List database


# MySQL hash MySQL password
438,340,001 *2C62A98C3AF261CEEF8882B1927558BCAED00A26 TZFHGKETHNLS
438,340,002 *2C61E0505698F91B2E8F9E315C148E2F189472F3 MILITANT AGNOSTIC
438,340,003 *2C65AD9F0070F42F1CA4F7FE57E8841B1410C2B1 U9509340
438,340,004 *2C6AC31AE38863A0C5680570FDD3A464D53701BB AOS%A
438,340,005 *2C6C2BF725AB783B26F03ED9FC9E7B78EEE48D32 minneapolissheridanneighborhood
438,340,006 *2C61A22EDF561B789E6A83A5DBFA83643210A352 umdrehe
438,340,007 *2C6EC9D732FE3C3F4F6786383E88E9547CF240B6 APPROVE6
438,340,008 *2C61D55179E18A0689D1840246C7D42732C64750 a+q)c
438,340,009 *2C65F75850928F7BA61CC7762542A75B426F0678 undevoted!
438,340,010 *2C6E137C565F44508BB8ED8664A43AEB50F8DC56 unquestioningness9
438,340,011 *2C6B27B783748C200E87A5676B09FD6CF2ED79B7 UNRELIABLEING
438,340,012 *2C69D83F225004EF8F5F4A198D59D4158E4818CB Monkey.Two
438,340,013 *2C6F7ACA10160CBF7E99F98F94E86F04846ADC7A more-boogie-woogie-blues
438,340,014 *2C6129BFF1B04F122BFA8B5E80BD6A5ECA2F3494 UOW.
438,340,015 *2C6E821391F459656B0D39D27D601FF99B7D2881 9NEZAMJERANJU
438,340,016 *2C6B71753D223F19766A3BBA4402814637FE2951 ARTURORENOUF
438,340,017 *2C6884C445ABEF6434149685E7E1F301E7B58FB8 USEMEMMOVEBSW7
438,340,018 *2C66D8E43F743C9B2521FD36252BDD9A23B48CEA 9PINGLIEZ
438,340,019 *2C63DF04880D4382E10A0F7B437AABABFE9C7DAE VADOODAV4
438,340,020 *2C6C2CF42959895D3600BFFB3284D6F5E1515B6C a2kt
438,340,021 *2C6051742ABAFCCB59C285733686C5B1C008A91A ATRIBUIDA4
438,340,022 *2C6C0341B076CB10557B14E63A336B4296974AC8 VANNOED
438,340,023 *2C6544F3791767076D4C9CE017237C7B6052C707 MYKINDOFTOWN
438,340,024 *2C6520044473B9B7393FED1EA7E056C64BF9C954 A3DE
438,340,025 *2C6D250E36D1ED39AAB71FDB9B710A137E1A6A66 vaticanitaly
438,340,026 *2C600FF1E0306DE0908C2ABD91DC3E396FD5E5EA australiankelpie89
438,340,027 *2C6AF70D61B501A7E5397983FF9AA2D1F27AE7B9 A7PP
438,340,028 *2C6FA8D25E0FB74FD23F4F12213396B72F6CF532 a9;1
438,340,029 *2C68A42FFD729182C9A0532E4BDF5E736F92848B ax6o,
438,340,030 *2C608AE674F9BB61FDB3E5DC0730F8AD32B20D19 VIININS{ILYTYSTILAA
438,340,031 *2C61D039928602CDD32365BE827A75056C9C2AAF azoxynap5
438,340,032 *2C64EA47731D232E9AB69E7C8959553BFB21566F NDOYHENARD
438,340,033 *2C6A5B15165D3705013FF9586CADE7F5B50B046E azw/!
438,340,034 *2C6B513B84855EBD7087BCCCB9DDBA7D04FEB220 vincyosborn
438,340,035 *2C6BB0B793A2DEDC1E0CB208C21C5AB373EB5DDB b;4o"
438,340,036 *2C6D5B9DA9256FB1C4934DCA6D69B4047B6C90A3 ABEL.FEDE
438,340,037 *2C61EF44D5F7DC3489031618B27FB0AC02B15567 BAB2D
438,340,038 *2C6570503C2F2B537534D4A6938FD6631C6DFC7D [email protected]
438,340,039 *2C6B20CA6ACB5E54770C26C8C7D2890225B9A167 VORDEFINIERE3
438,340,040 *2C667616EDAAA1AC6600B9F360A3386AF42B7669 VP6DI0
438,340,041 *2C697B4EED30804AF45DEFCC3FAC2F600515079C NICHOLAS_D._WOLFWOOD
438,340,042 *2C6CEADEA8964AEDB34F00CC78795119B4BF856B VRHACKYING
438,340,043 *2C677AC26E7C5629A6CA1EB6192600F27FF67E38 abridgern0
438,340,044 *2C65DDD7FB3FA23A501FD52DE4A15B63BCAAD491 VUOTISNAEYTTELY2
438,340,045 *2C659AB4C5A6527ECC7A7F6612A57D3C917394D5 NIGELBEAUMAN
438,340,046 *2C69B96C731086077BB6CD3708940DC0615D37A7 vxnxctr
438,340,047 *2C69796491B0544D58D4C038778978758CEE34B0 WALLY.STINE
438,340,048 *2C6BA739D8F539DE45BA27EDC7C49033E8A4E872 ACMY
438,340,049 *2C6E7BE582E93BFDC4BB6425109048B95F01B518 a completely new weapon
438,340,050 *2C60FD51925467A9D8F3D0709CACCCA07977AA7F [email protected]
438,340,051 *2C64317E899FE187E1A870515C8004D017A9147A acti,scene2:deinembruderbotichmichzummann
438,340,052 *2C6A7D20DE58974C03789F4CF707E5F83EEF9D48 WANKIE-HAMILTON
438,340,053 *2C62C2FD5BD4015F529C49B028A797E0436824E7 [email protected]
438,340,054 *2C6391C3D73AF399E46EE066E06D5DD4CAF04EA1 noncoll4p51bl3
438,340,055 *2C68884346E5B35A7B590A9D1CF4DA290E3D220E bd6d%
438,340,056 *2C64512ABA734DFC5BAC0695E13E94EC58BA72D0 adankokesh
438,340,057 *2C68D2E791A04F3247438E37A7B82A63E7DE94DF Nothing.To.Declare
438,340,058 *2C6B58664710225E16940E890294BAAEB0EDB607 B#####D.*.*.SPLOIT
438,340,059 *2C690F1CE128BC99AB821ADE1AAEFBF9E62706F0 wava.hopins
438,340,060 *2C69F074110E8799CBBD524FB787BFA63EFD5442 NOWLLWON8
438,340,061 *2C64FCB54E4E217FE3996771E09A094021389E49 ADER1
438,340,062 *2C6A14D7234EA9A625236F0FB04332D0FFA8AF29 A.DI
438,340,063 *2C6D600C7DADD607029C24BEF633BBC221F29A85 NXMOI
438,340,064 *2C6822D7B21ABBB19A2595BF794D43F29609AA8D a,dud
438,340,065 *2C6CF83D936B7490F39AE61E12DA7736FB84DF7A AE2V3
438,340,066 *2C62A196589FE75317EFF47155223F6A880C7B85 aeiu&
438,340,067 *2C6F71D8C781CA88C6835FFB58E8F0FDDEB6CBDF O->-<~`~`@======8
438,340,068 *2C65290A2BB552A6742A1DD148FC4A1AA9E9BB5B [email protected]
438,340,069 *2C687C61A4DB06FD580C25ECA228E16438A59CC5 obsługi
438,340,070 *2C6A2B6B34928C30E1B1C861F126F23299F28991 O$"D
438,340,071 *2C6BD3925221E31C6F7CAC7C17BB7791C9953B1B odessaeduwww
438,340,072 *2C6253B7CDC236A078BB14E2D37F131C5689AFA9 odorigatta
438,340,073 *2C608FF4266F38D892CFDE9FEB1E969499297614 bfe3l
438,340,074 *2C6158612E7AA2C547E9BBAE87F7C5740E40965A BFIJAKE0
438,340,075 *2C6B7194C872C8A70873EA224C8535864274F131 whats that you say schweinehund? verdammter esel? heil hitler
438,340,076 *2C69DF152D306FA1E641C1A7FF4A52C13C4EAF87 what-we-have-to-have
438,340,077 *2C64228598ADBA967E90DA1552F1495E6F2A934E BFPZH
438,340,078 *2C6FF51D3F1D49FDDE459FCEEC0E48E35A24D357 ahmygoddesstvoriginalsoundtrack1
438,340,079 *2C6CD64CF2C359C4A436E5EB9A4FDA6E70FF81D3 AIFGL
438,340,080 *2C66413098594E7285AC5CD0597226AAABBBD629 }o{[email protected]=====p
438,340,081 *2C69B58B8356C8A3D6684B1D96E2C099BD323A0D AL?+
438,340,082 *2C60E70CAA6D04FA8C2E03B9F4D8E82887B20E9C OSCARFRAILEY
438,340,083 *2C62E84B9809BB8CFEF19A3F93A662EB27B3FC84 WINSTON.BASKIND
438,340,084 *2C66FACF1F4389EF900182D2A0FFC0B4EEE346C0 wistit2
438,340,085 *2C67F6F498C59676979CF69A084C529F3D2DF041 WMJFBB
438,340,086 *2C6B6BF6E0F233E73CAB541290295138D6BA5EE4 wmschue
438,340,087 *2C6AC6F15EAC40B014536A4883DF0D5DDD356A8E [email protected]
438,340,088 *2C6B30F51B66E0EC465FF84CEC8D98433B094B20 OUTWAVED4
438,340,089 *2C607437D80884220B3DCE776231CD609826D1FA BLAQG
438,340,090 *2C6457F230B4AEBEC6326EBEB165EA53606AC8EA overmagnification8
438,340,091 *2C667F3DF913CCBBB4F694FE77FA53B468028FDE WPANOTADMINSHIP_IS_N
438,340,092 *2C65E0EFDCEEA008C0F7B61DB6DBF41A0C83A8C7 BLS!O
438,340,093 *2C6326F3B765376EA244C7A5253C85973D552237 bm;:
438,340,094 *2C60751CAC54EFA054B8B48218CA856E60569D0C [email protected]
438,340,095 *2C65FF1A95755155FCF565FB5E560C44CFA499F2 p0ly9r4ph$
438,340,096 *2C6F84C9AB987BDAE1445E1E01AA923E9E063768 bm)d;
438,340,097 *2C6FF4E9AF8593D5E7C4C185C803C959CB59418A BMS$
438,340,098 *2C65BE005C41671E8C4346332176141CC8A4A30E alodnerp0
438,340,099 *2C6098A50F8ED6267830834CB86CC3CD42CA4D05 PALESA-PHAKOE
438,340,100 *2C6FE6B387A7C78AA5D8D663A77E7058BFFC72AD BOB.MC.GEE
438,340,101 *2C6ED2C89FEFFD8DF17B62E81E147BE485B40515 bo-dacious
438,340,102 *2C6AD697F9AB1459173744F59382528DB9E0F868 alt-ahrweiler
438,340,103 *2C675A93A384E922BDE8250C98ACBC4A957F615C WYATTDOUTY
438,340,104 *2C67DD2FB3F58E0BE284CAAA3774A025DA757678 PART-III:-29.-I-WOULD-KNOW-MY-SHADOW-MY-SHADOW-AND-MY-LIGHT
438,340,105 *2C6A8B5832B2249EA9ABAB85241935241A0D232A b!-oj
438,340,106 *2C6B4E36D88B3D7C5C5AC9DDCA70A9CB7020BAA8 pasqualehoggatt
438,340,107 *2C6C68DACB53D680E12F82C202AC8D2EF1B9691A amanwithmoney
438,340,108 *2C6325E85186B478E8EC1598FF01450063C3AA5D PATRICKFREYNEISTRYINGTOSTAYTHESAME
438,340,109 *2C6ABBDEFC9A0C8CBC70128AF1E280CA44176840 amy1umce
438,340,110 *2C6EFDA3C40B9DC5998D2D13FE1FB6BF6A89DEF3 BP~0~o.o><
438,340,111 *2C63C68FF25186135E32F122E181F2F816FF4CBA a_nck
438,340,112 *2C62B94D16BCD32EC6DA91486C518AB4AC25F00D pegasusonchurchcomwww
438,340,113 *2C66B24C97CA130606491A1CF9BAF87DBD431534 b!pyp
438,340,114 *2C68B2407754F6A7FAC4620C504C0148D5439286 bradwohlfarth
438,340,115 *2C65E1758BFEE3AA827A66C48B2D57EA0E3B080E )X(*-*Q==B
438,340,116 *2C6E81CE79552771BE05EFF8329D6C184BAD05ED ANEINANDERREIHEN
438,340,117 *2C6776791C9F0A30BAC4EA6F99281A83CD412421 xud<
438,340,118 *2C6D36E7048FD779BDDF6D791C64E308FB5BE737 [email protected]
438,340,119 *2C6CFF4E1237D3EF1930EE3CF8CE2E73C4AA4EA7 peter.arnoldsson
438,340,120 *2C6BC64A89A65324B73F926843D9EB643F12D704 ANGELICAHO
438,340,121 *2C6A2FFB42D5FEBF7057190934ACD9860EA3BA95 brian-palm
438,340,122 *2C6578AB6D308C0A902F749B2FB0E36F31B26AFA phyciode2
438,340,123 *2C673D9143E7E81837045D7122E4339586173121 PIDGEONS
438,340,124 *2C67401742BDED9C820DE78B61B5E570CBB16CB6 ANTHONYLAURIO
438,340,125 *2C666A2B5ED57F2540617F553C4D1EE5BA1B28FD brunieria
438,340,126 *2C6DCABE2361EC668CF42A8FC0F5F502DF8862E3 poklesm4
438,340,127 *2C6AFC372B3C1F3B726D1AE60FE51BEC0A301073 anwterh4
438,340,128 *2C672B7EC367CF6848FC94A9BE28DAEE339E5109 B>.~.`.Splat!!
438,340,129 *2C6CA764D64A73243FD7127131793E8275D4A634 buafl
438,340,130 *2C620F8D299A6A8455CC0984A958F8B334301EF6 BUR+V
438,340,131 *2C61DBCFE6A5A162410E3D7441A722FC26A43A25 PRECIPITANCY6
438,340,132 *2C64DD4304AB7112FF7257B93F29E03112B2860E bv-
438,340,133 *2C69EAF191CE685AC2DB0CB4FFBA9BEC679865F6 YRITTKIN7
438,340,134 *2C616F32C339E31D79A2B78F1381B877668426CF [email protected]
438,340,135 *2C639D3A8546B81AF64B8F2223943EFCC3E6597A ARAHURA6
438,340,136 *2C65EFC093ADCA091DBB81E8302B00760E7376CA YVETTEAPARICIOGOMEZ
438,340,137 *2C6F129ED2E128642CD60ECCC9EED2A8438F0AC3 arliebeetz
438,340,138 *2C6534E1CF6A6974B12DB83341A128123D7889A1 bwo_
438,340,139 *2C60CE55A121C70280AF1C0642DCFA04B937170B ZACHARY BASANESE
438,340,140 *2C659F83A4B987F48E24D9E299FA5561FC5D9BDB arnulfosarne
438,340,141 *2C69E30D9BA0200EFF10DC089462C6DCF22388E3 profilautomatik?
438,340,142 *2C6E6C9BA1F2CADE1350429E9EFB323B36D8CE33 AR#RU
438,340,143 *2C621E47352962F6B3F0ACD7CBD71F0301000EC6 c0ncelebr4710n
438,340,144 *2C62FAEE3A9502362B135B6E160DE683D39EF4FE as9vd
438,340,145 *2C64B65A9DB087DD670F5D31ACF733E2FC27E18A C2rY
438,340,146 *2C62D23AD8B128BF01D06E416773EC20B48E26B2 ashleylentz
438,340,147 *2C64174C5956F50BB468B708EFB60309C2FE1E89 a.sip.of.wine.chased.with.cyanide
438,340,148 *2C682BCF2E606143A62AE457753B6787AA689231 [email protected]
438,340,149 *2C6039899E15CEF0292D4E8872813F3D033DCDE0 C4pj
438,340,150 *2C6C4CBFA69030C640CAA492616E518011C68E82 c7(9r
438,340,151 *2C60A309BCAB9E78916D5834B2266D058D850CC7 ASUTTAMA4
438,340,152 *2C684F716CF6DC83D9EB02AA7893AF9DE18FFB8C [email protected]
438,340,153 *2C6FB91038865D68766780CCF7D116ABE53B4739 Q181709
438,340,154 *2C6204CFC194D2CDFA10CF08876926A50C4F002C asy)k
438,340,155 *2C61974EB5CC26D5373D2E1D3DEA650A31100F72 [email protected]
438,340,156 *2C6FB1F87F9B12B04452ECEA5702837271D8DF9D ATB3H
438,340,157 *2C65E85473C4602A029273E53E018554DBF02BC0 CAMILLA.HENANGER
438,340,158 *2C6855186FAD1B03349FC01700779F4A1F480F50 campassero
438,340,159 *2C66F3B0F32D11DE40BB5520C944C7E21AEAABC5 c(a-n
438,340,160 *2C67F391BDBC71CEA2DB4FBD5C6F808F097830A2 CANINE225
438,340,161 *2C6C1A29F1366FC375D0CF6B128E1FCF90DD7E5D ATNAFH
438,340,162 *2C6CC1D5CECBB8232CD76744A6D5933C07BEE165 [email protected]
438,340,163 *2C6F79B2657B6AA5CBAD82DF23C061A36F70A531 ATUK4
438,340,164 *2C660F44C1CD07140CE5B27EBD75D012197448B9 [email protected]
438,340,165 *2C625802B1FC50E8A70A13757A30FC1E99DE644D cardenas-tabasco
438,340,166 *2C6F14EB99B520F9577D09BA203EC3F0CDFC2D0A auhd7
438,340,167 *2C6E5152F91E12FEA931EEC0012EF5443CB51B1E quicksilver-(1)
438,340,168 *2C61E2E88409E558D68B5288645DF62B51D3B409 БУ́КАВ
438,340,169 *2C6B3BFFCB9F34948C273435E96ED0A40B4D8C8D CASSANDRA BENTON
438,340,170 *2C62820E4881C26F7656B351477D2CF74814A821 AXAGE
438,340,171 *2C691CA7436C75CDED25B536079237FB4CDC4490 RACHELHARDIE
438,340,172 *2C6DB707985104906AA4928A53C57098A3299619 radiobuilding
438,340,173 *2C6F49F4A0837E12FBE9FDBB667E899A20A6F420 AZAMPIERI
438,340,174 *2C69AEBDC95DB2ED5A07BDA3EDEED991114CCB14 RAFAELLETTSOME
438,340,175 *2C6040412A643C3C10CBB1D3F6C7813CF33B861E CBAYOLIMA
438,340,176 *2C6A8F90BFBBAEFC7879BC61A4457C9833BBE0E1 C%bb
438,340,177 *2C69D518CEDF6499071398E7C805EBF5752FD8C1 >-< * *@==b
438,340,178 *2C602A4B679F55F7974968CA8D043DF21D3BA0FA CCKY
438,340,179 *2C6BFA18069F9B16813B858B04204DF69D75FBA4 ce5%$
438,340,180 *2C675F909BC7223E6A34291DDB2CE092EF4C74EF CEJ8H
438,340,181 *2C62F1BB2837F4E40F6B69B844EECE2885BEC38A RAYHAZY
438,340,182 *2C6FCC58A8876D07D466C53C0EB5600755F7DC1F b;_9h
438,340,183 *2C62512C4457559F1B9538E92FD72826DDDAEEA1 國家統計局長:ALMA
438,340,184 *2C6E6BF7957AC22B276633838C0E7FE14F40D08D b_a8h
438,340,185 *2C600C2A75370E7CA41652B008D245604B1A52E6 balw
438,340,186 *2C6634ECB825B744F7B717569397685889373582 banzcow
438,340,187 *2C6D8F6431AB31D631CE4DB9308CB1C2EA573A1F barkoitzeko
438,340,188 *2C6D0B70CB0E0E2E0B8F44DD1A3F63D5602486AF CHARÓNU
438,340,189 *2C6E3FB3CE68253BE224355F190852B6E534F463 REIDPRUTZMAN
438,340,190 *2C6870F402741A4E98CBF58727AFF2B3B15837B2 renaldowerber
438,340,191 *2C6ECEB6725A557436DCBDB9A9C17F4AEE16D584 B;BN
438,340,192 *2C6BB56179E173EEEC7FDDCBDC4AB6F0CF6C212B bb-w
438,340,193 *2C6DBAD1E617C88777F5EC2569B3046EAE7F37B2 CHIANKAKIM
438,340,194 *2C606F641977ECCCB70FD347B229E65CFCE23112 REVINDICATIONES
438,340,195 *2C6537CC4964A738F22AF897208023EF9CFF78F7 CHRISORRRA
438,340,196 *2C6E7EE43CE17DB39609ADDE69E321B2C56A40AB RICHARD-BALMER
438,340,197 *2C621FD1D7F360E957CD4ABB351B500C0564735A CHRISTOPHER.FECTEAU
438,340,198 *2C6E2B1C59FC6181AA1CD4929BC286BC30E0EE5B RICKEY.BRONZO
438,340,199 *2C688F9C4B53E77A33E7C9DE8375A19B8CA927B0 chuong4545
438,340,200 *2C6E2925496CE68E4688D6298700AD2656EE4056 [email protected]
438,340,201 *2C65F064EDDA407FEC18AB354C3F2C21E470138B 0[
438,340,202 *2C6173506F2851E969564209219753C5E5A9FCCC ciagaty1
438,340,203 *2C66380A768ECC3492D9CF67C51ADF6877A768B0 BENTON.LECHLITER
438,340,204 *2C6C5B61BFF61A32CA6E194832DDCDF5E64AF55A CINONACA
438,340,205 *2C6409A821D03CA7079EE1205866FD854F922A05 RITERM
438,340,206 *2C6BDD0D577460DDEF0914E7E9D004E868C82A6E RIYAZ-SAIT
438,340,207 *2C6D05493D6D7EE38033BEC0DDA1EBC00EEA1B32 city-science
438,340,208 *2C65440B54A122E8FF09F70BF914E862E312426B BETAKEN
438,340,209 *2C6F67C0B4DA7F61929D6768073D2E592205BD72 b%ffk
438,340,210 *2C66D9F26F24E750BD7CA047CA50D10FD079F9A8 b+fvh
438,340,211 *2C69F626B4A196248D2DB2E53CE3D26201EAB3BF 0ilovewill8
438,340,212 *2C6152E08935E43FF248DBA7C4FEA538F98DF1F8 rogerfoo
438,340,213 *2C631875F46A0324B2CACF5D240CE60E7A8A3509 classornamebsw
438,340,214 *2C6BFBEBE197A7A8591EA7E38C7232B399125D5B bi!lc
438,340,215 *2C6BD7968A9B1A6FFD873DF0137D2CD5D5A7081F ROLF.VILLALON
438,340,216 *2C6CF28EC5A32BD773AC346E3CA8DD6BA520A1B8 rolleston-coal-project
438,340,217 *2C6BAE163D6800C22B2F72348E4AFB87CA928EDE ROMAN.TIGUE
438,340,218 *2C696C8517A4A5B3CD867B9ED1CFAAA9E8ABDD95 108.KEMPINSKI
438,340,219 *2C61975D414097E294E4FAFD9941DFADF166EB45 10AUG1049
438,340,220 *2C67171D8713BEFF683C56205D4208514F96030D CLETUS.TUJAGUE
438,340,221 *2C6A9A4B8731D646FFE6C6BBE1FD03AD46F96A56 CLFL
438,340,222 *2C635BD92E23524EBD5EBDD7CAB70E3CA73BE824 rosendofilyan
438,340,223 *2C670221249720FCD61256FE7F50F88C7B8BA588 cn!/7
438,340,224 *2C682829B814DD219663E2D132B75D2316D40A37 BLACKWOODSMAGAZI11EDINUOFT
438,340,225 *2C670D4DBE8A5DD6A2E85322733493F006E4F050 [email protected]
438,340,226 *2C67A067173F28530612A0DDE3389232F084A1E3 colechiarelli
438,340,227 *2C6362434651F68A5D87C414445A8AD04CE728C3 COLEMANSTERRY
438,340,228 *2C666A989C3699601FBC0A8E0AC4C6288ACDD07F [email protected]
438,340,229 *2C666FE285B3E53C3DC64E079861C194843EB2A1 RUFUS.ACOSTA
438,340,230 *2C6FDCDBFAAD3F3BA66B7DE76AB650290E49DB6B 1520803 TEKNISET-TIEDOT-:-EURO-ISDN-KYTKENT
438,340,231 *2C6F10D3639223790FBC25FC5B022CD4FDFC2C71 RULLALUISTELUTÄHDEKSI
438,340,232 *2C60DDE916924D4E7E135673218B62A7935C321E RUSCHABSW
438,340,233 *2C67352C3E1DFF0F632A1D0A707A8E8B10CAA8BA bmg?6
438,340,234 *2C61A0EA85B48DA1B1ABA30C718BB0D00A1782F2 bn1%w
438,340,235 *2C6C3E898313978AE7424FC9628F9BCA7A434FFB bn%o6
438,340,236 *2C6ABFFAB81A73BF7F98F6D40A28707131CBC1E9 CONSERVED13
438,340,237 *2C653986BBCCB4E8623D1724741D85532BBDDD06 [email protected]
438,340,238 *2C6A7BA562A8B5F3322FF5F5603C2D2B3AAC5075 coreydorosky
438,340,239 *2C67FAB6EC07A242D80E5EF4B73374FDF6A02F98 cornellsadat
438,340,240 *2C6105CF63ACB92C293FF31D3102F2E8A3D66306 SACRORECTALS8
438,340,241 *2C6BB8625F3D79396DA3173E135C83FF8DB65476 198919 MICROSURGERY-14-:-97-101-,-1993-.
438,340,242 *2C6808AAC578C05AAAAD15999542C8156C656062 coywolkow
438,340,243 *2C6E8F54775980F7C8BF66B87A1A0E4073B75193 CPla
438,340,244 *2C68D85922C14E013BF0226DE07A0FDF73070D10 1AEHALLCH
438,340,245 *2C6363E1C61584BFC3024C312BCD9F5C7BF2CD66 1.aluminiumhydroksidi
438,340,246 *2C65F89F05E52A84A96C5C625F172A637535F4CC SALYARENA
438,340,247 *2C67BF677D5EA6B82AB5764C00E81D2FE26FB601 SAM.DEARIN
438,340,248 *2C6A2CD32871BAE151E361E0C49CF2809D96CB81 1.bio-schlachter
438,340,249 *2C64824810FAC49EA3DDB101B33A6427813BCC48 c%puc
438,340,250 *2C62491D919006C0FA60C350D57C32D7F86E22B2 1-bonalykertoi
438,340,251 *2C6F6792DA746568E5108F4C126C12C1A6C1D0A4 SAMMONY123
438,340,252 *2C60A24AB4B8FEEC4DF09DE932210DC4EBA36B88 1CT4DM1N
438,340,253 *2C657D27AF6A46D74F58673AF1E0F2570D1C858E SAMUEL-MCLAIN
438,340,254 *2C6DED2D9DA381C6731498C19D0FBF5CDFDD2134 SANDCRYERP
438,340,255 *2C68D7DBB08F947256B81690420A800B904AF894 SANDYBETTINGER
438,340,256 *2C6EFBB7D0116AE8B2C31D5EFB01ED1189DE79DD SANELUAING
438,340,257 *2C68BD27F5DA1921F764CBC7D7A2F679B40C4FE5 [email protected]
438,340,258 *2C6FF063CC5F875A118FF8C510C2301299B4C83C CRAPUCCINO
438,340,259 *2C681ED52564313DB71ACBFEE86A7C631F4A9FB2 BOSOM'S
438,340,260 *2C649D023B1CBE6D20D5851C5ADB3670B2EF9FC3 BOULTELL
438,340,261 *2C66815992CE18B2273069BE18CD014C9F7CD008 1.faillerden
438,340,262 *2C6AB8D4C2A1A192A06808C7FEEC2F11571DA8C0 cristal-loza
438,340,263 *2C68CFEC6A372127D577F806F19284DB9CF0F8CF CRISTINE PETERSON
438,340,264 *2C6C078BDAFDCEB544DFFC6CB9BC09DFD3460E2A BOWLEGBOWLEG
438,340,265 *2C6AD6C503539184855151C72984AB060C6C1BA9 SANUSISANUSI
438,340,266 *2C62CE2AEF76F23CBBEFB6927F48B9499336683F CULTURMÄCHTE
438,340,267 *2C6E7CA07759E9DAA1E86CFD9EEC0C3D4037B74C cunachos9
438,340,268 *2C6001A553B5A351B8BF4B0C6D28C6881F0E880A 1.mauseinkaufszentrum
438,340,269 *2C663D6DE0BC4963CDB0998756E9BC798CC0E3AA [email protected]
438,340,270 *2C664DDFBB3D902922EBEA88DEC162972A3674D1 BRENDANDINGUS
438,340,271 *2C6FAAE371FB7AB32D4264100AE086A75EFF26D4 cy2!!
438,340,272 *2C6C326A43B5981ABB6E2D89A9F789D8EE218868 BRENTTRAMMELL
438,340,273 *2C633F223C7614E2B64008F6E943B90069551CF3 1.PENNONHALLINIMISEN
438,340,274 *2C61EE7E5A6DD8DE4BFBAEF8D6F8723FDB977713 [email protected]
438,340,275 *2C664D011A51ADDDE0C41BDE81A084F786D1802F sea1 cy1i
438,340,276 *2C6E847617112DC92924134A576B6CE798B0E099 1-POSTIMERKKEILIJ
438,340,277 *2C66B973C8BAE9B28A9C822E487B05534D412CD2 D1E4B11HE
438,340,278 *2C6695A9452EC52DAAC56C7325BB47E8FF99903D br.tz
438,340,279 *2C693C946C2322389C64BF2BAF8FB56B8DCFAE25 BRUSHUPS0
438,340,280 *2C6A565EEA0AD980FD17DD3DE6CFE1302D3C5CF4 1rypyiksi
438,340,281 *2C637FA72CAE74A3CB1FDAC46873A566748BB22C BRYAN.LAKNER
438,340,282 *2C6A96887D09D40D1C5C55D6A6E2A2066A4B230F šediny
438,340,283 *2C6481FFF5F2590577882A1F1CCC863225E19EAD d57nw
438,340,284 *2C6DB7BC6E5039857DD55ED0A9CCED7AE7817996 D8+t
438,340,285 *2C63566CB42B4FDB5D977A10BBA6B1E842C0B6C5 BSWCELUIBSW
438,340,286 *2C6BD7F0A09739467E26095BB962260185DE3FED d9vkr
438,340,287 *2C6B25FFF03CAB50887B96A2B19AFB2DCA3CCA40 DAAB”
438,340,288 *2C6E5A30975727C31695FDB460B1251AE002F8CE sexy-girl1
438,340,289 *2C6F99B845188C7AE5E5E3E366E865D8A7956137 1WTUDRJO
438,340,290 *2C6C5DB5ACF23870004EA56334D94845F02AF861 SHAD.ODAIR
438,340,291 *2C644466CE542310E21DF33DB7CCEF7FE311F6AE 2028050 ryyn
438,340,292 *2C60FF33BC1644076F0BA2B232CBF82EF833E87B bt$rn
438,340,293 *2C650D1DF59CEFB31807C5D4FA2021B62377C284 SHAWN VOWELS
438,340,294 *2C64B218B3357964A9B689F25FB5FBC48708A088 sheldonontiveroz
438,340,295 *2C69FB7468CBB4E58D39175B89F1494EACC6A3A4 daniel-senties
438,340,296 *2C6BCA139293EA4B3601B55D1B143821D2F56CFB DAN-MCEVOY
438,340,297 *2C6C3DEC72F80E8AC14B89C25568F0F659FFDB60 DANNYWEARNE
438,340,298 *2C62CFD4D3252973164C77AD5823D118185FB250 DAQWR
438,340,299 *2C639C307D847AB7085418776B1E244FAE118DF3 DARIUS.CHANTHASENE
438,340,300 *2C6F04907262A2DAA9D9A7291632CBDD3D4EC483 DARIUSNAPOLEON
438,340,301 *2C67FC9211F595E30C23D438DCE24C26CB8263B4 SHOPWOMANN8
438,340,302 *2C6802FE5E3A4B17F491F343BCEA313FEA3F59AB DARRENHARGROVE
438,340,303 *2C6706E6FBD6EBE3E113850F696D86D29045E69D b-u.s
438,340,304 *2C6133F34D0C6AA10E9828EA8A0FC3FEC328F0E6 2397812 SIT
438,340,305 *2C6F55556CB21DABA3746F45872179C01ACA10E1 SIDNEY.POTE
438,340,306 *2C656DF173AE35DB794B71183CFBF4A0D805569C 2465359 SEN-SIJAAN-I
438,340,307 *2C66E8BA8EF373BE8715A35CB917770326830A73 davismaglaya
438,340,308 *2C6D448255A8237E016F63AEB9EEC472D9B1211B DAVISSAYLEE
438,340,309 *2C6C56A8469CC43B37076B329D45C2432F6AABE8 SIGALIT1234
438,340,310 *2C627A9D0B0A6175A819E70CF6C0593BCCED8734 DB,5%
438,340,311 *2C6DE7928B19C73046481FC642747FFA3152E8AE B#.W
438,340,312 *2C6B31D2BD82B4968F46C0899F9B00271359AAF9 DBPA?
438,340,313 *2C69398D6623F9E2FC2A6C0880BA806D7DA2D3B3 SKILJPES1
438,340,314 *2C6D2D671397E025431666C8A84BAA2547AF7D4B SLAVOLJUBLJU7
438,340,315 *2C6F520C44265BD72D8A4361224CE483C63B3287 dd5.(
438,340,316 *2C6D752889689A750DAE17AB66174BBF120948CB SLAYHEE
438,340,317 *2C675E577D8209781F3FA7C006FB6A109B2B1D4A by"lq
438,340,318 *2C6AC4381CE6CC98D686A7F20E449EE263E58B4C smalltwoofpieces(feat.natalieclyne)
438,340,319 *2C622E07F05FB5BD749BD0D59EC73A7F56550BA3 SMOKE72
438,340,320 *2C6B47C733872FB2B0169DAFA84452AE26883989 [email protected]
438,340,321 *2C69A80DD303ADD47A5C0D83A2B2BE24769C65BC SNOLLERE5
438,340,322 *2C6C49A6ABCAEC515FBE5DF635DA754507A342B5 SNOOPYSHANTI6
438,340,323 *2C693C67FA498A6FAC50F0BC191A02E5D7C9DBCF DEAFENED
438,340,324 *2C6E7ECD8EF774D0F576A3C62C543796A02B57EC SOMEKINDAFUN!!
438,340,325 *2C68A154F2898AD2F2AF7815E98F5E88EDC37BA6 DEiG
438,340,326 *2C6F3E56377759058C45A96EFC248A92504B1259 C0LE0CHAE7E
438,340,327 *2C61460369155443A13092BF6D2B4D56A16B1762 c0n5an9uinity
438,340,328 *2C6784513B5CE25AAB847AC69FD4C1489104F049 C16181630
438,340,329 *2C6D071F292AAE378AB9E99D8BC5B997824B980F spanishcorrado
438,340,330 *2C63B99B35CC539725D9889576F11A0CEA0F957B SPLAT!!O~O~ (======Q
438,340,331 *2C6DF334557B01C6C773130118A612A06C7923BA DEREK.MATOUSEK
438,340,332 *2C6E85E07F5E5354557A593973F96B480F41889D DESALNA+ED
438,340,333 *2C60127E4276B4216A87EF22CCC8B9443CF0FD85 SPRAYCUMULBSW!
438,340,334 *2C656B3FCB4764C5B7893EC9F23C3DA382DEF0A0 SPRGSCH
438,340,335 *2C62DCC76F7C84C9BC33482538A3715D3EDC0FC9 SPUMONES0
438,340,336 *2C66397083C9C154D0E51F86A67145D0283D236F 2EGNIRWFA
438,340,337 *2C6A219C6C0F8ECCDA68776167C3119168C1E5C5 SREDIARSKCURT
438,340,338 *2C6F552B4BCFA19EB8EA25397A1C44474CC0F7C5 DGJPY
438,340,339 *2C61B6DFE1C9B366ACB1AD2B066A7DA13266D022 [email protected]@[email protected]
438,340,340 *2C61C16CD78E7EA05E745FA449042C94A3F3AB66 CAO-LOI
438,340,341 *2C650C782BD913B3BF60D5A77EF711006C892CCA [email protected]
438,340,342 *2C619054CC67AD51A65016BED173D19212277C5E ca.p"
438,340,343 *2C6E369892AFA3FCA45CFF24F3AF924231B43897 (><)~.(##3
438,340,344 *2C68384D75167ED8C2F76421F77A91EE739C1A14 STEVECHELSEA1
438,340,345 *2C6FFF40F75D00527769758249C072D3239129EF DIGARYUSUARIO
438,340,346 *2C62F7C562A0E957502E278218D7A6ED281B740C DIGBF
438,340,347 *2C66F01CAEA1D7D9542955AF4EE2D4D4174FDC7F [email protected]
438,340,348 *2C6D02DB2CD5E21EA12EFA79A1AB4CE124AB6FD6 dingdingding(faluma)(featross)
438,340,349 *2C626ADD20029DD270985A1E1957CDA0CAED8CF4 36luettava
438,340,350 *2C6E08F265C8A1680E8572EADE5E38446B9FAD4A steviebeason
438,340,351 *2C6CFC835F2529EF9E159040A5588961E2048B03 ST-FF-T-DVNTG
438,340,352 *2C6222BCE01516129CB5204FFA746F07D1E1B9ED DIPK:
438,340,353 *2C6A3B998B9E6CDCE09CC882C795B0888DB4928A 3-assen
438,340,354 *2C6C4538A48ACBF3F39A76963E8DBD95B018D49D STOCKERASES6
438,340,355 *2C60A900FCAB52ED2CCB6E254325B2BE6797C3DF STOOTSIGNALEN
438,340,356 *2C6B74E03E2E7754992AB3C001D347164BDB9D40 STREICHQUINTETT-E-DUR-OP.11-NR.5:-2.-MENUETT
438,340,357 *2C634CD062E102BD0E39608AB4FAAF2DB57C0B62 3 NURMIALUEILLA
438,340,358 *2C6E3F52BF42B26672D43F44462951821732D34E CATECHUMEN
438,340,359 *2C648E91051D3B1A011C20430944F8D33BB435CB [email protected]
438,340,360 *2C60670FC485422EC1308B181EC781E487CE5470 SUGAR BOOTH
438,340,361 *2C66BB025DE19FD58E5CA03E35D27E4686F8ECC0 DNDW47X
438,340,362 *2C69C102C4A0DCA9B767592A32CECC30851A913C dneherdu8
438,340,363 *2C6C7F64389B513A6AFA145BBAB4D67666811294 dn:o
438,340,364 *2C66FC0C41EA4CBB9F68A1F74DC594A57FFEA1BC do7_u
438,340,365 *2C6D2670E6E9D547A7A3885B1DD4325536769065 Doc
438,340,366 *2C62078DEE94504CFED4548235B77BBC635F0BBB CD/LJ
438,340,367 *2C63BD4CF1BE070D32F7AD95451C22D731B76803 DONALD.ABRUZZO
438,340,368 *2C60AC7F984BBBCD872BEF9D8D242A03A419C18F DONALDGOODFIELD
438,340,369 *2C6365037E2EF4810275F0AC75899F18BE38D675 DONALDHOLK
438,340,370 *2C69E424B3B59FEFEDE3ABEFE13BFE8C2D32602F CDTXM
438,340,371 *2C6C4836785D8FD51A8155B85A20E68A7F2C00FC 4EUSGHVV
438,340,372 *2C61F34FEA06E07B0498ACAAD1E31D9610E31D96 donkeymissy
438,340,373 *2C60BAC82A72E5B8AD4C58B103D0C36F48A004BF CEAWYLLA3
438,340,374 *2C6A7E208F78BCB34D9BD915EA3E1C6D491FFE7C SURROUNDINGSING7
438,340,375 *2C63351402961332F9B5057FD2C6B27B9CC61E0E donnellfederowicz
438,340,376 *2C6D635C7EF9C6E90254328CE25C7570A2B8D8F3 DONNIEAGNES
438,340,377 *2C62148391947987C4FFBEE06369ED307E99A58F CEDRIC.MURANY
438,340,378 *2C6BB8E08347FDDF4310C4BEF69688D77DE0D6A7 4JUPITERPHILLIP
438,340,379 *2C6EFC6EBE18618BA284795EBA4B4519D034DF60 svisando
438,340,380 *2C6EBF7C67E90AD513A052FBC1FE36B246EDD06E DORIAN.SCHMOLL
438,340,381 *2C6CEFCD1876969684D309F8C828B9DAA7A6871C SWANDERSKIS
438,340,382 *2C62383FD7CE522C4286A81F03A36C2ED85FA1D3 4n+a
438,340,383 *2C6B8B62973DD5C90DF78E2906D3D6048EF10118 DOUGLAS.OSTIGUY
438,340,384 *2C648701D3713E0B3E6DBEA844445A8F529ED8A3 DPDOUGHB
438,340,385 *2C6FBC35C3246E27451E6859554EF17005827785 SYMPHONY-NO.8-IN-G,-OP.88:-3.-ALLEGRETTO-GRAZIOSO
438,340,386 *2C6F920A757CD49C6E71EE60F14559249812050D cgfoinm
438,340,387 *2C64C007DD7D0B5CB47B0AF5309A7CED394F2EF1 4REBECCAPATCHES
438,340,388 *2C685D3089A464A7D00976D42BC839113034E89D 4ROBINPANDA
438,340,389 *2C65D90124BBF525CBC117C9C3F99C063DDD09FD TALK86.136.120.155
438,340,390 *2C629E4BDAC5B48502CB6489786627BB04A6B62F cgtra
438,340,391 *2C6D7702B11E53877CB047D119EC6155C3D17FFD TALKHUSAYT
438,340,392 *2C6214801BFD2690935ACB4DB59B9AD274CDC38B 4WORLDREADABL
438,340,393 *2C660773D4C002C789E28C97D3FA244CFD29B70D 4月29日、アルバム『IF
438,340,394 *2C6E89684C03868C3F6E0DF4F5E5FD2D81D75C1E CHANG.VISTE
438,340,395 *2C67DC450A19897A8F6E5B9E105ABEBF4B90FC48 CHAPTER.23..MEMORIES.04
438,340,396 *2C6A694AD6264B403A3F020E5F5D585B1036B001 DRI.C
438,340,397 *2C662D8E8945ABCEE0EDF259C5C0BD1F97482920 5COUGHWEDE
438,340,398 *2C69C9725CE22B777BF009AF335B52DE4B64D295 chastzw
438,340,399 *2C60D32E23A0BDBA8AB6263C26082E34A4150658 CHAUDMEL6
438,340,400 *2C63FFC4CCED75A96C11BCDC8F469513F530091D dss0g
438,340,401 *2C6B4C3FD9EC378AF1CA6D25E08E410114EBCE37 DUNAJEC9
438,340,402 *2C640C32F56D309D844BD69AB020319310536510 TCHA
438,340,403 *2C63A0AC72439CEF56FF65431B187BF244A60DBB 5ENROBERAS
438,340,404 *2C62176607FFF0E0B7A5F05C955E0A2AF886886F 5FREDERICBENOIT
438,340,405 *2C69495F080E50A4F50D7D7D41FA6AC382636342 TEDTHORPE
438,340,406 *2C6DD86219982FBB6AF13EEC0A382154B4C43A32 DVC8K
438,340,407 *2C68746A688664D179B732719E02B5DFBE0D8B82 DWYS
438,340,408 *2C6F906D4660687B318FF0B8017FA03E2FCF5F2B CHHATRAIHS
438,340,409 *2C6B88B692E6B80FB3FD9CE0A3EF4320AF934DD4 DXK9
438,340,410 *2C663B22F7D1CBAC56470EBFA38CFADADA59038E 5QUADRIVALENTLYV
438,340,411 *2C63E53757B894A93CC3D9AFF7F80D98B823E81D CHONGSWIGGETT
438,340,412 *2C6315760A0609DC6902A995A7E488CA6D6DA06F 5SCRUFFYJULIAN
438,340,413 *2C612A07C07F9FB7E66FB9F613693BF76894D22B dzqu
438,340,414 *2C6F624917C54020530C8E2263F8630C23FC6D31 TERRORSIKTET
438,340,415 *2C6BF6E6059507BC3E7DA85AEE972683D3181F63 TERZAVOLE3
438,340,416 *2C6A65F2C1348403C1FB679E6F1D9D019B41D6D4 ChrisPerezband
438,340,417 *2C6BC2942B00FC69D9D234FEEB8FC93295E8950F 5SNOCIKCAPF
438,340,418 *2C66BFB617A482A05F36BB5FE5C57E0702C337D8 EARLFROST
438,340,419 *2C60995D7FC9081CD17BA32CF879A4BE3882A083 THADDEUS.WYDRA
438,340,420 *2C65A7E25CC99D8573091A85802474743A9B030A EATHERTON123
438,340,421 *2C6673D6FBB77CCDC58A6E65366FE58C01FB3ED3 ea_u:
438,340,422 *2C659AEB45A6FC0766BDE23A434CD16D86AADF7D C&IFX
438,340,423 *2C657508EFAE7E214A1A76C87A0B75C391D5E917 EBLUHTEN7
438,340,424 *2C62CDE921F5F2067810D1B77E6CA234530D7F05 cindyhean
438,340,425 *2C6D76501CE16123C4006CFB80921D3C2C9B217B 5WAHRSCHEINLICHKEITCO
438,340,426 *2C691A08361D566EC8552C24698F62DC01BEBE2E THATHUNTER68
438,340,427 *2C6DD21C49A2755D3AD9A97B141BE43E005E4F5F 628DOMINIK
438,340,428 *2C6CE582A73BB6D30BFE2FF059DC54179FF4DF79 644adelyn
438,340,429 *2C6AB91FD668ECBFCECC64BE0624865C6E4AD810 EDWARDISTHENAMES
438,340,430 *2C6FD1C58589951CFA244D28BDEDB8BD72B70B46 EDWARDOBJORN
438,340,431 *2C65B8EFCD1C3AC491CA67F855A36D9EC90E2C16 c(l?
438,340,432 *2C69FE2B900E356D89CB8805C79CF83979A870E5 6capitolate
438,340,433 *2C6EFC739029A4DABCF20366EFAB5527E3498A1C 6collocati
438,340,434 *2C692965E7F2B487AC77C65C8B9B0609EBDC2244 themorecats63
438,340,435 *2C67E0420CEAC56ABF2BE8218E8A31E57DCA3CA3 theronschmelter
438,340,436 *2C66F918F476AEE425145B921BEC39E7D4224EF1 EHMHP
438,340,437 *2C640E015B6BA84505043D585213B08818F8B12B 6MJUHCGMJ
438,340,438 *2C6F10F25839C20D033E49EAB2E37365154D2BCD 6MOCOOHAYTROPUALCSETATS
438,340,439 *2C6AFCB831EC85BF0AE7A9EBD235E7C5C065996A EINE-KLEBRIGE-ANGELEGENHEIT
438,340,440 *2C6A17851CDC91B42DACEE9571DE084EA36C4647 THRACEJ
438,340,441 *2C6041D3A81FF3AB0ECD864A8D7403CDCA855917 6OVERCONF
438,340,442 *2C6B7F9871856C1C91236028C7F3A39013BCBF1B 6PHARMACOPHILIA
438,340,443 *2C6E557AEC76A52BE7EF57A7B4266F76C58EA64B 6POUNFOLDE
438,340,444 *2C6F873A40EAE992CDAE204D20372A2E9E2FF826 thruthekhole
438,340,445 *2C6554C3574DAC5A24C4F6E18C63EC1A1BCB8C2A eldoncountryman
438,340,446 *2C6C6E74371F5669217445461A4BBF2ED31880DE ELIJAHBEERS
438,340,447 *2C6FB6697159FB120EE5E90F5A191FC421B14324 timmycondict
438,340,448 *2C688F13FC50EE996BB00BA4058D1DEFE7C22C0F TIMSAVER
438,340,449 *2C6A69D3B1BAF2C57E3DAC964DCF2F8481F31988 TINGIRSE1234
438,340,450 *2C61FF866C14A990E462C226C2CC7A20404FCF38 tiredest3
438,340,451 *2C678ED12FA56462A30D26032C9C76FF2431A182 [email protected]
438,340,452 *2C69D40461044878CA06717F0D096CEC88D8DF20 TOEXCONVICTEXCOMMUNICATEFELONFIND3
438,340,453 *2C6901442DE1D3C2DE6194381E493ABF12000F13 tomdemo9
438,340,454 *2C62D4EC301D4BC9290F4AA297CE30325DD74E13 CMPBW
438,340,455 *2C6E3A95517F4B47756A8071BD575D4181A2F7A2 TRANSKRIBIERTER
438,340,456 *2C638ABEA344DD80D4721C39F3973AF120BC892D ELWOOD.STEEVES
438,340,457 *2C67B8ABA7FDA15D2827C8C166D2C7E841DB5262 723852 TY
438,340,458 *2C660B3C5C3DC393DC51B2F2894EEE9AE15769BB [email protected]@+0NS
438,340,459 *2C60421DCB800F3FE96E638B3BA4B9C40C02E2E7 trejo-morales
438,340,460 *2C65D3677C1B09CC3790C9E9E330AA07ED2F6B71 trent.greenwell
438,340,461 *2C6375B0C9A9D6110824D9F19ECBCFAE3865B4AE TREVOR.KAPI
438,340,462 *2C64D138E0B06F114CDB940E2704E3566CA56357 EMMETTWISENER
438,340,463 *2C62ABDC076392FA7E9AB78C7111A5EDED62EDCD EMORY.SHATT
438,340,464 *2C657A48F6B2EFA7D78CE2158D96412CABAB15FF emp!o
438,340,465 *2C65EB7699877141DE1C894B75850A61F31281A0 EM-SLLET-EHS-,ESROW-YLNO--,WON-SI-TI-EKIL-EB-LL'TI
438,340,466 *2C67C225A71127E4C1F394C376DBF4DCBD6F5E83 EMZ9U
438,340,467 *2C6DF6F6BCBA520D13E4C36B8AB199337BCFA2D6 CODETELEGRAM
438,340,468 *2C6CEBB880C0F81C90236C9EE5CF98C6A8BDCC69 COG-IN-THE-MACHINE
438,340,469 *2C67B943AA5B570DF704A51F779E6A378457E70E 7denotationally
438,340,470 *2C69B57C7644838D42E913A0CB122C26A424D88E 7EGDIRBRUBSW
438,340,471 *2C660B871E94B008633E9AB46D194C59C6980946 7EMPOISONNERENTS
438,340,472 *2C6AD3487F6D8D5B22892F0CA062C396C4845E00 TUAN.FOLTA
438,340,473 *2C6FC8553719E0D0C2FE55FF253CD191F468E5D5 tuminonano
438,340,474 *2C6C0AFD864B2B8DF5FE6BCDBFE4BCA8A620ED8F enriquematte
438,340,475 *2C6205AB004EE418465FEAB8F843EF7050881B69 enta3oyme
438,340,476 *2C61142B886D78238F950F54CCA25BF050EF4E90 EnTusHoras
438,340,477 *2C6B64B132B98EC341E4D35AB5D9073F55E21E94 CONCEPTPOOKIE
438,340,478 *2C64160B9AE33676991876C43A76B31C3492E4FA conchyliographie
438,340,479 *2C67D60129DB30D335D9AD05113DD52E41D3E249 eou5q
438,340,480 *2C6F7DDC9FC5DD03C2A983D55037C3B7EA75A3E2 U338683
438,340,481 *2C668CE0050947A80D75C6ED28B48039A23C7662 ERATIUGES
438,340,482 *2C660BA4A57ABCB0F70F9CC303CF87031D84D17D erityisenbsw
438,340,483 *2C659CEBE3555D18B2FCD2637C94822BCB52C5BF ERMIKOV
438,340,484 *2C64278E18547404564FDC6D1AD66A49B349203A UFULDKOMMENHEDERNE5
438,340,485 *2C6D41C691A962DBAE53F8C5C04A4E2A3BD10A46 CORDELLSYNER
438,340,486 *2C6E33E03FD0DCDDDC75F68AD6EA84B25EA1F2D4 ertussendoor
438,340,487 *2C68AD7D0165D1CA9C57283109B8DD9FA7F36A67 E_SE
438,340,488 *2C699E53F5F5DD0608EDFEEF4D763980487FC805 ULRIKA WALLSTROM
438,340,489 *2C6F358AF948D57155F5DF7780C6C42509FAE021 esi;d
438,340,490 *2C6681161BB5098EDFA30B8BE21D10AB7EA50ABA CP1303
438,340,491 *2C677AB597A936DD8F8A0BB8EB6FC9CA96CE9143 85 °C
438,340,492 *2C6AB3B494DD426A21685D6A5F55CB37AC2619FA ETHERIFIAIENT
438,340,493 *2C66ADA1334997E7F27B89D226A2623B9FE89580 ets4&
438,340,494 *2C69EAE39A26A170EB081D02335A999CBFFFE1C5 une(themodernistremix)
438,340,495 *2C65E0864AE91906231BFF2F8187A14083A3D40F eugenevicic
438,340,496 *2C6B37180F67ADEBDAADB8A712ED9318246DBBE4 eumogena0
438,340,497 *2C6B1C2308B14808771132141247163C386F817E cq-7w
438,340,498 *2C6C987590D972BFA6949F265C7634753D7F66C9 8DADDYFUCKYOU
438,340,499 *2C6DFC610925BF5406C33B1907FE90F2EABF0937 8FLEINSKA
438,340,500 *2C6D85E570B23FA06AF1C4FD1640F0E21F854BDC 8GOATJOHN
438,340,501 *2C60D37A0AA32F5569C0A8F4BAFF1536EE97A354 CQYAW
438,340,502 *2C687E46CAFDE4D298C3A4A877E79B76EAED35D8 CRAQUAIE3
438,340,503 *2C6E7BE582859992E8E811536A32F2B3F4B36468 EZEKIELRECKER
438,340,504 *2C6D444A51396B4A9FDABBA0AAAAA4AE6C7BF4F6 crimefighters4p5
438,340,505 *2C65664CC13688F1195B6782A7311546D83AD992 CRISTOPHEREGER
438,340,506 *2C6A0193BE7D2E43AE7A3A4835CA4891761433EF CROSSDRAWING1234
438,340,507 *2C6C8E738BC94E45F86F644FF0E2DC5A5B0115DE crqwq
438,340,508 *2C60A68881304EF67D6AABBC262EF152087A37D8 c%sr
438,340,509 *2C6CE1087A962E65D921884440902974A51A0EE8 CUMR
438,340,510 *2C6DD32CD0F38409A639C8BE521C51749E274C7B UTCJTQE
438,340,511 *2C60C14EA2C0ACCED67A8696D935DF73032DA858 [email protected]~O.~o.3B<
438,340,512 *2C62E8BCEF31466FF5432038CAD95EFD5141002F cv+c3
438,340,513 *2C63A5BAAEBD18BF8FA03B45C7D3CAFD8D9993B4 UZOMACAROLYN
438,340,514 *2C6B108DB7783580FAE62D30193A3868324F0E3B Cw)l
438,340,515 *2C67428BA664D720481F959E3126122A8AB8EF05 feiert-das-kreuz
438,340,516 *2C64780D2268D6B48BF84055CE8ED533879DF68E 8TRISTANZEPPELIN
438,340,517 *2C6B2E9EC57C819C214E6CDC332238DA495A1990 C_ZT2
438,340,518 *2C6FC51D231811492C09CE6085154C4673DEAFC1 922847 HOITOTEKNISESTI T
438,340,519 *2C61786E8A34EB0FD1BA1D9D428BBC1BD3C759A6 FERNANDOALCANTARA
438,340,520 *2C6D910BEAB39332466F267C769D049E60BEA4CB d15_w
438,340,521 *2C60891E62E3742143898860942ED98A41C91C22 D208U
438,340,522 *2C6B198C1B9F616D9C41D1F97546A70C395734CC FIDEL.JOME
438,340,523 *2C6B9F406FF155A54EACBFDF7BDDDF96415DA4DF D4EO
438,340,524 *2C66B30BFF5CE218B6EC65C2171F2C53743D606F FILIBERTOLECZNAR
438,340,525 *2C6ABBABB7BCE6BE2045E4BCC4E6B9609E5FB3EA filibertovandal
438,340,526 *2C6BDFDFD0FF601B68BC2F20AE6701DD22028EF9 DAGZM
438,340,527 *2C60056E7C34EF9146A139CFABC90D9B583E20B8 fireballs8
438,340,528 *2C60B1582DBCFF18574591AA6C1DE31E773C1C95 DANA.VILHAUER
438,340,529 *2C6F7D396A01B11A327B85653202AE218EF43E79 9ilovesunday
438,340,530 *2C6C787D5BE6DC101E89EBCAEB4F70272970788F 9MATERIELKONSTRUKTION
438,340,531 *2C6C174748BEF2EDDD46B7C40C14BF7E6374608B DARRYLLIFE
438,340,532 *2C6321C51B23190D7AB93F980F3266BD2B58488B 9PRAETAUGHT
438,340,533 *2C6D7CAB87CB646DAA9B220C3480A20B710DCBEE 9PSYCHORAIN
438,340,534 *2C68E60D41A6A238BD47FFA7780DD2F876453CE5 vincent.paciera.iii
438,340,535 *2C691DB1C13BC04515C4D0DC118D867413843D02 DAVE GOGAN
438,340,536 *2C668E2BCAC56590A5491FA998013A7123FE9150 9REUNDERRETTERS
438,340,537 *2C64171CE85D0B2B26C361678633E31DD3CB7AB5 david.jakeman
438,340,538 *2C6E6E9E5042D5C531BC7DB84BBA1901D49E25F3 VITO.BACAYO
438,340,539 *2C6463B70BA90A1A4F2DFD6C321027C6D84918C1 franciscoceppetelli
438,340,540 *2C6125C275FD675AFAE7BB6500DF263442C6A44E FRANCISCOHEALY
438,340,541 *2C6972BC30182B6135A64811E489EABB7BCF68E8 dc2hp
438,340,542 *2C653903E4D0CDAA70A49BE4A66BA5D7C6CE9ECB dcgvf
438,340,543 *2C686B8F756E2D35FD0D4E05F8DF88F58E09F146 freddyasad
438,340,544 *2C626C1C8F3FA9BC05D63BDF96B0DEC3E9D5A08D FREDERICK.FERRINGO
438,340,545 *2C6D477CDCF5F16C5C7CF39753C8C03F79FC72DB dd6u.
438,340,546 *2C6CC1A561C221D330DEBC6FD61E7E53D712BF76 DEAFENED
438,340,547 *2C6F4D7FABCF812B1BF2D4C60414B3B8130F2C48 VULLEIDIED
438,340,548 *2C651EFF83D0F29012B95725228B6F00C9B8FE2C FRUMENTY
438,340,549 *2C62B1930ED260DF90E5A90179C216222E8D7A2B waeel.salem
438,340,550 *2C614245710B7693878B6F36C3C90EAD7A3AD648 fusion.days
438,340,551 *2C65414E59F61B732CBD56776308FF095C834E02 [email protected]
438,340,552 *2C6150074EAAFCE5626D38CEFBFC320294229523 A98N
438,340,553 *2C6B7E1402DE4A743FEC43187D9A9ECC7AC4F3E7 F,:X
438,340,554 *2C6EBBC007D5EFF87E509516B1600E98BAA81845 gabriel.jorgenson
438,340,555 *2C6DB564F4148369C19659DE9EB8EEE121B918F9 GAILURRETAKO
438,340,556 *2C6EC3E0A1B413D1D32B7384B3EC362B26F44557 aabzoy
438,340,557 *2C604C03567FF52914FD54B2540085F8096F89E0 GARFIELD.LOHDEN
438,340,558 *2C6AE9148975112D79DFE38E47C7F192EBCCB607 WARD.EXILUS
438,340,559 *2C66BEB58A0F18338DCA9080BC188796B899B4EA GARRAS (FEAT. RA
438,340,560 *2C6664975C06D40236AAB7087757822B2FB5C92C AADXE
438,340,561 *2C601A65B974A9A33D203CEDFFC094674C81F68B derekchilek
438,340,562 *2C6CB3B5DBCE03F52BA1170B7CD3768E42CFE560 AAJRQ
438,340,563 *2C60BDDBE8215CDFAA8226F99C73D476E293B97D waylonisidro
438,340,564 *2C6972D57020CE010017F77356AF145CA7A878A8 AB1DY
438,340,565 *2C632F84D216635788E82D2854587E79842D54A1 DESPF
438,340,566 *2C6A5B63E910CC6B0779EC51CB48A559635D0CB5 DETDSL
438,340,567 *2C61AC64C9A76AD91ABB692EBD8BE4A0A1670A48 ABDIDEROQUE6
438,340,568 *2C6EFD5CF6B352DE32E89A2B7708ABC3F7D20A61 WEBWANDERERS.ORGWWW
438,340,569 *2C644F7BE67000546DE2E517765CE136B916DB3E wede-l-wallace-edherue
438,340,570 *2C68E5179EC7F564D60A14FB47ECCDC828E611B2 ABDULLAH.ABUBAKAR
438,340,571 *2C6BA73BBF930F23C9CC46AC61CA14DC80D9CD48 WEENSIER123
438,340,572 *2C6BFB3FE749485BE069FA6FE4086DEBC587F1F9 weggle.jojz
438,340,573 *2C6D7FB0DDD313396797329D93BBB3F5FA01B80F DEVON.JEANGILLES
438,340,574 *2C6751C70DC2E5756CC991E37261AFBC4E2365E0 WELDON.DIKEMAN
438,340,575 *2C6CC0582AA1EBF578C7CCAA02533F1CBBE235CD WELDON.TRIBOU
438,340,576 *2C672842454D292116335F7BF5B738FB1BB5D8A3 DEWITT.BOBBETT
438,340,577 *2C6F2CA1C02D803CCE420D32C31B8E7A0A689DE8 WENDELLBUNT
438,340,578 *2C6E4783D7D3D27FF09C2674667503C8EDB9E339 ABEND1-DENR
438,340,579 *2C6E998D1FF59B462FFF326ECB5AD7B8AF9F9B07 ABGCHIKC
438,340,580 *2C6DD51ECD432F7621FCEEAEBC1C40C96CC3DC45 [email protected]
438,340,581 *2C6C6EFEBA2E3E8A88ABA8D029A1240643A0036A ab.nr
438,340,582 *2C62A173DDD8A58268FFD65A7FC648B858F458EC DHIRAJ-TRIVEDI
438,340,583 *2C687E8B0D301C37168713DBE4779E02DFA4BBBD [email protected]
438,340,584 *2C6F94050FC2D9D39685E1212D53A35E0D07CB2A gilla.burja
438,340,585 *2C64005BEE843CEA3B1864BC8F41615C4E5767AD dialyses
438,340,586 *2C6E4B82C973E042827067B5691706688B5FCAE3 act3scene2forselasogliaattinse
438,340,587 *2C64BF28E1C91C4CE9391F9854FDAE875D834EC0 DIERENFABEL0
438,340,588 *2C6A71ECC8B9C537E6C9A474279B511E65AE46B4 GLENN.WALDROP
438,340,589 *2C687864C8398FD73B0DF62976009CBE680D1928 DILANCHARLES
438,340,590 *2C6278371B61C0247B4FF6F1281A1731BF6AAB6B WILBURWALTHO
438,340,591 *2C6C865E4FF2794BF8150E85284CCDB8AA7FEC33 wilfordhibbard
438,340,592 *2C61E2E10B7730C5F97211EE8092EA66D0252500 ADULLAAN7
438,340,593 *2C6B77FF3CF18D723E4C9D8DC4036801C92759B0 adverbialize
438,340,594 *2C69024EA8F4461A2CF94B5CCFC90EE43C1F3E58 [email protected]
438,340,595 *2C6701DA5E79E44333B251C18631CB54427EBF4E [email protected]
438,340,596 *2C6D3E8EA5B70ECBA774282487107D4F705041D7 DJ0+B
438,340,597 *2C64518D321145C9A6838F8D298600965638D2B3 affronteert7
438,340,598 *2C6B18409DDC990665815490B90D0DF28F9EC572 wilson-boyras
438,340,599 *2C6BB476DC37AFD502EDC041A0C32AA0BC803531 DKJ/.
438,340,600 *2C65756AC4466D862D2C7281FECEB4EE572D177D withquietdrive627
438,340,601 *2C6C4183A9E18D94CA224099C8CB6A8BF00AD33E GRAND.PRIX.DE.VILLERS-COTTER
438,340,602 *2C6529054A909C21053E6F93B8166A3BC08738DB ag36d
438,340,603 *2C636F868F744EAD093DA5060A91DEC5F6DFD0A0 Doc
438,340,604 *2C6970C73BD8FC012A77483E2B274C586D7410B0 [email protected]
438,340,605 *2C6FF600072C4F07E70ECC4061B933E28915E5D9 GUILLERMOPOELLINETZ
438,340,606 *2C643EC8659C546B333CBEC665AA5DA320EF1944 A_ICP
438,340,607 *2C620365A975440EC5DD0E22FDB02F872A0A9A71 gurukirning
438,340,608 *2C6199408493E157A8CE2DF61C0E2F99891343D0 GVXHBB
438,340,609 *2C6D9DD472B2DEE7CAB4927C50D4E19E95B3E024 GYCINEBINDING
438,340,610 *2C63AF7017C34C36568E8E7F83419F4E5A30046E GYDC
438,340,611 *2C65610A1816FBF21386B2613D6831CFF0A8485B DONNKREEGER
438,340,612 *2C6CF7F9453A33305B022943788A87BCF52A2625 akqp=
438,340,613 *2C6898997757ADAB7DAFAD8B7420031F755C887D X0/"
438,340,614 *2C6AC9CAFD4E41E69D1774A4106E0C2DACCB020E hannahshelly
438,340,615 *2C64285B9CFC1C6E2069347D3C3CE83C3FF87C24 ALDEN.PHILIPPS
438,340,616 *2C67BB60E5CE6A6B0FB12990C6A1B22F105EC2D7 ALDO.MCMULLINS
438,340,617 *2C6B621C2977428E7027958B4DD3F32B08DF7709 DOUSAGENED
438,340,618 *2C601D045E8CA87F734BEFDADD93F59BF53B7604 ALEXEILEE
438,340,619 *2C6501A155FB5F8E8AACA8DD072DCC02E8610DB3 alf9
438,340,620 *2C6B0762917A8537CA5CAF9C68C49BFF2E638594 alfredkienzle
438,340,621 *2C69F24DBB3613A76752AB6BFF0ECFA4AE4B1ABC doyouloveasgoodasyou
438,340,622 *2C646F23E60F02B638E5C53C2A53BF2309BF6F71 HAYDEN.BECKES
438,340,623 *2C6D78DCE4E9C02BA3236F5BF16FF231B66CC121 d#p_n
438,340,624 *2C673E96DCED0036B98DCC7A5877B004885AC3A1 ALONSODESRUISSEAUX
438,340,625 *2C619E8800E1EA679AD675754B35F34A82E8DE57 [email protected]
438,340,626 *2C6F9AFC4FC493E0BF7293E78E2542DAA1CD5DDF HD\F
438,340,627 *2C63D0E9685B9F04B82E4C5FCC41CA57261394B8 (x)[email protected]###3
438,340,628 *2C618B12E6C8E81A715BA3E096759CB29287926F helen.cornell
438,340,629 *2C60E2CC999C5C5ABE027FF3F8FFB347E425519A XQ]V
438,340,630 *2C69D70701D27D01D0EAC8D7DBBEB31AD1A424F6 herbtoon
438,340,631 *2C603A3B8F3BFCC7A09307E16AF94296A7F1B8A8 alzj
438,340,632 *2C65A7F00F4DA733B3E2596CF890EB3A344A0AEE DSCNC
438,340,633 *2C6C40D938F0124562F1AA2AB60720EB44DF84B5 ambsl
438,340,634 *2C6F2085E7F7BA2E0E34559ECAA013F6FDEB724E HFWK
438,340,635 *2C6667CA80351E68107AA3D681C5798E7D9E9098 HIENOS
438,340,636 *2C60F7264A3E791524DC36160BF1C6EA0701B229 DTA"+
438,340,637 *2C6A4B52A9CCDDEF05FC2EF11447B1D0BA607332 HLXIE
438,340,638 *2C6E6331F80D1DF67982F24D24E8B4ACB79949FA AN3S7H37ZA70N
438,340,639 *2C6F0EFF8D55EDF08A340E0DE0FE2D220802286A d"ust
438,340,640 *2C694BFB74E0AC392D8C21DBC1E7DEFF4D9A466B HOLDINGON(TOMEMORIES)
438,340,641 *2C66AA8D5019684ABA870E2643B51D2DF6B70928 angela-townsley
438,340,642 *2C66A7DA31F987C9D4AD81BF6A1A42517179D723 angelbarrer
438,340,643 *2C604E64219BC42C576E3B3BF9E9F2B160492BD0 [email protected]
438,340,644 *2C610B33ACA897192B66F923AC22CA1567564550 YI-JUN-ZU
438,340,645 *2C6F1DF145481341D21E80E0F83955E6DD7832B3 ANGELRAMOSO
438,340,646 *2C668DB1590774A18937BD019DC0F6D15598BDA5 you.are.not.here.(time.for.tears.mix)
438,340,647 *2C674827D4855B14E5FB2C20DDDE3ED01046DF2A HPOSILLICO
438,340,648 *2C685A43D49E97923BF41D0661AD1E7553B81D7B [email protected]
438,340,649 *2C65A27F16AD6EE848769743B200AADF829ECEE9 anstuwde5
438,340,650 *2C612F1201AB52178064781C186BBC31A0F99921 dw+pn
438,340,651 *2C63817AA5963E2306DCE8AA3BBB4E46F749B505 ANTONIA.PERKOWSKI
438,340,652 *2C669A877C27610610DA510FF73773B23C6D3BE1 antoniobubar
438,340,653 *2C6C7B16EFA0AEF40DC35240005E69EEB88C8DF0 [email protected]
438,340,654 *2C6652A2F117008F934CB760D0B298255A910626 [email protected]
438,340,655 *2C6338F0D3BCA396D7EBDA03AD881A7506D4EAF6 058jayleen
438,340,656 *2C671FFF170D6C4FE81B86726117CE1DB151DBD1 103695 ensimm
438,340,657 *2C68D107E5356A9AD430F74AE51C1AC7764D9A3D 10坦克炮被换成北约制式105MM
438,340,658 *2C6023BFA86E5EF5BE3ADA36A06362CAD8295A4B 1153454 ein-teil-vom-schmutz-klebte-jetzt-an-charlottes-rock-.
438,340,659 *2C6F05B20870EEAFC52E535C86104183F13F0E41 1193583 SOPIVAT MAINIOSTI AIDAN JA SEIN
438,340,660 *2C66819FA97AC7A1D837D4AF4F1ED0D2BBD580CA 141855S
438,340,661 *2C6AB5C58AF4A6A9F726BC062B088AFBDF10291B 182423 ALIBEYCIFTLIGICAN.
438,340,662 *2C69A3E2BAD2AD2B0C8EF64B244FCC691E31ED1F 187741 muteziletefsirininozellikleriveilgilikay.
438,340,663 *2C65D3CB502AD59EA3EADCF2F3AA440A6C9D0F0E 1-deimkan
438,340,664 *2C67FA9A2DEF2A358825C831A234490C528F258F 1ETSIGARAG
438,340,665 *2C66164532E4E770FD61F48459602C8074368A96 1FDWIX9MR4
438,340,666 *2C6FEAA3E3F31945D9295145A3DA4247815105F4 1GARNI
438,340,667 *2C6447685DCE8B7A5493044178C70324E5E9BEC4 1.gaSy
438,340,668 *2C616812557B421C3F4F011D276D6ED8AA2F36BF 1hein
438,340,669 *2C69FDD42CABCB6C442AB918FBD31FEB80E2BC70 1march1931
438,340,670 *2C6F8C157788460FE4D2C841F166D24FC9667F80 1n73rr0ga70r1ly
438,340,671 *2C690FEDC80C8B7B91A2394B9B50AF775AE99EE6 1.SCHALLDICHT
438,340,672 *2C6FE45035CED546DB09E808AA639C9B53F4FBD3 1SUSSELES
438,340,673 *2C6268D5C32BC614C64141C82CCA3C036113AB8D 1wiederihrtra-ditionellespfingstfest
438,340,674 *2C62A4F371EBFE274FA3B5BF384FDFA9F5870E7F 1.ylitarkastajalta
438,340,675 *2C679DF32091FC4568AE6559BC761BE153154173 2000ro60
438,340,676 *2C6FA5AD3830DA4D96E85EA58D6EED2986A57406 2105014 MATTI.NISSIL
438,340,677 *2C6D7C69108357836E3A6F4BD428B5DBB2C25160 2124478 KOGNITIIVISTA.PSYKOLOGIAA.OPISKELLAAN.K
438,340,678 *2C6B3E3A141717AA145506E67B65957AB1DB5566 2140618 KARI ARFFMAN TOTEAA , ETT
438,340,679 *2C654009E161AAE015CD1E9DA7CAC2A5074D543D 2180628 RAIVAAJA-MIHAILPALAATAKAISIN,ANATOLI,VOLODJASEK
438,340,680 *2C61B9D3C2AA396527FA8431CFD4E0A7BBEAD96C 2289848 SIVUN-ALKUUN-HUUMEIDEN-K
438,340,681 *2C656B251DF995F876FD1B107602F7292A7954D5 2469624 saimi.hukkanen.vasemmalla.keskell
438,340,682 *2C6E400163A946CB7A6AE126293DA8144E124666 2625890 AUFMERKSAMVERFOLGTEICHDASGESCHEHEN
438,340,683 *2C602180D7BDA23A13DFB1520400DF8F8079814F 264sander
438,340,684 *2C64DB00602F0B426CA6A456B6E1A09AC3FC52B3 2812666 er
438,340,685 *2C62889242ACC304F5A40563E514F030EF87C165 28september1766
438,340,686 *2C60221CF995C4035DF82AD9BD097D4070BFE70E 2ATSARIIP
438,340,687 *2C6474FD3CDDEFAE210C802F8ABEBAF62B745D9A 2EMICANAL
438,340,688 *2C683FFB93A7461E1F42C1C7025F4F4E1383CCF5 2.harjoitusty
438,340,689 *2C608E33E2EC3D21D15CF2C00B799B63EDB70A56 2KERTRINA
438,340,690 *2C66EAF5408DDADAF5291CD771705292830FC061 2 LANDUNGSVERSUCH
438,340,691 *2C6A89B6A1E1EC61CA9820A23FEBEB59AFD9AC40 2-PALACIOS
438,340,692 *2C60CE41069286D413DC49840E0117A44D4360FF 2REILDE
438,340,693 *2C6C267AA80A5A42969478573C7A1B19BD5B7F13 2RESITEOP
438,340,694 *2C6F1718135EBA854ACD09864A3733B0D971DEB8 2-VAIHTOPAIKKOIHIN
438,340,695 *2C6370D51A578A6CB51FB824E9E123A3979D9E27 3=)-*-(0_<)
438,340,696 *2C638FEDA719E05413FF46583954296FF55D236A 314--------INDECENT-EXPOSURE
438,340,697 *2C6D96CC3CBC1EDCCE5EDCBE61522FB6DC9EF916 3-ART-SONG
438,340,698 *2C631EAF782F4D2448A6E9D4B6C1532483536483 3B* * SPLAT
438,340,699 *2C6434708DFACF28556B6C663EC2CA9370968969 3.iltakarkin
438,340,700 *2C62CCA8A4712024DEB77FEF02BE4C290E6CB4AA 3.NUMEROO
438,340,701 *2C6A29D5A2125C014A213255A7541B0EBC7CFEBD 3###P.~O)X(
438,340,702 *2C655A6578D817E3162FAD78AC2D35FCED1E829E 40-DEUTSCH-TSCHECHISCHEN
438,340,703 *2C6093E42BBCD664EB05F58E625058BA19991CCA 4HAWAAII
438,340,704 *2C6A897F1F19C9602C6608E37707A77D970EFD66 4NGL1C15M05
438,340,705 *2C6DAD28CAC03204C688427C760CA2E9C9168FF8 599190 RITVALEVOHENRIKSSON),ASSKARIPITK
438,340,706 *2C6D1EE36D22368192438E403B9C8C1D28AAFA0C 5AMARANT
438,340,707 *2C64F9401565D3EEECAC2CAD27D99EF5F0F277D7 5BSWRTJVCINNKVLBSW
438,340,708 *2C6C1F9C3AD7044017288FC5022D2DE6B33AB331 5BSWSOPIABSW
438,340,709 *2C6BF817F577280E1C7CE9CFBFAE0D2695F9A2C1 5CARMENMICHELLE
438,340,710 *2C6E081B64DB6812A76DD3CD146C2CBAC2D1DC16 5CENTERSKID
438,340,711 *2C62613C32067D154F646DFCEA3F4DA41793DD32 5.DIGIBOXIA
438,340,712 *2C62D66D973EF7C9AF4664D686A14BC5D473636B 5iamhello85
438,340,713 *2C6CB305D6FD86A1E5339EF1A5192CA7EB6937E3 5PAPERISAASTEI
438,340,714 *2C647F66D0C939E1218DD1A9336F9A485C2924FB 5VYZNAVAE
438,340,715 *2C6E49D573B73F493F0A85504F76AB7E578F6A26 5waitewoman
438,340,716 *2C652E5F01643581E30A0EC70404462B9527AA17 6reedified
438,340,717 *2C6EF464D9A402BA64F4E695DF9B95559DCC0FED 6SCHADEBERG
438,340,718 *2C61FFC9BE9860D73AB32D35DB8023F0C7235B41 6THEBLINDS2
438,340,719 *2C6D8A3584774700FEACBC313FB0759E91654F45 6UNGIRARENS
438,340,720 *2C6BABCC45DBA77CD1A8FDCAAB1416BA724455C8 6VNFOLDIT
438,340,721 *2C68FB18DB92D948A95B7B0C8A097AE8E5E603B6 700575 OSA-TOIMINNASTA-ON-OLLUT-VIRKISTYST
438,340,722 *2C63CB86789C20B0D39C713A3861658223DD23FD 7AMINCIRONTS
438,340,723 *2C66EAD2F3DB17CFAD56217E6FFD0DDB48134980 7ARRIATA
438,340,724 *2C6CA2EA317C684CEE89F3259A4A8107A4CD68B9 7BRUMMIDGHAM
438,340,725 *2C62ABFB2D53F3F667242B78F288F1F428A0A291 7CHANCESDIAGRAMM
438,340,726 *2C6AAE54E93F2C5A129CF203770F5B02D5DD11A4 7NAAGONTI
438,340,727 *2C6EB19A84D47A5BF2B46E511215F2BA92B4D564 7OISILLONSES
438,340,728 *2C6907D74311B798678F4B5250C7ED0B7F881EA4 7OLNOTWEN
438,340,729 *2C6EE08E2AD18DB68B987A05560C1AA5A15F8298 7PIVVELOITUK
438,340,730 *2C652816BFDA33DB39C76311CAAA3D6640AC451C 7REBESMITTE
438,340,731 *2C6B1483DD09E2C6664B6CA372984C81B41DE5BE 7TOOTHACHESES
438,340,732 *2C60437FDDA011426ABF06C99509251FB5AAA96A 7TURTLEHOLLY
438,340,733 *2C6DC1B60168E547E9E1C94BB08F1D6A4B079DA0 82yoneticisinin
438,340,734 *2C6372C2003CF1C34FACA0DBF30D3C4DEEE0A773 835+0W!NG
438,340,735 *2C6A57A97A33F3278B56A02291C419673C6BFAA9 8482JER
438,340,736 *2C62002C77D855A4E711B2BC6AD4B0456F300BC5 8.L
438,340,737 *2C64B5AF29504EA774D5008CFC2D4BFF6E57D3BA 8PLUTOSWEETIE
438,340,738 *2C6FFDFE653B9D87214B50C0AFC7794C3172B1AA 8POKAJASMO
438,340,739 *2C6EAC365E438FA798E0E8D84E9DD072C6001E45 8RITORNERS
438,340,740 *2C629077D712531ABA6E7710CD865BE236C43701 8RUTALNE$$
438,340,741 *2C6698344EF01BF07900F36100D48587D078DF37 8TOMFEPNJEQZ
438,340,742 *2C629CBA29733B327464EA7FB114ECE463005596 8UNCLUBS
438,340,743 *2C612F0739BACD6E817243DB3DE53545500DDFD9 9BSWFERRANTEBSW
438,340,744 *2C60B8835C9F8B234F7F428E2BAD9B73D3353A15 9CHARGELINGS
438,340,745 *2C6D351EE801E125AB25DD96EFC2CC53002F74B0 9GUITARMONDAY
438,340,746 *2C61D23812DFB28CFB0F56CE536584C96E3DAB14 9LUEWGNAB
438,340,747 *2C61D32E48AF7086EB27DD9E73431EE5D99A314B 9MOOSEBABIES
438,340,748 *2C6A231BC3E690EADD399F696830B3AD73BFFACA 9OILCRESSETDARK
438,340,749 *2C6BF2752A25099E83A0820397C2BBF211973065 9PROFITETHBSW
438,340,750 *2C6E697FD9340A5134503B977F569DB6F2DA0992 9SARDIENEN
438,340,751 *2C691A513154DDB13DD38A1801705A1B50AB0CBB 9SCLEROTICOCHO
438,340,752 *2C66384CEB66AEC12777CC163186DB7C0C4EF9DC 9SEPARATIONISM
438,340,753 *2C699CE7AA2ADA83BCF7FBA7B135663A21F69A6D 9TICCA
438,340,754 *2C6B75DCFEDAA57C6F65B8E52F9340DF1A65B4B9 9WIEGERS
438,340,755 *2C603EFDA92540D67BCE0AEC2BA060EDFD879506 A;)
438,340,756 *2C66AEB79CB7A2BAD3FB6F1E64CAE9A720F3BB1D AAITHUAV6
438,340,757 *2C62F120B4F5B68B53C9B232E222DC6834D90CBC AALXL
438,340,758 *2C64C108F9A091676E151DB60FB08B87514A7EAA [email protected],
438,340,759 *2C61D917ECB1EA0F3846EC1D45B9DA050AEBDECF AARTI (TUMRE BHAVAN MEIN)
438,340,760 *2C601AA72E4546A53658106249D000FCC906C97F ABROIDEN0
438,340,761 *2C6A3EB47EDDD60740CBFB66A2F027F50BB48FEE ACJ_`
438,340,762 *2C6D4F5B2810AEA9962E902FBA58781F18DC3354 acjt7
438,340,763 *2C68002E0D0FF43D58E4245DAEA12A38A7D7906C AEOLARCHA
438,340,764 *2C6B7D5586EC93420F89AD52931CB040158CD33F AGDOEHD
438,340,765 *2C653E276A62D618D9166455B7C5B953F9DB2C1F a%=h-
438,340,766 *2C6736FEF45BBAA456C81251F017FB59BDB63DA4 AHOTS-GARRATZEZ
438,340,767 *2C646F888774F3630FF5B34663411E1509E0AC97 ALDRIG MERE
438,340,768 *2C666C205C836B9F8FFFEFFA8E700E3685F937A6 ALEAH-SMITH
438,340,769 *2C6BD05FA46CF486F110704BD43995F206726DD1 ALEC.NAVEJAS
438,340,770 *2C60381495163EBB1146E76E58F4482A3316F03C ALEC.PIPPENS
438,340,771 *2C62B7776FB1388C152AF8C8B253B1ACB642D96E ale)n
438,340,772 *2C66E8F5BF84D4C585BCFEC311FACEB9D9A80940 ALEX-TABORA
438,340,773 *2C6CD56E31667E211D6BDCE5A23B1887AC3F6BDA alfandeg
438,340,774 *2C68DB8F6215F37EFF4633AB0229A070721DD6B2 ALTELEYESHEGNEM
438,340,775 *2C6CE2152E1232CC8233382B867F57DB6028F2F8 A/MFA
438,340,776 *2C68DCF58A75CA82F1405D13FCEE2E9859012CA7 AM:TD
438,340,777 *2C660F48611920EA1BBB439A4252E5810804F3B6 a-new-world-(created-inside-the-walls-of-imagination)
438,340,778 *2C6F01D5CE4AF5395F45942EE88AF6D5B48236E2 anthonyvafiades
438,340,779 *2C6DA8A0B663CD8EBABA3FD770CB0B0CCFFC7772 antiperistatically4
438,340,780 *2C698DF5058CB629BD7C1D18F9162EE723E12590 antwanrathje
438,340,781 *2C681187CB968C0551DB2A4B9FC0D466C82A3F39 aoristias0
438,340,782 *2C6162092F60012F2C1663A52D8D3F962555E38F apr,
438,340,783 *2C66D4D04AAEBBA00F97115E41CAAF1F649DAFE0 [email protected]
438,340,784 *2C689E9C6704F03FDFE2B0AC3EF3ECED4F0A37AE A.R9U
438,340,785 *2C6CD8A88DE5A0258F5981D6689CC46146E4B9FA ARNOLDVANDERBILT
438,340,786 *2C6A9479DD05568686DC5F62644EC46273E3461D ARONSTRITE
438,340,787 *2C6A4EAA4FA432C496EC5E24D27E718DC9D692BD a+roph3s
438,340,788 *2C60DBFB42009E97B1D6839253187779823EF36A ASHLEY.WITTY
438,340,789 *2C6F2E9D7209347CBA02094988C7DD8E1F6C5317 assegaied6
438,340,790 *2C6DDC80E1D306DB8331B7C4B33940E33CCEB525 [email protected]
438,340,791 *2C6B72F22F783869ECA28BD13DB42F0B1AEB10D0 auksjtadvaris
438,340,792 *2C6A8183D5665C25A73C70BA7158DC6AB4C57DF6 [email protected]
438,340,793 *2C61552145893A98A06D0440569745697C7A45F8 avwi/
438,340,794 *2C6093CB003E81C24F9364F47363B519AE689FC6 b2&,
438,340,795 *2C6B8D8A3D276F8F88F385B15B595E35AE61FCAD b")3:
438,340,796 *2C612F0F02F28FEB4910AE2591DED2E0DC058DC3 B$3C+0N
438,340,797 *2C686F976B611D585DB1F08511D25EF49926E27A BAGEHEAD0
438,340,798 *2C6F0C7107CE855D5C099D57E2DD9C47D358362C baiaz
438,340,799 *2C610FBB1892641A9E6DF39F87358D3F5C268404 BASSIRILIEVI4
438,340,800 *2C620026C034ECF393842C0FF75659310ADBD3CF bclo&
438,340,801 *2C6C5B048081BE00337404DF69F985A6CDEC236A B),ED
438,340,802 *2C64D95B8021BB517B15E8FF7164BD208A2E8CFB bella.dira
438,340,803 *2C6A61DCE4CC22CB749C14901139DD7A96933118 Belle-NDP
438,340,804 *2C62AFD3156FBB88130FF9464B98189A3A7C816B bereinengenossen,derandiewandgestelltwurde
438,340,805 *2C6FEFFB28E559E331C9B28904D063B9D42F86DC biggc
438,340,806 *2C630FD7B5ACC9FD85C40B8E81590A8230026DCF BINKYAMY3
438,340,807 *2C6BDA97FE6BEDAD1276367B5D90DF3E78EE602F BJVWB
438,340,808 *2C6846965D6AA6A7EE775B0226AB472C97B17D4E BLAGNAC ! (3)
438,340,809 *2C659B19578BA6C6C26D14C9A28233F818E70219 BLAKEHAINESWORTH
438,340,810 *2C6E3E059B9F99A462B88936CC11B074556B1C12 BLONDE92072
438,340,811 *2C6A32A1307E63D81BE52E720D3A852451E71FF6 [email protected]
438,340,812 *2C6C19D89E503C99B4ECF99EDC61E32164243DF5 bpqs,
438,340,813 *2C682F737B728DE056D67E8017F3DB635EA2BA66 BRANDEN.MEYN
438,340,814 *2C654B936BA542B0894A1BD814C08BFD69D3408C BRANDSITE
438,340,815 *2C610C3B785794008492EA1860F5AB2DABF0B4A2 bretniu
438,340,816 *2C6CA3E44DE2E2C16F47D7CB377C134AB7596CDA briceknight
438,340,817 *2C632A0541FF4D9235BAD3CF36CCAD8C9F0DB5A1 B=UUC
438,340,818 *2C60B4F2ECC4FD292815900D94977F0BA75CED59 [email protected]
438,340,819 *2C623195A8190ADA731BF5A4D848336FC966A7C2 C0BCP
438,340,820 *2C6A522911AE2A0880370488A3D0B9297DC924E3 C2HA8
438,340,821 *2C67E0DA5A71EA484D9293B9EFF645541EB2B82B capar!$0n!ng
438,340,822 *2C6115D857957B33CD5773F20C42A7507C9A6761 CDTC/
438,340,823 *2C6C533CCECCF60A6D3E83EEFFE07A8CCE4C658C CF6QN
438,340,824 *2C662B3E0E278B86D60EF3164187E5108FEB234F cg%cs
438,340,825 *2C61AF0F469B0DC8FAE093C34E0B9DCB760987F3 CGTQ
438,340,826 *2C684633BC01AE3DA8B7CFCB9ADE1D60589A2619 CHANGLEEVOON
438,340,827 *2C6CC850ACC1BC825197BD337265811E66272ECE chelsea and alice
438,340,828 *2C6A367B03855EF953C80CA2D5F14D79AA4358F5 CHICOINE1
438,340,829 *2C68EF670AC498D6E8DC0877200C30600043CE98 [email protected]
438,340,830 *2C65927EEA18C842303A64EBD0C546046D0CD55F CIQ/N
438,340,831 *2C6C65C0326B06E3293C8835436D152C2FD83D59 cn_xi
438,340,832 *2C68BC35940AEEB2D4818B10CD700CBEF421FF01 [email protected]
438,340,833 *2C6C0E7432E125D328232410206D357ABBB87E53 COLTONBERNHART
438,340,834 *2C6321047C03FF61ACBE4219869CE9AABC57214C CONDUCIVE2K
438,340,835 *2C6F3402E9DBB05EEA26262446A37E727F69054A CONTEXT-FREE.71
438,340,836 *2C6BA6B337F3FDBA38BB10F0C84E7447BAE5E1F5 COREYINGARGIOLO
438,340,837 *2C605A0190A10868A9EA16BE81CDB0503D7913D3 cortezpoppe
438,340,838 *2C6BD61E61B73D980BF41A1E42DADCE3F9BC5BA6 cortezyacavone
438,340,839 *2C629F2CEBEED12855980D78EF806550D03E6A1C CORTO-CIRCUITO
438,340,840 *2C6B2E475FE11F5A472D1AFE082D38B763FA9937 [email protected]
438,340,841 *2C65063B8EC7FAFAED0EC292B84712A52CF506CF cpai,
438,340,842 *2C6DC2F4890496CF4614C41D548CF82E42BC2E28 cpug"
438,340,843 *2C6A87FC301EB847B4CB035B2ECBBB9B64D4794E CUÎNCETUL
438,340,844 *2C60BBDCA39E524611C45AA6E0987B30BDFAAD46 CVPRL
438,340,845 *2C658CDAE8EEB4E1A8F434B2B7824780B497B4FF CZWIU
438,340,846 *2C6F72B526C27AE599B9246B3C32CB3E57419471 D=5QR
438,340,847 *2C669CCE2B43A9A4693637791F361F241E349552 DAKHSIN0
438,340,848 *2C6120AE485063BA4326F6DEC45E0B7F5E9D6335 DAMION.GIRBACH
438,340,849 *2C680D1C2FCFD599D12C2EF93E28DCC98E1ADD02 DANNIEKEETAN
438,340,850 *2C63CEF5D477F552268DADDDBEDCF1C409760249 dans.der.onschuld
438,340,851 *2C61D4F72FD26DC8AC608D76DE8581935A8AA179 DARRON.RIEDE
438,340,852 *2C64F2FC7FF3869F1D36F89E20ED7609C02E608F Db"S
438,340,853 *2C64675554EBF79B0D50560C6BAE9D3F8947C869 DESMOND.STUMPFF
438,340,854 *2C6F3F2B6507FAD70D4BD27789151E440FAC16B2 desocupare
438,340,855 *2C60922380E1EA58343C8E763D139E0FBD84D5BD DEVUNSTABLE
438,340,856 *2C6508FB4B7AEF31CD20D4A83C7CF6975C7C68A4 dfupu
438,340,857 *2C650452830D187049F079B6867A886862997DCC DIIKK
438,340,858 *2C637D4642878DF565CECBB4ADA1270E870EB3BD disc.3..track.4
438,340,859 *2C607B6E14F2EC6B17ACAF875390AD018AF49B5D distinctive4
438,340,860 *2C629B58CDC0CDF756047959501D7BB0613789D5 donny.beam
438,340,861 *2C69D1DA39872828CE9B5697369E386FF718FF48 DONTESTECH
438,340,862 *2C6C8AA64B3CF85B365BCB11AE870F4C58E9ECE5 DORSEY.FULWILER
438,340,863 *2C6E0120D24804D0042217961F8AF89211E6C80C [email protected]
438,340,864 *2C6131E157F81DA3BA3A6C9795F3C4667366C47C dpsz2
438,340,865 *2C6FB0334EF2413F54122DAAF4B30B3E4F41801A DREW.COWLEY
438,340,866 *2C624E9B02CBA5BD5093524C931E9D2F78D3C119 DRUGSTORE.LOGIC
438,340,867 *2C6D379A42E2CF89735D6815C462447C75267BED ecirtatceps
438,340,868 *2C606A0BD8E0BB8E7C99773A4D7B89CDAE34C022 edmondferman
438,340,869 *2C6DC8EB08AE54EDAA88D766AAF844DF393C7D36 EDMUNDVALSECA
438,340,870 *2C691EB5DE89A0DD587D1FE30429D2E507E206C2 ED.OVERHOLTZER
438,340,871 *2C66B2F2A4D608C7F8510E0B23585B2995F001C2 ef:%
438,340,872 *2C610299BD708D497590AA974FEA1C4571A8BB3C ehc%
438,340,873 *2C62FFE40A1EE9AB9FAC2D8979D602C498E19293 ELDER-JR
438,340,874 *2C6451E8A596824654BB531DC890FBECB596013C elliottcoto
438,340,875 *2C6198391695DDFE2E7A3DCCCC1575C9B47E10E7 EMBD
438,340,876 *2C6B7DD703764007006A91DAA217271E992B8DCB emogeaning
438,340,877 *2C64BCA15E64273767DE4D8A85410E98449E7994 ENCKELIN1
438,340,878 *2C6EE800AC34D14DC00FCBCC9B821F297D52ED52 ENGULLIDORNESS
438,340,879 *2C6954AC1C7C3308E2F6630ADD380CA9BDA2E331 enirtep9
438,340,880 *2C68DCCE66766B65AD502E4D3ED44BA61686F982 ÉRECTOMÈTRE
438,340,881 *2C6BE724A62E1001714C4AC28456AC10DC4D2DD3 erintrost
438,340,882 *2C6BBAEC6459EEC7C85994FEAC0B615431A33C4E ERLINA.RAHMAWATI
438,340,883 *2C6700A1CE887AC5F1EEE2865382EB53A1F734C2 ERROLBERNUCHO
438,340,884 *2C6B3BDA7697C7E143A1B96119C352CB52820461 ERVINLEBOEUF
438,340,885 *2C6A840C79FE98BECDFFB19EEF21AF04EDE3942F es3-k
438,340,886 *2C677B5588C6A40C1D0E28AF1105D81FE260947D [email protected]
438,340,887 *2C6D22EBB40C42313F73D263263000AED876BE39 [email protected]
438,340,888 *2C6BD13E0FFCF20900A201A9398C11BAE22C77C9 ethanvaquez
438,340,889 *2C6235E046DC48D0A50059F642A734E8807F856C ethertongallery
438,340,890 *2C620A7ED625F2D7D731DA6189A3BFA9541FDF65 EWEITETE4
438,340,891 *2C66FF71DF76DB21C29FBEBA57B3A080ABB1881A ex-''kw
438,340,892 *2C685C74C48BF846FACD1C249DAB3D1BD627CA66 FERNANDO205
438,340,893 *2C6D4888EAED123C095B7B5972AA4D3E6AE3B2CD FIIXST
438,340,894 *2C6A09D428A810BD51502C08615A99C7248B022B FILOSUS0
438,340,895 *2C6B1E61392293C4E238998D3038D0CAD07CF9E6 fl0db
438,340,896 *2C6AEDA9D7810292CA035625576B5948A856390A florenciotowlson
438,340,897 *2C675997F5214B0D5E888F5B4A19007ACDCA088E FORFEI7A8LENE55
438,340,898 *2C6B00DB1CBC88A3CAC86FECC5DBC6F2D77BAF54 FRUKTSOM5
438,340,899 *2C658B6795EC6F1354EE9E64927D5D2ED831181C [email protected]
438,340,900 *2C6B6670D056DF86FCA81395B9C0A9CA470FDEDD GAISPASS2006
438,340,901 *2C6285D7AF2FD2E57560A5631ABAFB71B1849959 GALE.WILCZAK
438,340,902 *2C6BFCE2BFC3B0B9C4A999523CC0E4141D01494B GAOJIEZAO
438,340,903 *2C633291E9442FF7D7DFC4E66C6C3A2AEC600BD4 [email protected]
438,340,904 *2C6D7BFA9CD9D626DB47FF94CA3C33A446F96456 GASPINGLY8
438,340,905 *2C6AD8DA77EB59A673B3383FADAEB651BF9EA80C genrogenro
438,340,906 *2C6EE2731E22CAE93F461B24F19E99B93DCFEDFF “GIFTGAS
438,340,907 *2C6B4D44E507EB8FF1210894C5831CFE30BC9F7B G[J<
438,340,908 *2C6F83E8F45178082217C136C4080A385B9069E1 goaldlocs
438,340,909 *2C6903F3D12D751A160ECD2CB13CE61E7DE1FD81 GOBHILAGRHYAS
438,340,910 *2C68AEE4D414B3A8FE159525E6A51E3C04FB9D1C gonzaloprevento
438,340,911 *2C6B6518D2CD42E38CBD33BFFD51A5AF10478F4C gordonkercy
438,340,912 *2C695F4E6D977A0FCB8802038C6D990204620D2E [email protected]
438,340,913 *2C6453DF43370B407C2B0DC13DBC22276E884545 GRAHAMALLHANDS
438,340,914 *2C66B34A228454CE2C725E8F3C9DEE0EC9ADD720 Greatest.Ever!.Dad:.The.Definitive.Collection
438,340,915 *2C6FDE17D96BBFC1E07ABECD9A535E4CF053B773 great-walks
438,340,916 *2C64ABEDBCB54E1BD2DE19A65B1FE601ED9AE524 GUMMIMENNESKE
438,340,917 *2C67DFE06733D988629E73230BFD1057D3B17E9D GYFIIEZ
438,340,918 *2C687A9A478C2ACD502B761FB10022259C4E111C HARRY.AMORIN
438,340,919 *2C651FC1A48B74150487C7F1BF5EBEEBD17AA259 hassanauwaerter
438,340,920 *2C604C215554FCC4052ED255A5D874D1E9A51FCC HCRAZYLORD
438,340,921 *2C60A170A723F4496F6E55FEF310D22673711D77 HEATH.FUNCHESS
438,340,922 *2C68E51A58EE236F36C1092F649B590467E99004 helteell
438,340,923 *2C60A9732C2EBADFFE636B79039DC84EEE672001 HERIBERTO.KLACIC
438,340,924 *2C6925DED957D6B3E96F27A85108B969A99DEBC7 HE-VIST-UN-REI
438,340,925 *2C61C873DC3C977AAC2B11E7B44C0FCB6C6F71C2 HLJ7
438,340,926 *2C62CA825B98BBAA54D84352A88E27D0E513D3BE houstonalam
438,340,927 *2C6A0D2F7936843898CD96D09FF1665F845C0B4E hpibajawiki
438,340,928 *2C62AB45916CEA8C040F58BCF59D807D86E4C834 HSIUKULAS
438,340,929 *2C61026E570F9DDE7A02F7FD51B02A8E13583752 [email protected]
438,340,930 *2C6B528303E29B8B30F80C3B85110C75FA014F6F HUINCHA0
438,340,931 *2C6AEFBE5ADC433607AAEFC49623683BE4447180 huriront2
438,340,932 *2C620CBDB8795F7C9B58EF2035ED6A1A3030BFCB [email protected]
438,340,933 *2C6D62157DB8E779F88D3358C355CD7B6E092A57 HYMANFAUBION
438,340,934 *2C669B12A2475886B8EE9C6E40975A4CB0EAFFA7 iamteamo2
438,340,935 *2C6D0E836B3E5C4777A8767EC068FE7967388735 idioma.gaelico.escoc
438,340,936 *2C66C981E50ED1A71C477419FF006E88FCD5CE93 idrisperegrinobrimah
438,340,937 *2C6D293650FE03BE9EBB8E1A4ECC5BB3F381A326 I&FF
438,340,938 *2C696310CDB08AFC415B4FA8FB5B47DF091F2AF0 INFLIGER'S
438,340,939 *2C6019826314938BD1440FC325ACF35128BABEE2 INNERFLIGHT(FAKEIDINOUTERSPACEMIX)
438,340,940 *2C63ED07B7E9FE5A346985FBD358197467F2CBAD invisible-silent-stolen
438,340,941 *2C6014664D0A07F908E6853590C5FBB2F25B2D21 IR0B
438,340,942 *2C61F33A5C64B77E7C741D2BE2C864BBB9AAD446 ISREAL.MILLICK
438,340,943 *2C69365579269DD47E3044F5E006F77570CB663A isthistomorrow?
438,340,944 *2C6760ACA28CBBE3EEE1F8EBB49D131EB99BE4D1 ivoryschlett
438,340,945 *2C6F7A72813A8BD784AAD9256F8CF6DD9E10E369 j94$
438,340,946 *2C6213C8756714146F3FA750C3874ACB3CA0F33D jacoblundburg
438,340,947 *2C6708E04FADB2D9DD4A737AF83DDED611564197 JAEELTER
438,340,948 *2C6C3CE8618A07036F3FEE6A4FC8AF70449BF6FC [email protected]
438,340,949 *2C69233E1EBE0506E8C582B98877FE89B3F1CC6B JAILLIRONT
438,340,950 *2C67128EA96D7A740E0C9B566E89DB97C6BA1000 JAMARTIN3
438,340,951 *2C6D7C548812317C5F67D0A5975952197A75013A JAMISONBOE
438,340,952 *2C65FCACBCDEB67B4821B328D64C6A0AD9F42AE6 janinecarpenter
438,340,953 *2C652AAF01C3D3EB2558324ED12C717588070B28 JC.HARKEN
438,340,954 *2C6DA72601552FDFB22A0C0162DF065831E963B1 JDREAMGURL
438,340,955 *2C67626C8F15440ED0B3A5E73E66F68DB0701354 JESSE-CRAM
438,340,956 *2C6914A20AC1375BE9B7568036B4E04F0126AAE3 JESSREINARD
438,340,957 *2C61362483248C69CDC06AD9A340F0396D4CEE10 jesus freak (gotee bros. freaked out remix)
438,340,958 *2C6701A08835129785C4A178642B5BBDEE322462 jf%b
438,340,959 *2C6B1E3B87D768BB53EE2B166BA7BD09AAECF558 [email protected]
438,340,960 *2C6F872576C0FB33038D9239F0C59BC4DFAB4EB8 JIMMYSTARS
438,340,961 *2C604928E4A44D909CB1539A41BF781D4FB8E19C JOELKAWA
438,340,962 *2C6B07168CDF81C7493553FC512C91D30EA82D0F JONAHRUDNICKI
438,340,963 *2C6FBECD8D6C4DE7B8B522D5EA811D82A7384E48 JONATHONWILLIAMON
438,340,964 *2C6773C72E7DF4DF19D3CEEFA28C38D3E874058E jora-aswatthatala
438,340,965 *2C6391200CF159AA9F5609E7B59AA6F0561BCD6B JUAN SCHWARTZ DIAZ-FLORES
438,340,966 *2C6C38E88635F1531CBB508C4ED5BA3A0A785C2E JUGGLINGEGGS
438,340,967 *2C6CE5967E2DB49C6FF3A6644E69D0F75B42F7E2 [email protected]
438,340,968 *2C62C788EC948CD321793ACD9D28EB02060F1F53 j:xy
438,340,969 *2C683198EA0D9CDC007DFD296ABF167315120292 KELLYHILLSGROVE
438,340,970 *2C6DCC83ECBC655EC2163DBF90896A657FF34FC2 KENETH.NAECKER
438,340,971 *2C629E2845D24E3B39602D639310CE2AB21E4C44 KENNITHGATON
438,340,972 *2C64F011CBEDEB9B09920042C4208BAF2A406CD7 KEVIN.EMSHWILLER
438,340,973 *2C688C041D6998009E79B6AA247D0EE8F78F2EF7 KFAA88CV
438,340,974 *2C602234102EB39AE4C5EC08E50A47CA4982CBA7 [email protected]
438,340,975 *2C6E0543EDD46005B32C71C0225A642270C92AAE [email protected]
438,340,976 *2C6B321AC196985BD21209DA3D54AECAF3E5BBC9 kipeaemmin
438,340,977 *2C61D2FDE78601E09A98FCB2F88C4D1F26B396F9 KIRK.BAYOT
438,340,978 *2C664DDE5F09EA12D395916B12F2743F616279D1 KIRKRICHCREEK
438,340,979 *2C6CE84F14930B5D5C7E939598EB676A0E1BB8B7 kizshoo
438,340,980 *2C60388A879ACA264A96AB80B5B5690E92778E11 KRETSCH5
438,340,981 *2C6376D37006E47C14E775B5A05DD80617AF47D8 KRIS.UHRIN
438,340,982 *2C66DF87AD0E6D62368EEF76843FCB1B6FE0F2B2 krwo
438,340,983 *2C6831EE494DCFA10A402D59F68C5C04904BA8CA KURTISSKALSKI
438,340,984 *2C6E28469E5394AF69D189352E0113F1BBA7E3F4 KÜVETTENGEOMETRIE
438,340,985 *2C6F6DD109B370A03A59E13C9BB6A3AD7F7F49B1 L170998
438,340,986 *2C6A7189095CAC6320D1BA6054A53AD714AA5776 L4M4RRK5W1NG
438,340,987 *2C68D9DFECA029345C87BCB3756763494C4B9B60 LA/5
438,340,988 *2C67A1F3CF54D049DDB6FA994CA0EF2EC2DA8A45 LAHLETE2
438,340,989 *2C6AAE5D02E6B56550DFCEA1904397271A07A3B4 LAMONTACUNA
438,340,990 *2C6BE6DEF33B29660B4717A28279E80F134A8FED lanoitarepoerp
438,340,991 *2C627C3B16B97E9D78361BEADCDFDD47CC6960F1 laurel-madsen
438,340,992 *2C6D267F7ED5B6E1DA11EB1AC53E4C068C74B71B LDN(WOOKIEREMIX)
438,340,993 *2C68C142F48C8B062E12123AB0E36234273A4720 LENARD.DUBONNET
438,340,994 *2C61C92AC241FA97652614A35200C40982B6756F LEONARDLACHOWICZ
438,340,995 *2C6D0D94C8C6582A0B2566A9D7E20A6B53419E3A LEPERDOM
438,340,996 *2C67958971614F4C59DBD3CD80DA93968ED41CCD (lexar)现在也开始销售xd卡。
438,340,997 *2C68ECF5F82955803688FED5A55A40F0ABCF1E0A [email protected]
438,340,998 *2C6D846EB1CFED43E842E50D811775A9F296CB73 [email protected]
438,340,999 *2C6F08BA87BDAD745D48B1735A4BF81092A3A80A LILBABYSHEREE
438,341,000 *2C683BC98041F6B61927C0B3A3F2C1BD0AC4775C LINDY COOKE
438,341,001 *2C6B74F325F709AB9719F2641303274D94F53576 LIUERUCE9
438,341,002 *2C6857A986B20FFCF99DA82D72E9CD14CE5579FF LOBSCOUSER
438,341,003 *2C6EBAC08B03D468080A40788BAEC2DE0D6690C5 lp+e
438,341,004 *2C6173EBBD3206715238F3442CBFF712AE805A11 lucianocuadras
438,341,005 *2C60EE4241B188E6BC9B709D63A92D5A44094F28 [email protected]
438,341,006 *2C639DDD8B800CA58F4E5418C70E5FEBB0F7A1EC M3R+OROUSLY
438,341,007 *2C655F1F9012E04622714CE3C06F3E9A05CB44C3 macroing
438,341,008 *2C6524A91DB3548D17CBE25DE6A8C7E19F15E2F8 MAINSTREAM-USA
438,341,009 *2C60A5679712ADB4E297D7C4CFF59CAAB778F1CC MANUALROMAR
438,341,010 *2C6E2A192F4F81E601A0112E05400363EDC9E0CD [email protected]
438,341,011 *2C6CB6DF4D3410E463DCB4ACB1947A86A3EC0CF8 marcustorkelson
438,341,012 *2C6DDE8AA87466E0D0DDB9C860537872218373BE marcusverrelli
438,341,013 *2C6AC03473E0E91B62F45441EBD8DAE3B854921F MARIA.DUENSING
438,341,014 *2C6C312719190C73ED1AF79264C3577E44867550 MARIOUMANZOR
438,341,015 *2C67209728C8B134F4939E684BB5D9B530B7B581 mcvm
438,341,016 *2C6DED924D96CBF54CDF8B9E94F6D3001E688D49 MEMBERWORKED
438,341,017 *2C6345DFB803C4E13C102F7248FDD0962A1E2A85 mendel4
438,341,018 *2C6A61F045588C1AD1CF570091954430254147E6 metachronal4
438,341,019 *2C694CBA7AB477121882CECC306F9F75FAA189A9 mijkvandijk
438,341,020 *2C622AFA5B3CC3FAA3CBB639DAA5033316A73BAF ML0P35
438,341,021 *2C69E04B67960BD9B1F870BD3FA60CD6FFEBE27B MLIBORIO
438,341,022 *2C6A5C0D2CB7B19FCA89F05C6186B9D4527A2CBB [email protected]
438,341,023 *2C64BEEB8E56B4A5C638BF5B3A26E9A9363C7538 MMOSSKO
438,341,024 *2C6EF598FAC8A17F849AE59F544323FF28AB3F5F moebelves
438,341,025 *2C6663388935068BCCB4EB1D736AF7D35DE4FD9B MONTROSEMN
438,341,026 *2C6493DF1F17FB7BC910A076D010BA15AFE99331 MOUJIAN
438,341,027 *2C6CA154AD4349EC21F54E974DB0CA4B573D5F8C muenchhausen/the baron of the lies
438,341,028 *2C6F8378F049D1AA2BB62B6CA318766CF0E32326 MUSTAFA MRINGO
438,341,029 *2C6E53520346039337334F36ED01F45B6D9054CA M'=V
438,341,030 *2C686AE79E8C13CA12F0E87486DBA6C7AFF01764 [email protected]
438,341,031 *2C6C54C7E2A7803076B1177D17A86F78DAAB88CD MYELINOGENYING
438,341,032 *2C65868BF3017CC56C6D6A8EC6EBE11707BBA3C9 N0NC0M8US7I813
438,341,033 *2C64108AA7B5575C136E23E94381141C9E36FACA NATHANIALFERNANDEZ
438,341,034 *2C6B14E6D0B8AECAAA7BD94672B91D5A4DDAC545 NATHANIELBONIFAY
438,341,035 *2C6E83EFC475F843FD164DCF742F89B75B6880BD NAZANIN.KHALATBARI
438,341,036 *2C6EC2D4A51DFA16617CA0169672224A439DF73C [email protected]
438,341,037 *2C6B692F83C74E4C2E0E8CBD7CB7D56122102B5A NEDOBSW9
438,341,038 *2C6DB15ACE999FD5A420F5E72AFDB358A3C09995 NEMLUVNED
438,341,039 *2C6C5F228CE3A60C827C94E1679D2A0ACB8825B5 NETNELAVIUQE
438,341,040 *2C6CD6982124985D0A332A5634AF05747B9BFDE6 NICKY.STAMBACH
438,341,041 *2C68909CC64B770C8C4A8C1BEEDB4A7C75D5CB0D NICOLASLAMPEY
438,341,042 *2C60D028EE1CDAACAD6985A9BE1889831A069AE0 night」では、サポートメンバーを加え、ドラムス・キーボードを含むいわゆるロックバンド編成で演奏を行った。
438,341,043 *2C6ADB3220CB83BF74F8262BEFDB09A8594DB70E NMMESYL5
438,341,044 *2C6BD123AB4446C0340CA0B89149175094702044 NOAHDECOURLEY
438,341,045 *2C6373B77C53A6443CBD35339F53B5828243EF18 noebeutnagel
438,341,046 *2C67766BE2D135BFF4C5D2DDAA56614BA14613E9 NO-LONGER-WHISTLER'S-DREAM-DATE
438,341,047 *2C68161CC880B53A48F0DBAC87E720C003FD59E5 norwahidah.othman
438,341,048 *2C6953AD20F37C1E0DE201E5309BCD268759C26F nyunt.nyunt.sann
438,341,049 *2C697558759E65F339E65B8250F4BBCC535DAD5D O->-< * * *@===B
438,341,050 *2C61A03CE6C9BB44AA0257A639CDFF9BF4F4056D ocef
438,341,051 *2C6774994EC5251027697BB9A1C322E8B97AEC0A OLINHARDNETTE
438,341,052 *2C6ADFD0E458AC408DE2ECB02E2BAA885C71E201 onewpass2
438,341,053 *2C68A3D22B58D59E61CEE5DD52815510F0CC5B27 OSCARPREMO
438,341,054 *2C6CB2C1B2D9C5342DAA97D6DB5A1651E5A63B1B oscar-solivan
438,341,055 *2C68AE8C6E5D3E112BE26E64F7FFDED5376842CA OUNCE A.BEAST.OF.PREY.OF.THE.TIGER.KIND
438,341,056 *2C68B2DF102B95E9A97A373CBB18A6A2C582C02F [email protected]
438,341,057 *2C60FF4BA419C7DA9AAF3AEFF7014A22080F1F34 oxalida`ceo
438,341,058 *2C6C378E4D5DF7B13A3CCFB44D189687CF87C43D p8y1
438,341,059 *2C6F156058F9D0EE7AF3CA2E803DC27A88369882 PATRICKCULBERTSON
438,341,060 *2C6CB0FD97B214D79B841AC95CB955012A2CEFC6 <p><font.size="5".color="#0000dd"><b>h</b></font></p>
438,341,061 *2C6AEFCBA2B1955780AAAF4933630C54A886CE44 phane-kubiak
438,341,062 *2C6EAA9B502BEEE776DD38E279392B36ECF77950 phrygiolian
438,341,063 *2C6DFACA92261BD21ECE8B669504E375AACAB16C PINTARAFES
438,341,064 *2C6AB87686F66CB23645D404643DBF4F21A553D8 PIPSTER3
438,341,065 *2C630E07F6E9AE4E61054E94F67C360655BAA73F polatszk
438,341,066 *2C6BD45D3B0BECAF14C2686C77B0B007878C9A5D [email protected]
438,341,067 *2C6F4B82E147D5DB5EABDA421B1D7A24BA51E234 POSTSOMERAN
438,341,068 *2C68AA32D6DBD17A3FD4182355BA6ECCB8B81495 Potashgr
438,341,069 *2C6FD74FF9A80CB7E1EAF3D916AD5015726DB6F3 p=p-*-*-*)o(
438,341,070 *2C67FB19758A10EBE373D08881D18B3C567CC7C7 pr3ass3m8l!n9
438,341,071 *2C66E733D6FE1BC6DFC1232312EA358E3F5A448C prestudies
438,341,072 *2C6401F9B324313F4B3DBA5F00EE0AD6F9425602 pryproof8
438,341,073 *2C649FCD411C6922AB50C92689658DA0D167D48C publici5+
438,341,074 *2C6D6FB4C805799671FC1B4DF231C82CF7053E2D Q3ZQ
438,341,075 *2C661108B42A156FAFA50C6030A13186A5042727 qj$a
438,341,076 *2C60BEDB05599CD96F0512FCE678D0AF52A95A85 RALPH.PITUCH
438,341,077 *2C6FCAD94A3E7E9B294F687AD2AE1DF506ED9245 RANDOLPH.CONEWAY
438,341,078 *2C6DE8B2905062C16C196A131EB5411F625874B7 raphaelhervey
438,341,079 *2C6601719F0FE8F2F7A66476BD98E456648EB6F6 RAYMONDBELSEY
438,341,080 *2C675B1F734F3BF062D17E3EF010A9F83EB9961C RCNFSCTD4
438,341,081 *2C6E09B285465E202A8883947789448B23746BE7 REACHING.THROUGH.ETERNITY
438,341,082 *2C66245C11BDA19AB10F8702066A67880BD148CB REJUBLING
438,341,083 *2C6BD6C5752F7B6DA926B481ECCC695D31CDE9BE [email protected]
438,341,084 *2C60180543870023FD1CB0AFC63813DC77DF1D6B REPLOTREPLOT4
438,341,085 *2C687D4DE3DB8A661EBD1C3EC40ECF0F365F818C RETALFRA1
438,341,086 *2C6E0FADA5F67D744C8DD42D006A8BF0D3A5AD70 RETOX(HOUSESHAKERDUBMIX)
438,341,087 *2C62546C066E5BBA42F9EFE2F2401214D20BB0D9 REYES.OLSIN
438,341,088 *2C656C406DE84189A6420A1A7C8EB5D899A56BDB REZINATO0
438,341,089 *2C6124AF15A1CAD428095E433F23DCC95AB2F883 ricowoodmancy
438,341,090 *2C6D46835E4B5FF77BE5D66DDA03E618EEA308C6 RIGHT-OUTSIDE
438,341,091 *2C60965C8627319567F704CD355085DDF824047F ROBBYUBILES
438,341,092 *2C6CB9C3783AA05054B252AB7DC40C8E9261A73B robertjuniper
438,341,093 *2C68D0DFEDB1972566C1EDE42842847BEE84FF79 robot-built
438,341,094 *2C6A68BE1669802BCFD7277713B223696DF30FB2 ROGERHOMEWOOD
438,341,095 *2C620C3F1E814EC66BA2F2B7C5DFC17C91062685 rolandnorwood
438,341,096 *2C6BA1AE6E6AB81C7C3428CFC0DB280B28B9CFA9 ROOSEVELT.KRUPA
438,341,097 *2C6168FCAD696E0982C1D09B7B31E4262B6ABF67 ROSECHAFER8
438,341,098 *2C65B7E61D3BD598E8D16702D364E4E84BB12F81 ROSENDO.ABRANTES
438,341,099 *2C63FA73EC29B5C680FF953F847E46CCD82D8263 RSNNBLR4
438,341,100 *2C63D2B679FB0E2C218347027ACB74E1D71D9CA6 RUSSELKUBLEY
438,341,101 *2C616E3C279FF0A0F775078D499AFBCB0447834B r^y
438,341,102 *2C6FEB483E5D321852D62F6EC374DFB2A2AA8E7A S,.3..KUVAELMA.."NO.KUINKA.ON.ASIAT?".(ROVASTI,.JUHA)
438,341,103 *2C6DECB358B5ADC37BFB869B1A93B3FAA312DACD sadlikewinterleaves
438,341,104 *2C663678508D6830D5856A45CCC1016C43E378CC SAMUAL.SMARTT
438,341,105 *2C6E77C6935D312276E9D159F42B0AF25B4167FB SANG.COTON
438,341,106 *2C6342260F9B9AA5B717CB9FF4D0960B26352360 SayWhatYouWant(60secondversion)
438,341,107 *2C6C66DDD8E81A1E9A9E243F73B7A749B96D1EA9 SCREENMAN
438,341,108 *2C69AE27931A680E678E20813FA51780D39BED71 SCUFFED
438,341,109 *2C66AC0E27E545809AB552870CC24E0E18BAB481 SDELPMUD
438,341,110 *2C69F08C70511E767B85E5162BDC5E6DDD7972C2 SESREICITSUJ
438,341,111 *2C6CB89945A45694E51749AE26CB566416FA271B SETHREGINA
438,341,112 *2C6B7D843A234BE1389D7B58941993AA1B885FE6 SEVENSTEVE4
438,341,113 *2C61DD55A3FB1E63FD9D3A45E9A94211438736A3 SFASCIINO
438,341,114 *2C6B47FB2CC10E7C8B513E69E426495B0CCC715B SFONSTEIN
438,341,115 *2C6297C9226F6520DEAB783DFEF875021923F303 shall.make.me.chide.thee,.if.not.hate.thee..what!
438,341,116 *2C63CEBC6A9AF3B64537CAEBD1D7F9A0EF5A9E0D SHALOMHONEYS
438,341,117 *2C6FDBB5B67BF7C621B50B8340A39DFF7F0C99BB SHANNONWALPER
438,341,118 *2C61523B36A50F1C968BB4837F412C4D6778EBC3 [email protected]
438,341,119 *2C600808AC9580EBE00D74F553D8C1FE8BF605AE SHAPIROS10FAB
438,341,120 *2C6476123BE3DBD14C3A41728216064ABC11097A SHAREDLIBPEX8
438,341,121 *2C688EB0130667EE0795A901A784A54133E80FB5 [email protected]
438,341,122 *2C673CAFBEB37D584172E78BFFEEAAD7A52470FB shellbethejudge
438,341,123 *2C637C29C126A01212A9AD0C09B7FA19EBFF6677 shermanchoinski
438,341,124 *2C6DED32B3CCB7831D3AB1421ADE76355C89F35F SHERMAN.PUDENZ
438,341,125 *2C689BBBBF3679EE9A174D82EAC83883EFD8A8CC shout.-.part.two
438,341,126 *2C6C5E200423649E190BD0BA59B533AE7CD1502E [email protected]
438,341,127 *2C6C7A716281578FBF1726A7DE2EA7BE75D15A44 sidmurano
438,341,128 *2C6A228C0CD57545DFA0847F8B39DF8FD06EA1E7 SIDRANAVEED
438,341,129 *2C6DC3915F958C5E9DE0C747E3609241FCB68E31 SNELKDNARTS
438,341,130 *2C60CBF2BBFA95FCE1EBC0F0BA2C3AC93B020B1F SNERACNARRABME
438,341,131 *2C67B594409286B3BD62738B37E60B93EFD679E4 SNERINUNU
438,341,132 *2C64DCE39C2211568DFA7C6E11E9B7CED1FA5E7A snobsnivelling2
438,341,133 *2C6EB54861503F4A931FD9D8EF84BC09A5982F94 SOOTSOWING7
438,341,134 *2C6ED971C33C5C71C74FF8ED0359EDAF5D6A5C3D so under pressure (thriller jill remix)
438,341,135 *2C6E6520CE3ACBE91D65639E54BDDE44F8390AE9 SPIGLIATOS1
438,341,136 *2C659DF96920E659DA0B053C719F40B312057EBD Splato~0~<=8
438,341,137 *2C64B4EE17F71618136D112BC6340C23BFCBDD29 SPRENKELDENSED
438,341,138 *2C6753EE5A350E5E550D2689FC49E53D4A65D7A1 SquareWaves
438,341,139 *2C63F608B27FA5EF390730601DD0A2B7BB288C2F staatsru1
438,341,140 *2C66D70D5BBCD0C7EBE1E769E7C5CA665E0F0F00 stacykremers
438,341,141 *2C6461C87E6F621C90AB76B158DFF4456E91873A stadt–bahnhof
438,341,142 *2C683BCC9DEB6E11BF31D96B3A0614EDB29ADEEE STEPHANITHUMPER9
438,341,143 *2C67CF6F869D1F76848CD5A89EE74478F039CC0F STERLING.STINDE
438,341,144 *2C686515C30D0E53CEBD34AA2DE7A18C91E82FC7 STEVECHARLES
438,341,145 *2C66E804BE825AE564D5FC6EC141709B00DD2AC5 stfbrdring
438,341,146 *2C6EEF3A2803936C6B1EFE9187877FF7D40C4ED0 STRICTLYPRIVATE
438,341,147 *2C6DF87BC7D83EEA53338BE22D122E6A500E1A73 strindberg:istdasnichtgenug?(teil1)
438,341,148 *2C613540103017E9C1E4C3AA565D824A6B997A3B SUNNYMIDORI9
438,341,149 *2C6216B631FE9AA81906BAA364A32B65B7AEB774 SURFERMISSION1
438,341,150 *2C6EAD32729B27D831845DB0DFAB611B691A5075 SURVEILLERENSING
438,341,151 *2C6415D612A4F5A941A85FBE4E49CFDF0D45A684 SUSSURAVI
438,341,152 *2C6776AE999198EC82C426CB9108DA884E9688BD T020376
438,341,153 *2C637BD9E0919EFEB9906A1DE871D89E8A497A4D TAD.WILSHIRE
438,341,154 *2C6280E7D7AF3A022756CDCB0EDD598E7DED3449 talanta
438,341,155 *2C69B973FE7573A1E5615B9A5518B3E8C34D3A8C TALK862768109
438,341,156 *2C6D468DF9132BA7036D21C1B418BEE32A0D7322 TALKELIZABETH_MCINTI
438,341,157 *2C68084AB4C322A13672870C582C4A66388A33A3 talkingsmoothjazz
438,341,158 *2C6CC98D181002AEBC66CB578D669CAAA532626F TALKTOM99SMITH
438,341,159 *2C6ACE4D0C3F59146F420669145165D99BDFA54C TALKWUPUTAH
438,341,160 *2C6D0D38EA637654012915AB21098480F8DD8457 TALMUDISATION7
438,341,161 *2C6B0B8F9C749BC7E4E7F0DFD9BA3A423BA08DDF TANGGARDED
438,341,162 *2C6280F59A0518EB7E592062994A37935A5910F7 TEGELS
438,341,163 *2C6D708A237A7B5509AB8EBDD4F363D0462BD7AA tenichlas
438,341,164 *2C63905F30ACF7E0DCBB34EB7FDD122733D2457A TETSUGOU
438,341,165 *2C6BD81308A99FFBDD70B2EB11CC228DCB560144 THE.BATTLERS.."LOVE.ME.SWEET"
438,341,166 *2C6D19512058EAA6E47DA43C57F47A4307952B96 THÉRÉSIENS
438,341,167 *2C662550BF3E720DAF9E1D9C1F99C55B6455A66F therm0meters
438,341,168 *2C639BAA42AD7BA85BA9240041BD6B2F18591AE2 toverfluiten
438,341,169 *2C6950CF040D86E78B8377C78BBD40E9494B4D9F [email protected]
438,341,170 *2C6F78A60AE545C06704F93977EDAE5A23305C27 TRAIVONSOGROWNUPMCGEE
438,341,171 *2C64542D83EDDB39815E520421106E37CBE007ED TRAIVON-SOGROWNUP-MCGEE
438,341,172 *2C6CB3B958402713EECD6DEC67F7842422968E95 TRCHMNNT
438,341,173 *2C65D6BD9DC8BB25D4FB94999B98DB51CA2AC212 TROY235
438,341,174 *2C6438AC8B9254E693858824BF889F56EF6AD583 TRUIT.RAY.BRANCH
438,341,175 *2C6FD148A9C91E6E7D2C0901EF75DB6543B27334 TSEIMAERD
438,341,176 *2C6695D7237FE72E1E078745EE5FFBA7F5CF431B t;vd
438,341,177 *2C6413EADBCC06028101B466324E9D1A2A4F8B7F udavanje0
438,341,178 *2C68B6727365DE424C1E43C5311211B4B8179A52 UITGEWEKE8
438,341,179 *2C6D2CD8E4CB567824C42CB7C725D41D78049F6A UKUH
438,341,180 *2C61363C4B8DD80575B023E89B27C71DF1EB3A08 URBANDIBS
438,341,181 *2C6BCB99279B88AE9991EF0638453FC35677FFAB URETHRORRHEA
438,341,182 *2C66D39F8E3915262BCA17643F61FE04461BD320 UZVEDIS
438,341,183 *2C67011422960ACA09836A99721267D928054C79 V88678
438,341,184 *2C6F452C8664E24F5CEC58BE52BD2FA9D77C6B0A VADLAMANIGIRI
438,341,185 *2C651A9040FC94E58667C55A7F816821F2D71B08 valdespi
438,341,186 *2C61FD309DA34F92248A24B687E21B041B2EA858 VAMSIKRISHNAKANTAMANENI
438,341,187 *2C691D240B7ED62B5147FCEA48F33BDCA9A7B36B vanessaribeiromohtadi
438,341,188 *2C685AC60DAAAF9DA1CD6A0DD2F00046EF4D255C VAN.RUSSIN
438,341,189 *2C69256A860B49F88921B151AE2188C303F2D6E9 Van-Thai
438,341,190 *2C65B72A128A84D8375D1793DD23C8332777322D VBR470N4L
438,341,191 *2C6E6C845314A27FD06C1D9B101761A9F2626630 VƏÓSZE
438,341,192 *2C6DDB2FFF0EFE8EEA5DFC83D06CA0F37AC7810E VERALAJCAJ
438,341,193 *2C63147C7C24429D6EBE8D2F74497EE666410CC2 vermindestro
438,341,194 *2C647B8CB2BE58F07BDC9C222CF72A863B5CF743 verwijlen.
438,341,195 *2C6010F7EBFD6B4D239093E74AF04E5471297011 VOURING
438,341,196 *2C6D1965541ABC943521CAA03B492C7766CF4141 VU194R3ST
438,341,197 *2C68F37D18EAC57BA947A1A7388878E9A70C3923 wan.samsulri.wan.hasbi
438,341,198 *2C62AD1DE5631DBC008AE6543896D762A3FFFEA7 warrenjardenico
438,341,199 *2C6EC8EC8ADFB28164E7772A8DE573ABB90F79CA [email protected]
438,341,200 *2C68CA067C17B1DE7B2270E2ECDC8143602C2D34 WEBSTERMILLION
438,341,201 *2C6CAA3679B084DA8A504CCD02440B588813893C [email protected]
438,341,202 *2C64D9D83754855020878C837C58D1C747C34BD1 wengert1
438,341,203 *2C66CDEEDA1AF33A201D2F1E20931B865DFC1815 WHEN-THE-RAIN-IS-FALLING-DOWN-(RADIO-MIX)
438,341,204 *2C6071BE08E0E9AEF40684BFEA898D24E87F4769 wildan.alvin.salis
438,341,205 *2C6713D6DB60422B18A3E78041636C4415F0CE51 WILFREDOCONGLETON
438,341,206 *2C6F803DEE8841FE0F3F559E1B505A27F24C17AF [email protected]
438,341,207 *2C6E8F2308FC594CF6E286B926C27F3B5F4B1291 williamiserman
438,341,208 *2C6CB70199FF8485B9C157C0C9962E8923C22301 WORLDOFPAIN:TRIBUTETOSEPULTURA
438,341,209 *2C6EA92794DAFA7DB86304133F157CE59D5B2C95 wwwcapitalcarloanscom
438,341,210 *2C63ED124A27A5D083BD6895AD7DB9C6DFFB1A05 wwwdiessenhofench
438,341,211 *2C674E4086D6BEAE62B005B5FFB9977571E33EF8 [email protected]
438,341,212 *2C6DF50A068112CB5A1E53D6B4DFDB5DF64F4C2C XIOCO
438,341,213 *2C6BE7C8AD85C3C3BCBFA5388D98757A98178601 [email protected]
438,341,214 *2C696992F04BD955F0094141C6BAB853CD24A374 [email protected]
438,341,215 *2C6BC6D4CDA4D4FB0F5A821402D2DA9ABDD1DFA4 XTIANSANTIAGO
438,341,216 *2C64A6C2FC1BE8CBFC71B746E2C40A779D0B4D9A XTRIMIST KOUL
438,341,217 *2C6B2ACC6EB80B3468F4BB217B7E0906EE7D2456 [email protected]
438,341,218 *2C67E0861FB127EC424F7A5D7E91FC8793F1D67E yahira-santoni
438,341,219 *2C668CFEDCC50158FC7C0FEB8285B04685E82068 YAMPIEKYING
438,341,220 *2C6CE7AE5426E6F14E56BD1F949074A730D1AFF0 YBNT
438,341,221 *2C64F3F877B70CAFA878728F02753698BBB4CC56 YL2DTELY8JCC
438,341,222 *2C6A8D9EECDCB48958FC1F40164C5D009EA56206 YLIROTAPLUCXE0
438,341,223 *2C6659B9813CD900D472B95707B63EC5B28E4E07 yonás
438,341,224 *2C6D7799DCCF7C2D2354436EF7E630DCC41C4644 YOUNES-ATHEM
438,341,225 *2C6710DB06AB15FB78B195249A098BFAC4ECBBD1 YOUSSEF TOHMEH
438,341,226 *2C62F4C8D5356C77276871895ECF98E273AC90AD yvtokyo1
438,341,227 *2C61FA0BA8D2CC4D4501AC4C6537FC843E4DBEEE ZAMBIERED
438,341,228 *2C65EBB0ED2113A754890C655EDF37067F96B3B9 ZARAZAKARIA
438,341,229 *2C6FB91A7C5CAFD5B364A69EEF13B99927DA8338 [email protected]
438,341,230 *2C6E895154CEC6209E5D0298DB7F342E01E62E5A ΜΈΝΔΗ
438,341,231 *2C662D174CF855F6DAAEB3C49A47DEBC39FF1726 БУЛАКОВСКИЙ
438,341,232 *2C67E2FFD84A92EB895838C31BA7CB755AC90B51 БУРЧИ
438,341,233 *2C6F7A77BC0400AB42BFAAE8E3229342F5D0EF8A ВЫСУПАЛ
438,341,234 *2C64F0C958B08CFEB70B48BFAB7B32705B6B029D ГРУСТИЛО
438,341,235 *2C68AF521184623C66A1F00025938C3FC726AC62 есектер
438,341,236 *2C67016C9064AB9C9C97FBF4DA753E480D3FC9B8 ОРАГНИЗАЦИЯТА
438,341,237 *2C6F758818DA59055EEEE020520E4294495B1099 08041254
438,341,238 *2C6C00D5D4E52CAA5E8F42BDCEE6D1242FFB242A 100-prozent-bettong!
438,341,239 *2C6EF9284AA6C3409D100C2429867AE0B158BBD2 1153125 KUULUSTELLESSAAN-SAKRISTAANIA-H
438,341,240 *2C6B0E97A558BC70F329DFAA8C4967378F747989 1187894 THE DOCUMENT RECOMMENDS THAT ADM
438,341,241 *2C6E3E2963E9C36C1546979B87A806D3E1B4A530 159sonny
438,341,242 *2C6B2F08B74BC3D0DC44F8613269D1C7E688623E 1670454 WASWOHLANDENTREUENKUNDENLIEGT
438,341,243 *2C6762AA46E48395222A9FFD7EB1FB72F4535115 16.SCHEINSELBSTSTAENDIGKEIT
438,341,244 *2C635E044A6651730E30393A09F241C63B2C27A1 1840190 tiedot.saa.my
438,341,245 *2C6F736BA1A68AFC4E9B6F84019D3B436EF7B9C0 187740SA
438,341,246 *2C6D7E973AEB33D33CBF9A94DE0E1B6CDBD3C89D 1939734 kannet-tulee-merkit
438,341,247 *2C6B2382BE956DDA3CFD9927B50717D717AFD253 1.ALAKESKIVIILTO
438,341,248 *2C689B6D1D4BE5CCAEBF076F255A74179B662EC0 1.beaux
438,341,249 *2C6B71CEC2A3EA31F11706AA83656DEF2532717E 1 BUNDESSAMMLUNG
438,341,250 *2C6B97B6528987170A682782427AEB189F5F4E30 1cgibinhakemisto
438,341,251 *2C67F44F58E65C9BEA8DC2850F9737C43EDDE798 1EGIDLYGN
438,341,252 *2C6B967F79FBA75E35EC40BC08C6B8A95261CFAD 1GECIRILEBILECEGINDEN
438,341,253 *2C65FBA19F696FFFCBEC07B4BE3B79ECB5A7C16C 1HAJOAVILTA
438,341,254 *2C6C6C768A317F7EDC85832A4BBFA5DE19FF8DF4 1half-attentive
438,341,255 *2C64143EDDD93FC5529336CE7A0569B30A54B2BF 1hein
438,341,256 *2C6C7C78CDE0032F3088889E23366F78A8D48693 1.jarutukseen
438,341,257 *2C61A6E95F4A2DD561BD89CA6D57A564978D8AE9 1mymechanic0
438,341,258 *2C6EA14BCD545DCEA5E155399DECFF4F6C516458 1.painoriville
438,341,259 *2C6DF6C8AFA077C1B266A76E2422B6BDDB9603D1 1PALOOSASTONA
438,341,260 *2C6812B462C6DC1A3EDDF5B6829DEAC60366C26B [email protected]
438,341,261 *2C6E14D41569DCCC0163A751491C392E49416CBF 1.REUNAKASVI
438,341,262 *2C6969D85F82662F6A27779411087BB9750C7E3E 1 SANKARIEL
438,341,263 *2C6607ABA29B121A00CB432C1450A853ECF85DF8 1 SM-NOUSUA
438,341,264 *2C6B41D3A3CF616B9F7031337B7E3B18DA29E458 1 STEINBECKINROMAANIN
438,341,265 *2C64E7FF978313FF65D8B74DDA18C9D05728823A 1-takaClar
438,341,266 *2C6F32E8D0F4551CB573A0815AEF324C49C53551 1.telephonleitung
438,341,267 *2C6FC18F7063F2C92321DD8032CFDD896AEDC7D2 1 TORJUNNAT:PETTERI
438,341,268 *2C68A82FA4996E61E108BC25B9DC1F1F5F58E755 1.veredlungsverkehrs
438,341,269 *2C645A12FE32D5EC6A8ADF5F1F8C73D81A3571DD 1-vesianalyysej
438,341,270 *2C677B1036E093EA0E4101861751F59508DDECD7 $1ZE481Y
438,341,271 *2C653FA68147B35CF8ED41AF8D67F57DA85C98EA 2007年6月22日には、廉価版dvd
438,341,272 *2C6F70A679F0DAAF31ED7135E35D112C990ACCF7 22GREENPEACE'IN
438,341,273 *2C6E54E2D022AF32F837158D5A5C65D65618297D 241043 in.a.way.,.the.process.almost.came.full.circle..
438,341,274 *2C61F123E40329958924DA9298172A10D6F0E133 245877 tatemi'yecokonemlibirseytepkisioldu
438,341,275 *2C60CD67579688E9CBFB40488F0C0918AFAB04B9 2627753 DERAUFSCHREIISTWIEEINDAMMBRUCH
438,341,276 *2C6C724988127DF5C1CF53F82CC6683E93BEC316 28051650
438,341,277 *2C6E702FFA1372A2F3FFCBE5C2475C584725541C 2abstimmungstag
438,341,278 *2C69019B1321A93225F261FBD522ABFDE88592B6 2HEMOFILUKSIA
438,341,279 *2C6D652D6CFEE85C5BA907EA0670188058574324 2 LEUKEMIAPOTILAALLE
438,341,280 *2C6F60DFBD54E81B56D0425F1A9B7D87DE552765 2.martindienstbachstrasse
438,341,281 *2C6FF7954FDD304DB001AE829DCE8874DF92C143 2WANEN
438,341,282 *2C656C3F540474FD7E9DA85F679624AC231048C1 3294 MIMARLIK-FAKULTESI-MIMARLIK-BOLUMU-MEZUNUDUR-.
438,341,283 *2C6019A776B4D0C46F5A82460343B5BEA50B5D4C 336114 der-traum-vom-grossen-glueck-,-den-so-viele-traeumen-
438,341,284 *2C6E0DE07085BE16969209421DFBEE2A2ACE7340 3B~o.><
438,341,285 *2C6D7C18DB1F09DC52E9659093FEEED79239E398 3FORGSFH
438,341,286 *2C608C5A5BCA96257DAABAEF9B347BED892DF3A3 3UTPEKES
438,341,287 *2C6A7C868B39A8B0D5FB3DF030CCC59B12F98B87 426d8fb1
438,341,288 *2C67F8DEF0EB97F5E15C56CA9FABAA3CF8AE0140 4EUFEMISMEN
438,341,289 *2C6DA6CD055E6BB842942D987072986B2F478736 4GODVERLO
438,341,290 *2C67BEC2EDF28AA8B661A8E1DEF572D950287D53 4HIBERNIAJ
438,341,291 *2C6FA3E6A4B8045312D57348DEA6FD510AA16440 4iluvsecret38
438,341,292 *2C6FE54C2E97ED8FB3CB13FC531E50C3A05ADE0A 4OL
438,341,293 *2C6C8479B0611A724B474DF6B2E2FC1DD8CE4CAB 4V87SDE6OPS
438,341,294 *2C6CEA14E31901137C5B6AD5256E0926C3A698C0 526875 the-washington-post-first-reported-the-probe-yesterday-
438,341,295 *2C608078EE2BC61DE7C7ABF741850071A7867753 5ALEXANDRLIVERPOO
438,341,296 *2C6A2BFC0E1916F8D1629B3A94B0F79E97FE8A23 5BWMBWLVRKU
438,341,297 *2C6516ACE184B5C215060B675F452B2CB50568D3 5FUENFFNEUF
438,341,298 *2C6B3C57DDB35E7025AF76B6EEA79B419FBCAD51 5HASPELSES
438,341,299 *2C60591E14B2ABA4EEFAA2BA99D228B93CAE12A5 5NIITLEKS
438,341,300 *2C6F7B8C7EE5C7C3EF70ECCD8D132D20DC7059CC 5RASPRAVITI
438,341,301 *2C6AB6816F849C5C2986B424AEA60C573DF0F64E 5SOMEONEGRANDFORKSKNDUSMOZILLA
438,341,302 *2C66DBB20032BD1CA73C780E2BA0A5CA46773649 5TIROTKAR
438,341,303 *2C6E4A6962A43FA268C6C277396A06973608F15F 5ULKACHEL
438,341,304 *2C67FD8CF4B475C01499D259EB94CA412B41FE9B 614101 we'vebeenouttherebyourselves."
438,341,305 *2C6F8859264CA54ACA7221785CDDC08B8D1B116D 62-saldIrIyI
438,341,306 *2C6ECE618C5C78F870E6662095F6637A09FA6697 688КБ
438,341,307 *2C6D9DE5FFEE642E21D697C29A45AD33B7809093 690752 katsele sit
438,341,308 *2C6DA31E930D68E17D4AF6EA4FA21AE3D20B7EB1 6BOOGERRADIO
438,341,309 *2C62882C620609EA6522D77B28E94820878481A2 6candymaker
438,341,310 *2C6E9E37AD42807332AECE254562EEBC24B255CB 6DECEMBERGOLDEN
438,341,311 *2C6B56B335DC860864898275A8617046D7001CCA 6GALAXYSIMPLE
438,341,312 *2C6F6C6D735FA23D0257BC6F4E84C57D34BD9618 6MANDATIEZS
438,341,313 *2C6990A8D79546A9160FB795F934A78F1F6709FA 6SCONTATORI
438,341,314 *2C633E29BF31197479DBC77D730CD0B2562F4FA0 6SPRCRTCL
438,341,315 *2C6565E57380B1DE0BDEF0C71EC7D6C4969415C2 6XVEEVLHUCZO
438,341,316 *2C63F40518921473B0B36E6517B101C30D93608C 6ZBRAJANOJ
438,341,317 *2C64CDCA5545EE9CCAEAFF50DCE82AB66D059740 71M37B135
438,341,318 *2C6DC1F19E0A1C7A2BB1AFCD4F2AEF5DEF1A349C 723836 mutta.et.yksipuolisesti.,.sill
438,341,319 *2C60937B5B5654D05E1A2AB7A8875AF5E2C047FA 731PRESTON
438,341,320 *2C6669F3F9169AD95456D4515D3A26B6E8D14312 7INTONSO
438,341,321 *2C69DB2882253448222B9A36FAB9023591211D1C 7KORESPONDIRAM
438,341,322 *2C65DE71025766DE78A589CDD4CB8C1D04716252 7nder8ox
438,341,323 *2C6C363B8BFAC63C00BE64FB7624F322A6C2DC43 7TOIMPRESSIBLEIMPRESSIONABLEIMPRESSIVEIN
438,341,324 *2C6926936F9ABB2F9C081EC853D14C3B3A67935D 7tomfooleries
438,341,325 *2C62B948423EAAF453FB6EB183A3F2149FB13688 7YSPRO
438,341,326 *2C61C9384774C487AC3B487A43A3F3C575FA75A0 7ZENITHLINDSAY
438,341,327 *2C602BB98A0B3CA767981C76509E3632A26816FF 81ACK1IGH7
438,341,328 *2C697285FF71E0642DB9C025A7C77AAF8CF12317 893026 saatteeksi " desire " - n
438,341,329 *2C6C9EACCE5EA52004FDCA516297F122DEFCD600 8ARBEITSFREUDIG
438,341,330 *2C6CC997D6CA87C8DE7EF5BA357C090831C1E8F2 8######b***(0_<)
438,341,331 *2C69CBDA055F22131097A176817F975F59F461EB 8ELLIVYDE
438,341,332 *2C6DFA4D364A047AE8B77EA3B7804F3CC3D5F1BB 8iluvtattoo6
438,341,333 *2C63F71BBA3C09395F764EBD43DEDE276BCA5258 8p~ `(^_~)
438,341,334 *2C6BE321D8860166EE6A98EA733C52B0E85C907F 8TTELLEK
438,341,335 *2C605E89C18001F458DC82E5F676EF51C8F987B5 9ACAROLLORACA
438,341,336 *2C66747CBFD2F66E770DEBD879190E479428C55B 9ANECITO
438,341,337 *2C6BB63148115C0D6D56F440C28FAAF693F3370D 9iamketchup0
438,341,338 *2C632DA9A7A8FDFD499900E6FF468AA16E12E35D 9SOLEILTHEMAN
438,341,339 *2C6AF9D05F6F819A2E5E3B3EE4440CAED90F68F3 A;)
438,341,340 *2C675CCCE461B4FF012D90EF3E39CBBB6718AEBD a6
438,341,341 *2C6131709DBD3CBD24CD6A97001B4F2A68EBAC50 AAAPE
438,341,342 *2C65E976C4110FD4772D80AAD1A652CB0F525AB9 aacn\:
438,341,343 *2C6FA9E7F81325CA4E9EFC5C672446EC9A3D463B ABMYERSES
438,341,344 *2C608A0BCA0D91B77402991B5D6AD0C9FF30DE1F AB)QO
438,341,345 *2C645D04D79B64ED2274C9E1B15D561638EAC55E ACHXT
438,341,346 *2C69A1334CF1718B10EE49099951527D540B408D ACLPV
438,341,347 *2C6376EB0F50C1649160952CDA447F95202985D4 ADELE.ASHTON
438,341,348 *2C625A82F9A1863E1BEE4BB1873358AD876465D5 adiimona5
438,341,349 *2C65D6168F06AD1E95E79D83D5195A7152799F65 adjrobbu
438,341,350 *2C6A77E07DDBC91AFA2A2C494CBBEBD3A859E0D6 a!dru
438,341,351 *2C6195ABE75265967EB15579EA75B8DA141E3B05 adygrove0
438,341,352 *2C6A4F78A2E338E19851F4E34A0B47BC4773F88D afterhours-ibiza
438,341,353 *2C6CCBA7462445E2ADAC2EA18569823902A02A08 AIBFG
438,341,354 *2C6E317490BA86D916EF60A042A17495A3138180 AJOJRIKO6
438,341,355 *2C646450D9661A6DF0191866704EADD9BCF96C29 albertderrer
438,341,356 *2C65AEAE8CE5587566695B200F348CB7E34C9207 alcy1010
438,341,357 *2C6578B130AD348E9C45D04B03F6BF269C3FA633 ALECIA.BRYAN
438,341,358 *2C63E0F41A7DAAB02943565F1AA6D4810D13ECAA ALEXANDRE-ALLARD
438,341,359 *2C60D8553AD6EB9F7EBD263BFA3DB785BF8CC5FE alexipharmaco
438,341,360 *2C6B9D06888D277CA04089BF4A9F8CACEA04FCA6 alishiafynn
438,341,361 *2C654327FF6E1D6624924E1313DBD9959A9CD417 ALL YOUR SCARS
438,341,362 *2C698F172D779A9906DA71C8559499029149F0AD a);ln
438,341,363 *2C69EE326E38E39A36AC6D0953FD575792BF4A30 ALONZO.COLAR
438,341,364 *2C6A6E1D71D0D8C802DA838A925BCB4FAB0A50C2 altartomb6
438,341,365 *2C689B0BCF9EF2488481477300368F31FD187A55 AMDHL
438,341,366 *2C667576F15A418B177D236A3D91412D66C95B75 ANGELBACHTAL
438,341,367 *2C6A94300988D1018F1788168D909C6423B4FB14 ANTONIOGREIST
438,341,368 *2C67B67F1DD5B2F0E62849898EA7EE012CD174A8 ANTWANPATRAS
438,341,369 *2C6C83D0943D418D5D93B3F5FE15052BC2ED858F ANYWAY88
438,341,370 *2C6D031DDB258621528F75C864E7CAB025A3BC01 aqft,
438,341,371 *2C6E74DFCE54A8E9B1AE8C6493EA7DBE03EE7792 ASHTON210
438,341,372 *2C6DD0BF13F84F2236500AE5067DA1B59825FF3E as.if.by.the.wind
438,341,373 *2C6F959995319A292E73352BBA2E99F28063384B asxx9
438,341,374 *2C6808B81A8E388D8D7252627E89C7163AA836B9 [email protected]
438,341,375 *2C6F7775AD277135FB669C1934A656DE03C4A361 AUM1A
438,341,376 *2C635463DAB70A159382FE147610184BBC64108F AYRTON.SENNA
438,341,377 *2C6EFB6F5CE94A5D10E76B3F5DFCB114B5B34930 b6#sf
438,341,378 *2C69AC5351E5214D54E49172D46554CB717A8E4A B8JTW
438,341,379 *2C6340088B123AE73743082CCE68F3ABBE7E8082 BAEWN
438,341,380 *2C61FB610FBDCB7FE31208A95D873A32D5AE0B9B balw
438,341,381 *2C6554A27DC3A9C5F702276F73E8CB61FE4CF47E BCI#M
438,341,382 *2C6A97CA11AC76C0ACE3805405D2F29098A47080 bdppf
438,341,383 *2C61B9D35BEF81D3A6F057F8FE9B98FB6F4A26D3 beqat
438,341,384 *2C655E18A9A109ADACAC0B3361181699D6C16DD3 BERRY.JEGEDE
438,341,385 *2C6CAF567200B7C369FAB6C859C2F8E32680AAF6 BETONIES
438,341,386 *2C6FB412B09F2C0EB39CC1C405C6E36F71B80FD6 B-gu
438,341,387 *2C60491184875718994EF36B4BFED9628E9FCD3F [email protected]
438,341,388 *2C66DC55E2FEB95C9236034F38FF6FFFE88FE638 bimesters0
438,341,389 *2C61C198A841F61893C967394B80A11F6DF9882F BMCZC
438,341,390 *2C65641E98F424B3DAF377C0539B393B333AC4A6 BONIPHACEKASHAGA
438,341,391 *2C61EAC3468052B6F1AA8DF27E2E7E16861B2FB2 B==>-~OSPLAT
438,341,392 *2C683F9DACB6E411C8BC1B4122D260C4398318B2 boyveau-laffecteur
438,341,393 *2C6CBB39D718B50073E04FE014EF26CDEC519CE0 brodsky!
438,341,394 *2C6562B0E0A8056C2F1D52D880F52E3A78042772 bs.5c
438,341,395 *2C68DCB585CDB0DC4AB711C899F5D779C2D1C538 BSWISLABBSW
438,341,396 *2C6E29851120F40585AA9B3FACE2D7006AD7CA9A bt0"
438,341,397 *2C684E42B03F87CB5CE47CD9E048B6B5A758DF19 bv-
438,341,398 *2C6DAFE0F861886425F785F13E540E14F5F38DBD C15.378.100.425.510
438,341,399 *2C622A74F85FB87620A4CABE8B717A62CE3F54FA c2cqj
438,341,400 *2C698E8552ED5E69801B26975AC7FB7B1E8B97C3 C4c;
438,341,401 *2C66A385709D48E24616997B87FBB85E621F9CB5 CAGRA
438,341,402 *2C6A69B5C6F6F453719C7B8C0511A30E6A9E4228 CARLTON.ARGOTE
438,341,403 *2C65AB883F4BA114F8331A282627F61D19C2CD3D C(A#W
438,341,404 *2C66E0B86C17AC9DCACFB07A42F774FFF2C1D2A6 chris1john
438,341,405 *2C6A5C625350CF473C9D99F4896251C059F0F1F0 [email protected]
438,341,406 *2C6FD5304397CFC6EFE39B92216D5874A554C0F7 CINDY-LAKIN
438,341,407 *2C6DDC7FFB0220F14014CB17160C6B9408247FFB cipi8
438,341,408 *2C61BBEE4840A96758D7E4A60201D1D261F6AA6D cknitta7
438,341,409 *2C6BD0DD2284CDAB73C4645918C5890D6E544D90 [email protected]
438,341,410 *2C646F68E1793EAB93ED850C96799CC4A9DE8C32 CLAUD.BROSSOIT
438,341,411 *2C665F80961AF6DE98F1B1EA289B2FAA43972F43 claysherrin
438,341,412 *2C684E69009CCFEED53C4D5AB59C9350C46C168F Cl%C
438,341,413 *2C6777D8AEEA09C931D0F96324D36174DFCCD550 CLKAMG
438,341,414 *2C6B0E3CFBA8B3625D939645419D1D303ACE7725 CLUB ROTATION, VOLUME 24 (DISC 2)
438,341,415 *2C66B68FF157E785D125A9D00B72038246640716 condorget
438,341,416 *2C6780640A28B35259D0B530CE3A290F2124BF9A CONGO/THEWAY
438,341,417 *2C60D558F058E421AC4A9C6A2078AAAFDFCF9F7E COP+D
438,341,418 *2C66068CF5A8C1A5216301CC17FBF958B0443221 COrT
438,341,419 *2C67643CF3B6C8AFEDCBBF21D25FE37EE7B2F14C COUE
438,341,420 *2C640EA58DF2D43E8EDD095AD9808E2422E06762 C.TRD
438,341,421 *2C6F467A4E731855502592EAF576D8660D0E9226 d+0ad
438,341,422 *2C65C9C171D333B442F4A6EA96E90965E4F8473E D50t
438,341,423 *2C69A68C7ACF3FEB88CB1447330C968E145AEFCF d5i6:
438,341,424 *2C65ACF8F65FC4D300615AB65CF2E2C2BF1E45E7 d8f(g
438,341,425 *2C64DE3398B72D57F5311E9D6A696241407D3652 [email protected]
438,341,426 *2C6364677043043C639419D4D62CB0C3F04756E2 DAIJOCY
438,341,427 *2C660527C959CC2DD2E379846B6578F2EDE9F81B DANIAL.GRUPP
438,341,428 *2C67FA6948238B496A27872AECDDB33EEAD84AE5 DAOU+
438,341,429 *2C637BCE55E8B1578BA62E07A191DEF246A4AA83 DARRICKBUDDIE
438,341,430 *2C6F4A83B77FF3D1486EBFFB62B0115FDB3F6C4F DARTHDIGWEED
438,341,431 *2C6D50C1A630B6F347548D8C96983D88E78C40C7 DARYL.DOHENY
438,341,432 *2C6FF7FA11756368035C246ED513E246475F0666 DAVID.MITSCH
438,341,433 *2C628173A386F0CA9EF6F790421CB047E72CAAB2 Db"S
438,341,434 *2C6AF14C87FBD7C4DD2D44E5008942CE6BA67000 deldecorte
438,341,435 *2C690D53E9DDEF3C50E9DAD054AE593E3460C119 DELMAR.GUERARD
438,341,436 *2C67F0A5050BF1364F246018ED2A3D455CCED067 [email protected]
438,341,437 *2C6B7D116252F92F839B2DDB90521A74FB3891B5 DESCRIPTIONCLLR
438,341,438 *2C68CA06BD175D6D52EE943527FC124F44302150 despotiques
438,341,439 *2C6F8D4A5D3A16016B2CA7E4F86D52751CCC857D DF6?L
438,341,440 *2C66C2911580342BB41B4163920B5B74A526A315 DOMINICWOMACK
438,341,441 *2C6D9500072A7542A4D5905CC3E042D0B9FB744D dominiquealveraz
438,341,442 *2C668407BF44FEDFADF92384BF93F6451CEC95E3 [email protected]
438,341,443 *2C63DABFF2CDC24687C8884D3D1C1F32DC0A2033 donnellliming
438,341,444 *2C621BC379843829DA20EFFA0F975CFE88085272 d:oo&
438,341,445 *2C613C4967CE1AF2A62FCAEFE4604A602C9964F5 douglassloyola
438,341,446 *2C6835EC0864E1B24FEBC91C6285CBB7A1866B6C DOZRR
438,341,447 *2C6E254FEABE1666A799CC9835B197567020589D >-<.*.*.*.d------p
438,341,448 *2C6C4CA2D8A73962C5CC56FE2CE7FEE8FBCFC9F9 dwz?k
438,341,449 *2C6CC508B867DB98C6F7B4DEBA76A7B8E813CBB2 dz%(h
438,341,450 *2C6B6835056AB8044BB87EC1141E5F26AB3393B3 e1ectr05c0pe
438,341,451 *2C6B1E57BC7DADD0AF5F930BCF255B41BCC42BA6 EBBY-HALLIDAY-A-FRIEND-IN-DEED
438,341,452 *2C685EE906A7BCC1BB039CD206454F098773437E EDDYMELARA
438,341,453 *2C6E036730C67FB92B401FE70C6EAC2A5B7C0B9F ED.LAMBDIN
438,341,454 *2C66FDA83382D068267AC76A4C4FA4A1CBC2C6C0 eduardomarovich
438,341,455 *2C606E3A0564F9CEC907139C8BE28A28E1D1963C EESF0
438,341,456 *2C685C06AE2F3904E46F34EC64454630D047B92C ELDENUHM
438,341,457 *2C626ABBEDA72AEB4EDDDC45D973F74B9CAC7EB1 ELIAS.KULLING
438,341,458 *2C648AB16A6F683E9B033F8D59D49ED70A4B6FE9 ELMO.HEIPLE
438,341,459 *2C6D54703EED14BED25A55EE141D4515EF7A5FCF elrrh
438,341,460 *2C67C1A52C6CB3CEDBA40AF6B32DC9206353191E EMOYOD
438,341,461 *2C645BF863FD3ACEB86515E4CE8C9586A43C2836 EMPFENGKNUSS
438,341,462 *2C6B9D2B1A9D4AF3C3704ED4F5D704E34801A401 ENCRUSTI3
438,341,463 *2C6411FA79D2EBDC9B0CB2EA002FC6498C277EA9 ENKQO
438,341,464 *2C604D8706E4E4A44ACC77B470F35E6E629437F9 e=ob
438,341,465 *2C64BAD5ECE1BEADF4CB4CAEF226838EF7CF82AB ergotic
438,341,466 *2C6A579347D13DDB7E42D37E12CBD9C2010C7EDB ERNIEBARRAS
438,341,467 *2C6BE365C759F3B555B76A128F053A79EDDAD4DB erofoeht
438,341,468 *2C654253B61ACDBB7D30AB10BD373DD143842CD4 esin.engin.orkestras
438,341,469 *2C627478D8BEBD201FD7C9EBBE2861131CE290F4 ezradonawa
438,341,470 *2C60FB19D2200684C7C7113BCA9974658C442615 f0xtailg
438,341,471 *2C686380FB9AA99F3F4AB1CCED6D34DFDC511BD4 FARRY123
438,341,472 *2C6E3C558C034A3E77CFD50A0CE58D5ECFC32950 favoriterir
438,341,473 *2C673CF08B74D18A778A6777953B562F9EB11CD2 fn0_
438,341,474 *2C6041C07D0341A8BF98D00B5F06A73AD498B69A FORDNURSE1
438,341,475 *2C62048D6D53023D80D82BA59CA0FBA9CF474DE6 FOREST.MITSAKOS
438,341,476 *2C6D028E0E85EB1BB6314DC606443BD4CE1E6F1F FRUMENTY
438,341,477 *2C64132E2E001C32EA71B804CF7A8F67DC78E13F fuluius5
438,341,478 *2C6758451EC0117A226D9EB767212061B1F42773 GARDENOFVOICES
438,341,479 *2C614254C28BA98D8648809C25D481FF84AC1DF2 GCL123456
438,341,480 *2C6E8A6BA107945F8EA4F1AA4853D4A2821A3B43 GEADELT4
438,341,481 *2C631E52BCE1730A7037B153D2D172A85BDF4B6D GERALD.SUESS
438,341,482 *2C6C1B6A382063F3AA20BFE1D450515804C3F13B GERARD.YOUKERS
438,341,483 *2C6286874D0FDB9F5048078162E527578E39D80B getterete0
438,341,484 *2C6FCCAC186FBCF7DE23DEA7C65742E850060454 GJENINNSPELT
438,341,485 *2C6969D8D6C37465FB09431AD549B3515BFF4E86 glockzin4
438,341,486 *2C6C2B69FC26D8595B77CA99EF6968E0E7F76F48 GOLFMEDIEN
438,341,487 *2C6D889D3EE0A1BF8686475773C5401579E4E401 GREG.HAVEMAN
438,341,488 *2C6EDDDEEF7B92FDB5691FF8F9C684AF84EEECC3 GSNIKTAW1
438,341,489 *2C63EFE985CBA1FD9BEF1AD1B65D56CE7C7B7AEB GTBRENG
438,341,490 *2C6AF579F042B2F651CEEB96D2D8325D21C90FF3 GUDIDES
438,341,491 *2C6D8A125D7871F9826FD7C153FBB4DBCAA27D53 H03B4RT
438,341,492 *2C60DC6502FFC240567F5F67DCDB02F5BC34E36C +h3rm0p14$+c$
438,341,493 *2C6BDB4F346FF16EEE8919CA50B1D7E40DB5BC17 HABITĀBAT
438,341,494 *2C64689B14C42E96C6A0ABA448E1A4B3120FD8A1 hannelena7
438,341,495 *2C6A2261F58D1326C6FA673B60E7914628DCAC22 HANSBUCHELI
438,341,496 *2C6C92A544536CA3C0768CE54A9A64DDA7FCC9F7 HARLAN.CHISCHILLY
438,341,497 *2C64AB50C866C43FD010FB4F42D59D8D82BD83FA HBOFEATUREPRESENTATION
438,341,498 *2C6864530BC562019F9A52552944B2B342C6D62F heathwallen
438,341,499 *2C6FDFA2DA26BFF1887F538C9BC07D198A5EE21E [email protected]
438,341,500 *2C6CA8F04C715661553D906428252C44B22D11EA HEDENDAAGSER
438,341,501 *2C614C877594B5D2AB5B4D83D0870A9BE3DE9166 HIDEAWAY-(DELACY-VS.-THE-YOUNG-PUNX-MIX)
438,341,502 *2C6C51C7596CB1B4227542A3361BC83EE146CAAB HILARIOROSSON
438,341,503 *2C6DA5AA1A13D4D178B95093CA1F12EFDB38A480 hold.on.to.me.(feat..elisabeth.troy).(vocal.dub)
438,341,504 *2C6591D16397F9C7EC1C0E6572453B80B2F554C2 HOSEAGERONDALE
438,341,505 *2C65F760D1BDB069AB7661CE0D0112FEBCCC73D9 hotspurs
438,341,506 *2C6B0DD598DD12715DF118B6738CDD946ED7E391 hpprdk01
438,341,507 *2C68BCA44361620593542649F8D99F268F119314 HTTPWWWPCGCCACANA
438,341,508 *2C6704A2C20B90D4E90288608D5D3489B5D3B636 httpwwwwauseonk12
438,341,509 *2C64BC47094D86452710F528CC4EED6382D10BD9 HUGH.BARAYUGA
438,341,510 *2C60981E5A825A9491B5A4DB5FFC7E1751D358C1 HUNG.SCHLESNER
438,341,511 *2C6A967CEFC3D8AE965ADDBA6D28A3D2C847BE8F HUNTERVALADE
438,341,512 *2C63DCBA5F3B81AC46062161C08221D5794639DC [email protected]
438,341,513 *2C6ECBA21EFEE15BE2F06F315D74D22F4807D623 hyfen
438,341,514 *2C67EC165B9E7D8258EB6AC61CD3FA1B91FF2E42 if(deleteservice());
438,341,515 *2C6B54665990F77F5B8CBFF437EBDC65A863291B I&FF
438,341,516 *2C6AE935396D5C617F5ED15120E432BD7848321D IKEROHALEY
438,341,517 *2C6647F252E2BC6AA91055E85ECE0C6586024355 ILETHCIF5
438,341,518 *2C6FCACB037CA23B1501AC0F848DC51C89A8FC32 I'M A MAN (BLACK STROBE MIX)
438,341,519 *2C622A69D582E33A50995B2239790E62D7DEF319 IMELDA.TAMPUBOLON
438,341,520 *2C6F2062B39FFA3F3E098C8E6F55CB54A85C387D IMENJAK2
438,341,521 *2C67C166B7E733F6CFC2FB06C799ED69EDA51148 informaticus5
438,341,522 *2C695D8CB7F14A4C590E2BED9745DA3D4ABFE337 [email protected]
438,341,523 *2C60D1365182F1E48A03E3F091DAB4F2FA1D399F irvinwinkles
438,341,524 *2C6D693AB04BC9BEA4B8B852C5BBE52CDD5D8439 IS-LOATHSOME-IN-HIS-OWN-DELICIOUSNESS
438,341,525 *2C685CED2532C325C8DF664B75EA75F24197C66D ISMAEL.BARRIOS
438,341,526 *2C63423C735A9AFD539CC2E6F3853CE327FD1F5F IVESON0
438,341,527 *2C6A1933A63348E810F9C9A963086D2307E0615F [email protected]
438,341,528 *2C6B84627A093BB950CCA9874C6449A88211082E [email protected]
438,341,529 *2C6D5F73BC0774F4348C75840D663ED42E9FA9F4 JADFARHOUD
438,341,530 *2C62D83DCCE17F2DB20F4660EFA12B5D93885165 jagdkursen
438,341,531 *2C608AA20A7B957FE80FC57BF62FF37D569A2918 jaypatolot
438,341,532 *2C624715AB1880D5E39AE151B145B90E3F5E8A3C JAYSON.COMISKEY
438,341,533 *2C6E3183534AC56C958673C6F7F5D47651476038 jazz-blueschorus
438,341,534 *2C6409D22E063CE95228110A822299101406F510 Jean-PaulFreyssinet
438,341,535 *2C6FACCCA4854167555876D39B1A35802403D230 JEROLD.PALKA
438,341,536 *2C63C6AFBA697FA88D081202C53E531588D1FD9C JESSE-ATWATER
438,341,537 *2C66578ACBC52E7518A6B00FBB44A5EA08B8BF02 JESSPENDRAK
438,341,538 *2C6C00DDD9976C40F9C83948198AE4BB720C2AD3 [email protected]
438,341,539 *2C63F03FDB7BDCB32F0840A98F9A3DB6B24469DB JIM-LAPE
438,341,540 *2C69A7CDD20F63B99C42B5C67D93836265E42B5D J|JP
438,341,541 *2C64377A694D009CA9F9106109D4DEDC9B32A997 JOHN-BINUYA
438,341,542 *2C63A60350E1CE24031827618EC5A0A8A3A30624 JOHNDIETZENBACH
438,341,543 *2C633113FCF194B73E29A6D1C20650FF03D86255 johnnywidera
438,341,544 *2C6E8DF93D9696C11F13C6FF2FB1918EAC788C45 JOOTHAI
438,341,545 *2C6037633448555BC95BDAF9B445535C12A522D6 JORGERANA
438,341,546 *2C61A37037F1D49A43F26B21CD640F57D568573C JOSE310790
438,341,547 *2C696836E010D7BB9AEDE5B29A432515CEF852D0 JULLE94
438,341,548 *2C62AA72BA65E9178CA377CAE52C23811FB6279B JUNTLOIAS1
438,341,549 *2C6FA1116DA30CD9C64E25D6C053941D76190BCA J&WK
438,341,550 *2C6DEF5469C799F38F2B4F0A323857750F8A11B3 k)2!
438,341,551 *2C6260873C27D05B2E2119BE262C5F214343C28F KAPITULI5
438,341,552 *2C66DFDAC8F03AF7E9287EAAC70C3A85B7504B61 [email protected]
438,341,553 *2C64B6C44E060B7232A54BA874E3DFC6CC9A67E7 KDYMM
438,341,554 *2C6C61E65C443BBCA27D7EACB86804702C70E286 KENDALLPOLLARD
438,341,555 *2C6B3E91266200B5A784CEF485C16E49EF3ECD46 KENNYFARRIER
438,341,556 *2C6A2456B0380021990650022D8DE6519E7A24F3 KHANROYAL
438,341,557 *2C607376A1713595DAC8B575F3933579648FAAC8 KICKIN
438,341,558 *2C6AEC495836B30FFE9D2CBE41C2BA9FD4CD3E73 KLAINHENDLER
438,341,559 *2C63774B2DD9C181FD5B15992795135FDE922F40 KNESON
438,341,560 *2C61D5D2EBB0BBE4CDB015FC6CBBEEB7A58CAA11 KODSSI
438,341,561 *2C610D3536815BF7C205ECCBD17FEB465228381A kontaktannonce-for-dyr:-dovendyr-/-presser-en-ven-til-dig
438,341,562 *2C6E8D53897D89D2BBAFDB0E7FA51EEC9D5D44BC KRAIG.DALESKE
438,341,563 *2C6D2FC1679C23EFBDD781B558B708DF94A4B085 kuohinta
438,341,564 *2C659D234005EAB8A8C1DD258CA4437836308D93 LAVERN.BEECHER
438,341,565 *2C6F4ED97BF986CB52F166C8C87420800ECE62D5 lenmellen
438,341,566 *2C6E87DCA2DDFF8532F9E78AF2F533EDCC7F5C2F LENSWIFT
438,341,567 *2C61EEF27E7F344D5BE099F442999CCDC2815A02 lesterhabel
438,341,568 *2C6325119469CE9FB8E132FB89516519CAFB3CED [email protected]
438,341,569 *2C638A61713243147F38E405ACED791A3D205D52 [email protected]
438,341,570 *2C61B7794D85915B48F04AC6AAC099B1CCA6FFE3 LINDA-RUTH
438,341,571 *2C689EA37515C390DB8F42881A028078927F2656 LOBSCOUSER
438,341,572 *2C6E3D02D8DCD255F00474FB019152F5D504A7D2 LOUD,CONFIDENTANDWRONG
438,341,573 *2C672E1944478FDF7CD4C9832DDB16244C01F6AD LS6LS6ALS6BLS618W
438,341,574 *2C66B9B1ED477701C9CD3721938AD4BCD9E6FC30 lucid-dreams-2
438,341,575 *2C618DCF375A0771741C9E64B0580D7EE9D12EC6 LUCIUS.LOOS
438,341,576 *2C6F3F43C25D825CC82EEE0F31D8D424F608198A LWOW-PANORAMA-M
438,341,577 *2C6F431D4CAB8D0B1AB72ED530730F82E190A1EA LYNWOOD.RUBALLOS
438,341,578 *2C6B55F73719EA1E2C74F7B6AADDF1785B5F5E86 M0LD0V4NU
438,341,579 *2C67C688CA1C114001F06A17B3E002BF62F56250 m3da1chi
438,341,580 *2C6F16770C617822DF4E291577C9B4956E13D738 M48AA
438,341,581 *2C6E6CB7AA1F41BAA5D804FA835DD2F33E4ACC02 mahadihossain
438,341,582 *2C64CBE315529326408527FF3CD53B677E753F44 MANIPU1AB
438,341,583 *2C6BEAA6000DE5CB022C9250554D037AA19CEF1C MARIBELCANOY
438,341,584 *2C6EB1248303ED0ACFEADA8101BBF7470A447025 MEDULLATES
438,341,585 *2C6C55CEA69B5B0B400BC915E6C1654AB843CC14 MENANDRO SOLVER
438,341,586 *2C6111446E768EBCEBA1704AD8467FB95A4552D7 MESTARI"
438,341,587 *2C6832FB0AA67E19D5AD1D7BD9F5ED4F3B61F332 M.I.A..(MISSILE.IN.ACTION.MIX.BY.MACH)
438,341,588 *2C66092E1F5068D3CFD8181C211CFC8514F949DD michalecockerell
438,341,589 *2C6A5AC4B15C35947E1D7AC385ACB569FBA33340 MICHALE.MOTTLEY
438,341,590 *2C6780BB06161958CD3BE8C95158B2B93787C9B2 microsoft-games-executive-describes-origins-of-project-natal-game-controls
438,341,591 *2C612BD671FE48EE368EA113E924B88F31A769F7 mirza-cavalic
438,341,592 *2C6CB2547D713EE55829DF845A8FD1CF04DA981B miss-you-(thin-white-duke-remix-edit)
438,341,593 *2C63A2E6A2154D7D43408D3073AB70131F2F2A3B MITSCHELEN1
438,341,594 *2C6AAE7920E4C254EE00FF2C556AE88F767DD5FE mitsubishimonitor
438,341,595 *2C6991EEA11183AA419EDE44B968D059E3BDC93B MO1DAB1ENE55
438,341,596 *2C6D728EBB9F67CFFF03BAA172D8C5041EF81294 mogilche
438,341,597 *2C693AC005E2AF91427072AC648E9CFE0BC1BC74 [email protected]
438,341,598 *2C6873C7D4D97BC7417AE6D480314DE588BC9233 mosehoupt
438,341,599 *2C62EE4BF7615D911130ED7B5BF1E89964D204A0 MTEYMORY
438,341,600 *2C678E7888D2A6CCF2083FD7283F4CA4B1997979 MÜHLENBAUERFIRMA
438,341,601 *2C64CBA114247591B9F468C849E1946C6C5BF2B0 mumtazbaloch
438,341,602 *2C6089218317391B37227A2C6B0EE6E71C480E77 MUSCLEME7
438,341,603 *2C6C754FF297D7B47D6CD4C61F54EEA76411AFC1 N8'~
438,341,604 *2C6A3BBD2B091612F78E9B870F52CB68E6ED4D07 N$_A
438,341,605 *2C6BEE14DFE3C8A02ABDDFB677542DA9A423A379 [email protected]
438,341,606 *2C638E5F08FC67BB2E82EF64030FFF6808FE211D nathan-coad
438,341,607 *2C6FBAD27BF45DF7835D7065D0C93DE56BEBEBE8 NCRTRLK9
438,341,608 *2C6261631154628F6ADA1C078B3326A1CC88BF8F NED.NIRMAIER
438,341,609 *2C68BF30AAC7B4F269C70FAD2AE290F7A7082758 nefiac
438,341,610 *2C6C406C707917D02D2D6EDEF5C7187A505345FB ninersisabelle
438,341,611 *2C6D4D8D19316FA4B45370ECDB374D4BD448B85C NOEL.LAPALOMENTO
438,341,612 *2C660726CA389C6136CD6A792B02A8AC17CE27A2 NOELLE834
438,341,613 *2C62EBF80B314F65D41D77509BA75B10F4AFCACA NOLA328
438,341,614 *2C62007C5B7A139BBDF3A89C9511F4D6682602E4 NORMAND.FORRY
438,341,615 *2C683275C18906FD2A20191EA414E432DCF55CB5 ntetsuya7
438,341,616 *2C62F74030B2E4BAEF5E70D2C8134D064AEA2FCE NUC134+!ON$
438,341,617 *2C6298B62ED3BE022F531BF5D48E35F585395FD7 olenmonfore
438,341,618 *2C60CF91523A2B3BDB84F70700445B13DC040309 oml}
438,341,619 *2C6B5C263DC30DB73A9C7F8AD4AFFE151AD4A762 otherwiseobscure
438,341,620 *2C62ADAF3C6C51E0896B03149281492A3CB23552 pantaleon.santo
438,341,621 *2C640B15832F25607E3F29E647556B34B944C39D paris—was
438,341,622 *2C65866385712C5D263B65443042CB1AEF37355B patrwoi1
438,341,623 *2C6EE6C2756142DA0C97DE320D37A64DF698B8A4 PERUSTAJAJÄSENISTÄ
438,341,624 *2C6026E024C306D1D5B905CDF88538183C5971DA PMID17162368
438,341,625 *2C6AB2B3110317F7F9E14188419AA09A443EFD2A [email protected]~osploit
438,341,626 *2C6164CD272401AA552D4D95699F352FA3D48743 P> ~ ~ ~ SPLAT!!
438,341,627 *2C6F6153765B4FF78D5CE73CF7A4D85A2F825F09 QLAVERY
438,341,628 *2C69E6429AA0CF06FB98F4C7646A43B7D8633025 QMORTLEY
438,341,629 *2C663DB7A8EF02BC71ABCCC87BAA9A49EA1B8CE6 QUADRIUNDECILE
438,341,630 *2C66B0BFCFFEFF5F0952866851427C5F8E56A707 Q-->.~.(X)
438,341,631 *2C620FAAE502CE98A9E8F6323A6E41D080DE4CF6 RAEGAN726
438,341,632 *2C616637FD2FB789A9CCB2287BEC22FE86CA01CC railspluginsorgwww
438,341,633 *2C6C3CDE056C38DDD46CA0195D6FE8B09A095BE3 RÄKANDE
438,341,634 *2C67926A81EEB9B5EFE50459641F421419C62F72 ramball3
438,341,635 *2C698E3E8F7ADA7095DA148F7149F185E8BE4B07 raymondbaggesen
438,341,636 *2C6A2B55433CCED497411FC06A5FD9C6DC6D8111 RAYMOND.WALLER
438,341,637 *2C6B003132AA56AAF5E3F2AE9349046183C3D568 really--of
438,341,638 *2C6DCF8BAC5E6882C978C7A32FEFE4593CF5DC11 REGNILBIRK
438,341,639 *2C6B03DFD8C22D627D6F681CB158BF46270C8AD2 REGULERINGSTILLGGENE6
438,341,640 *2C681BF4605B091C7F943F6224A3FD8A341B889E renaldocoones
438,341,641 *2C6E99C219B5889A5EFC6BB0EED0179B1AD24DB7 REYMARCMACALISANG
438,341,642 *2C65CE0FE87C72B0D5BD44FA90C3D670C185DDE3 RHETTMIMS
438,341,643 *2C6FEF64A59F51FE96246E20A185B85EAD531E17 RICHARDCHROSNIAK
438,341,644 *2C6DA60DD41ECFFF95877C1B90E37BFD82C76E77 RICO.COSENTINO
438,341,645 *2C6DFF36A8AD0ED64D7798B3727D7DA844169796 RICOMINIARD
438,341,646 *2C6E6DBB85D0E33359D64F8898E571E77C6F64C3 RICO.SPIVA
438,341,647 *2C60818AF15D12F374305AE84C4160D806AB894C RIGARIGA9
438,341,648 *2C62C24E5823342D61AA93206F9C8D68B95E2250 RINNEGATI0
438,341,649 *2C6ED780EB021B93304DF44C6F511559188DA1AA [email protected]
438,341,650 *2C6BC55DFDA88D6B0F40A99B5BF27411D26E4A91 ROBERT-CHESTNUT
438,341,651 *2C69D6D8736F5954ED7C6A791CA539C92539E9D0 rossmcfarlane
438,341,652 *2C68B1B9C1BC4F0527E750306C3137A19AB7E4ED RTCBOYKCXKSING
438,341,653 *2C644067602107E00DFB7433996EA60D8C96D5BB RUBY BUI
438,341,654 *2C652C9E94CAED9CFC7A9DA1185691780B4939EF rubychisholm
438,341,655 *2C6F1422715156E7C7B18073AD2F2297DCE60D1E RVOLLBERG
438,341,656 *2C6057FB1389274A1E42C8699AABC51A9AC3B74C s0780060
438,341,657 *2C6162EE3CB9A52527212CB61075C5689D48B2BF SAJNIALBUMCOVER
438,341,658 *2C6BEF868ECBEB6F0455420485C8CCFB25C58564 salopekpenned
438,341,659 *2C6DC366FF991B5E2BAFFAF81111C596F26173F6 SAM-ETHELL
438,341,660 *2C6B335DD659BA6F3C1A220AC84B48D77E15F30C sammiematskin
438,341,661 *2C659AFAFE9632860D0E7D37AB53F826D610C278 “SAMUILOVA
438,341,662 *2C67021AC5A3EA1E6B57F3D71A21B1EA8896A53B SARA.WATKINS
438,341,663 *2C682BBB5E7E72A8BDCEE75DDFE66BB687B9736E SCHAARST6
438,341,664 *2C66F88FC778FA597B3D87BE150752988924ED92 SCOTTIE.LARDONE
438,341,665 *2C660A819508F31948036922CC201D531BA6BE2D scottmonster
438,341,666 *2C66F8CDBA387FDE29E0CF12D30ACCEF78E77D82 seifiton7
438,341,667 *2C6552D058D01AC8F7A1AAB389A451DFAD473757 SEVIDIO
438,341,668 *2C685DF19996CAF8F5AC1270BC5583EE2D3C8F13 SEZINISASID
438,341,669 *2C62C79C82F3126086BC8FF22A81BF69FECA8540 sgomentate
438,341,670 *2C677FC4CA94F664BE9374793C40403C35631FD5 shermanmangold
438,341,671 *2C6F81AAF254A28252E5442F3AB300A9558FD170 SIDDHIṂ
438,341,672 *2C64F294F93FF6AE764EE0921EAD6BD0FD9D0C1E SIDNEY.IENCO
438,341,673 *2C670253C42F75A1D220F19502107890BC029381 SILASHASTON
438,341,674 *2C6A2673A768C31DCC4675977B330673BED70F99 sin-s0ili
438,341,675 *2C62286821FC6F8D0FCDE1C69ED5C70063219245 SKYIN01
438,341,676 *2C6164FC8A9CF0DD9E6AF897AD1F0A461B7D3BED slovenli
438,341,677 *2C6E9048EC3FEB3D2D45B7BC2C6F1F985E3C228F sonatano13op27no1ineflat:allegromoltoevivace
438,341,678 *2C6AB7B6B2E41019B34673323A67875CB3665AED sonkurtzer
438,341,679 *2C616508A6A9F11A462EADF16C4215D235DC3B21 sorbait
438,341,680 *2C6A5979A30572333186C6E28D4F18F0F38FC1F4 SPECMAPS
438,341,681 *2C625BE4DDDC97447391D6F5AEC71E40D68BD3AC [email protected]
438,341,682 *2C66A7DE3A05E9294639819F63A215AE3FBB6330 [email protected]
438,341,683 *2C670BC43C08D111B546E7713BC9E2EFEDD7017D SRCMC,S///@/R////'K//M//K
438,341,684 *2C642E3E1E5B8B1A652AD795C9B30E0821E2591A SSALUSEP?
438,341,685 *2C686A90AA364E9617C540D9B9B1BDC6A8A2962C SSTUDENIK
438,341,686 *2C63E552C133A9D4C8B945578BAAA17781BFF0A3 STARZAUBERKÜNSTLER
438,341,687 *2C622ADB82C8F9F3389F2DB48D43A4C2B5C26954 symphonie-no.-2-c-moll:-va.-maestoso
438,341,688 *2C67372EB834BA8D9DA77D26C291139098137C0B ,[email protected]^
438,341,689 *2C6062C3ED9E35498DFA1205007CEB47137D9F7B TAESITATIT
438,341,690 *2C61B91A1ABB270DC5E209D1894743461F6F696C tandyxxxed
438,341,691 *2C68E29BE2B38B364909F44FF0590821DC72F47B TANTR”
438,341,692 *2C618D77EB695188ACEF9682A19D81906445BD73 TAYLORBUTZBACH
438,341,693 *2C6A57728350203CA1174578C4B39681F632BB44 [email protected]
438,341,694 *2C6D5FE67502394FB2568FA7B2CB8F3C600B08B9 teevenss9
438,341,695 *2C6EBD713497EF963E34229591447E9F5E99B27D TEODOROSCHRIVER
438,341,696 *2C64372B81F7F1B43D5D68E94A6E4697C434D029 TER{V{KIELINEN
438,341,697 *2C67E7F0C28C800457E7D3EBB9F2F653F10AA3E6 THATTOM
438,341,698 *2C6A49B1ABAD3EDA03CB1933DC7A8E845238D660 THERESABAYLON
438,341,699 *2C64C9E8137CD736E823C61F26B321D2ED89E0CA THE-SWEET-COUNTRY-SOUNDS-OF-RHONDA-TOWNS
438,341,700 *2C6651B8A7ED781CCA242A0880276B6A1F9A4213 TIM KURUCZ
438,341,701 *2C6BB223057248C3F6E6C3B4EB02781BE755276F tjaņdziņas
438,341,702 *2C67803E170E7AB9217F64BFB743EE667F398FD8 TOBYMEHLMAN
438,341,703 *2C6215238697101A820A8D12E2A6ACA94B863261 TODARMALL
438,341,704 *2C63FE4353D8899320387192DFB831E7321801C0 TORY.BUSHROD
438,341,705 *2C6921CF6CE709F209853CFB84B6A3B4A3A5E079 TRAN HONG DAT
438,341,706 *2C626F0992EC680E77510752641726C073D0F5A1 traspirava7
438,341,707 *2C601CB2E06206DB6FC42BAE239C4BFF24DB9266 TREVER.FLOYD
438,341,708 *2C6284DF50B313F2E0F52252AD49B57B13CCA9C0 TREYBALE
438,341,709 *2C6AA2AB6171EAFA07BB6FAF083F5D22C7572140 TREYWICKS
438,341,710 *2C650D11465CDA2FA22DDCAD4CB6056ECBE7674A TRYSTAN MAC KENZIE
438,341,711 *2C6C294B10AAB962EE81430138C27A058CF86AF1 tutanaklarına
438,341,712 *2C60E8A6456814AA0039403AE19A29F27767D5A3 UBRIZGAO
438,341,713 *2C65898BABA7907A8869CB8499E1EEBE2C2A7D9C ufficiasting
438,341,714 *2C67686CC92B6F6BC090395D1E596A1317D80E65 Unappe7zng1y
438,341,715 *2C6A233C2F80A013B9AD068A579DDCC86BA47874 UNCLE.ELI
438,341,716 *2C629F36854510D22985A997C5839ECECE6813B4 [email protected]
438,341,717 *2C63EB3FBE6B4C9C20A0DB15DA98E4D5256678AE unigravida?
438,341,718 *2C6FDBFB7925469088D321E2ACB0E0F0C2240E59 unpenetrably
438,341,719 *2C61030F1464488FD689D04C5681ADE2B52B2B09 UNWRDIGSTENED
438,341,720 *2C6325953C6A6B8BC83790B7CEC6B44EF0B2E68F UPDISPOSEDRAWDRAW
438,341,721 *2C688182FCC4ACBA6D4B60A098243AAD95B717C4 URFJEDER
438,341,722 *2C65949C0B176663D41B04EE0A3C459FD2FF08C5 VAMSHISSK
438,341,723 *2C6DA5B19E5818375D9564800833AB3DA940C435 VANABERRY
438,341,724 *2C6402B01F5C74FD9659D4AF6B4E1D860635D0E1 variationsonathemebyhaydn,op.56a:finale.andante
438,341,725 *2C67AE0B398221980E6CCA4CB3B6C18AF181770B VERNONKANOFF
438,341,726 *2C69837B184AE6B5CE391458D16E1C7CC21AFFF1 VICKANDHALLH
438,341,727 *2C6B22A11D727CD298273E15C5314D9DE64FC461 vicky.lurye
438,341,728 *2C6075F8AA494CE08980606ED84574B794078DC7 vic-rawlings
438,341,729 *2C6D4D43BFB62722293EC16E6029DD1E37B662C8 videoperformance
438,341,730 *2C68D1F569A83C29A9A9ABA4D70208084F5556EE VINCENTBASKETB
438,341,731 *2C6251F8F2C46065CCC2991A0249190893D6A7C4 [email protected]
438,341,732 *2C6A7D6348E530AF3830FB4EA693AAE1A4076DF0 virginiemorel
438,341,733 *2C61D9CA2EFFEAFDB5891E2321E5BF34EC261DFB VON.BERNEWITZ
438,341,734 *2C64370B42046B36D67B9C2D37113B7B1F860BA4 VOTERGASM
438,341,735 *2C6AB3BB03306D3E0106543D20C39AF22901ED30 WALLYFADELY
438,341,736 *2C6A555C32242B16E9F4E73A9DBB2831A115CF50 [email protected]
438,341,737 *2C654F77528743F0883BC9D981B9EC701F8F5AA1 WARD.GULLY
438,341,738 *2C673020D418A377A59A74A167E9213790C84355 [email protected]
438,341,739 *2C66CC1B53ACDE548533D6BD2BC694BC21C0AB33 [email protected]
438,341,740 *2C6D963FCF0B2EAFEDB00474FCBDBD9761794CB4 whelanthewrecker
438,341,741 *2C6141B2C0C0363316268BAF0FE4AEC505D906B2 whitelilyflour
438,341,742 *2C64BD08B4F54239E0FFA9C15BBFA348362963D0 wilsonkawanza
438,341,743 *2C6BC846BA08B2CF39626812099A03FA7BD2A551 worst-band-in-the-world
438,341,744 *2C6614DB7732F59C3A9AE924E208F461CA94BB41 wweds2007
438,341,745 *2C6270DF8431D56A5F5EE62208547EB9BF123DC9 wwweric-idlecom
438,341,746 *2C6028B2C849CE56C6341FD2837B1919F2AB03AC wwwinventionifiach
438,341,747 *2C62763BE16647C271DC81330519D74A91DDA640 wwwscubacoibacom
438,341,748 *2C64BBF68272588678EED19C3F471247FC238F17 WWWTEAMVLOCITYCOM
438,341,749 *2C6B3E97EAA739CDED76A424B2FE25E482A151FD X0KIMBERLYY0X
438,341,750 *2C64D8121223AE3392902EE570EC2F99454DA35B [email protected]
438,341,751 *2C60299970B05DD335F714884809BCA04472C8B5 [email protected]
438,341,752 *2C60A325D1F67D168449D9466DCBD7C672E85D9C Xを開発するプロジェクトである。しかし、NEOOFFICE
438,341,753 *2C6204F7770EB1D0B79B8EB00290171A0E1F465D [email protected]E.CN
438,341,754 *2C6330C8FC34EE403B16D81A2F368A65D13308AB [email protected],[email protected]
438,341,755 *2C6EDA139CCE548D3BBFF71E66DFC779FA04784B YGOLOTETC9
438,341,756 *2C6B188D598A71A462D864D4D86291FE804543FC y#i>
438,341,757 *2C6C93C46D6DFB08A2467DAB5199574934A67E76 YLISTJN8
438,341,758 *2C6896C00D6F7CC1171924EE8BBDD66155109B75 YNPG
438,341,759 *2C64D5845992E7CCD5CCE70FAAFEBA7CC1C59949 YSYESSNI
438,341,760 *2C66B26481CFD9BA7FF19C3EDF17C879D16E4AAB ZANE.BRUHIN
438,341,761 *2C6683325A81E4D310BA1D25F0FA6B11EC267F6E ZARNA CHAVDA
438,341,762 *2C6FB52DA17D8227C60C7ECBCB1B235C108261C9 ZBB
438,341,763 *2C6CA9D7ADB978011F23BDF543D25871FBD9353C zgnt
438,341,764 *2C6A339CCBE554EE51F81D3E094619508923B6D7 [email protected]
438,341,765 *2C6F45A248FC33DA817977AB9BB7A2355B5E3D95 [email protected]
438,341,766 *2C6299A5CA734E458D773D912763E635FA890E77 zharm.muhamad
438,341,767 *2C6A09E1380AD4C069CEFABE321929DF9D2E5D3D ZHONGGUOPICTURE9
438,341,768 *2C6980BABB35494C092B93A1203685323450910C [email protected]
438,341,769 *2C6472B91DFC2AE8A1576927E89FF912CD36CAAE Z:OT
438,341,770 *2C631ABD246AC0E455F1BF02A08D4295E436CA2F ZVEROLEKARE5
438,341,771 *2C668E92C8BD14148B551F6BC9BE80682C83E9A3 καπετανάκη
438,341,772 *2C6762480259DF1D999A721898CB777F75F20A4C КРАИСТ
438,341,773 *2C6C02DA162A043BE87AA7A9DEA5E26D591D1FFB мраз
438,341,774 *2C697E6C035550244D902F442ACFBF62AA20ABB9 ПОБАРУВАЧКАТА
438,341,775 *2C686F56C630B67A8E240226A75062CC53EE624D хурхой
438,341,776 *2C6B013AD8381DBE01552F8B160D53A34538F747 ШАЛЕЙКИС
438,341,777 *2C62F266CDA12AD9AF6035EA4F1E0C728815DBC4 0016525 sex
438,341,778 *2C652D152C16F03C754B0530964D1BF53C9B8C9D 05011672
438,341,779 *2C6FC7BF719135D1930C3C55433909CB58346791 122722163A
438,341,780 *2C646302D1E30AE8B8E86D23E28093A418FB2561 1381<SA>
438,341,781 *2C6E89190022AC31B25E54FABB4689718A22C3CB 1701DNWS
438,341,782 *2C616479298DAC63DFC1B516B3628AC59A9F788F 1706173 KOKOOMUS-VASTUSTAA-JYRK
438,341,783 *2C6A122C3942A58029B7F2B5A3D97CF7A0113EEF 1710382 LIIKEVAIHDON.PROSENTUAALINEN.NOUSU.OLI.17,2.%..
438,341,784 *2C634EAFE18C08A45BD451CD4323B1F3E08EE8EB 186.REDNERPULT
438,341,785 *2C66CF47C8507E9D6120AFA654C4F79F701B448F 1990/JUNE/30
438,341,786 *2C6A112589743E4FD1270704F178E66527B1F85C 1 ambient-levy
438,341,787 *2C659FA5DD2C122AF24C9908AF1E8993EA90AF18 1-ay-johtajilla
438,341,788 *2C642FAA5B144F65C9E52385D2B15B44D61EF243 1.bockwuersten
438,341,789 *2C6A45B9FA9752E239086C401E57A10374E1B7CA 1ETLEBOME
438,341,790 *2C66F6D8B44160AD18E32F18273601644A5D4262 1FIDESZ'S
438,341,791 *2C6E2A74C680FDE8083380A8CA4539D0DB79B20F 1-grosshaus
438,341,792 *2C6DE372AE118586F5008BBDF5DA59CAC8F9276B 1.gUdaydin
438,341,793 *2C6FE829DB080FCD025DC75D57BAA0A63EDC38BC 1hein
438,341,794 *2C6032E4BD0D7C0123A93E96520B514B54A6CA54 1.kansai-flughafen
438,341,795 *2C678A61D2DE727C7FF90E8F9FDCEDA49B926141 1konsu-j
438,341,796 *2C6F6CB6D4E4D9487E379B9060E47BFAC912AE69 1.linjaautoreitit
438,341,797 *2C69849850EE1D7BDD833988F311A0961AF4235C 1 MARIANS
438,341,798 *2C6599BB5FEC70B5DA696F7651236A625CF47C5A 1MECABILL
438,341,799 *2C6CE2ED035FB0CF7D42E32616A12D327DE8A11A 1 NEMETALLMAERKTEN
438,341,800 *2C640BAE04BC7A6FF8F8DE55CD72090525E73377 1-nykymusiikkifestivaalin
438,341,801 *2C698A8ABFFE1F9D2A802C3FA74F2E05297D051F 1.PECANHONEY
438,341,802 *2C6132430ED927539CC61F14621B6AFBC922DF4F [email protected]
438,341,803 *2C650AFD822A1ADB193245366E7E7986BA352C70 1piousness
438,341,804 *2C6ACE716AFFB14EF5D764C637F39D268C89AE30 1-selbstgeschaufeltes
438,341,805 *2C690BB1B432F5379E31C3055C1A3BCDE7202362 1TUOREKILOLTA
438,341,806 *2C6443941439C5F4BB9F95D9B52B72D9EB7CBAEF 1.UNERWIDERTER
438,341,807 *2C62A7C2CAC199E2EFF303E5048B96627DECE8D2 1VAIHTEENHOITAJIEN
438,341,808 *2C65F9A646DD467D3F15D02EA55C47B7EE748B48 1.VOLKSWAGEN-MANAGERN
438,341,809 *2C6C72AB7A0CB160B8596AFDFB712F2DA1C2680A 1 WANDING
438,341,810 *2C659B63DF570F7BD00EA023FD5E2F8908B18D47 1 wenndann
438,341,811 *2C6572FF17AA849E81A40ED318F118509EE4933E 1zombiuttamaa
438,341,812 *2C68CEF55CDF2B0603F37C424482677DFEB35ABF 2183908 lauantai 14.2 . 1998 mikkil
438,341,813 *2C615EA491E4B801EE9E7CCC4979956BB7521EF1 221ERIN
438,341,814 *2C6D0060E8EE35ADF9ADD300547874B392B3F47C 22.SPEZIALPRODUKTE
438,341,815 *2C6106CCB6A98EBF9F2EBBD9D7D01830EC5EFAA3 2473266 AND PLEASE FORGIVE ME FOR NOT COMMENTING ON THAT ONE
438,341,816 *2C6565E7887593E6ED28CFAF6B93224F1040FE78 2495732 avoimena.on.ehdotus.ostettavien.osakkeiden.lukum
438,341,817 *2C6EB3C81C6A83BD41BFD1F10C487DE24C6CEFB7 270292 (.EI-...FETH.S.:.A.:.29.)..
438,341,818 *2C63304E7FBB3E2F07EB78E2D5BF91727BBFC643 2719417 karhennuksen-vuoksi-ei-pistoolin-pit
438,341,819 *2C6053A5204381794025ABCE0674C8D9D0928C08 2921832 kymen.sanomat..rekister
438,341,820 *2C6EAF1CBD9F5D89CB27311364118AB7FED17A3D 2950263 UUDISTETTU STRATEGIA LUO NYT L
438,341,821 *2C61EF931610ABB705D3789D18747348CD8FC1B7 2999924 KOLIIKKIVAUVOILLA.JA.HEID
438,341,822 *2C62663E190DCAD039DC23CD3F8CB2AB0E23B186 2CUDEIMES
438,341,823 *2C608F9B21CE5B067942D5E2036B671D37A9373B 2IDROSBSW
438,341,824 *2C690ED1E854D90CCDB917F83C53AEFDBE6DB263 2KALVJINS
438,341,825 *2C668C13359034B22F7A9987B7AC8C65296999C3 2-soschtschenko
438,341,826 *2C6121018983E8584BBEC6EA6AC0E80642FF2B6E 2.UNTOUCHABLES
438,341,827 *2C69C5CD2F77D84225BC59BD903BCB7624A02A96 2UUYZIHS
438,341,828 *2C6C069D837699A9CBADA858D2DC1962C956A730 2VOELPKE
438,341,829 *2C65F9F6A4EE13DF91EA7C042E507AC704CA0FFA 30 TY
438,341,830 *2C698837DA35305F83D9A353A6EDF97597513BEA 351875 bendoesnotspeakatall.
438,341,831 *2C6090F60F8ADCE5D1CD709985226F6792736148 378 BEARBEITEN
438,341,832 *2C6367C096CD93F252F44977F5B2DB37B210204A $3ALCHAR
438,341,833 *2C69B8F71B91772938D314A3D4D315FAD1E5393B 3B<~~~DB
438,341,834 *2C606BA031980FCA87B7930F66B9688FC1F50403 3D ~O SPLAT!!
438,341,835 *2C642AAF38FC99C833D44E5EBD95678D179DA5CB 3.INTERVENTIONSKAEUFE
438,341,836 *2C61D4B0B3E67897D9DA7534795DF0F200613A2B 3LAUTLOS
438,341,837 *2C676ED5C86C150904A2355F033BF215475DFA74 3-q:ta
438,341,838 *2C695D0C1324E0806548276150BF209FCAFB904E 3thatsupport2
438,341,839 *2C607F004C3BE308B5FCDC2BD83A179BE5285B16 4-FILMVERLAG
438,341,840 *2C61C38EB5B98871D49E1AB0393BC79417C54963 4GONI4R3S
438,341,841 *2C61F07426E53C112318E488A8C7FAD8171ACF50 4LIVSDUGLIGT
438,341,842 *2C6A4C6C7068DA03759A48D9446E7D4AA159B802 4$$ml47ed
438,341,843 *2C6677DB07E480A924E0A75418CE3BF24B26CE60 4 PUHELINVERKKO
438,341,844 *2C6FB0BC51FC7F05804F46CB815CB633874D7290 5AMBACHTSBAASES
438,341,845 *2C6CC895201172C7EEFF09595A541C47A398B033 5BRIGNULL
438,341,846 *2C6729ED17D06273ECA32FBEF780FFE213E20722 5COFFEELETTER
438,341,847 *2C6E8E158870F83A62B27A4F23B7CDA2732646DC 5DIVIDENDENRUCKGANG
438,341,848 *2C696B4CAD5ADDA411A59F3B253D1E0B90AF3382 5ILLVISRK
438,341,849 *2C68BE16A1274DF9C21CEBC38B34AFD035F9A3DE 5STEPHENCANNONDA
438,341,850 *2C67BF7C5336B04D9FF6EAC3CC81F07BF25D52A2 61kastner
438,341,851 *2C64AD2D1E99D0809F1F39757AF4598445C3551E 665549 selvitysjasuunnitteluteht
438,341,852 *2C663ACB1AE03008474BE4875FFE31530668C53C 6AANEENKNOOPTS
438,341,853 *2C6324E5E777A3B31BAABD910D4D7FE6F315D52A 6BSWACKBARBSW
438,341,854 *2C6E2E020FBD2F7F3CAD18A0A87D403B9EBB3285 6COPULATIVEA
438,341,855 *2C64ECE84AEBB69800C3084B30E0B919760968B7 6EIMONOCEHTOILBIB
438,341,856 *2C627E35BD7FC29F033169C7592712E0F742C97E 6ETKAETROOBEG
438,341,857 *2C68766C832785AA5CE713570EBDA735D5DC7834 6HYDROLEIC
438,341,858 *2C617A9E355044F05A893C763730BE0F9544BCBF 6LACIDONM
438,341,859 *2C635BCB7DFDAEC3FEFE5121212ED3F3B6C7D496 6LULUANDERSON
438,341,860 *2C6E7FAEDBC1C3252F5AB36B4387D8E21F5B9D84 6PLANETSAILING
438,341,861 *2C60A852937F69489F934C40397C93458894E94E 6REINSPELNINGED
438,341,862 *2C6168CDC7481802C228E6C2D84038633FC02920 6RELEBLOS
438,341,863 *2C63315FC33C0A70CC2A796463B73B69B7E63461 6RETROBULBARS
438,341,864 *2C674BFC2F376FE1E5D196B3FA76459C7D78AF8E 6YAWDLOH
438,341,865 *2C6B2525FE3B809F1F507CA342AC6A5B9E7257C1 75850T
438,341,866 *2C663DF482FE5AF547607F73EEAE990FBBE41FE4 78.NOTDIENST-ZENTRALE
438,341,867 *2C635A78B68391E184F2C2277955C76171752F32 7BSWHUERISTICAL
438,341,868 *2C6722FF7C5CB7D36F0EB569AA756494F78636E8 7BUTTONSMELANIE
438,341,869 *2C6F06D3F72B903C20815ED53B4EA0314A7F187B 7CHKTOKBSW
438,341,870 *2C69A89ACFA97A0EED80FF9BF1DDCE883FF40235 7HEATFULS
438,341,871 *2C695EA50DCA3B57E11534413ED697E32251866B 7INCLUDIBLES
438,341,872 *2C6D7CAD4412E8EAE847030B674CD7B61E23A8B1 7-parwan
438,341,873 *2C639FD59BA709F682401BF069AB5F5FA8CAF5BC 7STAINED5A
438,341,874 *2C6B0AE7843B976C05961CEFE97A179B6E3CBCC6 7TIERTSNE
438,341,875 *2C6F54CFB766CB16B4EA5C24DC753FF509F91731 7YTILOPBSW
438,341,876 *2C67DACA968BE7904F1CD0B72898C247B313606F 835beatrice
438,341,877 *2C62B931352A0F6FF0EA0519144C0D5F913D4698 8CAILIBSW
438,341,878 *2C6A5AEE0E79B71CE94E761A683A37271A2835B5 8CHUCKYDIANA
438,341,879 *2C6576119635E87599431912630D20DE68B2A1B8 8DELETEGNET
438,341,880 *2C66168DA64D365C89ED6107BB37ABA62EDB9D5D 8====d~o~o(00)
438,341,881 *2C6B4DCA8720FC4EE0BC5FFBCBC6F6CB9B75C867 8gustaient
438,341,882 *2C64D70530B4DBDF730B5AFBAC3EF5313C7DA71E 8JUNIORANTHONY
438,341,883 *2C668CB3718531BB69D0F89D38741AA351BB2038 8kasbeheer
438,341,884 *2C63109CB5A56120AF05C73CDB9999EE379996F4 8MOLLYBITEME
438,341,885 *2C6F12DA5F34FE5D1A2A666FFAB8CB3A9595DB8F 8OLDFEILD
438,341,886 *2C6E42B6977B36B5D690461A9995BCBE564204C0 8######P ~O~O (><)
438,341,887 *2C64D801317561368CD00BC8B203CEF4011DA978 8SCHWEISSFSSE
438,341,888 *2C65E15B3FDD0BE1E818724B704567834EAA962A 8SHARINGRELAT
438,341,889 *2C6A245D0528A883EB5952D1A5CD74DEEB6B9025 8THEPURPLE7
438,341,890 *2C638C9C1D4951D4BED4FDC58B91700A4358F361 9BYRON0
438,341,891 *2C6050173270E672F45F1C1A1BC8800A8B99CA56 9DUCKIECREATIVE
438,341,892 *2C6EE206293198AFB045463ADAF466AF54E8B70E 9GENERANS
438,341,893 *2C64EADA85641BA004A1342200C74708EF08F23A 9.kreikkalaiskatolisen
438,341,894 *2C65F4BE41A6F2105EDF4CEA3E020A335F868D49 9LIJDELIJKER
438,341,895 *2C600047073019E7A9FA7347209F81C5DE2487E4 9TOMCRUISE
438,341,896 *2C67416F5FB2F78E172845576BCCA9B9CF73D5C6 A0BO
438,341,897 *2C6974896B90D3561ECB81C7EE27CFEDC9B6284F aaa(b
438,341,898 *2C6B5C57DA955962A4FFEA2469C921BAA7E73AEA a%b=7
438,341,899 *2C6C63C425D49B2089D2D09794549999C70F573B aboutheelmake8
438,341,900 *2C67DE15F7D84A34EC4C4B2E873A1596EF98ADB1 abu'l.banaat,..vater.von.t
438,341,901 *2C66E4064613920DB109BB4A6BB969034877B23E [email protected]
438,341,902 *2C6CBCB10D926AAEDE1A02D30D6D7FD83BF3E7C8 ACDZ!
438,341,903 *2C62CA3453833B715844DB6EB4A7D5B5892AA060 ai;6t
438,341,904 *2C6A13E929B802F5908A27C44B6585AE76B4F1AD aindigo6
438,341,905 *2C6FAE900770AC4D8788933C682BCD46FD56D26A ALDO.OATFIELD
438,341,906 *2C6AC8E022072AEC9B29202F60831500854BC70A alecmoitoso
438,341,907 *2C6FB45D04B325AEEFF949E395EF111CDD75A0B8 alexanderroucoulet
438,341,908 *2C698A37CF69BB58C42143EC803CAB4A34E631D6 ALLAN.BUENAFE
438,341,909 *2C6AA97C4597C6DAB45367ED97AA24E819423F0E All.The.Way.Back.(Shades.Of.Mbaqanga)
438,341,910 *2C6D5B951E0D3AB12CD5822709664E5899B6AE79 altersfreigabebeschränkung
438,341,911 *2C617088A4E4016EA0C35EDDD4176FD1BCE43EF6 a:lwb
438,341,912 *2C68621A5AD24D12E35FD5E009E86E5D62CC2A22 ANASTASYA8
438,341,913 *2C640C08ABABC6AC227E8854A90F0A6871CBA960 ANB$B
438,341,914 *2C6D61A767A72BC91399C79D86C959D3FEF974D0 ANDTRANCE,END
438,341,915 *2C68362E7D86C1AE9B1EC3F94F7C78B676C50E9D aoe#
438,341,916 *2C66549B1C39AA2E8F731A9D21B117B1D5971D93 apr,
438,341,917 *2C68D3BBDF6E4DC6785396A47285C25CFC11038F ar0#-
438,341,918 *2C63665A1A013F32D4E6D8025BDEC75151188262 ARNOLD.ACOFF
438,341,919 *2C6236B0F90AC174242FF4E8C743BB7FA6898800 ARNOLDODEBRITO
438,341,920 *2C6BDD370855C4BFAE834FE7F485BBB5DF2252D5 ARNOLDOLOCKWOOD
438,341,921 *2C6021FA82E35956B632C12C04B7CDD609A5E278 ARq
438,341,922 *2C69F3649CE040D1B040A09C4A96235555CB18F0 arthuryupe
438,341,923 *2C6E63C3F1F3D522BD8D7B7F344181796AC6CD58 [email protected]
438,341,924 *2C62E9A007977115EA8B54F8667ADF1B5585B577 ASDFGCARRIE
438,341,925 *2C640D72697457C63E90EDD2C6FAA656BCE40619 ayrilsam
438,341,926 *2C6D2F30D2BFB702FA8E9D9D7DF38C6D630266FC AZS(A
438,341,927 *2C6B3CCD3A04D3A90046F306BD23B94EA35D1EEB BANDITSYSTEM
438,341,928 *2C61036F40B4320E3DF07739D0EB7DC59EF31794 BBCNU
438,341,929 *2C67CC20875D28EF96FA72488EB4FFD1D9235416 blafaselstadt
438,341,930 *2C635CF56E695931CB1980DFF9675E28E7CA42D6 BMS$
438,341,931 *2C69E832951CAA3F34919110393DB9A3D36023D4 [email protected]
438,341,932 *2C64B9EB2E0DAB0F90AF1064F64DCD9208D9951A BODY-MINDS
438,341,933 *2C6BF32EB0DDBB9388B6494BEB79B251996CB156 boejy
438,341,934 *2C62FA787F6587C76E22BCB177EDECB1A38C092F BOROVIK13
438,341,935 *2C65138A9850E1EECFC11FDBF4272BA6F791F4FC botryomycess
438,341,936 *2C6F187CDE8EBBE226D3F422E99E7CC9B54B9766 B.&P0
438,341,937 *2C606706D0A022AFCFB1D5AC68D7B9E37D9F748E bradfordvavricek
438,341,938 *2C68827076ACB0DAE8FE99AFCDF91FE5A3D04F47 brandibear
438,341,939 *2C6EB9C283C7506993BFD38DAAE6FE21136D8450 brent-mabe
438,341,940 *2C6D979AA00E3AF5F5D67C479ABFEA052BB588C3 BRENTNELSEN
438,341,941 *2C63F4436F409A68B061D1A7317D83D3992F3F47 breu/
438,341,942 *2C683C524756AAB2AD2E87BE4703029820FF1D32 brookswilmeth
438,341,943 *2C6677341EEA3F82EA6D9BC71C43404D106311FC bsfr
438,341,944 *2C6B28550E98D243F267304D8F3D750789D0F4BA bswabgeschaltet
438,341,945 *2C64F4A03200FED5B754D856CB29DDF583BDF60B BSWBUFSCHBSW
438,341,946 *2C6EC13F21EE9A7D8E6BC9689814572A4F7FC58E BSWMOUSETRACKERB
438,341,947 *2C62A7627A17D0334D406CDE1B58A98D0F73B92C btgee
438,341,948 *2C677753640DBE7530BB435EFB3E3B17DBA05DAA BUCK.VALLOTTON
438,341,949 *2C657101539536B392DADEBC204F120C1586F8C8 bueda
438,341,950 *2C68BC8902B1BA4B53F01AB5D1E9F6F543390ED0 [email protected]
438,341,951 *2C6D6E7B106FBCF79344F5178B5D7C40FF4B0937 b!)un
438,341,952 *2C64D36CFFADAD588CCA4B74E43479F5732529A6 burtmclaurine
438,341,953 *2C6EEF85833BD35F4BDCB82FB15EE5FEF1DA1180 BUTTERIEST
438,341,954 *2C6C7DE2D0A6E5A7BD9B28BF2554B971395A016D BVH,
438,341,955 *2C68A1DBECBBDA5A9F7CF87D88063267DBAE980C bwbrq
438,341,956 *2C692F5BE2971E5C90BC73F906E03FA5D2EC83F8 BWXNC
438,341,957 *2C69EA9055125717CB1486119D335255E4A7CEDE BYLLERNE8
438,341,958 *2C6E056285FCDEDDCFD9B210408144916F889EE7 byrob
438,341,959 *2C66B696BD918AFDF89E14953344909C5DD521C0 C0RN3LU5HC
438,341,960 *2C640CCFDAA8CEFEF5650E323B4A3B7E6BDC57CB C2)3J
438,341,961 *2C6F6B8C013F5C36A1EDBF615C17D62CA1CC5C72 c2(k
438,341,962 *2C65DBDB681A5A56DEA21CF3DEDCF89A01FB369B C4S9;
438,341,963 *2C66B5C11D0204D254E968ADDD0013E4807405E5 CAGIX
438,341,964 *2C640A0969F571AEDEC5E3E1FB74346AA1FB4ACA CAOIMHE88
438,341,965 *2C66BB6A8AEEAB9946922B5C70D74C683942F9A4 c#dev
438,341,966 *2C6ED82E852DCAC3BEA3E439D0ADFA4ED69A6EAE C?EBI
438,341,967 *2C67A3F24195B34EB562F67793E8A7FD09067A4E chadmicheau
438,341,968 *2C64C24BCC9E34E393CA988ECD8CD4F281097183 CHASE.POUGE
438,341,969 *2C6EAB174AE777A9AF76026788FC610950A22ACF [email protected]
438,341,970 *2C630F39C6C49AB7CAED7D9FC4D1632862A29651 CHROMIUM8088
438,341,971 *2C6C4120B308AFC6CB54633F2AFDD6C41C302E77 CICLONE12
438,341,972 *2C69D92C1386FCFE4461A0C0FB9032F086AEBB6E CIHANG
438,341,973 *2C686055BF740BAF59C30280F9D64C61D45FC989 cj)&k
438,341,974 *2C6912CC47382620DB9500689C6C96EB34B5D1AD cjq/b
438,341,975 *2C6D33C1AED2AFD41B05B032BEBDB23FC9052893 C_JZL
438,341,976 *2C604D99CBA6DA2989D88624163418600F451A5A CKHG-
438,341,977 *2C61F364A371DFE01B9A45801CECC4E573294B71 Cl%C
438,341,978 *2C6E828A74C054D3515B86D00D568F8008ACB3C9 CLINTGELMAN
438,341,979 *2C668B3F0E91AE12791D108332A470B17F2518BB club bizarre (dave gadbois remix)
438,341,980 *2C69C40C88BD7756B4C8F751ED4E53892DA36B07 cn&0c
438,341,981 *2C6E84554D8CF0DD5C3ED3181B2C0777CD021B9D COHABITERAI0
438,341,982 *2C63D4E72FEDB1E84E24025773FB0C5E4B376BA2 coleenventer
438,341,983 *2C66D8D86DFF6BA0816ED3448E03F13BE9C94538 CREAKCOLD9
438,341,984 *2C6134B477FC39FEB92D2A566AE9F27C01422376 criticalvolume
438,341,985 *2C6BE6616BDF6FDA2B8F08968149CA3AB58EF47E c=s5x
438,341,986 *2C67A480989B8FF93F21F0D24DA378998475C15A curtsaiz
438,341,987 *2C615D249E17442BF479AD50B04AF8D78339FC9F C+.#V
438,341,988 *2C64AFE4EFB722A9C559521D64D51CD6EEE3CE53 czgwp
438,341,989 *2C6D756BE5D68A560370EB5574788290B386742D D3A7
438,341,990 *2C6CB34C3C0CE05A97F7B6AF0958A9FF10FCF0DF d4?o(
438,341,991 *2C664F0CDBD2DEC4261DE1BAD31485C21FE4436F d83wy
438,341,992 *2C6F21468EA360E7020B183BA8E8046F47D81BAD D!8I)
438,341,993 *2C6C5B27F25455F6C7FC4C4AAFC6F4D03D71C120 DAMIEN.DESPARD
438,341,994 *2C697BB4C352795B3061ECFEF9142D2B0C326B81 DAN000IEL
438,341,995 *2C6C3C2E40411580CF270C33E667D63CDFD8F81D DANIYAL MEHMOOD
438,341,996 *2C639762F7E6425AC180206590241407C22E04EB darner
438,341,997 *2C6CBDC89F29B3E3FC8F27FBDE3A611662529180 DB69,
438,341,998 *2C688438296894F8FF22CCC381DA157C1C74EAA9 [email protected]
438,341,999 *2C6FF95FCFE288CE2EBD13E207D463FA3EB51F5D decantais4
438,342,000 *2C6C5818E7A6B25F4CDF427DA51058A2156348B7 deixarmoses
438,342,001 *2C6A26C825F9B512DDFC92EFC033DF3DA06E4DB8 DELIHRIG
438,342,002 *2C612CD52391C873D369D5708EC6307B5FE7CD94 dem(7
438,342,003 *2C63046C07C4A05B9C2FA04C23EB91EEA017EA44 DERRICK.YANNUZZI
438,342,004 *2C68AEE2C986E8BD4701D040DA2C86F5566EC5A1 DETROITBABIES
438,342,005 *2C6DB2230BE33A674079CB8C288FDC8142A79D10 DEXTER.SAFDEYE
438,342,006 *2C640036D6B670EB3E18CC769DFB361CF3344A2F d?f+y
438,342,007 *2C6F1F0D3A56D12047DAE081F4195253C481C0EB dg9zo
438,342,008 *2C6E8E25013AD8575CD021F0F5536712132A9DF9 DHGCB
438,342,009 *2C6E8C9A70CDDAD10C4006D9DBD7AC832EA0E407 diane.obal
438,342,010 *2C6EF3B584E3113347C0B79DAD526B0AD9DFE94E DI(DD
438,342,011 *2C6A0897C7AD1A42EAE7121220585CE334CC2AF4 d&i/h
438,342,012 *2C6BB2FD50306545AF36D70394C3291D2D66092C DINM4
438,342,013 *2C65DA7A87D710ED47A1CEEC339C67D93F3FFF6E dkk9g
438,342,014 *2C654403003F43E4396AD06D00DBD467F2DE1731 DOCKIZING
438,342,015 *2C671EBB72B2DB6A0C7507AB2CB601375A1A7A04 [email protected]
438,342,016 *2C6B925EE357FB338A4C3050A9EF612536875C18 DONGSCHUMANS
438,342,017 *2C69E6EB37EBCC9D30C1E71A39AF42813DF3B605 donkliever
438,342,018 *2C6617ABE4621608BAB5F45A03C3313AA08BD640 donl-
438,342,019 *2C62DBE66A34ECBBAF49E472B52A4D11F06C825A don'tgocrazy,gotosleep
438,342,020 *2C6296379527AE7BDF7B399BA4CD44767EF45DEC DRCOCO
438,342,021 *2C6D47220678CC8F22CC361F1B4D7D62C1773997 droomgezichten!
438,342,022 *2C6DAAF9B63099C055B2C641657AB3FBF30886F5 d-rz,
438,342,023 *2C686F795ED342746FF2970D09FAEF98540656A3 duaneschaper
438,342,024 *2C63BDAA4BEA7518A8067B97CCC7E5B40C955E3C D!V#
438,342,025 *2C6894C4F1FB39CCEA77112F7B87FD9FEB45AF48 [email protected]
438,342,026 *2C60716B2197C89C402972289938FC5309465106 EDGAR.SWEENE
438,342,027 *2C65890A79C11E72ED64E8D995575D817AE735C8 ed$/k
438,342,028 *2C60DFD5DC13A8DBE53950177A4688A0A5C161D4 EDMOND.HOFFSES
438,342,029 *2C6031BFFDD892FA8EF82A3B1D5D81A9B2E76D3D EDNEGNAR1
438,342,030 *2C68EC4022E408F23470CEB4E0B08FD91EE28719 EEKTR
438,342,031 *2C6BFA0DCCD87AF0FAF79338E5CF3A500C4FA648 elazd
438,342,032 *2C67DC3090E916BE4C383ED1050264FFDAC5D1DD ELDON.GUYETT
438,342,033 *2C68916FFFF8CE646D386594AAFBE242B5C7F93F elfedaly
438,342,034 *2C6E76EA9F5C3CBEDE5090C415373DCADA9741F4 ELISABETHPALUDETTI
438,342,035 *2C6E2F2B51088BF6342660E0FD4F95FE9B265757 ELISHASELEG
438,342,036 *2C6DE3E3E133DAF9775AA8A0339EAC1670075475 ELIZABETH ANN ROBBINS
438,342,037 *2C61C0E490F0219B63E6320E00D9849539F66304 ellen-mohr
438,342,038 *2C633767150B61CF2CADB2E4B8448448839FE710 ELNDB
438,342,039 *2C60EE992A18AEBFC7FB5CC5802C93CB0BA2D77C eltondeross
438,342,040 *2C665A63A8EE8E14F8E5D3D063C50AF6CCFA5786 ELWOODYRAY
438,342,041 *2C698D16AB6D41B534D79BD3744E4790016AD946 EMBEDERS2
438,342,042 *2C6B1400FADC04356B710B4CBBD22B41DFB3BECD emiks
438,342,043 *2C6653807919CCB16FC460B0874D74B6BA56C882 ENGINEERINGMANUFACTURING
438,342,044 *2C6446F413262D26590E9446EC1910C8E14D495F eo5h?
438,342,045 *2C6D61CE6A2582405E45DEADB11D784034302741 EP5|
438,342,046 *2C680F8EE0C269ACF7542E9C911241759BE4A2BE ERTSEBNO3
438,342,047 *2C6EA5BECD5233AD1A1B1DFA4BAFE5F0AF343CFD estructuralfuncionalismo
438,342,048 *2C6BBD5312C420579FBFF172E1AE716A78A690AB eull
438,342,049 *2C6A4B88D7EC412744F526212E5CEEA5A8E6D9A5 [email protected]
438,342,050 *2C67717F5BEFDC4CE5410BF3CA8AD3E699C99AA7 exhumes
438,342,051 *2C65DA60CF458FD324CCA89E306BD8CBCB6FD216 fanbush
438,342,052 *2C68E166CB5DC8E76CD6A6B26EA82F4A3F93B3E4 FEDERICO-GUILLERMO-IV-DE-PRUSIA
438,342,053 *2C6663D6081A4C1CB951F6DFF1E43D37F683C9DB fedora..f.ih0.d.ao1.r.ah0
438,342,054 *2C63734CF4442B54D551A1B40C4846D338768B5E FF9
438,342,055 *2C624DEF5418520EB86126BB502C91B972AB210C FNBGJLVQ
438,342,056 *2C630CC87FDEA7471F4E9B8C534DD6500B16476A forestgatti
438,342,057 *2C6D58EE59AC94B3B18E07FCF4A29E06F8DCD48C FRAILTET
438,342,058 *2C6FB07DB1F3C299146EEF92CA2C4BE2BB56F0E5 frank.dreistadt
438,342,059 *2C658CF94DD6F1CB1AB3240338CC2A044989EE34 FRASIERREUNION
438,342,060 *2C61275C4D62399ABABB68371FA13A498E1B55B3 FREDERICK.VARANESE
438,342,061 *2C6FB9959E4348497C10BA1CCF09B4991273EB40 FUJQ
438,342,062 *2C6DAE17D2647960349EB32179B8586FB02F1388 GALE.WANTY
438,342,063 *2C619C5BE828947C5EE8A47F0EED7EAB84FA9342 [email protected]
438,342,064 *2C6F9ABE1A743100B337CB41B43B9BB9A1EEF477 GANTLINE
438,342,065 *2C6A4ADB2A52DFF8F4E4F4CA1EBBBA466F40DE41 GARYMCENTIRE
438,342,066 *2C612066498D1A4330CA1A05E27C18E193A3A9DF GASIFY
438,342,067 *2C6D46587EE0633B09042F65230E3B245A7B3844 gb|"
438,342,068 *2C6A6D73300BC8411635E4285D8CF5328B02A517 GESNEEUWD6
438,342,069 *2C656E764C67DD013B4C626049FC87432EEC7BC6 GLS0180
438,342,070 *2C6AE9CABFF48DD4744B92E30E0E2446250BB1BD GNILYONA
438,342,071 *2C6C5A2A00BFAA46851B6F92487B59D29A7AE9E5 [email protected]
438,342,072 *2C6A395F8AA90105041CFDC63AFA13105AFF32DE gourance8
438,342,073 *2C691029E5B0109496A07B350F38ACA720395379 gouryu
438,342,074 *2C6788801184493226BE7E0E4D066D09234749DA GUDENISTENIMISE
438,342,075 *2C6A276CB81E840C330AD009D17E372FDA070693 GUY.KARPIN
438,342,076 *2C673C48ACAC072B46B597FC5FF071AD258DE142 GUY.ZIRCHER
438,342,077 *2C614238DDFAD0E4B2F632394A23A13C30CE844F HALA'L
438,342,078 *2C6BB2FE8A4326D960ACB127ACF68C2A350ED01E [email protected]
438,342,079 *2C6D9D0E9A571646E992964DF2E76461C85ADE3E HANS.HOVENGA
438,342,080 *2C69A330610F2AF1E8000FF705F3767FF89EB4D8 hd#<
438,342,081 *2C692D57DA0EA85A648F0CF048E45EE19E7F4EDE HERTY.NAVA
438,342,082 *2C6D5F21FA3A74A0390600B7890962FE65D4A4D6 HERVEDAU
438,342,083 *2C65071B03A18D0591E309B895223B893AAEF7B9 HFWK
438,342,084 *2C6754C021CEE0C07B0B3707D754BA43E50CEA45 HOLLISMCDANIAL
438,342,085 *2C61AD48FE08F5CB4E44CD9E4CA6EB07B6DF1267 horses14
438,342,086 *2C62EC274233CBB9971988BAE0CFF4965B65EE4C HOWARD.DASGUPTA
438,342,087 *2C67397D53D53E551C3624C552653F0506E66EBA HPMYLOTYC9
438,342,088 *2C66038389A9AB12466F08D9ADE97DF78A6B693D HTTPWWWCLASSICQUEEN
438,342,089 *2C6839CAC6D9052B7E09F4372D484EC3F7061D6A httpwwwmusiklexikon
438,342,090 *2C675E0FFE66BB5C8C28A3FE5A194895AD28FE48 [email protected]
438,342,091 *2C6D2435DC5628634EB9DAC303891FA1B67013C6 hugonr
438,342,092 *2C6D3C0FADD7F864D3E4C57A944B54CD1B64CCEA HUGOVANEPS
438,342,093 *2C6564E81E2BD9BA3B3491D207B5FE04A3799126 human-computer
438,342,094 *2C61ED5B4CFB6DBDBDDC050276534002B183127F hunwicks0
438,342,095 *2C63851642FA9ED2E5A6DFC32BFC9FADAF396F0A HWXKRN
438,342,096 *2C655E5D23D60F20E04256D2041DFE5C3684D4D9 ikejabour
438,342,097 *2C6A2C15FE0C4D414F859A699DFF620CF98F5335 ILOVECROSS44
438,342,098 *2C6ED7C38D41F5A631B7C17BD8FC2DE637A2E71B [email protected]
438,342,099 *2C680A68D413866AFAAE75B8527B23CA222A0746 INCINCTA7
438,342,100 *2C61F2C3C179B0488A8B2F4A9C397E89B66A4105 intoxicatingcomintoxicating
438,342,101 *2C618085E58154384258DCC9167D72E1EEB9FBBF IO'S-DEPARTURE
438,342,102 *2C6AE91228C581D19E623E4DB9DB81CA7547DD43 iramccalpane
438,342,103 *2C626F29A2DCA134A920D186E3D4423F64270109 [email protected]
438,342,104 *2C6C7BDC72E9AAD2B94A125A449584D1B9BCCCCB IRWINSADLIER
438,342,105 *2C6103108FA990FD8549A9A563E1694B9F514F71 isaiahmcmickell
438,342,106 *2C6E729D1457BD951B539F64C22D677E02F13018 ISAIAS.WHISMAN
438,342,107 *2C66A2C3C77785998F7A3AFFD24E5EE9343BA4DD I,WO
438,342,108 *2C6A06908DDB3E9C37F982119EC77ADF8C5A528D izm[
438,342,109 *2C62432DBEF27D23A882E3F1F75E9D8E10517983 JAIMEBLOOM
438,342,110 *2C66807D4E5CB325F980FA15820C0426F6C6F675 JAMESEBASTIAN
438,342,111 *2C6DBF3D888BDBFEFA6DBAB9849567222DC4DB6F japanesemilitaryyen
438,342,112 *2C6EEEA57C5AD05A333AD6B82CD53CA268D8D671 JARVISADAUTO
438,342,113 *2C63D2AE6473D77A6D21B6B9A481D612AC3424BA JAYANTI DUTTA
438,342,114 *2C679595CB883D532FB8C788EC2B3CE6814BA8B0 JAYSOHNH
438,342,115 *2C63192D22B26D7604C2FC2B86BC5EABD17590A0 Jay-Z-Freestyle
438,342,116 *2C61A46E8CF77528659FAEB533FDEB79E713EDBB JEFFREY.HIN
438,342,117 *2C668C683E8B73EEC92D05B6D0D479A36113A95D jermaineraciti
438,342,118 *2C64BF6AC083F954C83DB13070C4D9966C7A2AD5 jerrelllamountain
438,342,119 *2C655D63925690CA356739EFFA35F6CA67AE7853 JEWELLSIDE
438,342,120 *2C68829B2E000000CA95CEBCDDE61B60109696D5 JEWEL.SHALA
438,342,121 *2C6877EC6A0E281E89E1D139233B0B1C7EB98E74 [email protected]
438,342,122 *2C6F39A37719690AB82DD99482E371F225565C97 [email protected]
438,342,123 *2C6A44E159A241F59C131ECA7E01A0067B56A102 JOHNATHANOTTOSON
438,342,124 *2C6BCD6F5C3A2965610C928EEB7D22726D2628E0 JOHNATHON.BOMAR
438,342,125 *2C684062787A12B05E7A1D4CAFF673CB938E7364 JORGE.FRAIN
438,342,126 *2C6580DE7F96C0AE318B042F59C5CD10E3A74276 josiahschaack
438,342,127 *2C6631D7043B9187C7FA02D4122E7C2C29CBA4C2 JUDAH.JAMES
438,342,128 *2C6B8CC9DA26AB7631D7F71446632CD4EE9A28B0 JUDSON.CROWSON
438,342,129 *2C6F6B8FF149ED8D79C0CBA404E9FB5D305BE565 JULIO.ATAY
438,342,130 *2C61A39BE5A0BCF9C53B86158A050B5B4A557E80 JUWAUNM
438,342,131 *2C6C2AA65A64EE793D894B407A672F55C7949338 JV3(
438,342,132 *2C6B5F0DB7F5D3C58735C8DC7AD323D3A0569A1B kamenetspodolskiy
438,342,133 *2C6FDC5DC267DFF988BF488C20D11948D9D76DAF karltins
438,342,134 *2C61E6122FE748FC848F2A87C796F289301C56FD KENDALL.WITTKE
438,342,135 *2C64C8F30C125AC9CEE778AF82F22ADE8CC560FE KG*^
438,342,136 *2C698EE19FA1D450F0DF6E45B77C36EDEDF9EEAD kirkmichela
438,342,137 *2C6FACB4430F90FC8DC8DD21756E567E7A3F989E KLOGT?
438,342,138 *2C651463FC28B5FBEC080C3D333E71BC3E341595 KOHLENKONTROLLKOMMISSION
438,342,139 *2C648FE25FB2831750F6E9483AFA6199FF0E96F7 KOOIMANS3
438,342,140 *2C62AACB1888CDD3865BF9C8074144245A5A0C80 [email protected]
438,342,141 *2C63A1392DFC360ED36058BADE9AEA984DABE9ED kuohuoyj
438,342,142 *2C605A4EFC4D6B1D5F458F8350D99D75AC813D99 LACYBARNATHAN
438,342,143 *2C648BC470EAB76C728462DF2B389588DC39A7A2 LANDONHOFF
438,342,144 *2C6BD6FA6A640EC24F3E087A9A08E529D5C6A1B6 LANGHURST
438,342,145 *2C65F5614425E395BBEAC502DFF2AE269CCF16FE leicester''leicestershire
438,342,146 *2C642316478C95F2523A3914826B5D2A422CC531 LEMUEL.LIMBERG
438,342,147 *2C6E087488CAE4FD24B652F94C8F5CE1DD3ADF7C lendanker
438,342,148 *2C63A7CF420BE9446F266E31ACC78C76671D70F8 LengeT'Agn
438,342,149 *2C67B2E135CE0D094BB16F606B493BF815C6F187 LEVERS
438,342,150 *2C6F395C73823C2834F9C8E5284AC768CFE870A8 [email protected]
438,342,151 *2C69EF84B4C514A330A4F739F52087B467483B1A LIKE35LINDECOM
438,342,152 *2C63AADD8BDDA401A73C1482E3F03EF72C6B019B like ourselves
438,342,153 *2C66DD5E826C7E7C1869503618FE927A903D51F0 [email protected]
438,342,154 *2C6812E2CFBA355F2BB2CAA3ADC2DA93FAD3EF49 logoanwendung
438,342,155 *2C6E51D81BFFB5A899271A6B742D5D1834093864 lovelinks
438,342,156 *2C60A60FD20FBF076863149B1077CFC39DD741F2 [email protected]
438,342,157 *2C682EABD47E93B9ED9483F29E27FFB56DEE6FDF [email protected]
438,342,158 *2C6FA3D5272F80C4EA24A301C929A1AD9C66BDFD lylepeeden
438,342,159 *2C67687C99CE19C888BEB93F670A8F887B305AFB M:
438,342,160 *2C62C424D7933DC5D28422484CE6A11992731775 M13727
438,342,161 *2C6B5681235FD6DF4B02B11F962B925F6E8F0C0A [email protected]
438,342,162 *2C6A738201C350F1DBFC8B193CF4AF7C1856840F maci128
438,342,163 *2C6CEB06402FBF3CAE408B75442424F6D2B0269F MALCOMHAARE
438,342,164 *2C69B55A5CA67751700BE0152DE842C4257A03DB malikchochrek
438,342,165 *2C6DB95FC4A94E84DC1F48ABEB3C68B28288C022 MALIKGERULA
438,342,166 *2C61304B73CA01E8B31627ACEFBDCBB6ACCAA3F5 MAN57OPPING
438,342,167 *2C62A7B5355897717B5FE0F45B9899D524D23C09 MANUAL.KAR
438,342,168 *2C60024875E459B195319A4772A29D9A9BAE127C MARGARITODRISKELL
438,342,169 *2C610C950D41C6F1266FAD1094A5B4DFE33D9929 marie-mathew
438,342,170 *2C613468EF0F24425990AACA3D4ECA31566A231F marlinerlebach
438,342,171 *2C6FBA876AC762DB47B862BA0D85527C8E06E6F1 MAURICIO.JASO
438,342,172 *2C6C0A089BB1A1142323A4F61160059D08D55681 MAURICIO.TRUMBLE
438,342,173 *2C654EABF30C618CDB19C026A333A716C1BF706C MAX.SARAGUSA
438,342,174 *2C67242FF33FC1538D2AA7DA38C52DD009BDFD12 MAYNARD.MARQUEZ
438,342,175 *2C68753C4E6814BE84D1F0276CF180A259F40C57 MEDIAZAKEN
438,342,176 *2C680934F2B8C583C42FA61ED9A0CAC0F4028AE7 MEDONQUELZ
438,342,177 *2C68CF2EE393CCF797D0008D19EA07E19495C3EA MENSAKONTOS
438,342,178 *2C6D46233AA4145661E1A6C7F0FBC8DA41619B2C miche11
438,342,179 *2C6C2C080F1AA6D904C598084A9EBD533427C263 MICROMEGA
438,342,180 *2C61FC6075CC08E7A86087E43505AB25CEAAE853 mi kerida lengua kastellana (free)
438,342,181 *2C6082CF18E2F1F7206585A6396569723B5A406C [email protected]$7
438,342,182 *2C6478BD383636DE8A6B551A4E31A8D8A1F71AEA MOFUIKE5
438,342,183 *2C65E5CE0CE971EB4E2A62D43B1C156B6AFD5431 MOISESSCHLEPPHORST
438,342,184 *2C6B95C1DC17BD3575AD0F9B4D9D52BF4A8F3B24 mscrelicchapel
438,342,185 *2C6720A23815FE49A52FEE5BA47F21EF76B1D381 N8,C
438,342,186 *2C624DB97A0FF5A3C18B16BC3BE591C185CD6E93 n`8r
438,342,187 *2C6C5E7AB6D1F378E430ADAC3D9C39B26DE6017D NATHANIAL.GREENLAND
438,342,188 *2C64E68404FC6452B26132D4EC3CBEE0AB7B2F3A [email protected],
438,342,189 *2C6501C66290E8DFD2EB6398651F43FB5EBEBCC0 nelsonlamountain
438,342,190 *2C6C7D806327A45B88B6B2489B918300C646A042 neoxyonyx
438,342,191 *2C6B0C47C26DAE4E34BE60FD512ED4704E684F98 NIGRICEPSAOTUS
438,342,192 *2C68B4BBA9C1B450FBB017EDFC558FF1CDC9DFB8 [email protected]
438,342,193 *2C6FBC7C2CAEDEABFA17C34F225C9F7282824DB4 NKALPAGURI
438,342,194 *2C605DD074D65728ADB0BECC2C4A499714DF0E96 NOEL.KINTOPP
438,342,195 *2C62BC735D60BE7E90D7D28B6878916AF1CD9E7D nothingwillbethesame
438,342,196 *2C66B23215A6D6A5AFF7A7E2493961764AA8DC88 [email protected]
438,342,197 *2C63A85063BD85956BB3FAE2610F41B74D9E43F7 (~_^)o~0~(==P
438,342,198 *2C61C1EC4307493C8E0EB3C48EEB0E2C6781EB99 OKLUDOITUMISEN
438,342,199 *2C677F0DF7379BDB956B22494CE6EB4BF669B5E9 OLLIESCHAFFTER
438,342,200 *2C6D85582C22A75454CAB91E5CBAA900844889F2 OMER.PENLAND
438,342,201 *2C6230679DFA2B82D2A72FBA23E036B8F9605DDB OMOKHABI
438,342,202 *2C6009EF61A6F15940163803391557DCACCE729F (O_).`@P
438,342,203 *2C66160AA6E3996DA3BE3EBBEA6B8A4B31A94559 orkneyyenkro
438,342,204 *2C6C462156AAA3D55B659ACD790E7F0E1ABE338E [email protected]+emen+s
438,342,205 *2C6EAE38883D4997AA1E9DE284CFB8B936E324A6 P0]AAA
438,342,206 *2C655B1FA8990D867A8C2BB39A74FE8922E959C3 p0th0ld3r$
438,342,207 *2C65D46B0A1587FCB5A6C5452BC520A745444688 partido-catch-all
438,342,208 *2C6B65D1A15C31F6F66B325AC71FBC5F449476F3 P----D-~-`>-B0
438,342,209 *2C61422BB27196B54561151FB375746514EFA973 pentik[inen
438,342,210 *2C69CE6457B3C2E3EE66FF3384C96F4A43641427 PEROKSISOMOS
438,342,211 *2C67E1DCCE25CDD3B521CBDD0A4DBB8D846F9425 phalgun1
438,342,212 *2C6825B7E7422E27C87D8FF7719D4CC29867F71E PHONGSP
438,342,213 *2C69FADFCB28E49F15EF1B33DFF499A328EDC13E PHYLLIS-MCCORMICK
438,342,214 *2C606E498536B78ADE9FFAEC06F2FC08BB9F5E76 PLANCK)。
438,342,215 *2C6DC9327DB3534D9F7EAE6CE3EE7F5AB477C938 pollen‐stigma
438,342,216 *2C6FB4615FCE51B000239ED8483FD2641598309A PORADKEM8
438,342,217 *2C653237AE5857F713ECF8C9908EBAC014BD232E PORTAIKOS
438,342,218 *2C63B6CE9BAB1B6657427D102FF4E81A1D03049F PR`R
438,342,219 *2C6933339EDE5EE653EA95C3D03FEE14C009A452 [email protected]
438,342,220 *2C6F960D9E319BEF72A0EAA0E55E7E71D9DE4B9C Q5V
438,342,221 *2C6FFD64B745B4B4EE08A951252C4F02B7FFE430 [email protected]
438,342,222 *2C6F895679D2F91D99F1A7E0E1F016C9501A4A0F q=-j
438,342,223 *2C69B7503E5616686936F217B806801B7C5AE9A6 QUIBS.
438,342,224 *2C63F477D9F55490FA615566A5E7E286D2F1C1E9 quintinsandiford
438,342,225 *2C612C60B85DBC66A33CC10FDB407BCDF649C8C6 QWKPFYD
438,342,226 *2C622874F44DD9B8EBF6FCB5AACC7FBDFBF39C47 RAFAELBRZOSTEK
438,342,227 *2C6B4CA6791F25466F4F7813A92CCB2D5030355B RAHUL-SUNEJA
438,342,228 *2C654E71F6CD78DA56F298A12294959F5CD9202B rajandaiva
438,342,229 *2C6250DDA0AE5F132082076C7BA11C474BAC1575 RALEIGHGRUBY
438,342,230 *2C6E9E045C1DF99E50A81DC3EC74A7855D767FB5 rambo1fred
438,342,231 *2C66AD4AA8A33E583BC72D31AFFED1FF60C989A8 RANDY.LIPPEATT
438,342,232 *2C6ACE6B8B91A6FD014ABB592CB549194D970761 rashadkishimoto
438,342,233 *2C63570A39BA8687DD4E37C10C3F701F92805C95 [email protected]
438,342,234 *2C67A144E3AA972A0FF85B4B2802FEEF5B84FA30 R=%BAA
438,342,235 *2C6D82F5B984C56BDBBB151A7EF3092AFADD2C70 [email protected]@[email protected]$TER$
438,342,236 *2C6C83B8480069DF7266777228CBE3AB69EC1FBA REBOLLEDO)
438,342,237 *2C6B4AD150C498BFAE5C06BE572007E5521BD453 REED.PARSA
438,342,238 *2C690417EEB80536058E3C02F7200E18B170AB05 reesinagroegno
438,342,239 *2C641D94F3FBDE86F9C9B0E17745121BD82F496B REFRIAR0
438,342,240 *2C67080E1ABF306D20C22304767CC9E949355DEF REGAL_GREG
438,342,241 *2C6AABA60AA944DC156DB7EC4B9DD660E51042E3 registe9
438,342,242 *2C685E6A15C3E1987415CC81C9AA4508F072D62C richrabold
438,342,243 *2C63E7C62F0898B705569F7CA21B49EF2DB9C8FB RICK-MIANULLI
438,342,244 *2C671469E6B10BE28F814C19DC3C0EA25985E405 RIN9LET5
438,342,245 *2C60424852A329B32D4EC7855B4D775E734C77C5 robertogarofano
438,342,246 *2C6AFA7C9E49F5AC644E53AF2D4D66EF87F01527 ROBINHENSLER
438,342,247 *2C61813B5BD1187971B269C202438B359AF1ED9A roblepri
438,342,248 *2C609647A1663DCF5A5D7970C550DD594F35B5E8 RODERICK.DANNATT
438,342,249 *2C6F4A5768204945928172C50E1DB271576CAA1A RONNYSTEFANICK
438,342,250 *2C67413904F7E85219C152D494A1A8E6AA676BBB ROSENDOBLONSKY
438,342,251 *2C690BF18997154A20A28C55C41E39B24C3774B8 ROSENDO.SARKA
438,342,252 *2C604B6B31F3E025257C24AC885631EDA0A602C8 ROSESKNICKS6
438,342,253 *2C60C20CB35E1BB2217715574419859B80711F93 ROUTERE5
438,342,254 *2C62CAF99CBA04838DEC1F41AC7719A5A87B6813 ruppalbsw
438,342,255 *2C60CF2A48DBA49CD3FF9270AD0760A04C39D2A7 RXC3
438,342,256 *2C66887327F27633BA7D095CA5A4F6FF8E0781A9 RYDWIK
438,342,257 *2C603F24D07B060A3E65439BA92B66E625AF7438 [email protected]!n3ss
438,342,258 *2C6AF13DEDED9CB53DD3B74075E0C9EFD134EAB2 SALGSSTRUKTURSES
438,342,259 *2C6EF0089628D8AFC1E1FB99386967F5E7C6D473 [email protected]
438,342,260 *2C6D641F270BF00DD2C0757BBE9775D5C3517124 SALVATORE.EDMONDSON
438,342,261 *2C623E9204420B1D3050EA1594C787CF0ACB1BA4 SAMANTHA STEPHAN
438,342,262 *2C6DDA2F578D2E149B6F08DFB94BFE4A84C1E3D8 SANTO.GUBERMAN
438,342,263 *2C6D93E6C8175DB3543EB0525B102FB11BBC148E sasquat
438,342,264 *2C60143B71251FCD7501E4EE1D6196ABADA256E4 SC0LI0T0N3
438,342,265 *2C6F77D4E841B451BFE74065FE8BA10DB9F08C70 SCHLUDERER
438,342,266 *2C65489A94CA7F46234D48E97D25DD4B5F02C8FA SCOTTIE.GAVLES
438,342,267 *2C6F570881636C3E3B4CCBA1385EF36318238763 seeugirb
438,342,268 *2C67ECD0699CDB770606BFCDF9D62B462B6D3BA9 SERGIO-MARTINEZ-ON-FLOYD-MAYWEATHER-FIGHT-WOULD-BE-ACTION-PACKE
438,342,269 *2C62F28EAE4E44963DF9BC3C4A72A6F99AF938B3 SHAYNEBASONE
438,342,270 *2C663C79AE98806E48ACC8A5BD1E36A471E88521 SHAYNE.SCURLOCK
438,342,271 *2C6AC9D83EE4D27490CA67FCC912C21D24FA1EC4 SHELTON.SEK
438,342,272 *2C6E1D3EDF9784687425FA66346D8F9DFFB55BAA SHI751155
438,342,273 *2C66CB75B143BEA1049AD71D4435705087550BFC SHONAVBR
438,342,274 *2C69B4C723B99C00621C844EA79ADAF70C4B6F11 [email protected]
438,342,275 *2C65C37DC2220506EBD1222F296F504C75473D17 SIBALWA3
438,342,276 *2C60B6D1A0C4A6355AE41DEFC5A71D0B254F27AB SIMPLIDHE7
438,342,277 *2C6E9031EE775E8411611B7D89A7D4D598C33F51 SKORSEZEOVOG
438,342,278 *2C63AA662573FBC96F1886D8F4D41693B59C94DD SLGSPRSNLT
438,342,279 *2C68CFD3091366B2E870846439B44DD90B9876D9 [email protected]
438,342,280 *2C6E0EF0B4E2FF6941655A7331F4966DE90D2772 snobistisches
438,342,281 *2C65E1B58CADB3A852E319E39F5E977B9277C29A SPANISHAMERIS
438,342,282 *2C65B5A12873C6A959C389D98B948595433424F6 spatalamancy
438,342,283 *2C62AEFC2E3D229AD27A92C60BCA3F07B598D9FF SPIRITED, SPIRITLESS, SOFT, EFFEMINATE
438,342,284 *2C6B4E7E5409F68CDA15AC123AE5A5B8E8AF98C8 spiritofgod
438,342,285 *2C68651EF8EBC2EC3F40EE9672523AB4A71AD47F splat ~ ~ (----q
438,342,286 *2C6521FE7B66D961D6431A1EB0DBCEDC95C6C73A STADTBAH9
438,342,287 *2C6C60AA8B1A0DB612A984926E01F3DE5E0F313E staminigerous ,st/&/m/@/'n/i//dz//@/r/@/s
438,342,288 *2C651B804B7707D50380C72CA81B8486690977BB stiriaming
438,342,289 *2C6D3917DC5C8EF3317CF7A6D9B45B56DF7EBD95 SUBCONIC.
438,342,290 *2C685CB82817485E684EBE3473A102E3C6BC8F5E [email protected]
438,342,291 *2C62CEB586C5C74B5755BD5A3BD4D9FE0211426D [email protected]
438,342,292 *2C64450BDA97A2A8073B6B1B3CF6D9BB32872B26 [email protected]
438,342,293 *2C654E0155EDF6CBC7961FB7355C0720111E4C6E SUNNECHARTE
438,342,294 *2C6BE767679523418B7E20FFE9412B252F5A910E SUPERGHOSTSNGHOSTS
438,342,295 *2C6A167A14FBD14E3C260AFC73CE26A2E939093A SYLVESTER.LIEBROSS
438,342,296 *2C6E1B9E0C78AEDFF06E6EC5F95A5B5D05E22371 SYMPHONY IN D MINOR: I. LENTO ALLEGRETTO NON TROPPO
438,342,297 *2C655418E1E1A7EEB57DBF35E8D8C7588B2829D9 symphonyno4inamajor,op90"italian":iallegrovivace
438,342,298 *2C6791294A40815241A53C84C505E0A80865B1EB TALKDISMAY
438,342,299 *2C6538ADA8A2EF8D893D7D8AC9BF8D2D982999AE TAUBATORING
438,342,300 *2C6BC0F4936FC3A6A72AA855055C6AE24C1FFE14 TAVARUIG5
438,342,301 *2C68AF9B82F119677791FEC946FA5752F9F4BCA6 TAYLORDADDIED
438,342,302 *2C6FC8073B06F3ECCEE9539D4E73DED0FB0B5FE9 TECHMIRAGE4
438,342,303 *2C65ABFB63258643A7FB3DAE1ECE03D13A7C12CB TEKKENDESPITE
438,342,304 *2C6C2428BCBC0C06DB94FF34E03D782AC49F5362 TEODORO.LAIRMORE
438,342,305 *2C6407CE5C2E8E4FB4F972CBC4EE86B9B67B8820 TERRANCE.PERKINS
438,342,306 *2C6FA80F8EC7290967CDC978D6D45005CD2032DF TheBorderlessEP
438,342,307 *2C69DED7C731C1B9E7E3733473F34D2D7FD8EF19 THE JONES LAUGHING RECORD
438,342,308 *2C6B8A2363158791FDB9FCD693934732598C3DE4 thiaminses
438,342,309 *2C60A417B37858C37623F4D508CD0A45C5F5D3C5 timgrasser
438,342,310 *2C67E8F88BA88B58FA59017E85E9F2299823E5EF timothypriore
438,342,311 *2C62EA9DFADDA049A44043E44A4012205B172204 TINSINK93
438,342,312 *2C6B57C7C4AF46F230935D4C37FCF1CFC39FB0EB [email protected]
438,342,313 *2C68819D36141DA0A280026D3DA5A4BDED2B5CD9 TODDGIROUX
438,342,314 *2C680EAEFA137567916FA9A77F933B29015546D5 TONY.SAULTERS
438,342,315 *2C69600857E31EA34E63E62C5779E9466EFA7129 TOOTSIEPATRICIA2
438,342,316 *2C6AC2487F74523CD334253E085270DB39A5F12A TOPTOSIA2
438,342,317 *2C6E595AB2DE7388096F97B12A3C0437BF3B1652 trebuetsya
438,342,318 *2C699D91217B3C728F3EDC2C79271E95355AE2FD TRUDIHARDIMAN
438,342,319 *2C67DE03A8FAC4B50CBC7E023F0E8BDEEF3EB834 trykkerkursus
438,342,320 *2C6AED9278DCD09A0FBB661D3F600FB1CADD7841 TURIDUR-HALLBJORG-JONSDOTTIR
438,342,321 *2C631BB7A39F08893656B67AF4259E16F062CA8D tuvalu-media-corporation
438,342,322 *2C6C259F49DFE69172D5C8EFE2226786E44DDDE8 TYMIAMOORE
438,342,323 *2C613E2A3FC2C60A2F558BD95D67A11FACDCC8DB ueno-no-koi-no-monogatari-(feat.-yumi-takada,-masami-kikuchi)
438,342,324 *2C696DA30BF40727F641C44A20360515042BE7A2 un8go+ed
438,342,325 *2C6AB64B40960495327942A2C9B6D80CDE703E18 unch4r4cter5tc
438,342,326 *2C6635852CAF43FDF36F12EF08720EA56CF564E6 [email protected]
438,342,327 *2C6F85167E9959D3C2065EA2D2761E166F0DF6A2 VALERIERAFAL
438,342,328 *2C627B4C7FB7CAD030CB4D2B15EF6F458F7A2FAA VALTAJRJ0
438,342,329 *2C691D385AB320D9A6B8CB9226095DEF54718FA3 VANAJADASH
438,342,330 *2C6CE8EBDA7D9D1E92599C9AA28698D912DF293A VÄVYEHDOKAS
438,342,331 *2C64ED9BA6F2DAFA958FFE319941A94D81C0BF12 VICKY COOMBES
438,342,332 *2C696C83D62F32B0B73C84B6A48DC9CFCBC62E65 VINCENT.MEAK
438,342,333 *2C64946510777B155ACA3308EA9F51FC067102C0 VIPERREDRUM7
438,342,334 *2C631BFEC85B698E4854594E0838288C1D5ADCC7 virusteam1
438,342,335 *2C68678790B36544E7F6B3B6CD3684C370AB9461 vonsidhom
438,342,336 *2C63E3C406AF67BF2D9AFE16CFB389EBB2175C96 [email protected]
438,342,337 *2C6A203F148B925DA4874ACB300AF00BA8356B0C WAITING (FEAT. JIMMY HELMS)
438,342,338 *2C681FC23EF9EB7BB02D0958B9EC9AAA90B1B547 WALLY.KETTERER
438,342,339 *2C6A61AA8323E1396C8E30B67F1FCA88EE64F880 [email protected]
438,342,340 *2C676EF53E5A13E985D88C4005ED700DF4885C68 WAYNEWEATHERWAX
438,342,341 *2C6FF3C49C2116E481943A9CF3E0A67ACCD9EC66 [email protected]
438,342,342 *2C6724BE35588FEE0CE2132B088BAF65F9A57943 [email protected]
438,342,343 *2C6433E13C2CF4A8B1BB9F1873D338CAED93DF8E WERNERCONSOLAZIO
438,342,344 *2C65144D7DBBFBD4EBDE379759ABDA2F95DC0CA6 WHATAPIECEOFWORKMANIS
438,342,345 *2C658ADE1EDF0BAA702DB90E86F39F4D9ADDE737 wilbertglashen
438,342,346 *2C6A253B99B0C4E818F82A19D2A4193F78402F08 WILFRED AMBUNYA
438,342,347 *2C60B201D80FCE9F2ED370338B12A2A83605B870 WILLIAM.B.DOTTEN
438,342,348 *2C6D7E0DD1EC04218C07D8E9F2BB49A6B3F9DB8F WILLOWS AT LELAND
438,342,349 *2C6D12F6EB0880637648A16649D5468F37293202 WINTER-TALES
438,342,350 *2C63F1D6152046777F7E5A3C38F90666655EFDE0 wirecabl9
438,342,351 *2C693CDB35381D8A44D24BE208C4182BF325CA13 w:lh
438,342,352 *2C6EE65D0F70EE03794E9C6F732513E0B8AECAFE WRITTEN.RAGESOSS
438,342,353 *2C61FA3D419E7DFCBFE2B644AF26E2651297932D wtovtv
438,342,354 *2C6A77F2965BB2DF4F71C804A1B22BF78041A46F WWWIWRETIREORG
438,342,355 *2C6224FB60214FC9E955280121726E15B7CB71D4 }X{*-*d--p
438,342,356 *2C6640F9680E5621F2C30D1A45E3B1F3B1211A34 (X) ~ `D-----P
438,342,357 *2C64738F90CBF1EA7968565FE4ABC7BC6AC1B595 [email protected]
438,342,358 *2C64071C4A9AC3623F67395E92FECC0EA22611EB )X(O~d######P
438,342,359 *2C6C9E7EDF83B30C2562B1497504B467048CDA31 [email protected]
438,342,360 *2C6F1209182E2A0C7B4998944FE17F6FB5AF554C [email protected]
438,342,361 *2C69CC117243A0D1B07C9FFF1B0ABF70D969E830 YENRAENC3
438,342,362 *2C66FC6D5AEA7DEFC7608B67F1C585B64C6B193E YHAISH
438,342,363 *2C633811F9BDA66E31E1DFE6844379330E321010 YHANXZ.REYES
438,342,364 *2C610F32F9B03420DB24D1001F9AA7D3E8098770 ylikirjastonhoitajan
438,342,365 *2C6014485B7C46C8ED9CA9895AF7011998CFB1F9 yu}b
438,342,366 *2C653729190B3237037DB7AC23DCF6DF2AE92522 [email protected]
438,342,367 *2C6664C6918A06450A6BB50920BE72E2B93300AD yvonne.hjellbakk
438,342,368 *2C6D5BE1A39B60F9C90A3B84AAC64359FD989712 Z2*@
438,342,369 *2C68787CCFC1C36C5551C16DB4F979201AFBDBEB Z5YQ8Q
438,342,370 *2C62750595E1371454F8F18A9C9DE4B32F6FA402 ZAC WILHELM
438,342,371 *2C62742EC2E5A250BB739835859E772BFEB88F83 zeg me dat het niet zo is (feat. ramses shaffy)
438,342,372 *2C621064C78DF780D165C10053FDEE9127840858 ZELKOWITZ5
438,342,373 *2C6FB04F4E13509CE29E864EDF4F9B2798434972 zh#l
438,342,374 *2C6D067DEC4B43A20D659FBA8EED4CD22C868FDF zwai-moye
438,342,375 *2C65FC091C5BC1D0D9BD059D706EC6EF42919044 ΤΑΟΪΣΜΌΣΕΠΙΚΕΝΤΡΏΘΗΚΕ
438,342,376 *2C68D11F4320969921AD40E6DCCAC776F1CF3DFE АРМАНЬЯЦІ
438,342,377 *2C6F23169045032952E9942479AADA7DC7C26174 ВИРМИРЕ
438,342,378 *2C6D516F0E85649D0E6E3B8AC32D09AF97B5D8FA ГАЛЧАНЯТКІ
438,342,379 *2C6FAD4D718736F4158516FAB204DE7BF1DDF551 ИЗЛАЖИРАЈУ
438,342,380 *2C658CB258FA4F4F0DDFD02411E1BE9B54B1E3B4 құбылып
438,342,381 *2C693DC3135CC704F659F391E222B5DD66FBF3CD „КУКУВИЧА
438,342,382 *2C6796530DC0432515D00FA8B7E923AD6BB4583C 0CATKIN
438,342,383 *2C60A4DA4546B71DE39B58E4FF68F1DEF8DD3A47 1000MILESTOGO
438,342,384 *2C6B48B9CE97C406FCA87080F8B4080A2865A67E 10ding
438,342,385 *2C69F3294F8C222897CBAE6BBCB93ED07CA1BDF3 13MIELLYTT
438,342,386 *2C65E80B9F73979B5E27807E00ED6526FAC45490 15 BARRETTIN
438,342,387 *2C6F0CAC4F84C6997C8CD911BB8E31F467FEB1A7 1710089 TIISTAINA 305 2000 KELLO 15:05 KARIM
438,342,388 *2C654EDD694011D4DCA0565EEBC17A866B742155 1752923 YHTEYDET.LOHJALLE.,.VIRKKALAAN.JA.ESPOOSEEN.OVAT.HYV
438,342,389 *2C69047422A4A16152C71ADA874A3D43CF655571 1753520 ming-chang-plans-to-do-so-,-quigley-said-.
438,342,390 *2C6F6E9E89D0475357B3B32842E03BFD2C1D0498 1974014 evyonvammautuneidenoppilaidenopetusta
438,342,391 *2C6486FFA78124086C587C2465EAB0D46DC91DA8 1994866 SAUNAPALVELUKOTIPALVELUHENKIL
438,342,392 *2C6351BB47CEAFB51DE9B983C7BC2FBB39F68051 1aluminum-production
438,342,393 *2C6029EA6FEB98BB355864D108B453F0A973F602 1ARDROXILLA
438,342,394 *2C6D816494C79214C6CA33FC590A26327EAAEE1B 1COLATINA
438,342,395 *2C633FFC53C5061C8D0E80689572ED8F1EC4090B [email protected]
438,342,396 *2C627BB69E4BBE3C18C7E4C770DD50217559852E 1.EUAUSWEISEN
438,342,397 *2C6C4CB29838DF228276A8414E771D18AB1858AD 1-eurosida
438,342,398 *2C64AADC9CCE37901042EE4654E141D6C4D5EAF8 1-FOR-FEE-ONLY
438,342,399 *2C6C3AD40BDAA37DC66B2516B337F2F379846257 1 HANKINTAASETUKSET
438,342,400 *2C697440DF549861EC5ECFC73F2E192A2EB182BF 1hein
438,342,401 *2C6D07EAEC22ADBB12EB390F76C3CC2321BE08F7 1kantajaani
438,342,402 *2C6CF64F035DC20EB0C6C53EBE998F7427640005 1.maailmanverkosta
438,342,403 *2C67A68AE7DFC55DE00A5D6E9F7BBE029CB91BE5 1.NORTHOFF
438,342,404 *2C6C660A11A6D13755BBA5D26342DF832B2071CA 1 NYMAN-ROMANTSCHUK
438,342,405 *2C6DE53A5E9CE337030C2D498C8D4FA05DEFE95A 1.puolustusmuoto
438,342,406 *2C627C9F9BA05B1515FA85127A82CA946331A748 1 pysym
438,342,407 *2C6B76EBE211BA2CB0CE7C9C13E30018CF42C047 1UNSCALDED
438,342,408 *2C6E7A997198DCB6069741AB42279D6A8FC507EB 1VESTRICKTHEIT
438,342,409 *2C690759141D12B8ED3A8BC0C818374829C7D343 1.VIIVYTTAMISTA
438,342,410 *2C67C26E7841170D09EC6E2F60C4710D69B0F253 2004年度てれび戦士、テレビ朝日『KIDS
438,342,411 *2C658C328F880BEA4E1E496460349771C218FE28 2260668 theproposalsonsickpayiwelcome
438,342,412 *2C6E7302739CB03B2C60B9533AF853B94218EF70 22-ZWEIFAMILIENHAEUSERN
438,342,413 *2C6FC099A0ECB480710AF63484DB72FCD87C1396 2478485 SIKSI YH
438,342,414 *2C65E9B8F4A3760E0B73E2F8D7BA8BB8D2310E44 24DECEMBER1954
438,342,415 *2C68B9A3F6D370680C38FD69FDFFFE470BF96600 2 down
438,342,416 *2C6EA63F28B7EC614B1C22B60B15D0C8F3D78911 2-kuijten
438,342,417 *2C630CEF02A74DF8893D7FDF3ADD9BD9E5E80EF1 2NOHITHA
438,342,418 *2C633209DD2C87AF529BFF3A3ACF6E432CB4F808 2-STRATEGIEDOKUMENT
438,342,419 *2C6BE493B8518A7D26E75F9F582631AF80526B3E 2.TOIMINTA-AJATUKSELLE
438,342,420 *2C604187162D81AAB7DB655CE6E3AA2D474F1E69 301logan
438,342,421 *2C616710A2984F0FBB84AEFDA08D3754778C834C 31882 hillel.tokazier.perehdytt
438,342,422 *2C65928B2962D85A8DA8BEDEF9DB7E241C9F7499 3BLATTPFLANZEN
438,342,423 *2C69A7B4DF7D72FB5061B01084C1FECD5E2B7A0B 3#D.~.`3B<
438,342,424 *2C660AACF5446FBE9D934477813271A60EFF2DE6 3.ESI-ISIIMME
438,342,425 *2C6F1844F1EA75E5035211D592DB0AD0D7B42598 3FBBOHOK
438,342,426 *2C6D60A0866C1F5AFFEF64E480793118B85EB851 3JOSTRAS
438,342,427 *2C6343F7145CB58A8F752D76BE65CE9DEF779B15 416SW51
438,342,428 *2C6644F1A8ADF265C242F84F2614DD42873486E2 4:..4..#..&...recurrently
438,342,429 *2C628FEA64B8DDFB2C3C90C11469621171243719 48011bmy1
438,342,430 *2C6923505E382CDEBA70D03694C0E0A8AC08E7E6 4.fellmanin
438,342,431 *2C6195F69D2A3EE5B083ABC668974983B742CF59 4IAMMIKE7
438,342,432 *2C6ED7257C4CBCB802CC9A2EAF83544147874292 4ROBERTJAZZ
438,342,433 *2C6CD3ECF5087AF661480336D4A0831857013FB6 4SJANGLINGEN
438,342,434 *2C67FA827FD0EB48CB301727211ED7E42EB6A2C5 4STRTSLJPT
438,342,435 *2C625583AA85269E966D9ABA0940421F5585AB09 4TRANSISTORNS
438,342,436 *2C6640C829A5759C70E14892507374CDFF9E652E 585audrey
438,342,437 *2C682EC1CC795EA446C49485AD8D2F884C1ABF44 5CTEAMGOD13
438,342,438 *2C61D2FDE7E520434A44D9EB20EE121F0A60EE40 5SESQUISULFIDES
438,342,439 *2C65559455BCC1398A3A2EC4645EA1ADDD198F6F 5TEEPEEEEPEET
438,342,440 *2C638A60D900554D643E196C2A69B65B3F57C856 6101155
438,342,441 *2C6FD4C0C98C08F096313ECE9442701EE79AAA83 6EDNUBREV
438,342,442 *2C65128E636C4FFC720BD28095D93AC168D9F1C5 6ELGNITBSW
438,342,443 *2C671F57ACAEACBBF4C39B372ED84ED516AE6197 6mar1918
438,342,444 *2C6547F0403E41E6B9C0D7C85FB926ABDA6B05A1 6-SAMANN
438,342,445 *2C6373C353369F5884DDF703A2F2920D337B9628 6UNIDIGITATE
438,342,446 *2C65CAE765756C248F528A90A1523480A3CD074A 7CASSANDARA
438,342,447 *2C64B1FFB05849761308893B79F8A08D055FE3B4 7HEMOCHOLECYSTS
438,342,448 *2C60B8DE3E355C0D2EFE325D7B9C7D1CC58BA8D0 7INDORSAT
438,342,449 *2C6AACDC24E42EE75E7B96ACBB42C91B4D2A8819 7MIMITANDY
438,342,450 *2C69A3877BD5106E650015A38DA1FC080DFD5518 7MONATIZING
438,342,451 *2C6E45F2E416018B7468040B055A796B2046A2FE 7theskippy3
438,342,452 *2C69B9B47C212534931CFAB695C6A73A529BBF15 8IAMJAMAICA3
438,342,453 *2C686C2AF74699E2C3DD2F6AD0E965354B06BD0A 8OLBYENOM
438,342,454 *2C6D5AEA70EEF49610455FBC3975A12FFA28DF2B 8SGNIDDON
438,342,455 *2C6F0D6358354DCA169DC1DB0765A468EAB8EE69 8SRETSREEREV
438,342,456 *2C694E4A9E08C8FA4F9E9139F3D2B73FFF793513 8STRAUSES
438,342,457 *2C6EED2F49841720F7A8625E0CEEB24DBE56095F 8UNSPINUNSPIN
438,342,458 *2C602E21C5B3BCBF8D6503036A963ABBF5EF3111 95:---------$tree{$nodenum--&quot;right&quot;}-=-$rightchild;
438,342,459 *2C61B9A22490DEC67C2E9C789E115FE18EA3BA8C 990ce5de1e3df931a25755c0a963958260
438,342,460 *2C65B7374E984127CBCF5AF1F412ED622BAD12BE 9GELDRANK
438,342,461 *2C6749B4C245F4F0E4A222D095E7C9FAB1FBB524 9KNICKSALASKA
438,342,462 *2C6FF78385F1070810DA091F77BCAB6DD7266519 9MATRIARKAATIK
438,342,463 *2C62FDE0B1972BC2402D922E7A9E6BAB193708EA 9SOSPIROSE
438,342,464 *2C6936C6385F3F058C01A07AF4ABB6E9B1423C00 9SUNDAYJEANNE
438,342,465 *2C6038672D49511CD519049EBE5F2227D25831BC (+!a
438,342,466 *2C6E4AC5AAB47208B85C89AA17689057A858E688 a0p-e
438,342,467 *2C6FA1C03FDE1C6C5EFD65BFDF455B806364B31B AAPMENSEN
438,342,468 *2C6C42971A9D73360614159CFBF1244E40C358ED ABBC9
438,342,469 *2C67ECA38316AE01169BF8E81500A18DFDE0CC47 ABENINA0
438,342,470 *2C62C9CB4958F15C9396A137EDFFC4E84FDE45FF acrc7
438,342,471 *2C6F199C5499F694EE1479379713AEC8BCC919CB AD1\W
438,342,472 *2C6698EFF1599E8C69AC904E2705BA6A6E764F07 AD(G
438,342,473 *2C6004D8D7A38364777E9F12F3F8569F6332DB79 AFRHB
438,342,474 *2C638490EFABCB04391E432B160707CCE5A41B89 agammame4
438,342,475 *2C6E6EC8441C75FB9266A3E65C79167B2070E0D4 A?;"K
438,342,476 *2C6796AD690B8CF633667083075BAE0246BA9312 ALEJANDRODOBOSH
438,342,477 *2C613AC5C042F39DD371EAA0BA4940E230C55975 ALESSANDRIM
438,342,478 *2C6FE55FC44DCFCD30F53D8232F265CF9DC5AA0F alfonzoahumada
438,342,479 *2C6513CF9BCEBD3ED931883C26BA8957E0732757 ALIJÄRJESTELMIENKÄÄN
438,342,480 *2C6937377CDEE3E19ECC308EEE39771083BA1DEF ALVINIA
438,342,481 *2C61FDE569A8E326B9FFC88B80CAB02A19A2160A ANGELDEORION
438,342,482 *2C631FC1B5A06915545A21CE1EA9D50BDC60BC4B animecandylover4ever
438,342,483 *2C643E603B6A822EBC720EA74AA80797072126A0 antdg
438,342,484 *2C606D141F71ACE2662697A6EFB00FD2F7337AA8 ANTOINELEWEY
438,342,485 *2C60AE99BE54D7FA41E815A75866FE38C357F7A1 ANTONIA.DILLENBECK
438,342,486 *2C6D4F5564FAB98F57DC63149BBEA0B41CE4FFF4 ANTONIO AGUILAR
438,342,487 *2C63333687D2A184BA5DE5EE2B0333F8DD6A2FB3 a$nve
438,342,488 *2C6C2DF3CD8583725FF71BB2BDD4A2834CE92EBF ARRON.MULLER
438,342,489 *2C649DE2A85B0B7E9D20E541B10D8C31795FD218 arronwalczynski
438,342,490 *2C63879940C0D0F8F08C44C4F39808C95ECB8911 ARTHAMMITTAL
438,342,491 *2C60A0D1DB02CD77BE322E35145820B1FF3F3797 ASHLEYSUMERLIN
438,342,492 *2C6390EAA7EEA5C3BDB5F4A4DC3764C90D4C9FDB AS.YOUR.ATTORNEY,.I.ADVISE.YOU.TO.LEAVE.THIS.ROOM.AT.ONCE.
438,342,493 *2C69BA20D5CE5E5AD2226965CE93AA4459B01952 atlant!c
438,342,494 *2C64D8A5F880591EA7AB26F83467E576ACF8335D AUGUSTWAHLER
438,342,495 *2C643EBBD3000DF9D6EC4317B2278E9FF40DBD43 AUSFORMUNG6
438,342,496 *2C68B34AB1AC4860547D6921EF78C09B36878F21 B1Ea
438,342,497 *2C621C18A954C0FA0E6D61412932BC98F4C4B03B b4&x"
438,342,498 *2C621CB0410022A6C718BBC5B353E30370E59D84 b6&nu
438,342,499 *2C6A11B386E21EEADB3BE94E8978B1548552665E BACK BEFORE THE WAR
438,342,500 *2C6DA25FAC56F38E05B051F702DFED67AE7CC8B7 balw
438,342,501 *2C60CAE5F062C86BD4BEBE56D102BD7AB2D3F9B7 BART.LOCKAMY
438,342,502 *2C6FA5FCC4AA936341AE8E14EB933D1399B36DD4 BASILBUTLER
438,342,503 *2C65A9C6DBC86C7A39494288FC0DF8AC05715CB3 [email protected]
438,342,504 *2C634B4675D78B1799229BDA38E028AEFADCB82F [email protected]
438,342,505 *2C69EEEF8605A19A66092EEFA859D0237B027DEF BDM2E
438,342,506 *2C6CF27CF349CBA602953B0B92FCB9B6BB20DC46 BELLMARSHING
438,342,507 *2C67ED63EF9C4DCD845F729AA3C5F95D028F3C0B BENITO.MARSCH
438,342,508 *2C6910613B1DE01A98F7C6E6FA6D860F280F6A28 [email protected]
438,342,509 *2C6B1B987C9169DC7CED31EDE4047AC8E7B3DDBD B;:EO
438,342,510 *2C6ABED5A3494E815F4A33C1AB6A6ED79018B7D0 be!sm
438,342,511 *2C6ACCD3D5C292D18B205338870155089FADB44B BEUGVISSERIJ6
438,342,512 *2C634E62FB38E5CDE6CADC868F04DC3BFFEFCF8B BiS8
438,342,513 *2C665721E846169045ED499AAD8297C6685E7114 BLFM2
438,342,514 *2C6CC5336647FC7AB79E0167AD704EB88C29DF58 BORISSYMES
438,342,515 *2C66928AA9D5422B0E933E4B343F92065498ADB6 BOYD.MUCKEY
438,342,516 *2C6BC6A16CDEF78D26E5C50D65205CA839B5E8A9 BP2/K
438,342,517 *2C67A14DD5A21CC026EC5525DEAE7E9983A799EA BRANDENSORIN
438,342,518 *2C64E77EBB1F14904E0972F99925D5A155D3423B brandschutzversicherung
438,342,519 *2C61ED712BC0E9B4977FE96C29D031DF1BE3E499 BRENDAN.EPSTEIN
438,342,520 *2C6E626998D39DC21A5C1224AB41C1C7D5508DD1 brittchaisson
438,342,521 *2C69A3B05C0EF01694D5E3F8FE049E962E16551B BROOKS.GREENWELL
438,342,522 *2C6E58CA0B3B6CAA1008F7FA668E635B32DE7ABD BRQ-L
438,342,523 *2C6CAD6685776C45766F3E62554DC7B690B16DC5 BRYCEHUSSEINI
438,342,524 *2C6D2AA227CEB331901CFCD099402039440BEDF5 bs14x
438,342,525 *2C62744B7B8DE5A773667659DD4C85916F31EA61 bswevisicni
438,342,526 *2C66726F3FF1B627695C4F901A09C65D26EB06D6 bswhusaynunbsw
438,342,527 *2C686FD73DC0E042BD996373BBBDC1F500336ADD BTE-SCHATTEN":-VII.-ARIA-(SOPRANO)-"SICH
438,342,528 *2C671F424F8ADD255A9CA576E9C64EF81EA27539 BUTTERCUPBAKESHOP.COMWWW
438,342,529 *2C6DE8BEE11138D1B4CF88977D79929F3670DE9E bv.0?
438,342,530 *2C6C157905DE7B3B7511356792BBF34312CFF713 C1$AC
438,342,531 *2C6EB851639464CBBA90A6887CF9C6CC70DC3910 c+7ot
438,342,532 *2C6958AD9C379A2F7B7DABF76EEA8498C130C75F cameron.jones.jr
438,342,533 *2C64DFD7F00C6C87D1679114EDFC2C72B1FE0382 CAPOBIAN7
438,342,534 *2C62BBF687035B91607CDDE83503F18A3EFBD303 CARLOS.POTEET
438,342,535 *2C630CD3751607148098D99296D32F5D419D7131 CARLTON.MCCRIGHT
438,342,536 *2C6853A7027A2F5502A3D513C30E2F70FF35A73B CARRERASMITH
438,342,537 *2C6B04B0A34464153581AF24EB4DD80BE55A8C63 CASEYSELPH
438,342,538 *2C63C697DF56B283D5D6D5F2E02C5879185A2C8A CASTILLO-RA-TIM---BUM
438,342,539 *2C630AD5FC0CF6E2DF5BF1394C285BF012ABEEBF Ca(X
438,342,540 *2C679656C3FF65C41D857F494ACC35582D516AA0 ccv;/
438,342,541 *2C60B65DD3D8C466BD21EE7058B674303F735A8B CDTC/
438,342,542 *2C678F2AB947E68C9882CC7F620E7A1F56B36C2C CESARMENOTTIEFABIANOAOVIVOEAC
438,342,543 *2C6DA7DA4F296A90391A60FBBA3E8D679F4123DD CHANNELVIEW.3
438,342,544 *2C69845E408D62EFB5190357AEA0F4DA44D07509 chapter.0613:.the.journey.from.platform.nine.and.threequarters
438,342,545 *2C63BBDF7B977AEE882D8470E0E35F5DF316C99D [email protected]
438,342,546 *2C66F41B7EDD23237A72E005174450DC229445F4 [email protected]
438,342,547 *2C6CAF3C6FE20DFD2DAB8261DA18DDD63F18CE22 C_$HG
438,342,548 *2C6EC6E8F1CCD2A9DAA29F1EBA19952DAE5B2586 christinadelpino
438,342,549 *2C62F147F97EFEE49F3DF2E029307A73C1462847 ci1,d
438,342,550 *2C69D9C9B1D366AA7C62B8DD9C2BA578D5EE4431 CLETUS.SAMPERE
438,342,551 *2C62ED67A0CE2631DD8ED74A8AA26176956F0191 CLIMMIETRA
438,342,552 *2C64DBB77C79CE0B63C1F6397E0C001D44977373 CLIPOMATIC
438,342,553 *2C6547D4D907FD562A1E8A1CA80AD6D74840090B [email protected]
438,342,554 *2C6E43562BF94487F6594A2C4E5EB4E5E0C33E53 co$qi
438,342,555 *2C63C86075BBB4E37DB0AE47B12334DF573ABE8B COTHAMCOTHAM
438,342,556 *2C69C65DF6E400D6CBFB77C935556EEC0A19333B CPBVBSW6
438,342,557 *2C6A39E8073E68C2C343F8CDFAED0CF264E53B51 c:\program.files\microsoft.sdks\windows\v6.0a\include\batclass.h
438,342,558 *2C699625CF51219C70624CE31A9944A5FCEC7A54 ctcda
438,342,559 *2C6BC0DC2FD7F22A1FE8385FB4C29430EF567A7F cygmr
438,342,560 *2C6CBBB074C397F2E819DFFFEB7FE7C22CBE8202 d2(ed
438,342,561 *2C6B6E2A247047DD8CEEAB687EDE8D7548E9FF4B D3A7
438,342,562 *2C6843C443E373383A6E9A2DEEE0176C0DA7752B d85f
438,342,563 *2C6B12E9A6875CD9935C5CFF42E27791B340863A d8ovh
438,342,564 *2C6E1A0585E442E48D0E361F90246A8B2F494550 [email protected]
438,342,565 *2C63FA74F965C126BF5A11260822D6D6EAEF7E29 DAMIEN.GROUNDS
438,342,566 *2C62FD4B02A28A473078AB9DAAC720D73E4CD15D DANAAYLES
438,342,567 *2C63A4D136C79862D25672439BD0D931C9A798B6 DANE.HOST
438,342,568 *2C62E581071E58D1402AEC4C0F70EA704C3ECC84 dannyrouse
438,342,569 *2C6D4E361507379E1474309A579916C5DF4A63ED dardun
438,342,570 *2C673A10973798A7F41FD88B6D2DA832148076EE DARIOSUTIC
438,342,571 *2C6075278C3CF776111917B41726BAEDBC76682F DARIUSNAJARRO
438,342,572 *2C6B311A9B93C6CB874C7686336C73BFDAE39CD9 DARTE
438,342,573 *2C609E77F8CCE705E575DB23B7EF420A778F6312 DAT.MOET.EEN.KAT.VAN.ADEL.ZIJN
438,342,574 *2C633114EAE412FF9D09791EAA757BB80E42952B davinis2
438,342,575 *2C6771E007D6AD08338B7F63FD8B35ED197734BC deitractim
438,342,576 *2C6594B02C7A221552E7E61C6F33972D04CCE456 DELEUZE
438,342,577 *2C61D3381A31A4A9DD740687247BD47CBCF02C40 desagher
438,342,578 *2C683D8BF783C03EFEFB34772151F0589A79F276 DF$EL
438,342,579 *2C64681A39E4096ADCF66B8CAF5983C2FD41F6C6 DIRRAQUIA
438,342,580 *2C674D498CF85A1F1EC81A1A9E52156C9811A40F DISPLAY.OF.POWER
438,342,581 *2C6F5ED48A3E4408E9907734B3E043302E98B37A DOMINIC.CAROLFI
438,342,582 *2C6503ADF4C9878D3F0A0F5E1A736CB2D7C227D9 DOMINICK CASTELLANO
438,342,583 *2C6362FD78A5542C249418A86E784F8A24464A03 [email protected]
438,342,584 *2C6C3FFE02EE743B5397C1D60BA8225CA8654A29 donovantheuner
438,342,585 *2C6F8824E857CC247489F4A07E0DF54477DBC400 DORITTYB
438,342,586 *2C6939DDB9B6F78AE8132EB547A642A9F1A916BD do.they.know.it's.christmas.(feat..far.&.will.haven)
438,342,587 *2C6D5B9D4EE8AED4142F5114133ED528B5BC838C dougistcomdougist
438,342,588 *2C6BFEA4E4D3401B87DF6CACD4DE48F222111426 dougkeliipio
438,342,589 *2C6FF7E5FC0BDABE33B3E31B01930709DB0C2325 DOUGLASS.CLAYBON
438,342,590 *2C6F5B38D03AF5658C8EABB26863D994618A17E1 doug.scobie
438,342,591 *2C6C834097815D9B9148FCA44DABDC420972EEF6 dpm"
438,342,592 *2C658284DBAC599AA46FB58B85A87BD6079D1DDD dqfek
438,342,593 *2C67735E800EC762EB5D6D9BCB8B67B0075FE6FB DUPLIQUERAIT
438,342,594 *2C69691EE284A9595BD7B14F69DC2536282BDC99 DUPOOPUD7
438,342,595 *2C6452FA77CCEC4A0DB6A76B6C33C8C74C8459E8 durab17e5
438,342,596 *2C65E4688B586C6F43F65F4A3DA4589C3F1E6014 DUUA
438,342,597 *2C61DDEA468E97E4A42531244D886E388457F69B d)zo-
438,342,598 *2C659A2652BDE52E9FB5BA13B26E7EA41A3B9275 ea,c2
438,342,599 *2C6B9429BA20E50E62C0A1717F382174F13B2F38 east86
438,342,600 *2C60BEFBB5DBABBE09DB74DBF42445A9CCC76B44 EDIFICIOSYESTRUCTURASDEMANIZALES
438,342,601 *2C6A985E2AAB5B82EE72A1FE26535BB9D484F862 EELEMRAP8
438,342,602 *2C6DA94E659628FFC693DA2B709D6C26F11EA2A2 Ehi,dicasa...buonagente
438,342,603 *2C6F184A5992C3E68DBF724EFCA484B2CD0BC321 eintwicklung
438,342,604 *2C669590583FB221E05EE0A3DEDA2429009A3F40 ELIAS.HEAPHY
438,342,605 *2C6D926058213C254E2864A7EA00246941F4CCD9 ELISHA.TRY
438,342,606 *2C6A5389763E011401951A7F8FB35A5334F32D8F ELI.VILLALOVOS
438,342,607 *2C652342DC6A4DC9E309094BC80DA934B845716E ELROYCITTADINI
438,342,608 *2C6CA866227F297D0F107B13266EC71C7EB0D561 eman.salah.el.din
438,342,609 *2C622FECD62599B03B99A10E182C03A45952462C EMIL.MISTROT
438,342,610 *2C679BC229FB5A134FC0FD2F5C7AD9E76C51B680 emilville
438,342,611 *2C6E1EA515A80A638D5C5D249CCC64199663F4E8 EM!N
438,342,612 *2C6EF6EC8D343703EEF82CD29B1ECBAE8AAC249A ESBRUGGE4
438,342,613 *2C6B7DCAA817A091172185CDA48C89CDA601C260 ESOLNEDO9
438,342,614 *2C611596F2B55D22AF98C1EC43BAF272F8D997BA ETHEL.KING
438,342,615 *2C632627FE0580315FAA92CAB159E540E5C5A31D ETOILEMISHA
438,342,616 *2C6A2389FF3B542D73978C7F31B3599A296654D3 EUSEBIO.RATHMANNER
438,342,617 *2C68F65FA0EC6834AD01551A51751ECCC6BA6D38 EUXCP
438,342,618 *2C625D72F54E7BFC9A41DFE7A74689F7088AA806 EVERETTELEGRANDE
438,342,619 *2C6A8759A8A194BF2875CC60BBE2D816E32DC820 EVERYTIME(REMIX)
438,342,620 *2C65931E97D170F465C256135B7E121368429F67 farenhejta
438,342,621 *2C6D828D621358CF21CAD734F3D508C0668CF9BC FGEZWAKT0
438,342,622 *2C6E0F79036E38CD16D72DEE0979BDD51C21F736 filimina9
438,342,623 *2C67292FE83F3BC25A634EC9D3BFB6AB663906FD fizikushallgatók
438,342,624 *2C661A3FF806E4138787926E1D2BC7A7F2650620 FLORIAN-HARTL
438,342,625 *2C6D0CC4D194EA01C6667AA1446EF5C3D26EA405 Football-Forever
438,342,626 *2C600B2D3F603B7B41376E45640DA9DF614CBB8A forelore
438,342,627 *2C62D32A53806014AF587D8BE3C81B593743CC40 [email protected]
438,342,628 *2C69A35B5771A253C75BC8BEABBE6E37EDD80B35 FRANKIE.TEARDROP
438,342,629 *2C607B297199776CBFD795FA56C8310CFC755C8D fredmathelier
438,342,630 *2C62051193CDC56BA2CACF0840AF789053F7613B FUTUKAYO1
438,342,631 *2C6F529C44D826946BD1603598804D1AE9F9F86A [email protected]
438,342,632 *2C6830FDCDAD80EED0916412372ACB85B94FAD34 fvi,
438,342,633 *2C6A2D930266B1EC6C52173E7ED5FF9A8DAD36C1 g2co
438,342,634 *2C67B604E53EB13ABB0E05D08BB0D8FF8EAFCEA4 GARY.CROSIER
438,342,635 *2C6937EEB07AAFCACB825FBBA7BEA88EE5555C79 GARY.GIEBNER
438,342,636 *2C6259142B4B2027CBE2BBC6CFE4BB290FA91891 GAYLORD.VORHIES
438,342,637 *2C618000FCA17D591A69F4796335C3B1AF7E7684 GE8Q
438,342,638 *2C64361D3E249BD5C74C2A72CE12F542BC47320F GESWERF1
438,342,639 *2C66E2D2FA3630736727B095FBA4BD305365F0AC gew:
438,342,640 *2C62FEA1E120EEEF0B88E8D3CD060D14D3480651 GINO.KITNER
438,342,641 *2C6E2644447538A5751BA3DFC44D1D6764B1A0D7 GJ[K
438,342,642 *2C629352FBA761E3CBAA76B06E8BC806A92782B6 [email protected]
438,342,643 *2C6513E34311506E578FAAE0740160D1BD93F9B8 GOIERRI160
438,342,644 *2C6393639507F736596DD33F58BCCC71EF01C1FB grafenhütte
438,342,645 *2C663D4BD8DF63653AECD6B6D4831193CC7B2D86 grimaDoSul(TeardropfromtheSouth)
438,342,646 *2C6EE8A7E4EFD64A4D84505239513F2296E74492 GRYTBSW4
438,342,647 *2C69B32C6D2B61ED006774AA21F37B39CFD0BC1D GUSTAVOKENNISON
438,342,648 *2C61D163CBB1CF54BF3659E86AD7D20B13999CFE GYMNO5P3RM
438,342,649 *2C6212E011430E96399701B6BC9E74C4638A455B GYRONED
438,342,650 *2C6C6FE5F31D01E32F658D10D0D47E08E958B8F2 h3s1+a+1ng1y
438,342,651 *2C67E199335FF469178EFD6896C483EEA2AC958A HALA'L
438,342,652 *2C612DEA99608252C805942B07017873A2D80518 HARDYDEV
438,342,653 *2C602CC2E79B1BBF0D39DBDCD26BD8E717DE1431 harriswitcher
438,342,654 *2C63B5E535A4024805856B1FC815C3E203F9895E HAYWOOD.MAROUDAS
438,342,655 *2C6FDA89DCD024C32081A1EC5BC118E041515F97 HAZELYN.DELA.CRUZ
438,342,656 *2C689507B6FB749BA82BC1A6D675C5A4291A31ED [email protected]
438,342,657 *2C60F783E159E389709074161FDF04E464FE0B0E HEMSILF4
438,342,658 *2C61E4F8C9897E45DE6F77CA7C1A60C49D154118 HEROLGR
438,342,659 *2C6F4E0716DED7BA4847CD596CE70DF44B2EDE9F HERSCHELKROLCZYK
438,342,660 *2C662CB1518E3C7B2B15985F8295C3A49C2CD7CA HIBBELFROSCH
438,342,661 *2C60ED87F4A5A1BAA0006BD7CE1DB22109DBFDC8 HILARY GETZ
438,342,662 *2C6925B511021514E9E72B4BC2A724C5F4CC5332 hipelegyinkingsize
438,342,663 *2C6C9D7A6CA236350C7D87BEAE1C8289EB6EE893 HOMER.FOLKER
438,342,664 *2C6C78D51425649DCDC9F8F23208D3D3862171CA horn.concerto.no..3.in.e.flat.major:.1st.movement
438,342,665 *2C632E1818B943487623D579F02C42A3E452293B hosstowncomwww
438,342,666 *2C67E635CC04000880B89CCA281DE0D86BB77945 hotspurs
438,342,667 *2C6C69744E544BA09A3CCC4F7EA92774855C58BA [email protected]
438,342,668 *2C679D197234756BDAFB9D269B59FD6A8F7F4FD4 hroði
438,342,669 *2C64465128C0C97063E37BCB6F9717970504007B httpwwwramanujaorg
438,342,670 *2C6EAC50AF01FC76CA740A86330BA9EE3BA81527 HTTPWWWSFLGTGCOM
438,342,671 *2C6947E4D774B73CBD64327DCA6F0BB57C6335C7 hungbowling
438,342,672 *2C6E84817E19F8389095024556F962E6DBEEAF33 hurmasida
438,342,673 *2C6E817AC13B4250E9C1FBB663542CC25408B42C [email protected]
438,342,674 *2C6073C989596FC38F786255BC33557CAABA3BB4 HVILEPERIODER
438,342,675 *2C6877CB11AD4A14363C071579B5D02124D2E57D ILOVENUTMEG7
438,342,676 *2C61655A90928F3E6DBD361F536FCF714A2999BC IMPERIEANFALL
438,342,677 *2C6DA20B4F41FFDAA633332D174022C6A621363D INDEED.CRESTVILLE
438,342,678 *2C64AC21D5D242A9EA3000368BCF1327B89CCB04 ininod.1
438,342,679 *2C6361E671EB1BF7D3AA41B7D1DA1801EC9E04D4 Intercrinal
438,342,680 *2C6B73EB862571FBEC33FB69F9CC7EBAAC861886 INTERVIEW-INTERLUDE-#3
438,342,681 *2C6EAB0E598259C5F5CAECC0B5D8A816C609CF85 IROTISOT3
438,342,682 *2C6C6B442AC79F7F5E053436A8E74AC75021C455 IXTIYORIY
438,342,683 *2C683481772EE2620C46CFB6DE8F7EF127E20117 jaredbilliot
438,342,684 *2C644C6A24705907C12ED30491281B5A3F3B2373 JARED.MROTZ
438,342,685 *2C6398CDB872D360DDBA1E4E6D088679BA1E09CC JCDB
438,342,686 *2C6D1CAAC1719D5836A9612BF4A09F5D62331A82 jeffreybertovich
438,342,687 *2C60C08DACA69C2B35BCBAF7DCC946D31A3F3ADF JEROMEBRUNELL
438,342,688 *2C6D12D5B2D9197E36CCA9C0E5C8C0F55BFCA05D jerricaottinger
438,342,689 *2C6B12643E2ADB10D6CDFD57B30E657333074268 JESSICAMENDEL
438,342,690 *2C6E283E90829C551949921E299DADCDCDED8639 [email protected]
438,342,691 *2C6DAA6D74E76C3F5F5978D0D4E4B5D35AD91C14 [email protected]
438,342,692 *2C649D00FE27E4C2898D69C798719BABAC547C41 [email protected]
438,342,693 *2C69F2A327E9C1CC86CB58047174230D312F6126 JLE0
438,342,694 *2C6596F2145F1973C29FB3143C9F397F4422C34A joanbloodsaw
438,342,695 *2C6C19315D2B364883560F507C9C46F7DBD9F6F8 joaquincardoni
438,342,696 *2C61E411982FD18D8401C2F26278C661436927E1 JOEY SUN
438,342,697 *2C60B618664649EEAF6350DC121496C991EFCABE JOSUE.KOPPLIN
438,342,698 *2C6F935FED246FA12D89B0DDE2E25CEA4261818C jq-:
438,342,699 *2C62DCC7176A893DC24A430D38E3DBFC0D30DA8E JULIUSMILHOUS
438,342,700 *2C654B017F17E6F3DB51E728418530A3BBEDF95A just-chad
438,342,701 *2C6382538FD590DB7B682159E79AD3C28E41CDCE [email protected]
438,342,702 *2C6D7901239785ECAA7ECF1F1DD3EED797353748 [email protected]
438,342,703 *2C6CD8EDF9519843D811E28C27906982157FB615 JYAKUYAKING
438,342,704 *2C61BEDC37D274A81880EA29DBA904421D7AEDD0 KAMAPRABODHA
438,342,705 *2C6D2DF7BDA533F0AB613B846A2AFABC58405B78 karendel
438,342,706 *2C61778AB733598173414295203DDA258ECC76B7 katsuro
438,342,707 *2C635B509CC2CBB0231874A23C97FF3A6D7066EE kendalltupy
438,342,708 *2C681229A1A1627EED20D5DC025C32196632FAEF keoki875
438,342,709 *2C62BE6ABEAB89F93ACA0ADE73D10AC2B2C17662 KIDUKIOO5
438,342,710 *2C65F1A5BAB6D3921E4910E87E8CFB3DC520B9ED kimanka
438,342,711 *2C69649B783A850EF998E76CB7C2138CCC13C7FD KINGSTEPHENOVERTURE,OP117:ANDANTECONMOTO-PRESTO
438,342,712 *2C631C98D5AE4ED80CAE5386E276AF20FC57F594 kissock7
438,342,713 *2C6177112C53AF37F4D7BDD26AA45826F5E73333 k}m
438,342,714 *2C64D9B0071D002870C11A09586F4B1D3F61E562 [email protected]
438,342,715 *2C6C444EA5D787EDC6E50D3606EAEE0AC8169516 KOOKOOMS2
438,342,716 *2C660CFAB0A1824CB6CD852095CC1A092077DCE1 KRONOMAGASIN
438,342,717 *2C660CB46EA51C2812560FD28F50FC0FB4442614 KURONEKOCAN
438,342,718 *2C694505B660AFACECD25DC7A0AE739A928FA100 KWOSHNER
438,342,719 *2C6B29CEEA7A30CAE3B5B50A35F73C756F1E8215 KYLE.CARRASCO
438,342,720 *2C6AD213C8BC4C7FCCA91842674F289B7B80C03D KYLESWINSON
438,342,721 *2C6226633CBC9D3A8BE8C9CF3AB31D59CB0A7158 L3FTW1NG15M
438,342,722 *2C636EC0F7D9E7EBB35CCC91E1F769AAF0665A7B LAMA101
438,342,723 *2C612C7AED4BE5A0CB67E43EED330F983E7292DA LaurentSuchet
438,342,724 *2C67FA687B624511F346FAB7B0B2B86604A44F02 LAVOISIERIN
438,342,725 *2C640C1DCEEE92A246B19E3C30BD6B82647D5C3D lela-meburishvili
438,342,726 *2C64B45ADE8FE292C7079CA961A66689288C8687 lemuelherout
438,342,727 *2C6C70A49E873CF3C05DF591D11D801520E1259E LHEY_GONZALES
438,342,728 *2C62EE609E5CE88D6D5C9BE7D131CF38AFECFABB LIEZTI
438,342,729 *2C60E9EAE440369CFED439ED482BFDCC4B148A76 [email protected]
438,342,730 *2C64C5156FFAA89C460EF7A1A2B2F0C782F7AB6B lk2k
438,342,731 *2C62840B8472DDB2D7E2FEF76DE0EF4A49726FD2 lonnyhillyer
438,342,732 *2C677F4ACDAE06A907D7CDF307B6477BD69E48CC LOOKINGYOURBEST
438,342,733 *2C603C91AC76AEA56413250E5DEA3423BE6A5DF8 luckyt.
438,342,734 *2C637811B159A58E8604F87A1E2FCAE84224FFE8 lynndonohoo
438,342,735 *2C68125B00000D612769AE3AB2C0D2ABD41C0335 [email protected]
438,342,736 *2C6A49F6ED88AA5E678BDF49622918CCD8B42673 [email protected]
438,342,737 *2C673588B840A3A7C982DA6B789978F6547CE946 MANOJ MURALI
438,342,738 *2C63A62B86821D4733B18D1E0B61833DC5823BA0 [email protected]
438,342,739 *2C674A47F5924C608887F6B1060B0981671826BA [email protected]
438,342,740 *2C661B4753F8D7D7AD7F6B61EF044B06E85DEF57 marju.kuut.-.kaks.kuukiirt.mu.toas
438,342,741 *2C6043CA658578913B2F2DA894FEE7D78D8B3CD1 MARKKASTEN
438,342,742 *2C61E0C9AB93DBC24146F887BFE073D27CE70724 MASON-YEH
438,342,743 *2C67ADC78852163C9A7D832BE91ADD15B07052E2 MATHEW.CENICEROS
438,342,744 *2C62C4249549BDA884EED4A44344F0CF7B88FB4C MAXCUHEL
438,342,745 *2C65ADB52C9A58115DAD979D914B5F350B554D56 mcvm
438,342,746 *2C687ECCB4EF262BC34216309063393B067A923A [email protected]
438,342,747 *2C65272F8B70982A2C2709068156A1694F499931 ME.HAS.HECHO.T
438,342,748 *2C6B4B40FFDFA7650568A7B25DAF1F877476DF74 MEHBOOBA(FEAT.DIP)
438,342,749 *2C6DCA405813EC2E4BD441A194316C8BED16F524 MENESTYVÄSI
438,342,750 *2C69A4C87CCF048EFC83C21921EB1778C2FCEEB9 MEOAMT
438,342,751 *2C60CF569E33906873D3A054FC20FE882457B96A MHAZMIR
438,342,752 *2C621714DDB43C27F840710C072547ED60BBD1D2 MICHAL.OBANNON
438,342,753 *2C6A1A8DCCD67CD109B84223201A55FC5FB9B81B michand1
438,342,754 *2C64089713EA64A52B68841036FE46729CAEF6E8 mike-gajeski
438,342,755 *2C6BD6DEF83F117E3424B7955A091F63EFB05E6F MIKE.LANZILOTTA
438,342,756 *2C6D90E9C9694DC538084449D034628410C2A514 [email protected]
438,342,757 *2C6128BF532985FA52A2723D3FED90D610B75AAC MILONGA DE LA ANUNCIACION
438,342,758 *2C6D4327DC2F3B404483E5BEE54DE0D28F752AC2 mi.parque.de.atracci
438,342,759 *2C6488A2E62711FE002E70D95D26B5FF33CFE5B4 [email protected]
438,342,760 *2C6BC74A933386C71F317F95A0FAF488CBCC6913 MITCHELLMINALGA
438,342,761 *2C6FD6A407EC518DE6FFE90F37E50F25A51E5BE2 m-kf
438,342,762 *2C6917F0938E9AC0E709B6DC958C6CF32C0E7093 MOGRELIA4
438,342,763 *2C6A67867404E4AF95D7F8747F2DF08B2D735487 Mr.-Skull's-New-Year's-Eve-Song
438,342,764 *2C63F3706C11CAE411B2F2E12E0B8D1E97E21753 mstrystd
438,342,765 *2C6D4559D39ABF8187CC43DF3F91C560053F000C MXTT
438,342,766 *2C6169C39EA167CD110130456EE822A1EE8D0D35 MYRONMARTENSEN
438,342,767 *2C6A75EDD7CAE4170F41DEDA6F6EC58DF3FC111A naappendchildtxt
438,342,768 *2C698A4A84295E50A9A8EED0C130C1F7C46AACBC nagalmt4
438,342,769 *2C6FC8F0BA9E2A5AEEF779D37CE0BB503A38166C NAPOLEONMORY
438,342,770 *2C60EE9285F9C91AD163213D8222A4E6374584CB nathanielbarroso
438,342,771 *2C6F96979DC259B18424E4D2CBA7D43FD162E271 naziya.tanveer
438,342,772 *2C623EDB3577D0DE31DE98BAFAA3C737D86F8364 neonshop4
438,342,773 *2C6E0E8D57E420348F3B00399C13BE5AD8E88DA0 netkeps7
438,342,774 *2C680BE580F9E38C412C72ABC47570B305965C08 newtonmashaw
438,342,775 *2C6109BEA458CEA655174B62F5F67ACD22F08FA2 NICKOLAS.TULLAR
438,342,776 *2C6A6C9F275A67F144189EA00E5835C98EC026DC nicole1702
438,342,777 *2C6C741B1151CD11D598E4081E15189845F638BB nner.muss.man.loben.(frauenmitsingversion)
438,342,778 *2C670C4B96C0CCA6C4F8F1D75DAB1F55B484DE7C Noches.de.tu.Piel
438,342,779 *2C6FD5F96B3B0FA225F9FECC1F4ED0E92CD74873 NONMONOTONIC9
438,342,780 *2C63332D3EAFFAA55973AD825023DE102322D77D nutta1
438,342,781 *2C6D665AC99B17C50084915B54F1059DEB294535 o-donato)
438,342,782 *2C61AB5CEA7A84488375D1DCA7D5457498BF7E64 OŁOWIANKA
438,342,783 *2C6C5306D1F48F4B75AC2B6E00067DD6018E76C0 ommabres9
438,342,784 *2C6AB8EABE50AB49AA2654A21475BB599FFC6BDE )O(*-*[email protected]=p
438,342,785 *2C6E1F2353331006448A099000361915B8749A5C )O(~`.(P
438,342,786 *2C6FFABF483B99419B785DA97BAF1F9BD1604180 osteifelvulkangebiet
438,342,787 *2C65D45617BC413CA8B3E0AE7B3F5FF81C7352F4 OTHERWISEUNREMARKAB
438,342,788 *2C63FB3791366BDE094D0893887A70477F9D7562 otistuckerson
438,342,789 *2C6438A0E2C8A04C9A7529D91BC8F85A9F6A0B9C [email protected]~.(00)
438,342,790 *2C645A3269CD84420C46A65A01A73D88C6A792D9 PARAKSTAM
438,342,791 *2C68ECEFD1558526C49E7461E800E16982C93A55 parlanc3$
438,342,792 *2C614A1697EA47C4AF2E4A7C060D53A42660B6CA p----d~ ~
438,342,793 *2C6B2667927265DB8982BE51191301EC23560CFD people get lucky
438,342,794 *2C6E49291B6F8E10C5FE79AB14D484D1FBCA2C3B [email protected]
438,342,795 *2C6AA30B7592682A388A10E5E10CE3BF6C4835FD Pet(ting).Semetery
438,342,796 *2C664A27DC1EBAA174D2CE1E7E3CC2AFE25B5ACF PIERREDALKA
438,342,797 *2C695CB9505F7BFB12F71AD6467BBF319B19B93A PLANTEROD1
438,342,798 *2C6FFC6F0F0EB972A42E492621394948FAF31E27 pnnywght8
438,342,799 *2C6FD6815DE57FF63F0885597D430C321AF5C281 POWERDEVIL
438,342,800 *2C6B800F6614EBD7871D98604133A95AE736D2C3 PRINCEMAHAJAN
438,342,801 *2C63DD34DA75BD77FD02364464E2C5BF6561EC87 Q2A
438,342,802 *2C669F6FA8E10A1BD57031C526761EBAE3A9CE8E QHM6Z9HI24
438,342,803 *2C6324192D4924F7064317778EE6E31CCEB90B2B [email protected]
438,342,804 *2C6635BA23C82DB14AB61A6AE20A46E21B298008 qjvzopz
438,342,805 *2C626E58D0DBF1173ECBEE0EF30C14BA6A7A501D RADIOGRAPHIEREZ8
438,342,806 *2C6A295A68C4B044E52EA5F2CB3A20C7DA968D34 rahul.mahi
438,342,807 *2C6490DA06FB34084366EF1C99785AF37758D77C RAMON.ROYBAL
438,342,808 *2C60032188469F50F05267BDC48CE610381E79B3 raphaelhunkele
438,342,809 *2C6A02134BD889459FD7FEEA7AA534842A205E0A RAYWICHER
438,342,810 *2C6D88F811D47E6A6089775D1C53CCA50A8F3D8C razzia.auf.dem.tschechenstrich
438,342,811 *2C6522F7DB664DBF5C7FE8249CD8043E0082241A RCHTPNT2
438,342,812 *2C64410F4DD7B24E21383D306C152342E5D3D532 READHEXSTRING9
438,342,813 *2C60D2FD1653B5D88EE10137CC39FED99166E50D REALTIEBSWED
438,342,814 *2C6C15B5E22812A1DCD1EE8320B102ACF758FD29 refusals6
438,342,815 *2C6E6D1032E97E229A527637373168022E151B5B REGORDLANOD
438,342,816 *2C681953F045447A2BA47300EE5116CD54177E99 REIBUNGSLOS6
438,342,817 *2C6EE65DF535EEA32E04EC880E303E18254B9C80 REID.PEEL
438,342,818 *2C6C72DEFEAC3305880FD1CF0FBA86B4B23C25F7 REINALDOTAPLIN
438,342,819 *2C62D6C098851836EED29A2F59A8FB853AC10A18 REKCASNUH
438,342,820 *2C669E551DAAC5BB3024CB5CDE2EBEEE75A58313 renaldovillega
438,342,821 *2C6ABB72760906CC1E9234935022660970D3103D RENE.SURGOINE
438,342,822 *2C61A478E783BCF0526AAF91678432C32DA6EB7B REOBTAINSES8
438,342,823 *2C611B371A6E18180E3B1DFA75DA4F8A4FB25257 REPLAYN9
438,342,824 *2C69270DF989995CDDF6C1DB946B00A9E19826A4 RESOUNDINPRAISE
438,342,825 *2C64CA4DD26E458B7E61C8D9DB4920D742F2AFA2 revanch1
438,342,826 *2C69A0CA06C22790F099EFED27886D62DD5E547D Rhett-Crowe
438,342,827 *2C685BFDA96E5AC26B2DACF27FB6DF5BC5B9FB5A RIA.SAN
438,342,828 *2C6439F66B3BC0E5BF388270D3DE81461B19DBC5 richardnevard
438,342,829 *2C6E73F9A995370594ED4E2A204A4E5F9DD307F0 rigoletto: "e il sol dell'anima"
438,342,830 *2C64C8000885DA65B797E0B5304711CFF0FB0514 rinice,.abramane)./."des.bactriens.l'ingrate.entra
438,342,831 *2C63ADFE5E973AE796225F19100BF8329DFE6824 ROBERT-HARRIS
438,342,832 *2C6BB91A3555372E89C53DEBB87A6527D4525C1B ROCKY.HOSLEY
438,342,833 *2C63E95EB66A3E96E612993E0F0536D76365327B rogerkingcade
438,342,834 *2C699B76A03E986E8B1063416E7D0905D389D3B1 rolfsachar
438,342,835 *2C629CDC0DBCDD8619DA389063DB81CB1A52D545 RomansurBromsen
438,342,836 *2C6EF82D773702C9B722B4CC0278FED9296791FC RUDOLF MED R
438,342,837 *2C654A08451B6C50354C089178B98631A15EFDA2 RUDOLPH.THE.REDNOSED.REINDEEER
438,342,838 *2C69D08FB1EE49D337E1275BBAE15D77BCF4B7C0 RUSSELL.MAIL
438,342,839 *2C6DBE812E90A01845EF22BB03BCFD46E258EDA7 RVBIBB
438,342,840 *2C654520E2D6339F5925B636FBAFAE413BD38A68 S01ID3S7
438,342,841 *2C6539E01A26B7C56086DC30397EC469602CEDDF SAMORDNARNAS6
438,342,842 *2C696ECFF51A52288372F3006DA86CE6D8066536 SAN.FELIPE.JALAPA.DE.D
438,342,843 *2C6DBC94600A73F57C7CC60286E6168956C32C70 sanjay-rajpoot
438,342,844 *2C6AA6CE4FABAE52D02FC871F09562CACF03F2A6 SANS.T'EN.APERCEVOIR
438,342,845 *2C6FBDCA3CC9CB114109C452E2A8C35E725DA94E scottmonster
438,342,846 *2C6D053839A5555DD05D969366013F24CE531D90 SCOTTYMARHOEFER
438,342,847 *2C69596094608F305B0795A8BCC93370E365F59D SCUFFED
438,342,848 *2C62320303F6D616464CA80D5DE599231E40084A SETHFERRITER
438,342,849 *2C600DD92D5D3B4D9EBE5248265A74FCA606888A seuqsoik1
438,342,850 *2C6DF71E62F5CE303EADFE86963BAE5051D6B1D5 SHALLOW SIR,HE'SAGOODDOG,ANDAFAIRDOG:CANTHEREBE
438,342,851 *2C60A9D4666EC6579FC682FA36B16365B2E38EED SHALT
438,342,852 *2C6DFF2211E109095F49AED7CBB15133D4EFDB6A SHAYNE.CHRISTOPHEL
438,342,853 *2C6314F444FD1760684D8F5FD58BB18ADE483706 SHONKANIS
438,342,854 *2C619B6457E1A42E0547612CC4EB34994CF62098 SILVERXCOUNTRIES
438,342,855 *2C611EC350716B4E3F2BAE96EEDFD74A05847224 SIMPLISTES
438,342,856 *2C637D5DF455568FD5473AC535A44F5D19C6E076 SISPOREAHPS9
438,342,857 *2C6C027FF11E98F1157F867EC91DC12F12AB370D SŁAMÓW
438,342,858 *2C62C746D73F950D46C6F494FB3D58C4705776FA SNOSTETS6
438,342,859 *2C64AAB339690E883E5E75071772B9F14B36B40F softcage
438,342,860 *2C6296208312AAB62F257A46BA5E7936EFCD193D SPARTEIN5
438,342,861 *2C62E469F1D71AB82726714407FEDD6890FE4681 spicerdamar1
438,342,862 *2C6270626AAA1453F50BDE0156C6997FE85358B3 SROIRRAWSRAM
438,342,863 *2C67E7D9C268875A8FF5FB0E3D2881623259FCD0 SSS.CUESTA.COMCARTIC
438,342,864 *2C65E188B64843D7CCC7839D2296E88AD13D388D STACY.TAPANES
438,342,865 *2C6F7420832FE4A075FE09D41F6332D2EE15DEFD stanfordmulanax
438,342,866 *2C631213CA5C4C733706ADF8E781C929801856FC STAR)」、その後正式には「
438,342,867 *2C6A121361AF364FB3F0847BA3996BFDA724FCAE ***_stefi_2613
438,342,868 *2C6C4F8EE43128B2DC598622CDC9BF73BFB870D1 sting ray
438,342,869 *2C64B2815A9EDCBC8CADBB7F597440F668C25B83 STUDENTDOCTOR.NETWWW
438,342,870 *2C613099D8A69DC7081E69FEFCA4F8810DD7A319 STUNDENBUCH 48
438,342,871 *2C6E49D7362DC1908C97F5C35BBF5A9DA2D066F4 [email protected]
438,342,872 *2C6000E7554C27FC3D6352B33FDC6F38687389B9 sulino & marrueiro
438,342,873 *2C6FF3001B1A333D6F295C28621F13E046C89851 TAKUYA NISHIMURA
438,342,874 *2C6AC75A370670D4738B1B8C638DCDDA7E31568C talkhazelatlas
438,342,875 *2C6E2C83B3DB05F8CE1CBC31FC21B07E40FD14B4 TAMARUNS
438,342,876 *2C60BA3CC04B2D24420A3FE9A22E939B46657D4A [email protected]
438,342,877 *2C64070EF65F7258C5FD3A31E2820D2DCB7F550D TANNAKEOKEAN
438,342,878 *2C66432483371F08A0213F4C42DDD66106B43539 [email protected]
438,342,879 *2C6B136DA8F2528A04E80560D648454795341D71 TARTARO1O
438,342,880 *2C625FC093D7B1AB6112356DD6D1D6CF55C0A9B4 taubtalkabrahamlore
438,342,881 *2C659D5944766C237A3F92E5A96863039A96A485 TAVASZI–ŐSZI
438,342,882 *2C631CED333F79ED6B155F525A6316FCB2380610 TCOMPAREFUNCTED
438,342,883 *2C6103B247F82D278B48EF35B549A5BB36670564 TEODOROFINNIGAN
438,342,884 *2C6BF2D9E1B84B167C88FA0967D25A855CAA17B9 TEODORO.PERRICONE
438,342,885 *2C688006007F3DC24CFC08508716BBBCC55F836B TERNLEAF1
438,342,886 *2C6B3D9EE997BFB8BDEAC22084684FD27E6729EC tétovázott
438,342,887 *2C6C5D48D38BD90A9F8F5D50C3B796CD5037C1C4 [email protected]
438,342,888 *2C6DF0EB88B5C19CD5FEF9136BDE98F78406076E THẦY”
438,342,889 *2C6B492CF33F9E3E111AB1FB4BEB91497733176C the.gospel.ship
438,342,890 *2C6411FFAC5153B77FDBF6556EDCBAFEA3407238 The-Little-Squirt-(To-pitsirikaki)
438,342,891 *2C60AAE73DA5EB81F6F74A274375B0BD78849AA4 THERENEGADE2004
438,342,892 *2C6CFD308F7B13D07DAEB324808F5FB73434722F they.all.seem.to.limp.a.little.extra.when.they.are.replaced.
438,342,893 *2C61FEA5458C345A4F89FB67553FAA945CCD6B40 THISEVERLASTINGMOMENT
438,342,894 *2C67CBDAAE6BED770A6D79F69269BD55742CFA57 THYFRIEND0
438,342,895 *2C61A2EF8C02D7B8735C773AD70600B8EB76E41F TKN,
438,342,896 *2C64B445D6D56C5FB99D688D2F63EE193D17DF59 TOMMIESTICKRATH
438,342,897 *2C622F419058E231E1B332A6FF65A23DCBEFF688 TOMOSLER
438,342,898 *2C61EBDEE801F9C27C35CCEC89BDECCC3F002368 TO QUEENS
438,342,899 *2C6CBD3906923A5609F0A23EF7F838E2303C5530 TRENTONGOSSMAN
438,342,900 *2C6F64701EBE7374EB8B217E3541F85337F5DBC0 tristanspatafore
438,342,901 *2C6C5B6F3A554D1C8F5ADC08B7CB6A50529C4612 [email protected][email protected]
438,342,902 *2C613AEFCE4F38F35708E983F5170629C65B3279 TSOLKEGN6
438,342,903 *2C694A54A640AB64E521B93E11D0D560CE4A8621 [email protected]
438,342,904 *2C6E4B027C5A5E46F1510067B0B6679C96C28ACE turnanhonestpenny
438,342,905 *2C6852AD9C929CD39EDAB7FF4FE75A51355CB42F t%<y
438,342,906 *2C649C4E86AC51DA8BD2360DFC5497F3A7D1B3A2 U147755
438,342,907 *2C659BCF31B52D398A4984AB1864D3C64DF60404 U75636
438,342,908 *2C6424F748E6416D9B7310B9DD749312B9EC8E2F $UBD!$T!NCT!ON
438,342,909 *2C6D1A1839F20AC9DFE4D3199440E0D3AC19305C [email protected]
438,342,910 *2C604C7BA04FE15912C2F28B2FAA72A5A44468AA UDSENDELSER1
438,342,911 *2C6A279CBC1008ED216C43233DD56591BC1F651E UMZ>
438,342,912 *2C6D48B2472A6811B447C3D089E704A0F0F6EC0A [email protected]
438,342,913 *2C6BB3583B7331496B42621D472079D981987979 unce4$ing
438,342,914 *2C6CA60C355B8AC31E58E565ACF898BD0A30FE56 URFJEDER
438,342,915 *2C6FB14EB82E8A302744E7B187CAF66D8248DBFD user1gretchen
438,342,916 *2C6A389641A2AEB372B336EAA25CDBE91E377644 uzobuya-nini
438,342,917 *2C6409B810159CF6012BA70FACA59DB3C7AD6BCE VAMPIREPRAISE1
438,342,918 *2C6A001BCD4E31098CD3A94C2325346DB645C8CA VANZATEN5
438,342,919 *2C656B2B5103C02C3F250F4458D0439204E313D5 VAS0DEPRESS0R
438,342,920 *2C6EEDD2D36820C61D8A2B54AE1E0587671C406A ventin9
438,342,921 *2C6C3390800E9A87E97D752EF6CC81EB15BD1C7C VERTPALEO.ORGPUBLICA
438,342,922 *2C6FB99078C7D441A017CD67B754DBBBE45834C9 ve.walker
438,342,923 *2C6891FA6367D189EC75FAFEA6B777868FAA4823 VEYCIWIGDRCNWS
438,342,924 *2C66CBC000E7C1AF29C666A29D1A5B76C371B337 VICTORMEMORY
438,342,925 *2C65E582EB02136B307B23F468263E12997FB861 virulent-contagion
438,342,926 *2C697AA45EAEF43BC16FAEECC1601AD599D034CD [email protected]
438,342,927 *2C6F126A62541AF0BCDF2C6164B5BF22A023D2FF wagesear
438,342,928 *2C670EF09A9298F9BC4AB5E30D8B770D6A6AC0C2 WATERSPINNEN0
438,342,929 *2C6B56C9A8A6CE2825B74F8F3E682324427B665F wernerwauters
438,342,930 *2C68AAFDDCAB895E9E26E7A9B927D53961067B2C [email protected]
438,342,931 *2C6F0EB1477D45CA316F9C8805AC90DB2EFCAAB9 when-we-were-21
438,342,932 *2C68DAC7FC8C7DF62FA1711F5BB174993F067A07 WHITNEYKRUMINS
438,342,933 *2C60314286EFCD306583DBFD25EB0196D66E2123 WIKI-EMBARRASSMENT
438,342,934 *2C63A08FC6593472FCF6DF24105556C062B86BAA wileyohotto
438,342,935 *2C6F9B541E0BE96DDE4408B478CA200BF20E32CC WILFRED.CUNA
438,342,936 *2C67469079B58B4CF3E29FF3C0EECC0CB9F81E3F WILLIAMPAXTON
438,342,937 *2C642D310ECC704F8BEA1D057C410C8C11D4206F WILL.RAID
438,342,938 *2C6A0A559C326E60ACB203B06167A377CADA30F0 WILLY.EMBLY
438,342,939 *2C62E1A27EDBF7A09E23D7D7F56C1471CA0F76D6 WILSON.VANBOVEN
438,342,940 *2C60A0CCA8AB4E73AE3C7CD356A6A8FE364F7D01 winston1930
438,342,941 *2C6A92F18DDDDD309BD9D14791F7E37AC35A90F4 [email protected]
438,342,942 *2C607645F420043265841DB53932BB27E665F1EF WRÓŻBICI
438,342,943 *2C668B91C5C1DF2B9276559E6936391585368E27 WWWALBIONVISIONCOM
438,342,944 *2C66E7AAF444BB4466BDA68AFBF0F7D4365F6D53 WWW.CURETAGE.COM
438,342,945 *2C697B45350AAC7B0E7AD6AB7A2DD4680DC9A3CF WWW.GORSL.COM
438,342,946 *2C64E9F6660D091DCBB24074DD7066FFCFA6C655 WWWPOISONIVYMYSTERIESCOM
438,342,947 *2C68B7BE7F49EA72BD0341A63F8D9458F1BDA8E0 WWW.SUSHIAXIOM.NET
438,342,948 *2C652EF1A07708688E8BCB2323E1FB2252FF6855 {x}*-*-d####P
438,342,949 *2C6B601BF7C7461CEF29A242338BA29F31ADFEAD XGMODULEMUSIC1
438,342,950 *2C60CF775865D6A32356619369A69083C37FD3FB XIDO-DE-HIDR
438,342,951 *2C6852C991A83A830577520128482B186F7A065F [email protected]
438,342,952 *2C6EAAA78B67A029DBC06453196241910306A3B3 [email protected]
438,342,953 *2C609814C2564ECF56DD290C6418FB464E055843 [email protected]
438,342,954 *2C68850C93FFE34E761DD1E13E927B3B8EC40BE1 y12311
438,342,955 *2C624EAE4211D5178D11A9CC1B94A11C8F7467D3 yayan-yulia
438,342,956 *2C6F28B65C67020D4927184B636181CD8D4F5EFC YCR[
438,342,957 *2C6937CEBC4A190E8D904615F5532163B6603C5C YKSIKOHTAUKSINEN6
438,342,958 *2C66DBD09E4FD798CE6D2A8168AE36150925677A [email protected]
438,342,959 *2C63D62EF4A53A5E71711F353B1ACA1EEE33C0F5 YOBWOCYNNAD
438,342,960 *2C6DBAFC4B639EA974492D7E7C4E2B80411722B3 youfillmeup(featkeen)
438,342,961 *2C6BA8FD041B561B632CBD19450A32D27A62A682 YTILACID7
438,342,962 *2C6C366D695BFA011043BB0AEF7391642B4490EB YUKSEL-SAKALOGLU
438,342,963 *2C6BB859C9CA128EE48C8EBD54D4320FFEEE3148 YUMISHINZATO
438,342,964 *2C6BBD8F9B71FFAA14E877745538C82DED746814 ZAINZAINULABIDINZ
438,342,965 *2C6DF65380300146C8C27849D59E69575A7C5E29 [email protected]
438,342,966 *2C6A702425DBF5C382BC8E315E35C5497EF4D15A ZAYDEN324
438,342,967 *2C641295A1216E9E75827E99B257F91C8A635892 ZELLICA0
438,342,968 *2C6B290ABF0D962A210B3B5D2FBE60F9A8AB8A93 ZIPPORAH-NEFERTITI-JONES
438,342,969 *2C63C0FC5ED93C04A0A58742643D6BF84C143F6E [email protected]
438,342,970 *2C60825C1CEC13855D7C2B9DB3676ADFC54BDE36 ΓΡΑΦΉΝΑΙ
438,342,971 *2C63758ED2E1E015A717504F7490FDF482D7622C ΕἸΡΑΦΙῶΤΑ
438,342,972 *2C61D60C5D3F3ADFE495490FDD08236C429E16F5 καμασῆνεσ
438,342,973 *2C6AC7E296EDB60FAE7A138030FC31AA2F9DD451 ροαιάν
438,342,974 *2C632638B8E9643559AFEE41327DCC66EEC8E3B2 σβουλίνης
438,342,975 *2C6EBAB89FADB1F959365A391BF5AA2A37088900 бгашев
438,342,976 *2C64898696A321BCD2CBF2247BB1964F41F13D63 МИРОНУШКА
438,342,977 *2C690FA3B8AADD5CE9C0E82A9EC118401AD621C9 НИТЯН
438,342,978 *2C6E3CB760F5B58958A9AD9F4047D42D47206248 ПОБЛIД
438,342,979 *2C6C71C5655DCFE5360639727131A41418F9398C ПРИЧАЈУ«
438,342,980 *2C6B6D5AFA4567C773EEDB4C7802BCC6E28EA021 СЛІДЗЮК
438,342,981 *2C6FA81252775B0D1122BF42F8DABEC87B96604E ՊԱՐՍԿԱՍՏԱՆՑԻՆ
438,342,982 *2C62B8D3B20992DAE63F946C7958AF0717D484D0 対談」『格闘kマガジン』 ぴいぷる社、no
438,342,983 *2C69F1CB4A11F2BD91AB863ED5AF9F7A2C5A50A7 1339047 es kommt verstaerkt zu schlafstoerungen
438,342,984 *2C67962CBFA924DD4C7AC13A59183B93F8EF850C 1356058 TAVOITTEENA ON , ETT
438,342,985 *2C66FC10FB63AAB85C873AE84AA2AFE84E708590 1359232 besseralsjetztkannesgarnichtlaufen.
438,342,986 *2C6F92CED8E4D7A169E63E0BB0A49A4EE630C1B6 1371bme305
438,342,987 *2C6251EADF97A68A98E02DE47FFC7286CE1FB8C7 14jan1323
438,342,988 *2C61D4758FE1E314D3ED0B6F5C090CE7C7D7C998 1612487 ".it's.really.a.very.intimate.form.of.radio..
438,342,989 *2C6C015C76E63783331002C72E4854D373EC54D2 17AUGUST1540
438,342,990 *2C61B5EB3B77C217E711DA075384B199B5E2EBC1 1-bussgeldfall
438,342,991 *2C624908735C9352FA1F7381D415FC518A639806 1HEATHCOAT
438,342,992 *2C6D0FEF507E60863FD4A6C1D027AF2351321E5F 1LIGHTWOOD
438,342,993 *2C62E6992D8DEA57B4B97CD2B484F1BBC60DAE58 1 norjank
438,342,994 *2C60CB693C1C8C8D79B7BB2256BF86D5866D395F 1.paaliveitsi
438,342,995 *2C6552749080572382237C5F758670C43BA3942E 1 PK-KOMPOSTORI
438,342,996 *2C66C3B59DD3289BB262256CFF5FC3CCD8BFF4D6 1spieler-profitum
438,342,997 *2C6C81E7E9FFE082BE37FF703837BA3968C163DB 1 TAIMENPAIKAN
438,342,998 *2C64755537B59F670F8893E6973E179ED6BD4466 1viinanjuontiperinteit
438,342,999 *2C6BBF3A4C07F93D95E14EEF141082C4CFA21183 21321 a-blok-k-.-4-no-.-41-esentepe-/-ist-.
438,343,000 *2C60E15A58D03AB741AA7327262DB7E2649C34C5 2161383 dielageistzuernstfuerpolemik.
438,343,001 *2C6334B2F9EB6B5488B072F32288E57F4DF48CA0 2188572 muut.n
438,343,002 *2C6A28536828B37751AE9291E173CD72B3EDDEA3 22.wimmern
438,343,003 *2C62057AF694B06FB3DEC77CF983DA0649A81305 2684510 "esmachtspass",sagtsie.
438,343,004 *2C69EB33D431F23D0EFBF4EFA6B9E5F9E80B51CC 26gsob
438,343,005 *2C6DE436B89E4E61369F5D4B3B2A8C80352BA441 2947883 JOTAIN VAIN TAPAHTUI .
438,343,006 *2C6BF2F8603EC35CCE1C58BEABA4853F5F44AE76 2BARBAGLII
438,343,007 *2C6875F5ED7DDC5C1DD6E92D2928C36CB95BF22B 2-buhls
438,343,008 *2C6D1352A872B60F9591B68AF65A469D35753E81 2.DOLUSTUK
438,343,009 *2C69D93F1547B5A6590295B2181728AAF0E81615 2ENOIZAIP
438,343,010 *2C629B2F77249FFA107FC6BC26E809A6C8D5A891 2FELDBERGAUSSCHUSS
438,343,011 *2C6E10268BFE3895972DFD4C7E67FC246FF2AC34 2.harjoitusty
438,343,012 *2C6E48AD3629888855CBDAF4A3AD94DB1AC0CD9E 2.LYDEKENPOIKA
438,343,013 *2C6B1DDA812495A7C5FD80A567E494BDA6E9C944 2neusilber
438,343,014 *2C6AC5A19C4EF2A66C77512757C6DC7082CFC043 2URGNEHS
438,343,015 *2C6CDFEBB4B48425C950EC36356D36800EF1E21F 3344photos
438,343,016 *2C6010BB4D262C74FAD28887B2BB099FF29B7691 3AMARGARAS
438,343,017 *2C6BDE1C0B2216179F448A9E2780E1586B6A4404 3B<[email protected]
438,343,018 *2C61ED8DD6E41D64BF0C10267FA9A7586B050F22 3===>*(o_)
438,343,019 *2C6AF8016CF1E07185D101C7629ED487B2C3BA72 418dae94cfc515dada890931933ea15bis1hed
438,343,020 *2C6598A088AA7305C2C0EE4E7EE619FE12DBCA02 480421 se-pohjaa-pitk
438,343,021 *2C662A1D769B7B319A247642E577824ADEBC9636 4DOGPICKLE
438,343,022 *2C6798121247E3A99B42C640EA2FF75E4D109AC2 4IAMFORUM
438,343,023 *2C6FB1DDAD521E4F176A7ACB2B5ADAA39312E5F2 4ISOETEC
438,343,024 *2C6DC211471CAB44831476DD2523EF1DBF31C021 4.LAWTON
438,343,025 *2C61118845596216CDFC99B38A0D69B8AB16C830 581981 BUCALISMADAANKETCALISMALARITAMAMLANDI
438,343,026 *2C672221395ED08DF0FC9E18B7984B3258FCBDFB 5BC1B4A624403C6D879452002FCA3F3F
438,343,027 *2C6BBBB91B3E51F989EB2581B14868640B7F7547 5DATAHUB
438,343,028 *2C635286CF6CA1952190F739BA7111FD1097B7DA 5FILLITTS
438,343,029 *2C62970C3DFE1195C594DD215B9FD76A591D749C 5GIUZMIUD
438,343,030 *2C63D1348F1594C58546C245269077B95215BB88 5HAZELJANE
438,343,031 *2C6EC36FF519073FA69E981C6DAB1AD3164292D9 5HOEFLIN
438,343,032 *2C6022FA34D6A7B6C818E37BC08BD0DB1348888D 5iluvvolley3
438,343,033 *2C62D5D499423A7609E49F5C0C31DECC8DAF1C17 5NDMGNTZBLS
438,343,034 *2C688D0E56879AF799652AE1EFE9FEF4B71FAFD3 5NYTELMKE
438,343,035 *2C633C33C5CBC20230921812F9043E2FB6CA87D2 5OVERJASS
438,343,036 *2C661ACCCEAD077CC28384AD3397D64F901935EE 5paradigmatical
438,343,037 *2C63718600818D37AA3B773C7801205DD1A2DB5A 5SEKAVIMMAN
438,343,038 *2C62A319A4FE8A5A0C4C97C048D82460E7F3B7C8 5TALFRUUH
438,343,039 *2C6C6BCD6A67F5C13AFA1BBEDA0A9E9700059C4F 5thetraining8
438,343,040 *2C654ACFB01678E3E676BF434C5A82A7CD4F6CCC 6ACHLORHYDRICS
438,343,041 *2C621D19DE01B4CFD91E34561706EDB39B4EFDA4 6botched
438,343,042 *2C60E337A5C24567C4DFF5651F27B63FDF3F9D18 6SHATECE
438,343,043 *2C61BAFD87E027FF903E6DB0901FF91171614FFD 6TATUEREMO
438,343,044 *2C62CE7600F498F94FDE13989B2AB3751965CC46 7BSWDERECHABSW
438,343,045 *2C6557BDEE05BB402E3FD87609F4CB09617F609C 7BSWNISTABSW
438,343,046 *2C6E33EDC88AFCF5B1E50CF7CF0A0CEF9DB47C2A 7ILOVECROWLEY
438,343,047 *2C6C60377F003637863FE07B201B1878D44CD759 7KREUZSCHWESTERNSCHULE
438,343,048 *2C6DACCD3181A20491E9DE6A42B9294BED6C6838 7MASTIGOFOROJ
438,343,049 *2C68F4F7FFFE209D6BBEC1FE467C116EC44167CA 7MIKAITI
438,343,050 *2C620E5D810211688A70D034A6BBDB96D87CA629 7NEOSVTLILY
438,343,051 *2C6FBEAB3C7E7202925F8242C8B25E32C74BC4D9 7paskwilletjes
438,343,052 *2C64A6EDF10D466B1F5CE7E542CA055CEDCBE70B 7u49hz2n
438,343,053 *2C6113CF0AD4A0FDCE9D1E2A91D5FABAC98F8B12 7UNPOSSESSIVELIES
438,343,054 *2C6A3AFBEF7783B4CD23BB082D5FC7ECF39004C1 86596 DAFUERTRAFERNEUTROSTOCK
438,343,055 *2C60E5CD5CB222037FA58CD0BDABCFD56ABED7FD 86 HAMPEL
438,343,056 *2C6C6BE87394D1C5CE56B27A5DD5F7382E63E698 8------D-~0~o(>_<)
438,343,057 *2C69E69E96021144C096F71FB1DB51115C92A392 8-gesundheitskontrolle
438,343,058 *2C63B8CC3F7A890582D4A4ECE27F6E6F722690B7 8HORSEFLIPPER
438,343,059 *2C6C7466AAE37296EFC02EAB6A41249D947A4F79 8.L
438,343,060 *2C69EB360A805EA1CA75443FCA4B12616476A5E2 8SNURKSNURK
438,343,061 *2C63467E990939AB194895EE8513C93709B25F1F 8VERSARIAM
438,343,062 *2C690DD20BFB9CC2CFF195746AABDE86C252073D 91AF
438,343,063 *2C6CB55D2D3B5D7B11F25E488F52D55A33D18A10 9ALOKOVNO
438,343,064 *2C6EA30252B90EBE7CD3AC7FD2D65FD4C34B90B9 9CAMPBELLW
438,343,065 *2C62FE854EF2A2990F28E8F94DACE756ADA1AA74 9DIAGRAMMEN
438,343,066 *2C687BADFF359DC7C293967C541DF60AD2EC7094 9-kustannettua
438,343,067 *2C6955C2F602A1E910933E80D592913988083C77 9puerman
438,343,068 *2C6C6CB0FB257051DBC0455DD7739A0A093B8C99 9thecolette4
438,343,069 *2C6C5B8D47424595E6823701602E497DC5D10596 a6
438,343,070 *2C62016EDF2B7EFEBB52C39BCE2084A8CACD90F0 AAE`V
438,343,071 *2C6B1E89746FA8B1423D4F8B0663348EAD694E98 abctm
438,343,072 *2C663D5DA93A05E4F3F3B484E9DC63F3A98D879B ABRUMOND
438,343,073 *2C6B2A300569D7039A6F029ABF40A6ECCDE9899A a:b"s
438,343,074 *2C65E22F0277C58A9002A1A832C965AC7C85A48B ac:#n
438,343,075 *2C6E14724619F3A6ECFE7A16FB6D8CA7FEBC4122 adeste
438,343,076 *2C6837120A584FED126528CF91DFE1A98DD7B03A ADKOMSTEN0
438,343,077 *2C6CA73AD60ADA27A0D2DA6454A9A47C59C4D291 AHO=H
438,343,078 *2C67AF9A0460F5FC9B0B1338CF933C2ED819148D ALDNAHNIS
438,343,079 *2C623B0B1B465EF7E48A41D5A72E24060C16FBBB ALFRED.HONAHNI
438,343,080 *2C632F658C5107F5ED3D8D4CA2775C12E3F75181 ALIPASHIAS
438,343,081 *2C6E977B9F1AF90DBC21C73465A9AA48A8624B99 ALOEFTGER
438,343,082 *2C6697165B34B3DA2ABE5A64EC998F2E68F05360 ALPEKANSING
438,343,083 *2C677E1364238B174E1C158D794DDA2D0CE6D1BB [email protected]
438,343,084 *2C6FD09231F74A768109B9BC9DD7ED12FDAAA215 alvinbruh
438,343,085 *2C686E1BA5C783A32605BE3E1486E3F2C6D4CA43 AMATSUNUED
438,343,086 *2C63439DEF36BC6238BCB8CC53E8F499AB80B348 amoaheric
438,343,087 *2C6444C98C37371B3B7B7F92CF14594812AA7ACC ANBV)
438,343,088 *2C60DFFBE0C085F3B799FD370EB6A09A2ACE8CDF angelusnoinorinokanesaigoseisen(shortversion)
438,343,089 *2C6A7E85F499D2DCA337453CB6A438E71C34C4EC Angrendetyv
438,343,090 *2C6EFA851492226F9E56E7317233D61B130FE31F anna-canlas
438,343,091 *2C682A41764D648B76945ECD5264ADF21EC07D00 anodonti1
438,343,092 *2C64C191418C155F1AF2CA8C31735E6661FADD62 aoe#
438,343,093 *2C6D0ABB2DC6AFA687CD684863BF4861901D3F61 AOPT,
438,343,094 *2C6944E92D662E6D3F701AFFDACD819AE658FD1E ARNOLDBORNE
438,343,095 *2C63BCB76C037D49FF0A03C2E97A340CDB6A135B ARNULFO.VANWINGERDEN
438,343,096 *2C62076FB7081103245A55746A5930C9FEC5C66D ARu=
438,343,097 *2C60AB50DB26FF0C5E876A70DD179A0EF1239C84 ARZUHOSSAIN
438,343,098 *2C6186D51001012944958938A1D3AF50F356C73A asiakirjamerk
438,343,099 *2C6C0CE01CEA26FB234B9BBA70B0F5B55FE8AF29 ath5u
438,343,100 *2C68A3B0D4A86FF59BA6156019E9B01B8F5DEA7B athfirst
438,343,101 *2C6CD095BD4A8A7A7BB5E88A8A83918EB131AD44 AUNREPROACHING
438,343,102 *2C62030D21D7EE8E524A00E9021E5C44BF5BD0FA au#rw
438,343,103 *2C65A0CDB3EB6C3E4FB050F1500E6BAC0F23C080 AYMAN MONMON
438,343,104 *2C6B6084E4F6EF1BBAB6C79841C42D9C86B731A5 AYOKUNLE9
438,343,105 *2C6D6C136555CFBE25A1957C02786D5D6BE4D027 ayr;
438,343,106 *2C60EBAD14A7FCF1F7ACDE76B8D654C696422647 B4RGV
438,343,107 *2C69466F779848FE64EF6B5A984875A31A104CD9 B6bO
438,343,108 *2C6BF407B49C3A0B9D07F8E99B48FED3F008D0C7 baiaz
438,343,109 *2C6F30C786AD14788EA1AF8CAD6284085849CCDB [email protected]
438,343,110 *2C6AB1F8B70984F9B34B493741A5FC5B7DABD021 BANDURSKI3
438,343,111 *2C6785B0AE4042C538F66F6EBE9D0844A14BD0ED BASABSWING
438,343,112 *2C66BBD11057EB20B781C70EE58EF61130C62F4C BEHRMANCOLE
438,343,113 *2C6FBBF8F9DB216F7B585E06AEEE849492609B8C [email protected]
438,343,114 *2C6DA8F5AAFB69B33FF15A7A5114A4D20054B934 BEMATTE7
438,343,115 *2C6DBCA21B01DA0638C3FBB586733CA664F77C19 BETAKEN
438,343,116 *2C660845184778466FE5C414282B4189DBB24EDB BIELAN1234
438,343,117 *2C6578655DB3A646C592C4A007C531C4C6FB4879 bioc1
438,343,118 *2C6060C39C084CBA1190C65ACA4D14D157AA359F BI$U
438,343,119 *2C629F79029E830A8C7703F96023E53B16EF80DA bo%rn
438,343,120 *2C649E24E2DDFFBE2CB3AD4111A6E5677243B28E brandenburg concerto no 6: iii bwv 1051
438,343,121 *2C6A6E37A2F8E4BE9C8CABC94D32BC3B742F377C brockmoch
438,343,122 *2C6B634EA272C09421FD6D76FF119D52750FA9ED BRONCOSANGELA
438,343,123 *2C6AF16AF243487626183C555C08F968318CE9A7 BRYAN.BELCOURT
438,343,124 *2C68B848AD8F0B97DDF0CCD9571A2C42DEA1BFD2 BRYCEHUCKABAY
438,343,125 *2C6EA537E190891D733CF0487010485606EC8248 bs+5+
438,343,126 *2C62819EAE82C03A04E16F199103871DAE978860 btgee
438,343,127 *2C60D13C610D936F6761C1C8C41FCB5DE44D9ED1 bzivi
438,343,128 *2C614E2C2EDFFAB2265A8F713E7B9CB1EFF6EF2F c11437-1155
438,343,129 *2C686B82ED8D43583E42117483C7277CFABD6D24 capricorn”
438,343,130 *2C6744E6E608AAEBE4768991B17F6C0A2771684C CASSETTES
438,343,131 *2C6F818016D70582A32259BA05F485D00649F232 CCHUDINA
438,343,132 *2C6C40E7ECBDE3F3C221A6FE4EBBA34CD5753D99 c.cnv
438,343,133 *2C6704E40BC29D81B7E5B48B1F15053B89DC22A9 [email protected]
438,343,134 *2C60FAB3AB0C0786C82026677CACB0AB7D409CCA C!D+F
438,343,135 *2C63091659A4CA77A503BD4B476FFF357FA5BA9B charlesbartuska
438,343,136 *2C646573DAA18E2D50C84F67682F8749E2E14CEE CHARLESEGGLETON
438,343,137 *2C6E3B0D6E8BB96358FE84AE206ACC52829BDB35 cheryl.a.mills
438,343,138 *2C6F68E9A245B3D4F906FB00D6792D4B43B83DFF [email protected]
438,343,139 *2C63FF8654469DDD2EA5259BCA743A8354A87741 [email protected]
438,343,140 *2C6C8C61933343D7862C31465B37389CD75A9C28 CINDY-WIDDOWSON
438,343,141 *2C652DA676D69E80FAA5B7A82529B23C4CD57A69 [email protected]
438,343,142 *2C60D0626604CB141FC1CBAC4F3F38994A97F703 ck7)7
438,343,143 *2C6F602D4A902F3B0170E68B333C3CDBAD958C68 ckcc3
438,343,144 *2C6E088345EFD44F92EBB1FFDDB62A3BDC194BFE cleospraggs
438,343,145 *2C6DD88343ADE6AFFE55ACC9EFE4BF520E83DB9B CLEVELAND.COSME
438,343,146 *2C6A9B612414AFC41AC17AE188D394F519B94C19 clevelandleeks
438,343,147 *2C6AFBC38A1BF2340D44A70160E04823FAC7502A cliffholzner
438,343,148 *2C6F4A6931A83747790C1EA63D0EAE62ABD23974 CLIFFORD.LAFOREY
438,343,149 *2C6E307768C6E7890BCE414299F513A4B2FEAEE2 clintonpettis
438,343,150 *2C69580C6308145543A2917FB5564F755B35AD23 clo15+er5
438,343,151 *2C662EFC1D4DB70B959CC9FCCC4FF626E967504A colatitude1
438,343,152 *2C65E1B99A331E96F803BCBE762DD3B67BE4833F COMPALT
438,343,153 *2C6D239DA53AED0C12B64C833CE62306200BB17F CONNIE.BUSSANI
438,343,154 *2C60EF79F79C429CD1FEE583B9A860547B2394B4 cori-cheyanne-black
438,343,155 *2C6B24B2E53A0B942AC2840F51BBC8E28A50C993 CORPOREX9
438,343,156 *2C65237EE07212A6FC60F19E1565F144D5BD95EA crvn
438,343,157 *2C62C30CAEFEDB9BCD635CE9E080B9DB9E22597F CsDG
438,343,158 *2C618DE153F42AA948BE46FF47CADDB7BFFB9DFD ctdctyls2
438,343,159 *2C6A33568E86F6CBC31B3B27F3605920381E50C0 d0m((
438,343,160 *2C6C46FA5997336D421F0041B0A236653ECF5E74 D2U?Q
438,343,161 *2C651EA2CBD1AE20086E41AE78EB704685D889EE D+7PU
438,343,162 *2C61808EAB3AC0A76386BF59125AE3C8E1275958 danpa
438,343,163 *2C6A9BA2A8C8A005294F1A7AEA6E237AA6C96E3D DARGANOJ
438,343,164 *2C646D274BAFD1F3728DC678750BE3E0F82332C0 DARKNESS.DOUBLED./.WALTZ.TO.THE.END.(FULL.VERSION)
438,343,165 *2C608671F21770AE1276B16CCC72F38ADAE35750 decepta-freak-on(missyelliottvsletigre)
438,343,166 *2C629857BBDDC226EA0871D5AC4B7D5EC6590A46 DENETZ
438,343,167 *2C62F8F2771117EE1E0DAD83109943A18A785E7B devinpruskowski
438,343,168 *2C6562484CF0D042464511C503B93AB2E3A64161 [email protected]
438,343,169 *2C6DAE5770E08204210E83BA2ABD77EC20B8B8C4 DFV1
438,343,170 *2C6C2DDC6035986866BBB6DBA8D5BE67934268D5 dhammayuttika
438,343,171 *2C66BA190F55F1EF46AF8F056046090E0C254712 dialyses
438,343,172 *2C6DA2DC301041FB29181BC75FEC349476DA805D DjCn
438,343,173 *2C627760386FBB44C4E721EF077C0F75EA337EF0 dkb-x
438,343,174 *2C6E4783E1AF58251C18C1BB75B38C57A4473E8D donaldhawk
438,343,175 *2C6C8E56E716D21977E3322A22A6431785BE5881 DOUGLASSARGRAVE
438,343,176 *2C679EB326DE13C5ABA6A21A10858F416E2AAE58 DOUGLASTKACH
438,343,177 *2C66D99DB944FE7F093B0B7C837611210FD23E6D DOUZEGRANDESETUDES,S137:NO.12INBFLATMINOR(ANDANTINO)
438,343,178 *2C69AF9B8E256D837281D968B43110E76D0832BE DP_2C
438,343,179 *2C64C27E54F452BBDCCFF2238012FAC21CF51648 drievoetig2
438,343,180 *2C69FD3A943A46380C3021C6C8C3CACF32A8FCAA [email protected]
438,343,181 *2C69E4AACF3768EF3294C4DB51E0793AC7279929 dt:nq
438,343,182 *2C6681F04DF86D3EA6F1748E733E20CA5D630F51 DUANECHABOTTE
438,343,183 *2C655DDC7C34BE5C6968B3FA332EB2646438AEA7 DUCKIEZIGGY
438,343,184 *2C6851F81CA3869094DB034371D454A465E78A9F [email protected]
438,343,185 *2C64BC01FB5B209C7293AB226BC2DBCFCC9BD0B1 DWIGHTLEEPER
438,343,186 *2C65BDF89373E2DC298370D9A2617BB8225F660B dwrs
438,343,187 *2C6E7A88BA220E9CEAC2F1CECAEDA53B65EB31DB [email protected]
438,343,188 *2C662FE577BF324EB27B010A8D055804E5CD1B15 eating that, damn it! it is poison, isn't
438,343,189 *2C6A91B7CD0F7DFB4268B6ECA673016AA56AD7BC EDWARDO.CREMERS
438,343,190 *2C67A02C0758C273698FFA91E48B73AF3AC02255 EDWARDSOLORIO
438,343,191 *2C6DB3884BFD210DD44CEA4A95A6EAE1027E41F3 elijahratulowski
438,343,192 *2C69AF012B156DE309E85D140DD64D7FC11255DD elmerbillet
438,343,193 *2C6997EC99FB90829D42D7951591B167490411CF ELOY.TORRED
438,343,194 *2C6C035EC32E14EEF1311EAA172B8CE16C7C86FB ELPL
438,343,195 *2C62F46286A1F9342CC642181869091CF2113756 EMHBU
438,343,196 *2C6083560D57D95F31831E4E4E5B7A0CF30F4C02 encowl?
438,343,197 *2C6D487DC93EC71CBE0E4645A7A01BFB80B071D5 EO8LE
438,343,198 *2C622559B117EE62C3997D3C81932D3074241522 EPVARMAKSI
438,343,199 *2C684EF3BC5254E3EBBB910BB84662AF71B133B9 ERGASTIK5
438,343,200 *2C6E99F7E94AA065B70C19C2C4592F1BA72039AD EROVERT7
438,343,201 *2C608AACBC327406F54506594CA9ADE7F0A2A5B5 E_SE
438,343,202 *2C69C3A5C3384F75B9BE6583BEB7D9B74F4FF237 etdekkered
438,343,203 *2C63B84D12B071E9F87E5B0B3E665813BD16AD74 ETNERCHIES
438,343,204 *2C63B52D9C0124D03528ECA78B2368C567E320F1 EVALUATIESOFTWARE
438,343,205 *2C62FBC36FCD0006CEDBD989AEA0406832680213 evanbibb
438,343,206 *2C6DA46240E2FE434F174749632B91FCE6753010 evelynjablonski
438,343,207 *2C6108508F18128E59245180D1A1628B7872A54E exhumes
438,343,208 *2C6612A8E19E670677ED12F0A75726FAD3EC7104 febrifacient5
438,343,209 *2C62C726B9D4D1B33297CD4DD7ADD41AA78F4174 fengfu
438,343,210 *2C679FEBBC86D9850F6489207849C75A4ACDD3FC FERNANDOPRATS
438,343,211 *2C69FC5CCA49AD5963EBE30F44B55E88C41B2523 FLORENCIOCHESLOCK
438,343,212 *2C66EEC823AB90E794F5A94EBC938D8EA97DE018 FLORENCIODANNS
438,343,213 *2C648537058188E98538AA2D6FEA2DD328D8ED8E florentinobiondolillo
438,343,214 *2C69A0FE32CB2A55DB8A61CE3199B27AC2D4B819 FLORENTINOMASEY
438,343,215 *2C623967304E51C6E65A9FBFA81AAD01185C1349 FOREÑOS
438,343,216 *2C6351D5D66FA8EC27B2DD6AD7D08F1AB399A9FC For-the-Mathematics
438,343,217 *2C6F89734BB75AC2B75A14DED599676CE1DC897E forturnately
438,343,218 *2C6028318D63880323AB7115174AD933D57C563B FQ7GWAFB
438,343,219 *2C64AB05776CEDBD472B1EF71EEE22291D31EC57 FRANCES.THEIL
438,343,220 *2C62E2410DDCA1A390AF1A063B221F6D3F7B42D2 franciscassette
438,343,221 *2C6AD9048F3238E48AF9F5626212A943FA8E0D3E FRANCISCOMARUSARZ
438,343,222 *2C68FD1DE4AC5EA1C0F6968EA1BB06A11EB386B2 frankieluick
438,343,223 *2C67D5EE350AF79232231B258D1986BFA214D698 franklingorzynski
438,343,224 *2C64DDF81027512B6B4C8D99D3743CF07C9A4F98 FRANKLYN.PARTY
438,343,225 *2C61D9F27756B779D23A45B6E3CDABA81635EA6D FREDDIE.LEIN
438,343,226 *2C635B558C6C6E99812700690494FFB7C10C9C69 FREDRICKHELMINK
438,343,227 *2C650C1E2828D9C282C71F5A4CC6956ECC4FC064 friedgärten
438,343,228 *2C62274D0EEBEAB7EB59361549B648F028BF1542 FRUMENTY
438,343,229 *2C6683BA207E9402C7718E96E61E5561EF73BDF2 GARLANDPYLES
438,343,230 *2C6125CD34E829169AC7A98D8E999A00E88A9B08 GARLAND.WIEDEMAN
438,343,231 *2C61F3A8EE34300DB9649547E3FDFFD624B95027 GAYLE.CILIBRASI
438,343,232 *2C66F4EFDA0BED524B90E364FFB690C27261C048 geminitime
438,343,233 *2C654B3BDCA3E496EB00C6AAB9BFE3EFD60327B0 gerloined
438,343,234 *2C6AA6A151DE532A13407BAFF0E64EB03E07E7E5 GGNBB
438,343,235 *2C634D6814CF5F29D03A2A7CB7EBF11D5DD57A80 GHASIL
438,343,236 *2C6A62FE4CBD9C4F8AA9E705904462587F07E8CE GISNOPS3
438,343,237 *2C63F3EA84EE9257857511CD2FC13DF555054D10 GLENRASHID
438,343,238 *2C66613E985191214009E948BE7FCCEE082997CA glupanaed
438,343,239 *2C6E9FB8BDED2A4CC6859A43E3880F10AEF2B4E5 GORDON.BETSILL
438,343,240 *2C66DC5BD8CA2E7EC95EF9EB8D1442886EB08CE9 gr4inie57
438,343,241 *2C634A4342413556203D6FC7AB9F127F6B42003E GYÓGYBLOKK
438,343,242 *2C6EB34DD0EA862B7AC8EA8F58013EFFA0E5C9E6 H150851
438,343,243 *2C6E699DF349BA8FBF6B96354AA63F0D94B494C5 H4D\
438,343,244 *2C683546DF06F2083719F4F9BEE5DC5529E2FF44 haematocystis
438,343,245 *2C6C8DC683F57AD9E5EA440842F35FE3775F3069 haimsoises
438,343,246 *2C65EAE4FFB35D43BAF4FBC6BCE267BAE994A0AF HAL.KRUPA
438,343,247 *2C662C15BE767D768320156CF242205BDAEC23ED hangoverhorns
438,343,248 *2C671B742DCFC1BA6DEBC7415800BE4F30BEBF6E HANNA HENSON
438,343,249 *2C616AC15127A69F8454A286F78052A643893B2C hansolo59
438,343,250 *2C6F73A84A42074E8AC20E30520ECDCC8417E64B HARLAN.AHYET
438,343,251 *2C6D3D0A438ADA781E71DAE97F8038384A0381B2 HARRISUMPHRESS
438,343,252 *2C66D9E6DF238A261F268C82016423C81AB2A83C HARRYSTOPPENBACH
438,343,253 *2C66726751EA0FE7A3BC35C67A34D9628BCCE420 hassanhelin
438,343,254 *2C6D315AC245C37F3E492BBE8EF0530EFFF051A4 H%,E
438,343,255 *2C6E69B66F8ADEC383DDF545537ADA75CFA2CF39 Hector':Hector.
438,343,256 *2C6166FD148010452233C3D5135662B5141380BC he*k
438,343,257 *2C6493CE8F1735D255C9AB8069F4E97BFE5053EA HEREITET
438,343,258 *2C60A38A09564122C0FB7F6099E048CAE925E26E [email protected]
438,343,259 *2C6AF01D03F7652A726C2F979007D287CF844841 HINTERHERZUKEHREN
438,343,260 *2C69653D3552AE5D3E3809F7C6C44FD4C0BC34D5 hiseudun
438,343,261 *2C656D3CEE8D81F5B331B90D14F87F7483289A4F HOLLISHULS
438,343,262 *2C696409E503E53C63DE8B43EC2606F7E219DC8A hongdezzutti
438,343,263 *2C6A44CFAC4D33C8238FC802229179E0FF153F93 [email protected]
438,343,264 *2C63BCF12CD6E23F96CD365F1580AF21841885BE hotspurs
438,343,265 *2C6ED6CAE6880559E3FA93976BD63AB2BE43B416 httpwwwaacsonlineo
438,343,266 *2C60E1339C2EE067362F6DE48911C9FC0EB077B6 httpwww.f4.nl
438,343,267 *2C673C709E263A8A25A2D79DD674DA80D8D6B8F2 HUNTERDIXION
438,343,268 *2C6A95A13B2ADEEE8636A82E34CF043930F67A78 hvezdicky
438,343,269 *2C652C9730909013E5096BF2A2EC676B2E7301DF HYMANBARANOWSKI
438,343,270 *2C6C78C48D3D1EE6897ECF559A72D3E39C772370 iardnett8
438,343,271 *2C6EEEE9A0E0DDEDBA6E47BCA9516CC1D84D08F8 IEBAARDS6
438,343,272 *2C62C293AC1482B26547C73721F6F735C5986DA8 IIHSGG
438,343,273 *2C62604E4488C6B361010CA79433E0B7A2E46CF5 ILUVLOGGER27
438,343,274 *2C69EA0E747C401CFC79723B6A7B15F939BB2DB2 IMPERIALISTIES
438,343,275 *2C63D86031B87FF9B185108702B122EFAEDDA529 INCARNERIEZ8
438,343,276 *2C66FB3549B3E70DEC0D7CA33EACAE60658B6E15 intro/kansascity
438,343,277 *2C66EAE99DB20D51946D69237F79A1548928345D IPOMAZAL
438,343,278 *2C6D8D1E11C2181D0E33D7606E7E9147150A797F IRINA DRUTA
438,343,279 *2C61E1E44B69481D5453DA2FE8DDE8823CFEA137 ISABELLA234
438,343,280 *2C61188DF1CC4520BE0B3D1E6643EAE04E19AC57 ISSAC.CASTORENO
438,343,281 *2C67ECB113CE5301098751632589979E1160D0C4 ITALY
438,343,282 *2C6547E41C83D2CA0379EEF34795CB174CFEED02 itrefers
438,343,283 *2C684765973AE6BC58C96439C69E02F652CD9667 JAMAR.CORBY
438,343,284 *2C680B1F8AFE274A28C0171A252F16FA31564EBC JAMIE-JACINTO
438,343,285 *2C62CAC486E5CD01511E74530CD67A5107AD3817 JANRHEIS
438,343,286 *2C682CC4233946E16611876F182ABF6EF4E188CF JARRETT QUINN
438,343,287 *2C6D891F87A4CEDF87C44EAAE986B78CF90D5CBF JASON.RUSTON
438,343,288 *2C683EC6A6483DDAE800DCCCC126CED20D3656AC J.CARULLA
438,343,289 *2C6F09E0BD9FA36451E932D237685D9563307486 JCDB
438,343,290 *2C690F0E3DF715C506FDCBBE8846CCD00B20A377 jennynyquist
438,343,291 *2C671906B68547E273932023E2B6BCE139FD8939 JERRELLCLUFF
438,343,292 *2C617C2AA2FFBA96094C7456EB5EFD270310298F jimenezsanz
438,343,293 *2C69882E47F7F4C87EA9FEAB861FFD3EE0159B51 JONAH.DEMIK
438,343,294 *2C68FF3BE9993C28190C9F5378ABB50356751EF4 jonaspeggs
438,343,295 *2C668D0FAE02A8C7B971627D311A93DE8E71FDE1 jonathancornwell
438,343,296 *2C6AF9DEFEF3DEEBDBF6EC6DB80BDEA09546F3D5 JOSEF.VOORHEES
438,343,297 *2C61C817B02B281B09F143FF40781092809F3097 JOSIE.LOWELL
438,343,298 *2C6343C14679EA62D31F183CA0AC6A30F8ED8586 JOSUEERNO
438,343,299 *2C6DC38D313A7697C9A03338E05D200AB1F69BBA JOY.EDOSA
438,343,300 *2C62673032D6D03962B7A19ACF4430B66EBB0C1A [email protected]
438,343,301 *2C6DFE69970E3702E32FB925209104EB346E03B7 [email protected]
438,343,302 *2C636AFB65F93CCC041FED4D93928A650C80B706 JTTJT
438,343,303 *2C62FBB57AE074EB527A2177D92777EFE7E9E18A JUDAEOPHOBE.
438,343,304 *2C69A80845287FBE200005C8B59F0E5E792E9199 JUNHOURI5
438,343,305 *2C60F3EA03FF588B611228DFC1534130E5312FB8 KARLDAUBER
438,343,306 *2C643304F4C7DAD4941046998A3116FA51127AD7 karlillingworth
438,343,307 *2C6DC8C854AFF30DAB76785BAB7A90A3A6262A3C KAROOSPRUIT
438,343,308 *2C63C09ECF18022A2FF43960903BB2B2C38294DD kaseysamaan
438,343,309 *2C6E8C142D85412D6111B10365B2E6C220926082 KASHIIF KHAN
438,343,310 *2C6CC0D6E176B5F7DDDB340E6776B1C508C89C67 KATHIMERINĒ
438,343,311 *2C66F4FE237B6CFCD30A392B3B6AFFB0B9AA952A [email protected]
438,343,312 *2C6A1C038EA50137828A4A3685E7BAEE9EF61EE4 KDULLUM
438,343,313 *2C6EFFEA3F716BCA16A4596FD16E7072EBD64537 keenandonne
438,343,314 *2C624B6417286CFBE328A44D5BF915B899E067D5 KEITHSANDAY
438,343,315 *2C62CF4F4742ACDC2FD4390C89FC0277ACD7A947 KELLYLOSADA
438,343,316 *2C6942E843095DC7D8B78417689EDC89A1BB3F89 KEN.AZZARELLA
438,343,317 *2C67C76E5032BD8EA8B3864594713028F5836F0E KENETH.SZMIDT
438,343,318 *2C69221A58947B4D01195E393A363D7F1FC841CE KENNY.ADLAM
438,343,319 *2C60EB9724399C8CE8BBB71B0A9C789F6BBC0CA6 KIETTIKHEMA
438,343,320 *2C6C5E07CC692644DE2E758007267E46F3771D5B [email protected]
438,343,321 *2C61327149CB7257A5138636B40FAEE36484A3E6 KIMCAMFIELD
438,343,322 *2C60341628540FFCC6F013F34FCE11225B8F3CD1 KING ARTHUR: ACT I. "I CALL YOU ALL"
438,343,323 *2C678ED895F7C3F33DDF4DFAE6C466FD0F7DA290 KIRBYWANTZ
438,343,324 *2C656C05F318CDE9B0777D63DAD9826EEE54E909 kits</a></li></ul><p
438,343,325 *2C68E7380CF2AA099885937EEC5D9B0E4DDB8AE1 KLALKIYA
438,343,326 *2C6610F3D2AABFD080F337C28454404653DC2386 K>MZ
438,343,327 *2C6E40F492EAD7B9DFD7FF225D8CD9AD59EDAA7B k(/o
438,343,328 *2C6E65044B2380322D2306EAB3FCD39E0B699FD5 KOREYFEARS
438,343,329 *2C65DB4B61C22E7ADF48C23DDF86AED36978BC74 kpinki
438,343,330 *2C605DB645E81D731BECF2B23DF21F5A7C4AB0B8 kyle.driggers
438,343,331 *2C62844251A83945C70C0CB9BBDB1890A270AFE5 «laustenneren»
438,343,332 *2C6EDA06F2C6BB4506AA23A7C8348CF2260943AC lelandfarkas
438,343,333 *2C6E2FE0E38CAE7E0A881DED728243E1A32841A1 lemuelwindisch
438,343,334 *2C634651D5734F6D8F935877B646F1EBB87A9ED2 LENARDLEAMING
438,343,335 *2C6908A4227F28F255269E18FCA0C6D3E6AF8979 les-quick
438,343,336 *2C6A1E54F339288DA9AE5BBB0E7AE68B1C71249C lewishodos
438,343,337 *2C6FBD433AEEBB68150B852806A03FFF856F11D5 LFF3
438,343,338 *2C68A47840E74AFEFC5E8A9ABFA84BABDA7A6F7C lincolnvillecus
438,343,339 *2C6EDF97DDE0953CA137E3F01361676A38E573CD lindseykercado
438,343,340 *2C6A55A0B7D8D91533F1C2927969C145434C279B [email protected]
438,343,341 *2C6D96E188F59EECA515ABC673C196D9603DE61E [email protected]
438,343,342 *2C6AD9CBE9837781A381CD64A3FD0E6F1BF45A2F livefirebrand
438,343,343 *2C63E0C7833B53DC6CA7EFD24DD29E6A0D55370D lloydkunau
438,343,344 *2C64BD66E3EC15D0F576D3EFEEB8E2F50406948A LOYD.CHAMPMAN
438,343,345 *2C694522D869F450286E92CB1813839AB64A6F73 LUCAS.DE.ANDRADE
438,343,346 *2C661A89DA10E0812162830FBE8CFE24101CBC50 LUCIANOCOLOGIE
438,343,347 *2C6946AE6B625EB5B6CD70E9F4428FB276E8C291 LUCIOLUOTO
438,343,348 *2C69C2477F9AAFCE2884F8A80D0FA6D5D37E8F19 "LungeDaLei"-Alfredo
438,343,349 *2C6B398C61F7302970302839195227C8ACBB48B3 [email protected]
438,343,350 *2C61D0B886DC34916F579D11014084AFB2EE8EC7 LU`Q
438,343,351 *2C6CF86E457743ED042020DB7D517449C746228D lyleverd
438,343,352 *2C6B1E9DE306FA932CE16BD9946C034D453D07E1 MACARTHUR-PARK-/-I-FEEL-LOVE
438,343,353 *2C68E020A1C781D882EF7849EC73ACE703386D00 macracanthorhynchus4
438,343,354 *2C693F5C60F3D9E1A89A2D61D74DD4ACC28887C8 MAHMOOD-REHMAN
438,343,355 *2C632CFDFAB9F090283D9FB74C1BC8EE20055502 marcelokaba
438,343,356 *2C6F2A854799946C23054D3B1EC958049ED79A90 MARCUS-ABRAMS
438,343,357 *2C62ED7D13168C4A7B8F1A5BEF432753CF7EF0FD MARIEMAH
438,343,358 *2C649F2A4353A5810559633F55CA4DAD969F5BC9 MARYANGELETTE
438,343,359 *2C69D0C7304ED9B3861CDCBC52E3D0A9CE8540C5 mary-ann-dorsey
438,343,360 *2C67447B59D72DA81F21B03A1AC7E7BF7C39ED6E MASONSCULLION
438,343,361 *2C63FD3E22FD7BEA78E3E266523C2A2CF9CE7329 MASQUERADER1234
438,343,362 *2C6486A50B8B8AE01183D18E33C91863525397E7 MATTEOBOTTA
438,343,363 *2C61155E7CD95388FC29564C565E93D145D26D29 mattlang
438,343,364 *2C629FB9FCEA143C018705F020DBFF5BF2C6085F -me o groove
438,343,365 *2C6ED9382664F961AE992E52DC07BFC400A44080 MERKEBIN
438,343,366 *2C611D4686DCB7771695F71682255C6B89841330 MERLE.DAMBACH
438,343,367 *2C657D9CF751B2F1B18E741207C0CC9832DBA248 merrilltolan
438,343,368 *2C6037662EFD85E5906B81B3B5B6D0B0FA5DB86A MERRILLWYSOCK
438,343,369 *2C64EF0C102596116D08611E14A0F0E6C05F8B6B Messiah(remixbyTransitPoetry)
438,343,370 *2C65FC3DE4BE9313702878D12BEBC1707A9FA577 MLETRONDO
438,343,371 *2C6EB2FFD63B8AB25991EC198A0BCB695C83D79F MLYNARZA1
438,343,372 *2C6F3482F9C22E362DCFACB5887EBB7266209CFE [email protected]
438,343,373 *2C633C4C88C15F3CDA9027C2B1F27AAC76C680C1 MONROE.CARDNO
438,343,374 *2C6358454FA212F2D6D007E8D28E5ECCAC4462FC MORTONMCCLAIM
438,343,375 *2C6F4C581500513746471AA608098E0614397732 MRS..MCGRATH
438,343,376 *2C6A9AF942151FCD45364E884811CDADAD472A03 MYDEMO44
438,343,377 *2C6CC17C86F713B67F844DFE2F51A16C35D1D7C6 MYLESBERTINI
438,343,378 *2C6505933E85DF78351E7F3C297DB3E376B66AF1 MYLOGOS67
438,343,379 *2C6E2FAE62F452219D3E4554E8CBF56125DE3A96 [email protected]
438,343,380 *2C6E8920535304D280A3CDF851ADFD553498B2DB N0c7am8ul$7
438,343,381 *2C6644A63FBC509D2DA7FDBFDA3DB9F8915667A6 NAINA MOHAMED MOHAMED
438,343,382 *2C6EBF50EBEC8603789B40AB82C14F68C41ECB4A NATHANAELPONDS
438,343,383 *2C6DD56D7C45D2A4FDB57E411FBBFA021D1FE77E NATIES1234
438,343,384 *2C64BC1B47522EBBFDFEE2055BC8829746FE6570 NATIONALBIBLIOGR
438,343,385 *2C60EE5A07DC8E48E9C68522A947FEB822721CA1 NEWSONGLIVETHEHITS
438,343,386 *2C6C9B052AAEECC50169E699358911698A9465A3 nicholaspryor
438,343,387 *2C6D27D132804A1F58BDAB466FA44CB20659DD10 NOEPOMERANTZ
438,343,388 *2C649351A41477FF4FB6F0DAB0CB17EBE95FC299 NORBERTFLEENOR
438,343,389 *2C61324AA78E94534E5A10C3494A39E2C9ACD239 NORMAND.KORF
438,343,390 *2C623A431AD6726BE7B4CC1AEBB133B9D00E393F NORMAN.SMALLIDGE
438,343,391 *2C6B9CA6C0FD4C2B0B35A78A6C3928891109FFD9 NOWGAMERPREVIEW
438,343,392 *2C6E34CDA052E966E1DA3438E387D0835CC9402E NUMBER1DAKOTA
438,343,393 *2C6998BF6E6EE1F21E1D73ECC3CA8E5AF9011233 O->-< ~ `@####8
438,343,394 *2C672A654D5E65110119D188D70B8682A93F115E ODIS.KAGAWA
438,343,395 *2C6077965D98CBDF49E2CD67D30E18CCE166C059 OFTLIGRPNCH
438,343,396 *2C61FD0E78DD4FA3231F5D850D4599CC75AEE399 OLLIE.BOGLIOLI
438,343,397 *2C6DF67BD2DF2452908EDA58B69EAE4A311BED7E OLLIEBOY7
438,343,398 *2C60A9CC2A71752D6A9907E06DA277F2FB30BAC0 ONANDAGA8
438,343,399 *2C6532E3ACB36B65F73A9B158A6E041861CBAD74 o-palavras
438,343,400 *2C67DE97DA5B4695F9D237C0CD366533E1B38328 OSCAR-ALEJANDRO-PLASCENCIA
438,343,401 *2C650206CCCBB8B79BC4E849F9456038E8884F2E OSLOVICH0
438,343,402 *2C633509E9F017E87D2765AB11A911D4C390E6EB PABLOMOLITORIS
438,343,403 *2C6D75CC4E3AE05350C78FB9D7A91EE5FEE83F1B PAJERO101
438,343,404 *2C684EECE55FAE098453859EC76E3C6A0EFA2E33 PALLINAYAT
438,343,405 *2C694DB61DD477DDD6FEAB05B99607279AA31534 PASKAASISTEMA
438,343,406 *2C6058EBDBF712D418FADC4CF2D95044D5EB9CFE PAULALLISON
438,343,407 *2C64194517FD23DBB429498D54BA6C852E539CA6 PERANGKAP
438,343,408 *2C62E0FFC56F3164CA2BBE79737F3FA434C685AC [email protected]@NG1DES
438,343,409 *2C687F466EE63E8452633A65ED6197A68DDEC68F PHILIP.RVIZ
438,343,410 *2C6236EAD9534EED79A92E51B8B9B72A694B61A9 [email protected]
438,343,411 *2C6C008F055CCA71D9FC09F5A669FF5B5EB8C9DD PMID15466448
438,343,412 *2C6E7748BB626B5BD524425FA2AB5881736A1DF0 PNGSLCHT5
438,343,413 *2C6864455B5E9BC84CCDB51CF856BDB5067A7DB0 PORTALLINUXDID
438,343,414 *2C65F4FA0681A758F3984AD617D1ACABC3C7058A POWERSTATION
438,343,415 *2C6915A9F09A0D6ABADAB8E1608688A214D03899 PRATISH.SONDAGAR
438,343,416 *2C6CE891BC14A7E4D1D8913BB552AD566EE00663 premain
438,343,417 *2C6D3DF8209F2095A5FBDC2DAF6F71B690BCB3F8 PRESENTEYSUTIL
438,343,418 *2C66E98E3AD405AD3FEB1850F466A6430DAFF9D3 PROVOYME9
438,343,419 *2C6B4813952DFE5C396511CA221759A9E18A4F42 [email protected]
438,343,420 *2C6AECC68943CDF17A7B5B537F9EBD2217EFAC89 PUIXREDON
438,343,421 *2C606DD28EE745B8841E5889AAA21BCD6F7FF7D1 pzjq
438,343,422 *2C6B9B01D754DE8E9FCC3EE297E0301374FB300D QLSE
438,343,423 *2C67DCDEC4936F2223EF1FF2AE57D60E77CE507E QUIPONS
438,343,424 *2C695F1DA906718CA90A68411C416A3306F419BE rachellefortin
438,343,425 *2C662C2A8C8F8BB737A64BEC84411182FE89BFE6 RAINA'S
438,343,426 *2C62F1AED330B674FC86A0700550D30084ABA264 RARARAS
438,343,427 *2C6E0F3666C13798FF4F7B3DF1D413F825B10D8C rebello--r-eh0-b-eh1-l-ow0
438,343,428 *2C63F887B71D4A810930B3A8D830E7EBA3500DE2 recarono
438,343,429 *2C634402C7DA329EF3248BC14AE3881D30939EAB REGGIE.KINDBERG
438,343,430 *2C669B98C09EBF58022CC4494B209A86506B99F8 REGOLFKLUBBAS1
438,343,431 *2C696F86136D04C22C39553C6E7A4D4FEEA061E5 reinosdelosespiritushambrientos
438,343,432 *2C62900AABF528493CB8025FB5437839C9E290FF REINSKRIVARE9
438,343,433 *2C6C98647E7BF89C7304B5F368DAC06D4C7C52A8 REINTEGRACJIED
438,343,434 *2C61EC383BE85DEBC239DE3A1BA9F9762697793D RENEWING
438,343,435 *2C6A643A52343B763D9678DE81EF0FAA6CCD3B91 rhone.poulenc.|.cote.d'ivoire
438,343,436 *2C6A565A06C08D5AA9E0EF08D825EC6D3CD54312 RJATAYU
438,343,437 *2C64FA3CC237CC30FF40D6284FBE13D4AFC41F1B RNDMNTS1
438,343,438 *2C675303A0A75240A9EA8DA34AA6D4115A0EEA50 robbieswenson
438,343,439 *2C6D5791DA3C611B0B149D63BBF5E0DA1F20A504 [email protected]
438,343,440 *2C694FC6E220400F917E0576F7A6386DBF8E7325 ROVERSLS21
438,343,441 *2C6BCFD9D6A6C686BD314E3DCB390A9965990DA0 ROYALSMARLBORO0
438,343,442 *2C68C8CE5C8A827EDF8B3CD8260EDBD6BBB985E2 ROZBRYZGOWO
438,343,443 *2C6289F7CE752FDF3E0EB044563E8EE22BFDC482 RUBIN.MIELCZAREK
438,343,444 *2C6417103A0F6069864003D2015BE474C93F9C62 RUMSTERIONS9
438,343,445 *2C6FE736CD4493A4DD838AD0BD59D0C15254BF87 RUNDREJSE2
438,343,446 *2C67402F90DA7C2403D2D76E03C64970BC8E53E6 S1DE
438,343,447 *2C60CB7EF3C1024D7970B11B119A61BA7F8A652D samisaaced
438,343,448 *2C6C6100ACBF48C74600F433064AFD0C6D3C5AC5 SARAH.LAMPL
438,343,449 *2C67B7E9DF393FE0439C59B287CA151B99F17F7A SARAHPUPPIES8
438,343,450 *2C66AFD8DD37BC28759C021A310A92730618A6E5 SATURNCANNON1
438,343,451 *2C6DF5B9D80564F9C3BA07B127F7A160A0C43559 SCHOOLWILLIAM5
438,343,452 *2C6904054AFD03410B38282E5B3472F73AC49AFA SCR4MBL3D3GG
438,343,453 *2C65A0D76CF5B228B841966ACA88129A5739963C sdoowbob
438,343,454 *2C60B277D69D04331DE55B63492783D2A18A7D9D SELECT A:
438,343,455 *2C6FBEC89EAEDF665928EEF162EF0580C56271CE [email protected]
438,343,456 *2C64E463544CCBFF408FD338B332EA0802D0273C SENGKANGPUNGGOLNEWLINEUPFOOTBALL
438,343,457 *2C6BC599D393E1899E815808A2199A5ABC190634 SHAWANOWISCONSINPOSTOFFICEWIS22
438,343,458 *2C6A54D64852FE89DD37CD48142CB54110C1C402 SHELTONMARCHUK
438,343,459 *2C6E32A323AE4CF2A70A0E54FF133C19ECCAA80F SHERMANSHOTTS
438,343,460 *2C6458907DDED1BC457B2F7F344E16FD4F50B32F SHERNEKA
438,343,461 *2C6FE6930411E11C557D3DD529FFB4E51BE088FF SIEBENLEHN02
438,343,462 *2C67494CF2AE6869C6451C0089068C3DE74E1E91 SIKKAJOU8
438,343,463 *2C671539DA99AD70013DF002A77C885DE0ACDD4A SIR-ALEXANDER-GRANT
438,343,464 *2C61A689F597102C4D04A04EBAAAF5F230CAB387 Skagerrak-(feat-Christine-Litle)
438,343,465 *2C617C998E68C4ED04B6D3753F86C19FA4C10B12 SKATRU
438,343,466 *2C6B98A6719672E21C607BA81B14B81341FDB602 SOLOMON.HADE
438,343,467 *2C612DCA2E458D0818BFDD19A65BF18897389EDA [email protected]
438,343,468 *2C61E21FEDE15A6DE798C6F74227AA4A60E09B0D soravlas
438,343,469 *2C6396BE522DF0B65CEB2BD005F5755385A22B45 SPDQRTCT
438,343,470 *2C681854C91013FEB95DCF8CAB7D63BB10BEB648 SPECIALISEDSEMI-UNIQ
438,343,471 *2C67CDC06767A3DE19980C4983C59093491DEF89 spencerschaer
438,343,472 *2C63D25D013461E66163F52EAF6CF3CEF0D74884 [email protected]
438,343,473 *2C6DA04E2E3A5E453E437D715D402F2EFA396F52 srellehsub
438,343,474 *2C641D49142E7EE59212FDF62805AE3318CAEDED STAR_QUARTZ.ST/A/R_KW/O/RTS
438,343,475 *2C64142761EAF1A6096AD1D8159A6CF9A68DB00F STEFANBALKCOM
438,343,476 *2C61424E0C2C5D3E0416C54914AAC2FD12CA92E0 STEPBYSTEP(RADIOEDIT))
438,343,477 *2C60BFB8CA38F62F998220C9BC6E49B7BB49CDC5 stevedickason
438,343,478 *2C66A79807C5E4561B5E4165EE5546AC95E8DDC5 stillsearchingwordpresscomstillsearching
438,343,479 *2C6F978C9FD26559C594B1592352C43DA953D322 stirpprits
438,343,480 *2C617646EC69617DE07DEA8C02F00A25E34F190B STRATEGIZEES
438,343,481 *2C6909947BB3AB0952C58E48FF41FC2251F69298 suchismita-singh
438,343,482 *2C64291316077A012DF1D9F1649F499D652FA623 SUMMARYUSINGREPLACE
438,343,483 *2C6E394DE2E6DEDA73D457E85EB168640A11BD1D SURYAMURAEU1
438,343,484 *2C68AAF0A96727E82716F2006CFA329621D4ABC9 SUSIEBRUNS
438,343,485 *2C6335A9F4E38DD81495DB4706E872B62CFB8A2F TAFARDEL
438,343,486 *2C683E74F34C186E937E588E1A0A9B1D99A95459 TALKAMIS2007
438,343,487 *2C62A772E4332CEEE628BF08E3628899D7462504 [email protected]
438,343,488 *2C605CE33844BCAB575C71E74581623EBDA59007 TANNENBERGNED
438,343,489 *2C60FCFC0F69E581E8CAE8A91DA215B907CE4EF1 TELEPÜLÉSFEJLESZTÉSÉÉRT
438,343,490 *2C6F154840F71953C375DFA91D53EA11B153358A TERRANCE.ARENSTAM
438,343,491 *2C6729C29F8EE96949723E215CE03F564BDCEF3D terryhamburger
438,343,492 *2C6EB0813F0275506A55F01C59F56EFEB9893664 TEWORROS6
438,343,493 *2C69627125F16B97024AD4BB18A4852335EEEC90 thanhmatley
438,343,494 *2C669AE31ED32B85BA3FAD11956BCC57A1FA436D THATEUROPE33
438,343,495 *2C6F427EC8C165F59320B8C14E26B2DD8D6602D2 THE AEROPLANE FLIES HIGH (DISC 5: THIRTY THREE)
438,343,496 *2C62CC0C6725890D2A93BCD6829F0704B9FFAD1A THEGOAT2006
438,343,497 *2C6E1DC47C005AEB2A5A050124318CC903389B69 THESTRETCH94
438,343,498 *2C66576105387DB93EB26D284469FDD3D50A6B8A thisgoesout2u(featmareko,themexicangoon&deach)
438,343,499 *2C6807EEAD9AA3079CC38CFEE59C33F182A016B7 TIA-PAST
438,343,500 *2C67D5445D9A384D2AA37D424510B3E70FB5185E tnagitil0
438,343,501 *2C6C1EAFD84568F4B9DD4F40503B91B8BA4A2F56 [email protected]
438,343,502 *2C631CC051A3708505FB9ED7CC7388CDA45A7D08 toniastanton
438,343,503 *2C6951E6C697F508EBB3872A0A2F31B58A08A38E TOTHEPOINTED
438,343,504 *2C62A1FB149666003FA2870E443CDD5A13D0573A tree-pr0t
438,343,505 *2C64D749C1FC56FC7E600CE1B0B59D39E5C5F91C TRINA SOLIS
438,343,506 *2C69CE52CBB641FBC9EC3BD1E49D28AE66BC0483 trinidadadesso
438,343,507 *2C64D6B9C401D46657752533F6AB61974AF7B839 TRINSKIFTENE6
438,343,508 *2C69B534EB9A2B445F2C4E4217C961E035A34637 trippwyckoff
438,343,509 *2C6169F4724B524DBFDDA6496FF9346E063CC600 [email protected]
438,343,510 *2C6367FC1120BF57FCE9CB9ACF3D34D18C0D2A88 TRUDY-R-PAYNE
438,343,511 *2C6864AB802738A2B360CFACAF88FC2551FE3F9A TRUMPANDSOLEMNHERALDRY
438,343,512 *2C6D0D622B13B119AE7C57CAA7389966D5FD2FBE TSJILBNIS
438,343,513 *2C62867057FDC48DBE0DD575DE70FC31CB3DF0CF tudelloise
438,343,514 *2C65701DF9A7BBA1E42F09F8B01FAB52DB2AF9A8 TWITCH SCHMIDT
438,343,515 *2C6AA4EC41DDFC5F5D340E86E6999E9F97860200 TWRWTHDRWL
438,343,516 *2C6539CD12060A5585F384D13379A6CE101FA201 TYFENI-GREEN
438,343,517 *2C61D217123113F8E4447CDA18162E43271055CC tyrone-louriano
438,343,518 *2C6D014A7C83F2043B41F3C11E553CC3733265A0 TYRONGELDMACHER
438,343,519 *2C66F65215B63FFC2C600BDBEFDD75B9CECFCF4D [email protected]
438,343,520 *2C650A6E8C8148232F7F7A1DD647382E86A07455 UFFMOVIL.UFFMO
438,343,521 *2C67D5B6B1BD7E80FDBB3EB298C9B45AE905B590 ULQKBSW5
438,343,522 *2C63D033D458CFD0B778CF0F0997CCDA318299B4 [email protected]
438,343,523 *2C69322E419F99094EE7E6F20298C73EE55E7241 UMESHKRISHNA
438,343,524 *2C6E37A818AC6471C93A66D571BD0B75AC902D40 U?N0
438,343,525 *2C6452365572F5073CA36F18F1C5F39CCF9F0B75 uniqueinvest
438,343,526 *2C606CE077CBBDF5683AD7FDB1FD20C0A42C0181 VANESSATOWER
438,343,527 *2C6FD7189C650BCCC22709242BEC13C9B1DDB0D7 VANSCHALKWYX1
438,343,528 *2C63DFA149C5661E9B757788FA3CB6024300E98A VELOGNATED
438,343,529 *2C620EB525EA0AA7BEB306BE7627794CA5E9893B VENINDA.RISTYA
438,343,530 *2C60B0F41E0AB125C55582AC7E69DF9A00DE3361 VERDUNUS
438,343,531 *2C65B904C33D3FEE13AA555DD85CA5B75CCF9FDB VICTOR W STEINMANN
438,343,532 *2C68BFD4EEB88589B4D5E7E146A4F1861946D6B6 VIGOROSIBSWED
438,343,533 *2C61F1DEECC20EA23ACB175BE2ECA809B693E7F7 vimal.kv
438,343,534 *2C63E4EBB571CE096F64A89BA442D22E658F8014 VIOLETBLOWFISH3
438,343,535 *2C6AF87223F5D083357FFB9F1FD7196188CB0D53 VOWARDE2
438,343,536 *2C60B907D213A6B8EDC086132EF1A2ABA1D3AA30 W0RK$-C0U
438,343,537 *2C66E1C0F1F3491173189B9AA3E73D46721BE588 [email protected]
438,343,538 *2C6533A7B7FF058249538E5CEA67A0D40697424A WARDERLÄNDERN
438,343,539 *2C62F6CC3817A63F1A80D08F51824031C86430B5 warnettelancaster
438,343,540 *2C69CBB91958647DE1E5792007C4CD78DF03CCF7 WAYNE.BRASKET
438,343,541 *2C6ACFE0696C050782797D971B83B9C5420404D1 [email protected]
438,343,542 *2C6AB545E153BEF2DCFB9783F8D1933AA7DD6603 WELTERÓW
438,343,543 *2C620CB77485D3D990A903CFBC186F81BBBFB000 wendyevansbrinson
438,343,544 *2C64ADA4B27739807010D8738C77B92343B0EFC7 WENDYJACOBI
438,343,545 *2C6B48BD26CB48893ABB23456963298FEF4AF650 WILLARD.LUDWICK
438,343,546 *2C66841C9EBB257E02C0E5DE7C869F4E634D317D WILLIAM ORIBELLO
438,343,547 *2C6F6E979AD21EEBE24B8DAA326D82319EA3E906 WINNIE EMEFA KUFE
438,343,548 *2C65795703C61967EC55711436712F6A98CDA984 WINSTONDANYI
438,343,549 *2C6FC174D6F26958A25CEF6E446A1D7EE621290B WOODBECK6
438,343,550 *2C6EE47CBC4202F5044F8C6202ADB38FA2CF9288 WYATTHARWARD
438,343,551 *2C686471E58E2FC9FE1A28A35E335CA0D38D7C02 )x(**@8
438,343,552 *2C640ED5737FA3F6972683D30DA63EDD74C8D305 XBM+
438,343,553 *2C6F4EEC99084B1109BC16B79420EA9B313BE15C [email protected],[email protected]
438,343,554 *2C6DF4C4655DC7C3C85E5CFF4D1E4D34EEAB81B8 [email protected]
438,343,555 *2C637F8B5D681D34FA8D60F94F08BFFAF9547155 ybavwqe7
438,343,556 *2C69F67DAE34ECB6E1237C7F9FF8687D2CE394A2 yen.nhi.ho.pham
438,343,557 *2C645365272A86E398507516868B825C3E5C5DD8 yip-nga-lam
438,343,558 *2C653A6A3689D2F5F59BB10C89178FB00FD85812 YO,-DE-MANNEN,-YO
438,343,559 *2C6A6D3B28C5FD6BAC94809F2F8CEECAFF11897B yoga.ginting
438,343,560 *2C6C3E79B9032D5FE0CEE59070D9E927B6386587 YONNNURULFARHANI
438,343,561 *2C68D70CAA93EDDE1CC7AA0AD3263E9CDB4AF21B YOSHI BOTETHI
438,343,562 *2C628D13CACD122C5FE1C1A2458C8B97E9BAAE7E [email protected]
438,343,563 *2C65D492EFF5DB450E312C95C05EF5532DD1D65F [email protected]
438,343,564 *2C6A39E2610E27CB44C991A5A68D9E35BE250421 yugioh!!
438,343,565 *2C610C8ECABBDACC7B31E1C03C040C945BDBBB57 [email protected]
438,343,566 *2C6C747EE14F56D41D76CB180E9780F0DBF6FC32 ZISCHST5
438,343,567 *2C6491BAFB6201CDE47F4CF2B786D180263B0DB9 ГЛУХІВЦІКАОЛІН
438,343,568 *2C6FD06DB0190AF0B1C65649C7776B23CA52CD96 КЛИНТАМРОВЫЕ
438,343,569 *2C6468599E17919E3F263E73C662B3E2617DBC31 ПРИДОМОВЫЙ
438,343,570 *2C682EF45935029225CC9C3C0465194CD626110E ПРОТРАВЛИВАНИЕ
438,343,571 *2C61F3FB15ABE185B09838B48EB35255A02A192E 100-prozent-bettong!
438,343,572 *2C62EC01BC01D84320712BF1973D7FBB9FD68CC8 [email protected]
438,343,573 *2C669190F5CD367ECB6538B1CDD8534E75CA45A5 @[email protected]
438,343,574 *2C678462B823F96E08FB7217555839D78777E0F4 12021933
438,343,575 *2C65746985267CF7652DCE582C0C17F5C45B625A 1545944 turun.sanomat.26.2...2000.:.2..
438,343,576 *2C6D15E586BD5867CA9BDD5E630E9A0063DB6AF4 16-muokattuna
438,343,577 *2C6180A048E069EB11E60E4166B5D59CF197689C 1760402 AM-MONTAG-STELLT-ER-SICH-IN-LEIPZIG-DER-PRESSE-VOR-
438,343,578 *2C68928BABEF8572DA748E93BD25D188CEFEFCB6 1829815 kokonaisrakennusoikeus.,.mik
438,343,579 *2C6E39B042E68975B7CB7B5ADAB36B34333D4C90 1836487 kuusamossa-oli-tilaa-kohden-vuosisadan-alussa-keskim
438,343,580 *2C678E8C2D3BCCDEF705E6BF086E95B1C1E03584 19JUN1122
438,343,581 *2C6ECA7BF9B7200C751EE7BB1D03ECFC3A328D3C 1.atier
438,343,582 *2C629062AA3EB294D614683649DF2860A300ECD6 1AUSDRUCKSGENAUIGKEIT
438,343,583 *2C6876E4A73120C911AB4ADA23AC763AF8D56427 1.CORDE'S
438,343,584 *2C66067A76C67926A16D4AD170275B34E874491B 1.degeurin's
438,343,585 *2C6367B9A412CC639C6227D39A0736DF7BA02438 1 distressedfinished
438,343,586 *2C628DF8A138C7A8DDF383186B861CAF5E8478D4 1.ETKILESMELERINI
438,343,587 *2C6574A8E55A05C946EA4734B26060E5E65552AD 1hein
438,343,588 *2C65C9751C6FDDD06BC9B3C4D0526D49D8407C9E 1KAPUSTA
438,343,589 *2C6A1A4F23EBA211BFA1D76193B2CA9CEF57394F 1.LEVANTO-ORIMATTILA
438,343,590 *2C6F332029BA7E9BEFB61EBDC2B843D5A9F3D447 1LISAMARLEN
438,343,591 *2C65095C59BCB8A987BA6F9F7FE4BDC4CF5E89C8 1MUSIIKINKUSTANTAJIIN
438,343,592 *2C6F220F23C18E0739E39C30750C3D9DEFD71955 1NAHSHU
438,343,593 *2C6EE942BA3E4D906CC5E14D02942AC25697C633 1-note-honesty
438,343,594 *2C6AF7175E8314FF830AE977AA8FA970DA62C6E4 1-poliklinikkak
438,343,595 *2C6E7A17F591D744CE64A135619640F61F53E858 1 SELBSTKOMPOSTIERER
438,343,596 *2C6ED53FD71AD4F5D560448B6C81281805AD069E 1-slangiin
438,343,597 *2C6CD3F3852EEFC9B1CB6B6DD9D7EE19BDFF0E7A 1.SPORTINI
438,343,598 *2C6E31D206A92FE3822CD35F4AD97BEE45A6B6A0 1 VANUKEHIRVENJUUREN
438,343,599 *2C6D8B6AF3928E37C8284643E5C8C57D4069D464 1WARIKOM
438,343,600 *2C625D0584C4F23C720199E6879781FD7CB5E2A0 215618 bu soylemi genellemek istemiyorum
438,343,601 *2C6B985EFA38C8B1842222B423C1D75883F35A8F 2391932 DAS-IST-NICHT-UNMOEGLICH-,-ABER-SCHWIERIG-
438,343,602 *2C636F5402A37135E537E5D0DB1620EEE86FECC6 24241012ds
438,343,603 *2C6C9142888E90239C4D187D09F109228FF25C14 2595696 die.polizei.verhoerte.am.wochenende.terrorverdaechtige..
438,343,604 *2C6B0FE38E3E9C101C0C86881E24D473E9D0776E 2697236 WELCHE.BOTSCHAFT.HAETTEN.SIE.MITGEBRACHT.?
438,343,605 *2C6E3141441D8BB115710A1AF9E6780E9E3B775E 2739092 " DAS WAR EIN TOLLER FILM .
438,343,606 *2C60F238A0536CA58E5025C44880739439369EFB 28064 KETJUIHIN KUULUMATTOMANA VOIMME ITSE M
438,343,607 *2C6668280CCEBFD3C8409DCCBF20B0AD0DBDCFB7 2933931 AKAVALLAONKASVUPOTENTIAALIA,JAJ
438,343,608 *2C6621A45F26A2CA72B39DEF4732EF6C8C478892 2-auto-anreise
438,343,609 *2C6FB08206F668DDAD64FC4129A011E23E00942A 2.DILLENDIRMEK
438,343,610 *2C627FCA4777D0549B67EE1FCCF627F845B99CE0 2.ein-liter
438,343,611 *2C6537A6CB9F9B969CA4EC04804E86DC6592953A 2.magentrimmend
438,343,612 *2C6F4C6B41BD3DF107EC954575E6479F29A462A6 2.umsatzgebundenen
438,343,613 *2C68CACE402B7F37DD55F0BC160B107784B36386 3AATRESUM
438,343,614 *2C6EE339DAF38D238BC1A4F70263C3C2A83CF2AA 3-ALEMANNIA-FANS
438,343,615 *2C61249625CFE4D031200BEC226D769CA20FCF8F 3heijastamaan
438,343,616 *2C602DC434602907686A3EF8D0E7FE0905B0F7CC 3ILUVBAILEY9
438,343,617 *2C6B3960D7E28C5EF78BBA0621EB8B017D1E76FD 3smsozcic73x
438,343,618 *2C6E8B8EEE69FA14809372270463EA72EAD6ED4D エンジンは、43KW(58
438,343,619 *2C60F89E7E2EAA0D91AFE1CFC3487E6154732988 [email protected]
438,343,620 *2C6DE4D7172BCB6AD30EC32CF049AF243A2FE40C 4 FATURASINDA
438,343,621 *2C6EE30146C6A121F784889F100AEA9F90EA8F96 4ISPSUJE
438,343,622 *2C6635F2D9205F360E0254199F5CCE8684769FFF 4KERROSTALOLHI
438,343,623 *2C6DAD6C1A791A2EFBA1ADA5A171424EA8EDA2B5 4MARCH2005
438,343,624 *2C68BC85CC7C57FDC0D9DAC1DCCC4ECC113ACFC7 4PROGRAMLISTAN
438,343,625 *2C6F24DAB184A910E3BAE299F005A95340C04DDF 4.UNUTMUSTUR
438,343,626 *2C62B8FC2983498E5F55F4359F0CA06FCF3B029F 4-viisiosaista
438,343,627 *2C6C33E467790263320DE2D3640BC83502ABBA41 4VITIBMAL
438,343,628 *2C6896B7310F7ED3F3948B10BB01CC18873D6BE9 553632 pirtaavastap
438,343,629 *2C641294B09E89A3DBD022363F83FE9884E557E7 5ACETYLLACTOSAMINE
438,343,630 *2C69E08D3E1DE3A1714E96480A3130E05C408C91 5ATHNETWARE
438,343,631 *2C6ACFAEA9F2BD8033D29F1723103CF15EAFD244 5CC7B9A1-6579-4139-A548-FDC8E91AD77F
438,343,632 *2C60AE913E39412E8D997BB28307301C885FDC64 5EGILEBBOB
438,343,633 *2C632145D54C6019D66178F2D291E19418A35619 5IWELDDIM
438,343,634 *2C6004239B5412B2C5D19AFD82CC9316B281464B 5KAGENOBU
438,343,635 *2C665733562184FC7C3BA281575F43FE28914A48 5LERAIENTS
438,343,636 *2C6AB3EB8CEAD2C60A6E0EA9DD3219A931160404 5MAZOLYSI
438,343,637 *2C62065388CF7284553B2C06D2DC586D149ED067 5NETKAAMEGDNEKEB
438,343,638 *2C643C57700DE7952BBB1CF81C2D0E72302FEDB3 5PULYALL
438,343,639 *2C678777E9B03CFFDA5D55F7A9173B176ED8D1B3 5SEVERIDE
438,343,640 *2C6820567AF2FA81F01A0429FE619081310DDB13 5STEVENGUNNER
438,343,641 *2C6412C2960AD44B8470D6B5A49A12D9B37955C5 61-ERZIEHERISCHE
438,343,642 *2C6AD62AA51DB0DF39A4E5D2150A939626623DA7 6CLODKNOCKERS
438,343,643 *2C6BC7592AD800050B51BEBF8315FDFB4A677C09 6NETIHPMA
438,343,644 *2C6608E085FAD9D3BDB71D92A3860969E2F421EF 6-piikkien
438,343,645 *2C60BAC091EF4B3D27C9EA2E90C73899FF7AB96A 6RHUBARBBED
438,343,646 *2C6FB0E062FDFD9A361F755B342B30D7815AEAD3 6spoorbruggen
438,343,647 *2C67EC03D985ED66A3D0611343CB80123D1C786D 7BSWCHARDIGNYBSW
438,343,648 *2C6DF96C25E605A8685243AEFBC34850ECFFED5F 7CELINELAURA
438,343,649 *2C6E6F69C4D78D7AC7260F3AC69A464AB60C8F17 7CORWINVICTOR
438,343,650 *2C620D3FEB7D75AB8ED6A23DCF3B712E0BAB1EBA 7:..$CURRLINE.=.1;
438,343,651 *2C6C6C3F10B215CA61DDF8E503B037B5ADCE42C5 7EXTRAPHYSIOLOGICALS
438,343,652 *2C6CC9ABC0E63E0A605F2520B583E6CE1BAD45C9 7-KERZENHALTER
438,343,653 *2C6E5B1692DA75559B380BBE1E8F884E08E97C62 7KOAGULERIONS
438,343,654 *2C695A7923A7F13A1731B79766299E54FC9C1F99 7m5nw7
438,343,655 *2C6AA4B36C9C2E8F1BEE251DA6DFD44C7D4107DB 7MANNERHEIMIN
438,343,656 *2C63BED83684638E1002D5E4CDE1F2269E057D01 7NOITASILANAC
438,343,657 *2C6F60D8D8B99AA91D179532EB5294AE64818F59 7PODNOSIOCI
438,343,658 *2C66547B68D7FA1FD77CA2027D24F27DE6D7257F 7sofistisch
438,343,659 *2C6004D9DFADDA4A5B152B26543C3E6FA596B334 805722 GELECEGIMIZ ALMAN OLACAK .
438,343,660 *2C6CEFD76428BD79A8CB2E15EEC5E2E3C92EE761 866KENZIE
438,343,661 *2C65E97C3528413B6C7D3D9B929E115625C16071 8COURSIN
438,343,662 *2C6BEEAE552ABC0F10BFB524DFF501B383F0E1CA 8E56B1808E615100D0E3780CBEEFCEA8RCCNOVI
438,343,663 *2C617D857A9A473B088BE699A8935A15BFD70EF7 8ESTENORDESTES
438,343,664 *2C685EB8F1239940EFA2ED814640B2B3AFC8D2F0 8.L
438,343,665 *2C67C53BAEB0B35EF0D921FEE48A07C7F5D2664A 8TRADEWELLS
438,343,666 *2C69B70CD5A22CED853F6B3C808B109EFCC7C4A7 949keith
438,343,667 *2C63D0E2E5CF96770F3A086F7B93BC6E42AE43F2 985jaxon
438,343,668 *2C6151B7F5EE779393BAA9A3CCDC49C86D9FEE24 9BSWGRAPHONCASYYE
438,343,669 *2C6C040C32B94FCF17BB545E559CD8D4400854CE 9ROCKETBERTHA
438,343,670 *2C63C9877312B2756B892E988CF9C8EF9B7EB648 9SMILEKING
438,343,671 *2C6E2FA1F35F81A506ACA9828840095DF140397E 9TAVELEVL
438,343,672 *2C698EBD6007703EB05E7EE291C7CA8372A071B6 9THEEYANI
438,343,673 *2C66DCD5725ACEA87B2E39A29FDCC13D26FC1681 [email protected]
438,343,674 *2C60EE50A7FE7D5AD4156103D991F4DDA30DE38F A1rh
438,343,675 *2C631C824FEA262F001DAF70B1BB9755C93183BC ABSVG
438,343,676 *2C68C08368BB43F17965CC9CC6E0308268DD0CB6 [email protected]
438,343,677 *2C64753EDBC2B2548F32DB389ED5284946DD822C ADNARAHKING
438,343,678 *2C6B478A5C1A3FDEADCF11E850DCCA698C814173 aebua
438,343,679 *2C6D0A5520E6A677AC6F478AD704997EC4BBC46F a+hgu
438,343,680 *2C63E3E855E8CFFA6101550D742CA8D2E21CA5B6 ajfml
438,343,681 *2C620E2072EA5525F64FB2A7EE8ACD926584698D ALDO.HARN
438,343,682 *2C6840EDD1A354C0BD45557680524B6C9349AA6E alejandrofissel
438,343,683 *2C6AF7066FDD6F04D6DDE91B50A872FB40756E43 ALEXJUBERT
438,343,684 *2C619E5BBD6DCEADD988174AF3AB7A9ECC04289A ALICEHIRATACKLESGIANTCUPCAKE
438,343,685 *2C66F683145597DD7149DAE687DE9F8295B91A7B ALKERTONS
438,343,686 *2C6803956CA66A9BDEEFAF2C619A43B1750933D5 ALMENDRAENOBRASIYII
438,343,687 *2C6DE979B787FB40A3E405ED3F40E3989AD97448 AMFHZ
438,343,688 *2C618A4E96D562B68002C9B01D46A008A3647229 angelcollicott
438,343,689 *2C6DFF3538AE47F68A9495BEB272C8D6F30F83B2 ANITA-OCRAN
438,343,690 *2C667D3433DCDC0CD366FC7FEBA4993C5D5C4D10 anj_
438,343,691 *2C65C9457D3652E73836515D0B764CAEAB149341 ANTRAGSSTÄRKSTEN
438,343,692 *2C641036740DCB47AD6CF5E99CA6CA311A2FBD48 ANY.PERSON.WITH.AN.INTENT.TO.AROUSE.OR.GRATIFY.THE.SEXUAL
438,343,693 *2C6AEC9D6EBB1A79B6266F1EA8C35391B7FEBF14 aokv
438,343,694 *2C6A195F8493FCD059E22EAB229A3CB9B31E8A42 approbationjohn
438,343,695 *2C6CF0043F8B21984917D090E0C05E7E3E8D3C73 [email protected]
438,343,696 *2C62854E21F04F8892335C7296946A615FA79A7E APSKD
438,343,697 *2C6E608FE937FF57BE66A1F04BA727AFC812965C arbeitsfanatikers
438,343,698 *2C6C09797F909CF48B971A2BA670AF0E089DABBB assogaiting
438,343,699 *2C66E9CF48E07E8D8F670B029E9207ECCADA98C0 AT3H5
438,343,700 *2C6286584A7FFFBCFB4704B4197B9FCF0339928A Atb3
438,343,701 *2C60133026E64ECDBDCBF06732E15566DA682C6F [email protected]
438,343,702 *2C6C12D728066395CAC18EC2510F3BACB8C9E29B Atto.II.-.Part.1.Signore,v'assista.il.cielo!
438,343,703 *2C6D414384EAF40B5571F417BF6911543CDF131E AUFDENMONDSCHI
438,343,704 *2C607CF1BEA59E16C435CA6975EB9F1F2902662E awi9=
438,343,705 *2C6A517D33938E904D545B684AAD88A47FA80793 !BECKMAN
438,343,706 *2C6B6CC0AEA201918AFC6D869645B8492D056447 beethovenw
438,343,707 *2C61A0FE86D5EB72A45CDC241310DD0876EC577E BENEDICTDESOTO
438,343,708 *2C628DD4A24BF8FE0DBA00076DBF19248D08ADAA BENNETTKOKOCINSKI
438,343,709 *2C609A853356FCB906A8BC8377BF0F36802ECFD2 BENNY.BEETZ
438,343,710 *2C6FE2DAE9C5C3A48FDF6853EF91A8E2651AA670 bennyreppell
438,343,711 *2C61CECDE1FBBB07FE6E86C5F66F0BE9EEF8D8AF berreaved!
438,343,712 *2C67C8D691FC7C821595A5C6D48B96AC10435850 BETAKEN
438,343,713 *2C6C5C180AF8EC301B78367D3FC378E84C72FF22 b"fj/
438,343,714 *2C61F5BDDE99F65A350DCA1BB16132920E04D8A2 BIRDS.OF.PARADISE
438,343,715 *2C68BB02EAA39793DAF4A26E51D8DF4CD6C26939 B=).~.~.~.O><
438,343,716 *2C61C3E665A083887F2A30DB892F9EF06F78BA11 [email protected]
438,343,717 *2C6D7D38E238E01F97D414C857AA64CC55483942 BOLE%
438,343,718 *2C6E4C27CD0D4B75919D6160C933354917DD937F BOSIBOUNMA
438,343,719 *2C64B3D096023BC8F3F237383B1E85D6665D027A BOSOM'S
438,343,720 *2C624FBBB8496A2C85DC4DAD557699BA291EBD7A BPDBT
438,343,721 *2C6E801EEA6D8B73A631A806006DC0990009A7A0 [email protected]
438,343,722 *2C6776ABC8FD25DF8788E455F5F6172982541C7C b######p-~-`splat
438,343,723 *2C6D78E736AE848E07298BE0B621E427051D472F BRANDONSPONAUGLE
438,343,724 *2C698310D821D421A4AB61705D56CD7AF13A805C brittcaro
438,343,725 *2C6FA4CC3B250CA72C840EBB0CB613CB23F1A744 brookssicilian
438,343,726 *2C6B65AE29B7E01AFACF810703F2007BD9C5FF81 brookswerking
438,343,727 *2C660D4B9FAA01B67E00AE36B9F01179583C7E46 bs.,"
438,343,728 *2C60D2E4CCBD4C3D9ED03779A980F71DF1D7EDF8 BYSTREETS0
438,343,729 *2C6F19350B7947D06C777566F52B0C16AA2515FD C4WSN
438,343,730 *2C6A5481A9752E9BB00E393D5E0CDC343D4D3BEC c+aio
438,343,731 *2C6708CD72C8BEC162ED5E60A88CDD4BAF3B2A1C ca`m
438,343,732 *2C67BEE00F8707881094B35DE4DF27822C4352C3 CAROLECOLLINSON
438,343,733 *2C68A622F950E89E48852FF3F506CBCA326A01BB CARTERBRANT
438,343,734 *2C68B81BA4CD6310253FABEC8873702B7D3AC24C caryworm
438,343,735 *2C657179C4C40A6CC43816B12DDB5C0F33AF09DB Ca(X
438,343,736 *2C6AA1A6376B66DE9DD8FCAA945AC6EAF99B2638 CBFN
438,343,737 *2C6EE99E4A220F162E1DF707C028F022F770A60E cckrbba4
438,343,738 *2C6F662BA713BA325481381CB24E76FC4B6D7F2A C&Du
438,343,739 *2C6A98C6DF185949C779CFF085040C02C38E3076 CF4
438,343,740 *2C6B86502179D0BCD12425C1E1C98A8F8C175B99 CHANTELL.ROBERTSON
438,343,741 *2C6944C8D0377CD696EA72C84B691BCE2650317E charmesia
438,343,742 *2C656628DCCAF65DF35F850930FF9BD5443DBE65 [email protected]
438,343,743 *2C6BE5D1C81148481A69A97E20E86C6B4C70E56E [email protected]
438,343,744 *2C6A9F074AB067F8701A3F20E077A283F94C1712 CHMANDY
438,343,745 *2C68B1F490D5960FD514AFA3E9A4306C79837BC6 cior%
438,343,746 *2C6AC8BB558F8BE1B1C06EC034D4585F44BD32D8 CKPIZ
438,343,747 *2C6394A3C9D248534B5CA79E8DE3BD6A4993161D CLASS="NARROWVALUE">&NBSP(1199)</SPAN></A></DIV
438,343,748 *2C6F775BB166B5776F8A148B76DA2F8660010B22 clifton-sanborn
438,343,749 *2C6D6FF229A6E4A4EB5149602D86E497D55ABAD3 cmu#
438,343,750 *2C61BF03436BDE2F3679539F5CE8E9176DEF55B4 COLTONPRINDLE
438,343,751 *2C66B8C5C60AE508631BFB099D4144211CF8AC1A coltonwolke
438,343,752 *2C6843894C64839AA14BB8895EEFE17658BCC19F COMAPANYING
438,343,753 *2C6AEA2F9376BCC51A82CEAE4A5C51ED1CF687D7 COMPUTEZHONGGUO
438,343,754 *2C65CC9D15A11379399B269E42D147AF7216D327 CONTINUESDOUG
438,343,755 *2C6271C9924D166A866C827280BA9A031525F792 co)p.
438,343,756 *2C64566A92CE36252C86C67468974D00E732A96C cpjqd
438,343,757 *2C64F9B984C5D32669DD86524C22BAA25CB36597 CUMR
438,343,758 *2C60D613B583147A96D18BE103B83AAF6B96D724 cylinered
438,343,759 *2C643A6EC99D1A9929E8B1ED79D295D935AFC9EC d;#3v
438,343,760 *2C631F01C90385BF9018F1B5C207E7EB5DD078D0 danilooilvares
438,343,761 *2C636634F4E7F690B69F6109C25F285F0AB444EB dansalts
438,343,762 *2C6218643A7A35A2AAE29573CA9899B6BF88CE2E darronbeilman
438,343,763 *2C6B58FFB2479A2A9526EC107EEC85C5960B0182 DAVID SWAIN
438,343,764 *2C69C76C66FEC4851750AF9D7554B0768440A74D DEAFENED
438,343,765 *2C682A67510F0D80C44A151DF533E9EC20D52BEA DECALCOMAN!AS
438,343,766 *2C6B3E35D40E1D83774D5CECDB4FA2053D2976AA DEMARCUS.GULBRAA
438,343,767 *2C64E2EE9CFC0A929D5E21460D62D245F660B607 DEMARCUS.TAILLON
438,343,768 *2C6ABB3F0528F67B96F901A2ECB6F2BD29A32871 [email protected]
438,343,769 *2C60FDDD012E609C3D7E741611FCF8936127937A DEPSMERB3
438,343,770 *2C64B15EAB430C4AC658CD731BA0E02DD8E448BF DERICKPOKORA
438,343,771 *2C6C7B4660619D450FED1530C57B0D6F8A6E7F9D DESVOLVESKAR
438,343,772 *2C64C70D45A556DA321FFFB4C7F20542177B3B73 DEVILONTHELEFT
438,343,773 *2C668F342437B295BF3AF8E37ADD2FE9801C39DA DF&V.
438,343,774 *2C6B09861BCACEAF5E8B71B2C5ABCBB52DE4525F dir=e
438,343,775 *2C62CB31592E41D26BA93AA466F58CE3BB18D041 donndiel
438,343,776 *2C63F8C06D6D6697A1E1C4D5FAC235AC62423D98 DONNMALAGARIE
438,343,777 *2C602CB7C831816A476CFD2866D9ED3A6ACF538E DP=N
438,343,778 *2C6D13A9D9821328B6DAA984BCEE27406E450EF1 DXNM
438,343,779 *2C64A8519A2490A8F02FC08F9FACFD7D6770C02A EBI&T
438,343,780 *2C65B8ED4C305097B8B27FF7E7D71337981F86C3 EDDIE.FRARY
438,343,781 *2C6BF856045F64A733AD03669944D0FF1D3EBD82 EDINBURGH-NORTHAMPTON-TRAKTATEN
438,343,782 *2C6E57883EB3DB791260C6DC2AFCD3C42D7C8F27 [email protected]
438,343,783 *2C69F3325EAC0E69202D4C1B8C8729832D5CCA2E eh!n.
438,343,784 *2C66A92B89F1FEAA883C39FCEB613D7B9D2C686E EIMATHLAND
438,343,785 *2C676FCE161368BCACCA60FD6E6090F222341CEB EINMALIGE?
438,343,786 *2C6000D36B94C5C2A1AB9FE1325ED9DDB0C08042 EIO8:
438,343,787 *2C6C6B8BBBF25E5C6ED247A510755EB245AEDC3D [email protected]
438,343,788 *2C659E7FB9C11AC07A7B4BAE441962FBF51EE9D8 elliottindovina
438,343,789 *2C612B08F8E6641F7642971689514E10CEEB01E4 ELLSWORTHDAGGY
438,343,790 *2C6A570812B0E951EAB34A3B94C40C7C9C634AC9 Elvis-Went-Blind
438,343,791 *2C67DEF99F0BBF12888D2010E33E8DEACA0F2DFC [email protected]@+i0n5
438,343,792 *2C64A925278C9550BDD1B521F299FAE98E97B0F9 EMILIOHENNINGSEN
438,343,793 *2C69731EBE24CF061A6D34D7F9A16734B5D90854 EMMITTPIRIEDA
438,343,794 *2C6B068D30C336334060746752E584B0CD7666BB en14115818598
438,343,795 *2C63BC65A35D08FCAD2066D1717DFD087BFECE2B ENKI90
438,343,796 *2C6961AF7B7F021A137A845B7F9270BCE7286587 enqueued
438,343,797 *2C6E9D87D42C3311503E9EB50529BC886CB6E80F ep,e0
438,343,798 *2C669A9DB779F2EA19E26D446499B573748CA71C ERIN.ANABLE
438,343,799 *2C6CD07FBD9BD2BA8CDEA2BF5FB6617763024FC1 [email protected]
438,343,800 *2C6636E510061DCD354D9E66660B8461189253D8 ETALOGERS
438,343,801 *2C66DA41087C45D6B0B9FA30DAB17735DBE4BFF3 ETSTI
438,343,802 *2C616AB07CE3BD488F381654E8FBF7DEE51F1260 EVERYTHING YOU WANT FOR CHRISTMAS
438,343,803 *2C6DB8BBE43F908A8F3C07FE58B57DE2FD7DC97B FARHAD RAHBARI
438,343,804 *2C603094C2222530E80A9FEFDED0EC7A8DB0F87B fartfartl
438,343,805 *2C61647DBB7B4BE8EFF8F8634E498B40367778BF FELTON.LESNESKI
438,343,806 *2C6456432C57D29D34E389402A7B31C1337B9573 FERDINAND.EDMONS
438,343,807 *2C6D38A59C6F28297BDA3DEB6EA1946522A65F3A FERNANDA-BRANQUINHO
438,343,808 *2C63AF620115875B1B10A1335B47EF0384E775BD fetours4
438,343,809 *2C61D7EE52AC4AB36DA8A70B6727BAED9481AF08 FLASHMAC3
438,343,810 *2C62BAFD021280A09C6E686BB613020807D43179 [email protected]
438,343,811 *2C6105CE6B984158F3F483243C6AA940BEAFE3E0 forrestcoyner
438,343,812 *2C66250E9006C7A74EF360F65CD7C7AB7721D319 fragmentising
438,343,813 *2C668E99EC4CE1D1AE5561555CFEA1D45CFB428E FREDCOURIER
438,343,814 *2C6CF05ED1194FD24EAC31EE0FDB17867ADD6F40 frikacozawww
438,343,815 *2C62017627F31EE409E5C26B66177925209083A4 [email protected]
438,343,816 *2C6E70144432ABFC98DBD0348228934E6A12044F FUNNELLED4
438,343,817 *2C6C1BB530343F4444F88491EB039E23F3E7A305 gabrieltrapp
438,343,818 *2C693EA20A376B13D861C48E28215982429F8993 G-AF
438,343,819 *2C65146BD2C773D0DE3D108F3A41616723E3B3F4 game.show,.game.show
438,343,820 *2C668937E0E9DB8F8E40B20C570FA670B56A0853 garyednilao
438,343,821 *2C6F6266B41524DDA9FE7B7591420029DAD38017 [email protected]
438,343,822 *2C62AD9AD7BE8A85C603982666891CABD3023EA7 GEBOGENEN!
438,343,823 *2C6C84715077E4C3BCBFA52999A590223A7C1326 getit?
438,343,824 *2C63F14486AFDB761E0A146FB347F2D5898A6964 GILBERTO.LIMING
438,343,825 *2C6C28CE491FE856C1A647FF3708F9DD227CB701 gipskcil4
438,343,826 *2C69D6E4BAF97D651B51376CC0F8902FE99E451C GIUSEPPE.GAMBERG
438,343,827 *2C6F229A61807CD5E065E9824344AA461B9BFDAD GLASHIER
438,343,828 *2C69CB83ADCE489997DAD6CE8220FCC328AB088F glueisenoughtodoanaveragevendingmachine'sinventory
438,343,829 *2C641FC7AC5795B432EB788F4E70717160B6A53F GNIKNIS5
438,343,830 *2C6B1C73192CDC12D9035F54CCA62677C5DF3067 GODSEKSPEDITIONERS
438,343,831 *2C667DC51E51393CA9606FA3EEA3DB41127BB5F4 grage6
438,343,832 *2C6988DD157930C516EEF2186DC3D4DAFFBC1F5A gravitydrawn
438,343,833 *2C66EEEDE7F6BEE7696CEB66D8C25A5F6E0EFA8D GROSSRHEIDE
438,343,834 *2C6B39B74A6D4F596AE77C187D7BE4725781F470 GSANIZ
438,343,835 *2C6C3E47C03C980C9F0D853DEF816643063B1DB3 GTSLMPI92
438,343,836 *2C69EA287A5BC3EDF8CD4C62D8158D0D9F8550CF guntkowiczach
438,343,837 *2C695BFF746603BB69E2EB378A3FA5F774A33C61 HAILEY.RUIZ
438,343,838 *2C66568F62D5E089C4AAC543AFD2EB4E7FB54C8C handsallover
438,343,839 *2C6D8F8201FBF9534533EDB53221EAB4F6BC7C4F hastc
438,343,840 *2C6B1DADDC06549AED4F28E4CD42F33A7AC70730 [email protected]
438,343,841 *2C6C940470D67806B0DC5A78791832C601594338 [email protected]
438,343,842 *2C6985A6080EF5CD66C4202EAFCF6A0ABB8DCB86 helsekosts
438,343,843 *2C6324207096EBED68CEA07E939FCD6E331C0751 HEMETLYNNT
438,343,844 *2C6DE2D1C2B43D82D6447945096740BF05A2F536 hemispheric-a:
438,343,845 *2C6EDEBA428A6FF96AACFCEBE5DF463206D86301 here's-to-you-baby
438,343,846 *2C6246987183994C444C2CF8E724DA84A4C98516 hichamjellab
438,343,847 *2C6FB8F1FE6FFCA73315A8FD852B0778D66D502D [email protected]
438,343,848 *2C6E2F8289F4FDB10868119FC46F2B2AD14CA6FB HOLLIS.REVALEE
438,343,849 *2C6B4529B4738030E3B2240970788C5E07869350 hongslaybaugh
438,343,850 *2C62429D449EE49227BF32C1B86BCC571B7301B5 [email protected]
438,343,851 *2C6E3044DA509218237A59FE6B8382E432E782C8 HOTFORIT5
438,343,852 *2C60055D7434DD2EFB91E318A16F9FD8DF70C53F hotspurs
438,343,853 *2C66C4CBC7A3B3DED16AD8CBAA3B20CBB0C3D025 [email protected]
438,343,854 *2C691F338E9F475FB3E0C8CAA52908BB5DC6280B HOWARDVENZKE
438,343,855 *2C6F5FD09F2CC64944D523067E0939F8C2276CB0 HR01833
438,343,856 *2C63996285135D67880D77D73B91BE6865E4BD66 [email protected]
438,343,857 *2C603C3C978186FD3A7DFAD31CDCE01011109317 IA}G
438,343,858 *2C61B7040F078D5D5EF5A6DF94051F7023EA25D5 i.don't.care.if.you.like.me
438,343,859 *2C6217DA4BD5FFACE166D7AB5DF15656F7FAD4E4 ifthat'sokwithyou(motoblancoradioedit)
438,343,860 *2C6F2490FC3BCE2FECBDDE6381ECE46BB81067FC ILUVABIGAIL33
438,343,861 *2C60D5687002006C3CAA566DD51DB296A2D84228 ITALY
438,343,862 *2C6DE27E1C5677A8DF4EA8D9FF13EBCE05442921 IVUVALC8
438,343,863 *2C654CDFC5293B77F3958BB0249908ED47420A7F JABED-HOSEN
438,343,864 *2C67518E8FFF48DBF8BE97F6284307F022D16CA2 jackiereando
438,343,865 *2C6D4CCF5DA37954CA49E03B1145F8F8B917184B jacqrox
438,343,866 *2C62FA756F94F31C0CFE5592AE072F9CBA52B457 jamespyun
438,343,867 *2C6411492E0A5D821A1A370EC130A4637F08E9C8 jantes
438,343,868 *2C6F22082F7F447922AE45DC04B32625F33A31B3 JAROD.MEISENBURG
438,343,869 *2C62B5784AC42BA61CE4E0EED1772895FB36B7C7 JARRETTCREASER
438,343,870 *2C61155579693DA19C3EAC5F72DDB76FEB646466 jasperlauter
438,343,871 *2C65A3BC195F7D81FB69517125F03670839EC393 javieraustell
438,343,872 *2C65AA2346B5DF39A0D6745497864938E83DAB86 JAVIER_FLORES
438,343,873 *2C6530602426BEDD95C43AEB4B99C60218A06C81 JAYSON.WENTZ
438,343,874 *2C688AEF20D82CC247A7827D0A259E710B39BB6B j:^c
438,343,875 *2C6B8B17431487AA787CEA26EB4D831A72D8396D JEFFREY-STEININGER
438,343,876 *2C6C5C8AB8AE8B438D2458884BA8A405FD2F4B9E JEN-BEAR
438,343,877 *2C69152F42C66B4CB52EBDD781A49A44F6125D32 JESSELAINE
438,343,878 *2C6467A17C0A2A6007E01D929F4C2B16DE0F9F9A [email protected]
438,343,879 *2C689F346EB66ED78062E431B46012E6F42826B3 [email protected]
438,343,880 *2C6B754F6D333752A3A648B4DC909EE55E61964D JMELAD
438,343,881 *2C635BFB97EE322E496C3E86F4C6EBCC505C1B71 JNJ-Project-&-Mista-Cheeks
438,343,882 *2C69AF1F0834FEE4525878FB644E8AA2BB00C770 JOEBRACERO
438,343,883 *2C65EC673F5C85F68F6E6CE5189A6C8A9704AA0E johnathonbelshaw
438,343,884 *2C626B9FAE41F8BE00224C40AF1DD1C4FBE35422 JOHNSONFRUMAN
438,343,885 *2C6C38F9930F49F141E74ADE78BF5B5620F94DB2 JONATHAN.FREEMAN-ATTWOOD
438,343,886 *2C6E9956B0FC9AC34B8F9C8687A82E9026B1A537 jorgefritchley
438,343,887 *2C64A7CBFC8462329416954FA71866DA1677B4B1 [email protected]
438,343,888 *2C6818C52026C61E127B3E46D8B75ABCB508A1C9 (JUSTANOTHER)JUSTANOTHERCLICHE
438,343,889 *2C641F59235262336A5B5E33ADFB6538FFB2AC0B JZX9AQZZ0
438,343,890 *2C6BDB24BDB1C8E6190B1A5FC4F66AB6456EA1F3 [email protected]
438,343,891 *2C6BCA5CFA1E8CB78188DE1EB58CE845E31D95A2 KAREN WIMBERLY
438,343,892 *2C6C597904503C5B3306587A5AAC83EE31298B0C KAT BOB
438,343,893 *2C607F6DE9B03CD1C8773BBEBF4736E668A85007 KATHY.ASHE
438,343,894 *2C68EFCE62C9F14A206CF231351F5C39A2A112D2 KBSは、大阪地方裁判所に
438,343,895 *2C6A3BB86325D0523953E802210A5785258B4CF3 KEENANOKADA
438,343,896 *2C617FE9A832EB4E7C8B68FB861974B77BE3DEE4 KELLY MARIE GREGORY
438,343,897 *2C689D603F6EB47C1B2FAB269CFC318DE017DCBF KELSEY-KUECKER
438,343,898 *2C69CCB84B5C401E0079F1476AA72A2B05834FF0 KENKIKIDS
438,343,899 *2C6EB91586A82C10BC332372368FD5460B56BBDA KENNITH.BRINKHAUS
438,343,900 *2C6B2072E5EBA3E0B09BE67ADAFC0E5A6F39B982 KENNITH.VANSANT
438,343,901 *2C67E06B3C0BCA3490DC03D4FC8A909E143A2C3E KENT.LANDIS
438,343,902 *2C6D7A076BE7A13543259040E762A695C8302C75 KENT.PAGUIN
438,343,903 *2C6BCC9DF056B5989581C0DCB1B43AE21D188C3D KEN.YNGSDAL
438,343,904 *2C63AFC6E260F9026ED1D2B8155C326CC6B5A5B1 KHAMTSEN 1 0
438,343,905 *2C675A4F4652CC2B14B4FBDA57DBA4F54D4927BD KHPOYRO4
438,343,906 *2C6E18488DC3018DF69CCF5E4496EDB7D389FE84 KINGPHILIP WELLCOULDIBEARTHATENGLANDHADTHISPRAISE,
438,343,907 *2C6A1E919C3549A974550B1069CB21A586A840BA KINJITU4
438,343,908 *2C6860AA2116DD1EC069312589ACE1296AF73408 KOREY.MCCRANEY
438,343,909 *2C6D508F523128717E9C37FF59D959EA60E61606 KOSIOREK0
438,343,910 *2C61080BD5E0DDE7FC3FAF2B1FE7C0BF5EBC1F78 [email protected]
438,343,911 *2C61454E6BC780D0607C7E700C35174C33EB0495 kulhalli
438,343,912 *2C6F3328DC20E3A6C54CC69767F6B0B16489E2FC KYOJITSU2
438,343,913 *2C676FA2AD59BA2F040B4C07BEBE3A3D5F6632E5 la chorale v
438,343,914 *2C61D2666FBF3EC240E8C39CF8364FA9DE532801 larry.k
438,343,915 *2C699B01D33E477C584BB397444D652FEAA10C44 lass'micheinmaldeinecarmensein
438,343,916 *2C6D035D56287744DBD5C060682C6AE61EA25DCB lavernedunlavy
438,343,917 *2C61D895E93B2D88DFF6A343A4BE014662ED5FF1 laverntaverab
438,343,918 *2C6B69574CDCAE8D18330BBCFD5761E3889EC5E8 10anwaltsgebuehren
438,343,919 *2C6C8EB306A6A834706A17BB3D8E2142F9510AB8 112HEYSER
438,343,920 *2C63004055391FD59C734F976151F6891DD82253 1225880 KOHDE.N
438,343,921 *2C68C77AB92D4DD23F9F912B01F9BD90992A484C LEDZEPPIGLET
438,343,922 *2C61B18AAC0D9723D45212943DB52FF01BBCD082 leigh.olea
438,343,923 *2C67AB7479039BAEAB9A48008687DCB8865B2788 1184725 pinkertonaikoosolmiah
438,343,924 *2C658FF48D7734BE0EB1AEFD18321C434AF25030 12: 12 -# -& CONSCIOUS
438,343,925 *2C6AFEE8407AEB01F88F6E4101657A08F7E8998D 123go
438,343,926 *2C6420CF665A65B1C492BA7098CA09A606F7AAA7 12sep1653
438,343,927 *2C66D03327241711A4400690807F2F2C7D7F6000 LESLEY.THUMA
438,343,928 *2C67F5632D364D9AC4F4F9EEB113BC696935FD08 LESLIEHILLERMAN
438,343,929 *2C619E05B37BC263674EF2C7414927107DD3FFFA 1402401 JOKATALVISAMAONGELMA.
438,343,930 *2C61A6390787279631F774347853A140D376791F leverpos9
438,343,931 *2C6A6B2DBD469ADF8B134A752539689CA8BEA4A5 [email protected]
438,343,932 *2C6AC7747850CD0294F053854480983C301C82D5 [email protected]
438,343,933 *2C6A9669B43A9433FE2AE187000DB56B59089C7E 1740319 OLETUS OLI , ETT
438,343,934 *2C6A3E940F5CDCC748F206660CAB5E795EC54986 [email protected]
438,343,935 *2C64EB20455C23DD7B55F8174BC8AF5C89814F95 1893100 kuhunkin n
438,343,936 *2C657224B8E7EDDA21ECFB31CB8887DC5325478C [email protected]
438,343,937 *2C6535F5BC83E0958D632304B0D4D1CCC5D3FC9D 1-akuuteimmassakaan
438,343,938 *2C6426672EAA02A603ECBEE8BE7400192EE1EADB 1-bolschewistenfuehrer
438,343,939 *2C614323B4D4CC8CF87320FD75DAA8EB84FF336E 1AUCHSEIDEINSHANTUNGSTRUKTUR
438,343,940 *2C618A823D2A083DF4E5CA9629568A794E0573CD 1 AUTOFAHRSTUHL
438,343,941 *2C6A2FD8307DCF8A8441C518EDE2EFCBCF5509C4 LINDSEYBOCKLAGE
438,343,942 *2C6DA91582002494390C00451406B854E8C783DC 1.ceylanite
438,343,943 *2C69254816BE85F2DFA4C00C723ACFB10F994CD5 1D7192
438,343,944 *2C6A7D3FD16823D7018B012872B417EC4362AD30 1DINDASLARA
438,343,945 *2C67DC7A421512DC3FC82063F103CA854FBAA97A [email protected]
438,343,946 *2C64A0ADC38D4B59E65CB3292E242853647BA24E 1EINFAELT
438,343,947 *2C6E73C55EFC4953A97F0E248D06B465EAFCCA86 lisup
438,343,948 *2C64B3F59FE89520D3E406E4DD7A1436EC2477AC 1.GRENZDISKUSSIONEN
438,343,949 *2C6CE183B6E7A33FDED51E6F6A62B23675141224 1HALLORSA
438,343,950 *2C68639E175ED77E1E683AC5E8B3A232F35FB9A5 LKLKLRT9
438,343,951 *2C672879D581B01C17E912149438DDE322503FAB LLAMADAALOSMUERTOSQUEVIGILAN
438,343,952 *2C6ECC6EC4CA27358F0C4184C0812D2CB536D4FB 1.KLINGBEILSCHE
438,343,953 *2C607615C398BBA12EF7E63780582A640320B9CE 1-KOMMUNISTENHURE
438,343,954 *2C6BB91471ACA854DE2432DA8F049AA7984BC6AD 1 INTRESSEBOLAG
438,343,955 *2C66818E5699FAEC404132FA338416CC754A2A6B 1LDERPUNG
438,343,956 *2C66215ED5A29F2566915E0FD819930F67C58391 1liekkiyhtyeen
438,343,957 *2C63CEDFE2AA66E9266EE9BE3A49EE00FE250C62 1 ligettkonkurrenten
438,343,958 *2C6466B7542AF2EC3EFCD33253E0B425D4052458 1jermomaisesti
438,343,959 *2C60534111CF92A5513716E4489AD59A7AF25AA6 1.kakkosjohtajana
438,343,960 *2C695F0B095F71FAF1CA3905A2F9D9CFD4E2FF01 1.KALDIGNIZDA
438,343,961 *2C63877232CBDD5AA019A8A165E222C40496E3A1 1.KCLO
438,343,962 *2C6C86649CABFC78997C1B50E3A2F74EEAA8AF7C 1 kirjallisuustiedett
438,343,963 *2C6CA4A4BCEEE7B60FC71A91E0471F542B06DD47 1.kiyafetinizle
438,343,964 *2C6CFCAA50B462529916A590D0809A2247781A39 1 onionand
438,343,965 *2C6CA7F990B41F52DD27CE5127D91E2DC296E230 1.oppiani
438,343,966 *2C6DDE42DC89EBB1CDE26A59F0F9A20E0BEA697C LONSTAMM
438,343,967 *2C6DEE05082A0944349BD555DA08132E9E346EC1 1.PCSTELEFONE
438,343,968 *2C6F2030A080B314AB35E8828D3D80A42E354EB6 1maeckler-plaene
438,343,969 *2C6AF8F4890FE2F14B71D9DF9F9FBE9CF0FEF9EE LORENZO.GM
438,343,970 *2C62ABD449289062B308B169884683EEF6617643 lorenzohauptly
438,343,971 *2C6B629D1C0CA579926C9BEA0BC7CA021D016116 1.MARCH-NEARLY
438,343,972 *2C6F5F7F31882220D09D2E67BC3B46ADC0BC46A8 LORRI.MILLER
438,343,973 *2C6C64FD1CA5BF84ACCE43421E807A6FD49C3A52 1.METHOT
438,343,974 *2C60D7ED21BC084BCC3FD7006DC294DD1C289B6C 1 ROTOCOLD
438,343,975 *2C631419CDF38691B4AB29EFBA7B27F97D5EEFD8 [email protected]
438,343,976 *2C6BECC8998843A3B50EDA0A7FE5160A74DB5DDE LOVEDRUG
438,343,977 *2C6E93321D008A70DCA2DB1B6701F353EA1F5044 1 USPRAESIDENTSCHAFTSWAHLKAMPFES
438,343,978 *2C634F4B0834A6B120BE1B17E1130D6E1D6687E1 1VRHLTRNT
438,343,979 *2C64D6C9B2E261B0C812A8447A7E3D5883FE4860 1vuokrauslupa
438,343,980 *2C6F33D0598F84F621EE950B81BF0C74C542C85E LUCIANO.GERARDO
438,343,981 *2C632D41F939E5D3532C49F7CB2F8E5276AE5E9D 2005-01-26:-santa-barbara,-ca,-usa
438,343,982 *2C6BC06D74125424CCB93D42D89E06E7D6164937 LUIS.CAPICOTTO
438,343,983 *2C62A71FAD000803221DE8F98BC1EB79428C883E 213474 MUODOLTAAN.TIIVIS.JA.SELKE
438,343,984 *2C6FFFB8FAB1FDDF155478D96B95830B2D73E800 21.verkkopohjainen
438,343,985 *2C64CB961D084AFB471B08613955BBB3346757BB 1SZVDELEGIERTENVERSAMMLUNG
438,343,986 *2C6A719C6BB957250CF85E0DB1095F030FC2340A 2255368 doch seit dieser woche ist das anders
438,343,987 *2C6E832DCB9A3EF8385A91A1C38B5EF432178A9E luohu10
438,343,988 *2C6FDA1C21938BA6B9343FA95D69051DB0089424 2326626 SEN OMALAATUISIA MUUNNOKSIA OVAT RAPAKIVET
438,343,989 *2C6475CDCDD5DF3109FFD174E4614DA841B126FC luottamustehtvien
438,343,990 *2C6914E6DB74C68DAEC0C923E4797B07A1940AA6 [email protected]
438,343,991 *2C6BD5023A428E25BDDCC883FC3C7AF7ECFB3EF5 luterańską
438,343,992 *2C694FCFEA29D415C96DE6EBB639B51ABCFE277B 2569152 lappeenrannan-seurakuntayhtym
438,343,993 *2C6089995C8874FCBB76ED673E8CC7715629D9AE 2570601 TAVOITTEENAOLIPALJASTAAJATUTKIANIIT
438,343,994 *2C6BBA64FFEA242A3B32497CFA41379DD936CFD6 LWONGG
438,343,995 *2C68981335EA0105AD9CDC488AD8C32FD3032510 1.vastustamisohjelman
438,343,996 *2C6A619A6D1409B3F6DCFCD107E134A802B2EAAC 1 VIPTUOLIN
438,343,997 *2C6F70C939B36B7A5C00AC31349CE00048DD44B6 1.virkistyskalastusvesi
438,343,998 *2C624996D3E4C509E58F8D9EF284F569FF6E9BCE 27NOV1353
438,343,999 *2C61DA15901B07CF0DDABC2531FD08EBB48CE178 M0DA1!+!ES
438,344,000 *2C6CBC0B8AB0522E7711509A048DAACBCDE16332 2CAMPUSING
438,344,001 *2C6EC4DEAE8EACDE88C3388EFD95F2DD7FAD268F 2CLIPS
438,344,002 *2C615B16DDFB29FA7329958B2DEC0CFC3470FE6A M68976
438,344,003 *2C64E4C7FBEF81890BB3C249091D113320416E1B 20SEPTEMBER1998-THREEWAYWORDS
438,344,004 *2C65ECAE05EA613E1E4060BBCBE6D1E31DF411C6 2GEMEINSCHAFTSPRODUKT
438,344,005 *2C673BFE45581944DB8C7040750233106EEFF038 2ILOVEBIOLOGY7
438,344,006 *2C63F817DDA7F79ECBCDF607FFF0DCD722A7AEB8 MAC.WOHLSCHLEGEL
438,344,007 *2C6FCA170EBD01CCD9B4346D92BCAD316714964F MAD ICE
438,344,008 *2C677A734F7D492D59F46C58D2816C7C41D42A32 2KONSULINSAAREN
438,344,009 *2C60901E79FCF660EC7DCADD45D8FFA23FD72613 2398162 RANNEMURTUMAPOTILAISTA-TULISI-L
438,344,010 *2C64269148688C1A79F532F4DF457B3F47534825 MAJORDESHA
438,344,011 *2C643A3DD0B65D95305DDA3A6AAD0E13DBEDF2B2 2thatbonnie5
438,344,012 *2C6392D471128ECE583D55569C2B34918E363682 MALESEX9
438,344,013 *2C62535ECE0429663D54D79A98FE9464E2F35384 303146 ISe.baSladIGImda.eGitim.alacak.mIyIm.?
438,344,014 *2C699176FCE2B7D74ABE9CEA92D6DF47347F785C [email protected]
438,344,015 *2C6FDACC6D075C88EB8BA881F72CBB89FB570D28 31JUNE1401
438,344,016 *2C638335586E791E1F2E25B546CF2E7DC743211D 339JAYLEN
438,344,017 *2C638CDD5B5DAF87C59C840B497DC261F468729D 3CORTINOFF
438,344,018 *2C62074D0FEFE0EC6D7D79FD092127873F86F7F5 marce123456789
438,344,019 *2C6AD0A0E2975B784E3A6139263CF763E1105EC1 2HLAUTEND
438,344,020 *2C61BFA2FF2B2C64162EC09A608643B005BCB0D2 MARISSAJINKS
438,344,021 *2C69524C5E8D3C7A68B634A32E55876622F33E10 MARK-C-SNYDER
438,344,022 *2C6540F13C6C33CB67601012AF36CBBF8ABAB51B 3====p~ `}8{
438,344,023 *2C69FC70BAACC4ADB89014E904C7838A281063AB MAS DULCE
438,344,024 *2C6683C156730D0B27DA56E7C056635FB0BD9607 2SHAMEAI
438,344,025 *2C651E4C47397A58D072F089F7E866E0BA62ECE9 3stalked
438,344,026 *2C6EBB2455F3105E119E67AA13ACE91B8F4FA832 2.SPONTANEITY'S
438,344,027 *2C6596904906A7A4025A5BC2F03B7D9EF4FDDB8F 3WPISANY
438,344,028 *2C692D6348651FD95F570DBA654353CF1B775AF7 mathewmizee
438,344,029 *2C6D50EE9D49A8A2C186C30E49DA9D9725687A09 403ºw
438,344,030 *2C6D0DD06251AFEDCE4A1629977044CFE7D781B2 335ERIK
438,344,031 *2C62B75564F57287A9A7C3E82AAA9C87F0C44506 4DESPONE
438,344,032 *2C667F722EFAA224B4C47FC9A2A6371AC25DCC98 374476 MC.3,36.E.PROGMATICS.:.VAARALLINEN.LEHM
438,344,033 *2C68A82CFCB39EF01D077ABD6A514B06859EA605 4FGHSHARON
438,344,034 *2C692C507EBA35334A341ADDBB9C2E010D5069DB MCALANIS8
438,344,035 *2C67D26A6646181B9A6DEEC73DCB44F46AF4721D 3ALTURIST
438,344,036 *2C61270D0A899331E62ED929077A0AB498CAE264 mckinleybuggy
438,344,037 *2C60099ADB0E5FDB53A34BF5B1D3FBAAC8FD7050 4iluvsecret38
438,344,038 *2C6D66E6ECA4D70366C766B61CE271D498540F6D 3dichterlebens
438,344,039 *2C61053CF7D392EEE06BD25298F7D2F10E3BF96C 4M91453
438,344,040 *2C656C56413176F85666AC5816666822FE3B6FA1 4MIETBAR
438,344,041 *2C6F9D4DEA25631CC768AD94DEFD10227DFC0038 3levitism
438,344,042 *2C6CF221DC1FA61E23C31D933780A9318AE79993 MEDIORE
438,344,043 *2C64462D2C505FF4A8804AE9DE44C29EBB12B011 4QMCVDHJD
438,344,044 *2C6135B299966D875899976BB44F508074FEFD26 MENTASJON
438,344,045 *2C6002864C34E1FD36EF988281854D0DC2D3E82E 4SANCTIFIABLIES
438,344,046 *2C60928AE423CC4CFB9FFE82C2BF8776BA586F4B 4AKRILNIH
438,344,047 *2C6A34820B49889E2501C85D3F7278DA3401923F 4ATLIATN
438,344,048 *2C6CC9573D88B3D7D637BCEEFB88DBB1CCDDB104 MESSEBASSE:I.KYRIEELEISON
438,344,049 *2C6ED920B326FB8B785270562E1A98F35A7FCA2D MICROCRYSTALLITES
438,344,050 *2C6CD846157B3FA50FD7CF2995E6EDAAF5FE6654 5CONFUSABILITYN
438,344,051 *2C6300AAA801CB62983F8B9AC9E0D055087692E3 MIKEOREFICE
438,344,052 *2C6E72696575D4EE1E9E2DD5C25EE0CDA9451BC0 5FAHRPLAE
438,344,053 *2C6B1B1E3871A9AF69DE4EC51C8766DB3EA6B793 5HEMPNLING
438,344,054 *2C611CBDE6083C9D7A01883AA01ECF7AEBDF3360 5HISTFBSW
438,344,055 *2C6DB00B664606C822BF3EB622F8DF5FA0771BC1 4NEOCHABUJC
438,344,056 *2C629641E451F858D644D4E945D7C6B5EA6934BD 5INVERMASSELNENS
438,344,057 *2C6AC0908186B9CE34329D4FF93A87BF12C84883 5MAATTENBSW
438,344,058 *2C69DE8226DDB157935E687AFB965D128D861ECB 4RAVENBANANA
438,344,059 *2C6B1D58FCF2E3A3F117E2A744DAA27B192E28C8 4RIKKENSE
438,344,060 *2C69F53EC195828D68E6549F06AF109F08A48E3F 5MUSCIICSUM
438,344,061 *2C62F29FC6E16610AF27B1D406E41DC9FD380954 5NYKYAIKAISTUMINEN
438,344,062 *2C6DC22DD94D3414E68CB95F5863B842BB6E5AD4 MITCHELBEVERAGE
438,344,063 *2C6CDE4C52CEAE001B19A98EAFD44690F66C5C7E MITCHELGATESY
438,344,064 *2C6058BAEDDCCC417E1B0792FDD667E3C062B9D1 4TUKOMUHS
438,344,065 *2C6042A3D52E41E67E6C7EFB1B4E8D3B11E9ECF5 mobilisierungswirkung
438,344,066 *2C6D59A3FFEF2BA32D42B54A95BB9C1D4FABFA70 4YOUNGCHRIS
438,344,067 *2C631D27F04046F3EBEB9E2D8869526873EBC07E 538097 SE VOI MERKIT
438,344,068 *2C664E53A7F4E4F05D433CABDDE3BBAEE34F2A0B 6ALCOHOLADO
438,344,069 *2C6504E0FA3961BA6198F2432A77D959CB799C96 6ALIENSLOONEY
438,344,070 *2C68522705D248499E0BB6EB8C644A3B6490FFA2 6ANOMITE
438,344,071 *2C646074739389829E0FFFBA9EC79CF6D66E4298 MONTANKONSULENT
438,344,072 *2C665984DCF5F3BF82F62D0EB0EF5A7ABDC3A438 5A3B5CC4
438,344,073 *2C65F426938AEA4CDC2F012BFCCAE258B50EA105 5.ALISAN
438,344,074 *2C607E5710F2C5D81A948588613660EE9A919F94 moraviani
438,344,075 *2C61508278B6317700FDBFF0BB2818BE094302B1 MOUZYOU1
438,344,076 *2C66EB6D100C79BEE41BA595A3D028D5B0B142B0 MURRAY.GODE
438,344,077 *2C6DB0A73EF4F1248194C0B62F10D904AFDAB72A musicforcocktails.eliteedition
438,344,078 *2C624AC5DF77F70B90B3761C67D5D2DCA4A77884 5FLCCDTS
438,344,079 *2C6BE55ED1E23115FE88CCB89ADAA0D81F7E839D MYLESKULISH
438,344,080 *2C6771ED9B7868259D5B8970D48FAAA6F4E4BF0E 6NETEIFOE
438,344,081 *2C6074C75D5A0612C5413700CE2DD1756EF6EC41 MYOHSHIT8
438,344,082 *2C60D27CF526275A5BA825414B3C4495E8118376 [email protected]
438,344,083 *2C63EF7E2BDED54089D0992C70CB401994401288 nairbigged
438,344,084 *2C668C337425C27C8A777C3134DCC993CFB570AC NATHANIALENGLERTH
438,344,085 *2C667ACC6701E15F632B1061E3A149F800AE3D51 nathanielpilati
438,344,086 *2C6105F7723603726236271A9418500AE693CBB6 6SIETZY
438,344,087 *2C67BD471347E8E0DA9E0AC049848C7CFF5207F6 nd0ctrnate$
438,344,088 *2C6599976C586E147B3A561F73C82BB2A0F26B49 NDJAMBOUR
438,344,089 *2C60CAC2951DEABD4F4061720DCF104D9C4D07AB NEILONDED
438,344,090 *2C69ABC7A340B926FAEA585D8C60538CABBFA617 NEKETREDNO
438,344,091 *2C6E15EA00FD10FC6ADADBA0257D1970C7905EDF 7BOCHMAN
438,344,092 *2C6BF9A39585C33314582A7CF80A1AE1AD0A1B8F 5TIGMATIZING
438,344,093 *2C6C75895310BBB086A0B6CF09F6F728ECD7F80D 5+U++3R1N9
438,344,094 *2C691FD2238EAC4962C4307B7E57CEADF42EFE49 5VERITABLAS
438,344,095 *2C688D7158C5C82D792E3F0DC05B327ACA93F977 5WITDOEK
438,344,096 *2C624CE42F3A6CB7DF56520CA52CD04987AA780C 5YDLENES
438,344,097 *2C6CCD9601FC5D92AD9AA633BA6A138CFFD4573E 7FASCISSICSAF
438,344,098 *2C6D50EADB9AC3A0143B9CDA783D3759E35B5183 NICK.BLACKMER
438,344,099 *2C69E6E689D577461418AF3D1C5648C8CA91077C 7INHOURS
438,344,100 *2C662E445017AC43D5EBA54B0A9A382ED82FCECF NICOLE-MILHAM
438,344,101 *2C6AA5F9C190A3315DD7D208B6D990B2FDB037A1 7LESEFERYSTYCZNY
438,344,102 *2C62EF1389AD97FECFF261432E23C2651722DAAE niemel
438,344,103 *2C6B01CB6792BD49462C01502FE40DF41A0B2A8A 7MORONISNICKERS
438,344,104 *2C64B3461038D7819F063884F5FF361308734F48 7.NEUKUNDENGESCHAEFT
438,344,105 *2C6BBA898E3D75CF6C54FEDF353AAD514828A239 NIWIARZE-UMYS
438,344,106 *2C66F3D73C89B5CFFB14FCF60D87CA85D8F60C9A NKIHORI
438,344,107 *2C675572CA5ECD97A876BBE41667DEA5D9D0B1EA NLEKCIWTNERETIEW
438,344,108 *2C62D3A4E7AE9497D3DF538668E0F903F67530A5 NOELIAMALLA
438,344,109 *2C6CF8A7462130A22DD348FA37D832C57D36C3E0 NOKEIKJ6
438,344,110 *2C65B85E429276A7D06D60A67C8D1CC00599D64E 677JOHNATHON
438,344,111 *2C640B4E9041A1DA2CA9E4913E9D4E42200E12FC NONEQUIVALENC
438,344,112 *2C670A641CAD4BE2A14E2DC3CF5F064842B54537 692mathias
438,344,113 *2C66717C257C145AD77468F86DE37654B3E3E8F5 838JAYLYNN
438,344,114 *2C67F7EA8290067585B2C93F18F6DD35F1CF1FE3 noun-verb
438,344,115 *2C6E4BF2B307F7ED6EFB88452A800D456A253C03 OBENGOBENG
438,344,116 *2C63A53EF1FE78097F318C3295C528F519903F5F OCTAVIO OCAMPO
438,344,117 *2C66FC4BB36AF613E23785AEB05B7D878A67FECF OD<
438,344,118 *2C6D006612C8F8747FF47290C05CF9D6774BA92B 6KARKEIMM
438,344,119 *2C615102F44E1C976BA3EB375E889E410E286622 8GEORGIEVICH
438,344,120 *2C6CA99508FB4FF73A3ECF96D50388B85847B114 OKUCHIMEIKO
438,344,121 *2C6C2BAF2E30F1C2159892D0B033B9EA5DDEB057 6PAULSMAN
438,344,122 *2C681A562CF97EA128C9A783ABAE42CCE9475810 6SDDEUTSCHLAND
438,344,123 *2C6FD19629957B99479CE2927E26ACBAB3BF7493 [email protected]
438,344,124 *2C60E7D4D11B6BB6BE0678854EF5A19A55357250 8OOTHSUP
438,344,125 *2C647902EE09F2950FE264ECA5F08DA795D82A55 OREOHERZOGIOABIETALIA
438,344,126 *2C65916683463B62103D884A243AE5482BFE8359 8ROCKETSHORTY
438,344,127 *2C6CD49CE249B4B662C5EB246E3A794FA21296C6 8######@*Sploit
438,344,128 *2C6A4B8B3BBD4BC1A43A2E9311CB151028882678 ƆːˈSTREɪLIː
438,344,129 *2C69558C972206B86B7C0854E997CEED939FF7E8 oswaldocraigo
438,344,130 *2C6809E94553E9CEEA9EA75897A169280CE9D8EB OTALEIRI
438,344,131 *2C612771F2850FBCAE101C70D575BE9F3CBC2F03 9AZAKEMIS
438,344,132 *2C695BC645522EFBDD8F5D11DA2392E18FC6FDA6 P116754
438,344,133 *2C6F5972CF1E3BCCFF56020C998A1E4717676063 7BHRAATARAAVAPARAAJITAU
438,344,134 *2C612847316C60497A7F65FB4F2440FA6E1DE8A0 P)~ ~ ~ 3B<
438,344,135 *2C62817A087BAF5619706F297A2487E937EC17AC 7BREDSDORFFS
438,344,136 *2C6DA5FC02BBDC0F8755A0A873007CA46DB2418B paetevoeitti
438,344,137 *2C66DA97A5A62C88022B79A42D541484D1742694 7DTVPKVLDOHFJN
438,344,138 *2C61219E1C42E2B4E93395B92B425F33DD4909A3 PARHAM AMINI
438,344,139 *2C61CD5C7BFADA0C601402275586CFB586B75770 7ELOBMELECIRTAEB
438,344,140 *2C698D65856AD9CBC0C18B8394CDF0636919B153 7ITALIASCARLETT
438,344,141 *2C6872205B4C3553265D07B81F0DEC52C3118541 9iamspitfire2
438,344,142 *2C615636023FF7DEA4D1FA362C49856D51290820 9JULY02
438,344,143 *2C61A8F6B84A8918491A71EF176FCFF1D8577646 9LANSTALL
438,344,144 *2C68476C0026E30280F06B8371742D8159F25FDB 9mypiper10
438,344,145 *2C6BE1ED3D63D6EB8C69C6D97AD9533212058CB8 9RUIFFIS
438,344,146 *2C637B293BAEA30DA193106C08C646630C3034EA 7VKGAAAACAAJ
438,344,147 *2C603D034D366FCAEC0039EC69163311598EAC9B 7WQXCYECMH
438,344,148 *2C6D13F62129F3371E135D1A98CAB973262D9312 PETERGWILSON
438,344,149 *2C69DC238086B0D8446473E5DED5CE656E77F233 856741GG
438,344,150 *2C62BD55608D7D721A807627FAA417DA4141006D 894bb4012cbf3f8899a268f532ae656f
438,344,151 *2C652EF880D8459C15E88455FB9E69FCC3AAB1E3 PHILIP-JANSON
438,344,152 *2C6F38148EE9B81533DDA46DC356583F51B90D0D A;)
438,344,153 *2C657001D68C3A4160FBD5E5DC72CF2AD40A6514 8CLSBUTTONFACEDOWN
438,344,154 *2C6443D030A41692D37FE98F0D5E973078273B53 a1drew
438,344,155 *2C6D369C6F1FCB11C0CE2A451BA3AB0BF1DF011F PHOTOFERROE1ECTR1C
438,344,156 *2C642C209C164C8296A321A5CCA7298F902D6A94 pi9nora73d
438,344,157 *2C6652D925E69707F2519F431042A97291D4CC77 .pi/pct.fo.pi.eht.ot.tnelaviuqe.si.dna.ecivres
438,344,158 *2C6C5D49FFA10B418881B5A6445D891900826E03 a6
438,344,159 *2C6730E401E2A0F2212D4698B425BA6D2C9BA3E5 A+ACM
438,344,160 *2C6E995E898A44104EEA8E33DF8E7CD509BA5C7F pmc2590134
438,344,161 *2C6A4E8F0BC3A97BCD516E6B4B20F28E7CC374B9 pmwgbsw1
438,344,162 *2C629297ACC10DFFED500A1F33E8B7ED1FAA8D8F PORISTESSA
438,344,163 *2C60E0B7777ABD86D0342D49E05E12F543C143F8 portuguesangel11
438,344,164 *2C6D16B5794249B9AEFB988256F3A908E4FFBA50 poulet.n..728.120
438,344,165 *2C64B3209B4DB359630B8A246648FF9491BFA87F 9ACKOWLEDGE
438,344,166 *2C65B0CD375B16D2A19DF73BC5A194392C84C3FC ABDUL.GAVILANES
438,344,167 *2C693960604739B2F946F451BED4082A5D77649B 9ANTIKANONIKES
438,344,168 *2C60C8D8359B141797EC69775035A194AC9C02E0 9B32356608
438,344,169 *2C69A7D92F7B388C37DFD09F6DD2266C9F593A79 pP.`~.`~Splat!!
438,344,170 *2C6C080180D059F6CBE2F06509C3A2FE3AB1F53C ABGELESE
438,344,171 *2C68CBF87FA52EEA186DD950592D03570611778F PREACUTELY0
438,344,172 *2C6E7745FE14FF9CD1A1033FEBEB5992CB05A7AA 9EDWUEERHCSTIU
438,344,173 *2C6849C6C3AD8A30633E08A0F717B6808F735E24 presideren8
438,344,174 *2C658F3ACBBDAE3110346DFB8468D4F142CABBCB 9ISTOILLE
438,344,175 *2C6D119583FFD3BAC3B2F237FAA3BB664E329471 AbZ#
438,344,176 *2C680E2E5D55C10208DFA4D391E2E61AF8625498 9POURTRAYMENT
438,344,177 *2C60704CBFBAB3D9B9722182D6B5A4022492DFB6 aciz/
438,344,178 *2C6C1260259FDA3B84053580102627405CE41976 adimalde0
438,344,179 *2C6646BF0447E5616552231274636A6E93462CD5 a003627
438,344,180 *2C6221A071545DDD1E2F967029E11F7459D22C79 PRO7OSI1ICON
438,344,181 *2C6620BB1EB1AD604ECAFE681D4F3B30BC5D9B7C PROZOPOGRÁFIÁNAK
438,344,182 *2C63577EF0BB7AFA45672C8737D63112207F0E93 p####>`~-`~-splat
438,344,183 *2C6136D5AA77A7AD3994FF445E696C51AF916FCF A5NUC
438,344,184 *2C67B3C337CAF0BA74ED20AB210A8F5B1FB86F0B q=====b-~-`
438,344,185 *2C67832A8C0A05BB85BA24CA391B8F8A13F4066E a9.g
438,344,186 *2C64C1788AAF97B520268785E6F8114907DD90CC AHW9L
438,344,187 *2C68DE5B617F4323941F3177A4384FF08BB2D453 [email protected]
438,344,188 *2C69D8274BC13450E40854731674B323D2306B79 AAC6CN
438,344,189 *2C6701F4F2AE2B69563DBB75CDAB93E35906DD2A QU4D12I14MIN412
438,344,190 *2C645EB52CB6FA43F92DB3DAE1A3ADDF5E0579D3 AACZXT
438,344,191 *2C61DA819D2EEF01CF83E40C030FF56E0F1CD507 QUGW
438,344,192 *2C6D74CE3376688D9117A771A75BFADC60B3B2E9 QUINTIN.ILALIO
438,344,193 *2C681050C03D2B114F31E7F906DFAAD3780CA8B5 ALBERTO.COLON
438,344,194 *2C6A6CE4D643274D1C6FE0A6A315757731BACB3F ALEJAHC3
438,344,195 *2C6A02EBBD68CEB61ACD492100B9BE113DEF1EB8 ABFD}
438,344,196 *2C6F7CE00996727A3CEB0F5BE71F9F09A9490825 randolphgaspar
438,344,197 *2C6219C134A1A685D28A458CE6B8C6B52E3C8488 ABNQ
438,344,198 *2C6485E4C1EFE37FF59CA1617A2C4586761D8706 alto-todo
438,344,199 *2C607D862B74BA4E6050AB9A672AC18DC63F14C5 ALVINESV
438,344,200 *2C61D668316C0F603411BDA0D4B08E440E3B9AC6 alvinwaskin
438,344,201 *2C645711F1A4DE0497D198D3A20A986F158944B3 ac%7n
438,344,202 *2C6DF14210F2D13A3ECF3AD2490D9BA6751E1BC3 AM(1!
438,344,203 *2C6631AE08DAEB3F23069840EBD111B4FE1BD99D ratskin
438,344,204 *2C6593DCBF308ED656D47B0A30F34D04C46F9BBD RAYRODI
438,344,205 *2C626C423FBCE1366A169C9CB34CD6FCD8D2F191 ami.cooper
438,344,206 *2C6EE33E711A1B3B18EB0F9EA90991ED1F56B2EC amirs
438,344,207 *2C60CA5CE3FD46B960CE1B3655F6C91BD0147784 re1igious
438,344,208 *2C63C36CF92D6DA5FB9A79E208BC37922707AE2A redigeerden8
438,344,209 *2C638F94363FFB14268F0F0564BF9F48B08078C3 ANDY'S-TOOLS
438,344,210 *2C684FE17AFB1132942753F6D142F5B35198E6EC ADOPTIERTED
438,344,211 *2C63320C61F5DA8DBDEA8A492086F440F73629E6 ANNE FORD
438,344,212 *2C623C3EC670CD206536BC113CD9D7F1725471C6 ANOSPASSADOS
438,344,213 *2C61367800F1624329EBF21F1CD567D0723A259A RENABUFORD
438,344,214 *2C618BD33053A72CED62A490E8ACA3E3DEE2F388 RENATA
438,344,215 *2C6ADD99FC42B67664AE484185B0AAE6223ADF9B RENEWING
438,344,216 *2C63AB1DA0D3110323C7F773DF7F839F51130217 A?EG.
438,344,217 *2C6CE52C63E28A9158500C939785735E485F926F RHETTUONG
438,344,218 *2C64A163CED787E99ECAD5835DA5C44F4693A065 ricardoskyers
438,344,219 *2C612A70F135B5DE85E9F710A94EE867E9F15576 aqfe0
438,344,220 *2C670FB4C9B868A78A91ACC39087796DE2542920 arbrevlo8
438,344,221 *2C65632B3B94BE8C582167DA6187794C01AF5CF6 [email protected]
438,344,222 *2C6BD85E60769A6536F41DADDF57FAFF5D5DF8F0 rickyfreeley
438,344,223 *2C6BC5E2B81C0FD5A537F221923EB76C7E240487 AJU-_
438,344,224 *2C62287C151ACA0B093AFA07AA89850E24D14FDF ricky.zuckerman
438,344,225 *2C624B71E04E371F324105B9A4974193D29CB7EF ricsjck777
438,344,226 *2C685A6736DF9E8D2586F37A867F9BC2C55EA3EC AKKUMULÁTORTÖLTŐ
438,344,227 *2C68EC6D88275864CCC79CC6636175154CFE8474 AKULAIZHONOLULU
438,344,228 *2C67190FEAC92F6F9D26869DB2D543BE4EB0E890 rjf}
438,344,229 *2C641D6B75FAF3FB3386CB7C1DBFAD48DECFFE9F ARIMMALKARAPPAN
438,344,230 *2C6DA73C49AD0A788C832773595D930ED69C46AF ALBERTOMCCARROLL
438,344,231 *2C67FFBDC5F33B274DA8F75DA30E5CFAE8C62577 ROBINDEATH0
438,344,232 *2C6157434D92817CE7A33E7325F3F0C5F79BAE08 ARMAZENAR2
438,344,233 *2C6BA2AC3C57938FE514C9EC2F0FE6EDD3BED024 arschtrittinsgesicht
438,344,234 *2C6712388BB8E16D47F1D93E0FB1EEBC1448DD67 ROCKETH
438,344,235 *2C62332A12FC9EB9DAF56FD2385B684EA285A613 alessandro208
438,344,236 *2C6657474D2202C4DD4C0470FB2E41309321755B RODERICKCORDOVANO
438,344,237 *2C6B704313EF19E8C6D68C8DFFD92E9B412D4DCA alexandretta8
438,344,238 *2C64BCDE0E002B83B36703113721CB78595A36AE alexsheena
438,344,239 *2C628F7DA8B3E1ACB08FB191BA7D29995CD05D7C ALIVINGS2544
438,344,240 *2C61E1ADD1359B14E0CA0310AB5A18AF818EFFD4 ALKYLYL7
438,344,241 *2C64A893A2C762463C03EDBC3F59511CD30FE527 ROGELIOBEELBY
438,344,242 *2C6E28FED55CE3DCD04215648CC5638B4195D418 rogerhasbni
438,344,243 *2C66141F44326D46E422339AFDB89628C63FF3B9 ROLAND.ROZZELLE
438,344,244 *2C6B90CBE6AA7382590814ECD72F3346D0CC6A67 ROLF.EVERHART
438,344,245 *2C6DA6F76D2F4DE4A59F1672CFB94069608B678C allansparger
438,344,246 *2C6BEB8AA9ACE53B8B11579616B87C8F2957F5A7 alla.tiders.sj
438,344,247 *2C619328C5AEA97ACA83A456718393421D94C965 alonzocanino
438,344,248 *2C6F8F34DB8C8DB3286572A53C5DDFE040A1A2B4 ALTERNO2
438,344,249 *2C6A3E55F2FC6E836CE2F78537E77366D6B7A974 rpplrnt
438,344,250 *2C619D5B08B40AC544502301172756D35DE45971 ALWAYS-SAD
438,344,251 *2C6435A6F9910E652CF145A09E7EA9EFF7055378 amayijuves
438,344,252 *2C6B9EEC04B50A084DD7052E0043D38E1380E6C4 atsco
438,344,253 *2C654F990D86CFC9D0DBC370B4627D897C193C77 RUSSCROSBY
438,344,254 *2C61F362685A8BFDEC12F64F1DC565E239ACC7D7 AUBRETTJ
438,344,255 *2C6AF2D9DDB7CAAC3F6B9E291D9758FD05F2FA99 A!MN7
438,344,256 *2C67196255D259CD4F3F1CA85097CB81BC65F6C5 auhd7
438,344,257 *2C660A9476CBC3498D9909318D3FC6A83A8965B3 AN7I3L3C7RONS
438,344,258 *2C655E1836011FE9104AF2F500E9076A563337B4 anav3
438,344,259 *2C647EF11D442CE48405BA6282CDD5ADBA7CD094 SAANGEL003
438,344,260 *2C664F5E1B3BE43D13D512EE641815C841D0CAA5 ANDREBEANIE
438,344,261 *2C695E76116E3DC9843C0C1188F19F06E5131C81 [email protected]
438,344,262 *2C64C2B2F9F97839DADB510A4A9041B7DC0B3DF6 SALLY-MERRETT
438,344,263 *2C6CB381D78E85089D668B1615DB16DF19676A11 angelenos--ae2-n-jh-ah0-l-iy1-n-ow0-z
438,344,264 *2C6AB370F4E36D0C5FF9B567563D4FE800D4473D SAMMIESNAPPLING
438,344,265 *2C68A9AD8255A206A0926FCC81E262CD50148CD8 aut!
438,344,266 *2C68EF7FA83D07075E2CB3F352A42014A422A672 anthonyantunez
438,344,267 *2C6653D814814F3E074809FA5B86E981170E4078 a(v#w
438,344,268 *2C6E229AFC2CF018651E29239956553384EECE08 aw6p%
438,344,269 *2C6208F03A42DA36C0DEF3FFA72F163AE06C2AE6 ANTWAN.ANTOSH
438,344,270 *2C6C7CDB12906028212CC62135D10E585D366566 SC/AA
438,344,271 *2C6E09FE76644F44F92984129228DC2DC690E5EC ĀPLUTÂṄGA
438,344,272 *2C66D33E41CB4AED7E263F7927DEF38CCE826C35 apomeraed
438,344,273 *2C67E6EDD2828B3B546F5A5687AA2AEA8C2800F8 SCOT.DOMINGUS
438,344,274 *2C63DD679951D031405D732ADC2AB73AFDFBE28E AZERTYS1
438,344,275 *2C6A89CF3DB4757918D674BDDDC334ED7370FB1B (><)[email protected]
438,344,276 *2C6AD486E02C4C87E434FF80D31630E3DE105141 b#) ~ ~(0-0)
438,344,277 *2C60D02E846A052388A2FA9FA16D54B1BEF39DAA [email protected]
438,344,278 *2C627E1AB3F70930FB9141167FB6EB3862954A57 Aq(M
438,344,279 *2C624E0F9C5F019980F2A4578A7AED8A81B603A8 Secodo-te-che-gusto-c'
438,344,280 *2C698721D05EB801E391E18BB0458414C0D61165 A_Ro
438,344,281 *2C60BC6D9BE3ACB03D5F21203DDC83FF0BC9EBBF BABELET
438,344,282 *2C6772C8A05923996888820EBB2787F294CB3ECE ARTUROKEBALKA
438,344,283 *2C63FEC5B498BDFE6E8711D70C1E82C1F1782821 ARYSHANTY
438,344,284 *2C61E60EC6C0896025514663591DA9C1F93D4EDA as223
438,344,285 *2C6F09F851F214540E3FCF37494E9803BA937119 ballad of the woggler's moulie
438,344,286 *2C6C0B21AF6892EA5147DEFBEE65EB600287A70E SHEKHAR-CHAKRABORTY
438,344,287 *2C67FE7B93C8C37DB3D5FBA84E27A85FC8540DF4 SHELDONSPURRIER
438,344,288 *2C6E41B628786C272AA918228137234E4CB659D6 asiuses1
438,344,289 *2C6CEF6D2CD8347A5908A59D48932BE5F7497258 ASKSINCE
438,344,290 *2C6AABCDD18DDA87F7C39EE34BA5E6E9D6F7EEED BARRITARENS
438,344,291 *2C6B73E96CD24338362F8DCA067D2174FCA3122A ass#e
438,344,292 *2C6575E471A36FE44EA5245E0CFD11A10133C3AB BASALTIFORM123
438,344,293 *2C69EA8C1606C949B4A8534F0CA6C63631233ABD SHIRLEYFULLARD
438,344,294 *2C69BCAEEE9CE68668FFE5382070CF1AE2723E45 SHOUT OUTS (FEAT BURN ONE AND FORREST GUMP)
438,344,295 *2C6C5D5927616BA43150017BF64668A8DF15A626 SHOUT OUTS (FEAT. BURN ONE AND FORREST GUMP)
438,344,296 *2C6D635A3DD1844536798BFF53785488B026260C [email protected]
438,344,297 *2C6A3AF152894C6FDBDED8B78EED34F8CF345919 SIERRALAMERING
438,344,298 *2C6643B674856427C7D22A3D236631F39E216C94 silas1019
438,344,299 *2C6612B89ADC3D63B042228D0855701C7BE6F532 simonelvers
438,344,300 *2C63A4DF888D312FB9C259C845D7746B3BA299CC SINGALÌSI
438,344,301 *2C6948EC1D7FE654E4C40344E0BBE32F353DA73B [email protected]
438,344,302 *2C655DE2CA712894481F56366E766F775B0C6E9E ASUBICO
438,344,303 *2C659022B0A57BF4E86B3EFC505DC2A4243D06BB SMOKEYGRANDMA0
438,344,304 *2C604B363C5F1C647F3351E2F773EE3449173537 [email protected]
438,344,305 *2C6B48EA4C09577FE2CECDA703F006B7A35CC124 b,b1;
438,344,306 *2C6EEECBF88E3382681D88CA3812407699955AAB snijeti
438,344,307 *2C6E34E6CDE1001E622DDD24302E6D4766E6D9B9 atr12
438,344,308 *2C6CEBC3CFD7BD150C6B7F0A740377070F1D88BC ATUK4
438,344,309 *2C66428CF79809BD87EB10BBBD5BCCCB059C3EE8 beagleploeg
438,344,310 *2C61AD7F43546E565379EDDA0406354505C61ADC AUGUSTUS.BRYCE
438,344,311 *2C6347505A2182E8BD802A2E530194DB6590F4C7 BECKWATTER
438,344,312 *2C6CB2FD853C932DA8636F81FB2012FF8CE1DBDB AVGQR
438,344,313 *2C63181FBAB1CE0AC05E6EBAEF2225C5D40A80A9 awigq
438,344,314 *2C6E39FB9BE6EA4A6636F00587B97D686CF7A861 axzut
438,344,315 *2C6472CB6A0DCFFA0B708E761171778E6BB7EF15 BEte
438,344,316 *2C66187F420EC4B59513D506FA94679F3E42DCD9 bgkqv
438,344,317 *2C644DE9BC90DF6226A8924AAE51E77383B3A895 BI2,N
438,344,318 *2C6342244837FB6DD1D1BC66B5E9EE296D90CA63 SPLAT!~`-(==P
438,344,319 *2C6FFE135840A558B239E3DFB01ADA019B5D4DCE bigdognetwork
438,344,320 *2C67F0B28E8D04994F36232D13FE1992256CDD09 [email protected]
438,344,321 *2C6819C97054807F8B94317311A42F7C48CA2315 BINOMIAALCOËFFICIËNT
438,344,322 *2C6088A277A3B0BBA70976370489C728BBF55AB4 sq$y
438,344,323 *2C62F8CF48C575F72D0F1EF93D63F729764E114C BISN4G4RLHOS
438,344,324 *2C685C2632B264EC0ECB65251B450F1466DFD9C4 B?jr
438,344,325 *2C62E1D2A256AF2DF9CC5FDF3B9427BF5D034795 bankgescha"ft
438,344,326 *2C6A7760D053147926CF0153C56A84EEA1C43C5B BAS7ARD1Z3D
438,344,327 *2C65735220422057BFD4AEC75A9C3675DCE321A6 BLEV-ALDRIG-AV.
438,344,328 *2C63AD2F8483BBE75DD8BD8A2724A005CF9D58BD standing.alone.(view.remix)
438,344,329 *2C6A521B782580D4AF7E1A7724F2BCC041825570 bbea
438,344,330 *2C62611DA406124DCE812D82DDC0A6657C236641 BLOCNOTES3
438,344,331 *2C6A110BF44D8E1DC496F306B580FAC8FAD47FA1 BDIE.
438,344,332 *2C69CA52DEDA740621FB5C5A152242FA68D0E1E5 BOBOHOJO
438,344,333 *2C634B8AA3DF89914C545EDC3E008C4499C68F03 bodendenkmalspflege
438,344,334 *2C6D7501CFE4B479C242626971F578DCE3A9C7F6 BOKKEWAEGEN
438,344,335 *2C63DF21E96F35102253DAAEF7FC55741927F9C4 STNEMGIP1
438,344,336 *2C647F3B6C5847E163D7DFAC01C4D83929428B16 bookvol
438,344,337 *2C6261FAC66D52D868839DE7ED5DE5926FB0901B botaniseren2
438,344,338 *2C6906DF29F9692EF3BA5ABAB88453CB562BA0EA BETOKENS
438,344,339 *2C6255BDDFDC5A24977ED14E848D5E938FDC83F6 STUYVENBERG
438,344,340 *2C6FB2759ECA60E3736D2602ED0FAB3DFB9336BB BGHY
438,344,341 *2C6338C4625F5DE0A31FC2CE29A1703E132734AD BGTSTTN5
438,344,342 *2C6403AA86C60E56123122BE293C4879D267C9D7 bg+xm
438,344,343 *2C697821602C7FBC71701D2DEC7393291CDDA061 SUKKETT4
438,344,344 *2C668C960377958619D9AE13D4453DA054BDD60D BRJ1N
438,344,345 *2C6FD4540D14282BA9FF7A672899AB3D28E7F0A5 [email protected]
438,344,346 *2C6EDB8CAEBA0A262F37074569F7053839106A49 bibeloversettelen
438,344,347 *2C6E126634A362BEA9A05B4370DED1E2AB61A725 Big.Rat
438,344,348 *2C6D3434349CCFFE4B09E4E0A504BDFA6BEA538F bilateralistic.
438,344,349 *2C65E546318F61B61DB0F66F5449911C99C80409 BILLY.BASICH
438,344,350 *2C652636D1EE89F71654647C5246FCA646A7DEF2 BILLY.BOCEK
438,344,351 *2C69E9D31B232772B6243DFC756CB1F4D05B7F25 biose820
438,344,352 *2C64A24A2B53539B5C6FED2417EE7A84053BA241 bt,c$
438,344,353 *2C68ACA579B9E6A962D849C126A89A871799F7D4 SVJTRPBLKS
438,344,354 *2C6DBDF5E6FC7AEB6061DEFD38173D19EE51165F [email protected]
438,344,355 *2C64F74D05A6A4B2442A64A316079869290ADBC6 BUFORDFEAMSTER
438,344,356 *2C61BCA70F252606E50D663BC43E7543385263ED bu-h/
438,344,357 *2C660F5BEE745D4A85B35FCA4BBF56FA8A46603B blackcloudsdeterminate
438,344,358 *2C6C14B1A8FC57C31CEB5849E509553F91E7AB99 SZANYILTAES
438,344,359 *2C6FA29E7B137337652D481F41E03B55279D7E21 [email protected]
438,344,360 *2C64F0DC205E03B5B1AC9AAEF5309BB51120C451 blov
438,344,361 *2C6BC3F6E1B5A795301ED0062A48CE6107E21650 bvnlu
438,344,362 *2C630EC62B223BC48A5E21559000713F28B84814 bo;ot
438,344,363 *2C699B7284D31ACAAF225FC734EC7F2229E0CE3E bosssm
438,344,364 *2C68BA92EAB915EEB5248373CA0A54BC8D380149 BOWIRONNING
438,344,365 *2C6826551410B05C46DAA57D7A98978EEFD0A65D BOWNDONING
438,344,366 *2C68D151636F7F1DA14A3E4FFDBC47BC9EE73F6F talkwlpulsipher
438,344,367 *2C6849C54A835A4DF6ACF766B5B8E9E04365F499 b)zlt
438,344,368 *2C6967EF3EFB3D355ED66F0489F40222B1B39A87 B;Qi
438,344,369 *2C61A1F310B6C5754DC4FB575A62796A18EFA0BD BRE98
438,344,370 *2C6738353C120AD9322892785EBA8FD2A092A7AA bsfr
438,344,371 *2C682BF1306AA53C59539B2D71387E8C21D4FF82 BSWCONSEGUIUBSW
438,344,372 *2C634B8F876E4AE1C03EA26CBD621AB1FA211927 bswechokebsw
438,344,373 *2C69836657FD38A02C0E40F913BBAFF4363125AE bswhjbsw4
438,344,374 *2C6E1D29DEF21D43BD0CB764DBD3858492698528 BSWOPENEDSOURCE
438,344,375 *2C6C16BBA1BD686B0A20B1030D8D98A768F74CF6 bswutnereader
438,344,376 *2C6C695F3343CDB9F3F611CEBD35CEA4DB9DF026 btbig
438,344,377 *2C6646F68E1BA10AB94DEB98B1F69D94AF418613 CALDK
438,344,378 *2C65E869ABAE0C8CC06C512786900884273B85F8 BtY"
438,344,379 *2C647BBBADD88986BB1764EFC264D2DEFDB86989 CALVINBEILER
438,344,380 *2C6B3FC15622BC7DFB33B04BA7960C7FBBA1146A tessasingh
438,344,381 *2C69706DC736832ED4EC069299E83C3795400E74 [email protected]
438,344,382 *2C63111EC4867F34DE2DE9CD7A1123A6563E87EB BurlIvesHollyJollyChristmas
438,344,383 *2C6CED84709C6B281E17D1AEE48DB6A35579F093 burning-indica
438,344,384 *2C67A86A6AB4F127FA76E4464F37C168A3F48D13 thăng
438,344,385 *2C61082CA3B5DC5AD249BD26212CB9C1CD6B89D9 bvfvk
438,344,386 *2C6A2B11734E26ED8A1A997E4723EF74ED8D07B8 BV&U!
438,344,387 *2C63D9D00FEBA0EEFD6F94CDAEF997129F4EE573 THURMANSALWASSER
438,344,388 *2C61C3FA7658FD68DFDC38F11A01C54D56DA1FAC TIJOBABYT
438,344,389 *2C6AE9EE51E538C723D9F040A80AA888FD339E53 TIMFORBES
438,344,390 *2C6BF6528F78D84135E6B45E5580A17073EEB938 TIMOTHY.FERNADEZ
438,344,391 *2C6B1DEF9091191BEFB708FBD866E1589FD71947 timsmiles
438,344,392 *2C6C1F86D0DC8EFA5106F271802FD137ABF2FE01 TJEPTJUGOV
438,344,393 *2C66558DCB1E1BFE02E3213B08BE8682EC1E0F20 BYRONKEATHLEY
438,344,394 *2C646CD6542908532305908C5481FD228818E693 CARYFIRENZE
438,344,395 *2C6D5A5A0A5802359CBA591DB4094DB02AEB93C7 B面的歌音源取自
438,344,396 *2C6B30C2ED86B99087863F68B68C48461A979C4F tokensofrembrandt
438,344,397 *2C631E2725BBD565BFC6FE3420944DE13B17332F C1B0
438,344,398 *2C66C755D8D6EAAF3562928F3A62D0551A456D40 TRACEYRYKEN
438,344,399 *2C6B9CB76E4910BFA71691D4327DE793CABF6B6C cafehere
438,344,400 *2C6875C999CA73DB967C956E2D4662DDADC29E55 cehog
438,344,401 *2C6C6AB67ADC34000D8C5656081180125B735923 ceруja
438,344,402 *2C6186B3F9D18706F6A9AB4379AED1F69C414003 CF4
438,344,403 *2C6D5177740BA734AB89D67CC8C44256339946B5 c#g_s
438,344,404 *2C6BDD1271788E69E7CB800D88F41E7A474E8DF5 carmelotecchio
438,344,405 *2C674057A21F6B2FD4974E0798585CE7EF1B3D67 carmelotwersky
438,344,406 *2C6BBEB4D9989864632451897D5403204AD0138C CARMEN.MOSEBY
438,344,407 *2C6BDEEFEA59660B38B59AA1CE082794FA793870 CARMINE.MANZI
438,344,408 *2C60037A8DC2E74B5D3F619E8B96CD14AB6DE24E chain-mail-armor
438,344,409 *2C6DD23F5FC4482B1F3C7DAE3DC2B8C85A7B8835 changkanoff
438,344,410 *2C67F380D78C500B8BB412B30613F8F281D0BCB7 CAROLHIDAKA
438,344,411 *2C603A3721239C0F5494B6F5515EC266802BAD3B tri.kuncoro.surandoko
438,344,412 *2C6AD09B08E0D34EE213788BB5F91418713A5DDF CARSONQUINLIN
438,344,413 *2C6B9DBD285DEF6708B27633C5D0777A011285A1 TRINE-FROHOLM
438,344,414 *2C61283F8041ABEB2EAA061D71252639D7E66658 TRISHAJARREAU
438,344,415 *2C6FF4539ECFC601187D53BAFC89179EEE4193CB C_A!W
438,344,416 *2C614746B9B2F4862A7EA33C1E82368AFF658C0F C,B5B
438,344,417 *2C61A0697C1F83941310689C9D73D63960A087E2 chavatises
438,344,418 *2C6C6209CFEC3DB938A8B9AA297D345572D2DD21 cbnd/
438,344,419 *2C6353EDD4F1C8278465CCFEDE71804740F6E91D ccq&u
438,344,420 *2C6057E51B89239185971C2CCDB5535AF34B3854 CDTXM
438,344,421 *2C6948BF87B58EF22E57D2C48570DC5789445A29 [email protected]
438,344,422 *2C634B3B2BAC57809F06316C192E6D5F872853E3 CHOUBANG
438,344,423 *2C6A79A7C5D493CF76ADD6345FBD0799179D8BB8 chqteu
438,344,424 *2C625487A4A3632777654E0F28BC698B6687125F CHRISDENY1
438,344,425 *2C6726EB017EF84264A0298958967A4893844E98 CHRISOBERENDER
438,344,426 *2C689C99ADB680A78C8D848A37330ACEACCFED61 CHRISTIANGARGANTA
438,344,427 *2C6690E30B0C82932262A66C23098B63ADDFD675 tyrell.wilkerson
438,344,428 *2C6F941A952EC1621F2191942256C264D1BF6C0A CIGAF
438,344,429 *2C671FFD271122F5C227CBB92F5AF40976BC01D8 CITROENZUUR!
438,344,430 *2C689D933311E4D9F37AD5AA685F0B829807B1C8 civ2t
438,344,431 *2C669CB91DBA058AF39F55B604D866EEC55BB032 CJ_LG
438,344,432 *2C67E19753FFE371C1B6EC257672BEF904E61436 c%kvb
438,344,433 *2C6D61FE86A7BAAC0C22B49C15DCCF90223DDE1E CL0V
438,344,434 *2C6984A3B5641AC26A3800A737903B5A9F2FA620 ultradome
438,344,435 *2C6522DC9B10B5BDAE5E7547B74BAF4D970B56C7 UNITEMISEDS6
438,344,436 *2C61D7A4F88A3F08DB46116B226C77EC2AF2167F Chemical-Intro
438,344,437 *2C64C91AEDB3799FB56732B3D6BDC6E611C6503D UNSERSEITS1
438,344,438 *2C694C8CA63D5409C664D16CD144A7AA505D783D untrustworthy-/@/n'tr/@/st,w/[@]/r/d//i/
438,344,439 *2C6A8205EC0FC6D0A863C29CAECD688ED2B0218B [email protected]
438,344,440 *2C6B72178E066EB19A5333E323804EF1ACB1551D CLIFFORDHERSBERGER
438,344,441 *2C6A45A352148176172E1793AD7EF0EBEF86DCFB CHFXV
438,344,442 *2C6A0EA56C9CEB5E9C02EDD4EDF3AD3030BCA798 ClW
438,344,443 *2C63529D6E99C4AA9ED52317A38287589BF5CAC9 CMK+,
438,344,444 *2C6D18504E70711636ED43F14C57F95737B54F9E UU` <---Q
438,344,445 *2C6F6663635B8429864E39674EEEC12B7744098E UUSKYTN1
438,344,446 *2C6B84F5917115BAEDECFD3C35106C895762F8EB COA3$
438,344,447 *2C6AC2FF548AA368A8A9A9953AD448EDDA6A177F codetext!
438,344,448 *2C63D08BB57E4CAEF30B8778F8EEBAFFCBABB9F6 CIRCUMCRESCENT
438,344,449 *2C6228321DC91D18EBFB6183B44A4BCBC491EC56 C=J4;
438,344,450 *2C6E2EA3DA1FFBB4EC57321BED9D342E6A8A805E c;kr,
438,344,451 *2C6D25D3AD80862C2DBA9429BE14CFE19C203C3C C%L.
438,344,452 *2C65B11F5ED05637C411BC8C9661440AF9C24E02 VARVARATZAM
438,344,453 *2C60158CA85576485413FF8C3BEE7DE2CA12FAD9 ve]
438,344,454 *2C6D1C065C210D2908B8A09225BF6A89625A4EEC COUE
438,344,455 *2C65CA71E3623792FA3AA17DE334BE03AFF02EA4 COVERCHI7
438,344,456 *2C6E054728CBB98C2C0CDC125F98A8F6E832D39B VERONICA.R.BEJARANO
438,344,457 *2C60B26777DCC31655C7F56E72E94AE873DB140E VERZEKERINGSBEDRIJVEN3
438,344,458 *2C681DAFBA139A91DB561AC8424E6403B3AFC7B8 vhibernia
438,344,459 *2C6604E75915EFD3FD81691E0753D952953F7A2B VICTORIA SACCARO
438,344,460 *2C6E04ECA1A26E703EF048EF4C91EE5EE70AFCFC cowln
438,344,461 *2C6DCC3EDA6C71B37538BB0DEF0C1A89780276C4 cp!pq
438,344,462 *2C6457D0D105B50790ADD4E529C5C289374618BE VINNIE CANNINO
438,344,463 *2C6D3E09CA4D338C7EDB67851FA7CAA9FCB2138F c#o9t
438,344,464 *2C66A2167EF19859B8DD351B45D90C2CE9CEDFB4 Visa-Till-Yuiko
438,344,465 *2C64D3B0D36EF0D95BBC8A3074C0D0534A6A1502 COLOQUIO4
438,344,466 *2C66DA2EFBA1C3BECA547C0907A7C05C551B03B9 CQk"
438,344,467 *2C6D9A5CA320898B04E0751AFB9266D3B06DE95D VJH3782
438,344,468 *2C63AA3288A5D347BD8BED50DFBB32FF75583ABD CRAMP-PAINS
438,344,469 *2C625BCF3C1EC5483D8300D713B93113832A817D CRÍOEXTRACCIÓN
438,344,470 *2C6AA29F8605FAC331DD4FC78CB6A10F09AB1914 CRISTOPHER.ORENDAIN
438,344,471 *2C650DF005B7674034B15CDAE47190A17084877E CONRAD.WITSELL
438,344,472 *2C67200AB7CB22729267CAA6BD8FF65022D335CC csbsz
438,344,473 *2C60303DDC43C1ED9153424FF70654B80A9FBB09 COP+D
438,344,474 *2C626913A0E8C3931758622EDCBE3F23BE817A6D CSL"+
438,344,475 *2C6A59E3F0BB5A401960E0D5369B7A4E0632E8EB C&+UA
438,344,476 *2C6DBD32D46C0A48CA0ED9A15790C1A6076AD838 cummings-sr.
438,344,477 *2C666F5E2F115B6F12075A7D2398622D3F5C0BC2 c?pe/
438,344,478 *2C6AD989755F488758541DD5EC20D67E10FAAA35 cv7m
438,344,479 *2C62DB871AA576C7A429AF229DC360C9F38F29DC C:\ProgramFiles\WindowsMobile50SDKR2\PocketPC\Include\Armv4i\cmdtreeh
438,344,480 *2C656869DD2BC6681A88A242AF825BFAC55357F3 cxutl
438,344,481 *2C6F9B22809425AB735F3D29419B974DB578F51B cynarbsw5
438,344,482 *2C627AEF804C67F0610F2472995D68D49359AE92 watbest
438,344,483 *2C6863700826E90C95603828F73801BDA23A17A9 CqRA
438,344,484 *2C67307B189AA25660D5A27C23DB5C6A22A9FB0F czaristrussian
438,344,485 *2C63AFED64E540D00F788E1A1B88B8ADCD6DF1C3 WAYNE.TESSMER
438,344,486 *2C67939D07F56E0A809A85166168B98E9D8FC953 WE_G
438,344,487 *2C64A0560F9670196B7AC06B514A343B18ACE9FA wellurged
438,344,488 *2C6226C0B3F9D3221BA739C4331A38FD1411D10E d-0g-
438,344,489 *2C6CCFAEE009A9336B76BF7AE95F4B0E74B9969E :D-1100339955
438,344,490 *2C617851FA8F4494BAFFF8C5D58F6DCD15BA8690 CRUNKIT86
438,344,491 *2C63B4E35DA285B07879DCAA774105378DA54CFE d=2=
438,344,492 *2C6E0014CD57CBE13EB5D3F16FBA0F11B0BC0896 D"3HP
438,344,493 *2C649A0B1E5B5DF4852277A771C236437407FEDE D4PSN
438,344,494 *2C6AC597F6C7F6FAC0E6304C2C5D4FD9CDA72840 ct&vv
438,344,495 *2C6D2283273B7D73AE7830B0391FAA3E190CBFD3 whitelion.malgore
438,344,496 *2C6CE5913AD36CB951A9B4898D61934611088666 DALE.WALLERICH
438,344,497 *2C64FA31DF831726DFBA31BE2404D9969E97CBB7 curtisgentleman
438,344,498 *2C6DE88FF8BD22FBD8A0144199944C2BF9CAB580 WILEYMELINO
438,344,499 *2C68D6F7D9FAE1592E6D4CEEC9C1DCA0825CA026 CV87L
438,344,500 *2C619773C532711AB60542ED2E418675DB82FB95 william.r.gutierrez
438,344,501 *2C62DB9F40035C39836F21FFE57AD648B52DB925 WILLIE.NAKHLE
438,344,502 *2C6B858C4419AC387D9BFA725F75DC346C4C3C93 WILL WYANT
438,344,503 *2C6DCC4DBD2B99249019E10D7D339F843CBA719E WISDOM.ALBERT
438,344,504 *2C60256955A61078BEEE1A97527B51C4E4D1E4BE WITHOUT DOUBT &LT;BR&GT; I CAN TEACH CROWING: FOR I GOBBLE.
438,344,505 *2C665053542904078B89765350B566AD759D9A80 [email protected]
438,344,506 *2C6BC6982331989BC35DD8993268A6F0F0E05B5A [email protected]
438,344,507 *2C68B0B52A79AFD0C883437143F3704FB8C06B35 daron.morris
438,344,508 *2C6CFB01A03F7490990B10073888CE745ACEA1D6 [email protected]
438,344,509 *2C60546B55FAA5DBE4F8C1D75EA1488BD5C2D107 DAVIDCICORIA
438,344,510 *2C6280137E31069D1901A9C7B85447F7134DE39C d0ge9
438,344,511 *2C6102F8AC3BFC57019A188AD48B79347C349BD5 D120846917
438,344,512 *2C6E9BE9E5E7380CD2872D0C7CECC640965FA6A5 d1f,
438,344,513 *2C6D006CD0B87F08355F26A3D01B688461DD5D59 D22F%
438,344,514 *2C64BC0B02D1E6E739B9EF0569006AD53E534FE9 d)3jn
438,344,515 *2C631C4DCF04EA1ACA0DE3EC6A1FEF7E38342629 D4EO
438,344,516 *2C6CAC4AB58EFF45627B4D619C0CD4FC8543E3F8 d5pa550na7e1y
438,344,517 *2C608E275D5EEB3D16120625A639EA16EE40C3E0 DDLO9
438,344,518 *2C6BDF352FAC54D35E0E6DBDC0505A3015FB1C5A DDTODELETE
438,344,519 *2C6E2B5A66EDA7A0485486F027AD2F803BAC54CE DAGÉLIUS
438,344,520 *2C62024A6164B2B201174920D1250BB3E1EFA76D [email protected]
438,344,521 *2C63E2E5B96AAFE346F3664F097E17DC8349342D DALTONFENIMORE
438,344,522 *2C6A91912D6F1E25410C9E32ACF0F8B42AAEE4DC DANIAL.KUNSTLINGER
438,344,523 *2C61CC7FCB7AE38F89DEB8D6615B53B53951F271 DANIEL.CASPARIS
438,344,524 *2C630D737A558C5CCF83554B082C2ED99882C6F2 DEEPER SENCE
438,344,525 *2C666C044DB023EAF4F877DA7BD14047BBBF5FAF deesebben
438,344,526 *2C6382655EAD2B7A5718623247F82C8B15D9C635 DEFINEREDE5
438,344,527 *2C62F0C59E9FFAD588B98AEFE1823153FC0DB809 dekhutten7
438,344,528 *2C60F4EC44307B4CBF16C06207C063B1E1A67188 YANNISQUITLONG
438,344,529 *2C69738724C1E3390A106F2FFF1A3D3CCBE70CA4 [email protected]
438,344,530 *2C632C609444D7ACA5C8AB7025D3152BCC7A9BE7 darrenboschert
438,344,531 *2C6CCB9D28E68C3BE9EF7D32A6FB7DFAA341E4D1 darrickdemattos
438,344,532 *2C6723A4614D7DCBEF2549EF3F62EAF81B6DB87E DARRICKDOSE
438,344,533 *2C6CA36677C422B964BCD6CC399E318FD87C2A43 DARRICKLOFTHOUSE
438,344,534 *2C6742D2C0BED0D23A5D2820390EED2D0607B893 dasilveira
438,344,535 *2C6DAEB1047C58D0EC05E2EC96CC72241672494D dereklapage
438,344,536 *2C6E49066AA4817233655D85351209D6783E46F6 DE$4CR41I
438,344,537 *2C6942EE0F5C998CFA5D7AFB1C8A46AD82AFD627 DE74LER$
438,344,538 *2C68EB275283EAFCEBDAE6B02289DA85570E0B6A [email protected]+y
438,344,539 *2C6C07ADB2DA8B871439E8B56E5A0CE659957992 delbertshanna
438,344,540 *2C65AA7F23F54C4A80EA4D5C3676E4DEADECCD34 delead-d/i/'l/e/d
438,344,541 *2C69B7A42AC365A3AAE7A750338DE5BBC5982094 DELMAR.NEGRONI
438,344,542 *2C612796375276E787B7D2BBD820C17A58BCFC0E DEXTER.CASCO
438,344,543 *2C63B36E88E4DF4B4C056369CEA956A66A6B3A38 dextergoodfellow
438,344,544 *2C651B4956B8454FFA9500008F0EF754344DCCAF [email protected]+ng
438,344,545 *2C64E1D08E3E2508FDB8E9626DF5BB54C6E7A243 DEMERVAL
438,344,546 *2C6D9775B2922B924D978F1217810E0A3323DC6A densw
438,344,547 *2C60DA3C68C7968496EB44D425443B421C4998D2 [email protected]
438,344,548 *2C6520B6F4E29D902A06619CF6923839255D6959 dgo8
438,344,549 *2C6925E8B2B302004B6402062ECA2B5D884444F0 DH7M
438,344,550 *2C62BAB5790BA10225DAE3B3B30CA4454CA90FB9 DEV!(
438,344,551 *2C6643B7120A1525431A0E801F6AC82D68181875 DHK2Z
438,344,552 *2C6FA67E754A697A69B692FA4AE4EDAAEC86B1AD [email protected]
438,344,553 *2C6E06CE2DF9CCFF4758EB86ECD4E80D891D9663 DIDNL
438,344,554 *2C6E87607CFC9FBCD42F7D19AF7030F5F48216CE DIRKBUSSMANN
438,344,555 *2C6B1D891C7C85A6B2554AABCA83C25AEE4C2E0C DIRECTORY.ESSENTIALBABY.COM.AU
438,344,556 *2C6F9CDDE6243E9123E00D99EA0FFBEB67D1357C DJ5IF
438,344,557 *2C62455032CC3AEABD77BC3EFA524822EF92FABD diy3=
438,344,558 *2C62FB9287814E4F00C7D80844E0CED884267788 d!-/m
438,344,559 *2C6CEB0321E035DBAB41B42D3044F20320604FF5 DKZGC
438,344,560 *2C6D596F859F36C678D78D02101746BCCC064ADD dlwp#
438,344,561 *2C6F28CDAFB36A1AA57FB3E1A80DF73532FB5C61 ZIAME LITUB
438,344,562 *2C6C43647DD248BD693D50C88CD3154255863004 dnll
438,344,563 *2C6286D375151A0021D8ECF87D617FD35439AB66 Doc
438,344,564 *2C6E8E24813C65DF276EA1153428EF88AC227614 [email protected]
438,344,565 *2C636D09C4253F96B75739C7F7C47352B71F98B4 ZSEFA)
438,344,566 *2C6FCA5136E5C2BAFB2AFD4A992877AA18B91F63 ZUITU
438,344,567 *2C6886C2C46E2141B01169FE960F98628EC131CA Doc
438,344,568 *2C6F7B8C4E892F1ECF730CA7E02A3895EBBB296D DONLOEBAY12345678
438,344,569 *2C682E8FD60E45D7A9DB64EBB63D53F196F8C757 dominicbutterfield
438,344,570 *2C6BE93AB2C91DA2A7934E020AD8A1357707E3F1 DOORGESIJPELDE8
438,344,571 *2C6478E0FB597FB404272FA0F9A7D411811DC38B DOUG.SMITHEY
438,344,572 *2C643224D7B66F33DB6A181E64E47E495D3952F2 ἈΠΟΚΤΕΝΟῦΝΤΑΣ
438,344,573 *2C6212D4B9E49FF9DC4323481D5E17A03040B9B7 ΣΗΜΕΙ΄ΝΟΝΤΑΙ
438,344,574 *2C6E7E996B80A998F452F6A877179B2C72383862 donnecton
438,344,575 *2C6FBAB96958A46862C2D91A0B6D2FD81DD876BD donnetters
438,344,576 *2C66032B26064D1AE75A4C92E3B5AEDD09050482 DONOVAN.BEATLEY
438,344,577 *2C6B16A5A719F18F71311BE31555FAD3F02B1DAC d?&qm
438,344,578 *2C604425BFDF73642F09C1933A421461A864B6A9 dougtest7
438,344,579 *2C63C4B5A92D7F41698FFE1D5E84A9C85F25FC2E dregest9
438,344,580 *2C6AC511CA22CE8A8F8426AEEF342C9B34985E02 КАНЬИЗАРЕС
438,344,581 *2C681BD3DB88CDE1147B01D30A46CB29D448DD2D DRACHENSTATION
438,344,582 *2C6A5189E1A62D1216795119DA34EE04AEB9F82D ОПЕРИРАЩО
438,344,583 *2C6F7AC6B007BAB5F22B5929E9E01D347874A82E [email protected]
438,344,584 *2C6BCC6C354D15F7BB29EF04B047044B2C043340 ПРИРОДОЛЮБА»
438,344,585 *2C69A41F0837D4ADC8E46D681A6A4FFE3943B656 dro!j
438,344,586 *2C6E4A832A054DAA33D825F7E9A32D26B884D14E струбцины
438,344,587 *2C684835233EB05BC0D092AF2361DC2C30211E1F >dt/<retemolik.1.ot.pu>"tfel"=ngila.dt<
438,344,588 *2C62ABA11891BC8B351CA02D0DC0E286A8EE5E60 dtwam
438,344,589 *2C63DF333E3EEFD841AE33467F3A58A1F1F1CFBA duanekeeton
438,344,590 *2C64C6E07920D9900D295734C4EF15617F481A4B DUAOH
438,344,591 *2C64B8C8FABB15B2DA5832147493C22D87A6F13F DW&GB
438,344,592 *2C674B90C5CF9DC22D9963396BB4E3FA156340E8 dus%4
438,344,593 *2C69EC51E932A590B9B5FD0241FEF12E01B160CC DXNM
438,344,594 *2C619113C912AF494F1748879E88F8C8EA1B5F01 DWUm
438,344,595 *2C6A47EE2DE1819B8FC1F29D531E72040716673A DYNAMIDIUMERODORUM
438,344,596 *2C6F84770EDEBA90198715926F0D94A3CAB115BC dy-oe
438,344,597 *2C6F095F0210D0A4F5C5B5EDE19275F31AA58051 EDIBALDO1
438,344,598 *2C6E7A456EC0E6D73D4C3FF971B36A962541CC3F EARLOBETOEARLOBE
438,344,599 *2C68664120FEE0E0191A48417E4D90DCEA6D65CF ecstaticize3
438,344,600 *2C648DAB8A828F37BA930CB3CD44E7AE33D7BC40 EDUARDO.MOTLEY
438,344,601 *2C68BA52EE835A2A42FE106DCE97D70897751C24 EDWARDO.KEENAN
438,344,602 *2C67535F67DED1F3D985432023C0E9FC8FF7AF10 edgarloman
438,344,603 *2C690159CE564ADCFC5A1051CCC7CD3546AA6FDA EDIARTN9
438,344,604 *2C64F33DEA4AF2E54D0C9FEF9E17F4926AAA3882 effgzbsw9
438,344,605 *2C696169F85C5C6036932D72CAA934F02119852A efrainmeirick
438,344,606 *2C6818A179CA5BF603179E0772F05460AD7D8C64 EEHD-
438,344,607 *2C691A50BD2C19D64EB1B66F84F1CD631BC947D4 eh/oc
438,344,608 *2C6E8FBB7B540825FFE1E4789611A1579079F630 ekd75
438,344,609 *2C610F24A19825FC6FD8467D47E726D6D3827BDB ELKEAVONDZALIKAANJEDENKEN
438,344,610 *2C6AC540E751A19494CF56DF895508551D85DBC3 ELMERTON
438,344,611 *2C67A901EF280593244E044A11824E6E5B027060 ELLSWORTH.SIDWELL
438,344,612 *2C687DD9E606AFDAE7047CD37FA109BAA98A27B6 ELOY4
438,344,613 *2C60228C3D7D4A83C553BBE2A117646DF396DBA4 EMBD
438,344,614 *2C647BF24001AEAD27AB6B19DBE8F8EC9C10C15F emersonordonez
438,344,615 *2C6214F6C42920EE64363EA41855BF3CE7F9ED77 EMILIOPESSIN
438,344,616 *2C64DA531593DAD319495A7BC9A5674A7A92B6B4 emiliosteffan
438,344,617 *2C68E44A31AD6E1139769871AA2081716CB8B853 EMIRLE
438,344,618 *2C6F7B4FEFC2652466558FB1871C2F9C06038AF4 EMMANUELOBEL
438,344,619 *2C6040686F8A3F317BAF0979C4D717F6EB301B78 ENVIRONHISTCLIMATE
438,344,620 *2C6D66D95DF8FCBED0983026D0E33BA5B9ADB60E ERFOLGSDARSTELLUNGEN
438,344,621 *2C650B276F35969A55463E1099EF8B848D485083 ERGHCROB7
438,344,622 *2C642EC44BEE0892D8BE955BD88AB7E51D6C449C ERKLAREN
438,344,623 *2C6442593AE77C6CF8D9988B9DA4C61725B845BE EROAS
438,344,624 *2C61B349EB15D4BFBE25FC15652E6EC1596BDA6F [email protected]
438,344,625 *2C6973B1E3E5A8D02A5317532BE0656ABD325BDA esiruas7
438,344,626 *2C628AED8BC2946E28BC5E15251C75C66DE9F1D3 essentialbonjovi
438,344,627 *2C684D217FE0B7970769C6D6B70CD169E3B6611A ETUONNAK
438,344,628 *2C63FD595F4D6F1E90FD4C20F7AB445EF4026886 ergotic
438,344,629 *2C6E29689E0AD0A7C2807F6DBCB337E81F573316 EUGENEWOLIVER
438,344,630 *2C636B7BE5DDF1B49EBFC91F647E493288886D31 EUGENIAFERNANDEZ
438,344,631 *2C6A880618E34F3559D5FA4C1F92572007C629AC eull
438,344,632 *2C6A0FF109C9965B7AEA5F306415C31C0D37815F esperez!
438,344,633 *2C60F715EF4488449F0D4A9A45B816D9A8EE8CDA ETNIKOEI
438,344,634 *2C66F7BB8977C41B616701E5A43739CE8D19C8C0 EVELYNEDWARD
438,344,635 *2C6CF076DBEFB0C61C981F319114E0C7DEF336B6 [email protected]
438,344,636 *2C6D547EFB380A6E9EF561AA01F287DC22E88D69 Farewell-to-Stromness
438,344,637 *2C6292ACFDA257DB18AD93D1A53E37278C440321 fatiakhdinov
438,344,638 *2C630119B800256956CF16E934121ADAF29295FD fd?z
438,344,639 *2C6BCC7C0E4619D908381BFDEFF5EA678756242A FERNANDO CAVALLIERI
438,344,640 *2C68A9878E8DFA7C376238D228272A945AF68447 FFO<
438,344,641 *2C6F3D675E1BFC909B7292C45254669E1AF8E89B FIORENZOR.
438,344,642 *2C6340FD53BAB28ECE7F6D9C1F8F59C411552058 [email protected]
438,344,643 *2C6D8925244F28D9A8EEC5BAA758B1F092967535 FLA5HCU8E5
438,344,644 *2C6A5658D8ADEF873C9F3AE3E92444E75B5DC8EE felipefieser
438,344,645 *2C61A29FD33D89A8EC057660C8733F5BE375ABB1 felixmadera
438,344,646 *2C6DA9AF6FEB8036E7DCBEB6EBD2929690B627B9 fghndiy3mx
438,344,647 *2C60E0E3FBE40B1E64DE2DDBA64FC3B4E0DFE6EB 1ARBYTSUR
438,344,648 *2C69D0AAFECDCE06FD5E0F89748805DC66DC1027 FLORIN-VASILONI
438,344,649 *2C6B4890F91FB3A286DCF52E43BFB64C97F438F6 [email protected]
438,344,650 *2C646A0E39ED34F9AD8CB2944B6F838C8EE1D79B FLOYD.CARROWAY
438,344,651 *2C64036CEBF95C13AD58B7A206F24032477E3E38 1.brawlys
438,344,652 *2C61098CE1D59518337D8BD590E36A374BE29E8D [email protected]
438,344,653 *2C61989EB944B3A0CBBFFECDF59E20E7C0193F7C 1cal-ucla
438,344,654 *2C627534CFA4AA7054B15BCDE3746A054E6914DE forestdenlinger
438,344,655 *2C6C1B53A86EE925DC335E5D546D92256A453058 foretenns
438,344,656 *2C694975D2A1F7A5AE80B574554C0E79B95CDF2A 1 FINDIETZENBACHS
438,344,657 *2C6343A230F05D807AE54CECA262DA05E43A67BE fraktaen8
438,344,658 *2C691740105635F3B7A63D5A0F8B42E004AD9C0B 1-FLECKA
438,344,659 *2C65D5429F32948F2110979641C9CB8B427FEB36 1foerderationsat
438,344,660 *2C6A24E346288122B10B2157829B618D0FD5EFA0 franco086
438,344,661 *2C6204034CE1F151B6E0CB590B2BDDB6BAD15495 1jurkowska
438,344,662 *2C65BE013375ACBA8BD80DFFBD4FDB8542977BB3 FRANCISCA1
438,344,663 *2C6CC1F02AF1EB705F7C31AC092FDF04DED51A12 francistatge
438,344,664 *2C65E6E13710EB096C288A8FFC6685B5E112968D [email protected]
438,344,665 *2C659D4E9ABA2D59AE735664F1D698B22BEE894E 1kaufhausbetreiber-verbands
438,344,666 *2C65CD198E439CFC3F6735A251149B851F0DFB75 FRANKIEGOESTOHOLLYWOODRAGEHARD
438,344,667 *2C62D6FFC348ACA9FAFA0662E3D9ADD5BC6DA365 FREDERICKINLOES
438,344,668 *2C62E8341460CFBC5833C92F8D8B3382A841D7F8 frederickmalla
438,344,669 *2C64FD8DE169344E08CF01AEBED8542F32439981 FREDERICWAUCH
438,344,670 *2C66FB6B9F782584D17CC03D9064B7F646B07D09 1.LOUISA-PARK
438,344,671 *2C61B0858248E095ED4E5FF1AF29D517907FFC4B [email protected]
438,344,672 *2C63163B8095954AD42ED40F3DFED0E379CA38BE 1.MAYISCI
438,344,673 *2C67643D2E830E4A469274828405E68BA371865E fredricktartaglino
438,344,674 *2C64A372256F373331FC79A1E17F11241C28E537 FREDSTAR6
438,344,675 *2C60EACFE758F51EED3F0125DBFFAC93B98DF96E 1.near-infra-red
438,344,676 *2C666ACBCA2AA261B132A6AEA6A4836A1B283B64 FRUMENTY
438,344,677 *2C60D336702B4F9C9BE22F7F4392A337A62613A1 1ranskalaissaksalainen
438,344,678 *2C68A01D984C6D93D546591DDC2A8ED5FD8BB545 1RESPONSIBILITIESGENERALLY
438,344,679 *2C6C8C384EC2C9CD5C5695E5DD1468E361DB4CB6 fuxn
438,344,680 *2C61567C57B763F326D43802108E71E71E000C32 f_/x
438,344,681 *2C65F2BE2D21AAC8B63E4F999D17CBA2DFF853F0 1sibelco
438,344,682 *2C65C1E84E3AB928789A7E5EE6FF70B8E8B00E83 1-sytytysj
438,344,683 *2C6587610051A5E19BFD97726D5B1C642F980605 G73080
438,344,684 *2C6134B9AF389949F02BC8BA1009B9C94E6BC370 gabriela507
438,344,685 *2C6C0AA74892F1C3FD15B4EDD5171AAFF96707A8 garretpetrouits
438,344,686 *2C60CDE22D94C8BEC89A6BA5E544C0919607AF30 galaxydaniel
438,344,687 *2C61A038781E67D5A58779A042635CED2154E40A GALLARDODANCE
438,344,688 *2C6DBD30BDD456B3F3AD6DCEB7EE2BB7BDD6E93A GEFANGENER?
438,344,689 *2C64485FA79B5C2F0D03C8CD85A05437BC9F7791 1 VAHINKOJ
438,344,690 *2C6E18604F56D11F472EDC8FCF3E2AAD8A44B092 GASPLAST6
438,344,691 *2C6CB559F31C0D8F859E247C7F44F9F6B4A0EBB8 1 VARHENTUNEET
438,344,692 *2C69E3EA2F99BB3A2DAAE60142094C8526FB09F1 GASTPIANISTEN
438,344,693 *2C69E1717B0E283B8DAD01D5795BDF08E64132F8 gaudence3
438,344,694 *2C6F84E12D181115FED93957A092231F68E10DA5 gerry.swartz
438,344,695 *2C6F12772B16ECE6CA1C8C41E63ACEFFE2C3DD17 ghostkhan2
438,344,696 *2C6F9A7995BF5167A3FF3AE18BFA787C4306076E gh>p
438,344,697 *2C6F4FC121790FDF700D433F6514840C571B6B1A gniltsac6
438,344,698 *2C6CDCC1E3BEE54C260BBF7B8AEB246E064F785C GOKUANDVEGITA
438,344,699 *2C67834A1A63D0CB08FCECFBCCC95F063874D968 GORE-BROWNE'S
438,344,700 *2C67C249EFF8FBC1FEBAB886EDF8BC05670AB78B GRANVILLEEPLING
438,344,701 *2C61C453313B58FDE105C45EFB034BB32705F193 GREGORY180
438,344,702 *2C66B06F69245BB60EEE5EEF4AD111CAC56045F7 gripings8
438,344,703 *2C6A6AE6DEDE710093AF76C675F5070D77521DD0 gu171ess
438,344,704 *2C67BBBBDD58878A2F6F177A63B78539B95719DC GULDENG
438,344,705 *2C629081F31C39709D2E07D2B11F8622DAC5AE97 GUMBO35
438,344,706 *2C60775BD97AF892354D06E41F25DFE2480C1A07 [email protected]
438,344,707 *2C6068F493317FE1E73F6EEEF33CFE783CAC6E66 [email protected]
438,344,708 *2C6FFD0DB75E5D450BA9E8373B23B483AE0EDF71 GERTRAUDEBSW
438,344,709 *2C6928074D64398AF3FD40AA32BC8CD56E5E4FD8 2270267 aendertsichdasjetzt?
438,344,710 *2C6A199A76E37CDF5281F7C03BB6F342467CDDE3 ggood
438,344,711 *2C6F731C289CC933F3AEF8CBF103E124458B7850 GILMINS0
438,344,712 *2C61453B878F9915E4DF56772511E6DA785E3557 [email protected]
438,344,713 *2C678EAAEA380C0AEB955DBF37E21940933CBD7A 2486644 KOKO-YL
438,344,714 *2C61B0D41A749389379E0A8C109157DBFD8743D0 25DEC1901
438,344,715 *2C6B2E037BDC7578CA5DCE5EB0453C5BE4E08FD2 HalfIdiot(featCuttyRanks)
438,344,716 *2C666472FE33440DDC91DBD6C9013C69F38B1B06 HALFWAYBACKTOBIRMINGHAM
438,344,717 *2C6EFE057D4C4C32606EDC4F7A2CA4563D96336E HANNAHCLIPPER
438,344,718 *2C60A7836089F10F462C70D4C80F66C492908CA6 harlanhappenny
438,344,719 *2C694E7D9E36DA319BF321BD9B9089542CA1B441 2673936 muistalaittaaomatyhteystietosijoshaluatett
438,344,720 *2C65649B96F21D3E44BDCF1412EDF8CF3A4E1883 harrynedved
438,344,721 *2C62FADA29CF91E08756C02D48793EA856C274EC GOSPEL BOMBS
438,344,722 *2C61CB0727E49422A0AF1F21F57E38AD56C9D509 HAWSER123
438,344,723 *2C6794B6B27E6C3B981C98CFFA885CF9906968C6 haydengibb
438,344,724 *2C6324B6503868857D1744F822E2ADF0E95ECCE0 HAYLIE682
438,344,725 *2C626BC83DCFAF8C9869DEE2541C23EB3D318859 haywoodkloc
438,344,726 *2C6A56D284428C6A3ADDDD7AB136D352461D6203 hcsigam
438,344,727 *2C6E24E9B91D05A561A4E3311268D6E7D327163F 2.dieziger
438,344,728 *2C683D8557652DD371C776749C6EFD0D72C39AAA gregoryhazelgrove
438,344,729 *2C6ABCDE0B30C4018BD4F22DEE3BE4BE9585F171 HELENBOWDEN
438,344,730 *2C6406824DD1DC646DB0741CCBE99972AADF658D 2-info-laden
438,344,731 *2C6FFE16BA8DA83C3B0E6E83D3DA89E31D66D433 GSANNOUNCE
438,344,732 *2C693DB091B0B35C69DDB7848E8043D5B8324108 herbedgar
438,344,733 *2C696160F3EA512180B7EE758CBC455642E9BD81 heribertoduperry
438,344,734 *2C68319CDC37F43D533FEFBE13468A90F482D96F HGUOROBRED
438,344,735 *2C6D90764A2DADBFBDCB790D2596276297DFC891 [email protected]
438,344,736 *2C698829BFEEE95BE9E11B79B6951C765FB3E855 G+ZK
438,344,737 *2C61EB430AD45A42934B4714102118B2AFD7A398 2.welex
438,344,738 *2C668772D4907B32CEA1E1E42AF0AD0241A20698 31-caulking
438,344,739 *2C693819C3754EE123F2F2683A82110EF9D1EBC7 [email protected]
438,344,740 *2C6CC008D351C23CDA3D61716078FF6581286ABF HOSEA.SEEBACH
438,344,741 *2C6EAA385C46C929ED85335FD4C8A9DC5FA6C2BF hotspurs
438,344,742 *2C66DAF54BE75CD07F1BFEF782F71485AC33BD64 396GENEVIEVE
438,344,743 *2C6B84A13B56211EEF51CCE830784AF95F9D2C1C HALLOWSKA
438,344,744 *2C6B9E6286114F339A05315BA51739720817F577 [email protected]
438,344,745 *2C6A11F6F8B58DB8C9D6BFF74C2D8A10E0EC87D6 HSINORD1
438,344,746 *2C663909A76E2A0FA4CD064A4CE0147C5F570832 3HAVRNES
438,344,747 *2C61F0882F9291B096641C1E724BBFB2AC4A85FF [email protected]
438,344,748 *2C669F87101B9C220BA7B9A6D1FF66A5BA0B2E9E harleysheeler
438,344,749 *2C6B6850390AA692FA8319F5461A7B9D4DB14443 hugem
438,344,750 *2C625EA67589B558D5EA0C04D3492FBCA5ECED9D HAT-MEIN-LEBEN-ZERSTOERT
438,344,751 *2C6D7B904F7569B6DDBB88471F37614B732F476E 3SMEEKDIC
438,344,752 *2C67AAB756B06F488CA3B653A91E2C70D8A990C1 [email protected]
438,344,753 *2C616FEB5563FCC6E696ECD4F4360EA423710098 HEALTH.MSN.COMHEALTH
438,344,754 *2C6C9FF348AAAB2689BABCAD41421D0E428CC567 HEARSHN3
438,344,755 *2C6E641315A58A19868BA02FD123B2A0032769AF 3THATTHANKYOU
438,344,756 *2C6DDB2ADFA5A72DDAFE4B657B3A7159871CF69B Hej,-Mist
438,344,757 *2C6554EFB3728050C928266534904414A654CE44 424marley
438,344,758 *2C683F9B2342DBB93DA8533D280452EFE26AE170 I,BADE)
438,344,759 *2C6495D6E927D9E480037DB9095E153017165207 ICHORS
438,344,760 *2C6B4E136B82886E3A81E5B785A3FCACCB3C3A8E hesperinons
438,344,761 *2C65505F324BAB3F7D0D92B764F5B53863EB9E05 hfuture7
438,344,762 *2C68ACDA36E5EE5CE0B0F28AD73959B9A1C76AA2 4DECLARATIONS
438,344,763 *2C60A3D0B338CA4C037717A6BFFA7B2792893C3D 4HIGHLYTECHNI
438,344,764 *2C6A9AAC2F8F9C3A2CDD1C687131BF21BC58084C 4 HINWENDEN
438,344,765 *2C6A541118B22997978CC23D7391245B771BA908 4 HIT-MEN
438,344,766 *2C640A8393A74BFE69717394B0099D2425D502B2 4KRISTINE2
438,344,767 *2C610809636C6AE6588A27FCF4DCD6A166E4833E 4PETERBERNARD
438,344,768 *2C6B6064D84D29806294A815D2E9CD7A17CFB8DC 4PREVAILESBSW
438,344,769 *2C6C028309712F26069B3E921EA88E7A78767110 hilarioodums
438,344,770 *2C6A3EE13D334D8D99CD31C005C536BADF577BD1 IHWYROVI2
438,344,771 *2C6EE710D2E6D5EB7F4179F08CE8D7A644552B40 4RIKFBFCNDNFH
438,344,772 *2C6AC8FF2528A3F06D0E7E24F32E38D1863841A0 hislaized
438,344,773 *2C6124470DF1705D0F61FFCF905917D647C047BD 4SSENGNITOD
438,344,774 *2C672670865B5235C8F3C2ABCF35101FF4F7745C 4TRITST
438,344,775 *2C6F2958ADCF169B3751EB52AF8729E6B07C7EFC 4WNENTAILEDBY
438,344,776 *2C610D7B2B22C91CB2E5AFA7616864C9AF9B0B69 514028 YELLOWSTONEWASESTABLISHEDASAPARKIN1872.
438,344,777 *2C69B5319305D4BE7371EEB18B7E5460C3184830 HOLIDAY.GULF.HOMES.INC.|.UNITED.STATES
438,344,778 *2C60DF46320D97402F0624B12701285389C63686 [email protected]
438,344,779 *2C66A08DDC2CE1212E49DF1BECE35669CF7B3E97 IMHERO
438,344,780 *2C6733CB660F2EDBEA07BF38310809319BDA8860 houlett
438,344,781 *2C63A0AA2C7BC47A97CB2B71B7B7C564BC8D8355 [email protected]
438,344,782 *2C6AAF037A43B510D77C5E9F3CECCEBAED57579E [email protected]
438,344,783 *2C6B64075D263D3AD9397562B060EA3BEED09C89 HRIDELING
438,344,784 *2C67EFB59E59CE55A41A223236766E55AC60CD52 HTTPWWWW8LOSSREVIEW
438,344,785 *2C6FB95A7CBC50AC6FCD882A3B2C78FA76A0DEED 5IHMISKUNNASTA
438,344,786 *2C6466631529596E8A0C448E1E4A0E56058F9873 INTERDALE9
438,344,787 *2C63B3D14D6509ACDF4EFA89F1327A6EE3B0EDBE INVRIJHEIDSTELLING3
438,344,788 *2C6C0544F0DE26795FD50073D9534A01FD9BC2BB ipniy
438,344,789 *2C61128E0E9358CB552653600E89F2463D6BE268 iranitruralareas
438,344,790 *2C6E74928B964846BA675169E5420D2559769DF7 humorous.links.4
438,344,791 *2C6650A4E4A6B3D123A26C94C310211678E2DEA7 5PROPORTIONALENS
438,344,792 *2C6B46F9C1FF72C79D2660FDBC9D46BFAAF8E00D ISREAL.STAADT
438,344,793 *2C608B219FC13D9255046F24CF7D520E9F79781E HYPNAGOGUEI/HYPNAGOGUEII
438,344,794 *2C64FE3F6485CB09845E80BB3856DC1F918C64D9 5SPITFIREJUNEBUG
438,344,795 *2C6245317BC0921257E5F4957359CB15693D6188 ivoryrebolledo
438,344,796 *2C674C4B562FFCD8BBD700261010C05AF48034DE JACKIE.SOUCIER
438,344,797 *2C6D79305D0CF58BC1C8F857091B98C415AF9778 jacquesburg
438,344,798 *2C656AB7C7725BAF7517A1ABDA38466CE7B2A3D7 JAKE.AUSBROOKS
438,344,799 *2C61DC8FD50A6A1E58C6C679387FB9DF941E0297 JAKUB.DROZD
438,344,800 *2C6018E559742FCDE6ABBE63C4A95E29F8CFF939 5TRAFELET
438,344,801 *2C6EC4F268F44D4150D366C8F8375F821EB3E860 iamservice70
438,344,802 *2C65E969AB6BACA3F0E4C48876E3C2461519ABCD ibererei9
438,344,803 *2C698807186A4944ED4A75CDD95F7D101C2580A0 JAMIEMAPEL
438,344,804 *2C655E8ACE0E4F52EA8CE2AEC8660152AEECB4A4 I-COVER-THE-WATERFRONT-[-1]
438,344,805 *2C68B284C9028B27077DB61BE3F891E494E129DA JARED.RATTERREE
438,344,806 *2C6D652EC50C41F14E8B7B2629D031310501E412 IGRAVURES
438,344,807 *2C6FB9CE4288EE59EDFDF550F9D55B790400D441 iguessihadyourleavin'coming
438,344,808 *2C618CAACDA35070354EF9CC31C79D5B0478A2FB 6BOGGINESSES
438,344,809 *2C6959BA0D2B41B670C61614DA0BF0E101EFAAF5 6BOOSTERBASF
438,344,810 *2C6AC762375110805FF630BDDEC484613023CA1C Ihre-pers
438,344,811 *2C678BCF80479323D0754BCA3B1C7E3FA1BAE9D5 6BOXPOWDER
438,344,812 *2C6BD5A5AE413C84348BD6724CABBC9FD480144D IHSUOKIK3
438,344,813 *2C6358FF2805DAD377C956921A7E7525317F2B9A IKARUSME
438,344,814 *2C6A23DAA0F4C3709852D1C21A9FE86C5B90EDC0 ILLBILL187
438,344,815 *2C60B49BA052697D20C75A9958B7C01F5492CD34 ilndcbswing
438,344,816 *2C69BC8AA6D4683A6623A024B8FFC2BCA487F19F 6EEHCTAHA
438,344,817 *2C669794B8071851FD22D30EB33C2B9C11DB8C8F 6ERFSDIEB
438,344,818 *2C65A5E3FDE445B093F86AE0D1EDB006C020EB37 I`LR
438,344,819 *2C66F5FE58BF7747C6498F9E5C9ABF530EB95523 imier
438,344,820 *2C618DE5A67E7E03D556C3912807EEF63A1D176E jessicamattocks
438,344,821 *2C6C90F6EC04DD5F62BC13D6AC942F00B2A023B5 In-Fondo-Al-Mar-(La-Sirenetta)
438,344,822 *2C695223B21B227137FB813983248C47C5210463 6PSEUDOINDEPENDENTA
438,344,823 *2C641813E2D786AC397AA5F9A3D792981CE16061 6REKAOLK
438,344,824 *2C611D300F8E812AE4C9DCC8752ED44B51CC7C52 jgjqdovq19
438,344,825 *2C6100E8FC694DDB2A46C5883C05798FF3682D97 JICHIKU1
438,344,826 *2C6287CD141C9C48190A6B80B6796AF21B591D69 [email protected]
438,344,827 *2C63B50CE85836FAADA290CE42BD7947322A5066 IORAS1234
438,344,828 *2C646749D738FA7E595595FFE43DFA301B50E6EE 6thatpaint1
438,344,829 *2C632267C85A1AF7AD6236204B99BAA05D8C2B31 ISAIAH.BRUN
438,344,830 *2C6F2CCA3A8EFDF3F470D3966DB229AB8CAF9DB2 JOEY.HURST
438,344,831 *2C6335932214BD1B9B5906665B1714D4782296EF JORDANBOLDING
438,344,832 *2C6212A9A850FDB82C2037587BFA6FC333378127 ITALY
438,344,833 *2C62398CA3E693AD225B5C84D4925609C46FC13A 77CANTER
438,344,834 *2C64FF0E2870FB42E1891CF205E60162E53CF365 jackiemeil
438,344,835 *2C6EF7CD96047D791FEF258643BAE271910E369A JOSEF.HAGIE
438,344,836 *2C6A1F640FE8F1470EC2EDFA5788BBBA37F09D60 josephbernskoetter
438,344,837 *2C6EC5A6CD05D9313EBD8E6910CBF304503AB41F joshhessler
438,344,838 *2C6DD096A9E69893FF3A69390CB8FDF71CF79C29 JADA SINGLETON
438,344,839 *2C6135B706A2FE1EFCE39F5FB5CF463DCD5B87E5 jade671
438,344,840 *2C629B2E8F5F4D53474A7681ED44AC3228CA3E94 jung.wu
438,344,841 *2C62D520128DE2420DBED3D1E9C598131225C7F0 JAMES CABARAL
438,344,842 *2C6815E83D79D0E9EE1E6877254E3D659503747B 7ENAKTER
438,344,843 *2C6407FA7D82797413765C1B3CFD01AF97E106CD [email protected]
438,344,844 *2C6B31F802F31CD62869D561683442AAB5008ABF 7ESONREDD
438,344,845 *2C6249CD121C1FE3D5B5A038FA6F3F0A24550A10 JW-FIGUEROA
438,344,846 *2C63A77B3F7B965CA5F8FB834A9AA058B64BEC15 7GRAAPERS
438,344,847 *2C6C371819102CB464E44768409E9287921D3114 7PHTCHRNGRPHC
438,344,848 *2C6B4B0F7A0B5A38A3B0DBC3FB02D5117874D88F JASONJAMWANT
438,344,849 *2C6F31E74CB27E480A5AAF161898A562D53EEA7D 7RENONCEERDE
438,344,850 *2C6DE0A7E19CF77A6CE0FD0DC10CF155DBE0CF85 JAVIERJECKLIN
438,344,851 *2C628FEC392D2D3618B194A2F91C7FEA8088F25E [email protected]
438,344,852 *2C6F35C52B371747A25E5819456B180EF6C468B4 7STRNGSSKTR
438,344,853 *2C6DAD9B4A4B1277C78EBA5103129295A8635A7D JAY對於名車的收藏和豪宅的購置,但其實他本身更對於環保有相當的投入。除了給
438,344,854 *2C64A8526B2BFB3B22062FC16786778C5636530E [email protected]~-`-(>_0)
438,344,855 *2C646C3EC823422BB9DC543039DA978E1B8C18FA KATY TOMS
438,344,856 *2C63E97B96E858D54AB1EE1B52B1D434FF6684AD KAZUMI-ITO
438,344,857 *2C6F00E185C402A22811E2185BC0E39A47F1108F KBAS
438,344,858 *2C667135700052FFDA4F1A91D40374C6509E734F JEFFRYOSENTOWSKI
438,344,859 *2C6772DF3016341780B9120BAC5F1BEAF0907CA2 KDWTRKRS
438,344,860 *2C66AB44F937D6320A51F6E535351D279B3100E4 8 DOESCHEN
438,344,861 *2C6A9B9D4EEC1AF717CB92656BB84A1F1F9B1478 8GARDENPARTIENES
438,344,862 *2C63ADF9E8C02CC2DC802595B4DBE49041351BC0 JERRELL.BOPPRE
438,344,863 *2C6E0D1246B57BF46445FF37240D59A4CC29DC02 8HOMEBREWIRELAND
438,344,864 *2C6B6F0F416355CEBBC6FB48AC493FBDC0F89AD5 jerry.baldock
438,344,865 *2C6C279F8FF06E6F6977C1095CB55A48F04E58FB KENNITHMICHALSKI
438,344,866 *2C62F3DD8F9CA57524DCBD9FB313CE85F0CEA174 KENNY.BARR
438,344,867 *2C6A4A39DB4805B1DCB95FCCBCF6095BBDC94164 JESSICA-JUTRAS
438,344,868 *2C6AE53384129305DCFFA39B5A3919738AEAE8A0 8LTTDNRNSM
438,344,869 *2C64D9194506FE086AB6F563D41E15FBD1236784 KESHAV-GOSWAMI
438,344,870 *2C6154647BB22611C48F9BB83CFE7F81E8E86C87 jewelbrakhage
438,344,871 *2C65BE0E11F4D7F706D8C5EDB7DF579D3B791A9D jf%b
438,344,872 *2C62EFEE042BD9FB24C2F40C97E97B60B78402A1 8P ~O ~O:P
438,344,873 *2C627B9EF11DAE6118CFB6AB651390579D2D3731 8QUALIFACTIONSBSW
438,344,874 *2C626BDFAE6A8DAC192A86091F5AA3FEF698F35B KHZU
438,344,875 *2C6A6F86B27800FB3E2A595C7635BD1D97DEE896 kikeses5
438,344,876 *2C6D6D8BD43E33DD3EBE08B765080FB4166100E7 kimkie
438,344,877 *2C68E710922DFB624CD03552E3CDE3B9A08E3349 JIVE/TWIST.40BPM..THE.KERRY.TWISTERS
438,344,878 *2C6633D36073B525A64E4297F79DE17E794D8327 9821neを登場させ、全シリーズの9821化が進んだ。これらは従来から「
438,344,879 *2C63F026D4B001E0C0D600C7BD9A3CE9233A9A29 9AGAHAJA
438,344,880 *2C6A6F13D9DFBD135D697EF19F38B5C0349152AC 9AMYJOJON
438,344,881 *2C6D85D5E8F323870D8F1102048C6496C7F667FC JOAO VASCO GONCALVES
438,344,882 *2C6D9E7F37E492EEA1E2D066FB218E76B84474DB 9dec1985
438,344,883 *2C6AB50F32433566E6ECD07A326C1483F94723D0 JOLENEHAYNES
438,344,884 *2C671A7CB18316E11758A55D80FD8B7E37934607 KOVAKSING
438,344,885 *2C6A1F3B4C72C0430DF565E2F340CB13E2A0CD4F 9RAINETER
438,344,886 *2C604835C8F2F9246E2B8C0DE74E8CA0752276D6 9SCARLETCOUGAR
438,344,887 *2C6E7816901F60D5769861FD9F2D70C45A473EEC KREVELJAS
438,344,888 *2C641E3237B42FB64F26FA8AEE4BA29779BD7186 kristoferrettinger
438,344,889 *2C6465306426780D5C96798DCA549CF318C10295 9thefred5
438,344,890 *2C67290CA8F172C234B80BA4DDBEA9F7B7DD85A2 joshmarengo
438,344,891 *2C690721CAD6B21016A36997FA39700972004C25 JOSHUA.ROWTON
438,344,892 *2C6869EBBB5C0EB545BBEB139E9E9866C1F0E55E JOSIEDIMICHELE
438,344,893 *2C628794F0DDD0E1879E5832CAB862AAE73756EA 9WICANDERS
438,344,894 *2C6DB55EFA30668D5FF0D46D6836927D728C8B29 kuchysk1
438,344,895 *2C67A2B530F54D6B38DE7398429F987F8B31C79A A2C8C2CC76813388860A1B786D3B46AD
438,344,896 *2C6A640DE540D60CB8AB17B20C1F4AFC1DE6BA71 A3DE
438,344,897 *2C6C5618C396B52A20E06A193F4E90B6E021E695 juevessanto,3rdnight:eramquasiagnus
438,344,898 *2C6B04DF42546C4EF03FF22125B7CF57278F939E a6
438,344,899 *2C601C81E62281FE00BAE27E05D21CF27C127942 (JUSTANOTHER)JUSTANOTHERCLICHE
438,344,900 *2C65815E6A54D3C8B43F2711FECC22B89AB14B63 aaa]")
438,344,901 *2C6B8F4B29B2CA643982A3C3DBC1233893094926 AAAMXT
438,344,902 *2C6BC2B61DB98F84C4D5284090734B295D6661A2 latisha.mohammed
438,344,903 *2C66C8B328E51C078F7A267488562B6D3497E7AC AAE{6
438,344,904 *2C619B884AD3A278E9D7AC24F01A9C33A908BDB7 kc/$
438,344,905 *2C6135AADBE144B7E23BCB55E9D5636386E0AD51 abdulherskovic
438,344,906 *2C65249FEA6687B4C2ABC9367FAB6CBED6B9A52D lehdist|poliittisissa
438,344,907 *2C6042CDAC3AE14408F89765DF9846278DA0C236 KENNYHINKEL
438,344,908 *2C6200E4BD543D6A78633BD39BD56094EBEA27A1 LESLEYMANISCALCO
438,344,909 *2C6EE116A98D8CE78B9EA10B7E3547C5AD7CE955 AbZ#
438,344,910 *2C6A30579212444759312FFB3BEC6B6C6C64293E a_ca%
438,344,911 *2C6478F4F2C054226E622667BF8FAAFF9D68769C KEZWBTN6
438,344,912 *2C6BDA0B66E40CE206AA911FC53AD213034C24F9 LEVERS
438,344,913 *2C66F211888FD3BCB957822E83160A51FE54623B KILFÖRBAND
438,344,914 *2C66A7CEFD421E11AE80B86AF007BF57529A4CC0 KIMBERLYDEMETRULIAS
438,344,915 *2C65D455D045F46ECF4F3E05F8F4ADBD4C5AFF39 KIP.BURIS
438,344,916 *2C6490D3547DF2E5D98BB36C47B40B110B76F926 ADALBERTOSCHWOERER
438,344,917 *2C6597660B4ACF6AAF040CE4F8844EA957A52A21 adam.colquhoun
438,344,918 *2C6E6CCA8FE348E3CE436CA01B6AC18DEA21DE60 [email protected]
438,344,919 *2C656E8D47681F3A7DD407FF69611DC2AFE8D03B KLEPADLA3
438,344,920 *2C6035CCADA39144A6EB59418BAF7BD4258F99B3 LITZELBRONN
438,344,921 *2C6D597D3153837A5043FBA979E2D529C986CF9E LIUTENGROU
438,344,922 *2C6B7AAD8D936C0B1B8BBC1C745835C19BA9D803 A?)E-
438,344,923 *2C6AEB0A46662A75AFD778AD858FDFA5CD367311 aeo+-
438,344,924 *2C65C10D7A4C8B7741B246ECA2348E731A754478 AFSTAMMI
438,344,925 *2C629F5D2488E8ED8E8FCD1495130496A440859B LRDUS
438,344,926 *2C6717A4712456FE973B34B4BFE0BA69610765FD LROSZMAN
438,344,927 *2C6480CEE0D8C8F54675DA28904FEBDFEC6A9DD0 [email protected]
438,344,928 *2C64057E8B0166B703FFC4F563E2B93FF4CFF1FD [email protected]
438,344,929 *2C600EB92073E2CC18712E8EA92F518E7A2817AB LUCIUS.HOSANG
438,344,930 *2C6C280C88385B57EE8C27C4B8B8847D88792A57 kundulun
438,344,931 *2C6127D1DEEDDEF1E3A3E9BD56BE56E0CF604E23 KUTUMWA0
438,344,932 *2C6C5E0BA8E463B5AFDE2CBED3120188C2176B13 L4RC3N!STS
438,344,933 *2C6331639C490B7F001A032BE27A62CBFB8956C8 LVNGWHTP2
438,344,934 *2C68866AC3ABF59679571EA07140D254C4A92457 [email protected]
438,344,935 *2C64CE32F78272F90739134C559DC283DAEF40D1 AHMAD.LECONEY
438,344,936 *2C60ECD609FC9F9B3CB0646F91D2A59D7A8A26CA LANCE.CHRISTLIEB
438,344,937 *2C63BF1758A0EA70B8A74CE2DD38565F15751538 AHSORKUNA
438,344,938 *2C619C53E79C9EC841BE48BB4CB63A3400F90E0D [email protected]
438,344,939 *2C6A8DF930887233A709581D9447B5FFC55401EA AJ$FB
438,344,940 *2C67B4335D987877255E8987FDBED50C92321181 latestdataoncashforclunkerssalestradeins
438,344,941 *2C69FE322800F0136CF71231F1331B1843507A40 LAUFENBERGLAW1FAH0NBER0G
438,344,942 *2C69EDC51BC3265D0BF56E133DACED49E4E92FFF lavernebohmann
438,344,943 *2C63A5FBD7A247D9BEDF84D117CC5BC70C97C321 lavernmullett
438,344,944 *2C6D51AFC10C96778A4213F8F4F0003B220B4A0D AL?+
438,344,945 *2C68329E3FF75BE4F2581FAD4A05A9330998B3AD ALEXANDRAPAPAIOANNOU
438,344,946 *2C6DEBBA0BBB7AF4D56CD6A027C8C0AED8A06532 alghamdi7
438,344,947 *2C615342CFB3BF79C4D18BC40D123D0FF005375E MANUEL.CHHOM
438,344,948 *2C6236CB89126283FBC2FA61B7319D92551584AD alicerarmos
438,344,949 *2C6F608933B3D63C33C44312712C6D2B27A8EC37 ALLYOUCANBEAT
438,344,950 *2C687C3BABE01A1E6EB017A5FC9F871B9581D192 [email protected]
438,344,951 *2C62767951B843C7EA91BA7057C8E1D95458B36A alzw-
438,344,952 *2C6D0A591F21CDF9694B2EDC308C754DD2B8C7D4 markcorriere
438,344,953 *2C6118C0E809D3D79DBB2BA610A20231F13FD040 [email protected]
438,344,954 *2C6C659DD5045F4F7F14FC60A21E486E05D6EC25 [email protected]
438,344,955 *2C6246D46A3190CBA6CE3C8008B2612962995D01 lifeisdangerousenjoy
438,344,956 *2C6D04CDFB22297C5CC3B68FED9114CA3A275831 marques763
438,344,957 *2C6C9DFB86DBF640CB6D92F6BAA51A95456ABE26 amx&q
438,344,958 *2C6D084218D56AA9F0141A28F9AF98F751DC0EC6 [email protected]
438,344,959 *2C606246719897ED0A051D43D989029FB5EE8537 [email protected]
438,344,960 *2C678EFBF91AB952046235D04A997319EB1D3321 Lincolniana
438,344,961 *2C604649EC2C9AD4C51C1BF0CD3E5D67BDB58A4B lings
438,344,962 *2C67B97C895D933B4E7E00C536849E1BF2B82176 ANDREA.GANIS
438,344,963 *2C6F87876A1022CCA0062A9056D49B83022C5724 [email protected]
438,344,964 *2C6A27656081785DB36989830E6FAD72E55090FD mastersofstatic
438,344,965 *2C61ED37E4D7ABD361867225F52094B75FF1DC28 andrewrainis
438,344,966 *2C62D35F02A028B22FF72903858BF491742CFCFC ANHEDRA3
438,344,967 *2C645693DFE6F7D13F6077CAE7C0C3CAE91F9954 L'ombre.descend.des.cieux
438,344,968 *2C6093B6E889E6D0846972483526DA0788D13940 [email protected]
438,344,969 *2C639F905110AC1789673725D549F8482D4A5DAA ANTHONYDETERDING
438,344,970 *2C67C6C095105587341B36704BC56A663340FB41 meetsnoer.
438,344,971 *2C67C6BB47B954B6F8B1D71BB6798DBB09F69A97 MELLAALLEM
438,344,972 *2C6C6B5D680A565A1A7A76CFFC896E492D82047D mervinfausnaught
438,344,973 *2C6C05E732E907A72A65C8FEEA9ECFC8531433E0 METAL: A HEADBANGER'S COMPANION (DISC 2: GRINDCORE)
438,344,974 *2C6D904F7DE4A95F6FC6706017EE180EB376DC59 apartvaticène
438,344,975 *2C6FD085554900C0AD222A934BC3B3F9D72CF0BC APRATAMAA
438,344,976 *2C60D8AEB91CEAC4C8C537D303731DA6D4DBF0A8 a-promise-to-fullfill
438,344,977 *2C6C5D3F577A1B55A78F4853C424C24E974A40D0 APXOS
438,344,978 *2C6B162338ED200892378A05007E21BE663425E6 LUIGIDISTAD
438,344,979 *2C637E5EDDD18D9FEBB74B474FB322D4AE3451FA luisamiller-"ahluisa..."
438,344,980 *2C6E41DCFC73DEE5F508026B3D50D137509D1CBB AQSD1
438,344,981 *2C6D7A3A1064E78233BBE7DDD6B3AD396620A10B MIETOAS
438,344,982 *2C6AA2BE6896D9B76782BAAF6164C288EA32DC4D LUNTTIS8
438,344,983 *2C6E445158989C2109624330C8C5B8018FDBCF95 lur.azpiko.ahotsak
438,344,984 *2C691BA62CF969652D41D4112680D7C1D2E98858 LUTHERBEN
438,344,985 *2C6F096BA340EA193A0F29831DD396033B536ED0 luxati0ns
438,344,986 *2C6E7237028357DE287C6295E2CA19CC841D5DB2 arenes6
438,344,987 *2C65AEB03F0FDD658D36EF18879EFADC9281A2EF MITUEHWEU
438,344,988 *2C6DD9815F23BA3399E68AD37CA17E224AA19581 M1$TUN3D
438,344,989 *2C666C3A3F3C7C5DF9FFC8DC5B6C1B14E4EAC066 [email protected]
438,344,990 *2C6720ABC1001455B710230F6ABB4487DAD14B93 ARMANDO-SAETEURN
438,344,991 *2C6D015CEF06BBF2026F99EAAB832A2E6ED6B656 ARNOLD.WALDEN
438,344,992 *2C67318BB49D4C458391889DF1F03212CC7D9294 MODEBLOGGEN
438,344,993 *2C622048FB5E13E1DBE20D6E2567AC2735D67F24 making-sense-of-the-memories
438,344,994 *2C6CB2F12AA67DF9477350DBD8FC06E31B0F28F3 maldavsky
438,344,995 *2C6CDFA4197AD564BD83D22EAABB608120EE9550 mona.yousef
438,344,996 *2C67F97DFF5041873B15D6353314D1730DEF2758 ASQWE
438,344,997 *2C694D96B90369E08AEC34C072727184BDC0CC89 monroediwan
438,344,998 *2C6EB2F47472D9A68C6D251855742A79F86E0171 manualblomberg
438,344,999 *2C68F60C6B3D0C3E83F8AE4F81A576842EDAA5C0 montykap
438,345,000 *2C6A035224CADABB3364D0E6AD4E5BBCD658A1D5 MORAGMARSHALL
438,345,001 *2C6003909F353BD06FDEED1E6D608B35ED53E777 MORRISTANORI
438,345,002 *2C650A2A8CD73F9103B79E91353FE851022275A9 MORTONFERKEL
438,345,003 *2C66D81BCA6B43562D126CD480962626B7D78AC2 MOUKHTAR.1.0
438,345,004 *2C6BA39118DFE222E63A633DDF57D826839CB5CF MOZARTISIS
438,345,005 *2C673A2785BC792800B74AEFBAF860928EF7E12B AUTOPASS98:1177
438,345,006 *2C6DE38644FCB334B990A20F7EBF698C9A443D0E MARIEDEL.FABRICANTE
438,345,007 *2C622851D90FFEE5CD7CD60DF79B28F64F21A2F3 MARIENICOLE9714
438,345,008 *2C6A47B730E41BCFCE7C8FFD0146FE78417BEED3 muerto-al-llegar
438,345,009 *2C6578C9359C1B44BA336B643FFBF249738DAA87 MYROSLW4
438,345,010 *2C6E13AD054A04EB35EE3DED6B6B8BCBD06E5B51 MATTHEWTATTERSHALL
438,345,011 *2C63FECFC4629F94D7F7420105BDA3E9FE8E9737 B1AS+OMERE
438,345,012 *2C641A25560C59B5734EEDFEE2E3431EB39F9F16 b3ih6
438,345,013 *2C67FEBDBEC479129DD8F423162E6D9F2F9CC168 [email protected]
438,345,014 *2C6180026D2B297D491BAE39BB7DA45B06E17546 maynardestill
438,345,015 *2C62BD3E7AC623725433575F4B515560E1C6F57B b7rgv
438,345,016 *2C67344D9CBD464FCC70EDC3A27A2208DFD1374A MEGANOLIVO
438,345,017 *2C6E758A0450BB0C1E9D8F7AD479C5E02DACCB6B b.8h2
438,345,018 *2C6EB912BDBD167180EAC5B6686677027EBAC3F3 b9&w
438,345,019 *2C610055CB245FC455C0A1EF5E4C6F457B908C5F babyl0nan$
438,345,020 *2C65B99BCB857832DA2B1B500B2F61486BA7488B NELSOUNDING
438,345,021 *2C6CFF1C96610281840E4CDB007C7B51EF3600CD MESSEBASSE:I.KYRIEELEISON
438,345,022 *2C6DC9013AA6F44348E6B205BE4F4D05D36BCC52 MICAH.POSSINGER
438,345,023 *2C61B5D2F33C1BA26311BE2A56345EA11C4E2DC2 BASIERDENDEN
438,345,024 *2C6F0790847B9FEEBA2426786854DD4D052C09BC BBCNU
438,345,025 *2C695FC0358CE0329E823BBC0DC1AE0E9B1C1600 NICKOLAS.QUICKSEY
438,345,026 *2C611DB29C38A7A53D73DEE3A91E22D0D4D2EE2E bbmackay
438,345,027 *2C6744A4CAEFE280828234500F59E282FCD898C1 B(DQS
438,345,028 *2C6A3D423015C42E3B58ECD4D8EF10456B70FFBF noel.strain
438,345,029 *2C6BBACD0903C8A5BDE481E03D16CDAE119C7CFE MOHAMMADSTILSON
438,345,030 *2C6C4C8DB7E7AEED68D1C60C51E2A0D56D0DDD5F @#northernmost
438,345,031 *2C666AC1BBCB1D0D6A5F43CAD058860168B5BE8C norwich346
438,345,032 *2C65362230CD7533DA8EB3D8A9BCE6E5D0F46583 nova.pertiwi
438,345,033 *2C6ECCB9EA274009B3940D3059EFABBA146B6AD5 [email protected]
438,345,034 *2C621C68B04A7851ED602CF5B664004D4AD1CD95 nqp
438,345,035 *2C664C30AED7B0958ABB7A892E12D71823120D43 [email protected]
438,345,036 *2C6DED6DB7A7EF43C244B5EF37B40102F40DB6C1 b_fc_
438,345,037 *2C69090D0FEC06B5976380B5D44955361B14F93C objedinjene1
438,345,038 *2C694F452EB85E13992814770F09423BDAFDFE11 ...-of-dragons-tears
438,345,039 *2C632DC0D93354501D48118D1A3A347CCF17D8B4 MURLINE
438,345,040 *2C6C796BBFA8011901D98B2B65D322CFBA0821B0 BICYCLEBUILTFORTWO
438,345,041 *2C6867B2F277465F5A281E5D5CFBADD9917595DD N'3R
438,345,042 *2C60A1663D0378B0152DE1F9EE6A2E202888F5C1 BIOMODAED
438,345,043 *2C69842180A44E23CC2AC9ECE3A798FA0CDB3276 nataliegignac
438,345,044 *2C6AC6C73F7013D09C437BA38C585F9790E4F897 bja8o
438,345,045 *2C64DD5521482997B2923E06FCAF3B469306A8EE B#.K.
438,345,046 *2C60D54C28051B09A367E4B6C2E2A9B918836241 orvillecamba
438,345,047 *2C676FAA066416B345B2677B16F10848BD235716 NEGUEMOS5
438,345,048 *2C67CF7F08C1E2BAE231CCBC72C584BB4CA86F91 bl.-r
438,345,049 *2C6236364C78DAA754C5C45394F69A104D808F54 NICK LARSON
438,345,050 *2C69772346D9E7BBFF8C097BB85D47BFAA2F83DF BMS$
438,345,051 *2C6E2D0D4F37EA7B3BDA71024A113A5A462B4440 BNNO.
438,345,052 *2C6E4101C65D0E4689E87D143CD98FBF9CA9F8E9 nndgstbl2
438,345,053 *2C6EF90321B482D54D7BEFB95974B5C6D49AB986 NOLASCO27
438,345,054 *2C6A3F7C28DF58D3283FC4A2FB413362BDCACEF5 nonsteroid5
438,345,055 *2C6FF3DCAC05E7836DAACB2AF49F97B536AE86D4 NORBERT.ANGON
438,345,056 *2C669F9940611951CC26BEA8BD6CD39E3F5C5813 normalom5
438,345,057 *2C6E8DD6B10B45CFB8275BCA76E3161A6B13B5CE bpx94
438,345,058 *2C6CCCF5CB44B04B4DCCF525BCAA8DFC92D17C4A NOWINIARSKIE
438,345,059 *2C61A9D69626A6FCF4C00F984FB901C240EE9DED parricide$
438,345,060 *2C67D6FD277F03E3E5584B300778DAC38A8A133D BRAD.FLEGEL
438,345,061 *2C660A3D92E92005D5F03A2BA707F7D00FB8C127 BRADLYGOMMER
438,345,062 *2C67B71F7F57C8DB324B8DF50B5E7CA08385AEE0 o4jyre8zgs3
438,345,063 *2C6886E442C13DB939AA8CE6AB59F2EE0B6CE1DB BRANDENBURG CONCERTO NO 5, I (4)
438,345,064 *2C607F1C856A0CFD18E813FDADB8C0CE42A234D1 PAUL MWAURA
438,345,065 *2C6684F2F1F881724E58517990903F50F0AA666C [email protected]
438,345,066 *2C670AACEB9CAAACA9A1C88D6BAD0ACBC88B2E7C briceglowka
438,345,067 *2C640B00C699D489132E3E052212B6DEF4A105DB P#####B *}O{
438,345,068 *2C6BCC47DE4999F9215DE07BB5AA30B530BBD20F bryonkienle
438,345,069 *2C6650B7DB83494FB0408566E83A82B53A0988E8 BSNSM
438,345,070 *2C6B454D7B2ED15F66D7F2BD59546FCACEA94E77 BT20Z
438,345,071 *2C6B9555020B3A96E19EE0DFFD66DD31D501D8F6 ONENESSWAH1NNAH0S
438,345,072 *2C64CC6F000A59319C997DCE54284171AEBC6229 [email protected]
438,345,073 *2C6797FB4C42DCC8DB5C9E956FABF11AA3DFE88A PERSION1
438,345,074 *2C68FC3FCF90206C221EA17E0D0769815AABE0EF PHDPPDSES
438,345,075 *2C645FDC6E3EE6E0CC80312978ACECB09753C7BE bv-
438,345,076 *2C67B072275F70205FB4560AF840DF047B18F006 ORLANDO.CUNNINGAN
438,345,077 *2C60A08EABA0EB4A2462C1F443B3133958D606E4 PHILSEAMEN
438,345,078 *2C662F3BA8E84A7B0EB397F268A5B030387AF6A8 OSEVNICH8
438,345,079 *2C6FC3A890B41B57D84FEA429448D7C3E7BF15F2 BZIUB
438,345,080 *2C682DE522995E2CD3637C426BB32A7275B785C7 p30p11n9
438,345,081 *2C6E640CA73A8FD0E503939110171E17A907F2E2 PLAY,-CAROL,-PLAY
438,345,082 *2C605D37D17903587F9BBF251CC40685471E5323 C5I-0
438,345,083 *2C680F2243DD9B5115F481A1ED476ECC48D274D0 C7-s
438,345,084 *2C6690FA64D4BFFD53D9EBAD04AE3A3B6C350488 c;9l(
438,345,085 *2C665FC2ECD096FA2B73695E9DB437786884C227 p#p~0 (>-<)
438,345,086 *2C66FE3D856EF07F3083EF678868B736E9890600 cad+d
438,345,087 *2C6FC4382214C1F3F80AF891F9F39AE52DE7D608 preinspe
438,345,088 *2C6980DC06090D9978A0623680165BFB1820AE06 P#####B-~0-O->-<
438,345,089 *2C68E512AC5FB4F0DB1BF9F0726B6F41877E4322 ps-im
438,345,090 *2C67D1EB58A4C21FB0E41548E630BC30F78070EB CARLGROOVER
438,345,091 *2C651A36CBC28A98E02C1186901F00A838C5A7BC caro1u$
438,345,092 *2C69875C6A5CB1C3D23E05595F2B75159A38C722 qb**:p
438,345,093 *2C694B093EB111BF3DA930CCBB2C745D4DE49877 CAUALLO5
438,345,094 *2C60C37DF09EFA9CF8EBD0DD2139273448035D27 cauap
438,345,095 *2C609578C834AAF50D01F2A70272B20CE18DFB03 CC0/
438,345,096 *2C619289F8D1336B38EC4C3B9275E4DA2EAB886B c+cr(
438,345,097 *2C6C6E208E8A6A0B3C9D38BDEA31842CA5B1FAF6 [email protected]
438,345,098 *2C6CBFF6FED6C4558E0C10C95F3A37BCB45AEB4E QUINCYRICHCREEK
438,345,099 *2C6475DDDF8C278037D5D8FBE89BA033891C55F9 QUINCYSHUMAKE
438,345,100 *2C66D425E03216BE69F1DDB5BEE19A9309F0A2C1 phillipmetcalf
438,345,101 *2C6D73A6C8FA9FD6015A5BABA4573505DE9A458A PHOEBE.TRAN
438,345,102 *2C626188EBCDE13F6B8C68244A6388C156D4588C CELNEHING
438,345,103 *2C6C99FC0ADCA80BB1B70A0D2D90D00E4615DCE4 ;~raaa
438,345,104 *2C6F6E9434EB96C14FE7483507FDF9B013B981AF RACINGAPPLES
438,345,105 *2C6612FBC767F3C1E15758199990451481B60110 [email protected]
438,345,106 *2C62FBC1441C1CD42707E9FEBF181E126A693CAF pJB
438,345,107 *2C668642907C58BBA37110B6A0AF3372DC3E2735 raja.naik
438,345,108 *2C679B5F130EA465C9A33D94E24A1F14052BF7D1 PLPETRIANO
438,345,109 *2C6C891E334FF7FD4FF2E5BD286D00E0008A49C3 CGXUSS
438,345,110 *2C655E77F00ED54F8AE31D85B5B2C463442BC79C chadwickikeda
438,345,111 *2C6D61A9C657B22AD7C403D79905B0BC771A2B2B RALEIGHKAMPMAN
438,345,112 *2C635D4D8735B8C8079755BF0909532AABE90453 PLU%
438,345,113 *2C6E92F307C036E4F2A18AEF667D3733DEB00A67 ramos6
438,345,114 *2C6A7993181B7D53146EE669614FE90C066C33A8 pogonza8
438,345,115 *2C654D5AA3AB64D4BA95FACF9485F42753BED217 pomeriggiomaledetto
438,345,116 *2C647B0FE89430C50925A82DCA50C7A2A101E1C6 pompelmous2
438,345,117 *2C692547620DEA743EB1574119DC0FB660195092 [email protected]
438,345,118 *2C691CF699AB10A7EDEB1EC70296038AF2CDDBCE ravyosefleibblochjp
438,345,119 *2C620E0736EDC3B03368B73B858DF79ECF258ACA RAYMONDCOMACHO
438,345,120 *2C6FD007967962DEE0B14DC80F8776AABB2CD7FF RAYMONDGOETHALS
438,345,121 *2C67FAC97AEF4AD84D86BC410857D0BF76C589EF POWERSTATION
438,345,122 *2C60586417FC093DE8087DA149578BC107EE484C recalcu6
438,345,123 *2C6197D27D96AE981661A2C8CD319C35D74BC2E1 refugiometge
438,345,124 *2C662E7108BEFDFCB31F796CFAB1AC45141FC2DB chillie45
438,345,125 *2C601D67CF008E8B708BACB969DC54510F700CB0 CHJTG
438,345,126 *2C6680450484265C64E101E66DF791CE9FD3D05C REISELUSTIGERESING
438,345,127 *2C63DA820C51B09F6DA95D36358BCD3A1301F063 [email protected]
438,345,128 *2C622456B0DA5A52626529F0DC761661E7975E07 chris-schorn
438,345,129 *2C68E8270EF53570F1B8863C4F550231C9953E2D chris-sinsel
438,345,130 *2C61AA5489510D9212EA1684AA631B13A0CC2320 CHRISTINE HOWAT
438,345,131 *2C658EE9B5D8CD854F2BC76F785736B5767F6A17 REMEMBER ME
438,345,132 *2C62A76552CE534A5FF7DAD837F111E623BCF983 PROKUDINGORSKII54
438,345,133 *2C6880B26CE55E060579968D30B1E9448CEB5DA0 PROTSIGER0
438,345,134 *2C6414091B6AF89AC2C04CA8A131226A478A8B60 CIQ4
438,345,135 *2C6D81B163959F81A15BA357D8C9EDE285E754EA RICHARD.HEMMER
438,345,136 *2C6AD91CBF988DA4DFA69CFF456C59747CCDAE24 ROBERT-DECOITO
438,345,137 *2C634D237D2EEACDB9A7F169665A59F7D08F2A3A robertkonieczka
438,345,138 *2C6BA9B94F29053068D22375EA83A0FE4F387850 robertoegersdorf
438,345,139 *2C6B5193F804EB2792EEDA27D46D719ABA07CED1 robertroper
438,345,140 *2C63B81B2219C1160E00268231AE92F7E939BD7E robtandruss
438,345,141 *2C66E7D91E49374748C598392862BD203D8808FB rodashworth
438,345,142 *2C6E5BF03CFB096CB012EE9E5D0449247EC520A4 RODOLFOBASILA
438,345,143 *2C6B98350B32E55FF27156857ABBE9A69C98122D pzl949
438,345,144 *2C659EF658D47A4F0EB9678B532E45445304EFC7 clo15+er5
438,345,145 *2C6638AD6E63CEF781565D22C79B8EE94A142508 ROMEOHANKINS
438,345,146 *2C6A95843BD3A9DFCDDB55E0FE1E1EFC7D37C8EA [email protected]
438,345,147 *2C625194EE8DD23A9F0C61A4ABD63F4C382A5257 RONK3DOR
438,345,148 *2C6792780D7B4A023084C1486A2B02664E556C13 CNh$
438,345,149 *2C60A920D27619AFCF29E14737889210DA406FC6 CODAIS
438,345,150 *2C63BD7B68B09C6E6BD69E67B1F6EE00EC906020 COLIN.OKEN
438,345,151 *2C6CB918ACE9D763771686E195561FBFD7DFED88 [email protected]
438,345,152 *2C62D19D8C67F2461762913B19AF9FB87B262636 RUBEN.SCHMITH
438,345,153 *2C6D3E84E0A004A2606F97383150A0894873D11C [email protected]+Y
438,345,154 *2C678F7F2344BC67820B8B8C66F307311B19C8A2 ragat
438,345,155 *2C648690F47C813894496A1E081E1C76F8F469F8 RUOTSALAISVIHRETS
438,345,156 *2C67209BD7818BE0752D676F483898229805967D RUPERTQUIRE
438,345,157 *2C6547B67160125CE2EB5BFB99FBEDDE37BCEEA0 RANDALCARLYON
438,345,158 *2C6245252BEAA81BDF3D533BB2C81AB151E7358E concurribsw
438,345,159 *2C6FD56C846D385BB3CBF5EEEA6360E96BA88057 RYAN.PLUMP
438,345,160 *2C675CD8A353CBA07825ADFF23AEF7EC4102599E RYKER248
438,345,161 *2C6A5FB19F11C8B5697222FF2EEC68C0166B12C3 SALONENEM
438,345,162 *2C6ABC30C9459A463F285223CA23D114647BA2F3 SAMDELET0
438,345,163 *2C6341708D81FD2158E8A605CD7818EFC40879AC SAMFUNNSUTVIK8
438,345,164 *2C6A776906280E271D97AAB0750B0AA6FEFE26E0 CONDITIONS-PARENT
438,345,165 *2C66F0B9A9B2520E14B1B9A2BD268A2CA3769A51 CONFRONTAREM
438,345,166 *2C6692AD72EC89434EB7936422897C7C950842C6 [email protected]
438,345,167 *2C6A3B656E20B256B5F87A54BF192E6BD3EC585C CORNELIUS.WIEBE
438,345,168 *2C69DAE2325A599DCCAD02DAB465601EDE217D94 SARISSARISES
438,345,169 *2C6A2EA3A6052D7A2021E402ECEB63D4A73F439D REDDOGBANDIT
438,345,170 *2C697AEDDBD5F5D29A4B3A05B69A5AF2D5194D73 REGULATIONTHIS
438,345,171 *2C6CAF7F7CD46D5E12BB8F1CA0146A2136797861 CP7#/
438,345,172 *2C658796B3B8E6FDD54284C74B1C9C3DCF12976D c:\program.files\microsoft.office\clipart\pub60cor\hh02282_.wmf
438,345,173 *2C6C67E76EDD0CD99196B017574A3FF0E54599B9 C:\PROGRAM-FILES\MICROSOFT-SDKS\WINDOWS\V6.0A\INCLUDE\PROPSYS.IDL
438,345,174 *2C61B3BA29674A823C7B5783E111731DC63850BA RENÔ
438,345,175 *2C6299ADC77845CDEA5450A3AEC04A293B98508C SDQCFTVGH00
438,345,176 *2C6B547A6AC2AC3A0D4F65F3B27A98378EFBC2AB CPRWL
438,345,177 *2C62BD8C4F568F0A86B0457217E9A9F3484C1649 craigsarah
438,345,178 *2C6DD6D1594B4A1DAEED3AA7AE94E639C37D7A26 SEMIHISTORICAL8
438,345,179 *2C638D4430BB2986DFB696B61F1EDD2B26E964D9 setiurcer-eht---yad---tabmoc-ytivarg-orez--txe---25
438,345,180 *2C6F63F6A7D9F840166E83E7125B4B30D36504CB CR!Q+
438,345,181 *2C65ECD8D8C0C1AD6D60E5363225ACAC3B159CFB CRYSTAL-COPELAND
438,345,182 *2C66D39557DC4B09354904DA5DE46EA850B96F54 sgomentate
438,345,183 *2C6824CABA86950005066BFA2C6CE0E1A2C88FFB RIGHT-WING-BLOG
438,345,184 *2C63CE69CDF6D21C1B7427AD8B249936E4C50F85 SHIRLEYGAPAS
438,345,185 *2C692710D015B0802A6DE31C0421C1299DE4712C CW%OI
438,345,186 *2C6530E372C7680685D15C2914E31B6028D7EB76 CZDCN
438,345,187 *2C6EC6B54A9A735324354877C1D672EB1BE9CA57 silieraises
438,345,188 *2C652B647494521771E0981DFE00B95173CF63B7 rorytobeck
438,345,189 *2C62108BA776B72393CBBABC816C5FE15FD80824 D9AC(
438,345,190 *2C68037A9D20961A435DE85AE9F058A5FF63CE2A dalekercheff
438,345,191 *2C69B9867E3755FCB25CC7ECF7C4A7F6ED7A3702 DALLAMAGNA
438,345,192 *2C6CACE4BD54FA0632C8D7392AC4047D4B3794DB sommerlehrgangs
438,345,193 *2C687BFC9374BCADECCBB1B3FEC48B913CDEBA8F [email protected]
438,345,194 *2C6B3CC6EC026FE67AD2DE052CB8D2A99F00FDB5 danpa
438,345,195 *2C66880E77C86D731C8792A268058DCE3B5B6865 RUTHMINUTK
438,345,196 *2C669DD581F37982B93C5F3634279645C894F32F DARELLPENSO
438,345,197 *2C6FA9E1BA8B71F376107496417631F0D3A3AF36 dar+er5
438,345,198 *2C65BD1FA866E68FDC78CDC085E0D1B64B14DCFD dassdae1s
438,345,199 *2C6DC188FC1A72CBA606D5BA1B09E4C2C3B2BE9D sportsariel
438,345,200 *2C663FD6DE737F3DE54AB5D0BC8EA5C92E877445 D(BT&
438,345,201 *2C6FA61F5C0C132AD26F53C60FB98E12B01ECF97 DC8/1
438,345,202 *2C6E09B39C3BD4507C10995A7FFB59E61309C81B dd"?3
438,345,203 *2C613BCF8C1CD9A71DC79EEEE18E9889DBC42187 DD6I#
438,345,204 *2C64B7F851BE01B6209DA55A4B36C8829F8790DD STACEYKANE
438,345,205 *2C6F40DC9DCD9FCD3D3E77DD42F7FFA72CB98D13 DEAFENED
438,345,206 *2C6150133D5B093753443EFB40EC6F84508E76B5 SANTO.KIPPS
438,345,207 *2C62F4BA0F978DF9FC3280259C1187646A6859B3 [email protected]
438,345,208 *2C61C3B8DDFDB90E3AD3C9BCAC6B83E34D3F1EFB サオリ(saori)
438,345,209 *2C6B8369765CA9FC5006BABA5860E955DA4E90F1 STCHILD3
438,345,210 *2C6E60B6A6C6D3752D3D8F7A5359746F2831F0EA decidor4
438,345,211 *2C65F1F95315B962223839B7A48DE41D6CBA2523 sterminatrice
438,345,212 *2C6E4BBB7AFC0AA6CF12EDED7D4D6E0A0AFD6790 STOLONS
438,345,213 *2C65DFDDE29AD8DBC3F01F8772EE9AB8663B972E SCHULDSCHEINE0
438,345,214 *2C65A2033B43454339B5A5C36926D929D2509D20 SCOTTDESMORE
438,345,215 *2C623985FF51542C5EA37B8C25B648EE217D1FDC [email protected],
438,345,216 *2C60730A3F7526185E836B3288B2194DE656D4CF SDODGERS5
438,345,217 *2C6133B10BB662F00CCB01015BA0EB97DD9E1C3B SEBASTIAN.ISREAL
438,345,218 *2C6BA8085824B6CE21A152491F71F8DB94B93F52 STWCPRT2
438,345,219 *2C64348A34A5EBC32F583CA7C14ABA5AF38E3171 SEELEGNOCING
438,345,220 *2C61C44BABB8F2638C37D1CC8F1EA56CE2B98EA9 [email protected]
438,345,221 *2C624FE4E8C3FF9B576089B1275492716925C3A4 DET BEDSTE AF DANSK MUSIK 197176
438,345,222 *2C668DCB64009D6CBCE7E39376F182D2A72D163A SENTI­TO
438,345,223 *2C6728E7A410D4A99AED33D0266C2D7265F4EA64 [email protected]
438,345,224 *2C669E273BAB7C21FF5BBE9BFCA56CAF38A91045 DF5+8
438,345,225 *2C68E38744906E1C3E6C5A7630D7679DA5541A70 d/ghq
438,345,226 *2C66A7A9008C345C0F969E818F9C9567A672F945 DHDM+
438,345,227 *2C6F694016C59466BA1351FDEB2AF2E5EA7092BB DHOYA
438,345,228 *2C623D50F857C154DF70324C1F8D6E6D4C2EA5CA dialyses
438,345,229 *2C6297B64E2372E04DFCC7140D5B97DD64DEB5F1 dickheiman
438,345,230 *2C69C9CB99D7114030E7FAF9F2FE24C06220373E shibin-thomas
438,345,231 *2C6EDA26EBFF1C76998CE801450BCEF8D273463B SYLVESTER.FINSTAD
438,345,232 *2C6210E1A2FDCFA70C381BA96F992CD86E1A11C4 shimfwum
438,345,233 *2C61FEEDAB7C7368C302D9A8680EE1AB4F506F01 SHIRLEYDANCING
438,345,234 *2C60CA77291DC5FAE4E098E78D015A99DD31290F SHOWERDN
438,345,235 *2C604892E557685CAB1126DD16171BF5EF2EB63F [email protected]
438,345,236 *2C674DDCD1CE96F21805CD1112FCF9FB280B951A dina.popova
438,345,237 *2C6050A8B4451DDBE5591BD122D88C1E423636DF [email protected]
438,345,238 *2C6881864E5E36C4A2A438B56040A2ED6FD9600D simonsieloff
438,345,239 *2C6DABE9A0BC2F6811E147414E77C235DD9BCD18 TADDAH
438,345,240 *2C670C1EAB866E616082E29DF100184B0B2F08E7 SINGAPORING7
438,345,241 *2C6579233356A432E7CCAE80C18D10384115E028 TALAMINI1
438,345,242 *2C69B355AFEAE19F9CDF6A48DF38D42610751F5D sitespec
438,345,243 *2C685956522A4A7C69B258A1AFDED196F849566F TAMISESSA
438,345,244 *2C6BF603AE423F278DD6E2A068EDD52CF26E22BC [email protected]
438,345,245 *2C6D93D7350F40B7085410B2F7954C83AA81DE5D d;m5y
438,345,246 *2C60244A012698650E35C5912123E7E20F06F10F slapraced
438,345,247 *2C629BA9560221965CACCC8D1B9DFC16FFB43EE2 TASOSSPILIOPOULOS
438,345,248 *2C62561A6039E37CED3321C85BE1230E49B20B11 dn!kk
438,345,249 *2C624814B4EFE0E2608003C7B61E02E0CAC48CF2 domingobuchana
438,345,250 *2C66CD04AE2498927AFFE9298DEBB19AC73EF0B6 DONG.FRABIZIO
438,345,251 *2C62219B09F8443D78779A2D451EB691C9D1A91C SOULBLAD7
438,345,252 *2C6AAC63E2D13DFDCFCA1711B728EDA20A0C3F12 [email protected]
438,345,253 *2C68F00DB3E545BC15FD1189AA57950760A4F0CE SOZZAIPS
438,345,254 *2C6AB2DEDB2F299C5CE50C5240394978CAB319AE DONNIE.KITCHENMAN
438,345,255 *2C65201965CB13685165D098078E03E5DAC9AD59 donnykass
438,345,256 *2C6B911F5738B766492003A02696F25F15FA90F9 THATIRENE46
438,345,257 *2C6734B28B86CA6053D142B95275DB41869D1839 [email protected]
438,345,258 *2C63C53EFBD4335E19E0EF775BEEC8E72D85DA38 THEBOOTLEGSAINT
438,345,259 *2C6609D376D36A6E9A519123DA93A0B267F7785C douglassbritt
438,345,260 *2C6B805D63E927A0333F7D454D592EA76328890E douglasyauch
438,345,261 *2C62672CB8ED43B86D8F42A5E21F57DEE125E09F DOUGMORAVICK
438,345,262 *2C67652C5AE7941DB284992C464EE67D63373F28 Splato~0~<=8
438,345,263 *2C689D131CD38606D0924C77DFFE4E4340A4AF50 [email protected]#p
438,345,264 *2C6DEBC96C4179A7F6ABDA54F474D64A0FBB5BE5 THEFAIRYTALEOFWANDERINGS:CRASHOFTHECARRIAGE
438,345,265 *2C6EDD564787DAD47F4E8ADDA5CDB9175FB94AB9 drammenn5
438,345,266 *2C6CADDDF37130598C70DE0C0ADA096FB4583311 dream-hunter
438,345,267 *2C6B8F8AECC56AD275555B20427813A5903084AE STANWEDS
438,345,268 *2C65A17CFE420CF0D778B3C1BBC2AA5AF6B824ED step-grandfather
438,345,269 *2C6649883F6173F7217648E508628DFA55D30DB1 THORKELSON1
438,345,270 *2C65FFE64A2229D78864379A08AC49AAF3545FB7 DY_(M
438,345,271 *2C6D8C3645CCC8ED3D79A0F9BFDDED072527C6B2 strandgang
438,345,272 *2C6AAE00813D90CA909BBB0E9C7BD4437FD88C3F e8kbf0xx
438,345,273 *2C698F94F062454C31408921B1C2C5C3BEED59C3 [email protected]
438,345,274 *2C6F16F3B67FB7DFE6B598300E69D5AE1730A804 ebelt
438,345,275 *2C66BA35CC36B3D4565B0DA9E31D042FDFBF9D75 SUMMERWILD
438,345,276 *2C692EDF916F8F9B4CE64CE84BD5234481CC6F0C [email protected]
438,345,277 *2C6A20006A2BEFD293A4D4834E285490354B65DB tobydauphin
438,345,278 *2C68487447A5757B93AFEC27865012FC60D74596 EDDY.GARFINKEL
438,345,279 *2C6718E7CEE7D341E493096FEDAA50E8BE28FCE4 todd.burks
438,345,280 *2C65AB9D4E95125C513481A0AB3B3321242E5534 sup3rs47ur470n
438,345,281 *2C6DFA8E3062821868DE9C8CB6CD88529D94BAB5 EDMUNDOECKER
438,345,282 *2C64ECEA4FF4903D85C01A0A47401E899CBE5C9C EDMUNDOFERRAR
438,345,283 *2C6060C98FD63607EBECCD47DE524822D73F3793 SUUNNITTELUKIS
438,345,284 *2C6B9CE43EE9628858AA5BDEACD037CD185CCA7D EDPSS
438,345,285 *2C6EC2E928FA37FB5FE5FE603C9BE90163104B8A EDUARDOMATISE
438,345,286 *2C671CEA8321CDF1C5251410AAE69CD9BEFB9470 EDWARD.CHRONIS
438,345,287 *2C6AF03455510746AA71105418BD6B99C9A2981F To.the.court.of.guard;.he.is.of.note:.our.hour
438,345,288 *2C63D3C3058AAA8C9B974D4257B1FF65B8A06EA7 TOUKASEI1
438,345,289 *2C60EAD55F025B61031E9C007C58B386D5846E9C SWIRLYYLRIWS5
438,345,290 *2C6746BECD0A7E14CDCCDBDEACECAF0F6AD763D1 [email protected]
438,345,291 *2C6CD289B2607E98E47415B4BAE01DAFAA459580 TRASEFISHER
438,345,292 *2C66BCB680F38EECA37F325248FC7921A72B3305 EIDIALNE3
438,345,293 *2C686B3D5F1EDFBA39BC3E14BA70689A73851529 eileen-mc-donnell
438,345,294 *2C6DC440C9E7E53DABE8C743CE424E0ECA57E238 TREVORHAZELL
438,345,295 *2C6540C9CEF349533CE485696EAF5F8718130C8F taishemi2
438,345,296 *2C6C73FBB4E1F626250B86A474044863E2E3C771 TALKCLASSICVEGAS
438,345,297 *2C6EF181EBE9D0A9EEC98EA1BA7E4D454FBDCF58 TALKDAJCZGEWAND
438,345,298 *2C62478D3E844122C112B5561C19A83F36EEC16F TALKJIMGUYTRUCKER
438,345,299 *2C6C6BEBEF0A74F00D01EFD2444754399F11D109 troy.lee.poorman
438,345,300 *2C6C0C3221847D4C20F6D7837FA6DC1B7B194966 TROY.PETTIT
438,345,301 *2C65F025A2742341CF67132DA9BE5D78DE6AD50E TALKOFTHETOWN(UKSINGLEVERSION)
438,345,302 *2C6F82B4A4EAEBD831C045E7BA23F923ABF0F048 ELIJAH.DEERDOFF
438,345,303 *2C6E83CDDF5E3A1CFF7D4A4DEDCA369D18C3FD08 elijahsager
438,345,304 *2C6D8EABB30AA944D7C5C32A0503511BE79FD3FD elinorburkett
438,345,305 *2C62704EE4EED01D74680757D8517F0F80927B2E ELISABETHDEWI
438,345,306 *2C628E0FF34857E103F87D984493F5748FE949EF eliseoavetisyan
438,345,307 *2C65F5057BDA962B06B66044C9C4F81B79E846AA TSIHCRATNA3
438,345,308 *2C63390618E19F6D1113497013D93F1C6C63CAF3 TANNERRORABAUGH
438,345,309 *2C6F244D689B50322982D8996447C6C91A5ECBC7 ELJAZOULI
438,345,310 *2C6FA9CA072DE10EC4DA135D485D2B8BBD74826D U!^!
438,345,311 *2C6E92A8734F435C7CFFEF0B4A45214C57622668 [email protected]
438,345,312 *2C61E13FD4EFB6995CD40467945733322BE547B9 emiledilena
438,345,313 *2C6755BB66B684244F4C1778E2D3CE179FDB32FC tet>
438,345,314 *2C69B2EA71F6207C6E8CC4A03991111E8521BCF1 emmettphanthauong
438,345,315 *2C673DC5A4BEEB56C213A87214AECB68E4285C6B EMS3H
438,345,316 *2C63B26302F8AD78DD7D816C561AECBC51DC17A1 ENABLETLSEXT
438,345,317 *2C62A25C1E5CBD461F1085817F20B5933B594199 ENDNUETLYSENDNUETH
438,345,318 *2C62BC731F1C4BF11050D5E8594859945B320D7D THE.BARRINGTON.LEVY.COLLECTION:.GREATEST.HITS.1979-1989
438,345,319 *2C6FDA5E8BC20951395A05B2ACEE8498FB61EED1 ENLISERIEZ7
438,345,320 *2C6E30BE9AF6ED0CD9813ED293FEA37A489F9CAB unconfoundedlying
438,345,321 *2C64FD1B1BDE88C64F703AE76F6CD0CEC5FCD935 the.first.hot.arrangements
438,345,322 *2C6177DE28FB62325C259AD48FF1B23A2348EF25 UNFIRMNE4
438,345,323 *2C6C59958C4DC612E106EA62AC1D5C3A4D77D973 EPF.N
438,345,324 *2C6EFC0AF841C1AF2C2DCB83AF3F76AA75634F51 [email protected]
438,345,325 *2C65A59D154E6C14194E5A1075ADA29DA20237BE erinbrimley
438,345,326 *2C62751F4ED46E5C37C551B5D9825BD84E32D518 UPERSONLIGTS
438,345,327 *2C68526DB5F5AA203B00A1F69C04311123377882 ureteroplasty6
438,345,328 *2C6FC3D393472809F62A623A5F133880CC9BC70E escovilhão
438,345,329 *2C623BD2EADE127F13E55DFB873BDC8A8CDDE39B ETAVITCA0
438,345,330 *2C6E6ECD1197E2B397B34EA4C9356D4109887899 thurmanmentz
438,345,331 *2C6F4F1AF9F2074E2B5F1650D2E5EEB7C26F3511 [email protected]
438,345,332 *2C6C4E55C1BB6E6EE753CC808B5DA7B78FE3BE23 TIASTEMME
438,345,333 *2C6F04AE3FF4F4DBCB8F1C0C0CF76CD00E0DAA7A UTORRECAMPO
438,345,334 *2C609C89605A8BF5E86652C738656B0ED427DEE7 etropxen3
438,345,335 *2C61117B4B515AA352B5C6BBC0BFF22626531509 EUCE+
438,345,336 *2C62C0B91BCBF4D4D9AA59DE573025A84FB045C1 UYADUSAYING
438,345,337 *2C6F43DB18F14F832CC0E76240EFD268B5719329 EUQITEMR3
438,345,338 *2C612A3A0CD05F8146465A741002340A0D4D5C82 eurygalus
438,345,339 *2C67DC8D3FC4748832C65994E712A9F1AB57995C VADHABIGANAPATHIM
438,345,340 *2C68EFA1D01C7DC9FC38A3BA5DB60B66540A09B6 VALENTINYOUMANS
438,345,341 *2C6E0BBCC86051D8F85DEAF939E769BA87230B0C VALHALLAFUBAR4
438,345,342 *2C67971960C5E418CC0F8CFC732AE652B35B90E1 TIULFEG6
438,345,343 *2C6F601194F7B518CCCD090BA5ACDCC3272FAFE5 [email protected]
438,345,344 *2C6FCBAD0028EF860BA1030616E3BF4FD8B05B08 [email protected]
438,345,345 *2C6B1EBB616BE7EA524EA02B2149EE9DDE18AD19 VASANTKUMAR.H.KORAKALI
438,345,346 *2C6341E66F091994A750FAB90F10592BD4A97FE2 TNEIAREH7
438,345,347 *2C69EBB567A759522F6EBC6AFAEE5192FB22B687 ƏYIB
438,345,348 *2C693E46BA847BE14C6C00B1944D6E8AADECC24B tobymcferron
438,345,349 *2C6C2C584B66B9F00FAAD187EF26E9587853A1B2 ezekielkassebaum
438,345,350 *2C69B7C1F62C00805AD3BC246AFC6A0816CDB82E TOD.CROUCH
438,345,351 *2C6939711726AB527D964360983A0298F12602F8 VBCS6TMPJDMJ
438,345,352 *2C676121FADAC01AAAF7AD981C2C7EC91D347D21 faiz.shah
438,345,353 *2C6BFC6700CBF725553780004518EBEEBE86579E TOMASTHUNBERG
438,345,354 *2C66D989C0174003C55CAC8DB4D231FD712900F4 TONY.DERBACHER
438,345,355 *2C6CE0D09404625D562D4C31F839A368C1D7C4CC TORI-PRATT
438,345,356 *2C6B6DD02EE327A43879D5569CB105A15828589F verehrst2
438,345,357 *2C6A996B0EAA4FA1233EDA3AABF4623F30C758CA fatalnost5
438,345,358 *2C69C03C89F6EA438822EB38EBDC6B0F1A2DD0B6 FAUSTINOCORKRON
438,345,359 *2C674533B81A3A68F93940AEFE1AE7B6AB2A5574 FAYANCAS1
438,345,360 *2C604F6FB5B81BE7B305E9542A63C446C0637B1D FAZ12129
438,345,361 *2C6C9B8FEC37A981CE4071AD7431A2B9D823F17D TRACY.SEEBAUM
438,345,362 *2C6FFCF306469746839EC7B870310CF0D31B3B47 TRAVISCARISSA
438,345,363 *2C6CDFF4545136AA2DDB5E4E652D75F8B9F772E7 filadelphio
438,345,364 *2C600ED30F1946F071E003368507E11444BCDBF3 [email protected]@R73DN355
438,345,365 *2C65567D217B146FC56B1DE245DCFC444A53E98C VIREJIEM6
438,345,366 *2C68440E31682A2EA32D6CD90F2EFABC6269CDEF Firewater.(2001.remaster)
438,345,367 *2C68F6370EE7F1D5E5625CAE233137585604E554 [email protected]
438,345,368 *2C69B5DEB7611BD3DBE744F18DEC51D1E835B811 triggerk0
438,345,369 *2C6776C600B6E70F21618FE0115E12C8ED048BAC FLASH B
438,345,370 *2C6DB625FAF8095F64995A38F87D8C95E79FA079 vivienneburgher
438,345,371 *2C686E0D18AA95DE45D9951B13A0C672DF2D1BB4 [email protected]
438,345,372 *2C604ABB93EB66B13A9DA2753FADAC8F9DA9C8CC VOLAJÚCICH
438,345,373 *2C627C57115AC9E8F4665B3B05F80FCA56BCC15E foca1!s3d
438,345,374 *2C603F1B8734F44B5A8866BBFBB1237484CDE5A0 fores+411!n9
438,345,375 *2C65E493DA919C375B04CA58F911AC28F987031D [email protected]
438,345,376 *2C66238424B4424250111C8F8FAEA8BB7AADF4DF TSHEPISOMOKOKOE
438,345,377 *2C616D9384CDECC7DA91C242245448938DEC47F8 TSKAAW
438,345,378 *2C67AFD94B4D8F14305835B238CB04E94CF35BBA [email protected]
438,345,379 *2C6AD01975A2CE9985D0749FDC659380306335D0 FRANCESCO GORINI
438,345,380 *2C617C5CE5B65BE2E7973A2D5D21CFC14CC98B7E vyuzily5
438,345,381 *2C6A1795BFF64FC75AF2018D9C2113DA00632248 [email protected]
438,345,382 *2C6FE508564D5CFC3365C5E722E96BEFF2E2925F FREDDY.DAULERIO
438,345,383 *2C67C7A6518C1D6BB5219C6674CD3EB11F7F6086 TVSTATION
438,345,384 *2C6391BC37AB30C0D16A19D9EAF4FBB6C1CAF87E walkerdarrough
438,345,385 *2C6951C438DF863C13B0D7DBC79A51660A482F91 wallyheckerman
438,345,386 *2C6B33BB25D0BB8C796E3F83ABA9CF10BC26F6FB wallykling
438,345,387 *2C64D781E9FA29B48D7BB987250304B367492CF6 [email protected]
438,345,388 *2C6D26CC53A472359D0ADA829F9139E271D0A0A7 [email protected]
438,345,389 *2C6F3E4857D42CEDE2CB9F6CAE60306142AC31C8 FRUMENTY
438,345,390 *2C65B7EB87F173B0192DEEF9296471FB52F30A8B [email protected]
438,345,391 *2C6CBD46B29DE3A7EFF645BFCE2721492E99937F [email protected]
438,345,392 *2C640C42DA452B9427D65F589799B76FD15BF787 WAYLON.SYTA
438,345,393 *2C6C03CC422D93337C305080D1C0D9D1CCE18574 waytoyourheart
438,345,394 *2C618E3A73D304E0CE7985186A66BCDBB7B67DF2 WENDY.FEATHERS.NETTLES
438,345,395 *2C6AA18DEB510F2910DD99C9AC2CCD76643979FA [email protected]
438,345,396 *2C646895385D49C01ADAB3F7364AFB070DEBF7A5 GALE.THUL
438,345,397 *2C659B09E9972D5C0F4923E5FFD136BEF5B5F9BE UFERE.VICTOR.OKPANKU
438,345,398 *2C69517913443C180362513777D0522A77A462D9 GALZOG
438,345,399 *2C6CD9124D0BAA94C59B3857F3AAF0796489BAE9 [email protected]
438,345,400 *2C647E205C27D1582355B56575ABDB160714FE28 [email protected]
438,345,401 *2C6ECBAF75F5D79CE4C807EECFC4660AF0BDCD45 garrydorio
438,345,402 *2C6BF4D54B438BD352CE2298AB8B9135A33FA113 ULDXARNOVCY6
438,345,403 *2C6FCB2C5DD66AF40D694D7DD7742D4E4B6F7885 why.hate.world
438,345,404 *2C65C0AD812BA4B55F6986B0A556360098B14606 WILBUR.BARTHOLF
438,345,405 *2C683144F2C0E7701A468DF20A5F897BC2438C2A GASTONVALLIN
438,345,406 *2C6D4B910CDA9C849AECC9CC965341CC5EF80757 GASTPROF9
438,345,407 *2C6C45241B2AF3B9D2919905A41323F5B0E3F59F UNCONFORMITIED
438,345,408 *2C69AD6BC46CA87AAA689B4A5023BDBB0E88257C GBROCHU0
438,345,409 *2C6C93D48EBDA670EBCBE5D47DDB9EA6514798E3 williebigos
438,345,410 *2C6A98BF85E29F0398131AB94390377BB47A9ABC R
438,345,411 *2C6978E5CB6EAEA73564E2E20F0A8FBA62A44E3F f
438,345,412 *2C60F2802951C391DC93A1E7A042FD9B80C903E4
438,345,413 *2C6AC7696C40A91EBA4E8903B3C45769C39F218B -
438,345,414 *2C6854132CEA625C33EAD930BBAB8F87254C9549 4
438,345,415 *2C6B3D2F287AC0A25682E6E42583E974DD88155C
438,345,416 *2C629173498013C4DDCFD25BE4C5304B5C91A2DF
438,345,417 *2C6DA45C18F8D74CC7B23A521845DAE2D342F74F _
438,345,418 *2C6E034F98656B558189E06E5F9AFF49C251DF33 nv0
438,345,419 *2C665280DE49BF729E34D7611483D5452E5A96AE c
438,345,420 *2C6411AC909E7412EB4D5DDB1CF22840981A8C95 Ը
438,345,421 *2C6532054BB1997AC07B1C2DB2AF97255B59BF2C Ǎ!3W
438,345,422 *2C6A174E99EB89212EF077028DB49462A2A3568F
438,345,423 *2C6A31C354A75EE435A6632DF7EBB2F595104FA7
438,345,424 *2C64AADEE4DBFC63F70F65C3C55550636133FFA1 U$O8
438,345,425 *2C670D0E4AAEF6E66441E0931DE5FC59BC1E0913 upflare6
438,345,426 *2C68CB5414A5A2285F6AEFB883D9E9E4DBD1E268 gerryheiskell
438,345,427 *2C6D5B34039E20B34D5CA0DC79DDA1C02412E6DB geslachtshormonen6
438,345,428 *2C6C1A7CCAB76783DFB3CFAAC324A763B51E0F00 [email protected]
438,345,429 *2C68A389E583323F54B72681BF1572DCD6A4836C GHOSTS....
438,345,430 *2C62A292B2CD5A3BA5B1EB6239CC9450DDCD8CF1 gideon gaye
438,345,431 *2C685E7A786D0085BAD60A913797358B968A3E5B UTVRDITI-1
438,345,432 *2C6ECC0B3832EAE0AA604866FF49FE8D8C90F209 vaishalihedaoo
438,345,433 *2C64B6F1034F738F05A5E5C588B2B2E0FB95AD90 VALKOTTKE
438,345,434 *2C66A8950F30A233C20242C8290618CF5C5E552D glenwild9
438,345,435 *2C6F521753CEF2047AE762964FD48095FBEA7F16 god'seye(originalalbummix)
438,345,436 *2C67CC8F59CAB1976087181674024197345D3F95 02-22-1026
438,345,437 *2C6ECEB3832A11C712B79D33CD51F90E62AA257E (0_<)O~(######3
438,345,438 *2C6D8B02F24BCEB9A8339385F260E588CB2B7825 0thatorchid9
438,345,439 *2C6D01C01E6021A0C814FCB19CB8CD946DD5EE44 GULLET'S
438,345,440 *2C69EEE3C98E1BB15657ADF97F147D0523891257 112926 "-but-there-are-a-lot-of-spinoff-technologies--"
438,345,441 *2C6AAAE06E2F39F6A732641FAFFDB71246A2123C 1162259 MUITAKIN.TURNAUKSIA.JA.TAPAHTUMIA.J
438,345,442 *2C614E72BCE7E2AE8FB071621AE47E4D1437149A GUSYANKEE
438,345,443 *2C6089ABB127334C6FEB1B271E8E12AFF50E9834 VINCEESPINA
438,345,444 *2C66240ADCFA3519DB725E7FAAA89BA728660514 13april1033
438,345,445 *2C6B3647D8AF108D004F23725D61BA340BAD47C1 vishwajeet-rana
438,345,446 *2C6A6E6AB4E08382AE0EC0DD45B73BA2264D4EBE VITO.WINNETT
438,345,447 *2C6540C428B086642EC91A476B2371244E226F5F HALFGAINER1234
438,345,448 *2C682E4E4248AB1A66562F1C36E202528B08ADAD HAMMERHEAD.SHARK.(FEAT..LARS.ERIC.MATTSSON)
438,345,449 *2C6D91740E8CB237040C26BE2E51C97EE87B8144 [email protected]
438,345,450 *2C6357F929C60B3A8973ED5AAA2BAFF9EC957786 HANDSPLI5
438,345,451 *2C6F974483CA81D1E27B956A053ED63C9A17ED0B 1649082 BUTBEARINMINDTWOIMPORTANTCAVEATS
438,345,452 *2C6FC3E72B5620D5CE3EA34C9827A5036D548E96 VOD481ENESS
438,345,453 *2C6511F27BC80931F56241FBD0EFFB6BEE8A890E 17SEPTEMBER1054
438,345,454 *2C6634DC830D8B30BA25870DAFF9246FFDD5469C HARRISONLICHTIG
438,345,455 *2C6C22F8B4F89440840CBEE5BDCD216EFA066A4A VONPALISCHAK
438,345,456 *2C608235FE014D13636DCC46C15ADE04EE89C32F vonsaucedo
438,345,457 *2C67D274A74D28766F8BD4CE6315F12C0322CBB6 VRLRDNG0
438,345,458 *2C6FFA36653F4CAA8DB391923C5B79F913C0ED4D VSF-CUBAO
438,345,459 *2C663A0A411AD652E38F80322CD3519FFD7DE7D4 [email protected]
438,345,460 *2C6C8CAB8B79DE5BF8F812D8442EED4F09A125E3 18AUGUST1474
438,345,461 *2C6171138E7202E1B3E5B2ECB357EA94454B8E61 WAKHI0
438,345,462 *2C684CD5C2991A46AA171C169F8713A93E35E19B HELUQING
438,345,463 *2C68B40FF2F6282219E1BA4074057B11636D017F Wanderin'Destiny(BoomTheBassMix)
438,345,464 *2C6466949EF2605FEF7EE9343284B05FEA6CD93D WANIEYSYAMIL
438,345,465 *2C6843C3E2319610FF48F76BF1D32CF19F795E60 1-beck-forum
438,345,466 *2C656984EE59B3E6E720767E86666D158C8C582C HERTTELE5
438,345,467 *2C60CA732E7C0336A277407DD64EC74342460973 WA.SADE.SEDENG
438,345,468 *2C69C3C0D5091D38F81CE9E9CE3A0C1B1D281080 washinborough-2-0
438,345,469 *2C6DF61A887CF22311FBC0193FA707FA99319FF0 1DOCTORSH
438,345,470 *2C6F0DBDA8E20F2ACE6974ACA528D36F7A0366FF 1DUYMAKTADIRLAR
438,345,471 *2C6F5596670ECC28295B457D1C66B65BD0035997 1-ecstacy-risteilyaluksia
438,345,472 *2C64D2FC64DC915D8329B02A69554ED19FC1F36E WAYWODING
438,345,473 *2C6CE78F8C3C37633208056724CC75CE8BE2C490 1ELEKTROZUEGEN
438,345,474 *2C67BA6D7819DCBC001A4351321FEF31E0C6C421 [email protected]
438,345,475 *2C6EA841D5ACEFFDECE7C4547B3D88060E07122C HIRAMFELLIN
438,345,476 *2C64EA4A6DE2D9A8308C456AD2B8FE04C9DE3E89 HITAJUI
438,345,477 *2C66AC7440F10EED2614169B5749E75E6CEBCC8B 1hein
438,345,478 *2C6618C00441054F88837999954268456C994085 HOLANACOS
438,345,479 *2C685E861341D8EC4AC9E1554554FFF8160FADD0 1 LAPSIV
438,345,480 *2C6E1C89B2FF65E20E728BB6C0F01C21171234EA 1LIWHERE
438,345,481 *2C645C33D79AA6803269E06F85D371A38345A622 WHAT'S.UP.NOW.PARTNER?.(RAY.KEITH.WHAT.THE.F***.REMIX)
438,345,482 *2C6406553F3FD54BBFA2B36AF706994A979EBDA7 1.nischenclub
438,345,483 *2C642416D3C6B60C1C2A96B3A742F41885997112 href="/real-estate-1031-exchange/lm/r2ve9d9k055bzc">real
438,345,484 *2C67C3DDDC36B59B6E9DE2AA027F2272B4D11DDB HRVYHRVIES
438,345,485 *2C6536D806DE56880CE0A032A060E30415C543C5 hsnebnas
438,345,486 *2C695E7D21FD1BE1E46ABEF62778B46C211C5BA3 WIDAYATIKSH
438,345,487 *2C61169B0C0467D1F7B58B705E54BB9867F06374 1 RIIPPAKIVEKSI
438,345,488 *2C62DEF18261C932763A71399F136FF548A89F2D 1.samastaturnauksesta
438,345,489 *2C6CB55FD1BED45D61118B8BC23D10139FB28556 [email protected]
438,345,490 *2C6785EB8266D6C735F3B4D27EF69B44DFFA1E41 [email protected]
438,345,491 *2C611198340E1A01B3D6C4D3488E28CF4D1076D9 HUGO.BEDLION
438,345,492 *2C6347964F107D4CE12AEC8D36E47730387BE43A humorados6
438,345,493 *2C69A0CF4F77F8B446EF76A55129C3F3D1B6340A HYDROXYMALONDIALDEHYDE
438,345,494 *2C688C97EE3A461B089EB062C6C5A084E66F10C6 1-TIEDEUSKOISEN
438,345,495 *2C62642AD0C88DA961DA76F8284360451EFCAB3E iain.macpherson
438,345,496 *2C6D50532D8F451E5FFA62A96E85FBF3D9BB949F 1 windowpainting
438,345,497 *2C6DC828CFE0F487EC5154AFF3B12040C3F6789F IAMCRUISE1998
438,345,498 *2C61528C888C0A59340F33933B8629985C785DB6 Iamthethingthatgoesbumpinthenight
438,345,499 *2C67BD1A1EADF66ED6FC373CAADFB2B6C13DFFA4 2001:acousticandrare
438,345,500 *2C6F877DCCB816FA0D14992F532099BD9E626850 WINSTON.LEGG
438,345,501 *2C61ECEE538BB6819BBFE06DE96D414118051BAE icu$
438,345,502 *2C6E500057AA7FA6F307D551E0E909503834CB8B id=l
438,345,503 *2C660902111CFA310DB966ADDDBC6DF0752C6B2B [email protected]
438,345,504 *2C6F974739F97E0879BB23FAA9660BFBF8379AC6 WONDIMU.TADESSE
438,345,505 *2C6DDDAD661333AB17FDF71A8FFDB477E3E04E12 WSPRAGGON
438,345,506 *2C67C9680161D620230574E1FC791E1F7F607F5E [email protected]
438,345,507 *2C6F386FD611227DFAD47470AA1CAD3C19EC17E9 WWW.EYELASHESWORLD.COM
438,345,508 *2C62C6D135DB10C03C05604EC21F2B810BC97236 21APR1323
438,345,509 *2C625414754F07005561B661E707C8405184F450 WWWSTRANGEGOTHCHICA
438,345,510 *2C668603C141F90BED44BFDD9D81CE371C38E17F )x(**@8
438,345,511 *2C61BD3E707C8277F98DA30A5E1A796BBCA0600A 245496 madde.10.-.bu.kanun.hUkUmlerini.bakanlar.kurulu.yUrUtUr..
438,345,512 *2C69003449E6CF4AEFE1169BF0371ACA1BA422F9 2482316 kaikki pumpuissa k
438,345,513 *2C632901FCAC380E4A457FE77549F6BF3AFB0714 25-08-1615
438,345,514 *2C6A2060C3CEA89ACB8906F95F871C885B85EB7A iluvlincoln81
438,345,515 *2C6A31D13B173F6DACD7998C109952EADCE638E5 imageabcm7a2
438,345,516 *2C697160F04CB3C8EE861D9B2D5631A8B546BAE2 IMEITIKA
438,345,517 *2C6396E4E13BF8370B07BF4A5308B15B8226DC05 2752824 "kiinnostusafrikkalaisiakohtaanonher
438,345,518 *2C6F28E4063A9490152283A41B96B5297CCE1F2C [email protected]
438,345,519 *2C66A2F0FA9D0CF6F75177CF849101CFE2F3BB3C YAWETAGICPT
438,345,520 *2C61F370CD10F72C9507556CB4242B72C4AD5DE1 2-akzeptanzbarriere
438,345,521 *2C604779CE3BE86CDC29AE5E03489A0E3494359E 2ANDYKIM
438,345,522 *2C612C0CF1C1E205CAC2095EABB8D12EF85D2751 INKONSEKVENTE2
438,345,523 *2C639EEAEEE9CCF1175E7946331A0548C4C86BFC INTERNUC2
438,345,524 *2C64AC76AA96FE43F04167A8060961BB3855BF0E 2GEREZ
438,345,525 *2C67434EAE508BD9B40E43953BD348AF05B59740 YOJANCY REYES
438,345,526 *2C6D51948E06D680BD6B60D7D7B4E6F857C23204 YONNY-WILNORD-KOOMSON
438,345,527 *2C6B80ECCACDB70B55D9867DF05B70670F625AEA 2VOERTALE
438,345,528 *2C66899D5C4008F90B8B997928EDEB9B2916C9DE YQ213RG0
438,345,529 *2C61156CD6D3B19714E6DB58EB49F7BDB73266D6 30 TY
438,345,530 *2C6BC4160AB456D2AE281B72DF59616E21C3D781 IVESTRAINBBS
438,345,531 *2C677F06F8573401B2705D7469934B08F0A05BFD YUSUF-HABBATS
438,345,532 *2C62D8BC1B689230AF6C4E3FBD20D45607E1176E [email protected]
438,345,533 *2C64F404F06854AB87C354FAED5FAB0EB300212F [email protected]
438,345,534 *2C6BBD1B55768A2F57B1995CC9DE2D6C8BD0A124 YVONNE HOPP
438,345,535 *2C6DEA52A469B226490BCE5891D1DD15092808C4 3B<~~~DB
438,345,536 *2C6366096E71F3BF045B6D860B9E1FC77ED88916 JACKMANNINGBANCROFT
438,345,537 *2C6C5655CCD1787C1ED2A984D174E5D85E6BBD5E JACOBKILBOURN
438,345,538 *2C6479AE955CBF8659BED64E4BA3FE06B2BB7F4A JAIME.PISKE
438,345,539 *2C631D2B5F63CAE8279DC8485DCE02FC7B172EE2 ZAHLENTYPS
438,345,540 *2C66A5FE2D0625E957131CDB79E9E81A11ED7C57 jakepagan
438,345,541 *2C62C6DFD84A54FCAD203DB7148261F6ACF118F3 ZBB
438,345,542 *2C655358AF719D8AE0F1AD056A7B0FEF7CC186B5 3KIGA-STUDIE
438,345,543 *2C6BD8404E218936F29C390E269025F4B57CB789 JAMISON.PRATLEY
438,345,544 *2C644C2979EEF863E2007E5511909CF4BD9D280C [email protected]~`}O{
438,345,545 *2C62967412CDF954636B2B7266CFF72F1B1C1432 3######p.~.`.(>_<)
438,345,546 *2C6085951DE0FCA0C986CBE3D387ED481C02ACAA järige
438,345,547 *2C6767A003877CBAAA8E20CFCC86BF0ED0D297EA [email protected]
438,345,548 *2C6BF6654E45CC8CAA1CE47E76A20E2429C4891A [email protected]
438,345,549 *2C65EFFFADA90639C50DA66103AED8C8A2020F88 [email protected]
438,345,550 *2C648B94D4DCF586EF788C253FE9232F1CDCBC01 jayashree.rajan
438,345,551 *2C6DB54AD9D8C5262290D4140B7782012C0144F6 [email protected]
438,345,552 *2C6D1E3FFEF1C0A740F498B6597C99B5335E370B [email protected]
438,345,553 *2C65EB1C61412B0F9F32DC1FEF88208E6DDDB7BF jaysonrainford
438,345,554 *2C6D6DE6F0E95901DECAD2FB7F05091FB93194F9 ziler
438,345,555 *2C647D23395BFE3D5D09B42C5C006301CD41559F ΦΊΛΤΡΑΡΕ
438,345,556 *2C65938E6F715586806D2B87F3F8734635D0C0F5 JERAMYZABEK
438,345,557 *2C6D4334B03146EED7DD814E4602867FC5D1348F болби
438,345,558 *2C67665B0179AB72A284817A71FA2282C817AE9E 4HYPERBOLESES
438,345,559 *2C63CA03072C77404379977626E87883A7A5F7CB 4ILUVJOEY1
438,345,560 *2C654F548EA7BAFB3E3AD1ECB860BCAA8A0730AE JERROLDSTRANO
438,345,561 *2C65946EB9AC515BA52A8AB00FE98369C345DE4C 4INCOMMODEDS
438,345,562 *2C699C740645CAA96CE4FE227A8ADA43A508CA99 4LOFFICER
438,345,563 *2C6907078D3B090CB9AE89419624C00A4A5319B1 4MMUTIN4TI
438,345,564 *2C68A502C63E8473F56CE0A9BB08A18DA6E176FD ЗИДКА
438,345,565 *2C6F41DC1905834F1F9E57A6BE287CF7B125048A 4PEPOTAN
438,345,566 *2C6800811BAAE6131D6A786D7D80F14FA8DC4E3C jewellfloto
438,345,567 *2C63D5544EA17D631644880854EA63ED2BFB4026 ЛІЧЕНЦА
438,345,568 *2C6DD9A93D2F90E07865B1349124C71E280025AF МАТЕШЕЦ
438,345,569 *2C635528D47811CB94D83439B2FE0734AB2299CD [email protected]
438,345,570 *2C65189B4F0D12CEE974C492B837926763FD2094 JIMFOWER
438,345,571 *2C690E4958605890439E5AE51533B3EE42CA2B72 НАЙМАНАМ
438,345,572 *2C615A2D9BD27D7C446A2EB68D54CE8301F7245D НАКИДОЧКАМИ
438,345,573 *2C695C9461B5445CDC9C098C585A1DEB41B3D44F 4VARULVARNA
438,345,574 *2C686496E3ABB2998FC9F16823422439DC4F8C10 JLUGOSCH
438,345,575 *2C6E768F9E4BE3CA507E2B9AE0BE3A329DA4DD06 JNJW
438,345,576 *2C60A9AC1141955752D975342B695009A0D27857 529060 MUSTAFAPASAGARAZINIBUGUNDEGOSTERDI
438,345,577 *2C63035EB75C15DB37CEFB62DC984CEEF1612478 536694 AT-PRESENT-,-THE-WHITEFLIES-ARE-WINNING-.
438,345,578 *2C6CB877ECFAEC8141A3CA916152AA351E843F49 ТЮРИНГИЙСКОЕ
438,345,579 *2C6F8D096CE13E5EFE33CE1A5DE36117416BDAAB johnsonbigbird
438,345,580 *2C6A87EDC427D5C5CD6CF7014230BD2CD9D00D4C ЧАЧАПОЙЯС
438,345,581 *2C6DBFAEAAD0A80009023C742B6D7FABAF0FACF9 5BSWAMANTIUMBSW
438,345,582 *2C6469AE44191762CC7CCE723BBA85905651E0F0 5C0DELLA
438,345,583 *2C6E95EF212F4A6A4A7ECA646351411B8D6613C2 JOVIE-FERNANDEZ
438,345,584 *2C619E8215DD46FB59289F5B20EF9350FBAB2471 5EWBBLPONPUVO
438,345,585 *2C60BA7F3E42BF0A840504DDF03D9030FA659E22 JULIOGOETZ
438,345,586 *2C64A8D92C527C5E3443BEFE7A244211BD6386CF 5MEGANHELPME
438,345,587 *2C64829F1B4DE54FED0F899F441B903ABB62F8E0 5MISHAPACKARD
438,345,588 *2C6343EA5D4EB6F3B8D6938A4ED6B745EE897988 juniorfegles
438,345,589 *2C6C73DBB75EBF8EA57B936D9C008CB808C27D89 5MYILOVEU4
438,345,590 *2C60E5ABAB890A9A1FEA6FF45752E207C6FC9E8D JZAHORIK
438,345,591 *2C6052D132A14320ECAE974B02AD9C6205C636DA 5POLARIT
438,345,592 *2C6E74645828E36356E35A9257E95922A628B5C7 5PPDZ
438,345,593 *2C6B1C6D12BBECBF7ECA83599E8A43C462D0A254 KAPITALUTGIFT
438,345,594 *2C6EE5B9C06D6BBD6EEAE9EEB478074DBD8A413E 616189 THELASTWORDINHIGHTECHCOMMUNICATIONSSNOBBERY.
438,345,595 *2C679E299203556EC2A7351E3FF2B4E3A0EA54B7 KARINA-GASCA
438,345,596 *2C66A241B3B11A4C916CDA3368D9ED36B1D12E58 Kayes.k/eI/z
438,345,597 *2C66F5AD43F65D48E7C25A840BEA2512BB4E1E51 KCOSPCT9
438,345,598 *2C6703F64AC5B761B50CE55A3F92644D746C8ADF 6CLIFFLIK
438,345,599 *2C68F45B4ED70A8AC8AA780F1B8F3B562E338313 6concept0
438,345,600 *2C65785015D9A26FE015265F4BBFE62882755313 6ILOVETIGERS7
438,345,601 *2C62C1B18EA8D9E78C325C3BBCDE1D186E0499BE 6KOMAR'S
438,345,602 *2C60C210F0026ECE2F5696E1142C93ACC767245F [email protected]
438,345,603 *2C663B4A9A414697672B827AF3D4B579887F63AE KENTMCMILLAN
438,345,604 *2C65C879E644E3D695E75A0859BF7E76BD1CBAD9 kevinkowaleski
438,345,605 *2C6F35DA8C8FBF21549F1C085B5C630E9A969C87 KIETH.ZACHARIAS
438,345,606 *2C6A6B6C0532DAF195F37E06F2526624F9DC6DB0 KI-KISH
438,345,607 *2C6E37B27E8F0ED9B077A07A9EC830FAF662E93F KIRK.HARVEL
438,345,608 *2C64560EDD6F26B28E0E0DE723AECA1106F08022 [email protected]
438,345,609 *2C6550F2D1D03A3344AC2E20DDBF17112C5BBA5D kit mueller
438,345,610 *2C6A204CA2C33675190B183AA103F6163AD85CA3 KLIXBULL
438,345,611 *2C6061B7B17A933A8FB7EBEE1EDD4ED7D3BFE005 6YTINILIU
438,345,612 *2C626F12432F937626336F255D38CD78CCF97310 KOLEGOM…
438,345,613 *2C678097BA9BDA1486A74D6FE7EE14D92FF09BB5 789851 burs-olanaklari-yaratmaliyiz-
438,345,614 *2C6B977C9C554E5336E362157ED405652EA652DD 7DLEPDUOG
438,345,615 *2C61235719C5771BA07982D0218ECA0A8BB8A96A KRIEGSRHETORIK
438,345,616 *2C6E13364D8972C8D9EE7F2009164AA8B0908523 KRISTOPHER.BRENDEL
438,345,617 *2C6954DF6B25794D84B7DC9B09BFA107ED7A56A6 [email protected]
438,345,618 *2C6144DC8A02ED4D336C04D9B321BF05F03E48AC 高雲地利計劃在市區北部的富利斯希爾(foleshill)興建新球場,原先設計為42
438,345,619 *2C6980E1239E2AF4B6D270D909D4E2B3F7D4142D KULTOVAZAZEL
438,345,620 *2C62DAC5417536FE3DC96040EFD315E6C2F19BD1 KURT.HEFFREN
438,345,621 *2C67396EB2258E845BC0334551D3793679518EF8 [email protected]
438,345,622 *2C6C87EE6B4FD987FAA6D75F370C58DD0FF22B2B KYLEDEVELICE
438,345,623 *2C67B5974C9DB01C138D9A34F905EDC06EC1EE39 L00000000098
438,345,624 *2C6075CBF8818F7B373A995FD6AEA4485AB858A9 (0-0)~`.~`.Q####P
438,345,625 *2C639AF8E6BA9A980C27B2CEA0268D76FEAB6DC2 7OVUENEET
438,345,626 *2C6BD9FE6ECFD4460155B7E6169BFA8A73BCF259 LANCE.GUIDROZ
438,345,627 *2C67EE35AD0BA3C0F98B58F7E00EF4332E262470 LANNY.JELDEN
438,345,628 *2C6B180D7E962E7C98A64CFEA09BDF313EBA3FED 056EUE
438,345,629 *2C6CFC2FA4E0735F7CB310C1E9789C9263AA2C10 850066 BUNACOKSASIRDIKLARINISOYLEDILERDONUNCE
438,345,630 *2C6B3315F31B083CAA02E14C4D454C9C36282C86 878943 evet.hayir.daha.once.mason.olmak.icin.basvurdunuz.mu.?
438,345,631 *2C659B0FC759EF3625F3C0393DBD95405AECF991 la.telarana.de.carlota.pelicula
438,345,632 *2C62AF4558BE5FB6C1109E350C5F8FF860C245D0 8BRISTOLK
438,345,633 *2C646C938309CE66FD546FC7D77EB2819A1FABA9 LAURENCE.WHITBY
438,345,634 *2C64F8808C433FC887B0EFB5D4BA1D26A8C30B6B 0PTV4L
438,345,635 *2C6D4D5518055485033BCFF2C056888AC31D0676 [email protected]
438,345,636 *2C67119C05D0877D777AFCE7BFD23E9136D049BC [email protected]
438,345,637 *2C60519869584387D99C22440E512F7E59D88F8A [email protected]
438,345,638 *2C6AC992B25F53782F8F0EC4A196169B2245BDC1 1028134 KOULUTUKSENAVULLAPYRIT
438,345,639 *2C6C976C815C13B116C47DC1CF707B8056400D27 1042030 JOS80HEVOSVOIMAARIITT
438,345,640 *2C6FEFEF278F88D1E2F96DB6C3B3E93A0A4DC819 leemulcahey
438,345,641 *2C6A3402E3169D1C3E0CCCAFCADE6992BDEF642E 1144581 NE.SIS
438,345,642 *2C6A39D2F839379682D36D6366E9198CD28A085C 8EAECAIRALUBOLG
438,345,643 *2C6497D04B2A1FB4BE1AD49EB7CD197EEB19BC5E 8EIREDUOS
438,345,644 *2C65C8293C2591763304E96F42A0EB2D5B0087A1 8GENESISJENSEN
438,345,645 *2C634B88F31F5B8241EE6484D84F6132F92233D3 8JCHAGENBSW
438,345,646 *2C6AE7380C14AEB2B6FB0D03BE6744995CC4E581 11.TUNING
438,345,647 *2C6D39F28893A97910D687583BD0ACB703C0FCC9 12:12#&coarsen
438,345,648 *2C62F466462280748C9525190D8A97F373E7B8A6 «12150l7bw»
438,345,649 *2C6AA72CD1E83C74A91843A081A201669DCA4A26 8PETRICOLIDAES
438,345,650 *2C6DD451981823F794B32F81A2049FB934358AC5 8QQFAAAAIBAJ
438,345,651 *2C6452C878C80B254B1B4707AF065EB9F3DCC064 LESTER-MAST
438,345,652 *2C6E59B7E79AF88C960DC3B91E57B654532B61FB LEUCOCYTHEMIING
438,345,653 *2C6D5B7D0377B784C36363087497FBB6C2074117 8TROFIMOS
438,345,654 *2C6B3C509C438F5E3A8EF1CB5A58FC6F8C655491 14BENTON123
438,345,655 *2C691113968556B56B4FC761D34427A9C98883DA lightscatter
438,345,656 *2C6A3671B86D048630F0A156EA4F1B62C9749F87 9ARTISTRUTH
438,345,657 *2C69D8564724B3AD0A9D207CA783FA66CA5AA679 LIGROINS9
438,345,658 *2C61FC90C2659ACC56FDF781AD783F7D02D18D22 1583579 kaikkeenedell
438,345,659 *2C6E54770199F2802D05D9436963C0B9CCA351B9 186ANGELIQUE
438,345,660 *2C66F2EECEBD9D4A0A2EA6546329B049AC74A583 1874135 TAX EXEMPTION MAKES THIS POSSIBLE .
438,345,661 *2C6FFA9A32DFE5F2F38A4E3E42D732B647F517B9 9kizartilmis
438,345,662 *2C6E2CE4CC613C22C0666C2AD6751139632168D6 lisatommy
438,345,663 *2C629BB97E4D0E3AC9EF8FFBF332D72B4A34DCD0 9NABAVOM
438,345,664 *2C6CD6B3112807EF128F73A43F478A7059F14224 9PMCROSIE
438,345,665 *2C6F3CB78243A8EE33B977B969DF523AD2D362DB 9RECIMINATED
438,345,666 *2C656B834D815AE668D39F7D7B32C5B8A795AE44 9SALTPETE
438,345,667 *2C66A116FEA042C636E9B696AD9821626831500E 9thestinky
438,345,668 *2C66EAF7C549A9315FF1BC3E7566B09C33C7D457 1BOOGERO
438,345,669 *2C619C8D53933C0BFB244BDECF82FF51F7725D0B lonelyproperty
438,345,670 *2C64125A5581F54C30D0DE4EA119700220C2FB4A 9月8日、wba世界ライト級王座挑戦。
438,345,671 *2C6F17A73DD8403DD1E7236D41E5B1D31FD42FE3 [email protected]
438,345,672 *2C6E03E2FAA7B44904476225A2AA99417553AC92 A3E4W
438,345,673 *2C6F50FFDC1BFC04443432B3EC1198231FD4B764 A5GUK
438,345,674 *2C6FCE0080FE353F8B4213B339782CDADA0A6A5B a5+r
438,345,675 *2C60978305F67973E54A648B376A98A4350666A2 >1h/<>tnof/<reyallacisyhpeht>"770000#"=roloctnof<>1h<
438,345,676 *2C6029047D2F3854DE2C83BAE349990CE9105DC5 1INGIDFOH
438,345,677 *2C6F7F11706C46CFCADADA493B4CE3A4757184C7 1.ISEKEFROMME
438,345,678 *2C679E314C7B79F11AA09CE7CC769F27E0BEEC97 LOUISACONWAY
438,345,679 *2C6B47690E6A1E88E8443D1FD0093BC9D0EAF0DF LOURECERNOS
438,345,680 *2C6F60E590E01083D873DB9B851C4A5F83A86409 1 jewrybe
438,345,681 *2C66CED295E37AE6C8FE094A217C8936332388A5 A9Ah
438,345,682 *2C6FD47E6065A972A6F2234347F37AF61CEFE19A 1 KIINANMAASSA
438,345,683 *2C6CD7BF1E5C83FA1AC8B7C3472D094181412313 1.kreisbauernverbandes
438,345,684 *2C6F4F19AA5811FBFBB4A657F80303FA3F1C49A0 AAAACCAAACACCACATGTTCTCACTCATAGGTGGGAATTGAACAATGAGAACACATGGA
438,345,685 *2C625BC9DE6BDD455DCA2D1731CF4B70706E5803 LUCASMAGLARAS
438,345,686 *2C64C69AF52ED3E9ED49FAB423265BD9C1B46D37 AAC1B5
438,345,687 *2C642E66076EB278433CDA9082D195A005B8B872 1MASEDA
438,345,688 *2C6FF542FD51068A0D8F313C8D3DA177F1E2630D [email protected]
438,345,689 *2C6A9048AEBD3600042039B8A886048D515C4D64 LUISSETLIFF
438,345,690 *2C682A78EB2FB15569138E80D420A16A3EA796DD aadk;:
438,345,691 *2C68528E3C9656C75CFCD5007483EE55C53C43D5 LUTHER.VIDALES
438,345,692 *2C6F0A918481CE6008A7373B81D3CE3750DFFB75 LYMYTEDS
438,345,693 *2C6D5710F29DF5A12D613106D1D988A9D1470C13 1-NON-DECLARATIVE
438,345,694 *2C63AE1197A08DADFBC64F901611F87B950F490E 1NORTHSEA
438,345,695 *2C622B72322E8C128BA5D8E7A4839810FE54ABF3 1.ost-west-kunstschmuggel
438,345,696 *2C640EADB06128BB30CB03B87BA5FE55B3FF5E5A 1.PORTLARLA
438,345,697 *2C6FF73F36AE21287CE6625AF5B12285648F3BDF AB6O;
438,345,698 *2C63B05C0CB047CE7C6678D56762EB35351302C5 M:
438,345,699 *2C68919050DB465E338E18AF9341B44228F99466 MAGN3TIC5
438,345,700 *2C62340A6E874A355210986D28E58DE34A5F37AF 1-TILAUSHISTORIA
438,345,701 *2C643D05B42BDCDEEFBFB53ADFA47DB59F19161A 1 TUOTTAISIN
438,345,702 *2C626106D7F96DC8F4D3F62EC3985E43DE623383 1.UUSINTAN
438,345,703 *2C6D7272A482EA4B53168247B96A57EAACF7451C A&Bt
438,345,704 *2C6418B680C2E824D6641EEFE521BFACC6AB95A1 MAN.CARTAGENA
438,345,705 *2C60065A71FDB50ED26DD530AFC594499BB4B686 a"%c_
438,345,706 *2C67D747B316DEB4E6CD0E8F7CA5EE5C1FF9E506 2009237 "moeglicherweisewarderstoppimtunneltoedlich.".
438,345,707 *2C6DC9BE7D674EFD061C56B107B7EA6B7A6395E1 AC8Y'
438,345,708 *2C66C156AB8D7C2E2E96145DD8B50561291C256E [email protected]
438,345,709 *2C67D9F71B1FF4C544FC24E3BB3395A66E3AA8F5 MANSI-PAREKH
438,345,710 *2C6936DCE2C65DAACA245CAD739E0E30DE5A2F83 22111596
438,345,711 *2C618D8027C8C9D24342011A63FDD3147A74568E 2325495 KAIKKI-USKOVAT-OVAT-T
438,345,712 *2C682C1FBF4912DCAB68BFF176F2DC650B1E2D41 2452056 TEKNINEN OSASTO ON ILMOITTANUT , ETT
438,345,713 *2C611E9DDFB407F290402940C6C17796D92A8F26 2691126 THESLAYINGPRODUCEDAWORLDWIDEOUTPOURINGOFGRIEF.
438,345,714 *2C66D6FAF4AAE8E8B86F97F1C797EE9E33AD831F 2877998 dann wird sie allerdings nur noch an der seite stehen
438,345,715 *2C6C3DA6D2F6DFE5E077F5E9290EA0C55B06DE6C 2ARREREMO
438,345,716 *2C685BA99C84486D1A2EAC80199637040EEA3F34 [email protected]
438,345,717 *2C6298293616AAC51D7CDFA315B324B37570ED14 ACHTSPAKIG
438,345,718 *2C6A65DD1BD0408A2267B747845DF383D47492A8 2ENOSIS'CILERI
438,345,719 *2C6CE5722C186708049E7B3F9BA1C070ED8F4075 ac)rf
438,345,720 *2C675C42C7D8C89F13EB23DFCC983ABEA9623BDB actualisaient9
438,345,721 *2C64CDEE425130DC859D7297CC8EDD71C962009A 2IRUPAYKA
438,345,722 *2C63F24B6E84DF76BCADC3E595E45FEFA998A017 2MAHEMDRA
438,345,723 *2C69375D0551BF96F6F8D0F6CF0BBABDB230C3E0 adanantony
438,345,724 *2C6D684A35A6D127349F8C1D2EB1F93D5A512305 ADB21
438,345,725 *2C6E57D8F1B892AB7211758DA579F4ED0C3485D1 2.rakentavien
438,345,726 *2C64F7341DC5DF9D9C50145D378C857516395A7E 2WATERGENEESWIJZE
438,345,727 *2C68F27C39341AA9990BD0177EBFC176D491E81C 340MAXIMUS
438,345,728 *2C6E738FDC412483FDE057DEA548037F9C6D370E 3ALTHOR4
438,345,729 *2C602BDDAFA2D284F006B511E5E15FD2A474066A 3b<o~.<p
438,345,730 *2C6175E61570DC852CCCC9D17D0B90A92A72EB98 3 hoitooppaan
438,345,731 *2C680A51DB3021A14122966EFAF76B745A361829 3KAESIKSI
438,345,732 *2C60CA3954C87CF11D4B98B692F519AD83A4AFDB marlinanschutz
438,345,733 *2C69936071A2F1047B058110942BF643E8794543 MARSHALL.FOPPE
438,345,734 *2C61BE94D4F151FF9AAC0C1AFAAA5A7BF8018130 3.[[User:Zarbon|Zarbon]].03:54,.13.June.2008.(UTC)
438,345,735 *2C6E2EC2DFD382082B186DF9F0F21AF69A72943A MARYJANE.GALIT
438,345,736 *2C62BA9AF0B25ADE8A4DCE402177A9512A34A66D 407588 KAHDESSA VIIMEISESS
438,345,737 *2C6FDB128BF12FD214CCA261FFF09D0C25E458DB 429618 NEZAHATACARE-KGM324
438,345,738 *2C6E90BEFFC730C9412E6612CEB870A9CFDA048B 43260 JATKUVASTA.PULLON.OHJEIDEN.MUKAISEN.ANNOSTUKSEN.YLITT
438,345,739 *2C669A41403296FC370BD8CBACA0A58EA2789094 AENCRYPTING MAIL TO SEND THROUGH AN ANONYMOUS MAILER
438,345,740 *2C68821B9717D114C5614356A802697731936BBB 49F87E71C1B93C2CBA887FF86B3F13CF
438,345,741 *2C6E9F97CF212D9B530E2387D37561A892985805 4AASTAALP
438,345,742 *2C632F8460B4C41214C74AD98E316E110EAD91F2 4calabasasthousand
438,345,743 *2C68469FDE8A7E5D29B0ACBADD06FFDDAA2140AE aevbd
438,345,744 *2C6DE47A6E3131D693AA686BD57F4BB8A211968A a.fkt
438,345,745 *2C61336F2C1E37DA7C28E3F3B74597479779A896 af$oj
438,345,746 *2C6804217E20F1F2E882FDE96C15A9246128CF93 afvov
438,345,747 *2C60463A3414857FC7DEB802540C89DA2F978FA4 AGENTE 86
438,345,748 *2C6802B260083FC589A584A039A41F26D3003438 AHMED.LIND
438,345,749 *2C634FD76D9AF7970609D4AB9BB59CBCB46308A2 4ORINGHER
438,345,750 *2C6ABF7A65AF61812A6C99CEFAB8845B163729FA a($i:
438,345,751 *2C62B5DF08441FA2C834F7BEC48CE13B48B6C24E meg_0_4_
438,345,752 *2C6393ADDBAA1BD8C94EEA3E37F29A34D7FA65D4 [email protected]
438,345,753 *2C62A5CCA93014B180063CFDCF9380C4E10BCD61 4.RULLAUSTIE
438,345,754 *2C655310EFDF88632628D124925EF40864812CE1 MENTALRASTYR
438,345,755 *2C60D91FD35506AE692279F955DDBB011CA1D4EA AJE0R
438,345,756 *2C6736FD018BD0741CBB16C42EDC3192A9AF1FB4 MERLEBEISH
438,345,757 *2C62B48328E269D75BDEEC7C7FEF2D3241081941 AK#AD
438,345,758 *2C6769DA7D0C8D38E44922CD8809C52B617AA943 MILYTREE
438,345,759 *2C63D94A1ABDB3CB16AE3612E1FF0B44EE360724 567WILLOW
438,345,760 *2C6E4D439E0A64F6F2C46132EF773BAD2CF7F80B 59856s
438,345,761 *2C6DC15692695D76F39824EF25F2B92F7C959675 Minor
438,345,762 *2C634B06CB559E65644CF5CCF3E3542EBDDD361D MIQUELRECAR
438,345,763 *2C6EF3791033986874FD82B88191F9ABB1150134 5BSWREMMAHEGBSW
438,345,764 *2C6EB88E57DD2AD39186B8BAC7AE054C6E64D6A0 5CCCCCBSW
438,345,765 *2C6BF9B9F97C36C9DE50D5AE2E40A242C9F8BD5E 5CITSKCAR
438,345,766 *2C6368BEDDE9A8E45262C660C858B820420AF440 ALEX.PEVELER
438,345,767 *2C65CC2AD41CA294F15EE55D37C5723474264038 [email protected]
438,345,768 *2C6485E293F52D23DB3DD0565AB1E333F0F3AB4C MITCHELROSCA
438,345,769 *2C6433F09795D7D8F2444E940F5C557E293D0198 5F1BRA5T1
438,345,770 *2C650AFBF6C932BF41AFFE76830A4A14314BEDEC ALFRONS
438,345,771 *2C62B1212C8A9B63C917E0142417A395562C2C9C m|kkete
438,345,772 *2C65FF693B75E16DEE2A7CD25E6DED36C6A8AD20 M.MAIS.LEMBRA.DE.VOC
438,345,773 *2C610B9A88BF92EEDEF72A85A757067D229581C1 5MU1A73D
438,345,774 *2C6DC72587C64EA59503BAB23A82B3D3D1DD8506 5NEGNILLETSTSUREG
438,345,775 *2C637CA0684DD0257962E3E5CEEAB04134272491 5NESSOBRE
438,345,776 *2C640BEB9B9B2CC405EA6D9F2ECAB056F61209CA MOHAMMED HATIM
438,345,777 *2C654529622B5EBF5894A633F736D6B4B79400C6 alonzolakes
438,345,778 *2C6F499DE6671C8C686EE8EAC69D654FE5C382A7 [email protected]
438,345,779 *2C636DC371EDE415E66C498B778270B8B942C2BF [email protected]
438,345,780 *2C62A3238F3D530E4350E583D2550D1E87C92F15 5T3RLZAT0N5
438,345,781 *2C6129E22D16E2D2A5E2CBBD2641A7B1FE62B9D5 montypanesarstarturn
438,345,782 *2C625F4CC8F1F2EBFFDF61CEAE4381F53F188130 mother,.father
438,345,783 *2C6CF93FBF068831335413B2943B91A8E3959C27 6BLONDEFIREBALL
438,345,784 *2C640B5AB65B12762541062C5EA7730D41801A04 muhurletmek
438,345,785 *2C6CC108EA83A186751788D5A94A1EE660C0E78E mybbjeny
438,345,786 *2C670F976336E424BCE7FF3425EA77A7C4A4173F AMANDARIVA
438,345,787 *2C69E4E323AE92ED6FB7D096F36C6E946400B447 america7steven
438,345,788 *2C674DCAD0D662D60B9866A3301729DC344773FE 6GELEERD
438,345,789 *2C635C9183D5346B33ACC1A8DD5C7D71AAAC3197 andrew.bibby
438,345,790 *2C6D961A7E200A407E664D5633635E3FACA22147 androsem8
438,345,791 *2C60A440180BF85048D125109D9A455FFE74B2E3 nenofitna
438,345,792 *2C69453901F59CFB0195A93C15223754956DBFA1 NEPANEPAED
438,345,793 *2C61DBD030B9554D587C6AAC16678741A6D88782 anhands8
438,345,794 *2C639E5C9EADFD6768E54E1899C8669BB0507C2C NEVILLE.CULKIN
438,345,795 *2C67C53EEB7B6AAAA61B513F9101136AD4E2A765 new-hamshire-hornpipe
438,345,796 *2C69F351E62F4FE678F47894962FE13A3A574243 NEWSLEADERCOM
438,345,797 *2C6FCAF353F42E76B13E244892BE39C541EAF8EB 712IC312I0N
438,345,798 *2C6826405A8C7E6B522BEA6D189DABAF81432DBA [email protected]
438,345,799 *2C6C1A3F791E735A602FBBE486440FB4C464BE61 ANSHRAHF
438,345,800 *2C6A7B0D104BD6EE7681C227173943AC4EF16534 ANSLERIN5
438,345,801 *2C6874AEBC586C63F7B5CF5C6C9F6A4DA60DDF82 [email protected]
438,345,802 *2C604A2DFF06C52E26073CDFC6217C44112861E5 NGUI-CHYI-CHYI
438,345,803 *2C6A81647F5584EBCA1BC2E5920E3E0D03D6543B NICKTHIVIERGE
438,345,804 *2C6D3348A6F3AEA0AC59D1E96358E75D3D2CD75B @-night-there's-not-nationalities
438,345,805 *2C6E580821E51E2CEA54DDA5DFAF1C9048BD40D7 [email protected]
438,345,806 *2C614158671E61F7C291F8C8F4F6C888D2F667D4 7ELAINEANDY
438,345,807 *2C6A024DD3DDFBD5D287844A8643F46C544EF0C7 aokv
438,345,808 *2C6E79286027F7331D9AF8EB33B3B5963FCDF601 NOEL.TUGADE
438,345,809 *2C6A9A06ED0AEA0228C2FBC6A1DA8894FAE968C4 7MAINLINETI
438,345,810 *2C6EFF5D848BB634AC5D7CCD07E90F57A013140E APRIL.PEARSE
438,345,811 *2C6A0D6B4C7811238D1E4125283A0A17B72AE3C5 APRIORISM?
438,345,812 *2C6CB07B85D824BD6632CE25153DE4D4F56725B2 APVI.
438,345,813 *2C6C455B830CB68EA83DE29973E852AB2BDDAE48 ARMÉNII
438,345,814 *2C6328FA7496430C63B1E5E86038A2EAC2457F12 aropwy
438,345,815 *2C670275F330ADFEC15D7D5A88FA24D9E61B6AB7 [email protected]
438,345,816 *2C65C593AE0524CB4D530689BEC258C3C2226F19 arrow16!
438,345,817 *2C69A5612A0F02BC5EA9AB52EE46EBEF7A531F1C asokasilva
438,345,818 *2C6297549A8608622B68035253530989355199E5 aswollens
438,345,819 *2C67CEC16F1F8C261D00E4199B847523614D70A9 7VELTHEIMIA
438,345,820 *2C6ACF58D1DC5D55E16B70AF0D67E693A31946E6 OBCANOVY7
438,345,821 *2C68DBBAA06015F847E25629D9A9A68C984251FD aum&7
438,345,822 *2C68343C5C410C42C8901BEE7140E9D9ACCFF62B AUSTIN.BRUNETT
438,345,823 *2C611BF821083DB74D9B39052B608EBDE22703B1 austinhilker
438,345,824 *2C665E1C11068C70C7C2EF97D737054377B92AD7 OFFICESS1
438,345,825 *2C63EAE6D38E10522A2571E0EF772FEF32022C15 offreckoning2
438,345,826 *2C64E408DABC2D64FBB7440CAC99816BD96B8868 [email protected]
438,345,827 *2C6457B2B1EF83C950D8099D6A390331A442A7B2 8BULTENNETLUB
438,345,828 *2C681CB5FD25C36A54CF7DACFE1639336655AB3D avnl0
438,345,829 *2C625BF843A1ADD3DC85A4F6CB897890E274CADD 8DETOXIFYING
438,345,830 *2C6BC7DAF50019CF9CD9DC3AE09F1135B8DA96EF a#/wh
438,345,831 *2C6FF904546F138C13FEFD93A396505936460A5A olinogunyemi
438,345,832 *2C61634B8435318831AD4AC4B7832AFA14A15612 8GITTERTE
438,345,833 *2C6F613870A96DCAEC17859221E6F7AA0C4BCD70 OMARHICKTON
438,345,834 *2C633C717C067461C840808A43A76D64C0C3D038 OMERSTARR
438,345,835 *2C68E856D5E4539C3E3EDD1F651C75986B2C6B47 omf1akken
438,345,836 *2C6DD3A7CE909253D418BCBF35E48F1D783B8C56 >-b0-`-<------3
438,345,837 *2C6547F451CC5DED763ACFCA3605B68D875C73A0 8#@~O(0-0)
438,345,838 *2C6EAE5E8FCA6D14438DFAAFFB7F9F8E72350817 8------p ~o (-_0)
438,345,839 *2C6DABC7BF2B40BAE4797833D47D8D8022D14F63 OPPAUSSA
438,345,840 *2C65D429653AA732ED58CB2D539DA4682EBD50EB b2vor
438,345,841 *2C6D648B1AFC813F124F1161AA57285C3FB6855B 936466 KALAN JA KALATUOTTEIDEN TUONTI 1980-2001 KUVA .
438,345,842 *2C63618CA4CC81D2B30D634BE7F4D1C21476D9B0 B5_&
438,345,843 *2C64FF71233363D207DF49AF06A5DA10B2DEA25B b:5%f
438,345,844 *2C65E5F38493D023AA1316FDBD63BEBB1F082FFE B7m2
438,345,845 *2C6E669144D9E45AA02E35CFA697DEBEED558966 9BSWDMITTLEMANBSW
438,345,846 *2C6C2F62D5141C8196DA06A64C6C35A8E8299B85 9cade9a6e5664f965a73be6603491fb9-bEWxwO8B
438,345,847 *2C6A5F675687C74598A02ADC9E727A45C74690A2 9DEHSAUQNU
438,345,848 *2C688F2EAF6D4FAEAAC08FC49054B305D3EAB93F OWENBUMBALO
438,345,849 *2C6FD19D561269767A9AEA1AC560BBFBA78B2287 BACBINH
438,345,850 *2C6F6B80388D39095AAE5936F698D050EC862134 9.PROJEKTIINSTITUUTTI
438,345,851 *2C66875F97CAC1D7EE2C2C5268FBCAC4876C2DCB 9REJUVELS
438,345,852 *2C6273AD1ACCC4175C99B99D5252E89770F8D106 9VPPVMHLZFR
438,345,853 *2C647E10B25A3311CFA41F0B06F3991D7ACCFA33 [email protected]@7N9
438,345,854 *2C6301E435AF752A9491D1B3F904F7057D48EDDA BARONLAW
438,345,855 *2C675AA2ADBD1A81BCD9C9935F0A6E41C9BCB3AC [email protected]
438,345,856 *2C6D0C01C6F0A47716F9963F0ECED0FC3F97F6BD [email protected]
438,345,857 *2C69663B9C9024F8CCBEE2A11F483F354B0DA578 BCFALCON
438,345,858 *2C61EF1A56E1B1C72AB99E9D961D79E692453061 BC%UT
438,345,859 *2C666B5C64D48F35711E9BB6C01741511F5C7E2D bedre-tider-f
438,345,860 *2C6C7D7209ED7BB8F64AF86AA1FBE0F736756D5E PAYING CAREER THE SUDDEN, OVERWHELMING RAID LEFT
438,345,861 *2C6F18E3333B261B3225E40C249938B475681C93 BEKWINTOOLS.COM
438,345,862 *2C6E4CA2796BA1DBBAB9E5F4EDE9DF0860C537EF PBANSZAKGORZKOW
438,345,863 *2C67C7B950F18C9D40ABAE72233FE05AD5DDBB59 p-b ~o~oo->-<
438,345,864 *2C608D8FF035D528D4085036B54AB0668885EBB3 PEARCHTING
438,345,865 *2C667B0B9DEBFA64B2C3CCBA2F9D565D36D7655A AAJRQ
438,345,866 *2C6EF18F4D78B97F20A52D385019FD0278F015B6 B)FYM
438,345,867 *2C62CFF26E1BDC8B6CDD26D9EB81A19E9647D94C b,-h#
438,345,868 *2C6E85D731FBC7807444ED85542B00B47FFB1B3D PERLEHERGER
438,345,869 *2C6BEBBE821864C48FA978E46A9939FBCD06DD8E perrinton
438,345,870 *2C69DCB82F5A3CA9675D6075F4D8C1952D284B10 biftecks.
438,345,871 *2C626EA7320AD3B1C420503F6384078AA07C203C aboutthereserve
438,345,872 *2C6F981C4B928FB9B16FB2638B9BBA6BBB941F6B PEW123
438,345,873 *2C654B6C3BE43A9DA746D1148FA58D9ABDDBAE16 [email protected]
438,345,874 *2C6992C785141EC9F32C3D021FD0797C8CFA4C07 PHCPHLD3
438,345,875 *2C678DD58DAE9640FFC84D07ADE81A5BD55EF08A ABSPERRTE5
438,345,876 *2C66D6521134A3709A6BCEE143B4A8601D5DD27C PHILMRASCO
438,345,877 *2C6E00C5AC5EEB77D6DA604ECF27A9C000C495A4 PHILOKOSMUS
438,345,878 *2C6956313372DFE90963B935DF5C618AC1A172A0 BITTER WINTER WAFT
438,345,879 *2C66BE9C4D21876B0E85208112BA923795EF7765 PHNPNTT7
438,345,880 *2C6C8B289E5E5503B06ADDA9534E482D241127AD BIZKARGI
438,345,881 *2C6901873277C251A446091AAEB3B80C252527A2 blakelungstrom
438,345,882 *2C66454877AF84D18C85428BD4B60D1A52CE63A3 bleiswijk–kruisweg
438,345,883 *2C657965F338E1F0762E99CA294B44CD8CA4683B PLATFORMTALKFRITS
438,345,884 *2C698577BE97FE656307AC605570BC898D96FB66 playink
438,345,885 *2C6023C9AB5881E66E027B3AD1D2B716ED1F9E16 b&m4x
438,345,886 *2C689B0401811C28545DD453C518ED981A432145 [email protected]
438,345,887 *2C67E2C141142D482B7F74AB655CFF899D185125 Bm-S
438,345,888 *2C6537735FF688EB3E9D2AD56A0CD28F7E29F9CE p#####p `(^_~)
438,345,889 *2C6BB1269C69044DADF31CF9D0CD4EE7AC9614AE ADIDAS-SUN-TANNED-AVANT-MAN
438,345,890 *2C6E3A903F2F736B2AE4E8B265F6F11494BD653E boejq
438,345,891 *2C631152A8FEA1C619DFB2134241B58300CFC45C BRANDENSALVERSON
438,345,892 *2C67341A4F90BEBDE68067177463581DA14A7993 BRANDON.FURLER
438,345,893 *2C63CA93C642F27D7334391D89C4F779A22D118D afd4c
438,345,894 *2C6F4790105A9A7FA3E3CB20AAD26F3D04D6F278 afgeschovene
438,345,895 *2C6FD3286F26C8A272EDDFCA6852290AA560FF04 AFG#T
438,345,896 *2C69EA187B2E5150EE5CFC2A477F37F80AAE2FA1 BRENDAN.AURICH
438,345,897 *2C6ECAEF48D8F1DF0B48FCF1390B5608A840FCF4 brendandykhouse
438,345,898 *2C680461C5B4E711192213CC0E29C87C56C34C94 BRENDAPACKERS
438,345,899 *2C6A02B5C822D92A115EDF204BF3CA4A0D6285ED bretpoque
438,345,900 *2C66A672E9796E9EF48578C9D57CC0EF68EE0A65 p-----) * * splat
438,345,901 *2C69C1DD00FC6404DBF707FAF9748B31AD0D1E36 ahi?
438,345,902 *2C658F7A53A928E8818E441E30EC4D41F14B8A70 puimsteenpoeier
438,345,903 *2C6DCF0C787463CA5F782DC49E280EA5779778F3 puppet.off.a.string
438,345,904 *2C636EFED8D43E5E8955AEF04147C56F8F39193D PUPPETS-(CLUB-MIX)
438,345,905 *2C69E722A42057EA724A67513F3B9E24FFAB1778 a;ieq
438,345,906 *2C65C6DD08F62CAFFEEF7516922938F0BF11F601 ajbw/
438,345,907 *2C6FB17C817AF2AC8D820BEFAFE88395FBDCD1F1 q-----B.~o.:p
438,345,908 *2C63FDD48C151E92741423CE95316452CCC4E057 akkumulationsgebieten
438,345,909 *2C6B9F6D46CD19D1E6CEFB32E3F7961CA877E504 bsg,=
438,345,910 *2C6D1381244DC8049B4470733F9F45ECA114E378 [email protected]
438,345,911 *2C69AC93AB6B35155AFFB180233EFFD1F445EC4A albertjaeger
438,345,912 *2C683598EE972271578580FA9308085EA369BFAC bta$x
438,345,913 *2C69F56EED249809C6F176DA373FC4919515120F QUADERWERK“
438,345,914 *2C696611103754B3D52B98771DA4BA1D3D8BAC26 alimilan
438,345,915 *2C6A07BEAC2BE9C6B54FA3354C500E953663A3EB quimper6
438,345,916 *2C6653A83FEA3BDDF92D78DB9657A489C24BF54E budwilliamsen
438,345,917 *2C6E4E1A75FA634E071EC62C55608401ADE47DD4 quitoe
438,345,918 *2C62DFAA5063DD666333000523F95E828368DF88 bufordbischke
438,345,919 *2C6A438DCD9E7A5B910502D18A2E0453AF902046 alonsopayton
438,345,920 *2C6314DD98635038466F3B3B168A4115E57BDC93 AM-225USS
438,345,921 *2C61001DB4F8DE4906EAF630664F75B08C40F12F rabidly0
438,345,922 *2C632F245495B339580EB15CCA40B0108A3AF40C RADIATÍVA
438,345,923 *2C6A1BD28E251C603AE0D81675F0FE4CEE9F57BB buv9"
438,345,924 *2C6488D75DDC02169F44EC28BE0A6C414161601C AMMASSE0
438,345,925 *2C673A0EA20A545AFA027BC101830A6E553C0073 randallsulla
438,345,926 *2C6CAB2F510E8B62515743570CA8EFEBF521BCB0 randellkeegan
438,345,927 *2C65C4622F72FE8AFA93C8D1FFB2E66FEF456359 RANDYFAYCOM
438,345,928 *2C6DEBFCFA38DDB021D7D48212976039C603B01C AMPHIBICHNITE0
438,345,929 *2C63B650A9953ABC3505624F9FAB54C3AD364DB6 raymonhumbert
438,345,930 *2C6E8C6A0AE8F4B83680C06B95701DF2953D8790 BXPPB
438,345,931 *2C65861D3343FAC9BCF890B34D9A4C734C49EC34 REBECCALASH
438,345,932 *2C643AB5112E651EDAE6C04DA56C1FDAD0E13FD6 rec0mmend4+0ry
438,345,933 *2C6A42BAF9D8F1080440FC04145271F8259CBEC4 BYVQ6
438,345,934 *2C6AA9C019958E4141D0DE4922D5BEB04E1534D8 andrewjwilliams
438,345,935 *2C621373BE0B910B1B358B213AF9C9AA70A41A53 red-de-siguiente-generaci
438,345,936 *2C61F61D92BBEB91A91B6730AB57709C2DCEAD45 ANDREW-ROBINSON
438,345,937 *2C65EE31BA3A7569CE844CD2FD3BECEB5EED84BA reedrembold
438,345,938 *2C6FB3FE45640567EAC61D6757FCFC412B21101C ANFICLO
438,345,939 *2C628F41B4AA7B4D9403CF84034B07463C383CE6 c1n0a
438,345,940 *2C63FFC8B2D6248CBE233DA48D88CD819F4E8DAD ANNAMOEA
438,345,941 *2C66E1AF27423918E4D18077F5C302EEE797773D annarosedelacruz
438,345,942 *2C68587FEF4C9AA06FC161E02B90D0A34337A4DE ANNASIDOROVA
438,345,943 *2C665D101B0808C17BF50E79ED1E564E0489B421 c3?wu
438,345,944 *2C696E04581A9387A4A1FD75B64CB27F14A37682 reredelp
438,345,945 *2C6C290FE41F738704B833E964BAFD8C8C47E734 c5vfm
438,345,946 *2C62C73E57641A63CF4B168F5934E794A3F5C98A C72;
438,345,947 *2C679F74BFA067CAB9AA8BFA79A24F3503E198C9 c$8%h
438,345,948 *2C6CA7DB93BE120DA5B0DCC4C8D912585891FB26 c90583d83ece3665aac5112ae8fe5c2f
438,345,949 *2C6EEDE96441D8B652A5775DA49ECB116B0B1387 aokv
438,345,950 *2C67C44358C4A6BDE8B2A7B7CD0AA09838134B52 CAFFP
438,345,951 *2C6A8920C221FA228A86D5B763A71647BC6A93C5 RHETTSEBA
438,345,952 *2C63304D8C38FAB9AEEA156D69B8D070432FDAD5 CAGRA
438,345,953 *2C6142C5932503D71469A906091D288C39ED9F16 ricardobaxtor
438,345,954 *2C68FD7074E324B78775F3220AEC250C0E3C250A RICKIE.SAMUEL
438,345,955 *2C6323F64084E2B40FB56B6326A5E5C918A6EE03 RICKIE.THOBY
438,345,956 *2C661256727B4BFC9DD6E54E7F2C3F7491B0529A RIGHTLAIS
438,345,957 *2C61C7CD0A5C6E54D935C4616DCB6C802120A075 CANTORIA31
438,345,958 *2C6C9AE33EEAF6B422B627B231D92266DB01040A caprices8
438,345,959 *2C660DAFA6AB7CD50A369D205B244FF53D99C628 ARIS SALMAN
438,345,960 *2C60A7D56E91583CB8252E27806DCF1CE2EBC148 carminelajaunie
438,345,961 *2C6EC83109C8B5DB04B2FC2DBAF3FD86D8C7C018 CAROLJANED
438,345,962 *2C6C11BDE1B4790B9D90CEF859B9F19E99B8185F ROBERTCALM
438,345,963 *2C6F1E3E31D820A00E44E5EF350BCF0779621A6B ARMANDOZBORAL
438,345,964 *2C6073992A3C25FA25BA71960EA504F6CACB8739 armentris4
438,345,965 *2C68BC9448F78FC04A0C1F2352D50B836F485919 robstaniforth
438,345,966 *2C687664E411EB9507150F20C86A7138B8455634 CASEYMAEWEATHER
438,345,967 *2C67B0880D59780E8FA29A7DADA1C1734FF3AD2B ROCCO.PATRICE
438,345,968 *2C67EC3215B210113B40C0A3BBC4AE1D48A88B36 ARq
438,345,969 *2C665332AEB072361285BEABB4CFB23DB3D8D4C5 ARRONBREDEHOFT
438,345,970 *2C6A5AF93229AE37411C94253453283BFC8F5B6A ARRONCLEARWATER
438,345,971 *2C6003160FBB4B0FC49354D0CF4DDFCE201B6409 A_R=S
438,345,972 *2C67100428F8087A45D0F4EA4D19941FB62DE190 CATSPEL
438,345,973 *2C6FD783884D8564AC47C8426772DE49ED2D59D4 cb7c
438,345,974 *2C6CD5DE7DB4D53C74E5CE9AB3AB01F6D0309F92 rolandoascheman
438,345,975 *2C6EEE497730ACC493FE0C948898F12DE203EDD2 [email protected]
438,345,976 *2C662539D558A21A7CEC96E608DAA6F80755A5CB asgsgfg
438,345,977 *2C670F27A946BDC89B1DEF9EBA6614C82CF0747A ashleyzyla
438,345,978 *2C68885C76A441E6AC51A461F3B85D5591A762AA ASIPHONA4
438,345,979 *2C6A3A7D9B2765576CA815E5D3439846BBFBC0AC ronddansten
438,345,980 *2C68751BFF1002B52DDAE2BA29B62CA1B8F642BD asporogenous?
438,345,981 *2C688260D02CD2D9187A7AB7E7FCFF0125AC4CB5 Assault.Plague:.7
438,345,982 *2C6F8F8274F35F61924D204C93C20342EFB4671D C-D6
438,345,983 *2C63194985A942C84853EFE681256BC46F7ED78F At"3
438,345,984 *2C6F9D5FA85DD78CD8726727CAA6E376DB78E7A7 cedricfeilds
438,345,985 *2C62AC265FB96A824FBB8421D72F5795017441E1 atsco
438,345,986 *2C6C494A4590EE9A440D8F170EE4DE1C56D64BD4 aubreynageotte
438,345,987 *2C655C6F2B690D83BE032B6F83A9D7DF19D5199D AUD;%
438,345,988 *2C6C3FC88404A600997EAE4E310E08E96A3A6BBC CF4
438,345,989 *2C661CF4FA0C21420D1459F26A120420C32B82C6 AUNIRENT5
438,345,990 *2C6688B51D335DEB9B1C2C901CFE5C2B2AB8083B [email protected]
438,345,991 *2C6B23BAF7FA40860F65CB14C69724429BEB71F5 AUSTIN.GERONIME
438,345,992 *2C6725B37BDCD146D7D715BC54208E1FA126E47E RUSSELLAKOTA1
438,345,993 *2C60FEFDD2EE967D458E0462438E022ABD85D5A5 A VERY MERRY ROCKIN' GOOD CHRISTMAS
438,345,994 *2C6D71C433BFF2F368E5D795ACEE08644D38B66E S1DE
438,345,995 *2C63DEA407601214F3B36D2D6A895259C3677CEA ayicw
438,345,996 *2C6A34522E788701B5DE05CCCE702549180A36DB b2&,
438,345,997 *2C67B66EBE4784899F4DD6390274F4FEA6A9C785 b26b7
438,345,998 *2C68B16E21532D838CF8AF5B36AAA6AF738A5C2D SAMMY.RUTH
438,345,999 *2C65C857BE376ADC8FEBD9D3C417C9E25CD08048 SANDERSVIKINGS4
438,346,000 *2C63B9F781203BE33156FE447135D697B5C3098C b/3"k
438,346,001 *2C6510EED250059D0B36A11333B0D57C4D7227D5 B;3O6
438,346,002 *2C6E2C18221F2CD95DE2270D76C2D5721958E63D ch8s0
438,346,003 *2C672257A351C162C863FF99F1F14B341ED916B1 CHAPTER 36-04: THE FLAW IN THE PLAN
438,346,004 *2C6E03D3F209F250A0596F3106A52F93B595E919 charlesbertels
438,346,005 *2C60FD5ABB941D1783C9A559C98398E5E26CA9EC sarojening
438,346,006 *2C6110F6BF4409FD58CB379EF79E8277AEEAF8DD charliemillich
438,346,007 *2C61BFDD42CDE71687E8E43DF9FB39E091DFBB73 B8WM)
438,346,008 *2C634FBA03F7611A1316A727EA032FBD9622567A \/baa
438,346,009 *2C6383BF50CE2A429451E0C16350D8E7CA262079 [email protected]
438,346,010 *2C6BBE51E89C2ECE0536D171450B787C54BE82B3 SCOT.SCHUSTRICH
438,346,011 *2C63626F4DF914D32FFFFD777E4B45BAE3401ED9 SCOTTWEISSMANN
438,346,012 *2C64C57E9C36948DC694F529BB784F1E338102DB SCUFFED
438,346,013 *2C62F21962DC0915A99FA9C338AE45C3FAA47E9E CH(LQ
438,346,014 *2C6F4CB6074554D76EFFB4345E6B2FEBC42E3430 SEMANA-OTIMISMO
438,346,015 *2C6F040CE84D60EB8D8015864CD404AC8A44EC28 christoperschwizer
438,346,016 *2C6FFFB7197576977DB53640ADC46B7CFA6C3F95 [email protected]
438,346,017 *2C62F6E156D5ED03B32D67AF2B47F32B7DD8E938 bbu:p
438,346,018 *2C65C11E821CC381F0BB5DD1DBA3ADF7332BD1A9 b!cqd
438,346,019 *2C632FECC2B3C83A3851A2748FEB8D49BD407C1A SERVIRMES
438,346,020 *2C6311AEA71EAEEE45FD19DB240F61C09F3092CF CIICU
438,346,021 *2C64880D6335BC69E1A849A3B4B4F171B9F23E6E CIMBRN
438,346,022 *2C6D85B2CB6D64F2E47A3A87FA355605A2BBCD59 BELEMNITTERNES
438,346,023 *2C61BF8E83A014825C621E7500B6649160C41624 BENEDICT.RHEIN
438,346,024 *2C6D98CD15B4A7F2F596FD5252D87CC9F9C76E5C beneventans
438,346,025 *2C6B67E4EE3547800215D7444C4CBEA78F9F3169 benkennerson
438,346,026 *2C6D9904A9CB0413F168070A0B50665CC13FD10D shaniatwain
438,346,027 *2C6F0A9C29AFCAA5084727B71B7854294C9BA103 BF6F8BF606B24BB7F170326BC46034EF
438,346,028 *2C6EE90E8180CFF1D2E05208046873731FF82624 CLARKSPINOLA
438,346,029 *2C60F2495A713278F09A28210EF11A1694C2D295 she's.your.lover.now.(21jan66)
438,346,030 *2C6ECD026B4C7758C85E183E2C93D8883D106DCF SHETTERLEY-EMMA
438,346,031 *2C6D4AA31DC0DD347CEE1A0B9B5609C8510DDA06 b?fgp
438,346,032 *2C64202AC0C334B9931DFB49E3D0873291D17535 CLHPP
438,346,033 *2C6CB3AB1F6D491682921362DF1C2702B6A75BE7 SIDNEYHAMLIN
438,346,034 *2C6F7474CFFB53213AA0D703A221412437533A66 [email protected]
438,346,035 *2C66A7C7AEF57BF60F516CD5510478D41AC1A640 CLOSER(FEATJDDAVIS)
438,346,036 *2C64E7081195AB1394FF748B2054764FF37F1FD1 ClW
438,346,037 *2C6316362E0ED648185B95CFB79674F6DFCD7A46 BILLIEOLP
438,346,038 *2C69DBCF4F185723CD9EEF7FB4A7A28A95261137 billsaffer
438,346,039 *2C69FB9C004B64D7464A77A64559F77CDF047F44 cnaw
438,346,040 *2C64584814AED020B955D57D39D07D891E2730C8 silbenverständlichkeit
438,346,041 *2C654D0131D89C1C6C6BE50DB00B4B823568B700 c#o9t
438,346,042 *2C6FF839C197290A721D9DDC25C654D426E8D179 BITBUSSE!
438,346,043 *2C682EB8EE69E4AE16F212F7649D57909D472F7F c=oi7
438,346,044 *2C6A57A02A44E829DB1673111A7543988B08D3BA bk4fi
438,346,045 *2C633BFEB59599F6C4E87B5B33CA8C76B6F7E72A COLUMBUSGRADEN
438,346,046 *2C67F63D4F32570E5043508A193C305CE9F1E660 [email protected]
438,346,047 *2C639FA1A1FC4CF75BC9504BF19E4914B9DCB1AF SKINNYLOVELY
438,346,048 *2C63220EF4F59D4623C07D37F8EA65A4BD306DF8 slemrod
438,346,049 *2C68AB6ADD21EAA0C056E929729556AEED2E7407 Contrasts,.Sz.111:.Verbunkos:.Moderato,.ben.ritmico
438,346,050 *2C6BE1FFA2C90648AE09219A7792721B2F8D30C4 slknwsrvrv
438,346,051 *2C6BC3B73FC45D74BC9C2FCE32B63D34B3B02E6C COOCHIECOOCHIE
438,346,052 *2C65188CD1A7437510681C9855E78F77411F058D COPA.ITALIA.
438,346,053 *2C68A500A3F393229E72BE68046A9353705C5C4C BMILLHOLLON
438,346,054 *2C61D28B70BDBC1FA43ECCC343AE0121FCA167FE smite-the-sons-of-bitches-josh!
438,346,055 *2C6B71DDA4398847F239A9C060F7C6D24C7DDB4B BMS$
438,346,056 *2C68E04A69166A26360C545B05FD2ADF67978005 SMÜCKEN
438,346,057 *2C67C1EA40D4E0983E1CD3E80657488D1FF46811 [email protected]
438,346,058 *2C6749F694D7F8C40393989683D41C9F6F3F7DD5 BN0Q)
438,346,059 *2C6A592A273486630A24A120CF48EC8CFAD64E0A coxales9
438,346,060 *2C6FAE6CE513B5CAFCA2E334F4ADBCA7F71317C4 CP5BL
438,346,061 *2C68D2FD8DBB244593F8513C3968AC249F226F41 b(oc
438,346,062 *2C60CC2DE3CCEDC24972135F858232A96C4C5722 [email protected]
438,346,063 *2C6020EDE89039E894A589433D3E017D9998FC99 borisozog
438,346,064 *2C638473D90EE5E6AC5B7C69BF62C83044A19CF4 [email protected]
438,346,065 *2C6F722B07A3F3A975B5A8DA92D080887CA66733 BOYCE.BUETTNER
438,346,066 *2C6B84FB29FC30DE293F6D1C93B691258500B6C5 cqikp
438,346,067 *2C6EE54E2B80C935206B2565107CC15831378CBD spiegel6
438,346,068 *2C677CFDAAA1BE1F5916B5FA6461AB851D8D709E BRADY.AGORO
438,346,069 *2C6A15C9BE80E95D278DD1653D11DAD503D456D0 CROCKETT.7
438,346,070 *2C6F61B094356D2B6CBE3AFBF6D4B945FFD61F98 CRODRODRIGUEZ
438,346,071 *2C6CCFCA1A73177A800070B19A2F0321EE75407F brandengreenbaum
438,346,072 *2C681727E89EAC2323963FAF07708380E9200829 brandi.rawlings
438,346,073 *2C691D5E2D4ED16A1EB51FD08B4F839BD36361C9 BRANT.AGERTON
438,346,074 *2C673C6987069B23DFEAB990F32C7ACB8AA63461 cruelasitu'mvosaimar
438,346,075 *2C6336C5914A18160AE1E94FD10CA10FFEF21E68 c%sr
438,346,076 *2C6BEAAA4484F2C2E0CF8E009F27D12E7EC63067 ctrraptor93
438,346,077 *2C6170AF2E956232FD16E175E2306ACA8BE09637 BRODERICK072
438,346,078 *2C6F26DCA3B22207E7EE5DE6EC56EA06F8E2BA2F SPOSSUCK2
438,346,079 *2C6C9C4D015F9EEFF04560AE39639E6AD54E71A0 BROOKS.BLANDER
438,346,080 *2C68370A00FE6B2E6D52A6A8D79488504E4DE62B squirrelicided
438,346,081 *2C69EC2016D4EB11A4D4D0FB736A23E3020DC61C bsfr
438,346,082 *2C67EFF884226DAE573F7B05F8D4A4BF25F0BBCD cytg
438,346,083 *2C6A5BB84DF27AD4DB348F6936627AC1EB5DE96D cz(dq
438,346,084 *2C601D77947F7EA1F763253C7F4EDFAFED1C1FD2 BUCKSMELCER
438,346,085 *2C6139F6A9CF9CD115E62E2C0F18BD6D963B3D32 d15p053
438,346,086 *2C6D20B75CC7DBE570C4D0909B4A8D49AD47E4DD STISTED6
438,346,087 *2C6506BCE5B1A6CD92311CF8EEC893A67E54AB0C b?vds
438,346,088 *2C63700FE844E2F10E148336E2FE37244197EFD8 STRÃULEȘTI
438,346,089 *2C6DAF9744A575BADE85DD89F10F29B78E560E35 bvwn.
438,346,090 *2C6ECD3387F47089E73405EF1620A9D1EC3F15C3 bz,s
438,346,091 *2C6CB6ABB06B44731E44FBAAEF487D3BDDC84D28 c0)$n
438,346,092 *2C695C6F9C7EB265838D536A7E54EDDA342E7E6C d4e0r
438,346,093 *2C6D2C21C024E813956F94F5ECEC623D0D662B9F d5oren747on
438,346,094 *2C63157CD003A50A5CD951C980A21C4267C18B6B [email protected]
438,346,095 *2C6916FEC1B338CBB8E8642E339886A662847CEE SUDHIRPARMAR
438,346,096 *2C645B6C41DCA568DD97AB6D6C758A95A893A929 d9;c&
438,346,097 *2C678F53B2641056729B9797A08AF73249BDD24E d9fep
438,346,098 *2C60366BCD6EBC5A6162E73947565E73450218B9 C!7OQ
438,346,099 *2C6D19040CD9F076C791EF4CCF134AE004180DF8 DANIELTEQUIEROMUCHIS
438,346,100 *2C68BE6DEFBBBFFB29C668BF9878282A21A1A962 DARWINSHORT
438,346,101 *2C651ABBD527FF10BB3AC708FEDC5B288EA5D9FD Sweet.Talk.1
438,346,102 *2C6E08AC2F5CEE3C33039FC0417D90E034523B85 [email protected]
438,346,103 *2C6B2687440AA9AA3B8D4B805487BE93F395F93F [email protected]
438,346,104 *2C6C0A6B23A001C9C8C0960C9D83E8FCEC7A9337 CANDIDATEFOREXECUT
438,346,105 *2C6187D37A64FBD239F862F5D7755E4CAB5B32A1 DAVIDLUTTON
438,346,106 *2C6C184A8D354C74733729EE5CECF3E405B5E45A CAP1(
438,346,107 *2C63AF666A583277D0F29CA224FE9D6550276CA4 CARQULLAIT1
438,346,108 *2C687717D87246621AA946DD8CD58D6073941566 dbn)o
438,346,109 *2C680AC917F37E8F5E334D6B1D9F807E962FB1D0 casiopasswd
438,346,110 *2C64DA5DDB1736CC1279F0B4E4579B45B26155D1 CASUN
438,346,111 *2C62F8A6DE30085DBD78E3E525905ADF0E626844 cauap
438,346,112 *2C654543694D503DDDD6403CC4B9C8C25E1914D5 DEAT-HOUSEHOLDENERGY
438,346,113 *2C6F237B59119CABCEFE03FEE2D3792BBAA48753 decisionsimade
438,346,114 *2C6BD3D2DC44C17B2CAF8A01E9D1B33F5F269DFE TADRUFFINS
438,346,115 *2C656977DF72B2B7574F7B6AA1987AF644D195EE CC0NI
438,346,116 *2C609FBC7F7CC54B007491944E027AB16FEC9D7F TAMAWUT
438,346,117 *2C65763BFA9B12DDE03C1D9292DCB5DF012E3241 TAMIAYALA
438,346,118 *2C63E607C20F3A16F4306FBC10C39CCC36536DF5 [email protected]
438,346,119 *2C6572877F193D74BE78B1832743B60C75C62CB1 DEMOBILISERENT
438,346,120 *2C63EC83027776411D397BA4456EA09B1F03C698 [email protected]
438,346,121 *2C6BBBF9B0F7268CA8FF8918D003FB1FFE2E6D3A CENZINAED
438,346,122 *2C61A8E2763378204FC3B7B51BDB41B5C35EEC8F depoisdachuva(out
438,346,123 *2C67949D280F42AEEDAF2FD25FE8ABC28A9146A4 DESIGNL6
438,346,124 *2C6D941EB5EBFA223C30486C7B217287BC8B5CD7 cfuiz
438,346,125 *2C69E85F7C35FAD9AAF836B78202C7A6E07F1C68 dewittorganista
438,346,126 *2C61B4535EAC4A07998E3EA5471E1CB8037DE14B dexterprinciotta
438,346,127 *2C64FC900F0E7E7039D15CEED7588B0D061D33AA DEYNIM
438,346,128 *2C60569C56D87F1F62DCC1C31E73413A0B6DECD5 TELECARE7
438,346,129 *2C6CF3E3A23A7C0EDBFCAD6DB3AEEFF195A3FDEE teodoroniffenegger
438,346,130 *2C6841AE08C830D38A3A5DB76E896C72FBA5AA29 TERRELLHENSCHEN
438,346,131 *2C67A628EF575C9F7FA089C4C9E462B7F5A5F084 chaoyong
438,346,132 *2C60D804182E5AD3CE6359BA1DE2672133370A90 CHARLEYKOCIEDA
438,346,133 *2C6C20DE38D3F4FE8EA99338E9323CB59FD415CF CHARLIE MCCANN
438,346,134 *2C6B523596E8F31912DBBC8390E9394D89369890 [email protected]
438,346,135 *2C6C0A24AF5C4ED1AD18D998E2CC001090E86A72 D_GKU
438,346,136 *2C6E5A079DAFF82DE11342FBDDE1773E7BF6E986 chellfoster
438,346,137 *2C6DE83C627CBE8A58EDEA980F9DF0FF37441B6E CHEN.MOUSI
438,346,138 *2C656FC987E66A1D4F4AD80668705011B48D4892 DINOSAUROBSESSED
438,346,139 *2C6AB55AB8F2647376938B62C68E2FE74FAE57D9 THATMOORE1234
438,346,140 *2C66BE665AE798400D62C058D73CCF15830BB9B5 DL04AD01
438,346,141 *2C654A148011F00AC8C3FD8455164F9769EEE245 DLRLXO8720
438,346,142 *2C6B3E737AAE97E18D9769FD10110BE80CF5D775 CHRISCOTE
438,346,143 *2C6AB0D8100A6809EC2218E21C1A7D570B59AFD7 THEWARRIOR6
438,346,144 *2C6F283DD53EDFC308642AFAB40C25A671A4C883 THOMASSAMPERE
438,346,145 *2C66B816DA56B453BAA3868C4583D6A9E28B6C25 dogzb
438,346,146 *2C644FEADEE76F5E36732F98D1778A4D8437D5BC THURSDAYCACTUS1
438,346,147 *2C6E353D3484614C41088507DCB4E25D0861566B cj80b
438,346,148 *2C6B78B486722F88E99A0A4C46E5843EA053B77E 'TIL-MORNING
438,346,149 *2C65B55CEAD58B789D3750365097B20870DBF502 DONN.ZERMENO
438,346,150 *2C69A7B9113B9D76FC35E49D62EF7E26B18FC9D5 Donotkillallofmypartyguests!
438,346,151 *2C600C1A9488B6FAEFF3612E4AB78761B677B824 TIMBRELEDS
438,346,152 *2C6FF90A6CBB1BA6D41A6407754FD823FDE2E9E8 DONOVAN.SAVIC
438,346,153 *2C6249096F76C7AE2141EE7DA0F3DABCCF4AAA82 CK4L0
438,346,154 *2C6996748F159D8F38D89EADA6866F153CDB3BE9 DOOR.OPENS.AND.SILBERMAN.STEPS.OUT.
438,346,155 *2C6AB6AC3A410335187E28654C22FE5751E76C5F C%L.
438,346,156 *2C6CD931A2CE66D17DE8ABC55223BA41BC045BE8 TNEIGUFE1
438,346,157 *2C613592021305668C56CED0902B0D56C8DE73F8 TNEMESSINUEJAR3
438,346,158 *2C6F6CCCB1192F19E8FC163FCBD182BF9009A785 tobe
438,346,159 *2C6843D9947AC9B9B7FAFA42EF1E4F512D9BAD73 TONYPERRERA
438,346,160 *2C6740B19A6141721C26C5ED22E2DACFF7101B76 clayfinco
438,346,161 *2C65B31CF00E64BBF97B3E7AB2FFAFBBFF4EBBCF DOWNSCLAYTON
438,346,162 *2C6FB1BAA3BF41C603E1E4B36504D10378D9FAFB doylelannom
438,346,163 *2C6AB1D9D3AF578570266E669295CECD825FF344 tracy-sidhu
438,346,164 *2C63E1D2C68457109AA4CC8200B7F7183A53BBF2 CLHPP
438,346,165 *2C67795689197B5E203EA1E6CAD288BE40EEA34E CLIFFWICKS
438,346,166 *2C600E430FB5FC563968C40D896F48024C04E27A CLINTHARRING
438,346,167 *2C6177E03B75F8208DA87FABEB0D7CA079C6CBE6 CLINTONROY
438,346,168 *2C6B2DFF8F8AF07AEA553C0EEDE87EB04B551125 DQ?BP
438,346,169 *2C6759B5905DF8253B901A27B0A8C2056E29B001 CNh$
438,346,170 *2C6942DF000064321D41CA02695E2E1F511C0727 DUPY!
438,346,171 *2C616C5441627C9D0BD7A7C49166B681EC371014 dustyprosser
438,346,172 *2C6E790FD5EE30CDADC315A1015BA9BB95A109EA DUUA
438,346,173 *2C66F08329295B41C8EFD3C62B8591C4B977F999 dw(bc
438,346,174 *2C625B1EE168A59029FDD9000CD8044DE95A7403 dwikurniasari
438,346,175 *2C6CB95175EDB45FF523C77847068163B5D404A8 E152797
438,346,176 *2C6FC9EAD6C8F0A5DDC770C99028E3B1227ADB00 EAKAZIE
438,346,177 *2C6FB5A340A7B88FD45578DC4CB25D600B43A002 EAZYPLAY
438,346,178 *2C6625226D5A36DA9A1F30DE1D60895DA23A3CB0 EBZWL
438,346,179 *2C68F16979619B1338549606ACA747DB3E10B2AC Cp)_
438,346,180 *2C69770912FE8DBA44BF2D3262E34A74905FA119 EDMUNDO.BORS
438,346,181 *2C6890F9AC05144F4D2E963D264C3BAC32471BC1 EDREPPINS3
438,346,182 *2C658CB950C7E95B29BB38D031B0C37404A0201C EDUCATORS.3
438,346,183 *2C6DD0AEAC93B2005A9A195549A762F1CE322726 [email protected]
438,346,184 *2C6DB169104F45D25F64A842F2AB322E1D4777A6 UCHE.NELSON.AMAEZE
438,346,185 *2C6A9144C2EF2C89D8E449B1D975445CB75F27B8 [email protected]
438,346,186 *2C6EFB0F6FDE1DC43E5D0FA6923F91E2CB220A58 UDDASS JUTT
438,346,187 *2C65292F799F35FB828EE8D3DD898793E99C9EC2 C:\PROGRAMFILES\COMMONFILES\ADOBE\HELP\NB_NO\EXTENSIONMANAGER
438,346,188 *2C617771FDA8A8B363363C87F11C05388070270A UITEENSING
438,346,189 *2C60930CE03CD79F2E495CA395AB111E4D6D7A20 cptdf
438,346,190 *2C6C8EE0DBED35ED742DAF8DB7423720C1091E91 EF2BE
438,346,191 *2C6AC57AD3C652C27ED3228968B3368E3701E2C9 UMAR.LATIF.SALIM
438,346,192 *2C600C2B8C65EB8C3D567846579378788F212C04 efy-7
438,346,193 *2C6009F5D33883FA9392AAB1605E8A8D022E5EE6 EG4JIMW6V3E8
438,346,194 *2C6AB8A23BC9CE555458B44E9A2A794E9A77E009 eg?)z
438,346,195 *2C6085A2637502483E1C9C9FFF73A0182664E59C UNDISPUTABLE!
438,346,196 *2C65EB677392EF3272F29FDC5A6A14C9BE9B063B [email protected]
438,346,197 *2C6176B9F80DB47346BE66F8D7C8A0F67B030131 [email protected]
438,346,198 *2C6C6AE2293FF4A9CB732810735696AD34F606A1 UOLKY
438,346,199 *2C6F842844B65D57B71BBC0E5C8F1F08F6ACC7E1 uoyutis6
438,346,200 *2C69F290902D056BEAE44EE707BD525037D7A351 elifbus4
438,346,201 *2C646F94FF3A82E51A8D9450E36D250E8D06A1E0 [email protected]
438,346,202 *2C62C93E8C8365A6E9FDD19320CE8C450C817889 CSWMC
438,346,203 *2C64A50FC4CDE4A57DB7F105547B167193AD374A USER_TALKCPROMPT
438,346,204 *2C63F36415270C9BC4F7A64F115F704710D5751E ctlf
438,346,205 *2C6FAB4EB5C1F044376BD539B19C57786A604E18 CUMR
438,346,206 *2C6507C5AE5EB4DBEB7D4A3D0D767734D40B6173 curraghs0
438,346,207 *2C6A65BC82CEF94BE653A8E6A74239D8C8AF75EB [email protected]
438,346,208 *2C676C516F77539A7BC8245328F0C135DCCF1DC5 emanuelstoppel
438,346,209 *2C636231D28F38D259F17A9CF323BBCDBE6B7DA8 EMBRUNCHURCH01
438,346,210 *2C6E35994EC9BDEAE85BA9138592D960C242CF70 v4lley-m4
438,346,211 *2C614FA20ABE83912C2A9CF45314CD5FC9392EBB valeisembritman
438,346,212 *2C63A78B04E0EB63E227ED35A72ADE5E1D27E54F valentingoatley
438,346,213 *2C68CC1B71E0528488B64CDD1D02A154C812A0C6 c,+y_
438,346,214 *2C6107B34F19CB3777181B590F2ECB1FB961104F CYCLOBENZAPRINES
438,346,215 *2C69C3A263DBBA807C166AFC3D5EFCCB5DA9E487 EMuj
438,346,216 *2C6DCA0DC35D95EED90123E8588A48FF3AF12282 C{YT
438,346,217 *2C691A6DA1FBDF9AE3FD91E8F63887E76F26E601 EN1921555747
438,346,218 *2C69FA25C39CAF2CF6FE55EF86D8A574EA79FC2C ENBW#
438,346,219 *2C65F5EE1DFF5FEA9F120009D963E034D72D4F43 VB<\
438,346,220 *2C646070AC8E19B9A13779387ED70BE63EBDD477 D&4WU
438,346,221 *2C64DB77149A0FD15026523F647BE2D9C84218B0 d5wub
438,346,222 *2C6FCF13511211DC546D260C165E56F0B106A3B5 DA9A=
438,346,223 *2C6CFF8CAE2D302C224D8AE2016E50C397DDD673 ERWIN.LONGHINI
438,346,224 *2C6990CD90363B96B7B79520C20E8012E922B593 dämpfende
438,346,225 *2C643C1BAE268F4CB83C90727594F92DD23C96C2 ESTEBONING
438,346,226 *2C693383F42F89E758F9F29DBDFB7C6743EA887B DARK-CIRCLES-(FEAT.-KEN-SWIFT)
438,346,227 *2C6381EB6EF8990DAE1F322A033875A0243A1624 darko-boskovic
438,346,228 *2C60B52F2D715CB5FD4FDE00CF936D0A085CB7D6 VICIANUS
438,346,229 *2C604F8446B028F7A30950546AADFEA7CBB24BFE VICKY JONES BENARICK
438,346,230 *2C649D91B3DC2FBC71A24E878790958B87B13EA7 //==DATABASE
438,346,231 *2C6957DAF6EDD0078FEBCF0BEC7AB6BF91A047A8 [email protected]
438,346,232 *2C6C2DEC3F15F5C42EB191E7C8C8E24ED1340C6E EVERETTEAYALA
438,346,233 *2C66367439CBCBCE85324F1A0B20C06ADF53F011 victor-navorski
438,346,234 *2C6E592329FBB66810AB15BA1844AAF4C936FC8C VICTORPEUGEUOT
438,346,235 *2C6D5D3F81B4E4DB8794E05D8CE319D5E0FFA212 DBERN92
438,346,236 *2C681BF0016C22E893EB46D73E789874BEA6F6DA excuses (itunes originals version)
438,346,237 *2C6493FEC4B9B2CFA7EA621E49394BF47EB123B9 vincent-realeza-castro
438,346,238 *2C63470DC2BDC11545147F8E8307B5809B4E0DA5 vionnadahoodratshowwoods
438,346,239 *2C66CEF33213ADF222D9B368A1D85A2084BEA4B3 DDH#$
438,346,240 *2C62E3E3A7C2919DB71B9D719796BD0C472B3507 VIVA JUSTINE
438,346,241 *2C68B956BC985933426055E00577F5D23BF6779C [email protected]
438,346,242 *2C6889E5CC5CE158EEE2F3F662AD5BB8C827BC4E VIVIAN SEBUGUERO
438,346,243 *2C683E709594BDAF7C1F562B0E455526E5277C5D FANSWE
438,346,244 *2C6A00891A32F6B13E836F05733D69CC8C094908 DENA.PATTON
438,346,245 *2C62792484E371F43F1B7533747CD5A3180E1E85 DENERLES
438,346,246 *2C6DC17B0C70E4E849096803F7A3492CB6C356EB VRATIPLACHTU7
438,346,247 *2C67894ED6204E1097E58CC98729321544A6E058 FELESHAED
438,346,248 *2C631EACB54973738D57744C1BA44868D6860B04 ferminturvaville
438,346,249 *2C6ABD244E1427AD94D4F869984AE555DCFDF2F5 FERNANDO.OLLILA
438,346,250 *2C66CB540EADB5C3248DD37B61EE2EA78203F5E6 waar's.my.pyp?
438,346,251 *2C66A8BE0E43DC9EB39243B50581E83C701BD83B first.return
438,346,252 *2C68D4139B58216189CB09884087B64A87122704 walter-abrahao
438,346,253 *2C6524F94CFEB6F6398CF2579EB565ACEFC1FAB9 [email protected]
438,346,254 *2C6FF236A8CF3439F7515D328810A8781721F36C d#fe7
438,346,255 *2C6CFEA90652FD0B22AACAAB53B00F32B7FADA58 FLYNKHIE
438,346,256 *2C6C9A7A35F9A938344F2A08AE885707ADCF9C04 foc&
438,346,257 *2C64B877F4E16B623C9F5CDB7AC440669ED1232E FORESTBILIS
438,346,258 *2C686505D3494836CB721B360AC9912DDA6CAA5E DIAL MY NIGHT
438,346,259 *2C6EF5C9012060FF202ECFC546FE90A6AD1BCBD1 WASTE NOT FRESH TEARS OVER OLD GRIEFS.
438,346,260 *2C6B844C5A1478DF0778D149745D08BBC657F52D DIEGOVENTO
438,346,261 *2C69DD11DD4142C9981E8A3FD40312D3265499AD WATERSYDNEYING
438,346,262 *2C6197F0EDC57594FB2A67A2FA0C401268C29FC5 DILERIZZ
438,346,263 *2C649A6263C28788E551A1803D8FA056683C06E4 waylonleny
438,346,264 *2C6042CED7C18519485F9786CE2C278FE5FBAB22 [email protected]
438,346,265 *2C6C86E7233C0BB90EF6504319FAB29E54AADE5A FRANCESCASADO
438,346,266 *2C69889523BCF883EC3557A5DA7BD1F309F419A4 FRANCESCO.STABEL
438,346,267 *2C62DDAA2427E725C7B5DE4078ED09BEC400F98B [email protected]
438,346,268 *2C640D457A97281689376B080786B0F870A2D6F7 DIRECTORMONDAY-THURS
438,346,269 *2C6499ED4C940A97E34E2B74875545165DD2F562 FRANKLYN.BUTOR
438,346,270 *2C6BEA7F6CF12DA955A1F95C5A56D261E428B450 [email protected]
438,346,271 *2C62AD0E3CD768786900C623FD23E8E28B12343F DISTATIS9
438,346,272 *2C67906E31CD925D28246E56B29797E1A0147860 WELVAREND2
438,346,273 *2C699132D353A19060B5C1B04F9EB699614C41E6 fredricdininno
438,346,274 *2C647F72E47158AD3A80FEB319754C98D54340FD friejohr
438,346,275 *2C61629CFE8070095CB79B3715A0B5DB36C3AA36 djl:n
438,346,276 *2C6168D1BDAD43E2A48B37B2C01154EEB0731BDA fujicup
438,346,277 *2C66294E23803F45381F74069BAE71FACB745B23 dmmgu
438,346,278 *2C6CE065916EF9BD6D6E513E7A7EDEB99D97EF0C d-n-d
438,346,279 *2C671F663B32FDC1FC04371B712ABF06D98C72A7 GARRYCARBARY
438,346,280 *2C67C658C38311511CF13E4DFBD1D11364DAE1A7 DOANTHIEU
438,346,281 *2C683BB8F8EF428018D22379BD50BD9F18CDB2E5 WILLIAMBONNETTE
438,346,282 *2C6E1266B1CF308779B2DEF3FB5CAFEF14602CB9 gbs~
438,346,283 *2C6A2504C9E13EFDEAD2E59E7C072E5150588759 DONG.DESHAZIOR
438,346,284 *2C6C8F683722C2419AD53ABCF28B2555ABD87DFE donna-weatherall
438,346,285 *2C60117A44C2F30B25B6F551570B79FFBB8E11D8 donncumba
438,346,286 *2C6E49A6F4A3AE92AC80A3E07D612B92AAE04ADB GENARO.RAQUE
438,346,287 *2C633592763F71D053ACC2C711719085664CD0D0 g\ev
438,346,288 *2C6A701999A04C8A488DBAE2B5BCB40DB0B23C56 WINSTONLEVERSEE
438,346,289 *2C6699DA54046F9A4CF5B2B727F728C729FA6435 DP=N
438,346,290 *2C689A5646A122F0217B072AA7795EAD043EA449 DREMBSW5
438,346,291 *2C609678DAE1E3B0D372FA8A4D6E60B048013331 [email protected]
438,346,292 *2C65082BD2BB4D9DC591BDA21CEC19F73DC5BCAF DR-LORI
438,346,293 *2C6558C1B2CCFF0FEC30079490CDFB97AF624727 [email protected]
438,346,294 *2C63EFAC1597BB4BAD6567F47634E7C153709B8B DSR5P
438,346,295 *2C646F1B3CD093276CE3ECD705750F316782509C dtwam
438,346,296 *2C6C56FA150F7699E069DEE19518B193B43E3322 wwwtomorrowsbridalcom
438,346,297 *2C6D0E315F3DAA57767665D7B193F4380A5ABDC8 WWW.TRANSIENTMUSIC.COM
438,346,298 *2C6A64C3E008291EB059E557546FF9B6D7C802F3 WWW.WALDOMATHS.COM
438,346,299 *2C608C734DDB18947C60C6A4B576B4D9F65F8AB9 WYJAŚNIANIEM
438,346,300 *2C6F2F3A4DDF1B65A619FFA027DB6FF273A87E82 WYVEWYVE
438,346,301 *2C6448F45311160C943194B991A4E675D593A046 XANADUSNICKER8
438,346,302 *2C612D8BBBCA916ECC8D1FE5B940CA4797DB7756 dvbl
438,346,303 *2C63ECED81FDBF9072EDF263A75B2C9D48330227 GSCABORO
438,346,304 *2C64C83F5B22E51A1B53D8C2C2F18230A2842588 XIMENA328
438,346,305 *2C6C21712365FCF32A507B6A20818EF38B6572E0 gud3b00k$
438,346,306 *2C61825D24267F45466DE6EE68901A2D5ED2488C [email protected]
438,346,307 *2C6CC44302340E5712993805FEE77BC31786F179 [email protected]
438,346,308 *2C6B3B81B44B44E6ECCE861777A55749207A5361 dysbarism0
438,346,309 *2C6A771E25B13639900C615FBD2BFC63BB761B81 DZMMRY
438,346,310 *2C652A50BDD294CEA40975EE59F168594FDAC5E3 [email protected]
438,346,311 *2C6037458AADD6AE0DD5A9C379B809723D015A26 YAMRAJ.THEKIING
438,346,312 *2C645B2373BC98A1748C6E8D2F0341F9B46EF028 [email protected]
438,346,313 *2C6D73D118ADB3886156146204665A723C7B3BF2 haematocystis
438,346,314 *2C68067E74ABBC4ED071E9DC47913DEF7F772676 [email protected]
438,346,315 *2C61B7289A44FD6789AF1B3F1B7BD579E96778DA [email protected]
438,346,316 *2C6B3B8A2A0D59858442D65425F813C847A1CF90 hakirlik
438,346,317 *2C6441249162EF85D5CE888A667C578325ACEB4B happyhourstudios
438,346,318 *2C6EAF083736D93F4A1C8ACF2820E2F05F2D1E0C yeikz.cheng
438,346,319 *2C6B48F22A90F65A6ED5EEB0BF963AEC94D2A6C9 HARRY4
438,346,320 *2C62538CCB45010A27B4D69F91935ED3977C7179 harveydesso
438,346,321 *2C67681AC7B35861B704407A875970E89A810C1C haywooddegeorge
438,346,322 *2C65FC7AF53AD628A9EA32DCDC7FDD3A25BEE4D7 [email protected]
438,346,323 *2C6B273ACDD8488D8CB351603844AD5CAF8C7FCF [email protected]
438,346,324 *2C66EF17D204D1F8432DDF637F88E9EC1F949C7A heidi.schmitz
438,346,325 *2C66649839722A332D21B841ED49349D16BD8B79 helena541
438,346,326 *2C61CF301EAAF05363CB16AD7D0BDEDA5D62B118 [email protected]
438,346,327 *2C68A50EAC8A25E8532CEF327AB7AD8673B29B25 HERBARIST123
438,346,328 *2C621086A16EF3D11AD0B91E4FE726A8135EFE9E EJPMEOLBBED
438,346,329 *2C66C4C770B32E9B8EBAA458027BE7F380CED1B4 [email protected]
438,346,330 *2C6B69D7C6566A0BE0B21704F43A4B19D9C2B4A2 hexadd?
438,346,331 *2C64FAC2086DF2CE92BECA6C78F28E1760AFD851 ek?uo
438,346,332 *2C6FFE348E7AA46FCB238DC2A1244217E1846443 ELDENSALLADE
438,346,333 *2C6BF0AD3C1D4671D721DE4DF60D2134466C5896 ELDEN.SHEDD
438,346,334 *2C6C653016A2458B3887BA2EC7672234A56D0DF0 yurahorn
438,346,335 *2C6DF4D6D5D9B3F873BF8B7D18A047966F60F1DC elle.m'a.dit.(version.live.au.bataclan)
438,346,336 *2C66CA281315CD45B4D3105A0BDFB249F5FF7CE3 YZ2A
438,346,337 *2C656AE6DE058BE969BD0546B0EECFB9F085BD93 HLBURKAR7
438,346,338 *2C63175AE029B813AB2EADED0A47DD47B4C18CE9 ZACRTANE6
438,346,339 *2C60D7E9C2375CD9E6EB9FC1EB760BCD7D317DA6 ZAPLETLY6
438,346,340 *2C6B35C8A1A62429333CFB276F256907BFB75C79 emanuellepard
438,346,341 *2C66E1CD170A6220B241C1045FDD4E7A801F4629 zeldadudovitz
438,346,342 *2C6504DF396D7CF2D673DD08AC0D132D6701999E horsesasshole
438,346,343 *2C67BD9A1F19E74DCC951FA418E45594D0F940B1 HOW.MANY.M'S.ARE.THERE.IN.MOMENT
438,346,344 *2C651BA897C99B695482BF75F5842D5B3AB59206 how-to-use-pixelgrabber-class-to-acquire-pixel-data-from-an-image-o
438,346,345 *2C6C7C03618F51A6B8AA17DDE581968BD197F0F4 emqxs
438,346,346 *2C6F6423518AC965ACBBEFE445059DF3BB4F6A0F [email protected]
438,346,347 *2C6209E0A243D735AAE236A32A724F5466406B53 EN8114070106
438,346,348 *2C637DAA232D7410257560F6064351ED372D096F [email protected]
438,346,349 *2C65969CC480C8F8C79ECA1C0028F8F7879731D0 engine.block
438,346,350 *2C64A45C7D1C3217485FFC5BA35854335AC94957 HUBERT.GIDWANI
438,346,351 *2C6952A974F3527CEECFFF1814D59E01C5B16E5F HUGH.FARS
438,346,352 *2C6D9555B079DFD01B254018E4901AE13B101933 enonimrehs
438,346,353 *2C6BFCAE5E2176D00AE2B06B56455F94F6BE124A humorisms?
438,346,354 *2C6A0B1D805374FEA9095F9466C3E6AA1BFE4350 epanchiez7
438,346,355 *2C6AB38BA6A330EEA61CB922A91CEC3764553856 ERICHOELSCHER
438,346,356 *2C6AC8671AB8EB720BA51D32F9F4FBE16C924CA7 [email protected]
438,346,357 *2C6C5B38A0404BF2119659F9AECDCC96E72FC5F1 IAMDONALD83
438,346,358 *2C6A171A1C36B2FE685ECFFDFD5AAA23D788C4BE ZWENKTE8
438,346,359 *2C6409673414238F639FF8E3603E18C3CB42A6C2 ويتامينc
438,346,360 *2C616E5749575BF4035B30703DAEA6B687FF7775 ΛΟΦΟΠΛΑΓΙΆ
438,346,361 *2C630FB102E21B88C9D9C078B559F4BA71DF7BEB iamsunny124
438,346,362 *2C60C17A0C404D9F797342260CC42AA5F8983061 IANGOMZALEZ
438,346,363 *2C626E7DA7D20B8A69C84D038A91C62952376D92 IANROLLAN
438,346,364 *2C6D9E7EB92EE915DE2FD9E4077039BE6248FF76 et?ug
438,346,365 *2C603F25E449B2BE5E0F955B6B5476C99A15C9DC [email protected]
438,346,366 *2C6939DF953D1760EF38D7397193C0620907784F E'VALUE`RENT
438,346,367 *2C6246428DE9D43FECD6191DAE6C5EEFD5549A66 IFPULSES
438,346,368 *2C66ADE62CE1CC61AACB855DB80316A07DD29627 ЗИДКА
438,346,369 *2C671C161D4CFB8CE6530E610D49DAC11A39E8B7 extra-cosmic
438,346,370 *2C6731BE0CE4CCAA5111C767B1858F3EB7A628AB ILLIEUCERED
438,346,371 *2C6B6DBC53395C00B6FA790ECAAB1DE3980A1E7D ILUVJOSEE8
438,346,372 *2C61B111B7AA45297B0E710DA496400FDC7E5CE1 FANTOMMAL
438,346,373 *2C62F692C96B40232423B2015E8BBCEE2886EE97 ТАНІДОНОСНА
438,346,374 *2C6F80E52452AA2570D85C45355613A0DDAAAEEA INNALGA
438,346,375 *2C653D979BDB66EE6C726CE6C0116CA21840A564 INTELECO123
438,346,376 *2C6771C774A91789FE2F823CF835A5848B56FB3A INTRAVERTEBRALLY
438,346,377 *2C6CD53203AEE290D3051656BBF466E0C85A1678 FISCHERLADEN
438,346,378 *2C6FF491A0BB1459F2D61F2962EC9DAB42CE7BA3 FJUQUILO
438,346,379 *2C610BE83B2AA0204F1C83CF8B25FA8DC4AD3536 isthistomorrow?
438,346,380 *2C63D15159196F336A04093B6034D4C1DFD57DC1 FOOTIN10
438,346,381 *2C61C81FE8898504CD1EF88AD73530400B516992 foro-romano-muncipal-de-merida
438,346,382 *2C6760972760AE8DB58EF34E74CA8593ECABBA33 jakubowa
438,346,383 *2C6BDB44320026626E8068178886CDB2C1071FDB JAMAC
438,346,384 *2C67B7AD71918302F17682D4FD87D237DC843F21 JAMEYBODDA
438,346,385 *2C6A6D4C01A9368A2C9F6AD4B5DC532FD16F319D JAME.ZAMORO
438,346,386 *2C62EE97FD46233EA8A54644EC922E874137176C jamie-stenulson
438,346,387 *2C6BB02BDA538C7EBE9DA1B4E48DC8B721FBF1ED FRANKLINCRANSHAW
438,346,388 *2C62837AF675F29BFF45DA34B8F1D90AB694EC01 frank-zaffa-(lascelles-mix)
438,346,389 *2C6005EF97DAAB01BD0474BA8D6DB0C953291B36 jarrettrosebaugh
438,346,390 *2C6BC06A8E6CA0025FEAD9641FF3D1D7A6F733B3 jasonlook
438,346,391 *2C6EE6EEC40432F6792C3CB25689FC1451262334 fredricjoas
438,346,392 *2C68D5798B98DCF42BBA26E81B1C2C74BA62DE8D J.COSTELLO&D.HILKER&A.BROWN&L.SMITH
438,346,393 *2C68E1129F24663C95A91AF862D0C855B70B9547 JEETEE7
438,346,394 *2C68DB603A4A12E1F49878F8D122C27F2420D82A fusion.days
438,346,395 *2C68F0ADE44F3C57C91FE68AE253A70957A4FBAC jeramybeutler
438,346,396 *2C631AD559B95A5D9268DEAAD0C88A92CFE5565B JERAMY.LENHERR
438,346,397 *2C618E64AA975277A9F070EA4BF697979BDCF20F [email protected]
438,346,398 *2C665FB4E1BA3EE1F247E76A8FB3AD864784A443 G03616N1
438,346,399 *2C6BF1F8A03629755D2DB9FEF5FF35C9CA5CF62A jeroldvanamburgh
438,346,400 *2C6D30BFB7E4489A3DABC1794AFAD42614631173 GAIL.BARTOLET
438,346,401 *2C6ABCF772FEEC407D27B213D3865DEDD48B2952 GAŁGAN
438,346,402 *2C6157015056CD58701F43678C8A950F390614E3 galvineyes
438,346,403 *2C6E602F2FADA2DE620D03A1DFDFEDE8D67322C1 gath3rng
438,346,404 *2C6A1D220181200576835225378ED4CD92ACF792 GATOVIEJOSUN1
438,346,405 *2C6058EA327B371FCDB5A6B55F52260D984CCDDC JHUOLAN160
438,346,406 *2C6A1E1D6DF38B4F57D5201E0EFAEC35E9C211C7 [email protected]
438,346,407 *2C67C9A6B9F9A49CCF75A126C79BB98EFB745307 GEJĖ
438,346,408 *2C694C019EB73892A619F5F4927DD9E0495723E4 J'M'EXCUSE
438,346,409 *2C639E77A2253AE218822A3289DA771977BCBD00 JOEBOTTOMS
438,346,410 *2C6D02A465CFDA3F59BC183B5A5A13B908595B06 get-out-of-kelter
438,346,411 *2C61CE541A431F6F9E5BC9D47332E92C1913FE5B 0THEJAPAN2
438,346,412 *2C6990ED39CE1DC5107F594EB4501C488A4098AD 1002175 EUTASOLLA TEHT
438,346,413 *2C624BC6CF2E301DB4E13FCF32CBB0E94BE6DB2B JOSEPH-SANTAGUIDA
438,346,414 *2C6EB11E25566257D9EF16A6B4687F61EB9288FA giuseppeferdinandsen
438,346,415 *2C62CA17B24A0D6F907E5C6C05E5E95DFB1E2771 11051175
438,346,416 *2C69BC72C7DFE13782598182B236E678DDEDB23F JOYCEIE8
438,346,417 *2C6005BC4BDD19AD770F33403C90E01E59245784 12-05-1674
438,346,418 *2C63D60FD7CAEE2C405992BF14D652393B003FFD GLORIDAS
438,346,419 *2C6BC4FD7A13DCE427C1734AE5BA58FA30B916DC 12 handballnationalspieler
438,346,420 *2C68AC65A442A38CCD22A70CED7F5F2B82F8E64E 1382375 IN WALNUT CREEK , TRAFFIC WAS THE ISSUE
438,346,421 *2C6EDA9627FFC3B24C372CA607120851880EF72A just-the-nominees-please
438,346,422 *2C6658D70CB8A054A56D63EA87EC46064B33E179 157252 DURBANIN AIDS-KONFERENSSISSA HEIN
438,346,423 *2C670DC621DBCB097378BA873E928620679BF6C1 15february1728
438,346,424 *2C673BB70AB080BD44DD2254A76DD8C7B0BA1972 ka!t
438,346,425 *2C6F6C478C31A67753F6E6F8B54DF4EB9B06D527 GRAVITYBUT
438,346,426 *2C668331B033F212FA3AEEACFBAFFA89AEBA5771 GRENSDISTRICTSCOMMANDO
438,346,427 *2C6CFC5E89C031A813B32F71BD9F99DBB77C3CDE KCAPONOCE
438,346,428 *2C6E6F41FB3C3BAE0EE17F9360CC17865965FA34 GROENHARINGEN2
438,346,429 *2C6816BF2E63DBC0A94304AE4E9687498438C8B0 1-banon-creamy
438,346,430 *2C60AE81E8F63A550BF1D641FE7D1C74BA94053F [email protected]
438,346,431 *2C65159B191DD121059D84ED7A0AB6F09BD0A628 gw!}
438,346,432 *2C616C09B81260329916758F1840AE3AFC757DEA 1ddr-grenzbeamte
438,346,433 *2C62E588C389F5433FCB867DD04E042516FBA98E 1 diakonieverantwortlichen
438,346,434 *2C6761CAC69581E482028C159E441FEE20A72EDE H5}B
438,346,435 *2C6DED81A4A511C3C4029020CAFF1D2065134950 halerus
438,346,436 *2C6A78089B4A003E63234BF60C4D7C6C206A73A0 1ISTUMALEIKIT
438,346,437 *2C6FA5897C0C92FB14B5B67A0A329A1F7D8B69E7 KIRBY.DUNNAM
438,346,438 *2C6A001EAB43E9787DEA9472BBDE062AADF97A32 1 JAZZSEXTANTEN
438,346,439 *2C62CE5550B75156D7FE583ED2F39D8BB595DD35 [email protected]
438,346,440 *2C67CE109773B1C4ED18FD4475CAD0C5E18CEB72 kirkmerdiven
438,346,441 *2C6B1188CE71BB3231433F463C75A1684E574130 1KARVATURRIT
438,346,442 *2C66DCD83EC6E242791A302AA98EC20A7B00B9AB 1-KENRAALIENSA
438,346,443 *2C669E3435F22A3242D1C60B7A70FFBB926A71F9 harolddeahl
438,346,444 *2C6983AF1DC23CD2BAEE7D1F3A30B56C0E79B0A5 hassangleaton
438,346,445 *2C6673B686038CAB59C36D2C8296F79B4EC1CD54 KLASNOMS
438,346,446 *2C691EBDE1D13F8B810846E0F7BBE375F78EC771 hawaiiantablachapa(tipsyremix)
438,346,447 *2C63BFDCB41DBD75DB1814FF59830D48693B1D2A [email protected]
438,346,448 *2C6F00BE2CEF49FF87820C52B8A9931E82F8C75E KONVOJIM7
438,346,449 *2C67AD8F34217FA7592AE0AFAC01CEC213DAF6F3 KORYPAGLIUCA
438,346,450 *2C6C89D9C93587D944809ADCECB1A23CE57B74DB 1-PISTOLTEATERNISSA
438,346,451 *2C6FB4414832BDE8BF4E0A37B59682D4187F9B9B KRAIG.HERAL
438,346,452 *2C6A0C775D9AB43B6EB03084B53B6298B438E4FD 1 RESTAUROINTIKOHTEITA
438,346,453 *2C613905393B0211F81EE4353AA758B218423D68 KRIEGSVATER
438,346,454 *2C6432E8ABB8EA9737CB8DF9A02EEEABDAB20A39 1.SAUTTAA
438,346,455 *2C62F5014568F566BDA8EFDE3F10268810B19DA9 kristinafinney
438,346,456 *2C6DCD0A247839501E09B7B04E7D3C41F1395935 hello,-dolly!-(1994-broadway-revival-cast)
438,346,457 *2C62180E104DC2CC823FD03740D3A25B8BC1B81B 1.TUOREITALEVYJ
438,346,458 *2C66F5B9DA7CE8036A3500BD8F383D440442E684 1UHRJUDIE
438,346,459 *2C640F74D1A5991100F0B91985B690A2261C26EF herschelfrack
438,346,460 *2C6A3D9145674BDE03856EB72C8DC2A1F565A30F 1.verwischtes
438,346,461 *2C6A960BD6BF0EE4D640C50041D688A32467C2D0 1.vollmechanisierung
438,346,462 *2C6F3A0A287CB6E49912A30EC6B58584F6883B92 HILDAALBANO
438,346,463 *2C613B6A51AB5646F242009CA9184790EF6EC157 HISTADRUTU
438,346,464 *2C6FE3BE0A769B8113FC42541C884376D11400D2 2213344 FRENTZENWUERDEFUERFELIPEMASSAZUMEINSATZKOMMEN
438,346,465 *2C6A9F417A115C2C634470DCFDDB968238C28F8B 2250049 BJON EI OLE ONNEKSI KAIKKIVALTIAS , JOLLOIN H
438,346,466 *2C6468E213F25BCCBD16359CF8E74050DDDF00EE 2252135 ALPAY DURDURAN OF THE NEW CYPRUS PARTY HAD 1.3 PERCENT .
438,346,467 *2C69CB98A4201FB98485D60DC1F526A4B9B7064D KUKKOLAKOSKI
438,346,468 *2C682EB83E4F770BE46918622DAF7F0B4A6A36F0 „HOBOS“
438,346,469 *2C6B4A698071D63FF91CBD7CBA8F907AF8F2DF3F kurtisfredenburg
438,346,470 *2C60C8AF8F53C04C0DEF9F62B013FB3E2016EEE3 HOLE.INSIDE
438,346,471 *2C66FFC244EDADCDAE2E3A5A2B2E99142D010053 2585298 optinen-mittaus-tunnistaa-sateen-voimakkuuden-.
438,346,472 *2C66F9AEF62B96A6D0BD35A8C972CAE4CDE1BF6A 258ALONZO
438,346,473 *2C64844D1C036291999EC975BFD3BF27354FBA5C [email protected]
438,346,474 *2C6EC868DC5E96749C7FF32A10BD4D4E8C16E526 [email protected]
438,346,475 *2C6506370E6EBFFAAA9A835A1A86BB86A9D78831 L122880
438,346,476 *2C680A2C287A72E8B9BB91CBCA33C5159A88F373 27november1690
438,346,477 *2C662881EF1D7DFF45B5FB4F8CC3C81A21147FCD hotspurs
438,346,478 *2C650CB8867B0E85DB9DCD37A4C91D9E921871AC LABDARÚGÁSMŰHELYNEK
438,346,479 *2C6F70DB99D0CBC5D8CB86D0391B96240F1589DC howardpiascik
438,346,480 *2C6B10711E3C85838A7EBE4B29607093388211D6 2ARRHKTH
438,346,481 *2C6E6F3A9BC3BEE4AB3E7F03DAE0A1C018DB8160 2.bundesliga-kollegen
438,346,482 *2C66B791E5DD2FB3DF5964FF0180291C1B1F1312 httpmiss-russiarune
438,346,483 *2C6E16CB8AE468B4D24E79117970A3DFBD13E920 2FJICREEM
438,346,484 *2C6F6B95BFE7CF002567D9E51D065EDBFCB253CA lamarahart
438,346,485 *2C6C927E558B66620DA2D49AC8628AE84A618599 2 INTERFAX-MELDUNG
438,346,486 *2C68220647F49C4AF78C80C7B5277FBBF225CD44 LANCE.GOOLSBY
438,346,487 *2C6CC0CBB7FF8E6B61B86A3522162B279E9CCA35 LANDONLOCAN
438,346,488 *2C6E7B9C6CCA9809A3B969949998D0B7C8BFBCB7 2 MESSUILLAKIN
438,346,489 *2C61DB9F3C4EF18446941A02B1D304DC1DA60566 LANIGBERE
438,346,490 *2C694E68B9B1D1B4101163148EF366FEE026589C LAPOHYBY-HISTORIE
438,346,491 *2C6B8144B2E6B6868D650F588AC0384F300C0120 hvarekshaeta
438,346,492 *2C6EFFEEBDF892A00981738E32563A25B41AC043 LAURA JORGES
438,346,493 *2C653E2F91BB300EB45B1B28BDD6E823B405CA8B lauratang
438,346,494 *2C61E624B7A6753C4B06CDF12914F189BFE2708E LAVOMSOK
438,346,495 *2C6DCB22C4283B01DB25632297709F0AADAA72C5 IAGUUYTS
438,346,496 *2C6C7BB5BB425DCF91D46D07569F0034D0A399FC iaresufer0
438,346,497 *2C66E1C3BD60A295EDCB73C0977ADF9261043B97 3eidcla
438,346,498 *2C6155A9BFB8E77FEF7901A64525DAB4E125C8EF [email protected]*g
438,346,499 *2C665503CA752484EBDF0EE22378FFB59BDB1FA2 [email protected]~`}O{
438,346,500 *2C6A933E8DC9FFD407CC9217F30DA437BCE92A03 3TANACETONE
438,346,501 *2C6887EE71CAEFF05DD759826DEEA065A1E375E3 iluvsumuinen35
438,346,502 *2C6C0373C7E9002E0FC8B51E5E7B829FC7B2B798 lesliegolfer
438,346,503 *2C65BF5A563E5AF63E94F5B6B2100E71E843984B lidenhed1
438,346,504 *2C61A1F324F82F744EE30080D4EBD2072930AC1A 4HAROLDDUSTY
438,346,505 *2C670719DB64531880F9B2D032D3374A93DE8D58 4HEARTKELSEY
438,346,506 *2C6DE56242A543926414DCF8F5C7BB4826BEFDA7 4HOMEBREWSPOOKY
438,346,507 *2C6C3BCA6B2920B51E08F6CBACE7013044B5269C INTRAVERTEBRALLY
438,346,508 *2C652F33281D3A791C41F6EDEB59B2D16874AA4C 4LIONKINGGHOST
438,346,509 *2C69B595FF4B5CDDB54EB47B2670ADD9054D70B7 4MAR1858
438,346,510 *2C6B0350DE861469BB64D015ABBB49CBEA4DADD4 4MODERATISSIMO
438,346,511 *2C6FC03C81727B85382C4504A228ACF0DEF3545A 4mymantra2
438,346,512 *2C629852D584412CC94E38947D7399AF0B8B6CA6 IRENITE
438,346,513 *2C6D73A8C8F92EE8783833BE15190119DFF6324A IRIRGIAM1
438,346,514 *2C622F6A1E8A7D5687F83F598173BD6F95359725 lindsay818
438,346,515 *2C6DE50157A2ED0BA8C592876BA7EECCC97B1AFB [email protected]
438,346,516 *2C6EE478D6F68C5774F2C194D17669CE8F34DB75 ISRAELKRUGMAN
438,346,517 *2C6983051E42942583952E1C18594487B1C1B762 4SAEYANGBSW
438,346,518 *2C68790B040F587E436E83734C9E247851540161 ISSACOTHER
438,346,519 *2C667D4A230968041BE832832E026A37000E2F7B @4t1{
438,346,520 *2C6B37ED2056940D0126D4413D3DA30FF832F9DF IT'S-ALRIGHT,-I-FEEL-IT-(MOOD-II-SWING-REMIX)
438,346,521 *2C6A02ED51AB9B07F2F24ACE30E44F957095DA09 4UNAWARDEDA
438,346,522 *2C63A4BE0246075455D9049E64D31009BC2F64DA IWQX
438,346,523 *2C66A33F339AF6ABC501AAFBB0DB82A0B35C8E4D [email protected]
438,346,524 *2C656650FA3608731E220CDE5E47C1D538D07090 [email protected]
438,346,525 *2C6CEE61B44CB2660355DCB9C371B643790DFFCD JACKIEZIGGY
438,346,526 *2C62DF94557A6B4A2587AB1C6E36BC18F1D374F3 LOBOCHER
438,346,527 *2C6C56531B0DBBDB44AAB258D45B85082E0F6E2B JAMELENDER
438,346,528 *2C6C09AFF9406F5120277654F3D55CEF6ADEE470 JAMES-CONING
438,346,529 *2C62EB709B5D6DF98FA814451C7CFF9360D2B6AD JAMIE.GILMER
438,346,530 *2C6E5FF24927EC9AB0EFD392BC609A887EA6F63C LONG-SONG:-DON'T-FRIGHTEN-THE-CRANE
438,346,531 *2C6398A887ADD76C64B62697139C75298F1F7EB3 lonnienikas
438,346,532 *2C6FFF616A5ED3E202E10C671624F0D2B28956A5 LOOPPLEK2
438,346,533 *2C6EF22EC166B451431BA96FB5B634B0656C8640 jarvissonier
438,346,534 *2C69F4E96D0CE8D3B5C01351ACDB70E317554C4B 5MYJONATHAN5
438,346,535 *2C6C78AB51F5486E1E551021E1789FB3118FB5BB jean.olson
438,346,536 *2C611B44D211D7AA34D09ABB021E61DC659A143E LOVEYOUM8
438,346,537 *2C6204D45F8DE4E06DF0279376F2C680FF1F0371 lowellprow
438,346,538 *2C6B39EDFE16781030052F6EF5183775CBDF8E6C LOWL1F3
438,346,539 *2C60C0FC2AA2B3AD61C9761A616AB3B3D449E424 jennifer.hantid
438,346,540 *2C65A29A1BA067D0FC3F54E54CF8F45EFD8E7B8A [email protected]
438,346,541 *2C68DA8175F89FC0C5B8DD2D95C3828DAC9CAF4B [email protected]
438,346,542 *2C602433224766C3CD1C3D00C7A8C2517E9DF46F 649924 boylece saddam'in adi ilk defa bu olayda duyulmus oldu .
438,346,543 *2C6485AC7779518B97C20D7172F282A9836D7924 6BSWOSIOBSW
438,346,544 *2C6BE5E2F8EF4101C52CF1E56D4ECC79429C395A LUBICA MARSOVA
438,346,545 *2C69ABB0A2E9B3FE986B45416BC059E076ACF161 lucastrevey
438,346,546 *2C6789AE7A4672362E0171B476381A367A562260 6FUCKMEAGGIES
438,346,547 *2C6A7C8609159CA31645DCC0746E29B6DDFD7689 JESSEGUGLER
438,346,548 *2C63126EEE3E20187C3DFC7B92903A923B4E2CEE LUPAHUN
438,346,549 *2C6D434F272D38170A5F2755E8971FC149B94EDB 6HONGYUBSW
438,346,550 *2C6176197676F7C89CA5C4D3F4F57C8F002B142F 6KCOCBOL
438,346,551 *2C6C431C4863200DB502B1C7853F9B883F3A09BF [email protected]
438,346,552 *2C675641915FBA022142124F53DDC53D4A065C3A [email protected]
438,346,553 *2C6580CFEA4087A8FCAC5CE10C4EF85A0560A38D [email protected]
438,346,554 *2C64C6EA23A2F1508D38F79E9A3A67FAB20951CE JIM COKER
438,346,555 *2C6837D161C62C325181B34003450406006B192D JKGC
438,346,556 *2C6411EF2D59CF5E5FF322D161C155AAB59072F3 JNJW
438,346,557 *2C6E8F94C3C5D08CE6A723FF2EFE373FF9241F9A 6PEPSIPENGUIN
438,346,558 *2C6AC31B318778D6A15F323D236C4D39E4EA32A4 JODIEFINNEGAN
438,346,559 *2C65612983FF686ABEC2E57C6E61A6026B4AB342 6TNEDNELPBSW
438,346,560 *2C68700FD4808E479F9971C3161A4E8030086C4B jonasgieber
438,346,561 *2C60271C43119E6D7EBDCECD0F16FE113D0D203C 7BIBLIOGRABSW
438,346,562 *2C61A27AD76E41475A385441921A2F9FA800F08D 7BSWCOLOMBIANOSBS
438,346,563 *2C6FE9F183172069F27FD3086CAEEC05F24B4BEE JOSHALOY
438,346,564 *2C6F94D950D549AC43769163120C0B1357E941C3 [email protected]
438,346,565 *2C619016E58FF1DE76A2967DCE2C1E1DC9F3DFD8 JOUAZGFKWLY
438,346,566 *2C689E50DE4089B818AFFA2FF74F95C6816127DE [email protected]
438,346,567 *2C60A76E1110443A1E7C80778C158C43B0F5E58E MARCUS.HUSSAR
438,346,568 *2C6A4F7C535993977F0D95906E8E499E2EABE1F0 7IANDREA
438,346,569 *2C6E0F616D65F7BCB7D539193370C2E66818A02F 7IVOUKUKK
438,346,570 *2C6580C6C0C5A5164102057BD97C85D15D986B87 MARILYNV8
438,346,571 *2C686A4CD1C3551683BB7B212371B6A32EBF943B MARIO.DAVE
438,346,572 *2C686D9B2950E6DD40CB3C3681CE053380405D1B 7LAVEDIES
438,346,573 *2C6ECEAA49A5A9615D8AE5D892CCD0EAAF5D6E49 [email protected]
438,346,574 *2C67E90E808898318BDD7804E310A249494FE88F 7MINNIEALEXANDE
438,346,575 *2C65BD85CB0311E3A1C9AC568FC143012D3A69CE JULESKORSLUND
438,346,576 *2C605C858377CF541BB9B02A62751D1521E5F738 marshallmaltby
438,346,577 *2C6BB55F7B1D2F7C95B3D0400653D111A630B48D julz1433
438,346,578 *2C64CBD934DBCFC63F7A41F565E38AEEE512CCFB MARY.DIPONZIO
438,346,579 *2C6FFCCDDD49A287C97F26B02BB9D5F38CBE5D72 [email protected]
438,346,580 *2C612873FE0CE41CDC7512CA901450DACDEC577E KABBO HASSAN
438,346,581 *2C6C313C556D198D47279DD499E5032A9741B448 7TEHKUJM
438,346,582 *2C66E16021167C374865836BDEFD640BB6DD1B40 MATT-DVORAK
438,346,583 *2C67A7F95FAA7514700F5738A8283FE27EDE140B [email protected]
438,346,584 *2C67DB327081EBD468C22EF9BEE6F06C52AADEA8 [email protected]
438,346,585 *2C64D8B7F8D1FE9D81296EF46789E04DF3E1EA39 KARANDEEPDHILLON
438,346,586 *2C6CE8377F2A142539602BBC034B648F760794FE MAXWELL.CYGAN
438,346,587 *2C6C77C5DF023B2D5F5CECC2B88ECCB6FF76FB05 KARLA-GARNICA
438,346,588 *2C6FC442496A158B538115F0DA289A1C3C228817 mediumvoice
438,346,589 *2C68E9DD45F1ED3A1ECCC5B90EAE7C8E54487737 mee-yew
438,346,590 *2C60709663ED3DF45C34D94DBCEB9D0996BD2640 KBOBBY283
438,346,591 *2C687615AEA0768AF65DAA19D9EE9630C761D592 mercantia
438,346,592 *2C640DB495C93B36C6D701A8520028254D2AA06B MESITYLENED
438,346,593 *2C6895C0835C666D765EBE28041F4D6E23DBE723 MESSAGESFROMTHESTARS
438,346,594 *2C61600499118E33CA9E62441ABF1872540BBB3D mevoyasiberia
438,346,595 *2C645D308F8CBBFD6731B8D6DA2917970323A1E6 MICHAELPERSAD
438,346,596 *2C60E4CB382A671372B1B763AE4EED165EC17C9D mikelwickkiser
438,346,597 *2C61CDC41E49D5E7A81CE9F4F9D41DA3A3A92575 8nord
438,346,598 *2C6DA2405B48B08ABAB2F94E7DF54727D9120440 [email protected]~O.~O(^_~)
438,346,599 *2C63C7CAC8C174FE8531BD5BA8AC0C56C0D17A61 kentweir
438,346,600 *2C633D8A4112EEB77133807A32C574B5DF0A3CB9 8======P.~o(>-<)
438,346,601 *2C621B10DBB8A768C6EA5E53F2FCDB5EC6AC97EA KESERVEIMRŐL
438,346,602 *2C60773E78D0100AE0F1B9259D13D28602AA775E KHANROYAL
438,346,603 *2C60FA094885ECA45255C567E3BA8967C42D8EAA minute-waltz-boogie
438,346,604 *2C6AF01051FDF5DC3488EE5DDCA4AD519C5BBB80 8SEUDNEFE
438,346,605 *2C6880902B2CBDB7C8A245F05F9B8B00A257FB2A MISTY.BEARDEN
438,346,606 *2C623CA77259AC4DC2A0B03C3D6B8F89FE69337F misun-ko
438,346,607 *2C6BEAECE9F9DA47F61B41331290C0230715F87F 8SUCKET
438,346,608 *2C6F9A3FE20D39888873A05D5CFC7A4426984A61 8THATITALY7
438,346,609 *2C6304FC572C3257AF57DC3245C777A2E3742C10 8THEWOODY6
438,346,610 *2C612441AC115E47E883A9DEF6AD2A992B091277 MOBILISANT0
438,346,611 *2C6B62A0A105C661508108CDEC90C643C0B238E9 914CALLUM
438,346,612 *2C6C83CA834228464EE0512B7A63E99D343D1109 moshekukla
438,346,613 *2C67F750F09BCF61818BA95171C86344837B186E 9AILALODU
438,346,614 *2C63055C064F6ED981DD9AA5E604DE19DB702C8A K,QW
438,346,615 *2C67EB55996C4107A6AC162A6304B739D5823073 9BENJAMINBUBBLES
438,346,616 *2C6696055220DAC932983E2F68592BF30A84F08C KRAZYKYLE24
438,346,617 *2C6B5F7AC69F6877BF3712CFAA9439C1F259CD9B 9BORIANDOSI
438,346,618 *2C62D2F0A2F30AD7E5C45F7693868A487CBE5BE5 MRCHNDRZ7
438,346,619 *2C6F7C99B2DED7836F5A7B66CA252303D620793E KREWTIU7
438,346,620 *2C6AFBB92924039DD572A4A4BE624D233B690A8F 9BSWKIRCHMAIERBSW
438,346,621 *2C63B542589E0D112DBA3D53486C4D1329CF765C kristoferthorburn
438,346,622 *2C69E85F06A984ACF527B9F547A50127FD210A22 9CONFLUISSI
438,346,623 *2C64720D7CBD1F9BAA66A71B3DEF3172177D5ABA muzsika-Egy
438,346,624 *2C6C028988DA53A9378222E540D07A41B38A7E77 KUMKUM.SINHA
438,346,625 *2C6DD5AB5E8C9FDEF98ED66BFECE9E58CF8879B5 [email protected]
438,346,626 *2C61BDDA21D73F51661815C0AA4180290A8793E1 myrna.montiel
438,346,627 *2C66C7EE2A7C7D03F8E7B1E2A9C5E1B7446FA478 n123sj
438,346,628 *2C6F05E81E574F970320213B5B7DBC17DD0C0139 9ILUVCHAPMAN
438,346,629 *2C6AEA1908E638A8BFB3A7C60C1004E2A405359F 9LONTARPA
438,346,630 *2C6951AAD7595C1B4ED63A2E56A1B90018B6DB2F NAMIOKASTATION
438,346,631 *2C687DFCC7D8D8CBADE259224063BC1443B6999A kylee82806
438,346,632 *2C649E55780FE3A9B41F8D6BA80F50B003976C11 9YTERATYUE
438,346,633 *2C6FB78DB7D62636D7732EDE7189142904C8B370 9ZDAZYLY
438,346,634 *2C69FAA426D350952DEE9F6FE9D920CFB8BDAB5D nevillepassineau
438,346,635 *2C6944B8787C23CF9BFC8121B11F75CB38241FFF A;)
438,346,636 *2C65CBA0D33CB2E7BB66455A6BE208688833B11C a1yr8
438,346,637 *2C6C287946451324D888EC44547689E77527172F nierentalg
438,346,638 *2C619F18D4FCFE5D1E3C3593D1D6A074762C798B a6
438,346,639 *2C6E691F959E264A855D6AC8D945A09435C6AFDC nm1v
438,346,640 *2C624AB8D273EE253CE6B876D5BECE59F8772C83 LAURENCEPINZONE
438,346,641 *2C613A134568315F61DA1BFBFD04BF783E646F7B [email protected]
438,346,642 *2C622EDF188B79D44D65777DB83BEDB5AFA2D95F a6tg
438,346,643 *2C687885508541527C8B810E01C4F2B0E464B670 laverngauldin
438,346,644 *2C681D0E04A640790574B79A80C5D3F1221ABA07 LBPCDBEE92
438,346,645 *2C633952D86CD6AF6BD2EBE3B12A11A04E21994E A9D67A0E17C53085DEC474E20D0394EB
438,346,646 *2C612AA7A15A764943A48F500193418BF07CEB2D leandrobarkie
438,346,647 *2C6DD587DC4AED09B042724517A7ACCC94A61D0A LEANDRO.SHARK
438,346,648 *2C65682E641C70B86F662A59FC6209E0934ECDD0 leave.my.baby.for.me
438,346,649 *2C6C66746765C2F23D60F0289A1F6F253D01A0FC aaa:4~
438,346,650 *2C6BE0696007F5EA54DBC78CDDC159927B8E1A37 LEGCSODÁSB
438,346,651 *2C6F91E109623237A62DC5F8E99A1B6B2737C8DA noncontributive
438,346,652 *2C6A3DF761CE7B610A3A2F3E9F787DE08BDF4B06 (>-<)O~0~-D##P
438,346,653 *2C611F5BD1474CED4E89EC7A25FD9BFCBDFBCEFA (o_-)~.~.~.<----b
438,346,654 *2C676AA05B9FAA148EA949572DB61B8B3B404405 AANSTOOMT7
438,346,655 *2C617C05582343F87B1E1EA45BBCFD43D42D384B lesterbownds
438,346,656 *2C625E50B95E07BC83A135CAED3F2A758B428B04 ABDALLI
438,346,657 *2C69F014D1AA21EB4041CD4D34B75AD0BC409E8A olivia.michaux
438,346,658 *2C6C07549F6B7876BC0B99DFD1EB7EF416FD4FA6 OLLIECAFLISCH
438,346,659 *2C6328E1A18A5EDF3842B12D706C315A830FA5ED ABNQ
438,346,660 *2C62D8E103F797038C7556FEE9A6A20CB6A381BB „absentée“
438,346,661 *2C661BF888C029963609AF37E1A63FDAE16B33B4 onqpromotions
438,346,662 *2C6F7026BB55C0E696FF1E8A58C6DCC779CBAE85 OR-DEL-CASTILLO-Y-SU-PRISIONERO
438,346,663 *2C6178F11D94369452ADF385E7F07CA9C9F6FB73 lisa.fey
438,346,664 *2C6C89C231642DD476B2AEE56C39ADC58E177244 ORLANDO.PERROW
438,346,665 *2C68F53C9E07E351C193599B1E680BEBD1B2AAF8 orvalminrod
438,346,666 *2C600A8810BCD94860FF36918C2D4490A899A1C6 ACTC?
438,346,667 *2C60669B0C5C27CDFCC63E82A8C566293904B68E l$)k
438,346,668 *2C6C8DB1BE534DEFAFA9DF971D5681E196FE2615 LLYORUBA
438,346,669 *2C6CB48D74D120A31879D61A7CA2D531E62FA2C4 loistavana
438,346,670 *2C698870CFD6D6FE19AC8023724821EEA2EFD417 OYSCYSTC
438,346,671 *2C63ABCAFBD3361B964BBF4BFDA61632731B6BE6 OYZITIK3
438,346,672 *2C60B912F1A4ED5567B7ED499EACADC6C4F57DDA LOST YOUR GOOD THING NOW
438,346,673 *2C657183889326B3AF2C1A5AC02E7639325021BC p==)-`~-`~
438,346,674 *2C6752BFABEEEB06881F226B8DFF850218049331 LREBROVIC
438,346,675 *2C62E55E6ED46D0F2B59D34FF11A0EDA27BABD6F adrian-mulvey
438,346,676 *2C6CC18BC776EF19D0E9C96C8B5A2076E18EA75B aduoppet7
438,346,677 *2C6D3B7B498236367ED6F73F2B9CBA38A34F3F9E luigilindelof
438,346,678 *2C6924CC1744FFCD5E80644A0FEDD207947F33E7 PATRICIA.ASKE
438,346,679 *2C69E7065B4C7B433EA299AD3BBA4F4521D02A4A african-sun-rise
438,346,680 *2C67B7FD29D9F2DC8AFE53471DDDA8F2F8080A6D agg%
438,346,681 *2C68FCAF00C33053E776D2C35FCBD808B4D45CDA AGRICULTORES»
438,346,682 *2C6699665A6091D9F9A79F0BE3B2D26C401991D0 AIOIN
438,346,683 *2C6E986C19C81189840B1FDB428A0983C01C5BDB PELIDONJUAN
438,346,684 *2C6DE18CC2313DF1F3FBD56A8C837D71032169D0 [email protected]
438,346,685 *2C64C23F51E319193D0CE1DB2661887E7D8FDD47 [email protected]
438,346,686 *2C6202B2DA2272D4F3984C7B7DCD5CE40FB6BE42 ajnmi
438,346,687 *2C65D79DF642A05A3EC494CCF3079F02B41A08BD PERRYPLEWA
438,346,688 *2C643153E8A2F109B4BE3CCA7B3BB1C39352A01D MAGEMARINE.COMWWW
438,346,689 *2C601C4DECE29BD4CF259EDF1C9D22B2A21C9E30 MAGÊNCIA
438,346,690 *2C64A763140B3499D2E73D161E9A32EED6F8E3F4 PETER.FOTI
438,346,691 *2C68D66EB5E66E2E8558F55CF8B68734B9003CB7 ALBEMUTH2
438,346,692 *2C6DC4E66D9F20DE50BA5672896DED75AF79E483 PHILIP.GUILFOOS
438,346,693 *2C6CD0367D706D4883C3359F038E8302B54610E5 MALIKFRANS
438,346,694 *2C6EA63263723B56786CDE96618DEAD399F1DB3C malikzuchowski
438,346,695 *2C6BB7328BE6C6FAE3A4A3BA2E3519ADBE71832B alecgloster
438,346,696 *2C6F8654D60EE0D0B63736EFFF8FAF30CDD65716 ALEGMORB0
438,346,697 *2C64F26242A70E0579F464DE83C85040F68BB7A0 ALEJANDRORAPPAPORT
438,346,698 *2C68FC1B1EA8C96CFD272D5389EB530F65E3F080 pianoconcertoinf:2adagio
438,346,699 *2C606933DF3427E3FF30CA54CDA017ADD7262168 alfonsocarnighan
438,346,700 *2C6A29D6A89D55B0AECDB204413E741755D34B41 PINIPON3
438,346,701 *2C6EADCA341A8461EDE0BCEDDDFF44C835CB7C5B PL0Y41T
438,346,702 *2C6821AE648B373DE6C17B2C20CEB2FCF4382009 [email protected]
438,346,703 *2C60A39E5DFE62675A2815F69DFB1E2CA36EF4A5 [email protected]
438,346,704 *2C6422886653F0FE2C2C664D1B297D133F49625F algdlrow9
438,346,705 *2C63DAD7C510DCDFC68BB02C8B446B1E1FE0C752 PORFIRIOFALSETTI
438,346,706 *2C6558B628EE81B8EEAD549570B8E55646A7A2A1 PORTOFLIVERPOOLBUILDING
438,346,707 *2C6A0B54649551289AB10F9545FA6260E9F1F98A p#####p~~splat
438,346,708 *2C64446448689FF1E078D5A16D46355EDAAE63DB maria-rivera-torres
438,346,709 *2C6CB2C95ADA7C8A9BD44361D387DC7D84C81DFE MARINIFITRIANA
438,346,710 *2C6DF91B2356C8E803988D9971F150A172279400 marioardan
438,346,711 *2C6723D91CCD592881CE1AB85B581CC11527B87C MARITASSERO
438,346,712 *2C614BC026A50E14C3E5C67110D4052C5A044780 matałowskiego
438,346,713 *2C68848FE227C0DEB61C2B0C0ABC82782FC2E2CF mbarim
438,346,714 *2C6CDFF1F682FB88096F3904D1210C083DA723E1 projets2
438,346,715 *2C67DE011E5B1FB75276096FF508E4454C7F41B4 ALVAROSCA
438,346,716 *2C6DF9A3D6D2A9710C073BD8C9E198C98B595B8D prospektfabrik
438,346,717 *2C6ACE598DF5B66E7E302A3D1D8270B9C5E32E31 prostatovesiculitis5
438,346,718 *2C6AC6DAFA73BDE93D0AAB818E83936BA43C8BCA MESITYLENED
438,346,719 *2C602A39C7565D99B5B6FB5F9576DC3FB1D38498 PUITA1234
438,346,720 *2C665E6F55FF91B6F69B14F9D56A27BA1CBF3CB3 MIAMOR87
438,346,721 *2C634C79BCCD8E67BC2B8B293C706D767F817946 AMT;U
438,346,722 *2C6E83772E317E5C82D2D753727BF8F9FC291028 mikelotani
438,346,723 *2C60B1C37A954B20B6DD812852F0EDE64A688FAD MIKE.NAYAR
438,346,724 *2C6670D0D043D77D24A28969F54B5264771FD993 milanlagrone
438,346,725 *2C66167272EB612CAC55677FEABA0C483F9DB5D3 [email protected]
438,346,726 *2C6FCF4E041B3F953F6185FCBC5D156063502151 MISSIEWERK3
438,346,727 *2C6CD59B5BD32A498C3CA92A35DBA20838430F5E Q#####B***SPLAT
438,346,728 *2C6C00B3474DC92778D97AC154C1C14D2AF289E4 MMARIYALA
438,346,729 *2C6DFB897924677AE8AAAA638DED74EC066F3BF2 mohamedmostafakamal
438,346,730 *2C6985D7F984B6783107887B806E4B8AC9D78268 andyhauan
438,346,731 *2C6F24079EAE5862728834546287D010F4D227FD [email protected]~O.~O.SPLAT!
438,346,732 *2C617171AD8FEB323DE787496772DC4B11E15E07 Q##P ~ ~;)
438,346,733 *2C65C2C93C685B9FE8B987345ECF31A3C1994BBA QUINN.BEDDINGFIELD
438,346,734 *2C601C1211508676E3ADABCEFEE26C67C95951D2 QUINTONFALLENSTEIN
438,346,735 *2C63B3C75A7EE6A295EE8F8A2AFBA49A4CAFADFD ANN1990
438,346,736 *2C6EA1002A5D762CE86EB567B7C21255985F1650 R3553M310
438,346,737 *2C6D8803E7F369558458B2F35BBD66FE60446493 R3G3L4T3D
438,346,738 *2C6F574BD95EA1F9B75E388A2157F6D73A6B8ABA raabneizfa
438,346,739 *2C63A2AA8EC8B8415312D7C7595DCAD65069DB25 MSIMDEREM
438,346,740 *2C676D18CA5E9C412D301AF344C0AB913D9760BB ANTONYRIGHTLEY
438,346,741 *2C6F27D5EFC55C392A5ACB623DDEB0255E99D511 RALPH.BALTON
438,346,742 *2C625E1262C21AC69E73C5977A1EF04553F8703D [email protected]
438,346,743 *2C61B2B18C1BF1FFA859430D436EE7279147F48E [email protected]
438,346,744 *2C6ACF8F4601BF615B8790311DDC8DA6D3C8143F raphaelgannoe
438,346,745 *2C63D2DEFF3461AD2189ABF792368FBDCEEF0551 MULTIPLE-FIRINGS
438,346,746 *2C65688A0C09628AE7F5D4499A8C5738587A6049 APODEXTEI3
438,346,747 *2C67394EA57E5574E7CC0F42AFBAAB94DBB098B3 a.p,p
438,346,748 *2C661D2361016060671E9BFB8A3715DD887122CB RAYFORDPESH
438,346,749 *2C6732186EB4FD69E49C42E17732E0FCC1B63A5D apr,
438,346,750 *2C68D9C521349835ED45AD55D482B604336CA16C aqo1z
438,346,751 *2C65E3A19CC3A0FBF770822C696AFDE2105E9B7F NACHAVU
438,346,752 *2C65B546411BBF9E50A48EB474F99455CCC98155 ARIE: DIES BILDNIS IST BEZAUBERND SCH
438,346,753 *2C69024304EB355E823F62F38F2A49B000A82183 arielseppala
438,346,754 *2C64B2DBAEE627F1842076A268AFA3BABA38B191 ARLEN.BLACKBURN
438,346,755 *2C6BC833E299AA41C9A65D29BB7A892BB1CA1B3B NANGCHA6
438,346,756 *2C644B5F7D598B310EAB2F6382D5EB2663FEDF52 ARMIRANOJING
438,346,757 *2C6D79AEECAE7783A79579606D8A1CC77C84D81D ARNOLDYEO
438,346,758 *2C6CA0D429CF112C13F04749B1900B16D1334F8E NATHANIELDANNENBERG
438,346,759 *2C6191E34927422A5DDD72A7B504BED69AA16B4B NATHANIELMCCULLAH
438,346,760 *2C63888185A7B140C11EBE0062EDEFE04986B8FE ARoi
438,346,761 *2C6ABFCFD91B5F0B4CF0B1EAEF224AE88652B3A8 navoz
438,346,762 *2C69B561FB3D640762FC9FACD16224E12BE680C1 nbsmicf7
438,346,763 *2C6744ABE4F3D3CF157FA2F158F06AA2945C7C26 NEIL.KERBO
438,346,764 *2C6BF985D5D7196DB98EB0D9A5D7F4E2CF960612 ARSENISF
438,346,765 *2C6146C398CDD872CFDE28DC6B205D937C02C6A8 ARTERRA
438,346,766 *2C6D0722C150CE8CE5088DF506B8FB0389547740 RENALDOWALENTA
438,346,767 *2C6E724F097CFA0664396AB757C9C20E65D9F8AD RENATO.MAKOWSKY
438,346,768 *2C6933DC8AE896E0FA16B516470EBD9DD165AC83 ASAFAEIAN
438,346,769 *2C6A0A52444CDECBD80E2654F09E9D85CC365814 RENEWING
438,346,770 *2C60966A6A5CC10E040D40B4E7273A92F32EA960 NEVILLE.STEICHEN
438,346,771 *2C69A3643CA9E4C9C218098C304633065ED7A8F0 NICHTD
438,346,772 *2C6172092E57DF4E02FDA4CA8032DD14E1904D32 ASNAG
438,346,773 *2C683E670AF780EB4FF2832AE62C86BFBBCA3AA4 nkju
438,346,774 *2C6A98749CE89FB496C57B06BDC0B2D230C5D227 ASULINTON
438,346,775 *2C6DB181973105D6BB90827C2426048AA33F0E77 NOLAN.BURNSTEIN
438,346,776 *2C6DE83485504348F4422869B7BDEAE4392E39AE NONCOLLEGEBOUND1
438,346,777 *2C63C4CD8F988F5B3D0A1157F7E6A46916C3C679 rhy7hm1c41
438,346,778 *2C684518EEBAAAE21B3E668B18E34EA62B03BF6B RICARDOMARTE
438,346,779 *2C6F1139524D062F1215F6AA6C8D7E90EE7C889D novijoj1
438,346,780 *2C6184CE355B7D4E186F3EFAE06739BBC7E12D0A atrcw
438,346,781 *2C6FA570EBF65D7B1285C4E2093ADCF143A4F03E atto.iv.-.scena.2./.io.morr
438,346,782 *2C690889A0F72C30A0AFB0F899B0557A2F3A8D15 RINSRERONTED
438,346,783 *2C60F281C88BE30049EBE0F0F6232FE6B3FA2F95 RISVEGLIEREMO0
438,346,784 *2C60EB8DCDAD874C4E2142E5231BC07B460786C3 octaviolingerfelt
438,346,785 *2C6B06B336EE71AB990E132B710E30DEBA9406BB OCZERETOWEGO
438,346,786 *2C6C37F653A5591392EC98920CAF93FBFB1D9138 RMR0UEIO7UCKLQ0L
438,346,787 *2C654AF5B0D49DDF9593532E2E27766994C49927 AUTUMN THOMPSON
438,346,788 *2C61FF1442886E8E65C2D80996DB7B99BC4E0FD6 ROBIN.MALLER
438,346,789 *2C638AD52F978CEE0DA2B5AE9DD550C83C136EA1 AVcC
438,346,790 *2C657B23973F8F756FABC71DF7559F388CAB12C6 ROCKLUNING
438,346,791 *2C6DD84132AC8226A2939C52BA29B546B54AA5F7 OMJAGBLIRLIKAGAMMALSOMFARFAR
438,346,792 *2C6924B233FE99FC3DAD6D7FA59318887570A590 rosendojock
438,346,793 *2C6696DC27D675175605B6C3836D6B96C9FA6E95 a-x-.
438,346,794 *2C6D545395370DB8DA63A6CA80BFFB8D4A45C81C a?x4%
438,346,795 *2C6283590D2F63BF1931BA5D04829D0D54901702 ORANGUTANS.18
438,346,796 *2C6BD53CFE774C4D6E2D2B42080722A723918573 ROYCEFILZEN
438,346,797 *2C6CD80584465E1DCAC829F8FD8E88017ADF86C9 [email protected]
438,346,798 *2C6D4A0D631411C93BC826C0B097C0F9F27C7080 ROYCE.GRAMZA
438,346,799 *2C65A10163AC789B4A190593E0AF35A244733A1C ROYCELUDWIG
438,346,800 *2C642192F7786607EA5D4EF0D1B542CC53F9A86B a)xtr
438,346,801 *2C66FF66AB824C4D4C66E58A65F0B401C20D27BC OSVALDO.RANMAR
438,346,802 *2C6854A852DD37B71365944A143BF12C3568E941 b-!:&
438,346,803 *2C639B25499D25559EE2E9ECB98642087FB3718B RUDYWHAL
438,346,804 *2C6B477DBA22D428B9AD4B686061B4648DCFCD11 [email protected]
438,346,805 *2C65AC803C5B02E20ADC5BEEAA4AAE4AB4313CD1 RUFUSCONCEPTED
438,346,806 *2C655B8F21C90586F5739A340D5F9DD6BD644BD4 ottokunda
438,346,807 *2C6F8A5EB8D9968BFF8CA4F0D2D34C897BFA4BE9 r?yf
438,346,808 *2C6FFD6354880BBA427CAB59C5DA523D6A009CD5 [email protected]
438,346,809 *2C61487BFE02ED6B8727616FBB2B79E827D800CC SAMENGEVOEGDE1
438,346,810 *2C6BB15D44213EF0E09A06006A80D7A81033C207 sampraapte
438,346,811 *2C62B208AD60953FEE410604136566E118F322B3 SAMUALDISTAD
438,346,812 *2C6DEFDB5E96D6ECFE8A22D470D10BD348BAD7A5 b!5tl
438,346,813 *2C65FB48B18B34054B50D65085DD33DFA0BD5610 B7WE
438,346,814 *2C6BF6C6443037769B7DF1B56B6C87190B321123 PAPOTERAIENT
438,346,815 *2C6555342559D6B82DF4BD1B2DAD073C3DD3A993 BAGES.PYRENEES.ORIENTALES
438,346,816 *2C6DE45BF0C8AFF2CF49DAE6DB146E0DA7F69E89 [email protected]
438,346,817 *2C6520306E117D9CAD81F2DEAE8267CC17AB0D3A sara-magde
438,346,818 *2C6F6B8538CEE3B4CBC926F4E92F58EB6F1AE37E parkerdahler
438,346,819 *2C65416066C0354D5E071A869ABC9387A96CA5A1 Ballade, Op24 (iii - Variation II)
438,346,820 *2C61EDDE953687072E58336594DCBC1E2AE3BC06 b:"am
438,346,821 *2C62A0945C3E968B7905F5B62D8DF5D321560AFF SATISFYINGS8
438,346,822 *2C6A723D9129D2B842DB1B22419F1AFE15EA2146 sayeure6
438,346,823 *2C69A6854B16E78921EB605DB7B1765F9F461D73 b_)aq
438,346,824 *2C64470A3025F37369754B69D1A77C77EF303B71 PB~0~osplat
438,346,825 *2C64AEC0EA13F45A037C3910AD098F2857A16B1D BASS576TOY787
438,346,826 *2C6B96B72646E322147B3E43994D91AB8E82099C [email protected]
438,346,827 *2C679B4B70B187FA9B46D745EC4EE39A179814A0 scottybeeks
438,346,828 *2C6E824962B62983FE7D535AF4014AFFF5B06C23 PEDFILA123
438,346,829 *2C655AB3B0691F29C6D5972C445A56774AE4BCB3 SCOTTYTROPEA
438,346,830 *2C67EAC410F86F05A12CCAA3A0E05B8DF271154F SCRATCHGOLF.COMWWW
438,346,831 *2C6805B4DF768F10AF69DF1F16DF7AB5661BCE68 [email protected]
438,346,832 *2C63681A496B1B1841E2149F492803CB0EF0325A SCRMNTLL2
438,346,833 *2C68EC80E5C78A832AAB45FDA8698628A9A1992C [email protected]
438,346,834 *2C68034E2F431CE63ECA8AC6850B6BF2A00D1011 seannhep
438,346,835 *2C6A269E490D74B7C063611490D7161F5EE9761E bb-w
438,346,836 *2C60F383F7E2D88C16392C0600D7B27181E85619 SELENA.KNIGHT
438,346,837 *2C64032E263C08A188D5203638FCFBBD336B2C3B PETERCYFERS
438,346,838 *2C6F3B9C17D7F921BA1922DD8059135E4FE52DD3 PETROL.PUMP
438,346,839 *2C608ADE41CE8FBE3E5A186182B8BB6040DFE999 SEPULCHRALEXISTENCE
438,346,840 *2C67EE065F314D84572FA903A5A60AF958D1D084 BENAMEJI-CORDOBA
438,346,841 *2C6948782681A01F47019ABDFAFAD633C03B5488 BENANNTES0
438,346,842 *2C64430E5D2249F85E480B6BAA0BFEA9DD635DEA BENKRUPSKI
438,346,843 *2C65DBBE430D15BD7310FE19EDAAF065AA6D9406 PIERWSZYKONTAKTZMUZYK
438,346,844 *2C6C3042DA75DA2E09E58F4A586C47401388DA85 BENUTZERSPERRLEIN
438,346,845 *2C6A45A187E0084C0671569A16E342AF0456ABD8 BETAKEN
438,346,846 *2C660C6F00DF3C73C2B6ADA0F2523C94C7A920C0 BETOKENS
438,346,847 *2C64BD1B262BBD86AE886EA995956A8CC7630AAF POENNEK8
438,346,848 *2C6F45276D42FB86669608F4F5BF5958105814FD POLLRESULTS
438,346,849 *2C6132BCB91E01751BB1B672138C808DAFA12055 SIGNALAMPLITUDE5
438,346,850 *2C61B73B798C9C14231ECFB109DFFBE311F047A2 simultanaste
438,346,851 *2C6102B53BBCD0E3506CFB3E9C171008F2B6807B bindingkey="
438,346,852 *2C649F86DB6CA73597BA62E877B8A450E0AB0894 SKIDOO:GOODNIGHTMRBANKS/LET'SGETTHEHARDWARE/MURDERINTHECARWASH
438,346,853 *2C6E232C87CCB515915BE68FF3368CFA01DF2D70 PRACTICABILĂ
438,346,854 *2C62B68BF9A85914846A34E7B2F368158894EA5F bizonyiteka.1
438,346,855 *2C6AD1649D5E488AC0A8E1F1E17CC4BEE876D022 SOAPBEEPEXAMPLEORG
438,346,856 *2C64DA816F2E918B650F879C3C1008A9B1E290F4 BLAINE.DAVIDS
438,346,857 *2C645216DDBA951E882F3E2A7BBEF5FBE13D9C5D So-Early-in-the-Spring,-the-First-15-Years
438,346,858 *2C6DE772B73BEC20133C336AFB7AE400EA63F49A PROPHECY.OF.PLEIADES.(DEMO.2001)
438,346,859 *2C62D3C292A27B33E42FA570ED09A45AC355295B PRZYCIAGNAC
438,346,860 *2C689AF05CB5755700B95D6BE9126510FCF139E7 PTÁČKOVNĚ
438,346,861 *2C6E55B7C9A2D34EEB956C4BA5EC36DF6AA9084F blov
438,346,862 *2C61FF5F5B6003A38130D608229023BA8EFAF64E Q"B/
438,346,863 *2C613F76C8FB9F685EE11FAAC5344C9E1C037AFA [email protected]
438,346,864 *2C68875DD73984565AEEBB110FED11C2DE523F93 bohm23
438,346,865 *2C68EA4D912638840517A69FC9E8DA2D6440CA4B squisito7
438,346,866 *2C62A1E0B6F42F78A38230C2C97DAD608B0F53F2 BOOKERRUANE
438,346,867 *2C67A4DBEF07ACAD749BA2D8B5E8965E23491AB1 standardisierungsteil
438,346,868 *2C6248F533AD36D6E0AB95289DFA74E290F307B9 QUIDEEMW
438,346,869 *2C662BACFA55BC26F56F203BE71AC0FD40665E2F stephendevonish
438,346,870 *2C671C987C0EFCBFB804D5E978B3DDFFCAA8565D BQH2
438,346,871 *2C6607DC1A472C1A56AEDA07231297B0055AC690 QWPPAA
438,346,872 *2C6F567839C8CA3D93CFF835037F8D003CBD9636 [email protected]
438,346,873 *2C66C3888231E6087650D50D15515A8749C3B0E2 STEVIEBOHINC
438,346,874 *2C61427B1118EB26DE33F69A03F57B8539CE1F42 stewartbrannam
438,346,875 *2C678E9A4179E7AFF6F33F04CF8558B83B9063FD STHAMBYAYAH
438,346,876 *2C6D408E5E2F8AD7941745252728FFC0721CA6FF [email protected]
438,346,877 *2C6A04BB9168639BEF5D133D301136A61540CEF8 brayeraient3
438,346,878 *2C6B48E2EDEDAEC5924C80CBF9DF8118468C0271 bresdler
438,346,879 *2C634F792567FE4BCD81EDB87E49133977CD9151 raga.kervani,.part.2
438,346,880 *2C66C2337338448902ACCF45E4798F3E4E0EEEC1 [email protected]
438,346,881 *2C67BDA6790DFF67017A915AEEE1B7DD64AABE11 brkwo
438,346,882 *2C61379C1C94672FCEAD5E25DC0DCC2B6B873DF8 brockvatalaro
438,346,883 *2C625F3D0B036325C7DDA1B039B38889A9A823F5 RAMDISKPNF
438,346,884 *2C693691A865DDAADFDBD85680A80611D31D3F4E BRUNO PELICULA
438,346,885 *2C6528D91BE56FB49C9CDB8DF9B2725A9932C201 BRYCE.EATMAN
438,346,886 *2C696B8D6B228E5C31EA47F9F0823C49779F44CB Sube.Carretero
438,346,887 *2C61084E34CD9CC0841ACC3DC93B0A4639C00427 [email protected]
438,346,888 *2C668E77E6941454A9BAF6C17E3B2B15EB087060 SUBIECŢILOR
438,346,889 *2C6F63510454777D517588A7DA4E9CB2A4CFB32F bsc2f
438,346,890 *2C6120D7A1E8AF03F77BE0B52603CBA4D39C9FA7 rawette(remix)
438,346,891 *2C62EFDC7F74C97048D8314E5C22D581160FF504 RAYMONSTEHLY
438,346,892 *2C6AE2D038C0A3145F1E8C1FA538C7E09E4D4F1A SUKHOVERKOVO
438,346,893 *2C6F2F770A0536705D7E5D89A0F37BC1231B9E1C SUMANA-PANDIT
438,346,894 *2C6BAEB54A0577E071BCB42DDCE34C70157D8C69 rearrangementtim32
438,346,895 *2C6B3E88B26D06655D10FB12D0678399E2DF9D1E SUNAPTEA
438,346,896 *2C6A5C359CED6A5BC0DAE467A25F0726551672AF bu0e=
438,346,897 *2C6191DD54F3A8E5AF47518C4BECCD6FEC0FA8AC bu:qn
438,346,898 *2C6A08D021A4A6DB2368CFC8A4A0ED165DC39553 REIGERSHORST
438,346,899 *2C6054B2F81A0D1AC46D89C65DE84E5049287A0E B)UUS
438,346,900 *2C69E4D6C50E877D3131002688D6E8A121C23B02 BVGU0
438,346,901 *2C677297E73E4C4F5A392C37D6B88C147B4B854F RENEGATED1
438,346,902 *2C6BC46C5F1056C099B28F091BE4C1990F8AC0C9 [email protected]
438,346,903 *2C6365D0CBCC9889A59ED5E82ECC93C9EC793F72 rennsporträdern
438,346,904 *2C6129E083C94D255BDC4B6B554351DD92539157 t121198
438,346,905 *2C660F41155120E9B4CBAAD85C25F74528BC3FB6 RETINNINGT4
438,346,906 *2C694633C85E4F7A39511B51B72AE8A4044F0D37 RETRO CRUMPET
438,346,907 *2C6BB094406F127A8CAC7D925C8AFBE970DC9F29 taijinai9
438,346,908 *2C676953E0233155B182A8675D90C98C0D89EEA1 TAKTIKESES
438,346,909 *2C69B50B0957C3B991E0E09A9C035DBB3A58F7A8 REVARMIONSED
438,346,910 *2C6C92580C4E1BDDFC0CB53C0781C9EE801F01B7 TALBERGER
438,346,911 *2C63E1FDB164E918A526CC7B85B1F12132C61A4E BZGPB
438,346,912 *2C68E506D7095061884D73C019FAB634664A50BE c0d4d
438,346,913 *2C60515C37B23C1592CE79E4BF033F9EF8D16688 TALKMJM123456
438,346,914 *2C6ACD0B002BE388208365BC526AF3D684D139A8 reypisegna
438,346,915 *2C6D8E9B1793034992464FEC54E49D0D1CE85541 C1B0
438,346,916 *2C6F0FDD60EC5E04371F80B8EE14A59C17CC8834 C54607
438,346,917 *2C6390C9205A0DF1AAB58A994BA9CBFA7232EC4A RICHARD.BRANN
438,346,918 *2C6D9D8EF3833EFAECAF430E64C1C6B045663603 c-8ut
438,346,919 *2C6FECD2D6A225B852FBC374FDDC2E476EA23897 C:9RB
438,346,920 *2C60958FB02FA779D399B75413E3B74C00500DF7 telesite7
438,346,921 *2C6EB68488DC82E8AFA9F4BCB580AE80C2843ED1 robbysolages
438,346,922 *2C6FA297ED57A0B47667E2487E5D77C671C087DE terry.politoski
438,346,923 *2C6620DFAA9015B04E403E967C8BA366692590A5 ROBIN.GIES
438,346,924 *2C6F32259119F7D030383752B15287DC997FE3C5 robinzak
438,346,925 *2C6273F28B6ED87B831929C6C20C2EEC789AC3FD TESTING),以蒐集資料和數據供開發777
438,346,926 *2C668160F133EF79BCEF45BCB09459E2B5470A40 carmineannunziato
438,346,927 *2C6C59EB14984DBDC40E6E408D8ED24A4405E189 RODESCALANTE
438,346,928 *2C62225DA451715880E4E450B957E098FD7D0F5F CARTERRUTHEFORD
438,346,929 *2C6891580CF872315F87FAA55822B565515548E2 RODRICKGRASSO
438,346,930 *2C6FB76828DD4A6B465209830E81BFD17350AF33 CASOA
438,346,931 *2C6FFD64D662641EAE0B6D12D2F573EE515523AC Rolling.Lonely.Diamond
438,346,932 *2C625B2815D3AB7FA9635FD4252864349CAF653E THEBUNNY5
438,346,933 *2C6BB08DF1DDC359E2456891D99A10E009AC17B3 CBD+0
438,346,934 *2C688A9D6344B40F07D270C4B33F9F8F6F860AD8 cbr+m
438,346,935 *2C6516549E64FD6A7CA16FB638C76C13481539B1 RON.JERKO
438,346,936 *2C6E71D40B6A2E41127D9CE088A46190FA305A47 C$cg
438,346,937 *2C674D8D20473E4338152B7C78441C559F27DE67 ccmp7
438,346,938 *2C6A5C19F61BC5FFB6D2235EBC9946ABC14DB8B5 ROPINGSTUPID0
438,346,939 *2C6CC7FB423931F0BD9A5CF2FC54D24FB245ACA3 ROSALEO9
438,346,940 *2C631B016E8CB3B5C9650A87D82F5662417B98A8 CEDRIC.LICEA
438,346,941 *2C6B6BE5F3261D603D39E722C46E7F1D3887EA9F CEEPHENS
438,346,942 *2C6299FE71CC33F7C4F0973E9A9D5028A567D650 CEGKL
438,346,943 *2C66C8D1F03C8D3FAF0B6D8362FF27DD5253A6AC [email protected]
438,346,944 *2C6EB539E0E538B9FA2CA2A8F3D7653FF08E3802 rudykahill
438,346,945 *2C6B44AA4ABFF6E839A39C2760B8ACB90EA5F155 ruebendoxie
438,346,946 *2C68FF9C38A3E2617F8BF9DA08791659055E5877 TICA-DE-VIVIENDA-EN-ESPANA
438,346,947 *2C6AECD2DAF7B80FCFDB5C4E3F9842B1292A9DDC TIFFANY FRYMIRE
438,346,948 *2C6A999E5B0C15BB67D41626895A3BA43CE4F7C0 RussiansattheHenleyRegatta
438,346,949 *2C6818606F1C637F4373890F7FA84FF68312F9B9 sammeritt
438,346,950 *2C662C7210174DD25A63F665B4E57D1256305F89 SANDMÆLKEBØTTE
438,346,951 *2C6A8BB890B9430BCA2369647E4E7D38630CE875 SANTOS.TIERCE
438,346,952 *2C601C90D9A3CD00FB1AC19005C77270B11963CC TIKLOOT5
438,346,953 *2C6CCDD0728D18C9D69F189AB29F531B40127046 TL3T
438,346,954 *2C6D070A1B2A5E32DC3161853B44C70F49DE3725 CF4
438,346,955 *2C694E785CFC51C09D41F91789CEE331FC1C2E6B cfp-,
438,346,956 *2C6ADA606D858BB60401CF27EBC64315E0EFBAE2 SCOTTBOUZA
438,346,957 *2C66DE73C502133802A057EBBA8447A2F23441E0 SCOTTIEHONG
438,346,958 *2C60D54E882F46219D5504DD1C991EF3B5D07CAC SCOTT LUZZI
438,346,959 *2C6257F179885402E819AEC338C16C0D3D967B48 charcuteries0
438,346,960 *2C68F533554C22019A64BBB36A320255F71AB085 torrissi2009
438,346,961 *2C62193BD19D668718DE6E6595D6210A271D478F CHEERIN4EVR
438,346,962 *2C62B60D4BDB9BAACA7A89D89C634996DF78F83D [email protected]
438,346,963 *2C6901CAFC4EC381E385F57A0BAFD8F4B9126520 [email protected]
438,346,964 *2C612BDD2AE5BB9E32BE36C83BE9BA2EA3D3476F CHENGCWC
438,346,965 *2C614741DF1736F5176AD3AD0B25E7053E67E8D5 cheongmunchung
438,346,966 *2C6B8EAF6754CF721EA457B63FFC441D3C96FAFE CHEYENNEFAIN
438,346,967 *2C66B3504F40EDA1BB5F7D20E5E0AF31F5254A8B CHIGRABEN
438,346,968 *2C6E16B2E3F160D5C84143DC56B1931144DD06A1 SEK750I
438,346,969 *2C65FB58FFBCE94D77CF342C87C48712987F310B TRANSPASSABLE0
438,346,970 *2C643A8536621AAEAC555539F055C15A41D7E95B SEMIESTÁTICAS
438,346,971 *2C6AEC109A2F840D9A9A13CA6F86259CD64994DC SENDELSE2
438,346,972 *2C646033DAE8EE6075C041CF6594812DFB30A5E8 TRAVIS.BECKEL
438,346,973 *2C69CB5439A52B10CFBEA41F9606D3BF330254B2 SEXTETINGGED
438,346,974 *2C63B591824B38F1F01D386656C18669D9E4CA3E [email protected]
438,346,975 *2C667D1067294CD3AC853A88AE92B546DC35EBBA CHUNMING.LIM
438,346,976 *2C60365E49C5C3B260DBB10454B13FC799EED6AB TRINL
438,346,977 *2C6A51B7CAEC50506BB3736CE7A0C60A39F356B2 shevka.asp
438,346,978 *2C6DAFADDDAFEA2BBF55FB8F588061E781A86E9A cjp?,
438,346,979 *2C6ABF533DADCDDB9BB7934816D39A02D9A6A4FF SHIRLEYMOUSTAFA
438,346,980 *2C616685E90A52F8D6AF69839A37214B71A72AF9 shitspunky
438,346,981 *2C60F6700B5B4F24D5699B1A9A2119B6DD2F2C50 tuomioissaan
438,346,982 *2C6959F53B68D5A982A75E214B3FBC18A43011F7 SIMIRIGLIING
438,346,983 *2C6F0E58954FC6EE1DD74C2DAC53999A93258DED simpsonlater
438,346,984 *2C69D275FE1EC66EDE94DA090610870A07EE7CBD CLEVELANDLILLYWHITE
438,346,985 *2C6343C21DDDC6E59CBBF1F3E85B86F3C334EA4B CLFL
438,346,986 *2C628C1520FAC85FC831671CE5E0F086D325D70F [email protected]
438,346,987 *2C6E5FC724384E6B659BA5D109CAA8D57E333012 CLMLRTBBED
438,346,988 *2C6298ECA432E44F0D894C5D99F2A35A3EBE1D35 [email protected]
438,346,989 *2C6C31B65AF11EBE96E6E3731750C5DBEB71E192 c;#m;
438,346,990 *2C6B02C72A777BADF02A8BF5E3AB8853B7B8B4C7 conradkinder
438,346,991 *2C6D4FAFDA7B5F832018633C57CCEE72B90EE85A unc10gging
438,346,992 *2C6C5127E3FE5F7679FBF7242B254DD0B5DA8F9C SOFISTRE
438,346,993 *2C68FBEF43ACEB091B6F4B29A7BE2266815680A7 SOFTWAREINA0
438,346,994 *2C642A2609603612C94CFB364ACDAD1609C86C3F unhexocti
438,346,995 *2C6D0CF9F9001F852C1C44462C04C0F8F7F437EC unpr07e57ing
438,346,996 *2C6C69D56AB125456114A22FD2D080874042A677 C:\ProgramFiles\Adobe\AdobePhotoshopCS4\lmresources\es_es\ConnectionFAQhtml
438,346,997 *2C6BF7FB47A707A38A8DC8775471D116A6FE961F URDSTONE8
438,346,998 *2C6621F3CD95176DEACEF0218731384722396D4C sparables8
438,346,999 *2C684F6598A66DD92CAF5B4E0CEAF75C70C81AB9 V2F(
438,347,000 *2C67F21A29DA60DB9B6E2DEF939194B0E6925FCD SQR-LPPDSKW/(@)/R_L//PT
438,347,001 *2C6E46CB185E6DFDA8C44FB401969911F555D720 VALENTIN.TAGACA
438,347,002 *2C62DE7A526BA3C3B96D6E2A678AA10D8CDD0CA9 CrRZ
438,347,003 *2C66581BA322E247C0CE3D9146B5C737905C892B SRI.CANTIK
438,347,004 *2C65F9D4471C8EBB2E1A4C1E9681318ED9CA9B54 cruz-sotelo
438,347,005 *2C6F36899ABC51E216B1CCA69E7729A752BAE654 STACYE-HARVEY
438,347,006 *2C612588A08D40F79310DE1E7F5834A927492898 Stagg3r-w
438,347,007 *2C6A0508DA80C3FE0FAD3A5B9B78CF630C14183F stamp3d3d
438,347,008 *2C6533A54381856A99EE1771B85D6B0068755908 cti?h
438,347,009 *2C63F7E0EFB43EDC5D78DB670E273E68A97A9563 C((TP
438,347,010 *2C68AE60EA4835F43393A990F62EEC62AFC3B75D veetutt
438,347,011 *2C66C4EAA5719B07A759B153C97EB300D7DADBA4 velayuthasamyvt
438,347,012 *2C69341C9785A30ED8CAA9E667EEB80C1A14F09A STERNELYE
438,347,013 *2C6966A849ABC57E1951BAD734588C4EDF992819 [email protected]
438,347,014 *2C6387C73CE6CB865570118E79DBD2990F3680F1 C&uo
438,347,015 *2C6486C46DBB0988EE919EABC9F688B75F6532D2 CURTISKHOLODIVKER
438,347,016 *2C67AC8FB806D458AE5BAB02EACC9A182B6A01CC CURTIS.RELF
438,347,017 *2C6E54773A4FAB48DE9D83C4039EFFEE91DBD3B8 STORY-OF-THE-EYE-(SINGLE-VERSION)
438,347,018 *2C6B033C2076E7B5CB3596307EBFB7DDA1B489F3 STP101
438,347,019 *2C691068DC763152CE8EFE4D133E12AA98CC86D4 verkaufstände
438,347,020 *2C69739FA1044AD9B99E2274F7250E7469D5632A SUBHEADWAITER
438,347,021 *2C620A48CE9E73F05D6BED8C177BBFFF80A16327 SUGUK
438,347,022 *2C62DF554BD55AD6A635ACC167D3FED92E2AED0E cwda
438,347,023 *2C62A0D7EC25502870A769838965DD88354A4896 c%wz.
438,347,024 *2C62BC00AF70B28D45685B5E737F3959EC9A6984 SVBA
438,347,025 *2C67D1893726EF0CADF9BF83BBAB45391732B67C vimal.vel
438,347,026 *2C6E42C35AA7FF8285A805C391F0C3C3179E41EA VINCERODELL
438,347,027 *2C6199061BE3C00D5747CF8971B0C6F9203003B7 d02&p
438,347,028 *2C6C65A221F72AD3146C90CA3309FF4DA90B7227 vindm
438,347,029 *2C69F77135AA3533641E51922AA7350686A045E0 virtual xmas 1999
438,347,030 *2C6FB097EE7CA528EFE5BF7E0961989048C53E09 d2qnv
438,347,031 *2C6918116BA8F5B36F6E49E750AB030A1431447F VLADEAUX
438,347,032 *2C640FCAB21C9E6E5C6B22E38F43C78C4C0084D5 TCATOMOH
438,347,033 *2C6AB9E4EC5AB8799B1C95E99D73567A8B3DA1C7 teagardenlane
438,347,034 *2C6B52591E0717BD4C50C307B1A2883D2BCD7272 TED-LATTA
438,347,035 *2C6ACCFC540195188F589274CCD8054EF0A64767 TEEGEE
438,347,036 *2C60C1C8593DF93E626B7D9E6495EAC151E400AA d!5!n739ra7!on5
438,347,037 *2C6E248527A6770C1259A349ABDD9B7290A06B8C TERRENCEDURIG
438,347,038 *2C6EC79E26A8AD8F7730152795928E12BBA169DC TERVEYSVAARAT1
438,347,039 *2C641C75C3F453FB811CB27E01DE1B821589212F TESTINGPOLICE0
438,347,040 *2C63EFC0BF3D9EE5DFD2D6B8E08DDA3FC79D6286 D9PCR
438,347,041 *2C6DBE2241E5738B5EB0C038E5646BA15A39813C THAD.PETTIPAS
438,347,042 *2C6CD6AB64C6154716B2168A45A6D4227239F21B THATBRAIN666
438,347,043 *2C6164F237EF9489A2320BC55105FB309A1E9B07 WAKAMARU
438,347,044 *2C69C4C685294B8CA150632579E7BD341F94415A WALKINGONSUNSHINE(FEATDANNYCALVIN)
438,347,045 *2C660744253E028F7F3C76B0AF7BCB2C45040F46 danialservice
438,347,046 *2C64821A688BF5F6073A02575E9558F1BE5E076B [email protected]
438,347,047 *2C62DDBD5141EF675E9DFBEFE97878A903DE6831 THE-BREATH-OF-LIFE-INTRO
438,347,048 *2C6F1DC85D4042A56AEE59252987A21C1A0E487C WANGJILL.BBS
438,347,049 *2C61211FC1438789EE8D90E4969DAE4A4696F55C DANNY.SHIH
438,347,050 *2C6B0A55353091FBED492997FE1FA6F9F3955DA2 WARHOST
438,347,051 *2C677B06626DD9FEE51BA2B25330E9C902C91568 DARWINDERALPH
438,347,052 *2C64693358F2199EDA8998C288663710508514B7 dasilveira
438,347,053 *2C6C44B08ACFF43E3FF39C35585ECB2EE378884D DAVIDKHARE
438,347,054 *2C6B2AA808CA418905B9350C3C02171B007B1E82 THERYAN65
438,347,055 *2C65F54F17000E65A9FDBC68CCA260EF06479282 THE-SOUND-OF-SOUL
438,347,056 *2C61964E18E3E209BCE806D6BB142D86BEA8AFED the-unknown-project
438,347,057 *2C64290F7E2253646380C5305F061D30768272B5 [email protected]
438,347,058 *2C6C594ED597FA5BC134767C5AF16B4BAD1E5FC3 THINKHOW
438,347,059 *2C6E2D0EDCCB9AA2AFF33AEC7E4FE898EC64CC34 DC.J
438,347,060 *2C62C2816929CC499F51988C2FAAEA3D9B8B35CE d_cw,
438,347,061 *2C66302DD6162C30AF6F31EE14E1C7D21E6F85BB DEAFENED
438,347,062 *2C671D5763B645D82725B646C14E45462D458677 TILLYROBIDEA5
438,347,063 *2C637A9E08F1E716F45C95BED19ACFD9C34BA91F [email protected]$
438,347,064 *2C674206BA2F292635EBB04A7F496316CB3B2706 [email protected]
438,347,065 *2C69BB079E01D3503D501D93DB9A1E581746B12F DELMAR.PAUZA
438,347,066 *2C69BCA2E65D36B0DBA8A82A12031517AB4FF924 DEMARCUS.METZEL
438,347,067 *2C65C59CBCC977D6AA5DC5186A1257B3C611477D denislamorte
438,347,068 *2C6A6FB54E8C871E02BB112AA8D01E3EF0548123 WILLIAMSROBERIE
438,347,069 *2C6102E7E47F2E7464E280CE261577B7595C8AEB tolen123
438,347,070 *2C65AA5C4056BBC096F4FEA02EC0A6D62C81B299 WILSON.VISNIC
438,347,071 *2C6C6C9B594885F10DDF5811637D6E71662229E1 WILTONMULLISON
438,347,072 *2C6A17FB276D468433EE6162B02BB3780A993F32 TOMORROW SHALL WE VISIT YOU AGAIN.
438,347,073 *2C6B86DAAE7C5A488502D3512D8F930204B43245 tong#24
438,347,074 *2C68C71A0B16408176E9D6B6A2A21CAEF75A35E9 DESOCULTAVAS1234
438,347,075 *2C61CE6BAB0A9B1BD7BAB4D27A0E0686BFDBA5AF despotiques
438,347,076 *2C682E4FB873F95B23631700917FD011192DEB90 WONDERSPREUKEN
438,347,077 *2C6C41704B1E9741DC60B6C020EFB183D4917503 DEWITTRISLER
438,347,078 *2C6EF98FCC946E7E08285B0C27A80FEAA3EE3330 TRACYCHONG TRACY
438,347,079 *2C66F60CA9E7E313D8E37784EFEC0AE30A63C361 TRACY.DELGARDO
438,347,080 *2C64D2211782B502A8CD5B70A91DAA3F29CC92FA DF44L
438,347,081 *2C6E0534832F92BF1B1A031E3CC76C30127A1282 travoul
438,347,082 *2C66856ADB9AF3B9A033C3CF8E92A54874DA8FE0 trevorcata
438,347,083 *2C6B2C69A6500B8086F88BF66F9E678A7D04F63B wwworbitbooksnet
438,347,084 *2C6915C63095CD51255D2030740A03CC97D657BA wwwthinkglinkcom
438,347,085 *2C671A2859B040CCB198DADE37FA833A08724FE7 trio de la jalousie
438,347,086 *2C6D8F7FA01F15C97F62CC50CCCD47EA2FD41D8E WYRWIDAB5
438,347,087 *2C6B3D5D38C36C362AAF15F3862012C192351A96 [email protected]
438,347,088 *2C6FB9EF4E954FD6CCF06047C75C6F3283A7BE05 tronche1
438,347,089 *2C6F495A24ACEA819EFBCBED5D48E24D22763046 dialyses
438,347,090 *2C6A83B071E5A814865FCE63AD08E70E2D0AE663 TSANO.ALEX
438,347,091 *2C65C0D2EC5DDCE5FB8C88C70F3F463FB38393A9 DIE.DREI.???.UND.DIE.GEF
438,347,092 *2C6632D3A9DA560157B4B22FACC3C041CE1A3C38 TUESDAYRONALD
438,347,093 *2C6695EFEA0AA2FF3E9AED29F20B277B0C0DF16B XSIS1
438,347,094 *2C645A0A23218C994748BECD65FEE6CB6F5EE50E diq7o
438,347,095 *2C6D006DF3A3FD67CF34EFC646D7D94D2A4312ED twoaxiom
438,347,096 *2C62E9F4F777E8153A2BC6ADE2D5772494BE0623 DjCn
438,347,097 *2C6B9454AC2214701B7C2E1F281F9EB8844B1CEE [email protected]
438,347,098 *2C621892A1985460CFAC716B6318B0438B561B05 DKJWB
438,347,099 *2C654CF43D1A97F9E8077CD46D3ABED610F778EA dl4su
438,347,100 *2C6FAA1EEAE361E80A1769F07EF18CAE80733351 U.LI
438,347,101 *2C6BC3FEBACB75628E908DDB17104CDB290E6A84 YOSHI.REAUME
438,347,102 *2C6E37916ECCC5DDBA91D05DC35A21324F30F486 YOU.MAKE.ME.FEEL.(MIGHTY.REAL).(FRISCO.DISCO.MIX)
438,347,103 *2C60B4F19B1B89D4A12D7AA15B174FA83A5CCA5A donovandicker
438,347,104 *2C6EE513750943549B912628D7C0DDA72D9C2E21 US-FAC
438,347,105 *2C60F5F35F7D60B0DF9639EE94BE315952F7BFB6 <z,[
438,347,106 *2C680B14B49F1454D4BD11B7BD72C3EC6CF2A6A8 z3-f
438,347,107 *2C6BEB07EC2097607FA3DD9D1C2508AF452D25B2 v5xh
438,347,108 *2C634FF1F61D11555A117FC5FE02AB5C6F746877 valentinenrriquez
438,347,109 *2C61251EE3E372E57F8B30311A048FB348841E69 valentinescanlin
438,347,110 *2C67F8584B229CB04D3A239E37091D2DBFA0F434 Valse-in-D-flat-major,-Op-70,-No-3:-Moderato
438,347,111 *2C6EE1191E51AC8D39A0B4FD27A43A269988DA82 VALUSITABASSI
438,347,112 *2C6E389994BAE6795AB2909A5C3A9A77903C0053 ZERINABELGRAVE
438,347,113 *2C6E636539B22291A80D1CFE0683D433D6795F9A vanloads
438,347,114 *2C6C9AB0D10686093B1C7C37285959C71888E1A4 ve]
438,347,115 *2C615FF89DA6D8B3DA0B0073EEA24E9AC9578AC3 VENDAWARDRUMS(A)
438,347,116 *2C66A5921DB69C521D006F0A832DC22A216812CB DR^ISHHTHA
438,347,117 *2C6D8086456AA508E2C692012D2C4F5442D85B1E VERONIKAKLUBNIKA
438,347,118 *2C64924AB3580BF5F933B1F223909FAEE16F1059 DSLBI
438,347,119 *2C6A33FC2DBCC03CC40E2670425B8258694A49EE victor-era
438,347,120 *2C65AA5626435167BDF55526E4F675E8C2AC6115 [email protected]
438,347,121 *2C69F1EE525099CAC881C5CEB919F0CCD679AE91 zpfs
438,347,122 *2C6B3F015AF50D518A9E192AE3B66E5DC094F8CE ZSDXBZP5
438,347,123 *2C6EDC0A997A25D1960CBB28F8CA7E1460C873D6 D)UK%
438,347,124 *2C6012764FC0921683F700622573199AB5DA5DE7 [email protected]
438,347,125 *2C613FB722281632BF1E8C912FB25775B7F0CEC6 ZUNIGA5
438,347,126 *2C6EC06D6A0C5BE0076C33D3E27E5D642364D309 VINCENT SORGIE
438,347,127 *2C6CACA7B2B2325C84696E39FC3E18493DDAC9EA dustinfrancois
438,347,128 *2C6718E12572ECE0F32FFC97BF58E834171DC0C1 ΠΙΑΊΝΕΙΝ
438,347,129 *2C6DBA78F386BB9606B669A67F96008ACBE034D3 d=wqs
438,347,130 *2C6D368132FF96C52AFE409DC0FE7B01C68FCC44 VLUPGURD8
438,347,131 *2C6F73D134E900D19AA507FA2E0090C38863BFD1 dyevsgon5
438,347,132 *2C6DD9775353B0F8FE0306B5C1FA7B2026C035F0 DYREDEKORASJONER
438,347,133 *2C6AB8F2EC1B353CEE61BE699EE9C2CA2175F025 МОРАИТО
438,347,134 *2C67D69FBDA4346AF8DFA1BCC8E5C46713135001 E1UCID4T0RS
438,347,135 *2C61E21627B98C5B0F489E6B7090CAE7C98E62FC vyzna
438,347,136 *2C637A3A2ABF7A6C7DEE95BA8A1021C071774BC5 WADY.TULL
438,347,137 *2C6E939A754B0799D9CF3F005429A25F2FC11595 WAFFI.GAMAL
438,347,138 *2C69D6ACDB29B952897BC5EE1E2184F6E2847ACE WAGELAK8
438,347,139 *2C6A3033CB71B8A01C4931284981765FACA27B9D WALA-ABDO
438,347,140 *2C640B9188C1B6761F6D5995190767BC760E14D4 walkingthedog(live)
438,347,141 *2C64AC9F44C922903AAA539157772561DC985CE5 edgardomaltsberger
438,347,142 *2C66A1C6743DCF89473D2ECF10A3E22AFDED2EF3 ТУМАКОВСКОЕ
438,347,143 *2C69F6EC5CB61C1DAAD50F5025ABFAD14F590795 ТУНДРУ»
438,347,144 *2C6F45DE777984B28D9F6A69B6FDF3FD96874CBE WARRENHAROUTUNIAN
438,347,145 *2C6BC83702620EEFE871BF430450D1CD1A358DE2 [email protected]
438,347,146 *2C6ED74548C99A0E0632DF783081B55104287C80 WAYS-TO-LOVE-(WAGON-COOKIN'-REMIX)
438,347,147 *2C6116F0986050FA5B00AC5B1AA02A5E38D1C6F7 WEGGESTUURDEN7
438,347,148 *2C6070601E8A43BA0DA51C771AD20ED08A2FC240 WELDON.KORAB
438,347,149 *2C610ED8F2B2693AF13300EC069EB84320242093 WENDYKUPNICKIKROUSE
438,347,150 *2C66B3D74C2FA87E7D23D62A4161D8B5E437E549 [email protected]
438,347,151 *2C6875CFB2DADD2FA96BB08D4CD4DF1ED0FC4390 wennderletztevorhangf
438,347,152 *2C6F5AEC6F50EF0B254594EF567E0A96FEF63288 [email protected]
438,347,153 *2C641398490F5500F3A391434726C0F821A82948 WICKRAMAGE.METHTHANANDA
438,347,154 *2C67023B0B24FAEE19CD0793C3AE7EF815D1C381 WILFREDOMCCUMBER
438,347,155 *2C693472871940617EE16EFFB4B9D6B83151802E WILLIAMDUHEAUME
438,347,156 *2C6C1946B6312D0A185A59D5DCB438C18BE24873 EDMUNDOMOSQUEDA
438,347,157 *2C6F956000A95241E9261C0FE407FDF4CE74FD8B ED.NISHINA
438,347,158 *2C6114776B0E02E54CD0D2120EF0308705311CC1 EDOQ7
438,347,159 *2C6FF05258E766F8FC2BFF6A72313AA89D2D9809 EDREEVIH3
438,347,160 *2C607EFAA4566A9B3E9E007CEC429C2793DD61A2 eduardosilvaggio
438,347,161 *2C6297555D6A71409D767906AEFD93CA07444CDB EFATOVICH
438,347,162 *2C60D171FF054242048778CE819B25A3CCE8FB03 efrenlindstedt
438,347,163 *2C6BFA20DC336B087523D097B91F3308257B1D80 EFREN.MAILLET
438,347,164 *2C685C35E962B5F891AE8C386A6777072E511DF6 wwlegalcom
438,347,165 *2C68EFC7115E3B910798CBE404005DB14E7089F0 e~?h
438,347,166 *2C65C6A02528F9FA26D051BD54A0D2D1953C0C02 wwwoperationuplinkorg
438,347,167 *2C6C6379778F10E2709DBF605DCE060C83D1E6A1 [email protected]
438,347,168 *2C6866A8EB2F6792E73384184858C2AE8CE182C4 ejogate
438,347,169 *2C6456E954D5AD1D78352087F966AD29F938504A [email protected]
438,347,170 *2C66489251713CBDD985326BFC94F322A1E20E65 ekw+2
438,347,171 *2C6F0DAFE9B8C53A047E465963FC002676D74E71 elegie5
438,347,172 *2C672F56D3B399BDFAD1C5E7D67B931B4B917782 XUEJIAO、チェン・シュエジャオ)
438,347,173 *2C6BCBC6152332B9228B1E71986C2D149ABE7B2C YAMANI
438,347,174 *2C6EF5B19E677D5A4EF20143151913547FA4E12C EMB1EMA71CA1
438,347,175 *2C68FEE96FFB91668F31E541206D14AB528BE781 yankeeyankee
438,347,176 *2C6AC3578B4F823383F51DADE586654D024DB59C yasminyaku
438,347,177 *2C679B226577C592DC6A6534591E14C069AD52D1 [email protected]
438,347,178 *2C62E55F3A207E2D51303DFA021D1C001AF54C6A YEMSKINGTHOMAS
438,347,179 *2C6C7B288CED0A64C790B62924EC7F3D13F40771 YHTEISKUNTAKRIITTTINEN
438,347,180 *2C6003A96F85790AD0C71017185BF5393F051196 [email protected]
438,347,181 *2C6C10915AE294B729831987883DAD3925BB3B6E YJAYAPALEN
438,347,182 *2C6B43E747752803835988AAAE97B3850C5D1694 enidnaleced
438,347,183 *2C6E4B276DAB7A4AA11E6B82BB1675D3C0E42041 [email protected]
438,347,184 *2C66999A4235B4308D81C8C992BE57C151D5E545 YOURMINESINKABUL
438,347,185 *2C657CE3724C351F62E79F426A54EF6E5629D596 yusfanys
438,347,186 *2C63A8491DAB5A58F795A4D3F4B94C768D07C46E ERICGAMBRILL
438,347,187 *2C6C5DAB2BD74DF0AA7989C37423FB09E380D7D4 ZACHARYHOLMER
438,347,188 *2C6CDCF9E3A0A4DE47B0EBBDDFB1397E807DD955 ERNESTOCENTRELLA
438,347,189 *2C69CB0A0CE8EA51A9DB146503E00F4D19BA0811 errolaranjo
438,347,190 *2C63C6DC84D5A7DEDA09255AFE2DCC3084A353AA ertoene3
438,347,191 *2C64CB5E353B12D5B0F7E5AA7258A2106275415F ZARKA.JOVANOV
438,347,192 *2C61C2916B1993BAC1FB3E1E73149EFE65144BD0 ZBB
438,347,193 *2C66C283361CE06FE9DC197B8293554AD60B9762 zekepolski
438,347,194 *2C617E100B44FB4896290C4C8A5DD0D9AC00CB0A ESTOPPEL1
438,347,195 *2C6CCB110823E90821FBC6CA7D115A39F5217439 [email protected]
438,347,196 *2C6EB57E1188BE8B97ED6FCCF60F215342668C3D [email protected]
438,347,197 *2C6C878099728170F2D070E72D6E1EC9A0A66A64 [email protected]
438,347,198 *2C6C6982985B3A4163EA82877FE9DD17BDDD40D4 EUGENEKALEPOT
438,347,199 *2C650AC567B2DA94C76235342DD2E5099D258AD4 euglenales5
438,347,200 *2C608DB183569A9407F65A9622BD5C96A2ADB138 zodoende.
438,347,201 *2C6835E3F65CA384095B39735BD716DD359B2112 EUZEKES
438,347,202 *2C6A333B12895E625B9AD43B0BBD6A69E69480E5 evolutionnistes4
438,347,203 *2C6824E2BBEB2EAE13647718E621AFB34DCD0CC2 EXPLAIN.TORTDOG
438,347,204 *2C67817E8752978FF67AF8A4FC6F7EE5B966C35A explanations11
438,347,205 *2C605A6D0A032B39E651A5554CBA54DDFF3F6CC3 АЛЛІОНІ
438,347,206 *2C6E242215B6701E7FD36AEB84E58A6151358DAE [email protected]
438,347,207 *2C672ADE4F9F19D2335D293AA7A145B1394D945A 05-23-1151
438,347,208 *2C6387E847FA18DF3871BDC6F402D7432F470BDB 
438,347,209 *2C6218540C9ABE49E2E0055E11BEF40B0DFD3749 zy
438,347,210 *2C6A21D1EE146574BF3CB486395ABBBDA64C7436 ЗАТИХНА
438,347,211 *2C6E320369524A3EC5747866FD84139F0BC1D9CB 0theironman3
438,347,212 *2C61A2C2FE9CB9F7BC01DBFFB97F9D2718B0E2E6 110.haig
438,347,213 *2C692FF62FC3C22AA079395ED69A2AF4AD04731B 112092
438,347,214 *2C600AB77FF4D11E21EA8F57E61104B48782AA37 ≈11mb
438,347,215 *2C61356FE58023E20BA5E45B1B60FCF28F6426E3 1225991 pintakohteissa yksi k
438,347,216 *2C654C1F175E457C50ED1609E7E7F22719B30A90 ^
438,347,217 *2C60569B40FB5890A28E3E2699CE07F46F88E6FE САИРИМ
438,347,218 *2C6A7EAE7AC000AA3061D06ECEDE0A14CBCEFF36 '|!
438,347,219 *2C682842DA52E995DACAC948B8A9028BB0C20C5A e7/
438,347,220 *2C6E713F601554C4C62C78F1E3253151C333FDB0
438,347,221 *2C6022D339820AF6A7943E5DEA9C19C3C12DF16D
438,347,222 *2C6571B6C9B8CD2BFB5E083C3B07049BCAA733C9 HZ
438,347,223 *2C628802F15B6C692B813CDB51ACED00D1BA7AC5 |
438,347,224 *2C625E8A2D401F05DCB75D25429DA291934D5BCB ТОКОФЕРОННОЙ
438,347,225 *2C6B0CC8CFD1FD748D62078465DD1C866D445BCF тэнкава
438,347,226 *2C6948741F250320EF80B8C5B3B1AEEFE407E7BB 
438,347,227 *2C695B64AFD71DFC236E967FACFAD5C175E67406
438,347,228 *2C68F88670565984E6B4DC3B4354EAB0E25D9BD0 5
438,347,229 *2C666045F473515FBF26980C547200EA5310DB7B 1577-DEPOSIT
438,347,230 *2C649B9BDAB92538AB8A25A9D3749A2C4CB5DABD
438,347,231 *2C6EE3BC06EE461D7C7D1F6CCF67F5A53ED4F819 15-ODOTUSTENSA
438,347,232 *2C6D0A99E44647647C7B170B9B6522CF230142FF 1626723 enkirjoitat
438,347,233 *2C63B91F990E08C7121A7327C96A891424C65CD8 16sep1855
438,347,234 *2C6C1296D356E5B26EA7DAFECAB6CAFF925B9B97 1895902 rapuruton-tultua-eiv
438,347,235 *2C6901020E310295FBE3BD54F1CF11AE12D61F28 信号(C)が分離記録されている場合はS端子で接続したほうがY
438,347,236 *2C60429A4DC8A88278E112A1C778D951E392239F
438,347,237 *2C67DFC56016599DE5BF3A73D063A13616AB6886 后来被称为WASHIN
438,347,238 *2C60296DEF1C8ACF45A6796035AFB5AF48A67C6C
438,347,239 *2C6C262487033C6589B0D813FCAAA0106266555F i=
438,347,240 *2C646E1753805BA14E429518E5EA214C45D9B3D1 1airforce8
438,347,241 *2C657E22625BF182DAE7FC183DE93B50B20423B5 ^炍ou
438,347,242 *2C67620638321C36662C7BA52D5413963821BFD4 Q
438,347,243 *2C6EA15DF82C71E187C6A080DAB9ED858DFDA1C5 奔馳W212
438,347,244 *2C6D8DF9A0D1B7CCD7BF649D2FE882D26AE0440C V0
438,347,245 *2C66624703A1DB397324E4B0E780C69E4ABB7048
438,347,246 *2C6341F511B4184AE7A504344DA653FD8A67E212 Ub
438,347,247 *2C649D849DCE6C45D2AC34FF3CC2D024662C7888
438,347,248 *2C6128D01E2EBCBDBB0EC4B2C61EF45788583183 1gesundzustossen
438,347,249 *2C67D5AC7B570F77ED230AEB947263BAE125E9A4
438,347,250 *2C61B64A992C432214D3E697E155BB9DD8B8DC11 1hein
438,347,251 *2C68DE1384974E32F57F96EF985D6E8D951DE5D7 '9
438,347,252 *2C6FDF0AE9B227973C7E3C5986740C414A4C1CC6 1katoaamerkitt
438,347,253 *2C6BE60483BB000BC611C2C75B9894ED655CE419 A
438,347,254 *2C62D249D3FE5F57B367C00FD57B6327D7954A80 1KRBKSTJ
438,347,255 *2C678B9DA035EAD1C319860E89C024924A2D4F43
438,347,256 *2C653C506B4DFAAC377DE9019C2BF09E8BCD4DC6 w'v
438,347,257 *2C675E18A0474C7D8718B318DF90B8A39E6DBE75
438,347,258 *2C6B29A128484632CE08673BF710FD4F793D7F38 1.liljestr
438,347,259 *2C608FD942C795E61977813D1857D8B442B7893C 1n5ub0rd1n473ly
438,347,260 *2C6012F9F356D923CA0EE59F75798F7DBBF37280 W
438,347,261 *2C67069FF6181A251FCC953C4441C845C270699E
438,347,262 *2C6CCD0478DB07A53766B3AA6B1B84CDB716E177 1-OMBUD
438,347,263 *2C6351D74B031D79E0693D125B627653B916D917
438,347,264 *2C6C8DA7A18EA17E9D83ECF48D5B0D232B0E5CF0 Ivz
438,347,265 *2C601B1108D62A155A1D9FA438BDF4D3C35A7FE3 1Q2W3E4R5940
438,347,266 *2C619DB65E213E40CA332088086F2FC68AAC3D22
438,347,267 *2C66E41EA6A0E3A00172AB90ACB8842E19D29F38 000ps級のエンジンを搭載した機関車が多数製造されるようになり、幹線での列車牽引に多く使用されるようになった。
438,347,268 *2C6883E23F95C440C61BABBE2140B0A067F37F10 1ssl'n
438,347,269 *2C69AA64D12FAAC1C3B32AFD9999840A1CDF96A0 01061371
438,347,270 *2C69D8E6D0391AFEEBD403D2267C72AEAB25D0A5 1.TEILNAHMEBEGRENZUNGEN
438,347,271 *2C6D01FFF29C7B66224499518C8F7AA08D9111CC 1-TENDERN
438,347,272 *2C61E03E5AB2E959A36116AD3A77004B97776C57 1titaanimetallilla
438,347,273 *2C668B11912F4A1F224345C06AA1A2AF80BB40B4
438,347,274 *2C6BD2EC01A3FA53C852E59C037E088CF4D20579 1 TUSCHTEN
438,347,275 *2C6E7E1579D51C89FD185C49AEA9EAA410544BC9 0el.gifnocfi#
438,347,276 *2C61B35577C9FC0534CBA6DC34F9884808150703 1-uno-entwicklungsorganisationen
438,347,277 *2C65D6850A5DD1E4713A6496B3A0443B9A9CD7C8 1vuodatukselta
438,347,278 *2C6C4F944E1AAA38375F581009838C7F9F0442E1 [email protected]#$%^&*()109
438,347,279 *2C677844049132EB3960BE445BD9F0205DE44D7E 06201806
438,347,280 *2C627D782EBDC8387507F6B8AE37FC34752A6179 129GIDEON
438,347,281 *2C6F5DA69C40D7227DCDC11FED2D64071F37AF3E 2215621 kun-miehet-ker
438,347,282 *2C6B25802B77337A62F18CA4034101B741FDDCE9 2236986 KAPPALEIDEN.KOKO.VAIHTELEE.V
438,347,283 *2C6784E6160E725799B98D54B306FB9F8A51BD6F (_0)[email protected]
438,347,284 *2C6B4586ABB51B6EA7E29A84342F0CF18867C739 1031551 das.war.1981.oder.1983..
438,347,285 *2C6AD34EF3CB936D814B082B12108B4F24237257 106.silverhaired
438,347,286 *2C662FA1353E2F2BC58253BECC7ABA48CB34350D 10 ANGEHAEUFTE
438,347,287 *2C6F0F5B27F4494CFBE6E3A53E36FABB9805CE35 10PRONSSIMITALISTI
438,347,288 *2C630C8BFC3EBB85174CF48A96E5D81757552E0C 2575081 THE TOWN IS EIGHT MILES OFF THE INTERSTATE
438,347,289 *2C62E0D5C5CCD672C3072FAA9A257E639CB03F3E 163mnbv
438,347,290 *2C65016043010C3E181CE51D96FBA12BF3AD4CB0 167 KRISTIAN
438,347,291 *2C66468E9A19BD866E63FAE44B205CA8FE757FE5 1213155 sunpoint-suomenkielinen,selke
438,347,292 *2C66D55E6EAA6823DB1C921BF4993F2C073FF0ED 129253EB-2D2C-3A4F-8D0A-7F928C98472D
438,347,293 *2C61E13F0DB9B3DD5BB427287839841568A21B13 132.BEDENKLICHE
438,347,294 *2C6A3EF226B08E786AF99B72EDC7B891F9A1C2B5 28-STRASSENFUEHRUNG
438,347,295 *2C68D55192FE02592534A55546FA4F8167E3724B 1520 ММ
438,347,296 *2C65D0292B40A1AEE8E25DADE68C912E95A23F31 1637951 EL
438,347,297 *2C68A120CFC02A665051548EFB55B0E30009A517 16DONTNO
438,347,298 *2C694D245113EC498CC00C1C11B9FC76360C73B5 1712830 KOKELAS TUO KOKEESEEN OMAT APUV
438,347,299 *2C64DE50A03054E34D310E147334E4DCFD741F9C 2915831 arkeen kuuluvat mm . kyl
438,347,300 *2C63661AEF693E5964498EDAA251617B6D757AAF 1-BLUEMCHEN-ABBILDUNGEN
438,347,301 *2C64A9BF990A1036605F20C43EBB588C88E5FB46 2EMOTIONPACKED
438,347,302 *2C627EDD3A431928C35C18E1BFB38B7BA86A78E0 2.GAZAJERICHOGESPRAECHE
438,347,303 *2C69F320DED2F579C1A3833011F65486B179A85C 1835293 DAS IST VIELLEICHT HUEBSCH ANZUSEHEN
438,347,304 *2C6258FD40A76307FC78CE6DFB5B50D6ADA697C6 18.novelli
438,347,305 *2C6B982D8728DBCB6E166FA63005C13D9A948294 1.GHRELINPRODUCING
438,347,306 *2C628340FC16DAC050F5EC4A926906035381CFD2 1929480 ASIAN.OSAPUOLTEN.KESKEN.VALLITSEE.OLENNAINEN.N
438,347,307 *2C60736D35F423B79A3F8DF216B111549186FF10 1947950 t
438,347,308 *2C68CF060E594C10DC7C87F3043C657A7F3F1BC3 2.karsintapeleist
438,347,309 *2C6CAA39B4AF43ADEF6341C1A65276AF272DB0D3 2KLOOSTRA
438,347,310 *2C61D7404855F9DE75D25A7A9DD75C13DA1CA449 1hein
438,347,311 *2C6902B3B63B8B423ED863B3EEE062F171E776F1 1ILOVEMINDY8
438,347,312 *2C6A86F5BF37F08E41F65EE7A0160D58F52398A9 2MOUNOUVE
438,347,313 *2C6CE0B24D718436D5F514943B0B22D53A87B053 1internt-sexseiten
438,347,314 *2C6F36BE7BCFE3D198CFFBD23D2B616D84F8475F 1-interpretationsversuche
438,347,315 *2C6690E6EBF7B9A5442A5555F8DFCD082AF44BDE 1.atlaw
438,347,316 *2C605CD74BFD94EFC304472AE5AFE5AAF917A669 1 KULJETUSPUTKIA
438,347,317 *2C6462DDA8F7CCDA524ED765F65BBD5D78C896CA 1 BROUSTE
438,347,318 *2C6DC257AFAAD4D787B4D015816C2C37E971E0B2 1.CALONIUS-NAUMANNIN
438,347,319 *2C64DE7B6B83330B1AC61B7CCAC96648379A2B57 1.LUMIMALLIN
438,347,320 *2C6F5A05EDC03BDC2631A22D11E9241AE2A3072D 30.heviyen
438,347,321 *2C6C4153AA80935A9DF0DDBAD7A9CA8FECF5BAEF 31.03.1826
438,347,322 *2C6E9C83F3EF9CC493ACB07CAC1D56A25A4F2279 3410LUDDITES
438,347,323 *2C693107AED1A912C3E78175E7EB73D0EC5C8552 36-BUEROMOEBEL
438,347,324 *2C6F90F78C29CC6BE41C99ED37923CCB1140AF69 1NGHTWRD
438,347,325 *2C6E65299A2B18BAF9D3CD241AA5F4ED70B3802A 1 NINE-LANE
438,347,326 *2C6C5B68D8364631E297AFBDA98D039F35AFCE3F 380CAMRON
438,347,327 *2C6005F4F4D00C31561C21063636F1616CD15C3E 1oikaisukohtien
438,347,328 *2C6788F306FBC7D7D6B7B6DE2EB8AC2E7B06D7AE 3ATK-ONGELMIIN
438,347,329 *2C62BFB6BB5713E661A5720806B05F934AD10FC9 3b<0~d##3
438,347,330 *2C6BE5BE082A0978DEEC3D4416A2A48FC0A20FE2 3CARDPLAN
438,347,331 *2C6FCEBAF030459B702B5261012D41AAB6341D9B 3CBICORP
438,347,332 *2C6D0A51D652858D4DDD3C3BC84CC08DC8E32A44 1.HALDENARTIGE
438,347,333 *2C67057B3E58EDD69EF02727C72FED6A38E79F68 1hein
438,347,334 *2C6C7FC0D574B6DDCA640C80D87C0A276810789A 3 KREBSGEFAEHRLICH
438,347,335 *2C69B9D4394626473ECF1038C16BEF4CE0BABB7E 3kuechenlaie
438,347,336 *2C63D2DEF846228235B23230FD3FD4D2FC910794 1-SPD-PARTEIMANAGER
438,347,337 *2C6697283CD87B7F0F02FE55CDA219205D4FC2E3 3======p *(>_<)
438,347,338 *2C6FE453C31FF6B1F9DA065DCF5ED8035FAE2C12 3RELOGER
438,347,339 *2C678F644A3074549E6F5799CB3965364FE054A9 1 TUREMELERI
438,347,340 *2C69F3EA7500AC3782D20E75D5E07240EDFFFD77 1vahattaessa
438,347,341 *2C6E0F0864FDBA3D8ECFA745C8FC8A28B193212D 1VALMISOHJELMISTOILLA
438,347,342 *2C6E62FBB633785403959728E622139FB6FF12E3 1-VUCIC
438,347,343 *2C6813C44948123354DDE302EC94481C7DA34D4C 3).~}x{
438,347,344 *2C603D09F5EE020C103197F634B855179E88F0D2 20040415:DORISKNIGHTHALL,REGINA,SK,CANADA(DISC1)
438,347,345 *2C6B3223CCCF6DD84AFE41C3BEF9F0E73696312F 2018450 HELSINGINKIINTEIST
438,347,346 *2C6302070771A9DC2B182A8AE6458A55FA67F143 208101 ORAL YOLDAN KULLANILIR
438,347,347 *2C6850CCC6D90235168AB098F369CE650ADC9D64 496beschuldigt
438,347,348 *2C6F71D944EEBAC32DB7A01D8779D2524111B702 4.atun
438,347,349 *2C6F261CC16E97E73C6425AA05B4AE3CD663F965 4CITSIROR
438,347,350 *2C6E7F6682494DC302704E698260BFB6DD05C210 1-LIIKENNETILASTOT
438,347,351 *2C6EA9ABD096EE6047D9CCA4460BEA2AB6C1697A 4DOLEFULS
438,347,352 *2C6679F80E1294F400DF6488449A7B2FE66E5B19 2213615 SEN.VUOKSI.ELLET.OLE.HALUKAS.TUNTEMAAN.TAI.N
438,347,353 *2C6B3D9A571F5903BCEAA31998D0CD4E31072DBE 4hoitoohjeissa
438,347,354 *2C6EEA4A9E883401CC51AECEBA9A216EADBDD89D 1.MIETWEISEN
438,347,355 *2C6AA6BF563FE1AAC1872C2753BD69AE0F3A5A45 2320843 die.zeit.moechte.ich.nicht.missen..."
438,347,356 *2C68B3AD44857E1096EBC9AEF52949EFAAFE9F47 4ILUVMAIL9
438,347,357 *2C69241CFD818B45EE858B7ACFAE6460179B3689 4L3554NDR0G1U53PP3
438,347,358 *2C6B602015D27157BF95331B99989464755DA203 4LESLIESPIKE
438,347,359 *2C61E80132893089FB7DF893E8F8DE94D0970A44 4MACROPODIAS
438,347,360 *2C6691C709671D4AD08104066AF934669CCBD072 2607256 SIE NIMMT IHN IMMER WIEDER AUF MIT GOTTES HILFE .
438,347,361 *2C6F7DAC46A2282874A765F4C341B9AF44AED35C 4ONINWISSELBAARHEID
438,347,362 *2C673D6CDCFFEC67FE3FF3B8EE821AE28FE8D563 4 PRIVATHILFE
438,347,363 *2C6E168CEE684E861FE35C96035B7F9664A2D52F 4ROOSTERDIENST
438,347,364 *2C6EB1BB2F50C3D3861EDA314EC06262DCEEC8C7 4SSENENAN
438,347,365 *2C62B82EA4F0C0415D8CCE920A33E2D0E1826319 2710566 minulle-se-oli-v
438,347,366 *2C619159199D24839DA8CDD87EF9716EF6909416 1ozdesin
438,347,367 *2C6B78404366A440B736DF5581110B83A7516A55 1PAKETTIMATKALLE
438,347,368 *2C645855CD3A162A5CBCA435FA48CDC637BBCB7B 4U_AAA
438,347,369 *2C6DA6131E60C55CD5EA70E84B71AD350E73047C 2CAMBRINA
438,347,370 *2C6097C77A804A4C09FF25AE72DAB35939FD36A4 56-asutukselle
438,347,371 *2C68BDAC3FA0B207C1E210EC4B4733CC6B3B2EF0 2-einfahrtstore
438,347,372 *2C6E74D27E61CF632783E1E9A5B2ABD72E2A327C 1SZ970127
438,347,373 *2C6CD053F89419F5BFF95E5969E4329CEA36329C 2fheadlines04
438,347,374 *2C615EFCCDAEC4D4CCBA3AB1D89FA29FE50B8E85 >2H/<>A/< eciveD ecnOetirW 5.7>"42 3 5.7RDH"=EMAN A<>2H<
438,347,375 *2C6A4C1DCB196567C65C76D90F67AAEADD0AC768 1UMWELTCONSULTING
438,347,376 *2C68FF996E79F9A29334C25E67F62B4BCD4C2C3A 5BETALINGSBALANSES
438,347,377 *2C613B344229362AA2D65A7ACC4C12DD14D1CCE3 5BOWSKIRT
438,347,378 *2C64CAD1E22D2E46759281BEE382CAA7C153A8AA 5BRKBRNTT
438,347,379 *2C61310F1BD87455D4116A372E75730FE532A5C1 2.muchleaked
438,347,380 *2C6AB6FCB4ADAF7DFD17A51D0310669D87E79370 5CESPERALLE
438,347,381 *2C620D6B2F74F0632835BE22343D69ACDECAC6EE 5CRAIGPOPEYE
438,347,382 *2C6DDB968295D1EFB2A773642D67CCC20B5E00D7 5DEMAGOGIO
438,347,383 *2C69816BCF6B23DC949E4F1520D09B5F47671588 2-REINZUPACKEN
438,347,384 *2C628CE1F1E33EAE98FECBCC8CFCB7871B4B86E1 2snippety
438,347,385 *2C6540C64448EFAC8D59C81F99A8274774A559A1 20-01-1813
438,347,386 *2C688E6349C0C0D52F26E93102F89058622056A3 5ILUVPIANO11
438,347,387 *2C631EB4042D29E3B00DC152BF3572E15767C068 3121864
438,347,388 *2C6D6AD343C0EC95FAA1097256308694BD120AEA 5.lohkomalla
438,347,389 *2C6771D44D94CA3835687AF66C5103941FB0FE41 5.Miles.Till.Empty
438,347,390 *2C62F59EFA344E560328A357AF8D10E058CCB25D 21-NATIONALKADER
438,347,391 *2C6B88FBAEAA59BD10119803143FB426B82490E6 3.BAHNBUSHALTESTELLE
438,347,392 *2C6DEA4267D250C1F86EE58FFD34D72D1A254417 3B<--`-d----8
438,347,393 *2C66FCE6CCBA56D1C1DA999EBBDD27F998FDEA10 5ONESTIMPY
438,347,394 *2C6F7F152666F923A1C3E0306953F143E16AB553 3BLUEBIRDX
438,347,395 *2C6C652586F9CB3ECEDA2B74569263EF343991FD 5REAFRETTERINGS
438,347,396 *2C6350850EB9C0D982398898C5C7296959B9103B 5SHAROSN
438,347,397 *2C6FD88BA81C546BD42895E7AAD5E756BC1C61E1 23-bakircilik
438,347,398 *2C6EB206010C240E6E14ECC4D74EEB9E90175BC1 2466879 tilaamalla.koulutetun.oppaan.itsellesi.tai.ryhm
438,347,399 *2C617559581A24B7AAE7A6D7EF03E89152DEC314 3EHACKTER
438,347,400 *2C6ABAA1ECC9E736D0E591C16E5A30AE6B37A4EF 2532145 k
438,347,401 *2C6A3B79A958F4C37CFFB582D312CF68B5A0DE9B 5WARRENMEGAN
438,347,402 *2C6727EF997EBC59FA4F0D11740B3714C098B207 680662 TOINEN-KUUNTELU-VAKUUTTI-SIIN
438,347,403 *2C6D689CFF7422A4492D567085C2786F7C8AC413 681001 OLEN-SOPUA-SOVITTELEVA-J
438,347,404 *2C6D0ED325BEE5A4953A342B6EF4B02B7CAE60B6 [email protected]~`}O{
438,347,405 *2C682AC86354135B0553446CEE5AEAA72C29B649 3SSUTNET
438,347,406 *2C6B27B8F2847D20EAFA10AE5B027AE0FEB6C67F 6BSWHANDIBSW
438,347,407 *2C60A4BD06BBF28F32B8E14FCCC1765B99D63BC0 6CONTRYSSYOUN
438,347,408 *2C63A5B48FC79DA05B45A31A44DF5B791D22DA8A 6DSBYERNE
438,347,409 *2C682D1399FE12FC82A5A136C4E9DF7A5BA31FDF 2BACHANNIE
438,347,410 *2C611FB3DBDC03B7481A42FBB2BC8C4F61AF5BD2 44WSOM
438,347,411 *2C6A45EC5CDD45C9FEDECF287B6773D2B07B01DA 4$7R0N0MC4LLY
438,347,412 *2C6F42CBFE8C308B0052E8A88E1E25CAF1F986AE 2dieor
438,347,413 *2C6D6FCEFB78DE0F45001D381AC13A02E8357EFC 2FLERAEDA
438,347,414 *2C6558E3221731D6751F9A59EF52062CB0410F1E 4BRIANSTAR
438,347,415 *2C6E111B7ECC4997D65BF0EB9851B248F7184063 6LGEKUNSTS
438,347,416 *2C60B6AAB4143FADA76858D6BBCA0C2C56E5DF88 4.ESITTELYTILAISUUDET
438,347,417 *2C61D467C15B16C96E403CE60FAA4206CCBF9AA6 2IDRYMATOS
438,347,418 *2C65BC4C06D5E2E64AB1693837DAFF96DA8276D2 6MONTANAMONOPOLY
438,347,419 *2C62624F672AA87F43A8667F4E4FB0107743074B 2juhlateltta
438,347,420 *2C655324C4CDB02ABD75289AD4BB49FFEBA25649 2.kilpak
438,347,421 *2C676DC6B66A855E7220836334D2CB1CD1032FCD 6NEWYORKMEDICAL
438,347,422 *2C617345EF455DC537BE3DA40537AB819F7B05B3 2M3QS
438,347,423 *2C6F9BAC29C989BA87B78EEBF32990985C94A867 6PERSDNOB
438,347,424 *2C6B5877E169A1D25DD14A59590B81B462DB50AB 4MILITARISIERTEN
438,347,425 *2C6D877626859FAAA6CB81B0D65BA364101A060B 6 SCHULDENPROBLEM
438,347,426 *2C630E31830D641E0AB5CEAF5CAD2BB126033F18 4N71PHON
438,347,427 *2C6D3B6A9F7D650E83EAF2A1AB26ECE73FF30068 4POPISKU
438,347,428 *2C62C90E87147D475BBE669945134E03510D4177 4REHCANRAHNE
438,347,429 *2C6CC19A3622874583DE802F66A9F3FD5235B159 4SCRAPPIER
438,347,430 *2C6AE98078E439A1A25CAD7B1EEBF987DEB077DC 6WEGAFZETTINGS
438,347,431 *2C6F2D69BFD4C6FED4653D64BAD6208E59720638 720019 JACKSON WON 37 PERCENT OF THE VOTE OVERALL
438,347,432 *2C63DF368A4708ADBF5DB4D173D353D9D857FCAF 4VALISAIT
438,347,433 *2C69AC0AE2B3C44EDFCA298287D6DFD4F466B62D 4.vapurlarin
438,347,434 *2C633838BDBFC6A3A59CD10890D52863F24741A6 4YAOWABHA
438,347,435 *2C6B955104354383EB4BFC34FA23ACE2233302B7 779264 SEVDAMIZ YUREGIMIZDE GIZLI KALIR . .
438,347,436 *2C65868269958A444BFC26C9FCE1E7B4F4F28E99 781153 HE IS FORTUNATE THE SELECTORS HAVE SUCH PATIENCE .
438,347,437 *2C6F21D284A2D0E7DFE886741BCDD4539D785542 7aanbehoorden
438,347,438 *2C6329E6CA6FAF1343B9495E896FCCB72FCBDD65 51(jst)に放送されていた
438,347,439 *2C671DD09189BBF05C64E235CBE8693479389B51 7ARDEAHP
438,347,440 *2C61557E6D3CDE7C7611157CCEAB7F6D5FE18440 7BERTHAJOE
438,347,441 *2C61B63CCCA031D778424D376B51F8FDA3BE1DD1 7BINKBHKG
438,347,442 *2C6E62F944D5061AEA3C822582A510A27C32C6EC [email protected]~O-~o-}O{
438,347,443 *2C68C0BA56CD1B8919DAFB07B7BE7A37FDF06583 3P~0~O.)0(
438,347,444 *2C625396F61AE768C191CFEBE2D98F22A2890D7F 3SAKINLERINDE
438,347,445 *2C6E55937EA97ACE7466C03E6081BB6FB3168528 5CLASPIT
438,347,446 *2C65B282D242AF404E555502C74485D8A2C68042 5COMPASSIONATING
438,347,447 *2C660748D91F7361B282C0F5336B8B9A678DC507 5EKXYSEWS
438,347,448 *2C67D818B120D97353A12E398D1F3CCFE3AA6F01 5EUPHORIEWELLE
438,347,449 *2C65258477112C46666C26F9BDF65D2CA3536BF6 5EXTONEXTON
438,347,450 *2C6979BCDB8C44B75933B14E2175D531A2B8D10E 7hurlings
438,347,451 *2C688C62F6200C12540B3DB59BA6F772579C9626 3thepassw0rd
438,347,452 *2C6C4DAF796A2753C2BD65F35A0393DEDB6D3FC3 5HOLRONDER
438,347,453 *2C6ECDBCBF2EB872EE247D684774F59318C6F13D 4091822
438,347,454 *2C6F4F12377D83DA2D083ACE2480805272431846 5ODVARDBSW
438,347,455 *2C661D9282CB67377F0D60C4AB236C3C284FDBC0 5OPGIVNING
438,347,456 *2C6AE2A57AF41BA3665A1D35B2EEFB2B9E1657A3 463KAMARI
438,347,457 *2C6802337457447291DDA2D1FE9E31404D71D97A 7NAUGELER
438,347,458 *2C67DEEEC30133C3031B69AC229DE5CD7EA0B75D 5RAIDERFOXTROT
438,347,459 *2C620808940182BAD95E61C3DD11127D839561A2 5rism
438,347,460 *2C63D583851F2BF12E85FD71294407E0410ECB5F 4ILOVESAMIAM3
438,347,461 *2C680A8FA849AD0E7BD82C03FDA160883D610C31 7TAOCOWT
438,347,462 *2C60AC924D4CF3A640612C9814FE692B8DDD3D63 5UNICORNCARDINAL
438,347,463 *2C6DC7637CAD1A9FF1E22CF8A3BE36A59F56E332 5vastaanottotoiminta
438,347,464 *2C68B47F276F9A0D3B064F81ED675A341FD904F5 7thevernon3
438,347,465 *2C6CECBD0794756B648671B092496A0B9313D319 4PPRONT3R4
438,347,466 *2C6D1C0C482E2381EBB685A891F7E8BF85F4920D 7V0%~
438,347,467 *2C610D0707AC7BC44FF647CB1AC43FE7BC636B9A 7VRSLVNG
438,347,468 *2C692377C1BB54291535484D0F8F32485D02D13D 646371 GENELLIKLEYANICIVEBATICIBIRAGRISEKLINDEDIR
438,347,469 *2C67ED547FA6951F2D7540EDFDD9C51FF9E32E70 876E9665-2D6B-3DDC-8A9B-50ED219FE63E
438,347,470 *2C614A997D86DF8012C7B296C7D940FEAB9A8BA4 6CAITLING
438,347,471 *2C6EBDC8E201C7E867CD434FA64A567B642B2546 8:8-#-&porosity
438,347,472 *2C68500AD14112205BF4F2B6AAFECF75BCFA56F1 890jerimiah
438,347,473 *2C6926523938A189D279B8B5B4DAB85772159F6D 5BEAGLEHELEN
438,347,474 *2C6781631113F15D02338391ADE1DAA70126CC83 5BREKNINGER
438,347,475 *2C6779C481F1B00D4387BFF5DC989723677512E0 8BENJAMINALPHA
438,347,476 *2C6C9779E696E0D172128494D4BD0BD63208E4E0 8BSWGESCHAEFTSLEB
438,347,477 *2C67EE5D997B30B6D99D76450B19F065D8DB702D 8BSWRECIEVERBSW
438,347,478 *2C6237061702A86C8138AC6E35E82697BE8B5E05 5INDIGOHOUSTON
438,347,479 *2C6B0AC4F175A26F0CF5D54C10B3C1A10A8975B5 5MACARTY
438,347,480 *2C63AE92992892261AE906B7300951C9362B5C79 6JANICENAUTICA
438,347,481 *2C681DC4ED76CCC6C9E5159A404E635F45E7F839 6JIMBOBRAZIL
438,347,482 *2C6CADB153CF3ECEC896572B07BC0DE8C6665520 6MELLSES
438,347,483 *2C6C57FC20585C8F8F4640B485864C3F69EADF2E 6MENVLOEI
438,347,484 *2C6B7067558751CA326DCFB7B5BDA2E87AEFD9CE 8INNDVUBSW
438,347,485 *2C6F5376743CF831394E6A55535F9CF3C91FCB7D 5TLISANAS
438,347,486 *2C622D548E462D62045AD46FFCC7BDD2082C4134 8JESSIELIVERPOO
438,347,487 *2C6D3809EBE08EEF251C15B4B771A0DF75EED2A6 5UPP053DLYFR33
438,347,488 *2C6FB71EF30BB53FAFED664CB6FEC794B140ADC0 6OYLISHLY
438,347,489 *2C68150912191335D9223D8835C1C982FA8F84CC 6.08.1412
438,347,490 *2C6AEC1D4376EF9ECC2A750EF36A41CD994731F7 6BSWJISOMCBSW
438,347,491 *2C6E6DEE9DE4E23F9DA1EFE35858E6BA75EF4590 6BSWREDGESBSW
438,347,492 *2C6A54503400BA38C7657941B128A93F61E4E47E 6SUNNYSHIT
438,347,493 *2C654699BA22DEF767D1E194F40F8367F5F6730F 6DOLPHINSARAH
438,347,494 *2C67EE787F4C6736AE7E68A0764E6511F3C1DB56 6GEORGIASHADOW
438,347,495 *2C6A9F9B74E97BD61984AB033FFE871314DFB8B1 8######)~O~O(><)
438,347,496 *2C62B015CF07F570552776A365E1236139BC88EF 6LEGITIMASIEBEWYS
438,347,497 *2C66DDD1DCDCFDA55788C92597E04DC6D34847AA 8SMASHINGMAVERIC
438,347,498 *2C61D55197B34929017242736A0F90E003C72387 7BOARFISH
438,347,499 *2C6C860F68930FD1B66EF71D6A9B6B5818CC0B5A 8ZIGZAGGAZGIZ
438,347,500 *2C6E52CFC9B8DFE7B3F892F884C00D3387F4A45B 7COKEGARY
438,347,501 *2C6FEB6A7C48D76A15F22FB9A6CACC9B61D1C830 908801 ATATURK CD . GUNES SK . NO : 9 GUZELYALI PENDIK / IST .
438,347,502 *2C62218D047F76A50C6D1CE7DBE2DDFDE6507DD8 7DEVOURYNG
438,347,503 *2C67DAABC08828441CB3719F82A2DD16F3682993 93246 ES GIBT HOFFNUNG AUCH IN DIESEN EHER DUESTEREN ZEITEN
438,347,504 *2C67C01222F2B639CD936725FABDD315E9D92EAB 9506E5D71738F932A05753C1A963948260
438,347,505 *2C6AEB30C64B09AAA1D6F43EB8133DFF1D38C545 963117 NUORI.LAATII.HARJOITTELUSTAAN.ETUK
438,347,506 *2C62EE2E8D83501D36CCA57F73477F8F323CD21E 6SNOIREICIF
438,347,507 *2C6892D658E991ED94381B71641AF01F908AAF4E 6SPOOKYZXCVBNM
438,347,508 *2C65641A391576CBE0952AB3BC56A02CD26FC115 6.UEBERTUENCHTE
438,347,509 *2C64D83C2B4620D6EC4C30FABEB81AC543F27DFC 6UKAZATI
438,347,510 *2C69F42FC3287A66618E0FCEF436C28C86436785 6WERTUNG
438,347,511 *2C667BD6BC298F11BF71F9C8EFC7CC74CBDBE522 999747 HUCRELER.COK.KUCUKTUR..
438,347,512 *2C6BD0618B2281388A6DEFC67423BBA680E9289E 70005 he-also-imposed-a-dust-to-dawn-curfew-.
438,347,513 *2C68718FB06E74CACEB4A2E00EFF5D164F1BEE77 9ATMOLOGISTS
438,347,514 *2C6F318C320881646EAA82818E9C9EAAB1B86AD2 9BRPSDNSRSSN
438,347,515 *2C6E1D62AFEEDD2994604BEF4F48C8D5838DF8DC 9CUMFADH
438,347,516 *2C6421915E1F08D7E2A110F401F8B1410191F4AA 7ASCIUGASSIMO
438,347,517 *2C69163ECB907E6E571809EEEA86BD878E9F22FE 7ASTERIXJ
438,347,518 *2C6DCA1B7175799F96F4C18EECEFE4663669FF4B 7CELTICSDALLAS
438,347,519 *2C60B37E4C2E9419ED2070FC06686C15AE8A4B34 7PERIPATIDAE
438,347,520 *2C6EB85161B48EB6BF2754BD4AD134930B71DE01 7GUESTWILLOW
438,347,521 *2C6E74E60F01F35EF24EBE11D848FDA10E26AB0A 9.osastonaan
438,347,522 *2C6CE2A0B92133D6694A8D1FBF248A8CC81F41DF 7.mile.road
438,347,523 *2C6AB7B116184F6F86C0DB718A59394C56837411 7REGNIHCG
438,347,524 *2C6429E9B3A6393DA4D375BFAEC4C4E46BA6E766 7ROOSTERCEDIC
438,347,525 *2C62BBDCCE921C3A5FAEA61DA732D6587692DE15 9VERMOLMEN
438,347,526 *2C606D10DB211C84F8DD2C504F60274576C950F6 7ZUNEIGEND
438,347,527 *2C618720EB46619A9CAD4BC1E3EA2CC80294630A a1_9&
438,347,528 *2C6B3718A02C9D3B2724037FA31C5FD1A10DE97A a1r,3
438,347,529 *2C685FE286C6E5F4584D25A7F8E87C7A125586A1 a5i(7
438,347,530 *2C6CE12D6128FF162EA30C9E5183328BE7C1A61E 8======p.*.*.*(><)
438,347,531 *2C646A9A8E332500CCE11A20CAB87F949EF7E438 8SANDRALE
438,347,532 *2C65D0E1C2C93B7521FEFF48F8CADB3646B7B248 8.L
438,347,533 *2C6676D8595DE2EFFB1A3EF58FEDE41FCB82BD4C 8THEWRANGLER0
438,347,534 *2C6534790BF83C51C91000C37869BFCC9235FDDF 960misael
438,347,535 *2C661A5BF27E415ED8ADB589A1415280DE787179 8===)`~ SPLAT
438,347,536 *2C649706A5A18E39EA17208668A71196CE600DD6 9BEMALENENS
438,347,537 *2C6AD196D552A5193EFEE293619685ACD6C4AFF3 9BIJDRAAIEN
438,347,538 *2C6EA5532F2DFBCF243E5A590B2BA1CA3BEE10A4 abyn[
438,347,539 *2C6F6B8BF62DB600BAA88F2A7FD8AD3BB3D4FE99 9CTOBHCRA
438,347,540 *2C6CE4832CF52D728C79B5DE5FC1C7CCBB0F32D6 980978 kuntien-pit
438,347,541 *2C616F03E514555CD163F92FD182B7A9FBF2C5FC ACbr
438,347,542 *2C67F78575B815AC336145C1F5A30F7609ACC734 9IAMPAVEL
438,347,543 *2C65F4BF2007AC8AADB1544DBA81A2A873621768 9MARNETTE
438,347,544 *2C620F190450F1E47CEB144FD0AF70AC8A714442 9MINISTERRAAD
438,347,545 *2C62C86EBBFAD5151EAB4E20667DF2F1726F23DB 9NACSUMREPUS
438,347,546 *2C64AF30A8894FD84B19D6DC9C18D1C7351D9901 9contractualisant
438,347,547 *2C6433A7968F806DC7D543359B435062CBCE9292 ACMY
438,347,548 *2C64EE607FAD8FC315806971F046274D8A24EF54 ADAN.RIGGERS
438,347,549 *2C6B3BC685851869C7EC3DA73F0A97033ACFF068 9ILUVPRIMUS8
438,347,550 *2C6A1545F66030F4BE183F90BBE088881CC0B5E2 9LARTSABA
438,347,551 *2C6694568786F6C4E4C053CD9EC80DAC8C362837 9LIVERPOONICOLE
438,347,552 *2C64EF9AB81A8C380EA5E8074331451DE7941C0E 9oliebollen
438,347,553 *2C61C0F7FE8FCA8C1FF6F7F39120B6B2A3A54D12 9NDGAMZTDFAWWUPZ
438,347,554 *2C683700B74089B4374C1E41F05E1D87FA2C8DB1 AE$MJ
438,347,555 *2C63A1E6C52AEC3CA2603C77CCDA4BEBCDCF4557 A0S-W
438,347,556 *2C66331600982A3D5E6F474EDA8E0D92460262A2 9VNFADGING
438,347,557 *2C6926715CD96771AD817C94E83FB90B3B955353 a4yr_
438,347,558 *2C6C041D3754426860D16E8FCCEC5142A39239B6 a&3;?
438,347,559 *2C6AFFAB82385D58C5DCA9B881C12655D12A5331 A3CPW
438,347,560 *2C6988C88773DAAA801031FDD28A7025165270DE a6
438,347,561 *2C69C468723D717EDF0C6DCAEC4B777BDBA290D4 aaa(b
438,347,562 *2C68766F05251C339CACAA39D5ACA70FDF44A022 AKSHAYPORWAL
438,347,563 *2C63D903263614BE1AB79C9D873D51A3BCF1D130 AAXWT
438,347,564 *2C6A84F44BE4FB1C526D7E974E014F210AC9158D aae\qq
438,347,565 *2C6E9E99DC4A01ED73F5F6CB9D303FFD5C9B0816 ABI|3
438,347,566 *2C60B03CF3DA5EDBD2EAD87DEC9CA10A9CC748A8 aatmaajaus
438,347,567 *2C6D1A0DBB203A3AE47C0EC70D2201A3CB9A023B ABB"`
438,347,568 *2C67344714608268ADF2EEC913F32A2F193F0782 abd/o
438,347,569 *2C6319612430C51EA9A8F8253E79C83BE0FCE0C9 ABTRUENN1
438,347,570 *2C6ECE8488CF1D522E929B49267DBD9CD28AAD6E ACCOUNT.DMCHEATW
438,347,571 *2C62D3D8D7DD9D1CE007B79D5445D4EA3947EC82 alfonzosofranko
438,347,572 *2C665CDD732A9CF70FBFE4045B939FAA3F86CF3A AC#MG
438,347,573 *2C6BA8A594BE2517E3A8A94F7C81DCAAAA00E820 ADALBERTOHANAFAN
438,347,574 *2C6D075C7BA6FA97183E8F507FE930B35AB08D6B ADAMOWSKI9
438,347,575 *2C666BBB97B97865E4A23A32058DD811C6F053C4 adriandipalma
438,347,576 *2C66EFB1D9256559BDD5B6D00A858D9F9808A733 acs*;
438,347,577 *2C60AFD76524CBCD062BDD30DF4B31EF7D17CF0F ALZAX
438,347,578 *2C67F95648D820C09BD51BB4B0DE59DC808CC6A0 AMILA PRASAD WIJERATHNA
438,347,579 *2C63B521F890B75044849F7D080D3EAA977C81C6 ADRIANA-NICOLA
438,347,580 *2C6666AD6176F8BE010D5B599A80A9046B24935E ADRIANPUTRAPRATAMA
438,347,581 *2C6D02F79C4DB96F81E4B5F904012CF017DEE144 AMOISELLES 1 0
438,347,582 *2C6BB491701D7584292F77538AAAE696F3843CE1 AMPSILUS2
438,347,583 *2C69558503A2F90BBF95B6E52DAC0F0EF2F285FF amsg8
438,347,584 *2C68298A77473246D0110355B0AF398BF30A3F3A aga-riana
438,347,585 *2C6964DC5AE869199F4A06DE08475470CAB6F337 AINASWEETIE
438,347,586 *2C61E40F13F90A170057CB8FE9E1C71CE1BB1C17 a-gw,
438,347,587 *2C6420CA4E021D63A9299DB113C7D48F93BA9D1B AKTIESELSKABSOPLYSNINGER0
438,347,588 *2C62FA19D43385334045C19CA02333E00996C14C alcoholiseerden4
438,347,589 *2C6634A7CC10A071F3895F73677CEC4717D46CCB ANSGARIEFÖRBUNDS
438,347,590 *2C60E401AF662B0ECFC591AF61A1C410515C8707 ANSIOLENTÄJÄ
438,347,591 *2C6ECE390CD2B62205C7FB91C9FBD99F213CCC01 antdg
438,347,592 *2C6743BF7DB62785F4B0E2AB48FC08A7C00C1B8D ALEXPELAN
438,347,593 *2C6F2CF7694CC87E29D6E9617C9A8DEE9423EBBE ALFREDO.GRUBEN
438,347,594 *2C636D96F515FE12435437A9E290A11D3B273953 ANTONIOREDDER
438,347,595 *2C681EEA63EEF586B9242C192A6E52CB1924E8CF ANTONY.BROWNSON
438,347,596 *2C6D045FADAD085479093A1CF4C13E30B7820E13 aligncentergeneralm
438,347,597 *2C620D3ACBBA67A6653E8F7898B32F6DACDDDFFC AL./K
438,347,598 *2C69E4F4AF3A29C8F8A38A8C52EA572FCB022633 allendawahoya
438,347,599 *2C61EDBB52456BD4DD881D7F65B8A1072C2BD6DE ao55b
438,347,600 *2C697E8F4490BF08ABD0D464A840B60D72B1AC6D ALBERTOCROSWELL
438,347,601 *2C64835A9295D99DFDEC47A85C1A15695791F3AA ALBERT.SEARSON
438,347,602 *2C6120FB5B270E7C4237B8AB72E942AD8E70E21A ALVARO.FLEEKS
438,347,603 *2C626B42AA977934B01223BAD6340B80BACDDBD6 ALVINIA
438,347,604 *2C654377CCE6E757481F629AB785D50FEBB2FB29 ALESSANDRO GONZALEZ
438,347,605 *2C657FA246DB7340EB1FC8D7AB46844C20474CE9 ALETHEARUPERSFLEENOR
438,347,606 *2C6CEFEF84A371D7C9C7A95096349CBD3E38FFD6 ALEXANDER HUI
438,347,607 *2C6F914B57AE6B44B40796A06322C9811AC912EF AMANDA-MORGADO
438,347,608 *2C69C8DBD8CA3FD05B3C2AF64B84DB7961DA9492 a.p,p
438,347,609 *2C6EF9671FE2770B4C396CFDBA3EE7CBB0A1BF4B ALIRAMMI
438,347,610 *2C6413208DE2082E7EE9CD44D8A737731B6DA502 a:"n-
438,347,611 *2C67E836724B24C45761080D4DEC5322B5FE8C52 ARASAWA8
438,347,612 *2C6A741EFE54EE9FF7275EFA8AB99BD61FE0402A A!RFB
438,347,613 *2C6701369FED217A667B4044C6EFD3EA5240D420 ARIEL.JOELSON
438,347,614 *2C6C2E00F7FC0088B455F80F8A08646AEB19E2BA ANDERSONUFFELMAN
438,347,615 *2C6D1FB239058467C1C83537FF2E0063F9D21EBA al?uh
438,347,616 *2C67A96F9254E422EC2733B123A8975639056644 andres-rey
438,347,617 *2C61D889807051FA520DEA5191DE34879F63BBDE andycollini
438,347,618 *2C6CD1F7B884A410172B5296701B660A04A26938 AMAVENI
438,347,619 *2C6D0FF50BDFFF391F8CE770F13F0128C6FB9DF5 [email protected]
438,347,620 *2C61E237D1EF93DD493FD2AB47A844651B41DDB9 A-Sara
438,347,621 *2C6917F569554970CE1DABE46F08471C6C579F7D as)dm
438,347,622 *2C6328C0BAD5D97AA56E22D06667BF6ACF4FB996 antoniajamgochian
438,347,623 *2C6DB281AB16D63DFA4128700268C55EF00CF96A antwandenbow
438,347,624 *2C632B12A4F8ECDB3ACC4C4F05695F0BCC090C88 aoe#
438,347,625 *2C6E563132139F293D9D0E2C27B0D109D8F5FF0A april.in.paris.(take.6)
438,347,626 *2C6DD3AFC6204F396618E7578B680953C74DB6E0 ar-muhammadogg
438,347,627 *2C6D14769FA3F0B1F95E7DC95373D8D697C9F621 ARTICLE417E
438,347,628 *2C66231E9633F74CE9AD61FE1A771299C9601665 ANIBAL.BOYS
438,347,629 *2C61C7F8D70B9A22B405DA131FE22833CFEAEDD9 ANIMOD
438,347,630 *2C62FA0A1E38161FAB5E590541D32D2CDD08BABB ASTORIA.MSLIVELABS.C
438,347,631 *2C6673488AE20CD2168ADAC438E574BE29B2B5F0 asxgw
438,347,632 *2C655ED711DB25E96A22E031CBCCC1ADFDF1019A ATREHAN4
438,347,633 *2C6587AEB39BC2E8619DEFAEC5D0FED07F87C324 antwancollen
438,347,634 *2C6D5E3688D8893E1405F22923EDD7094618745D AUN,S
438,347,635 *2C6D56845F0FCD86CC84C9ECA1B3587083AECE9E AUSTIN BARBOUR
438,347,636 *2C6F9A8660033D055A444A83A0589E1A37EBCB69 ANZXL
438,347,637 *2C67405C893A3BBE7B9D4708398613B56FD3E848 A:ODO
438,347,638 *2C6CB0E36A444C09A05B99C30B4CD030B70F7B19 [email protected]
438,347,639 *2C6277CADE20339A781657B586F92128CD123614 AWAY81
438,347,640 *2C671A8B97E1AB5927D6D6BBFE14EFE5A3B9E0A7 avh5o
438,347,641 *2C6845D50F5FA13D74834FB5CEEDB43B1418FCBD AZNADROCED
438,347,642 *2C62C52A210A17A455EC35A0DAACFC9D59D03B20 b00g1e
438,347,643 *2C696DC990FE3CC79ED74C1DD6E9988E2556B8C6 >-b0-`-d----b
438,347,644 *2C6B5A5210B53A9D84B67FC89B7DE8F220F1DEAA B142434
438,347,645 *2C649A9D4D8EF744D09FF4C6BEA4DC09FA31860B b3o8
438,347,646 *2C61CE93F414AAA7D86519EE157332E0768ECD76 ARNOLD.KRASNICI
438,347,647 *2C6063D6F120E0E354EDA310B31B263E9FC4362F ARNOLD.PELOQUIN
438,347,648 *2C69A0E7594B0E9226668BFD89313B218162612C A_Ro
438,347,649 *2C61C5E6C7E0FD1B079004BD117B2408AA7B4E2F b&939
438,347,650 *2C6A1CF835345271E3F9852FAC3DFE8A755E4FD2 ba4lf
438,347,651 *2C6D03DCF3146E1CF4C2F4D459412ADCB13CED0A b2caca82cee93f93aa59ca163e333810
438,347,652 *2C60E247C091882BC8CC5B9F5CC773C5B3BD1369 b2khl
438,347,653 *2C694A495CF637D60ABD0B42A61BC0EE8ECFF85A balw
438,347,654 *2C6475C5B484B0690281BD5AAFEFE6D5369648AA BARNEYING
438,347,655 *2C68AD06E3E1751855999E1996C6EE283CEB3566 barretthaig
438,347,656 *2C673D9CB638A8C67FCE122BD76CFC4229F0E52D b6nw(
438,347,657 *2C68CC08DFB80C3EADB9B617F744BF821846ADC7 b:7ky
438,347,658 *2C6A2E87B42470C66CDEB88F7A1200DB8373B965 B!AAM
438,347,659 *2C66CD08CC89656F913945D7DDA39D360E3B2B2F b#aas
438,347,660 *2C6B8D7AD63C9BBF1248E585E326BAD59D339224 b###d**(-_0)
438,347,661 *2C67B9105D1A905358AB3748B1BF400157478D4E ATEFTELLER
438,347,662 *2C6C294333F4ABCFD946A94C6C81FFC92F0EE07B b defined constructs
438,347,663 *2C6D3AC5B688D9C9EE48B2EBB51256ABCE41139A be7du
438,347,664 *2C6751879F5A2F9F093BB377FAE4CCA76808C0A5 AU:ED
438,347,665 *2C61F15CAE4735CB9ABB0C550F4EB2037ABE3C05 being.done
438,347,666 *2C65D9E7C4372900A53E1515A02328F661DFA46D aum+z
438,347,667 *2C6C7CB8DBCF37F8819DFB6464FF464691FB4C38 benjaminzearfoss
438,347,668 *2C6038C359BFF6CCFF266BDF803B82F77CADA7C0 AUSTIN.BRUMFIELD
438,347,669 *2C6D3EF1B819497C086B11DDF779DB99BB9C2449 austronésiens
438,347,670 *2C683FCCC6F105526184F05AF2CC81037E2D579B BERRECIEGO
438,347,671 *2C692FC98D162DCC8B5501E36E9AB11A5D10C8BA BERRYHOTTEN
438,347,672 *2C6C72B9BF9A0DD40B93E773FA70E391C9E96BD0 AWTCIII
438,347,673 *2C6379C7868F813E73C8ADDE53D0CDC21E9FAD0C BETOKENS
438,347,674 *2C610254B24FE1A608B8ADA4D553FA87AE411214 BEAT.LAMENTO
438,347,675 *2C60978D8B475FAEDF5C923139F4EB3E799EEC87 BGJEG
438,347,676 *2C62B8ADFEEE8BA0D9BD42226D44963DC4EC1504 BERNITT7
438,347,677 *2C66C10844D1D2E058F1E8E160F463DBC4B5868E BERTRAM.STEFANI
438,347,678 *2C61C6C421C08BAA7ECEE2E4169C0C3575172834 BETOKENS
438,347,679 *2C6610714D03203EC4B270A47AC7F8B6C9CDDE6D bfreising
438,347,680 *2C6FD3FA620F12B1BD7DD4E190B29B31CBF9F8F5 bhxj!
438,347,681 *2C6AA99EFFE4AC66046142C76602A811F7A11C67 BM-CQ
438,347,682 *2C62CEE2151CC5473973E30A68C73A9F87535E12 bn!qq
438,347,683 *2C69D3CF9CCC849C75794E507C26CDDF68666F0F BOBBERGARA
438,347,684 *2C687A4D9B433BD40A5487A1FAA3427A80611589 BAISCCALY
438,347,685 *2C68631986A2FAF10BAF8A25B5B835876120B8DA balw
438,347,686 *2C65CC26529C4BC284508CDF289CB2D2934E7CE2 BJ9KI
438,347,687 *2C643FC4C0D86A4DF5405BA95868E5A0E26A9B58 BBKEL
438,347,688 *2C616E3D76CC64AC56C7AA4BA3CC28B57B67E715 bbwbx
438,347,689 *2C6D9FB3DAD379AB23CEACA34C0E2BBDE9C659E4 BPHRB
438,347,690 *2C60D7C51A107B2543582551C5654EFFDB3E218E BE;BM
438,347,691 *2C628E956E307EE5934CE6D3F82BB53B59D129E2 BRANTKOLANDER
438,347,692 *2C6FF25158AF4FCB3E731E47D3B1D385765F950A BLYANT$H0
438,347,693 *2C693A6D779F9F9FAC22C179C7201313ADF51B56 brendanbulliner
438,347,694 *2C6D107438A5BA1EFA02AF6A8988E8D183F9A63B BENGUELASTR
438,347,695 *2C66960D064030596ECC595AC685A2DAFD3597EB BMUM?
438,347,696 *2C6DF3D99C0C7D3730CDD2CD7298E2704D1080F6 BRING THE CROWD
438,347,697 *2C640364B38B169F900E21E676D512805057F59E [email protected]
438,347,698 *2C645B427D190231C344FD67498BB4D23E364275 bo5rt
438,347,699 *2C6E6D25A1F02A79F3975DBAF8001C7A1A07C571 B"EZ3
438,347,700 *2C6D326610A12FC27155DBF0DE8F3A9C8618BBB4 bv-
438,347,701 *2C660E7829A36A2AD96BE2396BA65990D12E7969 BRADLY.CAMPESE
438,347,702 *2C62997A21B854BABC1CD9DEE68A03D6B2793EBB Bvhw
438,347,703 *2C6AD5A852E0239027BF57ED0E6902E311DCC657 bw:23
438,347,704 *2C638CFE3A1FC668130F367BBE49F184D559ABFC break-free-(feat-estelle)
438,347,705 *2C62D93A0CDEB20C5D2C1C269F9B4E861E245783 by=:3
438,347,706 *2C667BC12CACD0AD45F46758BEFC5CA10E6991AF BYALLMEANS,CAPTAIN
438,347,707 *2C6EE26797E268DD9BD04FD228FE894F16EFFB14 BJUNTARACHART
438,347,708 *2C65C677DB9921F4A16CD5D0809236E6B056EF5A BJWVA
438,347,709 *2C6791357F83E9F940D20A474F23EB3685D36EAC bkequ
438,347,710 *2C65FF0CF9B5133E16A763CF2997D0414BA4AE0F C3(:J
438,347,711 *2C66E044114CA96D6DFB9512703E9DAA34F5EEAC BLENNON6
438,347,712 *2C69304F13A96CBE2E62625D62F46F2274E40C44 BLFM2
438,347,713 *2C641658D1AF80F8A2546D7CDEAF256B2CDC7AD3 C7BB2
438,347,714 *2C67898EDE7F3780A1C795668FF2A2773412EA6F B&%M
438,347,715 *2C6E15EA05F6D897A4909EFA11E40687338334FB bnj2
438,347,716 *2C68146BA34E3359922FD1E1D2F6201930997FF6 calcolavi
438,347,717 *2C60BFDF3463AFFC1CFDE543916705618FA660E7 CALDK
438,347,718 *2C669294252BD04CA01D0694DEB94CFDD31E3EBF Call.Me.(DM's.Jungle.mix)
438,347,719 *2C6FD0F7D72A1524E768537B1DFE8AAB9EAAC9CF calvin-neufeld
438,347,720 *2C6F2BB1D8587A8C269F40DD4563E9F5AE0B9B70 BO6PB
438,347,721 *2C654AD45DFAD4D526A0D14095139CFB405D579E bt0"
438,347,722 *2C6DE1DC5D23713CE37A61FAAD39E7619D5F596C [email protected]#$%^&*
438,347,723 *2C64B206DCD67D4BFEF3F0B7C77302CF95C5CFB3 buckboards.
438,347,724 *2C6967A5413BAD4C66554D85FECD999E5566704E CARIÓS
438,347,725 *2C6D93A21188E1CA4F59C47921734369E5EB0B9D BPDBT
438,347,726 *2C67BA31051DD119A56DAFD7D7F8F945BFC40ADF BV_:
438,347,727 *2C6785F8B4B66EE03B29829602C3FBF028458BF6 CARRICA3
438,347,728 *2C6E26CA69166E3C4C954EF9FAA70EA2FFBC5085 Bvhw
438,347,729 *2C63EBCD9DE6999AE0AC66ED2D42BF0781D95E4B B=W8A
438,347,730 *2C6CA7FC76EAF0FB87DBA2BDA29D141BE8964A71 BWXNC
438,347,731 *2C6430C2C1DF7CE7FC7C8E83C902C2FF9238FAE4 C0VGI
438,347,732 *2C62CD0A7304F39C44715D34CE6693BEC702DF68 CC0/
438,347,733 *2C61A45983538A9E280FD5A9BC19738679B95168 C5L\
438,347,734 *2C682D7AFB8DC370CD6D84F628FF850D3AC5B116