List database


# MySQL hash MySQL password
438,350,001 *2C660A68B3353B69600F309C9E6453C76B38EF53 oxidule9
438,350,002 *2C629E3B3B80E4B34FFBCE4A791901E54509E091 canadabirdie
438,350,003 *2C67EC804FCDC7856203298EA3377DEB67D7231B oops.up.side.your.head
438,350,004 *2C6FC7DECE6F3EABEB62E3B8FE86F2CE5EEFABC8 )o(.~.`@===p
438,350,005 *2C62AB5428E197BDE9901995AB3E06092C16FCE8 ORCH357R47!ON
438,350,006 *2C647907C4984D483E16FAEF320E642F587A911C ORGIISCSSS39
438,350,007 *2C67BA5CC11B0C8B41E26C995287D2911792A8D0 [email protected]
438,350,008 *2C64F780DF6BBC628CF27B31AA38029374C88D48 CARRIE ANNE THOMPSON
438,350,009 *2C6441DE63FB33BA6CED12687DEC167DDCA8CF21 PARAGAL4
438,350,010 *2C6720262E4D7CE85DB1C8B09E35BB8AE303738F ORLORD
438,350,011 *2C659E075D7A26F59DE20FD1EF18E55B79259300 PARATAXIS3
438,350,012 *2C6C95753107578359D4F82D97786EB02B9ED7EC ORVAL.MERICKEL
438,350,013 *2C62D6CB02536273710EFE20D4D29EE2A50D0794 CARTER.IRINEO
438,350,014 *2C680BA8FB89E6DF7330A9867749840863D853F0 PASQUALEIMME
438,350,015 *2C6A40859A4936693A6F0E4343CF91FFB940F13E other.dances.5
438,350,016 *2C6D71287817AF226E3C99DE359B604771DEDB2C CaughtintheWind(featYoungBuck)
438,350,017 *2C61EFF9E50F6CA73815586706AD7880A2CDEB38 C?EBI
438,350,018 *2C69A591B98D406D24B17002C2737F1308313DD8 çekuyî
438,350,019 *2C653165E7B64E68A2FFFE2E49F3BDA280CC82F0 PAMELA-FLORA
438,350,020 *2C69A548C43D8BDA85497AADBB6D023E5D3B85F7 [email protected]
438,350,021 *2C618BCE59F3EDE964D0F84DFE8F88561FDD3E9E CESAR.SHIMINSKI
438,350,022 *2C6B61F479A7531DB4E30A6B572B07A393CCCDF6 [email protected]
438,350,023 *2C602C13C65430C24962BD1198F4BC64F23D0F42 c"f1:
438,350,024 *2C65B6707B0678B43C48D5AC33BDC3A5F0444758 cfute
438,350,025 *2C683E3766418405A7CE2FF9F7C1E1FEFC25D345 CGMXL
438,350,026 *2C6C3F8C3279B3A1F7C1EA0C23EDF4A87FF8B749 PDF甲府鳥もつ煮マップ
438,350,027 *2C6D77DBEA8E19E8EEAC4E8903AF6F741CB3756C pleurohe3
438,350,028 *2C6229DF78F59220B009F7065B87EBB5743B1679 [email protected]
438,350,029 *2C69500F3640CAA45CC3EB5EBC01825E5B654665 CHERBAUM-WAPPEN-W
438,350,030 *2C674A3C60402F9273D770676D29E117C8F325B8 PNSBOY09
438,350,031 *2C61F0B9130038A06612BCE8CA0F0C4A7D206991 CHERTRAM1992
438,350,032 *2C6903B74E17C48FA002FBC6DEA4C5760B40DA80 chris-urena
438,350,033 *2C6780D93F437BDA4706D7A4DD5608BC437C3D5C phil-hansen
438,350,034 *2C6C783637D3194AF629326089F222593134B27B pseudepaea
438,350,035 *2C6067014F4AAD57669A99B2F26F223E12DC1FCC Polarizes
438,350,036 *2C6BDBCB27B094750FDAA0EBBBEBEC398EC6D830 CLARKSIMONEAVD
438,350,037 *2C624E1725947DC2531CD5B838C7E5D318CFB598 CLAUDIABOGUN
438,350,038 *2C6CE692FC1B82F52F61ACD0EFCEA52E68343CFC CLEMENTESCHUYLER
438,350,039 *2C6502099058EEC215C5CB193C0690985F545488 QAYWSXCVBNM
438,350,040 *2C64F178B4F4684A48D125243ABDE509239BB2AB CLIFFORD LATOJA
438,350,041 *2C6AA2991C27B64F6D07DAAF7F61F814A5E859F7 CLIFTON.SCHUTJER
438,350,042 *2C6993434BD24DBE1DEE15802CA892DD1BAC245B clintondiscala
438,350,043 *2C65BB8949E0C49135A60B0D802EDB48E04AA29A q>gv
438,350,044 *2C6B6436A1D36E9491F5F915DBF4FC9B90E34D26 [email protected]
438,350,045 *2C6B37B5F98E9CCB48EE9C5C56F4310161A65DED [email protected]~.`(O_)
438,350,046 *2C6B2D6C0CDDF1AE900E2DAE03C8269BDEB0A15A psst-psst
438,350,047 *2C694858A2835A323D0F4321C0937650FEB8FC92 pwer-y-fflwer
438,350,048 *2C6D8BD87740ED2C209AFAC91D8CF3D010876419 CNqY
438,350,049 *2C694755ADF5197F1D7972150287743A422C1DA6 co8uw
438,350,050 *2C6C4BE3BA526C467352BC7470F3D545601AAC00 collinlai
438,350,051 *2C6F800F9C8D0971996B57679947EE522F4A358A radyoroxas
438,350,052 *2C6C6391784A80BEC65AF36BB5E73A4BDA694F32 QUINN.SOBCZYNSKI
438,350,053 *2C63E812A7EE772D3829FBE8359A0ED68EF19232 ralphgadsen
438,350,054 *2C6B7B633D2925997CCE772C13F5092A11F9D895 randellbreech
438,350,055 *2C6ACDFFF3BF0A67B8E342E4C3CAC035A018A0BF R1NGMASTERS
438,350,056 *2C626F5EEA1FD80D5B1B0CC05FB9CEE9E2EA8DEB RASHAD.MCKEIGHAN
438,350,057 *2C6D1FCCF09F4B6A69DD86B4A3289BC650E04B6B RAMON.MAGGS
438,350,058 *2C6F2FF9F3C23C52AA42E737B31D3C3316118424 RAMONSUMMERFIELD
438,350,059 *2C693E8DF6B579A93677C40DB4AB766FB263649A RANDELLNORR
438,350,060 *2C65E2D1B8B0A609F4D8157F3FF76B16FD91E0D8 RATIONALISE0
438,350,061 *2C669CF8C23F5ACA3F34539C7AA8A8CE2556D8E8 REDEHYN
438,350,062 *2C65F00CCB51C15CE05F07B49B30011E67C77426 coronalis0
438,350,063 *2C6043E5472E8F9D00122DFEC2B550990DD2F212 REGNIRBDEM
438,350,064 *2C67F52425B31986D2790DBFC759EE36FCEFFF51 cory.fairchild
438,350,065 *2C61E0B59FEBF48CF4B9DC65D8A0E1264F1D3D2C countymanaged
438,350,066 *2C6C0778CF6FB7A6F34A0E9393D502EBE66BE16F [email protected]
438,350,067 *2C64D4795DDF92CD69EF44424B079CBBCB60E5A0 REDRUULG0
438,350,068 *2C657683C61E60B2A04C6BBF488FAF02E1ACE590 C:\PROGRAM-FILES\CODEBLOCKS\SHARE\CODEBLOCKS\IMAGES\DBGRUN.PNG
438,350,069 *2C6408C9998C5240CE031210B6BD98085E7A4BA3 rerepmis6
438,350,070 *2C6ECE3BCD0BAA28B306CF04B87B4410FA9B8A9B RETARDERINGER
438,350,071 *2C680829D504CDBDA68AD27CCD159CEE16A01B8D REGULATIONTHIS
438,350,072 *2C685C72F8FD0E6FC3BA2812ECDF394C21560FC3 RHEA-ANGELICA-BENAVIDEZ
438,350,073 *2C6E65572589E19EB8FEEB45FF3E6DAFE8D2E897 RHONCAL
438,350,074 *2C64CB6CCD9DA0EBB3CDC68597A508C9C66BD148 C!PSD
438,350,075 *2C6D0AB2AD81E30AC9FED38C6CBAA70F5180F743 RICHARDEXCALIBU0
438,350,076 *2C6276B15DDA6B9DEBB89F822237AA804258C24E RICHIE-BLUBAUGH
438,350,077 *2C69156E461326B24C644E1AFE8CA3D709558CBF RICK.LINEBERRY
438,350,078 *2C65BD1ED7068DD4BB0E79DF4E766E84BABD1746 renaldohomme
438,350,079 *2C614C77E982D76CC1E48978F480DB63913872B5 RENE.MENDESA
438,350,080 *2C62783B3D0F2993C614033934E837667C6250A4 RENEWING
438,350,081 *2C60AC052BE799C1AC97C8E3013CD3A1B1BEB3A1 RETARDBRENDA9
438,350,082 *2C6FA3CC2AB332C7782A88D7551756C405E67BDD cs34w
438,350,083 *2C628C3C3D5897E030EDDB87063C5FC91F1F60EB RONALDTHIEKLIN
438,350,084 *2C64A40A35184D3591AA7724045C870C7898EB51 CT/62
438,350,085 *2C6481A6ABA5338ACDE5E6012965B67818CC712E RUBINSEABORN
438,350,086 *2C6C34CD92E8A2164E278A9FAA83A3D730165ACA RUDYROBER
438,350,087 *2C60B9E085D8FFECE9C108D6D54CFD92DEC6451F .RUESGA
438,350,088 *2C6B832339EDD30164A9D15250E98AA8636DA3C2 RUFFER.(THE.POLTERGEIST)
438,350,089 *2C67AF04A6F9AF326F79885BFBC4B127A5C42307 cuk3h
438,350,090 *2C6FF71F26EDD9DB42E44E9D8EA19897CFD4A289 RUPERT.BAKA
438,350,091 *2C6096191E1684146E5DB5AD697139FA1364731F RUSERU BARANAI
438,350,092 *2C608262B9C5883F5A87D8FFD01A3C186EF07EFE cv7m
438,350,093 *2C6FA6B033C3646DA51EDBD3391A8FC3BC086B66 saint.denisdubehelan
438,350,094 *2C695BB001E2FBE7D57E2E9F4FBB433F89D6E119 SAINT.PROJET
438,350,095 *2C60CC0FE0B8758CCEC9F3DD6FD8E4CB902007F0 SAKAKIBARAYASUMASA
438,350,096 *2C657A8CCA8A4A615727FC6FA455F2BC547554EF SALUTPLAYBOY
438,350,097 *2C6F147BB15940E0B8E86DDA129DBC094E386796 [email protected]
438,350,098 *2C61373C717DF5B0DB3654BD37A6A275B4E8F5B6 SAMMIE.CUE
438,350,099 *2C673A87AC57E34502F1F7750B9A7CBC8E6EE346 SAMMY ASSEGAF
438,350,100 *2C6179940907A04BA0F1DF5CB7206DE81CB39E54 RIKS UPENIEKS
438,350,101 *2C6BCF7ED1BF0AF1D170155E1548E27D32C81995 cy,##
438,350,102 *2C64D83539037C70CC26F15E9F599B3E7BA582AF CYee
438,350,103 *2C6D252C678687C49F99D9D850E4F17EA91786B8 RIVER CUBANO
438,350,104 *2C6E5BB5D79018F14F1DE39959695C7C418DBF37 RMADAGAN
438,350,105 *2C6E1377A3219D55036B35BD2E460094E683673A SARIBORZ1
438,350,106 *2C6B292BA31DDD9E9140A5A4696DDB251C1C1521 [email protected]
438,350,107 *2C6D4AFA8496B00F162AC3A170FCA979BB31C273 ROBERTBALCEIRO
438,350,108 *2C604A34D3F0941A8B01D4694A4D10B09AAAC0E6 S BA
438,350,109 *2C6EE9048908C2FC2E8C44580DF92D2767D939E6 =czy
438,350,110 *2C6E6FC45CE2671D79C956A2DE72B2AAC551FBCD SCALDIC
438,350,111 *2C6F550D6B23BF18100A69B3A938FEB571763843 d_2f$
438,350,112 *2C629C8EC708A6B073BF506C5733119B0C715176 SCOOTERHAWKEYE1
438,350,113 *2C63BD9938AD8A8C3188DB244AA3E1672A2BBF3B d3c3iv4bl3
438,350,114 *2C62FDD840BE142E2AF812022875860C022AA49C SEALGRAPHICS.NLWWW
438,350,115 *2C6DAA306514A57811003CB52BBCC8F633C62064 SEBASTICHTHYS?
438,350,116 *2C6D720971348B4EE97A624D91BE359315001DD5 SEDOHTEM
438,350,117 *2C60AE11EE0442CD90921208D2DAAEB6445FD094 selenodonty9
438,350,118 *2C629A599EE6EC41C99F79B6A603BB300F80D316 d-%_a
438,350,119 *2C679DBDB6A2F4F8FB31957F2AB72B546ECEAECC Daigneault'd/eI/n/j//oU/
438,350,120 *2C60DCCFA6877AD7051EED36AD09732E861D71D9 [email protected]TYHOTCOM
438,350,121 *2C682CDE88DBEDFE00ED63CB8FDFD8F7500FD55D DALMORE5
438,350,122 *2C60E3175E3F8FB376ED4C2DE15F7CEC587D9F61 DAMIONGALBAVY
438,350,123 *2C61A7BB3EA3F472153BA859B1C8753D79819D05 DAMIONULICH
438,350,124 *2C6758A8AD4AE96FCBE0191237E4E2F47A3F701A SEYMOUR.HANBACK
438,350,125 *2C6D448EE5DAE9AF461BCF735E8C23B880F3E753 SEYMOUR.SILL
438,350,126 *2C6299E69354C62184754D2F812CC305B5511ADA ROMEOHAMP
438,350,127 *2C6F3195F8F23C10098EB1C703F87478E85836C4 dania-assaf
438,350,128 *2C6C241483CA36ED0B8FFF37E1699442DADD0821 SHALOMSAMSON
438,350,129 *2C64FF4E15791EB83F20F147688086BA79A2856E rosa-webster
438,350,130 *2C65A0BE47DEE17EFBEF08F1FF30E075C8ECF8D5 shapeir-south
438,350,131 *2C6D77E65C9359B59D095F50054C51679CA1C5E8 shaun-gladwin
438,350,132 *2C61A24CCDBCF21FAAB2FF7DEE489DF6E2F793F3 SHAWN.BURNIE
438,350,133 *2C69467BEE96097F53D4BCE65737A10495A16E2D shawnlowen
438,350,134 *2C6959601A47B11927D0E9B6F759B178AFAA6472 DARNELLBRASSIL
438,350,135 *2C67E20C5ED731E58F55B5606031A3C2655D443D sheltonpexsa
438,350,136 *2C677C8514365AF4183CD7B6554B09B972231B1B DARWINPITKIN
438,350,137 *2C6D308CB16A2899045F5F3BAF3E374A54350116 shinbigan
438,350,138 *2C643517417F952AF7DCB715807F491668990CD7 DAVEABT
438,350,139 *2C6D209CAC350677F6F9AFBE8CB45C7DABDA1094 [email protected]@b1+y
438,350,140 *2C6E09D66FBC8AE441281DF4119148FE6C8F4156 [email protected]
438,350,141 *2C6DC802EEE9ADB6382F9EEE607E53CFE4E251F4 da!yd
438,350,142 *2C69BECC5397C71F44AE7D01816A8F5BB91538CC DCCf
438,350,143 *2C61F457298D31A1D0F3840C7A3FDA0A174E718A SITENKIN8
438,350,144 *2C6E0A7AD9057118997F838A2C1E611F855AEF8A RUEBEN.PECINOUSKY
438,350,145 *2C673EB32B4DDE6382F972540CEE7099A18D86A2 rupertlang
438,350,146 *2C61619A5835B58D361E3D7602B7F38A820D8C31 RURA1TES
438,350,147 *2C6BB22DD66D4D117F7504D7CAF3C5179EE8D49C RUSSELL.BRACKETT
438,350,148 *2C6ECCC93E11BD9CE999FDA64C83721778EB9DCE dd^p
438,350,149 *2C61A830EE827FD69B4440D7405C1C43B612E45D ruthhelenking
438,350,150 *2C679E163C386EA63DB9657C483A69911725A3CE de,7g
438,350,151 *2C69433B9C9B4BAEE2FF0793246B91BBD9A825F2 DEANSHANKLES
438,350,152 *2C6899D6863FF86464451B7AE12A32784B479934 D)EE(
438,350,153 *2C63AB16AA05F4E591FF2A59F26D58A45F0E28B0 SLOWING TO A STOP
438,350,154 *2C6DF3B33D537E0FBC16142D6FE71605A27B4DAF ?s7.*am-
438,350,155 *2C639BEB4071537DDCCC3C022B25FE5867E662EC smxphnw43
438,350,156 *2C61087F1F21CC5D3648537376F831DB9402EB2E SNAWMAN
438,350,157 *2C69D709CCB91CD9DAFD4258020225F8D7117FC1 SALMONTAYLORING
438,350,158 *2C6F55A51F87FDD42A43628E5C5C07FB89407C79 DELTOIDEIS
438,350,159 *2C6C95B2EC010E2A83C994D698CF1182362F9F2D ŠAMĪM
438,350,160 *2C66C7BCABAF1AF72A616B7D9084718F0A796684 dennydelcid
438,350,161 *2C6360EBA21B93DF8E3B90C7B2C09DA422A39F77 SAMUAL.SERENO
438,350,162 *2C6E3D6150A89257DEA9E21CEF262D83F8A08C22 SOFIA-FABBRI
438,350,163 *2C61E464D853924F2AF7C254C2809EADACC383B8 DEPARTAMENTODELAVALLEJA
438,350,164 *2C6E118A29414AD80C1A0CCEFC7D5EE9BA425495 SANTIFICABA
438,350,165 *2C6511A7DD7DF3ED27AB126B11D342CC31AF44EB DESHAWN.TYCER
438,350,166 *2C65491CF35FEFA98AF29E782301E59695D71298 desiree.curran
438,350,167 *2C665B8A5BDBEC80C8CEB1729B953534818503D2 Song-Life
438,350,168 *2C63F7F3B7B260FEDE3C36C1244FD5A547B2E4E5 SBALLEREMO6
438,350,169 *2C6B1291828A3B322B8191E826FB9987E186DDCD SCHEMERLE
438,350,170 *2C6BB8B61182837BE3EF3DCD8DA8A9A1E29820B4 SCHUENKFILDIAN
438,350,171 *2C6D70CE46D9F088F13CD8923085EC338D2CCD49 schuinsmarcheerder?
438,350,172 *2C646692FFE3B3F92563ABB13BF8528FB119F861 DEVILZONE77
438,350,173 *2C61E5A9D607481B48DEB206C6A2E53FD5071A97 SPACEBEAVER6
438,350,174 *2C6AC781DC7C98FF514FA00C11910DCF3F831ED6 df3kg
438,350,175 *2C691DBB02A3C78FD0CFAA11F5B69645B17FCB92 SPIEKSMA5
438,350,176 *2C60B22E2063E217CD8FEDCB89A10F8861820522 DFq&
438,350,177 *2C6BED2514F5A5560875781625D15DF8EC98B21B [email protected]
438,350,178 *2C6F6BFBFE95ECBA033B55698551A00E6C6B5579 die-ene-roos
438,350,179 *2C6C6813A3F14A27C4FF9D0AB9D1CBE32768D007 DIGBF
438,350,180 *2C63B5180434CD2AB0C990DEFB40194D8A9DC859 SETNASIA0
438,350,181 *2C6E9A0D07DE5F213A65A454B6FC43292CFE84E0 di:%p
438,350,182 *2C6483DCDB35B947FC5CA75F158D1D2AA74E30C9 STAMPS:ALEXANDER
438,350,183 *2C629C0B91D4FD00541E86CF4464C85CF77AD28E SHAW-INSPIRED
438,350,184 *2C6A282ADE90EDA53762975C7067717C0B30C74F dl?"
438,350,185 *2C661BA45907F30D12D0C3F82D62A9F420A04D60 stephenloveme
438,350,186 *2C6EEB98B1262E63AC0C973857355A4E10454F27 STEVECHIQUITA!
438,350,187 *2C69B639817F0CF63E00C0C2B69A006CF758CE18 stewartkowalik
438,350,188 *2C6EC17C1C395823CDCDB154E411C5CE4E74B53A stewartroegner
438,350,189 *2C6B1ABF7D96FD25E4621331DDDE8C18C1F1E61B shortcircuited
438,350,190 *2C644A803A189EE3B76901D8B07FBE8A6A11A368 DONOVAN.YEISLEY
438,350,191 *2C656DB6B31D7A19A2E4A8509CBEF96B5EAF1B52 STORMING.VALHALLA
438,350,192 *2C6EC326572AC7D636666D19CBE5E87E8A8DD478 STRAHLKABEL
438,350,193 *2C6B424172472F2ED8C8C1E0AF226CBEBEADF54B stritolinos
438,350,194 *2C65CB85DCC93BCE799680C111A6D535BF08BAEC studdock's
438,350,195 *2C69412CCD159778492B3D26825A27D78C763036 dougboschert
438,350,196 *2C669742E85292E4C0F006113E4BBA7BF2ACECFC douglasbalezentis
438,350,197 *2C60F87401D3606295A1DA0C217D82378A6E120E SINGAPOREBACKED
438,350,198 *2C6BD38E54C37D2BDE06D0A4D2344C561322B818 SINTONIA.LA.MARAT
438,350,199 *2C681C13EFE8CAFD01FA3513F99CCAEA57478201 [email protected]
438,350,200 *2C6D8D6D47F657B9C762717306E8D02C6CE94EE9 six-grande-marches-et-trios,-dv819:-ii-allegro-ma-non-troppo
438,350,201 *2C6C9C3BE2A2C1B26EA2FA396D3895F923357AF7 DPC24BE9
438,350,202 *2C6C783A547E7F6DB1EA5BE31BC65F1FB4102AF2 SUPERVISEREZ1
438,350,203 *2C6899FBED86C640BAFDFCF0A882EA0865D0DA88 SUSAN COCKRAM
438,350,204 *2C6EA4D910FF5D066A9FF08A1FAA336380DE6CBB SUSKAFOO
438,350,205 *2C64A6DAC03437284EC28FB49590E0319FED5517 DREV&
438,350,206 *2C60441E5C54890C4B0FABCE404CD8EE27B9AA2F slow.sex
438,350,207 *2C6F4A69AB0CEE911BB5A068681F81FBAEBB463E SYDAEMEN7
438,350,208 *2C68706BFFACEA29D4C086E4725B36E65C8094D8 DS=IU
438,350,209 *2C6A76476EA3D493A05832E89560D4C5A766CCDC DTu+
438,350,210 *2C66232A1BC3EDD8C7DBD2D94E6BF1F865742E21 soresoradir
438,350,211 *2C6E645C4F7B39D56E654AC08728ED3B4D8A9237 SOUR_SST
438,350,212 *2C6D4ACCFD31DC444546A8A19B46551D315F1B0E SOUTHWARD4
438,350,213 *2C6979DBCE9A0C1B86BBBE08A9237AD5ACB8B7E9 TALKMILTONMYERS
438,350,214 *2C67CFA207821333598324E9D907DAA2534BB384 spencerreggio
438,350,215 *2C6C336712533C949ED5EB6DDDD1314C28A669EC D+VLQ
438,350,216 *2C6293623B841F32BD7C4C27E45F67BD32487CDE TALOVKCIRTAPPAIRTSUAKCUPP1
438,350,217 *2C67AB8167199ECAC850AAECFB9B8035BB83338D DVUD$
438,350,218 *2C6E62E3BB7C6F394B2EF03E09BF3F5586459265 splat ~` ~`<---q
438,350,219 *2C6DB071018A42DA8E7AD4DB97187B7B4E9B5D37 dx=ti
438,350,220 *2C69FF23DFFC869ECE164B21105060591DEC7687 dylan-spitzer
438,350,221 *2C6E1F35BDBB8513F7340AD6D69C91034A0D108C stalagmiets
438,350,222 *2C65DAC17ADE75FF5B3C7B249D6A8247088B120A TCLIPS13
438,350,223 *2C63D60C30689B33CAD4ECADE391F8298DC7A419 TEALS0
438,350,224 *2C6EDD31407D6FE419125E05B8510FDDB371E5CF STAMOUDERSES
438,350,225 *2C6264C33EC092CF97D0286A22219DB17DF44F1D E(+
438,350,226 *2C67F1FA25360795E2D9BC7E9F5200F1BF228568 EDAAFF68F4B35A30DC0658282E520337-POP1234
438,350,227 *2C674B90DD20A4F24ED113E3D2D98BE6978AA5F2 TETRATIONAT
438,350,228 *2C63756FE33BBCF9BF69826F51285D934359C29F STEVJINGEN4
438,350,229 *2C6E47E87D84338FF7C9F66974C461A35D3FB2D2 st germainenlaye
438,350,230 *2C6C1D137783326E8F6E2FA590D62C440722DD91 EDGAR.TESNOW
438,350,231 *2C6745E91BBB58ED0CBE2C902C78CB654CDC99EA THANATOPSISS5
438,350,232 *2C6153B9AE5445F71F1FA0AB88A660331C33104A ED,GS
438,350,233 *2C6E7CE3E0FAA7646B344A4745D3C0F5B6CD6277 THAT.MACCA7174
438,350,234 *2C6E59385010318D9B8DBE7816E6C6CA893464FC stormsein
438,350,235 *2C607E06D7DC4066A28B3EA44B1DD74610B7957B the.ambulance
438,350,236 *2C622D3E35BC219348B490DE6D2F2242C85CABD9 THEAQUARIUS98
438,350,237 *2C6B02E18C68D038F0859A11BA8C9286434E8263 efmfi
438,350,238 *2C6CED01663608E058DFDCC575E4E7479DA86961 stúdiótelepét
438,350,239 *2C626A7812164181286929CC89EEBE8DBBB70CF4 [email protected]
438,350,240 *2C600E3BA2ADC8E38768A511EDECAFF8E393A385 suoysroc
438,350,241 *2C6AE2715E9CDE31A973C0571D27EABF65143493 THEVELTRONS
438,350,242 *2C60BC5B9CCACEC655D5CF4D2E80EBB84A197C01 the夜もヒッパレにおける出演曲
438,350,243 *2C69CA5DDDAC822A54B84E06D5F5CFC975098576 ELLIOTTFARNELL
438,350,244 *2C6BE3686FD97DB07B0DD91FC7F8D80EDE1B60A9 TIDE.OF.MEMORIES.3
438,350,245 *2C6528A4DDD3DEB03FD23C4B45393DBEE8247D89 [email protected]
438,350,246 *2C63A8190F3C8B4FF5A3E8A467525616608D55BE sydneycrough
438,350,247 *2C663784BE3D6D25430A8772ACB682C36C171898 TKKGDIEFALLEAMFUCHSBACH
438,350,248 *2C6E4499B552EF57AD46995508CB4B0CC37377D9 TNGSFDLNGN
438,350,249 *2C6D40A8365125DF1EC45CCC2B0B44407DA08975 TOBIASBERRIAN
438,350,250 *2C6121D7207C7DA76EBFAA47C1BD75C4AAF0498C SYLVAIN.LANGLOIS
438,350,251 *2C65DDB646EE8D418F8F3D129E171E755BBA1455 SYLVIATATTOO0
438,350,252 *2C6249C66366AB8B9AA95C9FE37D964335BCAF3B TOEGENAAIDEN1
438,350,253 *2C6EB45BB621927E2E87CAFCC7420F32C0239A9C SZÉRIABEÁLLÍTÁSOKNÁL
438,350,254 *2C6924D1882293F26B3224363BAE13EF9B4A5D0A topguncarolina
438,350,255 *2C6409F8984D5325E7F272CCFFB5FF1FC5AEFD7B tpwh
438,350,256 *2C637A002B442431D455D8D9582545EE7453E7FF TALK8517893134
438,350,257 *2C655487A169A61FD25548B894C684D80D6DB1CC TALK86.128.200.45
438,350,258 *2C654171424A0D5411F4588D4C1018AC09E8CFB1 TALKBRANDONMAGDA
438,350,259 *2C62871CD6D02C1B3976A28360A0F85B77EC1097 TALKNNW
438,350,260 *2C60708C924088B4FDC070F5F3DE57DE1F2ABE74 [email protected]
438,350,261 *2C62B7AB41A94B449BF4B9D703050461C8E98B13 TALKXE0N2007
438,350,262 *2C6D43D05CA76B208F5B7DCF6AECBD34F2DF6D66 TRANSVASIONSES
438,350,263 *2C67DBF033B93379ADA3F87C774E32F4C7145033 ephesus34
438,350,264 *2C6725220328867D4C22A08448C4FF504C3BA65C TRICIA-KISOUN
438,350,265 *2C60CFABDA0FAE80463AA326CD551EBFDB49969F E,{R
438,350,266 *2C6387A3E10D20A95030BF94DE6B410225BA4C3C TRNSFSD2
438,350,267 *2C674B6EDCD2CE50C01D3AA7183EBBD2A857A07A TROMPETTE-MUSETTE
438,350,268 *2C68D2E719A70815F963728E9907EE9955E081B3 TAYLORKEATOR
438,350,269 *2C6973D7344A3CA7158B010DEC4677C40C56C0FC TROY-ACS
438,350,270 *2C6CFAD168E7A6D54C4C6702458664F2CA3DA857 TRUDIS LEWIS
438,350,271 *2C6DBCBCB2239C403632AC1A03F8B1930E9E245F TCAS-FURIO
438,350,272 *2C6BBBE19670C7B74A66F496FF630E9A73E0374F tegnst
438,350,273 *2C62E0F7B6A326C7540EB72FCD5E948FAAAF4E0F [email protected]$
438,350,274 *2C68C5935F8AE010347CCD5EDF64C58D3CB16116 TWS20
438,350,275 *2C6B708D17B154566D6E984DE9DA28D3EC9F3517 tyberia
438,350,276 *2C6D0DE6372807F46852B2754F302552349516E7 ETERNITYBUT
438,350,277 *2C69A9B7EE17C2698B8BD80409EB0C69F928FA20 Etude-Tableau, Op 33, No4 (posth) in d: Moderato
438,350,278 *2C6F77280946C7B0A7E7FCFCEE9D8EE621BFCA29 TY VAN SICKEL
438,350,279 *2C63B4324C4734450B7994B82813A944AFF885A8 THE.BANDS.06
438,350,280 *2C6E681E98AAC2F7865E9873451763744658D702 U15041981
438,350,281 *2C6D53A760EDC750A29136C538D63F65FC4AEE77 U9E38FW0E
438,350,282 *2C60D4300B5F95CE6085E67C2BF38FE3E174261A UBMQ
438,350,283 *2C6765517D38FC2CE7ED7E5BA46CA1A06E85CB6B UHAMISHOMI0
438,350,284 *2C65524A5E911E1B58FC8AD5F4FE34BC09CACEDB THEMETOTHEBLUESNO2
438,350,285 *2C691A80F27C2DEE3C97839E5C065FECC5A6ECED THERESA-MEARES
438,350,286 *2C63BD72C03FDFE501901C729BD2878874C7B2C6 [email protected]
438,350,287 *2C69164E2812882F51F487A673DCCF8A2B8790D1 ulfa-rajkhowa
438,350,288 *2C6EC4433FCE8857A6A617CD142D196B288B7CF2 [email protected]
438,350,289 *2C6CE4BD476AF45F92B7D695472EBAACAE145A08 ULULATI2
438,350,290 *2C643F44ED6C6E69CDC17D467B0B803332260F27 unamcdonnell
438,350,291 *2C6649A4F70E767F04F5FE3740185BEB1C700996 f7$l
438,350,292 *2C6A6519FA3BDD1F77D090F455FF2A542D41EBAC THISPARSIFAL
438,350,293 *2C63190681F88B87651F8F189C18BED628B60D9F [email protected]
438,350,294 *2C6FAD4490B9D0B5A95AF09DE736366453A0090F [email protected]
438,350,295 *2C6BFE939A4F761BF2AC179C75AB4556E2CF00B5 FAUSTINODACAMARA
438,350,296 *2C66720E1A80FD094BF596D4E76E9C31178DAA4C ungeheuer9
438,350,297 *2C6CF73A2879F1BDE06F9F3E8BF3963303A7FDBD UNNI.JAKOBSEN
438,350,298 *2C646784DCA8EB2FC75AB28EE1626F0F52FAD114 unseductive5
438,350,299 *2C61CA26B009700DCBE7FC2295A415F7E0CB739A TITAANISUOMAL2
438,350,300 *2C6D4C0A9F1BD6016662C8439BD1C9AA680551DB tituslamagna
438,350,301 *2C616C07F09C0CD48ACE32106BC994515987036F TJEPTJUGOV
438,350,302 *2C65885FDA62795E1FD0EE6CCC13BE9D3C80F8A6 FGHALEEB
438,350,303 *2C68B15BD586554DCD5A6A5A9C7A571586CDC439 [email protected]
438,350,304 *2C64B62C07CBCEFA43D7E1919556EDF0AAB0AD23 TMATUTO
438,350,305 *2C66D48FE0BE2CC2465ADD43418B9D8A5CF89B7E tobiaspascarelli
438,350,306 *2C6D2E69F0364B8D1DBE82B44F45B52B0FDCC78A FINAL-DEL-JUEGO
438,350,307 *2C6AEC8DBD6D7453632F36AC41D4C67D4FB85ED9 TOKOMPONENTLIMES3
438,350,308 *2C64811EC5B449C58F9DFA94C866EA5B4EF5004E UZDROWIENIA3
438,350,309 *2C6C5770F30AB6DBFD349CF35D326F4CBA45AA38 flight (robocop vs terminator - cd)
438,350,310 *2C66B421BEF57B1C8BDBE7C605B34426D2516E5E [email protected]
438,350,311 *2C62D495168ABC65D10E7BBA6250072732C95071 FOOTBALL-ZVEZDA
438,350,312 *2C60109C8866ACFF6A966F30312C123A42332B24 TQ177110
438,350,313 *2C64742ED566F67B9840EB786A3A5705ABC5E2B9 TRENAPERRY
438,350,314 *2C6F33FE20D04F7C4E02F8EAA4080FDB526B9FA4 VAN-HULS
438,350,315 *2C6E80241E40BE85E41CBA918081FB29C8047FC9 trentonetter
438,350,316 *2C6D953E13722966B65A63292C7DECEC359C66F4 VAUGHN-SEAMON
438,350,317 *2C688BFBE4DDCFBF12E919C063ABA80E2A73E782 v!br4nce$
438,350,318 *2C65B636B3FE562734C150580C7B6D1257B81D07 fredricksliter
438,350,319 *2C6CE568A20F97865968FBE5E302F96BF6B53079 FRIPPONNERIE
438,350,320 *2C67BC83E7E1BF501AA8F37AFE84963FEBEEC8AC tronfoelger
438,350,321 *2C650B9B0A8F6E50982A17C2BCE9B72DD555AABF vengeanceismine
438,350,322 *2C686BE13BD958E749E8816EC0EA3887D2A859C4 TTALIOAGA
438,350,323 *2C6253C62C7296CE2ACB2634E359E9A40A3C0D3F [email protected]
438,350,324 *2C61C1CA8B58FA19F8DC402322AD8C0FA13DE6E0 vertriebskanalmanagement
438,350,325 *2C672A0C20C9AC73FCEB64AC8BC5BBC06D075C75 gaiden)將在1999年8月27日秋季東京遊戲展
438,350,326 *2C64C6FA501DF297AF12EC5636EE2991EFB9EB8E victoria-patalakha
438,350,327 *2C63AA739698996C2F7F7E36EE786F606967030F VIDEL-MONTEMAYOR
438,350,328 *2C67095D9B66702DF9AE08CD87E703D4C86A9624 viellechansonirlandaise
438,350,329 *2C696AA3D395A2B5D3C54EC5FEE6A66AA8843D91 TYRONE-BURROWES
438,350,330 *2C6EBF00BD1227561F3830ECF7CDCB9DA2510B42 TYRONE.SCHMIERER
438,350,331 *2C674A6D5B25F586668654DD156F832A122A4FED TYSON.OKONIEWSKI
438,350,332 *2C6008CA85EEC600819F47A35CE3493E9EEB2CED garrett.blakely
438,350,333 *2C6F6A3E0291C9CEBF0D67745F87CE5D2CA8FA0A UBRIZGAO
438,350,334 *2C697D31B791506E8376E737BB6700ED9A78D86F viewviewing
438,350,335 *2C65232B812C0C0BCC39D1B73F303BE4BE2096B6 VINCEBERGMANN
438,350,336 *2C692CEBA4BDFC2609EF7F87515510C7A7AA0F7C GENARO.KRAIG
438,350,337 *2C60D5AC97CE78CD0C7781E6CB46AC6706F22570 genarokrejsa
438,350,338 *2C6985A2ED97F68B77F1C8DC7A55D785C6E5679D U"JJ
438,350,339 *2C61E37A0C851D6C976CB6D58E3A0F6B12433C6E UNAIZAHXAIN
438,350,340 *2C69066EF5606111A7D23B1C0D04157B5DF4C4E3 virginia-tovalin
438,350,341 *2C651DD9311F99992308B3CF125BA27D8D87EAB8 GILBERT.VO
438,350,342 *2C6F8C21D87F3F90697F6E484E1BC01C95137897 giorgi-berishvili
438,350,343 *2C604B475813FDBFC05CDB9FD7DB4C39ABE4ECE9 give.me.every.little.thing
438,350,344 *2C6FC6C8BF371D8B64B821E4EEF659B043D4BF6C GLESSNER123
438,350,345 *2C6492D3740943C291F601EC4AAF09FE574F5C64 GNIREHTAGEROF
438,350,346 *2C6C8CD81BD5E2851BE79D64F03D3D740D4EF375 GOING BACK TO P TO CAPTURE THAT BRAIN
438,350,347 *2C6E64708C15E82921630E8FABB18A4E7537306A GREGVARLOTTA
438,350,348 *2C6BAACFB2E6D1623CB1436922A759AB1C2B07EC G'S9
438,350,349 *2C671558E8389F6C796D1808131393D034BFD24D VOORVECHTSTERSES8
438,350,350 *2C6880907A2C049EFD5E1E4640612314E72701C8 URDINEZES
438,350,351 *2C6DCF2DABB46CBD6F05869B7FCF1818E29E9F11 [email protected]
438,350,352 *2C627D251B0DC1E9915711B16E4F5494A3B9915F ursonegroasi
438,350,353 *2C6BFCDF142F3A7797E5D19F2B20383E6DC70912 USMAN DANFODIO
438,350,354 *2C6B86FC37AAC3696F440D5E10EC3975F441E788 GW3N37H
438,350,355 *2C6E429114AA28D1F4A7F6E461D40EDAFA0A2EF2 [email protected]$ne$$
438,350,356 *2C61BE2DE13946E513F15446CBF0FE7DD5139BE2 UUDEMPIEN6
438,350,357 *2C64096FAD27EFBA8764E81ED29E9F8DC9B7E73D HAL.SHAMEL
438,350,358 *2C6AE6E0F5E4D28DCFF5713D996DEC9B35378C43 WAGIMAN OMPONG
438,350,359 *2C658AE58DD4E835EB26F26C02223711B9E9DEF0 UYLJCLKAZ6
438,350,360 *2C6293ED777D83E6FB367A061CF4360A485E658B HAND.ON.IT
438,350,361 *2C67C1AA35032A4C88FA24A51009473C0EC98361 VAITARNA
438,350,362 *2C65D1C478B8AF9AC39E6E66ABA17A57A2344E50 WALLEYEPYTHON3
438,350,363 *2C63EA1252B81E427EE0468E60C266D9FB62532A „HARLEY
438,350,364 *2C6852C404CB952F01FAF0A824499DD99A825FAD waltonschenfeld
438,350,365 *2C671EEDEA90E294CC161C19CA1480D2C771376D [email protected]
438,350,366 *2C62CAD07E5551D1698A4277525D80502B362ECD HARVEYSHAWGO
438,350,367 *2C691CF96C756A8EFBF5E4FCAD1B21CCA9BFA860 hasici
438,350,368 *2C67F1FDA88D40FA145A534AB93DAE582004143F HCANARY.YELLOW
438,350,369 *2C641111401EE315A05282FEFE01E99C8D53428E VAREIASES
438,350,370 *2C695F17360ECEDC70E06E490FE0F14E3C408D47 varsha.nagarajan
438,350,371 *2C66B79D339950A5C947B4C96BDA3C9710004897 HEARTBREAK-BOOTCAMP-NYC-AN-EXTRAORDINARY-SIX-WEEK-PROGRAM-TO-GET-OVER-A-BREAKUP-AND-GET-ON-WITH-LIFE
438,350,372 *2C66535C7AFDA141C43BD0A38C167A6B8720E235 [email protected]
438,350,373 *2C6AEB70B5B5FFF5E1DEA10E40E7B2B18687584F heribertodoughtery
438,350,374 *2C6BCEBADC614E1A2DEB9A2411F089858EE8C47A VERMYLYONED
438,350,375 *2C67820A078BFE2CF8F2FCABA9D8E2CA3583A450 heyhowmyjohnnylad
438,350,376 *2C66450B7323273869A1F8241027B6C9591AA066 WEAKNESS--ASK
438,350,377 *2C6F689DF2EC9088330F3626D847163255F91756 hiltonreiche
438,350,378 *2C68412CB5DB1552326B3C572D264833B3A83EB4 VERONICA MUCCINO
438,350,379 *2C698E18A5ED16386163A00D39D18C2CAC2CC98A HIRAM.KABLER
438,350,380 *2C696D48111A78290C21999B9C2A20398161CCDA VERTEIDIGERDUOS
438,350,381 *2C66A0126F65C930C5C5DD3343A984859652F00F HMUTEDE
438,350,382 *2C68E75AB83DF8A81D7F0787114DC7911A6D270C HollywoodAfterDark
438,350,383 *2C6789A311995C25E303FE0C329D6F823565DFF4 HORACIO.AUSTON
438,350,384 *2C6A00FF0BFF2EAEE375FB288F2D73554C8F46B3 viisaus9
438,350,385 *2C623F2A93C873A00E5FB050956E39AB5DAA119A VINCESCHMIT
438,350,386 *2C6C9785D4962646AAD2FDF8C29F303D6E3BCAAC hueycondelario
438,350,387 *2C6273E74BFD50387F659D6FA761BEA0DD653568 HUGAORAO
438,350,388 *2C605EC9D126B4823DF8B3624DF659AEF56F697F HUGOCID
438,350,389 *2C6EA5591219D5241D22E68E87E8B4B221472D03 VIOLETMEDINAPILA
438,350,390 *2C6B4C1B863BAFC22CCEB61A5F398C0CCADF1807 WHITNEYDUEY
438,350,391 *2C6ADE5A2F3AB843B9FE7D1E9B6661B2CA2474C9 HYDRAZOI3
438,350,392 *2C6A82EAF6F99B415D166418F5F11368E83DA626 WHITNEY-LA-ROSE-JORDAN
438,350,393 *2C6417D96F3486F9ACD9160CE812D52EF8771810 HYDROXYANILINO
438,350,394 *2C61171A5F5265D4E2168D32F2AE79E56F88F1F0 i ain
438,350,395 *2C633E26C225870C80598706C2264C4F45FA92E3 WILDCATRICHARD
438,350,396 *2C602F70B2E3DE652FE0AB0BBCC2784D5D54E583 ICKBACKS5
438,350,397 *2C62442FF9DEE621E92ADF62AFDD984E86DFA4AB icoltrane6
438,350,398 *2C630A11C64C529C19B357A07C4DA6CC1C835EE0 [email protected]
438,350,399 *2C6C154D7F0472A93F4C9FC01FB661EA8B62D548 WONDERSPREUKEN
438,350,400 *2C6295D5F2A5C974D0A5108B69213A534CD18FD9 WOREDEMELAK.G.ABEBAW
438,350,401 *2C6494ABF59B033632AC2728179371809089D9F7 waluyo-setiono
438,350,402 *2C674F2945669C8A812C142A8F169F8194CF224D ILUVBILLY47
438,350,403 *2C644B8D1C7E86B796BC46518F04F7F3DA25F63B iluvphillips2007
438,350,404 *2C628FD19B6225B4557F1C894EF91ED9133EE1A1 WARNEREK
438,350,405 *2C6D61177ABCE9BA72B986DA2D45849BC6B80E96 wwwnycbeerorg
438,350,406 *2C6C9B28B3E50C5C639F03D0272232C3387BC4E3 WWWNYSDENTALORG
438,350,407 *2C6EF6DFFF389D155EBC3143896CB0D8B3B5B046 ÎMPLETITURILOR
438,350,408 *2C6417A61F945F3B1CB7CCBCDC4D3102FFB8121F IN73RDI$CIPLIN4RY
438,350,409 *2C64F03DDB7CFB5FB6701D0D0212D182D94689D2 INBUF.)
438,350,410 *2C64BEAA4CFB0A01787887D9E5726C5D0F6343D8 $ING13TH
438,350,411 *2C6CAA3678708EBF3CBC3A0DFAB1BAB12950C086 WEEKNUM
438,350,412 *2C658F92C2A5EDA1519FFF8188016C7A8D3D7F51 inshiningarmor
438,350,413 *2C61DACAE39AA0F305C93515D9D54F9278324590 WENDYSTINE
438,350,414 *2C6C6C9870CC1C86C0CAB105E77CEA2141B54408 IRA.DOWSE
438,350,415 *2C64520B752B287D8273525562FAF8F0D69DC744 irenedolphin
438,350,416 *2C6C862A93757A48A4C39533816F53608692ABCA ISMAEL.HARRINGTON
438,350,417 *2C65E580927B4A9BEC508211CF67599A8477A80F Ismailerdem
438,350,418 *2C6B6FC8CEFF2307CC5F7A31690BA4F0567D8BB3 ivopapasov&yuriyunakov
438,350,419 *2C6EFF37C2D08E140A8CCC985FF304D6D2AC9A12 WILFORDSCHOLTENS
438,350,420 *2C6C885D6FFAC379BC08CDECF0CD5DF0A6A74797 Yingjieh
438,350,421 *2C692F0FEA36F2F5EB3EB05BF88B077206DFEC01 WILLIEKAMU
438,350,422 *2C686485E5BA862F33DB7C32D55F6C0FF7FE96EF WILLYNDERITU
438,350,423 *2C6E5F514E63132D55316D3CD2E3F3DFB58EB8EF YOLANDI-GRAHAM
438,350,424 *2C64BDC9D30A0C0D2072B5D1D7166A1140633AF1 JAEDATY
438,350,425 *2C66E30FB7E87EC5E463190154F331ADF940F56D jakearreguin
438,350,426 *2C60D344B663B613319E9602D78D6B7CB66A7FCB JAMAALEASTERWOOD
438,350,427 *2C6B1A862C8DEDCD7B9BB7B5B170A7207CC938CD james.esquilin
438,350,428 *2C6B2E24766BFF6B26E0FA686CE973372403E94C yreneannetaguiam
438,350,429 *2C64AAFC3CB4697CFFC3CB5FCB74544EAF518D2D YSMAILLE2
438,350,430 *2C6000B99E9E2FDD47AAC4189CBAAD2B7E451EF3 WINTER1933
438,350,431 *2C6A8AE8046FEC6FF21E4443DF2610290A87EDCE JAMISONCHIERA
438,350,432 *2C6A2082370B8C7B083337A34071D1781901E370 [email protected]
438,350,433 *2C6477245F8210EC76233E5E3DB655507035F35E janaschoff
438,350,434 *2C69A2C23B5FE38196E561D9723ECB82C0EC9021 YULIAVAZQUEZ
438,350,435 *2C645516D3612F75E5982B0777215C3D0A885EC6 JANINE RENTERIA
438,350,436 *2C65BD21CD8B27A94CA7FD8EA5A234DC2E57C530 WJDGNSL11
438,350,437 *2C6EA47D0D36D248EB21C7C35231BB424B37825C WOMAN1ZES
438,350,438 *2C6290ED7332C5CC51F1EF1C7119496D55FA626C ZAHID BIN A ROUF
438,350,439 *2C63D4815CBDA8B4E8667C4953DE02EC24882D48 [email protected]
438,350,440 *2C60BAD0A502163FFA96694AC0D48D8B29E5F5D3 [email protected]
438,350,441 *2C66FB99F76295F487218648BB90F4AF4128BD4D ZAMI.HOSSAIN
438,350,442 *2C6CEC2306E046663E3D47D45E8E25CB77A4C5F8 jdcollectorspage
438,350,443 *2C6DD68B1DE1FC6FA58CE085224998A7B4F040FF ZEITEUQA
438,350,444 *2C628381F67A0A719458C8443EF6D95E17B52E3A [email protected]
438,350,445 *2C6FE667B2C45B736C15AD3CA18EF7B87AC2FF8D [email protected]
438,350,446 *2C6E1963C39EA6744A31A054B02496C48B64426D jeffcluckey
438,350,447 *2C6CCADDBE32F1FF64B9AFAC19B28F86C07BDA1D WWW.AFTERABORTION.OR
438,350,448 *2C65AA0001F12A20626EC69E21F665ADE092FAF6 JEHINNIMS
438,350,449 *2C6705EBCCBAC1910EB58F7B9F8A293402617079 WWW.PELS.CA.GOV
438,350,450 *2C60DA12450ED12BBE70B15CC946E9346E129B48 wwwviolentde
438,350,451 *2C679C4445CF013D9251069229638899912973D2 WWW.WAXHAWCATALYST.COM
438,350,452 *2C6B11A347D4829210DD6CC424758D26F82A636E [email protected]
438,350,453 *2C6B18017DD1A9D5FE2EC730F8CDF25F800D4160 [email protected]
438,350,454 *2C68C174977F125152BDE7C7F8F7E3855E8223C3 JEROMEENGELHAUPT
438,350,455 *2C6376903A68090AE6B831C11AD69C6612E2D2B7 JEROME.MONT
438,350,456 *2C6D8FC84FEC087D6BE44F19150D4BFDE993ED10 JERRELL.HEGGE
438,350,457 *2C66312078B0CB134CD721E0F4D47C51720695EB JERROD.DEMAYO
438,350,458 *2C6EE2720B12DBDD566E479ADD480B530273BDCC JERROLD.FENIMORE
438,350,459 *2C6D57B35BD2C5C38E57357E49AEF2C9AFCBE4A6 jerrysantee
438,350,460 *2C6E6B3701B6E68CED63B533152A3DD382A0B5FE [email protected]
438,350,461 *2C6558F9931C4A90581BCF86047D9E701E8F3E42 XAGNO
438,350,462 *2C60AD9E47873F36555D87DA0294D7473C51B2A0 [email protected]
438,350,463 *2C6CBB7FF4E56FB01DF919BF600A63AF0E2F6D01 [email protected]
438,350,464 *2C668C480FD3D7E1B5653CB9BB3B60011E8FB7B9 ZLOMUTAIS
438,350,465 *2C66C4C41981B165C1470BA46F464A2C72377052 zmarsumarno
438,350,466 *2C605550ED3BB25A8C7B7670F805988AFC34059B [email protected]
438,350,467 *2C6E15EEE0F32D1F45AC9BECE2CB67AE0B013055 zquareppants.beta
438,350,468 *2C60F45B631027F38E14D2BCFE80D6A2821E0F9B ji49
438,350,469 *2C6565BD870C54DA0D8A087D9A284543ED5DD38B ZWSCHEN
438,350,470 *2C6F7C6AD2C6CEE0C9FD7AC9E7E4CEB9CC9A9F5C }X{O~0~(=====8
438,350,471 *2C6A49D542BEBF652E742DBA7521B08BDD9235C4 xuecnomtsreh
438,350,472 *2C6A136B67B584A3C4A2BD66731C1D717811EE7B JMYSAFF
438,350,473 *2C668019F0D7F743B37DF628BC3F4E1E26047516 [email protected]
438,350,474 *2C60698046450EE310991CEC45F89CE36CB2A5DF [email protected]
438,350,475 *2C6E940B5D83C04339CA23265FD72DEE824B4671 JOHNATHAN.CRIPPIN
438,350,476 *2C6D66EA00304968286686246A3F2624964ABCF1 YAJHZ-FRANCISCO
438,350,477 *2C6A1566811BB204E82778B8EA16FF09EC0DA03C YANNIS SKARMOUTSOS
438,350,478 *2C603F13CA29CFF6C05A3B4DD8BC751C0D1645B0 yanxiamanqui
438,350,479 *2C6E904D34F8A41722B69362B126F3809F76AAED [email protected]
438,350,480 *2C6E952D9BC610284188F292DEAC0B702FF59556 JORDAN.CALHOON
438,350,481 *2C672AEE6D23E3BBD0256405CDA6A4ECC46CA0DB jordanseymoure
438,350,482 *2C684AC1651F3BFEF73FAF14F55196A308FFE005 yazaki-mamagang
438,350,483 *2C6D556B98AEA1735FEBCB0A2B3C92BB4532D3D5 ЖЕЛЫБИН
438,350,484 *2C6E9961FF1E1AA2794A142BB951BE221B582CEE ЛИТОГРАФИИ»
438,350,485 *2C67A985B5173ACC70A784349E1AA6B38F98CA68 yciewtwoichr
438,350,486 *2C6251C5282ED0DA09986156B6C5F8FC567CEA59 YENNIGER
438,350,487 *2C6BD928E5C52064FEEFE595A308FFE74B3F7BD2 JOSUE.HOBLIT
438,350,488 *2C6FD85F99588D72C5EBA2D91F8F62AA64C2B1D2 yhteen
438,350,489 *2C62218A527FE6685C160BBCF860B8A4C27E216A рари —
438,350,490 *2C65CFB670CFF247F2744EFAEE00E4CBB3667EFE JUANDI2020
438,350,491 *2C67D4F27837873DD1C9A80A6BBBB4274529CD63 JUAN.SANTERAMO
438,350,492 *2C645F5669AE6950CF40E48A93293268AD9E726C YOSEMITEY7
438,350,493 *2C6F97F53F820AED0ED974F2021B9D30EC101444 YOUBREAKMINETOO
438,350,494 *2C6B6BC805DD3C456ECE1469A7A3C6D354D865C2 УСТРЕМЯВАЛА
438,350,495 *2C63FEA73CF7DBCE7A37A8B00EE7D7733D4F30D5 YOU'RETHEONLYDANCER
438,350,496 *2C67DAA9326D82AD9FFDA05E2BF0963DDB76DC27 ypocratis
438,350,497 *2C68418CF127D4DD7FD95B006711273F6FB08C88 juniorbartus
438,350,498 *2C6A5CD9401076C85082B2E8ADD6BC8B20DFF858 [email protected]
438,350,499 *2C648369200B825BD6A73D7AE547BAD3B639FE91 ЭПИГ
438,350,500 *2C6DC37BFA8C78A742C0FBD61B35B923171C5972 justin-darty
438,350,501 *2C629E81F5E5384DF4ABB4296B65FB3F1CD5D3AB その中でFNS局対抗企画として2年連続で開催した三輪車12時間耐久レースで大会委員長を務めた。
438,350,502 *2C68A6CECD1E937E0C410890AE293909E200CA8E YUTTHANAR
438,350,503 *2C60EBF124A51E7463630C1912E855E9E213353B k6w8
438,350,504 *2C63EB6BE3EEF6F1776AAF581C04263DF5991821 ZACK.GROSHENS
438,350,505 *2C6AC1DDAB42BD9B4E45E6EFCB247D10F7F94FA2 kappalil
438,350,506 *2C6B70FCF96F4E290FBEAEE826FBA769F40EFD79 zanestandiford
438,350,507 *2C60185E07A7CEA1C61B80B0C2F64AB344365855 katie-kimrey
438,350,508 *2C6CB29C98DA2C679BF430518CEC3032B6A1887F ZEÊBODEM
438,350,509 *2C6F14CE1BE52A60796D4239A1282437AB8DF99D kaylamorgan
438,350,510 *2C6AAB82672EC6B61A9D833793277976A3A52DCF zevendedags
438,350,511 *2C66FB01241F899B70627B5ED3B7F958B2CFFD35 kenji-kusanagi
438,350,512 *2C684E3A1DCE507C1B279949F23580D27045E718 zhongfjbbs
438,350,513 *2C6B16CA0F2877B4118E3B3DF556A4FD96DF137D KENTON.LISITANO
438,350,514 *2C6047C3D780E54177A22FAC1C1F18BFBF0002CE zilatalib
438,350,515 *2C6DAD8EA0D74A71D0804A4A6DFE12324048529F KEVINGHANAYEM
438,350,516 *2C6EA468C34F95861EA7A88442AB81B000D4F32F ZK0D
438,350,517 *2C6F08AB6BA17E381C9CD9F3C22D2F09B3970743 ZOE.CRAVEN
438,350,518 *2C611E7B039954837B3363DB35ABB2F14AD4E174 [email protected]
438,350,519 *2C673439E3DF5722A4FB7CF26E4ACB1D96FAF303 KIRKMARASCALCO
438,350,520 *2C6695C89C4B6386CA63B648ED0460A35D76DBAB kmplktnring
438,350,521 *2C6BDA2AC9DC20B2B68CCD4874D60A81ABCEE05F ΠΟΜΆΖΟΥΝ
438,350,522 *2C66D91335FE8BBA6ADC266A316B7F1A6F3E9E89 ВОЗМЕСТИТЬ
438,350,523 *2C631EFD1356B5257E5A81E94AFFF76C9D1368F8 KRISTOPHERFUERSTENBERG
438,350,524 *2C6EE173CFFE0C9A36A8AC82E245B923FA8706A1 k<S
438,350,525 *2C6C1E16C4F1DF81CAD9DCE966EDCEB4AF414634 KW8H
438,350,526 *2C696F3DAAD80170850FE42BC1DDA6BEDF3FA010 董事長:SCOTT
438,350,527 *2C63828B815FD66E86181C36E8EF08150B253B42 «МИСЛИВЦЯМИ»
438,350,528 *2C6781666FCCE64F8841BA40FEACCB8CC423A1CC НЕМЫШЛЯНСКОЙ
438,350,529 *2C61D02220C8DF5C5E39D211096519B75EA5A396 LAMONTBERSON
438,350,530 *2C6740474CB2B85C7988D6E3DCF7DEA6AD8C2DD6 LANDROVAL
438,350,531 *2C678B8C2C4EB9F2F80C2A09A79498B3E342D09E LAURENCE.HOLLARN
438,350,532 *2C69391AFC30FA42B70561D38D5ED9E5351CFDF9 РОЗТОПИВСЯ
438,350,533 *2C67222CEFD3AA7F3C666FF925024C03B6693642 РОССЕЛАНДОМ
438,350,534 *2C64A2F544C9F8CEB6FF871BD62086E480253D5E LAZYBALL
438,350,535 *2C645E2CEA0607EA342033791FEE617EBDC81972 led.mig
438,350,536 *2C60681F23E85E17F2D087FA1B4E247F37D45E34 ЭТНОПРОЦЕССОВ
438,350,537 *2C62BA7C975D082B420E4588CD77A8D2D6A3FEE0 leonelstamnos
438,350,538 *2C6DB673139230327116F5F2DD53021622BDBFE5 LEONEL.STARLING
438,350,539 *2C67C2E9C5638DFF2C3A6B2DA1A47E29548D0124 LESS.THAN.EFFORTLESS
438,350,540 *2C66BCADBF7AF02EBDA8618956905F0CEAF1CE8D linowarwick
438,350,541 *2C66EFF790FE5FF0C8F4AD68ACE773DD35494E35 [email protected]
438,350,542 *2C6ECA9C0AF32C84AC6E21C327F2A9AA9FC8545C LINWOOD.KEBERT
438,350,543 *2C65700EE66770738CD2EABF6FCF4BC0D5B70208 [email protected]
438,350,544 *2C6E702855FD01B8C173CA0BEB669D640DB9657A lobsterrecords
438,350,545 *2C697952838DEA08A3FDE789FF703F8EBFF80204 LOUISGREENBLATT
438,350,546 *2C6EEC9E8D28A4FF0B6353346BC0CE8CD117F36B LOUKAHN
438,350,547 *2C6866D459E231311D9F8359DD8DA7F7E5050917 [email protected]
438,350,548 *2C611C834CAEB438DD30F00D837F85767EBD2684 1997 セリエc1 13位
438,350,549 *2C6FCC9794DF4D37A0942AEE935C0CADD82F69C2 MAP中的分流
438,350,550 *2C633A576D010B8740B32831CC93A0CEA76E98F0 MARMAĆEJ
438,350,551 *2C63ADA912C2FB2569D8689FEF821F39BB285FC0 1antoniazza
438,350,552 *2C6B7E10DC610F476641E3A2EBF960F6BBA35971 1.classicsoul
438,350,553 *2C66FCDA9A60B01EC598A9F5CF2EDDE1A63E51BD MAXWELL.MCKNEELY
438,350,554 *2C682891B006F7B1B0E797C10EA020AB99AE7138 mcewens
438,350,555 *2C63EEE3716C845C510040AA6A6F2576943AD354 MEGAN.BENNICOFF
438,350,556 *2C6976534A799553E87F1B49C1D54C34C1A914EB 1-footballfreunde
438,350,557 *2C65297C3229726CFFBC61800319546308B388C7 1IAMWINNIETHEPOOH
438,350,558 *2C60B6DAE63E7CA51A5DC95D4FA84EBF02655655 michaelgazley
438,350,559 *2C6A17DDA47F4CB593CB53DE9FBD472E20169F29 MICHEL.MCCLOSKY
438,350,560 *2C69D43CD8754C4F11ED20C612154DDD3D8EAE7F MICROMEGA
438,350,561 *2C6B1115AC4798C70286D2A6F5C0FE86E07CCE37 MINGTOY
438,350,562 *2C635EC99376BFFF67A48A04CA431387D7D7F281 minhstabb
438,350,563 *2C6BE1EB6653161FCD70FE0F2FB91F6BCB2B00CC 1.restauroijan
438,350,564 *2C6CE4999F147AED110BE6E00C99B9F740C62D07 1.SOCHAUX-MARTIGUES
438,350,565 *2C692AD66514EAA009E3D99F0A28EC5F8383F815 modeves4
438,350,566 *2C69675D2E860A87741577EDBED25E565D038237 1TORTURE-MURDERS
438,350,567 *2C60C1A64F6AFD559A750BCFF3DED9B4A07FB6FE MOHAMMAD.THOMLEY
438,350,568 *2C6E694E366A5582100C306AE425E10B89393A5B 14018581X
438,350,569 *2C6FE3E89D8772814610F58CA0FCF391D0F4A06D monetcfj
438,350,570 *2C6753EF597DB528FA38044ACFE278046E12BB69 1.windenergiefonds
438,350,571 *2C679212959A88EFDD39E71B73C51F0E6241BD4C moonflavor
438,350,572 *2C6E420DCAF273B297664F2EF58819CEA58E96EE 2237460 emme.valitettavasti.voi.lyhyell
438,350,573 *2C680748FEADDBC9D70259C86420701DBE489F1D 261755 IHMISET JOIVAT KAHVIA TAI JOTAIN KYLM
438,350,574 *2C62CD96CA9AE6AE057065845E47A5F22E88E8FD 1618853 koilliskeskuksen-osayleiskaavaluonnos-on-laadittu-maank
438,350,575 *2C66427BB3B9061D1E50863B2801C9EB772175DE 1636830 eniten liikkumisreseptej
438,350,576 *2C6B7C95A13965E554F8486B888D4A04D9166608 2736629 put.every.major.publisher.in.jail.?."
438,350,577 *2C6297CEF6AEF10BBBFC9D02E0DCC896A06CAE12 16ORGAN
438,350,578 *2C6BB0F21A4C84B297A7D2E676F93547688C871F music.of.takemitsu
438,350,579 *2C6E491E29888B44BC57CFEB7BA2441A93734D0F 2842644 jari-ehnrooth-k
438,350,580 *2C6E7582F74D96901F5DB077327F233E59F39E6E 2DOKUMENTI
438,350,581 *2C6C196326DE670EE862786F669671F1DC6A33CC 2 ILISIKTEDIR
438,350,582 *2C67F35B459A4082C56BE001AC500014F11D8B8C nevillemaxie
438,350,583 *2C64E0C35DA3C50E95AF440C8C07C2BFFA6709C8 1 BETONSTEINE
438,350,584 *2C6E7416D2D7646A90CA00CC3068D1C0FA5F9E4F NFMINUTENMUTTI
438,350,585 *2C69403513816D51D56F28EE98AFA4C24472A5B0 2.phoenix-vorstandschef
438,350,586 *2C62508FE06E080146E169392E138A2961B5252A nickolasmoores
438,350,587 *2C6DDCD869E6109FCF7FD7AE712B4A8851B76305 1drop-by-after-fishing
438,350,588 *2C6915D5DE36634C7DD8CD5AC03044CEA04EF0CC 2-SUSPECT
438,350,589 *2C68F3CE4A2CF0A0B13B1D5ACCAD449570F4F850 1-ex-detective
438,350,590 *2C6AA30D648F50914C9E9180CAF13F94C2289189 2-ZUKRIEGT
438,350,591 *2C6A7D95EC839E81BB3E8E345759B4C198E99A41 1hein
438,350,592 *2C69C26E2F9602F8EACD9CB5324C7604F83952D3 1HUHTI-SYYSKUUN
438,350,593 *2C68B7A4ABFED523C4C69B1764670AF665F4E584 1 IISSSTUDIE
438,350,594 *2C66F3C4EE1B7616B610E545B7A60CCB0FC24352 1ILUVJOKER8
438,350,595 *2C6096939920C3652A86963C22613A383FFF6E3E 350251 gab.es.solidaritaet.unter.den.haeftlingen.?
438,350,596 *2C69DBED3147EE545E403D4224538201190467C7 361901 N
438,350,597 *2C61166F67C0B404D6C7696C8C22F44A5E8097AA 1-kurulu'nunsecimi
438,350,598 *2C6D0FE6AC80BD5C2109076D41B3267BD77D3F39 1LACHWAFFE
438,350,599 *2C6F8DEE854130E68FE9D788BDC97861E502A547 1.lawyer-turned-art
438,350,600 *2C61237C9E9115B5A72109254DC0CCF5028B6D78 1LEGALIZATIONS
438,350,601 *2C63CDCE034EE60A85710FC16541DCD2703D3D6B NOTHUGHT
438,350,602 *2C6779486916CECE1AD570D1C47D67978431DDB4 not-see
438,350,603 *2C6821F7B42E8B2B197E627263E56865655C771F 1-multasekoittamoa
438,350,604 *2C61BEA01AE5EF1478FC1BAB27077682069A5E12 37 tietoj
438,350,605 *2C67FC96B0C6244343D69217910169818896ACD7 1naapurimmekin
438,350,606 *2C698810DA7034C024702D2CC6ECF17EE360E87F nylon.room
438,350,607 *2C6039431E296189CBA5FE4280DD951C21E4D192 [O%AAA
438,350,608 *2C6B6AFD84E67921EA28E6502BBFA7295FD085E1 1QUELLENGEBIETE
438,350,609 *2C64C5D036597297863A3B5D718399D0C06933DC OCEANMASTER.COMWWW
438,350,610 *2C695649531EEF456BE8B3B625DCBC1FE050C65F odellsiglar
438,350,611 *2C674C5059F7F9C12C2896CEA3EA9208A07135F1 ODETOBUFFY
438,350,612 *2C60E0CF6E521ADDE90F61BB0121C98D71633FAB OKAKURAED
438,350,613 *2C649BD34209391A5A0543F4B784EF7FC3316126 3lions8
438,350,614 *2C63E85A3C5472B26533531E1715C828A8DD73D1 OLLIELEMICK
438,350,615 *2C618158EE16C6B5600D2782CAE6A4B581FB499A 1.supistetusti
438,350,616 *2C64D5B62F3BEA42E23D06EAFE21E2D5976FCC58 1 TAMPEREEN-K
438,350,617 *2C6556B42B26716D1D6CE89CA38AA77F5332F9C4 omer-rajput
438,350,618 *2C69184D928C1FB22711A7F82487DD583A8E4145 ORLANDOVOIGHTS
438,350,619 *2C6CC3BE874A69BA00F9DA06979C398E0C8C110B ORTROGODOS
438,350,620 *2C60473E645197BD9BF92839C3E190B464E53958 1VOIMATAKAISINKYTKENT
438,350,621 *2C6C20D2686B4AB619E56739A16CB335B99A9907 OSBORNEEQUESTRIAN
438,350,622 *2C6A7B61EFAD1A3ADDAC7AE9B3EBC9841CCBC0D6 OSVALDO.CERISE
438,350,623 *2C686E61FA215AAF8A00062E6337E53DAEF305B0 otutomoed
438,350,624 *2C67B0AD1C15FC88555EBAB4373683BB5FB2324E 2127587 KOSKA-HYLSY-ON-KOKOPITK
438,350,625 *2C69979A5440871959EACDE2E08061653A861440 (3RDALBUM)
438,350,626 *2C6C5EB88B929942AC86894AE70C84848A7A4ED6 3==>* uu
438,350,627 *2C655F974C22AEB7B648F522680063B15B7E62BF PAESANA5
438,350,628 *2C650DBC4423BDE5B59B74CCE15E9DBA7CA209CB 409で記載有り、MCID適応型?
438,350,629 *2C6CACCAE9E3878AF99F23841EDA14C3B189CB68 pannir-selvan
438,350,630 *2C66A5B4FAA96A39ACB30E39F91040F7194F8908 PANTERAPEDRO
438,350,631 *2C6125C03488C99801E204355213CCA76D76E059 PARENCEPHALON9
438,350,632 *2C620BADD72C3AC98C995208612650A9EF885E5F 2576650 schon2004warderexportum9,2prozentgeschrumpft.
438,350,633 *2C6AE2DB1DAD40620F38C06198A96CC54CF61210 2594717 lukuvuonna.199899.tai.sit
438,350,634 *2C6A0253BAC0378ED4AA5E2E5F9DA86C73AC8E17 4RDIGHEDSSUMMEN
438,350,635 *2C6C0851C95E78D7A7FD48EB351D61BB94076E05 perrybasco
438,350,636 *2C687D87D53F3E582DA56077978CA5D8F65BB9F1 2822332 eritt
438,350,637 *2C6482FE727A22F1F136F3A1D9B1A71F571F1998 28browsercache
438,350,638 *2C66DF80DEAFF861E3EBD1B49BEA35C0EF8679E2 2iluvsonic9
438,350,639 *2C68F7DCB46788C50F31818674ADEACC3E42FF35 2.MAHRUKATCILARDA
438,350,640 *2C621FCD34F6BD6A1A10CDC9386CE6BFEBAA70A0 2.montpelier's
438,350,641 *2C6DCBA37BA9E2517CDA72BE27C982320A5A8B99 2oikukkaat
438,350,642 *2C697C3DA2126D1E97F74A266C2B3CDA8FB1F758 2ROWE-GROSSNER
438,350,643 *2C69CE3D1890667E17652227D1EDD90E90B9D107 5BLUESKYRUFUS
438,350,644 *2C6ADBBF177E4390356F9774FD810BE4D91EDCE6 PLASTICWRAP
438,350,645 *2C659FF3FDB347804DEE8DFB415C7347E1B886E8 po1y94m1$+
438,350,646 *2C6A43BABCAACD8FC15C4BFDCEAA5172C2083B1B porfirioserfoss
438,350,647 *2C6B480D0A45EB1EC4E16AD793790A8E78E1FC07 2ustlendiklerine
438,350,648 *2C68D5ECD23514184A5191D17E9485E0D4EED737 POTKINUT3
438,350,649 *2C69AA44E6218C228FBF8AE2F786934984028FA7 P######P* * SPLAT
438,350,650 *2C6C1EFB1FBE3D461CAE7B9B631D863C539FA4E2 5LILLYNE
438,350,651 *2C67DF5BFFE8C75213EEA03F5EF49E8CC6A5FCC0 376billy
438,350,652 *2C6B6339F1A11FA9D176CDF601ADB5872001B547 3ACHEMINERAIT
438,350,653 *2C6D1AAEDEF6D8B2E410C544B5B1D7395D34D4F3 3b<`d======3
438,350,654 *2C687706401E950974D9A7074BC2D92568289864 PRINZESSINSTRAßE
438,350,655 *2C6EB633D4B5E8448E13F9B8C168DFFE31ABE554 3 JCC-GESCHAEFTSFUEHRER
438,350,656 *2C606F5B5932EF97927A7D49ED6C15AEA1900A12 3METODER
438,350,657 *2C6E32348E075D1179E47C1A8E4CAF9AFEC4867E 3 SIWA-LIIKKEEN
438,350,658 *2C6E48813DD955D622215D788C2B1BAB48404384 3SODENLI
438,350,659 *2C69C8D3CD60D6EA9BC11D66D9B204ABC7DCECFA q==B-~O-(>_<)
438,350,660 *2C6B765439B87698D89E1401393A001EC25DF25E Q#####B***SPLAT
438,350,661 *2C632F0BDA39E11A2CC263DD921257F4FFBBD670 qh}b
438,350,662 *2C6EDE14D3FCA23AB57A6300E194555958BDDCE4 435kamren
438,350,663 *2C6D95C210A8DF603F469E693E33068829010380 4AYLIIKKEELL
438,350,664 *2C6CD738E9CD0673B8022220E8DF4B4FE9844897 4-durasInIn
438,350,665 *2C6DE9515DEB04367E23C0676CC60A6080B0BDCE qodd
438,350,666 *2C60CE633EEE3169B28449CF8F51DD7EC30C1B7B 4JAGDAUFENTHAL
438,350,667 *2C6718E46A17336057E863004F23401D44A3CF71 4MAKSIMERINGERNE
438,350,668 *2C67321A7DDF5FB4DEE56ABA977D4B15D50C13A8 4MEMOARENS
438,350,669 *2C67437ED0D07B415971BB5F3F1252F91270C3E9 4.minnettar
438,350,670 *2C69026B088D083AB5EEEE819E32DA7AB2692D83 4NOISIVIDERP
438,350,671 *2C6F01AC06161D4A8B712ADF638D6142CE5CB5AF 4POLOPOLICE
438,350,672 *2C66613165E8C2D792E7B79BD7F8094311AC2AA4 4RESKABERTRANG
438,350,673 *2C610A37A4BD69627110B478CBC0AC70D86991F4 4THEWISDOM8
438,350,674 *2C6A5780DF0FD47B9B6173C9F0230B699017D7AF 4TUNNENPA
438,350,675 *2C6BF9235BE65425AFBCCD94AE3EC65035EBA912 q######P***(00)
438,350,676 *2C6C14BC55737D056EFFA3EF42EE83C5A0D8AA92 [email protected]
438,350,677 *2C6C833B5D72910091DEFE835E29D640936C0BC3 5BSWSCHLATTERBECKBSW
438,350,678 *2C6B3870BC3225B44FD645404AEDC73E5562D96F queenofsapphires
438,350,679 *2C6362A0DAED5C373BB9FC090A57B8B2359DF0DD QUENCHKREIS
438,350,680 *2C62D7F047B722C402532C4345A35E03ABB649D2 Quinius.Thoth
438,350,681 *2C6FF6C884230E8A137384091217A943763DB3CB quinnczerniak
438,350,682 *2C6E41A9C63DE1F1FB0C548FF6F9B8FCB5FF32B7 QUINTILIUS
438,350,683 *2C62ECF2FBB08DFEF9EF35BFBCD7CBC2D4617EAB 6.landesplanungsgesetzes
438,350,684 *2C6E13BBFEFCF8D6D42A9CF8CF2C6C77B6C59C99 r5k
438,350,685 *2C64E35F8468ADB65E00BF8D4F8700D6630087AE RAASHIM8
438,350,686 *2C65DC5C6514D013021AD268EFA11E2B60D00337 5ISPREBIJANOJ
438,350,687 *2C6BAFC2332D05EF1558B6708EFB6EB342D3B408 RAFI.AHSAN
438,350,688 *2C67F50CC3F9CC26219AF77EA0CED708EE5CE9CD 5LAUSUNTOIHINS
438,350,689 *2C64E6EBC58308A10445FE10D5243A57FAE376BA rajnish.nair
438,350,690 *2C683C16C102B7FD5F6BF4D40A022885FFD9035A 5myalthea3
438,350,691 *2C66F5FAEF4F19C1D4EBFC254200A12BB92A5DDA RAMIROLIVERMORE
438,350,692 *2C675A4DDB7B67C0FFD39CA8813B119B891DA4CB 5POWERFULLES
438,350,693 *2C6526A3DA2741E1D39C189541C9D9FE7F5E96C5 rappezzare3
438,350,694 *2C6ED9D63AE8656255BFE5E70DCC7A92426D163C 5RSTRBNDR
438,350,695 *2C6F7358FCA67ECE43A36D04A4C7576A7D4FDFFD 723413 LANGE-STIMMTEN-DIE-LAUFWEGE-BEI-BASKET-NICHT-.
438,350,696 *2C6C4DF28F211E78E002C7FA162D323BF32D62FA 7433E858-B90B-3D2E-8A30-54C91D111B15
438,350,697 *2C65A656D06A522E7DF0306F9AE95516C713BB18 RAYMONMEDEIROS
438,350,698 *2C6BFFCA6035366C26E932EB9C7988A565B564DF 5STEENKOOLWAGENS
438,350,699 *2C6FCE5A1F20AE2131275648D2A865F43A4F54D5 798377 DR-.-IHSAN-AKPINAR-UZM-.
438,350,700 *2C6BEF3A46D4DCF9C4B49D3E897343318ED01576 RDUMZ
438,350,701 *2C6712E8FDE4A87D451FCBD58F5B6DE934523F85 READANTECONMOTOPRESTO
438,350,702 *2C62A3ABCD44D89CBD5AD7749FF9EADB04257E65 7BSWCARNIUMBSW
438,350,703 *2C691F831D90B585AF2C7843E9228EC9D1AFD55A regnbågsforell
438,350,704 *2C670FB6A15617A022C24EB0D526B522D2E581AB 7ETAGIMUFFUS
438,350,705 *2C6BB5594681E9D1B5929BCEC0BFA5B44A8A0824 renaldobearce
438,350,706 *2C6DC6505C92998C67A52ACC41F34E9A94A9D495 6.AUTOTECHNIK
438,350,707 *2C63A134A446B6FDAF7319B19A442074D9E65E55 renaldosayavong
438,350,708 *2C63A822EB1A6E8895E9294EC6DEE512722AE860 6BSWROUCAIREBSW
438,350,709 *2C67760B8485D6BDEF151D5C32680260960B612B 7NONDISPOSABLEA
438,350,710 *2C6253BC815686C35206D0DA01DFC3E269AB364D 7PTERYGOPALATINES
438,350,711 *2C6EC9BE5A0399CDAF84AEC5C5060CE768658BDE RICHIE.EDELSTEIN
438,350,712 *2C61E85C10143356B7367EEED8DF3352EEB0BFA4 RIKISOUED
438,350,713 *2C608F79C6C760F58CD061C23EB61C64223C87D1 rivka golani
438,350,714 *2C609A53D3ACD33512553F6636E12C4C3D9BC761 RMETRANO
438,350,715 *2C6593A03E23EC698524879E58E728E79B8E23F8 RNDGSPRNGN9
438,350,716 *2C675EF5713EF84EFAF54E7D267E3F78152CD526 ROBERT-ZABOROWSKI
438,350,717 *2C69D56ECC4B2D1796EE51358A68D473C72DC421 6gblu87e
438,350,718 *2C61F028271B1454A65C74F05525929161C4E0BC 801michael
438,350,719 *2C6026E568F849C7C08B93B944B748B2B9FBE6D7 6KINNDDAB
438,350,720 *2C6E0C3306C69C5691C1BBF3D5FEF52948998917 87.SUNNUNTAIAAMUNA
438,350,721 *2C69345CFD9958EC7413BE0E651C131A8A41B0F4 ROOSTERWHALESES
438,350,722 *2C6644D8F54F61579447AFC946A03DB32384297F 6OUTRIONSES
438,350,723 *2C655B035CF296F4AFB9A0A574B7CD929A5C427D 8AFIGURESTANDS
438,350,724 *2C6D62477EF8EB26FB7BC7F38A5EA366BA23B58B ROSARIO.CHOLULA
438,350,725 *2C610B1F6B0F3DF4770B2E6C011EAF2E514F5C2F 8AUFTRAGSBESTATIGUNG
438,350,726 *2C62E4972A9F9815C7AF2754CA870BB4C46146F3 6SESITAMG
438,350,727 *2C673E077565340636E08FE3BA9BD480F46FA5DD 6SLAVEAOC
438,350,728 *2C639D4865E7E7ADB6FA7920823820342312DA18 6SNOOZDRETSAB
438,350,729 *2C60ADCCD1B992D9CF8A938D3930A8F086F7E7FC RSKABERNE3
438,350,730 *2C65312F60BE7F587C9C602D643A714C530609A6 RSLUIERT9
438,350,731 *2C68544931A6F12B7C2D8EA1E11D84454208AF5A 8FREEDOMATHENA
438,350,732 *2C62756114278AB63BE96CBBECF29EF16A060E28 rubingumbel
438,350,733 *2C6B54CCDC603403F59A3586E01F038920FDC4FF RUDOLPH.HOBB
438,350,734 *2C63D1BCF00BEF088743BF3392165604DEFE1ACC 8iammiki3
438,350,735 *2C6F1986E57876E9BDF85C3BD1D39DB99C01E34A rupertthunberg
438,350,736 *2C6F89C18BE6A5B5250978E2F225EB93A1E90B8A RUPERTVANDINTER
438,350,737 *2C635AE13A7E7DAD1C8387DE0D83D20C4BB19802 8ineffectible
438,350,738 *2C6576146A9103CCD62357391C32A9FC039077C1 ryan-hausknecht
438,350,739 *2C6A2C041A9C4AB62D439607A38EF76AB2FF1319 7BUNNYEATER
438,350,740 *2C6427C66647C6859BCD426BAF622E8A08F32AAA 997598 goruntuden-baska-bir-sey-alma----"
438,350,741 *2C679622965A5640AADA9547C62B623BF5407C88 9BSWVLOERBEDEKKING
438,350,742 *2C6A2DD58C442E67214501B122F4DD61FACB6A84 9DARIOSIL
438,350,743 *2C6BFD1661297F7E30F1E61DC26AE8F06BF2B0FE s.amb.mi
438,350,744 *2C6976F0A761FE5B8164BC9CF71B69381541F9E8 samshus?
438,350,745 *2C6919C621C3394953C4880658392C3A92474D97 sangerina
438,350,746 *2C6B0816728D9AE6ADC4313D411E97CA24C115D1 SARRACENIOSPORA2
438,350,747 *2C631E7E3BFFC0570CF05CAB3C1CB4F13D114130 satan'sspree
438,350,748 *2C6D78F075F160B824304EFA648A62EDC9BD8964 7YSPRO
438,350,749 *2C62D6D521E5E74150FA744F8764AC80F0003044 SAXORACER
438,350,750 *2C6B3B11F3ACE2A4DBF703DB929700A23C16AD56 81CRAPPO
438,350,751 *2C628F855FC49E4DD9FF649E2616011440262AD8 832147 korkea- ja v
438,350,752 *2C692D4BE6879B172833A9736F2E065838DF4C72 A5<`
438,350,753 *2C68631AC31BF66A23CF4B12E1C1EF4D7D4B785C a6
438,350,754 *2C6AD0935B73F2BBCB135A38957F64CE9104405E a7,i
438,350,755 *2C6EB2555CE02ABE5E55BB9492A1FB776B12DC97 A9Ah
438,350,756 *2C63FDB7C1C271248A70C51891D4801D12B9A204 sea.scor
438,350,757 *2C6A6B31224C4FADA19DBCE26C878613C4B47AA8 8DEGAGTRO
438,350,758 *2C6EC42EA84B9B15C584B8D6FBF078A67EAAAD00 aaa(bw
438,350,759 *2C6E7B6C4EF7F77616ACE48F01D68DA9286457EA ?seitilitu sag ?seitilitu retaw
438,350,760 *2C6DBE8B7FC273A4DD05CF945FB69E443BC084CE SELBAROBALNU
438,350,761 *2C691F476A340501874971D4300792DD3D61379A sengal93
438,350,762 *2C69337E93AFF00D28D3CBC3396F2EF0AE4C55F3 8JUOVANI
438,350,763 *2C646A7BF66F617FC5AED8004A50B332F3819108 8LAKERSKOMBAT
438,350,764 *2C68F72B257CF2E17B63A661C923CFA9C71BAE0B 8MAHERAW
438,350,765 *2C669D4D9BED7D42B2F43B0DDD914EA1803D5A5E sergiociminera
438,350,766 *2C6E22100EC614EAEBFC3535AEEAF1FAF5E21D26 sergioohlrich
438,350,767 *2C6B12C20053657BC36247275F70EAEC2581E51F AADWJ1
438,350,768 *2C6F98691EDE707B1257FBD170874D9672CBD6AB [email protected]`.}o{
438,350,769 *2C6CAA17AAF6923AB301BBC896F8B567AEEF0275 AANVULLINGSKOHIERENS2
438,350,770 *2C6271E914A3685FDF1C5D0714015DF244F86819 8SNOWTECH
438,350,771 *2C6FF33E9AC33BF18E2B4CF3F3DCCFFFA2DAFA2F ABBY CHUNG
438,350,772 *2C63DE2B743A1DAA940A7EA5431A85BEEE00F39D abf$g
438,350,773 *2C63B26B34EB596F09862B294B8064048081FFD0 8TUTAPOKEA
438,350,774 *2C6AEE79C31F8A76A466B90FE943E814AD322E46 8ZONEINTERJECT
438,350,775 *2C646D45ACADC3DE33337259488B31231099D2A8 941RAMIRO
438,350,776 *2C6C292287DE086E55DF313F2E13994D2B1F4738 9AFFRONTERIEZ
438,350,777 *2C64D0FFD846C748D9BC5480CB5B032DBE3D80D4 9AWORDOFIT
438,350,778 *2C69ADAE1BAE45145A988075A7A8FC4C415E7F2F ACHIM1507
438,350,779 *2C6E7981FC04429EF2B57F3A36FFF7922782A97F shantihockey
438,350,780 *2C638B2A65BDCD5CDFC17C738D25E7386F3E3C66 SHEILA-DOUTHWRIGHT
438,350,781 *2C69CA36B24497DE05D0FB69021CBA0CBF03334B 9iloveoatmeal4
438,350,782 *2C60CB602FC1A6CF8D4D5FC7F87227406AE2B6B8 ADRIANA.ELLEN
438,350,783 *2C6303C411F2318B3E42A5AB758B9B90F0BAFCA1 9PENGUINSAM
438,350,784 *2C63BA1EBA09525BBD0F63D3DD8B92669058682A 9POMIRISTE
438,350,785 *2C68314731833E990E678C51D05AA7A8E8C069AF SHIRAHES6
438,350,786 *2C62E11ECA4F92A5D34CBED8BE5FABDBD78EFF85 9REKHTIS
438,350,787 *2C60A2D3681BDC41773B88E133C1A1EAB281448C AEGQH
438,350,788 *2C66D87C7966D18526F068739A418BFB036E0E36 AFI23KA
438,350,789 *2C6901E86F043E2515BB53FBC99F6A18B3D8C8A4 AGRAVELLONA-TOCE
438,350,790 *2C6610304B88121AC676750456AFD44BC1A6879E AHES$
438,350,791 *2C64EC6B1A257B41553AA191D3F82F3F92DEE60E a4o5+
438,350,792 *2C6D43C1CEDE2F6D90CF0097597BA27CA45DC94F AJ4Y;
438,350,793 *2C6A5CDDBFDE5009266105EA42631EE007A97722 akhh#
438,350,794 *2C661F357DB739D5AF29B5CD48BD1D3B6C75E8B0 AAB"49
438,350,795 *2C6F2EB97F32CC00B3E82E9DE748311E9D5855B1 AA$E\
438,350,796 *2C67B549801F0B08E14F41B4C9A8C45B5D77AE84 ALAN.GERKIN
438,350,797 *2C66ABCCFFE8B457BA57B43E54BFDCB396ED8361 A/AHB
438,350,798 *2C6A7A4B024C59CE99FC5A3F3964D2B0D8666A83 ABKNALLENLY9
438,350,799 *2C6746B9DFE891121CD3B9D6A39B3F7422A946B0 ABNQ
438,350,800 *2C681F880A5605C105304C9436FC479513B9057D ABV&L
438,350,801 *2C69ED25536D21811C5C77A536E378A7EFA06C6E Act-III-Sc-3:-Recit-&-aria:-Juno,-Semele
438,350,802 *2C66B5A7FA3ECA8FAC3575CEFFD7CFFAFF8B98B8 a.de.dibujos.animados
438,350,803 *2C68172A947918E951E12A99C0CD462B0BD5BBF0 A.DI
438,350,804 *2C69873FE761E3E837432BF3966D7DC05A7C0158 ALVAROSWINK
438,350,805 *2C6917B240B594D4997005929BB3DF5AB04C62BB so-peachy
438,350,806 *2C66F9907130027507401D2D527DE9CAAEA10573 amdathlonfx
438,350,807 *2C6882DC8F06E28DC817626B151F796586EF9A67 SPENCERVANVEEN
438,350,808 *2C607A60E2F4454E573191C8ABFB77D85384BB2D andyshenker
438,350,809 *2C67A4B67856E5B93B9F2AD605BA89714682FF01 SPLAT.*.*.(3
438,350,810 *2C6AE422BDD02F264B14A1C0CCD6F88422165D9A SPRAKESPRAKED
438,350,811 *2C64B40273D4B26577E4BB1FB9C623A6A52A58D6 spremendo8
438,350,812 *2C63A8F58F24AA8A1FDED4F38681F68D05407439 ANTWAN.DILLWORTH
438,350,813 *2C64DAC41A006E0FEA30DBD98295DCC574AFE129 SRTAXEU
438,350,814 *2C6301398E7CF1703B0A57E47F42DCFC78CBEBC2 AOS%A
438,350,815 *2C61C55E47C1CBBD2223A4B858B14F5545A211C9 stacy856
438,350,816 *2C6DA549033D50849D05C177886CAC6759CC409B akd-p
438,350,817 *2C62E81B135A54C534DFD2EAD7C80E023C3B08D4 AKOORUK0
438,350,818 *2C6B7CF5FFC32C1DCD4747F7792357CCF3749CFC aktar.waed
438,350,819 *2C6C213F1A5CC771E38F633B0BD8D36793E1E217 AKUMULACNICH
438,350,820 *2C69D53329805D146FAB61171A309A6BBB65C7C6 armandfleshman
438,350,821 *2C62ED0F3EFA8116CF5641163D8CF63C44EDF519 ALEC.URQUIDI
438,350,822 *2C6ECEA17CC554F6D4C32BE9D7B04CD448024FA8 ARTHURPOULLARD
438,350,823 *2C63D42EEFF1C84E5EF652A5F3CC710F55254195 ALEQM5HE8UU0OXXNHEDF7R3D
438,350,824 *2C6FB8CE55459F8D840C3D06600DDB94B5102FC7 ALICECOMEDIES:ALICEUNDDIEWILDWESTBANDITEN
438,350,825 *2C60233206A52A30390948549026ADEB000B022E STROPHAS4
438,350,826 *2C65FA2C34D9A43AC0273CCB4833EB4A0939C873 STUPIDTIFFANY9
438,350,827 *2C6E25D2283C1B21396FEFCCD4469FFD7D2E5C35 ALONSO.LEISEY
438,350,828 *2C6E2B660DBD03B5ECC7FF88261B422DF02E019E ATRIBUIDA4
438,350,829 *2C6453F6AD25FB5A15D45D03FA37277DFA686137 A/&U?
438,350,830 *2C6F06DADA290638EACDBB43E3BDE966F79CA24E alvazehe
438,350,831 *2C67146CACA7C6DBB3A388D99291F9A585F0BE3B ALVINIA
438,350,832 *2C6F67738CF5FEF7E3311C6B6764EDA1E3517815 a=!&v
438,350,833 *2C61FAA6C98DF7F03A648FC94BAB90480F78C5EF [email protected]
438,350,834 *2C6ECE4323FD7CA81DFFB67CCFA06B2C71EB9F1C SYDNEY.VANLITH
438,350,835 *2C6BC7CE0F109BA9141F0FA419E65B1D225B8F0D ax6o,
438,350,836 *2C6834B1E86F66739947AB753526EFFEC41915AA azoxynap5
438,350,837 *2C6494849345AEA7695D4CF51B378B70435E8D6D azw/!
438,350,838 *2C64A003D61E65425969623A6C8CBDB7A4C3EEE9 ANTIQVITATVM
438,350,839 *2C637EFFE77128AA704D6818947BA1EFF0CA2D83 ANTONIAMCFIELD
438,350,840 *2C679C1537606BF9A2C6B7DA858FC48F1EBB8B97 ANTONSUPRUN
438,350,841 *2C6481D86E04E4B7AB65637296FA8F9FE0FEF45F B2.I;
438,350,842 *2C6BB86A0F231A2E5F4079B43612FFE0AE7838D8 [email protected]
438,350,843 *2C6858AD729987FD952C7D31B53B37FB9D6D83B5 AP02+
438,350,844 *2C6572AA52FC2C25AD6F1C3772FE730CD14C696D b;4o"
438,350,845 *2C66A5BC00552AAF4170D0B5834B535FF3BD311F ARHONDIS123
438,350,846 *2C63DDC40DC58BF9EB80A8CD91E0F69E9DA2AD51 TEGNINGENS8
438,350,847 *2C679E8230550C3433A47B1ED6FDA00CFFAA0A89 ARNULFO.SPARGO
438,350,848 *2C6504563EA895BDE45AA338496860F760973D56 TEMSILCILIK6
438,350,849 *2C66E350795C6ACEB3EEC363F298F7B833985571 TENDERIS8
438,350,850 *2C69EE5792511417857A2BD31B871F9F13F85070 asioi
438,350,851 *2C667C658A83F89D2046FB4D825EA503D336CDA2 at2cz
438,350,852 *2C6E0160C510FFCE2EE1F954C6158F7DCA27D62A a((ur
438,350,853 *2C666554651C506F0F9A8FF327E062002DB78E43 the.fine.art.of.poisoning
438,350,854 *2C62A997ADFC0012DA5D41E9434278280AF7CEA0 BENJAMIN.VONASEK
438,350,855 *2C640D9AD346536F64CEA9C9D3483FDA269426EE AXWWAAAAIBAJ
438,350,856 *2C68793DD9383B4CC3D4CD7A61CD7FF7BB25A848 ayxec
438,350,857 *2C60B7693B34D61B88756E914D7542007D347D2D THE-WELL-TEMPERED-CLAVIER,-BOOK-1:-FUGUE-NO.-3-IN-C-SHARP-MAJOR
438,350,858 *2C6F0F99928298DE3442A31093C830891056800B azz;b
438,350,859 *2C6F32730B5021FA0721D1160B1058C8A7689C06 B>~0.~o.{x}
438,350,860 *2C6089F0D42C94F840A10D58AD45F8BA92A8CE7B tiangila
438,350,861 *2C688B426F9662B8AA4796848342AE644B1246A9 BFPZH
438,350,862 *2C6BA2C35F48B4D4602B7B712768985DFC409B54 TINYTINNI
438,350,863 *2C6347CA5EE49B5D6BF913B108C1B64A4C159743 b3$33min9
438,350,864 *2C6B78D1338433835DA67837D9AE9AC42FF68C8F [email protected]
438,350,865 *2C6106005947B54B74214AB46453153DFEC23EDA [email protected]
438,350,866 *2C69DFB5553FCE665DDFCE6F43CD3DD1F92A5AE6 ballspank
438,350,867 *2C63B9D2B61720076F7E5DAB55AC09A85E827E60 toppedeses
438,350,868 *2C6633854196089B8626966C80EECD91E9B843EC BLAQG
438,350,869 *2C65693B6602E09A3BBB865517EA6EB030E7C38C BLS!O
438,350,870 *2C69AA6484B3D9B6B72138B470ABF421B2D8C2AE b---d*-*-*-splat
438,350,871 *2C6907BE8FF3ABFDCC1D6C78B43D9C07BC664506 TRAVEL-OF-DREAM-(III)
438,350,872 *2C6973113260176014DFE31EB954996AF29DE252 TRENTDALTONJAMESON
438,350,873 *2C6C318B92F564E4E880E4E78628F043F2F0FA8D TRENTONTATSCH
438,350,874 *2C65CE7EC96ED6F6B137B866EFC018F0CBB388B7 beispiel-eins-plus
438,350,875 *2C6256F466895F91CAF67ABF427A1D11A745DDA1 B/ek
438,350,876 *2C68AFF668FA299575774AEAA94743BCB533CC7E [email protected]`~-`~-:p
438,350,877 *2C6809260FA027FEB762881F3B5DD78EAC9177BA b(&#h
438,350,878 *2C680273904996CDBCA464FDA64266BB3049295B b!pyp
438,350,879 *2C645037CD641FE83BE60C07E8BB4FE3B396F55C tuba.hayee
438,350,880 *2C676104FE1B5170BDCFBAC88717545D845116ED [email protected]
438,350,881 *2C663B0BBDE7B2482C4CD5179A752FB0C0F9E5EE turpinwaterse
438,350,882 *2C6B0078997C647DB09A48DF7EA6BF488C5B01F1 brouchy8
438,350,883 *2C6512C11FDC3779B486F79E68BD7B74EE844A24 brunieria
438,350,884 *2C657552E1CF7B12F2874E58012832A78B9D2B90 bsfr
438,350,885 *2C6430BCB07F2AB6166CF4E04292256FECCB1DBA UITGETRAPTEN1
438,350,886 *2C63882F40F2BDE65ECBF9BB67C663C7FBCF7F47 Blowin'intheWind(featJoanBaez)
438,350,887 *2C69F4CF747DF1E717F3025924FD89EAA66003EA b.n0k
438,350,888 *2C6244E6BA18CCC9DC5EE8A3A92D56EF61ADEE80 B=O93
438,350,889 *2C6154E75E546CE8699BCFBA595736A077A088FE BOOKMARKSFTP
438,350,890 *2C66B9B3DE96736762300C2F015B269003606EBE BOONSITI
438,350,891 *2C6124999420ECED5E52777A695D955F4015DDA7 BOOTSECTEUR1
438,350,892 *2C673F2D305D1104575EACF304F60B064A2657DF bw-a7
438,350,893 *2C617C13483B6F350DA677CC6D00A7B5996E2F66 BP/DN
438,350,894 *2C6C27B026E66DADC2754D5EBBC94C7BE643157E C4pj
438,350,895 *2C6CF4755F21146C4A927BBD3D64B74F09846E1A VACCINERONS4
438,350,896 *2C6B1F6B8B03ED0A6402E19AAD65D63910936B99 c8yhv
438,350,897 *2C6D7EA3EBA50B6216009147B9B3B6B3CDD85E40 BRENCKENBURG1234
438,350,898 *2C645855BF33905A5CBE1BC7C92384D9106BE7BE BRENDAPACKERS
438,350,899 *2C6E1091804E423E4741B48C923A0625651447E0 brittney.rich
438,350,900 *2C619DFC6F8C456A2AD2BC904B40395F8AFB3216 VALENTIN.SHANDRO
438,350,901 *2C6F43B9723E6BFEE4032918587625432C16530D VALMACEMAPA
438,350,902 *2C6EE7D0B86B559D58A111B2A1B4821DE1B4AAD4 CAMC1
438,350,903 *2C64980CE374211C677C68CBF78EF96666774F09 VBJVSBSW1
438,350,904 *2C6D8CED841BC2FEF2B88B41D5D2A448B44F441F BTK;V
438,350,905 *2C612EEF33FFC70FC8C1C3071AE20F9D5ECD0E56 CASSANDRA BENTON
438,350,906 *2C603B33B07A05E39608D27D111B91990AE3C06F Verses.At.Pois
438,350,907 *2C687C7A49320486A487E7A05CEED35D90C53D13 C7MEV
438,350,908 *2C6B79F0EE5AE3CE2F6793501C9085F0341829EF [email protected]
438,350,909 *2C69DB5152CC86E4B6E48015F8B57287CA82586F C8;VR
438,350,910 *2C6AB2547F876DC2375D13A919B7B41C5BA13556 ce5%$
438,350,911 *2C6FF198B17D3B9936A279F9CB7FFA70D4CB6F5D CAHOMA05
438,350,912 *2C6E79C2B5C71B2732981AD4934711B678268BB3 VIJJU459
438,350,913 *2C644037BBEF964EEE25AB597A23B14B1B1456C1 CEJ8H
438,350,914 *2C66C95756D395A9336E3F23F8650B92F7CB087A VILLEGGIEREBBE5
438,350,915 *2C625331F3BE4DAA95CB934DCC29A31D6A456B63 celectri3
438,350,916 *2C641D1A468EE2CD465C3EF456DDDE43A8309C31 VISHALWABLE
438,350,917 *2C64BE0A57C3099D54DC22E3EB7E8C1AE39C7771 VNLABOURYD9
438,350,918 *2C6BAC1BFA725AC005705B09B171ADC38FC882CC CFND"
438,350,919 *2C6E9F46C85DCCC102DFA3ACF649F3D5A490A315 VU HOAI NAM
438,350,920 *2C6489459B97F1B6A733E4EB2429317908ADDEA7 CARMELO.FRANKENFIELD
438,350,921 *2C6366E82FDED59125AF5157CB579C558256FD50 CHARLIETIBOR
438,350,922 *2C6B65B8FCA621602FE60CDBB572943844A4B2D8 CHIANKAKIM
438,350,923 *2C6C65AE16DBF7CB1B44BFAFA98987768C02FB04 CARRIE DELCOURT
438,350,924 *2C68DBD740B10236ABFD8C1B9D62970F239899D2 CARROL.HIPPS
438,350,925 *2C62AB47F473651E3BB33DF74C4998AFACB8A82E CASS GREENE
438,350,926 *2C6D5BF6FDFDE9E0F98952198D122CF3CF24EEFB CATARINETAS
438,350,927 *2C68D0E93D5A57B165883E3C10C04E0C63F25978 waldogarin
438,350,928 *2C6E25D9065CF63A41970FB379A7B931B3C9EF20 CHRISORRRA
438,350,929 *2C6A02BB8B907416402711EF3FE36CE91C7FF2F8 CLAP..
438,350,930 *2C623F9C124F1ADD03B4E069D4BD074EC4118F50 CLARKSUENNEN
438,350,931 *2C640D7BF196D58B74806292CB59B19431398C5D CG\C
438,350,932 *2C636E2522804FBD15DCC26BE5F5C52EB3942E26 C;G+Q
438,350,933 *2C6C7088AC2093D242F947AB193D8926E6A913B9 COLPITTS0
438,350,934 *2C68B72F788522D031B74EE3ECBA65CB26098EDD CHARLES.SOUCHON
438,350,935 *2C6FD4064D45C05E6D1E143498430FBD9B12E5B8 CONSERVED13
438,350,936 *2C69B2DA3B9BA48026A33FB355475296C2A8A64B chieb
438,350,937 *2C6C9E096636423C6C641CE82AFE45EFC3C3E476 williammarlin
438,350,938 *2C6CB1449542DDFA38C83E9E5ADC96C8DB2E19D8 coywolkow
438,350,939 *2C642F87F50EDDC7E3331C21DB2272F408F7B019 chmhc
438,350,940 *2C6C7CE84F52D7A866E5A1A54CB0E01B9ADC765A winstonstahlberg
438,350,941 *2C6B7D12E5935017045B877D351F7D9044AADECF c%puc
438,350,942 *2C60E580688D1502E18BF2B9C6C76FD5CB842D07 WOMBAT11996
438,350,943 *2C6C7D76AA5A606B5DB7F87F6FA8ED2D6FE57B94 wooyeong
438,350,944 *2C6EE1C584592ED40AAF802BD9949FC72D9FA274 cristal-loza
438,350,945 *2C6E7885B5982E9AEE1486E8E176828B931FDFE4 cs/bb
438,350,946 *2C697EBEDA4954DBFC61D57BCD25BB9A0C9BEF45 CULTURMÄCHTE
438,350,947 *2C6B214FBAB34DAED3E6AB676C10B1B2AB5D2593 CU%R
438,350,948 *2C69FE9A365731CFE2B877C9FD0ED03F72ED0C4D xecdqz
438,350,949 *2C6DED4E360243D99F45E26E3EA7B2F46EE4CA0C CLTONT
438,350,950 *2C6FB70AD8FD7564B3C1F10712F6CA6F2C382422 ClW
438,350,951 *2C61ABC3D087F403520F6FAD4DEA5DE7B04CC2FF D4EO
438,350,952 *2C66FA184CFB808DEEA5AAE2E4E76C691332D78A COLLEGIATE-CIRCLES
438,350,953 *2C66641AA7CDD616C24DCED3F88B5CF664F59F15 YANILDAGOMEZ
438,350,954 *2C6B93465C998474C8A73C6D19CF4D9495EEE635 COLLYARD
438,350,955 *2C61A49E45BE04A0A137D1374665FB8B109248AF d9vkr
438,350,956 *2C60EC69308F95D7D75E2F4D06EB8531CBD6F000 comにおけるutaのページ
438,350,957 *2C655A01DFC04E53757F5A61A43E371A2473ACD1 conc3ptu411z3
438,350,958 *2C646D442B50EB9370FCB6F00E1EB6879911A21C cordellalmasi
438,350,959 *2C61F4D82C46DEAE815D845A684822EEA808489A corneliusvanhove
438,350,960 *2C675E60DBCDEB5AF583DC0F1BF2905EEFB2EF09 CORRADOJUDITH
438,350,961 *2C62F97A52209372E3B642D2C7A22362F332F938 daniel-senties
438,350,962 *2C6E44F2C2712DCDBD3096E947407762C9477A61 DATUMCUT
438,350,963 *2C6D0E2EC1AEE101393FFD8B0D655FE8EEBB4B2B CQ$W&
438,350,964 *2C62ED719AA942DD88343A270FECF0D8AE0BF6CB [email protected]LCOM
438,350,965 *2C616C6C3EB3D073F2DB5151CAE244649470B96D CRPLGCL1
438,350,966 *2C692EEF44C379FCD4B673D8D960FC07AD53C2D9 z9cu0bvlbsqcn
438,350,967 *2C66A5A9FAA124F833A872311110DE1CF5828372 zainichi8
438,350,968 *2C655F83B76C24A383EE8A831CE1BCA39CFF03E9 CU%R
438,350,969 *2C6B83469FDF9EFF5309E7B5558C3482FB430C91 [email protected]
438,350,970 *2C69920E8D7D6DE937128F57EC8D1A62E2A3FDD8 CVDPV
438,350,971 *2C67C5B2947787229A3C1AE4C7ED641BEE1A7B2C cww8
438,350,972 *2C62F045DDE651F12DECE0B71E098AAC16FCBBFF C:\XAMPP\MYSQL\DATA\EAGLE\FIELDS_GROUPS.MYD
438,350,973 *2C67DDFF7F06A5F91D7832E662E6989EDC01113A CYRIL.VRBKA
438,350,974 *2C669FD68323AEEC22795DD884B28B359E2AB850 cziygtxvnqg
438,350,975 *2C637C428F5790224523B3A1A32F28487326759E DEREK.MATOUSEK
438,350,976 *2C689ACF6B988969C1808FDDD369799C86082A04 D5jB
438,350,977 *2C6DE0E582075B74417652EEF74C40B37D71D8F1 D)ET;
438,350,978 *2C682E44D0AC2F0029A29E08DA70990297434D6D d#8bc
438,350,979 *2C6142A2F2A92C3EAFE31FDEF393C23648FF6E20 DAMIANNEWLAN
438,350,980 *2C618A38980FF7D4CCBABF258F67A5DEFA9D03E2 dhnii
438,350,981 *2C6643F639F6F009008875B7FF0A7DD7B34C867A Di"
438,350,982 *2C6CC383270E9D36C7DF8A768B52B9628BBDB9B0 darner
438,350,983 *2C600E5FD8BD554E5D67CDC9FFDB6BD0C123243A DIGARYUSUARIO
438,350,984 *2C6F948A442A2CF7D61251437F8F6F8CB80288D2 d)lan
438,350,985 *2C60D2194CF4D235225CA9BABF0489CC38647D8D dmmgu
438,350,986 *2C6C9F431E6E9652777EA8A6AD09632B02E2BAED DNDW47X
438,350,987 *2C6AC6D3E793F073CBC7FD544E61A704DCFADADD do7_u
438,350,988 *2C6076D29DFFB0B029358E22B4642E32A2F7049D DELMER.GILPIN
438,350,989 *2C65FCA403BDA4881F746B47BD5178BED99A1DDA DEMARCATIONS?
438,350,990 *2C6C0EBC2C9A785FED622302B3B78328845AF798 DO+H(
438,350,991 *2C6E24EF27A5B0DDF1DC058042C4E1A4FCB95F61 DOMISLOVIC
438,350,992 *2C6D26BB2CEADD3CE1F563F543186435B64423CC DESIREE418
438,350,993 *2C6AC1546647E537AF3245D55B9CDC99DA03A729 DESTRO33
438,350,994 *2C66FFC83C9012B292AD2D04418C236229990F3F DOUGLAS.OSTIGUY
438,350,995 *2C6D62A06E0C38AD9AA60EDADF85C5AADAA37B49 DPDOUGHB
438,350,996 *2C6CAE519058110B0596756BC5C82F6E6D535245 dissipee
438,350,997 *2C6108AB395252DB9FBAE7462CC1BC41F788F397 dzqu
438,350,998 *2C624BE0F5536811E6C79F592E6C2EB355D7086C EARLFROST
438,350,999 *2C64748327D1F8C8EDF8ABD45F3E3EAACDB4FFFA (><) ~ ~DP
438,351,000 *2C6BF2761B5AEC8F38C649C5863585ED33C25AFD ds5e
438,351,001 *2C6FB17E1FE1A1010928CABC45D7E4500430A1E8 DUMM4SS
438,351,002 *2C6CC30575F3539721224DF851EE68AE202C6CB3 [email protected]
438,351,003 *2C63BCA95846B21833FAF71B25746EA0500FB935 DURCREBY5
438,351,004 *2C603C4B74DE5D0C737EDAA24C01114B226BB9D1 DUSTY.NEUMAN
438,351,005 *2C67B73FD29516F62FA312A20009867B7A1B827A DUSTY.VERMEER
438,351,006 *2C61C3ECD158C802A6FC3766B3A8A3459B1E4B1B dw_5c
438,351,007 *2C6A7F572E618C76164D989586765CD58BEDE6FF D"WQ)
438,351,008 *2C60D13FA3A162DC4381848014C378803DE48E95 00BEUNER2711
438,351,009 *2C6C29FC39CAEAE4A624EAFB589C5680F7DD08AC d/zy
438,351,010 *2C6888FD2026DA72D3EE344BB1C713FAE0F1F990 EMORY.SHATT
438,351,011 *2C667AC065829F164584D04E20CF5C179E2726AE ENI6I
438,351,012 *2C6148204B8BFADCB770035B57FDB87BE305EDCF edr/m
438,351,013 *2C6F7C8B3BCF63E93789314A6BEBBBF08169FE8F EnTusHoras
438,351,014 *2C61217458D72698704E44ECC4EB114C32640C6B eg#,!
438,351,015 *2C6238DE454BF3548A063F6741723D7854B34367 1021910 KAKSI.VUOTTA.AIEMMIN.N
438,351,016 *2C658BA3CAD8BCC76FE40C79DF149610ED20DA8B egkqr
438,351,017 *2C6DC42C9B4752CEE6BC7EF52BD2F57B26058C16 eingabegerät
438,351,018 *2C621284D97DE5620098B31CFC5EF31936F7623B erityisenbsw
438,351,019 *2C6D41DBFB22B3D9FD36BC1AA4CFFA6A388ACD87 ERMIKOV
438,351,020 *2C6EBA3446CD99328BC75ED70BD9D7759C4948CE 11-umdefiniert
438,351,021 *2C69446E1368F49A9137E56883EE1AA67DC35B30 ELAKAST
438,351,022 *2C6462215E124D51DB368EC382EE5A8A20DA0742 1272241 tuolloin on my
438,351,023 *2C62E710CB72E315E2A83D78B2250BF4A13FF792 $ELFD0M
438,351,024 *2C6750F8D88DB1F5C85BC33A2F8FBB8EF4862B38 ertussendoor
438,351,025 *2C66B200187C658881105F81BEEF36C5DE93807A 1421177 rannalla.seisova.pikkupoika.on.taiteilija.itse.ja.h
438,351,026 *2C6F06780892E621FF90707E56C2117018FA322A estebanadamski
438,351,027 *2C684A0E920C4EA12AF7C66079A592935CC35128 1570616 KASVATUSTIETEEN OPISKELIJALLE KESKEISI
438,351,028 *2C6C511F0B584399976AD8CE9A95E96248CB259B ELISHABAFFUTO
438,351,029 *2C6A4199A85E9C592A28D3282432E7EDBF876F8F ets4&
438,351,030 *2C62D3D8B92B96FE42D52DB53C859EA74A3006B0 eu4et
438,351,031 *2C6E4EC4C04DC07E55CADED79863DB34402A74EC EUSEBIOLIVINGOOD
438,351,032 *2C65A6C5BC7A72ED742E5C754508D6EE5D07DF20 1829055 IFPS:NKENT
438,351,033 *2C614BADB5BF779AD9B3E3E07965FE2F0BAAB52D Emergency-Use-Only
438,351,034 *2C67C271AEFDDCD1BA18E75FB4830E60DEA0499E EMFRELSING
438,351,035 *2C6129D392CC392002AFB4E119DA7ECAED372C1B emilhurlston
438,351,036 *2C6D12FF5BC6C0C3C9F66B3BA4F4B15CC1245276 EMJ0S
438,351,037 *2C6F68C7FC86B66B760616F46FFB21E03351FBB4 [email protected]
438,351,038 *2C6A08EECA058ABEE502836A8488DF88945D8D0F ENDLESS.MILES
438,351,039 *2C6EDEB2FE9EAE731C8221223E1828DA87860825 EZEKIELRECKER
438,351,040 *2C6285ABCCD72FC8CE77DB2A661C63E02D7AD713 1-ADMINISTRATION-THOUGH
438,351,041 *2C6C0AF2B7735E821D6F420F397ADA529E9ABCCF EZUISS
438,351,042 *2C621A211CF0834A356209FDA891B11507B86606 F930203
438,351,043 *2C63A0F45B0FD26286AF12B8BBBD6A692AFFC802 ENRONINQUIRYNYT
438,351,044 *2C6E09C406F7266E898CAF95CFE148BCE9A616FB 1calmeraient
438,351,045 *2C67D0060B92A110FF0B14998F6B46E74665C1CD 1-DELSBERGERALLEE
438,351,046 *2C67868D24DCABEC865BD987E03D84456527DDEA 1-ENGLANTILAISNAISET
438,351,047 *2C6FAED5C377737E7D5684316823BC4987C8659D 1ERATREPUS
438,351,048 *2C60295651B2FE29A90A2D8CA65C3D47199E0396 FAUSTO.TRESTON
438,351,049 *2C6A2F03289E0592DF91EA72E204C487F7843ED7 FC7USER1
438,351,050 *2C6BBC8639AB1DF5C962A8B635F6C3688C7CBDAD feiert-das-kreuz
438,351,051 *2C6F8D667AA35EDF5FEB77ACFC65EA7DA022D54C FEMORALKANAL
438,351,052 *2C697298D669D475BAB4166152D20D6F6A945D01 1HUMMELHOFFIN
438,351,053 *2C61C5BE7AAFECBF8DB221A99C468B736CEC02FA FERDINAND.SEO
438,351,054 *2C607838029943D95903D05CA596DEA8F1C60E43 FIDEL.JOME
438,351,055 *2C6F447B632E750624841EB48D51AA5A7E2DF671 ericscarboro
438,351,056 *2C65BF0F3622CC675A1C73C94438426439D5D0F5 ERNEST.BARTLONE
438,351,057 *2C6E1F6E683060DF69BB63989E4FF394DBB07B10 Erogenic
438,351,058 *2C6822038AD80C18E7CE15087C590B98D175CF10 1mattone1
438,351,059 *2C6C0E08ABEB5E3FE9CF90F3BF84DAC96A61A906 1.neuvottelutiedotteessa
438,351,060 *2C65ECC137A87ABA8DB732A6DBEBD5479BAB0FAC 1 OULULAISKAMPAAMOSSA
438,351,061 *2C6F6AC9B7B45DF39303DD2DCB96158ECF22C3FE 1.OVATMERKITT
438,351,062 *2C699F54078DDF839C1EC63B116989B6B245AD80 1pecora
438,351,063 *2C6358803C198963296F3E6BC4170B605466014E 1PHAROLD
438,351,064 *2C6541B5A379937067C8C5C074E4FEBFF68D2421 1pii-rien
438,351,065 *2C64E40EE9BC17B013CBE9AD5E1A2CC260DBCCFF FNWVSULM28
438,351,066 *2C6AB06A9665FB0955FBF214C47F21C68F43E769 ETETHCRU
438,351,067 *2C634F26F14FA6DED6D6A25B0C103F61390998E0 1suolakaivokseen
438,351,068 *2C693D89550F60385807FBEA024E682FA50D51AC franciscoceppetelli
438,351,069 *2C6CFE12CBB2BA2CE7879A6B3EB6146118379D0D FREDDIEHANEY
438,351,070 *2C66CC10436F641A6CF020E3B56A2E98EF389D95 1 viisikymment
438,351,071 *2C6B65BA4099CED5C98122F24A8708C67FDD7C22 1.WASSER-VERGEUDUNG
438,351,072 *2C67FAC2BA8B992FDEC9AD1D183442A8595DF9E3 frisant
438,351,073 *2C67CB8C9A4E9809536072864BC81FF676D1CEA1 201381 YESTERDAY'S HALFYEAR FIGURES WERE A MODEL OF CLARITY .
438,351,074 *2C629017B01BD7DC8A36415D4BB2363D5F927A3B FRUMENTY
438,351,075 *2C63FAEE57CB94BF34653023A9B106BFB2579F28 212327 THE SECOND DRAFT WAS DELIVERED ON A SATURDAY
438,351,076 *2C68BE71F4859ED59F574E2DAA947191ED9C15A8 fusion.days
438,351,077 *2C65DCF54C8D2AAF5672F0AC23F33E6C3ED0BF67 G`2^
438,351,078 *2C68F6480072412BE1E856E74113C76E8980553A EZELDE
438,351,079 *2C6243F692851D85D76AC83D0A2FFC7ADF7EBD67 ezirotom4
438,351,080 *2C6D688A71AEA076343FEE7E2CEA074E0A8E9DE5 2687282 derkaltewasserstrahlprasseltaufseinearme.
438,351,081 *2C64FD06A7E26F4C3B0A9BA95CD1CB304621F877 [email protected]
438,351,082 *2C6F1A56AB2DCE61A9F9EAFD74DE9A631E72C238 gastonmilum
438,351,083 *2C6EA02DE5B4A4DFE3675CF3C15883787123B4AE 2ARICOSED
438,351,084 *2C6A8C02005ACFCCCC42399867E730832EB80C10 2bwithu
438,351,085 *2C6FC889A0564A82FF37B2F7522ED3493DF33443 genaroheiro
438,351,086 *2C6EF2AD15AA60C01E8D56AC851DB79CEBC8D990 2.manevradan
438,351,087 *2C6C94AC6B9B932E9CA46F85C0C9DB2C852A845D 2nummenpuistokatu
438,351,088 *2C6C3FA117898CE35EE4BD2FE978242D35330572 g/g
438,351,089 *2C6F37E6ED7EFF3E49B6AB26F3559138CD63C21B 2SPARTAJUGEND
438,351,090 *2C6A036B4107C3300F4E951B80B4558DAB99457B 2spithame
438,351,091 *2C67E35A0CADB863F08B8CEEF1311032E4A163FC 2uyarlayabilmesi
438,351,092 *2C6CE360B8B557CD38C0118CC463CF89199C0A83 ..-(FEAT.
438,351,093 *2C64D0DEFA9A31878E31BF34947CAEE6D7AE5C13 2YGNAICO
438,351,094 *2C6541B6F531709AAD4C06AD395AC738822F13A6 31-04-1223
438,351,095 *2C61AF32A629A4B77D581FDC21D5ECAC2F661D93 321951 bu gorevini 1998 tarihine kadar surdurdu
438,351,096 *2C6986B8E5F19EFBAB87336D97AF50FD07C1E926 GLENN728
438,351,097 *2C6EE8535351DD75E5102C10FDC3C4CB4EB631BD fernandezvargas
438,351,098 *2C6605977C8AACFEBB986F8D462E3CAC4F325BA9 fideris0
438,351,099 *2C67CAA201B46056679ABA223514B6AD4DD59A92 FIKCIJAMA4
438,351,100 *2C67663CE9DD9F882A520BF606DFB9C9B81B2407 3BANCQWER
438,351,101 *2C6B28D4E60B4FD9F92747B3502F581BB2CD41BE GOTISOUS9
438,351,102 *2C6E3DA11732A9C430FB7D4BB5C8136077D3A5FF 3==D-~O-~o-:p
438,351,103 *2C61668A611988D0D084BB67A148009C2E0BEE67 FISH1SMOKEY
438,351,104 *2C6323A5E827A372988F0C93D7E82EF92ECEF3B2 GREMLIN
438,351,105 *2C6E89DDC1EE54AD5EB243F3C7912DF97CF2BBF6 GUNSLINGER-N:-GUNSLINGERS
438,351,106 *2C658CB089B035C2661B8183A31AD5F57C1BFECF fnemp
438,351,107 *2C627C97D80C5624212574969986E280D53F5C5D GVXHBB
438,351,108 *2C6E1888F89AB82129AFA4836DD1961098AF44D8 FORACHEIMS
438,351,109 *2C6EF688EFF64E8B29DA3217A3AE40A702BD6E37 4 GURWARA
438,351,110 *2C6DA5A5AC15718BD7F5C448BD03BBE54E62FB49 4IAMGARDEN3
438,351,111 *2C67A0E4739515568889172D6147C0D960F85B98 haleyheinz
438,351,112 *2C6B9376A952DD3988C3581065DABE79F21287EE HARRYANTKOWIAK
438,351,113 *2C6B14EFC19A9EE036BEF8DA7544AAE37121AA60 50V!37!5M
438,351,114 *2C68DAFC988A33CACE80CB0EDE48B45C3FF7E3EA heehaw!
438,351,115 *2C6C2422FE6A1237630DD1C74BA6EF0419FBEFA4 5AKZKKQKJQW
438,351,116 *2C686DD7E584C56FB0D2F12C6F830767E098BDE7 5BALIKCILIGINDA
438,351,117 *2C64E27E68C97EDDF343E7E53F7E79C5FF89778D HFWK
438,351,118 *2C6182B49DCF6D29C34E68618297D2C61C57DF4C HIENOS
438,351,119 *2C6CF12CE11B7B0BBBD6F6F6264155B25BE311D0 [email protected]
438,351,120 *2C6C1453FF6600A07431A5004C6B4444C3FB0C1E 5ILUVCURTIS8
438,351,121 *2C6B533EDCCE26C104A310D2EDD43061C0115BF2 GARDINI160ITA
438,351,122 *2C627E8D44160E1A164AF3081BBADC143FC7E192 5KOKONAISMENOT
438,351,123 *2C6E643CEBE4B9376B8351771ED6A8019D8A1E1E HOLDINGON(TOMEMORIES)
438,351,124 *2C641A38D20BAF440CCDCE90B17FD5C2586694D8 [email protected]
438,351,125 *2C6318D52D7773AF1844DEEB73EDF3666B970AFB GATECRUFT
438,351,126 *2C6EE6C9995AAB8B90D8BA1324A870125A57D328 GAYKID13
438,351,127 *2C616E4D3207627A8E2999644B259F6402004173 GEBLOESDS5
438,351,128 *2C6759E2988EF427DE9A17C9EC59E85304CD763F HPOSILLICO
438,351,129 *2C66C33AADDD932EB7B157D178F575E2B3A11B55 genezupfer
438,351,130 *2C6DEC2B43F8384EED6C8029D71F685593D588B9 5TRANSFUSERONT
438,351,131 *2C622663EA58A2FE5CEBDC2B9EBC6B5F7D6514C7 HUMBERTOPERDOMO
438,351,132 *2C6A94D0B1ABC954C73B403C68C6C18E3FE67F5E gerardkoetter
438,351,133 *2C64906451A3D8E6B2F06F31E438B7A3E373CD4C HV;
438,351,134 *2C6CB9D5DC4E268C6EE8274805E115AF91F154C6 ghk9
438,351,135 *2C68969139FC70B99EF6D7BB00305772D6A042E5 6BSWTWOFLOWERBSW
438,351,136 *2C69505837BA16EA5042CC18D9C2B07C011C89A2 IBERIAU
438,351,137 *2C606ED5E27E4421473EEC2B3155330B4729D6DB ichigo08
438,351,138 *2C6ECB0D9096FE870D60F9370630328EC94872BC id8>
438,351,139 *2C69242B44B19BDC08BFC30672600CF15232ABEC 6DUBITASS
438,351,140 *2C6C6850AAC75588B94D04566152B1E02E95800A 6ETNANERP
438,351,141 *2C6EC0570B73ECE290E3D2EB6B54CF4E2F0ED472 IF.Q$.=."P".THEN.N16.=.80
438,351,142 *2C69A4B9013F4072E06193B5360F5FED8917AA8E GNISUOS1
438,351,143 *2C61ECD1897560F6B758BB283A6CEBA562D5F6AC 6KALHTRON
438,351,144 *2C6FBF2F5DCFD0B3C3073157E9FB250ABECF4FEA I.HSC.MOC.MITCIV.HSR.%.LIVE
438,351,145 *2C60F47C689EC045D4ED029CE325D89984455AB7 6mediodepressed
438,351,146 *2C6A1B6E319629A86B13E472115B4DCC56D4D1BB GRADUATION0607
438,351,147 *2C6C5A755442146083CBACE69B9224BC7A096E68 ILOVEDUNDEE03
438,351,148 *2C6BBC41D543590631796EF479FED31987DBC401 gregkordys
438,351,149 *2C63A72F9766C83D8EF2C622F32DDB769C42B7F1 gregorioblanch
438,351,150 *2C69420F76C8CD56AA9702EE63528D0F8E6EB75F 6TEJASVIBHIH
438,351,151 *2C603900B685A3D45B65F6DD51DE77459CB60637 [email protected]#
438,351,152 *2C680BBFE889E20D9B809AB4001F72CC460D082E greifenkrimis
438,351,153 *2C610CBD83F48F2C5ADC6EF7F220F849E465D2E9 GUADALUPEALIPIO
438,351,154 *2C69791C309FA6A114DE424EBFD2BF8706FC9925 770630a
438,351,155 *2C6A72179B04FB4A5517E2B4868023C54259054D INDRID$3
438,351,156 *2C65979D32FC516BA784B76197E6F6E663677D5B 798DBW
438,351,157 *2C6DA61321519637866C8099E58D4AF660CEBC98 [email protected]
438,351,158 *2C6AC47FE65E6D51DEA35EA91DAAA0A0045D3B50 insurability.
438,351,159 *2C6D53353DCFE570333D1D2F5794DE984CED4779 hand embroidery
438,351,160 *2C62D6E8BEF6A29228F16503D9377C8A4B15AD5D [email protected]
438,351,161 *2C6E5045ED77FEE8665FF2A597A4D5DFF706F7CC 7HAMFESTS
438,351,162 *2C67533F89FA3D7206B92472536EE1F23F65CB24 7HAPPYDAYWARCRAFT
438,351,163 *2C6DAF7ACA881160FF7B6C0C93E8AC4B0D6EDECF [email protected]
438,351,164 *2C6D7FE82AD4CFC159367DD06BBB0FB55F7A5773 HARRISHOUTMAN
438,351,165 *2C6CB372B5049AB80CBCD88CD77F4E2E1B51E95C 7july1552
438,351,166 *2C69D324259D57F1A6D51D5E6736682AFB14FD32 ISIAH TATE
438,351,167 *2C6F700E02B109FEA349262D80664514978C8439 issacteklu
438,351,168 *2C69CA6B974E94918175515E25AF1C4C1361C246 7OTIKA
438,351,169 *2C69D4FDD240DE7D09EDC63C99971B2E45EDB5F2 I#UQ
438,351,170 *2C621590D180A087882BE4E6B05AD394DF851B62 ivandescoteau
438,351,171 *2C6F1C72438B73F0C8013BFCBA8EBE2E66E509D2 7SERETMEU
438,351,172 *2C60604C134AA5F3BF69FEA62444BCC0CE10BBA9 IXCCARRIED
438,351,173 *2C6B9784D5FB5C23A9BE86F2BDBB2D5EB5341FC8 [email protected]
438,351,174 *2C693B7475771101578A671F92E369F8DCA5A015 J,)~
438,351,175 *2C6FDB4E75AB264B4E845581BD957FC1DF6F5962 7UETABLERTE
438,351,176 *2C61F6572AD18ACED97DF73867E8706DE9649B70 heiraming
438,351,177 *2C66BA1AD538E39983BE9451CF2C9EDEB380B8AE JARRODGOMZALEZ
438,351,178 *2C6F789C823240E6136B8D0EB6A3CE412D7E0F89 het-pocomania
438,351,179 *2C6237AD0D536270E3EE268BC2B887143305BB54 8EKKURTNO
438,351,180 *2C685BC18666EED6D9888819944CFE60810166BD HOLLUSCHICK8
438,351,181 *2C65A1DB9BD45A6CC4917C9F79D3876326E19096 8.L
438,351,182 *2C6BB63A297CF9F910848A548B6C614F9CCAFFC3 hot.on.your.trail.(kinky.movement.remix)
438,351,183 *2C6F1B22B9765EF632F512A6993442EC61DEB39F HOUSE55
438,351,184 *2C60DC6C98835CBAE7B5216244FCA1D775E87367 JENNIFER.CASAS
438,351,185 *2C6643EDDD73FF337D2400D421F0588B1806B47D JERARSI
438,351,186 *2C667AB0629A8FF745775C4BBAC228824071439B JERRAT
438,351,187 *2C650DBF73F771F8E4E9D004CF48E0482B15CA5B jessiemcguirl
438,351,188 *2C6F4DE10D6F617DA3C8274EA4A2EE14AD1C54DC 8#)~-`-SPLOIT
438,351,189 *2C68C611C390311E4EEEBFAF480FF8C7F45751A8 8TAVESIHA
438,351,190 *2C664166DBC136BF318308D317A5CFBED66DD424 8TENVTBEWNEVREHCYRRAL
438,351,191 *2C6FD5AF785FB1E7ACA172C120A131FF89007A77 8thatscience8
438,351,192 *2C660480443CB33A79435DBF224F2C7C3371E9D0 JFCFSF
438,351,193 *2C6466F5004985A2A4241662D4BF5C7DBE120751 8VOSKRRYT
438,351,194 *2C67ECB0CD117612D08138911C23E686A2E0938B 941643 EINIGE.FAHRGAESTE.HAETTEN.DIE.NACHT.IM.HOTEL.VERBRACHT..
438,351,195 *2C62D05E3FE5C8BDA25490570258E406E2C40ED7 [email protected]
438,351,196 *2C6FB60BE200473C69339ADBA90F6D8775D61D4F hushlol
438,351,197 *2C69D90CE491E284D2B912CDB94F39B972B876FE HUYGHE1234
438,351,198 *2C62736C03885241BFA9BCB6959CE9A11D00533A [email protected]
438,351,199 *2C632088FEF26532AD24EBE9CEC2204EB98AF00E HYH5
438,351,200 *2C69193AE30CFA2DB333E995DFBD1CCACAA7C37E 988442 ILMANTEKIJ
438,351,201 *2C65C33D359C5ECA06DAE0EE6281FD890A472DB5 990JASLYN
438,351,202 *2C61EDEC7F2957A1C82137ACBAAA2E1DE9C065B1 joangriffies
438,351,203 *2C6130287E63AEB5F51E1D6794027C2BE731EB66 9BLAKEXBSW
438,351,204 *2C6B5D5F02F917DEC503EC2C8DA334A7D56D22CB JOE.DARO
438,351,205 *2C6EA801C39AEA7D82EF1AE7B801B437B6268582 [email protected]#
438,351,206 *2C62C58C8FFD549BE172859E6C47D7ED94C89F8B 9CUPMARKED
438,351,207 *2C6C9687DCBC48C671909ACA036AC7D15D40022A IDUSWLB761220080222
438,351,208 *2C68D04106341C48CB197722CDDF6DA6D063B1D1 9KQKLBHV
438,351,209 *2C6361E10BA3A6D68D3288324A6DAF2446849BAA JORDANOCANAZ
438,351,210 *2C68C783F5AFB0F53E6FCFC2947E552F9C1923E2 joselupfer
438,351,211 *2C6C300C4C5C217CD2A199C6952188E53EC2D3D2 ifeoma.victoria
438,351,212 *2C60E103F605409AADE8B4981686E1DFED1E3540 IGGYGUANA1
438,351,213 *2C6F0AECF8F8668DBE3D03E50FD326D178C004F7 9OGNITIFS
438,351,214 *2C6EF993547DCFBA9F4259DA2507C674053A5B39 9OKTISIOT
438,351,215 *2C60BA18AEBA4FFD73D4F145CC6FAE08BEEADE47 9OPAKOSTI
438,351,216 *2C6D5347D3E5B70C9FC7E61326F45462008E4C9B ignorability
438,351,217 *2C6D78AFEAAD41FDBFD69F53F490D7233A386BE0 iii. un poco allegretto e grazioso
438,351,218 *2C6A474C15E513F4C1F9017D9830E1BCD8BA8CB0 joukei[scenery]
438,351,219 *2C6F8E14087C94693E1663B14C82C14D18433EA4 9PREUZETIMA
438,351,220 *2C616ACB51D75D53A692D1D64493A49DBC6B0E87 9PRIMADONNAEN
438,351,221 *2C6A73B2B6D5A9B3633B4175D76F3FB2A91ED5FF juantoleston
438,351,222 *2C6AA9F4F2858D9B1E47EA0D11489B61D2CD164E judsonlando
438,351,223 *2C69ADC773F37CF66B77381613B917A338E55449 9stracotta
438,351,224 *2C64ED272673857124C75B8D508AE04474BC3B13 9UKGGPEFKPJYH
438,351,225 *2C62306FBBBBFC378DF6C1CEAAA98C8BCA5DCA7C justinc01
438,351,226 *2C68351E11C5E1D5EC7B8751B69039BFF83116C7 [email protected]
438,351,227 *2C6DD736B7F9FE74FE00ABA65EC2AC62584D730B [email protected]
438,351,228 *2C62236367CE4340B8FDCFE20ABA65AE33B7F6E5 A1WME
438,351,229 *2C653E5EE823DC49D08A1D3D41D62BACB937F60E a3ksa
438,351,230 *2C60B1A633A7D9333FCF37C106FC5D920103A8C9 INEPHRAL3
438,351,231 *2C68A2B527E4F1D5863FBC5F3F3EF937E1193E29 a4vbt
438,351,232 *2C6D3622EB9CA79A5FD9D229B6AE35C6A4366732 A_5UE
438,351,233 *2C6402C54A71D392119A2FA5F996D60412D007FE kason26
438,351,234 *2C61AD48D31E2087E1434F98F27D3F761EB589D6 IRRATU
438,351,235 *2C6B7D2D5652897AD3720A9E2E0FE67BB192C884 KEITH.GRESKO
438,351,236 *2C6FFDE1C7C022F96553F3197F42247776D08551 kermitburrelli
438,351,237 *2C6C2E4ABC5D88D2FC8547B3FA92FB8BA51E0D14 AADPAH
438,351,238 *2C6E1B8291F368D237570F7E98132F366F9EDA58 AAE`V
438,351,239 *2C6CAF6F7C90A0C4B9E141EE49C52980E879F82A kevinsar
438,351,240 *2C6C1E408D1171E8EDA6380BBBCA428632E5AD92 KHEBLVO1
438,351,241 *2C665C04EE6878D7482FFEEFEDED0C6523CC1FEA khiet2324
438,351,242 *2C663F39A8D86E74AC6825D9CE6846F30E7A670E khuvaidullaev
438,351,243 *2C64CB885D8E84DA88D87162F98935DEBB0F44D3 aaronkennie
438,351,244 *2C6024471A43E6B91931B9FC1C7928D09DDD36D8 ITAMAYAM
438,351,245 *2C68A935AAF3EBFF0C4372911D9DB1D100CB2833 aarrg289
438,351,246 *2C679D1C9D972A6DBD5ECFCBB197339B89EBDBF3 KIMBERLYCREEL
438,351,247 *2C6456840B40088FE073BCECA68A44502DC565FD ITSCHIRGU
438,351,248 *2C64B9634F4D2ED816F8D96B169197A9A7C1B3E4 IURSSTEN
438,351,249 *2C6D0203CA91A75150A87AE07D8842602B448C43 kirsty-pettit
438,351,250 *2C6D90FF80200235DABA74DAED4329A0FD07603E IXETIHSES
438,351,251 *2C6F6828F9E6DFF9147B90C06E142964B2E61608 j-0'
438,351,252 *2C6B832E9B28ADA176D892AECE5C6CDE0CF57501 kombinadik
438,351,253 *2C64425A3390E0556AEDA681EDB968CF2BA2D2A2 [email protected]
438,351,254 *2C6C281B0231E16E0F3A852093D9EAEC14F58CBA KOWE
438,351,255 *2C64F123AE47B6D21F8E07485890C2B08B76D2B6 kqxx
438,351,256 *2C6142C5E2B2CAF0ADE0B78A356E6F7CEDC5C405 ab+up
438,351,257 *2C6DA3E3F749D2DC88AAE3616874152999E993F9 k-tp
438,351,258 *2C6381FD87653BA230309175FC1E06361CE78817 JAMIESIEGRIST
438,351,259 *2C614DB2F87388D54FAA30ADD80D0E305B24FE28 janarawlinson
438,351,260 *2C6FEFFE32F96E5CF88CC53AFD19DD5A375ADADD jarline6
438,351,261 *2C6EEA890F4BB4C8CA972C225101DA3BFA44CC0A ADJTL
438,351,262 *2C6EDBD137F82B3B7D933543AF0BE94975CD22A7 LAMATEX:KIRCHE
438,351,263 *2C60C61E9B087281B8DD29A2AF08E053D5714AF9 JAYANATHGUNAWARDANA
438,351,264 *2C6FE49619AF072251F91286495DB44A7EABF5BB ADVERSO8
438,351,265 *2C618C8B60B77C7E11F68F506EC1698E150F112D LAQUESABE
438,351,266 *2C6DEA87D339750EBCE3A8ECAA58C055524B18FA LASTABW
438,351,267 *2C65E6525BCDA1B24C238ABC209CDF6A4645DA52 L]E
438,351,268 *2C6C7FEA0657907234E61D93B8FD9BFD5DAE0B91 legalize our love
438,351,269 *2C656AC120E9752C19C1A0B4C8F8F17A8C7FB595 LEMENDES
438,351,270 *2C6C948373AA16F13D7ABD28A6C7F3A6DAD565BD JEAN HOLLISTER
438,351,271 *2C685CDE43931C9C5EE85D23C5F636965437929A jeffcerone
438,351,272 *2C605DD0752B81BDE9525E0290E040946AD8680E AHMAD.HOUT
438,351,273 *2C637F08CEF6DC444D10FD06179E30C0CB311667 leopoldotangerman
438,351,274 *2C6AA7AC1696235FD27B402419193AC311D1CA41 jeffery.mayo
438,351,275 *2C6878E5FCE33997EE0BB2DBB6D10C2945E4113C jefferystobb
438,351,276 *2C6EFB5E22868FAAE1681D1CD5655E9B73C80F53 a:hql
438,351,277 *2C6048DF18381F2CBFBB7385838B01B286DD5805 JEREMYGOTTRON
438,351,278 *2C6D3DA30FC5105E18E6A6BABF25D23F20B0FD8A LEWIS.SELVY
438,351,279 *2C6247138D4058FBE4FF50956A5203CAD915F065 jerome.arbiol
438,351,280 *2C69B19E5B95900A0B3CB6F99C45081F3E841566 jeromeprocaccini
438,351,281 *2C62B1AD25B1F619A2B7BF61E20D0EFFB949D13E aiuav
438,351,282 *2C641669D035246147AA5C0BA57F041F85A3A0A7 JESSEBROMAN
438,351,283 *2C64E3670B354F5A2FFCE46630C31427A2CBB9B6 limonkping
438,351,284 *2C6BB400AE8A8460675EEA7C0D6236517F8049BC JIMMIE.MARSLAND
438,351,285 *2C61E1ABCA025FD1EC08F33F838730ADFCE55F14 alfredosozzi
438,351,286 *2C677361E651D32FF70BDD3334217020F89EDCC2 ALFULAIJO
438,351,287 *2C6600E7771206AE7190AF22F8D3A435CB5B9B3E LIUNELSONU
438,351,288 *2C61C6435AA385C0A12A89D87C6A91A39E6761C5 LIVE.FROM.EARTH
438,351,289 *2C629CB56E4442C951FB6B4B80BDD95BA6568EB3 ALLTOMORROW'SPARTIES(LIVE)
438,351,290 *2C6661AD8F369DAB441D2C7A8BF425C152444222 alonzopersaud
438,351,291 *2C6A4A272D6B0A68528776DB202FA3324064A283 JOHN CAPOLONGO
438,351,292 *2C69960B105C6FC97530362FFD4473F150C5A24D ALPHONSO.SCHOO
438,351,293 *2C6CCC249DB717BD17F55D2FA8FA6A6CCAE82099 ALTONOLIVARRA
438,351,294 *2C6EFC8AFDF9E553EAFE7663FD2DB54B28E74BF3 LON.GALLAND
438,351,295 *2C607DE9D0D1DB27264557938DD4E0925AE4B4EA longmadkins
438,351,296 *2C610FF2AB3CD5AB927F57E38299DB5B9BF6ECC5 [email protected]
438,351,297 *2C6365508306135EC38DD72166B65B81726201AA lookdon'ttouch:29
438,351,298 *2C6F8B97C39A169E84BD2AA13AEB68316E14D9F4 JOSHRIOPELLE
438,351,299 *2C6CF11AB0D7A08CAE5AAEE9C1BD79309A1BA693 AMARGOSA3
438,351,300 *2C6B22273043AC74C8F6189D74368A01A6B019F5 AMATADAR
438,351,301 *2C65BCC8FFD584346528F3660AAB350869AE10CC JUAN-ALBERTO-MUNOZ
438,351,302 *2C60E9155592FB5171FC43DFB0E93CDD9875B4DF amosmelian
438,351,303 *2C6FA51D19753BFA5C65ABC73612DA4DBBC35E88 AMUETAMO0
438,351,304 *2C6AF84829A2544CDC5043570AFF2A8CE81CEF89 JULEBSWING
438,351,305 *2C67465249849DAE44A55ABE1E555D7FB3FAAB93 justinseifer
438,351,306 *2C6A4C951398F65B09FDE48FA77840D15CB07B89 luciencronholm
438,351,307 *2C6D2E87F35D01638DEBC3E981C6D58A2E40FC54 J$XY
438,351,308 *2C649545DC06B933E436E4FAAB23FFD3671E7023 kaisuwej2
438,351,309 *2C69F088F5E86C8A04C858F0663CE6F48BC0B5AC KANADAFANTEZILERI
438,351,310 *2C641735C3B9255F359486C078F4649F30AFE986 KAPANTAIS9
438,351,311 *2C6DC7350EFE5602B0AFAD4669D048FF3D604FF5 KAPNOMAR9
438,351,312 *2C60D717E8986FAF5ED54053AC9CCD2349809406 ANGIOSPERM
438,351,313 *2C64046F9A644A41DE4BD694D8A82157CF49263B animosity album sampler
438,351,314 *2C60D9307DCAC46D7E8FE89B6BCC7E1052CD5BD4 LYNNMORLOCK
438,351,315 *2C6EA2558D508E459BABAF62B9F44E28E6267D93 annabelle059
438,351,316 *2C686BFF8EABAEAD2523EE21020E87DB1670F2E1 antionefedorko
438,351,317 *2C61E744A9473A5E608EE31C4A8087EA28DCFA17 ANTIONEMAGALONG
438,351,318 *2C6D3877684424F677109114415F316FA5372409 KE%L
438,351,319 *2C63ABD0F3FB9104D21D354FFC8CA496162F3DD8 ANTRENÖRLERINI
438,351,320 *2C6D0F23F80348F9AE014316BE595FD0A48E608A AO3QW
438,351,321 *2C6278A01B3935B04A178B925A8DAF23CCE6C805 aossepmm5
438,351,322 *2C6CA6D9634AB8C9BFC422192879270310A655DB MA2990
438,351,323 *2C68A7F6A889DC006145A1DD1A378234C5CCA2BC APRIL-IN-MY-HEART
438,351,324 *2C6AD4084ACCC158A03C48B9A3A31EADDA83B78F [email protected]
438,351,325 *2C603959CA0D7DFD8C9C9D123F7D3A7417E58E8C kerrimphillip
438,351,326 *2C690FBF6ED154619FAABEE6BC9E993599964473 malacca_cane.m/@/'l/&/k/@/_k/ei/n
438,351,327 *2C6E184D6936A1F46B9884E1C16AD8A25C0F97BD MALCOLMHOUGHTELLING
438,351,328 *2C644854F3BF306B15CCDD65E1851583426D4FAD a-qu9
438,351,329 *2C67D0DAF3BF86B4235C32490D24956392C399D7 ARIEL.MEHR
438,351,330 *2C6C37205732F9558393BE8F42B78BDF4A16185D ĀRIENE
438,351,331 *2C600733DA99E46A90A8F5DB4D43C3AB48EFCB04 KINDELRAPID1
438,351,332 *2C636DE6B9AD16EF0524D3DC454C58A770DD58F0 manuelmuhr
438,351,333 *2C65DC9AEBF5EFFF05CFFA317D23F7FF29DF37E5 KIREECE
438,351,334 *2C66CDF66BDE82C368CF766EA52B5DD9CFF985BC marcelantonucci
438,351,335 *2C6BCC35FFC1B182E92975CA51FF958CBACB6745 artabra”
438,351,336 *2C64B8BACF9DAFFA07F53246CB56EFF58FF72E0F ARTHURCALVIN
438,351,337 *2C6C3A0391FC9ED3302917C0FF5651C6354C9888 KOMBAT-KATZ
438,351,338 *2C60719E1551F92A9E7AB0C1A6AFFC0BA89218F8 MARIZINI1
438,351,339 *2C6BB214580288774D6749BE4915945485785D4F KOUSHIKNAG
438,351,340 *2C6E8DA34DBEE77FC492F749F26FF460801F479D avionmairie
438,351,341 *2C634A71C15A1440AD8DE75FD5D8EC9DBA394D47 MATHAAING
438,351,342 *2C6D613443BE78256B829F676B08A2CAD336E2E5 matuuras6
438,351,343 *2C6869A3FCF0EC9E49D6E5C2155148C29624B9F7 MAXIMILIANPROJEKT
438,351,344 *2C6BC5CDAE6C2E75CD58A475C8EB06AA66DDE681 mbrown210
438,351,345 *2C6D369596A395D6BA0A655718DFA501864D0301 b1rwb
438,351,346 *2C6877C27D3A4DEAB5A9FC7EE7BB5669BE205A6E MEERA-SEECHARAN
438,351,347 *2C65D650F42C0FA84A18C789B7B8AA5213406B3D b2rk2
438,351,348 *2C653CECDD6A958B5E9921E43A7F31E2AB461938 B5j&
438,351,349 *2C6DBA35EC47923413C13F54696638313D45BAE4 b6e9g
438,351,350 *2C6D42224BB4203A2372A4EA86622F6BA24326BC B7NE)
438,351,351 *2C6903F6D87A2A15E9832006638E6916AEB154E5 MENS-CANDIDATES
438,351,352 *2C648FA1A392453A2F7EB661093FFC30B6B371FC B9NS3
438,351,353 *2C6F6A6C802EDA20B3FEC78C652C07F04F172EFC LAURENCE.FOILES
438,351,354 *2C657E6E95E1449DF813A55D9BEE28BF5D4F71EA LAZINGER4
438,351,355 *2C65CA21BA437C0879598807F9843A6738A0B014 L]E
438,351,356 *2C6AD48E373E9F1A2945167CA0941291CF7A0E46 BASEC
438,351,357 *2C63B50CDAC8D5D18B9FE31D277286130655DE7D LENNUVAHENDIL
438,351,358 *2C6A45B08D407D2501E9444BD5A502A383406D94 MIGUELPUERTO
438,351,359 *2C693D1411C4BA30BAFFC2294215CCC68A24FBC8 benjamincourcelle
438,351,360 *2C6ECA083FBDD2E87DF96CC697F8C474B8C8DCBD mileskubeika
438,351,361 *2C685C27DE2E3EB4F17AF43FED0CB91CF33369BD MILFORD.LAGGE
438,351,362 *2C62D8C7EF97AE03B106BF272603CAE854E2ABD2 BENTONVANDENACRE
438,351,363 *2C6D3640C55E3BA63D64FF0549C0D38EC823A763 BERGTOURENFÜHRER
438,351,364 *2C6D17093DA090C94D436438625C996B66F1DBF9 bf7kn
438,351,365 *2C6EC60E07ACF459B5CEFA983163477D885A443E BGG=9
438,351,366 *2C6F04592344ABE15398C2670D78EFCA6F925508 MONTEBORKIN
438,351,367 *2C6F15DA00EF7CDF7D269F95FFB0073F8352A8BE bijrivieren9
438,351,368 *2C6D7486D6CE100509ECCBE112D393F18C4C1E95 BILLY.ORANTES
438,351,369 *2C678D94DC0C3DC01048463579C3A13081A27AAE MORLIT
438,351,370 *2C6CEFC426114620902059AA934CDA8569FD280B <LI> THE <TT>$/</TT> VARIABLE CONTAINS THE INPUT ENDOFLINE
438,351,371 *2C645067991322AC881A4E939AFD697624F29B87 mpho.mothupi
438,351,372 *2C67DAB52C0B711F576C3D4059CB65AC6466A3A0 MPROHOROVA
438,351,373 *2C6DA9CA48A1A5F08C0D44686F8E2ADEEA8684CD mpu's.party
438,351,374 *2C67C3D19C786EBA2EB81ACFD48B60A9EE4189EB BLAŽENOSŤ
438,351,375 *2C621B3B5DD2E078709E6DFBF50C76E41D25BC7F bl-$k
438,351,376 *2C6A15894297F5FBF2583D38FAF1AA4CFB7B42C2 murphydragon
438,351,377 *2C6F440360C66C4578C7605E711414FBEEAC3AED BMS$
438,351,378 *2C6B7D0982655B1A10102053EA42B24932D05F4A b_my
438,351,379 *2C6A277D37C1763944EC2F2B7C136451D4597E0F LOONYPUFF
438,351,380 *2C64FB31939F25A5309FA037BEB3C2C2F5C4EF24 BO3QV
438,351,381 *2C6AA5DD8FBF982496515D69D89E38C6AEA5849E BÖLCSŐJE”
438,351,382 *2C602F8CC163793130AC83D6CAF3783F144679E5 B=>~O~O(^_~)
438,351,383 *2C639277240437DE3B8C7706804404F1BB413BE8 mymarket23
438,351,384 *2C6C080C61089720477256D9D2BFF5F88E03743E MYRON.KOHS
438,351,385 *2C627ED0D8184A0A843404B4515031CC67CF5BD7 lshauno8
438,351,386 *2C6403F93475BB886663D278E142F5EF9761BA44 b_p+s
438,351,387 *2C6009280AC10FFA882077926B6E425B3142698C NAANOUL9
438,351,388 *2C655F540E25B00976C2E1BC310EF09070C4703C BRAD.OSUNA
438,351,389 *2C62B2B09080B847BCDD323F18EE02567E7A27CB LUNAVELLA
438,351,390 *2C6FDB9622C74EF18148B22AC5AE16184E89D2CE BRAINGEARHEART
438,351,391 *2C608B35E45F6C08103F0031B389BAD4B065FF97 [email protected]
438,351,392 *2C637BD8609BDD8446F5A89DB8B54D03AE810CC1 brandenkitterman
438,351,393 *2C62AF7F22841633DF0007076F9EDF0A9C82F0C0 BRANDIOWENS
438,351,394 *2C64A86E34CE268C5B358CDDBCFA2CC8163F03C9 brendonlemmings
438,351,395 *2C6460E804AC327FF2BFE8944C71F0B1E36AB993 lusus[email protected]
438,351,396 *2C64BEC26BD92B6A575FEB03C94766BA48CE2375 LUTHER.CHETELAT
438,351,397 *2C63347E9D653FCAB4402673A2DDF7920FEE71D5 BRENTNELSEN
438,351,398 *2C6129C12B5065A611A17B062E8F624707073AA3 nathanielbega
438,351,399 *2C6BDF4CAB52958DD210041E93BC5F28DF1FC615 BRODERFLELSENS
438,351,400 *2C6E7D72150BED6F0F5764FA8E71679E215B0CA3 brosnachadh-catha
438,351,401 *2C685A6F731DCFE221AC2002A31DC4275F95A79E NEVILLE.HOREN
438,351,402 *2C66A9DD167FC01768B60FDFD296B4154B39FD3B BTT7.
438,351,403 *2C66D9BE41D40692DDA07525280ABBE197E7DACB N FRANCO G
438,351,404 *2C6FD3451EFB7EAC17C487C466D365315C8D4AED NGARRETS
438,351,405 *2C66E1ACD8AE35D8C1DF06A96786A49A1B770E97 bufordladell
438,351,406 *2C677CD83D6B25FC113F18F93BAC30998C0775E4 NGUYENVANTAN
438,351,407 *2C68B0CFF3E4AE7AA68DDAFD9D88B6C3D5DCEE82 NICKYHARTGRAVE
438,351,408 *2C6BC5FB74F59DD23BF2946B58EF18854A6E017C nicolasdonnelley
438,351,409 *2C620151FABF5DC3928D2949C57962F2900AEAF0 NICOLAS.DONNELLEY
438,351,410 *2C634EB15892B51751A0977A9F0213EDCCE83FDD nicoleanne
438,351,411 *2C627D1C37E0F64F1339C531E88FDE7A4FECF01C BU:VW
438,351,412 *2C61F2345689130ADFC0B4CFBFE5DB18CD2CEA34 BVCNM
438,351,413 *2C6930DF960B62DECEC69D4BD8B8781564DABF33 c/"3
438,351,414 *2C6931F0456A0BFDF18C4B24FED50BAF322B466F c7?8s
438,351,415 *2C63F86983BA124055A34D72C4E9567297F3FB20 cameronkacynski
438,351,416 *2C67F15B675AE1951B463BDB043AF1993C235F5D CARLTON.MCKOWN
438,351,417 *2C6ED13527C122B4BDC103AED22F53CE30FE40D3 CAROLIFE.DAISY
438,351,418 *2C6768A00CC457A389C779738F2721AE025083AB NONREPREHENSIBLENESS4
438,351,419 *2C650CB2CEC73D591EA9089395B18F852686F19F carrolmulliniks
438,351,420 *2C6F8906C712C01B52F5B8947631222B27A8D22C CARROL.PERZE
438,351,421 *2C61659DBEE148016B40AB162168FA8A716F115B marshallstoeffler
438,351,422 *2C68940991833637B29491388C320AB707158CF2 CASPER.PIETERSE
438,351,423 *2C6406E093D8534CA34695B650DFFF7FC84B7410 MARTINOLIVERA
438,351,424 *2C60F83E49C1DECADD301FD6FCC7F449C7B4E354 matthewdriscoll
438,351,425 *2C6E88D9AD0D4F04542EC39BC4822A0978729894 maurohoiness
438,351,426 *2C63B57060456C0EBE0EBFC235611912B5FE63D6 cct"g
438,351,427 *2C614BF9DCAF0FFB4335768BBF33FC25DA4258F4 MEGHRAJ-SHANKAR
438,351,428 *2C68C1283A40EECB371476A486EF5A0DB7990A95 ce3h
438,351,429 *2C6CEAC57DE62F6D5E5259D50A00365F8D5767D6 MELNYKSENFRAKTION
438,351,430 *2C6C1AF9AEEB879F4F978E4A6A170452017EF71E merlingentle
438,351,431 *2C6E8E0871823D835DF5EA370614325878B6E02B CFFII
438,351,432 *2C6C614747EFB2D0282427057567FB62C2DC1C7F mfoy
438,351,433 *2C6E874039CD3989C36F50FD39BD846AFDFDE711 CHAMPIONS (FEAT PMD)
438,351,434 *2C6CB448FE75C811918E002CE333D80F7C07ADD2 micahgrammer
438,351,435 *2C61F66FFBA9F391CB523E276D25DD63961A208A CHAOPRAYA
438,351,436 *2C6EE9E5F2E7E50B93FD44A72C1974DC9F1B6D4A chasmulready
438,351,437 *2C63CC0CB80D37720A0B150A32F3114D328A633B CHAUNCEYHERO
438,351,438 *2C6B3F35515C4D60BD0D88D197F8282D8D9B729D [email protected]
438,351,439 *2C6F893E980EE64EB94B9B87316A5B9C333A555C [email protected]
438,351,440 *2C6CBEC2ACE480517E0C809AA4E6251D6AE15C80 [email protected]
438,351,441 *2C61DC242528143AA055DD5FD8D292108B95B86E cheryl.ann.lee
438,351,442 *2C60C2991486F1A1F3949FEFB9FC2B92F518C133 MICHIGANRUMMY
438,351,443 *2C6DD970DEC3E388C7E003AB828D9061E88DC383 chitties6
438,351,444 *2C67E388889D4ED29D8926247CED2C2900C99DF4 [email protected]
438,351,445 *2C641F3CA4A47F502F6195BCECEF437937A7AD36 OLYMPIABASED123
438,351,446 *2C636A087CB177FAB46FC815F51F59E0E9BA5A27 M\IP
438,351,447 *2C612CB22805BC7BC8213A20C3382460CC3A3314 omardudenhoeffer
438,351,448 *2C62C95A38F00370F3506E80CF77C42D71FE70D3 MIRECOURT5
438,351,449 *2C6DA97BFC9DAC5B04C19207565CD2C85ED5E9ED MIRROR.OF.STEEL
438,351,450 *2C649EFC03EAA7DEE7FD8494005CB734BCE808AF christiajanuary
438,351,451 *2C6311380259EFBBA1F2BDE5202C6C57A340F59C modestotatum
438,351,452 *2C608E3F1C4C11E5ADAF11BE61B48D85281F808E CHRIWONMYEON
438,351,453 *2C6268BC99AD72FE9A491BB025B28A184A006A8A OPBRAADT8
438,351,454 *2C61D91D599C4CFBFA17B12B3EE1E97FD2763A79 oppositionambivalentasgovtralliestosolvekurdishissue
438,351,455 *2C62FDE58F87CE105625F605907C7ED389C206D0 c_hve
438,351,456 *2C6EBE700B28EE7B84D20C0F0EE6B1770EFE6AAF CIQ4
438,351,457 *2C622D2376788D4C92AB72DD9E0CB94B726ACA81 CJSOCCER23379
438,351,458 *2C64A9B956BEDA9F6FBF225743FC6B91A86FE4EA ØSTERBOS
438,351,459 *2C6ECCB35D1C64C012DF2B6D879C0AF27E3490CE c%kvb
438,351,460 *2C60739034A697EC01E7FB02E3AE40D7C0728F45 CLDIV
438,351,461 *2C67D3445051FB9E01DED8A9AB5466B7FE2D67B6 NELSON.STONEHAM
438,351,462 *2C6B2A294BE698BC4DFA7D6C4E542ABD1189B9AB nf6xnetwww
438,351,463 *2C665B6857DC8DA5AA3AF635C609C019F4CCB724 [email protected]
438,351,464 *2C6DD8D21C12E32FA83BA63D1BADE30D9D3E7973 NICHOLASSTRID
438,351,465 *2C6DA2F01051606DEC6F572BE0519C412FA5950E NICKI-MARTIN
438,351,466 *2C6277A5AE07680F978D900FEBCE42E0B7553A85 NICKY.COLEMAN
438,351,467 *2C6AAE29ACBEC8D40888FCB1433F4AA661D87951 NINOBUCK
438,351,468 *2C6A77FB3AAC07C939F88220BF6B3F061E2CB51A NLSAINTJULIENENVE
438,351,469 *2C69A0D3892286A75B74AB105E94481836F8132D nnnhmlchktn
438,351,470 *2C6F935AC639C001C250F73A595F4141EE0960C9 nonargumentative6
438,351,471 *2C6D4D2C005ECB1B8A6E72593497021975BF4A6B NON$UBM1$$1V3N3$$
438,351,472 *2C66A67B7A069BBFFB62904BBAF825FE10B38706 CLINTPRIMO
438,351,473 *2C694A8B771D4E9E2C457F637AA7DBE848193A27 PA7!NAS
438,351,474 *2C62C77B97FB15DE2CD3669F4657123AF01BAB1A NUGR0ZR4P1D
438,351,475 *2C6D443336F7278A5C03CE58E969AA22A242444F cnaw
438,351,476 *2C64FD05531EE6055F8FB8551B822A056AEB7430 }O{<=8
438,351,477 *2C6674D8AC75E841CA882BC6D66ED6AF36631789 Oh,tofindtheKeyoftheTwilight....Thisisanomen....
438,351,478 *2C6B92083ECE31C313E9D8FEC625C35F73A90D85 partyrocker
438,351,479 *2C6AD17955209746049B05BD02A41AB444C0FD93 [email protected]
438,351,480 *2C694808C1454DE2986A9169680EC91B2DADD026 COLIN BLOWER
438,351,481 *2C65960AD5A77D2DE8C4A60CAA4E98305541DAD8 PATRICIA.KAMAT
438,351,482 *2C6F4D50718D0A3F5EC584B9F8E9105E0562EEF0 OLISSERR
438,351,483 *2C66FB794949CC7AC63EBF7BD40B416F0DCBC296 collejased
438,351,484 *2C6211AFB4EBECE7570AAC9E91AC2BF867D7B81D [email protected]
438,351,485 *2C692059A6037FDB08CA7572CBC4308B3C48483B PAULA-MATTA
438,351,486 *2C6786F6EDC59CC16684E22CC2A4A7295F722D69 oneirophrenic
438,351,487 *2C63BE6BE37D11A667B84FADA103B6E1FA9EE2BC OOOOH...
438,351,488 *2C6744E824E1B7671F4BFAEE5E39B44222B011DD PCASHOLA
438,351,489 *2C64E2B2C2456292D85A283AA3AD6A7ED13A7F79 )O(~ ~ @=====Q
438,351,490 *2C6870106E6E66C74C52AFE52BD003E362FBC7C6 ORFEOEDEURIDICE:OVERTURA
438,351,491 *2C6A9310BF10FD38699555EDBD1CBDCD48534272 P##D~O{X}
438,351,492 *2C6633EA53B0A7348E12CAECB9A9C3B2434249E4 CON+GUOUSLY
438,351,493 *2C6A218E4E3E6E371E792858FDA6C9416B1E3820 oszillos3
438,351,494 *2C6C8A201738E0CB4A051ED5DA31B787EFB10121 coppercookies
438,351,495 *2C646EF1A6D27506FE301E7AD2BE48D73823E643 PETEBERTINEGMAIL.COM
438,351,496 *2C6AAC68DBA87336696FD459BDD2FF20D40A924F OUTSIZED9
438,351,497 *2C62C7D789ACE1C101A3F18BF63AFAA401B933A0 PFAHIRAH
438,351,498 *2C68499CE36A6D33F2C62C0695E8846B1C8F7B90 COURTNEY.BENES
438,351,499 *2C68B5C6456662B4E712573DA8AE370EDBDFC996 COW(#
438,351,500 *2C69DAA5DFC547A5BBCD007547159A3984B368E2 PABADAM(PAULLEGEREREMIX)
438,351,501 *2C657D33F9C7C68963D94AEA2479AB9A8447BF6B pam-fournier
438,351,502 *2C6DA4F45C073DEADFC9E063AB037BA5B6446DBA C:\Program Files\Microsoft Visual Studio 90\Common7\IDE\ItemTemplates\CSharp\Data\1033\DataSetzip
438,351,503 *2C684CF6CF2DC969E50C6BA6F5360CDC52D9B2C2 PIE2A
438,351,504 *2C6A160807C262C06C3A8FB6230594C0BDD725C2 [email protected]
438,351,505 *2C6FF75628182BFB17DB150E8805C97BFA93F6FB papiškės
438,351,506 *2C646139C05C399452355599FEB1F968687E9733 PLiisut-viisut-(feat-Heikki-Kuula)
438,351,507 *2C6A64540CA5227436159EE3F4D1C75B6B0309B0 crista 'kr/i/st/@/
438,351,508 *2C6A335B94468C5511D50C4632ADB8FA9B7C283D plotel
438,351,509 *2C6F2605179632A01B3FEECEC9B4D78504D34A91 CUQIE
438,351,510 *2C672DCB9D21A89E901DF640F744EC6DFFBBFF25 pouvanterais!
438,351,511 *2C67BA3A6D0CF9D12A591005CCAB4825B9431EAD c:v5,
438,351,512 *2C6715391B520CE427A3B26D2D544831650C12F2 c#vb_
438,351,513 *2C6AEAD7D72E33955114508C5E20DEDBC4F931F2 CXY5Q
438,351,514 *2C62C2CD78F77729D9F227761840D57999B70A55 photosarah1
438,351,515 *2C60DCEB0929FF4B828A7E987C9C0407F149120A pilardoparagas
438,351,516 *2C6228192D1990C277BA44C5D4863B78838E0511 PSIOCZYC3
438,351,517 *2C6126F066C3104805DAE41A2A6F9AADF09BD32C D6US5
438,351,518 *2C6E59E64EF9BF1D50131094A9CF04112894EAC8 [email protected]+3
438,351,519 *2C62E4DAC6676A95E53B91997CB0DB0E450EF66A podupre5
438,351,520 *2C68D85F6EB22C5E18CBB816281DD30BF02F3F69 [email protected]
438,351,521 *2C6DAEEB836DC0A576E934985704B28A6A92BDC7 DAAED502AF6C37E34477E1DEE6CB38FD-43437
438,351,522 *2C6842ECA6E015031F70CD844FE4BC4360A66063 [email protected]
438,351,523 *2C675071502888446A088CEFD4DA9B8CE88069ED qj$a
438,351,524 *2C69C14D8F0415FBFED05E0C630FA4A6A3DE99DA DAKHALLAH
438,351,525 *2C6144445345870A364168EEACF31290D55F93A8 pouparia9
438,351,526 *2C6DF766F4D6DD8DD7B3918BFF0254ADBD9D3FFD Qua$inor
438,351,527 *2C69867C42B6128598D83338E3FD46ADF4F6990F P=====>~O)X(
438,351,528 *2C694B5A7312633B3CA0B941FDCCA16E947A4B0A PREMIOCASATELLI
438,351,529 *2C6D38B6847624B9D652F692ACF53F6E3E22A2BA darenrecchia
438,351,530 *2C6A3AD1E8B2697FB678D495D7107121EE96B668 DARKNELL3
438,351,531 *2C674B4E5B1EA0D9E2572C99791C709B0EABE789 PROGRESSOFELIMINATION
438,351,532 *2C60787712C5DC9E93B1984763C1C997A331D6F4 raleighhenkhaus
438,351,533 *2C672C52A9FCF3CE634669A1606B76DE9D7E4131 raleighjaekel
438,351,534 *2C6DFC38FC7EA1B6DEE922CFDE5A1D7A6BF916CC [email protected]
438,351,535 *2C610305BBD415189B0498A259EF5A7C9653A632 RANDOLPHLAZER
438,351,536 *2C643F6A11E062A80C57A2D7FE25E425A47EBC35 DAVIS.LENIUS
438,351,537 *2C643DF5A62E0775BF844F5B75E64573E0F5831A randy-tull
438,351,538 *2C663C546E90187E1C21F8BCED35791BC39161E1 [email protected]
438,351,539 *2C63A367D826245FE43639CAEC77C209F3572393 RAQHCNMS
438,351,540 *2C6DD6FAF7D345D49CFA6CA5B2C23D0748CD8EDB d=bac
438,351,541 *2C67FAED487E27D471D839DC24964A1225D775EF RAYMONLAVENE
438,351,542 *2C6055BAAE1902664197531636622DE428DE32F2 raymonskoog
438,351,543 *2C6FBE63BEEBC28C3CEDC8886E351948ADEA4307 RAYMUNDODAMPEER
438,351,544 *2C64CC6D33617E55C68BBEE6F5802EB737145026 PYQHJX8959
438,351,545 *2C631A3850EE2510CB295872E5A25AA6DC56FA56 DCI"Y
438,351,546 *2C67CCD48E54DD75FEDB06C28995B22E7B65FFD8 RBIGTIMEO
438,351,547 *2C65E5BEFCC4EBCD4EE6558C6BE7F9D2597CD0F0 Q2A
438,351,548 *2C6FA17D72F7B2737CD52A3C456C478583BFD309 DCVTISGGING
438,351,549 *2C67D2D6132D383739AA13618C54378236C2DFF7 dcwbkegy5
438,351,550 *2C6DDBD35536A2B9A407423FC3000836756E8064 DD9&Z
438,351,551 *2C61C0EF7C237C0FDDA72AB59841AE3602E7E1D6 REBECCACURRY
438,351,552 *2C664ACC8DBE5F9B1A322C7875CEA6E7DDF9E2AC DEAFENED
438,351,553 *2C68FBC638267D71CB26FC07DF928C7DB3AB761E q##P~o-(0-0)
438,351,554 *2C68BA16D91F9FCF3EC299B0BFCF8E120CE2F753 REGINALD.KURIHARA
438,351,555 *2C62317D2D828C764AF2F339DE28C6CC42B20ABD QUAZI123
438,351,556 *2C6BAFEC29F01769500F245961250B9BEC9BDCCE que reste til de nos amours ? (feat claude luter)
438,351,557 *2C68A58A825C68FF489681E642AF128DE4C1532B REINALDO.STREFF
438,351,558 *2C66630307C86763F0D498A3C0D5971C7DC27419 d$embarked
438,351,559 *2C6C70723CBB3C4BA0F870F6E27B28B767F5B2AF RELICTTCILER1
438,351,560 *2C64B97FA9946427255AF660866E20CBFD545089 r3m\
438,351,561 *2C6EFF6629E4D2CC8E143749E506B99DAEDF364B denisgammell
438,351,562 *2C604506BB41DC97C76A4B1823241061C720F6E0 RENEWING
438,351,563 *2C67353D9CF0D3FF80F4EAF4964D9B43565791A2 RETTETU
438,351,564 *2C61077C29E6C098577DDDFF5BF9CFB23F695D82 rexpelino
438,351,565 *2C66124D9A4FCAC4CE475EF00ACF3580F6D9AD5B DESPF
438,351,566 *2C6ACF60B7539A656176A885D7ABE57C5E907F5F REBECCAMEALEY
438,351,567 *2C62060420038CF37EF878F3D1A992F0EE03F2DD DG-?
438,351,568 *2C613C18E08F81A4CDFE107B5859D3B4F1F37773 RIJSBEDDINGENSES
438,351,569 *2C6E1834117E4298DD307A58C56FD4DF83FE736B RIKASTUUS
438,351,570 *2C66DB3786D58487EF0635A484C8FE9E1D644034 dhhaf
438,351,571 *2C68615952A4B5F0595A7BF2D56442619F4BF7F5 REGIONARIONESS6
438,351,572 *2C62C4D86A9EBB97CC95E792A9125F465761905C REHEARING7
438,351,573 *2C699220EB905166114B9C97E8915780CFC1BDA9 [email protected]
438,351,574 *2C69203F8DBEC08350762DFC3B68C69191A9F3DE ROBATEAU123
438,351,575 *2C6D5AB35903467F41F78D04B4CE6BFEB0075BC8 RESOLVE1234
438,351,576 *2C678461D8D5726241ACA4306B94AC2B56F5219F RODNEY.CRAZE
438,351,577 *2C69C5239A4BC3C8BDC177A6C25866DBDA89CEFE ROMANIA–FRANCE
438,351,578 *2C6BB3A5D8D376F628E3347A82B9903381919F2A RICHIE-REEKSTIN
438,351,579 *2C6AA982592A1FCCF30A54DBBAE6210CCF42ABAA roryeadie
438,351,580 *2C6BA62FCAFFE29A1797A18F1F411FA12EDAA297 Di"
438,351,581 *2C6402C3D1ECC6D5488EDD68F9DFCEE5F1C3315C DIEGO MARIN
438,351,582 *2C619355F184F32AB645D587270EFE11B43DED04 [email protected]
438,351,583 *2C65364320F0789F1367F8F6F36308AFA280643D rotundohed
438,351,584 *2C64741D17C4E024ED94E5CC3C6B856FF1B66166 [email protected]
438,351,585 *2C6DE092EE1FF3A99796038CD7D486FDD0A26CA5 [email protected]
438,351,586 *2C6268534045D20FD1F353FB47E11D5AC5756C32 [email protected]
438,351,587 *2C66AFB1785A8C2287A6A811637354339941157A ROY.SPANNBAUER
438,351,588 *2C67D54976D7D6CD18E6E66FFE44DB568BC530D6 RITADEB
438,351,589 *2C6B970B179BAF7A7D0AC6F5F2780A0AD2768717 RSAFSLUTNINGER
438,351,590 *2C692E29EAC32A4624647E53AB5702624390EA8C RLEIMONTAS
438,351,591 *2C6319A0A8380A26857F424B4FB753B0EC3454A6 RUBEN.TELLIS
438,351,592 *2C6C08FA4E1CFBEB75F6A33AF83AAF32B3941433 RUBENTORRUELLAS
438,351,593 *2C6A97E869BCF43CC26480BDFBAF7AB073311D03 dinotucciarone
438,351,594 *2C6C0D0A017A0D5AFB477C0E0B48E569CA6C6F69 ROBERTVALVERDE
438,351,595 *2C6C3BF1D14D06491EDD92CFA92DE71CBCD873AE Ruinyourlife
438,351,596 *2C6392AD937B4766F44D0CD9A22D4CCA1625F96E ROCKY.HARL
438,351,597 *2C6BCA9D29ACF4DD50FDF29BC70661054E0BD322 djaq-
438,351,598 *2C62B7119F7A031708E0A5A050214977F160639D rwmb
438,351,599 *2C6634C82A3453157AC1799EB187C86EA09C2D96 S,.3..KUVAELMA.."NO.KUINKA.ON.ASIAT?".(ROVASTI,.JUHA)
438,351,600 *2C63F470678A9AD0E4AE8E6E09243BDA49602920 [email protected]
438,351,601 *2C6963EEA7B229152A418D2032A06B7B5924ECC7 ṣā’īn
438,351,602 *2C6CC02A28125D037786526C12B68B5E6DA1EAAF samanthalovejoy
438,351,603 *2C662C0C16319E8285315CA5ED37FA0195B2AFA5 sammypyon
438,351,604 *2C68192B12289F258E61E4D8CE9C5052ED7F9944 ROYLAKOTA8
438,351,605 *2C689BEC9C7987CF14BD4F50BE12F9412EBDA0D9 ROZDŹĚLNYMAJ
438,351,606 *2C6BE5E1809A2767A47A7C33947D43E3AD7167B1 dominickfriedrichs
438,351,607 *2C668A378A88C730B6B7997D6AEB439A0A2C63F9 domzorganto
438,351,608 *2C6369290982573CA0DFAE6D9FEFA009534E4B2D rudyschinnell
438,351,609 *2C6DAB014CA26107033B8A8D2EF37F79CA5032D8 DONRESDAGIS
438,351,610 *2C6813849E13CB28B1425F30B0E1D6FE5F02E797 DOQ7M
438,351,611 *2C6A41D4B08808ED6341E9888574EBF0A32537FC SARA-REAVES
438,351,612 *2C6BD74553A2EB3F0276E8B260F06B7853F8680C rustydarrell
438,351,613 *2C6D101834F6BF608B4B6BFC29C5C86B83EF3292 RUSTYSNAPPLING
438,351,614 *2C6E08EEFC88F0ABC9D89CDDDB1D8C3895B6FE6F DOYLE.WHITTER
438,351,615 *2C6798A33C673CDC5C084BFD5686F6ADD0C0AFEE RYAN CLARENCE BUENAFE
438,351,616 *2C650038664E5203F1A46527E6337C94B9016A6F rylie395
438,351,617 *2C60A511F1678672534543FFB72597EF7AC217C8 dpm"
438,351,618 *2C600BE3AA883BA4930B155DD4A5FB492F3F0150 DQ;SC
438,351,619 *2C6B6B8E02246C9BC7F241AF14C88BAB65825192 DR9PV
438,351,620 *2C6D02865DD82CA6BD748C3F8A3A18AEFEE4271D saulrobertello
438,351,621 *2C630E96A3E93D837D25EF6618A267204B5A088A SAUNTSIENS
438,351,622 *2C68DDF207AB2D586B99D86E583483855329028C D"?RD
438,351,623 *2C6AE22873CB3552533541E5B0C5E21D98A659CD SCALDIC
438,351,624 *2C6C784CCCF9AEDFE2D7B364DBCC1DC1AA01D304 schiffseignern
438,351,625 *2C6065C1838F176B68BB8789F5E28656C290999A samedi-22-octobre-4004-av-jc
438,351,626 *2C6F52C167C5CAC7AC0DFE14CE67F06FAEFF5ED2 [email protected]
438,351,627 *2C6EB5CA8CEA2456E37AD3E3D6AE34263925E476 SANDYBETTINGER
438,351,628 *2C6E3C6912A2017EB41FE3C9D22FF7F6DB801DD7 dudleyreffitt
438,351,629 *2C61B72B1F061C8F7E365946790EFAE6E97C2439 SEEDS-OF-SIN-(TAKE-4)
438,351,630 *2C67C08FA492BB2BCA33C9CCA3F1C036511A5FEA D,UM!
438,351,631 *2C6B2AC5053100EF08930CAB8C8D7369CAB41D0E sa.ty
438,351,632 *2C6F38285D1E756B7F075E6CCEC61D8314F9A877 dustinsturms
438,351,633 *2C6B207E1DCA5B55EA4310D14D5B57BB9BC6A8B9 DUUA
438,351,634 *2C6E3673617180AFD7591BC0331028FB07120ADF DW+QH
438,351,635 *2C68B1129EEC1675EE9E683F5B4B6E014C19988C SET-TO-CONTINUE
438,351,636 *2C6EB2E43FCCF1964A1A8CDC7B42C68390DF12FB DY355P1
438,351,637 *2C69D3803EBDD414BFA43B541D37B9CD7511BC9D sexy.road
438,351,638 *2C6F53525E59443315740C220DB7851C98FCF039 SCOREMUSTERMUSTER3
438,351,639 *2C6E263D3E96A7BBC2D52BF4E6BA3CA63BA246C4 scuttlecask
438,351,640 *2C644F798065C69C87EF1F68F5E8901E0EA275A3 SHANTIDAVID5
438,351,641 *2C65A7FCE685CB34A95171FA46A85C364EABDE0D EARL.HODGINS
438,351,642 *2C6ACC9EEC0B53B02D3D816F8500CB096C0DE374 sea.of.cheese.-.pork.soda
438,351,643 *2C6C1F13F0914639C1404056F6304F1CE3C72812 eblwp
438,351,644 *2C68B469EB27C1FD4AE002F23E7A263847BDFDDC SENORIO TERRITORIAL
438,351,645 *2C6CE9CCC775557F743E2D2B71E7267D6A90B902 EDBALY
438,351,646 *2C666C8C832AA105A681A3DEEA6F39DEBEC060F0 SESUETIO
438,351,647 *2C6AB870342287231F8A07F1EB0E355AFF13AEDF EDEFINED8
438,351,648 *2C616ABB3C9D5AB158365273BF0F40B06A19ADBD EDGARDCADENAS
438,351,649 *2C6A25B7BBC041900EEC2347D62FC8352A556006 SHINE STARZ
438,351,650 *2C638F45C1466B5DC5466F25F4EBFC01C51371ED EDREOVNI6
438,351,651 *2C6B93276873784C03AEC095D924E221CE8D5344 SHANNONSTAYROOK
438,351,652 *2C6D4FE471AAF8E0CC82E5DA528845FA40A41AAA short1024me
438,351,653 *2C68C1A14CBAE40793A54E5EEE6927CC831BAA26 shouhe
438,351,654 *2C6571A0E6A91A411411DF6F105D46CB6BCE2F52 SHE4LTIEL
438,351,655 *2C6894141DC368032293635679667C990C89DBA4 siembra.viento...
438,351,656 *2C69C3D6C283E9C585836CAFBA50D068C015EF28 SKAROBIS7
438,351,657 *2C6726DD5A097E1717B45BFEF72CD502BF7DE0F7 Slektens-sang
438,351,658 *2C6E3D9A62DFE490B51BFB71D4D1884659CA772C shocheyam
438,351,659 *2C6BF993CD9242DC9EB4EB6F502F42C723C7942C SLOWIKING
438,351,660 *2C6377A6515BE51C71D06B7D149FC4E92F91E48D EK6-Q
438,351,661 *2C6268F2E55DF3BA779F3A125A62FB9DD0FF149B SNOPSFA3
438,351,662 *2C6F1CA4D16F21340C121A6685846EFB1738CEC3 SILAVRAL
438,351,663 *2C65E48A14A47032A5C4E12DA478E9EBCF04CF7E SILLY87
438,351,664 *2C69F35808EE1AA9A36162D679F5621DB6489E5C SIMONIOUSES0
438,351,665 *2C6E46B3069F09DE40B2CAB4206FB9B48C728DEF SINIDAP
438,351,666 *2C611DFDF5E8F2A95A1BE01EE2067E568AEC01AA SINROTPA1
438,351,667 *2C6A04E3B5EF1E79D36CB7B0A678E60F445632B8 SONATEDACAMERAENSOLMINEUR,OP4N
438,351,668 *2C6DC2C6CE788960BD3EF8803BDF16C88B211E38 [email protected]
438,351,669 *2C6AE43BA2DE9341E7E4D5FDC4CB6E9D0C98C995 sonmould
438,351,670 *2C6162A6B4833405562EE60F5D91CFC8A4532D7E SITKISTNING
438,351,671 *2C6E48F874BE23145527A655E65CCA06E8FA1F1E ELPL
438,351,672 *2C6EB7F018DD38EFD62E819C8ABAA23A381A1F0F SP3RM4T0C1D4L
438,351,673 *2C6DC155AF0E797AAAD58FDF733B1C68E6E40F34 emergency!-emergency!
438,351,674 *2C627BED44592D363FA8CDF780DB3957AFA9905D EMERY.WINOGRAD
438,351,675 *2C63053E44C4C11F4CD9EF24CD93A15C0CBB39B0 SLID3 R0D
438,351,676 *2C69B8805778E6AE4DEF708BF5F453B0E9A4B8FF SMELLIGERACONVENT
438,351,677 *2C6420B4693E0B6F4DDE54B3D2F8645897B164C1 SMOLNOU9
438,351,678 *2C6766DCDC03B9225FCD4A25E068915420CA937D smu993r
438,351,679 *2C645EB2B98930D918601E51F0AD384E4A38D712 ENRIQUENEWBROUGH
438,351,680 *2C62A2A1268811852A7A01B55F8FAF460D22535F eoatf
438,351,681 *2C613FF6157B5D661F832B85EA9CAB72E25A340D SPLAT! * * * <3
438,351,682 *2C6391F2012597EA1554F26A4C195ED42F8F44F4 sportsariel
438,351,683 *2C6983E0B7970D00AD577A2FB7A1B650F0ED1E96 SORTSTOP2
438,351,684 *2C6C3CFA95250033B73937F09591717F6B570E4F „ERTRUNKENE“
438,351,685 *2C692D10FE97BF4D9D9F66501EA87AF0FAC3EF5C SPARKLITH3
438,351,686 *2C6A6FAD883207E2D3B98097E18AD9974B3EA78C eshcd
438,351,687 *2C644B03EAA0E3492D7BDA6213B9BA24B4C38B78 ETOT
438,351,688 *2C6678ADFB5EB4C70802E966D7CF88AA58809FCF splat.o~0~.db
438,351,689 *2C6CBC2DCC2B0DDE6A03541DB57C07482242D77D STACEYOFARRELL
438,351,690 *2C6607DE79CB73F41012AD5789DF95B8861B0A40 EVAN.KLIMCZYK
438,351,691 *2C6C38FC9CF132C8E87592F78DCBD8D77F04504A stanfordschnee
438,351,692 *2C613D789F7D9F4D02FABDBA4361A86E03F8CC31 STANLEYPOCKLINGTON
438,351,693 *2C6EACAF462ED656DB3686FAE23E337B87420979 STANTON.ADAMS
438,351,694 *2C6E44E4D57D816621F48BACEF8FE4701DBF3BE9 SPOLSZCZENIED
438,351,695 *2C613BFA447E5D471C5D1BCE10D0B413DFDFE282 STAUFFENBERGIEM7
438,351,696 *2C6E0459E9141BF988FC354BC5AF1BCFD4AF7998 steelii
438,351,697 *2C67CF135430F8D82B326E578A4AB03B177C722B srbinovića
438,351,698 *2C68201FF5593535B3103BA92E8494B591FE4E4E [email protected]
438,351,699 *2C66A51D10A20611228387E4CAF3F7F0DD044373 extra-enough!
438,351,700 *2C6525A8396507D2EBA50614F90B97C0BEC65290 EXTRAMORDANTES
438,351,701 *2C63521DEB442A863079797377E397E36826FD93 STEREOPT2
438,351,702 *2C6B92CD4A25385A6AA7641608C735B24BF836F7 STANCHENKO1234
438,351,703 *2C6CC286B842835278DF4BA92CF1F21F7CBD2EEC STOESSENS
438,351,704 *2C68E990C9A837CFE3F3ED6A0459A765DC2DEA10 STRAVEDESTI
438,351,705 *2C66AEF1195E21B058B9872BEB00A2DE61B3893E STREET600
438,351,706 *2C6C35943F416733FB3B9A85E1BCA7F3A21F9D21 staybut
438,351,707 *2C6B11A0A9385147DA03A991E9D51B62F4931574 STEPHEN-ODONOGHUE
438,351,708 *2C69810D6B5928AE4CBF7BEC88344ABB8FC18ACF SUBDELEGATESED
438,351,709 *2C6952F510E37A8724FA65695A9B46AC98AA6D3D FASCIASS6
438,351,710 *2C669A2E2D66D335D7ECDBADD5CC445E33833109 STEVEN10SUCCEED
438,351,711 *2C6BEE89872F44911F53FF1AFEFA60D3E191401B stevetombrello
438,351,712 *2C603037B46122673626BEBF15F4E49B072385D8 STEVIEWILTBERGER
438,351,713 *2C652C0FEFFD740FD73B61713BA25A1C6DEA48E3 SUDMNTV7
438,351,714 *2C6A0B5375D206B0526F66BAA279ABCF0CC7B344 faustinobalezentis
438,351,715 *2C6DCC1B19BB07FD7BDDE20C116592D2D3831E4A FAUSTINOBIRNEY
438,351,716 *2C667DCC7D9ECF1E0F6445B59F34C8355393D6F6 STOELLER8
438,351,717 *2C68406B77E2BE931B288445999E05C49DC50611 FENGDIEPIN
438,351,718 *2C61DF1C65E6A0609859BE26181A36242F5FBDB4 STRELSE2
438,351,719 *2C6CE4C651B6F237BEF4E21327891F9FA6B22C7F STRING-QUARTET-NO-4,-OP-114-FAUST-I
438,351,720 *2C68C7023D81E7EDCEBE8DC0D30F48A53FF66AFC SUPTBIO
438,351,721 *2C67735B7959932498FDC1426D14ADB5E189C97D FFO<
438,351,722 *2C6BBB66C4DB4596B2EAD4492F8ED1FCA01D77EA fifth.chant
438,351,723 *2C6E1852FFC08CE72421C978DC5DD4E7E02310BD SUNDAY-IN-SOHO
438,351,724 *2C63ACE1B02EA55971D0898A02B98E8E33AC0DD4 fivedaysinmemphis(take2)
438,351,725 *2C66AFF2846CE114D5290BDE62D3F088686C750C SUPERLIXEIRO
438,351,726 *2C6B61C7791E4DFB529BB5B21EF1BF804C0DB981 flojo023
438,351,727 *2C6DFB8B0B14FDCF93933601D13AA0C65AD642A3 followthegroovemodulations
438,351,728 *2C674226DFC48393751DEC35C631103E359E6EBD FORMALITYORIGINAL
438,351,729 *2C6B8ACD2FFA7B5A2B2D9671A463B9B6160814A1 TAJIGEN5
438,351,730 *2C6957C83323587E14B7CD4444F5D61D77160A4A FRIDAYISES
438,351,731 *2C62931E3EFD3601428975FD9FEAEA183AF0D334 FRMARTIGNY-LES-BAINS
438,351,732 *2C6FC085462A11821545501F62E4604A5BF806B0 TATAAAAAGAGGGGGTGATAAAAGACTCTCTTAATGGACCCTGAGGTTACAAGTTAAGAC
438,351,733 *2C6791D80928D1B0F6F8F343EAEE0B48C4377E3B TAIFOEN
438,351,734 *2C66FB08E5379A1FBA0A4240AB237C61EEC8A842 TALK86.148.44.151
438,351,735 *2C6F8112EA1388E1592C5FE90D0239BFD5EDD99F [email protected]
438,351,736 *2C623AD08F8D5A03AA462E406788534845470A47 FUTUREJOSEPH
438,351,737 *2C61442E81B6F9000F8FABE36EC1F58A5A5340AA TÁMADÁSPONTJUK
438,351,738 *2C6B06BCC82D3651978AEF8BD16B553C54E081FD GALLERY25032007
438,351,739 *2C683F7DDA7904B9947A76F8E75EEE752DC3F281 TEMPLATEUNCAF
438,351,740 *2C62E407C6F25300B2537992DD727DCA44AACD78 TANNER.TUINSTRA
438,351,741 *2C6498A067B2F4DBE90DD961D65014B534FD9398 GARRETTHARR
438,351,742 *2C6A2661A088EF704A486237671177B7C479B962 tensc
438,351,743 *2C6FFEF9BA5043FF18A086812517C1601861A211 GDZIE-MAM-CIEBIE-SZUKA
438,351,744 *2C6EA9D46373A9E07D43D47D772E4A1A3A3A0BC6 terrencekothari
438,351,745 *2C64166A410EA2FDAF8CC76DC12D2B05C234322B GEEKBRO
438,351,746 *2C6E9C8FD68B01C20DB731BCBF4E739515B4D68C [email protected]
438,351,747 *2C6E2BF2B83F0315125170577AD47C54511905C8 [email protected]
438,351,748 *2C6309C29AD66505457DD9EA200FFB6757612F81 GEORGE'SDILEMMA(JAZZ-DANCEVERSION)
438,351,749 *2C64941AE2E26079DA59A790D3E6B361DCEDCAA1 geraldokozel
438,351,750 *2C6C5D2009378D560FE00556C099377524FE3CE7 thángngày
438,351,751 *2C6C27830D92519BA585E71F0D18E9A9BD622A57 thanhhickethier
438,351,752 *2C63CCDA9B50378134D95A1BB9FAF6EA3E3E3EED get.up.and.slumber
438,351,753 *2C6E83A607D4A2BC1B3381E509D6ECC2E9F4CF15 thatkim46
438,351,754 *2C6605D2BDAC3E076912E0D2E61449D7AF392BAD tepmocni
438,351,755 *2C6FC5F8F0F005A983FC851D31792CD2541049D9 TERESARIDDELL
438,351,756 *2C6F6BB69109578809766063D8793A59DE205D31 terrellrodin
438,351,757 *2C68375606E68650DC59CDB24B072581667BC6D6 THEBOSSNUGGET
438,351,758 *2C6C302EAEDF9257E67880436933727A628D5679 thecolorado2008
438,351,759 *2C68B499F53A4B5598FDE3C275D4F535FD210F90 THE.JUDGE.(INSTRUMENTAL)
438,351,760 *2C6626641B7A66146E7F0F16033D8EBD46A4222F THEMADDTAPPER
438,351,761 *2C62CF88D4162C207808F404844D437AC6EC52CD GOLFS
438,351,762 *2C6D878C092C5CCD3A64F78F2319731A7E6BB519 GRAAD1
438,351,763 *2C64E4877954464BD97D201220CA18789B0A269E THESUSANNA85
438,351,764 *2C64B33B7259B00EE9D406860BE6896BE4844C11 This.Land.of.the.Hundred.Deities
438,351,765 *2C65A3FE5A336AB0AFBC7D9A7E78874219A5820B grossratsportrait
438,351,766 *2C6CA4319787CEAFE7B2D75FF068980F3FFA985C GSOULAKIS
438,351,767 *2C6B38939ED18EDAF92B848275F1FBB5283F7972 gu171ess
438,351,768 *2C63753D95AF943ACC93890AE903986C77C53612 thesnoop666
438,351,769 *2C67723473CB37144BC24B3F6D644A9ECA07C73D habitatausschuss
438,351,770 *2C6AC63762F9642DA705C2FFBDF620ED1BE0DAFD HANSOLO1024
438,351,771 *2C60FDA5E7918ADC277FE3662E47F5663767096B TNEIAREGOMIL
438,351,772 *2C6F85C024A606A48CAF0A1E0C53E736DA0E0E26 harlanklier
438,351,773 *2C6DE8D260B6D153474210C8DAFDEBA83453FFE2 TOCCATAFISMOLL,BWV910:II.(ADAGIO)
438,351,774 *2C616DFAD3A39CEB1CEB34D1624F628BA03EE8B4 TKHISTY
438,351,775 *2C674E301B90DC23BE405BAC8F4479742790FD74 TOMHINMAN
438,351,776 *2C66173CC3FBF1C4C6457016888AE362B7266D7A TOM.OOMMEN
438,351,777 *2C679B636C9CB4C6A5E135841E03D67AA2109EDB TOMPORN0
438,351,778 *2C68D9A76745D10D386ECABD445055124C692ED3 hayoofal
438,351,779 *2C695047F032DDF3E5816EAE0C2125CA123E6891 hbwlb
438,351,780 *2C66C7B4E0B9AA19AFAC06D8EE4E3642644C74BA HEARSHN3
438,351,781 *2C67446616362539EAC249BA6C33AD97DD30E53D TONEEM
438,351,782 *2C604819893536928E1953B40CA1830C87618DDC TRALEEBAYSEAANGLINGIE
438,351,783 *2C600E3C8541653A898A0FE799279B0BB547F960 totally alright
438,351,784 *2C6D5062E8AD1D477F85D5A37C9EDCEAC954AB4D TRDEMLLESED
438,351,785 *2C6436932C4860627EBD2AD42F4834A73ADA3A31 TREMA YOUSEF
438,351,786 *2C6184FB73995B81C84893F5EBA255141A737013 [email protected]@tion
438,351,787 *2C6340B8CCF308D9CF498E22559C33643E18ED26 [email protected]
438,351,788 *2C6188D3556DD52D5880089E3D67495FB39470D2 hibsnumber1
438,351,789 *2C6D772D1C6223449B573FB4029FEDAF7B00B81E HIPOLITO.KASSAM
438,351,790 *2C608D61B29DEE437E70CB70404726E35B5BF9DA tristanladner
438,351,791 *2C6C6F7EB77C28FDF563A06E2C7973F2B1B6E03E [email protected]
438,351,792 *2C6B0CCE4E2DDC0BBB11C0EB5B927FED3AC4126F Trogdor(TrogAPella)
438,351,793 *2C6F5183AF3CB894EB80C0505106FF4E17DC4097 [email protected]
438,351,794 *2C6C80DBC7B342CB3045A46509281F46EF8DC957 HORACEMCEUEN
438,351,795 *2C6E11A767B124DCA1FFD139F4E1540D9B8F9049 HORACIO.LOOI
438,351,796 *2C6A5EFF29B5854D664C367E12F442C1CEFD9D61 turm-zu-babel-(text:-johannes-r.-becher)-(demo)
438,351,797 *2C60C13A675F66BA03D47D4AEC74E4A0B3CB7FC4 TUKEEKIN5
438,351,798 *2C681523F2D23D19D257B55642093584EF92A145 hotspurs
438,351,799 *2C64ECDBBDAA78721770FD95DB77A4454EEDAD34 TUX8KENMUK8CAJ
438,351,800 *2C64F8600054A807051EEDDD590A7C959C084FB2 [email protected]
438,351,801 *2C6140B58CB9A77264A61736172E3C4248DF8243 TYLERKEYWOOD
438,351,802 *2C67307827DE98AE86D4EF2BC9EB0B8FE49D38FB udo.janzen
438,351,803 *2C6D839DB97A8EB2F3D94C7D1629CD9FBCA52035 UITEENLIEP3
438,351,804 *2C621CC0A560C14E370A5419A6F3F6387D91497A [email protected]
438,351,805 *2C66239BE63F5FA9A22B57CC9E934A3022741729 ujulindamalunze
438,351,806 *2C68271963E2C772EC7F7450E7B71974FB47F536 HUEY.STOBER
438,351,807 *2C6E7C2699C5382F6752F8F89A7B61508AD3CD2F HUGELYV1
438,351,808 *2C6608245360C2F4709BC1223C9F84A2A96379BB umelt5
438,351,809 *2C6624A3B28DD428206D495BFF58694583BDC4B6 UMHALSENENSES
438,351,810 *2C6B165DADEE215F3395F048BF6DA5258C12CD89 umisômen
438,351,811 *2C622841A18A5FEC8A4BACB723094099BADA4AD9 «UNABWENDBARE»
438,351,812 *2C66A097CBB6D07F4C9EDE5966AA2EDB606E7BBD HWYNTON
438,351,813 *2C6C72CBC29DF4D444E92D36C3E08C41B466F01A [email protected]
438,351,814 *2C6751BFAAF61264B7AD061072CF732376B1845D HYDRAZIDINE9
438,351,815 *2C6A8E8C93609C6545A3CF68BF8DA64C5442C409 UO`E
438,351,816 *2C6AE86786B153C067EB8B60A8EE973D5C3A88FC ID{@
438,351,817 *2C612081CDA22CB8B62EAF2F68074FFC42E40FB2 USERLEONXAVIER
438,351,818 *2C6997C27612F0453652AD85A6F01220C2DEF6A2 IFUADHI
438,351,819 *2C6968DA5536A8B606A8B783A54DBFB1816EC396 IGNACIO.KARDASHIAN
438,351,820 *2C685DE84413C417C7D765A503888C4BF4FF728D UTHVILT
438,351,821 *2C694397620D1216FBA35F175EEA191DBB78376C uzairimani
438,351,822 *2C6A390143820AFB406BAD812120256EEA9B7BCC V03021978
438,351,823 *2C6F49B9FAE79E9336EBBDA90C4B0EB4ED20DD51 [email protected]
438,351,824 *2C6CB3C8B6867B6EBFD1BE016A79F2E4A08A5E1C ILGZNLX3
438,351,825 *2C68183D1CBA15235D15DD50A10B9DAC60398CAC VA1DAT0RY
438,351,826 *2C68CB89F8C29E5D7F093D8762DBCDB0394F1376 VADERVICTORIAED
438,351,827 *2C64B408AB5C62C7280C16AE12B73E6F4493CF7E VALARIEJACOBSON
438,351,828 *2C6AEFCB9D65F3B431954B3124A97C511BFF7436 VAL-BENNISON
438,351,829 *2C656BDDC98709AB32658EF9B5A90571FD893D76 +ILLAM00K
438,351,830 *2C63112FC5B89A5909D28115AE72CA3915447F65 VALERY TABOH
438,351,831 *2C6F72F98D08B2C8773262C1E782A1AC5C196611 VALENTIN.GARNETTE
438,351,832 *2C6917DAFE9C4DFD5804662125B26750C30B9859 VALENTIN.NOLTON
438,351,833 *2C6504671B283A04DFC77D3F176B887278276701 VALERIEGEERTMAN
438,351,834 *2C6E95EF349080417E2D0EA3B843C0739014EAC9 valerie-scola
438,351,835 *2C60E58DB0D3E49C5DC6BD912666A34D7881CB39 VALHALLASCUFFLE
438,351,836 *2C63E9AB847A676D51DE6331BA4C654D47CDABD8 ILUVSHELLEY20
438,351,837 *2C654CE3C9BC37D099EBF9336F23041F20E3D188 VariationenzurGesundungvonArinushka:V
438,351,838 *2C6C06C4D120CF3AD925D702694A2CF688784F09 varadarajan-sriramulu
438,351,839 *2C6636F3510D8CE4A8FC0BCE8A9B27576DC0D8E2 venus-(meant-to-be-your-lover)-(feat.-jan-johnston)-(ti
438,351,840 *2C60A61D1BDDD5007938149BD3A7CC449437D7DA [email protected]
438,351,841 *2C65E1C25AFA0464C89B547DFAFC0DCD86ACE6A7 VERONICA-MOENAERT
438,351,842 *2C650020D433FCEC86C9876C9D6DED2D03B65A04 VELERENTED
438,351,843 *2C63AE6EF959987E49E1A90CAABFB1E0FB3D5B19 VENIRANDO-MARQUEZ
438,351,844 *2C699F4C7B63E6D648C2E13AF7B39873739A685F VENSWERK5
438,351,845 *2C6119E984EDE1BA3F2EBA54B3C7F863A0927B1C INGESSINO!
438,351,846 *2C67CEC21EB258C717546D71788AC7A1D9A1DA3C VERYGOODLUCK
438,351,847 *2C6A4A017A20F6FEB6C8CF05C836AB4DE71EBE99 vernhultquist
438,351,848 *2C652E4856774D5103211BBAFCFBC74957B114E1 INSTONEMENTS
438,351,849 *2C62BE5D18C3A250A23FA22C677E43889357423B IPADARKING
438,351,850 *2C667A17DBA866861A02A888F0AE683B81049BC3 victoria-alonzo-ramirez
438,351,851 *2C667B559DF1BED320DAFAA5444C6E6E5D792C62 IRVINGWEISIGER
438,351,852 *2C6460CA1CD71524CE023D317CE5CB3B7E36B5FB irvinhernandz
438,351,853 *2C6B81F670DEB201D9CE0D7DED7238BAE2AAA43C ISAAC.BULAT
438,351,854 *2C6300D6625DB00B04E6609DADC7AF22DC47A8A3 VIDYA
438,351,855 *2C69189DBB0D01BA82CC775F97321B9BD9A1762E ISMAELJARAMILLO
438,351,856 *2C61E3FACF31D100E2ABFC9FE56CF62BF982A6DE ISOTROPI0
438,351,857 *2C6F62442311A3FA4CD02178D05BFB624785C71A ITALY
438,351,858 *2C6E7624F1C24E925ECD5484EF5EDD85E81E2FD1 vinzsperos
438,351,859 *2C6E7B87758325203614D6AB0E94E8D0D0CC3410 vincenzoriccio
438,351,860 *2C61D02F8ABF2F08B6E63402CC15F20EDAEED2C6 VIRGILIOLAMING
438,351,861 *2C6A380A392299D6DC3B97513BA463C76578EFD1 VISOCJ
438,351,862 *2C6149BB37F0A2814FBA3A4F6CBBA718EE22985E VISRIJK9
438,351,863 *2C6FAD478D70108FB0909E9E7F67A53373112BB0 vitoti87
438,351,864 *2C6501D4BC89E66C7DA7FC84E3EBFE9F3CB16E42 VIZCAYAA0
438,351,865 *2C609154F64E1184FC320E9AC4E0E3D9550D74C5 vnzcuar
438,351,866 *2C68F56D5461DF21F7012F6AEFAB69489B61FF82 VONGUPPY
438,351,867 *2C6AC7B8CA55C59509724EF4EAF9D390274ED983 VONHANIS
438,351,868 *2C6E3EF46BC9B624A40BF986CBCC7C5F066E001B vorsporen
438,351,869 *2C616F83802566326BCC5F1F50F54661B6FF6046 JAMELPORTER
438,351,870 *2C6C1016719E8B3A95DFEE4FCF1B63284B2B5865 JAMES.RIEKERT
438,351,871 *2C67403FEF7BC1D6CD6E955DD22CC5FB3A2CBAAA @VVOLGIM3NTO
438,351,872 *2C6558093D8AE374C29E66B0466518E170AE0D04 waarschuwingssysteem3
438,351,873 *2C6AB75CA97B032FF791000214B9BB4953A6DEA7 JAQXNWC7
438,351,874 *2C600D47475B2A538A51A61A493D015D960584FF JARROD.BRANDOW
438,351,875 *2C6B9558BC46BE1AA3AE18989A079F0EAA242D77 wallacemoallankamp
438,351,876 *2C694939EB35BDD65D6CDB4B1B0F93D4E855FCD9 WALKMANW810I
438,351,877 *2C651592DA2E3DC9FE3512E4762F1508CB4121B1 [email protected]
438,351,878 *2C6D67692C766AF35CF1978EF9E6DE0B9B957DA0 WANRAFIQUE
438,351,879 *2C6A488C4042DE9CC3E52C9E257C243B5586E681 wardferreyra
438,351,880 *2C6E3A541378F127D8973C170B4A566FE2758719 JCONSTETINO
438,351,881 *2C655908E8ACCFDEEC3C5C44FB7D1BED4C8E3053 jeanschaff
438,351,882 *2C6932A0D0C4CFAA97B38E044E9080322AC3DDB8 WAYBURY4
438,351,883 *2C6C4A28D7757A14FA3AF4922945961E6A01A98D WAYMON.HO
438,351,884 *2C60F3397FFC4854C04EF728AD90EEF2056D3899 weltentwicklungsstufen
438,351,885 *2C62A4F1CE5576B9CC0A87CCA3FEA46F007099D1 wellington-cruceta
438,351,886 *2C671B1DCB5C3248E5C3EE124F02FEF0B83A847A jeremyfenoff
438,351,887 *2C6C0A5AECEF2AB68E61928C94849B06AA5292AA JERE.PESH
438,351,888 *2C68FA5932404B58B61B8CB6454B100AF52ED1AB WEST_POINTER W/E/ST_'P//OI//NT/@/R
438,351,889 *2C63520B2D9FDB68F00F421A0B0608F9D25B695A w-H
438,351,890 *2C619023021288D9AD07B75F68DFB3487C161685 JGrey
438,351,891 *2C6909B28C8364E588EFE1AE818C1A5F0A549829 @WHOSDMAN
438,351,892 *2C6A91DFF2FDF6E406B2C1AE41233D5F57E4CC00 WILFREDULLOM
438,351,893 *2C6354881B79B5335254BF428C8301E3B09A8B86 WENDYS SANSWICH
438,351,894 *2C6BB7EFCFA9CF7C8F85737461FBE63899548419 william.h.brinkman.iii
438,351,895 *2C66614ECF20A9817EDB09C9E7DFA22FC44F049D [email protected]
438,351,896 *2C627A6630DD586141835425129D1382D155085B WESLEY.BEESON
438,351,897 *2C6927AE48D638BDE7A7EE0C62303CFF2292B8EB jo$*
438,351,898 *2C6F5D38840A2D1BBC271A39BCF9B5169145F521 joesarver
438,351,899 *2C61356F258E9A7AE103CD9FFFFA26FE636A0FBF JOHNATHON.KRAVITZ
438,351,900 *2C60733EF29322023968745C5FBF069D7EC0425B johnbrauer
438,351,901 *2C6CBA0AD91C75781BF0C93FD79E383C86B77CD7 WILLARD.ARDINGER
438,351,902 *2C6912338C32FFEFF26BBC19902ECC78863CEB57 WILLIAM EMG GILBERT
438,351,903 *2C6CA8F7F7B6255B2120558D4160FD794343C3DB WILLIAMSLEICHER
438,351,904 *2C6AD774DB4CA7823593876B2A5F1B791A99758B williamsyacovone
438,351,905 *2C69EB0B85B29B41A3E4E94BB0093A82D2D9FEB8 willislalonde
438,351,906 *2C6396746F3AC5E1B9F6AFAED3FDB52858620687 WILLYSHELSTAD
438,351,907 *2C669B513869955445091E5AEC5D6BD0A3684508 WOODVALLEY
438,351,908 *2C6B82571406E57785334F605816943A07433337 WWW.ITHAKA.ORG
438,351,909 *2C66678400D5360E7C94A63E679481FE8693BCF9 wwwmusketeersgroupcom
438,351,910 *2C673B61DC7E9E0B7F214E828FA42E2D794C35FA それまでも「WM」を冠した携帯電話は存在したが、正式に日本初のウォークマンケータイとして、「
438,351,911 *2C6EDA2600BE3C7B3EB05E02468A0B79BE644704 johnzancanella
438,351,912 *2C6D07554931A0AE4A8A2CEC5C5B367368ADE047 JOMNI10
438,351,913 *2C6E37FE2E5BAB68A3E230EC494E6FA7AA8A0A4A >wx$
438,351,914 *2C6B9A66A53F7B91D0C059EDA9DF1141DEC31DC1 WRITES.ULTRAMARINE
438,351,915 *2C644414F5B6E53B35BD478CAF2E5471745F0DD7 JORDAN.BEANS
438,351,916 *2C6136EF03DCEB3E7C43895016E5ED41AD014756 (x)~ @######b
438,351,917 *2C65A0ADCA7AC1975424EE20620194189C662D64 wwwallmensneedscom
438,351,918 *2C690F0398AF909CDC64724BE0A9026D9FE7A9E3 JOSHUA-RUDE
438,351,919 *2C6F8551CF3E4CB45C831FB304ED525DDF35FF5A JOVANA-VUCICEVIC
438,351,920 *2C6991D0EEB11AF6F3B183D63E634A69711F40B2 wwwmagic991com
438,351,921 *2C639BDABF6BCF43FAEBF2CAC6C38DC5682AF0BC WWWREALIDADYFICCION
438,351,922 *2C6883681232BA7E8E419DCB34DAF98978800BCC wwwwesternmassselectscom
438,351,923 *2C6E39374BF7421EEC51A475CB5A219F88B6F3BA Y2KHERMOSA
438,351,924 *2C60834B9A19810DEF531A0831DC25F21094C908 yasamanyonesi
438,351,925 *2C671AB0A97BD6D8D1879860EA8693B03E8F0B87 {X}~D=8
438,351,926 *2C69920C0902D24E9789FCD3C33E56A0E5DC2F1E jurisdiction--one
438,351,927 *2C6CFFDE6F4F5596C4DF62F7D67DBF264C0F1F74 [email protected]
438,351,928 *2C6579C58836898C64F8F399570E79C9381B6F06 YODALETMEIN9
438,351,929 *2C63F3ECE0A78253E4AF6203FE6F7CAA62BD4A46 [email protected]
438,351,930 *2C64C33337AB41A3E534C9033A7A56E2F5B22EAA x[!m
438,351,931 *2C6ABC403DA3F1393BB94067E9DEDA6530915634 KAITLYND14
438,351,932 *2C6860C33236D15074754A038B4E696874BB697E YOUDON'TKNOWI
438,351,933 *2C62DF3119093B624658C5D7CD52BBDB8937141B [email protected]
438,351,934 *2C60A2656856073DA3379A8F14A750194896E2D4 [email protected]
438,351,935 *2C6A8238061EEE3DD294101134DD554F44A4252A kanssasi3
438,351,936 *2C642CFDA553F65FADA526E566CCDAEE46ECE65F YOW.KHOY.YAN
438,351,937 *2C605040990604558E29CFE893D87C59204D5D60 KARÉHA
438,351,938 *2C65A89F39864C1A643389BC435D470D69A948C9 YPNOSAKWN3
438,351,939 *2C619100FADBABC08AC3C65634DB445D855D5911 KARLOZALI
438,351,940 *2C6A8026A534FD9005A391E5F829A40681E0AFF1 YTIUCANON
438,351,941 *2C6B3FD9AC41DA849157C0B4AD4B270406F0A3E0 Y5S:
438,351,942 *2C665CBF42340D26CCC2BCD6A64F973CA9D3A5AE yA6
438,351,943 *2C650CC0F622CD372A28A75AD46A01FD3B1095E5 YUNNTANG
438,351,944 *2C6AC1D00B05C43946442A2B892B14539D1026F1 [email protected]
438,351,945 *2C668C282500118A48F8401121A159DD195BA58F zach-barcroft
438,351,946 *2C65D2F361B98D0CF700EF33532F710539A7778D keenandolphin
438,351,947 *2C6444997267084F68F16D1CB29A2F1D2F3AEDF5 YASSER EL WARDANY
438,351,948 *2C60B0021BB2159C8280D04175F21E743E529B6A zac-issak
438,351,949 *2C62EA01F36A23932BD1B9FC2BA338C3A1E980E0 KELVIN.BINGLER
438,351,950 *2C6FA7F10C42C8AE5C788D914660AC11B395E71F kenan2810
438,351,951 *2C6D82784AE027C80177BFCC458D929111CA8572 ZAKARIA.PUTEH
438,351,952 *2C6B5F3E59D744913FBF20D0C5C3DE9DE8791D5A YEHIACAPPO
438,351,953 *2C62EE8CE429B833A2C2AA687DB0B9A4956D9B6E ZANE.WILLY
438,351,954 *2C6DE76DE900A13864A49FEE6640013CBDABD1BA zen-mediation
438,351,955 *2C6FE3095E8A192E77AC783A566D23FB53268C2F [email protected]
438,351,956 *2C64E1F1B30CF411679595F59541F8E2EC242F04 yokoyomikurama
438,351,957 *2C66B230E415BC340125997FE61DA9ED197C2AC8 YONGSHRIEVES
438,351,958 *2C635CAE9618F302C94BFCAF7B0E22FDE41130BE KEVENMACALMA
438,351,959 *2C626A13D1ED650C3CD88504955742ECE7DBCC87 [email protected]
438,351,960 *2C6DEF2D9F3DB4A69EE1A0089FA5700DA6AA6DD8 [email protected]
438,351,961 *2C6E2632413195DF1D8E364DD32B0CEC9AE407E3 yuvalofir
438,351,962 *2C65C0924F2CA1ECFAB3AFE3E1E51343826804E3 [email protected]
438,351,963 *2C6188EF9ABB49706ABCB1905257D8A2FF9DEAB6 YVYZJUUHTK
438,351,964 *2C6571CA3C9A49CE98D4C367348E9B3796590A1F kirksackett
438,351,965 *2C689E340F8AD2E60D6EF28BDCE1E239D0B62784 ZANEROWOLD
438,351,966 *2C600AAEA6AAD0D1FA7D508691CBF2F1BE4CE1C1 KLAFFO
438,351,967 *2C6B446FBA1A0958612035571611E2B72181C0CA ZSUPPORTERTZ
438,351,968 *2C6A5F5174A7F17D54D480BA3D40F5762E0D0479 [email protected]
438,351,969 *2C6029A64B5AAEAEF1E7EA9C569B22A32F47B9D0 ΓΚΡΟΥΈΦΣΚΙ
438,351,970 *2C67710A3E763589A5A20385351D8466465AD7CD ἔμβατον
438,351,971 *2C63AA2325B4241AE446A971C80A6D78EE7C435E ΜΕΤΑΓΓΛΩΤΙΣΤΕΊ
438,351,972 *2C6044AE9D4BFF730C14CF6940476E16EFE24B7F KRISTY JENKINS
438,351,973 *2C6B4FA447A576BDDFA9C206095507C2C12DAB67 KTMI
438,351,974 *2C680BE7557BB7405ED95438456CE38F2E886C76 KURVARA
438,351,975 *2C65DECBA0B5F54CBFE1FB8B85F0C90BD7DF4DC6 ZPPLNHZL
438,351,976 *2C6648843D352497F9E9C3EFD6C36F260DBF0D7F ZSABAA
438,351,977 *2C6F1DB9F942FC07E139512D28F6BD2A7F6BCEF2 KYKNEIOED
438,351,978 *2C6CA35922A909310E7E8F125B7A3C1E0356B006 “ЕРА
438,351,979 *2C6012C3F9FEA1BB154F9EFD36C42BC5A5B93A9C "zxcvbnm,/"
438,351,980 *2C6B1DDA82B8FF8B94A13F5FFF575A5D22B7C056 интересах
438,351,981 *2C68BF35F70CE1ADF942099504236CEF118CEFFE lambencies8
438,351,982 *2C63A6CCB012FC4745ED37EFA3451F8A04FFDE89 ОФРОЛИХА
438,351,983 *2C633B97CA1913AE6E4BC1AFA276F735B3E2CDDB болгарехъ
438,351,984 *2C6F437C8A1DA6F7486B23E2F732ED95EC2882FA LDLBSNET
438,351,985 *2C6B9D00EE1E69959D10A51CC3A501A4A357A3D2 [email protected]
438,351,986 *2C648F139DB57C1CE60918E5A85497D5DC090A3D lemuelstimer
438,351,987 *2C6FD5F80A156E452EF61B8609947B8EFA505D27 швейкерт»
438,351,988 *2C69E0122E879986F4D35CEA5E694135E063DB93 LES.PARONE
438,351,989 *2C69A2AC1D3EFB7343ECD7C00B30FAFA0D67C93D let's-get-wild-(feat-floetry)
438,351,990 *2C6DE8EAF2DC1EDC8E53364AE9AF5CD86813412F «ОМОВЕНЦАМИ»
438,351,991 *2C68C7CF9BA03FEC0E9CA877F999DBFEA41CD4C2 парафянин
438,351,992 *2C60E68F3C5E41B4282756AB1DB67574A7B9CA54 „пардес“
438,351,993 *2C68612BC2738D5CEFC59EA295B6BCC2D1B41CC3 [email protected]
438,351,994 *2C652C1D6CD03CECD5B0649686E39A8434D2B20D [email protected]
438,351,995 *2C690C3F68CDE56EB4D8E55A97790BB077914633 LiFE<BR>
438,351,996 *2C6A96527662992F798DA9E7319760F296A906CB рсдпр
438,351,997 *2C6681F8B1E71F70A8BDD5D537EF2A566B583EEE ТАМІЛЬЧЫК
438,351,998 *2C65788557A0E13EECC85EA84F2FD6A0C320B116 [email protected]
438,351,999 *2C60D51C5142FD6A57A6111F47F323F7EFEE29B4 [email protected]
438,352,000 *2C67C61D6A289BFE77B4E6C26C677A27AC0CC310 ХОЦУМИ
438,352,001 *2C62504AE13AFFC614818D9544929BC8AFA3BB41 LMBRAND
438,352,002 *2C6BC93AF0A866805A462C3AD7087DB91FF33858 яснер
438,352,003 *2C644D8B72E809701D166D5579CB7E26735B9E5E LONNY.BEKER
438,352,004 *2C6E9CA5BEE9BAA5106717FB23DD6F369A1CA672 LON.STAUBER
438,352,005 *2C6A514923E05388D46DCAD7679E743E72B01C07 look.in.your.eyes
438,352,006 *2C63BC3279576B1BA74F49FA4F82E7D04E888661 lucienpeguese
438,352,007 *2C6B786342B552391385A0601A0FCA4A54A0FBAD LUCIOPILLSBURY
438,352,008 *2C63F57117E2C896E0751665AACA908DFFD53FFC (活性ビタミンD)に変換し
438,352,009 *2C6E3AF2B45AFA26978E19169DC68F2F8DD19D15 LYNNMEEDS
438,352,010 *2C6EEA9DA0E6A167C2A10AFC08F43AB4E4802DF4 への無許可航行を敢行した。skr
438,352,011 *2C60F5862DE508F103B8428EB5B73F9FF9B31C30 [email protected]
438,352,012 *2C6E8DE59EE53A534DD449798981E46175DD96F3 MARIANNE.MANTO
438,352,013 *2C6D3635642CBBBBDE59B1FBBAA41EAB30DE84C1 MARILYN BIANCO
438,352,014 *2C6B6AE196D93A79DBDCAF6ADB218E4FE6485173 marionbeucke
438,352,015 *2C6BE22BFF657A02D0503F3ABD7B433D325E60FC [email protected]
438,352,016 *2C6FE65A330589BCCBDA4BF77A6521FA9846DF29 marwa.sharif
438,352,017 *2C66FD0BA23B9216FB8E5A2B67CBA088C7E06241 MARY.FUKADA
438,352,018 *2C6AFEE3570CC3AA9C6B52A00323BF599E797558 MASON.SELING
438,352,019 *2C6E1261AE0DF2BFDCFAC1AA21BC784B299F7B32 Massula
438,352,020 *2C66686B17F684C1C1B068A25124303C5594B05A 05221763
438,352,021 *2C6E81597F1199D9BBE41F444FF3C88424E5AAD8 10.MICHAELISKIRCHE
438,352,022 *2C64B7752BF764C53399ADDF270C45829C573D11 015HOLDEN
438,352,023 *2C660D5FA2AEC68D70DB5FDD758F80DC65549A7D 11ORCHESTERFASSUNG
438,352,024 *2C6770216A50284B769F6D3672759C082FB98492 11RPO
438,352,025 *2C69D3C7D84850AD7E18DBAC012A2B8CC708556E metopion4
438,352,026 *2C6F4D138A248C115217BF1DED65B1923AC97222 13KAKSIMINUUTTISTA
438,352,027 *2C6D3D7EBE1EAB23416C785E661D36007FFB54F4 0THEEMINEM0
438,352,028 *2C64FE1DACB3A21649EB8877EAF84CB2A49CB607 1475831 NEIN,DIEFUSIONMUSSVORRANGHABEN.
438,352,029 *2C600F31F21F5CD92409DB7106AE78DC4ADF7647 MICROBRICKS.BLOGSPOT.COM
438,352,030 *2C6E4EBF6F6D4F484F2F39D1A1EBAFF3E6182343 1553019 min
438,352,031 *2C60B98BBA3BD9B0CE74E6C91C94265BB0821810 10.KORUTON
438,352,032 *2C6A6EAC6912604140AE3D83292111FDA225B8B5 110578
438,352,033 *2C6D3AE28315039972FA13F60F183BECFC7E1219 16-MOMBASA
438,352,034 *2C6C31067790CA572231BE1ED245E2987E643DAF 1233186 THAI.FUND.TUMBLED.3.1./.4.,.TO.23.,.A.12%.DECLINE..
438,352,035 *2C6E170D3D5707F31F2E5C0632BA6EA35B3D927F 1753960 der-grosse-knall-blieb-aus-,-zumindest-vorerst-
438,352,036 *2C699487AFF63F9AA6C3D0821CCE12CE6A100CE6 miltondrexel
438,352,037 *2C62C5CB7ECFCDD65DB9535DDD081E5E8CE23806 1307425 sprengtporten siirtyi ven
438,352,038 *2C6AD3E9352387CF65C18F9CD4417C72C2861318 131631 utter.tiesi.,.ett
438,352,039 *2C64A4616C50161A9D858CC6C7A853E971667AB2 MJD}
438,352,040 *2C65548DC67E8E8DC6056E5DB262DA27848C185C 1altap
438,352,041 *2C6B7925F15D2A510F8A98FD0793FF74E128FC86 1712795 kirkkohallituksen-lis
438,352,042 *2C693772F1E252825CBC7D97D63DDC7800DCA992 1aushorchte
438,352,043 *2C6350D982D4A00C11CA45D27E9B7053946559DF 1743573 KIERRESAATTAAMY
438,352,044 *2C67B3C18A124FBFD44C6B7190FF695023F8706F 1berufsspoetters
438,352,045 *2C6B96EA0DFD75C4FB6586C939510FF27E34170C 18051719
438,352,046 *2C6CFF10E4EE088B57CD9C7740F8A30476C3E8D2 MONDSTERL
438,352,047 *2C69F850E88819C31BBF35CB9B4207957AC18EE3 1-bozal'in
438,352,048 *2C655F65F111601AF30FAD3672B37751EE27F9B3 1DETTIME
438,352,049 *2C64AB63CEEB4F984912A52C2FB255FA3663D7AD 1989OM
438,352,050 *2C6B8F0065C78C503F65B62C08DB96B28F5B3825 1 ERSATZSKI
438,352,051 *2C6B4271CEADE9F031115B2A97BE0413DD447139 1-ERSCHLIESSUNGSSYSTEME
438,352,052 *2C6E58AE4DA7058075D46CC52F84F6B3EA01AC7B MOSEBARSCEWSKI
438,352,053 *2C62AAAF00AC4AF8634386372AAA35348C620FA6 mosheheldt
438,352,054 *2C664FEDD6738C51D7DED0E594B6507CAB645A9B MOSHIACH.3
438,352,055 *2C68733E65692F94B4E4B9D607D89D9FD9D243C4 1FILSKRIS
438,352,056 *2C64473B50B3A6798C83AF61732ED4B083B17C14 MOTHERBOARDLEVEL
438,352,057 *2C6A1AE73EEA5DE19BC7E5DD90B496E3D07CBDAF 1GREKOKATOLICKI
438,352,058 *2C6C032DEE2CD57512DFC6A1857D3C75E52DDF86 1halbfluegge
438,352,059 *2C60B9D16AD61F0818979BAF9AC6FBD979080F93 1.augusttermin
438,352,060 *2C607FD10427EF02D624AF9A1CC52F737025404B MRHANDS
438,352,061 *2C68616235BBFB115CE35D8C089E9735843C059E 1-BLUTARMES
438,352,062 *2C65D18B9D29FD64F3D1437F5CB82F6E0159905F 1hoitohenkil
438,352,063 *2C6E687AFE980AEDF880815A0BFFDAE50A13F704 1.ENSEMBLECLEMENT
438,352,064 *2C6D2F57C0598F6BB8F9BEC684EEB038911F242C 1jgwaehrend
438,352,065 *2C691D8BFE39D71CDAA6EDEAF0356B5E675F6E82 muignadi
438,352,066 *2C6089A61E95B6113D5401944B8EA42CB92D4087 1FFUSTIAN
438,352,067 *2C646E281FC513A7BBF6A27594BF5D7CF567036C 1KUERZERE
438,352,068 *2C68138DF1B90BA237DDEBF1FDC91F7A6240904C 1.kutlanmistir
438,352,069 *2C64CB4331DB8EFE1B354D16151F94A78ACECFDE 1-kymmenkuinen
438,352,070 *2C64C4FE83A60B39265B866946C3CE7E030F8E3D 1.landfired
438,352,071 *2C6894F6436AABA3E0A2A44BEB2451F5F4E1458B MUONMUON4
438,352,072 *2C6D800F6062071A574FCBF2164D43A0EF9B485F 1LENIN-HUETTENWERK
438,352,073 *2C657EC4E54CE375124FEAACB6367112543F44FA 1LL3G1T13M
438,352,074 *2C6DD58F9295E5F0F7C23979B413E9E7BE14375B 1.gesundheitssystem-forschung
438,352,075 *2C67229BC51C05B0B199FE1A0F0933BF2973C162 1hein
438,352,076 *2C61A189BE498AEF0CCD16628FCA799473F2BA4E MYDEMO44
438,352,077 *2C6738D128D4753DDB828F5F602A17979B3670A3 1oburun
438,352,078 *2C619A8908C22B66688C853A068905A6B2498550 1kurgedanke
438,352,079 *2C66472FBBCF9309138FD5C953F85F62198944F2 1otogarInI
438,352,080 *2C6FE900EA9B21D5F3FE9B1E654F4536938D5E95 1.LUOVUUSKOULUTUSTA
438,352,081 *2C69D6F477AF7EF2D7D92D49B20B8CA961A3BEFE 1 PIKAOPPITUNTI
438,352,082 *2C643C0D8904C4620FE96B05DCB64A6170E9C512 1-MERS
438,352,083 *2C6980ACC852CF78944CB97E19F835F14FA0A085 1 POMPPOJA
438,352,084 *2C69E96549FBA58548CB86ABD17ACF2F803581CD 1MONSTROSITAETENKABINETTE
438,352,085 *2C6A6789F7C1854BA38AB517186FA4DEEB1103BD N00N+M35
438,352,086 *2C6A220B5997F56BAFB8295D9FAD6BAC9F5A1F82 1ROSSIE
438,352,087 *2C6E4F854DFBA02875A5F473234A2BE1D583BF1E 1 NIELSENNORGE
438,352,088 *2C6AE56580DA146BA92CD9BF3116B4F10FCDDE11 1OIRERYHMI
438,352,089 *2C6740B908E5EC9AC45C88CD223B9B101523193E 1oopperaesityksiin
438,352,090 *2C62BDE1AFE216741ECA61B6A72EB497084BEA3A NADER.ALI.NASER
438,352,091 *2C67A763DFE5BF1F42B0DED22C3C9410713E302F 1.PALVOEN
438,352,092 *2C688FF16590CA6BA933D48A69FEB3F30AF97AA2 1-poliklinikkak
438,352,093 *2C6A9796C258729346B27439756746F613F144D2 1PRESTIGEKLUBS
438,352,094 *2C60A1D01FD6AD800FD5D689A6F18D19401619D5 1.suyapa
438,352,095 *2C6DF882EBBDCC745385F904FF18F978757BE6C2 nathanholdorf
438,352,096 *2C6EEEA99E65BDD52A43118F1B8D6670BF0C5194 1U-BAHN-UNTERGESCHOSS
438,352,097 *2C603C45616118863C897DD4B36B417D6B0F54B9 1uusvanhuuden
438,352,098 *2C64EECD8A960B025EE86FDB4DA50E61821C6F9D [email protected]
438,352,099 *2C6FC5CE8FC680969048ED4832B0072782141C80 1viskaamana
438,352,100 *2C67D4260370D0277587342381C70A33B4DEF476 1SATUAARRE
438,352,101 *2C69064A3825835897CAB52F7C1E12A6E9404570 nef4r1ou5
438,352,102 *2C64E95F14114461940695455831F64C33FB7661 1YHDENTYMISELL
438,352,103 *2C6CB9CE25DA734BF77889199141B235A998BE82 20040302:THEFILLMORE,SANFRANCISCO,CA,USA(DISC3)
438,352,104 *2C674703A77C59F38DBAD552BA91C9F7B85D9518 20477 ALLEHIERIMHAUSSCHREIEN
438,352,105 *2C626B44E0A2C6DF7957B564A3D2E54EA945C45F newsandsport
438,352,106 *2C635DC8FF7A82072C81D61E3A29C818318A8FEF 22&357MAGNUMFIRE,C/U
438,352,107 *2C69894DDCFD90BD97FBC2E4D5AC9EA1774D0FF0 1VIEKKAUDESSA
438,352,108 *2C6A65892BFFE9265827A1E5BA4B3CBFFDD3EC35 238yazmin
438,352,109 *2C6B0801F67336BF53117D0F149AAC3FEE4F7B93 noblegarms
438,352,110 *2C6D6A5391082E400F160DA1697C0B9F310921BA 2246181 poistamaan.ne.joudutaan.1.-.3.vuoden.kuluessa..
438,352,111 *2C624EFA09D7DEE7CC257AED9054660641CC9D87 234560 "thisjustgivesisraelequaltreatment
438,352,112 *2C67026852BE63D72BA94653856FE21F51D5DA86 234oscar
438,352,113 *2C6F93936299BC944DA15450F83F85B42D79C683 289 UNAUFFAELLIG
438,352,114 *2C69D45738D877C919DD5B0016659F2BE49B3F85 2425580 samestore sales fell 44%
438,352,115 *2C6B6BDF390230D714451F941500EA894667CB55 2457LT
438,352,116 *2C6BB042A27C8945C08CD1745C3837D1908FC24C 2 BEGRAEBNISMUSIK
438,352,117 *2C65FFBE5E1DC05944AEA2B5E11A0E3DDFDEE286 2524785 NYTONSEURANANIVAINPIMEYS"
438,352,118 *2C6504269FB87A3F2F1369327F69856B031A3C51 notovillar
438,352,119 *2C638B154966E932B5F1AC6F66D47327AFDE39A1 2FNATURE04746
438,352,120 *2C6E325A499EBD7CA4E1FA1E8B2DD2A8FFDC93C4 NOVASCOTIADUCKTOLLINGRETRIEVER382
438,352,121 *2C6049AB1F346A45FC397DEC764B0D852B1E7661 NOZLEMI2
438,352,122 *2C6A46EAB88F723B5E83FC28F63FDE2C8362F9AE 2.HAUSHALTSUMSCHICHTUNGEN
438,352,123 *2C63E7D7503591C11A5228A9FD981D0A62FEA1B6 2ILOVEREED0
438,352,124 *2C6186D21B6DF791A872BF8E6A4C4AD624D18C42 2 KLUBEIGENE
438,352,125 *2C683FD338DF8CFB15883C066E1DA17E97CC3264 NUDIES
438,352,126 *2C66C22DC7EE2BAA6F6804A7648DDF51361829C0 2.ONGORULMUYOR
438,352,127 *2C6171A6896C4009230112A6F99B61EA9B5DD308 2PARAKOU
438,352,128 *2C6C866F4A91012DF3F329AB7A20516DDC7B1247 O0WZ
438,352,129 *2C6B3A5A5710ADBDB29970BF1C2C372A5BB33A26 281544 - evet yoktu
438,352,130 *2C6F480CF7DB03B21C3013DBCFD7C754B154B98E OC7U
438,352,131 *2C6A58EB0B524D553E65763A5CE20CC8159898D7 OCEAANOEVER4
438,352,132 *2C65AB0CF6A4FD994B6A842F0739BDBFE7A526A3 2ausreitet
438,352,133 *2C6B02C866D8805EA391C69C4A5AE3F694B83FEA 3#####> * * * ~0~O3B<-
438,352,134 *2C6F8F45751D5CD5D7D3E978B70E5DEE33DAF351 OKAKURAED
438,352,135 *2C68287EA2E2F7BDD621041D0694A8BEA0F8F5E0 33-NOUSIKIN
438,352,136 *2C69BEA8B74EA2CC1AFA20A5190516F9EDC9B1ED Ol.gir.del.druet
438,352,137 *2C65CBDA9916C5F7F3790139C2380730D5A654F1 OLIN.BUSHARD
438,352,138 *2C61F7A25986B506606BDE850F745103165281D0 2ILHAREM
438,352,139 *2C6C936D92BC818C1EBF8ED3B9EE6064434DD452 2 LIHASS
438,352,140 *2C6A7C6CD4B77D9482BC8808D2D70AA4D5EED9F0 omegapaul
438,352,141 *2C6D970B060F26654829E30B17B2F71C2A62CD3D ONHEHE2006
438,352,142 *2C63C2B3F94A13837067FA7AD336EB60EA95B146 3FINSTRM
438,352,143 *2C6E2305BB37289C155715EF77EDF71807D95406 >-<o~-O~d###B
438,352,144 *2C6451F9D000D31E78B427A50DE8C106C07023BD OORTMLTFVGRR
438,352,145 *2C6885D0DCCE386EF39819D7CEDC269E1583EFB8 2.SULKUTIIVISTEET
438,352,146 *2C64EDFEA6D957090DD370AA4705B639DE6AB0D3 2UNLYFED
438,352,147 *2C6C0D1DBD5EFC0997D77C9E48F105F5B0B50471 ><*.*.<3
438,352,148 *2C6A3BBBA22D470763934CB23966CE80A59B7D17 3PARKPLATZAUFHEBUNG
438,352,149 *2C6F0C06467FEB152A86533AE0DBD871D2D7692E ORVAL.AKERSON
438,352,150 *2C601F6B3B27145E70C6D025EE34D7C36A5C33FE 35cca6c151737430
438,352,151 *2C616CA27F40EF630D8BB08A3031CB48A2E4A8B5 3==p.*.*)x(
438,352,152 *2C6E968498FA3C21A842A0AE193E190944B9BEA0 ostromaansche
438,352,153 *2C678DF3679650AF1F63E99ADA8AE0CA90F27B86 3SPIRITT
438,352,154 *2C6D0005A739B52010F78C6A38649F12C22F04F9 osvaldoswiss
438,352,155 *2C6A6B46020A5D17F0BB8CEE3331571A4896AB4D 3THATSPAZZ4
438,352,156 *2C6043D8EDF565AD2E82266E55FCA1019AB42C22 41897
438,352,157 *2C6DA8F1271A7AAD0DB99DBF1F697D81FC021F7F OVADEAN0
438,352,158 *2C653D0D79F814F600B8F6E7A22F11C67E84A387 Overpersuade
438,352,159 *2C6A940A90C285FCDEF05590C72E1F1EB098C2B0 overvaarten4
438,352,160 *2C6545A8B5C422E7F36AA631B7A67413C2DCEB0A 3.lard's
438,352,161 *2C6372C57553CBD628B9EEF37514EE6CC3843D07 [email protected]*.(>_0)
438,352,162 *2C66BBD30BBF8AD9AFF4A2FBE161E4319BCAFC13 3p.~o.~oo><
438,352,163 *2C62BD3FE22B4704E93DC9FD59BB9AA6569E390B PACKSN
438,352,164 *2C6687619DE150400E5DB96A6DB323E1C2CF5059 4ICDBTITS
438,352,165 *2C6C16B2EF0281327A11A0082852DEF8079F8AE2 pandasmashcomwww
438,352,166 *2C6DEB0101BBF4384DDB16CCF5CCCCD0B646AF3F pantomime/everywhereit'schristmas
438,352,167 *2C67E2C0E424B81908B293EAAD34CFC4DAE96422 4OTSOKIRE
438,352,168 *2C60A6EF3877CDCACA394B3D608FA73DD4968C54 495327 sandalye-olmadI-kendi-kendine-.
438,352,169 *2C6181A535FF364FB42E5F666143B27592A722C1 4ALLERIST
438,352,170 *2C68663505AF5C055335BBE9C9533717CBE37AB3 4pjbgvhzomsc
438,352,171 *2C665C00155B72E6676257CD0A371D00B85629DD PAUL-VAESSEN
438,352,172 *2C6DEA98ED6DA682CAB75A613E67B603F2F2A904 4IRISHLETTER
438,352,173 *2C66B982867C4F6856E28DC04B290AE64F06FE08 4TAITAMATTOMUUS
438,352,174 *2C6FC0281AC8B8FB6CF7FEEF6173FCB2B5DC2F96 PDF2SDIP
438,352,175 *2C6BB2A6BFC973612CF952FF3464099428C94F34 4TWECHELL
438,352,176 *2C61FB05794D7FC7766DA8A337A2D4E9CA681C5D PED4N+RE5
438,352,177 *2C63B19280A264ED4FEB0558BF462D4F71D802C0 pellattbsw
438,352,178 *2C68F02DC1B2B304D830D71EEF06D461EECBD6B7 pelotonnerait1
438,352,179 *2C6F8CB02EB152714C2D6242129FBCF0E8E5422C penny.dorsey
438,352,180 *2C695F5FDDDE779214F3B63D6D6BBA496DBC829F $.perl.-0.040.prog1.infile
438,352,181 *2C6FA5D5CE273BBB5483C45FAFB5FDB1F35697EE PETE.BIGGARD
438,352,182 *2C6045C64CB55952D734468F70FFB35256992136 PETE.CHMELA
438,352,183 *2C6512CE8F794E4828C90A6F92DA6B45F8BB33F9 PETTUSPAWNEE
438,352,184 *2C6DD7639DE1711BCD2DE533BEF3D437C2F303C7 594118 BIR-GECE-RUYAMDA-RAHMETLI-BABAMI-GORDUM-
438,352,185 *2C612A3F327AEB8437657CFF34E3D18A22806C86 5ANDRE7
438,352,186 *2C62F9190A5D45709E1EBC0975E154FF9D836995 5BSWCONVERTITESBSW
438,352,187 *2C61656107921527655023603056EF64EE91752B PHIL-NICHOLAS
438,352,188 *2C633F158D5F8A2174E52CD4178A5874F0447BAD 5CASALINGO
438,352,189 *2C60D54C5A8D94B8CA382F9500573ADC59FFE6E6 [email protected]!NG
438,352,190 *2C6D251985D00C573EC452B2396097D710A5B48A PIËMONTESE
438,352,191 *2C6171EE3B76D81EDF0ABDC013B79332AD9AAB4C 5GRAYMAILPARKER
438,352,192 *2C69E946D021CB44FDBD5800A6D1D39DFAA2E991 5HSHTOOMS
438,352,193 *2C63743A8824AF0E96A9336319539E25A4D0901A [email protected]
438,352,194 *2C655EC8862AAAEC1CEAF4D896804496AD0A0B2B 5iluvawesome7
438,352,195 *2C6CF25B6BBE88106A187AC5069740E8F99155D5 5KESHERNETBSW
438,352,196 *2C65B551D6D7A3FDD0C7A923A6608373AC02CB97 [email protected]
438,352,197 *2C67122FF7D3AF358CF9C21C37C20932174E35A1 5DHVSSJTNRG
438,352,198 *2C69C99B8C8EEABDE1AC99BC53625695A436154A 5DOEANEHOF
438,352,199 *2C629C9358BA49EF760B2546412BBD866CF0E8A1 PLEDGEDS2
438,352,200 *2C66D280C4307DBFC283E381D4271CEBB412E7BF 5MISHRAANI
438,352,201 *2C66B3FB00B08B77CB84733F3AB533276BE6039B PLU%
438,352,202 *2C63FCFF21BB05915BC3979A69EE0EC0BA4B3240 PMCSALLY6
438,352,203 *2C6ED0AB9A9701693F16AF9D03D267596FAB8EF8 POBOČJA
438,352,204 *2C6CA294C77D4114DE8FE128AFBE05A7DC94D527 pollaiole
438,352,205 *2C6B0EFEADE450E21C404318C0D5B8E45B91B79F POMANES4
438,352,206 *2C6F3B52CBFCA2F73FD7A7B8D50E2FB198EAE70E POPLOCK15
438,352,207 *2C664B073FC6F5625ACB4F166FC750611873184B 5OPHTHALMITICS
438,352,208 *2C67B1F11EB36313156D274FB04512D4CBC4D182 PORFIRIOMADRIZ
438,352,209 *2C67A2A90C65E1D7527D31A59286FAF7F3106EAB PORTERDELANGE
438,352,210 *2C6392CDBA88C90ED64EB2F7659A7E5B6475543E P==P~.~.:p
438,352,211 *2C611E0801AB1AD35993E9A7F7E65B59A43AAA03 PR0PALA5TE
438,352,212 *2C6552D36E1D8FDE1C0071FE03122CE5816FA4E2 5SUROINUT
438,352,213 *2C62686D56947157206587D71CFD196CEAB344BE 636952 OLCU ALETLERININ YERLESTIRILMESI .
438,352,214 *2C6664CA14CA707B23CE5AB06E9F7E760475225B 6ANGOLINO
438,352,215 *2C661A6BDD9EB7AEB7B7830173452A6B699470C5 6BREEUW
438,352,216 *2C6DB58DA80ED4D4953064BA4D7828A28C0F47AF 6BSWTEXTRENDBSW
438,352,217 *2C6266E33F964F8F199FD5557AFEE165CEAD137E 633VALERIA
438,352,218 *2C671F8C1C846AF68AD0F2ECCFDB3D0DBCEFFB59 PRINCEMILLIE
438,352,219 *2C650A25B30AFC4F0713603B8FA7184C9CE689D4 6.halbherzigkeiten
438,352,220 *2C6B6383C4520B3183705B42FE87E027EBEADC08 6CLAIREMINDY
438,352,221 *2C6E33184ED0528D96363D812D6613AB567FE88F 6iluvpiper13
438,352,222 *2C6BEBFD961C09EEAFC6D9351B54A7EB9DDE15ED 6FD261E800593D528669E8450E434B24
438,352,223 *2C65F42A774F93873B110BEBA693A6B43B336685 pU\
438,352,224 *2C64C1F5B71DD28D7D03D63A9EC23DCE09B460FE 6iluvq1w2e32
438,352,225 *2C6906664C3F56D85ECAB5C0EBD58EB704CCC778 purwörth
438,352,226 *2C6A81D50FC7EC4CA9237F7689CF4DEAA8BC6577 PZCQTFFD
438,352,227 *2C6CCB6722777D9494837AA8218BB063069E1405 6MEAMWHILE
438,352,228 *2C6D5D41CF6A4AAEFAADA96426D29F46C30B0FF8 6WRAPPEDUPINCAUGHT
438,352,229 *2C6B8AAE23CCE0E8B74C537FFC9AEAAAF93E8D50 6YQUJEHA
438,352,230 *2C67D3E03771C9372993B569BBD8490105094541 QILAISO
438,352,231 *2C607211EBA9E5409DC7AB939BF075F43810E88C 7AIRBORNEBUDGEBULKBULK
438,352,232 *2C6A4D58E61D942796CA484F41DE9252C3614D43 7ali
438,352,233 *2C6DE46E3031F434C7228EB8536D4D6505C8B7C6 QUART11ES
438,352,234 *2C643C65FABF926B695FD71ACDF8833A11CE2E42 quincyivy
438,352,235 *2C662256778CDA85A84B7CBE4D379F8418EA6F2A QUINCY.MORRISS
438,352,236 *2C6D3E52445336D5EA3723212494C142132E8234 QUSCPJXGB9K
438,352,237 *2C6F02129FF61309AAAB5338276A521E2FE3B04D [email protected]
438,352,238 *2C66AC5EEB1726D982965CCADA11B02FD790EE99 729rhys
438,352,239 *2C6698758249F124DAA5C2968CEB1E282DBCC783 RAMIROCEDAR
438,352,240 *2C69741C2974B3E4A91872DC468F4DC250716244 7PRINCESSPUPPIES
438,352,241 *2C6D0FCCCA4B11365DC3770C1991E1A8F1C18D77 7RUONOHSI
438,352,242 *2C614E9E0ED04FFE26E34BB3597432D8DA7B889A 7RUSSELSCOTTY
438,352,243 *2C68E95F619C7954EB5128F70A8574A52325B4E4 7SCHEVEEVEHCS
438,352,244 *2C6B5B6FE451EA931C76860A032F3D19E7EE542E 7SPEKULERAS
438,352,245 *2C6C2FA362C1440818BDCDCA15B44DC5D4A26378 7SPELLERO
438,352,246 *2C6DBA94428C1F97596818B5BC43C49D0463AF19 7UNGEKAPSELTEN
438,352,247 *2C67240E373DAF86CE857AE5CDB5FAE37E4E1056 7VADESTEDERS
438,352,248 *2C6140A4778650C0B92FF19457D5850A7218669B RAYMUNDO.BRANTLEY
438,352,249 *2C6FDADECD9D311BB4EEBC046602F091D5EC00B4 7WINEDITBSW
438,352,250 *2C6538A322840FA1717D52FBBA177F4E29DD5458 7UNSENSUALLY
438,352,251 *2C6F09C187839092EB979EC3265E6B942E475219 7YODOPSINA
438,352,252 *2C605A242A17F6882F419BFC8FB8E53FDDD49C3A 80xvxakfh7e
438,352,253 *2C6C3CC18F0FF5D4F275D08AA0722BA40D3EC3E4 8att3n3rs
438,352,254 *2C611EB5D01E7E9AC3A6450BCE6DD8A167144898 regarderaenarrièrc
438,352,255 *2C63CBD38419B014C91DAF63D430F45EBE6187E0 REIDMINEAU
438,352,256 *2C6560B01DF68DF3110A6ABDA374CED9E6C682DD reinjurierions
438,352,257 *2C66F89DF0F822468C967C3DDD9DEB6D7BE966B1 8DESABUSAIT
438,352,258 *2C6EFDF3CF820EC4C16EF4F7ED7C64809C29D58C 8ETSIVAEN
438,352,259 *2C642FF35845DA991DFB40328F92F6C4EF3B76CE 8COSTEANTZ
438,352,260 *2C6D04ABE55F60457CC169549D63C2E2E79D4CA8 REVER8ERA+!ONS
438,352,261 *2C6353C750FF3914DC1C3D10BA7B447BB11C3E10 REYAMESO7
438,352,262 *2C6806455489C4B31F50C0FB2FDA8B69D987DB04 REYES.SHAMSIDDEEN
438,352,263 *2C6D6CFC7EBAE843E5AFD66A9DEE1DCA151DE707 [email protected]
438,352,264 *2C6A9699056247A1A397C41E5A76483CBDA9E11A 8NARUKVICOM
438,352,265 *2C6B4EEE9CB5090D585FCA34B41F5A89A9F85F9A RHIPIPTE9
438,352,266 *2C6463ACE3E0D5168258E2E1128D03B395E0C805 [email protected]
438,352,267 *2C6C90E048FAC7AE8774BCA80B6C45CC6D662596 r"ibaa
438,352,268 *2C66974C0C77A536AC98F07B796BE0A93AB16B06 8OGRAMMER
438,352,269 *2C6A84F8E58A246253F06239CC37EAFD6BBCFFB9 8MINEAMANDA
438,352,270 *2C64C8BBF66E7BD53542341B274FAAA8B01551D3 8MUTEGNOK
438,352,271 *2C6572B2C061B35472FBBE28534813E1CE2906D9 8---P*)O(
438,352,272 *2C67E5237DCE70F0901F1BA986F662E41172AA78 8p.~.~.~.Splat
438,352,273 *2C6647BD88A79279CBB1B246363755CD830576B9 8RIVNINGER
438,352,274 *2C6A1CFA4A73B3893B7539838F8D5EF84D09AFB8 RITIRERANNO
438,352,275 *2C67CE6FF01B9A3310C57E638EA2B0C0D6143BF6 8====P-~-~{X}
438,352,276 *2C6B78CB9CFBEDE19066A642D27B2AD03F7696B0 8SRFALDSX
438,352,277 *2C6C6284018D5A54E984967C03E772A159EF0E62 ROBBYKARANGELEN
438,352,278 *2C6D93D77E9BBA5D8AD6618C0984497390560523 8thefox6
438,352,279 *2C62E2935D2D3697616A2A1F94D21174887816E9 8UAEBEPROMEMIRATESNETAE
438,352,280 *2C6E88E0CFAF3529DC6C72847939705380107770 ROBINCZAPLA
438,352,281 *2C69E376919AD29325D656D9B5EE619798723D13 ROCKETORCHID9
438,352,282 *2C638F45DECAB6BBA0DA091AA983102EE92BB93D rockykouyate
438,352,283 *2C6648F183384F05F50AD4D8CB4F71136E79E63E 917831 en az 4 CeSittir
438,352,284 *2C682B24D60F5B795C04C30848B4F53040C4B683 RODOLFOCUDAN
438,352,285 *2C6A4D0758B67025C251264FAC592D53099F1229 980981 ONCE-SIZE-533-YILLIK-GECMISTEN-BIRAZ-SOZ-ETMEK-ISTERIM-
438,352,286 *2C665762F68178FD8D76597CA7CB198EA75BC317 ROOSEVELTASHBACHER
438,352,287 *2C6A7686E7E8B07C1D31168DA38B408AD770140D 9BSWGETVALBSW
438,352,288 *2C6B66DBE407D6AB83EE0826DF9188DC9176A476 996365 DIES IST AUCH DRINGEND NOETIG
438,352,289 *2C657FEC879230E449D73694D9758BBE8DDFFECD 9CIRCUMSISTEREMUS
438,352,290 *2C6ECC3CEC75951CE9B99DCBE1F6A3F17BC3F6F9 ROSARIONORKIN
438,352,291 *2C6790635A217AB545CBCD5282F5583AD9D4A253 ROSCOE.BARTHEL
438,352,292 *2C63E3828573D9451B3FF787BB66B247E4C5ED03 ROSENDO.DELL
438,352,293 *2C6BC9F741B006BA164C1EF3AD9A0AA608955BA4 ROSETTA“
438,352,294 *2C6466715810000C79D2E98073213B56FE0D08CA 9BSWHELPPOUDESTAH
438,352,295 *2C63143D7CB236608181D63B0D92C840CC5CCCE3 ROSS.OLEKSY
438,352,296 *2C610D0DC94D82D95EFD556239CA31424DA767DE 9BSWSUPSETBSW
438,352,297 *2C66F24490DED514117EF6B4FF0B0A99DE03B247 RUBEN.COUP
438,352,298 *2C620B4E4C4391AC239D5718E1ED906ACC8305DE RUDOLPH.DRIESENGA
438,352,299 *2C603164BBC201BB0A823708C232B47290FFA29F 9SUECICUM
438,352,300 *2C632C8A85E1B5DD2C6E8BC8E70D42978294F669 9SUPEREROGATINGI
438,352,301 *2C64334C0D93FDD769743C49DDCD5FB06D1D3CB5 9GUIDERENT
438,352,302 *2C6EB1F18B2783C44F2443F893350EFB2AE50D54 9VERNEUKERIES
438,352,303 *2C66BA25C48234124A35A14477C1B7D3FE5DCD42 RUPERT.DELGENIO
438,352,304 *2C64CE10B4FB1F44C7975BF229FF85651C0651AD 9JANNINKS
438,352,305 *2C670184DBCCC105614883D0E0781EABE587B436 RUTHWANGARE
438,352,306 *2C6A2CCEEA298B5F041655DB0F8057B3757941FC RUXZIGGYING
438,352,307 *2C61774FF3CCCBF35AF94F6ED69694D2C96E4AFE a1nyl
438,352,308 *2C6E093CA0F2A8FBF8DC7CD770BD221C3D5FDD8A ryanjuliar
438,352,309 *2C6F69FB14F07759784764965FAD36FAF33EF518 A2OTK
438,352,310 *2C694282B429D8B9CC03496B83B8C59FDD830F8F @S7R0PHYSCS7S
438,352,311 *2C6F90F7279ED4346BE204DAF890DB7DF5964C73 SAAVILLA
438,352,312 *2C629DBDF582F51C2BCC37917EE2D5C1CA1D75A9 A7PP
438,352,313 *2C67B6EF760FD047107708AF876981EBE504B857 A9QE0
438,352,314 *2C6EB5E5136B20955CC07ADEBEE4C3CD011114F3 SAMMIE.VANBLARICUM
438,352,315 *2C6DBA415958127E9898CF0C1A7773C7D63C04B7 aaa5tt
438,352,316 *2C6A24EA804BF15028B862E778DAF699CB9B0F28 A1BA:
438,352,317 *2C6A2BB838DC291D69968ED87552B94A54884152 A2rq
438,352,318 *2C6ABC1BC918DB6184D8AD34CFECE7B5502F42A7 a6?s
438,352,319 *2C6ADA705A599D3EF3F125530E9B770D6D856CD3 AANGEKREGENENED
438,352,320 *2C6829C848323217019D3BFCF3918FDA83006271 aaa(bw
438,352,321 *2C65AFCA1801ED737CFB672B2E8F4EA33FAA3027 AABUSHAAR
438,352,322 *2C641042B4670C3B7D721BCFB7D23603A2042569 ABDELFADIL
438,352,323 *2C64B8E680D5274007E6CF3FAD0CDCBD63F297D0 AAE`V
438,352,324 *2C69F739D6DB5146D8F304E1A01553AE64CDDC9B AAPOO
438,352,325 *2C6610B08F408BE9E3846FB1F8D7C0FDBEB92C11 ABESNOWDEAL
438,352,326 *2C6A185EAAE96878EB638C6A8DCD53C4F96857D7 abgefarbter6
438,352,327 *2C6713F202BFC05AA82979B6A6537EBE95669547 ABRAM.MACCUTCHEON
438,352,328 *2C69BF4AB459650377FA1FE300026C695519D2AE AB)]T
438,352,329 *2C63C548C1AC49C03FFC10DC4392BAACBD569F42 SCRAPIESES3
438,352,330 *2C693D7FBC79923D3A7353316276836B1D9702A5 SCREENMAN
438,352,331 *2C6ED8AA68160DCDC14C670DF1570845E28E0665 sebastiankluth
438,352,332 *2C6EA56B51C1686462D63B57C6ECD748DDBF1740 ABOMINANDO1
438,352,333 *2C659CCF901FD34273C434231ACC79BE7CFCBEA8 ACMY
438,352,334 *2C65E1AFB1C5F4426ED174E1011451095AEC629A [email protected]
438,352,335 *2C6DE930C5096568B664898AC21BF1C002D2819D ADEVILLOTA
438,352,336 *2C674EB5411C5D51C3B1E8A063E94163C60BD203 A.DI
438,352,337 *2C616DCB1AD052E22B4DD77958268AF934BDA4F7 adminpass
438,352,338 *2C6C4ADBE08EF3913F14FACCC9F27E61003DB278 SFACEVO4
438,352,339 *2C6047D1B4617987E4B02EBA42D559DAC382F947 ACWBI
438,352,340 *2C657BF80745B75BEA26A3628D287979011D4624 [email protected]
438,352,341 *2C6DEEA0A044C41CBB15A414AF2ADE52B9B3D804 SHAQUITA.JONES
438,352,342 *2C60232AEA3BD619E3E7AE22AA9D6BB1DECCA9B9 SHARK-(ORAL-X-MIX)
438,352,343 *2C6E3649E3C514897C6E46EB296CE36FBA9FA9F8 adbf&
438,352,344 *2C63B400CCCA40A8836CCD2C4A0F70471826ACA8 a/hlp
438,352,345 *2C60F1EFEFBA15C288C7F629D4986D95FCCEAB71 ah ne bileyim
438,352,346 *2C6B8AFEC5A0C68EE9AEDD92E6A9BD42695F2D5E AIMEEBURGAN
438,352,347 *2C6F6AC97B6D2D20D8073674618C752736B196BF aiozn
438,352,348 *2C65CA8B60470EB60B345505223334F0E24DBE26 afn/w
438,352,349 *2C68338E18EB5AD9A28ED1C3001A5BCBD9E877F7 afstomp?
438,352,350 *2C6171C214A4485E29A1279E03A0D26EE3A8D6B1 ajzn
438,352,351 *2C66E5C703A5CED45121CC5F56231493A20F1203 agrounded
438,352,352 *2C6F424792FA1F8C4196C7DFA679F502310C9D36 alanz
438,352,353 *2C675318E05801310B88E9686E90CC249DF8A411 A$LE2
438,352,354 *2C6277D3DAEB1AEF5881EE0430FEFDD909AF2AAB SMITT3S
438,352,355 *2C6C8385AE8645E9620C3E3E7A42D956F7A3538F alexanderbrierre
438,352,356 *2C6A82FD18FCEA9CAACC5C9CFEA5BE74A14BE5AD ALFABETRIO1
438,352,357 *2C6834BBDC52AA7783AAC9822A457B37EF8F67E7 ALGEMOU1
438,352,358 *2C64DAE032F00F6559297B46C6ED0CB0AAA6E0EA ALL-MASTERPIECES-REQUIRE-WORK
438,352,359 *2C605A26A65DA0E86DAD30251208AD3AC348AD6A A-LUCKY-SONGBOOK-IN-EUROPE
438,352,360 *2C6210EDAFA03D9816910F5C5F3B9E7667824902 ALVINIA
438,352,361 *2C64A830D11710A42335ACC605DF6D9500703D81 sonatag-moll,op.65:iv.finale-allegro
438,352,362 *2C601DA84F16116010B7DC5D6E4639B57E891076 AM=4L
438,352,363 *2C6A83B01615CB5793CC99917E18FDBFBDDEC6C4 amor, amor, las nubes a la torre del cielo
438,352,364 *2C60EA547A49E7E11ECE14712829523DAE9FCF2E [email protected]
438,352,365 *2C6D66179E5C5545EA074865A1ED135A32C94466 AN&"2
438,352,366 *2C6E5F4D1B4E6BA93FB53E363590DE74E4DF6FA2 [email protected]
438,352,367 *2C6E6A1775D1C709FAC9D6880D00D0FED2683037 ANAILAK0
438,352,368 *2C6EC25B8DABBED21C528DC428C58A48EF55D223 specijalizaciju
438,352,369 *2C6C133C0EA80FF5EBC7142994CF8B5046366954 SPEX
438,352,370 *2C6FA6FE55D06B13283D4C29B12D527B41F79CAE andydinola
438,352,371 *2C6821E9CF6369DFF09340970BF981466C33E9A0 ANGA5
438,352,372 *2C63408894ABAB2F9405B61BC2F9EBC8D5F07F44 ANDYREINARD
438,352,373 *2C6C6884524A3E751C328228EAE6352C7D14A6FE ANNHLA70RS
438,352,374 *2C6FFBB26822CCA89ED9102C03202E1F430CE8FC ANTBEAR5
438,352,375 *2C628FABEBBF34F70BF082E540E729BE96A43B2B ANTOLOGIERNA
438,352,376 *2C60166F1260F9B19C81E0B94A575BE2CC9A1700 antonyliontos
438,352,377 *2C6124D7FBE2928E6C504E8B6BCCEDCCB004257D [email protected]
438,352,378 *2C6D6867B5F1AF88534A59A437B69E5C4A08D94E AO7EL
438,352,379 *2C6ED88CEDDCA80146D521B76F1CC544F91D9E76 aphrodisia
438,352,380 *2C63346662EEC45469103992FF81370A7D5C5102 AQ9NB
438,352,381 *2C69788E88CF856A8FA8010337A3C64674430582 STEPHEN.BONENBERGER
438,352,382 *2C6615076BED0261D32E0717E4B0841BC90C765C AREFRIENDSELECTRIC(SHADOWSONTHEWALLMIX)
438,352,383 *2C620C10CB35DD24201E571912F530F1FF182E03 A")Q
438,352,384 *2C6EEAE7AB60ED2B6EBB5A772EA486DB9B4CD2C3 AREPICIT3
438,352,385 *2C6E9F5D08F57953C815F70679FA380F4448EF63 streetleveljam(partone)
438,352,386 *2C618F0F0F40B0E77EDE966446C043453E6CBFF4 arl/&
438,352,387 *2C6481EF36CB5B69B530FC1A61471597306AFB0A ARNOLD.DAVILA
438,352,388 *2C655EE587146F6FBA08160AD04AF8F846027287 ARTICLEBHOEBLE
438,352,389 *2C60C55BA21A523DE6C8B0AE4348FB251680F0C7 AS3WF
438,352,390 *2C6E0C6B4B657EB04C62EC5EAC260AAD02272105 ARTYSCRAZY
438,352,391 *2C6C83DE254965D6BF4B90DBA0BE81E12AC86708 arugola6
438,352,392 *2C65D0E96373CE1DB235BE0554204724690D2926 suiteno2indminorsarabande
438,352,393 *2C6706F77F491B54B9113EFB452202EA0129C7BD Sunset.(instrumental).(30.second.version)
438,352,394 *2C6F7B3B3E425CECCDD6C447F711F8CADBC17E9B SUNSHINWILLY7
438,352,395 *2C67C58B76017107CFC96D63495FF01F72C70B24 ath,n
438,352,396 *2C6F0112E427B468A3FD55AE8FF886FF2C958632 at5rw
438,352,397 *2C690734DC7CB65133600A80D55E90BF9799179A ATTEMPTLESS0
438,352,398 *2C63CDCA14EF3D32771CFC6886E7DAFEBB8B9B46 susno.aza
438,352,399 *2C6ADAE46BA3AC8451F54468AF4E2E153223583C A:u&
438,352,400 *2C6A2832C16E383339CE24D5C6AD30F5AB5BB3D9 AUBREYKEHLER
438,352,401 *2C6535D737B86ED7D06ED6FFBF28C66D33C29DDE [email protected]
438,352,402 *2C6A691E15344EBBAE760F3AE5AE0F095128EDD5 SWINNING7
438,352,403 *2C6A4A23E18B87F8B053537D58ADF0A400A69F08 autolycus fivejustices'handsatit,andwitnessesmorethan
438,352,404 *2C6A50548F0445FA325FDE9FAAE76180768E5B36 SYDNEYFURRH
438,352,405 *2C619D475E8B28C36927D14899198E6D0532BF72 SYLVESTERGRAV
438,352,406 *2C6353F03DF5CB5576D480F765A7497B80CFB0EA SYMPHONYNO.6INCMINOR:INTERMEZZO,ALLEGRETTO
438,352,407 *2C66F3B3133671B78EA63A071440E62F45C57BC4 [email protected]
438,352,408 *2C68899FC17DC7FC0990E7B6397FED4960C4BCAD TALINGUER0
438,352,409 *2C61402F791E81EA59A9BB2DD88EC1FE7D4F56AC TALKRPK-74
438,352,410 *2C6D1AED0B4A0EE9C9BFD46AB9BCCA71F95363B8 [email protected]
438,352,411 *2C6679A782BCEE4605D56391407E4A85CEA6DDF5 avwk&
438,352,412 *2C6CD601C26F873751E46FA63876363733B3F3EB [email protected]
438,352,413 *2C6DE96427F2355F7E0C4131E4143A1D9740432D tanvi.kohli
438,352,414 *2C6CA9DBC167BDA40D31D00CB4194064A49C63C3 axaaa
438,352,415 *2C699AFE6E88DED1F79B276F9C9A5FF26F8401FE aw!lo
438,352,416 *2C68156E58ECFE849E7864BC25C9D978016DF1F2 AYGF-
438,352,417 *2C6EE301D21F3AAB7AF1B44695D663920C26C8B4 AYVURAPYTA
438,352,418 *2C68A7B4F6A77EEE60D3F00726C2C688956D8A78 B43EB
438,352,419 *2C6425A714696947FF8A17B3A915D7CAAB29467F ba55p
438,352,420 *2C60024A1F49E79CA8877A548651B9B6A5DF17E1 THEFLAMINGO2002
438,352,421 *2C625DE0FA1BD04E0E624E595E33791E4616B749 bajonnie
438,352,422 *2C698FD0F4BAC4FE332E4F87971854C817F53E37 THESE FEATS
438,352,423 *2C6DD10CB91F0FC8DC68F43D93EDE7D7CAFE9530 barkahouses
438,352,424 *2C6C50CDCDC4C3BF73DACAF740EBEF5132947312 THITISAKED
438,352,425 *2C641C7659E77528873B3923E237E2570195360C BARRETTDEROY
438,352,426 *2C69CAC8D970BCF84077EC516138E7CF8D47AB8C [email protected]
438,352,427 *2C6B83DD844F291F10C4793ACAF0C50BF776C95A THUMPINED
438,352,428 *2C60AA4BB4E512E3B30F07DD5FD24293CBDFCA1F BAHTEOR
438,352,429 *2C6E216602FBF635534DAA3EFF59D68AEAC3FFE1 BATEMAN-(ALTERNATE-MIX)
438,352,430 *2C61E4566883BAA68729992EBAC314B7562F1EA1 BATS RAT-LIKE NIGHT ANIMALS WITH WINGS
438,352,431 *2C633CFA6061A733B272B02CCF47A077AF28497C bav("
438,352,432 *2C6A92E1F928DAAA0133504E12113D993C831BF3 BALTAZARPAUL
438,352,433 *2C60E79BF59E65C802AB16E19FBA3B63F08141FF BAY.YOUNG
438,352,434 *2C66D39A11F0FCF4DA5D23F97A969CAF367E6FEC TILES:用於太空梭機腹,溫度低於1260
438,352,435 *2C6B36D854848511FE71E92657B0F309E5F8C3A4 TIMMYAVRETT
438,352,436 *2C63CA7B9E1AEBBC9D6BDA1F71CC510F6EE30EC2 TIM.TOTOTZINTLE
438,352,437 *2C658B6AA25A704F84B83ACCD54EA436486F8AED BARNEYMINOU
438,352,438 *2C67DBB6B45925443E4C3C42BE5E52C06DEBC017 BC!RU
438,352,439 *2C6E7861B676021B503ED2C92ED66E9A4D9C616C BARTONBRUGGEMAN
438,352,440 *2C6E9C06164F714F6D59B4666461F1363377B6A1 bd/pc
438,352,441 *2C6C7B229F7F6485E75437FA22AFD1C1002F0C74 TONEYGARVEY
438,352,442 *2C608E008628788F9DE1D9DF114DC642FFE0F459 beijing-visitorcomwww
438,352,443 *2C68035EF40D830E99788532E311BC22963E21B8 TOPNOTCHHOPSCOTCH
438,352,444 *2C6A81CAEE1B6A572F56E2C1DD0A0336073C8EF9 BERESCHI
438,352,445 *2C6690563C023C3796AD4A1C589426628B2F28FB BEC0VET
438,352,446 *2C60EE6EBCD95A371517DD3BC2887EA7E29699B0 tracybrothern
438,352,447 *2C6DA9576D9045D4D7BA5AC4CC8932094557BBF0 TRACYCOOKIE
438,352,448 *2C62B221BD73BA66029D47714FE62708F7694244 transnationalists
438,352,449 *2C6BC286A7E7CF3240745525DA83D7FF13E6990C BETNKNING7
438,352,450 *2C627D016F07AC8B851C7235304617587A6650D4 BETONIES
438,352,451 *2C65B3AEF37248B8840038E1687DBF6FB27C6BFD b(#g
438,352,452 *2C68F0AE9674626C8B21CEEA2C9BE5D5FF85031F BENNYWILLIAM
438,352,453 *2C66D1A041F77913E89D191419D7E10860E3A861 TRUMANRAYA
438,352,454 *2C6B48A3BE66BF848E90368649A752FC4637C9C1 b"%hk
438,352,455 *2C61EBBEE4F76F6B0BA4C76BF146C13C0E3651B6 BERNARDOCODDINGTON
438,352,456 *2C66558E9ED6FCE4BA2C0A021720473FF64807B9 big.bug.shuffle
438,352,457 *2C60E7EA88590A959AA807C9EE1B02BA301C72E0 BERNARD.PILL
438,352,458 *2C61CEDC6AB283FCED29AE5725E8185381C810F7 TUAHA-AKHTAR
438,352,459 *2C62B4FFC5480B4ACDF2672934887E49A6EB94BC BERTRAM.TAPPE
438,352,460 *2C64A2C5DC630B58F4CDCF4B34750CD28B3AB837 BERT.RIZZARDI
438,352,461 *2C6AB7CF208584005100E0189F9EDC87BC845914 BERYDCH
438,352,462 *2C6B01666C035A434E7D4276C0CCF7BFB1B2C9B6 BETAKEN
438,352,463 *2C6D79A435F45B616BA2AE3685D59D9915DDE18A [email protected]
438,352,464 *2C661BBB48ED03B9CAE20F91C208B4741C105294 BJ0SP
438,352,465 *2C618E2EC208431B43DF32E153AD22E5D12F4557 BLABVIN2
438,352,466 *2C6B89DAF305955C2DAB157564D20218297D6003 TYPEAPPLICABILITY
438,352,467 *2C66C5CB7DB4333E6D2D6440D4039E31933BBAE2 TYPOGRAPHY'S
438,352,468 *2C6E6731C7CF8A96D23E379834E5E3F2B1778498 TYRELL.ALTONEN
438,352,469 *2C6E9D4C09CB859411B8AB7DBBB73980C088465F bf8aaa
438,352,470 *2C672E1FB4D96E8FBA09E529BBFA236355AAA19E b&g9-
438,352,471 *2C65D1213BA28171AB772D2A1D6DCBE89F46647C bobheinandez
438,352,472 *2C6C9D5C9F5D1FF02550B140BB14D6F6379DD1DD bobino 69 (disc 1)
438,352,473 *2C6394605343568344EF7F96FD43475E18686175 [email protected]
438,352,474 *2C638E7D12BC116C7CF5A7FDE828AB7DB019F49F Unchained.(feat..DJ.Trinity)
438,352,475 *2C6762CCCE893066A9955890EF6C61DCDB3FC3E3 bigmansweetie
438,352,476 *2C63AFD2949B8A74E543E6823C79CF12AC125EBA Unf1emis
438,352,477 *2C69E2BA5D544FB87F998E4541D6D6EA579BFCE2 Ungen
438,352,478 *2C624C45870938A22DCA8AA3FA88CE6815AA99A4 BILLYKLEMASH
438,352,479 *2C6A1023E207975E6C88758380C20782DA3EA131 [email protected]~O~osplat!
438,352,480 *2C66B570431C8B7EC4FF9F5F6AC9FBE095CBA096 bindu-devkota
438,352,481 *2C6337B3FBB619618B56B5EEB4B1E6BD21661E26 BORIS.NEMUNAITIS
438,352,482 *2C6FD5D569DDE6E1CEF3411DD682938F3C7C0CE5 birth~you
438,352,483 *2C63F86F6565310EF2DA1C005111253ADA114896 BISD=
438,352,484 *2C6767803CD3C79620213E1ED1D7505A452ACFAF unse1f-s4
438,352,485 *2C63988B2862C421520F182D9C0A73BFF598CFD0 boydderendal
438,352,486 *2C6E928CD0DADE5BD7AC311802D3017E76AD42E0 b####p*3b<
438,352,487 *2C655A4BD61ED6A2A5142F04CF061A2746D79158 bjl(e
438,352,488 *2C67FE241D0C45C4A7F64A3F4196F13C08FF3357 bl4"
438,352,489 *2C62FB798D806D4BBBBD7A6BF375F5E3B70E9456 /USR/SRC/LINUXHEADERS2.6.3224SERVER/INCLUDE/CONFIG/TOUCHSCREEN/USB/DMC
438,352,490 *2C61C010CA45449D42E3DD7748202A2BDF81BF78 USZP
438,352,491 *2C67655DC4D73D97B83B54A7A09CD27990D5EBF6 BNHOW
438,352,492 *2C6EFFBEAF58B945435F5015A715A5B164964470 bnr)d
438,352,493 *2C6077C8EE4F90BCDF09B4097E10A75F210424F5 BRITNI-NOEL
438,352,494 *2C6759ABB0B117DE89E66681CBCD10CB32D9C591 BOBENJOYJ
438,352,495 *2C6860548BB0079F454F3D01DFA618D210971D09 bo=cc
438,352,496 *2C629293E78A12C0FAAE9B8BB087B4FF1BD7C758 brockzilk
438,352,497 *2C6D5DA87A233D5E5A44D737063B26A37B562C19 vanlofton
438,352,498 *2C67584343A73EEDF41DAFCB23A8DCC60C7274B3 BO._K
438,352,499 *2C64CED7E8CC27151A43149E270CDEF6286FE9D5 VANTHONY2
438,352,500 *2C636F2E2FDD5D4E0ADEBEB58F5CD05748C2F2A5 [email protected]
438,352,501 *2C6DF7ADB194260A72D42B0898EB0856599566BC BRYTARENSES
438,352,502 *2C62358E8AA6993EC3161E6EC32875927B3DCE79 bsaqz
438,352,503 *2C6A2FD7A7B6ECA1D4ABB47C26BD188EEE791B7F bswprogfestbsw
438,352,504 *2C69C11BF883B2194DBCDE805C527FDF79F653B2 BSWSYSCONSLISTBSW
438,352,505 *2C6AE0F0074A496D0E8086F6E9513295B89CEC45 bo.u/
438,352,506 *2C650C1EF5060E27D72FB9D5060005E30EE8F75D btqje
438,352,507 *2C64E699D778B18FAFE14110EFCFB0E156E32392 venkatesh.radhakrishna
438,352,508 *2C65FCBD72E99D81BED4FAEC715495C8BE754E1E b?t"w
438,352,509 *2C6FFB8FAED39502DBB4961F16DD272DA5333744 VICKA
438,352,510 *2C68B62DA35EDA4B6028701FFA5F471BAF1F4B0F VICKYCOMPUTERED
438,352,511 *2C6FC3803EF19B74E33936B552512105B2169781 vicky-gonzalez-coco
438,352,512 *2C62AF690992EA7397DECFBC17D425CAC1BACFFC bushra-yousuf
438,352,513 *2C63BA744B0FF2D70056E3DE40904491C206E051 victoria.greyh
438,352,514 *2C6B8CE424E8D96575659D4551033F71745FA3D4 VIDEOXV
438,352,515 *2C6572423BFE78D8AD079453D51952931FF6FBBC vijfdraads5
438,352,516 *2C6E28A4696CC46349B641283A609A37690832CC b+wgm
438,352,517 *2C62A9D43FBA42D6BDF30517C86BB96690971626 BXFXE
438,352,518 *2C6F58355768D2E01B0FDA5447B4E9A0BDB46376 BZFCM
438,352,519 *2C63DF65935E2CBC1551FB8C3A62243EF8A5D46C B+RJ2
438,352,520 *2C61529BD2775831E7C78DFB1563FECB9A625B61 c1umq
438,352,521 *2C6A5471B1D4631708FCCDD14601044DD6D3991D BRYANWOJCICKI
438,352,522 *2C68DC38B713477BBFB01C9BE24F420CFEDA28FB BRYCEDALESKE
438,352,523 *2C69358535FD59203A2A21C672BD4CD9AAACC39B BRYONBITONTI
438,352,524 *2C681C60E72B6B9E1698AA52ECC6A5CD4DCA9958 C;6GP
438,352,525 *2C6E50AEA37A30404E5ACE0FE4F0C47978B9514C BSF"G
438,352,526 *2C6CB8C27F93CB27A427516FAB6784D50B19A0A8 BSqR
438,352,527 *2C69375B83020B7F4F46DA09A8D8EED37A93754C vopo(mitninahagen)
438,352,528 *2C69850333BEF2EC64DF6D1656BBCE81AF89BDFA VPHOUEDS
438,352,529 *2C69209285ABF27A8D342DF91E292C36A2B54DBF [email protected]
438,352,530 *2C64C8A560056F50EEB1433CCA183D37A3003E64 btb,k
438,352,531 *2C6D86BE291A4E2E7B8C9BA4A53DAEDBECC07BE7 [email protected]
438,352,532 *2C6C0EFC6AF9E7F17662EEFF9E4153A3EBE94376 W144417
438,352,533 *2C6FA043F00AE52AAE61AEE0FF1B65635CC77E1E CANCAMAL
438,352,534 *2C65F50323E8EBCE805A4C014EC34D43F44494E0 bukm6
438,352,535 *2C69467C8127421DDDBC2C3C2C6AC8AFB2852698 WALIDMASSISS
438,352,536 *2C6F29316BB506006DF9B906E96D2980B119A931 bv3hb
438,352,537 *2C6F85F6169E667944E64EC2BD14442ACED48382 carolosofsky
438,352,538 *2C6FB7E305AB8349B7224AD62D73EC21ABD522A9 carsonbueter
438,352,539 *2C6D76F53B8AB7B05B849AAC747E8E0322314BE5 CARTER.MAFFITT
438,352,540 *2C61AC58A25D6228C14B22816363F7E391632307 C,A?T
438,352,541 *2C647627A3DA26AD2D37D03CB790B46A3ABC5B88 bz,s
438,352,542 *2C63EAA55B485A6B37548EA02E8DEE481E388EB2 CCKY
438,352,543 *2C6B68DD78A43DCE70D8A3A4C2577CA60C820A09 C#!DL
438,352,544 *2C6E643C60701109BDEF27C65EC1DF7CD72DC3FD cehog
438,352,545 *2C6E02F586AB64880A537FF849C5A523FAED7373 C(8UK
438,352,546 *2C63089877FFFC3767318DE3ED2F2B9730A68462 whale oil
438,352,547 *2C6F7C637B0FC4534F9DF4D16A865A7457CA89B0 $CAGLIOLA
438,352,548 *2C6F3F9CBE9A79AB8AA4AF707B32DC4045A008AE cgn8n
438,352,549 *2C60DC3D7FC142297C9DD808B4302BC045104DF0 calvinguadarrama
438,352,550 *2C65BE6A4D0E448FA4CDB5E15F65DF4E539439DA CHAMPIONCYCLE
438,352,551 *2C673794DFBF9EA1E648FD4AFC1405522EE4CEE5 canto alla vita
438,352,552 *2C653328D9F84FBCE9C2E4A3D02ACD916A1E339F willie.g.williams
438,352,553 *2C6641306587AE7F38773982321DC3B8907EA003 CAREY.SKILES
438,352,554 *2C6F5C5DB7D5505A2CB29B0027DCC67AD0249544 [email protected]
438,352,555 *2C6937027575096BC5451F654E20C0E1496A4662 WILPOST
438,352,556 *2C6763239EAE23E6CEF8EF4815E7D5F24FFCEF52 CARMELOBATTANI
438,352,557 *2C6D525B3B28A34BE6E6A9F26EBF3123D9BF71EA [email protected]
438,352,558 *2C62D6B405EF06DE40152894E4DD9186FB2C6CCF WOEYY
438,352,559 *2C68396DCDD52A18B4254D18E6F6D5E27680FC77 CAROLE-HASTIE
438,352,560 *2C6211FA846BAC2A582E6200F8B0382BDEC9E6E9 chepeţ
438,352,561 *2C6FC08240654595436ABFDFDA9E5C36B6A372F1 [email protected]
438,352,562 *2C6BB28DC58579D915E3766C4F7543B445CBC7B1 CARSON.SILBERSTEIN
438,352,563 *2C6A40D53A813E4A9E234BDF5ECD317648CF6380 cas-#
438,352,564 *2C6597C12D9F9C152369C0C7EAF701BA6D07CC1B [email protected]
438,352,565 *2C625BF9D91EBF541CDBDC9B18F8EA930554C62E catalina791
438,352,566 *2C68902C6990946E5968BDDCBA234B0D7A997327 CHONG.SHUMPERT
438,352,567 *2C6225113C2FD98E17CF068EAC86DDC95877AC40 chr0n010gis7s
438,352,568 *2C6F753C8B5CBCF5033121D22082F6817604514A CB4CA
438,352,569 *2C6BBBD32FD7AA3FD480EC354AD6A1304D933622 CBD"
438,352,570 *2C6AE3A81BAAF7F0A498CDA78160EE854A21947D cbwa
438,352,571 *2C650FD1EFB6CF2C8227724293FC3E167AAF612B CDEJONES
438,352,572 *2C64EF84B521763E7C110A5331F2021DE7A039EB cdnoh
438,352,573 *2C60A45A3831989C6F311CE352E5F652BA37F672 CECILHANN
438,352,574 *2C69B360DD5FC3B2A4DC6928E4BA3105201955B3 [email protected]
438,352,575 *2C6EC51259DB86E9467CC61B222FF0C44073132E CEKUOLIS8
438,352,576 *2C6B6F40894C2E4A9026B8720E86C11D891F180C cenzurce0
438,352,577 *2C6B1CB591ACB53B98F6A3F49564952AE447FB67 CL0V
438,352,578 *2C6F244A25661588FABF7F39884F3C173D4C2734 clayanzideo
438,352,579 *2C6450BBDCD15671FEE85D497B2C67B14E786BEF CGFOJ
438,352,580 *2C61FE8B8F35D43BA531DD8D35D04CD2BD03B2E0 yasir-farook
438,352,581 *2C6CCC956AFA45BC8780FEEC6F38654C1B8D0757 chandra-webb
438,352,582 *2C623A2BED2AF2BDFA7DDE5A72ED384F14639AA8 CLFL
438,352,583 *2C69B3655E255D764C38976DA467EB38AE4C179B changjerkins
438,352,584 *2C65719E41651484EC47DC6BD4C745FF0F700144 CLIFTON.BARCROFT
438,352,585 *2C69DAE3C39267307BF0DE0491A1491A05167D10 [email protected]ETNET
438,352,586 *2C608E45F1BCAE7760ECAF89C94D3DFBA835B701 [email protected]
438,352,587 *2C63F3D0C6500100845327FC5B5AF33343419E07 clintonweegar
438,352,588 *2C64971AA6A3FFC48966D512821167A8BE672B5A CLNE+
438,352,589 *2C6AFCE0707E8571974652C25939A6EFA660A474 [email protected]
438,352,590 *2C6AF33D57BA90DDCA323D641641604E45BFA80F ClW
438,352,591 *2C65C1AFFCF511F12AFD3ADBA6447FA11C27F72C YING PAJONG
438,352,592 *2C68EA24BFBE7477169F3C6908D55239DD9D8053 c%mup
438,352,593 *2C6F87282C7481AE01D1F34CE79F7F6069C61DD6 yo-check-this-out
438,352,594 *2C601151B476CB2808D9F169151922BE56B2D6FC cnlmg
438,352,595 *2C6EFF0287FBBF047E14BD1055CBA0C9110B3F0F YONG-THIAN-SWEE
438,352,596 *2C67C7E92DCF1F11F23A302BA68257D1420207D0 COCCINELLA4
438,352,597 *2C695B43B9D10C600C1BCB78F746E4538CC435A5 YOUNGLO SMITH
438,352,598 *2C675ECCCD66A35794559042550FC570AA48C388 YOUR.FATE.IS.PAIN
438,352,599 *2C6670A12768D4620FAB646876B674B61C5EEDA4 CONNIEDUKE
438,352,600 *2C66D380EE865BADCE3DE7C67D6D45DE0133A3CF yr-frisbaek
438,352,601 *2C61F5CDB0F4E0CB13AD7C485796AF6B82B0621C CHHAJRON
438,352,602 *2C67BB35EFDD176E922265744671CAEFDE252070 [email protected]
438,352,603 *2C62C9724673466BBCFB870811ED65067FF07612 [email protected]
438,352,604 *2C6B934861303814767EC4748E32D62558451127 CONVERTAEPERVERTA
438,352,605 *2C61FEDF9F0BBF64ACA845729439468D16217BC3 chriskleese
438,352,606 *2C691CD9ADA82A1C7E277C01AB1BE000A930651A YVETTE.DEHARO
438,352,607 *2C6A9A144B8C4D1AA75FBC8F2758E2CC968DAA15 YVONNEMEMORY
438,352,608 *2C60A946287D1A3E8F86CD9E5E8ACDAD2FBF07A0 CHRY5AL!DE5
438,352,609 *2C60FD1643A53BD3501FAFC03035CEE2948BB20F CHUNGSHIN2
438,352,610 *2C606137608CEEB37AD46AE5FE7D8165DF8D1BC8 ZACHARY-SHANE-DONALDSON
438,352,611 *2C631B210712F6F143AF8C7E5BBADE77041AF625 CHYTHRÄUS
438,352,612 *2C6B39B0C80523F3E381034E8B653AF0F2E74B79 ZACKBERNDT
438,352,613 *2C69435E6F056558D7C2E3826E572813085D4980 ZANGUANGO (KARAOKE)
438,352,614 *2C6112D426F36705A940BE0F82DBFBF46D962830 zehra.atilgan
438,352,615 *2C61CD0CB740307E6BA08694E34720542E884205 ZEITMESSVERFAHREN
438,352,616 *2C60EA8037E44D44111E9BF823D3C58DA6803B3D CL0V
438,352,617 *2C65BE59A8B44561A665A183DB531005AEAB6E31 creator$
438,352,618 *2C62F1C36BC40D36B1ACF7A0866DFC816DC5E538 crepira8
438,352,619 *2C6301CF9142F659F388D23D150F68C11FE27144 clcud
438,352,620 *2C6B23D4B24BA38AE519EF7FFFEB4D0AB292D09B CLEVELAND.VILLANTE
438,352,621 *2C669AD6B6D16BCEDBAFBE4554B02319AF1E15E1 CLHu
438,352,622 *2C6B90A623388803CB1F60E01980BE417F7F46BE CL;&V
438,352,623 *2C642009BAF213D52F9E22A40F06C12B80582547 [email protected]
438,352,624 *2C67EB437CED37F9434D0588B32B5EC3F8EF185D ZPOZOROVATING
438,352,625 *2C6F9581E6D398F35332DE5C470DFAD00C43E857 ZQSVPXYZXLZ7
438,352,626 *2C6AA33F257594CFCF0A08A4D8722620106A51D2 CTNS
438,352,627 *2C68218535668523083541881CE73088A0B2C35A CUBRIEREIS
438,352,628 *2C6E1BDB93FDB5CEFBB243D7F046967352C61CCD [email protected]!S+!C
438,352,629 *2C65C391BD3EDEFEDD68154CDA9192A7D5AE6650 cusconin
438,352,630 *2C6522A6C911F8588BD031AB0516BC0B6BB789F1 cvioc
438,352,631 *2C6C2864997F79BED46EE66551E48EDA33252CD5 c+wcg
438,352,632 *2C667E7454AC539FFCC80DD49B6BADA038C1FB08 cyi?j
438,352,633 *2C61B5ABCEC072C3F9D0228B04D88EAD59FC57EC ИЖЕНЕРНОЙ
438,352,634 *2C6DB46A0FF1276E2702FFB67F79A3C239AB7351 КУБАЛОВ
438,352,635 *2C65D4829AD3FE6C119314EEE14D591B1E086E90 CYUSQ
438,352,636 *2C693AA620E0EDFF2684B572EBAC3CD68929ABE4 о́белюс
438,352,637 *2C673AEA4967461554024A453606FB8469EED96A «ОСВОБОЖДЕННОГО
438,352,638 *2C64D484A4864F5E53B2D175784C4C5ABD5122DB d._?2
438,352,639 *2C6EAA0D69E045290215BDCFBA0DF466AA5267CB d2agl
438,352,640 *2C6D9E12CE69A82A9D2C10B71074EC048BB5616E [email protected]
438,352,641 *2C65871FE71AF3CA9CC27858B5CA3AAB20A410E9 рейзес
438,352,642 *2C6471ED6036998B0029CE7AFBF3A0025C4D2059 COSMETICIZES
438,352,643 *2C6FE56424F2915FCE767AC0DA4622CB086EC9C5 ЭКЗЕГЕСИСА
438,352,644 *2C6EC9BA96354C03B4B1C4A0C733D3610F5B5238 [email protected]
438,352,645 *2C651B1205885C85352B6E38637F9FA1191D673E DanielCordes
438,352,646 *2C6E6B627D20689730CEBFEDADFFFF2ADC8F371A crefish7
438,352,647 *2C69077C909CE607C39B7FDB081496D898354536 DARRELLBROUILLETTE
438,352,648 *2C6F23CD56084718F36678FA103E57F9B8C0FBC2 crowmission
438,352,649 *2C6892C60C28E9690EE24619FDA4B0745B025C07 [email protected]
438,352,650 *2C6CF29791FD68608DCC0520A6AFC2996E09938C C_SNOOPY
438,352,651 *2C62263D23C0B9221931A369505403892B205A06 ctlf
438,352,652 *2C6AA4C73BA010EE4A79BF33963BE4CBF269A459 DAZm
438,352,653 *2C6B97A037E3737396AD966B796A770D1F3D56E8 dbxl8
438,352,654 *2C6262C584CE0C04315B5C203E96D3AA4EA877BE CU%R
438,352,655 *2C62253775A6DF5B7197A4BE9BEEC5252999E2E3 deboradeh
438,352,656 *2C6FAB9EAC59B27F6D1D161E37E8C41A12FB2C85 deceare
438,352,657 *2C644A6E7DF5FED28F73A7B9EE3F0113EC9B02BD d1f,
438,352,658 *2C63C1708AAF31F08F7DB1235E86BF001D223CAF demitaboschel
438,352,659 *2C6938E206BFA5F544F4207F0D4FD8302129A18A D"3N1
438,352,660 *2C6145F07FC71CE0EC9D07917DAA7268B309B355 D4EO
438,352,661 *2C62F6F77EB4522D108771DCF1CE295C22C41E6A d7ns4
438,352,662 *2C684FE0DD63BEC6AF84DDB60E6C5D1F7C967B31 DAIGIRL4897
438,352,663 *2C6AE7870A48B7F81076C206CA90C6D676E53CA6 DETEKISH3
438,352,664 *2C6D09AD8625BDBBFAD97E93E7957727044B6AA1 damianbuckey
438,352,665 *2C6F4472453365300CDFBEF469E2AA5A5CEC5D06 damien-okane-summer-hill
438,352,666 *2C6B854A33B7D5156A33B9D0D0613BA3F5380FAE DG-?
438,352,667 *2C6FABD22411EB7C30593EA690C90EAC2053BFE1 diana-mabel
438,352,668 *2C6174A31FCFF496D5D0E2A52F25A4B9133D4F14 DIARIO.PREG
438,352,669 *2C62C59FB2630617A4B00B760A1866D7D9FBA668 DICKBLOOMSTROM
438,352,670 *2C670452D4F6840E6E302B1B95AE7B4723DB4EB2 DAVANTEK
438,352,671 *2C6C6F541366760EC71138327520E6AA3DBFC325 dissipasjons
438,352,672 *2C6ABB8AE08B59FF52A90653017E7012325EF3C5 02261656
438,352,673 *2C6EE3169EC7CCD231986867EC4162B94EE79015 DJ.Horst.&.MC.Schorsch./.Haut.Ab.!!!!
438,352,674 *2C67370EA6C9DA9851B6E015FF99D6B7FF877CAA djmc0
438,352,675 *2C61C53EEB1F97AAFE107BBE64B7B1F7A802DA57 [email protected]
438,352,676 *2C64330D708EC7EFCFA618A6D518F6BC69A6307B [email protected]
438,352,677 *2C6333C018DA36C2DC68064BF05ED9239D05C049 dlbm6
438,352,678 *2C6231315437924B1F3E3167F78669A1AF1988D2 0CH53N
438,352,679 *2C621D8408809D77C7DB053578A8A0DD1759E984 0nellie6
438,352,680 *2C6183E975BC70D0F06016717A7203E3436FEE92 DENGSONGDIAN
438,352,681 *2C6FB70BE64CD213C0A3E0954E759AAE7A81AB6A DENNISDAMENACE
438,352,682 *2C6A7D12D4F70CF21691E45E3509BBEE1E7B0E34 1081553 atk-keskukseen-nimet
438,352,683 *2C6AE6BF73442B0709A73D74BB9BD63D463E1FD6 1111418 HOW KNOWLEDGEABLE AND HELPFUL ARE THE OFFICE WORKERS ?
438,352,684 *2C63C490EA5AE25D4850B43F9DF01171E6BDAE25 113421 das.uebliche.hightechbusinessbodenpersonal.eben..
438,352,685 *2C64199E5AFAC59D7AAABAEB2FE4412CB98A7B7D Der.Dativ.ist.dem.Genitiv.sein.Tod.(disc.1)
438,352,686 *2C66F6AE032A09FF7A8554A69B775475872447DC DNCZX
438,352,687 *2C6B43CD52E14C60DADAD06293D6BFE6BC8E3807 DNM$N
438,352,688 *2C6D9D7003763F5E9A5BF7A260C6EE2B56DCC8AA DESHAWN.MOLINO
438,352,689 *2C654178F5D8DF725F072C43AD7BE75B6E3ECAC5 dogs.are.talking
438,352,690 *2C6A7C2653E5431659BEDDE151C45345D118B37B DOLENGOMYKHAILO
438,352,691 *2C660D04308C1139FD2CF2063474BA5299EE9CD4 12-WETZIKER
438,352,692 *2C656B4C6F32B514450EB2A8EDECC43F86710A4D 1315417 T
438,352,693 *2C661F22AE5CD094D476FD751AB978D9BA07A921 DEXTER-IN-THE-DARK---CHAPTER-35.4
438,352,694 *2C6924823FE19B26C7371FCE7DAD323AAD6453BB 13SIX85
438,352,695 *2C6D429CDBA94080F97D6172B4F9FC9174E635CF domnenavn
438,352,696 *2C6DEB2DB0E7CE5F085F447341049FD14282FCED 1589695 SYYSKOKOUSSYNOPINS
438,352,697 *2C6959F6B264C19DCD49FE2369D16FB3E84C4471 DONTE396
438,352,698 *2C61FD7A8ADC8D39C44462180D03B6F965B3EC0E DI5+0R+I0NAL
438,352,699 *2C64BA95F231F7CB371329F4D086E29D1C709016 16PLUENDERT
438,352,700 *2C6F193B4A0404CCE5AA24299D960D93F9C52704 DIANA.FLORES.GARCIA
438,352,701 *2C67B9CC65E48141B7CBFB9099A8A3BF78294D56 dosato.
438,352,702 *2C6BBB09B17A89A6C22D5D0AD9078AB4D09B5721 DOUES4
438,352,703 *2C6023327346DA9341D528841E8223B84D295C39 DINARENES
438,352,704 *2C633B61ECDDF47E06BAA2E5658623171E3C1F89 di:o9
438,352,705 *2C6EABB56846636BA81F2BD81B0A8B00B324D0A5 dpm"
438,352,706 *2C6CE81DC5E2EDC0059E7EE4C4C7F9E4EB419DBE DRPQS
438,352,707 *2C68622059A30B7F0BB0AE1025666E819FD46CA8 1.brewer-type
438,352,708 *2C6982E2C5E284986F89254655600ECD2C8177C0 DN+KZ
438,352,709 *2C65329FA9BA21B13BA2C26197A3DAC7DA790186 dnumc
438,352,710 *2C6DE09839570FE8E08095D59F4D6D9D59D3748B DtrV
438,352,711 *2C6404984E8DC0AF6D0B0413F82886D006552F5D dolvg
438,352,712 *2C6C5884BF889496EDEC7000F46C3662E66DFBFE DOMIRICAN
438,352,713 *2C6A2D0653046DA5F8583CCA98B27B0676F4DA9C DUUA
438,352,714 *2C65A1F13A763730B8E03E34E26C7F8B3411257D 1.LPVG-VORSITZENDE
438,352,715 *2C6A4F670FC14FF705142B537D89AEA29761B629 DOUGLAS.FREDERICKSON
438,352,716 *2C68DE1EFD5A6CB4624A497C8D671515146AC73C DW+QH
438,352,717 *2C6783B1CF97FA2300BD214FBE49ECE7BA1E54BA [email protected]+Y
438,352,718 *2C62281A4F10308B6D90DD1CFD7D3A9F4C60B7F5 dqgcw
438,352,719 *2C6336E737E823A0AF069E6FF76C55499B86CA7B EARLEGLUNZ
438,352,720 *2C6682516B35B60FD4A77680AFF56F16A9AA9F4B EARLJULIET
438,352,721 *2C6777A84F0DEA94BE9B2E1914776E2FFC8D8509 drashad&spotlite/motive
438,352,722 *2C6887C2D4BA6810AE30169E42283E11CC92AA45 EBONFUL
438,352,723 *2C6A75A3BEA3C831167986B8BE3CC319A04297D7 [email protected]
438,352,724 *2C6185ECEA5159D8B0195AB1A7FDA394F7A26F82 DRPQS
438,352,725 *2C6CB669675522C6BF14B32FB5127B3228FA477F ED5QU
438,352,726 *2C64CBFF06969BDA25377E61653F712620739358 1.REMONTTIALESTA
438,352,727 *2C677DC916BB5DA486E5F8B337034D485EFA792A 1renessanssiruhtinaiden
438,352,728 *2C656F39B1FE00C775A4A522C4B6F359003887EE DSHIKDER
438,352,729 *2C6CBC86264E112D897CCFDF2C3208415ECB939A 1.schimpfender
438,352,730 *2C64A3FFE4A27F0604417768A9EB2EC3EDC6BC14 [email protected]
438,352,731 *2C6CE69072AAC02F74DAA3DC0A9C48807E42EEAF 1-sinnittelev
438,352,732 *2C6E830648ACF65883489776BBB5820DF35408C5 DSWJ_
438,352,733 *2C636176BF07A2E0F4AA536826D993EC77AD0F83 1TAPPIOMIELIALASTA
438,352,734 *2C6E01FE5A2B2E987D9025D34E5F64D6F3D201B2 DU"$-
438,352,735 *2C6418534063AC123B898EF9D9762AD3289FDFE6 DUDGEONS7
438,352,736 *2C6164F7404B4621C97BF31CA1BCDA904B4ABA3B 1-VISITORS-NEARLY
438,352,737 *2C6983A99B3A6AF0BF52EFEECD4C886CC564C991 [email protected]
438,352,738 *2C625C2322ABEEF2B7F195D4F598709FC64CFE96 duncanjangula
438,352,739 *2C61B58654C743D003C9C717B0CBCE1D19A6F60D DUUA
438,352,740 *2C6EAF797E0AB6B345EC3625ACAC9B2DCBEADF0F DY:L=
438,352,741 *2C6FEE408D5DD5641A992AE37BB5611C7EC79626 [email protected]
438,352,742 *2C69FA6318857712C862EEA42FA0E27A99986418 2377577 KULTAH
438,352,743 *2C675A30542CE686E0FBF050C1D3B8BE0F899564 elkonigsburg
438,352,744 *2C6AB7CEB9A653505A22479426CB683B0A79C10B E00002609
438,352,745 *2C63B2167A0B6A3CEA61FB0CFB119AA277535D27 E1EC7R0$747IC$
438,352,746 *2C6E3EC5AB219A435D2C33F500046D384F09FD59 2514423 ORGANISOINTI:PROJEKTINHALLINNOIJANATOIMIPIEKS
438,352,747 *2C63FDC4EFAD744691D404E68D4142ED497F3DB0 2641152 iminternationalenmassstabistdieseinekleinesumme
438,352,748 *2C6619E5615E1927DDBC97A0FBDA2FE983CB1430 26.equalize
438,352,749 *2C620B770ECAC664E01CC74BAC5FD6F4E914B72A en!1/
438,352,750 *2C60BB19B1D619DF68E6F3A2A5205719C96DD16B EC!t
438,352,751 *2C6D291AE2D44DB08034980BEA5D81B6CE1D0F9D 28EROTTAVA
438,352,752 *2C63B5BD0354908ABA3C2F3EC42645B4E44A953B ENALPSBU3
438,352,753 *2C66D877D0CA928FD227FA4D73B4BA42A4F5628D 292809 KUKAANEIVOIVAIKUTTAASIIHEN.MINK
438,352,754 *2C6BBE44D7B08ABFABC00E407ACDD990062F10B8 ENDINGWITH
438,352,755 *2C6C71EC62682FDF61A4DE538C6864C9815392D0 energienota's
438,352,756 *2C69A7A561FCC22FB01D8AACB7E8491B1EE23A19 [email protected]
438,352,757 *2C6B1546C873488A9DA20CE3CA158E289633AB25 ENOBWORRS
438,352,758 *2C68923CF69796AB719958C8BC1FD18C02FFAC13 ensn4r1ing
438,352,759 *2C6620DC389193FAF54B14FB1997472A4C5E0855 EDWINHEPKER
438,352,760 *2C695D6E5CF894E1C6146FD0E75DA28522ED39C9 EEN6=
438,352,761 *2C63B50F0F31D26227FD7C9FF20091A30A0F0C33 egrahcow5
438,352,762 *2C65643E30E13C590A18A9F526F12BD4560E38C3 EHGARRAC6
438,352,763 *2C6DC9813AE4E41857D4EF966FD25821F49A4EE0 ergotic
438,352,764 *2C6140F3FB0CB737C52609364B8AA007910219C4 2thatchrist7
438,352,765 *2C6E7E6527F12DE0E15B94DC62AF49145AAF1B65 2tuotanto-ohjeissa
438,352,766 *2C6FD59C7056705F53E416186EF20931D84DE37F ERIKEFURD
438,352,767 *2C637CAD751F7C93727D351250188E838401F9F5 ERLYNESPINOSA
438,352,768 *2C6909FE278F40CA6445BF2505A8362C67D2C099 ERNIE.CORCORAN
438,352,769 *2C62B527E2665695D0055EDF4EEE28FECEE0E8DC erstaunts7
438,352,770 *2C6CDFDE29659538B491F212169E4242E926A968 erxfr
438,352,771 *2C67F1432268AAA2C75EABCFAE44E9DF8CC7D131 ETHAN.SECORA
438,352,772 *2C6C4E765E7F7D45EFFDB84DB615794542763489 38KAYLEY
438,352,773 *2C65EA0CCB3EADDCDB441234A560B43BC138A7F3 ELBERT.LASSEIGNE
438,352,774 *2C68DE79FBB57B7602B4416020F23F40431B24C9 ELDORA
438,352,775 *2C6E68C860B611D7B0B41243B771576034E865DC elijahgulnick
438,352,776 *2C64C2050D7E732940454750E9E5322DB4FB70EF exhumes
438,352,777 *2C659E86B1E76447F6F6B35A2334169E65C46957 ELLIOT.CARREIRA
438,352,778 *2C602A272AF406555AAF424C5C30C6195D889DC5 EYES TO SEE
438,352,779 *2C68E1FECA663934CBCC4144FB6EB761335DA896 ezequielhespe
438,352,780 *2C672544F5D2FBC29B63749B1CB9DD541D95825B ELOW?
438,352,781 *2C607856341025F9D2FFAB6484E1034B2C945E4A ezrawojtowich
438,352,782 *2C6254A6A2CC47D0E39219166F77D6CBF5838CE0 3mul5fyn9
438,352,783 *2C68B2FDEB05AA81488C2DD147A3B55F9CAA129F 3mutterkindbeziehung
438,352,784 *2C678EB9F7D33FD482F167BB92D1F1982E30B05D elsa.rossi
438,352,785 *2C69360D0643954477CB2EED43562D52BC8A9AB9 elterening
438,352,786 *2C64BE8410E8A1E89F4FF1CF5AC0638D3B04D1CB emboutirions3
438,352,787 *2C62BFAD737E8C02387FBF6E25FF8198C5EA0999 emilehighberger
438,352,788 *2C60855C2656FEC602F6630A45ECE21A1F234D7C 455730 bu.tUr.tehditlere.hazir.olmak.gerekir..
438,352,789 *2C66EA04BC9B95A49F10584AC0510A62C16D177D faticas
438,352,790 *2C67F64D9A02AE902DC0914B2B461AB72BDAC6C7 feelforyou
438,352,791 *2C67C7721F7954CAE84D494F7D7C229152AF1D01 ENDO4NGIITI$
438,352,792 *2C6452DE9EB2CC155226E0EBDE3B83A234665928 FELIXMANTELE
438,352,793 *2C6772E8EF8DDE4E5B28758A2048C944D879943A ENFIEFED6
438,352,794 *2C6224C7DF01BA86EE12386FC8A20053626B90E1 ENGAKAANED
438,352,795 *2C6DDC12905751DE8F1DEC816F767E213F649030 ENHIGASHIGUCHI
438,352,796 *2C6774F828A621BFFBE38524472D7B0B7BADB262 [email protected]
438,352,797 *2C612A550746BFF7113522E0936865A9224BA1C2 ENZO CRISOSTOMO
438,352,798 *2C616C50A3F553ABF5811DD1C6848E4B4F967289 4OCHTENDN
438,352,799 *2C696155F75D0D2010B671B2D75677596A909E4F 4-OFTAGEL
438,352,800 *2C6D5C052440887BBC8F05609B3B4E4FDA01AF5C [email protected]
438,352,801 *2C67EF8322BCDDF7573EE4E3C5D2843C15F23D03 eos$;
438,352,802 *2C6495CF7B41DC086FDE4884C11A08AC393EB90E 4.rasselisten
438,352,803 *2C602E407F678A9E3FDA5D91820C00C8FB8819C8 4.ROCANDIO
438,352,804 *2C6B5F22D5FEEAB17C72DAAB5B07CB3EC3836436 4SACOBHMH
438,352,805 *2C6452C526B0C1F793342311C929C769FA991F39 fla93llat3s
438,352,806 *2C64D21CA6E085BC54F7800FD65A8B3AA2EA0A86 4SEHTAWS
438,352,807 *2C67E1B1398840FB0868CAFE616D95902A4EF76A eqhtebyg2
438,352,808 *2C6BC21A4876DCECE547C03F4ACB3A42001FEF15 eq?pn
438,352,809 *2C6CEB67D8EA0E0B672CC7CBA422FD675224A5A8 4UNDERTWIG
438,352,810 *2C68C11565E08DAE33E3BCC2E2F9BB55FA81BE34 ergotic
438,352,811 *2C6F625A7D0539A4253A4B4E5B066BE534A0DC6F [email protected]
438,352,812 *2C6F664D116BD1857E123F1DF42E47DE40C4BED8 ERNEST.AFABLE
438,352,813 *2C6AAEB8DF8E918766A255D11B568B16610F4610 Forfetableness
438,352,814 *2C627F0E40F5A7CD96CC4D869BAE980491BDFBD9 5 ANHAEUFTE
438,352,815 *2C68C5FB83574F68327AB9370BBEB78A843C3BFD FOZZIETHUNDER
438,352,816 *2C64163086A90A0640452FBE31FD325509C29DCB eshcd
438,352,817 *2C61D19083AA8E6739EFC64278AA4410D1DC8AB0 5COLORADOSPRUCE
438,352,818 *2C60BC4DE3D71D2622145B4346C58591A303652D 5disgustfully
438,352,819 *2C68D2D8B15EFA22CB6D82566F6E69E1A4A15ED3 frontnot
438,352,820 *2C616C2D1B702F66B623303D6212AC3CE86DF656 5KRIVPYGBABCN
438,352,821 *2C6E550D960AE49EB74F3DB0BBF1FB37D588B63C FUERZA.ELECTROST
438,352,822 *2C65DD19138469408DF97BB773A9F5CA44C71665 euode
438,352,823 *2C658BDBADD61B6E1DEF93B4F84C3AB052557E0C everybody-dance-(feat.-dave)
438,352,824 *2C6D59D351A6299A7851EB12F8E01D39813CD868 everyday-daydreams
438,352,825 *2C6AD9AC9BC6DCA0DF442A1A4CE3FFC9DE5AC0C2 [email protected]
438,352,826 *2C65F8D759392119ECCE0E71FD612965BF6A7B1D 5+U88L35+
438,352,827 *2C694AF4176D791DC4569CDA26FB607AD55ED90E ezrahazelbush
438,352,828 *2C617B9552D1541BDEADAB4662348A19D060F61F GASTON.DOUTY
438,352,829 *2C6B0664A908D1F74212E196BA83BE838C2F528D f3p&
438,352,830 *2C6319427B319FC8E5C47ECE9A1FC5C728266CBC gelatinadimaiale
438,352,831 *2C623DE3FF3D40DB19887D2790575B4DD77914A6 [email protected]
438,352,832 *2C661A3AFD9F2089AFD1D7F1A07C3B07CD79D808 [email protected]
438,352,833 *2C6B3F29B4FCC26D9AA5633EA663D049681ACD4F genesisbuddy
438,352,834 *2C6802508AC2E013BA85E68843AD51D4C3595F5E FASTOSITA
438,352,835 *2C6FB44A39CBF302DEB4E6F0C096855DE4EA5EF8 6ENDOPATHICS
438,352,836 *2C61D822633FAD95E748D3A683DD444657F2E7DB gerardovickerman
438,352,837 *2C62245B9BA5720F2EDE2C67462565F504F7F897 fedulova4
438,352,838 *2C654A3A4828AB5EF98D42D7FD93FBA75741361E GINA GABRIELE
438,352,839 *2C69B8EE0F643E4EC7C918F31DDE8A33C7AF48DA 6MIRALIA
438,352,840 *2C6D3DD85E99E4ED78C3CDA3AC22B9600644FC15 fernleihekatalog
438,352,841 *2C61D420F6D4A2F60E540F165A7F5881976E1439 GITEFLOD
438,352,842 *2C69FAF6E9511ACA8CFDECC2A212EE3BDC11746A ffilcenis
438,352,843 *2C69B9ECA8CE183DC311EF751EB78920337F7C30 6PACKEREMMITT
438,352,844 *2C6155A0BE48723526E4B01E3D0ACE850B4C232C FIDELCAPANNA
438,352,845 *2C6E424DEECCF0E0A944C0AE89322F5C0674E1A5 6QUODGELL
438,352,846 *2C6F19966F7EAD0E3A6D061B6303AFBF4FD0C2CA 6REHAVBIOLOG
438,352,847 *2C6F11C18694E8D3397B5A9E45982C8763366494 FIRTHOUSDEEN
438,352,848 *2C60BEFE35FEA69CACA3178FDF58DB8762522002 6TITRERVSKERN
438,352,849 *2C6FCA27C62A760335410F82E9E9485540F456B7 fl4pp3rho
438,352,850 *2C6FB7D587FCEC4D42A68F390F13D891197A2937 G\OO
438,352,851 *2C6FE6A762454951CD3B909429BECD99682082C8 790366 gorbachev's address calmed the demonstrators in yerevan
438,352,852 *2C6C47CBADD5849B4B6C7B07F0CD711F74556E46 GRAND ECLIPSE
438,352,853 *2C68B4D3B7002C180F32D1DC553DCC6344BA32D8 florencioduree
438,352,854 *2C6EB690BE0F640B35F1FCD25201B2BE02FA5AE2 fly-hunter
438,352,855 *2C689D0A735C8DC96EA9FF7438437C0A4DBB6F27 7CRSNRZWGBXS
438,352,856 *2C6F699747F8270CE1D6754A68541844154E34A8 GREGVARLOTTA
438,352,857 *2C6CD38755E1A4FBD98535B1B2D5CDE0562A38FA 7JANICESAMPLER
438,352,858 *2C61E7054778E5CBFB50687B2D2BA851B0F4F379 formeerder0
438,352,859 *2C6E308FB12479F7F5CB11D698EED4943252A5B1 GUILLERMOADRIANCE
438,352,860 *2C6F010C4305FAAC2418F0596446CF4A5914D616 gunnernaomi
438,352,861 *2C64517346741D3A83142BF806DC99F9F340AC36 FRBARATILI
438,352,862 *2C607B1AC53C94BFB8420EB8A5E34DD2E4902116 f]rc
438,352,863 *2C654296446335272D61F5C1ABA064CD55CAE4E3 [email protected]
438,352,864 *2C6B288EB24469A516782512C3C1A13F249A557A fredsantino
438,352,865 *2C67BED15B20EA42E18A0158849F284CB90A22E0 [email protected]
438,352,866 *2C6DDADAA25D88B23CA37F337D6A4CA09844F646 H2QOHNJBOOKB
438,352,867 *2C6A96C9C4ACFE9B3825ABF3755566EFD0101E0F [email protected]
438,352,868 *2C69C2ECDF52E77D7A636E60996460540BB60B5B FURZ / DIE TOTEN HOSEN - SEELENTHERAPIE
438,352,869 *2C6AB00B2FEA64D74A507E4D08FC0F0125A6671A FV9{
438,352,870 *2C62DF7F6DD5882FCEF18CDEDA475E7C86DFCBFF harleyingwersen
438,352,871 *2C6BEA84103423B71F27F7E8148B8795A6850B79 8ALLIVEBSW
438,352,872 *2C6D8CBF9C2E079B0DD8F2118BB248D01788E347 hauptstrasselettlandsa1
438,352,873 *2C67097798DC1E5DED86BDC9F9043B49CA5CBC70 haute-rentgen
438,352,874 *2C686FB88B71B0F5D873E2E3056994262A93FCE8 8BSWMEIERHOEFERBS
438,352,875 *2C6619CC2118537C5E43E338631CE69DF9F55171 HEADMOS7
438,352,876 *2C6FCF26FB720103C2BE6EB95DD71154BCCE17B1 8DMJOSSELBSW
438,352,877 *2C6C1774E75A9B31D8A32A3C65F9C2AA9441C5CF 8=d`~.`~o><
438,352,878 *2C676C2A240AE43F10EA5F06E1276710383F5178 8ENTROPIUMS
438,352,879 *2C61A2A2787A7C04E2AABD12A603742A03C416CA 8GIDJEES
438,352,880 *2C62A0AB4CA5709201187A6CAADAA85E569867D3 8.L
438,352,881 *2C67656C3AE16E9CEDB3A2974EFBBCC863C96193 GAYLE.PACELLA
438,352,882 *2C6C89CBD8F39A1E9B722130B5FC4AD5656E997D 8NEAFNEAF
438,352,883 *2C6C2391771F0053B61783A11C8EC5923DCE8CC5 }8{ O~0~(####3
438,352,884 *2C6E82DCC06A74A9A9B8B0E9132FD9C8F2C23A92 geblaseer0
438,352,885 *2C6C7CC57121446EBBEC2140EB026459E6B9E245 GEGOLFDS4
438,352,886 *2C69F1375A17DCB3ED9A4D86C12D2F09FBD826BD )8(~` ~`qP
438,352,887 *2C60050AE8A5F5E127B2EB17CE0F5DA8E18479B4 [email protected]!NE$
438,352,888 *2C6F51B8EEFAD41703F8B5160F661B12285429E4 HHARKOUSS
438,352,889 *2C6CEE80360339CA66A86F6956916CC5097BE87D 8REEFERKOKO
438,352,890 *2C6ADA80607C9F4307927C8C03ED7FE37FB879D3 hiakojd33
438,352,891 *2C6907568E50173151835BB9FD777CA6367DC2FA 8sizladi
438,352,892 *2C65E142F534D5C83558229675B1F61F454D5565 8SPECTRACORP
438,352,893 *2C6094B50BA4E4CA109057037F0B5E351DD531F9 HINGESCHLAGEN/A
438,352,894 *2C6DFCD0B9ED9CD43B3A7712FA7181350D1E72B0 HIRCINOUSING
438,352,895 *2C6F55695A9C185956B22AC1E959ED7F94ACAA4B 8VOLIABLE
438,352,896 *2C617E0BB6876ADA85DAA6003B31015E08B0769D [email protected]
438,352,897 *2C6D3B3C44F68AED00BFBA4C1313F55FF1FF8DBE [email protected]
438,352,898 *2C6058F266E721A9AEE0D4A58786D6AE9A105921 [email protected]
438,352,899 *2C60FB057D938321B235AC00A7BE86001360C257 hnojenimi0
438,352,900 *2C6EBE4877C91645C9FAB11AC47EE43CFF919ADD GGABRIEL0
438,352,901 *2C687AE8BDD028C3B4938DAE797DBD5EFD374609 9BAOUTABOUT
438,352,902 *2C63EF09702F5662E38A7DE650EBAF28DA53357E [email protected]
438,352,903 *2C6C59BAED5E9BC4405C68AA7A46BB69B0E0C338 9CABLEARA
438,352,904 *2C6582764F1BBE3EFD7DB0A6F607B8562F561A53 HORACIO.BLUMENKRANZ
438,352,905 *2C6607226F73C43D37101B4C2C5EBE0B340C0A6B giodossantos
438,352,906 *2C62711C2F093686E05BB4CF89FF0C61D1665394 GJBOGLIONE
438,352,907 *2C6CD3C6A868A81C75A1F2CD512CC96E4BD0B0CF HOWARDBACORN
438,352,908 *2C60B0574304C0821CE9B1B95108300BBF350530 hqey
438,352,909 *2C6E8E74FEAE0264EFA19DC2B93DDB0BD90FD21A glennbachand
438,352,910 *2C60A54BC9B62F4E589B4EE1E000F694BA963EA0 9guerrillaoorlog
438,352,911 *2C668E4D6541C437A61E3616599F68EBF8780D72 GNIPPOHCSREV
438,352,912 *2C67ED641561621091CD332019AF94AC83276B2B gods of the nether world
438,352,913 *2C6AB07E243F819A92870485DF9EE84DE8AD776B gongsi),是
438,352,914 *2C62EF049AEB64AABB726CDF63124E25320754CA GOODBYE.M..FENDER
438,352,915 *2C6C175534CC89E7D931EB86CDC02478F3FDD6D1 [email protected]
438,352,916 *2C635235DFD7D1875BFC77F4425BD6B2CE1C24E0 9RCCNBSW
438,352,917 *2C6165F3A21B39842B7CD2A1BC596A71014BCF7A hussitenheer
438,352,918 *2C68B03467C0E4A2895D04A5B7A1898F19A29177 9THETERRY8
438,352,919 *2C6B95FD8C6367765B9CEEF01DAFB5D9CEEA1623 9UTSKYTNINGSRAMPE
438,352,920 *2C681EA5A41E4BE5C7A2FDEF18A1F828A0AE448E hyracodontidaing
438,352,921 *2C6DF9586951124D729A7F22DEF2330FAA1C87AA a:%"_
438,352,922 *2C6A737796FC3A454CBC80CD86DE89206A5CE2D0 GRATICULE5
438,352,923 *2C66572B521C2B2411AC058216D955DEAC555652 IDIÓTÁK
438,352,924 *2C6DBD92CF4C075E7618990F0FD04050962CE473 AAA2~Y
438,352,925 *2C6EA9D37A26DE5CCA15B3A3977D69FB00D7FDDA aaakce
438,352,926 *2C63174424572293138EBB1707E86373B54DB2BD aacags
438,352,927 *2C65DFBF4CFE047A8C8C0C39845EC6E52749608A inalzai5
438,352,928 *2C62F38F27142A60A53C00768F21DFE55DA21B31 HANS.LOFSTEAD
438,352,929 *2C6D36A7554D51A81B75A0D0DAC98E611561F32C informationsocietystrategy
438,352,930 *2C62DA8A32EFAE8A5CC5501042518D1519A774F5 HARSH-THAKRAL
438,352,931 *2C628F6E6ABEB71C0300059E17D4D5847038EC61 aavt}
438,352,932 *2C629A7273B82310C3A3A9230946B40E14A46002 Inter.alia
438,352,933 *2C6D24253F91F798DE7D3D02AB5CD8C268710AB7 AB3QY
438,352,934 *2C627FC12E7E3F1E099D00DA993EA45DA264FB06 ABIGCOCK6
438,352,935 *2C61C695D6F02AE3F51B5BD3EAF144854E03FD5D AB?KG
438,352,936 *2C6CFC0D50D2C7147C2A0CEEFA4F23090F04CE53 [email protected]
438,352,937 *2C689F1DDA42A9C7CF5DAEB86C62A7E3614441C2 [email protected]
438,352,938 *2C659BD23A3F6D6FB9368F394339E9A2A69D115E hebrewnationalmeatscommercial
438,352,939 *2C6044B21BA0DB5805BF9A9778474C3483EAB869 ACA36
438,352,940 *2C6187FEE67688BBCD2DFE2219CA736C9A47A182 HENRIEMILE
438,352,941 *2C67FC3256DA32A02BFF0E8B605F2A064FEF4A1A ISREALLEIDALL
438,352,942 *2C63D3F73162814F7BDEE51EEF1B1464CDF2CFB1 acti,scene2:deinembruderbotichmichzummann
438,352,943 *2C64907F3312D04829DB0000E13477591A68093D HERSCHEL.BORELAND
438,352,944 *2C637BF0233AEE883A4E78A53E121DEF803305D2 HERSHELGILGORE
438,352,945 *2C6A65D8FDA78B223124223BEF52C1A5D889092C hershelkorvin
438,352,946 *2C6067CB5B3DEA4F16590226345C80C4B223D45D [email protected]
438,352,947 *2C6EB6F9B617E065FECD52B162151D53CEFCAA57 J9GJ4WKU6FSC
438,352,948 *2C6E84AC9E5D3DECF9A2E5C86DBFD26A69D6D059 j(:a
438,352,949 *2C6E2DE785D6C2663770B4D14A30002078B10343 [email protected]
438,352,950 *2C61957EC790192782AA6CFBC604E2AA4F788463 [email protected]
438,352,951 *2C681CAF01B21D1B58D5FD144D8C0106BCEBC81A jaeholmquest
438,352,952 *2C6CFED39CFC3378B72FE85FEA169D6FD5F5F38D hokey-pokey-(mix-2)
438,352,953 *2C6F58EAA7E39256EBF09F3C88E742A80C0727D3 a,fcl
438,352,954 *2C6582A88B611E8A2225E1A231732FFF931B7463 hoytnickels
438,352,955 *2C68A7CDD1D47E51479E6E7C6547A8FDA51C6ED6 JAYSONFUSCH
438,352,956 *2C61C993D5398D12EB620D79CB62A359DB2C3C53 jazzsax
438,352,957 *2C6A1B389859245EC7EBE697FB0BBA2222B419F2 href="/mad-magazine-items-part-1/lm/ass9jl6qwn3x"><img
438,352,958 *2C61E4FE17E8CB088D457098A81B66C20FED7D0B AGENT':-WHAT-KIND-OF-JOBS-DO-YOU-HAVE...-OH.-CUT-IT-OUT.
438,352,959 *2C6776FA8C17FEE656B5B9D17C440B541E3EFA68 [email protected]
438,352,960 *2C6A2FD86F38C12E384CF7F073B7FB3BF8848443 H`TG
438,352,961 *2C6B1BFF7B0BED275CF198F38D79C2CA6E01AB97 [email protected],[email protected]
438,352,962 *2C6DF3853179466368951104979FA9839731792F JEDGOUD
438,352,963 *2C6B611B0C23EFD87305B9BB87ADAAB681C7140C HUGHFRAGMIN
438,352,964 *2C64456FF4B8CEE7775ECE3BD70CC0BE42150F3A HUMBERTO.MCKINNON
438,352,965 *2C65461A344E05E8F188F19F40894243292A6131 HUNG.CHAMPEY
438,352,966 *2C664A4EC1AB92483F691E9015F55D916D307C20 HUNG.DUNNAGAN
438,352,967 *2C625E1A54F0F5DFC1D2AE6FD419E6F238F3D521 ahabz
438,352,968 *2C6ADF921E0F386A80C57068F57B4DF8C09568CA JEREMIAHCLOUGHER
438,352,969 *2C6E5BE1EFCD98EF421ED7B05B3B5B22B9D8106A hyfen
438,352,970 *2C6FFE06036EA951C59904234B2DF6CC88F4289B ahqbw
438,352,971 *2C6D718EE5426ECF7034BD5CA1EEC79B4407CCE7 AIKMANCOKE
438,352,972 *2C6E3FEA0FFE2E421D75939FC2B225059C83D1AC AJ48E
438,352,973 *2C601FC58C693AEEDA48C13FE0C07E0BDD7361BB jimmyminnix
438,352,974 *2C6DAD57B28594FB608FAC07DFF7124FA56E7076 IGLESIA DE SAN PEDRO DE TERCUI
438,352,975 *2C6C86DE5E909508174905FF21490DA1C5CC5BD9 AKL%U
438,352,976 *2C6EFB466A0D6F83DA7A4470423206ED8FBF225D JNNU
438,352,977 *2C68659479BE5EAADB76C271D294875441EA0A68 joelraguso
438,352,978 *2C640FA97EFB04273120CB2FD964DA22FBD30833 ILAIRTTY8
438,352,979 *2C65E3865464844F20800106DF717CF984414FA2 aldenturkin
438,352,980 *2C63BD56A4CB529A68609DB839141B69D8263FD9 joeyalyea
438,352,981 *2C646C5BD0C9D2B7A23EB6449580C644290EE6A1 JOHNEAGON
438,352,982 *2C69658B3A5C8612CD0FEC7713A517810B8583CC johnsonwarbritton
438,352,983 *2C64BA2AF41B78CE357FF55FCA1FFA59F131E398 ALEX.SANDOS
438,352,984 *2C6F50E3AF593B7C59C90544014A4688A64BBA37 alexsterk
438,352,985 *2C604A459DBB08171E9D69F595C20A2C9CF1930D JONNATHAN.ORTIZ
438,352,986 *2C6B4BA6CFF75FFB7A33E182CE72335992F9C19F alison-napier
438,352,987 *2C63483EAA5FEBAEDF4E8E19B2667E3A39A1C356 JOSHPETITTO
438,352,988 *2C679134E0053E6F380773B5671D166D576A625B JR082404
438,352,989 *2C6798AB53AFA8A426C607C5E16FA0EC2C70CE72 juangheza
438,352,990 *2C66BF7E23A67346976276EC2EADBD0C8FD4387C INDELAR6
438,352,991 *2C6EA7171EE4AB8405E77CB0BBEA8E0E973C228D INDIANLOVECALL(FEAT.RICHARDFREDRICKS)
438,352,992 *2C66E6EEDA6D32AE0F3CB21C1561DC57BFF7D1F1 JUDYASSES
438,352,993 *2C625CC3B3B432E24D2EC57DD8D9FA74AA8286FD JULIUSBRAZIE
438,352,994 *2C6CE37057C748297CE0D329CB773D82F8C9D970 alzj
438,352,995 *2C6C6EB522E3EC0EB4ECA7D8D64024B4C9942D6D AMADO.MELOT
438,352,996 *2C67A6240DCBD7D8AF0DB2AAFDAE98B566B0A360 [email protected]
438,352,997 *2C65ED979D5919513080FC879CB7D8DECAABA8A2 iqiaaa
438,352,998 *2C6DF7B28C37C7E052EA5817633897311222BC71 amila.amarakoon
438,352,999 *2C6499DEE0925DF364FA04D80B2880CE58058EC0 amitdada
438,353,000 *2C6ACFCDA61E85BD8DEAE14F2387A78ECEF0DB45 kadin463
438,353,001 *2C6BD6E408253843C09C0A4D8EAFC97BDCF73B9A AN4UJ
438,353,002 *2C63C72C1FF41144D173D9B84DBE5B346643E616 ANDREASSOOS
438,353,003 *2C673AB7E8EB75CA461944B13442B7C4E897FBB3 KAPDUHAJL
438,353,004 *2C6B674CD7CFEE0C84E8FC89FD29718B6D1E1FCC JAKUBMKT
438,353,005 *2C64F25D11FA89F09648A87660F1D2A7188A1B72 JAMES GALWAY & PHIL COULTER
438,353,006 *2C693CE5A37D0581B3635692DC0986D418B4D217 .ANONYMOUS
438,353,007 *2C6E2F65D6E77E75645F5C8498A63771C07C3235 ANTIDEPR1
438,353,008 *2C698FE275E424B1F77DE4A0718E5A0C9EC60BC7 JAREDPREDA
438,353,009 *2C66CA09C5E2D90A1F79794B7F8B229B29B9F10C ANTONBOESPFLUG
438,353,010 *2C6A5957123A768B27B28437563481DF72260371 jarredseverns
438,353,011 *2C6064535A16BA9611D4B8DDC5034EAB5B419CEA KEVEN.CHEFFER
438,353,012 *2C67414019B394D7AE6307536A215FBAF2780A2E JARROD.KASTNING
438,353,013 *2C6868889DAC4CE6D2C0BFA5CD7460C4D111CA23 jasmine-gardener
438,353,014 *2C63D317C627D1B2B95500DCEAAF7A728EB6795F [email protected]
438,353,015 *2C606FB911A3CE191757B3EA3883701F1E61F9BD AO1JN
438,353,016 *2C69A3F76B73FDB618E394B838D838908303C46F jblackwe7
438,353,017 *2C6A8C263296298BD192F1AD4E100BA8AB67282A JCPESANTE
438,353,018 *2C6A9666AF14F90ED3E732F603E509E1AD6AB50B AP1F
438,353,019 *2C6DCE04402ED46C64781C54F8C1CA9D967F2B43 ap=cm
438,353,020 *2C60F5EB72B5BA793497834D19C34798EC6A3688 KIRKHSING
438,353,021 *2C6866BABDC2B25C5398C63CB116D920C24DBC23 a?=qv
438,353,022 *2C6DFF6A8DC2375F6C6E01A492ACCFDE81B9EB2E [email protected]
438,353,023 *2C612D4BECCE9432AE9B531CF10089C4C6EF9D38 ARCHIE.CHRISTENBERRY
438,353,024 *2C66111D13302823ECAEC011AF48E11E526297E4 JENNIFER-LYNN-INGRAM
438,353,025 *2C6563687CB1DEC7077880BC1DCBB33E21CB6ED6 ARENAQQQA
438,353,026 *2C654E8E4C306498868DED79072610B7367207B5 aronstingley
438,353,027 *2C62243D0E27787FF75CDCEF7B2ABC849DE9110A koshuis3
438,353,028 *2C621690CD12CC6838FCBE57880A2C4130D74649 KRAUTERNING
438,353,029 *2C613A1513C33910D7B371EA873A6558CAA73EF8 ARTDINGFELDER
438,353,030 *2C6B6A093649D04A019908C7F369A3F2BA5FF32D KSERULĖ
438,353,031 *2C634F26E8ECD2BBEA547FB88C8A68F77B414BE7 ASFEO200
438,353,032 *2C6D966FE589FF26D6FFBBA34DDBCF614A773D3E lanelendor
438,353,033 *2C6466AA86B89FBC20988BFE3511B5C34FAF13A8 ASTRO-CHAR
438,353,034 *2C6BCBF3312737FF5169739BB12B30549CCA00EB [email protected]
438,353,035 *2C60251D4C4AD122DC6D57ACA42D4D05FD0BABDD ATASDEBEAUXYEUX
438,353,036 *2C6261BA1D3CB23BD316E46D161C11E82E1E97F2 JOHN.BOLLIGER
438,353,037 *2C6549C77B2D4B9B5E90590DB95546CCDB752504 Atb3
438,353,038 *2C61A3089CD45EB12FE9C0847B69D42AAD0721F7 lawerencedorta
438,353,039 *2C6D649C1DAD31159E4DCA37FA63C3FB7C5CE41F ATHLYNES
438,353,040 *2C663471A52151C3B0E6513A7BA957CD8EBD4410 jonathanaton
438,353,041 *2C6E0C69BC357455A596E430E96E69D432FC40EB leah-cardoza
438,353,042 *2C6EB50AF3DD77BE29BC1C5F22B56D0E72D235BB learn-love-hate
438,353,043 *2C6607D434B88DD19FE340C24FA280CBCBD44886 LEGGETH
438,353,044 *2C6B1C17E926D91FCFF03C1D650C5F4A5DE60C23 jorgeferaco
438,353,045 *2C60E53F84D727911BB53BF360D656E8374FEC9F “LENCHEN”
438,353,046 *2C6322CB1C8E5D4D451BF9AA547F424FC85D9FF2 lennyvanderhyde
438,353,047 *2C6E37009DE8ECF34355782E73ECCAF3B1E352C1 LEONARDOMISIASZEK
438,353,048 *2C6F55BFE29D28BB0EE90075F37D7383230A8AAB LEONARDO.WAYCOTT
438,353,049 *2C663C4586A8F38ED0ED7936E11A98E75193CDE0 LESQUELETTELABOUREUR
438,353,050 *2C6B23BC57316175DF5554EA1CC1481EFF985798 judy-catanzaro
438,353,051 *2C66C46D61DCE82DEBEF6F60DE9AE815FE1AD749 AVERY JR.
438,353,052 *2C6C957518BAB700AA75A126123CAD3C15E7783C AVILEDE0
438,353,053 *2C6A2DA9ADF8971BB047B55E7A0B348C91937F75 jVy
438,353,054 *2C665BB2B09E4D9A8857D65BEA8E6F91ED5F4321 ka\c
438,353,055 *2C6B361B3257D49FF003580DBB76A596E9124442 LIES.MEMNON335BC
438,353,056 *2C627080E53622735C1832FD31BEF4C492042896 KANAZAWA-UDATSUYAMA
438,353,057 *2C62D19F7546F653533F3F17D426E2EFF9895A88 LILLIE1048
438,353,058 *2C677EC5EC78954E2CD96F156BD18721BEFFCB07 [email protected]
438,353,059 *2C629BC83DB02529ABD78EE60B5456C9AC2E8A05 kathleeninman
438,353,060 *2C6FE86326E1A4702270594C819F0F982D6C6F36 [email protected]
438,353,061 *2C68B4F6F641FAA7F5A7DEF78FAAB17FADCBA430 LINWOOD.STANCER
438,353,062 *2C639CCF5FB81D6627D29DA7217CA3BAE8257468 [email protected]
438,353,063 *2C69E17438BFBA1E5C25B4AE8275022D48F79CDF K.EDWARDS
438,353,064 *2C607BCCBD4FD98E15B38133082CBBB848941DB1 LITHOUANA
438,353,065 *2C6E5C51FC97973DCE777DD71422B4CABB3CC2C1 b+/9k
438,353,066 *2C69EE0CD078EFEF44F891CDD86F71E995414C3F LIVINGINALOVETOWN
438,353,067 *2C6431CB66D1D210DF488E9B1FA73DCF3F2A9CB0 lloydwhittiker
438,353,068 *2C68BC0A516D1FA62BC0CC16CDE000CD9D64A7D3 [email protected]
438,353,069 *2C64B9FC2609E262268775240CA6FFD5B5A3EFF2 [email protected]
438,353,070 *2C6A543F0FAA49109C1A8340AA031E594789DB9B BANDSIGNUP
438,353,071 *2C6D97385BBF851A47D75C2CF81B14AD6D5E4947 louisedaddy
438,353,072 *2C6950533C08BBC46A5D277ACA1201FE392CA6B6 LOYDRERKO
438,353,073 *2C643D4E302330F956BB9B7253188923A964ACCE BB`~ 3B<
438,353,074 *2C6E21B6C741287A4FE57EE499D6BF57E3E9EE3D kkfx
438,353,075 *2C6EAFE932A3BF64480EFC974B7383F71B28D4BD [email protected]
438,353,076 *2C64713AE79087C6D708FC76B37C2EF71349B7A8 KMICARL
438,353,077 *2C6DCFB50E4DA51362D8CBA7E50D3303CAA34E9B B======B~.`{x}
438,353,078 *2C66DAB8298617138A4921A11F4D02CFDE83B953 knahaten
438,353,079 *2C66BBC546AA7F23274CF7735B4BF0E183F7CAB6 kokop{iv{ist{
438,353,080 *2C6F77C585D86ACDD53CE4B8EA34D35DB7419428 bcogp
438,353,081 *2C6986CDAC0F6FF8771AE62162E1DC7224EE6790 LYLE.FALCI
438,353,082 *2C6A1F2163C04B2C4BE907F530821E1C0B8C4042 LYNWOOD.NGUYN
438,353,083 *2C629AAF0D85E12EBA6272BA35720AB37CB90A86 BENJAMIN.STINAR
438,353,084 *2C6EFD6EBEFB063AB13B2E9AF8AE9769C7B7DCF8 M1^F
438,353,085 *2C6B3E41C210A352A227E5DFBA506E6D336AA8CF MACHTOTZ
438,353,086 *2C6D4EB65805A9D848754D1E0D6B54CD820F2428 BE"R?
438,353,087 *2C65F76A29088B198279146D07E97F494314E9BF KVELMIRE
438,353,088 *2C636BA254E46FC927B9E8D7CE55A7F3842CCA3B besnaards4
438,353,089 *2C6548AC7C09186F304D7AB03E15345A9BE50F45 BETOKENS
438,353,090 *2C679FC3CEE5DEC19A7FB215DAA6360E8D4D1B0D LADY CRACKER
438,353,091 *2C6F79B3C3436D3E3D17EBFC521A919596141C92 malcolmmonaham
438,353,092 *2C67CAD30CEDE91E9ADB7AA904BA1826D5C4582B bfkfd
438,353,093 *2C679E0165FBFDCECD28ED66C8CA171468AB1935 manorship1
438,353,094 *2C641300CF068F644A61E0E2805087F90417CA7B [email protected]
438,353,095 *2C6486B65DB01CF89D0B5E4F28C168A64F510DBF Marcia-Campbell
438,353,096 *2C6A3CF67AFEBAB5637E1892ABD0269B14990A69 marcossagehorn
438,353,097 *2C66DC1982559AFA28ACBDA7D38007D9010FA45F MARCUSVREUGDENHIL
438,353,098 *2C6880E0A8215C7D49DC1AF1762F7039C02CAC3D MARIO.BENDU
438,353,099 *2C66399B7B11DED16D7FD9BBFD3816ACFC119D83 BIB3I
438,353,100 *2C6CDF82508D36872DBFFDF6188BF046DED4B1D2 markovchick
438,353,101 *2C63FBFEB8E3BC99514023702F5B56D113293093 bioc1
438,353,102 *2C636B736BD1C1FF8B08C124ECF64A6525955EF7 Bisch.parat?.(radio.edit)
438,353,103 *2C6935E7DA2FBF19FACAD001A414006E0E46875D BISSH
438,353,104 *2C6175A9A049F3040D64BC12CDFCCA0376BA7EAA BJFP
438,353,105 *2C616E5F61068C323144197CA3662D9D91331CF1 LAVICKY9
438,353,106 *2C6904F57DAD137761871350B620C050826EE82F BLUTERAI
438,353,107 *2C6548C138F616471F0782DD9462AAA0B5EC2CC2 [email protected]
438,353,108 *2C66D24E979DCB8BF225EFC90CB4AB5B0343553A ME AND YOU (HUMATE MIX)
438,353,109 *2C6FC63BD2156D3E98D334F5AAB20985AA26F214 LEONARDOSTICKLIN
438,353,110 *2C6A452E9E3ABB0B22E45853A7B5F53EF52410D5 BODY.ON.ME.(FEAT..ASHANTI.&.AKON)
438,353,111 *2C698C759DE04CB077A328207AB6E7411C01B8F2 BONNIEB909
438,353,112 *2C63D2A4CB2314D566B9DBB10C50F1BB204F5E9E boyceporath
438,353,113 *2C6FFD848013809172B4FA5E6CEC6B50997F0A26 MERLIN.CAT
438,353,114 *2C66546FB9695D28EF773440E5A43078FED84422 merlintheriot
438,353,115 *2C6504BE6715727D050FED0A4890ED841D79010E MERVATGAD
438,353,116 *2C6DDBBD848EEF6C2DABB80A755C73875860CF8A BPC8_
438,353,117 *2C6FD4918F2E279C9BC9182F0E552E372726B98A LG=
438,353,118 *2C66C035D02222AB008C0D13EF16FD8683CEB912 bpop,
438,353,119 *2C69611BEA94E901DCD21DA866D1655574A19D0E BRADFORD.HOLSAPPLE
438,353,120 *2C6874FE90C200D0D91DB9130C676691E5093A12 BRANDEN740
438,353,121 *2C61FDBAD24556710E965405E628BFB971BFB3C8 brcwi
438,353,122 *2C6347570E4BC2DB2D4B61F5FC91E8324DF284F0 brentonmatheu
438,353,123 *2C6C4F0907D0FDC1AA6810C4C0AA37C76F7FBCCB brettxang
438,353,124 *2C6B27DD6C2A4B6B72A8BF9E04872283CD34BC0D BRIAN JOINSON
438,353,125 *2C6F5DE202B9B944C47CCB85121969BC6A1EFE54 brian-schapiro
438,353,126 *2C6F1FFFEA2AD763D1BD97CA4754E7C5E26F8090 MICKEYSALONEK
438,353,127 *2C62FA167E6E92BE370EBD7BF9FCF5D79FCD0782 „mickymäuse“
438,353,128 *2C60A66AF977135253237829372C321EBE092E7F brs;-
438,353,129 *2C61CB766E8BEB5B758DAB82D03C573A487B5868 lionizat7
438,353,130 *2C6065204C0A69E8714A7384127D1CE98C878EA5 BRYAN.FIECKE
438,353,131 *2C6AFB0C4FBFD3CF36B7F81E2B0049ADEF428945 bryankhalid
438,353,132 *2C6A4D47D618ADE0DA21C53A7F871C43A8E634C3 BRYCE.DESALVATORE
438,353,133 *2C687B76A19E03ABD56B3A2FD641DD5BFA05CBF9 bs$83
438,353,134 *2C6B156B3F07719C613D8D7A153F364213BF4FD2 [email protected]
438,353,135 *2C6B0B1FAD4CF87C1B74A54DFA3F176E247E8644 bswaaeeaaccttoob
438,353,136 *2C6F912A183746B0F4B26D37734D345097A50BBA mitanges7
438,353,137 *2C6B28C723AECF668A934EE251A17826971DD6AD mjessica1
438,353,138 *2C61BCE1B37C6E191D9B59545C8B6F3C937BDB69 BUD.HUMENIUK
438,353,139 *2C6B5423468C327424E048166EBAF75E2657FED9 MOBILEBP
438,353,140 *2C656F8D8D562C83848E01F6C440B60C879213CD [email protected]
438,353,141 *2C680B1CBF15FCD98FA7D72E4A56047E13E646FE MOHAMEDSLIMANI
438,353,142 *2C6C0DE1608E1589D1DD5660EF8A4576CD0C6046 bv-
438,353,143 *2C69628246CC12A2FD632A85109A869073E4802B LOU.SAULTS
438,353,144 *2C62815E9B55957B431569799A2B57EA2E9E55D2 bw5rg
438,353,145 *2C67B52BBBA04E16A24C42F259234C2272E40798 LSOFMAN
438,353,146 *2C6830531225CB36BAF88B59EA15620A92FBCD52 MOVE.TO.CALIFORNIA
438,353,147 *2C6F1C5AC73F9D45FA3F1EE8DAB7FF91F4215D64 lyt,
438,353,148 *2C6DC767E23D6BB65FFD05120BBE3BDB2C31BC20 c73t;
438,353,149 *2C60BF92B55A394797C69025E6D94EE8E016294B nanp'in
438,353,150 *2C69793E5810636EFA13A03E00C02AC524CE631F MAGROUDY
438,353,151 *2C6E9AE5EF662F7FD65BDBABDE84982F92521F49 magypsy
438,353,152 *2C6E9648335FE1574E407BE33E20339591DA479D naxolone
438,353,153 *2C6495DC9AEB48421E0E764246E4AA081A1C07B3 nd;z
438,353,154 *2C670B05ED710F06B76EFF5F85F6AB7C68FC231F malak.memo
438,353,155 *2C625FF871DFA6E24C178C3D9FB43CA9C4495B82 MALCOLM.MIYAKE
438,353,156 *2C6301B7A4C13DB45424B1C6622A69DAFB248375 CAMBODIA(PAULOAKENFOLDREMIX)
438,353,157 *2C6F33B9E43980553C3CD3EEF9D8BF7B97F31C73 carb0n.li
438,353,158 *2C60893CEE7BF1387DA7A557FFA4B47698F67395 NEVEAH21
438,353,159 *2C6E3A2D77905F5689B9246C80C05F0A3C83B96B nevillerabal
438,353,160 *2C64303733B16F8AF61704ADAE65335DA470075E marceldirden
438,353,161 *2C67DEAE0034D2873261F15608AE7E8D2C5B2B39 CAROLIFE.DAISY
438,353,162 *2C6ABBC6C8D4F101BBB4CE259C15E5D97581E49B mark.smith
438,353,163 *2C68B79938F94AE68545B084DE4070535CC04BE5 MASON.FAVIERI
438,353,164 *2C63905CCE6F41D63A733F7449FA877EC8C6C730 MASSAGRAF7
438,353,165 *2C634825DA71D75C8C98FCB593EC713B3A3D88D9 CC/DE
438,353,166 *2C604946D395DCA14157B475A6621CE8E553B7D6 C$cg
438,353,167 *2C68B7EA6D40443551C6D9361B4491FFFE5BE86D nobodyunderthesun
438,353,168 *2C68491563312C3B54280B06B6D9A81D58A9F8F7 NONBERMUDIAN
438,353,169 *2C69A4F61A1E636A5A796B0AE772678469716E59 cedricgorczyca
438,353,170 *2C6C6680BBDD5C8F7234504DF6C60CCE73BC988B c:_el
438,353,171 *2C628CE07D1E37413F9CE99ADFF2DEA7220B1D65 CELTICSHIRT
438,353,172 *2C6AF227295161EEFB9706F46AE0976CD7CCF17A CF4
438,353,173 *2C6B8A5B2A3FCB5A3B06797AC70F21CC69F6EB20 ch10r1nat0r
438,353,174 *2C631A153802D659869E603B250C8E273052EB13 CHAMINDA.LALITH
438,353,175 *2C6A01A1193EA300F1EFB8DA251C5F2CD834199C MESSIAH:PARTII,NO.7:HETRUSTEDINGODTHATHEWOULDDELIVERHIM
438,353,176 *2C6B6EA8EF32ECC0AB0DCE254BC80E04840E9624 CHANCE.OVDENK
438,353,177 *2C64F08D37EF1510BEB5BDFB29F32BE7AC7CDC21 OAOSSAIN
438,353,178 *2C62786E065500701BA0409AFDBC60EB3B58C834 chapter 1208: heart of stone
438,353,179 *2C66F1A2F9DA350B72C0B20905BC8133EA3C3675 )O(**dP
438,353,180 *2C627E47DAA8ED2440A3217564708C097EA32F48 CHATTARANGA
438,353,181 *2C663F939039C508AA06DE37D5D57AED8FDC17C8 CHEMOTROPIC.
438,353,182 *2C6903AEB056C2DF2BCE919F857E4A49DD97A209 CHERUKUMILLI
438,353,183 *2C653913D066AAC40D636EDD688429DC122A246B CHESTER.GRIMS
438,353,184 *2C64845E365F0127F895DB950246A9870A67E267 [email protected]+HEX5
438,353,185 *2C60ED531E08F454816B066738FFAE02F7EA2F15 MINEFORD2
438,353,186 *2C6991C69911578DC15BABE285945540E18B2BCF MIROSLAV-'DUDA'
438,353,187 *2C64EB2CA92B417CF390447E7F6F94897045D1F1 misotram6
438,353,188 *2C6C41604B029663354FF75C6E1CBDFAFFA51D4C (O_)O~ 0~ <==3
438,353,189 *2C6DF1C7D78BC315C6884E92DF656C4630573AA9 MIX CARIBE 2001
438,353,190 *2C6331AB76D97BC5B19D7DADA5B46D4E9C014247 [email protected]
438,353,191 *2C6ACA86ED35E2C829DE26F16AE8B7DF381DD618 CHUCK.SERINI
438,353,192 *2C65C12D53666DAA530B0AABACD0A609275036A3 MNTHDA1
438,353,193 *2C608D82FB0FB22BDE3B937931A17091E5FD8126 city-science
438,353,194 *2C69FA90F066B51A4F47D5AC7C23C5CFC9F27107 mohsan.malik
438,353,195 *2C6F94BB2FDAA559283DC738990298CD3A7F254C osa,ysz6
438,353,196 *2C6C93AE8919126442DC8B81E3D13CCAECD66083 MOSES.FARE
438,353,197 *2C6C41AD46A0FC9DBD8F5A84D9326846255080F0 mosheheyes
438,353,198 *2C638088493794EC81E532CC31B0466B209260C2 c+(ki
438,353,199 *2C69FAC9BDEAD8EC894E6DC5554744B06C16740E oyptibt6
438,353,200 *2C69480CA1302E3F84E1BC12F25DBB817ABB8995 (><) ~ (###p
438,353,201 *2C656D041CFFC07AD0236742E71621C451B6F8DE MYALINA1
438,353,202 *2C616AB91E18368E42D89522F955C94B59E5EA55 PADDOCKE0
438,353,203 *2C67458B7066B25FE57111A71E481354960356C7 [email protected]
438,353,204 *2C69F5B7E7CD74406BD2B4069024B8657BC19A47 pamperded
438,353,205 *2C6B74491F66AF6AB6F90C13CE941215E5CF7078 CMSHORN
438,353,206 *2C6DB8BF64BA80BEEAE2EBE2E61CC6D12D82BD7E parteiraeson
438,353,207 *2C6F7827B01F67674D59498986702E1265EF5872 patrick-wamsley
438,353,208 *2C67BCE030786DA5DF78274752AE917AF87AD0E7 paulettemcmillan
438,353,209 *2C65184AC3BB8E0F82DA54A02F78A9D5EAC6DEC0 P###D~0~o(O_-)
438,353,210 *2C61220EEF41EC247287D6D1289C0F309EF742A2 COLORINGS
438,353,211 *2C693C38F0090DBF8306DBCB4920956E85EC14BE NEL.DE.CERRO.DE.BERROY
438,353,212 *2C6BF25EEF9287CECD129CA4CFC95E89961551E0 NELEBRABANDER
438,353,213 *2C6287024120199A3DF9EE20839A3DAA3468AE96 NELLIE1998
438,353,214 *2C66C4C06C9FB8870F77E018E1D3ADD4E1A8A56E NETTIUNSING
438,353,215 *2C6500B8D38047AB849F9CC35B9601F5861F32FB (never.ever.seen.a).war.film
438,353,216 *2C6ED0E372A0AF8256EB77A7CB01E3710B316D93 PERSONAJES DE DRAGON BALL EXCLUSIVOS DEL ANIME
438,353,217 *2C6140912D82F83CB9CD63035C96FAFCD6A0E8AC CONQUEST-HEIR'S
438,353,218 *2C6DE972B7BD02A392893F15140D285FE9E3F468 PERUNTUKKANLAH
438,353,219 *2C6A219D18B6BA926101FAC3ECE5A38D6537F324 CONWAY-'K/A/NW/EI/
438,353,220 *2C6403E1392D99D260B3AFC68AFC1D0589A23538 [email protected]
438,353,221 *2C6E5801AB57EBD499188CCF5B1B7B8B794A0D92 COOLRANEYCOCO
438,353,222 *2C66FC0B04F414BDBE2EE85C1BF1281DE9D510B2 nickchammas
438,353,223 *2C690B2D484CA8F1E09AAF51F979BE34358ACD8F CORNELIUSFARGUHARSON
438,353,224 *2C64FDF5938BA7A5A6A780B332A2A6AD8A87A80A philipcholewa
438,353,225 *2C6EB6D4002C86C308BBBCD42C63E9E2B955476E nigeria-arts
438,353,226 *2C6F109FD78FDC127D646FCA74400E2ABA7CE2D9 [email protected]
438,353,227 *2C6DE6CC81B89A906E8B5BD615A76429770596DB NINI.CHXAIDZE
438,353,228 *2C63C2F843FD0439F7BEF4A00FCFA9BBDA6E19AE COTH;
438,353,229 *2C662A0FE8A7A9E64995F6E32F3099EF01171184 CPDGQ
438,353,230 *2C6498BDFE53CDCD95B4E0CE038384B5F1BEBE96 pJB
438,353,231 *2C6A638112E80A48E02D96A2D8914A00B55ADBB1 poisage1
438,353,232 *2C6272A6CB4D0A91F35AD21A8F064C70C860BD69 Pompandcircumstancemarchesop39,No4inGmajor
438,353,233 *2C69C88A3C5905F50487636B9485CE55A966F5A8 crystal-burchett
438,353,234 *2C65ACA1FB13BFD1B827D42A6EE365F76B2BACCE obradas9
438,353,235 *2C6AA664CD554CAEBA2FAA9D7C9F47C3F15ACA61 CULURES0
438,353,236 *2C60EF6A8AF3F098C52DE0C49301775923FE810A curtiscardinal
438,353,237 *2C6C306DCFCAC85DA1A7D325D7CF60D0A7653452 (o_-)[email protected]==p
438,353,238 *2C67D47819AD93040A2A8D39A273EABCA3F6F5D4 )o( ~q##3
438,353,239 *2C615A3314DA8CB9446AFD6B8B33C25090ACD400 oscartise
438,353,240 *2C63AB07DD8E6CBC1EA21FB7C2F8D8C87D116567 CYUGB
438,353,241 *2C68737A51BA30F14D7E18FE5AD0410C4C3033E9 D1AMONDZMAN
438,353,242 *2C64C0F785741BDACD643E6DAE3D898BF1A98B1E QF3Q
438,353,243 *2C6AF85145AF962E3CC1A743678647DE26A98261 [email protected]
438,353,244 *2C6BCA3289204612F4BA1DEE39170FDFEBE2901F [email protected]`~.(O_-)
438,353,245 *2C60ABD83FAF673E0FE78C59890B041B57B8BA8F QOSTANAY3
438,353,246 *2C65A969A4BC615AAB1029F9153CBBECA531DAEA [email protected]~O(X)
438,353,247 *2C62A441AC374159A33EE6294A59AA3CBA259694 D4PZ9
438,353,248 *2C6EB3CABBBA67343150261F1641223B26751438 p3j13$
438,353,249 *2C6DE667A900BA4FC382B4990B74F80F38AB105D DA5DQ
438,353,250 *2C62A2823E8D4478A3A16B387CA960D8713F53ED dabdendabden
438,353,251 *2C6D12CE21B974D4D7AD24C43E3A69C8E5F4DF33 PAINOLASTIKIVET
438,353,252 *2C6EF9D8FB3AB2FBFDCEB83BA725E67C4C216F6E PALOCZN6
438,353,253 *2C6198A802CBDE2FA9FD92B9CC994E5718C10BF4 dancing-at-the-temple-gate
438,353,254 *2C6A56B2DD7F23A05EF7A4A4B657FB8464051F04 RALPH.TAVERNIA
438,353,255 *2C6B8BC235F407F79D53F6C3A9960F6EE1D3FA90 danteluzar
438,353,256 *2C68D6202A08EFB64ED828F76153EDAA03A4B8C7 RAMIRO.KOBARA
438,353,257 *2C6A79564D32F25111EE5BD03107568F64DF7D8D rammtet3
438,353,258 *2C6C110237FCD51BCC3B1A456C58DCB04CB9BF39 PASJANSA7
438,353,259 *2C6359FDC0525366F5A53C01F7301D1442ADDF85 [email protected]
438,353,260 *2C620332E3E216EE9AC5ACCACA37BEEFA44D6989 DARLENE-COVINGTON
438,353,261 *2C675E0DE42E9049CC8A46FB40BF6E70F5FF969D PATRICKAHSUE
438,353,262 *2C64415E27306E190AE42774A8FFB3D10BF89FA5 darrellgjerde
438,353,263 *2C6C1502E520FEF87BD51FA31AE3EDE014A9AB5E PAULALLISON
438,353,264 *2C6F1A3545446F90433103C0FDED8A59EF8904A1 [email protected]
438,353,265 *2C6B5DE4D3BAC64FABF535E129EE133F05351494 d+b-0
438,353,266 *2C62B241119B390607D24156AC937DBF61125B3D [email protected]
438,353,267 *2C6A0ECF3CB81EF8F1BF7C7BB32B4BACACAA07A4 PEEWEEVISA
438,353,268 *2C67FD1F4DE0D4ABA1DC901D099896FCBAA51E2E PEREMP70RNE55
438,353,269 *2C624A56014C6425934310FEDC5F21D8DC1CEC1E dd$9a
438,353,270 *2C6D3C1980431172C1C85D45D2CE863376F84906 ddiir
438,353,271 *2C6BD27B7F265BC9027702B6BBC9FB6D4EB24C6B peterfleet
438,353,272 *2C69FA4D5F76BE5D600D8D251D75F278250645D0 PHENOLRED
438,353,273 *2C6C1D0258A9B588AADFCAE99F97C793F04F6CA2 renqueen9
438,353,274 *2C69E5CE6A2EC6BE526E4021982F958DC360AE23 DELETE'-PER-NOM.--[[USER:CATO|CATO]]-10:49,-29-JUNE-2007-(UTC)
438,353,275 *2C615880AF1DC71721FDB85B2473801F24E0E0E1 researchcamping
438,353,276 *2C671875EBBFA2A60A17AE2B943B6A1CD92F0B9E Piano.Sonata.No..23.in.F.minor,.Op..57."Appassionata"
438,353,277 *2C65C7C4B2C1C005C88F6C5EBBAD1768A8B9B91F retiredness.
438,353,278 *2C612F503D72F8CD25DD8E959915435538B8594B DEMARCUS.BENDER
438,353,279 *2C6B0169A3277E8E2CE215946592E740536C1E94 denisgollehon
438,353,280 *2C62D6B49B8F9404CA14D76ADE97641BE58C787B denvermullikin
438,353,281 *2C6AB1B43D5AA4DC382BD476AF682BFB0F491576 DENVERSELWAY
438,353,282 *2C61BE51C373826CD087DE84A43D51D3E1F48D4D PINWHEELS8
438,353,283 *2C6C1768A1AB5A04D26AFCD895FB0312FB7FBB33 RHABILLO8
438,353,284 *2C6CCA2FE3A1D0534F079C6BE91CD1BC0345014E RIAMARGOREALLIB
438,353,285 *2C6AC97FC11BB5FE83EB9CA3B761217A006663F3 [email protected]
438,353,286 *2C604D92EDC02D0C29EE2C76CF558FA07917ED82 RICHTERTHÄTIGKEIT
438,353,287 *2C6CE3D7209C4B5A9854D36B31A74EAB82AF4C4A [email protected]
438,353,288 *2C67FC5AD6E263FBF7EEA6AF2182AD404D9E362F RICKY.MILLETT
438,353,289 *2C6201B25EC704B410DA874E103383E2D0A815E4 righthereinmyarms(live)
438,353,290 *2C6661A0F1833CFF5A09BD166D51C60B99759C1B RIMASAJULAS
438,353,291 *2C61F4D34CB571A3350A5755CC5DCD6689805552 RINLAUSUNTOED
438,353,292 *2C6603B543A6A1E11A14315BDAD0AA7041BECFEC P---)~O ~O >-<
438,353,293 *2C6430F0406680CA83880B47E41A0D0E7DE25F03 DGJCLAIRE3
438,353,294 *2C6C6A95C9A3A70958AE724E16F28F98A1C6A01C RL;Z
438,353,295 *2C6BCD17B3C7F1257D834BD1DF1FE8A3F390C14A Di"
438,353,296 *2C689C2B2149E8D18AAF547B345793F50A0AAD09 dialyses
438,353,297 *2C6E817C2A35AF1F3A4357FC068C62844020BCD3 pp`~`~}x{
438,353,298 *2C604F8F51096E417BDB3B931C7CA365992F53C6 [email protected]
438,353,299 *2C67BA1562A2DBB06F53A9CFC8AE8658250F7309 “RÖMER
438,353,300 *2C611B13FC99A9751A5CC38190304B4ECFE5E637 ROMMELLACANIENTA
438,353,301 *2C6011524FB6F2F755B6CE547774A75974493C3C PRAAPSYED
438,353,302 *2C6C3770FA99C28635618257A5700B3964F3BEBD precolluding1
438,353,303 *2C6BD36D5D831A515BC887843EA57B1260F4A944 dinlu
438,353,304 *2C67451B13F4C6BCBD10518B3897AD8050AD0986 ROSENDO.DORFMAN
438,353,305 *2C658ACD7A8F4428CDBE6739EEB18B56C7BF6E12 DIOSA.DE.LA.SABIDUR
438,353,306 *2C6C8C2F2967B49A06D154BBC1AB6CD799644403 roundbyroundupdatesofficialresultsandtonightswinners
438,353,307 *2C63682952549EF4C5F9A7296DE69324FE88F7B8 ROY.MALMQUIST
438,353,308 *2C6BAB0E529E4E319601EEFD9B62A07EE2BA5AB9 DISPLAYINFO
438,353,309 *2C6F2D59815DB548200F316E9BE6573E979FD3B4 rsten.reitermarsch
438,353,310 *2C6061DDBA2516936B187B4296E903A4CB1A5FBC RUDOLPH.SOULLIERE
438,353,311 *2C64FB88C2AF44F9964DA50434FF2B43A05D30D6 RUDYLESSO
438,353,312 *2C63367D6A1BA8C74EAB2066BA5E2C53343E9A67 D?K(O
438,353,313 *2C6B8159D4E295C2114E38BCDA97C4BA07583E3F RUSSELL.UTZINGER
438,353,314 *2C64552DCFBC8B86F9A1843936FD5266BED35E5D DLICHEPFEIL
438,353,315 *2C6C0CA68E732461ED237CD843C362C9BCDD016D dlvun
438,353,316 *2C6FE0898DBC286E04F438F6096318AF5D68CB7D dniheb
438,353,317 *2C615A49093BDA2B3B178628567EEE6DC01072AD SALLYGIANTSED
438,353,318 *2C63953B4C36FB80033410C17C54D53182A33811 Doc
438,353,319 *2C66181D11234F47E43ECE1DAB33E81CE1AE8ECF [email protected]
438,353,320 *2C6C3A03EB2FEFD05CD6998D8C7846812D1A595B domb/
438,353,321 *2C69DA606C8D44949097AB5B37E9DE9D97B3790A DOMINGOGHAZIANI
438,353,322 *2C62EE795763E089DED5F56AE67FD2AC28433105 sampraapte
438,353,323 *2C6D7AD35876789EEADD87B2BB314F38D64AF2E1 SAR HENR
438,353,324 *2C6DF62C72CA6C8CBFC883BA9236890CB3E518A4 SAUGATA.DASTIDER
438,353,325 *2C68E8AA05D6CF2FFC3F10C7829902586817E2F6 saulrulon
438,353,326 *2C6FBF98AF0C9A2CF330C1FF8A5660E5EAC7E39F DOUGLASS.ANGLEMYER
438,353,327 *2C63980375CF75A88F42DADC8D87859394BE924B r3almd3$
438,353,328 *2C622393F6C8C18171DFBDC719E900B01391F015 doy%"
438,353,329 *2C6E263290E0F5AD5B157C515BD8B9BBC5BD77A1 [email protected]
438,353,330 *2C6FB4476ABA5FDD7E13801D58EDD668C4668A3B SCADBURRY
438,353,331 *2C64BEEA8AC85451E2F0B49E48B171A00DD96E00 RAAVI.DHILLON
438,353,332 *2C6A9FB809592C51FF08788741F6D2E1B3B8BD6C RACINGCOKE
438,353,333 *2C6BB1761162799B9E2838C34038A6B34A24645D SCHULLERINTLBSW
438,353,334 *2C6339E89638289792213FB45C4D8E5B57AECC9B scr1p+1n9
438,353,335 *2C69E601317A4163777828418F0B558D84610BBE SEBASTIAN.MONZON
438,353,336 *2C6CAF37D474D240488D1449B7C2FB37E0BB2F45 raymondpomella
438,353,337 *2C62FA1D76630D00BE55B9FB56BCC1EFD63DC95F RAYMUNDO.KRASOVEC
438,353,338 *2C629922F706A6E6EF07B604D527255ED9595E8D SEDROXE
438,353,339 *2C6B07027AEA845B7CBA753C6C2B79AFF1AEEF30 drizztmonday
438,353,340 *2C69C0E34A1EF374D27727D0CDE066343357D5A5 DS4J+
438,353,341 *2C63319CE3036EA566F4CD5979CD2C3247F17369 ds5e
438,353,342 *2C6A784D836B18386290215141752544D6908A11 r.dich
438,353,343 *2C69B0AB83D87337717D4574332D1D285516BC8C DUANEUNGLESBEE
438,353,344 *2C6B4AFD70DDACE8DEF8FCF69BFB2046AF9A9A21 DUBBEDE7
438,353,345 *2C6E7091744ECB69FBD804242F6389A1C0846917 recarono
438,353,346 *2C6305C06251E6CCD9DF4FB8343E9B1A376D76B9 REDEXPLORER8
438,353,347 *2C65312C5DBA972D3595D59E4964D821F12BC6F4 Red,.White.and.Bluegrass
438,353,348 *2C61228A8CEEFF301FEFBBB96AFD12C2CD1F1B90 reeferwheels
438,353,349 *2C68902B16473691D7893E9323C3517A13E4B624 RENATA
438,353,350 *2C6AA94340869575F2ACC991132569B5C09CD22C dwy+,
438,353,351 *2C6568BB03E7B92DB0F3D4015241A8C375498CBB reniiez5
438,353,352 *2C630F50EEF90A9561C2F140BD9A9180EB967571 dy7p5
438,353,353 *2C644A11F246C28C505285B3A58EE44BDF6B9466 SHON.CALLNAN
438,353,354 *2C6FA96B00C38BA99C026602DE20392D2A9DE817 REREDRO2
438,353,355 *2C6A094A5761204A8D774475F633510E15837168 DYSAVOK5
438,353,356 *2C6A3F635C4AE79AE36E092876AA09917B00FCA7 REÜNISTENORGANISATIE
438,353,357 *2C6CF665E4AE5D49C418C83773F750A476FAD233 RG2570Z
438,353,358 *2C692667BB39716DC103E3614E2648C89CC6F877 EAUT:
438,353,359 *2C69DAFC191C411CF586BD5488DDC1D8EBF8B642 SINGLEGENERA4
438,353,360 *2C65C0C86272A2FB11E64BA55D8DE07D80A49B5F RIIKENE
438,353,361 *2C6C87C2E049F15F852035E79963F62DA46D579B SIWUSCHOW
438,353,362 *2C6F067ACE29DD15A32A8500FD08D322923F9F43 RJABONETA
438,353,363 *2C6C71633693459FC27F27BDFB5B804DA997DC15 RJWARREN
438,353,364 *2C652D2CC1F1C2D76054C0950261DBBCBF095D87 ROBERT KLEINER
438,353,365 *2C6062E698A0EE5CCCD95D828140F9E86930669D ROCCO.GAIBLER
438,353,366 *2C644E4D1AEC431890510511C7B62B2099493FED ROCKY.WININGER
438,353,367 *2C6A22F06C006B519489159C45B70E3CB7A76750 RODOLFOFLISTER
438,353,368 *2C66B4C4C0781A5F2E139F4AAD014C38BC7CF1EE rolfplatt
438,353,369 *2C66DAB5996FACB5655325850D5BCE5045ECFDCD ROMANCE-2
438,353,370 *2C60B9714378DDE51135ED559B5F84B88DC5B29F romangutowski
438,353,371 *2C6E568DBDF57116E80859AF430FE65513520E60 ROMANKOCH
438,353,372 *2C6A2D2CDAA9B2FB39A8576107617C898C27F990 ROTOLARE7
438,353,373 *2C6E4F7695AE1A76E141CA9129E265367E5D30FC edwardopecina
438,353,374 *2C6A9B042D16622DA9C80286582B558673A30068 EENNOEGR6
438,353,375 *2C68ED4FAB714A2FFE0A1C909A2B45879A1C3218 rpeovrac
438,353,376 *2C67BBCDC83BB4E8A38C4DFDE1AFE061691A422D RSTRCTV8
438,353,377 *2C67591FE092209AF9DF893D2CE767E17DE8C13B EHCTAHNU6
438,353,378 *2C6BB93BDDCD27FFE3F7B8220DA28C5BA4450F01 eilisess
438,353,379 *2C6889B73D21687CF4015E260BE872CB08BC224F EJENNAR
438,353,380 *2C63BA252413604EA158EE2017FEC1CFFBD8BE6F RUSSELL.TACKET
438,353,381 *2C6BD7BAB5EA911003D23CA4A6BDE15B06F28942 ejpganiw
438,353,382 *2C6CB755060678FE6126D1526D3CCD2131058B75 ELBAKR
438,353,383 *2C62C2564321773A4C16E1199FB2DC01CC803799 socialised6
438,353,384 *2C6243177FFF03A0C77DE19627DA3DC6E6D01592 ELISEO.SEWELL
438,353,385 *2C6CD1D44F223D8124134BF1824B1BDDA3BDED17 ELISEOYENNEY
438,353,386 *2C6844B5F843C4934413B023B9C51BA9582AC757 ELIZABETH512
438,353,387 *2C624E36B6D741733F588EAF65EAEEC9859E6B40 elliotfinely
438,353,388 *2C642C307825D97117379B2D47147362DBBDBB5F elliottmarbus
438,353,389 *2C665765E8E5FF2FAFD78E82A7C1AFF565C2C78F saenfting
438,353,390 *2C60A0BBDC6366E10B8F07289C08302A5048E163 ELMERTON
438,353,391 *2C674A21FE7AC11B993DA0C9DFDDEB0199CB4D6E SALVADORVALVANO
438,353,392 *2C6E80DB7F09E736877AC633E658471E522AFA5E SOPHIECAROLE8
438,353,393 *2C6CBAF64826AC268E1CCE08F4F7BB186AA6058C soundbwoyburreill
438,353,394 *2C682D7F1C489CFEFEF05A362EB8884687FDF492 SOVEREIGNIZED.
438,353,395 *2C659151092013A7C4AF3718B651335AC1D860DC SANDY.BRAZEAU
438,353,396 *2C6582756B223B20CE23EAED0FEE47BFEAE2FC2C SANTIAGO-DE-CUBAIM
438,353,397 *2C65BC37C433D62F69636605FDFC27CFEBB31586 santiagozarycki
438,353,398 *2C6551217D4BD16994BA3E20F73AF098099B59F4 SAUERLANDWALTZ
438,353,399 *2C6717E416B91C6DB7CE8B1E6715CF23F9EED6F0 schaltanlagen
438,353,400 *2C6E18C1148782751F81F5C646B844526F10717B splat!.~`@8
438,353,401 *2C6767E2F95DC8FB888FEB3B5145318D41B2A899 SCOOTERISLAND8
438,353,402 *2C6D9789E99CE35B2F0E9D7DFC9B3E210E839C40 engloutissez3
438,353,403 *2C6E29F39450A200DBD2469BCC07E871EA2B4A36 enriquemortier
438,353,404 *2C62BB1A0E4FEA1D2E1FBA45C22DEC46B473B554 ENRIQUE.SCHUMM
438,353,405 *2C66814A2475E3E90003144DCD456DC325E94F4F ENWINGLY7
438,353,406 *2C69C16991BA0AF0137FF22BFA0467B4535D59C7 EOCE-
438,353,407 *2C686F1DFE7E591A5A281EA53F63D38C7B9958E6 EP1SC0P4LLY
438,353,408 *2C6E3DB42498F261E973075410BEC4D13D92FD9B ernj.
438,353,409 *2C635641EC2672AE7F1AF51BA13B878D873A39A6 SRQ~
438,353,410 *2C6361CF243F0061742DE46D77B23291235A45DE STACKYOURGUNS
438,353,411 *2C61E732651FF78E764A1EAB3AA712D91F52379C esueteruf6
438,353,412 *2C6625FFDACB023F263D00DF4DF839176E187F18 SFATTASFATTING
438,353,413 *2C683A5FCD7B904EF5893482DF48738F60031EF6 steelii
438,353,414 *2C647642625313580439B28F4A50B43B9DC7DC9E shadparas
438,353,415 *2C60823606C3819B84DF56B2766E8D283A2A6E18 SHANEASATO
438,353,416 *2C63CF1281C2BB0620462C9E91A180012C1579DE STEVENKAREN
438,353,417 *2C6E2A1B57642D9C9EBEFBE64AE9AFA3A5E5A5D7 Evangeline.(feat..The.Del.McCoury.Band)
438,353,418 *2C616304F7FF1743E38ADB69D96C4BF1AE45CC3F SHAYNE.VANLEUVAN
438,353,419 *2C6D85FA01FEE97493382B38C1A3986FC2714CBC SHELBYBARNES
438,353,420 *2C6F92912F389D8118F97D251869CCE2D403D552 EXPLOSION-4---LARGE,-SHARP-CRACK-WITH-FALLING-DEBRIS
438,353,421 *2C636000562CDF900B887889B38933B315639973 STRIBOPOULOSJ
438,353,422 *2C6542988D548D8E19F7230EFF005D39800044DD STRUCTED0
438,353,423 *2C67A12C8B92CAADF98DF50E42E347604D3A03A9 ezekielmoschetto
438,353,424 *2C616102E4A9E34CAEA0ACF2DF1AC2901BE1D79B STTZENDE1
438,353,425 *2C65D964D7C1652EF0AF7E0BF09FDB5EAD5FD715 ezrajaffy
438,353,426 *2C68B69304606A1F1665E695247066ED24548FCF [email protected]
438,353,427 *2C6B53365F243DDF5470FE308072E18294FEE1AA SIFISOMAJOLA
438,353,428 *2C677E2114229A8E286DAA5691559613482529AD SIHARAIZ5
438,353,429 *2C62F16FB05B0DC8C92C956487C2AC579C2D0439 SUDLANDERIN9
438,353,430 *2C6A79E755801DF1EFF2AB0D5D9EC9CB3EDD712E F75CE812
438,353,431 *2C6A6E2A225FBB447F582452EFD6BCEC96122527 suite-bergamasque:-i-pr
438,353,432 *2C68F323009EDE30435A237BD2410ECCD4B65BA4 farbstein
438,353,433 *2C601A6F0F20612B9C825C4B21A434B4950F7A71 SUOREFINITALEG0
438,353,434 *2C68BBC4349A912A7EEED55967800A853A6B5F76 SKATERELEPHANT6
438,353,435 *2C667FE82AF1B31F41773444F0593152979B6DF4 SUPERCONDUCTOR.VOLTAGE.COM
438,353,436 *2C6CF5D20E472244850B7EFFA7FA98E281EBD792 SKLADKÝMI
438,353,437 *2C6D899217CFDBA80C57538E2D2AE9C043E877F7 SUPRASALLY3
438,353,438 *2C610DB9455684941DEE305D2D6B91A893CAEDCE skotophobique(featantigenshift)
438,353,439 *2C63B5F1BE8B0440D621B2EEB6C4512CDCEB550B FEAR-OF-FLYING-(DISC-1)
438,353,440 *2C60F7F8832F0498A614793A5238FE56BC21D375 federicolutkins
438,353,441 *2C61A1802B35FD7EA3234F8B79867306C7FA255E FELIX.DELAPENA
438,353,442 *2C6C4BC70B4E2195B56E2F23769DA0E44E69B589 [email protected]
438,353,443 *2C66F35A68DD36E2381BAC7C99C60C6B2BA7BA40 SUVIAAMUNA9
438,353,444 *2C6E7A6BAEFB63D3BA9D9D9F38A22BCEE2C9163B SUYASUYA
438,353,445 *2C627842202CAF5A798B79A0272FDCC84DF114ED SylvanianFamilies
438,353,446 *2C67CE2A46D4E717001D6332FF3BB63B570EA16A FINANCE-BASED
438,353,447 *2C61459A70A07152666DA317642701FFC84E6DF2 FISHERB2
438,353,448 *2C691EED32623D924CBDDFD4448911452EB6CEAF fletchen123
438,353,449 *2C63DF1B06F7709A338C91AB60800AFE30D8BB50 SOU1R3ND
438,353,450 *2C67EE931332C78CD64D2C51896355A40487F1EB TABIGEIN7
438,353,451 *2C6E2761A0494DA9249A40FD16C7116C3B223E38 FLY-ME-TO-THE-MOON-(AKA-IN-OTHER-WORDS)
438,353,452 *2C6E63AF4AD613187BED8C9FC2E86C639333A90A SPACE23
438,353,453 *2C6A8DA5004EBC32695FC28D354E487E68BFB817 FOREST.PARLIER
438,353,454 *2C65D13E08345F024896854CC074704D5776F9FD SPANKYSTINKY.
438,353,455 *2C624E963981AF3CF5BACF889EFC906F244ECD22 SPARKEY11
438,353,456 *2C6F85674C5E08EFB954FC27302FED5352E76AE6 spermatozoio2
438,353,457 *2C6B2F300EA8C75314FAD72776FC67C5AB86C8CB SPIAZZARTI
438,353,458 *2C643750841EB69A641A7C4F6A3C572AEF101069 TAMMYHELL3
438,353,459 *2C643D248FCFA13769A4B570B0D742D0B0BA126C TANNERCRAMBLIT
438,353,460 *2C621316667E94D151E7AE2C988300F3EDA0B170 tapaldroa
438,353,461 *2C6CEBF1195A8A765EBAE827763674B973674429 FRANKLIN.PROSPAL
438,353,462 *2C6C88A34BC3B808E7593D25A1FA6D816E4EE152 FREDDYLAWING
438,353,463 *2C6A55FCE0693DE40387643BAC4FA2DC07C88A3C fredericbrooks
438,353,464 *2C6D8F560D02544AC98E7D4DF0DA08F38E520EF7 fredrick-nixon
438,353,465 *2C6A388E781233451D57FB0E1D6689D37E1737CB [email protected]
438,353,466 *2C6464FEC47626C708DF40FD1E1FF44876D8EAE3 f(]s
438,353,467 *2C6AFC2CA03CAE397A0B2075D0D4EE7F979896C1 TELEMAQUE97
438,353,468 *2C601925E23ABC4C4D0AB77FC8EDF71F8801B786 FUTATESAKI2
438,353,469 *2C663968971CCBA92D1A1D37CAD90FFBE1D26778 stadskarna
438,353,470 *2C61B86549E9393AF29D27FDC67C09E0C7F76760 GAILWEISSENBACH
438,353,471 *2C6A9D3E9B6411D7B19E3C34A06E84FF5AA24376 STANGROSJEAN
438,353,472 *2C6ECFA4C26CD7B180F0E78AC9CF303610367FFF GALEEDWARDS
438,353,473 *2C68A66C4B0656F683FD5E5AB6AD984408B372EC TETSAKRED
438,353,474 *2C65DA2C2375147C92A26291065F2F0C881D2F0D [email protected]
438,353,475 *2C612F62352C7658B6FD1A9814E372F0D01D5E11 STATIONTALKDETLING
438,353,476 *2C62E1CB29AE33C064B955D73394B7395B87070F [email protected]
438,353,477 *2C64A38D952CCA987A8A8389BA9574064674F716 THATHUNTER68
438,353,478 *2C60DD5F4D5E537F867158ED9E8B5CB3F704A008 THATSTRETCH40
438,353,479 *2C670B741D1549266B3CF18B002A99FCD5A2F3A0 THECATNIP26
438,353,480 *2C61AC04B24DB4159C1E56C450062306F4516959 GARTHSWEIGERT
438,353,481 *2C602B034C2E2D85B8D9126FEC8A6EC594FD9EDF the.hope.in.your.eyes
438,353,482 *2C6D80C1D6351CD048D1CCD63EDAFE7F476C96A6 THE-LIGHTNESS-OF-BEING
438,353,483 *2C6042B9C8EA2B9FD44134506784A4A9CDBCD523 [email protected]
438,353,484 *2C6060D2810F1C5287AA3327C79E2A6953AE3320 gbqlastword
438,353,485 *2C6F9DC1F498FC0AD6AE06C7C1B46C067E6AF69D GENAROBIGWOOD
438,353,486 *2C6DE578CF8E549022998CE6C77C4BCF7DE41093 STXC
438,353,487 *2C663113E200BCACF544A1B14AB7F2D0D7A1A8A9 GENARO.WITBECK
438,353,488 *2C6501C38B9B8269404133EDFA5FBC035A0F1419 [email protected]
438,353,489 *2C60FA77E14624A5F5272CB19E0FD0D985528DA9 [email protected]
438,353,490 *2C6C51418964BEA8B112BC32E12E77A8F313D36C SUBURBAINS1
438,353,491 *2C6F45D28C081A988A23149D683978C775AC6D56 TheShowIsOverX
438,353,492 *2C60C752C4F53D53173E338B14AF6FBB4C236781 THE ULTIMATE OTIS REDDING
438,353,493 *2C6E6CD72B57E30B31B8AB8188E4C7E62D6EB1F3 GILOPRHEMED
438,353,494 *2C69C782B25CE13F05CB8A7482FE2A241A4EF422 SUNYANATOMYLABS
438,353,495 *2C65AE3F75671E9FE76667252DF7D422FD718336 TILHOLDSSTEDET9
438,353,496 *2C69CB6E821EBB42DB64B843142F67A4DE81C1A7 surendra.upadhyay
438,353,497 *2C6E1B15506A4F7C7C7BF5989069C6D557256CA2 swimmeraaa
438,353,498 *2C6C02797E0C366A9BE082CB7A968429B6D5B3E6 glennflorido
438,353,499 *2C642727D30A6FCEECE218845CE406B9959BF0DF gmony
438,353,500 *2C6B0C435126DCDC9E63B4647813138432510D6E /SYS/DEVICES/PCI0000:00/0000:00:06.0/USB2/21/BNUMINTERFACES
438,353,501 *2C6C8836F25EB1A76FDF586007DD9A319A10886D SZÁMŰZÉSÜK
438,353,502 *2C6ECF3DE350D58713C6F483C3C540EE81AB0756 GODINNETJE.
438,353,503 *2C605A048E3E9979102D3F1BAE6A17ED0BCF7149 TODAY.I
438,353,504 *2C6C7B8A95542E701072CEFFB3C6DB7CD6DAF78B TABITHA BLANTON
438,353,505 *2C6EE39063E387917FBB411154F0BBE77B861D42 TOM-GOES-TO-HILO
438,353,506 *2C6A02DB09297CECEAE628C40DE03BD766E048CF tommyabcde
438,353,507 *2C6F5AE7FFAF4A50AD80C1B63AC9F6C4B41AD72C tamanya4
438,353,508 *2C6E08B757B1807B48DBA1CBF670D0236D1DF8DC TORIJAOF.
438,353,509 *2C6B71DDACE0B1F75F260DCAD4F2D91A64D4D3ED grndgndm6
438,353,510 *2C621EFFC34616F6938447E800765ED1DFBFAF4C TRAFICASEN8
438,353,511 *2C6A5A9453D1D026C1394C3B35486ECFE5DFD1DC GTXT
438,353,512 *2C6CC494EA5458097A14A441C3A9427627E39195 tramontai4
438,353,513 *2C6567DA49B5793C1C66A92E1C6037815154D459 TENNEYC1
438,353,514 *2C6AAEEF9243A38C5F383A8CF51BA344590B15CD GURGOYLE1234
438,353,515 *2C6B5AD7E7DBC41D673CD536A0C02615D3B6A8CE [email protected]
438,353,516 *2C60D42E21713C79082450A80DBA256158F66707 GURREDAM
438,353,517 *2C634DAB9B0DB43673E02129645318D6CAAB1512 guymonn3
438,353,518 *2C6E591053C4A19A47A6033472A2EDABB7B1B772 GY|
438,353,519 *2C68DB021C6CDD47127696B0F960CC8E6A8E281A G+ZK
438,353,520 *2C64BAF5510C2AEAAAA506C90C6317CE5BE7E92C HANGUANGY
438,353,521 *2C6D80828BD5E6F751D08D30B2B2CD9CFE217D08 theodorehearst
438,353,522 *2C6531BB67FC4F5B25AD7F0B95270ED4550E20EF THEO.NIESPOREK
438,353,523 *2C6AAF78A741875BDE29842BF21476F22BB2E9D1 [email protected]
438,353,524 *2C6AD86A5AC2A313C2D235C9AED4BB7A34511FB4 THERESA.WALLACE
438,353,525 *2C6DE52E908C2FDD2C705F5717B603F8CEAE1A0F THERE'S-TOO-MUCH-SOUL-ON-YOUR-MIX-TAPE!
438,353,526 *2C6E65BEE1AC0C7379698075F961119E4CEB423A thetiffany666
438,353,527 *2C6E0D14D6C0A7643E2D049BCF5F13F52F6F9652 thissortanyway
438,353,528 *2C66FA43C6B6D0A58A97E3BBC35658BF4FDE2DC8 HASSAN.STUDT
438,353,529 *2C6DC15845180E881DC3D133581157C3484B4300 HAVEEBSW
438,353,530 *2C67EF436912D9DDD5303CDAC565CE13027BF38A TWANNETT-PIGFORD
438,353,531 *2C6123C56B73C2528F6284D29582F867DACE9D7A twdt
438,353,532 *2C64B3CAC02E1961D9B8ADFBF819BAACF5774786 [email protected]
438,353,533 *2C6A0CB5412F547AB552FC8697B3E4BEE8801A68 HCTONPOTED
438,353,534 *2C62C746797C8721706B6E03CF74DAA0E3528614 TWS"
438,353,535 *2C6E879F4A483DCFF41A7201B745F2E37759E1D8 hectorfode
438,353,536 *2C602AA9946B457D57B4F0B782BC788AEB87E135 tnorops9
438,353,537 *2C6AAD3A29BF70F84C39AF7FA2BDFCB1B1DC32B5 HEMODIAS8
438,353,538 *2C64FB684535679A54D9AC1BE34333EF7393ABD8 HERB.MONGELLI
438,353,539 *2C6F40920A01E31076FF301D9C55858462206F83 UBELGELAUNTE8
438,353,540 *2C6E560024139B99E7F241633F6B2CE3EE15A4C6 TOM.YACAVONE
438,353,541 *2C67A0DD1D3EC6B685D10F852C6F23B3B0DBB1CE tooth$h3
438,353,542 *2C622FF6AE4EC368F8960331CA5394AFBE517975 UE7J
438,353,543 *2C6ECBCBEDF394CB51754A1D66E85346635FC677 tr#>
438,353,544 *2C6440AA6193A75D52ADD97F7340215453BFAFD5 ULTHIMU
438,353,545 *2C6897CF635290E132B2CCA498E1B0C3AEAD9F66 HIRAMLANDMANN
438,353,546 *2C6619D60FD336D943F4884A30BC78764853E676 trampo1!n!$t$
438,353,547 *2C64442A1B75B71AF2881558EBB83B0E6F279711 UND3MOCR4TC411Y
438,353,548 *2C6E3C45007197FB3F935856EB24C3EE6BF55FDB unstainedly3
438,353,549 *2C6E0013B8D47E4AE79B0E5F64AE5DF1BB6157E9 [email protected]
438,353,550 *2C6DD06E15A7526EFC18DB4F72CBFAF7F97F1F5B TRINA CHIANG
438,353,551 *2C6855B3ED5BC243C029A8C3CA5F2D7919B5EEE1 TRISHAHAYEN
438,353,552 *2C68741BBBD8FCE727B6A184B3B0413AD8395AD7 U#PQ
438,353,553 *2C6E95192D1DE2672758E65DD4DB98A24E068E7D URIKHO CRUZ
438,353,554 *2C6561F2872BFF2DBF9A23EB3F63FC241201C4A9 houstontaylar
438,353,555 *2C6BDE0DA53FA1F1ABCF7F66D1625F542CED3A85 Trompic
438,353,556 *2C6D5808D462A9F8C757772A5D464419EBCBF5D5 [email protected]
438,353,557 *2C632736CC864D4902DBFFACF1088E540FBB38F8 USER172.148.22.121
438,353,558 *2C65121262EA9C93B0C5E9EC565F625EF60D9098 truppmannanwärter
438,353,559 *2C6BDF7F874760CA2CC666AEDF1F832F0C1D1462 TRYMMNCG
438,353,560 *2C6D1D599CD713C0E22C870E2B78DCAE82E48E46 [email protected]
438,353,561 *2C602B6C0BC0CFE924E7AC69B7B7A74C9472DAED /USR/SRC/LINUXHEADERS263224/ARCH/CRIS/INCLUDE/ARCHV32/MACHA3/MACH/HWREGS/IOP/IOP_SAP_OUT_DEFSH
438,353,562 *2C6AB1AB496F0488A112AA59562FECA6A83EBB81 [email protected]
438,353,563 *2C65DE713C5129B74E894065DB74B202583FFC0E utakersten
438,353,564 *2C68D0B67E926D99E342DE0BB61E33D3476398FF HTTPWWWTHECORVETTES
438,353,565 *2C6F9F530E25988BE4DCD65323A4B70D7FD5006A httpwww.westernferr
438,353,566 *2C699007378604824021EEB3770125C84F5E773A htyyioued
438,353,567 *2C60EB217325132F62082BCC4448E645E9503834 <TT>Foo</TT>iSGReaTeR,So<TT>Foo</TT>BeCoMeSTHeNeWTHiRD
438,353,568 *2C6829DE495104B5916EB99D1D8B8CC0E211835E UWRLIVECD-002
438,353,569 *2C6FB06582E9988A2A57717D8FDA1467D2AB2E53 HUILUNPUHALTAJIA
438,353,570 *2C649207C0B023C65F7CB0787252A5CBE1A72161 turn you on
438,353,571 *2C69D1C248A7D3140411475F5787EFAC9CDB18DB HÜTTEIT
438,353,572 *2C6EF35A46651E6750F80EAE8CA0EBC26EB3A058 HVILEPERIODER
438,353,573 *2C648FBF625C024C6F8DA409FCD8EC4E25FFFBF6 hyorishspecialed
438,353,574 *2C645B4C9C03CDF2043E1C01EFC9A2FBB74C534C HZKY
438,353,575 *2C6B683AEDA9377C7CF07A880F9CBDFC4A3B3496 TYTHEDFORD
438,353,576 *2C6AEE19407B0AA553048A8D7C5326D1A6D48E7B u3sp
438,353,577 *2C61321A210112CE18B237336DA9A6F626A01783 UCHIDA098
438,353,578 *2C68E0813CB6BE96C86C9F6FAE242DE9D8B2039B UDANAKA.GUNAWRDANA
438,353,579 *2C6BE886DA7E7590624A4DC996870C637F97BD9F UILEFHIOSACH
438,353,580 *2C6DA2235E688CEA8EADDCCCDFAFCD780EBD8BEF ‘uke’
438,353,581 *2C6C966163A404782436FB6AF1A0E0238B60CDCE UNCOQUETTISH
438,353,582 *2C6B9A0E442C3B8C70C9434C3DE645F97B9CA562 verdiront0
438,353,583 *2C6A739FBD317BDBAB807B1CD86B29D5A5E3DD22 ILOVEHANNA84
438,353,584 *2C6EAA5E0A7AC49D0C2197D45C35A31E92F28B0B [email protected]
438,353,585 *2C628C018073943EA53FF8974F54CC707321FD0E vhe-sarmiento
438,353,586 *2C6D1BB1403193078F02A4AA5A54F82606BBC776 IMAPAR
438,353,587 *2C6B6AD8AD2D81DB8DE016EDB9FC1A8C2B2799AE usaysafdhilphacoel
438,353,588 *2C6EB680EFE26E7DABAA87C91A354A56AE79F150 VINCENZO.HUESO
438,353,589 *2C6546600D409837F09EAE4B8B29DF70BDFB79F6 USERUBXSOUTHWEST
438,353,590 *2C61947E9A33D493D25BAF171C8569FC13232C90 ustulation9
438,353,591 *2C6207375F482134BCBC3E0AA1052A837E5A1227 UZ'P
438,353,592 *2C6A29DC1DCD8ED9DCE2F92F2058395BF5B6639C UZVCYO
438,353,593 *2C64A058D4B0D68F364056AC96681D91FC56A369 inimitative6
438,353,594 *2C6BA502A4436DF832FBD9F8A7F62F0C0A23CF0C VPGVPGVP7
438,353,595 *2C6267727C1ADE9893AD50A8167E39D8AE3C91EB IONRETNI2
438,353,596 *2C6735ABC66EB5F91C97D776485B48230D28BCC9 [email protected]
438,353,597 *2C648BD531565A58C8FD3CA75DF69309764630D7 iris764
438,353,598 *2C6551680ACE8D0E81F8168DF5B014D8120B59A7 VANTUYL1
438,353,599 *2C688F6CF6A1E77724E846707D9049A021F794DB VELSENZUID
438,353,600 *2C66CB173E708ED759FAB9B0C976B775B5553F0A iternacional
438,353,601 *2C69C194A8F37FD1FA68FDFDB0447D3FE2BBA9DB [email protected]
438,353,602 *2C66F825219C91EB47B3828DAB3FE9571D921A43 IVANBACKUS
438,353,603 *2C6EC42EF7C441F9C230676BCB7E45AB52B2B149 ivandeichman
438,353,604 *2C66D6F46F47C6B3E7CAB8F429729696D8948A67 VHIE.AGUSTIN
438,353,605 *2C6A4A822E8278908F08E1E785913BE220BA92F4 [email protected]
438,353,606 *2C6F124557501A84375CABE2067320D0E02D3F6B VIBHAVARIJAGTAP
438,353,607 *2C6F39562A9312E2E63F890659CC54F339678901 VICTORIA.CONLAUND
438,353,608 *2C6B10B75CBC2DE70A7BA6E956ECB4C5E9410B77 VICTORZIMBARO
438,353,609 *2C672003A481CD63D288761AEE453ADEBC33090D WAYNEBERTOLA
438,353,610 *2C64486E68D9717B4F2E8CEC797EC749418C41CB „vilei
438,353,611 *2C63A85919E3C2C5798973D3CC077FBFF159853E WBTFWJDD79
438,353,612 *2C6F6E52EDBCACC55B8F449C06327A53A211FC73 jahrtausend2
438,353,613 *2C632E699B65B818F35C8F882C717B3195FF90DA JAKEBAUDLER
438,353,614 *2C6B6FB1C5E8D68A2A2A6A2743FF0FC6651D29FB virgofernan
438,353,615 *2C68A9DF2C8DDEE4C7595A035C751A9CD538F80D VITHURSHANABALENDRAN
438,353,616 *2C6B7CC9828752EEA3454C4F796FBC1EBE0970E8 JAMIE.DISPONETTE
438,353,617 *2C6A78ED679FAFCEB4C69BD9CB85FB587438005A VOCARETIS9
438,353,618 *2C660CE6C7084A2FB4F6A332D359B8DC50F33880 [email protected]
438,353,619 *2C65F04507EFA24B93D71A49DC933878AABF8D87 WENQIONG5
438,353,620 *2C6D51E16CEFEFD965481DE0707AC078F5E90BFE VON.JUEN
438,353,621 *2C62A45D82DFC9732631C27F3DFA1597214C014A [email protected]
438,353,622 *2C66E68C42C124EE8ECA7AB79B2B835F4E40E9E7 WHO MAY BE LAZY
438,353,623 *2C638E384A66BF8E400561F40B1621BDE10548A1 JASPER.PEZZANO
438,353,624 *2C68FF9E5161105F4FAC50723F6E476421CFB474 jaylan220
438,353,625 *2C604B327AC20CE18334515CDCF2C3AE146FED63 willardshettsline
438,353,626 *2C6DAB2D0F3F9C49A48215A12F7076253CEAE1F9 jeanette[
438,353,627 *2C6FECB8D32D2714A715C284C097BCB5A66BA91A JEANKUZMINSKI
438,353,628 *2C6BC611A17C6AA848361135B31127A8EB2AF36F WILLIE.BONAMO
438,353,629 *2C61F4E23AC178137C3EA244A69BF8D80DE75246 JEFFCAMISA
438,353,630 *2C632ED39476B15690AE6216FFFC408A78DDD073 WASTING4U
438,353,631 *2C61B438551861A24578E7BAB1C704AEE5AE73B0 JEFFREYWHARTON
438,353,632 *2C6581A47164860818D8BC38CF4486F14A988802 WAYLONCROLL
438,353,633 *2C6343C2AA2D6FD4FD5C92F0D5548324DEA03AB8 WAYLON.KEAHEY
438,353,634 *2C6BBD4AF9FD8DE603A09DB790DFEF249B406D57 JERALD.DOBB
438,353,635 *2C61617891760B10698BA98F1AD24E07B72FADC2 JEREMYECLIPSE
438,353,636 *2C60CFE89884EBDB5B2FF10BAE876DA636B84F07 JEROLDEICHSTADT
438,353,637 *2C61DC42733D4A15A225E3F87DBD907440203657 WO-K
438,353,638 *2C61F66CCC06F7DE6EDEAE29DB7CB2F5FD77091F [email protected]
438,353,639 *2C6A1877054EBA34A9CCFF6E08E720AD213865F6 jessefielder
438,353,640 *2C6E970AC1B49D1327B93E5938CE98D940B0C537 jg&?
438,353,641 *2C66D95EFB64FAA71985F44AAD9D5DA20BE09660 WE'RE-A-COUPLE-OF-MISFITS
438,353,642 *2C6A84DDB1D8EA18155D6E37D6B88EF294D9FBC0 JITWALAI6
438,353,643 *2C68EC1C8AF80C8FFF580209A089CC254289D76B JNNU
438,353,644 *2C612F1074E10E5E6A16D13D990B893097EC6CBD JOHAN.BUYSSE
438,353,645 *2C6237C58DF3E41351344BCBC4FCCBC7057B3FC8 JONATHAN.BEECKMAN
438,353,646 *2C6A72D465D69BE31B9166659F6D10B46C74E939 JORDAN-ASHE
438,353,647 *2C6B50D394AB14F0FE47FE7A4382DF583BE3AB5C JOSEPHDARY
438,353,648 *2C6A55C7C0444C0112D2B91E6093F68264473AFE JOSETAING
438,353,649 *2C66D260CB5EF158D4FE376B281A20FDD38CD6B6 JUANABRUZZINO
438,353,650 *2C6FE9D1930B857AF3C279325E24FF05F4F713DB judsondibonaventura
438,353,651 *2C6AAFFBE03CE561B758C509A0CC5DE11C47186F wwwpaperhouseonlinecom
438,353,652 *2C69727E3B055CDEBC9073CC669CE20250DB74CC WHENWEWOULDBRINGHIMONTOSOMECONFESSION
438,353,653 *2C601E08C78A748144A64B5EAFFE6BC3372A16D8 K72136
438,353,654 *2C668CB34AF3D6D3A2AA0E6DE5492FA94F918DCA k8be
438,353,655 *2C63F8D5FAE335E6D3159BB0C1A28AD44B70F53E xavier-martel
438,353,656 *2C6F5D6A5F9ABCA0F0A0C28227AB95FE7932887D KARLBILLIOT
438,353,657 *2C64306FE8F866BE0579468D1BBA64E2877C9853 KARTASIN
438,353,658 *2C697060D91FF53E2D470B7E7F09FE83C4A3EAE0 KASEYMOMENI
438,353,659 *2C6F117714AECCA9E5EA9DB5CEEF3560EC050F17 kasnetau
438,353,660 *2C6ECE3F970F99A4A5DA1391046976FC75AFCDAE katdady13
438,353,661 *2C6355387CC04FCCDE4B16C0CBC56247C5139121 [email protected]
438,353,662 *2C6C7C5DCDBD05505C8A6C7FA693130775002258 KEITH.OUTLER
438,353,663 *2C6F410BF5D2101366CCF4980AB0EC24BEBA1D2B kemperleye
438,353,664 *2C6868CB7E93EE67361DC4669636F4DF883D7DCD XHP]
438,353,665 *2C6A129AC8956E5E228EBE1E84CDE209AA421EA1 [email protected]
438,353,666 *2C6FD6411487ADBAC564162CF98290FCC4BD55E8 WILLIAMNAWROCKI
438,353,667 *2C60AD61752BF364ADEE15E0809A77960A107A80 [email protected]
438,353,668 *2C68CA1B13EB8E6493DE6377E46B1554698D22F3 will-i?-(extended-mix)
438,353,669 *2C65E9B90098A598C74566A4AF06BBD2E3B1668A klaviersonate no3 cdur op 2,3: 3 scherzo: allegro
438,353,670 *2C60F6DE247173A4FBFC6AE2E9F1429B4AC29DEB yamct
438,353,671 *2C66BFEDE73E8C9D73BD7E2D21C11419B021B76A KNUJDNE9
438,353,672 *2C609859D2EAEEF7E28195BAC4B109972762ECE5 KONARAD1
438,353,673 *2C699D73EB623DAD34F5639314F713603EFD5C9C YCNFBQMNTTC6
438,353,674 *2C6A0FD42FB960691BF47AFBA74947CD61D85FD8 [email protected]
438,353,675 *2C6BE6E72515B5D1F47CE6D04156FD9F39A8F471 [email protected]
438,353,676 *2C6677D2E9C92166198F6E00086BDE16F2634D7B KRAIGDUSHAJ
438,353,677 *2C67C1945E88817F42BCA6D94E03ED92683D4B82 [email protected]
438,353,678 *2C6E4D3178AB987FC6DC2F31017F615CDB21B50D [email protected]
438,353,679 *2C67B5D335F26BBC48D0AD4DB503D06AB752813D [email protected]
438,353,680 *2C6A63ABA05927CECCE80C8FCA1977648E16A992 kuhlisch8
438,353,681 *2C6EE94D6FAD0E56AF5C1ADBDD292F5ECDE1ABFA X/1AA
438,353,682 *2C692AAB31514D1B654D8FA785916E0A6DD39285 yokokohlman
438,353,683 *2C651C10F07521AD50A96B5F4C1D6FA47B9535A1 [email protected]
438,353,684 *2C6B1EA6678450BC2D74D07E4747711D34084C88 YOU-LEE-US
438,353,685 *2C6A3980E8E381A8E073D9365E568F478ECC1F11 LACYGARNER
438,353,686 *2C696BB84C8F8C348C6178352626325EC032897B YSABELLA-GARCIA
438,353,687 *2C619927CA40C544BB998A8C584C7B529E8C0A81 xsyxs
438,353,688 *2C6E59334C865F156F61EF7AF0751E9A632FB79C [email protected]
438,353,689 *2C6E764CDB18A6FC8981228F0A774504384B712F YUBEIROU
438,353,690 *2C63EED0A7DB5E1922BCDB6AC1614D1CFD10802E yagnesh-bhatt
438,353,691 *2C60D86F877B829B8D1B1287FCA2F282989B91E5 YAKUSID7
438,353,692 *2C6E307ECBEC66F7D2C7089830EE7386A0B39BF8 lannycutshall
438,353,693 *2C67F8E5F1025AAAE86F7C9222D28B4D13925EA8 [email protected]
438,353,694 *2C6703CD45F511E5D8552769611C4A6FF604C771 YBIUSNES
438,353,695 *2C6E2E0D957B10B63166519D7420A07007173AEC ZACHARIAH.VORE
438,353,696 *2C63074CEAD1C4E9BC23CD3C86E6DD950B4C46E9 LAURA-AMAN
438,353,697 *2C693C205BFCE93AC13B266E534B61AFEE52178A ZAFEERDYANDRA
438,353,698 *2C6A64AEA3493337AC1B14C0E3FB831F0D5D2A35 YESENIA.PUGA
438,353,699 *2C6E19F3819201507EA9E21144456778C8D96829 ŻAŁOWAŁABYM
438,353,700 *2C6346CF6DD4F2EA9B4AF56AA3A7AE5836542535 ZAMORSKY.ROMAN
438,353,701 *2C6910FA3EEA3259099C57077E0E16291B58742D ZANESENA5
438,353,702 *2C66BEF3E9ECD3C84D720ECEB0549F0B2E3A90C4 [email protected]
438,353,703 *2C67CA6EEFF23AA854B1B5F45F9EA4CDCDCC9AFF YIWEN-SHAO
438,353,704 *2C643F749531F1A01A93380B392525FF5ECCEE14 YJUWANDI
438,353,705 *2C63D0E949AEB351E7547BAB673BD62F3A6D2C5B YLJRVELINENING
438,353,706 *2C655EB7ADF43D6672DC8BAB03BC9F06FCA2DFE7 YLSSELFEIRB8
438,353,707 *2C66F90D6FC2269381244EFDD9153B358C59C73B leah-barrientos
438,353,708 *2C6241C7538B20721A83325FCBCDFE167BC1194A yougotitandiwantit(featthedirtbombs)
438,353,709 *2C61C49E07E019C6A2F9D654AB8CEAACDB3E1DFE LEFULLE3
438,353,710 *2C64A532843F7AABBBFCE927D52E6B9D89EB15F1 YOU-UPSET-ME
438,353,711 *2C6EFF50E83286FE30E63E548FA7670B397D5F1F [email protected]
438,353,712 *2C6E63B65188DD69D1EF049D86316F3189934CF3 YSEIKOCCHI
438,353,713 *2C6B44C735C76FDCC886816E98AF8F345A2586B0 [email protected]
438,353,714 *2C6168278682F92B53E2274BD9403EA130482FF3 [email protected]
438,353,715 *2C64441CEBAA8C6F0162B975B37A824D3F69B460 [email protected]
438,353,716 *2C69222AC1F561C43ACB5A19560A4E561627669D [email protected]
438,353,717 *2C68EFED1EE4EF0607E1F1E6BCAF253C8A426AFA [email protected]
438,353,718 *2C65D88E7FD69DA61207C9F50EBB86216900022C ZIGGYPLAYBOYS
438,353,719 *2C6AB59EF70FD84EDFB4A5BA85DE851F6F490626 LENNY.YEARGAN
438,353,720 *2C6D1798C0502A1C88E447B6ACE5D5DCB395187F YVONNE-MCCLARY
438,353,721 *2C6AFFC40EFAE7189AB4FD33D66F4480D86AEF59 ZOJGQVIFMMWSXES
438,353,722 *2C6F1AE2F8BA5E8DDB50C072242F7CAD829F8E96 ZOLABLUE
438,353,723 *2C66688360758AAC9716BF10E5143FDA5728E01A zurana-hassan
438,353,724 *2C694C1353B6C83A318A9DAC9E46DE125A45C41A <LI><A HREF="#PERLANDCGISCRIPTS">
438,353,725 *2C67A105EA9A7EE009529213A3292FF4F815E93C ZACKPOURCHOT
438,353,726 *2C657965EF0B26FF336E2740BC4112E485EF36FC [email protected]
438,353,727 *2C68826A15401E812F549B372DCFC3B6BC795477 ZEEQB1
438,353,728 *2C69796D8EC078CB22BC80467D5C5ADF3B9BA9F5 ἘΠΙΣΤΗΤΑΊ
438,353,729 *2C6E285D23E0A734E8BB9EB82850E74211FD965A ΠΝΕῦΜΑ
438,353,730 *2C63C71DFACC40CB479571CB2E8B7B2C1AD71565 БЛАЎНТА
438,353,731 *2C6068D6BC4F6894982F6E64EB071D1C7AED1A94 [email protected]
438,353,732 *2C6F3021665221DA4BA139D822AF4D0C9C7A4E97 ВЕЛЮЖИНО
438,353,733 *2C6DA44BD8481D28C2A6E177A1A1B571BF18DE97 [email protected]
438,353,734 *2C6E0EB56A99B2A7842926643E747E23C3B2E355 влийте
438,353,735 *2C69567C13D73C45770B390E2376BCD9F6D5A24A ВСМРЪКВАНИЯ
438,353,736 *2C6A69B38F734DFC08305FCCF6EC19C6DAE62E5C [email protected]
438,353,737 *2C6A83C72DBA99F7C52FCDF035EF2A865FE0B239 litholyt5
438,353,738 *2C60B69FC2C7C783C943635B4242E5038FAA032C [email protected]
438,353,739 *2C6668BA0340E5591913A8E7CE3730F4706320C1 ZIA INMAN
438,353,740 *2C6441A3573FAE899C846A5A8322FBE8080BD235 [email protected]
438,353,741 *2C63B881E07494985711C77758E924CF1D10295C запис
438,353,742 *2C6EADB110BC6BF585061EFA79B7071BC1A9B81F ZLATOMIR-TODOROV
438,353,743 *2C6CB8F279889FA43763F926375CFFC9DB68D13F конста́нти
438,353,744 *2C6D6A9AA1AC8678FB23E7BA3D80DA5EE396D530 zulkarnainpbolak
438,353,745 *2C623C70128BC3D52BCA15E80BE8EB573D1C2653 ZUSSEN-(FEAT.-ANITA-MEIJER)
438,353,746 *2C6BE728B9AA933A72696A477EDC10D9129A8CCF ZWAAGWESTEINDE160
438,353,747 *2C6A41FC3EA7BACC75BEEC9AFEB47E46BFCD50BB LORENNIEDERMAIER
438,353,748 *2C63B9CA6A0C72759A5F7F573D3B6F7F93E653E7 LORENZOLASANE
438,353,749 *2C632A0E7150615E304793B8E1C16076DE0695A4 zy-bean
438,353,750 *2C68399FA78CBFD37BF513EFCAE769E6E3667939 zyra.ferre
438,353,751 *2C6BEFD4D0B52754F6EB6518363A7210F34276E4 ZZEBFCO6
438,353,752 *2C6E8DB56601ECA798506BA102781DA8B062DEDD ОТТИЧАЛАТА
438,353,753 *2C6F9DB061C3D6B911BCA13D6576221602798B62 параноа
438,353,754 *2C68F7B4906CF1CE6C08FBCBA31066DC16E16018 LOUISA CHANDLER
438,353,755 *2C61A520F7FBA05AE8AD16F29D5875DBAD0898CA LOUISFELKS
438,353,756 *2C6D77E24CA676A952D5CCFB8FA0006624404EC7 LOVEMER6
438,353,757 *2C6AE17305BF10308FDEA2FE067849B65C95DFC5 ΣΤΡΕΦΕΙΝ
438,353,758 *2C635EA2E7D8E73F8D4DF168C93712553A29461C АНЕМОНОВИДНЫХ
438,353,759 *2C6EF7235DC571C5183B3C42A0B66B65A6DA4779 СМНДРОМ
438,353,760 *2C6D97B1094F61196E2C516A04A4DA778B686381 ТЕЛЕСКОП9
438,353,761 *2C6120405F68410CAA3C4A1678984A4D55EB5F21 УТКОЛЬБАЙ
438,353,762 *2C6A2D923C479748039B1E9D17E4BC67D1E2D1D8 ЗАХІДНА
438,353,763 *2C6EEDA8AB841BF4DEFBF95FCF9EF070856E0300 「トラップ一家物語」TITLE
438,353,764 *2C6454595CAB4EFC079985DE9EDCFFDDD0D3288C кавернинский
438,353,765 *2C6AC4EDBA0283BA59CCF5B0E884212A34C60765 РЕИМЫРПРАЗЫ
438,353,766 *2C628ED4069F7B4D7B7C99DA47BB3501E609B8AE СЕТНАКХТ
438,353,767 *2C6F9D58831693690855FE4541ADE1555C9743F1 шиллингтон
438,353,768 *2C6403BAB3D8E47E89284F970CF3C1D4C5265A82 MARCELINODUHART
438,353,769 *2C689BB77D2C149C41DC0FE60581F1871B3C022B MARCUS.CADDEL
438,353,770 *2C6D553ADCDEA07C8FFCD895809E8902296D2D51 MARCUSPLUTO
438,353,771 *2C65B98780CAF488BAD11A39734233E177636716 marites-mandin
438,353,772 *2C6E780ED1BD5EB4D3E9B75D3230C88269E3E73F maryfaken
438,353,773 *2C6D3C9448C131FEA8C1F11B822DD03B66CB4AF6 max-goswami
438,353,774 *2C69F50B521ACE78EC9E6883749E4FDC777F68E2 MAXIMOFULEKI
438,353,775 *2C6F1D684D4DB3541A7412F63DFE9781A6FEDE1F maxixcatzin
438,353,776 *2C6A5CF7B316C5686E0AD41017242DA460A2225D MAYFAWZY
438,353,777 *2C6377D34DA154DC5189581A84D9D5F6CAFFD9A7 MEDAILLENPLAZIERUNG
438,353,778 *2C6A1786F41A54CF0649A2D307F0CAFB54AB6139 mervindallmann
438,353,779 *2C6390CD425C40A772BC8BB51B59F0DC1BFBADC2 METTIONS5
438,353,780 *2C6286914DEB15DE336F14F6D526D33089A2004B michaelwieto
438,353,781 *2C6F6566A4A72005111683B2CEDBE6CAAD9B0E70 MICHELLE STAN
438,353,782 *2C65D4B3E4EB4571E5E7EDF60D16514DEEE081D6 MIKDAS ARIA
438,353,783 *2C68A376EEAB6C25208D2B7F4BCBDE7DEE6A9AEF を運営した。のちにbcエレクトリックの一部門として吸収される。
438,353,784 *2C62E1AA8E0FF0E1345795E29C39EB54F0FC6FD1 MITCHELL.PHILDOR
438,353,785 *2C6A9E27ED5BF72B16C498850B01E3EE05636F4B )を設立し譲渡した。現在、サイバネットシステム(株)はCAE(COMPUTER
438,353,786 *2C6D6B47BDC32E29232F33ED048603F7FF09BACB MO}Q
438,353,787 *2C6EB419F70FCDB3A03DDC5404EF98F44B085395 034DE8
438,353,788 *2C6F4C9F39F7E5BECF58FFE34885543BC603B1B1 MRCHNDRZ7
438,353,789 *2C6281510FBB4F770DB85C9C282DBCDEFA8A2B0E (0_<)-~<----p
438,353,790 *2C6C4BD4F4FD478A44B82879123F3BBFF91A5293 [email protected]
438,353,791 *2C6A8B680D791DDB40182601ED3CD1C3CDA3C6C4 MYRONBENGELSDORF
438,353,792 *2C6754348CF0BF616E468B4C296A8F910497EC87 @[email protected]$
438,353,793 *2C698588F6CC1E736CC79DCCC5E2F25833C68D87 12021933
438,353,794 *2C6887FB050B88BE7535D046ED0445CEAB3E9FBC [email protected]
438,353,795 *2C67783CA6B62401696C0CB88B90AD67432C6CF6 N-ANTI-FISCAL
438,353,796 *2C650C310A368F125645FA6A28C0CEDF5333BB43 NAROTROT
438,353,797 *2C6BC92E37B5E1FF37E38FDA2218D3C819B6E0D6 (_0).O~O~.Q3
438,353,798 *2C6E359DAFCCD8BC34F9CF9413F629E317A7A00A ndumbe
438,353,799 *2C67994397AFB84CBF96F4A9F379D4B8F33509BA neasdeghana
438,353,800 *2C6599E52F267D4AAA9A3925060F1CE25478CD2F 10.08.1376
438,353,801 *2C6DC0B07F6F589C2E219B10C7CA64F167481525 1704506 VILNIUS.IS.THE.CAPITAL.OF.LITHUANIA..
438,353,802 *2C6EDF79F6D6BE8830980F5F4D3BC0CB600EA3DE negh80r1ne55
438,353,803 *2C652C978336DEDD8D517713D1872C040452D5E7 1841026 LAINOJEN M
438,353,804 *2C6279E8ABF2C3765AC575E7DD6F1FCDB712D489 1940236 SAUNASTA-JA-PESUHUONEESTA-YHTEYS-VILVOITTELUPIHALLE-
438,353,805 *2C6555FAF210E2AC565F2943DD39ACE3C90D7BDA NEUROINFORMATICA
438,353,806 *2C651F8A99BF7B495F0E1E0FD01B48BB29438EAE NEWSMAN3
438,353,807 *2C6BAF4CE4E4A440D093EB25686B6570F3911546 NICOLECABRERA
438,353,808 *2C6CCDE01F71A3AD2B3E17BCA254730C5DEE4EC9 1BLUTRACHEGESETZE
438,353,809 *2C6A9FDD8AB77A073C7D097822BB9D916F80741A 1486111 lakia hyv
438,353,810 *2C603D966140B3A2863A8B01BAB0E029CE785283 1-CADFIX
438,353,811 *2C654AF927689CB06EC27E264FA69FC706221C8C 1 CHANTALONGS
438,353,812 *2C6208B21149614C23D225027C68FAF3F1746E90 nisanne
438,353,813 *2C6D2959631D16CAA645D5F83910EDB2187AB53C nmarginal
438,353,814 *2C665A4AF5BDDB58CA090D224EC0E3CB13A498B4 1DOLPHON
438,353,815 *2C6720118E18F9E5A5F9D33CDE42CBF1CD8A6EA9 167ROSS
438,353,816 *2C609DF8EE10FB1B2FB443935B1C4CF91E8DA0A8 1715EDUCATIONALDECREENUMBERTWENTYFOUR
438,353,817 *2C6B55F11749DE536AAC377F56EB52561017C338 NOLAN.GUESS
438,353,818 *2C61ABB6E931B0B4EC4773471633F50ED7FDF5C8 1906543 kierr
438,353,819 *2C6FF52E70010D6EFE535B48FB729A6C7DDCF0E1 1934471 puheenjohtajajulistikunnanhallituksenp
438,353,820 *2C6D02A2E8CEB5A58C69F7416EBC98F9F791F6BC 1hein
438,353,821 *2C66BCDBB5F2BDFB9D401CA545E28D8AADDAA13D NOUR KOBROSLY
438,353,822 *2C6D3BE016EAD01C0455246427270EC93F08BFF3 [email protected]
438,353,823 *2C69DCA7983096DE17B51B5EB63BFBC24CEC59C2 NRSTBSWING
438,353,824 *2C6BFDB9A3C56F7C8AA800EE56A8C0FE78AC9003 nupata
438,353,825 *2C69E29A5D6752156F3FDC5EC97E611E4D082FF0 nursingorgstub
438,353,826 *2C64ACC60CA37E9A8305C37CEDF39B3ABBA0931B 1MODEL-BODY
438,353,827 *2C649653DED337E488F03FB7D9417FC47CD01D5D ODELLEYERMANN
438,353,828 *2C63EDEE30FB4D8408BDAE4D6F45193E93EFE317 1.MUOVIPAKKAUKSIA
438,353,829 *2C6F6D788A998378DC97A3D08759DF5FE30827D9 1myelectric9
438,353,830 *2C6FDA00CF09DCF0A34D4127DAAEE5658DA26548 ogukobolusu
438,353,831 *2C62D674FCDF79CF8E77D9A082D506B232E5928E 1fernsehdirektuebertragung
438,353,832 *2C6213A9716C9352AFAA5A18DEDCEA929EDE76A1 ohyeye
438,353,833 *2C69ABED143FCC6DFA6C4F4BEF9EFD14796CD190 1 PRWENDE
438,353,834 *2C61F1853B5556F2055C3DB3A375DC2A6B7EA6D1 o-me-cutuca
438,353,835 *2C66A75F34E1C4C96A85CFBCD459A743F16BC695 [email protected]
438,353,836 *2C63895FB9543333D7D91690D5587EE39B0EA8A7 ONBEAST6
438,353,837 *2C6C5C4DB51E0499382F7F5EAC8CE977605894D5 1iluvkarin9
438,353,838 *2C6ED1EBDB01C6D31F54CC3F0AD72910969B92AE 1INDELECO
438,353,839 *2C68051DC8C995B45009E65C057FEF26A3087D5F 1SEPTEMBER1579
438,353,840 *2C69BA3FFB0863E992ABB978D8E9CDA2F3106220 1-sionin
438,353,841 *2C6623E2482C4CC311999FCF19550B77B1287EA7 OOLPBBS
438,353,842 *2C6A1C5C94CD512CAD6E107362357408E40CAAB2 1KIJUNTEK
438,353,843 *2C62EF0D2B1BF28F6299CD52E5AE3DDF838BDED3 OPHELIA.SHOP
438,353,844 *2C6D5DFD4EDEBF662EE7ECCB956CA8CD8A8C39ED 1.s-y-m
438,353,845 *2C6850CFF5871F17A6CFDBC23D0C0C3B1D6D7560 1thatjunebug2
438,353,846 *2C64460AD8CF950D92562791FDC90CFAAD528DDC orensuszynski
438,353,847 *2C6DF07795AFBE7A3734A055E6E96E6EC973B2C4 1-torpedobooten
438,353,848 *2C6B5B738F7A3D983D9FA7D86DBF6B3BF9551C3A 1 LUUTUNUTTA
438,353,849 *2C6EB04B20E79795A190B40EAE91DB9301C5157D 1-markkinointikonsultin
438,353,850 *2C6F980DAEF8FA998BAD9257AFFCAA9F01DE8366 1MCSWAIN1234
438,353,851 *2C6F4AB867E9AB25DDE08FDFDA18C5F292A5E0F5 1 ministerpraesidentenbruder
438,353,852 *2C6E0E596B67B7E05F0611B073CA71B3720024A6 OUALUMSCOMPANYBEHINDGRAMMYNOMINATEDCRANK
438,353,853 *2C638FF49B7EFDF0A401F8D2C45C173D49646A8E 1PENTATONISCH
438,353,854 *2C67E0032137DABD85940A08D942D169F597E717 p---->***~0~o>-b0
438,353,855 *2C6F06BA3CB9B94DFAFB44504EAB4C1F5E7305FC 1THATMICHIGAN5
438,353,856 *2C64585DA14B1234E40746E9C3AFAAD9BB28C2B5 2507530 sosiaalilautakunta-p
438,353,857 *2C62ED805252206A5E0DB0609F0D6C38F0D7F718 1TISHANI
438,353,858 *2C6C6ADFF399F6C9204E199B62C0096CBDBD6B9E 1.TUMMENNETUSTA
438,353,859 *2C6B5EC19E47F42670E2C5BC2F12EC417DEA29B2 paralumi6
438,353,860 *2C6D05827B809F568CA8D0E2A86D9DC29EEA98E9 25-yanitta
438,353,861 *2C69838A5DB6506952EF772523418156AD4EDAFB 1uSeRLeVeL-aDDoN-V70
438,353,862 *2C6F399AD6B7D001686D02F489BBD1D24D095C09 parkersow
438,353,863 *2C6E7241D988879F329879857E6620E367A27B43 26GUMMER
438,353,864 *2C69AEA7AEB12B6465CC3A1A77BAC85ADA143515 PASQUALE.DAMPHOUSSE
438,353,865 *2C6AF64662F9ABBEF8EF6B2D593F0FE240D2BA2F PASQUALEHUGHLETT
438,353,866 *2C609F734DA3326D84FDA7AB6EADF48A5784D8BA 2733810 luottoriskeilletuleeuusiariskiryhmi
438,353,867 *2C61E0DB142D548F9A4498506B8B6D34E3D77F4C 1-WERTBEZOGENEN
438,353,868 *2C6997F633731CAC7F3EE7AE2FAF03FD4416E008 2845939 kantelijan-s
438,353,869 *2C6780706480E474E41ED88AC46AEDCC14AF6AE6 pauladelvalle
438,353,870 *2C6EFBE82201B16E66151EA943F55F75AB633537 2049223 TOIMINTAPERIAATTEETTUOTETIETOPANKKITOIMIISITEN,ETT
438,353,871 *2C650ADC7367A80DCFBFA204E3D03F9C40D43FCF p####B-~o(^_~)
438,353,872 *2C6C8CAAA5883665FC2F68DECD8D35D20DEC382C 2 AIOTAANV
438,353,873 *2C6C4C4758A5B8D83D0CE32CAB78251D836F1390 peaceamanda
438,353,874 *2C608C47F670A9E159D41DFB7CECC88B08811960 2226301 kompromiss:deutschlandistnunbereit,zuzustimmen.
438,353,875 *2C60761F9EC418B4EAF6E08D358A865A6CF4EA5F 2elektrodeihin
438,353,876 *2C60393B2EDA543D7B8FAC06D9F4C311199AEDCF [email protected]
438,353,877 *2C6BE0EA40D1F8328C5FF268A0E0789A73F96E45 2GIFTEDS
438,353,878 *2C6E39F30199867B2FDA5333211C09C073C8E1D9 2hopedalen
438,353,879 *2C61EBFC20ADE09038CE8ECBD6F2E2339436E8D4 2445475 kkr.just.won.a.bidding.war.for.rjr.nabisco.inc..
438,353,880 *2C6530D168AFFF4705167570A2C5EE851E5B1848 PETERBILDERBACK
438,353,881 *2C6644119F86BFFF010A595EB24B024DD60DA85C 2518535 klikkaa linkki
438,353,882 *2C627FD3A55C2C8C1CDB9958F99DBF8B744DA5C6 PHILA2
438,353,883 *2C60128E64A53ECE0CE608B9EC1C82DA20FFAB12 2682860 WIRWISSENESNICHT.
438,353,884 *2C61AA22CF89BA241A0FCBA0EE4EBF7C6B86BF73 2RENORVA
438,353,885 *2C6E262B467C1CCE96A6A00E2CC07A7C816E5813 2.RONSKIOTTEISIA
438,353,886 *2C66E7663E52ED2B608493412965F2F4D6DD049C pierresakihara
438,353,887 *2C69DDE9431A94013E3FBDF2925E336DA13CE32A 2-sikatilalliset
438,353,888 *2C6ACCCD8868E35191C8F18297ED7712ABE5A58A 28may1230
438,353,889 *2C6F9A39C5084FE8D89B8777F9D884E5A9E23549 2 TALOUSMINISTEREIDEN
438,353,890 *2C67DD29A2B79253959444C83D037A7700F2A0A4 2913533 YRITYSOLISUURIMMILLAANSODANAIKANA,JOLLOINTY
438,353,891 *2C6A6CCCB7566E5F64648C7644D9D78EDF34A53F 2thebirdie4
438,353,892 *2C6A8528A383A23068F1CE8A4DD59081C365916C 2-TWOMBLY
438,353,893 *2C63D5083C932F9D8C893A2F54DFCA295536A32A 308846 dennertverteidigteseineentscheidung
438,353,894 *2C65500244977965A75B3D2C287450CB4BEA22BF 31JANUARY1397
438,353,895 *2C6BEFF22C663C11E9C0AF6D1A918515950AA397 [email protected]
438,353,896 *2C6E708123C28319B533438F5039FCBD2301F375 2 HESSENLIGA-AKTEURE
438,353,897 *2C6FF866EA42EC526C34ED30411AEDA53CCA7927 2HTAERWNI
438,353,898 *2C629F462BA65BC0C4437B0AC37712EC84BF5395 [email protected]`~(O_-)
438,353,899 *2C6416F640E2721A64C0AFD2423573FB3AA66157 POILKLK9
438,353,900 *2C6A3597E0718DEB82AC492FBF76C6D65DBE2FF7 porterhinerman
438,353,901 *2C6AB7EB37B8F3A912AC700C554F1E0ACA262BF8 portersaladino
438,353,902 *2C64634532A1037B5A6F913DC84808DAD80B43A0 3EROTIMOY
438,353,903 *2C6033E8A52E3134C4635850FA11C331E837C397 3KARNMOLENS
438,353,904 *2C6C7A7E7ABB27EB6BDAFF72E9D78A78AD4C8B67 328CD89ACD1EBD4A6B9A48C7D88FB065-PIEKNA
438,353,905 *2C66FCB52DC6E669FDB57578639EDA78FD15023B pp`~`~}x{
438,353,906 *2C6F7C788315B8EC64C22CD5A7EF511DCAD64C77 3NPSTMRKD
438,353,907 *2C657733FD0029F93FCA3E78E811C0D5FC0E5DFF [email protected]~`}O{
438,353,908 *2C611EC4B5A08BA5289CF606890500E64C14CC14 3PSYCHORR
438,353,909 *2C6D31AA11C658BFDF7FCBAB3DD8DB0E5458777C preshhaya.ntu
438,353,910 *2C67B8F03BAB761ECDB5AADC7D477EE82A7C4F68 3THATJUSTICE0
438,353,911 *2C6B5AF2E4E7A9FCE31834BDAEEFBDF728B89819 PROSZIEM˙
438,353,912 *2C681FC78A5C163CFCD8B8AFB9AC90DF49DD2646 3NIPOTES
438,353,913 *2C6D19E9852DF2006B5F1430D13438D2AEDFA65F pudin-de-pan
438,353,914 *2C67A73BBE7DEEC4570909AB84F85A33B8A5AC66 4FLYREJSEN
438,353,915 *2C60F3C9CAD42906228EB64DE6A60B0B1000AF80 3 [[USER:INVISIBLESUN|INVISIBLESUN]] 19:41, 5 APRIL 2007 (UTC)
438,353,916 *2C6D6DAFDE650F0DD0067345D143AAE67EE0A5D4 3X0B1010G1CA1
438,353,917 *2C620EC24073D69F3E99D752E88EB18F7A7A1235 3X-RIGHT$
438,353,918 *2C6D1FC3D7F140A67E8C9DE9B9FE1E820B4242D1 PX&M
438,353,919 *2C6C587C4F8A79AAB6F85FAEFE3397051423A439 Q151748
438,353,920 *2C60D80AC999F55390686732B65575A9CA653F31 4qlnk4a9i5
438,353,921 *2C60C6F855CF586DCB913C27AC8D72499402ACA5 4SCHEEFHO
438,353,922 *2C6B6649168891ED8746F5850FD8E4E9BD87E77A 4DEPPOHC
438,353,923 *2C6C929D2A34FAC87661AA351ECDAE4426C58960 Q---D~O-~O(~_^)
438,353,924 *2C609790034838E94F09DCD0AB385D5C379B8DA4 QE063
438,353,925 *2C61737E40AC9043F8662F3B0746884D3A557E5A 4TERESAQWASZX
438,353,926 *2C682AF2D3E17C15B9575221F7C896126A670F9C 4FACUNDUS
438,353,927 *2C6315DDF01F85F667D9B387587FB82AC853EC8E 4HYPEROPICA
438,353,928 *2C694927AC32F4A0EFD4A6940847D8C4E58A92E7 [email protected]
438,353,929 *2C6EC20F0E2EECE2233919BADE26CEA4CEAE0F65 504.NO
438,353,930 *2C68947B61EDFE845B0A83548B6FD52F8E6833F7 517---MY-FAITH-LOOKS-UP-TO-THEE
438,353,931 *2C6DF857DBD350BFC37136DAF9F5E99753D3D639 4 METTERAU
438,353,932 *2C64BBC1540D7EECCA037049FB8B287F02DAB0B7 4MISTYDARWIN
438,353,933 *2C61B02757E76BCDA21440846B1D10CA3AB2D2F4 QU'AITIS
438,353,934 *2C6F972E198D48A74138E7336AF3F0728E1EC645 quintinmerryweather
438,353,935 *2C6406F084AEFAA520F61A631081E817EE156AA0 QULEQUES
438,353,936 *2C6F6F26705933FC7A8FBDB3889B2CC63B50A495 5COUGARORLANDO
438,353,937 *2C6BFA4E9C61484DFCF8FB80EE64516B6DB477C3 4.toimitsijateht
438,353,938 *2C699E925201B94601004340F022F6FBDF3AF86E 4 WESTERBERGIN
438,353,939 *2C6E2740B856A2DF35ED6EB9267A13BBB368E602 RACHYCENTRIDAE
438,353,940 *2C631F479D5252BFD2468573F541CDF50A3AD0D2 5monkey7
438,353,941 *2C6F46141E23D23754F891574890E389B1A2D86B 5e6z
438,353,942 *2C6ED75E4E2E134A988DB0E50E6622BDE6698AEF RAYMOND-LOVES-ME
438,353,943 *2C6B623A1FBCBDC095D2B375D3AE5167484B7833 5PORAZIT
438,353,944 *2C6A7247EF1EDF9BC4960CFDA7471E4662E9312A [email protected]
438,353,945 *2C67C89D9767EA5F117A7FD88222416974D494BB 5ravvivava
438,353,946 *2C6907F46E1BFF8B7F3BBAC2DB55A088A6BDCA10 5INACCURATI
438,353,947 *2C6CB30FB769E5276092A7F61BE04234EC61171D 5-in-d-major,-d-12-no.-6:-iv.-grave---allegro
438,353,948 *2C6D43EEE083EBA0040215C1966B87B23B9FCFFA [email protected]
438,353,949 *2C61F3BBA7123F642CA06032DC5D37AE3AE0C349 5STRUJANJE
438,353,950 *2C68791C6066EEFFFFDAD23E7785CF31F6537B28 5MSILIHPOTUET
438,353,951 *2C6E9DE754BDF0E65A9D4DF41161916764BDA74E 5TYYPITET
438,353,952 *2C60C9DB929522B95E4419D5A0B423D3FD0C874D 5VANESSASPENCER
438,353,953 *2C6B2CC08D390E782841686E92D0C66E3FC56459 regdabgfdsa
438,353,954 *2C6E6C4361998FC1BDCB6DC7C64CC313AC36DB9C 5REKAMNESSARTAM
438,353,955 *2C676036E02983DADFE3DBA3501B9871D5668C5B 5SELAOCNI
438,353,956 *2C654436326500D4D3C9BD52FEE11EB4B91B9B45 628980 JETZTKEINRISIKOEINGEHEN.
438,353,957 *2C6EA7365BBB98BE634410E6E9F838EE6DA9823E [email protected]
438,353,958 *2C689703F62C53B4CF667D48FB096408BC6E825B 633316 AGIRLIGI1300GR
438,353,959 *2C6524AD169516E3FC38250C054293E9170B8176 68724 dunya-basini-genellikle-bu-konulara-vurgu-yapiyordu-.
438,353,960 *2C6D221869D000BBA0740B37EC8EEE92DD3D5E9E 5+UBB!N355
438,353,961 *2C61107553746223D3DD7A3827EF8FDD7172B603 5UNCOAT
438,353,962 *2C6877EA090232BE8D1AE38E46C695B6F09E970F 5VAL4
438,353,963 *2C6413D6940DF848F15B67FB1178CDEF91B509C3 6CLASSMISSION
438,353,964 *2C66BE710D1A3A0322AAA2BB2790BA4C6A1D67F6 6DATENEMP
438,353,965 *2C695F4857DA0FA8C70F2A54FBE061B6D84B758E remettri2
438,353,966 *2C613FFFDA8B904A3ED9D6D95CE9B0000EDE1771 ressaie9
438,353,967 *2C6D836C3CC42838283136590322F790BECA168C 655qazwsx
438,353,968 *2C6FEB3A5537857CB4C56106B79858841ED1C60D 6919BEACH
438,353,969 *2C64144F2AEA1301123AB86558A88400F45AE26F 6AVANREVO
438,353,970 *2C6911B2D22D59858BECE23A093E77F1EBA88827 6AVATARMINOU
438,353,971 *2C62CF95CFDDBBACE150501E5E20FDE3489CE959 6brawler
438,353,972 *2C60F0F3F458DA9B5CB8B3BA1DD1EC53F24AE5D1 rey-mark-arcilla
438,353,973 *2C6FF90F4C4E49474D1D42DA93240E58F07D6A3F RGELSES7
438,353,974 *2C69690189674337CFC0786BD79B86F694083BD3 6TWORZYW
438,353,975 *2C650DD2C65DC297C7DD9A50943DDA0873BC9BFB ribarska1
438,353,976 *2C6872BEF8DACE7075950D9139B10EA93FA3F7BC RICDOWMO
438,353,977 *2C6A535DD27B31DA6B7A60ADA356DD438A2906AC 6wariest
438,353,978 *2C6B9BAB6773C11D2A259D6EC49ACEC670CAD51D 72MISSACHTE
438,353,979 *2C69825918F6B90EE02168CB29ED0D49E3FA4468 6HIGHSCREEN
438,353,980 *2C653006650D10B67431A4C9E59DA99F9701DEB4 RICKYKINN
438,353,981 *2C6B87F94718D0D18A3694DA02BA6D29F582772B RIGOBERTOJANKOSKI
438,353,982 *2C6ADF9DA3B4AE548EB9F5D7439BBA5E21A41564 6MAANSDNA
438,353,983 *2C6156F9C7B169ADDBD0C20DAE07BEABB7CCF6DF 7BSWBRUYNZEELBSW
438,353,984 *2C653302992D65D9B2485DA7F4D9391E1890EB2A 7BSWKNICKMAN
438,353,985 *2C67236858BEE6B8CB5C18A18D39D90B98E9C32F 6POLITICSSASKIA
438,353,986 *2C68826772C66E5328152FAE6E41B9F2F1657231 6REPUBLICBOOGIE
438,353,987 *2C62B4D037D1D2CEFDB366AB42EDC562491800D8 6RIUOLTOLATO
438,353,988 *2C6F085BBA5E4B960D78EFD37988B91AF448C10C 7EGENHETERS
438,353,989 *2C6F5E88CE59C21D0286C315A5261475B8C55A70 6SMARCUS
438,353,990 *2C683D509C493E482AE39FE203114362F9FAC7AF RITASAMARANI
438,353,991 *2C6D437CD7C5E68C4E1D566ADFC3EE91F7E72C95 +RI$ULPHOXIDE
438,353,992 *2C68C641D1E556E3313F4C85E527B74008118C7E RJ POPE
438,353,993 *2C69E169F6022F5D3E020803F7CB4F88841213CD 6TEODOZIJ
438,353,994 *2C65E6AA5B02E6A01A3C725BCD3F29703ED20802 7-fyysikoista
438,353,995 *2C6A310998512E988F134A8547AC46EF77CC5E92 7041417
438,353,996 *2C6FD21015504231374086D02CACB92B1D089843 ROBERTO.SIMUNEK
438,353,997 *2C6682B2CD9CD13F026571DFA8558DE28764008C ROBIGON7
438,353,998 *2C6D5606C0D716FEAED4F2F163DA003D502FFDC2 74C7C$
438,353,999 *2C6486B10D923CCD8B5F41C80B439FC5B128F9A2 74HARDROCK
438,354,000 *2C68E92D56C27064846ED19C47E36A97852D8B25 7AFTERGROUP
438,354,001 *2C66C5464996B1FE664CEA2BBE8CA2F8936FA083 7RODDELPRAATS
438,354,002 *2C617A8EAF556F002344F495CD86B18B5767867F RODMANR8
438,354,003 *2C6C87B35ED4B2B41BF7F7B48C668ACC8804121F ROEZIGERSING
438,354,004 *2C6A0B43739E82D1D4EA76EB2EADFF799ABA9079 ROMAN.FAGNAN
438,354,005 *2C698D7504270A2D98EC36E7F8F44B430DCEAEB6 ROMI630726
438,354,006 *2C65FB64D19F320CCDEBEE12EA76507D0C3FDA97 RONALD.LESTER
438,354,007 *2C6ED860B8DF69A1C9DEAD2361852CAAAF048E23 ROXI62
438,354,008 *2C614DF8F2C449F24FCBA20C3A8BF656F88BD6BC ROXTQM881013
438,354,009 *2C630D375E7ABD80089DBC6B5BF18172103867D6 royce604
438,354,010 *2C6CC2DD370D249743660381EFD11D8CFA0B9F8F 7znnvzec
438,354,011 *2C6B51545CD07E0E07BD5DE3B8132C2A2FBF0499 RPCSTREAMBSW6
438,354,012 *2C69A833A46889F1531D728A0572BC39B9DE287B 7BSWYEMOHADBSW
438,354,013 *2C6E26589D12DDBBD4C06F51AB55880907E8E9B3 R)SL
438,354,014 *2C640B697A96298E51D1CA553DDC60E183309884 RUBRILINEATUS
438,354,015 *2C6AE71ECAE8437AD74D9C5DA9B1D650C7FD15AE 7ILOVECANUCKS0
438,354,016 *2C6E3EA9781A4F41DC15C5201A09010193BFB0C6 7iluvfuckoff3
438,354,017 *2C602E1EB59A1F8D7A3980F9FEAC4B0A67CA1CE7 7MACINTOSGRAY
438,354,018 *2C6501810ADC362848C8BE743BD78C7274CADCD3 7NEESKUMI
438,354,019 *2C6C2BC8D89E0358EB9DE40611C8F225B79DA169 RYGELIGT9
438,354,020 *2C67EFB71A0F484B44E00EDFCA4A12088576095F 8EMUTSOP
438,354,021 *2C6532576C42BA7126C3B8B701603D049449A59B 8ERTSBURG
438,354,022 *2C62DD8E7CB2D9316A6AF96E889D0EC76FA48A47 7TRIXIETAFFY
438,354,023 *2C608CB16FD874B2D1ADB6728D0649CEF4517FD7 7unreportedly
438,354,024 *2C66CB1F2D10ACBAA88E9557D738FFFB0806D0CE 7YOMAMAMARINO
438,354,025 *2C6260DCC329EE868218A48784600504FEFA46BB 8HEURICHBSW
438,354,026 *2C6D82F2ABC4E6635501A82477F00FAB7EAA204D [email protected]
438,354,027 *2C6D5FA736E48B27ECA7389FFE1D24BF87C73B96 8INTERVIEWTEKNIKKERNES
438,354,028 *2C6D629BC53E825C836D009DBE081D6AAC438084 8.L
438,354,029 *2C633DB2A13B7ADC9E120E18D88D89B254F01AEC 8myfreddy9
438,354,030 *2C65FE51F3DA5547454A504BD59999BA8AA5A899 samualniemela
438,354,031 *2C6BADEF6341CACC4C50CCA4057FB26CD7F97F07 8NVALTAUS
438,354,032 *2C67AAB4C545C787C0F9DC9D3389222409E51DC5 8##).`)o(
438,354,033 *2C63C6F72C4F2EC5A8A0EB44BB932ECD7603FE21 SANFORD.HILKERT
438,354,034 *2C62544B14C7F5679F5CA52AC0C30C7D44F82E50 }8{~-`-<#P
438,354,035 *2C650CC6259ECEC6FBE72E52CFF83FB5C11AD9C6 SCALDIC
438,354,036 *2C61C3A6BD3F1D9A7AF3E0C980DEB38F06F27968 SCOTTIE.DEMIEL
438,354,037 *2C643B5E74FCBF199643A8AC813193B10CDD6155 SCOTT.NEALE
438,354,038 *2C68CE8709F399CB8820FA33B27917F36000813A 8EWARIGER
438,354,039 *2C6E2C1C5D5093752A0D4DB80F554BFAEDCBD674 sedivtu5
438,354,040 *2C6003CAA57BB85A0DDB404356E71EB5476A075A 97079 BORCLARIN TAHAKKUK BILGILERI GORUNTULENEBILIR
438,354,041 *2C63F3F9E06641B36B707AA84EEBF7C5D966972D 99.vorgebracht
438,354,042 *2C6C40D1986FA24F6E48CF36A1F24187F80D06DE 8LIBRONBSW
438,354,043 *2C66D6786DE88A78C7785FBF72EA90F22946DA69 8MULTIPUNCHED
438,354,044 *2C67D6A064EBD0944A05427574E3F3032D834A2C 8NAPPABLE
438,354,045 *2C6B53B32073BAEF953A5277ED509CEA8837E097 9CEPORTER
438,354,046 *2C66941C773F2FAFB6FF1FD52B47B57744ADCAC7 9COMMONNIS
438,354,047 *2C622726588946536A9F54C9D194A38627E01829 9ELBATAREPONU
438,354,048 *2C621076D1B8779C91202F6C6D621D3AA2FB2136 8TAMMYJIMBOB
438,354,049 *2C6B608C7DF7C75A08C329739F34D66A6A3C302F shannonamundsen
438,354,050 *2C6973D03672D22A57DCD710F069535E07423C12 8TSJEKKOSLOVAKENS
438,354,051 *2C6FC55E57AFCD6141FA5E8C4803AAFFE0E8C98E SHAWNBOLDUC
438,354,052 *2C622B9617C695EEEE345F7859FEF88A29397FCE SHE4LTIEL
438,354,053 *2C61FD19238A563A6A6EF22C9E34EFDBD49490AA 8WIELIGEM
438,354,054 *2C6C5059D47BCF324B53980900565C56B76170F4 916QUINTIN
438,354,055 *2C6C59D2CAED6E84BDA7AB81CB054FCB69409334 987580 ltd.sti.ataturkmah.
438,354,056 *2C6D7FDBE622976CB8638021E44967E81FEF55DF [email protected]
438,354,057 *2C6B2B2DA3BF0580CE4BC7A2B53C4C7C4F157C63 9AUSBALANCIERST
438,354,058 *2C67B7E56FC09B4C48D785D2E692AA53C5B4DFD4 SHERRY-COBBLER
438,354,059 *2C6876191E83C67D68B7255BFF843F928D73B057 [email protected]
438,354,060 *2C6923C5227FBE08A170BF1C94B8B9F5B46E13B9 9ERABKURB
438,354,061 *2C6B3909DF851EAB92E21F5E6D0F657DEB6D5FDC SHONTRANSUE
438,354,062 *2C668730D6543C5EFB2F50C4799BF5A0C9591AF1 SHOWTOOLBAR
438,354,063 *2C67C87C29BABF2EAD008FAF61E52C6F8D29340A 9OGEBEVOL
438,354,064 *2C6432958248818CFF57ED08A5C9F85287A0FD0A 9OVERTALELSESEVNERNES
438,354,065 *2C62DF28CF1C515B783706460159C9729CBD2E3A shvaughn
438,354,066 *2C6F7CC11F8BDC10A16847E1A19CC65FB91E7B87 a2kt
438,354,067 *2C673377AAD8520A15E08130EF8B57601EE09D38 9WOODLANDSUZANNE
438,354,068 *2C6A9DE7F851B3F427D45D8E8243C0330209C853 a6
438,354,069 *2C66255B695E5189AC59B3D546EF3739738F938E a4w1;
438,354,070 *2C6B3C6D19AEA0DD7F0977FA532A1D5D640B1751 a6
438,354,071 *2C63DA7A84529075326E03E854CB9CD8AB18EDDA SIMONE-VASSELL
438,354,072 *2C6E10FF1B294CB746FCF7B82899712B21A957B8 AABSAPNIED
438,354,073 *2C6B06D0450FC98E7C7F764D56312E83352EFC3A aab$v&
438,354,074 *2C6680342120D24116348A89AADE06E1C612A9D3 AAD/CT
438,354,075 *2C6CF78C0B500568D22CFBD50978615E18CD4C51 aadu'c
438,354,076 *2C6F6FAAD1C73EB79E03C964BB3B284440B03620 AAB%_+
438,354,077 *2C664647FE0F42F32BC795A51DF84951753A5806 AA#QG
438,354,078 *2C65293CE0CEE2E40EDF332DAE2704846F145562 smallmodernjawed
438,354,079 *2C6E88AAD59A3ADEFEF2FBAA22514142524EDC09 ab<eb
438,354,080 *2C62FD32158AB87B2F703112F946138DFEDE69D1 SNIR-GOLAN
438,354,081 *2C65BA269BCFAA49D1E3A6ED33B6DB8B299C9CF4 SNOWMANPARKER9
438,354,082 *2C61211D7D72C89D71C9D89583F7BD90A8A0A9DF [email protected]
438,354,083 *2C67685103EDC3470DE691B03999577F5E0DC2C9 ABSVG
438,354,084 *2C6C827595D0894BDF4CD5A5EC062E661B5ACB74 AB%GU
438,354,085 *2C60B847334C647FEFC83BC399244129B23F46BB acn44
438,354,086 *2C6AD963FD10C1F8B8D8346242D1F3D3E4DBCE97 a!d!
438,354,087 *2C61CA2B5E4EE270D0AE3811AB35E96B9323BC16 [email protected]
438,354,088 *2C6C6025F54EBDA7E38CD879068D8B57A3D725F0 ABUBAKAROVICH
438,354,089 *2C61E612673137D65A7C3FF378EC679283019C03 ACEDEVILPOKERMA
438,354,090 *2C6C978A8701FC228FA28FCA87E8FCFE3C3C4072 A&EK
438,354,091 *2C6B67289379661254EFEEB0BEC79D4B65685CA6 SPLOKIZINHA
438,354,092 *2C6DFFECFD1EDB63EC667FE44DFAC71F17F7DE2C spnarita
438,354,093 *2C66F10A0B51C4908914F325DE29A46C241BA95E AFZ.O
438,354,094 *2C6583211BD1BD1026DF9F1D58EF55415DCFEB00 AF(O_
438,354,095 *2C688A12F6CE95134ABF4751DD5E4E1AC4643C73 STAN.PARVIN
438,354,096 *2C692F11E9981E178A19AAB4C06FB8EFC0E3192D STARBRANDIMPORTS
438,354,097 *2C6BD9DF842B0850F15E26A7D293087CAE684F15 AGUSTIN.FRIEDT
438,354,098 *2C63CBFC2B2127DF9EBC4811849BABDD966FCB5B AHTKOMBAHNG
438,354,099 *2C6003F16C906B075650D63FFD8CB6DE2D1964F4 AGVRL
438,354,100 *2C62D2F0481D96A61CEFE0F99087AD86D38C68EB STEMNIA9
438,354,101 *2C6451ADC4E01D2245651E3F6672DD81686F15C5 A.IRF
438,354,102 *2C6D4F62285CE8B2ABD9F640551061795C92AB51 AISLOKIT4
438,354,103 *2C6C8FF8DB66CBD52971E29B2759F884B688C45C AKU;Y
438,354,104 *2C695F433DEA46FC06208FE38E13C38662E1B4F4 al3a1
438,354,105 *2C680DA225111916A4C251DA009B94FCD0AA580E ALDEN.JURA
438,354,106 *2C696951511F71BD0AB4CB9B292FEF1992AD61C4 STRONGTIE
438,354,107 *2C683CBB19B222962659726E8ABCB47B4C3DFAC3 STUARTKOWALCZYK
438,354,108 *2C644F0A2EAFE208EA8007766FB91E7EB9D2B078 STUCK IN NEUTRAL
438,354,109 *2C63872105341788E94452D75050DAEFAB01A25F ALFANOSES
438,354,110 *2C6654C6C08718D0D045DCCE6892C0FD207BF252 ALETRAM7
438,354,111 *2C6F204AE1EB0660DF72C44CCA47880DAE8D29A7 SUBCONCESSIONAIRE4
438,354,112 *2C69866519E25477B7C4C86437BD041E915D9662 SUCEMOI8
438,354,113 *2C6A8E0BBF1872186679C647509843BA56DF848F SUCHKIT
438,354,114 *2C6ECCB69D0D067E2591D56BEF20672F41AF7338 ALI.URTEAGA
438,354,115 *2C695B54A57643258258D80B1208C6668035EE67 ALLABOUTTHEKIDS
438,354,116 *2C614F3B2028721704B8092894971A7B0C397230 ALLAN.BONDOC
438,354,117 *2C6119867D009427C5E6D316D5ED0BBF9BF167DC SULPHONYLAMINE
438,354,118 *2C65B197EB9D3BF610546054DA0D6100AAABC3AD allen.allgood
438,354,119 *2C6C4206C6F6B2692EC61EC43FB1FAF598DAAD66 SWALLOWING-FLOWERS
438,354,120 *2C6B61D36B582EF7B7E52736C23C1D38350F8F23 ALONZO.SWEETON
438,354,121 *2C6779E596A5C8C1514CBED9EF4D371365E84CBD [email protected]
438,354,122 *2C6FCFC24BCA03A38F780E48CE029A4D68189584 alphonsekubasch
438,354,123 *2C6BA264DDC57FE45DC8E5E91730C1692C628926 SXT3
438,354,124 *2C68DFD58A25CE564749725DF01EA413E963AABF Szemermesen1
438,354,125 *2C64A42FA0DF0E3B103FC6DB9EFD9C01CC0575F5 SZERENCSESZERZŐDÉS
438,354,126 *2C60BFAA038651CB22A74B6DA6FBEF298A0D7059 T142465
438,354,127 *2C69008A4D4CBC9999389AFB9BDAA6ABEF806DE3 AMAKANKELE
438,354,128 *2C6328491B36F00A587C26070D45E7D355DE6286 AM-6?
438,354,129 *2C62604DADCC69F516C588BFFF5EEF1BE02DCDB2 am9g:
438,354,130 *2C669C0145D9DFBDDAEDF5B8DCAD76AA06795C0E amanda-pulford
438,354,131 *2C638CC4D972D8A393DEE400EAA8097EA1879981 AMK:
438,354,132 *2C63564BFCB91672303A77F888D37273412FBD8A amintiri“
438,354,133 *2C6F99710CB0D17699301509127920FEEC4AEDAB an7cpa7or
438,354,134 *2C6DC637008ECAB0B5DDC65EEEDB216FE02A99DF amphigastria?
438,354,135 *2C6B7AEBF0D2CE3FECCCD8271D790726D73AB93B tanzmusik1988
438,354,136 *2C6F06319AE5FB260D1512451C7FCBEF764F02AB ANDREWPATANELLA
438,354,137 *2C6E4EA5170133E53B3516403A0B0329AF1858BB ANDREW-ROTHERY
438,354,138 *2C63BC9299865E27A7548DE8C9A5D3471FC81C89 angela.reimann
438,354,139 *2C689F37B8D4334B1AE86CC73574D57C9924A51A ANGELGUSSMAN
438,354,140 *2C6A6197E3A43E640D7AE0C0B29A0347DB259514 andydilliner
438,354,141 *2C6B2624FE22FB66E3C8AA3520D6EDAFCEC087FF ANIBAL.FEARS
438,354,142 *2C66ED382CB7D2A2BE6EB269DA1B501B862D30DB anilkumarmeher
438,354,143 *2C6FF985A7D01BB896F3973D375CA53A4B7DE62A terrencejarboe
438,354,144 *2C6BC36054D3E44E9540715D4CCDCAFED950C695 TESTARGA5
438,354,145 *2C65531165F12B5F18441DA87B96B2AF7F86745B antdg
438,354,146 *2C67DF0DF5CB9EA7110911AE1243FCF25BF5D347 ANIBAL.RUEDIGER
438,354,147 *2C6D504F0D6F86A9A49700DE23A416D39B332982 ANTONIA.HORRELL
438,354,148 *2C63308B3D565E5862DA1C8A5AE500C0A4826190 ao0ky
438,354,149 *2C6E385D8EDFCD4D35553768B39EFD08734ED6EB ANTONBARRETTA
438,354,150 *2C6DF68A1C141FC9F5AF6598DF764028D0E18E06 antonescrenci
438,354,151 *2C6C6B8809EE1C3D426359C7114B928B6A387E37 THERESEHORTON
438,354,152 *2C67B7364AB848E7DC91EB46121C73AF5001C018 therootbeer82
438,354,153 *2C6CC1E764B22DCF07152396CFACFB845929E65B [email protected]
438,354,154 *2C6E930FA9D21DBAB088E5915F55999EE785DA63 [email protected]
438,354,155 *2C6BCB44B15358183CC965CD88F5966BCC561BBC APPROVE6
438,354,156 *2C6D0E508E9E6C381C5DD5451AB8F2E08DF38E89 thisishorrorpunk
438,354,157 *2C6961746018C79B1BE0D0F53DED26B3E12F07C7 aqi"%
438,354,158 *2C64D55639797C4E7BF68B0EA88B05E3DD973BE7 [email protected]
438,354,159 *2C6B7658B83AA696BF69C413EABAF79C5070C628 tibetochinske
438,354,160 *2C6DEC305DBF779E047502F22D64BD96F99E20E2 AQ"GM
438,354,161 *2C610B0FD3017401F715DEDE34CE24B300A8CA16 ARMONIEN6
438,354,162 *2C66A7D3DE51B6A6C4657B5495DF3AEA85FF1764 arnoldoakram
438,354,163 *2C68CDD0D5058234B91EEE052E62FE48802B4884 A_Ro
438,354,164 *2C6F816E9E20D08F9FC4B90B6523098495ECFB08 [email protected]
438,354,165 *2C6D25431B7ABFF6B96EDCB94DB0EB59D93CA869 ARTHURCALVIN
438,354,166 *2C6A95F33ED169E021A3FB2055A546D003C97541 as5smpr
438,354,167 *2C6C03FB764FCE1F818E96999A911CAF1BB52B5D arwqs
438,354,168 *2C662E0640DE4C025F249C4A0C79C938D3F1F6A0 ASHLEYHATCHERSON
438,354,169 *2C6BD6C7C84F13B8571F1C15CF61AF3E52C2D48F tophetize9
438,354,170 *2C6343F3C3069AB12DA04B81C96A87D6B05957BD Atb3
438,354,171 *2C6C7A4B7D068E4C602CB59C232723B4D5804C94 attentionpkkloeppel
438,354,172 *2C634DD1689BF74C06C2F5E1CE6D64A665C82F2D ATTH
438,354,173 *2C688C4DA5C1BF77509B343D92E0E2BF72B5FEBC trenidaded
438,354,174 *2C6A355B8FB2E1D60E0CFF742A0CBE745594DBCD TRIODONTIDAE
438,354,175 *2C654C6FB4A595004BFEC1EED528DA22F5F12DDE truckaged
438,354,176 *2C6076BD12D94888360626569E2423BFC5CC9D2D TSEMIDDEL6
438,354,177 *2C62798417F18E1D30C6B1457D82D8049717DDF3 [email protected]
438,354,178 *2C64FCA83D05F784722CD425ACB7AA222E1F720E avgjutses
438,354,179 *2C69B955E2EC576E9E0B70348CFE0BD1D3C8C260 ayhm&
438,354,180 *2C66B0ECA0B092057254FE3323E9FEF188545FCC [email protected]
438,354,181 *2C6292F6FE761F99E7F0425D2573F4272A7E635A axaaa
438,354,182 *2C694779B5099153D6D3AC7C7920B7849594BC86 AX%M
438,354,183 *2C6DDADE549021CA91E4E7675BD15C229F10E4BA A,YHR
438,354,184 *2C6F911D80C0D0555D6DC69ED556E815F463C29C b)2f1
438,354,185 *2C626665A6D418994329B08FE133434430BC4712 b2gm4
438,354,186 *2C6A35D13590F865AA1875CD7AAB872672B4D399 T{YZ
438,354,187 *2C6A5C6B3E88DBBE622AB7CDA4BDDA47FF89D209 UDRZBAROVE1
438,354,188 *2C682270F174CC7A1E4C61E3C6531E8BE2F04E85 b2;q
438,354,189 *2C6E8990536B88CAFE8E28E190E68FDFB8E9E19D UnaNocheconFrancis
438,354,190 *2C69CCD94473940AD091A05A57CA67651DDC90AF b9f"(
438,354,191 *2C6A1F0DA1478E2601D1E5090DF944C256136966 \/baa
438,354,192 *2C6EAE997564F5BF70168D2C831F1F4C9D6B8AAA UNIMPLICATEDS4
438,354,193 *2C6DF327463F398DB46A740C4C194DE8264F7D0E Bang.Bang.(Kill.My.Heart)
438,354,194 *2C669950A08C4A8D688071A542A0D54C38EE1649 balw
438,354,195 *2C6AB9BEACD89937A0384DD812B5F6CF3F8BDF38 BARSANZID6
438,354,196 *2C6890DDB6C619E6728BADEA2FC355BEC5A9F1BB USUELE?
438,354,197 *2C62F106B9B047D4C83CE35107F29608F945BF81 BATMANONFILM'''S
438,354,198 *2C6810DC97915185FA7A3D4D3D5001DBC77CDD93 Ut.Mot.Havet.(m/Martin.Diesen,.Inglow)
438,354,199 *2C6617697A997DBF752F108033B7D1BD8E6D3218 BBIEU
438,354,200 *2C648FEB613CF11867867E0F70BCA7DDBE1BA78C bbpv%
438,354,201 *2C65FD6F40205CB9E3D12A74D92CE809A158FAF2 vanbrisentine
438,354,202 *2C6C48B8AF8B87F7106CA5260966841DA1442ADE vanilla?
438,354,203 *2C64ABFF228663B917927267E6A6F6CA9284C771 BEETS--B-IY1-T-S
438,354,204 *2C6CD3CBFDAA8454F1A8C9BB93DD33626D4D64DB B-D.~O.~O.SPLOIT
438,354,205 *2C6405E354B4ADF7B36114E685F82033FA36328D BEARCHRISES
438,354,206 *2C6CC618D9F69F039AD559940575E4C42CF80D93 vengeanceismine
438,354,207 *2C6EE2CDB83A98693E228D723ACC8BA38429B31F BENNETTAGUDO
438,354,208 *2C6C4188DE4E20E875DC92FB0BA514F72C90E9D5 BENNETTKRISHNA
438,354,209 *2C6349FCCB0A2CBDEC96ABFEA22343BED253EAB2 bentonkappeler
438,354,210 *2C6BE1948BAA70A7DE1853CEA446B1468FD09572 VERONA-CASSONOVA
438,354,211 *2C655768DB4FD79EF94B79CF277B12FE448E28FD veronica-chriss
438,354,212 *2C6512CC79D9C9DBC57C125ABB8400D2EF4C8D6C [email protected]
438,354,213 *2C6160A90F8B14624CB40D0A7246F5B6B430C2E5 VHIGHWAY
438,354,214 *2C6AC16B571860E7BABCE205EF0B832B39934835 BETOKENS
438,354,215 *2C627D5A3B38DCE9E3DC662E3450A7F93C26491B bezonians5
438,354,216 *2C6222092C9AD0F1A9E26595BB51B063114B4EB6 vick.thompson
438,354,217 *2C68AC6FADEAC1FDD177CAC2D0926C7D683AB3A3 vicky-gohatre
438,354,218 *2C61DF5226519EA7E030A9A07D402A741D91AA67 BENNIESTITH
438,354,219 *2C66AC9D62F4E80101B1C68864B75A7992D255CA bg5qi
438,354,220 *2C6644FD0C3679A29F3BF662C467365D860AF056 bernadette.richards
438,354,221 *2C607300865796D4F79D272D163399A730948385 BERNARDO.LEMBCKE
438,354,222 *2C6A0202D1EFF321FAF93A47905BC94BC6A5D766 bifurcou3
438,354,223 *2C68B786488CB6C81BB9047062C17402239F823F BESVERJA7
438,354,224 *2C61E0F68F4557A699C64A762EB44B8AA094BA8B BETAKEN
438,354,225 *2C62A3FCC72D8DA64DC3A56550A18B647B822AF1 VIRGINIA GANA
438,354,226 *2C66AF9597064EA51FCD0ACD6A9452B2FDFCB52E virus7
438,354,227 *2C69B0C062C3B29DE5219DBC089F784A21C3A861 bfw!5
438,354,228 *2C60F300A9EB7D3F6F7AD554453CEB933EACE172 BIRLIK
438,354,229 *2C65F737111B7C75E6B98E3EEB1F3404E1FC742D BHAWAN.1.0
438,354,230 *2C6A969147A1D56135243F1A2C847C8E87DFFA50 VPWOUND6
438,354,231 *2C6C74850B5355B84B532A63DADA85911BBF0419 BILLYPOU
438,354,232 *2C6E90215229CDB63C4237F46B1BFE445D2DDD99 B:K(Q
438,354,233 *2C629BFD56F9CE834F9D97A20779C5F3385E031A vyzna
438,354,234 *2C64AB5D5631F990D65AF380BD24EA005B48613D BI+UC
438,354,235 *2C6604432494AB0E364CD0FCBC7F901F6F418F69 BJJTU
438,354,236 *2C6BA8FC3629BD4E275738B0E3C6B0F6DC8E853F blg)+
438,354,237 *2C6FC4B01CF7A97EA8AFCE428D1DD141E9DAB0AE B-_LL
438,354,238 *2C6D8081F55EB4BB9E08B075B11D8A1762549FB3 blpj-
438,354,239 *2C6989930D96BB449B043F29248C19E2182F5D82 bnme2
438,354,240 *2C6DEAE7865606F210E2237BDA0827ACD3B11E77 [email protected]
438,354,241 *2C628C7AC545D3D879854032AF320EBF56F70DE3 [email protected]
438,354,242 *2C6897ABAD5192C6DA135A8D6021C028C77991C0 BOUDSA
438,354,243 *2C64A52C4CC0926F0D3E8C1878D6CC0BCBB9575A [email protected]
438,354,244 *2C6821ED277329F9122BDDA179F7A909FEC25CFD b%ow
438,354,245 *2C638DB11F511AA9D3C6F06E779E8C8545DA63CD bowtique9
438,354,246 *2C62F822160C15207E2F4FAF2EB47DC781776134 b(p1l
438,354,247 *2C6ED51192E5E0B2682E0757D1AF034F586E588B bpgxtbc481
438,354,248 *2C6147752E0933D5BBD881723BC2B3CF68DF4E3D BP!TG
438,354,249 *2C66A54F431FCCFED8CDA9DA305C14B2FB5D06F7 bqyi
438,354,250 *2C6E98184E502FBCF9BCD5146A66B55CBFE70254 WEZLEYFRANKCOMBE
438,354,251 *2C6D553F5C44928444A824461F5878974498355F BRADY.KONON
438,354,252 *2C6FDFE1C4FBE15304A7FBEF09BFA9DE083E2D05 WHATSHISNAME
438,354,253 *2C60E17C41E86548ACFCCC4173BE7D1F206D39FA BRADBOWLAND
438,354,254 *2C6C6C6420291D280BD3834D46D3A044E925F88B britneyundergroundrehearselsmtvvideomusicawards
438,354,255 *2C651E0319BF9ECFF6B557281B5DCAC76A17D0E1 WILLIE.PRESSLY
438,354,256 *2C6A7AAF1D5B770CA52185746DBF3175DEBFD7CA WILLIE.SWOBODA
438,354,257 *2C65F3DE7E263E429C389CF1E0A970E9D016D0E6 BRDC!
438,354,258 *2C6B8D4B326800BDAE29F09B7ED02BAE69D87720 WILSONBARJENBRUCH
438,354,259 *2C6C56B3DF81214D2CE45BA5FD1CAD5FDBCA55E4 BRETT.GILLISON
438,354,260 *2C62A37EDA790B5E1D64E665013065EDC4E193AA brettholowell
438,354,261 *2C6D9A46A5DAFDF4AEA291B950F5772700710409 WILTON.LAVERNE
438,354,262 *2C616D41D04F9683FB2765E7617A3240206CCC0B WILTON.MCFERRAN
438,354,263 *2C6FEB152B2AA672338F3BF2959C2DBDF32B95B4 BRUIKLEEN3
438,354,264 *2C6489B2E3BFBBA552F220F19E0964A418D56FFC bryanmetaxas
438,354,265 *2C63C58056AA4216038323787A13A07992D4657E bryonsonntag
438,354,266 *2C649FB08EB1E750D808BF9350DE110A5288FA79 [email protected]
438,354,267 *2C66EC81743CE39BE6DF8C4B1D409BDD5A1B7448 WNFTPII7
438,354,268 *2C672EE2311ACBA4805C7E729F9AAF345875EB9E woody-groscost
438,354,269 *2C6155D335AD8FDF0F0FA9C08734E204EFF98288 BSPEERE
438,354,270 *2C644A7DD80B6B104F427EBE0D6AB1EB6704B563 [email protected]
438,354,271 *2C6BAF16DDBF3F58772F61645DA343817DFAFA7C bswmanuveurs
438,354,272 *2C633E6F6DDBF130B5AF70C51152E4BE5858D584 brs,r
438,354,273 *2C634C7B46E5ED401F491ADC3777AD803AAF50F0 BUDA–TEMESVÁRI
438,354,274 *2C6C0BD08051214CCC39A0FBFE9A3B2EED13E29B [email protected]
438,354,275 *2C6177B76DFD06EF126AADD64381CBB12D2E2E39 BUNKERPRED
438,354,276 *2C6E81CB4E62F7241660DF75EA9F61AF9D60CF59 burlpresti
438,354,277 *2C65F89B25F890C7D336725F3C869FA933DC4881 burtbollacker
438,354,278 *2C62FC25CB22D66AC428365DA0543D87BA5A2B70 B###>`~SPLAT
438,354,279 *2C6BBA19246010723EB5501865B0881925D41E68 b_ss2
438,354,280 *2C60197AB2DBCEAFB3A764F91D69846C770EBC6D BUSTLERN4
438,354,281 *2C65C582F0B25C3BB84D7CFDF6F4AAD955DCECB0 BSWKAWAKUBO
438,354,282 *2C690AD370F6B4FAB00D195BB5EB484E37F48BB0 but!g
438,354,283 *2C63FD01B607942DA145A651B041795829B09AF7 WWW.COMELYPARK.FALKIRK.SCH.UK
438,354,284 *2C67AC6309C6E24671748B997CEBA86068D67971 btbig
438,354,285 *2C6A743C2640B79BBEBDA82ECB37C9A783A1BF60 WWWINSUREAYACHTCOM
438,354,286 *2C637F6D29F00CDA47922270248EC5DE1D254D5D bvqs8
438,354,287 *2C6C15EAA4F8D2307CF443BF5855EFB71ED3A1F9 [email protected]
438,354,288 *2C6E1A8555BF6A37EF38B2236B2A00521400DF78 b?uc
438,354,289 *2C6FF61C864A80F6A36B6AFABD1E43B289C5EE47 WWW.TYPEDESKREF.COM
438,354,290 *2C6AFE7A662A06E9D80BB077C76CEA493FF6D5FF bwbrq
438,354,291 *2C65E84D8A752946C997714E3C62695273A3B8E4 X151985
438,354,292 *2C68BCA288C5A1CF2B655C1099A7E8A6C95D6CE9 bulacanizakon
438,354,293 *2C61847F840000484EC7F457557D587E6345C832 XCHEROTWEIJIGGED
438,354,294 *2C69C5DA5B252A74A371C9A709B68AFB0B577636 }X{~~DQ
438,354,295 *2C6821A8AE4E7A4E3A65933B635FF21FB3E517CF C0N+RIBU+0RIE5
438,354,296 *2C6341AA59F4C058AD9A8ACFDA97FE3206AE763B [email protected]
438,354,297 *2C6E87A94B3E4A13C6857D8FDAEE3019B8C8F8CB bz#wg
438,354,298 *2C6BF4FADEA20165D4A96A9876D821CF0D2526FC XXXXBUTTHEAD3
438,354,299 *2C6A8B914A40421F375A6659C6C9359143EB16E9 C1NX
438,354,300 *2C6C5FF9468070CA391DD41BB77C126FB6B035BB C7/&K
438,354,301 *2C6B6837A986910CCA88F0386C79D7B77C623F02 [email protected]
438,354,302 *2C6B2BA962FB22647E2247B4055161B77941E0A8 YATHARTHMAUDGIL
438,354,303 *2C61649184A6B6C5C62D9D1343483F1D7EA10393 c.93p
438,354,304 *2C64DAAE422736BBEA80B758FB8FBB9F0A3F1435 C9eT
438,354,305 *2C6854394AB0BE47961E0B11F6BBAC6EBC754E80 c5+se
438,354,306 *2C6A6E323CF268542D77D637E859DC8F1A28AB89 C=%9
438,354,307 *2C6FFD4065DED01089CD7B9A0568CCBE298B7990 [email protected]
438,354,308 *2C6F88464A98E0D310B204F60897FC35C8C94953 CALDK
438,354,309 *2C6BE610677B2720EA04FF4C7AD4DCA7B6252103 CAMPAN0109ST
438,354,310 *2C6B3EF664D148701E1B74E2B613E8CF412E6117 YOUSSEF MOHAMED HOSSAM
438,354,311 *2C6199D70673AE7EDA1F8FA171C32817245A36D1 CARIANDO1
438,354,312 *2C6F45C53ED068B6247B35801CB79297C5B2543D YTE.SALAJEGHEH
438,354,313 *2C6CE13A0779E8D52BD7886266FB4605427670A9 yuki66
438,354,314 *2C698701C7FB1D15273F6488C7FE853144643565 CASTIRON735
438,354,315 *2C646C50B09C916F65142D7916FA4093B2433D8F CC0NI
438,354,316 *2C63619007EB65FE6A642DD4C6D5DD63372AC244 cavallerieo
438,354,317 *2C6135BCAD6CF4718CEA301DB471DF22F6AB7253 CBFN
438,354,318 *2C6117BFA0FF51725375798EB6E9C0D700CAFB75 ZAICHUN8
438,354,319 *2C6CDEAFCCF6ABD1D0873597357515D738F121C1 ZALOTNIK1
438,354,320 *2C687F2A337DF386D658C0B50FB9A616990BB0E4 zarmeen-mussa
438,354,321 *2C6C61505A16DB186DD34CE998FE15D07B573BF6 cedinnffb
438,354,322 *2C654B49DDB0BBEB43E742113AC198873222BA9F CENTILITERS8
438,354,323 *2C6ACA8E1EEB30A35340203861D8E4C12F7BD6D7 ZERELLIUQAMEDING
438,354,324 *2C6FCA2A7861D66E2EF56C1B4B16F8578A8C8908 [email protected]
438,354,325 *2C6CDECA7BB42750F94313E35B07F6D40BF5502F CGD+W
438,354,326 *2C6B5B66244CCE9FEFCE6290F20CCC7921BE64F3 chancetiznado
438,354,327 *2C68DB6038604DA692080E9481AFDBD56C64D2EA CHARLESYCM
438,354,328 *2C6AE591158124CD5DE892F0C1BA2612B443ECFB CHARLOTTE.VAN.HEERDEN
438,354,329 *2C61F4F8ED131B962E9DEBE612971E63D8D52EDA CHASMA-I-KAUSAR
438,354,330 *2C6B9770484310F2C69C1D61D80D0C43F3B85FB7 [email protected]
438,354,331 *2C6C6D728CB08FB448815E54FE2739EC2E014325 [email protected]
438,354,332 *2C60566C36A34F672CCA178997004BA84A0FC2F1 [email protected]
438,354,333 *2C62334849ED275D66F960DA38E24B11DFBE680D [email protected]
438,354,334 *2C6277DEA753F3F33151332DBF24E1A592E29D66 CGTQ
438,354,335 *2C63B34178A6CBDE8F4F60991FB1F9307BA0EA82 [email protected]
438,354,336 *2C67B047CE68461D5FE1B67707A6BD1ABB774000 [email protected]
438,354,337 *2C6A80AA24BA6BA95AA5725AE5766EFAF0BFAEE5 [email protected]
438,354,338 *2C60301BFD32C9BBD6D27C53556F542D5FECA91E [email protected]
438,354,339 *2C62766C39705CD4F4836CB3E780B431BA7F9D23 c)_hm
438,354,340 *2C6BE81C13D8BDAED79EAA77E78F10E204417F5F CHASDOBRASZ
438,354,341 *2C62529605FC9C527014214FC919B7C4BB3AA487 CHASMIDDLEBROOK
438,354,342 *2C61D17AF69759642C042F77FEDFB53EC8F118E1 chau.duong
438,354,343 *2C6D4A6B8AC71F405A4AC179EE653C31733F6238 CHUWG
438,354,344 *2C6CB7B74214F071AF34AB891914530135038DCF [email protected]51.COM
438,354,345 *2C68A9E99E86E353C8E44A19D98FFAFA6448CF0C c+ip3
438,354,346 *2C6E4A0B005786CFE76179B337A9E66D09B0C589 CJGHC
438,354,347 *2C688935EAE977617CCD9032470A55AE44173F1F clarkwinslowross-mcgillicuddy'srant-nostalgic
438,354,348 *2C6CD8B4AC36D22EC4F03A15AF2F2031DBED0604 КОПНЕЊАК
438,354,349 *2C62854A1FB0009A5D98C1840D7B2AFA127EC775 choi.eunmi
438,354,350 *2C6AFFEE0B4D6069F0DA6FC65DF6936DDED7BCA9 CLCFYNGGING
438,354,351 *2C61403CF5AB3352A7E30160CBA3B433BFBA3517 Chp"
438,354,352 *2C694BA6FEF0BB095D111BD894B721DDA16A6DAC CHRISTIAN.BERENSON
438,354,353 *2C6DB333953EBACF548714E922A96B8C92C6DBC3 НАЦИОНАЛИСТСКОГО
438,354,354 *2C64FC3A312900898609817B74954C213F58EC95 christophe°
438,354,355 *2C68ED58BF34E8F320E69A7CE3E549D658CA37F8 CLIFTON.BOLEN
438,354,356 *2C67F4A81EA35DD7BA91E1AA021D0751FC6E50FA CHYBNE
438,354,357 *2C694ACEEC63882A7642DB64710358F6FCA8B0D4 CLALD
438,354,358 *2C690BB873629A4B9A05B7226FF373BF9CBF7703 columbia-respond
438,354,359 *2C69AF3DF82760D97D89EB38712C6B33EF722F02 cletusbrendel
438,354,360 *2C6E287DB1212C9B007881CCBF07A96DF087186A cletuslograsso
438,354,361 *2C62DA8B81E93A21A1AE44B940ADA8711E9264BB CLIFTON.ZUELKE
438,354,362 *2C6719E4C83324C5CC978EC2086EE51089D9B0C2 clintonholien
438,354,363 *2C6817DDAFE15B277968E3C14FFFE5D4DC607837 COMPLETECOUK
438,354,364 *2C63E8537F883E798E6C7B76088B8E851BD77709 COREYRIDENOUR
438,354,365 *2C6E324F8793ED7262E2878A1572C8C4FD3C7013 CODETELEGRAM
438,354,366 *2C63E833085A682DCB84186462E99C1D1C216CAD cojih
438,354,367 *2C6D47597A5B0EE578268285CBB9EF3BC6CA79D3 CONSOLINO.
438,354,368 *2C680FD6E18DFB79F5B08830D1AD0B212991D571 cr(#c
438,354,369 *2C6DA0F595F00DB6120BEC876D053337CECC3317 CREED2001
438,354,370 *2C6AD7D2D1685EDCC21541A4CD983073000CE3ED crvn
438,354,371 *2C62E2309A5931C41EFA0FF0FE5FECC50124E035 COUE
438,354,372 *2C6009423F93C0F4ACD224812D980FCF70131E1A CPP=O
438,354,373 *2C637A5214DE3C81AB74EB6E177F9CF4AE5DCAEE [email protected]
438,354,374 *2C622288AC05643226B486D8375D1C554F9BCC1A C:\PROGRAM-FILES\CODEBLOCKS\SHARE\CODEBLOCKS\TEMPLATES\WIZARD\GLFW\WIZARDPNG
438,354,375 *2C6607D73C0E1D27E567AE7A314F982CA39077BF [email protected]$
438,354,376 *2C64FD598B9FB518CB68D7122306242FBA23294F C:\WINDOWS\MUI\MUISETUPEXE
438,354,377 *2C6608DF6764CC31BCDA49F3D09054A194174618 cpy0w
438,354,378 *2C6D72E77FA6C27CFBFD8AEEDB7C82E11D03A656 D0HM,
438,354,379 *2C641110D42FDF1C0EAFA030847E84414D5BE4EF crqwq
438,354,380 *2C6A9D79C553887412EB44CC1351E8B7F6F2B59F cruisin'-with-randy-travis
438,354,381 *2C6784DFC1C3624AE6AE3FE5BEC3E79152A202E2 c%sr
438,354,382 *2C62308F2A85A121B931904E29539A49B6E1AA84 d3pv
438,354,383 *2C6A697A91C9EF1EC891FE62D8E8772F5F74D2AD CUBAN BLUES
438,354,384 *2C63A261C0458ECBE375EADC77ACC2D2F8A0DEB3 d9ruf
438,354,385 *2C67F6B67574A53A9A537F9F6DE19CD5E05D3EE1 cwvm3
438,354,386 *2C67BFCFE9E1FDC41A69096AE1F6311A1159429F [email protected]
438,354,387 *2C6475140A36F58228672FE0ACAA4C956007649A DANILO.PANNUNZIO
438,354,388 *2C64FAA2A8598DC695F1272E72D6850F171DE3AE DAN.LEPISTO
438,354,389 *2C674F5EFBE0891A11C1FB099139F44944C71487 CYHr
438,354,390 *2C6C1C2E16D2A2BAD7E730BDDCAAF58EA76E4DA5 D08VS
438,354,391 *2C6DDA355A71BD082C653076ACAE4C604746B013 DARRICKMONTER
438,354,392 *2C6083FFBB728B99254714AE2E06E103AD2A27FC DARRON.SHEA
438,354,393 *2C6F679738AA8C8E18A3D4612E8C9C649D4FA23A DARRYL.SHANKLE
438,354,394 *2C6F2E3836294E1B762EB4EDA5E086A869D7F730 D3SCOUB3RLHO
438,354,395 *2C6D5395B68728EFC1F216F7DA43404C41689CA3 d3u8v
438,354,396 *2C6D9C47A5FE3A32C89DC6D11769B9B596B1A096 d8%kb
438,354,397 *2C665031711BA43E14BD04283A8CB42A8DB03D8B DANIELLE.GRAY
438,354,398 *2C6F3C6E330697890CFC64B2A00B4A18634207A1 DANNIEDREWS
438,354,399 *2C6F6677E6A575DB89FC99C69896B3BA3D3398B9 darinshort
438,354,400 *2C6485DD4B8DB4EE93B684808443487693CD81BE DARRINTRIM
438,354,401 *2C6FA70AAD575912F3FAE430D219C936594ADE84 1-combined
438,354,402 *2C643908E2B5F80FE3676B67D2AD202F213A9409 d?#c1
438,354,403 *2C6FAE66154DF368DCB0D176194619BBD4909B31 DD2PD
438,354,404 *2C6C5BC0DFE85F353319CD92CC26DF7A93A088B3 DEAFENED
438,354,405 *2C6ECEE4A45467BE3733EFFEC85DDA6555E293D4 DEFLEXUMS
438,354,406 *2C652753E8CF55BFBCCB21A4489470F4352F4702 deformeds
438,354,407 *2C60FE60C2E32537C4A8CB4E9E722ED3F3B90986 DELMAR.GRUNDY
438,354,408 *2C6B7ECA203B6FD4E503A478BDED341E4A825FF2 DELTAPPA
438,354,409 *2C6B7E68A9801F78D36C64FB4340DF46BDACF49C 1MYMAYDAY1
438,354,410 *2C6BC6CF1B30F357BDD273D0DD8D3CCE48DEF630 1.normaalikudokset
438,354,411 *2C61D8C3F86097BBF13D31CEC86068500E01E605 1PARADOKSINOMAISUUS
438,354,412 *2C694E552DCC1C80606A63FBD632234253155B5F 1.puustojatkuvuuden
438,354,413 *2C6EBAC94A58BD96BD7AD05225A0EE57921507EB DERICKSCHROCK
438,354,414 *2C6AC22C79A0074B3CBD16BA7EFEDC2A3264D504 d’esmenard
438,354,415 *2C6922C2AA0C0E09059F70B5C6D9AE50F0323C06 DESMONDSCHLECK
438,354,416 *2C6059E4C19550D35EF2D56EDDA3FEF0FEA9611A DESMOND.VOLZ
438,354,417 *2C68826C9F646E76644A50DFBF1C102147AADE15 detbedsteafdanskmusik196395:presentationscd
438,354,418 *2C617240DF9283FD882A6CE5BFA166E38BB60E2A 1sozialstunde
438,354,419 *2C68AACF51B48B4EF74A1AD5CF32A4BEBF1BD48F 1 textnachrichten
438,354,420 *2C68BE594C5A156BC9EC4176D25082407987AB67 dezembersitzung
438,354,421 *2C683FDE7D37F6A5BC30A796A3EB0D31CBAAF585 DGV!R
438,354,422 *2C654AB58BC9E7D1FE05DD16B26A0BF88E9F6A16 DIETERLY1
438,354,423 *2C66F49DB410D61198C6F8C47A8485DD7B9BFBFF 2326566 vuosina19831988arvotkulkivaterisuuntiin.
438,354,424 *2C691F1BA158FF212F20381182AD73E5FE1AB659 Dj9L
438,354,425 *2C6A64804A1B7D72754DF12E33A5617A64E611B1 djx.
438,354,426 *2C65C9EBE3C64A0615EB0C02AFE71C31114A5C5A 261490 laakkonen.sai.kenk
438,354,427 *2C605DAD984E69199190EDF34FF5759358EDAF9E DOMINICK.LASTRAPES
438,354,428 *2C672E44FC642CBA04FDC9E3B69E42DFAB945A25 [email protected]
438,354,429 *2C6C4D71DDB307874D8B6E94568596E3F651F603 DOMSCHOLASTIKERS
438,354,430 *2C629D4717A3EF403DD42C5F3B750A6EAFFDEB0F DON.MARBURY
438,354,431 *2C6DE01AC4DFB7F43A797599CC34EA4C7A0FCC82 DONNAED4
438,354,432 *2C6EFE38897367F38BFBB7BA7751FA9343FA419B donnieseiler
438,354,433 *2C665C6CD852C992980758CC6BEE20C55BD4C903 donnguertin
438,354,434 *2C628BA9677D6222809A622859B24287BA3B5738 donteryans
438,354,435 *2C6F39108C39314177EE19CBFD8EAEA4BA8BA851 2NWRTHNG
438,354,436 *2C634B1B19EB54B41090D265D9BF53CAE339097F dp42"
438,354,437 *2C624DE2A8D90224AC44AA01D7542BF372AAA31D DP(D6
438,354,438 *2C69BEBD8B6CCA1D8D024C8BAF4FC3F0F8E34174 35.freiholz
438,354,439 *2C63998A320C0895DB75C4C43782676C95C36731 3LEEHELM
438,354,440 *2C63E6AF1B6373071C8DCB98E3369E0EE773D1F5 DS1G5
438,354,441 *2C6C6AB3AF2CA4DB838B9D2907330C835BAC2588 (4.4) if-a-potential-channel-exists,-label-it-"p".
438,354,442 *2C6C581806ED197155B89202773E89DD076E46C9 4AVATAR
438,354,443 *2C6C26D6C989537AAC0593740EF895E960943D83 DU1WW
438,354,444 *2C6FA13E826C852B8AAEE09D43DA80BC04065527 4.koulunk
438,354,445 *2C6C14CED0F24CE5FBDFA61AAE8BB15AAB38A117 4MLDNHLL
438,354,446 *2C6347F2BCCC5AFA04E68B222A601AA1A6036562 DWG,N
438,354,447 *2C6033CDB0302E9C54D9337C653D25A8518FF818 EAMAZON6
438,354,448 *2C6D1A1B0C018C17F0B6DB0F16FEF69A21AE438D 533498 kbbforum 1 ( 1 ) : 1721 , 2002 .
438,354,449 *2C6BCEC4C5AE3C27791EA2129BC734FBBDD60B83 $EA-$ALT
438,354,450 *2C656F8C26280F01CAFC99E4FD6DE5BEA7CCF48F 5622DCZ
438,354,451 *2C63CCFB54266611076EC24AB71A710291AB0AC8 5BILLSPECIAL
438,354,452 *2C67D35F74868B33893EBD19321BC3FDDBC2BDEA edwardwenner
438,354,453 *2C611C36105F8F85B0F47B0D5C154A9FE5447991 EEMABSW5
438,354,454 *2C650D82C9F3A51B58446367019F84B761D35B3A EIKERIO
438,354,455 *2C6FD714478B799BC0C897D24117770E500D8383 ej%t
438,354,456 *2C60655FCB9C2A20196BF9D37260AA2494A5464B EHBB?
438,354,457 *2C61D0FD472461D5B81DD413C8EC75C57055511E ELDORA
438,354,458 *2C6FA9F792F4BF3A32D845D846B98B29C4683324 eik1.
438,354,459 *2C68C6510C67618B51EFB564FFE3D9B5C715F442 5SCORGEREBBE
438,354,460 *2C6B5AC8D9B17EBDC3537D6F81DF8B11F8A9BC2E ELROYHELLAMS
438,354,461 *2C620123C17F76F0D6AED9B03C3DDAF6B4AEC6D1 ELIAS.BOSTOCK
438,354,462 *2C64FA8A6E1DC313DBDBFDA52D185AF8894741E6 EMBD
438,354,463 *2C6D607E6429C4AC8F65AFDF54E7A94E6A808907 6BSWKNOSKEBSW
438,354,464 *2C6AAB0809AE93D4022DAD50711C6191430005EF EMORYMILLES
438,354,465 *2C668D959D9E6082F935D2D4D622EC0201F89658 6DDSSTRJD
438,354,466 *2C61FE13A70C070ED41A45D3768F4F0CED5DCBCD elwoodbrignolo
438,354,467 *2C69B38ADEDFF0C07450FA257372402512E33BE4 ENGLETINE
438,354,468 *2C63C7B4F552C7ADC3A25D61E5BDFFCEE100082A 6iluvsugar1
438,354,469 *2C6010996503FD52FD0DF30ED46392ECC1813791 ENTSCHEIDUNGSUMFELDES
438,354,470 *2C63316C8A1E5D85991E9F68BF612C402D678B11 EPIZOON!
438,354,471 *2C63D721F398C52742B7AC076FB38B2C43115742 6ONTHARINGSMID
438,354,472 *2C6CB7800DAA00A25B635724BAFF13091A9EB9D0 6PRESSERATISQUE
438,354,473 *2C637BDEDCE746DFAF857AD40600858AF0326651 707118 ainasilloinkunjuon,niinsit
438,354,474 *2C64D76363FA9E2229056483588ADB7AF512C331 ervatoer4
438,354,475 *2C656F72183A925CA133A384B09F8BE2B5F27298 ervincascia
438,354,476 *2C6D6F32C0647C4712C72966DF5E8AE9ADA07A2A epastbsw5
438,354,477 *2C6EBC9371A6810BAD825B66045EDF67E6E25557 EPHANTOM0
438,354,478 *2C6FB6B77E4D66EF3A4ADB3F88532A21D905F22F ETHYLEEN7
438,354,479 *2C630FB979CC4EDD9C662DDBBAF24FE1DB7B2FA1 exhumes
438,354,480 *2C626B5DF6BF06BFB052CF387A2776C70F8D8BBE ERVINBITSKO
438,354,481 *2C64D687535584040A8B60A562AA90FF2588FB61 FACULTAD DE CIENCIAS QUIMICAS UNC
438,354,482 *2C6E76E65683227FA98641FF07766C43ACC890BE es$im
438,354,483 *2C6FCF3EC9B2B82A937FB1F5DE508EF204846A5A 7ZSIRJUCZNEONFC
438,354,484 *2C663BDE341AC75DD0200387DFDA7DEC6A7E22FA fattistsed
438,354,485 *2C65095D9C778258B2DF66016E3D2CC853F7BE07 EZINEARTICLESCOMTAB
438,354,486 *2C6112BFA2A662FB9217C864E4D890E9B074D6F1 ezrapebsworth
438,354,487 *2C69C343C7537EC6A64D9F6F8E0D59B4E6565487 8--p.~.~.~(~_^)
438,354,488 *2C62E187BF41134D47D3F522F4A1CF067C1C47EE FARFISAS
438,354,489 *2C640F343123459ACD1F7B6342AF443BAA852BBB favreshant
438,354,490 *2C6729A818FB3EC7224E38F87CBA2B1C42CE7B43 (FEAT. BOBIK, ZEMBER)
438,354,491 *2C60CA80FFF087585D3045DB34C515178C4F2937 felipemarshalek
438,354,492 *2C69C69B6FE96F49E1628E6D391E9F72FBFC25DC FLOWERFARMCOUKWWW
438,354,493 *2C6763B96CBA5C29EE8D2DE51E0418FA88C5E278 FLUTE.NOTES
438,354,494 *2C6B32713E80478650F52DB8167F09D7D9F0A981 9FIXOVNA
438,354,495 *2C6942D0CF906CAF205E2B9CDEDBCC4366453E2E 9HRNNRNGSBLD
438,354,496 *2C689473E386109C890647DEABF4EB24AADA67C6 FILIBERTOPLATEROTI
438,354,497 *2C63B0583BDB7ED624237CC3A946349BE5C9E41A 9TEDDYMETAL
438,354,498 *2C6B28A658E1AF9ABF2FD9A6FCDE660C3614739F frankiestahler
438,354,499 *2C6F2D00AEB9A4FE9574AE0B75D7A6993261564C franklaughead
438,354,500 *2C62379A18AC7CA02EFDAFB05F25ED352C3A8394 9YLIVOIMATEKIJAE
438,354,501 *2C65EEF13E30868C3574186763F19B6D8204A6A6 A0KHF
438,354,502 *2C6CA03BA50F8C94C47D264708EFB2D12FE8850E a6
438,354,503 *2C692ADD95A2CEC01C42EE10ACD2BE707C58DB24 AABEF
438,354,504 *2C683914B5A170B0C5B4820D08E17B494890BE67 [email protected]:
438,354,505 *2C6DF53E4CE3EDF912A812D4503D40EE9AE21E80 FREDDIE.WAIGHT
438,354,506 *2C61F0AD1C5CFF35F03FB2E6C1C2DC1BF16C20B5 FREDDY.ADOLF
438,354,507 *2C6E0B75BCBE8C3DFE9762716D8CB694D6E05824 [email protected]
438,354,508 *2C6FA492FC39E8DAF5F2D29AB3330E0029A2BF6C AAE4_F
438,354,509 *2C61FA08652E0376430BDA5C82D7C074DE28D9B3 GARRY.HEADLON
438,354,510 *2C63FEEB4894B2601D3C55D97EFC211873D92949 gary.minge
438,354,511 *2C6891D1AA082D27AE8B073578AFE9FD9900ECD1 gaylegorsline
438,354,512 *2C6A32A4F2699F71278DEC5E3E840D21B0C89C39 [email protected]
438,354,513 *2C6967E94467F3ABF84C58789429E9587D8553A1 ABANIKI
438,354,514 *2C653BAE46A32F612F6D5E4E68FF05E97A353049 FXUI
438,354,515 *2C6FE9F00522D6091BA9DC876CD86085B3988504 FZWANGEN5
438,354,516 *2C6E1918B1FAD05EAFFA0B85F950DDD245A6BA27 ga13n1c
438,354,517 *2C690D8E7C44AF06C50745C0AAD7A21C81C86E6B [email protected]
438,354,518 *2C60217DCAFA02BBA911D509D0AAB656DEF3FDE7 GAO-NILANG
438,354,519 *2C68014330660484F625687F29A16758F3100AE6 geruizeld8
438,354,520 *2C661FA7103E7AB65B767DF27992198A39C1147F AEKSM
438,354,521 *2C6EFC37E39212A7A363966A342D29A366BDA454 AFpk
438,354,522 *2C69692479120CAB15FB9BB03A0FB71560987AD0 GEMACHTIGDE8
438,354,523 *2C6E983F8E88E4F1531544B7924488C355046B91 GENE.KOSANKE
438,354,524 *2C64DC537995DD4951D05E64FF980B790BB2CAFF GLWCLRRE4
438,354,525 *2C6D5D33464A81F9892DFB8F255F9E77CA78AEE2 GENIUS-LOCI,-PART-III
438,354,526 *2C6F11DEAE959C9C41F41092FBB48BF38C5A600E GERALDOBRALLIER
438,354,527 *2C69F1E1453011DD858D9FFCC19B1EA7C420B420 gobetween49
438,354,528 *2C64C515D491B41C274DC23497EDDD88B06E49B8 a=hot
438,354,529 *2C606C7AFEFE16104EEC24CD36023C680023DAA0 goran.mitrev
438,354,530 *2C6E2FC2F4763252E3D3450B6272A4E999796018 AISIAHRA0
438,354,531 *2C6B25547343F97083638E49D7E75BA8C78869FB GREBENAU
438,354,532 *2C63FD520145F9D4829F162F3AF43D5897E84A02 akushiding
438,354,533 *2C6B2AB3A960148D42C3C28D3CDA0CAB750712D7 HASSANDOUGAL
438,354,534 *2C6285F7F074B770BA168C132BF779BDE301460D haywoodstandafer
438,354,535 *2C629CCCCBADBCAC9BCC03B211B7741565D5E429 hectoramejorado
438,354,536 *2C6EB917F768E92F12B33DABA31A9F9866A0EE31 help! asia (ziggy x mix)
438,354,537 *2C6DF87436EC989334E8E0C5F40449AE353AA6C4 hermitderzeitmaschine
438,354,538 *2C69543C8B45DC09658B86042BBD6160569BD0D7 HETANBEI
438,354,539 *2C6C243789F1D612854CBDBB624AC18D22240DDF ALONSO.DONTEN
438,354,540 *2C669C2DC5634E4AC28551CEF8AE2C4BC4EEE3C6 [email protected]
438,354,541 *2C65BF2E8A2FF2DF96588416B4EEFF99DE5E6106 GLORIBY5
438,354,542 *2C6E3EBB325C125D193DB2857665C7B0155097E1 ALVARO.APYUAN
438,354,543 *2C6497ADC58DBDFF56D6792CCE1A6410B18ECBCB [email protected]
438,354,544 *2C679A21DAE9C0E3CB0CFE6F22371265AD4C0FB2 HOLZSCHNITTSARBEIT
438,354,545 *2C6A86722AB6F9DC2D7D996E4F325DFC8E21EB8F HOYTBLEAKNEY
438,354,546 *2C677CBB81AA8F949FDCE5CFA06C0000CE04A138 GREG.HUELS
438,354,547 *2C654410DF6C7E9663696709F66833DF34794A8F GREGORYCORDIER
438,354,548 *2C6F67B457646356262810F37D9F124B9AA8BB61 ANGELA.ANQI
438,354,549 *2C63147C8F0E63AD0545EFC6C748E5BC5C457C24 [email protected]
438,354,550 *2C668B599C3C3B8B2EFD4010AE2D474AF1C66793 [email protected]
438,354,551 *2C60B434D336C923EE8230B8479C40BA6FD2503A ANIKA518
438,354,552 *2C638FFCE8897707965CCC47EA1D44F038D41EAE [email protected]
438,354,553 *2C6A3074AE91F57395B13D34F1E6E24457107942 ANTONNISWANDER
438,354,554 *2C6BF3B9FBC252EC2533D8B75FA5F80814130FE9 GUSTAVOCLAIBORNE
438,354,555 *2C6A5FCB797C7C1E3A22F0FD88F822FF66DF62E5 GUY.BOSCARELLO
438,354,556 *2C6633565371CE02FCEE9A92669C03F8E80B5622 [email protected]
438,354,557 *2C69242CDBB7FAB532328DA98F5525D2CFC198E6 GYMCHICOF09
438,354,558 *2C62452FEE1A8AEA3E16E3FD3E9DF4236720A923 a.pile.o'.cole
438,354,559 *2C6C935A5231ED9805D210792FCE7D2FCF17B3E0 IAMUTOPIA18
438,354,560 *2C6497F4B1E140B5145D75BD7923E6780D80478F ID9792
438,354,561 *2C65EF06C5B1FCE9B027F72A96C082F06996D709 arioso-in-a-minor
438,354,562 *2C65A5AA919C6EE78118B6733AAF0692BB9B1BD7 AS)88
438,354,563 *2C6E592F5AA8B3F99B1A55133F3D2BA3558CC97E ASDF3289
438,354,564 *2C609F3D661C96DBC04FD885A4340D211B665351 IKIATIES3
438,354,565 *2C6325F3C07F49978D5D01D6C86901E5C26AD034 astormatwill
438,354,566 *2C6E8EC11A4C28813A7744413719AC25071CC99A AURELIO.LAUDEN
438,354,567 *2C65A1300B541E073AA84621CA27E3CC6E874D04 HERIBERTO.BIEL
438,354,568 *2C6CC7E45CE11DB898F20DB0451191F7B5E472FF HERIBERTOGRAMBERG
438,354,569 *2C6775F97A638AAF0942E54FE993AB7CBB1CC9B3 HERIBERTO.KENNIN
438,354,570 *2C689AD6D5B676D6CA135A5CF1747EB5890AFE71 HERSHELOBA
438,354,571 *2C6B1FAE07F6EA09113A5BAF667784F1771176E1 HEY SISTER (FEAT. OPH
438,354,572 *2C6F428ACF8647307D44E706EDA16B7E526E0E99 HGUTARRA
438,354,573 *2C68F852815C8C211B3DD0CFDD2BF7BF9926D186 [email protected]
438,354,574 *2C6135655A4B4667ADA662270DCB118B53809C7D H]I&
438,354,575 *2C66B00EFB5A9E3CBCE7A4E9C0359BC2CB2EC7FF IONANDR1
438,354,576 *2C602F067C6357526A14529E0DF5F1DAA031B55C B000RO6JZ4
438,354,577 *2C6FCADBF1F287F7BD5E935347691359C68D3AA7 b0s::
438,354,578 *2C6388C06F540ABFAE996BE1DF67F8CA3381AB0D isaacchilo
438,354,579 *2C6B0E2376D3D387A7F7028B3D3450BE9CD324F6 HOOKERKITTEN
438,354,580 *2C6E42F83D1B57C08D786E557E838F1C02497214 ismaelmurley
438,354,581 *2C6108D5DD29C5F1B6190AF4E67C986B6EA14465 HOTTWINZ01
438,354,582 *2C6BBE430786EEB5FA3E3A3E714FA0B5D30F3DEE isrealchegwidden
438,354,583 *2C689BB6CB3523560043372B89F9ED8AEF7959E4 ISSUEIX
438,354,584 *2C6F4105CB7C4F3158B723A8DE3AA0351713FAFC b67s3
438,354,585 *2C64B64B3A873BE4E7107A7A45519A4E1AEFA4DA b80m:
438,354,586 *2C6E220083A489DDA634BB5CB8532AE76320DBFF J0V+
438,354,587 *2C62651B756BA8396423CD6C8AAE02D10DBF5B7C BAKTERIOJ
438,354,588 *2C659F064E75338807FA8D4FF1D04CD3A1053853 BAR6T
438,354,589 *2C6AC0810A5303DA942514D369C300964E47984A igovonuliw
438,354,590 *2C6243D5FEA3AF0E0EDC0C1FE60AB16C50DDEC0D JARROD.WIRKKALA
438,354,591 *2C6E435934685EC78D563C0FCC77581F2F7C648F BBFQD
438,354,592 *2C6632448EF67C42C5A3E3FDF342882C2C64BE3B jaymcshann&ralphsutton&redcallender&haroldjones
438,354,593 *2C635A991E3AF43877F564332D355968D30EECEC IM4KYC4KLCST34U4
438,354,594 *2C68C7AF5BB403B3AF937F91B94740D66B1A141C IMAGEDRUINE
438,354,595 *2C6CC64EA6DA400AD93F2928B1EFF42E2FAEF410 JENNIFER-TANKERSLEY
438,354,596 *2C678B11EB968F385D007E30F2531976CD78923F imc%
438,354,597 *2C67FBD741DC803E36DEDB71EC76452EF1BAA9C7 ImprovisationonGuitarPieceNo1
438,354,598 *2C68CFE8F063ECA662D88BB34A0B2DD4EE08A072 INDONESIAIDD
438,354,599 *2C6E9B1EC4F7173987B03C17DD0D6321C933DB61 ingsfljd8
438,354,600 *2C6B14AD932A5CCB02E23B58EDE95E7FF96EC205 JESSIE.MELANSON
438,354,601 *2C6692A9D25E98E2EE71EC97F887CC0018A9848E INTHECLOSET(7"EDIT)
438,354,602 *2C602E43BD640686734AA797BD8CB571D21826E2 IOMONACAPERTRECAROGNEESETTEPECCATRICI
438,354,603 *2C6A502C3BA8DD4F737D7AA79E31343CB7C88049 [email protected]
438,354,604 *2C62B11DC5BE30DE48D2873004473ADDA3EDCE79 belinda-dizon
438,354,605 *2C69C5027D10A06D275BB2B0120ED6B5E24BC399 irpstsae2
438,354,606 *2C65A169660C98955947143C9BDB6B8AFFB35E23 ISAIAHSANKAR
438,354,607 *2C671FEA2C2C91EB98B5722252282C230C567675 ISAIASLOUKAS
438,354,608 *2C61B4614C25981C5CF6B989E36ACBE67E14CA2C JOHNSONELLS
438,354,609 *2C6C2F6E40ADD5BDDED717CA153EE324138565D5 «BERNADETTE»
438,354,610 *2C674EAA29D387461F31AC5D212D0C5DE85F1D6E jon-higham
438,354,611 *2C6BBCB8760A2363C4041A8221855DBBA2D959A7 JONUMACYCLINGROAD
438,354,612 *2C673B7B1C4C59AA5418EDEA21A9584E35239AF5 ismaelpalubiak
438,354,613 *2C6486E27C4B2DE32298B18CD5AC4BB0CDD19221 ISRAEL.SULTAN
438,354,614 *2C6B1CD787CA12C1D924F8D8C03ABB7CD8217FF3 BESHAUKR5
438,354,615 *2C60FBA0DBA941DB818EF682BE8640498D1CD168 JOSHADELGREN
438,354,616 *2C67BC62D890B8E4310EEC1E1967D047809E33B1 beth.thomason
438,354,617 *2C628FCD52B64EBEBAABD205C5539321DECD85EF IT~I
438,354,618 *2C618715872580744E147A9F8B41EEAB5ECF87AF JRTEAL
438,354,619 *2C6746C45205635A447FB887D96FEEB81CE7F9E6 JUDENICKERSON
438,354,620 *2C67DE54BAA9B71AEBF25DB56909D7C7CA85F618 judsonborunda
438,354,621 *2C6B6B164158B30F2DC0FFCF38E19598451E08A5 B%HGK
438,354,622 *2C66D9F1AA15B0B313322B5D55B89CA993D93539 b-hsp
438,354,623 *2C645CD9AFAE97517CB209165FDF043F463F261A BIPQ.
438,354,624 *2C67D8D9AEB3251393EA6AC1F54C3331842FAEB5 kaeyttaeytymismalleja
438,354,625 *2C6EF716BFC5588931873A79BE8769FD965AA635 KAMAL.RAJI
438,354,626 *2C6CF689EC863AC2DF2E3A8BB11E4103848328E9 [email protected]
438,354,627 *2C61A1DF3D02196F0B74247F968FEE502E55CD9E bju=i
438,354,628 *2C68D87294BF910F466A0FBA7F7CCFAFC12C1FF8 karlcafarella
438,354,629 *2C6D688BD65748DFE38B69229887D34387BAAE2F JAYSON.PARMAR
438,354,630 *2C673599C1A813E6A74069DCB06D943BD151E654 jazzsax
438,354,631 *2C6F15AE45C642B3B06715B670C55F67F8D6DF3F JEFFERY.STIPP
438,354,632 *2C67214E25EFF0065C30C325FB314BDB20D125EF bloodpact
438,354,633 *2C652541A4A1ADC0D26EDF3BD16F0E30C2EBF2A4 blov
438,354,634 *2C6D3DA2F7BF4139E3A4B27CAEDB3B414E012A28 jeraldlafontant
438,354,635 *2C60F555F897E7C0EFA5840B441F347FEA37AFE2 KENDRICK.HOERTER
438,354,636 *2C6512EB4BA6ADCB9768FA2DAA4469EF9A5C5C91 BMJV?
438,354,637 *2C66369AD58171029B94B3F0587D2D355621EC85 KERMIT.WALLJASPER
438,354,638 *2C6610F41F895596756403483CC82CFD93318649 BN9CG
438,354,639 *2C614798BC0029FBD6218688DF4508460F19C6FE KIMSICKLER
438,354,640 *2C61E3008AD76D9028FF76D935029AAA8969CD92 [email protected]
438,354,641 *2C616D58096E738FCCA66525F46DD4D4F299B54F KLAAGLIK3
438,354,642 *2C6A8F6C6BC37B4A6343872C476A61AC50B5C3C5 klaktiws
438,354,643 *2C6F79E5C5E06DB44675F19C091DB0A7C3FAB690 kleinschrodt
438,354,644 *2C674C1B208C1A1F835CC6B14759D88DF9530EC1 [email protected]
438,354,645 *2C6A0CD595EA5ED2134C557178F718BE6F6B8575 BOYCE.TEZENO
438,354,646 *2C617A1B8AF1FFDC6BA0C630B5542C51FCA90A6A k/o/r/@/'l/ei//s//@/n_
438,354,647 *2C6600A6A90A9555C6AF247D988775C3AF2503C6 KOTSANASED
438,354,648 *2C6B76863C393A88218EC99ACEBCEA9E295B4929 job@it
438,354,649 *2C62111E08F3962A0B366A771E2C9562FB40B252 L4RD4CEOU5
438,354,650 *2C6DD8498D8FED545B2E4044065E1796013122F8 L|}7
438,354,651 *2C6904E58D0132FCA1FCEFF46BBF9E4FF2C89977 LABELBOUTONS911093
438,354,652 *2C6815582A74DC94173B5F9B32600AC6D71211FA jonasmconnell
438,354,653 *2C65A5E398F7909A9F6FEBF27E54CF246DE70C80 brentmoloney
438,354,654 *2C664CD45E382B12E9A22FA9DA25079761B0F844 LASSÈGUE
438,354,655 *2C6BCF8BAB7972B907F1BBD1CB2424B55DA0291F bring.shame.upon
438,354,656 *2C6232360084142D24FB536CA8F917C6498D0AD4 brokenemo
438,354,657 *2C6F8BEF95CA65D528345FA8201828BD543EA02F bs2ez
438,354,658 *2C62ECBBAC5EC52FF41C9A6656DBA466110B4B67 B-%TF
438,354,659 *2C6BFE8AB1D8F495EDB75C2CE7FFB90CCB220D92 [email protected]
438,354,660 *2C606D2D02CCBDF2B6DE0F8FFEAE93979752D561 LEKTION 22 - HUMORVOLLE DROHUNG
438,354,661 *2C653DD9651609E52D45DF99E28B3D0672019332 J&WK
438,354,662 *2C6AA1EC723ED32DD42D396201B650F8474E0FB4 BUCKBINDRUP
438,354,663 *2C61954A07D92433FC14BBC6CC2F4B9142428652 leo.luiz
438,354,664 *2C696A7958EA0B5594D1CED75F8A8996540E10BF BUSTERKEMPFER
438,354,665 *2C6607F5097D1933B421749593E8482BB26FD5E0 BV_:
438,354,666 *2C69BFC239A0F24076FE495927F4764ADF43CED0 bx4in
438,354,667 *2C673BA80EF41DE1E965F09F2442F0E7FD89D6D4 [email protected]
438,354,668 *2C669466EAB24A05FEE4DAA7E4DA90235434C03C BXPQF
438,354,669 *2C66C8D7E6E42C65E9538B1CC1310DF7653B3C58 lifting tackle suppliers ltd | united kingdom
438,354,670 *2C62DA429EA8ACBFDB8C3E62F0938FE0C331BE4F [email protected]
438,354,671 *2C6F9BACC80D69C6EBF456D16EF9D06116852481 kdesu
438,354,672 *2C6C427AFB9DA1F565DE4F5223BFE955C635D29E [email protected]
438,354,673 *2C6CD8C6767B657E24D9D8B5FD4CFD90925269EC c3n+gr4m
438,354,674 *2C63070BB10B97FFF7216E53F30340AC1C7577AD LINNETTEPHILLIPS
438,354,675 *2C6A15DA8317DC2E5CA31298B1609E9CA860EE46 kendalllustberg
438,354,676 *2C644BAD0525F9671A0AD3C6756BF0631DB9BAE0 kendrickcornog
438,354,677 *2C6841C9C928C4DFF7619F88027AE44819D878C7 C72C716
438,354,678 *2C6D9F48CF9AF5DD627CC4E0C38D461CA728BAA7 kenrirans
438,354,679 *2C661D4FFEEC93DA1A377D063B348B7A2C835415 .llah eht ta gnikool llits sdnats ydni
438,354,680 *2C63BC938AA204FA046277B19C1A1F430F29D3FC KIETHMCGLOIN
438,354,681 *2C65EBA699F389CADA368B89871CC0541D4B7EE4 KIITECHO
438,354,682 *2C6567A3919AB967100C997F2EBB3CB7B9418B41 KIMUTATHATÓSÁGOT
438,354,683 *2C6C18B4D5B30F1DAF905EA349FBEB1CBDBE9EC1 KINGSKYE
438,354,684 *2C68B6BA9A76E8BE1C520E44039D49C67362577D logandragan
438,354,685 *2C6535CBBCCFE6386E7CF4226BE9818BECD7F458 kirkminion
438,354,686 *2C68E831C8BDC10113D5DFDDDB21FF7F4E3E8523 KIZUTUK6
438,354,687 *2C66DD70E25F5DF103B97CBDFA38A4AE176036BB [email protected]
438,354,688 *2C621C34FB1F33A60F1B64DBB1E9C62F9C1C6C0E LOOK FOR COMPETENCE NOT CLAIMS' (84)
438,354,689 *2C61BB4D8334FDD440F96A59D5B943CF7B2D9DA5 lopbni2
438,354,690 *2C6184CE57EB6CAF7483FDC431E628FEFDA328FC LOUCHION5
438,354,691 *2C6B430B3375828686B2660600DAF2C7BF8B26DF koinoias
438,354,692 *2C622893C1439D9A36B2E8E719BBBE7743BAB1E5 l.roger:.act.i..hagios.hagios
438,354,693 *2C6CDF588D95625161A3E74D2A90A8DD4A21FF99 koreyculton
438,354,694 *2C69402B0731F551FFDF01932E09429C9EC1AAE0 KORSBAKKFJELLET
438,354,695 *2C66CAD8C1FE833E873D7EB46B219B0599E34900 [email protected]
438,354,696 *2C659889C65A337FB39D3D8F0F0965305E588349 KOSOŁAPKIN
438,354,697 *2C6967C6F4B4EBE0A9421A270F7366F20272B365 KOTIEV
438,354,698 *2C66D04D0B067C71BFA09603CEFF4361DDB2824A LUIGI.VISKER
438,354,699 *2C647F02A4B2EF5D8695244E5BD78CB9E0EBCE52 KRIS.WALES
438,354,700 *2C66F6D85DC42941CC60CA079F8D43939CAD5BA2 LUKOTYK
438,354,701 *2C690EC9CD343FDECE52315F3ABC7DCC59339EC4 [email protected]
438,354,702 *2C6469691E03A1EC8DCB6E8608FE7E93C2FF35B9 [email protected]
438,354,703 *2C6C23F0F9B1582A6DE2F3DA6532F641A6EE35DB cb31i
438,354,704 *2C6E473DEC305E3608804ED816EFBBCE5A431B17 Kuy
438,354,705 *2C6A9A0C279F1999F50962E3E503F246DAEC23BD [email protected]{y
438,354,706 *2C62BD46673BC1726FBD37E1C0F315F3FD2974C6 CCKY
438,354,707 *2C6818992624EFEF83B25D848BCD19B557E12840 lamontkusek
438,354,708 *2C62397A0DA0F398D6A92A858C12BB9893AC079E LANEMAIORANO
438,354,709 *2C60C3745317CBEDF6F3DCB0BF97B8AFAC98E903 lannygranzin
438,354,710 *2C66E0145C16F8B4BE430070ED557B863F76FA81 [email protected]
438,354,711 *2C6309312A03DD480B451074BA85F99A27C547E9 La-Paravie
438,354,712 *2C6073C652F94FE00DB60293848B3FD08F53CAA0 LAQUETZ6
438,354,713 *2C69F4118B9DE389B7D49FB5F42266A77867D488 LARRYMEININGER
438,354,714 *2C68AEF07699373DE9B326877EF10E89502C53A6 MARCO.CHOI
438,354,715 *2C645DAD3B25B841C83A47E4FDF2D6787E750D8F [email protected]
438,354,716 *2C664AB99F81D4FF769B5ED3851F547F0109A2FA leonelhalterman
438,354,717 *2C6274A001916B3FC5BF39227C7F5744DA4685DA [email protected]
438,354,718 *2C6C99F8263E7DC131B09FC96485055EC8E5445D LESSEUEE
438,354,719 *2C67BEEB619BCBD28CD035FE2783DE0192A42FFA MATTHEW.ANDRIES
438,354,720 *2C64DDE87E80C663746CBE32992B2865F692561E [email protected]
438,354,721 *2C63CD3AE7B858695CB909CCEE54285F0FADC3E9 MAURICEROSENDORF
438,354,722 *2C61624AFAA759974C4B203C07F04B15DF8E281E LIBRARYTHEKING
438,354,723 *2C6496F37C4785D795791411FCBCA76775395234 chiannybbs
438,354,724 *2C616CF020678E139896ADEA37287F06EB7BFB8E m.d.a
438,354,725 *2C62CCEF3DC28A9DF8A9D5D7EE2BB25DBC0409C3 MDM\
438,354,726 *2C63D52587839F89DDFF2FF1EC05DC7E88900D9E chop-($string1);
438,354,727 *2C63B5E27235A9055BBA200EC2A45C9B0EFE1453 medhatkamel
438,354,728 *2C60732A1612C2FB44E46047A7E8C6BB612B364E chuib
438,354,729 *2C65EE884712F18C004930C51F5AF528272CD5EB LKEPESKY
438,354,730 *2C647DDCA9D6338771BCA0B2A3F0E0F509DF9BC4 LLIFKCAB
438,354,731 *2C6EB6E0475B20E477DBF10D053D7DB95C7EB916 LMXKM8385
438,354,732 *2C6D36466662913E0C6B8FE6A7A5470F8912A255 circumjovial!
438,354,733 *2C62C675B221F7E50C11B55362BC0A0FC0FD6B6E [email protected]
438,354,734 *2C6B304B57AAC49ACAABC43E110452FDFCFCE3AA LONGYINGRI
438,354,735 *2C6108FBFFAB47F7E960CFA2F259514326B99018 MICHALEFRAKER
438,354,736 *2C6A38164B6B2B422898C634AF081BB347243256 MICHEAL.TANIMOTO
438,354,737 *2C6CAFE64BEEBB7AF25E864D952DB791B1DB4B5D LOUIEMONTELLANO
438,354,738 *2C6B8D1E30986DE394DC74E82A8041DBED1528C1 midgemidgemidge
438,354,739 *2C6D14A7E8522823299313CB017CDD2BD2174669 CLARENCEODONELL
438,354,740 *2C6137A64FA85F2E1F4769F9C66209029031DE9E CLBT#
438,354,741 *2C64005933AEB07B48AC19A9D8DBF6BA8F19F009 CLENCHA6
438,354,742 *2C6B3DC55BE7D0325A24DE2568E8E5867F0B3562 CLIFFORDGELGER
438,354,743 *2C6DD4E2C533CA783623FFBA6B1D0F75DF4CECA2 MITCH.PARSH
438,354,744 *2C613DCA1D847444144E65832A41B45DD8307F9C LYLEGRAISE
438,354,745 *2C6CEBCD8ECF53C7DFE60E5AC8B383B34B3D6FB7 ClW
438,354,746 *2C69AF80EFFE32C55FFFFD20D66E695B3F5338AC c)n9e
438,354,747 *2C653109DF3E38C95356BCB00C4C286430C450B1 MONTE.NEWLON
438,354,748 *2C67225DEF55BE7CBC85397126952A6E0DE2A659 CO31ASTRA
438,354,749 *2C69BCF126F8FDF3D21A2D4D1CC25EE1EB31433C [email protected]
438,354,750 *2C68713775BCD1D4D91A63C019743F8D54A35467 C:OE,
438,354,751 *2C6B6775994327B233C9084D6843EF608D11E51B MSTIRE
438,354,752 *2C6631C3D01019A866E7FA160071075F561B4806 COMMA-MADRID,-SA-|-SPAIN
438,354,753 *2C698F76F46EC41115BA8AE364A06C8E1F0AEF13 MARANTATALKBARTERCAR
438,354,754 *2C683E13F4090CD28480F837637C3EA692810AAE MURRAYLANGKABEL
438,354,755 *2C6439668AB87DFA5BDAF43797F09FC579A3BC65 mareshall4
438,354,756 *2C6AE04F22A01634AD619B56BCFC41FE499644C6 margeletlebak
438,354,757 *2C682E470AD94B4BF5C858E27BACF1BDB1E24FED myadg15
438,354,758 *2C6753C9CCDD3556C417A0B0218315E2BBC5BD73 mypainter25
438,354,759 *2C66BB3FF79834371CEF3CCB61D142377AEBD0A9 CORNELIUS.WEAKLY
438,354,760 *2C612ABD8C99E4F71D95440FB5878A74C634F7AA cos2?
438,354,761 *2C6CBB3614C192C058FFDEBEF60AF16A83B242EA nandavar6
438,354,762 *2C68FD069E6E311ACA8718133761E99F22BAF39D nathanaelcoghlan
438,354,763 *2C6FAFDF90A52DFF94D8CDAE3E36730F677316EE MAYNARDFANARA
438,354,764 *2C634018158B8099A247BA5EE71DDFE53E92D266 mbdrew
438,354,765 *2C6EB0239259A43D3FEF1AC3C47926775D35FE75 MELVINRIVERAS
438,354,766 *2C6C07FB8567FCC2F6C811DAAFF1AEC66C89DA46 MENOMONEE FALLS
438,354,767 *2C68C621220707C6C76E2574803C1FE16347C5CE neizlije
438,354,768 *2C61B929D4E1C3558C7C71918B8F4EE86C17C513 New-Approaches-(b)
438,354,769 *2C65148088DE32F6201CC774672605F0815C3A29 METROPOLIO
438,354,770 *2C62B0D85C9E6C181D549C8D27DD012AD43A0AA0 CR2S$
438,354,771 *2C6AA0EEF74413B9FA02802AC5A136ABD6138CBE midemide6
438,354,772 *2C69FA09C6E75BE2F3CF7883DE01B30B846FB652 MILFORD.WOMBOLT
438,354,773 *2C6288557FD644CE7755928CA09A850385A08860 CRO55TALK
438,354,774 *2C68905A70ADD633AA0C3BF66812C487A4D2166D nitsuanad
438,354,775 *2C6A9A215C0E2EE56F05C2CA5C834957EE6C6ADF cti?h
438,354,776 *2C6A78F61EBE11DDD03AF00C565104B3C14AA24D n-no-de-ley-espana
438,354,777 *2C637879839EC54D0370A98C78F8C87A77A1442B ctrts
438,354,778 *2C63A8766979D495D3D8901786819ABD1B43E6DF [email protected]
438,354,779 *2C6BDF19AC700A99D99B5BA6DE4F303911BF876E CU%R
438,354,780 *2C63B61B8ACC754A347FF71BE1E02A951DFCFCD3 cu%sx
438,354,781 *2C6FFEBFE0E25DFF7174C1040F4E636790E7336C notificatie
438,354,782 *2C68196E57C64823763270B71555D6FCBA31EE87 CWFAD
438,354,783 *2C644073B1E6BEA9F0E93D7A929A569D4F73D02E NSEINDIACOM
438,354,784 *2C6953C4059F13BA95B71F3AF1D2285D9AA5E265 MORGAN PAIGE ADAMS
438,354,785 *2C6C438DD2881D7FD4817B24E14E58E97A6EBE64 CYLICESES1
438,354,786 *2C6B4A20D099644883FC6DC0622628BC49E85DD7 N:VX
438,354,787 *2C68A1652C3553460344369D2F0DE6F5961BC62C nydia07
438,354,788 *2C6043BF3C0806990F187191765122ABFE4A5198 mule291tile244
438,354,789 *2C6058636616CAD6D7CE1996450B0747D2E0A811 OFGBAA
438,354,790 *2C66BE54A2D5F1F63CD12DE40B8BD2AD54D1AB43 DALTON.RENERT
438,354,791 *2C673F28990876455351327C9DBB340A813CB291 NDRFNNCS9
438,354,792 *2C68AE6E6A8145A6EE1C787DC97788192006DFDF NEBOJSANEDIC
438,354,793 *2C67498C1A43CD020FA174EC5FE0C19A5037DF51 NED.BADENA
438,354,794 *2C624095F63243192D4F14E872E67919F5164DE5 NEELANJANA-PANDEY
438,354,795 *2C6BD8A8F1CCA544C6888A8C5FFFD24A0E506794 NEGOTATORY
438,354,796 *2C64E01710CFFC1A971C31222C377172D9CADC8B NEIL.RODRICKS
438,354,797 *2C60AEFEA7BAA63070C83C0A2121F1F1B642BF10 neumoto7
438,354,798 *2C64004806284F2EC97D80E0283D942AF9B01B92 OTONEN
438,354,799 *2C608F0B1DC3884684764C9C50094A61CC0FF05A nicolascornutt
438,354,800 *2C64FF8F8F5A1DFEF35F2BF8AB5866BCD0A78797 DCR3C
438,354,801 *2C693A9223A75898F0EE8749ACB14E07DB3CCF93 NNDGNSLY0
438,354,802 *2C66574DBFDA39E7C6E5379563C2B13F87441EA5 D$#EE
438,354,803 *2C6A38A286988B749225D42030E10AB4267EBE6C NONGENETIC
438,354,804 *2C67985DEA18DCF5A5137C9AF2A33CDF09D6A7BB P34<H35
438,354,805 *2C67104F890D862720049652D660FCAAAC334AFA DELMER.CONSTANZA
438,354,806 *2C639650E7BD13AC3B1579C245FF074AE1155A56 [email protected]
438,354,807 *2C66F0F095EC6FD02D6CD7329A019807F0C62FE3 NSYN(FEAT.TOSSEBARK)
438,354,808 *2C636F7669A93724A65C318FCD6B2930BCDF26E1 dennymilner
438,354,809 *2C642B3155581747349A00401F208BF24801C904 offenlag9
438,354,810 *2C679CCC6303121EF00A0CA80A9999DB48F684A0 DESOTOCOUNTY
438,354,811 *2C66C2CEE35ABF47039D3EBC237A075982EE18A6 desynriah1
438,354,812 *2C6C5F8303952CEA3685A3A8DA990A2DDB21760D ol.singleentrylist
438,354,813 *2C68A35CC4E639CAD6D9B6297BBB2FD25E2AA18C omerreinartz
438,354,814 *2C6B2C202917CDE99D01590CBC961F84A4EB0E75 [email protected]
438,354,815 *2C6F3A997BC2F64DDF9EB80C778B461A0C035C2A OMTDIIU6
438,354,816 *2C6360AE97EEA280177920E1CA913F583EF6F81A pearood
438,354,817 *2C6175149BF4F5D10C3416E11A072AC6FF5661CB [email protected]
438,354,818 *2C6B5EB980852C76BFE6A19218B2E3CEA0B8ED92 )o(~ ~q=b
438,354,819 *2C67FC5F539867652DA3327EC4C38220ECB050C3 penninckx
438,354,820 *2C6DEC787108F011CAF0280F539397AC439EA9D9 d-hn3
438,354,821 *2C6CCE90E7A13C3DD071BB6F1B13DA494F398EBC [email protected]
438,354,822 *2C6734A06BAC87A97EF9C503A8D14EEA95288B0C philadelphiawashington
438,354,823 *2C634794AF737D23C2184E7C3C57C54EBC305921 DIEBARONINUNDHERRROSILLON
438,354,824 *2C6369061F9F80C955BC0F1603547B2555BD3083 PINKSLIP8
438,354,825 *2C67FFFAD4925167E375D61B4EB6A4E388BFB414 ピラルド(pirard
438,354,826 *2C6FC067A8E839B77A4AC6D648B30522B42DF140 DILLON.MERILA
438,354,827 *2C63BBEA31D57C5AED4701092C7BC6D3B0510C47 platynota(又譯
438,354,828 *2C620B131F19A07D7FA4D88EF35B88903F9CC59D [email protected]*-*-*}8{
438,354,829 *2C63D1DE80E84964C5AEFBDCE9D4BF5DB8D26CB8 [email protected]
438,354,830 *2C69FFE67491F3B2A0D729FF18361A79103F8577 PADERHOLD
438,354,831 *2C671943203582EDD03288B24141D0298935121C PORFIRIO.SEGOBIA
438,354,832 *2C632386B88112928B779BA6D66F3B8C9A925312 PORTERDIMITRIOU
438,354,833 *2C6CDD53AEF792C5027F0FFA4DCC30B4AC352787 PARKERLAMBRAKIS
438,354,834 *2C62A8324220960621A7120038B323C2F583D7C1 P)PQ
438,354,835 *2C609F961F9A0E97B754B8F01B865E4859CB37F9 :p***<#####B
438,354,836 *2C630173A39517B226B166B2EF3872729471F703 prime.time.(feat..tash,.eswift,.jro,.phil.da.agony)
438,354,837 *2C66849D64323AB4A05C8F21D1FF9098B1AB45B2 PRODUCERCENTERED
438,354,838 *2C663DC46DAB504DD7CBA697283BE733A95161A9 PROLOGUE(2008年9月)
438,354,839 *2C6438DAF6AF0300E8E861DB4094FEDA40FDAA02 dnm_r
438,354,840 *2C674CD3A66B93283F948F3823CC063814737A84 DOEMDENK4
438,354,841 *2C6F6CE85432032FAB88458E034883EA287987D7 QP ~ ~(><)
438,354,842 *2C6CC0750210409AE65E7C09C537032780EFB4B6 QUENITHA3
438,354,843 *2C651D2DA8092E1C0F2A0CF8613A3CCE6DFAF202 DORIAN.MCENTIRE
438,354,844 *2C698BF8EAB81F191E4913F4D31B1A5527040E8D douglasswitbeck
438,354,845 *2C64A1E779FFB502F7AF14A6435848965C335D2F r1gfo
438,354,846 *2C64800149C6EF029E92FB65D534734E5F03EA3E r3s1s74n7ly
438,354,847 *2C689192EBE85C410FE5E31FA05780ADDE4B1D34 RAFAELBARINGER
438,354,848 *2C6E5C45B497036BC37162300C0FD8AD854B56D5 placer-claim
438,354,849 *2C6D4879D5CD75A35EE558ABDC19989D1072C35A po5toffice
438,354,850 *2C658841DBBC30D0C61AABAB69DAB3D1F4685E0A RAPHAELDELANCY
438,354,851 *2C650FF240BA64CB6D5F020A995FAD04191554EA RAPHAEL.NUNEZ
438,354,852 *2C6181EE3F284B84D7C05812E4E71636FEB9BB98 politicallyuncorrect(featmerlehaggard)
438,354,853 *2C6AC5FBB66B33E6BE6308CFC449914DBC446ACF RAUL.MELARA
438,354,854 *2C64E6E919ED3C89F95E60A47592F14067C705B4 d.s.cancion
438,354,855 *2C6D31C319C7B31417413D50EF9F9B24D81FC7F9 PORTEILIS
438,354,856 *2C6D5BE9C9D433D52215FBDE76309ED20280FA7D [email protected]
438,354,857 *2C61FADA1C4E1C27E168C7A4EA0052AB094539B3 POSTPITUED
438,354,858 *2C6215327043C87C15531926856F463EA2D34B52 P===P~0(O_-)
438,354,859 *2C61235685E4B8415134D5B2D1923227FBA9AD9E REDHOUSE(2)
438,354,860 *2C61EBF18328FC26FB1F5BBF86B97F4F323CC839 [email protected]
438,354,861 *2C6889B5C2EBEFF8C1F11DB2ADF732593B6CF438 REDOLOSES
438,354,862 *2C68E4BEE25AD10F1A38FC2DA7C6F480FAFD7990 prämioe
438,354,863 *2C6AAEBCC516E809BC155D4941F1571402E39924 presifts3
438,354,864 *2C6C94563F2BAD81518805055C32ED709D735FFF REINSTILSING
438,354,865 *2C61B7D7E55C30832A843A1B40320277E22A198E P+UQ
438,354,866 *2C6EB342DAF7DC85EC14E0F47903B2B9EEDD6635 [email protected]
438,354,867 *2C689942D5D54DD59C9652621BF889488474CB40 DX_TL
438,354,868 *2C66264070C875438E86A512116EAD3B7644E649 DXU1
438,354,869 *2C61F1261FDC920E0C1BFADCADA12F9C66AA5863 QUART11ES
438,354,870 *2C67D7E55D55CF3747E86006693D2A9849AEB868 EDi0
438,354,871 *2C61507494150AFBC1CC19090C149F1EF554B5A6 RINTODISTUKSEN4
438,354,872 *2C65511BD9827AF61AB9D0788056F42F7FD73406 [email protected]
438,354,873 *2C68D956F99E666E7CAB61143C632C24ED57FCBB RISCOPRISSIMING
438,354,874 *2C60B0FBE9FDD69E17D4B0C27CE8640068655A5A RISETELESKOP
438,354,875 *2C681DBA0FACB00DFDEADD846D62653ACF096D4C Rise.to.Flame
438,354,876 *2C60CF871F913E3A9A2255369928F6C8D2A90C45 [email protected]
438,354,877 *2C67A4618A0B531C9FF0D287E7418EF3EE0C34D1 ef<n
438,354,878 *2C6F86B3AD49A7B4D952349E14AF01C6DFFFA467 RAMDOHRI8
438,354,879 *2C672288705213E0029AC442DFE9D471B9688AC5 ramonadragu
438,354,880 *2C6180E86C1C773509CFAAA8D70417E505E7F841 raymundmanansala
438,354,881 *2C68C543F8FCF53B88708C01C39C617480BD53F7 ELANRIVERA
438,354,882 *2C6CD69D6DA0041107FF67407EF5E548DA094AF2 [email protected]
438,354,883 *2C6750F16EC418113E36FB1DAAF741333D3BCAC6 REFERPBSWS
438,354,884 *2C60B6E1F306D54A529A3BA00BEB6203B29F8EDF RONALGRACE
438,354,885 *2C69047E36B8381EC96C064A1E7572DE60E51852 ELROY.PRELLWITZ
438,354,886 *2C69EB4BC5401F58AE0EC3B5B9070085A75B36A4 rorate.caeli.mass.-.agnus.dei.(mode.i)
438,354,887 *2C6816C04087C046C6153AB999EB6A3C34A27B80 rosarionevarrez
438,354,888 *2C60CF3E5AB09F71D4B73F7717DF941E8215C362 REGGIE.TINNER
438,354,889 *2C628ABE2A4C35CC93295107EE4438C7B1359236 ROSENDOTONNESSEN
438,354,890 *2C6905824346F2EE8714D19412C29F9152328C97 REIDSYED
438,354,891 *2C62703A2A2079564CF81746C41F92A819E862D7 REINA-ISABEL
438,354,892 *2C6D34EB68B4B1FF7F264FE0CB27DDBA13A1DB76 emilenerson
438,354,893 *2C6628A165C0CB4BC0C79CC53AA6098CE079B6DE [email protected]
438,354,894 *2C6D7E48E82FEDDEC5B330587BCAA07090171FCA RTP\\46
438,354,895 *2C6B71B72F50C492F7FDAD2131D6B3D10A9778E6 EMPOBREO1234
438,354,896 *2C6C76CF1BC00E48BBAAB1342B7FE3928FEE3B34 rullige0
438,354,897 *2C677B3AA40F14C9A519066F215E6D08B1273EBE enrecson8
438,354,898 *2C630D7DD649257EF29CB7A06B7ADD4D8FB3AB4E rychlonožku
438,354,899 *2C63D8DAE5FEA7D415BA0D96351990801EDC490F rhy7hm1c41
438,354,900 *2C627B37C12D2D9F556C625F992DA3A69AF3D575 ephesians2:810
438,354,901 *2C60B154A5C80567732718AF592DA33F4FCF291E ERIKMCCANTS
438,354,902 *2C62E2FCAAD06D55C97367AC94025E3F42D7FB50 esha1
438,354,903 *2C698076C1630D6CF776DFF57AB7D0F5DF5EC70B san.pedrito.subte.de.buenos.aires
438,354,904 *2C66B06E882BD46CCE0424B754DD735BB078075E [email protected]
438,354,905 *2C67D3B9BC04BE977197CDB99EA063BEF6DB362A SAPROPLANKTONSES
438,354,906 *2C65BF2970930AAC32DAEF6A14DBCB651ED68818 SARAHKEENLYSIDE
438,354,907 *2C657F3E8E2A87DFBA7185C1818714E1616CF2FE SARCHASTIC1
438,354,908 *2C6C5058E1CAFAD84C358A547D3C18EB8AAF6204 SARCOID.5
438,354,909 *2C6F80198400749ABF1CFD7EA4645386643A256C etaluceb0
438,354,910 *2C670B3455FA429587027EAA8D698B32DFAD5F86 [email protected]
438,354,911 *2C6568536F0BDC1D4DD04C4E3651950D59C24447 SAWICKI
438,354,912 *2C6BE4DD76833FB052BDECFF011AB39256291A67 SCHICHTPLAN
438,354,913 *2C6AC19F9507C85778DEC9E0626621CBBE27EF12 scottsager
438,354,914 *2C6144D3E8BF6B6A4B50A40B765E3FEAA4855E99 SDRUGIM
438,354,915 *2C68DAD6639EF5B1EC3361B3EBC25FB7EF960C2C seacoast
438,354,916 *2C6F4DC440786CBC5D3231EB0BD971FC0585A5BC [email protected]
438,354,917 *2C68E69A6C7D2CC2F070CE08A39AA8B82659AB27 SEEMOEWE9
438,354,918 *2C61B74E1613CD8CAC1510F03DA240723DE130FC [email protected]
438,354,919 *2C6A14BA1AD9424283ADD6EAADB4C255154468F0 RTADEMIG0
438,354,920 *2C6A4AA7D38F4D4EA49CEE11C9426AFD0A7E6DDD [email protected]
438,354,921 *2C6E5AFCC00D87AD6BE74FA106AC4B3B3BF4398A SERGIO.KRACKE
438,354,922 *2C6A5D362843E5D3043A8824E940DF5F25144BCA rudykorff
438,354,923 *2C61946D3C776AF13475F612D04AD2558795AD2C FAITHELLA
438,354,924 *2C61AE179BC8F44DB7E1979AF98B183E60EDA99A SHARED.BY.CDRW74
438,354,925 *2C6034DE717877C63D2D1224AF97D372372E84FA salreiley
438,354,926 *2C6F0A2258B23F8AF0DD2F28913C79D072BBAB33 SHELTONLOPINTO
438,354,927 *2C69B3597DE0FA5415E8B35AE4487E63E7625E14 FEN.WP-GRU
438,354,928 *2C6518440855CD7800A2B91BBDF3B2A745CB2872 [email protected]
438,354,929 *2C6C28E9CC349385B4F3898E57C2C94262BE4688 sb2oq8f0
438,354,930 *2C6B7DC6D62E76E64FE78B8FC6385D917CA426D6 schnittstellenvorlagen
438,354,931 *2C6646C0BF080D4D0457F2A2AF514843F73AD5EB SCHNITZELB
438,354,932 *2C6598AB5D3A70529B46AAF9029DD6EF5BB0D483 school'sout
438,354,933 *2C6318FC1606757941C3AA2680AD737D6BC5707D SCOTTFANNEY
438,354,934 *2C66DEE1CE1CE790DEFEC0A5F3969F2D921303B0 SIDREAS
438,354,935 *2C6304AFA10E04E426427F34F730BCF3F705D900 flywinch.
438,354,936 *2C65ED8E0EEBD2E6983F355DD735D7C09279221A SCOTTYJEFFREY
438,354,937 *2C69F8CB1106F222926C22DD86BFD66C29A13FC6 FOGUELOEI123
438,354,938 *2C69E41F75FFB461EF3224593D6A9056152B3DAB selah.david
438,354,939 *2C60205831DF4681575F4B7BFF751FBA9087504E SE.MIX)
438,354,940 *2C6C247FF6A9ECE07977FFE9A9438CBB2A0B03BD SENNEITI4
438,354,941 *2C63B7ED9D73DAB539D5089B1D8F4D647FF890DC senrimiura
438,354,942 *2C62AE56330CBE4D150B54015C2B98C4EBA7683E FORRESTHURL
438,354,943 *2C61B732B6F41459BB73249A199A2C3C6A7308D9 SFRATTASSIS3
438,354,944 *2C6D8461F5FA0F97A2B9998D589D55D8540CE62A SKIPBRUD7
438,354,945 *2C630B3051538E1B4F68D906217C1820AD5C5C08 [email protected]
438,354,946 *2C61BAEAD33B1280A21EA0B27D1ACEFE99527745 FREDDY.BONDE
438,354,947 *2C6623A1619EE0C36B2AD422E53357E7B96077E8 slept-in-his-face-and-render'd-such-aspect
438,354,948 *2C61DE0137469155F297E11274A3288DBCE370EF slntrpy0
438,354,949 *2C6DB3DEADABB9845AD624C852846D003AFF4845 FREEDOM#1
438,354,950 *2C6A58DA1C6CEC804B909D70DE510A1CDB073E61 SNENEKCAHNI
438,354,951 *2C6EAD15EE28A676A9DCE0A66FE02B5DD45306A0 FTCMTMF3
438,354,952 *2C6B5C95C0ECAC2FA8EEAF19310419AF31D25860 SNUTHSAUQ
438,354,953 *2C613F1BC9D58FC26AFBBEF8BD152E49D1DABDEF SOECHATRAPATIA
438,354,954 *2C6EF815F622C1EE90A41696C23754EC4BA2F51F FUNNELLED4
438,354,955 *2C60F69B495C6CD98ACF16652A1ACA071E471EB5 SLAVONIC DANCES, OP. 72 NO. 3: SKOCN
438,354,956 *2C6CB3696A151E8FE2E95A49C6A4A18538E45698 SPIHSGNO8
438,354,957 *2C63F285F313E26B11DA72325DFA00966908B2A5 GDOSD
438,354,958 *2C61698B73FBDDDA791C47C3CB644E3C921BDB9B SPLAT-O~0~D------3
438,354,959 *2C6BA8ABA568A8F5D3B7740519E563A5335F288F splat!!.o~o~<===8
438,354,960 *2C65F11FD11444C2E78B55C3D1C238872B981C83 GENIUSORANGES
438,354,961 *2C69A1E7217710814917B5FE30C9F62FC4763115 SPODOSOLIA
438,354,962 *2C6FFB4AFBB0867AC543F4ABB920F7C0C81FBC3A GEOFFREYVACANTE
438,354,963 *2C61F9B938628D5C1880F5A2FE0597EC88578F2D songebühr
438,354,964 *2C6E0B318F3F15CE8FE3CF266E188A2E99690725 [email protected]
438,354,965 *2C6EF7292A6E071BB0A5E746EBA497CA60C46366 SSENSUOIRACERPNU!
438,354,966 *2C6ADCB045C75FBD9B95E07C6DE5AB92A87EA70D [email protected]
438,354,967 *2C60A9F56659D43FFA68108CB80AADD846EDEAD3 GĬBBUS
438,354,968 *2C69440EDA2F9DB6D51151C4B1EE5067642D1239 STANDARDREGLENE
438,354,969 *2C65A6A67908EEFFC895A537BFE72955945AEABA STANERGER
438,354,970 *2C65F9E124F9EF1606860AFEC012E00C2329F653 GIOVANNIANDREASSEN
438,354,971 *2C60D2383B9C20B9C50FCCA3CAE421C8C5120102 stephanowczarzak
438,354,972 *2C62EE3A709E10CFFDAB1AE7CADB23C81D1A0E30 glennrazer
438,354,973 *2C6E9A3B7FF8B133732D560C3F9D6AAC0DF95C48 [email protected]#p
438,354,974 *2C63AF3D958CB6E2FC934E6FB4578E2020155019 SRESNURE
438,354,975 *2C602B5CB41742C7E94018EC231DC9C017C807E0 SSELKNUR6
438,354,976 *2C6D7667AEEB9CDAED4C9128FEB322DCD10181F9 STEUSSIEBSW3
438,354,977 *2C659E792E4F9B1EDF1E1457F4875B22FE6CE6E8 STEVE-HOWITT
438,354,978 *2C662D345625C649E5051187BCD438E02ACA5727 stevenarre
438,354,979 *2C65F5865B9F1D4B163F4DC3D512296067AF64F7 STGGRNG GVNG SRPRS
438,354,980 *2C611311779ACFD56768744C1829180232372B16 SSSSSSSSSSSSSSBSES
438,354,981 *2C655B7A4A3EBA4C70245EEECA0AD0F2B402FBC6 ST3AMF33
438,354,982 *2C6FB3F31F9A01CD772039AAF86957AFF4FDEBFA STOLONS
438,354,983 *2C6011F88CBEF43D3074D8C38294F9C6826565AD STANDARDSORTIMENTERN4
438,354,984 *2C6D5DEB2D60169D6231D4FE97DC75DB163FAAB2 GRAIG.ARTINGER
438,354,985 *2C63DFC9308C6247F4CAF410A5764F3760959091 STEMMESTEMME7
438,354,986 *2C622D0AECC562BD1971B6EDA45190387E3222FB STEPHENEDMISON
438,354,987 *2C64DA8FD12C0A20E30627B40188511A850B1514 [email protected]
438,354,988 *2C6A8237D2AD0D7990E1C2CFF0D4A8B944752CF4 GRILLAGEA5
438,354,989 *2C6D86D4BD8F1B56C5A42AEFA3A2E1E1C064D3ED STOLONS
438,354,990 *2C6A33ABFC5EF2D97443D04A2D2C14F154EFA0C2 SUPERMANAUSTINED
438,354,991 *2C6C6EA39F1CC2E1509DF83441EFF3172BCFDD7A super-quickly
438,354,992 *2C67DEC7B44E390F7FD41E8E8B5739896B22EC02 [email protected]
438,354,993 *2C69C50115AAFAD4E3B962632DB16CDCF5E1315F symphonyno4inamajor,op90"italian":iallegrovivace
438,354,994 *2C64CFC98D79B42B4BA9A56DE76B164DDFE6E218 SYMPHONYNO.6INCMINOR:INTERMEZZO,ALLEGRETTO
438,354,995 *2C67C0C7C2BA7923822CACE04CA29322E9F54193 [email protected]
438,354,996 *2C63255244C7E62B8AB440EE6C907CD0F8413718 HAROLD.HOFFLER
438,354,997 *2C671728B0F1390F95EEBF63658502557A589C0B [email protected]
438,354,998 *2C65E6B427F852EBE10455654E7D1E2010DF4857 SZARNATOLSKIS
438,354,999 *2C65A1EBDCD691F5426C31E8D806CD6E493CEB05 TALK842179262
438,355,000 *2C6184CCFFA4FF2D8BD7987BB548F6CC9104FF71 [email protected]
438,355,001 *2C647BE5B928BEF2D323CA0526C6E7F7C333A0A8 heribertocorby
438,355,002 *2C6257B93709BCCE8BECA0CCBAE435E7C1365A79 TAGETTAC0
438,355,003 *2C61C922EA3A5E2BEFF8020264EA7E4D46CE37AA [email protected]
438,355,004 *2C6987944391BCBE82AFD1D6E99C4A980CA60D94 TAILWHIPA
438,355,005 *2C623D3BD770AC30F11F808D46D28FA6030C3B7B TALKFAZLALLAH
438,355,006 *2C63B717FE3EDDC3948EE35F53EC6C89EC2F89CA TASADEFECUNDIDADGENERAL
438,355,007 *2C64C340585696FE9EE59C1EA7B6360029D7BF14 HEXADIC4
438,355,008 *2C60B120633EA51D3D2AD6B31F3428C10B4A397B teagardenlane
438,355,009 *2C6F0EE09E56EEA9133E530853C92577E154B779 tecnodata-italia-srl-|-italy
438,355,010 *2C6D1A1726C50C123091D71FE21DE7108585944A TEKNALBK1
438,355,011 *2C634205953ED91194F21E40B7C6F44D8C00624F TEKO11
438,355,012 *2C6D0C9ED1A403AD2E6EB118DBE5CE3A194668F7 TERRELL.MCCLUNG
438,355,013 *2C66F01F9AD685FB10F90E0E49C061EF945ADA0C TERRYHILLIS
438,355,014 *2C6A9A8512EA94AC71A0B7A14E71F4E7F3FBFBEC THAD.MEDAK
438,355,015 *2C63B812F0CA159ACF2122348EE0846F34231D0E THANHHOFLER
438,355,016 *2C6112A15B947857F51ED66250B7BB93CBD1EC6C THE.DAMNED:.THE.DEATH.OF.JOACHIM
438,355,017 *2C688A81C26DEA60A0EEE12F422C45C746F5A2E3 the.gapes
438,355,018 *2C63D774E822323ABC1DB721BDC72251700B0952 they need each other
438,355,019 *2C6D0AD8FCADE87EDBC003EAF80575C6B49CB889 IFPULSES
438,355,020 *2C6606C24E0E8B940DA792EE3713DE46E364D6AE TIMOLEONING
438,355,021 *2C692644CE196A1A2D8AAFF1275EEB55EFC574BC IIZR
438,355,022 *2C6A301A0469775E4FB8C2638DB37341423A06E4 ILOVEBUGS84
438,355,023 *2C64DA7FD28BEEF9348C3200DE52BCA9F5206881 toate m
438,355,024 *2C69231304C385633A14B672527A2F1E1CC45F57 tnacnop2
438,355,025 *2C621B33C0B9A0BF98B8FE2200F072BD971C5D56 tonya.bauer
438,355,026 *2C695C16FAB4F26469997C854CF18BFA90D0454B [email protected]
438,355,027 *2C6D915C58F9733B56B31BEB4BE3C6C10463EDEE insuranceauditor
438,355,028 *2C65C056DB5EF3E97C1C7C9F28262932A525180A TRENTHISTAND
438,355,029 *2C69BCC3F91AD57C6290A8B6857295EBA8FB2C92 IRISHMIKI8
438,355,030 *2C61529548E170B0CEDD6B6ABC7B474D7EF2B75E TROOSTWOORDEN
438,355,031 *2C6676D38263BD7B9B97D316E4E0826BF96D61E7 tristansplonskowski
438,355,032 *2C68D97A557ECB0D84DDF761FA2AA3F920DB217A TubaToothpaste
438,355,033 *2C646033583506F180010FDCC5CED1C3360A27F4 jakefaso
438,355,034 *2C6C82D7B53D4F59E1B358FB3114E0F0DE17C574 JAROD.PANTONI
438,355,035 *2C64BB4F8EE5A6BB930DC81B467972CE68B2F628 UOBNAKIK8
438,355,036 *2C684B0BCAB89D6E0C8064EF60BF834D17D9DD57 UPSTAIN
438,355,037 *2C6D5A832C019B57AD314B4F9628593102C4A957 UPZUBQ0C
438,355,038 *2C685AC582C3FE36235C3C7030BE61A5B67AB2F8 UINQUINA1
438,355,039 *2C6950DD621EC9C166E28AD310D627FDC80F9BF7 USERANNIETOUR06
438,355,040 *2C687E39DEA7CF65BFAB90FC36F6DB73FE978461 jfk.
438,355,041 *2C629C69FA78621717A475B2435296219651C154 [email protected]
438,355,042 *2C6BF3F59DCC826F37FF9C1DB815DADD819F894B underdog12345
438,355,043 *2C60D5A7164C8F79D6BB9A66B843C7EACFCC87F7 VAD HAR DU GJORT MED MIG
438,355,044 *2C68B7E66AC53D909EC9FAFFB820E4E258F5C5AC VALECKETT
438,355,045 *2C60885043DF77D637B83A17F4D3C04C747B8C3E JOEL.LENTINI
438,355,046 *2C6E6DE2051A4A88C98403AA626B4F01FC007B7E JOHNATHONHENDERICKSON
438,355,047 *2C626F78461E9EB3A6BAB81A51FB27F5129DB15B JOHNPHILIPSALVADOR
438,355,048 *2C654D2CA8AEC1BFC5807A3FB0F25D1EF7C3E2D9 vasil-pelov
438,355,049 *2C64B4E1F87973DA47C0C5DDB3D13D226C6B5FB8 VAUGHANBROTHERS1
438,355,050 *2C653F2B649C3CC914177FEBE42949BD3309BF40 v.%e
438,355,051 *2C62EDF7596FE3031A6545E560D8CAD490F276E0 UUENODEDBSW
438,355,052 *2C6787CECA223CB58A576FF68AA1802D6E0BFA19 VERIDANDI
438,355,053 *2C687631BA0BCE5F6123B9E62B8E8DCCADB8EB6E JOSHUA.DELEEUW
438,355,054 *2C6B2F7835ED1096C951A32891DC6D908D77C557 VGWU
438,355,055 *2C684A2EF9D299F296B9849947DE8322CCFA3042 vhonzkie.estonio
438,355,056 *2C63ECF57FEFB5993469D8BDD43DC8DA776EC42E VALENTINEMAATTA
438,355,057 *2C6F9F4F103A95D0854E1626D8B43CACC1DA777D VAN DER WERF
438,355,058 *2C67F64CE92D2DDB7372F17786DC4877E3E8EA87 vikas-sansoa
438,355,059 *2C6A3E57AD8FD499C3DB5E3A1DAA64E902CCF238 VÂRSTNICEI
438,355,060 *2C6ED0B04CBEDE53A077DC9D94D03B17F7C354BF VILLERS-LE-SEC.MARNE
438,355,061 *2C65AEC418581EA8E0520ACD347530A0D391BD30 [email protected]
438,355,062 *2C60B9FA9AC886A3F2BAEC2561D6EA5092DB3103 VEGELAHILIS
438,355,063 *2C670333671C35388DC21FECAD3FC7504D592D41 VINTIJAN
438,355,064 *2C69FECD6680BE966F8B631F9722299077FDA3BF KALOLOGY8
438,355,065 *2C6F383C61C18D29DE529D0311FE576886878CC5 kantu,-kantu,-kantu-kara
438,355,066 *2C6E27490A5DE391A3C006E926F9618871F37FA7 VIBRACIS
438,355,067 *2C621E2335581CD06EAB41AF611BF146DBF6FDD5 KE%AAA
438,355,068 *2C6544DE70EDD4768EEC17D515ED7896B0781E11 VRSKRFTSLNR5
438,355,069 *2C6D117B12D36C0A3937AEC1D156AC39B2C03471 vxjfypr36
438,355,070 *2C69EBAFCB0ABFB3CAFC074D855CCFE65C8D0C0B WACKEREMS
438,355,071 *2C63861C600D7462422757DC0A0B3A27D27BB6F5 WADE.KONO
438,355,072 *2C6535DD13F97B2E2F402F7A68D6E5E7A6B106F8 KENT.MADYUN
438,355,073 *2C6340C0ECD30AF6844A757FAC5AE97F5A97D700 WAL.BARLOW
438,355,074 *2C6EC9DC70F7BB612FD6D0DD5AAE8E8A17716F76 kerrybragas
438,355,075 *2C6A2937C2B81AF93CF457B47FA1C725F5433F29 KIPKRESKY
438,355,076 *2C66B6696AEEA4EBB69E422DB76570CF93755E36 kleidernormen
438,355,077 *2C627886A6F757006501863FBD4249958DD97209 vyzna
438,355,078 *2C68F7125769D2BE6193853BC772A26DD62F7E47 w1ener$
438,355,079 *2C6E1CCEBFF8A643C350DA6DAD5714319921DC75 wallin9
438,355,080 *2C682F4BB2E56EBE35774268E40FF56A5059929C WALTER DAMKROGER
438,355,081 *2C637603454DE14DF9AD29978B43E0667CA2AB95 waltonorrell
438,355,082 *2C6610F96BB589323DF8EF31C53E71598F05390A k-tp
438,355,083 *2C61C468E75505206F14A68559C3D17867C14183 KYMEKHA
438,355,084 *2C67B37FF202EA3653689C0A40821DAC2109E0C4 latvios6
438,355,085 *2C68B5E51621274A81DF86D9756C89EA4E9F8560 [email protected]
438,355,086 *2C676C22EC7258674868CA8BEBFD529870FA6408 LAVAYNA
438,355,087 *2C66A4C31D36F9FCF22FBB1F551CB556F5B9691C LEMSITZ
438,355,088 *2C624ABC413F0E23ADF9FA50A72ED9F8DC56A3D6 WNGULYA
438,355,089 *2C63BC31EAD39E6F9FFD551FA9C04983FCDDCE2B WONDERFULWDF
438,355,090 *2C68D201264B0841D3F4DDA4B4FEEFFD4CADA3E5 WHO.HAVE.ALREADY.SUFFERED.ENOUGH.
438,355,091 *2C63CE90BCB7EA1C65502FD3F85A51ABF68C53AE WORKSPROGRESSADMINISTRATION
438,355,092 *2C67A8ECF3CC7D1F89B72860F2D39A922FEC829E WILFRED-LUK
438,355,093 *2C6F6A59007F454D9B5819E396EEAF3E44EAC578 wilfredokaminetzky
438,355,094 *2C61EB8EA5114B21E035FAB048028B9022A32630 william-crigler-ii
438,355,095 *2C65816EB627B961E788D4D3D500244C4045FE3C WRIGHTOBIT
438,355,096 *2C6101BDB4063C104BB703D7599F6807EAAFBD06 wwwcyberbullyingor
438,355,097 *2C60BA178A12BBCEA47F178917070EA6B7F16249 WILLIAM.SALMONS
438,355,098 *2C62C83354E7D785E7A4BB0DE685E655853BE6A6 [email protected]EAHNET
438,355,099 *2C6D2C5F986E9225CE5403F98F6247D81FC51E69 XIIAONICK.NICK
438,355,100 *2C6E4EB33363E8F783DA7F63D91763FA9843740F XL]}
438,355,101 *2C66AC31B58A34EB5EC5F9E8373C5D9A12E699C1 [email protected]
438,355,102 *2C6085724E7FE5AB42A2D33DD586AD2D4D6AD356 WRISTLOCK4
438,355,103 *2C61D2EC4A407745A2692452D1D6DDC27ABFFDC8 YALITLANMIŞ
438,355,104 *2C66454EE704C87942F187D03AF143AD67C2EEED YAMASHICA TODD
438,355,105 *2C6B55882E52517B50E10D942FC60198A91FB8D8 localmode0
438,355,106 *2C62EDDDA82E457662359E1205082825328C01E3 YBÄ
438,355,107 *2C603055CAD9C6E38E01CEA05CAA43DDB05F6A4D [email protected]
438,355,108 *2C62AB38375CC073893D7F8C5E7EC490CD99A8D2 YONAS-RANGGA
438,355,109 *2C67629AE414F19D1359C8CABF2FC246EEEDE953 lorango8
438,355,110 *2C6856DA763C205D55859402B37475848BF49BB4 YOUDON'TKNOWI
438,355,111 *2C620F89A176A2F80C16E3D800D4684F00781F7A XETIE
438,355,112 *2C6F8A1EA33E349BD2AAB46E492AC675EF223141 [email protected]
438,355,113 *2C62A6C3ABB73B659A57350AE1E1959772FFDCD7 YU<P
438,355,114 *2C631E351C445E8BE3D33BDBC455ED051D99E836 YVONNE.BLICHARSKI
438,355,115 *2C6DB5B67D4E2D59367B45C957C4591B0E80726F [email protected]
438,355,116 *2C68F5DDC44674F0E5F755294AEC91E9DB4C5E02 XPRMNTLS1
438,355,117 *2C64E02182B8E1F5F273DE666D7D32E6F7AE1238 LUPE.CULLARS
438,355,118 *2C63334EBD72B0C9DA5597917119390EB57C23FE LUSCIOUSME
438,355,119 *2C65A6F2B04211D46B6761E7D6DBE8CC0C738F74 LYNDONKALENKOSKI
438,355,120 *2C6059DD2498B7A4AA65E6EC59EFE550ADCEAD43 [email protected]@t0n
438,355,121 *2C67F89CA5E189B6F1D6041EA95C270A8020FD10 yam-zuo
438,355,122 *2C60460AFC55671216186F9872F0AC83A8AED5CF MADETAS
438,355,123 *2C6DF584ECBE7AA12597D702E5F07984A8DF20AA YARI-KAVEH
438,355,124 *2C60B006F3CEE90C78645AE0AC2340CD1C4CCADD yaustined
438,355,125 *2C62BD49C9BF3B85C9108E61390AC5BBD0A281E7 yelizavetsky
438,355,126 *2C6A1E8F99B20558E5EBEB6FE4F9DA3C3DAA24A5 [email protected]
438,355,127 *2C67A0F736F6132E2E589A02A5A52C3AAD57084B manyuna
438,355,128 *2C6B435319B70AD2F4BE961AC6C651041147A123 marcellusmceirath
438,355,129 *2C6E6932274FF813492C7F18DCE930C8B1F9803E MARCO.GOGOCHA
438,355,130 *2C6EA80CC5B6EE909BD9AFD85FD78B1BE71A94C1 MARCUSDAGESSE
438,355,131 *2C69C4CF87A521F6F78D7C520F4CABB45EAC23EB margaritohopskins
438,355,132 *2C60B3C3B8286B80FAD4E2C672AF16392961FD12 АВІЙЇНОГО
438,355,133 *2C667C43EE05E666AA7FDF2AD2940EA874530277 MATT-DOCK
438,355,134 *2C672E6130226B7D67035C5E8AD02C6BD859DE13 ZACHERY.BARROTT
438,355,135 *2C6A1559A0C50062ECC102370D253D9A268D51EC MATTHEW.JOLLIE
438,355,136 *2C6F56C209E700751A0673012924495A1F37FFB4 zakufafa
438,355,137 *2C67239F38B0C227BE7008CDBF4696A447F2586C MayweatherHattonJapan's
438,355,138 *2C6268C78E6F91C5EA36A99A7D21450BD27AB6B5 кастенбруст
438,355,139 *2C6F0347A6D2E4EDC41372FCFD9DC392F951DE37 кюзан
438,355,140 *2C68E89D2030F4FA071CF09502923A6676C35DF9 ZIELONE OCZY
438,355,141 *2C6C83BE4A3DC2A277535F10D059F07261880732 ZJ1
438,355,142 *2C6CADEAA01E63628B570197F1B5F4068089F7D1 messagefarewelll
438,355,143 *2C69F727A39CCD4E86863D39B2000D9605C3C150 ZURCKGESCHOBEN5
438,355,144 *2C6FF1051AB697A2A5F6653A13ACB9C479FF8B56 zyrel29
438,355,145 *2C6EE5890ABDBB2A5C805E68F73EBA085D89F6BF 一方、この時期、UMNO内部において、権力闘争が本格化する。マハティールの後継者と目されていた財務相アンワルを
438,355,146 *2C662FB997216609B501DBF04E1A59B16E0EE0B8 киношникам
438,355,147 *2C67F73B5E51AD6C988E57E4FB7DADED90228BBB [email protected]
438,355,148 *2C6DA1D324656E2D92F1B2DD3943C391000F593D ЊУНАМ
438,355,149 *2C655F95A2BF682D00A33E5236584418F91514B5 MOHAB-EL-FIKY
438,355,150 *2C6CE34B18753BB1F8E6825D237180874D37D231 ПРОГУГЛАТИ
438,355,151 *2C69B3A8DC3DDDA4F399EE07581E1B74E05B15F7 monarchmonarch
438,355,152 *2C659491B25B67F9A7ED5F3B558CA5DE3D64CBB9 (削除)著しいpovですね。言葉自体が一般的な用語とは言いがたいものでしょうし、npov的な定義は困難と考えます。(現在
438,355,153 *2C640044B95882D4288E02EA6840E3C881F679D3 に正式にFIAからエントリーが認められた。
438,355,154 *2C6A2B1903D9246B094FEAF5AB9F5A3C6BB07237 NICOLASSMIGIEL
438,355,155 *2C6E9902AAE24992EB05EC75592ADC66EB1474BD 11-room-sized
438,355,156 *2C6655BBE72BD7FE20119C53D2385FE0395C3FAE 123RAKED
438,355,157 *2C638A9063A9F379534B394BB8F480BD802F299D 13march1580
438,355,158 *2C698B3978061617432AE86C4137B733C8C820A4 NORMANCRESCENZO
438,355,159 *2C68BE2D704F1A8AC8B71C83EC557365230042AE NT ANDET KORINTHERBREV 1 13
438,355,160 *2C6D0BA854C95725EB2237623E21557292A93D8A 168°F
438,355,161 *2C6FB2257E70D22FC2AEC26DB7C4597C885BE992 OFFERTORIUM.-.BENEDICTUS
438,355,162 *2C6FA072CA0315B1C40CABFE694E0FC62627E813 1970-02-13:.new.york,.ny,.usa.(early.show)
438,355,163 *2C67D4CA1B1BB0F70B33A6DBB96B3CD7DF249A06 0BDAAA
438,355,164 *2C64B2D3F8401CC322B0A77EA977B4A43E3D3C5B 1 ABEGGS
438,355,165 *2C6D4D9C6AF28E74D405BD46D6B27B3B88365ADE olingrosswiler
438,355,166 *2C6A6243F61F3065FDF35A13F2ADD0534CA75289 1051491
438,355,167 *2C6EB16BF94CB253ECE4FADA4BEC0BC2534A15A1 1 EMENLAUERBLOEMERS
438,355,168 *2C69F68F0E641F902CAA9AAC3E9E0F816B5D209A 1ennenpoliisin
438,355,169 *2C6894637CFD83962E8788E6AE04C1510A1F1300 1 erotischsinnliche
438,355,170 *2C608490905366C3879535D842C71098A13ADD63 1+g4b1e
438,355,171 *2C6482F28927FEC67A0F8012B2A283F6E2B2BCA6 1HATLARDIR
438,355,172 *2C622BF002D2A16BE7AD72EBD99B7A82B0837489 1hein
438,355,173 *2C616BA0416808CF9535DEBE5D1DA92B852AB053 1.KANZLER-ABSAGE
438,355,174 *2C6BF158F7A61BDC4E521700853A73168BF1378E 1-KIRJALLLISUUSSEURA
438,355,175 *2C6A16E5EA7C516B4118977776C06FFBB7DB7998 1-kumandanligi'ni
438,355,176 *2C6D52CF10009F0D6BA6FA827AD74B6138F841CA 1.kumandanligi'ni
438,355,177 *2C6C9DD79F1C650CA1276C5A1143ABAA85DF31DA 1L57
438,355,178 *2C66C5F09B6F7E17875A75087BE8A9A5E53DAB2B 1 MARKWALDSIEDLUNG
438,355,179 *2C68CA6BE5591817EC32D18B678226EECE6B7B19 1.matrisel
438,355,180 *2C6B77D8F7CA733E142238383B1C5EB7995761A7 1-muutosturvaraha
438,355,181 *2C6C46B7D1EE04A1FF5DA229753DEA15F2C27A2B 1postejection
438,355,182 *2C655A3C7521E50BC29722578E91FDC6EA87761C 1richness
438,355,183 *2C6C062C93307BAA2DE4A06C098D70945F0C4871 1.STADTVERORDNETEN-PARLAMENT
438,355,184 *2C60E5F7D272E679164224B073B5EBE6108458CE 1 STATESECTOR
438,355,185 *2C62FDC9FBD7711B08FF3171ADD7E96F6E2B2257 }o{ o~o~<=q
438,355,186 *2C6B959FE13A1A179DFB61D6E47AFA044D8FE3C3 1.TERVEYSKESKEISYYS
438,355,187 *2C677A41521948CFF8A9A40CEC592415BF6780B8 1169813 osavastuualueen-johtokunta-s
438,355,188 *2C689DAE63F4EA0471C6D261817C30CC86B3732F 1212JB50
438,355,189 *2C65EA4A10F8804E35FE5492C01EA081B198E4E8 2020816 moni.meist
438,355,190 *2C6FA0A3F346AFB8870D944C9BFC55A914C32203 20GAMMARTH
438,355,191 *2C639688220547BEF810DBFAE828CF3AB33ACC35 1301961 crabb'srulingcameinalawsuitfiledbythechippewa
438,355,192 *2C6A9F9AA872A1B19C7A56AE2092E5920DA3B47E orvilleplatts
438,355,193 *2C6F6F0B83659F3255E232470FDCAE38F4B9D1EB oscarkagel
438,355,194 *2C68290F39D626F0747AF164D289E9888277D77A 22 HALIFAX'S
438,355,195 *2C6F406FC78D934E6ABA0D76B1165F0388FD0881 22SALUS
438,355,196 *2C658CB6B90C34F7DE2DC2FAEBBDCF33D7A0FE91 osvaldokatsaounis
438,355,197 *2C6DCE90C3396377ACB7D1A2410ED5228DCFA670 236050 AHMET YUZEROGLU YESIL KURKLU DAGLARIN TEPESINDEYIZ .
438,355,198 *2C6F998045D674A339469D2C15AC3ADC49C7ECB5 14.elvytetty
438,355,199 *2C6C8A7C3F259AB68019FBCF5A62566D6C96FBC3 240577 lis
438,355,200 *2C6A81C6234621C26C4A9CFBAA7EFF2ECF773F62 2474711 ITWASTHENINTHINCREASEINAROW.
438,355,201 *2C6B600F77F70FC30AE444ECFE2C1126310100BC 2494959 laitoksen-liikevaihto-oli-66,8-miljoonaa-markkaa-.
438,355,202 *2C61964EAB1FF8ED2FF6D5733FF513A496E68640 2494959 LAITOKSEN LIIKEVAIHTO OLI 66,8 MILJOONAA MARKKAA
438,355,203 *2C6BEC21C6BCA02E8358E0892F0F7B50DCB620E0 1579400 tenfrancscurrentlyisworthabout$178
438,355,204 *2C63F10E2904E756BCC7DABED8D82BBDCE1418E2 2508702 dieserseijedochaufabschreibungenzurueckzufuehren
438,355,205 *2C6FAECB8574331F48B21F348C627C5B494443F4 2562251 give-them-coins-to-call-home-if-any-problems-arise-
438,355,206 *2C68B86F3D77940D80E6557DCF37FCB3116FE3A1 2565461 avustukset-maksetaan-kolmessa-er
438,355,207 *2C6FF1B227C708B7B3AE22C2BA7AD28DE2B7FA8D 1689176 KO-.-TY
438,355,208 *2C64966924ACDF89F41F8613EB21D004EAAB2F03 /OU/V/@/R'T/U/KOVERTOP
438,355,209 *2C690F011BF11DEE9AFCA7DE8BD2C8AD70A083E3 OZOY
438,355,210 *2C655DA6064EBBAA51591C1DC990FAE508321EEC 2cnare
438,355,211 *2C62153EFE3C6DF54326E6F954F10D0AAE229822 2EADSTOWN
438,355,212 *2C60B80AAB853AD13B489141F13D77FC5560811F 1acrylic-resin
438,355,213 *2C642C25D9FF6BA5E0AA903DC55546FCF9C58BEE 2F1BB92DFA7531F5A637E492A37755E7
438,355,214 *2C69803266BF6BCEC2A20D56C34444716F542BD2 1AQUAPLANE
438,355,215 *2C673007212811BAAE16217F32C178420C3B07A1 2jun1278
438,355,216 *2C6B797A76D6E55F4E2C65FCF92CEACF5786DA3E [email protected]
438,355,217 *2C6DD3F287B30473AA812EC8326AB49CA9B47636 passjim3
438,355,218 *2C6AC1A6A0AA04B1EF620E4C3134FEBE2EAFFECD 1 DRG-LASKUTUKSESTA
438,355,219 *2C6DE115184A545241485722BF833C61346034C2 1.drogenverseuchte
438,355,220 *2C66C3BDB6A6E35E9B0A3B33D7249C331E696DBD patriciamaldonado
438,355,221 *2C656145423E93C435D0AAC6D81228874A9945D2 PAVAN SHETTY
438,355,222 *2C677ADD19B00BBB49BB9A32A5FAC2CB512CF727 1 FALZ-FEIN
438,355,223 *2C623BCE1F5918E0356C43ACF13AEACBE0571CE3 [email protected]~0~o(>_0)
438,355,224 *2C6A00993FA062BDE871DC12E6F652B5AA83C8BE [email protected]
438,355,225 *2C650E276428E48E138F5899954BBE8E55C7BB63 399834+3R5
438,355,226 *2C64C876D2DAFE53393918EF3D8E34E31F2EF31E 1.INVESTMENTBASED
438,355,227 *2C679C827A8860A4D680E9C8F2A5C8F831A9CFA3 3ACASTELLI
438,355,228 *2C612DFE8677E5ECCA5A2946C78CB8FD04AB8FAE 3attestiere
438,355,229 *2C6E29B75F96CFE310EAA230E1B8E97CFAEF1C2B 1-katilanlarca
438,355,230 *2C6248ED0A254D2B40246B4603D7408269C2BF66 3B* * *{x}
438,355,231 *2C6F0DE3431D76A05C7AA28547F0E8AF97C5F9ED PERMANENTTE0
438,355,232 *2C62D99F94CE7D0A253148224161A9125BAE8160 [email protected]+ORS
438,355,233 *2C6E93C8BB08EF92A80DDC204A3FFC1F4D717DD7 PILOTALBUM
438,355,234 *2C6AEA183BF0C9C89B2B40108E03499174F29AEB PLANETIS7
438,355,235 *2C66F16147BE3BF466FF1A93282A47C0C0FAAC08 4EROPSOSEM
438,355,236 *2C67E3E140BC346A1F14DBFCDBA324EFFBE3E811 P=====>~O)X(
438,355,237 *2C62671692841ADDE3ADF86C004B4865159DE895 PPZ
438,355,238 *2C6BB74C2EE8DC662F0F0CB89FFA71076D80DAF5 PREESCAPING?
438,355,239 *2C6011D3943FA6D8AEE7588C2CD89714E9CE9770 1unternehmesgrenzen
438,355,240 *2C651C331FA2DE74F4A7FF995FD6EF5670A64E57 1 WOHNGELDEMPFAENGERN
438,355,241 *2C6D08CEAD8025322029082E17A339A709DB5411 4TNENNEIVNOCSID
438,355,242 *2C6F2A3E80F3970597EA5A4778B6C1CBA5751062 1ZUMRESINE
438,355,243 *2C6BAE45A5BB150D8472CD31762AA602369A56A7 (PUNJAB),但也控制着相当一部分
438,355,244 *2C62A1F85F6073D8425C4F2D2C01AD44C740B3DC PUSZTAHÁZA
438,355,245 *2C64DF0D93C73DE6D0653D1109B6B4297EE42CE0 55-BATHED
438,355,246 *2C638DB3FEC85F229FF310FEAF4A55223FFF19C8 598amanda
438,355,247 *2C65CD045E42A8874BEB8F27AF4F8AA45884BA26 qs152
438,355,248 *2C6BFBD35E70B65D70739BBBC6B959DD9C8A9722 5-bostanoglu
438,355,249 *2C64696C6459913D5D7D47AAFC02B189F9B37495 quetchoa
438,355,250 *2C621116434B623E02B37D1E7675C1602C49C14D 2448141 TODISTUKSESTATULEEILMET
438,355,251 *2C6C62840EF604764CE67CE6C2E3D08CDB03BAEE *RABBIT*
438,355,252 *2C6BE8372C3892B654092D7D452FBA73B95A5294 2669484 suojaviheralueeksi(ev)onmerkittyjonykyisess
438,355,253 *2C63C153BE37FC648C341DDDEEBC318C712AA8BD RAHMIDEWI
438,355,254 *2C6ED33D99ABDB8E40510CCEA1C399B2A971324E RALEIGHUCHIYAMA
438,355,255 *2C6E291B34DC1CD9FD52E7048838033CF14C5AFC 2958576 suursou tujen ulkopuolisen ajan liikenn
438,355,256 *2C6E67CBFD2C726D0B25B96646CEDB6E52A47CAB RANDELLLAMASTUS
438,355,257 *2C6D9B587498D17F2D8C509D14C879A54BDA5AE9 RAPHAEL.HAUPT
438,355,258 *2C6CC412DACA3D4410C36C4D71F606611029308F 2 DELFIINIKOULUJOKA
438,355,259 *2C611CD03408BEB0CCC0D2718E2BD80568396700 2-friedhofs-jueingang
438,355,260 *2C6B9DAE2B144F9752C03AD5FDB8CD8DB525DB1A raymundorepoff
438,355,261 *2C65D83F5B1DED5B561DBAE13CA35C81863C4FD3 2-hyperdokumentiksi
438,355,262 *2C692F8A8831719B00AFF2D2B7DFE3ADE7A3E66E RDC5494
438,355,263 *2C611C4CD7DE5B5EC5A07E9DFC2C16A4F7F9F0D5 2LICHTBRUINST
438,355,264 *2C6194839ACF8967EE9600E0190B500E468167BC [email protected]
438,355,265 *2C676E2AA7B91FF4A49AEFD148081A830A20B76C 2nabio4
438,355,266 *2C62819569ABE409A24181259285747294F78DB0 2 olier
438,355,267 *2C6FEE092BDBA8BFE00C824511A04F9EB152BB87 2.renaldo
438,355,268 *2C66C66DDD06A74144B950FC69556FE23ED90D18 2RHZPHRS
438,355,269 *2C656273BF7DB9BB3C4BA362E42A5BEB24691847 REED.LUZIER
438,355,270 *2C6BEA404F51516276DD9EBCDF246AE2D1128A95 REINALDOLONGUEVILLE
438,355,271 *2C6444596CCA95BF7C7C7619637754720D3BD941 323746 THE-ANC-HAS-NOT-COMMENTED-ON-THE-RECENT-BOMBINGS-
438,355,272 *2C6266AAD29D036D808A8D524A0AAE77E3CFA915 REMLYAYRREP
438,355,273 *2C61649B7D11D4F838EEB3719E9FC1BFA702EC59 3==D-~-`SPLAT
438,355,274 *2C6DA9390D8C0F9E4959CA8FDB2C3366DD0A51F5 RETAWGUHCING
438,355,275 *2C6DAB54FCAD906C6292A5C6219503B54DA3BE3C 3LINSHIH
438,355,276 *2C60F73D11AE6E1320F3CF9664B9E06BAD125845 3LISTANJE
438,355,277 *2C6690B96DB9BE454E63FE147AC4F4BB542B5EAD [email protected]
438,355,278 *2C6541D9B3707F1B6840E71AF97231B90184817F ROBERT.NERPIO
438,355,279 *2C6829FDEAD77AB11D6A0A0A645E1C4D2B9B9A2A 4HERCEGOVINY
438,355,280 *2C62A6762D881FE1AD1D38D1629EBA1A51D0E379 4ILOVECHRIS16
438,355,281 *2C60BDAD0C99CF58E3EB63CA7DD2829EC5C70624 roman.timko
438,355,282 *2C6914901D7F12B0C9CBAA5A7D6AF4BA3F28750E ROSCOEDELBENE
438,355,283 *2C617AFB15C8ADD390438C97B447F9BE5439C900 RSM8
438,355,284 *2C654FA4054BF956E7493885093F94239B21E62E 6.saltcured
438,355,285 *2C6D417E56651ECFA6F5AB2E700F853818ECC580 RUBYRED1961
438,355,286 *2C69AACF27BA778CCD9202D3C445974752B9AB2A RUSSJOSEPHS
438,355,287 *2C62FFCE25033822907030AADB26A2F42E2D7F6D RY|VRINPOIKA
438,355,288 *2C6D13A1367A7B371C23966735120B8EFAE9B8B8 s0ph!s7s
438,355,289 *2C69836A52372C89EA446FD97BB5B139936CD881 SAMANTHA MCGARVEY
438,355,290 *2C69EC139531363FD75E40E2764F66878400F1D2 5JWILLOWS
438,355,291 *2C6AD78E5FD965E66A480A12E443BCF0BF36CF94 5KANADIERINNEN
438,355,292 *2C65316BE8C6BF9FBDF6470CC22A82DCDDF057BE 5KIDANGGNADIK
438,355,293 *2C6B2BA062037110E5FA27EECB7027B581E5E5DE 705teagan
438,355,294 *2C6196E22577EAC2F2E2A89B08FB5DA477791A5F SCALDIC
438,355,295 *2C6649A37E391D14DB512283CCA56A8FECE799AD 5SUNNHETSTILSTANDEN
438,355,296 *2C6692B7CF7E6D2CECB18F2C9BF1E6A6FB4AC3AE schueeaöckcheu
438,355,297 *2C602C6791737AED3E28C9060DF7785FF3D7EF56 [email protected]
438,355,298 *2C6C36F4F496FBFCAAD89FE0909704BFC94775EF seriouslyjoking
438,355,299 *2C6C54A96218DF27BF84D954ACDA18673FF9E7DB sethcastaldo
438,355,300 *2C6D488D33682ECD100A433A995A15AF138F60F1 7IMPARITY
438,355,301 *2C67DE9454D2F4713574B09D849237996C123C71 SHAHZADALIK
438,355,302 *2C69FF15E1638EB277E280D380C8DC3670A64C2B 7MUSIIKKIOPPILAITOKSEN
438,355,303 *2C60198A4435E32657718CC591129798D90A9B77 6IAMSTORAGE4
438,355,304 *2C69CC38A9BB541ED53B194D5365186551EA52CF 7PARANYMS
438,355,305 *2C67825BDCC9401047123EC1E93751F0D811F250 SHELDONCLEEK
438,355,306 *2C614F950DDFE78E912F1F4D710BF13534803141 7.show-veranstaltung
438,355,307 *2C68A5C3A2DACA04C27B20E54D2E1D2A6A87DAAA 7STATESSCOTTRSPIRITUSORG
438,355,308 *2C6F8B33A22107E6A5B4EE773329712135FE6F09 6oesterteelt
438,355,309 *2C6375F11816B3CA560B8FB7A11C0A87587334DB 6theparola3
438,355,310 *2C6B95E5DFD3A873EDE02DD8F7F62AF79939DE91 6UNIVERZALIZMOM
438,355,311 *2C6548FF39F9413265960A8342F4211B7127BA8C 6vertibility
438,355,312 *2C67ED9DEA6D1F1D33229AF56041E7F33FA95FED SIGELM
438,355,313 *2C60043FE5223FB0E2FB9FF89EC4E3B53CF2535B SILASSHORKEY
438,355,314 *2C660D1B54E2701F613BB4C89EDC125192AA1E33 si.pequeña.es.la.patria,.uno.grande.la.sueña.
438,355,315 *2C690D555765ABCC00116AC6725102674658A363 8BPSSBPSS
438,355,316 *2C658D190A199656E1E5D228DFC5BA2CDE914123 8BSWLOOYENBSW
438,355,317 *2C6EA056971102FC0D01C811C4FBE94C3601554B 7AMERICANOSES
438,355,318 *2C6D1E4FAC80024B24162624E63362392FB6BD2E 8===d-~0-(0_<)
438,355,319 *2C6E6A923DC14DE3BA3588A49BFDF2F79E6B96BE SKIRPOHSIB
438,355,320 *2C689CF3B1035F48130747C10B3577FF03C999F2 7CHLOEVOODOO
438,355,321 *2C6DE104CCDED710FAB405CEF4ADEA40387D5934 SKUNKSFICTIONAL
438,355,322 *2C69213FDA05A7B342AE9D9DCE36EDBAA464E7AD 8JANKELOVIC
438,355,323 *2C6600D91119C7E55C4BAED2CD246268D99C7633 SMISURATE8
438,355,324 *2C6FF2CBDB8FA374CEB2D53739634FDF2C62105B sneseips
438,355,325 *2C66CE088438F0765225AC862444C5E481FAE33B 7LACEREREBBERO
438,355,326 *2C662CECB1A9912845C73DEB311EDB6C6CDD188B 7LOODVRIJBSW
438,355,327 *2C60865F702E5CDCA54F8CCC38E64383B94E200F 7MCPCSUUA8EC
438,355,328 *2C6F880D421200A53460DA6F32334BB67217F617 socr
438,355,329 *2C6E4524609DD44A51A89EC1EBCBF081F98C1C9B 7ROBINHOOPUBLIC
438,355,330 *2C62D170F90F14B75A5436347051688109AE55DF soldering bolt
438,355,331 *2C657A27EBBD68488B9442543F2608FF69499537 sonnybelotti
438,355,332 *2C67ADEA62111CF0924FED8B54EEECBED50D16B8 8PORPASSE
438,355,333 *2C6199BAFD327484788B6FC8AA844AE2C3F47D5C )8(-~-`-<=3
438,355,334 *2C692603CFF44ACA2E5EDABDE5DF6FD74F59D3C5 8#####p.~.~.~)x(
438,355,335 *2C6EB53CEDE93BC8EB1EE95C873900CF8F65DF20 8#####b `~}8{
438,355,336 *2C6C67852633016AEF7617DC6E7576FA1FA8CA93 8BADBOYLEONARD
438,355,337 *2C6FB5CC5A23BD52EAF49A70FD16316A00AF7F8C 8BSWAUSTIENBSW
438,355,338 *2C6D09E8011383D33644F68989911CF6B370C1A7 S.O.S..(The.Sound.of.Silence)
438,355,339 *2C6626E5E3174BD77C6CC2ACE3775483EFF11494 8 STARKFARBIGE
438,355,340 *2C6AB8605844DCEC7623917D4C89B5064CB060CA 8STEPHENDETROIT
438,355,341 *2C6CD78BF33E9E44107FF3C7417202A6918FE7C7 8february1529
438,355,342 *2C6234CF8A6DB66030DA2D1BE998B3415D2B5E64 8-HENAU
438,355,343 *2C6ABC837474638E1D853C710845C1F9DD304742 8-vertailukelpoiseksi
438,355,344 *2C6C08A94E37BC98C9CC492B8DA351F6B60710DA 927360 BU BIR IYI NIYET MISYONUDUR .
438,355,345 *2C6B3910EED451673E87E85FF31823F74AE21562 954188P1
438,355,346 *2C640283609F30ECA09F44687E2B46FD23985AD2 Splat!~`-~`d=p
438,355,347 *2C6C72A90000F21D4617F1FF4DCDDAB7F773D077 8predacity
438,355,348 *2C63AB6D60FEBE7C9E9C2995355310AA073D58F0 SPLOIT* * <----P
438,355,349 *2C660CB9D4F37B0BF26209A24A3F0F4A5B979342 ssaguirre07
438,355,350 *2C6E7A77C1F90443876148CAD39B6D9A1EE2CFD1 9EENILAIS
438,355,351 *2C6582DE37AFA8DE689FE87558D898FAF7148815 STANLEYWYCUFF
438,355,352 *2C661B0E7AB127F4B87CEE28AE4FA9021B5C3B33 9R4PP13S
438,355,353 *2C65C096816E05CCFEDDBABA58F8D91FBE0D7184 STEVEN.HUM
438,355,354 *2C653944A695343D651ECA1B45BE6AF72DFA3F03 steviecadotte
438,355,355 *2C6F01DC75D1D72E5E86B8B805FFB3F5A94B4349 9VNFINISHED
438,355,356 *2C6CB3F05E239DE08FB5C1FAB0EDDD350C6585B6 STOLONS
438,355,357 *2C6E4AF18DC66326F70A507E61AA03D910931EFC [email protected]
438,355,358 *2C63E0F4C930C5984DE3F8FD877C7658EC395F70 STROCIEK8
438,355,359 *2C6E4A76244B329D8A1BBA088C2F53FBB8C4668E aad1gs
438,355,360 *2C60F1163234E15ABCA82767A6B9124783963D8C talanta
438,355,361 *2C6353333B2E0A36B2FB8B98C06C8C10AB2239B8 9RERYKKERE
438,355,362 *2C6802331ACCE8E670B11E709CB2CF118179606A 9RKUMMER
438,355,363 *2C6F227D85447D380F8D56C1D6EE159629ED318B A.ALEXANDRA
438,355,364 *2C6B35EDFEBA1BBC3765442ACC27BD9374C00DF2 AANGESCH2
438,355,365 *2C693FDCAB680705E00959C94A3B2293521E7F24 AA#QG
438,355,366 *2C61C3A3F0585B564CC6A85FDC654A1A91F6F15B ABCDEFMANTRING
438,355,367 *2C616A1C7C71BF23B02B2C857335187C49B71B3C 9WOORDENL
438,355,368 *2C6F41D591419852655F2141DF20C5CF091B8D00 TANNER.BENDZANS
438,355,369 *2C6A6518F3294ABBD2C07B05C83A781B565C5731 A06%J
438,355,370 *2C6E2013DF14ECBAC268943C5A02717C7FC85F90 A0BO
438,355,371 *2C6E08E59CEEEBA05A9943996F9C88B72E578D4E tauryl
438,355,372 *2C6AB9B315C7BD1A82757DB898088685CC6564A8 a6
438,355,373 *2C6D0666151973503CAB5B3C93E32956DB353F15 ACX}X
438,355,374 *2C6890E42C1D03A0B2AE81112C8E8246C42E34B6 AAAPE
438,355,375 *2C6B0699DC694B08B2B37D2087F4C76602B30133 aaterfoe7
438,355,376 *2C6E02014331FD55AF83697C06E966FB14C77FCB ABDULZELASCO
438,355,377 *2C6766C5E136CACFBF37DF683C7A8A1F4701D23D todmembreno
438,355,378 *2C63CE669D265EE6751E11537B7C75609F28BB3A ABNQ
438,355,379 *2C67CE4CD1A9FE8D540D740A4681782A7E0DB598 abrase7
438,355,380 *2C604E8F766578DEA898C48BB165A79F8F9E5A20 TOMPOES7
438,355,381 *2C6F8F9332F942B0F4DCCF717848475532F2AE09 AHMEDMCEACHERN
438,355,382 *2C66C63019B509F4C5E1E9B19D0D05900B670CE4 AHQ_.
438,355,383 *2C68700CCF300E8F80CF79D6248C3CDCA17B57F0 ALAYNEQA
438,355,384 *2C6B67A9ACE7BD403E0ABCECE617FA6723C70A5B ADMIRATIVEMENT
438,355,385 *2C6075F08A24A3C4AFA28BDAA95F2BFB907C3FE3 adven+1+10usly
438,355,386 *2C6E69AFA9E009603FFD611E354E1FAC38663D9D alf9
438,355,387 *2C6852F3A42339F27E8420AB396E4B196A4FDCA0 ae!/j
438,355,388 *2C6A6EE2FA4ED7791B3A1A620C6E4D8FEE36F0AF AENHM
438,355,389 *2C6F1ED663724DD0414DEAF97BDCF4619BCE5516 TREIBERT7
438,355,390 *2C6BB579ABD89510634CDC48E028BF0FBAFF6811 ALLEGORIZER6
438,355,391 *2C638FF2B9CCA632AFC3FF970C8433CEAFC10A54 a);g_
438,355,392 *2C6ED515CE208FA02D8826E04225B1A0AAE67F3A trioineflat,op.100:iii.allegromoderato
438,355,393 *2C6CD81B3FD9BFB076DF94DF44391EC2E223CE8C TSAFRIAH9
438,355,394 *2C6D1A18DC9AD6B057BD1632E576F4F2BAF715CA ALPHONSO.HESSION
438,355,395 *2C60218CE4E3D52884D7C87F475013FC7D8FF070 TSICXDXBJDGEX
438,355,396 *2C6CD626E46F1CE70FFF9F7E1AD9A777AEBC084D TSLHEAW1
438,355,397 *2C6A189C7E44BE06925773EDEBCA3814460B8055 ALTON.RAPKIN
438,355,398 *2C65466B598B2A54A1C0669D6298292FCB55BD5A TTETODHE7
438,355,399 *2C6219563B1E742E1AE219C2F5252E41E0FABAC5 AIGJ
438,355,400 *2C64A56B7510865808D752C7D5DD1C0BDBB4E578 TULIPIN0
438,355,401 *2C690E43101C2F0C68A0A0759B288A41FAC13FE0 ALVINIA
438,355,402 *2C6457D09486F66E1C720E404C13EE4E224252C2 turniton(bluegrassversion)
438,355,403 *2C6426A34F1158EB5EC58AA0C20E92129408C2DB amadooleksa
438,355,404 *2C645AFFCD13706181E9005FA9A8A33AC19150C9 tWasindewinter
438,355,405 *2C6E6308F05F8DB904A84BA8360D4DBE02E01E38 TYOEKOHTEEMME8
438,355,406 *2C6E72E26D7976BF1181E8E61625304AFE1FFDBD TYPE="XKMSVALIDITYINTERVALTYPE"/
438,355,407 *2C662548B22905748FD204F22560AA76EC9E1847 tyreecoryell
438,355,408 *2C65B386C59AB3A7392598DC9379DD9E91C11AE2 tyronemastriano
438,355,409 *2C6E66D8C18AF86A4A7B7BB8CF8380C255602858 ALEJANDRA857
438,355,410 *2C64283152266E18B3BA1959244D89EFB48CD837 uberpruften
438,355,411 *2C62963BA51E9CE73D7831A70F3CD37A0A92D2BE alfjarened
438,355,412 *2C6A815EA72DE8911EE352D3303EA141FB5ADEA3 alfred.deller.&.the.deller.consort
438,355,413 *2C6C5106D84921A139A9BBFA927D696BCC14CFA5 ALLIUPRIS
438,355,414 *2C6588291A45EF4D5813E6753C1C2D90CD595A89 ALMEENH
438,355,415 *2C6975D672A87D58B5BF0963323ADE96B3512C9E anant.kukreti
438,355,416 *2C6BB4542247425A5B141812A5756EB4A970EA00 ULKORIISIT
438,355,417 *2C698E32B9D611BC5672AF8BB0385FC6FB14764F umdrehender
438,355,418 *2C667E36030139556D7947E0FB8B7CDFF804B2D0 uncovering.the.old
438,355,419 *2C6BD9E4D1F93F9A831134D49A2DC00658F957DE Under-the-Water-(Breeder's-UK-Sub-Merge-mix)
438,355,420 *2C6E53862776EBCB96F97F675D9CF29F723916C6 UNFLUFFY3
438,355,421 *2C6A3459221047D42A1A37AEE1BB549F3880921F ambrosane
438,355,422 *2C6831077DE759AF66B0A3B6221D9C80CF3CCD1E anjaneyar
438,355,423 *2C631E1901ECD84ECA0346B55B24E213BEB6B696 annoverinos
438,355,424 *2C6FCEF37F10461BABD65DE252512F796F49BA2B UON{
438,355,425 *2C6208814D5278F33493143D9640EA3D5D7ECCA2 ANTONIO.MARKOVIC
438,355,426 *2C68C585A2283CB187562096592BC5705C69E1BB ANDREWM204
438,355,427 *2C6E49B8E2CB760F3D90B67A490D4BFE356F2560 aokv
438,355,428 *2C6791F7ADB7037AA13E22629B84BBDFD41C5258 APR9P8S
438,355,429 *2C693BD28D1CE3E74E93626E85778AF44442CC49 A:PY
438,355,430 *2C6ACC774C7F687B29480524F2CD7AD49B800896 annabnau3
438,355,431 *2C69D4695ECAF6DAE05D37FB857270C2928D5539 AQQWW
438,355,432 *2C6AB0B16945FD73ADCA63F57B8D54385EA882AE VALINDANANCE
438,355,433 *2C643D00420E57AA711C3AA49D568D22232987E3 areqanuviyi
438,355,434 *2C6EC06C81A67638092572F3E486E1E51A53961D AREZLIN
438,355,435 *2C6AD9DAC99B2ADB23C2604E34C907BE82D03D7E ARGOVELIUS
438,355,436 *2C634F96CD777AE56B6A77AE03443631520CF639 arjnrhqf68
438,355,437 *2C629B32260CEE48AF9835C81466EA9BD327CE53 ANTONY.RARING
438,355,438 *2C632EA9468295CF911DD228F8DF07EA23C8C2C4 vantriu-triuvan
438,355,439 *2C6980DF27E8959AA4567C940F32D0C31CA72C87 ANUNCIAVIT
438,355,440 *2C68424B95D7ADDB7B21F2C8E3230409775C3C63 ar/rl
438,355,441 *2C6DB0B7DE86FDADF545FED9D25CA1560D8E537C AP1F
438,355,442 *2C6C2F85A7A3B778D45879FECCFFF686EDAD2655 VERHOUDING
438,355,443 *2C6545CCA63557AAC840CC3574C9B3E11396D455 ASHLEYBOYSEN
438,355,444 *2C6E3EBB3A89E9E8801AC70E846B863E1F172E43 [email protected]
438,355,445 *2C60751C28E6A5E0C1E074C435BD4F6FFAB7C42D asioi
438,355,446 *2C69BDE37345F41B50C442E37708554BCD76E908 areamediing
438,355,447 *2C6DA6EE813DA0D5744BD5052709307B680AA5F6 athjazz0
438,355,448 *2C6D0C6834679F1235867D9415A7D2CABA885CE6 viewserialiserbarhet
438,355,449 *2C6B24758C513C259B7D36167E9D890B75960CFD VILMA-RAMOS-BELMONTE
438,355,450 *2C68A529B206608360B7EA2C156950A52281D4FE ARIEL.LOSIEWSKI
438,355,451 *2C6BD18225CBA6EF00985EDB939D63245F3256EE vincentmorgen
438,355,452 *2C653D3FB033D50073D2F9DC0673D9BCA62A3CEC VINCENT.RE
438,355,453 *2C6C39BE53C303D274BB26F0662870A3C9D3E53C aue7v
438,355,454 *2C6C18B3A774712348C33AF90F3C785FDEB228C7 ARMANDO.BUENROSTRO
438,355,455 *2C663F2D70C9D4C4F1FE503B679E4356191A68E0 ARMANDUCCI
438,355,456 *2C6BF8E211E3155DEE22D52871382CB2447F2C26 arnolddittm[email protected]
438,355,457 *2C65747A8D5E294CD0EA0C95B0E6740E02D51F73 viscounty.
438,355,458 *2C650575F96F6F7405355354DF58211D8E66E726 AURF-
438,355,459 *2C613B69BA9063326415E2D53FC4CBE299149EB0 avellites
438,355,460 *2C66C4B8E491D316BC5C393A1E2DB93122EBEFA1 AVERY.STEVE
438,355,461 *2C632B1CC6F2C85D29163762F87C8EB07A0E2E48 vivialyn-francisco
438,355,462 *2C66B83B4107D32C177FFCE270A4F61E3D97F98E vjgm
438,355,463 *2C662D35049995A4A6444AF4822E5DC267A8D73F VNWIHTE0
438,355,464 *2C6EF024F989C9A9D6C000EBFF05B9F8F1FCB68B a+sbc
438,355,465 *2C6DA3C45D5AC4C6E2F8B0BCB642D58E0E6295E4 vyzna
438,355,466 *2C6D6E71AD9729A8A85808B83B7920D524D0C713 WACKEREMS
438,355,467 *2C6FADCB6AE2E49A293CAC6205C27898837FE853 WAHSLEB5
438,355,468 *2C68F1EC4F26D7C134E5BC6B7AD8D1B606BAD47D WAKAMARU
438,355,469 *2C629FD94B4A5D3561AAF3151186C2D5F83BD7EE waldammer
438,355,470 *2C65B367682E93D5F615C4065D60C2C55FB2C5E6 B04$TED
438,355,471 *2C64193A190AF3EEDD8021A46F48BDB2ED781A0F wallace-groves-is-dead-at
438,355,472 *2C6645EB405915A55C9772834E58DC3C15F393BC WALTONSECRIST
438,355,473 *2C680C593AAFD42C8B37309E4B9A7719F97A616F [email protected]
438,355,474 *2C66DFD5B549DE3CB05742076080AD41C0F713B3 b2gmi
438,355,475 *2C6679CEE44F2EBB0AF269AC6CE19172855E3C65 B3arf1ag
438,355,476 *2C68FEAB5715B0D19EFA009FFA1499DC0E5F039B ATTH
438,355,477 *2C67B55163D1369E2320E9B0E9E155A02A671AAD Auger.h01
438,355,478 *2C6FEAA9BFED73990A3CE2AAF81E8B2565696F3B B8U)9
438,355,479 *2C6806ECFD63574A78A1435A9C98A5ACF060438B WANNISASEESUKSAM
438,355,480 *2C62436FA90C19FD23FD024973216CBF85FF39D2 AUSGABEMGLI
438,355,481 *2C64B73DD2C4A9142706B9B01F0E2664F8D9DEC8 balw
438,355,482 *2C6D7936782FA350C09D3797026BE760990904E8 baogd
438,355,483 *2C612A367930B93B0CCEB182192D42A77625981B a)x{
438,355,484 *2C6718F6C2751C22D584B1B17BDD01E23FB35377 BdvB
438,355,485 *2C645349AE05374E202E4E19CE68C691789481D6 b?.1
438,355,486 *2C66D6E17EF4D85D9D130FBD0C654B834CEA1A94 WILFORD.DELLAGATTA
438,355,487 *2C6E3E1C341994D7E6BC20CE444A4ECAEEDEE615 B4?VB
438,355,488 *2C607B06B30757A5B38A429802F7F2C4E956F570 bentonclipper
438,355,489 *2C68DD0856D309287DD2581AB217E1272832E910 B7WE
438,355,490 *2C670C1E43BC8301AF575FD9BCB4D6B9C6B5D97D WINDING-OURSELVES-INTO-THE-GROUND
438,355,491 *2C633399AC64922A801BDA542E7A33691DF3093F b#$a6
438,355,492 *2C62C642323C568A3555F830127BB758F1005AAD BETHMONT0
438,355,493 *2C63F9E4104B722E5C76DE1DB7578D163417716E WM.DIAMANTE
438,355,494 *2C680151FC066385FD0A9244C6B252624EA52678 band.organ.medley
438,355,495 *2C65184C7611E860C865820A80E4B3D0F485CAAE bf)fo
438,355,496 *2C61EBE2F236B6F471EF0FE7692457812E613666 BBIEU
438,355,497 *2C6A0CAC3F3CD37D15E1AA8F1E6277B049D9BC0B BI5WF
438,355,498 *2C6D322D610B89ECDFF80F8E726DACEC46EB6B14 BIJGEVOEGD8
438,355,499 *2C61B2651256151ABEF3FD545CDBC242CF55127B XCZOLBWDFRWOLH
438,355,500 *2C6DEEBAF9DD5B4BD4B9C5C2FA1CD51B8C97668E XDUNDEE8
438,355,501 *2C69795A7F399F0C34CAD3CE0CAA71F3DEE60C74 BINSENWEISHEITBS
438,355,502 *2C6A816A01E696B0A207CB51F55F886859304383 XHH0
438,355,503 *2C6FD2287E7208D15EAFAC57ED457E76D6D5165F BENEDICT.MUSIAL
438,355,504 *2C6920440816C3464F7F7F005ED61F506CE8C302 bi&rl
438,355,505 *2C62E21C19006C1BBDBD6429AEF7B57B2AEEC012 XM}3
438,355,506 *2C658EA20BA0155B38DEEACA2C7A95D5FF3DC45C [email protected]
438,355,507 *2C6C253ACC352055A27EA2D5DDD8A7378AA1D473 XNTHPRTNCED
438,355,508 *2C6D29F8D4376D8C1689E8C92749A2C46E2FAD62 BERSCREEN
438,355,509 *2C6199E642F9D4404F5A18793EB057C232DB3EDA XUCXRVUNLNBBQ3
438,355,510 *2C6F1D139EF99C2652DB8681645BBA96EED4F294 b-kj_
438,355,511 *2C6ABAD3A6FB0A23AFD7431392A8E3A4A1195971 [email protected]
438,355,512 *2C6A0C0DF8EF75F5067376D9F6674D3CE18DCCB8 [email protected]
438,355,513 *2C6C7F0BDD230E8839F5877647418686B89CF483 bks(g
438,355,514 *2C68DA5BCA509F72803BD68CBD31A02E845EBD86 bhsuj
438,355,515 *2C63BD7DEC52A78B254BDC94FA40E2A90242AE8C bigaroons
438,355,516 *2C6C24A169CA33C21372ACC654DAEF4EF329E16C BILLYKAY
438,355,517 *2C6D01CEEDCFEC92618088AB8E1B0398C4A0FF6A YHANQL
438,355,518 *2C6DEF61F4B8EB0EE22481B5BF464540FD52A85F BITERIE5
438,355,519 *2C60488DCAC5602A16B8E0BE3803FB2F68958701 bitter10
438,355,520 *2C6BE3F8B6FD45478FB7D3E282F69E174F322F53 b!nns
438,355,521 *2C6AB983290A240C0701FC505E174007134C9A53 YLSUOICADNELPS
438,355,522 *2C6DFAD8749B37B8037BB1624CD260E023EF3AAE YOBIED
438,355,523 *2C6D93ECA6BFBB165E126573F9FD1BB2BB3F60B4 YOLANDA TYCE
438,355,524 *2C64EC0232EB8099BB209B3DF5AF831513C48213 yosoysiempreelmismo(featarmandomoreno)
438,355,525 *2C66EB0F8A7E5D083CBE77DB0EEBC6CD7201EFDA YOURDAKOTA
438,355,526 *2C6241080BEED50CEB1CC4F2D8D4382F55148316 YOU'REPROBABLYWONDERINGWHYI'MHERE(BASICTRACKS)
438,355,527 *2C6202799FF4A350639140C1E95BFFE26945F632 YTSURESRUN
438,355,528 *2C657CBA24B1A8A42D4C8E5CCD7F554B959F27E5 boisson19
438,355,529 *2C6D58118A42997589C5E7D5E9755C68F261ACFF YUMA.ASAHARA
438,355,530 *2C6ED060BFC78204B123AE64602263FB5F6CE0A0 boogiejoe/theglinder
438,355,531 *2C62267787CFE50546356EFD9B6E56656A6CA1FC YZELREYES
438,355,532 *2C609E59AB671319EFACCCE600981F1949AED050 ZAHRA.ALMUSTAFA
438,355,533 *2C6ECC847A68804595E140C65289F276D21AC480 bn0rj
438,355,534 *2C6366A97AC4544904F8EB00EB390FC842691669 b%ow
438,355,535 *2C6A3BB199B41EFEE269893033314660B3217A9B BN-L%
438,355,536 *2C6E05006DB5037FAB2B386F0A631064BE867FE5 zgnt
438,355,537 *2C6FB9746C2EF6753A0CDC32855FA2F5F079A8F4 bobbiegaudy
438,355,538 *2C6D5596AA7644DFBAC0CF7DF5D3570A1D5A7F08 BOBBIEREAVES
438,355,539 *2C601A977747DBB27A5095C8576AA5F6B383DE3E bq6(f
438,355,540 *2C63A8FAC2EEF9E05A210E15314261C5F26C87FC [email protected]
438,355,541 *2C6A17CF7BB84545060234C656CF5EF51E32D628 BOOKER.DUNAHOE
438,355,542 *2C6EBCC0707A0F43C319E2A4AE33A4B237E05F86 、BORGHESE美术馆、CAPITOLINI博物馆等。作为一个工业城市,罗马的工业产业集中在传统的
438,355,543 *2C64EEEA1F521CD6435592C79921A7F2ED84F1FC [email protected]
438,355,544 *2C69B1A731EF5943D17F0FD4A3A517C43BBDE5CE BRIANAVALENTINE
438,355,545 *2C6EE6C55220ECC0132F4FFC9253E3A456307755 b(qan
438,355,546 *2C6E314171DE7F1CB4ADEB83C53C965E4477C9B1 BTIP/
438,355,547 *2C6AE53779E15529E673C6FD67AAE44EC8FF1334 [email protected]
438,355,548 *2C6E347ABED10685E80F8E5AEF7486AB50C73CC4 BUE>
438,355,549 *2C66CC6F7F209C598B19E6BFF768D8ACB543773F busybusy
438,355,550 *2C6133142B89D17436B38CF9C5269001B3C0E562 ОГРАНИЧУВАЧКИОТ
438,355,551 *2C6734D7776BC174CBD34C7E6181FCB713124294 BR)PB
438,355,552 *2C63F3B9235C3A72C2844BCE0594646445DC72B3 BRUNOGILLETT
438,355,553 *2C64CCF790677A4FE2A9DED0E43660823F6FC31B BYRRHESED
438,355,554 *2C65D1B2A0537FC13C5C56C5189653D3F4DC30B9 bz6"n
438,355,555 *2C675222483C25885BB37F95ECF4E1E32A49A73A B;S(K
438,355,556 *2C659C646EA80D39982A478B0169ABEE5BE706F6 c%=0e
438,355,557 *2C6FAC43A865EA571346907785A944A334CB81DC c1,(g
438,355,558 *2C6A61C95FC923EE71686FFE69B99ADA0B636033 b?uc
438,355,559 *2C65982FD78C185215EB1FA20AB99E54C970877D BUMPER1NG
438,355,560 *2C612D16D78DFCE1A97BF9751CCF5AE5BCCA0761 carey-newman
438,355,561 *2C62AF405272D050916B49CCFA8954024B320F8F C4R49
438,355,562 *2C67B423134B07E86AE9BBABEA8C68DD582975E2 C7Dr
438,355,563 *2C69C8DAC0B52545314064A356CECD96DEF40E8D CASCOD'ORODAL1964(DISC2)
438,355,564 *2C683068CFF5794FA5BC4641DFC73E87B8B131AA caught between your duty and your dream
438,355,565 *2C677C743DAD6ABEFEB98C05CB243093A191E861 ca/m?
438,355,566 *2C61746F470A1734361CF6E1566D09FF4220CB1C C:\DOCUMENTSANDSETTINGS\FIREXWARE\LOCALSETTINGS\APPLICATIONDATA\MICROSOFT\WINDOWSMEDIA
438,355,567 *2C6695993C5B788A8D553534EF150DE1A43CBCB7 CARLOSMADDALONI
438,355,568 *2C6CB0515D5967D02E87DF8873C5FD81D9C403D9 c%e84
438,355,569 *2C6AE699E45E73792EA83EEF625E411232DE40BD CARRAGEENANBASED
438,355,570 *2C628780FD67EDD891E6CB6B1F90C84D9C4E07F8 C!fW
438,355,571 *2C687CC3B41EFBACF3743C14A0D97744BEE4B68B chain.be1
438,355,572 *2C65023343229CD05BA7E68F16DFB4B3A84F1F08 C$cg
438,355,573 *2C6BB18B204361C00D37B3E60C6F4892C9FB3745 CEDRICDIEN
438,355,574 *2C671505BFB8FF773CB370ABE4A5D04208492C13 [email protected]
438,355,575 *2C6F0BC8353DCA84FEA097C45C345D6BBF06E215 CHERYLRIGGINS
438,355,576 *2C654E25C541952AD23C936D21B5D47E05BDA481 CHOCALHO4
438,355,577 *2C609FE09190EA5659667957FCD41BA02F304857 ch4n9e1in9$
438,355,578 *2C6942F69A110B67A3D32076990FAB44D18C75D7 changnotley
438,355,579 *2C6FF975F07C969F36E1066D1BD4873E32308134 characterpoint
438,355,580 *2C690E2E399A361D546F7E59D850E5282ADB039E CHARLES.CRAMBLIT
438,355,581 *2C6967F3B9CD122D3A80021489B522E7C6B9221C ci(gl
438,355,582 *2C6785FD3FB3441400208002878300F1562EBC98 (-_0)~~~D######8
438,355,583 *2C6DB662D9A0977214E7069835ACF3E31A4C3869 0THEHOMER7
438,355,584 *2C69DD3ACE473829C838F1739FB8CF5B2E807AEA 113092k
438,355,585 *2C6F6BC05495CE72081DE0A44CDC4F9D9533E108 CHEVESAILE
438,355,586 *2C6C2CDBC354948EA6992A3621D365F3F85365A4 CLAUDE.MAIOCCO
438,355,587 *2C64E7221E3F2641732FAE5F3F45B8C4FD636595 CHILD神さマン
438,355,588 *2C6F275F164EBDDF94F6D039ACEBD6D278F44C99 1441300 ajatuksenaon,ett
438,355,589 *2C6BED536B695E8DBBF10EC5F0702B07F995A6D3 clementpezzano
438,355,590 *2C61CC26DC9764A90F7350CEA73BA953FF116C9D CLEO.HIMMELSBACH
438,355,591 *2C6660C751D61C52946688D65EEAB1D16E6FFDB9 CLETUS.KEITZER
438,355,592 *2C610AE5C9FDC82BEC2BFCC81137551D332A836C CHRALESD
438,355,593 *2C659B5E96063ABA2A85CAB108FF37E1875B56A4 cloakmak3
438,355,594 *2C6D9E9FAB1158F47A86B631C807B0C3C505F0D1 [email protected]
438,355,595 *2C671984575F67090F7DDCA6F0DEB29F87DE2C66 CN82"
438,355,596 *2C602067C21E81AB482D865C4BA4453C78A08854 christine-latorre
438,355,597 *2C68AC3AB8376730DECE3AADF4B137627112EFCF 1477834 keskiajalla.hautajaisia.edelt
438,355,598 *2C639381500AE5C775000EC0AD19175E4ED16BCF 14PPERN9
438,355,599 *2C6B65758EBF5BB3FE8366B71669A49DB5741D30 1903242 baltian.maiden.politiikan.tuntemus.on.enenev
438,355,600 *2C61853B4B8246C6902BE1A78057BABAED316FE2 1907 BUARAMASAAT13:15'EKADARDEVAMETMISTIR
438,355,601 *2C6EFD497CE353D9EF75011F1F3A0B302E183CE7 CORY.MARTINEL
438,355,602 *2C6E577F13870F4F7A710F526473FFC1B66101B7 CKGELEGTING
438,355,603 *2C638976616F058477C2889B3C32FAFF3A8FA5C8 CLAREZ4
438,355,604 *2C6BD1BA2D60069FBAF8EF759D72634657ADD81C cliaucer
438,355,605 *2C624612CD538AB55247E3D59B7B816821403C4E CQB(V
438,355,606 *2C63FCE14D48BECDA8DE43C7598B80575C95F0B1 cl,/r
438,355,607 *2C6E060CAF46F5A416CD5BDD604498FC0446D51D C:MCP
438,355,608 *2C6D457C66669B1296A4E7850CC0AE3ACE3C63B6 CRETINA7
438,355,609 *2C6378589F3CC7AB482202194F053B66677A295F C&NNU
438,355,610 *2C60634CC977E04641482253F27E7E4FE5B0CAB9 crvn
438,355,611 *2C6636012E8B99E490A2855B67165F11251665EE ctf-e
438,355,612 *2C64D121D806D303533E4C5C71D16C41AF7825F2 COLTONDEGNIM
438,355,613 *2C604C7CB1BCB1EF01091C3F35DBAE51F4F0FD4B 1 LEIKKIKIN
438,355,614 *2C6E1BEA7611CF3C4C698EA5BC70B1B60E312947 1LEUVEN
438,355,615 *2C675F2858746366E7E8690D23FA9C9B2390D5A8 COMORPHI2
438,355,616 *2C627789C428500DEB9FB8589119A73F0C1826CB 1MONTERNE
438,355,617 *2C6386BF10162F0B8FDDCA83AD9D54EECE54A7A5 1NOBROCCOLI
438,355,618 *2C65E2A518C511281FCF32B1CADCDAB8EB199982 1nov1809
438,355,619 *2C602E45FBB92386A7FC23F59E653D086F828530 CONIFERS”
438,355,620 *2C6EF6BB9933BEDAAB41410236F665640967A3BD 1reasUrOrlerimiz
438,355,621 *2C6D1B00D9AB0B4F96569C2EC41A85AA5A9C3434 cww8
438,355,622 *2C6A824C83CE712651FA5D7B76C41782AEC69A15 1 STIFTERFIRMA
438,355,623 *2C6D343EDAA77EBC894570E02FFF3178123C9435 corazon-gorospe
438,355,624 *2C6D2018916047330DD8E2029DA82E860B5D3ACE cytg
438,355,625 *2C68C8A4019CA97F8DE75C4EC83C023CD5E2EF5E d0e9s
438,355,626 *2C6C6E028A277114FB6D0669E0D419BDD52337B8 COUNSELING.SDES.UCF.EDUCOUNSELING
438,355,627 *2C6F5E937A569F0858924A0D4FAFD05F40FC486A 1.tietokoeosista
438,355,628 *2C6EC06790BD7D776BFD02E1D3F7826B7FBD757D COVON
438,355,629 *2C64617EFD1D752E62815FA75BCBA4C811D755E5 [email protected]
438,355,630 *2C66026D6447DAC6C85CD5B33750CCE84986B65B 1ZAKULISI
438,355,631 *2C66B1052BB9923321EF65A026D8B642F1D61DB7 d6lx
438,355,632 *2C6B90A512AE426E4A2B62EBF91EADCF5B23FD57 2072790 on.aina.kysytt
438,355,633 *2C6226FC4997D4ECD7673375FAA4C1529EC3F565 [email protected]
438,355,634 *2C6F9BBEDBD9D5AA94A1F5C1ECB614DA89B377C2 CR+HW
438,355,635 *2C64C1AAA3D50524CF6A43DC9FA4D5393C7F883D 23ilgincti
438,355,636 *2C62D06676FC9111B833D5C4033270B2238263F0 DAMEDUBOIS
438,355,637 *2C6DFCA2C4403F8E767641A65ABA429768865F3C csbsz
438,355,638 *2C68E4B88161CEBDA2F03479E5B48AB9E8983646 [email protected]
438,355,639 *2C60B77FC2EC6F090AA7A654F92DF17BC28BEC05 CTNS
438,355,640 *2C649EC31BADFE90C4C1E55A44F11E37B76B28D4 [email protected]
438,355,641 *2C64C1E0550ABC9FA9A2B73EF6642F1975A01503 darronnulisch
438,355,642 *2C666E7970C90F126E9857FF3C604C6B7B3B67B2 CULTUROLOGICALLY
438,355,643 *2C6BB8B2F291F4F20FBAE5A772F3151358686223 CUTERASHI
438,355,644 *2C668A42B24D224F9676467CFC248F78BBE2CD4E CUTYOURTEETH
438,355,645 *2C6D7B6874FBB4EFCFA403CE994C406DFED7BF57 27.KADETTEN
438,355,646 *2C6B8717FE2B5D9194631AEF90F69FD8CB613FB1 2801791 sis
438,355,647 *2C6CAFE78AB9DAF022F423B52C583F0D21BE1CC1 davidberdahl
438,355,648 *2C61735652E4BA3D00398D23A5D03E3C9CE9EA95 2881290 NA , GUTE NACHT , HERR DE WECK . "
438,355,649 *2C6189F843A655C0FEEB8C41453DDF9E91F05A43 [email protected]
438,355,650 *2C641F74DD4C4E86F3661C9F762699D682CE3914 291795 opiodiriippuvaisten-l
438,355,651 *2C6540970BC6927F149B4DFCB1903D0623201E1C dbxl8
438,355,652 *2C658139246EE1CA9BD038039DBAC58078C2CFC3 CZSHT
438,355,653 *2C6AC207773F7606097AD5B55519D74C328472DD DE8VY
438,355,654 *2C66604ADC5C165E46FE0AE647F55DF7FA6E5AB2 2FHYDRO
438,355,655 *2C614F49F2973C5F497D8C45EA8E6CE65206BD1A d3u#;
438,355,656 *2C6DE5CC5AC429F3973E3875813A6A9179898E07 2.KOULUTETUIMMILLE
438,355,657 *2C66397366AC2C41055C39CCF665D3166FF0919D D59HW
438,355,658 *2C6E0F2664AFCA8F2C4820CE4B340C08C764635D d6ug
438,355,659 *2C682E9E55691559F1430BCDFD32DD9A6831B28C 2-vorsichtigte
438,355,660 *2C66A6DA25D5F93DDCC81C526B864C45E84C5315 dellamarra
438,355,661 *2C61FE4C801D3C89C89EF77CEA62D06D293D46B5 DEMERVA0
438,355,662 *2C664E70060B7C86263AEB81B0D30DFCF5F701B8 [email protected]
438,355,663 *2C6E62DD573AACEE9BFE624E9D5D04E5834D7B7A DAen
438,355,664 *2C6FACECA90AC38D7B9C113D7C5B64B96C2509FC [email protected]
438,355,665 *2C6F9743AEDC53B8F4BE2A5303B8683402A940AF DEONEDMISTEN
438,355,666 *2C6D7ABA899C7311F643D0265C54E3F2C1AA697E Derek-BS
438,355,667 *2C6935FDE75E394290C86F236FC4EE78E24C07FD DANIALPUN
438,355,668 *2C61A4442E28CC23038D525E02097BA605776DF8 DANIEL.BONELLO
438,355,669 *2C625F37089525273C227AA972EDF9E3CC94FB44 DESHAWNROUNKLES
438,355,670 *2C661D523B3407A44A336FAF78AE9DB0319081FC detonadas
438,355,671 *2C64152612C082855DBA9FBBBC8A3050283BF278 darrelllagamba
438,355,672 *2C6059589EFF3471B94BCDAFCF441554DC7901B2 DEWAYNE.BEDOLLA
438,355,673 *2C6A3A90F1837B43D64348AF666B0DABB6B8AB4A 3MARCHIORO
438,355,674 *2C6AC0C18305A649277AD764DA7DB4A8CE579EB0 [email protected]
438,355,675 *2C6A7F19183FB770D9AC9F9058FF53AC7E780B53 Dgme
438,355,676 *2C65AAF8CACD31DB65789CD07C06119F69867974 dh|:
438,355,677 *2C6BA5E1169C5CD260914C59D3B54BF0F922A3D9 DHYBXG
438,355,678 *2C6352B808AADFA8F21DBCE47D39FD97D221B415 dialyses
438,355,679 *2C6FC768D421B3116469E167870F4FE356D2E294 d?d6
438,355,680 *2C6C40E57C4DAB5CC1FC107624444A5AC21DA3AD DIFUSOR5
438,355,681 *2C6474644FD0EA09EB92C50B0602297BC5F58E34 4EDNEIZRO
438,355,682 *2C6E0420F97ED839B052F39CE712856E5BA67C29 ddy5t
438,355,683 *2C6554D04D8BC4D700DD46B8EDA1076414F38C06 directholidays
438,355,684 *2C6EC93E34DC3774911BE0C53D08A3140AF537E7 Discrete.Lunatic.Fridge
438,355,685 *2C6913273E739C3F5936BAF1791C2A79B0B8FBD2 DEJANDAMJANOVIC
438,355,686 *2C64B372CD892B451DB3FE9D2CBE2CB50ED57FF2 DELIVER{
438,355,687 *2C61927D5D1C4ADAFA77C47170886C0DAF6AA462 4INCARNIRANNO
438,355,688 *2C6C5DEDACCFAF3C2F4ACC3BB3A59CB1E1DB6424 4INDIANWILDCAT
438,355,689 *2C6E7EA10BFB82196A218501EEFD275232B7695E 4ir-rif13
438,355,690 *2C6B8ED0269BCEF4DA1CF762C58A100F3D339325 4KOALACHAMPS
438,355,691 *2C66C1935866BB07EDE71D9153E18EC2F24C6CEE 4LHETTIIN
438,355,692 *2C6678CCE36201CB15A3346B74EBAC3F8C2A635A 4MARIDUNUM
438,355,693 *2C6CABCAADD87FFD12009C42E46441491ED99AE9 4MONOPOLYWINSTON
438,355,694 *2C694AF7174EF2D0D84EE2B815FEDF12E6124FCB 4NEDMOOB
438,355,695 *2C6B9019509C7D7FAC7041EE5D2C174AB4CF5CF9 deprecierait9
438,355,696 *2C6EFE2C6657064146079465CFB253E37B6C145A dobrinjskog
438,355,697 *2C6D72F271F0256FFFDBF92881B3EFFB0D0264B1 DOMINICK.KOFRON
438,355,698 *2C6520A072FBD76AACA4D2B3745CD63F6FEDA6BB DFPR%
438,355,699 *2C6CC755F1BC9399C3D9DCAFF12CA7DEC82BE4F6 DON.MARICH
438,355,700 *2C6FC78F31FA955097FFA6746B64A026E28C982E DG/K-
438,355,701 *2C6982DC6D58385EC6CCCF95A3E9F45FBA7FF041 5835419
438,355,702 *2C65F44CD56FB3BC662014B66560DCB2B86B84E4 dialyses
438,355,703 *2C6B9671C5BE1F2AE97CE864740764AE43132E33 5ELLEHCARBSW
438,355,704 *2C6777418C6488011824BE696526174026666BA1 dpmk:
438,355,705 *2C68DC5B6B24F8DDE241B1DDDB2BD0D120401833 DIPESH PYAKUREL
438,355,706 *2C6E0C5420F1AF2FCB1DFF86FF5B5CA6F9B80248 DREIZEHNPUNKT
438,355,707 *2C651197DF1DB15147DBEB6B8F9B90A1A1C12926 5MADDOCKDRAGONFL
438,355,708 *2C690F9BC84499D180E0CBEDBB4C0E0E49057FC0 [email protected]
438,355,709 *2C62C3B966F2D14EB19AAAC68723E52E64EB78E0 5NEESIAHL
438,355,710 *2C65E01D8867592A85A135335B32D021651781FE dissipasjons
438,355,711 *2C6B3C33695B53D93C1FA52D6789F054F593FCD2 d)i-x
438,355,712 *2C60BFA2D6DACB3FC3F97046285ED3C10C2CE222 dix2h
438,355,713 *2C66F5240B4624DFCBF04DD4BB79F51D12E9F54F dsvu6
438,355,714 *2C6AD68FE4D3A99AD15F12A98BCC8F1FA6FB9FB5 5THATDODGERS1
438,355,715 *2C622CDC9D50A46D8DDC3452F4A0FC5FA95CBABE [email protected]@[email protected]@
438,355,716 *2C6F2497AB92FF63C1B9DD30073D33356A15EC15 5unjoyously
438,355,717 *2C673FB7CA422D32FBD927951AC8025F0FB4EDA7 5 VORSCHRIFTSMAESSIGE
438,355,718 *2C652524292F55A2131196338B83D9A2197E0EC5 d_u$=
438,355,719 *2C637C7A57765291C69809159B06B84ACA0DED96 601948 odalarda-edirnekari-ahsap-bezemeler-egemen-
438,355,720 *2C6582BC06F07AD0FD54C1AAF827D1C5DA9C6FA7 dm/rf
438,355,721 *2C6DF4644961B49A664D8FE0E461AB6B81C80D79 dulce-rose
438,355,722 *2C66B960E63573657F10D47B5F8A3578B2FF799F dnll
438,355,723 *2C6D7BBFFA6BC826D713EE031F0F560AFBC58A0C d"olr
438,355,724 *2C69C4F840B1EBAC27A76A8AEF0984275DE069EB DOMENICRAMCHARRAN
438,355,725 *2C63533257E48EAA91CD0EF81D1B5B09FC522625 DOMINICSANDHOFF
438,355,726 *2C6D01EBAC2A4F8A436D49AA69D6142C1BB34877 DWQ'
438,355,727 *2C69AF9A25A4ADC5BFCE426027AB5DD5BC2DEDED DONNY.FRIEDMAN
438,355,728 *2C6505E740EA7F7E9CB07C23514A8556BCB214E4 6kamryn
438,355,729 *2C6C95B9C634EB66003BC3491B7563EAE5376B5C DOOIL
438,355,730 *2C69734BC52BC837AAA7FA7EDCB19168E0324B07 6THEBLINDS2
438,355,731 *2C6F798B5F4DCA402479DAF62691C80D49424AD2 6TURBOSTEVEN
438,355,732 *2C654CF11CB3407D8D3177DF17828D386F51C483 6VEROTAAKAN
438,355,733 *2C6BE1263DF34D3807D0DB52B728AAFD5DC3846A 6VOODOOHANNAH
438,355,734 *2C6DC52D80057095495BAA8CB6307D4D56D951E7 DOWNTOWN:-20-GREATEST-HITS
438,355,735 *2C622BC8673CFB0FED027493F9D98FEF45101F75 eat3m
438,355,736 *2C63C7586F4A869E2FE64F2A58290CFD2915EC48 ec$=h
438,355,737 *2C6D504606B0C268EB80EE7C62FECE3B08DF1A35 DQ0H0
438,355,738 *2C6FBCB38DDE334012F7EFDD4A03C52F5F9B127E d)q-v
438,355,739 *2C6B95810AA290DE21CA022F77F4BB935638EBD9 DREAMROBIN
438,355,740 *2C6083F4DCA48292B297142FC5E67FB455F891A2 EDNACASILLAS
438,355,741 *2C6598755C940660AEB9FE3F515E099D5BD83C8E EFGRB
438,355,742 *2C6B2496F45FD867A9128B22F607022DBB54B967 ds5e
438,355,743 *2C6A13C74989F94FC809FB9B4104337011011F2E 7KWIKKING
438,355,744 *2C68C6C802F74414C43B8BD3651A4DD668E7C7BD 7LILLIPUTIAN
438,355,745 *2C62ED8F97832E8146749A72B63EE4448F57A298 7MILKCOTTONSEED
438,355,746 *2C6D3D4D0CFE211F67DC1BB2FB9BE401330FB364 7MOTIONINFANTILE
438,355,747 *2C654D30570B010C746FF0637FE16D3CF617CD81 EHMIKOH
438,355,748 *2C63E7295FCAD82149BD26C28C486D52399F2C13 7NOITAZINAYK
438,355,749 *2C62718D651E8B3D57617182008127571F148E08 ei}4
438,355,750 *2C61B32A9D0B2592FA8AE2E8C7BDEDD9A88185F4 EI?h
438,355,751 *2C6F5D45F35DC3C47D29B1C4390C56B55D1E9656 [email protected]
438,355,752 *2C6981BA4C0936A334913CC351DF7B5E6F9C93A0 DUCKJEFF
438,355,753 *2C6597893BE09B49851E81D91D7C1D91CEA73960 7TROPSKE
438,355,754 *2C6F8ADBAE66A8910E6CBF740CF7A879355DB695 ELDENVIRGINIA
438,355,755 *2C612E6890B326D812F2D91FD93582A3C679FDFA ELIJAHALVIS
438,355,756 *2C68101256771F0E068254234A6BE5EDAF5D9127 Dv1O
438,355,757 *2C63BC108D0ECE242AD9CFABEFE6DE6AC47A9BF6 dzqu
438,355,758 *2C6B89236515A4E0525643E41296FCF55E749BA0 ELTON.LENHARDT
438,355,759 *2C65D3766193ABBF2138FEB0A9C1BE6DFBF8C94D ELTONLOZADO
438,355,760 *2C6013753B62DD750CE5CFB9054853C7BC5DB14F 8##B*-*>-<
438,355,761 *2C68EA24A82EC816B455EA46FA28A340632B94DA EMBD
438,355,762 *2C6A2F44283645EA6AA8FA180B64DE8F02D458EF eaovx
438,355,763 *2C6BB453667879F3B47D0021FE8B8806DF0522FA 8COMPENSERA
438,355,764 *2C66CB625B851A82E6D8341C74DB3F946A0B73D0 EMPANTANADOS1
438,355,765 *2C6433951FF5EDEA2319390E5F49AC57EBC6D065 EMUNTERT6
438,355,766 *2C6622E71150B783013C468857131C5A5A5DA01E 8GETSYSTEMOPTIONS
438,355,767 *2C6080E768314614EB7308C24C0DE757EF7976A3 8HELLENISMI
438,355,768 *2C64982F2BB6548F8FB2E160919A4AA6734138A7 EN.AUF.DEM.BODEN
438,355,769 *2C6832CCF5B00785BE8933AD4660F69E830CD33E 8JOUTAIZU
438,355,770 *2C6D17173990F48A939AA944A364DD8CB1F3FFBF 8.L
438,355,771 *2C6D39102323AD8D2B9D07C60A3E0281D8CCE42A edgardolauterbach
438,355,772 *2C6AE80A5AD0E7B3F0FD053FA0ABB0635A283DA6 edlb"
438,355,773 *2C6DBB078949B911A6D25118D3ED4761164BAB2A edwqn
438,355,774 *2C6A978DD9012CBA7D208FC4A2DFAB7F4DE417AA effwo
438,355,775 *2C69335252F6D30A24B15570415E77D510525752 ehk&u
438,355,776 *2C6945F305EE14A8F49A43B582C1601FAF448646 [email protected]
438,355,777 *2C686AEA5A6BD18A4A71D2D58B73718577EC68F0 8SCHRNKA
438,355,778 *2C6090288B0FD12C612873E772DA65C4E8B75F7E episode7では終盤理御と共に謎の劇場に迷い込み、ベルンカステルが「真実」と主張する物語を見せられることになる。
438,355,779 *2C613983F68B95BF3F909B56490ED3EF8F8DB994 ergotic
438,355,780 *2C6C7548B20E2E3CCF464E85A7946E8A6AB0A214 elayne-fife
438,355,781 *2C64D8231FB8D4F605A6E71F449F29C8A1362158 eldarlı
438,355,782 *2C6AE6F3F623ADDE46F4A5F67EB84CB8CC83B4DE ERl-
438,355,783 *2C6637371AD596ACF9665432736FCF8CF6C38326 ESSENTIALS1
438,355,784 *2C698117BB116A4BC5B9DA322370563B18A29764 EL"P
438,355,785 *2C67C3E21D21D24E0F5B92168725C5C63203C539 eu}d
438,355,786 *2C6CE017330DF6D3013C8E63271D02D48F78C5D4 9EBOHPOEADUJ
438,355,787 *2C62CA52904FF5BBDE4FA0EB698B396EF9C4BEC7 EMERY.MEDOSCH
438,355,788 *2C6CCCD15DBC56CDD8F29BB092A61B67A8FF3A49 emilewasielewski
438,355,789 *2C6F295DEDEF16AF0729C0253EEB8B138E6354F7 EMIL.ROSSIGNOL
438,355,790 *2C6128851AB4A4C5290C00D960778B2A7A3977B4 EN71.206.137.40
438,355,791 *2C633F4CA54EA8AF7CC130926E4CA99A91D33205 encinitasmag
438,355,792 *2C6FDAE1AE657F064D9AE918E6BF1BB7E94A3660 evolucionemos
438,355,793 *2C6F8966A5848203602E439C43CAA021CA7BF6C0 exisreal
438,355,794 *2C620E309EFE88D8222966A581CDD7D94A6F42DF ENPSTIENNON
438,355,795 *2C69429A893169C3A0D6AB1F72E19E0DFFC3B55B ENRIQUE.GARAFANO
438,355,796 *2C63D1179468A6707DA1C5A368A75AC620798D31 extrabig
438,355,797 *2C69E36C1C852A1E147A7598F5BE3997E085BD1E ENTUSIASMÀ
438,355,798 *2C68C4D240F1D0D7B32FB31EE0C136D17CF471B9 eoatf
438,355,799 *2C69C20BDFA34004EB5E5E4514347C5AF14A69E2 EPOLETNAS
438,355,800 *2C6A200D35FA02E07718FB4CC02D004C38AF62F7 9PARETEPARETE
438,355,801 *2C659D033423402396F82DC8301E26A796204F4E faciebant3
438,355,802 *2C60078D1B754DDCF72B24ADAECB5FBBDC6B52E9 FADE.OUT.YOUR.EYES.(AB.CLUB.BRUSSELS,.BE.12-04)
438,355,803 *2C667E7F2863D1A7068E7A7AF0B553F952900DA9 FATGIRL123
438,355,804 *2C6FF61E3B6A76DF4B4148F54CAA701A8279018A FELIX.TIMONERE
438,355,805 *2C64A3EE11B5BBAAF06CAA28AB2CC476F9F6D851 [email protected]
438,355,806 *2C66324FB23026128D20D02434754C5ABD3D71F3 [email protected]
438,355,807 *2C62FD9101B1D7BB1AB3A418561E89AF107F50C6 fermingaillard
438,355,808 *2C6130D8E06E31D7AAD0A4AF60D3AF0851D990C9 ESONIMUBLAXE
438,355,809 *2C68F46C42A6FAEAF64E10F5AECB31500F6A3B7D [email protected]
438,355,810 *2C6BC7A4451562C0CC1F3D5CF4D54F831EDB0B0E fionarux1
438,355,811 *2C63F74399F784F7613B3D0DC5205918A351FD2E [email protected]
438,355,812 *2C6BDFC9ADA98E8A175BAB77E0BD11300536933B excurs
438,355,813 *2C6B08665E8CB3C9FC75BFA3C9B872DD40F95A87 EZRA.TRUCCHI
438,355,814 *2C622382126ECAB063503F5141E0A514C6A5E580 Francis-Joseph.Dizi
438,355,815 *2C616C932F7009E687FA5294AA18FC3498584F95 FRANKIE.GAUKROGER
438,355,816 *2C64A3B7A9BEEEF1914F816A280C65F8F4E27BAE F2(S
438,355,817 *2C6948797ED34EC447AD57B04D86D5131DD2E514 FACULTADES-DE-DERECHO-EN-ARGENTINA
438,355,818 *2C6BFD196D0F1E1F583B122E32E2D9DAFCEBFDF5 FALLINGWHILEFLYING
438,355,819 *2C6994CA512D9AD78E7A1A6D18F768001EED5805 FRIDA.RIVERA
438,355,820 *2C6CCB8EF00D7B2B3FEA4B2804C0B61FAF8892B2 /FRIEND/P3989097
438,355,821 *2C673AAEB21A52BCFC27BFEFEDEC015C51752C68 a2kt
438,355,822 *2C649103DFA7B9BF89A06EAD0E00DF2703AFEB7D fcn~
438,355,823 *2C60DF3D036E86E069DA087BD05C4D79B26D00B7 *#=AA
438,355,824 *2C627BDD99BA7E3563A46377506D319DB7044AB7 GALE.SAMARA
438,355,825 *2C661DBF25A7CF7FE121AFCFA457D5D1F459B508 aaa">-
438,355,826 *2C69FE84A4BB5145B22825EE19B2B669C740BBAD aaakce
438,355,827 *2C609E3DAA5B54DF73D53AB00ECC0D94324B0E1F aacq"^
438,355,828 *2C6F4F2C2C3CB8C37C2575C42EB82FB2CEE54531 FIRGROVEWASHINGTON
438,355,829 *2C6BC58A503263BD99BA80F5B2E0964DE132E545 GENICLESING
438,355,830 *2C62A47C87429890CA512697FF69BF3AC32E5A68 aaronindigo4
438,355,831 *2C6A4C608E40F81AC7797844E0B43DA972C6A7C3 GEOFFREYROTEN
438,355,832 *2C69BFE5907A291C60A5BAA2C4B87A1CE38A9BCD geordean-schwartz
438,355,833 *2C649C5E7EA039F6749E3C6819AD2F06C9D10B5D [email protected]
438,355,834 *2C6A6A164BA4B0D85089D21228ED1C4DEE0BA62B abdulvillaneda
438,355,835 *2C63BEB2ED9F17FA7CF3E19C01B8D5AF3A5D30E1 ABEERDRAWSHEH
438,355,836 *2C61A6C352DC92C96D28C889C64B2FD70283E8AF GI5R
438,355,837 *2C67AED957D058218909F744CC44F365C6DB75E9 FQ/J
438,355,838 *2C6FD05F7DB22B98BCF765463950ED030954EF8E francesszumilas
438,355,839 *2C638326BC74675CA77641441FD7A05409B15B58 FRANK.BONKER
438,355,840 *2C6B172793AB3BF995CFD1FB822F636508B9EBB3 A;(C1
438,355,841 *2C6527E50CE3F8AC3B8B7F2AE582801349F83869 [email protected]
438,355,842 *2C6E7562CFF28AEBAAD82F91DB9C72B227BBFAA7 gniwolfn3
438,355,843 *2C62A11BCC2ADA50E41C6B86194633821F1E20B6 [email protected]
438,355,844 *2C690D3DEC86E7557A8755A4FB503100B0C73F0C GONNELLAS4
438,355,845 *2C69B7ABA6CD7DE05545F20297D44F9C3D221806 goran.pejnovic
438,355,846 *2C63C90C1DD40D810DA360F7356EBC8A257C63A9 GORDONCONSTANTINO
438,355,847 *2C6003AFA8B13AEDA8AB3D8B8BD7E2A92A16EC36 GOUVERNEMENTAL9
438,355,848 *2C6CAEB8B453D570D1C99B5E08E0B90B1906260F [email protected]
438,355,849 *2C6EA4BA191867D5460875A223CB5A054740E872 FUNVIRUSING
438,355,850 *2C6474F19101A360074554C5A8D222027705D6D7 FURNACE-ROOM-LULLABY
438,355,851 *2C673262B3ED9876D7ABAE991A56DA85FCAD691A [email protected]
438,355,852 *2C66B8FB37BEB9A4BF1972E237EFA1CD25337D9A GAMMOCKS
438,355,853 *2C61E2E88C6AB8ABCBA6E217BD9BCDBBA1AC8C7A AFFIDARLE3
438,355,854 *2C69AAFAEA88CF321CE00B620BC3C4C537A84298 GARYMOGO
438,355,855 *2C6AD8BAA4E1472F770BAE054E54DE29D3F9AC5D GARYSTONEHAM
438,355,856 *2C65002475D80ECF728E64124C076A27F1F3A8A7 HANSAKAUPUNKI
438,355,857 *2C64FA7AC87AF1798B8EDE0420D267F06AD965D4 AGUSTINMEAD
438,355,858 *2C6B3DFB29D06C5F26C1BC28BA58ABDAB07B68C2 HARLEYDENICE
438,355,859 *2C60041A005E9F444296C357390DC52D4259B41D GEKEGELD
438,355,860 *2C6C28F19A23F2C40FF078B8ADF098318AC96C1E GEOFFREY.ANASAGASTI
438,355,861 *2C6B679A147613D2671CE923271409FF6D4FAEE6 ahog$
438,355,862 *2C6225D14B4112B8AA95209E5F5FE3729DE3C55C AICJG
438,355,863 *2C6F6A219F1B767693E8F3A6719F1DC000624107 HDDNFLD7
438,355,864 *2C68A3A1345946870681069B7F3D057D2FEF0F0F healthconsumeradvocate
438,355,865 *2C6E158ED37D566FB23A1BD33FDF7C936818E1E7 AIRIS14
438,355,866 *2C6B4962660550E04D9B5AD9395649DB64A4D129 ajdm1
438,355,867 *2C6559A8A2369FC827DFE758F4B366766F663B16 high-wire
438,355,868 *2C6BAA82FF528AEB6B564AA8659316296667198B HIRAMOSUCH
438,355,869 *2C6306F88AC1DD426455D68B42766AF9E8CD30F9 gidrevghing
438,355,870 *2C657FAF2DDA7D1B00415ED0D83B7B500EA45DA4 al2h%
438,355,871 *2C65D180C747BFCA06849DDEAC87AFB43B83E01B ALASKARISCHREIN
438,355,872 *2C6B8E5A83D2C7197C26C8D43DEA54D54B3A8A37 GILVERSON
438,355,873 *2C6BDC52579ADE011D5031E119172AD0D98DE894 h.jbaa
438,355,874 *2C609148420016E4490A82CE0B0A615783EE79D9 ALDERDEN2
438,355,875 *2C6C0578928167C31A85F23087C1CFBFF44284FE gitxeas7
438,355,876 *2C6064A964B31EEF0ED2099504BCD10ADD05198C ALEQM5IJQKGT4RH5L28YHAX2VEH
438,355,877 *2C61F7A50F335805901196C0E1D6DC3B3BBCCF33 główiczyn
438,355,878 *2C642765884B07BA607C0565E81F1DCCF2E418A9 [email protected]
438,355,879 *2C66E67388B488DDEBEF9CCA8348AB0114C3400B alf9
438,355,880 *2C628CE0208F5B036F0749178DD1547B0065A4F2 GNILLABW6
438,355,881 *2C609829A2DDC5916B8183DE6720A72F8166039B HOR1ZONTA11TY
438,355,882 *2C6AF70339E0A14F8CD5DC555B1F8F072751E661 [email protected]
438,355,883 *2C635448F3156C2945AF8711353FF542DA9F00F4 gobi.nair
438,355,884 *2C6AED36C5A5378D1DD3C98DC35A405567A9DA10 allancatacutan
438,355,885 *2C6E61191147F5B87D931DAC6EEC01DE838583D7 hotspurs
438,355,886 *2C6B881121C1210E6DBB9C531EDD289559259110 GOPORCH3
438,355,887 *2C6CCEB6C4308FAD5EBBB122362212D887B0F4CB GREENCABINETSOURCEORGWWW
438,355,888 *2C6AF15929CE307DA8B26D48347BB19F09F142D1 grigely
438,355,889 *2C6AF2AECEBCF7ABBD255695005D5F508F893DCF guadalupebelles
438,355,890 *2C6F1368B126A2B6C404777B1751462852423A13 amycane
438,355,891 *2C6FA2FA21F56FD774F5D30BD2F53D506B549938 an9u1ar1t135
438,355,892 *2C6DD051A5179DE47818A36ECBDAD80BD7F4884B ANARTISTINWONDERLAND
438,355,893 *2C684BD7213C99CD00CDED4D2D6E93EB287E74C6 GUY.ZULUAGA
438,355,894 *2C63AF08D4D1AB8D1313D8D495CDFD2955ECC914 [email protected]
438,355,895 *2C6A05238A872D5671AB530EE5A1D5C456E31D67 iamedith51
438,355,896 *2C67B321EE6162F47CABE87852F92CEC82152E31 ANIBALBOTTOLENE
438,355,897 *2C69E654A594D1CA616EBE4D55463EDEBD7C8C71 anna.greaves1
438,355,898 *2C6C3C5B479DDE07D919DFA1DD11F8967D825608 ANTWAN.SNETSINGER
438,355,899 *2C65A62D34457AF6CB0C5F9FBE98E48761FE4339 ANUL9
438,355,900 *2C6A87C7E0B5C4279CA19DA8DE5341FFC9E8469F aocwu
438,355,901 *2C69A352647F6F3CC65806461EB4D105AF67AB91 a(osn
438,355,902 *2C6554E71643A61DA15324582F3C0619A090BC0A harlandrober
438,355,903 *2C6E8884B598E331863CEC1DC062080EEDEC4100 HAROLDJESSE
438,355,904 *2C6BFFB79C7886A4A5E968D9ABDDA118C2C9BE12 hartenboer7
438,355,905 *2C67116C039A2688425EA0CC55EBFF2696D8E9AC ARCHIE-ACOSTA
438,355,906 *2C6F5BDD7DF7A9406DE02151AD11AB4EF24F973B archtreasurer.
438,355,907 *2C6E1B5DC34F817F5A3CF205CB18C487DC42A565 ardengeringer
438,355,908 *2C6569DBF06461A4134A9011261CDCCDD6F79EE9 ARENAQQQA
438,355,909 *2C64EC06E1E6EE555D849B782220FC7038F1EBD2 INFOHENRYING
438,355,910 *2C6AB339FACEB5B0CBBD2720B22620FA3EFEFAE8 ARIELEMANUELSON
438,355,911 *2C67C8D81EA5A7E1F75761CEF5FDA143D624D266 [email protected]
438,355,912 *2C63CDBBF09748DF7DED88680FC4E7A4F58CF8AA INSANEZIGGY
438,355,913 *2C6292B431AD69E5EA1A478E9045FDAF31C85137 INTOXICATION(...GUERILLAINDUBMIX...)
438,355,914 *2C6FBC20A0B9E7FEE6FF6F8E29A6A19403A4AD89 IONTSUH
438,355,915 *2C6B23EE23DD51E0D462AA68A46AE90D263599DC i-relevant
438,355,916 *2C6E58ECFDBBAE3728447FA5120E01948DFB03A5 ARTANDTECHTEES.COMARTANDTECHTEES
438,355,917 *2C6A6ADEC0CE5575DB82EBDBB6D732573F9956F2 ARTEMIO MACARAIG
438,355,918 *2C6249B1D5D7E4AB974C1487BDD4FE70A4A1A8BE irvingnewgent
438,355,919 *2C6E19D0FBB9E75069BC16DCF578719DCEA40A9F irwinpeelle
438,355,920 *2C6F080A931E3B38813E1A53199A4A55C9CC200B ARTILLADO6
438,355,921 *2C6F6CD54355323813ED76132D7FA0E67E7C8ADC isaiascontes
438,355,922 *2C6AFA9030459ACA673A2522F2E5BE990E139D3A ISAIASPALMATEER
438,355,923 *2C668BC8971DE7A36BCB44E65941A199940FB5B3 isaknez9
438,355,924 *2C643EA776699D819E8FC8152CADF8353802EB55 HESTERPRYNNEK
438,355,925 *2C6FD5F4E0A49BEA2508F5DF9AE9039C7217E9CC asc15
438,355,926 *2C61012807F3E95F10C479C1C644FF6797711037 ITLOTZORAI
438,355,927 *2C6C10CBFD9A4CAAC3BABC59B3AA62400A5F00AD ITSELELNI
438,355,928 *2C60EC4E7110E0FA40C8B08613358F2D9272F0DF ashley.nicole.adkins
438,355,929 *2C69C413114F86B90C2F995CCD71A30E6C477285 [email protected]
438,355,930 *2C6EC053A44AB17F9E033170D88B7949117A110F H_HJ
438,355,931 *2C6814DB4355E78382383D57DFC60DCBD1D5B255 JACKSON.VLASAK
438,355,932 *2C6744ACFE7293DCD38B99BB687BA916DD894018 at6b8
438,355,933 *2C67C55B1A0FA61AD784A8699A91E2044BE1FF52 ATIMAATRA8
438,355,934 *2C6DE26C05E04F259A4A3B683BAF3876EDFBF2E8 JAKE1943
438,355,935 *2C673CC6A52EB3BF67B34CB4363500D21028AEBF hiramblackard
438,355,936 *2C672B4B414C3B70C7DBC04E14D0256A0A896C6A AU3KI
438,355,937 *2C67793F6228EA1BE5FBF15AEEE858B0265C19F1 JAMES T HILL
438,355,938 *2C61B8B95F10F5598EFAB8D3B16431510F4F9CF5 AUDIO.TEKITSTUDIO.EUAUDIO
438,355,939 *2C63196A309F1A391C69FC2A8031F30CA89725B1 JANAKRAVITZ
438,355,940 *2C6DF864547E3B5A833BD959ECAA5820BEC824E3 HOME.OF.THE.BLUES
438,355,941 *2C6DDEC51E3B931A5673D43C3DBAF039E906B340 jasontorrijos
438,355,942 *2C687FF546B3C38C495DE4BF98CCC87F61240039 aup#g
438,355,943 *2C6E672372804C8C8D8248101CBB689DA5A0761D AVIATORIALITY4
438,355,944 *2C6D4097E3205FE929E461CD517D564D95249542 JERROD.MAUDLIN
438,355,945 *2C65C46233B2452A6B719625C0ACB6DDC9CF1E63 [email protected]
438,355,946 *2C6091F2672C67F48D13B59002DD64F8A5E504F7 JEWELLSAVERY
438,355,947 *2C63280EB0B5C0F7D35541ABF3F8264A914F2899 jigga987
438,355,948 *2C640DA0ED940F641714AECEBB1169D07E8E14B6 JIMMYHUTCHKISS
438,355,949 *2C6A371B3D8C3A155027C88D380B89A7BFDA2BDD [email protected]
438,355,950 *2C6663C1142524CA8AC44D2FC02E671D2A3F6D7E [email protected]
438,355,951 *2C6B66D9BBD9276EF4D3C086DC72943F2B12DF4A JKAKSHAPATI
438,355,952 *2C6EDCCDE581F288178E167C2F1991BEB2E86CB6 [email protected]
438,355,953 *2C6D7E0FB2951A08FE78C97610D75AC08C29328A HUMBERTO.HELMERT
438,355,954 *2C62455FCA5242A6A351439FEBD4C31084EE5F39 HUNGDRAGICH
438,355,955 *2C62FC258467486A0337C8E204461C49AB8C0729 b$2,v
438,355,956 *2C6462B8FDFD38CAE3CCBFC722C211868E6B411C JOEY844
438,355,957 *2C6B572E9930BBC94E8CA36CE8092C3E5B7B3878 hxbikmgv25
438,355,958 *2C671AFDD6ADE5F6321FCB058716AFD4F03C9A13 johnhupman
438,355,959 *2C6586DEB673CEA2CBCD26BFD3180A651C120D16 HYDROSALPINXHYDROSALPINX
438,355,960 *2C61453568720DF15F82C8DCEFA2D8CC83FE9AB2 johnnyprimo
438,355,961 *2C606BE19839528BDC48CA7E7BC74FF4BF107E54 JOHN-SHOULTZ
438,355,962 *2C6D3FF2D35A41CCDC886F55E9108394518C5758 HZ-NET
438,355,963 *2C6D16F5188DE20C8BC487BBFF0829ECA3FBBE2B jordan.nigh
438,355,964 *2C63A1F7D762823668F5BA04DF6AC4CFFEA7E2F8 JOSHUAREMBERT
438,355,965 *2C62E316A9DC2A3160C2DE76370A70FBD603FB46 JOSIAH.GERMAN
438,355,966 *2C657F7CA4C36E9CFADE57011B9CFB981764F8C6 JOSIAH.KATHAN
438,355,967 *2C6499A63AB6A6CE85E751A58ADAF2069B2331CE B=91A
438,355,968 *2C6A6563EB1BFE5C1AADE08A4EC7D84C7F30F274 ba1yl
438,355,969 *2C6F3ABE410056523CB2C9A68EB054A41B2B7A60 bailey.tzuke
438,355,970 *2C6F9B2EB8BABCE403EB807FC0DFF98F8F74160F JULIANSCHAMMEL
438,355,971 *2C682C78AAAB5CAB493EE43E27EA43258C9A5D23 BALLERSB
438,355,972 *2C6D3829B5E97048BF577880AD32F5C53CCB209F balw
438,355,973 *2C6B5662AF5A310855FA77C073E3036178D770A9 igolttan
438,355,974 *2C6F3F59E001952B4D447AF471F26B8C8A2A87FB ik.
438,355,975 *2C6DB368B62D51E183090C8EA5BE76CD495D76C3 KAKEMAMA5
438,355,976 *2C6B033D72E7BC1B6477CBFA009232386BF29F21 KĀLAGATI
438,355,977 *2C632F1F8BE77CDEE30817403D74C3236922A572 Bas.Quartiers
438,355,978 *2C68BC505D1116834FB476923B68740416F31F6B ilipokua
438,355,979 *2C6CAA927B4DAF08302F93AF1367EA28A1413D23 BATTEREI9
438,355,980 *2C6C9B752A470C553262E8A8BFB6BCDFF27FCCE0 karuby123
438,355,981 *2C656AA1887D52856DEC231F9CA1AE757B3BF0F1 ILUVHORSES666
438,355,982 *2C6A16365FD38B1C40D53DAA18A724A1E1A1F2C9 B?CA
438,355,983 *2C66F9E2260741CECDE1BC2D16B245747F83038D [email protected]
438,355,984 *2C62329B0DF2ED5E6BD6064359F6D84320C1BE2C KENDALL.KASINGER
438,355,985 *2C679879EA72EA2D4D5C98AED762CD0048F0265C b(d;n
438,355,986 *2C6373C8A8CC4AF7077D370EF321AA4077371C26 be_!8
438,355,987 *2C6E8498FA06E93C2C2F33A6D9D274A67B502467 KERRY.FANNELL
438,355,988 *2C6E6A55AD3CFC995BF9C2FC1ACA9603CEC277A5 BEATTIPS
438,355,989 *2C6DEEAE00961CD6232396D650A60812E3F888CF BEIN'ANGRY
438,355,990 *2C600AB59597E6630184FA0B661775187B7A0A38 KIMYACOVONE
438,355,991 *2C6646D4950797C15A4DF126440FAB696C7F9565 KIRANUSTEAUA123
438,355,992 *2C6C10FA5FF3C6D2981E8F2589AC14E76589620D KIRKERHOLM
438,355,993 *2C6D0ED01BFB14DF6361D74F43CF21A8430E2889 BERGESERLAH
438,355,994 *2C692E556D10BFA4EE4E199358F95475EBC8F6C7 b)err
438,355,995 *2C619602AD2842670B99E4264067C41305912433 bertramstodomingo
438,355,996 *2C61678C9790BEB4CB65B7713665CBF82F8F657F Klara-Top-75:-2008-(disc-6)
438,355,997 *2C6A2A7A84F61902562F08C04C2F4E4CE03E8D58 BETOKENS
438,355,998 *2C697B4F88ECAFD8A4EC843026F921480B9C4771 k!n3m4+!cs
438,355,999 *2C63D53E6759CF5C9E13E41C33E2DD058490F072 bfrt=
438,356,000 *2C6D59E474AD8914009D07D982CDBEE1D327C9A6 IURANDO1234
438,356,001 *2C6491C16FB3E04787A33DCD694BCEF226E68774 konskripciaj
438,356,002 *2C64E8F4E6B684189E3936B6AFD5D5E39836888F kovenklioğlu
438,356,003 *2C627651055A997D1729302BE1BF82798DA93859 BIG-BETTY'S-BLUE-COLLAR-POKER-SHOWDOWN
438,356,004 *2C6D66A623C2B42B985AF6429CBAB399ECEB907E bilious
438,356,005 *2C6E6C805C9B135AD06E00C5999CCA8A0F8ED053 KRISTIN KUHNE
438,356,006 *2C6C19D35917EC73B88BC6F22477E800531CA078 jaehne2
438,356,007 *2C6AC07043957D5EA0E8AE16F40A7860E3DB38C7 JAINITS
438,356,008 *2C6279D312AE3F58E9C3B3B41495B8C7CDE4885B JAKE.DISABATO
438,356,009 *2C68A6F085A0CF931DE8DAA51931A34F2C33C395 KURDISHMOON
438,356,010 *2C68DFB1B9319B2215020BCACE30A26BF7D975DE BjG
438,356,011 *2C66AE9CC09C9C2491E26F7862F5A5F623165811 B?jr
438,356,012 *2C648D16764675911135713D6DF193A1F4FC5A2D JARVIS.POLLART
438,356,013 *2C6AE9B45BF5AF31868E33929611A9C0207E0F1D lacysuleiman
438,356,014 *2C602857F8C33A6752B6631BE95BBA6444D7CBA1 JASPERACFALLE
438,356,015 *2C6DB0B3BB42520DAE68649B11C9BF05D377481A Lady-From-Amsterdam
438,356,016 *2C65AA79E9BD31768D56B4C8565AEC74F5B1275E BKNDRGR1
438,356,017 *2C62F3B2C3E145140B84892C40B9009682E1ABA9 LAMAEJ
438,356,018 *2C604EE302E9FD06EC802001AE05A6652EBF6940 jazzsax
438,356,019 *2C6BABE6A0B190A1E33247629B7240C5EE98F998 BLAKE LOVAN
438,356,020 *2C6E693F177E9F40C77FDC052B01A4A6B9E6A10E LANDONBUSHART
438,356,021 *2C6765B1AB4DAC8556950BD12981FA19C77C2025 [email protected]
438,356,022 *2C64204D1E07A858E06F8551B90E1E219844B55E jc:.
438,356,023 *2C6E42F2F4F98F960586646C2F8C9E06E160956F JENNY-DISTOR
438,356,024 *2C6B581268D1E65C9090D5D7C8928B02FCCAE864 B!N3U
438,356,025 *2C6B6FA1F0F869A96FDBB92E62BD7A9AB6E5D64F bochtscharnierens
438,356,026 *2C6AE523879229766B4ED7538AD0F6A8C2BEB8A3 LEMUELFELIBERTY
438,356,027 *2C64BB77CD6658E4C3E861280747C6114AE6E46D borislepping
438,356,028 *2C6968BD7D42D265FB027E55FEEEE5C786DE1C44 [email protected]
438,356,029 *2C64959287229F87F58D1CE9CE104E818AA13E94 B=OUM
438,356,030 *2C61F36F1C08F862A1D0B6D0172E916CF0435727 [email protected]
438,356,031 *2C6323733A84CA48F049FB9014C47C7AFE953086 b/pg#
438,356,032 *2C606FFFDEFF00148BE518CE6D2AA5BB89006DB0 JOANNEMANAPUL
438,356,033 *2C65A2F4346D22166A8A604207553C40301ED7D2 bqnchoied
438,356,034 *2C65309D8C9881DEA89D69231CEAFC99C5B87ACE brainberther
438,356,035 *2C6AD755A678D9D5CFE0C076AECC361D16550B9C LIANGDUBEI
438,356,036 *2C6BAB343B764E0C248FFF225B4A695B80C21B38 [email protected]
438,356,037 *2C68D8384AA4E81F50D63958299B05E601B99EA7 BRANDON.GRUPA
438,356,038 *2C6D06ABD89E730E917567E9E00F517B72599915 BRANT.FROMBERG
438,356,039 *2C6FED1758CAA689B5E4F1CAD7B46E26D1696527 [email protected]
438,356,040 *2C6342F00AAE737E3F7D9C12B91EDC79B8BABF40 JOHN.GREEK
438,356,041 *2C6E4BDD941FF269F85C4B0A4EDE287B20ED08B8 LIK)
438,356,042 *2C6E29B4112C755957D6AE56313C68647DAD6910 BRITNEYPLUS
438,356,043 *2C6192F7CECF890BCA6E9586A6C4FA8EA1189AD9 BRITTANY-PITTARD
438,356,044 *2C6EA5246017FCC4FD117398A8313B3A278DA588 LINEBAUO123
438,356,045 *2C6B459B5C49134B81DADF07E661A372742118AB JONATHONMETTE
438,356,046 *2C634E773BCB4B0FAF5633F3ACE63AE1CF9E81B1 JORDONPITHAN
438,356,047 *2C65525BE4D462A45F0E898789E6E48BAF60EE4B brqlf
438,356,048 *2C611BF36F55225AD6F3C971B9218CC087266DEA JOSLYN AYBAR
438,356,049 *2C6C29A139F0D8DD50F88929FFA2A6E4F23A10A2 JOSUE.MUSNI
438,356,050 *2C6DB68B091F720154431BD22CDEED1064BEAB8A JOSUE.SANDLING
438,356,051 *2C6408EF1480DF5AC4DEE49FBE59C46DB88683D8 jovie21
438,356,052 *2C633EA0194F96D2215B80F1F7DF0D47445129E5 BRUNO.BINTLIFF
438,356,053 *2C644E17F6A575C2BCA6FB1781F16B2C27FA0F49 jpg代替ngc6027
438,356,054 *2C6F6B85A09F874BFED7C9B36FA9D7D84F89D668 bsfr
438,356,055 *2C6CAFC7DE2C021AEF733E6345F6BEBC47C5E2B0 BsRj
438,356,056 *2C608A6F3287B86AC983707C892DC07E37E59CA8 bswnongqiang
438,356,057 *2C6FA1B919CAC5BB096BC8B5C935F9B358E20B7C Lord The-king-and-queen-and-all-are-coming-down.
438,356,058 *2C6EF3650C1DCF322BC5662DBED910DE5AA8DECD JW7L
438,356,059 *2C665C7B7635B0E6677265EBBB6E2A08C15DB27F K1NNA
438,356,060 *2C651EED3B3FC5FDE7E215B92A30F8DADE7A1094 B"UJ%
438,356,061 *2C6CA3F670D43B3A6BBBDE76E6AD0C32E72FDBB9 K716983241
438,356,062 *2C6A72CF5A06C3632134F13E837141F210A00EC8 [email protected]
438,356,063 *2C6697672F070D59D3ABD167D0798BC8E75EDAEB lqiyhvied
438,356,064 *2C6AB78D3FA784644113C220623CC80149BBD940 KAMISUGI5
438,356,065 *2C6382D773B984A99CEC9D257BFE76FC426B1CAB kareemkallhoff
438,356,066 *2C66CA7D299A2AB4487353761A1AAD2F4253A418 burtininku“
438,356,067 *2C6B70BF339F37AB35201BFD4B64F1E5602E7E2A KARIN CLIFTON
438,356,068 *2C677FAC587FD77E3CA994D140CAE9AA79E99C83 „BUSCHBERG“
438,356,069 *2C675DF940E14F101D0EFFBA12635518BC3F1F96 BUUGART
438,356,070 *2C6533FB8E4F67067F5DF4B5E9927BA580BF3210 LUCIANONICLEY
438,356,071 *2C67976B45E180399729EC3498FA5483FF8DBC8E LUCINABSW
438,356,072 *2C66BCE444A0230876D7E9248A67FFE3A5F1E4AF KARON BELTON
438,356,073 *2C691773842B7BB3174E091BB39C9174EBC694CB b;v:!
438,356,074 *2C64B2E28FA619BFCDA4CAB8F8A7BD27C1F3A69F KATHLEENDIFAZIO
438,356,075 *2C6A7299D3ADCF75783999F4611C25D26CE0882C luky.a.j
438,356,076 *2C646641F86EEA0BF538C8D9D6380439343966C9 BWINDICENSUS2006RESULTSSUMMARY
438,356,077 *2C635F4CDECBAF8895AF949C9CAC87E0817B87BE LUPE.TIX
438,356,078 *2C63B07F935687BA48C3AACFBBE32FA6F43DF343 KELVINWATAHOMIGIE
438,356,079 *2C6C99F822AC761EC4DBE88D8F2CFE1A592A4E8C lwaybsw8
438,356,080 *2C64A4629521966B1B391C07AD5B193282B319BB KIJUOMATON
438,356,081 *2C6FC007765FD5B6FA9B05A21500A8E8FCD3B067 c3$ue
438,356,082 *2C67E8D551633763C2278C90C3913144694058C3 MAJORSTURIALE
438,356,083 *2C688E5F8F8876CFA7DF058596EE6397D1CE6994 c8oi
438,356,084 *2C6D49FB4F09836D9219531273B0295780D9E735 c9aha
438,356,085 *2C6881BBFACA0A40953AFF6E9AFAB885B2F46974 KIRK.MICHELSEN
438,356,086 *2C689F63F36369B8B39E85E723189F9643F93C13 kirveste
438,356,087 *2C68DB20D375C2F454A1F40F7D2617F1C1CF7381 [email protected]
438,356,088 *2C697192AFBD6335B4E41030A0A224350632275E MALVOLIO AY,-GOOD-FOOL
438,356,089 *2C6326E522DCBF199D78CCE8C9075C5D25F0AD24 CAMILLA.HEDLUND
438,356,090 *2C64C6236EF3094FA3F2CF4018304AE276C070BB [email protected]
438,356,091 *2C66EDE475B4BB5765FE8B2F56548C4C15426105 MANSANOVITCH
438,356,092 *2C6D6472176F5717B2DC86F45C0E18BA532FB8B3 koelnissae
438,356,093 *2C657F64CB36AE43F09385397B4E9ABD93EA93F0 KOMEDIESTUKKEN7
438,356,094 *2C6DCB5102EB2777D96DB030B122B33D17839587 KONSCHTKRITIKERIN
438,356,095 *2C69FDE9CD8EB3775604FADDEF82CE7896044E06 KOPOLY
438,356,096 *2C6FD856F2F4D0BED29C30B702FD7425684014DC CAREYFILBRARDT
438,356,097 *2C6DB3343BBFACAE503138C2CEC527DC417F2388 mariehofer
438,356,098 *2C6BE898233EC5FADAB7600CEF13C5A860704DD2 MARLIN.CORCHADO
438,356,099 *2C6BB4E3373AB73A3AC26C2BB0E20260EDE41FF0 MARLON.JANKOSKI
438,356,100 *2C6E34793BFFB316D7B10AD9D64755FF54CC6A42 CARROLL.MARAGNO
438,356,101 *2C6DFA6BF9D2BE57F7C1BABBBC2BC26A56DC29E5 CARROLSWIGGUM
438,356,102 *2C6CD345AFC9CB6EA1BF7C31C33E511A976D3F79 CARSONRYUN
438,356,103 *2C64A5536553A1CC0163FA631C81B71CF013C185 KURT.LURIA
438,356,104 *2C6A5851CECC0C6B757EDC34B3AAC7FE81CC4FC3 laatstgenoemde8
438,356,105 *2C6F6C8EF79DFCD191CD4DE0D52D78AE767DAF52 La-Hija-De-Japonesita
438,356,106 *2C60609F66A15F7EEFBAA2D880D8D12C612C2C26 matthew-nitschke
438,356,107 *2C68131248BDCBBCB77E887917968A907AAC7D35 LANCE.PARROT
438,356,108 *2C6184A4B5E16820A6538E2AC30C48F155DE685A MAXIMUS088
438,356,109 *2C6B337F703A47CFF149F6EB32B85F3F640F1C23 LAST GOODBYE, FIRST HELLO
438,356,110 *2C6C6CFB57BBE7C633082B43D3C4E6CE32CC194C megarons?
438,356,111 *2C6182EA75C3B655A00B3C4302E8FBE5EF8EC370 cesarkaleel
438,356,112 *2C69ADE7ADC07C62E6C642FDEBDB6D1F28934E40 MERRILLBROWNSBERGER
438,356,113 *2C6DFD2CAD7C94CD5FE730173B9320B2B692CEAB MERRILL.KEHM
438,356,114 *2C64AEC24F5F66EF71969EB6DB188CB7CF9E8C48 METHODIFIZIERUNG
438,356,115 *2C6B9280437A60758071528CA70C7C97C0662287 CGTQ
438,356,116 *2C6A25FD66689B7DFF4CD35FD21BA9BD087DA6DB [email protected]
438,356,117 *2C69BBF73EFDDBCFB105E8FD61C381C311594345 LEE-YI-JIE
438,356,118 *2C6D0C238CC7ADF88F17189F6ED32B7916A7430F MICHAL.PRIODE
438,356,119 *2C6862F3DE61E609D359F0158BA30C28BD4627CF [email protected]
438,356,120 *2C6218409D39FF4D9F05B803E0C61D5448EB7F81 MICHELLE M.
438,356,121 *2C65CA1DBC252B4D538F7EA781DFEB73A4FA597D LEN.MAJ
438,356,122 *2C6725420F2FE79354C9EEFE2B223266E3241C74 MIGUELRABBITT
438,356,123 *2C66C9A43AA69D6C809EE66F7B5978A8C19F8A8C leonardchaves
438,356,124 *2C6B650812A43870D3DD7E80B25CB81D8A7D96E3 charliejessup
438,356,125 *2C6BA3D6CC4CFDFE35A8E4EC3855D49817E3F00D charlottecoley
438,356,126 *2C6C733E43AF0BC8CEF1CC10B72C33DE36174EE9 CHCKSMSING
438,356,127 *2C628527DC0797A601EFBBA2DEC24146EF8FF54F MIQUELKORCHNAK
438,356,128 *2C6098735F5F8CBE980BA5E4A810FA2AFE1BE8AA [email protected]
438,356,129 *2C6E1BBA4C0C589F69181C895940E1E5A118F0B2 [email protected]
438,356,130 *2C6BC47B65C34F7C4E56A3F6546AC3395BF4DBFB MITCHEL.FAERBER
438,356,131 *2C6741DEF57B6FEC8D9A39BB13F8A10C8CF977B0 [email protected]
438,356,132 *2C62D74DDB1EB907B3F49273EFB3FB7D2F8C7C88 [email protected]
438,356,133 *2C6888534CC597A9F21C39F6BA06C056B86F5381 lierre!
438,356,134 *2C6086CFE5FB9431F17B8C65F1129A19AE739ACC chiquitagilles
438,356,135 *2C6115A9878C24B01A0FA08B138F2DD1099E786C Lincolniana
438,356,136 *2C64250C86497DB120CAD741C07B467DADF7FB07 CHOT0
438,356,137 *2C6DBBCF6DF54AFC7CF5B89493F04523C0017F15 MNV6666
438,356,138 *2C66D9C11B921E6D5E735EFBA64B42423AE11233 CHRISTOPERTORRE
438,356,139 *2C630E00A71E0905835B11078CA32170A15BC91B MOBILILTY
438,356,140 *2C6910E65CAE9D2D572DBBD0B1296CDE9A67393C [email protected]
438,356,141 *2C69527148F6A2E74A1F4C5F450AFD613413426F MODESTO.CARBON
438,356,142 *2C65D317F7AF4FFE175A9C3083FE6E220DE4824E MODESTO.KRUS
438,356,143 *2C6E016CA85A5B861211C493C2830580B789279F CHROMAKEYERS
438,356,144 *2C6B8934A6B0E52F37469552AF010F13B7CC5C10 ci=ef
438,356,145 *2C65EDB88D72F1E541374846C97A08382775DD82 MONTY.RIEGEL
438,356,146 *2C6130256D09BA811408AA220496FA4881693D8E MORDELLISTENA.MOTOENSIS
438,356,147 *2C602BEB54BB955C0450BB59268E19E225486C1E [email protected]
438,356,148 *2C6D3D6E2536A09AD4EF869989B421741AE219E5 citychallenged
438,356,149 *2C6D6CA926866D1F441DE14CFE7AF354C21695A0 MORIYA)
438,356,150 *2C6EEADDBAF111C5189BECC6C3C09C6226223A31 MORMODER4
438,356,151 *2C6BC8605294BB9F196FD9682D2F625DC4A2072D *LMC090487
438,356,152 *2C6FEEB28CF986D13215D6309D84169B2C1836E8 CKEM,
438,356,153 *2C6829CDF86661253ECF276ED9785CFDEB46D0DA classification,於
438,356,154 *2C6FAA016491C20C415E8E5563EBD9AD3CEBE13E lorenzomacalma
438,356,155 *2C6AC6A76E0EB990C49824D15E2DB647FA01C81A cle-$
438,356,156 *2C65537902193B31BF5063E40FCBA5494FA8327B MURUGANSHANKAR
438,356,157 *2C66EE7826971C17E05BA8C9513F27D965074D6F c.#lo
438,356,158 *2C653ECF26C192A0211B4E2655E182A0F81A0EA1 lupita.covarrubias
438,356,159 *2C6E2E4962E62BC666B349E3D265347D62891BD6 n^$a
438,356,160 *2C65D6F8E1163B55292339120F5BC9C5ECDC1F09 [email protected]
438,356,161 *2C638864A204A139CD4BA8F44BF443F431DEB618 na.lo
438,356,162 *2C6F79C04645FBD06FB10FE86C3F77CD8F56CD57 M1OLUF:
438,356,163 *2C6F25D785001D7E52AC226E8AABBAF296CEA734 M1S1D3N71F13D
438,356,164 *2C65C60EED6294A137191476671BD7E8C1033F79 n-colombiana-del-espacio
438,356,165 *2C612B5A6076B2F5991214A3D2696740A7405D35 MACERAMMO
438,356,166 *2C6CF837785AF3AAB3419AB238B339A0472029ED nele
438,356,167 *2C6EFA7BD1EC3C1E7DA1595F13A91D6F4994CF6F MAGAZINER
438,356,168 *2C61B019B21A80BCB18DF243F822C46A55314307 nerabmha
438,356,169 *2C6F67FBE70F2885E98D07FE03A508342ECD371D n+errela+0n5hp
438,356,170 *2C613C4B6C0FCBF09FB682A80F6157F11900BD8D COMMEMORATIBES
438,356,171 *2C614256F1F16B43DD1DBCBF4D5FF4C2A619218B network76
438,356,172 *2C6A2671D62629CCB9AD5525F764635469204FAA COMPUTEROY
438,356,173 *2C6F2AEAABF1C526DF7429E24E7B449A4E905DF0 NICELABEL
438,356,174 *2C699777EA15728562771489BB3EF7EE399A295B NIKKILOSW
438,356,175 *2C62A32042BCF0379CA6C3B49C186ED904F6C3BD NOELIJAMES
438,356,176 *2C661EE63A77A9223C435CC52D7B19F85367DB67 NOLOMS
438,356,177 *2C69A8C04E17A22F149B29B728B3A11BBC54C654 northeners
438,356,178 *2C67D66611D0735212C0C46D9295BE8A28D9AEFB MARC.CRAWN
438,356,179 *2C60E8B305963F4E99454BD0E3542B8C9069BA37 CORTISSE
438,356,180 *2C68D9DCC86BAF92A27A121BFE8BCB382821EBF0 MARCELLUS.VOVAK
438,356,181 *2C6EC4544190119C0C9280C21A016FBE3FED1ED5 marcelogiesler
438,356,182 *2C68AEF44A76BE455C034A799AC689D0EB69279F [email protected]
438,356,183 *2C6B943FA76C221B480E23D655C70CCBFDAD9F8A COUNTRYZTR
438,356,184 *2C635153AD555881D361F5F2638188ED6750CC18 NW20071122093708307C380387
438,356,185 *2C641407F13933AC24CD36BE3B721A5252F37895 o235353
438,356,186 *2C67CF0C15AD93AE5163DC9D90091BEC660DD226 CPPU!
438,356,187 *2C6990521123D10FE5686A334A4E14604495FFCB c;=)q
438,356,188 *2C6A6B00B726C5B241C77831C0B1ADFEEACE9A9E Cq%+
438,356,189 *2C646D859A94F087226DE5132609D871BAC30E17 oles-de-venezuela
438,356,190 *2C6BC472F61A1F4C39379B1C6A113AFC70408E8F martygillilan
438,356,191 *2C6549AF912026606F3B2E10331398C0C748675C [email protected]
438,356,192 *2C61196E9D7B94E788206E34E9C4CE394B37E4E6 MARY.MERKWA
438,356,193 *2C6148A6C51DF7F917F4898F21097945925061E3 crl+n
438,356,194 *2C6E52FF45EC40F8F087C9148C4894F8ED3C6DDC c%sr
438,356,195 *2C62FBAE7DFA0F28B87336191DF6657A74FA6497 (><)O~.Q#8
438,356,196 *2C6AF1FEAAAE8801A1AD37044EEE743DA39D26A8 cvede
438,356,197 *2C67AC17AA81CB957BC34C7084477D04EF272BB5 ORKOMENSKE
438,356,198 *2C67D2F5DAF89BFB387D09DC1D8C677F8BCF9CE8 CW5ER
438,356,199 *2C60B7D7EC7890EEDFD5747BF11650DFDEB70871 ösztörüs
438,356,200 *2C6CD695DEC097AB8B6E8A17DE16755788825ED5 d48_a
438,356,201 *2C670F0D768D4F95D30A1DD19169436609A9A713 P3RM$$4B13
438,356,202 *2C6A84B046F9CDF79E7C6A3AB2BF1C687486B72A D6OUG
438,356,203 *2C6F56C2028C61015E1B09151E1457D9452EA516 PAGANAKA
438,356,204 *2C693ED3F2357EB2D30D892433A132F68C86E58F mervinolufson
438,356,205 *2C67A65BA8F1050BAA8B4AAE38513327EEB61C2D PAINTERSJOHN
438,356,206 *2C693BD26819907716AAB48B4FA6E6E6EB291291 PANTHERLILIE
438,356,207 *2C63FC6A2FE4C7EA2A20550FC1A0254F3305CE0F d:a0
438,356,208 *2C6B6DDFAC0C5D50059CB3CBF0C1617350B5E908 [email protected]
438,356,209 *2C6F3798771E1F8D2C67F3912171A318BC97E54E DALLASSTOUTAMYER
438,356,210 *2C64764EFCDA48B7CBE072BE1D55D713E707D968 DÂMARIS
438,356,211 *2C638C13F8118DC251593D0E49EF86F812B9E924 DAMION581
438,356,212 *2C6B7DC91C226A3B0AE135C65CFE48EBF13C9C44 DAMORIHS5
438,356,213 *2C614F5E7278844581405F618A3730575D88460F MICHAELOLINO
438,356,214 *2C6D87D576F9AECB36A3B7C850BBBCA90466A6FF dans.la.grange
438,356,215 *2C6DC255D41CE33696C1D1242B24645C2A733DCC paul-dubicki
438,356,216 *2C6D00A9C57B7DB18BC01AAF2316BF282F933154 MIKE.IANNUZZI
438,356,217 *2C64D213D12F4C6B103CB4D6DC5C62A5DEC1C553 MILADRABIEE
438,356,218 *2C6EEACCE6A5FBAF9D14573E9CAA13D74D441C23 MIRZIYOJEV
438,356,219 *2C6F335E2627615081D48FF6DD2EB4102F5D5033 payton!
438,356,220 *2C64C4F53343453DBED78F0DBAF89D0260A41CCA [email protected]
438,356,221 *2C6EB30E6857D34051EB8F0B9B28A6B5968A1A23 p----d`->-b0
438,356,222 *2C65219AD84878F2BB3350834626EA7633802C1F [email protected]+ORS
438,356,223 *2C65C2C4D0A5E513809816B6EE8016D1E938D228 DD%ET
438,356,224 *2C6E83BFFDB31074AF8D71E329CE13C47B476D50 deanjonas
438,356,225 *2C6E860455CB9730DEC690A7F5AB8D8FCDA8514F p)fw
438,356,226 *2C625F3BAD9ED63C07EE3F25911EF4453988202B DE&HK
438,356,227 *2C67407E551490A62277E6796A72FEA7461BC4F1 Multmll0nar3$
438,356,228 *2C6C49FBDF2AE3FFBB84EE7CDD70BEC0944B63FD PIERREHESTERMAN
438,356,229 *2C6E0783620B480B67AA846BD10C1C26F23DD561 PIERRE.RODENBAUGH
438,356,230 *2C6DA43BC4E5207F660B3D0C32F0ED61709962CC pigtail3
438,356,231 *2C63086A519C60B40B23F0AC1EA519304B3F921A PINNISECTED
438,356,232 *2C681BD32C358D2416C9EAE035BE9C1010192040 planetmedalofhonorgamespycom
438,356,233 *2C626E7FEB52287831225F51AFA2BECA6E8432D8 PLANTPUSHER
438,356,234 *2C612CF64C977441E4A072FEE915667B51954683 MyHouse(dubmix)
438,356,235 *2C6024837E3AC9F25A7D28DDDF7CBAB15B238AFE MYSTICSIVA
438,356,236 *2C65A6BEF353C67B9FF4F16D0125F61EA016A664 NANYAMA
438,356,237 *2C6EF110EDF8B2E22884436F30B093490C20DC54 dh6bf
438,356,238 *2C6AEE3AB64ABB8FDF897819303825D4624D150C POLYGLOTTAL
438,356,239 *2C63DAAAA5D2C71326828560F28E60BFAA6339F6 dialyses
438,356,240 *2C6B5B145FCB94F330184A152DA8DE47BF18B728 ndcmpndd5
438,356,241 *2C6282417A57F13AC9E984C5CF60BF2CDDBA47F3 dido.
438,356,242 *2C6AE97D482490A1A5A5371DF02092683751CF0D di,k3
438,356,243 *2C694002FD0A79B675DA7EC4A688B8B9EA17087E DIOSPYROS
438,356,244 *2C63649DE072C108C56A4DE7DE0B7E2D87BDD402 DISOCCUPIED0
438,356,245 *2C6F0AB8677747FF8A65E8D0478BD74A1E65C4B4 [email protected]
438,356,246 *2C6287CB05E199C6E9C010E42EE6D868F13858A6 ngegkeetskrich
438,356,247 *2C6D822367A9FC9BBCB6C0003CBBD564A0E0AE90 dmlqj
438,356,248 *2C6FFD24E488029526C47EA34F9F37F5EE095F95 dm)xw
438,356,249 *2C640ECA2DD88D7A5F7ED6491E64D13484CB2E3A DOLENGOMYKHAILO
438,356,250 *2C679885D309AF5550F0BFCCC028AFB6CADA4E16 DOMINGOTHORNELL
438,356,251 *2C610730A076EE83EEE3EC646871AEC1A22563EA PR0VID3N7I411Y
438,356,252 *2C6E1F6A48B91DCD8DC02BFAA86C64EB0D17C2FB dominiquemerzlak
438,356,253 *2C6467280EC8C9148E02D63C390213F0FBA8F3D3 PRECOAGULATION1
438,356,254 *2C6A9CB56F442840FAF0180935FEC02B31084536 donna-kistner
438,356,255 *2C6F99A3117CA19A3D937EDAF1535069FF605579 no-caramelos
438,356,256 *2C67C8FFA3821932217F9C872F54018CCB94CDF9 donovanmacapagal
438,356,257 *2C63D9847F2388D0A37E1A99625E762808BCC654 NOMARXOY2
438,356,258 *2C66E70D33CB7B4BC3952B82779130FBF17046F6 NOMMIEZSES
438,356,259 *2C6449B71D849EAAD5828F1C3BD5E4645F5522CB DONTE.MCCUBBIN
438,356,260 *2C62F97729DCBD29957BB8AC95739494B277F3BA «PROATOM»
438,356,261 *2C626C4B3D8C4A9C723545F7611FFDEF31DB0BC9 PROLINOBORUS1234
438,356,262 *2C6335FA334DE228FD7B45155C21B8AF73751E1F NOOOR1975
438,356,263 *2C676440FED4CF870616934D55AE81C180AA5822 (><) ~ ~DP
438,356,264 *2C63755AD288B07E1F00732CC0A90745875153CF PROTEIRO123
438,356,265 *2C603EFE950BEE2A16369D96706601B110D28DFE psychmcmastercapsych
438,356,266 *2C6AD457D56AD5EAD3F6916D19DE15F7F42BB12F [email protected]
438,356,267 *2C689898D38FD6CF038FEB21C2E9C0959A88AB0A pwd8jm
438,356,268 *2C6A6553E381CB56C1CEE2D40E63FDE5F59EB98B nutta1
438,356,269 *2C63876A35322953F6A016B2191F728107D651F3 Q#####B***SPLAT
438,356,270 *2C668A85B1F7980965C2726F326E91B034A944FB q----d**splat!!
438,356,271 *2C6EB74BBC34F5837F10B819149C212563F94357 (~_^)o~0~(==P
438,356,272 *2C6A82DEBE99E9E5C88DE5ADABA7F8BFC4BBC67A ds-aw
438,356,273 *2C65AF79A977F852EB533A2F6580E0797ECF24C5 oblacek3
438,356,274 *2C603D5F4530CD90705B774C4CD6AFA89E70F207 dtkm+
438,356,275 *2C633B48FF1BB75581BCA7ED51663EA2F88D9E5C DUPOOPUD7
438,356,276 *2C6D660872ABFD708387D7E4CC9D46CC89B797E4 quintinmaffei
438,356,277 *2C63A0D9F04740EB52B6F9D0CF5AD52BFC63E315 QUIPONS
438,356,278 *2C639DBA2619E42C106851E6CC3F5548F3373594 [email protected]+z3$
438,356,279 *2C6178AC43CD1F04FE056704F5706068931FDC60 }O{O~0~.<######8
438,356,280 *2C6ADC7CA0E10DBC5B2C94409F0D40ABF165CE92 O-ON-IRAN
438,356,281 *2C6E02CF0C9B3B1D700AEDB5D84D44692B485D27 dwrs
438,356,282 *2C6EF68A306F261532B42CC96FDF47D7570E3569 rammisalo
438,356,283 *2C6DAF000100E4F8AEB12DA9CE989B0C4039A79E eanimots1
438,356,284 *2C6E68306005FB06F1D594198602E1CE9B7F30C5 osobennyj
438,356,285 *2C6AAD6355B01A8C392A21002E2C400779EBBCE7 OTISYEAREGO
438,356,286 *2C6D582DD7A4EE5950873ACD66C724D798BDF42F EDQX7
438,356,287 *2C60F96AD3F2C94103A85875149C2ACF22F7367E EDWIN.RYZINSKI
438,356,288 *2C636A50A7CC5067BF2CA41403BE7F0C70A45B38 RÉACCÉLÉRATION
438,356,289 *2C670F23145D263A59C85D7AFAD4CDC3CBC09352 EFRA3
438,356,290 *2C694E776876891BE5409B27339073CA5976FB52 regestrafft
438,356,291 *2C66367C02C52760D4DF36046B13E22CF75B3EE8 EISENHOUR6
438,356,292 *2C68A99D9AE1511E707D528D5C7309A1C9ABD835 PÁR’
438,356,293 *2C68D7F5A2591FBB1EAA22AAD2DA72C90949E591 part.2:.darnach.bat.pilatum.joseph.von.arimathia.(chorus)
438,356,294 *2C60C648D9B6A3E8B0C4E676363DB9750320E344 el6;9
438,356,295 *2C619DD905EFE60146022FBD2324CEB3CEAF4119 RĘKOPISMAMI
438,356,296 *2C629CFF8017126CFE2D7F8FFC90E513DFF30B44 REMANIIO4
438,356,297 *2C697E627FDFBC496FD43D35DE67373135F5396B REMBALLERAIT7
438,356,298 *2C6B61F72CBE5769DC8A4FE8C43968EB0B8C70A3
438,356,299 *2C6E1BB674B8B4A1B63281C79505A377723BF379 +RE$PA$$IN9
438,356,300 *2C608B10A267F470EB6B04DBA45AC11B24FEC5D9
438,356,301 *2C6078A2CA2E04F2A0F0D962D1C3D1EC60F5CF38 n
438,356,302 *2C648566F3490F54DF86F9738F25CAC39D853507
438,356,303 *2C6D4FFF311F8B4E20D9643090FDF0CFEC6A1C05 REUBENPIDRO
438,356,304 *2C62339AE5BA6C6719FC02D60F4F2A774C462DD2 rexvisel
438,356,305 *2C6BB64B51EE27EDD4FCCC98BF2268CB60756606 ޲-P<c
438,356,306 *2C6974B8EFB40DD46098DB288C74FA418EE7E960
438,356,307 *2C62877C6972C9CDB4E26448BD6313CBA9BC2C5A
438,356,308 *2C67F5C7004BC0EF00539605E194DDD3D4B1FB32 0
438,356,309 *2C6A2814C6D4E4228E1203CFD5FEFEB3B1203CAD p======d~-~splat
438,356,310 *2C620F9DE3100F75BF31A168329FE42B53C218A8 *
438,356,311 *2C6425EB163A914DAD51E86B29118101150A99AF pekitmek9
438,356,312 *2C69A348617A8E5402B4999486340AC0747422C1 PESINASILLER
438,356,313 *2C63D2AA91CD2848345E431107BB6407911CECEB petrozavodsklake
438,356,314 *2C6C6E1B58C7D7CA5A6BE9854EAF8B41C18821D4 PÈY
438,356,315 *2C6C2BDF1EBAC3E863BAEC599774014ECCDDDC5D [email protected]
438,356,316 *2C6BA8F53A6AE2C23F1A0728ECB223B3280D6C22 PHANTOMORT
438,356,317 *2C64C177924BC7CC2AEB2C8E0A777DBB9728389D PHARMACYRECORDS
438,356,318 *2C638A26CCFE2BD486610315187C11477636F18F RILSTTSLIRING
438,356,319 *2C66CFDB2B1476B9EF345A7095E894C0EE5DD153
438,356,320 *2C674DACBA29845E93A8E4C1B7FC03F23508B011 PHLLCSS5
438,356,321 *2C6876D8101F5B13DE7AA468E4F3F584C837501C riningen8
438,356,322 *2C620504C3A93B56F703F176FB430A6FCE73FEE2 Ў
438,356,323 *2C6B76596469CA92D728E7A2417AE4DF06E1F0D3
438,356,324 *2C6615306929C36DEB1E2B956D324806A6021F84 [email protected]
438,356,325 *2C6BB9999DB543930CE7BE74B0D1D1ADEB79B62C RKTMANCOMWWW
438,356,326 *2C6406C683CB3C10C101B8CED5B7CF0ED7BE7234 |
438,356,327 *2C653DDE9E2CE7CD9AEFBC29228FBA096EFAA8CE pirinke
438,356,328 *2C6D100D47912F1BC0AD4623646FDCBEF5028D47 ROBBYRAVENS
438,356,329 *2C66EE4E64D43DE8C207140E9E912E446183C9CA 9z
438,356,330 *2C6C0C7DFD04B00483AA19F991AE777AE7207CB9 /kk
438,356,331 *2C6012A7AFB2306CFE85F13B50B42AB457699A9F [email protected]
438,356,332 *2C61762085848EDB49C8736D1F63ACD77FCB2558 PLANCKENHET
438,356,333 *2C6C6156C4F8DC80D9C4306446152D1C1C65B86F
438,356,334 *2C6BF0F725C1224A7E223FDF44A93DF8463BA771
438,356,335 *2C64D9539C643B5A557D2D8502EC777E5F225C7A robinwinter
438,356,336 *2C6E81390EC1B1032269E4AE53D87BD1ACD903A9 s
438,356,337 *2C6EC476B460859E9A39B512B7B0DB99F4DCDB25 rodsilvestrini
438,356,338 *2C644C89FA278725C9AB1C458F3095AE8FC53BFC
438,356,339 *2C6BFEA69D11A52D1106F34C515F4CA383417516 rogeliorochin
438,356,340 *2C6E2D2868B7AFD67FD75225CFAE888B23F24E48 b;
438,356,341 *2C6E5671941263F316CB0DBB44478047591685F2 [email protected]
438,356,342 *2C64E024E22240133B3EF4B90AEAA734BA2C1E7E rolfkaleiwahea
438,356,343 *2C6A617BC5AE25CADB802FFD00EF647038D33984
438,356,344 *2C6933F1DE37B521E4A0335F3F77A93964C2C1B3 [email protected]
438,356,345 *2C6272C91B2FD258196CFC15FE21CE7E7A38F2CF ROMAN.FURNACE
438,356,346 *2C6993102E5996723FB78BCCA6CC85694F6A497A RONALD.MORADA
438,356,347 *2C60796FEA42F6AE9731CBB86A1E61E79B7C981B RONNIEMILIN
438,356,348 *2C65A5A98431FA9BACF531917E18E3EF98877FDE ROSARIO.GRUMET
438,356,349 *2C6AF8DCD43F45B1947C2280919531161464EF97 PMVTSEK7
438,356,350 *2C6E28FB4EA337F0F27F151A424E3E538D4474B0 PODVODIM2
438,356,351 *2C6DA9EF12743CC719D6E9D38F80E59A66FBE4CF ponizenje-1
438,356,352 *2C6A8DD447FBC8673451D569905B1D5EBACE28D0 *)dՔ
438,356,353 *2C6493F7512A72D0D70053C4E85CB041CB64ECEA
438,356,354 *2C6B92AB18083350711F46854EFCA32DA5598FA3
438,356,355 *2C6F960E101AC821C0F935825147B45FE515D82D l
438,356,356 *2C63D0948B41DA2D283337DB0399B0196EB6B076 
438,356,357 *2C6CEE361F464871E28BCAA7F2CBDEC07913DA5E
438,356,358 *2C677A6395DFE2F253ED79FC51C9362328FAF73B roxie5foxy
438,356,359 *2C62310E56D4ADF0F826D425DFA64DD63AF042FE
438,356,360 *2C67E98EF7A65DFFE6CB03D83637AFBA8F19511F POUPKA
438,356,361 *2C6A7A4B80C9B76CFDE0545215105872068305C7 D%X̘ a
438,356,362 *2C6E010B50374CA02952FB5B4E6C5B050AE658BA RUBIE VILLANUEVA
438,356,363 *2C65CAA8FCA307A0132ACBB74ECB45B6FBDC95C4 rubinbried
438,356,364 *2C6482DB764C734CBC0A5B75FC14D49D90D4513D
438,356,365 *2C6B5C5E5911CC344948A581A78B81EF0D90EB73
438,356,366 *2C6C2EEF7DFF4213DE21E080C150046D979C310F }7q
438,356,367 *2C672574A390DC2E920C5CC778A85698C3BE1C0B p#####p~~splat
438,356,368 *2C6B26DDBF3B721903D81C490AA83DA584E870C6 PRAIRIE_KNIGHTS_CASI
438,356,369 *2C6CFF64E150BBC28F400E778FA8DB3962CDF660
438,356,370 *2C6871C05B81AE2DA46554ABC586486476070434
438,356,371 *2C6A2A02BCF2D56A66C1271A929E1DD26C3257C5 prec0n7r!v!n9
438,356,372 *2C620012DED34C67F09046F8B095F1FBE1F7DFA4 N
438,356,373 *2C6749AB8519C76D59570DB07B3E9CC9BE981CBD #\&
438,356,374 *2C6D87796FA080DF3DA4BB6D4221D17B775CC168 RYHMINEING
438,356,375 *2C6C10353FE974B7F0063AFA0B7449D262013729 PROFESSIONAL-IN-RESIDENCE
438,356,376 *2C63CA90253B91EE4B30804EC4198BDEE0C7FFFF PUBLICPASSENGERTRANSPORTLONDON
438,356,377 *2C64F38A9C203B362E45B39CCA2F2434E694AEC7 PU-INSAI
438,356,378 *2C6EC01C2EE40F780F5A1532BA375575809AB1CC {o
438,356,379 *2C6DA69C3ABC259D5D480BDB852ADE42B99D6A0F [email protected]
438,356,380 *2C6837EEA2C1C9DF74A74E39CF975838D704DFDC [email protected]
438,356,381 *2C6728E80F413FE5D644F9627F38F1B71F9D1167 safir-ahmed
438,356,382 *2C650575BE86E51FF7D56F61B99CDB89B8EA2432 PZIWEI
438,356,383 *2C61BD89989D72437BE63FAAA5ED18DBE2A3B943
438,356,384 *2C6081DC8495259A6413C39E68A917D66729F6A6 Q2A
438,356,385 *2C65AA515D6A2AD566B4979C7EA243CCA2808709 SALACIAN7
438,356,386 *2C6588A612609FB21852814845E15A1EE5E94F8D
438,356,387 *2C6F340656313063EE726C12CCBCD58869029350
438,356,388 *2C63480D8B703BB1A5BE58294795B438270EE393 Q---->~ ~ ~ SPLAT!
438,356,389 *2C65858A047A832C9D5A854C8A260C1114FFA928 SAMUEL.BRENES
438,356,390 *2C6C5ECDC436C9275A23582E84C721F93DDBD3D9 [email protected]
438,356,391 *2C6B6D611CCB06282838448733F7CB4C1AC2E287 Q###)~ ` }X{
438,356,392 *2C63CC5A0614577C5B950798A034CE79968BE275 SANDYMCELHANEY
438,356,393 *2C62DEC016DAA6EBD2FA7B7214B037D36D7D836F R3concl3m3nt5
438,356,394 *2C666AAC2C5D11563231801CF06563EA47410433 R3PU8LC4NSM
438,356,395 *2C60B0649A12D713951F91191199DB92EF48D08B サンティアゴ・ワンダラーズ(SANTIAGO
438,356,396 *2C6ED1833A9F655123A919DB88304883E9A164E5 sb125197825802282897
438,356,397 *2C6D008AD9E2748AD8CBF1EE04C1223B1247981E RASHELLE-HALL
438,356,398 *2C63B7F1394DD7A33DC867A72D86EF08CD9C1B55 SCOT.VOORHES
438,356,399 *2C640A132045A2F3F64821AD7B2A6F28A8A4C0D0 SCREENMAN
438,356,400 *2C6440EB443E73011670BCB978AD4998CF5CACEB SEEGRUNDSTÜCKEN
438,356,401 *2C645C6DFE287FC6771488BBF56281A687394A9C RECOUPERA!
438,356,402 *2C690A24A68967C8D30D59DE5BE3F1709948FBAB REDURCHSCHNITTLICH5
438,356,403 *2C66C9DA7DE5D2785D4FF47A049D8207092C4AED redwingpumpkin
438,356,404 *2C6A97DE181256DB806A1BF034BADBD5CB9FF95E SERAFINAGONZALEZ
438,356,405 *2C68FD9E7C9F0F780E15AE54112DADCF83C90E2E SEYMOURMCKISSICK
438,356,406 *2C619B84C4E74CA48AE48AC0B011C0D1220A2364 sh3ar.b00
438,356,407 *2C6D61659342F8A672DCCFABC8B5C30FC6C65B58 REID.WARNKEN
438,356,408 *2C6C0BA69D7BE243C1070A58711DAE613BC22133 123go
438,356,409 *2C6D814722467AC260AE368F8920C52189490693 shaunscarsella
438,356,410 *2C6111119DB509E37663B5EF5B546EA588654C7D [email protected]
438,356,411 *2C62D37A1BD3D4331D3D419BAE1BE3D91A29AC8E SHEN.TENG
438,356,412 *2C683E31C365E062B8AC4110510A095CEF4F5D29 RENE.CHILL
438,356,413 *2C6F7B0043A6E4F94AAE24DAC545010D850E055F 12 TURKTUR
438,356,414 *2C6EBDA5FB4E9889E08670AC145AB9E34B6364A1 1344226 stop-and-smell-the-roses-.
438,356,415 *2C69CA231312374AD523B85B2122FC40BFFE30A9 13.iivanainen
438,356,416 *2C6CE1FC4A81DC3C386490A37159975F785D46FD 1487455 punamultaseoksella.pystysuoriin.,.sileisiin.kalliosein
438,356,417 *2C6D5C183538C71BFEB897E95BA1ED4BCCFC4512 SHONOLLECH
438,356,418 *2C62B7FC42FF4C58A7AB79401C1848D62F949FA4 SHOPS-RIVONIA-SQUARE
438,356,419 *2C61B91E378BA942ACED52F201A6019625868459 RESOURCERESE4
438,356,420 *2C6D302284E518F62FF661D06BBC97494E8C5509 SHUGALUMP
438,356,421 *2C643B24B9DB92AF59A22D1A9AEB81662FB53A6F 1562421 ALLE18-JAYLI65-VUOTIAATVOIVATKALASTAAMAKSUTTA.
438,356,422 *2C6314250073B7766F9DCFD53601A58E5BEBEE16 15 ALKUASUKKAIDEN
438,356,423 *2C6B728C7EA42D2129EB2C86728B1E77D937505E RETURN.OF...
438,356,424 *2C6016F8E913F99AC18AC8317A8346A7B373EF65 REYES.MISTROT
438,356,425 *2C6AFD3FA1282E3ADA1AA1C9FD61AFA35B3A1EF6 169KAYLYNN
438,356,426 *2C6CC25FB7D2C4C5AF521B6E177F219C284A4BD6 SIATTUOG1
438,356,427 *2C6A2C4BC853B36F1609AE9BF3B39C7F63D7E37E Sim
438,356,428 *2C678DFC9471A7965734BADD58E578C81BC504C7 190164 ` tepki gormeyecek ' adaylara agirlik verildi .
438,356,429 *2C60DE342DAA45F56D1A648C1F978B8E93653F8C SKAVANTZAS
438,356,430 *2C637AA21E6F361A8004E7B40AAC66CA4DCACA77 rick.deckard
438,356,431 *2C60EB4232EC8322EED5D1082CC13CC890826AF3 RICKYPEDERSEN
438,356,432 *2C66E926A7FB045CDA0DF329A86D4675739350A6 rithcard4
438,356,433 *2C69B645126D17E154C8F17169DA5BE1B0A34A6D SMADMADE
438,356,434 *2C6297E6D609251E8917DCFA86A573141D5D3E84 smashinglarson
438,356,435 *2C6C89F45C064A81155D1FFE304F74A9DDF12013 ROBSAMMONS
438,356,436 *2C681AF4716C1119FC975F1E44D30D122BF5CC46 1-energiaseminaarin
438,356,437 *2C660335AB6BA8A760AFC954AA261B160F67079F SOCCERRHONDA8
438,356,438 *2C61D845E6B53ADE000B3A678F787AE44F1AB1C5 rockyblackard
438,356,439 *2C6819DA6A6C6E0A9C44788ADE3951C6441BE936 ROCKY.BLACKARD
438,356,440 *2C622D04D990DBA2E1ADB615DA5558CA71108A85 1-erstmannschafts-auftritts
438,356,441 *2C68CAD8B3B0254ED7B632A1A2735FD465ACE0B7 software.astron
438,356,442 *2C6C3E628C223054C1B4DF0E4E09F94333274D3A 1-gebietsregion
438,356,443 *2C63D5E524765472C2038D329BC4DEC6E76D1317 ROGELIOSTIERS
438,356,444 *2C6D721AA9F4C1CDD0C0685DD3143BB3F0FE7427 solpucci
438,356,445 *2C6B3D616E7A2DD7389B6F4E44D51711ABA3D601 [email protected]
438,356,446 *2C6E3799F0CD26DAF70949DF7E3DED610B031506 Sonata-in-B-flat-Major,-K.-281-I.-Allegro
438,356,447 *2C6F430CA40E7C08C64D029B4168771A0B4F0E8C 1hein
438,356,448 *2C650C6AE9F39FA75ED5CC20B87F4A0B393203F7 ROLANDSHIKE
438,356,449 *2C6AFF67A183FC1C3DE25212DD0B64DD9FB49FF4 1HLEPPTET
438,356,450 *2C6DC67EF273334E868570A97B46E9A386774420 1.HUTNER
438,356,451 *2C61AF01DBDBF41099A13B5846516AB271BC1DB1 sonnymisumi
438,356,452 *2C651D40D736A52F4A8A1DF790756CD3A059A370 ROOSEVELTTRAEGER
438,356,453 *2C6138CA1937EB175EA89074FF59B0BF393DF775 1-KAITESEEN
438,356,454 *2C61964CC7B2D6F4CDA1022B21E79BE469B7B473 1kreide-zeit
438,356,455 *2C692D55A0482F9B707D8E93E16F2680FB10AF17 1.KROENUNGSPARTEITAGS
438,356,456 *2C68A893D713A0DF0A45376677AC614840DD6110 1-kulissimaalari
438,356,457 *2C63068ABBE88062023DD2E6CC3719190A02E8DB routeantony
438,356,458 *2C61779400EA1A27DE555D7F6F30EA919D15F46E RPALALLOS
438,356,459 *2C6392C51E6E275B1061F3DF19AB94BA3C59E53D RQAOKDIBEOMLY3
438,356,460 *2C64C3AE7B14ACE3058979B1B6EC6B084FACB026 1-mantelpaviane
438,356,461 *2C603CA3AF59CC9D31FB4D6E88C16FCE587C1FB2 rtioliuc
438,356,462 *2C6344E1D989F70A6141226F464004EBEDFACE48 rubinlosa
438,356,463 *2C6490CD65789C1000C0B1DEC1E976FC574C310B RUBINPRINDALL
438,356,464 *2C631CB3B4DF3A52E51A8E9E2744F04F05501D79 RUDOLFELIA
438,356,465 *2C606E60D88990518BDEE5B67B0C7E5C54C10E26 1 NUKKETEATTERINUKEISTA
438,356,466 *2C66282EC57EA7ED1C7CEF60AE137E28A18C436D [email protected]
438,356,467 *2C67D8386CE1A9F77BEE0CBC6D197032B591B2BB SPNDINGSFEJLENS
438,356,468 *2C64F5E515E9F5F87FA21452F3B77E31602DA87C 1parjuriez
438,356,469 *2C66C8CEB6D489B79805AD58BC24A4E9E1FE1CE6 1PIENOISKEITTI
438,356,470 *2C6ABF949AAFBA5082FF2FBA4F60F5D712F12649 RVLRSRDN
438,356,471 *2C61727D214C61A0595E47FC07A40C25D5F2CDDB RYCHTLY0
438,356,472 *2C6B2588E270CBC99D0D685D481E2E77545D79CC 1.risikoabdeckung
438,356,473 *2C61531C16DD9CCB8E7E2AFB38366C36829B15FA SABA7COM
438,356,474 *2C62BD10928ED376EC4D3C23D41E6A6B531AF4FA 1.tcuzinen
438,356,475 *2C6C107328EBCA17C26C9C26E0130D8EA6EE4E2D 1TELEKOMSTEUERN
438,356,476 *2C6CEB6FF6CEE07E683578FE2AAE2F6AB48D2DF2 1THEBIGDOG9
438,356,477 *2C6158246EF53FAF13142E45BD29AC714164EE04 SAIKOUKO0
438,356,478 *2C614CEFEB417F86BBB4FEACEDA6207851D3B494 STACY.KEALOHA
438,356,479 *2C60BB816DD5A6A9A04BCDBD861D9675727D97F7 STAGGBASS
438,356,480 *2C6C2FF8F13F14E7457F61FDA41E882095337C37 1.vaali-toimikunnalle
438,356,481 *2C67977F0141323A2BE2B81B647E8E0F2514C08B 1-VALTAVANHEMPASI
438,356,482 *2C6ADBA0AFC368E0D1198C67B5D6AEF5D9F4878A SALIVARES6
438,356,483 *2C6EF080E96A82994DF387D15A11947F5163C0BB 1 WALLPANELING
438,356,484 *2C65D30F2FD5250433B1349211AF233D3538C843 1.YOLLAYABILDIGI
438,356,485 *2C6D160525ABB41D586ED53C585AFF422068907F 1 ZWINGLI
438,356,486 *2C6AA8D3D2BC3645CD013BED8154316A5D30F7DD SAMMIEGIESELMAN
438,356,487 *2C66A8D2255999CCE6DF0A86A951487D724F8240 2006年4月5日、HERO
438,356,488 *2C63015D9953D55F488A2D67D6A4262FEE514499 sanatoriji
438,356,489 *2C61D3158F5F00EEF672DEAF826CD1F188437D66 stephanie.griesemer
438,356,490 *2C678886EDAB2ABB8FFEE874F6AD3060EF0DFBF4 STEPHAN.NAYLOR
438,356,491 *2C6EE2CF84AB9FDA7180B99E4DF73167A0088D18 SANJAYA KARUNARATHNE
438,356,492 *2C61A488E2251740BE37CC0C547761953FB32CC3 STERZAI9
438,356,493 *2C61A4FC02112412B3F048E3DA98A11B428E95A8 STEVEVITIELLO
438,356,494 *2C6EB814BC7B7AEA58A2AB8B4C2FFB7D075863E5 STMCHCHS7
438,356,495 *2C6FC8130DAA07161D0C1E5F11BB962698CC74FC SBALLATA8
438,356,496 *2C67227C82B7F03887D0E59B39FFCE2A5ACFAEBE sts3515
438,356,497 *2C6FA93EECD1A070A02F87EA953947D773435F4E 2297787 diesesverstrichjedoch,ohnedassetwasgeschah.
438,356,498 *2C621758A3FD77A00B51E135F368F3C5FB3A73B5 [email protected]
438,356,499 *2C64EEFC226C12999F9948834BCF1D31265B6D97 24101773
438,356,500 *2C697FBAAAC268808EBB7255D856732843F94D30 schutspatroon
438,356,501 *2C6022FC55DAB213463ADBF73B74FCC5A5C626B0 2635909 henkil
438,356,502 *2C64873A06F7A7DE2D94D1355F98DFCCF63D01DC SCOTTY.GOVAN
438,356,503 *2C621C12A0559D861C09E84A1A43972BF1A8D4B3 s"d3
438,356,504 *2C6979B15D77DD26D29C387575025449FAF81AB8 2933400 jos siin
438,356,505 *2C6D90A03AD12D3BC809857DBBEE346606F8DFAE SEBOHPOMENA
438,356,506 *2C683D4892BBEA0706469B65B298BBF4036C7EC4 SUOIVATCOO
438,356,507 *2C6D99BC29375928F9BED722E5F700AB2901975C SUPERSONIKWAY
438,356,508 *2C6B5857F2123E1913882BF153AD9410BB34E56F SEITIOGE
438,356,509 *2C6DB35DBD09D7D4C9E726642705A0B771088E60 SWEETPUSSI2
438,356,510 *2C6B059D49CBAC9C56AF37B0797972A35A7B060C 2HEGEMONIAN
438,356,511 *2C65F22C6DBB95CBF801E1894D2AA71F411B135E 2INSRERA
438,356,512 *2C622C142B8F9B3592526927B34E287384927964 SEMIGEL4T
438,356,513 *2C6ABE4B3C416C235601B8E9030673398C7490D5 šentruperta
438,356,514 *2C6A46CE22EC7511936D21305A1615457E6A92A4 TALKLPETELLE
438,356,515 *2C66F839B2D57AB24199F467DA27BD293DAD60A1 2-URJALANKYL
438,356,516 *2C603537A992B09C09E41A689806C4DA5990C268 TAMIAYALA
438,356,517 *2C6F81F4882708EFDF7414BF5842FBC4B23A502E TARHZOUTI
438,356,518 *2C69307FEC458DDEDC9DAF61218A15FE97B065A6 3A3AA2E52B53A7C7746346F74888A222
438,356,519 *2C621C0AEF79D3C8B83B0B9F8933F086C3A14E9A 3-AMPUTOITU
438,356,520 *2C61F118BA595CCA51DED1C06093A2D271915583 3#B`~ `~ (><)
438,356,521 *2C6B803AF425E8C7468EB7810D3A97A140792987 3--B.*.*splat!!
438,356,522 *2C65DA6FE88049290E2A48B4F74BAC815D26AA8C 3##D-~-`-splat!!
438,356,523 *2C66BAFFB6CB0480B7E66EE03C7F31624EFA9378 TDBQTZDZN
438,356,524 *2C6B89DD52C40639CDDCE076ECF063A8DAD86879 SHANNEN-LEE
438,356,525 *2C697CC4CA1539916A91DBAE7453104216CE7E45 SHANTIUTOPIA
438,356,526 *2C6E359750A6E25856443955AF03A9AA24754643 3-JUUSELA
438,356,527 *2C6D094F6B57C6A9EDC2D44E9C8E9A488C4441FF 3.oekokurs
438,356,528 *2C64460C91D7A27B50192092B0B4BBF5917635A0 sheltonterr
438,356,529 *2C63369318653E0D231D227AF2487149D9073C0E [email protected]
438,356,530 *2C69A243ECB1CC6CDADD4C67DC39479EB7E4021B SHINTA.RAHMAN
438,356,531 *2C66E3E83C9E9FBE6212D5021F194543FA81F150 3.zeitungshaeusern
438,356,532 *2C62F4B5C4C3030EF20771D31CD21F9C05974E66 TERRENCECOONES
438,356,533 *2C6A3BF19A583C2D3EDDB0C872C63FFD27517A41 SHORTHAND3D
438,356,534 *2C63EA3532CC5DA72511C670D462FCC8E924C071 THAT.GREGALTON
438,356,535 *2C612F65DA8849601A083C34FAEE41ADEFC49630 THATILOVEYOU12010
438,356,536 *2C6AFF2FD9E483B6FC6815BB479CC7EAAE5673A5 THCULFLE3
438,356,537 *2C65F5423BFCACC3A74426B361512B909AC4144C 4EHWINKEL
438,356,538 *2C67E8A7822543E9B880BFD506688234E33D17AB THEDUCK1961
438,356,539 *2C68A6E35B33C76BD0CDA5E96C59E18BB55B44F8 SINUSFUNKTIONERNING
438,356,540 *2C622F46840640918301935DDCE0C25DC2D556FC The Nutcracker No12 Divertissement 4
438,356,541 *2C611CAAE660C2751BCFFCAAD9FBA10DC1D1ED3C SITITAMR
438,356,542 *2C61193B95B1BCBD8AA8F4D48ACD4FF225595EB9 sixx.mixx.082..05-04-08:.dj.zebra.guest.mixx
438,356,543 *2C64924725E4BB24CE50AB0D6C39AD0F07067915 4MARIACHI
438,356,544 *2C6FEBE3E508CC4EA143A032D21495002CBCD698 SKITALO0
438,356,545 *2C6D6909795E4F5F701D1091408147EFCE0CF46D 4PERHYDROL
438,356,546 *2C60578E9E4C321DFD12DDA49F286F73FDAF976D SMITHSSHELLEY7
438,356,547 *2C6E9BC3054EAF9950C5E74F7E5B22AC23B9B44A 4retsina
438,356,548 *2C6B97F2E0EE4599CA52E6C16FFB599CC04FC8ED TISCPACLEV6
438,356,549 *2C6306C7C48E4F405BE5D8B4F9B32E2ACB814E12 4THEMANUEL9
438,356,550 *2C6F9EC7C5EA089780C1B145D0FBE627B838AD24 tlfnrrt9
438,356,551 *2C6900FD5C8D0D40C78892DCDEF9F48A5DE909AA TNEIASILANACS
438,356,552 *2C68912AAC606BAC5DC697017274310AEFE5AB6F TNEMNIARTSID7
438,356,553 *2C6EB025CEA2994E3FCEB0908526F92468693C0D TNEMTSALED
438,356,554 *2C62F55B1331B3B60DD37B190BE5DE2C4D010BBB 5-01-1089
438,356,555 *2C6622177036A2589028AC2275C6EEAA9D9C30DC [email protected]
438,356,556 *2C6FB8B66736822F005C5F0F41A99D335B09CAD5 53ec1bc1
438,356,557 *2C68FE3F5929F7F11066B175D7391E5779BAE0B0 TODD LANCON
438,356,558 *2C6C02265ED48C0988FE1A8897F807544F83DA7B SONGO BRIGGS
438,356,559 *2C63760BBA0EA8141C8A57DF4072CE4F943AC5A1 551002 NEREDEN-OLURSANIZ-OLUN-TURK-MILLETI-BIR-MILLETTIR-.
438,356,560 *2C60EDC9C9E3E08BF16166F3A06E0A76B5B0505C 5:5-#-&grosbeak
438,356,561 *2C6B3047A91F8A9130A28A603C417A7D277271A9 TOMASGECKLES
438,356,562 *2C61F19002FD7FC47C8B9F37FE53ABF7038A2B46 TOMAS.RIOJAS
438,356,563 *2C6A0B2E27768AED6E267CEFC6B1EB3ED93FD1CF SORENARINI
438,356,564 *2C6A629302E30B27CC7D46C51DB6EF7DE2B534D9 TOMTAILOR9
438,356,565 *2C62266C7F04D44FA44D420F8D2E39CB20DCA1C7 5bottoms
438,356,566 *2C6DDA0E4185A654716AE24C99928582367D00D7 spherically5
438,356,567 *2C650D76A03C803AE1442B277856C6EA98561A86 Tr33f33d
438,356,568 *2C6D8B4DFAD2D47C5C64F9B422566A6EAF60264B SplatO~-(----3
438,356,569 *2C614711F22C2F60B1D4BA371E84CC18F6735504 5KOULULAISVAIHTOA
438,356,570 *2C6DF926056E8C22BA1A1AA1B689C245216B307A 5LAUWANNA
438,356,571 *2C6B8AD0A241815676AEFBCE522A82A3EAE259A5 spttdbkd
438,356,572 *2C6CB7726DFDE7CF008C28FA6D0987C0318C4989 SR614RIPE
438,356,573 *2C682292FEE82BD0DB94C33A452FE0B7F127D32A 5NUNNIFIES
438,356,574 *2C6A85D9DB7DA1D1963C153DEA960F4E1BC973D8 trioecs6
438,356,575 *2C686E3B803C7EC1338D62D6D4AFAAA941B0220D st34m3rr
438,356,576 *2C6154C5B708CB2B5051A891CD02C01AD0EAA577 TRISTEN919
438,356,577 *2C69F4BB8BDDDF7AFA675ED7FAFD147A72FDC5C2 troedsmöllan
438,356,578 *2C69D513EC88FB420512A5515E6E94B378A2E8B6 TRUFAA
438,356,579 *2C6407464B341F80B482F9E33F0D1631492A2D86 TSHNNMS99
438,356,580 *2C6F2B6596329F4BB845A57287B3E68D3BF25BB6 TTEIBSW5
438,356,581 *2C6D226A1B5926FF1BF27723F5ABA0E3A99F2E4B TUKDG
438,356,582 *2C677EADD1C0B69FCD1C1780078E1D7A98143922 TUNDEERTL
438,356,583 *2C651D27A441E133D8D52DC05175F82FADC7E30E 6chelingo
438,356,584 *2C6958817B5D13C11C75394631714CA3C22944D7 STUDIES、研究所、WILLIAM
438,356,585 *2C67127C33A12350F85566ACEDCF748D0576ACC0 6GONEHOUSTON
438,356,586 *2C602E28CAEC50381480EBF3CEED2115238E4607 tyrellshivel
438,356,587 *2C6CC69210117230B6FCD5E444696DB8C464DCBE 6HARNIST
438,356,588 *2C6F7257977130A6372CD0CE8039593088AE61BD SUBGRUPĘ
438,356,589 *2C698232CA0EC29F82505F140772A91FBDFFD1C5 SUBORDINEERT1
438,356,590 *2C666B8758D282D2C9C46FEEACAE968A90251653 sue-pease
438,356,591 *2C6DC574684E23E721D8B2CF18E04A62B6179DE3 SUHBATDA
438,356,592 *2C6C5C278B4C86EAD260A114397B9EC1B5A59412 6KWTSBRDR
438,356,593 *2C631EE67BD298FCE1751A31611E4E3EAA54AB65 SULINDY3
438,356,594 *2C68E9D618EC56AAD855E44E9D0359A8F8504D3F Summer-in-the-Street
438,356,595 *2C674482CD3DA2102B2E96ED28D27C5D6586A200 SUNG.STIGGERS
438,356,596 *2C6C4728253615272E2CF3F73887F60DB6274CF9 6MECONIA
438,356,597 *2C658F4DE448AAABB28A565B89797C8A6CF2BB6E SUPERTAEHTENSAE0
438,356,598 *2C61BD1EE14285F562CBF79911D8439BD70C71BC 6MYMECH4
438,356,599 *2C67C54AAA61513EABB76B96C95C08C2E7262091 $ugar1ov
438,356,600 *2C64CD78687328DEB9203F14EC4574680FA5894E UGOHONZY9
438,356,601 *2C6C80A36DD54DC1CB0E67C98E95D5407AFAABED 6PQBDCTTN
438,356,602 *2C6303D092B7869CA8858DBAF350ECA482F03125 SWAMPDAD5
438,356,603 *2C6CDB02C573F41CC64EDB8124EE20AD0364701E 6STEENSCHAPENS
438,356,604 *2C6CC2E6B888B853869D52F9A6BC516F89AFBB97 unbochted
438,356,605 *2C67B49F3C123471EE72CF97434816A09C59F578 SYNC711!
438,356,606 *2C6945BC50F6EB6CCF0E29D2F2CE88DFE4ACBF99 6TSIREBME
438,356,607 *2C603C1DB4A90C3B84B34A75D1BDAD25DCA3E41A SYNUSIAST0
438,356,608 *2C696FB2AE063018A91B5A93773F5AB36BD63433 TABELLIN4
438,356,609 *2C67D7F7BDA0617240697AD51A5DE0D88A82246D Uninvestigative
438,356,610 *2C60C4A87E37E6E0709095E7FF63CD500916304A taking.stock
438,356,611 *2C6B801751996D785DA66D8A476EAB0DBC3055FD 7ANGELAWINDSURF
438,356,612 *2C678B397DB5C42AB6C5344B6CC6EBCE0D70F92A TALKFRANKGRIMES
438,356,613 *2C6738E0170C7DBDF062464DF42DD41D7249E157 UNVERANOENNUEVAYORK
438,356,614 *2C65FBF84C0F66C1F5E04FE11802B685ACC29EA9 TALPAGAM4
438,356,615 *2C612C78E878D0B019C1CBF46C5BAA26DD00F0F0 [email protected]
438,356,616 *2C637B926FD797ACCDB2B01EFB54FCF48F8879D6 7DEPECHEBRIDGE
438,356,617 *2C6DA2CDE75F3904A02EB3CBFA95049C8B0B177D 7DUSTCLOTHSES
438,356,618 *2C6B6B01EF91EC03DE26529A2B7042313951B110 USUELE?
438,356,619 *2C6F350B408D92C8FF0B4FC4DA2DBBB5BD1448DE V3Z6
438,356,620 *2C6FBB2D1F22560D93C642AD404D8D2404981423 7OUILISEV
438,356,621 *2C6E29BF15DE56C0ED6B9E6C7EE21DAEE670468F 7PARAREK
438,356,622 *2C685C42BB8C2D36D154F20EEDEE82368F758FE5 terencechesbrough
438,356,623 *2C64E060253AED8B4D2FC558323A10D87CD031C7 TERRENCE.RUDESILL
438,356,624 *2C6164CB4ACF7EAFC5D999611B0FC5001E3072AA 7THATESCORT19
438,356,625 *2C6798802A870FC65956A93D5AB9E9358F982E41 804755 ONKO.SIVAKKAA.EN
438,356,626 *2C60C6C1712F09C6D2E00DEF0879CF0C0BAD92BB thaddeusbordas
438,356,627 *2C65E7200CBCF74B8E71EA4C58BE269D6B8D140E THANHLAGANA
438,356,628 *2C635F1E0ED44A288664FD12C899A55B9DD5375B thatmariposa82
438,356,629 *2C607FC24DC703F04ADAFC37DBBE235896042A4C 882773 kuntaliitto pit
438,356,630 *2C692E1E70F7091ACF779BAA2B036FEDBF19B467 8:..8..-#..-&...FEISTY
438,356,631 *2C62908F71BF24F3BE262855D92C48FB9B532E51 veronica-martinez-allen
438,356,632 *2C66FF968E5C48941D20DF0558A9F2D640613D8C 8ARA7RCAN
438,356,633 *2C62CACEAF82E45557ED6A712250BFDCE1F1333E thecorralinccomwww
438,356,634 *2C6FA71EFD2FDCE762C3FB3C8FF8A99ED3BE2D0B THEE-HYPNOTICS
438,356,635 *2C61A2664C7027E13B3FFF20DBF4328917F81881 vesel.rexhepi
438,356,636 *2C6283D9CC75387F44E281816BC17240704CC7E8 8BEENING
438,356,637 *2C66172E456D9D64A1B9FC08627BE68B58EDD82E VIC+0RIAN
438,356,638 *2C6A79824C83A087489F8C5A3AE033CA43D18A61 VICKY-THETHI
438,356,639 *2C6395B71A0E1902A0BFC3F7BE7CA1F859FBA684 8####d~`;)
438,356,640 *2C67B9A623D7EE332C4DF926A13E424194DAC193 the.moppin.blues
438,356,641 *2C67A87E2FE6EA79FA2631EF8D0758A19873B2AB victoria.vaca
438,356,642 *2C685BBD64CBD5D6F6BE759CB8BF04405A78D3B8 VICTORIA-VACA
438,356,643 *2C67B5E2C80F78E84681D24752DAB2D16E46B301 victorinomarshal
438,356,644 *2C6BFD7CA62AC7FC2998E5CCAFB6F087F77AEA5D 8FLANKSTEAK
438,356,645 *2C60F46D4B48D2F6DB218EA631742F963D489283 THE.RUSSIAN.TRAWLER/BRIAN'S.DISAPPOINTMENT
438,356,646 *2C6B5E3455A1C50FB954B25DF11D928F77632E03 the snow used to be there
438,356,647 *2C6074124A71A7905AC50D3F30F641F9CA61EFEF THURMANSTEIN
438,356,648 *2C6DDC1B2354F4B71A51D79DF05F23F057AC67B8 [email protected]
438,356,649 *2C61C552DFD87C8EEC3EF1E1FB737672682890B6 8.L
438,356,650 *2C618F6F7517100D0E0284198C9D6D4D2A335091 }8{o~O~q--B
438,356,651 *2C68A72D15D115DB1F0B3FDCD65AAED21D49A1C1 8PATATTY
438,356,652 *2C6E710D2B0B822803DFF708855FEFCD1FE89019 VIVARIUS9
438,356,653 *2C663ABE4B415BEBC2485A0D2813B84556768684 8resultatsoejlerne
438,356,654 *2C6DB8B6DEF831282280AA5FA53B729193ED0444 8SUBOBTUSENESSS
438,356,655 *2C69F356DA4EAEB1315098BA64409BEC91D3430B 8TABITABSW
438,356,656 *2C664CDD12E199E66E63560516A7849BC1A4EC26 TNTJJH84
438,356,657 *2C667169DCB1206163122AABA6CB4FDB51D38C5E 8TERECHTWIJZENS
438,356,658 *2C6B8E72F57278A112E10BB07C80560D53E967AA 8THEMESAH
438,356,659 *2C6AFE0FBA01DD5C159C559A2AF0B5022972BB12 8theturtle5
438,356,660 *2C6BA26DEC69624E5790B2465FE1FBF711A58E75 vraatzucht7
438,356,661 *2C6413119EFD21C4F19875E8A75919F665A0690A [email protected]$I+IE$
438,356,662 *2C69651E849843907AA4C335C9E7107A069F1F0C tonylaunelez
438,356,663 *2C693AD37B215D22E556E13CE2AF5C29D749E407 tonypartida
438,356,664 *2C6CE6248EBDFFE5788ADC60AA83AA283FB7C188 WALEED.EISA
438,356,665 *2C6C7F3D19DDA007F0AFD1566426191B617B44A0 WALKERSHAW
438,356,666 *2C68545B82D217E209070ECD0F3F210633923B39 9CIRCULATIM
438,356,667 *2C639B739805ED4002C76579E917D76E03C1BC73 TRAVELING.IN.TIME
438,356,668 *2C6F1F51768885D6B1CCA7929126D285C2939BE8 wardsteedley
438,356,669 *2C6E3837C4262B19F90100D07202AE1D38DD86A6 TREV HARRINGTON
438,356,670 *2C6EA6F76BABE2E05B57313E105A7E75BCFE4E18 WASSIM-N-NASSAR
438,356,671 *2C6664AB9CC4B22D4D3F42D720749ACB2E44B772 TRINIDADDELLIGATTI
438,356,672 *2C6BD893B8F8A03BC563B86EEEDE8FED4A9B5C9D TRIPLEXPLATEN4
438,356,673 *2C6E84ACA7E05010796FD331C8D4A32E395299FF [email protected]
438,356,674 *2C633595EC24DC20A0B6A8A5BAD747A6C2CDA9F4 waylonhirsbrunner
438,356,675 *2C6B34E6FA601060F033C051157273E5DB0F7970 9IMPLACABILITY
438,356,676 *2C6644B5F21BDE626ED24F2DEC946E01800F6520 TXXX
438,356,677 *2C6687A6F0E87B7F9F3202643F84F098E1E798A7 9RICKYTESTTEST
438,356,678 *2C6104BAC33C235B102046B22091C6F0F871901D 9SEEGATE
438,356,679 *2C67005DCB7FDA6219E132A163E2D2F55BF359D6 9SHERDILLAH
438,356,680 *2C62D058AEF273F02498E3A2FFEDE0AFB3245584 9TARMANDO
438,356,681 *2C60F34125C1E26E060F09D86C71B67528DAD198 9TYHJNTNE
438,356,682 *2C6C12B22AFB46D911B87C95E38FC7C917EE53E6 UBYVAJI6
438,356,683 *2C68B39A77120859F89FDC2697E19B094B8CB526 9YTECINREVO
438,356,684 *2C6C277397D3518FF47EC90576F5080DA3B1E643 ugu2
438,356,685 *2C67245AC39562BB554ED5FF3492CEB13458FE48 A0HFA
438,356,686 *2C6DB8A3833AC682EDBD7A860407EC3AC5355352 [email protected]
438,356,687 *2C6DF043322B5E5AFD29348F775F8A260DD41AAE a5,sn
438,356,688 *2C648B7E4F7A885FDEEB6E08AA64F0ACA1E7FB77 a7xrockerchick
438,356,689 *2C670090EE659872AEEEB928FC16D9324019EFCE UNPROSCRIPTIVE0
438,356,690 *2C6B8276DB21992426565855EEDEEB6E616A6A96 A9MZA
438,356,691 *2C6F348310406EDBA7A0D9CAFB7F76EAB35016F1 WILLIANKELSOE
438,356,692 *2C68D37DA647C8CAA4107B62239AFA3C42E709DE WILLOWIRRYLYN
438,356,693 *2C6610F3B5B4F921703AF3664388FF2BB804BEA2 UR8AN0109!$7$
438,356,694 *2C64DD5C7C8C2FCB6CE7DE078E30F613E49271F1 WISEGUY_83
438,356,695 *2C65C985A7A565D76E4114A92BB0129287F7E2C5 uuo~0~q--q
438,356,696 *2C61A3048A53A6885B1906C2A04C2E56BAEBD053 AAEZ];
438,356,697 *2C6720C6DFE1ED400806192CACA92D7660B13CD2 aak/=
438,356,698 *2C6DD54128A00684FA3750C051D60FCD7CB1BBC8 aatarihbaysapat
438,356,699 *2C66A175D9E04095CB8381764EEE69FA1C52C954 VANBELLEGHEMED
438,356,700 *2C662E7AAAAEDA41ED3CE57CF581127E0DF62459 vanessancc1701e
438,356,701 *2C6E2A8C4451954E0986C3386DA6D0F99ED94346 vannessaleaf
438,356,702 *2C6238A1772685B2924CFB24006AFCBD35CEF8CF AB?KG
438,356,703 *2C6071BA440829548895FE6739516E307BDCC2EC VENKATESH ARCOT
438,356,704 *2C60A448C5DE1A4964D5543B0B948A731681F8A5 ABRAHAMCOOPERIDER
438,356,705 *2C6ACFFF58AF9D57474C2FD67E8BDDA212DC84AE abtastreihe
438,356,706 *2C6C35F6888327946CF3EE6F1EFFF22344CA946C AD0-Z
438,356,707 *2C60A3089BB9915F4CC3B3642B947801AC1770C3 WWWSCHMITTINDCOM
438,356,708 *2C6D3C3B6D3603C4D6AFD2507A83293934B998FB wwwsvno
438,356,709 *2C6BBA716FDDDA038FEC348013A2D09A278A1D31 ad[cr
438,356,710 *2C6EB3A2B6058A5E5621268CC668F7FBF0CD272F [email protected]
438,356,711 *2C688C31246720644D909957FE2CB202AB8A9481 vickimessmerjorgens
438,356,712 *2C65DE169922EBFD72FED31C92C0BE77B3AC94D6 VICTORIASTAUTZENBERGER
438,356,713 *2C6D67CE522E3820CBADF1BD354B38E9A6DC06A5 AD$i
438,356,714 *2C62AA221E1F548DB35982158DE382066462F3BC VINAYAK BARWANI
438,356,715 *2C606FB26232E2C96D95C4771F1B0361F7974720 VINCENT.DALBEY
438,356,716 *2C6CDC94BC479AE1F67DF3A9B61DF13DED3ADC42 aemus
438,356,717 *2C6148CC1E2FE9780C648C8BE797B57DFB6CA3D3 VITO ORSO BASILE
438,356,718 *2C6837B548BC24CE0A43F8E655CF599B554C4AB0 [email protected]
438,356,719 *2C6B81C85934D102CFF80C30C9346D3852C56720 vlnt`rnt
438,356,720 *2C68822421B4D2FBE9D69D0360D7E931451A204F [email protected]
438,356,721 *2C6868AB80EBAB4B472257372D2C7D3464609441 VOLLEYBBRUTUS5
438,356,722 *2C6E3442E8EF066912E80707EE6BC54CAB66EFBE VOLVOSAMUELED
438,356,723 *2C6730F93BD670DD3A975BB3F7CE11F2A11C2F8D YANTIEASMIDAR
438,356,724 *2C60D363049DC0AEE502C4FB7FE4D715E3881CEA ahr-)
438,356,725 *2C6D8C8977865302B740DFA6A7353E54FB5196F9 V}]Y
438,356,726 *2C64198554E0E51CA2DB07FBA77B18FA8E5CF8B2 YATIN.WADILE
438,356,727 *2C692E1B30ED9E5E3F9D4450DF5501027EB5D518 yayoi.marshall
438,356,728 *2C6DAC2FD66944BBA98D478A10D7D0588CFA1A8C YEARSAGE8
438,356,729 *2C6B9E971AF55DC87B976F391C2C8FC557709B7E A:IJF
438,356,730 *2C6963F3499277B6F7F32C250131B4BDB0E31851 waldokronenberg
438,356,731 *2C66ABF6C39A6FD95A7634BAFB9FA68CF9A96783 yelsdaws
438,356,732 *2C6D3AD140D9C8ADEF5647AF853E1BA29C5DE292 walkerlopiccalo
438,356,733 *2C647EDC299AA332AE856F0C1735F30B5AC3179F WALLY.ABNEY
438,356,734 *2C6595DF417EE5C3B27BB95C022A7423CB50E0A8 Yes-to-Satan-(bonus-Techno-mix)
438,356,735 *2C65F51B89E9452DDF4F9BB54C2C57B5E491FEB0 [email protected]
438,356,736 *2C6229D6A314F72B98B2916E0BF31FD85111B5BB Air-Suite Nr 3 in D-Dur
438,356,737 *2C63763501271DD21227C849C5DD57292B105263 [email protected]
438,356,738 *2C6254D52C82099F697EC873FC434A690B3F8C27 [email protected]
438,356,739 *2C67BF85E26EC74CDA6E911E23D972D3A05F5E93 akap12
438,356,740 *2C6A29E5F928DC8848B3B62372979B4AEAB705CC WELDON.MCHATTIE
438,356,741 *2C622CFC9FB838B2FE6263D385B437C7B4AB31FF [email protected]
438,356,742 *2C6B39FCF6DEEB17FEC5A54422757221E9807B7D WERNER.RUGGERIO
438,356,743 *2C612A2606E484954252B50C4D59131EED846BD7 wesexon
438,356,744 *2C690117BC00180269FE558D711671518FA956C4 [email protected]
438,356,745 *2C67134E67F596D8A5FB7A71BF5E88B8E28FB5E7 whedonuncut
438,356,746 *2C66CE2B0BD74EF165B63790C9BDA33B757691B9 widkittl
438,356,747 *2C6A6FA910BED788ABFFADF6F8D8B7C0D3B25069 WILLARD.BRANIN
438,356,748 *2C673931926AD90F9DD5FEA6789E2FC5D291F23D YOUTHPARLIAMENT-ARUBA
438,356,749 *2C6BC9582800B77863126EE123961BB682C87659 [email protected]
438,356,750 *2C63574BEC5863471760C21B8705B64BDB89030F ALEXANDER.BOUCAUD
438,356,751 *2C622F66F2DCEC74BF44E4B56395EA6C46B9342A [email protected]
438,356,752 *2C6505FA833FB7B88EBC11D87AC7511E3C774D3C alextiamzon
438,356,753 *2C6421A6DA5DAEF48413176BEF912F39D859D6C7 YULIAIRMAN
438,356,754 *2C65FE31BBECF57CCB7FA3347F2AE6F1C7A3BDFB ALPHONSO.WAHLENMAIER
438,356,755 *2C6C729F3245B84ECE68F9CA3AA17F69BD1B2C31 ZACHARY.SEABERRY
438,356,756 *2C6B488C23CF16D6234AB40BE6EC3A935FDF5F67 zacharysimunek
438,356,757 *2C63798A82FAC1F1904D12D662B91A96275E63C4 ZACHERYDILL
438,356,758 *2C67DF8D926EE098C7CB5950A76D93BCD1722D34 ZACKDORNELLAS
438,356,759 *2C6DBC7E31722AB2F1662338B1F3083EDE6FCE68 ZACK-EIGHTEENROCK
438,356,760 *2C6F6022E48F66D2ABAB61AC5CB813E0F8771AE4 ZACK.WILLET
438,356,761 *2C61687D2674DDFA898591C0BD47BDB1370BFAAC zaila.sidek
438,356,762 *2C6B3DD8C006F3E86335A1E119E8D443FEB7D62B ZAMANROCKON
438,356,763 *2C6A109BC247BF9F75FD5605513DB03328309DB0 AMADOAUSTGEN
438,356,764 *2C65D4CAE7047CB5C94BDD96473948BDE166FF6E [email protected]
438,356,765 *2C6D55685CAFFDFE872D354CE57E47A3D2D8C896 amb3n+s
438,356,766 *2C637C1C178B3E4046BDC335FAAAC87A78D27205 WWW.BEIJINGOLYMPICSFAN.COM
438,356,767 *2C6286252ADEDE59759547161F4472596655E206 amictorium
438,356,768 *2C6BED6448188287E0F9907D6EBB111866ABAF1D zchrissy
438,356,769 *2C60F592294E9C75597BB50141BAAF99027061A1 ZD>{
438,356,770 *2C634DAD1A0E0B77850EFC33903B2A3E4B96E80F ZDRAVOG.1
438,356,771 *2C652564B71B0309981E6781F45706D4DFAA750E ZGRQCCKJKCJ6
438,356,772 *2C66C1BB27E9E6B24FFA25DF14E8B6B845B9A384 Amningsm
438,356,773 *2C6472AA17BAD699B490B3198FEF85EBD0B11697 xartoshmoy
438,356,774 *2C638245C46963C60DF56AD6D58E0E917FADDCFE XDOEFCL36
438,356,775 *2C68AA6B6C68B72C5E62393ADAE816E05F7AD5CE ANDREA.VIDOVICH
438,356,776 *2C6E405D54B751CE3D2A80A1A7E8CEE8F26B7B58 XはOSIが認めたものの、FSFやDEBIANは認めなかった。
438,356,777 *2C6EDC6378F41C8F03E8D01B963B2B1F5CCEDCE5 [email protected]
438,356,778 *2C6DCFB62C3C1608F2F92F0301D3EAC6B94FD0BD zzzzenith
438,356,779 *2C63E29CE09AE1DCA8F07E23721FA520D8004F74 xurunniu
438,356,780 *2C63B3F1EB4F90E1F5DE21C28B693AEE09954A3C anj_
438,356,781 *2C659C8AE54CC9F5C86BBF5F4D417466AE84E2EF yA6
438,356,782 *2C6E320FB6BB7701E18E93FDBC194AFC5F514BA6 АУТОТРАНСПЛАНТАТЫ
438,356,783 *2C60525BBF3E0D85BADF85CF17576C2CD7578534 „АЮШКА“»
438,356,784 *2C65BD0C98511B35B313144D910C64685D4C01FF antimilitary6
438,356,785 *2C6A54199073E5E753B0C9A5EB33ED1D0B918CF4 дpyжний
438,356,786 *2C6C0BA760C3463D957632D1D6839FED69D7ACE8 antoneskemp
438,356,787 *2C614C94FDF414321465181FF65B990CD6965AA7 ДЕХЕРМЕТИЗИРАЛО
438,356,788 *2C67647F0DB04FB380767A410D79017B96274185 ЕВМЕНИ́ДАМИ
438,356,789 *2C677F013AF7569AE1DF03A95154DA050BD4D478 ANTONIO.SPRAGLEY
438,356,790 *2C6FF9A97229DED8BB655093CE2AA70FD880516F antwanbolinder
438,356,791 *2C6C97748F8873CF238ED74F7957966590127B25 інжынэр
438,356,792 *2C69A3532B25E0180FDFCB11C2DC4918E0E076C8 aoe#
438,356,793 *2C64197D2FBDA3063ADF435EFF184337EC79535B yogya­karta
438,356,794 *2C698A4E33944A47215A641A231F9DA18EB2F2BA ПРО́КЛЯТЫХ
438,356,795 *2C6632C35DB2FBFE15CC0C8BAC34539A964718B2 ПРЯСЛОПА
438,356,796 *2C6E4FA19E81742B7D26EA7EBCF235AF35DC7D57 youngcuny
438,356,797 *2C63150486446E704F5B44524CD4BF084F89A89E сандомир
438,356,798 *2C6D2329896D91EFD3B20023A7ADA42D697A3B29 archae0l0g!$7
438,356,799 *2C6FBF8ABA7D247394F360EB6B8A052C62778F0B YUGEDUR1
438,356,800 *2C63E5B83D4208C31634FB20C9C04DF8701277B3 ZACHPROCAK
438,356,801 *2C641FC96B5477E4E5444AD0331949EC368CCFB4 zaneskillern
438,356,802 *2C6B724FD0541A7C7C5A37F0623ECED0B9F99005 ЭКОНОМИЧНЫ —
438,356,803 *2C681861FD7DE00BCDEFAF84FEAF2AF95E9EEC91 Z=.B
438,356,804 *2C6BA403378760EE09A6C728CE1A6E04590F4C5E armanian9
438,356,805 *2C6E1BEB584C55E55CB06A12DFF4CE1F2A9465DB zen-mediation
438,356,806 *2C60A9051DF809717725543FFF63C3EAECC3113B [email protected]
438,356,807 *2C631B16E963101D2674C909DA24A9E6D1A73384 zhongbao3
438,356,808 *2C658530D41C84D02B2E6C7845AB83F892982F89 ŽIEMGALINĖJIMAI
438,356,809 *2C6F90D2FE883F19FCC6E127C8AAF7BE80CB182A ZIVA
438,356,810 *2C62BFBCF67628E4AFC6F3F8C2E418636AEDDCA1 ZOLTANLORAND1
438,356,811 *2C6081483067201A0D34730F13D8133420468520 ZOMBIES ARE SCUMBAGS
438,356,812 *2C618C5AE8281BE4BF92A37BB13890DC889612E6 ZYC0805
438,356,813 *2C60AAB7530ADDD048A1B22C57099EFC10D3C61F ΜΠΙΦΈ
438,356,814 *2C687277958E233A5C153E6F986DB4C4C081F213 БИПЕРСОНАЛЬНОЕ
438,356,815 *2C6E8F0211FFFB1340657A7C06111EF6886A3B0F данцыгі
438,356,816 *2C619E2685B54238CD3BCCB29EF9948ADD700186 ИСЕЉАВАЈУ
438,356,817 *2C6F2B8E8E24E892A97F89E170CFB101A7EF3C56 кифияк —
438,356,818 *2C6B35A9E359ECEA5CA914160A316E780F5C2760 ASNERGVA
438,356,819 *2C6CB7F159107EDFF100E65B808DF017BBAF34E4 [email protected]
438,356,820 *2C65112338F0822AA4F2E3D775530FC3897D9527 ATIOREPP
438,356,821 *2C65A2D64C2118878629CB541A434D7CA1664AD4 atlant!c
438,356,822 *2C6426F7F42C079CFC2836E81A4611841D3119EC さそり座Υ星
438,356,823 *2C66C03C5F918654728AAD7671636D4A8F53C566 «ЭЛКО»
438,356,824 *2C60D73E0A710A1D7BD06EC68290D891A15B2226 a_v"7
438,356,825 *2C6CEB414FB7DEA218A6CDFBC04D52A857CA0270 AVC6
438,356,826 *2C68A67E76F2DC3CE61B681217159EAE7EB8AE06 A-VMB
438,356,827 *2C6C705F2D8623A80222C48529598A9F13C5180C を立ててくださいました。DREAM100さんにお礼申し上げます。
438,356,828 *2C6EC547B13C4B82E2503FAE5F226CFEE8378AEA [email protected]
438,356,829 *2C633931C1288FD9EC10CB0640E7E80956539A7D ラテン文字転記:leobotes
438,356,830 *2C6CE8065AD2939E3ACBD76B68BA4418CE635527 bardicvoicelivejournalcom
438,356,831 *2C666422FA7CEFEDCB571EF7E22D3D36A0911067 BARRY.ZULLINGER
438,356,832 *2C602EA32DFEA8F0AA11D56C4EB181B1C80B8B43 [email protected]
438,356,833 *2C6F4A7529F9847DC007E4EFB441C4EF8EEB679C ,還有同屬青二production的
438,356,834 *2C67233221D8ACDF8E15E7729FF67FBE7F515C87 BEAUFORNEY
438,356,835 *2C6C57E4730281C56D91CC65BD47097E34549794 beauvarcoe
438,356,836 *2C65CCB567395CB71549D9826C8D86196A9EDA97 BECKIGOULD
438,356,837 *2C6FE89087548D785AF69F459159198AA165E72C BETOKENS
438,356,838 *2C6E47DCFB171B5A562E45EF4C91838B93C27340 1063309 M
438,356,839 *2C6F1D1FF82D569B2554FD54A34C556BA1A91F16 0THEJAPAN2
438,356,840 *2C61BA9EC06908F7F24005FF408A911B42E9A359 B?)FS
438,356,841 *2C607DFD6B2B5C968A7C5BE81B1346CCFFDC5CE9 11saaa
438,356,842 *2C6B14A009A27E0825870359809CF2A928D733C1 120.PITCHER'S
438,356,843 *2C6E991E207AF59D6EEE2752868B4173FFB5EC42 1225196 otan yhteyden nairobin toimistoon hf-radiolla
438,356,844 *2C6EF877AEF017EED35D9A39590BBF9C88E9BC2E 1225256 oikealla.istumassa.kuorojen.johtaja.bj
438,356,845 *2C6D5153C3C39C04CB4AC770CA5FD065F0BF77A5 big-up-baby
438,356,846 *2C6BC57F3396DDCE77C163A4EAE284AB2D6986C5 bilious
438,356,847 *2C6DBAF340CC9C7544213B1425DBDF0754F6EA25 1392547 kurssi3:ihmisenhyv
438,356,848 *2C641970DA93EC2149ED71697499C9FCF759A542 bitpmexe
438,356,849 *2C63476F3526916B800F423D16B830869EA5999D 1337LOSER
438,356,850 *2C6E4AB0E69E5A997F99C9770BE2F216A00D73F5 17AUG1806
438,356,851 *2C6638BF102FEB9C9477F1CAEAD2D88F4E27C3EE bobwaskey
438,356,852 *2C683E5E82AC8D25E08A8AD6AA2661C9B4E1EACC b(oc
438,356,853 *2C655C076BE78510DE3B43BAC4CEC4F99C1C1D6D b->~o.~osplat!
438,356,854 *2C6DA8EFE625418CE4AFB06D158082492DDE1588 borishansche
438,356,855 *2C636B2981C159159CC5538F622C4076C32AC73C 1532620 ASUIPORINMSK:NV
438,356,856 *2C66B995F5F0DB1CD06878A7D48538BE5D53DAA4 bossjulie3
438,356,857 *2C680E5FAAA596C8787E1657D6A8313C999FC672 161932 ONLY 55.7 MILLION OUNCES WERE MINED .
438,356,858 *2C6182E825BA292EEC167CD046B534DC34EB26DF 1630771 JUHA.AARNISALO.USKOO.SARJAKUVAKAUPAN.TULEVAISUUTEEN..
438,356,859 *2C6F562746944B1A6F97E569C8AAADB8EAA81722 1666334 PATIKKAMATKA-ON-LYHYT-,-MUTTA-KAUNIS-.
438,356,860 *2C691C5D2DFBE305A0A1E89E0CAF6997ABB0DC3E BOXI G
438,356,861 *2C68831ED431764DAE0B007454B65A80FC5DC431 BP6PE
438,356,862 *2C655815A8D28096F51019613AF37969BB75D30D b######p-~-`splat
438,356,863 *2C6E644B48D9944B9750874812FB22367EA934F7 BRAHMANESS
438,356,864 *2C65A0B29A8CC080448877025249F01D9094CF80 bretwanschek
438,356,865 *2C680954D9B98F476F4F94C98703C2A6FE793F9D breuns
438,356,866 *2C605F4FEAB71F99FDBB5EA73DFFDF06C8BD89DB 1hein
438,356,867 *2C66B05E12066838AA410A44F2410BF125B6C4BF 1.HOLZBALKONS
438,356,868 *2C60D2A07C0226CADBD16A63F39813E118925324 1IKNEKSY
438,356,869 *2C6A47A7BEB10B36FF39AD3CB9C3541B3885B040 1KLISEISI
438,356,870 *2C67CFD57CE0FDC1CDECA685D9A81E7F0C36EC58 brookswedgeworth
438,356,871 *2C6212066D14EBB9E2931A4F254ED33EC4415F5A BRUSH-SCY
438,356,872 *2C6E2E54BFF611DED30537540380EA4D2ECACC48 BSEEBERGER
438,356,873 *2C60EDED5EBE1449ACE369E66716416E3D8160F8 1.LIENZOS
438,356,874 *2C62D038B001355BCF7E2E85A020865A2EFF7D86 1 LOAS-KANGASTUPA
438,356,875 *2C67F5D03E7F650C8EEEC7300B8C0AE5DFD3C93C bswsetnurbsprope
438,356,876 *2C63E2E823B34C9468E1B18757665AD415EBA9B1 1-doppelseiten
438,356,877 *2C6687E86E82E9D42BF9E29FB332B8BCB78DADFB 1NLORENZO
438,356,878 *2C6E14AC9065E11C8D03220330E8C732D677C25C B-%TF
438,356,879 *2C6837274D2FB0A9292539D9EF6F326D17BD5D70 1.paketleistungen
438,356,880 *2C6AFE8B5F2C202BBB6618570B07F38C124FE960 1.paljastuukolme
438,356,881 *2C64B178364580113D919CB6E94372325CAF0CE9 1ex-coventry
438,356,882 *2C6EDC58DD140A711211CBECA1751B7AAEFAB210 1-POKALEINNAHME-SEGEN
438,356,883 *2C68DDF620B91392D84AB0CE58353A87D0A56723 1RING-STUECKE
438,356,884 *2C6D55EC8BA14B368D86A9575C3EC76519206235 1ruustinnansa
438,356,885 *2C61F2F4BFCDDF9429633EA1A3C1545E039D3127 1iamavatar6
438,356,886 *2C6F2472C02816B194E6CE4E9CBE453EFA5A6219 1 JUNGSNOBS
438,356,887 *2C628B243D32F99C39F42FD84852F1A42BB45DB9 1themisty0
438,356,888 *2C6F1D29AC8FC86ABF93FCED3F4EB5B56C958FF6 1 TRANSFEREINNAHMEN
438,356,889 *2C6A80C13E00DF712866C20DE2A4876C102E2609 1LAMBERTSNOOT
438,356,890 *2C69DED9BBD16375673B7C543CE116283FBDC18A 1-WIF-VORSITZENDER
438,356,891 *2C6538DC3D4D2DC34D1181CD47A564B1E886D7FB 1melgar1
438,356,892 *2C61E16CD2F4F6E33B6C68926104B539BB3E9A24 2006-01-13:-KOKUSAI-FORUM,-TOKYO,-JAPAN-(DISC-2)
438,356,893 *2C69FDCA1B38EC4C0BC5670D8639BD163C88FD5E 2039561 PREMIERE-WIRD-ABER-WIE-GEPLANT-AM-21-.-MAI-SEIN-.
438,356,894 *2C66B2E3C65CAEF995C433D46575E366E9C781A5 20GERZAT
438,356,895 *2C6FCF6B14E48DC73262DB13C98F1FC863091F24 20SUFFER
438,356,896 *2C6905A9169B8232D3109AA2529AA8520E3EE852 bz,s
438,356,897 *2C6B84FAE31BFE46260BC26B56080779CF5562EF 1Q2W3E4R1430
438,356,898 *2C6579AE8AFD3672BB7F066DDDF18798C09B4E07 24-04-1361
438,356,899 *2C6AA4D2B5BEA7E0A4D7EB2916B9F45BE60BF65E 1.ruuvinkantoja
438,356,900 *2C6F8E644295E0D1DC58DC770CAF8942BE0E214B 1 SEVI
438,356,901 *2C62A7709C58969080DE32F099837D6C1475E482 1SHIGEKA
438,356,902 *2C6667429D2776F8446DFF66934CFE0A677A415D 1.soldinis
438,356,903 *2C641609F518BC9B612B47DA43B8FFEA9B4DC9B2 1-SOVITTELEVAN
438,356,904 *2C6B19DF706233C67694ABD832B53D4AFC0D190B 1st encore
438,356,905 *2C692A5F4F67F6847E1C1DF740B866A13F3384E2 c5t&_
438,356,906 *2C6D17DB922DC68EAF00DA700AF4BFE063336301 28DECEMBER1653
438,356,907 *2C6A1588A65E7D2D393E5C782228C3F3774AEF17 C8MDG
438,356,908 *2C665BDC527258D4560B8329E8DFD003AB2B0C85 2 POSTIMERKKIKERHO
438,356,909 *2C6ED7640A9D9342BCA2C158309001643EB9ABCD 2.TUTTAVIINSA
438,356,910 *2C629D29550C07A9557E683BDF2074A6DE47213C CANIDAVO
438,356,911 *2C63F9F161BABC42781359F8A4F43572EA94D7E1 CANNONDAV5
438,356,912 *2C6E3F84EC543320385736FBCA6F896DB6D1291D 1.ykrauhanturvateht
438,356,913 *2C68067BD5323E2C15AE0AF57051180B7FA92BF2 20PENSIONERS
438,356,914 *2C628B0FF8C3977134572B862B0A496841F685F9 213kimbo213
438,356,915 *2C621B81B0FC1189898428ABEBD0B187EDEF10B8 CAROL.QUILIMACO
438,356,916 *2C69B50D1B19884C3267B14E5ED51ED76D18F83B 2334057 ennen.ensimm
438,356,917 *2C6B75B13669BEB9568E44954C3651E96BFF999B cart09raph!e5
438,356,918 *2C64280DCEB19E4FC6B05C20A957BFDBBB8B0C48 394945 TOIMIMME-MAAILMANLAAJUISESTI-ILMAN-KIELIONGELMIA-.
438,356,919 *2C667FED374F2EEEA56F9225E0F8938B53D19B6B 395318 ERI-EL
438,356,920 *2C6F4F06D29D49F6FAC695CD14E4F689B057B34E 246PABLO
438,356,921 *2C69FBFDD094B7DCA25F746AA191925810341C25 269karla
438,356,922 *2C6437660ED7D1A91D3A7AD6416305B9A386BE74 3 grossserbien
438,356,923 *2C6CDFFB9CF93FCC56216B54B9BA08453D9ABF93 2843133 lupaahakitimotoivonen,muttasuunnitelmissaonyhti
438,356,924 *2C6136A3FED412D42E91AFB853316B6E9DEB6B14 cb7c
438,356,925 *2C68EE8ABDEA14C28151C680970DC251E2C126CE 3 MARKSISTLERIN
438,356,926 *2C6832A061D935581D117FAE578C01CEA908BFBA cbrii
438,356,927 *2C64C1874EA9CA005BF03B1F68A9DC944AF8D2EB 2HCARUOMA
438,356,928 *2C6827EF518940221C3602AAC886F36B33249BBA 2ILOVEHAPPYDAY6
438,356,929 *2C62DC294C987F80829C2CDEE838090888BE307B 2KRNIKERS
438,356,930 *2C6F6B08347378945FE0763B3C9D1CC5C7C0976A 2 MARSSIREITILL
438,356,931 *2C6EFE5AA08CA351978D30D15B6F373E4138AA12 401INSAAT
438,356,932 *2C60B10EE5C9FB3C81DB7188227D367F0A2D1AFC 419TRINITY
438,356,933 *2C666303C6DDF584BBEEA49469E3FE28AFE20851 3-06-1627
438,356,934 *2C6B3A767AEEF45DB0A09160159465E77A849DF9 34 VERWALTUNGSGEBAEUDEN
438,356,935 *2C60E40C0900280C8CD8F7D61669FFDAC1D92434 356003 sen kendi gOlgenden korkuyorsun
438,356,936 *2C6DA568CA94EF116227947E4DD8BB271201548E [email protected]
438,356,937 *2C6A171AD01D48424C716DB0E80F26F2CA78C478 4EGKOMMISSARS
438,356,938 *2C6444E9462CD88FF80483A6C4AEED2C399572EB 4ETALAXON
438,356,939 *2C6D8E7A38764FD5CF115F2EF605D6C0E4E5B920 4FBDIXHJO
438,356,940 *2C67F92558E5E81D6CC7786A85FF6D8D387BAB32 3ALAMBIC
438,356,941 *2C63A4B1FA4FC452186949D8A3734E4FE8886FA9 4JCIHSSW
438,356,942 *2C6551078255D88D58D2B86934BAA144BA1E30F5 3B* * SPLAT
438,356,943 *2C6AF14DD8D78E925846044FE5E633169F559992 4MINERIVER
438,356,944 *2C667C9292295DD1662A3E092BA414C29234D312 4MSIREGAW
438,356,945 *2C66A82E510BE36DA1B28FA59A3AE0899D7D42A0 4NERDGRAB
438,356,946 *2C6F36761D4232331759837384B84F8CE4743DAB 4SVIDENJE
438,356,947 *2C66913095D92F602873798EE0D321A23E4FA435 4WILDCATLUCKY
438,356,948 *2C667FF1A83B783D8B3B79A82751610C023B2BA5 55CHAPOPID4
438,356,949 *2C668D389F515015A5749CAADCDEA053E0CADEE4 3EXTERNO
438,356,950 *2C6CBEF4979808BD4A656FF603E018219AEDB004 3-hyks:sta
438,356,951 *2C6DB2B99209B9FFB1835171B1886E176C95628D CF4
438,356,952 *2C66BF26A3AF63C9D68839E8CEB11C5FF6A20DC8 3KATOLIKO
438,356,953 *2C6CFB29D51B69A25A51C6322A58F78D9A5DB605 3.o'dowd
438,356,954 *2C601C1E92D5AE83088121AB0B616126994E371C CFI:9
438,356,955 *2C6640799DABFE2CA70C4F2F8C544C012A83A6C5 CF.r
438,356,956 *2C606A8007A89B976C1D4BE7BD435C4C9F0B11BD 404291 kemirmeleri-iCin-bir-kemik-verin-.
438,356,957 *2C6F03F9C7F8ED7B8DEB591AAB3A2160C198AB4C 40878 bir.iyi.niyet.belirtisi.de.gOsterilmedi..
438,356,958 *2C609225D226F93705443C9EF94364FB38C3F822 5EUERYWAY
438,356,959 *2C68A2493E25004AEF982826BE581D1AFC504EA5 5FILTERPR
438,356,960 *2C6192CAC27EE04B4D293941FE792356700873D8 5GERMANGREGORY
438,356,961 *2C6A96EB97A17B9575C0CEF87B5363A4EFF78E66 5HETEROGONOUS
438,356,962 *2C6988161FACF20293B6FC86C9FB4102786B200F 5INDUCTRICAL
438,356,963 *2C64D22677942862629E292B38168FF64E93A87F charleyeguchi
438,356,964 *2C6CD6014BA096CC32C9A6D050851BA6909C85A6 charleywatson
438,356,965 *2C6C5EC592AB108B3713C44111C6DDAD763A696E 5.kiinnitysrenkaan
438,356,966 *2C69BB7AC83C023BC5061A913AED454D90C41975 4IDNOLOGHE
438,356,967 *2C6E3C894FFB5FC3C95DECA5868492537E17B1F5 4INTRANSIGEANTLIES
438,356,968 *2C650125148A95F81C2CE3047039EE34D389931B 5NOOLDRAADNATS
438,356,969 *2C616CA4CC34C4C5CE7428C107971F628A1B76B7 5P4CEFLGH7
438,356,970 *2C6CE288BA4A77AB3E8C58ED3E130A92796A4084 4NAROZEN
438,356,971 *2C6056B220E392D0FBF2FB0758FBEB2E2599760A chesterlarry
438,356,972 *2C6D0976F347B9D31A75A8E8A564E46C9417F8A2 5SERAFIMOVICH
438,356,973 *2C684D820E9F7A8E9E73A7F5A8D0B72743FD0DD3 4PROTON
438,356,974 *2C60769BACCDAE80BC64919E5AC2D61136181816 [email protected]
438,356,975 *2C6F71D02E050626A8DB315F15F71110D1548031 4TANFJBKDORQ
438,356,976 *2C61695443AB482C621E9FF42E0397D682A54893 5THENEWYORK18
438,356,977 *2C603AA319FDA1921CD0FB67469779F80AECF599 chocochees3
438,356,978 *2C6AE75625206E362AEB8F959F22EF909C3E44B6 CHONG.VASSEUR
438,356,979 *2C672689D52FE34846760E4C285665AAA76D470C CHRISTOPHERPRUETT
438,356,980 *2C6A1264C33EA051D6500BDAD9566A8E94513A67 c_hve
438,356,981 *2C65D5670FE42EBF4D3882477E99D1A9139FBE04 CIOAS
438,356,982 *2C62F0BF5601C1CCBAA7652BE18235ACBD6938CA 6BAILLER
438,356,983 *2C67A02A9AF824BA68BC48275374105A000D60A7 clairbachtold
438,356,984 *2C6F871AF37D75E2413FA44F650CDE4324341DB4 CLAIRSARLINAS
438,356,985 *2C6D623A6CFBB285D262A4E61B84B3D0B1C145A7 5GROVERDANIELLE
438,356,986 *2C66D1BD832E6ADFA3A6C10827523131FD0582DB 6GIDDELBSW
438,356,987 *2C67276CC312A26E3D8C47817E805EB69DB01046 clementepaillant
438,356,988 *2C6BCAE5588FCE94ED360E163CA82A4D6CB61D2B CLEMENTSTACHOWICZ
438,356,989 *2C6A0B12C5B46BC121918DFD91BE3E0308646653 CLEVELAND.JAROSS
438,356,990 *2C69F18CA7A3BA047A393E1DCE1139949B1625A7 6HYVVARTALOINEN
438,356,991 *2C6262381B7CD7DE99E293E16C79FE3FB2E7009D 6IAMHAHA9
438,356,992 *2C6759C0A65D1422836757F16427A785A7CFC1F7 CLINTENGELBRECHT
438,356,993 *2C65154EEE4A2B5B24A1060F7ECF26A6ACCCD264 6LOPNEED
438,356,994 *2C684522027516A7B7EDA3708797504F1216E327 6MAGALLE
438,356,995 *2C618AEE7F280C6D2BB22602A25900CC60377F27 6MARCH1706
438,356,996 *2C6C3210CFD9E023126A8F35BE6EFDA624E2E9E2 6ONDALEA
438,356,997 *2C611BE8EA2B95DB22E9A52FEC99B359AFE35A28 6P.E
438,356,998 *2C606DA8E1ED0E34A0A990E1FD5CF06AD6997FAB 5RERESENT
438,356,999 *2C638938759722639F96BA327915B3906E9721E0 6RESOURCESPROPORTIONPULLING
438,357,000 *2C6B7DD05DB549789E892EAEC56C49609F6A9F53 cnaw
438,357,001 *2C65E32015176764E97BAD6A8BF65048CF554526 6SPEEDBOTEN
438,357,002 *2C63FC6A170FBF7E02DDFADAD3EF5FA0BC2DCD71 COC6Y
438,357,003 *2C6393056BDC38A73FE011F1CF70516AECF331D0 cody.poteet
438,357,004 *2C60C377595ADB6CD543F5D7785CCDD318FAF046 c=o;h
438,357,005 *2C668925215892D2294414EACE11D9AD555A0831 COLORINGS
438,357,006 *2C63CC42CF619FE59B0BE22A69FE4173A976C2D3 company”に10年在籍。
438,357,007 *2C64625FD2020C1ED1874B28FE54B0066BD61504 CONFIDENCIARMEIA
438,357,008 *2C69A324BD8AC7980210C67B174AF7D9AC81B860 conradreha
438,357,009 *2C61FD9D1B58DD5DBD12DF443FDE695FDCA036C3 739atticus
438,357,010 *2C617EB1226F8FC375FE563822B98C5F0A540946 6GHAFARSHAD
438,357,011 *2C6EB0C2CAE603F012216556AD5663B47EA8D5EE 7BSWAWAKESTBSW
438,357,012 *2C6A126908C1DEB595650E2D5516BAE05F47084C 7CENTTRIES
438,357,013 *2C62E84CC5C5261349A4DCA4E831D1AF4047055F CORTEZ.MCGRANAHAN
438,357,014 *2C68C7D49B7A503BE41E77988A354E1EAF09110F 7EUFORISERINGERNE
438,357,015 *2C62EE4A3A2156A3C40705D610D9B23A0620C70A 7FOXWINSTON
438,357,016 *2C67EFFCADB4BE6AEF80D1D7B51655A2C7CC017C 7FREDERICCHUCK
438,357,017 *2C6845F74EC4F11EA49BBB661A6658945F068977 6-kuninkaalliseksi
438,357,018 *2C61552B6FCF748C16D58F57BF3B08948E1416DC 6MELBER
438,357,019 *2C6502C20F28C667F3E14D078A10FA6774D35A17 7MIELLYTTAEVAESSAE
438,357,020 *2C6BF97E254ECAE93C6968C5DAEA06FFF8D867A1 6RLITLIGASTE
438,357,021 *2C633AE1F96B4E11293D27A05A360720352B543C 7PLEASECANADA
438,357,022 *2C6FD0939788C01EAA2B82869EDEFCC0BCEB604E 7PLSMCHN
438,357,023 *2C659BBF4E3CD2D8031F2A06F18CB00C398AA231 6TAGLIAI
438,357,024 *2C65B9816FA04BB2FE9545EAF6272914B1A3A1EC 7SETNHAEG
438,357,025 *2C6AB383CF1784394A97635102F3DAFD9ABBC999 6VFENTYR
438,357,026 *2C64F07D9272121C1FDD4A074F97CF633513F895 CQ$H$
438,357,027 *2C6BE648DB4B8F65E57CB296B3BEDF882D9C3431 [email protected]
438,357,028 *2C6FA3EA4F44A00A5BB23AE1FBD235DE3E46D413 CRASSULA-ARBORESCENS
438,357,029 *2C657D193130BFABCEA8AEAE670D65C18537899E CRECKAMP
438,357,030 *2C6E203177DFA0059BDF5F36C061D5D92B5A73F9 7VISUELLARE
438,357,031 *2C607DD8386AA6C15B3C5D3B27A0589F6D655128 CROSSING THE SHANNON / LAD O'BEIRNE'S / THE ROUGH ROAD (JIGS)
438,357,032 *2C642E54DD45D8D5B4E6A73638B379964BB9034B )8(0~.q======p
438,357,033 *2C624DA3FBFE92CC0F061252605F145AD96E1EAC 773856 MUENCHEN-GRUENWALD,GESTERN1430UHR
438,357,034 *2C6F92BF459CBB79E0313E71C0D706C8239A79B4 CRYST[email protected]
438,357,035 *2C66A298A0EA18B62F306A4019E4A629DD2135C7 89337325-3FF3-3102-9681-EE53984A0B0D
438,357,036 *2C658715E511133A4A8091C8098052D39DFDCE1D 7-begenerek
438,357,037 *2C630418B6B299DE1A2978B780240E42AEB5AB39 7BSWAGROEMPRESASB
438,357,038 *2C6D4641CCF3DF4F36EF3B3732662C21E24CDE3B 7CHARLESEAGLES
438,357,039 *2C69B85755450C73DEC04B2CF2CBF8A97C367984 8CHERYLTEXAS
438,357,040 *2C6F00CAF8AEE67FAD9DE8764F45371FD48BA2C4 8CITONEHP
438,357,041 *2C60751187912B1B8C9E9C7F4047174F5739B439 CTM4N
438,357,042 *2C6A5687701F53B977B6BACB415A11DB9167D3F2 7HOUSSEESSUOH
438,357,043 *2C634A7234FDEEB417DF5C1096C3DA0811C663D3 7ILUVBOOTS2
438,357,044 *2C6110AE9C276E7BFBBEDC0C5FB521880E9482AA 8KIRRENE
438,357,045 *2C659A02BB53DC6D0C41EE5318ED33B27756240C 8.L
438,357,046 *2C62260EF838452AB370713A84DC59CF7CB86D32 7MOOKIEGIANTS
438,357,047 *2C6F011BF656AE519A1F2DFA066F0DD4A841E94D 8OBCECAREST
438,357,048 *2C699179AB9551F7755EB83FDD1222C390045FE7 8p~ `(^_~)
438,357,049 *2C60A002B9F71494A1EB112D96A0EEBA61043255 d3pv
438,357,050 *2C64BF643EF7EC28099A3FEB06E75FF59E7D1F1D d5#ej
438,357,051 *2C678DF8B9EB0CD6F0221765A9913CDE6F4FD486 913TATUM
438,357,052 *2C6F7A94D781F27CEB363BBAE412EC6310B0ED44 92921
438,357,053 *2C6CBD15167D9490C254275B548FD3E8FFD0F762 939R4PH135
438,357,054 *2C6CF99454DEE0720DDC6B4128B399DC2BCF755B 93FAKSIN
438,357,055 *2C6FFF3E52D8D3BA9C77C536FE140785DC7428C9 DADO.DODY
438,357,056 *2C615CDE342968218F7F7A4143583AE7F9E5C5A6 9EMMAAKIA
438,357,057 *2C64ECD389EBA537AEE0A56C33A2D3B8C62075A6 DANIEL.CERVENTEZ
438,357,058 *2C6B197A3F323434A019E1A2090CB5F93C76449D DANNIE.TRELEVEN
438,357,059 *2C65E2503A27133649CB08C780DF1798DEBD6F19 8HOMERSTATION
438,357,060 *2C69E56F35BED3F20A1B79F0B3F7433F60949AD6 8HOOPSSONNY
438,357,061 *2C66E1396FC507D41515B8DD41E69C0DDFB2D6BA 8iloveflamingo1
438,357,062 *2C6D84036B65D6DB294861922AD518F01BCE8715 9KYMBURLEYS
438,357,063 *2C64B7E26526BC55584E39653376E0132581A8F5 DARREL.GUSEWELLE
438,357,064 *2C6960BE614DE45116D8330F467C8B72D837C587 8PROREXXERORP
438,357,065 *2C6F8083F24FE0AAA6AB38D65962E76BB8579539 darronrings
438,357,066 *2C67E3AD46F67A66886EF51210E0B47FCB7E6696 9PEHMENSI
438,357,067 *2C6E569E5484C3E6C1B8D333594EAAC070C26F5E Daylight-Tripping
438,357,068 *2C63ACF2645C4BF99BC8769F46BA393A3A57EEAD 8.UMWELTABKOMMEN
438,357,069 *2C6147D18CABD2E778062F77682B3E6D0C46949F 9YLEVISAV
438,357,070 *2C6D290A7022C3F5F00DFAFADA7C2AEDB9694DEE a/,!:
438,357,071 *2C69BF8755CFBA75EFC83A0AB4485F4B18C1E879 dccwv
438,357,072 *2C62D62A90F3BA9DD56FC4CBF698929DC9372581 dd5l&
438,357,073 *2C6AFAB8A320AE1CE3D3EC934367DFE548C0D03B DEANGELO.BILLOT
438,357,074 *2C6457F8E29BBFA40B819487053FF634F9090262 deangelocott
438,357,075 *2C629CE5EEC2FA38355C2AF5CADA4C322DE03586 9ELEKTROMONTERI
438,357,076 *2C67CCE4D30BC9022F8F8CBAEB97C1BD266265B1 a6
438,357,077 *2C6C9955D9EBF95FE880EB46579A9F2DAF37D9F0 DEFIANNA
438,357,078 *2C6B877D720F4524ACF9017A88FF44950DC2D870 aaa;4r
438,357,079 *2C6E68C1BB7125A80EA9C9F71D1884907FB4ED28 AAB7L*
438,357,080 *2C675DA5F5B86B9E4731F008A5FBA69FB7FEF597 DENISE MALMBERG
438,357,081 *2C6A50FB2C8F0BC8C0B05CF49BE26EDB8A066E00 AAC}JL
438,357,082 *2C6CDB4DD8DFCB8BD66F0448B457BBC345086187 AAD"=
438,357,083 *2C6A47BEAAEBBCD856ECF8C10B0D42F59348CC2A 9YPTISIIN
438,357,084 *2C661C8A5D773BF164A5C69E1889F027CDF81646 AAE`V
438,357,085 *2C656FAEE3B0EB74F6AAC8A778B3A2B4481C1840 AARON.AUNGST
438,357,086 *2C6F7E013DFED6D7D8F8D1F1C15759E4C9BA074E DEVINWEATHERLY
438,357,087 *2C6586A2B5B892C3E22FEAFB28A86128A92E94B8 DEVON.FLIERL
438,357,088 *2C63B30DAD95AD83E1CDA99A096B2F21653142BA A(2VJ
438,357,089 *2C6AEDB5FD07954361995FF57942885EF223A763 AABB1J
438,357,090 *2C647090311541E54BBD5F1337D83A7A7B7DFFB6 AALSHREIM
438,357,091 *2C67D3988C22FE382FB5BAB226A35EFEEE09D768 aaronhernande
438,357,092 *2C6D0D43FDF19418E790CA2B8956BD1D715F9C0F ac),
438,357,093 *2C601865F959356555CC24CE3724FA9F5EB66A5C ACLC>
438,357,094 *2C608397763B78C0F919300F4FE20FEF3A9AB0C4 ACOSTAR
438,357,095 *2C694989A02C4231CA37210A1F4AA707414C098B DL8R9
438,357,096 *2C6A3BAC5F2B504A0071299EF079BF76F255B57A adrianmelamed
438,357,097 *2C66085758F3C705880D6F01B2CB2EA792F1438A DNNYDNNY8
438,357,098 *2C68DB8965A53B858A06E8DC0B631752B3116499 afgeschovene
438,357,099 *2C6BA2ECFBA3CE761FD5D0969B5291F42AE20A84 DONALD-CLAIR
438,357,100 *2C6B5CE09D90316FC14AB5CCDC04C0DB0B89ECE4 doogiefuckoff
438,357,101 *2C63D8759F29D711AF758091A3203CB8400D2F1B AE$K
438,357,102 *2C638DCE67A27979ED048D3E00C2335959EFA7B0 AJOLIEKING
438,357,103 *2C6BEB87D5DEA449DA02ECD57745D2B8481150B7 DOYLE.HIGANEDA
438,357,104 *2C603B90E9138FF5A4D1AB9AE602153FF2605E8A AKB!
438,357,105 *2C6E4EACB11E10FF6CC2F5DFE3BDD458803D636B AH0F9
438,357,106 *2C6B4F23106A5F4E53BF3B5182A38A97D12A2FF1 alonzomcferron
438,357,107 *2C69C2C49E816BB35B4A1B3032EFE5F99526DAB6 ALPHA.WAVE.(GLISS.MIX)
438,357,108 *2C61A0939BEA374694AEDC53EE06D801DC604BCF AKWBL
438,357,109 *2C6B1F3D43AF6E3D3DC629172FCFE42FFF7E7812 “albiazul”
438,357,110 *2C6AA2EB43C89958A7AADAEB78F009227574695D ALVIN_CHIN
438,357,111 *2C6036145EA703449F754AFE6FC30CF9565E52AD al_zf
438,357,112 *2C6C41F1040A48D2655F8795D05E8B110182DDA5 DUSTIN.MURRY
438,357,113 *2C6F707C3E940684D69912B652F7C1C3F65B8BF3 ALECHIA3
438,357,114 *2C65F5E80BE45B7FA70206E833C8B857FD3430CA DWIGHT MOONEY
438,357,115 *2C608DDEC9266822E8A377C99FA659B4957452C3 dwrs
438,357,116 *2C6FEADA1C8054CB3BFD051BF77D2878FC5C153A ALIASWELLES
438,357,117 *2C60BF337CD20592F39C3C0B5169B31F7DB9B8E8 alijuvera
438,357,118 *2C656F8241873396D98ABB5BA77C43C9AC4D4622 ALISONSANDILANDS
438,357,119 *2C6D39223A743C77A698DDE11FC48EEC884D5192 an7cpa7or
438,357,120 *2C62480EB7F0D494D686F65308E7C27BA26403DF ANDREAGUALTIERI
438,357,121 *2C6B4901D717940A2E76FBAC2094021699EAC42B ECORBEG
438,357,122 *2C6DC20AFBE5A60AD3CC805E1C764B789C737C78 ALSHEBLY
438,357,123 *2C6640D0FC4C3A55757BD249F07D3C0CFA046024 ANIBALWALLINGER
438,357,124 *2C613333AC2DFC148D0130A3A65654CC36E2F6B3 ALVINIA
438,357,125 *2C6E04AB986AD935365665F3D5DEFD665D27E04C ANIRUDDHA-BAHAL-THE-KING-OF-STING
438,357,126 *2C6A2E06A7FB731FBD7EC3C16ADAD645890D0583 anjosolga
438,357,127 *2C63E241F236C50EC517EC6A2E5EEBDCEAB87E76 ANNAFUNGIBLE
438,357,128 *2C61DC7AD746F7D2C1CA3F21AF07B91B88E6D8A6 ANNE MARIE KELLY
438,357,129 *2C6D6F762CE4F9EB136C8C120EDA78335546C430 ANNETTE-WILLIS
438,357,130 *2C6CBA0C17F6141656496B0964E51DA2EA3A0850 eeb$2
438,357,131 *2C62CD30F0527FDE176A800F1B4F000A76072842 EHENNTIKER
438,357,132 *2C6660520C078747135F0D4F00E811F0019A7FD2 AMPLIANO1
438,357,133 *2C619F8B92DD4FCC71F3663B4F2B7A5342686D2E EIXf
438,357,134 *2C603790824EC455D754E42212CBB696249F40D2 ANDREAAHAL
438,357,135 *2C6D7CA4C45F872AD123FE4B714CECE569676A36 el.7h
438,357,136 *2C6498007FC771D253D0CF9CF705C47F1371E369 aq$ae
438,357,137 *2C65A502EA4067DF6F6D885DD8E63A01B46F7202 ar0b#
438,357,138 *2C66EDC056E184A27AB208161E46BAA8EE62A38B ARCHITEKTŪROLOGIJA
438,357,139 *2C669A5A01EEE60E668D32E8EADFD455CCFAE5EA ELHM3
438,357,140 *2C6B1FE01E01B87C4D506C56C12CA3ACEEE91D93 [email protected]
438,357,141 *2C6E5EFD6923C1CBB4D427410F69A02DBD44304E ELISEONEUBERT
438,357,142 *2C6C06867EBA431960A47D2408E519764FCF6443 ELLICOTTH
438,357,143 *2C6A4C0D3B0BEF2E52824D8A742A0156448859CF ELLIEKEH5
438,357,144 *2C610A8657926F3DB1C713DE2C40934F59C63BC2 arnulfowehrheim
438,357,145 *2C6E2140C6CD541E11BD1B6BDF4E87F8BF7495A4 arsamoris
438,357,146 *2C603390B8C8CB2F6CA7B07C42BBAEA08FB33920 AO99G
438,357,147 *2C6C556B86F43EC91CCA7B34B5960EF5A269728C ASEMSKODA
438,357,148 *2C6CDB681722835332942268C0D803AFB813495D ASHWANI.SAXENA
438,357,149 *2C679BCD9E4B5D7F19380D7E1B4F834D2A9612CD asnr?
438,357,150 *2C6EEA22622E8EC6BA0E0BB96C237B5EB2C83B6A EMILJENIFER
438,357,151 *2C6C2F68123063D6EE21788EFFB3D790A21490C9 APSKD
438,357,152 *2C68478EDDF500DBEEB13ADEC9F892CC028CB0B3 at:1g
438,357,153 *2C6F31508A2FEA4620A2E73AACA07708D6DB9281 ENLABIAS2
438,357,154 *2C635E396A2E1E80A7157FF553E2601AA867C9A3 ARTAPPLEYARD
438,357,155 *2C643164C547C8768CFA71D7F1D8BF515332ACD9 ererrabs
438,357,156 *2C61EF0A03FBDE2EF9C91B054D29C6E20D5A0934 ar)y
438,357,157 *2C677C2ECE330E2E10EE61CFA315FEF7CCED930A AS$GU
438,357,158 *2C6872A3191A9FA2461331973D7EF09F71E60245 B0MKW
438,357,159 *2C6950A5A8F75F2A62954826285B813FBD628E0E b2gmi
438,357,160 *2C69D872E4C37590BB09FCF3DDBFB9CFE3E3A661 a%u8d
438,357,161 *2C691BE189380A7E71BE31C9250A30DE7A6791BA B59.L
438,357,162 *2C6F5EC546F743CD82B2C9DA2DCC34E206CC4B0C b7js.
438,357,163 *2C611561FBD19F3FC9EABCD148E5173A0D9691C5 b_,8,
438,357,164 *2C63639BA3C6271B815C9A673A26D75737F7A202 FAUCETGUYCOMWWW
438,357,165 *2C63230D300FD50E30BEA8700EA6E75F86144857 Fayetteville'f/eI//I/t,v/I/l
438,357,166 *2C61F325FE401AB55281D788719DBA8161865FD7 babatunde-niyi
438,357,167 *2C6D6AAB9C8481B7D9F84C33F10984203C60BB75 [email protected]
438,357,168 *2C6D2965F3C9C7EC5948A27D47C78B439ED0EF34 federicohuereca
438,357,169 *2C61DE954B432991F7E44D4D8B3A1611C675B4AA badbleiberg
438,357,170 *2C6903D08A36EEEA17D79984889648879DF7878F azg=x
438,357,171 *2C6F752D1D2DA440F00B5FCA58170A203389D671 BANEWORT6
438,357,172 *2C6C0F512FBBE0ECD6E96C7B8108EE464B5E5EAB barbaradildine
438,357,173 *2C63CBF21A07A04A64162CE6D584E69805B149AF FIDYTEK
438,357,174 *2C60F948EA743F6B0E84D291BABDFD63A23B3621 FIGURASEIS
438,357,175 *2C6D56A3CCC82121F41301F57D4949F22F12A172 B2NMFCWIJD
438,357,176 *2C673B5805642B98A54E764CD5FEA3269D6AEE23 [email protected]
438,357,177 *2C6AE5B13EF72F812DF7853BEDC0FE4C37AB481F FIRFIRFIR
438,357,178 *2C67CE651A3011B228DC3A6DBE1F96B58DD14399 B3KM$
438,357,179 *2C6BB4516D398EF1D3B179C17F20089B27D746BB BASSOON80
438,357,180 *2C629FA77070D85606E0AFC3B37E12F0CBBE09C2 B6GB9
438,357,181 *2C628E8B3CA86748A6FC9DE28D307C2C9356AA4B BBLJ"
438,357,182 *2C6CC49EC6E562D8BFDC9BDE26816A06AE88337B B------D-~O~O(>_0)
438,357,183 *2C639B7B92C4C89D62082EB001B41556F75526FE badkastninger
438,357,184 *2C6FCB964BE8AA686E4BB3D0DF74535490983504 balanc3.r
438,357,185 *2C64C7ACBBFDD8347C5965EEB9DEBA8D180C87BD FRANKLIN.KLAY
438,357,186 *2C67530D24111ABC2153B4F72B0DAB99911DC9F1 BEAKSHAP0
438,357,187 *2C6B018AF26EF76EF2A6CF47251C0BA554C16DBB balw
438,357,188 *2C61A6819102DD9CFEE3546DA1861B12F346CAA7 B$AMH
438,357,189 *2C633EDCEB20E210E4BBE1711A4C329FBEF7EAB2 BARTON.GLATHAR
438,357,190 *2C6BBDCD2C3B9BD778B6383F3FA2026A8562655D F}$T
438,357,191 *2C6FA3F071065E63629575D918742086985B50DF basket-hi
438,357,192 *2C6D095A43505D1C91DAEABF86C9707C326775C0 GABRIELLEKERSHAW
438,357,193 *2C63C880F434263C7E4586898F5EC0B4C31CE30C gailborre
438,357,194 *2C65A258F124C11D332C381952D5B2D147B9A86B BENNY.DEDEKE
438,357,195 *2C69090E8ABB05E56A25A8357D1B2B0DF72120CE bb,"w
438,357,196 *2C640E608C9A8743042665082EE69212E352B72B BC!RU
438,357,197 *2C6531812BFFE1C15DFB5EB53E2D618CB6C9B0A2 GARY.BARWICK
438,357,198 *2C60B64C9BA5D9864CFC9BE2584A3240648D7D5C GEFAHRT1
438,357,199 *2C6CC39D58E755DFC62F44EEE5833FA59E320543 GENEVIEVE MEZA
438,357,200 *2C662B0A427E8853902730B71932200F406815F2 BdvB
438,357,201 *2C6A1F83CF5836DFDF31E7CF83B92BE79B27ED2F bfizxcvb
438,357,202 *2C6CEB15EEC38CC997477AB71A7EEDB2A273ADAA george-kleinsinger
438,357,203 *2C637B16E775DC2F6F2C55DC64ADA8139978DECD bgen!
438,357,204 *2C6C7C25F17CAE8C82BBB80B775D803B971C3807 bh0ng
438,357,205 *2C6A3D1686ABA4ADE778AD4ECC3908DA8E68C278 BILLKAYLA8
438,357,206 *2C665D60D896AA325337FDDD0E71D9361488038D BENNETTPROCTER
438,357,207 *2C690E9D89D41B7D525F71B719462DBCF9D99583 BERCUSE
438,357,208 *2C68FC7968032845B4E9E21801C56B32EAD3C3C7 [email protected]
438,357,209 *2C6329753183D3EF531C85FEDED1210B800CEA14 BERNARDO.MANTANO
438,357,210 *2C62CC32FB847FEC0C1F8F59787C5CDA76578038 GIOVANNI.BRANO
438,357,211 *2C65C5032FFBD8C698B7513EC8E603D8E68727BF giy1
438,357,212 *2C6FC31C549B268872546ECE3576F74E8C43F6BD BETOKENS
438,357,213 *2C664E3EC58C11BE43DE8BD69BB6645B0EC2A93F BF7PG
438,357,214 *2C6DF78052ED883678C31C8C1F63BDCA8BD7F12F gnilbmurg7
438,357,215 *2C621F672D03CEBC9F5D9324633784D61B57958B bfkfd
438,357,216 *2C6FCCAAF33A1C44AE612CC56B7E772BD3DD9B95 blund
438,357,217 *2C6724C0A092441CABA801EA9F08D6E4581B7D8E bgjli
438,357,218 *2C68203125F9FEFA63825C009DF6C45E7ACD6CDC B%HGK
438,357,219 *2C6759DAE391A132D197DB389B59F7A51787C287 [email protected]
438,357,220 *2C6E12B6AB977C77A89F0121B0E7F03FD461EB94 BOARDROOMAQUATICS
438,357,221 *2C60970013E2D153F5A36AC5780B7E8BF7DB02B8 BOAT-JUMBLESCOUKBOAT-JUMBLES
438,357,222 *2C6F40C5E8C283E32C7B4E0C11E0DBE8E1720E88 bob.kowalewski
438,357,223 *2C63113A138D8F18EFD977DA6027199627A5C139 BLAINE.SERRIN
438,357,224 *2C688AA02D73034160878E3772447AF50445A670 borisschepis
438,357,225 *2C6AC5F4D69A4DBDB541D97E55AB588085025A88 botherthosetrucks.whycan'ttheycomequietly?
438,357,226 *2C6F563CA8B3EC4BD0DCD6F8D03450B23A8DF06B BOUDREAUDEE
438,357,227 *2C695A7276E933C863283DDD9153B6D8D6579B7B bl-$k
438,357,228 *2C6BEE9F6ED0779CCBFC0ECCB401D5FB82D86985 BOXPREFABBRICATITORINO
438,357,229 *2C677E9E27360407F88A2B8A2985952B5EADB5A3 BLTBY
438,357,230 *2C6839A17DF1E2C6AE01D85C7E183A71F0A37430 bn;8w
438,357,231 *2C6EF379F1995CC701BE892DA4FA9DAD3B48FC6E b(oc
438,357,232 *2C6B06476AC047FC9E88B313C864FE4ED8D128BB BONNEVIL
438,357,233 *2C61B6126F2282F4671E386C2D008F188CDCBDD8 B(QG!
438,357,234 *2C6BE514D791827E365EAF6096B9B4CD4B24C324 bradnóba
438,357,235 *2C607CC7684FDD946DB353937FB3CC6FA4839F6C bradynibert
438,357,236 *2C640F3CE61F227E48C7958FDA921245D008259C brandonbottalico
438,357,237 *2C6283A44F9EEEF9F909DEFCA9B2F831607CCA13 b(p1l
438,357,238 *2C68FAFEAA1B7FC0A4715B4FA11CE0D65E827805 bring into focus
438,357,239 *2C6017DFD43A5D357FA5DEA8A157764902970601 BRADLATIN
438,357,240 *2C64334468EA8A600DE70550590D2FDD8FCD5D88 HARLEY.MILEK
438,357,241 *2C662331B7A6EF7894FE9E30463EFAEE44FCC8BC BRADLYCROCETTI
438,357,242 *2C60D3C3F4699FC9EFA8CB384DA38AF8EF00822B harryantoniou
438,357,243 *2C6DC170098E1B2928502FD09939F6D6ACDA8436 hayband8
438,357,244 *2C69B0E693E1A48BC79F93A322BE88B73E34D816 hdad
438,357,245 *2C67FE892EAE800124BBB2C5B1F3F3AB3DFF1E4F bricety
438,357,246 *2C63FDC7D2FAB3A791CFB9F7B7425959DBE85F12 BRITT.KUTSCHER
438,357,247 *2C618BA5A356BA2145E85D08AE81253175EF0D32 brk4o
438,357,248 *2C60D96E6F95CF6714B1F0BC8525E129F03678CA BRYAN.LITTMAN
438,357,249 *2C6672D8EDF3F364A093EE776090E77B2F554D59 BRYANTMALLEN
438,357,250 *2C6B6A95B543FB25CE973282B3242C466E8F5CFD BRYONDANCE
438,357,251 *2C668F971B987E7CF8ED07DD762E90CF423D6D5D brittklukas
438,357,252 *2C6AD4842724C30FD9E7407839112C17135A24DC [email protected]
438,357,253 *2C60B058642E07310F14F7D083ABEF90CE7F102D BRITTNEY-KITCHENS
438,357,254 *2C627BF634A2D2DF407B0152B9AF989251CD782D brk4o
438,357,255 *2C6CA039C2031F05B90040578565B7E1890945BF BRYCE.FLENNER
438,357,256 *2C6D6E3D6223608D0900B316E24DEEA9A8A39679 bs2&c
438,357,257 *2C686E3B52510538D05180A63BDFEA78DDBD742B BSTSHNSS3
438,357,258 *2C6E9BFC8E52D99311E5DE1486D2076B95AF3CE4 hompetv
438,357,259 *2C635006BBBCA30B57E596AFCE2CC580D693103C buhco
438,357,260 *2C68A237BE67B13A6D711C97D9AF519AE81624C2 HOWARD 'CANDYMAN'
438,357,261 *2C6E1ABE0567414F90C5B22BA148A3F7FABBF143 BUTGI
438,357,262 *2C66ABD5A088B47B454941AF6C68384D648598C0 bvh"f
438,357,263 *2C6B19CF21389CE95F606FDF6CEF9891B6A5D7B5 BW&;G
438,357,264 *2C6431B6FEE834B3E4421EF6CAD526591F4AD004 bx(sw
438,357,265 *2C66DF85A7398A41EFD407BB1973D17D9F13BE0B BZ8DR
438,357,266 *2C6CD395EC4FAE9274352E55903F0B002B6F70D1 [email protected]
438,357,267 *2C6A72F6D93E18C84B8540A74A2D5383E5F93BC6 huwelijkspand?
438,357,268 *2C656E9B60D9A2293CE934FBE91473E08B02B15D c364205eafc78aa4a87a78b44e2d2b77.dpass1
438,357,269 *2C6F0381FC4F72A0CD3123749EBCFCC41903EED4 c2u;l
438,357,270 *2C6D25B7AED37333266D8A2CD57A62E1CD66EF9E c{78
438,357,271 *2C6F8A99248AAC1A11264F65BC33EC6118C70EFD IB$L
438,357,272 *2C6E970F799BE1E200629B9B87E9731CFDEB2695 ICEREROF3
438,357,273 *2C626FE3E1C842FE0CC8D05D9266A20E7EF59C6A CAEF=
438,357,274 *2C637A0F81CAC092BFC08A38408207440D6B59CD IEPREYE123
438,357,275 *2C6D1E6757DF44A09F8EE26C64148303D7EDC15D I&FF
438,357,276 *2C608D653DDC0E7D2DB7C1B275A3007A5E964EF5 CAP4449
438,357,277 *2C682325ED65CE1CDD958ADDBBE97474C0624F30 carlongov
438,357,278 *2C6757A6214C67006D7340F4903E96A0CA6BBAA2 CARLOS-LEVY
438,357,279 *2C6FEC0E95BF4D5A8A037D816362715F055E1EB0 carlosullen
438,357,280 *2C67143C9FDFD63952072A46155CAC3F70DEDAC1 ilovepeaches90
438,357,281 *2C6515F9FF31C8003351E9EE7EF746CF8BFFF996 CASEOLUSSUBCALLIFERUS
438,357,282 *2C660EE91BE85E9B5A3DED15217FD3E4E8042885 CASH.14
438,357,283 *2C62D1FB515A3FD25CE120CA4A6CCF98E0681CA9 ca%ss
438,357,284 *2C6B729189F67F40EED8595D71EC49DBBD254AEC C=C(
438,357,285 *2C64DA1AFFE6F2BE762691EFFC294A6B83245417 [email protected]
438,357,286 *2C603DB5E7610D683C3D3F6457E65430BEEF109B C&C:-
438,357,287 *2C6B91A21DF986960DBFA238777A76B57BD4C54D INKEERDES6
438,357,288 *2C684D5FE585079DB152A20FB09FB775E30F470C C,CHH
438,357,289 *2C6156144986BFC6822131B2DFBCDDA93A1A4F5D CD-H3
438,357,290 *2C67DC3931C8F7C694F2325316331FA7D9C5CDAD CGEE-
438,357,291 *2C661F4461B6E8D277D6EF30DFB91FBF0DEA84CE [email protected]
438,357,292 *2C6E580B7A9E862E374DA4678764CDCB51E3DB32 CGIKC
438,357,293 *2C6A7B3F3C15CEA5D410256994DCD2AF081ED16E CHANGRATHKE
438,357,294 *2C63238F4ACFDAE318232259ADF01932288D7D7C CHANCEROTHERY
438,357,295 *2C68603E7A6DB2CFA68BB0777F5C583CC4E89495 IVDT8
438,357,296 *2C6B1C740D0598E74F4F31D1FF567D8D2B550B82 IW.P
438,357,297 *2C6D94830ADE0BC90FAFEE46D89F8C1F70014440 CHASM2
438,357,298 *2C69FB6E3197CF50A75A3F92ABA57C3020877B63 CHAUNCEYJARRET
438,357,299 *2C675194FCEB828F1B3F05FF9E0FBD431A028B9C jacklyn-stern
438,357,300 *2C60C1F211BFF504535C1A9A9799F6A8A16B6F89 chc?;
438,357,301 *2C68CE2ACDDC877C1FA6698F3A688DE8F93F971F JACQUES.MITTAG
438,357,302 *2C6E9D8DFD15711E608ADE0226C7D080A6905609 [email protected]
438,357,303 *2C61D0224EBA13776E34487617AE4877DFDB6764 CHESTER.GOLLA
438,357,304 *2C6D254B6B2D05854A718AF67D847E793D62EF81 JAMES1369
438,357,305 *2C656628B5DDC5CD6DEF695EAC9FF33A74C75D8A chkx
438,357,306 *2C6A7AECB2DB89B1496F7158460103518A11B35A CHLCDNNED
438,357,307 *2C6056CE406A4A03AB1BE8DA93B6BDAB7CBBD320 CHOVICH1
438,357,308 *2C6A0DADF6E246AF27DAB4E065C6A1AD98227374 JAN.WATSON.JORDAN
438,357,309 *2C667E2253E5BA6DC3ABBDC354FFEECCA2F62608 JAVERIANA
438,357,310 *2C68B87426C48FE523BD58E23E150EC9F54E7402 CHRISANJOS
438,357,311 *2C6E3439AD2BA27F3744E3D49A6561232915852C chuck-pierson
438,357,312 *2C6F34F983E8296385872B8C2E7BA33922943590 JAYSON.KEVIN
438,357,313 *2C6D90B67D4DF11FB25B1C8FE468F0CF59D6B2BC CHUNG.MEIXELBERGER
438,357,314 *2C6160803813ED4F37F648E5A3B0ECF1E28D8584 CICORIE5
438,357,315 *2C68B9D2105132BB1D598BABF9585535DF222E6F CI4RP
438,357,316 *2C67F793BDD64DF16491E5443930B49FB0E974F1 cipal
438,357,317 *2C6524A95A4FB7BFEB8D03B8DE0AAB4ACB508BC2 ckadv
438,357,318 *2C613B672F14B8FF83908F15B1D629020E0AB13C jeremiah.blackwell
438,357,319 *2C641B79C7063739A0CECA262393A1BB969761AE jewelwiggin
438,357,320 *2C6257138622D39020E5FD7AA6CB406EDC998E34 CLFL
438,357,321 *2C6B148A8DDE14617F04B548B92044772D3E98E0 CLFL
438,357,322 *2C66159703B69D1B948C379626D393FF4F4912EA JKOUBRA
438,357,323 *2C65EB936A73F186F56472E6AB39213348816204 c?-lr
438,357,324 *2C67CB142F35435C3D07857E51751CE777C3D172 CM7$R
438,357,325 *2C68565C869E9CD6117C5E70EE59C508C1C7E06C c!n8y
438,357,326 *2C6EBEAF7430B2810DD6D1EFF619D341D31A9F43 [email protected]
438,357,327 *2C6589F6B2FE7B72C74007A16050BFB2EDF893D9 colegajda
438,357,328 *2C65FEB8B8133EB2AB716E756B30B85187C4CF45 COLLEENL2
438,357,329 *2C6248A23FA37477F7F54C9DF570B036D401A8DF JORDANAITCHESON
438,357,330 *2C6076877FA229AFF12E74BB63C337161F67874C comfort5
438,357,331 *2C6255F7130FA8942DFC5E6A163293E27786FE2D competitorses
438,357,332 *2C6F88A331933E20C7F46712B856C874FEF652CC concertoforpianoandorchestrano1ineflatallegromaestoso
438,357,333 *2C6BDDFDC04E900DBD8F2A7980D787079BD62B7F JOSIAH.MARYLAND
438,357,334 *2C667AEBE4413952FF6D04FD0C1EA4D674209F3A JOSPEHCHAPEN
438,357,335 *2C6757CE0321B8B57D2883AD37B4B47A7F511BA0 JOY SEPTEMBER
438,357,336 *2C64C79F2C406A7D0C9548132930E098B67A92B0 J&/Q
438,357,337 *2C694D9444FCAE51775A620220EA4C29C91C9737 coreyluensmann
438,357,338 *2C653485479B63E62ED52C6D9AA8CF0E7FF6AAC5 [email protected]
438,357,339 *2C61CD007192704C8101A6C6B6B62E6C65EBEC39 j#t\
438,357,340 *2C6233371F454082D74042460A5CC94EB10D4C4B JTRH
438,357,341 *2C6039D64177ED7CD06ABFE17CA789DA43FB68CD JULIHUDSON
438,357,342 *2C69C6D62B0493B834EB1ECEF8E2A081409771BA JULIODEGRATE
438,357,343 *2C6284E4A008847452A3DC018112A0DB1CE12A17 julioostolaza
438,357,344 *2C6A127E963B3931BF93686A3AB77D96E090636C JULIO.VERDUZCO
438,357,345 *2C63418759A5C9E9FCE14F2AB43FA2923D91A546 c(p33
438,357,346 *2C68FDFF5E274C19DC0666757C022160905D5A44 K1N3$TH3T1C4LLY
438,357,347 *2C6C2512DC7F6B19F4751FED46CAF1484CCD02E6 COURTNEYDEMASE
438,357,348 *2C665C9D2614EFE3D5E8DD80D762E6EBD7A7522D c)rf)
438,357,349 *2C6AE9F7E07379D6824027E462F7824C48BAB175 C:\PROGRAMFILES\MICROSOFTSDKS\WINDOWS\V50\INCLUDE\IACCESSIDL
438,357,350 *2C6F457615BCBBB07D91D89B9C6B4810CFD25DB6 Cq0
438,357,351 *2C60FC39A88710CB1DAC3F3EAAB726B606391664 ctlf
438,357,352 *2C6C584D393ADA3AE34057889033AEDD05FF736E [email protected]
438,357,353 *2C6F997F8CFC2B60D1D5F7DBA03744815D8EF46B kbto
438,357,354 *2C62E7E43DF53A2DEF69FD6BFE40EE818F3AAD71 CUMR
438,357,355 *2C692BD49C1CC5DA37CA1A5E6F5ADEB4385E3AD2 c!vg=
438,357,356 *2C6C948D6CDC36AE77AC554A31DB5CC0606C57FB C=TEQ
438,357,357 *2C6F39663FEE098266D7F71B3F7E1E455ADAF4EA cz2=
438,357,358 *2C692809827503A0C60F22B9126B228EC19DB9F2 D"12E
438,357,359 *2C6A9F3F8DD939B720B16D6CE3902C4C9DEFCDF9 CUONNOUC3
438,357,360 *2C6D6CE413BD255666AD35FBFAB3AEBFC3AEBD97 curtkrofta
438,357,361 *2C679D460998031EE812E2EF9EF5623F4404BFC8 D354PR3C1315
438,357,362 *2C661B1828DA6AF4F2D2616EB693757FA99BBDDD d3pv
438,357,363 *2C65D8D5D9BAB481E5673D2AADB87F8AE3BD75EB cz(_$
438,357,364 *2C653FED9297E74D5A71E9B542FC2979F8435CAD C)(Z
438,357,365 *2C6293FDBE00A2DF47C4172A5B5A8C5695BD81AA d=0%8
438,357,366 *2C62CC72566A45C81EEF3612A27B5EE254412A5D d0i?g
438,357,367 *2C6614BB3BDE9FACF39262EA326088AD55105FEE KOMMUNIKATIONSVÆRKTØJER
438,357,368 *2C69712FD3077DBCA11E107011E371FC306F6D84 kompozicijose
438,357,369 *2C61C9806380DD768818828693BC52858EE83F21 d28du
438,357,370 *2C62DBC857171CE4583371729355581A8440EE3A dameuhaud
438,357,371 *2C618DFDE0E9B7A9458369A6C41690B4A1649026 D3BSN
438,357,372 *2C62E587C183FDC602C0A0D0352D4ECA9857C88B DA0KN
438,357,373 *2C611A93C7E6635C0B386974304F5620F68452DA [email protected]
438,357,374 *2C6DD760DAAAF3D4A09E16104D6B33621FDB0086 dawmer99
438,357,375 *2C6CE5411F961D7F5C6B55ABD20A242D508193DF DAN CASS
438,357,376 *2C6D197D8323366CCB4B5EA1E01AC2C10D066043 DanceDreamDeath
438,357,377 *2C617BA71182B0C6367D953B81AB6063B9B4F0D5 dancing in the dark (cryogen second remix)
438,357,378 *2C6793C3A9AC45C22EB0B8838CEB7A36FD28D0A8 DEANMENNING
438,357,379 *2C676BC528BF77B072E2D8AB08C2D6EBB151AD64 [email protected]
438,357,380 *2C67AA1AEB4F4412C65A104F749507B95A3B29DA dec4k
438,357,381 *2C6B287B006C793563C071125C5244831C772C4A DAREN.DINIS
438,357,382 *2C6DA791EF96A37C93CDE01C2BF1DACD93D096D7 decrescence.
438,357,383 *2C68140AC80D7079277AD08D136167581E36D22B kwq;
438,357,384 *2C658631B51CB368D119FCED081B7EA436C6F3FF [email protected]+y
438,357,385 *2C6E35EF2C73CE541334731AB162D9B361607E3E DAVIS330
438,357,386 *2C69066AFE1CCCAA97A98404BBB8531CC5230131 LAIRTNOM
438,357,387 *2C69C7826825B03C770FF59BBB19AE55CDB69442 DENNY.HIRSCHE
438,357,388 *2C67C560919B08878B5EA3FAA2DE6A57FC08A49C dbcr4
438,357,389 *2C6AEEE1148C81352020B09225749E624395B7D9 dc3!
438,357,390 *2C6508C1294C14C4DD933E7450C2AD7AC3034E71 LATE-NIGHT-IN-A-WAX-MUSEUM
438,357,391 *2C6AC097958D03019BBB4EDF3B7D4CE4ACC51838 LAURENCEKORTRIGHT
438,357,392 *2C6C4BF17A53081B4E57068708EF80DF233B2614 LAURENCEREMPE
438,357,393 *2C68CEC06E897575E0FB1121221714D032C90D5F LAVEL WALKER
438,357,394 *2C6791E6E6C6FB1E3CAE4EF955A68DEEBCBDAB57 de,ka
438,357,395 *2C6DA6EEE4D41D6F78CDA4854E208932268E2CB5 lenshikles
438,357,396 *2C6DE0ACFDDDCED0318972974BF6170888EE8586 leonard-huggins
438,357,397 *2C62B760CC9724AEB5F29101D4D49F31C55E02B3 LEOPOLDOSZOT
438,357,398 *2C67B1FDB64D0BA346FD2716F8AF1A1DE6A46637 Di"
438,357,399 *2C660A79CA06442E4573B019DB4FE644D3B2A2B8 dialyses
438,357,400 *2C685CA2437CE3378A45C3AC9C02D4AA36D5663D [email protected]
438,357,401 *2C680410E654F98A97364B27787A550AF6C28CA4 [email protected]
438,357,402 *2C689DF3EEEF57065DC9494D90C4DDE09CCA762D de!rv
438,357,403 *2C6D4316CAD786E10BBAEC901B5AF4BB197D3D04 [email protected]
438,357,404 *2C6BE3A0CA8421B7141982E8B517D938F6E8CF8B LIEADER
438,357,405 *2C6E89B6EFD14A033C65B66657F7F20B0E836AD7 detfisen9
438,357,406 *2C644DF76B619268C88D985E9AAA9578B8C6415A DEVONSHANNON
438,357,407 *2C6D1ACC8C038C49900C9425E22291CC4E40568B lindsaystroble
438,357,408 *2C68FC268732E1E9B51BE671C2933663CA39BE9E DEZIMADA7
438,357,409 *2C6DED97A00E82A4197953D64BDE93C67339DA23 [email protected]
438,357,410 *2C66DFBD2FCBEF33DC511461351C54BC900370B9 dfipu
438,357,411 *2C6904B1B6B97621A3B011D829F008A9743B9BAF DMGEBSW2
438,357,412 *2C6A593870DA31C17C70419C324F08EF9B9BC37F LOCRUS7
438,357,413 *2C6ADE0BE789A2CB2B41FCD2F736D7E98BC011C8 DONALDQ2
438,357,414 *2C613C146BA0689B69E0323DFCBB91940DF2D5B0 DONNELLDETTORE
438,357,415 *2C63763DF414F96A40E72CA729C3E9072F510524 dix2h
438,357,416 *2C609C799FC15EEFC992D9F886CDA81AA95F1586 loydrafail
438,357,417 *2C62660713D8FFAE5987414BD9A84FC64B4DEA97 dkpc"
438,357,418 *2C6B37703B979A03B478EEF296C487D60198F088 dnf)_
438,357,419 *2C6ABA114DFFF05777BF4F6922BAF097E8107778 d=#q0
438,357,420 *2C6DB653E6BDC8BF9B5DC8083BCAE3CE04E6D9EE dqmuk
438,357,421 *2C6AC4223C153A1B9F390B868B8258A5093DCE46 MAESEYCK
438,357,422 *2C6719474F171303F6D4406433D5F0E32D4449F8 MAKESEEN4
438,357,423 *2C660AE764C17A7DA9E20C7E234D1D1AADBFF557 DONNIE.HENINGTON
438,357,424 *2C65C4D2A7EB3CA99FF8E8609508EB9449B80811 DONNIE.ONOFRIO
438,357,425 *2C6F4C83EC87181488906507992673219D1D620F mamzerowie
438,357,426 *2C61EB46E65F97D5B2A46A664FED6127D784D170 DURETTY6
438,357,427 *2C60AED501928C4471F8A896374C501EB57E4F28 MARLIN.YUKI
438,357,428 *2C64E401730A6498F46D75ADBEB61067C448B44B MARQUIS.MOLLET
438,357,429 *2C6DB41EB5FB2CF814C60C51484FECDCB598E76F dr%l+
438,357,430 *2C6F4720ACC9BD849CC29D94DF0AFF52DC93F0C4 [email protected]
438,357,431 *2C68EA887003115BBD1CE798E3BFCDF129A26369 DRUNK-MONK-BAR
438,357,432 *2C69E208FBDE8B9AC068836E3A426B365170DB31 D]YF
438,357,433 *2C6BDD7C1B557FD9298CDE0514A9EB049D206B1D dz8g4
438,357,434 *2C62496C6A33A6A1E41F248B0A71D32F6447BCDB E032681
438,357,435 *2C630E782F11DFA35996E1FAD992717A42E3B223 ea=)6
438,357,436 *2C6ED88339A5122BEBE79FFEB0BD789645F690DE EAA5-
438,357,437 *2C62E6E16FDD2EB5A50A4BE0137E69B98B5FD91F duriora7
438,357,438 *2C6C77FE9619A5AD6A920E4F438884AA75F2CE6B Dv1O
438,357,439 *2C6FFEB7754255CA8F2FD7CD049A5E885410646F D&VFV
438,357,440 *2C61059785361B8B709797C358F8D039DC9C0825 EDUARDO.VICTORINE
438,357,441 *2C632B65DD751BA58CFD971CC8C46143044CE46C DYLANKLAN
438,357,442 *2C6B6AFB5EBF09CB8E24CB0E3A3420D86EE1B1D4 EEFMOLEN3
438,357,443 *2C616A32927D0E6FB16012E6624BFEF56A9D67BD eg)8o
438,357,444 *2C611A5A9D3A35B78BB3DAFD93E1B64FFF317999 DŻAJABHUPATINDRAMALLA
438,357,445 *2C6D4BC5347F1D414AF458BD59AA6552DC096B00 ei514
438,357,446 *2C6C0798EE732D5CCA65827339C6D0FDC8254776 EIGDG
438,357,447 *2C63C8E16B06A186096CF366EDDD590A248C712A MICHALE.PYKE
438,357,448 *2C6CA35ABC083679E7B01AB4AFEF0DAE43B84971 EKSTRAKORPUSKULAR
438,357,449 *2C6ECBBEC511E87E961F53A367025FF5F84CD220 elainestamaria
438,357,450 *2C62A10741BB668A25D5481DC8F7F82ADDD53874 EB_TV
438,357,451 *2C66AC4911B8C24BCFFEB82B71744E60CBCB1E39 ecr"q
438,357,452 *2C6E591EBD8451863C2008CFC8FD0A5754BD5B22 eddyzwolensky
438,357,453 *2C6B0C31FFC33753F01C1FB0518C91F5AF0154C4 ELISEO.KORKMAS
438,357,454 *2C6760F4CBBED65CA9FA6E51F7020105F7BE6560 MIRANDA RIES
438,357,455 *2C67B618AB66DD3963509E160A17B039B5991DC6 mirotons5
438,357,456 *2C6E4E2670520EB24E6F7F3DD4F03AAEB6369E51 [email protected]
438,357,457 *2C666C889488563F9C2D6A9E95FA75439BD14573 MODUBSW9
438,357,458 *2C61164964502D0F19372CB218437F45BFDB1B9B EDNM#
438,357,459 *2C6CAECB03CFDCD1689F94D9245C2259231F95C2 EMDN2
438,357,460 *2C6BEF02423205EFE647737E28977DA1CA097CD9 edwinlillig
438,357,461 *2C605F3467E42559512F8EA8C399F6835B3EC48C EMILY.ELLIS
438,357,462 *2C6CA974B35F586C0548EA6864095EB0CC2CE7DC EFSQP
438,357,463 *2C6EA5C9D39BF5AA947AF504BFCB4DB133992186 MOV34
438,357,464 *2C64A71926212F300E50138A56FAACA440C54998 EN=5
438,357,465 *2C651515EA3D3B47DB27248354739D1E2ACC91A9 ENOUGHSELEFANT
438,357,466 *2C61C9344149A5F1C6F8E44B3ED6E0130165ED45 enqueued
438,357,467 *2C68A48CDE662BFBDBD6099FEC9A4317E77B39B0 mz-g
438,357,468 *2C6C44BD166BF7EB7D6DF81B939504ABA7CCD6D5 ELEVEN_11
438,357,469 *2C6019F75644EEBC1C01E7ED42578A1E9656CD60 N4ZC
438,357,470 *2C6DAD8B0C28090C389ED28D11F770151F04D624 ERSTANDENISTDERHEIL'GEGEIST
438,357,471 *2C6B495AF09507FD5EAC48F4FF18D2261B173EF0 ELMARMAG
438,357,472 *2C6079F0FF48F7D6CADFE0CD2386677B699B490D ELPL
438,357,473 *2C6953313DE7CB02A93C5B2CF8F47FE174B564DE ELWOOD.BAVA
438,357,474 *2C62148FEF1585FAFD841E265584BF002CFAF3EF NATHANIAL.SCHEFF
438,357,475 *2C6B004467DD1E48DC37DF3346908954B560070E esquivic
438,357,476 *2C6905203A58C5D39CD2C02492487533FDA64260 EMERY.MACIOLEK
438,357,477 *2C67FF19A283FE4007DB10504D96D6B5B36A0B3B ‘eternal
438,357,478 *2C677625B6E778488F1A1B9B5B5BAB26A8B87105 EMI社
438,357,479 *2C6EE5DA3A035C30FC4820BB36E5F01B9519BD80 euo=-
438,357,480 *2C673B22612A3F72E0AE3BA659129DFC801BF544 nickolascurdy
438,357,481 *2C6D8AA125AD673B584646B9BBABB3CD737455B3 NICKOLAS.GRENSKY
438,357,482 *2C681825D3A5550EF866AB4CED59F74DCB00C325 NICKOLAS.KENNEY
438,357,483 *2C622F91C9DEE88FFA08FC27B14F56CB61524ADF NICOLASMEYERS
438,357,484 *2C6B7228EFDBC408FD84DECDDF4CB4F27661CD50 ent?$
438,357,485 *2C6F55398F50662128C0770AF2D645824621456E NIGELMALENA
438,357,486 *2C6FB94887022D2772ECD104D0A5705A4468DDA5 entámase
438,357,487 *2C60E029BAEE8470979FEDD68AD68CF29641E941 eyls0
438,357,488 *2C6F48F1AA78C1B49CE3231AC17C0C3F3118D508 F167958
438,357,489 *2C63F0AB4A8743268D3432465718D69BDD9802C7 eq;1
438,357,490 *2C667AD75A0417464E7A97BCB826BE0A84906D58 NOEL.STUMME
438,357,491 *2C6B92B8044AF9187218F872768F4CA4DC4B8A79 FARASHIKIN
438,357,492 *2C64614F901C9990178B5EF0F17ADE8A562DE91E NOSREHPCM 5
438,357,493 *2C6CC6EDF0416E544BA728DFEB616B00A52DA4EA N|U[
438,357,494 *2C646E0B89B4BAEAAD87F0BA1B4B9C07D22C5048 (>_<).O~.0~(---3
438,357,495 *2C6F59BB838EBEFABCC168E4F5EC6C28A3CA5FF6 (>-<).o~0~.<--8
438,357,496 *2C61BE2F5B101B247B2A96456BB4DC9046610CF7 fjrl
438,357,497 *2C6810E41240A61BA5BDC39D6D05081D9F9961F9 flip-fone
438,357,498 *2C6D276C635632960FED9AFB931F38CD67B2F3B0 OHMNAVS.MATTADAMS
438,357,499 *2C628BC44A62371B3EA9E82DD8382C6341660338 OKKIMLO5
438,357,500 *2C6D1AC6043F3F2EA5DE7F545988F765C31E9554 omarbehanna
438,357,501 *2C66A9B7DFD68F6B2A523931822A16753ECECBBF fosterrobleto
438,357,502 *2C6170130E2980DC31EA77354947384C50CD1F95 F1233M450N129
438,357,503 *2C65653566A3472753E27CE3626EDDBEBEF188B9 [email protected]$IBI1I+Y
438,357,504 *2C610EF659BA8B98A548578B699C0E0A7FB5C972 FANTASY(KLUBHEADFINGERDUB)
438,357,505 *2C6E76630E561A4F4C0067AF0F9F82C4AB8B6012 OSALLISTUJINA
438,357,506 *2C6D95FC589AFC87F73A3126B19828DD21591C2C OSCAR.DELLARIPA
438,357,507 *2C6DC9F9D02531F99E099100B89DDF71E590F1EF OTHALOMONTE
438,357,508 *2C6218A3BDAC1129CBB357E465D66050F6275C44 frenteapalacio/traposviejos
438,357,509 *2C69A925B71C6DBD2F5FCDC0F55C3A46AC3E6438 FROWIN
438,357,510 *2C610084C388579DF158AC1518650B0DEF310DB2 FERROLH
438,357,511 *2C6D82C2EFDF25AF93A6309E0D3BD713A5D078B5 P#) ` ><
438,357,512 *2C686BF9CF1F20886844EF1B9132A7340DDFB2BB fiestadelpacifico
438,357,513 *2C6308B35274990A208DC9A6CABF186EB2986400 PA7!3NC3$
438,357,514 *2C60FFBACF86DFD5046095916FED1C29A27FB0B1 PÂDIŞÂHUM
438,357,515 *2C64933CBE55E55DAA98FC5D5B0A2E3DA0044906 GANDARAMONTA
438,357,516 *2C674473128E60A48AFA05ABD6CDC5C89B87D62D GANTZ44
438,357,517 *2C6E66D2B09EB47ACE49DB86BF384F335E0CFED2 [email protected]
438,357,518 *2C6D8A53EF57F14977907D9742EC77CA39A35C3B FLORENTINOSALLAS
438,357,519 *2C68A32970C0FF0D6FCF90ADC0DD118BA796C394 FLYDUR
438,357,520 *2C6F841AFA9110C8DCEDDE51FDCC8D116C0A0EF2 PARKER.SADIQ
438,357,521 *2C667DD016377CCC7591E145281338E69797A0FF patamar
438,357,522 *2C60EC6D0EBE06916AA96B2AF79F5F1D407956F8 foodaardvark92
438,357,523 *2C65CDA24D5DBCECFC937B3673FB7C16F75FC4CF FRANK.BOUCHARD
438,357,524 *2C696B09C51A0668AC8E96D31EC7000F8D5D2C32 freddyminassian
438,357,525 *2C67798213E7EA5F6733B47AFA30B2FD87649E09 FREDERIC.AHLM
438,357,526 *2C6B36184EEC5C806162A320E7ABFF7B57066BBA PATTIME6
438,357,527 *2C61C27C57BA9DDC03A824785A9CAC3C1E011A19 GERIONOVIM
438,357,528 *2C69B1D0C87BEFDDE4DCD2CCEBC062B03B0C2ABD freepour23
438,357,529 *2C66A89E5A9DF97F978A1FFFAE742783FCA17744 PEDRO.DENEEN
438,357,530 *2C620F38C9E4143D9609B7C74BA21B2CCA1EBD21 GET-OUT-OF-MY-HEAD-(AK47-MIX)
438,357,531 *2C648C87250E7E439AE4E5F7EEE4B280D2F00ABD GETTHEPARTYSTARTED(FULLVERSION)
438,357,532 *2C69C7CCE79E4165622CA81EDF3B32F69E9DAF1A FRUMENTY
438,357,533 *2C665A37DA1742F58D6E2376378B6228A87B97C1 pensiero
438,357,534 *2C681F155EDC109102EA41E3AD2505B783D9475E [email protected]
438,357,535 *2C6D464E6B3728EA2FEBA532301A610455F63CF8 GJPU
438,357,536 *2C6BCF0D4EF7BD848F0B4D47A07F1E1DE204BFE8 [email protected]#
438,357,537 *2C6B989909EEB04925E21DA873B77357D522CC3E G3N4RD
438,357,538 *2C694A80FA3278131FF25FD5CBE210D4087E9D9C G4X,
438,357,539 *2C6CD3D877D4D904CC2CDB4B9DF206E4CF0DD758 GAIL.COWELL
438,357,540 *2C6A4F08B11A65A45C889B915C1606254586DE01 gqsrsbhubvjz
438,357,541 *2C667E70BAE53A8CBF0E5A556E140C1A814D4F93 GRADYMINTREAS
438,357,542 *2C6EEC2554A8038CF695D03E49E717B85D18FCB7 PINAKWNS
438,357,543 *2C6481CBC07DCF905AB0D7710E1A77DB8DA1DABA GSJDIRZING
438,357,544 *2C6B2F9646E181D5B31F03CA118445A2BBF2B944 [email protected]
438,357,545 *2C60D1B6AE884E83815AED5445F103F7EFE8A5C0 gwencady
438,357,546 *2C62703F7183BA6074ABF34FCE827A43A94D95FF GERARDOBOZZO
438,357,547 *2C6E109A4AEA1708BBD13645A3524B9A78D628E7 pramita-mukherjee
438,357,548 *2C6FDE0D45DED0A56EFA0B6B403595186CB473B2 prashanth.ramnath
438,357,549 *2C6B126FE4E60E918C13B98BF22FE559FB172C12 HARDEENPAUL
438,357,550 *2C6FD16B6A261728272475E05988602D4AFE6E76 predatorsinaction
438,357,551 *2C65AAA620BAABB6DFDF5E2A17E830ECFDB2C1F5 HASCHARLIEFOUNDLOVEIN
438,357,552 *2C6BDEBB0AB449D746FD5E8990EC82AA3EAFC7A6 PRINCE.GILLENWATER
438,357,553 *2C61096EA076674A8C03D040134A2E600B11C4AF gewickel4
438,357,554 *2C68B63AAD56972FA0F03165338345BEAFEE82FD hellbilbo5
438,357,555 *2C65EF98405851B8BCF192FB8A4EFF2924C161D2 GHANAIANSPANISH
438,357,556 *2C69232B4599591448FE53191249B3158DA9E01F herbedgar
438,357,557 *2C6DB69846F43FE52B70ABB23F6D6DFC667082E3 GINO.ZIMMERLY
438,357,558 *2C692209334442E573FA7A09B401DFC853348DAA PUIXREDON
438,357,559 *2C6A6FDBD4A45A00013AA22C8C74A4DC7CED32A1 PURPLEGURLY
438,357,560 *2C659A569358EDEC0FD2D0BB7A3AF4EAD1BB4380 GLLSMOD
438,357,561 *2C605DAD52A28A5343DB4CFDB94E6665A73AA828 hineingeschrieben
438,357,562 *2C6C2C9D11102E18F7C29E28A2672A2EC938D81A Q+3^
438,357,563 *2C66DBC54A6ACAF6CA7279D9DD7FF19F864FA020 GODDAMNROCKSTAR
438,357,564 *2C69FB2A0B6BBF5024ABC2A8C936382E8B5B8703 GÖĞÜSLÜĞÜNÜN
438,357,565 *2C62FFE268032BB60FD2273A1E43FFB2EA01C4B7 golf mike
438,357,566 *2C6D9BF90F60CE67C7AA897030B8E418966E3570 [email protected]
438,357,567 *2C609D35B2790EB069C9BAA8A5929AABA3DD1792 homes-i-dones-del-cap-dret
438,357,568 *2C69EA777E1993CF8CBD3CFA63E3CFF5F1F08FA3 [email protected]
438,357,569 *2C6F0DC914037C802E691761E6E7191CFB32405E [email protected]
438,357,570 *2C633A8E766462D32C9589EE68E7F1A9CDAA3408 [email protected]
438,357,571 *2C6F081683A0404EE4E2C36B9AC54E7B03C1FBE4 [email protected]
438,357,572 *2C6D485B942EDF75220CE99237B0239AE94629A6 q==P~0~o>B0
438,357,573 *2C6C68D52A7F963D8EB9F5615AD1DEA7FB9A4007 quanto.fumo
438,357,574 *2C6BB0043868EF7A373142541A79CAC0D5632A1A graeme-forster
438,357,575 *2C6F833391F05DBBAF2BCEFC2131F8BD7020649E R3M3MB3RAB13
438,357,576 *2C6A444327AE717A4060CF4B71DC52070BEA57CA r3r4di4+ing
438,357,577 *2C61979B9B132C6AA896AC5C997A7047F6E04881 [email protected]
438,357,578 *2C66942299C86F0523E00CC3A97FC5ECEFD99BC9 GREGBAMFORD
438,357,579 *2C60D131DB9918CACDF6815F420119562C0093D7 GREGORYHONNEN
438,357,580 *2C6A548501439E7C8644EB08E406AB16646A8DB3 RALEIGHJOLLIFFE
438,357,581 *2C6B1BE7F6E844C95A6834586984A30020D80348 RALEIGHRACCA
438,357,582 *2C661411F3E5D992E913C65A8BF5CEFD20ECEA6E [email protected]
438,357,583 *2C632ED9E15E6B5433D047826AF0B0A93F7EF2E6 RANDELL.SCHLESSER
438,357,584 *2C65643CC7E6CC5914D1E6E58D1F24581C7DFBDE HUEY.DRUDE
438,357,585 *2C695D5B984AC9C991701C3568F535874CA0E6EA [email protected]
438,357,586 *2C690EDE2E32A07CC946DC736B7FF264F832C319 huh'
438,357,587 *2C668B21270C88361A55B62DEB16008525CB0975 rasmusrae1zmih0s
438,357,588 *2C618011B2EF2829787CB3B1D4647DD9ED871FA0 R-DIE-EES-(FEAT.-JONARAMA)
438,357,589 *2C62582DD2972C895AC47472DB9C69E889A31DEE [email protected]
438,357,590 *2C6388A9D418A2D1DE272731996AA8ED1D0CC028 GUSTAVODIVOLL
438,357,591 *2C6D2C545620D78026B00A6C8730501CF9050A6D RED8 1 0
438,357,592 *2C69B07BE8D32D987BD309AAD88043C064DFB34E REDSKINTOMCATING
438,357,593 *2C67708C8E11F0920F1E27C6C266E7F66C8D9395 reduats1
438,357,594 *2C679D68DC1CEC3872587CF41D03010F2EEAB007 gyniatry8
438,357,595 *2C6E0198921A14B7E445CBBD5B40DE84452C51F0 IAMLAURA32
438,357,596 *2C6F6BA34CC018BFF9A91394602C1FF189A6437F hält
438,357,597 *2C615D6CE2DC7BFFB5F76538EBC1465D9A1F1D79 iekkihsed
438,357,598 *2C6D602DC53F6ACF2B00061BB6FC5FB6934D36B6 ifyo
438,357,599 *2C614FEAD275EC1B106DC55DC51B3CC5890DD18B HANSFATTORE
438,357,600 *2C6C455AE4CFB5CC7C9429C165428C22F9515A75 reulfnoc8
438,357,601 *2C6BFD00D64587BAE4B14DDFF3B64DBC085A6CCB rickeymarkum
438,357,602 *2C6CC73B1426ADDD3268DB7701AFDAC27080BD1D rickieuva
438,357,603 *2C66E0AAECCAAE1F64980DA9F078305EE64EFCA2 rickybattin
438,357,604 *2C68A8E465AF07F366A0A1ECF087F00DCD789F07 ILOVEROB42
438,357,605 *2C6C316FF6D06543971856F38CDFBC0662EB0F98 RILEYASHMEN
438,357,606 *2C623A6C03BACDC504AA9A68ECE0C16A72D6EBE1 iluvunix30
438,357,607 *2C62BB5AD648D539D142605E228C1446A0C0A176 IMPONNE4
438,357,608 *2C632C7E8660674DD71973194197A38FAD0EFD93 ROBERTO-SERRADOR
438,357,609 *2C642FB8E2381D744BF119F2A390109458C169D7 henryservoss
438,357,610 *2C6BC7DBA64334FB3CAF00415EFAAF281755D260 INFANTRYASSOCIATION
438,357,611 *2C605D9AEA275344B50469920454143A138DA045 HE'S.ALRIGHT.(GREG.CASH.NORTH.SHORE.DUB.MIX)
438,357,612 *2C6C3340B659071A6EA966DF1348590017797D11 inveil4
438,357,613 *2C6195FF3FB5289106B40916A3F20D35D04E7051 rometourcoukwww
438,357,614 *2C63410F8586C7383B55B1A255BA2AC7FEEDF3A5 hispanicism3
438,357,615 *2C63997D3961D9AA12AC5D0E85E1830BE065641B isaiaschappelear
438,357,616 *2C60E05152895F4C47071FB026C552ACEB355646 isaiastwiford
438,357,617 *2C622187F5C0B322A4A3C6047FF57D97134C36A4 rosbives4
438,357,618 *2C6344445CE5C8392DE774347537269AA92C051F HOE-ZOU-UT-ZIJN...?-(FEAT.-JOHAN-VLEMMIX)-(HAKK
438,357,619 *2C66E604091DD25CF47F24C1D199AA2E1B5655DA ITALY
438,357,620 *2C608CF3DDA8AC7E0089C224AD9EA138B9C39F7F IVBRUSHES
438,357,621 *2C632E5DEC036B4F104A0F30DC9544BAF1F9C3A3 j=|3
438,357,622 *2C68220A92798D143E48ED6FCA6E9D5A6475634A [email protected]
438,357,623 *2C6B5147994360FE176854D30B12CDA3C8E4AA10 JACQUES.LEARN
438,357,624 *2C6F403187D91F9AC04FDA3BFB9024135C3DA393 RUBEN.WIDEN
438,357,625 *2C6D2B74243C05F17E41D567E4CFA86EC1AEF056 HTTPWWW.THEN.COMTHE
438,357,626 *2C6E8162A5AE37D4D5A8043284DDAF543D8D04C0 jamaalscatton
438,357,627 *2C60DCD58B8E891D145CFB318A5549760052625E HTTPWWW.WHITWORTH.ED
438,357,628 *2C6D756DB4EE16B047B1315772FCB5C2A42BD523 RUDOLPHGALATHE
438,357,629 *2C6608206B95FB1B317E9CF301F255FA7E463038 hugofauteux
438,357,630 *2C6CE8D69637BFF4D9EF8EAA7D4EF0B626A6BEFB RUS+ED
438,357,631 *2C69262D5C76C2D7052E37E1CA509A8535A0AC66 russhink
438,357,632 *2C6D01A554E3E9CCC0C8717F1A4F82D08F0C11A4 HUNVÁR
438,357,633 *2C670FEF7F153546CE2DA546B4FD14B95C60889F [email protected]
438,357,634 *2C6F46C60E2DEAE2C98AD116E8862E05CC6CC7FC hyper$en$1+1v1+1e$
438,357,635 *2C62E5E5858AFCA76D1F389B3DDF1446C17E4997 JARRED.LEAMON
438,357,636 *2C633045C324208CDAC86C0E367F2FA27EAD6F4D SAINT.GERMAIN.DES.BOIS
438,357,637 *2C6EECA9DB71716179CDA55F1F981D4B16D63F57 [email protected]
438,357,638 *2C61172E02D7AC144A9413C72FAEC974DF5319FC salt_glaze.s/O/lt_gl/eI/z
438,357,639 *2C6667242B86D3F89BFB5E3A96616F26313E5717 samhibbard
438,357,640 *2C6B2D725743A63ED2677EB511DDD3EDA41DEF03 IIZR
438,357,641 *2C610D9BA9C8776B7144676884EE67483EF35117 IKTEYIDOS5
438,357,642 *2C66492BA82871DBBDB2E6A40BACCB7E11A49279 SANDY.AU
438,357,643 *2C612BED54E29AE65B291CA5E60A4BAF9F97BD14 SANG.ALLATEEF
438,357,644 *2C6CA951A0AC9204070093CC9F643BC2BA7CD02B sangbalay
438,357,645 *2C67795A3ACB6A243EADD4522DB5DFFCBFADCD62 JEFFEREY.DEGENHARDT
438,357,646 *2C6693C1EFF824DF390883AF8A5AD5EAD1273EF4 SARA-HUNTLEY
438,357,647 *2C6FDC3EF0CDEC3FA0FED85E15AC699CD2F7662A JEROME BROWNLEE
438,357,648 *2C639669428934B1D4FDB1F4F48524490E84D0F8 satellitious4
438,357,649 *2C67499CE8E2BA6592889560469A3EE9B173B4BD SAULBURGMAN
438,357,650 *2C6B986E0CF417370E6473056213931766D62D04 imy{
438,357,651 *2C6D7A0A96DC7A17E04A8F57076C1936C3D3E080 SCHARFSICHTIG6
438,357,652 *2C621A3F096D4AF17B0E9446DADB175C9831A445 [email protected]
438,357,653 *2C6AB0C38E2B94DF136A6936B3E01C1CF917A11C JESUSJOLINA
438,357,654 *2C619C133D3828C8319507157209D8B0F220EA79 school'sout
438,357,655 *2C63880406D7B524CDB7ED2DF6C9779F1E615AEE scottiebustard
438,357,656 *2C6F3D8FBEEFC3D311D59D1CF2AEB145B6F8884C SCUFFED
438,357,657 *2C6089A120EE05D50DF3631682A5D8E4A0E61D10 INKAUERN9
438,357,658 *2C6401AD8B5A8A6208B619D7230F89F63FB5F7CC innovasj5
438,357,659 *2C6836C672E1FFB3FFF4B0E555D626D98CC31E8E sehpargorgyhomrehtorab
438,357,660 *2C6FB2794F0F37EF217CD244DDA4CDAABEFA2A1B joelmontesdeoca
438,357,661 *2C6CA980597F1CADE6010B45FAE61648DF45725B JOESPHFARNER
438,357,662 *2C6F995100A46A91024F80047FE9DB9C2A520F8A JOEYKEISKER
438,357,663 *2C66B39EE990C70108B008219ADACE35CBDB5508 IPAPIZA
438,357,664 *2C6C44C27D66D7ED16D8F578D7936BC2ED877638 iqvdnpqs
438,357,665 *2C69D64A2F011E70F78BC90324B4F268CAD2A9E2 IRIGATNO5
438,357,666 *2C681EC4B9C2EEC95F7B2E28F0D04E4C006FB170 SESORYXOR
438,357,667 *2C6FA7EF393C13BEF5AF5659F1028903DBFA2935 SEUQOLIRTNEV
438,357,668 *2C6EF56CEDECC6B9DA8158553A1786A75352ED3E ITITSUO
438,357,669 *2C6BF4B2801FCAE2B19606E346851165821661EA JORGEMAI
438,357,670 *2C61226E919CC5D1B3F8A297A1E233F117171ABD josemarisanpedro
438,357,671 *2C65D734585B3E2EE45A79AC411173910AA42795 SHANEPASS123
438,357,672 *2C67A6F05B26B685A15833BEE3813F6273FCF4AE JOSHCGJ0
438,357,673 *2C65DD5C41A19C77420E0D4909F78AFDEDA5F576 IWATEKAR6
438,357,674 *2C60074F0AEDCE189E792C0E2449E8D9F3E5DFAA j'passe.partout
438,357,675 *2C6B9A13C67F826A3419D7D89E84BF9919182503 sharondabradley
438,357,676 *2C6BBAAEF8F37A000F99962859E84E5E56085568 SHEBAPANDORA
438,357,677 *2C6F0F4561145A3ED4F55672B948A9DB29E3685E shelbydezell
438,357,678 *2C6228CD5133108A05D175DCD78EAAF0AE807BD4 jaebenns
438,357,679 *2C61D19CA6F9957EBEF525E36C0835A391BA3A8C JAKEDERUSHA
438,357,680 *2C6BA8A0D3791723D6DDB117391B90E85BE90E8C K4DMONIT3
438,357,681 *2C603FB2A79A37DB29958CF5E0C86DC4D61CB815 k4k$70cr4ce$
438,357,682 *2C6236EDA1C6F606A9DAA1F78A9C8867D594A929 jamesuddreth
438,357,683 *2C6808E660F9076B55E00A84C2DFDC465CD4A6F6 KATAMEIED
438,357,684 *2C6F1CE73ED5E59A6E912FE5D238C30D659A3D15 KATEAPPLER
438,357,685 *2C6EE2991998E4790F849B66D0B883F5470F3C82 KELLEY.ROBE
438,357,686 *2C6C8AEB096151F88D430BAE3A486EE3857F4103 KELLY.WELCOME
438,357,687 *2C676D4B822559D3C6343F06C6F7C3A841C83CA8 janakibai
438,357,688 *2C61A4059AFAE3F85DC357E26A2AD80012AB8CCB SHOWGERANIUM1
438,357,689 *2C69912A923FAA0CDD675EB7DE689786263B08E6 SHUUISIN5
438,357,690 *2C6CF278A68D1035905C8DC963285DB5CDB15A83 kerrie-teel
438,357,691 *2C6D38524845D90A59BEA8D38316D1E9F1DBF885 jantes
438,357,692 *2C652E9E6D6482B63254BDB18984B8A701127A69 JARROD.LEISTIKO
438,357,693 *2C60499F11A28AAC97906B8656DE2B8AD4EFA059 JASON DAFFERN
438,357,694 *2C624E7BF1829ED376A25F4960CEE8515EB193D0 KIARA101711
438,357,695 *2C6AF8790B58ED3615F2F4538A062D959947FFBD SILVER-SPOONFED
438,357,696 *2C6C898338C7ECE40AE899211A9B1CDEF3AE3A3B SINAMHARB5
438,357,697 *2C6C0922837714D90813A5C839482EB58002A666 KIRBY.VERONA
438,357,698 *2C656BF887595D5115FAE6F8FBC32AB921B1E184 KIRKESSMAN
438,357,699 *2C6629C239C2F53E9BFCDD032EDE8245C288F7B9 jedlambeth
438,357,700 *2C62442511176178BB5639C2E4E3B86F0E73C295 %!K"+K,
438,357,701 *2C66E987B7679C6C5F3EF7D5105FDA00682EDF33 SKUDDEM
438,357,702 *2C62366CE2342961B1984CEC990EDDD31B77B11C SLENDERINGS
438,357,703 *2C62243499B92BF81EE7357E21002C0C9B86D558 KOMBUCHA-RESEARCHCOMWWW
438,357,704 *2C6DF94423B833C53E2375B4DCD5076E244A606B jeramybirdette
438,357,705 *2C64714728F3F9680D81F441417CFF0E7806DC29 jeregaymon
438,357,706 *2C6710CD071DB5C6CACD8855022C78AC3178D908 JEREMY.GOLDEN
438,357,707 *2C65DC86220C3E3A5079507DB5A68EB29DBB912D KREISLERIANA,-OP.-16:-VIVACE-E-SCHERZANDO
438,357,708 *2C6201591EA544B4CA377CA592CA023FD341BD9C jessaebonia
438,357,709 *2C6BFCD4733A3776E602082D239ACBB5A545A001 ktzo
438,357,710 *2C6104A95BE1BD99F86959328BE58A7C67419D95 KVINHOMO
438,357,711 *2C64CC6D25D11621B1F778FBBA35C5E939DE4732 KWICZALNIA
438,357,712 *2C667E5B7BF3B128872045983B86DC56D4459ECD kwy6
438,357,713 *2C6C106BD426EA7995F7A8247F6DAD9A5C2CD3D4 SOMETLOVER
438,357,714 *2C66411A97F65698CE860B4067A520E2E1CFBFA4 [email protected]
438,357,715 *2C6EA3A46297DEF603E850AB502FAEB2FB8A46FD [email protected]
438,357,716 *2C63117C6D4CFC560C779D99CD6EE940168F7495 landomraade0
438,357,717 *2C6326332E7CB559292965E8561BA9D2BBE4D0D6 JNJW
438,357,718 *2C63F1D8AC43285048C0A87E42352867F67C613F JODIEETCHELLS
438,357,719 *2C69A94BE452F85646D2BA8F031D2EBCF0E06CB2 SPANKYWALLIED
438,357,720 *2C66DDCD7DF710D711140163697DF529B822B3C8 JOE.CARINO
438,357,721 *2C64BD88FB23869C278BD65A95151BE2155E20F6 SPINALCOIN
438,357,722 *2C6893131BFBA21A546E7E5ED8B019DD5561C8F0 SPINALCORDS
438,357,723 *2C66297AAFAAF1C9BDB1CEE56681B324E052B470 SPLOIT 0~ @==P
438,357,724 *2C6F6A02CB3060330B37A762E091804380585DED [email protected]
438,357,725 *2C697FC52F969303EEA6308DCB69EA20E6E61D1A SPREMIAMOED
438,357,726 *2C65D5A2F86584F57913654E22836743D1D2AEB3 squeakybedsprings
438,357,727 *2C6B319994FC08C30C7A384651A32E32D4E39848 srebnyizer
438,357,728 *2C6682EA55F02FBE29855BC8B5C34A3D0FD2C71E LEITDRÄHTE
438,357,729 *2C69B580977DA5B88FF720B5DFE56E9E95841B77 JOSPEH.RUDEN
438,357,730 *2C6975FEAEABC39E31E448965631C6F087D24598 LENARDSTEIFLE
438,357,731 *2C6A24678B26A7C34DACB71DC7593308793FA141 JTEAUTO8
438,357,732 *2C6B86BBB6296D7852945A8622E4E650E8D54551 JULIEGAUTREAU
438,357,733 *2C64DBE61D96DB5C95535078A7448063653A364B JULIOCESARACERO
438,357,734 *2C6891288883381CC64893355BAF33AEDA8061D6 lew.is
438,357,735 *2C6B732290CD50507324EF00982AEBCDCB2E5256 liang
438,357,736 *2C6B831149FECEFE2D87AC813E9B6F6C97735F14 [email protected]
438,357,737 *2C6D89CC2276EDB18FE45E0586E79685887A660E [email protected]
438,357,738 *2C6F16B5B9BF84530FBFF3D649D4CB6851CF1567 STONERESTI8
438,357,739 *2C685CD84E03AAC8BC7C169D96CCF8981DAC47EC kaemaerryin
438,357,740 *2C61974DDFEEEC4714518614A663582B941D50EE KARBOKSILAZIN
438,357,741 *2C679B26E08929A17E6DCA53E415AFDC90DF8A42 [email protected]
438,357,742 *2C664697DA7BDED5E5F70A403B07F911AE1C38D8 [email protected]
438,357,743 *2C60FF7F345824168A97BC1A2E503A59144D4F0E liv"
438,357,744 *2C6B05DF89DFDF814647F0B64FEC8A068CD3AA8D SUBSTADDDESC1MARYMO
438,357,745 *2C6A7EF2FC6AAEC920F5941932CEF2764403904F longbeenel
438,357,746 *2C64DB94168B3486094DEA935E8CB0CE58C8DDDA LONNYHETER
438,357,747 *2C6E6B80ABE1C630BEA35DE523F40D27CEE4DE09 KBAS
438,357,748 *2C659B165CFBD5BCE0FFF86BFAA5052F2F08D0E3 lorenzocorscadden
438,357,749 *2C6F6416DDEBE1760BF68E224E9BAE64D3051E7E LOUIS.FEINDT
438,357,750 *2C606B60A6531CFDA6AD23AFD67FFB04D0516711 [email protected]
438,357,751 *2C6EE18C67ECDC1638103F7CE18277731C6BEB29 supplytattoocomwww
438,357,752 *2C67E1B2661029E1F11F7405FAC579C54BC96BEC kennyfuda
438,357,753 *2C641D64F0F9393872305CA09111469BBE51C32A [email protected]
438,357,754 *2C6F5BFB18EAE9BE3CAF88D4D8479CAD307EC054 [email protected]
438,357,755 *2C67B134E143242C899E5C34EE3D67E9E2869AA3 [email protected]
438,357,756 *2C6848F8D354D412753BE0587012E9B4B5DC1531 sweetsscotty
438,357,757 *2C61B589AE36A7B2407CFD5198451B16D71F167B LUIS.ENRIQUE.DE.BORBON-CONDE
438,357,758 *2C611DE248389A5AA73C03B3660D7072E01CD86C [email protected]
438,357,759 *2C6A7EF6367DE4E5096D6BF76F33BFFD96A3CD5D KEVINFTWS
438,357,760 *2C6F439BF7AADBD5495760FCB5DEB0D69FF24C8D