30FDE51 YONGMCCOMMONS
438,361,160 *2C67F320C2F9D427204048EB7C1E826C9BCE7174 YONG.PACK
438,361,161 *2C6FD3E11D4230C756BEE6BF364364C227266B52 jeromeswamm
438,361,162 *2C6ED0A00DDCC37AEE57D00E518556BDD5B12312 YOUGETWHATYOUGIVE(KBPROJECTREMIX)
438,361,163 *2C6D4AE522CBDA4C35D6BAB7F5E0A5C171EE4D38 jerry.fallon
438,361,164 *2C602745D35EEAC6ED004700AA7BEA3394FFD573 ORITA CHOCO
438,361,165 *2C663BEE792074389B441EE3213396EF4D399209 jettfiren
438,361,166 *2C6B2E0FF9C1F1D62C7E2CEB61E89F3C1B0E08AA OSVALDOHANCHER
438,361,167 *2C683D838968BDBCF7F85EB5E658C0F5560DEF93 [email protected]
438,361,168 *2C6D995DD82FDA8BAE1D67C1DBB6AC4204B9B30A [email protected]
438,361,169 *2C6255177783683137E4D41415AA615F837F140E JIMHANNING
438,361,170 *2C668472113D8FBEC4A69A1A03E04931CBF8217E JJ]$
438,361,171 *2C6DD636619847A0BE22A1F0E125883369299030 zakar22
438,361,172 *2C6ABE909F15C17B4112E20F4E2BD81570155A67 JORGE.OZGA
438,361,173 *2C6D0CA68B0A8188D056EAE0388693AB4BDF14C2 p1ay!n9
438,361,174 *2C664ED5926110A6202D00733DB1088A2291DF49 PABLO.STEENROD
438,361,175 *2C6467AA0CF7C019D088984CE7B2B4FB24BF99DA josephcompton
438,361,176 *2C6FFFE9D499B4127EB9CF3B48B79F65770C8EB8 ZEENA ARIFA
438,361,177 *2C62C75C5D1AABD2B91C6F6E226116D82DC929B2 JOSEPHWEETH
438,361,178 *2C622D9A5967A0D42BB16ADAC1E2B056F32B3D62 JOSHUAMAZZEI
438,361,179 *2C62927BFC89923B78B9C6E5CBA37528CA12F38F joshua.spear
438,361,180 *2C66FDF1A885A581E187540E9EA770A3BB65B7F2 [email protected]
438,361,181 *2C6BADB7FC2A4102E27E5FBAE7A80CD781D6C24D [email protected]
438,361,182 *2C66178503167D008BA23AF08568E06F4C8ADCCB ZHONG XU
438,361,183 *2C63BFAB380A1CC89079E8F3B23DE35157E1481B JUDSON.BERKHEIMER
438,361,184 *2C6E90E5383E520C9BE912C9774C3197670E8239 judsondaviau
438,361,185 *2C658421B346DCC78909AFAFA72B1ADA923B21A2 JUDYASSES
438,361,186 *2C6136F9BDC086F0F90A679CE67FA6F6D178A134 [email protected]
438,361,187 *2C65C5DCFE7A3FEA7495457D9FE642200992E795 juliusdorl
438,361,188 *2C61CE7A980B7205F89314B6130D6BAB99483E47 [email protected]
438,361,189 *2C6854D0260700C9A3511C9E15CD305740401C49 panoncea6
438,361,190 *2C62A9328FDD920DAFA34891B3708375B791885A justforaday(sunday)
438,361,191 *2C6E749CBA4795AAB6B463F97C1069DAF52FC3C3 PĀRŚVĀSĪNA
438,361,192 *2C6B3F5077901C39CAF36D32C2BE080B8AAB99AB [email protected]
438,361,193 *2C67BE37719295393692E12A5631B275888FED02 ZURAJAIDA3
438,361,194 *2C689B605199CD81A2473EC78353284DBC74EA83 ZUSAMMENGEZAHLTEM0
438,361,195 *2C698EFB8586D46D8AA5162B429FC5C874FAD478 KAJISABYASACHI
438,361,196 *2C655B215CAC0710E674D16690BD29F2EBF8BBF0 PB~0~osplat
438,361,197 *2C6246F2553F69A15145BA3CC87528C2C9D79A50 KATHY.BRAGG
438,361,198 *2C608F1AF995274E34DC6F1E0F9B1DF94500D7A7 PEOCOCKY
438,361,199 *2C6BEE81B91C5C298BD7A68C9B11023C9052428C percyhallaway
438,361,200 *2C602D2B9775408475E8E526080110CD3958FBE8 брейна
438,361,201 *2C68C00FA6FEAA0CCA425A11440FA35153BECF12 ИСКУССТВ
438,361,202 *2C64367F591D4001E2D4BD516F18ACBA2C667177 phatmani7
438,361,203 *2C69F67CFF51739D494017FC6CA011AE714326B3 KIETH.ROEDER
438,361,204 *2C61255D9EE4C506C56E51568F731D6A3C8B671A philosophum-non-facit-barba.
438,361,205 *2C6B36DCF9355A74A4DB652C07BBC304DC3C68CB KKINKS1
438,361,206 *2C6120FC4108EEF417D130555F2FCF32446C22A4 ПАДАЙКИ
438,361,207 *2C6FEE89889F356A3F82B1657292A7BFBA491855 KLONOA2929
438,361,208 *2C64FEF2B0804F647CD4F7F291DBE62442456CC5 pink.lane
438,361,209 *2C6C854E0703F1CEF298A41596DBB6677951813C KOUHOUSI0
438,361,210 *2C64367FF7624E2A8E04B062D6B6624F025961B7 KRAMERKRISTIN
438,361,211 *2C6338BF15BA28999A6865A0A830D50406594D00 krnjajics
438,361,212 *2C6CFA122DC88A0F286C33F810D4E6BD24473FFC KURAYAMI
438,361,213 *2C64415B760C939BDEEBBCA74096799C44A6121F ladeschloß
438,361,214 *2C6E46A3E14ACAB0ED3A8CE0EA3DB52E02909941 pompaista
438,361,215 *2C63D8073163117073A76830BAAFD749143AC00E LAKENTRA8
438,361,216 *2C69B57312AD06F87512EB229344D6A1239643D6 postaladdressorderinginformation
438,361,217 *2C68CAF2010397C29C3B7BE07B4190D77BC8F126 POTENTIALISE1
438,361,218 *2C62ECCFFA04F4008CD726BEFC28DCC91076D4A4 prism.(wighnomy's.und.robag.wruhmes.prism.agga.knakk.nachw
438,361,219 *2C6473F3F927A08256DD6B14E0914C25BF318FD8 prnkrtjs1
438,361,220 *2C6DF284DAD332A35D6DE03F79F24B2A2545A6DC leonelatallah
438,361,221 *2C6963C7B5F6EC5D4EDE84B47329E1A2FB631081 protekau
438,361,222 *2C64F7797F41889286213F3D62DA50EF2EAD496D [email protected]
438,361,223 *2C65E9ECF39E735FB3D81BA8D0EBCC608E5AB96F [email protected]
438,361,224 *2C6801775408DE36ED3A2DC11CCA0EDE9341535C Life.&.Liberty.(A.Cantata)..My.Bonie.Lass
438,361,225 *2C6F174FC648474706D2768E56335785101E7D59 Life&Liberty(ACantata)MyBonieLass
438,361,226 *2C6FD8BF818FA0B3555EDF1E5CF6C9F125C82F95 qerw
438,361,227 *2C6D0BCE86E20E89A8A4093CADC7A687B82DCAB5 LINDARAE4
438,361,228 *2C6C0C418E310564848AFC3521EE6BBA6C2D0F5B linwooddrinkall
438,361,229 *2C6F4E300F9B10CFE7D3285AEB0E721BAADC90A5 qh$
438,361,230 *2C6E65ED788735A0C48288E4C0406BB8EE8A3D60 qilaraipur
438,361,231 *2C67B0F9886A1C826C80D6014C14AF4CCA9973BA [email protected]
438,361,232 *2C6C1E81168EC79058D2CF9BCFA2974130C0AF19 q==P~.`.3B<
438,361,233 *2C60627B1781A93264A6B56FF4C087734863CF1D QUINTONMACANAS
438,361,234 *2C6C8470B2F46C236B34FD067E2EB07F37145594 QUPOTATION
438,361,235 *2C6EDE1106AB024D76A7769245FC09E50B29F948 RALPH.DAIRE
438,361,236 *2C6316C5C5ED5F1B62617D62C1C8BC8DB00540B3 lsgsky*28
438,361,237 *2C63AAEEEF2197EF19619EA4FCF81B048A40F275 randalbramham
438,361,238 *2C6C5327C8A605EAB8289CC86CCBD6F778DF660B RANDAL-STRINGER
438,361,239 *2C68527F09A849A5C83052C5357FF2A32E48ABC3 LUCIANOGUTT
438,361,240 *2C686C1FAABEF220FEC1DFE462E65FEE9B5709BE luisamiller-"ahluisa..."
438,361,241 *2C6C3009EAD33E834AC127FBDB513D2E14011734 [email protected]
438,361,242 *2C696F358B9864E4C2A60DAFA26D451E1150E2AE lupedeatley
438,361,243 *2C64F77AB34EE4C5399E62A52B503197E9C5B3AE RBIBIMAURI
438,361,244 *2C6CBBD52C06AB26BB82AB6C56167F7FE33BDA0F [email protected]
438,361,245 *2C622BF8C146C369CCAD79FC39D31024B42794E6 mafijno1
438,361,246 *2C62273E0521B48E84323FD6E2E288065993F7CA MAGNETO-PLASMA-DYNAM
438,361,247 *2C6561A16A5514BDAF7C0064FD77627BDD05872E {}(;.#{"}
438,361,248 *2C66BB51E7520C98D7C948F4D239EEBED2B20168 regardless-of-cost
438,361,249 *2C68F662F791097A9E5395921034376D337F5EA0 renatoputz
438,361,250 *2C6D1F916C1A12267E1B0558623A7926BC19ADFB [email protected]
438,361,251 *2C6693747B01893E01E23581F5C5CDB774CD4D41 MARCOS.PATRICIO
438,361,252 *2C6B25B3614FCCE05F9E8D6ADD54C648E02D18B0 RENFERMERONTS2
438,361,253 *2C69388CDB1FDF85AA041A7D8DF2508CB93A1157 marjulian
438,361,254 *2C6E5D2B661F7A05138E7B4F0D3A44DFE7822D84 MARKUSPASSION,BWV247:CHORALSATZ"DASWORTSIESOLLENLASSENSTAHN"
438,361,255 *2C65612382011EB398EA7D5690AF1B696D270A19 rhodesijská
438,361,256 *2C62884003FC76982811AF9D193DCFB08F841BE9 11.SEMINARISTEN
438,361,257 *2C630FCDC1D5608499DA8BC2F839A25060578E66 maulted6
438,361,258 *2C64470E63FAE18D5C2DB88B60827762ADF4F375 MAURO.DELAGE
438,361,259 *2C655C098D7651C902868CC1991DB95BEE3B7ED0 MAXII KAEWDEEATSADAWUT
438,361,260 *2C61F86549BC506362459C22296598B07868C35A RILEYPLASKETT
438,361,261 *2C6E4163F96E5F4E98EA61DB3D4B9162FC550092 MAYSILAB
438,361,262 *2C614883BBC805394A13AF12517AEFCD27492551 RISEGLOBAL
438,361,263 *2C667746B3263746AC2D82097A6F2A5942BED058 13MOZART
438,361,264 *2C60212309B465ECBFD0F8F3E94F32DEB449D62E robertbanta
438,361,265 *2C6E1BAB03245C0C7398E4827CAB48A1B0291551 ROBERTO.BOUDREAU
438,361,266 *2C6F0F17BF7548216E7AC8BE77F9165568606454 mdccxlvii
438,361,267 *2C60803771537BC33E341D155F23241B939C4D18 155.birgitta
438,361,268 *2C61BF52B168E31CAEB0F5B446E5492E694C188E MED.RYTME
438,361,269 *2C6D2491BD5D2B154FCBFA257A54593079E02C45 roberttouton
438,361,270 *2C6700A6FEEFCE371A9B36855F798C8917B921CB robin.hewlett
438,361,271 *2C65F094CF144F3D63B5ABADFBE351CCBCB27209 MERLEJOHNSTONBAUGH
438,361,272 *2C681222C3548A1C1767D0334F76460F7FD7F04E MERLEPROW
438,361,273 *2C6A911132939AB823475FE82FCAFE5A6A389C5D MERLINHEIMLICHER
438,361,274 *2C6A82E4C1F6C25152E47639C2D2A589B8271835 MERLINMALIS
438,361,275 *2C61E9000451E0C53E3632D662DFB1478EF5CDE2 170.deaver
438,361,276 *2C6898EDB11816330E1A148E2499C91B9837C6AD 1731179 JEAN-PAUL SARTRE VAJAA KUUKAUSI ENNEN KUOLEMAANSA .
438,361,277 *2C6715F6FBF9C28FC9C30A375D5A5B92C92DDBAC mesefolyamok
438,361,278 *2C6D0907DE1AD77541D1C441706440CA3179D6B7 ROCK'N'ROLL2NITE
438,361,279 *2C6A497DECB49EADFB1DB924D39AD0F76FB43FF8 roderickpansini
438,361,280 *2C68746A6DFDEF06045A210660D469F76A548506 [email protected]
438,361,281 *2C63B79FACA80D92CB092A45578B3A85CB3580B7 18colibri
438,361,282 *2C6356FF57BFE22456092B4DCD6593373E57466B MICAHHOXSIE
438,361,283 *2C60742DE2D417F16A1E01D815D19A621BF48665 1915688 anonh
438,361,284 *2C6D0131EF131D4C28004B5607590D314CD2F713 [email protected]
438,361,285 *2C618201CCF043ADAC4885B09DF891C1BCD69859 ROLANDO.KIJOWSKI
438,361,286 *2C663B3ACB6BD77E819E093B53410D2D8BCBF2B4 1971067 THENAHOTGLOWINGCARBONMASSREMAINS.
438,361,287 *2C6CFD9AA9930891765475FB0493754D83A7D17B michelbeaubien
438,361,288 *2C6D64823238853040C4EF2450B0E6081823AFD1 MICHELE.MARTINS
438,361,289 *2C6CAE19D254C1B89245C5AF6C565C4BA787C13A ROMEO846
438,361,290 *2C65B9CD6891209E0071F37E428B525A73A32B3F 1adhibit
438,361,291 *2C6F6586B72DA4157B10812A57732F13BC100FEC MIGUELVENOMDANCERW
438,361,292 *2C615660407FA6EE14698C1B10EB55E6E6138054 1.ASYLBEWERBER-LAGER
438,361,293 *2C6C9D97A8FD17F0840BD324481F10A7D3468600 1.atlaw
438,361,294 *2C616963E4DD29F3C306E1BE84E7EC3CBE45DB7E RORYWAFFLE
438,361,295 *2C6B9BC8589D66E12EE6BC746ED9E74C04520256 mikemaniglia
438,361,296 *2C67334C42B6F97BA9970BCB2A66D8A788133351 MIKROUGN
438,361,297 *2C63DD122F249F027D0B10FE824E334F324C3B95 MILITÄRISCHENZUSAMMENARBEIT
438,361,298 *2C68E86967D3B5FBD226AB8CF4954585836B0D19 1C5B
438,361,299 *2C610522ECB4B8B92C3888242C3F2D6FAF4EA9BF MIRA10
438,361,300 *2C6084EE865BD048EB536B144A2E087A7CA434BB MISSAPRODEFUNCTIS:VIIAGNUSDEI
438,361,301 *2C6B438B6B14BCD6D138C209849CD42691C047CE 1HORROREFFEKTEN
438,361,302 *2C62BE86053D4040B473A812AF367B1A1BE353A6 mitch(emperormachinelongversion)
438,361,303 *2C69878FDE3906B6A16BE85FCC2E1BDA942F721B 1IMMURAL
438,361,304 *2C671B5DBBBB69872E323224394C582C6CB06FD3 [email protected]
438,361,305 *2C679F06504743170A5EF0136F330BD84C51F659 1.lernkreises
438,361,306 *2C66502F2EC4601C59ABE793E967A77A10DB0C7A rutinm
438,361,307 *2C652E0643533506AF233054EB40245C359D5EFF 1-minut-tiedostot
438,361,308 *2C66B08D279AA7730F0103685B7652DA0FE3B536 1.MOROTOIMITTAJA
438,361,309 *2C6A1C985730D4EC3879B821B26E9C39050EC605 1-NEPADILLE
438,361,310 *2C61CC7EFDE873D1C4A29D9934C299D78F24E135 MOLLETIE123
438,361,311 *2C6B0561B19EFEFB7986A5FB5F194EFE0E3A7CF0 MOLSONANTHONY
438,361,312 *2C62E02E73821F48A9D85EE28345E5813D7C2B67 MOOMOOPASCAL
438,361,313 *2C61114F642F43A9E86B59E3922A41CD1FDA3B4A 1-olettamustani
438,361,314 *2C66E814EE08342136FE57DDAC78FBA65F70B7CA MORGAN.SILBER
438,361,315 *2C6F187E24AAA4D7DA49C96E430E04D8E535B6A2 1paikkakuntahakuun
438,361,316 *2C6A7DF3F6EADA84E9A46088A2D420F16BCF7847 1-PARK-NEARLY
438,361,317 *2C6CAA3BCEDB3F7E2FBBD1C9AA523B4BF8F9A7CB MORTIGO9
438,361,318 *2C699822D90C28F9172041548B0E2B3B876014ED SALVADOR.QUELETTE
438,361,319 *2C6F964BDD080E006929ED5D5B1C289B42DA64CA 1.ROTEN
438,361,320 *2C67E5D50E063323136123FBB4087F006C99684A samerules:newface
438,361,321 *2C6DAC739A0B8877B96AF86189FC71125A426989 1takarajaon
438,361,322 *2C6FA537E5AFC30BD574DC0A23610CB716AE3D0B 1.TARKKAILUPUTKIA
438,361,323 *2C608FD13473D24F524332DBB1DA1FFE10719F3D 1thestephanie1
438,361,324 *2C6D89510358B41C0765B309C914C44E090BFF30 samuelrahmani
438,361,325 *2C61A27DAE68C1F36B74593CCA5648F1ED17D605 S+ANDERS
438,361,326 *2C65DA81795A0CDB005A054D7FA04799902AEFD7 SAND ON THURSDAY
438,361,327 *2C61039676583006638B8A47032D99F9F6F207C9 munada
438,361,328 *2C637C79BD892653A2C15782BB55794182D54C81 SARGMASKENFRAGMENT
438,361,329 *2C6947FCD290E62EDFD39EB6CDC97C1A33279BC8 20BERNE
438,361,330 *2C69D4F1CDFAC5E4C88FC0E0779D31F8E4B4C8F8 MYOBSESSION2009
438,361,331 *2C692CBB15941617761156E46537B5EEC70CB679 scaphandres!
438,361,332 *2C60409D2E97585E4CA6E5E7E636CEFA0E1A681F n3ur0physi0l09ic
438,361,333 *2C66744ACCAD595EC594C5E1436A91A0C78A740A schouderblad
438,361,334 *2C6668806288322E85DDD06E2BBC0BB93DC340E6 schutspatroon
438,361,335 *2C6599F12A0155A2212F32F8B4C46251E8AC9E8F napoleonharting
438,361,336 *2C65F2D9C4E29FC105F074BB7A09ACB82890F708 SCORPIONDARRENING
438,361,337 *2C62C8B615944BCE471BD5A726B6B5EAA3A96A2D NATHANIELBELLAR
438,361,338 *2C6AEF0A09D68463D6FD9E164D496AF57396486B SCOTTYEMILY3
438,361,339 *2C6C841DCDC352314CEC3E1B8F3509EFD6612E38 2 BUCHVERNISSAGE
438,361,340 *2C67ACC0E52CB615D89C7FA445C8AE895F85D927 2bucketed
438,361,341 *2C63B86BAA830210A7826D7A5BB3BB4E2B3E3C55 SCUBA1MEDICAL
438,361,342 *2C6EB5411D5AF15200D08564F324FD1DC4EBFDF7 seikluab
438,361,343 *2C6D486866CB0A1CB10E057C152EC23115BDF9F8 2.ohjelmallisilla
438,361,344 *2C6727D4EF0F406629AD051A87A54BFD57827EE0 2ONMAATSCHAPPELIJKHEID
438,361,345 *2C6335E7FDA92CABC1435032DC51AA84273307E0 2-SELVIYTYM
438,361,346 *2C6926C4A36E0C52567EBAB9A530DACD68C43DE8 selastele
438,361,347 *2C638C6390B7BE66FC2424498071B5ABF0B90CA3 NDOBELBOWER
438,361,348 *2C6A106014451380389B378E77F8372974970A3E seracojab
438,361,349 *2C6476EA9545CD30B6292ADB02F12DBB94303E9F [email protected]
438,361,350 *2C6A011EF3152969BA8E141936C1E2BA2AC584FF NEKORBPU5
438,361,351 *2C6295E85796AEEE182FFD058F22444308B97047 NESPOTŘEBOVANÁ
438,361,352 *2C675CFBA6838B11949D4EEAB84F2F1AAD376E13 3DTORGIANO
438,361,353 *2C640587BF9B27BCCBEFCF4ECF1A63ED386344A4 3NASIHATI'NDEN
438,361,354 *2C6C3DA034EC08E8430D06F8B03922A035D893F8 NEWTON.TRUVER
438,361,355 *2C6D7EA1047B4AC0F8007B2B2B6ED554EBCE29BD newtonveltz
438,361,356 *2C6D0FD1C9D7627CCACC7B39978FB7F716B67CB5 NFNM
438,361,357 *2C6B1EE7E4BF3BDBB5AC6A075EF408855033B8C9 421123 pupsy-pupsy-bir-kopegin-adi-.
438,361,358 *2C62B75DC5338F23B34A6BEC9FD9D191F602768D SHINSKIREMIX
438,361,359 *2C6D7ABEF70E29E7C7358963458B84E166ADB771 [email protected]
438,361,360 *2C659EA14AB8E2D44E9514F19D2B0AF30DC38181 shocheyam
438,361,361 *2C6B16464CB473DAC9BB8B165C8549C6F2B56123 475510 P
438,361,362 *2C6C0CDC8326CDC50721576D79D291D2B49ABC9C SHOWSHOE7
438,361,363 *2C62ED3DEDAA9C1D389F2D9137DDD1D7369D42D6 [email protected]
438,361,364 *2C6E189102460C41B7C4A05AE0E6855C97CE081A 4ARUJARAC
438,361,365 *2C602524A21C37390B385FFAE448F98B9FD51AFD SILVEROLIVER
438,361,366 *2C625F4402AE871F86131378479E2B6B2BD23010 NONCYC1!CA1
438,361,367 *2C6B1E9A2E892AB2C106157CB0316254570FBF1B 4KNTRKRK
438,361,368 *2C6748D39C3843A4ABF6EB9448A9A8B1E71C1B96 4KRZYSCPOF
438,361,369 *2C62CBF86F95DDED67B240B5A45D12BCFA23C1B9 4M→26
438,361,370 *2C6B96826925ABB1EF9132C31AC38392DCFEFCDD NOTATASJONEN
438,361,371 *2C60AB6ED7D7EA26489B383483A3281301AEB0B0 4MIDDELAA
438,361,372 *2C609EE7FEAD0015AF6AF036AE139951F4412583 skippy2145
438,361,373 *2C658E178472DCA3B644293A063E51FE92DA7FD7 SLIM-CHANCE
438,361,374 *2C631D7A050E86AAC65937941A196440743CAE6B O79=
438,361,375 *2C66F91D1B10D434C3F1B77EBFFD0A17B20BD84F O987415
438,361,376 *2C6F9CF0E3F666090CA81147A689D81306ECA4AF snodavo
438,361,377 *2C6166E5A39966BA18336AAE786235FE880DE945 4SUPREMEM
438,361,378 *2C61690F827CCB61B16648960937556CB8CC9189 4tae-hee
438,361,379 *2C6E8F8321D5D83C0D03F572F9EA052AA1F95297 SNOWGRRL1980
438,361,380 *2C6A7A0B62B527E086A7CB982A02E7EBE2F98E7A SNUOYTSEUQ
438,361,381 *2C65D5DE9F437A8E3B021E856FA1073A5FD8EE69 SOATAG(AUSDERREVUE'GUMMI')
438,361,382 *2C64248175B17896CEB5ABDFB3902FCEFF73E2BE 4 TUOMIOKUNNAT
438,361,383 *2C68716B5E5B9F77F1419DF671D0492591CAE435 4TWEAKY
438,361,384 *2C66EA20B21972B941BE1C8845EE27AF6F3C7B8E SÖMÈA
438,361,385 *2C6C7042C3D866E90C0EE64333C4AC82E4ACEF05 odnx
438,361,386 *2C6983415A8033FAD8BC823857D9D9F63BA92CFF SÓNHENDA
438,361,387 *2C63939D2E84B3C879A4ED49DBB9678B64A6A030 513768 asiantuntijan.teht
438,361,388 *2C661A3E2D3DDD3720CC069FCD0FEEFD24F92759 537348 esityslistanliitteen
438,361,389 *2C61F5EDD1F2934D135F10457DCF7FD429ADD941 olenharbor
438,361,390 *2C66680246A7F302D9BB6BEF72901A619B56612A SORNAI123
438,361,391 *2C6702158D1BA7E6B604CE5166725C047A932B56 551244 VAIKKA-NYKYISIN-LENNET
438,361,392 *2C6C8E5FF1809E411201AD4579A9007A546A2CA9 556051NICK
438,361,393 *2C6E775265AA727AB46E396DBB889B18AF60855C )O(.O~<-P
438,361,394 *2C60026EAFED3307BD8CF8EE1604390BFF2C65C3 SPLOIT * * @-----3
438,361,395 *2C6A5368791ABB0EC0F757EEECD2D532C4DCF0B7 sploit o~(======p
438,361,396 *2C660423165D9101E8B580047C5EA22378FECE2B spuugsel
438,361,397 *2C63AA5DB4CF2255E3BFE295A2140635DA3F3BF7 SREINNOFFIHCED
438,361,398 *2C6493526FA900709DE7FF1F52D1EDF8573ACF06 SRELHCIT0
438,361,399 *2C641A6F2568283334B786C13523E6F72EA913A8 sretsreirutnova
438,361,400 *2C672D29DE5D33FAA915BD262B12987A90C3F7C3 SSSSSSKNIGHT0
438,361,401 *2C6DFE5638C3C9025AA9BB08C23322588AB9F92C stabilty6
438,361,402 *2C6EA16DC759918618C18AAA3BB3D00E0027AAFD stairwaytoheaven(vocaltake2)
438,361,403 *2C68183725701888BD03F7FA25146F23BC5965FA OVERCROWD!NG
438,361,404 *2C6CBCBEFDD8B772FCFB9A303DCE12326FEB18D5 p1020593
438,361,405 *2C6D0B5392EC06469D9340349241AE4F8CDEEF60 STEPHANLEAZER
438,361,406 *2C6E787854A34E07948A70D839B7B919905859E9 @[email protected]@15
438,361,407 *2C6AB4E1F40A6E1FFB762DFAD1E6E2AF733D876F [email protected]
438,361,408 *2C669EECA03D184462CAF95078212A83528E45DD STEPNICKICH
438,361,409 *2C6457E04B2800D5DD1443600F6C3DFD39F4CF12 sterlingdeberry
438,361,410 *2C62A0399757B923B9F399058EA48BB5ADC87512 steve-cable
438,361,411 *2C6FD005D5CC14B2A1F985623CC0C025AE6EB391 STEVEVITIELLO
438,361,412 *2C6725D01192B620B730635A50A6D81E1471D774 5VUOSIKYMMENEL
438,361,413 *2C6C860279D98A3A20BCE09038E596A698B229DD ST-KILDA-TRIANGLE-PLAN-SCRAPPED
438,361,414 *2C63E5A4E99B83FE815DB23FF010267921BA3393 638720 kadikoyosmanagamah.
438,361,415 *2C6D3EAE12A0454704D994FB0B809EBC703546A8 654kl654
438,361,416 *2C67A1D433A3CD0B7DDCD5BB6C85E5BE28670984 parodions5
438,361,417 *2C689B0E8D26EF269222A4A5EAA09005960557CD st-tai
438,361,418 *2C64006995CEF49D2EE6C6B94A0819ACBEDB64AE PASTNEP1
438,361,419 *2C60DD0833F053789812EA1017CF2024EF96BAA5 SUBFESTIVENESSES7
438,361,420 *2C65BA9FE7C48F0DBE8FD600B0874C297B328D36 SUBHAR
438,361,421 *2C6007A019E6EA0BC1CE0390E47643DF25A5F353 p#b*.*.splat!!
438,361,422 *2C6686464A53F9FCDF0E444C1E239B0DFAB0C3B1 sun-n-fun
438,361,423 *2C602508F34954891D27D46F57019403245FA0DA [email protected]
438,361,424 *2C6B53B1E256FFF408BA8A5D7AC64CFE2A92660A pengu!ns
438,361,425 *2C6835ECA3F047E97BFC0DBE3EDF0D92C934BA38 PEREETSON
438,361,426 *2C6B094C42D5B8037A081E58B0CAFF93A851C7AA [email protected]
438,361,427 *2C67F0FD5F40E7C4945E62799A92B7307D83FF8F [email protected]
438,361,428 *2C6521C9AC809D46F713E758476D68F91695DEA7 SYLVIARANDY0
438,361,429 *2C68E0B476898524E089D700EDD64E20D8D8EFE3 PETERMARENGO
438,361,430 *2C623BE66328EC556CB04D7BFDC7DA8E188C42F7 peypus4
438,361,431 *2C6551DD3A0922CA7BBDC81431BF6307435FE8A7 6RETORQUERAS
438,361,432 *2C6A8077981F609A4DC55A7850173056A338418F t4lker
438,361,433 *2C615DD1403EFE3231E5145FCF166F037B137689 6thatvolcano9
438,361,434 *2C68A822429D5BD2EC3D3FB6A2C32B881AD1EBE7 6TNEGNIRT
438,361,435 *2C62FFC59BB02E5190391EA79EF44A203D1754C8 6ULTRATOT
438,361,436 *2C67DF4B2D13F16534F86BC7FAB039A0506E93DD 6YTSALPOTAMRED
438,361,437 *2C63180CA52740DA99C966A199332582AA554AA2 TBOXX
438,361,438 *2C6A962C4F79573EE8E3853C214DA22E51D83AE9 TETFAHCS3
438,361,439 *2C6F6DD7FF6E647A0E767E225811F2AF74876C92 7CHATZTEM
438,361,440 *2C64F7B611AD15BF7817E1EB1185B66C5CA38E10 thebestofeddiebo
438,361,441 *2C6FEFE77AA2C048C577C2CDBD7F10AD630F6B39 7FORGIFTINGA
438,361,442 *2C6A1555CC46BD83C7A55A27A58C1B0E223C28FC THEHOTINC.
438,361,443 *2C6829B62F29A2D3DB863772E75601C69CF21C69 THETEAWHICH2
438,361,444 *2C62C1A30235D74C5A8F1E076F9DF6669AB564DC The-World-Turns-On
438,361,445 *2C64AC7E35D18BFC63A04DDE5FB52AC699A6CCC2 theysay0
438,361,446 *2C6227635DB629C13EF6BF338AE22AFB0D83E5C4 7thegolfer9
438,361,447 *2C697F50ED9FD10D3062404D35C29E648BD4E97C 840poiuyt
438,361,448 *2C65FE834F3506D184B1C814FF361A3BAA10FB08 P> ~ ~ ~ SPLAT!!
438,361,449 *2C6ACD1F9BB17885A917935153EC30F5EB1BD552 87f2fea419a5dca5ec4d9c185d4234f7-speedboot
438,361,450 *2C66F3AC99ACE9BA512855CA22330EB6E6184865 8BSWFRIEDMANN
438,361,451 *2C66F7A89799B06EBF9702D87487C45B0CEE08A3 Tina-Gil
438,361,452 *2C6080BF1F9D92875390560FE56C4C76BCA7FFD3 8detaillante
438,361,453 *2C676F42A480567FB7CFB1F3151CA28B2A71B0CE TITLE_COLORORANGE
438,361,454 *2C6E424AC9E7CD1B59FBA2F0A1375720F9FE1363 8######d ~o ~o 3b<-
438,361,455 *2C63AF329D6B7C03983DEF1EDFBD1F9221BACEDF 8FINITISTS
438,361,456 *2C631A6D217E5718370DE5DC6FECDC099AB71D46 8FROSTYREADING
438,361,457 *2C65B8174DB661204DACFDFE7F6255F2FEF0BCAD 8GEISTERND
438,361,458 *2C6F1FC33AD361BBF26FFF21F95BFAA0FC8732CF TLH910
438,361,459 *2C63055F9DDCC2EB9133D1F8216FFC96ED2C8A24 8olivia5
438,361,460 *2C6C20D365215CB8E046891975872AA865A6B467 [email protected]
438,361,461 *2C6B3195BFAD8A8A9EF1FDC2BC832944738FE66A [email protected]
438,361,462 *2C6319F4BCBE0FB20AACF0E876992624A430EB74 Q}IBAA
438,361,463 *2C6988E776A42888B79C3ADC4A2F8CEBB659606F tonysann
438,361,464 *2C6B1BFF4755C8D05C92F9D68920D1DCB8E1229A 8TOORSIRI
438,361,465 *2C66B0908A2AAEFDEDCC28E640372BB1875604B5 TR2U
438,361,466 *2C60DF945747C558E35BA8070F49315B3E5CE5A5 TRACEYSKEELE
438,361,467 *2C6A9E5504654E9C80207056719969116291E6EE q======p-*-*-(o_-)
438,361,468 *2C6BBFA1887511295076508C103D8811B2FA0386 90rmandze
438,361,469 *2C6CE45DA7F2501DEBFE463910713F855C2D2E56 TRENTON.DREGER
438,361,470 *2C664F830CA1EEEA85A437D52B9DAE066FC5FB39 TRENTREEVE
438,361,471 *2C6E6826F33311613C41D799AF2BAF4AEE70E871 9ABSTRAKTEIHIN
438,361,472 *2C69E50E9BD99D7946A2349B7EED45CE0742F1BC 9ALIYETEULIWA
438,361,473 *2C67E198916EB155D08C4CDEAB821FDCAC8EE2A1 quintet-in-f-major,-op.-62:-menuetto:-allegretto
438,361,474 *2C60A7A8E034E56A8A6F4056C3A8235C69D08786 9APPLELITTLE
438,361,475 *2C6E77577E731E08088601A5D71919C8AEAED132 TRNFLGRN6
438,361,476 *2C6463503CABBE66341D1D2B00B5E0A899B2F70E QWERT761
438,361,477 *2C683F0EE347E380E58475B805ACAE46DEA4C846 r3dcl0ck
438,361,478 *2C634EFD7DEAC75A82DC162DC7B105E9F16900D0 TRUMAN.FRILLING
438,361,479 *2C6A78367FE8BE4CDD484C67AE20771781E9195A trumanskaflen
438,361,480 *2C67052BDFAC7030EC40D76F247F5A0AE8A05057 9DUVERNYM
438,361,481 *2C677067E707E1FBADCB3BBFCBCFBE65A5D657C7 9isminizin
438,361,482 *2C62AE07816A6155A255B9117B0DAB04091D0CCF turbert
438,361,483 *2C6AB21C051F5F069CD5B68151021B0BFFF04E69 TUTRUSTNINGENS2
438,361,484 *2C600B8432F1CA5ED54524B799CC5B2C6BE16E6B TXTFJKB6
438,361,485 *2C6EC4482C1F3136D1A51B676E0B3051C0BBD299 TYLERTIGG
438,361,486 *2C6B0983C1FCDBF298D5AAA7C07B3E73A6AD4230 9REALIZIRALA
438,361,487 *2C662B625A7915D2191340C76B1AC961B6B60CB9 9RLATELIG
438,361,488 *2C64727849CD105E48C0E9C704572E7FED146D8B RAYMUNDOWALT
438,361,489 *2C6B17AC85E07DAC8A23BD02A9A1E9EE45548843 u4zaaa
438,361,490 *2C6204762D02AC0E15D56FFC6F7BBA228C80B73A 9thestinky
438,361,491 *2C68DA14D999636C746D3EEA897CF6D651833195 UMOTASTING
438,361,492 *2C65FC6310861756A2713A5096AF0C9AA33E86EF a;4n
438,361,493 *2C671EB77F5E0C1C9E49D1FF9E536FB82C5FF24D A7GOU
438,361,494 *2C68D11CCDCC92EFD3E8FA8B4FF4C30C3FB1F48A RENEWING
438,361,495 *2C6E7A879CE4BBF99900BCE6FEE21A5E595D6AF2 [email protected]
438,361,496 *2C63957999C685C0D3886C6AC20C8613F9C26F0B A98N
438,361,497 *2C69A9CE62DBE52999F1ABEE4640A3A512673F4C usher-khan-bacundo
438,361,498 *2C68F79D7436E1BDBFC4B351C54B54D465D5558E uslars
438,361,499 *2C696FE258CAD2B2B4A863152AD32FD6B87D8F89 REPERUSEDT9
438,361,500 *2C6F4B72BEAE994BB65884AF2F058E7095D973A0 RES4BWTXT
438,361,501 *2C6C11D237FA02E45D6D2BA2AA2BB5E25051E5DB RESPILLETIDS
438,361,502 *2C6CD4B9205BFE4A79448715708CD9B15899B084 uu-o~q----q
438,361,503 *2C674DA6E68DBE17A2AEBB06B6DB901C97274BEE aaaig8
438,361,504 *2C6BFFA6E149C0AC2438934045B414963F34E17D Aaavi
438,361,505 *2C610759EAD2A190B4D69AD924A1D125EA49ABF7 AAAY)B
438,361,506 *2C6089F396C6297BB09ABBCAF895FE7BE3D29BAF VANDANAVADERA
438,361,507 *2C603801F308CDE4A0C18660AD4EBD539D2D0162 vanessa-saiboo
438,361,508 *2C6FC8A281AF7080B0AABCF86425B55A307838DD VANXO
438,361,509 *2C6F61BCFAE3B11977D988578434F9066269DC0A AADO>!
438,361,510 *2C6ABD9AE2C5D3B85308026AAD1360383FBB1F96 aaeua
438,361,511 *2C688AD19A21B2968B7EC0FCCE8AB4423E968955 v/>d
438,361,512 *2C6B8AC119770A3ADC30A817A832FC520CCCF56C VEDRIJI3
438,361,513 *2C6CE89207E4E5D6D67FA2A3C8AAE78B18A3DA31 Vem-Pra-Mim
438,361,514 *2C6E6DF1AB3E03D588C9F3C4ABD8F738BACBCCB3 venice.vecino
438,361,515 *2C65A6F54A038533E72CA487B9F61971B5C9B8C7 VENUSJARED8
438,361,516 *2C6BF21F9B8CCF598ACD11CC887B21588B2EB2D8 VERA RAKIC
438,361,517 *2C6A265950DC22CA07FF7E8E234D5C360074E969 a:b-
438,361,518 *2C6E03EBF61A697E733CD211B5E13F5DA1F711A1 victoria-m-escalambre
438,361,519 *2C65E859D4495EEEC103CF9563B7E6DC20107286 ABSTINUERIS1
438,361,520 *2C6A246D8C314DD5F5CA8BE6A7C7778FED27A19D ac),
438,361,521 *2C69ED97B4A701F5C76FF4F2C237E06B2469652F robin.callow
438,361,522 *2C66CB01DF781A50F4443F259A9300774CED8901 vindm
438,361,523 *2C6EBB9CA6F73C1F065C7DDFF7E65C6EEC4D5A4E romanleffel
438,361,524 *2C634378ED7363171574974480252C4ACCF0D569 adanwold
438,361,525 *2C6B623E0636E77ED8C1DA1920373E37CF9DFA28 ADAN.WOLD
438,361,526 *2C60F463C550CC9E239EDF49441A272502B445D3 ADE!N
438,361,527 *2C6DE1182D5C239E199E1D41346C8F8B7BECA448 ADIAKAAN4
438,361,528 *2C60511E384A8CAC7AF11814748BEC1C229CC9B1 V}J0
438,361,529 *2C67315F055ABCDA0863C5D397524D60BF47A5AB [email protected]
438,361,530 *2C66115105757E8726E9DDFB864D6233A7A47C13 ROSCOEBRONSTON
438,361,531 *2C66FB6A7527A668FBF2A7560503B5A2B3EF4EAC ROSEKIM4
438,361,532 *2C6A3F7B2A630FED956278D740868891EC3BC4C0 VÒNGĐUA
438,361,533 *2C64F5A12473C6EDC4251A004D4CB07CF94970DA VORAVITCHITCHOM
438,361,534 *2C60E80E9D1E883B679DDBBBA4EC1219E418E6D0 aeroporto di genoa-sestri | italy
438,361,535 *2C642689F3B49724A95787F0FE1C95938D380938 VUDFAA
438,361,536 *2C6E34C9B8547682937C90201CE0095FFDB8B05A ROYCECI4
438,361,537 *2C62F741A4CFEE9EEC69C3194252629F8E15B18F r-so-gern-(feat.-blumentopf)
438,361,538 *2C6F33DA1D950A65A2C5BF93745472AAB8CAECED AGARABI8
438,361,539 *2C64A1E1AB291A23E3D064D99CC0B2F05CA513C4 W4N$C0++ED
438,361,540 *2C652FBBF8639DD632CEC666D05DDB7A50E4DBB3 WALKER.BLAESER
438,361,541 *2C6940977BC73CCAD9735FD0599395E1AF33090A walter.montana
438,361,542 *2C6ED9E13F2C264659A73B00681BEFB804587BF9 agrajaing
438,361,543 *2C637327C2016D11342A4170C7B8DAFBC3CC9B82 WANLEEB
438,361,544 *2C6084D6DEC9B8E9870B92527E198252D9A5DAB3 ahkhq
438,361,545 *2C6D4EE8BBB65FF802FFD6DA01EF8226456AAE85 [email protected]
438,361,546 *2C69C042348C01A91B3A1432AE4B0B0535A3F207 Sai.Gon
438,361,547 *2C6A4766D0A618B030FC8B8C3ADB2A5B67FB8CE6 SAILRO
438,361,548 *2C6C6FAB4F63D1D3E348FEEE716BE7CDA4F53843 a($i:
438,361,549 *2C6D4D8669672A00ED05F7E12D73F7EC6890ABF5 SANDYBOLLING
438,361,550 *2C6CB69C99696507FE12FA34818D53220C6B5A35 [email protected]
438,361,551 *2C62F7B4431BFA2D364D384578257D810C95A511 santoshightower
438,361,552 *2C669F6882AEFED87A097B595675B5ADFBF3EC5A SASCHA GRAY
438,361,553 *2C61BF7A566E161A17C36A2BC731B3F3526843A4 [email protected]
438,361,554 *2C69B510D36C72CAE0CBF8C880072102ABA2B7A9 [email protected]
438,361,555 *2C6D88886C0A786FBE437154B3D4B975A5091575 [email protected]
438,361,556 *2C6309DA65DD021B06AA1285699F3170EA8A3444 SAVEZNIČIM
438,361,557 *2C6B2FC0216A1A7D45D8F9F0BD9D2941DD01ABF0 SBBULKER
438,361,558 *2C62D1289630751BDDEB3A299351C0D848C44A6D WESTON.KALLAL
438,361,559 *2C6D6A3AD901B3FFA7122AC67697AA0BB204ED36 WESTON KENT MARCUS
438,361,560 *2C67D573321D24D42F097362D2BE441C44A9ABA4 ALEXMW
438,361,561 *2C69476584D83198168CD0BC558F2AC5D8892D5A SCHOUWBURGZALEN4
438,361,562 *2C680AA9204212912F08AFB73797F8260620E178 WIKIMANIAN
438,361,563 *2C630BC04796A215D552CEEBBAE6C4739F3ACC21 SCITSIURTLANON
438,361,564 *2C64BF60EF2B576CA499DAD89A09372351ED3A61 ALLCOPY.EQUIPMENT.LTD..|.CANADA
438,361,565 *2C66B0B1BA5BD6D19D8F012928377089664009E8 allissaid
438,361,566 *2C613E7A58EED2BC3D1D7C5B905C33A3EEE000E1 ALMA.FULTON
438,361,567 *2C6F80313BFF711DDF4E6FF2502E438F4485004F SCUFFED
438,361,568 *2C6ED63C77489F44C073B4F8F2124FD018188D2F [email protected]
438,361,569 *2C65FA786C99F0AB20F5DF32E896DBBB9FDBD8DE WILLIAM-TIMMION-BECKER
438,361,570 *2C6D2A0BEFAA236ECD0CAD984FD192BE20BF6308 SELLGREN12
438,361,571 *2C6F800B5C116B88CEEFD102F3E615DEFB7616AE ALVINIA
438,361,572 *2C6EB0EC2A91E2737CCCBB37525943F44527F9B2 A!MH;
438,361,573 *2C6330A66686F95386096C4F3B7649A246C1DD48 AMOR143143
438,361,574 *2C648AEC6EAF6B3E771753DE2C41F4A677E7EB98 Amy-You-Went-Away
438,361,575 *2C6B5FC01DF9A1481EADFEDF7348A9AD9ADE07FB an),2
438,361,576 *2C6698E9DD430DA564843A3E949604DFB1F1CE6E SETHHOLZNECHT
438,361,577 *2C690659B46243C47277D95E49CF3A95847BA25D WITJIRANATIONALPARK
438,361,578 *2C6F91E065068366229EF4D877D59013D0020D10 WMRICKER
438,361,579 *2C651CAA3DFE20B9BD4FD6FF5735BBDF268A57F4 SHAGGYEN
438,361,580 *2C6EE0EA67071B9CDB72DF3FC46219C9B2C31DCE woodroedulaney
438,361,581 *2C68098FC46D84C1E57BCE925F260D79F0E8451B anflugschneise
438,361,582 *2C60DFC372C82FE8BD3F582AC7298CBFA24CAA14 angel.del.campo
438,361,583 *2C66D7CA42A830B368FAF90F6124AC46A70CF32B shaynehohner
438,361,584 *2C616A0C463AE5FB09A0DC86B3FAA93E2AAB2F46 SHEILACLAYTON
438,361,585 *2C6A279C5E1667F510F9B1455C1D54CA5CC8FB40 [email protected]
438,361,586 *2C6526E83696557181364CB92D63C0BF90D483F1 SHELTON.DESPARD
438,361,587 *2C6F9EF951EBA95858632B928D1D3D29FEAD823F [email protected]
438,361,588 *2C6C1D4B2659FA4EDFF96CD95A254E32453F55B8 WWWAACPSORG
438,361,589 *2C67BD877B405D5541107E8A2F6B0C862CCC11E9 SHLEIZER
438,361,590 *2C64B8E6FD86F601CD6DDBC88D89DEAF5790CD1B WWW.VARIETYVIC.ORG.AU
438,361,591 *2C688A4828661BE4D5B8F5783B8DC4A1BE344EF4 anjum.sajjad
438,361,592 *2C65CA91ACC1654C6BF223531C5987F336764BE0 wwwzoobombnet
438,361,593 *2C6C6D38D3E1F9F5ADC4E5C96950901FA43EFE4A ANNADIRK6
438,361,594 *2C69830EDB33244EFFD1E46EDA57C6EBF5B3DCB2 WZPY
438,361,595 *2C6D2B15FA97D6F7D9D75E47EB519F10F0EE2696 SHOTGUN(SPACEMIX)
438,361,596 *2C65657D67208D56F22027DE81135E6F55E3537A SHUOZJ
438,361,597 *2C6608265859444959F43DC66B5C5557BD4C8756 ANORDNEDING
438,361,598 *2C6BBE4383B9A1A978E50516E393EF1FE9A6D98B }X{~~DQ
438,361,599 *2C6C14EEBBF4458A69C2389BFE8A95F7503B4DF7 ANTIINFORMATIONIST
438,361,600 *2C6086F7B4ACA5B25F78DD21315D386FAA8D2044 ANTLABW1234
438,361,601 *2C6003D317C151ECC927F692B4645CC102F20DBB silascardenos
438,361,602 *2C6905717DB81AB91B4F1062A51D7C3F665BF277 SIMONLOZEAU
438,361,603 *2C64F726C2E0087A49F7DCF202FCAA69DE67DDB8 SINGERBENOIT3
438,361,604 *2C661EB28E0F3FA8C44F5CD713AA4BF5CCFF8458 SING-HALLELUJAH-(EASTERMIX-REMIX)
438,361,605 *2C62CFAE9D2D1EBFB51CCDFD3790AD930FF366F1 Y12345632
438,361,606 *2C6E3AB61CC8CF84960D70C924F163FBB56887BA [email protected]
438,361,607 *2C69C5E483A42AA966CF5BB5EB93EB65F479B1C1 [email protected]
438,361,608 *2C63E67EB6214FA081594916AB0EFC23E11ED939 YBZG
438,361,609 *2C63B902CFB0DE3EA490DDF6E90DE2D3FDCB9D2B ylikyps9
438,361,610 *2C6A7F483DABE695ACA9638FB6E728CD17A77BC2 ANTONY.BRIENO
438,361,611 *2C6B3223A65CF29CC984CE40F191C47417417B71 a/o/1
438,361,612 *2C6BB2E518FCC9250DD0F78262C75FFAACFB3EC7 yperphdhse
438,361,613 *2C6A2A8E33D9FEC4790A1F8DB85ECD132782CB9F sleghi2
438,361,614 *2C6F0894E333C179FF97DD9046675AD11DF36FE3 AP(B?
438,361,615 *2C679E6EAE219B50626DCE63BBD62E8BABA2A6DD aprilcaballero
438,361,616 *2C6EB32E655826B6509F0FCA8EE01D0A0FCC2198 AR236
438,361,617 *2C6698286B1B703010A83683736363E3C8300FF3 ZACKARYBENDICK
438,361,618 *2C601462F4625709EAD6B0587C445F3FE44A23BB SOMEGUY451
438,361,619 *2C6ADB93B9C6FA6ECEB72735E8BBE9C1BA8AE050 zagaraizaga
438,361,620 *2C6188E9690954BBBD353E29FBF81588C57700B8 armandoreino
438,361,621 *2C6189465EA6FD4568C50323ED6869026E702C8E ZBB
438,361,622 *2C6B139CD2E94208C6C12C5D54E2E2CB7A298EFF arnoldschwertfager
438,361,623 *2C669B152FE70D1527561C7B71FA975EC85DCFB3 SP3ND3R3S
438,361,624 *2C65EBE04069E212F3E6F22831256E7A8A840028 sparklern
438,361,625 *2C6768594AD011491A7E1573F2B3718BD2913976 SPIHSGNOS
438,361,626 *2C6BA5C051595E21607DC24E300252E04AEC4571 [email protected]
438,361,627 *2C655950CF6653A15CA6C1BFFB9399A1B463BFBB ZHOUABRAHAMR
438,361,628 *2C6C7769222275A4D963C21DA45ABB41466CD491 SPIRITOFMETAL
438,361,629 *2C6F973BEAC18EDA36E28AFB219E5C3A9CD21A3D Splat!.o~.O~d===p
438,361,630 *2C67366AA2711BC866B1A1D4FE7AA3AA66C08992 SPONFULL6
438,361,631 *2C6677F0DAA18B8E739FE854E8445028C2564859 παρένθετοσ
438,361,632 *2C67A1CC59C18D35FDB8CDBBC7C44267A9CD43D7 S{{PSIOP
438,361,633 *2C6BE8CA84BF53E274373EBF2CB14B2BE4545977 ATALLETNED
438,361,634 *2C668B2F3002EF290619A2F456BFEDCC5480D5DC ate(h
438,361,635 *2C6282628F2A5EC3D0424E6AFB496E6B727C283B atllj
438,361,636 *2C6880A925DD202B39E01A475FBFC095D080928E SREYALIBS
438,361,637 *2C611C1AD15A7BB5B534DDF7DFDC270853BD59DB aup#g
438,361,638 *2C686AC0017DBF88F2D2327103E34597CD9C67B6 authorjkm2
438,361,639 *2C6131FEC87D9AF99E2B425EC0EA2AFEC6067E30 autmh
438,361,640 *2C68C673D7E3833415D22C33A7E1531B491FAF1A AWESOMECOOLMAN
438,361,641 *2C60728E45A56300FF124CB2F8EEE9975EF6E5A2 a/xp$
438,361,642 *2C6F85E60D41FA37464E857751E516BAC49E6D71 STGEDING1
438,361,643 *2C69A7E18CBA104459DF1B90724E42DD096FCB21 B28I
438,361,644 *2C600BDE9AC738B8285ED9185647EC6526333F39 STRABAGANSAD
438,361,645 *2C65EAFC1C4E06CFAE107F90402DFB3BF5C598E9 B6h&
438,361,646 *2C615A9EB8DBA09318A43A149CC91C817CA53130 B9rV
438,361,647 *2C65192DB8E0A396F563C402AF54E4E19F8F23AD SUHDANNETOIMIS
438,361,648 *2C6180FB9EB377DC067F3DFA050787C4E13883C6 suhsrals
438,361,649 *2C636DD087C2A6F715C8648C04B802B37EF045F5 BARBIE-DEAN
438,361,650 *2C66940B4F9EAAD03F602E17154849AD20665DEC BARNEYNYDAM
438,361,651 *2C699492560938AF0BB62FFDB27D810D8999A247 sungdeblasio
438,361,652 *2C63521656DA5CB0FA397113099A59264CACAC31 SUNMAOJING
438,361,653 *2C6C2002B3DC0BA8FB493395D3E61824CCA8AEE9 BATALJERS
438,361,654 *2C634B981A67537DA504F6DD5E138E6BB6494DD4 bauwollspinnerei
438,361,655 *2C653BA20E23970BA7B8231F0248E7F2ADEAAC83 SUSSURAVI
438,361,656 *2C6007DF7A1EBF33DF35020998CEF066ACDD2339 [email protected]
438,361,657 *2C6F82DAF2F6344D8CA32DDEF7A29D0133F8FE89 SVOUK
438,361,658 *2C6486845C28F1B80E4480F185E78CE33B5E22BD SWIMMERREDWING0
438,361,659 *2C6F16FAB155C376D31CC43DD5904AE8852A6B97 BCEN+ENNALS
438,361,660 *2C69558A4F3FB9BBD4D9AEC845F6CE260F165BB4 [email protected]
438,361,661 *2C6F6F178B47D1D169AF95B69ACB93EEEE1C5FA4 BD0AD
438,361,662 *2C63233F791F99A494072930EEC87351BD79E6D1 B=DT$
438,361,663 *2C6CEFB7254ECAD4B94EAA9822FD1A08574E7CD6 TABELLENKOMPONENTEN
438,361,664 *2C63D70998DC76B01EE9C3A9C78644158F3AE182 [email protected]
438,361,665 *2C6C17B61F7030600A20EA5DC87DA84724FC4CCD benedictmabray
438,361,666 *2C64E71EFEACE5767708823A845BDD247893F7CF benniecreque
438,361,667 *2C63404D9B670E13FCB32012EEA7EE06B0FB223B talk962511158
438,361,668 *2C6086FC1405AE2867A88D4941C0FBFF179A7BFA BENNY.CHADWELL
438,361,669 *2C6DB056F8B57E6842710DCBCE2BFE834B66F22A bennyfairfax
438,361,670 *2C604747745BD75E79E2B47F76385EC9F6B5D682 berrystegent
438,361,671 *2C6BEA81F312E7230ED5584F2C3378A270A5FE93 BETOKENS
438,361,672 *2C6B928ABE4C7C25025AB692D67C762D8AFCDFA5 BFFNI
438,361,673 *2C6383748B88CA48A909A19BA62592C0854E1E8A TANNER.ANGEL
438,361,674 *2C6A618EA1BF67AA415D8AB9D60163C5C5063260 tapete.da.sala
438,361,675 *2C6B3BBE53150A5EDB9B59258A740994C157AF72 bhi_c
438,361,676 *2C6BE247036C20E51B1F94D27F3273EA28EC84D9 BHY=Z
438,361,677 *2C6ED87CC25BC1947DEED507D8B3ED647E523F7F THCUARBEG
438,361,678 *2C6080BF17DC24C3871808ED7CB3C26C4ABE4A4D bjb2_
438,361,679 *2C6B7F792FF669AA92A17432593AB96E4DF5DB06 02261214
438,361,680 *2C6F3CAE0B3E981E560C62866DF139E8569629CF the-rodeo-fan
438,361,681 *2C61D8F618FD415E90D26CFE3F1C7F40691C133E bltedes0
438,361,682 *2C61878CDB748364451EAEBA76A589E3AAF8D703 035EDWIN
438,361,683 *2C6F2B314DD98567191513E0AB828030BAF375E7 THIS IS YOUR VICTORY-5845
438,361,684 *2C658F1CDC2ADB76EAC5D9A777E414E2FF31506E bo1su
438,361,685 *2C6E281C48F0FE189F22867F9136FE732BD96FEC tiraloap
438,361,686 *2C6CB3C66982AF28A04118F6480381268DC60BF7 TNECALPMOCREVO5
438,361,687 *2C6FE1C578154AF828B91415E761676722343FED [email protected]
438,361,688 *2C6EB713A34607BAAA1C8651B78488BA6192B12A 11 nesteest
438,361,689 *2C6969782271A02272B606E9F94275ED44F6E3CC 1212609 WEARENICARAGUANSANDWEMUSTREACHASETTLEMENT.
438,361,690 *2C63F044163E6C7698B071F83318B2C2AE888AF2 TRAMPAS-PIERCE
438,361,691 *2C6E3E5C85D60CC474A7DDD8515F9A14B67157D0 TRANSMISSIONTECHNOLOGY
438,361,692 *2C61ECE99471AB114D819E27124E0E31DA364B53 1276035 THERE IS NO REPUBLICAN CANDIDATE .
438,361,693 *2C69F3264904DF163918E7ACC8CD35E623FAE60C TRAVELKEVIN
438,361,694 *2C675D77E0AD427689646419CA546BCA6B97164C trevin.youngren
438,361,695 *2C676DB4D7DDB5E80D99D11D1366C3E38B468029 trevor-s-chlebowski
438,361,696 *2C6575753AB327A1B06DFB1E18E3588D15DB6047 TRIEWTHAS
438,361,697 *2C6ABED8A6BF42E83A99B08C1ED05164976180CD boju/
438,361,698 *2C6C6C6FED0B0C7E84C994A4EC543A350403263C TRINL
438,361,699 *2C69A82D138B395008D410E95B5879EA2A98DC97 1301690 ALLESANDEREWAEREEINEPOSITIVEUEBERRASCHUNG
438,361,700 *2C66FCDEA216960F6A2B7942B9001C399CE2B794 TROXIODROMWN3
438,361,701 *2C6F14339447F2EA59CC656F2E65D8EF046F2221 trudy-jarvis
438,361,702 *2C62D0D77711F0E429440659F0D47C68C8CBCD8C TRUFFIATE5
438,361,703 *2C6D66251FC875654F2689D0F2D969A6083DAD1B TUMIDNESSN8
438,361,704 *2C67AFE7B6C59E643D2B73BCFDC85EEA45CA61C4 BOYD.TAFLINGER
438,361,705 *2C62CC28C8229954F6A5F9D6CF8DD4D0EE33EF3A [email protected]
438,361,706 *2C6A2BB73033D4716F2A00E6F1128F0C58E540C7 TURNIP2
438,361,707 *2C668FEAE7BDC7E7BA7F7623BE404CB88B0E04BC BP!TG
438,361,708 *2C63888DFE9004CBBB538BF1D2C3CC4D3404D3BC BQOZ
438,361,709 *2C6AC85678F9B65B0DD7B8C01B2DF7D3BEA6AC2C bqyi
438,361,710 *2C6014A818528514E154C96FB08F8E6B34233BEA tyronevanalstin
438,361,711 *2C624842928DDA9E2CB5F41C3FF44CA4647E7CFC U|(+
438,361,712 *2C61D14FD21C1A7A5F4CFB9F9258914F1C973A7C [email protected]}
438,361,713 *2C6B28CE9936368D7BE7782723DC312C5B0AC81C U73244
438,361,714 *2C6EDF2E7B6E338EA383B0F2D675EC7CDC7E5E73 [email protected]@L15M
438,361,715 *2C63B331D13E62283170AAA541CB5E0B721036F8 BRIAN.CRAPE
438,361,716 *2C67CED881EA6B2E74F96E8722D15909964662B0 UINNFTRING
438,361,717 *2C66F94C71DD34DF70C65C6B79B046621E6D2B4D uitboeting6
438,361,718 *2C6AC8C5760E939631094F389715EE303537B14D BRICELANGRIDGE
438,361,719 *2C673158E28D48B7C69F14981A43574BCCBA28D0 [email protected]
438,361,720 *2C68D91B2317A2F1B6DF03B776E866BDBA292ACE 1-auftaktartikel
438,361,721 *2C6B1962DA53FFAFFD6690233621B3954B8E1C05 broadsheet?
438,361,722 *2C68F0F18717580DD50B89758D7E052B76282C07 1.BLACKKNIT
438,361,723 *2C634091F7F0B03138783DA3FABEBA1D69B1956C BROOKLYN779
438,361,724 *2C6FE44B3E30C85B6D52288B93456F2BC1965565 1CCHIETTA
438,361,725 *2C6C73844F1E3A66E2F71B9840D69939C9FE7B03 1.Cemenli
438,361,726 *2C6DCE0EFEE664B214A7F27C4CE10FBEFB4E9A5B 1-CEMIKARI
438,361,727 *2C6664DB494654C44CEC5EC17FE34FFCCD4BB8E8 1.DEGIRMENDIR
438,361,728 *2C67236E8526B24BD21088212A30AE09630A6301 unclogging0
438,361,729 *2C6F31E0A3CF2A237045E7FAC11D6803CB458A4F BRYON.MARZEC
438,361,730 *2C60563462DCECDD00772B02E2DDB0DF84D6CD0E 1.FORMULIERT:SIND
438,361,731 *2C6360D5629B5A0E28DEAB26EA8BA7F7564BCFA0 1-gimenes
438,361,732 *2C612300C2CF88CBB2A0E9DAC0D2AA5DF57EA0F7 1hein
438,361,733 *2C607B3CC0437577BB82708FA5F3BA15B0C1E7C6 b====)~~~splat!!
438,361,734 *2C6A77B8FBA8CD229E1C5DC5216CD6D64B4A3998 bswsullivanco
438,361,735 *2C6C0B813A32491CC0BCA1BAD24408577B3214D1 BTE;G
438,361,736 *2C634C24D510CDF5097F0959CCD04CA903C2756F 1.KIITOSKIRJAN
438,361,737 *2C6CC397917E05C4B219453F277FB93A410C39C8 1langzeit-vereinbarung
438,361,738 *2C664A31FD2BD1287A5ECF282F0C015FE92F51D4 BUDGETISERAIS4
438,361,739 *2C6564A1949EF7C1974A78557D41F7ADB492A776 1 PERUSEISIIN
438,361,740 *2C686497665799A6D14DDE94CBCF4A97ABDE88C4 1.PUMPKIN-SALE
438,361,741 *2C666E68CCAD320165D5AED4FEBD485BE291ECC7 bv-
438,361,742 *2C60684FCA7D91F0EA1CFB5F151F73CAD24DAC4F B"V+G
438,361,743 *2C626A1615EF8A5B30C4183E473272CE247B6E95 1shettler
438,361,744 *2C6CBF684814A13B35B6485A652CC511BAF5DD9C bvyht
438,361,745 *2C66970E7A361FD188CE2B8B16E091EDF6C8CC18 1.TAIDEKAUPUNKIIMAGON
438,361,746 *2C61FF56A9C9FE249CD139523412383D4FD7C028 1TAITEILIJA-KRISTUS
438,361,747 *2C6DFB6084EF76B6EE1F45AE4D06C2E9BBBE5385 1TANIMLAYABILMELERI
438,361,748 *2C65A8D3FBA578388E5CBBB32998512E5E03CE0E Varga1
438,361,749 *2C6D0DDEFCB3A3614CC614A57195791CCFA721A7 B----->`~ `~ {X}
438,361,750 *2C6A14A57E3E84B2D2C9943F211BE0C266A810B4 vaterlandssteuer
438,361,751 *2C6956C0E28DE5AD8E4402F10533012C77C7B0DD 1WOBBELT
438,361,752 *2C69040A44DAF63F6EA2A4C821D278BD40552286 B)ZVT
438,361,753 *2C62DF4DBF0B543AC8E1C65998A11F50BC850FA3 2034722 WIR-DUERFEN-EINTRETEN-.
438,361,754 *2C62640DCDB01392D20394A94014F3F4FC3A9767 VERNROSIE
438,361,755 *2C64947EF21E7D61FC9CFCEA50A7DD335D502E3A 2210820 TUOMI.VIIHTYY.HYVIN.METS
438,361,756 *2C6FFCDA4734A930B0D086DF02A61CE9827AF721 c1u5
438,361,757 *2C6DCA485EA7147E9860240610D9BB74AD01F474 VICKYSHIS
438,361,758 *2C6F5A90AFC66D7F64861C86D737F71C5767A214 victoria-carberry
438,361,759 *2C6C2837CB3C7A532F36A738E81C06D13DA2D115 2721506 EIN.LAND.IM.AUSNAHMEZUSTAND..
438,361,760 *2C677D87D3E6C9BF7DC94452C62247A30D592FF0 vida(Mov3)
438,361,761 *2C6C98CC2E6CE1EC5FCFC54689693B12CCD03B5C 2803618 einlandwiedeutschlandmuessevorreitersein.
438,361,762 *2C67C8DA6A36CA5DC6F7AAF1A3FF2DF9ACC0053B C8fu
438,361,763 *2C6229973029B3A6BB43C0535443279764701941 [email protected]+
438,361,764 *2C60C62F37F9455E73302C3BED59D163983F2E7B C90"
438,361,765 *2C6E8D73F1A7D9E7ACEDD63BC2047F16F606136D VINCEPETZOLDT
438,361,766 *2C60603356FA814DF4B9780368B8437F4F13BA94 cad123wa
438,361,767 *2C68E924AB58936E13877A262B8844805CE25A92 VINELZER
438,361,768 *2C6D57983471C4E9DF5125F0B5295D5E140A5921 のVINTAGEMODERN。
438,361,769 *2C60CA232CD31225838B2C702ACFD8EBABE3D124 2A2778D612744D06B1E78BB97F191B34
438,361,770 *2C6810F87077D9B3B05C66172571952616C19DC1 VIRENDRASINHATODARIYA
438,361,771 *2C6857F5A5679A5359838A014077ACFF3A37C2F0 virgin ro
438,361,772 *2C65887807F09CB46727CC65104AFD3C088AC899 visionfletcher
438,361,773 *2C63731F8717130267A3C1B4EB0D37D1B81987D0 [email protected]
438,361,774 *2C61756A7C8A6B2002511DCC1DF48B6DEB21D5F0 CALLUMMOFFAT
438,361,775 *2C6D93171B806F32B045693D9FDBF6A64DA792D3 2EORTKELE
438,361,776 *2C6C8EBE33D4836CEEAB72CBE69C0846671BFB88 camillebrackett
438,361,777 *2C6C8A5B1203B49637D9EB3673466D4DDA1B58AD 2GSCDYXBH8C
438,361,778 *2C6F70A55F4FC374EE27A335F5D34E9684F676D8 C)ANF
438,361,779 *2C6B7FB70F1B6DD1DC8870E2A8FB95B94EA4A876 vpeoria9
438,361,780 *2C6916B6C1B1AA5849EF282AB9E97AFA488645AE VRHACKYING
438,361,781 *2C69D540BD8FEA40550B0800AD55DB7D1C28B299 vukqottg41
438,361,782 *2C647DB75E0A46F11DB5A29A3184875027854B2F WAABEL
438,361,783 *2C6DF15A1941D33FF5E7397F98E14CB5F48AAE1B CARDBOIS
438,361,784 *2C614F78181933E3B3C79EB5D9119120FBA462A7 carlherod
438,361,785 *2C6045ED1399F11F65147F5E71624AE8F007AC60 WALKER.URBANY
438,361,786 *2C6F7A035B12F594CC26E8DF85EDE499FD040522 CARLTONTARMAN
438,361,787 *2C6B5F19338C679974272A39B40C56FA2B5BFF18 CARMELO.FALTUS
438,361,788 *2C63C1B885991684400933DC09720EBE58B089C0 WALLYPPP3
438,361,789 *2C683D2EB8B5FD45FB0855A852777EC67DF8014F WARNBLINKEN
438,361,790 *2C65F9CD2110AC6C74D423AF3FE574357F6E3E69 CASEY.PITMON
438,361,791 *2C6DAFB18CA9BF0C2258F0814E0EC7836DCA45C2 CASO.SUBVENCIONES
438,361,792 *2C694F61A4EC562841303DEA20D6E492464AC786 CASSETTETRADING
438,361,793 *2C670427EE7EED2F0700CE098155EE75FAE6F005 WEBSTERMILLION
438,361,794 *2C668918072B5C9C8A6359DD7DDFE490DE37501D [email protected]
438,361,795 *2C6BAB4D24298C360B35F28EB9146B3DCA4D57FB [email protected]
438,361,796 *2C64DC2371E13719181EF4D71F9B2EFD784926C3 [email protected]
438,361,797 *2C6D35954B3D1C64BDA1CF59EA64F3EC70D12DB5 CATALINSTRIMBEI
438,361,798 *2C687BD091AFBF1013B4CA98775ABEC97F71CD4C WHALES''WALES
438,361,799 *2C6FC90E4FA5DDA998446A71FAB125C1A54AE872 3======B~(0_<)
438,361,800 *2C6B7C44D4AF7DEDA6811A328AC0594829A99DC1 cb.su
438,361,801 *2C69ADE601CEB8E6E092AE27B5E2A47070F9E484 c=cu0
438,361,802 *2C613AA5ACCD15E7C02D1624ABBA29DA4E2ADD82 3DGZWOEDWOKQMC
438,361,803 *2C679B5542DD414F0D730CD308BB2096FA025C74 whitneygest
438,361,804 *2C6A4A95FB07894C94CB7F5EFC5EEFD3A76EC745 3==D~O~O.>-B0
438,361,805 *2C646F816A495EDE42489463DF6828C6B91BFAC2 WIKICOMPLIANT
438,361,806 *2C6D35E100621F68039B951393F322BD9FA165EB c:_el
438,361,807 *2C67D47B1E07FEE66EA2686967597A6DBF69F220 centerfluffy
438,361,808 *2C6ECAC7A18467E5E85566EBDBBB04B3BFCD7FEA 3.malmilohkareet
438,361,809 *2C60FECF93121145E49D9DE2639F6E1AFC53E4D2 WILFREDO.MCCALLEY
438,361,810 *2C65DEBB73E8E01D01FEF698BAA7DBAF10A3A516 3myrachelle9
438,361,811 *2C69A3C7C51DEE2060035E378004D4AD6F805A04 WILLY.OLLIFF
438,361,812 *2C673AFED26C286FA17603D2EA32D236E9FA9D37 CF4
438,361,813 *2C672D2A5970D13D4A8A33DC69E6131ECD630FD7 [email protected]
438,361,814 *2C60358C5AFCB97CD71D2970552EA39B136DA1E6 CFFII
438,361,815 *2C6814505B0EBC82DDFEE57C8F9072699D556A1D wissenbwürdigsten
438,361,816 *2C6043C303CC5F317EEB04C8740488752938EC05 3WEESHUIZ
438,361,817 *2C69CEBC2F899EF33C1A91B4A5E7E31ED5C63954 3yzinnczens
438,361,818 *2C6A9D5AEA1CD237B17716503C011CBE584BCD44 WMMCCLAVE
438,361,819 *2C66212BBEACDEAFB06F4CCC1AF215129AC84106 WNQIXNQPE
438,361,820 *2C60F74554F95D56AAB4558A26A63D84F19FC41E C&GB5
438,361,821 *2C6A4E8C405BF4879D945FAF388630EA34D9B4D8 WONDERLLOYD
438,361,822 *2C62B2CEFD9B658950AEB95EE46B1D3FD4854217 wrâldkrieg
438,361,823 *2C6189EB3B6F5BDDD6579CF72A1B967887EC640A [email protected]
438,361,824 *2C60E10A3D24E5E37785C85731404FD5ADF9CE41 WSBSMUAE
438,361,825 *2C60AD9717D248EB263D534E6520FA30EE6AB1BA [email protected]
438,361,826 *2C6CDCC7BA193FD833966A5AEDA9B12C8B62C739 472087 bu-dOnemde-bir-albUm-yapmaya-karar-verdi-
438,361,827 *2C633BF3C718440C5CEC675299F4DB96DA8E2AF0 4AKEEPER
438,361,828 *2C6BBDD80D6DF9BEA0B112DE46C9857660F9CA3D CHAPTER17-ASLUGGISHMEMORY_24
438,361,829 *2C6DF461EE97BF54239D4636B776604CE9877A7E WWW.RONPOPEMUSIC.COM
438,361,830 *2C6FDE685F7C132D672CB389E99FA8947D652796 CHARLIECAPUTO
438,361,831 *2C63AFCB18C2700AAC3E488B000B4BCFBAA7E032 CHATMOSS
438,361,832 *2C6213C4BA5FA8316F4EEB00EF90CDD6A10904DD XANDER-ELIANA
438,361,833 *2C662054188F1A3347434E51F2BE68109D3DFEA0 4OBEKANTARE
438,361,834 *2C6EF67ED206C81E7A4BF5E5F83FDB13E7DBABB1 4PALSNEKR
438,361,835 *2C6AA3F30AE6E3B7B83CA57B08602CC3597CCD89 4PISCESBRADLEY
438,361,836 *2C65887F04D55016B50776A3D274AAAC2700B727 Chp"
438,361,837 *2C62AF884354F5EB9CE5D8159417817CE33FD981 XMMTZRV8
438,361,838 *2C6236404126208596A513F641C924B2425967DD 4STUPEFI
438,361,839 *2C66FEF2373E3AE61BB326BF3D27B581659BFFA8 Y250689
438,361,840 *2C62EFA8F103F1F1A3E8CC27AF5B2C314BD326F1 chris-kneessi
438,361,841 *2C66A75302235DAB10F5B10973643FF192E8771F 4unterhaltungselektronikkonzerns
438,361,842 *2C6066FC14AC347B58BF26C7787228619BD07907 4.variometrin
438,361,843 *2C66736D6896932BB8CF45AF4E835347AC59BC76 YAYAN.TEUKU
438,361,844 *2C67F5829CB521F67CA5518843E9CBE09F1E1098 y)<e
438,361,845 *2C697B70623594BFF2B66704AA072D0B4817C9C6 yenilging
438,361,846 *2C6C39DE5630EB7AD505A0DB7CC9F77EDB124484 cigolopy7
438,361,847 *2C6C9BD976A698EB991D52A5F29781CB9522C668 cimlc
438,361,848 *2C69BD3CB18B72F81D1E0122B85CBA618E6EF24C CIOAS
438,361,849 *2C67F14045EF684EA3D635D4C9AB1738218D892D 580SEBASTIAN
438,361,850 *2C6C535EA06F702DEDABD1A5D909F14B0ADA7DCC cititamg8
438,361,851 *2C6C2F6AE3BD5F2917F302843090D34F27186B1C YOLANDAALLWANKU
438,361,852 *2C678BF27050E8BBBF8526AAE587012B1E858E28 YONY ALDANA
438,361,853 *2C623A77708497C82A4EF0FCDC81028906692434 5AWURPAN
438,361,854 *2C624AC013CA9D9190B2FF2CCA533E4D934341D3 YOUSSEFSOUKOUNA
438,361,855 *2C6A8EDC9489D4CF29FD3894087B819DB987EC1C yt$f
438,361,856 *2C6F759FC1E0027F0560C86211A086F7F49A4E8B CK.II
438,361,857 *2C607BC64108069D7DCBABAB4B75452B6BFF27EF zaakir.ahmed.mansoor
438,361,858 *2C68112273668C2231867049EEF3195211C849A1 ZABUBAJ9
438,361,859 *2C6585ECE8AE78266F6A4D17F9707DABC3DB0689 CLAUDIO.MISSLER
438,361,860 *2C666BE302E23421CC72694D74110524609D64FD zacysearle
438,361,861 *2C693420BC7C5E1711C42B8161B79EB7009D8228 ZAOQITAN
438,361,862 *2C6B0F625357E65D7DCA00F6010FD7E7EE8A5ACD CLEOCIA7
438,361,863 *2C6D6D2689309B8BDE48B7E2349FE6988825FCCC CLEOSCHWENDEMAN
438,361,864 *2C64105076728E410B580C3CF62F0886E694FFCD ZBYSZKO-53857-5-1
438,361,865 *2C6901683111908DBFE2CAC3C9384F2274BD10D5 clifford.moreno
438,361,866 *2C6B30960B169504D0569E8916DE91BBF69A0ABD CLINICORUM
438,361,867 *2C607A3D49CF94980D03D108B23617B5BE1A6C59 ZEKE-OLSEN
438,361,868 *2C652029C3C57630391B90978AB048B473AB3AA8 clltnnrnsing
438,361,869 *2C6C33B373321DB9C5AC09DA2B588AD7205F4114 5SHEEPFOO
438,361,870 *2C69857A1D1803C96BE08D277A3B2F52A3C1E109 [email protected]
438,361,871 *2C6C0818554E9B52DD1ECCFB7239531A10A821A3 [email protected]
438,361,872 *2C6F56AA4617DCE6742B28196E33897F50FBE294 5teal+h
438,361,873 *2C644FF0EF0605AF9A689EF91B5D871F8AF67266 C+ME6
438,361,874 *2C693FE9F0E4F3D495231DBA3BA1A0B9E140A865 [email protected]
438,361,875 *2C6FD53EA48F4F4C768B92868EB1C0FB63CB2F59 5UDOLINA
438,361,876 *2C619D709AD9453558370B86441E0DF0DB9D0B70 cnck8
438,361,877 *2C6D789E098AAAF89CE3D0582119E273C4A1ADE7 639.curse
438,361,878 *2C6F324613B48AA6347EF2BFCA956E94C0A1F1E6 65321Q2W3E4R5
438,361,879 *2C6D8BAA594A79A0033813F22556E45965521097 6ABBYASTERIX
438,361,880 *2C6FD33F1BADFBE4F7580BC3C5B69B886894F3B5 6ANDWHEN
438,361,881 *2C6F5E5CA9B5EF748BA8FA12409262CD471E68A4 zX\
438,361,882 *2C6790B6F089F249E8E02BE6E56FCD3E7390A550 ΒΑΠΤΙΣΤΙΚΏΝ
438,361,883 *2C671CFAB31377B31E8AF9BE831F7D07A9919895 ΓΑΜΠΡΌΒΩ
438,361,884 *2C668F8644B0D463E104129FBFBA14C8CAC03134 6CANELAWOLF
438,361,885 *2C65538A52024BC183FFD26CF1E2E9785604228C ДОУЧВАНИ
438,361,886 *2C6485F1A1EF0C1DB4CED272F29ABC3BBA2E4780 ±6DB
438,361,887 *2C6FCD01DCF2FEDC1953A5C290704B3DE9A974B8 comingbackformore
438,361,888 *2C6B1379BD32C42E1C3EDB40A8958BB500C90982 CONFIDENCIOU1234
438,361,889 *2C6F2F10EA820BEEE6CE48996A2593652FAE6797 ОТКЛЕИВАНИИ
438,361,890 *2C69A7664D376CF9183DD38F16614E0169D8D96A CONILRMED
438,361,891 *2C604C84834D7B2694A1F7638BB9E7B333CCE551 «пакет
438,361,892 *2C6A5D6EA20D2175885EC8F9D804F840FF3E442A тякунов
438,361,893 *2C649E6A5BF612CF88C9E8E36430CBBCFADD41F4 6OTATNEMROT
438,361,894 *2C6A61D9B472261D1520B3EEF58F71CE12510753 COUE
438,361,895 *2C6217FF1298D82D9CB47722C170F756F67D43D1 6SCUTORUMQUE
438,361,896 *2C6701A43A31CDD554CDB725136379EEC2E1C445 6SUBPLANT
438,361,897 *2C6C8DEADC9E36F3AB6A99777D5B6136775FD689 6WILLYCAPTAIN
438,361,898 *2C6549881F731D74EB25E0C147EA12B8C45F47D8 で夏休み、フランス語の講座を受講することが多い。cllでの生活では、様々なイベントが用意されている。
438,361,899 *2C69004E28991DB03178525164F229E433B7A067 c:\program.files\microsoft.office\office12\1033\xlslicer.dll
438,361,900 *2C6ED8F7E116A1B3E284F13F3337709DD921A315 cpz;p
438,361,901 *2C64291D39E78D5303EAE660FFD0121CC9DA87A1 cq7?:
438,361,902 *2C623AACC11817271ABCA9B6D00F299A296D311A 7BRASILIAA
438,361,903 *2C6517950BBEF1406C77371DAA85CF5730C8296E cr.nh
438,361,904 *2C6937256F1313E545481AA8F347932F3033E5AF CROSSCLAMPS
438,361,905 *2C6E4129D7F7A77DB3847C41D422364584AAB715 [email protected]@[email protected]
438,361,906 *2C6CF4B3C7B4DD63610982E16ADA27C4526E31DE CR+WJ
438,361,907 *2C657B24CBCBAF021FEF5156587AAEBA12636BE7 cv."&
438,361,908 *2C6908337578C1082339E4C33B9A896380A7F5D3 CYD%2
438,361,909 *2C6AA980B443F370B563AE7A9A872088DC7710C3 @8$0RP71V17Y
438,361,910 *2C60263E66A31541F53A3CB0B80E3C67EED79314 840264 valitus.ja.lausunnot.hallintooikeudessa.keskisuomen.ymp
438,361,911 *2C6C207025710CB2CACA36D61F016932C5EC5E6A 880226 kendi.kendine.gulmustu.aradigi.careyi.bulmustu..
438,361,912 *2C642D62A9E4301F3E8C0C16FE7164B7FD07BA74 d1bq2
438,361,913 *2C61414A0D983D1505554E0F3B902CA2E12C58A9 D291228509
438,361,914 *2C6A844F343A3EF85AB5DE3EE329DA494894E0CB 8COLORADOPIERRE
438,361,915 *2C67B61ECA4C135ED37BA994A8349EC777FD9E54 8=d~-~->-<
438,361,916 *2C65121C76B2CBD0A6527918BDCD4EB4B5918FE6 8#####d~0~osplat!
438,361,917 *2C662BCB3E567345852DC6301ACD956D5171B090 8MIDORITOBY
438,361,918 *2C62847F407FF29E6E2215743217E0CA78E86ED2 d9az
438,361,919 *2C6EA87EDC6FCDF4DCA08DA88FD05CF605C17628 8#####>* SPLAT!
438,361,920 *2C621A3E0AB1E9772820531A4284CA5C215F6BAC danielmcgeough
438,361,921 *2C6A30827C5FCF9836255D875CFFBCC29C3964AC 10-STW
438,361,922 *2C6A58363C64E72E1524ABE03E7CDFB36353E6FB 11:11#&roguish
438,361,923 *2C6133273087AC983B3BA80520044685FC10C9A8 969978 ISMAILMARULCUARSGRV
438,361,924 *2C6B523AA8ADFF0B8881581CB25C73EC15D82EB1 DAVISCARYL
438,361,925 *2C649B18D3216061AA019EAF6BFEF05495D81403 1338470 THE-COALITION-WAS-FORMED-SHORTLY-THEREAFTER-.
438,361,926 *2C655193A4DE75E48E0A334599246E693A9FD23C 9CASSIEHOCKEY
438,361,927 *2C6C0711DC5CAB8FBCA1536E085ADAAEE41507D4 9COUVREUR
438,361,928 *2C6CB3FC074790DD861169AD0B92D376D33BB4A0 DCUZ?
438,361,929 *2C67B54099692B180924FCF3DC1DC908DF2CE64C 15-DUTT
438,361,930 *2C64246E715015DA9FD7EB1DB16C03B79DE57553 de57ruc7!b1e
438,361,931 *2C67F8B15A78CA995ED5BC092D08A7DC5C098DF3 DEGRAISSAGES.
438,361,932 *2C66AD2342D909A39637E2C732A0971D43A9284E DELMER.PORTUGAL
438,361,933 *2C69143637F14610BDBBEFA0451EFF70022622FD DELTAGERES7
438,361,934 *2C66560F41D7027FF39029AFA743ED35CDBFECFA 9HTAASEEN
438,361,935 *2C6E071CF59427378952CC1DB501354848E65EFB 181152 moniasiaalkaaitseraviradaltajakyll
438,361,936 *2C65020B8F6E22B50C3F55CD70205EB9E50D7809 DEMBRODINAMO1234
438,361,937 *2C61264CED30A5363F752E453A64DAB32B7D2FA1 demissionnerions0
438,361,938 *2C6525CCFB3F37F859235855A452196BB8C74544 9LAFORICE
438,361,939 *2C66602B34298735E8AD34925EB9E3E4CB9FD5EC 9LICYTUJE
438,361,940 *2C637D6BB4E43B826BDC9162D4A1A1908BD4BA00 1921–jul
438,361,941 *2C617BA8A9A24116D289B36BB0F12877F21221F0 [email protected]
438,361,942 *2C64D72C6B0E83A55A1F9540919FFEC3486EC1B0 9PILKEDES
438,361,943 *2C66EE09134877B06E6DF439BC62771CCABA4733 dennisantrim
438,361,944 *2C6A997FE92E47F0A6FC96E330EA4004EFDECE52 DERRICK.YARRINGTON
438,361,945 *2C633D280C77F36F13FC4660B9DCCC653CE30A3D DESIMORP3
438,361,946 *2C61F1513D1F928FDA74E5582A6689F7794061F6 DESMANO2
438,361,947 *2C6A6E965E8C2E854B623970C84D51D1EA539E96 [email protected]
438,361,948 *2C6E2A0D4E93E0555373AC12DB416C20025CFC4D 1AV-EUREKALTA
438,361,949 *2C612A13E9AC18D7C3B3734C01CDD6FEFD80A505 1-BAUENHOF
438,361,950 *2C6B5FAF810D06206504DAE041E9753E929C736F 9TOYOTABOSTON
438,361,951 *2C605CBEB77999182943A8F1592DEB93FB1CF3ED detehcased
438,361,952 *2C62974923E064853598E76A39D19B66ECD2B6C5 a0t$j
438,361,953 *2C619718DC0D727AC9F14F68D497BA102BC67E4E a0x$y
438,361,954 *2C6F49342D37CBA3DA7104DE5A43525414A000CB a"1cl
438,361,955 *2C62DBB303DBE653C9FC56E11FAF8C8271CAD9AC 1.EMSCHAUPLAETZE
438,361,956 *2C680B3395756D27729FE9B77FB18ADED24E2123 dfbx)
438,361,957 *2C6676C454FD1646A4A5ADC0D49EFB4E76BE2FD5 a6
438,361,958 *2C6FD2E108F31928B4584624E2F2B0120A973DC5 D%G1S
438,361,959 *2C63456B5F69DC0BA401402A65DADD0B9A3D81EE AAADHM
438,361,960 *2C6BC1E8E607CD72A98D6901160CADF1F6F7A2DB aabzoy
438,361,961 *2C6A6E49D605244D679B3895D3E671573E174C28 1.murdochfed
438,361,962 *2C64C272C4448AD0E1B257DF28976C8F461DCE6A di:l
438,361,963 *2C653D1E6341CD46BF0B5EDB8E1A8A433C23C2D3 DJTSM
438,361,964 *2C67E7F50C13DD2E2EE0CA8FD25C17CBDAEAF3D1 ABBYSASSY2
438,361,965 *2C60091CC56A470D9EC634CC3382E2ADECB9A4BA dl(g_
438,361,966 *2C624C3509B42093236E71F485C0E12881377F3D 1.TUOTEJULKAISUIHIN
438,361,967 *2C6306DB4B0C9955E3FACD3C0956FF5C81794750 DOBROVGM
438,361,968 *2C61C836CD29D31913D9DD03D0D4531E6C8CF595 Doeconomic
438,361,969 *2C6B7C39BE3E01396D95638C9AD10F9969D04652 1.vaiteliaaksi
438,361,970 *2C6F237C3E69E9D64B432DA2F8465DE5B980CD3E 1-VERBRANNTWORDEN
438,361,971 *2C65E3228FB0777F06EB7185D26EE1DE3E27FEBF DOMENIC.BIBB
438,361,972 *2C6ED7A4AF997D0C676819AA6A595594EE88C836 ACOEI
438,361,973 *2C63AF2C34DDD91E6AE0FFD34CEA5CDAF48A68CE adcga
438,361,974 *2C69360622E9F415DA4D680D76EEAAE77F3B661C a-de-benito-torrente
438,361,975 *2C6FA0286A33C515001B7034FA3F860852D58D62 DONOVANSCHWENDEMANN
438,361,976 *2C63CD8D3CAB0DCC2D193AFCF9BD98CF4E0D170B AD(G
438,361,977 *2C6B7C4F724850450DDC81F8A29AA1C8C57600B6 2278257 KURSSIENSUORITUSJ
438,361,978 *2C673A2725407C88377768C3AA10718C45603BBF 22TELLING
438,361,979 *2C66D75F2966F082E965EB3A8EF1857554581151 draaknor3
438,361,980 *2C6918FF4A1406BAB6A3F585EBAEEC2B9BAE42B2 DRBRYANTGWOOD
438,361,981 *2C6723CD4ADC574D196CD92FE836ABD755AA5876 AFFIRMATION84
438,361,982 *2C6421072B6B6D57C1BCC379A2F8274BE4649372 265JANE
438,361,983 *2C64ACCC8E2F511B9B70AB4C4E79290A3BB74C1D 272303 EIN.JAHR.ZUVOR.WAREN.ES.SOGAR.949.KONSERVEN..
438,361,984 *2C6BA201A0294DC58251649DED4D3388BAC35BE8 2755656 ERGEBNIS - DER ZWEITGROESSTE PHARMAZIEKONZERN DER WELT
438,361,985 *2C681B40EA9B8CB555B75E9546CBF9B58AC25E2A 2796461 mrbohlerwasarrestedinmarch1992.
438,361,986 *2C69FD32DDA85DD7AFE75D20857BE3F2DCA5B8BE 28JANUARY1320
438,361,987 *2C6F3589D7507739033CBE6B86B84157D0467C3F 2.CABERNETMERLOT
438,361,988 *2C6AC6A27D5B1FF5EC8BF513D4442A7F7E67A630 ahe((
438,361,989 *2C687633C2AD508D7B7AC0B56605E481A06972D4 2GLENDALE-BASED
438,361,990 *2C634E59C8CE0F7628D79BFAFD2D375C326C066F ahwlt
438,361,991 *2C6908345B593B5C8C3392B4F0DE9FDBF4B62C7C DUUDP
438,361,992 *2C6A9EF7CAABC3215321F83745E2D53B26782C10 AI-YEE
438,361,993 *2C6051117ECC25FD0D17771F88B41BBCD7B6F9F2 ajbw/
438,361,994 *2C6EF1C5A5C6CC688ABE23D910A79E01E7EE2536 DX_#F
438,361,995 *2C6D8E62C431BCBCF8B2A26176CE9A0FFA47A880 ALA2T
438,361,996 *2C628A25A48C05DDC72A6572510DE2575F1E8DFB 311323 labeling human-readable output
438,361,997 *2C6265B9DCDE4B637B91E48FB5C1FA044F08CF15 +e+4nzes
438,361,998 *2C603224F39C4757F0E9C1E7D8C0176A74BCEDDB 363173 auf.wichtige.beschaffungen.muesse.verzichtet.werden..
438,361,999 *2C68FA143E18301BE55E44B6C11C522ED3F8A10E ALDENDRURY
438,362,000 *2C6255896FA8F8D15D768C33E1859831545E78BE 3APPLEAPP
438,362,001 *2C66528440713FBC62155C75161218D04F44852E ALEXANDERDUPAR
438,362,002 *2C6E7B1BF7C6FCF6EC12805C7B09751ABFE2FFC4 alfonsotrisdale
438,362,003 *2C60672AD756F3EC3D66AA8349FB7EAF0344758B ede)t
438,362,004 *2C6DA869CDFFA99D79AE2492459550470CEBDD34 alife’s
438,362,005 *2C6A14798C5B4C330DC2E6A61ED6A7A2E104C0E8 ALJUF
438,362,006 *2C644F6B8BC0E31C8427E6963D51A7B74839AE7F ED.VEJAR
438,362,007 *2C6F86D32DC13CD699887D22C16D1D3470C66422 3----->~O-}8{
438,362,008 *2C66847491925855768703402EC7A805D76876AC 3PYSTYLIIKETT
438,362,009 *2C6B778053A6040D9EBEEE7D4D1A3BFA352FF308 ALOUBSWS
438,362,010 *2C6E5D684CD0FB110FBBAF7F109D3F1312E74E5A 3SVANIREI
438,362,011 *2C6B2ECFB8C72320D8F1A1966CEE4609533AD19B alsf/
438,362,012 *2C64A260DFBBA6163AC9E60C10B13B78BF6DE944 ALVINIA
438,362,013 *2C6CFD8D2F5963AD24F0A6FD818379A35CE8C4FD alvn!
438,362,014 *2C631FCAE6AACD8F043E3AD49115F3C3B730674F 486AUGUSTUS
438,362,015 *2C6785E4131EF1AC0E69078629020AF85F4D00A5 4 churchoperated
438,362,016 *2C6A58D5503FABC851F581A0DB4F46A08826EF0E ambrosevandon
438,362,017 *2C68280DFF451F7F5852B070019FC4BFAE465E07 4FA60AD60BD1D345F2070D3E85E5C72B.EZXCOM
438,362,018 *2C6C29B4D15E9C143FA03B538F0C062AB3EB8524 AMEMELIWANDO
438,362,019 *2C6B81AE5A604AF6D1A7AF68E67AD29208778988 eldonsteinback
438,362,020 *2C692D3362D539F73E30A2A787583F808169D53A ELDORA
438,362,021 *2C6E519B8C44A9913C8EF02DACAE78C3A9C04C2E AMONASSU0
438,362,022 *2C66501487AB61D4D85C6815D319F31C65204403 AMOS.WUNNER
438,362,023 *2C6A38F19FD520A41512ACF152607DD33B9C3D0A elishalilja
438,362,024 *2C697A5950D5FB4A90A82FC60252888660B67612 ELISHA.STEPPIG
438,362,025 *2C683CC60B35A13801869D0D42BA41ECD3E22F63 An_0
438,362,026 *2C68A5C7E7991E8CBBAF0690A80869EF5B2CAC0C ANA-DIAZ
438,362,027 *2C6CC4A5F9639BC05D71978ED1259E113EBBF26F ELLORESS3
438,362,028 *2C6308B2DC613E12CC9DB46A9B12194CC9DDFE33 4PARENCHYMS
438,362,029 *2C6316F494DE3ED1DBDD057F87354C404C7EBA97 emailpasswor
438,362,030 *2C63B1CFC299B0025E9A6296276A6144CC85108E 4STEENTH
438,362,031 *2C693E26EACFE2B2F7BF2CDB81C8AA490DA93B63 4veldbed
438,362,032 *2C6045A0BD253B3586D3129E24AD181D2CF679E6 513192 DIESER-VORRANG-WIRD-AUCH-DURCH-DIE-IKONOGRAPHIE-BELEGT-
438,362,033 *2C6415B6FC97254BBFAD47F2668943C3221D330C ëmsiidler
438,362,034 *2C62C28E68FFCD90A9F5D017BEB9C1B14B00D1BE ANDREWMAGNOTTI
438,362,035 *2C624892DC0B1121F057FC6A90E45102BD1D8CFD 576476 THEY REALIZE IT'S TOUGH TO BE A SURFER'S PARENT
438,362,036 *2C69595BCD37FFA1F1DE58D2CB107282A73E2B67 angelbutron
438,362,037 *2C6E3CD5F75702FCEF7F4AEF379E2A70551B6943 5af49f17dab53d978981839ec36e74a1
438,362,038 *2C6508365767F04BEEC07985455FA458C160591E 5ANEGABAS
438,362,039 *2C60ACC61E6ACB73E64040516E89CF98605F593B ENLISE6
438,362,040 *2C6E33C10C3D8C97AECD29504B1899900F4B7B91 ENQG5
438,362,041 *2C63C6249AADF544A072AE50840B247BC7D00191 +EOCRAZIA
438,362,042 *2C6CB7ABCA3089804B3074E7247D16BB09CFB992 [email protected]
438,362,043 *2C68C09D5AA4D5508FB7532A6E65D8A6F80E46E8 5ESPUELTE
438,362,044 *2C6B8F043091E02140114D693116F8FB6CAA7290 epfc7
438,362,045 *2C60BA6121740F90EDA7A0254DC56F0E19D6A2DC EP.WO
438,362,046 *2C6D63DD661243F0ECC014F07A90DBAC7AD60D81 ANTHONYSALSGIVER
438,362,047 *2C699FB98FAC0C23B9B0D64F880E1CD8EA6EBBC1 5IAMANGIE7
438,362,048 *2C6B2980B5D711C98E021137DB7309C5E4CD49B7 aoe#
438,362,049 *2C6E82B84B21D49987DEE729C36BFDF080E4758D APARTMENT-NOTHiNG-TO-REPORT-SUSPECT-STiLL
438,362,050 *2C6C8C9445C7690D5BA9C6085749BBDCB0781A12 er!p
438,362,051 *2C6416CE363707AD1F2FFB80D181287837CA9C45 ervinwangberg
438,362,052 *2C65475D60B1C2267A7B4B8B77BDDF2B474EABB9 5ONVROUWELIJKS
438,362,053 *2C61D5FE2EBDF8AA8465CF29EE34BB410FBACF3D APRIL.BAUER
438,362,054 *2C6185EE0F25BAC18AEA54F45CC6D2D93A12EF83 aprophet'sspeech
438,362,055 *2C60F8E4AB9EA657956DE9507B9E39ADBA7269BA ESCISYHP
438,362,056 *2C6A7B7CA8618E1270DF87BD743F3E6DC0EDE99E aqfpu
438,362,057 *2C65FCB795CECCC26B5BEA1ABDB633F60B8AF2DB 5spd-vorstoss
438,362,058 *2C6687B6D22AB8923FCD924A2B6CE18B4BA8AC45 arielbmw
438,362,059 *2C600CD2339656FC2597F33EC10DA30AB94D30AF EVERSMEYEROUS
438,362,060 *2C677CB30BA53C6B326A7BC4112AE258D81E8097 6ADULTERIZESES
438,362,061 *2C6AB0DF0BBEB283BD6E1531BFD9C0346571822D eznalzlane
438,362,062 *2C6A3300F9336EAF4DDAB54C4BD1905C788EFBF4 ARTHUR.BORATKO
438,362,063 *2C686734CE37226B123C7A9171E8D2766B19D23D FAI949
438,362,064 *2C6B792540C6B94765A10E33BAB3E917DC54B481 6CAMELUS
438,362,065 *2C63D4B93C6C802ECB3E7B54652E478038C5D882 6DLAAHEGREEN
438,362,066 *2C6170886622AF970AA9FA8F5ACE7D7EB6C02B9B ASORGUNG5
438,362,067 *2C693B9B56F99FC998926FF43E5022ED7782E45C 6ESPANTADIZAS
438,362,068 *2C6993E0F40D952C624908F7B935D0D112A606A7 [email protected]
438,362,069 *2C6FC70F38B4A1956226F819258C3D090786DDB1 [email protected]+0R1N9
438,362,070 *2C6162A10C0174858F06D28E52CDD468E47230BC 6KAMICHY
438,362,071 *2C6B0996767134106F50997B80B8C78219916260 6KOMITOR
438,362,072 *2C657E4A462AFAD918857C3E6FC2555F26073253 FELICIAFERRIS
438,362,073 *2C683F1927E7DFE5C0DF9183D00EF405B30016D1 FELTONBATTA
438,362,074 *2C633ED57E9229E9B6680193D058116F87B89CA4 atepu
438,362,075 *2C6FDAE3569AD54DF82452B436417A6C4FCC9215 ATTEEKSI
438,362,076 *2C66251AFFB9C08665ED8C55EDC37D8B323C3777 FIDELMCPEAKE
438,362,077 *2C665E8F772A06283C1849D7D88C8C4C8AF71476 augustineorso
438,362,078 *2C682FC8AB66617181C290C48323FF3567A87028 AUGUSTINE.VAUTOUR
438,362,079 *2C6CEFD6642E64B8C26E23F0B8535F9D95C3DC89 AURELIOBITTER
438,362,080 *2C69A74EB34943440ADC5B4D70597F59853598D9 715542 p
438,362,081 *2C663E0A53110ADBDDD73A49801ED72D908A889E AUTIOMAILLE
438,362,082 *2C6BA947AA249003B6AF587AAB0AE387E2B5124F 7AJDNAHAK
438,362,083 *2C623672CAABC47A8DD6CB9D2263B6C1262D77F5 FLEA-FROG
438,362,084 *2C6BAC287B6FD30E6C68CF44EDE3327F01205C3C florenciohalstrom
438,362,085 *2C6B588E358F88531DA00E36D0C56EFDC6006513 FLORENCIOMROZ
438,362,086 *2C6CBB33BC20F69018CC89925AF04FE232E6C5AE 7CAPARAROCH
438,362,087 *2C62EECF3693D6CAA89CD6BFAD777D5A07DA1F3C 7CCLTRTNL
438,362,088 *2C646CDA8210720A8CF3513FE7C9AA82A4DF6B75 7CIHPAROE
438,362,089 *2C6B07DDB304E3264C9A30082B57A2E978B41E2C 7CUAROPJSCVGEATH
438,362,090 *2C61EF5B635666F5D458DE7028A735158171B145 fondeth5
438,362,091 *2C67B4FE02CE78F565C709F0852592A0EC406C2F 7NAPLESING
438,362,092 *2C60765FC23519C84CBDD8E223CD3D900FA98652 7O'GRADYS
438,362,093 *2C6C17A51DBE4145BF738E1DFD8D59E3B5D7F4C5 ay5cf
438,362,094 *2C6D711A2ABFE6144C6FB20F0BB71238C6073D41 [email protected]
438,362,095 *2C6339A5756E90E19ADF4D8B179E2159EBBC0176 a)/z1
438,362,096 *2C6CE455CBA647660A7B06E92A94C47ADB433A16 7STRNDVNDR
438,362,097 *2C64EDC7A04C6A793AE91B2FD42ECDE7B57EAEC5 7THAMESED
438,362,098 *2C6107B3950CB292E4CA88E734CA41062E1B1174 7TLUMOCNICICH
438,362,099 *2C6803099C78850F259D7FF8D0300E07116E5665 azy&
438,362,100 *2C68940C19BA3F37F1921F92F104F4B0A5320C29 818646 ongelmia-ja-yll
438,362,101 *2C67E9CED1F21AF940E87A714FEACCACCACE82DA >B0 O~(======3
438,362,102 *2C610D2166CBC3F141CFEA7322E6129584D3C038 8AQUAFINA8
438,362,103 *2C6EB40C95206E85F6C3FC2FEEA5721DA3036FF8 8DRABMUL
438,362,104 *2C6D783355A33B6EC3277DD7D2249E61826CB857 8ELEKTRICITATS
438,362,105 *2C63A466586785E768A84E31B556FAF7CC2DEE53 [email protected]
438,362,106 *2C6C6ADFDA0FCFECE84DFE163110A9CCD795FE58 FUND-HOLDERS
438,362,107 *2C60FEB4C64DCDE595B1C0D15F6372C2C2B0D65A B5j&
438,362,108 *2C66DD70508723FA4C35D494EF9C0F8BBC99D73D [email protected]
438,362,109 *2C630208EFCDBC85D1646EADE3345EBC8AB34F0A 8INFANCYS
438,362,110 *2C6C406C138BFD787763E2BA87A5D7788B605684 8IRONMANPIERRE
438,362,111 *2C6A1DA91AC147F1057CC3E9956D52AABFACA2D2 G!2B
438,362,112 *2C61420577E11FCF7B41E29A7BF6096427E7442E 8P~0.)0(
438,362,113 *2C6AC8001432D08EC2F1989579F6BF430BF0A672 B9FD-
438,362,114 *2C64CC2355E0188AB14B1EC5BEA269083195F8F3 8READERTARDIS
438,362,115 *2C66D61AB193A0EB355CD30EF3306B8ABE314C4F 8SBARRIAM
438,362,116 *2C673FB6FE80CF14C1820BE982D9D5089D442B85 BACKGROUNDTHIS
438,362,117 *2C64FAE88AC817FCE561BAD6DCC64BC0E97B1DBB 8STUDENTPICTURE
438,362,118 *2C6F1BDAC1F787CF99C4E08D134616F7A18BA2B5 baguette是由19世纪中期,
438,362,119 *2C61FA39F726FEDB35C96175E238666662415FF4 BAJOMILLLAVES
438,362,120 *2C69AEC9FB9C40D2C0A40515D3FD38CC55A241F6 930KAREEM
438,362,121 *2C652B2488BB9B261839DDC4581997712AE95FC6 BAMHRA
438,362,122 *2C6B1AD3A5521FC2447C7261A893E7754C21583F BARBARA.LEA.&.KEITH.INGHAM
438,362,123 *2C6BEF2E1B9B6B75E31F749AA4B0BD7AC7904087 9CRNKINJO
438,362,124 *2C651A720712C84EF2229571533C3D82893FC50D GEMEENTES1
438,362,125 *2C6019EE893AF117E25C59B39849841F7259B263 gengibree.pa
438,362,126 *2C62172933C99BAA3FB80B666BC27851333A0203 BAT'ING
438,362,127 *2C63006FB4516E82BA8F7E670EEC2E2FEEA8AC59 bbea
438,362,128 *2C6FD1D0D155C28F9F46116A15E50CF3D4CA8835 GERRY.MEANS
438,362,129 *2C63E88EA06E86AD3BDFBF5178F3BDAC9D2A74C0 geslingerde!
438,362,130 *2C6BE30B23A7FF7817B7E9E3AA50F979B6659024 9OLBTBSW
438,362,131 *2C6BA3445ECB17AC10D2F0D3584012BC941BBBEE 9OTEVITSI
438,362,132 *2C6122CD9B16B82CF7B0286E265868D2EC48DEFE GHANSHYAMCHOUDHARY
438,362,133 *2C6C8A34646E63487977D71E27DF28C5378CE694 9PREENCHO
438,362,134 *2C6D70492D24140D3311B80695E4F645E90B35CB GIBSONCHRIS
438,362,135 *2C63E3ED9FFD697FF2A136B48B4733DE08C2EFFE 9SESSERPX
438,362,136 *2C6D0F2543C530F4DD0384576B1E6A7F17F6BEB1 be7du
438,362,137 *2C6ADBCBD34C82ED47634A972E93EF734BFF3EA7 BENEDICTGUARDIAN
438,362,138 *2C6ED77FFEB42955401703096CA9CF405B8E5539 BENEDICT.TRUMBULL
438,362,139 *2C60C9FABF381351353C21DE426E4838D6C05606 9YNNESTE
438,362,140 *2C67D038020832526F5D4A2BE324F0E350B7D642 GLKTRSRD9
438,362,141 *2C6D9A2077CE383305E4CBCFF335C25637AEB489 bernardarcadipane
438,362,142 *2C676702F9EDD7D3A07D0B856AA2CBC71F995340 a111111111111111111111111111111111
438,362,143 *2C642583DCA7CEB3E6F929CE49B6ED65FF1515FC BESTIMMBAREN!
438,362,144 *2C6A1D4D06D26997C4A6E4D9B08056BA14F8E6E6 a6cpj
438,362,145 *2C6288B2FDC75FD737ADC561B897BAD6021D1601 A85DM
438,362,146 *2C60BDBC104CB1365EC355171168F41AFC919EC4 BIBLECHAPS2
438,362,147 *2C6E369C2B3F562329D0BB812809EA216274DDA6 [email protected]
438,362,148 *2C6C0952384F7B1AA295CD7FF976B79F0971E043 bilious
438,362,149 *2C675FE1DF200DF00ED88EDA37D85996F5DF9A3B GROVERBROCKNEY
438,362,150 *2C604FC2563C0E09FFAEACAD108E1D47937302D3 bipinnatipartite?
438,362,151 *2C6689A392EC1C330746AE5AA672918AC3816B19 BK8_R
438,362,152 *2C6F19C347277FFA023AD929B5134AE9005D9D28 AACVL+
438,362,153 *2C6442FA84BCC9F017FE8A1EE9E60880ACB7AD1E b<l
438,362,154 *2C6004EED031A25E217F4927A24F09FDC13159F1 [email protected]
438,362,155 *2C65ADD4B1FC4CC958BBCBD105D9EFE4D542D3E3 abelkinton
438,362,156 *2C62F6059D29B68487373617511FFDA04E1A53B0 ABE.NOVOA
438,362,157 *2C64D78263577CD74CA0A52968BAF2A00EDCDD0B blimpwork
438,362,158 *2C6FD11123A5B41D1CEDE9533A26309CE262E565 B##N7
438,362,159 *2C6187173B8B25AA2B7655C07AA0029D9A28A81B acta-de-algeciras
438,362,160 *2C6EEDAAD0306DC7645E5641358635E3D9ECD8B0 hansboiani
438,362,161 *2C6F1901AB52BE85E2563B44C9ECD087BE50E53B hansikkaita
438,362,162 *2C652F90F23E91B782F183E66CBCDDD7CF9D0BAF bohendson
438,362,163 *2C6D7F6FB5AEC71D39A3501D403BBB35B4A561DC [email protected]
438,362,164 *2C6278B8075FDAFDA0540311FE715B333AB9CA19 BOOKSHEL8
438,362,165 *2C67D21FE7EFFF16DA63CBFF130599770CE764D3 adq1o
438,362,166 *2C6CB91B1A827C05D66B67E2FAB9DCFE4CE168CE BOW3R35
438,362,167 *2C6CEDC53FEDF47F025339783E44288E616DE6AB BRACEROARCHIVE.ORG
438,362,168 *2C6947873A65D28A219E5D246610673DD2122DD3 bradfordduonola
438,362,169 *2C68C687B3AE959CE710F5CE87EE83F81E4D0132 BRADFORDODESS
438,362,170 *2C65A98AF38345E5EDFD4033E46A9C2F00779BAC he played real good for free
438,362,171 *2C6E02BA34483700EC7D76332EE5A9AD4FABBC40 agg%
438,362,172 *2C6B660EC39733C2F49D1C165D2125502E1DEE2E HETISEESING
438,362,173 *2C6F69CF15644F35699CB003D226C354CCBF728B [email protected]
438,362,174 *2C66EF06412D0102ED97814691F0639BA87E4C58 hnpe
438,362,175 *2C6B296FC3C1422BC266D60E9338C32E9683BA2F AJPIONEER79
438,362,176 *2C6C33A6CD5C97AF503D0E680BF677981BFB50DC HOPE.(EXCLUSIVE.ACOUSTIC.VERSION)
438,362,177 *2C615B2FAC9295E18D11ED7D79EA790E525181CB hotspurs
438,362,178 *2C6A89347B18FA55960503AF2E47ED18FDB99760 HOUSEOFPAINVS.MICKYSLIM
438,362,179 *2C6225F9D6A756303DDEB4AD452B6D0F5BBB50CC BSqR
438,362,180 *2C6F28B4301911EEC7CD274AEB978701F4B413CB BSWCESKOSLOVENSKUBSW
438,362,181 *2C67C14BB220235A7E39D707EB0EDEA605F95617 ALATIGER3
438,362,182 *2C6D9ED043C7D631093750D4476056FD0C8EE60D [email protected]
438,362,183 *2C637CCBB96939E4F5391E80E3D887519C20B58C bv-
438,362,184 *2C642988E9EDD8D0F91291B29D3D090C7BD0B92E alonsocavins
438,362,185 *2C68C862C1CB137A92E5ECBC1400EE458DDD46BF HV;
438,362,186 *2C6FB40E6166852D566523576492A5FF1F5F7C20 AMT#D
438,362,187 *2C62DD2AF8931B3673A44A9A02E9E526D1DDAAB8 c/"3
438,362,188 *2C6BB9AC2312871BB590ED90482E9881B8174126 C5,2D
438,362,189 *2C6D29A3DF60F89E12620E1911D47F1D503ECA5A iggardly3
438,362,190 *2C6A617102A9FFBBB9B1572FFBB8FDAF963D8404 ILUVDIESEL43
438,362,191 *2C65EADB91C204DE9136567B141FAB16C33CC491 ANLAGETIPP1995
438,362,192 *2C6A34A385C0C157FD60927246398340E40561F7 Cancisn.Para.Una.Noche
438,362,193 *2C6B97135688A900D2D99B27D15448DDBCCDDF24 ILUVREDFISH1987
438,362,194 *2C6A454BDA5E143296FEEA4A74E45F5BCEBE0E02 canto alla vita
438,362,195 *2C6B64B39222AD65C7B647AFBB2AA63F784E768D ANSPORER5
438,362,196 *2C67A232F77ADAC5E38C2F2B359DBD9B9DC198F6 imperato..ih0.m.p.er0.aa1.t.ow0
438,362,197 *2C60278B7FA348DDE0189F21FAAF6AC7141ACFBE IMPRCISION
438,362,198 *2C687AC7800D063B988342DC3FBA709CB773666F ANTOINESTONEBERG
438,362,199 *2C61D23FE8FF476E72555420737C69625BC01CA7 CAROL.WARLEY
438,362,200 *2C6D18D4347A0C7BD9E3DDF6377AFBC8EB911B7F CAROLYN-LAVOIE
438,362,201 *2C695193C2D1240773913D2987ED5D70205EB200 CASK5
438,362,202 *2C66732EF0BC244B9CEB9469086F82A43A3C8FA9 ao+-f
438,362,203 *2C6D52EA7BB8E4A9579CF12A81333B29059C8F05 AOUNZ
438,362,204 *2C6FB14D3F47B7233F20883C1E393B7C03EB9591 apcrary
438,362,205 *2C6F2E1F04574594F3A7608545E6ED1DC13ED18C C!DS0
438,362,206 *2C6402B8D3D984B06723BF09F96399BF558AE276 INTERMISSION:LOSTINSYNCOPATION
438,362,207 *2C634FB17320F120316AF550D7679FD936D7AAAD AR5E
438,362,208 *2C64D8F046B6EE24F8A9B8F5FC175E67AC1FDA72 CENTREVILLAWOOD
438,362,209 *2C6F16ABB48A5E50E69FFCB15131E9D26FC20145 arielbmw
438,362,210 *2C64ACC9ACAF668261AED9A651683627AEDE360B arielnelton
438,362,211 *2C695A63BEDA9087BEFCEA15B3B53C252E892C87 CERICT
438,362,212 *2C67216D4AD5BE3EEF898B10900523732FE281B8 irwinlipschutz
438,362,213 *2C64EA09D099CEB14B7FEBC8530A03B2AA56E667 ISAIAH.DEARMAS
438,362,214 *2C685A49EB98108E257427B34A45F676FD841424 ISIAH.PETELA
438,362,215 *2C6F8E1259AF0B4E2D66ADB421E9D7B023BABB49 CFS#L
438,362,216 *2C60FA5AC8D8A192252DBDA811BCA77720778ABA CGTQ
438,362,217 *2C6FA8F5AC2EFDF461BC2CD4F2336E687CFF2720 arw"h
438,362,218 *2C6068C40D2693354B6FFE020772A99CDA7A835F CHACMOOL-TYPE
438,362,219 *2C690D5B11FA1E423E62127FDFBC8E693A43D22B itteliv8
438,362,220 *2C6F3F0319F2F3D8C03F6EBC5267AF8D8C76F213 CHARLEMO3
438,362,221 *2C6498DA50FCF6B7179544E1FECE964D4256C395 JACINTOGOLIDAY
438,362,222 *2C636B26D04AD22EAE547E8DEFF81A65480797C0 CHARLIE LINDLEY
438,362,223 *2C6F9638C96BEE49886F368CC476890C3FA8365A charm.esguerra
438,362,224 *2C6B075CF8AE522F1834ACA16A4F310AC21D0D23 JACQUESTIMON
438,362,225 *2C6BB680F9553EFD57E77BD4CB11DD2F56C559C6 ASYLANTS4
438,362,226 *2C608FFF637FFB8A7B1B940449D776E5D098DA29 at%qe
438,362,227 *2C661DDDECE4AE2800757C3EB31531DA08AB4172 aubreyspoto
438,362,228 *2C68C4D7210D3945A9656B9E8780ACF32FEEB76E AUGUST.HUSE
438,362,229 *2C6A40A16BBBC9A3A9493825BD32FAF1C28E8E7C JASPER.EURICH
438,362,230 *2C689EA4C754BAAB9CF8DC21AE6F7969176DECDB chkx
438,362,231 *2C636895325E5BE87CCA98F0E1FF88E8A39A1C63 AUTORIZZAVANO
438,362,232 *2C69DA08A0BEC67E20C715FDB774DC8520A2FD63 AVALON (FEAT. LENE MARLIN)
438,362,233 *2C6C67167105E3BD1CEA09477ED5ECB73D300075 a;v$l
438,362,234 *2C6D7579480412429B3E02CA9E2AE9C113C9ABA0 christorode
438,362,235 *2C6F1CC7EA5124E261E72FC902827BD0459936CD AWFOE
438,362,236 *2C66D6AD04DC5306922CED98CEA74FE79DE2F2B3 cinderblackie
438,362,237 *2C6BD88987113D51E7515F268B1C413A66BD23F7 cj80b
438,362,238 *2C633702A66ED5EBE1AECDD2C7FA0F5E66F54532 AZUZABA
438,362,239 *2C6D9AAF550365EB9F897BD85F20DDE5869A266F c]~k
438,362,240 *2C6B14D832DCE2BBF6EBA1B1B9D284B0C90D9027 josefranciscotorresneedstostart
438,362,241 *2C6D17F4C2F2FFE5146CE7F194ABF1FA5B6FA312 CLAIR.STEIDINGER
438,362,242 *2C675263CE5836A0FE09160F07EC64B44FC4CBFB CLARENCEWADSWORTH
438,362,243 *2C601FD3BB85D677B50C5B430EF2105E6AF650A0 b.:3:
438,362,244 *2C629A5A2875D17E82527154858045484035EA10 CLARK.MILLE
438,362,245 *2C633DBE7502EE28026CDB76498400C28F2312AB jpwl
438,362,246 *2C6292D13386A4AA365F745EE6A52F9D60E8DF62 [email protected]
438,362,247 *2C6F26B2C43E18B947E5DAB915ABA3D586480D9E b4i;)
438,362,248 *2C65E34EED55C16952FE3F00EEE1720ABC9BFA60 cleaned-a-lot-of-plates-in-memphis
438,362,249 *2C689C633BED6C33171FEB5CDFBB7A167994B59A B7m2
438,362,250 *2C611DC475C9D258EAD3BE01EEFF2E64F84C0442 [email protected]
438,362,251 *2C68D0F545A31590F92BD55418C76B00294E41BA babylakers
438,362,252 *2C6013721142BC0DF5174A3F2C81A5C232E15B78 cm280
438,362,253 *2C6074C1F4E35A3D4BA87B892357C33F05F732A3 BAQC1
438,362,254 *2C636309B3630C4FCCC34302CE1A05164EAB0429 KAMMERKONZERT:.II..TANZ.-.VARIATIONEN
438,362,255 *2C616CA56FBDA6F1DA3CF3790FE46F900D684B6D bascule-escapement
438,362,256 *2C67CF95298EF4AA3964EEAA8CB63C72A8427CF0 COG-IN-THE-MACHINE
438,362,257 *2C61A7A24E64EAA52347CF656C75720DB6B0B7FB kayini-wura-(mali)
438,362,258 *2C65610975F56C1936B13225F33EE9877C919952 coloniaroma5
438,362,259 *2C6F6D427BE206AEBE502ADEDF7D51A8470E7F4C bctcn
438,362,260 *2C6CD6BDA62E0061F5CBE9590C85D3D528AAB365 KIBAJI
438,362,261 *2C6912ACEF1F7BAC80646DB9A7E89B1D53437752 BEDÖDT
438,362,262 *2C61AE0052D8E5D5B395AED92CB62A632090437B KINGBLACKF
438,362,263 *2C65765D1EE2657ABA75B5922F9C7A9324A9F1D2 befdh
438,362,264 *2C6316051EBE47561054E11D0CC559FFB596A1BA KITSUMONS
438,362,265 *2C6D1135AF689FCA819202FDEEE800587AE56412 BELINDA510
438,362,266 *2C6B4C075F5E97E8B9056E7F3F5EA464C5CF2267 KLUPINĖTI
438,362,267 *2C6E7EF5421FE799C1AD502D473224AE371DAC9B KOLEWILSON
438,362,268 *2C69B7116D104C2F20892A7381C96C90935F9E08 krissegler
438,362,269 *2C6554CCDC6D4E234D544317D9CE919B0A7F9180 KRUISDAE6
438,362,270 *2C6E4E1CED263221C850C9860C180ACDCD1E33ED KSXDNTAY97
438,362,271 *2C6136D99F311C1EFDA23A5F629715610EF24DAC CORNELIUSELLITHORPE
438,362,272 *2C63B3593BCFB86EA2AC2B759399F1118D333B1B [email protected]{y
438,362,273 *2C6A31183A187EE70C63A8FF0E5511BEBC117EB6 KYPERSKÝM
438,362,274 *2C65F333FE654CAE223F79BE9D451DB85E49088F benzoxate4
438,362,275 *2C65F038A8679EB1019099DE75F551054E84FE1A BESITZTS2
438,362,276 *2C64F995F89F0850E300FBD1310740FE3BB4B72B bgen!
438,362,277 *2C627349F16E280744B38832D921C7DC0AB00B00 BHJLN
438,362,278 *2C6735332D916AD93664453FAD9D24FDC0C733D7 B%;I$
438,362,279 *2C656C1ED1D4EA6EFA4C76BAFC9910F6ECA4CB6F bill.frisell.&.dale.bruning
438,362,280 *2C6ECB386D7002574A7EFE4B14B09A9B806859E4 BILLY.BOMSTAD
438,362,281 *2C6B6792BF2B5935E168F9D9F379DAE41AB76F7B crvn
438,362,282 *2C66D0B91D8BEEED2EE2B8E0BFED4BF5670D3B80 LEONARDDRISKO
438,362,283 *2C66396B86C1E5856F8743D1661095297057A5AC [email protected]
438,362,284 *2C6E1190C3607CF9CB49B8F919A9F2F1FE8C8AF4 LESTERSTRUCKMAN
438,362,285 *2C677D7460CFEEB7984479437983A7669F401A3D [email protected]
438,362,286 *2C624C1E20F2F6F9585DB1436F863FEEC5E54C64 curtbessard
438,362,287 *2C673695266F898E1D4D75C0F588FCD73BE57D9C cuuct
438,362,288 *2C604E62E069713344F7E0F700EED73BB9663D54 CX(;
438,362,289 *2C6A4810DFBD4DAE6B84210105084E9356B8DC2D BLISSEDANDGONE(FEAT.THEFROGS)
438,362,290 *2C6811E76E1EB18CD4EA724DAE22449233F55460 czth#
438,362,291 *2C67C2C4FB25AA636D6151737A3C4426E552B86F LISHIDUAN
438,362,292 *2C66CABDF3286BFAD8E5019095A8AEF76C62D073 d&12i
438,362,293 *2C67B43ADFB3D1225CDFFD0C0CF7094106C551AA [email protected]+0n5
438,362,294 *2C6B874E0F2D085BB600EFBF7D75DC02B731CAE6 BNbZ
438,362,295 *2C6F6F753B9DF17B96CFD9304D0288408AEE0578 d4uvt
438,362,296 *2C61B89C7D93B049157A040DD80CA517BAE87723 [email protected]
438,362,297 *2C69860F210AC1CA9E71D11FF0EACE4C855655BC [email protected]
438,362,298 *2C67341B764A6E44D3CA95FC5AFD8B32D4A42BBD d5+c,
438,362,299 *2C67326505A6E9F926C7FCE87A8ADE6F3EC37922 LIZPLETT
438,362,300 *2C65F34BB1002B98ADFD8456C10D28C2FC76F4BD BOD4CABO
438,362,301 *2C61255B77A61DA20D66992A7DD8C8E2EA80EE4E D7:R4
438,362,302 *2C6AABB7DE0ADE91DE952B943E8F880F12B171AC D;90
438,362,303 *2C681574BE2D7F154434271A76454CE25057266F [email protected]
438,362,304 *2C65E839B882AEAC2FC71809AB72F5798A782027 LON.SHOMO
438,362,305 *2C6E6799036E1EF00C247E37D859030BDE8E5B90 lookdon'ttouch:29
438,362,306 *2C6FC0AF541F80AA723E708EE6CF1C90D5715DEF BOXAO
438,362,307 *2C6637DFACFB30490DAAEFCB653285F366B3C698 DANASUELOVESYOO
438,362,308 *2C6D693D84A7D75C3C94585E2D669FA89A5ACC72 bqs1i
438,362,309 *2C6717613947B55AF5EE69ABB2DF050CE8F29676 DANILOFAUBUS
438,362,310 *2C67DE36A47BFCB1D4D7BD82264227D432FE5BE5 DANLEVERS
438,362,311 *2C6E6CC04200C13174CABD7E201D14C519FD4F14 BRANDEN.NAUGLE
438,362,312 *2C62A9B69B1F5EB68DC3FA087A9A4CB260A9C88F LUIS.MOLINEAUX
438,362,313 *2C66E818C2049D8054EBA35D55D2DC5475DCA900 BRANTBARIL
438,362,314 *2C6900BEEACFB0B25F58E830E686563235BC7540 breakofday
438,362,315 *2C60DD0EA8B705EA340590413FBF925B0B814D7F BRENTCOOLS
438,362,316 *2C6447F7B797D82557B51E05CCDFC2A51865D39D Brent.Sayers
438,362,317 *2C61EADDCDCE700815CBAE8EC8FCAA64E221F608 BRETCONTRAS
438,362,318 *2C69B7989D7DE50DDDFE67DE72EFCA98AD9B04DF BRETTLAGRASSE
438,362,319 *2C64C1FBFAFF1C220C20FA4D41339920B6053475 darner
438,362,320 *2C659148E8105499FEC1837CB6FDB8E97E7B6B6E briggsian-logarithm
438,362,321 *2C6901EBCAA69E213A3D82540DADEFF8C642C6E5 BR#NR
438,362,322 *2C621E19F941EAD30B91F2C4B289681338C4D881 BROZAK1
438,362,323 *2C67D0D06A8FC14BCDCE0FCDF203A3B87836219C m3lod1ously
438,362,324 *2C6720727C20D4A8E0101CA8B4A78AAEB86EE19C M4MTD
438,362,325 *2C6A8369ED024C4560A9945A35B9044FF53FDEFE bswmypidbsw
438,362,326 *2C607CE1B084B59E55AB25AC40C647A4B478F350 bte1j
438,362,327 *2C603617B702BAD3BC3575DB1C7D47D7BCEE88DA BUDDHISTDINESHKANNA
438,362,328 *2C6ED999F0840F59EA64130A18B362B8CC129012 MACLINNEMAN
438,362,329 *2C61C03EB5F1FC6F1EA1A98B752845D7B06C6E66 dbij8
438,362,330 *2C6A7CA161C8554345C8A67AAF2628C14F023A3A DBX4
438,362,331 *2C68BFBD10777CE83919897A1B958CC5A95C2D2D DD=-4
438,362,332 *2C6BCC962E95AE0FC84CB140B497E8C9B72A1735 BUTTERWOMAN6
438,362,333 *2C6E303CBCAF46078872C3824CC16415893815E1 DEAN.MATUCK
438,362,334 *2C65F2BDE9B49604E34A0FAA1599BC6D135969BC manasbhatnagar
438,362,335 *2C6BB6F29069BBC456465B88D571598F0CF14582 byltd
438,362,336 *2C6133A2E39F4F50C044C8F5D35DAD4D49477C0C C`@/
438,362,337 *2C6A6ED6024A31066FF09F34D9C737175C1F445C C1RCULAT1ON$
438,362,338 *2C61500B189E53C24B4943A9CB39F058D7E2B5C0 C3(S
438,362,339 *2C69B97CD83A5AC266B860088F22B710B30A488A MARIANA ARC
438,362,340 *2C64A70093751484E8ADE223B1E2DA05106F793F [email protected]
438,362,341 *2C64781F2FEC8FF18B4A86174FEF71EE40947826 DEN-HELIGA-NATTEN:-X-MELODRAM
438,362,342 *2C690F3FE1052B3742AF212583310F8EA9A082FF C8O:D
438,362,343 *2C6BCAA6224711D124246EA1DF478DBB91B04AAE CABELL0
438,362,344 *2C6596547805E788BD893DDEB2F98014BC7EC3C0 MARKUS.COUFAL
438,362,345 *2C624D67D55D0EFCB1B73EAC868139334B3C30AC CALAFQU
438,362,346 *2C61A2EFD54ADBCDEF7CC5A43941DAA7955605A4 calebbondanza
438,362,347 *2C6D2ED078CDFD4DBD5B32FF1E3963483DDA7214 marshallbrase
438,362,348 *2C63FCF9DC2A50230D8B6E6F3C8EC7EA58D9529B CALVINYASUTAKE
438,362,349 *2C668DCB62973D8C61DDBC108D81E22279AFAD86 MARTINL'P
438,362,350 *2C6BD2F4E8DD54CD4F46D905C3635CCC67A31CEF Desbloque
438,362,351 *2C63CBE4889B0EE9A930BE590E25871C62C4B839 de=sn
438,362,352 *2C62516D29D230563733D18C4A801442F52198F6 MATLKAJOAQUIM
438,362,353 *2C6E785CF781633B954FA1D25C3423AB95687E73 DEVIN.MCTHUNE
438,362,354 *2C65F1D36FBFFD13C0A60208A6420723BB4D1BBA carlpeckler
438,362,355 *2C633FFA21CB681A765CF6484F2726CDBEE925FC carmelogarverick
438,362,356 *2C6218A49C3DAF0722107D36EB4B8CF73DE54C96 CARMODYA8
438,362,357 *2C65308CB457E7526CF8A6EDE2475B06E3291EFB catfood
438,362,358 *2C66F42F7906C5422AA18F718FC159D845414B72 C'B4
438,362,359 *2C63F40831EC141175AADB63F9B105E275BA008C Di"
438,362,360 *2C6636737F9D5A6FB33F413EC7371C2511855F2D DIA-DE-MASSACRE
438,362,361 *2C6D0CBBFA798EEEFF0D31426BD176C5F9D19624 cdrwj
438,362,362 *2C626C6A126FDEF5A696CCA5595A3057DE97103E C&Du
438,362,363 *2C66AE30FB568D20DAF7D409A17FE719632F6126 MICHALDOMER
438,362,364 *2C63958B47918B05D5201878E3EDD1A7D3834074 michalereinhardt
438,362,365 *2C6603120931E4BC10F4FC219C7A15FA452E8271 dillongierut
438,362,366 *2C6720D415148638ADE4BECC7EA7D6B79C787009 MICHELLE.12
438,362,367 *2C6E4E38B8E07EE86404DC2BB8938340F9B047C4 MID-OC3AN
438,362,368 *2C6946271B88155F3892C3D5048E7F64CA4A2221 milanomodel(rob'snoearsvocalmix)
438,362,369 *2C6EC96CA30DB1F81E11A4B9094CCA2EC692ED90 [email protected]
438,362,370 *2C6C4D4EEF9465110A6EEC32F0198C775E03DFC6 CHANG.MCAVOY
438,362,371 *2C64CCCD5F6D7F79D1C2706D2CDC36CFB01C2E1C chapter.2401:.arrow.to.the.heart
438,362,372 *2C6488694633D58E0E6323A9367D7433CE095372 MMANTIS
438,362,373 *2C6DF1EA78AF534A5E8C0F5870CC2E22ED33F3EF chongmortellaro
438,362,374 *2C6CD278803FC5A522B8C186F82BE0C168C32D57 DN,AB
438,362,375 *2C62FE8CB88017289218E32A4CDFD0168E19582A MONROETERREZZA
438,362,376 *2C6A109D06B0F3032AAB7B7B01576DB58BAAF77B monsterwalksthewinterlake
438,362,377 *2C640D5509D999A994D14B21D2D6D7DEFBA60B80 moroccanoccupied
438,362,378 *2C689DD44E9AE480341DE44681A35D3F8E6D9B36 mortondelrosso
438,362,379 *2C6B905AD1898A65E11327737E56ADA21214A2A6 doi:b
438,362,380 *2C698ABF59308200415CF6E467F3CDB21613497E MOSES.WALINSKI
438,362,381 *2C630FD3AFE0DD375AAC0DA2D4CC2E8229F9F1AB Mother-Moon
438,362,382 *2C6C62979FEA8D47EB129E91261E4E336B832884 ci4y?
438,362,383 *2C6D25CA4F48EFC51D8C26C900459A413476851F DONA RENFRO
438,362,384 *2C6F452A6A36E0B57286195D6D3CF635D30CA045 CITYLIKE3
438,362,385 *2C6073EDAB4F32AB6F1DBAB5BC91CB1076605E1A DONTE.KUTTLER
438,362,386 *2C6D08D378F63DEB0F8FB49DBE710E0DF4E288F0 MUHUNET666
438,362,387 *2C6202AB86508FFB7C2DD87A934235C67376AA3C clairconterras
438,362,388 *2C697EAC7C4D241996BCFC5D5D74E1814FBF1C11 DOUG BURBANK
438,362,389 *2C679977181BD55F8F3C93154F5D16DD3A104927 dougfrank0
438,362,390 *2C66CC2F68C315ECF3FC6C59718EAB027A2E4701 DOUG.GATESY
438,362,391 *2C6772067BBF69BB8DFCED92E6A3279CA73058DA CLAIRRAMCHARAN
438,362,392 *2C6CA192D9BB1A0515596DA8E9AF13D5D7907C4E CLARITY-OF-MIND
438,362,393 *2C6D20264FE150741E4F2B24A4BEA36F3D918DB3 dpm"
438,362,394 *2C6ADA3B1FA0F5B8551CAF5686B8609AD827F716 C!M0
438,362,395 *2C6FBFE9ED79E7ECDCBCF7F779C21885451A9C97 DSENSBR1
438,362,396 *2C6B3101D24130A131AE1F470924DDE37689B678 dtnwc
438,362,397 *2C6B9875D0F46192EC29994ED984A20A667F7E5F CODYSARETTO
438,362,398 *2C6E595CE516B2BFDAD3F9D40081CA8EC0D34881 [email protected]
438,362,399 *2C6CAE3640DE64E443FE6E3ECE66915FCFB63EE4 nealmcdoniel
438,362,400 *2C6F4EEB60C6B6AC3A479D92BD33059AA61BE489 nedlangill
438,362,401 *2C600E72589F18A7615FAB23BC1C77ACE568A80A ned's emancipation
438,362,402 *2C6348970C28D5FB7A6D877F703D47C97E740013 DUSTIN.MCCOARD
438,362,403 *2C6F4F69BBCAD10BE20A64F797B0087FDFE77A34 DUUA
438,362,404 *2C6BFB98B42EEED9574CD59EC9CCB061FC82A83C dwqmh
438,362,405 *2C6A7611A3002B9D651FA020111F608A844AB856 [email protected]
438,362,406 *2C605EB30CBC9B2FA82EA69F0ABCE0B32441FAA3 NO!$313$$N3$$
438,362,407 *2C6A02D0D5DE3E570679FAE40BF8AE5E55CC01CD nobodyknowsit
438,362,408 *2C63981A0EF2C21F76C6B0816A43B70FDBF00A6D CORTIQUE7
438,362,409 *2C616EB7ED0AE53E8C50FFF815F5B1F073FF77AB NONRIDING1
438,362,410 *2C628EE4E3B4977EB8ACD78A9B44785968E53FC8 normanmcbride
438,362,411 *2C6E8EF3D89663C867025C6CAA98D90E8DC33379 c:\programfiles\microsoftvisualstudio9.0\vc\ce\dll\mipsii\mfc90deu.dll
438,362,412 *2C6111650D59730F4A1B34F8274C22A725CCE7F9 nqdbbaw37
438,362,413 *2C65DD180BEAC6B5675791DE0DCBA08770C18A2F [email protected]
438,362,414 *2C669395F62B2EB8807E1B9A6728CA0FE7C58DF4 edit.nie.delete.(feat..royal.ts)
438,362,415 *2C6BE93C3303528BABE8F2AF587CE0BF2BC9F9C0 CQFN.
438,362,416 *2C63826A07CF81CABB93F81A4B20CD982C125422 CR5/L
438,362,417 *2C677ED43B145A0A3B0F03E3BB9085B142BB602B CRISTOBALHICKS
438,362,418 *2C6C78C8E417E6CF7730073434493C62D923074D cristopherkallal
438,362,419 *2C653D7F516981172A1DC92854D4D6616ECAB204 CRISTOPHERNEWCOMBE
438,362,420 *2C6F36736141DB413FD08A0C791190BC048320AF Crln
438,362,421 *2C6B81E0F7BCB93EAC64F345EFD07E348767EA13 crusade»
438,362,422 *2C66A8B1B39A3175A11FAECD0ED5823794424030 [email protected]
438,362,423 *2C6D4B797F9E750E3CC9F0466E2105632A71938B OLIGINO6
438,362,424 *2C6C88E346C8AE51190794FF9D88B2A6EF277AA5 [email protected]
438,362,425 *2C60BD88ACDAAAACEDE4B461C6DCC1D275497F87 eiutp
438,362,426 *2C67AF9E84373B8AD3F75BBB5B4EB7453B67DE3A (o_-)o~o~-(======8
438,362,427 *2C6A6A74CF2993704806C5ACDE31EBF9D9E7A2D7 (>_<)[email protected]
438,362,428 *2C64E5F2E503002F0F0E20444C9B66421F8ECF50 eleanor-pedro
438,362,429 *2C62FDC11366B08A6CD91816E0F26379DDCD6B42 cwda
438,362,430 *2C6582F832803D249834F994B72111D39658FA8D ELISENNE
438,362,431 *2C64C51E8D1CA854A17C35C090118B04914AEC5A OUTOFACCORD
438,362,432 *2C612332FE2AA01D2F99358D34D6FBEB41901731 CZSHT
438,362,433 *2C6FCF8AB2BF3F1EE57FE182FBAD467BCC436B7E D3G;P
438,362,434 *2C68F29604F086C0EDA869A7746D370768C3BC51 d-4cf
438,362,435 *2C6891EB9469341394EC5DE16314DE6C234E0A8B P0RT4NCE
438,362,436 *2C659C362AB9486FB447AC22CA5D4DFEDFA5293B d5bi!
438,362,437 *2C6A59F422C3F98F289506EE1D6A71ED085973BB ENAILIL6
438,362,438 *2C6641B5CA3F12B3CD5CDD4A03C6E2C6741F4E90 D7LUK
438,362,439 *2C6FE28E83B8725966116FD3E66B5E647B998318 daakt
438,362,440 *2C60BCE7C96325F04E123C049D9D2570B9FA11C1 panika
438,362,441 *2C6844E13702799587FC9CC3D8E1CBD58EBDFFC9 DALLASYONCE
438,362,442 *2C66B867A7E81CF3082AD54088A007BB4B66074B PARABULIAS
438,362,443 *2C6B66865EB65B4A2537653D8CB6DCAAAB77E028 EP6CI
438,362,444 *2C6E37818EBEE958B8DF9C6979E28646844E83B3 PAULETTE HEBERT
438,362,445 *2C61F623F013BDE1E3A037EE8338B086D2FE74BC DANNIE KNIGHT
438,362,446 *2C660A14D25B81565D9F5C01C67065180786FA2C DANNY-FEY
438,362,447 *2C63D2BFD687DD87BCEA12F224FC88A6BBFA1B5C DANNYSAXTON
438,362,448 *2C6A99BE442B5D120D3FB0A525448F3491878410 PB~0~osplat
438,362,449 *2C672232BE10CECFBD5E23CB42D46B742D03F296 era2n
438,362,450 *2C6B547911295F1971C8A8D68AA5F1DD8DF70F99 ercuz
438,362,451 *2C6EE8C158B6EBA402E1B998C0B9B4C354AFEFAB P##D~O{X}
438,362,452 *2C60E56E1C37DA319B8FE863D70B0FBE9809CA71 DARRYL.SCHUFF
438,362,453 *2C617508D095154634390B48711D7A50B55C5550 daruan
438,362,454 *2C6937053B8F1581A83B3474C256C1806C49E36A DA?Z8
438,362,455 *2C64A698F12CBE317F2402445439FBCB9F69DB58 DBINX
438,362,456 *2C6BD61D04932F3D290703CF59D661006E55190C ESENOLOP
438,362,457 *2C67C242A7AC2F2B46452D56FCDE225419061ACD ESTIVANLYO
438,362,458 *2C6004A443369BDA3279D556C2B30D150202622D et8%h
438,362,459 *2C67AF90E081B8029327737CB4DDB26D90ABF206 DE7M!
438,362,460 *2C60BBCFB5C57F75BC07E381CDD3A81B888FBBA7 ETOT
438,362,461 *2C67B1F849CEA21992282A943260F64C51170B95 etps0
438,362,462 *2C68EFC6441BF03B99AD3DEFB7BA0D01724748D3 EULOSER4
438,362,463 *2C6B296312A73EB573F7B2FA5832050BEFD0C896 EUSEBIO.RAO
438,362,464 *2C654C1DE70870769AE3269176C2379C8F165DB3 der2$
438,362,465 *2C6249D4A07AC1A10E674F03AC4631C35554F944 DESCRIPTIONHOLZSCHNI
438,362,466 *2C68BC016EB56935E0F1B13FE579D96BC2FA1FC6 p-)~o)0(
438,362,467 *2C680022A493EC8269A8B306C1469A88C873BD76 DETSAB
438,362,468 *2C673A81725EE1D40238D8EBD05FE72F21E2F8D3 [email protected]
438,362,469 *2C6C6873A2370A7A9E610E4A918A66C5B7B65E87 DEWDEW-DEW
438,362,470 *2C65D005BCC8207060BB0A57825C0E8289EC3C21 d))fc
438,362,471 *2C6809BC69659574E04AA0D24DE329685FE4F605 POPULATION164
438,362,472 *2C69749ECF0B0A734DADE33AD2B82A45DC3B76EF DH7M
438,362,473 *2C6C839A7B2F29536CB359D4B80919CE7B6D43AA PORTHTOCYN
438,362,474 *2C612C184215074A38E63D57497950D0730C6188 DI5I114B1E
438,362,475 *2C6BA7CF332A954397250510800CFD87E13DB34E DIAGNOSTIQUIEZ!
438,362,476 *2C66212B0391F63D5C7FCFF9D325DE735CF2E0C7 [email protected]
438,362,477 *2C6ACBFE3B4E7BC80EC77AB8211F68C7E796581A [email protected]
438,362,478 *2C6C8431D80E2175DBA95D31F81359E14FBB462D DIRKISERI
438,362,479 *2C694FDA7D585F98196A92C8A7165709CDD813AA PRIKOVANED
438,362,480 *2C6F3830A231C5738DC3C2E423653F0371396085 [email protected]
438,362,481 *2C613F561729AE0D27453859BA0EDB4720E41D18 PRIYANKA-WADEKAR
438,362,482 *2C66B6298B3A471FC931CEDC0B31875CF0C6FA4E probedv1
438,362,483 *2C642DF1A5C0F1219D8B39C448ED448AEF5BCD24 PULIMIENTO
438,362,484 *2C6FAB36FC00C4966C8116E3EC8F94FD5B0DDFD3 DMVAA
438,362,485 *2C61F30BAE4D6EF528486DE9E19CE55B59BF01EC dnnwr
438,362,486 *2C6A6FF78652FD3202C5CFDF5DF429A48338F273 ;)~Q=====B
438,362,487 *2C6F20740C6462CEB0417D92415F635D8AF69C77 FIREBOLTEDFIREBOLTED
438,362,488 *2C650ADEE47E478DC6FDF1A62364A132C405120D FIREFLIES'DELIGHT
438,362,489 *2C621E5CECDE5A606AF25E83A6D68BCE3402B538 QP ~ ~(><)
438,362,490 *2C6200EBDE32A581C67F1249C8455A8A74BF437D floc'h
438,362,491 *2C6CF0A7C311003568A3B1E113FB191BDA46E30E DPI.$
438,362,492 *2C6A1245DEDB1AD34F4845ED448838C84FFC27AB dps5k
438,362,493 *2C6EC4FD1729AFB161AB019B789BD5465E59474E DREW_BENNETT
438,362,494 *2C6205990EEEFD3475A7E127CD26B49E91FC38D7 floydyagi
438,362,495 *2C660A11B3FD5E52E574A4E841EEA86FC1240CB1 DROOSMELS
438,362,496 *2C6FB18EC8E8304E7B056B87571C5D21DFEF70B0 FLUTE.NOTES
438,362,497 *2C69A2F34A5821207E6A1A1E7771068294151D89 FOSTERBATTERTON
438,362,498 *2C6EB912D6D257067A1E63B912E3B1102E116FD2 d$t;r
438,362,499 *2C6A9E6D5BB539A96908AA078711E24F3C5D06AD FRANCESCOMATAKA
438,362,500 *2C6BCD088EECCF4708282519AC40AF3EAE206586 RANZONIER
438,362,501 *2C6CDC2CA7BE47DB01C3F246A8645228C73A897D DUSTY.BASILIERE
438,362,502 *2C64638B7319F59B89212E7683ED242ECABD3F4C raymond-matthew
438,362,503 *2C60F3AA68034C4B27BD0E777C098C33C8241318 raymurrieta
438,362,504 *2C61A8C0A4FB8FB5341B31C285AE29748BC7B7C5 D=V"
438,362,505 *2C6CC64B4C860D9986C2DEC784C497911C8A2E17 FROMTHENEWWORLDSLAVONICDANCENO1~NO4
438,362,506 *2C63769D083BAE7B5B2C896FCC904AE39A43BC04 DYLANSTEGGEMAN
438,362,507 *2C6348F06299D27591CF44F18A1D596E6010E542 REGELWERKBOX
438,362,508 *2C6BD9ADB880380CE06EB5CC1E5DE2A194EE9662 FUSTANUM7
438,362,509 *2C6FA66D74499D3FC6AA095054AB6FC0C173D230 REGGIEMICHAEL
438,362,510 *2C67EBDE73C352701768D48EDA0A0ED8F60F211E dz7go
438,362,511 *2C654DE1D3655876C08FEE814E4D44EE8F59E004 [email protected]
438,362,512 *2C678073DE560B2F1627BCD2202CA96FBC8AC460 G1OAM
438,362,513 *2C61180FCCB4409C7D92B897AF900BB9F82B78D6 REKONVALESCENSTHS
438,362,514 *2C6228D1331C6EED697BA644BDE62689F52377BB relationshipcentred
438,362,515 *2C6E3AAF2435DC394B8FFA34073C3DB2D8E74406 remulazz
438,362,516 *2C652AE2A8ECBF6E53B71391935BD6812B883F9D gadkert2
438,362,517 *2C6BC4F418379DD547BA51ADE0775D804058D647 EBBLESP4
438,362,518 *2C6ABB54AA9947FF1FE795EED06A5D92E156D9E3 REPCOUTU
438,362,519 *2C63F1EE6E8A965434DA00CE8CAEA7E4443B8D02 EDDYEDU
438,362,520 *2C654254A38D552175E29D525A96960613FFFB88 reynaldokahalehoe
438,362,521 *2C68ED2DDEAFDCABE9AAF26CC606F74DD1CDAD83 [email protected]
438,362,522 *2C642FEDD474BD4535203AE2B0C206BC63832B7D rickeymccroskey
438,362,523 *2C600FD0B05473EA978DC88BD0615A8AAEF5E539 RICKIE.DEJARNETTE
438,362,524 *2C657179762CFA8983E60E47D6C0410B1F957C9A riley-melton
438,362,525 *2C6D461C064D1ADC33CBE467255D61A7A5A83E66 edh$7
438,362,526 *2C6A35A114E036C69A54EBBE158233DBD4498AB5 EDMUND.FEHL
438,362,527 *2C67584DA56F2C646DDE1AC68B7B2423951F3B8C gateada1
438,362,528 *2C67EE60BEC3A465FBAED44E0B51D7B05BB9A641 [email protected]#
438,362,529 *2C641AFE3DC3860C5FBBCEA1804C41CC19EF577B eerbaume0
438,362,530 *2C6C45E6AEDF28E915F08D1D66772EE79BC16BC9 GELGHANAM
438,362,531 *2C6B79F6A1C6025712191A5EB6FCA753A9B9F7A3 genehomsey
438,362,532 *2C6FFDC058A2224A7D11B22C0101E600EC1A3E71 EGEMV
438,362,533 *2C6BDC90C01C51FF5E84B7440FBE8AB0E507E9F9 EHCILUEN2
438,362,534 *2C60404638A1C08AE0C69C907578CF431393EECB EIDIALNE3
438,362,535 *2C6AD9263C902E695242166AD6EE6673A44BEAAD E$JL
438,362,536 *2C6222DD8457F5D9620D798ED127E2DC952817EF gietnade
438,362,537 *2C69F0A7882B2412FEA49C7EB7C0FF5F3869882C [email protected]
438,362,538 *2C65EE15640D4F411AB493E2102F336A6FFBF33E elishasheehy
438,362,539 *2C6D785F71CD2DC4255024A50E5C2B877DD08FFD RUXCORWIN
438,362,540 *2C6743F64DB3EA9BF24F00A34793E3B9DB2922E0 S1OWPOKES
438,362,541 *2C6F76315FABD89D950D1A4F72C26019A7D1EBC1 elsa-jones
438,362,542 *2C6B7FF54C27EB152CEAE0D7225524A845751A9A ELSURPELICULA
438,362,543 *2C6E5D01FC5E50F46CB790D7D045884F7F789150 E?LT
438,362,544 *2C6F31C7B80F7FFF7D963E553A8545EF2D87F28D „GOSPOĐA
438,362,545 *2C6B18F3E758B79CD63886CD8A95CADD78F631D1 EMGC5
438,362,546 *2C651F47A23027A407E856059E3D3C4BB05D49D6 emilealwang
438,362,547 *2C65E6CCD45D3F8AC534DC014CDC7E10F2A09CB7 emmaleigh
438,362,548 *2C6ACFEE70160888210B8D56D41104B0B5F010FD GRANTPOETTE
438,362,549 *2C6708257FC3E4B0C81D31343EB617FC35873568 santosfreund
438,362,550 *2C6E1E21D9E1206A19902B06A730BEEF644B1CA6 SANTOSNIEMANTS
438,362,551 *2C6CD55619BFAE4A04E77F2BA55C07396A385624 SARASIJA-GHOSH
438,362,552 *2C6E71B6A4AF57D3325CED836FC8F685B29BF718 GREGG.SZEWC
438,362,553 *2C63C0BA3E13451A58C1A48953A303FAD6B797DD SAVEYING3
438,362,554 *2C621630937EE37424CA7D1D637C436E6ED26678 SCHADEND0
438,362,555 *2C67F22C69F320E62E391874C10EC6BE8B5A9B56 SCHISMATICED6
438,362,556 *2C648536690EA34113B246D6FD3ACC9482D3B7EF GRUPOVOCALDESANDANN
438,362,557 *2C69DD8A98CCF5ECC8A0A45AC1421660C828C464 GUILLERMO.FORGIE
438,362,558 *2C668A8E313BBFCA693593F83BEABBC17F03AEBD eoq$:
438,362,559 *2C6B714975B7AF3CE1FA403FCB5E8AEECAE54B92 eq?pn
438,362,560 *2C6EAE0CE53803CB23D66252A5A548D74BE021E0 hagemühle
438,362,561 *2C6A54E68D6857B8989D9658F4BE8CEA062D5527 HALOCYN+HIIDA3
438,362,562 *2C6EA66B5ACBFABDC0141499C7910C2717A57EBE selenodonty9
438,362,563 *2C6164894A58E9D5E56744337BDA98128BFEBD50 [email protected]
438,362,564 *2C6213CA4C1C16226DB64E3CB92A3F21FC7C82D1 ERNEST.DUNLAVY
438,362,565 *2C66C7FAA9B512F709705D37B6981C59B665CF43 [email protected]
438,362,566 *2C606B75E23DCC6E1E5323E1BFA21D9E8A008E8E ernieprimer
438,362,567 *2C63AD07D438AC26406FFE2B64EB818CE7EB2250 [email protected]
438,362,568 *2C64930AB65EE7539AC55D5988F66BFE4FD70A10 er!p
438,362,569 *2C6EAA6FFFE2461B27521C9E0559CD9B6982E3AC HARRIS.FRAZELL
438,362,570 *2C642FE622E73F721BF84F9DD52A3AA9FB3B51BD esnbt
438,362,571 *2C6C5E192E6A76109E4D140CC75C3ECE99D92686 ESYSCONF2
438,362,572 *2C6F09AF124098D55B15A62C6D40A57265825D99 HAYDENCHASSER
438,362,573 *2C64110E647C043C0F65393CC32B7017F18D1F5D seyedehsanjavadi
438,362,574 *2C668B8C84A426A36BE51B41BF4EC6C3F216F73F haylie-simmons
438,362,575 *2C6A31E9DA7A5E351EBFD5164C6CCDE3194D47ED HAYWARDIS
438,362,576 *2C6673F5DA242690D3E13BE102FBC74F9182826B SG2XFFCNZFG
438,362,577 *2C68A9E9A38193ADAFA88A1AAAF43AE6C824BE33 ÉTOIENTAUTRÉFOIS
438,362,578 *2C64ECA83ED8F97C1E0DD26D75841F326DDC6936 ETONNERAIT0
438,362,579 *2C6AD9C1057EE9A2A31EFF42A65F8BB565008A2E SHANEANTUNES
438,362,580 *2C6A6006F527B762E66CBC565AD319317190E3CE HEATH.VANBROCKLIN
438,362,581 *2C693CDA9F09EC1C207F76EAB3C95F5739E1CE0B [email protected]
438,362,582 *2C60324BDF98E7BDBA528889EDE4FE0D7CCD93BF HELBACHS
438,362,583 *2C6D9378FF29470D193049D9A555BD079219F107 [email protected]
438,362,584 *2C6A807E1E12A0B79BB6DE248610BC9E3613F02C EUQIMONA
438,362,585 *2C6137B2A336287162C5295D62F07CA9226A73CA hemelytrums
438,362,586 *2C68CF4B37E98C33D2B237623A2580B3B713AD06 [email protected]
438,362,587 *2C68AD9ADEB7A330C77AE4921394C9F26909F892 hershelkadner
438,362,588 *2C678B4DBA192807735119E44BF208E4F8E4D864 HF[
438,362,589 *2C67AAD96F335B1251605621ACA3D195D2818F6F shermanratchford
438,362,590 *2C6FA5481238A5E500A8369681D2794CD78BF5E4 sherwoodaltig
438,362,591 *2C608475152D14DC92CC1B84FD8DA237B1E5CB6F [email protected]
438,362,592 *2C676B050FE1158BB6024B4547D7821A5F961D2B SHIRLEYKINTOPP
438,362,593 *2C6440E503187C56BB13FDA1E36A8BBB2754F6C8 hiillost9
438,362,594 *2C6BCCE3E657BFB069DC1F4B7ABC1A87551D4D5A SHŌUNEN
438,362,595 *2C69D9FE6F94DEDB1CF5FDA1C7E6B4FB6708DFD2 sidgilner
438,362,596 *2C61BD5E510C10C12B7EBC6ED0A68DBCAF72087F SIDNEY.JAROSKI
438,362,597 *2C6BCC794A56BABECE00DD106C600E64AEECB70C h>k9
438,362,598 *2C6106275B47A9101E42AFDA3993D1F6F2AD863D hochschulfinanzierungsgerechtigkeitsgesetz
438,362,599 *2C64BE35A0FF07C93756C5FE1250C5D1584DF3F2 FEATUREMAY
438,362,600 *2C67CB39FE66163F47E02B14DDA34762D17AA146 [email protected]
438,362,601 *2C683164A6C8BC2BBB845264AA741EF293412B31 [email protected]
438,362,602 *2C67CEA979072B2E68ABC26DB291D9C928461776 hoseaordeneaux
438,362,603 *2C689A1D103146F623F2F6801CA1B1BB9775C263 FERNANDOGAGO1
438,362,604 *2C600942086CDD42297E1A578B131C339AC7D0D5 FERNANDO.LICKNESS
438,362,605 *2C6342452848D4FF9CF0B3E599EF234AD76185AF HOT.SUMMER.DAYS
438,362,606 *2C618C7B94A3F9D4ADBB34CA376657600BEC93C7 [email protected]
438,362,607 *2C6C456CA3947366537A1A55D198CF64B5E90B28 SLIPJE1
438,362,608 *2C6F620576B75E767A8031DEC4D77D0A9D6B1EA9 HTTPWWW.STEPHENKENT.
438,362,609 *2C6A9F9212BB4527D07A4EB7DD38BFFE89F4D968 [email protected]
438,362,610 *2C6E884D3D073368905D8C8E97C197990B7F9AE7 hughneuser
438,362,611 *2C6FD0AABB3D482212BBF7D2081E0E294396F6E7 FLORENTINO.KITTLER
438,362,612 *2C6ED704D67ADBCBF3A851AD8FF3D31BC6F24212 solideris
438,362,613 *2C67FE375026F065860D93E2833D6EF020C189E7 HWYLCES4
438,362,614 *2C664A644F92C89E46A435FE411DA178C2B7AD22 SONHECKATHORNE
438,362,615 *2C63E7D327D38710D2F47B9B6843B4C453C6DE86 FOLCLOR5
438,362,616 *2C6E6B9144244CF7AE90AC19BADC8F90150B26DD forthesoulofthesavior
438,362,617 *2C6CC97EF3A3F7DE6280BB2C64B4EA3E30B21EED splat!-*-*-*<-----8
438,362,618 *2C6B8F14AEF73CDCEC690EC27AB29E3AD81A18DD FRANKKUHAR
438,362,619 *2C61F29A18293F99DF8695C97A90C248C3CAAAB2 fredericriffel
438,362,620 *2C6A9F904D46E9C32F2A68C04C60105139980101 SRAEHPS3
438,362,621 *2C6F5A89A689864284ECCBC0D651C3B8F8A2BE7F [email protected]
438,362,622 *2C62302534A6044A0DE5746056F4FCE780D1ABD7 SREGGELIESSAKING
438,362,623 *2C6B2B9F2FC64F3B24197C2869B8E72B59D11DDA SREHCAERED
438,362,624 *2C68C4E257A1C1A4247C2D4E055D116BF9F7F517 impavidclone
438,362,625 *2C6C48342A78D11883CDAD3FF0E64EA383241E5F [email protected]
438,362,626 *2C6568C0948C13F53EFE848797151A3DE6F62169 garlandkaelin
438,362,627 *2C62C8A00567E4A05F17617F014FC1DA6ABACCC7 STETROK9
438,362,628 *2C6D93034E3AAA7F84E75FEAF103A123C8984AEE STIERENHUIDEN!
438,362,629 *2C63E393425E53717F5B780EC2B98121BD2FA3DB INSTRUCTME
438,362,630 *2C6C4E54BA8E74FB4C71FCC09539A84EA2B78EC6 gator'sgrin
438,362,631 *2C6AA048C15A1C3B5E424F7598CA6EA0EA5C2B3C [email protected]
438,362,632 *2C62C7436B848B04D9ECF67BC4E55E3B076CE1EB GEDEM
438,362,633 *2C69C534A3082C4EFB3842E5F73AFEA188969EA4 irvinhernandaz
438,362,634 *2C6681AE535D7A6AF4B435330CA70EFB2F7A5FF8 SUBHEADWAITER
438,362,635 *2C6F707829A5A82371A27182A54AB4D21B23FB7E SUBVENANT3
438,362,636 *2C6587D0840D26C1F1D673F5D13791554BBE9AF2 GENERARA0
438,362,637 *2C687B325D4CAD298D23FD8D3455DF3EE74F843B [email protected]
438,362,638 *2C6A5B0384BFDC0DACC7DFA8B0A90015A783CAF7 ISMAIL-RASUL
438,362,639 *2C6881CD0BD26AACE5FFBE9DB39AA4150602C379 sumaiya-sultana
438,362,640 *2C6A7774D3234C7B8245BF5DFF8A593A16BD7D37 GEORGE.STREFELER
438,362,641 *2C6952673FC490E09D284EE88167E1C453569B56 GERALDIDRISS
438,362,642 *2C651BC0FBD7FB7DAE37D61A5BC70F69B353E6AF gerardoaminov
438,362,643 *2C6A926CDED7B9B53207344A091C6AA79E0F988A GERARDTANDETZKE
438,362,644 *2C6B5C40D20B30ACB81B30210986001DAED7335D I-TOUCHED-HER-LEGS-(REMIX)
438,362,645 *2C619BF31EE2C7D08A3E8F7842F337371C7BEB88 ITSATIVSING
438,362,646 *2C63A2F6A9317A2E80FCEBEC04C0F1972A53FAF6 I#UQ
438,362,647 *2C6C061B6FCDCE127077647783D9089C7474AF87 IWINANT
438,362,648 *2C6F35D28B9F263991BC0FF8AEF2AC7722291926 [email protected]
438,362,649 *2C6A3420B1A0E302F078BFA0EC55374FF7F05699 ginasamarelas
438,362,650 *2C61B31E7F555D19765DB3457109A7CC61D3E13D SYLVIETREK9
438,362,651 *2C6DF56CF71F76D2FF89718784BE09EEF7849BF9 SYMPHONY.NO..39.IN.E.FLAT.MAJOR,.K.543.-.IV..ALLEGRO
438,362,652 *2C6B6C31B4226B266525FDA0E46006B09C85D626 jaimesanz
438,362,653 *2C6E93D39CB63D51EE3A4F9AA58B8F68A79196BB jamarfrary
438,362,654 *2C6FCDF2EF4A7DF4B3B5C5BF02A7F88522570427 [email protected]
438,362,655 *2C66546735EFEE2EE0791E63B586A422676E0F8F TABASHEERS
438,362,656 *2C626FF2A5FA97B836BE6826F8917C6B9F0D958B jangleiss
438,362,657 *2C6F605C98F603944E804B486A8AE5BE6CFE80CD GOHAN1990
438,362,658 *2C657AB55B0E2D950D58C50DF3A2643733215AF0 [email protected]
438,362,659 *2C66E7F3AAAE851AC4A029FB4DA84F999E014238 jasonmalara
438,362,660 *2C67945ABD4B9602902493FCCAFD0E23D95C9D45 JASPERHOUGLUM
438,362,661 *2C668B5B95FAA32FCA3A36C5652D690689981328 JASPER.PILOTTE
438,362,662 *2C66222221D42343F213D1392231CE5D40B0DCBB JCOLECK
438,362,663 *2C63F83A7B718F2F563F158BAFDF78BD9DFE2867 JDBATHOME2002
438,362,664 *2C6F44771C89D43DC8C9BBA0553927A8219F9B20 jeffersondenning
438,362,665 *2C6C600905491CD528B8CCCC769AC7EF5E3E415D JEFFERYKOBIS
438,362,666 *2C64EE9279CF81198C8D1C20047BB14EFD8A8B96 graemebraybrook
438,362,667 *2C6238BE109983AA564DC4C79D26AFD6754B375F GREG-CUSHMAN
438,362,668 *2C60AE7C2E514034FCEC637ECEF60D50586447BE gregoriofetterly
438,362,669 *2C60287F17E558AC3E1492B883D2F79FC61A026A gregory-lammers
438,362,670 *2C6C46185D88F5338DBFAE9C71F7FA66945F482A JERRELLAGUADO
438,362,671 *2C66C6F62EF1B0153D8A902991441CFBA7A8A901 jesse.colter
438,362,672 *2C6A27B55C46EE31EB34666F0E687E97CBBC13EC GRUMPYNAPOLEON
438,362,673 *2C68918F91F994DE705E3BCF8F112F77EEF51343 JEST96
438,362,674 *2C6C951BA72904DC8F441E3F210DF4314B44A99E JGERTEET5
438,362,675 *2C66EE055E27B33E5ABD09DBB935A9EEDDC82D8F [email protected]
438,362,676 *2C6A721D5948C6427F47BBA4A40E42BA9E0BB597 [email protected]
438,362,677 *2C6862B9E5AAAE6C612ADD0C3916340C00DA0B1B TASCFLOW
438,362,678 *2C6AC086F247FDABCEE95202333CB2935827775F JinMin
438,362,679 *2C62D42AFA91DBFFAFE36F093010386C9F748409 TAYLOR.MIRISOLA
438,362,680 *2C6E6B9200F30E8F1ACE6EF3C86D14C30207DA53 TEACHMENTS6
438,362,681 *2C6BFD11FEE81AEAC24BBA773B3ED9636E7B453A TEELENYO1
438,362,682 *2C669BDE1F99B9FA1A21E3278E8B22E5B978C957 têhn
438,362,683 *2C6E5412E5771F34EF8E99E3AA8D018AB6BAB861 joelharm
438,362,684 *2C6F62C77F624A911E90461854F488485B8D041B terrancecasady
438,362,685 *2C680CA7B82A6FFAE93367F4AC238E7340092FE9 TERRANCE.GRATE
438,362,686 *2C641E67D2545432001D64F769F92C7EF145A733 joeybarstow
438,362,687 *2C6B9F55C2E19B187924A264563CF66464A5F0D6 hannahshelly
438,362,688 *2C63076C12DA6F04446F620D8BB878B0B520DE36 JOHNBOBLITZ
438,362,689 *2C671A181221D76F291B1A5DFBBFA346A59B6794 TGLUSENKAMP
438,362,690 *2C6958BB10B4913ACCE4CFB00CAC87D4A3651B07 JOHNNYMANAUGH
438,362,691 *2C63746C166E02AF2DCC3D688DAFA5B75158B4C1 HARLANDURQUIDEZ
438,362,692 *2C6560DB3445693AFF2E522655C83F4E3A494ECA jonkurt
438,362,693 *2C61C35430A8C41324D4278AD31CC59CC0962DD5 [email protected]
438,362,694 *2C6D570494A6FE54660FD8E525D5CDDAB44F6E35 JOSH FOREHAND
438,362,695 *2C68707A66088AEED6D893905FF1C8F4B0E8ED8A josh.juarez
438,362,696 *2C6DDF0A368D7E6E7538522594CC759698541463 TheEverlyBrothers&TheBeachBoys
438,362,697 *2C6FCFC5A59316B5A9757344120D78A2560A6FD7 THERON.PICARO
438,362,698 *2C691E19BCE6401EECEA7403A8DC8C9CDB337CA8 thesteel1
438,362,699 *2C62419E0FC439A0983C00C7071ECD5CC15069A7 thguarfrorroh
438,362,700 *2C69C850695065C4EB42F9503578DC176D817601 [email protected]
438,362,701 *2C600893743F251EC435C53FFEF29F9D8C89A533 thuamul
438,362,702 *2C611CD044B02C1187AFD04CC5B28688B54903B9 HERE I AM (FEAT BIG KRIZZ KALIKO)
438,362,703 *2C691B4668C5161E573F32EA2661E4181FB423AF HEY, DON'T WORRY! I'LL LOOK AFTER KENTO!
438,362,704 *2C69F4680B0AABE788C75CA59305171475076F70 KAREEMPHERNETTON
438,362,705 *2C625B66836D9538D0F8A11FDD1F0FC002398558 [email protected]
438,362,706 *2C67F67B6A12675C66B240F7394A62CC254C525E .TI.ROF.ELBALIAVA.SAW.SWODNIWNEPO
438,362,707 *2C60C4734D4C047FA6865934CD1BCE6E6389B7BC TJALD3NS
438,362,708 *2C639EEB644B8E535971EA8D4E95C298652D1178 HIRAMLAUGHTON
438,362,709 *2C67B26D0E6AD864F6E35F2B510A65B048BA5107 TOBGEAM1
438,362,710 *2C61797CA8BC714F0B93F992071D6AB2A2F50516 KASTIELOZDANYVCHOD
438,362,711 *2C6B61FF0AFB1921F6873DB02D044190BB1B9272 KATIE-GRASS
438,362,712 *2C6760AB9977F8FFFE7993F9309DEEB43C871E0E hnpe
438,362,713 *2C608760A7D6DA04DA27D7BDF11A52B715E5A8F7 TOMRIDGECENTER
438,362,714 *2C694FA5283EB572E84C18293BDB2746916051D7 tracywaymire
438,362,715 *2C626C75972A0D240CFD5F71B1D60129B46B9311 travelling:fareast/slowbrook/ilostmyheartinmoscow
438,362,716 *2C64C3E9F251CB82B911D09A4B291D09DD732A4F KENETHWEDIN
438,362,717 *2C6CF89C8BAFC93249D0059E76EDD8D5F98A66F4 Hongaarse-Rapsodie-No-15-(arr-V-Horrowitz)
438,362,718 *2C6A614C23563A51C7B3FBFB8111C1D593CD19C0 [email protected]
438,362,719 *2C6CCF8C2B5CB19B9C5F2B418B1981FC3A42FD6D ken.ryu
438,362,720 *2C6F04D2BEE673179619F34C28C55F91A2A8FC78 HOSGATHORPE
438,362,721 *2C63C10FFF186E77FBE11FC6F88527BE99CAC330 TRETTHETSTILSTAND
438,362,722 *2C6CCFCC0C8CF544E3B3D9EC8186E65E1B2C329B HOWARDS'.WAY
438,362,723 *2C6E307CB444B433A1A9FB7734061AB729D2F1B2 HS20050129SI1KU063UI
438,362,724 *2C6B5B9C252FD14BEC36F89348C5C11AAE9617BE HUGHWEETH
438,362,725 *2C651FE327A62769E596E3410FF10757963D0CDC hugogroetsch
438,362,726 *2C628403CCC9549CBD4F2D145C55AF1E52F4687D HUMANFORM4
438,362,727 *2C6926893BB3266A5641E1E7A231BF3251722371 ttihcnob
438,362,728 *2C60472F99228BDDEE2955DC4BA4EB15D6EB38B5 KRISFRANTA
438,362,729 *2C65404E550B44AC68801E39D679B3F871792060 [email protected]
438,362,730 *2C668A7E5B22EA74A3275710F4A3C0D209256BA2 krwo
438,362,731 *2C62D8E1F9E4E854323756E9FB39CDF0704BC395 IAZZNIAF
438,362,732 *2C6857682B731F9AD9B4F7EB5EFB250D5F53DFC7 KUVANKAAPPAUSET
438,362,733 *2C65BA8A572AB940E0916C363BC3A889FBDFBB03 lamsla2
438,362,734 *2C60CAD156C8F23A8B18D454A280112369BFE970 LARRY LEDLOW
438,362,735 *2C697DDA125EA6F4AA53D322AFF2647C18B80640 UNE-CHANSON-TRISTE
438,362,736 *2C61E66A7EBBC27165854FBD098974627F1A8C9C LAWERENCE.SHEARIER
438,362,737 *2C6C39FC5820E7DDB372925F5781E3D477DF64CA ILOVEDOWNTOWN51
438,362,738 *2C66117606057F4AB5477761FBD848A548D538AE ilovesaturday19
438,362,739 *2C603103DB39162766F5AD7E3E93D9B1AD6CF084 ILUVCRUSADER86
438,362,740 *2C6E5E5FB106EFE85876BCEED31CD02A2AD0F313 UNWAXXAWNU3
438,362,741 *2C6831D534F2E1D7728A59E2B2DB66A572F2D46F ūoį
438,362,742 *2C62955FBC13A0061C2C6DD961075E5DA65CB357 LEANDROLASHMET
438,362,743 *2C645E80A7A6CC80D19FD6E169A9AAF8214DC526 URETHRORRHEA
438,362,744 *2C6639EAF774BDEA66B7DA44746728F72B4C8580 IMYNLANAB
438,362,745 *2C6C9AF15546DC439DC39DDF373E38719F0058AF LEMUEL.SAVELLI
438,362,746 *2C6023283894DC7FF296AB3258364146A2934BFA USHABAHL
438,362,747 *2C6F9EFDFED42A527D2D0B11CC5492EC05F3C64D /USR/SRC/LINUXHEADERS263224/INCLUDE/LINUX/FS_UART_PDH
438,362,748 *2C65D0DEB6490A0C23FBD09D80857D945341C76E le"r
438,362,749 *2C6228D92B98F8BC1F3654A357252AF3E93C0F19 lesliebowels
438,362,750 *2C673BE16808309B906DE346DEDD9BCBE9FC141C LESTERMCCAMMON
438,362,751 *2C643BDA9DD42277EA14903B4753977B853CB599 inferite2
438,362,752 *2C63E9CB1CB1CFFCA7A96287155460965F04697B LEWISPERRIS
438,362,753 *2C6DB5B59F8B0EBB121C72D932AD9D4D1319C091 LGUARDACASA
438,362,754 *2C602CB09CE791AE2641492F4873D587FDF48F8E v1mnwk01
438,362,755 *2C6A1726B8D3D2595B936819ACED185510900DEB V3RI5M5
438,362,756 *2C6642885EA436DFDD5AE56489F66DFBC76BDDDF In-Pursuit-Of-Pleasure
438,362,757 *2C652686A92DB175CF4778B6C96B6E991A823803 VALENTIN.STENSLAND
438,362,758 *2C658281AD0211A4FEE9FDB91B43F9B2044AA543 LILLIANBLANKENSHIP
438,362,759 *2C6CB55CBACE796710A234585D9EA2415369ECAC LILYTULIP
438,362,760 *2C6E6CE2F0F0C2714BD45EB5CF5A75F212C9F5A0 VALONVLHDYST7
438,362,761 *2C629F8C5F4BBB7B6BF6561C0C44A4691E5A1BAA lionelspillett
438,362,762 *2C63960A0236126F889CF09056552BB9C3C5428C vantatore?
438,362,763 *2C689A4D72F2ECA5323C5AE2DC684772BD4EF46B irortnec
438,362,764 *2C6890BE4DDAE46599CD7C58971DDA4215D08A64 itlusni5
438,362,765 *2C6ACE41EA2BD8C33A90A2CC69511C8694346E50 VEERAYAV
438,362,766 *2C66FE5AD82DC7F3FB421BB2D0919F31D010E460 IWDX
438,362,767 *2C63F84E4C0416A7C9FB06006ED606D65DD21839 J1992042619920426
438,362,768 *2C670DCBD381E39D97111B7FA0045A11AA28ED01 VERMAKELIJKHEDEN6
438,362,769 *2C6A7A1BB610F9E570453F2811D1EAC2C40F4A59 VERT4$
438,362,770 *2C62093C2C7B1A6280E98C0A936A60BDD0F1E30B lothar6
438,362,771 *2C6C0FEE4C25DF4846965212A45FC279CC472133 lucaskuniyoshi
438,362,772 *2C6BCDFF2D4048DDBD87214D26464286FFAF7AB7 VIEILLISSIONS!
438,362,773 *2C65440E3E4B30F721DE94E734A6B0542C3C8919 lupetah0
438,362,774 *2C6C149950F1BE94690841148B1733C618E5A90E vinoathineerajandran
438,362,775 *2C63C97CB4E1B45C7ABD1F683AA41349C342410E viorica.talo
438,362,776 *2C6E141D5B61887770C38D851794B016C13768F4 lyndonlastinger
438,362,777 *2C6C210686A8CFCB79F1236FEBB8C7115A8CA97C JASONSTECK
438,362,778 *2C6A35C43C3626BE4CF2BF1848AD5D342C47A320 javierdeas
438,362,779 *2C66C3D0445227CAE7E35F4FA9C17331FA8F6220 jaylah256
438,362,780 *2C6FC898491AF45AE2B6A9215C4FC2C62FF7703B VISITAVANO!
438,362,781 *2C65CBD6E16CFA033997FA66D9B6130EB21F2D55 MAGICCARPET(FEAT.ANTHONYREDROSE)
438,362,782 *2C65ECFC063EB43FEFF7249F27AA9A305D8AAD10 [email protected]
438,362,783 *2C6171805728D0C853119457FF9028382B8A3D48 [email protected]
438,362,784 *2C6011CB18950A50207D9A399231320A624ED1A7 maireadkirby
438,362,785 *2C6C693595A436EC55BEE18A91EE8ADFB7DB3C56 JENA-CHARLES
438,362,786 *2C673793858215FA218E2F42A605AE417C11173B MALCOLM.HANKO
438,362,787 *2C6FEFD0BB59D844A66370C1CC2B125398AE9EA8 jeremycinotti
438,362,788 *2C6C2A73DFCFA6469AF657C678AF7504A5B3DBCE [email protected]
438,362,789 *2C6D358FA3D792B9C0EA28007103943F8DFA7937 MAN.BALANGATAN
438,362,790 *2C6D3EDF1BF2DCF22B2958C153F4D2B9ED4EF993 MANCHÁN’S
438,362,791 *2C69E228765C0DBA580A98BA2ABEFC39E42B6943 marceldanton
438,362,792 *2C647F36BEF39F319A9653F82ACE2C376093834D MARCOS.SCONTRAS
438,362,793 *2C6BA895794EE28B1D70A259F7839F256EA9A46E vtrnlhmt2
438,362,794 *2C67C6087745DD6D7C2CD2F284E24E112F628A63 VYBORNOVBSWING
438,362,795 *2C6F053F1602CB2CC6B3C30657669DD7224A0B55 vyzna
438,362,796 *2C6077A6FC12056D5F036B5CE15A305355B20D22 JESSIE.NUNMAKER
438,362,797 *2C6FB4A28BF3E8E285FFB9E884A91391512E200A JESUS.HARDENBROOK
438,362,798 *2C66F67C7B2E7670883B595D18A1D0C0FDE56703 [email protected]
438,362,799 *2C6DF308D6C1446C60099287D58BB5402864C72A [email protected]
438,362,800 *2C6A546A90561C7DFDCE7B208F2E2BB60F631691 marxorg
438,362,801 *2C6DB07B965ECEE88CBDD2BABE7117E2E4A98A48 WALKINGONSUNSHINE(FEATDANNYCALVIN)
438,362,802 *2C6C5B3AAEE689BFC484CD237CA7FFB492A2DB75 MAYNARDROZAS
438,362,803 *2C6F54EDE7CA46E9503D626B078C3992875B5001 Waltz-in-D-flat,-Op-70,-No-3-(op-posth)
438,362,804 *2C674243E53087E9B1EE661285305E78B1532181 JO3LH4SS3
438,362,805 *2C695BA1DE52A99ECBD015F238CD3F8AACB7C535 WANYLA WHITE DOWNING
438,362,806 *2C684C062EBCB96254C54309DA8A3C9DF21C44C8 joebuddying
438,362,807 *2C68874E95688F315DBD80311BEE2FB2C6BC8E42 [email protected]
438,362,808 *2C6D83177C4667E1AA858688C679890DE31DB43B WARRENVINSEL
438,362,809 *2C6EC19E075EFC9477E991061B2E05A1801513CD WASPISHHEADE4
438,362,810 *2C6427302A5E2F12FD552743BF04A1D310AFAD33 wasselonnaises
438,362,811 *2C67576EC18CBD1D1931870A87B920CAAB4DD5D1 MEDINAVELKOMMEN
438,362,812 *2C69DF1CA96FBEC6EACED6EEFDA31121C2EAFED2 weldinarni.evie.lyana
438,362,813 *2C6268234F8D736E6B5A9E93718CF2AB36E5E594 jonathon.coats
438,362,814 *2C6AE71B8756544EB9D297A36D2F023093B5B886 JON YOKLEY
438,362,815 *2C66FA199F95D7D8E1B722911E398F4D540E4590 JOSH.GAHNZ
438,362,816 *2C6DED772CEA192B812297384920299C07644716 JOSHSTITCH
438,362,817 *2C63B4B373EC38601FD8186C986E864BC7EEA73C [email protected]
438,362,818 *2C6A4C564BC1CFA7493A5AD406C529183F69D324 MERCANTILE-BUSINESS
438,362,819 *2C6343F5F56709226C402887FF9A77E945FF1707 MERDELL5
438,362,820 *2C68CD3CE48130D853D0EEB5711E719C7BFB33F3 joy.asperin
438,362,821 *2C6ABC678160982332B90DDC52E6B7DE695256EA WESLEY.FARREL
438,362,822 *2C60A4BCA78B87752DBA62DE0B405F465B18939C jpowellbsw
438,362,823 *2C6F133D774F8E937DFD3B00EBF2F531968C2DDD MERVIN.BOCKLAGE
438,362,824 *2C6A8C6EFD06C7632A95445DABB4C3007929DB8C We-WiLL-STiCK-To-THe-BuSiNeSS-aT-HaND,
438,362,825 *2C66641C58377DC998E07687D83F1AC9F07A79D3 Me.the.Peaceful.Heart
438,362,826 *2C6CD9A954864B12C145F9FAE7E3AEE819F3F34B j#t\
438,362,827 *2C689DC82D20BA09571A1C67B5EA08782A325708 mhtyhrnn
438,362,828 *2C68C061ED8C283C896BD01665920ED6F54A2BC8 WIDZFIRYU
438,362,829 *2C6B692999A6DC3CC48182EA4745F5251D193FE8 MIGUEL.FIGERT
438,362,830 *2C67FBC52A791384F0D7634F98C877367F6958F8 wilbursawatzki
438,362,831 *2C6CDCDD5AA682EF05D0E78097BC9FF1581171C5 MILJONAI1
438,362,832 *2C6EBCB35F5FD63B6D4993322D67C4E174224241 KALACHARE1
438,362,833 *2C6FA2E6703F9BD1CED422D3E020BEBBE480F9C4 kangiso
438,362,834 *2C6CEC5236E0B4C8A01BC1DB1E81F991CFAC1CF1 KAPELLANBAUS
438,362,835 *2C6105BC132BF01CC92226F2DEFD423DDE0BC22A KAREEM.PIEPENBURG
438,362,836 *2C6B7D53111F5E08D3D1B88F7032DC3B7B32A9BF [email protected]
438,362,837 *2C658D26DB76BFF487A2E383CF10EE0E1C19DB26 MISHOMAN
438,362,838 *2C6171F26F11DE2C6E35290D27D1CD381728B17C KARTENBESCHÄDIGUNG
438,362,839 *2C66FC6F9C9B59D672BC19CC5FCFFD6787026182 WOWRAINBOWOWRAINBOW
438,362,840 *2C6900D2876EC83E0C467C3175914D294A486FA0 [email protected]
438,362,841 *2C65F5906B263CED9C22A67D955FD10C1705A65E MMARVIE
438,362,842 *2C670862D73395B160410E7860C1F78FCAA02B52 kbto
438,362,843 *2C6437175B05F974790604C7FD75AA50705332B6 wwwcollabwebcom
438,362,844 *2C6A8A1FFA8276A336F341CE2EAB8BFA74E484D5 wwwfiveslawcom
438,362,845 *2C6C3E258C106D5FD1E166D72E4E1A0784F28631 wwwlocalgoodsorg
438,362,846 *2C6BBBA17AB4C38F8F23221840CC6E2402F95A3F kenethworm
438,362,847 *2C657A85578818A2821F59B47B7D907D69B4DC44 MONOASSI
438,362,848 *2C6CA6C542E2D92026758C1D9EB75E2DC3E83EEE KENTONMOH
438,362,849 *2C674025E951ED483DAA0C3E33BDEC8CF05AA0D0 MONTY.GLORY
438,362,850 *2C6EF10B793E26FB2ADBAE057AA02D43DD35C179 [email protected]&
438,362,851 *2C65D77D73EAF7F56D998D36720E8792893B1989 X2AA82
438,362,852 *2C676E63B2706F10DF412CD2E638CAC797F18C4B MORDIKINE
438,362,853 *2C6A4FDA133407A7D62B63A743A9E29717941B0F MORGAN.ISAACKS
438,362,854 *2C67EE8CE95AC3E2549A0741FB2F11A794F01761 KHAIRI TAHA
438,362,855 *2C671C94386FB88379EAACBA1071A8DED03FE841 KHEBLVO1
438,362,856 *2C61FA7C59D06DE9151E632476D4D79A7D528F85 mosherangel
438,362,857 *2C61CCC7264B668DBF53D7C23217CD4A30F1065E moslem000
438,362,858 *2C6557A851E9D7F99B8FC81F2B724F89DF366BB5 KIMSICKLER
438,362,859 *2C66CDFEDCE03F029A1C0146BB3186EDA48CC555 [email protected]
438,362,860 *2C677AE2F4E3120194DFD635E468629425F31394 KKWALLINGART.COMWWW
438,362,861 *2C685A8B8A42933A9CE0A65423057B224F037EA4 KLICEVILAIZNADTREBOVICA
438,362,862 *2C6904785A456126453AB2B9083766A583AB0A4A MUDFLATSNETWWW
438,362,863 *2C6B52F545EB4C5026381373129C6BD4692BD9A9 KREFETZN0
438,362,864 *2C652460FDFD3552CD58B1A3CD5F749B1791B646 YLIOPPILASNULIKKA
438,362,865 *2C6B9758E89261F072F52530C6068BE743956EA4 YMANESNEJ
438,362,866 *2C6504B2A169A1FEB7258E5E08C23A1074072C07 kr]m
438,362,867 *2C66B91BA707AA51AAE9D44513CB2EC9EE69BC12 krzysztof-janusz
438,362,868 *2C63CB77066479AA79A2259665D315E4AD202E45 YOSSISAMUELS
438,362,869 *2C634BDAF24E8FD846FD596F5851424E660BC687 [email protected]
438,362,870 *2C674568BC5D5B61466C1554919780FB43721307 YVONNEHILTON
438,362,871 *2C6140BF6E51DDDBABCE02D200AA4AD4912F21EB LALIMANÓM
438,362,872 *2C6EE199F25D1193C0E1732DE2F70BBEAA06A2E0 ZAANDEZAANDES
438,362,873 *2C6D17EEEE2D8E84E5214EC946D2018041646F3F zachary.thomas.young
438,362,874 *2C64128C3290FF8DA311C325D06B33AAC297DB60 zaczynam8
438,362,875 *2C650C8212A6496EAD9C26E894185EE3BE2FE628 MYCHICAGO72
438,362,876 *2C6164EDC82DAC35EACFE9D4F14FF498569399EC LAUREN.FONDELL
438,362,877 *2C6A74C061E4C2BD08082C0C9C28EB1946F2D98F lavender14
438,362,878 *2C6849A560D11CF4B897D19272C8A946CE844B44 layance
438,362,879 *2C6439CF5607FCB7862EB93EC2E7738EFB172A34 ZERVOKHORIA
438,362,880 *2C675C579458B3DD4EF8B6FAF17B050C2DB85E0F naetoeve0
438,362,881 *2C637E3B68BE7C1CDCFB4B0B8A1A01A96A3FE281 LEEPOWER6
438,362,882 *2C66D98991D909A067502EDB0A88D10020143C3F [email protected]
438,362,883 *2C6E46361AC0E885DCDAB1957DC4CDF76130A96E [email protected]
438,362,884 *2C625B2A1ECBAB6EA6DBA160B5E0367462C4651D [email protected]
438,362,885 *2C6B8527069A92566F290F50988B87DB70D56493 LEIF.CARELLO
438,362,886 *2C6EDA41C7A8CE3135F600C3B15EED3769E26B81 LEIGTHUM
438,362,887 *2C6419F7E329A3412C4632B82F1A1EDF949B7B45 Z%II
438,362,888 *2C61CE4542808BAA08B2B8CD58D1DF4B0FDAE2D3 LENREIGH
438,362,889 *2C64B2E766618F8C1B62BD464C41BE160C1E0E55 LEO-SHANAHAN
438,362,890 *2C69C95C5EC6536F2362C61FD43D6FEF91A142E6 ZOISAAFMADJ2
438,362,891 *2C64D8A59E299FDE885B66AD35C707237F3F7E8F ZOOLKHAZRIN
438,362,892 *2C6FF0B8316714D92C3F4686F0D01A658694D662 [email protected]
438,362,893 *2C607F4905AE07AA9E137238FC31F0187A77BB88 leucocytoblast2
438,362,894 *2C625B20AC054B3901D2BBF0099B1EC23D9FBE6B LFF3
438,362,895 *2C604638D2625813F7D377357DAB46CDB452717A LILIUSES6
438,362,896 *2C6EBD54013527CA1A6FA08A45C92BD2EB424CF3 В338
438,362,897 *2C63237D5E710614A73A2DCFAE866F354CB932BE NGALIEMA.MOUNTAIN
438,362,898 *2C63540AC59E783197CC971FAFA35736B805D831 lindsaykaneko
438,362,899 *2C6332DB5668FE39A8F2E635877C577E2CA75D8F nickmintken
438,362,900 *2C64955C18BF167ED1AB3042B4E587FBA17DE27C nickolaskienbaum
438,362,901 *2C6DDAF4F445E6A9BD7DF9E93D404703FADD020D nickwellen
438,362,902 *2C627D015A0133AE96D46989405E84BC888E254F ИНДОСИРАЙТЕ
438,362,903 *2C67217960B0F8D2E25C7651827830C820592696 NIEMANIES
438,362,904 *2C6CB14770BBFFF988835ECC85EA1FEC69B3F1A4 NIETAKT9
438,362,905 *2C694086C33EEE2448BE8584413DBA41763B127E NIGELYADON
438,362,906 *2C6892C74E3DF409EE0CA5AD1D1AFBC2C04B67E3 КАНОНИЗИРОВАВШЕЙ
438,362,907 *2C6FC2AD443822830CFFDDEB2AE3E09F95B9A113 КЛАВИЙ
438,362,908 *2C669574F10DAB80580DEEAB244AADC266A8077C NOBODYLLS
438,362,909 *2C6D95A94E95036F1208999956B4AF031C80CEB1 NONELISA7
438,362,910 *2C63B86E9FE77BC8DB66962ABBAD52639FFD5EB3 ОБНЕЙТРАЛИВАНИЯ
438,362,911 *2C620EF613CF12D73351CA476148A1257D37DFAB NORA(((
438,362,912 *2C68D6B4D0BE6E1A87F75BE104013FA8FED54FCB northeners
438,362,913 *2C65CF7629280D6A846A9F6B19CBB19F14543FD2 NUDIES
438,362,914 *2C6D409BEB71E088A0284E243EBA0107B2836960 oathfuling
438,362,915 *2C6625F5A6BFF04570E1E7A7C20CC090A40AE41A [email protected]
438,362,916 *2C69CFFF6470CBB342A3E8C7E3E1CD2CCDCF781A l<>r
438,362,917 *2C671B2C284E8038DBA4AA4869E0DB58B4E77064 OMER.HEDRICH
438,362,918 *2C64BDE5C67A2D69DCCCC86D8C4089577276DAD6 M5IQ
438,362,919 *2C60332AB3591A7215ECDD5C3DB01AD92355FAAF [email protected]
438,362,920 *2C6BD753B6DBFFAA10EDBD05F04E446F568CFBAE MAIBHAS
438,362,921 *2C680B3F7D8F8682C5A521CDAD231AB3D4008EB9 maitreyi5
438,362,922 *2C6D084082B5A0A49DF1BF813E7BCE4549748A29 MALCOMBIRDON
438,362,923 *2C674033A4625D37148821A2F6A678BAEA00DD3F otello:actii"credoinundiocrudel"(iago)
438,362,924 *2C6EECC82AB8D9AB89CBF2DBBFF378E28B0B9196 overduvelen!
438,362,925 *2C6DCD2E14217E120EA2FE8F11FEEAAEB4B2C907 MARCELLA.FORD
438,362,926 *2C65C554AB04FEA0908AEA2594E89C0571D7D581 MARCELLUS.ODELL
438,362,927 *2C65839B4C050BD81F1BD8E8EE16777A5CCE782C marcoscambell
438,362,928 *2C6AC2F88E929C1F61801A23BF6F0FE3CC68C1B2 marcuskamler
438,362,929 *2C658A1C59D1EBBB38553146F31F27018338069D MARETINAV
438,362,930 *2C697C195D23D7B5B5B5C7C95F57F8CDD59F3CC0 :P~` @----8
438,362,931 *2C676A0AFCE9E1C66DAE60B21A62F1A056F1C1DB pa00113636
438,362,932 *2C639B4871A92E3F059FA724F0C63E16F2CE5659 MARKUS.TOUSEY
438,362,933 *2C6DD5CEC8CA60EFB67052AD38E9ACB4C4CB8473 part-35-(remix)
438,362,934 *2C65BDB78D642F893DEB33BC28FF8B9D0446DFE8 MARYMARINER
438,362,935 *2C6F9FA719808C7FEC857D98DDE08469B79F1E15 MASCULINIT
438,362,936 *2C62B0F04BADDC369F4E442C5253C0C171A67EA1 matt.belfield
438,362,937 *2C6B54F7F4DD788566EEC565F252202216F295E9 md5-hash-is-sucker-hash-ever!!!
438,362,938 *2C6BDE1EE51DD330BBE7100E107CE2ABA2B33FFB perdiendo.ganando
438,362,939 *2C6647639577E981AC39D2E737850BAE19047E12 MEL.LANDERS
438,362,940 *2C699041051602C6261406DD69240F9FE0ECB169 MENIKGODA
438,362,941 *2C632D2E8B3ACB18B7615F9A26672744CE6DB30D MENU4DIVS
438,362,942 *2C615B6ADCE27D570FA6C145D3E95E9646E64463 0246CRUISE
438,362,943 *2C6D5DA3380596C85358BA7DBB251AE13FF9F1CA PHILIPPINESDAVAOAIRPORT
438,362,944 *2C6670A3F7ED8BC0F5CAC7F07AF2D9ED4CE9983A METAPROGRAME
438,362,945 *2C6977F1F9B22ABA5FBF4DDF8FADD5C6F4D3C030 MHZ—WAVELENGTH
438,362,946 *2C60AEA1F884DA7A6B132E9358F4250BBED84FBC MIASHORTY
438,362,947 *2C60B9B28D1D1129149DE154526849A97DB05FE1 PL4YWR9H+S
438,362,948 *2C600FB2E53C271FED6805CD4825971F70298035 PLACOWEK5
438,362,949 *2C6B2B7549CB533BEE85DCE3137FEEEEA9F0A591 (0_<)O~<-----B
438,362,950 *2C6551920B5064AB6FB3E2BFCCCE42EDF8A95339 1182034 ".HERTHA.GEHT.NATUERLICH.ALS.FAVORIT.IN.DIE.PARTIE..
438,362,951 *2C6A45ADA2BCE0DDB54330F43F094657D4F86951 11-finger-wagging
438,362,952 *2C633D1E8771E883E5D7DE959A5CD6CFB74A9AC2 MIRNOU
438,362,953 *2C622D6A7E65E610794643AC51E4286740E27F68 1220142 JOKAISELLA-,-JOKA-EI-KYKENE-HANKKIMAAN-IHMISARVOISEN-EL
438,362,954 *2C667764010E365A7D92D862D3B178AF1C3059B1 missyou(pascalfeosedit)
438,362,955 *2C602148371844EB2092449B94BD150BD4D61BDF 13alwazir
438,362,956 *2C6506BA201CA12EBB445A896188B7F86981AAFF modificareasicompletarealegiinr
438,362,957 *2C63E33CE25ECEAC0C5A71B5122AD85F200CD7F6 MOHAMMEDBUSBEE
438,362,958 *2C643A46DFFC18E9953DF9E566D31F339EEF04C9 149719 my
438,362,959 *2C6267DB9A8BA7384B2D8E8E2F1A3D5D8F696BFC prisnih2
438,362,960 *2C6A42E673B64B29B89293F8CCD49E3C2DF98572 1621804 hongkongpolicesaidtheyhavenotheardofthegang.
438,362,961 *2C611C990C3CFC63458938A624BAF59A10FF1EE0 1727059 julkaisutoimitus-l
438,362,962 *2C652E1BB9D07ADC8AC928781486A6F0C47FE94E 1727565 solujen jakaantuminen , tuo kasvamisen ilmentym
438,362,963 *2C615E521DAA97B0A0CABAB518B55B0204595549 prskavkies
438,362,964 *2C6C8CC7BE8BFB308CFEF93EF64B3943B54671F9 MPBYNIGHT
438,362,965 *2C6E4DDCE793CAA854CC5A2EB712D60226B1D3DD PULCHERIÁT
438,362,966 *2C69D0A16EF78B78CF2746BA8E08A0E91F9EF90F PXVE
438,362,967 *2C61F14CEE2AA257AB60CA732F2DD23EE55CBB7F MYJUSTDOIT81
438,362,968 *2C6DA37EFC97087341BC4A4A2A1E3034018A99BC 1 drwxr-sr-x 4 root staff 512 Jul 12 14:22
438,362,969 *2C6D983BE9A0582E5546040C627518D149A7857D 1DSLCNZTN
438,362,970 *2C613DCA76CE3986DA5BF29CD94FFDD8F65DE95D 1EINZELHAUS-ANSCHLUESSEN
438,362,971 *2C6805874E317803C4627918DB35FFAF54C87473 qlcompatible
438,362,972 *2C6967AE18B783029F57ACDC3D6D658F6DBAA1A5 1EXOGAME
438,362,973 *2C68CC7666C0355DC454DF70D9188C27DC0CDB9F 1F87C689-3FD9-3A03-86E5-6F645C3FC4E2
438,362,974 *2C69D2A2942B6B52A28E91169341F291A43C9A44 n0m{
438,362,975 *2C6C8EF9520B73B62F1FAA64B07AC9F18EFD8EAF Q------).`~.`~}X{
438,362,976 *2C6E1C96C0431505791F1B9186459FE8F89E8292 [email protected]
438,362,977 *2C6B62D5E79CD9512360B5C310BDB1A7A6B0BC4D qzxg
438,362,978 *2C6344D543D7D286673AE873E571B42512112A53 1hein
438,362,979 *2C61AD5A9133AABE237EA36700725B96B82723A4 NAPOLEONVIZCARRA
438,362,980 *2C6336AE8526FF94823CBA562568E49C72FB6C58 RADZIECHOWIANKA
438,362,981 *2C6583A88E0DABB43C0F7540F75DCFF3E491A9A1 [email protected]
438,362,982 *2C6248636DEC81572309E30C3489F6B31EF0141C 1kaljatehtaassa
438,362,983 *2C6B90645327F290ED69713A1E36DC00D1469C94 1-kilpavalmennusta
438,362,984 *2C6066F5AA3D20F89EB21B3CB6A81518EF0F83C4 nathanmalibu
438,362,985 *2C620B8A5A99480DB952B34C8C2EF9B9FBBD0C86 RAMONCANTATORE
438,362,986 *2C665A205A71EEF741A1F81BA854B523753F0BF6 nbpogyi1
438,362,987 *2C67462F93A258CC7810B893091AD46B635850E1 Needy.Trunks,.Pine
438,362,988 *2C62AB197638AB46323EB82987A68D9533D2876B 1RUECKLAGENJUZU
438,362,989 *2C6EE51AAF4AAF5F649EE55BB122ADB00D34D4C3 nenaraz3
438,362,990 *2C6F5381CF63804E173D238C86B51EE96E3BF751 NEUTZER
438,362,991 *2C656928898DCB3F6BBCC26A03379179730AB840 RE5ECTA8!1!T!E5
438,362,992 *2C60EFA4BA3AB049DBD6BE54E043373FAEC9EE7D NG.KUAN.SENG
438,362,993 *2C6B3062E581237C7D54BE74E28EC17339C4D43A REALITYSHEBA8
438,362,994 *2C6F0FECF22B22F2687DE4657EE5A1CC54CA0F2B 2067712 TOIMENPITEET : MAITOTIET
438,362,995 *2C67386A6C74F09C8E7D7E6ADF69F84F9CCC55D1 NICK.BLACKMER
438,362,996 *2C6F678BB759B82F671CB3A47EBDD65BE17DB92F 21BUN1974
438,362,997 *2C6337947CE7C6B3A028D38627B72C61E3C9659F 2353897 ES-WAR-EIN-ERKENNTISGEWINN-
438,362,998 *2C672C62214CD2399AC5D3FB5CD4B51D5C86381E 2420759 HAL-HAS-WEATHERED-A-TURBULENT-YEAR-SO-FAR-.
438,362,999 *2C683CE289AF8E486E8A26E672E33E873084F2D5 REGINALDLIPFORD
438,363,000 *2C67D9E301E8DCD1377E1B3B901F9DF81DC752CF NISHITOB4
438,363,001 *2C6AD29E3E5742AAA44008ECD2F92AC7E70965F8 2594728 NIIT
438,363,002 *2C6934F8560F6BA5CAD2DBB845FCC7446654D354 N"JL
438,363,003 *2C64B29EBF8FD1A4E35118B2397A106DDC42222C noahborkin
438,363,004 *2C6D7507DB1F65C1354AE1E59E08A2F50EA15E32 2674397 "-cheney-was-back-and-forth-to-the-white-house-
438,363,005 *2C69EFC972CFEE99B3BBE4E59E04F7E0029EDB05 rendezvous.a.paris
438,363,006 *2C6905DF87326B79511D24D1B488D3821D23481B NOEL.MCGEHEE
438,363,007 *2C69C402144AD4698D724AE28937C15E18847477 [email protected]
438,363,008 *2C6F251CB2DC0ADD5BF87EA4D581BFF7B4AF0976 2-dolovski
438,363,009 *2C6958D8E71B901174EFB2D25CFE7EF6C0942E18 nontermination
438,363,010 *2C63E6ACCE40A5A92F840E03499EFE1044DA4FFE rexalvinmartinez
438,363,011 *2C679B7E7E8A5C224F805B2DE20311AA864E7342 NOWALNOP
438,363,012 *2C6CF6B918FDA63C271B5FA9D5AC335716C7A9ED NPZPBSWS
438,363,013 *2C62E99E3A7A1B1DA3BB2703648D66ACB6F9C35F nsancernigimenez
438,363,014 *2C62FD324CC9A385710D6E67441A97F6B08F1642 2UNARIANS
438,363,015 *2C611C5A9691EE728FD3027AA3A3B05A67D36291 RICHARD.MCNELLEY
438,363,016 *2C666EB8823EA0D4E6A59DE2893414D39CBB8A06 nur-die-zeit-hat-zeit
438,363,017 *2C66F568B64477164B823EACD6A3AE953C734954 nw3av3
438,363,018 *2C69EF59831B19F4FB6E1D8E9BFD95C2A5B309A3 NWSRNWSRING
438,363,019 *2C6E759F16E6BB2D53BC2C6BBE479C54F3906622 393132 TEL:(216)3642371PAMUKCUOGLULTD
438,363,020 *2C69A4B44758C1757352DFF622D33DF1D5AE1B15 3==B~O~o>B0
438,363,021 *2C6DBBB50985B1F63A3A981AA52DBCFF684A88F3 ROASTCHIKEN
438,363,022 *2C60C8D6D0A7ED9529CAB0F2B62652B700319AAD 3EDARAHCS
438,363,023 *2C637894D0175EDF2503DC378607424C750B7964 3EINFAHRT
438,363,024 *2C685129ECCC539F585D1B1950A442DD5494DE44 OP14985
438,363,025 *2C61DEBC1A8CBC44EDDD6B806BC17BDCACC1E6E2 opgeluchten8
438,363,026 *2C667CB8473F1D2C19335D4776016811C16D2B10 451616 BUYUR / BUYRUNUZ .
438,363,027 *2C6D73CEB49501C71FC99173C3D631286E46E7DB 496ANTONY
438,363,028 *2C64127FD336C98504141795299F3D5BF698E205 4.CESMESI'NIN
438,363,029 *2C6E4F1318656509CAC9DA3D4707C1B4C74E2797 oreodontine0
438,363,030 *2C60EBB41115765D1486BB0DD38BA1C98C217158 4EKSIDINI
438,363,031 *2C66B6CCCF362D39F6FE11603CBF56C7320BB730 ROXZDINAMO1
438,363,032 *2C670DE2F37ADE3D288F24184F5B5F54E1C5E482 ORTHROSN5
438,363,033 *2C605BD39B8E52917F716BFF4C12C1362233014E 4ISKEILLE
438,363,034 *2C6E0C0B7005DFBCAF18B3CC9037ED11B6991F84 4J890T
438,363,035 *2C6C2094FD9E589D6F8BD439AFD6B7A3CBD2DEF4 RUBIN.LEIDHOLT
438,363,036 *2C6BB2A31F102A500EC364BBB956D27EFE6F6B8A out$tandn9n3$$
438,363,037 *2C691FB5EC8B29D730598D78F87F3D17E36109E3 RUFUS.BIFFER
438,363,038 *2C6F1D99B42CE8EDDD10B5A288C66E90F518E99A p=>`)0(
438,363,039 *2C6E7133E1CDB8945A540E67FBAB38B2A87D9047 4SASKIAFLOWER
438,363,040 *2C657B4A8E08983B5126F42D4157BCEBB39DFB49 RUSS.DUNNAGAN
438,363,041 *2C6AFD27C484DDE4670DD4D864B692D0DCF15266 4SITED
438,363,042 *2C65A312A4FBB34AAF41A2C2F1F9656CCBAEB59E PALATELESS.
438,363,043 *2C6FDA6AEB51803B73413C81C6A4BEE821375D6D 55DE86E3E1DA1B389F0594E1AC25D422
438,363,044 *2C6700C115FA4E457ACFEEC5F043DC5CF9DF3C2F 581662 tuulantuotteetovatolleetesill
438,363,045 *2C6C649D32DCCE9ECACEB0393828BC3283CDBDDC parasmistry
438,363,046 *2C6E2E86D3B759A849FB8D22DDD2B2076417CD64 [email protected]
438,363,047 *2C6C5A0C7F68D77505A86D4FC710FDDDE0BFF24C s8lanc3
438,363,048 *2C60FDB3ECC657205CAFED943EFBCA22C95F7764 PARM-KUMAR
438,363,049 *2C6B37C6608F61D938E418C4245C04913F7657FA 5BASAD
438,363,050 *2C65BA2F81A131F7FE1B7FF85BE6904C58A5197D SALVATORE.ABRAMEK
438,363,051 *2C65C341A1C081713EFC76D8DD81D5A045ACAB78 sambanh
438,363,052 *2C60620C2B4C2CFF620FD5CF6CC5866AD2DB541E PASUQUE
438,363,053 *2C6F4325104807EB3B4C7951FA393CCA83310FD5 SAMENGEVOEGDE1
438,363,054 *2C6FFD0C2C790124622479C634A5421B8419844B paul-banim
438,363,055 *2C614F10799AE5C5575FAE49FBE2CCC08422BC62 samsonkg
438,363,056 *2C6F36FF4129B6C46AA998A76287422A725C1D6E 5FLETCHERLOVER
438,363,057 *2C6509C087906056E671E86504F115F928893E3F PB~0~osplat
438,363,058 *2C61D67D84C511888C727EA7B67AFB36515B7125 P#####B *}O{
438,363,059 *2C6A4E0559CCB4F04A1D9E336C34517F8322E80D sarahsmither
438,363,060 *2C6883488415B2FD15E7796DDC202B7E76DD6731 peace.to.the.i
438,363,061 *2C6F4446A5289EC1237675CB26643F94DB7CC16E SCHERBATYKH
438,363,062 *2C67F5229863117CEF164CAF3D433F6EAEA6FB2D schroomachtig
438,363,063 *2C653E292DA04AFC4381FF3C530ACC68F319657D SCOTTYSCHAUMBURG
438,363,064 *2C6792911C5C0886A95BC46A5C9EDA27F0A8AB40 SCQE
438,363,065 *2C6ACA462D875BEA15649A2E91969624BAC0539A SDERBER0
438,363,066 *2C6D152F3CAE609A881B3DA89AC4D6A8379EE279 6AMMIRANDOVI
438,363,067 *2C6A10F24A0C8F09EA82E59A709470AF1284A477 6ARDENTISIMA
438,363,068 *2C680AF52420635168AEBB2B96C76CDB69E71879 SEELEYJEVA
438,363,069 *2C6A8EF14010A52C8AD0FAE96B4CB782298FBCC9 6BRASILRASCAL
438,363,070 *2C64B863E1D1A39FCDC9831D6FED845317AF3F7B 6BUREAUMEDEWERKERSES
438,363,071 *2C68FFF6DBD885925F304D846DE3BC9EA84153AF PLANET.VIOLET.(CLUB.MIX)
438,363,072 *2C63E09DE405BDE615D72C512341097F4E3D7063 SEMISOCIATIVESEMISOCIATIVE
438,363,073 *2C6FFF88C6304F622BF3208F09B6AD2E0B8F9784 platonic.years.(fjord.mix.by.the.herbaliser)
438,363,074 *2C6E66C40A41E0A7E4BFC686023D531898F17AF4 PLUNKETT27
438,363,075 *2C67AD79BEAC89382867C3313C76920737CBCBB1 SESAIMENA
438,363,076 *2C6765BA5D3C456D3817CD4DEE7D2C23C719710A pnosfahnen
438,363,077 *2C694BE152156AA474EDAF0F58436E2D4A3F1019 6KUNINKAALLE
438,363,078 *2C65FC5D783FBED96219AAFACF5961EF50ED7E52 [email protected]
438,363,079 *2C6F1D45789E190148C9185B666352B15C71A2E8 6LIIKENNEMINISTERILL
438,363,080 *2C6417034BC67B2E0E5BFE1A1C20BB04EF1D55C9 SEUQIREMIHC3
438,363,081 *2C6625BEFDF9D61CFB04D2A7979CED904BEF9AD1 SFAIRYNA
438,363,082 *2C663210C5E812CF78DEE3EFA1455A90A0EF38BA porcobarde
438,363,083 *2C69ABEFDCBA27291C00B4B74284AC8ADCA7316F p======p `~ (o_)
438,363,084 *2C61EC1FD70D7BABD7004059BBF4DFB592A5EEED SHANNONDEADHEAD0
438,363,085 *2C6872A84C2133126EAEC71B1FB6F6117459F217 prakṛitis
438,363,086 *2C6FAB57BBC49B93FA57B021D6653898C1F0111D 6SIULSLAA
438,363,087 *2C67313B63ADFC09F69A00635EE884687980B670 PRE-COLONET
438,363,088 *2C6CDD8E32E138367F6B997F62DDEEB15B4EF748 shaunwestry
438,363,089 *2C6F83ACAB57502775D925EDA853FF3ED3C36D1B SHAWEQUERE
438,363,090 *2C66E319717624FE61441A4C44831E7AF2489916 shebascarlett
438,363,091 *2C60FD36C7FFCF96F4E39854F99469FD067E6682 prospereert1
438,363,092 *2C68795386E293F3C62BCFAD5E21953049D7A9B2 7BORECRAWLCREEPCUMBERCUMBRANCECURBCURB
438,363,093 *2C69DE58217FFCF7773B11A4A6C3F13B663DE66E 7COCOMITCHELL
438,363,094 *2C67B43A67D06963D193F57A105340E0DD6DBD91 7DEXTERSNOW
438,363,095 *2C67E670BE55FE0493F11220AF25AAB78E190030 7GTCLARKBSW
438,363,096 *2C68860BBF65783860149B1B7D85ED216954C5DC 7IAMGABRIELL2
438,363,097 *2C649472912BAA302128B9DFC760277639921BBA 7KYISYCQDBQO
438,363,098 *2C6CE2703A0EC206265A7740D906992DEF0F3253 SILKEKJOLERNES3
438,363,099 *2C63347E031C876C12F2987AAC3E7706F9BD9B0F SIMELETTJRV
438,363,100 *2C62BE430CDABD3BDF7B1AC2A6BA39ECD642E051 SIMPLISTES
438,363,101 *2C62EBA8E590AFCB5739D67CA589BF62221D8C52 [email protected]
438,363,102 *2C67A5F9B69203ADE21DF6CFCB627B1369477B38 siteswapper
438,363,103 *2C68BEB3F28D4F163136FE11DAFA64A868AD89D4 SKALAENS8
438,363,104 *2C61D78E09DAD50C023954152C9F635F5950A5DB QASDATULBURDA
438,363,105 *2C6B6529631F951D25A6947E37F0838F54582527 QAZ42
438,363,106 *2C626B54C8CD3E5F6C29A54D16CDBC8D8D00E5AB SKODLIVY6
438,363,107 *2C668FC678E77BB165C3DD156756499A335CC89C 7SCRUFFYGOALIE
438,363,108 *2C6E988CC0D5A93841AF133B79D8753FCE77EAD1 7SKIDOOCRICKET
438,363,109 *2C674AD7AC158A9E0E6665F34CF1A988A5BDDFAF 7-SOKMAYACAK
438,363,110 *2C6C527447FC5D2AF8D24020D13A69E886190676 QM9M
438,363,111 *2C675B2C3F09222DE77CDA6BE7FCB5647FE145D9 QUEMADA:-ABOLI
438,363,112 *2C61E384669AAEF209E5DE52D5FA1B499F66099D 7yirmilik
438,363,113 *2C690D0E3D8B7BEE4DC140E75C407920C0FF56D6 819356 HARTOLAN.KUNTA.JA.SEURAKUNTA..
438,363,114 *2C6D099B420758F53B94EBC952F9B867F18C2F41 s,oa
438,363,115 *2C6D989A72133B28A16A3344E2AE788F4F20F212 sokol022000
438,363,116 *2C6BFA518D2E85A1AFEDB3A06BE2891CD8E73A6B RADUBIS
438,363,117 *2C6772F20D0044DC80BFF513E90A7BEFB110750B 8dwiz11111
438,363,118 *2C648C3116EA475415F4CFAC8F18709EB851ECC2 8MINIMEDUSA
438,363,119 *2C62973AEF2D926A14D764BDC8D3D6CA025AB906 8NIALEMENT
438,363,120 *2C6BF0C288E4D3EDFE0AE7F57B88B6FC6355F07D 8##) * )O(
438,363,121 *2C6DB6CF49A2B36F4521962DB231208A41C2987A 8SCHUKOSTECKDO
438,363,122 *2C689498D026B9A444D9DEC240A837B509622216 RAYMON.RITTENBERRY
438,363,123 *2C698598ED3A7B85A4EA7F67B8E1A3980B98917A 8######@*Sploit
438,363,124 *2C637AC4CB379FB627F6B7297BDD4B2190467205 9.08.1039
438,363,125 *2C67BB467C3ACA3485B22A68D79BFB75687A1C20 965501 skotlantilainen-pc-card-kovalevyvalmistaja-sveitsil
438,363,126 *2C6F4F6A686A586D24D8924D517B867AC4363E9C reeutitsbus
438,363,127 *2C6EEC3A902F3194768E6D8E205844E5C8C25F6E 9BSWASEMENEABSW
438,363,128 *2C638F194EE9DE08EAA7BE67A604B954117F4192 region)とも呼ぶ。同地域の
438,363,129 *2C697C4C3CBF585E305DCA37E76CF776FBE3E331 9CORRADOGRACE
438,363,130 *2C6F957F9FF3EFB43CDFA72FB0B3B450C42782B6 REIDCALHAUN
438,363,131 *2C66A6E6F3242C0499CE521A13951F7B690A54F6 REIDCAVENESS
438,363,132 *2C6A86EC7A32D3DB8AD89D365B96EED5063816F5 9EFC224A1C7E3958BCFFC5BA8C32A198
438,363,133 *2C6BC041C0EBC0D5B29567D54F77D37AFB3D94E1 9JOEYBOOTS
438,363,134 *2C6DD2C878701299AA05ADD8DBE7B6D4011DFBAB [email protected]
438,363,135 *2C6A8BC4AADA67F4DCAF521F7FF10FB37972BE8D 9MEGABAJTAMI
438,363,136 *2C657D7DAD2801679ACDD2D9607A27EAB92C3E61 RENATA
438,363,137 *2C65EF489375D1D7D8EC3ED03F9CF27B446787AD START-YOUR-OWN-BUSINESS
438,363,138 *2C6A533D6C75C836DF730981EA2F728076CD6AB7 9sanggil
438,363,139 *2C6BCF0925AF4563F0B5C37E93B32681A7B27A12 9TORRIDNESS
438,363,140 *2C6DA69F7C11A45FC4AE054B1E1BF9018A533E5B REPROMED
438,363,141 *2C6E6DA593FF95A0DAB09A3564C8395820CBE301 [email protected]
438,363,142 *2C672A291219B9EB7A18178184F58CC978E7AB21 a2l9
438,363,143 *2C66D4D3CEAAEBE020D205E37A7DB16A76D761D9 STEVENMORSBERGER
438,363,144 *2C66059C3003C901F4FFC1F52212990E5840B8D9 |a4w
438,363,145 *2C67080328FF6C2C16F9CBD492D82E10199170A4 [email protected]
438,363,146 *2C61621B7F50A1CF068F06F3C1A12874A643FB62 a5+r
438,363,147 *2C62FDA01132E43452FC73E6D372BD00F92CFA64 rfathxdlohcierekim
438,363,148 *2C6B76C302C1DB650C12CEB498F88AF29D7405D1 AAADHM
438,363,149 *2C68438F2B77B902C9C2723E1F820E4ACCFB47DB AAAPE
438,363,150 *2C63115A3325DF0E133206183DF71E986EA8FAED SUFFICEN
438,363,151 *2C67758184CE96160C9B9DE15E26B3B1C3703A32 sun-n-fun
438,363,152 *2C6D4EBD4172682653557588620A370FB93420BB AA%G!
438,363,153 *2C66CC7001E337A0770033395DE1E86134F0257C aaron-vanwinkle
438,363,154 *2C62B728BCCF86F189C99689BB87746233431493 RISRAELSSON
438,363,155 *2C67022DD2581C725FEE7691E833D0DECED5365D rizaenrique
438,363,156 *2C62DE159D0B04584612707F77A5560AD4C1A90E SURFACEDRIES
438,363,157 *2C6303CED3B819F30B3F062CB20398FBFF262238 SUURKIRKKO、英語:HELSINKI
438,363,158 *2C6CC044763C69AE6ABAE4A5E7FED637BD179A15 ROBERTOLEGARRETA
438,363,159 *2C61D503EBBEDBA986414D54381D937A994F67A9 ABELRODARTA
438,363,160 *2C6523539D8A8842E94B81F7120886A009658EE6 Rocky-M
438,363,161 *2C645B01A6670507835641D426E0A3946A8638BA ABITANTE
438,363,162 *2C66E4CDD0064E16FA013AAC3335A31AE360C82F symphonie-no.-3-"collages":-ii.-lento
438,363,163 *2C62DE1A2090FFFDA7499B6C96B66D15D1F99575 SYMPHONY NO.51 IN B FLAT MAJOR: II. ADAGIO
438,363,164 *2C66C5EDF49DADB601AC35158AB4C55DE08034AA ROGELIO.GRINER
438,363,165 *2C6AAFDF186C75D1C4ED2CA52F1211CE9636EE61 ABW>&
438,363,166 *2C61021492C13D3B7DFF361E71D31A85479D662F ROLANDO.HANZEL
438,363,167 *2C6FBAA205AE058570B2A90AE2C17FB237F64C5E [email protected]
438,363,168 *2C6CCA192F869E2FD7C1DD0753FF368D036AF42D t25f7v90a
438,363,169 *2C6D546F055684A193C9C9665F21D085C6FBA67C [email protected]
438,363,170 *2C6BC2492F4AA39F89AF7FBC54E6821A2F611FC7 ROMANVELTHUIS
438,363,171 *2C6CAB8B804D54DBC2E4DF85AA62D397C41BC707 ROMEOANTIPUESTO
438,363,172 *2C694A0D5B659E9C37F093D6B0F712E79C5BAE2A [email protected]
438,363,173 *2C68DE7EAC5121B0E832D7949B1C31C952BDB44C tadgalaz
438,363,174 *2C63757AF7627EB7164BD9DA2B8731FFF1EF90C3 RONEYWHITE
438,363,175 *2C6805687004A4B8F27F958C259CA206251169FD RONNIESIGNOR
438,363,176 *2C6B66BD2BB6A747EADADD7ED289128F1A260A11 acimbsw8
438,363,177 *2C6A44A1E24CF682B60C0E9FDD36F4541DE4DB59 TALKWISCOBOY91
438,363,178 *2C6A398435D779390887C7A006CDE791943021E1 RP`Y
438,363,179 *2C66EFCD8C36A20A6CCF4B435915EAB42F7B1106 [email protected]
438,363,180 *2C6B898CDB60798EDA47B6908BBCF5DC7D9E067F TALMUDISATION7
438,363,181 *2C62C9375BF39EBAA10C87213A02823C4DD2B21F adeliben
438,363,182 *2C6175D1797BCF828FF109D065C22D7DB01FF7DA [email protected]
438,363,183 *2C69374A51185ED1E1277D628BE37837A816949B [email protected]
438,363,184 *2C69856176AF621404158EDEABBEAC0B7BFB9E3D RUMBLE - HEAVY, UNDERWATER 1
438,363,185 *2C65E346ECC765CCA41C342CC5586EBF704F54BC RUOKAKULTTUUREIHIN0
438,363,186 *2C648D9F71C96D3042C7F33CF3F0D882ACCF06C8 TARSIWALA
438,363,187 *2C6F184BD74090D13482C4FF426B3315079CE55B TBPXVHGY39
438,363,188 *2C633175C0FE209ABAD6BFD8A640DA068595546D aea;?
438,363,189 *2C6563DA1CFBD17D349BA91539D860DD42F68267 aexv.
438,363,190 *2C665913A65FE4C42CBD402F2F5DC9A1B490FD07 AFGESLUR0
438,363,191 *2C65F5A38A8995CDD1D52373FCF1F2D2B687CD63 africa(feat.nana)
438,363,192 *2C6437DF003E1B34584BF0B86CB2ABD7D241E691 ag;7t
438,363,193 *2C6C34AC13C6E974ECC4A84B8A12DDF538DA5870 AgnarHolm
438,363,194 *2C69A6C38D8E4B97CDEC374E4C90272ADC48037D SCALDIC
438,363,195 *2C6BFB2B86455FFF02C2B590D99F142DA638A2F2 THEENTER19
438,363,196 *2C6D3C4A387AAD1CC9137D500DBDF7355E21AB00 ÁISIGH
438,363,197 *2C6DFFC3D862350CCE46D3E121EA537281653527 themichelle4
438,363,198 *2C6A27868DA5CB7900FE9D8B8C2C52E55AE8B261 THESIZED7
438,363,199 *2C696B496B1A5484E7BB8DB8509B22EF6E7E0208 the sleaze factor
438,363,200 *2C627A44553C59E071FEE5A7BC25F25B02290F4D TH-GRADER-IS-SHELLING-OUT-THE-DOUGH
438,363,201 *2C60573A7D8E9C6AD068DB02B244A73B98A9BFBF THOMAS.CHARLESWORTH
438,363,202 *2C6D93FA80C24637EE819D174389A719BCD9EC05 SELLINGTHESUMMER
438,363,203 *2C6F94AEE664E2AA84CFAA039F7F7F3801EC229C ALBERTSON-NY-MAP
438,363,204 *2C651D2EC5233C6962A9F9568B0E604CB4F5E3B8 SERTUN
438,363,205 *2C6C460186C03C70AD86FFCDE0511A6D8F34AF40 [email protected]
438,363,206 *2C62EC3A6F1D4CA8CD3B1924EE620F65C0A184FB TIMBERNEW7
438,363,207 *2C6B0A83F21D8ED89FB1EDA599189AB7C2E822A4 ALEXISKAESER
438,363,208 *2C62DC4A87127EA8B4FA74251C52B1ADCBBF04DB SETZTENE9
438,363,209 *2C67A2EA696E9FCC32DB0A2FC31C784E4EFE9EEB TIMOTHYNKOMO
438,363,210 *2C666AE5E359CF3515FCA30823C84161114BECC3 TISFERO
438,363,211 *2C657DC83187EC51F9977BD00E82EA13AA1353CD TITO CASAS
438,363,212 *2C642B4C4F0FBFDAEED88E2112FBC0C4CF393DD9 alīmardān
438,363,213 *2C6EEDD7E933F028542F69077B3D00836F1EF1AF TNANNOISSIMD
438,363,214 *2C66A3346E4A8B8E2DC92B8E750CB5D7CF00465B [email protected]
438,363,215 *2C65F3B4E7401F17381A0A58EAF8A078CE43DE9C [email protected]
438,363,216 *2C63042F6C00C6C4B14F8A8A1A7E54659D88CF39 tobiasdenis
438,363,217 *2C6F050419615187976CE974EA2064E424CFAC23 TOBIAS.KUMM
438,363,218 *2C65355EAE6AAB039207D887E84190C5E2B614EC ALONZODAUDT
438,363,219 *2C6D00FD2E7BFE96F01C4CB012781FB00EB71CDD toddbayn
438,363,220 *2C6EA1DDAD5F788D2636BAB136CB0ADCD9F020F3 sheappard06
438,363,221 *2C67B02B2948B1BFE601CCA47DFF721728A9FA38 SHENGYG
438,363,222 *2C607219C8B662D1A229FEFC6FC9D590F23D0663 SHINDŌRO
438,363,223 *2C60750B9E6F08F976F658419B27C16C5054FD73 SHINN098
438,363,224 *2C62AF94022AFC54CBBD9727C67DA074B94F5C65 shiny-disco-balls-(feat-jessica-eve)-(radio-edit)
438,363,225 *2C6213659727258ED72AA7A4B3D1487EB402F2F8 TORIE.BUB
438,363,226 *2C61AF233740735A38AB2D354D5D8B9F338AC730 A-MDV
438,363,227 *2C6FE5516AEA386E59E587986836CBC178565B95 sho'la
438,363,228 *2C64947F83D6E1FA52E5845E8385BFFAF580EC33 SHON.PLAISANCE
438,363,229 *2C6F60A8CB0DA95D182DD31DF51247945FBFE102 a?mjk
438,363,230 *2C6F2666F2173D3C087D63747311818DED8DF8E0 TRACEY.FILL
438,363,231 *2C63D6DFE8AD7DCBF338AC06848726891C285B11 amsi7
438,363,232 *2C6B4DE80B708041265B8FF7AF8447C5BBCF926A trenadas5
438,363,233 *2C68C22F4875FAB44542D96B6868B73F884AF83A ANGELBOURSIQUOT
438,363,234 *2C684EB0CF4CC25F5A49712AFB12AF705DF1D6F3 ANGI0$C1E
438,363,235 *2C6C9B8DC739F7C083E78C4D5046C607C4226C7F AN/HQ
438,363,236 *2C6D25C0134126AFF7BBDA7080E191F31D5F5F2B troy.jungwan
438,363,237 *2C6140FE6DCC0BC1392C8F6A318D97325AB5541F SINTONIZARON0
438,363,238 *2C64C46FB31642115E33D52FFF3863DF0DAC57E3 a+nrf
438,363,239 *2C6186C455643E7982420D0ECA0CB74884C5EB4A siwel.49
438,363,240 *2C67DF8450E4B92DCA2601A80CAED0AD393E38BB TURISTICIZZATO9
438,363,241 *2C674149926FDD1E7949E95667E8276FA68E6653 SLATTERI6
438,363,242 *2C62EB314B6F3CBFE983E218638FCE49E5B85CCE slmgcrwp37
438,363,243 *2C6BB9C9E40CA223841E07C36FE772B72D215102 ANTONY.DENOBLE
438,363,244 *2C685FF96349A526EF6D55507C1D919B0AE885A0 tx-i
438,363,245 *2C6B10C7592B62AAEF9BB9CE212CAE432EC3C8D1 AO14P
438,363,246 *2C6555F0696996494C1BA8BE263352CAAB1D59CE AQlM
438,363,247 *2C6320B2B920BD9FB67E5AB972FDFA66688E7022 ufanksprojet
438,363,248 *2C6B62C1ECA47D1AA95469213EC3A3E6656C6DCC arcadia-202
438,363,249 *2C66DA7687240E5FD699908BBB1BD1F9E44C7955 SOLDATENKNEIPE
438,363,250 *2C691FB014F6957692AA79DEBBDDEADE5157394D SOLESTRUCKCOMPORTLAND
438,363,251 *2C6CE560763F1D1284E687495708D3AABD502D8E ARKUMEEN
438,363,252 *2C66A72B51BA0A21A784B82A4EF50DE9D3575484 SONIC SEDUCER: COLD HANDS SEDUCTION, VOLUME 90
438,363,253 *2C65EC727F55D9CA2BC57BD36FF86E2B6C8BB52C SONYANNA2
438,363,254 *2C64383090610E803723740C34640449922101F6 SORALIACH
438,363,255 *2C6291BDDE1BFE1F69A7519458207BDB2DB14548 soro-soro
438,363,256 *2C6BE7A0943E78EA8E7E68DAA3250A10A50915BE ARON.MANTINI
438,363,257 *2C676313E68C45267BC92744D7068531D5BD012E ARq
438,363,258 *2C63C4E86FDCF860F9F95530195B530A4B792B55 unionsch
438,363,259 *2C6B70E55F915E3A8362B5B9C7AB8A5B39F05F00 arww=
438,363,260 *2C6EFE6282332EE9BE2C80E6FDAF3880F2239292 UNSPANG13
438,363,261 *2C633ADF53B58BADF6ABB83F2B841EB442075E37 SPHIKDVAYE
438,363,262 *2C69DAABFFA8C3284C6E6636352DDB7FF7852307 spirocheticidals
438,363,263 *2C66F90A24AE4B7EB58C591B430526A5B83A0ED2 SREDJUJE
438,363,264 *2C6A0D423E6659228632CE554E5EBBB500E0DA6A vajra-watson
438,363,265 *2C6F20D68D2B9DC55D281B4A42D7394883D9A53C AUDU-ERIC
438,363,266 *2C6217F6F4B90843F6E2B7FC00E0F2DD81689AA2 stahlka9
438,363,267 *2C656AB20074FDBE3C5E10F7CC8AC4965EE741D2 stantonreadenour
438,363,268 *2C61A81AFF0A595677E1908B8DC26C86B056837D au(r
438,363,269 *2C6B47A652CEDB7BCF8FAAC0E070A81097579597 stevensss
438,363,270 *2C61909925836E86754AA22002D3D3354FB18769 a:vns
438,363,271 *2C62B46EB0CC95F7D5B781ABC9058AAC6430937B STIFTUNGSRECHTEN
438,363,272 *2C67492E0E527A7D1F02BE2BA3D1C8ECDBDD7011 VEDGERTON
438,363,273 *2C663CAC220D9BF9662549D34C19214E031424D7 STONESTI7
438,363,274 *2C68EFE6F99F0326124B1E6F81F188F2878D4D42 VEER SANTOSH
438,363,275 *2C61F434F5FF8E1D9D4C7D1B686A7C83FA32279C awovb
438,363,276 *2C69325489D08609C77527EB085A0CEE60567639 VENDULA6
438,363,277 *2C6116607A2AAA7C5A9EEFE6A860E76317EECC52 VERNAGTHÜTTE
438,363,278 *2C6AD0B29460A42B808269F7DE2964DA0D424368 VERONICA.VOGELER.HILDEBRAND
438,363,279 *2C6382C47F056507922F71D57C8AFED39BE9578C B0DY-CENT
438,363,280 *2C6935397FA857A70FDE27D1FC356ACE66868D26 >b0 * *@=====q
438,363,281 *2C648A5780ECF50812AC9FC7DB16382CFBE29923 SULTANI-(JARKA)
438,363,282 *2C634828BE1174F4E906DFD0E49DF27FF20C908F SUOICERPPING
438,363,283 *2C6C189466188417CAF141128F08AFE8229E255C SURKEUTT5
438,363,284 *2C6E37D11B885A7BE712B416D45A311842139E1B SUTUDIK9
438,363,285 *2C621E461B93E64B50A668BE7565F3EE1B5D4C4A SUZANGARCIA
438,363,286 *2C6634B7BE3D74E407A81DE906EB0B82BF296DDA vika.koksharov
438,363,287 *2C6A594AB430470A3C9379AB2EACF94213B4CEAF B5j&
438,363,288 *2C6DD0FC5A6F4ABB6A04957FB554C41EEA31EE79 b-7d_
438,363,289 *2C6E4084AF9FE0EA3F05330540727F3136939118 b7mub
438,363,290 *2C6AE0870941ABEBB2DDA119CA73B5879F0AE459 b93f6009498f302c877bd432982b11f2
438,363,291 *2C6FF72E8F3F1540BFCF991EE611C65CFA4DD63C symsonia3
438,363,292 *2C6140E4933FF5D7DAC05965E32214A12C21B4FA BANT3R1N9
438,363,293 *2C6407F5ED27C3BAC63DD7FB91ED9B24BF3F027C BARTWEYAND
438,363,294 *2C6B0B3410D35DFCFE4B566AA79279173FAC4D86 B?CA
438,363,295 *2C6C0E9F224C1589A8CED0675FE079BEE13D010B TAVIBSWS
438,363,296 *2C6BEFCBFFB349BDB6A58411C15B4B2C686BCA5A W6JC
438,363,297 *2C6EFED51A37D9D3F7E7F3EDD5E54D3CC0F30668 bcv5/
438,363,298 *2C6A0C2E6FD7E1893CE72F7340C8F5A25C92F65E bdbi"
438,363,299 *2C6AC7B83DC1C546EE15D2AD052220844D1384B5 TEODORO.BIGBY
438,363,300 *2C6398A17B7358B5D16AF291A34D1929FB2B22A1 wanttoo5
438,363,301 *2C6225BD82BDECA29156F5299538E093848C658A [email protected]
438,363,302 *2C6E56DF6DC6DFFE37B7DCFE9054A9EEEDCD9791 BERRYCHERPAK
438,363,303 *2C600560F57D49CFEE84AE1C76B31EE6107A672B BETONIES
438,363,304 *2C69A94DB04BC31706701BFED695F8A97DE76625 THEGOODBYECELEBRATION
438,363,305 *2C65DA58D58A3FE4F99C2FAF04B7950016B12C96 bewilderedbluesages
438,363,306 *2C61E6F804721349F19B2BFC71B2BE366FB9F53C b(#g
438,363,307 *2C672E21EF558A656E29B5992837333908927639 the.orange.tree
438,363,308 *2C6FA0CC429A3C814E07E9526CC3394CE91A3FE7 WHOLE-LOTTA-LOVE-/-THE-CRUNGE
438,363,309 *2C6EE56324656F863DED853206D00E622ED3D720 WIJZEND5
438,363,310 *2C63711F7A7FD7BAA7F51ABA55B971C7A8CAE870 THERE'LL NEVER BE ANYONE ELSE BUT YOU
438,363,311 *2C6E36D12830215752582EF97013714F3ADA0F5D theronferdinandsen
438,363,312 *2C6981D629AD475D7E7A20B10EC8CE3B729AFA11 bh)qp
438,363,313 *2C6DD46827457658B14ACB487ACAC200EF8F1FC6 [email protected]
438,363,314 *2C6907F4A12758B031376E4CFD39E4999284649A THOMASNUNNENKAMP
438,363,315 *2C672924C2C6BD4C538DA56CEACC31EC603DA437 BJJTU
438,363,316 *2C6377B91A68FB79E9F0B10ADC13B0589E431445 bj?vl
438,363,317 *2C6D23597FE91F50602BC3FF3A4B3DE9CF8D850E bl4"
438,363,318 *2C641C947290436DF5460C9B6EB83C8D3315CFE2 BLJHF
438,363,319 *2C6006D8A01A8767CDA6B188D259100854D12044 bloodpact
438,363,320 *2C6E509A7E3221EB89929ABED129ED488E880DB0 WWW.LAYERCAKEWINE.COM
438,363,321 *2C6419561A468A68AF38E73E2426BA230AB43472 bn=%x
438,363,322 *2C60A7BF2D21AA363497B22943F17DA1B535D8FE b-----).~.~o->-<
438,363,323 *2C600DE0AA193922ADA068BD759BBE0C5DAD013B B====>.~.`}O{
438,363,324 *2C649615E2F19B496D5C398EBBCD96911E7F16B7 [email protected]
438,363,325 *2C62E91972B0C8C156732FF08F17237D1D4FD39B bogrodica
438,363,326 *2C648623124409657FE2DE25CA6765133DD9D617 XHEN.TANGAN
438,363,327 *2C6B0962D37769F16DE59FF0D952592E1CA6CD47 bosalata
438,363,328 *2C634A07D9241E46BF3B44D0AFF5992E785244C2 xixswxies
438,363,329 *2C641C113BEAE0D0A953157FD43B2495145E7A56 TOURISMTALKDESTINATI
438,363,330 *2C6056EB78E397C2A14D0CFD7F9EAD021DB2F37D )X(.~.<===q
438,363,331 *2C63B071D52FDDD56AD64EE9A231BA0D4E56AB54 [email protected]
438,363,332 *2C65B3BA4BA063C510CB9377DBF34D8CE884B2A1 BP%JB
438,363,333 *2C6B2915BDC45D45C724E4E33C741D8B1EF06818 travisandtanya-muhlnickel
438,363,334 *2C6B5BC11D0FB67A9DD2663D5B3F409562F59E2F YAMAHAQWERTYING
438,363,335 *2C69CB92F844134DC602F28FB581666056BB9345 trevorbut
438,363,336 *2C62FBA78EBCC2AD7B1E9F53947BE3CE71447B8A trevor.pokela
438,363,337 *2C6D88DB9FABA187184149A3758CF220C05D038F BRADMONFORT
438,363,338 *2C697728D779459AC663F63BDD72713263E72023 [email protected]
438,363,339 *2C679766512F95F2B9BD30C39C03F31BD887BEDB BRAKTEATFRAMSTILLINGA
438,363,340 *2C664C5D8F3980E4C29CA3F9A02B4C1EBA235AB9 BRANDAN DOZIER
438,363,341 *2C61989D2C97BF401FAF7065333C6C3A403AA5E3 TROUCHKA":IICHEZPETROUCHKA
438,363,342 *2C6386FA7CAFEB589E7322FB1132447F4606C50B BRETYAIVA
438,363,343 *2C69B8A9FEAC3C2EB2EE0D6D01920B7BC7F645D9 yj/&
438,363,344 *2C621C4F25E5BF2C99AEA23CE1928A583BD17D62 YMBMMVZGYHIWB
438,363,345 *2C62AD14B5EB50D8EABF8207886DB34FBEC96822 YOELMIN
438,363,346 *2C6231C89E0D0EDA9DD5F0483F60A5C5B78534F2 TRUMANVANFLEET
438,363,347 *2C6789B184B05E75D40B10E00DC13572ACA11B95 truniers
438,363,348 *2C64170EBAD5611623D2E99C545E8CCAD926C558 YURR.MMOM
438,363,349 *2C6D64C67925C22D97E5FB8F8CE3DB8FE7B230E7 [email protected]
438,363,350 *2C6372397C490C249D7A72AB784532BFBEA265A2 b_tfl
438,363,351 *2C6680DA37F6894BD8AF86892AFDFF5EEF3B0FC6 TUNDE-ALEX
438,363,352 *2C6351473B5DCF0F7A2C90FE72904C1A577E4779 TUPERIEZ5
438,363,353 *2C617C779F7A0769531BA7448AB4BC46B331863C tupper1881
438,363,354 *2C63A155032BE4C7A0C9A86E5CFAC05FD177EA0F BUGHT7
438,363,355 *2C66C290F4CD516A312909BE5BB1E5C94D9EF9EE TYNGDED0
438,363,356 *2C60C18BC9ECE7F75A55294DDDC9F760EB59A271 bv-
438,363,357 *2C67758656F2BD83D49E26370BA5664823007ACA ZAKENVRIENDENSED
438,363,358 *2C699F753EDDBBD6FD94D121A1B7247E81BC7C57 ZAKLOPIO3
438,363,359 *2C62901F9E2727FFEB0E20F23692EA1AEEB0124D bvfvk
438,363,360 *2C6E156ACCE23C57333484BFAB1D35A3F9CA5D21 zarcone1
438,363,361 *2C6B5B6647C5115EB2FCA0FCEC0D639F8B1ACC7F tysondeloera
438,363,362 *2C6EAA19A72CD827C5E17B6C64B3E7EB6A844E3E TYVERSDAGGING
438,363,363 *2C6C13D33ABADF31DF7F8C679BA9A14CFA08639E U`>[
438,363,364 *2C671B23DB12EDFE98C20CC33957D53D03D8C51E [email protected]
438,363,365 *2C67812DEC38D31C25EB8D6989103D6FDFE62DAC $UB$7I7U7ER
438,363,366 *2C620F60312D51F6CDA683959952B95D487A844D UCVILJENI4
438,363,367 *2C68A92D3906707D12BEF129EB774FCB00E7EA1C udayveer.singh.sambyal
438,363,368 *2C62F90B3AD1BB6BFACCD4A650EDBDD312CCC6C3 ufuomaotajonor
438,363,369 *2C6AEE9F7B00496AE0B3DF8966E413C4714EC655 [email protected]
438,363,370 *2C6ED7935C784C656EFDF6B97293703980B23476 C0KPI
438,363,371 *2C61FC56F93F7F79D391CFB71C0DFA47F67AFB79 c+5pq
438,363,372 *2C64B7C38964B126EB603185DB6D81AD98FE4FA4 C7MEV
438,363,373 *2C656A06779A68A3991AE5EB68325933526338AF UNCUTTABLE.
438,363,374 *2C6E04CD66F50E58DB02A38E759E40039B1B0BD7 candlelights!
438,363,375 *2C69076B0AF1F710C2E4E4F7BB2B08E55804B382 UNENPÄINKÄÄN
438,363,376 *2C675A75C6964E60B3227EBDB4913B467BBECDB8 [email protected]
438,363,377 *2C61F30ED9A2600DD8EBE21C03D65FB4BF264047 Ungen
438,363,378 *2C6E20B7A62B0FA6FC3D0EDECEC263665CC01929 CAREY.GULNAC
438,363,379 *2C60C5560A7C2BF0259836AA983178E01E1CFD85 carl51
438,363,380 *2C65A27FB2C555D1BCE55D1C9D5DF194098E15AB ВОЛШЕБСТВА́
438,363,381 *2C6DA2BEC851DE7F3D0763D84D6182E461690B16 ВРАЊЕШЕВАЦ
438,363,382 *2C6EA9ACD71476470C7E291011AB9282BEDD038A untitledtheatercomwww
438,363,383 *2C64AA160881A5DE61CF91C5D91D6F87492F4973 CASTLESANTELIGIO
438,363,384 *2C6AF9B54D97DF480063D7AC29830CB2819F5DF8 експлоататорските
438,363,385 *2C6950BEC135ED87FD79E93D02A492BE60EF0183 {USER-FRIENDLY}
438,363,386 *2C62A2943F43AFB0DA92A872B72F3177C41A9033 CB)TQ
438,363,387 *2C63D2774C709736EFEB29CAAD6BFED9234CED0D ussnowboardingcomwww
438,363,388 *2C6614880972BC12626DAA3A9309E43B9A8B5F60 USTUKIR9
438,363,389 *2C6D12E5DFCAC7A1B4DB346C0298911D9F10AB6C мідлсбро
438,363,390 *2C658FEAB82409A923EA1AF798708F377B4F3331 [email protected]
438,363,391 *2C6BAD42DE6550FA3DC2DB25D8334CF834A56CF9 ожега
438,363,392 *2C6E00F73389B6EAAFFC140EF811CF142A7102D7 CEF),
438,363,393 *2C68CB33619C31F82116A92F5D057E35A3F61A13 cep!n
438,363,394 *2C6F0506EF6E44311C52D5F10A50E4BBB0C0BBDC VANDEE CUMPIO
438,363,395 *2C67CA59E0DFED7327ED1341707D9572359D4DEF vanessa.ferris
438,363,396 *2C674D4DB2C1C106B78AEA4822E3A46F97528C38 cg=yo
438,363,397 *2C63D41129F3C053C67630F301C69A7FF92D3B06 charlie-bot
438,363,398 *2C6AA5EB056F414C8AF4D5B2199AE6E5C30996CE CHARLIERAE
438,363,399 *2C6CFF7C05F2B7488FB51AD2CBF6965E963DC59D [email protected]
438,363,400 *2C6FD343351934C8897A860A8A8AB1883BA3A18E vd{
438,363,401 *2C607D6F3604321DB049BB2728868C617730031D [email protected]
438,363,402 *2C6190F166ACE020371018098EE5F9BC1ED143DB velma-crosby
438,363,403 *2C620D33CB1E4A16B4B24E83552FBCE586A618D4 CHIMON666
438,363,404 *2C61A453788D2E9E680E117339E4FA6ADC3C4CA5 CHINH CUNG
438,363,405 *2C6D36B5E412A863971CE469BED541C3A38F9604 作家、作家一覧、category
438,363,406 *2C6D32A623C22369E58E729C664CBB6816726851 (全名:ALEXANDRA
438,363,407 *2C6DF9D26E6D168B0B663C922DC9D40426016ABF christianbrodie
438,363,408 *2C6DBB8C8B52447EC08D9D0FAFFE6D214B370043 CHS/U
438,363,409 *2C6F6EF6778606DC97F5F79A4E1E362E6FE79B1E CITYANDC
438,363,410 *2C60F2D8940CC8FF5180E5319FD21AD6A6DC1B86 CJ1PW
438,363,411 *2C661277CC894DFB0C83855C9F740792C900DD2C clarklongs
438,363,412 *2C6A673F8A748CAF949ED5349D81626072D5BCC6 VIDEOAMBIENTALNI
438,363,413 *2C634FDDE39F2F5BCE0F6794F71D569D9138E039 CL-=D
438,363,414 *2C6B9C931FBE54FA5CD23DA905BCCA47BB325211 VINGT-HUIT,DOUZE,Z
438,363,415 *2C666572B210D21BFD839158D0B72F9CC3199C09 VISTARINI3
438,363,416 *2C6109F740C0C51A477AF0577898FA9B66642ED8 vitokeliikoa
438,363,417 *2C627E43FC68A46DB038528912D65DE514256C53 VIVEK.DAVDE
438,363,418 *2C68059CB247EA4C6EE420BADD462C5F53B56281 cl&"r
438,363,419 *2C68882F584292CD1F238FE8882FE48493A5CF41 VKAKAROLIS
438,363,420 *2C6FEB50B5E3DC1BD152DEA8BD9D3E24ECF97105 CLYU4
438,363,421 *2C66DE98E141E130A83DF694546B03F7873BF4F4 VOLATILIZAR7
438,363,422 *2C64366F9C8E3D8DE30FDC47DB925DBE472C6642 voncolarusso
438,363,423 *2C6630DA067DE012EF8AA944424959F78B944094 cndnsms9
438,363,424 *2C6C25DF7295C7E0EE6AF7A2E6D7CB411E65B275 COLIN.ORWIG
438,363,425 *2C68FB81F399B7587C53A2207EAC3213E939EF23 vuhs
438,363,426 *2C6370CE87E6953811BEFD7D4E8B1E541F1A1AE9 [email protected]
438,363,427 *2C623BAB81FA6307BBDAED88998EA8A2F98A3ECF vyvyencedoan
438,363,428 *2C65AB85EE1EB7817ACD36C6A7BE8B57FE120AFF 相似文本:这部作品将把sbs每日电视剧中经常不断出现的
438,363,429 *2C6238796FB61922D01B9577BE7A36569B623B69 CONSACREREN4
438,363,430 *2C6EE272F54F10B2F77BFC380A83BA01D356E250 contrad!ct$
438,363,431 *2C6D3B9CDB93A49B9EA1C0E48364B87DDB6A7C40 COREYDOUGHTERY
438,363,432 *2C6CCBD9D4A0AD37D2FD31B036F67B7D3316CB01 [email protected]
438,363,433 *2C605437E4842F58897651407D02C9CCC80DE587 [email protected]
438,363,434 *2C6B81A6992D6A637829F8066918A8C8ABF3C10F wantaghnuevayork
438,363,435 *2C69524E454663D02B3105745BAFBF5AAD34EE95 $)//=\:/
438,363,436 *2C6350240809531969052DD7796B952994014A0D WATCHOVERWATCHOUT0
438,363,437 *2C65BD4EBB0D8F259163D474C7FD1EF29A754173 WAYNE.HEAP
438,363,438 *2C688EF3F2F3A7D15F9FA4C66A785C5E3E46B79D (0-0).O~.<##P
438,363,439 *2C6196CB89520AA066C18E2EFDC9F48840D60C22 01967e
438,363,440 *2C696CD09B19B58F7F6D086E3D96C3C77D1DEB45 c?p$/
438,363,441 *2C64EF326BAB308C46C71079794A79EB3739610E cp!pq
438,363,442 *2C624EEEBCF9CE85821DCBF27023CB231D40B5BB 07181707
438,363,443 *2C6923303F60C59DB8372BCFF83A300E990219D8 WHALLEYTEMP
438,363,444 *2C69CFC50443A8F7C8CA6FCCDA57EFCF1293ED8F WHATWEAREWEARING.COMWWW
438,363,445 *2C65B804F409921269FE4B2A108E740CEDB4FA47 (_0)[email protected]
438,363,446 *2C670C5B7B05C49F7E0CA57C8EB1B09FC7EF58A9 wh>s
438,363,447 *2C681EF6E99DDFEFFB2D36BEBD5AAB5A6E8D11A0 (-_0)* *q#####p
438,363,448 *2C605EB361256A9CE7F19A164601C63096A57C1F 10-KINGSTON'S
438,363,449 *2C64690A3B50A7585A5C72FD73C89D2774F35B2A WILLIAMHUGGIE
438,363,450 *2C6A1AAAF99441ADD69BBFB76DA5B1CAFC6F8446 WILLIAMMCCLUSKY
438,363,451 *2C65DE8015FC2D725B5DB79E12C3E89741300864 1194590 TY
438,363,452 *2C64DF8D9068E285F0F5B7FA2C63D0348B0D1B3A 11.AUFLOESUNGSVERMOEGEN
438,363,453 *2C6A007BC1899B916B3893B185A4CB74B513D848 12.23.1528
438,363,454 *2C6C8A7B1816930B2D0D6CE18DC970973FFE1B6F wiltonhamano
438,363,455 *2C68588BEFA08AA28D0A2C53F9EE210F4F0186B7 WINFORDSORGE
438,363,456 *2C6D7CBF0A77267CF0CEB23A9A8A7CC3D6EC2A2B 12814icwhag
438,363,457 *2C632E8D077F3FE38F858EFA537316914374525F with-pity,-that-doth-make-me-sick-a-lady
438,363,458 *2C6FF46239A1C93903A457AC54EBE2D66FE77C40 CSL$H
438,363,459 *2C6FB92530F88572DEF39266BDAA190918287761 WOACHOLENA
438,363,460 *2C6A0C939529F6260FC1BE99F199FC67B21C1923 CTPA%
438,363,461 *2C65356D91712E60EEAEBDF1F896242039D41F6F CTTCTGAATGTCCCAGGTGTCTAACAAGGACTCTCCGCTCTGGATGGTCAGAACTCAAAC
438,363,462 *2C661F2B8FE6C25278F81B1468796136362E3625 WORDLESS-COMIC
438,363,463 *2C6AA3C8F991557FF436FFC8F792390A73652B46 cu0y9
438,363,464 *2C691A0FF027267542CCF98E4F62960A9E2BEB87 cuhzu
438,363,465 *2C67DFF1D4CBC7C1FC9FD58D8C0E9189D0CC72C0 [email protected]
438,363,466 *2C672C52C8298137B14A73331B5186B91EEFD04B [email protected]
438,363,467 *2C6AFD064DC8DB4C1C12437D5C6FFC6B35100333 cu?#l
438,363,468 *2C633C542D4593EAA270804C1B4AE771E6B000FB [email protected]
438,363,469 *2C639CD8476C8642861F749B0405B852683F6FED CURTIS.LIDDLE
438,363,470 *2C6491E9735409D509939FE1565234A8901E4DFE CUT/K
438,363,471 *2C673AC3DC83B70754D19A271EEE63893EDA548F WWWAGGRESSIVEFEARCOM
438,363,472 *2C69C2F92C7DD220ADCC625B2343457AE7EFBBD8 cv%b:
438,363,473 *2C62DB251A8ABF15C6222BB41A761FAFD50459D2 1amphibians
438,363,474 *2C6F4A37B22A117CE1BAA79E54FA6E469431164E WWWWANTONHUBRISCOM
438,363,475 *2C642C6963A5BCE8C49DDE889A2301A63C37FC49 wyattmckerchie
438,363,476 *2C6D802C6B89CB852520951E76512D7159B2D046 wywdshp8
438,363,477 *2C61874E31CFF4B5231BF3B8FAED97A9FDECAEF9 CX(;
438,363,478 *2C61214D0A3518A603D75826D78192D698AC0251 1ENITORAC
438,363,479 *2C6BD7189E54D9BD4C0FA2C708E50749F8B15DA3 1f9eb3da0f56d755aeb8e74f8a179861-14me14u
438,363,480 *2C615FAC64F547A75CE88C34760136047153AD26 d)%%,
438,363,481 *2C6B9659BB71020C583ECCDF42252F0A7EA1B29C 1GOTINGCO
438,363,482 *2C63F301D7B7452BC0D4F6E9F3E5075EAD346641 1hein
438,363,483 *2C6A2B56EA466F2DE297312CD3E3907B4B9886DB d3pv
438,363,484 *2C6B7D22431659B8D780BD5C8A55270F682A3566 D:4T6
438,363,485 *2C669524333199F23235F6D7BD0F2B9CC8E919E1 1kohautin
438,363,486 *2C60B433A70F3A5E7ACA31920744519629099128 D5IS4
438,363,487 *2C641945215B18C3998E3012776B89E767E42F8D [email protected]
438,363,488 *2C628BA125A102CC5947E5B564818D9D380C653E d7ib_
438,363,489 *2C621AD61A930D0ECC1F2AEECF459A48BEA232F9 daleharkleroad
438,363,490 *2C635AB15F7D47629CC7D39A67EB83908F88CF27 YESSI COMPEAN
438,363,491 *2C64A2DAE005C066FFF9CA069EA2AA1EC01339E0 YESTERAVILA
438,363,492 *2C61E1FBB8D248CB44F9BD517826C9982D3E9CFF YLGNILWAS
438,363,493 *2C6ADB55AA23E8DDAF71ED64F9C942C1F6F006B4 [email protected]
438,363,494 *2C6EFAD289E4676668BACBBC9D5BF1191EBA19F1 1 RANTAMETS
438,363,495 *2C62083050BF0197EE79CC78647A6A0313228969 1SHEATHES
438,363,496 *2C6250216DF2597A1906E0627480BDFEA3340816 yoko-napita
438,363,497 *2C61EB2D6A8E7F7F6E61AD0C56DD2FAB2015498B [email protected]
438,363,498 *2C626AA5C9343F5872C0F5CEC95AA4302462CD64 1STシリーズ第8・9・10・11話ゲスト・本人役
438,363,499 *2C679AD8C101F3C727ED2EF0653A89373199422B DANIEL.CHESTNUT
438,363,500 *2C6B0B620ED24DA7190FA423A04BAA4A7BB333E8 youaremyhigh(20000stlifestyle)
438,363,501 *2C67CC984319474ED409A20B491DB962289F1E40 [email protected]
438,363,502 *2C63C26DB6B21D3F1EF1AD81A2317B37AA2D1D3E DAQABANI
438,363,503 *2C60608751C4C1BAD429D29C456F95A9FF85DD32 1.ulosajoihin
438,363,504 *2C62735B3C9B2A52A9BB369A20D11ACBE95A318A 1-UNTERNEHMERMENTALITAET
438,363,505 *2C61CB2B7AB62CDA496824124EE856E4C69FB74D 1-VARAVOIMALANA
438,363,506 *2C662E37D2902C86F7B11745934CE9B0303AB4CB darondahmen
438,363,507 *2C6A9DC5F8A788F54D5362A90BAD3EC87B1A3617 DARWINLUDDEN
438,363,508 *2C68C5D0299C18CCEA63786DB4C499BE16759EA3 2003-04-16:PEELSESSION
438,363,509 *2C63F169FA90F247AD9CF0E02CD063708E7E0749 DAVISSHAHEEN
438,363,510 *2C62C7FB42FCC4E41F5C85F2F5A286CC674DD558 db-?/
438,363,511 *2C694934EA8C4021B529DEEB637D438C65DD2409 DC34B57E2EB03FA3F147562ACCC3091CSNAKEWAY
438,363,512 *2C652EC4D31D981F3FD4F4A8516D832CFE606CD7 dc5!t
438,363,513 *2C6F202485750CE98B4E5577676DC4776DAD0A2B ZHA.MUNDANGEPFUPFU
438,363,514 *2C6AA1012FAA90B9717FFC13C3671B981C2FF4E2 d_da1
438,363,515 *2C6511E91BA3F7C2F6B75F379C695B0A0F1D4DD6 [email protected]
438,363,516 *2C65133E10CAFF73CF10BAB1444EE43A98D279F2 DEADLYSIN
438,363,517 *2C6045701E317005D8468EFA3212B8F8825DD649 ZIAEBW9TBW9THIYBNIAEBW9TBW9THP2NPXW8OKKMLO9WTC
438,363,518 *2C6174CF278601C5CA5AAA6AC7A4EEFBC37B171F [email protected]
438,363,519 *2C61EF8D05F34D4941359839E6B1296BC0E62290 [email protected]
438,363,520 *2C6BE25AB6791AE90B6F6231453600C6D4B6D897 ZLATUSKA7
438,363,521 *2C662A040AC97C33342B273D210F66FBEB2048EA DEGRESSIVES1
438,363,522 *2C67ACD5364EACDE0CADC1FB1E71241F16596E5C 27031247
438,363,523 *2C6DEF576ED6E752A851A8BB68E015BDCBE5CC35 2831518 PALKINNONVOISAADAESIMERKIKSITY
438,363,524 *2C6C240AD2E0BA8B11BB7AC4E290522A7B22DCB5 zorica.avramska
438,363,525 *2C6E734802887CD577B87480D7AF3C27451FB13A zosimoabulenciajr
438,363,526 *2C6C1FBB42C853AC542654516CA839F879C04462 ZT[<
438,363,527 *2C69D052A86FA8A92E541ABECB89B7095269A18A 2966968 kuinka laajaa k
438,363,528 *2C62226C3EADE443762015ED46473C7BC356B1DA ΛΟΎΝΤΕ
438,363,529 *2C6AAF6B01A02B5E37690E062DB133DB3D87729D 2-franchising-yritt
438,363,530 *2C64F0E9636BAF02EEF618B93B7D930E76A61EAC ГИДРОБИОЛОГОВ
438,363,531 *2C67D485E584978AE101C9577D434B54822F792A ГОРМОНОТЕРАПИ
438,363,532 *2C68A6CC8AC3BF2A033B610EDC7DE7875077F31F «ЖИТТЄПИСИ
438,363,533 *2C6FB7A805E7114B9825BE712D76B693AC700D59 ИЛЮСТЕЙТЕ
438,363,534 *2C60116D61E672B4EB629526D80EE6FCBE9F1DFF 2-KUNSTOBJEKTES
438,363,535 *2C67D106E6842C2E34980C2CA73B2D7D60E7C566 DEVONSEGAWA
438,363,536 *2C6937D59FC6D33B4CF4B5E50FB803B6DF955D2C DEVRENIM7
438,363,537 *2C6C70B854689A2797ACD3AFE2386756B09A8AE9 DEXTERSTIEFF
438,363,538 *2C699F0DBA5AA5C4CBE9241236FB6B8D184262DA D&_FN
438,363,539 *2C6B258651F2474ABDB8427B45EAB4F05BC6A875 Dh8+
438,363,540 *2C64B944C88F9678ED434D9AA1EF8D1FECE54CF3 ОБЕЩИВАЛ
438,363,541 *2C644D1BB60E4C4B61A67A3DD79689F99F539CC0 dielove
438,363,542 *2C61DD55E19DD7F61CEED6CE1674B413441C6254 diiodomethane
438,363,543 *2C67020778F131E37D9A2148E2C6624989DD9CD2 39-NACHBARLANDES
438,363,544 *2C6E3637182C5B85B93E6B3751D41C5E9F74F294 diputsle1
438,363,545 *2C65C38492F482066BB9CA41D1630FC41491B263 dirkector
438,363,546 *2C6FCCD6AC1DAF4B4D092B5233470D8634D99611 disneyland-toontown
438,363,547 *2C6AB429B93F871208C9EA6CDC8CF8D52F2B6ACA 3mypussy4
438,363,548 *2C6BF3A60F0E22384E171C6249336F0B146F2B11 3PEKKA8
438,363,549 *2C69DEC2511DC2A6842146C7D1436C14A964A34D dj:v
438,363,550 *2C6308E4DC1CC26D0E3654EE6679571BD781844B dlav(
438,363,551 *2C6BB5C4F60A748702C75C0500ED307C2CF2A1DF d$mel
438,363,552 *2C634A6BCA40A866869A9A0727170C860EE84D0F DmjS
438,363,553 *2C68D82471A8172110627C3CAA3FEA75F7C4442D DOMENICHARDYMAN
438,363,554 *2C6E4EB245B20848F5FE9DB5F8F7C29BBAF8FCB2 4OMERANNO
438,363,555 *2C6EE0E5F9B21DA105716AD87C1BAAD125675738 DOMINIQUE.KIVIOJA
438,363,556 *2C62149409496556D79C03A64C178D39CB8D898D [email protected]
438,363,557 *2C66CF009F3AF9F2A884385F40DF356A94F10945 4.SEENOTRETTER
438,363,558 *2C6C236886BE31486C8553635438BD150F494475 4SHIDLERBSW
438,363,559 *2C6016EE2B4E110B41E3696C82D6647E42558987 を指す「dieci」の文字がある(これはザフトにおける最初のモビルスーツ開発者が「ジャン・カルロ・マニアーニ」という
438,363,560 *2C68A1A3B17A7EBAFB072C57EBC07BF55ED4C0D6 DORIANGALEOTTI
438,363,561 *2C6116ED3DD08F1428712020B4BB7CC25BD740D7 DOUGHARTUNG
438,363,562 *2C6D60D42506AD1F06872840D3BD2FD5B7B1F2C4 573ELSA
438,363,563 *2C6F373E51B98C1C0E1F250C79CA43DC2C0F0592 5CHGUEST
438,363,564 *2C632E1F0733FD95CF4CE786A0C6502448D188C8 5CONSUMPEDBSW
438,363,565 *2C6E6D55EC6E960A4FA0A98730C33872C33FAD4C [email protected]
438,363,566 *2C602D7BE4A9991BFF10177B3E6B1C7C65EFD040 [email protected]
438,363,567 *2C6A9620C31D0AF7CFE91145F55BEFE4277E3ADF 5JAN1175
438,363,568 *2C65B48EF14FD8B9AF25F1045C548C5D7EFD1F0D d..su
438,363,569 *2C6A93E148D872DE7FEBBFA69FBBFE2A1DB5D740 5RANIHCAT
438,363,570 *2C6CF2138E60046CBABCD6F8AE77D75E1D09E60B 0ILOVESPUNKY2
438,363,571 *2C6F28AEEE21CE0075D7729EE28E7BF466D3F42D >-<-0~-q#8
438,363,572 *2C619D644A31AFA49167209CB244BF198320FB61 5UKSIIMME
438,363,573 *2C6B0B2192B44BC25ECF3FE6B29C76E531038675 Duschen.ist.kein.Metal
438,363,574 *2C6385A080B5E67B85AF0D803E144E1BFBA959CD dustinalice
438,363,575 *2C66E63E355370FFE362A654CB81CE1306D3122F 1115901 THE POETS HAVE THE CROWD RAPT .
438,363,576 *2C6C889FE0CE9EC91EFA259714B01DE2F3328966 62325 koulussa-eiv
438,363,577 *2C68E4D634B1EADAFE7601DB7E8E5FA9A8D571DE D-UZ8
438,363,578 *2C65826E80DAC4E630BB80CB4D40413C255B3E41 D&VFV
438,363,579 *2C6D39318CE81248152F05A633032E5A91C3E946 DWIGHT.GOTHAM
438,363,580 *2C662B70B07D202B87DF6653991ADFA52DC233B7 DWIGHT.RIED
438,363,581 *2C622B846D16A114FB1FB4C384C393EEEDA870DD DWIGHT ZIMMERMAN
438,363,582 *2C63934C74F896F222D63E3C2963B275582D22FE 1531343 on kai selv
438,363,583 *2C62979F8E88AAB957437189D4E564A338AD38CD d`xj
438,363,584 *2C67A0338E6485717D2941FB5BC0BCCD1C4F587B 6iluvprayer
438,363,585 *2C6D584E31B486F6C93FF64D6C1BE0D80AAE1D2E eb)nz
438,363,586 *2C61CA6611E1A1BB7CF9FD6C71518231F73BFDAD 6NUGGETFLOWERS
438,363,587 *2C662FBC2E196FE436FBDE87A7992B99EF99EA9A 6OUTEFFACEEJECTELIMINATEEND
438,363,588 *2C6C64A4D9AEC3882393161D8C4499C5F372BD53 6STSYLTU
438,363,589 *2C6C4E884DB24C992E5BB52013588B2C9B4AFBC3 [email protected]
438,363,590 *2C6C47A563DAA08029C7613800F0CD50C5958C6B 1926735 BUTTHESKY-HIGHRETURNSARELONGGONE.
438,363,591 *2C6C134E9A513CB3162CB54750B4FDEBBC6E3C14 EEN.BARG.DIE.H
438,363,592 *2C6C26E9F3F8E2F7966D536BD2DF180045CC3B34 egnqe
438,363,593 *2C658127122957A746351BF91BB9C05EA4E99AFB eilu6
438,363,594 *2C6DFE11319B036B0560E51722B2872904033D57 7ENVIERAS
438,363,595 *2C636AB357593DE9D73482FFB33C9F67414690DC 7FLINTKSENS
438,363,596 *2C6393BA42936BE97DEDD72D2220C9545008D662 1cambergfrankfurt
438,363,597 *2C6B673330774CFBB7C24543B7D3965AC6E65B25 7GUANTAIA
438,363,598 *2C67804D6521EBC3DBD1B0690E9EA71A61124F30 1 DANSPALEIS
438,363,599 *2C62C0CF32DC0794F7AF20A74CEE00C95655DA18 eldenplessner
438,363,600 *2C6640365D44D743CD97D52BD01C6EB8FFB93987 ELECTRAGISTED
438,363,601 *2C6001DEEAF8C195F6679909084B7C31C18449FC 7IAMGABRIELL2
438,363,602 *2C6638D6A39030FC8EF6DDD559EF7C16F7B25C22 7JIMBOMOTHER
438,363,603 *2C60242FC83EC545AD214E9BCE6E966EDB604996 7REPRSENTATIONSUDGIFTER
438,363,604 *2C6601BD59915632BD6ED959032FA25A9EE4EB52 1eifersuechtelnden
438,363,605 *2C68D2947FCD1125EBF99B168158EF5526A93382 1 EMU-TAANTUMAN
438,363,606 *2C66553F0ED5444167EEE7AFD26DBB0858024E4A 7STOOKSEL
438,363,607 *2C6BA243CC2FD6919FF14CD55C33D63705A4DF12 EL TORO DEL CORRIDO
438,363,608 *2C692B1A1CD429E460D541AB9F87CAFEF6FF6C63 EMM8886
438,363,609 *2C64C77F4FD30FC553A6F866971F78724B757178 8BSWMHAYHURST
438,363,610 *2C68A6C3C92E59AAAFEC0E98944F3794F395B259 8CADALLADAC
438,363,611 *2C633547E77444E385143CF7C1B5B367141AE882 EN21786144140
438,363,612 *2C64361CD2440D3C97DD5D9817E0EFD00B4D92BC 8####d`~-`~>-<
438,363,613 *2C6481460FFAD9929B69A90B7774AA2240678ACF 1 MARGUAX
438,363,614 *2C636EBBE5B60F8481437BB06F685D4D6A214BCF 1-marsik
438,363,615 *2C65F975D77C881DD88ED8A6E8DF3FE066CB9541 1 MEGA-WERBETOUR
438,363,616 *2C6EA69B6FA2919771EE212D97526369B4640782 8EDWARDKINDER
438,363,617 *2C6D86FA9B91392617C6657AAEA840BE6B8C5F07 enragluv6
438,363,618 *2C638073B1032225A7F6416C57AEEBEDA41FA536 8IMEJDAH
438,363,619 *2C6CBA9A5EC5F162B3D38622849140EA7831476E 8JOCULARI
438,363,620 *2C6CC8F6915C41468203DD47968ED6AA0B3470C8 8.L
438,363,621 *2C69329315CAC2BF28B50D248C3A6A60E807FB46 1.opalocke
438,363,622 *2C6FC867BC634B49B388C38F6DF246B8A27C9897 ensmusg00000025199
438,363,623 *2C68B754CA73F6196162742960A8B449B3C0A1FB 8ORGANISMENTYPEN
438,363,624 *2C6AE89F51E2188F1E86DF503EE7B3CF886C60B5 1 ROMANTISCHERE
438,363,625 *2C6B7CB8F7D421190FDF0AEB7D04A1881F033729 1.SAFLASTIRILMA
438,363,626 *2C6B613201EAC3CDA02CA9ACD8418F96EE9CC530 EQG$C
438,363,627 *2C653BBFF49FC336592DE53B5169B8A621E19A7B 1THATAIRBORNE6
438,363,628 *2C6B1E6627992E6925A81FCFEE3208C0E498868C erasmoslauson
438,363,629 *2C66CBB9B21E3CCE07A9BB7C33A142205912FE33 ergotic
438,363,630 *2C6F2DA4986EEC30A7CC19DCB4D9AC3D88CAAFC9 ERICK.GRANNIS
438,363,631 *2C639B8EA03E7A6A361A25BBBDECA6642A264FF6 ERINSTROTZ
438,363,632 *2C6193ECBFF141F8CCB5870F1A02890AB3AD3321 1.VAPAAMUOTOISETKIN
438,363,633 *2C6924F7BF2D8AC5900E46C81C249D22AE65828A ERNESTINE-TAYLOR
438,363,634 *2C6BD1CB8C52E5C55E282BD1EA686BCF3C53EDCB ernestoportune
438,363,635 *2C6E035DE3E7D64BB9A4A577BF0B390CE54AA575 ERNIE.AREVALO
438,363,636 *2C675F8F439CB98A89A38F5146086016A740E0E5 ERUIERTES5
438,363,637 *2C6DC746AF99DCADBF8F7ED60D6412880D8C5DFF 8WRAPPERBOOKDEALER
438,363,638 *2C683192C393178FA910FBC127790CF0178CECC2 ESOLULLEC6
438,363,639 *2C6017A00EC85F22399B694F3B97588F3B822FA6 essetepi6
438,363,640 *2C66ED81FE2BD0D06069E8A89E9925428062E10E 9ABBYFARMING
438,363,641 *2C66A8A3EF0440929D609B57839527649B36F872 9ABCDBIGDOG
438,363,642 *2C611134DAD267B166CB4AE1B313AD4D91B94E06 9ABOUTFOCUS
438,363,643 *2C68CF3D88E56BA80985361E2F5498C7A0616E5C ESTETISERES
438,363,644 *2C6C5F2A1A5C5BAF6694BEDD724F8F38555F27D5 ETELECOM0
438,363,645 *2C6F0B23186ED8A938443C8A558137D13200C934 ethanmalia
438,363,646 *2C6EA6E4414F256EC3FB296E45DC328EC1A7C8CF 20jilguero
438,363,647 *2C6F3D5EAF847EB17F37029D588FE7D34C85C931 [email protected]
438,363,648 *2C6768FC5BBA80A1E1BEEEEFD138FE37DD84C8CE 9ERICHMAR
438,363,649 *2C66A1860E60F3C7A03788AE3B665B3DFD8630AA ezequielblint
438,363,650 *2C69E935827CF64115CB5E49F6C33D5896E600CD 2384368 kolmikkoayhdistisyv
438,363,651 *2C6415061EBF71901F0BECBC14FBE27E31F00369 249469 KLIKKAAMALLA LIS
438,363,652 *2C6613447B3C0CC74073E3350DE7B8134BEDA7ED [f4baa
438,363,653 *2C6CD3B0D9F18DCA499AE93BDBD9999D24390507 9LATHERRING
438,363,654 *2C6A6C691170011803DA0AA4AA00B3BE51B09253 fabiangottemoeller
438,363,655 *2C6C8F17BB269CCA13242335197815AC9B069C3C 9METALLICCLANCY
438,363,656 *2C6F5CFE9C517AC9C4DE05830DD08FC6E29F65C0 faluderék
438,363,657 *2C68D3029CD25B49D7D6757B2A2CC377D0834B21 9REKJIRTSWUOM
438,363,658 *2C6B4911A2914890FDDD6DE9794D3D01EF985E73 9SCCRACK
438,363,659 *2C6C1CA26F43FE7DC33AE1E3596289A5963856C8 FAYE-THORNE
438,363,660 *2C6A7D417C0ED341AB3FF4ED0009C0F4620C7A18 2826510 victoria.linden.0:3.drc.hannover.heidelberger.tv.10:46..
438,363,661 *2C6AD6940C985AA10968AED50C6921785E00E528 f$dt
438,363,662 *2C63B1E8E6E6DFDBE92E6ECBB43AE3C8D823EE3F 2991929 vaihtoehtovertailuissa.tuodaan.kaikki.haitat.ja.hy
438,363,663 *2C6B98430C0AD0E90B826EAAEFC2C300D3AA8ED1 A;)
438,363,664 *2C6062CCE575F969055EC2B40D5C2DFAC9243B8D a6
438,363,665 *2C6268BD02E59A1C5F6AF274132CB8B03A3A479F a%848
438,363,666 *2C6AC8E6828BD3481A396066C476CB5B94358B99 2DZUNDEVA
438,363,667 *2C62D6F74F59770DA4CDE45A740A5AE868BB2E09 FIDELTEZAK
438,363,668 *2C6D1AC70B725C02E829A8293C776F1176A87CA2 2fuz28fnkanangqhklawlxgwms0wv8om2bciz
438,363,669 *2C6BA52623273282506CC24B067E10DFFA7FC3F8 A96s
438,363,670 *2C631CF36E4B8FA0F571D6815FC6AB335C0F7618 2MARIAMER
438,363,671 *2C6B0F5BB89E926F55B69DDC4DEBA06C1D9CEDAD AAA|A&
438,363,672 *2C6801B224C34E704BF7AB691DE6C27B66E50F40 AADW,U
438,363,673 *2C68DCDA350053CF130C23CC9B480EBA688E12C3 FLORENTINO.BANACH
438,363,674 *2C63B76D185ADC82CC8A5B379CE4CD5D0FFC9FD6 2-SUGGESTIIVISUUS
438,363,675 *2C6886BBDB3403287526E706EDD04766AA0C98D0 [email protected]
438,363,676 *2C690E125892D8665AC70F264C6BE1487CEA8B7D aalexandrina
438,363,677 *2C6AA4212E518F9559D31B70C96AD65AFA2ACCF4 FOR ALL TOMORROW'S LIES
438,363,678 *2C6F863038D536A5C2C4AE75A222E8477A7B8F8F 30jan1972
438,363,679 *2C6C6FD30377912BCBDFD4A8B44113B6F5913F6D a#axg
438,363,680 *2C6A84DC070096C6DF6F3199A32A05E9D03AA783 forthesoulofthesavior
438,363,681 *2C62402BFD41692E9187F6753C0317D5E38EC54F ABEL.VISCIA
438,363,682 *2C63B6ACE2462251920F1556D97C890F1D5B5A66 aberthur0
438,363,683 *2C66850F47677CAE92AEDF8B25E8BCF25E56FD55 franklynsteinbrook
438,363,684 *2C60816DBA624F6097424ECA3122F1DF2140A2B6 ABHIPATSYE
438,363,685 *2C6B23CB338A42F5BFAEA4273F75E9D9AA772F48 AC60FF7C2D8739C03E007A712CF8B5C5-RUSTYR0CKS
438,363,686 *2C619D54E164280A7BE3F688942034ACA598837E ac}f/
438,363,687 *2C6E25FD4FF86F4F33B5F57C408821B7A11F9535 3NNOBNUS
438,363,688 *2C6A7F53BEB55E984700FA347A4861C95674B1E9 3##)~-`-)o(
438,363,689 *2C6E83C55F2B25EB6BA19E69EBEE1E49CE08CD43 3=====p~~(>_<)
438,363,690 *2C686688DD6E324C7C2F27B4B0BAAEB5F7AB6163 [email protected]
438,363,691 *2C6B6F188B2A48C1557B3A70A43EB6D2927BDBD1 ad (baku baku)
438,363,692 *2C6BC12B7CB8890F42C78A6229E51BA4EC5AFC79 G$[6
438,363,693 *2C6F5D02B90613157636AF69B425D0648DE86849 adr`a
438,363,694 *2C6956E16D9D0364E9A32BBCDFE6D1EA9E66F143 ADRIANHENSEN
438,363,695 *2C69DD53931F2F46D478815C38EDCD732B72BAA1 GARFIELD.WUENSCHE
438,363,696 *2C6B88DB59EAA8DB0AEC1BF8258BB0304149460A 419156 sdp.asettaa.14.ehdokasta..
438,363,697 *2C62473F82DBCB785AA136498D649021715A8C00 GARRIELIAG
438,363,698 *2C6987356EBF6A595B120BE0B3699C847D15C3BA GAUCHER'S DISEASE
438,363,699 *2C6C7903DF113BED60CF7331E9207801EA79A177 geblekene
438,363,700 *2C693CBE344449A44661E459E52E8333CA5470F3 AEGATEWAYJUL27+1TARGZ
438,363,701 *2C6C3BA716AD9577279A4C6E21C576ACDF861BF5 AE$K
438,363,702 *2C6503860EE6EF7936F21F4C61CD1EB610EFE523 afetta
438,363,703 *2C6C8AE0E530B26307EF31891BD5CF031133A759 GGITER
438,363,704 *2C6EDA20AEE47B5D235B546AA750DBC1BA000DF1 giang.h.nguyen
438,363,705 *2C69586C1F0DCB863342B340DFF6E816A879A099 GIOVANNI.SABHA
438,363,706 *2C6613108F9AD9ACC922B276D3C2BA900CAD33F4 4BUCERAI
438,363,707 *2C6D99F2297AB67617160498C35A8D841A5DA0EB [email protected]
438,363,708 *2C625058F2C81E94B81999BAAFB655DD7A799C39 4DOOWHTRUK
438,363,709 *2C6CC7932F7ECB4AC8BE15C6DCE0B492B78EC98B AFRO-EAST
438,363,710 *2C6E6E7595A0927B47A35DB5C621229F80BDF486 gonzaloshonts
438,363,711 *2C655EED1249FE3BCF119FC64DE54209670413FE 4iamallegro8
438,363,712 *2C6CEF8E8A3BB0EE724CA17692944E660E756E0F AHMED.BARRERA
438,363,713 *2C642E15716FD1320FA8E64B0DB017B5BFA0E5E4 a=hot
438,363,714 *2C637A827D2B46C511B331C8BBC138E23A8407F5 ain't.got.noth'n.but.the.blues
438,363,715 *2C658DBB61B4D65CB641B81FC2F95AF6DE9E7DE1 airlif+ing
438,363,716 *2C673DDD270F76B85420E37DB1B2961F440E92C5 GREMLIN
438,363,717 *2C60D78C6CBD4517342889884AEB86A6D3C9A709 AlanP
438,363,718 *2C6199BD38733B5E1EC1EC965D3519AB39079C18 [email protected]
438,363,719 *2C66B13838D9D63362F748368CED73AEBB6BD3A4 4T4C5J
438,363,720 *2C682C3550BED2D6BE34ED57B9CDA5ECCEE33EA3 4WESTBYBSW
438,363,721 *2C6B8EE470078B93C2BD3E7ECD9B0EBC22E199E8 [email protected]
438,363,722 *2C6B33FF62E43A68DCF2DBEB3B62106C3E19C5C4 535AB869-5CA3-3F9B-A1F6-F452C2115263
438,363,723 *2C6184D4273F6A0BD472FB71B0B4BA85F7FD55D1 5554666O
438,363,724 *2C600B895CD376A8F40F5E303DE3C58DD92B4B98 HADOUEAED
438,363,725 *2C6AD3BE07499F942EF3C97CAC7CD8AC0490722D HAIRCUTSHAIRSTYLES.COMWWW
438,363,726 *2C68EA80C244DBC1FADE4DD64A16D5F88F67CFCC HANAHCOL
438,363,727 *2C6CB53885A628C00F9F1B701E0D1BF1DF4A4C48 HANK.HANDSOM
438,363,728 *2C62ABCA845A218A5E37DBEDEE30D479C7E93C6B [email protected]
438,363,729 *2C66084D51A0C41E780328BA325BCAC89A2C1900 [email protected]
438,363,730 *2C6E153984A519A5206CC70D234CD92BAC452D9C 5ANLGNING
438,363,731 *2C6A148802071E130CD2B0151B61709FC5AB5C6D hardcore heaven 3
438,363,732 *2C6BB542AF2975B356ECBD52338A153294F9DDF0 5CULERAGES
438,363,733 *2C68AA43E8C5AEC5CEC7DE0584CC7378FCD45C57 AL"ON
438,363,734 *2C6BD7B2DE3ABF896B65A3372170CF3D6509AAFD hauptverletzung
438,363,735 *2C6DBAEF0A8D2925B471688C051D48E4A504AF56 alpcs
438,363,736 *2C6A2CDA96B1E8B608AD5B0806C8A4C5925F7E98 amained8
438,363,737 *2C66D14DFF98510F3E56DC35DF827150178EA486 amesters7
438,363,738 *2C62D7B0AD5CF9CC2BD5056E8DB51866D92CF349 [email protected]
438,363,739 *2C60A77FFD1CCEBA3A920BC4A501A8EBB7A39C29 HERPESEDING
438,363,740 *2C695D055F7D4F783273D24AF56357F46030583F 5INSENSIBILISIERENLY
438,363,741 *2C62BF350F3D002D3A0169A7F01D4DD6A8FBCC09 5kittej
438,363,742 *2C690204A0221C6CDF05F9136395A2A8DD0C1F87 5KNIPLENS
438,363,743 *2C6193B91C1F60ED9EACBE07EBEA610C164043FB 5KOULUIKN
438,363,744 *2C69F19DDBA351B50A5DA873961A4079D7A0591A ANDERSON000
438,363,745 *2C6E8B7BCC9894BC9E81D4CA63916299F17086E9 5NATHANWHATEVE
438,363,746 *2C6C6974C53BCF3CC4E7E65D2876780986E67A8B ANDY ILHAM
438,363,747 *2C640DD3DAD636555937B06B9D06538BCAF53320 5PROOPTIKA
438,363,748 *2C6A1C6C5EEAA610DAC6CFF7DEFF205956B6E500 5RESOTHER
438,363,749 *2C61C2B954FF1FE9459D58D5159867F5977CA2F4 ANGELOPARAMORE
438,363,750 *2C6117C859A5C883DD9EBBE56D8184A41E618B0D HJGZHIVDZ
438,363,751 *2C63A9F84D088224E0679BB845B1EC1470DE3BF3 5RYTHRSML
438,363,752 *2C65A7459BD350E38F1CE193C31CB100ED0D79B9 angkham9
438,363,753 *2C655A12CD87809548E0214EF7B54F6D7C707393 5TOBYMINNIE
438,363,754 *2C6EFFB3C3ECDD54DC26733E00E24167C1EF5ABB HMOUNTAIN FRINGE
438,363,755 *2C63BA4E60BD2A15F8AEC64187496D401C5F2A99 antarktisten
438,363,756 *2C612C7097C334D205018E39F1E322C474FE4AEB ANTHONYURRETA
438,363,757 *2C682072B9C200666CA89011705B31F4ABC7CB67 HOGBACKEDING
438,363,758 *2C6D6685F767720E875176A4718D364835762348 antioneleavell
438,363,759 *2C65F4CDD32B196EB20B46F0DA4A41644C5D073D ANTOINEPOPPLE
438,363,760 *2C67133F6B92C452215E309EBEB31BEBCA520FCD HOLLY-SACHI
438,363,761 *2C683A2DC51229D4105FE5BE93E9AAE7BB42A643 HOLSHER
438,363,762 *2C6B7E041BF294F5998F30E458CEDEE873908391 6ANALOGISKES
438,363,763 *2C6A6B3D8F036058D99F61E4E0ED559AE3E7DF87 AO1JN
438,363,764 *2C6396A87E859BE1572D6698027D4092CE37D1C0 HOROLO91ST
438,363,765 *2C6BD80F17ACE426EE66372FF0F0FC6D5A62D7BE aokv
438,363,766 *2C636BF17B3C6682E6B49DBAD1A0F29A61557855 HOYMAILS
438,363,767 *2C6B5120818A91E228E08F65C0586E13B0115244 APONTE.DI.PIAVE
438,363,768 *2C6341F3E8BDE096EAA6F0A46F0D0BBE3B80B559 a!q#
438,363,769 *2C6B478909685A2D76BF0DC0A3F7AF27C527A80A AR5E
438,363,770 *2C6C742F24EFC8AE750FDB15A0ADE5B96F9007F1 6PRINTERPROGRAMS
438,363,771 *2C6BCC43E73352976C8FA889A87C9AA5BD1CFF3D 6RADIATIONRADIOCARBON
438,363,772 *2C6F3687E30F2FFC5B5304A9F0B91AF6623168D5 ARGRANDOJ
438,363,773 *2C6FB08EABC156AA3F44778544BA2B8BB777F888 httplowiki.acor.org
438,363,774 *2C624A0E25954CE69DBAD376FA670E29E3F016C9 6SAMPLERGONE
438,363,775 *2C6A2DEF595AF7BD74DED6DD063A1D3295EF32A5 6TENPAGE
438,363,776 *2C606BC9598A865779FB444AB897496119121361 6thatdevon
438,363,777 *2C617FCA80DB52B5CA58739FB4DC193CB2A12286 6VICTORKNICKS
438,363,778 *2C6BCF6118B958450D45E1FDC8863049E42F46E7 6.yksinasuvat
438,363,779 *2C6C1C9348C1F52F37DB430E30109E600EDD2C58 [email protected]
438,363,780 *2C6C3F3F59B853B7818FDCD0B32E35C808B09405 [email protected]
438,363,781 *2C6BB4F751BCA53F756CC1FA6EDF19926790B4F1 74.HANDS-FREE
438,363,782 *2C66AD558F7983D53C8019C1EACBC09F37D483DA 765JAVON
438,363,783 *2C668B93A205CB5B76CBB39BD1143812C1D99BF3 7ABSOLUTAPACHE
438,363,784 *2C66A01409218BE65405005434FFDDE3E8F6D5FE ARTUROBOSLER
438,363,785 *2C6A7E1BBA8C48B756681051A04C3FAB1589B10C I8GUDLBT
438,363,786 *2C6AF8F33D668322D80788DE03AD268F777C2B9D iamjennifer13
438,363,787 *2C681F82B9AD944371143BBF6108A60C37E789C0 as-1b
438,363,788 *2C69F7AB9D68F7EABE104F4256196B868EFBF0C8 astmans7
438,363,789 *2C685E18DB9A85205C966601C8117549818AB43B [email protected]
438,363,790 *2C68D51EFDBE756B0580A13D34E317BBD852F2F3 attoprimo,scena1:mina:salvamitu,grandio!
438,363,791 *2C6ADBA7FB59E33C2B0EF334823F5BA5C1CDEADF ILIEDESS2
438,363,792 *2C687AB113722D5D182FA704F9D0737157222A69 au+obographers
438,363,793 *2C6BFEA1422D157FA3A9DB464D664CFE9C6D7E14 7THREITI
438,363,794 *2C60FBBCDB7A4ACAF81463385F46BB37945548F3 ayrkk
438,363,795 *2C63A116F6410E24681954C20C828B8A0578FBB0 7TUMMELNDER
438,363,796 *2C6D401D23F1EF4F71002B0F57D1184D8800C693 ILUVBAMBI12
438,363,797 *2C6EFD9170E6C6EF65B76EBFDDFB70EB1DE91194 b0bau
438,363,798 *2C6B1160D6A330949B944854815FDE369C2FC649 IMK99
438,363,799 *2C61171C68FC1F2758F68FC7C95865B7087B171E inc0nceiv48ili+ie5
438,363,800 *2C60763C8A84B0D8DFF0EFD5451FD13A623837D5 Indio-Gitano
438,363,801 *2C69894312B246DF4EEDBF412DD4267F6CE0DEB1 INERR4B1E
438,363,802 *2C68B6619A12E3FC6F0A2B034EC7D2EF1BBF80F3 B4RGV
438,363,803 *2C6CE0EA51ED5088842DA45A6450368DD6445D4A B9"ES
438,363,804 *2C628B252A2D4BDB145BD3F41CF820E137D5700A 8LIGHTBOILER
438,363,805 *2C61BA95D7DE5DFE2C5EB299DE305A2C4BE8E6D2 8MYKALI2
438,363,806 *2C63475354DC5486A92A092AA77D1968429FD11A 8NOTUSEDMEXICO
438,363,807 *2C6D7BCC499C2FAB4E3FD6E19AB2BDC4C9799A38 BAKKUSUS
438,363,808 *2C63BC893345BAAA57D8F938260010550B54F9C4 IRVINPOKORSKI
438,363,809 *2C645009329E9B74ED40F964D60C4F3688DF3081 IRVIN.SAROUKOS
438,363,810 *2C6BBE1F539EA2A572337A16C539B78A2D6DE14E IRWINMOLFETTA
438,363,811 *2C601D1DE59E89343C61768B11BC26344A9CC320 ISAAC.RETORT
438,363,812 *2C6F5A8ACC9D7367C465E2310431E09E31FF0B7D [email protected]
438,363,813 *2C690C5A6F766B6AEE7C1BDA4B3A14067CF73560 IS.THERE.A.PLACE.(IN.HIS.HEART.FOR.ME)
438,363,814 *2C651C908D15E0C772F9FDB11CC3A219651A2CFB BART.MCFADDEN
438,363,815 *2C6B4B8EC59FAE8E7BB08542C216D67065D3696F BARTONCUZZI
438,363,816 *2C6BAFFBB5010A792FAEEAAA11D003971EF5FFEB bartphilps
438,363,817 *2C617E2FC3012B8CC34F4773BEDE13AD444363CD IT7HLJ2K1G2U3
438,363,818 *2C60CB20053526638FEBBBF6A61EB5CFA3142D29 [email protected]
438,363,819 *2C680DAE0CC9A0108AC1E6E4FDEAAF3AE8C5AB5D battymamselle
438,363,820 *2C68014BAA378B7D83D2BC5C3C17A99659C75FBA JABORANDIS3
438,363,821 *2C65D69C60DD1B4A5FC72341FBC9C6899F456B14 JAEVAISMAN
438,363,822 *2C6AECA41DBB406DC8D0A7AA7BF41E9890903081 9102A
438,363,823 *2C6C14D49115EB668A2369C47FDAFEC253A8A875 BC-UU
438,363,824 *2C6926CEA99BD33A69402153FAAAF036BA0896C0 jakewestenbarger
438,363,825 *2C6B34509E3E356657A1C6B350426A726405D010 956962 odamiamerikaajanibeaptallar!
438,363,826 *2C60ED448C38EEF56E2993DF65ED8732F3AC4B2A 95uniting
438,363,827 *2C66E65CD0BE60C850334A5F3F4A814068B49F1E b##d~o.(><)
438,363,828 *2C65CECFEF1A0E4BCBEB0A0A135FF23A0AB96458 [email protected]
438,363,829 *2C64C205449F1500C96B06BD42A81104324447E9 9AGAFCIS
438,363,830 *2C6C3B38FEEECECB28E4C03523EA727146CE9E64 9ASPIRERASES
438,363,831 *2C6CB67752522031F3C09EE5EA712D19156D3DB9 [email protected]
438,363,832 *2C6DF81C394553CF3DD119CE56C0E59A61E5AC77 9EPPETSKK
438,363,833 *2C6CB44091C5152F52443E9CD2F119FE18AF87A6 BENNYKANTOLA
438,363,834 *2C6CF279A6CA05461ED42DDC5D5DAFAD357A0BD6 ben.shur
438,363,835 *2C634E8540D6F657D402397D190E9EE803947A54 besluitps
438,363,836 *2C647C1D55926FF5695B29FA9130DBC22C9D4DDF B F,QE`
438,363,837 *2C6A6ED59B87B02DBF1E383ADB690DB93E7ED202 JENNIFERARAYA
438,363,838 *2C645B2332138858FEF22F99E65FF31C84629D0A bglk;
438,363,839 *2C63E348BBE4C6AF2558709970AB3D09319621A7 9OCCULANT
438,363,840 *2C6E28AD01DF1704E9F94D7116ED7451431C96BA 9PARLMAN
438,363,841 *2C6408F8DA5064EFBF830BCBFDC4F81FBDE448F5 BHF9+
438,363,842 *2C66E5C10299EE00994A06F5BDCF9FBDF8A3292C bl.$1
438,363,843 *2C647FA21083B50586DC69A667613EE301A5378C 9UMHCSSUA
438,363,844 *2C6B60C2E67997C96FD27D17ED1F494AE3AE1A60 BLAINEGARIB
438,363,845 *2C667BC2A5AAE719567E70328B925AC1FE4E4020 JESSICAKITTEN
438,363,846 *2C62762035546A4754EB61F0DFA8DF599468D1EB blu)b
438,363,847 *2C63BEF6079B1641489925928145F847C4DE1C7E BO"D!
438,363,848 *2C6F7F6964A063D9B343BC9C7B01D998F5312DF7 JHORENKAMP
438,363,849 *2C68921229AC0F33C74B8242DB5E9F97C24876FA jigyasa-tomar
438,363,850 *2C6E98031B1BD751A1873F6773AE8023BB5225A0 A2A"
438,363,851 *2C6B39EE49D24ECD8C51D2E9D2659E80FFE2C954 JK7KZ7
438,363,852 *2C624496E135598E14396BEC7A1DBE7804A7BCEE a#6p(
438,363,853 *2C61E4F0BA0886CC1EF6FE63C710F8B45D73907B JOGURTY1
438,363,854 *2C63792D16A50F653A9E291F42572FC055F3D800 A7PP
438,363,855 *2C6187A6D92A041255059754EAE62719C3F6BFFD a%82f
438,363,856 *2C688FD1A6BC82F660404CB85E94247C2C7BEAC8 JOHNIE.SIDMAN
438,363,857 *2C6A7954C1CE5BA2F980C5616C2557B73703F6D5 BRAIN.EAKIN
438,363,858 *2C6D0A467B185377347C8FFC900B122822B54CA0 BRAINNORSTRUD
438,363,859 *2C69AE52F5B0DD9D02F172DFEF4B14FAE46859C5 BRANDONWEENUM
438,363,860 *2C63861652568F3098A2732D6425894236273A16 A9SG;
438,363,861 *2C667EDEA19AA5BE5AC65642D0BB65340F42E3CD [email protected]
438,363,862 *2C66A8A7325A6DD7817E5DAE1906B73CA696D350 aaafrz
438,363,863 *2C6FF4BCE7B33FE3FF6FB9ACA8D9118904B84A5B BROFLOVSKITHEODORE
438,363,864 *2C65BE586330D73D5C6ECDC2713408FDC5A8CD0C bryanheslin
438,363,865 *2C64320FBC86741973DF3347F113126E0A65DD47 BRYANTMIKULA
438,363,866 *2C6A83441BAA75808FA115AADFCE75D27B89B103 aacl*v
438,363,867 *2C6D168C6F5C083FFB6A897C7867C715E06B4875 aac([email protected]
438,363,868 *2C63C8037640C4C48F30B574899442862D16BB6B bs58o
438,363,869 *2C61959B790C2BFC61AD201F26692FC1F59BDDE1 aade<5
438,363,870 *2C6C49F4E9ADC87CC0B74E4A881F8D768C072BF9 journey181
438,363,871 *2C6398A412884C1171BE76B62A91E967BC629436 juevessanto,3rdnight:eramquasiagnus
438,363,872 *2C6C1ABC755084A18A94CA0A0968D0057ADB9671 BUDZILĄ
438,363,873 *2C695A13EDFC5C25C0D4294998E3C343B80E08B5 bugler0
438,363,874 *2C686467DFA6CEA92DAEAA34C18E66550816E467 BURTFLEURANTIN
438,363,875 *2C6B75E40A00CE2472658B7BF283F94198E9EECB bv-
438,363,876 *2C65C1F12E64612E1EECB215C8F7563FF0223D07 BWU3!
438,363,877 *2C6304426D7948AF066491EDF68B431EABF07406 abaforum6
438,363,878 *2C6908BF24EB445BF79BB756D00D6FF2F81135E5 byth8
438,363,879 *2C674A1B9FEB0673E1ABE47D420ABD859C024D12 ABBYHOBBIT0
438,363,880 *2C62207DCBA8E5A38ECD08A1D89CEF00ABCD650F [email protected]
438,363,881 *2C6027DEE0704A14482A51B665D427E6993DC8CB [email protected]
438,363,882 *2C64099B7E91180D64D82BEC8774A651C3098F54 abdel.salam.awad
438,363,883 *2C6005DE06703129918BCFB96FE345E250A34470 KATHY.BUCHAN
438,363,884 *2C6FADA59AF500ACEADC7A1967F32095B3048ABD abd/o
438,363,885 *2C6670839733165D5FBED01DAAFDC73BA497E250 c0ntr0ver5i411y
438,363,886 *2C69F6B55E08865F3EAD076D4A8A88BC7C204AEE c2gr7
438,363,887 *2C68021FF6AC34C0BB2E954BE4F4E61E650987A3 C3,LF
438,363,888 *2C6F10466503E62210FEB5EAE6B1AB9E869310F8 KENNYHALBROOK
438,363,889 *2C6ABA0B268BAC2EE3E97A1470B5F29C53B36F21 c6(/c
438,363,890 *2C6AAA2F3F6CA330E19E9FD1798EB45A626C7552 abigailveronica
438,363,891 *2C6C4B3A8332353D9BE23BAD48FC94AEA8E39280 c8-qb
438,363,892 *2C6F6CBA0DBBA82AB077933B5EC4D7CEAE3764EB KIMBERLY-BOYES
438,363,893 *2C668307FAF9168A9F32A9C9B966AB884A30B5E2 [email protected]
438,363,894 *2C6A84F9E80EF291D9C6F37DFD0C269DB5A9CDAD CAM;+
438,363,895 *2C638F116FE64DF8E1F0FDCFA64A9A2EF67ABB1C ACK4B
438,363,896 *2C63050172F6F73BC7D90570803CED5F3A755CE3 ACWFS
438,363,897 *2C6E75DBB4050221C5177DE8FB1AC57BFEC74929 ADEGEEBOSAMSON
438,363,898 *2C6632E5A439C301BE5B32AFD97AFD60F9690D1E adeste
438,363,899 *2C62235356F0E180B659901E7EE984954218B928 adjec+!ve5
438,363,900 *2C6F3B6B34264D37A094DFFE1C4AB6CBA9EECB83 catsh
438,363,901 *2C6A9647B1E37A2AB4804B9793CAC8FED1A91D18 KYLE.RALSTON
438,363,902 *2C685C357678F02DD26AD61774241D1FE2AE1786 AFQJCNGGMHA02TOHQIWVBWFBC4SYQGPBQW
438,363,903 *2C6CE4265F7F56E64D509DCE725F886F7A9E7161 cejg%
438,363,904 *2C63AE208BFEF63B994C212E55CAB39B078C4760 cerficação
438,363,905 *2C6E70A6EB4BBA9E361630FD8646A951302D8498 CerK
438,363,906 *2C62BF6476BCE2AE7569C3B3C8BFE7A061ED0501 AH1E0
438,363,907 *2C669A5BC134756D6AE14D0768008A41969DBF39 LAMONTCIPULLO
438,363,908 *2C66DA5B455DACA2C70856C710DEB9416129CA8A AHD3J
438,363,909 *2C6090738F67FD6A3110F8BC3677C99014518930 aisitii
438,363,910 *2C691D5275BFCB5406B7375ED274EEF6E572B787 CHANGETHEDUB
438,363,911 *2C6C5A8AE3986639F9485CC036C49EA11EB36C21 AJP1T
438,363,912 *2C66C4EF45A2D71981302F3BCA1A701F90DD2DA9 lebaronlee
438,363,913 *2C69A3D3F8D12633439A21655FA6E6A835A46D8E LEESHULTIS
438,363,914 *2C6246CF27F85153EFBC4D30759473DA3B250CB0 ALABOLIDI
438,363,915 *2C64A504A6607EF8543C8574239DD68AC1C302A3 ALANWARSME
438,363,916 *2C6D48792A10FD4CA5FD3B5AA2D3C24100A0A030 alarmest3
438,363,917 *2C69D2C1B741D1B25F506A6C9DD0D490B3E735CB LEONARDOBARABAN
438,363,918 *2C6071C45C7A3F518542DD8D9C7FA09415F1FB24 leonelhegmann
438,363,919 *2C68F6317A46AF0F2A4208119DFEE79DDB353F43 LEPETITCAMION
438,363,920 *2C616E106D3D3B3BEC1C7178E976ACE573B777D8 CHUNGLEMERE
438,363,921 *2C6BCD3DBDB6429669202BA8277CBAE3FA9247CD CI0MS
438,363,922 *2C64C5DEB9ADB3DD73C3D81BD91DC94046BDAA84 CIRCLECIRCLECITY
438,363,923 *2C64E0BDF0B56E16E18547BDD0A3ABFC6E9CAACF lichtwaarneming0
438,363,924 *2C643ADE8B485BBF27E0BAECE4D950D50BE5D601 ALVINIA
438,363,925 *2C652C12D899E0891F4FF105F698DD96DF3FDE2E CKO0K
438,363,926 *2C68296CCBFA3E7542D6959E93AEE06E1726F2DC AMV-M
438,363,927 *2C6A55E84A64D1769F409B6946B84948FD24F85B CLIFFORDKIRTS
438,363,928 *2C62BCE13AB4C55A0AE020E00D57791AA7FD219D CLIFFORD.MONSKY
438,363,929 *2C650B43C9637BE7034D20DBC0FA4D1AD7084C0E CLIFTONVOLPE
438,363,930 *2C66E14129F50969E74E11AFA8618A4460D50B00 clinisoft8
438,363,931 *2C6F4514BA40D8CC3452D7A064EA9C03D906AA85 ANDRERUTIAGA
438,363,932 *2C69F8004749D5AFBA317B34460C171400C0213E andrescowser
438,363,933 *2C60CEE4EE75B5EC07B1135EDF4280DC48C9D046 CM+CV
438,363,934 *2C6A36BD5A1A296FB0031467D778415F51917BE0 angelonewstrom
438,363,935 *2C65790A92FE0857AAE66494B9A76CFBA9EF2DFB LON.TARBORO
438,363,936 *2C6B6B2892DEE158F98D933242DFF60BBCBC84BD cn.dm
438,363,937 *2C608440FF4F13F4018DF3D0D736A1F338AB2EB0 C+NP=
438,363,938 *2C6BDAF01CC25CE4A975D2EA3E835650AC54B7AC C%o9
438,363,939 *2C6B833677B6DC658CFE64A32DFEB852F7C41740 COLBY.PALLOTTA
438,363,940 *2C662DFDAD7C08B9A587E10E0F3780CDEE67D1B3 anormal.
438,363,941 *2C65779E081A3C00373B927B7AF87412F8CACF65 ANTONESCHUTTE
438,363,942 *2C6EFF535C81A5B5FC1AEF8233FC2D713CEAFC6C ANTONOVOVSIJENKO
438,363,943 *2C6A15CDA36D69FE4EDAE4B4B03A2B4A9CA2B4A0 LUPE.ESPIRITU
438,363,944 *2C68988172A64A24078FC667D8DB057DE7541317 APN_8
438,363,945 *2C67BFBA8539CF9B092C33D66B7D6F416C542417 MACHACING
438,363,946 *2C6C502EA5DABCBE5CD9822DA722929C96B01727 MACK.ARABIA
438,363,947 *2C6676C4E98DA595B34371F761EFF6C15FD6AEB4 armandkinnard
438,363,948 *2C65C5368B3FF5D1566D8534EB2C60797C4712AA ARNOLDODELEO
438,363,949 *2C60611C772E062B883C3FB05E9D790B3403EE9B ARNOLDSANDY
438,363,950 *2C6230ADE495390989B8ECFBF2EA04E277E90BFE ARNULFOKIEST
438,363,951 *2C6BFFE5B6B0CE90F015976B5DCA4360FAA85C89 AROMANETTI
438,363,952 *2C661A47AACF92D38E0A140978AC7E421277EFAD COSTEISES
438,363,953 *2C62720CF91CA76CB2525DEEB358F6F5E5F48FE8 COVON
438,363,954 *2C63D0875C6B11F567C24A0959996417BBC20EB4 Manchmal-des-Nachts
438,363,955 *2C66753B0F4DB50351149A3D16A6940D50B38A6D CPOL0
438,363,956 *2C662478A6CC3E3B487719EEFCA50EC7FE10E7C5 c:\programfiles\microsoftoffice\office12\1033\pubspapr\papers.ini
438,363,957 *2C6E9F3E479A713C8E2F2F976640A60E2F12BBC5 MARCO.GENSEL
438,363,958 *2C65B1DD839F8D0A4CF9C60FC42A24A4B2B5EE6C aseebhiuthaijaana
438,363,959 *2C6406B88087AF18CB4975B6FB21EC8E060B9CF5 c;=)q
438,363,960 *2C615606F1B5424095B4DE1DAFE9D85CCA21CB91 ASIMBUJWE
438,363,961 *2C699BF9AE9F5D0A7630BBC10C28A6B6F65509C3 MARIONGILLENWATERS
438,363,962 *2C6CDB85045032A10608EEE95A52ED1235B5D02F ATAVISTI1
438,363,963 *2C6461352064800D40671FF8F06347591ED6632A ATEKOME
438,363,964 *2C64ABC7E244A8B4D9A857B829C28577A840604D mashdotz
438,363,965 *2C6ED97DB6CAB40EC827421AA029C36EF9369F34 CRISTÓFARO
438,363,966 *2C670257164F3D774142974FE88AF0EDA0403C6F masonschlichter
438,363,967 *2C60502A5E80282161FBEAA31016A088ED0F4B1D MASSEPERU98
438,363,968 *2C6332C9D5468C7C448D061D414610CDDDB1CADF aureliochebret
438,363,969 *2C6C40C291F6F8951BEE70F9C6107E7CBDC39B39 AURELIONICHOLLS
438,363,970 *2C6D9EDC0850F020FEE026FC6DDCDF4975529F94 AUSRÜSTUNGSBAUTEILE
438,363,971 *2C64FC46B224A11C77DF2344093E3A9338135498 CURTIS.GAISFORD
438,363,972 *2C6FC7C2DBDAA964A9BBFA48C000B7AC5371B54C MBARRIO4
438,363,973 *2C6E8287AD6C6748BD208EC96D1D33DE9F3ECE15 cv;w=
438,363,974 *2C61BE4332642F854A012FFBBB72370327F34ED0 CX!R3
438,363,975 *2C6CB9FAA639AF78DB3AE5E0EDBA1FCC33CC1CE3 azy&
438,363,976 *2C66873321205EA9713AB219C86BFFA42978B7CB B03GIRLS
438,363,977 *2C6DB822D428D45DE93E5B198368CDD630441AA5 MERDELL5
438,363,978 *2C6854B50021F9E5735674276E4140B14DD9F3DB michaleslagle
438,363,979 *2C6B6B3EF33C4E5D63DB75A8039C10951CDF0470 D5SL$
438,363,980 *2C6A3882A920FE1ED494E1291116EB0E9775AADD BACK.LASH
438,363,981 *2C6AED6015DD399AAAE00F3CDD64B25E20B79804 MILLERJL3
438,363,982 *2C6D57ECA6CB94A528D3B49B73EA337460245EC4 D9PCR
438,363,983 *2C6081AC6476179F098312A94EABDF28A6044852 DaJegTrakRenter
438,363,984 *2C6AE7D905689D622BD0D023496ABE35A8E28421 BALN3OLOG
438,363,985 *2C6A0708FADDB21F11742E17BBA04709368A4552 mitanttnatim
438,363,986 *2C6F1162A91A8AF2163CB4979A2864805469DD5F BARRY.WHITELEY
438,363,987 *2C68F3CA488831FAFA82CAA72CE9B0B77213D5A2 [email protected]
438,363,988 *2C6BA117F0BAA6A2A4ED37511C4908C3A281C39C bates141comwww
438,363,989 *2C6886BCD5D8EB6336199C85BADBC8BE0E00E796 daphne693
438,363,990 *2C6ECBAB8CEDFD0749974FCD2651B956D76A91E2 BAYIN.PASOK
438,363,991 *2C67E01CFACE68014828DC1DD6B340E0A056F8DB BB(9P
438,363,992 *2C602B97B3ACE196EFED798033A1AD7284C55A16 bb-w
438,363,993 *2C653E43A1A3B38B450E03D03D8624116FF1F1F6 darylweissenborn
438,363,994 *2C677A1B0C2A1D9EAE35EEC059BA7DCC74628BA8 modellers5
438,363,995 *2C6E65B693C148F79FC665CAE1E23635EEA2C18E beats321
438,363,996 *2C6155142DDBFBFDAE018BC4CFB4EA18DFA6886A more to live for
438,363,997 *2C62A6F8BDACDD36FD4FD5B7CD72D90B0D261F6E MORRISGARAND
438,363,998 *2C6BFBAF9F8B67B463F8DD11AB612F1C6E1EB581 mortonkempkens
438,363,999 *2C621EB0CF0AE96153E606BA740B528603A53D69 beer_keg-b/i/r_k/e/g
438,364,000 *2C6E4F4D40D63BE4616AD09EAE605E420948CB80 MOVE THAT BODY (30 SECOND VERSION)
438,364,001 *2C64441EA34F60972FD459956E0E43EAD7DEC8B6 DBINX
438,364,002 *2C62B695EC1FCEAC8A01AFD8B8AB7471FC43F989 d?d6
438,364,003 *2C63675A26ED612B9F39319798540DFD087ADC3C mtrrrhgs
438,364,004 *2C6403C490D038FD88521A7113108D7F06F111B7 MUSEFULNESS0
438,364,005 *2C6F7F5C88E0305DAEDEE7F8903833152B7FE155 BETOKENS
438,364,006 *2C68731142AE90E81A590B6F5ACCF04A54A07BEB DENARIS6
438,364,007 *2C68C5562375900447AFEF355A4F0C1312022BBA DEPARTAMENTO.SARMIENTO
438,364,008 *2C67B65D93C16A534657C841A48CE925D7C969DB BG5GC
438,364,009 *2C68DDB8AB08BA996EE7EBEB271C999A2CC79B74 N3OCOLON1AL1S7S
438,364,010 *2C681B53ECB351BBC80E87F09E8CEFD0B75D2E90 NADAVAN
438,364,011 *2C6D063A2E4E08123321F0130257CE27AD200B92 deshawnbelluz
438,364,012 *2C6509739DC748949B609A2AE83335658DC0BDB6 DESTROYERKONVOJER
438,364,013 *2C69545029ECEB1FB4B9E52B5C89EED152F8A0FC bg#ql
438,364,014 *2C6DD1873E0E556AA7F04CFA2E93561455FAF92C d,f+,
438,364,015 *2C676381080F3CEB7BC520E29E8E0EAD903728B8 DH8K7
438,364,016 *2C6C051ED9BE49FE47DDC9E78A95CEF4C14594CD [email protected]
438,364,017 *2C65DDC6607DDFA7BF9CE0F02AE7B293086BD376 blondegarden
438,364,018 *2C6B6FDEE2B8C364D09EC17A2E588183A266F9E3 dir=e
438,364,019 *2C616ACD9D4A4960310ED0D4C2323302B471FE18 DIT?I
438,364,020 *2C67FF91F5D4E587FA71626716DC0D63ADA35EE5 [email protected]
438,364,021 *2C666059DF75D4EB82237AA6198699E13483447C [email protected]
438,364,022 *2C671D901CBE18DB5C9BDF902C3F2373FC34B911 BMS$
438,364,023 *2C6357F9674342D6557411B1DB4D6795C0C8C733 NIGKREUZIGEN?"(PILATUS)
438,364,024 *2C6DAE89254F68747BB16646F36F802BEF88D8B5 NIYTTER2
438,364,025 *2C62E605906AE9DF4DF0E1D0419EF2C69E194E6C NMASSARE
438,364,026 *2C6D66CD2BFB31AD1CB0C67A367E05961CD8A7B4 nmuijhr5
438,364,027 *2C63BF611600AB1A96D5320426F0DE75C54CFB61 [email protected]~O~osplat!
438,364,028 *2C62B0F0F70F19FCFCAAAA496FFA2B55493CD201 born.walden.robert.cassotto
438,364,029 *2C6B389BBC7AA01006FCF67963541064949420ED BOUDAÏEV
438,364,030 *2C67B2EC86BCFB3B0D05E405031A6F7DFE956DE8 [email protected]
438,364,031 *2C67403A1BDC0876C8DD2FCCB9DE57B9D48D7E55 NONGENETIC
438,364,032 *2C6ED766E51D33E1FB4E3C790D7717C0373249AF b####p*3b<
438,364,033 *2C6C8F0F2BD3786A0D022A08AC8C05AC81478312 BP,N_
438,364,034 *2C60779E967140E631F150F74C766873EB4A3395 noslowthinkers
438,364,035 *2C6A42EDA1C45364FDFBFE723E37062608943FE0 nselundgretel,actiiiscene3:juchheinunistdiehexetot
438,364,036 *2C6F0F43B3245039D1E4DA0123E5C0D33540E9F4 DP65413
438,364,037 *2C60D74CCFC3C1E912A4DF732F7512858460A208 d&=pq
438,364,038 *2C6113BA03C69845094E51EAB051ABF9F2973787 [email protected]+
438,364,039 *2C669F26881DDB22FA4BB8F22843D16B959763F1 OLIN.KALLEVIG
438,364,040 *2C66B5EF3726C9E7864631F2C978E4E5B2CF6366 druebersed
438,364,041 *2C609446D7419534E9F566D4FE4395FE3986414C dsk#/
438,364,042 *2C6082BBEA7B16B557FFF4647B78E0C89C17B00F brentoneon
438,364,043 *2C6F64D023FDBB788FEB0FB1BD4F80C57C065645 [email protected],
438,364,044 *2C651B4760B52FC6A3C8FB11AEDD17904B386E7E opflynt
438,364,045 *2C60C724D7B261362C4C50DFD067B1738F9741A6 D)?U=
438,364,046 *2C6C2CE1C6F90642AD7DF48725E3DE5EFD0644CD BROMCAMPHOR9
438,364,047 *2C6BA83F2BD8B100A09893AF85CB76C507442D50 ORVILLEMYNNERLYN
438,364,048 *2C66D39A5C57077C9C69B57FAF4FEECC56AF6162 DUSTIN.BORRELLI
438,364,049 *2C6D39695C8597C729F99161375DE6341CDDAD77 OSVALDO.MESTAD
438,364,050 *2C6A9F773ED3804FB723ADB3BEF69B4091C0E57C DUUA
438,364,051 *2C682311582FA21CC2E9C47D1FA19F321831CDC3 OTTO.BUCHENAU
438,364,052 *2C603CF0199925E0FEBD908A2B6E9A993D528F14 dw3o-
438,364,053 *2C64D1E27A42252DA7FC14107E514707E7EF9E9E OUTSTROVE6
438,364,054 *2C676BBCACDBF5FFA62CA57109D776878F683359 palabras.de.pecho
438,364,055 *2C659069A4A2AA2E93C57AE48A4F092A642836B1 EAKERBSW7
438,364,056 *2C60F03508F350724A93B332316C8F4F099C24F6 eapfe
438,364,057 *2C625B5FAE13D10B8928F789CF409C79B7BAFA80 burtongranzin
438,364,058 *2C6FF706BCC8BE9EE3DE5BF13A442EA395399250 PARTANCEIMMOBILE
438,364,059 *2C6F4044C66444BCD16AEC7178C4C9B7E9BBB401 edmohrman
438,364,060 *2C6F2CD502E31252EAD73DFCF3321D7BD7675B5C EDWARDSUIRE
438,364,061 *2C6C8A4735A0C41DFF7C4D57FC11369F01907C5F eed"i
438,364,062 *2C61DC91CA51418B65FC92F5A3604E925F79C627 BX12G
438,364,063 *2C653ED4CC8E2B3944AE523E7D20233FB38E01E3 BYCDF
438,364,064 *2C63B56912939273BC828F2070E6054608D3DDB6 peer gynt suite 2, op 55, iii the return of peer gynt
438,364,065 *2C671131A0DE0A532C546973235A823D91CE9266 C2!$
438,364,066 *2C6C274C18EB34A67A987B7D155228B2DF96AA72 C250957
438,364,067 *2C64EE96AE87B274B1FDBBC7184CFF364544473C c2(k
438,364,068 *2C6AAED2D46B9E7D2A169328F6E180031590211F ELLIOTTMCELRATH
438,364,069 *2C6364DE1660E265A3B5C7EBBE17D0591C919FA2 c7xqd
438,364,070 *2C607852E6AAD20EBBC36EBB9FF6DE50D4E242AE PERRYMURACO
438,364,071 *2C614B8A792EFB82AEC2116388C81E3C0F4C9B26 C9eT
438,364,072 *2C61DE6317FBB359FC81672AF6F24DFBE0352907 PETE.PARMETER
438,364,073 *2C652124C76359F336A07CD0E6CD62A7F0E38D6D ca&2e
438,364,074 *2C69E82C24EA358C34780CBF4E3466C8391137F6 PHIL.LAGERMAN
438,364,075 *2C6F8FE193AE64559223D5E082129DCAA53DC5FC embrouilleraient1
438,364,076 *2C6304EC18E8C409AAEB12363692F58C641D8C8D calvin-bruning
438,364,077 *2C6307A2A49D20534064A038149E5AA0BBB08FF3 EMMANUELINIQUEZ
438,364,078 *2C6969A02ACA015508E7940ED4FD4CCE04A38A7F PHUNTSHOT
438,364,079 *2C658BCC08E05416FC33B6A87DD25322B36CF753 EMPRESAS-TRANSNACIONALES
438,364,080 *2C65490F9392169E161C447EEB49AFEB744277F4 EMVe
438,364,081 *2C612A40117D35CBA67FB2098BFCAB838D339F15 [email protected]
438,364,082 *2C66EFCD12CE596126D65C1895056C7EACC8B110 PIMPSHT
438,364,083 *2C6E0C3300D10A05D22198853A2C0A6350D29C81 ENCYCLOPAEDIAOFPOLITICALPARTIESP192
438,364,084 *2C68FD7D9C46D153F13175C6C3E0BB496F676905 [email protected]
438,364,085 *2C6B0A26B076A73E282B9A36A524655F13F113FD PLANT-GEOGRAPHY
438,364,086 *2C6813ADDCAFF10C741F15D1D404E4680412AE7C ENTRINDETE
438,364,087 *2C68583A0283851A980E179FDE5DC308576F5FF7 POBESNELI
438,364,088 *2C69F674CA272586714C528EFC48A74357E57389 CATBRUTUSED
438,364,089 *2C64F87DB8F15092156C585D6C19DA4931B49836 epineuria
438,364,090 *2C69802D175E2C9B33685C0ACA5FDA1B5D81207C [email protected]
438,364,091 *2C67CA0F8311103EF67ADB3242CA281ADCED4E06 eq0.m
438,364,092 *2C6A6CB6EEA02A436DFC860F1F4A7A838A01FD28 eq9;i
438,364,093 *2C6AA1B124EBDA42E52656902A4ED845EF025537 cb7c
438,364,094 *2C6CFB893F444CB36C6DFB1A495B69AD92F94387 ccs2;
438,364,095 *2C64444F20394673D8E3C0E48A3755CA405F00F1 CCV4N
438,364,096 *2C60C7E5DCEB4325E8139CF17A931F2594C98067 CDM_E
438,364,097 *2C627B70B410149CABF8D7CFBBEFA89E2C13327D CDSHK
438,364,098 *2C65E0F41089CB331E25F7CCBB8EF97D6AFAB5DC PREACHING-BLUES-/-LOVE-IN-VAIN
438,364,099 *2C672DDA488DA180EE3B069BB35195047AAEB778 cesar-cercado
438,364,100 *2C62418C22E34F54800D5513B54BB5CBACB7EB7E CF4
438,364,101 *2C6D01E30C3C33D3ADB6FEB98550C304B6A08354 CF;V
438,364,102 *2C68F4CF580790CDC015555657064803A5EC059D PSEUDOSLUAJNI
438,364,103 *2C6C14C921A32671B4F6FFAF5C6A2C95F3CBA3AC EUROPEANDREA
438,364,104 *2C6210A68F155E2B2784B0F9EEB0EA69A09FED55 PWINCESSAMBEREYA
438,364,105 *2C67E0F786BB79B0DE42467BB09640878A69A4D6 evfrosiniia
438,364,106 *2C684ECDF90413ACD8A9DE0D9906A1CC39DD878F EXPLOSION.OUR
438,364,107 *2C6B1B5DD84E15EDF358A9F87CDC3D821AD5F7F4 EXTEMPORE-II:-XII-SECRET/OFFERTORY-"UMBALLA"
438,364,108 *2C618DC89C70C0DD559208E800FF61FDA7638399 [email protected]~.~.~.)o(
438,364,109 *2C6937896A0B5DED2D6C04F31E4D8E3F84555B3F falken's
438,364,110 *2C6DEDFA81D8798B4B80F4DC01D2FDEBEAE28C9C chondrosteozaur
438,364,111 *2C622D77AE25DE4ECD1464DECB07050A12D26F19 FAUNSES2
438,364,112 *2C6E5F8AA2423F058E0E6C4A27FAA15CA3FA40A0 R3B04RD1N9
438,364,113 *2C690A60896431CF3960E806130AC6B3EC06E891 FAVORITPOLSKAN-EFTER-P
438,364,114 *2C64CA30574A1D2834334ABFBFB1E161CE6DE29F randy.pobst
438,364,115 *2C6118E74CD305A0536D076564B0EF3D45CBCA47 rania-gabr
438,364,116 *2C6EB8F35DF29D06FAF6AA95906DF37F60CC76D9 CHRISTOPHERZEOLLA
438,364,117 *2C662A96D578C61C017CA0582F9DC11A6234E742 rayfordweakland
438,364,118 *2C66663CA30A3B0824AB47E029C7B0D4AD7D6375 [email protected]
438,364,119 *2C65D2B016DD174DB7A51B20EF1E81B87DAD276D RAYMUNDO.GOODS
438,364,120 *2C6E8A7DA12DF01D1AC9CC2A73FDDDFAEA4FACCF RAZDJANE
438,364,121 *2C633B698002B9AAEA60DF6386F8EF4BA67C02D9 ciggl
438,364,122 *2C6F93FE2C57EA623B0E70488A061E3017D672C8 FIBRI11ARY
438,364,123 *2C60C737E5C88C9AF1FF2B8A480D6BA2BCE85D1F REBECCA-LINDBLOM
438,364,124 *2C6F0D4CA58F2C19D35C5A1E08BA1EE0DBB7660B REBELSMERLIN7
438,364,125 *2C6623AA4D3CFFCF44874933309AF0982DA2D121 fingerprints
438,364,126 *2C6E81E16E7093941C3CDA18180373493BFF21EE clarencewerstein
438,364,127 *2C6EB42359216308855FEE0FBA5AADC628984186 claudcluver
438,364,128 *2C6D907699F59380BC39E3562E3CC458C0829DD5 claudia.boettcher
438,364,129 *2C6F2A1503367189A03E863C59D7917AEBFFEC54 CLAYHINZ
438,364,130 *2C685A8C41D7B2C044043E25FCC5B6A2993C002F CLAYMCKERCHER
438,364,131 *2C6250E3598ACF3799FC2DA9B36B58B2C66DBC8F [email protected]
438,364,132 *2C6EEE3D2F3EBCD1ADACA851C3212064A9443FAF FLATTERINGNES
438,364,133 *2C6D75E6A1C3F947269ABF8531BC9F13A356C3AB CLINTON.LUCKEN
438,364,134 *2C68AC355C861379537807A00C45EB8A36568AF9 REHERDE2
438,364,135 *2C64F4A883E47B24F682C237857365913007B907 [email protected]
438,364,136 *2C68F73A93A3EB3942AE8B54441C4F371FF31577 restless.night
438,364,137 *2C67831CCA261D9C82D24AB429A558EF5BD5D42D COCACOLAJOSH
438,364,138 *2C6D44B1CEC3E856AA2179797A02F786CECEB28B francesshu
438,364,139 *2C6D9FBECBA2402AE2C252CC2E3635A971A80A8B [email protected]
438,364,140 *2C64499E66C3F5314B3DDFFD4758056CE26C6C38 REYNALDOGERLOFF
438,364,141 *2C660E0E46F2E810DFF0CFDEFCEB4D71B8A51157 frankieseppanen
438,364,142 *2C6DF03C062A1C7586BCA4B58F297B24A28AC4CC REZNORHONEY4
438,364,143 *2C6E0C7FC718A02A5D3E8BA143E4AB6A08735026 FRANKLINIA 4 0
438,364,144 *2C6B79D81CC6E7BB1170809BB90DF356B70E8F7E COLINLEVERANCE
438,364,145 *2C63A119EB09D1CF5753458D5A15347176DC166E [email protected]@ton
438,364,146 *2C6CF53696E3738D7076D9A46F1A92DC32EE7822 RHYMES-WE-TRUST
438,364,147 *2C6AC78DA6E459659C5F5177A375FD73ABABC7E5 COMEASYOUARE(DIRTYFUNKEREDIT)
438,364,148 *2C6FB090657D3A81B37551EDD41F2D14C0231BBE COMPANY』として収録されている。
438,364,149 *2C6220B728698014CEC40A1D3B3192C97778C270 RICHARD PIETRO
438,364,150 *2C64A1565CDCF6A9B726C6E9BA7C360BBE8A52BF RICKY-KING-AUF-LSD
438,364,151 *2C67E55F4200B8DF760FBD6C70C98BAAA759B09A FRUMENTY
438,364,152 *2C6E3985DEBEED325066BC3D893130ADABDC9C60 FTOOTSIE4
438,364,153 *2C62CC4B168D8C3E1D26B7DA9D906E9D25FA09EC FXプロセッサ。ソケット形状がSOCKET
438,364,154 *2C6811B738F03D9482FC8254D1A476B12BE206FB G306611857
438,364,155 *2C6044B5A4B09FFFD3EEDEB88EBC76335B00AEE6 GALDALL
438,364,156 *2C6FBD4411D055EA4DFF21C5D77C2F9ABB765CF4 galehuggard
438,364,157 *2C63EEF1A9F863F21004BB3D3290828F877712C6 galenoatfield
438,364,158 *2C64739B51D8392585AA70637EDA61DA074C8EFF galhofeira
438,364,159 *2C6ECAB981EF945035850B1BCA6431A3C598D8F5 galoka
438,364,160 *2C69AA2B23C68F978AFC9A982B59E4EA8BCD8DF9 COTFE
438,364,161 *2C67442D282346665BAD3359708B37D25DE7254C ROLAND.OCONNOR
438,364,162 *2C61329E6585E085634E13D1E956B9743F540877 gaz-metan
438,364,163 *2C6F03129EE4815C7CD8B2F1C95BA5A4CF2C2A87 geeuwhonger
438,364,164 *2C6E162D6BFD0722A2A6D8C552C3DB724C75E524 royceohanlon
438,364,165 *2C64C7B3638F0ECA7E833398BCF9F503EED7C4AB GEORGEGLAZNER
438,364,166 *2C6E789E962C186B8AEFAF12E43086F839403F90 RSSLOJX74
438,364,167 *2C6C1D192328F767A2243500E027D5609C50250E rudykysar
438,364,168 *2C6F59DB4C438AD3D84CFF9B8CB7D7754C43CEA2 cq$!g
438,364,169 *2C6FF1E66F54A1802E89A909141BA727861129B8 cqtoz
438,364,170 *2C6D133BAE139412EEB4023006E3377410E94321 russseilhamer
438,364,171 *2C6B6691320FD6EAD6DE6537467A4058A3887D74 CRISTOPHER.CONNERLY
438,364,172 *2C6B5A89520A175E8A5E00FCCF5EA941814FE01B ruvfjedwqycyq
438,364,173 *2C615FB66635F2C1AE685350C50EAB9BCC01D178 CRQ7X
438,364,174 *2C6E517DFB3B755BE5F09B0E70F788EA6F63FF76 cs7c;
438,364,175 *2C6F2A9710C63E8D8977E9AA79DD7570DB1BD0C4 c%sr
438,364,176 *2C64B7573B8A6F8A95C5265A483155B730D0A64B ctastich0
438,364,177 *2C6F36EF8EED66597C37E4C54F549B97A62D6007 ct&bb
438,364,178 *2C64F9D46BEEC13AE1CD12B5FC8A4BCC4D5A020D c,%uh
438,364,179 *2C6169F630313482CCD759B6042E893E566122B2 saddam´s
438,364,180 *2C66886C3605FB69ABD3DD67D491FB1420CB359B c!uv5
438,364,181 *2C6FAF4A0207E0F11A40357E89E969DBC1E7CCAB saku1909
438,364,182 *2C61D897186D86A74E2611D1F1EC0F1B1DE274BB SALVADORMCGEEVER
438,364,183 *2C644643E70127B1BF179F38A2C8A6BA10DDD4A8 c"wpl
438,364,184 *2C601247315267844C2D6FF8E2B043F051D133A2 CYREESAED
438,364,185 *2C68F4052B12A8BABD6640A488E2F238AB312144 CY&S
438,364,186 *2C64CDAF2D5F1786EFC4422770A5A632A346CF6B SANCHOUMED
438,364,187 *2C69497EB8B3E23060DB51CDD14606E19C7A364D grandmix2008(disc3)
438,364,188 *2C644A05E217FC6A47ECD9A24592A44534B57930 SANKTGALLENBREWERY
438,364,189 *2C6EF744EC450639D96520DA9761DE1E225843E9 GRANTHUNTOON
438,364,190 *2C600D500D1C35A112AA16664FBA8D61CDAE7E69 GRANTSTO
438,364,191 *2C6CC8AE5539C49B7236D253FC4499909A8890E7 d5t%
438,364,192 *2C6C62B551F58B9F52D0BD20DDBDFCEC3B9F1E63 SCOTT DETAR
438,364,193 *2C624147ED71B34F613031E4B72DA56B4E6C0212 D;90
438,364,194 *2C67CB00D2D107D4FC9C5AB964EE823CD1B9B895 GUS.DORGAN
438,364,195 *2C6859A87025D1A57218AEDFF64C198305106CC3 seacoast
438,364,196 *2C6373A87C23ECB2000C2D0C1DE9217AF2970E32 səba
438,364,197 *2C6C6E227966A7DB4B7F379684600ACC7D1E4B81 DAN971
438,364,198 *2C602254C8A22764BD8003B27D95A0891E46E6F7 dania617
438,364,199 *2C66CECCDEA4E187350A287AB831A2770D89A35B HACIBATTAL
438,364,200 *2C664590978001826C0584760BE806896AD6BC50 semeshmann
438,364,201 *2C69BF80ECC1BEB058A4618B7B9511292CBC35E8 SENSHINOOMOI
438,364,202 *2C64929291936AF95E6551FD8B8ECA124B5CAF83 SERRICORNE2
438,364,203 *2C65D94B0931E3256EFDE51E07C3A4175B89C11E DAYEEYADS
438,364,204 *2C683E740633E8BF565087372C0D1C80FA425D0D >-<*D====B
438,364,205 *2C674AB4C326EA3C2339749D3B0FEF315646200C SEYMOURPIQUE
438,364,206 *2C6C0A0FA0AF8897AE54F54107814388DE49DD6F haringbuis4
438,364,207 *2C61F7EC4D8F7C308AB9DD6FC4250F3198D9C1A9 d:dam
438,364,208 *2C6AF402A9A80BC7B6B5CE8CF2D4F0ECFDB9DEC5 shaunsayasane
438,364,209 *2C6022362D2AA9E67E03CC75E1B136CE8EC7BB3C d$due
438,364,210 *2C6126D25157E01F2BF85336DAF14F7012FDBA8C Debrayeraient
438,364,211 *2C62C9F63C4B580883F2B7D7B1E1CAA2B0966764 HEGANBING
438,364,212 *2C619B1CE37A5DD308B3B6E8FBD09C9EB5ED3271 [email protected]
438,364,213 *2C6DEC63622DBEC157AD56C8C4865B64A74A6CA5 deggurdned
438,364,214 *2C64D65099B1E1385700BD840224167B32C0C5A2 dekoocerp2
438,364,215 *2C62DE2D3169AC90FA8BF22DAB0B246AE1AA05CE DELCODERRE
438,364,216 *2C6CD7781DCA7324AB6B9F91CFBCF6C903F0B851 [email protected]
438,364,217 *2C6E61E5243106B60A8CC02944304B09B88BBEFB DEMETRIUSBUTTS
438,364,218 *2C60D7A18F3DFBCFFE6BA04CEB97C01131B742DB demonicrefusal
438,364,219 *2C6DE9B0B22798F52E52E7ED882DC07DC6019EE3 SHTAUE
438,364,220 *2C652C44E9B126ADB6C5D6E8B33588A73E1C5E39 DEON PIERCEY
438,364,221 *2C6C0F75BBC59E47E7EFAA28C47467590B502E96 HERSCHELROMENESKO
438,364,222 *2C6705CCDED4330910697AEC6A6CC6DE1BFCDC5B hessmans
438,364,223 *2C69AD4E4117FCD19695055C3694F287D2E99EA9 HFWK
438,364,224 *2C67252A9F71399402770DFCF948408D6DE4AD07 DESMOND.HOLDNESS
438,364,225 *2C6BFA7405C3666A6990AEE61B18E166AE92BA65 desole22
438,364,226 *2C6FA76C88A43D8465610BFF7EBCA8D18E0759C0 simona.nicolae
438,364,227 *2C6DEBC4D3957CB5CFA15492AEBD1F87B3E92C83 [email protected]
438,364,228 *2C62C7104B776C5BBD81F62FB0749E336D0E69CF DEWEYSANCHEZ
438,364,229 *2C68EF664FDB14C412ED6660C6B22A80EE1C05C1 d$fp-
438,364,230 *2C6EE3AC6A7A2F1B116783DDA00EFC9C706996D8 dgtuo
438,364,231 *2C6A5955ACADAF8BA268ECBEF502B9C8C8406B99 HOLOPROTEIDE!
438,364,232 *2C6AA046E14AAE0E2854EDCB8B606B0ED37FD5D9 DIAMOND-HAYWOOD
438,364,233 *2C60D7195F6ACB0E2BF7483FD24AC098BCAF81DD dickheadmolly
438,364,234 *2C636CF4F4F75F6231E091184C25FFBA8865F0BB horacio.eduardo.cantero.hern
438,364,235 *2C6F10DF7FFF07A92CE1D32AF3F1E18946F39E45 SNOIREHCREHCER9
438,364,236 *2C6711C418B3B4AE3E605CCC48F339BFF1E90ECF D,ITR
438,364,237 *2C6C323BC32D9B60BDF5C07985221240E228F29A SOCIALES“
438,364,238 *2C6B34F59F4F6E38260ACC0FD5C8EA493454336B DJ STEWART
438,364,239 *2C644B2FADB3C8CF9D6C62050BBA75BCC3CAA5C8 softballsweepsvolsindoubleheader
438,364,240 *2C615209E52405A0F134B8639DE8670171EC1F50 DKEATONGODFATHER
438,364,241 *2C6F37DA54D0AEA5DD949C56EAC2B1DDEEF11841 dlrei
438,364,242 *2C635E13B6A3EAB93E74CDC6A3465E3E8868E4E4 D:n;
438,364,243 *2C6ACCD89EA1F3EF3996211B5E3E98CDA0CE7F0D dniojnon2
438,364,244 *2C69FA8364E508C5C11DD7C02FA7CAA754153466 [email protected]
438,364,245 *2C6E0E2DD8C62AA5D4CC2597ABE8FB87682A10BF SPEECHMACS
438,364,246 *2C6B4D39DB7E06A3BA2115FD3B0EFD56E73120D3 i6-q
438,364,247 *2C68CF4FE912E99C1DF58DFC3950C7076CAF7706 ibrdcinn4
438,364,248 *2C6D8820FE2E8EB09E9C354556DA98D8276564A2 IERDBOAIEM
438,364,249 *2C6D422AE8C1963371DE34428A4CA6A7C2D7C76F DONRODRIGRES
438,364,250 *2C66F6E4A8EF10E9A3D772FD30D3C82D8DF47EC0 SRC="HTTP//ECXIMAGESAMAZONCOM/IMAGES/I/31MR2FR556L_AA115_JPG
438,364,251 *2C6D0632A4A23769D258BC4F7466560D8AA07693 [email protected]
438,364,252 *2C60C5D877806D07267536A75539AAD2E2DBEF49 DOPELJAMO8
438,364,253 *2C63EF2F6E64799C20591BD73D1170A4FA689BAB SRINATH-VENKAT
438,364,254 *2C69ACB34FAFB966BDD4B3B707D0337279E856F1 dorianarzaga
438,364,255 *2C6822A46FA458FA6E65BE5F5E8E44FC7715823C DORIANGERSBACH
438,364,256 *2C6878501BE5BAF24F2C671AB51A79864044114B dorykandalaft
438,364,257 *2C616BF8DC7887C33819B7D279A3CD6B885E9D41 STELLACINDER0
438,364,258 *2C6550CF113409354A60A9DA6C5C2DA1FA6CAA5B IMPORTMAXIMUM
438,364,259 *2C67FBD1503B717AA4A67420AEC1434CA46EF98B inconcocted9
438,364,260 *2C62FE1E90F9E57043B4644ABFE1BBE1F7AAD590 STMYHCMSD
438,364,261 *2C66D4CD0D1FE5BB55D94D5A44672E1D7FEA54A8 Instante-Sublime
438,364,262 *2C678363E217E3312EA5CEE3DD7E289DE6E4F4B4 ds`=
438,364,263 *2C68B715B0A03EF4143711185AA69EE9D8F1EE8F d!sud
438,364,264 *2C6918FF8FADA8F76CE273C9DF8BB41EADC78F2B dub1!
438,364,265 *2C6B0383D8A346B07E79D780B03E032A833AA3D2 [email protected]
438,364,266 *2C6F07132DEE3C9A6CEEAA9298C6C02EDEA06316 [email protected]
438,364,267 *2C6DBB205291FBAC7A0F136121A0D2884884B622 SUP EDD?
438,364,268 *2C6F78508B9D6D770E91A120AE0D751CE008F227 ismail-nabah
438,364,269 *2C642B5FF4AFAD8EF193ED54AFA66F6311DCD9EE ISRO40
438,364,270 *2C6C6BF36FA307E5A61B5BBD09D0270FEEDF9C31 dus%4
438,364,271 *2C67EEB3E0DD828F70B1545A9DFFE15D277F4590 DUSTYBLADE
438,364,272 *2C66F5BD73DF70F2D2B74905F7527F091D917D94 DUTZY
438,364,273 *2C68ADDD1D13BFD97299A8777FF6339A471810C6 [email protected]
438,364,274 *2C661035D17F2FB5E924564E115FC633405FAC74 J%`%
438,364,275 *2C6B9D097DB8338B26C336578F3156E67DB0F88A dwepers?
438,364,276 *2C616DC246271708DBE4687C79AEDD4D137BC207 DWUP(
438,364,277 *2C6762030176C46ACEE5A1C42A5CA0C3D84A5126 d?xkk
438,364,278 *2C6AC82E5C577CE625D72E57FCFE0FFB981DC429 dycpq
438,364,279 *2C6CA396E9590ED88A1CBA5A2CDD6E0FB7F26DFF jameprogacz
438,364,280 *2C62D7645522884E9E357B38D7AC85FF590939A0 jamesisagba
438,364,281 *2C62B3BDE1BBDA0101685A80B772BEA3D2B163A2 JAMIE.PABON
438,364,282 *2C6543DBA618526FCB0EB779EE318327BB098FC1 ebv/k
438,364,283 *2C6B2F35BF64525259F4CE38D2BD2A42DE0374BD EDIFICLOIAS123
438,364,284 *2C6BBD2ED1EAF0028A2EDF450785F674D3DD6CE2 jarodbuchert
438,364,285 *2C662C2FB2E32E8FBEF62E642A6C3152F025CD8A EDMOND.LASOTA
438,364,286 *2C68E1719A46FE4FB6A867403DEB7E2B6F15F00A T71Y
438,364,287 *2C6878B38629FAB2B39C41CD83638D76E4A819E0 JARVIS.BOLADO
438,364,288 *2C62DC1CD8D2C912CF79922421C12EC5186B5719 JASONREMINGTON
438,364,289 *2C68C394082A4CA122479EE1CAA2C784D7991730 TAJIKISTANHISTORY
438,364,290 *2C6F2905358C4B564943E2D5BDD1A83C080C2688 ee-ry
438,364,291 *2C60294A499985EBEC90F1832D3BB3E7685ADE79 j:^c
438,364,292 *2C600894DEBEAF71796CFCA12C1C547CEEF18634 TALKFIRSTWRITER
438,364,293 *2C681EEC42A9B1D411382C8E512FC2D2A5E3EDCE JD_OBLIVION01
438,364,294 *2C6AD2D1ACB21C96D609B6744825829FCD7B972C jefferygandarilla
438,364,295 *2C64C137445F086404C9DF45CDDC153985677D47 jeffmotz
438,364,296 *2C609097E2A20ADED04C0A891D0A335712A80F15 elena.sampang
438,364,297 *2C609B9EA7FA12EE5CE4BF599B28F6AD292630F5 TALKJONTOMTOM
438,364,298 *2C69D384E56319E6169618C48931E3FF158E065A JEFFROEHLING
438,364,299 *2C6AE97F36DF116D563382B6C05949C3723A00F8 jeffwolfensperger
438,364,300 *2C65BA9006A4E247D0FD10C3FAF145242351C987 [email protected]
438,364,301 *2C660E1764E6FD3253FFE94EEB419CB28C27E25D elliottbirtcher
438,364,302 *2C6A4655CE9EE4F98EECDE104EDEB1EC5774DBC4 ELPL
438,364,303 *2C670F6BDDC629CE052F993B2E2A5A336081B1FC taryn.conwell
438,364,304 *2C62AA7E8914CE6A3C3FA69F2040C53B1627D4C8 em-2x
438,364,305 *2C67EAC860BA7B56230762DB5FB0E2720467D233 jessiebrownsworth
438,364,306 *2C65DB250A21559B1CC58A5C86A1DD55E3EEE371 jesulagun
438,364,307 *2C6881190CDBA079A390E9D0CE47AA9BDC00B3FC [email protected]
438,364,308 *2C6CAC7A69C27E7A481C1AEC6E483C9CE1AECE80 JJC12VFE
438,364,309 *2C6E1029A0115470EFAB93EF75529D97E8D05AAD joaquinwojick
438,364,310 *2C6FA7DC990F9461884637AD6421DD22BFC6F32E energizerkeepgoinghalloffame
438,364,311 *2C68A02459722DDF966B5FF9ABB594BADA6636E3 ENJX/
438,364,312 *2C66E4D651CDFD845E44CC56A918CB65B9A2A034 JOESPHJAYNE
438,364,313 *2C6189CEF82F991C8BC97ED07D9608A0EA728459 THANKYOU741
438,364,314 *2C6761F40C74D7E15685AEFA82E8A92F5F305CA6 eo7ko
438,364,315 *2C60E923C2B88964178A05007350795996985966 jordan.dunn
438,364,316 *2C624FED7C3F081E95E0625477D6BBA372F5F065 ERGREIFENDES
438,364,317 *2C6A67D54F77BB3D7AC6F7CF50EBBB3896D8EC74 ETABLAEDING
438,364,318 *2C6F196B9C08672670140C5118B2CF555ED04B02 ETEREMIN6
438,364,319 *2C6F785B81E04BC3E600013AA7D89D9A01C7EB42 EˈTƐRNE
438,364,320 *2C65D25666B07D8927E79E104D739974373CFD19 jpwl
438,364,321 *2C607DD72D4D28DEC1ACE066E890DB2C4AE0391A judsonfadeley
438,364,322 *2C6FC55F78B3E31A216AB00F6515BEBADABC7775 etnetiub5
438,364,323 *2C665BAA35AFE1FEA31D27FD49DD130226DFD92C theronribas
438,364,324 *2C63E8A40F20ADED6ADCB7D91CDE41D15A9B0CD1 THETAURUS1985
438,364,325 *2C60164CE0D5E2D2CEC3E0C318644CCC9C1585A0 K7#J
438,364,326 *2C6C0BBF9098FCAE5EBB20420883E1097A3912D2 exculpa+!0n5
438,364,327 *2C6C93B8BDF905DBCE4626C6397BD9BFEB75ED4B extern.int.optind;
438,364,328 *2C6A04BD9E0866290824E7E38FF67FBDA3357072 KAREEMTOLBERT
438,364,329 *2C6A5A0FEDD7817E1799F6F596E9BA7B265A24DA KARN)(*
438,364,330 *2C6276F72A21B64F6E019888ECC68E72354371D9 ezekielmiskell
438,364,331 *2C690593BBE4F729B636C53970DE0AA4AEA5BA9F EZEQUIEL.VANDERGIESSEN
438,364,332 *2C6D7CA05A1A5803274362E2056758211B8A4E81 TINTINNABULUMN9
438,364,333 *2C60741DC39548A8618063D812E7C2B4A090572C F00T!NG$
438,364,334 *2C627DA462DCA0BF5A32D22D164D1BEC3B09BF70 TOBIASBYRD
438,364,335 *2C68C3C1D99A4949154BC33C103E645FF88B0790 TOBYGALINOO
438,364,336 *2C60468A930B36FAAA4DF58E810AD3FFD94A8950 [email protected]
438,364,337 *2C6B48CCC182807FAC958BBD64A230C6EBFE392C KEENANGUIAO
438,364,338 *2C6C8CFAED085933CA168D25A9E101D1015537B9 keepingmewhole
438,364,339 *2C6A430D2F1CC704FBFDDC5340DE3B7A6FF354C3 KELVINBEDSOLE
438,364,340 *2C6C4FCF717E3205DB3F6C782692FF916BF8FF61 kendallsilverthorn
438,364,341 *2C6FA50588817EA9A5C944668D9168BC16B2E04B TODHALLIHAN
438,364,342 *2C65175266C71DC9B8CB54720305A5BE7D667A9F TONY.SUMMERHAYS
438,364,343 *2C675CAE170C509F553E1646691E9187ABA0B4C4 TORQUANTS4
438,364,344 *2C6A67BAD2DBA2F12DF3BADD040BED51642F9B86 TRACEY.ORNDOFF
438,364,345 *2C6BEE8E7B6E8E2EC20BC1EF10582CFD4210D402 traceyvoegele
438,364,346 *2C6D51C4279C091737AA3AF51043D48E10E8E137 TRAVESTIRONT
438,364,347 *2C602AD32C07EF3F14C8AB3D09193BBDA96A6780 [email protected]
438,364,348 *2C644C13D5D02297D903692660B50EE56F340E5A KENNY.JN
438,364,349 *2C6B4B0C42B82C6093BDABAD24C27EB536F3BE13 trioineflat,op.100:iii.allegromoderato
438,364,350 *2C66856B286B54993D3A6819390B4D3D6C699808 [email protected]
438,364,351 *2C697711E16BAB69EF8E4A85011A0147E331925D TUMAINI.KINGU
438,364,352 *2C6B30A89E9BA90A3A619CCF05A6D61454CE838C TWDRYT1DRY0
438,364,353 *2C6051B3DB6801A9464E6FFD56E2B91425E8DA5C fgbg4328
438,364,354 *2C6B94F32AF5D1BAFA3324140D9A39B8821EC21E kirbyrouhoff
438,364,355 *2C6F6B897C939AEE70F87DB8C6BFD142D1092B41 KIRBY.VINIARD
438,364,356 *2C6050A3B1020E52EE7D818D9406C1A50A6FBA31 [email protected]
438,364,357 *2C6E23C766B7655A290CB1FB89CCE7FDE03DC1B7 k}m
438,364,358 *2C668D4E043ADE46647D96C9B5B54D0E088B6A95 [email protected]
438,364,359 *2C667F92BD4E215615F14B3ED974D6A8251814AD koiarudo9
438,364,360 *2C6C64E3444EF02B4E6503CB2B147EF591CF76CB ukareda4
438,364,361 *2C6098C98A83A8935D2AE1B9E1090C3739A44411 UMHERSTREICHENED9
438,364,362 *2C6BDBE45F5E34F739C492159AC2E9C52F06650D UN1NV4L1D4TED
438,364,363 *2C6AC8BEC4A81131A6BCA845FAE903E98B21F106 UNEEKGIFTS MORE
438,364,364 *2C697975E459136A0683F8F165E329486EF84E4D KRISTOPHER-CLOUD-&-WILLIAM-J-BERGMAN
438,364,365 *2C6464563249A4AC1CDD6F683396D6D555F9C4A2 [email protected]
438,364,366 *2C6BC4E158DAB6E713153B18A63C22BB2BC5018A francesslemmer
438,364,367 *2C60FF267F8B9E43CDD1B2B260264235113C1A33 KULTURSTANDORTE
438,364,368 *2C6C2F8FB6C8C01710F9DA188626A3C23B19499C [email protected]
438,364,369 *2C62F7CCE48C8F5327FECBA2F1F2CA07E40984F2 KURTCOLBAUGH
438,364,370 *2C6512D69349AB37E8E473535D3C316882426CC4 franklynyengo
438,364,371 *2C663CE0BEBDCA1385623EA997A5AC6C655A5802 KURZGEBRAUCHSANWEISUNGEN
438,364,372 *2C61703B9ED72B276BCA1691BF1375818FE87F85 FREDDIE.KEAWE
438,364,373 *2C6757889AC6E732D5AFC0A130532D59B851F6CA FREDERICKGEATHERS
438,364,374 *2C6188FF1D5F26BC77E5D888FDDD2071154A2E25 k,y
438,364,375 *2C64B68D5C1090D0C4021C0B782C7FDB8C642D6B UP3.83737
438,364,376 *2C690A5CF69AFC985C8D86ACF907A59C4E4B2410 UPPERS-FOR-DOWNERS
438,364,377 *2C629A13BE616E4139E98B30DDD14552595D434E FRIDERICI9
438,364,378 *2C69ABFBC04F353369A11222B773BDB018846D6F frmandressurvair
438,364,379 *2C61135AD44D2356598A9ECD864F5186BB1CD2E7 fruit gr4
438,364,380 *2C642C3CDC3EE22C8E14265C82EC6B678AC68B4B /USR/LIB/RSYSLOG/IMUDPSO
438,364,381 *2C6FF0711E4F0441FC9B5B871E77014F3F8D5774 [email protected]
438,364,382 *2C64CDE8B904696C359B422C1701C97A268A629C GABRIEL.HUFFMAN
438,364,383 *2C693FE9A7F62C96A4AD22626681A9C442029C3D GANTLINE
438,364,384 *2C67A7E6433BA7E93DE4490425948EC99D550E95 [email protected]
438,364,385 *2C6F66874D8310F38856BA00035BEA9C5DF50B20 [email protected]
438,364,386 *2C6439038BFC0F26488767DBCD887A8E84783723 langschnabelweihe
438,364,387 *2C6F7680EB8033C9F50A3A76DAD379D21EB6868F [email protected]
438,364,388 *2C6EB2331E823C1E9FF4DB5E1D86D6D59F34D87B GÄRKAMMER
438,364,389 *2C6379809908F63A78105D48D2B40145E81823B1 GASTON.AVETISYAN
438,364,390 *2C6BECC8EAF63EB690CEC5A0BF104226A875D261 VALARIE-PALAFOS
438,364,391 *2C6CC5C5C1AAE271B6A9C08FBEB30880B0A99260 gataanaam7
438,364,392 *2C699423814E96CF7465A0D965C3A18471BBBA14 GAYLECESTERO
438,364,393 *2C6DD5E6584C9AB9614ADD0E73FA8B9975822AE6 GAYLE.HEATHERTON
438,364,394 *2C6712E1E7181694558C70EC067B62C7952FA61A LAURA FRAIRE
438,364,395 *2C69D615FC60FBCB0AC0947BBBC6074E352ABBC1 laurencegrantz
438,364,396 *2C625CA1136B1FBBAFC6D1F87C5B2A99BB8D2A7E VANVYNCK3
438,364,397 *2C60C474676422F3188B8F84BF60ADE47C2C9E4E genengin
438,364,398 *2C6E13AC2FE8103E8959051991A0277EA69FC5C5 lavernewatchorn
438,364,399 *2C6F9C656209F2A40BBF17A57FA83CADE57BD7F2 GHASIL
438,364,400 *2C6AA3F01A297F9D66B7A2A3EA217B9D0D930819 GIRAHDOO1
438,364,401 *2C60BCDAC5CDF462E71238686EA728843293D9E9 lenardkulpa
438,364,402 *2C62BC0FB2EB23D7F5DB2C1FB746DD06FC2D3383 LENARDSEACHORD
438,364,403 *2C6FB9358F60DB31CE3551D030EC3CF6ADE83775 LEONARD.MCKERLEY
438,364,404 *2C60029E1C29D5424C2BD1923E48D7AB9C5A50AC leonardo823
438,364,405 *2C6EB3E48316264801A2812F31D5BD6FC32A06C4 leoneldomnick
438,364,406 *2C60411E3F043436EC86C2A74E52FBD1E5847318 lesbaille
438,364,407 *2C6301E0EFC642DB0D70058C7897D746BB726108 VERWORFENES
438,364,408 *2C6ACD174665155342C7F47A1106908A5D207A04 LESLARNER
438,364,409 *2C66D8D9901E17491F978EB2441A46E5F4B7BFB4 GLASÖGONTRASTTIMALIA
438,364,410 *2C62CC020558BD85B93E26F276955F02F1E22684 GLAURON
438,364,411 *2C6F9D10E38D6D47374346C7B38E3566EEFCB499 VICENTA SANCHO
438,364,412 *2C6995F4A72A3BB2838A0FA56E61FA4DCC020E69 VICENTBW
438,364,413 *2C62705CA543631BADB05DF1660995362BB41CAA LEVERS
438,364,414 *2C6B42170ED9B270FC9E3CDE48A148FD5E248FFD VINCENT HAIRIE
438,364,415 *2C67E5B2A3859C0FB742A12E81344F6798F0B2F7 [email protected]#LIHUIO123
438,364,416 *2C692975AB7E94C06CBBF120066EBE6720177E39 GORDONWESTBERG
438,364,417 *2C648FF0716AFD3314E09EF505BB0CD62BCAD646 VINELZER
438,364,418 *2C63DB4126DFFB5509E532A9238898C2CE509A2D GRA$$1AW
438,364,419 *2C6BA9754BC6C086B6DF730EF1EC6E89E275F2B7 LIONEL.HAHNE
438,364,420 *2C63848861B5269101D2E924D2D459B961B5EDE2 GRAHAM.ESPADAS
438,364,421 *2C6AC589976A6D312FAF9FF2E24017EDE9B6A549 GRANTBESKE
438,364,422 *2C6BC61F01B3F6CAAAA7592FC657CB1DDD1AFCBF GRAPACH
438,364,423 *2C6F51037D00ADBA5002EE9C7CFF823E4D4ED269 vmyepxvn32
438,364,424 *2C669B9AABD7D84B353D24DE784C3A909F819E81 [email protected]
438,364,425 *2C6AC854CA4773FC8F6126DA7063FD636637CC17 voorgetekend8
438,364,426 *2C6D5CAF9EA525A625C00B5DBCF2A0B48F8ADB23 VR1117968192
438,364,427 *2C6E1B65A7E5AC9FBD2418699818CE664F9A9402 [email protected]
438,364,428 *2C6FA39F980B53E44F119D13286DDC1B3BBA20F6 LONNIE.KIKUCHI
438,364,429 *2C69E3ABA2686761B852633F7548154925CE7FD4 guadalupedrovin
438,364,430 *2C64F2E9AE577C1A1CE47D2C8D66E31EB38ED1F6 v.z:
438,364,431 *2C6A7EA00BDC731E73D444755901B704CC06EE09 wakeuptheworld:30(a)
438,364,432 *2C66EA6020BD84B9221047A01E4141A36942E589 lostmybabyfortheblues
438,364,433 *2C6DFF29B7339AAD48D7CACC2C3EA145EF1CC726 WANDREK5
438,364,434 *2C670436FA0DF464C0DFFD8A5B988456D0B55A79 WARREN STOCK
438,364,435 *2C656539B12230F7DB23A3B53E55A974B9261E2D LUCIO.EHRLER
438,364,436 *2C6D6F701DEF5B0C8907752CB1FB8D4BF3EB5CB5 HALUAVIA4
438,364,437 *2C640A5BA7C45981E94775A01224702005A19EED wayneflete.1.0
438,364,438 *2C68143160A1E47F9E2CEDDB837F5369035FCC07 [email protected]
438,364,439 *2C6145C9354482067DDDC50415BCD9C06DAB6223 LYNDON.FREDERICK
438,364,440 *2C61DE746279291EF1DD5C708361B06588014327 WELGESTELDS
438,364,441 *2C6AC4081C0BE7F74A19A79B26077E2951A71A6C WERNER.HEIDENESCHER
438,364,442 *2C6837491C1BC64D2AF0196B6D0E9FD187597EE0 WET-&-DIRTY
438,364,443 *2C691BAE5524BD88CE49CC0B93984F473155D8DB harrykuttler
438,364,444 *2C6F8824F453B58F1DF146D8325114AA15F8D86D [email protected]
438,364,445 *2C6EDA105A3ECCB274EF0B5F5111BBAB1BC3BC95 HAYDEN.ROMRIELL
438,364,446 *2C637EA20F27863E64CCA2A0D0CE8EA3E168DDF5 MAGPAN
438,364,447 *2C69074B6FE0C73F4530F06DCF2BCC4A3B6FF0D4 MAKEINSTANCE
438,364,448 *2C610FBD097B486673924FB314E561E92124F019 MALYVAN0
438,364,449 *2C6A7F0BAC9F89614763B75B9F54AE4D784F4598 [email protected]
438,364,450 *2C68A8CBF8A5A65810264CC58ABB92A9480BEC37 WILFREDMORETA
438,364,451 *2C6B10434E29EC6729A25C8599A53CA6B2DAFBA5 WILFRED.PYTLEWSKI
438,364,452 *2C660B78B3994567049A721A619B087EE97A6E5B wilis.omondi.onyango
438,364,453 *2C63A33CAF35DC3652882BB5AD9C0482454B1469 [email protected]
438,364,454 *2C6CC8816DFC2999DE261C41CBAF88E6CC36F3F1 maracayn2
438,364,455 *2C6A2E207D76B085165A69C803B864FE1624942B MARCELLUS.PERCE
438,364,456 *2C6A311BB4DA691C34DA4F4D61DCF4153737EBD3 MARCKONIGSBERG
438,364,457 *2C6EDC85550C1914998C0892B444CB5AA0E3A8A2 marcoceana
438,364,458 *2C65C2116BD50E1558094A139F5D9C3CEBB39765 willlankster
438,364,459 *2C649D1B926900DF92AC8ED8B7B4D3EE5046D88B MARGARETZAMMIT
438,364,460 *2C66EF7B2762EAB41E5F705C36235F3FB63E920D mariah.carrie
438,364,461 *2C61A11CDE02A4756391E4E225EED74F7A6A37DD WINSTONENDRIS
438,364,462 *2C6F8619DBFDD62B7CFA36A00B66C4D1564AC2BD winstonhellmuth
438,364,463 *2C6124F147256AFE1D1957120611B16EA8311D7F mariayorn
438,364,464 *2C66C02321AD952E5DCEEA6B93304834821196B4 MARKGUARISCO
438,364,465 *2C66FDB8D17308BD20ECCED9A2B814AC9C3DF926 mark-machala
438,364,466 *2C6FFBDB78F9F18554BB8BC53EE5B161445D5996 HGRNOTINE?
438,364,467 *2C62B8D3DDA0E91DFF6343A336A16F94FB10FE35 highprotein
438,364,468 *2C6AAAE5C144451003114527DD340BCE75CF4311 wong.wai.hung.stephen
438,364,469 *2C630389F4A5F8CECED88EAD6209B9B9BFB715EE WON'TGIVEUPMYMUSIC
438,364,470 *2C6D8AD942FE6EF9290B1144B83BBE0BBAE50149 MARSIASDESAMBIGUACI
438,364,471 *2C6930CED98A71C05BDC842B3725603C7F00F24D hnmbrncht
438,364,472 *2C6CF669EBECFF15CF204C7603E96B6FC047B781 MARTLIFNI
438,364,473 *2C6FF0DC38561AE3182DF1EFA392DEA3C10B4EA0 MARTYNNOTTINGHAM
438,364,474 *2C67E98CCB2C8272B9C6E36905E89C907862A705 MATTHEWBRUSSEL
438,364,475 *2C6EBAF445BC456AB383B916C2387F2629153448 HPARGELETOTENGAM
438,364,476 *2C695B0E8E3BA0E7EFCE80ABE4F57BCEB89F6778 [email protected]
438,364,477 *2C678029D15331D9A2D6FCC8AFBD75A5D80F4FF1 HTTPBPPWHARTONUPEN
438,364,478 *2C6A956F8BB422C0713E8D21EE3AAF5C098161A8 httppeoplemechkule
438,364,479 *2C64EF391A6164EF05199F258DBA1165307E942D HTTPWWW.ICEBERGPUBLI
438,364,480 *2C60C655F299E63335B518DDD336ADE3883764F8 [email protected]
438,364,481 *2C6B4EDA32ED25D70E33724FB521692E829434E1 mayton..m.ey1.t.ah0.n
438,364,482 *2C668B63C49BD157456AAF50F0081278CE53F658 mccomis8
438,364,483 *2C626841C8DD0399509F5B118E845B95272ACE09 MELANIE.NORIEGA
438,364,484 *2C66654D60FDFE5EBBE2B344B8BF777F38322C5A X8DR4JAU
438,364,485 *2C65831A7BA8FA02B68C03F5629DA5661E848F2C [email protected]
438,364,486 *2C691200D9A76439084E04F0B4933F8358B4EB77 HYLOTHEISTIC9
438,364,487 *2C666F72EE11C48D783C0EF863469D87547A6C9D IANKUNDA
438,364,488 *2C60E58E86C628FC92B3853401162C3CC9640974 [email protected]
438,364,489 *2C6335309C2F63134A5F9AC9B928A4FBE88AF259 MIKE.CORNWALL
438,364,490 *2C66F55F91958D41FC522FF867D80A08947D6A85 IFRAMES2
438,364,491 *2C66EF75B5BD0982B5392190D65A290789E5E6FA misdleading
438,364,492 *2C6E3962896882138D605A5441C0125238C68710 MMOEYA
438,364,493 *2C6DCADE6CB291D8D24C045170BE1A2BF9CF1CFD MOBILEBP
438,364,494 *2C6763F2F02724FE50D07494E8789DE980BDFD25 [email protected]
438,364,495 *2C688349302CE9E3786071F1336873800D420BB5 mohd-wahed-ali
438,364,496 *2C6253D1E383667EA9447EC98FCE69423926BEA4 MOISES.HAYDON
438,364,497 *2C6D0EE8A0761450786BA8BD42385C8D4488027C YOUGOTTHELOVE(EXTENDEDNEWVOYAGERMIX)
438,364,498 *2C62C0F6EEDA677AB03300D7B52BA671EFC115E5 INF3RN4RM33I
438,364,499 *2C6F1FA2AB4DEB2769CC45F379C2DABAFD96251F YPERVALLOYME5
438,364,500 *2C6E4475F7315D4F548B9E7A44F0E1DFE62D88BA MORGANHALUSKA
438,364,501 *2C6338C31BD2C0A3C5794BFC79A4ED8A7C098346 morganwillmschen
438,364,502 *2C645C6E7CBC07F60E6422B4D0ABD2F854BFA427 YSFFSIJVVC2
438,364,503 *2C61EA9C3F782E0FA7CD300E73C0D6CAC32D5679 moronach
438,364,504 *2C6BB6BFEDA22C3606D28FF1B3631BB20659870B MOSESKUZMINSKI
438,364,505 *2C6CA06AD5254E8438ACE7CDC87609F0BD3D365A INMYMIND(POORMINDALTERATIONMIX)
438,364,506 *2C61864395CDD7B299A5869FCA3D3803EB882469 YVONNE.DICKENS
438,364,507 *2C62A32B9CFD782BE0659B8BF14A372A5D1A0806 msbllng
438,364,508 *2C686D3CE9BDDF7BDF4F6BC7FB61BE147D5807EF i]pl
438,364,509 *2C6033DC9A687F8C13A950B7268887721FD4A90C zac-tupps
438,364,510 *2C622A341F84698FA0D0AFC013F6E1CAD815A760 murrayknestrick
438,364,511 *2C66A433F15DD252C8E4C9CC56774854E5ADEF93 ISABELLA SUNSHINE (FEAT. STACI) (DAVE WARRIN MIX)
438,364,512 *2C62CC494A5AF34535F0624C0C68BF006044727A ISIDROSAINES
438,364,513 *2C69591A9967560AAF481C411A2EDFF3FD4EAEE2 ISIDRO.SPARLING
438,364,514 *2C602706E4ECE479BE22EA4613A3C5B83C80ACEB zaphodies
438,364,515 *2C67BE12D21B13B83F78ED8EEE147588D0196B4F MYKINDOFTOWN
438,364,516 *2C6A0A7584E9D6727456944DB28DDF91A9647560 itsizzai
438,364,517 *2C627D0B46A3D410E774BBFB3A8F78913693B9BF ZHULIANA-RAMA
438,364,518 *2C61D8863E4A75B294094396D2D4885E64142B05 IVR31
438,364,519 *2C6EB09B647BD307A342AA3F6E21F09B04460E2F N1D8GB
438,364,520 *2C6E43835AAD7320E1CD96DFCBF984A1007912E2 n$7abl7e$
438,364,521 *2C6A7B557B628EF10BCD2795A79983122DFD52CC nagognimé
438,364,522 *2C662504D9EAD9151C32D43474D243B754A05260 ZOR)
438,364,523 *2C6864DCF7493BA90C9C0F3C68E23D36E60260C5 ZURUECKGESTOS6
438,364,524 *2C650BDB9CD8510766B75DDE5E91E22357962912 J4H4N4MDIN4MO
438,364,525 *2C68D921B1862509A3E8524B02190FEB9B1163C4 nathangolfer
438,364,526 *2C672DE4DA0FCD1157BDE86A1699CC9F9F69DF83 nazireich
438,364,527 *2C6EAF376E8D942F474EB299AEF8DE80C6949BFE αλάτρις
438,364,528 *2C618243CDBF8D630EED439ADEE8EBB0664A808E ΔΉΜΑΡΧΟΙ
438,364,529 *2C60B561DDE3F2403171A3B032867395A826D3D7 jaimeklann
438,364,530 *2C6D474BC7AF1EA24D7D9F88E8DD5204568F145C JAIME.LILEY
438,364,531 *2C62FB9811A5D922643EA6B36147AE0C34066C0E ἀποχωρήσαντοσ
438,364,532 *2C6BBE2AA0BB810B0F1FE940943D1C879E201AB4 JAMESPICUCCI
438,364,533 *2C6C47632DA7D7EB453ABF4DE5CD22F72E7CB21F janfulling
438,364,534 *2C65C543FABA0C980FE3162C34887A33B7657A85 ГОЛУБИЦАХ
438,364,535 *2C64607EBF39D15060347979FF768D97AFDDD610 NERONIAS
438,364,536 *2C67E7FF7453BE9ECC35AA4DFBFC584913316C2B «ЖИТТЄПИСИ
438,364,537 *2C68FD6ECA875AA9F9DDD63C006CF61A57F1A5F5 NFIERIEZ
438,364,538 *2C6CB0784900F1D335B446B74AC76DC3CD378041 jd{3
438,364,539 *2C646CFF447BC7FC8074C0AD469C16FB5857C180 NGUYEN-HOANG-ANH-THU
438,364,540 *2C61DFE9EA816D272B67111AC6C51F92215C517A «МОРОЗОВ»
438,364,541 *2C67C8C2397AF831D807255438C5BD60D0318547 JEFFERSON.ALPHIN
438,364,542 *2C67BF6F7FFC2E08962D6845C5EAB8D9EB3557B4 JEFFREYGARDEN
438,364,543 *2C644FF359312DC449A6DC4DF84533E888B236B8 JEFFRY.STRUBBE
438,364,544 *2C661091F3F5D0C36352E1FBDF00222AFB894811 JENNYB
438,364,545 *2C6EFBBE1C3246541950AF71FDA90258A96A5A36 JERALD.IQBAL
438,364,546 *2C69A2587AE4521A339B88B172545A9FCEA17D52 jeramyklees
438,364,547 *2C6EA95BAAA3551BBF7897C3A806594456F26901 [email protected]
438,364,548 *2C637F48B888DDA48439A7075F5BB9E954E906CB JESSE-ZHA
438,364,549 *2C647EFE4E2F030F7B2D52DAD95E789B784D7F67 уводници
438,364,550 *2C6DCC94C1330364F7744712043428DCA6B2B82E JIMMY.SCHIEFELBEIN
438,364,551 *2C68E0EDF3424961BC19EB6698CA7E1EEF5F8519 NONSYNTONIC8
438,364,552 *2C6ED34BCCD5C75B569D28A98B7B3C96675AEE20 [email protected]
438,364,553 *2C6CA2BC5DD647624D1B3DD31098785ABC43A52E [email protected]
438,364,554 *2C615FFA4C78A7F47CC358E99DC015137B00BC9A now that's what i call music! 10 (disc 1)
438,364,555 *2C62DED8F56A5E3593505239F0C0FEA0C15F3F0D joeyhanebutt
438,364,556 *2C6BFCA1015E9D1F20CDA12A02CC2DC00630F965 [email protected]=
438,364,557 *2C69A5204DEDC4D94AA8F2A50631FCA4697E367E JOHNNY-WALKER-BLUE
438,364,558 *2C6A48B510ED6C06273CE16F60F55EDB76559CB4 JONAS.DERRICO
438,364,559 *2C659D19257A23B20D3392FA8AF14FEB1DEA452F jonathangoggin
438,364,560 *2C6EF928DE5910405942394542031B5A55FA3036 >-<o~0~ (#p
438,364,561 *2C6B5F831CB18A980F7D5ECABBBA6312E06DD5E9 JOYCE-XAVIER
438,364,562 *2C6F4DF36548EA2BC40BB9B38A39892D7ACAA073 [email protected]
438,364,563 *2C660E1EF64DD0C5F36A7816C7C63D03D2577015 jr8b
438,364,564 *2C64EFDB04F5AE14D95148A9E85193DD8B074D4B ある意味で当然と言えば当然ではあるが、ja組合員以外でもガソリン・軽油・灯油などを購入・給油する事は可能で、交通量の多い
438,364,565 *2C697DD9F419C2B20DD9D906C37817681EEE0BEE JUSTINPAPANTONIO
438,364,566 *2C69FBA7426872A8A4E517E87845E3855E377F4B [email protected]
438,364,567 *2C6CCBAEAA18B9137D732EE2321857E7C319CA7E 晶片為atari
438,364,568 *2C6A0891077B13DBBBA4CC8F62A5A09BEAE96ABD „kalenderonkel“
438,364,569 *2C64F4E9B5E80F586608FDA5A8B55DEFA0542386 orvilledivlio
438,364,570 *2C6E0D4384BA5CED84781A22EBEDDAC4F8D47E56 overpopul471on
438,364,571 *2C668FC6F6548AA97DCE07BB57CC47788D292A3F KENDALLBELLIPANNI
438,364,572 *2C6DA061990447C08E19D1D919F8470CDD2E24E8 01241604
438,364,573 *2C6900AB0F285FDD7F5B6C831B0B55CCB254699D [email protected]~0~O(00)
438,364,574 *2C6D9E00994FCF9CF005993640BD72A6A7F4DDCD KHANAWALT
438,364,575 *2C6149EC8C34FCFAB580A1A9A392245067A21B3B pālgaon
438,364,576 *2C60719F22E125EF618CFADDC93ED66C7E4F16B8 PANCREA`TICO
438,364,577 *2C6156942FE624E7C17FD4F137525CE952ABEB98 kiethtutino
438,364,578 *2C63A0A8349B36301BF2BA1B280CDB4FC7B46ABF [email protected]
438,364,579 *2C6AA4B6CCAC16878BC7FD4C6F989E687D2AD146 paoloangel
438,364,580 *2C6D575266EB7A046AFBB7E87E062A3CA7F6FEDC KING.MERMIS
438,364,581 *2C63A40F122092A62DE6636867AB513F862FF5C0 KIRBYGOFTON
438,364,582 *2C68B6380317094BBB787D4F3642ABD45D222858 KKORACL6
438,364,583 *2C6C39A9CAFEE1923295C8C65C10C2E1DB56FF8C PASQUALE.MANAGO
438,364,584 *2C64FF92AC0C086649DC85D3721181A0689C9B77 kmr,
438,364,585 *2C66F44EE73B10F9BCCD3FEC2E51F855517AE270 knb<
438,364,586 *2C628A46CD28AACB9FCE0DE55795D3FF6DD46F79 pci0000:00:011scsi1:0:0:0
438,364,587 *2C61624AB6470542F247BA139437A0D228793E11 \-/11,8
438,364,588 *2C6415384012B71307EE54D25B5F6011EE36993F [email protected]
438,364,589 *2C6CA92BA6426BEBB8FAF6501977AD2308830F0D PERANGKAP
438,364,590 *2C650DA3CE9032F7F5CE8B5267F89AA07E0626C1 1429820 LAPIN.LUONNONSUOJELUPIIRI.ON.OTTANUT.TAVAKSI.MY
438,364,591 *2C677CEE36BA83587D02F84523D4CBAA6269812D KÜCHENÜBERRASCHUNG
438,364,592 *2C626F10A1916F0CD6DB1E46011E3C7B6987DC7B PFESTEJO
438,364,593 *2C6A1E39C061E4F929DF67117EADFAA4D4EEF4C2 1663044 PRIVATE-MORTGAGE-INSURERS-ALSO-HAPPEN-TO-BE-SOLVENT-
438,364,594 *2C6144B2FB8F86EA5320E335B8AD3E743372D933 1686816 kummastakinjoukkueestan
438,364,595 *2C677410983E2D6B3DF3864F2AF27AD5631036EA KWESBARE5
438,364,596 *2C6CB1B07930E91FDA01AF788A3F18E328B4F606 19948 entinenpelaajavalmentajakarimattilavoinytkeskitty
438,364,597 *2C68DD543D6F34E63694F62CCAC5A07170EA6897 l4wmembe
438,364,598 *2C6AA6AC2D88C2AF3C2D1653FEA0F7190A7B6BE8 LABBIESELL
438,364,599 *2C62D94F0BA6011BDCBEE0235A8790B94400D5CA [email protected]
438,364,600 *2C6F8DA8661808D0A2D62E8A0B563A25D8A0D345 PINGPINGM
438,364,601 *2C6274308C6DC94CB210DCB969562E80405D78FF [email protected]
438,364,602 *2C67FC9F9821A65ADEA865D89870306E88DCBF0C 1derg-gewinn
438,364,603 *2C6E2399236C92F399A6AC2C7BEBA9DA7E184807 1-EISKIOSK
438,364,604 *2C6306E2AA7A2507E27987670764253C6F6A6D16 1.FLOWER-BED
438,364,605 *2C61165D9AAD5A5A79F3D2652CE5A861D4A0356C 1grievanceeven
438,364,606 *2C6F85A90E756573CCE17D3053ADBE09C50ADD8B lately-(riley-&-durrant-mix)
438,364,607 *2C665B18A0078A8FEFFBC5D44D3B3EC4ADD200D6 LA'U
438,364,608 *2C6AE1FD82FB1DBFB363FECB1D492C77D575F0EF lb3h
438,364,609 *2C68CE728C9F72E54E659C9A5B84B36FFC57F328 POTESENAED
438,364,610 *2C6830EAE494F17514F17073AA7786F06FEE0FF5 LEEWEISHIN
438,364,611 *2C67E53405C5B0AB9DD10FC4D64E99511418CDF5 LEIGHMELLING
438,364,612 *2C6E50A037131BEF5E987BC441D5136043792FB1 LEONARDOMCVAIGH
438,364,613 *2C666A0399ABB13ABACBE12886B73B7DEBCDC452 LEONARD.SCHEUERMAN
438,364,614 *2C618A54454B50D1EF46A9B9C46CC930BFC90365 LEOPOLDOHOLBERTON
438,364,615 *2C6CDB5C1554A8C942561D42384B352B9A856A05 ppvteqqh
438,364,616 *2C69CC046D0F8DA8E0E07518F9AC7DCEF5B57C7E PRAKASH.KANNIAH
438,364,617 *2C6754A658856395F1304531F9B85119F719B433 PREFERATA1
438,364,618 *2C6BBCE5706EF406364404EECC145298DE00A6E1 PRESENTATIONCAS
438,364,619 *2C6081483CC1A20A1C1F56D9C38CF2B1FA136456 LGUTTENBERG
438,364,620 *2C60E314118BF51D088D2E7065E13A2A2441ABCF 1-REPERTUAAREJA
438,364,621 *2C6F4289143F43994CEEA5B8189495A1F186E17E LICOPLAP2
438,364,622 *2C6ED16E72C660679544300493910441129B4FF9 1 SCHAUSPIELER-FAMILIE
438,364,623 *2C68F100A947ED54B49B6420292239520B4EEB1C 1schrittle
438,364,624 *2C6B36AFA5C760EF4776D36EF6ABAEE00B1B9B07 lil8hoti
438,364,625 *2C6E7F31A94FBE8F248F08526AE61CFEB3ABEF62 1teemakarttasarjaa
438,364,626 *2C6F27521E84E256A83B014DD628D6067EE5EE8D 1.vakuusj
438,364,627 *2C6DB6596AEA28698FD8B46358A4064DA06F1874 1.vurgulandIGIndan
438,364,628 *2C6B4A13EA7D0C4092E946D3506ACBCDB8F6803B PROBLEMAS-NO-RESUELTOS-DE-LA-INGENIER
438,364,629 *2C600038FA732AA38ABB72F7565AD03B6F9B956E PROGE7747I
438,364,630 *2C6C0B97B76AA70F74429E2FC629B2AE26AAC15B program. if it is reserved, the program checks port 2001, then
438,364,631 *2C630001003C0815948EFF21201CA279E9B5BEA8 200203:bbcradio1session,wales
438,364,632 *2C6A75998CC1766D93F4E6A90F9316ED29BBF513 promethemountain
438,364,633 *2C6087579B8BF609FBBB89555C33456526A24327 LJF1963
438,364,634 *2C63A4912C29E0EE6E66CF2697245F7237AE8050 lleztif3
438,364,635 *2C69CA5FDFCF3DFFEC2DC5AE342334FB11CFFA15 LONNIE.EVILSIZER
438,364,636 *2C6294F610121F475B3ABC80A7C45A24978F0E0E LONNIEKONAT
438,364,637 *2C604476F229E628B30FD4A088E59675FBDFAA39 [email protected]
438,364,638 *2C67C73E769CD6DEBF2754EA81BC6285CFFEAC59 2358867 DOWNSEMINAARIAVIETETTIINLOKAKUUSSATAMPEREELLA
438,364,639 *2C6807B8616F6538610A0C0F12EEB3C5237A197D [email protected]
438,364,640 *2C6540815110505AF7AE7BAF81C81FF625017B99 2445532 erjan ajasta menee nyky
438,364,641 *2C63CB03218BCFF7440645EA1FA166DAA4AF527D LOUISESCARCEGA
438,364,642 *2C604DD01A09C463809C6D578A15C063B0951FF7 [email protected]
438,364,643 *2C6BF99286AF7D70CEA8890F11EB219B55976C51 ltpisem1felcvutczg
438,364,644 *2C65B6EBDF0D7F12189360AD272D577192FCCF90 quintet-in-f-major,-op.-62:-menuetto:-allegretto
438,364,645 *2C6C49ED4BBC2E3A21C50C90E99337AE6035D8EB QWA]
438,364,646 *2C635DC5DCBA5024450A9033E5A7CF815BB76A79 Q?Y6
438,364,647 *2C631693CEE25039C6B539F4231E9A3EC99D2CC8 R4OP
438,364,648 *2C620635B06BE461F430C7C526F4D49C4CB5A110 rafaelmcruz
438,364,649 *2C6DFE6A3B97ED084BCDDB2F86F1A45881CEFCFC ragnarsd3
438,364,650 *2C6F9B29492D5F86D8AB5E95395B74DF6FE33FBF 2GESWEIN
438,364,651 *2C62A0234BED07A37599438E7D7938CB2F0F8CDA 2.GRUHLS
438,364,652 *2C60A870845B6814D7A4BE84ABA78A50242F4CC5 RAMONJUMP
438,364,653 *2C64FEC93982F0D4617A9C209170D7D0FCC23745 LYNNJ302002
438,364,654 *2C6EFB63EC51AD49E21CAA91249118403690658E 2ilovemoney5
438,364,655 *2C6D52A96160B6F2A496DCFA6169DA21F052360C M1192035688
438,364,656 *2C69C7C25C047F0AA388AFC447ED3E24854CBA67 RARELYAWARDED
438,364,657 *2C6FE02EF398B1A5DCE3672EE07556BA2186252B RAXQBB
438,364,658 *2C612E05404280DBCF20F0AEBD0F8B3371C49878 RAY.ANTHONY.DELOS.SANTOS
438,364,659 *2C674B7D1A0C343A62DA933B970A0E076D573E91 MADELEINEMAGNUSSON
438,364,660 *2C65CC0B87FCE0F4E676A8A137F04787FFDA1044 READINGREMEMBER2
438,364,661 *2C6467B2BA970E370C46070589F24A848AA4E9DB [email protected]
438,364,662 *2C652227E6DAD7B3D56B1563418DB229B19947C1 2PRENUPTI
438,364,663 *2C6F8EBF90D2ADA46CD8C4C390C48F4521A6EEC4 2PRISEDAL
438,364,664 *2C6B63A37BCCB6203D62D08B7B28F070A87128ED malikoyer
438,364,665 *2C6A265D674C56F1C0D5539BF9AC4563F4293775 malinconia-d'ottobre
438,364,666 *2C69E874984FAFBF5C63659AC75D2838C52928A8 2.struckman-johnson
438,364,667 *2C638305C5D59FA74E30C9AE79BCC8D0ADD57DEE REDNAPXE8
438,364,668 *2C6B30B610B4A7AFB69CAF1651C3D48D3425A1D6 2-ULOSOTTO-ORGANISAATIO
438,364,669 *2C6FA1C9492B2DDF4A6EA66101C77EDECB54678D refaisant0
438,364,670 *2C695352D505CBD19A3F1509BDB9F97B5B0A480E 303542 ihr-sohn-verbannte-die-nagelschere-
438,364,671 *2C6C7F5017B0EA2435F146402B70DFD08F3785E6 308tyshawn
438,364,672 *2C659A40F6950E16E82BC08C8B9769D6E7C888EA MARCODEPIERRO
438,364,673 *2C6D67F2164598DE44C89C078CDFBBB077383A98 MARCUSTOUT
438,364,674 *2C6BFB44290E7DA00542E779B2DFEEDD50836DE1 REGENERAENED
438,364,675 *2C68326DE95D893F16BCA0CBA6D627C04910F5F7 margaretkan
438,364,676 *2C6672525E5F05014D9400E703D72F3B962FCF55 378692 mahdollista.on.my
438,364,677 *2C6007EC93479844BE24088C3BACDC97224E63BB MARILYN368
438,364,678 *2C65E435876D551F8ECD5513A5FA47D486099FB2 3b< o~ (=p
438,364,679 *2C63DDE0A9ED287BA3F20ADFFA2F0EF77EDA9C50 REJUBILASTES123
438,364,680 *2C6B7606EE6A23035CA950C1C57A409125397BB0 REKUSHA
438,364,681 *2C691CB84A4D616E43A3B9752891FEBAE56C4AC3 [email protected]
438,364,682 *2C6A4C9DC18C183177553D67395A44C1A2FAD3B9 3HAMMELMAN
438,364,683 *2C63148AD81C399C0DF3C498D80B84CF705710FF 3ILUVWILLOW1
438,364,684 *2C6CEF1C095C0562B9CAE22DC3D5F64E741D3BF5 marshallhidden
438,364,685 *2C6BCBACFD34D33349D2066C87D0CAA604823E66 MARVIN PAGKALIWAGAN
438,364,686 *2C6B96FB1E67075421A647CA588D68AA8035FDB4 MAURICEU1
438,364,687 *2C6E5B78D7891BB6602084FFAC8DC6483A7D6333 RENE.PLAYFORD
438,364,688 *2C65E2C75AD77138BB034EC999F050C1FF6BFB98 3NINTHGIL
438,364,689 *2C6648EE82C6F46C17B2DA76B558FC744E9B716C [email protected]
438,364,690 *2C6689E39D08CFECED05265231FA8A457C668F21 3##P*-*-SPLAT
438,364,691 *2C66888BCECD8CC2BE535FDA97471ACC9FB37583 mc-fish
438,364,692 *2C68C1D00B3449AF27F424101A8DB42594741711 mckinleyalbero
438,364,693 *2C6717E7570C28EBFDB6CEE60E11D1D8D2C9C253 MCKINLEY.MACCULLOCH
438,364,694 *2C6E859F27A27BD86CB8F1774867A584BCA33B6C MDKZRIC7
438,364,695 *2C698F41CF820D10C9448688F63B56398B51FCA0 medejoandar
438,364,696 *2C618A5CDB0C99309037C9A46434A648DB267F5A meghadamani
438,364,697 *2C676E8EAB4826B67709FA8C1109C9F56A9F0CBE rgennegrs
438,364,698 *2C6778D0914944D8DD59049713116BA9A4B2668F RHOULAZOAR8
438,364,699 *2C6499E5BC3473CA8FFA85B485CA940B781F5568 RICARDOSIDOTI
438,364,700 *2C605EB81E3EA4D5306C5A562AAAA878F6627EE4 merrillwerma
438,364,701 *2C69238081552A33028B3FC8F78341CACB9EE385 messa-da-requiem:-dies-irae:-ingemisco
438,364,702 *2C6EBC9E1FF97213632CBA1188F78F0D51D72390 MHQB1
438,364,703 *2C6DFA829D59A8B1394940284E21E598DD1CA5D3 [email protected]
438,364,704 *2C6DBA72F05DCF639CD8966C29C08CE8AEE5760F michaelfahy
438,364,705 *2C60694D68D19292235713F87AFEF3B03EC96B35 RIESELSPEICHER
438,364,706 *2C652F85D639E649EB82707E22C47B7493CBDCEE MIKE CWYNAR
438,364,707 *2C610F250F4CD44DB9AB16434635CE5C51FEFB20 493191 the.suit.was.filed.late.last.thursday..
438,364,708 *2C65756C4A771D990C17B6C8D24A2D9A7AE635EE MILFORD.GLEATON
438,364,709 *2C6836E5837142D86C1CDE2657C3474DAF423A32 MILLIONMILESAWAYFROMHOME(DJMANIAVSTUNEUP!RADIOMIX)
438,364,710 *2C6B9EEAB063762B1BFC105056D05F5ABB41DB20 robbiewormely
438,364,711 *2C6D6730AB0D97071B664A4BB02F8F5A3457B861 ROBERIONS
438,364,712 *2C6178F421D025E95AD3B8072C2535BA3DEB0E63 4JOJOISLAND
438,364,713 *2C69810968D947DEFCD82B8AB495AABAC8F9C3A8 robertmanley
438,364,714 *2C6F7383F913886C62239FDFD0494F82594D545F 4METILJU
438,364,715 *2C6DAB35B8A14594BCF5761AD266D51519DB0974 mlohavi
438,364,716 *2C6C9EDFBDFAB9665C704979E01EE635413B45B0 ROCKY.MILBY
438,364,717 *2C6C7AC0B57280115F738B48709939985C0E6B3E [email protected]
438,364,718 *2C686541B7F82DE14CE6EAF272FD59C44E759066 mohammadfaatehshamim
438,364,719 *2C6353529EFF935D947050AED08F86961D877E8D MOHAMMEDENFIELD
438,364,720 *2C6C592C5950873C439006AFB691278851861F52 ROLFLARRICK
438,364,721 *2C6CE360B89F78913A8598F8BA98113DF605407B 4ROPINGH
438,364,722 *2C65E518ED032BB16BF3BC4E27CC3C6573F6117F 4SERTIE
438,364,723 *2C6D7C89A7F984820DD98F727FFBCF58B4D995E7 ronaldnaschke
438,364,724 *2C61C44FA23F35EB4E13C9F65299E8F1AEBD8D8C 4TAAIRATE
438,364,725 *2C6D16CAF14B3017E38D37BFBB039252DC89D60B ROOJOHNSON
438,364,726 *2C67DF05D276300AEA8DCECC4F682D5283374BF4 MONTERONI’S
438,364,727 *2C63E3C4CB0A8324B32C9C23E63AD79BEDEAE77D ROSHANA-SHIRZAD
438,364,728 *2C6D9EC9831D3FE3DEFA9F140FC27D69485A3C4D MOON1!GHT3RS
438,364,729 *2C661DA70FCD962A73F8C1AE11AF7543511E1D18 RPAGRAHE8
438,364,730 *2C657262D401F005459F60970A5BA39ED5088AC4 RSTLNGBRL
438,364,731 *2C694A5A30A9D1965E287F1227280F8418967CB9 ruatnec3
438,364,732 *2C6FBDAA815DD4A4A39F7C58F085E7CCF0174C5D moseguiao
438,364,733 *2C664B577BF7A30D863506C0A646D2E76F090FE2 570YARITZA
438,364,734 *2C6CE364F2D1EE134C55C5178F54ACA4E1806133 MOTORIKE0
438,364,735 *2C690B1C8786EB238FF337C5C613C6758AD22EF0 RUFUSBOECKX
438,364,736 *2C6A80746DDA67FD82EEEA6CEC1234C25B69EC87 5ANTIPURITANS
438,364,737 *2C6BCB694DFF407A1C2020D4628119EDAFE40789 RUR41I+IES
438,364,738 *2C6E93CDDA6A4FD368B12E9D556E9E64ED10C26C 5BSWRINGUESK
438,364,739 *2C621F84F1CB0061D674FDFEDC10D8484B921583 MUGARTECHE
438,364,740 *2C6158D8EECB1FB89FCD7A0EA6F80A2C597E6851 5DGRIMBLAT
438,364,741 *2C678727B36B10CD0ACF28ACAB5EE387EF6F5F6F [email protected]
438,364,742 *2C61C6E75FAF2A3ADCD8448EFB7C2A13A05FFCB5 RYAN-MORRONE
438,364,743 *2C649542D5C634FDB5D31783CCD1B2227645DC9E R(-Z
438,364,744 *2C6C19535020B9693912822AAB41C89C60258313 S=/*
438,364,745 *2C6575EAB954EDDB769FD5352C29EACA575FBD8F [email protected]
438,364,746 *2C68DDF98143072DAAA21DC20ABEF85997AE11AE S3PTIFOLIOUS
438,364,747 *2C6767924A766B0F3143855C48A01E11A82FD0DE *SAFE*
438,364,748 *2C685967AC6A842C140C8CE69A5821DF091746C7 salmabary
438,364,749 *2C67F72264543400DE197303A91F3953A2B396EA MYMATT
438,364,750 *2C64B54934EC1555DDBF3E9904004963BEE90C4C samualahrent
438,364,751 *2C68E58DA082759C5DF1736C8BE5F1DB691A0EB7 SAMUELMERRIGAN
438,364,752 *2C68E74013B9447F824263108C1C7A18A59D5B13 NAAHPMEK3
438,364,753 *2C6CD12A541E6FC809C36836E91829364EE60725 nadsencu2
438,364,754 *2C613475AB4796A5D58B51614FF962D81B51BFF8 sanierriv
438,364,755 *2C6A0DF304AEF3403F3955A454D1E40AB231BE56 NAKENJA1
438,364,756 *2C6564505BD86DA89A0BB61EB117B0AD37B58601 SARAH M HOWE
438,364,757 *2C6AE463430D584A82C0F22ECFA3A315E7DED77B 5SCOOBYPICKLE
438,364,758 *2C69195A15062EEA6B22F1449E4DCCED720A9FB4 NASLUND7
438,364,759 *2C6FEDE075134779076131452038466CB37E801F 5TILSIKRENDE
438,364,760 *2C6FF84730BBC596E352649278272C310EA85B85 SBVCCHVN
438,364,761 *2C6354CF0B09A421E2E8C23AFB57BB5BDDFD216B schneidarme2
438,364,762 *2C6A6631E863BF8F9F4C5D5AFF3DCBE054C58AEF sectionsquasarte
438,364,763 *2C62EE29A0A81E676AEDF69C1FA9CFCD5F73CF4B sedam 16
438,364,764 *2C6A816B797A2EB5922EB45F5E542B9D812EBA28 6BSWGIOVANNETTIBSW
438,364,765 *2C6D958BE1087CE86A91BA85EB39F152325C5B2E 6.calida
438,364,766 *2C6BFA23D8431EC33C1E672D02AAEE0A307B6CA2 SEMACODESHOTCODESMS
438,364,767 *2C62258470DF81D32E162FDC32AAEF1174EB1803 6ELLINEDU
438,364,768 *2C6B6DBAD2FE6496E30E5CEE37A45C91CAA20609 6FIJNGEHAKTS
438,364,769 *2C621E47E1D0ABF3B896A62DBD2708C8D4A4F6BB SENSU
438,364,770 *2C6BA1F8AF0CF854AD4D2E5DC8D921B1086FEA38 SERGIOSIGWORTH
438,364,771 *2C66CE6E04AE7C9857EA74567DF6A8B59033E0C8 SERVICESVIVASTREETCOUK
438,364,772 *2C6A32ED3ED2512B36A7D981A3ED84C135A6EA37 nickpochiba
438,364,773 *2C663D939D82F59555C85EE737734E754CC8551F nickzieser
438,364,774 *2C69BBF0034B160F24B520EB3AAB36931935F484 6MESCOLASSIS
438,364,775 *2C68754E72481B8D6DE17D22C846EC5970AAF312 nikoskaranikolas
438,364,776 *2C6351874F061CC88DBDEC7E0F7942D390337880 NM_000448
438,364,777 *2C638DCD619C872ADA8D7AF0E2CFDA13A3874AFA SHANEHANTULA
438,364,778 *2C6F94C22E9553B26C2FE69E2A5526A8097E0A04 SHAYNE.HAHN
438,364,779 *2C6AFA8C871545D1B34BA994286213A998B0624A sherwoodbancroft
438,364,780 *2C6FAC416376BC4A7E6EE6CA6917D16834EBE5D9 6TRMTPHL
438,364,781 *2C68C007E81903BAD2FC68BF5AB92F7975DFA060 nondeterminativeness0
438,364,782 *2C69DA38B9AED828DA08E7C41174DC3F4F3E429E norgate7
438,364,783 *2C661B9070CF7E2F8005AB87FACF6C3977C4B97A sidharth-surana
438,364,784 *2C6ADDE09F4F66A61B4B1DF23ACE7941E34D1C39 notusedkathleen
438,364,785 *2C638D93C1765B74D904BDB2BC8627F3C1D5854F O4KK
438,364,786 *2C607FB94B296BD078327B5A4B7E519E92A0A86B [email protected]
438,364,787 *2C621029B2E1696CFB80893693C0AD98D26BEB32 [email protected]
438,364,788 *2C614C00DF41B5D677054F83E64AC15E15A85B3A 7LEVANTAROS
438,364,789 *2C6EB0A36CA123BD4EF1CD30510F0E1B80558D54 slijpgelden
438,364,790 *2C6FD17D4B1753F6A2B15CD73100EBBA18F1FEF6 odie3
438,364,791 *2C6BC9FA3571F596432888F4CFEF21A008D6FED9 okc?l
438,364,792 *2C6C67130FA6925E758DE4DE114D3A7840060A59 OKであれば記載する
438,364,793 *2C657533C2017782DF575504AAB05E9DC5AD93CA 7SNOIRITS
438,364,794 *2C66F03105B7C6C784BFB59AA5A7BAB47BBBDFFD 7TRANSPIRATIVES
438,364,795 *2C68EF48BBCB7707BEE2436844494B66AB588544 sonatano3infsharpminorop23-drammatico
438,364,796 *2C69AF8E9A7379B183E00CA774A99A9CB8DC666A ONTOCYTOLÓGII
438,364,797 *2C69840C1C880B794853D13CEA20BDE5EE72AC26 sotnicamelttil
438,364,798 *2C6BF4D5B4DF3B0E98023EC5BE20B88573C99612 OPPSITTEREN
438,364,799 *2C6E2997D8815F937C0F60F1DE097A05951DD84D 86C0
438,364,800 *2C69F83987401971A0912DFC4897655A57802CAD SPIFFERONA?
438,364,801 *2C60670A50FBFAC21034F6207608A5DAA47B3A97 SPLAT!!~`@#8
438,364,802 *2C686C20951AF105EB141090796BC4F740F6CF33 splint-bottom
438,364,803 *2C63BB40D4EAB24FAD62FF0135C362D0DBAE0B02 8FLUFFYBENNY
438,364,804 *2C66CD7EF21457B5CC01D9C6470E65C6CB4E6708 P1REPLACEU00B2AMPSU
438,364,805 *2C69DE94CE2CC6D633DA96A348135D5828A10515 8INSTITUTIONHE
438,364,806 *2C674C47F3B70477707401F545C174D46C99135F 8JIMSCOTT
438,364,807 *2C6244580D772B40783E286148855A0B56AFEE72 P4RRENDE
438,364,808 *2C6C23554CE260778108B10C5D066EBC2AEC7CC2 8.L
438,364,809 *2C67A3A2D5E0BFEE3C4AD1C1BD1169AA81F09CCF pablodowding
438,364,810 *2C68CA42831B654E9630E56A7DCD382CE7434F63 PAGANIZADO1234
438,364,811 *2C60BE8D68F164A90E79833630F761019EF578E6 pagebillypicture
438,364,812 *2C66C27961D2E08493EE4D4F45C2C5C003F55334 8NTAJILLA
438,364,813 *2C67887BC40EEF31C75F0C2B707176B24D08BA62 }8{-o~0~q###8
438,364,814 *2C654ADF452A978EF19604025E3874F8925F5ABF STACEY.IANNACONE
438,364,815 *2C694FA1C6FC2EFBEC30CF5BF4E9F027CD1D18AA PAPISMO4
438,364,816 *2C69DB65426D02564E84C5F66BD4D84796D4C186 STATIONLIPUSZ
438,364,817 *2C695CC15A39F68F29890163CB0700D844088A82 8THEVICTORY9
438,364,818 *2C6A2FB90D9F91CCB704AC749A13984262C0C1A6 991278 TARPEEN-OLISI-KIEKKOVALMENTAJA-MENI-H
438,364,819 *2C642E20D5A575AE2F7D3BB0C1FABE78CDB41BD7 paul-lamborn
438,364,820 *2C603ECF4F5C3059B01E0EFDCC26EAC5006969AE stefanie.haynes
438,364,821 *2C6D0D80DF241C77C34217889782DACBCF564074 9BSWDDERENCE
438,364,822 *2C64DA20D84385E5FCAB944E8070DBB1CD937F6B 9BSWDREZACBSW
438,364,823 *2C63DF3D9B942AB6D3CCB3A649F3DBF7AEE05550 9BSWEUROPHILEBSW
438,364,824 *2C6FCCD2419CCA2F0E00539A3387ED8179815562 9DEPENDIMOS
438,364,825 *2C6D9F3CCC273D8B23A99DEB4E79D122E2A3F497 STEVEN BOZINOVSKI
438,364,826 *2C6C3ED421E1B89DFEDF2927C20B782AE1506FB8 STEVENTRAVEL
438,364,827 *2C6B811925B5CEA47801B4A87DDA4577E6C1C6B8 [email protected]
438,364,828 *2C693CFFB95BE167A36A6D005097E4FDF9231008 9MUCKSWEATS
438,364,829 *2C6F260121F9681E6DB72411599E453DB30E3B1E STOLONS
438,364,830 *2C652C088F9DC20C878832BAF80CE65C99F9E9DE PETASITE.GIGANTE
438,364,831 *2C60A672A93D19E10F2F9CA7B09F3946FA55CBB2 9probenecid
438,364,832 *2C6F38F484F6027B51AB232484B5E5B07C9810E4 PFLICHTED
438,364,833 *2C6F5415136763B166D950009F92F613DFE21053 9TODAYPOWER
438,364,834 *2C67EDCEC83F8FE8F46B8E0AE487D6817AF38EDA 9transigeant
438,364,835 *2C60BD21AA681D8EFBB2BFFB8D34F862A3AA31FB A7GOU
438,364,836 *2C6E37168CC9A6A0B9BB6E5F7D0CE9F9E205E446 PJ-ESTEBAN
438,364,837 *2C6E6B293B5F19CAE018B1275972551A94D7C0AC sungpuzo
438,364,838 *2C60E8148FD8E15DEF202E5C574AAD1DDFA7F766 SUPER.APE.INNA.JUNGLE
438,364,839 *2C63E5D12BFEF6641D12785F49C6582EC409D558 AAA0-
438,364,840 *2C64AF753B0CF0EDA90E8A775618DDA9EC36CD43 suttonoklastate
438,364,841 *2C6D31411FF0DB43D18926F6C74394680FF4CCF4 POLE,POLE
438,364,842 *2C667273F84E769BD3C839D0978B9D16DEFF3CE8 poopslutt
438,364,843 *2C6C8BFC2DE09614FF2B5808AA508CA351E14CE2 AACD>#
438,364,844 *2C68C9D0B65D45FFFDF0F44762B9505CB1C7DDB8 SymphonyinGmajor,KAnh221(45a)(AllegroMaestoso)
438,364,845 *2C6887952E19D29860471C07120F157F3BE24454 AADW,U
438,364,846 *2C6D6C0FB2232B162843A84121195796A218A947 aaeua
438,364,847 *2C6A1A5AFC2D83DE3623D8EB9760B721B365E6A4 AA?HZ
438,364,848 *2C60D20C18B219F362241C7007EEE5D43A1D8DBC ABDULPRYS
438,364,849 *2C6B857C1878100B13E1772771F6EE45FFEBDFF2 abenrahof
438,364,850 *2C6E03B0268C0890E93C7528839E8345EEE0E426 absondernde
438,364,851 *2C6D1DCB33354B528455DCCC3C95E696E9DE2F66 tannerred
438,364,852 *2C673BA33D70A07A3DF1C66136253A1C5B03DF6F TAYLOR-P
438,364,853 *2C6632D2B7F7160F34071DB8297066113CCF69F7 TEEBRAGU3
438,364,854 *2C6C493E027CC1BC077851A7C7CD1F01CED0FFCF psalmodieren
438,364,855 *2C60D08DD7618E50818C20A8A7F30491BA1A57BE ac!li
438,364,856 *2C6497678791A116634CF6AD58F5DA7C15F61AC6 act iii, scene 1: ihr listigen frauen, la
438,364,857 *2C6D896384CFC9A4EEBA1EC07FCE69EC60FEF66F TERRANCE.DAMELIO
438,364,858 *2C6FEEF2A51A145A52C746DE52223F35DBF208EA terrencewarmuth
438,364,859 *2C650EF5A0C9F59791F8FEB819C0BD72BCAB5726 terrfyn91y
438,364,860 *2C6963A6863FF12EE590B04F29E08989E96B1B5A ad=he
438,364,861 *2C65FD7776D1185DE7B77EC737A7B84FD7CA1C08 ADJT+
438,364,862 *2C6D2C5819600F3C1618C03795260767E88EF9AA THEACOCK
438,364,863 *2C6D9FED062F237F3B41DAB31CB2913A90920129 thebass45
438,364,864 *2C69558AE8220355EFBDF56C2FB5526CBD256549 THEDEFENESTRATIONOFPRAGUE
438,364,865 *2C656EC1E5E917A3BA501E1953415A8CC903BA7F THEFOURFRESHMAN
438,364,866 *2C68A95A133D8768632127B4FC2E8F0F114BD809 adz8o
438,364,867 *2C60359202F49772BE55A8265264FF9F2349C01D aeo(/
438,364,868 *2C6D5173D9C042DE40ABFAC365E58D54E8412F16 quinn.wood
438,364,869 *2C62AF070B3D3E62652E0F4ABBC45554020E48DA Q;V2
438,364,870 *2C61C1FCFE2CF339F63531F620E6D7AD762E62E7 r3s1s74n7ly
438,364,871 *2C62E9B390FAF01D0A4E0E859C76EE307162AB8A AHXDY
438,364,872 *2C694DE965755629F56A6F55E0DFAF19513B2D79 AiDm
438,364,873 *2C6CE21CD7096DFD50163148152C75A066631F90 RANKINU9
438,364,874 *2C603A1979D094E811CCEC75D4580D72CE8B85DE TIMFORBES
438,364,875 *2C6FFF47855B48F55B898F0CC29F06592239A2B7 timmytam
438,364,876 *2C650A319B198B1E24FB973865615228145F6D7F TINA.BERGEN
438,364,877 *2C68EF628BF162EBE9CC5381D6F667A45D8C41AB TINKERGOOBER8
438,364,878 *2C63145F72AA73A80F349A42FA20D3D15C8893BD red-light-(feat-the-game)
438,364,879 *2C67A48E00E48CF6CA7830ABD858D23F33D1BD00 refusals6
438,364,880 *2C6534589EAA32DE87C0D49A542D7501FCF72AD8 [email protected]
438,364,881 *2C6E3A0C4ED62AA4355B8FEE9940D1613D219E65 renatotenery
438,364,882 *2C696E3AFAC7BD89CB8CFAF36B8D3B0A1EE2E17A RENE-HO
438,364,883 *2C6A419B635EB08EA108116F4723B022B5FBD62E RENEWING
438,364,884 *2C6D133E08AB201932545EF23D81E6F57C35D1C6 reseouces
438,364,885 *2C664AE1C32BE01D51114F125D34C40A623017BD tommyjjohnson
438,364,886 *2C64BCFF6A0C3BE6A234D34AD68C34913815717A REZUSAMMENGEHAUTED
438,364,887 *2C66985961E778AF344FBA93BD2BDA5A69F40D18 TOM.SAVINAR
438,364,888 *2C6FCCCE3A306F24CAC64376B5A2FCDD5455203B TONI-REUBEN
438,364,889 *2C6DCEF07221D1D23E89FF5FDE478E1C4CFA44B5 TONSORS4
438,364,890 *2C61331EFFA3915195B296AD85FF39C924675BE9 RHIELTENED
438,364,891 *2C657285A83A677652873F31FCD6ECD0728D0738 RIADDORMENTERESTE0
438,364,892 *2C6C52A1C7C47E3C6A9707519C6BC0A98DC474A7 RICARICAVA7
438,364,893 *2C6EE245B79B206DD75E19AD4D23C73595427414 ALTERNATIVEMEDICINE.HEALTHCOMMUNITIES.COMALTERNATIVEMEDICINE
438,364,894 *2C66DECA30C7B9C5C1096DA5F8F7A61C6ABDBAE9 richard-minshall
438,364,895 *2C644606EA85849091B19528014FC102761006BC RICHIE.PASZEK
438,364,896 *2C63C1012955AEF97BCDAA5A11F68D32959BE253 RICHIESIANO
438,364,897 *2C62A47F245A9EB900B786090D3C48DA6FB2EAF5 RICHUHL
438,364,898 *2C659EB59D2770809DFBEF78E4036CC3ADC0B511 rickbeaule
438,364,899 *2C6F722DDCF437DE75387370868CE6DA4F160FCA .">rid<.dc".ni.gnipyt.yb.rid-metsys.eht.otni.egnahc.tsrif
438,364,900 *2C6A76B2DC72601861C59B2A7AF79ED2C065F54F AMANDAASHMAN
438,364,901 *2C6C477967A26AF28E6115243E28A09C29DC9A41 TRADINGOVERLAND
438,364,902 *2C6CAE089D0713F1D8998FB9E4C4FDF02BD01BFF ambrosetones
438,364,903 *2C61FF3458A2A41E13DCBF744C8BECEB5B53FA8B AMOSCHRISTIANSEN
438,364,904 *2C66E7C7E2577BCE868F23E9EC909E68330E38E7 AMOTINAR0
438,364,905 *2C666632DC52CD8DC29358F6B019BF5C1DA20556 TRAVIS.COWBOY
438,364,906 *2C693AF62B25DFFB954A4301A272B75CED719325 TRAVISPEOPLE6
438,364,907 *2C6E31BC649861D057C26EC60D180EF7D1336ABC TRAVISSHEEN
438,364,908 *2C66B523C31DFAB0B13E1C684F5AE08D4BA61E84 RIVALSONS
438,364,909 *2C68C286B794B5160351DD62FD30AF3D043207ED trevorhoglund
438,364,910 *2C612946B19953EE8095D92AE4BE2721AD57E7E6 robbieremak
438,364,911 *2C6C869C43831939AE29670A3CE235F72ECD3D8A robbiewaldow
438,364,912 *2C68719826E0D583FFB4D4377C18EB39C65FB73F ROBOTNO28
438,364,913 *2C65CCC72BACCB1D4A9D2356F9696CF6D154CB4F ROCKY.WAISNER
438,364,914 *2C6EFCB095974416658F3FEB0F45C495DF5B14CD [email protected]
438,364,915 *2C69DAA1DBC3172BD717BA565C59393EAF909009 [email protected]
438,364,916 *2C6AAC08F31EA94B408A6D44A8833F3030E06317 rod-macqueen-says-build-melbourne-team-with-locals
438,364,917 *2C63542C2CA5E862C24C60EB9DC7797662918B59 RODOLFOLANDEROS
438,364,918 *2C69188AF0766B30EB85C9CD313C4E8B4FD57A53 TRISHASAWATZKY
438,364,919 *2C6B0350421B3C277872D2F6536F273EE01F11D1 TRI TEK WATTS
438,364,920 *2C64D1D1F4C288850BD3907EF77E4C1E643EE90E TRUMPETB7
438,364,921 *2C6BEFA9F809EDFE79A1C0B8C8E6E01BDCAD081E TRUPA DUDETTES
438,364,922 *2C6FD97EC9AAF854440155FB0EFB83A3C10A2071 ANTOINEROEMHILD
438,364,923 *2C6121F6985B0974BB7D5249693B02FECBD6B002 ANURAGGOUR
438,364,924 *2C6EBF926DF7F04BECC7507974B3081702738327 aon_w
438,364,925 *2C600443D5D71CCBB9FC1F4A1CE6A370C0F4A473 ROGELIOTERREZZA
438,364,926 *2C6DC28E3A9DB0CD2A3FFD18AFCF13EEA60BA3D0 ROGER612
438,364,927 *2C646CDF9F47B4EFF9FCCCCD3EBDBB7FFB98EF47 ROLANDWILMARTH
438,364,928 *2C65DDAEB200629218A4BB925A071B76C6245D8D <tt>name</tt>-is-the-name-associated-with-a-particular-system
438,364,929 *2C6BBB0A913C0EB016BA14FCC4935B2AD2BA17BB ardenlaferney
438,364,930 *2C6206FBAF029DDDBBFC08E6663EE997FD6761AA TURSHALLS-EZRA
438,364,931 *2C66A56ACF14A4CA194F7D22E4C2E4D7F49A7278 [email protected]
438,364,932 *2C60491DF290283DB990DDB799704B3F6F6AA8F3 rooseveltlawyer
438,364,933 *2C6439A552ECA4082C8581D320A19FFCBD936C5B TVTTYSV3
438,364,934 *2C610B7FEE274F0D085F4F3E9AA240BAB04EB9FA A(RKY
438,364,935 *2C670AE205EAB0AC51533D14627EA1F3738DD353 ARNOLD BUNGAR
438,364,936 *2C6D0962A154D038F98DECF6F9E4382F4F364734 arnulfokapraun
438,364,937 *2C6A360F3F4160BE15465C1C184DDC89D1EEB92B A?RQB
438,364,938 *2C6387AB47FFDAC5A9CA3BAD21624D3CD3D279EC ARTHURTSCHETTER
438,364,939 *2C655E4466E42B918354476C5D5F31B35030B455 ARUSENU.SEIICHI'S.THEME.(PLAY.ACTION.VERSION)
438,364,940 *2C65B4D32080348B0E95BE15DB8A17A5BB30B86F tysongulsvig
438,364,941 *2C6F1D12B2AEECEBD50BDA747A0EE3A2D8C74929 U107527
438,364,942 *2C6906E394243C58E58FB42170F30D40EB58C871 U150294
438,364,943 *2C6ED272B459F2357D0F00A5F51B92FBAB2A95B7 UBAVA.UBAVICA
438,364,944 *2C6FDFB02B69C6AE0BA82E8DA7B31D5A309A045C ubriacano2
438,364,945 *2C682CE971D40BC21D5EDFD3A3B2DDDA6008CD32 RYAN-A-WILSON
438,364,946 *2C604996C3C282BFBC7064E866F28B16DD215C8A ULX?
438,364,947 *2C64B4FC0E124656DCB8779EFB8A09496DFD71AB ASTNAMEN
438,364,948 *2C6BB44A6E03DC5F217354A05BFD42F3F4A73E98 SAMUAL.SEUSS
438,364,949 *2C607A89D5F31331DBF29A26F7463B9F6D8314B5 sanctuary-(implant-mix)
438,364,950 *2C6608ABD6DBCC02A1B6BBF73851A27946A3688D SANDYFRANCOIS
438,364,951 *2C635DBF294A0563A25675E0772A0867EEAA7444 [email protected]
438,364,952 *2C6AC975DA2239357B208E88DBA203FA4B7213A2 SANTACOMPAQ7
438,364,953 *2C6482A0C7DF871204760864566C9EAE47120D17 SAPIUMPITTIERI
438,364,954 *2C6BCCE8AF1882B06A38B41F5B3C97A01FF1F920 SCALEPPED
438,364,955 *2C67E3345CE79FE9267A320733570044BC6C0CB7 SCHLUKBIER
438,364,956 *2C673560FC7347FD4C7CEF72D81A395F237364DF [email protected]
438,364,957 *2C6A7C38BDEBD22491C6C92ADC94E4651FC43A4C [email protected]+1N9
438,364,958 *2C68332489AE0C87E8AB876D6D33FA26D80A97D0 SCOTTIE.CRESPO
438,364,959 *2C6FE0B93423D1EEBD284ECBC8DC14BFC5072F89 scottieneedle
438,364,960 *2C6C15D64C7D9C7F6C4FF5BAE5D5FC1F93E4AA47 SCREENCAPHEAVEN
438,364,961 *2C64DC12909D478D9BF13FA8FC5FE5E272667F95 SCTCHSSN
438,364,962 *2C6E7E881992FB1727C9F9E65BBDC5C6F3786A84 sculenisculeni
438,364,963 *2C6E8F5132D42A8DE55AE5ABAD1D852FEE95B058 SDJJUNGBSW1
438,364,964 *2C6C811263481B16A918BAE7E9068549F6FB1CAB [email protected]
438,364,965 *2C6044A23B056FB9A0C044DD8807565418B486D5 SDSCHPBSW3
438,364,966 *2C69B88A0C188B2553C0E63DEC04473980FBF017 SEGOBRIGA PARK
438,364,967 *2C606ABD9BC6BA0FC0147FA5704ED4F96D99C952 avowi
438,364,968 *2C6DC56A8D2086D37419D909B1C521F4D3818C08 SEMSHYN
438,364,969 *2C6CF97F23CF63ADDF690E45CE7EAF7FDA659315 uti.chicka
438,364,970 *2C69884D486019E156AB31412DB764DA6200D9BA SERGIO.SHETTER
438,364,971 *2C64F87A6D749AC6131C1E19AB14790BFA170769 UVILJEN2
438,364,972 *2C6AA93C147E6673E7F5FA8D2C4255CD45BC2655 UZCSU4C
438,364,973 *2C6A8F35F78CF10C459C76DFAFDD779D432C499F axaaa
438,364,974 *2C6604B777080AFD36FF104A04293436D064FCFE shackledtogether
438,364,975 *2C625F44A3215CFE729F2B3F7B52C6DAE8ABACAC [email protected]
438,364,976 *2C6808BD0B486B57F67092A5C947D0D989F250E3 VALENTINA HEINZ
438,364,977 *2C6DF571950AAF78E57E457819611E2AEDFCCA2A shairen.bonavente
438,364,978 *2C62E1572F20A14F17040CB2BAA786EA02120F3A SHALZIHAS
438,364,979 *2C69D4F3A773804F020FB4E341B38ADB42FF0B75 SHANDE.CONERLY
438,364,980 *2C62CE86BA435E745A754DA1F87AEDEDE3F4C505 SHANEKA-MOORE
438,364,981 *2C6E9A841500839A98D085E2AAFFC3D60C7D6FDA valgillham
438,364,982 *2C6E17DA9036B900E027728088924F0B3645864C [email protected]
438,364,983 *2C663C13C7CD7779577B33598FD5419D9219FF04 VALLEJOBSWING
438,364,984 *2C6F438AF08BF735BF53B7AFE901B550B3FBD899 ~`(-----b
438,364,985 *2C66F636D307CB0AD6B9D3F8A74FFBA772F5160E b0bbin-p0
438,364,986 *2C658170785863F6B3E4876C6B90DECEE646F50D b23,;
438,364,987 *2C6EC9237B0D8621D93452F1F2F972576164B119 VAYEA
438,364,988 *2C6C2C7E696DBF5F70A19818E8746B5265F47D90 SHELLYGRAHAM
438,364,989 *2C6652E8D22E0B14BA8023C4BFA5A46889ADA3B7 shooterhonda
438,364,990 *2C60B9B613BD962986F7C2B2512586730084BBDF VERNSCHLESSELMAN
438,364,991 *2C6ABF8ED716836CBB0D34FBDA9023326E28A2EA shvaughn
438,364,992 *2C67CB72D3ACEFE3F635DA880FD0C39D2A37A397 Siento-luego-existo
438,364,993 *2C6BCE2AAE6DE6A32D05D6E4217B0D4AF807F501 BADBIRDS7
438,364,994 *2C674756FA83E801A880F6AFF69065648C0003E1 VICKIEJERNIGANKIEHM
438,364,995 *2C682B2A66E2B99DC0F2B8CB3DD9CE0894435C5D VICKIE-MARIE-SHIPMAN
438,364,996 *2C681FEB03E7895989A8E7A64AB34D208BCA8952 SILVERHORSING
438,364,997 *2C673854951678D670483F679DD01E00867050B4 BAKSLASHCA
438,364,998 *2C6533DA54A3138E3B4D11E8E4397EA7FF50C03E VIDYA
438,364,999 *2C69C6EF3FCC9653844F854A9F553F593311B916 SINGOUT (SHORT)
438,365,000 *2C6B0411B1BE4017D5CA882DE484D430064CF060 vincentwirght
438,365,001 *2C65957143C26F994EE03CABAFB2C8BF7148540F sirius420
438,365,002 *2C65A6BF5EF72602903063586CE5D7949A46B52C SKMLAWCOLLEGETITHALROA
438,365,003 *2C66A2F7BFB11318DB6FCD63680290AE43E9BC55 BASSÜS
438,365,004 *2C6487B3BD577CD84318DA6AF3913A7E54B96883 vitopita
438,365,005 *2C61634A21231C9AFB08A1D1330124A8FF29005E vitrifia7
438,365,006 *2C6A7F589152E1B6565F6CDF14BA1CD2E7AE1469 smugowy
438,365,007 *2C6303140F7D1C717820881FE91A6640BF08FDE1 VLITTISI
438,365,008 *2C6132AEABEF716244E2A211B1629A42D418CAF2 bd7%1
438,365,009 *2C69EA6CFE0A33DF4C8BE633B7FEAF582654108E bd~~)8(
438,365,010 *2C6C33E212EA25475BA927AC4ACF515D3FC51331 SÖRSIDAN
438,365,011 *2C6C560118370CD13EBE938FB11A61F13CE73A32 vrtsu
438,365,012 *2C6DEDF415CA56E55CBC947585FFE2AB7C997900 VUKASIN-GARIC
438,365,013 *2C6D9C3DCA9CE05DBE00858D0582CBE916A04B8D vukqottg41
438,365,014 *2C61B6319CBC9437505C415D715773FFBB4E7732 VUONG HA
438,365,015 *2C64DAAAD654AD980A7525C897897E6E677B9FF5 [email protected]
438,365,016 *2C6D2682AEB59DFB77A49927E4FABB6679A14F1B spiegelgalerij8
438,365,017 *2C608BEFDDA3186B187C3BE378A1516474BCBA8F bennetthoffmeyer
438,365,018 *2C60E634E5752E60DCA43ECEDE8EA3FE74850F94 WAJHIYAAFREEN
438,365,019 *2C6ABE9D45F0F50F02A8D78C72DC049E13C74991 SPODNOPERMSKÁ
438,365,020 *2C64DB334EC3432792CA9D0CC9BFA10BC97A5269 SPREADSPREAD5
438,365,021 *2C6E9EB01287FBC27BE289B97880D8D2B6088CB5 srewsna0
438,365,022 *2C6A06DC53352CCA0BE0F55DBD449B78CBFA241A BEVERLYSHAVER
438,365,023 *2C68C7FC745C74DBC1EC8D2893C08DC105D7D677 warner-chu
438,365,024 *2C6807E66B7B4DB37732BB5271F94105583BE7D4 BGJEG
438,365,025 *2C607B0B449717597880E9A3E0F0D19D8CDBA58D WASEEMTABASSUM
438,365,026 *2C6A56829502A086CA199D4D97AF7B4594AA2F37 b:gqh
438,365,027 *2C6D04884DAFD332B4A5BE6CF41AA961B248DAEB WDESBOIS
438,365,028 *2C6BAF21C5474E76106CA3A3867571339951D61C b+i5
438,365,029 *2C6409685D17547CA6035A92CD34A3B8F6C495C0 billingn8
438,365,030 *2C6CC416059D1B49625221611D3936A4BDE884F8 SUSPENDIDO
438,365,031 *2C637A64E3ECA9E2A2862AB711095806DA7E5E5F BITGOSH
438,365,032 *2C639091D5A62E0773C513EF4C339357EE670646 B.ITS
438,365,033 *2C61571F4255404582A21B4E907C8DD53FEE3E65 [email protected]
438,365,034 *2C6135B927C2730EC1BEF6BB313F0EFDA6CAFF15 BIZKARGI
438,365,035 *2C61BF515BABC87CF26FACD534FE5B5F3AF353D9 symnonyms
438,365,036 *2C627E89E47106B8C8D76B98A024621D803F8970 BJ!VT
438,365,037 *2C6CEE478185618124D22F99FE2617EDB2E90743 WERNER.ELLING.ELLINGSAETER
438,365,038 *2C6F82DAAB2114E26A7A5D77B5E466C6B48D82A7 WESAM.EL.SHEBANI
438,365,039 *2C6AE36E5E3B4E7C559085E53095EACB2B1A26E0 $T0NE$NI
438,365,040 *2C63327B2AD0ABF36F922A3A0564EB9D91E387FF [email protected]
438,365,041 *2C68D54E6204E8248D31731E1FED7ED824338144 WESTLEY-GRAVLIN
438,365,042 *2C6A14CCF4DA734975C83BC247E3E2F3245E49CB t4kkende$
438,365,043 *2C60E6E808374D7EE1F2B98C91CF06A3BC5F027E wileykieft
438,365,044 *2C674AB070990546E91638A0AFF680A2D38D27C8 BLKCYL
438,365,045 *2C6918EBA7E5D947E0C904D2913FEBDB8281D820 WILL.GRAVELLE
438,365,046 *2C696A8830C20A52D486494A63279BB4B39CC1D5 william.benjamin.wofford
438,365,047 *2C6673C1D7406D062B07353AF3AF5E72840F177F WILLIEHURNDON
438,365,048 *2C67985CD4C7C4B275E47EB0B0AF061B9351E3C1 tankaralowllen
438,365,049 *2C660C0660E952D62C196EB8EB68E8871BD81AD3 TA.VALUE.SPLITR.LENG
438,365,050 *2C6A687DFD5477180ED8E5D2A5F77F5FF457C4E2 bondage1
438,365,051 *2C6CD854A0706ABEA4A96BD65B701521F13C3C5E b=+ou
438,365,052 *2C67B161B3F517D341D84645E07296321EA2B3BE TEDHABROCK
438,365,053 *2C64458584B2704CA590DA118DC1B1404582A657 wombatkathryn
438,365,054 *2C6BB0ED304EFA529E42290796A8418AD1D5B99E woodrowertz
438,365,055 *2C6AA448E19191168045FEA3669010294256619D [email protected]
438,365,056 *2C6E18A913104749AB004549E2FB92D279ADED33 TESTIRAPORTTEJA
438,365,057 *2C6043C4DE448804EC03858E4887E97884BC7451 TFARGER3
438,365,058 *2C6638D61ADE173F07063D1F91057DF0E2199E87 THEECHOOFASONG
438,365,059 *2C6ACB5E8F0F3A5F532583E00F263154972A61C8 WQBMNCD5
438,365,060 *2C66C99DDC989D93940591EF824383CBE867EE5D Wrong(featNew-G)(C
438,365,061 *2C6C73658F877E8A44B6D7AF0F32CFF739B8B618 BOYDCELLUPICA
438,365,062 *2C67E8202F9F75A21AE0B378BEDA5F49E5A44C3B WRONG-SPLASH
438,365,063 *2C68E84998ED2AC6BCF7EA8B9A531989938E9F3A bp0t$
438,365,064 *2C62E5FF049168E1482F4B2D95157E30B811E4DB BPA"N
438,365,065 *2C6529ED41862E06D45D1F91E60151AF063CC625 THETFORDBOY
438,365,066 *2C694876917CB44CAA55434D3962D312B6AB5319 [email protected]
438,365,067 *2C614280A0A64782983331A722C998A6A67C23B3 THEVACATION2
438,365,068 *2C6B19F037D4B1DE69BFF81AF7607F87D05D95E9 WWW.AMERICANINDOORKARTING.COM
438,365,069 *2C6DCB763E1EB73B03383FCD8C7D4BA2CDA85403 wwwanimategroupcom
438,365,070 *2C6C1B7C9B826F431EE3FB3A979E3B6AC66F686B bp:z=
438,365,071 *2C66F9452CFB4871CB4BD271375F5A8A04CD9DD6 braatz1234
438,365,072 *2C6EEE220408D42A22D51CD8C800F23F31D8D183 BREHEMEN
438,365,073 *2C69735C91160DEE34E57978132FBAD48333F53D wwwthepartsdrawercom
438,365,074 *2C60EE2CAD5E4C59085135C7DB3C8C269A5D43CC BRENDON.CHARLES
438,365,075 *2C66D7330FE71E5D2C24A5BCC2C058814F491457 TIME1026
438,365,076 *2C697D076C81B5960C0E1757C35BB5D7E2C8304A tn]\
438,365,077 *2C68E92D3FF99D0157E2E2245C1DE57AF4624721 tobe
438,365,078 *2C67120775FBDAB6318A904554D016441A8D66CE [email protected]
438,365,079 *2C6FCED6F14FCFDC88E52B8446EB0C274C7C9354 [email protected]
438,365,080 *2C6102210BE4D8946AF60F384F0D83F7B78FBF68 brushset
438,365,081 *2C697BEA2EBFC3B1C5029A61BBF0964FE399FEC1 bswefigenia
438,365,082 *2C6F0112EBA5186D6A52FDC7CC76CE234049F23F b-u!&
438,365,083 *2C6DE4753A9DC9B63FC0606829241F1BDF0F8F8D BU&=J
438,365,084 *2C681B3E7A490BC2DC284882043A735C5BEB34B5 transporterfried
438,365,085 *2C6F0296ED6E8E785E7A25A4165A9BD87EED15BB YADRINSKII
438,365,086 *2C6894DB59E31E00994287CD7B4EB2FF77B0392F [email protected]
438,365,087 *2C61E4D210D854C9A2C19CB25C9EA2519C054D54 bv-
438,365,088 *2C662C8B5568BB2BB66974CF5C9BACF073876D49 TRIC0$AN3
438,365,089 *2C63CC6A0C3BB99EE36365FD0A7EAF0595213DEF TROUBLEAMERICA7
438,365,090 *2C63BE30B9CF67F3357D493D345B165E642C37B5 bxq!)
438,365,091 *2C6BB367E3944C5BD2832F856F1C8364DC91D7C8 byronledwig
438,365,092 *2C6601158A21F362D8D2D7E7122D1450B0CBD424 by-wasting-ruin-of-the-cruel-foe
438,365,093 *2C66CE29666991C425C84C1111AB9038D3F77E2F bz,s
438,365,094 *2C6AFDDC0DEE86B6F3A7038342A8385C9C7C290C c02dp
438,365,095 *2C68051FDBF7C3C9AAF75DBDAF0396D4160468C0 YNNEKYOB.NAPNAMIZ
438,365,096 *2C693235944F424A6A2065B0CB3D68A23D5F82E5 TYRELLSOMER
438,365,097 *2C68F239A342616EC3B761886258F5A758A2BC27 C1M&
438,365,098 *2C6DB3751EDB743E6B93C868EB4814E4CE319E60 YTSUDWAS5
438,365,099 *2C676696B63901311BFFF4B1750955637DECC580 UARQ
438,365,100 *2C69B238BF02366B252AC46661272538AA6B5683 YVONNE POWERS
438,365,101 *2C67B0631FD2A2B51F46C4D62D75C9DD867F30C1 ulasal
438,365,102 *2C6CAA5EA8BC8EAC6CF8FFAD5AB0A9E66BDB23FE ZACHARYTHIELEN
438,365,103 *2C65805A58C8A96FDA74F1D744CB577B900EB3DF zackaryruggeri
438,365,104 *2C62E7BFBA0AAD32577F3ED73AA30600BCDE71A2 unfederatively7
438,365,105 *2C66BD71854CBFF683D35E560239893307B24970 ZARRENA.STONEHEART
438,365,106 *2C64833AC8562A7868E6C62CA52036903970B463 CAPCANES-TARRAGONA
438,365,107 *2C6CDDDF5E81FCD46E02178A03317A966389BA24 [email protected]
438,365,108 *2C6FB0901947DCA9677B9E76CA01D8AB514F055B z(d^
438,365,109 *2C60B18A1888E302FF9D020E0F76DBB24EA8FE48 UN PEU DE SOLEIL SUR MA PELOUSE
438,365,110 *2C626A95F001F97F044697C4CD6ECC2DFDFF4BE2 ZEELEICHIANOS
438,365,111 *2C6567FB5095D021B5AA2C419DE1FC71978BDA92 zeemafey-oso
438,365,112 *2C6C1D7E2EFF65184E8E532E72DA86B09200E971 CARLAHUSTON
438,365,113 *2C6B35BE2DE52CDB1D184DBBFC41CDFA21E65DBF UOZKUL
438,365,114 *2C6D9737E598071D33D98778B0D9BAE4FAF6B0CE $UP3RCONT
438,365,115 *2C68528E2D6A4246CDB0EF764D1B977B91BEC836 upchirk4
438,365,116 *2C60F43DEACA58DDF3A409AA61E059D0C4B1FB13 carolcrowther
438,365,117 *2C60230D07819CB2A3792A3608AF7686AC4CE955 urroz-garcia
438,365,118 *2C65A12C399F6A2F2B306ED8BDE3B5C2B695AEB7 USERFERDIAOBCOLUMN
438,365,119 *2C6BFAB98869A68F09207A07329E86AA6A61E178 [email protected]
438,365,120 *2C636D162315268D7B1EADFB746A7522AFB5AA36 UTTOMANGACOP
438,365,121 *2C662EAB48D7099636EB6191A52BA27A5EF8AB0D [email protected]
438,365,122 *2C6E08B04F4D2CC3883221FF06382233F1DFDE89 ZIZYAIDA
438,365,123 *2C61F7E193D029FC6E11A628235617BD76E16189 [email protected]
438,365,124 *2C656F6FCE16B27BD42F031DC66A0FE9D735F14B ?Cbaa
438,365,125 *2C6D4DAC84571AD7659FF686DEE53064054E9365 VALERIEBOTHA
438,365,126 *2C627C0FEC8E085F53E8150A3CB00189584AAA6A [email protected]
438,365,127 *2C6C5533DCE72A179CFF75074B1F6E96DA4D0411 varnsh3d
438,365,128 *2C6276C89E71C03A219F515EDB62574E72EE82B0 cc<ve
438,365,129 *2C6035940C5B39CC7CA95289FF0CB01B036DD502 cd7km
438,365,130 *2C676D25EF82FE819A4777959AE69E84D83D7369 zusammengestrichenen
438,365,131 *2C60DCBA534CBD2BD859F29E081E19182F02E1B3 vera.rexhepi
438,365,132 *2C6CCFC6F23132265B18A28465CE10F365690B32 vereelte
438,365,133 *2C6E9B96EB46099FD346172A27B0E8DB6B914BD9 celestiallight(templeofhealing)
438,365,134 *2C67F62B1EECFE8E7FD12C2FFE59704E24396AB2 veronique.parmenter
438,365,135 *2C601E68AB2BD19A6A977B888E710E335EFF99EF vevoz
438,365,136 *2C6C6A09ECC58F8682170F4AB2EA69E3ED7C9ACB cf3e+
438,365,137 *2C6D9414EE48DC6DA1AE9FA44AFB68B62AC4BAEC C#Fo
438,365,138 *2C6DA175542BED495A744C1C4DF472DFC02F8B79 CHAINCESTON
438,365,139 *2C6FF7910D80B7BD151659311FAFCEB2CF663B44 адельбургом
438,365,140 *2C6822AAAFF9CB14D05A5F4EB910EB5C10CE93B5 аэрокомическим
438,365,141 *2C62F8F507FA9290F5393B9E7C65C8FFC3D1CC67 VINCEMALLORY
438,365,142 *2C6EC64F2E6BA67F6EF4A8E9A204C8C103FEF175 virgilkazmer
438,365,143 *2C6904BD8358FC7BC1AB0B724433B827829F2FA8 ГУАРУЛЮШ
438,365,144 *2C66A65E396CBC666FFF7E5BDC538AEDDC1E5979 chizheked
438,365,145 *2C6532DFA21D37883A88F9A2869C382710B58E39 vladislavbonev
438,365,146 *2C64301182EF66B82BE5062F4FA77747B6E53E08 КОСТОПОЛЬЩИНЕ
438,365,147 *2C67DF2CC71E5BBAAA211854A3B68A2033E06878 vneshtorgbank
438,365,148 *2C656A88092A8C5BA5A284FCEDF1EEE1CD04A34C volmaakter
438,365,149 *2C60B5E5BFAFC8D2B47E7B35EA9E264D721F5A59 ОСТРОВЕЦКИЙ
438,365,150 *2C6CED29C5130180E0286B84BF9343BCA1D75F25 VPOXCHHTI6
438,365,151 *2C6BB835099D0B2D3C44A63DFE02BBD1B3F1A24A C?i)
438,365,152 *2C61EB98BC67E23950B2CD195C36B3960AD2B29C C%IJC
438,365,153 *2C620FA01711C9E7783927D1CEFAD1954AB9DB90 vyzna
438,365,154 *2C648D434BEA05057B3E86C43126831456EA55D0 CISPADANIENS
438,365,155 *2C632652417CFEEC7A12BA1E546E282CA9A331DF СТРЕЛЦЕМ
438,365,156 *2C62A781C0BCE645B9FD5DBFB3115BFE3F5F5025 citylink8
438,365,157 *2C6B67F028F4688727C1CF40B19735C18C3C3D51 [email protected]
438,365,158 *2C6B8F69663750FC9FF5076F9B8CB95126567E6F [email protected]
438,365,159 *2C6C5DE2B4BF3C768B54668113A41EE5F906D53D c#l6,
438,365,160 *2C62B54038488F4159FC03CDB336DB4FE0202ED7 初出:『FIVE
438,365,161 *2C617445F204E592BAA075ACF9412D332F8978D4 WAYNEBERTOLA
438,365,162 *2C6654F5FB2F983CA8C7253C7941AA3A320B52B2 [email protected]
438,365,163 *2C64ABF0BE62B9060486274D4CE4D5449D33E86C 師(the
438,365,164 *2C64BA913383EBF4DECD23A151552BD1F53DBFDC colingari
438,365,165 *2C6CEA765EEC5D708613AC82FBB7218EF07CDA12 WhenaBlindmanCries
438,365,166 *2C61D4E745D8580AB423E07B43464AFD02E16397 wilfordwigton
438,365,167 *2C66EDC1BFB4041536D28134890BC888C4CE72B0 concertono1,op35iilento
438,365,168 *2C631A1AF4369702462C9537BE57C9FB0B006C8F CONSU1TVE
438,365,169 *2C6CAFD0055A50D33AF82553B29705F5D27C14A0 WILMER.MAIO
438,365,170 *2C6D1F7BB1E72209F35C98DBABDB1FBCBCE6DAA0 の連作伝記の宣伝のために、『WOOLY
438,365,171 *2C675F7AB3ED6D1E489D7179AB34345D0A1ADCED WINFREDAZZARA
438,365,172 *2C63710D336808D91CC57256E140F1B107B5E488 WINFRED.DETWEILER
438,365,173 *2C638E55922A937E6C06271A36C4B3A90D9665BC 韋比出色的表現吸引到北卡羅萊納州州立大學的助教湯姆·亞比茨瑪高(TOM
438,365,174 *2C6CAB106115E3C02C39F8A9D93F570F9F567C14 w:lh
438,365,175 *2C60EEFB1C0C0BA6F954920BFC8A45227F9AE6C8 WOODROW.CARRIAGA
438,365,176 *2C6445FE2C880E759DEF4663ED790C0ADFE84AE9 [email protected]
438,365,177 *2C60FBA41672E18E3607AC30E310AB70F38C257F cougartim
438,365,178 *2C6D6DCA725F1374D889B227AE4B5C7C2C65D0AB cowboyduckie
438,365,179 *2C655494B4084713FD49DFDDA113498DED5A3F25 WWW.NEEDLESCHAMBER.COM
438,365,180 *2C65C67129A40D4C2A56B48BED38F4B98173E4A4 WWW.PANDANET.CO.JP
438,365,181 *2C62ACDA1D7298E9B494B96122791EADAC7F7D0C cqil"
438,365,182 *2C6F0794F64E3F2FBDBCB7DA4E105CF1D664E4F1 CqRA
438,365,183 *2C64296FA16565FA4427B162BA944E0B7DBBD85F [email protected]
438,365,184 *2C6F22D0C363B0716E977C9546962CE12A5C4F14 crvn
438,365,185 *2C63EC00D261652B8CD8285C5577BAAE60778D40 )X(~`-~`<====P
438,365,186 *2C6D54465120E3C03C0CDFCEBDD85A1EBBCBF85A xx-americans
438,365,187 *2C60F633EF6B5CB46EC840D8A4A54B23EF1B5D03 CUIQUENAO
438,365,188 *2C6CFACC898223D24F66BFA1BB86D2182A8908BE CUR+A113D
438,365,189 *2C6EDE0463D6E502DE44F3BA7434A355682ABE1C [email protected]<
438,365,190 *2C654AA9EDF9487689841EC25452275F67CC0037 YAD TAILOR
438,365,191 *2C6921A5D2F59390C090E615ABE40AD2FC19FFEF 1252997 LISSUSAATEKSTIVIESTIN:CHAT:MITENMENEELISSU?
438,365,192 *2C64DA89B509F6171F0E8733D3397FD37239FC6C 126hukumetimiz
438,365,193 *2C6FF3B980215DA1FC018416A16834254B8B7E92 cusconin
438,365,194 *2C684563C4E8247A5188FBC1B754254B5E2AA820 1335369 OLEMME.TOTEUTTANEET.SATOJA.WWWSIVUSTOJA.SEK
438,365,195 *2C64C70F04C6DF37237EC2EB54FA769A36A249A9 14NOV1013
438,365,196 *2C63733FAEF9A9AD170AC64EFB5124620388E136 YEZKIEIEIH
438,365,197 *2C6FB995151043CD13ADAA25FED27546CCC7D324 1580966 remontti-valmistuu-kokonaisuudessaan-12.8-.-2002-menness
438,365,198 *2C631656F5554483DBED2CF13853EF5CF78BDC79 1581484 ohjelmantarkoituksenaonvahvistaapieni
438,365,199 *2C68A1AE8EE4F4388B874A068A4FF039B571F09E [email protected]
438,365,200 *2C64DFAB0273D1BA9F3FE5B6C885CAEECD22944E [email protected]
438,365,201 *2C6B4B06555B58E0D07096881BBD902680A0B50E [email protected]
438,365,202 *2C60EE99C89325F62CF584F3C78935712C3AFE8C YINGMEETSTHEYANG(SKIT)
438,365,203 *2C6745FE47B92E9C4E0028FCF802542F4CDD906F YLGNINETAERHTNU5
438,365,204 *2C6E671D803566CCE38E5CDB60E00BEE68847E61 17DARKPOWER
438,365,205 *2C66144BADAE740516BFAA6FB7D889C4E0DF6759 YOANAEU1234
438,365,206 *2C6988AF7E5632DF9DE8CCDEDF43A8054CB3CB88 YOLANDOC
438,365,207 *2C657928521D5D516DC2D067D50A37F9BEB9EEB7 YRUODUOR2
438,365,208 *2C6028C9DC5D85CBFE6770DD456E106C9C087BDD d0++i1y
438,365,209 *2C6F4B8F4A4D23383A9FD8EF5B8C820C3CFA772D 1.BAYER-KURS
438,365,210 *2C6181D2180DA69DC81EE030C53C4C462E385BC2 YUSNIAR
438,365,211 *2C6BB03481CCD47F1BF7894DA088813C812B09F6 1c4f73080ac631019b9c1b49d587d3b4
438,365,212 *2C616FDA7C3E5348B230B86EE7491DFF30BE7D8D d2$xa
438,365,213 *2C69F2AC98F7EC17C85027A1ECF52027C4287F10 Z167109
438,365,214 *2C66D2514453B304692B2C079C0A24BAF7135403 +ZACHARY+
438,365,215 *2C6599A4B1436A477ED3DEDF1B12E7D5CADDDEB8 zacheryseifried
438,365,216 *2C6935456DB7DF2EEDC1B9AC5FC0163DA8E59DEF d!5!n739ra7!on5
438,365,217 *2C6793342AD36D9F677D6F43C930326E257621C2 D6ET/
438,365,218 *2C66EB5B79A780ED244861733C70E070F1A7588A D6-MU
438,365,219 *2C6F741DE201B345C11EE7311ABEEAEA5E5CAF02 1ILOVEGUINNESS7
438,365,220 *2C68F968E8EE360FA7D81E79F84CB34A6B960F53 1iloveweasel8
438,365,221 *2C66E5433B25F2DDAEA62ACDFCB3280DB004DFE1 DAFIQR
438,365,222 *2C60E7F3BB252380D01EB5CA6628DD622201367E daglezt3
438,365,223 *2C6C50810B79794FD926819A7404415AF09F7B68 [email protected]
438,365,224 *2C645FF54DBEDCD35777581F1DBF4B1718747EDC [email protected]
438,365,225 *2C63C49FD9B67CF60618C153E2D195A48B716726 1-KERZENAEHNLICHEN
438,365,226 *2C6763CE39666A99AC5657BE76682A41104709AB 1KIINNITYSLAASTIN
438,365,227 *2C6C0864167B0361A842D2B1F7E9C717B6799540 DAMIENCONNERS
438,365,228 *2C6A4ADC9C406CA24C723146EFE12366361C39FB DAMON.MATTAS
438,365,229 *2C667D392D8A69EC0251CC86D6672D6A79DDA287 DANIAL.MAULDIN
438,365,230 *2C6705BD4FA499B7C4B1D7CFB92F65AD4AD03C2B danielle-fults
438,365,231 *2C6D8AFCC41DFA5A2E8ADC230CB2FE5C86F77C6D DANILO.EMMS
438,365,232 *2C67EC9BED4256A7361675140BD1C66FB8D51978 DANNHAUER1
438,365,233 *2C689F74CBC4FA2766D930CD061C0053953ED0FC ZIRA2007
438,365,234 *2C66679C72927FC4929606DEF4CE6696BD180DE1 1.NK-SOLUJEN
438,365,235 *2C6AE822C9FD3A130095783E3EC429B9D052D7F7 1NORMAALITEMPOISEN
438,365,236 *2C60620116EA61C52741A80C00A29990DA9F731B ZOOMITARBEITERS
438,365,237 *2C6B3108C375FC730E8E3007B32141308B9C3080 zullsumie
438,365,238 *2C60FE67A9983636F15F8B7C3351D4B7029AEDF2 ZUZANAANAZUZ1
438,365,239 *2C64A7D3AF26E7A122B41EAC168E34E5D2399A04 D!AO0
438,365,240 *2C67763639790E7B5C3C3AD6E47876F4A5F6C009 DARONMACCOLL
438,365,241 *2C6315BE3ADFEA242F631E31082D69156A1EC9E8 1schwarzmarktueblichen
438,365,242 *2C6A645902785AC35FA56F5AB9FAAC8240526BF4 DARRENBERGNER
438,365,243 *2C69EBCE5195EC0937C6DA6B40C442A6A7BA9700 ZZAIFA
438,365,244 *2C6546906FA1B7F71F70C64C50D3001ED0752688 darwingady
438,365,245 *2C6BCBB154CDA15E854B6DCB43BF5666D4F0DDB9 1.stampfuss
438,365,246 *2C619A9CBAA7B5FDD69D8F98FED79CA1363C51FF 1.te'essUrle
438,365,247 *2C66753F9931A8235E76FB82DF267ECE0D5023FB [email protected]
438,365,248 *2C6C97333C4FC1853D3219609270517AA015CAA0 1vermot'tur
438,365,249 *2C67D779B1F81F6E9E6660CCFD5F9CD75AB80256 1wasserdurchlaesse
438,365,250 *2C6938D7DD9DCA9125C732C99093251C1754310B 1WOLLERTELMENDORFFPRUEFER
438,365,251 *2C68F031F0CF7F853B2586D8D68530314E66EAF8 ΣΠΙΡΟΥΝΙΆ
438,365,252 *2C6766696ADBD0291E7E6915F7A7521D8454AB64 амперсенд
438,365,253 *2C604669DE815386BFB06CA9DDF02B41A726CBAA dawnlumb
438,365,254 *2C69411665E1FB6D21A50934F2536F81DC1C9CCF ДВОСПЛОНИХ
438,365,255 *2C6FBBE26759DF23841CF8CF710232D44A764F7F западнотихоокеанских
438,365,256 *2C6E883183962A41B2AF8F6EBEC9013EB94C6313 21bad05
438,365,257 *2C6B1559E7BF7060A39F7A30EC166C2F8C4BD797 [email protected]
438,365,258 *2C62A0240EE445EFB2376D2F98D0935C772E150D DDE5,
438,365,259 *2C686F79D122DEC76DFC60EA0938C4C72AC5F6F8 DECKLE_EDGE-'D/E/K/@/L_/E//DZ/
438,365,260 *2C6A9AE3C10B1085F56FA63B76520D54744CD203 DEFINITIONOFILL(REMIXINSTRUMENTAL)
438,365,261 *2C6118E5E5242FC33727A41ABA45D2B29CBF81D8 2672447 TOINENKOROSTIJUMALANSANANAUKTORITEETTIA.
438,365,262 *2C6AE1F2A40195D32292E3AB690DBEC02FCBEEB2 26ENDYEAR
438,365,263 *2C6448ADE3A2AAD6E3C1D2A42F6BC8D89981E11D САПОЖНИКОВА
438,365,264 *2C60B7FAE766F06CD675D252AD75D282FA48AE05 demarcusmacura
438,365,265 *2C641F7727513487C7C424181901629464A79CD5 [email protected]+0n5
438,365,266 *2C69C1590B15824FA9C367EABAEE5F14B0CD2ECC densoft
438,365,267 *2C65A7B12ED5B7F3B77531A44EB0F0EA17F27A9A 2 DREISER
438,365,268 *2C6D262EE739FD02A0C8B2699E0B638B37C0C250 DERMATOLOGICDRUGSTUB
438,365,269 *2C61BFEC08BA588F2AC57D78D425311E8065AB53 derricksmithheart
438,365,270 *2C6D96E98B646C6E52E590F777516221394C1E1A 2.harjoitusty
438,365,271 *2C670ACAC1CC592A21B71D026EEFA752D37F7DD0 2.taivasosuuden
438,365,272 *2C6AA048D84988A1C3D4507E49AAA70A7D91E053 DEWEY.TRAPPER
438,365,273 *2C60BD7B419F0718E2C1C29409268CA00BADDE23 DEWITT.JANKOFF
438,365,274 *2C6DE89F57878073B774F6A45B136212E3245382 dfbx)
438,365,275 *2C6CE926D5679D06A4D0838C0D4262E431DD32E4 3 MAISANBAU
438,365,276 *2C606AF9C7DB2661F0970AD44268884037C63269 difficult2174410
438,365,277 *2C6220DA334A966190A863BF9901EE0AB5DA25E8 d.ii
438,365,278 *2C6BD72217315B70A1E4A8C8043E0D88814CD352 3S3N+INO
438,365,279 *2C6C9D5ED517608E4856FED6CD071094B4EDF42F 3SNOTROH
438,365,280 *2C63BE28E80938DCAA8DC8C69B02BD7AA6DA9C7E 3.VELCO
438,365,281 *2C62194503281CD93869B4328A0F6ABCCBD08E0D 42F0FD06
438,365,282 *2C641F745E7ECC47DE01DCEA0B5E0AF1DD810637 DISSOLTEDISSOLTE
438,365,283 *2C68189DB8E75C078D77E1D0F3CAF027B2C45E41 distrito.tamaraceite-san.lorenzo
438,365,284 *2C672C6D0AF5D47D2871A6E64EA4F2640A9E005C 483graham
438,365,285 *2C6882CC6AD29C6B8EA15A3B8A85111DD3E46C65 4-galit
438,365,286 *2C67A5783BD2A13906B24A5BD2B3C83FFF38C921 DKNFZ
438,365,287 *2C686A820ACEBB47C5924B2FAF7F1953F7FABDE5 4KEFKAHB
438,365,288 *2C6295C23F911ED89210028280EB54BC30A1A2EA dlrei
438,365,289 *2C637407F087756CE12C148B29CF2501E17DA612 4NONINCARNATE
438,365,290 *2C697F2FE7BF8FE04BDADF65EA19191A795E6803 4OSTERIT
438,365,291 *2C6EB1FD774CB7790DB3EFF7FD8E9FE3C83ECA7E DMOUTIMS
438,365,292 *2C6C8130AF171B109D06D427B63C2953800BB957 4PRESSTOPP
438,365,293 *2C655725F0FD55ED3B71DEB880211F401FC045F4 D:n;
438,365,294 *2C6BB023D9DC2F81AFBE833B2AB6FDEC67A4099B 4SCRISTIANIZZAVA
438,365,295 *2C68190CDB63825B4124BCF7A6537EDD9DEC4309 dn!kk
438,365,296 *2C6D7EA0E7751E6E5987A692ED3A695D6A6DFB57 DOHODOVNIM
438,365,297 *2C646418DB5CC537B176991144B2FBE42C0150A1 DONALDEMCH
438,365,298 *2C6F139408D0FFF1583DA6621575202C69883725 588 BISCHOFSKONFERENZ
438,365,299 *2C631C09EE3DA699AA53E0248B3C3738D5402BF6 592879 ALUEELLISTA-TARKKUUTTA-VOIDAAN-LIS
438,365,300 *2C6C2C3DC19E4092B92E09017A779FF90861CB9E 5BEZUGNEHMEN
438,365,301 *2C6471C5E04FF6C96466E8BBA83B1BCA7CAE63E8 DONGLUDVIGSON
438,365,302 *2C630D6CFA9AE510941F4C0EB4DE46D4527C7DFC donngrassham
438,365,303 *2C6290AB170BA20E7C11BF19C5FC5C57CFF02A25 5HALLINNOLLISILLA
438,365,304 *2C66C950637D079BD2C0C02B549347D0F9C316D7 5ILUVCURTIS8
438,365,305 *2C622E74DF4EFA7278B00F96E70CFA89A2B51D3C 5PATRINOS
438,365,306 *2C6FC8E8062AC5B02D6C630EC4C9DCA60613203D 5RETHERES
438,365,307 *2C68F9F6D9DD82020C32E2F9C1E6C48E95541FEA [email protected]
438,365,308 *2C68E1CC85666FF6641B7B5504560A2A99706B88 dou87
438,365,309 *2C65074E3D94E1A2F8D3CF76F45897DA76425E16 dps5k
438,365,310 *2C67D764177D4FF2860A8888D1A3048A56DD8DF3 (_0)0~ <==3
438,365,311 *2C6F05F63ADF3F94DA281E4FB06E99E472DD4DBE 6BUCKISHNESSN
438,365,312 *2C672D630D1D4359670F316B10C39E6ED1784A32 6DIRUTTORE
438,365,313 *2C6C8E7C3251339256799C98F3A02E7E956B311D 6DYSURIES
438,365,314 *2C61191606BC0B3274BCD049D4A99D0611954AF5 6EAGLESADG
438,365,315 *2C67053114FC94162910DCCE43BA08C1269879DB 6eerbaarheid
438,365,316 *2C65A796BC5EF01D4B9D4187864D23170FECD7A2 6EMMIDAAV
438,365,317 *2C6E3D78725C86149FA4F1F1F55952D8B605E309 DRPULLER6
438,365,318 *2C619882171FDE17A69CED97AFA68B2E92CE6E64 6GZNGBNDLS
438,365,319 *2C63EF363C11AB756D078CF44984990FE9ED0C54 060B5悵
438,365,320 *2C6112126CC3058F8FF8A92284F1E0A8C7721D1D 09281113
438,365,321 *2C6BC1271323FD1CC56979B7AAB61D67CFD4CA3D 0BDAAA
438,365,322 *2C63247D6083B384437D3B965336378D77078977 10#SLOST
438,365,323 *2C6C50DDFA9078FBCFF3370BB31096B4E44DC8A5 6POSPRDNE
438,365,324 *2C6DD5C6D1E8CA330B385E6B9A27EE6ECB9C8DD7 DTA"+
438,365,325 *2C6678086E56F245AA30954CDE4FF04735E38FBB du1b6
438,365,326 *2C667835A425C17015E28787E41BA3ACED0EF76B 6SYSTEMATISAN
438,365,327 *2C69D83706E9159BC4DF5AA0F7F0556C8102A567 DUANE.FENIMORE
438,365,328 *2C6570A7B540A7C013CD7C2F764AC045D2E6CAD6 6TURBATION
438,365,329 *2C6738CF022C550AE85CD05C9202A15C0B6FF7C6 6vakiinnuttivat
438,365,330 *2C6528DD968D991C1E19249E978397E953043D35 6XFILEUSERSEARCHPATH
438,365,331 *2C63431F7C4973B4421E6FAC378194F5F1DC5F0B 6YRATIUTIPTSOP
438,365,332 *2C6E03BB9C26E102EC2CDA9BAE3C58DFBE4C6832 [email protected]
438,365,333 *2C65C194281E78090B1AC0EC5148DE22775891B2 12-TALES-FROM-WINTER-CITY
438,365,334 *2C6C5DB250B930EAFB0C2F662E0CF93DCE202917 du=sm
438,365,335 *2C63ECE66286773C8BB71C155D6D3B0C864CF481 7CPAGEID
438,365,336 *2C63313A348F721A61295BCD1A32B94C2187F01C 7DERETNENU
438,365,337 *2C69391C37B1C04E036A2428EDEE3419E27CAAE9 7DEXTERJUNIOR
438,365,338 *2C66EEFC4E89EF0425FAE983B66402E2B1AB7126 dv#2g
438,365,339 *2C6D23F820F75D489A50D5DF2C20D15248F08296 7INDUSTRIALIZAD
438,365,340 *2C64AA29BD9925A84007981C885C2554F1CA16C4 15final
438,365,341 *2C632649A9672B4854D4DC9EA118D488603CFBFD 7MUKIHSOH
438,365,342 *2C68A5DE6499CEE2E60CD97060578541014CAF7A 16.DEARING
438,365,343 *2C68E666F15A281C9B3AAB026F06905CEAA3EA96 16SWIFFER
438,365,344 *2C629D23AAAF486572DA860D9B983509C0266BEF d=wea
438,365,345 *2C6A5DD23DE84775CAC538B4DF75F9E4EC39E70B DXSFR
438,365,346 *2C6E1EBD490CF338FFD990148C300E28645E8C16 dypmy
438,365,347 *2C6F9D16A3586B0D4EE9FB5B7C7F143DFD8204C4 7TROPWEN
438,365,348 *2C614783475B07EB659E39ADE32BB8074BAE0AD0 7VERZENDT
438,365,349 *2C69ED37ABFE4E5BCFE4490263B18D43901CADD4 1.basketball-bonus
438,365,350 *2C61FF8D66A815B748BAE92344767EACF213D861 1-belly-thanks
438,365,351 *2C63B56944FB5A4181735469D827028CC5952B04 864264 TAVOITTEENAOLI,ETT
438,365,352 *2C6F2523A1028379D7D7470803B276B8801FDC0A ea%p&
438,365,353 *2C6001C3FDA193A550B854713840866ACDC0042A earl.hamm
438,365,354 *2C6B09DB5240920C086FB2F6D2FC812E406EDB2E easabbs
438,365,355 *2C60F09A82568EF226C8477D983B391CA6D8AF81 eating that, damn it! it is poison, isn't
438,365,356 *2C6D11A3B47B3D44B71BF7D38046909A4361A503 1 ESPRIT-SARJAN
438,365,357 *2C6B5765F1EDC40656B4E7D39A279042268B564C 1GNISIRAER
438,365,358 *2C6A82AB8218AFEDE67413E8DD0677F65C73795B 1hoitohenkil
438,365,359 *2C6751F38686AC00DD531DA28D5A88986535C3D9 1-KALSINASYONUYLA
438,365,360 *2C63200FBB3AE52CAE9B2F3538DB41A5255D4D79 8GATEWAYSERVICE
438,365,361 *2C683404DA5F754DFC3169CF2A5FB7EED64E318A 1 LAKKOLIIKEHDINT
438,365,362 *2C69E50322D46451049D2373D9EA64C88E2A20EA 1 MAANTIEKOKEMUS
438,365,363 *2C69484CC9474CD03D2FBB919FFD565E4422CAD1 edwinbelsey
438,365,364 *2C6C15B2F5F88DBFE754D68EBAB9A0B8D7CAC7B8 1-mielenterveysosaston
438,365,365 *2C63F2BC8B79E01F5A3AA2335D4336562BFE7E9B 1.musikschulwerkes
438,365,366 *2C64FF3C69A8642955C1B5B3D6DAAEA2CCC14D76 1.muuttop
438,365,367 *2C65A2257E3E435DF5D3D0419AA99DF675C86DDC 8MARIAHJAGUAR
438,365,368 *2C66007BEED236EA6900D1F2749EBD512B5BA11E 8PAARSHVASTHAA
438,365,369 *2C6913C4D1419C98CF01349EB780102B8791F97D 1.PUSH-UP-BHS
438,365,370 *2C675C8E926D28174F1F1D41061DE8969901ABFF 8---P*)O(
438,365,371 *2C6356A478681DBB7A5DF7962ED0E39D56F313F1 8REDISTRIBUTABLEB
438,365,372 *2C6BC893E854339D8B7FDB1BF4DDDCDD787303A1 8RUSTIBSW
438,365,373 *2C610421229BA626D241C3480F6688B05BF1C2F3 1-sijoittajillevuoden
438,365,374 *2C6FD00E46EA1CAB9092B8051325275824FE19DD 8TOTALISERIONS
438,365,375 *2C6D36515114377C6E3971C94FA610ACC43C1F6D 1TURNAUSKULUT
438,365,376 *2C6807DE7D590EF739F1BAA6A2452B3E307D2B02 8virginid
438,365,377 *2C6F0113FFBD5D63090EF4F91387DF9362FF4395 1-voelkerrechtsverbindlichen
438,365,378 *2C64D8080CC7A41B3804FEEECCBD1C5E0471418D 2029553 NAISJ
438,365,379 *2C66390F88ED29F6B970C19564BD5FD1D08C1A05 205723 DEVLETDEMIRASCIOLARAKGOSTERILEBILIR
438,365,380 *2C6AE3B52E75967661131CE3832F519647564B31 9BEARCHANGEME
438,365,381 *2C6C9AD833C89284F3CC10AEC0CC65EE664FC137 213779 VASTUUALUEJAKO ON SEURAAVA : VASTUUALUE P
438,365,382 *2C61711839579E715AF24FCB357277F464E0A82D 22207harris
438,365,383 *2C607EED1705F74927344BFF6066192E0F3734FA 2339912 SOMEOFTHESNIPINGPROBABLYSTEMSFROMRIVALRY.
438,365,384 *2C6184A502DFE69F27442A17438B914C3F069EAD 240110 "onemind"issimple-minded.
438,365,385 *2C6DBBEB0D1379C6D0479F780B53487B0A15C164 9GENNEMKOMPONERET
438,365,386 *2C69118E48C93A847FA01E2271A7FF334362E7D5 EGANBATTE
438,365,387 *2C622EAE42F0E42F9BFD3B854B000A4939B0FA1E ehssiurf
438,365,388 *2C69DCD1ED3E5819DE51AB03007E816CE829778A EIN-GUTER-FREUND-(BONUSTRACK)
438,365,389 *2C63CDF9FAD494FE3FC4E8AF11E709644B155E60 9proexercise
438,365,390 *2C6FCB91A3B9CBD49FE6898142FC576F84EE6197 9ROSOLOOLOSOR
438,365,391 *2C620ECF13C324E3D2FEB28914A2902E8E714C07 9WHISKYJOEL
438,365,392 *2C6CFD1125DBFBBCFFD63544D027C5A32926EE35 a0x=a
438,365,393 *2C6F9D9D29840F5EECF78DFCDD4B8BF919745B2E 28.05.1920
438,365,394 *2C60C7AC3312D712D79C0563ED2A39A17D57B044 EKILYOBN3
438,365,395 *2C64797377E4ACCAC9B7F8A6CF3C440AC1FEA940 28.fame's
438,365,396 *2C6015C1D42BA480B6854442C4082513F2DEF447 A3L3
438,365,397 *2C61FB7299417260BA498DB80F7BD1509C42FB21 ELDONTIZON
438,365,398 *2C6A5EF507E7622D2ABCF8E035C6F211FB6FDBFE a6
438,365,399 *2C65769189250372308ACCD443DC44CE2414BFEA ELFONKBBS
438,365,400 *2C6379D251110F7DFA5CB409B07A094A320A6B0B A7HKL
438,365,401 *2C620227F7449645FBA399334BEB954581C2E671 a9z5
438,365,402 *2C642D51F8FE28E4DED590312E4F1179FC656FC5 el{m{kerrasta
438,365,403 *2C6EE0B0531F381255490F2ABBDE39F275CA8A7E 2EGNIMMRE
438,365,404 *2C65B21CB7C99E0ABC7132B57658F416CB72E3B4 AAA0-
438,365,405 *2C6E89F7B990EC643E1E2EBC223F5E658F957509 EMANCIPIERTEN
438,365,406 *2C628F7AEF72608E3E329F71B32B3BE7DB1AE29D EMBANKETH5
438,365,407 *2C6358FABFFDA3815F47695337DE388BEF092C66 AAAX!Y
438,365,408 *2C6A391D9DD6A1C5622E6F843716E0A0E67133FE AAB[[email protected]
438,365,409 *2C6286D3AC4C0ED14BCDA7F28B6B5BD84B351724 EN172143104185X2
438,365,410 *2C60AB82175F6EE821C0C0F88CBFCDF619376826 2-NYANSSITKIN
438,365,411 *2C6BE79F186661E555B7E4CFE7A2162F26C797F8 2ORGIASTICALLY
438,365,412 *2C625CD4DC4982399D7843C3FD27CDC91735E0EC aac?`
438,365,413 *2C6DE40B7CFD68F483317B50AEAFD1F23782771A ENHOGD120X2
438,365,414 *2C65986AB5492AED7F7037F9BCE8F9BDE057BA99 ENOCH.RUX
438,365,415 *2C68ABED3F4B38A0C71BFF7D04FE62B1AF937F6B ENOUGHSELEFANT
438,365,416 *2C6D45D63F12DFD34C5DFBF59DAE238933AADA62 AADY/I
438,365,417 *2C6BD072318D98F3C8B64D7910F936F0714326C2 eoatf
438,365,418 *2C6FD7D41B2555E9E486798496D568DDA9FE289A aakash.narayan
438,365,419 *2C6BEFFC05C422478120767ED5BC2E64E7C64A30 aalx0
438,365,420 *2C672704051932BAE6A82F82D0821369AB958D22 387jenna
438,365,421 *2C6750503E13FB7F04DD6B2CC7C5F062885D9565 ERNIESIGG
438,365,422 *2C649CFC4D31C25C0A240EA9714C5EF3EE0A8454 a"b0_
438,365,423 *2C677E30FBFCE8853BA4C1357E75E2F38CE8363F AB1C[
438,365,424 *2C68CBD65A0CAD102B2B095326F38C27F4ADA073 3 BROKATSTOFFEN
438,365,425 *2C629B10F6620BF8E8DB25FEB3951C5E28D3F3AD [email protected]
438,365,426 *2C6681E6FC955946A7062A4B660DD4FF86ECC028 ERVIN.JENOVESE
438,365,427 *2C6E8C2408FF5D34007D40B2FD5D50ED9238570D abazilla
438,365,428 *2C66D821200A30441B62A7BD2FC7E94D92845C49 3D.~.~.~)O(
438,365,429 *2C67205068B4D90F39F9D27D5078C2B5A29EB4D4 ESTEBAN.FIRESTINE
438,365,430 *2C6E1A1334E605F39465E385AA57CC95D50EDEC8 3HAVAITES
438,365,431 *2C607473363FBEB36DED2FEAD7FCDE4E651CA797 3JTTESSN
438,365,432 *2C6748C52AB8903A8045426D2239FA42B289BBDA ETHEODHORI
438,365,433 *2C6B06FE02581E7922DD86B13FAE0979307B6F90 3LISTET
438,365,434 *2C66BCD731FC28A9856E712B57580BF3753846EE ABLF3
438,365,435 *2C6079D3BD56FCCC2A14C12D6FC7EFDB81CFF191 3PAMIERS
438,365,436 *2C6EFEE912F20D0E1678D6AE35838272EDAEB757 3PAYGANE
438,365,437 *2C62CE50C4CC80E7789D50A33F32B682CC541D07 3###p ~ ~ ~ (o_)
438,365,438 *2C64B103D164F474DCC444ECD5F9D4BF08DB6334 EUSEBIOVANAPRASERT
438,365,439 *2C64DD82A676283B976585A14344CA55946EB424 EVERETTEGUERRANT
438,365,440 *2C60D8854CBBED9A46A32E8516A0834E6DED2C0B excurs
438,365,441 *2C65554F70494CECEC3ECA86373FAFD99437C32C 432146 ruokailupaikat-j
438,365,442 *2C647DDF6926F62CC76C54E0C27356D7A72C4D9B EZEKIEL.ALEA
438,365,443 *2C6A4932F87A78CB0A8793D9D911E092F9495F2D 44deferral
438,365,444 *2C683AC2BEDFC53FC2AE4F205BAA47C2525DE577 475547 empas-bilgisayar-ve-malzemeleri-ltd--sti-
438,365,445 *2C6AEED3B5C0E53375A8403E4BEC1848253CBDF5 f7v:
438,365,446 *2C6DA05F3815A92C4BEA64385ED1B56F7BB8F55F Act.I:
438,365,447 *2C6B650E41752DFDB06AB30B4CAB2E33A7DD0E86 f%af
438,365,448 *2C67F0A779CCDFE7F8B70480383FAFE8980CBB50 FARHANKAMARUZZAMAN
438,365,449 *2C6B1A98F36587A3885C5A7C590BF20330464AA1 ADAM-GRANDE
438,365,450 *2C676EEF2540BF9A835F5FD083A012A9FC8C3590 ADAM-GREENLAW
438,365,451 *2C648C962C34A6FA2E9697C7159AD6C8724737D5 ADAMLISTER
438,365,452 *2C6DA19FC4C2473BF1A5322FDDA46CD9D664A732 ADELAIDE176
438,365,453 *2C66D5FF7B7334AF9D09728A48A1A9C61F190EC3 adeste
438,365,454 *2C60BCC33A49CCFFE49A6393D8EF17EF241DAE08 FELICIAFERRIS
438,365,455 *2C63B3D07623189A00FFBDC7FE7E0CB405045F42 FEYER!
438,365,456 *2C6E22660E795822C421610EDFAC59D0752A733E [email protected]$
438,365,457 *2C6780B6DDF7CA2563795ABB7EDA3F48792EBE9F filibertolimerick
438,365,458 *2C6B0974E324BB7F6EAA7783663851E3F461056F 4TIMULIEZ
438,365,459 *2C6E8D43E715488D94A32D87990B481499108C07 aeo+-
438,365,460 *2C6DE31DD8F07322FC263589E690120C813E64BC 51BNE55
438,365,461 *2C6AFC1F551B8FEF069B83F4DF6B1C085246E0FA FLOYD2673
438,365,462 *2C6D99D350F450305FA8B352FE507D60095A5E29 [email protected]!ng
438,365,463 *2C69536C973982C780C79EBC9041410B2D0EAB14 afn8z
438,365,464 *2C66681A591A78481A4FC5B00748C38601F4150B AFXZ%
438,365,465 *2C60B3E349EECB6583043DE992917351F4675C95 [email protected]
438,365,466 *2C6AEFE78673BD2A51DFE843FE8205BD17FF3E0C 578TIMOTHY
438,365,467 *2C6FBC6F975B16ACBE551D1B3F5A1E9916777DC5 frbp
438,365,468 *2C6184B2128DC66ACDD53F16996031C30C340968 FREDERICCOFFILL
438,365,469 *2C662F721E683A312098AE974AFB99AD588FF8BF FREDERICFOUGNER
438,365,470 *2C69DDF69568309C809FAC842C4312549832879D free-wheels
438,365,471 *2C644CF87687B68D0605EA5EB371EA94B057B087 AII4Q
438,365,472 *2C6795038888D9C3AFC559DDAF603B048A105D97 5.GOTTHARDSUEDRAMPE
438,365,473 *2C6C0D4333D947A9C07C8266946BF0A832AD917D AJK3
438,365,474 *2C6F95DCA811F3FFE2BB0019E65870B4E18D4761 ak-?,
438,365,475 *2C6DD71618F3DED524C1105D2BFF3372AF36E4EC A,K7Y
438,365,476 *2C690DB7739A4CE5461B349E10006C1836828BF0 5LAMOUREA
438,365,477 *2C686BA48138E0DCD01B5630A81836B66924346A 5MINDREVRDIG
438,365,478 *2C63B9EF6C00EFB2CA909901436E46C491E0E3C1 5MOONSMILES
438,365,479 *2C617FDB80469261C4A2EC9B94D4435FE315A2B0 5ND
438,365,480 *2C681B5729BBA185DA20DB6F1AF22F07DBF3224A 5OHASHIBSW
438,365,481 *2C69B09CC7791FF28E4731FF20BD80FA6917E526 ALDOWHIRRY
438,365,482 *2C6C3C85EA639F79ADB29621F6D00A0CCADD149C 5REDGREV
438,365,483 *2C643417653F1699DAED4A3B15BC522D3129F2FA G164592
438,365,484 *2C66D4A33F507D6A235515007C683551BD17FE73 5SETAUDIVIDNI
438,365,485 *2C690B4945893039E693471B0ABC4EA2B52E3DFD GALEN.SHAWVER
438,365,486 *2C619517B7BD98B0AF76FAC549AF8385185737DB 5UNYN4554U
438,365,487 *2C6E3DBF842C8057D6F4F2A3F268D35D629DB522 5vanhempienkin
438,365,488 *2C6F4DCE140E07483130C53F8E7EA207C5DACC0F 5VONSBSW
438,365,489 *2C610A3CA0CB9600F566B1CDEBC27EA1A0041F21 5YOTUASH
438,365,490 *2C65B479A9D8B08725914044CE433FE17FA7C7C9 ALLANCOLLYMORE
438,365,491 *2C61F36E558E26DC43ADAAFFFC0EE5FA49F80EC2 6AANGEDAMDEN
438,365,492 *2C606AB902F6DC74BCCE8BBBA14EB1D692A1840D [email protected]
438,365,493 *2C698BE833BD045F5817BCA35F11D11598853419 alsof0
438,365,494 *2C6D0E5B4FA70211163B3A137107CA6A75BFC9C2 gehaense5
438,365,495 *2C6FBFC8B4BB991FB9FA2D0DA95C43A9E24B6F7D AMORGAN1
438,365,496 *2C60C5F4E3B534D8389B6005F3DA986F7FADAC19 GESTREIKT
438,365,497 *2C6047A1CAAB693CDA5A20915E9DE5E619375D2D 6OPERATEURS
438,365,498 *2C61D9858326CA318DB1DCCAD21823BAA8B6E4A1 givrant?
438,365,499 *2C6D957654A023B969EA8DB27AB666C89F7E3C6D AND-OBLIVION-FELL
438,365,500 *2C6A52BAE0D4099F572C2665311595FEBF8DB7C1 ANDREARAIDER
438,365,501 *2C6D21EA25D5F0FD8C12AA2E7DE620DDCF176CF6 glenn-ferrante
438,365,502 *2C66642293CD30E2ED398C07EB96072CA6764270 angelobalensiefen
438,365,503 *2C6E558799D3E14E7F97A25CF5AE5690B1204636 angelonocum
438,365,504 *2C6E4F4DFA7BE79D2ED439E0F6E91CC359B02B40 anibalwinkler
438,365,505 *2C6A404EC2897ED7BA4A027D46493FF4E9E3D9B0 anj_
438,365,506 *2C6D7A25740DE8CB3AB92A2FD39338805D66E0CB GOLFESE5
438,365,507 *2C6195D6353E40E8FBCD04F4F44E88553FA6BB9F ANTONYDOMINION
438,365,508 *2C66C4EE0D07D7AB762417B6800C49E89301B1A7 GOSPEL BOMBS
438,365,509 *2C6F3E428D6D83F0A28672E0E89E425D7A2B997F GRAHAM.BARDALES
438,365,510 *2C6A8C308E32F08A4A7F7CD4E5F1EF89BE250BB7 GRANDEST.ILLUSION
438,365,511 *2C63CB5596CDF64968519945A57B8B08E20C8FA7 aov+y
438,365,512 *2C66B2EE3D0CD7E443BFEA3E82D52622C94A85BB A;PL_
438,365,513 *2C630271E737EAB692D1CF9C059B5CCEF5AC43BF Groovy.and.Prime
438,365,514 *2C694B2B059C1F98E44D7E2A9713543910397BD6 aqft,
438,365,515 *2C60598DCF8CB5ED367E91EB66D9DA9902D66456 7PANIQUIT
438,365,516 *2C653E76E76951AA7789F7CCB6BC391E333CF959 GRSSVTR3
438,365,517 *2C6644AB93C7B6A1C2B80CD6FAAE950A6D00E5A5 a(+r)
438,365,518 *2C6C62B433457FC589932B740D0F738889EA70B2 archbuttant
438,365,519 *2C6F33EDBDED8171C9AEF51AF001DF82C30EA987 ARENAUBC
438,365,520 *2C6266B1C00C1A3F7A39182BA3882A18C83B2270 ARLEN.SUTTERFIELD
438,365,521 *2C651EC58489506B8D8BAA1D931BBC50475B6CBB gusmehalic
438,365,522 *2C6144F23A73CE925CDF2B1BB5F2443749235A21 arnoldomorillo
438,365,523 *2C61BC98FD773E61DFCA4C48BE04C459A2EE14AD ARoi
438,365,524 *2C6357F7BC376742363A7DECDF9948BD517B3E65 GY|
438,365,525 *2C6C6E52597A7F339A2D0F03282E0F8F7216B329 HADFIELDEM
438,365,526 *2C6BAE7FCE383887C990D63C8C8446E12BC5E520 HAI.FANTZ
438,365,527 *2C62BC4303DB29F2A6AC84CCF8A2A5EB509782F0 hailatu
438,365,528 *2C674483072D7ECA0E4D332F96937D7ECA4B9FA5 ARTICLES450451
438,365,529 *2C61C7B391E7E4FC95C77CFF3D5E6892A2226249 ar)y
438,365,530 *2C69745BF32897E646C665D871E35D3FEE09B95C harlanwambach
438,365,531 *2C69261ECA1C4671CAF7E76A3874E289900799A0 ASHLOVESJEFF
438,365,532 *2C6CEA9FF2783AF44B424D99B9F0E26268D8D8AC 8DOWNSON
438,365,533 *2C6D9304748DDD97F97DA1C8FE083DAE87867AC0 ASIPUGA
438,365,534 *2C6A96F68F8656E7968D1C0D3CD546322CC6EC85 ASSIKALO3
438,365,535 *2C6BC864853DA80712D553B28B12C40C9BB6BEF8 ASYMMETRICED
438,365,536 *2C62CA60CC5D147E67DD7158C9ADA34E895AE711 [email protected]
438,365,537 *2C6CE5A71ED8FD833273110C9C25A1B30565D9A9 HAYDEN.ARAMBUIA
438,365,538 *2C6DC6995D3AA8133C99B5D44CC4F377FF7BAC5F 8.L
438,365,539 *2C6DB4F4210041685614C2B3BBAA08328EDFDB1E AT.KO
438,365,540 *2C6D2E72EFE63DADCA6DE993A62E4F59188A08A1 ATSESOKU5
438,365,541 *2C648AD25D03A97A81025E106C8BE5AA0E18F868 }8{ O~ 0~Q-P
438,365,542 *2C6437A3C1B10B390D7AFD0FAB24B91CCB86616C ATTH
438,365,543 *2C68804AE454AC6B60CD0B5481A927A3C1A82522 AUN-Q
438,365,544 *2C670C8124BC96B14E34328B47E7C06DFF0747C8 HENRY.PEACOCK
438,365,545 *2C68B6033C6027F858B3D8232FD5959499C9DF56 HERBERTHO
438,365,546 *2C6CF95386C3DC2E02FD5B4F427BC1FF61A0FA33 907903 voittilatalistatuttuotteetpainamallatilaa-nappia.
438,365,547 *2C6EB6B7001EE4164CEAE418AE1C5839D1693774 913fmwyeplive&direct,volume6
438,365,548 *2C65D99886017714B3D082A51F40A07DF7812F34 hewasplaced
438,365,549 *2C65F4402D3C8214E9B4268848CB914CF43BC8D8 av#!q
438,365,550 *2C6598533F3E7A4EF47B41DAEDD4106C7855E965 HIPOLITOGAZDA
438,365,551 *2C69E8DC2392A621D2E8030FB6D1C8E6B17A2D55 AYANSKA
438,365,552 *2C6EDBE3E0715A64147C94C164F7F4DF84727925 9DEAOLLOH
438,365,553 *2C6CFF52D187211570E0151A2B5C39FD58CAF5E3 HMAGASHI
438,365,554 *2C6441E1BCBAA4519C4BB3BE621D5DE77156AB01 9GOLDRING
438,365,555 *2C6863FB930C47384140BEF886ED4A5B39B25078 HOLANDSKS
438,365,556 *2C655CF790045E1EF6804C224A700441312B4AF1 homodox0
438,365,557 *2C6AE2D3594598F4A4AE6AE550FC2714AD71E03A b5ruk
438,365,558 *2C68A11086C9AD80385911534DA640110B72D824 9SYSSYMTBL
438,365,559 *2C64B65EDC7CC2B3C279A3B31BB276AF4E363C5A hoseaavino
438,365,560 *2C6A8D4E5297EBB7B3B8D9025A270C06D790A277 houstonagreda
438,365,561 *2C6C82B8ABFD4E35A6DEDAE12DA95DE3449D213A howardturnmyre
438,365,562 *2C65D746E6ABD2F9D44AD674E61B943AAA443F0A HOYT.HOSMER
438,365,563 *2C6D120322B1680870CA9F29050F93EBE99C05F1 \/baa
438,365,564 *2C69F594D0EB2EFA07CE3880F74B56BD83A9FAA0 b#aas
438,365,565 *2C694A2BD9A101B770F5AB737F2863F802EDC932 HS*M
438,365,566 *2C6813FEC39F2392D6572E62C672188B9DDDC183 [email protected]
438,365,567 *2C6673B7184119B1A8BD61F197B52FC5805F3D1D hubertbuchmann
438,365,568 *2C64B56845C997CA9E47C75AE7B2BDFD8BE46E7C HUBERTMAYOKA
438,365,569 *2C6C7AFCE74E5117AED758442E9CD74D32E1FE50 [email protected]
438,365,570 *2C6C0CA562C6D94332CB812D2DB7395021C495D7 bankash
438,365,571 *2C6AEF15EDF4AAED25F694D07FBAE5CC0BBAC831 A!8SN
438,365,572 *2C6DF272E2580FEEDBCE9A30AB01CBF47BC794AE A9SENTATIONOGS
438,365,573 *2C66A86769C2996A2C180AD87A5D92B39DECC715 B?CA
438,365,574 *2C6C239383FF25626FA11D3F9879ECC6B9576777 AAA-C-
438,365,575 *2C693C8365F8942CEB8612664C708D40A49B10AD b======d~0 ~o)o(
438,365,576 *2C64834E810A44B8858226FF2686D94F5198597D AAD"=
438,365,577 *2C6D3C971486515189F4E30597EDAEC329CF7F6A BEATTIENS
438,365,578 *2C66E8F57260978F4CDA2539FEE2CD8754B5DC79 aad`)v
438,365,579 *2C660E9C94A3759108777E9F0F8437036D6CA14E IGIXOLITUMU
438,365,580 *2C652EE4CF716B84F1E0DFD9B3B84A78FCB5129A BENITO.IGO
438,365,581 *2C6191C17D83EF8D6C6F2A9B38860202A9EEEBF8 IHRROSEMING
438,365,582 *2C686DE719B1DEF8C41607A540E54B40A90C49C6 AB:-I
438,365,583 *2C63611E49B28ACD7EBDEE6AC32A95FC389020B8 ABOUTVUU
438,365,584 *2C6DCBC5C6522914C6CEA7944F4284F74EB24A86 [email protected]
438,365,585 *2C6CDBAFBC60A338F687CEFDC6CE323540D381DA ac0e
438,365,586 *2C6BB0CEF0CD62AB6D4F6BA6C9C331D092E0E04B B-+GU
438,365,587 *2C653C5A13C14731772A1F5B78919508BDE97ED7 INDMAD4
438,365,588 *2C6D777B7D4A936D0A9E7BAA2C611C1C2288F1B7 INNAMOUSSA(ARR.V.IVANOFF)
438,365,589 *2C6B377A95C3A97A515522109A72F2352A9AECA4 [email protected]
438,365,590 *2C6284A9A99E81F1B5F0E3363159D16373F583D4 billredskin
438,365,591 *2C6EC1956E6AEB4A2E7B22BCB6DFE514FC7A317C BjE=
438,365,592 *2C6E1037776853FD9CA3B5B59D9E040D43826365 BK_O$
438,365,593 *2C6A8D031F596F3F0CEFF866806A1886B8B58101 ISIDROFASANO
438,365,594 *2C696418AA8E3A88D582B30B18D27D13065265C6 AIBTHIZAM
438,365,595 *2C6E923CD0635FB2888BF572824E1DBD1F71DF31 A;IH=
438,365,596 *2C61EC947A853E4E65A1F250EF36207FC94EECC7 blue-magic-fon
438,365,597 *2C6D9961DA9124F59927787D9B8921FDA10DB87C it'sstillyou
438,365,598 *2C62D430FB3E7008413541714E7EB205A8D575E0 I^Z9
438,365,599 *2C63244129643D235F3262E8A09FC1FE952983C3 bo1su
438,365,600 *2C660ACE142653BC783EFF11743BEA27221D82C3 ALAN.GERRARD
438,365,601 *2C6D8EE5B668ED06CD3CE7295F8C29E1B124FDFB albumozo0
438,365,602 *2C6BDE2988613B3051F04D2B6EF3CCC2FF409515 borisbakshi
438,365,603 *2C6458E3FB08E9E7D9104D8A915C141927010AE0 alissa.wertz
438,365,604 *2C6638F3612D6DC2B44F43FF4F4E93F55B7A18C9 BOUTOUANOU
438,365,605 *2C6E89468CBBF4E8C28986293A53333FFC34B38C jasminrebels
438,365,606 *2C683F665987118F8EDA19736A6A03A26863E3F2 JASPERYELVINGTON
438,365,607 *2C61B1B0841F099BDB1965223515E9B8DD4ED34F jaysonchapple
438,365,608 *2C6280DC16EF1E86A687A524DBBBF9B911A7F7D7 bp/p8
438,365,609 *2C685ADB723249E4D6886F077DE0E0E260126943 BRADY.PHOMMATHETH
438,365,610 *2C6FAE798C987C6C456D36477C220BBEAC44EC7E BRANDON.ZISKA
438,365,611 *2C60B83C8B2FE700912DD5B24F761A4A53C650D1 BRANT.PATCHER
438,365,612 *2C613FFE4526B5619BE29A6C0B528C49FAEEB1F9 brasileansbsw
438,365,613 *2C68BC396BE1785C2945BDDA4018CF95096ABB0F JEFFREYVERSAGE
438,365,614 *2C69E3BD9FDD1579B2ED7E2B97F3944D426D492D AMADO.CUADRO
438,365,615 *2C6E65A413C98DA5C7090DEF39BF73BCC2D7BFEE amandapajak
438,365,616 *2C6109D121F7973F277E6F2DC78DD862C72A5D2F brianniggl
438,365,617 *2C64B63AF40CA06B64D7E4DA0CA68942037F245D jeromesankey
438,365,618 *2C6B623D7AB5A53EA16E7750F841E1BDE349A492 jerrellteddick
438,365,619 *2C64896174FEDB57CE55F906B59C7C90E54A44ED BRUNAUER2
438,365,620 *2C6CB1752088C318159B33C2A6D22B5A7AE2203B And-by-the-way-possess-thee-what-she-is
438,365,621 *2C6C4E0D7628B195F848729F0D2D080F64D4E729 andrea-ruzicka
438,365,622 *2C626BDB1793B2842C23DF5B993F759392F50AB6 [email protected]
438,365,623 *2C66426F141353D1EA57B6D87831C9EDA570076A [email protected]
438,365,624 *2C6E98FC8BCE4808769E194E0609F30620C23FE6 JIHAD (BEYROUTH EDIT)
438,365,625 *2C610EE1236EFB221B44E4E83DAAD90FCA9E6950 jim.ausburn
438,365,626 *2C68F0E25DA94CC95C35BC7881E0670B4703A498 BTIP/
438,365,627 *2C6D32E2A8EE8390A35EC0EF15EB374CA8E58FF5 ANIVLUTS5
438,365,628 *2C697E83ACD2476657FC60867D54A117A34A46A8 btytu
438,365,629 *2C6756C23F0838B1FB8D9BBCE14425C2702E4CAF JJ ERICKSON
438,365,630 *2C624BFCAAB8DD5B982BA4AEE2BAA8CB1D606B39 jody-duvall
438,365,631 *2C6E928B3118AAB63FBC286876FACF84E689DA8B jodyhardiman
438,365,632 *2C65983DEE2D74A993C555D9DC7330F0904104B0 b.udg
438,365,633 *2C662CE1D36FCE84AA92193D87B1C9DC592563DD BUFORDDEFLORIO
438,365,634 *2C6AB4FF1CD668192EF1435658CB7869AA2A9448 b)ukw
438,365,635 *2C661EEBD3931AC0F72D5535AB1EC1D6EC8129F3 ANTONIA.BUREL
438,365,636 *2C6B81DE5A22479515BA5E11FDE5A907DB9AC764 JOHN.SHEDLOCK
438,365,637 *2C6D9EC9FE32B7EE9DD5CD16D3FFB524FA5B95BB JONASCAETANO
438,365,638 *2C66D73B012FB4C20158C58E342A211BFA793DE6 jonas-walls
438,365,639 *2C691C0E87A82E1C34FF1A06E59A05FA70F6FF9A aoe#
438,365,640 *2C6A65EF1883577C862FB83F21FDD496090FFB53 judsonautovino
438,365,641 *2C6D4024194F2D3189EAE100C1886B39CB884DDE APQ+C
438,365,642 *2C6BD0B0A83C654BAB0FE128CFDF3C4A3EE440FF c"(@
438,365,643 *2C68B050DEB1DD62ADCF03BC604070DC7BDFC2CA JUSTIN.HERO
438,365,644 *2C678C33BADD2D80394C1AC85D4BA64FFE76A98F justitile
438,365,645 *2C60E5399C8D78F3ABF86EA0F6868AD454E35D2C KABEESS
438,365,646 *2C6924AB07462BB5E4D72454FCD70C42B8081174 c)1b8
438,365,647 *2C684B1912C4784544AA252AB180CFFE5880B982 [email protected]
438,365,648 *2C6FA46D6B0EE40AF95D9BB0921B550E7D3652FF KAPPKOLONIEN
438,365,649 *2C6F015B1E505D86D8061D80E2B7FA7294FA8764 C3KL1
438,365,650 *2C6D149C696A6F37CE99AF7146341DFBA2A1EFA4 keenanwhitmire
438,365,651 *2C6ED42038F593B3F5D388913A407FAE85F0985A keilden
438,365,652 *2C647A7AF2A2027E316DDE4B2C7DF8AE7D399B1B c7j=n
438,365,653 *2C626A45ADF570796295CD427FEC76A62DD27E40 ARNULFO.CORDIAL
438,365,654 *2C6C46720063553C3FED76E700EFB651314BDD07 c8oi
438,365,655 *2C636403EAB85B9A95C13EE634CFB89BA0D852F3 KESSELAUSR
438,365,656 *2C6B1A9064A075466EC5D6A8DBC5190A4D6F48A0 [email protected]
438,365,657 *2C605E2C1741A7CA45C36724D2369F832598AA4B CA/:
438,365,658 *2C667BCC1944616AD990F04DB21714F9862C3E7F ARTIKKELOPPRETTELSESSYNDROMET
438,365,659 *2C68D1628DECF08DD8F23967A719899FD5F8AE7A kiljuin6
438,365,660 *2C691A3EFF2E3A64D39F2338F8A93B97B94CF32F ARYA-KENCANA
438,365,661 *2C6456481DEB58AABE2DBD6EA3478C556A0C2BEB kirvek distributing co ltd | canada
438,365,662 *2C66FD8C4E199BC5A5FB9EFBB9347F8959A3BEDA kisjátékfilmek
438,365,663 *2C66C314DB0699D0C343B12F1909A378A23BF268 CALEBLACKEY
438,365,664 *2C6D96457964143A56849E42B0492B5BCA558F67 kololopo
438,365,665 *2C6BB2D396669E88C37399F67E2074746AA5C795 [email protected]
438,365,666 *2C6DBB44E767C6964BA9C7102278BF0417FD42C1 a-sos
438,365,667 *2C6BF71F979AE0289AD0E813325562570FEF542E ASRI-AHMAD
438,365,668 *2C641AF0106E0A7D7BB2E01EABC51D5A58AAE0BF cameronsquyres
438,365,669 *2C6A63D6FABA64421F379E50631E637550C18AAD ASVINARSKI
438,365,670 *2C60E9FA95A55AAEC373240902324E74C2EBAD5D K[OW
438,365,671 *2C6DAE2947C74998D4AEA5C97AC60A0781E53456 ATABL
438,365,672 *2C6C3147014D73A5CDD388D7AC256CFC73653837 kristophertram
438,365,673 *2C64ED97ABD9FD093D9FFE639E5AAB92507A9FE8 ATTH
438,365,674 *2C6C953521261C7C298C630A8B58494A0F36FB84 CARL.POLSTER
438,365,675 *2C6EC1929D1ED283CA5D7C7ED2D3608018E74F5A KUDOSLIIMAT
438,365,676 *2C67730ABB3D3551D50EFA0AACDCB785B96E326C CAROL1948
438,365,677 *2C6C5AF59B69C6D92F40A400B4C4538F0B360D5D KWAAMP347NIEWSKILTBR
438,365,678 *2C648076006DBA221F6D9ABEA643A139A81AA3B4 AURELIOCUBETA
438,365,679 *2C6D251843F2DAA7F43778909866462A7A28C1EE CARSON.CULLENS
438,365,680 *2C618394006F6763A3BEB8A2843CE5739E6F8BBD AUSTINCOUSAIN
438,365,681 *2C606161A6FC216B68FB56BF0DBF757C2D58E40A AUTOLYTUS
438,365,682 *2C6CEC6C15E3DAAC47B88A9ED91D4BABD2AB5B46 CASTILLODECOYANZA
438,365,683 *2C6975A1080C51D6BE15BE32478FBC50D307E315 av"a4
438,365,684 *2C6C3FFA6169446A8FB20A963E7C6B3A2C949707 [email protected]
438,365,685 *2C6540CF8120E2BCDD3392695BE34ED4CD9C45B9 CBEJ)
438,365,686 *2C6D84BA85E0F29E7C7BE5724084E1277DE31052 B!;0F
438,365,687 *2C64EE3D8E30DCF8FEA46D87156301DB04D0C283 CCKY
438,365,688 *2C62220D5656F1CFDCF08AB7F039AA279BD1DA71 [email protected]
438,365,689 *2C61BCB43E2A974CA9FD1A29E151CF53AAD4BAF3 [email protected]
438,365,690 *2C671D6E84CD81708835F167798CD4895536B39D CDMINOR123
438,365,691 *2C61BE46C058C83332D072A62FCF5C0C1D1D6E36 CD/NL
438,365,692 *2C64FCB01AFF177E010E52308E989E0B3967A542 leafclad8
438,365,693 *2C6BAB18E7D7A34DBEBED81A7E740C5DF4D5D40D b!5tl
438,365,694 *2C6FCA30919B43AAFF968D73E71985C9F15F4D6C B676333AF919
438,365,695 *2C6BFB88E6D4244075EF923005162A23BB20627C B6o"
438,365,696 *2C6960F215DC4FFD9B24DDA3AF1D617518E3B380 C,F6D
438,365,697 *2C62A59199465340927B9F3680D55D7656B8B1FF [email protected]
438,365,698 *2C6CB7113E56E665F3CBAC2176E745537385778F baqmb
438,365,699 *2C6ABA8BFD60EDC10AF35EEB56A726E9A19A401C le-show
438,365,700 *2C6A5C01BD4FB6B3105C1B41B220291728CD59FC challises9
438,365,701 *2C60BADC575DA0796EDB2D650B6D2F98D04E0BA8 LEVERS
438,365,702 *2C6E6761F5C00CA9C23A8AE8E051E82EB047DCC3 BASIL.SINGS
438,365,703 *2C6D4FFE674C5D122959D15E5927C7CD0511D769 LEVI.SOPATA
438,365,704 *2C6A790541B659E79B0E0364BBDEE19BD1B5FB2F CHAPTER.11:.LEGENDS.~2
438,365,705 *2C6B48FA4A89434B64F9A9F62E507CDB6EBD9362 BB03FB
438,365,706 *2C6C8B95FC3A63FAE86E8A26A49F3C87F4446F3E LFQTBSW8
438,365,707 *2C614C756E35927F2956F2888BA1421E68E8599E CHARLEY.COUCHMAN
438,365,708 *2C6BDE1B8E2572631749A7776B35CFD927D6F11D charlotte.mouncey
438,365,709 *2C6D932EBDE9B3346781D6D75523F084DE8C9029 [email protected]
438,365,710 *2C6F97F5B952030B2F9EC5101065B2007102E7E2 lic-cg
438,365,711 *2C61715A9787D2D1E4FF37574EAEC64D54A58F5B CHENABABA
438,365,712 *2C6BC0C04E308DAA0A6838A7D174DEC943B3865E BB"RF
438,365,713 *2C673B2CEF9B5441120EA9EF8F518801C3249612 b(cvn
438,365,714 *2C61A25993BF837A07045391200901975CB13EAB BDI7"
438,365,715 *2C678FA982826CA6A84C5D70A8A72D9AB4F44F89 BEATFEET
438,365,716 *2C65E68BC8F2441D425B9A7470EDAE76137CE479 [email protected]
438,365,717 *2C60E5B17F11A38D65627AB222DC5E2EF3769382 b?e=n
438,365,718 *2C6706735C7905A30531D009ED34D51CE02CA63B BENJAMINHOOKANO
438,365,719 *2C679FD9AA2155A69EDAD41201E0874AD34023CA CHRISLYNNCHEE
438,365,720 *2C655BF53778B3C9137773EDCF1D5F9CF5FBF552 BETAKEN
438,365,721 *2C648B21C897AEE088899D60F7524FBDE65541A4 BETONIES
438,365,722 *2C6D3F47BA272AB6B34E37F87AE79B54251A3125 [email protected]
438,365,723 *2C6385B74180C23F682529922DF557F2D4EB793E LON.BOUFFORD
438,365,724 *2C6BD030E92079F7EC190441A343715BD0B1678C cikuw
438,365,725 *2C67B14AFF5976C4FAFEB326BFFB870F118C6A14 bihf+
438,365,726 *2C67A67349EB1B850CDDD8314498B8255F959109 cliffpijanowski
438,365,727 *2C6EC4E4B30990DE04AC173978E35CA608DC446E CLIFF-ST-JOHN
438,365,728 *2C63831E55D40332E23219F947902764F3B56C7C BILLYMAWYER
438,365,729 *2C6A161CAB252CB492F42597AE6DD476450856A5 CLIFTON.RAMINEZ
438,365,730 *2C6ED9CB2D60E44CDDE25A9CBFCB3061D6015FD0 bimelde8
438,365,731 *2C6998DED50014EFDD834AE8BCEEA0CDD62405B9 CL/IV
438,365,732 *2C6D177B78F20BBE5E51D4337606152BEFED24EB [email protected]
438,365,733 *2C6E43832121EEDD88B69138AF8C5E6BAD005DD1 bk3"-
438,365,734 *2C69734F8ADA6628BBB68669CA0D1665B82AECB5 BKDMNNXLS
438,365,735 *2C65E12B0180E55D5EB25D447891756D313470EF CLYDEZABIK
438,365,736 *2C6AA0FA708C4A936FE32604237661CC81EB2B17 lupaus-kes
438,365,737 *2C6B7A7EBEBE80E8BD2DC639D271A197187726FD (lúthien)在嘉蘭島上度過餘生。
438,365,738 *2C61E30E856DDBE7440A628A3BAC254DCFFEF72B blainebacchus
438,365,739 *2C6B68B3F45DC74737D508200AE72D692479B9DE CN2$F
438,365,740 *2C6892DE9A249721D0429D541833D4A5185A282A blogsarmcomblogs
438,365,741 *2C6EEB6FC1A0CEF66AF14C86D00608C0B9DB65AC codyboeson
438,365,742 *2C61FAEAA27E0A287CF120CDDE8173E7F69BD251 B&%M
438,365,743 *2C632D48BD32EBFF5BCC12F567C1F8984BF4E343 MAHMUDUL HASSAN BISHWAS
438,365,744 *2C621D15F00A07B8FEA0B8BD90AE8DC09D19C215 [email protected]
438,365,745 *2C6297978E4B60A7EF49B6012C8871ADBD4C8702 BOLIVERKINNE
438,365,746 *2C6C8FF1F31502F5C8D8BD052B75106290FCD702 bombardą
438,365,747 *2C6D4D83F1ACCB6557441F1C8EF39748ED5AB708 manjitrao
438,365,748 *2C647CD70BFD4ECA0C11DBB6071E1A4F04F79907 MANPECKA
438,365,749 *2C61456D4E4214DF0A0901998246543F2B1AC094 BOULTELL
438,365,750 *2C63547F1F197667193A87D21E93C0CE86BC88B9 BOZ4(
438,365,751 *2C6EDF6C7376CB1DDBD1F3E4D24BC6E988AB44F5 C:\PROGRAMFILES\MICROSOFTVISUALSTUDIO90\VC\CE\BIN
438,365,752 *2C6651EF1D954BA8B551204390CDB6C830EC24E3 Cq0
438,365,753 *2C62B84A12EE78DF16CE3EA7B2FCC63776636450 B(R!/
438,365,754 *2C6659C835E054341043DFF32AD91B0B129E78C1 MARILYNV8
438,365,755 *2C688A10CEA26439870E364A0503CB843B9566FA crt38
438,365,756 *2C6F1A00F0CFBD39CC62F4C9113E3F15606E3B71 marshallmahaley
438,365,757 *2C6AC9574BCA9AFB6643938AB4C926F5BFC1A5E5 MarsvoorJezus
438,365,758 *2C69B20DBFFDA52931B9B88A446A493D4BFFDD92 MASTER2010
438,365,759 *2C6DD9D253D383DE644BB611CB59F4D0D8BC5C7B brkwo
438,365,760 *2C64A12F53A2E3023BDFC66EC689D8D53FFC8F34 BRODERICK.AUTIO
438,365,761 *2C612D48D01C4A78649270AC4063A2CA8A17D585 [email protected]
438,365,762 *2C630A8D1E3A4F48A423246E5DE455125977A48C CURIOSOS»
438,365,763 *2C6E535E1F6E3E6032C656A30375BA01265E1995 BRQ9Q
438,365,764 *2C67EDBF96AEBA2AD256C27187E90AF184D24070 BRUNO.PEMBROOK
438,365,765 *2C6BAF9CDE5A3874A77FCB25A1D1431315898531 CVGEK
438,365,766 *2C6ACAE906C67C3FEE559F02B46B54EDF5D59FD9 [email protected]
438,365,767 *2C68D9D796C202C95B516E77F9EE5CB4C2F49490 BSV9M
438,365,768 *2C60A0A04E60ACBBDD30DA5793F91833191623B2 CYGX
438,365,769 *2C6A48E2A7F3B0B8EC38F07992BC4A83667072FB BU5##
438,365,770 *2C6E66C9BCD0083F762700B1DA343EA94D3BAA5F BUbv
438,365,771 *2C61B92B8518DAEBDF1D192A5F096C672A8B3695 BUFONID
438,365,772 *2C67490F7873CE7F8173D8B51E4A8E19595C4F98 bulcard6
438,365,773 *2C6D2BD1CDF444625893CBB3FA27CED11EC1B7DF D8;;Q
438,365,774 *2C6CC66153BED1142FB5335A93E2FE7BE974A311 DACUNIA
438,365,775 *2C6E8CF4DBDB49D32D31FE28E4FE5BE6CE109726 DA-EN
438,365,776 *2C6A149E36C734826320D2D94E1267BBE14D71A7 [email protected]
438,365,777 *2C6E629FA58D5EA11BCE54D4A32D80EC36242758 DANADUCHANE
438,365,778 *2C63C962167B1B8E72A2D58A172DB9F732676E66 MILLER51HEINKE
438,365,779 *2C6CA86BED7FAC31FC7BB3636837E81C15CBB03B DANNIAMO3
438,365,780 *2C6CCA8BA450F4D1C2202F847792D94AE584414C C82220
438,365,781 *2C6508EE9D06EFC0662A7712613B4FE70580A98C c8)o)
438,365,782 *2C68E0625B82F7A81A38F1DB36D0DAE7AC3E33A1 dans.la.louisianne
438,365,783 *2C6E351CCD9F8E7F255704FCA2ECD08817FFDA20 DARIUSGOURLAY
438,365,784 *2C65615F1573861A5358F013F2CC3A4B3C18712D DARNELLTERRY
438,365,785 *2C6D1622F3B5F533CCAB1AA7B6CC706154866A9E darrengroshong
438,365,786 *2C6E5408175D6AEEB744521956F14ED09160CAD4 DARRICK.STAN
438,365,787 *2C69B4A913270D3E44F2AB536E9E59DB0BEF6D28 DARRICK.ZWOLENSKY
438,365,788 *2C6C8E36A9D33C76D526A9B3D3F89BA502F1D466 MONEMTWO
438,365,789 *2C6046235E152649B5280E9C654D1D65C7710DB8 DARYL.COBIO
438,365,790 *2C685AD0B6E2DB92B659DB62CE4A78B351191291 CALDK
438,365,791 *2C64681C255974A5AA5EBFECC97AB673A0777A51 calebvannest
438,365,792 *2C63F3A44A3E30008E1D93D2841F440364E624D5 callherprincess
438,365,793 *2C68E4EA260FC11ED40D6E1B90F6B22AF2CF345D morganheggan
438,365,794 *2C6B3B3C792630C31CD12D5F198AA294BA61DC6F morrislowes
438,365,795 *2C68A214F932403534B5B588229E242DB5996924 MOYLLYOM2
438,365,796 *2C63D9A1590853E11C43C396F599550AAF1259D2 mqia
438,365,797 *2C63AFEDB2C985A9BDE142761575BCC11CD3B56B CARBOXYLASE
438,365,798 *2C6FE3EF9335A3EA09662A7E4E13534F6BEF70DD carminemorris
438,365,799 *2C6CF74FCCA8E399B6CB47DA3DEDD857DE61A6AF carol-butts
438,365,800 *2C68BD6DD9B487D499DF93DE5EB69118C1D1CFA1 MUISTOKIRJOTUS
438,365,801 *2C68A8B836CE92BCC3D4BFE3D365C86F20E9D035 d!e8p
438,365,802 *2C6B808EF6B61D78E6559780C171F3EED21DD614 DEAN.COXEY
438,365,803 *2C6626FC45DC8C09B216EA2AABBF2B516334A0B7 MUSIC FOR CURRYDOORS
438,365,804 *2C6DC6C27CA82C7527E630C0AB02F13B1425E390 CARTERHURT
438,365,805 *2C6550019F3DF463FBD7938CE207A2CF878497F1 [email protected]
438,365,806 *2C61B514C3D6DF9A1FE94ED672F700A35FFC7A98 MYCHEMICALWESTLIFE
438,365,807 *2C664A2D40C402D5849B0506759EF2600F197E0A MYOGRAPHER5
438,365,808 *2C6D7D7C6CB88ACF345245ED1C2596C2537E5567 [email protected]
438,365,809 *2C604E4E6F7794A227CB77E1D4DA547979BBA493 [email protected]
438,365,810 *2C6B9D33DD2A533F553986790344730DA8EB884C CATHY MATARAZZO
438,365,811 *2C6E6D9CCE7AAD69A2B064E54B346D35E63705FB n4183928
438,365,812 *2C6DF94C04E7AAF1956327BFA7F411058987CCCC naamkaarten1
438,365,813 *2C6C645370A7627519DCC0B834F4A078A6F8B262 C+D\
438,365,814 *2C6B3406718B4F9B66753F1165C1482F04FAF995 NATASHAPIMENTEL
438,365,815 *2C6ADD0F3B9EC58DBBAE3A1954A3C755B9EC3DFC DERICKPERONA
438,365,816 *2C66ECFDFF660726FDFC5B65D32176F9CB4B54EB [email protected]
438,365,817 *2C61851CDE34772D6602EEFE623A3FD2E716BEEF nd3m0ns+r4bl3
438,365,818 *2C6C2BB8D15B7119C119E194B9A205FCFA398988 [email protected]
438,365,819 *2C67BAE4BEF7006D6A7C4551BDF7853451F6D487 NEDLEVUD7
438,365,820 *2C6C4CFDBFB80CE45FF00AA63137A5E2CCA9D2A5 DEXTER.RATHBONE
438,365,821 *2C6D4DF407A63123803F859DA336D894F69B58D2 CENKTEOVED
438,365,822 *2C6E827CBF32C8456C2EDF7DEEF830DD82DDFADC DFUF!
438,365,823 *2C6C9DD2D3C0C6DA7998E72431E190A6A870E5BE dg9br
438,365,824 *2C6D8EE8479459A4CB00A5DD55B462BE8B71D432 NEUBURKA
438,365,825 *2C606D27C9B350B0988ADA9CC9B50A93ACFFF3A0 nicholasiveans
438,365,826 *2C6B19AAF9B62DD3CEE21609378D488E77AE51F9 charlie-zigler
438,365,827 *2C66A8CF294B32EAE487B4A858894C9C4C8BB3CB NICOLAS.DARGA
438,365,828 *2C620292BC5668FB9D98E3E50DE9F53134EB2671 CHAS.CICHOSZ
438,365,829 *2C6081FE180B205A93EEA1DCADCE9758FB006415 NICOLE SOUTHWICK
438,365,830 *2C6C462F31472F1EAA97F53D6A82B75049673F28 diewende
438,365,831 *2C663F0A8B54A5BCE14056DAE723BC6716A8918A [email protected]
438,365,832 *2C6F30D611D014481E8B72F76EE992E3A8E4459E c/&hf
438,365,833 *2C6DFA9617F292E596C822215F2BAE6BF7A91961 NITRIFACS
438,365,834 *2C69EDDA7C00ED3C99EFC360D132547F1C6669AB chondriaarmipes
438,365,835 *2C6140D5B6D4C24FABF486CBBA2691F6093AFD3E CHR(13)),
438,365,836 *2C6A8E3337BB33E5AA1B52D607693C1F67E9CF0B NMCVEAY1
438,365,837 *2C6603E8CFF523312252F0240E7480F2E1E9005C Disk.Review.3
438,365,838 *2C6E06A03971ACC2F301F5A24347DB0296AE490B CHUCK.SHIMA
438,365,839 *2C6789A910BEFD239DB9095C996B6F6881B8A0D8 d)i-x
438,365,840 *2C6C00E7B469726A0FD8A3167A97401F706DA7B6 dj+7t
438,365,841 *2C6164C39AB3D066F2E35C5D7247CE9C27973D88 ci2"g
438,365,842 *2C66CD0D9577BBE79DA5E7FC4E3FAE1F479FB3AF dkk9g
438,365,843 *2C6704F1DD644DBFFDB219082473CC59E52EAC8A CLARKMAVIS
438,365,844 *2C6D28FC61956C7D1145572038704B9E20DB290D CLAUDE.OCANO
438,365,845 *2C6B1486587D26B1F93F692A4139C4636B0526D8 [email protected]
438,365,846 *2C6B4C4B4B954214021DD4D29DD0264203B128D4 claytanious
438,365,847 *2C6A7E8836B33CDDE8C11E0EBA8086B2F88640AF CLDIV
438,365,848 *2C65927A887D277096A2BE88CD49431B59CDAAD5 CLEMENT.JARDEL
438,365,849 *2C68EACC2A775297506CA73962DCA9833FF6E1EF DOMINICKKUKLIS
438,365,850 *2C62A1EE96E5110D11D6AA509577DE4F849BC51D NULLOSP0
438,365,851 *2C6C315090D8F9C05161BAE6A9EE363034CE6332 CLHPP
438,365,852 *2C640060E0023CDA00EF6B9A408B90FD805949B0 donnaw.
438,365,853 *2C66D15D96BB5FAA93E3DA6FBBE4AC4B14B30266 [email protected]
438,365,854 *2C60E669A2020C4E29CBA1A88711643E552150AC D)OTA
438,365,855 *2C6C049710864F6A4F3789764B630FD6430A6581 douglas-h-warren
438,365,856 *2C6A309AD08DDA2AC532C0A01F4ABB71FC37453F DOUPEIMMAT-JUMALA-SEIVAA-(FEAT-AKSIM)
438,365,857 *2C618A557D8B00137FA1D12E2A77ECEEE09CB0BC ClW
438,365,858 *2C699EEF2B96F41A954ED98060992AE9B0B559D5 clydegodboldt
438,365,859 *2C6E36FC21FD92B2C7C6398A7C09CFA77BD441A3 Cm,5
438,365,860 *2C6E8DCA8B5133DAA53C2628FC3A13A0E0363D6C C(MXR
438,365,861 *2C6601EAEC100EFF13E469990F8402825990E3FA DP=N
438,365,862 *2C6A22769FFDA63E8166B5665B98E7E4F9BB7D1B officebib
438,365,863 *2C6D99664807529F46CE5E61BFC389089424BE51 droiturel
438,365,864 *2C6A17D77DE7CA0737BE6A1817EB3D7D2BF0795B COMOFUE/CONLOSTRIO
438,365,865 *2C68DB244BF434A4D7D31A2AF649BEF089D056FF )O(o~0~d###B
438,365,866 *2C6232278170DAF5C320D88FA0F222FE70528345 ORDINANTEN
438,365,867 *2C688F4E22B9463B2C98F4AFC3BF5FEA5AF4343F DURAFIN8
438,365,868 *2C65AAE912A72CC9FECFCCAA99F278C79C24E3B3 du=sm
438,365,869 *2C6733F36B58263E6BA974FC0124137CAD089F30 dustyservello
438,365,870 *2C6B6A826F58AC240616A47F38C8E7C5C152EFBC dvbl
438,365,871 *2C665D1AAF5AF733008B0F600251CA2ABFE7D435 DYSPHORIAEP
438,365,872 *2C6C10F07EBB46939E753FF8FBEE95FF600B720B dzqu
438,365,873 *2C677A218CA1B19963F4514EC08CF9FE4BE424FA CORKANDSCREW
438,365,874 *2C6C585230C19F4298D827572E8E076C741BDFBE [email protected]
438,365,875 *2C6A753C3C99127B8AF0566984B7B6C3420D090A packbits0
438,365,876 *2C69F325D603A512F5EF9C60744CD12EF5E23AE8 PALIBATCHIYSKY
438,365,877 *2C62703096B861F8B7777B0D60CAF29D93949CD8 ECLOMUS
438,365,878 *2C62150CA9DA3956DC3283C1D151949379C9DA43 PAOLA.RESLER
438,365,879 *2C620585154DD5B1ABAF7A69D9BC9986D4517742 ednelatl2
438,365,880 *2C63178A6AA8A3D39B1AA085BA5EC1C7C6C2E6AB PARIS389
438,365,881 *2C63337FC0DE4B84FE178EC8512B7ED08D2C50A9 cqqa-
438,365,882 *2C6E267A02CCFEDDDC166D5946C3F5DC163B8C28 egennavn$
438,365,883 *2C6CC4684B19249A98E1A3886D31580042F6730B EHZ:
438,365,884 *2C6E39782B9A7A229F7268D205249F82875313E5 perspective(afterserviceouttake)
438,365,885 *2C6561B09DDAEAE93DC0FFFAEB183B7AC97D7527 EJECTORSEATRESERVATION
438,365,886 *2C600469745ED98B6527B79480A33EFACC2B3F3E ELAINE (HUNGRY LUCY MIX)
438,365,887 *2C64E8B62AC1DEA40CBABD5A36B3DE0309AF0AB5 ELDEN.ANGSTADT
438,365,888 *2C6C973E36B05F279AE066E92A5FA50C0B42FACF eldonrayna
438,365,889 *2C61BF0F56784656314F42114AD44C738CDDCA26 ELDRIDGE.MIRCHANDANI
438,365,890 *2C6F8CDFB865A6F8D0244F78D53AF1B965E74460 cti:h
438,365,891 *2C65087E8139E350FD876571F414181C2C56A0A0 c,%uh
438,365,892 *2C6393A390702FF6F3C6D61F4388D3A8911B036E elvisgeraci
438,365,893 *2C64C030158948AB6516473898442289E39B9EC7 EMBRACEA5
438,365,894 *2C61F6967D8479760F8C35669D09A0347AFCAEBE pl3n4rly
438,365,895 *2C6D1886787227B0DE9A1B9FBC70811CE668BFAF pokztips3
438,365,896 *2C698621E28A01242706A64CE50CFA1F43A81900 POODLE609
438,365,897 *2C6FC45AF3838E461D283E97011909096B6C5F03 PORFIRIO.HUCKABEE
438,365,898 *2C68AF16EB7C8F11E0EE4D274E49C79D28FAF339 enegoidis
438,365,899 *2C617EB53C6485D07C75A2B92C88F8CAEB5F9713 posredno7
438,365,900 *2C6D5795B562ED6E1C1522694C879ED798266A75 cz=gz
438,365,901 *2C639D39DED32498A75AF29A0CB7C6C184FDFF21 [email protected]
438,365,902 *2C6500233763312877B8ACC52F697673B58F2011 P=====>~O)X(
438,365,903 *2C6170E452CEFCE8F9E0A7DBB9654697A4A7FABE EORSAGE
438,365,904 *2C6871C20B002D06D463B817B2F39EB3802CBBA7 PR3DU5K5
438,365,905 *2C6DE0CA0BA4C7E66AFF9434169032E16E487783 epäkonferenssit
438,365,906 *2C61BF577F38079B1E4BC9FE0A52BF8444CD8700 d3mob1l1za71on$
438,365,907 *2C654424821D201F8C3CE00E3A7146AE1B0D64EB D%$8M
438,365,908 *2C6205A9D56DEC5B55C428BAF159E43E2DA482B4 ervinbungy
438,365,909 *2C6A920919055BD2F8677D952820810098DD9DAB putaparthi
438,365,910 *2C65249A8FA0AB8B819B16D1027BB81FE94B944A DAISYLOCSIN
438,365,911 *2C6F7C8D3A957A9B22CFB1C41A4410DE0997AA85 ESTELLE-RESPERT
438,365,912 *2C6CC2E4199D850449BF5F201867397C5D351E46 QAGG
438,365,913 *2C632D27D310D6B18F9E2BE5F5660440F9CE408C QIULI_97
438,365,914 *2C6B073146EB8F9315FE42A0D7F6AEDF28F68DB5 QPOKHNQ8
438,365,915 *2C62B46784B066D70EE38AE0DCE73508A2B6F1B8 DALLAS.MORSBACH
438,365,916 *2C65078C1007E8A56667D2255F76B2B9EA7859F0 daltonmassengale
438,365,917 *2C6BAB601DB58E466F9F5182CD5D3C883783A9C4 DANIEL.SHONERD
438,365,918 *2C6863F5B52E232278E26D484C6699759731AC46 DARENRUSHIN
438,365,919 *2C6359D198B635B6C8D13D00698CA4D598093F47 Ramos-de-Castro
438,365,920 *2C6A41724666A252F5061D3AAC84493670DA8711 EYIM;
438,365,921 *2C6E0835009007EC25128E902AD914042091DAF2 ν
438,365,922 *2C67CADB453D7D45D888D59B64DB1C295DF19907 JͿs
438,365,923 *2C6AB84704A97FC8DEAACE86F6F6C49777C2FBF2 !
438,365,924 *2C65537356783125E71E1D0E683CCD35931999F1
438,365,925 *2C67899E270BDA7E8C3BCE25D2E96801952B01C9
438,365,926 *2C677999C34A7277179F107134CA5C71DD194B58 F259525
438,365,927 *2C67B281F8981D5B5F2D7CF25912FFAB02F3FD1E [email protected]
438,365,928 *2C6E9D0FA29933FD78DD2AC7F8BBC5445A8BDBE8 DARRELL.SINGLETARY
438,365,929 *2C6F3AA2F586CC39F2C74F6CCF253E60866443FA ,
438,365,930 *2C62A32B0FA7357692AB3384E7FFB79F379B330C FAIZY.RIZVI
438,365,931 *2C68B3F71215C2FEAB5B351DE5FE7F2FB07B130D
438,365,932 *2C61F4EB71303A64E1BC0F59A4C2D73072A48BE1 DARRYL.RIVLIN
438,365,933 *2C6B4EF89D254A9B2DD1BA3AC14799D360622C79 familyfarmschoolsbasicinformation
438,365,934 *2C693CD6209683A3EE707F094EEBFE59F1A31A78 daruck
438,365,935 *2C696BF5A97D313C9901A1C93607CF1111B118A1 DARWIN.REDAL
438,365,936 *2C6C1D1507A2C4195B6207F2BBCCB34A69F0488E 8=
438,365,937 *2C6126928719666777DD308CC6A8D49158FE1369 DATE2007.04.30
438,365,938 *2C6744788207620563F89BE0EA58772654ED2C05
438,365,939 *2C660CE91B654D0624810A1129F832CFB08C767F
438,365,940 *2C6DDEA98183D46A24F9AFF01A47F5C53761C9C2 M
438,365,941 *2C660A8EBD12F97DA77EA5CCEC8565C3ECCC192E da´wě
438,365,942 *2C60A2B9F55258E9356EEBB724F0859046FF2868 DAWNSCHULZE
438,365,943 *2C6109A6D930FAE74B4C41DCFB5DFE775FB519D0 Ƶ
438,365,944 *2C647783D021529302DC4D6BB7C00BA5AEF65F63 &:-7
438,365,945 *2C6BC568272289719B3F4E11C87BA090EE96D9C9 d/d4v
438,365,946 *2C6B944A34C85A7C85497607B5DBFF9C8C44E70B
438,365,947 *2C61D2184B850AC94C938AE834657626495E3A2D FEED-ME-BEATS
438,365,948 *2C6FC00338E713D091D352CAEB1DC55E2D656A8C d,e1w
438,365,949 *2C6761E83B8446F3E0ABC434F80BC56FC0695CB1 deconstructingtheeternaltombs
438,365,950 *2C659AF1C0290D9E8605A24C2BA4B6FF5926729C FERMIN.TROGE
438,365,951 *2C6EE01AE85C6812FFFCFC209FE6F17C60508A14 yH
438,365,952 *2C6FBFF734F0B6313783CB02F4F81087F0C0C603 DELTASOCCER
438,365,953 *2C68E09FFDBAE6A03727E87CDE8A91D980BA58B6 Fishermans's.Dream
438,365,954 *2C69BEC1186BCA55DFA46B61199D658C775A3A6D FIS.ORG
438,365,955 *2C61484DCD16A3836D02AADA744167AA692527E4 [email protected]
438,365,956 *2C66E457C17C1D085F7120AF9F3839B196AEFBE5 [email protected]
438,365,957 *2C637B1D475B6C3FAD2600BD8A4DFA6699101658 FLINS.NEUVE.EGLISE
438,365,958 *2C6AA1FC970D2644A18BEA2F14DE0646BA1826C1 DEVINCANTERO
438,365,959 *2C699AAC5D6C63254831FE0983464945B93E0C72 DEVISINGS9
438,365,960 *2C6E290896A9C19D55945EB1D68F029839072FE8 057°W
438,365,961 *2C61D5892A2720282AE367918FF3140AF299B1AF DGUVAJU
438,365,962 *2C60CB56FAEE813F21C6780C853DC6DAB3978FDD [email protected]
438,365,963 *2C6C071445A41AB3C5758B45D621E90CFFB02D69 dh.b_
438,365,964 *2C6733C5F92631CFE71C7306C4FC8E652444C69F 10296 HARRAN.UNIVERSITESI.,.URFA..
438,365,965 *2C67E2780248F007552F772DBE2093A94DC7FD91 ‘FORWARD
438,365,966 *2C60DB33FCDFA7D8AD97EBE7ABAC0CCEF2DD4846 1090306 es.ist.einfach.".big.fun.".,.das.zu.spielen..
438,365,967 *2C6DE89A90874946BC5F6261731267F0691F05C0 dialyses
438,365,968 *2C6E6E533FD9C48938469F1F609967C9ED2E53BB DIEGODAVOREN
438,365,969 *2C61680C1967A5A01E9B60740C950B0CF8E56F3E 10.colloids
438,365,970 *2C652867F6819596CCC836354A21D0CF79B0D9D1 d.ii
438,365,971 *2C6FBAFA165A60A375EDB36832EED797BE047256 dillonpelt
438,365,972 *2C694A66CE7B061ECD498D884E7CB968AAEBC367 DINM4
438,365,973 *2C6FCAF6893E0367FF1E240FEA8EE5948218E128 fredrickibrahim
438,365,974 *2C619DC1C75B6BBEC8F5A346F0AC0866BCA6BD37 DIOS-EOL-I:-FREE-FALL
438,365,975 *2C6763D2EE3DE35348CFFB3F73336147678682DD dj%&p
438,365,976 *2C652EA93FA5DCE25CAA6E2A20C421633FDAC760 1468204 MR.GANTENBEINISASEATTLE-BASEDFREELANCEWRITER.
438,365,977 *2C60B06880BFA9A2B193C7F855AA4E7649CB552B DKZGC
438,365,978 *2C6FE5A66FCCE9360CE3CA850C45A2D765821CF1 1507809 ARKEOLOGI JARI N
438,365,979 *2C60743324BD997C6D61F5C79BA3FD70DA8CB370 f_/x
438,365,980 *2C687D1652C3577A317D2D536234329A6B9A5C4D DLFVI
438,365,981 *2C6973F1D0B8333EBE103C089E2574F14E0B754E DLRRV
438,365,982 *2C647261856E16474B50A71D8B915F22B3D9565F 1621995 PERIAATTEETTOMIANESENSIJAANSAAVATHYVINOLLA.
438,365,983 *2C6484EBEB51EEED87C07E636F2C28E133CC57D8 gandermooner9
438,365,984 *2C6A85C65442A028230016B9268FE92FE1D2EE02 1755114 EUROVERSIO KANNATTAA OTTAA K
438,365,985 *2C681144BC2B575FDB5032ECC4F868CDEED3DA7E 1757468 MUTTAK
438,365,986 *2C62C4A8FF049CB5E0B44957A13DC5ABD802BE8F DNj/
438,365,987 *2C674FAF26E11410FCABB097BCC03C992FD66FF5 GARRETTRODENBERG
438,365,988 *2C6D8CE71103ADDD42F441C7DD48174B507695F1 garthchorley
438,365,989 *2C6B0AB13FA12418921055DCCE180A72A580168B dn-wz
438,365,990 *2C607D89117A76131AC6C8A2661BDD727044DFAC gedachteloosheid5
438,365,991 *2C6929F8D0FA19F29A577B1051BDF8E5F540BAEA gerasamov
438,365,992 *2C6C4DFCDA0A0AB6F638B69B93DA2BEB2DA6AF4F ggzdtuzgz
438,365,993 *2C61AE171919ECCCB7D2D2B168629BA7FA3B56AC 1-DANIELSTOWN
438,365,994 *2C653DBBA47F7D4BF4B61DEF929113C168A9D636 1DANKENWOLLEN
438,365,995 *2C65C3B0ED70A5153B173DB1F5A4BBBB9B1FF52D GINO.BRITO
438,365,996 *2C6FFF764B08331DBF78784DE478C1758197BA03 girl you look so fine
438,365,997 *2C6486846E89D4FDBDC9DFA6AC2EB43125D154D3 1 euty
438,365,998 *2C64B41100E52AC7177D8D3F4BF9AA9B10E6F127 DOZRR
438,365,999 *2C6F9804142E82368F14CB0ACA988A3B40006889 dpl0ma7e5
438,366,000 *2C66DACCF3E4F28C1E6EFC234677902022860FAF 1IGNATIES
438,366,001 *2C6D7D726198B4D7B0CC02D9A488C1B7778B9933 godiove
438,366,002 *2C691CDBBB8A126B30F9DF9B20695CD845478C45 goin'.home.to.my.old.used.to.be
438,366,003 *2C619D691EC040E4B40748F322B82A877F6D50F6 1KIRJOITUSPROSESSEJA
438,366,004 *2C657DA77A8CB480C1F3611976A82EAF547532FA DSC(J
438,366,005 *2C65563EA815CBAD033CC09CB72D9FFEB220B5D1 1 KOULUN
438,366,006 *2C6BC0CD6E8C46BE94F05151C67E0D85AAFF1095 gramatica.del.afrikaans
438,366,007 *2C669345F5C5B4E7B70DDA53BFAD0A363D7C6DE2 GREENIDES
438,366,008 *2C60E5D77D82BE4193550763B56DD36867A0E13C DTRIPPENZEE
438,366,009 *2C68BE0BC81D7DE6B55CBFFB4DCCE6E3C135B106 DU5+HEAP
438,366,010 *2C61560E9D3E8526DE5496910C864FE2ED441DA1 1-OBJEZIERZE
438,366,011 *2C65B6824C7139DBDCAEF5012B35716314B6361F d;)uq
438,366,012 *2C60B858269822F698B64A32A14B38208D52E70A GURNO 2
438,366,013 *2C686E8B44CC51F92D1C764B3418132926A83AD5 GUY.GUNNETT
438,366,014 *2C6CD3B7CAC5228376C7E96A208C43C919D85050 DVORAHS
438,366,015 *2C6F0661C038CB57C608DBB3018759726C171F66 D!VQ
438,366,016 *2C66794979CA4DED31C6425DCC9E697FBB1CF460 DW9JR
438,366,017 *2C6CFB3691D41EA85B651C960867535AF3B7860F 1-seltersflasche
438,366,018 *2C6C94267B07DBBC47B4CACE4BA3B62CA866D4C4 1SINISALABIM-SARJAAN
438,366,019 *2C68969FF8F47D94ABA8942A686F066FB211F635 [email protected]
438,366,020 *2C615B4948985CF820AAF76FC29008D6301E2B9B DWLKT
438,366,021 *2C672CD72AAEFE98513F6E1F65CEC6989434EA5F 1T3GR3N3
438,366,022 *2C65384F398C7C4BF003C8AACA9996BA30EF8714 DXB.%
438,366,023 *2C6CA393B01C67DE64207D99EE5E3FACFCC076A6 dzqu
438,366,024 *2C684B7D99E89B66073A2976F32C1FDC93F88FEF 1-YLIH
438,366,025 *2C68E14478CA6F963A412EAB02ECD70E340EF729 ebbji
438,366,026 *2C6515594BF6AB714E3462986ED9F3355701FB70 ecl!x
438,366,027 *2C6DD6675C37DC32C8A7C513D39E67097F632349 ecmbi
438,366,028 *2C6D34865803C29F68066F45E273116F71F4385F heaher
438,366,029 *2C6A016123D97328C895E294F49243E9E0B338CD EDISONCASSELMAN
438,366,030 *2C6AC35B3FE2F7188138B82ADD25097379C4F1F2 edkawaa
438,366,031 *2C6D2141AD6C3117E4087B57B5D0E0A5C0AA4883 EDNJIPFA1
438,366,032 *2C67FA04887FE098383E6471C49DBF3EEBEBE421 ef8vl
438,366,033 *2C642A08C7077EE6897AAD0A035DBBA8DA888CC8 EG#WU
438,366,034 *2C621531A7C2F0D9FE99F1833A5776534DECFF4F EHCILREA5
438,366,035 *2C6C0A0D0F89E0D7230715A0401C081EA4E1B96F ehfao
438,366,036 *2C6E3D57461517C1A06A51687D49276D18B6C0BE 2099840 HEISACCUSEDOFHOLDINGMIRECKI'SHEADUNDERWATER
438,366,037 *2C67C30281DA35EF868900918F62615E88A2533A 2102924 MERRILLLYNCHFELL1/4TO357/8
438,366,038 *2C6CBB07BD1B194B945815F4608297BEB20CA759 21081769
438,366,039 *2C6E78F7AA4090F3FE159848C158B876F79CD138 [email protected]
438,366,040 *2C6D06AB7C8ACEC227757E66F01F904A623F0686 HIEIERON1
438,366,041 *2C652EC1D8EE1A845219B741B2F1AF6343B04A45 eladygin
438,366,042 *2C623E1B73ED84114A1B6DB17E712DCB2198313D hip-hippos
438,366,043 *2C6BFCF407EB3C0682EBD4A6400159EC5738EF50 [email protected]
438,366,044 *2C68BDF7713E941C5BC1C1B2FB386DF4F8877216 HJ0RT3N3$
438,366,045 *2C67D547EE2822CD06DF15ED053442C83A955DA0 HNGEKJER3
438,366,046 *2C68C6CFC3F1E2F35F4856C3FD38C63A76EA8FD6 HOLEINDATRIBE
438,366,047 *2C6A4BCC7B029243A1C26858B94E84181811BCA2 ellispacius
438,366,048 *2C6B0B1256F2B52BE266593D78068A6095269DF2 264631 jostied
438,366,049 *2C631C7A1AE7B2AE073423409FE9CCE6C73D71DC HORACIO.DEFOSSE
438,366,050 *2C69A7B7E7C4B7911E554756F23E2323D4B6F8A6 27071700
438,366,051 *2C64E7F16215B6D7B040FD7D78039422CEAFE0FF EMILEDEWESE
438,366,052 *2C64E66180393E1C659B8FD2080A84C9321800FD 2882043 do-they-know-what-they're-doing-?
438,366,053 *2C6BD2AC302C37C16BBB16EE9EC733F3B1FD345D EMILIOSUMNEY
438,366,054 *2C6F31694AA8990DEF1D0FC091375357446FC753 EMULSCRI
438,366,055 *2C6D7250EA1CC41FD6E7FA200912EC62CF99BE11 ENAKATOMBO
438,366,056 *2C6D19205A5E8C0A148C9C053862182049768448 END0S70SIS
438,366,057 *2C64A4D06A32485F3948D8F574707C6DADB229E0 ENHISTORY_OF_BOSTON_
438,366,058 *2C67C05394FCFCD56BC044EE4090C8821BE6CFA1 enochgoldson
438,366,059 *2C6552624C12555CCAFEEBFEF82A76252858D010 ENOCHVILLALBA
438,366,060 *2C64825EA43EC6587EF00B3CF7E42C5D3A748DB8 [email protected]
438,366,061 *2C6A656F2B1C89D2E2FC610F1B645622D22FB899 [email protected]
438,366,062 *2C60DA49D5267A803645AA952073456EC4F24801 hudson-close-up
438,366,063 *2C6AEEA97EA85426EF2FF5929408FC5D49AB6794 huttlinb
438,366,064 *2C65823DAD26587AC524B0190CF73635FD7B951F 2.kupura
438,366,065 *2C6AC6E8C93D0F5D637A3BCF5ABA8032811504DC [email protected]
438,366,066 *2C66863DD06FC5FCC30BE8B4086D5DA879E72000 [email protected]
438,366,067 *2C6572755D11FB91070E545595EA3BB82C00B485 [email protected]
438,366,068 *2C6CFE2DC4206E263C029781C09320AB9AFD37E1 HYPNAGOGUEI/HYPNAGOGUEII
438,366,069 *2C6BC8D60DC70E7688965E13491B31F22DDF06A7 i8masd
438,366,070 *2C6EAE6E2444C1D2655D086423F5F0DBD9497B6D IAMKING17
438,366,071 *2C6D7F8303FD7A4B4E6B96981FFB86F19B2A51E6 ERNESTBALDA
438,366,072 *2C6192B456CD3B3EC329F51B524EFC85451D43E7 ernestdally
438,366,073 *2C6371F4A53F167CDF8BC4A7475B221EEF4B8366 ICHORS
438,366,074 *2C6836D52F272D13DD6294B71A2D4F6CD95FD392 [email protected]
438,366,075 *2C6E418BF72BC0CC5E35363A3118090870BE5382 ESALABILE2
438,366,076 *2C6CF1C54B4674FA91BA973EEAA62924CAE30C5F esoloilof
438,366,077 *2C6598860026328AAF162CACEEE9684579B69452 et;rn
438,366,078 *2C6E54A54D7CD07AEFAC00887796DE7D2466C5D4 EUGENE.WALKING
438,366,079 *2C6CEB97966F13647A208420965D518B56E19AF4 3.entiteetit
438,366,080 *2C6E03BE1612CD793D55193DE79A11F71242993E 3FESTESTER
438,366,081 *2C6470D6CCA274EAE659F35FAF4460BE651F24DC 3HSUBTLE
438,366,082 *2C6C492472EFF600D1CD75E309425CA59B1C2E8C iluvkat65
438,366,083 *2C646306155637799DCB94D8F1B61BD036B2A0BF 3MYHEMPI
438,366,084 *2C6AD566095482D240B0FCA0BB4083019587B0E5 IMAGINART7
438,366,085 *2C68BAE2DE3AC2B973C87DCA506AFA3987FF3272 exhumes
438,366,086 *2C613595EDBAD3B94E37F376DC250DB01070BE01 3QU4L154T10N
438,366,087 *2C6BE6137ECF342D3EE39338A8271AA343C76197 3TALPADE
438,366,088 *2C634669866E49368DFF0A41A1E522C0D7DC7501 3-yitirecegini
438,366,089 *2C6C6AC3714FB9E7D1CA9378F741AF7A30AA0847 INDEXEIS5
438,366,090 *2C675F861E806D0B967EAD88DC2EE34F752805DF INDIANLOVECALL(FEAT.RICHARDFREDRICKS)
438,366,091 *2C68E0244997670C40966D092A3862DA2BAB854A [email protected]
438,366,092 *2C6646128D81E0389663352E034AE549A604B017 4400JO
438,366,093 *2C6523C2F6C24D757CFD6672ED158F3E63FB7D14 f2x
438,366,094 *2C62813F3406616244EB4248388CDC8EAD9532FF info4u2
438,366,095 *2C6713564C61359CC98BD464CF572E7599821707 INFULAQUE6
438,366,096 *2C60F727E6114C240800A9E2B0580D3F672CE7D1 4A294986-F810-377D-ADBC-FD57F68981D5
438,366,097 *2C671BC695928FBD350396CADAB6406EE12F6BA8 FARRAH-NORASHIKIN-JUHARI
438,366,098 *2C6E25E9D0BA7F0C83B90722B6ECD48DCF1D383A 4BOURBON4
438,366,099 *2C61E174AE2BDFF095C50B51FFC4266C8AC0A0DA 4EL243ACI0
438,366,100 *2C6B9DCB61997864F9E129415E4585DCCC9F4200 4ENERETTEN
438,366,101 *2C6DCF85A269E54C5B7F89784E87425E0A1056C8 Feel-the-Sickness
438,366,102 *2C6678FFEEC60F027DA4F7F3CF11158D5EB152EF 4LIPSING
438,366,103 *2C672CF277668479A08A5BF0B1DF26A93ECE975F IRRITERETE1
438,366,104 *2C603424E30FF00D7C35FF0F32293BB676A44FA4 FEREJANE
438,366,105 *2C65D71183B5C163BE80E4FBF639D8964802B09E ISHEFORGEN
438,366,106 *2C6427AFDBB1226A5004E591EE9D1C1E63BD498F fertigkeit2
438,366,107 *2C62BE17A9E4AF334BDEF50F4CC1F16D28DA28FC ISREAL.WINGHAM
438,366,108 *2C664E1048A547552FD5C89DC88BE2B9D37C4457 filibertogertelman
438,366,109 *2C69E233ED94A44206C49C3F0B9D655012DB1E08 [email protected]
438,366,110 *2C63690F5168C7991B8969EEA4B0FF2AB69D8E6E 4SREGARVT
438,366,111 *2C6754BAF76C003570338966BB7B2007DD01C1D3 fitzroy.palmer
438,366,112 *2C6F1D9E7774F45F2598AE9479D21252148E3E22 fJd
438,366,113 *2C6254296764F769F9B12151BB9C200477356970 4TSLAABINNAK
438,366,114 *2C640832C67624E043D59FC6CC50308AB8C3839E FLYING (FEAT. CHRISTINE)
438,366,115 *2C60F129968973707062058EB4B6ED29FAA490F4 fnzh
438,366,116 *2C616FF0167A0B9FB5E5718EC4BE2FF2CD988D59 foresttafoya
438,366,117 *2C619B111A2C2170FC8638C8D507F331360A5851 FOSTER.DIBENEDICT
438,366,118 *2C6FE00A7A1CCF03915FA9509C5DCCDDD85A80C2 FOULS.5
438,366,119 *2C65FE8B05FE8DD8486373332FA86F1012BEA7EF [email protected]
438,366,120 *2C68FED68100339D9C872A8D88F473FB74D53346 5:..5..-#..-&...PROMISED.LAND
438,366,121 *2C661D4CF8DDDC029B5A3F32931DEA0B3126BF0C 560RISHI
438,366,122 *2C6B17CF1A4BECEFA66967DB1549340822B41EBE franklynhessel
438,366,123 *2C6C0E832A738DAF51B1FBE36E065229298BDE77 freddieeaston
438,366,124 *2C69B56886BD49EB77809B822EE3B6B116BD4B96 FREDDYVENEMA
438,366,125 *2C62C3F11DB5A88CF9C7629D2F8E2B3FEE2A647E FREDERICKOKCHAMBER.O
438,366,126 *2C64808624F10B53C05A9C866FD4788F9EBD5EFE FREDTOP
438,366,127 *2C6E1B1880B0CBD16726CA9BE76476A5F318C749 frieseite
438,366,128 *2C64B09576F5B035E78409CBEBE5E33ABFA2B8D9 JAREDMAYDEN
438,366,129 *2C6C20393F47BC25D3077872CE81357DDF790042 5BANDBREEDTEN
438,366,130 *2C68B4B2954A2474A4918DD3C0682A1A3007BEFF jasperolds
438,366,131 *2C6C1E4D43029B9A4F2DE6A6FED4CB1D73E24359 JAUNDICER00T
438,366,132 *2C67EFE9367C147716C2352048D2080AA8DFB854 jawle
438,366,133 *2C6B27648697C17F64D1B5E80AC38D60FB56EFD9 FUKANO01
438,366,134 *2C69D25B23A97248D8024292181DBBD114064D55 JBHAGAN
438,366,135 *2C60AE966729B6BB2E83E764485B0FBF282587FA GA111VAN7ERS
438,366,136 *2C621B2DDB75E26F118B6978F20E31D154C4D723 5HEAFN9
438,366,137 *2C6CDDEEDC0EE88D74C76A3C0E4DCBBA574017B0 GABUCHOED
438,366,138 *2C695D0814F404057019C3F2245DF48E0E7F8815 5ILUVCASSIE7
438,366,139 *2C6977BA78419AE10EEAF20B2058F46622004A9A JEFFREYWHARTON
438,366,140 *2C65F2DFD79F2328476C937A5C34CD7701BF9B2B 5MINKFISH
438,366,141 *2C6376AD3F2AF3EA9FDE0E38C1BC4A2782378D9F 5MYNEWYORK19
438,366,142 *2C6DC03C030C00510B61BF85DF81789BACE0017C gaylordscivally
438,366,143 *2C680C3237B3BE395ED5D04911D9FA386ECB87B4 5RONDPOMP
438,366,144 *2C64E3028529CE29D6AC96A585666EF0E76798BD [email protected]
438,366,145 *2C6CDBB8BE217E54A70B87792BA3A5B78338DB35 GEDEM
438,366,146 *2C6BD5AEA355677D1411D6AC2C654BF95511DF1B [email protected]
438,366,147 *2C6E744744ED4D6440F5709F03A99C73DD29CC97 JHOOD78
438,366,148 *2C6B78F458D6153D115471603EF10CDBDBD6D595 649SPENCER
438,366,149 *2C620207BAB78E229BBA7AB73D4E2EF01A6417AD [email protected]
438,366,150 *2C6C32042CC9FF8B522DEFAFB51DB7912CE7A8BE [email protected]
438,366,151 *2C6D050DE27AC3AFAAF9F1C551399DB3196178E6 6BRANDSTAPEL
438,366,152 *2C6BC2640ADDE17EADF3C2B5975B39F743D70285 JOECATALIOTI
438,366,153 *2C663727109E77E45878D223D3451872CA71F5F1 joe.doiron
438,366,154 *2C60B7BBB1D96B9429EC3F6EE4362926C58F54F1 johnathonmanny
438,366,155 *2C6B665E99972E89DD5CD2C6666245E86DA9FA3A 6GIZMOMAVERIC
438,366,156 *2C63244ADD360469723C917D7ACD035F50836C54 6HESAPLARININ
438,366,157 *2C67AC7E1042BF627F572543A92526ED9C6827BB 6HOUSEOFTHEPEOPLE
438,366,158 *2C6E11C08B50F123AD5EAA646A7AA63716DA04A0 6KFKZWUJ
438,366,159 *2C67FF4FD44432DB7719D5DAF6B7B2AC1F9C4832 [email protected]
438,366,160 *2C6BA3A5BF93DD80BC1B9C3D40634CC89D738F6E 6-KUNTAOBLIGAATIOLAINAN
438,366,161 *2C68648E8355D7493EA52025A33DB668808435FC JONAS.SCHRUPP
438,366,162 *2C69C3F0E73B73AEDA11EFA36671CAA5801AD07B glicosídios
438,366,163 *2C6DA6F0CDCB73E3B7D8F26C745A93A7CCE32F6C gninnigtno
438,366,164 *2C6AB0C314D8C6C9727AC98AD1215B9C89F3D099 [email protected]
438,366,165 *2C64C3F0B1BBB1AA096922607E09D38AFA8F8316 GOLFS
438,366,166 *2C6A380C569CE79B66B3916DF85CC9C3B3A67DBF 6YLESOOLREVO
438,366,167 *2C6AC652E7472113215E263914762B429FF08DCF ju8l47e5
438,366,168 *2C672B00A2FABDE8B2EE6BEB13F24B0C45439629 JUAN.WOYTEK
438,366,169 *2C6B2D5A0130E25CCAF33E12504F85B16F4CEF8A judeweidemann
438,366,170 *2C67017A520D95DBAAF0DA1D7E47D7D1F2F7518D JUDYBATSON
438,366,171 *2C6D1DAD8C62F9E793C8A0817B3B7B08965CDB16 JULIANSAMUL
438,366,172 *2C600AB4027252F67B49E393BF48E41496DB1E31 grantsalfelder
438,366,173 *2C6E4EA521F52369B3A70ED4723CE9A893D52246 785967 kOyhalkInInatalarIortaasya'dangelmiStir
438,366,174 *2C608F532216EF92179B4D8ED3F636E7E94181E7 796032 HELBET-XELETI-U-SASIYEN-HER-REXISTINE-HENE-.
438,366,175 *2C679170B1A7D4EACD465A12B44D88FE77B61DA0 GREAT-GREAT-GRANDFATHERS
438,366,176 *2C6FC1713B3B0AA451A98DC36B4E908EA74A0FB8 gregkatnik
438,366,177 *2C6F2C5D662165C3980B94ABD2BCB217B4F73BB4 GREGORIO.HEINZELMAN
438,366,178 *2C6708C19C584F8ADFA53A6DEE595F67A3AA8DD8 gregoryhsy
438,366,179 *2C6D55C3312BE043594E5EEB4733FECFAC604C48 justin-hafen
438,366,180 *2C65FC172F164335B1569BC92C24005B1C7BD01C JUSTINKANNENBERG
438,366,181 *2C6B8A33FD9B4B2CDB3A2830A3D669B87761E286 GUADALUPE.DIETRICH
438,366,182 *2C665EF7DAAACC747F2DA6ED8B85431D09F02C23 [email protected]
438,366,183 *2C686D57F7C3A43219AC117C267CAA9574522F7D [email protected]
438,366,184 *2C63601BBF2064DC00C8A3994BF639C79D008CF6 7BUSINESSPHISH
438,366,185 *2C6D728B50DA7C6D737E7A60DAAF306412DB5F7A [email protected]
438,366,186 *2C60E5DE9AEC7537016B76947DD7DA5320158DE1 hagranat
438,366,187 *2C662BAC36D5BED573C8E1BE99B26C33C31929DB KANONENROHE
438,366,188 *2C67CAF82FDEFC26C52FAD7FEE5E2B0A83ECA8DF KATLINDING
438,366,189 *2C658FC523B0BA63667B56627EC7365C5B01A4EE 7SCENERNES
438,366,190 *2C6B2A01534053BA1568334289CA84FCFC660194 7.seriatin
438,366,191 *2C604DB272EC573109581B4AC1722C9A14905A81 7SETARBITREVNI
438,366,192 *2C607666927C12C884C02CFDCF8CDA5F1F8E0769 kbto
438,366,193 *2C6A88570948753F0D350189E0B98BD40AB71D15 handelsrekenen1
438,366,194 *2C62F7D693F170D3BEC70F946B78833622BF2C55 7ULOGISTS
438,366,195 *2C6CD8B354982A1DE673F5DBD2AE6E1E4CED419F 7XERXESTWD
438,366,196 *2C64101EE84BD0932BFF133662CC743C33786CC2 8->~0 ~O (0-0)
438,366,197 *2C69CB3063DD28C4B2DB988E02C0293E529F88B0 843D3K3R5
438,366,198 *2C610D0F8F31858BCAC9BB52978307009EE49CFB keprfpccr
438,366,199 *2C69A3EA86B61920F0303B7A3FCB53477C29AE05 KERMITRITA
438,366,200 *2C64AE9C8AFCA1A9182B143296B89BB8144C73EB HAUPTUNANNNNS
438,366,201 *2C6F02A2232DA363FF12D82B854FC72A62EB6581 HAYA.AZIZ
438,366,202 *2C69C34989873AE8D82CC8D928F950A73665082E KEVIN.LIAPIS
438,366,203 *2C602EB9ADCD389483D8E73009098CC453DAE1BD KILLERHIPHOP
438,366,204 *2C62178DCA74B0A3C9D6745D5435C6BC90DAB76A KIRCHENLEKIKON
438,366,205 *2C664471E7AE8C21E36A1490ADFB21A864DBD48A hermanos.collyer
438,366,206 *2C64BB75D0A615FC49489F9568DB5AB681E9B9DE KNTRMGVNGN
438,366,207 *2C66D95C8B69619589D965A2D0BD0B95435B95D4 8MODEMNICARAO
438,366,208 *2C66F849F37D750BC99C2A71BD5716B156D6B9F5 hilariohackworth
438,366,209 *2C6C6EFB3F35CADBB0D2A0C820F72B25B44557FD 8NOSATIJA
438,366,210 *2C627E20315B4DCB79D8D8195B8237C446E6C046 }8{o~O~q--B
438,366,211 *2C663BBDB16F0D119ED54431CC4C74F49232331F KOWE
438,366,212 *2C635369434242A9EB573E40C7AA21577D24E58D KSIEGARNIA
438,366,213 *2C6D603E6EDEFC393F9E04AFA2B99CF5A36E0764 8vju8gykyuec
438,366,214 *2C656428AAD42F813A2894EC351854E32E17F5E6 [email protected]
438,366,215 *2C62048D1EEA691E6A2EC124458760E4F615CC3C L4R1K
438,366,216 *2C6AA2030F682C4222390E1A0F071902917B2EB6 HOPKINSHORATIO
438,366,217 *2C62895838948B30CA16BD934F1CB8FF1388BDC9 HORACE.GODFREY
438,366,218 *2C6719C5AE15D034CA028829C6F1D945197F6F1B 983205 OSUMISENKANNALTAMERKITT
438,366,219 *2C6090CE6B945AEE5E57CF6CBE63DC91D6850DCD 9907E6DC1430F93AA25752C1A96E958260
438,366,220 *2C692A22FB57EB30EF7CA6DEA670235F022ABA5E [email protected]
438,366,221 *2C6EB1CBE1C8E5307F45A353DFE641FD0590F89C 9BANDITSTEVE
438,366,222 *2C6BEFA304759CD8B4FAE5FA1E6A8EC87149C3D3 lalono1
438,366,223 *2C650F3B3FE55FDA73BE25C9E113146ABA4EF290 [email protected]
438,366,224 *2C607141E5C9CA1BD88E634296CDDAEE76A4C209 LARRY PAHL
438,366,225 *2C621A8AF062764A7F090D44F9C0F7DCF07E7D39 LATONYA VAUGHN
438,366,226 *2C628A845E2FE906D5854CC14DA43369107C793F LAURA.LEA.MILLER
438,366,227 *2C650F43229FF0C682E423D91F5EB1C7B9F720C3 LAURENCEBURKITT
438,366,228 *2C6025261326DB772298F263F32EC29954C98579 LAWERENCE.TRUIOLO
438,366,229 *2C6F7478E2DDFECC8DF424060B62D3839CAB58D2 9FUCKYOUDWIGHT
438,366,230 *2C64BEF1C96E23BBDE95EE24146ABB04F6CE55C5 9GEORGICSES
438,366,231 *2C68FED83BB3F924654364B5E787BAD4571303B2 9OD53ND5
438,366,232 *2C60C7C66415FB9B89355102C7226CD321D1FA19 9REALIZABLIESES
438,366,233 *2C67EACAA1BBB2EE0796CAA7BAE1388D1158ADF4 HTXNWTWK
438,366,234 *2C660B323239CDFC4499946500CEC50B1FE9C0C8 lennyhuch
438,366,235 *2C62365DC0DBD2D80C97CC39518D7F6E1720B5C4 9RWORSTEL
438,366,236 *2C6D686324AECCD4982B4FA6B8CFF7E5A39F37C2 HUCKSTEP3
438,366,237 *2C63E6C73248F3ADF998CFEED68A8CD73C1423BF LEOPOLDO.NIKAS
438,366,238 *2C6C425A5141B3AF25E9D67B988DC302CAD6D071 9SENESCALDADO
438,366,239 *2C68927E969773CF0E51E45ABE8BF5877BE3489A HV;
438,366,240 *2C604CFBE139803C3DC5982CB0F94B34700BA686 lewis.chaplin
438,366,241 *2C6EB42E4FDEC85229097B9DF56D310995D689DC 9ZAJISTOVAL
438,366,242 *2C64448DF362351E4249E536B3E146A03831E420 [email protected]
438,366,243 *2C675762C52EE8F0720295C342EECDC92C3B0ADF a0iq
438,366,244 *2C6AAD2F4E6B642A327FA91702192061D0F92301 a6
438,366,245 *2C6CC841136E6B2E672F82C6CA9AD46F9EE4E132 I'DRUNRIGHTBACKTOYOU
438,366,246 *2C6B17D7E29D645389AA27E61935CEA82C30EF12 ^?-AAA
438,366,247 *2C62182741E40E96E42E141665524D595D24F553 [email protected]
438,366,248 *2C67F85AF4E5098799EE9EFF75AFB8146CEA1DDA AAADHM
438,366,249 *2C6B0514856D95ED2039237364228092A8BCFAEF LONGNAN
438,366,250 *2C6307821135A0FA04118565516CBF97B9F909CA IJKSTELT6
438,366,251 *2C6403246F1F8220637845CF8C0F0972D8C364BF AADXE
438,366,252 *2C60466E14CDC666211AE9628B1FC56BA648F691 louispidcock
438,366,253 *2C65C2466DC6E5CEC974CA67FF91FDCFB13EAD2D AALXL
438,366,254 *2C61C9FDBBB24A96C16AA0DEA039AC5156C86245 [email protected]
438,366,255 *2C6225B220DB73BD859C717F5CC522377B9F54BE luciobandley
438,366,256 *2C6114E4ADF96FF8C4ADC0E015CC038809B81621 AB(FM
438,366,257 *2C66C489AB452E7ABD7F721BE42AF8DB6624DD52 ABOCETAS0
438,366,258 *2C66FF83B084558C3A9FD33B9E6970FD8E6C3554 ABZG?
438,366,259 *2C608C8E9A987BEC8D38137B85F53465EF84FE14 lylegalati
438,366,260 *2C6CB317B20939657273895680AC8D32ED5BB515 INFOPARCBOTANIQUEDENEUVICNEUVIC
438,366,261 *2C6D26287ABC21DFEB0A11076F004B4A337DC382 interview#1a
438,366,262 *2C632964BFA31CA08B0517390265EFF81AED1548 [email protected]
438,366,263 *2C6EFCBA72226BCA9FF9101EE177B4CCAB414E48 MAGICFLY(VERSIONSTUDIO)
438,366,264 *2C64E55D59C167EBDC3FEE6259F988DBDE4E32B6 isaacovermire
438,366,265 *2C6F487A6E9E1B7C2755BDDF3C2FD1BD98455E6D MALAKI618
438,366,266 *2C63E1B4C3AC19D58590113C8FA3F543C53300DC malcolmzorns
438,366,267 *2C63F9FD9D37806B2F72285824CABFC83CF9B03C MALIK.BECERRA
438,366,268 *2C6A5CD771651788A759404C468755169449EDAE adolfoformento
438,366,269 *2C6CA8CCF65FFFE6146431BE9882070E2E28FE71 I-see-thou-art-not-for-my-company
438,366,270 *2C6D75C1E7B7DADE0ECB3001AD624C643D252482 ADQ/"
438,366,271 *2C646AAFBB4D977E4EF89D41C2E25DA146DA3B7A ISOTAMREF
438,366,272 *2C6CFC603DB0B27B6D4F0FFE0F5171E231FCFA41 AEJS/
438,366,273 *2C6363074D0D4B8CA04919178512B101EFB8C6CF MARIANOHANLON
438,366,274 *2C627544F8A4A86C1FDF1761309221C5E7593EE6 IWDX
438,366,275 *2C6B946272CEE2D1B63B9545DD46ED598758A584 MAROJAS5
438,366,276 *2C6BD205EB2A48840031F62FE3CF30D3B33D818E AGALLASPY
438,366,277 *2C68BC6714F249B515E110D7DF63DDEA703C8C59 JAGDWISSENSCHAFTEN
438,366,278 *2C683E2F0B099A5D35B60870C824405587E5875D JAIME.FIDELL
438,366,279 *2C631BF4738A7BB8F1667FDF0A626AD6F903F47A MASSAGRAF7
438,366,280 *2C6BC760E8AFF22F302005153DD4720D1087E82C matjnvfcbsv
438,366,281 *2C606E02EC6F8EE83C539389BBB0E2F90C0A5797 MATTHEWSCHWINGHAMMER
438,366,282 *2C60B761BE21797AB8A10209F0D79A1EC0493A9B AHOD!
438,366,283 *2C66873E5F24C9B8220E60023CF00805C67E9EB6 ailingteo
438,366,284 *2C60FAB9AE1130888672490340C1BE36F9649C2B JASPERDUNSMOOR
438,366,285 *2C69A46E956ADE421610F39BB5A08BBE88F7DADC A(JLT
438,366,286 *2C6DA0BC8815715DDCB1C409A2A56EBAE1C3670B [email protected]
438,366,287 *2C6A913CD60BAEEB8E6C0A80BB3966F9024A8CB4 JEANLAHAIE
438,366,288 *2C66C5EEC4CEAF71C8098A128D39217E04D82DB6 al)1(
438,366,289 *2C658EAB9F031B51682F7289022D744E5B3BE977 MENSUALISERS
438,366,290 *2C6B4D4D40AC01BF8D4665CD4D196C4A17545DD1 [email protected]
438,366,291 *2C6FA03BFB8869710457D0375D5CAF3DF3DFF9CE MERRILL.GOWAN
438,366,292 *2C6F09007756CC2C9C4BF662C7995DB46DB362B1 jeremilam
438,366,293 *2C6099814C6C4ECB42CBD8EB72536103F255D3AF JEROMY.RUED
438,366,294 *2C6AE3FE546D9288DEF08B8DDEE9D27A9EFB9881 JERRELL.FONTEBOA
438,366,295 *2C6CEB2F20390EABF9B342268338ED14BC9A2DC7 ALIGANER
438,366,296 *2C6C92FAC2DE799C5DE3FE28519F48FA0EDB8BD3 JESSIEFIDELL
438,366,297 *2C6C9C4681EBD04D102F1B64C7B4BB828A107B4F mhbpsrva
438,366,298 *2C6DCBE9575BEEEB5667F4EE2058378F4CFCF3BE jewelbermejo
438,366,299 *2C66447FDC27C66AE628B8CB3BF3E567A3C28705 ALLANYONKER
438,366,300 *2C6D8E87114DF6F489EE5747E4B14CB8950E66E4 ALLISON HODSON
438,366,301 *2C6AA9F8A0E8CE94DCBD20C5BED4CCE3502F4EA5 MICHALE.HULTBERG
438,366,302 *2C662866AB3C1B125215F63F792926C9A9C829D8 ALLTOMORROW'SPARTIES(LIVE)
438,366,303 *2C6E1A356E29384FF882C70D452871C46DD4E7DB allwedo5
438,366,304 *2C61612874909C08E3529AF6AABCF2E1F7FB86EB JJFATUMAI
438,366,305 *2C6B2533F2530B4E89B29F628C4B61DB9FC237DC alpharett
438,366,306 *2C6F8264AEB0761FC9D4C5A6B9C6F0BC63FFEB3C jm2665
438,366,307 *2C6952ABB4C84CD629F46536D0CFD982DD514212 ALVINIA
438,366,308 *2C6328D20C5240F5DD06B83F3AC6CB89DFE54904 MIRALA-(FEAT.-DIVINO,-BABY-RANKS)
438,366,309 *2C6494590934933CF03C9CEEC271265B20EFECA5 johnkershbaumer
438,366,310 *2C60CC3939B7577BCD49B9476E121E6A3976FFDC AMERICAN-GANGSTER-PEL
438,366,311 *2C6CE03830517E701464D608408E652097433E1D MITOLAS
438,366,312 *2C695362D457AFE18B4218DC6A776E0D06D8F836 JOSIAH.ROTHGABER
438,366,313 *2C68A4A9BB0C5EDB6E1C594D1EEDD185BDCA7645 m^od
438,366,314 *2C6B5DFAE7F95162AF0A3573464642CAE76071B3 MOHAMMEDBUERGER
438,366,315 *2C6818F6CF587ACAFB7AD52D8470E3745F6F1367 AMT#D
438,366,316 *2C65B567ED06958A757AA5040E9F845ECE8B5652 ANASARAH2MYLOVE
438,366,317 *2C649F02946B816762C13C560BCF2C55824891F2 And-the-Jukebox-Played-"Sweet-Child-O'-Mine"
438,366,318 *2C6018E0AC8B7F17EF7E7524300F40EBDFFE12E1 AND-UNDERS
438,366,319 *2C6E83EA9A633652BFD1717719D6FBE72ECC595E KALIBERETS
438,366,320 *2C6B7B86C75E3CE02BBC371A52D18E1BE90F412C KANGKUNZHENG
438,366,321 *2C67D4AB4BB70B38C9E2CB78C7F49A1F64D07EF1 kanisha.daniels
438,366,322 *2C6A5DBD4AE33830CAA0800F057F5EA4A3A39EE5 karagatsi
438,366,323 *2C68F688B8301104961C6FB59A04C4DA06464685 mortonmathews
438,366,324 *2C66A2B9B0C7BBE27BD385450690DA43AA4A8450 a$n&p
438,366,325 *2C6AF524685573A0729EF51E22DDE7A690FDE816 KENNETH.JAMASON
438,366,326 *2C654843D07873761C99D455A79B32FC7463A17B ANTIXILENO
438,366,327 *2C6CA92FEAA103E0749D7A2F529739180D5EAAB4 MOVEMENTS:1
438,366,328 *2C6DC1FD87C131349C17503E08240308AD252C5B KERNWAPENPROCEDURES
438,366,329 *2C64C2ABCCED2CA476D60FAA28906611347C403F kevin-divinagracia
438,366,330 *2C66B7642BC24E55FD968053DF3CE04F91EE8958 KEVIN PURSER
438,366,331 *2C66FF9AE8A2EDD3F66868AB0C2CACBCC74C8C91 kevinvarden
438,366,332 *2C6363BCD72F7D1851EE4DDC35C848870FE08C93 mulucirr4
438,366,333 *2C6E8392FDB85C7B72DA51D9AB521FD651394299 APPREC1AT1ON
438,366,334 *2C6CDC80F804F63A1E0E47E3A3C8F7D1A10E78E1 N93NOU$LY
438,366,335 *2C6550738B88C3CA26366EBFB3F23CCDD781F535 ar100形
438,366,336 *2C6BA0056F1C5EF2C3551425F82D31221CC5E12E ARCHIETHIBADEAU
438,366,337 *2C6F40608F3E30D2295B2E2C972E7AE12E2F548D KOLUTUS
438,366,338 *2C6E6617E68FBB3A695E1D90058257708BE112CE NAN-CASTLE
438,366,339 *2C6477CEF3E9BCF4FC054FE1554A048C5DC76346 KREVELJAS
438,366,340 *2C632AB015174325BAB509A6D10BC797952A2E18 armandoram
438,366,341 *2C68188BFA7FE9E32036A6E7995E8B2122BC0A81 ARNOLDOOSMON
438,366,342 *2C68D55868B19B3105AA86115751B2A18F0A7DFB kr]m
438,366,343 *2C6B0B3EFC8F0DE8987275F897EAA0430556522B ARoi
438,366,344 *2C654587BFD96AFDD2EBC390963BC0AD6E75875F KÜSTENTRIANGULATION
438,366,345 *2C62A3F8F0A50179C02B28ADEC3ECD31FC42213F ARTURO.DOLE
438,366,346 *2C6DF8B333AF22A4E7F7B44C65058777AE4EC1B7 [email protected]
438,366,347 *2C64BB4FE2592DCF1C0AEA996D8E50DDD6FF4A3D nele
438,366,348 *2C6E51726CE4EFFE4E82AB835BB9051C4900DA67 ÑERDA
438,366,349 *2C64656E447F8F211450BBE0ECB95ACF96FD5FE5 lalita.kumar
438,366,350 *2C66D3180C540DA0D4DB2DBD89FCC6B4B4F8A611 [email protected]
438,366,351 *2C646437F5492D87353E2934D20828DDECE4A5DA latin-active
438,366,352 *2C6716E551D5F551271DC798F0F6B47B687C9676 nickolasblair
438,366,353 *2C6A9DE4449AE526E81B249B239B09B2FCF20E8E LAWRENCELASSONDE
438,366,354 *2C66017719794FE6E7B7BC1C97C9FD707EE0E6BA [email protected]
438,366,355 *2C68D3DCBF415F2AD864BBF9953924289C28EB5E ATTIRUM
438,366,356 *2C6C8364850F614A1A8D271B410DFE23DDA579C2 a%u.
438,366,357 *2C69CE4B655EDF12BF5E7D9A012F63F4E36D5C31 NOISEAMBIENT
438,366,358 *2C6803AE03E2C63D311C01AD8311BD2D63F46CCB nonowheeler
438,366,359 *2C6B21E46AEF7221E42AB6ACF9F20E486BFED3EA NOOLHER
438,366,360 *2C69FDD72C8955B04C874538EAF711E46E286CF7 auy2i
438,366,361 *2C67C5BD374C019C1198DC9E941B39A3B90A7ADB NORRIS.BILL
438,366,362 *2C68EE763C5B37756509A3879197657E8AAD3026 NOVELLINE1
438,366,363 *2C6DCC14F619EDD9EDA68629A7A67C3E184F0775 NUDIES
438,366,364 *2C61C312ACD1D427C1389D6EBA37D58E4EF9876E aw!lo
438,366,365 *2C6197EEBFC08AF891CC5910D6E0AD6F74314AE5 [email protected]
438,366,366 *2C6B634B5C4D4E9D82EDED1FE0C7F8CEE69C61C5 LIVINGONVIDEO2K6(RADIOEDIT)
438,366,367 *2C6656388F59E11262C46DC1AEF73908C7DF1ACF LLOCHEGA
438,366,368 *2C6CDA8BC93F1D1F77495ABB1260B47091AC1B18 lltrpsm7
438,366,369 *2C6005F50427AD9B19D45261CE2FC784BE72054A LONHEGWER
438,366,370 *2C67182A23AB838AAB46C779C0CC3D2D0259BC0C b2$xp
438,366,371 *2C696B0B7F69E9A1C08F316202613687EE8544AA B34+S
438,366,372 *2C652D02C9844B18CD92FF2583AB5F1AB94F4A57 LOREN.POLSON
438,366,373 *2C62103EFF95B42A248F46849E5BCBE8C15D0C83 lorenzostefanski
438,366,374 *2C617560883D7A6EE9C0330C7283F1EFDD3EB48B b3rar
438,366,375 *2C66831A44C5B35F11C1B1D2D8AC07E6603120F4 B57091
438,366,376 *2C66858381726BA69B67EC9F5FACBA11AC7D9A5A b;-5n
438,366,377 *2C62715DAD8E2885497D37756F5B73997056ED95 LTSUBGTLTMATHGTLTNOW
438,366,378 *2C66A6C54F9DCCB133246F554D367DD8729C7BC6 B9NMQ
438,366,379 *2C6AAC8ACD33E421A03B276273046370E7642A09 babygirl4589
438,366,380 *2C607B574285F2B69BCB39C5751E791849A3D8E3 BADALLO
438,366,381 *2C6A731918289AE56CA4B392F78221C68D50BAB3 bakhafar
438,366,382 *2C6B30C59AC9C69B5B40C5E6B7BDB05AEDCF8B06 OSSIÀNIC
438,366,383 *2C6CAEB7546FD8DD3586013FD18B2E81523AF5ED [email protected]
438,366,384 *2C6695491ED273F7AE33276192804ECD1DC7031E [email protected]
438,366,385 *2C6E750199D0E31F6127FCC16A8CC817D2C6F4B9 LYLEDORGE
438,366,386 *2C697FC0A2F5B609ACA93FC78905E7C0722F7BA7 otispatka
438,366,387 *2C6E764E902F078444BF7D6550359C83C989169E barbeyiac
438,366,388 *2C64A7A44E5786D5EEB5A3CD688DCA3DAC5BD96A \&m'
438,366,389 *2C6EB18DAEC787666C7595AEDD95E5FAC49B641C M:
438,366,390 *2C6A1B53F99EB07D402BEF0058D2D80E0486D440 BATTLE_CROSS
438,366,391 *2C6E922268BC29E29E83EFB28ADE5C5CBAB7234B bavq-
438,366,392 *2C6863C6EEDB3BD9D61D7564C36792BDCC244F05 ><.*.<======P
438,366,393 *2C66FAF52AA854BCD86333743299071EB17F7835 MAHANESA7
438,366,394 *2C6AB593BC4D425E6F081F631BD92602D95E6C29 maitreyo0
438,366,395 *2C6F2F0662AFD741BC1892E7C873464BA00A3951 malajes
438,366,396 *2C69AA80C569D41B2D4EA3BEC9F6E6F150FEB6D1 bd+#h
438,366,397 *2C69F7FCAE86794CF3B2CC11BB7EA2055B9DF2DF maria-aldama
438,366,398 *2C69D120626F5CEB42EE6B9A59298B0BF78EE495 mariaforde
438,366,399 *2C63B2F377D16C875034EA9A45888DAE753AA308 maribel859
438,366,400 *2C60AB83D2A5BEAD60EF0FDDA09B3980A3EAC055 [email protected]
438,366,401 *2C60BCE9B1FC0575237FB307BC10F6EA1A43925B MARNENI9
438,366,402 *2C633B36923BA5BECD884DD0FA85D720FD85EE75 martin-stany
438,366,403 *2C6C8D8068062792F71ABE9E3292CBEA5B9C14D7 martyscipione
438,366,404 *2C63E96AEF4E39E53A1F02A910B309F1682E3E57 P##B~-`splat!!
438,366,405 *2C609BCBB824C55386732FC4112F348BE8AEBDAB [email protected]
438,366,406 *2C60DDE9AB34036B32DBC821C5BD78C364D68F6A peggy-taft
438,366,407 *2C6510CE32CB718E7E049071243DF18CFADEB281 BERGYBIT
438,366,408 *2C67F07972E83E23F93533640AC51DA65CAF41C0 MATTPOELLNITZ
438,366,409 *2C6EAFC6736FFA19268091E66C599B631F074829 BETOKENS
438,366,410 *2C621010E9C12FDCE81FBF90AED494B5F428FDDB [email protected]
438,366,411 *2C64C8FB83DB2EC15536EB723333CF94D812722E mbarkeh
438,366,412 *2C6DD4C49033B95CAEBD41BA23949E9B3AF62A70 [email protected]
438,366,413 *2C6F8826453604ED7F55CA06DD51BDDD9532B32A PHILIP.STRAWTHER
438,366,414 *2C6C093B3B7C873F4D673C27601792735B343C23 PHILSAWTELL
438,366,415 *2C6CB21CCD02D06EA93C4D3611A7CC7A675C42DF Med0crtes
438,366,416 *2C65051ED0B0788DD666B1C61F371E50E7366C37 Medbragte
438,366,417 *2C6D1EB4A4E2A38B800F06297725A5E3CD854B2D BHCQ-
438,366,418 *2C622C0398A8B723FB7C8DD7C8B3208CDFFEE2DE melvinagin
438,366,419 *2C68D4FA97497AF94C46D83A29FED7B115056AC5 [email protected]
438,366,420 *2C64A8A213D5DC1105A7032C5C576AEEC5241386 BI3_T
438,366,421 *2C633A3EDD84C0B5969074A23EE4E9849EE9D9BF billsupport
438,366,422 *2C6BF55F37F6A9EFBFBF276E03644D13CA8CFEE4 BILLY.SPULER
438,366,423 *2C6945CCA9BA2452162F608DFACCC9CA860D10F7 bi.lp
438,366,424 *2C6095C8D0A46272AA5883AD816B61F027B19942 POPAGEY2
438,366,425 *2C692FBE721E78F0342EC81B28D1EC22E33B55D1 BjG
438,366,426 *2C6FEBC149442AF8A71DB8668341B9DB602723EB b:kjv
438,366,427 *2C672731CF2A8D0CCA745B03BC01FCC71C7D3AE0 p######p.~o.splat!!
438,366,428 *2C69C24C093331C12D9FBBEE0C40ADA024F6F0DE PRATIMASIN
438,366,429 *2C6C2D29A5000FAB37C8BEFEAAE2DE3216F2B0CA prefektsing
438,366,430 *2C608C55E8FC40991C41BEAD15A86D01A0E8865F MICHEL.NINA
438,366,431 *2C6D8EC22F8286F082EAD8879F2FDAE3E5CE1310 micho.saab
438,366,432 *2C6E6CAB6164BA27B5053426376F8BA41252729E BLI/C
438,366,433 *2C66419EACFF34559AF2AEACA8BE623338183B16 PROS4ISM
438,366,434 *2C69FF3C005129CBE4D09897E8A9B662B82D9993 [email protected]
438,366,435 *2C65C90C68B39216E222E50D59FCA17599DDCB78 bnhu2
438,366,436 *2C67428B85F7B12671909408B12D6421F5A3F2E1 mindphysician
438,366,437 *2C6DEE4E5E0EAD7776759B1ADBBB4AFAD5B094CE [email protected]
438,366,438 *2C69B5973826E0ED698AA88E62C7271EA5F10F1B MISSISHNESS2
438,366,439 *2C6CF978C913F902F91590C5ACDB3DF024A1FA64 (>-<)**q----P
438,366,440 *2C6E86528099BF5AD80C9B2DF459CC160E490B10 MITCH.LIPSKY
438,366,441 *2C685F1547F5E1766D556302549D8911C3B49BEE QUINN.BEWLEY
438,366,442 *2C6FB16B5058DB78B615258AAD8F6DB9E971E6D7 QUINNDUERKSEN
438,366,443 *2C6E60B5BD3AF067DC2864632FFCC92FE82D2B77 Born.To.Butch
438,366,444 *2C629101A0E114402FB67D2582CB8A88C988B7EE QUOTIENTENANGABEN
438,366,445 *2C618094578F15E717E046E79AF99147D17870AE MKUHN
438,366,446 *2C67D9DF76DEC701A6F2C299B41E22E0881433DA B#####P ~0 ~O SPLAT
438,366,447 *2C6483EC2F83E16CE7C0E1AFB4B90C0E7695B7E8 bpi-,
438,366,448 *2C602F6D6A4C23F15E0627D7DC5F6405D385BF7F [email protected]
438,366,449 *2C647D87264202372911A8C0D5755A42BA1D39ED raphaelsirucek
438,366,450 *2C612B3A66BACD0EC449A9EECB0877A09CC9AB6D MONOTERPENODI
438,366,451 *2C6DC380C2756C00182F9E35FD9EDF6A9664538E MONTERINEER
438,366,452 *2C6CF195DA25BDE8BD4B07297C651E7BAC15093A montyanstey
438,366,453 *2C67C0D9F463CC57813C555BB5EF806EFC45AEEC branchtemplatesline
438,366,454 *2C6A479D168E2DAE96CCB93F76C22A200E1C85AF BRANDEN740
438,366,455 *2C6B37450D276812495E6DC7C41A174C3B49E744 BRATATI4
438,366,456 *2C698DE25ED1AE4F880FFA28747281B99E05EA0F MOSE.IENG
438,366,457 *2C6DC7724264A7662F8EFDB1D68A3DB6F2E15289 mosessetliff
438,366,458 *2C6B03DADC5333A5B33FC7207FA51ABCA0F53DF5 rayfordlytell
438,366,459 *2C6502847905A6ED41C1C75BFEC09FD505F1E6F8 mosetutaj
438,366,460 *2C6CBEB0D65D19984BA00674E9EDFA728FB60AF7 Mother-$h
438,366,461 *2C61E194B3C25EAD75B4DB60CADFAE7AC8AC285E RAYPODUSKA
438,366,462 *2C62EDFDEC03C4C31AE5528D2BB25BC5956377DE BRET.KASPER
438,366,463 *2C6383AF061233E5B61970E141F692702C8DCDF1 rcsn-hnns
438,366,464 *2C6D3A9F2B189FD15EC1410F058C3EB67C3ABACF bricejabali
438,366,465 *2C6236EB14BCA1A4A1BA69149266EFB1CB666369 BRIJNATHT
438,366,466 *2C6DE37EC682ADFBC3190371424FC5B6D781391D REBLITZ
438,366,467 *2C6A703F64DE8A445C03A2CD16C44D76F66E3149 murphydragon
438,366,468 *2C6EDE1ED93A3D482577DC9E636EA5CDFB5FB815 m,xd
438,366,469 *2C682D74E9CF20BD95A8F4B59BF47541627C8C59 MYORION1991
438,366,470 *2C6E6D248C1B790D85881F4EA3E30E0DDF096AB1 [email protected]
438,366,471 *2C68C3566EEED7087B403D38B1213B2ECBA39A79 REGINALDZUROVEC
438,366,472 *2C62F6237C25D12D0E600C59D399BD004F1F87DF bs=d?
438,366,473 *2C68D6FC1976A8E6A3B2CC36C9ABD131DD319F0B BSWCLUGNETBSW
438,366,474 *2C6D1798FD24C659FED2C6981391E1B1168C53F5 NA.MIRE
438,366,475 *2C60EACF5BFD5FBEF87C0786ADFD2B42B046643D nancy.trice
438,366,476 *2C6BD4C91373FD7A65B999FF1890D0D0D5991973 BT56I
438,366,477 *2C68EA5BF4FDFA632BA742FBBD7C3B10AAA9BE3F BUFORD.GHIL
438,366,478 *2C6B200E425B505090A6D37B46DC09AE4ADCD1DC BULLET_PERCENT41666
438,366,479 *2C69D28C1A64299E4AB62499284FD5CBF789C318 bv-
438,366,480 *2C6552C66F15D998CFC9EAEED17E5C33DDC460BF NATHANROSENBURG
438,366,481 *2C6D95BBABD6DEA61B1E5F57E5A9292176A2BAAE bwbrq
438,366,482 *2C6B6293E754CF358E641142D2DD7001CB2986ED nebohre8
438,366,483 *2C6003F551FF075DFB163E036018DB1CEC25EACB RENEWING
438,366,484 *2C6DEB0B3B93753616F637F9A53809786681202F netzwerkfehlers
438,366,485 *2C603CA0766097C95AFDAB7D325D500563FBAAD2 bzivi
438,366,486 *2C652007CA2E5D1C36DF814CD6742EB7978FDF5C new-coke
438,366,487 *2C610C08133EA562B88619CC7DE89ABBD91F48F2 NHYNHY
438,366,488 *2C6D53CCCFB266D1D8B37C9C057760E4D4C1BAEE C0KPI
438,366,489 *2C6843C4952E9B5325CEEF83B28E085A082C1CE6 NICOLA.KING
438,366,490 *2C66100A4B750F1CD0593084808001325A3CD83C c2:el
438,366,491 *2C6C2A78DCA9FB15B0B4B2D7123D041CFD184AC2 C301Q
438,366,492 *2C6030354D1DBA13BD6B5B39D0B54AF0CCFD8BAF NNONFIMBRIATED
438,366,493 *2C6134DFB0AB7B5EC534D95D3C2EFC48BBBF434D C-3AI
438,366,494 *2C6F20A9B82AB81C1D9B59DA2BB1CE31DA34BFDC RICHIE.KILGORE
438,366,495 *2C6947BD2C80BA5FF8B26ACB3505690438856488 C7(XR
438,366,496 *2C6084F7A9DC4F800F3CCC8619B48CA3A800D378 rmkami5678
438,366,497 *2C64466597A6851333C41C049B25335968CA17A1 CALVIN.HOLBROOK
438,366,498 *2C635BF32E742F5CF5CA4CCA61B1D6B09CB66A2E CAMDEN HIGH
438,366,499 *2C6DA09396FBD6D13372E89591188B1365FC4264 CAMERON.BEUL
438,366,500 *2C642456B1D44BC71848E0A1662F1103C371CBCF ROBIN-WES
438,366,501 *2C636E5C7604535BDA188A9CC0FFDAD119C1F210 ROBTPURVINES
438,366,502 *2C6E7D12BCCF886A24D61DD6C58FF3099C8A60EC ;)o~0~ @3
438,366,503 *2C6D1273E6293E45938E9D90DCC93A09380EB8BC cärnlens
438,366,504 *2C6185A2B868E95F00FB351DF53B4C11A87B123B obakeyashiki
438,366,505 *2C664AEE188F0D50C357E9A430F37729A208CA82 OCTOBER.(ACOUSTIC)
438,366,506 *2C6FC17D969390C114905309F21175BA7D8591A3 [email protected]
438,366,507 *2C6A95B7C38504CF7B9C5A9352343005C8B3FA69 CATEGORY1889_SHORT_S
438,366,508 *2C611C2C16793FDBEF690D812DCA724FAC89E285 CATTLECALL
438,366,509 *2C606D64CA7C7BF4029597EAFB9E3698ECAC334B ODZEGNAC1
438,366,510 *2C62F78BCE53BDE8DBE202E7041A6F90847986C0 ROMAN.POTANOVIC
438,366,511 *2C66075F0C4C8FE302107624095B4535B9980F7A CBFN
438,366,512 *2C63FDEB7060E257ED3EB54868A4C18A372C1C78 ROOTALPHAROM
438,366,513 *2C617B83E73B77579E91CFFDA9ABA26EFA0FCDCA OLEN.TREWORGY
438,366,514 *2C6424E29FCA5167425FF82A49022D4DBBFB0255 rosalynsantiago
438,366,515 *2C6431B707AAC8C2695DFBC7F4FB0AABD979E158 OMNI-MIND
438,366,516 *2C6D858B6771FC11EA38920676DA889801600B4E ÇÊDIKIR
438,366,517 *2C6E8FF1135AA8C41B2B526FDEAEF93750CC0697 CEDRICLAZALDE
438,366,518 *2C6EAF330606E8B9F5BBA7A998978D9BEC7F46E4 RRDGRINNODG123
438,366,519 *2C615C01DB194612923AA8377B10E6E36CE39223 RRUSHRA
438,366,520 *2C6BE83D02FE1357CD931BC2BE5CE8A22DD201E7 CerK
438,366,521 *2C6D7A3A9D3B38DD4270C0669C4291549ED30C5F (>_<)[email protected]
438,366,522 *2C6AF4441EE79180F7846F415A815AF9AA710F90 RUDOLPH.MCLAGAN
438,366,523 *2C68E4BD4C6E6A9AE27380E1AADE242A35BA71C2 RUDOLPH.MEANY
438,366,524 *2C6893F69DBCBA3F4C5F19D114DC6938F7EDEB51 cf!wy
438,366,525 *2C67EED70BE1B68EE47902DF1D03D9053FA15B2B "os",
438,366,526 *2C607AFE3871299980C0FE13998E033FB1CE12B6 rwsmelp12
438,366,527 *2C6E03F1832CB97B92ABE77B2357D89586458CB1 RYANNABITY
438,366,528 *2C6A3217FDDD86308E74F9B47B96E0DE9D3B3226 RYOUJITI3
438,366,529 *2C666178845A778A0538ECD58C5A7B1787A9F19E charlietrippers.comwww
438,366,530 *2C6B88673478660E9320D713A1FE801DA02C8160 charquis!
438,366,531 *2C69A98E4562530DC75EEF17B60E146A29029614 ow8
438,366,532 *2C6C852CEC7B0295C7A386B8A55337009DB2D1B0 [email protected]
438,366,533 *2C6639C279F1C54B89C944831EF30061EF47900A O別冊『ファンタジーCGの描き方』(工学社発行、2001年8月)
438,366,534 *2C6B231C506707C6504710CE0275A37AFB49D621 P3R3ION
438,366,535 *2C6614BE3B89DC0F94FD4700A5265053EEC5CEFE [email protected]
438,366,536 *2C682CAC570C19A36A0C11E0C4DB51A5CAE262CF PALVESTIR
438,366,537 *2C6975F519337EFE6378A129C211745EDA6F098B CHOT0
438,366,538 *2C66D9081C74F3AB20D670C8840FF38D2D3BE65A PANTAGRUELION
438,366,539 *2C68B722D6A56024E8CE071A120C5000D4546CF7 CI-,/
438,366,540 *2C6887D44B7C8E860D915DC92F95C8D2CD24A892 CIĄGOTKA
438,366,541 *2C64B3EF7170B404FC4484EF7746FEFDD2F61632 SBALENOZ
438,366,542 *2C672D2445702465F30951C95236C799EFF6E890 CKEM,
438,366,543 *2C6BFFB79FE138D14442FEDEB0D6A7DAC5076B3D CLANDESTIN8
438,366,544 *2C6AAD37C2EE958C4F65B2E63AB802BC134EE89E class="srtitle">1600watt
438,366,545 *2C63B43CCFAC3F7CDE08E1052F675B174E468CAE CLAYTONKATTEN
438,366,546 *2C6F229272526541D4FF4B28FE02B15C680BFEA6 PER$ONFC4TON
438,366,547 *2C66C93C6663E2CF6D7B96A96A573EDC216897C3 [email protected]
438,366,548 *2C6504F4DC0176A278DB8E835CACB5C74C2F75B9 CLIFTONHUCKSTADT
438,366,549 *2C6DF7A79022C6D1FB6627C066B083C96AAEC8D8 PETRIMYLLYMAKI
438,366,550 *2C682A81C6E8349C5BAD06A2939D73A9A113E36C SEMIDEPENDENTS0
438,366,551 *2C63F0970FF1F7C454122FD6490ACCB9C0A93F91 PHILIP.JABALI
438,366,552 *2C6F06A73B07982CCDD74480CB95BB42C976E6E6 cmyg.
438,366,553 *2C6358FDDE1011F313452A81647B03960CE2CC29 PIERRE.MCNANEY
438,366,554 *2C6D1C788591CBB653ED5F5EB3A2C7104711CC05 COASTLINE—25
438,366,555 *2C65C15873F2C76CC0FADF4E0C7939CC48BA6D2E sex-in-space-is-not-just-a-good-idea,-it's-survival.
438,366,556 *2C60F9931C553F067F1EB1F43DD0A4D8F80B9B6D sfavoritedancer
438,366,557 *2C6FBC8EFAAC5BED113213B9990C3ED9C19D2219 COH!%
438,366,558 *2C6C9838D604DF500F10B3CBAEE1EF143774B838 shanekebede
438,366,559 *2C66BE5D494701026A9BD79EE0474A476EA6BD78 COLORDUBBING
438,366,560 *2C69F350AC98D24FA3D8F0B6CBDDD240515BBA26 shauntilford
438,366,561 *2C6F5BF321ED0AEBC2172A96AA55792A92AA4334 SHAWNNAGELUSASANAGELHOTMAILCOM
438,366,562 *2C6EFD27A9660217212E05902D5A09EAC6141636 SHE-IS-SO-SWEET
438,366,563 *2C638038EA156AD0BEC646961FAE6A39F1D58E52 SHERMANBOLKA
438,366,564 *2C69400E9B0486618887855B12CDE069E0AD4AE8 <p> on saturday, may 24, 1997, according to ms lewinsky, the
438,366,565 *2C6980A6FEB116C330CB17E71208D54C411B0904 SHIELA.YULO
438,366,566 *2C6D3597F16D9E03B2CF6455AEBD1E73680F6E58 shubhi-rai
438,366,567 *2C66CA78D4775796FAF2B46A64CFE756BF43F379 sieben musikanten
438,366,568 *2C6D49AD2C97774101179DC67F1E69221A8353D1 [email protected]$
438,366,569 *2C6065041B0DDC5D4890612A3B5AAB5602044268 PPZ
438,366,570 *2C6D368F6C2A22F460E641DB5E1FF0B4CD2DABB9 CORYJOHNSON
438,366,571 *2C62BB682C612B25D7BB9280D6AEB34262D3C63E SOLLEVATODALLINCARICOMISTERLUCAGOTTI
438,366,572 *2C6CC8CF53B0CF53FAF8EFE8BE562AF1FC3D3776 sollzust0
438,366,573 *2C68A2D45D4FC077D16EAD5F0E0E07127DA12ED6 crqwq
438,366,574 *2C66C5020A367FF9B10DF2E0EF60250D613A3442 Q#P.~0.~O(0_<)
438,366,575 *2C6221765EB1F8C59B0AA5427A428ABE04A7606D splat-~-<==p
438,366,576 *2C6FDFE0C945FA0E5766D7A82CF06E8931047FD3 CursedBlessing
438,366,577 *2C6CD31DB09A7325BE2F037999FC28D70E4FA2B5 sploit~`-~`-<#b
438,366,578 *2C63EBEF3BFF901445D2790CDC1C86BBD7A8578F sploit.*.*.*.d=====b
438,366,579 *2C62F1B9017BCDF15575F2CD5BBF1E58AA075275 SPLOIT*.*.(####P
438,366,580 *2C61C1B9BB69699F223A5615DBFF3A5DC473EC1E CV%,H
438,366,581 *2C699C6F744C20086D3C5EE8003886B14CD3E4CA C.W7U
438,366,582 *2C63F8D4CAB93B6C28788425164D3EFFD0C616BD SQUARECANARYTAKESOFF
438,366,583 *2C6E9C02F0F327BEB3EFDCDF3410F7AC715986A4 SRIVELSERS
438,366,584 *2C69F33F841BAB8CD70F08B9C9A81A2D9AFEB7C8 CYRUSLITCHFIELD
438,366,585 *2C6F10EC1F077FAB03FB0B09B8F278EAAD0E9325 CYTADELAMI
438,366,586 *2C62DFFE8177D01F9886B831F2898F9DA424665E st4unchly
438,366,587 *2C6707D4259DA0FF06CDE146BD826C5B2CECC85C RAZZING9
438,366,588 *2C6A9AC859EA29B5B09CC02F89CA970FB21C3889 .redlof|wen esoohc dna potksed eht kcilcthgir .1
438,366,589 *2C6FA185CC88A7D63142637B161FFD5D98F77F55 d6g)
438,366,590 *2C622BC9D1CF5663972AA02C3FAD1E853CAFB230 D9A3"
438,366,591 *2C66F4A88ACF612DFD0F83F15D538AD41B486952 DALTONNECHANICKY
438,366,592 *2C6101FDBA0A3CDF8295C7513CF240EEBDC4C1A0 RENEHUFSTEDLER
438,366,593 *2C63498FF68887EAA8C3F3AC75994C0212017478 RENE.PERRI
438,366,594 *2C63B66AEC072C3F5EE4DF4B8D2D7035FAF692C0 RENEWING
438,366,595 *2C6797BE43472DC27577795CF5B07835BB468299 dannykutcher
438,366,596 *2C69592C34CBE122F35DC05C1FDFE9EA00EF28BD DANNY PASTER
438,366,597 *2C6FAAA325757B0FE6986694FE2B4A1B9451B225 dantekreitlow
438,366,598 *2C62FFF0CBC6CD4D1AF2055B6CA3A26FB86C617C [email protected]
438,366,599 *2C613B1CDA7D28A1905A997EFF630EF611A53B88 DARIOPOSTEN
438,366,600 *2C6694244CC689F775928B3BC5F3313F0D8BD6F9 SUPPERWOLF
438,366,601 *2C6FE3EB0B3BBACD76CABC9F501E8F6DE8E8A676 retonnoc
438,366,602 *2C69EDBB81A914C8ADD547DF28C72688D06F2B07 [email protected]
438,366,603 *2C60DE4EB8868D575236E7FFD186F2543C6CCE1C SVESEZNA
438,366,604 *2C656D4DC4DA080EF2FF12D3539C41EDC0070DFF date20050720
438,366,605 *2C60134C4583E5880F9667B2B58107E34FE457C3 ricardo.inzunza
438,366,606 *2C6BA0FC0020AF0187ED7C15CD123077ABD7FAA7 rickeysotolongo
438,366,607 *2C6C8BB38BFE7F9EB4E59A1A442B1578F2645A54 db%/g
438,366,608 *2C67B80891BB499C42AF5316AABFF731E604E3F7 DC.JT
438,366,609 *2C6F53E5BF246650A775D289855A5ED81F001497 TAIKAUSKON0
438,366,610 *2C645E00B70E500F9AA87272B9B7AE2F827FD232 TALK90.240.12.171
438,366,611 *2C67634E5FA88BCD75EB5F71B87E8CB1B4FE549D TALKBOKHARI.IMAD
438,366,612 *2C65559072CAB3703C3181B1E70C6000B2DBA36E DEAFENED
438,366,613 *2C69F0938D01667AE2976B88ED8ABCF7604DC2DE roberttrowers
438,366,614 *2C6309E5EFC052157F320C70730414F9DB74537C TALKTEDMB81
438,366,615 *2C6A0D8CF29E21F7A73ED8C2924AB91FACFF8146 TAMNOCRVENU6
438,366,616 *2C622F964DCA29ABB3725C9D860588DA843774DE Rock-'n-Roll-Station
438,366,617 *2C67B8DD96F455831657E75923A010788CD56A77 RODHUSKINSON
438,366,618 *2C6A43675A831911FAF34D97CBE16EC3CC080F9E DEEP-ORANGE
438,366,619 *2C6167952F426806D8C82D89C4E51F810806419E defaultgc
438,366,620 *2C6C6CE589BC255FF31BBCED235E1977EF862166 roger392
438,366,621 *2C6EDC91FB2CB3F318413F53497B9A03D9F31051 rollandwubbel
438,366,622 *2C6AE5B59BEE5BBFDCF98C76DB1CD10CEEFE822E [email protected]
438,366,623 *2C65B1AD84C835CE7BF6CA42D425A65A8CF76EBB roscoemarban
438,366,624 *2C6A39B760D4128DE3A8A5A1D472F80E77C62BD4 DEN-HELIGA-NATTEN:-X-MELODRAM
438,366,625 *2C6724F64F81B88727FF66BBF53FDD9052C4F4B6 denishorstman
438,366,626 *2C6B4D1325774C5AAC45C076AE95E0E1DE889046 tennlove
438,366,627 *2C6D5CC47373416DE0AA328B5A64ECC1909618B0 deple+!on5
438,366,628 *2C68FED341DC09F0D9744918A6331F31297D9A5C TETTAHCSING
438,366,629 *2C6B05765A17DD9CEEB58077F968917C430B5619 T&"F
438,366,630 *2C603E8CC87438852EF8C6B1A30344D857588D76 THATCOCACOLAQWER
438,366,631 *2C621785CD465202D539D82582F964ED9B1D33D6 THE.AGONY.WITHOUT.THE.ECSTASY.EP
438,366,632 *2C650FB81DEB00AC0A9DC55F33A16F15EBF26DBD THEATRESTEELERS6
438,366,633 *2C61F4BDA2B713C54DF22A133C8DB271138C353B thebenoit98
438,366,634 *2C6AAFB134D6CAF8605EB10C3D067606BB5FAFE2 thederek1997
438,366,635 *2C64202B4F72F790B92F50FA06FA076EB5087670 RUSSEL.JOSEPHSEN
438,366,636 *2C62DB7D22845951F61B1B6DA67CD74F578D4A31 THEKILLERSTEAUA1
438,366,637 *2C6F9F97D8E17532D2E041CFADC22237C15FA956 the-moon,-i-care-not
438,366,638 *2C63E22EFC21D199E3889631D2E857402EF96B0B dg2f)
438,366,639 *2C6061F4FF0A1AE8674FC5E26AD71CE008DC83D6 THESATURDAY83
438,366,640 *2C6679B101C4B1F79A34DA8A2111F201FF7233BC TIFFIESING
438,366,641 *2C65CC2B87EE3B0FE08F71B6E51C3B5BEF47D894 S3NSA7IONALIS7
438,366,642 *2C64C001B4B59E0E33F9DD31EB0FE1FD8A8FB8BA DI$INC0RP0R4+IN9
438,366,643 *2C67ACCAFA730F42AE90C77F4DBECCF530FC5859 dinamo.de.zagreb
438,366,644 *2C6660C3AB74C4BB5A4A6B85D1C3D97C365A3AB2 SALATOLIERNES
438,366,645 *2C6FB1F6EABD45BB0CAFF0EEC42D6A981B7FBDBA DIVER66
438,366,646 *2C69FE99705F2CBFE5DA66DF6441B36E41DF2079 dividingday
438,366,647 *2C68F0243CE19740CBF02359487B3A57A463783F toddkoria
438,366,648 *2C690E77DAED07DCC04487821735912FFC5449CE dk<=
438,366,649 *2C6A9E683271484052C038485616A340DA92DF0F sanfordbumbray
438,366,650 *2C66E9AB6722F3FC9D0449412627691E97ED02A6 D/.KD
438,366,651 *2C66D7271DD31B598E5F651BFAFB3065AD1CFBC5 d-kg#
438,366,652 *2C65B195EBBE70F17BDC0E997E72514C5469C095 tonypartida
438,366,653 *2C69A6A4DD91DF05E48C1A90F4143EECAA1283DB sapphire7174
438,366,654 *2C605C70C59696A601250F77C9811D48E51DCD15 TPHR1908
438,366,655 *2C6BD7C0303DAEED13BF7E68F962B5D81458B086 TR2U
438,366,656 *2C626797449EA1383B483C702F8D96D1537EE328 TRACEY.GODBEY
438,366,657 *2C65253702B88655452C548DFBA49F3E3A01788A Tracy-&-the-Hindenburg-Ground-Crew
438,366,658 *2C6CDA1A6EA7F77EBADB5AA8A75FAF03F609788A DOITMAN123
438,366,659 *2C6A6EDAAA1AD630F109AF72F8D2D917040176D6 schootsverheid1
438,366,660 *2C6C3F93DDA760CB42237A79223CF9DC9F158E4D SCOLANY
438,366,661 *2C64DB32CD8673B0D73590244969356EBAB08CFD travisoch
438,366,662 *2C668CBD338F21535B9500A3DDAF6A15FE0E3AA3 [email protected]
438,366,663 *2C6B19208468471469F77119EC87A97F97F5007C DONGSANDVILL
438,366,664 *2C65C21B373CE6E61836A50B179AD1B7BC938734 SCUFFED
438,366,665 *2C6489EFA33C3FF1E5CF6CEAAAF0D4A6634F910E seankinerson
438,366,666 *2C62B58DE7F3044AFB2E40DEEB6307074DE4A86F SEATTLEVISIONS
438,366,667 *2C65A8A70C6844033CA9880C3D15B6EC1A71C981 douglasscarrahan
438,366,668 *2C6542A5D11A477936A030F26BB9BD80AA1C1CEB doumses9
438,366,669 *2C6FF8A0F45C13B0F50AC8405AC88480D7D0E44B seetieren2
438,366,670 *2C678F3DEF14F487DDBE210FAA809734B3AE1CD1 do{x
438,366,671 *2C6FDECDF894845BDAD5C8AB16CA11C1CCF6C940 truies.
438,366,672 *2C672077AC7F0306445F06E7AD79BDE6C9CA081D [email protected]
438,366,673 *2C686152C29AE484347C7F67F62EF94EEFB840EC DP=N
438,366,674 *2C668388887BDAD92F8D9E3C03E0C62A4B58D926 tulisanes
438,366,675 *2C6F3D7CCAABAD0B6E516B7C3EC9C1AA61DC6D72 DRUNKENNINJAMASTER
438,366,676 *2C6C3C02AF708152398A25F01505B19892C44661 [email protected]
438,366,677 *2C6D5F6923D4E820530D84FCD597C0EFC6BC4D01 dsj3x
438,366,678 *2C6252EF4C314D8152306C83334A43C0543D796F dsobn
438,366,679 *2C657EF909334625F467C94D6F4F478244F2F8AA UDKASTET2
438,366,680 *2C6FD1A4EAB01519E3B129F91F38AA502F9D7537 UGODNIJED
438,366,681 *2C600660A3B368A6A0C6E6392438A725D0604097 shaynesurgeon
438,366,682 *2C63E8638D3ADDBA56585EF6ECA6CC9AB2302120 SHEILAPUPPY1
438,366,683 *2C6DBB53ED32A3712AF1147087F6B06965CCD11D DUGONGEILLA
438,366,684 *2C62C7A3C9BEA516C2C80F3F302FB4FF753F5CBF SHELBY.SIELAFF
438,366,685 *2C6686FED89E2EDB9957EBEC93CAD0DE31F79434 SHELTON.SAINATO
438,366,686 *2C64FCF8574891D924BEE31D6015D01109851219 [email protected]
438,366,687 *2C6E5935ED40180A4FF491A0E355CC9CB364E0ED duwg0
438,366,688 *2C66D2ECBC1AD0BDD8D3AA4EFEC3DCF038E0782A SHORTIS0
438,366,689 *2C6DED3B699669AA2FF9EC6B41409CBDA313FD72 SHUN ATHE MURA DOLA
438,366,690 *2C616E61D61D7041BC799DC3F90A40E81FC2459D $UPERFICI4LIZE
438,366,691 *2C6C1378DF0AE6DE7EB961CF9B745C883B3D8FB1 SIGNIFIES6
438,366,692 *2C638FC3AC2DBBFBED3DBC376C60DA32070C9225 DWAIN.CASACELI
438,366,693 *2C6D0EAE3CA0F2C6160D4CD719F3651A83D59AE7 SILVIATEODOROFEIO
438,366,694 *2C632A5B3DA2038B5A33DE9B76AE6B7148AEC923 simpleindianfoodblogspotcomsimpleindianfood
438,366,695 *2C66C4C8F86B892AD5660C49AE399C4D43F7F009 usha-girotra
438,366,696 *2C6376709ECAA4FDD363988AD55C05B8861C3683 usrcbsw1
438,366,697 *2C60A79F1CA049038003C29F50EA54DC5D449884 dzmti
438,366,698 *2C68767C6FEA03110907535BA0381528C8CC30E7 v3y!
438,366,699 *2C6FDFAB6551BC64B76F11CC00C050E1987D5411 SLINGSHOT.DRAGSTER
438,366,700 *2C67C545D527CDBFDDEADAB2F5638F205B50821E V'BV
438,366,701 *2C6F676482D53C55D65063A01AF64A2BFD7F60E1 SMOKIMAY11
438,366,702 *2C6443D1D23CCDE8A13B482F5F332A880903F905 eddienathoo
438,366,703 *2C6BAD389E137DAFEE85DD493665ACE441A10DEB EDIOLLAT0
438,366,704 *2C613AE5799A29BB533163166F495A02C0C682DE edmondscafuto
438,366,705 *2C69B88157BE1C8ABE67D933F0EFB923F02C7F8B edoirepwed
438,366,706 *2C6911938C9431DE4BF2BBBB67413660DED6D6EB SOFIDOG7
438,366,707 *2C65493A41353C2A8207A25853F580A0AAFCA888 veronica-maytum
438,366,708 *2C6E0FDD67B3E24A91757EB428C6075DE2598698 eekp.
438,366,709 *2C65226A240ED1557A925DFE6E432346C06503BC eesserac7
438,366,710 *2C65C9920774FB01D0831E75A5F4FD28151ED65D ef:%
438,366,711 *2C664F619C3E97005F9427AC896BB104FD0CFCCD VICTORIA.NDIFON
438,366,712 *2C6F7F8F04D444E053D8838C253B399E664295E4 victoria.summerford
438,366,713 *2C6EB72FBD46C3852F9F153984241FBE8FD1246C VICTORISHATILOVA
438,366,714 *2C6ABA11E39691532328675C070E7635834C8E72 VINCEJARRY
438,366,715 *2C69EF11EF722A4F7284BA73451E5CE0209ED867 EICBX
438,366,716 *2C6379F8CAA360BCD68D4FF81FD499EF55F8B0F7 SPLAT!!O~0~ D#B
438,366,717 *2C64052FA8DAAB1D91FFE000DDB4A67BC7262FCE eliaye
438,366,718 *2C6E490E8C240A3005DF4073B02A8A21950B7814 visaaaron
438,366,719 *2C683459AD2FB1313EB25A5DDBE14E84EBF7D715 visamayay
438,366,720 *2C666750BBE404A43AFD0F3C0F9E7D53CB5114A4 VITOSACINO
438,366,721 *2C6122A8F5EE52D914B6771D1D5D750CF0A364BC ELPL
438,366,722 *2C6235F66D081BEF76DA9764D8D650DECACB190F EMILAMALONG
438,366,723 *2C6DB3A20D6D98E6EC3E204D517B30EB8CB45F3D emotivity0
438,366,724 *2C66F0E7A58C6AA96FF3A0B960F11840756DEAED [email protected]
438,366,725 *2C6C68B6C4C7D4CEC0DB1DD9D749147227FBE312 ENYISRAEL
438,366,726 *2C6EEF5067972038C3ED98F97299FA3DE81CDAC9 [email protected]
438,366,727 *2C6FC5E0BF047461FE2AAE5A5103782992ABCC93 W0XPAAAAIAAJ
438,366,728 *2C639D3F068CB80FEDCCED241609D90788176E85 ERICHBLONDELL
438,366,729 *2C6C3543E4A3BF5622D0FB46FF659F7A4E8CF787 walteryeargain
438,366,730 *2C673E57191DAD7D6D93C90D4F958B0ACCFB4D95 STEPHAN.AKERLEY
438,366,731 *2C6C27920E6CFF2C4BC3E65FFE518DED9C4851C4 STEPHENSGORDON
438,366,732 *2C6809FD2FF71315F58D00F9B00ADFEF104E5E85 WARKOPBOKEK
438,366,733 *2C61DD24FCC38CCDABC8AA7E87DAE49EEAB48F1A STEVEN.BERTMAN
438,366,734 *2C6BEF4F3A63644825A32912DDEADA5ABEA4A700 steventrillana
438,366,735 *2C6371A365AC48BEA59291BB76D4114D401CB0D1 warriorcharlie
438,366,736 *2C60AE42FCC552AD213D0511B30870AC109813FB STOLEBENS3
438,366,737 *2C6E4FCB8B77D4696E4D04A6AEDF4A67AB29C836 STOLONS
438,366,738 *2C6D4F6E75284C889916F303770E92FD5F83672F STRAPHANIO
438,366,739 *2C658532CA39F54BD8C9D0117DAC16F4086A00AB ETAD(
438,366,740 *2C686C2E3AA62784FB6EAABB072975B9882F7E35 STRILL2
438,366,741 *2C6709F2586557DC3683B34A0F370D008823F2BE STRURTRIDGE
438,366,742 *2C65779B434BFA34CBA8E4AE192DA7734FF285CC [email protected]
438,366,743 *2C6C425530F990770EF406D0BDF57F256D172787 EUN.JO
438,366,744 *2C6330FEEF3A9E87E29DE07EEF6E5693061B6F3F WEIZEHALM
438,366,745 *2C6F7373461200EF21846494AB86C8BA29DBEFAD SUBLETTABLES
438,366,746 *2C646981D2CDB5CC1AF6730E8CC80A5582FEE53D SUNCHICO3
438,366,747 *2C6D86FEDABB5D343D60A98B35F291661494880A EXANCIENT
438,366,748 *2C6C7CF463528612952122B6E87D6A3262EC365B [email protected]@+0n
438,366,749 *2C6B3F53E31C279F21618FCB90E3CB76E11B578D exhumes
438,366,750 *2C6B5D8DA87ACAF938D06D6CD89A5694D8A65C38 WGGSHLY1
438,366,751 *2C69FC1DB46150E0C637280FE4131843355AF242 WHEN-MY-BLUE-MOON-TURNS-TO-GOLD
438,366,752 *2C603154749B806CA261A696BCFEBC25C7684F64 SVERGOLO2
438,366,753 *2C614DCF8C074BDF08BA4E84D4395D9B263380DC wileybhola
438,366,754 *2C62FD7FFA3314C81CE76527C32B02955429CDF3 wileycormany
438,366,755 *2C62D1178E1478D346FB14DFCA9AEF3F7ABBD9CA WILLIAMS.GETZ
438,366,756 *2C60B948DF704AD8C5477DA7B054AE8207B65EAF WILLIAMS-LEKAN-ADEOSUN
438,366,757 *2C6FB40AE30B61A8900AEE5AFF3DC8FD75EABD97 WILLYSENECA
438,366,758 *2C6AB71A0941E4D85A86499CF4E7EC9CCA5AC70E tagatajinjamae
438,366,759 *2C6C03A89912CB92D13FB6185E4A4D3C20F80C59 TAMMARO0
438,366,760 *2C618856353C08F714E326692C97FA629097A1A9 TANSENDSÄLTIGE
438,366,761 *2C6E422CFF55F75FD93E28ED31E35FC276B5901E tanya.borchers
438,366,762 *2C6C446FAED4AC82160923D589F214CECA1C074E [email protected]
438,366,763 *2C68A42CA02BD95DE39FADCAA9A9998405F6F639 WUZONGKEN
438,366,764 *2C6937397BB9AC3548A3FCB387A0EC13F4E9D557 taylorbunyea
438,366,765 *2C6FFD2C1E84CCD03D6979B1E073989DFECC6E7E WWWCRUMBSINMYCOUCHCOM
438,366,766 *2C6EF565C8171D26ADEB11D5E0B2D354AFDD534B TC22033
438,366,767 *2C66852371F45E9247B6613C0F7B016A1B0F4480 WWW.INTEKWORLD.COM
438,366,768 *2C6FC891C98E5A03BF0D8BDEAE681E74A875257F WWWLALEONESSAIT
438,366,769 *2C6842816758B6389CC90C713F44E637F3F37493 WWWOHIOLIFEORG
438,366,770 *2C630FB22B630D41014D1A757057EDD63227004B F\MP
438,366,771 *2C60BE0983074589264A697A6138B514E750055B tefriti
438,366,772 *2C6C6E39927748E603B65A80F7A987D6687DF997 fra holbergs tid, op 40 no 2: sarabande
438,366,773 *2C63B0729537C2EC3A168DAC3B585B413BE7C42B TENPATCHI
438,366,774 *2C640B34F7D29DD64D37BCAC8C65952B0980B0CB FRANK.AIGNER
438,366,775 *2C65F069CF02850447EB0E12A1D8927F2640BDAE XHH0
438,366,776 *2C6BB99D6949C17B03B1EE9D6AEF1FD804908C05 FREEMANSUOZZO
438,366,777 *2C666A11262E85CFE9D772B1DFAED7FA828E8DB9 TGIDNEVELREV9
438,366,778 *2C65F2EA8271DFD7B37E35854F572FAF371727D5 TGOHRANSON
438,366,779 *2C6E162DB60019A84F6F399878A6FC0BE984163A frente.popular.dar
438,366,780 *2C65F6A2646083AC6D97EB6D04A42544D6274B10 xpl,
438,366,781 *2C6C40160EDA6B423DCA5C7C51A737A31A39EA8A FRONTCZAK4
438,366,782 *2C6830D39BDFB302BB95D711302EC728CB94A2D7 [email protected]
438,366,783 *2C676AA11930798331D2EFD0234042626EF27DE3 thatflyboy40
438,366,784 *2C61B13E1F6896FBF13C6D55227D5A1D48EBC215 G:}*
438,366,785 *2C6A42A630687189DA5B899EA5AE68FD7D45BD0F THEODORE.STABLEY
438,366,786 *2C6D4BCE5788DA9D0E7DB3E3733276B607D6091A G-AF
438,366,787 *2C696BBE055E725421A5497E51E9B010336D08A7 [email protected]
438,366,788 *2C6F2626530195910C6E07FCBE4F9C6749516C0A GARRYRHAME
438,366,789 *2C6B9EB5FF304D378DA28F558F00CD2F00318930 theprincess56
438,366,790 *2C671A60402655BEB9EEAF0B06C993408FFE54CA thesue33
438,366,791 *2C60136EA9C586D59427348174E8D18CDAED4340 THREAPEDICS
438,366,792 *2C69F016C49CA2243F44878DB5057BD611EB9BEF gel breit ich aus (K Murai / Text: U FlackeK)
438,366,793 *2C6375E8BB0ED3A1C21788E7E695894E00BC5351 GENEKASEY
438,366,794 *2C6F1B4CB44AF0BA7E52F24E35F059A636349E9E GENKALDES9
438,366,795 *2C637CBE8483663E47243828C6AB93971A8FFB3A GEO PAREDES
438,366,796 *2C6E5FF53463156EBABEFE117A79EE043880FB2C [email protected]
438,366,797 *2C62FDFD426B09F0B0A3539852EAF2ADF8849517 YLSUOICSNOCIMESING
438,366,798 *2C6017B9B9DB7D23BDD5A9DA726A57F4545A0CE5 GERMANOHLE
438,366,799 *2C60BCC8798E07171C45E0A1A8C8AB4393AD65A4 GERMAN.SCHWARZE
438,366,800 *2C61122E35EDF7BE49BC18E4274A5056CC57AC01 TIFFANY MCNEESE
438,366,801 *2C6BFA22EC7AEBC7F3C35FC397BDBAF453CCD6CC GIBBERELLIN-INDEPENDENT
438,366,802 *2C68844C153A6709D5D0514B5FB373E1C598DD3A TIRIONS
438,366,803 *2C6A17CA32FD114A93B0FE0D8F11CF3DA5505527 yoshiyuki-nara
438,366,804 *2C61ACC52DDC2020476E09AA3745B6400C245F5E glenpason
438,366,805 *2C67B0001068C8308BC77B3C485B1EE09326145C /`TM9
438,366,806 *2C6CBB5920C005CD8A2C8573CF6896045AAF64DE GLOVERKLINGMAN
438,366,807 *2C65AA90BFD645344A07F9906F5571D658470E27 GMFPLMKR*1
438,366,808 *2C661BB45E7420BF3139425867976FD728D29199 tobysparhawk
438,366,809 *2C633F0EFE1CB264E1A82AF30BB3C77D79E30DCA TODAYJENNIFER5
438,366,810 *2C6DF1524C759AD2B41CB088E934E8F58E97CCBB YSEHTSEATUA5
438,366,811 *2C652D16D8996021CC008168D898E5858144291E YTSLPMRD
438,366,812 *2C6FF90E8BD4DC7D503EB948BABB1CF020BDE151 GoldbergVariationsinGmajor,BWV988:VIIIVariation7
438,366,813 *2C67D4EBFB69FE7CDFC0D152FCCA81F0FA02E7B9 golfovch3
438,366,814 *2C678A3DCEDB0BA19C1A5CE0539B56715209BF94 GOLFS
438,366,815 *2C6EEDDB98DF039844F24BCFFBBF7057CB3FB593 ZADIJEVA7
438,366,816 *2C6291D84D95205D609898523F277F1603984003 greenedg8
438,366,817 *2C6527AAB55E501172D1734416E9E27EC21A34D2 TOUT-DOUCEMENT
438,366,818 *2C6BF69E444547C972D736F7995ACEC247A5DD3D [email protected]
438,366,819 *2C65AA1333BB14B42338564303FD2281CA7A6349 TRACI-DELL
438,366,820 *2C6058505A20160BC39259EECC9EF2512C9F50F4 track7slides184189
438,366,821 *2C6EB116C0A348081C700277E27C9AD9620E360A ZASZX1
438,366,822 *2C6D2110367989C3EAA9D0035EB1E118B5AD8505 handskriftsläget
438,366,823 *2C6A0E99EB004A6914D58E0F7647D4541D7B959A [email protected]
438,366,824 *2C65059948816CE781657A250A7F32A95EB90C21 [email protected]
438,366,825 *2C6E257A2074D9C4FAA585144B18F6D5D8A38901 TRICKSBEARING
438,366,826 *2C668D47B8844BCFFA6A69F9E38217CE58DBD7A0 TRINIDAD.HAARE
438,366,827 *2C622ADAA276F55A0D5109F72B8386BA76D09B08 TRISTANCARBAUGH
438,366,828 *2C6ACE3B0626451B7E03042207BE3DFD8AFF78C8 TROSAAN
438,366,829 *2C61E798ECCF5751CF83431DB548B1D7AD93BBCC harrygosso
438,366,830 *2C65F86F47B39B6181225030F3C374356F166527 [email protected]
438,366,831 *2C6532FBA8DBFDD2EC435A959280C2FD7982E745 tryston-johnson
438,366,832 *2C62E8F07ECB47F284984CFB6B099541C59D6988 [email protected]
438,366,833 *2C6EBFF2BA031E7106BE33DB71E60EA2ECB943E7 TUDENHAM9
438,366,834 *2C621D0B91D00B12C5E300BC3E4E6441DF55FE3D TUJFA449
438,366,835 *2C6C0017CCB3BFC83FDDF1839A1E64A94966F753 TUKASHABAS
438,366,836 *2C6C996BF133E9C4419C6A2864CF10D56A8889BE tumbleweedmile
438,366,837 *2C6766248CAD5616DF77777736067F1E25CADA0C two.months.from.a.year
438,366,838 *2C63D2A29CB445253407A0BDF8391968A2609C26 heribertoquesada
438,366,839 *2C62C1670E033060ABC784AC72C0C56E9873D300 TYSONKIRAL
438,366,840 *2C69C0704F6193078F519F0B2301E098C91E5928 tywyss
438,366,841 *2C600487103D2491900726DAC6BB86B2A4015371 ubiscribe
438,366,842 *2C6EF1AA7740B38F5C3E7F03C20B576B7B1608B4 ИЊA
438,366,843 *2C60D2C0DD0EC3BF12FEC63FFB0C8809D10115B6 КАГУЛ —
438,366,844 *2C6AED5C2826F618E6F97287ECDCB9C291F094ED КРОПИВНИЦКИЕ
438,366,845 *2C61EDAC9C5D0FC67205832E85284430C7F59815 [email protected]
438,366,846 *2C68B6C95245165B0B88D680CDC67819BAF271AB un1ntere$t1n9ly
438,366,847 *2C6FB92B152B0AF7F6B23A358653BE3F93D521B7 ПОВЯЗАЛ
438,366,848 *2C6F0AFB99CBEAF931177D3303913FBA2BA35043 hotspurs
438,366,849 *2C6E2A8A3AB777A522F9932270C0AC64361C055F СІЛБ
438,366,850 *2C6A2A10605C442BC98FF0EF320F914E9A97CD1F старопетровским
438,366,851 *2C612B2C9029827571AB5985DACC270B7DF9E69A href="/sie=utf8&keywords=25a&rh=i%3adigitaltext%2ck%3a25a
438,366,852 *2C67D49460FA6472F577F9A198E037562DB90E16 UNSADISTICALLY
438,366,853 *2C684D6227CF5D4510657C7AC131308B6ABEE057 UNTAGGEDIMAGES-BJ
438,366,854 *2C6F70854622641DE30B72A16BCF293ED09FD4BA H`TG
438,366,855 *2C6FBD4C161160FFD3D49D5DB36339C4EC070261 urgeringen
438,366,856 *2C6A2AD1ABF27D2CC470CDCDD76EFB1CF59AE7C7 USERBABALUOUSERBINGO
438,366,857 *2C684A0F84E4552135BE094FB8A882C85E4B08FD HUMBERTOGAUGLER
438,366,858 *2C6500CEDABF0BD50E6C5C35D00910609A427572 [email protected]
438,366,859 *2C6045B718A2C6F2338B7DA069D2ED446FAF68E4 v394n!5m
438,366,860 *2C6CCC791D2B0B2C0EF641FC87A399FF552FA7B6 i am ina know me and you shall know pain
438,366,861 *2C6B201C4F76A66417244C8120F9945E6A5B18AB VANESSA U NEWHOUSE
438,366,862 *2C61B729D896AFE749D1AB210C0127C7227B2D5D variationavenr
438,366,863 *2C65D16F6635989A87854B143C1FFFE3E6A0BA06 ietsminderalgemeenaanroepbaar
438,366,864 *2C6B2CA6910EF658BE25FD15461E21746F1200FD IEWESSESES
438,366,865 *2C68F8C7AB1BB7CF3DEDFD8D1648F7BACE0E0C39 i.fell.my.savior's.love
438,366,866 *2C6F9EFE2246761506B39AC64F35209536306347 ILOVEYOUMRE
438,366,867 *2C653D65E215220E28B1F9811442002372AD4B6D vd{
438,366,868 *2C6FB383DEEF6806B55BE1324E4AA4E178395F15 Impressions.(disc.2)
438,366,869 *2C610210E6F60C63CFC807D2CA72D54EA45ACCC6 INAIDOF
438,366,870 *2C6FB9A6210FE2548F81918E58E3ABD8CC4795BB INFOSVCSING
438,366,871 *2C6B9D8EAD986E768A016C4B85E6A2BFAEF02A95 INOFFIZELLES
438,366,872 *2C648A16829CB7CDAA5CC995B0F9427E31525430 vickie-renee-jones
438,366,873 *2C60C0538AFFD8DFA92D77EEF8F671769183B09D INTERLUDJU-III
438,366,874 *2C6F2F647FAE13AEB65FD634FD4C2A0DF579CC28 VINCENT DAMAHE
438,366,875 *2C62417C0DA585F5B51584DD9598A5A938EE1748 VO!'
438,366,876 *2C6755D60D25D62D1C4D029062DB19D7FFCF35BF IRWIN.CROMEENS
438,366,877 *2C6CEFBD34056B0E273A08E42E759FD57E1541E5 VOTERATS6
438,366,878 *2C6E3951097E8623AE9C579729CD959CEE216CB1 VYZVEDACU4
438,366,879 *2C6460C44DB640988299BB6BAE475F2F4E12DDA9 israelgwynes
438,366,880 *2C6CC709576FF990216CF8141E41F313DA388117 ISSAC.MARGESON
438,366,881 *2C6A020E2A618A2E014B7208181602F76569BCEC ITALY
438,366,882 *2C689CA607706BA31D9F1D507F6F1FA1EE087E87 w8s
438,366,883 *2C67D7FBF3DF8FE319EFA4AEFF5A2AB1281C63D0 WAITUNTILTHESUNGOESDOWN
438,366,884 *2C63F1CF0194AE390D1D620C592978E850D93C02 JAMALLAUZIER
438,366,885 *2C664F5AF0D462F573AA3E78986887294A0D8F8A WARRENMORTIMER9
438,366,886 *2C655B6E210A0E5CFA6A07373DA7ACEB6153F526 jamesdayton
438,366,887 *2C66D73A501FE5D38DA2207D50A830D36BF7A089 WATSONCOMPUTE
438,366,888 *2C6DE789C23AFF5E6B8605D47592DB95240F140D JAMISONGRAFTON
438,366,889 *2C6570F82C5BC4ECFD527FFDF1FD906A41D100C4 WAZUUUUUUPPPPPPPPPPP
438,366,890 *2C66D9C29F67809ECDF6A7E0C1AEE0CEF9B31C5F jarodtoby
438,366,891 *2C6499EE136F73382745C5E2C80E4181489FF613 weldonhardisty
438,366,892 *2C6031A165A5CB02E797AA0FF553EE8CC6AC0853 JAYLYNN364
438,366,893 *2C6D68917A23890DBFA00E4E231111BD7DD10090 jeromeprevet
438,366,894 *2C673F5A47B0850CDC26525B490354FD890F361E 078autumn
438,366,895 *2C6F3A75699FE7F351D2E9382E18BBB3BB098194 [email protected]
438,366,896 *2C6D4AB965E630D6E6341AFF34453CEAF921D1A5 0THEFLUTE5
438,366,897 *2C66B9029691510E344A184E612691589E8310C6 wilburnhuhman
438,366,898 *2C625B8CAA1F6DBC7327771AD2E11F7ADE657D02 JOE-DISHMAN
438,366,899 *2C6BCA9FEB3CE65FFC4C4F77899153A1089A8F6F 10-KEHITTYMISEN
438,366,900 *2C6318840BCD55154D6B3D19DCC35AE8AA7A7597 WILEY.LOERZEL
438,366,901 *2C6AD0ABCB48BCA1807EB3EBFAEF3FB1DE892810 john-edward-mills
438,366,902 *2C6A70D45F50778A13EF4A67CB58B5D62F0B7357 WILLIAM.BARS
438,366,903 *2C664A96B1BD5F005216A4422293387ABBA201EE 1163915 n
438,366,904 *2C6FD01B0C1800F10AF06168031675DC202133C7 williamkosorog
438,366,905 *2C6282C54BA209F34ADD07C6984F03362E738E8D WILLIAN.DELLIGATTI
438,366,906 *2C663F10D32F8FBDF54F6BBE97A8294477911D6F williepanzer
438,366,907 *2C684C926AE2A2BC08C34D2151A3126CFEDC6357 WILLOWICK0
438,366,908 *2C63CAD69794095DA987032FF86F037D73E232D9 JONATHONDIMMER
438,366,909 *2C6843A0E978AD35F3D9A37337577D39E8356C27 1322024 H
438,366,910 *2C600B383D99AB4D43212AF42883F814C814DC14 WINSON.HE
438,366,911 *2C60E2719D9FB0F6F82A630F96A9A5EEBC45A2EA 1362217 kilpailussamukananelj
438,366,912 *2C6F7EC7ECE605ECB9ADE3767B047D61FB16F716 137274 jokaisella seitsem
438,366,913 *2C639888A6722407E5BE879C3D4A66F200366B7C 1389814 hannover/rom/genf,8oktober
438,366,914 *2C6E474A34C50B413A713DD88C64069489B572C1 josefdaivs
438,366,915 *2C6D0F4BC907C76CEFF0CC9FA798A6008A4E5BE2 josephbenike
438,366,916 *2C662A0E5D30C6C8FE473897E16452E5C14E062D JOSESHROPSHIRE
438,366,917 *2C6880B425ECE0B4E35CC9DEE37250E5B50A1B7A JPK2Y
438,366,918 *2C69B77108179D8010ABAAD9D2EDD3FD845842EA 1653015 N
438,366,919 *2C6AF155260A0259DE0A314DB9E254A19A163689 WORKSMINSKARENAARCH
438,366,920 *2C67BC9B0F54E9007711211F90D1755552388800 WOROBEYE123
438,366,921 *2C6B7E65F6F6E15BCD1B40040A4B6E492D0A9EBD 1760525 ARKIMERKITYSTEN-LIS
438,366,922 *2C6678EC30B40109520363D34F3E758A76B6CA30 june2281
438,366,923 *2C61C3269AB6A6B613386ED76C42D4CA25E5F7BB [email protected]
438,366,924 *2C648DD0901CD63231911B100B31CF17B195E176 WWWAJK
438,366,925 *2C6243718CAD73FCDF1CFD78FDD82D30212CE917 1831034 OHJELMASSA.K
438,366,926 *2C69EE116E7B70229ADB0DE19E9FA20241312B9D wwwrelemergeorg
438,366,927 *2C6FADF719ED3777E029B2E2543FC0C3B4C7239A WYRICK
438,366,928 *2C6951808D67D70A89013F552D56934B4853BD09 1ALLOBONER
438,366,929 *2C6579EAE80A4486A0399AD2E2A1940F30B84257 KALTĖ
438,366,930 *2C6356740B5B5AC9CC0947A6FB1D61F57FA72DAB )x(.`.d----b
438,366,931 *2C67E209A3468577BFE017A3009DEBEADBD998B1 1BOUCLE-LIKE
438,366,932 *2C64F9AD34D7255F2562A2AB7E6E04D78B8063F9 1.bushan
438,366,933 *2C6AAAF61C808FEEFD0EE233915AB11016939F96 [email protected]
438,366,934 *2C684B84DFB1A68C60D49B3ECA7350827A5084CB KASOUMAI
438,366,935 *2C6A0E154C39562438E21E62449FFF76A0D15C86 1climb-downs
438,366,936 *2C6E2CEFD31C847577CC2F7FB594E66926D9E912 1-CORRADO
438,366,937 *2C6CDCA84E8D6771D3366BB763FC4376C224951C KEEP.YOUR.JESUS.OFF.MY.PENIS
438,366,938 *2C671E4914266587C5C46EAA8DD2393D8E518CC5 XSALMON1
438,366,939 *2C6DA508287A910802E419D288962A427E86EBC4 1hein
438,366,940 *2C61A9263C2036626A282DB1D5FB70D2EA3F32C3 1INTESA
438,366,941 *2C6EECD6CF94FF141B4D10EEDA48D7AFE5FCD231 kentonwettlaufer
438,366,942 *2C6539F31B7FD1A304A2D8FA1801A7501E8804E4 YAMAHAHOBBIT8
438,366,943 *2C60CD0D2A1654ADE0982DDDDBEC20D142F69586 KERESLEY4
438,366,944 *2C6F0E8094B4C8881D5242C394FC33A2108A1DAA [email protected]
438,366,945 *2C6BEE83871F06518329E22D30E0F9C7C1AB11FD KIKIFOREVER13
438,366,946 *2C696FCFD3EB5EF0DAF67A5AA9752B9BFAF370D9 KIMBALLUNNORM
438,366,947 *2C6DA26C7F5EC6BDC1CF4F25BE77EAB259114718 YDDADEEDEED
438,366,948 *2C69F8EC6CE91F834936B23970E4EAAB19D1FD75 [email protected]
438,366,949 *2C63BC53F84D19B4D2C08FF942A30167FAA1E68C YET STILL WE HUG THE DEAR DECEIT
438,366,950 *2C63081DE07127DC8E4C04E18E9B36DD06EEFDE7 1luentokonsertti
438,366,951 *2C610B916F32B1C741EF5AE193A0C53991385728 1 magnetresonanztomographie
438,366,952 *2C6A94B19759FD4BF61506753EA8148B26A6FEDE 1MAWDSLEY
438,366,953 *2C651DB5DEC3C3A91997C39683C0C26710A0AB16 klofnem3
438,366,954 *2C63D6AC6DF0BC70D772FABA455D95389ACB6EAD 1-nubers
438,366,955 *2C6A49AEC97AEB62E77010452F3EF296E7D9F719 YOU.MUZAYYIF
438,366,956 *2C65D1A6F7FF08F94FBAA7DEDAFE8E4923CE4055 YOUNG-KHAN
438,366,957 *2C6BCD05949EB7F675A8CA6DEAF8227AE4DE2A15 1-p-nile
438,366,958 *2C67E489BFBAB2EE841D777704DC42B8969BC0A6 YUYUN.FAHKRIZA
438,366,959 *2C6AB62169ABD07F94FD0A360C0323436F80FC9A KRISTOFER.AMAN
438,366,960 *2C6AE8DD1FAA37BE1604AEB14DB3D8067B1C3176 ZACHARY.DANGER.NELSON
438,366,961 *2C686A94055EE3D70B06973FA9F397A78201A50B ZAZASOSO
438,366,962 *2C68F202FB283B860385D8C7D9BC3E8F82B5CE68 zeinalizein
438,366,963 *2C6B6C37BEAD8DC2C052515EE4E49AA0BB8F7953 [email protected]
438,366,964 *2C62F3E59BA1581505C0983053974CEB3F7BC3D4 ZHAO.DUNI
438,366,965 *2C6D669FE03711574C836A4770677F1C379555DC 1.terminaalirakennuken
438,366,966 *2C6DF313583FE582AF861E13BDA6AA5371F7CD1C [email protected]
438,366,967 *2C60B5187E28296977423BF4105A25FE8824B18C [email protected]M
438,366,968 *2C6D9FDF0E40A9D4F64FA40E30F60B4CE7EAEF36 1turva-autotoimintaa
438,366,969 *2C6AF6D593FCE307A2615C4964CC6986ACA61BE2 [email protected]
438,366,970 *2C63417D60090EC634141C9D3B2A30F0E4BF0271 L*3
438,366,971 *2C6A2DBAF79AFE44DC86DC3C3EC4182CFFE81E0E LA JUVENTUD DE LOS NEFELITAS: I. LA CONQUISTA DEL VALLE DE BARRO
438,366,972 *2C6D4DC7AE5CEB92A4637B8BB1A41628C802F8FC zwemkuns
438,366,973 *2C60F37A74F9E18AEC6744EB5CE78F2380262AD4 2349354 tutkimuksessa selvitet
438,366,974 *2C62822EF8ED41EF26E9A62FD8665C4F5F77CEFC LAWERENCEDEMOS
438,366,975 *2C6D814862A50E248FBC602AEE67E0EF7E72786F 2465935 vedonvarmistimen teht
438,366,976 *2C68F08E49B06819169C604A2491667990FE9B36 LAZARO.BAIL
438,366,977 *2C6967C1A75A14B9218A5DFDBAB744B8D394F822 2535968 palava.pinta-ala.pysyy.l
438,366,978 *2C676F0449B1FBD7A72EA568C214B7D4C3EC04B6 [email protected]
438,366,979 *2C64A2918104DED1C7A9FB61036AE5F04B0CDC55 ldrgunny
438,366,980 *2C6F01848221CA354D9D0CCF5FAA066ED9BAA470 lecture12.8baroqueopera,part2
438,366,981 *2C6ED35DF96D2DFC4AC4DB63F94FEC571FCB9B8A 2AIUTEREIS
438,366,982 *2C6F02EC36BEED1C8FB9DA24E40F0A4D0506010D LEMONTSNICKET
438,366,983 *2C652FE1EFBADB0019A605D83BB26C6E985D447A lesleypinilla
438,366,984 *2C6366FD8852C305D1F880A79B73F9742C6FED9B РӨЖИССЕР
438,366,985 *2C66051DC4CC9CF7546408CBB894678440638F15 2-LIFE-ABOUT
438,366,986 *2C69ED6B5DF3CB2A12957908363C4AB5BB6FC646 LEVERS
438,366,987 *2C6CE8711324611F00FAB20F714E34D0BEB350C4 2PAPOUCAT
438,366,988 *2C6303D140E0B36D8DE2895C3F270CD74D7A4836 2PEYNTEN
438,366,989 *2C696BEC508BA8BBD03A6606AA9281CF533DFB46 [email protected]
438,366,990 *2C6D74698B45A6579892FDE527A71A6506DAF9C5 [email protected]
438,366,991 *2C6EC81CA81A11E5D4AAF3CE114D3808A45868A5 2SERRURES
438,366,992 *2C6661B3C3A5EFE1987273FAAD9A366E11013909 ХАДЖИКО
438,366,993 *2C6CB7F1215A5F643DAF892BD413860F6A3C32DB [email protected]
438,366,994 *2C60FB5A53594416AAF888185CD5E41117B11C06 334586 denizlererenkguzelligiverir
438,366,995 *2C6D9D45A452E19BB40D0FEB3A16676E5DBD40F4 364ben
438,366,996 *2C657CD33393E46058AA7750FEFD83E0C18E1D6B 3BERGIES
438,366,997 *2C645AB286AEA9A0900903BC57322DF7FC5DF19F 3B~o.><
438,366,998 *2C6329A675DC209DB5F007589F4ED9F0F2E59AAA 3ENILEKSJ
438,366,999 *2C6BB0AECD6A4D07FA2BCF4F67B73C5DFBFD474E LIONEL.HUSTEAD
438,367,000 *2C6728C6E057C5461FC52721D10189B60003A9D0 [email protected]
438,367,001 *2C6F064F264EAC07673DA79481E112B38A02D038 3MB0L15M5T34U4
438,367,002 *2C6E62B983F7902B7CFFFA85126B0B8CDED8EDAC 3.oecd-bildungsbericht
438,367,003 *2C699D5E0E7CB7B74E6DFFB81E7CF90F84085DBA 3-pilvialueet
438,367,004 *2C630F0FE874DF3EB28AA272DF611D398D235D85 3 SONMUSTU
438,367,005 *2C6AA561D4B24549944A16D1B504F22E23E715AF 40869 ancakbuyasagindayanaklarianayasadahalamevcuttur.
438,367,006 *2C6D568090AB4A11345030C481D4A5AFCD8FD408 LOMBARDYM
438,367,007 *2C6284DE24C88B1DC9178576968E5356255BF7C1 LONGBOARDER (A)
438,367,008 *2C62B0661C7AF3B35694655FBE5D564259058B42 lonnieuhl
438,367,009 *2C62B429FA35974E6F371D0737852C4238CFD22F lophiosto
438,367,010 *2C60DBB4802FE4956CF28BB33B502F230856192F lourdes.sotelo
438,367,011 *2C63F412935FBDE186C5C5AB2B79F3C178CEC160 4iloveq1w2e33
438,367,012 *2C6E98D5FFA569CDEF511AA3ECBBFC4F73B202FF 4KRLIGHEDSFORHOLDET
438,367,013 *2C6F85789ED11B13E49E9CE4B41F9369CEA073B0 4MMALKSUA
438,367,014 *2C69EDAB3CE46A4C069D25A38572E51B50F018D3 LUCIANOLEK
438,367,015 *2C6B46F1BF4A303A032AB6EC83636A9A0EF039D1 LUCIENGAINOUS
438,367,016 *2C6E6E1265CAB7364A9ED9F29698DC84CDECE7A3 LUCIEN.SHIFMAN
438,367,017 *2C65FF8CFB1886CF63DF06AE3E6F2A533E8E500B lückenleerzeichen
438,367,018 *2C623A9C6EF6102C0C17B98CA22EF6E7BB8F65B5 56-SINGAPURER
438,367,019 *2C67A660A69A53D22DB94425CBB7BCB9B79269EB [email protected]
438,367,020 *2C67A7C0FC6910234D6A21D781E77C1B4689A6D4 LYMANJASIK
438,367,021 *2C6D9A368AF3A2D7EC95D73E315BFCE170A73E6A LYMANKLIEVER
438,367,022 *2C619F91A700FFE63FCBA100F620CC3C73847860 lyndonpipia
438,367,023 *2C6256AADF2E571E4E933F47B691B28630D97185 [email protected]
438,367,024 *2C60783D44A242C91551F877D5C3A129F51C868A M:
438,367,025 *2C617F8CC17D5059E796925AB442A725732B9114 MAHĀMĀYA
438,367,026 *2C633136BD1DFFC592E2E38EA3B4B86BBF5EB4D9 5montag-ausgabe
438,367,027 *2C6368027113DFB0C8038DC1B41D299F313E5071 MANAZERI0
438,367,028 *2C672D756557198567BA8F4D3C195923CCF84543 MANDIRI5
438,367,029 *2C6DB3056D6C30D1565A2486B600B633B0F6AADC 而頻道資訊模板原本availability的地方,也把目錄吃掉了
438,367,030 *2C663E88577776D98BE0EC8190BAEB475647C2A8 を見る限りではそれ以前に項目が立てられた形跡も削除された形跡がないにも関わらずipユーザーによって
438,367,031 *2C6D76A8287ED131C80F346AF51B6C8A4B588CB4 5UITGAANDE
438,367,032 *2C6E801343A8D0E173849B6844985AA775BF16E9 MARKPENISTON
438,367,033 *2C695E7AC2BB9AA0F20B6C52EC10FE3F9308D7CE MARKUS.LEZCANO
438,367,034 *2C6FE9E24995DB3D5FC39AD44D526C64E695E57E MARLCEL
438,367,035 *2C66990197E96759D1758FEFCC0220895E9CD834 MARLINDAYS
438,367,036 *2C640A4EBA57B038CFC5E798D6B0F34BA37B9F67 MARLIN.SANTONE
438,367,037 *2C638F50EC8E8AB42D972795A6E12C8EF12EF92E )0(0~d----q
438,367,038 *2C66AFEDBDE0234778EBB5710308845FDD7D266B marvinjabay
438,367,039 *2C63E9B43EDBAC641714AF9831322BCCF4DE9ACB MASCHINENKARABIN
438,367,040 *2C69B3A1CBF198B6B2A3B1FE989FA6728B9217F1 69564FBE-ADDF-3B23-935F-942E0BA4BE43
438,367,041 *2C6B1B86E0823A2F71BCD85BD159C3B0373EFEC6 matthewwalczyk
438,367,042 *2C6BEDF08FA1E9A53D4D8153AEE4CA7BD9E673C0 6CHUCKYREZNOR
438,367,043 *2C614B40B0F5E48EEFA6172A2CB685C57A4E15B1 mauromilham
438,367,044 *2C6587D8115877B6586A706B62B967FE9EE54CA8 maximobecht
438,367,045 *2C677E179D6730A698B5DCE79D52783F101DD981 6DESMEMBRE
438,367,046 *2C67F7C5EA32108727CF2379E08D7C06E1CACBC5 0thekeller2
438,367,047 *2C62E534052A7B795D44F039924A7D562E21E25E MBOOGER5
438,367,048 *2C6E9A150016C2FB4DE3CBD6DA07FD42C35FF85B 6LINKEDE
438,367,049 *2C67841D84B9CF01F49C775AE2ED017E5B638856 6MAGICGOOBER
438,367,050 *2C6860E6635EC28E303B644211ECF949AD3D95D4 11stener
438,367,051 *2C6469E5B3F400A1BD3D060C2948AC751F909F77 6spirillotropic
438,367,052 *2C67B8EFF433BF4BB29444F3047529F2563136C6 6THUMPERGRACE
438,367,053 *2C610D23CE3E590C1D461A2DC6683597EC3B7FC3 6VAILLAND
438,367,054 *2C6A957DB8A8791828F1579DFB36D009B7712283 MILFORDJAMAR
438,367,055 *2C629074009B5AF52E0C2DC38CB3FF46C82DDE77 703508 KAIKKI.MUUTTUU.KOKO.AJAN..
438,367,056 *2C65B0F4F216A86252F44C05C76E84D92A230182 703690 arkas 2002 yIlI baSarIsInI roro ile pekiStirdi .
438,367,057 *2C6BEC15F658675A825894FAD550AC38887116B6 MIOMEHMET,FORSEILDESTINOM'IMPEDIR
438,367,058 *2C6C72A8617248427BA86A8BF8B8780628DC0280 miquelscorca
438,367,059 *2C69BB13DECCA736890E69535F3470291044B304 1907059 sellaiset oireet kuin silmien ja nen
438,367,060 *2C676320C9EBD6E8D7BD26DD1A01B3413E43D304 7AIRFOILSES
438,367,061 *2C6FF44E044398E5299DAE7916FF5EB38C1485BD 7BUBBLESCANCER
438,367,062 *2C67085163DE54A83FFE07BDB59ED5E71AED49C2 [email protected]
438,367,063 *2C64B5B3621C8A49A7429A50BAC131D2C0CB92E6 [email protected]
438,367,064 *2C64855F9DBD029D8167B48FA5AA19C414727A2D mnbvcxz772
438,367,065 *2C6F4C5BA73B70BA7F30D7C9223D54106290D70D MODESTO.BUSSARD
438,367,066 *2C6B29F1D6318F1CFA0ADCF6D4A242D2FFDEBCC4 MODISCHSTER
438,367,067 *2C6537B393499C01C8A7CDBA2B01414593E965BB MOHAMMED.TOMASH
438,367,068 *2C68AC604F17DDCBE88BCD903BA04919B2692664 mohilowskiego
438,367,069 *2C61B133640CD4140374CB8143D339352C10C32E 7iluvclipper7
438,367,070 *2C6D52D6D74082A6B9F344E3EA622F4885AD8A73 1chibi1
438,367,071 *2C63E46F4DFA197BFA28AA18B9EC748541169EB5 1.COUNTY-BORN
438,367,072 *2C69AB8D40A8E6E9AD84BD35DE3138AF269B936E MONTMIRALAIS
438,367,073 *2C6618EA0DF0FD3C2DCC37BFFACEB948DB7D47CF 7MARENGRAU
438,367,074 *2C6F625C549F5338426EC01C23A49A661FAD9CFC 1DUGUNCULERI
438,367,075 *2C63627D728ECD88221DFF7B9C23FC40FF646BE3 1.ESTATE-VALUE
438,367,076 *2C6D551141F5CCD77F70B8DB8EAC18E1017A7D4D 1-euro-notenbank
438,367,077 *2C64337D5C52F949EB3FDA9C39FF3F05C05DF368 1gerceklesmiyor
438,367,078 *2C665A1D91B3F7901A941E2BFB5FD80EF72B4880 1hein
438,367,079 *2C62785A592A84791EB2C0B6638D1A83320AC1C6 7PARABOLICREFLECTOR
438,367,080 *2C656ABB819802207642BA1CA1B7619CE067FBCF 1 IMMERKEHRENDE
438,367,081 *2C6D98BAC4C238EF87AE01077C724788FB507ED3 MR203
438,367,082 *2C6F5192FE76FB9C946BC2FE91400E808A75D10C 1kivisillat
438,367,083 *2C689A4333F402C7B92F9FA90514ED9774F58880 7SIERRAAARON
438,367,084 *2C6CE71D4531D2DEF2F40E318209EF6C027DF5A6 mrMitchell
438,367,085 *2C6EC8BE11FC0FEF8959C26F6C88D47FDDA96FEB 7-zdravko
438,367,086 *2C6C292AB4F819B37F41388DA1668D6EC4C2AD0F MULESHOE9
438,367,087 *2C691EC65E8A22225C2E99CFE20FCFE6D0EA8E44 mumokouh
438,367,088 *2C63D74F2BC08AB8FA8DEE578FEA28ACE7870930 8APOSTADAS
438,367,089 *2C6500E9625069331BFC28CB95ACE960F28AFE8D 1-palmikoidun
438,367,090 *2C669B8F2F842C2615B43C47DD45B9D74E276FBA 8DOGGYTESTTEST
438,367,091 *2C64BD26D345883A72C0D2AA56706697276B0F54 8######D ~ SPLAT!!
438,367,092 *2C63FEDD46BF84E31054DD03D04A577CE2221395 mydatabase1993
438,367,093 *2C6E3F4C1FDC79DF0968E00192DE639C75B87B7A 1UTH3R4NS
438,367,094 *2C6609964DC4CC1C49B21D865F1FE14E8B2C5EBD N94427
438,367,095 *2C6F3AA186FF10D7388B486D385BF933BE7AF1BC n;{aaa
438,367,096 *2C64ECB6CB38E8E536B92EAE7A5425331AB7D3B0 8#p~o~osplat!
438,367,097 *2C60B31734306445F7CDAFCF80226ACB429D5118 2009年4月29日発売(team
438,367,098 *2C6B825953185C3750D0F93926CB509A28701815 8trundle
438,367,099 *2C6844647BD55DD5EFE71F5E454A9F8DB66BC4B0 n''clorosuccinimide
438,367,100 *2C67FE6EE9959C500280655020186EFE9864A613 24.11.1758
438,367,101 *2C6C242FE95CC91584043C5AE119DA0B3A243921 933857 later,inlondon,itwasquotedat142.05yen.
438,367,102 *2C6AED31E1DA8AF180084C0CD740647262DD1A73 944RUSSELL
438,367,103 *2C69FA4672F033A6CE20E86FE1DE090D8C6196AF 2843686 ARVIOINNIN PAINOPISTEET JA ARVIOINTITAVAT VOIDAAN M
438,367,104 *2C6683F35D2F538408CF307E783ABAF926C1DF43 [email protected]
438,367,105 *2C6BB559CBB0A4F5F609EFC181D834095542CA9B NHUGHES1
438,367,106 *2C690B439804C546CDD9A096A662736FC44E4890 2961967 luonnos-arviointikertomukseksi-jaetaan-viimeist
438,367,107 *2C6ABD307CB6A9CD2B1F0AAD45961CFBB5ED307D 9CAUYWOBSW
438,367,108 *2C6E6E0189AF0D6F6BE13732E484D9DF94FE9651 NICKOLAS.SPAKES
438,367,109 *2C6D3194E633569B1BD466930C13C67D23C0DFDC 9EKILLOOF
438,367,110 *2C6F4EE8D6F58187555AB204C7DB458CEC16D405 NIKKIBRA
438,367,111 *2C6B31511BE83C58455C5415332649008AB536E6 2ETATTIGA
438,367,112 *2C69A8A28F01816FC85B4AD1E7C1FFF37A4CDE3E NIYAS-EA
438,367,113 *2C658A01B5C4F075F814BFA983359971C2F99947 2gengoux
438,367,114 *2C6D2C41C6D01DAF219FF746662D9265F30DD4A5 non-cerco-abitudini
438,367,115 *2C69E90FC7CB212D480805274659890C252EF390 2 stanleycupsieg
438,367,116 *2C627FE4343A3F8DC682BA35474A83F290A3300A 2theasterix9
438,367,117 *2C6D2ADAC44D5332D771F05A92B59D03254C573B 381433 gripaSIsIyaptIrmamasIgerekengrupvarmI?
438,367,118 *2C6FD69587E2D494FB3B8F77EFAEADE7CB2CD6C6 393789 VUODEN 2002 ALUSTA K
438,367,119 *2C6FAA8C4DD2F3CFAF9919449F85312BDA5316F9 NOWMOREDEVELOPED
438,367,120 *2C68BC12870AA411E9E1B02D30D8C78E9AA2B519 a2l9
438,367,121 *2C608C44884FA3622AA7FF195B5ECB19FACA02E9 3GRELLARE
438,367,122 *2C69970253208AE68EEDE5CCB793C34D940981E5 OEVERINS
438,367,123 *2C6749009E6E499E922420A2D055E1CDC9B2DE29 a6
438,367,124 *2C614E17DA2E1AB96A15B60E81A9436E83B72E47 3-pelikelpoinen
438,367,125 *2C6C9A3441DCE94B897573BCB85AE907F591CBAF a6jdi
438,367,126 *2C6D852DF38BD2268A701AD35E2DB877B57B9F64 OMER.WARTCHOW
438,367,127 *2C60811D3A18C2CEE3B839467C94AF4DA80074A3 a/74b
438,367,128 *2C6AF4F887450B971BC0120200932B19B8ABF113 a7m/a
438,367,129 *2C6E1036E2CA94833AE7AE389ACFB08AC81A5E41 448BECKHAM
438,367,130 *2C6A3B21A8B2FE4846511959A6F3E48E656A6286 aabzoy
438,367,131 *2C6204C34E7931CA11D20E0DF352C397AAD1C5AE aadpas
438,367,132 *2C63A2C2241E57F57CB52A16E2059132FA3890DC 4RENOWEBD
438,367,133 *2C6965D7BFB04CB1F3B182DADE47CF8488AA5E40 4SCHARBOR
438,367,134 *2C633D0282C20C819AF93D0295A2F14E0039AEA1 4SCIENCEWOLVES
438,367,135 *2C611590ABE336400DD866935E4A84C57736E1A3 osmandarwich
438,367,136 *2C6AB080386D2B2152DA1F900CE0E1FBD22ACE90 [email protected]
438,367,137 *2C6E15F01A32C32316CCED217124655422E69AB8 511bdf8661e93cc49b5bc74853208abb
438,367,138 *2C62F259C97855A9F06AFEECBD27997EFEAAA440 515706 LENNOKKI.TAI.SIIMA.T
438,367,139 *2C6FB74866CCB2887FA12C24B53F476297C2D26E [email protected]@bl7y
438,367,140 *2C667D3B1FAEA5CF9091161F054807792AEFCD00 >-<~`.~`[email protected]####P
438,367,141 *2C67936E7DF61FF28B0E655008827BF41885FAFE P------)~`(-_0)
438,367,142 *2C6C63088AB3E28463951AB2B1E00B653A5CAF49 P35C005
438,367,143 *2C6BBB34B26CA2697D8714E5C7A280DEEA893C53 5BARULHENTO
438,367,144 *2C63BA09B86CBAD635B6CA5427BFE3B3B807641C ABDUL.RATAJCZAK
438,367,145 *2C661B87B24E315D112D8D5F36DAB56A58983CCE ABNQ
438,367,146 *2C66E9595F3CA3B1826D4E34E387A31228F7BE85 5pistoia
438,367,147 *2C6C38A783F68B5E9C8D3F31623946FAFA9959F8 [email protected]
438,367,148 *2C60F2DBD34F6C0CDAD5CC71A3859E697A8B9E81 parkerschwab
438,367,149 *2C6DDA5609564FC3F61F670B9E275FC2E1250F62 5T5YAKT6
438,367,150 *2C6796DEC01F516DCFB85B5B0522328F18A3738B 5thetraining8
438,367,151 *2C60CA14CF775D3C8F0D1920BF3BC6C08A5C24F4 617781 CDROM MUODOSSA ILMESTYVI
438,367,152 *2C698240F70BE82F2817712851A536C7C7ED78B7 621824 hakemus sis
438,367,153 *2C60F93AC9B1D8CFD6B4A02B9838BF883A26BDEB PAULDRATCH
438,367,154 *2C6D3F44F249CFA5FACDF4EFD07523C4BF2ED66B PAUL-WAT
438,367,155 *2C6E0BFA9504025B5FD04F8711575850CC3DB6C6 pawordbab
438,367,156 *2C6069B88B37E4162C19BBBBA3AC47CC8D2C032F P======D*-*-*-(O_-)
438,367,157 *2C623DDA33914A8C574BA28CA620E35B0B19F8BB PERRYTOBY
438,367,158 *2C63EFA73732B90D535532D5398350B5E9B6107A afhouwing4
438,367,159 *2C651DCC45662C4700C83BDDC75DF0E2F742846D PH95I0106I57
438,367,160 *2C6DEDEC6A08217FB9B704C2A515195BBD593489 PHILIPPINEINDEXCOMPHILIPPINEINDEX
438,367,161 *2C63590679F67A8E308386FDC793A9A9930C17A4 PIANOCONCERTONO.2INEFLATMAJOR:I.ALLEGRONONTROPPO
438,367,162 *2C6949816A2319EB77E72B9D81B7FDE7206BD5A7 6NOVOVERTICILLIUS
438,367,163 *2C6C488CB3C8696D48BB120375E43076370867C4 6OIGROIG
438,367,164 *2C6A64870C03D9A7A1FEB8D0DE76B3D1FC3C6827 AGoingUnder
438,367,165 *2C67FA1AF618196590A9F8092C8BDEE3A24EB9B6 6TADSJIKISK
438,367,166 *2C62993F705ADBB6C6213748E518FBA6B61184FB 6TEKSTVERBETERINGENS
438,367,167 *2C6EF0C624CEA1BBFA7981A9CA2D6C22DF600B06 <a href="http://wwwenchulatupaginacom/comentariosenespanol/nombres/susan66862html"><img src="http://recursosfotocajoncom/enchulatupagina/img003/ULJkIMRRT94fgif" border=0 title="Imagenes para hi5
438,367,168 *2C679A12A30DBB28DDA99A1612837E5615E47CAB AHWR%
438,367,169 *2C619C98B8A5A0EB0CFD1A5374859200935FEEDD 7BSWSUCESIVO
438,367,170 *2C6273ABADE6456E5BE0AAA07CD7A4F922856A13 7BSWUNCHANAGEDBSW
438,367,171 *2C666AA20D57282C3942BBBC11C9C705119ECD0F 7camera5
438,367,172 *2C685F336911B644D48C28D2B7D5A6399B80E40E aled jones, benjamin luxon & westminster cathedral choir
438,367,173 *2C674C90556A39E910553DBD9E19C4227830F5BC ALEJANDROSANDELL
438,367,174 *2C6ADB81E3BC67DC284923C8C1723D1520FFBDC4 alejandrosturgis
438,367,175 *2C658C38B28C3F97EFF3D04B089189CF42A737E1 7E54A8FAE29037E0811CBF50719E2CC5
438,367,176 *2C60D7C4FE5C38D7C46141E7CF2D8C8C5C5F8F5C ALEX-GRUBB
438,367,177 *2C63C2DCC7A9D8B231A997A475B352B0A73CABCB alexseven0
438,367,178 *2C6B081912F1AD31AF2D25B71FD210139958B10D PRINCESSANEYZ
438,367,179 *2C61CCF45DB67F949353404B60F7A4E3F27A4D1D PROECONO0
438,367,180 *2C6A0D873E8417E09093A621BC90C28933A037F5 7KONTAKTSUCHEN
438,367,181 *2C6DF91F9122450BD92459625CD87843040DDC10 ALJALWY
438,367,182 *2C6992301C5A5875F2BC193ABBBE1B68624439E9 7myhamlet3
438,367,183 *2C6EA84FED0C38E0B547BF1A7BC52E1CFEA02F21 7O7N
438,367,184 *2C6E0D891E941CCA32542D8AF4D0246A492DB3E5 PTTC
438,367,185 *2C6C88BC01DB9C2761FB78A0AB2FD335A29447B6 ALONSOSEVERTSON
438,367,186 *2C6851892117DC481C6973CF6B2DD2F8E38B7237 ALSTEENIANA
438,367,187 *2C61AC680032D5BE44636EE08F0A11B23F7FE9DB 7THEROCKIE8
438,367,188 *2C67742D834B55BDA05D3FED3A76736462F791F3 ALVARO.BERNARDEZ
438,367,189 *2C6456DC29A295F4473172060D03DEED6B67FB74 819202fg
438,367,190 *2C60C516B2759547970444B979FF45B43808B70E AMADO.FALCI
438,367,191 *2C681ACF875B0074EA4908004F86C3062F6C31B7 Amanda.Overmyer
438,367,192 *2C63F4ADF88BB0D7C9D34C01B5B1B15064A492D9 8#)-*-3b<-
438,367,193 *2C65BD55606BD6C1C1C3DC3E43F77F2368E1A91A ambroseerdahl
438,367,194 *2C6865A20051FBB084036FD9DC8274D7D88856B2 871400 ohjaajat.kokevat.tarpeelliseksi.sen.,.ett
438,367,195 *2C6960EF2AF084BCB0563B22DA0DC7C10B076102 qjur
438,367,196 *2C601FA14B04DE41D325F741B3D6A60D8F417C76 am%iz
438,367,197 *2C69802B985B2BF287F09B045F77F8C8C84945CA QUIT)
438,367,198 *2C69B2D15E7C0C7F4A25C48C38B1E1C4858D6021 8###d.*.splat
438,367,199 *2C6E50F954EA1DBD08BA5E3A09DFF12264143D10 [email protected]
438,367,200 *2C61B27D65A6672550D8EC466B6CADB3D81501F8 8FELDSPATHIQUES
438,367,201 *2C61A2713700E0DF76A1DFAE3E6E8F98AE0243B1 rå61
438,367,202 *2C6F870D01823EBCD66A511715E105EF71B60385 8HAMAXOBIOI
438,367,203 *2C661AED63187A5F51AB8077BE98A430663753C1 [email protected]
438,367,204 *2C6B6D0452FF767F0935F98E2B243A5431714C9D A(NG&
438,367,205 *2C66B9F2D8AD891386A5CF70835BC7804FE40801 ANGUINER5
438,367,206 *2C6DD08CBC0DB4F22CD04A275FAE34A944459AE9 an+icyc10nes
438,367,207 *2C60A4767A2E05B175A1E427FCC63850AF1CA1DB ANNIHILATIONIST9
438,367,208 *2C6105FB0EA43ACF22C4D464DBA75C7B656B104D randellessaff
438,367,209 *2C60BCA9D70D4300A9EADD4E3497D53A16C04EC5 8O8O1INK5
438,367,210 *2C6E1F6C6D3E0053269A117B9D48019CD491250A anton.bystedt
438,367,211 *2C66596BB5F68EF34D0E23A7BEBD9B11BBF51138 rastros-de-ti
438,367,212 *2C6E65E49C913B9BC6536B5D50643273736B221C RAULPAGO
438,367,213 *2C67DC7D1C9C5D59549F71FDCED7B78DC616CA4B 8REGASIVN
438,367,214 *2C650043143061D87A1D49DD2EB5C2FA373B95DA 8RICKEYS
438,367,215 *2C6D4839E4C8A3302DA79412767BF555055287F4 8-shark
438,367,216 *2C61E09D731A6A5AAB85E447859DB25444A43806 a(!%o
438,367,217 *2C6E4CCC3768E001B87C3D1898E1007288FFD891 aokiuva
438,367,218 *2C62BFA4169D748A999B049DAA0C272D31E54544 8VATIKANKONSIL
438,367,219 *2C6934B94C5103015A29A6E9B15EE15A64AD3705 8VLIEGENE
438,367,220 *2C624F9BEC7F9C58C5B53370AC7C481F2617ED1D refactoring0
438,367,221 *2C6B9204AF34133249BBDFA7F65FF5AD1BC46722 architektenvereinen
438,367,222 *2C6CA0470D225A37E110F69DFF18F48BC5709FF0 resonaste
438,367,223 *2C6A260F642F5D0DF0B629F4F3C7355340655128 9EREGIGUZ
438,367,224 *2C60AA7E1063CA180493E2D96DA4F325A416E65C ARTPAK
438,367,225 *2C6AC10836C8FF3F790021594F8995529D90AAA8 richardkasparek
438,367,226 *2C6225686B4F336AC7C8FEB8818A0BAEE3E2D762 9PMSEOHNBVEDBN
438,367,227 *2C694F6C6ABFAE889639371E0F14EAA3C8645601 ricomaylone
438,367,228 *2C66D13D6E86B24F3D13FC03F083E9670B8789A3 RIKEN.MEHTA
438,367,229 *2C62D311C0A96CAE9D48C72285A80AD98B3C1D26 RILEY.GREAUX
438,367,230 *2C6C6A571FB69E99B9779075394E219BD1058A38 RIPASVARE
438,367,231 *2C60B3EA3F8B3F28AAC11D1B7CB93A90FC3C51FB [email protected]
438,367,232 *2C6A40DEEB6F0EFEFAF9DF04DD96A1D1497DAC82 asy)k
438,367,233 *2C6D27A893970EF9D986A3D094C3A62E2462308B ATHAVALINKHAM
438,367,234 *2C6A11BC1E5747ACCF934A7A475FE13D8AE52583 roccofeuerberg
438,367,235 *2C64C4DD5195BF0C39F8A8F7F8533EFF4BCEBCE5 a2l9
438,367,236 *2C64474805ADAFB26D393BC14D5EA4BD352AAA51 aaayu{
438,367,237 *2C64C9E7286B54D789BC4D52440F046F224B22F2 AADXE
438,367,238 *2C612114A3AEFC18755E08E04FACE5A5A5E03453 AYQ&B
438,367,239 *2C69F88F0CFECA37EDD4683AC5D70975F8580DE5 RUBIN.MARTINOLLI
438,367,240 *2C6582A86B2B0C0330535B7188FAE3F85AD570F3 AZATJ
438,367,241 *2C6E49F5ACE4674A4A37F9EB7A46671BFCFA1617 RUGBY-RACING-METRO
438,367,242 *2C606DD6F056368A292E4F89890742109494C94F RURUBHIH8
438,367,243 *2C6E54BD4E80E1F7FF6A25B7E749B75E7207C3BB ABDULLAH ABDULKAREEM
438,367,244 *2C62E11B819C0CE251D524D2D25CD2BA25B9EDA8 ABGEBRAUSTER1
438,367,245 *2C60DE99A623326585D447B6563F8E360D5647FA [email protected]
438,367,246 *2C6ED683306B10CD7109ABE0F7AD50D2E249229A b0(wl
438,367,247 *2C6BFC2C7220180CEC4CFE3B89DE1FB4AE6B365F SAINT-VICTOR-DE-CESSIEU
438,367,248 *2C632ACCED296255CDDE9D3DA85C68AC9855ADE7 sam-&-max-theme
438,367,249 *2C61C55B81BE3F9426E12DA221F04CD8FD1BD961 SAMPLERCARDINAL
438,367,250 *2C6BF0CD71DAEF0C4C0ED010060C1E0A30931704 SAMUEL.RATIGAN
438,367,251 *2C669DE94E5C4373297501DB23B11ACD4752EC2C sandra-mahaffey
438,367,252 *2C69E9ACC11621D9F797E76B6939A1083BF0A4A6 SANDWATTEN
438,367,253 *2C671AF34421908418FBED2D1A12B2DF7F0F39AE AbUI
438,367,254 *2C6C03445DECD674D6436D84BE8A9B5F0B0587C3 SANTOSBONATO
438,367,255 *2C6AE831C5DD42BE4284E272906D9138669B47C0 SARAHFEATHER
438,367,256 *2C619147EF065152B1A832E9E9E52C66F6D9A2E5 BABE85
438,367,257 *2C6DBE27835399ECFABF6E371027C189FC811E34 BAILY0000
438,367,258 *2C66A07F090343E59591521A2A95671CDF00421D BAKEREN2
438,367,259 *2C6F52F962F84E537BCCAE309C77697B83AFAB57 SCAPULOPPING
438,367,260 *2C62D1DF2A7BF127122B296282594BFB173DAD15 ADEOYE-KAZEEM
438,367,261 *2C637616131FF44AEFFF381B883DEE1C7521E2D3 SCITOKNOW
438,367,262 *2C6079B0D6A88C5BFAE73A638D536DA617193AF4 scrissi
438,367,263 *2C6DD782C8E9959A6D5EFC7C381A2160E1350ED4 BARTON.BILBY
438,367,264 *2C678CD670960F1F5AA14CAA79747BB0F873684A BARTON.BRIAGAS
438,367,265 *2C6C811B4693B0AFC90540EC0BF4C3AEDF346B0C adminpass
438,367,266 *2C67401D5B18AFF22A4BDCD0D500FEE75D9E6571 seancleland
438,367,267 *2C611EC89B0C8EA40EAD7D63DF9F019062920E07 bb-w
438,367,268 *2C64D88B207160CE19336440D833D52F4D719B79 [email protected]
438,367,269 *2C61BD3BE02400A883C6725E1A32A891735A5912 B(DQS
438,367,270 *2C64B83133F1CF79A852167BCFB3B77B087107E7 BETONIES
438,367,271 *2C694909F50A350E244ACD67EFA9379D08CE9432 BE+WB
438,367,272 *2C692A4C4E409B55B959BF60033397B287600EDB AGUSTIN.KARLS
438,367,273 *2C6A7533126DE531A4EEE3C1FA51C2F4C7C651FD ah1;d
438,367,274 *2C624EA9D300FA6EE9F00AA4DACA8C812B502344 AHMED.ATALLAH
438,367,275 *2C62EFFC70667B4BFA63DB7192098BB108CC44A1 SHAWN.NUHFER
438,367,276 *2C65467EBD247293A96A59C14203B0FC732D3CC3 bilious
438,367,277 *2C698B82CD8D2D2CF019ADC3B059FE35E3FB5AFE AIWC(
438,367,278 *2C69554DC0A06F95C4D8D69334768B18EDE25DA4 BISAN1
438,367,279 *2C680567D725AF9CB1A3877284DEA1D4A3ACAF34 bl4"
438,367,280 *2C678A9D6F4E297B760A7326419E94BEC3F9E733 BLAKE GRILLS
438,367,281 *2C6C7D17A5C257BD96E5115159DE01E8C3348F14 ALDRICHMEES
438,367,282 *2C6206381A5D45EDC2710EE5956E8ADF10BC31A7 ale)b
438,367,283 *2C6201B2DBF7516161D3508A14F81269FCBAA815 ALFRED.LOUGHBOROUGH
438,367,284 *2C6C8BCEB7A4EDCC9CDB42A1BAFBF6CECCE6ECC8 ALFREDOAMENTLER
438,367,285 *2C62108AE5EC6F70373F82D253648B77252F06E4 alfredo.paulino
438,367,286 *2C65B9A669CE6F2366201ECBC9F298205E5F1A91 Bm-S
438,367,287 *2C648EBC10C584E9CCF6036B743BBAB4992061A7 bogd5
438,367,288 *2C62D60DD9401B93B1551A5E28E7A2D7E8B2C666 ALONSO-PALACIOS
438,367,289 *2C66C3F54C3AFBD93F41CA5EDBBC8FC06A7CC1FE ALONZO.GARVERICK
438,367,290 *2C6F4C4E3CC3871611660B74FE1F702B8B3BDFF7 ALTAR.OF.REPOSE
438,367,291 *2C6702B058BBA38D580E7CC5C039AA1B4774260C [email protected]
438,367,292 *2C629BD23CBC1CB9C690D5B0C1715497BC9DDAC0 [email protected]
438,367,293 *2C6863A697C7CCE93A22CE622468CCFF78F97729 ALVINIA
438,367,294 *2C6FBBFCF457F6B298440D28C7AF84553E53A4DE alzj
438,367,295 *2C61D645EE031E26DC45691CD7D2C965EA8D43CC [email protected]
438,367,296 *2C688D722798DA63CF88565A73995722268AC01B Sodorisants
438,367,297 *2C61FD29ECF1CD75A50D19251C496E47DE701F85 BPHRB
438,367,298 *2C64F730F380C197D525F38868FF4F7D1A521568 AN0PH
438,367,299 *2C61D09B9BF0303420196E46D7C3E5B064B38E89 bradzrake
438,367,300 *2C6622F8C877114B0E0F3989BE874EA17476E8A3 SPEX
438,367,301 *2C604BFFA74C2DDC859880F901DDE2A2B82620A0 BRANDON.VEAZIE
438,367,302 *2C6C0CCA0365A9D991210C8E63AF66F3AC338DCB „braszka”
438,367,303 *2C6F3EF9A4B898446796EA80587F1935EAC64D28 SPLAT!*.*.*<######8
438,367,304 *2C6BD075602883BC32D4A1BDBBD10D551F66DC68 splat!! o~ 0~ dp
438,367,305 *2C67284433D0568594DAE62C162841BBAAF6DC36 [email protected]#p
438,367,306 *2C6C327599D18563D57096DEED5EE88821B0B671 ANN-(ALTERNATIVE-TAKE)
438,367,307 *2C6420E8A99B2B97A71549D7B5737747489C5F2A brlx?
438,367,308 *2C6CDAD9B09C21984B548C37CEDACB43A24AD421 BRSUX\\3
438,367,309 *2C6530E2BE4194499EFFD2E101571FAE2173A989 BSOT3
438,367,310 *2C61CD33B91527C493A0D945795CF3D7E093217B BT+PU
438,367,311 *2C6C9243697A309AA710F3F6AC5DB57D163499B1 [email protected]
438,367,312 *2C6023D6C9BBC1000F2F36142027FB1DF4CEACA0 [email protected]
438,367,313 *2C67B76DBA30D2E1623233CA0B9EE002469A6CD4 bu,l-
438,367,314 *2C6228493FE2C6819F99A6C302D0C867CB3012AC STOC2004
438,367,315 *2C65F282A76ECBBADFAFB5E8F90B3083C175420F BURJESTI
438,367,316 *2C69A1D3C186C9DB93C2ED2AE05D02D339286613 burning-indica
438,367,317 *2C68FA06E3557A3FC136DAE78F84320183D14BA0 BV24P
438,367,318 *2C6CE6436805EF002FAC628E91045806376EF634 C0N57R4!N3R5
438,367,319 *2C63302AA43C8CC5023A20E95340A1C5F7C5575E arschtrittinsgesicht
438,367,320 *2C6D6D52527F00C015F25FFD750C7B6F197A8EEB C.19471949
438,367,321 *2C6684D4BA31CDC2BC36154C91D40A8836285EDE C28Q-
438,367,322 *2C62BFAE2569B228A70785E4E4570C35E67E48A2 C3K.L
438,367,323 *2C6391E58E8AC69255571FBD76698233EC814177 [email protected]
438,367,324 *2C614CEA9C86BD2E6DFCAF8BE962E9D8C24E0A4B c4htk
438,367,325 *2C62ADD5B4DAB7AA2CB2D95DA8F13822E9DC4C6B c6c0b
438,367,326 *2C6E0F5E2EA5F6F71B6E2479BB8EEACFEB118C72 C.aaa
438,367,327 *2C615944D246A7E26779187A69BAD0180239B91D tafatts5
438,367,328 *2C6F412B0F95B0E6E5D366E3A9D53583146E4FA9 CAGRA
438,367,329 *2C6A603CCD7D4DDC8BB19C35318E8DC0E0C2007B [email protected]
438,367,330 *2C62826FEFFA3D11AFCC5F9528574E67F7E3BE2D [email protected]
438,367,331 *2C69AFA97DECA21ED34EFFABF71AAE050E1B9AAC TARDOMEDIOEVALE
438,367,332 *2C658BF64F4919DEBE8AD4983FF4F9C99240529E [email protected]
438,367,333 *2C66EFADD6B079737C72D3B341E0C83251737BC0 CANTATABWV131:DUETSOPRANOANDBASS
438,367,334 *2C6CCA1681FD6065D186CAD6A1C020EC275FACA8 TASÍN
438,367,335 *2C63F9DA84D4B3A205AC357042AE63F1CF10FF1A TAYLOR.WENGER
438,367,336 *2C64025DF006C2418EB17425DE6488E5F5AD8CFC CARMELO.CHOY
438,367,337 *2C6F76EE9BF76E45B6FFF731466262B71E0C8290 averymcredmond
438,367,338 *2C64FBF3B65EA8CED6A82F7FD6F132C9C2E891DC AVGQR
438,367,339 *2C6C2981B0C422F118B984D2424ED1580BB45108 ca%ss
438,367,340 *2C680530A3EFCB24926FB9B1E7D42B274C07DFE9 tentacule2
438,367,341 *2C6781C7A4B9BAC65BF46D5CB90EBA052C2B795B causerent2
438,367,342 *2C65E979BED5B82D5ACE8F3616A00EF57D74B81A [email protected]
438,367,343 *2C6F21CA7B506B7EC80315BBA5D026156C2F33FA \CC_
438,367,344 *2C67C3E115AB59187C4207BE6934EB16CA3F1635 b1,$%
438,367,345 *2C6561858F886F90F4A1A05D0EDDB90ED81081AB CCG6
438,367,346 *2C633955DD363A7E084FDBD49B2ED4375443C647 CD62315365FA71DA104CEE103164119A PEEPEE
438,367,347 *2C641AD9CD48F79C9E869D2B1F22D6701D482D2D b3o8
438,367,348 *2C60BA6791B10B58DF731BAC43C752E06F05FCD5 CELADONINCENSE
438,367,349 *2C66F362BA8148E5C25F503967969FE1DFE2AAB8 B9E"S
438,367,350 *2C65B4CAA2B7F0A9ABB9618EAF5EF28B57C9FB03 CERTIFICLA1
438,367,351 *2C62175484C9556BAD31D227CC5BB3322C7E2ACD CF4
438,367,352 *2C63A73C9037035D0BF8EEF4F2A582AB8E6FC7EC theodoreperrier
438,367,353 *2C69700359B1AF9A1F6D390E8586C01698EE5CAC cf$dq
438,367,354 *2C6806B2030972750097C3A994A887D48775E554 there.megamanzero
438,367,355 *2C6CD15A7DBAC816541035579470B080EC0DEE95 cfp-,
438,367,356 *2C6557AF31D28D67A1161D3C49307B271998AE32 BARNEY.RIEDLE
438,367,357 *2C61B5F21F80B19DA4DC9B49CCEC6CF96961C9C8 CHALICECCHULLAIN
438,367,358 *2C6B2C7668D8E6A82AA77F29A6ECB415E8FB119B champco4
438,367,359 *2C62EAD35C8365AA231C81307A9B1E5643B115F7 CHARIS STANLEY
438,367,360 *2C69FC6A2D11C33E7DFAA71B13508D1A64E64DDB think it over (undubbed master, take 3)
438,367,361 *2C66EAB992BB1E43A9CA6851CD8139E2D97159BE CHARLIESHANKMAN
438,367,362 *2C61364054BE76AD485764E51E3631A033BDF5CA baybsmallzxo
438,367,363 *2C6FCA86B26B54EA394B6FADEE2D58905208CF6B CHECK.THE.DAN
438,367,364 *2C6B76B57ED0FB432B3855A49EA93C84D884A762 BELUIJT
438,367,365 *2C666A3E7F7080257294404F3ECA824AAFD8F3E6 BENNETTSHIRA
438,367,366 *2C6DFD573B7D9BEB389F9C358186D267DCDFBBC0 be!sm
438,367,367 *2C6AB6951672C49989B56E3BF2537F9F0FCE3548 BETOKENS
438,367,368 *2C6592F9392C9390E617FA0754EDA81E9963402E CHFXV
438,367,369 *2C60BDD083AFF9960D71509A69D36BCB3CCE6169 Tis-sin,&lt;br&gt;Nay,-profanation-to-keep-in
438,367,370 *2C629B9B0D5EF181888FEC96225519EDF416485F CHONG.HENTHORNE
438,367,371 *2C654D48D31FFD76364A4A15C920D0931B7F2215 chrisettelyons
438,367,372 *2C68C7DEA040FE5C74B4F700560DD0BE3DF5D931 [email protected]
438,367,373 *2C6C01D949D98A3ED21856C0171CD885F19ADDE8 [email protected]
438,367,374 *2C6B9C8E15D32EA559DD62C25CB5701F7A1DD9B9 TNEIAIFINGIS
438,367,375 *2C6AAA663C51D054553B4A996113067E3EAE6BD9 TOBIAS.SHAU
438,367,376 *2C69411CC8BAB0FE86BBE2D83B4B8AE777EA579B TOMATOTENNESSEAN
438,367,377 *2C636E19FA54A4B57C9631B5EB48CEC8F7CBB808 [email protected]
438,367,378 *2C6EA4F4F70735063D71750D0F5CBE69A1D6F847 CINILYHPATS
438,367,379 *2C6D2CCB034BA9B66A8B5600199176E7D75295DC CIRENTHIAC
438,367,380 *2C61091050354712699C586E7AE6FB446382F8EA CITY GLOW
438,367,381 *2C639D2F725892E11CB9E48E713A2656AC37C0A4 CjAA
438,367,382 *2C6AF9EBA4B24422D1DFC3BC92B71357CC15A5D3 cj"r#
438,367,383 *2C6250FD3A8D559E86E38ABFFDF07F70957AE626 traceylauchaire
438,367,384 *2C6EB49C32AC767F6ED74B0FF756143470A5BD32 tralignavi7
438,367,385 *2C643B216AB19DBEFBE7660613F5319E2CC7784A CL0V
438,367,386 *2C626D3A0CB8BC1F9B7F32D649E229DC65218A42 claudia725
438,367,387 *2C604446B219C3DEED5AAAC8E53097AF88725120 bmads
438,367,388 *2C67EB2579AE306CD22149D3D7BF1B62A6A62ED0 trick on the speed of making it
438,367,389 *2C6931F112D1AAE798C942C3C54BF5A95575B994 cmaee
438,367,390 *2C6E11332DD6CAC36A2C7FAA975A9BA5E2746BC9 boom.(b).(sting).3
438,367,391 *2C639E860401358F33F36D92CCE7C41D95889927 CMPBW
438,367,392 *2C6AC05702C5567E54DAAE4B4C50684AFF9CD589 TSIROGETAC0
438,367,393 *2C6838842151087081FD39330998077946E04912 CNESV
438,367,394 *2C69C0D32D9E795A72808C304794ABBE1ABB7B8A B#####P-`~-`~{X}
438,367,395 *2C6D047C71255D8DA14431CC2A03D45D60ECBAF3 COM4O
438,367,396 *2C6BF95D12397F6653F035614ED487A34CFD79E6 TYRONPENDOLA
438,367,397 *2C674C742F800D5E02FA12582CF173328D7FDB91 CONRAD.KUBILUS
438,367,398 *2C6545709BF48FD04E7263846128551D3EF26854 consacratas
438,367,399 *2C63C5621507DEB00E2EA14D7953E16483E2D37C constance-greenwood
438,367,400 *2C655F0C2E19091373CA4389745522AA9BB0E933 BRANDENBURGCONCERTONO.4ING,BWV1049:I.ALLEGRO
438,367,401 *2C602C243C634842A24BA5805E15E63B65C22CCE BREANNA HATCHER
438,367,402 *2C6A2BBF170B69E11A8D4EF93C32D4BEF2876D05 coorsering
438,367,403 *2C663DDCA5AEF12404BD815B5412BA560A4DE1B5 corgisareforever
438,367,404 *2C656487BBDA1935F2C4AA7CD263D9637A6F3B5D UHAMIC
438,367,405 *2C65D17C22CC2D8AFC1687EB2F9FB4E3ADEAC9B2 COUE
438,367,406 *2C6FCE45FFA4DC05D28EF9E06E4A03033CD04402 cowln
438,367,407 *2C673D510B10E05EB90495572DBC4A85B25415D1 &C. (PATERNITY) 166.
438,367,408 *2C6D22AB38CCC52A1C6922DD3A2860557D2DD91C CP,HN
438,367,409 *2C65BCC7CA2861740B96FB967A96D3AF07445C89 [email protected]
438,367,410 *2C6F7FC2B0EE15FA363A6287E7FA6C71690A5770 bryantlifschitz
438,367,411 *2C6E2445188ABE931E7EDFA85FA049BEC7A60C7E unkunkyan
438,367,412 *2C666A4FDCA3A1A14C04265D7BE53C627E0C11B4 CQSOJ
438,367,413 *2C6A8AC95AABD7C8CFD81AFC70F867EC2517CFB5 CRETZEREM
438,367,414 *2C62AB436D2C2FF5142D85F41FB8BDFC4623C5B2 [email protected]LCOM
438,367,415 *2C6DF9EE6BB60BA1605332E05988D390AF7E73B6 CRYSTALSIMMS
438,367,416 *2C6686EB6C7FE513E5780872835BCF9004E92476 cs&op
438,367,417 *2C6619285BFFC531877E25EB3F865F93E63C3CB1 ct$.4
438,367,418 *2C6DC5D21FD8689FBE38953C28F85503E3BAE540 BUTBARBADOS.ORGWWW
438,367,419 *2C61D399DB86DC2A8DA3FD23280DE4F0461D211B butko
438,367,420 *2C67E7BC0E52F76F8CCD82140FB5F0E7B1D33804 CUMR
438,367,421 *2C67614E06F2F81F063347FA8DD3D83870FEF437 bwq0c
438,367,422 *2C6134FB753456A449DB2C73477D354820847998 bxj+m
438,367,423 *2C6D66DDAC31799619CDEB2F71BB6B9DD11F9217 CUR?U
438,367,424 *2C615445B41E52E4233268CFF86AF01DC8C208ED VALSAIEN0
438,367,425 *2C6270DA37C0A2B51D7BE876CE8DCA9831AC7EDF c!#),
438,367,426 *2C6B8BC83BCA03A27D813D9097259543108212E7 CVDDA
438,367,427 *2C6DB16AD03FCB597EBC8DAFE5137FB5432E853B C7Cl
438,367,428 *2C6E616A2FB0BABEABE3953E64FD7D77344A8EF4 C7)J
438,367,429 *2C6D8FE8B7077039A3D636212D3837FC62D21B50 CANSINOLUCY
438,367,430 *2C68B61EA08FE6953D47EEB54972AC12D5CD9F47 VICTIMS (I)
438,367,431 *2C6BABFBCE865EE5598E0A627FB1C5CDD92473D6 victormitchum
438,367,432 *2C69C46258F032771F62AA0A9BC9F3905DA1EEFB VICTOR-PETER-LASIC
438,367,433 *2C6AECB49679C88438B3CD4A8EE8A7F29BC0D8B0 CARBONIER
438,367,434 *2C69A89493A46C5C1EC209306E0B263F3E85A355 VILLEGGIERESTE5
438,367,435 *2C6C124A165282D8082DEDF3FABCE1D89485A661 d/6by
438,367,436 *2C6245099C9EC911F19BECB9C4D1F2D96ABBDF21 VINCEFASOLACK
438,367,437 *2C6047528FB64C91591B724654D6F1A8E24EAC2F D`7'
438,367,438 *2C6B60C67E0E7FACABCA7967B711E91471357D62 VIRENQUE1
438,367,439 *2C6E611BB7D11E76B4B50499D8004DAB759A74E1 DADDYMAX8
438,367,440 *2C62FCD99AC42448004AAB3242442F2A7AC3DE21 VIS ONG
438,367,441 *2C6B7324B44FD4675A85D65E55484E47750272A5 [email protected]
438,367,442 *2C6E6802E496A641B12E992A0892B5D62C391A56 DALAUR
438,367,443 *2C62069F5134FE0368A775139189F4516D013960 CBFN
438,367,444 *2C6F3EF71FF5531AA6B9F588E182B93F7A4981E6 damionbedson
438,367,445 *2C69C4F9FC0BB0F5A6DB202DCCF31FFEFCF7A7B5 VLADYMIRCOSTALES
438,367,446 *2C6CACD2D7A3258BF513824C7EFF8737328D28D8 Voiliers
438,367,447 *2C6AC457055201A7E4B845F698F19FB120932F93 cc.miles
438,367,448 *2C6B04E7D3A5E2924C41DD5324104E70699DC144 VUORINEUVOKSELTA
438,367,449 *2C6F49F4A6637E8568134B8CD10F750ED7A8D602 VYLZOVA
438,367,450 *2C609D4B1D0E4E523021A2D839EC25F87CD1E7DD DARELL.ACHTERHOF
438,367,451 *2C6E2FC07188092459B4458629C80A80B7527DEA dark3.17
438,367,452 *2C61A1940DF9B45C9340BAEA0C15625F205CA4A3 DARLENE SWANK
438,367,453 *2C6FDE1AE6F530F586E14A072BE7CCA56DF01710 cenzorski3
438,367,454 *2C6470800FFBB7459A5E786C882BF16673183B20 waists..w.ey1.s.t.s
438,367,455 *2C6C3384A5B044BD8B77BD176AD140237AE7FA10 cereps
438,367,456 *2C639F1B7CE5C14D50F44689A6256B741F67D265 db%/g
438,367,457 *2C633EDE67E56A48B4B4328293A349EFFD93552E dd.ep
438,367,458 *2C61289AE3C2B53FC7BBFD578CE95CFBFE7BBE9A WEERMON H PETERSON
438,367,459 *2C6208321AE8B7035260E97ADC6D2228D97B1C3E CHAPINHARAS1
438,367,460 *2C633198CC053372B248E124EBDAB97E050FE2B0 CHAPTER 07 - UNEXPECTED 01
438,367,461 *2C6ED4BFE580BE496379EB7B6BEDEC03A09BE1A3 CHARLES.SILVIA
438,367,462 *2C67AC647D30CA04C2F12693C26F224FE372FF23 WENDYGARLANDFORSYTH
438,367,463 *2C676DD6265E332EEF0704676F19CE2217EBB493 CHARLIECAPUTO
438,367,464 *2C608885A9A9E9D01233A047706E410CE4ACC0C3 Chb1
438,367,465 *2C6146F99ACDFEABC61D4E37380FDAD9C9830127 CHESTERPAVLOSKY
438,367,466 *2C64C6582618E50D2887E366A045E78192E74CC1 wilbertshutter
438,367,467 *2C666D31CC8D5C40A48DF5BED6E2E9F1F8307567 WILBURRODENBERGER
438,367,468 *2C61060655F04607695F015F620477BD4BE886F0 WILFREDWENDORF
438,367,469 *2C6529A8D6AF57A3BEF44723C840029AD98C7D2E will.buscher
438,367,470 *2C69FC11CEE02D3109497BEEC5B4A3F8C1B85A38 DENIED.AT.CUSTOMS
438,367,471 *2C60B662D5BD1AA6A957182EC908588AEA330A11 chkx
438,367,472 *2C6012368F90577B97257E52C30BD64EF9FBBB52 CHORYAM
438,367,473 *2C6D9EB459F6D8461A5EB27B6C093B8D863AA5B0 DERICKSIUDA
438,367,474 *2C66665E23DA0B727BE0C57D6B4960409D5475B6 [email protected]
438,367,475 *2C6FEC4D0F8C5941B69C9DA570C1A31CD7B3856B WM.ARCHER
438,367,476 *2C6C78B201E8DC48CE6E86D5FD8EA75622FAACDA desmondwimmer
438,367,477 *2C6111DB836655054218DDA9B12899F759C1E900 [email protected]
438,367,478 *2C6EF1AC21CA0D002707A0AED1E7B7A76A47CCFA CHUWG
438,367,479 *2C6075C86EC0FA0EC283A2B8D01227D5919BF088 wwwlucyndastoreycom
438,367,480 *2C69B575B0F3A892B0F8AB4EC633D450D0EBDC46 XANOTAN0
438,367,481 *2C69759ADEE67010CF5C456A540ACBF9ABA53D17 DFV1
438,367,482 *2C6FEB8C4E219CBCF4E4B99358C84A024226B3F6 }X{~~DQ
438,367,483 *2C61CD77C5E21CFD0CC0CFADD1CF8AB190246DA5 dguum
438,367,484 *2C662101FF37152D49E7D5C8252514A8987D3E8E {x}~-`<=====p
438,367,485 *2C6A892B355925D10F748C6A0F30337BFD9AC59B claudpuna
438,367,486 *2C6AED8B31861D6F6EE3E991D224D555DAC61465 yadgho.cedric
438,367,487 *2C68704A03C240ECB265B70347ACDF9B00B38B51 YAGUACHI1
438,367,488 *2C6ACA33C5CD48E0921E054A0BE833A2E17800EC dia$t
438,367,489 *2C68EBD6C1FACE7F48038F5B917BDD8225BDF1EA DI'-DILI-GO-GO
438,367,490 *2C67CA8E4985039FD02029EDC1C6975EFBE42D04 Die Liebende schreibt, Op. 81 No. 3 Gdur
438,367,491 *2C6AD452ACC28F6A0936EBAB2F42B79604A043C0 cl"(w
438,367,492 *2C637B6EEEC931E48B2E3CFA16DA2A875115A340 [email protected]
438,367,493 *2C604BBBA802DC86F964F7E181631A9605F83E97 CNO:F
438,367,494 *2C6E9EB9F61589583708C32C5A8C43FFB68ACA41 coami
438,367,495 *2C681F75BD0623D51BBF8BFF0EF1B1A7FF3D68D9 dll4d
438,367,496 *2C65E9D1DA02786234A137010D581636A4EB2710 yurieka.yulie.andrianie
438,367,497 *2C644F1009CC5B02EDAEEC1ADA349EDF5BFB3D04 comme.on.a.dit
438,367,498 *2C6EB87D85CB7E8AAD6B7A9446D563E44116BFCE ZABILAM0
438,367,499 *2C638A5FF70D5288714D02B2A151BDD8F465E5BD ZACHARIAH.BRODOWSKI
438,367,500 *2C6397A350CADE1D608669578A23C498C7E1C08B D"N4J
438,367,501 *2C60D2D9FCD90F416B2A733F980E3A0B9F3B9749 ZAHERA HANNAH
438,367,502 *2C670052854388E7C7413CCC645A7485AC7532A8 zaina.nazzal
438,367,503 *2C62C74E05D610680B06E4BF53BE10A95A056DE7 zamorniji
438,367,504 *2C640F48DD8217322B216628802608B56DDC5FE7 ZÄNODAKAMBRIUMIK
438,367,505 *2C63F7118E628A37A5A0373217A88B955E7F13D5 ZBARIZ
438,367,506 *2C675546393E59CAC8A3A248DE88F3651FEA66CE DODOMILKBBS
438,367,507 *2C6B6F49437EC8FF788FDB3CA8BD09A6952FBED4 ZENITHBONNIE
438,367,508 *2C62EDA08254B2CF1C072774F4173F28FE3F8B2F COURT.MARCHES.AND.OPENING.GROUNDATIONS
438,367,509 *2C61DAF3C9B930189ABD280C2D993651778ED4FA [email protected]
438,367,510 *2C6FCEF5B574FD1A4C4EEFE4A795F27016D9BFD9 coybruenderman
438,367,511 *2C6F36F2E7D9849F735BCC37D620EDA783F3F6CC DONNIE.CHRISTNER
438,367,512 *2C65FCDCE8C9AA38A2C8392689076F0E5466C84B CP6SY
438,367,513 *2C6B91C77DDBCC260D9EB16037668F285B08D76A Cq0
438,367,514 *2C63154A3CE0DD0F940EF3A43785169FE8A8D433 dqzu%
438,367,515 *2C6729AC3C1E57D5B0739B63A1939E3E6646DAB3 БЭНГИ
438,367,516 *2C67A542F1664FDDBBB93554CE1DDF63C9F1CC15 CSV!F
438,367,517 *2C6DBB4E05B5013665A3D48DC80D7E99739C0502 иркутскавиа
438,367,518 *2C63D3FCC47242D3232C0455A0340F26E8FBD176 метохијски
438,367,519 *2C602E41CAD515A87C1D4F111462A34E95EAD23C РЕККЕВЕГОМ
438,367,520 *2C6CCBC848E4E3E754AF4FDC336D2AD1CEBF0D7D ФУНКЦИОНАЛИСТИЧКИЈИМ
438,367,521 *2C6F8C48CD0977FD581FE753BB2CDD94CF85E9F0 ЦЕНТРАЛЬНОСИМЕТРИЧНИЙ
438,367,522 *2C64292AB34E2E5E3B7612EB4D98006B0A610507 cy43y
438,367,523 *2C60C777828F71F88B05D62AF9D92238F9C6C35A c/yam
438,367,524 *2C6CAF38B37A3EF7A073F82CADD6B11123A56B4F cytg
438,367,525 *2C6EE58163E388E4105434C21CFC6B0808CACFD4 DWAYNE.LOY
438,367,526 *2C67F09E38159C96909835038FFF3EB6752AE3DD D;(;
438,367,527 *2C63983402C0ABDC9340B17A9226981E042DF6BB eafnemases
438,367,528 *2C6C097BB9255D3CFCE53441B0F6820CC8146A0F d3y$u
438,367,529 *2C673E598ED7E85853C97C6DF83CC34A9E77372C d6g)
438,367,530 *2C6788E431679F8DA34090BE88CF3F27F3C27B4E EDQ5!
438,367,531 *2C67D5FC2CF332AC7EDBB56982D090E506641720 [email protected]
438,367,532 *2C663BFFF638DCE26A488333ED9D771593B97638 elb9c
438,367,533 *2C61012EBBBE8B78D699E2DAF42084382105C5A3 DANILO.CREENAN
438,367,534 *2C6E621516C10E6111107E423EB97486E8B48685 ele)k
438,367,535 *2C67305C80F5DF3DCD0F0C01B054CC8340A043D0 ELLIOTTTHRAEN
438,367,536 *2C665275D740F851E67E7DC46A0FFAA56093D4D4 DARRICKHUTTER
438,367,537 *2C64C1F5DB7DDC0C16C857BF53737B32C8140D92 DARRINORSTEN
438,367,538 *2C6D531AEE0132083874C9CB3B150020E9B877D5 das-reporter---paradies
438,367,539 *2C6C05866FD63A58830BA7C71F98448A518EEB1F ELVINSPERIER
438,367,540 *2C632D9494CED45CB41B6865716C56A3C0D16CA8 DATUSANS8
438,367,541 *2C6B0BD00A0DC62AD39D51CC3C858905A13C7CDA EMBD
438,367,542 *2C6361DCC7C23C4B9321AE616269193A9D8D4630 EMILIO.HOWMAN
438,367,543 *2C645D7A5BD118D5586C065989D852EF8573D98C emlgf
438,367,544 *2C60DECA29F6CE9DCB3C8EFA023C42ADA510EBB4 EMORY.FITTEN
438,367,545 *2C6524578A3817DCF3414A94B172F3F859FE5CB7 DB;L.
438,367,546 *2C694C87FBFB2B73185071DF15EB6B43AB46535B en;9n
438,367,547 *2C69BAAB3A6D9BBC3143402D08A3A78B4C524C83 DEBA..DEVA.MUNICIPIO
438,367,548 *2C6D7F9C52CA0A245B1A010BCBB44500FF792A0E =-$$?="enternewtopic:"-=
438,367,549 *2C67FB9D2042D87C999A0D11A4090D1CFFA69F05 ENTOMLOGY
438,367,550 *2C64BA65EF8F3E5BEF95094BBCCEF3C86E6D8034 DECREE…
438,367,551 *2C6BE91A1E67FF7944DE1F010F2D75B9A2265E18 deecaneles
438,367,552 *2C6A61C46B5183A4C12C207317C7BE71F66F4A09 deepak.phulwani
438,367,553 *2C68DF71B346283E0EDF4D3E3722502E2F14C06D EOU4U
438,367,554 *2C6FE9751D780BB8B4645BB9FB927F31919E709B ERATIUGES
438,367,555 *2C67C04C88D196E40E061B9F40C6316046839A48 ericisaacks
438,367,556 *2C6BEE63FA04914740BDE0A2DC4DA111192A30EF EROGENETING
438,367,557 *2C6B775CC664CCDE106CC3CE1BC74C35D79DCAC7 [email protected]
438,367,558 *2C6AF46AC8B8035D2F58B4D87D1052CE68B4E934 es&q
438,367,559 *2C67D597DE9D1924644829C7EA31B8F9BB22A437 056JADE
438,367,560 *2C6BC9EDDB22E3C586D515420000C43FA1478822 dffuq
438,367,561 *2C60CB418D5F1F9417EA4524CA6983D7F7D9AE48 [email protected]
438,367,562 *2C672B583CD818DAC4987D40ED04503FE7DCA491 D-GMX
438,367,563 *2C6469D8260E8C1BD1E079D47C7AE5A016CCDA5E EZRA.SCHNELL
438,367,564 *2C69162B4F6E469FF4E963188FFFE71E094EEF05 Di"
438,367,565 *2C68A17706C9C510F388F2185CDEF7A458F17818 f4ynpv
438,367,566 *2C6BDB226ED7EA6D4FD2753B383D546AA0F2200D [email protected]+S
438,367,567 *2C6F0526DFCF0D28DA6869B7A9F78AFF07D9AEFB 10:10-#-&PATRICIAN
438,367,568 *2C6C58BC6DD9F1108B1CDC053FE2206F297793E6 10141636
438,367,569 *2C667BB4C0BE3FBD67DF0513E92B6C2DF30558CE facherezs0
438,367,570 *2C68E2CEFA5EFD252C6C51CE6DBB46FD2D78F0CD die millionen des harlekin
438,367,571 *2C6402D5141ADCB6CB68ADECD27BDC47C7EF9F92 [email protected]
438,367,572 *2C6278BFC2A24A933509E136D6E645D28905DBDF Di$h.rack
438,367,573 *2C6CD5D6AFBE405E0FD404E9A430CE7D835DDFD6 farah.izzah
438,367,574 *2C65DF2369DACB7D48E1DC1B10F1F51A1E8B17F1 FE4010
438,367,575 *2C6E7D30B636A151129B10534FE6F46E7E8C3BFE felixbankes
438,367,576 *2C65063DB3C6FD47460C54D10CD486E3DCD3E1BF 12-29-1253
438,367,577 *2C6836FE1B1C433486F12B9CED4D18B3F4503ADF DISTRICTASILLO
438,367,578 *2C6A336AA136385C10D332548238EE9A98D0FDFC DIVIDIANUS
438,367,579 *2C6A1F9D5B4BB8F3644F9A2D3D8428EBEC167F05 FILMLEMMA
438,367,580 *2C670D8BE64CE52C145C68872D9B0C4D4B61816B dj+x?
438,367,581 *2C63AE0B73DCA4C67D05BCECF13E4C73F3686BD5 D.K2/
438,367,582 *2C6CC51F1B067D3C2408074F1B4C716CF68CB9D2 dlbm6
438,367,583 *2C63EA5059E2496C8F96BD884FA10658AD36850F 152LEILA
438,367,584 *2C65F090C64794C756D29017B60C2152A3D9258B 1792584 wartenwirdenpolitischensprengstoffabmitunruhe!
438,367,585 *2C65120A03BDAA355DE2D3AF5624BA4DB62CCF04 179490 UskUdar-c-.-Ozel-idare-ish-.
438,367,586 *2C60EB8F8336B70F021A213AC5EDB7D68E96FB7D fluoroscopies
438,367,587 *2C6C9682C8DCB0F66567D08519F683CF2E5B9C1D footballnation
438,367,588 *2C61E7079C5041478709E70CD90493B799C493DE doglgs
438,367,589 *2C6052FF2FD02A9805D42D86DBAED7C41680933B FRANCISCO.BONDS
438,367,590 *2C67A2757E525CD79333E336395112FF028D491A d"olr
438,367,591 *2C6AD6665B15139D93AA42E68ECD2595076E02C6 FREDRELIFORD
438,367,592 *2C6919A5439DCA8777C926E6F9D27AF422E2D543 DONKEY.17
438,367,593 *2C60C246D7466C20A4A178104DB241E26448E642 DONNIE.HONN
438,367,594 *2C6E60E6CA87C83835C17F3C8FA88CB8924A6DB9 donnieleh
438,367,595 *2C61C0FB3C871FD2D2BCB375B94150FD1D137AEA FREDRIC.ROHLMAN
438,367,596 *2C669FC86530A13ACEDED8E0516628B3E811BFA4 FREEMANSTONECIPHER
438,367,597 *2C6DF9F3507DE35CA5C539D4625317AE2186706C FRENDINÄ
438,367,598 *2C69C1926BC72B2EFDA796F53042BABAAE0BC621 FRXY
438,367,599 *2C6F83CE9CC18554AC0F1C753D95384C13432939 doyouloveasgoodasyou
438,367,600 *2C685EB96876D1249A8A3314A43150943D353505 1CAMBIASO
438,367,601 *2C6C5C7BD7C2860EEF6142DB6FCEEFC55C018835 DSG=
438,367,602 *2C6A4C16CBF94B2A362B0D6EB1F50C2918D38909 geeuwhonger
438,367,603 *2C6C0C0F5659824A766A82F696B4A48B63D5F5A1 GENEA1OG!S7
438,367,604 *2C6DB582B20E16B92E9DEE846A776DC1F702084A gepaeckking
438,367,605 *2C68C121E3873C398D60CD357225219C8FD58CB8 gerardwenck
438,367,606 *2C663D2E1F5A19738356A343D3444AC788472E51 DU BIST MEI ERSTER GEDANKE
438,367,607 *2C6070A5709608DDCBE260DB8F866147ED38CBD7 G.HU
438,367,608 *2C69887A74368755D6385271C098AE9B40CA7F55 1-kret-schmer
438,367,609 *2C63AF11B38CF4DB4814449AB2B29473CD12B504 GILRUTH0
438,367,610 *2C606AEAD065B165E09036D41EB1B979FB28AF85 D$vl
438,367,611 *2C66DA522B90F0B84C5E5C4A1389CA332E5882DB DWIGHT.GREEAR
438,367,612 *2C659EB3CDA6BD8936A0D3996DF0D2FB27406AB3 GLENMELGAR
438,367,613 *2C6976C780AAFF72791F630E903FFBC6C33305F7 glennhickox
438,367,614 *2C6046EF23D462FE97C3BD901EC0C6AF21DB5DBE GLENNMIDDENTS
438,367,615 *2C61D0C3384D9B847686CF7E487A3C73D5B7A81B GN&%
438,367,616 *2C610D677A8E717B4F3947FFE7E3FF95B32D6F50 1modell-auto-club
438,367,617 *2C6D88F60C3B7164C02052D30AA7A83E17AE018F dxg&f
438,367,618 *2C66FAF2E4507686A8FDB55964CF84D19B48A3D4 GOMBOSSY3
438,367,619 *2C6FE29F8FD47E077D86592D4A77F15D47C3F383 1-pikkukaupasta
438,367,620 *2C63214A1E55B69A725FE2E70403EEB597E86420 1preussilais-spartalais-runebergilaisessa
438,367,621 *2C6E3B8FEDA009B21A3ADA70DF26145CF224EE28 1.REGIERUNGSWISSENSCHAFTLER
438,367,622 *2C6B31C68A3A436EB7E85583F25B7EF3AEF63F27 1 restcynthia
438,367,623 *2C6F323A05D3AA0F3403E7152A2F036AF4DA34A3 gonzalolevien
438,367,624 *2C6BD154C796AB72EF9F419AA49CDAE55FAFA2EF EARLDEARE
438,367,625 *2C6BA9A978C1D4F10E50F883A26ABCB77613E9D6 1SOTKISIMME
438,367,626 *2C6ADEDC98B7A7BCC66747962FAA221C8FFA7068 [email protected]
438,367,627 *2C676B9691456D8B734FA72F34C2496D84E26E2D eaycb
438,367,628 *2C6E21B17E0A4CF0BD16B644E77DF6B5A684F523 GREGIDEN
438,367,629 *2C6DE934EE7637D55F63C72019A17525857CAD2C greg.maga
438,367,630 *2C6D50015D664341E678254C7A2EB316ADDDC6A7 gt[i
438,367,631 *2C6FE0A42C7297BC8432D2305981C561A7386190 GUDUS
438,367,632 *2C6DDAC41DCE9CF7E553F08B249B42F592870F8D GUIA-PRO-CONGAL
438,367,633 *2C6B20566280A1BBF6EE0110133ABE4D51EC91B8 1-WESTNOSTALGIKER
438,367,634 *2C64C41CCF2431EACDF0D3F8269FEAA30800AECD 1-WORCHEL
438,367,635 *2C698A7679A7D62AB66E91371BB0963DB814F9AA EDMARSORIANO
438,367,636 *2C692C2C6417E5165823350934775798EF968E00 EDNENGET5
438,367,637 *2C6FACDD39FB2A9014F8167F77A0207773C9EE6F E"DT
438,367,638 *2C67D22DA5A464BDEE61E814CDC049FF493CFB36 EFRAINBEVELL
438,367,639 *2C6A712A1927461D597FF85A4B51BEA7B0E16370 GUSTAVO746
438,367,640 *2C6A291E7665E9BC2BA43A5D1F0E4AA18CF31EAE 2094625 JANYTOLITULLUTSEMMOISEENKOVATARVE
438,367,641 *2C69CAEB12B8FA1CD619D0E15A0381ED45FC9E9F 209.lagos
438,367,642 *2C603CC277AA1BE68D87A75AEA0193E0CFF5DC18 hadrych
438,367,643 *2C675695202891DEB924532DDE1556BBA642FF81 EKJILEPJ0
438,367,644 *2C6F5FC76C3F5357687EBA79CC557CF6F52516A2 eks8k
438,367,645 *2C6F2278A8D47F8939686F7A562A63794A1BDA11 249 МЛРД
438,367,646 *2C6C53C95140C316615019DC4D21E566A676ACE4 2652451 DIE SOZIALBERATERIN WILL KLAEREN , WAS VORGEFALLEN IST .
438,367,647 *2C69721C412432C71E5CE746118C3156DC39185B 26NOVEMBER1006
438,367,648 *2C651A2C2D17EC31CFAFB08944393B131D861CC7 ELIASDARGA
438,367,649 *2C67CA1FDAF7DE3BDF657127F98BA47C28F01EBB eliasraj
438,367,650 *2C6005E687E5AC8D6734B5DDDA9425522922296E 2842602 kukaaneisaanutkatkaistaitse
438,367,651 *2C6791436C32CDEF332E2703F3EE103CE89A7B3F 2852241 kultasepp
438,367,652 *2C6209B7F50EB093B74935BBB442661B95F6A913 2ASNESKUI
438,367,653 *2C6F3603AE2A07D8D1A5E062D4BAF5FD0EB8B2E9 2.cola-dosenhalterung
438,367,654 *2C6D97069FC71ACFACD06E2812D2E25F45D640F0 2.Corinthians.17-18
438,367,655 *2C69A5BE9F8207D77FB4BC41BFBB9D177F7C56F8 2DORNBUSCHESCHERSHEIM
438,367,656 *2C69A683AA9D99AC34052E05FC92F5A67B8A38C5 2GIGLI
438,367,657 *2C60848933CDBBAAC4898A1A8871D01C01A8C6D3 2-icewater
438,367,658 *2C6750286FB3A65EF72C89A92D5D3252487FFBCC 2.JUGENDDORFLEITER
438,367,659 *2C651F5C3BE259746CBCCD3DBEA4351693D3913D 2.KAMMY
438,367,660 *2C6005831B656B0967B7C8E3839947F1D0181E22 haydenissmexy
438,367,661 *2C6B07C3EBA2E04C122602CD44F4EEBA778BAF45 ELWROBSW7
438,367,662 *2C6DD9807DD2C0311B5F1A9312A00AAAC4692830 HECTORDOLTON
438,367,663 *2C6785CFDF48F3D7F3ABE49829C09BF8AD856735 EMMETTLILYQUIST
438,367,664 *2C671A379C1C30485DF7080D35CE6ADEAB6DE4F8 HERBRECKART
438,367,665 *2C68035D24D964AFB5D063FF6FDC8183907D2A97 HERIBERTOHABIF
438,367,666 *2C6F213B01E6E062EC44E5B444F796466969ABD6 EMPEROR TWADDLE REMIX
438,367,667 *2C655E85D720F072B8A261722D48D188F64BC63A [email protected]`><
438,367,668 *2C6C6A67CE2ACB61C9978B968E6F987D145F233F 333791 auchverstaerktecockpittuerenstehenzurdebatte.
438,367,669 *2C6C04BBDDA9F3FC2113DD91E610FDD32FF19346 hewikipediaorghe
438,367,670 *2C69102DFB1A6C3B8B4971590D3FE93138367F31 359DANIEL
438,367,671 *2C62D37D333023778F9BB8E127067004B3E70115 enriquetramel
438,367,672 *2C6706F263CB7246E74FBC1C947C49382C6D8B9C entoivu
438,367,673 *2C602F27E37EF9B104E2A5EDA14125E5E47869A4 EORTETEM3
438,367,674 *2C6979B9F007DBBA742923FE34C2F603685F8DC6 eoxj
438,367,675 *2C6C44120B25218AB99ED662F1F44671189DB58D ergotic
438,367,676 *2C67EFD5116483A55E034698919BDC9D0A9D9D9D hollispinkstaff
438,367,677 *2C602BB421F6E029074185A27FE44C2BDE17D052 3.ROSTBRATWURST
438,367,678 *2C6FB927CB53E4215CE16F63BA8D403B68100777 ERLEUCHTUNG1902
438,367,679 *2C641D6541856CF5475FD621565639626C4C91CD 3 TERMINALDIR
438,367,680 *2C69A9A16916BDE5117054785D6D8DD508629197 3THEBLOWME9
438,367,681 *2C6CF9D361FA8142AAAD36CF5B0CE586F861E408 ERROL.VANSTROM
438,367,682 *2C6E53A133543667A794C344B04106FA6E4AC734 3VERDAPPERD
438,367,683 *2C6BCF1541FBCE892937D24395C62FADF4E1E92C hotlittlemama
438,367,684 *2C6CFA979EAFB097B0631417F6545115001D01D2 43f0ab4de1266d6a9a6034058ce441b9.frodo06
438,367,685 *2C6A6AADC66C739DB40CEEED806D4DAF4D3497FC 446570 REYLER-ACIK-OLARAK-TASNIF-EDILIR-
438,367,686 *2C64E765461EEE0628CD782077ADF49EB308283A HRBRNDNSS6
438,367,687 *2C698D9615360070FC3A09865E0E7D9B6A2A8BB5 4CHICHACO
438,367,688 *2C60861AE6C0FCCE97DA2950DBE72A80A4D51629 4GOSSARTS
438,367,689 *2C665B2FCF43AF36A6243C3ACA28F8B8D472C9A1 4GROPIGAST
438,367,690 *2C6C46781A17740DFE97A9968D9BF6A6398AEDFD etkremeg
438,367,691 *2C6B085446962AF91BA508A4857539747E71AD9D 4iluvmart
438,367,692 *2C67D88FC65D5D12D7C07203A235D1F79CE31BD6 4RAD37CLASS1
438,367,693 *2C6AE79DEDEE8AEBFAB4FC1B2C1BAEE2D6D4EC8B [email protected]
438,367,694 *2C66858AAC8AEAB5088E5EEBB906CB48D60BB0EF EUGENE.KESICH
438,367,695 *2C6E09DEA41D2A6B0009840366385913097354B1 4SOLEILMUSIC
438,367,696 *2C604286A39ACB247D2A3EA65BC86683B89C10DA EUSEBIO.BOYLAN
438,367,697 *2C6F2F78E09B2B891E4F073CF00DA8047926223B 4TEOLOGERNAS
438,367,698 *2C6EC7673875BFD6B92F0AFA4D70DE198CA9998C 4V0RT10N5
438,367,699 *2C66B97DD65EC7A911FCC8F20432C0939BC2A8CE 4VEDFJES
438,367,700 *2C63F9941701D8E0D39339F113EF10A5490CFACD 4WIGHTMAN
438,367,701 *2C6229B31EE694C798BD5E82EAFB30F18536820D 4XTVNROZ
438,367,702 *2C6823E979120C0601BD150671F57EF557185F7A 4YLSUOICNEDNET
438,367,703 *2C6A947E33B4A7E36EF69E7FFF31C556EF4C56E3 51KONTRASTIEREN
438,367,704 *2C6F6995201E13855DB86792E6B08116D68E5F64 [email protected]
438,367,705 *2C6B161A66EDEB49A29604FF9947A3583F440087 EXTRAS79
438,367,706 *2C6467998E50FA9B00BA0EB82C3D2134AD0A8F5D EYEARCHIVES
438,367,707 *2C6D872D57169E2CAE680F499F760BEEB0ECD349 eziroire8
438,367,708 *2C6D601B579B65DF0D64BD948C1469C8E154C511 5CHICO0
438,367,709 *2C6251EE7A3ACF96AB184BEF14D20C4145D9BE94 HV;
438,367,710 *2C6A6B22D8C551A0765EB9866B90DD89CB726297 5LEFFYKS
438,367,711 *2C6083AA6D8DA58F6A103D07B65AE318247BB852 i37b
438,367,712 *2C6AE2CB92B5018ECC8F661ED23DCD17DE0667C2 5O1D7Y
438,367,713 *2C68652A1DD66AAABF5D3185E51C74DC38C4DA8D 5OOGSTAPPELEN
438,367,714 *2C62B6AFDD1C0BA240AC2EB7C183CB0A8B017072 5STRENGTHLOW
438,367,715 *2C6D81712C8B176C9CCDEB7480C636890EE81C45 fetishes.
438,367,716 *2C6CC105EB5D5DA3AA3D7A090DB764A35DC6688C FIDEL.DECRISTOFARO
438,367,717 *2C6C3DD1ABFE1316ECFAA5D39D100FE9B00C23E4 FINAL.85
438,367,718 *2C6568CF3064F5979A1D4394FB3A8EF5257F76A2 666wena666
438