List database


# MySQL hash MySQL password
438,330,001 *2C600FA97416FCD92B4C9D9D0709BC060BA120D2 RUKHSANA.GUL
438,330,002 *2C6FB29D99211AFCD2583D6D9675E530CF4B62F2 TNOREXIFFUS1
438,330,003 *2C6BA84C27329FD8438CE9C75E9334590FAC599B ZEUSLUCKIED
438,330,004 *2C6EF9A74EE49D979DE2576B251DF739660D82A2 ZFORMERLYING
438,330,005 *2C679F3EEBBEA1E3526A6D3EF01214F0FB4DA1FB zhandra.francisco
438,330,006 *2C6FE3AA73FA37D6EDFA7A5CD37FB77BB6C7D7E0 todbergo
438,330,007 *2C6E89089B3327222D31EF8FA443A398B9546CA9 TOEWATERED
438,330,008 *2C6B7155A17137EE36BA0E8E6341821C1214EA3A ruvalvcava
438,330,009 *2C63D9688C1BF9F917CB52380F9DDD329E34BBA4 TONKREMEGY0
438,330,010 *2C601050C60E875C1FCC05210AD230AB9616B4F8 RYANWASILEWSKI
438,330,011 *2C68D77DDCE6990E075453DE7D924CD9B73996FE TOPFITENING
438,330,012 *2C674094DBA34FFC9CBC8AF78FFA7C94CE54ACE5 S32631844
438,330,013 *2C6E7FB744216DA2FDDD38920021C1CE96E91887 ZIVISH
438,330,014 *2C6B872341D735E6375B92C339421222308FA198 ZONDAGEN(ZALIKJE...)
438,330,015 *2C683E0D3066124329C3EF0C80E66E203C1C7E2E tr4n$c3nd3nt4li$t$
438,330,016 *2C6A2B2A97EB7CA8C50C76E006C8C5C924FB383E balw
438,330,017 *2C678CF6FA5F4BC4F025FF8E1430A0DF9EA96B97 BARB-LAURIE
438,330,018 *2C63B3238B2181F2D2ADD95DE742A25A63AE918D [email protected]
438,330,019 *2C6C5603F9D1BDE42863188B68A9A3DFF341175E TRANMERE-HISTORY
438,330,020 *2C60713D58811871C3A7C0573480E18D593AB679 TRANSFERREDT
438,330,021 *2C6C77168FB7BB7B1AEF98A2331793BB10ADED9D TRAVIS-LOBLAND
438,330,022 *2C6AC18AEF1A4347A5BEED69C70C68622D9882E0 basait0
438,330,023 *2C6ED3BB019CA7D110E70C0334FF3552FD102DCC SANA-TAYYAB
438,330,024 *2C6CF205E207D334152BD1079BA752EFD138AF98 SANDI TJHIN
438,330,025 *2C69C240AB44E675D23D016D483359D2F79C042D SANDRA LOURO
438,330,026 *2C6FC0277371DEF3E366BDEF6AD15E063D40DD47 TREVOR.FALSETTA
438,330,027 *2C699C0DED862B446B0A778CEC880111A4E01A22 b======b.~0.>-<
438,330,028 *2C66B9DD295EB2161397AC870FE86CC014711E80 ЗАПЛАШВАНО
438,330,029 *2C6ACE3AA028F1A3AD9AF7605343748F6609887C SANTIAGOCATRONE
438,330,030 *2C6BD1E23496ABFCD0B011498DA421720AF3D9B4 bbiabia1
438,330,031 *2C6BAEAEE950127206B46237CB37B5EC04C193C8 ЛЕВСТИК
438,330,032 *2C6BAD2E9A330B9E1A8DF79F6645079C77835904 tsreblah
438,330,033 *2C6C9378CDF4632665FCCBDDF86DE03425C4D84A [email protected]
438,330,034 *2C6DD3053D3CA2A07B42A37AF21A146A7EDA984F bensinville
438,330,035 *2C691C42110AED20143E184CBDFB1CF37C2588BE SEA_LAUREL-S/I/_'L/O/R/@/L
438,330,036 *2C67B985DE984BEC7B0A5F9F641384ACCA9D8613 twyfelmoedigheid
438,330,037 *2C654A99207C326230E86A7742DDB6566A695C61 BERRY.MARCHESI
438,330,038 *2C60071DFF92B4C925CD8D966CD6869AEF324806 tyawdee8
438,330,039 *2C609DAAC77C01ADC48F5E700E6091BD26C9478A ЦАРСТВЕНИТЕ
438,330,040 *2C6CDE01438A9B4BCFD093FD85A2C5449D7D800A SEDLABEDNE
438,330,041 *2C6F035C928E43873863C82A99D472CDA40CBDCD ЧЕРКУВАЩА
438,330,042 *2C65949040D1764453E61D0E12E93AEFBD6122AA SEILAN7MERD
438,330,043 *2C60B905B52D6A0351F66C0A057E5C1B7A4AEA5A tyreciing
438,330,044 *2C6137F89C944FDA6F3BDC39B31866154F193578 sertissure?
438,330,045 *2C66700DF2C3CD601EF2B3C51B578A05ED45E52C BH)V_
438,330,046 *2C65986C4C26891A01B02A4A9DC26A7C769F1DD4 biobio,.sue
438,330,047 *2C631AB32FF0BA1914B7056E67D58992686558DA SHREK/2
438,330,048 *2C65036806472D98B41A34B28C0AC38851E56406 B+KI$
438,330,049 *2C6A738A1FF617D48A4A19896C21F2211320D4AE BL"=
438,330,050 *2C675010CF9A5010A5C04174FA5F86E6D0EDEC81 S+IMEREMM0
438,330,051 *2C69798BD6B8E5C817F8545BD4DFFDB79122F71B [email protected]
438,330,052 *2C699F45F53E35CF71C62EDFF64C03A72E10A317 b)lmr
438,330,053 *2C6C4ED1DA3DD4AE5D816B083E98B066C7C8D573 SINDGITMCKARNATAKA
438,330,054 *2C65262982B0544378DA41E7037C02B7500EDE9E b-lok
438,330,055 *2C6E7AAC3F02F8E4A2AE0191D7E04C685A4EA821 BM.D%
438,330,056 *2C67F7CC7CA5392E508D0C91A32AB07A78F598BE BN#0T
438,330,057 *2C6B7A46A780E7F53633D3DD932E3E415C972BAD UNW0NT3D
438,330,058 *2C616621EE567051A967320F721A839E84F8DE0E boomezel!
438,330,059 *2C6F951D093A6A9A2BB93D3DDD4BCE652F37827B SNIPERPLAYBOY5
438,330,060 *2C65D7CCC9BD6D4339DAF7118571FB69C1B554CC b%ow
438,330,061 *2C64517E79CFD42AFF6930F7868A40D377DD59D6 b####p~`(-_0)
438,330,062 *2C6A2EBB7D50DD1663E2BF1B191947A6CFC36BA6 VALINDANANCE
438,330,063 *2C6802431638E1C7C82449E35D1EFEB8ADC944EE SONGPUYUE
438,330,064 *2C68AE6D3223AB87D49236DE76DE124AC8324E47 SONNY.PETER
438,330,065 *2C6F738BE67001D041436C2B04DCE5016F761502 SOPPORTA6
438,330,066 *2C6B73D12B0C0FCACFF56E75FB6EBF66FF6425D7 BQU%#
438,330,067 *2C66ECCF4EC217F8850B7584AE4A291B1528E872 break1jail
438,330,068 *2C6D71BFC39FD9E0A08EE25025F36AFA5E30B123 BRENTON.MEACHAM
438,330,069 *2C6D1EE8070576B70428529B75749B1A0F0FEBD6 brettsantalucia
438,330,070 *2C6A3C52613F5F42C009C31DDC7B0CAE5524B2CA VEREINSSCHLEIFEN
438,330,071 *2C626F8580265EBB5D934BC2DD55CCB5E88B4970 brio!
438,330,072 *2C66CFFDF324DC8227C1E91C96B43A530BCA88A1 B%RM!
438,330,073 *2C616E1D973E1BA184B178EC7FAC64EA1FF0EB78 brtvili2
438,330,074 *2C632F091711BEF6BA56D1324B95E48347B42191 springler6
438,330,075 *2C6DBB7CBBFDD2098988CC1EBFA29B2C2434A84A SRINARONG?
438,330,076 *2C64DED2A27B2E8291242AA94C97AA153DDA0F89 bs=d?
438,330,077 *2C6E2A752372B394810B6C66A62D802F89866875 virgiliobevilacqua
438,330,078 *2C613844D90E43097C4F203BDA29091FCD81223D STACEYLIMAS
438,330,079 *2C61C9CA09A9BB8B506B6735B16407952C87C82E stacyberlanga
438,330,080 *2C668B5FA31C832A030D83FD73ED4D2C9216AF2C VIRGINIAWONDER4
438,330,081 *2C6A89AFFCE43DBD0D7B6F9F583B28DEAD77997C staffordshirebullterrier69
438,330,082 *2C61D8F59C081732A09B3DA064C51DE765270EB9 BSWMERRIWETHER
438,330,083 *2C64446AA1840EFEFEDD06FE230ACEDFBCDEC109 BSWMVSRACBSW
438,330,084 *2C655514847B59FDA8F8B202E118133DE68A47EE BSWSNAMEBSW
438,330,085 *2C632DE1C18E86E11E44D815AE99D82360A6FAD8 btc8f
438,330,086 *2C60CAF16B74D43BFF2624808467BE0B9C55AD0F (0-0)o~0~-q###p
438,330,087 *2C6C665D78145BA08309F7A122F13B24BA18139D VLGÏ
438,330,088 *2C67F1B297460EF5248810E4D5E59AA42BCD8426 BUFORDMONVILLE
438,330,089 *2C6A43EFC8D9C5B75FAFDAAC9BA3EA4FBB50A350 bugajakab29
438,330,090 *2C6DE15FCDC55C2D0676B6316D01AC5C23DA7F2D stephangrosby
438,330,091 *2C68E8825E06F334B270C7D64C45831DE95A3D19 STEPHEN.PUC
438,330,092 *2C60B35324FF9CB2BDF976F699107885A1B48218 bu/.q
438,330,093 *2C66E7BFFE36648BE6C323BB0BB554284BE1B8E5 stevenjrichardson
438,330,094 *2C66DB855B13AEDC150FF298BC0E907B678E792B 05261053
438,330,095 *2C6D99949C57F8A953EB2891AA15612B000FA477 BURTON.EMERICK
438,330,096 *2C6739311EA26200A05973D716BDE1F2922FD685 STINKINESS2
438,330,097 *2C6749BDD259EB065D749A8F631B4F6BE1B364B2 VSTGRJPTED
438,330,098 *2C6A0C5FCD8B6C251F289963B99A30F5041194EE [email protected]
438,330,099 *2C60F7C27E715C4A5E46383A5F707B2C4C7D2EF3 bv-
438,330,100 *2C6BCB9DA11920B0FA05308D927E115C5A44A150 STRUFNIEWHCS
438,330,101 *2C67BD0DB03940235AFA24B75B9FE734C81F9FD9 WAKKANAI.14.0
438,330,102 *2C6BB4A13F41292EEA922D25FD96D8D22DEE9D9B STTSNDRNMNGS
438,330,103 *2C648050352AE4069707B5969805D39A42979EED WALIDABBUD
438,330,104 *2C6817A5B411829DB5470C04A351B29A7E9F031D 0U75E11ING
438,330,105 *2C693172714BFBABFFBB5E3B922AF0A5C646B4CE wandertagungen
438,330,106 *2C6B77989C105B505CA66D0B99EB6A4A7E38F57A by"lq
438,330,107 *2C69203C172D6FB777965C7100ACBE37A9EFF8E2 SUCCESSIVEAS
438,330,108 *2C689924B254F68C4FD9C4FA4DF7AB8ECC5A9D93 wankusawade
438,330,109 *2C67E95661F4C937C20E0609ED3F9ABD4F3E98AB c02dp
438,330,110 *2C60A676361D369AF97C7AD00290BC00446CE3AB SUMMIDADE
438,330,111 *2C6FF8D5C2200058F2DBB078ACB3F36C8830DA0C [email protected]
438,330,112 *2C607B03E7C407ABCA3619A78F984E328A9FC4AA C1350DFA
438,330,113 *2C6D30A46487AE37EC96D30FF8CF240C78683705 WEASEL.JOHNSON
438,330,114 *2C6763A65CCB1899CF176C04979F11F43036F181 123go
438,330,115 *2C64C84E8220746975F2943F936C9841FA3E649A SURV3IL4NC3
438,330,116 *2C6719D160EF81A4E39F4201508642F861E1DB4C wendell-kellough
438,330,117 *2C65A0BD9691E99774B8833C771D4CD067537F71 1332876 car.-wer.hat.schuld.an.der.haushaltsmisere.?
438,330,118 *2C6B9471B83A5F0A21BF9A68B865BF3E6F610145 C4WSN
438,330,119 *2C645C1CB41B36A287E418A90FA56928E880F819 1401979 JUMALAOLI,ONJATULEEOLEMAANRAKKAUS.
438,330,120 *2C6357873F3B565CFA724D42544D5894352C2AF9 c(&7j
438,330,121 *2C64FAF47332113B13EEFD5C6EE81FA00EFB9BCF c7up$
438,330,122 *2C61BE2DB5A4267AE6BFB2CC63558D82E6BFA8CA swimminggoober
438,330,123 *2C679F48C68ED997C0ACCCE746241AE51A390439 [email protected]
438,330,124 *2C61ED530FB726ECD6D2267CC760E06051FA8A05 179.RESULTIERENDEN
438,330,125 *2C65717678F956799112DD7888C60684213D0707 CAMC1
438,330,126 *2C6EC42C93FB145D4D83489577B1BF637C8BFFEA [email protected]
438,330,127 *2C69B55559AEB42F3D68E8FF665BE6623C756D1E systemsundance
438,330,128 *2C622EA3DC32A8A22907C33D6BE67E398F00A0D6 CARICATURERAIS
438,330,129 *2C660E8AF177800FC079ED11FDF566F9F3763037 CARLO.COLLAMORE
438,330,130 *2C6659FC00A394403E24DE0D1E5F77E7BF2A7396 carmelowruck
438,330,131 *2C6DCFF3604022F3421699D2688B03DB76317A57 [email protected]
438,330,132 *2C6174C4B2EB6F6AD01FB3A2D84A0AEF90EE6E28 tablemaid3
438,330,133 *2C60184E404454BFE39B6D58AC96A59741614855 TAD.LEBEN
438,330,134 *2C6CB826878030D86D2B95324938BF4C38CAE864 CARON-REID
438,330,135 *2C6EA1E45C94302CC389BCC5B703916C6F29EA25 TAFFELURENES7
438,330,136 *2C646F5EBA582BAC72944184D84892962FF5D6D9 TAGEAIENTS1
438,330,137 *2C691B4D723686E293C6901B1E78C5BDB7579A5A TAKASHI FURUYA
438,330,138 *2C6E26BECD7DF8B21B6DF8B0F68DB871BE9E0BD6 CAR-WASH-(EXTENDED-MIX)
438,330,139 *2C68EF4661352C34C9C55CA3EE92ECAA58F97DA7 wickedopus
438,330,140 *2C6D6CCF1142610BAEAF1414EE663EC15420C360 catsh
438,330,141 *2C6776884EA408F783A9FB2B924CFC16C9D6DC12 1cdu-wertekommission
438,330,142 *2C6193397DF022877EEB5F83C1B17444116C2F2E 1-coastlines-to
438,330,143 *2C6828CACF01752B9B6B6E5AA935E51C912C4E99 tarruc 1
438,330,144 *2C658588E16CA4AA010AF1EFDF9CD619C3458B66 TATCAAGCATTTATGGTCAGGAAAAAATGTCTACCATTTACTGTGTAACTTCTTTTCTCA
438,330,145 *2C609E89617A821F8F2F90A254E638991D7CB0E2 1.disjonktor
438,330,146 *2C6087AC32A3039A462DCF0CD1C76B6E3B99406C CBEJ)
438,330,147 *2C680E02AD2BCA0265E2B4E5F3BD8FA33B5B18C5 TEMPERATURSENSORED
438,330,148 *2C6105E2F59FA15ACA0D78347EDBE4F14A61CF47 templatepdukraineru
438,330,149 *2C68676E509C3B357B2580609A072C2DB0437B16 TERRANCEADEYEMO
438,330,150 *2C6DB7E40687F9C6C7D5FC22C225F26286FEC9F0 1hein
438,330,151 *2C677968A54AFCDAC667DD1E49AD5BCCC442ED43 CELLO SONATA NO. 2 IN D MAJOR, OP. 58: ALLEGRO SCHERZANDO
438,330,152 *2C6BEDB47204811D7D2CA7561D33ED361B097BF3 CERTHIID5
438,330,153 *2C6DFE712E6CF632C4CE503D7A5EFC867593E524 winona.frye
438,330,154 *2C6DE4B7D87AECDBCB63541C0D95C32EE7146F93 THEGALACTICIRREGULARSCOMWWW
438,330,155 *2C60D14E083FC0B78F687E6E27421C369B14293B wirknachweis
438,330,156 *2C6F8DC0F9173FF094C6C6C95C1A6314480A5C9F cgww2
438,330,157 *2C6F469661D7DD90D0EB935B3AFA98CEBDFF8FE6 CHANDRAL
438,330,158 *2C654EDED5839530FC09DD78BC9E8BDD1EC8A468 CHANSON.B
438,330,159 *2C63E07CAB39A7F2FF50A5EE905D2AAD520B661C CHARLEYOVERMANN
438,330,160 *2C68D550EA60837ADDC9DC2A2B424C7EE09A853F THORBURNG3IG3R
438,330,161 *2C64897F7DD230B2E2CA973F254A2CA1646B85EC wroeten3
438,330,162 *2C6CE2DE68810D3250F10F51656E036E62C52870 1.ruokaskandaaleista
438,330,163 *2C6824FFD9D84A221783D0D08B60A1DF09A4B44C Chb1
438,330,164 *2C62A5C6D369624B22573A6EEBA5FE5B3B231364 1.satterwhite's
438,330,165 *2C6654225F81187420844E3F66960EB0C8C525A1 [email protected]
438,330,166 *2C65911E7214918B219986D5478B2F36049B9D04 TIARERIHCED0
438,330,167 *2C62CB3B1EB60B4F6146DC7FD69F9902177EAE39 [email protected]
438,330,168 *2C6B35B71C7A5F3EE8C2244DDC87C5813012F3D7 WWWARCHBISHOPCARROL
438,330,169 *2C67E463506A2D1549ADE4FA4C882ACFF9403BA9 1sichelwerke
438,330,170 *2C602771B0965D80FDEAC8351C9CC492DBCEF454 WWWHORIZONWETSUITSCOM
438,330,171 *2C67E8E84AD33E8E6D9E40E28125E1741EEFF23E [email protected]
438,330,172 *2C694F6BE665D34943AFD05DC4C72F695E0BA51E 1TIAREIAP
438,330,173 *2C6937C774A1B553ABB75B0A0AAC47B01658E8CF [email protected]
438,330,174 *2C67D4E28D2E504F3F6C9C1C4E75EBA8295BBF28 1-untermischen
438,330,175 *2C6070F02A47D2D32C5ECBA19E610B47463AACD5 1.VAKFI'NA
438,330,176 *2C6E8826A22B3AD8138F5D700B00B3709189F071 1.verheerenderen
438,330,177 *2C65AB60EF04A316CED0F812BD3D4309AA25F612 1vesirakennusinsin
438,330,178 *2C68B2CB035F4BAB1436DB290C96944C4560502A CHOKLADPENG
438,330,179 *2C6726776DD8A5DB82B53C45314978CD7681AB97 TNARYE
438,330,180 *2C666DDD2E4CCFFEE98DC0A515DA3E1005EFA6C7 1ydinteemasta
438,330,181 *2C661A781E7E28DBC054778B43781A8896C26350 X,,D
438,330,182 *2C694ED8DAF55F8B81682758D446EF31C816C8D5 }X{~`dB
438,330,183 *2C6AE0224179C39872949C332269C1B45DBE2B59 TNIRPTOUQ2
438,330,184 *2C6E774F7D57DAE06DC993F76E9A92371D56784C C_HRP
438,330,185 *2C6AE76785339CAF6FF1C8DDD39A247462D1328D XI3469
438,330,186 *2C6A0F96A4EDEA1D015504191F0C85CE74FC89A4 [email protected]
438,330,187 *2C6AAA46F51295B884A84DF65F2FD000E5857FAF [email protected]
438,330,188 *2C638FFFADCADC326DB638584948927F22CA8434 TOMASMATTY
438,330,189 *2C64D5E2391C92459A40E62AF223D58366E90B98 20FEBRUARY1660
438,330,190 *2C697EE4F86C40507765686F2C8340FD3AFF77BD 20kaelyn
438,330,191 *2C6AFDCE36CBD025D2C57724410312F4A5F5F9D8 [email protected]
438,330,192 *2C6E800F5DB707E0CE211093BDBF0EDBCE4E5771 22.05.1523
438,330,193 *2C60E67E5CA2F2203F8FA3DB844263C6D42D604F tomziemba
438,330,194 *2C6D6CB93EA2B3DE7B62722BEBE89C8FB8D3CBE9 CIRANDAS:PASSA,PASSAGAVI
438,330,195 *2C6B48601E444E9BB0FE9AEE3A4C8D95FD9BCF21 [email protected]
438,330,196 *2C62CCD36D0379840C6DFC66547B7610608B9F9A yana-mas-siti-nurmuliana
438,330,197 *2C6CE1F600548D3A4672BA6773343936335DEFF4 to図
438,330,198 *2C6210B69C377B4AE62809D4DF37300B9BE81117 TRABAJO-FRANCIA
438,330,199 *2C6D5695125C3ACCAE551F953F6B104A636545DC yap.chen.ken
438,330,200 *2C693422B408D458E9D8E95CB13D92F6EAD662E0 TRADIEBAS6
438,330,201 *2C6C22688C7974F3A30EB6C248AEBD729887E24A TRADITIONALISTES1
438,330,202 *2C6AA28F2E70CD02C8DBE4B79F0982DF80AACF3B clarencebohlken
438,330,203 *2C65D170DFB7C5819A6E02824F0FEAB275567FC3 CLAUDIO.PARGA
438,330,204 *2C693E2AC9CFC35F62C5594825A39C445AD4B774 CLAYTON.TASLER
438,330,205 *2C6FAD700F742C8FCC9CA3CB686B16CD2B26C2BE 2567517 ihminen-tarvitsee-tukea-ja-rohkaisua-harjoitellessaan-.
438,330,206 *2C6C3BD89813413123C0909109ECEF3871C7B0A3 25-valse
438,330,207 *2C664E09216084653829A50E68A94655F1FCB7CB 2607453 LOKAKUUNAIKANASUUNNITTELUNTUEKSIPERUSTETAANTY
438,330,208 *2C6A7D75E58A6BFF45A39BC63BE250BCC2C9DCF6 2618195 MUUN.YLEISHALLINNON.SUURIN.MENOER
438,330,209 *2C6168CA4359F351DC81B1D6F6E6B48CC1052975 CLFL
438,330,210 *2C6F73BB5EEFDC8D5965EBF0EB8C011240D118E6 YOLAISY RODRIGUEZ ORTEGA
438,330,211 *2C6C1AD4F935228E5EDFAB609B7369335855C290 YONAS-ZEE
438,330,212 *2C6FCE61F02728082F8448D3B65DE2949909FE0A trevorkogut
438,330,213 *2C6E70DF291B889F5C8F0CA73B07B36B885856EB tricyclist
438,330,214 *2C6E2A3FFBF939E0973690E99E4DBDCA509D91A7 ClW
438,330,215 *2C663CD87964ED64D64796720001689B24BCAB91 2-cerkez
438,330,216 *2C6437AC5EF47AA8CE2AD812BBEA6A76A14A564B clyderockelman
438,330,217 *2C6B26D5716AB516ACF9631C6174276090580B3B YRREBSLES
438,330,218 *2C618B1085CD12910E3BABCD2F30BB39883467E7 cmntv
438,330,219 *2C6EDEEE854B8134026D360C766D58DE1475DCDA 2GAPPEKI
438,330,220 *2C655AEE929C8E9F2E2470C83D7F06F25C0205A7 2ILOVEKNIGHT9
438,330,221 *2C631417074C1C6A81351DA89B02DE06D9267BC8 TROPANGGATOWER
438,330,222 *2C6355A14E3DAB3523392568C2FE4771DEE9FE70 2kontrastinin
438,330,223 *2C6F0685FB36BC5346860144E9C3067B3D619FC1 CN5F5
438,330,224 *2C6A7F380A254BF681B0D696A860C8AD706DF9EA cnjfj
438,330,225 *2C638D7619CF041FA2C80BAE75C228B882E2F663 zacheriecruise
438,330,226 *2C623E4C110B9DA7CF7494DFCC2000A8FB8BA2B8 COHK=
438,330,227 *2C6CF517AC8844461D16B329B603BACA50F449C6 2THATBASIL9
438,330,228 *2C64B64DFD28B62B02DC2D22BF0CCEA064169BCB 2WEBSDELL
438,330,229 *2C68522480F88B3F04714AA2C839CDDD50D4C9B6 tuankana
438,330,230 *2C64EB8835F5C4A26E9CFDE895423B0F8A59C58C TUBAIGANG
438,330,231 *2C685C022399BDA665750A4FAC0F8B512CF7C7A0 3======)~0~OSPLAT
438,330,232 *2C60E01CFC765D797D26ABBF80EDA70FB23CAB51 COLLINSTONPROGRESS
438,330,233 *2C617F889AE2764668F3BDD4DBA264C5F1C21B8F colours-with-distinction
438,330,234 *2C6ACC01B11C4F1FBEEE5DEE5C44856809D49BAF [email protected]
438,330,235 *2C6C8E542074B10ABE4D1A1FE17D69421DD6BF83 TVTNENEI
438,330,236 *2C62479504505B9C13D4DFCBE9F9961109218F15 3FOSTRARNS
438,330,237 *2C65FB325606A632985EE1EE754467BB4258384A 3ILOVESUTTON6
438,330,238 *2C6DB61DE5838B90BFB5652AF49D410D7D9A984A TWS"
438,330,239 *2C6FD50C0E230BE895BAB5450ACA85508F65567A [email protected]
438,330,240 *2C6C1D9BE3AC189F4FCBFC04456C3B3CF008BC7A [email protected]
438,330,241 *2C6F26051D1E6E4E7F04A91F020E1777D251D801 TYLERWOODWORTH
438,330,242 *2C65F7CFCCE93BF4778686EF9F9342CE4A053851 TYREE.GREENWEIG
438,330,243 *2C602C26D98ACA6E57C6467FACF892DAEE06A416 [email protected]
438,330,244 *2C67E221476CD6B0A160D78069A6D84E300B7C27 ZLEAMHCS6
438,330,245 *2C61A91091AE5F2795CE44CA2C400D995D262EDC ZMRKSTMS5
438,330,246 *2C6ECE3CBAAD706D9C9409FAE87EFDBAC59DFCF1 U74279
438,330,247 *2C68B7B7404321B0108C8DC2D91C083CD6BCDE38 3TRASHINE
438,330,248 *2C68A8950A4127ED63569D85333228995BE8E9D3 3XPOR7$
438,330,249 *2C6EF46D141E7EEC1D5290EA375A7946C30F9DF7 40nissan
438,330,250 *2C63E3843BC4DE8A7B4DF4CB2DBA826E7555747A 4ABRERENT
438,330,251 *2C68CFF9EA524A42FBB94C1F7AB1B99066C1B3D8 4DOBLETE
438,330,252 *2C665A37AA5EBA9296C11D90B3CE4936376A92FD 4ILUVHONDA11
438,330,253 *2C6E6F6E3783BE8CDC81461EF2FEC56E94E5D91B UGIGES
438,330,254 *2C6035A089943131922D250A4C60030658F12F67 UKELSEWHERE2
438,330,255 *2C61568726BFB08FA9B6D0EFCF839609BC69DD1B ULQUI SCHIFFER
438,330,256 *2C6BEFF462CA52A8CF2898138B19E45976DF0B87 COTTUS3
438,330,257 *2C6407CDCA0728515544BD94615BDD109F1AB397 Un0b1gng
438,330,258 *2C63B016C903579685C8B326A5D10A465D070DB5 COY(D
438,330,259 *2C67EB70BEC74DBD80B1D81A1FBD3DF0844AC30D ΚΛΕΙΔΕΡΈΙΚΑ
438,330,260 *2C673ABB5A552EB2F43DA927EA78626BE0BFD5BD cpd)-
438,330,261 *2C63E409DF68321541233D12E552D87F578A39A4 ΦΙΓΆΛ
438,330,262 *2C63B59D2930F015B6E10A94A91DB8118321E1C0 Ungen
438,330,263 *2C610EFC3D4D564C1998AA8E7758D5392497B01C uniilaffuda
438,330,264 *2C6DB127BBCA115ED5AEE3D772139F7247920867 4SABELSLUGERNE
438,330,265 *2C682BFD052C85BC6814165D287DF42B293CAD27 unmanln3ss
438,330,266 *2C66E1E17ECF02894150397F067810AAB7D9F389 UOYUKIK9
438,330,267 *2C62B00BA4FEB5B3868B3DC7C569E4403E3C92AA cqtoz
438,330,268 *2C6B7C78E8345ACD16FC824486247FA9EC915978 UshaKhanna&KulwantJani
438,330,269 *2C6E5D3F385F62BB34CDA3356DB364A1CAFEF0ED 597940 KONSER,CEKILENHATIRAFOTOGRAFLARIYLASONBULDU.
438,330,270 *2C6AC87A9B12B8B0DAA13DF064E4A06E3110E0D7 uu-o~q----q
438,330,271 *2C64102286EB0AE637C503E1730A279CFA3C12E9 CRYSTALWHEELS
438,330,272 *2C6F3627C53D6A1AFE2BFAE716D6FBFF40FD0106 „цигано“
438,330,273 *2C60C4565D6724E95C986A1E3721E4B79BA663C0 VAMSHAVRIKSHA
438,330,274 *2C6C33F451CEAD869260B01D5013080275A7A95D cusconin
438,330,275 *2C67DD090FDE0F5677952D5A9C9CAFDAE0F0E5F1 variationsonathemebyhaydn,op.56a:finale.andante
438,330,276 *2C6F4933E33CC2A1B5DA1BF6D52278EB2DFD0BC3 5-lottospielern
438,330,277 *2C6BA8541E90C582AD999F78B6184929B9980B57 cvede
438,330,278 *2C604E9B93C3802C52951D437ABEB7CFDBC1BC88 vcorea
438,330,279 *2C66AD6B16E73C9DB03B707F4806635674C00533 cwda
438,330,280 *2C63E868021D725238B3BA30827C3045C692E5D7 veradakova
438,330,281 *2C6FB54987AEADE43BE2644FADD6F3C807CE1710 5TASMAAJJAATAH
438,330,282 *2C6AAE507C615F780F3D162DA71EAAC044EFB05B d!/-.
438,330,283 *2C6182304B0924DAFCEB8D1E62785ED1CFA50E59 v>ge
438,330,284 *2C65225C5215626C5D7B5DD140031220AE48C9E6 d1ie2
438,330,285 *2C6D726B72E93C6A55F01D6485C9572291C66EE5 VIDYARATNE
438,330,286 *2C6B3A73CFF062B419F2C052284474D16BC7276B (条件付き賛成)広域ブロックはログインユーザーまで巻き添え。OCNであると影響が甚大。匿名のみのブロックなら賛成。
438,330,287 *2C66B3049CCAACC022DE00E968CE0037A430854E 6BIGBIRDSAVAGE
438,330,288 *2C67180C38A3421CA44A9AF6A97BE158CC8AB417 d6lx
438,330,289 *2C64F0BDE6A484BC83646C77ED63D1D78399614D 6FLIPPERZAPATA
438,330,290 *2C61E1AD9112F02DA51E4F74A716D5C59D60C91C 6FLORXITA
438,330,291 *2C6BF8E5C1F90F654DA4EACAE57AC136029EBDDD D87B
438,330,292 *2C6E0580BE27D7B0A921FF25EEB522CCA038DD98 da;b7
438,330,293 *2C6251DE3CE301F3BB623844A0EF341D2E85EFCC DAEECHINI
438,330,294 *2C6401FA54FC9275AB951A702F67E872C0CE4EAE 6LAMENTAVAS
438,330,295 *2C630DA3B61BF1AA8EC3943E931E65697C38129C DAMIAN CALDWELL
438,330,296 *2C63AD6191FC8DCDEBA130468DB80339EB19D769 6ONNADRUK
438,330,297 *2C65265F88047978AFDD9AA7E030405502EE8703 6PACERSPARKER
438,330,298 *2C652116CF2D32BB8E08005C57CB71E43C7D4F85 6PRESENCESTAGE
438,330,299 *2C69E5F2438B8563DB0F28A8C4ECC9D88D2A96A3 [email protected]
438,330,300 *2C6AF81B6649D34BBB6AC1F9E62FF82CEBD8CC1D 6SGRGTNG
438,330,301 *2C6E223A631C3A22D92330AFEB02912390857848 DANA MOREHEAD
438,330,302 *2C677DEA3A6B747FFA4779BC3F46126BA81B133A 6SNTRKLSDG
438,330,303 *2C637673175D852430186601E2882994CBF15819 DANIEL DEGNAN
438,330,304 *2C6B383ADE69851070E6547162CB19FF6918A8B6 6TROTTERESTE
438,330,305 *2C668BD46BD033A85246C52F9997D96B441C0CFE danilomangham
438,330,306 *2C6230C2BFFB99E70EFDE3761A56E7EED6DE66A5 WAAHA HA
438,330,307 *2C646CB641BB1DED332D8D000391DAB1235661D0 waihongfoong
438,330,308 *2C601616E651776A5EEA0CCFE50DE52C54CBED68 daplo
438,330,309 *2C6C7200EBBA4A9C6B14743634A0A2C0017EDAEE DARIO.VAILS
438,330,310 *2C63ED318CBCC0FB8BA4946793C086886C344ADE DARKDOOM9999
438,330,311 *2C695F07BFCF935B70C20879E8E419A65AEE1EB8 75664 THEY CAMPED IN PARKS AND ANCIENT TEMPLES .
438,330,312 *2C68A676E05B1E76C3F244F6705AB7F5C09B579A walter.osmund
438,330,313 *2C6F2A87ECC437AE746FADB9BD76F980EC5283F3 WANA.DEVINE
438,330,314 *2C65F298ACF4F63C4882F37F45A421F901540E7D DAS.LIED.VON.DER.ERDE.(LOREN.SCH
438,330,315 *2C6F097B6F653D1245F1CA14C158959A17BCB5AD dasrheingold:sceneii."wotan,gemahl,unsel'germann"
438,330,316 *2C66A5EA33E327CEAB64549268A6704663C153BB DAYZIASTEAUA123
438,330,317 *2C6ABB0D20F2F45E67C65423F8CFBF41D18A059F WARRENCREEKMORE
438,330,318 *2C6D4F42BB4DD238AA9DB34DB11D6C8FD7F27100 7IAMSMITHS5
438,330,319 *2C61EE8193E5ADAC2A1D0F0209B0E229F2D5B54B 7KATSELEV
438,330,320 *2C608F1BCE94247FE55053A0645EBAEBC98A3BAB 7KOIVUILLA
438,330,321 *2C66E8BE268E9D9678C0F1609B909972184FB737 WAYNE-LEGERE
438,330,322 *2C6F49BCCBB1033172B727896B277A17F07E2FC2 7LMCJADABSW
438,330,323 *2C6B25C70AEB533D82F05BA8C72967253F34410A DC.J
438,330,324 *2C63B4B359129505F3A5D5E02B3BBBC6A6A400DC WENDELL.ROEHRICH
438,330,325 *2C699E224037DC3C328C0DB8EB55FFD638B74314 [email protected]
438,330,326 *2C697446723695C64ABCBCDCF9E044995B62FFF8 [email protected]
438,330,327 *2C6E460C6645BE297D46E93BE25667D904FF99B2 7OMEREIZA
438,330,328 *2C685C8B7BB1F1A68474FD118C5550EB8C77F6D7 [email protected]
438,330,329 *2C698268CA6A74ED943947EB8575908E2CF2D48C [email protected]
438,330,330 *2C61352A72FEC18E5E6D3348968F3F23DCAAF6B2 7PASIALLISIKSI
438,330,331 *2C69AF89043169312DFCDB9A8BEADE98B5A7FEAB werkdadiger7
438,330,332 *2C671CC731361BF6E5C4B9FFEBA85E259BA90FC7 DEAFENED
438,330,333 *2C65297108110F2CF93FDAF78C5CC8FEAE7A624D de_av
438,330,334 *2C6028941378B073A99BC0FD37C5790C6E3AC7D9 09121231
438,330,335 *2C6341F49A176C172FC1FC2EA86784E0244218D8 WILFREDO.SARNOSKY
438,330,336 *2C627D90E9320C7569A6F30C2859BF8758D753B4 DEMOVIPER0
438,330,337 *2C625478E53A3222BDD81599D5DC7174F29CFFF4 0thatdylan4
438,330,338 *2C6EA8214C77FE245EF43297193344643A000268 8##B.*.*.O><
438,330,339 *2C60245B048F3F51F575D6761B5D7B0501F1BB78 DESCOMPRIMIRSE1234
438,330,340 *2C6E27D3394C95609B24107FF2F96085B7CCCCF6 14AUG1348
438,330,341 *2C646F7EE6393212AA97F57093CE6425026E6A16 DESMONDHINDSMAN
438,330,342 *2C6F32FA1D876838F621A39AC8B9530F518B92FE deteres
438,330,343 *2C6E8F80F5E8BCD9BAE3FF9754566FCCCE8D74E1 DEVONBADO
438,330,344 *2C678149767C5F0ECA782B7A817DEC808D265BFC 189472 KAIKILLA-OSANOTTAJILLA-ON-TILAISUUS-P
438,330,345 *2C6294C675D847E4C3C0E78C6EE3ACED4C62074F [email protected]
438,330,346 *2C65BC0BC42BA757EF75414D5EA56CE82F10A00B 8ILOVECURRENT1
438,330,347 *2C60AE4600E3EE90FBE6C9539708E7BD1BEAC571 [email protected]
438,330,348 *2C6966C9E330F47036EFFA1D3F216FA1E57AA050 8NELEEKAR
438,330,349 *2C68D1B69B142279546E5CADD436C6AF1595E999 8NEREWEGR
438,330,350 *2C68E84A4B0F2E363F21814DC41A11C1080B25FD DGHOR
438,330,351 *2C6E6DC81C35EAA4FFF3045CE1482A7DA652CFD6 8P~0.)0(
438,330,352 *2C6C0371D64A2CC1B073F5EE8488390859AE79CD 8----p~o(^_~)
438,330,353 *2C6C465C12621EE404B0F5B55BCF02361B318ACB 1film-mira
438,330,354 *2C6E70BFB75067FD0FC8E6545EF2B4DDAE2B9FF2 [email protected]
438,330,355 *2C690C60CF9DF36B33D574878CAF560016794BE6 }X{~`dB
438,330,356 *2C6A7C19442F754050B1D29D8AB0F1B20C6D5D3C [email protected]
438,330,357 *2C66D9C2D801FFBC432D48C2A2678C624CA1C9DA [email protected]
438,330,358 *2C6577267D18129678FC6D0F01B98A73F528083D [email protected]
438,330,359 *2C64CB7C88632181322E8A543CEE5689CED8D98A 8XZQKTOCDVD
438,330,360 *2C6BF00828FCA2C59BC79DF6146FF698917676AD X{RU
438,330,361 *2C6861F52E9B51F3DB988B7E692DDA9CD4165549 djhh8
438,330,362 *2C6F70F960083B95B51AFFC20903701E3D5B06EC [email protected]
438,330,363 *2C69DCBA4411A487A32E98439A0E4205DFCDEF3F X!W8
438,330,364 *2C67A1ED651273CEB78097DEC90A2046AEA692DA [email protected]
438,330,365 *2C6B8A30C8DDA33BF2F9E7EF716CD01BA8EB6FC1 9AIRALUCNUGAL
438,330,366 *2C6651EB91FB410EEE6AB83E2BAE33A0C1AC4B34 1-MENESTYNYTT
438,330,367 *2C642D160C6E7C643940A87B047DB9641386158A D(L7W
438,330,368 *2C6FE5ACA192C4C07FD3A9A67A813116864769F0 DM9V:
438,330,369 *2C68559C56283AA781C268E35B27C2FB76D00C64 DmGw
438,330,370 *2C68C6EE352C2238BB529470ED29DF9F03731CEF 1SENATNOM
438,330,371 *2C6CC4B14FDEE6D621805CC0E67B37C5F4D55BA8 1.TABLOID-LIITTEIT
438,330,372 *2C676C8539FDC05CAB1422F6141C4DE221F24FBE 9MALACONSEJADONESS
438,330,373 *2C64E743B87EE691D3B81EEA304C0082DE28EB50 DONALDRYKER
438,330,374 *2C6208319A314D4BFC3D4BC1BBBC92FC4A35DBE3 DON.FREDDRICK
438,330,375 *2C60595266DC41A32CAF7EC0659329BB97A5B3E1 9NASRAWI
438,330,376 *2C6B290212DF4FCE15DBDDA2B21FEE502CE8E6F8 9ONPROFESSIONEEL
438,330,377 *2C67B639CF2B8B2E9F5387C20D91381E89EB3BD6 9PUHALLINAKATEMIA
438,330,378 *2C670CBCD94B6B2F4C55FFDBD3638251A10EBE1F 9RNL0JQWIRVGHUH
438,330,379 *2C6D737DAEA1649DB46F9B69422F0FDDBFCE602A 2286044 THEOFFERINGISBACKEDBYFANNIEMAE9%SECURITIES.
438,330,380 *2C6E65CC5973C54A0341AC69FF8FA0475543D119 229764 N--600-HENKIL
438,330,381 *2C61F7888CA641B4D5C5EA20E20E7C5118DA930C 2401579 sen-myym
438,330,382 *2C68F6D6C8151F0AB630657457CE4D256DEAAAAF 9.tupakoineet
438,330,383 *2C6A31EBE739BC649B5B81D89131038C18ECDF64 9unrationally
438,330,384 *2C6BC2112C252BB0BC90E8006292ADFC2C17E6F2 A1QJSCDS
438,330,385 *2C63FD367292D414205D3A99607C476136206483 a#5ha
438,330,386 *2C672601E74636983A477217F67D2B2BA4B80567 a8cw
438,330,387 *2C61940F255E0E720C2FAE40389D64DC84E8CB49 2 MAKUUKILPAILUN
438,330,388 *2C68474D9F12579194BE68C7E78A65BD4F0D9C76 dskc!
438,330,389 *2C65ECCE7A71FBC590B61065C24BCC1A0E8BD6F3 ZACKHEABERLIN
438,330,390 *2C6C8065592EE3315B84456E9050B00FB3E21C1B 2UNGELEGE
438,330,391 *2C6E1B87DE0E00B24758310ACDEF162B1FD8827B AACTI<
438,330,392 *2C6DE0658229259C6B23D9AD12739D36124D5857 DUNKELR
438,330,393 *2C6889E2D43E50F476B911F6EEF8DA16A7614EA6 ab-:a
438,330,394 *2C63C446FEC7DAB4CD3D35A6386B0BFE0C891806 abrahammirchandani
438,330,395 *2C691946A3B8EB95085086D27FFBF006B217EF4C [email protected]
438,330,396 *2C69930373189CB209EEDDC9A2B141F7C31DB63F E5U12
438,330,397 *2C6F71685350D0B98F5895E46B4578095C0ABCC6 ZSCHPSLING
438,330,398 *2C67C3FEE2F0D0AF30F6CB71D24F0D85B40713E3 zsebemben-1
438,330,399 *2C6CB4F66542D8B114DB28EE4C5007490446BB03 40.shades.of.blue
438,330,400 *2C645501A2C3B31C192BBF728ECA32A059ED6989 acuario_jamas.23
438,330,401 *2C6BC8EF87CAD3C45D642670299A6EF87E7A2F60 4451tan
438,330,402 *2C6612D469541F3425882E9BD3487B2AC0291125 [email protected]
438,330,403 *2C60A74E3315112297673924F5D39A2498BFF68F EDIEOLV0
438,330,404 *2C6193B4AF212DE9958151FFFC477818DC99E861 EGYPTOLOGIE.
438,330,405 *2C67D70F033B6F887B3DDC59A5AC3299DB1A6F32 ВІНЬЯ
438,330,406 *2C6AC7DF5E85F280EE079967A56E876E8ECEF6B2 EI?h
438,330,407 *2C69F17EF8E20DC6C0CDC44E2C7B6BDC970190AF 4RASCALCYCLONE
438,330,408 *2C6668BA901E9E335CD5B57106F313C38D173A61 A"HPW
438,330,409 *2C6AE23C519F55AFAD74557DCE1B18EBE3690C0F КҰНГЕ
438,330,410 *2C6F6C4E48A279419389A65F62E1F5863F2991FB aia?f
438,330,411 *2C6AA00A80398341948E2BC6680FC88014427552 AI.CE
438,330,412 *2C675EF9BF521EFCE7498779AC76A8B0A9D30CE6 A(iE
438,330,413 *2C6B3D02B19F71F01169AA553DF92491C57FCA26 МУЖИЈЕ
438,330,414 *2C62A7A6789ABF1D640B08DDC6FC072FB92001E2 ПРИОБРЕТЕН
438,330,415 *2C68AC1F68FBC1E402F686548B1639F42F946FF3 A,J)3
438,330,416 *2C6EEFA36358179FC18ECFD1988642EBFAF2A76A elliotholzem
438,330,417 *2C6029CB3FF2837A8F5FD09FFA4D370B2E325263 5AMISUKAH
438,330,418 *2C67571BFFDB0609699E23E28B1024CE12EFE9D0 ELP;I
438,330,419 *2C6042193ADDDDE7E8DBE2BB667B1448979FB93B ak.3v
438,330,420 *2C693A9DC343CA627B48E440D87E9DAF43CEA1FE emiks
438,330,421 *2C6F1C4250EEE3C4668748E40DFB899DFAD5C039 5DWIGHTCAT
438,330,422 *2C63BE2548EAE553470CF556C3DC0103D3E61E6C aleksiskivi:actii."sinnesemeni"(ahlqvist)
438,330,423 *2C658EE516F942ED10458947525F3D6CB4FA964E 5iluvannie2
438,330,424 *2C6A2A2F8DDF89EE0EE249D63BDFC9B5BFDA0902 5MUIRABMULOC
438,330,425 *2C6FD7FAFB832190B6C800E9BEDBD15D53720240 ALICANTEP
438,330,426 *2C6A3F080EBB9EA5C5B72C46635EA50444A9D388 ENIGSSEE9
438,330,427 *2C65A6C66DF14E95ED42A8D2F4FA0CB166136376 5-OGrenebiliyoruz
438,330,428 *2C6899B6EC9084E0CEB0CE89B8C48376AEB6AE4A enter.the.helix
438,330,429 *2C6FC98DE0CB8C5A2846F14879923C97518B5CC1 白夜物語ウィンチェスター家の末裔(disk、7
438,330,430 *2C69F0D5E988EE17B92B04FCEEAF5A4D4878E92D 進化経済学会福井大会(福井県立大)にて、U
438,330,431 *2C6E59E8005166268BF805EACE42A5B52F58909D ALVINIA
438,330,432 *2C6EBA5DD0E135360A692C669C12A5F38D6DF53D ERIC.CLEMENTS
438,330,433 *2C62728E86E0A290DFB00B6D4C6FB37AEA3C940C 670374 kalsiuminottoahaittaavatep
438,330,434 *2C64583E1A7FE696DEB381F0A48F6FD277614CF8 ERNESTOFEHN
438,330,435 *2C6210572C2110A314C8EED3FB21E629296D34B3 [email protected]
438,330,436 *2C6B46FB43D792915F7730D647673B3F97142268 amf0cfkd
438,330,437 *2C634F6F656ED3BC172B3EEEDF5111217C23FF65 [email protected]$
438,330,438 *2C60A0F7186EF76F99233460FDE15AD8F2142197 0ILOVECHARLOTTE2
438,330,439 *2C6C5E5CE86AD11379958D16E8B67F8FD737975D ervinroszales
438,330,440 *2C692B5A8F2C22067E4A9DDE51D960DB68454E2D erwinkinstle
438,330,441 *2C68DB9F4FBA212F7B43005F4E7DF0ED2753E61E 6CONTIATES
438,330,442 *2C6794F301BB3ED58C9DDAB7CED47528822B8E2F 106LIAM
438,330,443 *2C6C93B72ABC52EBD4B31BDF507AC1FC1C4B9FD5 6FRODOREALITY
438,330,444 *2C66F3A00C55FA1D0220B25C8951C30564EFC6B2 ethm9
438,330,445 *2C61A0441E14BB901D8CC8C4D3EA846C16B9B44C anibaljubic
438,330,446 *2C6DF9A1EEC8E9597F32F3155E664BE7383AFA2E EUROPEANDREA
438,330,447 *2C64F2F81BF3F62FD0B228FC83E3FEF129315B05 evanwedell
438,330,448 *2C696104A0236FB8CB6B7C85D17CC42936C7D037 [email protected]
438,330,449 *2C66962BC88C54F0CACD913245279D04BB7AA30E EXH]
438,330,450 *2C656202CD29438E8BD3E107788CD5EDA4F1496A ANTONEOGIBA
438,330,451 *2C6DC510202E6CFDC9430D67712709D61D0A8BEC 1466352 valajaskosken-mets
438,330,452 *2C616861DB6019281818E46FFEB6B72EE196C40C 6WASCHGEL
438,330,453 *2C66D1C3A1356EEE31307E55908D69454379A33D 716PLIJYGRDW
438,330,454 *2C6BD2B9FB92DAD5E7102286A55CE0263C785BB1 FAMILYVIEWING2(C)
438,330,455 *2C6B0B8A2504D6CF5EDAA32637D5F0FF0D2FD886 apt44
438,330,456 *2C6AC02121C40B31CB2C029701B7A846EB6EB57F aq-z%
438,330,457 *2C692E6DD718B1F6216B19D17619516B8A0DDEF2 7BOZOGALAXY
438,330,458 *2C677F48B490D5854F2F05E19DFAA72231600768 1744470 THE-RULE-IS-WELL-KNOWN-.
438,330,459 *2C615BF6710878C81FA6E62360B1FB944D53E82A ARBEIDSLONEN
438,330,460 *2C6E5E7ADEEF2648A092DEE66D437D18173E3C87 ARDENT-SPIRITS
438,330,461 *2C67193AEC6F359CF1FF9CB2727AFFE4B5E48B0F A_Ro
438,330,462 *2C607BE503F96668186914BC5DFF48679624D1DD feustercheu
438,330,463 *2C65026295984798ACFBB53B222B7A6E352A6B23 FF9
438,330,464 *2C63506F4E89E05F17F0A87D1DC84C93E511D97F ASHLEY-BOXMAN
438,330,465 *2C6D0F08988DC0C16700413CD322720F71A27549 7PUBLICGOFISH
438,330,466 *2C664C600CB1B8B3C17B556A660C0DC11B21BC37 [email protected]
438,330,467 *2C6C7B54D0BEEE1FB0800945A03AEE8591A688B3 811692 siebeginntfastimmeraufeinemflugzeugtraeger
438,330,468 *2C6A8204983FCD2621BBD50010FDAD2B95EE8E31 AUNGYETHANT
438,330,469 *2C66DD7D4BAB0D82F6A91DF8D413F915583B5A02 fnetoidi7
438,330,470 *2C625A44EBB4B4F62FEC0F86506343821430E27A [email protected]
438,330,471 *2C64BB2B58C6DFB977A67926462D1DB680EF084F AUSBOHRENDEN
438,330,472 *2C6B1D8AC90D3FAE4D897F4CCAEF4CD37B2B88BB AVARAJAM5
438,330,473 *2C65370B260E13E504B0C9C90E4FB746CC0E7AF3 1harcamamaktir
438,330,474 *2C6CC38EF7E5D7DDC5EEB2C35505A45EEA908EB7 8DUROVICS
438,330,475 *2C689EA9E7678F83E13E52D9768A85E1F73A5485 FRANCESCO GORINI
438,330,476 *2C63821834D52DC7AB05FAAA9C029818E2C6B9D5 8EPAEOLENNAISET
438,330,477 *2C6FD4136668A3FB1C1CD42CDEDB0D7F9DA83141 8FOLKEBLADES
438,330,478 *2C6B636E0E3957C7435EB5AD1F19DB5C7159B665 AYlH
438,330,479 *2C664E16CEAE097FE247E81C8540F95076732BCD 8july1582
438,330,480 *2C69646DDB5CC19670476A4A449E6B3FF6144C39 b?".4
438,330,481 *2C60B57431AFBD890AE14468FA27A1069ACA2F31 8##>.~o>B0
438,330,482 *2C64CB0DA68114A5069EBB5A83508DD521EDEB69 b4-f
438,330,483 *2C6DFCD9D0A6D91EA35FECFF2FA101185E63C50F 8spiriform
438,330,484 *2C6B7C57F7CE11C8928C27689541D2371686C006 1.spielbank-stadt
438,330,485 *2C67D8FEF21AADE643165EDFE89193C6FD85A23E bckwtrs1
438,330,486 *2C60C5033113806D5C21E5352E796E75B181C665 GARTHFICHTER
438,330,487 *2C6812F0264238549A8178353755BC4FFD53CCE7 1-TARKASTELUTILANTEEN
438,330,488 *2C668EF9646D4FC393BAA16529847241503CC4EF 9IMPLORATIONN
438,330,489 *2C637C26DECC1A821264337299EE2D3320F19992 [email protected]
438,330,490 *2C62D5E6833B2D434E28044D9E693C9487EA37D7 GECENSUREERDEN0
438,330,491 *2C64613869B29A0F82B82A4320C13C8BE4D2336A 1.UNWETTERARTIGEN
438,330,492 *2C68A988255430E804B09AEB98D534341EFC702B 1.USBRANCHENVERBAND
438,330,493 *2C6296938E02337A2F914A67D46F03B8AA1AB870 B;D$C
438,330,494 *2C674F8A97266FF0D0F998ADFA263CE983E8D72B 1.valitusmuurin
438,330,495 *2C60FD3AA5F1961B3CFCE16B2956D3AEA80055A7 bdraising
438,330,496 *2C65C341DBE10AA3A1A88E87F67FE90737DF0AA9 a0iq
438,330,497 *2C67B17422A23D6D087523213C01427FD7675557 BELLMORE
438,330,498 *2C63C6F114FFA959499CD29C8449FF727D373773 BENJAMIN GOODMAN
438,330,499 *2C6E2BCC8B61368681EBAE7A35F41D167D5F8C21 GERMANHIXON
438,330,500 *2C625EB3CE66C99E8AFB0DCF2CF2B13EB615BC10 a6
438,330,501 *2C6DB67EF5B8BE267942D768D4151CE856FDC6A0 gibson-dunn-used-legal-thuggery-say-montana-supremes
438,330,502 *2C69A07CD98F00E7523937B265CD643409B4AF57 A&8EL
438,330,503 *2C6F40DE2A8EAE21EE606D85B496711137392BB6 2134047 ihmiset.ovat.kehitt
438,330,504 *2C6D7ADE1984C5F10081CEF812250DC4F7E931A1 aaa8%]
438,330,505 *2C6BB6AC5F674DBD60FAFAEFB81B3A92B543273C GISING
438,330,506 *2C6DE439E25F02C0A5258B2234E209A668E57479 BETONIES
438,330,507 *2C650E692EE01A2A805EF1EBEA37CBA674FD2183 BFM86
438,330,508 *2C6F9979B14D2A1A915C3C4FB2DA597A56289DD8 bfw!5
438,330,509 *2C64B3E2A2C575148D4AA5B7A30293BE34A6A989 bh.h:
438,330,510 *2C68163DD6B4A0814F7C30AB170A0DE47A0FF105 gozzutied
438,330,511 *2C67BD505A747C0D63084976E89ADFA32273EB9C 28041709
438,330,512 *2C6E739AC350609E622B6B027E4B30E52416D465 AAPMENSEN
438,330,513 *2C66B336E7AE5BBAA1B79181F666E4A7A7346ED4 AARON.FOLLAND
438,330,514 *2C6CD91E9F1C15AEC7345412C8F773EB305173BE B%+IR
438,330,515 *2C6DC5BDC159AF3353A0F9BC9D7B46C9850D3F3C ABADIA-DE-SAINT-GENIS-DES-FONTAINES
438,330,516 *2C69DCAF12C842E5419382867AB6984F0E1E1BC3 gue$$7!m47e
438,330,517 *2C6E0ED047464B54DD6E69CFE7F88529681457C7 2FURSKIN
438,330,518 *2C6C7A5B0E4540BDB0512859D933CE5D4A662F31 BKLIG
438,330,519 *2C6B3681E8E98FEB91BD12F94C0B3BD351A7F2FA AB^O~
438,330,520 *2C612B044F574ED01295F7484B188F4BFB42E5C3 2MECINDI
438,330,521 *2C639DC892AC1334DDC293EC38D9D977F3AB6399 GYHPOPYHED
438,330,522 *2C66DF2CA0857E99518D2CFD6199CD701456710D ABUBAKARSHERIFF
438,330,523 *2C6583D23D566A0E921B5210A53DDF96D3067978 blue beat
438,330,524 *2C699D0FB2A1DB2371662E25C37CDE3CE47AFCD1 2XAVERIAN
438,330,525 *2C633DCB7A4AF78E6BDAEE63C55C704AFEF217AE AD%).
438,330,526 *2C6C739FBA058885A1EDCFBD748D95E55B6F2ADB 34459CC826EEF3448BE1F48B97CD5AFB RESIDENTEVIL
438,330,527 *2C6261B240E256F3EF89057367EDC2050AF514A7 HARLIVLEENKAUR
438,330,528 *2C61938FBF39711CEA773457C74BF20F57425AD0 HARRINGTON.WOULD
438,330,529 *2C676C1A19B369DD0A37175F32E8DC0BB793B26D 39 days, (number of castaways) people, one survivor!
438,330,530 *2C604B3890EAEC6292F7F327312DD9A323D9FBC6 add?d
438,330,531 *2C61A35B6875B0E582883201F16C57E30D8FBF40 3ATMOSPHE
438,330,532 *2C605B3DEA61D4893C175BA2CE65B3C6A758F031 3b<o~.<p
438,330,533 *2C61C72A572EF834ED2C4AB260DD3E3EF1030966 adkr/
438,330,534 *2C68130F675E7BF8229A7AEE6CF0FF54E882D286 H(*E
438,330,535 *2C61F9C3F80A4FC8F10965FB3B82FF3D1FD7938B healsomer1
438,330,536 *2C60EF20D7EA57FBCED172281F946F185A2C02EC 3FISHHOUN
438,330,537 *2C66A392FE9B7DAA963F7D21FAE1D9339528772A 3HPMAILEH
438,330,538 *2C630103A5D316E3E7438BCBA3603C0072C54CCD 3NENOPER
438,330,539 *2C63F7284046D162ADDB13F8B5F22908BFA2E3FD 3---> ~O)0(
438,330,540 *2C69B48C2D52A978D48363A1277A5B376C8ED9F3 HENGWENDY
438,330,541 *2C6B2E31C6DAA4AAAA3CEDCC2E334B5F141B2EF2 AEBGO
438,330,542 *2C6FA9A6D814E83189D8B91995A1DBA403CC2E40 hirampadalecki
438,330,543 *2C661355E03E73501D1ED2DFD0739AEBE73D64CE hisonics
438,330,544 *2C6C97D1288B5B176284862E58030ADDF49ECF3A historyjayron32talk
438,330,545 *2C6D4EB40C470EFA317229BA1EFC73D5D8B213E1 483KELLEN
438,330,546 *2C614616E77D9596E45365A5DA2769F511348D9E AfrahBaladi
438,330,547 *2C60ADFF452586A6DEE6B5868425313CAA546A84 HochwaldCowboy
438,330,548 *2C67246DFE67A0682983132715890DC736390749 4.FINNMINESIN
438,330,549 *2C6BE2F628B1FDEA57C1A7C737D1A6A07075F829 4GHALAMI
438,330,550 *2C6F4979CE54CE4820808B37DACA244195A0C687 BRADGALBRETH
438,330,551 *2C6ABEDD0A90E12C51D852D2F094E37B4EA6B9AA HONGCALVETTI
438,330,552 *2C6F6C2E5EB552D809DD1CC44E2A60BC3E4D7D5D BRADLY.MACARENO
438,330,553 *2C6AF59163E143FA1968AD191E3D6D8D7C384A5C BRDLME$
438,330,554 *2C6271A164A221AEC1373E95B84F16260D754610 hotspurs
438,330,555 *2C62C2AA37597677202ACD1C86EA87B77C6D931E h^s4
438,330,556 *2C6ECA0D38BA3A36498EBBC44AEE5007B47DBB83 AH47O
438,330,557 *2C68ACD1266E05488CB45A0613CF46241E80AF0C bricha.kouts
438,330,558 *2C6284B41D37F68AB6E37DA403A8EDC3503DC602 bridgespaladin
438,330,559 *2C637620BC4AAAEAD3754DD5FCDE3BA7EE9F6108 BRODERICK072
438,330,560 *2C655C64EA69975D6E933DA1B829A94C90D92E6D brogards7
438,330,561 *2C6B03887A326E736ED6715E1ED09289751DDF30 4SUPERNATIONALIST
438,330,562 *2C68B9BBCB4A2C65E6A08171F54B3954706474D6 BROTEX
438,330,563 *2C651A42DC6D41F51C1B133ECD847CA267FE4EB3 aḥruf
438,330,564 *2C655236C0920EE8653FE9176ACB1152961582CA HUSIENMOHAMMED
438,330,565 *2C620B5E108373DE6E003ECE03F8201609CC6441 [email protected]
438,330,566 *2C6A95AE2D8DB4240B2316FD2A0DA8E520413508 HYPERPER0
438,330,567 *2C687CCCE04CB02B8E8AD7EA500BA3688AEF20A9 [email protected]
438,330,568 *2C6AEF68C5B9F6FCD4285FB9D31DE7AEA48144AF IAMAVALON54
438,330,569 *2C6A2D0ACB2332303B58510B1F4DF9ABC96FCB76 5bottoms
438,330,570 *2C6B0D5FAC3E35EEEDA1826030FDC866366D739A bufordstenseth
438,330,571 *2C69F0243036797602DDA9816C8260C3A2D54126 IANDILALLA
438,330,572 *2C6F8347EC742EC766FF422D7DF49DDD15E69F3D IANKAWASAKI
438,330,573 *2C63E67D9C1F5989C8E143496CD2B4B1C320391B iaterced3
438,330,574 *2C6020DA7DFA7A84074DEB1D83E65AD36E6567C9 burlea.victor
438,330,575 *2C6ED95FF2B40E587B509544A1AC9FDE3742B0D0 5EIMILSUM
438,330,576 *2C66CD4A204688B79191192917F5E062CBCB3FF0 bursasporov
438,330,577 *2C62C74C61F111BAD9B4DA6E4BE0A14A5268CB15 busybusy
438,330,578 *2C693636ED4A2DD6510D4FB216DCA27C6AF82797 alexandra.schoolcraft
438,330,579 *2C6AE55E18B024E4528987CC046D8644FAE2FB88 5LYNNROSEBUD
438,330,580 *2C64A5E1D8942179CBDB9A374DF862ADE6AE4AA3 5oct1336
438,330,581 *2C65592F111C0A093EEE6A0753C03E341DD8D030 ilove.wes
438,330,582 *2C6EC6EE5512369C32B73FEC793AB194D6A15C68 5SIMOKSIK
438,330,583 *2C6E5C643B7D88DB066BCEB8CEF8D479181BE45D ALRERXH27
438,330,584 *2C65D17762928A188A5648F1BA822996D48B42CE ILUVZEPPLIN44
438,330,585 *2C6CF90BF98A1B96A1F745880F199CEF1FD03456 bznw$
438,330,586 *2C6A31F27C9934BB5BD13D9376442A523FE04244 c2jy?
438,330,587 *2C682DE0358286FD5FEFB7D2443ED6305E4BF27E 6AROBALLI
438,330,588 *2C6ADBF6DB6A09BB00780DF084AB0B335C93EE78 c3138r735
438,330,589 *2C6C28959C4F89DE470B7697C15B7590E0D83C4F INRESEKRAVEN
438,330,590 *2C6CD2D063299B005E3FB03354B3E5B8027C3D62 INTERIMSMARTGRIDROADMAPNISTRESTRUCTURE
438,330,591 *2C6F17082017BA80E95B6434D8425C0DF5A38D32 6DDELMOLL
438,330,592 *2C606F1E5F82B0CE34DAA5676903DB3152A12EA1 6DISSIONS
438,330,593 *2C6F06A71D4C9D3FCB24708D22D42B481A724B90 ANDERSON.NEREN
438,330,594 *2C6BEE85F18EFB58EA7147C93D771961943B0697 c7_dj
438,330,595 *2C66802D1CE8A87515283DDABE5BEEB787464AB7 6FRANCISOFASSISI
438,330,596 *2C6C8DD09EF7648ACECC5C7E5B15876217400F7B [email protected]
438,330,597 *2C631CE3382D6695C28FC8B302A75573807626DD IRVINGBUSIC
438,330,598 *2C665F01437C6F802E7A9024D5FEBF4EEA898021 CAIE1736
438,330,599 *2C64E32A2B3E009811EDEE2B346A41734B2C51D5 irwinpetrilla
438,330,600 *2C6F1D254908EB174BC2411CB2A33286362FF3D4 CALEB.MCCASTLE
438,330,601 *2C67909D497324B7005159A59A8DEA58B56C37B2 CAMBODIA(PAULOAKENFOLDREMIX)
438,330,602 *2C606D12048C4C3DB11EA601C1410AE4DD5D94A3 ISIDROMORTIMORE
438,330,603 *2C6118D99B4BCD3921E85DE573EFCC17D13AA103 candycoatedchild
438,330,604 *2C60F249FAA66A761D55CD80BDA4CCE4FCF1BB8A CAREY.FREDERICKS
438,330,605 *2C60C877C698E1131CEF81AF9B35FF871F740E8B 716457 kauden-nelj
438,330,606 *2C699C432E37BF2C541D681451044A5C7B8051FF 725522 for now , its preoccupation is politics
438,330,607 *2C6DEE96662F4011F1EED56404DB7EFCE40E2466 a"o.r
438,330,608 *2C679C0A18C9B6A62C3231E378F469267C6138C5 ap=36
438,330,609 *2C6363C71B322CE15CD390AFF427BB000280950C 771MARVIN
438,330,610 *2C61BC736A1497B82D30230D477D4C00D24C3582 CA.UH
438,330,611 *2C624FAA6FE2C5696DD0D8AEABCCDA30DF5FB47D JAMISONWEGWEISER
438,330,612 *2C660FD2EEB8021F1A38FC9CE0AE5666CE81B7DD AQDF$
438,330,613 *2C6C8D8F45055CC4AF466A0D0EE9A79ACB2D8DD6 JARRETT.FRUHLING
438,330,614 *2C6548B6DACA8A889529D64CE3A206C890C425C4 CCUROLOGYGROUP
438,330,615 *2C6C72086DAFC20E6265CFD1FC2D883E69290948 cc_wc
438,330,616 *2C6776081DD61238213A95568083FF5ECE4EA311 ceclio
438,330,617 *2C63A171790462F3BD28ED92BD1C56F81B589872 jaysonlecourt
438,330,618 *2C6385734080639B8F45CFD401D46010BC7AA713 7IAMTIGERS6
438,330,619 *2C64186912EA258C635A01ACB13190D64AD1DAB6 7ILOVESPAIN1
438,330,620 *2C6D4F9EFE0EC5AE63497F2B3196F9C8B2BF32F7 JEAN.LOUIS.PARADIS
438,330,621 *2C61DC3E884C7C764393B1A49DE20B3DD47E6B33 ARTNELLA0
438,330,622 *2C6514AA0D91C72291976C0F3E34D1E651432377 ASDFJASON5
438,330,623 *2C635F116D7D7079B8BD699A03390D96AC3A9948 jenelyn.bataller
438,330,624 *2C632F14F2C41A9EC066F87A0DF8286C8E2A40D4 A$SQK
438,330,625 *2C6D86A9FC781E392415B09403F6CE1FCE239995 JENNIFER.PROCK
438,330,626 *2C66EA0596E57CC08E6AB699BFDB03A4DDE0E061 [email protected]
438,330,627 *2C6356005861436B9EE4552444FA5DED2695A828 874nlwsul
438,330,628 *2C6182BC1873759A56CEA3CFA6A78A3406FBE9B2 [email protected]
438,330,629 *2C69E8B71DD956755BD78991CA08B0760378B2A2 JESS.TEMPLETON
438,330,630 *2C681EC2A63B4405ED7B4533C2486913543DB725 8BSWHINDORFF
438,330,631 *2C6909A27116F88036DF5155D85483EA59D5FA99 8BSWPATRICKVBSW
438,330,632 *2C6A32684D84DA2015A9D209FB4A31D1D7EB252A [email protected]
438,330,633 *2C61B07E6ED6C023804D4C380CF6D52924D7BE8B chaquete
438,330,634 *2C67B94805C6B76AD2070F803466F3F9CD910457 JIANELSONP
438,330,635 *2C686F8250EFA463E16E41452DEA16CFAE0C89DB [email protected]
438,330,636 *2C66DB7D4F77001614A3B0527B0AD16EB30A1D7A atms%
438,330,637 *2C6F43A220D5D4EC85E169AC102B5CA3F54E98D9 jill.webster
438,330,638 *2C61C61EFFD7847EA10BCE00DB742A308F0A75A5 chasebolnick
438,330,639 *2C67C4BDF4CCA0B1B4C3496384BCE63E8C931E56 at-the-green-desk
438,330,640 *2C62BFF11AE2F2C8E1188DEB5A22E3D43611A93D aubreyshreiner
438,330,641 *2C636709AC901EB267A5A671E8C8BE7703026FCC augustuskaer
438,330,642 *2C68F37C27AD060CF80C62923FA5580DA214DA72 AUPALAKKAL
438,330,643 *2C62A75093164BE502074B0F9E24F27A2021D4A1 8JVDCIEGXACQN
438,330,644 *2C68AD4363B5E128D23A9E0E1B5FEB768F3E7024 [email protected]
438,330,645 *2C60C4303450AAB6EBD5B6C7BE6CB0455713293B 8kitkattomasti
438,330,646 *2C6A5533057F5F94463EEF4E0180DAFBA7F142AA avhelkirin
438,330,647 *2C62148BE3334F8E7BF09F748B3F504EED17EEEF jonathanperl
438,330,648 *2C6885C09B7E281AA61A8553B3F7334067562280 8>~O.)8(
438,330,649 *2C6F50B66048B06C7FF094F5501FAE8FBD012141 chrisditto
438,330,650 *2C60EB16D0FCAEFD8003C09EC68C77B83F60C2EE JOSHYAWNCOMWWW
438,330,651 *2C6456445D9AA5F2008D99A3F266C037987A4ADB AWUFX
438,330,652 *2C65C134CCA4120C434E20E0B80597A7E99D9998 JULES.DEPP
438,330,653 *2C624FD4067FB40AE0D778B10FD7603FAB90A0BA AYTXQ
438,330,654 *2C64A160A79F3BBB5C7CFC4DC35662280AE75381 8SVAGEREBBE
438,330,655 *2C64952F007708602DE7F40E1F113D49EBFFCD4D AZ!A-
438,330,656 *2C681B746E36F20DF02AC3964F5E69C24D3D4341 jun02renegadesoundwav
438,330,657 *2C604ACDB43950ED01B1316D615721E18277EFA9 CICLOPE-DEMOLEDOR
438,330,658 *2C64DEF6EA5558ED0A13A0AD59A45D9ABAA64DCF JUST-EXPRESS
438,330,659 *2C64B30B253F695C61EB98A7E625D932DD9E6D62 B&0DI
438,330,660 *2C6EC15E6DAEAAE1DE27C17C03F71DC5D804790F C{#J
438,330,661 *2C61923D083E687B312BDDEE3213895FB457F798 CJ_LG
438,330,662 *2C65520447BD775D18906657340E122A1E7B0EDA b42af
438,330,663 *2C6E6476E5131BEA4BEA4C444B3153E3BD7D9F69 CKIVU
438,330,664 *2C69A0FD2B9762BC16F55001BA94F3D31BB23560 Bach---Mass-in-B-Minor-and-in-F-(disc-1)
438,330,665 *2C6D20445AF3781F808CFD7E99B8AC244DF148AA >kcin<-poed!->kcin<-po!-:002-level-kcin$-eciton
438,330,666 *2C6DFA21B7D348C98CB7ABA7373178C26C6E65B1 BAHF$
438,330,667 *2C63230BF4791123577EB0B5014B8E916D74F0CF KENDALL012
438,330,668 *2C6B33D652EF11EBF9A00E102B57CAC448F40384 9LOUISKNICKS
438,330,669 *2C680DEB1D2EA90E5E6DEEF68021D41B5972CA0B balw
438,330,670 *2C635621BBAAFB08D0EA02A7AED952553EC680A6 BANT3R1N9
438,330,671 *2C639CDC2E2698BBCBBBF916470A67ADA20F787A BARNEYKUBIC
438,330,672 *2C62E4255F2F0ACA5D4078216B3DA2F7EF06B1C9 KIB6995
438,330,673 *2C663A42403B1D8B405FF13A97B3441EA4A223CA b#bj9
438,330,674 *2C680EED9CDA38B08291E10FE74FC6874CBEEEF5 KINLEYSI9
438,330,675 *2C674E597638F27D2C238723342245006EF31D63 9UPSETDISARRAY
438,330,676 *2C6DFA396457F57F6C8123C1E6E9BD747950B2B1 COCINA THAI
438,330,677 *2C60A3C775D3855176FEE198BCB8B55415A8E396 |_?a
438,330,678 *2C65F96DC3F122FF82BE12F9347020A1CA6DA696 A0T4K
438,330,679 *2C6129AFF8EE2E97BAA88C1873D753BE7ADFAC24 koryclark
438,330,680 *2C67FE61A737E21737BB21482D298D91328B145E a2klu
438,330,681 *2C6468C3B6251AA6F78C937B3CD1233202052FAE A3H!2
438,330,682 *2C685F7A8B027E149538CB7F0BF495EF78244CEB CONCEPTS.TIPPT
438,330,683 *2C6FE85343ECB874FA1CC7698DCA5C1295EC7104 A4ZW/
438,330,684 *2C650BC4DADF617F2CD6EBD6DB6CD3035C50B8B4 a58qy
438,330,685 *2C65AC26F2487027AF1D5766ABC2A84036C9434E bengordan5
438,330,686 *2C6446F25AFA263767321267B43B6792D0598792 a720
438,330,687 *2C6A7D5F1E8EF1D0EFD2C5474871B2BAA52AB202 KYLEGUETIERREZ
438,330,688 *2C6B1F641D55D0EAB9BAB41735A72E7AC453111D KYLE.LAWLESS
438,330,689 *2C6D97B351D4448AB831474E92D3C268715E4F59 LAGRANMENTIRA
438,330,690 *2C63B487CECF5806472DF8619690B91693393C1A [email protected]=
438,330,691 *2C6161905B19FFAC491771B4982B4B2C513EEF53 LAUREN.SHULSE
438,330,692 *2C6C59C7BC9B65B948C7BE97F879B0D2D0957F90 LEAFROLLING
438,330,693 *2C6A2FA76E13E41BDD2F7AE1C8036F10105E5FFB bi&rl
438,330,694 *2C670E3CFA4C91FAF15CD64292932EAC238FAA97 BL'3
438,330,695 *2C67A1F5936816D30B718BEBEDDEEFF918308C47 leroyrouleau
438,330,696 *2C6DE459DCBAAEC8BD76C6CFCBB80268E89D189D ABEPRINCEVALLE
438,330,697 *2C69737D8C3758F1ECF5CC456FFF808C419E844C B:LVM
438,330,698 *2C69B7ED2CCCEE025476C306628882C09F114853 b---)~ ~o->-<
438,330,699 *2C664E14CB9EF5DE020CD3F65B6A5191758C82B8 BOBBIESEVERNS
438,330,700 *2C68D41A9FAEC8AF43687F1BAD42B9A65A8F55C0 leuchtfeuerstavoren
438,330,701 *2C60D7D08B9249FED94F7796D6164B452602869B AC1RQ
438,330,702 *2C6432C68D28955D799F82F3EDD3F3516BE910F0 accusatively0
438,330,703 *2C6CA31BD8C223D53384141653BD290E80695E69 [email protected]
438,330,704 *2C6517E7592342A5E69E40AF6C2E46CB3D015D9A boots40
438,330,705 *2C606E38E4FFEEDC9D351943E95035D42A0DAB3B b%ow
438,330,706 *2C6AFE3E99D63FA8F7ACD025C28AE574D2F6151F ad3b$
438,330,707 *2C6A404706628C1294E70BA930EF2B0F99768E34 crvn
438,330,708 *2C67A06ADCDD5E18496F62BCEF33D70B84EBAE9A AD(G
438,330,709 *2C6922D92E4186F88FDDAA1AAE140F0922428A03 ADV3RT!$3D
438,330,710 *2C6DBFBD5D7060F7891F53D91B608443531C92B2 brentonshimp
438,330,711 *2C6550CEE925DF33FFD207C4963FA94DA4DA3B22 living in harmony: p. resigns, is punched up
438,330,712 *2C6C7E10428359FB2A21E3958730CCA0005A1219 llu!
438,330,713 *2C64287613AFC90160ED705CC18954A119930EED c;$w#
438,330,714 *2C6D51A20CB9A9955A71B4F4E59F8897866B16B3 [email protected]
438,330,715 *2C6179AC5DC473A8AC64A88A0EAC5A0515406D1A cwl7?
438,330,716 *2C60B05EAEF8C534ED5C4D9BD0E0AA5E0ECED47E agraj
438,330,717 *2C6890085441AD0D191DED9483EA6E5EFFC71E5A C{YT
438,330,718 *2C6BC6D9C5FF7D69AF969739592DE90A462F65D9 [email protected]
438,330,719 *2C64B581BAC7CD218C60DB1B61F0F41893F1815D d14per1n9
438,330,720 *2C66B5F68C1F9C3EA833EE001ADE044173C375A1 lovingchild
438,330,721 *2C69E48661E4F06093F72B817DB44CF872EE320C AJ"?$
438,330,722 *2C6192E910D45D65792F0FEBBA3634D7AAD58BDC BUBBA1CREATIVE
438,330,723 *2C66C219CF8DECA2F2551AEAB80284688D12637A buddynavorro
438,330,724 *2C6F14DBE99B355AA3E95A0DFD13D718858F575D bv-
438,330,725 *2C617AB15E9489DC9EB9378658C5EB7DF66B8E39 DAHF5
438,330,726 *2C628731D9CDAD6101135C2B151043A31C81AE53 [email protected]
438,330,727 *2C6948C4D4CDE3C4C721A3EDC1411D3E6F0C930C dangerous madness
438,330,728 *2C66C785594D4598E7A2BEB0CB3E3E394DD0141D BY&N4
438,330,729 *2C6515D3D3F1F0A557FCCBB0967D263BE63CB8C5 ALH9H
438,330,730 *2C663880C369D3434B8C4CBAC92E8BB553A65833 danielledeihl
438,330,731 *2C68D668118C4AE4C4A89003B7C876190D98E108 DAREDEVILKUSTOMSCOMWWW
438,330,732 *2C6E1E30FA22E9B01265AB3C7D582A318D932502 c0<q
438,330,733 *2C6EF819BF158FEEF085A501261BF1407A53C046 c1dhf
438,330,734 *2C685532767FDEE0DBCC955E542A5604092BEC2A margaritoholtham
438,330,735 *2C66989E63BEBA172D2771450243C1C09A98C916 ambrosewortman
438,330,736 *2C6AE2585353119C02EC64283A41FE0D3E72F7B1 [email protected]
438,330,737 *2C62FA49372C0BA286EDAA2F3CD5807D09F85A58 C6P-6
438,330,738 *2C6F96024905919C6B8198A419A7B97EEC2E5768 AMOIVAIES9
438,330,739 *2C6FC05508B72E26DDB3CEBB722CD2CD5EF7CB96 DAWNHEMSWORTH
438,330,740 *2C6AFA951A0766512D74EF1CC578496472E4348C c9j(
438,330,741 *2C6388C1F6411BEBA82AE5BA9204F4298B719852 marquetry?
438,330,742 *2C6AC2743F520C38C4D09BF5227705311FA2198E MARTINL'P
438,330,743 *2C6E9FC525C2697FABB8DAD0AA716D886F0AA576 MARTYNWALKER
438,330,744 *2C6F34FE7042BF706C16E036547057E920470EA2 CANDYSTRIPEBSW
438,330,745 *2C64236F4C7BF0AD843E94BB4D4C95205ABB97A7 deanhaakinson
438,330,746 *2C6B34901989BE00F20665CE6A4E38C11D146578 CA\\\\'RON
438,330,747 *2C6582819F8713699A4B877290035CD6B66D7CA7 DECIECHI2
438,330,748 *2C6577C058B9CCB5D06F6D9EFEBB65D87C7197E7 deconstructingtheeternaltombs
438,330,749 *2C6023AC1B8B66D1804FD31207AC2090FFE7ED84 cartergaraventa
438,330,750 *2C6366F28B0070B42C226BF9AE5733E82DA75EB7 CATICPLAZA
438,330,751 *2C6F02BF22450CFCC71EC99F6DEDD3E3CA9DC5B8 [email protected]
438,330,752 *2C6B056AD070E791B16A6F765C405D64714C7BB9 CBFN
438,330,753 *2C641BB68C0CAE59819657FA79477B95B5EC880F degravesing
438,330,754 *2C6B8D5ECC7D510855D714ACC2BA17CF6A33B6A3 cdoerfert
438,330,755 *2C60286538780B2FF3EFF76DF08BD92C8B5E4C08 DEMOPÍSNÍ
438,330,756 *2C654B2EA4A067D9B9A93F0DEDFE94FD8B81FD49 demyth0l0g!z4t!0n5
438,330,757 *2C61F9D2ECEFFD4D71EA61A781ECE15E15300120 [email protected]
438,330,758 *2C640AD663639D56EF73AA16F9E7E2313319B465 centerfluffy
438,330,759 *2C6D7014CB81F5F68CFEBEB391021CE73F63B0B3 chaurika
438,330,760 *2C69CAF0FE77C626D9531035F13EDE04360750BE CHKTB
438,330,761 *2C666311AD8A0EF28AF3489EEDA4BA701F2F775D ARCSACROSSTHECITY
438,330,762 *2C66F5092D89F44E793892277D335DB0EA21D73B AR$EN0BI$
438,330,763 *2C6DEC74A65E75A6FE9B3D18DE4E810901F43F00 [email protected]
438,330,764 *2C6FD507C9DD2A02A76503399FCAEA7759331480 [email protected]
438,330,765 *2C65352FB6D464E2CC24C615F857108F8E5AD1B3 Arhive-1
438,330,766 *2C65BA56F5B1881EEF29D65A00D67B98F14BCDD0 chris.van.stelle
438,330,767 *2C66ADDEB06A3E83C41C75554F965279BC94ACAD C&I%9
438,330,768 *2C6147DB84547CC2437E63B1C25C344B039CD85D MKALCOVIAN
438,330,769 *2C6CAE0BAD7D51A4A885F9C5A4C518EABE90B143 ARUNKUMARCOIMBATORE'-'NEELAMBUR
438,330,770 *2C68FDE7EA428586006903E28942B5B78C7F16E0 MNTHDA1
438,330,771 *2C6550EC0B189AD07EAECB7C5B2C092F2B977BCE CJ4BH
438,330,772 *2C6FDB13DC58EC57F13A16A1D87717DECD51E531 dinesh.cp
438,330,773 *2C62347A1EB3C442A6CC5EC6338636B3BA977855 c(l?
438,330,774 *2C6DB6A63AA4C48A99B3E171599099FC3B0B8F53 ASSESSMENTWI
438,330,775 *2C65EE57034193C81361E51AF35880BFD81F3BCB MORRISDRIES
438,330,776 *2C6023042933B6E1CF9349D0E79F5FF8A3B922B0 dixie66
438,330,777 *2C6F19D1AEA41C62F074DD03DDBB3DDC8CBE82FB augustinedrenon
438,330,778 *2C642D9B5A436887A33CD0A4876A2ABE2A0ED023 MUSKMUSKED
438,330,779 *2C67593097C68276D9902A7A68F2BF3DAEC42AA6 CN%O=
438,330,780 *2C676F97A63AC9AC628FAA579480E2A0B2F7E0AB DNAMING
438,330,781 *2C6038B38B25BC4CFF4D31C7349311B9EF76696F colo.do.rio
438,330,782 *2C6EA26508E59B4619A8596D01CF0356B3BF961B DONNSTAGNARO
438,330,783 *2C66CCAD0F9BFE43BC58FBF2B094DF0BC5178C34 donovan.steyn
438,330,784 *2C6E35EB9C3710C1F6366D34D5EB87D0CFB73AF7 DONTE.HORRY
438,330,785 *2C6B41D5D70F152516B2F021462045EB9C1793FF DON'TMAKEHURTINGMEAHABIT
438,330,786 *2C6EC047B4A0347EBC4E9B6CA6CA32DDBF3F7717 b"=,$
438,330,787 *2C6BF5D7915D59BC988032596A58145BBD2E87CB DOUGLARTER
438,330,788 *2C6785B123DFF032CC0970FA486559357C3F4AE0 b1b11o7her4p1es
438,330,789 *2C69537E5B24952368282A288F5B943CB5C1A734 dp-,8
438,330,790 *2C69CB17C6F52F1398BD608A378BAF3D6DEFAF82 D=,PD
438,330,791 *2C6DF96BADFA959FDD7E5AB3F09801814353334F [email protected]
438,330,792 *2C6CA7D12B8875125DAEAFBAA5EF89F72E62645B NENERAMIREZ
438,330,793 *2C6B89BA65DD5FD5CA87377441B25AE64482B3CA NEOE
438,330,794 *2C64F37EF102B78D153BD600792878A1B72254A5 CpI:
438,330,795 *2C6846333C7FD490A749441CF094CB33DCE00D63 c:\programfiles\commonfiles\adobe\xmp\customfileinfopanels\20\panels\description\loc\description_ar_aedat
438,330,796 *2C66F108341B404A87AAAE5FE83FB05D50497CDF dscplns3
438,330,797 *2C6C42EC591B6F9A217754170FD65558F8B430D7 NICKOLASFRUM
438,330,798 *2C64B167B75C158F8EDA3B2E58527C8A40B3EFDC CQ4V/
438,330,799 *2C6A3499D49652FA215294EF658947EB14883D28 duderandy6
438,330,800 *2C6F8FB999C111BDF1843367A4EA72A083F8FE5B barrunta2
438,330,801 *2C681DC3D6E779C3C57EB0025ACAE664625BC9FD nikihcu1
438,330,802 *2C65F7DE11967513715BC38976779F5008FDEA7E CREATURE19
438,330,803 *2C6188E3C7E9321D10267C9F88B2A2750F659870 NOJBAAAAMAAJ
438,330,804 *2C6EE594A706108D071A30BE16E9703F69B9D944 NORBERTMIRAFUENTES
438,330,805 *2C66CBF2E073511462006B21DFB379CD3369A3EA DWF8V
438,330,806 *2C6EA3FF345622C9CACE587C9B94C5CAA44C512A B.D"P
438,330,807 *2C633F08EC934971C46E3230D3942411E083D915 BE;BM
438,330,808 *2C66F64D04B87570094E7476AE1D871FD410FE47 CURTCAVENDISH
438,330,809 *2C68BDF08BEFF6A02588C2F54F5C5373023A3DC7 benniehank
438,330,810 *2C68939FF0422ADE833364845500E7DE8820A6F7 c(wy6
438,330,811 *2C67596176D5D8FAD494EAE7CBDB6A69D5DC4898 CZEREPY
438,330,812 *2C6782754B74D033C41C7C3954C0B7492F01C2A6 BETONIES
438,330,813 *2C626D2284A29F29ED6C3CCFD9E1FAB63BDEC279 BEUDOIN7
438,330,814 *2C6CC7A134ADDC537C209C8D1D734FAD1B7C25EC OLLIE.KORENEK
438,330,815 *2C6F4BAED8D7F085BA8EC2BD98FF9E11ED82CF5B OLLIEPOLOSKY
438,330,816 *2C6596FEBF87DAC4DF31AA15A93763F1DB13B3A2 omaakihba
438,330,817 *2C6293D56EC97D703189AFC2C1B61589D8651D07 BFHQR
438,330,818 *2C694C22696C002A7D3AC1BBD6EE37C38725C4D6 one-tree-hill-who-should-lucas
438,330,819 *2C68D43737A8D7C109D17F33E1929D39309226EC efdespel1
438,330,820 *2C6E7DF7F4DF40E61BC8DED3EFE488B82728FF95 d5jff
438,330,821 *2C69821A8BE44A36CAE81B229F11E21321D5DCB1 efrenfallaw
438,330,822 *2C6862951EDE3338E53602A42908E0AFE893456C D7LUK
438,330,823 *2C62389FBBCAB9E10F577CB2B9ACD5B1125E8399 egkaloysing
438,330,824 *2C6BB38EE23C0893FF120BA937244BEC0A6C1556 bhr)t
438,330,825 *2C6FC3C434E4D1E80B49BE78B1D1FE3F0D71999C ORG4NIC411Y
438,330,826 *2C63A2DA080AB64ED0FE3FA36A61688396A712CD DAL&:
438,330,827 *2C619B1C3209CD862BB789C257261CB44434C07E EIMATAANED
438,330,828 *2C639C9874A27937EDDD835721B6249360FB75FA orvosra
438,330,829 *2C6C533A3727A7127CBBB5521E8500D5B962B879 EINZELGRENZWERT
438,330,830 *2C61AB4234E2A219FA571CA6BED5BD52EB35C5B3 OSEGA
438,330,831 *2C664F9A55C3100053A5E7499F94E66D534158EE O-Tannenbaum-(Large-Kalliope-With-Bells)
438,330,832 *2C6F89788E40999431B92E828D69D63C7492EA10 DANESILSBEE
438,330,833 *2C6BE1C9F1E89EC122D3C998036FB34E24ADBC18 danpa
438,330,834 *2C6BB85C64D8EB6C3F7794F36FDE4A4332644CC3 D-AT1
438,330,835 *2C6CF7662FD6E067730D70CADC9C25244B68E0F8 blov
438,330,836 *2C634352654BEF5ABDCC0A1D6718A0255DD3639D emileflewelling
438,330,837 *2C66EA11B910D0D77ECD33E83C261C3E9536BF70 bobby-mcclanahan
438,330,838 *2C69EBCCB50CFB6A7919AE7A22C59F04477A9910 BOEGSLAG3
438,330,839 *2C6BDDF5C951AC74CD078A8D780C40B44E4FED3E DCS8K
438,330,840 *2C64DB724E8311E961BDF4FD7F68179348FEE7C5 BO(NL
438,330,841 *2C63FFB096286566D81D4A5D3006BF928C4D2108 [email protected]
438,330,842 *2C631FAFC7BE62382039E07B75551F798EAE798E de0me
438,330,843 *2C6D73697058D40D6834DCE1002C26FEAA7CF6BA en[s
438,330,844 *2C6500DC7260E66519742FE7A1D6D64BEC0C42FE DEEP-LAID-'D/I/P'L/EI/D
438,330,845 *2C6A14F8DEBE4243327C5F82377DA54636262DE5 ergotic
438,330,846 *2C619269DD910FC033F941E35E850A7233806891 ERIK.MANGINI
438,330,847 *2C689C01F5A4399066A96E2247CF42C49D7F5E41 ernestrodarte
438,330,848 *2C618C6BA4782E7348D3BCC0CC2F0659338B0372 dennisstauffer
438,330,849 *2C6261695F8D5881C1BDBEC95089B1E7701CE1FC BRENDONKIRKPATRIC
438,330,850 *2C6E23ACE0B428E98CA1BCA0D49F710C796DBCF3 BRETT50
438,330,851 *2C6E3724B70A95C0858545FD26C319E01AF9DA80 ERVINCHIMENTI
438,330,852 *2C661393929F434AC98A7C903F3C2E358AFCA80B DERDEPP
438,330,853 *2C6A61E702D4D11F09315F5D40D04A9D8DBB917B DER ZAUBERER VON OZ
438,330,854 *2C6F956874AFF52C740F3F8A394BDD5FE8FB1B08 [email protected]
438,330,855 *2C63F81E28404CD85D989F89929A9CC4341B4079 ET40U
438,330,856 *2C6F1CE898EB9CA0BDA75D47D32E388585B4F2B6 PLNTHRN8
438,330,857 *2C6CA30232B7334489130E328DD401212649F756 PODKREŚLIŁ
438,330,858 *2C65B9BF899803437047E48C15F2DDCD90CF70FD bsfr
438,330,859 *2C65C72806E1B1EFE6D32717A68C6EF108D3DDF7 BSNSM
438,330,860 *2C6C4A63F48A62D356D286D779BD3E5CCABE2FAD <p> on saturday, may 24, 1997, according to ms lewinsky, the
438,330,861 *2C6B1536E689C0E10F88ABE3154C572474BD06FB BSw.
438,330,862 *2C665F2B9C4DA9F207036857A85332033FD756BF dg_fw
438,330,863 *2C6AE0BB3529AD144677A3E89C92A2B61AEB8F31 BTI2G
438,330,864 *2C68BF6EE4E37655B249B93CB073926000FE62CE pp`~`~}x{
438,330,865 *2C6D765AF86072E85DBB761CEEFA20AD14CF9BBC BURTON.HOUSEN
438,330,866 *2C6402D573E191D0DFDD1E2CB99B5972647AEA6A [email protected]+Y
438,330,867 *2C6233756D75EFAA9C535AF4E1B74C102F655F95 FACULTYPARASITES
438,330,868 *2C62B414B078728A09196C91C95726E5F225F297 B)V0)
438,330,869 *2C6F46C4B7A7ADA3E8CCFCF6B65DE573144EFB1A PRATICA55I
438,330,870 *2C63386719184E2EE958EB54FEE6FA78A28D4770 BVKARANTH
438,330,871 *2C61BF78C35CFBD9F65F386C9E67E73959F2E493 BYW_M
438,330,872 *2C64F4044504C2ADFC4D668ED9320FEED78427A2 c+)0$
438,330,873 *2C68E4428B7C8083AC2110AE5E1A88375331D0D2 prospereert1
438,330,874 *2C618F629D257D4069D1770E16FF0591121EF133 C0N$01ATR
438,330,875 *2C6A79F456321A68C0C6BC3E0CE7773FDBB70D9D PRZYJĘTYM
438,330,876 *2C6C0EE4F49F250C68F2FE85E75BF1C3FF8E1188 DMP2V
438,330,877 *2C697A79F6A991076592E89D0B4B46352A90F8F9 c%2g
438,330,878 *2C69635A14F407C02BC2E6EDD1C2AB0803FDD9D8 C6!CG
438,330,879 *2C654F0B711331B6988D1EDFAFDB8CD300A14935 [email protected]
438,330,880 *2C6382B861575224BF1F3F1A7D5AE40447036B97 C9H!D
438,330,881 *2C6C59DBF5F9A80EEA172C8526A067CBF8DEB860 FIEFFAL0
438,330,882 *2C6A7B1F59592FBE96F80ADB476890230C74BC75 CAC,Q
438,330,883 *2C692472937BA20C2624827B271F81656BED14AB DOPH$
438,330,884 *2C6D0390BD774E002FAC1FFE337B90CA770ED0CC queenese2
438,330,885 *2C69CC778C229973179998A82BF5945128BAA570 QUINN.KEAGLE
438,330,886 *2C63CE58D947316C005FD687272171C9FF7C4660 FLOEPTE9
438,330,887 *2C6892232221B15A67B50F6C3FFD91A93C3033F8 CAREY.ERICKSON
438,330,888 *2C69BE16A1C745B17195DC6382E324AB399BC3C5 CARLO.CENTANNI
438,330,889 *2C6688D29C983C65358FF792221445C5847455F2 CARLO.RINARD
438,330,890 *2C6346D78AA03178044F435BC19C16FF82FA9C06 CARMELOLANSBERG
438,330,891 *2C63FBD3D927DE8D862693058B91F10E6D06B66F RACCOUPLIEZ
438,330,892 *2C6D3AAF419F80D8A25E3D8B717B09050A93D6B7 carrollescano
438,330,893 *2C6A2B3953DA2A3664E6BBC717B6597B6AC207BD RACLIEZ
438,330,894 *2C65234E14110DE5235B234C23BC0BC27DAF7366 FORESTTEARE
438,330,895 *2C69F1C9DA4C75822B9CC67B38C8608157FD8173 d)sph
438,330,896 *2C6C03B990F0A6F3AE3BE8BE40BC71056686EDA9 CARTER.NAPOLEON
438,330,897 *2C60C9EA5625843135DC656DC01CB307B556EF0A dtkm+
438,330,898 *2C67F9A7D28386967B4C2E12143B4CC0A771DDAA RANDALSTEFFEE
438,330,899 *2C6F481BB3E86AB487A8769D5E8EFF7E4E2FF558 CCG6
438,330,900 *2C6B95C445A1BE648C1BC670141F4B2E61CEC97A [email protected]
438,330,901 *2C67E2A2A4C759792191F25D337F20C5D30A1182 RASHID12
438,330,902 *2C6D98BF6A41D1AEDBE6B585BEC64C870B40FB28 CDKD6
438,330,903 *2C6A8865A981D20D75AD461C503BA117D3DC4F6F RAY.SCHWEERS
438,330,904 *2C619F60F02B98D2DFC1337FE5113E8BDCE040AA [email protected]
438,330,905 *2C68407768C47797C01FDB8D4058C611A8057D4E fredrickover
438,330,906 *2C67149A14C994C50307FE1F4DD397C798C6E1B3 ÇERKESLERININ
438,330,907 *2C67D78CBDC39D1B2A0D2EB0FDCB2FC5EA400E9A cf3e+
438,330,908 *2C6D4B3654EF81F6231D2840017C1941FBD8BF10 REDECORÓ
438,330,909 *2C63E20FD1395D143D8648640C74A69B22958F38 cfb.r
438,330,910 *2C63C629224249BC701514C03CBE9FE545BB8023 DZU?$
438,330,911 *2C6BB79781F560179018BEFE954B06A178889C02 GAIL.RIESNER
438,330,912 *2C61182C3069D295205A6A4AE6FD809BD16FAE70 e8821048792461
438,330,913 *2C62BB66E34EEA9D34F261692DA6091B195ACFC6 REMPORTEZ5
438,330,914 *2C6CAF55F07A8BA12F260EF0B9DBEF3F6C507731 [email protected]
438,330,915 *2C60B429FC3F4251B1FE4419BF2DA4F8DBA5C77D EBvw
438,330,916 *2C6E9E5A44987CB3E33C4A246E178FC501ED7F6E eddydost
438,330,917 *2C611253A377E6DBF69E7ED5F7251E7F73250CF5 REPEALTHEEHOMEAGAINS
438,330,918 *2C65522B0AAC39F9F6271832113A315D990FBB76 REPUBLICANSWEIGHCALENDARCHA
438,330,919 *2C6B8DD86350376C7F2B0FC954FDDA61031C31B9 chaudry321
438,330,920 *2C62D2B33F3B27CF0F60B7CC2CFB702740B0FE93 geeuwhonger
438,330,921 *2C6255AC5A88B5BC774FABC95E6F4DFF516AF7DA GEOFFREY.STREB
438,330,922 *2C6033FB9920712D8B4FB071F984005E224A32AA einkaufsf
438,330,923 *2C642F52623C5EA8F1943D3E6CE073128AE429BB chlrfrmsm
438,330,924 *2C6F4E2190761D67AF30A4AA42CDBAF01439EE6F chojyu
438,330,925 *2C63602E94A306E816E2586191413B626E915BC7 RICARDO.VOGUS
438,330,926 *2C6DE461A3F0DC1C705C864FEB45FFF5BDCCE22D richard-gutierrez-and-marian-rivera-thrill-fans-in-my-bfgf
438,330,927 *2C67B7C4FAFCF60EA0BEE6F2F98FE905B9865847 CHRISTOPHER.POULSEN
438,330,928 *2C6575154A0658BB0E49682220EB1F60291A2110 RICKY.MCCLELLAN
438,330,929 *2C60C640191343552D2B1A22A3458CF758BDBB25 GHANAIANSPANISH
438,330,930 *2C6F754150AF507FE95AFFB1A8DA796EC0A17F4A RIDICULISMUS
438,330,931 *2C6F99D6420616BABC602D44965C3F2E4ED31853 [email protected]
438,330,932 *2C6B1D0F13BAA88B8461EE9DC55E51E7314AB9E8 CHUWG
438,330,933 *2C6F002147A6F980E947A3E80800B3BF0FC3ADD5 ROBERT.ARNESON
438,330,934 *2C69BF14F3C69DCFE10157BCD66213DA5674055E ELVIS.ROSEL
438,330,935 *2C6CCEDEC1BA4130B09E5CBFC152922FB9491010 CIMENTERENT?
438,330,936 *2C6D53E8242D147769FC25D65EF0E505FD7B9F68 RODNEYPRECHTEL
438,330,937 *2C6743B98A7EA79184878B1E9675DCBEDC02596F civilizacion.caralsupe
438,330,938 *2C67175DF12E168EDE020580F29743C146064F0F roger-avalos
438,330,939 *2C6F391BF37DA344AB3BEE2D6D80FC7661BECD98 GNINBDMO6
438,330,940 *2C6EDBA4F0F8304150A669B56773326B317073A1 gnitroped3
438,330,941 *2C6715CC8B5D1AC65EB6C24251A1BB002507AE2E RONALD.HOUCHEN
438,330,942 *2C61C5F90B9C0D7DE4AF09D8BD707F617109BE41 ENDAVID_HASLAM
438,330,943 *2C6DC5BE5819FBECB9CE4856492AE2D35C96B936 ronnyfulkerson
438,330,944 *2C622F6B60FB148474FF8D7D65598CEB0AF60979 ENERGIASZINTEKET
438,330,945 *2C69392655E9213AF34BF0033FADA72EDFC4A58D CLAIRE.MCCULLOUGH
438,330,946 *2C6DA1A60A01C96B940F3B2DD4910B8D9FCE3A96 Engel.Weinen.Heimlich
438,330,947 *2C671AE51B6C9B56A2B2FC1E28A09BE7D19223EE rtcaaa
438,330,948 *2C6672CF10480639976C16E92C8338527F57C504 RUBAIYATAFGHANS205
438,330,949 *2C68479B80F0D61D2812297B315C2C6C68B34AC9 RUBENRYLANT
438,330,950 *2C6700D1E9F31229085A22ED8F90332A0B1982C5 ep8rb
438,330,951 *2C6C9476189AD16D4E640567342DB83185178095 GRAJATADING
438,330,952 *2C683918CA2E0FAB29189AB91CB50D84E8B0CB71 GRANADIGLIA
438,330,953 *2C6A0D84E4419CE216692A34EBA76F1770EFAAC0 rumour-said-fire
438,330,954 *2C6011C047745EA896E64D81C0182DC529804FD8 rus71ng
438,330,955 *2C6D21A1BBFEBB7C75781B6D5BE18AEC7EF7E099 eraicsaf
438,330,956 *2C6BDC75C5C8251651CD82008E80FA605BC2DB09 cnudn
438,330,957 *2C60AD2A15F989544AC2D064DA64871FCC0D1AAA coami
438,330,958 *2C64A9FB5C243D8B6B14163D0504BE1991958808 SAHAGEN2
438,330,959 *2C633DDCEEEDABBF209AA1E3E8A7F2617211F852 GUSTAVO.TOREY
438,330,960 *2C6C71729196577F8EF7A103B6923DE571809BD2 ES_FH
438,330,961 *2C681C0FD5418A14C85387C0EF19C01F64E79B9D SAMPIGNY6
438,330,962 *2C65CA7142644F856607B8D24C391DA3DE558A82 commonlop
438,330,963 *2C624652585FB34CB2D922810E5541A067DD561F comrade1921
438,330,964 *2C676FA49C3208031973E28559F6D2E1FF337305 EUARISTO4
438,330,965 *2C6E263A4E9B7397CB63FC85FCFE45C060C91423 HANNAA HAMED
438,330,966 *2C6C030078E8AB19CDDBAF0679903E1387408121 [email protected]
438,330,967 *2C67000F76C519A127E7C55A2A717FEF09A4A1E9 EVERBRUGS
438,330,968 *2C68B8B0D47DC056E977019F8E58460F5B9A3E73 everything(that'smine)
438,330,969 *2C6FEEF1FB61AF40AE591F4824E90367F11C7F0C [email protected]
438,330,970 *2C60C74344EB189764FD2D234D282F53040D3017 COYLOEHNER
438,330,971 *2C6BE50FFC9D93E82AD70037BFED9495A54BC01C schaikseweg
438,330,972 *2C6811309F31A2869DE5E0FD1AEB2248D16C4AE5 scotsickmeir
438,330,973 *2C62A9613EEC0DC78EE10EED02DE1DECC3875394 SCOTTGEPHART
438,330,974 *2C6C31AD5DE19D2400B78434ECF29DFA290141FE SCOTTVILLINES
438,330,975 *2C68AE985B68ED872EDF4649770A7742DED9E97B HEMEL-NR.-7
438,330,976 *2C63D66305D2B195B49809B02A49E8BE89290B2C SDNEIRFYRAUNAJ
438,330,977 *2C65CAD6CE8902E1C1AE4BFC4602951FE5C19919 HERE-ARE-STILL-MORE-WORDS
438,330,978 *2C6308BA4CC72F8D04FE5C08D3B92F3A1805B4F6 HERKISTMN5
438,330,979 *2C6A00D3FFBA334179C17D0B90BA51EF7FFCA155 HERMAFRODITICE
438,330,980 *2C6B4FCB0D620E68BDD143B837522921E9A86959 FEATURESDREAMGUY
438,330,981 *2C6B8D513988ED2998A9A50C285B716B49AE0993 SENOBKAE1
438,330,982 *2C654E95F7AFFB8B7BE1AA57C05B9C242327CD6D ferdinandlittrel
438,330,983 *2C674A65594CF903F87224E304ACDCF689C99C32 CRIS_DEFS_ASMH
438,330,984 *2C6C6B19898CFCFCBA7512E4C73C9DCC98B62BA1 ferraribuck
438,330,985 *2C631D96BCD3AE496DD50E1C9534300E20ED85FD SETSUARBBING
438,330,986 *2C68AA9D2270C69F447BB271A44C05E617DAE0DD setubirtnoc
438,330,987 *2C68E9D1973AEFA2D9E47EE28F8029F0211233B3 CRYOEVEN
438,330,988 *2C60DE56EB20A7D6D7998268169E6611AEB9583D hkdk
438,330,989 *2C632CC073FEFFB9A1300FA98A762BBEB57E7E63 c%sr
438,330,990 *2C6585A97B46D78E9B12B2C67915DDE34A77DFA5 SHAKIR-KAZI
438,330,991 *2C6EAFB71027742C15EA79EAF6A430DBA5DBD931 ctlf
438,330,992 *2C6C2DD04F0AA9A15A78B16D2FB274E858AFED4A HOMER.MARTINSEN
438,330,993 *2C6CB06AE074C21AAB9B0B200AD1DE97C228ED9D FLOAT91
438,330,994 *2C625837E61F5D154D2B5F13E935E0BD70B0C1F0 hoosmaned
438,330,995 *2C6DB40BFDF898A42F7D7D4740BADA83E29B5F6D hotspurs
438,330,996 *2C602260B83D701BE45D1B64F15A71926F1E4464 SHEUCH7
438,330,997 *2C682147C3B0A35346A05F0971D92E4FBDE1CE42 shiowibbs
438,330,998 *2C618486FB7F7E0D7A3C4F5497B6451807836049 [email protected]
438,330,999 *2C66588D287A792778477FE33586BB5A6E1FF60B SHIRLEYGEMMEN
438,331,000 *2C66D22E3F2136AF04F8FBC39D9988652CB8A315 form.a.line
438,331,001 *2C6C43F4C6464A4AF7EAD2747B7A341E76AFAA15 c:\windows\fonts\schlbkbttf
438,331,002 *2C61D360C4A3487889D10840180164A8B480A794 SHORTDAMAGEDDEAD5
438,331,003 *2C68EB47F871F08580EB5EB58E620AF3CE419ECD HRDLJVGHD1
438,331,004 *2C6DC0CA9B89C61CE144E62CF6D9E93EAED8B176 SHOTGUNKATHY
438,331,005 *2C621534055A1547E131A2BC415D1F74049C3F3C CWY9O
438,331,006 *2C6C3003D283706D16879E72B1D08FA5EEDA2C2A CYGX
438,331,007 *2C6F818356D576C6BA55298628450B36A630898F HTTPWWWWORLDMASTER
438,331,008 *2C676998A885D6CFD5E61E2D8E4520339A29DC29 ŠIKIŠIMA
438,331,009 *2C6C98944663874C3FD68FA0C2D0D35DEAFDA92F SILABEOSED
438,331,010 *2C61ED5C1A27046851373EFE583539F86476E9D4 FRATERNIZABAS
438,331,011 *2C6519FA11BD1EBBE37ADD855AE45193101C50CB huddrounsed
438,331,012 *2C6D4806AD803F94A71BAC956516DB22E2A6DD40 FREDRIC.DUFFIE
438,331,013 *2C6733CA940B2D6B893BE62D08EAC0B3EB8A185D HUNKY
438,331,014 *2C665BD731F8109F01C03D28FD37CC73D79EC611 FRENCHIE’S
438,331,015 *2C64B7948A16A57E36468B1D85AA3F7121AC3194 [email protected]
438,331,016 *2C62A71261C2A44372B9065212EA8B4D92A00B87 SKIPPYDUCKIE1
438,331,017 *2C6F50EDE7B08AC4600B4D84BB03577AD0CF222A hwlln
438,331,018 *2C6920FD8530572649ED5A38E0F2D0DCD950E01B FSGT
438,331,019 *2C68F59D1F2642DE313D5B7AC693BD854F147C89 slicha--excuseme
438,331,020 *2C6C72B0A4A373F796177B4966E9805E8FC2DBF9 d4uvt
438,331,021 *2C6348ACFD5D964DE5379378127B6C1001A200CB i0m
438,331,022 *2C6D223320CCF60E9D617D79F2F062D1D737BECF D=6b
438,331,023 *2C6A563D501CFC1A36E3EFCC27CF8E03E480D72E GAFEAZA
438,331,024 *2C68AF2D20FEDDC94CD2D357A3F829F35D37E5F9 ICHORS
438,331,025 *2C61880B0103209F8CC41D10E9A6029823FEDEDE DANE.SELSOR
438,331,026 *2C663E5F07E38C991ADAC810AA9166FFA032978A i-go-(feat-kim-thayil)
438,331,027 *2C69D77294A2C10EEDBD6041436974D2CA6234BF IGRENSEN4
438,331,028 *2C61B4003697DC05FAFF7DF2D54EE86FE8F110EB SORNSSNROS4
438,331,029 *2C6D7CA413C5F2197F76C35E12A80B2CC0B445A2 IKEKANEMOTO
438,331,030 *2C6C6383876712DE222C4AB4B0E28E5D43E5CE5B GBROV
438,331,031 *2C6CA89DD7180C989D5F61DCA1B2AC8F09354417 ILFE
438,331,032 *2C6081D18061F45D0E6DBCD6008E4741C23A346A SPECIALARBEJDERSKOLE
438,331,033 *2C657BB411645364438B43B565C30DFC1027972A spkhkernes
438,331,034 *2C60F20E5A42B66BE8D2B5477A1F97F93F95AFB7 daugharty6
438,331,035 *2C69B384FA211FA3B2B88411A27243E9078D340E iluvservices30
438,331,036 *2C6C5ACA57E94FD020574101AA7529BB1701DA53 ingam.2
438,331,037 *2C6C2AE29379C119A5F805454B0CA1CEA5784295 INOCULAT-12
438,331,038 *2C60BB012A1C7E28052A43393B1E38C2E19A0AF9 gnitlupa5
438,331,039 *2C6B416E6A98544BFCE1025A0C2D510B2F6BA0BA [email protected]
438,331,040 *2C678D553B040343CCF1BFB405A943BDC667A8BF sradhabus
438,331,041 *2C65CD82CB476743B6A63F7DFED4B52C19162566 GOLFS
438,331,042 *2C681153B961FC54AA75A4B46BA56AB75FF584E8 GORDON.KHOUNBORINE
438,331,043 *2C69139B03DDD3A9EFF50886319B6A75186BFE64 delmerprial
438,331,044 *2C64B3FFCAE22BB733A9EB8F6E0446BCE49CBB06 demetriuscumberledge
438,331,045 *2C61A4ED24CBFBDDEA84BB8513BA8F01269F31E0 grischenco
438,331,046 *2C6B6F19620B3BFB80A3F7B9FF5DDB33AD888144 STEPHANBIERKORTTE
438,331,047 *2C6E855BFE7F6D8DFC2C8329BEED134FC3163130 stephenwarman
438,331,048 *2C656B37416223006D1FBDC13431A4D9F2C39365 GUILMANT:.MARCH.UPON.HANDEL'S.LIFT.UP.YOUR.HEADS
438,331,049 *2C678A2CFC7BD2C09856FCC7FA84DED639DDFDF2 STINKYJAGUAR5
438,331,050 *2C637AB2AD01E3C1EC6FB1128100CC4D8FDCB16F gvngngnmn9
438,331,051 *2C60A9291C47A53CAC87B8D3D1DDC6342F0B537A hannahmontanafan
438,331,052 *2C61F56F165A13B1742A86EE7BB215D893C03F62 harlandarrick
438,331,053 *2C6492B5FD46FD7FEE63326CDBAF055308BD438A JACKMANNINGBANCROFT
438,331,054 *2C67506B9460C2B063F21FB4BD0CB6544BCF1DD3 harrisonmartowski
438,331,055 *2C6D6CEEF22199CF8AA417D78191C5A87A799971 jacquesburkitt
438,331,056 *2C6D9A92F188B351BCF0ED9FDB54106D0EAD251F Hatch77
438,331,057 *2C6E351A8400A6206428BF66B7AC60A0B9A1A077 JAJZYDIED
438,331,058 *2C6FF0A52F72AD678C2264771E3E390F407EC31F jakerosenau
438,331,059 *2C6E3B35CCD3E60083DDBC763E0233BBE545E8C9 +HE0AN+HR0P0M0RPHISM
438,331,060 *2C604362216AE8ECC62F3E0C9B5558F548BC48EC SUSIE-CORNELL
438,331,061 *2C6F9E2E7C9EE11760A58DDC79B524B88D39863D JAMEL.BRACHT
438,331,062 *2C6FC049424FF82498AEACD66DD27B1563D0D84D DINI-KOSOVA
438,331,063 *2C6F180A0CAFB63EABE9379C7B8AFCC3D2123541 heliocentric-pantheon-interview-with
438,331,064 *2C6A979443724814A2476C9A663F324E4CFD154E jaredwedeking
438,331,065 *2C6E4A64E2486A1E9827C929EF2E813B9E306415 jarrodeppich
438,331,066 *2C69CC68F9ECC6C4A891AB7FC11F80FD03A6E3BA HENRIEMILE
438,331,067 *2C68842C840DCA28BC76DF730CD4AA7CA7A728F3 dix2h
438,331,068 *2C698E7A39F867A75135C90508BF90B8E33CC395 JASONWANTA
438,331,069 *2C6D788D23A8C16CCEDE6DA8B63C965A82B97DC6 DJUHAS
438,331,070 *2C6A3DA263A022E5191B6F20CCED6638D43EB6BF d%k24
438,331,071 *2C629B7D02344BA4939910181873C07CD3A20517 T3NMINUT3
438,331,072 *2C62E5FCCF514DB923BB4F8707A7BC6860DF4B34 dkblade1
438,331,073 *2C6E401D1D8750F7E84CB4D4FD7F373124D13AA1 hiramyankovich
438,331,074 *2C62ABD7C8227D16E91C4BCE4D31DA0F6A724FB0 jeanna.morris
438,331,075 *2C6334D18DC88A0AA62D204116F32206B93B1680 TANGLELE9
438,331,076 *2C689066F7A0DEE1B44E22FA63938E3FA587F210 JEFFERY.HALBERG
438,331,077 *2C6C4FB1F97F49AA3F784CB80C25B72855AF51A5 [email protected]
438,331,078 *2C6803AF7DD0E50FC541B8D61577965DF101A3C9 DNj/
438,331,079 *2C650658CA6973770265A592CA6FBBFA190B4BD9 jessecalabretta
438,331,080 *2C6600C206BD2F7BF88CAF14FDEA798F8F4B04FD JESSIEDOWDY
438,331,081 *2C6733D1B84CBD62E9D82A68A6087B8A882DE1EE donovanburks
438,331,082 *2C6DF8CB625CC96DA22E2049B7CDC5350484175D hsiatuhs5
438,331,083 *2C6B75738F8218197A55A81F75B27E05BEF7F623 DORSEYOLESNEVICH
438,331,084 *2C6D5985BE098C95A4DCD185D33F9D2879A1CECA J[IG
438,331,085 *2C6D3C472636D90B81733DACB29143EC744A329F jimmyblas
438,331,086 *2C6B7CE193B6CC9E5D34D99C7B1043A3528FB733 TERATLOGAS
438,331,087 *2C653E893870A662821C73898AAACCF50CD0BD9C TERDECKE3
438,331,088 *2C60B2222685B840B72A53FB0E3B8813C0D70E70 HUISKAMERCONCERTEN
438,331,089 *2C610BD545D0EA9831AD093D91A670941071D673 johnsonschadt
438,331,090 *2C691706B77389313E25EE17F99ED90A872999B3 dream.tower
438,331,091 *2C61503AAEE0E322608BDFAB58F38DF2BFC2FF2E JONATHONRUBEO
438,331,092 *2C6BB7A06DB09C1136FD38E582F654B8B0C11F46 TESTARUDO4
438,331,093 *2C608C711CE91F1791E447BBB58C5FE1EACD21AE JORDANREXROTH
438,331,094 *2C6EFF853F2ACDBDC8B9F453F7F7232436FCAEA1 JOSE-MARIA-JULIAN-MARIANO-ESCRIVA-DE-BALAGUER-Y-ALB
438,331,095 *2C622BC400E13FD5261D7ED761E6F84E5BC12E02 dse6a
438,331,096 *2C632C990339CB9F8FEC0D318062A29C5A1098B4 JOSEZABBO
438,331,097 *2C64254683B0BBF5BA5C5CA3D41AE78C8ACFD5F3 iamenterprise00
438,331,098 *2C6A885738B985353021303A744916F21FBDF26E DU2-Z
438,331,099 *2C68953C6858E64BBE5CB1330A7A4CB543FB3AF3 ichigo1290
438,331,100 *2C60EA81F50621718908B7775E16908F6DDFECDB jummilts
438,331,101 *2C64795F69A5597F4639ED21D3A12CD41439408E dw/;
438,331,102 *2C6A9FFEE30585DFC0C02408F15ABB70407F969D „kanalisationsrohre
438,331,103 *2C6659A3D9E521AE1C20384710FDE3FD72FE44BB D(WLG
438,331,104 *2C60DC2F609571FEB7991F46D0DC62A4ACF059EA KAVEH FARHADI
438,331,105 *2C67B42572825D2A079A5BA6F15E6AEC7B1E35AF IMPERICED
438,331,106 *2C6A19B059897CA2F7EFB35E1C1874938C6608B5 [email protected]
438,331,107 *2C6CD885F4ECBE046D568DAE2FE575E3C846A2E3 kekom{ki
438,331,108 *2C6656BAA4B54900F3923FE1F7CE1423255A0FF6 kenji-kusanagi
438,331,109 *2C630772D8D2A84F98A094B1668839FF77FDB4B1 edlb"
438,331,110 *2C6247EEA9D57047AFF26B3996E7015BEFD7A9E0 inthedeathcar(featiggypop)
438,331,111 *2C60FCB055D3DA5B5AB7505EA3D73D98A445A688 efrainrepoff
438,331,112 *2C6E060A4D568A03C60BD9FCBB7262DFAD9F92A4 KIALAKULNI.1
438,331,113 *2C6C69D652EF184BCE659C7A635717622BB5B272 kimberlee.robertson
438,331,114 *2C670EF61818800DC2A807C5C2D47A6371524D4D KIM-CRUMMETT
438,331,115 *2C679704E613D8C29A6BA4E15DB107D84F781677 KINGKUNERT
438,331,116 *2C626114A612ED68C5AC69D3F11CB52AD593068E .elbacitcarp-sa-noos-sa-snoitalupop-yranoitats
438,331,117 *2C6E8C6B91C0AED4267D0A615E47DADEEBE2AFD7 ELI.CUSTODIO
438,331,118 *2C69DB5535424B0C64B45F45AC6F4120D6DEA4DC tlh
438,331,119 *2C6F39C0EBCFCA78A7D9EA460226A6FE076D283A [email protected]
438,331,120 *2C68C5F4EFF402CDDB61B57E6015189204986B04 [email protected]
438,331,121 *2C67D9852ABD267B2E8C8040F513F68C921A4014 ISUTUOG2
438,331,122 *2C683E10B281BDE69AF168470E9D26DC0DD0E171 TODDMCCLENDON
438,331,123 *2C6FCB550AFCAF90A2CE04C34B1B14DDF372C4EA EMBARRA$$1NG1Y
438,331,124 *2C64533633B70BB55155F8256B51419556D43DCD TOMDIDONATIS
438,331,125 *2C645623B1CDF8C7B7F5F5C35C47C87B6C543D42 EMHBU
438,331,126 *2C661978CEC7E9559B483E1E0A9CB1A6179ADC27 tony-backus
438,331,127 *2C621DBA5F114C8C985219B3F320FAE081BD3A7F TONYCHRISTIES
438,331,128 *2C6CAF98BE906814E0518C298B6E825A84884722 emlgf
438,331,129 *2C6C745BF919AB785EC4D82CF63EBA863708D23D [email protected]
438,331,130 *2C65A48D951FC44D2A06AC623A1E5BAC2534369E TORQUANT8
438,331,131 *2C6E09BFE9E6FA4BBDBC7C86E4BFF1CF2B481143 kreszenz5
438,331,132 *2C69152B6B3D6571ADED223DF10D7A77C6882EFC ENGEBOLL5
438,331,133 *2C6783B401445E892D5E3EA99892D3782FD65A2D ENTERR10
438,331,134 *2C6780313B29E460872404FD7C667F50E2505676 james.threlkeld
438,331,135 *2C686D0F5BFFC63AD7B672DA725382EAF79E5548 transportsimulation
438,331,136 *2C63F16C4A87B7B1EFDF14E4DDF4F066370F3F5B epanelen4
438,331,137 *2C669F7A0A0B2AAA7066D515C1CCC2E7E2EFE609 jarodheckle
438,331,138 *2C64080A7785755C2D4392BC934C59722AEC8F51 TRENTONWAYNICK
438,331,139 *2C68B2E544D81D65A19A9E074341A8F4E4033F6B erica-marrs
438,331,140 *2C687114C992280EE1F48D13F353261EC8D3D181 triple-stubbings
438,331,141 *2C6FA1A50837D003CA157D4A137F72484D3C1AE9 LANDON.BOREY
438,331,142 *2C6B5C36E1D6E55E49580FDEE3CC25AAA143A712 tronfoelger
438,331,143 *2C698D90FC9ABA06C9DBC7C6E7C0E9CDC7CE4827 JERAMYGAUD
438,331,144 *2C6CD5A41C57101F2D0526223C3913AF9110452B ETHAN.BARTELT
438,331,145 *2C6FB1B76760494CAB4408E8F26CDA21859C4618 JESSICA PETROFF
438,331,146 *2C605D9D9492914FE70213B50A04EA8488C0EBBE TTTCCATTCAAAATATTCCTAAAATAGACACTTTAGAAATTTTACAACTAAATGAAATTA
438,331,147 *2C6533B7DEBAD41401F332BA9FB604E0BB3CDBFB tuels-iitr
438,331,148 *2C6ED3E5094FAF45058EB5AA46E22AFF51C6958E TUODEMITEWSB
438,331,149 *2C637B5BBEED731545CA7F4A21D8C4153550B8BE jewelslogan
438,331,150 *2C6E958897BC7AC3EA61398E58546F61AB93FC8E jhzoa
438,331,151 *2C64C0987351ACA56C80BE761113493E45F437E2 legendreeratosthenes
438,331,152 *2C6A8A9899EE4F4E8FAF250EF99652C0743D2B23 evelynsaldana
438,331,153 *2C6C20B537678C30C87F23C5C12AABA0254A584F E-VOJA
438,331,154 *2C684E3678CF92179ACF98884B749D497F8C2761 JIM.TERP
438,331,155 *2C6F3B6808D78DC9F49BD6087BF94EDCE5E28B89 TYLER.HETTEL
438,331,156 *2C697B59D61834D5D9FC10D0C4CA5A6710AEF160 exceptdiablo
438,331,157 *2C68DC8E1DF3D02B1CA42B9261704D57ECB36685 leopoldofyffe
438,331,158 *2C6C3C37995D9BAADCF985829D71A3A0B4BF1075 LEOPOLDO.SWEEZEY
438,331,159 *2C6CBDBFC6D6BFC0E274F1A5B5FC58CBCADBCDD1 LES.JUSTESEN
438,331,160 *2C6194A0C356476B725EC2AFD875747249EF3B4A UBERNESS27
438,331,161 *2C68C1FDC228B5AB5F2184EC3B175A7CBBF0C9CA ^f'aa
438,331,162 *2C6EE327A2F3B260BD8655F47F5A7E64FE7A4B1E JONAHISAZA
438,331,163 *2C6C7F26E45C3BF85BCBFD2B22BB87A56E213474 lewistandy
438,331,164 *2C64D598A19E7FDA8FF1354AF59EB9F760E11106 JORDAN.WERNER
438,331,165 *2C6CB15356D9185C75645C1AED82E90790F1E366 JORGE CALLE
438,331,166 *2C6BF2B6C3A93B6F1334442643B6507BDB1A919B UMSPRITZUNG
438,331,167 *2C631C789ED90AF6CF054FF333D4DFAD1FA86769 uncertainregard
438,331,168 *2C6F45A2E16C31AD7076BF72FBE85CB620C22337 Ungen
438,331,169 *2C6B18DC914E85B207803D58A1EF1236F51E083E UNKNOWNTOUGHS
438,331,170 *2C69CB07CF55162CC047204800AB17C931BD55BB faxende1
438,331,171 *2C6B0154E918AF6F00912491B9BC39140EFCA01D juleskeesler
438,331,172 *2C63255B350CEABFEE8DEA8FDBA598C95E0453FE LINO-GONCALVES
438,331,173 *2C6C452AFCE767A82058AF57E61FF3742F3D745F URETHRORRHEA
438,331,174 *2C675686EC220E23419E30FAB6CABB0BE0E4FE4C LITTLE.FUCKER
438,331,175 *2C6B18C5AFFF53E80D25D32EF9DC040CEF7203F1 liverpool-biennial-stuck-in-liverpool-by-jesse-richards
438,331,176 *2C6DAC4E65957E28F6CF19C154789454FC701B84 KANCÓNĚ
438,331,177 *2C6D18B063E8392165C903FF8CDACDD3A7E82234 lohengrin(domingo)
438,331,178 *2C6C7AAAE5A23BB0453A37747D84BA6BEEA2F215 [email protected]
438,331,179 *2C6C8042AA9F36CF23903F03E16B6AF4ED1CCABA FOODLESSING
438,331,180 *2C667575DD2991C7D1E5F4DA5E0ABD2D8854640A KAYDENCE663
438,331,181 *2C6AD4FA4719EAAEBF2CE2FB6EAA39E95DCCB1D7 VANCE.MURDICK
438,331,182 *2C69FE98D01F5167A7947737A39FBA52082644BD VAN DEVERA
438,331,183 *2C6A525E07C2AF164C1E088A0E4862B0C3E32903 VANEEGUNA
438,331,184 *2C6940C3F7A223BB279930DF327145B639D0DFA5 fourthday-plantsandtrees
438,331,185 *2C6710DA7C98494D7216F2FEA57B10312757FA71 Vanghiamo
438,331,186 *2C62B7A5A3B9136896AAAEB44105894C8EC4F593 KELLY.RACH
438,331,187 *2C68FBC96836BFFA4CA511E1DC7367798AF00621 FRANCISWITCHEY
438,331,188 *2C64D57CD4A7ADC0ADCC59312279D001DEF3A474 VASSILIS STAIKOS
438,331,189 *2C674A726C68B95E33E4E827329D45F50813E6CF ltunblockenllists
438,331,190 *2C60D5928BB747BB8D64DB7BE63D0CFFE99F4040 LUCAS FORSYTH
438,331,191 *2C6FD0DB1559CA83D74FF9D975426B5A8AF14CE1 KERKGEZELSCHAP
438,331,192 *2C688FEA545F75361383510A6DBDFBBDCA9A93F0 LUCIEN.ARONS
438,331,193 *2C655191986AD9EDCB4635421C061D512C91685E LUCIENKUTLU
438,331,194 *2C6E415EA3B2784F6012A2A8258A9E4F8B50EA46 LUCIUSTROWER
438,331,195 *2C6A377FD175CDD86E13BF188A3200A252196020 [email protected]
438,331,196 *2C60B886FEC18FC7A28D3F278A0442CBCEDDD4B1 FREERECTANGLE
438,331,197 *2C6FD9880201A85A6A437EA512AC6114B0A03B9F FRUMENTY
438,331,198 *2C62F26CFA0F77B5012596F2BF3CA06FDEF2D161 F)S:
438,331,199 *2C64D6B844AF915B699EFA5036D587F7993724D4 verdord
438,331,200 *2C6A61F2E746B753E94A9A4B0821968D1E3CCD1E fyud
438,331,201 *2C645E1ACBF08E36DA5FDE40CCC8E47ECB04378A LYNNMOSCARDELLI
438,331,202 *2C6FDC53F519671602735332BDF82FE91DBBCE70 vetturnedheroin
438,331,203 *2C6B817331175B866307C2D0FB2A61BFB782E14E KUFFST
438,331,204 *2C626C3F7E46B64A2DA2448E44150A7E08B4B0CD VGEYPQCDH
438,331,205 *2C6E74AE9AA5BFF73714E0C299776E333846ADA2 kuoeyhl92
438,331,206 *2C63F528ECFC1908B1A1CA9F9F3FEF69C088A6D8 GASTON.RISTON
438,331,207 *2C6C754D436FBE22FECFD239623DD4AFCB1A3503 VICTOR-FILIPESCU
438,331,208 *2C6B14DA2ADB9F094DB3BC7891FA2AE4FFC0F204 VICTORGANAWAY
438,331,209 *2C6BA4EEECC78B7FB2498ECD285B3E45160A8C60 GAYLORDKMIECIK
438,331,210 *2C6B1001936CCC1A0F25CDBD88D359CE03517106 VIDEROPSUEN
438,331,211 *2C60A8BAF855000F576281E277ED27ABCD2341F1 geblekene
438,331,212 *2C6FF6EA67CB76F3B5C100148032119D4B67AA8B GEEZER1002
438,331,213 *2C6DC1CC85F2B811EB8C197462FFC87BFD2D0438 [email protected]
438,331,214 *2C60203BF7692B8CD3198E0FEB6B8DC9EE3C63F3 GEMINITHUNDER
438,331,215 *2C640623DAB3EFB2579006E7A8297D6B26211929 lakketh4
438,331,216 *2C675DC47F24DE973C4B5BCB25AEEB80325AE008 VINIENTE
438,331,217 *2C65C07CA93C2F72018D11CD0C7F606909006A1D marcodunay
438,331,218 *2C6D36EF65B0C88369D5D6BA08C9D24615A0B7A4 marcusdunham
438,331,219 *2C69AAF06FFD9427F1F716B3C61F068484C29277 VIRGILIOCHALLENDER
438,331,220 *2C68A4AE124B83C9DB30FBB1C63D17CEFB3EC101 LARA.LAGROSA
438,331,221 *2C6572EC1B2FD333152C19AD0C7C2CA565783868 LARRY-PONDER
438,331,222 *2C6B12129F1BD999DD5BA8662247799DDA5EBE89 VITAMINOLOGIE2
438,331,223 *2C6314710B521CCCEB3385F89B294D344B49C64E Latino.Latino.2..Nuevo
438,331,224 *2C6CFAFF4F385E33EA09EC0EBDF7F4E70B9608AC LAURENRODDA
438,331,225 *2C65348DF6B5C5247F645BC0AFD9053177D9929A v+#j
438,331,226 *2C65A8B36343EB9CE10AD7BAF8A21666EF7EDC64 GIGIMUSCHI
438,331,227 *2C6362AFA90D2B2003F92F67CFED1A02CB1443B0 marlinbihm
438,331,228 *2C64BA8730518D383FCB527BA38FAF965361ABA3 von.russell.punzalan
438,331,229 *2C61F7FE16C16DA80A2DAD81237CF8CD9DE7C910 leah-bergen
438,331,230 *2C659E7B4FD286ABDAF73C9541ED258C8479610A marvin-consul
438,331,231 *2C6B903A1F838F64B2D860BE48CED925A71D1E05 glandere
438,331,232 *2C6A1D3ABC4699D9BA519F0F6660E63BC8D6A0A1 massno2ing,d167:viagnusdei
438,331,233 *2C6EEC8416447477EAD0CB0922D0E9BAA42FA80B LEIGH.SUMIDA
438,331,234 *2C65A72C1F74385234D04972EC44E88FDB5CAED9 maurobuchetto
438,331,235 *2C6052E33ECBBBF049D69A745C0F20DB20229853 [email protected]
438,331,236 *2C6B4AAA4F4A292F266869DBE3C08A5D091977C8 [email protected]
438,331,237 *2C66D763FAE2B89D5FD1D21557F0519B6B34E8B2 mbto
438,331,238 *2C6F6FAD907753A8B70048656B4250F082EF81BA [email protected]
438,331,239 *2C667B8760A6BD346F1F5A1B7F02CE45B034A8E1 WARAPORNVIYANON
438,331,240 *2C64E6AAE13B77275FDB6ECB8515F0FED642CFDC GRANJEAIS1234
438,331,241 *2C6D028F9FA2873642EB10122D45B86AC89E37B0 LETAUREAUBLEU(CONTELIVE)
438,331,242 *2C6D0BCCBA88167B9131502E4E99EFEB45EDA59C GREASEBUCKET
438,331,243 *2C6DEE2095E9C05D02857AE1D8B570148C47EC67 gregoire.kalala
438,331,244 *2C6E3C4997644886F6B60E3BFB93E767FF9750C8 levirizza
438,331,245 *2C62077050D7FD62D8CA9F9545A75A9B6E96668B [email protected]
438,331,246 *2C6B69040B7FF379AA5D63BA08B483E52FD60F5F MEL4N7E$
438,331,247 *2C654A0E122F0D4B9D0F87DE6D5C5206739617FA [email protected]
438,331,248 *2C66901D3EC8273EDFFC8E4D6C5AA0C29ED6B96B GUADALUPEBOCKSKOPF
438,331,249 *2C6F360803A190975A69A099BEEDA201E7685C77 melvinrovner
438,331,250 *2C649FD178C226B59AC5A10EA4A0D0668BE4C8CE GUODUANMU
438,331,251 *2C6F2B1C88AA35646C28437E08B391227E110234 WELLSUGGESTED1234
438,331,252 *2C6FE750A3259E54DF25ECCE128E9583126496C8 WENDY-BOLKCOM-HUNTER
438,331,253 *2C6A986C83E5CAE727EFA7D510259894744A0AB8 metalpicsa
438,331,254 *2C6F727BA92432972EB86D0AABD86053FF65BB3C lifelove88
438,331,255 *2C67A8D420CAD6E8D5CAAFD4D7F4123C04CE7271 LIGATURERNAS
438,331,256 *2C605E21C0046386791F8180457B9F36169CD263 [email protected]
438,331,257 *2C6A71D8AFD4102090FF89E5D066202D0DE78996 [email protected]
438,331,258 *2C6AC877C8FA5865AA5D76E39E0E545B89071138 [email protected]
438,331,259 *2C671427729562DA2B925396233C38273D146A80 [email protected]
438,331,260 *2C6EC686C4AD00735880C19924943A8934CEFB15 MICHEAL.NEILLY
438,331,261 *2C65891A31D67EAD93C7C0BE32F58B22E081AA4F MICHELETEE
438,331,262 *2C673859499D636809DE396B1839AEE3FD411034 WILBERTHOWELLS
438,331,263 *2C6FC1124A88D69E80E7A9EE28168EA491165DCA [email protected]
438,331,264 *2C6CB5AF0FC96B345D930E2FE0D042922020861B [email protected]
438,331,265 *2C6650E894BCE9AC09234D22E950C22EDCEFF0A4 mikeivens
438,331,266 *2C6CA01D2E446BC32FC3A6C641830145CE79EA80 l%l"
438,331,267 *2C67E183279E76E8B9C5D707463E35E24A386C69 hans-ernst-j
438,331,268 *2C69AC5521CEF64A82577F574F7BFDA2286B7046 happy.sarong
438,331,269 *2C6CE912BC43D01900BA9A811ACBBBEE8B453394 willysage
438,331,270 *2C699845AD3714CD6B50D345703D8CE322920B82 WINDSURFSAM
438,331,271 *2C66817B06BF351311A3722DD89B67F6053638FF minoc.(negative)
438,331,272 *2C67A700FD3DC06F6EAEBFAE672AEA4FECE64C8E longsoberanis
438,331,273 *2C61A3303873DD7BA82B9A9587C60EC444B218DD look.in.your.eyes
438,331,274 *2C6FE830294DBCF8412DDCFCE811516DBCDE9885 LOU140406
438,331,275 *2C69CCA50C016B2331ADAD7857700573F28C503D mohamed.ace
438,331,276 *2C687386EC97ADCD16ED85CDBF1F8E4AE9C6154F HE-LIVES
438,331,277 *2C6F40024563FD122B4D6056465D0CC21175FE12 WWW.JHSOFT.COM
438,331,278 *2C6E28AC2A4F06AFE8923B6EC0DAE999AD4FC656 lumpmens2
438,331,279 *2C6CF9B6A22C54F6D9020BB529E2689B6BCE3787 HERBERT.MALONE
438,331,280 *2C69DB0387CAF80BB301A8A7F7FA4DAA63D7EDA4 WWWTHEHUMMOCKCOM
438,331,281 *2C6F8061048E09DF835F52D0DDBAFEEEA4F27CF5 wycliffe.amwoga.mulahi
438,331,282 *2C6ABF1944E539696659631E5B4BF94C8DCC318D LYMAN.ANTUNEZ
438,331,283 *2C6B0EA459AD6DAF0F088E18610EA740B7AFDB07 MORONI4U
438,331,284 *2C685CAAB03C44CA5B1D0F2E328E37CA48C84F7C mosehusain
438,331,285 *2C69E577CE22D11A38DA83EB36ACF75CE0634210 )x(~.d###b
438,331,286 *2C6A6EA8AFDB4A02C31C0F23C60FE2BB1F2E6243 HILARIO.DILENA
438,331,287 *2C69BAE1C647B86E995ADC61FC7185BAEBB9986D maanpaon1
438,331,288 *2C631BDFD3702DEEDA15A14CD6A9B8C79FB4B3F2 [email protected]
438,331,289 *2C6CE26E4FB47D5A2DB59E00AC9619F707C2713A mad0708
438,331,290 *2C6F9D76F5D7F31EC09BF7CD5C913542D137C2F1 MOVIN'UP(30SECONDVERSION)
438,331,291 *2C6F2A60443D1DB229B0062CD35D3B5E84ADE3A6 HN/W
438,331,292 *2C6F1408032374DA9B8FED2CB86ECFD9F50330AF howardeyestone
438,331,293 *2C6B13425924233C31F2A24F40DB28A5237157AF Y76079
438,331,294 *2C6D3756390A7AF65FC2069E79DA0CC9EC6E326C MARCELINOSPIREK
438,331,295 *2C63D0E990C58C3508FD64EA227EA91FCD3681F2 HTTPWWWFIRSTBASESPO
438,331,296 *2C6A58F6D35975A316D599E8EA7B6A0A603D21EF N8524922
438,331,297 *2C6DB536A4B8C47A8E2D9768295CA16FEEFFFAEB NACISUMD
438,331,298 *2C62A300DD773A78116C630F944CF7913DB65E12 markkirch
438,331,299 *2C6CEAC7750E470013E85EA2E89EA7008824FBC3 [email protected]
438,331,300 *2C61B8A7AC2730CE0CBFD6824DB5D367BBD60981 ynohtnastac
438,331,301 *2C6B924F85481B6CA312786833850C644D5A147A MATRIARCHC
438,331,302 *2C6221B4B8F1B31C0FDEF85BF3B07793761C0D30 youch-me
438,331,303 *2C6FC5F014E90BF8DEAFBD163E30B5F4DF2C731F NEPALED8
438,331,304 *2C684874EB0A49D0BD8041F4D5D2BEE7DED63CDE NEUABDRUCKTEN
438,331,305 *2C61DF128F351B8A3002410290796D5B0710FBA9 melissa-in-wonderland
438,331,306 *2C63783B34DA49D58303C0A33AA9D5931CF08F1D YUWANDI.LIM
438,331,307 *2C6DDA1071D274AFF2FA39A9F0312E4424A2F00E NGODORNES
438,331,308 *2C6E66752DF305DEEEE6CB0242A1738FDE14976A MERMAIDLAGOON/BADDAYATSKULLROCK
438,331,309 *2C689E3759056D00CF66F49CA61CF4403F5B4524 MERRILL.LANDUCCI
438,331,310 *2C61C7E1F2F934CD1755781A53F6FF55A883FDFB NICKACEVEDO
438,331,311 *2C6C23B17EF2BF00F62F9496A72423E4281CFCB8 [email protected]
438,331,312 *2C63BA5DFCC9F98E73E493C396E6DD42E6D0A53A [email protected]
438,331,313 *2C61AF98E5DA6EF832A5088AE004D6C7B3B135EC ILOVEALLEN87
438,331,314 *2C685088FB1C069D65635827BABD09D1007A4BC6 m%H
438,331,315 *2C65FFA3C96F34A0D31C0E274E686C0A1D814174 NIKOROGA9
438,331,316 *2C6F8608211ABB85221CF6DB9B22ABBDE71CDA56 ILUVLIGHTS84
438,331,317 *2C6A8295E30EB1642092358DC1921D7BCFC09816 IMLOWIAFING
438,331,318 *2C6D0B7D4CC9F52092586FE0F33DE76C9D3D7E36 ZEMBACZY
438,331,319 *2C61694942366C93987B3BF99C3156D5B52E7E0E MITCH.GETTENBERG
438,331,320 *2C6AE053A8C84FA1992A69D5BB38EF4C27227543 z=hy
438,331,321 *2C6BB67892B27DF83B75673BE3A0CF5560323216 MOFADURA1
438,331,322 *2C66881888179CAA64C6493773BDECA4C0E0520F iravthan3
438,331,323 *2C606D5D3D89DEBFA96D63BA7688E5C3D8C0D6EA OBLITERATED.NETWWW
438,331,324 *2C68C64F3344D6101F19E2AF230AA5393F13E739 MOTHER2008916524
438,331,325 *2C6FE751D570F65A8188EB2C5F6C1831777D5A50 MOZARTRACOON
438,331,326 *2C6C0A1AE9A9DF3DB9E6E96E365AECD889D1342E ISONEPHE9
438,331,327 *2C672241A5F02CBE90E4B4951BD3B44D00FEC31C ISSACPANKE
438,331,328 *2C63C6410AF85CE64714302E0E7A54F05FDD3D46 MRS..MCGRATH
438,331,329 *2C6097F633C752D1A36C998C1A2CF888178C5D21 muhsbswed
438,331,330 *2C6FB5A5B34E7B595992A5F1DD40B19A42F12243 [email protected]
438,331,331 *2C6E9322889559F8EBC998630A573A754D1B1C6C ojf[
438,331,332 *2C6E4DF3D12B1ABB89A780D00E76EA0138CCDFD8 OLIGACANTHOPUS
438,331,333 *2C63710C6BD9248D4529E4AFA63D3E7548D96944 АЗАРЬЕВА
438,331,334 *2C66BD18F5B4BAC49A3934ECB632F118340864D6 MVCNPEOU3
438,331,335 *2C67DE96B51A37A838C06BD21090B1CF087A6651 «АСФАЛЬТОВИЙ
438,331,336 *2C665013410C63C8FD996F7677A99B4C4EDA9FE2 jamesviele
438,331,337 *2C6811EB18D35CCBFF4934F188B6258FA5F7DCDB jeffereyscutt
438,331,338 *2C6722B884CFBA2CEEC85E6B67BB7879D1355226 JEFF.VEGAS
438,331,339 *2C6E3402222E36D4DBE2BD1040AA6EE3A1128DB9 jerewolfert
438,331,340 *2C6F456D4452BB5C7B6341AEBD8DC25368AE84F2 n00nt1des
438,331,341 *2C6ABD820944ED431CF6C4B261854705C72C41EE JESS.SEANG
438,331,342 *2C6EDE9C9A999C0C7DBFB620B7F5D8BD316E048E JGERTEET5
438,331,343 *2C68BDAC2EFC3B6CC7CB4B5632ECB2336D8A45E3 NATHANIALWATT
438,331,344 *2C6507ADE97207176BF0621BF6380FF2BD10AD29 NED.CASTENANOS
438,331,345 *2C64917F8BD0A32574A7C193BC52B8693B4B01BB NEILFRASURE
438,331,346 *2C6C1DFBCBC077467FF7C87B8A78D15699B3D12E [email protected]
438,331,347 *2C6A4B5F9A86036875F5AE357C1FFD854CE6681B nemaddrob
438,331,348 *2C625D8B89927A00DF81D06CEB3C86C4D452A817 pagunawa
438,331,349 *2C605830C350DFB429D8DFD1AC6AFC2A11FFD8AD форсированный
438,331,350 *2C674A9E05AFFC5A72183C13401000903DD58E08 хубek
438,331,351 *2C6535579A5EDC6B0277FFFADD36E900265AC2B6 NEZLONAMJERNE
438,331,352 *2C66E04F75A60DB777FBFAEF04BE328A0A82DEA1 nicolerandy
438,331,353 *2C6F53D28D0EBE5F2BBA48708CF8D1FEB4AC552A PEHOVIMA9
438,331,354 *2C625762A36AEAD62988D4DB6FBE4E992187FAD3 none.a.jah.jah.children.a.cry
438,331,355 *2C670584CBADD4248F27AF4AA7417382D15ABBCA phabari7
438,331,356 *2C64771BB83EC1ABEFA7E72AC181B93887582E8E PHILLIPDEDMAN
438,331,357 *2C63B15E3F8F71E3A005CF9336B8F47CD7E58446 photo-initiator
438,331,358 *2C6E57C2BBD1B26CF5E1F7F8C715FF9C6719C0C5 nurhahan
438,331,359 *2C653F6299C2C1A4DE9B7AAB516AAD49DF85D48C KANSANEDUSTAJAIN
438,331,360 *2C67028C5CD4EA9FFB4C886519346F7E019400DB PIŠAMILKI
438,331,361 *2C650E40A7CB1FDB1258344ADE8F0AD747DCDB73 please-find-a-way
438,331,362 *2C6EE90EDED770C4884B471C67CD330B73EF1F56 』では、悪魔将軍2pカラー(同じキャラクター同士で対戦するための「色違い」キャラクター)としてゴールドマンが登場する。
438,331,363 *2C6FADCB05CBB28D6C3C230D0907F3D18B1362EB POWERSTATION
438,331,364 *2C61E6FE281670BBA598C93A9EC6033B14017200 kellie-ann-obrien
438,331,365 *2C604FBB1154D37A4D8E388D46E979D792138315 (>_<)[email protected]
438,331,366 *2C672E9E6D88BD7E2F15A4B7BE2A694496D3F3C4 PREGRUBOM
438,331,367 *2C6D915CF1BBD3DBC1ACCA298B2C97BDABBB05A1 KENNITHGALLIK
438,331,368 *2C6485EFADAFBDAA12A593E010B621FD5E672FFA kennydien
438,331,369 *2C6916C8AF7297FB22975D890E4E646348E91C94 kentonbate
438,331,370 *2C6967089F3235954283E1C246F8C3B6D7725795 opinionately5
438,331,371 *2C69556B01A59B87231690EF79CA5AD0C77FC971 PRESENILIN-INTERACTING
438,331,372 *2C6C3597EDA954F49500D37F1FEF08A09861E34C PRESTONPETRICKA
438,331,373 *2C6FDA334F938234FB6A6CF24835B49EB55B95B7 kimi-whipple
438,331,374 *2C63C88FD37EFD2C1EF95F8E5E782546183ACF7C KINDERBUECHERN
438,331,375 *2C66EDFE15ECD60215BD9A1C86BFC87F45E9DF94 projektnavigationssystem
438,331,376 *2C67EA10D47D1F5C541BB0C8AB55F30DAED6D68B projektparkplatz2
438,331,377 *2C63E4DAFAFC3D95AEB0B0A11523880FDA2AE3BA PSPELLACY
438,331,378 *2C60E58CA7F056C4E23686E096AB8C44B5101186 p-----) * * splat
438,331,379 *2C65B6F2981357A6603FD103F61CC4D80764652B PUNKDUDE1668
438,331,380 *2C6DE56205B23481C49076A2060988439E88A24D PUNTELLS5
438,331,381 *2C6DC77BECC877CE3E102937A042C3CB3B3778E9 kvent-12-0
438,331,382 *2C6617E73E0CA5C7CB51A5B037BE2FD141944D43 k,y
438,331,383 *2C64E7FCD27CF4DFC05B996613E414B7B57BFE00 kyle statham
438,331,384 *2C6814C8888718FE0C6AD45F964A8458A8368511 Q====P * * *3B<
438,331,385 *2C6330AC5CB8A1BBBE3B34BE21FFAC43DD241C6E 0broker2
438,331,386 *2C6C39FE54B42609913886FC5943A5A46C4E5B7D R3$$7an7ly
438,331,387 *2C6B07798211F90C7A1A2C7C4DC28BCD932DDF3D 1076248 ei maailman parasta , koska sellaista ei ole viel
438,331,388 *2C6CD109B796A54D7CB8A08090E6C19E9566E04A POLYGLOTTAL
438,331,389 *2C67C3B88238AB500878B1AE9BCF7C62DB9B8F6D 1137996 JOTTA.T
438,331,390 *2C6CD173429E491CC13379780992B77C4DA76CDB pour.le.bal.des.pauvres
438,331,391 *2C6E605A9F6025F69975DDD19AB788EB5828EEBE 1246479 SEN.LIS
438,331,392 *2C62ADA916592E38348661CD02515D1288C4E149 LEA TAYLOR
438,331,393 *2C6DE3CFBBCB3E0C32B555BFBFE996D234D90BEB LEBANESE
438,331,394 *2C63239F1BA16F6C0040B2E4651A9BE4A44BD9F5 RAMSHA-ASAD
438,331,395 *2C6444A60F698848C7F0D5366AA4BB9860F8569F rashadpoplawski
438,331,396 *2C6DE5AA1EC949707FF578338436EF11808A4FD6 P####P ~O~OSPLAT!!
438,331,397 *2C63809F7BCE3A4878B9BD8B1365615A6A8C0401 RAWELEMS
438,331,398 *2C6435B58BDCA8A1BC1916FE9191329892ED0272 LENARD.BUBIS
438,331,399 *2C66192C69924757C314A5427649AAA1BC6F515B 132415 amabuolanaksIzdI
438,331,400 *2C66E61109190F6AD0EA7366B1C67544CBEF7C54 RAYMONDHOCHSTEDLER
438,331,401 *2C6834FDB4F32A78F1C219D154F28376FFCB2564 lennydern
438,331,402 *2C6A8BBB2DCC28AEC83B50119803C1F9AC0AF8A9 leopetralba
438,331,403 *2C6A19DE914CF8175B3939D739A8B0854DF464A8 prestonchmelik
438,331,404 *2C633D5686F9C05E03343C7D4DC5CD2AD5CCA90F REAUFGESETZT3
438,331,405 *2C60E14D6B256CAD34DD013C48E78BA6523D4D17 lettin'-this-big-rig-roll-it-out
438,331,406 *2C61F8EAF6E768D8CBBBCCB0034ADDEF36962450 1613803 kotikuntalaki ei edellyt
438,331,407 *2C6E66111639972FF81152EF50B46DFE5F09AF91 PROGAMER51
438,331,408 *2C66AA8FE6BBDC9175634F10F20EF4889EB8E073 PRYCILIEA
438,331,409 *2C6682121EFBCC144ADF068FFE4845C88FA3664E REGGIE.KULICK
438,331,410 *2C6ED6D61E72F7218417D400C2DA3AD56BF37C04 1893651 WIR WURDEN NICHT GESCHLAGEN , NICHT GEFOLTERT
438,331,411 *2C63E29B160BB73D93F269638905A482B772025C ptvfl
438,331,412 *2C697FB3CDEFA913F729B05DD344933022E4C27E 18slithered
438,331,413 *2C6B8F9B00E15F47F959B4D8551763C63F5266D4 LINETAMA
438,331,414 *2C6C112E464C6A133036732A680BDC3F748CEF37 [email protected]
438,331,415 *2C600B0B7522E65CEA6EB83B76D46F9E172649AA pudin-de-pan
438,331,416 *2C63F7D2B06549A3924F73250C526C7A9036C799 [email protected]
438,331,417 *2C694570334382EE2BE75F6D2522C1B40472EA47 linwoodpaseur
438,331,418 *2C6DADD6173378DC047A89C53446B1A4CA7DD73E REINALDO.HEEP
438,331,419 *2C6606290529309684229C9F5C75CD76D1383C8C 1963年)、イラク考古学総局(1956年、1959年–60年、1969年–78年、1982年–92年)、janusz
438,331,420 *2C67D979614287B99E6E31CFD42C2457836BF054 19910917: new york, ny, usa
438,331,421 *2C61317EFFA862E5C3840FAAA027E6B52C0FEEE1 1AITTOVUORESSA
438,331,422 *2C6EC91164893348C82FE2EFA1A74E0F2FAF908E lisa13579
438,331,423 *2C6F07480CB639984BD7D3841555B5FB6053FBDD REMOTTAGARERS7
438,331,424 *2C6220CE727A8BE5041109A1DD5F1ADF09E55EDE 1APYAAJAU
438,331,425 *2C603480FED0ED191A46543AFA64A28298A30307 PYTHONOMORPH
438,331,426 *2C6FDE1074962D0E7F9597B51C642EEF5C94A8D6 Q#####B***SPLAT
438,331,427 *2C6A24B31F70EDDB8C807134DA4EADC97C211744 1CRAMBBSW
438,331,428 *2C661464E9A943A6ABD8A113BFDE9FD93B98E08C Q\M6
438,331,429 *2C6915CCA1A6C07A47CC04605A45AC7E926A0697 louiesmsith
438,331,430 *2C6BEB9BFDEFF05323D90840917EC3F7B747B71E RETORYCE2
438,331,431 *2C663FC1E7002B3C57AECE4068B0280ACFBD0778 qu411t1es
438,331,432 *2C620C7C4570DABB80ED3024F1CBB898037C10F7 quentinclise
438,331,433 *2C6900755108ECDD897F7894759D5482E94DDC6A REVISITVAMOS
438,331,434 *2C62AC0DD13F038E6FCCFD1F49A9816AE5E71BA3 1gregorienstended
438,331,435 *2C6EC835C89DF2D0CD7275FCDD180E75B2CD8A43 1hein
438,331,436 *2C627C5907120E8E30D8F04C6FBA1D786E7147B5 RHONDAFRANKLINING
438,331,437 *2C6D0970932DD26EA3AF15ABC4F8F570201345BA RHUMBOW9
438,331,438 *2C61FB27FE83D3D31D16ADAD0B6DC04FD0A5F635 QWNPVSIPULQ
438,331,439 *2C6E2D2FC246970B78883566FCC236B87DE79427 RACH111
438,331,440 *2C6B881355F985B579299B7FE70C006039438E17 1 KOMPROMISSVORLAGE
438,331,441 *2C6AF8B5FF45F8A1F5BA29DE1D0EA8CDCD78F045 RAGOOOSA
438,331,442 *2C6C5787F3757D85157FBB20CBDBF04C789ED6B6 lupinosis?
438,331,443 *2C682370CCA1F1DA5FE832F3B5F714EB9CE7129B [email protected]
438,331,444 *2C633F2771C43E707BD6EE7366576A45B6942C5F 1maaseutuelinkeinoviranomaisteht
438,331,445 *2C63C7D8554E8E9D831950B83F99D3AC342E2F18 RILEYWOODLOCK
438,331,446 *2C61C606DBB95C52BF460A282B4682FF919094B3 RASHID12
438,331,447 *2C65DBCA90CA79EA82E138DD19C8A4E1BC9EB4B7 RAYFORDNOLDE
438,331,448 *2C66E1F3AEB93EE01EFE312C7106B8D51A1688C4 1OOECIAS
438,331,449 *2C6F45BFC8EACE98822C905963CCAE40837F32F0 1 PAULINE-LOUISE
438,331,450 *2C63B2F3436C059EB10FF7CE216F4AE4965490B8 1-pika-aloitus
438,331,451 *2C634CD18F5BD243C27D6DB8B41590ABEA855823 MAGDA-MOLLER
438,331,452 *2C611352FA03FEE28814F03CCFC63FF2AFDC6C3A MAHATAUQIR
438,331,453 *2C6150811247C22B0018FD0A09F99624C5BC3A51 [email protected]+1N9
438,331,454 *2C6A6D343B0CDA07C918EB221194D9767E411609 MAINBISEXUALCOMFOR
438,331,455 *2C67F908C02869BAA748A04804A2E124CF100938 1rotortuerme
438,331,456 *2C6A50B5FC4D2D79F79A17AD84BC15D7B9881A67 rednemmoc
438,331,457 *2C66B491E9FBAD6F5EC003380E70980CF80AB680 REENGRAVE
438,331,458 *2C6DA83EEDFCAF55E56DC1EA0A5F247B4673B905 REGITZES0
438,331,459 *2C626432FFE1B2B16C7964AC71117D09C35109E5 ROCKYNUCCI
438,331,460 *2C63AD87972D089012E8488AD414D3FA973FDC02 RODERICKBRUSO
438,331,461 *2C63447F1BF286169F163DFC822A3175492127EB [email protected]
438,331,462 *2C678CB7DB1877584593E8290B771B76D4CED1E0 REIMPLYING3
438,331,463 *2C6414315801CF532FD7BB5FD92568747CC60D1C MANMCCLEAF
438,331,464 *2C6438B04E557C4FF0AEDAAD2CB63F582402623A REMINO4
438,331,465 *2C671CF103FD1B1E9998C1077C1B05723E3EC3CE [email protected]
438,331,466 *2C6B9A4781C7092DD49AFFE06D730848A36851CF ROLAND.BIESINGER
438,331,467 *2C60A004C6C6A46E92505907D7F73E4C1A593848 MAPTBIH2
438,331,468 *2C6FA13C86E9E8EABF43A79FFAD3DB005064E2BA RENE.SPROULL
438,331,469 *2C6E647348F4CBCD613750E7CF8094ABA33C5F69 2003年4月25日、アリスJAPAN)
438,331,470 *2C6A890E594E01D404D49BDB2373EFB3B2CECB5A RONDELCAMP
438,331,471 *2C69EC828C64FA765263D8004AAD6CDDA2086C39 ROONEY)以及琳恩·梭特蘭(LYNNE
438,331,472 *2C62244376BD6B7F15CE2568FDAA5F5EC398BAF8 REWOBMEBSW
438,331,473 *2C6F26E4B424619A07332A1993D302FB83220A71 [email protected]
438,331,474 *2C6461474A41A18711A992A4FE774808116D4B69 reysito
438,331,475 *2C6FF3A4DD086BB2AF8BE0036FBEF42331B84928 ROYALHALDER
438,331,476 *2C6129681C96FCC3F3C7E6EB2CFE24371B5011F9 MARQUISMACHLIN
438,331,477 *2C6217B6524A627A3A0288C2CE5E9AF2B70ACDD2 RHODESIANRIDGEBACK428
438,331,478 *2C669A3D2ACDCD141F2E9131D1C762FDEE8FD162 r"ibaa
438,331,479 *2C6380B362B89BAFAF6B93A62D913528838E693B RILEY.MACCHIA
438,331,480 *2C6200FA645DA3F16E5D1B304217FF56E22AD8D3 road160xtreme
438,331,481 *2C61C814FCCF48C6FFF221A7B6FCCD47D68001FA 2694580 fuer.mich.war.das.nie.das.gleiche..
438,331,482 *2C60035CEADE09D7194991C736102B58EB7462DA maxwellpribbenow
438,331,483 *2C6ACE0F189EFE9044289B0F428E53A74689B332 28.03.1126
438,331,484 *2C6BE83CCF7CDE1F1D23EF820D9C92F7F3227F9C SAIGNIONSES2
438,331,485 *2C6636F85FA037B94FE6414523A22166AB8FB607 SALVADOR.CHAUDOIN
438,331,486 *2C69B610BF72C0D75A5B019C6713815993A86D95 2COUVE
438,331,487 *2C6D3E9D036D99B0B9DA181DC79F66B5D071EE6C 2DIXOYLOP
438,331,488 *2C63153E56033BAF774713F7A4EA9F85066A6F37 ROLLANDBSW9
438,331,489 *2C6CF87051E2BB90B989401852C4B79740C29AD8 SAMUALMCGURIE
438,331,490 *2C64D1CD199AFD4D08ADB8B2351C153CB293F188 2lackieranlagenhersteller
438,331,491 *2C672ADDCB2559694B748759759E12CC9119649B 2LAUNDERY
438,331,492 *2C697D2E73C768E60EE6F1C3658D8CFD95FA7E35 SANDYPASION
438,331,493 *2C600A0F23CECEC2E176AF9F591B7A4109EB1AF6 ROUVRIRONTS4
438,331,494 *2C63AB1ACFFE10617D24C1E75C38CABF2570775F savingpearlharbor
438,331,495 *2C65F60C96A362F6C3E204A6DC6F92C6DE0608B5 SCOT.GYLLENBAND
438,331,496 *2C66C2F6FC89AD084BF7CA802BFFBA03DF3B81F9 SCUFFED
438,331,497 *2C658AFB0046B40448BAB2271DE8AB55BCDD7C41 2-PROJEKTIINNE
438,331,498 *2C6972F05E1CCD973F6082D0A3B927FC59F3F394 SEBREE6
438,331,499 *2C6DAF30F92BD35BE9F99D7374615FEF966C6074 2RESIDAN
438,331,500 *2C666CDCC6ABE12899005B4986C4AF1C84AF646F michalearnette
438,331,501 *2C61CF72E46620D41B67F2D316AACC404738F72F MICHALESHENTON
438,331,502 *2C65A9192413B66A0CCA734B8EC515E908869AAE 2VOITENKO
438,331,503 *2C6C74373A73FA5447A7B510F983D6BF1B780929 mickeyerby
438,331,504 *2C69D98FFF5E38578973724E6FA6849568532CBB rukia.kuchiki
438,331,505 *2C69BCF0F967B015788FA666849109AA2F65057E RUN0U75
438,331,506 *2C6629F1397256DB4309B928FEFE0644DD87FE16 semeshmann
438,331,507 *2C6F27B127A1133A2BCC2B73B5FEA4DDEC1454FC 369198 hepimiziyikOtUbirbirimizlediyalogiCindeydik.
438,331,508 *2C61DF7D8702726C2AF307DC74E69F663718DAD0 milan.m.
438,331,509 *2C695ECAECE39F7689B8DD99C8C01F7297A76876 387BRODERICK
438,331,510 *2C69CC36D5317988E9C94A71B71DADA74151D832 sethfranco
438,331,511 *2C6B45D81F92D404ADAF89D4A79E4272C9389A95 minhswestka
438,331,512 *2C60ABF4E542FBC3F1458FDD2A7B3F1A3F3EBACB [email protected]!n3ss
438,331,513 *2C6DA4F75B9B71E73FEC2E844FFB248298395273 MISCHIEV1234
438,331,514 *2C6338D2E8E356FABBCF4E4B5CB416B5D30466EF SHALT
438,331,515 *2C6A8E369C9C6B3AA31BA91207450247D9AB2D71 MISZEGDEN9
438,331,516 *2C689DD0896D0E86528307546ACFCBCEC235C618 SALSIPU2
438,331,517 *2C691FCFEC86C5DD7495A155370FD7ECD2E96791 moderate-to-liberal
438,331,518 *2C6054D0B054BEA5811DEF1E11CB1C68C1177BC2 $3LF$T4B
438,331,519 *2C662C41F7B08C9B48502DEA4C8FC740016A2FF0 3mefirstism
438,331,520 *2C60ECCA3FE737AF8579B9DCE3EC41278147F4B4 3NBNGSTN
438,331,521 *2C6643D5187A1D9646E634E8B8C1577B6ADC5468 3PALEOGRAPHICAL
438,331,522 *2C6081CEC5C134D541CE74474FC625F8F0B6ED1F 3-----P-~O)o(
438,331,523 *2C63043D5E6038658624AE5CB418E88A8AF62E50 SARVABHOMA
438,331,524 *2C6D5DF305909F9EB487A69F74E6A6EDCA09C195 MORTONMCSPADDEN
438,331,525 *2C62C8BA60138F4723D70068221F6B61B80ABA29 mortonzimmerebner
438,331,526 *2C6D734411689561747333E42D0501C436D09CF7 SC/AA
438,331,527 *2C648E1C93CC5EFFCDBA12D114A38919C9616599 41-rahoitussuunnitelman
438,331,528 *2C6906841A8F83CF19EDA52C577C444C1A1D4340 SCHMALKO5
438,331,529 *2C67DFC12107A7711AE263DE2776E0E8FCECB65E MRLAKERS9
438,331,530 *2C62DFF60A0D058B5669418D8252004DD72881F4 SCORPIONFGHED
438,331,531 *2C658E217C0358DBDB0793D73370C68EC0023B2F SCOTT8ANTHONY8
438,331,532 *2C6089D79EE1C517770E631261BACDEB72D6F461 SEAN.SHINNICK
438,331,533 *2C646FD2CDDE90AE371B904C7D9A879CBAE9A4B5 MUTILERONT3
438,331,534 *2C6BDA4BC7E50402CB8B77F4D178E312D058336E skit.:."l".speaks
438,331,535 *2C6A508F3DEA640E5F8D7C4DA380D749DB3FF8A4 SEDUCTIVELINKB
438,331,536 *2C671D853DB312EE8D7AAA1AB0FEA23E0EF99BE9 mycougar39
438,331,537 *2C66FA8A3C323F237FA20D54E5F487257F705C98 4IAMMASTER18
438,331,538 *2C6C2EF8D302A0C3C11796DBD6EC078560CD8B61 4LILLIBELL
438,331,539 *2C60364E6A4039CEFD47663AEB45BC8FA8B21CFF 4LT3R4BILID4D3
438,331,540 *2C63BC58035327143435963CB052523B9C0D62F5 [email protected]
438,331,541 *2C6949CE179759935B102FBC370435873C8AC608 SEPARAATSET
438,331,542 *2C6461D36F52ACAB7DB91DE271C1F98144CB73BE najpovoljnijem.1
438,331,543 *2C6A77FC22EA7FFEA8BBE097E1DCBE359BBA8BE7 SETH.DEMUS
438,331,544 *2C69FB6EBC94C7A9AE1A5E34FC803AE36DE9F5F7 SGHIACCINO6
438,331,545 *2C6109C61486AFA86C6C4257374D1020105E56CD 4UDVIGNESHHU
438,331,546 *2C60879D698806089FB947CA6BA3A467805EC9CC SOKP1960
438,331,547 *2C608D525806512DC077AC327BE4728F3126570F shasta57
438,331,548 *2C67364C3A395A6B6D725E51BAAC59C22BBEBC01 Song-Sequencing
438,331,549 *2C6C9DBA6EE0C685D0AB246F908EB87698B64819 552603 es gehoert bashir
438,331,550 *2C692C8855FF84A571859E2626542C104E8DC6B8 SONNY.BOVEN
438,331,551 *2C63C235D839AACB4243C839D91683418B52A395 ncssttv
438,331,552 *2C65C1BBE81F370871623AF1C20DB4FB908C5A33 NEOSPORIVE
438,331,553 *2C6EA94F928498A89CC0EAF3FC1BB03332FE59AE Shooting-Star-(Smith-and-Pledger-remix)
438,331,554 *2C63DAACC36A1BCF9C0756A879579CA4B84044C9 SPANTOUW.
438,331,555 *2C677C380895ACE67BC6ABA265AF8477D1AB12EA [email protected]
438,331,556 *2C624C3CEB9479DB09FD1FB58BA7393BFD2FB9CE SHSHARP0
438,331,557 *2C68A662FBD7522EEF1661253278607E4A1A56F7 SPENCEERNIECA1944194
438,331,558 *2C6FD5327DDA078CD980FFE3FE0F3EF4DB037AD4 5DELEDBR
438,331,559 *2C62DE335F97F313CE53A82F3F0B120B35C75DB2 sica(lexluthorzremix)
438,331,560 *2C6A975DD34EAFA7A6C13E8925D250E47CB1F7ED SPIDERPINKFLOY
438,331,561 *2C62011026A570406CA83239AAC8EA504F3DD383 nicolassporman
438,331,562 *2C684959DB0F7F418E6210D5627D18D8BFAE26C8 nicoleanne
438,331,563 *2C686DA3D3D14AEBF46C7C74ACE3BEC82474A9CE 5MYILOVEU4
438,331,564 *2C6481216F1F7C4AFA60409E5CDD332E54D79CC0 NIRMALA NANDA
438,331,565 *2C67C5FE188003F4EBA301E6B3575DF0C897E4E9 nisi dominus, rv 608: iii. surgite
438,331,566 *2C69C9438F336707F90489F45A91D415A5F59919 slonov
438,331,567 *2C686DDDB35EC645DE7A6274BE16039DDC5CAE86 SRUTCOSBBR2
438,331,568 *2C6921A8FB215950B9762C88E24236A078B61C2B SLYNCON
438,331,569 *2C616886848B35673E9C45B5CC68F60082CF05E9 nobleharrisow
438,331,570 *2C6EF93B6BAE20A4256156B71E2562B8F61D2EE6 NONALTRU3
438,331,571 *2C649ED8B18ACE9F43A7649CD8D10D498EC0325A NONSQUAREGRID
438,331,572 *2C6C87FAA68EE6DCEF94E43806EF5F8B5407EA9B snoixelfed
438,331,573 *2C6EA1B27C4998D97EEE45E7652E15F610A1D09B startpage<br
438,331,574 *2C6524B3389849E733888A1312B0A59AEA05AAEF solomonabbamonte
438,331,575 *2C6EADA7BC4FA37892614E6E9C22D87AEDE86F6F SONNY.WILKIN
438,331,576 *2C6F634D073D6509250B011F41F324C612BA0EEC STEPHENROZEK
438,331,577 *2C66CD6D9A3CDF7F1EE7E3BB89DB91EE97CE1D87 Sound.of.Tank.Firing
438,331,578 *2C6EF6E408131D6349D5F7CF1F025695E0F4D736 [email protected]
438,331,579 *2C6ABAFE955BB0F4B94590754922F2C795F83EB0 sparxxx2007
438,331,580 *2C6276F1899AE4E3CF0984E788023355A5CBE6C2 6CONNECTIONEVENEVEN
438,331,581 *2C685508D83FBE5C984B747D074E21891D4B7404 [email protected]
438,331,582 *2C6DC577D736DF7297960882AEFC6B97B102626E 6DEBOITEREN
438,331,583 *2C6829BABC60784A109836FB9D289278E953041F oj160no160l195
438,331,584 *2C62EF7E14980A41E98F4FBF4E058F5462057D25 6EUQINEHCE
438,331,585 *2C61893E34E98169CE5697BF300CF0E4D1D2EA44 SplatO~-(----3
438,331,586 *2C6A7DB0B1A39A4E3DCDD234052C6E288BB1038B [email protected]######P
438,331,587 *2C6D58E7083ABF4934BDB4CC792F91267F5CDBE3 o.Meu.Amor?
438,331,588 *2C6A63078C673B52C1228A639980162FE433DB6C 6LIBERTINE
438,331,589 *2C6E3563E1FF4F7DDB3EE962AFD512AF2FA40BEC 6PONEDERO
438,331,590 *2C6A0CCDB7B13BC60AC3EE0ABEFBF775DEF67E91 SURADNIP3
438,331,591 *2C69DD94189525E168EF0EB8DDE61F2A8E33C6C4 SU*U
438,331,592 *2C6F6000BCA437D24E9DC530E0D0AC8E57A84234 SVEUKUPNE4
438,331,593 *2C6CF086CDD4A5A6AA50B4955F2047D1361BC753 STACEYOFARRELL
438,331,594 *2C693BEC46E15D041CB5E89C108AFC504503B751 6TLETSPOROOV
438,331,595 *2C699E392CDC2FFBC34D3C6E1B20E8149AC65B88 SWESTXXXED
438,331,596 *2C6B13047482AEFF7945A2395D37EFBE790B3073 SYLLGSTCN
438,331,597 *2C6E16891FCDC15036799F4250AE495A5BBEAEE2 SYLVESTER.CUI
438,331,598 *2C6FE8616294BCE410BA780C307109416F609D00 SYLVESTER.NELMARK
438,331,599 *2C6CC04DC3E0A9C521B7F0029E5AD303FF8B2874 707judith
438,331,600 *2C6BE8E6779A2A89A4E76B9B1BA8AFD2EADD63AA OTTOHARTINGER
438,331,601 *2C628633689C134CA13873A0413DA7369F422777 oui c'est noel
438,331,602 *2C68D3693B6E5FDCAE7545A4D0085EB737DF6F89 OUTOFACCORD
438,331,603 *2C6E4D6C4880006955525E7D7DD54533E0FBDB86 [email protected]
438,331,604 *2C63AD74376EC2125375717ABE41F11E3F9C755C syzygy
438,331,605 *2C60756327AA0E65BC52F51045E7FF45550997BE STEVEDORINGERNE!
438,331,606 *2C65917FE47104614E4AC1B65E25F0E497FB7E82 7ACHTERAANGEBLEVENE
438,331,607 *2C63A02A1D3FC4A3F6859CB0A4B64802ED45F5E8 7ali
438,331,608 *2C6F296D61453B923CBA104414A7A420D125BB28 STFNSKBSW
438,331,609 *2C67237CEBD41B6AF801BD3094B7D8BAF37F1999 7ARGWOEHNISCHSTES
438,331,610 *2C63675552939DF040312B388042A8D86D15D8F3 TALK82.33.88.162
438,331,611 *2C6B28152ED2F5668B958B8597F753A12E870FBB P0$!T!V3$T
438,331,612 *2C62ED604F00DAB17CADDACB1CC3C45CBB0251DF [email protected]$
438,331,613 *2C6F6535D432975AF38B9701280564F2BA207A52 STRANDDENS7
438,331,614 *2C67BFB07B3AE33B9555683D9ECFFCF040510F13 pa00098374
438,331,615 *2C678CA6F95052AA3D161F271B9FC423D257D8C5 [email protected]
438,331,616 *2C6A27BB32D9D149BD198CB7ED07B48F0068AAC6 7ESCORREGA
438,331,617 *2C64FB4DE1A5F31F367994ED611C8BC3C701E41C STUART.MERLO
438,331,618 *2C6F4E599404AE40F533A4F8CEF2251883386753 7INTROMETTENDO
438,331,619 *2C6F37EDDC34424E77E5AD6DE78DF768C3B714AF [email protected]
438,331,620 *2C64ADD55BD5408265389214A53F85493299DC93 SU&"
438,331,621 *2C64D26621A1B06BD46815E5AC11011ED782ED2A [email protected]
438,331,622 *2C629067E9D9149D34A3CDD0BD09A520C1E3E0BD TATUEREMMOS5
438,331,623 *2C6475EFD4A41B648EB08EF320FBCB9501E652A0 TAYOSHCHICHCHHEDA
438,331,624 *2C630B04B7BA474022BA4AA33D42D832987EC5A3 .TCSHRC"
438,331,625 *2C619857C67DB35405CCBE0EB308D9C0E38A38AF 7NERSPACE
438,331,626 *2C6A786ADF4DD52B78813331D75C488E36A0BEF0 PATRICKFEAR
438,331,627 *2C677ABF16C1A4F50CA44408787AA1D81B2D82C4 PB~0~osplat
438,331,628 *2C6E65E2AC8F0DD5B33A5F02E84FA36DD036A669 PCW-WRESTLING.COM
438,331,629 *2C6CA9251E5AA4C59DCAF066F4D9AD88C28F892F p'dise
438,331,630 *2C65D893044BE70B5BF73A9D06B2D3B95A91DF05 PEDANTEMOS123
438,331,631 *2C6CB188F51B675A260ADEFDA9DE912EE9B07D43 SYGKATOXOI
438,331,632 *2C6DDBE71BB945A8CCFABE110429ABB2C1764478 TESTRESUL
438,331,633 *2C67E497DBC337944B6B7C4C6BA2459A9F671E2F TEXASLJFED
438,331,634 *2C6E3B04802DFA15DFECE1033D4554B934A0E9D4 thadsustaire
438,331,635 *2C677186D60343C3DBE20C0360B78A67ED28DC01 THARAKA.MADUSHANKA
438,331,636 *2C679894B637EFD57732CF2BD40B2F55C25D2CF1 t0ilet.pa
438,331,637 *2C62E6C360564D12D8025060798D0267FF655451 THATKLEENEX4
438,331,638 *2C61C18B2A4BFFDF1CB343214445956C7A7B9E9B T4MGS1J06WF4B
438,331,639 *2C693C207A1EC17B0536F3A95EEB9F99D309072F take-me-now-(extended-version)
438,331,640 *2C6900C03709A98A41D4EDDA9AE4E8DA0BC1E570 8DENTELLEARENS
438,331,641 *2C6EA9DDB4036607CA31BE1499CC42510B482703 tami.broughton
438,331,642 *2C6C2735F094258B6A3F7E5A26FA21A718596DD9 [email protected]
438,331,643 *2C6C30E31A347B587B80AFC367C29ED4EDBE9B9B THIS BOY'S IN LOVE WITH YOU
438,331,644 *2C60271F767C6176EC46A7967F401F5BE5031420 PLANTMAINTENANCE
438,331,645 *2C6907FD1FCFE1C647A12D3AE4E21E3990001C50 ThreeLongYearsAgo
438,331,646 *2C6779624CDFCE60C7FF2167C119721EC8F7DA72 TILISANT4
438,331,647 *2C69422D36298B2BFA9377C5F194274FE64D3421 p==>~O3B<-
438,331,648 *2C6462696EE0C5D7DDD9A7E7339FB1B184088D04 [email protected]
438,331,649 *2C6822F1923E781C287CA84FBAE6A1DC6DDF0FCD TITUSBALDER
438,331,650 *2C6A861348953C558450BF9424DC1E3672B9CB14 terrenceschumucker
438,331,651 *2C642D602169195CB653EBB29CD1A7CD789E822F POPPY04
438,331,652 *2C6FE387867F9A15EF2B4C029C24A0A63126B1EC t+g
438,331,653 *2C63B5B823867250E01B4A0EB693F42ABA3BA3A8 8TSANTIS
438,331,654 *2C6D1146851C8F6FA779843C09C72F6C20EA6FA5 8UITGESPONNENHEID
438,331,655 *2C6A52AE31F5268A01332DAE84843826F6401452 thatgetout94
438,331,656 *2C68FEE55C2508C3F32495783D0AE5B01300C769 THATPINKFLOYD58
438,331,657 *2C6D26C0B6E8D75EDED7D37CD6FAE619EDCDE88F PREDALIEN123
438,331,658 *2C67B89F5AE74560EB02A9F22580B143FCA39069 THE-APE-THAT-GOT-LUCKY
438,331,659 *2C682F403E4D306FAC996DDA70B4FF9A62D6D266 the-born-one
438,331,660 *2C61DC91D68648A97C8AF3B2E64B52C78ADEB37B princess326435
438,331,661 *2C6298B41162A7B016E339096EB1506E703BCEE9 THE-HUMAN-BEATBOX-(INTERLUDE)
438,331,662 *2C6BDA7A2D6D4C09F13D87CD51D37F985FE3E56B transportstream
438,331,663 *2C6A82E6B8D98C1A6C206D45DCEA8A919EDBC84E 9GYBBATE
438,331,664 *2C6B8CC027F515E9E0021088CCA039DCAE9448BA TRCHPHYLLS5
438,331,665 *2C6344770572AF170DFA9968C60D8D64C0D99C89 9HAMMERCHESTER
438,331,666 *2C60ED35132DB882744D521DEEAB6D980520669F TREHESI
438,331,667 *2C6C7F1FEB7CD04CD023D6DE4497BFB361D668BF treshabrooks
438,331,668 *2C6DA20A153C2DFF45514787FEA3C4705C007AFB 9KERMAKORISTEILLA
438,331,669 *2C6D84E8EF2215913C27E2A7DEB288B7C49DF15E TREYAYOLA
438,331,670 *2C6DFE841DB89B8DBD6C0A76C790972A1307AC2F PSBWYTNK12
438,331,671 *2C6CA368B1B44160E09129327981208E5A2651DD puimsteenpoeier
438,331,672 *2C609E80A4C1DD83F5FF8B1D78B9B9A4244C9EF1 PURESKILL
438,331,673 *2C67274D2D19C02A0F8CE7790BA8DCC095A27853 triumviratetechnologiescomwww
438,331,674 *2C6A36B99A78C0FC2D414813255AA337EC8ECF55 THE THREE IMMORTALS
438,331,675 *2C6CA2597A2BC78EA6505E530067456AF22F38E4 pyrimidinbase
438,331,676 *2C6EF183B4AF177C27C0975194A079DFAD235B03 TROTTASSERO1
438,331,677 *2C6CC4080CAC55006AF0EFF61C20F1A16FA1BA51 THINHAIRED
438,331,678 *2C655567DE43C653E6881631B9E801CB48A1A5DA 9SPRECATAS
438,331,679 *2C6DD00F0F04AB1825CFE5CF89DA11D3BF1F06F0 9SUBCAESIUS
438,331,680 *2C6418E5F973E5C42C1D7C1731C8E74511E409CF THRS21122112
438,331,681 *2C649ABE9293229CAA5432AA207D87B045E86F00 TULEENITANI
438,331,682 *2C6B08D03D0A6CCBCF532FA7390C924B0B3E1727 a3ksa
438,331,683 *2C67ACFF151341B57AFD084902F578540D487ACD TINKERMARILYN1
438,331,684 *2C6ABB2F1BF2034EF56F1350EC2585982A494517 a6m/$
438,331,685 *2C645CF62CE6BC86F34B3621EFA7F7C6D8F55099 >-<***q#####P
438,331,686 *2C6419C8663D0CB8AA7419177CE69758B835C56C QRL:
438,331,687 *2C6416E3E9F1FE80013134EAC24DDFE4EAC5E270 UGAELYVI6
438,331,688 *2C64AFEABB0F4E844EBA51B0839A48FD8CBEB979 AAAEBT
438,331,689 *2C65F3373E9E99D0B502CAD5CB046AAF380C6D12 UNCLLESAM
438,331,690 *2C6F9EE6FAB3FA88035B805E3D906D26AC8B9E07 UNDISTINCTING
438,331,691 *2C6DE284F0D3936F26137A3F0DF8D16605FFD1C5 UNDULATIONISMS6
438,331,692 *2C6434588BEA97F5751B6F7091DF94C328288C8A [email protected]
438,331,693 *2C6862D86E529520B544C6514D381CC5D6FA70EF TOMMY.CLAW
438,331,694 *2C67D664A065FF888FA8ED1201F019F3C67E2D1A TORTOISESESING
438,331,695 *2C6C866216F436BD3BCC091848CD101443A933C9 tramainealston
438,331,696 *2C6F9F630BD15AF5E4444580CA942F0D0FEFADA9 RASTBSW1
438,331,697 *2C6198A4196D2BBAEEB62ADD1A0B7DFA25CCF9E0 AAD.%R
438,331,698 *2C69C8A109D8691345B74E9CCE5F8ABED87CCD65 RAULWERO
438,331,699 *2C6B8349C6F4BC19B2BCE77CBE6FF1C7B46E8042 [email protected]
438,331,700 *2C64688B8957D54202A7CE2444F0BDC170F1E87F aaeua
438,331,701 *2C67FB1C283E10CB19874C0CE5A6A45C28BFF2A3 raymonlaukitis
438,331,702 *2C68BFE5F846CC8CF52937D884A7FC897186836A aaeywa
438,331,703 *2C687CEC5543060F55C43270721FB885EE5229CE RECOLARIAM1
438,331,704 *2C67DC6961A5987B0AE9426464153E63B45C8225 trumanbalsam
438,331,705 *2C6F24029681BDB4E4D89B92A0239766E9C2B8CB ab/qb
438,331,706 *2C61FBD2CACE348ACFADE03D974EAE6FE8A18323 REDSKINGALILEO
438,331,707 *2C6DDEEE78FBD5A5A87545DD4C554A6CD2EE3038 VANDANAVADERA
438,331,708 *2C6EEB7AB0EF7C87D86BDA4930C05B27D0D8AE17 REGGIEMICHAEL
438,331,709 *2C6F0451E8F545C4870141D664A9AFD24AF9B2AE ACOH7
438,331,710 *2C63FB8A6EE961289AEC58FB6463B954B2FF1720 Remember-'The-Paradox'
438,331,711 *2C6713077FD65FC5AFD6FC3221148BFB128A7894 tyesha-cardenas
438,331,712 *2C6E155E22FC0F8E3E46946CD727961C9A4ECA17 TYREE.LANGLAND
438,331,713 *2C67304D25C06E8A73DCDDAA0509B98832B13F95 VERBOSENESS
438,331,714 *2C67455D627156B19926614F5A876E4A09DACA0A UADELUPE1
438,331,715 *2C6C11494F4682116AA7FB490C772E7123C1D563 UDJAELANI
438,331,716 *2C62EA65B2932156E77892BA15096135704F7C8E vervloeien0
438,331,717 *2C65D8CED626B2D712957DC42CC1056B0492C6F6 rew8522
438,331,718 *2C631791B8F2D2A1D55F74245140A11B71A40B4F UMAPATIDAR
438,331,719 *2C6B5275E77A4E1838AA43C1A650ABF2BE6DB793 AF25M
438,331,720 *2C657D8B7CB4575A0F6723F6BEB88E589767FAF1 UNNEBULOUS9
438,331,721 *2C6B48F16AADE5CCD5B10E9E2725EF137B7A65E8 ridy
438,331,722 *2C6AF206822311D71BBDD934DF6005F933FAB617 [UNTITLED](SPYMANIAREMIX)
438,331,723 *2C6D3E8FE2CD3D88783AFEEF3F162EDCB3C3594A vrijgezellenbelasting?
438,331,724 *2C6F0177F9A6102A6AB9DCE5386BABF14BAF2F85 VVLM
438,331,725 *2C66DBC25ECD554A1AA6D3D2DD877CA91D7F7328 AHMED.ALDHAHRI
438,331,726 *2C62755851532A18F39C82E0865D9AEF8871032B ROBREHM9
438,331,727 *2C6528843B1FCAC24B1B26FB524A68338CFA85B7 AHUGB
438,331,728 *2C65A1C5C33896EA342446387769267805024879 RODERICK.MUMME
438,331,729 *2C6B08E6CD14125AC644072D3188FCB56FBB4BA4 ai(at
438,331,730 *2C67D7B3981484AA7893B793F4C6266F0C5051F6 valleycity
438,331,731 *2C652C46E9879E6E4679C9729D3CB65A33BA4B0A AI NO CHIKARA
438,331,732 *2C66C091A34402FFEAF3C275977A24E1A330D1CC rohanquest
438,331,733 *2C635488BCA030A442B98EB71463612454703D53 Aiq$
438,331,734 *2C62B6C7509ECA223A45CACE7C5828898478E6DA VANKILAPAPPI7
438,331,735 *2C6621CE62CF649F42D1C771261C9919C7622E44 romanvaudrain
438,331,736 *2C6EF4915E81B0C7628C2B4B0FF6FA6AD2B6153A AJANOTARSEIA
438,331,737 *2C69D95DB330E0CBC287E90D47D364F4DEBBD9AB VASTASELITYKSEENSÄ
438,331,738 *2C678A7FD68F76379FEC04A91C1AC6CE09D2DD31 ronnell.brown
438,331,739 *2C6E5C502E3A19320402EBD665EE378ECE5AE3DD AKABUIKE4
438,331,740 *2C6FE6A37EB25F180D6ADC893A801058A961E0FF WARUNIGAMVIDANA
438,331,741 *2C6474725D4F864942DB97C3BFF6AEB0BD1C5E72 AKsS
438,331,742 *2C6B2284F487ECEEEC493E735D186EC6F98D6888 veijerddi
438,331,743 *2C6E3472367EAE3D773C9C7B51C11ACFE719BAF7 WBXNF
438,331,744 *2C68797C75810501B1EB5497B61540514A5E98CA roscoerochlin
438,331,745 *2C699071261037A44BAFD9F02FA44F3915AA94F9 albertteixeira
438,331,746 *2C6523CFC2998B73CB87E985759F4F37FF436C28 ros.no..11,.a..228:.part.iii
438,331,747 *2C6C4C3423887A21CA4BEE845B814C9909C091EC alfauske
438,331,748 *2C656A27DB26CE20F9CDFA49B692750EF62D00FA WELCOMETOMARIOKART-A
438,331,749 *2C6BCD681EAE1EA008EF1EF0910FF47A55570F8A RR-=-WRITE-(FD,-BIGBUF_IN,-1);
438,331,750 *2C6F42D22DC2B3F4B830595AB0E2C618D979FFE8 WENDY-ABUAWAD
438,331,751 *2C6477F392EFE449758394C45CECF6FDAE579548 [email protected]
438,331,752 *2C6AF2585E0834E3CD060C39003E2FFCA3540970 vetwtiy4j4ob8gb1v8gdca
438,331,753 *2C6BBF6FD364EF3F2E6F5175244CE1A39D2E703D VIASATI
438,331,754 *2C617375CE0CA13F5B5E89A562E863CC53C180B7 RUDOLF.MELROSE
438,331,755 *2C68F7D1A844D4397EB26EE080E5E99D51DD9767 vighnaraj.sathivelu
438,331,756 *2C6ABD3361E5F284C8C063CA9253F5C561FECCE8 VILIJA-GRENCEVICIUTE
438,331,757 *2C6D3215AB39DC2512DCA5BB988FA55AD2A57F49 rupertraver
438,331,758 *2C6F5AE131C1C87490EAEECC84E58469309404BF WhereWeFrom
438,331,759 *2C68B8E88043FE4CF31988F3BA87D1ABF40FB3F7 rustico.c.
438,331,760 *2C6834C630D03048C980443AC086796BBEB88966 altemeir
438,331,761 *2C665ABC7DEEE9A9B27EE891D3AD97BAD3735975 amir-van-der-hal
438,331,762 *2C641385B97840697B74E861D5E9BD95DE0DF327 AMK:
438,331,763 *2C69AC34DE94B021FE819A1AE79687FE33C29692 amnht
438,331,764 *2C61FC8CB75784AE63AB59228322BF1753C2395C [email protected]
438,331,765 *2C61A05205589526CBF98D6F5B4B20C7F21BCE4C VON.BERNT
438,331,766 *2C620B017EA0F55139749B7D58E3D3D08861A845 voorbeeldens
438,331,767 *2C6A23353D775F47A91544430E31400031EF7D70 andrea.webb
438,331,768 *2C63F06015268CB9E2DE03F0564336D86D444AD3 WILMERSPASIANO
438,331,769 *2C6A34D5490F7D18AA42FF5976C04CB67DFDC1A4 andrewsweetland
438,331,770 *2C6221A3A0C7FBC4EFF433DA3DB8D54B8D666B96 WINNIFREDTIJAN
438,331,771 *2C62386E234DD601E73111BBD65C8A2FD658FF68 A_NIL
438,331,772 *2C63165518B523C7D5F697C0C9F61A283A784FDB SARVESH-SRIDHAR
438,331,773 *2C6C40F2E1A38890D62C84A6D97FC0FAA91A0307 WATSONCOMPUTE
438,331,774 *2C6A8DF8C4F9A1449A4D41A8CDF86854ED2BFBFC WWWTALK-PROJECTORG
438,331,775 *2C6837C029F3C1B817A0B3A9DDEAB6408F62AF0C WWW.UNDEFINED.COM
438,331,776 *2C642AD10208A7CE8ED9BBCE4C5621D5167083BA wyattmanago
438,331,777 *2C617D1CC7EF7B59AF3257019C74A1D4862C7724 [email protected]
438,331,778 *2C664D205D4730C05BBBB5E8D798B1909A44C861 wes-carringer
438,331,779 *2C60D4F77891014EBE0C849C25A9B8E4228D16F1 [email protected]
438,331,780 *2C615DAA323350CC8C75E707E6A66844A991EBEA wiedelapan
438,331,781 *2C673480661648F5C0E5759CF8AA3F8735E289B0 AQlM
438,331,782 *2C66A06144CA8C244342CFFE5B8469DC854BC561 SÉRIÑ
438,331,783 *2C6371C831655FC0DB0EFDFE6AB22A45FBD2EB97 ARCHIECOSCA
438,331,784 *2C624C8112104EAC4119FA5D435FD89B52F8BD8F [email protected]
438,331,785 *2C63D25D3A1E13B8D11AF6DEE86E4498B61C4DE3 [email protected]
438,331,786 *2C631E9C9F8CE69ED1B145344DD068EAE4F36A72 SHAD.VERBILLA
438,331,787 *2C68535613862056CD15FF1EC3DCE1C59A8F111E shahardahari
438,331,788 *2C6542D59BAFC8D8F53E9DFBD125076E6F1D2BE5 WILTONHAIFLEY
438,331,789 *2C6C23A2117E1F14B3CD354C72720D8476E41265 ARMAND.SWENEY
438,331,790 *2C67C96738C3B114D94E6E41F945786E9D90748C shannonrunge
438,331,791 *2C6DC85124DA8B19C8A76271A63DF515F52E2B67 ar:mu
438,331,792 *2C6ECBE819B97F4ACF9CD24DA0275F33888C55BA shawndafields
438,331,793 *2C6BA953863CBC74F5BE4A8CD5FF68372012829F ARUKSNGING
438,331,794 *2C6438EDAE862A79DAC51286E19C8CBB9415FE7F [email protected]
438,331,795 *2C6E6D5BB61E18EEDC779F8F6CF042FFDB5D6AA9 wttnaction
438,331,796 *2C6191EA233213F12BC0FFE8DD7C186425CFA37D YOANAKRISTI
438,331,797 *2C6D0DCF88753BAC9181CC097D5C59E7CB22BA07 ASHA-BASNET
438,331,798 *2C60CFD85C41BA609FE6B8F47B7E9E4762BDFCB8 YOUSIF-KHALID-ALMOUBARK
438,331,799 *2C641F9A2A5DC5D60E8106CC18C575A868AF70EC YOUSTOLE_MYHEARTX3
438,331,800 *2C68D2E889576E23D36BEC2EB8ABD10B81476782 yuc#
438,331,801 *2C67CF8009438A722DD59945F03F75C42B11D744 SIMHA RAO
438,331,802 *2C69421741EDB95099991ED1EB1E9D260F8BE152 SIMONSATO
438,331,803 *2C696AF7E1B5DE8212C880274401EC699F47F2CE yunus.bilakhiya
438,331,804 *2C68B06C3D995BE7345EE287053C406A4DD13FA2 atllj
438,331,805 *2C65BFDCA1DA54A92388F665AB3A5A517449DFFE Z%]6
438,331,806 *2C6A51525111F73FB669EE47D4EA86B1DC6FA4A3 SKANDALISERTE9
438,331,807 *2C67179E37903C62385F2C32828BF65B17402154 SKANITENG
438,331,808 *2C6D9AE3E6FB159AA4CA5691E9177644F6F23DB2 SKARLAKENKOORS4
438,331,809 *2C6D25F57055B42E62C3404443BA7EFCFA946DBA ZACHERY.MAENO
438,331,810 *2C6AA2193A0B37AE52A07ECC98AA1FFE8CE09DB1 SKILD3RKUNS
438,331,811 *2C69CF9C5E2EF9110EEF7DFC9B19C891B0CEBEB7 a_ts#
438,331,812 *2C6C1DC07239811723563356096BE8F4AD005422 atwistedpair
438,331,813 *2C63DF656C64720E90EC579D16C1539190CA6E4F zaza-nita
438,331,814 *2C6DDE1528FDF9F0252A9516034A4A5401FFEB97 [email protected]
438,331,815 *2C64EA2B60E380FE7F839960C2C228D111DB6D83 [email protected]
438,331,816 *2C6F9486B01D0E2831476830E985E36CAA825045 SMILELIZARDING
438,331,817 *2C630575D549B6F033BBCFC1085B69E156508C3C XXVICEXX
438,331,818 *2C63301DACFFDEA5486A34CB92156F3E42B75FF4 AUSGANGSIMPULS7
438,331,819 *2C69C598B6D4DDC5F1A8EEC8DF6C3E40E11007EE [email protected]
438,331,820 *2C63CE22850489451EBA3CA0AD47413286D4E94A AUW5H
438,331,821 *2C6FFF9F88D4684CE3C97BDAF6457D5697B946BE AvfB
438,331,822 *2C67CD1C750586E6C8A31DF7E232194EA7699592 [email protected]
438,331,823 *2C6CC31256AA2876D9CB01921B99E1B49FB3B4E2 SOURABH.NATH
438,331,824 *2C6F87B4B0C9F6853EF62DD2469F18FDFEBB33ED b===)-~-~-(~_^)
438,331,825 *2C6F75609D46B7B7E7FB6E4536717FE995A6633C B#####@*;)
438,331,826 *2C62F5493B9BA4253BD5B741C3CF92A9D128F40F b$1pe
438,331,827 *2C6EFB47EE23683A46140E1EE7E4AEA7E2893C5C ΠΛᾸ
438,331,828 *2C607F911DD6D96DFE32FAA2B230363112462B0D yungboy93
438,331,829 *2C6AD0106830073A10EFD8BCC4D1BFE61DD34D62 [email protected]
438,331,830 *2C62C44E41780238100ED37EEE93955ED83E8589 ZEMRELY3
438,331,831 *2C6041D7416125E4CACD18AF62F62CF9461BED83 BALISTARII1
438,331,832 *2C68EC78117D5E304259F9C95531C2AF30393421 STANFORD.MRKVICKA
438,331,833 *2C6FE12AB899CC4468F0DD515CE1B2178F6A1C5C STANTONHOUGHTELLING
438,331,834 *2C6678F71F8F24AC52574AB6265381868C35812A ПЛИТЧИНАТА
438,331,835 *2C64DF0E8A0C13DA00F5FBF6136BC4BBDBBDC94C ZSABAA
438,331,836 *2C690B5209B31CD910AFFA446F5F558EC2913B14 Stay--now-I'm-here-
438,331,837 *2C61EBB6D1762C66DAD845842703EFC6DFEFC880 ZVĚROKLESTIČSKÉ
438,331,838 *2C6CAB85FE36A7725C35B74FB039435E1460E2F2 zxy-world
438,331,839 *2C6B704B989E90C90E6ACA497BCAF62DCC1D9823 СИНЕФОНИЯ
438,331,840 *2C60287A4DB17C02CCA2B3BFAC6FD68ABC55CDCC bc0!.
438,331,841 *2C672E667935CA1B8EC1717A4F2A699EFEF26D86 STEPHEN.KITKO
438,331,842 *2C6A61B7FC30DB757DBDF4CB518C9F7ECE1CCD40 b!cqd
438,331,843 *2C6DDE510B1F26C8D2CEE973EDA95044A547C5AF bd~~)8(
438,331,844 *2C6030953DCA7D2A7A862CF496D058F3777897E9 bej(?
438,331,845 *2C609A6A7AA6174794D2FF4111FBD1C23E5FF21C STUARTRANDALL
438,331,846 *2C62F8C1BEB6187621061E82643C2D9BA9415358 найрозповсюдженіша
438,331,847 *2C6B6798E2F32C35F928F06065AF627A0C0E16AB BERNARDO.VELARDO
438,331,848 *2C6AC7F85AF9C108A478A1F7C21A77B8ADDD18C4 СAНТA
438,331,849 *2C63D1F2831C85D87B2E7383789C10C1D947F1BF «тоса»
438,331,850 *2C651A72271EA81B7C9EFED0AD5756075298766D supernaturalatcomicconerickripke
438,331,851 *2C6DA803CC6B890EF6860EB6C5FFE0E5BED300E4 SWAGGIN.WOLF
438,331,852 *2C61A7CBCB8B6A9A9DCC34137577C81127136A61 B.FBH
438,331,853 *2C63295C3DEEF73515CC1287509C25ED0367CCA0 SYMPHONY NO.1: ADAGIO
438,331,854 *2C6A355F8CB8185040F550EC733874F0B61EC30B [email protected]
438,331,855 *2C6B681AF2EAFA5889FF1B23CAEED57174CFE155 bildener4
438,331,856 *2C62E56391BF86833AABB314089A88EA3EA11034 林、2006年、p
438,331,857 *2C6B3968F5A2E16B734535396FCA6730D2A50552 BIRD2149
438,331,858 *2C62E0608A770A42BE42A34310184094A59BACB7 ただし、インターネット放送では音楽やCM、枠内ニュース番組が権利の関係で放送できないため、無音もしくはBGMが流されている。
438,331,859 *2C630F006F00188D0CC0F7DE88EFE9C8530AFB9E B?JD1
438,331,860 *2C6B84CC1F682E9BE90EC6CABA8EDD67E7F9524F tattoom1
438,331,861 *2C69A8F6CC370CC55C4058EB04C653367BE3845C bkwnm
438,331,862 *2C63E61DA754024B6CB4BCE263228FECEEAA4C8E teegrakidnapped/failednegotiations
438,331,863 *2C6D23BC10A5143256DF718BD7B149CD2DBDE4A1 terrellromanoff
438,331,864 *2C6EE91042C870A58CA4BAEF4DDACD3C56CE8FE5 terry.cosgrove
438,331,865 *2C60D824819696E398566AE49AD4EA35513180AB TGITTSRUSH69
438,331,866 *2C629175BFD826E0CFFAF718584A5158CAEBAE1C THADDEUSATTEBURG
438,331,867 *2C6B90AF6507BEA19F2164799D0155E6A5A0A79B BOBBY1749
438,331,868 *2C63D9CEA8A9F6B4F0A791D87801B9266945BBE0 [email protected]
438,331,869 *2C66BAC7B5E0FE8CD0092B6F6139B47ABD4E48B8 THAPHONGPHUMI
438,331,870 *2C6741CEFC8219BC51183B0F44F631DBDC8B23E8 BOB ESPONJA LA PEL
438,331,871 *2C60F593C69B75E31EB20BA7AADE67CF2D0324BB [email protected]
438,331,872 *2C6D744B6BCE050ECD98F31F960A589AFEDF3F3F BOLOGOJE–
438,331,873 *2C699F465056AFC4FDA2E9F3C861018E048E44DE bomk.
438,331,874 *2C62E2A6A1CEBAAE6D5E4DE96C164233998A35C7 THE-DALEKS'-MASTER-PLAN-1:-KEMBEL-II
438,331,875 *2C69B959E6657BAF2FF82770EDC75BEF7180567F BORTFORKLARINGEN
438,331,876 *2C6CB512789C0802611D91B07B07BD7E1D6B68FA BOTERWAR3
438,331,877 *2C66B28DE85E6F06831AD93C64F47A47AFD5C29C thesummit2000
438,331,878 *2C6C3C9E62A7B3BC0BEEECDB2FF3134091E21D24 THINSETBSW6
438,331,879 *2C65511E8F5B6A43D19B8D969AE53D5F45D704D4 thorbj
438,331,880 *2C6AC7876B294E86D062096B5B5A0C3860325A0D BRAVESMILLIE
438,331,881 *2C68D880582CCB67F55B37DB66C41F9AFA8AC5D1 BRET.CHERENFANT
438,331,882 *2C6A3412192E3C3AC07814403E90A0780813C2FC 10 ALKUPER
438,331,883 *2C68C2204C50D3DA1A2C3B37A76C3F50D70952DB brittanyt
438,331,884 *2C6D1300EEC7ED8FCEA3F4BE351C4C5815C61E1A 1222969 KUKAONMIELIS
438,331,885 *2C68FDF440A9320BE19F1B9A0B3B5E438893F0A4 brown.suede
438,331,886 *2C68ECCC7F05BF51AA551FE6B8686EE89CB58DBA TODHAYMAN
438,331,887 *2C66CE3A891F091995DFF699F18510F46D029203 BRYANTREISENAUER
438,331,888 *2C685CC4606D8CD4ACBF374C33D16AA4A696D97E TOGETHERJUNGLEKNEADKNOCK4
438,331,889 *2C6EC66EEC5FBD1A47696F76674982D00D2A32A3 0v3r5tr3tch35
438,331,890 *2C6383113B8682C3BEFD324B25DA708BFA9DA3FD TOOTSIESIERRAS
438,331,891 *2C681AC8147E140FAC7A91F152D2A681B97A7D2E 11UMN47ONS
438,331,892 *2C63EC7D9BF43BD8ED3873F0B8C830E7907D81C3 BSWERSTAUNT
438,331,893 *2C6CA117FEC6BCAF414709F83D0FCC65BDD5EBF6 tpwh
438,331,894 *2C6989AB580E5EC8ACB083A04E0DA2961BC5C23D 16000US5462140
438,331,895 *2C69B827914AB8B31F461EFA6E56E1A01F1CEFDB 12perinn
438,331,896 *2C67C5B4E78CC8108AB1819D293039474FDAE98F bty&2
438,331,897 *2C6B07EE1AF17771E7BE46E3E5F0C9D2C1FCFF32 budmelusky
438,331,898 *2C66F7A023C827CF11348079ACB2173ACBF23593 TREITERAARSTERSES6
438,331,899 *2C67ACC1150498A3032A7D21DB684F3836DA2DF5 TREUZTIRIADURIOÙ
438,331,900 *2C6274B80ABE75BE3AE81A700A17F77025D457B8 18DEC1241
438,331,901 *2C6BCFD1B517CC4291E3D8E584F86FAC8A409ACC TRICKTHERE
438,331,902 *2C6DAA9F03E0F773D55FED95757E06ACC219AFF1 TRISHA-MANLICLIC
438,331,903 *2C6183EE2CCF251E6FE84592C0B32CE3763A3C5C TRISHVACOVSKY
438,331,904 *2C60B30FCF759A58E6A42FE6A4470BC9F567DD9E 13organisaatiomuutosten
438,331,905 *2C6B7981E32FDAEE196B8F7BC19015310B537FEE bv-
438,331,906 *2C63334DE12DE929A70B801E6EE1BC471E52F1DD BVH,
438,331,907 *2C6AED927EB8F647D23FFCCB6F5CC67BAA5FF9FA TSUBHEADEU1234
438,331,908 *2C632D81EF1EEAD000DB1C1BDCBD99625DBD09F7 1BRIJDELS
438,331,909 *2C6A9E28AF481062E187753846B4A0BD36949265 15051419
438,331,910 *2C66D9CA9AF781C55E51737BF8B1C30A4582D99F 1CORNMOTHS
438,331,911 *2C67F093B9A11F5A18B66DA598345EA424D7584E 1DHAVAN
438,331,912 *2C6D2849E172D5A0D395738DBD2D3532449AB652 1.emu-ev
438,331,913 *2C6CD00AA3B84FE9CA654C8BE66306544332631C 1hein
438,331,914 *2C6C9391BAC5118EDFA938CC4E2941B53841D313 bz_=d
438,331,915 *2C6038C75BEE07D1C193712BDDE5D6E652B0A8D4 1KELLER-BUERO
438,331,916 *2C6FAE040F7D1A1BBF93FAA57D1205684E3F33C5 1989DONTFORGETYOURPASS
438,331,917 *2C6ABB2B692B8B50634CC2CF55847890AC3A014B 1-moldova'nin
438,331,918 *2C635090C883AEC2B09E8242C33324B83A88165C 1.MUOTOILEVALIKOSTA
438,331,919 *2C6CB0EB8524A1543813E336823C5A5756AAABB0 1N5URG3N
438,331,920 *2C6CBA696443D5B253D4D366C4F2D02D9E8F7647 1.nacy
438,331,921 *2C6F64DEC5F60F0E1D2B528922428B5EF6E95ECF 1-aids-bezogenen
438,331,922 *2C66E09285B07C60689A1B195065902DF1B08509 UEVELVET3
438,331,923 *2C6B4788C05C6829D425D944B51FA98F88CDD1B3 1BAGENDEN
438,331,924 *2C6E88B166CC13F4DA6BC95B88BC2EEB0AE6C791 UHNDTERLIGHEDENSES
438,331,925 *2C62EA468BCF469BD022C5EAA5DD52483CE53CA1 1ohjelmareserviin
438,331,926 *2C6B6330979490150AD4C56F28549F20D97D11FE 1 PERFORMANCE-CHASERS
438,331,927 *2C6DEC6D3E74E665734FC48098EAA4E57D60F737 1-portsmouths
438,331,928 *2C6B01F0A4D353E38688234F2D08745CF88C0EE9 1.prewitt's
438,331,929 *2C6912C3B813623CE7D9C84781368483156DEABE 1PROTESTANTCATHOLICJEWISH
438,331,930 *2C69EF5E82B67E2B8C8787282708C0FEB446C93C 1rabbinerschule
438,331,931 *2C64AF494E779523CD0A284F82BBC33FF99821C2 1.sauvolaisuudesta
438,331,932 *2C65F297758341CD1B1C198C677E8F4429B9BCA8 1czubay's
438,331,933 *2C6EE79A15D01D8999BD4DB73730818A7E99B056 UMGESETZTBSWS
438,331,934 *2C6F1B6FA3E8C3DF4EFB9BE3073694B87D1A3FCF C4S.Q
438,331,935 *2C6ADE4F237F9FE12F99F42348FB48D5A71E900F UNBEZEICHNETE5
438,331,936 *2C6B23517CA5A9838D94FA8CC381AC557EB3C017 1DREWPING
438,331,937 *2C661587956881677C90AC6D78E089FA7EEE43BE C7R5W
438,331,938 *2C608D052CCF75841F0DB3601A8AB88552F43ED2 C9H!D
438,331,939 *2C64C923AE6BE7C1C066D72C93E40AF87E8B0F46 1-taidevaunujen
438,331,940 *2C6B351763E4B199815943722836AC9C4C1E1AD3 1 euty
438,331,941 *2C6627FEE0BB2AF806A7D605A28A34AF1D518849 1TRANSVESTIITIDE
438,331,942 *2C61D9EC34C7AEDE2CB7F5D2D53E2198F81D620A CAGRA
438,331,943 *2C6155B0C693C198EDD7505977B21742E45A4B1D 1.veistoksellista
438,331,944 *2C6FE39132F1F0379FCD536A7B8B0C52F17D4E3F UNREASONABLESED
438,331,945 *2C60CFAC39DEAD80A3987747A14CEA6AD0803503 1inclinational
438,331,946 *2C64376BE7BAFB609DF11EC7D2308E5E50AD6632 CAMBRAI.7172
438,331,947 *2C6951D9306CB521CED9DC486268D80AF8FAFDF4 CANDLE.IN.THE.DING
438,331,948 *2C6FF2C8F143DA32DF7BB845EC4852DD34A237FE [email protected]
438,331,949 *2C66C589448EE50FB79A5C5A68B6E522F0347341 CARLIE-SUTHERLAND
438,331,950 *2C643F71784EB4C94654CA2869A5F7BD2944C3F2 CARMELO.CARRIEDO
438,331,951 *2C60176578339D326743F1FB7CC23F0046004E82 carolyn-steiner
438,331,952 *2C6C4B7C14790F10846813ECE030044E529970CE 1 MARTIKAINEN-FLORATH
438,331,953 *2C6700C85738CC8C310A4BB3A2214AC0E4F5E889 CARRION.CHRIST.PREPARES.TO.EXPECTORATE.INTO.HIS.GREAT.ABYSS
438,331,954 *2C6AB032C21BE5F4DBC3CFE061B1795BBD48CAB0 CARROLLPLAUCHE
438,331,955 *2C610006696D3925219D26632046980DE02A5139 20SEPTEMBER1493
438,331,956 *2C6884271726413F2312A48214DF17284986C3AD utrakwising
438,331,957 *2C64C082DC743DA839AAD14C83D31FA199A155C8 1ortaklarInada
438,331,958 *2C69133A2D7EBF7547C16114D8D8E518B6476E01 1PADMAJAM
438,331,959 *2C6E1A71B20051C786C803EF7EE3EFB31ACC23E6 CATEGORIES32JAY-Z
438,331,960 *2C6BDDA5696F889BA9E06E8BFC992578D1417A2B CATEGORYPHASIANIDAE
438,331,961 *2C6776624282EDF7DEDB843A15A5CC3FE9A8E870 22STÜCK
438,331,962 *2C676FB32924945A0CDC0B054D8477DD78F3E3D4 CAUTE'RISERAIENT
438,331,963 *2C60BEA98E0AA916730669F2AAE2EF16DF735272 2445142 SOLANA:HAETTENWIRETWANICHTFAHRENSOLLEN?
438,331,964 *2C62641E56B040CA4EA7AA392DA1B5FF4852D5E5 1RATING-POINT
438,331,965 *2C6E3CE7F814EDFF7274A927B8E865402069A8D2 24.ARBEITSKAEMPFEN
438,331,966 *2C62BF2847BB3A3AA99EFEA5DCC33CDD8785E188 CBFN
438,331,967 *2C6D6BA44813746F744FDFD1136EDAB2FE24DD0C CBO)=
438,331,968 *2C6260AED143DD195B68B5D593C0FA8076235071 cbwa
438,331,969 *2C6288A2206E985D3A7A2659A227B224AE8C0870 VALENTINEEHLEN
438,331,970 *2C647030268FC4C26E79C7191ADFD6EB4D3B26BF VALENTIN PAZ
438,331,971 *2C6372A620F1C767836F99E0B1127DCE5E80E21F 25LAMACA
438,331,972 *2C6B490F5231AC52D67B0A2801E450232B8E2534 1.TAL-ROUTE
438,331,973 *2C64213D4B8E838DBFBC5FE8FA84F7A729D0AE65 2641718 ALUEEKOLOGISISSA SUUNNITELMISSA JO AIEMMIN KER
438,331,974 *2C69B918B7E852EA49A274CF04B9618BBB23EBF6 cd7km
438,331,975 *2C64166B626D58559A84B4699FDFE419EA022C5B 1u-bahnabteil
438,331,976 *2C616F8C038FE3076856358ABDA9E679C1BE583E 1UUPABGEORDNETEN
438,331,977 *2C6AF1872EBB8A19F7AFE39CC9F16AE8362E2ADC CDWTW
438,331,978 *2C65491D7E71FAA67E59BC2B25CC5F88081FBDAA VARJOTAL4
438,331,979 *2C652B49C939755F52EEA721A5273EED573D8CD0 1-vietsint
438,331,980 *2C666D2457574B1838043A73D5E12FCB1B74D514 1WAERWAER
438,331,981 *2C676D43D36C454A94250D42D3DAD209F392DB7D 2807134 puh 8851 643 tai 0407185 395
438,331,982 *2C6A5C230D0035A3D8FA38575B537D2531C59E49 CECILSYNER
438,331,983 *2C6DBE32ADDCCF5F4425061107A4CAE4AD2AA352 VAVKER
438,331,984 *2C646E5FF040678841559E2885585E321F2B938A c"#ee
438,331,985 *2C6FEBECCCD4C46B33EEF1C41E7B75CF9B33AC19 1-WILLERST
438,331,986 *2C680A5454762511772679DB2A890AF178400705 2atk-yhteisty
438,331,987 *2C6017AF8DC45B73494787CA83157DAAADC98DD9 VENDAWARDRUMS(A)
438,331,988 *2C6880C0E4D9707BF5D133A11833AFD41D5BBFD9 VERHOOKS
438,331,989 *2C620D6DB897AEA5404EBE20C47A3D5C1E4D33EB VERN.LAUB
438,331,990 *2C65B3342F4F917EFEE66D1017CA566C6FE304A9 cfd=%
438,331,991 *2C6A22F24CA0791ADFB9BF0769238CA4F56A29AE vernon-webb-jr
438,331,992 *2C64E7B2F868DD3D752FD0D211133E01D8BE8730 2iloveviolin8
438,331,993 *2C60D55244A2C3F659A4BF8C9B9D544DD3793A2F 2.LTD:LLA
438,331,994 *2C66A754474CF78F731F6E7D074AE6EFA597947A 2 PFLANZENSCHUTZNORMEN
438,331,995 *2C628FE82A96AABFB718AB70D9CF617599C0A8DA 2 TIEDONVAIHTOILMOITUKSEN
438,331,996 *2C609CF52F9B683924BAE32C433ABC64DCB04C38 cg=yo
438,331,997 *2C6F5044A66E579460985A84E1C54E3AADC5E98F 2.VESIVEKTUOTTEISTAMME
438,331,998 *2C62E0DD0244B1797FE1088D415A79BB608F4C3D CH4$T!$3D
438,331,999 *2C697D4EE40AB9E8828E7536B6968176E871AA11 2zeitgemaelde
438,332,000 *2C6865B0C64DD4D4049E1F0A40072E5EB44C73BC VICKYPATRON
438,332,001 *2C617F0734B66CC757E8776AAE7D180A347698EC 2:..2..#..&...SPELLCHECK
438,332,002 *2C61B7A9353DA1AADEE0E7882DD04537A25625B7 31-uyeligi
438,332,003 *2C6E3C067C9F16D7FEF7D853FE85A9300B6228DE 337769 hatta-fazla-sicak-mi-ne-?
438,332,004 *2C6749B3743A83C98C7148204172396091F4D73A 34045 bitiSiGi-/-ICel-IsmetpaSa-cad-
438,332,005 *2C6D06D89F78A700F6A3E1E3414BDD2BFE2E7C24 CHANYOUNG09
438,332,006 *2C6BF42EDB05733F5AAF3721B4540D14981DA04D VIENTUĻIEM
438,332,007 *2C6D7E2E9FFDE3078A586B544ED9F8B43713FB1F 3751<LTHE>
438,332,008 *2C627DEB54ACD82D4687122A21EFC6C7CD1F7B0F CHARLESGENT
438,332,009 *2C65719D6F71B94E031BB990C7090340C0D509BF VIKERIED1
438,332,010 *2C673CB0DD9B9CDB5DE846C389DC204EDD39576D VIKKI ANN TATA
438,332,011 *2C601EF548C21C0B6DC86C67036608E3A1317492 vilmalin
438,332,012 *2C65664966491D4BF9458C5765973EFF9EDBD9B4 3-becancour
438,332,013 *2C63A4810D7BF2E0F8F81AB88E1137AB2C544A14 3==b~o~o;)
438,332,014 *2C64A490C98EE3D38AB8210C7CBC42E42D6CDDD1 VIN-NAIR
438,332,015 *2C6447D3B15E87572CCEA22753BE3B4BB2DF65CC 2667153 odotan kuulevani muilta osallistujilta helsingiss
438,332,016 *2C6AF5415A4D9117C029DF1A3F13D4843C44B3A7 26DIERS
438,332,017 *2C608897B514BFF4C9BC47BA429BAEC809D8B299 3---D-~-~-~SPLAT!
438,332,018 *2C67267A29B0B95221DB82A9D0AAB7FA5D8D6317 2762439 emme-kuitenkaan-ryhdy-selvitt
438,332,019 *2C640F8C8FE5D628B7D51E6B7CCC21B8525C54C8 cheetahtest
438,332,020 *2C6D2D74207C8BDD5F503E6809130CAB500155AB CHEMINER!
438,332,021 *2C635F0CACDC73C12129539224ACF5EDD5F8B88B VIRGILIO.CIERSEZWSKI
438,332,022 *2C6FE3E5D8D8176BEDE96B524E71B575F748D727 2960165 AY-.JA.YMP
438,332,023 *2C696FA829030BC1E44C9882B25DC33358F0C833 [email protected]
438,332,024 *2C6BD8E3AE61A51CEE9CCD229752BE714BF0441E 3mytrebor1
438,332,025 *2C60E7187EF0B6B5835DE153C44C17017EA7F1E9 chipiga7
438,332,026 *2C627ABF1E11D50506D2F38682525C5AF226F94F volkantet
438,332,027 *2C6FF48133311A97E4E5AC454513EC291D41F628 40TESS
438,332,028 *2C6DB8553512D9CB140E468E171D1CAEF44F9652 CHRISTIAN.KRAKOWSKI
438,332,029 *2C67A2FCEBA9B466891A03DA9AAB3EE7FC295ED0 CHRYSOPHAN
438,332,030 *2C6E3D634022426BD59B40D84F8B6B7635766661 [email protected]
438,332,031 *2C612F6EA0A807205BDF01BC2B24F32B8C0FBF63 43FJ
438,332,032 *2C6AD8555390D778AC18350E09B03E1149081009 vVv
438,332,033 *2C635A8453D0BF077BB4F0C049203AE3AF0F783D 45 lapsilisist
438,332,034 *2C6B3ACEC13A99BF1F6251121FA08DD6E3A92E5B CIPANGO0
438,332,035 *2C65929ED8562C1E5D48493ED781DF7F69E27E4A 4DANUELLE
438,332,036 *2C6D5DCAFE7C8F2266A606CFA8A13A80C90E49C0 4 DRMIC
438,332,037 *2C6D408543CE1A368C48C76CB7326C52EB442530 4EADITAMM
438,332,038 *2C61426124E7A198F72035A055533313A6471EF0 2 MALIBU-STRUB
438,332,039 *2C600F776442908711C56374CB69AF1949C45B38 4ILOVEMUFFIN1
438,332,040 *2C69C0A1BCB0905A431EFF639DE0D217E8CB19D5 2.preisreduzierung
438,332,041 *2C66C8C4C776E9E79CD7BDAF4E457CF67E1633BE 4MISBAKSELS
438,332,042 *2C6C87D75CAD8B457FC27C962FA6F2D358B522FA 2-rockefellerin
438,332,043 *2C643CFB96311404FB8F25DE34CD7F58716E4135 2ROOMANDBOARD
438,332,044 *2C6AB04F41A3458C38CB854E24AB614265B24479 2SALIGRAM
438,332,045 *2C68446F1D930BA9299C86A3C17375E72130045E 4PHOTOABSORBING
438,332,046 *2C693A3773AA7B0656710D8B4239A0EA8295F197 4PRISUNES
438,332,047 *2C647A0139E02462BDB9736215B20569F56ABF67 wanformatie
438,332,048 *2C69177C5A4C1A25AA02607950E2A4F373F63FD5 c(l?
438,332,049 *2C610521EECF1AFB0641B4CCAE80ADE798F90593 wanyfj26623261
438,332,050 *2C67AD36590BFBCE96FECFF5A6D044BE5112F64B 4STRNGBRND
438,332,051 *2C60FAC3BF6774059C6754720FCE38C1EB220253 WARNER.RICAUD
438,332,052 *2C6ED6B645737D071A000134DB56D1ED0EF18CEB claudsmythe
438,332,053 *2C6C7D6ADB92C97A63446AC0A939D57FC544EA56 CLAY.STICKELS
438,332,054 *2C6D5D0D9E6AF69BF4433DBBB15C7E622F1208E3 CLB94
438,332,055 *2C6D3E1E24FB835FD04D24CC4DB915BE3E1E5531 clintonjakowich
438,332,056 *2C682DEEC0002E8D9B801055091157D79D371D7C 38000pg
438,332,057 *2C65509FEA766F18A435848205A4DEA97647050A 394SELAH
438,332,058 *2C67E4A5F5003F672FA3D542FE3D5861743D08B0 [email protected]
438,332,059 *2C69F4C740E6DADE1A1946A905DF7F2F175FFBEE WEIERSTRASSTRANSFORM
438,332,060 *2C6CB71303564F5DD4CB993911573E7152E3082D [email protected]
438,332,061 *2C641F6C4C1929A3817111556E3FD490EFCE75ED 557ALFREDO
438,332,062 *2C6AE195BC39756ADAFB7A348AF298FEA5001A52 [email protected]
438,332,063 *2C6427D3668D66F02F5B8ED0925A4B7721C91D3B [email protected]
438,332,064 *2C66EE1BF18A0BEA0C357E8E58C34D0FE0FF326D CO5TOCORACO1D
438,332,065 *2C68FF98AC2DCCE9E50DE54409587731702772FC 3GDJVG
438,332,066 *2C63D46D8DF5208D785969A12FC305AE64216F06 5CIANTTNAIC
438,332,067 *2C6C935B284BDA8B675E8ED4A96641521EF2077E 3.MAYBO
438,332,068 *2C68C58F3963993590D85B8F949B4E6871189F0F we-zullen-'t-wel-zien
438,332,069 *2C6B08A54B2E2B712493B6E5384DDB75DDD01A38 COMBINATIONISLE
438,332,070 *2C693A27EEA573A003C02DD09672D438C88A6310 3OVERHEARTINESS
438,332,071 *2C650BAC6CAE4DF9F224734E37075E43B8430BC9 5EKSTRAKTERNE
438,332,072 *2C6B7D380C41A00A8E175AD4C672121A638544F2 WIDDLYDIDDLY4
438,332,073 *2C6A571905F58089BC93698A0FCF87C18AB05EC3 3xac3r8a7on$
438,332,074 *2C6C767D490715E788599DC39BC1294153A128F4 3XH4USTUSQU3
438,332,075 *2C6C5217CD99E1EAD8DB834C80652141FBEF200A 5GUAGLINO
438,332,076 *2C60B453AB7E7D31566A2E869CB019710E41A2CD 5.HARTHOLZ
438,332,077 *2C69E67D17FD1D669E2BC362B2051FE837A303FD 40-KIRJASTOSEURA
438,332,078 *2C6CBFB4EEC8885DE09DD74BD803EABD8DD1703F 5HERSHEYDOGGIE
438,332,079 *2C623DCA1DEE1559891368DEDE01B55601AD2DCD 5HINNIUPBSW
438,332,080 *2C67C856A585F8D7B72A346C77DEE3B3FB0598C4 CONFIREIS
438,332,081 *2C61E290230D30650765A1DAA11F49E6C6F22903 5LUCKDISSERVICEEVIL
438,332,082 *2C6EFEB0A64B6DB7B5FEE392F3FED825B77BA702 więcławicach
438,332,083 *2C6C7893936FBC35682B97DC68E5E641F29A1777 WILBURLAVI
438,332,084 *2C61C95CF1869A65E88F198C10C5343B7F272B89 5NGMAKING
438,332,085 *2C692D8B3E428F883811646D70B8D6C9A591E2D9 WILFREDO.RUGGIERE
438,332,086 *2C63CD32D4C74A692E8F95BC40E05B3D459596E9 5OVERCONCENTRATEDV
438,332,087 *2C6F8D6678A15A5DCA4205957BA524A09FA5F5E6 WILLARD.BAXA
438,332,088 *2C63282EB076DCD70470DC40C00405D6689D12EE CORREN.BBS
438,332,089 *2C6DE88E619198E561BD86C930247C362B3A6348 [email protected]
438,332,090 *2C6CEC6B9D9E602A1DA3FB9A97D56A216B966011 COSECANT3
438,332,091 *2C67479C226A81D33B22A22B56611D7DF1C3CB89 4INANCTIR
438,332,092 *2C60C4EA0025721A074DD3BBC2EC399830B41032 WILLY.KNIE
438,332,093 *2C60F2D81B8E65B6E0444170B68584464B4F0D4E cpd&k
438,332,094 *2C6E9D62AB9863A11F1DA39E506F473B369D243A 4POLIZEIFUNKWA
438,332,095 *2C672D8987F446C0DF3F8196B0D5DF27A0B3ABDF 662197 OLENNAINEN-OSA-ON-KULTTUURI--JA-MEDIAKRITIIKKI-.
438,332,096 *2C68C54ACCE6F5E60B0277C2230A926C5ADCD39A 4qlnk4a9i5
438,332,097 *2C6F14EF87BE45D5CC3CFAECDCC96A957E3691BE [email protected]
438,332,098 *2C6A0EEDBCE6C11C29833DB7B7DBE6BFFE1564A4 [email protected]
438,332,099 *2C6C9F516F734988E9F827F202929E0977B7F347 WM.BIRKNER
438,332,100 *2C656BEF3CD8D8AB2496D83429248D0B0467D2D3 WMGAMBARDELLA
438,332,101 *2C616BD8344F23E01FC38E26F2DDF8D034EDA80D 4RORATNYMI
438,332,102 *2C61171361419B50057FBC140C632B377CA7A9BA 4TATTERER
438,332,103 *2C60EA2F38F65AD615747B5F369B48689F253C71 4thatscorpio9
438,332,104 *2C6068FF1CFEAFA620F336B5EE5304EC1643CB75 688098 niin oikeassa he ovat
438,332,105 *2C6D029EB34E8EAF151E5723E4F6B307142AA9FF [email protected]
438,332,106 *2C66A85DF933DCF8DC444463977CA7BD7AC77C97 52e0cf9e93e5ce8fbe4c9db7c72c8caf-flatley
438,332,107 *2C6153395621E6FE3E4B5C8D80ABDA84CEAAE9E2 wukenqun
438,332,108 *2C6AD881E51458A444C1BE5EF356A9FCE8E9C438 6C5CC0B61F9739249269FFBB54C2697D
438,332,109 *2C6E8BB8474120E43065D4A62F1D0F0B50D1D5E4 CSS1Y
438,332,110 *2C6E34A5F54655EBA82BDF64FAC09BDACF6F6D04 WWW.ARIPPA.ORG
438,332,111 *2C6A9F15BCE4F955F59EF1438613CE84AD791CCC ctf-e
438,332,112 *2C65868045B9F48C1CEC2157CA849F7630E55BD1 5AKUNTALA
438,332,113 *2C68AA57855CBED6A9E107391760D26B750C4D83 WWW.IFOCAS.ORG
438,332,114 *2C67F16D877E66E1CE736EAF8A4371B675F826AA 5ATSAKIRE
438,332,115 *2C6112B817095BDD3197A129FC229BFA87BF59C2 cu8fo
438,332,116 *2C641DD39F832FABF3BBCD3A2F8182F02F980E54 cucr8
438,332,117 *2C63A0F0FB2DC3349781AAA55F6CEB0DCEB3509D wwwoldprintscom
438,332,118 *2C67B969AC4997C7A97EB97C34238CC509C3CE9C 6MGFSSYSJBSW
438,332,119 *2C663A712056FDC7522112A401AF81B9D2636515 6MIKEBOSTON
438,332,120 *2C60A2F525494C96A19ECF96BA72EFED40138D10 [email protected]
438,332,121 *2C699FEC2593F65B6F92E424164C11D154A24F99 X,2)
438,332,122 *2C63975B9518AC039B56B9AE64C1C932C7D0F46A CVARNADORE
438,332,123 *2C6FDF6642D5B41AA3684B026973EA37EF7C6853 6PONOVITI
438,332,124 *2C6AC4677F497CA462396FB9A0B6583BB17F646C CVE06LEZ
438,332,125 *2C6DFEDBA9C5F92D7D5D4DB7E2A210FF7DC7E0C0 6.TEMPAISTAAN
438,332,126 *2C6F408DEEF183D370E19676D795AA95AA3665B4 5KIDSKIMBERLY
438,332,127 *2C6221A56437295BF03ACDA0B9940194C1C15708 cyslosilicates
438,332,128 *2C6F3F9CACA2F6BD254C2519316B771414666EC4 )x(o~O~ q3
438,332,129 *2C613C339702BF59EE07CAAAEAB09EDAD7FC8C0F d//,
438,332,130 *2C6133C18ABA7E6414120E59CB0926FB21657753 [email protected]
438,332,131 *2C69FA032B88146F2A5FD892E0B6DB4B19D99B64 5NEWTONVOODOO
438,332,132 *2C69A0E9020620CCD2C5A1FE0C5BDBE3DF959CFF [email protected]
438,332,133 *2C634E8E28D088418411E928D6781273E7C79C0D d&=2)
438,332,134 *2C698412C13DB837ABEF31D1475507060F9A8F6A D=2Q&
438,332,135 *2C61C6EB9769619F928BB20E099BD3B5EC673C01 xxxavier
438,332,136 *2C6246505B0FDE54BD77DAF2006613803472FC1A 773francis
438,332,137 *2C6F0A1179D86BF6FC7A5150622C9A11F990567C 5SAEILYTAET
438,332,138 *2C64F981D85D2C0ACEBFD48624AE25E547FCB7B3 d52c;
438,332,139 *2C646D1E1933DFDA39A485D6D37F06335A7D2FF3 YAMNA-YAQOOB
438,332,140 *2C6408628D639583DA4340A736C896BEAC2253AE D6d,
438,332,141 *2C6E76D10C6C5D996F2742C382A9F71BE164C45B 7CRACHERS
438,332,142 *2C646E6239EF04252343D76B5C513D500E83F38D D"8)
438,332,143 *2C62F36027A7DF116B4388366A61E69F5E126965 YENTRUOCEEDEED
438,332,144 *2C6F31467717EF35564BF48EA44B7CFC3B68B7B3 D9MFO
438,332,145 *2C6411FE90F1497E1A140D4A23F1E04A02BFB43D DAAY0
438,332,146 *2C67586E1F56B10556952BD8B0408D5BC50DD2EB [email protected]
438,332,147 *2C63E939581BC2F53552F5AB2D8711EA36F49B5C 7ELIONORE
438,332,148 *2C6867A0F056BFC819E4846FE3FE2D2368D84C0D da:hb
438,332,149 *2C678C8A95DDA4A51BAF8767697FBD26CD8DDF47 [email protected]
438,332,150 *2C6752DD4647185F3EDBA23539CFF969D4D94651 DAKTYLSES1
438,332,151 *2C694E6BB15F83BDC49D68A2C77B0D84234C00D0 DALEBARKLOW
438,332,152 *2C6A96CB71B686FB3479E8C1CA3C55EF70F32970 DAMIEN.KIELMAN
438,332,153 *2C68F709F089D24FA04377C7FFC2541863569B7A danielle.pease
438,332,154 *2C6806042486ECFCB9C56482681F4E7616FF197A 7KONINGSA
438,332,155 *2C6D1602960ECD62F5108E550AF73EA1F4B12FDC YMOTCENOIC
438,332,156 *2C6D9E067EAD154C6FDBEAB1C20A361C83AC386D DANNY-GERVAIS
438,332,157 *2C6E491E69F9F51AFB58A71480124D011CDB8C2B 6ATAZZINOGA
438,332,158 *2C6F41314D94E7C99F2D0F4FA347227FC38D9656 6BABILITY
438,332,159 *2C6850594023DB201CC4099635A48B873B5E9C6F 6BEADMITTED
438,332,160 *2C60E89E7BF8F94CA2AB7F113DCF5E7B279D3C90 YONA.PAPISMADO
438,332,161 *2C6C39DB772007B53D69669F81DF7CE3B86CAD56 YRATEIRPORPSTHGIR
438,332,162 *2C639012CCC837926F82E7039EE31C78694CFE14 6EMARIETTA
438,332,163 *2C68AC2418DC72980E826BCBFEA5755FA7129AF2 YTICCIFI9
438,332,164 *2C69E372831FDCCF7F8E75C3E8CC80BF5BD6E159 YUKIKOHOSHIMOTO
438,332,165 *2C68D2DEBA7FFF92DB09D395E9721E6A903AFEB4 DARYL.NWAGBARA
438,332,166 *2C61DB4D7DA808D3C6E87F6F3FC256A791B9A7DB DAVIDBILLICK
438,332,167 *2C6B74B94940AFA4159555D8DD9B992A677C0F05 DAVIS330
438,332,168 *2C62E3FCC1280DFADF27BD43A8883062161B4ADA DAWNKOKO9
438,332,169 *2C6D20F660516692F971403538532D7564C92BC1 6FSVOLLEN
438,332,170 *2C6DDAABDD203EDADD9823EE6F8B532E98181A1D 6HIEROMHIEROM
438,332,171 *2C669A38D2AEB862D84DAD53247F8A60AC61401D 7THATMARCEL6
438,332,172 *2C6EA930715EB8F36211DE618D7B0DAD146E7983 DCKST
438,332,173 *2C6BE3A14A4EAC3812BD0D41E9EFE4FE91F3AD17 dd0+p
438,332,174 *2C6E0424D071B1F73975DE7290F3C31E5E355473 DD2PD
438,332,175 *2C699A7E6C010632372161C3362E64E2D034C016 6OFFSTOPSUMMARY
438,332,176 *2C66A2D130906B02C7BA3C3E1F0E06A128208AFE ZALEDIMED
438,332,177 *2C66C825102FF5AC012F90BB94F701FA1EE5E781 6-oluyordur
438,332,178 *2C617D5C140CB237F55AC444FBE7E96BD14AE43E DEAFENED
438,332,179 *2C61D5690BDF7A86424711C3AB8B4524BE1FA56B zcz!
438,332,180 *2C6B8F18C86FFC395ACB4DF85FC6AFE0293F8439 6ujjxw9e9jucwm
438,332,181 *2C678F3FFDF99C28D57F8E96E40E8F0EEE7B6996 718104 ein problem loest sich fast wie von selbst
438,332,182 *2C6AF23CBC32F82C798505CC02A87F0BDA738A6C 728KAREN
438,332,183 *2C635D50767FD6E1507C429FD023C47F2A8FBE7F 7ABCDEPEPSI
438,332,184 *2C6789A82B14CF0E1EC584E3D5F9671C66F3F25D 7BSWDAMARABSW
438,332,185 *2C6124C8FB58667DE499B2F778CC20A25A5613BB DeineChance
438,332,186 *2C656C54E0D0FC5C3AB6D2612E2AB981A1196EBB 8BSWCDCDLBSW
438,332,187 *2C6DA57056B604147E4B491C6B35A2278A98EEF4 DELOYALE8
438,332,188 *2C6CF286888CBD054C69536C997DE2F18249BDE1 8COULDEN
438,332,189 *2C66A2858984EFD4AD465DE0F21546983EFAAC07 [email protected]
438,332,190 *2C60B5F246C2DBDAFD7B2F5D8B269F03646ECC66 7EPYCYCLOID
438,332,191 *2C65772436689AEE581A59CB4BADC34B324B3E78 7ETELAEKOREALAISET
438,332,192 *2C6813676CF54700396C1093AB8016A63D76A338 denisesandoval
438,332,193 *2C663687300DFF0C3A6AC0E568E623073F9E9AB2 7INENEIP
438,332,194 *2C66F53127BB320AE700258EF0685196BC4FB764 7kasvatteihin
438,332,195 *2C6D2E99D467A499AFB5DE71756FDB14FD75A128 denverheitmeyer
438,332,196 *2C641F5A7682CF649DE5B9E4120FFA157CEEA4BB DEPARTED-DETAILS
438,332,197 *2C642E6B44496FFBB156C48FD7618A3C8F3725A7 [email protected]
438,332,198 *2C6657A509A5275FBC1937918A8655C815F3F43A ZPASCALL
438,332,199 *2C62F02C606AC881F7C0D2C4ACE393BDA0B452F8 [email protected]
438,332,200 *2C6681CBFF71A988C6365771F4A80F32A34B0EFD 8JEANACTION
438,332,201 *2C6774A04BB6C8933A85AEF21B30FF32F59FC982 DERRIKNS
438,332,202 *2C68F517B92E499388C87D6BC13E767661F21342 de!rv
438,332,203 *2C611B88092018FCFD0FC8AE6D3E50A9FA6E505E ZWILLINGSLEYER
438,332,204 *2C6382E73BCC023BE75E2D1953D0964FB1AE2038 8misting
438,332,205 *2C60C3EAAB6F52D7577CDE484F24CAED969074AE DEV\\3
438,332,206 *2C6CB3F387DCD73E1BE3035999941082D95C6D83 8=P~.~.(0_<)
438,332,207 *2C68D2D8CF05F1EE0F79F112B7C4F0C489D6AE50 [email protected]~0-~OSPLAT
438,332,208 *2C6681C82AD8F1DF586A228011C29CEA300F4F30 8afgejaagde
438,332,209 *2C676C9CC34C9D7CFB428D8D8AF7ACD386521475 dhaval.kataria
438,332,210 *2C601785AC2004F9A84EF254621C1A0A3C0114F0 8TRISTANCHARLIE
438,332,211 *2C61DA4018C5A88CEB1CC5BC6871ECA55D9664F7 dialyses
438,332,212 *2C65D9C8106BD5D9C1AA6BB5629DB1D2D944BE38 8YELLOWMANCOLORED
438,332,213 *2C6C5C67A6D6347FA749999267DB39B62CA9BCEE DICK.CHEBRET
438,332,214 *2C6C73DCBFBFB004BE59BB4F47CE8BE648033BCB DICKEYN4
438,332,215 *2C621EF0C531ABD665C0D7C869C9F49B626DF0C7 DICTAATSCHRIFTEN
438,332,216 *2C6D88A6EE248401A44170E322744D0E654BF060 980RORY
438,332,217 *2C6F0D432F17D199707316FA170FBF2C6C422837 DIGGER42
438,332,218 *2C66E950841E5F5D1F67332A11870B883D4482C0 di:l
438,332,219 *2C6B917B1542D2030E2F39F76C5266C5AF19A236 8finkeitels
438,332,220 *2C66EF02B8C35AF3ACEBCDACDF7E187E2FAED529 8FLAGITAVISSE
438,332,221 *2C6579387D02E42644B68EDA3B29BFE5738D1535 8FORSTOLENES
438,332,222 *2C6C9FD6ABE0D4D851D34A1D2068702F050B2008 [email protected]
438,332,223 *2C690FB55676CF47E7980B88D90C6DF0F15D538D ИНГЕРДАХ
438,332,224 *2C612CBFC4B10688B1C29D13FBA330DA8495E757 9BSWSEEGOBINBSW
438,332,225 *2C67DC337BE65DE6CE92932BC6240B50E7362F1D 8IHSOPNET
438,332,226 *2C62801AB3F944B7EE5F2FC2A2E47E982A68A425 8JUHVAANO
438,332,227 *2C6578F4A8BE15DDD0336510DA60D7259CF0CD8E DION.UZUN
438,332,228 *2C6252E1B065BEE934CE4ECCE71BB5D1B6313F4C DIONWINT
438,332,229 *2C6565CD87A2A4050118086FB65123CAFACDF19C DIRECTORIN
438,332,230 *2C67E2C1A4B8D3F30C02F991AC3DE70CF87C4A12 9DETAILVORSCHL
438,332,231 *2C6A14AEF178B4ADE92289F000BE5F0BEEC43656 dissipasjons
438,332,232 *2C6424AE137CE0BCAD4D6040E3E2E62163140979 8#####P.~.~3B<-
438,332,233 *2C6C9A06D72AB78507DF9E7FF6D560F081026762 9GRETCHENDENISE
438,332,234 *2C605A0A68F762504EA45DB0737BA4BBB32F19D5 8PHANGLE
438,332,235 *2C60371AEDC2C2C88E316BBDC9E07C88D7B57B8D dj:v
438,332,236 *2C6FEDB59E03F0AF749A4E133A42CA2491013D4A 8QTQAHMOGTA
438,332,237 *2C650A461B87BF8A4B41205B51DA5259BB431A21 9INFECTORIUS
438,332,238 *2C6183E01949A944EFACC78C177890293261CD48 #D[KNR
438,332,239 *2C661A4531242E2E7D22422BC8DF817A5E914632 DKsY
438,332,240 *2C6C05B92E480340E07305047010CD43B131F55E 9NELOKSTS
438,332,241 *2C636BBD09220FC05EA6DEF9195185A5A524A485 dliqtnnfing
438,332,242 *2C6A8A877F6D507388995A03466C92019AD5C2AD 9NOKUUST
438,332,243 *2C60B01FE166C413425C15620C4B4F0954B0297A 8UPAAKROSHAT
438,332,244 *2C6A909DC425081D9690D94C56D3C06D6D0E8E72 902404 SELITYS.INTERNETIST
438,332,245 *2C62AD56D1125748ADCB94D620866115985FF463 DN#C/
438,332,246 *2C6E31E749940ABF6B1654B0FE0165563F65B260 DOMINIC.JEREZ
438,332,247 *2C6602540B7D2E4B98C91869D38C61AD55D4755E DONAVYN5
438,332,248 *2C62E8331787DCA5B83EB03CB983C6FE426DEE36 a1zmh
438,332,249 *2C6EF57680C332EB6538655EBDB1CC1EA1F6C803 DON MCCLURE
438,332,250 *2C6CC40E1AEBC30493D944E2C37EE8F7654C079A 9BFLDBSW
438,332,251 *2C67B87215C65FCD8331F7447A6EAA4F1A65ACD0 [email protected]
438,332,252 *2C6D4F44FDACBD738FE96DBA4B1A32A0F9D4C0AD 固有名詞の場合は使用可。半角英字(IやVなど)を並べて表記します。
438,332,253 *2C6383C4CDE552E5FB84A80A1E0EFCE1C96B76BC 9CHRISSYDOG
438,332,254 *2C60149C145FEA4339812E8799FC0543BCB9C666 9COMPAQBENJAMIN
438,332,255 *2C61EA6EABFEAC508220C79064754887BD71C506 dookiebach
438,332,256 *2C62BB1992C48AF65858952F2373EAD29C66FFF0 a6
438,332,257 *2C697093D4C9CA385656C554DC55DDD5491C4693 DOUGLAS BUITRAGO
438,332,258 *2C6B1066453843137C7876F57A53ADB3BB5A7D24 DOURTHE-VA-PARTIR
438,332,259 *2C69EC72CBBD0BABA2B4E9D86A7784A89E6EC32E D?&QS
438,332,260 *2C61D5B85FF688A29AB04FDAAEFAA1192475BF32 AACTH6
438,332,261 *2C677439C571FC4AB6B8F67CC68ADFB860F7A2A6 AAD0JS
438,332,262 *2C60459F44F11DBD3BDF0827F207E2FC651E4B7F aado$3
438,332,263 *2C6031206AE95915BC15E83886F405D904C53538 9YLLATNEDICCANON
438,332,264 *2C6631358E553EB3A3C72A0DFBFB0F3AF41D7442 ab&-;
438,332,265 *2C6B1873F6F33C5627C6C6FA9C432967BFF7DFD7 d%u6u
438,332,266 *2C6F02229F2EC9ED4990CE8B2EA0CC8CF49F830C A2PH0
438,332,267 *2C6C81AE739192B6C996CBE6FB91F7A6146AD23E a5+r
438,332,268 *2C613F9D65E22C08821ACDCD56180A20A3C69AB9 A6F3C
438,332,269 *2C62BA005F14E703D35C5C41152AB16369B4015B a6tg
438,332,270 *2C6544627EED28CF2B470BFF19F72E51265EDEA9 DUSTIN.REIO
438,332,271 *2C603D0504A07E27A201A85AB67A2E0D93B0C935 dustinzaretsky
438,332,272 *2C6F2A3A28605C2D6037A87816615EE06735A9D3 D?UW#
438,332,273 *2C66CEFDA8BD35482596364DC541888DB83F30CD dvbl
438,332,274 *2C6B4852A325A1412618C445DDCA7D1E0331E824 acconigliavano3
438,332,275 *2C69AA5ADB69510115D06D6A7354DF58F2F1B5BB [email protected]
438,332,276 *2C6045822A142B45D5477D0C9B928CD0C038D4F6 D-VKR
438,332,277 *2C6A5FFD927C40931E89F6233C41F4201461E1C8 DW9YA
438,332,278 *2C685432884A21590B301116E05F1009F1AA1CBB AAA]^5
438,332,279 *2C60144C6AC58208B9001805107EECB05F05E836 DWYS
438,332,280 *2C63230BF4F784D7C0CF4D37B0AAFA72A2BE7282 ADAN.MACCALLUM
438,332,281 *2C6607FCD03C4499516B391E42E9537A75B6D582 adcga
438,332,282 *2C60F70D95373EFD46EA60E6365E9799BB73A188 ADU}(
438,332,283 *2C622F2609BE8A5C49D932E5122E1C1130E60487 aeg70
438,332,284 *2C699D71524A07D7BFC734A0A0FB2625CFE6004D A-BAILAR-LA-RUMBA
438,332,285 *2C6B818B72974CBC4DCBAD8840728CDC7FE21B10 ectoproct!
438,332,286 *2C6E35C42FF3ED5DCB68A7C93728F2E00F46B9A7 edhimmelright
438,332,287 *2C6F643F1E568C359DCC5BA45EC84A41B867EAD4 ABGESEHENS
438,332,288 *2C6A548D7270895CB7341CBD80B999CC161EB14D ABJUDICATEDS0
438,332,289 *2C6689D9C902BA0A7CEC0B6C0C80B8417B478467 ABK.Y
438,332,290 *2C633573E4D5A2DFB19C957B3A8C6D215478A30C 1511971 nevertheless.,.he.says.,.".i.plan.to.run.again..."
438,332,291 *2C6EA642B4E3783228106A32527C6F969090F840 a&g)s
438,332,292 *2C6215F7A2D3D193AAB0394910FF7B39B0247B47 aguaity
438,332,293 *2C61E4C7EBE84B2045DDFDAAE094D8DD48E710F8 ahmedkoizumi
438,332,294 *2C692FC62BDF37BC81125A94BF8E111E7BBCB6E9 AHOTS-GARRATZEZ
438,332,295 *2C63976ACE595ADF48EB0C4B06D6246326831B13 ef8vl
438,332,296 *2C6B7DCBAA888F7D031F584A7C1B24D79AB5609C 1745546 VAI ONKO JO MUODOSTUNUT ?
438,332,297 *2C691821C4589A364C5BD05607E12C228CB1D88D accozzati9
438,332,298 *2C6C6F33F7549A0DB44EA72540D37EA466EA0CB2 ACG+H
438,332,299 *2C698CBE53942B68051C9B6F4986E189E37F9CB1 EG(V
438,332,300 *2C6BE3B02D7DB94B0260CE62A029175CB7DA072B EINWOHNERVERHÄLTNIS
438,332,301 *2C6AF8C2AAF32905F9A028D8B788402285149BB8 198154 the-intex-unit-makes-a-computer-directed-wheelchair-.
438,332,302 *2C6592FE09FE84A211C1BB4B0FD19F8575C811C7 EKSGYE
438,332,303 *2C697787F50551B13ADFDF932FBC9594AE225D40 AJ;"!
438,332,304 *2C67EC0AE60A0BCC1451B0186752683BDDE53FF1 AD7J<
438,332,305 *2C660884F2D7120F9404F28B7FE47B194691A790 eldonagron
438,332,306 *2C6AD8E8DB17C53596E3C697065170BD04517C22 ELDON.HITCHEN
438,332,307 *2C624E7DE1509D264A44C7E7226412352CA55803 ajzn
438,332,308 *2C6211C76EE3FD767662E0310D056ECE4C55AC4E 1.agazi
438,332,309 *2C68522B3760D543CBCA73C2C4355EB5A2F727DD a{k1
438,332,310 *2C63B79AE4772D89AB3126C281A474DD337FD5D3 ELIAS.REFFETT
438,332,311 *2C642AC910D02AE8CEDA95CF8AD4765453FC3D0A ADESTYANINGRUM
438,332,312 *2C666B0FCDA5ADC30ECF4086A68287872DD779B8 1 BILANZFAELSCHUNGENBEIM
438,332,313 *2C68757D9DD48922DD0A86A3605745F4461A66D6 ELLIOTT.KIE
438,332,314 *2C624253562E2A95E61B5D764A34C22CDB0AA899 al=ab
438,332,315 *2C6EB0A049BD0837F98156E5866129B7F46FCD16 adonis525
438,332,316 *2C641E66069AF7E44010AB96AB82828CF7B025E3 A/DRW
438,332,317 *2C6CFCDFA632B3073BEEDBEB00EE4C1B86693D43 ALEC.JUNCKER
438,332,318 *2C6095A5EDCAB5CC82C8DD2628A97CE818C64619 1EMZIRMEMESINE
438,332,319 *2C64A1FB6F02D50AD379B3A304F5ED79FDE6384A A+ECR
438,332,320 *2C6F94951F31CF2DF05D296988946ADA1B3C0066 afn,9
438,332,321 *2C6EA8EE23713C61AE39243021AB6120E1BDD798 1KAPUSTA
438,332,322 *2C62A9C2B1A7132A9E5240A9A9DF0E28394F7C02 1-KNiBBS
438,332,323 *2C610367ABA6D71D5F514BB50AECC221E52F04CD 1.liegendenden
438,332,324 *2C672DAB1B8F1472D20B4B5DBBFAA92E37690468 agnathia7
438,332,325 *2C6C2C2F6F831E3C1E4E4DBF08F9B4F6B87C32C9 ALVA.DINUZZO
438,332,326 *2C6393A9945E0FAFAAE4666E83D91CE28A54A704 alvarobeamon
438,332,327 *2C6CCDCB24028D05F3E905791B2E20F7243A0E85 AHAM8
438,332,328 *2C632F1C75CAE3B261F11B27D203DB7E28EC23E8 am&bb
438,332,329 *2C629323B53546163E29EA32CBF8C7AC7D80D637 ameliegraymail
438,332,330 *2C6982D83BBE0FA135C640D2F50DDD41B53F06A4 epgms
438,332,331 *2C6B974A5EBAB9E61C2109E62C7C6F7222A31633 er5o%
438,332,332 *2C607B550F24A494980831E57ADEB7A282436AA4 amon.418
438,332,333 *2C62ACE3E26E113347F695D4526C75B0BBE057DB airshot
438,332,334 *2C6A07A76A2C8C1674AA649B26ACF55985F457F5 AMRITASARREKO
438,332,335 *2C688FFCAB65828290B4A751A028BA4CD36E1C3D ericschmale
438,332,336 *2C6645EAFA4B39D5C03FBFBF7D194E454A9B2C14 andaknave;whichnotwithstanding,thoushaltbe
438,332,337 *2C68C4E2480088120D6318A6D31DCFC2D00B0270 aksx2
438,332,338 *2C683935103E27A42E734C499C3D72178C60E6F8 1-THROUGH-TRADE
438,332,339 *2C6CFC95BCA87FE234B5CED795C9CB53BB6A725B alan.murasso
438,332,340 *2C6DD11FD27EC38401D69ABC4F22BF22A464F802 EROBAKO9
438,332,341 *2C64792EDB49A65AACE6C1AC07B072E0905A3C5E ersendet4
438,332,342 *2C6E5A76AFDE7C276C63F4478EE038E82C9B1793 1.VERTEIDIGUNGSWAFFE
438,332,343 *2C68DE41162740BF153F6D71AE0178162DBA39B9 er!-v
438,332,344 *2C6800C239D445543CFBD75C9B86EE9FDA619694 ERZAEHLU5
438,332,345 *2C65E97FDBD49F8C1702BA429F0E8C14977A0EAA [email protected]
438,332,346 *2C63088CD90C02CDBC4FC1D09E7BBF7D88FB0C48 ale)b
438,332,347 *2C61C363DEF1A37385473DBD36B90D29897DB7D5 alegoria-malarstwa
438,332,348 *2C649570FD81A9B546329FD21AB481030F7837AD ALEJANDROENDOW
438,332,349 *2C642D9674296F0B6671F5B1EF6376BC16A03158 esx_=
438,332,350 *2C6F892B7AA242E83C7F1271D4FD67899C9D6BEE eth0e
438,332,351 *2C6C0813E2A5C42BC43CB1C93EAA7D48B7647F16 alexander-sumampouw
438,332,352 *2C651660910F2DFE5FD6495AFED0ABDC632BA74A ANGESNOC
438,332,353 *2C60144DB6C4B28D78DDB7B21D7EA295C6EF3868 ANIABW
438,332,354 *2C6AD4409F98BF24E7EA80E8E6EF0BCAD0730606 1YUPIN1234
438,332,355 *2C66A71216723080999663D3D76BF873B42DF2B2 20060919: PALAISOZAKI, TORINO, ITALY (DISC 2)
438,332,356 *2C61445FD5326A0585981794A77E960077388BEA a#li5
438,332,357 *2C6FD62A36D5461A9301E76A7E74B4FF02F1C180 ANN TRIMBLE
438,332,358 *2C60B6CEC6AC61751710524A537C679F0E1C6998 ALINSAT
438,332,359 *2C6C91639AD1A7C70CE7BBBBA7D82D8BEECA0799 EVERYNOWISPAST
438,332,360 *2C632B7212418FD4A2BA4896D0558EAE23B52C2A ALLYOUCANBEAT
438,332,361 *2C6EDBF4636DFEE4C6B67CBA34232E7DFE55682B ey9:r
438,332,362 *2C62027117CB0E39EFAD41712B3E0D6E955853B8 ALWALEEDNASSER
438,332,363 *2C63079C47CD0D577F6B1B32B24AAE212AEF367F 22NOV1327
438,332,364 *2C6A835A9BA80EDFF7F3DE3B582B5F82F26334A1 AM:TD
438,332,365 *2C63D66823F6DE1144A4CCFA1F7094994FA64A6C analogverst
438,332,366 *2C680A29CCCE44206C7D058A4A91F5E9477B5E34 APRICCAN1
438,332,367 *2C6C9DD52FE75D8CBC1E3CA2F960594AB50A238B fapo
438,332,368 *2C6DA007FCB31B172DE1D8E2B0C57A213CB06562 FAUSTO.HUTTI
438,332,369 *2C642A5BC3A6B01DD9BC8135C24B9ECEB0F6EFF5 aqfpu
438,332,370 *2C6B4F7238C7EE537DC9C938574065DFA5F4A1D3 Aq(M
438,332,371 *2C6321F315B3F4FEA7B6E2A074E282C30498FCB5 arcticmaggie
438,332,372 *2C684BE5D899D4249AD933D5A96CE74ED5385CB5 ARNOLDGOMPF
438,332,373 *2C6D7D323B4F299BB78CD1DA7352A7DCE1084C89 andre.villasenor
438,332,374 *2C6C504E59150D2479E1872F1D3496E25E6D96C1 fiadiach
438,332,375 *2C6A4CBFC32A497754035A9FA2D701A67670A56F FILLEYBROOKS 1 0
438,332,376 *2C6BC4CC1047BD3D880D88FA0CB42F7AF48D3E71 antifreeze-&-aeroplanes
438,332,377 *2C679DA7F180620B3C0D15D4BD44C31EF88361A8 ANTIKB
438,332,378 *2C6ECC60571C2E4F092898A903921EAD83C1B05C antoniaraschko
438,332,379 *2C6DAA7A42090EC60057C1372C590C88B0E17294 [email protected]
438,332,380 *2C69E5B54F793180C302896F36A277E2CA9B8417 ANTONIO.EASTWOOD
438,332,381 *2C63550EB163A76C7B19A600546CF7965FE597E0 ANTONY.HESSELBEIN
438,332,382 *2C6BA0ECAE3C57BCBF01EA5C35505A4B7D05098A [email protected]$
438,332,383 *2C6898FF3A539BA4DC3B58597804338A2A88FEA0 at2ga
438,332,384 *2C60F69858AD6B25EDE9E54A3D90B8392201F76D 2EXTRAAUSGABEN
438,332,385 *2C6A955BAF4C97FC63B15763A56807CCBD61EA28 ATHLYNES
438,332,386 *2C611C5C819ACA8962D36E7C0E36FE9A35ADBCD6 an%xg
438,332,387 *2C6E08B6BEA4B513DDB98EA61ABA062DFD945CEC 2ilovesweden1
438,332,388 *2C6EF9FD69C4A26AA5ED3D3DD259941CBA48A089 aokv
438,332,389 *2C6ED00AF2A1E35DCB274336732DB064D407E33A A%#P+
438,332,390 *2C6AEBCCF378E7C11086D4A2B6E63B22DC9B816A 2-kuva-t
438,332,391 *2C6F637333D217D13E396488EAC4EBA35F319C13 2night-to
438,332,392 *2C6A315D27201259E699FF53058939C6F1A55D89 [email protected]
438,332,393 *2C6C4F658F6F6A189105597B8711CEB9BC6CAF91 FRANCIS.SOLONIKA
438,332,394 *2C62F3DD82418D149AD0A2A8C3D873ADB07BA127 2 SCCGESCHAEFTSFUEHRER
438,332,395 *2C68E8CC2983FB07A4573F59D612A7D01B88ABC4 FRANKBURUNDIAN
438,332,396 *2C64D9574790EB6668A9D74626AFDC1B1AC1D00B AUFEO
438,332,397 *2C61692652F42F4A2096FC501C7743617D5D3950 FR!AR!3S
438,332,398 *2C698A4CEF4E35C04A96B21C5252FF5C1B9F2B57 3==>-~0~o)8(
438,332,399 *2C6DC50A49D64F03D9A791086ABBD60B8F3F43ED 343209 muinaismuisto ja suojelualueet partiissuo / hovilampiyl
438,332,400 *2C6D367225D3902BF0DA9558F48C6F28C95FA419 34-mm-kisoja
438,332,401 *2C6AA084AD38F713CC0A4ACAB12F356A3501DBF7 AQqn
438,332,402 *2C6CAB41166239373F0C70B46BBF43A855712CB8 a(+r)
438,332,403 *2C69A34A0A7CCBCC705F90D44F1A75A5FE2CF091 FRUMENTY
438,332,404 *2C6893EBDEBD08F3340C38F1AC1A2D3B264686B5 AVERYSCHWUCHOW
438,332,405 *2C6ACAE519F2A41B76D849EB1F68A112A2DCAB89 F<U!
438,332,406 *2C63DB5628597C2BC870D00CB6B8C80F207A6404 FULL-MOON-OVER-DALLAS
438,332,407 *2C63E55B5B5320035CC90ED045FDB4FA18293C7D 3--b`~)o(
438,332,408 *2C66EF896927A74A34AFAD68DED2EBB4F6F5F548 [email protected]
438,332,409 *2C6941FA1CF93E5C0EE042C843DE79D540F761CF 3d113746
438,332,410 *2C6421AEC1CBF0CDAE013BFB047C4564D0BD1A0E 3d ~o(>_<)
438,332,411 *2C66F78CE97454798FAB13340B4668941F0FA938 aw:t+
438,332,412 *2C60119D78A4DE9763EF10A80818EF09C28C6B7B 3JUN1862
438,332,413 *2C62757D59137042E57521ACB71FEA0ED5977340 garryoleskiewicz
438,332,414 *2C6AC6899E5B68456CDA0FBECE1BF2A3EE94745D GARYMCGRATH
438,332,415 *2C616AC9F110668200AA9AF658186E9FA3BAAC2D ARTPHI
438,332,416 *2C68A3D102EE3C6890BC30D8F300E85C42A8BFA8 ase,b
438,332,417 *2C6591132630EFF910F2555F6B345A84006BB52A >B0***Q=====B
438,332,418 *2C6434974A6DD6001D1E032CA46319BE7CF65A21 geluidssignalen
438,332,419 *2C6D32453858241862F9941BB8B3E0C517A82F55 425AUBREY
438,332,420 *2C6933BD3231203E44CE080E3D360FAB8AB60821 GENSING4
438,332,421 *2C67E8A74E9CF5C8DD8AFFDA426ECE80220ACA8E GERARDO.MEBANE
438,332,422 *2C64F00609041B5A0FDFAC45060AE755923D4078 at-._
438,332,423 *2C66028726C92FA7F612CBAED8D2DBCC4201A07A b3o8
438,332,424 *2C68920D1A6B7EDCBDA7A5626ECC44F17F590A36 Au41
438,332,425 *2C68BAA40BF25704153B873850A871E6084790BF AUD8&
438,332,426 *2C6DE1A1C2BB3684DE7ED5C8248D98399B01E7CD B7JKI
438,332,427 *2C6DFB860E51347E412C28498CF3328F33C47BD9 AUGUSTUS.LERWILL
438,332,428 *2C650D0E74F3DAF32EFAE5EA2396AEB2F588EB3A a-u&j
438,332,429 *2C63F65CC30B9F6446C4DA979767C798F71C0C51 GIDEOMTOO6
438,332,430 *2C6C3C215E9287B4C7C8E1C27F7B7666957E3755 4ILUVSUMMER3
438,332,431 *2C66922978B0ABEEFD32FF80CD66818EF065359E a_va6
438,332,432 *2C6B8AE334F046EABE4E898C77AF3B0B513B1B1B bachroxy0
438,332,433 *2C614587F5E010B49D086F4091251FCF1A2EF4D1 AV.VW
438,332,434 *2C6E664426BA58A5BAF1123164EDC8141475EF08 awasoruk8
438,332,435 *2C66A96C5309316227DC7CFB33B9D57EA4AEC5F3 BAIKETSU9
438,332,436 *2C658119E3AB961A810A947342B50933FAFC22DB GLENNHARTSHORN
438,332,437 *2C68323F8CB4C7C3E67471B20210C99017989C37 ayqe/
438,332,438 *2C6BF105B01D280BBFFEE2503DC949947849A197 bartonbruntz
438,332,439 *2C6AEBADC53CAFB1F6479C631BEFBCF165F61DB6 BASIL.MCCANDLESS
438,332,440 *2C689623C588BF99F2FFD412045647E2951729CE ;) ~` ~`<----b
438,332,441 *2C67A373F0EB13E487DF8E58B83C6087EFC23531 [email protected]~.`;)
438,332,442 *2C64154F08B5ABFEE2B8F420BE49C28A3967E977 [email protected]
438,332,443 *2C6129F233ECAFC6951EAF2E43D07BD245D781AC b0736ca4e7ec3361702a4de41853500ehellohi
438,332,444 *2C6455EAEBC5E3D541ACFB606CE5FF5B0485BD3E 5+4L4GM!+35
438,332,445 *2C662BA54E9970C2867CEE02E42D785D3081BCD0 b).*.*.>b0
438,332,446 *2C65B4F27A0282CDCCC946344E034997DFCDD92B B#B~O (>_0)
438,332,447 *2C6ACCF0C67138997AF0F66ACE52C91FE7AB387C graigkinniburgh
438,332,448 *2C6F4F9DFD0F8DCC14DCC28542B85FAB51CE1A6F 5COUNTRYRESEARCH
438,332,449 *2C6AD608B69356174EF66F211180F9C849123A46 5DRADERIGES
438,332,450 *2C6E1882A6BFA722F984D381A0B00848480753C7 B4PT1Z1N
438,332,451 *2C64452132FA8AB7A080213B3F831FEB2B9B9A81 b4rc0
438,332,452 *2C6ABD133986ABAB365DC06E8272C9EECD5957C3 b54)b
438,332,453 *2C63E4410254B22F9108766F9CAD07DCB86FF483 BCAU)
438,332,454 *2C61721FB67DDB1B0E323CD626224BE746C28ED0 [email protected]
438,332,455 *2C6B9799F02A23D0EBCE9D35481C825D97E27DE8 b8tl
438,332,456 *2C6E5D351361F6AA9843A559E1E9264EB5D1E008 B95212
438,332,457 *2C62A2D91F7B69543BB5081B97C72BC1712CB980 GTXT
438,332,458 *2C6A4B6218CDE68825709FAC9D6DFE336C132202 GUADALUPE.GRANNEMAN
438,332,459 *2C6B231D17F6DA4497EA64BF270D6DA7C2C40970 5MYHELLOHELLO6
438,332,460 *2C64DAAC1219195805545CD246622001FC87D50F 5ROXYPASSWORD
438,332,461 *2C6457732D97995363906F0D61DCD1E499CE992E 5SOLBRILL
438,332,462 *2C61EB5AF00475F88EE1C3561B210B489AC4892D GUYBURGMAN
438,332,463 *2C65ED6CD160B2BA728EE9035BEB5F51312BB558 5SUMMERTYLER
438,332,464 *2C6F37FB0596BA156EC0B8A4C37569A50A8175F2 G:VH
438,332,465 *2C6A0109AA0799647F4AA2F7A95803DF11DB7BD4 [email protected]
438,332,466 *2C66CE96BBB2FE4E7633E291AE3F4577C2076574 g";y
438,332,467 *2C683D5F14FA90E33FAD27ED9A7142520772D9F3 bennettstanwood
438,332,468 *2C684F3996505BA49F829F6AB1036FB81EF102C6 BENTON.PELKOWSKI
438,332,469 *2C6CCEBA8D967B4074B33C93BCB749B233D3FE7A bajnoksã
438,332,470 *2C641AEB1E04E84B0447C324167332319C6C981D BAKAHREV
438,332,471 *2C6A85CDB3713BB23D5689F71CD9796C418180E3 haeiritsivaet
438,332,472 *2C62D9AB78031A27686230F458B06223EA36D3E6 BAMANANA12N
438,332,473 *2C60183DC76575D47A5F0251C257D9A050A29566 BETOKENS
438,332,474 *2C6EF0146CB64928FB83CF7472292852AEF5E0CB BEZNAMIETNIE
438,332,475 *2C609D7FD031633F21DA6458458617E3BC1C897A hanstyron
438,332,476 *2C649ACD076248A3F58CF13FC64496C6097EFC00 BAROCKISIEREN
438,332,477 *2C67E02CAB384EE0BB1E34AC745D306C7ACF6F51 BARRETTBARTHOLF
438,332,478 *2C6D218C1E9719CE7BBEBE61D3883B50903F8D0E bf9fq
438,332,479 *2C6CAB8BE6FD34B7B8CCFD1274953FC986297200 HAROLD.TELL
438,332,480 *2C6A22EED7838F83530FA821853973A659C67F4F HAROLD.VASTARDIS
438,332,481 *2C61D56B0087EECB462C28AFE03A8FF4AE10DA1A BASTARD-(ALBUM-VERSION)
438,332,482 *2C62426EBD0938278DD5A3D26EEF28C945C6EE71 6ASSARTTRASSA
438,332,483 *2C64F0CA29EDB2EF03E82DFFB422D3CED0F3604C BGF_V
438,332,484 *2C67893E56D0C072F8544C3D1899BFCA0F099F3F bb7b9-dim.-(beg.-with-half-step)
438,332,485 *2C64FA5F2C86163A679B5CF84DEF9C95BA84DD0E BHAVYA-GOPALAKRISHNAN
438,332,486 *2C6ABA21DA6ECBE2FAD77A2B947272E7760107A9 6davids8
438,332,487 *2C657F4A263391A3214AFA79EB3C36504C67861C b=hgu
438,332,488 *2C62DAB51EAEFB9549A0D16B5874737043BD8AD4 HEATHMCVEY
438,332,489 *2C6D72816562E48654B09CC894BAC2CF7DC59F0B HEATHREEKIE
438,332,490 *2C696D9929BD95F5F6DDE88D79DF6D15E2A5ECB6 HECTORMODERO
438,332,491 *2C694A223E8CF33FEAFCD992726025037FDC7BCA H/E/DSTAIRWAY'ST/(@)/R
438,332,492 *2C60CBB8164FFBF08E0AB5DEA976EF2E450AE513 heirig
438,332,493 *2C62AEC70F333829A659D8E1213780B43251FBE8 hernnyt2
438,332,494 *2C645F02D23BFB591AD8008DA035C4EDD415186A biaviciding
438,332,495 *2C670002F221DB500C142435B0A46BDD8B83B526 6DIRIGENTED
438,332,496 *2C6D53434D02C86122AD63C4131E055F481A2E2D bca2m
438,332,497 *2C6FDC4A21CC253D2986CB4A7C1D3C7D28FB7477 BD0ST
438,332,498 *2C60A0221761B78B3347354211ED07B504A6918C 6KONGERAALS
438,332,499 *2C6D4F199ABB1780BCA6F49E4FDD6928C96F3D0E HIGHJACK 'H/AI/,/DZ//&/K
438,332,500 *2C659E70F7BF8DACB85832DE969BDA682BF82252 6MADISONALICE
438,332,501 *2C63D9D4D62D6D39E67DC49BD932CDFF842986BF HIMANSHUDEY
438,332,502 *2C628BED0683A7DB68045206E06CD48ECE2621FD hiwr
438,332,503 *2C6D4FCB8B8E221AE84DF25F8B25D288460C1BAF BEDECKEN5
438,332,504 *2C61E373DD0ED4EF2C4150A9A51CD49EE49FB5E7 [email protected]
438,332,505 *2C6904ADD00E184FC74A3833434D110578C4ACB1 BEN.HUTTS
438,332,506 *2C66E9F8AA0588835B6F27B4682424CED52D9F35 hofbankled
438,332,507 *2C6F0DBAAEDB802AF01C34DB7240E25BA25C62BF BENUEBSW7
438,332,508 *2C610D5A3CD33320D6681B586D90F4BF46F208E4 6STEALTHBASKETB
438,332,509 *2C680B0C1200F71E60208CCEB10D9ACC62D4EF77 BLAINE.FUNCHESS
438,332,510 *2C6C648E2310FF2B1F2EEEFB0DF9BEFCF3FFFED9 BLAKE-EALY
438,332,511 *2C6371E6C57F7C9F3BA509CC0194A9EEAC19EC4E 6UNIGNORANTLIES
438,332,512 *2C6CAAE1F1143BB6096DF248EB5D1E51253607AE besogoodinthefresh
438,332,513 *2C6D0F873166DB1937C052A91107E22861B87E5E BLOODY.MARY.(LIVE)
438,332,514 *2C6E8DDBB7DDE6CCF04458265F1C1084A2F7F3C1 [email protected]@ck5
438,332,515 *2C6A940D247FE67863C86513B7BF276A1642DD6B HTTPWWW.SEACEX.COMDO
438,332,516 *2C643E6AB96C03851585A8DA5CB3FEB08E7C2569 hubbieamed
438,332,517 *2C63243AC88BA32050C82EF6DD815E95E6FEEADF BHMX(
438,332,518 *2C61E4127A87F6D6E83204723384E4500B1E4D9D bo4z#
438,332,519 *2C60FCDF1C7F37898C004BCBA602FDF6652689F9 7GEBELLIF
438,332,520 *2C6232A2477F0D7547EEC6BDB6723BB196A9FF85 bigryders
438,332,521 *2C6691CBB6A52442A95994D4F38FFD59B6849F23 b(oc
438,332,522 *2C63FFA90A0EEEC07A3AC0F6B1586408B626256F bofk:
438,332,523 *2C6402D69037AEE47DA3A3E3FC4AAA1F1AE2F492 I125199
438,332,524 *2C63D9AAB69B48E29503AB691CF014F793A5DB41 IAMGOLDFISH95
438,332,525 *2C6D3B155977A951D26DD4A0C848408493CD7720 BILLIE.LAUN
438,332,526 *2C6E982C7B546DF6B8C11FADCA63EF8334B8552F billykocka
438,332,527 *2C6FDB13E33A541576DD7F3EDE83CFE57B68E706 BIMODULE9
438,332,528 *2C637628949FA14675AAC0DA6323723D42902CEC BINGOCARL7
438,332,529 *2C67E51F92E7B309DB96DA60D9E1AC4FD97B6E94 7PIGSTICK
438,332,530 *2C6B5221E0021EE91156E9B2AB05435BC3975C19 bj?vl
438,332,531 *2C6D1B35AED8B0D91A24F4ED7BCFE4EC7FA2ADD3 IFWE'REGONNABEATEAM,WHYNOTBEA
438,332,532 *2C68B1404DD6A1D946EC02A257EBCC60F318DA83 bl4"
438,332,533 *2C6E1A7E0273FD74A8927DECA05FF9450C62714F IKE.VICUNA
438,332,534 *2C6FA0311E57C74359F4F610B4CAEB90993DBDF7 BQA4,
438,332,535 *2C6525E93F8C824DB03E9BCD85B1FA2B9DE5F708 7VX2CZ3E
438,332,536 *2C63B322C9FCF0B1E6C5425CC0D744AEE9EA6A2B ILOVEYI1314
438,332,537 *2C6D61E70AA22338C9632524286FB4ADDA38560E BRADLEYMERLO
438,332,538 *2C60A82BDBF8237546F1B36C32B2B2E540825C95 ILUKURUD8
438,332,539 *2C69D81AEB123CE417457152CE93940087A02561 BLOODRED'SBESTFORWINTER
438,332,540 *2C6F6BBD734BD0A5BB72BA89B498057C24AFC6D0 8AUSTINANNA
438,332,541 *2C6D85CF308E6B82D46D148671435CEB549331DC BM.HEMPEL
438,332,542 *2C692D28B4A653641BADEF40D5E422EEE35A0082 inconditionalsupportofbeauty
438,332,543 *2C672908FBD191A275C5E6C9D469BAC049D3C445 @8H0RRER$
438,332,544 *2C62565F26FAD47E933A18C59DDC2D13A41AF5F0 BOCCONIA1
438,332,545 *2C651B9A714FED3659258EB7D6440A961E92BF98 INPUTBUS0
438,332,546 *2C62DABDB06765A56BD4EDB32E73AE88C64039F3 b;oka
438,332,547 *2C6DEA8899F0F0265DA798D26377630C624C247F INTEIST4
438,332,548 *2C60FBBB91D2C1A128151AC8CE35A6ECC862D0D7 8KSMATIGE
438,332,549 *2C67B3633AFCD469C6B69CB865EEDB0C65D4F7EC 8MSIREMOSI
438,332,550 *2C604CB5508F7EC57325565D8462683D83A82013 INWOLLEN8
438,332,551 *2C6233DD889EB60F0CFFF86F3308D4F019CDEB20 IN.YOUR.LONELINESS
438,332,552 *2C6CD21E2006A50062009F1E602AB3455773078A BSGNUNOH3
438,332,553 *2C68E0470B54865E61DB93B8F803E72F5215FA90 BOYCE.PENDEREL
438,332,554 *2C626D5BCBD73EE66831A87083A27CA91F873BDA BOYD.PIN
438,332,555 *2C6B73EB8C75C767E210F5193A6E8AB735367F90 B!P+"
438,332,556 *2C681CAFD5917AD82F1090A470A224119AF3DBD0 bpmtwist
438,332,557 *2C6A393F1018384B1F79B7ED21C07743CEAD8D11 B+PP:
438,332,558 *2C6A4F1487B05B97840DD8FC85D7C19F723DCC9C 8theturtle5
438,332,559 *2C6BF34AA7E20006F1625981A6062D26D22BFA56 BTTRAS
438,332,560 *2C62FACA79C0672A83C5A0D5A4F55BD96D85682E BRAHMS:-COMPLETE-EDITION-(DISC-40:-CHORAL-WORKS)
438,332,561 *2C65DF1157AB12A4F991534E05C4DD2F342F3B9D 978594 voitrastittaauseitakohtia.
438,332,562 *2C6CECCB0B8732F12BD0A27485B6EF6BAB247E86 BRANTHELGET
438,332,563 *2C64F0BDEE2173B0726A6EEDCE11210C47BB0586 breezingsequence
438,332,564 *2C6B4CEF22A069E8282A7F9B52127C52C2589C1A ja.dat.is.cool
438,332,565 *2C67C827FC5AA4B28883389E3A02B98BE13124E7 breu/
438,332,566 *2C6AAE1C89BC9C21D9E059FCF66BCB25AF8B87D3 [email protected]
438,332,567 *2C6077C96CEFDAFB57C0988CF493A14E06C8F3DF burniss1
438,332,568 *2C6C82B5996A8202DC4EA864ED670507503F96C7 jamalloosey
438,332,569 *2C6A7E3513342CBB4128CE4ADB60AD6CF7CAE38A JAME.FUJITA
438,332,570 *2C6EEE6744D1AF8EE343115E3CDD40BF42A2D786 BUSHEL'S
438,332,571 *2C6E27AEBA5D003015BDB65E4F41D112A1690325 BUWDBRK41
438,332,572 *2C67ECAA6CBB591F1C60221C44B77B970E895E6A 9LADDIEROPING
438,332,573 *2C6AA4C8248CBE2C70A908975BBCCE81E1B9F139 bwfkp
438,332,574 *2C6FA4147F82BF87A5BFCA9636E41DD1B60C91A5 b_xac
438,332,575 *2C6A5A3B753B122C258793CB475CF98C9D9C2463 9NTALEHTI
438,332,576 *2C61874C889ECF4DC01D6334EA64984A59B9E881 B,S5J
438,332,577 *2C66B5D2BA094EE53E056E2934176FE07BA348CA JAZBIZ
438,332,578 *2C6075831AA144D7EE4FC69DF47E746538274437 BYRON.HUTTS
438,332,579 *2C6BB5BD4C452F06E41298F000F71DBBCE4D5E5B by%td
438,332,580 *2C6F951846A786AD674CCB31708FBC342760104A bswparanandibsw
438,332,581 *2C62EE074E844275D6431304122337D88365846E 9SUBDEPUT
438,332,582 *2C675A5905337A60F8987F576B7D74092D47168B 9SUPERABSURDNESSES
438,332,583 *2C6F632EF0A5DEA9DB0544CDDCE2E3085093286E c0mmenda70r!1y
438,332,584 *2C6F519F2598C0D82B995AA62EB2ED3557B44602 b?uc
438,332,585 *2C693D190330A5E52557F701A1A9C173238D48FE C3K2R
438,332,586 *2C6B86293DB5397BA578AE50AFE544A0946B469C jesslattanzio
438,332,587 *2C6FC363B6CE3A6B9BFF7DE6437524055534B59B bv-
438,332,588 *2C6D589244D0E25814568B9629C66351810C80C4 C4Y7E
438,332,589 *2C6D2A46DAC725545C478235BDBFF9DF7F10369E JHELLESTO
438,332,590 *2C6BF2E2248F83B7103AE4AC8FCBDA1459F9E103 c5chr
438,332,591 *2C61B552BF7C05CD7B24DB0BFDA02E7C95FB2723 A2rq
438,332,592 *2C64A156B8F8A8CC0301AC79B6D94DED57B301D7 JIM.CEDARS
438,332,593 *2C66AC0BE19F009CCB592CC7FEEDBA22B5B8100E JINSHANG1234
438,332,594 *2C6CB0DE92A172390654937FE6E2BAE965085F09 [email protected]
438,332,595 *2C65D4C340CF0AC60E5F0F406DCA46ECC7195325 a)#&4
438,332,596 *2C626779963D8F85576EC7F2C2E206F341B1A24D BXPPB
438,332,597 *2C6796EA1E2E6013CB9379DB9CB1332742DB14E7 joe-ciulla
438,332,598 *2C66341B8E53155EE1F63E9620444A49E1B12512 JOEGURECKI
438,332,599 *2C60A7BE80DAFB78ED7AAFCCF790A90E0C9D8ACF c9j(
438,332,600 *2C6BC7656B6DCB435008917FF260B53DE9008FEA B-YEN
438,332,601 *2C65EEBFD2160E98696E51B990E64FCE920858AD CAIRNGORMS0210
438,332,602 *2C6CD772449F421A1C5503348FA1EF4C544D73BC calebkuehler
438,332,603 *2C66D74EF4F7DCE5C6EE5351E3FE3F1857A4FB62 JONATHONMEDERIOS
438,332,604 *2C6ABE0BD14AF188CA1CAC2F79504AA032797C26 c+((
438,332,605 *2C67DDB04EE088BEC8C02DC5EEFD8A817EF7C396 josiasing
438,332,606 *2C65DD6B034DAAE5694701F515C210B168BCE8D6 JSEDIH
438,332,607 *2C671991AF4957ABDBFBF4ACD1A91D53EDB4431C [email protected]
438,332,608 *2C62B123DD9B886B5AE0F8DC2DD3F898D57EB9FC jtorri
438,332,609 *2C6DAC967262F14A5AADB6C58C8B2D4051F83F5F [email protected]
438,332,610 *2C642DFB7B1DB4B8E9288713465317C93249A2A3 JUJÁÉHOZ
438,332,611 *2C6487DCF59157FE917658A9C75155BD0D9202E7 c7?_%
438,332,612 *2C6A9C66D99C622BDD8F4D88D05C6A158A15777B K96641
438,332,613 *2C6283E0A04FFE2AE79CE59B017E0DE2F8B5FD78 kaffeetrinker887
438,332,614 *2C699897091B32923047D09A839B5C42496FB1F6 c&$84
438,332,615 *2C66755CD1CEC924E7A87BEE007605F95FAD9174 C=8a
438,332,616 *2C62838AD43304888AA3EC2282A3CFD64C9BA513 CARMELO.STOROZUK
438,332,617 *2C6D5672F01DFE0FFE2D5FB1A02BEDDF56C90B55 KBRPLP
438,332,618 *2C6D1A93212165140D36941ADC362F92C1B64DE2 aadm{o
438,332,619 *2C64505738583AB8D3B7D6454568BA91A19B3863 aa>t?
438,332,620 *2C64B20BC306A8F0CA57C14022F81A94D790B31C kennethtauras
438,332,621 *2C6172ED84A00B3A398D73C016287652E40E8429 KENNYSIMON
438,332,622 *2C6367178B1C1AF232E97926F76F32BF4CA00FD0 CATECHUMEN
438,332,623 *2C62ECE98A188502D3AA351DE7B53D2A879EC675 khulood-alawneh
438,332,624 *2C6ECA78A49248678C351C099F0109B94C36F84E cbwa
438,332,625 *2C6A2EF49DCA9A905C7571868C8686DDADDCBF53 cdi8l
438,332,626 *2C6841E65E74901E036CEE7EA5360B5981A160A6 C%AOK
438,332,627 *2C623DBDE869B8BC75EDF7155707F943606B7D87 ABUPH
438,332,628 *2C614582EACDC03F28E104AC447F91933674E2C0 [email protected]
438,332,629 *2C663C3CB4073ABEA7915EF26595250811268C35 Acc5
438,332,630 *2C611F7B0D22A710638D2DABEBCBC6CE42B1DBC7 carolrumfola
438,332,631 *2C6EBC8171C8E120524013BF180A3E3A85D6B8D9 CEIT)
438,332,632 *2C6CC7C3F959B603ED1339ED7626B89FD7F8C351 ACMY
438,332,633 *2C6825BCC37BFD189601B44FDE7FB059E0814D15 ACU!A
438,332,634 *2C6D3DA2DAA82E2571CDD98A58DE8BDAA779FFD3 carsonschaar
438,332,635 *2C6B1FDE90302C5B5EEFA14185C651A88B06A4BA kriminologit
438,332,636 *2C6410DCDA0A90E951823858592190F03086A424 ADAM.GRIEME
438,332,637 *2C62707C1C5552FDA90901CED5A435FC9E11057F ADAM MURRELL
438,332,638 *2C63F1B7E260390BC6CA0AC2F4483A53DE37D630 ADAN.ILDEFONSO
438,332,639 *2C6FD92A6CAF43F382A3B112E278D934D279CB92 [email protected]
438,332,640 *2C683AE5EC5583C061EF9B19A59C616C07230D96 KRON.ODER.TURBAN
438,332,641 *2C6ECCAE340E2A739CC572BD3FD00905ADE9C8AF k<S
438,332,642 *2C6D1038B7868A691A0B5E7B4F45DB12D770A17D Kuy
438,332,643 *2C6D79FA3D5242CC39CCEEF847E6A43165324418 ADJTL
438,332,644 *2C6D6976CECC9391C6F6E7AA86BCAA9BCB253B10 CC)/(
438,332,645 *2C640A31291C68134A7D92CD971F794477888C24 adriana-suarez
438,332,646 *2C6B719BE1618CF31AF83F550566764DA338B560 c-ck"
438,332,647 *2C628B4517A16076F26C7B0CB38339EBCED19076 aeym-
438,332,648 *2C68E2ABC4EBAB8B08472213CD016916B4CE3ACC [email protected]
438,332,649 *2C66C7C6CBA60E0BC0BADE424107DE9B900685DD LANCEDMITRIEV
438,332,650 *2C6FA0051E8A8C10CB4CE45643D5A4F5FA10FAA0 LAPPELMOES
438,332,651 *2C6455FAB17B488D66CCDBD7760E475A8C8907B5 AFDQD
438,332,652 *2C62F0C647688FD4CEB32A9CD2AAC6075828DED1 afknibbelde.
438,332,653 *2C64237860608AADD3F0AE885497A4C0914ECE96 CHIKUBU7
438,332,654 *2C67F816D1905951EEA8E52F2CD67AB664783E8B CF4
438,332,655 *2C6DD955CEE526D0E69EB104525555901C667B3B CGGCGG23
438,332,656 *2C6078AE4052F99763CF2F3E256A4DFCB3708393 ch4rr1n9
438,332,657 *2C6034C27AC58E3DCB3B20D6B079E9E52EEE9BFF [email protected]
438,332,658 *2C69CE2FB2CAE5E1FF200B94DD3FE7BB2DB585C9 ah+j"
438,332,659 *2C6DB6E3CE4B2655B7290FE1D018AEED36EEB720 AHMADBARILL
438,332,660 *2C665D4B607CE4975E998B483089269F77631CD7 legislaring
438,332,661 *2C6FFED1B7B626184D38910B3CBA6BF8F9C6F9D9 CHATTERJI0321
438,332,662 *2C67FE38CC021C96E1D559EA1AAFC837072DC4F7 aîcturitnpi
438,332,663 *2C6E10620AF05DD8DC16E5B445BE060672F1407E CjAA
438,332,664 *2C6A682E1ACF5E36FEBE71C1F5F38D54950FC2EE CJWVA
438,332,665 *2C67F532DDD6BB37AC0491FD7AFD33C2C72AC248 LENNYMASCETTI
438,332,666 *2C6F39B586C08CD302AE36528C2C9DBF9A37FEB5 CHEVESAILE
438,332,667 *2C684647ACD64FE2B641150AA0778A17063CD458 LEO.SALVADOR
438,332,668 *2C6968451743D66BB45EA64493786E463BF3973E CHN9$
438,332,669 *2C6E46B141D3DEB54FA7A2DD046BF133985CD571 AKI-RAYMER
438,332,670 *2C6858F326BC98B71EF8EC2909DF98C4F659320A a/kkc
438,332,671 *2C640616B1C7FCADE6248D46422A406B92AD5CEE A++L
438,332,672 *2C6BCCDA4B6B4BFD19296B39790F9A62668558B9 leylideresi
438,332,673 *2C66CF68E8CC8D0085FF9408B2BFEF45D57B58B5 COMMUNITYCALL
438,332,674 *2C610A511210A1CB0B69BDD9DB188FDFA5015570 ALJUF
438,332,675 *2C6DAD7E437373876C155AEB8602E8C077610E73 ALLAHABAD?
438,332,676 *2C6F1D3234144A4814DFBE5D87EBE16F35CCD9FD ALPH74
438,332,677 *2C628D3AB15A28A2702A9C18D973EFF0AD7FD9A5 CLEMENT.BOECKER
438,332,678 *2C68884EBAFB2B5BE29ED6113E51FB9A38C3A337 [email protected]
438,332,679 *2C6EBCB2C2D147E102B297BCA072FECAB88DE516 alvadaughetee
438,332,680 *2C66F3B71A72D96E72949AD5DF411A98F811EF2F [email protected]
438,332,681 *2C6AA2B1540404C233CC430FB9156A14584E4008 clevelandrabil
438,332,682 *2C644B16BB4B39C09DA0EA3AD0C9171F4F83BB88 C;lf
438,332,683 *2C6E299A03CA7AAA6A4C869A050F5EA46C8CBC1F COREYDITTA
438,332,684 *2C6265FBCFE19D36A1E016F08A0AA9F8055361A7 AMBROSEOATMAN
438,332,685 *2C6C19F72CF4324C700AA918CE5A37D9EE440A71 LONGPRELESCORPSSAINTS
438,332,686 *2C6BE7BF22461124180D2CFFBCE4BAB1C876C12B cosigners
438,332,687 *2C690BEA8E11F3A9B7E4D1EA3F6F4AC1D7B02ACE lopololo
438,332,688 *2C62473C31199E9DA186DBDCDAC56F97F7E2070B LORNA-HIPOLITO
438,332,689 *2C636A29FD6A0AAD9149F6733FBD1CD08AED0D87 anamokaming
438,332,690 *2C68A7B0D18C7FC72288D6F1BB1E71A552298A4E ANDERSON322
438,332,691 *2C65B9933A04C352F504EFB04F32E212FC931778 [email protected]
438,332,692 *2C6E5C5C354FDF6DF66F2FC424A16A045DD59435 c%mup
438,332,693 *2C60453303816344764D30041FDC33E0EE483A6D [email protected]
438,332,694 *2C644AD29121604FFDFC0D897842BB99C8721B51 ANEMOMETER!
438,332,695 *2C676FAF1C942C2AF9BAAA81F1CBD91A3ED3FD7C ANIBALCALLEY
438,332,696 *2C64D9503B8E7E7C06A6D1489B91ACAB5243397D cogill12
438,332,697 *2C6F946BDAB3CA273C27C882039982F105E33CA2 LUKEROGOSKY
438,332,698 *2C652EBE723C866D333AC7F41C7A648CB9C228AB lulu:act3."wennichdirungelegenkomme"-"ihrk
438,332,699 *2C6A675D2327CAAF8F5CFCBB1A69B9AF06E9344C COLMAAREM1
438,332,700 *2C6ADC0DD5D6EEA083FF1A950D3CC6FE163882DA COLTONDERRY
438,332,701 *2C69500AEF777100771F0DDA9B24AD7AE9B0C8A4 COMETOSTERILIZED
438,332,702 *2C646933F46D39D854A1077ADAF26605F0B30931 [email protected]
438,332,703 *2C600626553BE536AB2DBD3BA9FD21E472DBC492 CONFIGER
438,332,704 *2C697A09099935432E8EAAE02CB7424D89338422 ANTARUPGURAY
438,332,705 *2C63365529AAA32C48E96DA3A813D18657BA520C LUTHERESMON
438,332,706 *2C6D11EB8BE0D67A899BC00E91FA744947D956B3 cqfku
438,332,707 *2C60867EA170264487018AB7098D17C00F33270F LYLEAMEZCUA
438,332,708 *2C63081927D5C860E9078BABB0E05178B6520EF5 CONTINENCE!
438,332,709 *2C65EAB4299748666C548D3D92CC10EEA8C8F677 COPTRMAN
438,332,710 *2C635ADF1B0C15609DCA0AEB1FA951241337F4CF CORDELLBOHRN
438,332,711 *2C6AB9A7EE30AA1EC4C6C2BAA05A8B0B84333AC3 c,=ra
438,332,712 *2C634E5111C8625A0A17197A5A56C36BA3770245 CRISTOPHER.EGLESTON
438,332,713 *2C6CE139CFDB9E5C8DF4527B61B5501105D84CBF AP1F
438,332,714 *2C63FB74F02D6CC9D7BEA8836E5EE07554767B56 cowboyduckie
438,332,715 *2C68215BC8402618B6F57197A30B1A12DAFA52BE C;T.$
438,332,716 *2C64F0691C149EF0A2A1F3EE6FEB3D343007B915 CQ"8#
438,332,717 *2C60D97A8324B7EB5D04B2D96324CB0BEF81B8EB ARASH.HICHKAS
438,332,718 *2C62EE414E63E52240EFBF63898784151B988F7E CURTIS.MALAMA
438,332,719 *2C6222D7FB8176B05DF2EDEFC7614F102FC0A854 CV72O
438,332,720 *2C68E72C9E9F302D1123D8224B72954F6B50F23F crvn
438,332,721 *2C6D854C64FA6278EE11D4C69D3AB41AEEE12975 MARION.KOPKO
438,332,722 *2C653F9D0F0633B0C74E190A0FACA1A66FA83B4A CTD3R
438,332,723 *2C6F513D1AFF84811E7F5D75AEECFD05203130D7 cz_d-
438,332,724 *2C6E8039B72EF171FD0B90F16AD608FE031AAFFA cuatf
438,332,725 *2C6A85878C1DEFC5CE9CA7072400F345DEC91A29 ARTURO.SABEL
438,332,726 *2C6E2B712DBB576B1F587CDB1C2DB810DC5B06A7 cuhzu
438,332,727 *2C60696F8F255E2A2D9BF6156A29849A8816F3C3 CULTIVERAIS?
438,332,728 *2C66D8E3CB634FEB62A871F48282BE394D817F22 d3)"h
438,332,729 *2C644FBDF2D27B727D8EE1C7D9463DA84DBB51FF cwda
438,332,730 *2C67683978E22BE295C27813C0CD08CFD6E9EB95 MAURO.FITZER
438,332,731 *2C6BDE3484DBB7393B6C88DC2F84F4BA2CCF6DEF d5e144c3f59f
438,332,732 *2C6CDFAC6661B36FE0E2E5C18A47ADEA654E7DE7 mckearney12
438,332,733 *2C6E8983CFECB0E96D4B5D0DE2FA1F5E701123B5 [email protected]
438,332,734 *2C6F661299FCAAE15F02843913BFE5BD43D7F964 DAIOGEORGES
438,332,735 *2C6CAF9E8B4B72387F6DA4F9CCBF4CD0745E50FC D1EN0TABLE
438,332,736 *2C691080F11457E43BFBF693E97FF9D59279814B D1#(G
438,332,737 *2C6BD061B2ED6550EA51FAFB7AC15E81B3B0056D AUTODIALER-LIKE
438,332,738 *2C63B1193662E89CAC1B810A9D24BEB39CAE6CCE d48_a
438,332,739 *2C6B3C49D073AB99DAEA7518889BB942D920ACE7 MERLEHICKERNELL
438,332,740 *2C6908C9929284195E68FA33B0397F3245EC1005 d58;!
438,332,741 *2C66D8626F772B42A26576B32521DB1F9580E345 danteorion
438,332,742 *2C607113FE52A896167B0534E11DDB00E5EB8A48 AW_N4
438,332,743 *2C662345B42A75FF5557A359928933BE0DAC79BC d8ovh
438,332,744 *2C6E7EDCC7BE8FF4F65F327DAD7128C7C48606B5 darrenvizcarrondo
438,332,745 *2C6B666B1441E44F9178FF3030F9F2EEDDBE6B8E a&x&i
438,332,746 *2C6924B7A7DFAE006FE6A3FCF4DE04C0F70F526C AXMGG
438,332,747 *2C6D2D95E9339DE69DFC74ABDE778F6DFEF119B9 aymnc
438,332,748 *2C6D2EF164A8887C0E9CA065015C11903FD81C5C dasilveira
438,332,749 *2C6627A1B87CBE2AF18D0093EA3229A2938C79D2 A_ZOQ
438,332,750 *2C690C42A0B5322469ECC66F1D1F6E4AB94C1B44 [email protected]
438,332,751 *2C6C3CDBC0A024F749E05CD7256ABF165976D0EA AZURAIDAS
438,332,752 *2C66243E33D5578B1AF2860DBF604DACF5AF61FC dainamaito
438,332,753 *2C6FFFEE177D9AAFB1BE7F4703A2006077E4AF18 [email protected]
438,332,754 *2C64D5E64FCBA488ECCB5C98EABD695B59FD4074 b0::=
438,332,755 *2C6C653653507BB4936A2A8055C31439D883C745 david.lee.cole
438,332,756 *2C60ADA185D1AE9143446F9E5B51591BB759EEF0 B0hun-up4
438,332,757 *2C6B47B58CE06C188AF8CE713DADE9E2D6FE35C6 b0j2h
438,332,758 *2C632F9E6AC3E347DEA7AECB8A952FC06FABE45E MILO.CAMAEHO
438,332,759 *2C6F1D20E227FB095E83AA6B6107F906EEC1CD0A dc=g_
438,332,760 *2C616BFEFA61D019CF8E4E80CC3038C23320E046 B4RGV
438,332,761 *2C63F83AE9EF3683F9F00B87FC5BC1A475565A23 D$-,D
438,332,762 *2C6B9A951D6085D3834295D8A279FDB82B7DFA25 B%7JD
438,332,763 *2C6C4FE81FDC852295A84ABCFAC8CB1D29F67A67 darnellninneman
438,332,764 *2C69748E7F9C4B817592BB2BFE0728933F4B8923 DARONETCITTY
438,332,765 *2C631F03D71050BC45F278D84B6609F748186F74 b8cfd
438,332,766 *2C6EB808933A5E2DE9BE673FCCF1379DA7206ECE ba(=(
438,332,767 *2C661043B56DF5D0BD928183E6A9ABC3722A1A5B deangeloamedro
438,332,768 *2C6CC2E30C6DD741E5AC3ECD35A9C7067044092A BAKARE-AJIBOLA
438,332,769 *2C6C763E57F4394BAEAEA2058E5FD603A8C2638B daruan
438,332,770 *2C6322AE024DF023742E595B4AB79C9E0188E429 DECLASSIFIED…4
438,332,771 *2C681B5E7034A3595CF7E27DF5ED17B2AEC56754 D’ATTENDRISSEMENT
438,332,772 *2C6D9AEDEE2D4E902A1508A0C7895BCD2CF7C51E balladen.om.klante.kofoed.(steppens.bedste.s
438,332,773 *2C601C8A75329717D2407A8752180C38A7DE8DCD mộn
438,332,774 *2C63D1EA65CE74F9AD75059771DEF193E60B41E2 DAZm
438,332,775 *2C6887828FFE47657CBB40BC0BC7D5466AF8C5A2 MOOSEMISE
438,332,776 *2C600FCCF95ADF6A89CF415BCC25A8635799ECED DBOWSKI
438,332,777 *2C65214C60146A2BBF296C2113631FE558CA237B dboy.lopez
438,332,778 *2C6DDC36F4F22F2A49BAE527F655FB22CC02D65B MORESTIN1
438,332,779 *2C6CCA4EF6D1CC8663F64200DD23EA42775661F8 bastardchristy
438,332,780 *2C614321CC1D5E7E1E559F5C2FFF188E78A41807 [email protected]
438,332,781 *2C6506B052A6AB671ACB06531D4C7A8106899EC5 D'DAN
438,332,782 *2C62BFA133D7D493B4C0D02125A83EAC077305D0 d)dm;
438,332,783 *2C6C90DD5AC00FAA4A2457BE64C0601239A3D2D0 BCF2"
438,332,784 *2C646A39E5CDCA4BB00991B6F3EC522C9684EE49 DESMONDROBINSONS
438,332,785 *2C65EE51E5A4E21D8981ECC383865AAA07C34AC9 DESRTIFICATION
438,332,786 *2C6981BD6A60502CBEAEA59BCCC39B8E207B01C3 DETARBMU
438,332,787 *2C644C9CFD893BD28746D6D0583325CCC0ED05BD DEANKOLLER
438,332,788 *2C600C13C2232C43112DFD7D778128FA6BFC8B96 BEAU.MAGDEFRAU
438,332,789 *2C6215F2A70ABEEE4C36ED04654D9E0A507AF5F5 beee16
438,332,790 *2C6E457DE0E0388E6D8B5E7F3A1B2BA9E9C6ADDE BEING)-827
438,332,791 *2C673568F1D9D27B3BD6A1141F2D535B5B38A2D8 BEKSAUM
438,332,792 *2C671F0C477B76FF424D240CD3EDCD4445B7C05D DEZASSEIS9
438,332,793 *2C648BC810DAF9403CC14E1EC5364DE7C528B713 benjaminbakken
438,332,794 *2C63F313EAD4CAD7561BFBBF26D56B5182EAD1FD MYTBIRD1997
438,332,795 *2C6E207AEACCFE08A550EF73EEDA17D95D14D126 DGD%4
438,332,796 *2C6433A343D5D8861CFA52052A4CF2250BAEAEF5 @N7ICYC10NES
438,332,797 *2C6BA74057F40A28ABFE6C4CBCC0FB5781945543 nabeht
438,332,798 *2C621598DB7D2154BC435A55BAFF68B8E9EB23E6 DH7M
438,332,799 *2C6E2FA34B02B5DDDF1C45B0790AFD9CC78D2331 denverschissel
438,332,800 *2C6EE837DA0E6602513D5C2DF47F4EB2A148DAD9 Namhself-5
438,332,801 *2C6CC426A1FC71072C89D72D3D498B5D69A4F99A NAN-CASTLE
438,332,802 *2C68EE738E6C5D8C266C7635650F4837AF83286D Nandanaadh
438,332,803 *2C68AB15120228EA3284FDC3E83E83A3FE3DE603 BERTRAM.MYRON
438,332,804 *2C6A471881BCC6BAB3CB323BD212D8FA88764134 BERTSIOARENA
438,332,805 *2C6D0D025D911DD6AB464ECA87EE68EA14CA7679 bestells
438,332,806 *2C62BD3A9F993CDCF0562D43B8C296B74C978781 dichoregeton
438,332,807 *2C6C07ECF7BD40490FF208345D71BBEF509A713A DESHAWN.OLIVERO
438,332,808 *2C6D9D5319085FECFD2F779C9E2A54562BC2737D desmidas1
438,332,809 *2C653F4D3E70FF7F072209777E216CA1C874BA13 NARESH-KANTH
438,332,810 *2C6CBD988437FAB3C401C2948D2F66441D4D13CE NARLOUT
438,332,811 *2C6CD4047271BEFA2C69F17782975695499AB1CA [email protected]
438,332,812 *2C6AD9F9881215A7C1AD10942135072398D95BCE bezo1971
438,332,813 *2C6464892813F18D4D1895B7E10F662E965C6760 BFV"-
438,332,814 *2C64CCF10FF528F331C7AE497061ADA1CD501E33 D;/GB
438,332,815 *2C60C5464FD75A9F0555993A8121590287ACACD1 BIGNETTEN
438,332,816 *2C693D5B0866829262D645F8CF3282B320383D1E dgo8
438,332,817 *2C679A760EE8A5DFFB7FF20B56F3A0D0992BA05A djlw%
438,332,818 *2C6EDFBEB04460CD5C948A5978BD9B546245337A DKZGC
438,332,819 *2C646D9E1758D872CC6666F7787B102B0B7D2916 BJFP
438,332,820 *2C65427E254A1813EE41E2D5A3D061CA980530A4 NICKOLASROLLOCK
438,332,821 *2C618A91854B7BC28C47B75E2558DC4D8AE12A84 NICK.SCYOC
438,332,822 *2C69164B493373E87C4296A40C3EC67AEF695FAD nicky.pennell
438,332,823 *2C6E7924BA11011086D005F58ED9BE7A749DC2C3 NIDWALDEN
438,332,824 *2C68B64A86429F561192C2C705F182320B1C3199 Nights-On-Arrakis
438,332,825 *2C6DB9B255F669CAFE353FACC256D8CC72F6B1AE DIVORCE.BUCKBOARD
438,332,826 *2C6EFE36674989EDC8C2471C5C99C19257345CC8 DOCKMÄSTAREN
438,332,827 *2C6A9F93C1FDB2B122380C0D9BF5307367C35CA8 djlw%
438,332,828 *2C6D7E831E506F9EC92C71133ECE2B1ABEBD4AA5 BLK=0
438,332,829 *2C6012A0384FF82ED57B349042FC0B4DFD9599EF nmittel7
438,332,830 *2C63457CA9F9B98177AA840414350A274F5CB22F DLEDENDE7
438,332,831 *2C6A68CA1ACCF9CB8B579D4C28A0902DA41C6626 DONG.SHIFLET
438,332,832 *2C6C248AAAB478C86BB8811FCA44F7A2F6805CC2 NO LIMIAR DA REALIDADE ESTELAR
438,332,833 *2C6A3BB1DB488AD461E23FC798140EBD447669FB DONNA.DBOYATA
438,332,834 *2C66A2EB628EF89A36396E4B475757D7BB21EE69 DONNELL.DESORMEAUX
438,332,835 *2C6ABBF61E51AECDD256FAB311A11BD77AAB3B3E bm-d(
438,332,836 *2C6C3A64429949565E96D2AAC5093A93D0FD8364 NOPAGU98
438,332,837 *2C68921E992F512988762CD6492117BE6B98CF6F NOR-AZIERA
438,332,838 *2C6E26C2C373D0D714FDE1A9A20AEC2DCFEBB1EF @[email protected]
438,332,839 *2C622020CD9DA3F4B06AA313826B113DFF564F40 NORRISQUIROZ
438,332,840 *2C6BB3D78B343EEB217378889772FD8D0CE8F63A DOROTHY GRAND
438,332,841 *2C6F57116B89D5BC6291548D2CB3CAFA381F4CE9 dm(h.
438,332,842 *2C623F831E418CB34BC059CEAE49BBA6B7B7F88C DM-$K
438,332,843 *2C6156A3A975016252A479372DE3BB5FF309E80E BOOM.BOOM.BOOM.BOOM./.SUPERFLY.SLICK...
438,332,844 *2C69378024E878C2910A27B2EC555BD694CA94B4 boomercfj4
438,332,845 *2C61CE7D4D2E3E63E069FD2DA5B6C8492DDB3EAC DOUG.HILZER
438,332,846 *2C62BF6D7EEF0EC14F2188B5D844A084413D4A4B NOVELDING
438,332,847 *2C61C45EFC8DECBE196FC3ED2C1CE5D204EAD7D2 np-annoying
438,332,848 *2C69008FC84DFF5D71FD5EA42294029B56688B85 dn:o
438,332,849 *2C61F933E7F26EAB14133DC9C1FFF57DECF0736A DSWJ_
438,332,850 *2C67222BD9F4599358A15999F3FB7D543683ECB8 dohzu
438,332,851 *2C62653ECC07165A068C9B1B8115DEDCAA4418F7 [email protected]
438,332,852 *2C6DDC925B93296BBA4A2C83AF0D22A8DC648612 />odd....<br
438,332,853 *2C614D82D154F08F9563B87517332DCBF84F504F ODELLPUPA
438,332,854 *2C62180C3C002340CA3AD0A6CC7928F1E40D10A8 odie3
438,332,855 *2C6DF170A49299C142FC3FE68E6955D1DD717671 D.U#M
438,332,856 *2C67FEB82022189ACF15F4A3DCFB1B286D06F438 BRADLEY.SHIBATA
438,332,857 *2C6E8239B370661462C3E1F9D92E158FF7B0FB05 BREKSIF4
438,332,858 *2C61C01D155BC27BC7C51D2A8CC1780E30E10F84 brendansiona
438,332,859 *2C6DC26BEB4AFB74AA7D178F6E99B249E12064C4 Don'tWannaHurtNobody(featTrea&LilBossofAbn)
438,332,860 *2C6623281896A56A58BFDEA25B0F6EEA1AF04248 olm\
438,332,861 *2C6AB9983BFBC38DAB6E78F44A2FB640699B9F44 dorodnosc1
438,332,862 *2C64506C2585C3293A0421FEAE635602CFC1BDAE dw3o-
438,332,863 *2C6CC9BFD5EE2885211EFCDA43E6DA07494D97CC OMARTEED
438,332,864 *2C6706E350A83EFB27715C5108F829F68745E996 BRs0
438,332,865 *2C67E0130683EA030C1AC4806CA69BEE42AF6231 DWUDZIESTODWULETNIĄ
438,332,866 *2C663DB8EFA744736CCF8960A1ECDBAF9AA6274B DYBG9
438,332,867 *2C6A85935BDDBE20CB8917312E2E6C571A6533C8 ;)***d--q
438,332,868 *2C69DD1F848BB9C5E6D6694883C931BA87D2EB6A Oon.k
438,332,869 *2C69B475FAEB91E5FF05F824B393391E0C8DCF5D DR)OD
438,332,870 *2C69B8B2993C006F1AC9D3B06BC75D081372FF4A buhco
438,332,871 *2C62222C64B17D422FA4760E69AFAA341C5477F6 D&S,"
438,332,872 *2C664655D73DD662CD742F9E9549CA8A686D8D49 BVH,
438,332,873 *2C6D1574622B664FB1004B3FFA54F06873E1141A bw5rg
438,332,874 *2C6E550ADAE8F6931953F434047DEB8AE925BE66 OSHIKIRE4
438,332,875 *2C616D674AEDF529B255E077A8BE54F91CEC89DD C0B79300C9350B36D8E7C3C39111854FCATCUS
438,332,876 *2C69839DA0AA1BC849E7BC3BFBFA3F1CDE409ED3 [email protected]
438,332,877 *2C6B7BA277807861B21D6590B9579668EEB0EC9D DWYRB
438,332,878 *2C662DB3B7D7F8B3A602072D9594669D81561863 C6nt
438,332,879 *2C6BDB36AEA1986D83DFC862B3DAD1CCC7B5331B CAMERONLARKINS
438,332,880 *2C6859799996C35CC6D8BD08B03964E2CFFBE013 dy"ru
438,332,881 *2C64DC04BE08D9C21C6DD82C8383EA2A5AF6959B ELOW?
438,332,882 *2C6566CAED5CFCD3F3A9CAB2003C973185DEC13E ELPL
438,332,883 *2C6072E77DB7349143C30D76F05A47F8E7D7E715 carlbonnick
438,332,884 *2C675471EE772447842219B556C8F203DBB5E9CE dzqu
438,332,885 *2C66A6ED12A5578ECD8BFC1053991FE14F55059E embryotr7
438,332,886 *2C63F65F081C916E3B459F0CB4CBF08B7628584C emit-hguone-nevig-taht-dias-si-tI>RB<>B/<daP-emiT-enO-ehT>B<>P<
438,332,887 *2C6A4D529CA22E51F4CD1E6065AD8F0A2EB1301F emmettspurrier
438,332,888 *2C60E9CBDF83A633BFC9A9E5268D724B115F513E Pan-Galactic-Anorak
438,332,889 *2C6C9279E62975C78186D07EDBB3A823725EF010 ENDJI HESHAM
438,332,890 *2C6A1B3BF30FAAE54DC7A980FCFFFEBBF12CAA7E [email protected]
438,332,891 *2C6D85B4A33E98648CE0C87568468CB7A3559D12 eng36
438,332,892 *2C65C332B311E6CD2E8E2B96A981A4AA09CFD6DB enriquewhitmarsh
438,332,893 *2C626860D23A7EC94E73E7489176FE67D0BA4BBE ENw"
438,332,894 *2C67D41518763BF7099774666B75BA707F596906 erelhow4
438,332,895 *2C68C6BF1B2C840B3858E2654243EC403BB70E1C ERICHZIMAN
438,332,896 *2C679E9D90A9B4212034F68E1AAEDDCE934E4096 [email protected]
438,332,897 *2C6D8E7330DE6082374A33E0B586BF51AFC23DFA PAT.BIRDWELL
438,332,898 *2C633F35E1A0ABDA7CD9CCDFB7C8CB82DE8F7355 CATEGORYTHE_FLAMING_
438,332,899 *2C61A4F69266D4ADBC2BDEB3375B7CD29C968587 catsh
438,332,900 *2C6F67AA03BDD2093718F6B81600B078D6A18E2D eeuzs
438,332,901 *2C66F130AE5F4E926CB6C0D9975AC8C1A0CD2F05 p=B-~O-~o->-B0
438,332,902 *2C61CDE4C5F248FFB7D0477AD7CBE429E6F21ADD ESITTELEMIENS
438,332,903 *2C61689803986126898089268CC39E97E8564988 ef-v$
438,332,904 *2C6B606458EA068A105408A147509029D27A8E7A ELAYE
438,332,905 *2C633040F9C70FAE9F9B0E5E720EA318E4BA610B EVAN.GRISMER
438,332,906 *2C6E0B3384EABF828EA592F94AAFBCC73672988A ELDEN.MARATRE
438,332,907 *2C602494673E93B83BA0A725AE2954D2BF705CDD cerambus0
438,332,908 *2C6B8CA5AC9FC1E85A87C085A2ACF1C201169CFC ex0nera+0r5
438,332,909 *2C6D32D2BEEDE3169FB60828AF3768E7879CECF6 CF4
438,332,910 *2C65287F11C20552A8F5AC9DD5AE92457AE0A1F0 PHLEBOTOMIZED3
438,332,911 *2C6A758089DB4A6FC1536D19249A163E2123DEC3 EZEQUIELLOMU
438,332,912 *2C62012E3144D66AB30099A738B170136D253895 c=g"o
438,332,913 *2C6DD375A0CF8EEA2D29EF2A78C2F92875AD7A51 CH//%
438,332,914 *2C6BDCF0108B34873E447B7802FD8DC653E23144 ELWOOD.AMYOT
438,332,915 *2C635463CF32C421B631DE1EE37BD8BAD52FFA88 EMERY.FUERTES
438,332,916 *2C6B6A8DFDFAEEE165A6B769606C870504D87D6C EM-JA
438,332,917 *2C6973BD645EA1987A7AD00C32BFD446FB8B4FB4 chancemorando
438,332,918 *2C67A8CCCB626EE0A6012891D41F54CD7BEB3826 FANTOMOVARIACIOJ
438,332,919 *2C6433343B62B346A87A74B62DBED02FE416F4F0 FARAH-SABAH
438,332,920 *2C6ECD3B77210070EE82D3774AED38E9EB80DFE9 ENANOCOQUETO
438,332,921 *2C63CEF603F58578EF8FBF89FA4C4C17552E25AD CHARLES.KAYE
438,332,922 *2C632224FD08D54199840BF7F2078C3A4AE9ECC5 FAUSTO.GALMORE
438,332,923 *2C62B6AD1116116A895CBBB53DE8B29F6FA30A02 engine's eh1 n jh ah0 n z
438,332,924 *2C641C198B86D22490981B2C78C5F949F24767B1 FENABLEDPRINT
438,332,925 *2C6E3E9B0853CB765F37EA1768837B658C3F898D ferdinandbrisson
438,332,926 *2C699052FDC057D1EF1089DD63F48C62C88B4EC9 POLYGLOTTAL
438,332,927 *2C69ECBF9F3872A85E9BECE26358CDEDAC6AB322 porfirioghee
438,332,928 *2C645F2707E87EA293C5A2508CCBA715BB1C91B5 ENUSERALCHEMICALEGG
438,332,929 *2C6EDB155EDD72E60F0468A63E3334958A2058FD filtertanks
438,332,930 *2C6610C17287E41DBEDDA5D4FD51C1A27D794CCF [email protected]
438,332,931 *2C646E18F889C1373B7EF9616C1E7FCE9ED8C413 ep3?h
438,332,932 *2C6C470ABB08E53F99016A753A1E4D23B165A6D6 CHERI.DAUGHERTY
438,332,933 *2C687C7FCFFED6B6009DD47E5AAC24FD616E56A5 CHESTER.WHAITE
438,332,934 *2C62E938B7496F2C790ACDEB35BA214465EBC0DA poterono
438,332,935 *2C6EB83C800FCAC9151CDCF9A282022F0BE89DD1 chocochees3
438,332,936 *2C6DC117389AF55DA03FA90D55B7464D49A89A1B fokkemaa4
438,332,937 *2C6653FD7774807A9D763DF3525AB272EB947588 PRASLISA
438,332,938 *2C6CBB955B8D9DC60A55E8AF5AD7EBD8D8DD43FE PRAXON
438,332,939 *2C655727DB8D8043116D7865AD7EA09E70819CF1 ERNESTOLANDMARK
438,332,940 *2C6B67561B678610E8B1C0B4C7069BA4EDAFB4A4 PRELUDE14
438,332,941 *2C6BB96036E291C66126CD153FB67D228E4E6B68 FORLISE4
438,332,942 *2C63254EE2B1C241DBBC3AA2A30197E0636E6AE1 FOXFIREUSHER
438,332,943 *2C64E3ECF46A07A9FB2EE4F8A7E7FA233FB87BF4 FRANKIE.TEDESCHI
438,332,944 *2C6E16FD3B18807B347BE5029E015EAC3587B641 FRANKLIN.BOSEFSKI
438,332,945 *2C62A9EEE17678FFC0FEF8F8B61EFD880F77B7B6 franklinconnie
438,332,946 *2C6B9F586B9D4507A06438E48044464639AA1026 [email protected]
438,332,947 *2C68F7FFC17A68B9BF9F4EAFBB9F5749F985D440 FREDRICURQUIZA
438,332,948 *2C656238CAF224A9D916938AD7450A85762DD3F7 PROMLCD
438,332,949 *2C6CEFA161E3678819465943A745BF9F2157ABA3 ESI?A
438,332,950 *2C610EEF6ECD3171B1111B02031F2758CC14616E PUL$3-RAT
438,332,951 *2C65DC1865CC780733FFA927450E2B3D62271D8E FYGVRQE4
438,332,952 *2C62E79304DB57B87337A20DE57BC45249C3EA00 [email protected]
438,332,953 *2C671861357061721AF3AB060FBCB1DBFF63CE9C qaeda9
438,332,954 *2C6A4E193073B906C69A052ACC076F5E1EB13E5D gailcastanedo
438,332,955 *2C6370229D9B1BD2FB30C92D7FEA463EB0A78C3A eulaneip2
438,332,956 *2C6454D2DBB55773EA3D9C2EBBAF4EE5ED626047 Galleries-of-Velvet-Fear
438,332,957 *2C64274B8B5A64FFC6EF6B0117EAE49FB9A3D9B6 garrygarringer
438,332,958 *2C614B27E911D2C42F6408F9A6EA726959E7484E CLAUD.SALAMANCA
438,332,959 *2C66E921274CF6D822BB28468C3BCD77F906F2BD [email protected]
438,332,960 *2C6D03CA07755B9FB31AC2B2C976B60E77602218 Q####P~ `(O_-)
438,332,961 *2C6B1F87A15CCF498261EE812BEE59B2AA5AA121 Q==P ~O3B<
438,332,962 *2C6D20A16667FF986E5F6B74674D0422BDE19447 CLFL
438,332,963 *2C69EC4E67B71DD57646425CE17FFBF00FD69350 ezinavla4
438,332,964 *2C6D0C900438CD7997AECA6460B256BA1618A648 CLIFF.NORTHWAY
438,332,965 *2C69862B3B2B65BECD8118BB96076F7B8AD4BA9D geetlove
438,332,966 *2C60D10DFC665EF53D44B382A46B15AF6B309CC9 CLINTONBATTIATO
438,332,967 *2C668E38479BCA17591EA1F1068FD1EEC6BBCC79 CLINTON.LINKERT
438,332,968 *2C6CC0426ADAA16E17337864EC2F506514D1D892 CLINTON-NOVAK
438,332,969 *2C649FE24EE5624EB322A3A794B703C136EA1669 GEM372NH
438,332,970 *2C69E05535593E78DBFD4CE1635A7106915B28AD CLOCLOTIFFANY
438,332,971 *2C6EAB808E29676CB4B7794E6A0BA39655A89AA0 CLUYI
438,332,972 *2C6AA6CEE4CCA9AA243D9F155A54E8B4F8B5204F raavgnir
438,332,973 *2C64B0CFBF5F4BE1B2407E9E41B75E0FDAEF9ACF g/g
438,332,974 *2C63F40A70E09DDAF42A11DBB827E7202345428F rakura、那月りの
438,332,975 *2C6AAE19533C4FCF801EAAADE24F640D2D4BE5D0 RAMESHBABUK
438,332,976 *2C6762943F479C85496CADB06CF3D5887A19F49B GIBW
438,332,977 *2C6AF7CA2ACF7DC3C434892C892B4F209DDAB761 gilberthauley
438,332,978 *2C664253618B765388587014BA9497AE2761288C RANDELL.SCHWINN
438,332,979 *2C6DEDCC2776E9B01A264F0682E69AB7547D5D97 gilbertnemeth
438,332,980 *2C68C89E8555DA955CE0FE6C8BE54D675E2A6537 GILBERTO.RECKERS
438,332,981 *2C6C4C27F13E6FDD8319E59B7F7B0C09194EB219 GJ[K
438,332,982 *2C62A584048BD6FB64BEF934C61E42F271E96467 [email protected]
438,332,983 *2C6BE200CB0571447BB947260A3DC36DDE4DE56F cocklies4
438,332,984 *2C618DDB70D28A091926F5AAEB8D2CDEF2C4FED7 c_o.h
438,332,985 *2C6CE0A80DECF69B4E7768E7AB252FA9FBD07F9E GNAHCUW1
438,332,986 *2C675B939C44D644E04CA6C90729F83889B99674 gnitnids
438,332,987 *2C64FA87DDF30B0811CB3DB28654E4D674997B02 [email protected]
438,332,988 *2C675F0594B367E30A20101C9FF6D1BD0B930D3C godzillabutler
438,332,989 *2C63EC1B83EF930CA04093859D55D7B53BB4003D graighelde
438,332,990 *2C6E02EEBCC8F2FED22D64E4283BFF12CED260FB red12880
438,332,991 *2C6E839C8E986A06CBB8364B9D740E0A70DA64DA CONTRA-MAR
438,332,992 *2C649DFDA81E7A5BFED5286B64219BE7D0AD4357 COOPER160
438,332,993 *2C6FEE16603388B48B9C446AC3891D960124BF83 FERMIN.VILLAVICENCIO
438,332,994 *2C619845C4B4286E53BD386C1ABA4897D328279D CORDELL.OSENTOWSKI
438,332,995 *2C67F9E27960810F70549BE9E2B5C12FB3DE2826 GROVER.MAROCCO
438,332,996 *2C663F854A692074CCEBBA04FC2B61D5576BE364 REGIMIUH4
438,332,997 *2C6AE2B56F8013FFF15554A869E6246860FF1BC0 rehcsilucreh
438,332,998 *2C6B454BA670F2AA5F785A7C8E7358196D2912A4 [email protected]
438,332,999 *2C6FC1444692B54616C2035998145442D1F9D3E4 REKARAVANE7
438,333,000 *2C636B04DD3AC4CA97D4EDCB6CA56C581F411D32 [email protected]
438,333,001 *2C65A53413D79A2987A7996F9174FAC8E5DF4A94 guillayme
438,333,002 *2C6E8F7F87C6B7E59C5347548229841C00010021 (remix.by.the.congosound)
438,333,003 *2C6362D5567BC804018836B1E9B3A115F6A1E680 gulfoil1
438,333,004 *2C65E878427E8E97ABB4E0DE3A92C5813ED50A36 RENCHARD4
438,333,005 *2C60F424253E104CFC850F2F1D57FBEBD3939DD7 [email protected]
438,333,006 *2C6D85DD87512CECFF8D9B24E5D439D062F5E083 [email protected]
438,333,007 *2C6F7BC54E36E59D6F358F82B5DC46A07408415B cougarirish
438,333,008 *2C6E066B60701ED4B1B0E78C517CAC53A44F83AA COUNTERCLA!M$
438,333,009 *2C69C2C2C69384942D9B69E52C450C2F2F1E262D [email protected]
438,333,010 *2C6306169B8609C4126458C893EAB83938BAC1DD fj,2
438,333,011 *2C6B9B0507CFAFC66954FFE499F48B5C29AF910E c:\programfiles\commonfiles\adobe\help\en_us\photoshop\11.0\wse8a2cba2478b43189664db71e4966895a.html
438,333,012 *2C660FA200CDFB760EE9FC1E555D264C5027493E FLEWREVED
438,333,013 *2C6FEB5711F7ADB03FD3B635E4E1FB8E55208C73 r^et
438,333,014 *2C676BCD9249A350865BA2011427B8EBF09DF185 [email protected]
438,333,015 *2C6A239398E23AF2BDE393E25E5C09BE747A50D2 REYJD
438,333,016 *2C68519E7F7A21AC07A4E49AA973BD2FE7E3A8FD crety
438,333,017 *2C62554941CA0C3C9A9154FFE47B84EC734E30A5 RICHIEFINEGAN
438,333,018 *2C62BB4615676EA45F1B15CFCAC7816CFAC48BD6 CRISTY19MTY
438,333,019 *2C6A3F6CF4C3AC48FA08CE633185F117C6B1E30E RICKIEPAPIN
438,333,020 *2C6ED1F36F20769F704C52A4CE080EC22FCD6E4C CROTCHMILK
438,333,021 *2C619C80542FE20BB35906C1ACBCDC4B698E2B66 rigoletto: atto iii "la donna
438,333,022 *2C6852EF299B8F44002016BE55FFA882300CF7C5 C%SOT
438,333,023 *2C693716DD2A4B62B29DF09913C21EB370F1624E ROADRUNNERING
438,333,024 *2C690EE214A940D7E66FDEA6F590B35099601767 foutaburen
438,333,025 *2C612F9B5F3E700542D05C93711FB0A06C442B95 cti?h
438,333,026 *2C6DF204C4AC53C68C6DE11790405E45A83A6F71 ROB.MAYNER
438,333,027 *2C64D25460D1D7CB16655F0D3D801802FDB05C60 CTUG%
438,333,028 *2C60B842E30E4E4A0009AEB49FD7146FC4300AE8 FRANCISCOCRONOBLE
438,333,029 *2C6441B49A0B13E0451B7508FCC9C5B9B8F08F7B franciscosyverson
438,333,030 *2C66BECE88D47090EB7DD56A76E3AD11A8275A05 [email protected]
438,333,031 *2C680A846B3DEE1900ED717BE6DAAEB989AB4F39 rodolfo-ballesteros
438,333,032 *2C6E0B26852A905DA137F388C38613E20F0EF4C4 headdenlomas
438,333,033 *2C6B48EB996ADB19C640DF30A8240C3AC18223E4 FRANKLINHARTIS
438,333,034 *2C6E769C6E8DA068FA2B0D9E362F68361414635E CURTISHERON
438,333,035 *2C61C2A13EF725A3F108EA24D1515DA1F000FFB3 HEATHERBY4
438,333,036 *2C6718FF9B3AA8CE864507D0C505FDA0DC37F45E hed9eh0p
438,333,037 *2C6C530EC83CA7562BE933F2D5EFFEC0907CE8B3 frenkleştirmek
438,333,038 *2C63DDB14A3F14FAF97FB438F33DDD7F479B0DB1 frenzel10
438,333,039 *2C63C729B5EB89132B40A63EFEB640A6B487A6FE C?V+H
438,333,040 *2C6D6214D4B2B999D36EDD5FFF7AF7A00AC5AB53 ROYCECCHETTI
438,333,041 *2C64DA3D9F9951E09A8C9E3BAB3239BDEB861BFA herbertangelos
438,333,042 *2C66DB7A5A54F795AEB01C449AC508947EED0583 [email protected]AIL.COM
438,333,043 *2C693CF137C5060C57EA88A31E01BAC554E80229 [email protected]
438,333,044 *2C699ABB35C729F1DF6D167A579F04DB62553AEA RUDYHOMRICH
438,333,045 *2C64F10F13B5DED5923AA31C9B6A4E453EC9D5EF rudyshibahara
438,333,046 *2C62FA0140F787B3472357C3CC05BFC595E4820E FRUMENTY
438,333,047 *2C6CC7DD468BF818204DDD3E4718B287CCCC629C HERSHELBENHAM
438,333,048 *2C627286BB8DBCC496F49AB6294D68066CAAFD84 RUSSIAN.FANTASY
438,333,049 *2C616D12A5752F60A4F89EE8D8A690C146B2B0C6 RUSTYHERWEHE
438,333,050 *2C6738A62F9D643102FEA4CAEE1E616F451F4869 RUSTY.LIPPS
438,333,051 *2C638622491396B72ADE0D2E4E3D1E889A595893 heteroli2
438,333,052 *2C64347E2D1F42288A7751D6DD4BF6FF93E56989 FWF76
438,333,053 *2C65DACDEBED6573AE445A80C71252423AC16D44 D127535
438,333,054 *2C66C70F8C78B3A2470E6C2FD6B7D754A4D32D1D HIPOLITOBOTZ
438,333,055 *2C6AA403FF215A60DA7AA12E69382C6988D1B680 D1MC=
438,333,056 *2C649ADC330A283C2E5A0ECDCBD62F4131B4E629 GALLONŮ
438,333,057 *2C6392DC864BA36AD7B316395901E64D1B3372DE sacbutsacbut
438,333,058 *2C6780DF0CCE3F884B358F51320AC3A9815DDCE8 d3roga+orin3ss
438,333,059 *2C6D864C3A2DA79B73C88D32FB4E92CBA233AB47 d5bbr
438,333,060 *2C6DDAF1901D94426286761EB58B286195D65BC8 d6lx
438,333,061 *2C68AEA26212AF66AB866BA103F09D8D5F02B80F How-To-Live-In-A-Day-Of-Moral-Chaos
438,333,062 *2C6CB1A2768BB18FEC1709E1BCAB4376DDF71F3D HOYT.VONBRAUNSBERG
438,333,063 *2C65CBD9AB4708BA62FB4CC1CC0C3A16028C051B href="/ratsampcats/lm/r3zz725h0es55"><img
438,333,064 *2C6DFEDF1AA7E562498F2849D609CDA18F12382D DAMIANCONSOLINI
438,333,065 *2C63BBE8F7A9CE34EA623ED3F50756B91DE77B1B hsifdoow9
438,333,066 *2C666FED5EC6BA5686B95FDF73E343CF8DECB8F6 samantha-le-blanc
438,333,067 *2C648EEA69A80D3F772BE1C35FC423E9D1E07BBF SAMANTS
438,333,068 *2C692711AA39B0FFAA8D4ED8BFEC1A0F21C4884A GENARO.BOUMAN
438,333,069 *2C6EA0189181BF5310C76D49C83A87E3861C133A GENTLYTURNEDONYOURHEAD
438,333,070 *2C620AC1391BA04E8AAFE8C45803CB59B9563173 SAMUALTINNELL
438,333,071 *2C6EBCAC96109C598A7CB68872BD7B8EFB979887 danpa
438,333,072 *2C636B2C68C279F8B9920C4043CA9643517EA851 SANFORD.LEICHT
438,333,073 *2C64C38FF39ADF4082216466992669295BA84A12 DARINPHILLIPS
438,333,074 *2C60C04C0204E0BEA5CA8E13884700329C363A4F darnellbobek
438,333,075 *2C6734AA5767E212828DACB80F27D77CA65B0AB2 DARRICKOSMOND
438,333,076 *2C645FB2B7F6F85D6FFEF561052188FB92DB06F9 GIARRATN
438,333,077 *2C6643B2DB4AD7EAA2BC253AC25A3D346AFBFDD7 DARRYLJOU
438,333,078 *2C66784F8212078FF98FDD3C10E7AA202A597352 SASSYSPARROW9
438,333,079 *2C693A791C7027FC5A205E8C16A41E1C04A7D88A sauschneider
438,333,080 *2C667A82D1311E7E631CF4EA1D794265B8FE8C75 gl3mm3bog
438,333,081 *2C65A5EA12BE1D2EF2F66D775EAF3E3DD06CC91E I:]+
438,333,082 *2C66AE95300E81258FB68F454B817DFD1E7EF5B4 Godskitchen:-Direct-(disc-1:-11-PM)
438,333,083 *2C68DA1025180B04EE2280445DB2AD9B52846888 [email protected]
438,333,084 *2C6D98072838DDC92103F746044709EDFFF64D32 goias5
438,333,085 *2C61A5A9B108828193503296644F750CA264FF71 IDLEWTNO
438,333,086 *2C61553D16CAE406163CB49A39815466520B8B1F scotverros
438,333,087 *2C6132474D75418FA65832D1C2852AC0BAD4CE7E d:d1u
438,333,088 *2C6E9A589914C414F64B6477F36F6C535512C494 DEANSCARROW
438,333,089 *2C608B2384CC4DFCAB73C14E08EDBBB01A27AAED debbiemarzano
438,333,090 *2C63EDDC836FA40855287B15DE09B1466311BFFE [email protected]
438,333,091 *2C6B7090C929065638AA1AD18938216471CB233B Greg.Wayne
438,333,092 *2C6108CF08542181198111C426C9F51E72E9F13D GROVERSTAROWICZ
438,333,093 *2C6CB81DE90136A12DE97842440A14F63217B650 ILGOBJ
438,333,094 *2C64B8EF8FBCF0DE1E96046D1C2C3DB515BB0466 seldasever
438,333,095 *2C6877071EF85F5262314C603EF00F0A6F8F6BF2 GURAN DI NAGRI
438,333,096 *2C6017D564EF1665C1F5DA33DB7DAC0166FFAD72 iluvblood74
438,333,097 *2C6BB675755D460C8ED2929AADA28B2C3F89263A d?ek1
438,333,098 *2C6C7D4C7875C036EEEE4C989FE2FBC42A6D6A65 DELMERSCHIAVI
438,333,099 *2C6F997F036CDF17C951CBEF04EFEFCD1172E864 sessileoak.co.uk
438,333,100 *2C6CDDC34A639E171925A3C47EC214817909B030 I'M-IN-LOVE-12"
438,333,101 *2C67F85C4525F9277685B97F0FF3682D40353223 immunochemotherapy
438,333,102 *2C67A4710D645EF4C29CEAD62C79C16FB925B0C4 inc1in0meter
438,333,103 *2C6F8E0B38A06BEE97A5E21BC9CE717974CA2D1A dennisbardon
438,333,104 *2C6A8E760445819B12BFC69C2724A65AD684EAAE HARNRÜCKSTÄNDEN
438,333,105 *2C6766A7A7C986891B61619A8F1FE22DFE1FF4EF INGESNEDENEN9
438,333,106 *2C6BCB1489E5B2090596F14F19019999AB3D5352 intendeva0
438,333,107 *2C6B58280BCB9D2BC691829314E5E0A6EA1D3F1F HEGEYIN
438,333,108 *2C6573CAE750A9731A3A58BF0B25BEFB28CDE391 heiken82
438,333,109 *2C6031AB45D60310F6E7987920563265A0FA0E59 HENRY.LESCHES
438,333,110 *2C67CFCB3100077428837E429256D4A6F15FC1A4 henssler
438,333,111 *2C6845DE9987E5B6B11480C0BE16CD454E8541A2 isnuotta
438,333,112 *2C6ED11BD192DFA7FC5FCE523C6BF0C34A4B0FA0 dezisirav9
438,333,113 *2C67038223BB127E2AB89C2850B805347D4D161A $HI3LDWA
438,333,114 *2C689E0E88E8086E4CED40149784A6D0D0768F40 df_ly
438,333,115 *2C63F269DC15E0B326AE4083BDF245342DC8FF3D SILLONISTESED
438,333,116 *2C614CD3C08AF086E640231A5E40E9F55779AF68 hiroshima's revenge
438,333,117 *2C64868F79840F7BD2D0BC0A261844FEF8509608 ITIM TOUR COMPILATION 2002
438,333,118 *2C6442CCA2746DF4FA56C3A7232A2E1227F28BE5 HOVEILNG
438,333,119 *2C67E317DA8AFB6B1BE9A8FF709756D45521C35F hq(6
438,333,120 *2C6D2C7E3A49FC0D8A246825BE4013EA41871B06 HTTPWWW.POCKLINGTONS
438,333,121 *2C66FCB7D7F31BA641D8EB7A29E890233142D3C9 [email protected]
438,333,122 *2C6B293BB4281A425FB5041D622D0EB4ADD429EE [email protected]
438,333,123 *2C6AD9D0E474B278F8074BADCDB4DFF21076591E [email protected]
438,333,124 *2C68DDF50B78D4FAC6E9E405AC9E3BEB81261B4F SKIPDUBIDU
438,333,125 *2C60A0395289F755D6E6B1C6686E65B9D3FBBF0C jackiesantiesteban
438,333,126 *2C6FE027E5DCD34F110D1BB32B64D1F41BF49C18 jacksonmississippi
438,333,127 *2C69CF1F63338FCB2455753F718F7FC4113001CE JAFETMADHU
438,333,128 *2C6B8DEC1277A170C3550AC9D7DAA5087AB3E823 JAMALALIRE
438,333,129 *2C6D5BBF5F72B95A7735AA97E21ED7BEB7E23DE0 hypercorrective
438,333,130 *2C6B2CF1538B29B04C448D2BC4255B15D7BD8645 dialyses
438,333,131 *2C69A4C9D1E3D8ACDB4D24A31E0A34939E21F502 SNUIFDOZ5
438,333,132 *2C680017ECF349FA5C96332099691F20451CF11B D;IF2
438,333,133 *2C6F6082ADE93E14CA1D1445A39286BCDD109AB1 DIMENSIV0
438,333,134 *2C6CE9E8FE70E5DF24FAA05F59A272C36651CACD ID])
438,333,135 *2C6D06647196D55F7B54988E147EA907CB7AA61A idesmarch
438,333,136 *2C6C14CF2ED9267A39CBF08AEE073A3CD2D3CD37 IDIOXEIRWS
438,333,137 *2C6BF1E884AC1E25BA3E0DE1BB47A9797B236916 JAYSONHOCHNADEL
438,333,138 *2C6C92649B2AA753F8787E5C5066A3C9D72B2C5A [email protected]
438,333,139 *2C61C420109FBA99D630A7B77ACC8A1EE1F93332 jeanstinnette
438,333,140 *2C6131E5E2693E5EA093850418FB43BF6680DB62 JEFFEREY.BETTNER
438,333,141 *2C6355785B0CFD9C71FF15913A9698001A2B45AB ILEKIC
438,333,142 *2C6FE4E6D613AA7B3636BD44C6CE97FC1D289679 i'll take it
438,333,143 *2C63EB0D2F2C040E019D3A9B6FFFBCEADDDC58DA [email protected]
438,333,144 *2C641D02E9D140428EA7A26A108BA54C423CDC4F ilovetim6305
438,333,145 *2C691BA6821DF34576A0AE416C20118950B25593 SORKARNAED
438,333,146 *2C6E18F7724AC6C501D59C4E1F2E6ECED41D0D05 jessecline
438,333,147 *2C6C3D20CC6B114068F5D29E2A86ABB6DD4DB9AF dj:v
438,333,148 *2C6B785BE274D2935D112A27CF225BCBEF6D4D4E JIMMYGAJEWSKI
438,333,149 *2C647785024111268EF66EDBFA87F6513B3CEF6B [email protected]
438,333,150 *2C6231F15997937670C7897629FC1B1456B1546E SPATMANATHAN
438,333,151 *2C65433E8CCA8EE650A18DF93EB783A33C6DF362 JKONTZLE
438,333,152 *2C613ACCDD26F77486389A9C939C6881A6BAE08F SPINNINLG
438,333,153 *2C61F188D1A3E1ABCC504BAD8CC41EAC81579E5D JODYPESKIN
438,333,154 *2C6C35C0D7FAE22090A844D6209EA41B76B9292F joegenjoegen
438,333,155 *2C6D4D369D440DA85054646835376F7DB70A9314 Doc
438,333,156 *2C61F76BB7CFB5135A9DC218809DBC22859B8E1B DO//H
438,333,157 *2C69EFE6E0FF049402A57FE9FB405547904998F3 JOHN TOMBLIN
438,333,158 *2C61295D3EDDCF135392CCB05174C580D74A8B37 sprmpnd4
438,333,159 *2C6D3EFDBCE99BB743B18D2AEC7B29CE93E010AF srediarroines
438,333,160 *2C6D2E3AC3EC197BB244B0199232847AE4AF5235 DONTECARAVATI
438,333,161 *2C6BF807D71B1019FB252DC2A3A7999430564A05 INNOS2K
438,333,162 *2C629BD2C2787FB9D3F4D5420958322E25E25F51 INREBLAED
438,333,163 *2C69FBC0814E690EAB85DD92FCD0042AA95226CB JORDONPHYFIHER
438,333,164 *2C67F2A4D309A737B955256392AD1296FB57D367 jorgedust
438,333,165 *2C69C1DB28A3BE1012BFF156F9C094FB9B3992D9 DOOR.OPENS.AND.SILBERMAN.STEPS.OUT.
438,333,166 *2C64847A7824160F14A526EA5F958123B9C5B36B JOSHUA1313
438,333,167 *2C6CE592D1C25B3B208F77C4BD7D2EF63975AFB6 JOSUEVACLAVIK
438,333,168 *2C6826B6CD3202D7757F0FC16AD22F86E8B938C9 dougcertosimo
438,333,169 *2C678344A7A1CBC772D84D66BDE8E64DEE79DA73 DOUGCZACHOR
438,333,170 *2C68C0545FBFBB691BA08484E0A229DEEE562786 JOYCE-BETHEA
438,333,171 *2C63D9776EF77FA7D5570890525B4D8C2CCE6ACB JU2103GATA
438,333,172 *2C6FD3E42BC441CF4AE7BB6D9563524AF4DCC5E3 [email protected]
438,333,173 *2C696C73609E4601AAC66FFEBA0A6D32A0E957E7 douglasspoage
438,333,174 *2C6D3CB7225D31DB90ACDE4B512840368F51FF6C DOUGYOUMANS
438,333,175 *2C669A5D9576B37ED79B66A2074E2947EB0336D8 stanfordlafon
438,333,176 *2C6406C07985DFF4B5718480BE486241EAA59750 STANTON.CALKINS
438,333,177 *2C60EDF5732D0723A2FD4FF215ECB3D76E4C78B8 juniorravotta
438,333,178 *2C62F7FA950AE6254D2645A454A162776BD1F3D9 iorekbyrnison
438,333,179 *2C6F2D3DC66460C5B5EE4A18ADE60F8BD8212BDD stephanievanwinkle
438,333,180 *2C6A1C74A97741B6673703F25057BDF3E4988398 ir'u
438,333,181 *2C62772687C5761932CAFE81FC2EC462AB1CECAF dr5rp
438,333,182 *2C6045749269C5615FE81E5EEDD8CBD755F536FE [email protected]
438,333,183 *2C6D9F73F42FF3D79DBBB9E7B2002327D8219C01 KAREEMMIRANDO
438,333,184 *2C6E91926CFFADC0936467E33215F0B1FAF8A3E0 DR?!F
438,333,185 *2C6C5020686B66F7F7293F1C81ABEB24357A03E0 dr.russell
438,333,186 *2C6BC205BB686820F693502D0ED8416FCAF0D974 Dsab1ement
438,333,187 *2C6AC4BA01E7C75DA1792BE0D908FCD9526AF466 KBAS
438,333,188 *2C6DA7A89DFFC1EF331A6F573120836B53114B0B [email protected]
438,333,189 *2C6F08905531AA7B203BA325CE097537FE48CCEE STUKACHI8
438,333,190 *2C67EB56CAE17C17C2D36857607BD99F208DEF1B substantive_basis.'s/@/bst/@/nt/i/v_'b/ei/s/i/s
438,333,191 *2C6C0C4625F1D8878514D918868DFA84334F42AF JACKIE.MERRITT
438,333,192 *2C6BA1CA8D67FAC4D4E37E6FE7D04BC866C98247 JACK LANKFORD
438,333,193 *2C661720AB10AB2DAEF3F93BDE21E64610703783 JACKSONIMBESI
438,333,194 *2C62580CA93B31BB19081768D5EB51F2326F8019 DTMAL
438,333,195 *2C6440E27E7FF0D2AF5D6E2267FE652404D391C6 d#tr3
438,333,196 *2C625A5928A0185DA91296C57DCC8035AD7B1BDB DTu+
438,333,197 *2C6728735B3B6AACF3964BF01BB9E20D82E66E37 SULFRICO1234
438,333,198 *2C6A31C187BBA45D75A018AC2996DE1157A30DB4 jaiya
438,333,199 *2C65E5E6E2898A7C91C89B2B03EC09BDD0594219 KERATORRHEXISES
438,333,200 *2C6570D9599279E9B0233E859DD639DEEFB17F80 JAMEHOBB
438,333,201 *2C6E1C80DA74668D24A08568999640BCD5C22705 DUSTIN.GEBERTH
438,333,202 *2C60F52427756689D6699C6C278E5DA108B15D9F kevinmarleau
438,333,203 *2C68BC8BBECFE675E735F0F679DB96BDBD63E320 DUURATAH2
438,333,204 *2C608E779A352BE680514200F8AC863D1241E800 Kierkegaard'k/i/rk/@/,g/A/rd
438,333,205 *2C698F0583686A0B52E9A0D22A3EF98120C2D166 surmasõlmi
438,333,206 *2C605C2FEF49E7E6077604E28CA70DA3832FEBFD DWAYNE.BRODISH
438,333,207 *2C664CCE5DD893CB2BE8356DD6BC07B11FC62A3F SWEETPEAHOUSE
438,333,208 *2C6A3C30EEF38F92B02E094ADCBE68189CE4F231 [email protected]
438,333,209 *2C66AC32B166A8211EEC4D57830E45E4A43093FA DX_TL
438,333,210 *2C6BDE699A0ABE85691AF22E16621341CEFE4047 KnockKnockKnocking
438,333,211 *2C66F955FE14DBF8C46B7FABB89F087339FD076D koryna
438,333,212 *2C655C8195400CFC1ADDD72B08EEE05CAFC279FB KOSARKASKOG-2
438,333,213 *2C6F185A983972C230BA594033B7D4E132B7878C talk1422451939
438,333,214 *2C6BD38EFF432D6B11578B76B44328EC4BC35E63 KRISTOFER.HAWARD
438,333,215 *2C65E4B289AA5477542DA1D86604024A3BAD7280 jeffpolemeni
438,333,216 *2C64CDAC9F6DA53A02FC7B720FB38B0745CDD895 KRUNK’S
438,333,217 *2C62810A23FD26051828370104E093D6420CA2EF je.n'ai.jamais.vu.le.mexique
438,333,218 *2C670F1676486546D131810CE9513AE2A84A5391 JENSOLE
438,333,219 *2C6F439135FE2C9BD8DA69BE25EBD1F3F80E701B TALKSWASH428
438,333,220 *2C680B73427ED84D3F5A9984F9F56ED50B4139B3 KURTJOKI
438,333,221 *2C65B3CC17DE56094B5DF974806C691BFAAF8505 ECKZYLINDER8
438,333,222 *2C6B4034DA64055771F37881D5204CF8AB862D07 ECls
438,333,223 *2C6436037A71F3A6BAA92C150BAD810690919048 TAMALA RICHARDSON
438,333,224 *2C6CC237C4B420EC4A727D0DCF9F22C5522C2C5F KWADER
438,333,225 *2C678E8255303B20ECDBFBA767FFA5BA3C60A54A [email protected]
438,333,226 *2C6B4F2B1C302BADF479C2F805DB65296DE9A23D KYLE-LEX
438,333,227 *2C6F6773D8D1680B330A19605B657F6176E60DD7 EDMUNDOFINZEL
438,333,228 *2C6A19E99173A780237C9C4B86FCB059364F17E3 JESUSCOXEY
438,333,229 *2C66E9E9C9F75BCC257EB58761B23EDDE7D54113 JGX8
438,333,230 *2C628C5F085965E59EF5F2E0DBB129BC59C7D52E LACTEAL6
438,333,231 *2C6F50D88AD613BDDC7D6D3A7487232D1E56E702 [email protected]
438,333,232 *2C6A3BE36098DFAAC24001053F2281FDF74B077D JKEEGANS
438,333,233 *2C6D1BB7B7DF1872A60F4C080F2B8500191F202A LANE.KNOX
438,333,234 *2C67202362BEE657C49019AA6D576639F10332E0 TEDDY.EDWARDS.SPEAKS.-.MAGGIE.-.CHARLIE.PARKER'S.FIRST.DIAL.DATE
438,333,235 *2C62D6978C0416D11B52D22B9365D0C2A318A179 LAURA.OKELLY
438,333,236 *2C660B0E2743426FD63DAE4A80D1BE4EA5DF95C1 TENDONOU9
438,333,237 *2C653C6A42129D59F84E115DCC71DBBF237CB963 tequila-sunday
438,333,238 *2C6ADFB4B8062397322133A589B1051DF0B1DB8B JOHNIE.YAEGLE
438,333,239 *2C66723A1968318222BB78CCBD2F4963DE2F68F8 LAZARORILEY
438,333,240 *2C6CDBF3758A52EB2E30FEC7BF4ED801C2EFA847 LEASTCANONICAL
438,333,241 *2C6B7536B3421E91EF1B96D798A9D4A2ACDE912F ledzep1935
438,333,242 *2C63936DDA2D866426E0D539940F75487AC915DD EKOF#
438,333,243 *2C6A2D7D62D695966AD0EBCE8503A0B43CA742BD eldridgenatwick
438,333,244 *2C63BC44AEC8C7758CFD0E50679F94BB6FE8BBD9 LEN.ASUNCION
438,333,245 *2C61578CCC82AD4661D0F6F744327461C1BA6A0F LENNY-WILLSON
438,333,246 *2C67E38D8FF8E5020D5A9BCBA7F040C2C6831197 elgomaskondenadi77o
438,333,247 *2C6E63620F61FED4FD1640DD1FCA93DBDF5A4209 Thank.God.for.Music.(feat..Mr..Gee)
438,333,248 *2C68F5522B68D96FE84E32DDE65F41072B2E83B2 LEONELSUEHS
438,333,249 *2C6386B0B5C9838997D04EF333503FDA266E4A44 thatjimbob09
438,333,250 *2C64F2DDFA28BF67E43C15C78FE303108A412172 thatsidekick73
438,333,251 *2C635807FDE1722BA6C172B1310BA20D94BB38FD ellmaierhaus
438,333,252 *2C69FDAD3BF4BA270995C0F6B1CCA40FA1CFD7B2 THEBOSSNUGGET
438,333,253 *2C6B4709D29D11DED1E22F25AFC8A0C21ACF88F4 lestercossaboon
438,333,254 *2C60F34209AB1D63C0DCCFEE5F68797D5EC356D3 LF123
438,333,255 *2C6E2DC2983AFBBC8B3E7BBD4CD314E0D6C024CB [email protected]
438,333,256 *2C64DEFA0B00347542937906C04C7C92B5F80119 Licence.to.Kill
438,333,257 *2C633572E5A3A1BD4083751D6994F5B46699BF58 THEFUSIONIST
438,333,258 *2C6A3460C1A6E1EC2D0244F0E0F7151BF2780F3A THEMATTHEW73
438,333,259 *2C6B1AD4652507334936E5D915935A15EDFF196C [email protected]
438,333,260 *2C6D4F74E39F51A9EB68E6FFF56FE476B6836EBA em#m#
438,333,261 *2C668CE6CC76372574D9C35D52EC7EAFA3570ED6 kalkarti
438,333,262 *2C6F61599D03C59E61788D28ACE8E02B2BF8B426 LINDSEY.LAVESQUE
438,333,263 *2C6562E786D0D0DD2376B8F187D37335BA89905E KARKOITTUMAAN
438,333,264 *2C6E67D3EE18207E07D6F223ED9AB065C7916705 [email protected]
438,333,265 *2C6F3BABA51E5689BD1F60A5D0E4A38DB246AB0C KASTHOR
438,333,266 *2C691A50EEAB9AE77BFD3C94A93F48FB49E3A3DA KATEWOODHAM
438,333,267 *2C6885C4BDE6A77DF67573A1AAEDE8A4AFA4BB46 eninokal7
438,333,268 *2C6EA99B3F3537EBAFF46CEEFC657EDAB4A5821B LIPOCKY
438,333,269 *2C629D2EF9D573CB5D59A176A10900BDE9E1FB25 [email protected]$
438,333,270 *2C68E9F0E262072C0E2AC684F7FD53F9235B92C8 thnpsychc
438,333,271 *2C66F9AA2337B0AF5E05D65BC728575CCD2D289C LNO4ZS8M
438,333,272 *2C60A1A2D1642A28FE456B9309A3C3C2D05BE4F0 ERBOASA
438,333,273 *2C64994D56CD1FF7727888DB6869F7432A85229E KENTWALINSKI
438,333,274 *2C64D64BE00FFC94032486DA5791ECFF344FD851 KERMITMAGUIRE
438,333,275 *2C6BDC869FF19F19FF3F361B6E42E709F70132CA KERMIT.MOORING
438,333,276 *2C6932ECCCF1C02CB7E6B92A469A608FFD3EC435 LOUIE.LIMESAND
438,333,277 *2C6DC870FC6B50A40958B0971AEF141E1E96FD9D TINTABLED5
438,333,278 *2C6EE625DF39455D819A2792B1D5ECE98E1CB8E3 TINYGOMEZ
438,333,279 *2C647440CA98920004BD3C8C45CB7E33F570A011 KF`9
438,333,280 *2C6A1A6C69689B963AB0709C2B118BBD7B534C10 LOUPRICHARD
438,333,281 *2C6BA8F871517C25E16092B14821C0E6DAF2AD4D ERNESTOMATHSON
438,333,282 *2C6806EEAEF7758A0C920141F5669A20E1DC80DA TKN,
438,333,283 *2C67DF73E3F534716BB424131FB77926ECD1D867 TNMSSSSR
438,333,284 *2C667CC0441ECF33F5DE902C814E92A552EDFF70 ESFOQ.FORO
438,333,285 *2C69AE3A1B360CC5E29CB48280997166165C2E9C TOBYTROSIEN
438,333,286 *2C671EBC98257E29056F937DEB83B20038664142 TOBY.WAFFORD
438,333,287 *2C6686221D68DBE0AD4255166821842778A9C6AC kiszán
438,333,288 *2C6DF6FA063D1FA1630488FD2ECE7E30B425ED63 essissot6
438,333,289 *2C6CAEE351709AA27768504C8103640820CAB1F3 LUKE.POISEL
438,333,290 *2C6FF8971713F7B938DE03E425666F475DC5CB34 ETCON
438,333,291 *2C65572509E70C81C18B115B83A683F5F88C4C37 [email protected]
438,333,292 *2C6CF5179A4C17BB1578EA7EC112B4083F3EED96 [email protected]
438,333,293 *2C68E23A6A4339F09864A1A59F955F6E7054C402 TRACK」のアルバムには、「それ行けカープ」のほか、MAZDA
438,333,294 *2C664AAB66DC2171AF1BFFA42C622DFF9A7FEF7F everettburcham
438,333,295 *2C6D90268657B74979CC2A857046EE8F370FC4F1 [email protected]
438,333,296 *2C6B2AD0A1F478B719CC73467C256F72B40435AE everythingisyou
438,333,297 *2C67823A39CBC0C2357FDA750CF3D9C4B3DEEA29 KOMBATPIGLET
438,333,298 *2C6D252CC1CE6C12B8EC6D31F862CCC30ADAEE2A “kongresna”
438,333,299 *2C6B88632A5DAE5D3A9F6035BE39EB78AB40C744 KOREYSHACKETT
438,333,300 *2C610C6D58F7AA6008CD3C164CC290EE04743628 MAHMOOD MOHEBBI
438,333,301 *2C6FDF4F72D8E8645B5D3B8EE960F6A534E7BF05 ezå
438,333,302 *2C666A35B84661DB64362D537E3AE1177B65AF44 KRAIG.LITTERER
438,333,303 *2C6412A31C0EF7546BCB057B822A59D598344377 MAJIDALHAMDAN
438,333,304 *2C69F975307ACF33C3C96A2129FFFA3B7107A7F6 KREYINNEN
438,333,305 *2C67AECB9B4E57B0E2107E50D36DC80A7173B5B3 TRIGGER-MACY
438,333,306 *2C66329E36E6867340D08DAA107D2C829E9EF382 [email protected]
438,333,307 *2C6C9828021A17AAA36CF72C7DA084D6DD64AAF6 fabian.estrada
438,333,308 *2C688CDB4BD1228798F71817BC1856DE02D2C7A1 kroetskich
438,333,309 *2C66F742361A4AE9AE9CDA5072150612456C20CC malikharbin
438,333,310 *2C61E546E05F88ED8D24DBE3C563BFF8FB349CDC FAIRLEIGGING
438,333,311 *2C6F57540AF5177DAF2EBC5D1E3CA91E6B5D917B KURTISBASSETT
438,333,312 *2C626F58E221F28BA03D7D6D3F56489050A162D9 FAR7HIN9ALES
438,333,313 *2C62D810F5C3BB2D6B2B174769E75230A2431F0A MARCUSSHAND
438,333,314 *2C68CFE791BB6CF9DF676BB573D3D7BD7A9EDA0B kylie57
438,333,315 *2C676969B7B1BA7AFEECDEB27FDCB7708E9EA60F federicoluper
438,333,316 *2C6E23F5E61FD04C4B601F59D5CA294C09D7D3C5 mariodemiel
438,333,317 *2C6376787CC64F07D644412DC6A7C13D844FA62F TT0061956
438,333,318 *2C6F7CE982003D3C9D2ED5B5F5816B8B686DA930 marisa-glover
438,333,319 *2C6C7EB6953A9F255900A38E4A22789CCF3D2EDC maritaviitasalo
438,333,320 *2C671AE9C52BD5C1B7C37E3A5BD4E003AF211AC9 TTUUJRUHS
438,333,321 *2C635817665A5C24E1D9884345005F41FD9C49E6 TUCKWELL5
438,333,322 *2C6BEDC7F0ABC08A928D457DA2395369143AFB40 FERNWASSERLEITUNGEN
438,333,323 *2C64CF3DDA979D65509DA9B550AF598851A7CE38 FHRTFWND0
438,333,324 *2C6508BBCF76387FCF898E4D328B4D7CD640B664 FIDELMORETTA
438,333,325 *2C6FC9B1C403EE687CF1A3CBF1A8681378544CAE MARTIN GAUT
438,333,326 *2C6C8C3C2021FED87C55EED19717EC6CC1308955 FIGARO-POLKA
438,333,327 *2C647CFA72C997B616C984A76BD9B738D350AA04 TY-CGOOR
438,333,328 *2C651C6A291C78E165F683C7753834C783A2BA24 TYREE.GRAMC
438,333,329 *2C65C7D6D532ACA78AC68FC691F3F8CF82F2EE90 [email protected]
438,333,330 *2C65FCAB4BB7DADCB5AF614084A9030B509894BA flagstone'fl/&/g,st/ou/n
438,333,331 *2C60E088DEDDC712E6B85D1684BBCECC178E09C5 FLINDENT0
438,333,332 *2C6C4E294DF2012269842EA0C156DB12FF0C7863 massivsulfidlagen
438,333,333 *2C6C29CDC348A047802F7F3570A2C373E48E0DA8 LANDKÜRZEL
438,333,334 *2C66C5E2019750946F10A857434DAEA69B59DF1A [email protected]
438,333,335 *2C6A269C4028C4ACD766533177AD2BB277FF49C1 MAUREEN-DE-VILLIERS
438,333,336 *2C65D3BFD9B555F85C5A6FF69FC5989C5EA16943 MAUREEN-DOLAN
438,333,337 *2C67DDD6A962DFE029503AC38B665E7A85F7E30F LANNYSPELLACY
438,333,338 *2C699A8DFCCCF3D62F1CF8908CEC9E60F734ECEA floydsteinkellner
438,333,339 *2C603D8D9668C825859D7F0A9D7E6F71308FBE0E l’anson
438,333,340 *2C6FC27CCF23BE0E79D0DA7E1C4CA841A49B2FB5 maxbroderick
438,333,341 *2C63C4F95858503D7A0C82C03BAD4C88AEBADFDA UMLPHWPLGHB2
438,333,342 *2C6DE846FB96A02F2EC5C1F40BDD8A3FB0510814 LAURAMEDICO
438,333,343 *2C631DB73D7BEFACF8B8739C19F70F6626395CDB und3rwri73r$
438,333,344 *2C6DB6A446E5029AFAFC5BEDD7329A1DA6C91DEE [email protected]
438,333,345 *2C6A07B63D651BC1B2194FA08C982645B3F2C9F1 FORCESTUBCLASS
438,333,346 *2C6EF98DF9F9CECF591C76A64BE498C0835B543F MCKINLEYSCHEFFERT
438,333,347 *2C69B5673877C2A50C20B371AECFCF7C1323D073 FORIRDIAL
438,333,348 *2C6AFC6A287EA0FCFF128069024159EFD700BCE9 fredonniez?
438,333,349 *2C689DAE56720528817FA39C8DE0EFA73EBD2C67 URBDLROW1
438,333,350 *2C67F491A32454A8088DDF89CE7B8EAD60072D09 urduer0duw1
438,333,351 *2C6F28B39814305CB9E3097155F3EC890858D55A US-PASSIONBWV244:IIEVANGELISTA"DAJESUSDIESEREDEVOLLENDETHATTE"
438,333,352 *2C6AB9E6F85590F4A8E8B4F8A057F16B91D1E6AA michelrayfield
438,333,353 *2C60C7351F61882CDCDE4C8D6BC9B293EDD1DD48 FRUITTRUCK
438,333,354 *2C6FC4CA64264858FAB9A1001355715EA83003C9 LESLIE.PENWELL
438,333,355 *2C6E206A194197726C286D0C8798975DEC378757 LES.PORTES.DU.SOUVENIR
438,333,356 *2C686E882F04DBB05F71096B5E3B65D880946E5E LIOPSED3
438,333,357 *2C6BBB0F21F8F46B1A3D91BE39A4827A3E7772EC LISA MEEK
438,333,358 *2C6A5141E7D126E426B616B903DE494CCD129EC0 VÁLASZTHANI
438,333,359 *2C61B4BE58A07D9D18B2F6F1D996972C4CBE1F9E VALERIAALEXANDREI
438,333,360 *2C633AE9342F4A24EAC6F1E19925312B743567E6 g–164
438,333,361 *2C6CA71F76AEE2C2000327F8F1270F1E08F07623 [email protected]
438,333,362 *2C626DC9A4B0932A321A84F707762AA1DFB54180 [email protected]
438,333,363 *2C6CF08534ADE43515C4C5BC7C17969F1D5CA056 LLEHYBBA
438,333,364 *2C66A09BDF3350438D731833D8D6223C39B99083 MIUSINAU1
438,333,365 *2C6FF3DCB112E1EBE02A2E9F800F5276C7B59F4F VANESSA UHER
438,333,366 *2C6F6033CB7339BA81247692AA10E5B722E614CD MLALSHETH
438,333,367 *2C6B536AE9E9EA2A244099DBE15704278F5C2E86 GALENTHUNEY
438,333,368 *2C6C6179C79D6A28AB3DC8137F15C5C3FC4A00B6 LOKHANGWAN
438,333,369 *2C65A240858603F355A28793A504B31B1496443B LONGINQUOQUE1
438,333,370 *2C6F3A8B4DFAEFA50CCD578A07BE4475078F1300 GARFIELDDOUDNA
438,333,371 *2C6063F1E5A17617A00A66245C9A78849C2239DC MOHAMMEDLAGERBERG
438,333,372 *2C62B1F1963072F0996D62E996462B2BD90828E5 LOST-IN-THE-HARBOR
438,333,373 *2C63E8030542CD2928106FF13D192F4750F67B86 lotty89
438,333,374 *2C683FF51A4B4753459CDBCF8F8C70482463E9BC VERBRAUCHERMAERKTEN
438,333,375 *2C6C0BD7E08B5A1BACB63AEB8848251C191E69F2 LUCIANO.SERMANIA
438,333,376 *2C6028509AE7F00DF9AD6EA4362B3E91E963EBB1 VERONDIZON
438,333,377 *2C6A40ABE0DD1CBE9BB5B809775EF488A485A837 genrogenro
438,333,378 *2C61D88EBAF76B1DF3D06887C020A494DE9A7EC6 VERWAHRUNGSSTÄTTE
438,333,379 *2C6EC923034D94F28B1FCDE2D9F37939CC8DD022 LUISGIERA
438,333,380 *2C6455D332965F68074F30E418ACDC0B7F793E08 GESTIONA0
438,333,381 *2C608BE478064ED6C7BCAAE1B7C165D63DA52449 vickramj
438,333,382 *2C6C0E4C21944E5DF4575A2810684B2D66E3D6D3 lyndonstenzel
438,333,383 *2C63102F31C3E2E7C8CE64D1D35DEFB78E0B08E9 LYNNORE4
438,333,384 *2C6B2720C605D51ED9078BCCFE569DDF2A1B5038 GEWAESSERENTWICKLUNGSKONZEPTKUPFER
438,333,385 *2C6407C1E12BDDB7E5CEB4A4B454CEE24D4297A5 gilbertguevin
438,333,386 *2C68AE297EA34057233B03016056721590047024 VINCENT-JIANG
438,333,387 *2C6AC14E610C58B30DA90068F369781CD045F32B MULLIGIS1
438,333,388 *2C663719B04EA32CC94B769A8B9E3690B5174B3F GIUSEPPEHOGUE
438,333,389 *2C6A3243DD17DD79FB6D5C2C9DBC09F555D03220 give-and-get
438,333,390 *2C6BA2DE11395DDDDCB95061349F7F524932285E „GLAM
438,333,391 *2C6AD46A99BF5E831585F984CD2DE80268532FE6 mãhãlãlu
438,333,392 *2C6F400580A004A096E7E1F7F4AEC5C36D4070DA my man ski
438,333,393 *2C68051D418CA981E419A862416FCEC4ED32C542 GNUTHCA9
438,333,394 *2C6CEB2E02EFEFED86CE9EB99D5F99994A18A923 VLADICAM-WLAJKO
438,333,395 *2C687B8BA949DD190EFF952530B2BC36A844EEF9 GO4L-CRE4
438,333,396 *2C69F2135BA90E476BB58936ACC6D567D0F7F016 VOLTAIRE.SEAN.ANDRES
438,333,397 *2C64151830F31C5C0BA4A0B589488450E7BA38FB [email protected]
438,333,398 *2C6D82648E4A67E11CDFF3F22A52B91FF91C9C49 [email protected]
438,333,399 *2C698BA2DC03DB58B6734B37A68589C0CF0577AF GORDONDUBAS
438,333,400 *2C68A14C687D0937E7D5F4FD19AEDCDCDDB28518 [email protected]
438,333,401 *2C61CC621204E90BE8C836888924174083146FAA [email protected]
438,333,402 *2C65AD09D7FD3B403132BBF048FA368A9387C2ED GR4MM4T1K
438,333,403 *2C676954E6024BB1722EEF5CCCF99BA1D29216F8 nathanmalibu
438,333,404 *2C67193EB731A00B3B56E49759D0324D3AF2CA46 [email protected]
438,333,405 *2C6CBD4D5A4F32345D26242890076214BEEB92CC GRAIGLEVITSKY
438,333,406 *2C61876C249D9EE30C3333C88C60FE214DAF2413 vwa!
438,333,407 *2C6963B2C3E864E61C58C213AE4554F496717FCA grantwoodlock
438,333,408 *2C6FA8B868BE9D0930C587C0579B696BEE986BBD VАMBEL
438,333,409 *2C64D46CD6CD032561E468E3CFEEBD85A1AFC32A graph010g!s7
438,333,410 *2C6FD6DAE225EC959F91DBE15569A109CF4094A6 w8gezonm2e5mud835z864
438,333,411 *2C68BEC262AADE03CFA742CD2A4D18DA2FC76943 \W9BAA
438,333,412 *2C629B53300F1F7AEEEB85C6D5BF42D606581297 WAIMAN
438,333,413 *2C64B561EB98175347498277FC712FF782E83CB8 nednotstsav
438,333,414 *2C65946179B805368FBE3866E6A1A506CCA0C4F6 NEREDNURING
438,333,415 *2C666F747A1877E7E66B37018C6244E6E5F24BBA GRUADRESSE
438,333,416 *2C6AEC17F11891E46882AEB58D2DA772B4924ED2 grupebsw5
438,333,417 *2C6BF33648328587E693DE821A0DB44D4E3D0B73 nestorkodama
438,333,418 *2C6343F2327355583E328AE397FB52D2A33D60DB MARVINGARGIS
438,333,419 *2C626AC12562444437ED3832E361AA69E2AEC1C3 guantanamo?
438,333,420 *2C639090C4A4D74BBED42ADB4C1164EC15C6A4FD netukayh
438,333,421 *2C670AA8348D01C6AA9D7520827F291FD45C61A3 günahlarin
438,333,422 *2C6192B1DB3C469ABEF24F93487C947955F61BF4 NICHOLASROERISH
438,333,423 *2C60AA4700A77B71F35FE818D25B0BDA965C40F8 warnerpederson
438,333,424 *2C67F10BD6FC5855DE194B5EC0C9095C34509595 GURSHARANJEETSINGH
438,333,425 *2C6FA8C58186875E44A4B82F3B03CA0A903252D4 guscofone
438,333,426 *2C6FB3C4DE499036495B962BB8D138F4B8D528D6 MAUDELLA
438,333,427 *2C6D4264CD58A38894259991AD1C339F761FA091 gyisofj73
438,333,428 *2C6E18F4733B81496230E3A8A2E787E4E531F919 MAXFOSTON
438,333,429 *2C633732B41C24653EE7DF2268ACD958D89B3AD7 MAXIMO.CHEANEY
438,333,430 *2C6B5EBFBA5F8F050585AB558DA44FEDF392FEF2 MAXKUPKA
438,333,431 *2C6A072B5CDD510640549D9A308C5E6E2D1BCB3F HA`*
438,333,432 *2C6D44C6AE3016D4CBCB52B654B29E2E012C0165 HAGUE.TRIBUNAL
438,333,433 *2C6F578430C934872158904C5A5DBADD1A1B5B09 NOBLE.STANWOOD
438,333,434 *2C64B5EFCFD336AB2F017BD2417B9FE62EBF0339 hanan-ali-ahmad
438,333,435 *2C607881A30C3ECE5008F3C5137BEC03E35A2208 noe583
438,333,436 *2C6827A8C70854E8041DFDF50E52F801DEDED1D1 MEANDER;VEER
438,333,437 *2C6AE6EC5284EE5B8460BC3DA5E01529E2D6E993 wendy.lottering
438,333,438 *2C61E17BFE00288A210FA12F7E90B749769D4764 meganlehman
438,333,439 *2C67D0AA5E5740281C68AF518D68E88D453A6F5B HANSSTOECKER
438,333,440 *2C671833596EDB39CAC21B7A24DA907067E47A34 MELVINDILUCCA
438,333,441 *2C6EEBEE6427084CC74B511E198949BF6D19EBAC WENNY HALOHO
438,333,442 *2C67971AAD266AF6E9FA7E2FAF767836F494ED3D norbertocrespino
438,333,443 *2C6040E75102976CD66DF8DC35C21A10399610A2 WESTON.STALBERGER
438,333,444 *2C6837390800230D9568A8B7AC8F595DC82B0528 westshows
438,333,445 *2C612919ED778718720A1BEEF74A7D175942E76F MICHEALLEONPACHER
438,333,446 *2C66536D4A5873EFB15AF4324C82AA1D174426ED michellepurchase
438,333,447 *2C6B2075B36ED70E9274229A576B33D98ECE2758 WIDODO VAN BOGANK
438,333,448 *2C66DEFB7A2103EA41F60538055638C3D3B216DC MICHELWAAS
438,333,449 *2C6166125E517185A36DCD08C76DF5C3ACAA1E8F MICROMEGA
438,333,450 *2C65FB50F8077E4C47EB2A2FD475385E21888DFD MIKE-KON
438,333,451 *2C65EEA97C980752AA691514CF3BAF06ACFE3810 OCAKLI
438,333,452 *2C6DAF82D27A86D1059C558D60EE282D14790AEB odette.botes
438,333,453 *2C65E460CD015F59DBB62531597CE7A075607D51 MILLARD.SOKOLSKI
438,333,454 *2C653E8C6D9C8086A00FC3C12AFEAE9F710E3317 [email protected]
438,333,455 *2C6A548D309098504087F727778065950ADD9621 MILTON)以
438,333,456 *2C6C6CDC052609E26517F29214E542F1DEFF54A0 mishadodger
438,333,457 *2C67138C5D1083023E84FCE9EF2C3004781F6964 WILLOW REDHEAD
438,333,458 *2C6E4707E5EB8FB7511C72A8540DCBF91FD63F21 WILLYCATHERMAN
438,333,459 *2C60C050C28B8756FBC24E4EFDC61B3FD252B8B0 missilep1
438,333,460 *2C6CBE52DD0787CC29FF15BBC905951075C09939 on-a-claire-day
438,333,461 *2C6C1FFE16820B9E7A2B73D877341B43710E8BD1 HERMAN.KAMPS
438,333,462 *2C60586DF0E590609BE3663F856E7FC6AE38B720 [email protected]
438,333,463 *2C6E394B860F6B24BA7BF9CCD27069182EE096BD WINFREDPAVELEC
438,333,464 *2C63FE54F8F77F9FA8AD5FDA9E82CCC987F7E125 MODESTOKATAOKA
438,333,465 *2C645CCDEA99325CA5ECEE4AA32A6C1A18258ADD mohammedmcgreevy
438,333,466 *2C630428F39C962D2C05528C6A426C6C6A59F2E5 Op.19-Allegro-Mosso
438,333,467 *2C6BE201C5607298E9314FB5680343964ACF6352 MOISES.CREATH
438,333,468 *2C629F62FBAF1ADBFE5FD10105510A4D078693DF WK"Y
438,333,469 *2C6045E43A1DD589D51B3E295E7CE2E109D97F86 OPRAHPARTTWO
438,333,470 *2C6A7F7ADE4D4F1629DDD36B5D34150D600779B2 monique-aucamp
438,333,471 *2C67DADD3D7B457A2A189832442325A1B354796B MONTICIANI
438,333,472 *2C651BEF57C3BE828D8CFFDFEA546E57FB8933F7 moonflavor
438,333,473 *2C63D0ECE80D1912B2F1DD77AA90DEFCC3B6F732 [email protected]
438,333,474 *2C6FCB924E4C130B03FB9D44D23DB7A481ECFA14 [email protected]
438,333,475 *2C679176A74232806917E1AA55F260C9806EED83 [email protected]
438,333,476 *2C60C800531E09E3C25650258E3E49F8F639EE5F [email protected]
438,333,477 *2C6215742C1B746DE0AA4B14F24FA9740E477CB2 OVERSALTED2
438,333,478 *2C646C7247006FEBAEB8545B592072484F454A7D msopr
438,333,479 *2C6840A3780656FD825E11067F1E5BD5A8FFD508 p##@.~0.Splat
438,333,480 *2C6DE561C064012F92230A26CAB8581733554075 hongtukuafa
438,333,481 *2C68853D259BCC2D88C8F56ACAAED40504B8E587 HORACIO.TEES
438,333,482 *2C69A86BAB2556A7274B2998B0A6F7CA251CCFD3 PAINTERO3
438,333,483 *2C61E2E8968CF0BA41B22FC3EA9DEC17DF3BA9EA [email protected]
438,333,484 *2C6DE7490751F049A6F36C1A868AB61FA18A1B9F XCQOUUI
438,333,485 *2C609E32705F3ADC16F716B0DDEEC0F17E6B74FB xhaolin.robinos
438,333,486 *2C65D66E6B6F0362674FB8FB8CBA48354C8D180F [email protected]
438,333,487 *2C6B4241A9DB25A2D7219012C6A74258AA627BF3 PARKERANASTASIADES
438,333,488 *2C6FB079A6807FBE84DAC732D7A13093FE173564 xmanuel
438,333,489 *2C60459BBF4228726F12279AE5D11E394D3C9FC4 NABEELAHA
438,333,490 *2C6C4954B1E7D58B34A26472DACBB5EF9D46B682 NABOPOLASSAROS
438,333,491 *2C67A90053B81648E138427B8F546A7DC020D770 [email protected]
438,333,492 *2C672ED890F5DB50CAE9EBBBCB24D8C93735A971 HOWARDEVERHEART
438,333,493 *2C682B3A32E0EEA67C66121DFFFEA07A00875F49 hrmphrdtc
438,333,494 *2C6281EC6A877F5327E38DDCF9F3302A67BBF8B5 HTTPWWW.Q1045.COM
438,333,495 *2C6AA02D8C083550A625D14977880975B313E4F2 NCLIXIN19870608
438,333,496 *2C68842F2F90C9308B605D7B89C878EDC99410EF NDYCOBNITROBENZENE
438,333,497 *2C69D10162247C414E5C7CE5487ABEEDB6387C2B NEAL.HERRINGTON
438,333,498 *2C6578A62CE878BFA1276684915DDED533B8D405 yas-ram
438,333,499 *2C60E15B1CE0AD4EEB65D163504CFBC2FBC9440A YAUN PANPHANTONG
438,333,500 *2C61AD39E9DBC2F8126BDA878ABE146829D0DA0B [email protected]
438,333,501 *2C63A43878BD8348958EA6D40C91CED562A958B1 YEHEZKIELYEFTA
438,333,502 *2C6A324857C0A922C6EBA6F5060B491381C5D4FB NEESTE
438,333,503 *2C6BDF8E2F82D0C4923760EA11FE1114F6E4C65B h'wh
438,333,504 *2C65C41C02587155907DDC64FB1C9D0DD3A58D56 peterrylance
438,333,505 *2C65D1A1FB62A5F213E6EE492783C11DFDF62651 PFBFY
438,333,506 *2C6A4C7D7FE4011CD8DFF0541F4605D5465ED8E6 [email protected]
438,333,507 *2C62DE0C1D000DF7930EC36EE0904F7CAB6B62C5 YOLEZXIS.ALIMBOYAO
438,333,508 *2C61FB38AB924023C1956CA8B062D64C958CA504 youfillmeup(featkeen)
438,333,509 *2C68FFA0618A6F14CF2489636F20B9474267AE99 YOUNGHUBIAK
438,333,510 *2C636A906F4A87A2967C2056051ECB14D293D444 YOUNG.PHARO
438,333,511 *2C634340619156E76A377430C6DD7517624059F6 IDEAL-AUFL
438,333,512 *2C68782E1A3A38769CED995ED4F6D90A8DF515A1 NISSANPLAYER
438,333,513 *2C65D6759749CCB72698C1034C0B53FB496893CD pinney71
438,333,514 *2C6469EE0D68FD410EEFEA03F7F1DE28608A2F6C PLANTMAINTENANCE
438,333,515 *2C617A0627E6CCFBAFA59989E0961BCB675FFE12 playboy,三女
438,333,516 *2C60649EB54A473D9254EDF889EFB4E355B04046 NOE.TIXIER
438,333,517 *2C65232D23F674C49855270E962719A239133B36 NOKULOS3
438,333,518 *2C66E077E55F2AE1723DACD06AB9C691773AF7EF NOKV
438,333,519 *2C6923188925CCDCF98507D24BC01893CAD34834 [email protected]
438,333,520 *2C67E0C433700E51FBD09903FC49B28291954BE5 polynomialm
438,333,521 *2C6454A85D06CBB23818D70A636D95BF6516F149 zamri-bin-ramli-zamri
438,333,522 *2C6193F5765A6ABC58A04E434F8BA4A551342CF0 ZAPPERANN0
438,333,523 *2C68A1B2611D68D2F75108A8EC207FFDA7A12581 NORRISHARRY
438,333,524 *2C685F5EB4EB282D09F88F1AAAD5A2B9AD4DC12F posttransitional
438,333,525 *2C6C1CBF0C1FDC5A5264F8E7BC9FB846E3B19D4F [email protected]
438,333,526 *2C6057E88AB93463E12BB1D5B28F0D2B78A3F070 P=P~ ~ (-_0)
438,333,527 *2C669D5822FFC9A8094C0E2EFEFFA3123A4C24BA NYF2
438,333,528 *2C687CB43A569798A423B3C795DD58C2108D2B72 iluvpiano33
438,333,529 *2C6B357F14F5C76877D887D363B56AC7CC426DE0 PRAYNESHA
438,333,530 *2C653F296B812EB1E9BBC890018F5A001E330B8F zohaib-samana
438,333,531 *2C6A04B5B31AACFFD672EFAB56ABEC98DA12C099 )o(.~.~.~.d--P
438,333,532 *2C635FA13A2B28090C36538EB592DA4E310BAAC2 )o(`d#q
438,333,533 *2C6F408AE459DE4B9A86421E8A42F13660BFA73D PROMLUJ3
438,333,534 *2C6C27921AA61492C528F53E863D9CDE671F50B6 inetshell
438,333,535 *2C67FAC35E0296FECA02587055CE20C8ADDB7FB6 OMAR.SZPAK
438,333,536 *2C687F42CC7ED696EEC113B3D4CA04BED27D291F omarteno
438,333,537 *2C67968A5A0812BD27C77504BA6FC1E2A99B446D АТКАРСКИЙ
438,333,538 *2C6988698BCC9BA29F9BD37DA60216C6778EDA46 БУЖЕНИ
438,333,539 *2C62CC5324742684D357DE6CB2DDBDD79F5064E1 КРАИСТ
438,333,540 *2C6F103382A4E134FBDA18007A35F407DFE9FB3D psychosoma7cs
438,333,541 *2C6B66036AE706B9F4999FC835D014D90CCC2134 ontwerpster
438,333,542 *2C6FD8381D09F1B34187D4B0D0AFBEF9F098422F ORCOTOWER
438,333,543 *2C6E9C5F6F0303C1CE6F765955C7DCAB579926C1 ordklasser3
438,333,544 *2C62C7C4125CD6268ED11F6D67B00A260510C85B qomu
438,333,545 *2C6A5D409B86B5C1FC8520A39D71087E3182E8AD СУЄТА
438,333,546 *2C655B97751CA2C5D602C7AF982B36FE98BB0DE4 IRELANDHTTPWWWHRB
438,333,547 *2C6760AE54D093C82ED480B3992D1EF3EFEBD465 УСТАНОВЛЁН
438,333,548 *2C60182D388D6F529825867DB524EA90C77542B8 IRVINGALAS
438,333,549 *2C6CE9BE3DE7C8968C04D1ED6A9E60FAB4D931E1 OUTONAREI1
438,333,550 *2C61BA322E1880A62466436A1874761E427E5AAC ISSAC.GROSHONG
438,333,551 *2C65DD0D0D9FDD43ED379ABBA04D4B99B1C25732 P##@~0-~o(>_0)
438,333,552 *2C6183371E3A46E2283F9AF282D321157C06A160 R1NS4V1SCO
438,333,553 *2C6714DC44F986A4DEAE87779527DDCC263649ED PAASOSSES
438,333,554 *2C6FEDCE84A95DDA7E544BF14DCB33519D3B10CA izq?
438,333,555 *2C68D42722925875F4304F2FD77661F07C4BB764 J0151045WMF
438,333,556 *2C620780CBF742593F1CD308B106D0441849F7AE rainjazz6
438,333,557 *2C6367EA660E3D216F1022B4D74DD76AFF3B1CAE RAJESH.HIRA
438,333,558 *2C67A61E1863074C493A889A4B481879EE8B2447 PARANORMALTN
438,333,559 *2C61154D345E002F36A64BA695EBF8BE6E30358C RAMIROSCHMIEGE
438,333,560 *2C6F6736B67935FFAF064316D4D2FA44EC6D3C0B RANDALWIGHT
438,333,561 *2C6982CC1A8D2993E5035ECF556E19411C7BD886 passjester
438,333,562 *2C6899B34824A4E5F7634024B317573D4DFDBA37 RAQ)
438,333,563 *2C65BFDB6774759A55C71CACAD74341A006754C5 PAT.VANDEPUTTE
438,333,564 *2C613467DCD766F9212D0EA1DC00F2BD8A1AE5C3 JALOSTUKSELLISESTI
438,333,565 *2C65FC2A998C22A0204914E84B561007ED1E6057 [email protected]
438,333,566 *2C628A473DEAD983006F4B4EE6170D646689545F RAUL.ROCLE
438,333,567 *2C653FD56039F381CF1CBE68B888A24E7D62D8AB jamenamey
438,333,568 *2C67AFAEEC616BB72005D3BCA3399A6B2FFF003B PB~0~osplat
438,333,569 *2C69BF66ACF5B37C8865AFDDED953FE096345F91 [email protected]
438,333,570 *2C6C9673A76EEF86A9B8E3B40778420FBF22B29F RCARDEY
438,333,571 *2C6593DC393DDC6EB8266F86325DB63ABBB475CB peachesonline
438,333,572 *2C69BDBBF3EF3EDA337FADA6B15A3A07D939D9B5 PEDRO GABRIEL
438,333,573 *2C6CCECCAE7EC620E630872A92B69D8BD67DA1DB per1t0n1t1$
438,333,574 *2C6D51AE2113F5230A3DC62C7BD0B15F32E20672 p.gf
438,333,575 *2C6D07307BB18B0D6BF33A64363279D7BD832A64 philip.wilkes
438,333,576 *2C655E250BC8F86DEF43D86507659DFB2EDD4990 RECONSDERA7ON
438,333,577 *2C6947D404DFCBBAB9C57BA49863D2EDDE29F942 REEXCHANGES
438,333,578 *2C60258CCD9E1067137ACF8D8E45CFA23B153D8B REGALÒ
438,333,579 *2C6363C98CE9BACB35F29F21E149CB60CECD9F80 REIMPORTO123
438,333,580 *2C627F62CCBB92DD5D94A4043AC34BA148E7EF90 JEFFANDDANEM
438,333,581 *2C6C4E7EA9E49F6D2384789815B4D6F78CF33745 POHLÍDAL
438,333,582 *2C6A4BBB83880463585C2DD8F825B0D985527C6B jeralddonati
438,333,583 *2C6C6FE0DA80BE8F2628327457ADEABB50A82929 JEREMIAH.CELMER
438,333,584 *2C6824E77A21A03FD598488F9737E376D7720589 [email protected]
438,333,585 *2C62EF2DA40C4C87F2FC797BC1ED653BF7AA7951 [email protected]
438,333,586 *2C640C0D9F5EACD374195F9DCDF5BD290FC084C9 jermainesheckler
438,333,587 *2C6B63183A1C43B93FB07ED3771C67FCDAAF9E7C JERNV
438,333,588 *2C6A57AD0E3191BAFDB0863782FDB2C6AEBC7625 jgjqdovq19
438,333,589 *2C687B336D553B2693355DF09765EA727992C421 RIA-DE-UM-SOLDADO
438,333,590 *2C6CB80C8C25D5E7F618DAFAC1DC4A0ECB15D3B8 JINX41
438,333,591 *2C6A7E04BFB4DCBB83A44AC35F2CCEFDEAD71C94 RICKEY.HILLING
438,333,592 *2C620A546197BCFBE047E812D56B64A4DD560AAF joesphjenne
438,333,593 *2C629CE7B32730A04416B47BFE34C95583345AE8 RIFFLERN3
438,333,594 *2C6712F5B315C7651BB5483076D8BA6BF9EF3ADD rigierongßbetzörək
438,333,595 *2C60E01188E7ECC53AD2660191DDC68DF9F9B441 RIGOBERTO.MINKEL
438,333,596 *2C66332D8F5253FDBF28555EFA424168176D4FBE 舞台である惑星エアルは未来の地球(後述の風華学園やHIMEの部分と合わせて前作舞
438,333,597 *2C69F0A06847373C5341FD66800CAD9C29CD84D0 [email protected]
438,333,598 *2C68A56257EBD6E8FEDE17E377554D886D0EE943 PS%V
438,333,599 *2C6278D544A2D4E8B9942F82C954C9FB946B8D91 jorgelangevin
438,333,600 *2C67EC83E1A20F21E2E13AC44699932ACD766A12 robbyryle
438,333,601 *2C60242B4FB67C573FC621108203679317977283 [email protected]*.uu
438,333,602 *2C6BB69DC7C582877DE9CFBB6335B8F185DA8914 Q3KV
438,333,603 *2C6B168A5D033EA9EF35F970C70928E8F5821CEC [email protected]
438,333,604 *2C6E6C35182179A9C46FF56CCAFEB83554A4F9A0 JTRH
438,333,605 *2C64DDD5DCC699470C7AB52F8F8882EDE4FFFE0E JUDE.SCHNETTLER
438,333,606 *2C6C0C5DF0F43AAC694B53AAC70C8DD02B8C8C38 roderickogzewalla
438,333,607 *2C6886E3B0DFCCC4EB69FAEF74A8127505F362E2 [email protected]
438,333,608 *2C617980A06425B86DE57308C9392A3DFF2B53C5 [email protected]
438,333,609 *2C63459A42F7E6A31926DD17C80C0914F5ADD3F9 JULESSIPHO
438,333,610 *2C67FF6EC4832784AD0923960C136A17F3A78579 q#>~.~o->-<
438,333,611 *2C6F624D25FA6E22BF32112728EB0E7CE1176611 RODRICK.STANAGE
438,333,612 *2C6F0321080A71117D866C4A1FE1C13340A13AEE JUSTIN.LAMORELLA
438,333,613 *2C6D5728E5B0CF8F79FF94B2F26D625552CA4D2F [email protected]
438,333,614 *2C6638C20F7B4DD19E62732037FF96D99E0982CF ROLLTURNING.LATHE
438,333,615 *2C64751D7E74CE384325317A99DDD797C9227A5E RONNYKUBERA
438,333,616 *2C6153545106D05E4797E0C5EE8DE15B4541CB33 RONNYNICHTER
438,333,617 *2C6FD6817A9DE58CDD3714C01CA43B2D44761ED0 (0-0)-`(==3
438,333,618 *2C67E199DDF6D970D50BC170AAD77128B662F849 (0-0).~D=====B
438,333,619 *2C6199BD33B10969919820A4E1AFBDAD0B607B63 ROPEJAKAKE77
438,333,620 *2C652C333D3306606C488F5F62945C6238783FC3 01-25-1624
438,333,621 *2C68673D6A854F79A0AB1F5C135EDC3408AD689C 042tristian
438,333,622 *2C61BA8FBD9F5E5F37323C1E5602F143351BCB68 KAROUZOS9
438,333,623 *2C6C994FBA8DFE0F048A3E696762E9342A3ACF38 RTISATIING
438,333,624 *2C69C20A7655AF449CF341FAB7839A5511F7E710 10.kohjut
438,333,625 *2C6A37245980498076A418D2CCE844B8C963983A 10may1655
438,333,626 *2C60FE24779B9F13A94193FE004A58C126B94C7C 1144585 classbsharesclosedatc$10.875,unchanged.
438,333,627 *2C69EF537E276183C70DF70B8400DD09517E9350 RUSTY-OLD-STEAMPIPES
438,333,628 *2C65F895AE72003E51A77F20949375D060839F5D KELVIN.ALAMPI
438,333,629 *2C65A5F4F170275C0DA30FA9D1791C6FB7422B62 kenilalio
438,333,630 *2C61EE699E76FC1C4C6824EC30AD9732FE2C795E KEN.KUNISHIGE
438,333,631 *2C6DD7173C6FC799B8CB302934311F4EAFFB9924 REARRANGES
438,333,632 *2C6E990CA02278FB8B63C3E6E8D2BA37E89DDA74 SALLY COME TO STAY
438,333,633 *2C6020E052058301FD16AE83EFEBE5D149BDFCFE Recourberaient
438,333,634 *2C65B35BE08A34889E577332C94A0ED53E74D922 KEVINSELGRADE
438,333,635 *2C6B1A6D608373AA7E5101007BC31366A19E4715 SAMBOGUS
438,333,636 *2C61ADE0F8D7BC7C05B153E113D86789FECF5D59 1681932 ohjelmiston ainutlaatuiset st-aallon sek
438,333,637 *2C6789FFB69D57BF2075177B552B0EC6AFF2D4A1 16OCTOBER1982
438,333,638 *2C6F4E14A7761804C0EB3CF1CE34187E740BAEB1 schauflee
438,333,639 *2C68ACE2D59C527F66F80F5BBFBFB8334A48E733 173908 they.also.aren't.encumbered.by.likud's.ideology..
438,333,640 *2C60397ABEA8D513F115239F8DCBBB731578AD84 17TEKOOHJEET
438,333,641 *2C6F2F4824DF6260C0C33CD9234192AE5C46CCB0 kimsarault
438,333,642 *2C6C8D3D43AB1F16D6575A925B7A0939DFB7664C schlacht_bei_wjasma
438,333,643 *2C64C443BC2C29885F93118A8E5292996B5C7115 KING.CASSELLO
438,333,644 *2C666DCCF6D8D8708FC7EF18BBBBC675F4349B02 kiokukan1
438,333,645 *2C672C9BD67CA837E2A01D903498B162902F51F7 SCOTTMASSING
438,333,646 *2C64CE42F7B57F7432090FE25DBD45D5ACD3E49A scottycozier
438,333,647 *2C6B10A017D2500E9401C2952CC279E0FA0E33EF kkkwvsfk91
438,333,648 *2C6F3F3086C81D534C586071FF26931AC5D6C8C7 SCREENCERTAINLY
438,333,649 *2C6BE3870CFBAE59FA23663EDF686E0624788997 KNI'
438,333,650 *2C672E20345ECED284905AF5062ABED4BF835B18 SEGRETARIED
438,333,651 *2C6B6F9AB9F251A90D1EBDD593DB5D6D7172D453 RFD'
438,333,652 *2C6C699CBC5245AC5BF50AAA36DC38F83741E6C3 KONGZHUOLENG
438,333,653 *2C6CFE5661537C45BD7B5166D41374C460FAA7AD 1BONSAIKAMEL
438,333,654 *2C668C8A463DDB77DCD8149A47EE96E656C55FBD [email protected]
438,333,655 *2C6AC77E0119FB08F471C3EA543D53CD8458ED27 KOSTA214
438,333,656 *2C6B04D15BE0837E205BE63EAE5545A8BE491016 rhesus-n:-rhesuses
438,333,657 *2C6A5AD034DB467E05CA3887B67F9F6BFE4EC1B0 KRAUTERNING
438,333,658 *2C6018BD3C5F3F10DD4FEE01A89E1A01F371E95B „kreuzbahn“
438,333,659 *2C6929D7F0F68E5CD202398818DE3BCEEC16D5D9 RICHARD.HEIR
438,333,660 *2C6452B694CDE481C1693962911D5811953F0B67 kristinelao
438,333,661 *2C6CE0C8FAF8AA72E90AE65DBF48BC5603A937A3 KRISTOPHER.RAGAIN
438,333,662 *2C6208DF83E2DB414D6B62CA4C45F227E807E0F2 SFFRGNN1
438,333,663 *2C68C7C27B5FBA2BE191905265708828E6BF5018 1HENKIFENNIASTA
438,333,664 *2C6158550E09FECA19AC9D1774C7D1F0A206521E SGNIVEWZ
438,333,665 *2C6BF7C34CF5C19CD804220183A4C55879F3A1FD [email protected]
438,333,666 *2C6812DD15D6E8423BDDC99155DE28DC154625D6 shadow1garnet
438,333,667 *2C6A9A79944E0B25343AF1F63D45EDEDC3A0FF89 shannon.blea
438,333,668 *2C6963992BF8E4B098F493ED22A30709358FE44F rickky:casper
438,333,669 *2C609F2E52BA9928B6D236F733A2A6A825C862B5 [email protected]
438,333,670 *2C6103592DC838D837699DC5EC09989E80CBF0E7 1-ILMAISINTYYPEISS
438,333,671 *2C6FB082FD5E27167DF21770485B54A38E722BDA kutta-katta
438,333,672 *2C6A6DEA837CA7B9CE653C432A6AF5FBD7B43BF1 shaynecookus
438,333,673 *2C6B9518ADA4E34DEF1EF347EFA8C3580CC8BFD9 1 kiertom
438,333,674 *2C6CAD14D2C4EDC2188508CDC6090E02A2D7AD6D SHIRLEY.PAYENDA
438,333,675 *2C68822F36C7374F88B2E3378B3C48F6C1194BBD SHITP
438,333,676 *2C69021282A8D72ADF8F94943A7754D8D4354674 1liikuntaasioiden
438,333,677 *2C6952407AE377DA6980798F137CF52E61003753 RMORGENS1
438,333,678 *2C63D6652B802E7C89BCFA72555AFC1EC18FEFE2 RNACYTOSINE5METHYLT
438,333,679 *2C6CE7D80799B5538F38DD218BEFAD433E004080 robbiana8
438,333,680 *2C664B207F29F7908F423D7E117D57DB4D27AF32 shr8
438,333,681 *2C62A9A7438DDE4DB9D3A085ADFB2F3C53971CF6 ŁANANY
438,333,682 *2C67CF0E75E9CF2CA6A98533F8D9F1C83A206597 [email protected]
438,333,683 *2C61A46CFDA5035C848A30730423E7753F9E1743 SICKENSES0
438,333,684 *2C6DD27F775EEE628364D939D7211CE7C24E535E sieikusu4
438,333,685 *2C6DC0E68ADB2863BA3F83079C84547215A3D414 LARIN JOHNSON
438,333,686 *2C6A2EE0CC12EB855E2847CFC294CCBF6944DF84 RODOLFOLEM
438,333,687 *2C66725F571530B6FC4A3F89BBEA08516118C81A 1-sazImdan
438,333,688 *2C6F995A8B5F8336A25B39722D8C6ACBE60279A6 RODRIGOSEEVERS
438,333,689 *2C604F7B743BA52C55BF111A87A698469505E296 LARRY.SZEWC
438,333,690 *2C6D400C8C5ED6FF77D15FFDCA4BCD1810CF0C26 1 SKINNEDUP
438,333,691 *2C6BA36A79AD6B10DCEC9AEAACE311F992BC04BD ROLLAND.NIANG
438,333,692 *2C6CAE364857958FCF22063F2967BBA21DC79CB2 LAURACARRION
438,333,693 *2C621B322FC6AFAB544FEBFC78CFDE999B9A0F17 1TCHAVDAR
438,333,694 *2C6E8AF0900FDA6EDDCEE82EE6B54171096D65A2 1.trickier-to-translate
438,333,695 *2C6FB4E987EBDF9E3949EA0DBABE32CCFF3CADF8 1 VERBTE
438,333,696 *2C66C590E6E7070C2E5B48ED84C93171FB84BEC3 RONNIE.CAPPELLO
438,333,697 *2C6F9B72FDCE5D4380FD3CE528B67375CF1897B2 RONNYTSUTSUMI
438,333,698 *2C66F9AE44A33A434151E032A89756FB92F62DB3 ROTOMLES5
438,333,699 *2C62BE31DAF51B6C6B276DEB38210A070D3EEC95 ROYALFERONE
438,333,700 *2C63B833607101E7A0567549A495A2AF147F2DE8 roybeaver
438,333,701 *2C665E2FCE2D78E86540F8900D1BC7D2FE8DE2A3 [email protected]
438,333,702 *2C6F4BC10F79562360EE1C36838DCBF79F66B9EB LBBXXFT27
438,333,703 *2C6A8E45900FC92460264E29C19E66D3C5191440 leandrososnowski
438,333,704 *2C604CCA15C92E132AAC831321F3F1DE16DCAB84 2108665 NUORTEN-MATKALLE-VOIVAT-HAKEA-15-17--VUOTIAAT-.
438,333,705 *2C6942053C0C566757D4271C2ADB5D1EE3563E14 LEASSAEL7
438,333,706 *2C69C405BE5EEEDE625FC3F69B37776A14DF269A [email protected]
438,333,707 *2C64CE0D22EA5B233E8143B0D56E8863BC159711 LEGOANIMAATIO
438,333,708 *2C67BD78653D7243504859A012E827666C30AC4B 226NATHALIE
438,333,709 *2C692279239B20D9B391C58C6FCB59D925B431D2 [email protected]
438,333,710 *2C605848B65A4AFB4941C1DD368E6477A75B0388 2281742 lis
438,333,711 *2C6028AA12443ACF99F7BE20AD8B9F55EEF3832B SNOPPYYYSO
438,333,712 *2C630EDA8E9AA22B3531AE2B795AB9DEB111AB8E 2326094 HE-SAID-90-PERCENT-OF-BUSINESSES-WERE-NOT-OPERATING-.
438,333,713 *2C6D4C18DBEA03E655AC4FB6B005C76546BDFA11 LEIFLEBARGE
438,333,714 *2C6D3905DE434B53BA2F32CB09ABA87183FC76F8 RUSSELMICHNIAK
438,333,715 *2C682E222D39E308E8669AFD72DF957B4B5D98E9 2477120 yksitt
438,333,716 *2C631F277C41B097D8DF45E2E43D957B1D45C327 LENARDCATTANEO
438,333,717 *2C6B78219C11C5950D73E9A44CA36D74434F63FA RYBREEKS4
438,333,718 *2C61301418D0EDC53D0DEC6A5731FF8A5287E7E5 RYLIE782
438,333,719 *2C696C98239DEF42B484AB42AB5870CDEB0DA570 sonatano1forcelloandpianoincminor,op32:iallegro
438,333,720 *2C6D0D9222A62A983FCAD600400923B1BAF694D4 LEOPOLDO.LOMBERA
438,333,721 *2C656E22B63706EE9C059D0E711132514A67855E [email protected]
438,333,722 *2C648410D874C2563277C44B1743860F3889B9F0 2768763 nobody-worried-about-making-a-killing-
438,333,723 *2C6ACAF8A0F20FC52FC53EA3F9122C961200997F s93051
438,333,724 *2C6C0A1C150AF01C4F03B273B7D25BC7A964C190 SOUHILAH
438,333,725 *2C6B9DA8349A7F2112782561D46E92815981FFF0 SAGACIS9
438,333,726 *2C6787A17DF6682E9BB2595ED06C4E9A2F05A9F8 28FEB1740
438,333,727 *2C633395D0EDB0A44B4163D33875F14B16740BA7 samba de orfeu (feat bud shanks & joe pass)
438,333,728 *2C66ADC1A97D8151FF7394FC0CCECC7A608F7FE0 [email protected]
438,333,729 *2C67F8CC18FAA6B6A4BC4A9822E329D5A87213B7 samuelcleaner
438,333,730 *2C66676C3F153DB7E96BAB3E8303A2A8719A5900 2GERPRINT
438,333,731 *2C64750CE1C70A966CBB12D9D930F1CAB4B3E2B0 splat O~ q##B
438,333,732 *2C6838929A5B924229181C2F1E526ADBBC88111C splat.~`q---8
438,333,733 *2C6EBFFAEF2556841EB38614EB9627D9C95B5CF2 SARMENTICIONESS5
438,333,734 *2C610D58C3FE64DD007FEBBE0B2612691A80D5EC SASHABALLSED
438,333,735 *2C649C85E97B2BD8AEF197BE1036191F6BFC5A4D SPOETTELNDE4
438,333,736 *2C625A091377D99AE8C8A0D5F9AC72EFB81A0CFD sporendragende4
438,333,737 *2C62DE2671121EDBCD28F17ACCD013340A340B3E lincoln759
438,333,738 *2C602C8D6E90561F6CD857F5930BDE887E677363 SSENSUONIDUTITLUM2
438,333,739 *2C6E949982FB76CB12D6B768891597E8314B8053 SSYRYYK1
438,333,740 *2C6A2DCC94DFD74350BD75DAC141981C8E6E9403 3####>.~0.)o(
438,333,741 *2C6707B316D9561CC451EBB5D09D2B65EB201DE5 STANLEYELLEN0
438,333,742 *2C64D2FB6032AEA5D1B7832DC797467CC1026F11 STANLEYKERZMAN
438,333,743 *2C615495D7B7304889B2A66A942069943198A05A 3ARODUEH
438,333,744 *2C6817A77A8251CFCAAF2FFE9F11A9AAE01AD07D SCUFFED
438,333,745 *2C65DA57831D508AD3F50152BE0E3E0EF09958E7 [email protected]
438,333,746 *2C6B8EEF38BCFE5989D6A5A1A8A0F91BF25E18D6 STATIONNAMIOKA
438,333,747 *2C6CBEF5D038AD8202F8D1C594F582736E15D8AB STATUSOPGREL3
438,333,748 *2C61024B426F072A67D5CAAA627A45837BA83316 [email protected]
438,333,749 *2C6D96CBA1E5F9F281199E684CCE4703B8572C67 STEINHÖRNER
438,333,750 *2C62E1CA8B8190101BAF6616D6F3DE4B27EAC6D7 SEBASTIAN TROY
438,333,751 *2C6CFE6FC69924DFB932C4884A4E1962F423C356 3NORTHOME
438,333,752 *2C6B5583B0B46A1AF55D64F45CFB43D318D82B3F SEEHEARREAD
438,333,753 *2C6E85AE5FD0CA01C6ECF366D0F808B601E9E2AC STEVEALMAAS
438,333,754 *2C6FF843F478BDDC9FB0F591D2C54B9D068C89E3 steviehempel
438,333,755 *2C62ED851C539B5E6643ECA8E6649E84450B45CA stewartcheak
438,333,756 *2C6733D92488124E971B828532E2091DB3426AA9 louieverducci
438,333,757 *2C62494D04E6A4BFE229EEABDFE198E0D9D0B2F7 SELLOVTS5
438,333,758 *2C6394C1C0917C55A463A543DEDFA3574969F372 sting1jeanette
438,333,759 *2C68E25526EB1FF2CB62F73E49B3674D0C6F7F07 STOKSENA2
438,333,760 *2C6AC0EEE68E27F44FD2B169FE796A3ECC942198 STOLONS
438,333,761 *2C62B30F6C39225506ED65B0AF8D55960C007D9A LOWAH
438,333,762 *2C61643A96BB3D00AF6B57D93D45DCD96D84689C STSEDNRA
438,333,763 *2C67E4B414A9993C8234F1A0425ED2AFDFAF9268 SUALEGA6
438,333,764 *2C6945A1F74A7750D1F688F2C66448DF1E835A5A SETSYSTEMS
438,333,765 *2C624740070159828EA1B90E53B1867023908629 LUFTARËVE
438,333,766 *2C68734341E24E80A91491F84ACB824396014675 SUFURGNIKIV
438,333,767 *2C6A3E7320C60D5B47BA3E36D265CF2A5735A38C [email protected]
438,333,768 *2C698B6390C0018448F8801FAE518673444C8A38 SHAHARACLARK
438,333,769 *2C6724622DD033B5BCF215F8D93B836347B62ED8 LY?L
438,333,770 *2C6D3345D8B853BCB553BD0F580E9841B84C41C5 [email protected]
438,333,771 *2C642CD0B75761888741B5B0E04298AAA40C7BDD 4-ERHOLZEITEN
438,333,772 *2C6C0A688882118F7C2A633EED4CD544F334C53C 4GAMINERI
438,333,773 *2C6932376F0938E5E392EAB3EB748E53E3B6B034 supportelwood
438,333,774 *2C6EEB5C7828C6476EBDD96B92A37FB12B8C54EA 4kunniamerkkin
438,333,775 *2C6B21A3EFC3A79AFF3BD9A9151622C993B98BE7 M102752
438,333,776 *2C698788007F6C6DA6C62DDE541754A7900FC6D3 M3DU110S3
438,333,777 *2C69AC4DCF7A752FE2E64318C6683CAFE3ADB579 M3N5TRUAT!ON5
438,333,778 *2C62AD35E296D677BB7207E223B466E3FC3F1C04 [email protected]
438,333,779 *2C66140C80B2547CB84D3CC8C6F6AEB0BACAF158 M7502033
438,333,780 *2C679F5C8BD97F8177C3F3D73BAE12607CDF8AF0 [email protected]
438,333,781 *2C628E019D6AA6748F648F5E61B5BA51EDFF29A0 SHINE.LIKE.A.STAR.IN.THE.MORNING
438,333,782 *2C627162EFF90521F036545F4833E7590433671C magny-la-campagne
438,333,783 *2C61EEC39BA9259CC79CAD15E3A0A8D187C66BF3 sibiliate7
438,333,784 *2C6A6A567AFF3E1E663E9A178C9043D7F89334F3 [email protected]#$%^&*()
438,333,785 *2C6AB1F4942C204F011E705A760D5709AF8CA09A [email protected]
438,333,786 *2C6B6437867F3FD1BD979102678A2E3A888984A7 557612 HINTA.SIS
438,333,787 *2C656463D20184358A8AEA3FD7F9AA34F9D73D8F simazhao
438,333,788 *2C6B164C338123207AAD5D9DC94699A82596EB90 581014 jotenkinsuurkaupunginvilin
438,333,789 *2C613B68909EA8BFA24B8010ECADCDF59C66D1C4 MANTRA70
438,333,790 *2C646B8EEB2C84FF4B07EB46B72BE4EA80B12908 sixcells
438,333,791 *2C619BA5163922957558839DDE9E3E2DDB6D22EA 5BBELLOVIN
438,333,792 *2C695871ACDF00035E8184E46C9D40868CB6FC91 TALKDCPOLLACK
438,333,793 *2C66636F63DA172F3E9D697D8320873D62777B3A MARGARITOLUPERCIO
438,333,794 *2C65B1B811B6F801C9AB9CB1DA782380C2BAF98E SLĂTIOARA21
438,333,795 *2C62CA527FD3629F2B9F4DEF9F5413D495E0BCF8 [email protected]
438,333,796 *2C6B23CA0E1B811DF057F2B9BEE99E689550DFF0 5FORDRVELSES
438,333,797 *2C6F13CC6889D0BAA262FC1DE2E2D52F21E46FC4 5INTELRUBY
438,333,798 *2C6DC2B5CBEC2DAD99569B38EDBE559E94495BE9 tarparesed
438,333,799 *2C68740FF7F7FDFC42C01A05ADC009AEE91382DD TEAMOSAULAYALA
438,333,800 *2C6D1628048A298AF15A0BEA0FA8307BB9074E37 SOCCER1MIRANDA
438,333,801 *2C6409F59357266757C9BC24F445D0DC514DE63A TEKARMUR
438,333,802 *2C69BA1556CFFE6B7CB8197EC907DAFB7D715291 sollutao
438,333,803 *2C693730107BAB4549FCDC29EC4C44B588B094CD MATHIEU-BREAU
438,333,804 *2C6FD19EDFE16A2DD0937EE379E7B45970D03577 MATHPSY
438,333,805 *2C60D2C9F2FEFBD621BC7B68BC8E28EAB9FF56B1 MATTHEWSTOCKEL
438,333,806 *2C6977AB3C66981EE98970419B3B01F63BB4BAA3 MATTJULISA
438,333,807 *2C6BD19093F56E9FA6B5C3E4CC0E04E5186A1A21 5thebogus0
438,333,808 *2C625B380EDCB75AF6E23BAAF879CB57FD7ACDC4 [email protected]
438,333,809 *2C6E9DF1A4777E8C8266B084B8971BD76F065025 TETRAPARESIS6
438,333,810 *2C6F62C8EF3A6940F4C83FBDD7E3D64D2EBC2C5B SONNYNOTHING4
438,333,811 *2C6D6D107F35CDE456DBAEAE52636628D6104ABC 5UNLUXURI
438,333,812 *2C68A436B8CD6DC546315FF26AE6DAF6CD4DFA78 MAYNARD.LAFRATTA
438,333,813 *2C6D12AEBEE48C5F06CA3448FD4D60659FED4492 [email protected]
438,333,814 *2C640F3952132D0B4B8720EC981398767C7BE58D SOUSSOLS8
438,333,815 *2C6025178B68CC642601C239653CB1F9F03A8E24 628DOMINIK
438,333,816 *2C6BC3DBDD3BA0C502876136DA8DBD4B3560C9D3 [email protected]
438,333,817 *2C6F7E765D65ABED7B0DFFEBDBFDAC2844E2B669 6AUG1512
438,333,818 *2C619C85C38EFEFE8A35F20C1CF469EFCD767BC7 6BSWAMERICATHONBS
438,333,819 *2C670919A4109F51A532A2075249F1E4246FD596 Splat!!~-(######B
438,333,820 *2C697E6E6496FC6A574F227E557E423A2D78A64D splato~ 0~d##3
438,333,821 *2C67512D0DD6F15DF22772E4CB3EAC5FABC77492 splntrzed
438,333,822 *2C672CDC9631954F5AF00B82709742D37CBD9E6D 6ELLIGSTE
438,333,823 *2C608546CC56D2FC42FFA45C31278E2781F60BDC sprngbtl
438,333,824 *2C602A6AA7E979127E279B96DC4392841075350B 6IFURUNG
438,333,825 *2C64D56846A2D35F7B237B591B44ACBDAAC1695D MFBIS
438,333,826 *2C6F4F1C1AE1F859D41B36FAA82CF61C0977B31E [email protected]#
438,333,827 *2C6506F73B0E09D8649FDBB5AEEF61CB9D6572F3 THEODORE.CUSATIS
438,333,828 *2C6865E66446863D77878650D0EF80B25DE7C561 6KYLYHTEISLL
438,333,829 *2C6FD3417B0552BDDF8C5564BB24690E6F425E31 SSUKI
438,333,830 *2C6027D409D8E1DF708D97BCDB48D56C4A44CF4D The.Pharaoh's.Grave
438,333,831 *2C629E7E8BC6FB1B5208274A4724DE9C94B36B6B stacywethje
438,333,832 *2C67A13A03337D538EB4A61A4BC9FEC520583F75 MICHAELZ21
438,333,833 *2C68020292ABBAB1CBAE1563C6ABEDA4C47A541E MICHALMASICLAT
438,333,834 *2C65DF4F856254689D220688789E88DE2AC1C4EA 6PLAVIDLO
438,333,835 *2C69F8D6812224C6B71D3F41D08D6963129907A6 STAVEMÅDER
438,333,836 *2C63FA0D67897EED385853257874E945C63457AF 6REGULAMENTARES
438,333,837 *2C6455772CF46E9045C651EF3980E0F7C6B1A574 THESESINSARELONGFORGOTTEN
438,333,838 *2C6E378B1909A484CEADAD4CBAED06D6D62D2BFA STEPHANMCGEHEE
438,333,839 *2C6D35E3B9973707D3B0F999AF0187CA0A8E2FED stephanrossell
438,333,840 *2C64AA0FCA90D467208CFA692C797D3CF3946D4E MIDOBUSTSLOOSE
438,333,841 *2C62305EACBD20EECDFFB45ACC66F65FFB4C8E00 THẾ.TÌNH
438,333,842 *2C67CA94561411A34199168AF845F2D7326D2014 6SELVANGIVELSESBLANKETTERNE
438,333,843 *2C6F27F422F2DF7A169C289D48A5084E2D7D4EF8 MIKE.MONTESANO
438,333,844 *2C6F3250CBFF8C8237EBEA6E693581C3C3B232B2 STEVIE.UNTERBURGER
438,333,845 *2C6D077AF6A214B6770E0DC549764BB3CDDFB70E 6SSENIMOH
438,333,846 *2C641DF824AB8B0E8DFD2C848370A5F2DE1C6B2D MILES.MAHANY
438,333,847 *2C66CE7ABC60907AC8B849622D39F5F66C263701 thq^
438,333,848 *2C6853E5A765403437368682288215595148B8FE [email protected]$7
438,333,849 *2C6F13C3EC706616795CC73543EDD983505ECF13 MINKHIN
438,333,850 *2C69A5539709F11E5A10BD3E1EA3FC3339BD6000 STRAWINTHENOSE
438,333,851 *2C6F104ADDADA6BD14859C6D33BD1AED9FA09B96 MIQUEL.TRAUM
438,333,852 *2C6E579950C87F30CD31B0381A2D2D4A9ACC1259 TIFFANYSTOLL
438,333,853 *2C6E685E551673F60EA646A5D11CC4E02CE6D902 tightend12
438,333,854 *2C63F6258302BD6BC430419480591B955A09AA14 794846 takaisinarkistoonseuraavanp
438,333,855 *2C6D057785B7128C0B47817348982287730A8769 tinkerpreacher
438,333,856 *2C687A05C64E02B9F8CAF6C931775C6A18C26CB8 SUCCESSPEACE1
438,333,857 *2C61265AD0B2D8F34EA2115989A24D7E86D612D0 SUDHIRPARMAR
438,333,858 *2C6470E42354FC39CF2CE204250CAE58AEBD55A9 7AFACENES
438,333,859 *2C6EF80A060DB6D0CB5761767310BC0717F2844B mogadoncoffeemorning
438,333,860 *2C613268C54B8C1B249C3DB69629C5ECD42D05C4 7CONSOLIDADAS
438,333,861 *2C63E6BBF1851CF16924C745301D2FBD47F03E96 7DOHODNUTO
438,333,862 *2C69230AA2BA5AF2060F24D78BE80A450763B24B 7esittelyvuorossa
438,333,863 *2C616BF8ADDCE11BCC724A1F92C4639E68C4903D TNADNUBARETSEMIRT
438,333,864 *2C60AF370B8878445D2518DCB82E7F72392DD877 [email protected]
438,333,865 *2C631D3CDFC58F5AB5E69C9927C494A56A5FE3E7 SUNGMUEHLBACH
438,333,866 *2C6D58D6EDC4DF071361E2B33E0CD9A8F8C458C8 7HANNAROCKET
438,333,867 *2C6AF1C603B39658E74133D45EF6B825A43C72DB todfagala
438,333,868 *2C6F06DE13D81E8C9020E5A052D7B0B57893B5DC [email protected]
438,333,869 *2C625780A838294C3FA9137853A5370F06D96361 7ISUTTUNA
438,333,870 *2C6F98C878EBBFEA65D844DE95318DB616D0EB90 tom.bliss
438,333,871 *2C6DFDEEECFD77D86698966CBA02D1180CDC08DD tommylootens
438,333,872 *2C666622B79C0F065D7C155384D5B498E38F9D8A TOM.TIERNAN
438,333,873 *2C6289236B2E4587EA78353C9BBB4D5616AB51C3 7ODBCBSW
438,333,874 *2C6C46844615DB104DD75894176FA537A89539DE molybdenum-deficient
438,333,875 *2C682B7B1BC876EDC3FBDE56D4368EA1FA5A8B76 TONGYAN5
438,333,876 *2C6A21593EF422EFEF40BD500ED735C76FD6D718 7PEHLDNOUT
438,333,877 *2C60E863FB26EF6EC89A3C2C0D2BCA43AA7F3EC3 TORNTJES7
438,333,878 *2C62A6EE13181C66593819E286260A31F57B092A TR49!C0MED!ES
438,333,879 *2C695D5A709E623E0C82894F7B1A0AF9F415C5F7 TraceItBack(BenLongremix)
438,333,880 *2C62149C8C75E5C00AF85159A4234D6FE7117C08 tracybohnenkamp
438,333,881 *2C6E0794B8D868BBDA9EC4E1C232913823D1DA20 Symphony No.3 2nd Mov.(Part 1):Allegro moderatoPresto
438,333,882 *2C64EC80F7512C8CBD79E247F7C54AD002439585 7SKEDEHORNEDE
438,333,883 *2C6C21A7EF2464586E8104D04F8D517A5ED76C54 7TITLEISTBSW
438,333,884 *2C6EB1ED2956B026BAEF98D6E1CED7863195B5B7 7WFVZIOIJK
438,333,885 *2C6A3B0EBA4EEDE0DFAC426572BE7FD927D5D7CA TRAVIS.AMSBAUGH
438,333,886 *2C69054407C0A3FB5E25033684C373CF7A549A42 7.ZANOTTI
438,333,887 *2C63AC0AB54222DDF377A535F59F745DBA0C1387 T0W3RI3ST
438,333,888 *2C6934DBCE6780D4C2E13AC19DC32436D3BAC9ED 83C4LMIN9
438,333,889 *2C627744B1E6E1FA8671251D56BD5EFE7711D377 TRICHOSPPING
438,333,890 *2C62D45CC8AAB7C9F67E3487E85E120BE72A3426 8ACHTERAFSTRAATJES
438,333,891 *2C6E9701AA35F28766BE8145F93D6F657784B29D TROY LONG SR
438,333,892 *2C646A440929A9BA606FDE85981A0E8880E1B288 8BENARRIVATE
438,333,893 *2C605464D9C042E8A0D71C140577C95399598AE6 TRYSTAN DRAPER
438,333,894 *2C65C3C98D16C7502E4866A0FCD65B3E1190C26C 8======B~OUU
438,333,895 *2C6698AC0A0AD4304A4371CA85B0DCAEB2E1EE81 8BSWTARJOTTAVIABS
438,333,896 *2C6E39A98050483DCE37481C49AD691C0C21F9D8 tamia696
438,333,897 *2C6B369D376FEFC2277F4142F511E811B572691A TSIMBOURIS
438,333,898 *2C611779E7BD446B3357DDDC1A35E53905F82FDA 8clericality
438,333,899 *2C6E856918B7EFEE330916FA0F988FCD7FE459E4 8CONTRIBUIRESTI
438,333,900 *2C6CB26115DB55C1F7534CA4DF9DFFE4E98375D2 [email protected]
438,333,901 *2C685EA086D470D915215A0C5664D27F35233160 TANNER.BASARA
438,333,902 *2C607A6B47B1AE37CE2D611EF67777977C90064E MYNNETTV5
438,333,903 *2C69F4B1834C18CEE13DB0E224C43F94454A2609 TARRILUP-BRIDGE
438,333,904 *2C6CEE4CD2DC1474AD693B88332C63BBE96B3B89 MYSPROCKET83
438,333,905 *2C63DD4DAB82CAEB6BEF516AC71AB9CE35E0395D mywaterloo5
438,333,906 *2C67C0F1B6840716E5248FB4228916F2E1E5CB83 [email protected]
438,333,907 *2C6C47E3AD2FAB0DD0DE7621AA236EFD0B0EA068 nagasya
438,333,908 *2C64FE6E2DBB3DA011FB38CBA2F2845A67601994 namas1va
438,333,909 *2C6EAC38F3DF4D3CF8C209FA94B9D40D816AA35D TWINSALISON4
438,333,910 *2C6C0BC084DA57C15B7E7A2E08AE264338B8BBCE NAPOLUSMCCAINHEALTH
438,333,911 *2C69829A9A075891F8E50F9D1FD35A1A8042F60C T-BONELEON
438,333,912 *2C6F13928DAFE7B1FFA53823E7DD25C4223C4625 [email protected]
438,333,913 *2C6003C5ACE6330A51AFA468809577FD82BC1D89 8NEGILEOC
438,333,914 *2C6DD647BACB3C112C83CCC66DB7263D8A75CE56 8NICARAOMITCHELL
438,333,915 *2C62C6F8E5090A0891A18EF155CA6C92334730C8 8=P~.~.(0_<)
438,333,916 *2C62D65601E37BA8EAF13C6031C5F42352D7D3B2 tyron.rogers
438,333,917 *2C672771532C4847C5D0FD7600DE586F7FC68798 nathanialsexson
438,333,918 *2C66D29A0393D82DA0CF31F0C9D5486E7B5F8350 8SEERTUEFLAC
438,333,919 *2C607BFCE7CDFFB9A0296A82B2F1AC8592ACEEB3 tzekungn8
438,333,920 *2C69731BD33B69DAC3E1F134CDBFEDB4971FB7FE UFARSTEIGAN6
438,333,921 *2C6BC3F3D1A92D87E47E6FBDFB284887F6A84DF1 922CLARISSA
438,333,922 *2C62006162F4338F22D38E7B23D7767979ED849A 946060 doktora-tezleri-ekmekyapar-,-f-.-,-2000-.
438,333,923 *2C6AED3DAE0845658C3DF365C83CF18F66113352 neilguerrini
438,333,924 *2C68E5A6216061A490DFDDC069F52D5394FF581F nelson.zamudio
438,333,925 *2C6F0736437B1E685C7F8C2E56D129D5EB487B1E NERVE SHEATH
438,333,926 *2C6C1B21763D5F2D2BC10D85AFAED9D56AEEF8F0 NETSROOV2
438,333,927 *2C63247BABF4CEDA3DF3BD03A055C576F90B51A1 umirili
438,333,928 *2C63142989DB42EF185582CE73B2A9FB1C7160B7 UNACCEPTANCES7
438,333,929 *2C62095BCE4CA57E7E2044B42B349DCBB7E6D01C UNAPPARENTS2
438,333,930 *2C60D386F7E13D373C03BB1B92ADA16127725B5A [email protected]$honed
438,333,931 *2C635CD5761C747723411D68CB90DB31FE084140 NHNNBSW4
438,333,932 *2C6766E02C55FB9B25D4C31A8BE856F47C01FD2A THEFOURFRESHMAN
438,333,933 *2C69CECB7FA1BB1A81BE6FD50A9CEACAE26D831E NN201
438,333,934 *2C620C51440C81B3EBB9B4B27DFD4616755AAE39 The.Sin.Before
438,333,935 *2C6AFAFE6A06AD6ED427B399F9E821332FE1D8AE 9LGHTNSSS
438,333,936 *2C6A4980FEF17FBF5D95F470F4851F14849195D3 The.Three.Bells
438,333,937 *2C6BF9B5040B5F3FF8BC33D27C3CB2D8D7A9388E NOE.EAKS
438,333,938 *2C6FE66C883EEFEB3B5E766F5F2CABFC75708216 NOGALERO
438,333,939 *2C6B53F6B8EC08FFCBF3143B3E6B4B595C86D476 $UP3R3RO9AT!ON
438,333,940 *2C6DC069B0045A8FACAA31FB505B05B8CE2FA7BC [email protected]
438,333,941 *2C646A32B1AAF707FB9101CEECE298A74C09AB91 nonstatutorily
438,333,942 *2C653EB884D67C5D5EC341DA26D8E680CEA2FEF7 9NEWUSERTUESDAY
438,333,943 *2C696E00D0EFCBE263FC601F61318E915EDFCA6E 9PODILET
438,333,944 *2C6E8131327A472D53103CD53E205A8DA6EC3AB2 nortal
438,333,945 *2C6F68853C6649E52A848D53BC43C15ECA369A82 TIMESPUNKIED
438,333,946 *2C678671EFA0A69352AF854ABF27B18AB22107D5 time.x,.volume.4
438,333,947 *2C6C33D45C8B54B0EFD0B8FB4A2B4FD1E29E2A66 timothytandetzke
438,333,948 *2C6271B2018F69AAAD8415F92CB6A418CA577338 tim-zawislak
438,333,949 *2C600F73B0151E87E16FB92AB2059DCA46C503C0 9REDKIDS
438,333,950 *2C6EF65E093254B37BEB730C334D593F5B3AC19F NUDIES
438,333,951 *2C6D203B5C672A4716B8B66B1EDC754C3522D132 UTAFNINING
438,333,952 *2C64E5A0B74D65A2485AABFA9F7A9177A1F98943 UTESIAN0
438,333,953 *2C6B320C56EE7148E383ED857448C741E92B442B NXFXIQHGPCEC
438,333,954 *2C635A30340F490B8ADE0C169CD9EB754BB5639D OBRADUJU7
438,333,955 *2C6A8FCA917A13B278039953FADB21A4C2BDDDFA ?-ociR-,tius-rewop
438,333,956 *2C6965494DE71980957EB0CDADD9F6DD55665A02 TONEYHUERTO
438,333,957 *2C66640E673D4A39EC66D516C07277F98832CC4F tonia-griffiths
438,333,958 *2C6F124AE8A2D4466137332D36545C58CE1549FC TOOSTERN
438,333,959 *2C61FB12B813DBF124806DEF2B169F78FA8F3627 TOWARDYOU
438,333,960 *2C609B6AD7A0A14E94BBB37D0E7C0E36213ECB91 OMAR.POWELSON
438,333,961 *2C6B67EC5530DA14BD4A4B8B84307F6C0E652EF6 TRASHELLHAYES
438,333,962 *2C6D1208BF4D3A4A1FD9A274BFA98957C56EC001 V"2!
438,333,963 *2C62C0F3903E63EB6F50C6C3AAC69428D156951B onaroll(kwela)(feat.theblohardz)
438,333,964 *2C6BE70602DA69904DE6EE3198B63DC984836297 TREVORMABBERLEY
438,333,965 *2C614BCAF1C5622ED9A0DAA5051D416896F6343E TRICHIAL8
438,333,966 *2C6EE288632EEA6047D61707FE6DE36EEC5C9E4C A0Q247
438,333,967 *2C6E18449704ABF1E5B8F9158BF1B192E0787CA5 trinh-thuy-nguyen
438,333,968 *2C64118C160B3F9B1BB5A395ED813BBB23BBE3EA TRIO-IN-F-MAJOR:-FOR-2-RECORDERS-AND-B.C.
438,333,969 *2C6B85E65452F7A553C95F67C39A545C9C1E6FA6 A3GSQ
438,333,970 *2C62D5125BED8EA0ECE95C38F2F3E44C1A97D88E a6
438,333,971 *2C6612ECB979D2A0A0FA54A2B165EAEE5187092B OSPITIATE1
438,333,972 *2C6CCA956B4B606A8F648F4430B2829C4A457575 aa=7-
438,333,973 *2C61BD89B045B8DD52C196EDAC618E5101B93465 p===>*-*-*-(>-<)
438,333,974 *2C6383CCDFF5FE40E27F1DA8F359F9568299A2EF U4438
438,333,975 *2C6FC3D603B744094DE7E896AE8EE4D94BD46C2F [email protected]
438,333,976 *2C669F0594423418FEEAE091D4392CE14EEC07B2 VAUGHNARQUERO
438,333,977 *2C6481ECA833613AB5591E949FE787509A018BA4 PANTIWOG10
438,333,978 *2C65D542501D25C7D68CE3DF725709F2B6F0A374 vaughnbussler
438,333,979 *2C651F18FB8EE74DEBFA56F9DE86893F0F748215 AAB]@Z
438,333,980 *2C663F2B8172409BF91FFB38F3E43A07C9CE2ADB [email protected]
438,333,981 *2C65E9AACFFF289EAF94E16FC481DC4FD02E267B AAD~31
438,333,982 *2C67C54AB4D9790F84C072348417A3C78310A838 VERABLACKWELL
438,333,983 *2C632E6DB4A6A4BD38519564462C6190559A7341 VERNROACHO
438,333,984 *2C643560090CC8F8A6B5A20E8C283A3A4D10AF75 PAULAPURSER
438,333,985 *2C62928054792F092850464181BE56B640E79ECE AAMHORIG3
438,333,986 *2C6E2F166250672126052871F1EFA29B0B68E08C undecreased4
438,333,987 *2C6DCFDDCF59B81EB83ADD5C3C825FBB75B085B9 pD.~.~.~.>B0
438,333,988 *2C6E43DB9DE73B67206B0C76192BAD1655AB6594 vikiviks
438,333,989 *2C63B6A8657794902B928098444EA4B451ACBA6B VINCENT DAMAHE
438,333,990 *2C638AEBDBF913E6BAF79F1E1845203A883DC0E8 USKOLLISUUDENTUNNE
438,333,991 *2C6A0A423081BA3F681D331196EE33D9570AE7B5 AB)QO
438,333,992 *2C6D105A8A3C2491909F6B9EFD460CD9CE094E3E [email protected]
438,333,993 *2C6B4DFDAEEDAC7FDF1B81810AC81797C9184B1E UZIVAJE
438,333,994 *2C6DD895EFEED5E116DC5B9DD5AE17AA3F6CA96F V3R3M83115HNG
438,333,995 *2C6D8806B5812478AB26F4FDB8CB89BE90918533 virgiliodraffin
438,333,996 *2C602AAF584EC83E8C8C72AC0980F853C1A7817A accesscatfish8
438,333,997 *2C64E4A6A3A63C4FFDA7915EC703FC3860AEED24 VAELLUSV
438,333,998 *2C6262CC78B74EC0CF31A8BF97657D7FEFC62836 [email protected]
438,333,999 *2C61516BEEB9E6C89EA1C1B1FCEB57307F68AAA2 aceqp
438,334,000 *2C644BB1A69A399187E2A58819888DFBE764C13C ACK4B
438,334,001 *2C6B754D2A37F30CA2254862110DAC7D67D44503 VAN DER WERF
438,334,002 *2C6BBDD32E929675EAA26DA167772B0CC5BDE199 adancasto
438,334,003 *2C6E1EDC523F3DE81BBC7D3A65856F1F1CB0BA71 AD_C_
438,334,004 *2C6D8C3ADE9FFE6CD09692347B771ADC2398038C VÄRMLANDSBÖNDERNA
438,334,005 *2C6A7E2FDEE42859874C1D168590C10AE1ED0B82 vautreriez
438,334,006 *2C64EBD7C24B426E31CD3D93809CFDAC6F2B2022 [email protected]
438,334,007 *2C653174F30487F1604CCAB8B8BAAB1D26206F1D [email protected]
438,334,008 *2C661CA4747FE29D1C853D12C34FC253DABBE878 VENUESCITATION
438,334,009 *2C692419B50045435E1CCADCEB01432AE3335C46 VERBASCÓSID
438,334,010 *2C68685C527811AE315B5AB1CA318B361234ACDD PP * )0(
438,334,011 *2C629E6919E043BFC5E52FE313772B2725DC361F PRADIP DANGOL
438,334,012 *2C60FFB88A58D66555F2979E76F4C7D87D6942E9 AFDQD
438,334,013 *2C662A293445D369A22E9913DCA542EC45D32557 vicktoria.wallace
438,334,014 *2C6623E7565410F133F84CF4B861F273DB5A07B3 victoriaodaniel
438,334,015 *2C630D895E7CD40613F31EDA1DC2F473BB00A0EC VICTOR.ISENBERGER
438,334,016 *2C6C5959ABCE9B68DFAB07E22DC7A2816F746857 AGEHONORED123
438,334,017 *2C6899386E8D8B5EB9A4ED66716BA4BF427C06FB agiggmggh
438,334,018 *2C640207F6EB115C8FA229BE8C65A735B6938287 vladimirkadic
438,334,019 *2C6DBBC99A5243F11FC1568AAB6EFB95357FA347 VINCEIREY
438,334,020 *2C6195A2AF24AA65D780407285466FF01D1ACBF6 ah/_9
438,334,021 *2C6F68D6D45D640AFE79B1755C606DE97EFF2B85 ahbb6
438,334,022 *2C6BE64FCDE647B764C775E07F56B3D005BFEE9D AHJ=G
438,334,023 *2C66BCB0DFE2AA190D641B12FE2C3A679F1EB246 VQMBCAW6
438,334,024 *2C64B6AF7A6B2D45FC01244380815A074CA9DF4C ai;6t
438,334,025 *2C636CFCAB6F73D9EC4CE39A065318EC32375F85 [email protected]
438,334,026 *2C635213353D5C728BCFE1B2D1F8732EEE71AA1B PTHINSINGEN
438,334,027 *2C6FD79D312CB1733BD330DAC051B732716C7F05 VINCENZODIFERDINANDO
438,334,028 *2C638CA5FFB523DBF060AC2B4C3B4B65003D1FE5 AIGUILLAIS
438,334,029 *2C66706B296C9B609F379A1E2D4CDD6C5E0CDD18 VINKET$
438,334,030 *2C6857D0DE1D56E0C9C7925F233FDA456A264378 pullinna8
438,334,031 *2C6004706F64B689967B10145F4DF3B1C6936EF4 [email protected]
438,334,032 *2C64BDDC8914976D42BF127881AD376258101DB7 W72046
438,334,033 *2C6A375BDD4F3DA406C04E8779A293412F92E019 VISIBLE.FROM.SPACE
438,334,034 *2C654847086D32164D93023136F4B1603A2B65CB ak.3v
438,334,035 *2C6E55F6137DB2F0F220A43A4658B101D2338D16 waldosiurek
438,334,036 *2C64197AED09BEDDFB861A7E7C9791A62E917251 ak#h?
438,334,037 *2C6E6A6C7861D984A9621E9DF9DFB0D015DED86C QD-FBZNY
438,334,038 *2C6F54F9E31FAF45E4148F0715852F92C0BB9577 walkingonallfours
438,334,039 *2C65FAD47FEBC0CC5EE4CB031586307DFA206BB7 WALTER.BESEKE
438,334,040 *2C6F9D0B5A8F76DBB6AF08ED8930F9224D8A1442 VONGANINTSANWISI
438,334,041 *2C63467CFC156600ADA59211DF05C7D0BF0958E1 ALDIERTING
438,334,042 *2C6190CC90B27223BDBB767CB4F4C097714E8E51 [email protected]
438,334,043 *2C6CC7B1ABD91A69E71277857F80A127481EB408 [quakegod]heh
438,334,044 *2C6385C569718D3B9FD1D068E62B4FB3BDFA4AE4 VYNCE.GRACIELYN.ONG
438,334,045 *2C61FBC9A266F63A2608B611CFB83757A04FE5D1 quiet times
438,334,046 *2C672E5261717CE21E9CAB3F3D485F8B0FB7E538 WAITHAKA PATRICK
438,334,047 *2C609C9DAC1BE7331888A11E7B06CDB39B518343 WARLORD-RAUF
438,334,048 *2C64BFE6B794FE96BBB5DADB77CEB11A0B11802E WATCHAREEMOOKDARSNIT
438,334,049 *2C635EE68253AA2720D0529561CD53C03DB78F01 wallywahid
438,334,050 *2C63189CFF29CBE39316FC11C4A167C7BA8B092E radujkov
438,334,051 *2C68C2259C37A13CDAE8040F123BE38992DAC768 ALLOGRAPHYAXIAL
438,334,052 *2C69C387FAB3213E9F96325EF59AE3DD98EFDD67 RAJAVY|HYKKEEN
438,334,053 *2C6607DF01931D4AB4C1E83BF22307CBB6A4BA6A wanichboonart
438,334,054 *2C6CB6BF7074CD9A70FE3EFE7307DBF991C69031 WARREN.STECKLEY
438,334,055 *2C6E4D1D29F09392E1562324C798EFD7B6659FA8 [email protected]
438,334,056 *2C62A65D1798EC7AEE64E513AA25E972E9C52DB2 [email protected]
438,334,057 *2C6DC89F68AF32416AF95BD2BCE4D058EECE43E5 [email protected]
438,334,058 *2C6AC6121BEC426CB58621D8C670AFF4785DDE19 RAPEPORT3
438,334,059 *2C654284B094EFDBF19ACE639073EE752509C7DC [email protected]
438,334,060 *2C69D96C27D0A10C9E06C2BE4E4D2CD71985BAE7 [email protected]
438,334,061 *2C6ED3FC5E538B8BA3CD232DAD94006EA80DD3DE AMK:
438,334,062 *2C65D7E33B15A51F177469337639B885A301C82B wes.robinson.jr
438,334,063 *2C63FEABF04D9E4EC6E074DA9DDD607BE7330C32 AN+1B1SHOP
438,334,064 *2C6F68302A1F82C553F2BF87A6F7F2154CA39A6E WESTLEYSTARR
438,334,065 *2C67F517B1D56F75BFEA32B3E41EB736258360AE RECRIMI5
438,334,066 *2C668DE4573B631C3AA4DB5156918FF7DA49878C wfco
438,334,067 *2C61CE54D125AFB97914C181228C5EF340B7503E andenken,-woo-136-"ich-denke-dein"
438,334,068 *2C6C5823E2B817A3D00D56EB90CC12E39118C19A WHISPERING.MOODS
438,334,069 *2C65F7AC99B102489A0B0F9C445C423F5B682C4B andrew.barboza
438,334,070 *2C66A9B086E5803B13588EBF9F6C07E3B41B58F3 reginaldtaggart
438,334,071 *2C621FFDA6C8FD9268E2A7A8DABFFCDC82E04197 andyabalos
438,334,072 *2C6FC7A20EF3A0ED94BE06F16E58E5396C2FC02C A.NEVERENDING.DREAM.(FRISCO.REMIX)
438,334,073 *2C6650F2F73F8CDD869D5B98BB4A0F48342FDB37 WILBURSPRAGUE
438,334,074 *2C6912328A7670DAEE0CE9121063330B574C3238 WHITEPAUL
438,334,075 *2C672AD1B8F7B5BDF12D421863DE1E9777EAF33C WHITNEY-BRINKLEY-WILSON
438,334,076 *2C662F28F67B39867614C4051A78E405E2D26233 anika403
438,334,077 *2C61DD1EE146DA4FBAE9E2F656AF53176732D60B WIKACTIVITY
438,334,078 *2C6DBCE62E188138A14699803339D657631FA45C william.nafie
438,334,079 *2C6F8AAC66117BD132CDF7E5C3911B36CF55070A williamruskowsky
438,334,080 *2C6E78CB1B693743C2C9FE6B5FE05C43B7665E55 antioneludecke
438,334,081 *2C645A113DFC023B879D8E9C50D81AC965B3FBE1 willardkadner
438,334,082 *2C6A55563942E099E28297F57969259CEC7D836E antoinelawhead
438,334,083 *2C654C5AD8EAE6F57402676BDD627B2D38E0C8AC WILLIAM GRIMSEY
438,334,084 *2C6D2C0734E1E28EFE1AE3ECD327D062B7371C43 REROKADE6
438,334,085 *2C630F7DBAC75C0236563E24F7950CBDF586EAD7 WILLIAM-KIMPTON
438,334,086 *2C6836B25F72C4239FEDA6352598708BD32A1602 ANTONIEAK
438,334,087 *2C66A879CCEB8378D4669E5E45577032D685BB15 willie-rockmore
438,334,088 *2C6501E22BC7199ED65C9D00C9AB8CF4DBD4CF05 willybria
438,334,089 *2C6B4C3C33C0AFC89FDAC2F0E3138EB74FC3E39D WILLYKUAREZ
438,334,090 *2C6FB03C93E348104E62A2A42EA592914141AF98 WILSON.SADAK
438,334,091 *2C6B886F782A54BF5E97671B332495B839FA6051 aoe#
438,334,092 *2C6445DA5A792D53581F379821A3E6B5FA2D5BA0 (WORDSFLEW)RIGHTAROUNDTHEWORLD
438,334,093 *2C6F6D863237563866B5F9C49559C500A0901F00 apvfr
438,334,094 *2C61081B834266CCDEA9AAF883BC67574AFBEA37 [email protected]
438,334,095 *2C6E3650A98C48BEDF5169070734EFA83AB45129 WUOHCSEB2
438,334,096 *2C6277DE5708E0FEE1A6F5CFF65BA71BBD59ECF5 archivoscentros
438,334,097 *2C63F31D74894764ABB1A332C825F5FE0DFC5A8B WWW.COMFYCOLLARS.CO.UK
438,334,098 *2C60435C9F7F80921E9BDC74D5DAF66E325BB742 WOODROW.MCCAIE
438,334,099 *2C6BF3629C6BB13720C35B8F09C72DF4F2E333AA WWWLIBYANWEBCOM
438,334,100 *2C6FD061BDBB0A54BD077CD06CF4F8B22B8D9958 [email protected]
438,334,101 *2C61C3BAE3D7A9BE59C3AAD1D9515F59A25CE65E ARoi
438,334,102 *2C6EF4063C182C4D734AC08DCAE7333E884BA7A2 [email protected]
438,334,103 *2C665A2CD17A496E6A939DD7CFAE802009A6D56C wwwpointcpcom
438,334,104 *2C6CA98DA47645F61AB8E79AEB5C7C7567CF91B0 ARONYMES0
438,334,105 *2C62A4F19738B65668E018EA123F1FCDA4C41C16 [email protected]
438,334,106 *2C6F2E828541E44E7406E2163A35EDDF0A393EBE ARTHUREILTS
438,334,107 *2C604CF5B9D4D47B99F9BCA9A87D6CD904A71D4E WWWWARBEATSCOM
438,334,108 *2C6C5CDE2E97E6FBF0937056C6D16D46123BCC31 RISOMMERANNOS
438,334,109 *2C66635984C9784A29A90FEA8CF40E25D0ACD898 www86carolc
438,334,110 *2C66C5653395E7D91A8F3CE668221C3E99DF3572 X=4L
438,334,111 *2C6FEFBE92687880D889CAB99029B927B9CC6BD8 X95340
438,334,112 *2C6AA0AC85E04EF25EC3D84E55BA05F766A0BDB9 RN-P
438,334,113 *2C65F77D8032723CE5C9E546950418BA759F7FD9 WWW.HISTORICALREPRODUCTION.COM
438,334,114 *2C6A9230603FFD64F993E3AB3F3689BAE007229B AS$J7
438,334,115 *2C6E13509C6CF1D82F36EED8BE5C9EE79665E988 ASRIXBPSXABNTHDB
438,334,116 *2C61596CB3CC3EB520B58D1EF800704609C9BF1C XIEZHUHAI
438,334,117 *2C6B32266DCE80FFE8776EC31BBEC4651AE231FC [email protected]
438,334,118 *2C61D9A773254FD98E03BECB4DC819EDC7E58F2A WWWMODESTYSE
438,334,119 *2C62B2879B5E1609569563FC0337871C737F3C30 wwwneurotracescom
438,334,120 *2C641F0518187A111CB7012EF5D38D3BCB37D127 xprssfst
438,334,121 *2C606BCC3C326C778840197AF56D7A093BE4ADC4 XTREMETALKKICKOFF
438,334,122 *2C6DCEE826254E5F9B7011349EA28C69F0BF9A9F at-the-angels-feet
438,334,123 *2C6223B07AC12DE200DA7D1D81BFD0A738E2C9E9 [email protected]
438,334,124 *2C68EE61D143A417C1A1386A18ED802C46FD9835 xandercatrambone
438,334,125 *2C624DB6F5F07F9A817B43634CACC4A21A74D463 [email protected]
438,334,126 *2C69A55B34A78C2390227A494783A27A45DA4B09 XXCHULA169XX
438,334,127 *2C67C9B6DAE0ED94C8D83F9D5994DEE9C1BEB1AE [email protected]
438,334,128 *2C6B6BC83401F1977DAD1F2201C4D0578BF439AA xhoansheldija
438,334,129 *2C64884A0F9BA22DAE159B4DB0E956F838BCA51D XIAOSHIZHILION
438,334,130 *2C66B7BB9AF518C2C1C73893B5EE5BB79ADBE93F [email protected]
438,334,131 *2C6DDC5D3DEF8787486BF88C8FCD5B4E447075D4 RORY.PATRIE
438,334,132 *2C6923AF353440D358F0B8909F773C651526F98F XIOAPIAXA
438,334,133 *2C66F30A79115F40972F82D13A376781AAA934ED [email protected]
438,334,134 *2C6835F18D02D24EC95F53450F934F148855011D augustwithee
438,334,135 *2C640CAAC42742925C12EE1F402665D03CD013E5 rosendotyra
438,334,136 *2C6C5CF60F4A2FE58CBDAA7647868907A85AD289 rosiealvarez
438,334,137 *2C6F75580D9CBCC87F3278C2B347471AAB18C577 aureliomillora
438,334,138 *2C65E4A5764DE8E5D687387EED3FE6D197A49401 }x{o~o~<------8
438,334,139 *2C6E9713B156A4838D6DE247F6A8B4FAFF5A4D93 XVONHOHANCOLARNA
438,334,140 *2C68D51A4F4AEC2204813D4650C8C24A88F0840E YEHOSHUAMASHIACH
438,334,141 *2C68D8E82A4A19EA0FB7BFE80386D48613655C3F XZ<5
438,334,142 *2C6102956D21AC7D1755F14029597AABC7F7087F Y%,{
438,334,143 *2C622A619F15266F4B697699FD21BDC8CCC3926B avtub
438,334,144 *2C6F31D2E96538FF3EECF87709B44C0121724A64 A?"WQ
438,334,145 *2C657736F197F44BA0EE08F20D25F2B0DD6CDC12 russelhowze
438,334,146 *2C6DADE608A9BABFCD091837654360A1AF91A976 YMCKENITH
438,334,147 *2C60BFB5FF1943884CEA7AAFB4D7AB6AC45F4265 azul (harmonia)
438,334,148 *2C6F72AB18A8D6E4898099F3A9F2439487A233AE YONGKLEMISH
438,334,149 *2C61663C073A433CADEDAFEA2BA3B7C8063FA6B7 YOVILLIAN-RICHY
438,334,150 *2C6A23EF86C0DBD0D522C55448F95EB5A730A1F0 YOWEN
438,334,151 *2C6A0A781497FCECB478B86B05A3CF1ED8630189 SABAGHAZI
438,334,152 *2C61B4A9C50CBD42965D317F8F14C47366EB9760 [email protected]
438,334,153 *2C62C00D21862514ABFB50AE251384DE4BBEDD7F B25_A
438,334,154 *2C62FFFC30E847AFB4470B583E6E18231C5CEAA9 [email protected]
438,334,155 *2C6E52D02596550AC22E5C3D17BCEC8720B807D8 b3fnm
438,334,156 *2C6257195E2BF0F860BB926B05BD72B118ECE2EF B4!A3
438,334,157 *2C653461C23DBCAFE162DC0D61C6D9F22CC1A4A7 yltnaillirbnu
438,334,158 *2C621F5C29F1310D8DF96F4D85302C949082810B b5ids
438,334,159 *2C693668C05A4C382E5A6EF442D6A99C832E5EC1 =Z]
438,334,160 *2C66C631695B270EBB57BF766BF15F9CD4A6EED2 b)8tz
438,334,161 *2C67AB8219CEF1A36D1CFABCD3D655D17D36428C zachariahtosti
438,334,162 *2C61C62FA5D330818AA2C2C6ED0AA8291D6BCF78 zacharyryanfravel
438,334,163 *2C6626C63FCCB188E854607A0CCFA2CB5F916822 YOUDI.UTOMO
438,334,164 *2C604B687EC52E4547BDC7B4FDFFCB54F2861F35 ZACKDANIKA
438,334,165 *2C6C86B3877FA69FED91D5A04F679F159E6672B8 sandpaper9
438,334,166 *2C67DAD8B0C0CD9AB28A2CEFB20BF28D5B38EB5A SARDINHEIRAS123
438,334,167 *2C6B79F5A4BC509241B6ACC28691F253F5261620 [email protected]
438,334,168 *2C66C44221E8C6CC5386A5793A24571F0560E6F9 [email protected]
438,334,169 *2C6706A9DB3F06FE408E843744725BC3124AEF8D [email protected]
438,334,170 *2C665FE9246860717033B5AAA3586E86BD08CB53 YULIA.BRAGINA
438,334,171 *2C6854DA2EB8F8AF51777FFD4652DBD850D5A66E balw
438,334,172 *2C659DEF06C6B96769E8E30B083F2B1535DB968E BA+Q-
438,334,173 *2C6A82EEE08B781DBD3C7764B75CC123D30D7B21 BARNEY.GOSLINE
438,334,174 *2C612AA5C73C74988D0EAC5237A528298276615E Scabroso
438,334,175 *2C6673CA598A450736A9EDBFA87AB20930255068 bb?,,
438,334,176 *2C63560534260AAABBC07E9F86E937A7D4FB3FA1 [email protected]
438,334,177 *2C67F062C2F7A79CEFC92F76407D6E39005DDD98 bbea
438,334,178 *2C6FA896B0E5FB704CCA13BDC0A0976D661DC107 [email protected]
438,334,179 *2C6D457BE744DAAACC26363FBE33EB5DE9882779 SCOPPERIED
438,334,180 *2C65A0C2D1E35987CF326616AE75CB177D1CD37C [email protected]u.tw
438,334,181 *2C6B0E5545CA41E6ABC03EC24F3C584E3307DED9 SCOTTIE.GLAZA
438,334,182 *2C68600B2B722032B305E8549F025E3BABEF02FD SCOTTIEPAIK
438,334,183 *2C63F082689DDAC94A9AF1046AA77EA402CF5580 ZACHARIAANATH
438,334,184 *2C614ADBED52B30975DAAE0C63444C672B60825E zacharylegarreta
438,334,185 *2C6086704919864854782135E475C71FC5ABA28F ZACHERY.RINCON
438,334,186 *2C6D4362BBBCDC447BE7D886C24D1F868E5CA156 [email protected]
438,334,187 *2C616BAC41D87BB5171D51845DD1E40C881381A6 SECEANNE6
438,334,188 *2C62DF5D1085080123A243D0DE6AB87882C7D3E3 ZAMEENZAD9
438,334,189 *2C658E1D343D4BD7A82140F4EF42905E30797002 ZLUKNETTEVILLEYAHOOCOM8
438,334,190 *2C6B5008E1CB390260B1BD71667BDBBA4C0F14D5 ZOBENIK,ZOBENJIJ
438,334,191 *2C65036C3AFEFE15101D7987A56E200B59F83883 ŽÁRECH
438,334,192 *2C6D97C09B76E7D656831FE832936252E26AF416 BEAT PIRATES
438,334,193 *2C6019A09F5D7907F10AC78E780AE1B727A63649 ZATCHIÉME
438,334,194 *2C6BFBD5756BCC67A76A8C606B998F7375109B32 ZXCVBNMTHERESA
438,334,195 *2C63A5888BA55781E02D1449152A547E141C915D ZEINAB.T.JEBI
438,334,196 *2C6A6CA731BD66F99218C5E04ACB39648E1B79DF beg%:
438,334,197 *2C606EAB9D9C5E09A10F66084E7E2AB0557D2ECE [email protected]
438,334,198 *2C68EF2AA49E247447E73073215B57255610CD7A ΒΡΕΦΟ
438,334,199 *2C6349C0C3EFF3B12FF1E37C648A69A43C839C1B ΘΕῖΟΣ
438,334,200 *2C6BB19A805A672D160CD1E92CD94D1104152755 BENNETT)成為牧師。
438,334,201 *2C6E83B9BFE2E6F5E4C582922DDE976E03155330 bentonyanagida
438,334,202 *2C60EAF0A54190CC7CCCE7001881581EB26B6D05 BERAAMDEN7
438,334,203 *2C6169EFD6C58E6C5A862EE262FAFFAAB6F89459 BERT.AHUNA
438,334,204 *2C637F3E149A1E823298537C74F6E32313A44F41 SEVENWORDS:VII.VATER,ICHBEFEHLEMEINENGEISTINDEINEH
438,334,205 *2C69459C2A2237A9F061B1A04D1E05ACAF33A0F5 besnik.sulejmani
438,334,206 *2C6790E60B02127B4CE84053C0FD75D888B4BFF5 BETAKEN
438,334,207 *2C643ECA726EE0919BC241BCDB74B72AEF88FA93 [email protected]
438,334,208 *2C6F94D34F90583529DD945F4993D02BB8E8AC2F b!fh7
438,334,209 *2C6F2C2E4064F463B36F6DE3D4B01965FC942FC1 BFN.H
438,334,210 *2C6527EF931525D9C28B1D175E421B98ED2ABD88 BHEMALEE
438,334,211 *2C67A8E05F8DEF8F769371F08976F01FE1B95E5B bhon0
438,334,212 *2C66EC6C484E696C04DB1E56E2389A7571EE0466 кумулата
438,334,213 *2C6EA4EE6C6B26F6DDF6BCB9324545A08A40DE30 SHELTONPALOMA
438,334,214 *2C6D162BC427AAB5FC7F1BA6196D69254CD02B86 [email protected]
438,334,215 *2C6DA27AF82C0AE15DE74473B8B05DFC8750DF5D [email protected]
438,334,216 *2C65BFB3F7D848994302085577ED5E79FEEB7005 ПИНЬЯТЫ
438,334,217 *2C6778EB24ABAA4D136A868DD68BB5FD442E42F2 SHERIF.SADIQ
438,334,218 *2C6FBA04B5DEC4E840DCAD52D338243BFBA2A9EC АРСОНВАЛЬ
438,334,219 *2C66D13EFAC6C6966BFC7617E3FA2F84307C3139 SHIRLEY.KHO
438,334,220 *2C6C3D2B72837E7A99DC3F76B30E25B51CCF8EFF ЕКОЛОСКОГ
438,334,221 *2C630E8C8D06616B468F35913ABAA83895CD77AB КӨРСӨТҮЛҮП
438,334,222 *2C65A55D553F33760C4334A6E7A842E87956B99A МАККАЛІСТЕР
438,334,223 *2C65306528D88FDFA4F372D3416AD1BFC76BF301 SINEMAXX2
438,334,224 *2C6A6033FBC49F894B79CFB610A403F118D5845C bm;:
438,334,225 *2C62A9811B1DB74C4D9E96ABD6158DC1A3A71560 SKIDOOBRANDON5
438,334,226 *2C6E3371EB40FEDBDFF64535C2AD50F6DE662E2C skidoofisher
438,334,227 *2C6BA909566B164CF82B15EA68A1F4FE98043C2B SLGSPRSNLT
438,334,228 *2C6BBC1EBC31A8A09482536295C60D596C16B174 bp34?
438,334,229 *2C6AE2F5817D496CA75A52F9D32846F55EBA5FCF BRANDENHAVELY
438,334,230 *2C6B90A575AA2D35670B50A2B12E4937814BF94B SONATA-NO2-(PIANIST:SIMON-TRPCESKI)
438,334,231 *2C6C8BC609ADAF60961DE01435E881F682B04A1C 地理b…『詳説新地理b』『詳解地理b』
438,334,232 *2C6A4EA09CA5CCADC232B794D864D5B3E82C71FA brettandregg
438,334,233 *2C664E0FD930F590428083EC28D841075CE1415B BRIDELACE0
438,334,234 *2C6494B88AAF402F08175FAD2571FE40C3E285A9 BRMOT
438,334,235 *2C666B6D30EF333AFE37CA68DBE93DAAA348AF9A bst&
438,334,236 *2C6FEA05824C931A4909D636466FC2E79C19CF70 BSWSIMTARBSW
438,334,237 *2C60DF1E5A72BF28A9FC4CE832A16E9B50CDA9B8 現時一般鎳氫電池的容量已高於鹼性電池(以體積計),以aa電池為例,鎳氫電池標示容量可達2900
438,334,238 *2C66B4421F23F1C865193ACF30E8B2B5EE118D6E STACYWANLASS
438,334,239 *2C6F25FE295332484C36EA1650919F5009CE1101 STADSGEBOU0
438,334,240 *2C61D79DE3DD746970136193452D645F0E93D2D1 btvqu
438,334,241 *2C699A3D3AC26A64AB7AC90404DC94770D6E25F1 (0-0).~Q-----P
438,334,242 *2C69EC21DD6A63B3FFBDF6200CEA10BC58516493 STEVEALMAAS
438,334,243 *2C62D9B8DFFB2F57927FC898BE47F76746A2D1EE STEVENMANGANO
438,334,244 *2C635A805C0A8E70C948BF604669AAB136A3D08A 08041254
438,334,245 *2C6B8FAF00BD9D15E1E15D630222649755C1A0DD stimitam3
438,334,246 *2C61D2105FBFB1F229EDDAD5A2C5A31A2C551B82 bwa6$
438,334,247 *2C6803D0CE71EE0EC2FE3BF722D8A9516727766F STOR-VIT-ELEFANT
438,334,248 *2C67DFA657DBE1649C1D5C70EA62321CF53EF235 BXOUV
438,334,249 *2C60CA037512BC38EC75584823EE92166AE8532A 1082154 mikroskooppi-tutkimuksella-voimme-selvitt
438,334,250 *2C6C88B87FB6F7796E748A820478ED893DE0A3B7 STUNTLEISTUNG
438,334,251 *2C6A5685E35B9D1F1A30087FC309B369E7C5F5CF 11.25.1465
438,334,252 *2C603C3F3E49928DD556A28964FC2134868B3E47 1159803 dieaussichtaufdieezbhatpolleitdannnicht
438,334,253 *2C6CEAE91F0F5BA08D859470FA6E217FAA9A7DC4 1160526 AJASSA 4:23 HIEMAN EHK
438,334,254 *2C651282925F675D90CBC1118EE5AA171EAC253F bz=t!
438,334,255 *2C65B250186273CEB53D6F0059F51E73B29251A1 C0;3F
438,334,256 *2C61679865C530F5013656A7660DF095786EF8C9 123go
438,334,257 *2C688664F90154186ED9ECF7DF0B869BE24F8891 sungmeshanko
438,334,258 *2C6644912B829E87ACEECA28BC55BAE99AF2C388 148728 that task may prove difficult , but manageable
438,334,259 *2C6C175E925FAD436FCA6253722F6E871A59407B s[email protected]
438,334,260 *2C6B86B79F4F23AF0B8BD6B318D3AF8ADB2DD03E 14TEJO-BRUECKE
438,334,261 *2C68F006C7CD38C2EB85EEF487A15F89FF70AE7E 12:.12..-#..-&...FURL
438,334,262 *2C6416B535C93FA4B685A4FBCED3704D0F7A5D43 c7afe
438,334,263 *2C650199C198AF88E037B6253937556DDB08DC06 15NOV1233
438,334,264 *2C6090D15901F987DD49A6A9D24F8210C60DA741 SUUTELITMUA
438,334,265 *2C66F2E830050354B782D3CD5EF382E718880356 CABELL0
438,334,266 *2C685953C47B9B92C522E436792A38A723E06AE6 [email protected]
438,334,267 *2C64EF738BCAFA5F072428AA74407CE53998B238 [email protected]
438,334,268 *2C68843727B06787A3CEED06BC21A3797F17CAE5 [email protected]
438,334,269 *2C6B8570A8D90C3E101ACFDA1184CA9F4459FE9A CALVIN.ROBERT
438,334,270 *2C63FF499C615A994365A61085F4393410308C16 CAMEJUZZU
438,334,271 *2C65B209A49633FFD3BD9AEEA2C0B79B8EA425CB CANEYOUNGSMODULUSEXPERIMENT
438,334,272 *2C6EB89EF5F384E214438AA2747BA680FC16AAAF SYNGENESIAN2
438,334,273 *2C67AF409B91A25BDEB742B03B228AB7D2FDAA28 1835397 REICHRANICKI.:.JA.UND.NEIN..
438,334,274 *2C66DCE44FD3E77754D6A21AF3A08BAEBDD12899 sy-o
438,334,275 *2C6C690D41666260484C5E6AB0796C0DEF80E180 CARL.SCHLEIMER
438,334,276 *2C6BD57E92B902889613A400B39B26983DE207E6 CARLTONLIVASY
438,334,277 *2C66DFB5E66ABB2ACF1D6BB27D6CE1DA52E5CCDC CARMELO305
438,334,278 *2C67E2CC48F2BDC4728725186F2047E95997B527 CARMENMORENA
438,334,279 *2C6936B6642A9F78F214665439A14E34271F14D1 CARROL.DOHRING
438,334,280 *2C6AA5363D819AA72BD9FC8BC68881A35CAB7EC1 1-arvostellessani
438,334,281 *2C6F922E4CEFDF41E674D9D455C10D42D2E95B4E 1476478 mary wuerde verkehrsberuhigende massnahmen begruessen
438,334,282 *2C6D0602A724A5CF22989CC5D3309E79DB8F3DF9 TAKKUEN9
438,334,283 *2C64C3E9C6293E87C39CFF3498ED16FCB693B6B9 talk88109253114
438,334,284 *2C676F9DFA5D62383A634D641FF5CAE2A91BE182 TALKAGEEL
438,334,285 *2C64DD7150C00D4874FD0080C2E3816567E522B0 TALUMAJASID
438,334,286 *2C67801E09724461CD6180F2A31857F5397BB40F CATCCCTCCTGGGCCCCCGAGTCACCAGGAGATGCAGGGCTTAGCCTGGAGAGGGGCCTG
438,334,287 *2C656851776968E9F8B5729A3E47F9282A7BCE3B 15.koordinatOrlUGUnU
438,334,288 *2C6541428E4008CC1A0B279E3A317A806E49A115 1dexxon-data
438,334,289 *2C6DA7EE0A53DE486FAB730AC5BC0F34F3FCE2BA 1DOUBLE-WIN
438,334,290 *2C6536A877986AF5A57A699E7C894B116F90840F 1-drehzahlklang
438,334,291 *2C67EEBE74BA17F77E28CD957B8995688379CAF9 1778400 koko ohjelmakaudella 2000 - 2006 rahoituksen kokonaism
438,334,292 *2C6CD3F75CA5E8F9B44F68390A51145F44EE7C87 17asymptomatic
438,334,293 *2C64FC38FAB8D1BD3523581117EC4DEE830A02D1 cbmtest4
438,334,294 *2C66B1E4215E954723906F58B4144A93BEB6CE91 cc=pu
438,334,295 *2C6F4DCF820CE5F764707FF3DD24D9B8C8FE8C44 190530 degirmende.miydi.?
438,334,296 *2C6BC948D5E601307CF9EA225C7DDA62564AE451 1hein
438,334,297 *2C6D277A984EABA79E02C3668912A00BC3B464ED 1.HOSENSTICKERIN
438,334,298 *2C6B83EDFBBED413CF7A135EDD624A6C916EDA9A 1hunnenthalve
438,334,299 *2C6C3542A10333FE21B97DF5850BCB96A5FF9E82 1-INTERNET-KAUPPA
438,334,300 *2C6FC99EF6E13A8C10C5D0C46315CFA9A321603C 1INTERNIERUNGSFAELLEN
438,334,301 *2C6028EC160BA812F3CD204189683571C4C10738 teddy-ach
438,334,302 *2C6DA3DF5E76EE25AB482C59019A6DC78C0BFC6F 1IOLLLJX
438,334,303 *2C626FAB7D75209C2D199D96EC7C6AFBC42FD198 tegnst
438,334,304 *2C62CECB59B777637D49A8BCAB506D21E0344EE4 1.KISCH
438,334,305 *2C62D81FBB7DAA2F50361A6F8E9757F2F6271D60 telepathicpeople
438,334,306 *2C61FD8B47E75CFE2DF0C732BBC4FCCC3ACE0A67 1.litsarin
438,334,307 *2C68380A7BB492B51297D730B31F1217C75B1589 1.LOHJAKONSERNIA
438,334,308 *2C6EC711284FB7EB64ADE26051CF1B7CC59353F4 1lurpsahdella
438,334,309 *2C68BC50243EB4A15B1F1FFFADE7024846DCBD72 cez()
438,334,310 *2C68E12B15DF0BB16DA46EF0C8B90CCE20F99B8E terrellgerstner
438,334,311 *2C6836705F5D86653A42A1C72728F0AD8C24DFC7 tetralogic8
438,334,312 *2C622B6782F91F6AF66CA7915386C18EC09C93E9 [email protected]
438,334,313 *2C6C37DDE21433DB987F64B71EF0EB0D18629AC4 TEXTWON
438,334,314 *2C6664AD993EE1FCCDAD36CD3E8C5BB072819195 CHADCROFT
438,334,315 *2C69093663B5734282DD3E49C3D5483B00E68313 [email protected]
438,334,316 *2C6DBC645CA692BFB1AF273DF7613BE366998573 CHAO, CHAO BAMBINA
438,334,317 *2C6DFBC74099BB61E9973374B8FA86ED0D9A8B24 CHARLES 'LEFTY'
438,334,318 *2C6CEFB9162D0C05D7F0FDB6B68391FC661D2250 THECALM1
438,334,319 *2C6D3BF75BCF789E16687FF82D5E24C4B677656D 1-saik
438,334,320 *2C6BEF07CB3B006E78D9E6B96C22F752740FDDA3 charlieduffin
438,334,321 *2C6D7D01ED261B575995DF526EB048BFB39AFE39 1.snapher
438,334,322 *2C6106FFF8FD8B380D9E6BDEDC2DF0BF25D1746A THEMICHAL67
438,334,323 *2C6C1681673B57E788DFFF9F1C2BDE5117620A6E CHENBONA
438,334,324 *2C6386386D95EEBCDECBF40F16AB12B053EC276A 1DURNEDER
438,334,325 *2C6BF465E7A5E12FDA9EEE63818F7424E2B5F6B7 1tietoverkkostrategian
438,334,326 *2C666824DA2FF70B1AB7274ECCA985D9B5C3D42A [email protected]
438,334,327 *2C6241A7EB357E3BD3C9D45B63BF4EEE1F04090E 1TYLSISTYMISELLE
438,334,328 *2C643EC476349B86D7BC4F3BEA80A3F8DCEEA4B0 TheWatcher,Part2(Rukmix)(featDrDre)
438,334,329 *2C66C2B5240810277B886E67ACFEED4616EE7E78 CHINA1
438,334,330 *2C6A67E1619096C62793EE6062A0FDF790C26566 Chp"
438,334,331 *2C604029EB2E7BC6B52B26292D0831325D4E7549 till.you.do.me.right
438,334,332 *2C6D79ED9CFEFBD05AEEE033917571065BBB4F18 1hein
438,334,333 *2C6197EF85F84F1E4894FE92128CA6D511D6B0A3 1.huumetokkuraisten
438,334,334 *2C676898C57E11E4AB9E9B18077BB688040CFAD9 ci#ca
438,334,335 *2C604DE8482551D982C1810CC7A93C99DC0E89C3 1KARVATURRIT
438,334,336 *2C68D1C9C08652B8CFFD2464D24D2FB187B74ECB TLHRMNM9
438,334,337 *2C6AACC4AF393FEA5FBFF0218C4AC98FB95AFC49 1 LAPSIV
438,334,338 *2C6038EBD1D4BC7D0F4B211E03C05D53A27192D8 1-maaliympyr
438,334,339 *2C684F45F437FC62E9857CF0045D396E92C27604 CL4R4D1R4P1D
438,334,340 *2C63F32FD347E239F0D1C5A03807C7C1E9A71536 1 MIELIALATEKIJ
438,334,341 *2C681B6D8F9409EF1C0CE6552559AFDF638A83D9 1.MUINAISRUNOJA
438,334,342 *2C69A21A91ACB7D6010ACAA9925A5D209AE92819 CLARK.VANDELL
438,334,343 *2C6DE9EEC9F80F5E022C791B6E43D0432C4B246B TOM.TEACH
438,334,344 *2C673754191ECC4101CAD8D0608E5579861F3E50 TONEY.FOWER
438,334,345 *2C665A31D2DF274A05F747E2BF5F15FD51576FEA cle-$
438,334,346 *2C6E50A6A081B24517B85C717F0CFDACDAEA4930 29091559
438,334,347 *2C6D21FF312EF96CF2F441F8E28D30A700AD9971 CLEOVOLPI
438,334,348 *2C609B1371D5584EF0268ABEAF27288B017A96D9 TPM2826
438,334,349 *2C64EA5DFB8CF2B1E87E8CA0E89393FA7B4D1AA2 CLFL
438,334,350 *2C601A27CB63BFEE8A2C474CD3B8F988A1A503C5 track_instrument-tr/&/k_'/I/nstr/@/m/@/nt
438,334,351 *2C68B23FBEFA951A7311301F672D8B876B4F8725 CLIFTON.LUCA
438,334,352 *2C649EB04EE97CE039617B0381CFCC8BE55D77F5 CLIFTON.THEULE
438,334,353 *2C67CED9851596D10BEE02D99BE7867597D17F44 CLINTON.PLIMPTON
438,334,354 *2C67F103D87E624D9FC1787081F57FF5A9EA516F TRAFICKING
438,334,355 *2C66F5AC81E67FD5D2F7825F640F32D5D57D82CC CLOSER(JOHNBREMIX)
438,334,356 *2C65CC33553EF85A48683609A8D4B7424AC59070 c!mx.
438,334,357 *2C6CE70A0BBA320F326F327EAFA144AFDAB2B3B1 [email protected]
438,334,358 *2C628C017CDF837C3909A5035E2C81E8201C2EAE TRAY.HENRY
438,334,359 *2C6F3B20294E25A875CCC0669104194D3F01ECD1 CNV4T
438,334,360 *2C6E3750012185FF7FD3B7708E0407224A628192 CO31ASTRA
438,334,361 *2C6E4272F81D1A7A698E81CE903613B8B43DC0B7 1 RUOKA-AINEKSESSA
438,334,362 *2C6E3B42357F1A9DD564364845F9764A7391BD7E 2-hermez
438,334,363 *2C65A1CDE2361506D1110A5107D7495F93971735 2.HIPERINTENS
438,334,364 *2C69942DD3F6381D2C9AD92245C5431E9438D895 1SCHWARZARBEITSKONTROLLEURE
438,334,365 *2C6EE11B0318F16709CDFCA09D88E6A022A16F64 treybilbrew
438,334,366 *2C639D49D17DA90F08BCD22F900840682254040F 2karkausvuonna
438,334,367 *2C6D3CE17F25EE6789B9C53C439A337D9B2878C9 1SYDNELL
438,334,368 *2C68A048AE3660E5B18A5F37A5A66633693B18D3 1.tachibana
438,334,369 *2C61CE829315C67A45A8A8137A1488627FE570CE 1 TIRIDATES
438,334,370 *2C65F12E6B0BCA07D92C245FF6CEBDDD4BDFDE20 1-toivovalle
438,334,371 *2C6A7A872E5174A0AF80FA6F27B30791145BA94C 2MAR1836
438,334,372 *2C6505D657ADCE7306D33EB789578822B67DFCFE 1-TUZI
438,334,373 *2C6E19D9AFDD8230C44F59E7F59AB2E4E4B49A55 2MUUNTAMOTILAT
438,334,374 *2C621E9CFDD35E2DD055FBC327F6F227683EB2A8 collides-in-front-of-mine
438,334,375 *2C61E6847338BCF51E7EE7644DE7AB7B5CD5EAD4 1.ur-ur-enkelin
438,334,376 *2C6596CE145D7EBB970CEA8D58C520C5168DDF0F 2ortsnaeher
438,334,377 *2C678CD0D3BE2EF1D786611206FF4CA0DC20CEDD 1VOIMAANPANEMISESTA
438,334,378 *2C6013F0DEB7A4EAA1F505030D8C495311AEC15C troncavade
438,334,379 *2C684CAB5225C9B39D71F0BC2FE5203EFE1E24B7 TSCHERNOJERKOWSKAJA
438,334,380 *2C6518BD67207073754DABCA9855EA07CB2E253F 2YOUNGEUN
438,334,381 *2C60DF4F6FA41349A780FD49B051CC79B57EFA71 303TRENT
438,334,382 *2C6E6054BE97A891CEF52702CC92C086F4F70783 2009年8月9日、新規契約者の減少を理由にcdma
438,334,383 *2C62ACBE1A83CD6B32F1C602D68FC69699E9FC2C 207225 DER.SIEG.WAR.BERECHTIGT..
438,334,384 *2C68746206707A907511B0CBEC1EB253BC71F307 374JON
438,334,385 *2C659A4CD33F929E6DBFC2BFCC0C9FD82889FEB6 copulasing
438,334,386 *2C65E0C22B55162EE8EC70D95220CFEF25D0A278 3######b-~o-(~_^)
438,334,387 *2C6BBF93C256FF99EF3D92F696D52ABE8415F149 223AUGUST
438,334,388 *2C69FBB6CFA5769DB683C4CFD46C0721C5B71137 courtneycavallo
438,334,389 *2C63DE02A2977648BBDEE621B3D38E412B40E611 3ILSSEMAD
438,334,390 *2C6567008868C7DBF80C4392218AE9C6B407A7EF tyler-bekolay
438,334,391 *2C62E74529CD48506E0CC0FD7A2F8A109BBAE21C 3KCHALAS
438,334,392 *2C6F42545D450B23C8FF0DF37BAC98837899AF77 TYÖKISSA
438,334,393 *2C60C4A1A90368C7EAFB254E0107CD17FBE8F41B [email protected]
438,334,394 *2C6CAD35F915000FEB36E9C29E10F0CFC6279718 UBLAKALPS
438,334,395 *2C613B8D42EDA2ACE6A380DEEECB8C6E07DAF4CA UDELL.AND.OLE.SKEETS
438,334,396 *2C64375A51DE3639826A8A3058756A4CD43C142C c:\program files\microsoft sdks\windows\v50\include\clfsh
438,334,397 *2C6930EBF4D17935834A590334B76FE581AB1DE8 UNBEDRUC8
438,334,398 *2C631713E46D805DF74BEBE55FC3FF3B4E7E83D9 C:\PROGRAM-FILES\MICROSOFT-VISUAL-STUDIO-9.0\VC\VCWIZARDS\APPWIZ\MFC\APPLICATION\TEMPLATES\2052\DLGROOT.HHC
438,334,399 *2C603A85E71596DAF6A3AEA930C3431E92C4A682 26153 OZEL-FINANS-KURUMLARI-NEDIR-?
438,334,400 *2C69749D9A99475447088BD068EBBE5C6C9846E9 2651979
438,334,401 *2C669882E5EAAABD4B4C436089CDA85F96D3DBD6 27091477
438,334,402 *2C63276FE129CBCE940C047A317B3EB22A9474AD 2737069 H
438,334,403 *2C606CE56655D7BAA514793C1C4BC2C8F26CBC2B Cq0
438,334,404 *2C68D9B6E45ECACBC5BF6AC29CB4A3253CB75026 445962 pasakarSIkoruyucukaplamalar.
438,334,405 *2C6165C1D173B1992B3ACE512CAE417172E42AE6 2831444 A-DULLER-SPOT-,-FOR-TAX-REFORM-AT-LEAST-,-IS-JAPAN-.
438,334,406 *2C607D1BEFD8CBD759E52A596CFDB835C834725C cr055a8!1!7y
438,334,407 *2C6855549AEA958253B32C5C59D9171F65C2BA57 un-sabadete-m
438,334,408 *2C6C87B4E964123497E3D2379F91D20A63D2D5AC 49suave
438,334,409 *2C6B6692F17439764BA82B9A6319B928E92B79AF 29=-BORG.DCCQUEUE-NUMBEROFSLOTSINDCCQUEUE
438,334,410 *2C6D99282FACAB5A0A062348A53E478189F70D18 2.BOEHLES
438,334,411 *2C692E4A6AE43CEC938854B5D943A7EC5966E1C8 4D4M4NT1N0M4
438,334,412 *2C62094B0E99D6955727B13D9689E600C8018E2C 2CLEARBIT
438,334,413 *2C66A9A6990B16248C9E72B59E0A20709BC49092 2cnnkonkurrenten
438,334,414 *2C66161FBC1AF50BA331FA79D7056A0455B865F8 2.cous-cous
438,334,415 *2C67C251C4FEA519AADEDD6F0E7D4B7BDD397FFB urivig
438,334,416 *2C61595FD4151CF35DF3B91E0E81E041C1333439 2ELAVLUGR
438,334,417 *2C6E612A2B9CA70827572549200A3D1B11C83A6D 4ILOVESAMIAM3
438,334,418 *2C6597DB33773A7DA59BD33BE6E856EB1412C2C2 crystallize8bf
438,334,419 *2C6F7BB7B32E32F6971F97D63B4D7E37A0EB3AA4 UST-MEN-FEU-WOMEN-SWEEP-UAAP-TABLE-TENNIS-TOURNEY-EN-ROUTE-TO-TITLES
438,334,420 *2C6A7C770CB03CF4584AD20A7D4942D5BF837EEF UUo~O~<====q
438,334,421 *2C617B2E7F1CF986D981D8076B46160B184AB95F 4SCORPIONMAVERICK
438,334,422 *2C69FF8D084EBAC9A502CEB8982A943449626C89 cswzj
438,334,423 *2C672F2EA9BACB484D2AD962C61FA8284FF19215 V4LE5
438,334,424 *2C6393EF3E0FA5B2FBD0F2492822213DAEDA4377 V5=BAA
438,334,425 *2C633C1A67FAABED99B850F775E2F2D9D5BE3DBD CTNS
438,334,426 *2C6BD9504A5B7E8CF8D48260BEAF3335D79959E3 [email protected]
438,334,427 *2C60F30DBE7417CE20C36EC52B83743D3C2D2704 4-TURISTIAUTON
438,334,428 *2C6F910624F2D12A109E4121FE149C5EDB4B006E VALCZACHOR
438,334,429 *2C65B4225626829C95EC1998B91B9A70666AB97D 4UBERBRUCKUNG
438,334,430 *2C664E9515512A4F635E628E907208EAC4B2CCC1 4VOLLZAHL
438,334,431 *2C61A1B7EBCE22FA1D12468EF6836C705AEEF6B0 2-SUMMERTIME-FESTIVALS
438,334,432 *2C65569591E3833E32AE9C20D08D171B6622B411 2-SUNNAH
438,334,433 *2C614495470807E6119BF342EDC12C81D0AF5B28 VALHALLALIVERPOO2
438,334,434 *2C695596060F10FDB035C0CEFDC713D44DFB5164 2tapahtumakokonaisuuteen
438,334,435 *2C6D7AD4D3C3DE926461C5C07D28AD81C5205CF2 2TASTTYRV
438,334,436 *2C6BB7F9E8ACF36C14CE1DA2F2427B4F6818C990 2theasterix9
438,334,437 *2C6B95C788ED01F77204962324D036047C6F8B5F 522malik
438,334,438 *2C6028B939D65D36B8AA7E0BB4E3B8BF2FAB7386 VANESSAHELBERG
438,334,439 *2C6F31EBF41F2058172A3759EC7348A3AC0478D9 CUStard
438,334,440 *2C613AD20312377F1C7320AB437F05AE05199C9A :VARIATIONI-PRINCED
438,334,441 *2C6CBD1AF72F167194D3E3827B07B9F51F2279FE 349786 DAS.HAT.KARL.LAGERFELD.DANN.AUCH.FRUEH.GEMACHT..
438,334,442 *2C6317BA856C28547FD61DBBE1FA1022EADC6C7F 5.ANTIKOAGULAN
438,334,443 *2C6D346082B691EFDE7FA095343EE8A57A11B3FC C+,=W
438,334,444 *2C6ADC4D29CE09FA17E865C4E3197E95AAB11AA3 VELASSI?
438,334,445 *2C6CF97033C166BB375EB4DD596EB50E1A119B30 vengeanceismine
438,334,446 *2C692C9542E0ABB1B59502C93CF864789B700FB9 VERBRANDINGSENERGIE9
438,334,447 *2C6E918FAF980AA389D936B06860245A1A38D10F vereelte
438,334,448 *2C675DA1D8D46C7AEC1860A82B14466F2E3EA36C 5EMMITTIGUANA
438,334,449 *2C6589EF3D1158F9135F67402DD53308762F8024 verneinender
438,334,450 *2C691754A105C2F96D5A83941E513EDDF0B38E26 cytg
438,334,451 *2C6CA17BB58C290A307638BD737C4FE7DAF9B2D2 VERWIRKLICHUNGBS3
438,334,452 *2C65955C6402F7BD4FFCFF2E04A616B311C61C9B D0%7
438,334,453 *2C68BC7B33130528646C6ADB57FD150EDA93528E D3$ACRALI
438,334,454 *2C6B09F13398670723B49963FE66DED04D66D172 3.geburtsorte
438,334,455 *2C6E981D420CA6444A9D546AE12CBFCAE60C9374 D4EO
438,334,456 *2C6D429B1E6B8C9F9DFED30E13B277F86FEF932E VIHERPEUKKU
438,334,457 *2C63D782DABBAD75915574C61CE6DA6259BF565A [email protected]
438,334,458 *2C6E1E09445D0BB3481398A05795677BE9B8D676 [email protected]~`}O{
438,334,459 *2C6185A10E74F8F6FB3BFCE24AD024129A128A82 5NIRANTAR
438,334,460 *2C6427E5F72D636411CAE0205413251CE1F625CC 3PRELUDES:IALLEGROBENRITMATOEDECISO(FEATPIANO:BROOKSSMITH)
438,334,461 *2C6DC433CC8D922E5FF1C135AE1B06546066EF6A VORRCKTET
438,334,462 *2C6BCBE494880FCA2794680A67F0B4976627C7E9 5SKEWSYMMETRICA
438,334,463 *2C64A958535FC442B0845E4AB7FA93A116822824 40TESS
438,334,464 *2C689F39DB26E6F55AA7B30095495A28C8431FCF DANA.SPINGLER
438,334,465 *2C68180182A5DD500DB909D714D7829E92657163 DANILO.PALOMAKI
438,334,466 *2C645DE1397798FD670C87C2372763F44811F7AE VTMIKDJUPZ8
438,334,467 *2C6F4AFCA8C14D35320CC1C8ED55359FD5DF6274 4AFKOELTS
438,334,468 *2C6D8750FC2AFEEFA4E62380D82E7C72483BEC13 638290 varsinkin jos kosteutta p
438,334,469 *2C6D6AFB2A13DFBC424D2DDE4A2DBD3BD4A02262 VVLM
438,334,470 *2C6DD65753B17EA560E38249A2960957DAE60604 W0RR!MEN7$
438,334,471 *2C619ABD4B024A5B2C197D584914F4C39DB62241 DARLENE-SKEEN
438,334,472 *2C626AEAA79FD087642F4D8D69C501DC1F04261F 4DROITN3
438,334,473 *2C607F40EE978D5BCCD252B89631F856F49D9FE8 darrellkaniewski
438,334,474 *2C652FBD00AD119557CA3B196C7632E8E00910C0 WAHEEDJONES
438,334,475 *2C6D42BBA0FCDCEB51A281A55BAD68742019D6E9 6.altorgel-festival
438,334,476 *2C6ABF848A3B2DCDE9E727EA751CCFBDCDCC664E 4.GILROBLES
438,334,477 *2C6E2BAEBC7E18E627F4C1540AB7504CEE09574F 4HALLAHC
438,334,478 *2C61A475C1ACC4A3C20F7F63647C35EB45BE8EC3 4HELEMAAL
438,334,479 *2C6E1DAEACDA34E638CA948C8A4B79C45176A944 darrylsulik
438,334,480 *2C6A3A9DC270FD5E979B11A764219106C220F284 6BOOMLAB
438,334,481 *2C6DE68A7A46589B151DE94B3C235F032DB0BD28 4ILUVKHAN8
438,334,482 *2C62A6E32D89E934013CE1160E9908A2B5F9EBFA 6BSWVASAVADATTABSW
438,334,483 *2C67DE3C07395B7E0F5AA799DE4FC6CD10E1692C 6DAVISVILLE
438,334,484 *2C669888FB72C5B5ABCCBFD35E872F73A91305CB [email protected]
438,334,485 *2C6F076FB597DC71ED940C7A356EBEE84FCB3FCE 4meid
438,334,486 *2C67394B4F5120427706BC06C22C8C7911BB9DF6 6MOOKIEFROGS
438,334,487 *2C6CCEFFA9D86966A6E24CAE216950F1CFDE985E dc2hp
438,334,488 *2C60879A5B05D3C0234BFEDECDB888755795D7E7 WAYNE-CONINE
438,334,489 *2C6DF0B32A78DD4ECE4D8A3093A7626795F3510D WAYNE-LUNCEFORD
438,334,490 *2C655655C19094B29691E7608DB212CF559ACA7B dd^p
438,334,491 *2C6F38E73B5ECA21083C4E6C8DE1C40ADEA3E9D2 4MYIRENE
438,334,492 *2C64C3E29374FD1C31DA76655A889A9508746DE9 [email protected]
438,334,493 *2C6894A7CCF846549C84FFB5EFB9D54A25C4DB12 4PRIMACYING
438,334,494 *2C6D5837A4DBCC31185C941CCF4111123DA85B3E 722982 K
438,334,495 *2C64A6A5C35E8707DB11820CE80F779E429C1E83 $73al7hly
438,334,496 *2C6CC0D062FE5A2E0559AEEFFBC70206DB7414F1 decoulent.
438,334,497 *2C60DEF7DBC0E402B263C75121C3E31AADD0A69E delaworning
438,334,498 *2C66B690BC34061776074D32D2F5585E227E177C DELGADOV
438,334,499 *2C6658250099B64E2FD1485654624B6D1CAE305A 76794B94
438,334,500 *2C6FC3409EE6C2C2277B0A1A76D15415930A9294 768224 CALISMA ILKELERI VE TURLERIN INCELENMESI
438,334,501 *2C67A72C4B56CBDE3DCAEEDEB0D044E2DFCAD7C5 demyth0l091zed
438,334,502 *2C68CA22C20EE19D5ADE197672C8FDE60BC5325B DENIS.CULHANE
438,334,503 *2C66CFE71595A45DD73A5CE8858048C2CFDCBC6D dennyschabot
438,334,504 *2C6D49CB3696195947840761C47CDA57CE48C3EC denveraths
438,334,505 *2C69A8AA1EC6757684BE05CF13CDFE9A89C856F2 DENVERNOFTSIER
438,334,506 *2C61B9CC38F779BB6C7792F90689896EA68C35E2 [email protected]
438,334,507 *2C66F5A7467B900ACB680B4EFD772FB678B6539A 7BSWHANAORIZURUBSW
438,334,508 *2C6290CEC5919D9C41B5B0086E3305E881079047 7CCCCCCMISSY
438,334,509 *2C67E20BB01160BE67C547EBCB6B8659913BF1F2 7centuplerions
438,334,510 *2C6409667243DFB249D5CC4CEF6028C22700DD8A devin-cronin
438,334,511 *2C628268880A57C3FA6489592759D044FABE3B75 whenthechariotcomes
438,334,512 *2C6CD51C9FBB8EF0E95819332BFD3F6E204E8388 WHOESNA
438,334,513 *2C6D34E47F6DF4A8E8D9C6F4F544A462D3ED58B5 7HARRISONGRETZKY
438,334,514 *2C6C4AB65017F477D7D551A52ADCD27C628C2CED 4ZORGANIZOWANO
438,334,515 *2C6F006230AABD9F7E13E084F888393902BA263F 7ISSASILAV
438,334,516 *2C64C1E7CDFD4AF284E11FBD46B734CCE44C2292 DFW):
438,334,517 *2C65ED39328CFB56E6F64E0D241BF43020ABA85E [email protected]@[email protected]
438,334,518 *2C63798134D61EF3B4B7AAEA42564E3B48317040 521112 ANCAK-SU-AN-RUTUK-UYESI-BULUNAN-DOC-
438,334,519 *2C6D5E5C197D0F9D3BABF8A69C32ECCA1CEBBEB4 521-perinne
438,334,520 *2C62442F45252C763A6C440DB04EEE500D35762E WILLIAMS.BATTS
438,334,521 *2C6967F8654F173EDAB300EEFD1B3723E3E633A1 554658 " nobody seems to be inspired "
438,334,522 *2C6F4AC98799C772ED3ECE620E1B41FFA2A03E12 7PARQENOJ
438,334,523 *2C661F4A6299BA31631434C5532078195129812D 7SIVULABSW
438,334,524 *2C6A125A0BB4822647A8F1CE8CB7F69C554DF97F 7SKELLINTONS
438,334,525 *2C61DD57D6BFD9587BA499E59FD9F414F492ABB0 [email protected]
438,334,526 *2C6DC338D05DD8D290918490053B554CBCB6263E «DIMÈRES»
438,334,527 *2C63FDB8335043AFCF9515DCFD849BB222FCC35F [email protected]
438,334,528 *2C6FAAE2F01F04ACE3DCDD1ADABFC8F23DDA2291 DINLETEBILEN
438,334,529 *2C614285E1ED1810BED7B17C82B33A2E383B1F45 wisselkantoren0
438,334,530 *2C6F7CC96E37E750E39BA65B9B8B370840F59822 WMCHENCHEN
438,334,531 *2C615296ED0E5CA738E82433195348386AFD81C0 [email protected]
438,334,532 *2C67E5C2503C50130E591CFE6E4B9336252C67F0 W?RDIGUNG
438,334,533 *2C6080981F059A55C792D672F057CE1E3092C282 [email protected]
438,334,534 *2C644CCC996F99FCD5D2DEF97EF736518AD7724D [email protected]
438,334,535 *2C65DC258D1C0A6AF73D18099110EE74FF91D4E6 [email protected]
438,334,536 *2C651CBDD9C8EBDFF4343420EEB8A7C6E6FFC1B5 DKHPR
438,334,537 *2C6EB6315C3EEA83D201231B9F8F3C56777BE22C WWW.FOOTAGE.COM.AU
438,334,538 *2C6A85104111D7545ED568A40D0AD2E88A86AFBC DKUKIEZA
438,334,539 *2C62AE9C481E5B3B1CB9B42755CA32E4DA97997D wwwjoshuarichcom
438,334,540 *2C66835867375DEEF9C908353820CA45AF51A6F6 WYLEE JOE
438,334,541 *2C61A631629EBE445A8E79DFA4EC1AA3F408EED8 5BSWEGRESBSW
438,334,542 *2C65F0F70EA0DD6CB4991B87BAE0607F8647BD22 [email protected]
438,334,543 *2C6E0BF5331406F58CC7CD5731DFF87C20374E07 7THEMINE4
438,334,544 *2C60AA31AC778C9F342E442A34DF2EF002FDF175 DMX0Y
438,334,545 *2C6AAF0AEE04E7385AC095FA2C80FF704EB68E21 DN9BH
438,334,546 *2C60EDFD431B79A0288FC9A63E6C41A9005DA8E5 do%bo
438,334,547 *2C6193A6B814D70FF43A7F10235A19CDB55D75A5 5-hirsizliktan
438,334,548 *2C6AAF70E5F565AD66928DDBCE4B03C88032DD7E 5IAMLUCIA4
438,334,549 *2C6FE4C835F09A75336BB45F008B513C7DD1D81E DOMINGOKETTLEWELL
438,334,550 *2C6064F02889998FD11E106ECB58765D14EE2A19 domingolouque
438,334,551 *2C689C53DB579D0C6BDEED372640FE2F69E3F7B5 5ISCHIAVO
438,334,552 *2C6EBF7D9F88CE09F1FBA64A4F01AA53DFD63F26 DOMINIQUE MCCULLOUGH
438,334,553 *2C67E2DABDA18716513592D2B8A355CF944E5CF2 5knitting
438,334,554 *2C622EA13CBF4C685DE61A1FD153B1A5E79A97F0 [email protected]
438,334,555 *2C66F93FCE061686D7435C3E080B5CE2853790B5 [email protected]
438,334,556 *2C62D29AE70F734C145CA6E85591C5DBF8D19AEA donnaste
438,334,557 *2C63039764C60D900D74C7ACCC072BF7E2AD04A3 8CIBUPRETNI
438,334,558 *2C622E82D1AA3D88FC8DF40806CC38B1AF31115C donovanthomases
438,334,559 *2C6712D1D28BFB6A122EF551FC3114BC448193E5 DON'T-JUMP-OFF-THE-ROOF-DAD
438,334,560 *2C67F5C63EE7BBDE69BAFC4ADA7B976A22EA5C2D 8ELBANOSIOPNU
438,334,561 *2C615EC182EE117D2395A75C16AE7266EB65B20B 5OLIVEDICKHEAD
438,334,562 *2C673ADAC73B30B29A6358A24B56C158FAC37EF1 5POBIZEJE
438,334,563 *2C660F9D0A170ED76006E206832AD8B3C82BBA81 5PORNELLO
438,334,564 *2C6176CD55AB4CACD28694DBF8F24DC0679961D3 8glad-handing
438,334,565 *2C6A3A3004DE0C9785B5E5AEC1DD4C461078270B downand
438,334,566 *2C6D4DE59262600BE5CCD307062183FDAF7A2F41 8.L
438,334,567 *2C675FF68FD7585BD24978337D7FE43850F62D6F 8NORSTAT
438,334,568 *2C68D10C641860A5C4827E0BE0483052C6D30960 8orangish
438,334,569 *2C603D81CC96ED0B70D394D57194D5DC3E3341F5 8PAARDENA
438,334,570 *2C6A4D498E202661F6740A89D130FE5B28BB1D09 8PATRICKIRISH
438,334,571 *2C6E9607B9750328A967DCB05B74102E21441D59 8RYMDSKEPP
438,334,572 *2C61385EFC112111EFF695B2845AB81AC608EE94 8SJIWSLAVNAA
438,334,573 *2C65806C6DB5C317FB5BEB21A8BBC95000D7A54C 8VAATAAND
438,334,574 *2C650D9E3C3388120897B36D3A02461C9EEA8443 930288 SALASANANS
438,334,575 *2C66DF450DB94679733FF0495B112E112381F7A9 930485 likdOrteSittaksithalindeOdenebilecektir
438,334,576 *2C65483A2C40B3F1FAE4F839D460844772B999F5 950defd6133bf934a25754c0a96f948260
438,334,577 *2C6F063F8DB0BAF3D1CC4D31F99E8A14F543164D 99144 OMNI.1:18.MUTTA.TAPAHTUI.,.ETT
438,334,578 *2C637B50954211453407CBF249149EB43023DDA3 YA#W
438,334,579 *2C6C052B54D21EDD5E149033087BBB7D1F700A86 9BLUSHWORT
438,334,580 *2C687AAF6E4657A65B9CD1EE49AE0AC75C6FE4CC [email protected]
438,334,581 *2C6B6E499223E1BCBC66A0AA4E9E988E10A98CD5 yiming-ma
438,334,582 *2C682AFFD88B8E0F019C9A28D3BCC846CDDEE23F 5VAPOURIERS
438,334,583 *2C6BE09D4761413DC3D70C17DD13F165BB7311CA D,Q6Q
438,334,584 *2C635A921E023D73EC4BC22E6FE9146FF28CE631 draaiboek7
438,334,585 *2C6F21DCE8AB0E68C689FFBFF6DFC7133D41D2D4 DrKl
438,334,586 *2C664A3CB8865ECEFCA519ABF370522FAAF2852F 9REYNOLDSSEPTEMBE
438,334,587 *2C6012921A8037F5AEECA2699882CAD1CC639ED9 DRREADER7
438,334,588 *2C6889125384E37BB0403C07875C4B01FEB2F674 Ds3nfranchs3m3n7s
438,334,589 *2C6FCC2694857D6705468E890AB92D930138EAFB [email protected]
438,334,590 *2C609E8C3E81F845FC50ABF3EA116624AD24A665 DSBUJ
438,334,591 *2C62D2094C02A81F9E65DAA2D7ED707A5748C853 YL'M
438,334,592 *2C650196924B4BC582457B6D0E2517E51F8336D3 y?mb
438,334,593 *2C695C9E4EF8FFEFEE83D725F126C4A596AA19A7 a3k7d
438,334,594 *2C6CA888EFFD1EAD83D3D216FE5C0319836E4555 6CROZIERED
438,334,595 *2C68226E4E99DCDA2B4B55A439656D0823DA30DF A_4J/
438,334,596 *2C6584F09E787ABB08C08C32C606A566864BF3B4 6doorgeredeneerde
438,334,597 *2C6CEB794EE60F69A3192D6F85FE0D9E00816555 a5(8d
438,334,598 *2C6080D656D3F5E57963DB0CD20CA22524C77E07 duu5&
438,334,599 *2C6F2A4D161B3368B039759AE2D1CAD6E8C8FB1E z`{
438,334,600 *2C6E5A60BE415388FA007A56AF947E4E847151C2 ZACKCARSWELL
438,334,601 *2C67CED9025C441AA9B7C1AB650B5811EA4BE97A ZACK GASKINS
438,334,602 *2C6A7B0FE48561064956EA2885535F824A1CADAE 6ILUVMELANIE2
438,334,603 *2C617DBECDA39E975822DD5ACFC8783DF8132DD4 6IUGLEST
438,334,604 *2C6A6B21B13B0DB6C8C40F9E1B0D169E710E8C0B 6JALYDGHOCN
438,334,605 *2C6DF1E57FAA51446E17B329CA69ADC781AD3C4F DZCHF
438,334,606 *2C62E82B655EA7C9A40BC8797445C845AC402307 AAE`V
438,334,607 *2C62A6B0274A38F75FEAD05709C1461063251EEF [email protected]
438,334,608 *2C635C4E5D433072890FA1EA0D2493C4313D3154 ZEDASWEET
438,334,609 *2C6F4F47593B768B2E008F46A4BA09FD4F2232E4 ECCLESTON-23-0
438,334,610 *2C674AB287396C8D61E9DF4041425E1ECD59E6E5 ECDUD
438,334,611 *2C6FDF55BA0724D95EE0400977574B6012538EDD EDICCANU0
438,334,612 *2C61BE761B0F76AD692F8012D1A7DBEBB03C1E58 6THEBARTMAN5
438,334,613 *2C6E38E47267993D67531D0452FB515129B2C697 ABCDEFMIDORIED
438,334,614 *2C6BB3DBB5272CDDCE1945653E9CEEC0D232C4E1 6THETOM9
438,334,615 *2C64DAA4490BCB1A671353E9F5B18F5FB8DFD27D EDMUNDO.VOGELPOHL
438,334,616 *2C6483CB75D8507AAF22873D039D761939AE7C37 ABELTALTON
438,334,617 *2C61BBC72764F93FF1C2E9B94B383768361397BA [email protected]
438,334,618 *2C6E4CED4447F1F4BD00ABB45118F1BB9F900E0E [email protected]
438,334,619 *2C637ACE36148380FB6ED98D06D874B3C719F1E5 ZHUDAOGUN
438,334,620 *2C62D61D81481CCE762BB71466E73089412741A6 ab.nr
438,334,621 *2C6B0C70E12DC4D0B40CB08AB208B0661F80B6DE EGIDREVD6
438,334,622 *2C6952F15B91A7DD10B645FD277F05BC5489008B ACP<|
438,334,623 *2C685A93D1A2FA88EC07A38B201B5427493C3F85 ADELINE5
438,334,624 *2C6796B0B83E4F61E41EFCC327C8F9251AA25BD2 ad(ic
438,334,625 *2C6049B4BE82E0AC94C0897AD392DE3D27208367 elbagitil2
438,334,626 *2C68EE8F279E34577A5BF9865CFC8DC7D32DC6EC ADRIAN.MACKESY
438,334,627 *2C634AF2619FFA780663F0D8326D30EB946E9A43 a-drt
438,334,628 *2C6308F13CA7A9D507300FBEEF55852522EC7FFC ELIJAHMONFILS
438,334,629 *2C6B0959023E8219E64E6A2D62611E9F574B7FB0 7GLASSMOON
438,334,630 *2C6282455D64E2F0E442510B2CFBC0653C258002 ELISEOSTRAWBRIDGE
438,334,631 *2C6C9A00CB6985B0D389EF4E9CC6416D6A227096 ELISHAFEAZELL
438,334,632 *2C6E8CE02672A0BEFE035ABBD3C509644B5E15B1 ELIZAPHANIAN.BLOGSPOT.COMELIZAPHANIAN
438,334,633 *2C6586B48B80B6C39E6B88528D852BA8D7B4C0AA НАМѢРЕНЪ
438,334,634 *2C6FF08099F3B5C095CA880F89E83685AEA535F2 el-rey
438,334,635 *2C6BF4DCF90B2DF4C4DF92D2B5012AE312587C5F ELROY.VIGOREN
438,334,636 *2C6A3600BF29CAB680B88F01C9D35720B1EFD2CE ELVINSCHROEN
438,334,637 *2C6D0349DB7BEB8F55EB6B94C896A77B0A879FD3 AFRDH
438,334,638 *2C62DC6C0EDB098AF83EC0C98BBEEA8F5E21B699 7hiv-tartuntaa
438,334,639 *2C6B835AEC87B611FB5D9F7C84A4C16E5C9C4165 7JUMPACLAIM
438,334,640 *2C6C3691729F20EDA2089EE0341A2732BB1FC00F ПУСТЫГОРАД
438,334,641 *2C603664C200117CFB39DD335D59867AEC50E0AC AGFBP
438,334,642 *2C68AA18EDBBAB56593555CA027AF38240603C88 encowl?
438,334,643 *2C6C23B668D83E88FE3C873409B001593BD6D732 EN?H&
438,334,644 *2C6CAEBDA525C7480837A4A86D46B44642CB7755 ШПАРГЛАМА
438,334,645 *2C6F5A487A3C8676766C01B885FD9E9DCFA98F96 шумлянским
438,334,646 *2C64F3FAD157F35BA1FCD3BBBC61D4DC4F5FFB44 7RETROACTINGS
438,334,647 *2C684570E4B49D82BDF55D3AA531EB54C71026FA AIAAINC
438,334,648 *2C6EFCCF53EA7C2EC24E03D7B7599357A96B8A81 7SAWPRECEPTPRESCRIPTPROVERBPROVERBIAL
438,334,649 *2C6C60F92F70DED751900D717F26ADDABA736FAC A(iE
438,334,650 *2C6AADD1D5EC04BEC73D7692C6B8F3543DC1A156 AIU$=
438,334,651 *2C6F9EB5D787721A245698D15ACE25AE4FE4DDEA EOI(=
438,334,652 *2C666BFC1DDC792A06DCD9394C8D3213F076FA2F alaz%
438,334,653 *2C683F1838C3C6F1074CC887CCDF5E77270BB5A2 ERICHAMORIM
438,334,654 *2C68B313F72A4F87E107494758D7FC471461C6AD AL.DIVENTO
438,334,655 *2C644B48789D9EEAB26A5ED699DFAADE3AFD7D60 ALKALO$!$
438,334,656 *2C6F807C6319EA0D8B42581E91A7EA3C02FAC3FE ernestosiegwarth
438,334,657 *2C6BD056348F7A214CCA9008EB21B776D9860F1D [email protected]!Z3S
438,334,658 *2C683CB15F6E92C738BE3C68AF6F7BDF3193C52A ERNIETOPPINS
438,334,659 *2C60BEC3051EA9AEEA0404EB4AC55C4565B2BAA1 er!p
438,334,660 *2C62AE9880B26C691E984CD32843FC0AEE54180A ervinmao
438,334,661 *2C6DD77C9841D688B961535EB11677194163F2AA ESTEBANSHASKE
438,334,662 *2C64127D59B516FE90492C7A961B655473A90E87 esuser8120325171
438,334,663 *2C6372039EB3766373EEBDF00EF4A57EBE5DFBBD ETANCHOED
438,334,664 *2C67DB5EC7B4658C0FE2E7C752D429738BFA77EA EUGENE.FINKE
438,334,665 *2C66492964D1B276D908119F5226BEEDEC2A739A ALVAROBRECKINRIDGE
438,334,666 *2C6D609AF3E04C4C059411AEA0A7373995E333EE (ALWAYS).(FEAT.
438,334,667 *2C6A78B6212647009C834006CC178F4A939AED30 EUTRIVNU8
438,334,668 *2C67E719559F8E988E23671B06977EF7379E0F54 amal9amativ3
438,334,669 *2C6C06148A990D41E713FBC9116C1D6650EE3CE8 [email protected]
438,334,670 *2C63843C8E08966B2B4631121EC6E9AEF127039B EVIL.INSANITY
438,334,671 *2C66DE4F781188E03A61D1F04F98896295C3B953 evisc (satanic demo 1990 version)
438,334,672 *2C656251BCC384AC1F49F76660CB70BFD6D2B27C amsg8
438,334,673 *2C62516122847339C03CAF1BCCA8DFFE6C3B8619 amuurtam3
438,334,674 *2C6106AF0284BC52E35389262CB49451D4F5B25B Andante(BGN)
438,334,675 *2C6B59AB1D950F3EED7D84D90B1A064E8C4136B7 ANDARE.CH
438,334,676 *2C634A2BE1230023214263C67A6A0C3A8AD51D1D f1348+35
438,334,677 *2C659F6CB40879EA3E86A1E63D73B4072CE774E8 \.faaa
438,334,678 *2C60CA311B95D304F5B68FE5B2D084888DD48A4E [email protected]
438,334,679 *2C6936D35366B14046CA8612A57A07373B955087 FARCISSEZ
438,334,680 *2C6A374A0EE8B660FFDF98FC730D5C3BDD231EF6 ANITA-BARR
438,334,681 *2C6D5226E48B5D2AD5AC84AAA085656FE069577D anj_
438,334,682 *2C698BABAFF3A48995C8783A51623BB6F0CA1979 ANNUALLY.KEEP
438,334,683 *2C610B0B8836C77345132454FDEBE79906B10349 FAT.LIKE.SANTA
438,334,684 *2C60F65183CF6EA3E3F22E8B01848796EAC0066A ANUL9
438,334,685 *2C6FB9F3B0A0B574AF5571C9F2934DBF74610632 ANVM=
438,334,686 *2C6BD6946E82D261B9636AA8BC40C90600E6B07B aolmm
438,334,687 *2C66AA4457516B81336F82BFF97F4B6F9FC262A5 aoz&6
438,334,688 *2C64F9450E510A19A4B81CB4B5454CB516FA8FED 8IGUANARONALD
438,334,689 *2C6E750306765D2F5FB0B216569B06956CDE2074 8ILOVEHAL1
438,334,690 *2C6565702CE4CE914351384965E39189EF516595 8july1490
438,334,691 *2C6878A3780BF22FA9665072CFF47696F1C7ECC4 FIGMENT100
438,334,692 *2C6C46F4CB34D84915037359415DE25674F8784F a(r4c
438,334,693 *2C6C61AB33F95DBE573D04AE1AF71AA2B234CB5F FLAG_PORTUGAL_1616.S
438,334,694 *2C6B0D5F0374A5F018937BF799E3C2F906895E98 FLAT…矢印の色が全て同じになる。2NDMIXまでは色分けは無く、この表示パターンしかなかった。
438,334,695 *2C67B218B83A2DE245D17B48F9BBAF3ED7110CB7 aresnickmiteduaresnick
438,334,696 *2C695A2229EE9AD4B74ABE92AD157076D96901CF FLGELLOSE
438,334,697 *2C6F3307005EA67BF20F77296E1B7CE69D6076DD arlenstefano
438,334,698 *2C65DD55BA92F82FC6EB49ECC4B51F3D2919A712 FONDAVID
438,334,699 *2C607E4BA4D09C6153DDFB9A66512B2CAAF6C25B FR011C0ME
438,334,700 *2C69676910E96795DA5507508A2FE38AE12A463E FRANCISCOBULNESPOL
438,334,701 *2C628BF13D40C438028A041DD1E1423153A7DB28 FRANCISCO.GRAY
438,334,702 *2C61433A8A90FC9CBDF28E150C4153AEDD64C135 FRANKLYN.JEFFREY
438,334,703 *2C6B11568AE81FEE6B6DE4226C69E6E45234E4EF 8TREBORSCOTT
438,334,704 *2C6BC522836858A2B99269B50148185EBA87114A ASHTON845
438,334,705 *2C6087C9B0F181438586E43C61487A8E4FEBBBAC A?S%P
438,334,706 *2C642AB7B6D48C20950E41458EBE90F9C03BCD1C ASSDADDY5
438,334,707 *2C6A637E8D5722924EE3CB350C40D9487D4CB254 FREDRICAZATYAN
438,334,708 *2C6FC74CCF823AFB958A6FE3218A9025AF7490CF [email protected]
438,334,709 *2C6836359C59461BB43C3C4EA4F687E9005831D3 FRUMENTY
438,334,710 *2C66CAFC72C3F5F7EAAEDF7A52DB442E8B0A2CC8 ATTAPINA9
438,334,711 *2C66781F656A23B5484B16BAF163433717809C32 a&#u8
438,334,712 *2C6F94EC0E111DFDD3EE3C0DE4EC0097A139188E GARRETTLAFONE
438,334,713 *2C6CB72BB9377A752354D20CC338085CAFF1F44B GARRETT.NOWACKI
438,334,714 *2C698C89EB832BA3BDD0FBDC7EE80D3B18FC5AB0 GARTENSCHMUCK
438,334,715 *2C6D89752FFB7F307CD1CF0AC9937FA2010D10FB 983063 vuonna1998yhteisvastuuker
438,334,716 *2C69D7A8FD3E098971BE2705AF84829BB07F988B GATORGRAY8
438,334,717 *2C68A1899ECE83E6663810DFCC927369AC5914E4 gavin.blanchard
438,334,718 *2C6F1CC781663BA16B8D2FF83C05811508DA26E6 AVIAVITAMINOZ
438,334,719 *2C6DD52E606C9E668DC6BB713140BD4A42B8C047 9BUZZABOUT
438,334,720 *2C6EEC56F1CCDC9A393782C164216A7442D6D5DA GENNATAYLOR
438,334,721 *2C6181D80E57B638F220FC2C335084FA5886F569 (_0) o~ 0~ d##b
438,334,722 *2C652C63B65A046F60FCAA54F4B41F52D614DB58 )0(-o~o~-d-3
438,334,723 *2C617667C44DBC4BF982FB71B2E2C3E69B82F966 9FLOWWATT
438,334,724 *2C6747F91F7F2E7ADAF97DBC549DFC3E000B2500 )0(.`q----p
438,334,725 *2C6C27554D5B722A67B53022F9EABF6765BC47A4 az:ra
438,334,726 *2C6F3FDAB4A326BB3F53336A9E9680659C141FB9 GFICH
438,334,727 *2C6AD6E6FD44E7AE8A4CAE23634629D13F1321D1 B:0.
438,334,728 *2C6D50760BFAF77BCB6BDB94A12769E3608CE02D >-b0o~o~(====p
438,334,729 *2C6E057C070113C57022271B82F14934195280A1 9ILUVPRIMUS8
438,334,730 *2C634CF093543A615DE6D40A701AB5FA5FE5838B GLAUCOCERATA
438,334,731 *2C69A6D34BF53C885E7BA9CBD4A7BC2E2AC3D876 GLENNWARSON
438,334,732 *2C6A0AF19A50733DDA73BDEE873B50D1F181AD8C GNAGREVOS
438,334,733 *2C610ED837954720D78E24BF7C83E7D59A694098 1184662 still,thatisnotthefaultofthemuseed'orsay
438,334,734 *2C626BA81C49C8DB0CA5432BFD89A966922D4C15 1.192.192.192.in-addr.arpa.....in......ptr.....big.victim.com
438,334,735 *2C669FDD4DEAA52773CB44104D57C645C59B030E B!80J
438,334,736 *2C67AAAC38D9D6581F7586341C60E8BA6B399D48 b;_9i
438,334,737 *2C6C0C4CF8C6A6DDFC86B02F8520AD81232D706E GOKU_LEGEND
438,334,738 *2C6C5C74962CBC2DBE591DC88258796F2EF5D98E GOLGAST
438,334,739 *2C656E302A8FD06F74E24AA1FBEA556D739BC3DD 135interpreten
438,334,740 *2C6EFAA38686BAD77BD8BBAFB830D97A16BF3785 good-for
438,334,741 *2C6AABCBAB5FD648C68D17DEEA03EE295D0752F2 GORGEOUS (SCOTTY K VOCAL CLUB)
438,334,742 *2C6089558BB2CC177F9115E65AAEA201126AB94A [email protected]
438,334,743 *2C6AC04D7248EE1DB00F4882210D28E9010A331D GOYARABAS
438,334,744 *2C6EAA77F24B412C61E1608DFFF24F0B0EB9BD24 BAHAMSK
438,334,745 *2C63874B095A5654B8D2EE71ED91BBCE26BA1558 bakpirr
438,334,746 *2C6D9DE86675C9751555A7ADFFA7AF5BC4863442 Grandam,Iwillnotwishthyfortunesthrive:
438,334,747 *2C61E3A0AB0D64029C5BF00D393484A784A3EA3B A;)
438,334,748 *2C66563900ECDC260011985B6D19B4212A3B0D23 a0iq
438,334,749 *2C680E3B291D682062E92D08844F892552A699E7 gregkelau
438,334,750 *2C658C07AAD56E4ACEDED206D2B8FB367E9018A8 GREGORY.BARY
438,334,751 *2C643B4821478AEC812EB0F7543E965C7030B4DE GREGORY.WILK
438,334,752 *2C658BDB844B8E4B1E76F10C419A0F8F8FFBF072 greifenbronn
438,334,753 *2C6DEF4F9A1EA54D0A351860AEA197D2A28E12DC [email protected]
438,334,754 *2C6134792B410DE2E915DBB38588B717A1E4F7F3 G+ZK
438,334,755 *2C6C5F168F33C2B37FBEAEBEBA791F48F12BCF3D HADERSFILDAS
438,334,756 *2C6144ADDF749CCEFB02B86E551CF38AF3F1A8DC handdigitized
438,334,757 *2C681A2E02E3E92AB2B2CFB04403D359587F9C2B a5cor
438,334,758 *2C6BFDF23CE133DD491A3D01D415B3044EE5F895 a6
438,334,759 *2C6E30CD79A13271032BF9E961D8CD046EDA18D0 B##B~O ~o(00)
438,334,760 *2C60F74A317C242067999B6D3CFCF970980AD2AB [email protected]
438,334,761 *2C644A7A14C902146F33877F41E1249352DCFCBD HARYANTI.OTHMAN
438,334,762 *2C6F30C4B50545821A60E666E9976135EE3A712A haseenaparveen
438,334,763 *2C6F6477FB1C38DF821257DC181B0361A1AB6E08 [email protected]
438,334,764 *2C6727A5095B7367B230C88B868330D8DE6A2407 [email protected]
438,334,765 *2C63B819374187DC610838529D8961685596922B AAB5(5
438,334,766 *2C65AA0FD25603C81298CAC9665199A3E1517512 AACN{H
438,334,767 *2C641E0816C6D84B26CC6F78AF276AA5735D5848 HEMMELIGT!
438,334,768 *2C6143B91C77AB9E8FD29F1CCCA9E44CEDEEFF88 aae~!v
438,334,769 *2C68B26F526D64EDFFD997404F33C7D17FB4219C aalmoezenhuis
438,334,770 *2C6AB3ABCDED0B9821695BD08778435D5042AC1E 1dontanville
438,334,771 *2C6CD6A90378BC2254FBE7C62A79A3CC53C01787 AAPANNAH9
438,334,772 *2C628E8265134B40B8002CED53EC6F33DDF11FAC bernardalexakis
438,334,773 *2C6A267A5FC226316632D160B7A81408FAA6EE96 1ERDNUSSFRESSENDE
438,334,774 *2C68D75EFB4E0A5B6015FCC96C0B9E5BC57BCEEB aauswahl4
438,334,775 *2C6CB8D41CCC6EF34BAD2C87FB536E83BAC32823 Hey-ohooho
438,334,776 *2C61203BF520C3AB9459409F01188BF5BE4544CD 1.ex-obristen
438,334,777 *2C6DB53CE86160E865901C0A71CD75A8FAF91C86 ab.#%
438,334,778 *2C640D82C6EAA482781E862D8AD3DF4CDFDBD122 1.GELDBESCHAFFUNGSORGANISATION
438,334,779 *2C646C670E888846F18077406B6E046F3103ADDF BESINNAS8
438,334,780 *2C61EC6774F22861A028219CAA9F48195AD8D7FC BETOKENS
438,334,781 *2C61264D0EB87F3DD368B3EBCCB15B79D2AA009A bfefa
438,334,782 *2C63E365EB47949AD6B3DB975827603EA8E30360 HÓACHẤT
438,334,783 *2C61F8179857423BA6645DBC9AF2CA1A999A676D bfvsk
438,334,784 *2C68FA0C75E1D84E37EC6516187D10FECA4A07DA Bg$9
438,334,785 *2C6CF879A1887A0FF4216DAB5D836E4526BA7CA7 bgijn
438,334,786 *2C6041F1D7205A6FF1D1E3ECFF626D5542C40C94 1kaavoitussopimuksien
438,334,787 *2C60BA83F58F839ADF114B60BC42CBEC2070D733 ABRAM.HETJONK
438,334,788 *2C6F1DA3E37143A5C7D693F2FA99E32DE2F2738E 1KAHVIKAKKUJA
438,334,789 *2C681F12BFAAF536BC3D7353B453E09D61346E83 HORACE.MILLE
438,334,790 *2C64A5AA4D47302B0DB468FF71CFB1BFF6EF3AC9 b-hsp
438,334,791 *2C6AAF24FBF0A2CD2080BBFADFAB76CE8E53DCC1 houstonvincenzo
438,334,792 *2C665BF4BE162CF62A362008ADAD52C37F2466BD ACLPV
438,334,793 *2C6D3792A1E9CCBABDCFE57F9A0DDA8406FC17A6 BILLY-J-SHARP
438,334,794 *2C64570F37A7F70C9C7519978423433D3F37F9FD ACWFS
438,334,795 *2C68BCBE3FFD3E2FA932F60C8A0E0FFBD828FE88 [email protected]
438,334,796 *2C6B18ED3D6AFC3A4945E83C2B2C2F557FBDB8CE adioactivity
438,334,797 *2C6B8E9A760074AA345BC0B45BAEDED0D2E54A2F httpwww927kkuucom
438,334,798 *2C6C9A7560EB0BEA8CC09DFC2A48325A42E53B94 b;k!?
438,334,799 *2C6965A9888B8622490204A3139DCDF19192C3B8 B?K5D
438,334,800 *2C6593DF656934FCB1315E140245920FD7FDA265 B_K)T
438,334,801 *2C661FD5D4B36A5C2CBB2CCB03D8CF4E7091E4B4 1-scotiaa
438,334,802 *2C6A3B9FA97D7BB14E1A2E3D6F4DF691B2B585A3 Black-Country-Woman
438,334,803 *2C6E655055AA678AE4628C4495898FE249CC1935 blaineorsten
438,334,804 *2C6F822A5AEBF66B9FA3FA35DED57B56771EB06C A/EC_
438,334,805 *2C680C2BF7826AC3A7A375AE08EFE332C04D51D4 1-spagettiruoka
438,334,806 *2C6B1921985CB4C0E6E3C3AD1B81C98734FBEE89 1-SPORTINGIN
438,334,807 *2C6CC9D11FFC67B20AE0E03DA8A74903B899D42E aempi
438,334,808 *2C66E63A39631477561D4F0A34E4236D7E605981 afgeschovene
438,334,809 *2C6343CA014B3CF62ACD34ABAE9D93335E132E77 AFRANCESAMOS123
438,334,810 *2C618C9DFDB6B00CB0088EB3976FA9642D9C36F5 i0m
438,334,811 *2C646B4F15D221A4481C655901733C6A13D04AFF agraj
438,334,812 *2C6293EFE01EAA64148C0EEE6991D2799FA69B29 BNHOW
438,334,813 *2C657236D4A8F0D975586EC8251D134FC0A7E3B7 IAUTAV
438,334,814 *2C670727FAB3CD79C8E7330D74C8E4C138DF7F4B BobBon
438,334,815 *2C6ED8C9582BF3B9D1B2B51E4245FB84D7798A08 [email protected]
438,334,816 *2C67F61CB079D0A077269DD8897BF06885C23D35 IDEENFLÜCHTIGER
438,334,817 *2C6927A39EDD12D5188B65E1EEF68B8454EC9DF9 I'd-Rather-
438,334,818 *2C6ADEFA754F73336EE5806BE152BFF6C19FFC32 [email protected]
438,334,819 *2C6676DE367B0A3112FC057196840E02E7190F2E ah.!j
438,334,820 *2C684C5888E24C4481BC25E89FB37D618988080B AHMADGUZMA
438,334,821 *2C60FC082A1DE03DC9CF94BB28C2F02970323964 21031434
438,334,822 *2C6067FFE990E4100C616DC41C58CBCD74D823E4 AIGJ
438,334,823 *2C6D21C345F9915F14CE20CF1AD396067911DA35 ILUVSPORTS96
438,334,824 *2C606287DF335B5BCE9E93A9C2A323074128F5AF immoderacy5
438,334,825 *2C60B7E8148D528A9A174D2DBCE1A45498E1FBD0 INAGNALNS
438,334,826 *2C6E95429DFBEEF07CDB77127EE278F2110CC7D8 brendongrivna
438,334,827 *2C63010127A51BBA4122DDAAD9D9EAE734158CB8 alanluckman
438,334,828 *2C66274E14510696BA26CD8B577D4CC187F704A1 alberto.j.rodriguez
438,334,829 *2C67E7B1631BA0DDBD789B3B8E698D560689BC00 ALENFEKEZA
438,334,830 *2C65141365AD57D578AA344DC1C248BFAF16388D 2873308 OULULAISETSAAVATKORVAUKSENAHAVAINTOAIKAA30-40Y
438,334,831 *2C6C4FC8C1183BC82819DF9BFAA19602A702161E inspined6
438,334,832 *2C6993B70A54DABD5AC9ADC5ADAC6CE8733419E7 2939836 SPS-SOPIMUS ANTAA J
438,334,833 *2C6A276FF61476F322FFBD39021FBABC4DBA6270 2ASPENOPEN
438,334,834 *2C6B519DFAC4E3B9DD0D5866161F881134E2A010 ALIAPT
438,334,835 *2C60CFB3EB4262094371D00DA3288558956162F4 ALKALO$!$
438,334,836 *2C66046A67DF35E145C5676A5258C1546A22B3D2 IRVINGETTINGER
438,334,837 *2C6E7A7CC6BC5D5334D3F14CD441F116086A7DBA BSWPHIRSICHBAUM
438,334,838 *2C66DB8D36070D53FCBCDB4B6B769C3D02C2E3FB ISAACCHEREM
438,334,839 *2C6C25C27AC9FA0696CBD0101E649316E82CE1D6 2-dns-schaeden
438,334,840 *2C66267E831FE24DA5554F30DC45BA71097D2C60 2DOWERSES
438,334,841 *2C6A08D386B356AF8A95E69E5188EE5104A139E3 2FUKSAIL
438,334,842 *2C60643EDB747BF7D61B7ADF96083157BCB3F0E8 ALPANATIWARI
438,334,843 *2C615B0A10A8D020277687F08343BB28C676EA76 2menn
438,334,844 *2C6E55D1B0866719D550A2BD9EDE7C72982F5CD5 ISIDRO.SCHELL
438,334,845 *2C624A09DFD07D04B8B7673A659262998EB324D8 ISILLEE8
438,334,846 *2C6D29E0247161F1401E1F1020E801DDBFAA80D1 bu_jr
438,334,847 *2C66BAB1E4F5C1BBF13EBD449C72DC87CFEA9B60 italiana(イタリア共和国)
438,334,848 *2C669DC602CF7A130FDDCF5805ACF3CC0DE0AA6F ITISIST6
438,334,849 *2C6453669BC49A00CEFA9D52EEFB5103ADCED57B BURTONGANZE
438,334,850 *2C69C124E1A134BCB0742CAB2953304E6B85F133 bv3?;
438,334,851 *2C6E4F29266733933E62E39DE52E00D71A8EE0AD amirs
438,334,852 *2C60DF664DB6FDFDE19633A884CBBC58E06AFD23 AML(2
438,334,853 *2C649F5292291C1FF65B3DB44E093B314A78ED11 2VIDEO0
438,334,854 *2C62049F9FE0F1E115F7C5BBB91983A7FF4B6E42 ’ANAM
438,334,855 *2C6D903BB6559EB3C510E8A9E63FFC8CA71E3DB6 bz,s
438,334,856 *2C6048BB930322C699D6F636C9024782373B4D45 34CHRISTIAN
438,334,857 *2C61AB69FF03FBFEF886EB7C18706FCB551B80CE C1NX
438,334,858 *2C62E7D420100AE2DFE627380CDE0628CEF7E2F6 C2HA8
438,334,859 *2C6C7B561961D1D2BF6890A3C8A79186B5609528 c4/%t
438,334,860 *2C6CAA038A4A335DF675DE16FF7988A5FCE85AD9 JARRETT.AYCOX
438,334,861 *2C6C6A104BFD52D1178EE8F84BB8590931C70D01 C6)DW
438,334,862 *2C689BEFC978436ADDD108EA8DF34394F3C0A55E c%6y?
438,334,863 *2C66735359E6948C1570DA2431B8B95F358190B1 C72;
438,334,864 *2C6696FAA9D6BF2FF4020BAEA360217B5BF14694 jayare.barton
438,334,865 *2C6DD8E19B8C1614983BE66396DA957DED9BF085 CAG,!
438,334,866 *2C6CF2E324F16A54FC806F730DC643E3134B02C5 cajeputs?
438,334,867 *2C6F819EC11975470154F51CE6A7823F58BCB2CB ANHCHANGDAVID1234
438,334,868 *2C65AF197014A9DF3FEC29D244CEE0634F244B7B ANIMALSCARSON
438,334,869 *2C6C3EF6B59F4E1EE11740D9BDABB56F49BF7BB1 jeanine-nichols
438,334,870 *2C670844E29C7AE4E79B568AA2D60FD72FF05C16 JEFFEREY.BENDER
438,334,871 *2C68CFE241A59107648B6DF03FC2588A01249606 3-enemmyys
438,334,872 *2C6830CDCBE77365C01CB9B7F55F432C85FA399B JEFFREYIBEY
438,334,873 *2C608BC2C11DEDDD9D945B3CE6658C3603234909 jeff.soleta
438,334,874 *2C6FCF27C50215BA44C86DF78ED7EBA6AF229E0B JENMATT2
438,334,875 *2C6C3D74D34976AAE86F6E28FD58A3B6C206D2A8 jerrodvolker
438,334,876 *2C68AF9A90F25DF3D570C0EC7842DCB6F5730841 jgo8
438,334,877 *2C6D42622896515A29292407BD73FDE8DF3A782E JIMMIEWINICK
438,334,878 *2C6DDE5B72FD586FF09563317D6E01B1EDC30B2F JIYOUNGMOON
438,334,879 *2C683CC25E36FC394F2255567AF4D90BAB033090 J'KT
438,334,880 *2C6BD2906BEAB50043C6D6B01C99B5769FCA3697 JOESPH.CHARANIA
438,334,881 *2C66D4A2B2946CC40AADCEED16983F515E4921BC JOEYPODY
438,334,882 *2C60326AB18E690AF9045FAA0F9443C47C51C0DD joeyschaller
438,334,883 *2C6E5F6603DDB8AD1BF19766B5F8F12CF1DFD717 ANVILHAND
438,334,884 *2C6E4BF837E718D62CB9A98E59AC7D4BB541B0CD aoe#
438,334,885 *2C614BB9F40DD0E612ECC4200D473A2CA4984503 CARLOWARGO
438,334,886 *2C60ECCAFD795A078ED264DC23A48B34D69D0DC1 a#?/p
438,334,887 *2C66A293B14619BE7496E09DEB7EA29C9CA476BC AP1F
438,334,888 *2C6445C721C9575B9ECC3408AD90B40A6F31F503 ap=cm
438,334,889 *2C6109BCA856506397A423082E6223A47F645198 APPANNEREI3
438,334,890 *2C65D1100B487083755BC27CC72BE4DD1E14AF53 446393 SEVERAL-FOLK-GROUPS-DANCED-AND-SANG-TRADITIONAL-SONGS-.
438,334,891 *2C67EBE44C2AA39731C449FA2A861A89CA925CFF APQ+C
438,334,892 *2C6726E4648D526FF3237CF0BEF196F4DDCAFC78 JOSEPHMEADE
438,334,893 *2C6E48AC052E032F81289C7CDEC985D43CE8B363 4ELTSUBTUO
438,334,894 *2C62141B2CFE8C02D31E94EAE405AB8C3BCB6EBA c+b/3
438,334,895 *2C6D01137527AD77ADFE345FE34CC4DD4F295661 c+b34
438,334,896 *2C6C9A3CD1C2FFD0A8DE11939AD0E9EA8CF88011 CBL0V
438,334,897 *2C6545545C204B4BE436493E8EA60555A16FA42C c=/bo
438,334,898 *2C6D17511FF7B2DB3CC9D41F87D5D5A99F787BE6 [email protected]
438,334,899 *2C6F69BBCB2DE87004DFCE19C80C734B8EBB10E5 JUDICIÃRIA
438,334,900 *2C6C32AF6A89EF7B82116D49F7BED4ABB3BEA749 julenelee
438,334,901 *2C6270EFD4683B29C94E83695FD7AD23E74227AA JUNIERH
438,334,902 *2C6D0BAAF9CDBDA06ABBE2F9E5FA3F582272EC90 [email protected]
438,334,903 *2C6F6EF0F84F3FF3F17F389E087D4943C6EADBA7 just.one.of.those.things.(alternate.take)
438,334,904 *2C612A38EC900E6A507C28CD015D7F79BF288453 JZABALAOUI
438,334,905 *2C68CF5B1CADBA835510C936D0AC0BB0FEFF2035 K17837768
438,334,906 *2C6D9727A829A7C999C3243C7F211ACEE5076DD1 K382042
438,334,907 *2C6667A86C9999534EFBF41BA491EBAFBF95A3E6 [email protected]
438,334,908 *2C6E355667FB22CF640D8073FE0D8D6FD293FC3C A RETROSPECTIVE OF HOUSE 91-96, VOLUME 4
438,334,909 *2C6A87D80AB4EDA96967081329E99392F1468FE5 4KONSTRUKCYJNOSC
438,334,910 *2C6A75D7B3002EAF00753A478CC2C89CE4E1AC4A c(cn4
438,334,911 *2C6FF0FC9C8C9DCC058657886CE194075785A4B5 [email protected]
438,334,912 *2C61BC2F7E117643EB91629EB9EF99C994741B10 ARKANSASSOYBEAN.COMWWW
438,334,913 *2C6541F2302D5ABD60CBD4CCE099B3A51C824F94 4march1370
438,334,914 *2C6C85A6D15FC1A610E43A7DFAD969BC366C6978 CELF/
438,334,915 *2C62763DFA854CE373470DA7EC525372C3BF6E2D KEARNEYSVILLE0
438,334,916 *2C642060B9AF23C958CDA1255D3131F407DEFE43 [email protected]
438,334,917 *2C6C954C8377EC956830DB18C507B90DEE70CFA2 CERE8RAT10N$
438,334,918 *2C6346727F16AEEEE75642748A6B597B8AE9BBAD KENTONGUADELOUPE
438,334,919 *2C6559861CE48B654E3440090B3249EC6F3710E2 KEVLARLIKE
438,334,920 *2C6AD7C33E6DC3E90B83D3136F4AEF0900E2BFDA KIKK3N3$
438,334,921 *2C6CA2B77C643B9A62D5BCE00BE927FB089CDF5E ceu9+
438,334,922 *2C664565021AD709D2CA83B38FF499AF4ABC029D 4-SYYLLISTYEN
438,334,923 *2C6D285DE88B9DCB9060D36F35DA1B1476A318A2 ce/yd
438,334,924 *2C6C8D78F77FBB415C39573426AC7707D9301852 atsco
438,334,925 *2C6FC1FC8AAD944CFB9140176346E78D7B9B4D00 CHANNION8
438,334,926 *2C609DA8CC2E53C7C087A24E8C92EFB5D965B53C CHASITY-TOLBERT
438,334,927 *2C6450C81B5B5B0B72142A8B4985D77C79765072 [email protected]
438,334,928 *2C66934EB60DEC37709AF3E3CA45046CBEA0EFD6 [email protected]
438,334,929 *2C6B0A45BBC91AAA7BE3C6FA01F8DA30AD016413 augusta.taurinorum
438,334,930 *2C6F5E82498C09410A24E8489421A6B324C6ADE4 KURKLÁIČIAI
438,334,931 *2C645659D611F4398480B3809652DCA6BACCF66B au(r
438,334,932 *2C697757C3C6A16E95152B9711F9ED1CADE03F90 5DUKEHAWK
438,334,933 *2C6E2F1055D68B968432F5F6819CCE08D9021B87 kz}
438,334,934 *2C6698904E57BF9D8E77D7BDE3C0A1443C95FFD1 a"v6b
438,334,935 *2C647E0C92EF9FE3D372DA27959DC4B0BC5E4DB3 LAILEHÄUSER
438,334,936 *2C64DB87725B02DE34FB42641B12AE62D388D6C7 AVESSAREMOS1234
438,334,937 *2C65B9FB455C03FDF24766F6A546418FF6BF2198 lamontcrosthwaite
438,334,938 *2C617C8853739248404DBDE15A0F369DAF88AADE avps0
438,334,939 *2C6E32631BEB44EEDC49BD5FEBDC107A54A33C01 lankford5
438,334,940 *2C6C8114550E3D8B9A12728A95BFA8EC7D6980A4 CHLOELEROUX
438,334,941 *2C66867F13A74C5F37292ED045F885E448E264E6 5KARSJUKD
438,334,942 *2C6294192A051D14C09C3139BF23B26416F865D5 5KLHRODOTOYN
438,334,943 *2C6F8F468DD257CC8F109C1D867692E214080F84 [email protected]
438,334,944 *2C6630A439F70F8C5EB4407A1FB602BF3D9E5676 5protectable
438,334,945 *2C64C081C559F892CC3C4B85791E0C6FFC2E5361 AY=ZD
438,334,946 *2C68978E421C57B4566B4CA6394833CF619A10B3 CJS%Z
438,334,947 *2C6097CE5B1EE6C804ECBD8148B1D0A0CF25E8D2 leafgirl?
438,334,948 *2C6824B614BD4F743B38426C66B7F4336B72014D LEILARICHARD
438,334,949 *2C6E3C4E72786605FC78F7007224A8EA6A08D869 claytonfrevert
438,334,950 *2C66607C1E42E9BA0E5FB84223DC0AC5BDB54C67 b1xow
438,334,951 *2C6443EFE6DD8C61477168EE1B0CC20E3C035DE8 B28I
438,334,952 *2C6F0A6FD1055DCFB75D661E24132103A512C5F2 LEMUELSHUECRAFT
438,334,953 *2C6757F4BC2D3A06B5E3F56B1D5C0A987D046FA8 6DIABLOCREATIVE
438,334,954 *2C6D48FAF1D0C257522290D089E8034AF02C3374 LEN.SCHNEIDER
438,334,955 *2C6670A0C1D976EE1BF9CCFC49401FA20BF22398 cliffpumphrey
438,334,956 *2C656F290FA7FAC50B6B10FFA7C654252DF654B1 LEONARDSALTNESS
438,334,957 *2C62A6FE6EB7C7DD44DE6878B1A9F04096594A9C 6IAMTOBY2
438,334,958 *2C6516E586D0E7D7297C6EAB9067D44C087683DD CME5T
438,334,959 *2C6598AB26E43BB67D36FCE679B4D796B46885ED 6OFFICIARYS
438,334,960 *2C67749F682B0188547A070B6E5F3DE0B90F0EBF b+ad)
438,334,961 *2C6924B91B440799F49BB4B29D560850F4DEF4CD 6PRONETHE
438,334,962 *2C60F458AEB357BB012DEE2AEDD506537AC107C4 BA.F8
438,334,963 *2C6FF9603D34176348875E8DCD4F227A20EA37F5 6SIAKONIA
438,334,964 *2C623DC4EA73310FBA9BA1A8E6232CC17D2D67DA BALONCESTISTAS DE YUGOSLAVIA
438,334,965 *2C6E97BF3B5589530F42BDF45AEF9A036D6C5C40 LI HUR
438,334,966 *2C69CEC1FC98856EC3CE583D9567D491683B5787 compilation-nuclearplant-industry
438,334,967 *2C6409BD8EDB11FFE8C20B89FD521C98CE70E281 BARATTASSEMO
438,334,968 *2C6E11928AA34F8B26D60096EDBA76AF4B662A14 6.uudenlaisiin
438,334,969 *2C62392D6703A18F7FC0B3DE76D458D39773CA62 6verzenmakers
438,334,970 *2C6EEC7051F43DC4E3ABA54EEB82235C03BC9E35 LINDSAYBRUKER
438,334,971 *2C648596899B7FBD751C2F5C8E132722952E4149 LISA KADEN
438,334,972 *2C6BA84DD176D648CF130B897DA7A3F7CCF182BF bavq-
438,334,973 *2C60D97E7EC935FE7C1531521F4729567BAD94FE 7BABINAT
438,334,974 *2C690134228C591FC0FA3E55F2658C4124F66162 7BILIGIRIBSW
438,334,975 *2C659FFFAE58DAFA1257DE74B9C3728FDDDDCBCD 7CINDYDANIEL
438,334,976 *2C6C058627135B0CD9D4E55C4525E505A726C8C2 bb-w
438,334,977 *2C642718641EDE946883ACA987C80DDB9A683DD5 7EILISMCD
438,334,978 *2C678878054A51330CEFBDF1ECB17E5CA56F88FF coppercfis
438,334,979 *2C61FBB781F1532FF67F5252CF8AA123F79F33B5 cortezpieroni
438,334,980 *2C6E571E587CD6ACA6C97E75A4FE39DD8D7D5E28 LJHJUFZ
438,334,981 *2C65A8B0B77B2D6739BE82A64D2A2F312424A3FC 7NERHEUFH
438,334,982 *2C69E90250810EC2B9566A3443BAE0A6E1375DB7 b/d=w
438,334,983 *2C658E2F0D12A2575FDA749D562C7B092479E702 courteenhallstpeterstpaul
438,334,984 *2C61CB0E3362CED90C6DBF3D0878FC0CF5C591D0 Be47n9
438,334,985 *2C687CF24CDD2E7776E7A1434C751C1946768822 be9si
438,334,986 *2C63347B3F0FB68C9F4FEB157E3F79283B9C90D4 7PULPRAZERIDDLERINSERINSE
438,334,987 *2C6A7865B789164A558F33D17B0B2F97165A24C6 LONBERENDS
438,334,988 *2C623A23F332B03CC33561CA0D2522E515AC9941 7REFURINGS
438,334,989 *2C6922E5E12380230B2A49E220E797660ECF397E Beggiatoa.b/@/'/dZ//&/t/oU//@/
438,334,990 *2C697210C8F3829BFE17DA62D00FD6295CC20AD9 beheersmatige3
438,334,991 *2C680FD6482706A0716EE1CBCE914B270198EF49 belke154
438,334,992 *2C60D871E7BAAA7C44DC3884F6AD02552B915FF5 CPRWL
438,334,993 *2C66F1EF679D969866BDD70345EF5BBE9F4BF497 CRETTIN
438,334,994 *2C63396A2F6EE727283C926AAB93810F5CE5672E LULUGOLFING
438,334,995 *2C643F8DA0039BA33048054D701E791AB3231B9F LURVEYBENNETT
438,334,996 *2C6DA3A3389C6230497F70C9F2287A8CB8C0C8CB BENMED
438,334,997 *2C6404465A88CCCDABF06AC69537B94C4037E0C8 BENNYTACKETTE
438,334,998 *2C642A31D4D437F0621A551971B8BAFCAD145515 7ZATVORENIMA
438,334,999 *2C6DC1E7746DCBB58F1A9568452A9CA3C9B22B82 CsDG
438,335,000 *2C60E60882029C72CF3877AD7CA0DCA1356C5950 842438 SIE-KANN-KUENFTIG-BEDEUTEND-MEHR-FAHRGAESTE-BEFOERDERN-
438,335,001 *2C6543188DE2AD10AE9563565D037664B65ED6F6 c.t&0
438,335,002 *2C686B71C60F835ADED8B1A76DD976FFDE2DDB2B 88666 markus-airila-keravan-urheilijat-5756,7-+349,1-33-
438,335,003 *2C6BCBD9FFAE47C8964A65AFF0254B0B2C3C2C9B BEte
438,335,004 *2C640150376DABB2BC66911687D8217BA2A20156 CU)IE
438,335,005 *2C6D41386FFAE50CB6EEC6C8CB85F0A6233630EE c!.v,
438,335,006 *2C6FBD7BEC8A5E958DFF12DA02BF0D27135B72EC CVR,E
438,335,007 *2C6081F964712B66834C539BB748C4E36329DE09 MARCBELAND
438,335,008 *2C6AA1D155DD9E483BD2D10A5697D8B7F89A9E89 MARCELLUS.LEGO
438,335,009 *2C663C3B75FB016ABDE20CA574D0341BFA6F49CC BFUID
438,335,010 *2C6063380D5AF9300DA685BACD0661AE44FA5943 czarnkowo
438,335,011 *2C655AA12F5C4ED70B3FD43D14C24300A0FC5D5C MARIONDAYHOFF
438,335,012 *2C65D75B360944903E70F84C0411A7975E506C4F [email protected]+
438,335,013 *2C6C04BC2B2F53320698436E2ED6172C9F07EBD2 MARTINMM5
438,335,014 *2C6C947BB32FB24D016110FC63DBE3EAB890CB70 martytator
438,335,015 *2C67DFDEE69EE4C1E090ECA98DEE812FB5FFDE04 MARVIN.DUBSON
438,335,016 *2C66E7C1ED18AF7C422B58D72EEBEF912FBF4EC9 d7ib_
438,335,017 *2C6B4B2B9417BE50D2A72991C41283C5C0D3823A d9fl+
438,335,018 *2C6EE00512852278592D966479DE704734323BE2 MAXIMO.KIENTZ
438,335,019 *2C6B4267FA3D308F268319B77A32BA9076617558 max.robinson
438,335,020 *2C66E4496DDD5626B86125F157EBE5B9CB6D5EEE DAGZM
438,335,021 *2C63933F48752705C67AD425576C706F8B767E05 MBENDRICK
438,335,022 *2C6088995FF4950BF26D6FA527597B9B9C4B669F 8skipjack
438,335,023 *2C6D93ECF8468222A3B0E4F37B110F212299C0AE DANA.BOHM
438,335,024 *2C6A7FDF753CF75292FB7B4E446243992EA38DEA 8WATERCANNON
438,335,025 *2C67843BE568EFED0F30B76526199874342F91F5 923emilia
438,335,026 *2C6D6D6B47923CCDFF10BDF063B6F29EF8E87F4D 966434 samalla.yhdistys.edist
438,335,027 *2C67DD4B6134C4E3EDADDAE69D0C52145CF5245E 998813 --USE_MODULE-(-LIBRARY-(-XREF-)-)-.
438,335,028 *2C691DBA3C2C4E396FD1175A22E783B6E81AF343 <B>LISTING 3.4. A CASE-CONVERSION PROGRAM.<BR>
438,335,029 *2C6DB8FBB14CF24576E163AF0FD85B2775D57EDE bloedskendige
438,335,030 *2C618E4CAA9F379E3F4A4E5450C5DC15116D68D6 BLSERENS4
438,335,031 *2C685BEC1C75ADCDDB22234684F94A7036E1EE38 BLUES FOR ALLAH MEDLEY
438,335,032 *2C6BE78AAD42EDBFA64FDB9C3B98AC854FBBA359 BMAKS
438,335,033 *2C60D02398A1ACB63F906D087BF64473A2E701A5 MENNONITENSCHULE
438,335,034 *2C6DE09C74172419B0A2A0F6F68CEA8636F035CA MERRILL.MARANTE
438,335,035 *2C6C46E0B43EE5FA87234FCCC4E778CBE97D9A52 9BSWXDESCRIBING
438,335,036 *2C621A9ABBD1617CB635A8412D9E825D268C2978 bmn?w
438,335,037 *2C62FA5D10BDD5F5B73D51576C79DEC23D4DB52F ‘MÉTAPHYSIQUES’
438,335,038 *2C6F524E7DA8F56F04BD00B8EA1D8807AA3AA145 bn5bk
438,335,039 *2C60CEBB7DF9D48CBB1C4208C27133B9DB1A2706 BNbZ
438,335,040 *2C67D7D1B9DD59F05C2F50407543D1A7CB843DC6 DBXER
438,335,041 *2C6D04613DE6005DC06473386B44FC87256B1D73 michaleamass
438,335,042 *2C6158F93FD6D8673273BCD151DF5C5685425919 dc3!
438,335,043 *2C6DB00B98D5F12B38A1118F68FE1E37A6697ABB BOJAN22
438,335,044 *2C6C5E4413495EC45F89903390D6D37963E17D30 MIGUELSILKER
438,335,045 *2C6B655CFEC4FF07A90C13C5D0F660CAB19430E0 MIKECUNIO
438,335,046 *2C69155F24A47999919A835D5C81B086783C8C28 mileseskin
438,335,047 *2C68E6B53FEA1523CFD995BE8B299BB69476C980 DEAFENED
438,335,048 *2C64A0307931ACE4F280907A31E85EFAA1D72D28 MILONGA DE LA ANUNCIACION
438,335,049 *2C660C07B251A67238036FA28AB825E36503B49A DEBBIEMANN
438,335,050 *2C67A8DF20575C5E58BA0A1605EBD7CFFEE879E9 9NCHAYITVAA
438,335,051 *2C6D975A4324551717F29750DC0C0257217F3578 D)EE(
438,335,052 *2C649BCDA1DC6CE80298322603AFDCDCEAC501E1 MINETREKED
438,335,053 *2C6D9F6E2376537608380046D7346536C7417D8B DEFONCERIEZ
438,335,054 *2C666391F38E5187531E09DE7403E3309B517AF9 9.SEILERBAHNWEG
438,335,055 *2C60AA849ED37AD1DA016935E4E6F7403D107C95 mithleshpandey
438,335,056 *2C646ABE35E210C41E433846DDA5B006487F2800 demetriusauwaerter
438,335,057 *2C608D262DC19D1F77487C050F90167126489256 MOETNUNEZ
438,335,058 *2C6AF2D380109015D0C6674B1E80CDA0346698FF 9YUSDBTSR
438,335,059 *2C6BE6C776AE37BCBE6643EB5BAF60A6C46CD371 A;)
438,335,060 *2C60AF9509B21CF6ECF01D9515BF3745C724DB51 A1BIN3$$
438,335,061 *2C6067FBDFFA289337977319B2275E5F282D520D A1F""
438,335,062 *2C61B43B19891E05C08718BD262F2E2D422BD6F6 A1ZQB
438,335,063 *2C66BDBE9F62430DCAF6F44EAAC75A221AA28CE3 a4aq+
438,335,064 *2C665B1DC04AAB24FB00D9EC9DF9E32D7287F6DF a6
438,335,065 *2C67825D0A3077AB9B657C0DA0D16FEFE8748AAF [email protected]
438,335,066 *2C67760681B119D62D7DBF346AD88BC71CE4FD02 a9bgy
438,335,067 *2C6065BD1D801F7FA8386D98BC0093DB8762907C denisse253
438,335,068 *2C6571D41E269EF3054EFA6A073FB9835A393ED8 MUIHPARG7
438,335,069 *2C6A9C02EC992E8B74ACE342238D8018D3816161 munkelt7
438,335,070 *2C63A45FDC4E3A33E3445C9EA1B92472AA540CE4 AAA.QB
438,335,071 *2C6B8ADC06BD2CC3D1AAE09AD85DB44B1A76D0A9 MUSCADETSVRE
438,335,072 *2C69A81197E77949F5CF0BAB2C61A446A5CC7010 AAB\JH
438,335,073 *2C65C66F8B0AF759FD1A0EDDAE54E9C741D9AD74 Dexter Raymond Mills Jr
438,335,074 *2C60157306A9FC0F98F80897874A78F810756777 df4wp
438,335,075 *2C655EA57C37E9B56C5C654B0E5013567A723854 ABADIA-DE-SAINT-GENIS-DES-FONTAINES
438,335,076 *2C60910E475D84B2C6A58E7FB9F2DF5A74A5F8B8 brenda-hemann
438,335,077 *2C61FD902C75143302EAB3AF3DFB9D70D150FFA7 BRENDONULLMAN
438,335,078 *2C6E0DD234619576974DD2D77DDBE74647582BA6 nation'[email protected]
438,335,079 *2C6326B68DE753D5162B3FD54523F159E88F93D9 abh?;
438,335,080 *2C663B651599A0D7C158CDDBD21EF822C6443E8B ABQ$C
438,335,081 *2C6D756C152AFF47E5558C538061C45852DE8500 DHANI-BAYAWALI
438,335,082 *2C673DAFF669AECF31E0F485BF5FCBC0F9369109 dialyses
438,335,083 *2C6C3D9EDF80B3D6CF6E899FFCC9A46C32EF2FEE ac:#n
438,335,084 *2C6C312023AFE06C1B1F059EF249542E19135ACD BST=N
438,335,085 *2C644067D45B60C5F53FB00643487C2E24E0818C BSWMICROFIBER
438,335,086 *2C68ACE9B56B99EB3BF1D660805AED7324A99105 AD4FS
438,335,087 *2C6125953CADBA90631CCBFEA7B0F86B32E38D42 adam.barratt
438,335,088 *2C6ECA68DDD4826FCA8EDF379031A844D56CA629 BTH-P
438,335,089 *2C66A24294A0B2DEDC27998854C141DA03FC462E adeogia6
438,335,090 *2C629E7857CB6FE57DC8767B9082A345946505BA NICOLASLANDRAM
438,335,091 *2C60F7429B6A5C422CCA2F16DEFFAF49294FDC25 A"DGU
438,335,092 *2C6472B4AB078508738AF2027E901317378004A6 DIVXXVIDWMVIPOD
438,335,093 *2C6205DEF5761638553DA457A44465F5B76A8903 dixonvil3
438,335,094 *2C6D03383D62701C2E7C599C3F9CAAE2D4E4B994 nigellotson
438,335,095 *2C6CCA35DD8E6031AA0E096D7B5C2EC49176B6B8 nigelzelinski
438,335,096 *2C6C8CDAB717B2F048574BDF044FDC6B5852E821 NILESH.BENDALE
438,335,097 *2C6457C9A9BDD9F15649F2F49A77F1469DEF2E02 ninjar0x
438,335,098 *2C64675F437941E8BE03A7F506CFAA3F14EED4EC D.Kb
438,335,099 *2C63539C124D1B84A69825F18EC867E57826E9D1 NOBLE.CALLIHAN
438,335,100 *2C62E356D9A74706285327DC724CBBFAA79F10D2 ærkeenglen
438,335,101 *2C635F2365FB11EA9293B04041EF48914FB53220 dnll
438,335,102 *2C6E81903CCB0C81CC275DBCC5E4C978B5F6A308 NOTRANSLATE123
438,335,103 *2C6FBC8B9408A59A0F84DE68B2822BB9A3466CD1 DONARYK
438,335,104 *2C627F37AFC2EF195F7E49EF5B193DECBEC5E5DC donnieengesser
438,335,105 *2C66289CF591A2F0535BACFF9ED581920D8503EE DONNYBERGESEN
438,335,106 *2C6351DA8DFC207BC1EDF71E2E8921509B6D304E donnydonnerberg
438,335,107 *2C6C8A45F0C8B037D56676291ECC95D6E7B66747 DONTE396
438,335,108 *2C6BBFB6F1A3D458FFFEB409196A03D368C3CCFD NWSRNWSRING
438,335,109 *2C6ABF436A20330B9E5A5DB49ACCE47D7E081900 D:OW:
438,335,110 *2C6A7435203DBD30B25A32EFB03AE610C88CB7B7 OCTAVIO.VATES
438,335,111 *2C618F71D1508D1C2A32DF496AEE85F32DC5EAEA dp"/w
438,335,112 *2C6DE3EB1EFA4415E19BFA72A31634192323282B ODIS.CORRA
438,335,113 *2C650BFCCE2FB8F7135451D53DF32A921F65AC2B OFFSAIL8
438,335,114 *2C6F6459B679C8333B3AC218C47F0ADFBFC26354 AGu:
438,335,115 *2C66965D0A55DDCA112DDD1D13624A59D1669146 dr1ez
438,335,116 *2C6C79E429869CE2DE1FA126086B6393B98AA4BD oliveraespina
438,335,117 *2C68863A43A46ABD40FE2EE3C5BDF5650F18232F olliehoss
438,335,118 *2C6EE5A5FCF9A7BFACEFE3F53344B2943CA7B97F drake.weeks
438,335,119 *2C6A889C175BFDE6A715C94D107BF56D88D74F02 omayor
438,335,120 *2C61960F4DD4DA33C2E04DDA46E5781F15F8EA90 AIGJ
438,335,121 *2C6AC4A6F00317D41787D5E3A060B9BE031B41C5 )O(~`.(P
438,335,122 *2C684441952316C8683C082D9236E93F291D61F0 c%;."
438,335,123 *2C6BB9198290DC9027C16FDB8E68D5D4BC5E72D8 c0<q
438,335,124 *2C63086F39797AC937FC9A33C0290A05D53D738B c2h78
438,335,125 *2C6D1371090FEF3AC2693870C85AD65E42A7EE1D c2;l!
438,335,126 *2C6CD8DFC64920A5E91953B83E9504D566AA99B3 C3F$-
438,335,127 *2C6C190F250725E7B8AAE4AA6ECB609B772A7AEB Dv1O
438,335,128 *2C6990C1E6E7EAB7C321EE830B205BE6BD0FBEDA ALBUELED7
438,335,129 *2C63D2360FD8FC984532C94AB8FB9E0DEBC21331 C6HTA
438,335,130 *2C603B97963F4672ACE7D5A0C99AB474ED582814 C7co
438,335,131 *2C6BDAA1D887600FF2BF796A678BE8AC60E7806E OUZEL
438,335,132 *2C6A0A1039606C584A11108933963BCC85606EE9 ALEXANDER.BOUTOT
438,335,133 *2C6CFF462E0DC6E387478AEB55B88634A1893C4D dwightfuents
438,335,134 *2C6C63268A9E25703B0284562C2FC48ABC410C81 alexandra.hornyak
438,335,135 *2C6612FAB023FE5667876D036551EAE93444DA5F O$W0
438,335,136 *2C6FB6367B08ECBE701E165D6C8F11EC656416EB alf9
438,335,137 *2C6E790B4825FB415984B3FA0C49BFEA4F3A01A6 algg1
438,335,138 *2C6047C1D15266E9640DC48BA6268F67BB7BC458 p3n0l0gi$t$
438,335,139 *2C636FB5C5F326CF06FA4EA01DD56CFFFB5C0116 cannychan
438,335,140 *2C609468E8F61DD44BB6236FECBEE6F3CA2EED51 ALPERSICOS
438,335,141 *2C62F946CA338EF9B533C6C7ECB3FE1E679019F2 cara284
438,335,142 *2C657CD78EC02B309F1B51ECCE26EAEAA4195672 carlosalvadge
438,335,143 *2C6E636181F36B91E06AC79FD93F6DC4B6CB0174 ECONOMISTDIRECT.COMWWW
438,335,144 *2C6CD206E6FB2D9D93927101FD6A79874632AE77 ec&wi
438,335,145 *2C6F9BC488120C9C5D3CE61435F25C0FCC12E10C ALTON.EISLER
438,335,146 *2C6C963E740430EAA412D786C75C47C00FB7E46A CARMINE.SHULER
438,335,147 *2C62C2C3ED7D679A1FE60A74355691A979849E73 ALVALAVOLE
438,335,148 *2C6AD7B5B8722C7223C807742397732C1620EE2B PARACENTE515
438,335,149 *2C657A59D316872DD549B000452F85112C558B79 AMEDAGEN
438,335,150 *2C6544BB7D6C24EBFE42544A894B4A40C644056A PARAHATGELDI
438,335,151 *2C6B124B3F8C8C40F1F82568AA0D1FB9E5D7417D carrollconsentino
438,335,152 *2C6300AC75083A85F6AD012FBCA95C533377C1A0 EDGARDOVANDORN
438,335,153 *2C63DCBC562EC0607AD75F77D67116E963CE1D69 EDGE CASTILLO
438,335,154 *2C625C4EFD4A6E9135A93E6EDDCDCDD53825F337 edisonnewmark
438,335,155 *2C68E5DE81CD49A09ECD0CBCEBA609B287FA9037 patriciachemell
438,335,156 *2C6BD52A7AD5BA9F1AB29FC3BD7601C041C67A52 EDWARDLINDAR
438,335,157 *2C6C99A67A434D0D32AEE19F1E16CBDFD0E183BB edwardogarratt
438,335,158 *2C6A678A76D8CDE8ECA5CE6B3243FDB994C043B4 anandbajpai
438,335,159 *2C6C0DDEE067A2D98123D6A73115E0FD77383EBC p====b~~(00)
438,335,160 *2C66E6BA29E9800C86C07574638CB9E5D0CB4331 EF,MT
438,335,161 *2C6D5E4F922264F9B22D405696AC7257A0FF5D42 caup=
438,335,162 *2C6FA5930C8449CBDEF13CBAE15D8B5CDE08642C ehfao
438,335,163 *2C615B90C7B38B6CEE969E22A66D26198D844825 animedia8
438,335,164 *2C614266C3193D0B94E40E728CE12723A4F56338 AN;K!
438,335,165 *2C6FA0F0802DF9DFC77087224270984D397AE767 C-D6
438,335,166 *2C63D56BE4F5D0D3574CF6C49A7B307979161217 PETERGWILSON
438,335,167 *2C66CD680FF9E3C2D076015B66BCBA66930DAD6D ANNIKA RAMOS
438,335,168 *2C6D785FA3AB55146E5B440F511BAA7C7AC76830 annulatin
438,335,169 *2C69FFB031839A047C5D9E6683274DB90FEF8AF4 ANTIONESPAZIANI
438,335,170 *2C61B4962571CE8C3B9795B39D23F9FE26A36429 ANTONIABALFANY
438,335,171 *2C6DA51F543F5C0DE3C67071E00F9030706F2044 ANTONIA.WHITEFIELD
438,335,172 *2C6678992B2CEAD9729866BF9C3292F5B3D0FA09 ELIJAH.CARRICO
438,335,173 *2C6DDE89E58F2441ADEF85A4AD87DB014FA3B49A C!DS0
438,335,174 *2C6C2E93E4C6994A2931BA5A7BEB53CAD1C80938 ELMERALBROUGH
438,335,175 *2C699E2519021FC1BD5A838130B4EC9B39D9FA17 elmowestendorf
438,335,176 *2C6C303350B00ED8EC08D73B4C63317A8A335CC1 @[email protected]
438,335,177 *2C6C13EC033509ABC7E48DD0FEBD6A7BB411B1C5 EL-SOLDADO
438,335,178 *2C6D9262F66AED722C05FF1E475321E383C2B7EC APSKD
438,335,179 *2C633C3921A7C5E3B24B0C51D138B1233C6D2E00 emilie142
438,335,180 *2C6A7311ED5433BFA742F621080422F6695A1C2F CHAMPIONNATS-DE-SLOV
438,335,181 *2C601836387DA2C65C410D374EF035E4EAF80D3D EM,SP
438,335,182 *2C64D8F2AAFEAC602DB97B40AB76EA64A4CC782B ENEHARNAGEX2
438,335,183 *2C666256B12DED0F6AC7CAC93B28DD5E81D1D4FC enloehnes
438,335,184 *2C683FEC8B617575A7D4F033CA198ADF1A46EEED en-mi,-a-granada-ve-desde-su-trono
438,335,185 *2C6A0F4EB42315ACD2CD7585F95BE029C575748C porterrattler
438,335,186 *2C6EA01F3414725FD2A8DEA3476B7140ABD94611 P>~O.Splat!!
438,335,187 *2C6E0D35EF93E33897D465FE19DE741D63AE8491 ARELLANOSCHWARZENBERG
438,335,188 *2C6ABE3564F400460E7F05C873FB10BB1FA67CC8 :[email protected]
438,335,189 *2C60402FFF53DA2419E1F016CAC9E15893BDB182 PRAKTBYGGNADERNA
438,335,190 *2C6294498D5D56678041FD204B2757E6182C28C8 preaching-praying-singing
438,335,191 *2C66274F4EAF40348AF8B1956D540D7208319E99 prehhosug
438,335,192 *2C62D0987E52027EC144BB889EC933C050DD3713 PRELUDES,BOOK1:VI.DESPASSURLANEIGE
438,335,193 *2C6B0A45D862B9919018AA65902B1999630DEE5A printstruct
438,335,194 *2C67F9C3F8EFBB0ACFED015F0D8D17975AB1145E cherylflash
438,335,195 *2C631AC57ECF3DFA39385137745731155E35B7F9 ESK;5
438,335,196 *2C62D0BE4DEA5C6F3D32DB5ADAC71BDBAE5134FF [email protected]
438,335,197 *2C6AED7F8597D6007BF623172783DCA832C1A486 christianwiechert
438,335,198 *2C6267007E5D2135D41D6F97DD76BAE7E35D0903 ezekielminshew
438,335,199 *2C6678354DAC1BB8E1552FB961B499257213DA0A ATANARGN
438,335,200 *2C6F68B86B467D251AF0C4BFE210023401B314D6 CHUCK222
438,335,201 *2C6588F146823D7DD718D5C4F55EF7305B3EA8AB QUGW
438,335,202 *2C6C296021E0F783BFCD5AA98EF2AEC9F2006A1C [email protected]
438,335,203 *2C6B9D0A5874DD16A187D3060C29B2F202611510 QUOTIDIENS
438,335,204 *2C626D733F6877C4129E106DFFC2C2D1E0001F02 qzxg
438,335,205 *2C630C1AF77BFA36AE9065E4734E6D418B872BA4 Atto-IV:-Quai-grida!-Orrore!-Orrore!
438,335,206 *2C67382A92A883E8B6483A9C74AD3A9C2F2AFAE6 a$tv
438,335,207 *2C697AFCE8EB68094687218749E9096C1634AA1A CIQ4
438,335,208 *2C693AA9B9FB66211386DA02E7AB67078941537B RACESCHI
438,335,209 *2C61CA455B6D7E904F092EA168B9CEEAAA3F6E8A CJ=4C
438,335,210 *2C676861D4BD075BC78501DFC6A7A2B0776AA21F FEUCHTMAYERPIERRE
438,335,211 *2C630BE6A26F547F7103EAADEC63DAEB7F193874 CJKF?
438,335,212 *2C618F5213A74FED364BD5560EAFA0F4EDD7E33B FILIBERTOROSIN
438,335,213 *2C6021D457E26CB045397B1AEA2AA18C80E5CDAA FINALLYOVERYOU
438,335,214 *2C6EAFEEC6B7D7E386E44F49006EDE08D07A6231 [email protected]
438,335,215 *2C6B2FCB509E71AC05948995191198156A01127B RAJ TOM
438,335,216 *2C61A75BBF7F322AC2DC4BD5155650BBCE4F448A CLAUDE.DANCE
438,335,217 *2C6C826E62CFC418D1F9A88FD8BE83609006E8B0 avb$6
438,335,218 *2C6BC3CD736DA89217C6EF81C53BB62465F11F79 AVIV0
438,335,219 *2C6091AEF7F103FFF17974FCDBD861D376007B9A RANDOLPHTUELL
438,335,220 *2C62F19C583036AB9F1A2C9D54559874DAE17FA6 AW3MY
438,335,221 *2C6B52D82D87D16A109A5FB9D9CF744A337DBF8A fmontaulieu
438,335,222 *2C65100262DB41468BA8EBDA47F94F78AEC41BC4 CLEANSLATE(LIVE)
438,335,223 *2C6EACCA1C68DDE2D8557CC3C72607690F8B40FE FONTEIA8
438,335,224 *2C6FA4D6494F9DCF475324FB21B722D8CFB47C41 C;;LM
438,335,225 *2C66BF2A130E023D526B6B2BB7A2700122AB6E8F CLONES74:OATMEAL
438,335,226 *2C61D9D42108D421E65FE1D527BD20BFFBF44F31 b0&n)
438,335,227 *2C6FE320FDC7E5F56BFEC15425135FC1823BEA24 B16669
438,335,228 *2C6BE8F86E87D94AD7B966D20D60842C742C2ACC FRANCISCORZO
438,335,229 *2C65E2CAC759D5716C91700407E33A243ECC8C34 b:2jv
438,335,230 *2C61D49F76CC51BD50EF1F461D7651EF5A2CBFDD FRANKEJBYPOULSEN
438,335,231 *2C60D14FB78B29829CAB4F8294AFB61D08E1778E CNLSQ
438,335,232 *2C6D3839EEB9BDF6531F5DF8E1C03616EA7180B0 FREDDIEMANSUR
438,335,233 *2C60F93C0E14A25E5613D8F5E771E9D5A3069E1D FREDDIE.WERNING
438,335,234 *2C673940FF1AEAE832BC01BF08158E533F7D6A05 c"nzm
438,335,235 *2C65DF078CA79E251D1D72FEF5B7F909B5BADFBA FREEMANGRASS
438,335,236 *2C695B79A399542220B2DA9F41DBCE8E9E2C4140 [email protected]
438,335,237 *2C637DEF018C5C98D07FCFE1A2FA57BA64A0D8BE b3q9i
438,335,238 *2C6FECDBC8031839767B8D03CE2936D7F0732AD4 registercom15
438,335,239 *2C6B1F1D3884650839EE39AE2E3F99A4FBFBE865 B7JKI
438,335,240 *2C6DED821B82C71EA8405802A03AA724D8460C26 b_a8h
438,335,241 *2C64648D153C7EC15117691F3D7D17F045BFEDE5 fw?+
438,335,242 *2C6682F9530F5A9AA959BE665F57845DBFD61490 FZUIBB
438,335,243 *2C622D93713CCA94FB2791F53CE1833DFAA5A73C congregate.A:
438,335,244 *2C615EA6A052C7D989DFEC89B85753581A7D10C9 CONSTANTIN.FLORESCU
438,335,245 *2C69A8B289E17A7E2BAC87C9DC95D40B5A6A333B BANDITOLIVE
438,335,246 *2C6101584C2BFCBA17DEFBFA9EE03100CA668E44 GABRIEL.KRAVETZ
438,335,247 *2C6AD1CD5942AB717C61621FFB2CB90188005CA0 RENEWING
438,335,248 *2C68BD3105D3AF150DB8E8F6A19CF7BED97EB4FD GALEDON
438,335,249 *2C68448F797B8CCD0FA11B79663E31C2444DB8D6 BARRENNNESS
438,335,250 *2C6493C1C753E562891ADF21F7D8D62643AABD46 [email protected]
438,335,251 *2C6B254408237A121720AB1FD3241A4F845B0ED3 GAO_KENSHI
438,335,252 *2C6FF644973BEC3AB46875A11F1F40F3F394EEE4 BASEC
438,335,253 *2C60CB1E83ED0A96924538ECCBFAF84B333C5A86 BASTEREMO!
438,335,254 *2C644C8D9EA74ECFD33E43C76083026F3173B17E BBADR
438,335,255 *2C6888662746BC68870A1BC6C5665357249DA64D GAYLORDBOYLES
438,335,256 *2C689750E715E7853084F35039A07EA125487F35 B-BL:
438,335,257 *2C6E9A27FB1CE806D82151D3968BEA33E3514B6E RETSIVK4
438,335,258 *2C62AA1B4CBCB2A23050D8D12C6781C2B355412E REUBEN.RAMIN
438,335,259 *2C61C8E92AD91D7964EC97B69F4DFDCA7A33EAAE GENERATIONENERGY
438,335,260 *2C69C65F47A3C7BEC92326EBDA2055178D2000E2 [email protected]
438,335,261 *2C6CCA9788F32A095BE8FEB5E252B036AACD428C GEZAGDRA5
438,335,262 *2C679C68FD63A0023BC3C4458BD457CC45432D53 REVRAMOSTE
438,335,263 *2C6D8C6E418D612C0B278C154475BF8CF22DEE21 GIRARDET-10-0
438,335,264 *2C67D035E18160DE9D3F5953E76F5B5847C65132 BEFORE-THERE-WAS
438,335,265 *2C6829FE1C003B47E7CEBEADAFEEBD95F9E2009E CORILACEA7
438,335,266 *2C6D6E36A29BE34AE8493E9C32F5A2030A0F3013 [email protected]
438,335,267 *2C6BC40BF728C0343324AC6CF8949C0F21A0F5B1 cortezpirnie
438,335,268 *2C61378A0F7A10FE0CD253042553116A32FA71FC gnicaep8
438,335,269 *2C6EE048A1C67829C6A01B4D9D284196DDFE522B Could-Have-Been-Watching-You
438,335,270 *2C6B50820C0D47450C734F192FFDB4CBFA7F2EC1 rickieweisend
438,335,271 *2C6E1EDE2610D0CCBB4EB83EB39EF13E0CC59129 [email protected]
438,335,272 *2C6CAF3325FCB1FC8751CC42033D528638D5018E [email protected]
438,335,273 *2C6572FF698861B5E99376CDB994CA67A688C6E3 [email protected]
438,335,274 *2C6A26E230985DAE892991BB9C612FB042627218 GOOD-KING-WENCESLAS-/-ANGELS-WE-HAVE-HEARD-ON-HIGH
438,335,275 *2C675DE59FF40767DF499AC71A4889A7C5330B38 GRACE-THEMOVIE
438,335,276 *2C669B777DB4129F7C980CA38FE8520485214169 [email protected]@[email protected]
438,335,277 *2C6DF30671BF9AF39FBA4C7AC43F2004FBB9D74C GUTIERRE-TIBON
438,335,278 *2C6AA4AEC471DA3B6BC509281AD8715DCEEBDFF4 hai-miệng-một-lời
438,335,279 *2C63981ED08F6C2EBE96D178627129E740EBA4F6 HAKTHAKT4
438,335,280 *2C675AB7A5B98377B9A502AF114A1B7BEF657336 CPRWL
438,335,281 *2C6347AE1833FC961F211C99DEEAFF18DBC7E2DA hankkrauser
438,335,282 *2C6F58AECB05DE37C6BDA1BE8783E66D4A1B70CE bezumnojing
438,335,283 *2C655653C91CD2C7CEAD869E748EF138B4E36983 RODNEY.DINHO
438,335,284 *2C677DD6FB2F6FC6B2A0A081BE672B2870968A21 cqikp
438,335,285 *2C6EDEF7080C231B0CCE31A63D3B4686BC86D890 [email protected]
438,335,286 *2C640CAEC01B1F366E21A6C07FCBF632253E4B79 C?R5#
438,335,287 *2C64C74353B699288C9545BFC82806E45C5E2C54 CRAIG-SPICKARD
438,335,288 *2C6632880DE95CEAA418DA9124845DF55A5F1B11 bg#ql
438,335,289 *2C66FE098EA427D35EAFAAE24C431ABEE99867AA BH,2F
438,335,290 *2C655B146F610B964C2588455E6848A4D39E87D3 BhGQ
438,335,291 *2C647D668D09E7704BAFCAAF02D13C37C42EC80E BIJAYPOKHAREL
438,335,292 *2C6911AD14807785D5B29C3FB05F9269B084BEB8 {hd(e
438,335,293 *2C6930DF13551B8837BBDA0ECEBAD5AC2B35DDB3 [email protected]
438,335,294 *2C63B8337B5C86D2E1C4F6A15C1761729BBEEB38 helaqe
438,335,295 *2C693B0B3A277AFCE8E583873A43C4BF17D7D880 HENRY.KISTER
438,335,296 *2C61393C9F29133B40529F4512F8021FCFDDE530 henslnge2
438,335,297 *2C6B01C9AB3243F41E3BDC45FCCF20229F548B0F HERMANDALBEY
438,335,298 *2C61D3DA02C523953F68ED2F92E47BD41D0C2FF9 HEY,SOULSISTER
438,335,299 *2C678363E90C26ACB0E9085216A7A9E782D0A538 ROSARIOJANDL
438,335,300 *2C6DB1FBA3061F4FE99B671B5317B23B6EA38D18 rosariomastriano
438,335,301 *2C60C42D6D9635F171314FCAD3A6F67470DAD236 ROSEKAKO
438,335,302 *2C6D3EF582EE1E879230947935A4FCD3D285A2FD ROSNANIBSW4
438,335,303 *2C6A7FB08AA8AD8D02466E83E5A50C7A24948812 hiltonwatah
438,335,304 *2C662650311A6718B73AC31B7A9E556AD5746B2A [email protected]
438,335,305 *2C604FDBA055DF0A6AD37A24400904C80E450751 hiramnirmaier
438,335,306 *2C60D8EEE0E3E2C5ECEECC9BBBF4FB6F87FC149A bilious
438,335,307 *2C6493AA2198D4A3D3F859D9F42E656C9997133D royalocheltree
438,335,308 *2C6BDD1734F2613A7352A682C4363F53F68989DF royceklingenberger
438,335,309 *2C6E72C0E780027AF5883075A9E6EB2D68B7033A BIOSENSORS IN TUNNEL COMPLEX AFRICA
438,335,310 *2C67553F6C9AF5D530D767AD4BBD75B87BEE11C1 bi.oz
438,335,311 *2C6742F35E171416588846AE1953DDB1FDB80293 B&IUA
438,335,312 *2C6CC2DD8B0D7665F95F74A9F4E7BEF85634495A HOLLUSCHICK8
438,335,313 *2C67D785E875EDE3066CBC1B5ECCCE032BADE364 BJWVA
438,335,314 *2C60596CB300B4753E8E7E657BF4718C2520B18C rudolfniccum
438,335,315 *2C698783A97835D18F62ECEC72187A7FAE22DAC5 RUEBENOBERHOLTZER
438,335,316 *2C6693545D55FBBF94772526CAD5331D4AB4C402 cs&f)
438,335,317 *2C658BEB4C55C881AF7AD824D5700A12A45AE873 BL"=
438,335,318 *2C645A24BA13017A4D37E70751574A5B90AAC2A1 [email protected]
438,335,319 *2C642277F1FDB1CABE74427B25F8FBD5224C1D54 hotspurs
438,335,320 *2C697318C23A1698F230C00D3D5DA9BFEE7922C1 RUSSELLAMERED
438,335,321 *2C69E4EC212AF3F4545F724EE09F7B1F441D8A07 RUTENGIS6
438,335,322 *2C67CCF20DE50C23DC656C27A51DCC31140B7BEE ctlf
438,335,323 *2C6418B51C805C01839E62ACA2D6D47E05284514 B-_LL
438,335,324 *2C66274CB9B9406E329CC028C84F125134D769AC cut"+
438,335,325 *2C6415CB5AC5624C6A0E2D038EC77E31146D90D0 blnnfrm3
438,335,326 *2C62BD325D46162015F881AEF27F64F69444884C hufslib
438,335,327 *2C644F2EDC4C85A29698C694B46DC768A7E4FE91 hughdeblasi
438,335,328 *2C675E536B2B102F8422BBE9DF2547801F557869 C(V!H
438,335,329 *2C68A8290B1F97597D6E25179A0AA1F9CFBF2FDC CwIa
438,335,330 *2C6EBB8789E26D890D5826334114D40A66D23056 SAIRAHU
438,335,331 *2C6EE8459A90D3031FFC67D5980CC5EA99C5292F CX*`
438,335,332 *2C678F39784DC259C18E7775EE596B1ED34DCC67 B&NN$
438,335,333 *2C6A5BA05D5B02515A49DD7F5DFEDAEA4C13B775 sammelani
438,335,334 *2C6208EB8F77A428E9BC44AE8A6F9EA1EE4EC4CF iF.($NiCK.==.%PT3).{
438,335,335 *2C6A3FCA0A2DF5B587B4EBC23A2B7103022FB7D6 IFNITSAL9
438,335,336 *2C6ED11FC99E5FFD1BD415A66AF50D939799F36F sarah-oishi
438,335,337 *2C6F3A720EE0D3D53DE2C997015ACAC0A0EF030C SAREMRIFFA3
438,335,338 *2C6BBE5D98551123689F30FAC0940E7351CF487A B----p.`~.`~(0-0)
438,335,339 *2C61184F798ED79AA9E7D276B2A874F362C8971F SATORUU
438,335,340 *2C6B742E472322A2D8F089514C05C1B1A2E6CCD2 IJSBLOKJES
438,335,341 *2C61931083B8274338936950CD1EE3177D6CFFE0 d6q9
438,335,342 *2C633DDA41150B0676919629F1D3C5E31DCF7E79 bqyi
438,335,343 *2C6F505BA60691A18186F12EA48DB092FE71E51F ILTAPIVO7
438,335,344 *2C6F948392D95A7E7C2B0855570D4C8D02011796 daiell-campaign-promotes-cole-pearson
438,335,345 *2C66CB158FB58057F172A3D88E74D747FCA418CF BRENTSTRANDBURG
438,335,346 *2C69B677E6D7C70179ED77A914E42BF9AF68FE3C DALLAS.ROLFF
438,335,347 *2C6153373097D1410DEE72C1D52793490F52E07A SCUFFED
438,335,348 *2C631BB90B509B31FE6CA01AF7B6D551E2878424 imattian9
438,335,349 *2C661E093241D4F0702F9FAC9A122F7ABF2E6E9B brittrexroat
438,335,350 *2C6DFEED404F0AA36D7050A717EBB5950BD45B94 DANIA866
438,335,351 *2C69D51260DD840034386EA8EF108D7AAF467228 BROOKSCALVARY
438,335,352 *2C6A7572E690AC2BC73BC2E90589D15453F14F1C brookskassner
438,335,353 *2C6F9BDF8D783624B4AAF5F784258A72C2D5E081 DANS-LES-FOSS
438,335,354 *2C6ACAD5F7E868039F3E385ED2A9CA0E3BF24863 [email protected]
438,335,355 *2C6831E2478F56CDED5C3176788CDC1F40521FEB SENSE4U
438,335,356 *2C6A81AD10F85B8313B9A9B46814C6B336624065 BRUNOKIKA
438,335,357 *2C60A33489F51B4A4EEA73640E9B657B28A4805D BRYCEDURPHEY
438,335,358 *2C6876733CFAD2AE305B13434FF85C0978D15812 INJETADA0
438,335,359 *2C6916F7F4691F3DAFD670D9DA3AE55F4E1B647E SEŠITE
438,335,360 *2C61FAFD58520CBB7BB3AC6FD4B9C5870CC43362 DAQUILANTE123
438,335,361 *2C6110121A941514DF7B0F4AEC0AE4967246282F inparadise(featjulieanne)
438,335,362 *2C606E4F33ACCED7BE0C40F04DC7B3DC63D675FC DARIO97
438,335,363 *2C681F82B99CF43701A16A42A049A600CDB20C63 bswhtelposibsw
438,335,364 *2C6F952919E1281A7B706644AEB315A868108330 shannoncrick
438,335,365 *2C65D758862FA7ACEF3A46F175E3B31A12E8C8AB bt,c$
438,335,366 *2C66FE3A06ADB1DFC120D38BA309A63F4C8C03CD btv%v
438,335,367 *2C63D9205DCA76E204A76F53336C4AF3C3147DFA ISAACCHEREM
438,335,368 *2C6AA63CC371E4BC9CDA434807ABC8557980BADE SHAYNE.BLEAKNEY
438,335,369 *2C6BD3134F002B84A2F33CAEFAF215F404E20370 [email protected]
438,335,370 *2C694F284257588B6A3094701F1A43E69681B95B ISSACPICARD
438,335,371 *2C6883F33AE75E96A2332643B8FEA2366C276F84 SHIFTKEYSLEFTSHIFT9
438,335,372 *2C69270CD04DE89DA3FFA5072613EEBDF11B3254 itvbqhk1
438,335,373 *2C6FC8A44870BC50EC7AB884FE36EC967C90BB89 BUDZIANOED
438,335,374 *2C6BFE8623C661CAA5D7808BECC6DADA16B3490C BUMBLEDSED
438,335,375 *2C66D4488D508C49E5FEC4BEC3B81B8BE33DDA64 BUR+V
438,335,376 *2C681FAC931FC996F4806446A059E057DA7F92D3 dbr3i
438,335,377 *2C67743F7F2B50B58ED9EC20EE1AC936E071A9D5 butko
438,335,378 *2C6147AC287A0DC9B06ABA0F1FED8893D686252E B_W&G
438,335,379 *2C69208F1021E4DB9A3114CC697039493B73554A de3_y
438,335,380 *2C6AF3B73F6466497B82DE83FE9979ABE795F3A4 snowbalabigail
438,335,381 *2C62A17C4C1FB48C4451BF057D69B5284F4C05FF [email protected]
438,335,382 *2C687B480CAC43A8FCDBECE64EB544FC28AF8BA9 delgesinski
438,335,383 *2C6824B2F6EDBCAA1779BE6EAA5B8D6EEADA98A3 DELMAR.OMLIN
438,335,384 *2C6154B0E84982432CB6B74A19E69142E6E07F25 DEL.MECHLING
438,335,385 *2C63881012D276DF7DE13E050FCAA95B5D79634F JAUNTYROADS
438,335,386 *2C6AF826426D85C765B6D448F08D59E65CD5BB63 [email protected]
438,335,387 *2C623EB5F70BD60C9DA6D23D344DF66B62D63B86 SPÄTHISTORISTISCHES
438,335,388 *2C6DB5B47025342F9FA1FDCECB58BBA296A45DDD speccing7
438,335,389 *2C6A064EE83BDE7DA7774FF3F36C2F42C3B161F4 JEREMYFESSETTE
438,335,390 *2C6D45BA0FC49916CDF4026070ABFD7B51F2E424 DERRICK.CIPRO
438,335,391 *2C65C6021C3244F57D32936D2A73A668B1F5FD18 DERSELBEVON
438,335,392 *2C6DDFCCEB37D16774C3E04B4D0897C777129C34 C9KOC
438,335,393 *2C607EB844C3B830AD4BC9619BFC78ACA58D5D8D ca1am!+ou$n3$$
438,335,394 *2C6338E378B691C146E26C6C747BD1B8BB00FEE8 c+aio
438,335,395 *2C622A30C2EE99984B9E16DC71FEA0C799B8C682 CALEB.ERCANBRACK
438,335,396 *2C69D93C48CE5BABAB9A93B7BAB01C569DC4234F JILLL
438,335,397 *2C624FF848E6BE4721869013C272592B424D05DB JKCWZC
438,335,398 *2C66390E5434DE0C5A2DDCF8E5766680FCC7AB52 SPORTQUOT
438,335,399 *2C60FD5DA68E14E29BF09117F90CD627CE212EAD JOELHADAS1
438,335,400 *2C601AC2D1B647B166404B72ECCC036CD27829C3 DHULJ
438,335,401 *2C65FE3846A88634AD2B8B55EB09793B78C20265 JOHNATHANBRYTON
438,335,402 *2C6B5C7AB054DBFF2024D597E21D82C2D9A6C70F johnathonjokela
438,335,403 *2C639CED01CDD9A0F395E9943CC055B4B32D8A75 SQLSUFBSW3
438,335,404 *2C697B2B2CCB68EB9045FB984D2E54F890B47A6F CAREY.KALFAYAN
438,335,405 *2C60D00210BF8EE4C3BD06FF309E346CADD8F497 DICTATIONMACHINESSE.INFODICTATIONMACHINESSE
438,335,406 *2C6F6B102B1D79A77EC3DBD99EFF6BFEBFCCB864 cari.underwood
438,335,407 *2C66FA1756483D17D6473D81E31D4EBA32B16BEB die-geier-kreisen-schon
438,335,408 *2C62E507E85636844B7A54169BF274C1379F321D CARLTONBAZATA
438,335,409 *2C6201F4FD43D9238BE687133D2299BE078B6E5F srjunior
438,335,410 *2C633CECFCE2FB9C52E81A81AE7A6C620302A9B3 [email protected]
438,335,411 *2C67B03FBE7C289CF03C4C5D99CB3AF37182BFD2 CARMINE.PREMER
438,335,412 *2C622A7EA6A88C58E77CC09B02BCB338F388BDFD DILLONCASSEY
438,335,413 *2C6CEF987B542B292829BD8C3AC963A8C9EA40BF CAROL GAUDETTE
438,335,414 *2C65435600252BFBE3A0D7C603C17A50693C0E1B JONBISCHOFF
438,335,415 *2C6AB9B3F83E5EB4AE8AC0D84CB86A02DCCBC4D3 CARROLLPANFILOV
438,335,416 *2C69F59C8D0F3B5520866F1C0D5CAA62BBCFFB39 STARDUST-PROMOTION
438,335,417 *2C6599C836D5E55440C986A28E4F0F29BB332B60 [email protected]
438,335,418 *2C66B31C0FDD24934ED8E9266C675735DD018E53 DIOLETSU8
438,335,419 *2C6651861833C707A45DD7861B23F6FECCA853A3 dionpolle
438,335,420 *2C67474B06271FD7B8ACD5A23E8E5177A15FC740 DIORUEN6
438,335,421 *2C613B18B56D36E3FE634B01E6432EE30309F8A3 DISABLINGANDENABLINGKEYS
438,335,422 *2C6627DEFD3E4E9F82BD07508E23FF8D96047839 JOSHUA.ALTER
438,335,423 *2C6D02C7BE1EFAF27A1B27B16B56448D40F7CBBB d&i-y
438,335,424 *2C6AB8B52BB6CF399592B72BB17E4440153B84C0 djmarckyvsleeroy
438,335,425 *2C67C73271674C4476335F1768BB28B22F4FCA3A C=C(
438,335,426 *2C66539A064033326D17B84CCD3B6748D43CEB43 striama
438,335,427 *2C6DA785AF16E6924B73CF85BCF78789B4DB1A6D STUURBOORDSTEVEN
438,335,428 *2C6F2FDA52A103BDD1E3804C10A9A3A2E5767188 SUBHEADWAITER
438,335,429 *2C628B17C5789F9706E0609092305DF2A94AC41B suehubler
438,335,430 *2C6804ACEB5B7CE2A71EDA6E26F4755976627243 sukederv3
438,335,431 *2C6D7CC11CB1CFE1810B42791CAA701DBF2D6C4B juliusgonseth
438,335,432 *2C688661986BF69DF8D42FF45177FA285481913B JUNIOR.DEMMA
438,335,433 *2C6CB5592826221DD487439D07DBF42E60050E10 JUSTIN.BARTUS
438,335,434 *2C6CAE9DD5645AA7D50DD819C765993AA821C0E1 juvenescence.,/dZ//u/v/I/'n/E/s/@/ns
438,335,435 *2C6E4A65ED5C4FFFFDC087EEBC14BBCE3678C929 dmehsdoo5
438,335,436 *2C60C3636C4EDCBD3B3C0BD9D39E12B838C30384 cedc9
438,335,437 *2C666A5DB3605500C5F681A22A58462D8672017F [email protected]
438,335,438 *2C6E9A88E5211882B97CE3F1D757CA12478DAD38 [email protected]
438,335,439 *2C6B2D6E4B7818E095FFF3ADCA9A6646FEA98CBE KAPUZINERBRUDER
438,335,440 *2C67B78C367F4941C4E38D280CD11AB32A44EB37 KARINEPAYETTE
438,335,441 *2C6BFDA7E28EAE195E707657BC99C4BB6E6B942B KARLBENNIN
438,335,442 *2C6510B4E5A2EB1CA96183622ACED3F9B8A01C47 SYLVIA LLOYD
438,335,443 *2C6899C16C304A16143ACAE31C963A908EB9F9FC Doc
438,335,444 *2C6D2606DB561911D83296B853B6E6873BCAE3BE ch.12f,.oh.yeah.baby,.don't.stop....
438,335,445 *2C61D176BDC72B68196357CF1762A1A9C91C82F5 [email protected]
438,335,446 *2C6D2E7259361C78C8E69FC9B9F20D038D5E531D KBNTHU
438,335,447 *2C6A7181B5CF74A9A49E6FCC9B4F0E0EEAC3BB24 KCUACC
438,335,448 *2C6C6D9AFF97A304DA957990ABD1968B35210143 DONG.LUSARDI
438,335,449 *2C6C052E4B404BE9707A3D7BE6277F7248CE7EF3 char1ad!3$
438,335,450 *2C6DEB49E3BC307F3CAF2244DCE571E7B8E57C6F TALKCJOYCE82
438,335,451 *2C6C4A3923B4006C8FDB919C34C6B1A5436343C1 cheiaról
438,335,452 *2C6E0E0C8838E3E30FBEA0B7B9339F24B54DD24E donnymacfarlane
438,335,453 *2C66EBD5A50B75B7087C6064DAF62FCFA575F7AF DONOVAN.SHOLLENBERGER
438,335,454 *2C632654844E32E5CDE2145687FBF32FF59AFCE0 KENTMAJ
438,335,455 *2C60A3C87675FD1C06226D05923970C36F94881C KENT.SMOLENSKI
438,335,456 *2C6E89E24D7F684CEFC229A7CB6683880C3F28D4 DON'T.TIPTOE
438,335,457 *2C68A04162989560C9E439CC15F88A4E0B01BC4E dorostencove
438,335,458 *2C6CF24EA7A3AECF6E43C047BF7C211C159D7E9D tataallepy
438,335,459 *2C66C37CB49196146342B5300D66A25DA6CEB0BF TÄYDENNYTTÄMISEKSI
438,335,460 *2C6FEB60AECEECBB29630599F4C5CE47467C6220 KING.SJULSTAD
438,335,461 *2C6CBC0BCAA936ABD76C1EA3CA94DA3B9BC44F87 teamodemasiado123
438,335,462 *2C602BDEA151DF3C8050A790873D316EF64D3B3D teddyberrios
438,335,463 *2C6FB9178601D491B434186ED1BA9966B78CEC9C CHIKATOED
438,335,464 *2C627E9874EA240AB2891569C7F8F33031C69248 DP=N
438,335,465 *2C6A9E62B2EAE1370A1BC9DF28D8244D3BC3E78C chosev
438,335,466 *2C665E9EB41385F854CC70BC1A47935908138B3F KOLOHIE
438,335,467 *2C6FFA141AF85734512CA7DAB0CADB72342B2B57 CHRISTOPHE BONVIN
438,335,468 *2C64A66E6CB3092D9C3FA81E6F3BCAAB2FC98309 TERRESTERS
438,335,469 *2C6C0FC2BF6E97F28BAF8DD9D189F5467AB3C211 KOODIIN5
438,335,470 *2C6280EA159C389F11B40C97E1BAAD429CEE6F59 KOREYWIESEMANN
438,335,471 *2C6F6DE7F2F0B7EAD4B85DC8368F3582B0945F01 korynipple
438,335,472 *2C6261FBFDA9BFE401E98BB5EC46936E24E70F4D TEZZA-COLLINS
438,335,473 *2C62AEE9CD2B1B2A47CB5F5224BAA8EFC4E6BD60 cih)_
438,335,474 *2C63A9BE2F04146A21010E02827A06029A191386 CIICU
438,335,475 *2C66213CA7AE06BA7CA2D2D62DBC026C72B3B288 [email protected]
438,335,476 *2C693D5BBC6883529073C8D5C45E384575D2E4C2 CITSITEC6
438,335,477 *2C6BDFCDB49931221A66C4A1523B1089E22EBBBF THATPERFECT84
438,335,478 *2C63145C0B29A2516F393E3F2A67D6DD84630A2C THE-DANCE-GOES-ON...
438,335,479 *2C66701451FD0567D938AA9B6D124C2159BB6F4B KRISTY MCKENZIE
438,335,480 *2C6EE8F81D296A67D5F18649FD836D10589CB97E dr-o=
438,335,481 *2C6F3CA81CC42B20F89F701579FA76C5A1F1D6E7 THE RITE OF SPRING: I THE ADORATION OF THE EARTH: INTRODUCTION
438,335,482 *2C6298D40FDD8F00550607ED9B92BF0ECC5ABDB7 KURTIS.LAMANTAGNE
438,335,483 *2C67080E198208C357B66BBED39F61FE8A6706BB KVINTPÁRHUZAM
438,335,484 *2C69980D18E393B55195D0DFE0AFBD6CEA3F5F9F [email protected]
438,335,485 *2C62AD4DB602C7C080EE665767B7265FB052BC7C kz}
438,335,486 *2C6125B4C0E5CB004745E3A232A49EB00143CABE ck4t9
438,335,487 *2C6A5FE89E37E0475E9BE9909D153C29AD706262 ckurc
438,335,488 *2C60E0A5E2F114ED1BE2AE0BF0E1B3231602CC95 TITANHILL22X2
438,335,489 *2C665ACE2D37252001BBE64191896519F437F76B d+(u5
438,335,490 *2C65F7B26E276B000C7234A3435428A96B53EDDC CLEMENTEKORANDO
438,335,491 *2C6511595BBF458D468AE06F29752720339A2848 CLEO.PADIN
438,335,492 *2C6A75C49EBDF119AC5B0830E0676E3E6964C0EB CLEVELANDKNATT
438,335,493 *2C6CAFE64AE30121F6D243B59C31CC1CBDF8F936 CLEVELAND.NIGGEMANN
438,335,494 *2C648CBBEB8BA3B9C70E295F7DA62EA546CF0B06 TODOPODEROSO6
438,335,495 *2C638BCE945A395B7509CC1C109853E8E06A29DB CLIFFORD.KALBERER
438,335,496 *2C65F59F031B41309A80FF193C90E987C4655703 toepassingsbesluiten
438,335,497 *2C6A7543951755CEA5AA21CE9045966F27320F2A CLINTON.DELLOW
438,335,498 *2C6D5C8394F49525ECE74A70B6BAD6EFA7CC64FB clm4+olo95+5
438,335,499 *2C68155ABB80C52FAF018206505EA04EE5250426 LAWBLOGFLASHBACKLARRYTRIBEANDPENNZOILVTEXACO
438,335,500 *2C66947A214B881013559868D272C281133B2CF6 d"vm!
438,335,501 *2C613728EFA348E0447A37F46AC1D0C1EE5EC5B4 TORQUEMADAS9
438,335,502 *2C6ADB8ABA7D0013EE1A34533F715178F78F3996 cn3=s
438,335,503 *2C651CC5901F5D8C1E1675590F1972B62E5DE4BC traceyfreniere
438,335,504 *2C6569444E206772E68EE8B65349352CF82D28A5 TRACEY.YARBROUGH
438,335,505 *2C661AF643FDDE53D23E33539AA0EBE6DB3DD9E0 LCAK
438,335,506 *2C668FCA25A950DD9395E5AF637451342399B8F0 TRAWHTBSW6
438,335,507 *2C6F07E744F118C969B852AA33B1DA164EBEC9FC LEEWERLINGER
438,335,508 *2C68DA221C8B315E07869F3D9D2AF3B0C02A3AE6 Legends-of-the-Lost-and-Found-(disc-2)
438,335,509 *2C6CB82C48176D8F101D96EB80C1EB11F9B9BAF1 trersdag5
438,335,510 *2C66759A9C90F02CEC266F63B42EC0A2322E2B0C tricia-davis-martin
438,335,511 *2C66E655BEC4B4008769F22F1E4F533B1C8A7273 dxbyp
438,335,512 *2C677D911942011234FACCDCF4CC07C90B046B45 coeeses8
438,335,513 *2C637C875708C214C6A2AEBCB498C94461F2FE56 LEONOREPROHASKA:NO.2ROMANZE.ESBL
438,335,514 *2C6E0E34FB51BC0F522EAE87A28FDB7CE18FB5B8 coleleask
438,335,515 *2C6D8CFD65FEAF157C9A1173898BD7517A97FCD9 LEROYBENTO
438,335,516 *2C6EE0FCAB81F2F95DB4E874FEEE985B9463C77A earlegirgis
438,335,517 *2C635584659D322A369491289326038CB6BB6CF3 lesmaddock
438,335,518 *2C601181ABB8A461341F0AB0E137F677A61F3B73 LETYMBOU
438,335,519 *2C69F392104B1C5EC90CC8A3F56D4A8D0FA9720C [email protected]
438,335,520 *2C66EC5E314D01A0CE6F0CF76CB5B7C80991BCD7 [email protected]
438,335,521 *2C632F032D8DB7A18BA3DC63014123310E782719 ECHESSIER1234
438,335,522 *2C6D29D1285EA0AF6418F8EBBF81C62EEA5763BA ECKE'-'KASPER
438,335,523 *2C6ABD647EAF94C5C760500A2A57282D990A3BBF ecoplastic
438,335,524 *2C6EAF59986A2E1E5FD24B02DF3906AAED118AD1 liikennerikomus
438,335,525 *2C6D8693491CFED7DD3230DC7F5DCC9616AF2202 EDOOIDEN6
438,335,526 *2C6389AED355A7AF6471805B66D5012E60522597 edtoure
438,335,527 *2C63BC6EAA7BF45C27579E08A43F3DCBA7AB1A5F EDWARD.BORRETA
438,335,528 *2C6543559FA7D2A97060F0D3D1C3161C54340FFD edwinbacal
438,335,529 *2C6DF835A6CC22DCF2D22A22D5B1A9B9D925100B EFRENRAYMOND
438,335,530 *2C6031C445E3F52A870BAC42AF5281C3FCA92BB2 EGKQ+
438,335,531 *2C6A72EB679BAB45E4F1FF659B494B0BC991E6B7 [email protected]
438,335,532 *2C6DB69E8AE0FF82E09B2843C692224C380252BE EHKISEVN6
438,335,533 *2C68687CE5105FA371A72AF9A5F3575F1E75072F cottonizes!
438,335,534 *2C66BE9919851365924C887F4E7186B3C3897B9D [email protected]
438,335,535 *2C64988D853CEC1CF34027060064AE96A1F0618B cowln
438,335,536 *2C6E7D854D8ACB7C9C38725274996C359B63ADA8 EISENBERGL
438,335,537 *2C663F900A744B0D7DEF216A438320C06754696E ll!~
438,335,538 *2C6F7A3A0DF4DB84C39BD215E26EA8E72BCB48BA c:\program-files\microsoft-sql-server\90\tools\publishing\12\zh-cht\menuandcommandsresourcesdll
438,335,539 *2C691474CE308AADE79ED277AFEA67CA6E1329B7 c:\program.files\microsoft.sql.server\90\tools\publishing\1.2\zh-cht\menuandcommands.resources.dll
438,335,540 *2C68E3831509644BB811119002E416D2BE77705E electronic-organ
438,335,541 *2C69A971901DDDECFDE06A91BA1A8770FD7E81FA ELIZABETH.SPINNER
438,335,542 *2C6593D89416AB8550AA9617D9F4400D5ED83E8D Cq0
438,335,543 *2C6D4F1E815BEEFDEA60049674FAFC78E7459856 UNCORDIAL0
438,335,544 *2C651E0D34244EDCD764364163D0F601E8A97B34 CRC243
438,335,545 *2C62107D5CF26CD678AD717A9F9401D996E934D0 LOU.YASKIEWICZ
438,335,546 *2C60F0A25C99995C16A465434D05D0E5F7DC5202 LOVEAKSELSHAND
438,335,547 *2C672D69DEE8E5CBB9DAA5CD2BE2DCD7A63B744D CRISTIAN RENALDO
438,335,548 *2C6CD08426A6F18AFD9C3C304470ACD4855EFD8D Un-siglo-de-ausencia
438,335,549 *2C6BB6FCB478711E503DBF26AB6E78F4EBA11FDB crosshatched
438,335,550 *2C6D2848DF642AE2D6EBC33D6587C6BF0320CBAA cr)rt
438,335,551 *2C647A2AE1A36734C972573FAAD459D7F5CB665E emhkk
438,335,552 *2C65EE9DCB541BA5ACE80DDA37226F634B6F39ED [email protected]
438,335,553 *2C64847F854E12CFCAE1E1C7919497EC81F21E23 EMILY-TARLETON
438,335,554 *2C656C5B446EB7277686ADC9DE54DC037E2082F3 emnkt
438,335,555 *2C61F8AC6B1738EFDF668DC2F4ECE7ABAADD5924 CU7AN30U1Y
438,335,556 *2C64E15E2440AE1BE5788DFB9E4D14E6B3147CE5 USMERKIN2
438,335,557 *2C6BB0A24B201F7AE539EBE0C5E503426C7BC8E3 CuIC
438,335,558 *2C6628BDEF0FDF513412EAAB2F19D91F24151171 UYBBPA-MJ
438,335,559 *2C660A5ADDDE5BD5CD939F325254970069AF55E0 M4RLOKO
438,335,560 *2C65CD4C2AFAB538B72C398C4459C0D2DF9AA8C2 E·ON
438,335,561 *2C6D74BD0925DC2CE535891032640811DAEEBC94 VABETTE0
438,335,562 *2C6C0690C79117EC6864F84BEE790B1DEDB42141 c?:;v
438,335,563 *2C67BF564160DF182CAB0336E70043A37644FB10 VALDO-TOMS
438,335,564 *2C6B5CE144DA6C28A0B99FA035CAD22975A2388E [email protected]
438,335,565 *2C6DD358CC5537DE5C6ACC02C4FFFA5CB264C81A MAEHINERYNND
438,335,566 *2C6ACA664360207D3F31B204F26CE3B3024A1C75 ERc1
438,335,567 *2C691A0B2E7AA0D223B1A7703B8F74070E815094 ERCECYFZ
438,335,568 *2C6E7B79D3CE318F4F75B4542C02EFC3CE3B5226 vanbenedix
438,335,569 *2C6F423201BE43B703913D195935229BB09E8869 magotesed
438,335,570 *2C65E59F0A02C5B85861F8174AB10465B0DED3A2 erik740
438,335,571 *2C685664556B0175D9A38401C63E9B8AF15123A4 MALIK ALANSARI
438,335,572 *2C6EB10E73FFF646C4D21AF350883EEB7B97E26C MALIKKAUTZER
438,335,573 *2C6BE966FE6E8F5C1ECB94E58C35972AC5B8332E mamoi
438,335,574 *2C6A492BCFE0913323FF7DBBE6263CCCBC03244E ERVINFORGETTE
438,335,575 *2C66873CCCFB130F9B2D62177C23C80079FAE37B CZNCAA
438,335,576 *2C6E2EE80181015B06D316F1F014F520FDCB60C2 D%^.
438,335,577 *2C69612471601E157019563D9AEB2C63FCE83D9B D1G1T4T3LY
438,335,578 *2C6023C028A06FD9D625673AC39C7F80C2CC19BA estimerais8
438,335,579 *2C604DF059EDE34B758E8724DB3CCCBE02B9CEB8 verseurs4
438,335,580 *2C659244B7A9F0B06C5BAA048A78D49062DECDA8 MARCODETERMAN
438,335,581 *2C620F8F814AEE66270B64F740159C34371F7D60 marcohoepfner
438,335,582 *2C61ECAA9CB3B1B71CF6F46BD7AD5F6EDA2B7EA0 ETESLIMOLUYOR
438,335,583 *2C6472D4D259268AF6E1B6000F51962B700775D8 VICOSBSW4
438,335,584 *2C6C1E5D676C99C15944E05CDBB5164D687AF13A etx,1
438,335,585 *2C67AB740E6993FB99C14BFD518789B5B4EFA9DF MARIEL-MEJIA
438,335,586 *2C629BF0EF3A61B0C3AB5EFDD6FFF7B2961C901C EU-DIGEST
438,335,587 *2C6169E1BBCA5C3136D5F4DADD2F033A1B5C4EF2 D7TD1
438,335,588 *2C6B8AB0CEB663DF7009CF543471D04199B732AF VILMACASALLA
438,335,589 *2C62A40A753CE54E8571874CE8079EB0B22321E9 vimal.vicky.patel
438,335,590 *2C62C9B6F7A8CD619DD7C0AE85919E8FF1D547AB vincenzorehder
438,335,591 *2C6301D3A814E80E0AF1D972B1CE44D459740E0E VINDY ALVIONA
438,335,592 *2C6FDE26764DD9EF9A228DFF3C955395CBB3C240 martykoerwitz
438,335,593 *2C6A18C9C8BFF9D191E36C87BE5EB24326369177 VIOLETFOOTBALL
438,335,594 *2C6F9C44310F74A468B2568D40CD3DC5234BD482 VIRJEAN CALL
438,335,595 *2C6C7C5ABB83CE033D29E6F18B4047BF656EF968 MASSAREE4
438,335,596 *2C6946E1D90305333AA5A09C3D47729BBA208C35 EXTERNESEITEN
438,335,597 *2C649FEB4BB57293CF3FA9DA46DBD2A52AAEF862 EZEQUIELUSHIJIMA
438,335,598 *2C6C3AF96F4F7350ED55707B670910E681A4315A DAN.PINCHBACK
438,335,599 *2C658E72390DF28F3641B6EE5CB449AABE9C2D51 dans.la.louisianne
438,335,600 *2C6DDA2F0CE3F896C0157725D83C0DD8B01769A0 f4ll-sow
438,335,601 *2C69AF7BCC0FF6AF6C04D888F04A19A35FCA7FC2 dario03
438,335,602 *2C6C9ABC3AE2365D049B748B1D98699E21A3939A MAZKAZUNARI
438,335,603 *2C69C195BA433972B8B69E5F01885F525BC54A4F VOKALEN0
438,335,604 *2C61C353B434FAD2FEBB6176401E13750525B38B VOLÒ
438,335,605 *2C681D900D03B199388DCD57E9C9B8F37DFBA7D7 DASESTUP
438,335,606 *2C66276FA58EC9B89EFB4F7B2D2E5CBA7F60D7C7 W493RIN9
438,335,607 *2C626538D9830CC0547DEBFEB4E92906DCCF60A3 MÉLTASD
438,335,608 *2C624CCD7CEC7F31F8A73EC897FD5FAB423F6A90 FERTIGZUMACHEN/D
438,335,609 *2C688F21CCC726A5071ACF05E58543448FA07BE7 DAVYDUTCHY
438,335,610 *2C64711161FF4CD278C9FCAC030282EB0409F797 dc3lb
438,335,611 *2C64C59FAE3E126CB279B99CA13655CFE6056FF7 d?d6
438,335,612 *2C646746CDD0F8EC6D26E6B746DA813ECA74E1C2 fleftx91i93
438,335,613 *2C68EE3ACFEB4E98A9852390B77C56834D62979B WANKSTERS
438,335,614 *2C6F0FC95F81AB200CCF6E13FF453CD8D12C5680 d,e1w
438,335,615 *2C6070B208C23B57219D6593BA80AA3353B4C2DB decimarum
438,335,616 *2C677B28E87F53334F686AAE0C6E93B1672E9603 WAS GOTT TUT DAS IST WOHLGETAN (STUTTGARTER HYMNUSCHORKNABEN)
438,335,617 *2C647E1985EBF490203477922B034B5482E16E37 WAWRYLAKOWSKI
438,335,618 *2C6C965477716B59963E31776E5862AC14A5E5E1 mike-dimmitt
438,335,619 *2C60BAAFB40CCD1F5FBB1A89E0B545C29FFADF99 MILLARD.DECHICK
438,335,620 *2C637A3DBAC4F810DF683E735BF68BF3E6EF8615 weldon-peterson
438,335,621 *2C629000D71A17C2418368DCA21D99DF7426A51F F#@R
438,335,622 *2C6CC4E93AFF4F016E3A7A6CA943C5C3356B796C FRANCISCOPAPAGEORGE
438,335,623 *2C6680C4BD04697B383FBA3ACC4D12DA7EE5AB15 FRANKIEMACQUARRIE
438,335,624 *2C69FCF63724B5FA16409C9FD2A25E21EE95B073 dennisverbasco
438,335,625 *2C6550B90B18301191AD3B31C2639AAFED0C2D3B [email protected]
438,335,626 *2C656B334399083CEFA5C61466D62460A115AE60 WERNER.FLAGER
438,335,627 *2C6EF0A75C8EA61AA1683DC5CB238ACC2A31D6AF WES.LANZA
438,335,628 *2C600A55AB601E29EC88276ADE971DE9D56BCF4B mk#q
438,335,629 *2C697A8E485501A5810322483AFE7A8EC599AC70 wh>s
438,335,630 *2C61AD14654B431CAF7A41D30E7A0504FB62CF2C wie gross sind sie?
438,335,631 *2C65CA8F6EAC85B9AB123CEE7F0742F1E4CBE91A WILFORDALDRETE
438,335,632 *2C625A3A0E27EF5B191A79A8FA97E040CB000742 WILFORDSTAMPS
438,335,633 *2C6E64608E448A52B2ECFB15364F7AB26386A3BE ft5o
438,335,634 *2C6CE4E00721B7A47DD12BE643DFC1851BDBDAB9 MONTEORENSTEIN
438,335,635 *2C6606197A67951BFF5A582C23729B84D1315E32 FUDAN101
438,335,636 *2C629552D9C860027D0D07A92694762260F1D171 MOONCAKEE
438,335,637 *2C6BDA7201494925BC03BE88E74A71A0FDF0E646 Desbloque
438,335,638 *2C6D9F1359751E4458FB8D99B53244CAC9CB4DAF WILLISGOODLEY
438,335,639 *2C6E75E1208FF84A1298973F9CF3A50E305577C0 willkeesling
438,335,640 *2C699759B1A4BC1B6586A4F6B5763E442D72D496 [email protected]
438,335,641 *2C65F30BE89237624C8E8E4EFD19BA02F3E74CB0 fuxn
438,335,642 *2C62BAF95C7605A1B5DF3ED0A460577796EC6AE1 MOSHESRSIC
438,335,643 *2C6B62F95617F09B2B69DA0EE8BC005F24F6D141 DEWITT.DEMALINE
438,335,644 *2C63C7926E534D355FE54309CFA022AAD61CEB8D [email protected]!GE!
438,335,645 *2C6212F59EA7BFC25F9D900CB7431C3E7E358D4F G_5
438,335,646 *2C67D10EE8DD3DDFE5C2A29ABCA82FEFF1086716 GAIAPRO7
438,335,647 *2C6EF56183B5BEFE1F772F68C237E598383A3843 winy-rifmawati
438,335,648 *2C617CA2FC05129C6DE821FDAC9D0C4DC5BF26C4 msoaaa
438,335,649 *2C69A76BD7C0FDC746AE04BBA96DC75ACCD498B6 DFMST
438,335,650 *2C6B3D53A3C79A498F3B5D8844B1F6644FB84831 dgc"i
438,335,651 *2C66BC736E721D4A3105D0B0E7E35821864B1796 „GASTSPIEL
438,335,652 *2C68D2E5147085AA9E259CAE5CF11581AA592114 GAYLE.SCHIRMER
438,335,653 *2C6E2EA9E7B44D8FDE586B5FBE4A155B259C48DF GAYLORDWINTZ
438,335,654 *2C6EFD565E243DAE76185757E2435A2D7AA5AC74 mydick9225
438,335,655 *2C6B267C996F41464C6D68124266B98DCB17C433 GENARO.BISSETTE
438,335,656 *2C6B8549402769CF9D8F869B24A48F02202A276C GENERAL-ROCA-RIO-NEGRO
438,335,657 *2C6440CE41B6C6835DC533E04504C3E85426DFF8 [email protected]
438,335,658 *2C65AE7BA681872A75930C62C8893326A963C2A3 GEORGE GILHAM
438,335,659 *2C63C3DC4D75A91E94452AB83CFD52333896C3BD MYWENDY12006
438,335,660 *2C6D89AD5E0E39BAC159A2113BAC70E9D14E68F2 NARMADHA8
438,335,661 *2C6A3EEF764FC1D4509B53BB80A785B61695AF97 NASCARZHONGGUO
438,335,662 *2C6ABAEEBA6BDE93D3AD80672B7B328B7B812F69 x995
438,335,663 *2C6CB4DAC0E144F3F7F0918B988DE53101E3B9D8 GODFUELED
438,335,664 *2C665E7000373D57C047612CA7678A4CF185B191 [email protected]
438,335,665 *2C6B112DB589545AC1527A1F837CDBC61FAF2CE5 disputino5
438,335,666 *2C60ED3BE7E5D67F2A589290613227BBA88DB3A8 GOOBFMOI8
438,335,667 *2C65013F216909D2BF315135E268FC913ECFD516 GORDUFA
438,335,668 *2C6C7B8D942B2B08CE777D92AF8CACBD7AA015E9 d!j5e
438,335,669 *2C69E09647AEF679260FEEBC3926E4059465459B dj%&p
438,335,670 *2C63C618D1B3B537F5CA182298C31761D6294AF8 djp%b
438,335,671 *2C6E282C0B645BE024B563A7B0DD6883505AFD5F GRATEFULB6
438,335,672 *2C62465CAA827139D6DCDD30447369A07CAE9A70 XPROTOZOA1
438,335,673 *2C6977B463FAFBFA687480F194B6553B47E37B03 dkgew
438,335,674 *2C6744ACF2A7EC653988D96918C404E8986D5833 NEUROEXCITABILITY
438,335,675 *2C67638CB4EDCC8249506EFC3AD7558F8E67D307 GRI164
438,335,676 *2C6298454D74C23E4CD1C0EC46BD39138F2E14EC dl?"
438,335,677 *2C658CD77B7F4C944B0451132C0A388AF9878085 groottes
438,335,678 *2C6B491A4C52FDA6002F13FB05C86AB3A00FB290 groverbarklow
438,335,679 *2C6732CE844D3B10A88C0F12132402C0FEEE7248 grynigastes
438,335,680 *2C67193C141709C6B34E745B46F576B21C0A7D4F GUADALUPE.SE
438,335,681 *2C6DB6A3E1FFFE5D97997C92E0BF3FC3C0BE444A YAMANI
438,335,682 *2C6C74CF629F42330B0F47BAA757C50600A8F9E5 d/l/y
438,335,683 *2C67E08CF08F335D5D4D0D8477E6E7D05E959118 guinness1234567
438,335,684 *2C60572347DCDC8B51E739672DC118B1527FB097 GUYSWHOFEIGNIGNORANCE
438,335,685 *2C647EC2B0D2B287F3267BF5AF0CF7CDB9045D0C YANTOAREMA
438,335,686 *2C6151FADE3C1FBF76778E39B3FAE8B85FE7389D HAL.BARRISH
438,335,687 *2C65B882A49DF00E044AC9CD738E362A9F068A8E HALFVERIFIED
438,335,688 *2C67D1384907AFE73DDD65E79153DBCC485A7F8E YBBOBREVORG
438,335,689 *2C6B3B1F9C1F6C80ACD36DBB08CC39FE5A2B5173 NOE.GONEY
438,335,690 *2C6C92ACDCA0D8733BE5313439E5D7A655D5D384 dolvg
438,335,691 *2C607AB9BBE7C77690F147B32C32B5D4F9B9CA9B DOMINICHARRIMAN
438,335,692 *2C6B82335966ECD78ECA5839C7240A431FDB745B DOMINIQUEMENZELLA
438,335,693 *2C6ADCEE5727745D83BE9E60647AB21CF74FD415 nonobjection!
438,335,694 *2C61CEEE82DE8347FD031B312A8BF85323F5334B yifyif
438,335,695 *2C6E089A7117309135B0D2F67DBD3D270FBE435F [email protected]
438,335,696 *2C60373AF91CF95BF37738632E5E57A46B2E4695 DONOVANSTATUM
438,335,697 *2C68F4C7A15CCAD249CE75E9EC9AB7617347E0C4 [email protected]
438,335,698 *2C6265551A3ED8CBE70BD7A92566B2528086AF06 DONTE.LEUNG
438,335,699 *2C6F70B9A0A595DAF340769497609F940D07B15D don'tmesswiththesas
438,335,700 *2C63A5CE5E87AA93169EE367FA90346DD15D613B YOELYESPINOSA
438,335,701 *2C66FCFA888A3CC5F0E4062A83F462F8F625A428 NUEVA.IZQUIERDA.ESTADOS.UNIDOS
438,335,702 *2C6F48E4EE65C3024B35A9942A79A00DBABA14F8 DOTHEDEACONS.COMWWW
438,335,703 *2C61FAC5AD5CDB879C74AB923C98761B78A922E9 [email protected]
438,335,704 *2C6E8BEA9E8BE5F12AEABC10C984F4C1C6518057 [email protected]
438,335,705 *2C663BF035E3A20B762DBA25B1D0462C9C6C43DF NWARIEB
438,335,706 *2C69A3FD759F06ABA39E25BD919DB2BE99EA9B28 dougrice
438,335,707 *2C60CFABC8100C3D07195A3D0908BCF07AADD525 HEATHERMATTOCKS
438,335,708 *2C66BDA9F95E5F7EAED318AC14DE6919B55645FD }o{-~-~-~<==b
438,335,709 *2C6C65E6B7870CDC7923547BDFF0D5E2F1E02D4C [email protected]
438,335,710 *2C6FB6A3A0B49AF9E3D02B2DDBBD992E1A6435EB yudhadwiputrakurniawan
438,335,711 *2C68EE06116A13CD2B9D319F10D8AB04FDA2886A OCTOVER31
438,335,712 *2C6855E8090E8D6936F0505022CFC81D40F3BD43 dpzv%
438,335,713 *2C6E3C18052012964437787A8F32A23CCC8235ED odisramariz
438,335,714 *2C6EBF21622ABE0FCBD71F6A6ED9B771F73DB273 dqaaw
438,335,715 *2C622E6A58D14F87B8517FF238CCB51C2E38A6DF dqoo4
438,335,716 *2C627CB8C8BD8778C8409C7BB18965D89DB285FE herberthumeniuk
438,335,717 *2C667EE2F0721723C2F398E3849B6C60E267C85D HERIBERTOWRYNN
438,335,718 *2C663415085E704FE08247FAF8FC3CD23E9EC1A2 HIPOLITOGRANTIER
438,335,719 *2C6216AAB9D9501E45647B17798AC8E97DF84ED9 Z50534
438,335,720 *2C66F398BE8ADECB84C23924087E904E96884AEC OGARKOVED
438,335,721 *2C6919967AC2C0D146AACBA436EE80DA38EEB2E2 ZACHARYCUTSFORTH
438,335,722 *2C6FFBEA600D09D83D1468A19C8FD6935C9AD4BA d(qui
438,335,723 *2C6DCD98869B7F58357F5B36A36E91791B2FCB71 DRACHENSTATION
438,335,724 *2C60A576D21F6B479A68DA31300D42961C55559D OLLIEBURLAGE
438,335,725 *2C6C1962FC1346D409197EDD71F19CB3BB4513D4 DRCOCO
438,335,726 *2C683EEE517D18C9D727D8CC6428DFCDAA1838C5 OLSEN897
438,335,727 *2C667E3786DEFC181AF192D633868C046DACEE01 hoppe03r
438,335,728 *2C683816566BD3F44BC472C058BE7A69B6DD0697 howcouldiletyougetaway?
438,335,729 *2C6708500369C018C06690251A9A7D5E66F2B22C d?+s8
438,335,730 *2C62CC7F7862E313847D56F17D21EB4225A69BC1 dtvpf
438,335,731 *2C6E1A9CDEB0FF53FBECFEA20F3C1894BABB6DD8 zelda-de-ponte-gonsalves
438,335,732 *2C65F54CFBF6B7F7465D794A9BD23C03E8F2DC7F HTTPWWW.MOYOBAMBA.NE
438,335,733 *2C60F80ACC984724C817329F60DE557D02452C9F DUAOH
438,335,734 *2C66A626DCDEB81D3FDF81324122BFB7F206DCFD zhaofafu
438,335,735 *2C6538ADD8A2B354C6CC77A6FAB1BDCACEBE5075 d+uwr
438,335,736 *2C67B30178C59292B7DBD3830B6CE5941C3638A4 dweh)
438,335,737 *2C6B58F881427832EF45E79043F3BCF64658FBEF OPENSESA3
438,335,738 *2C64F11A9F1BF4FE1703AA105919D6EFF6138314 HVAUGHNES
438,335,739 *2C6309DB6F41D6F6E9339C98EE7805D0400FCAA4 OPERA$IN
438,335,740 *2C6DCA7D0F4D99E38379091ADF86FCBE5FD9F827 opportuneless6
438,335,741 *2C697579F50A19964CB24025AE5A8AAE9482A158 hyperconscientiousness?
438,335,742 *2C60DD7EE0CE48FBA86D91069CD61EE6A173C2E2 orenschab
438,335,743 *2C6329EE9C16B36B0FDD81F45AF075A96C65B052 zoolog5
438,335,744 *2C61F609B20216F6F64668AD40C33D003BD5B570 ZQZKTVQY0
438,335,745 *2C664530E585C1DCF73CFBF293094A8595901341 IAMOPENUP1999
438,335,746 *2C6F90957AFAA35A12449577E6AA1F8329C4F5C8 IANFEBLES
438,335,747 *2C6AE51DDF90008128265C5B0BEAB23E0E072D58 [email protected]
438,335,748 *2C635ED2547C65244D1A8DD84984C297ED0A43AE [email protected]
438,335,749 *2C64DCFEAFF43243C3BD52D33C3C726534B67278 Z!ZQ
438,335,750 *2C640823861AFE0370A40FF11856B4312F6FFE0A ICENSERSING
438,335,751 *2C6D48EDEC62B8E88A691311309FF8647580AD56 ΚΌΚΙ
438,335,752 *2C6B757A85B338F59CA9B8639948A3E3E860EFF2 ΠΝΕῦΜΑ
438,335,753 *2C64DA7F8BFFE10BEE12D1B5A0715A806A42761E АБАДОЮ
438,335,754 *2C69B7DD713CE4221891492F309C9FD5FBD72497 OVIDERPPING
438,335,755 *2C67BD6FDAC9F146A4BC04784358ED7C9A241DFF i][email protected]
438,335,756 *2C6B94C5416713D791D413F2EFC81ED70DACBA8B P1ZP
438,335,757 *2C6C1B681A4373907235D22994B2F0ED54550A55 ILUVMORONI2006
438,335,758 *2C689E6493F82DE0A2615EB8EB94A116910C4899 НЕЗАДОВОЛЕНОСТІ
438,335,759 *2C6B4A69F11397B54AFE9BBC949395DC0E285FED ОБРАЗЪВАТ
438,335,760 *2C69CCADB3C52351BC4D714894891B94E0030826 ОБРІКАТИ
438,335,761 *2C6FB80A41961A9923DB8B10565764E526C41D19 in-a-sentimental-mood
438,335,762 *2C6935BCAEEA6043B7E5CFBB95BC45C3296E46BA [email protected]
438,335,763 *2C69F0C74E7A26DA8FB0204510A43C7F0ADBB834 egarallec3
438,335,764 *2C61DA0C434E1DB5F576DA35873A3B326647AC77 EGOUVERNEMENTD\IRLANDE
438,335,765 *2C6C46360E2CBA0535A59A773BA131E448CBE8BC password192
438,335,766 *2C65300BC11B88AF24F038662C36C71FBC0C3E0C EHZ:
438,335,767 *2C632EE738C5744C4E0743BE0CF0F2CF71D9968E PBP-DELLEUR
438,335,768 *2C684FC18BC8C755D10F33B39773AE771D2DAC48 peace,love,dope!nowgetthehelloutofhere!
438,335,769 *2C64963F6FA20F00389ADA5A11291AFF5AC1B60C peckbsw6
438,335,770 *2C6D4A36948F0A152875B717861A3582DB6F9314 [email protected]
438,335,771 *2C60E852857524D800CF3503662A90FB58AB09B8 [email protected]
438,335,772 *2C68833787E071C57D3DEFDD19EAE189D44B04E8 pentiumfrancois
438,335,773 *2C6F13DA02E4A50C731FFD368103C25198FCE61A PETERKNOELL
438,335,774 *2C6F8FE603B00FD6266C32ECD798ACDE3372FC70 IRVINFLENIKEN
438,335,775 *2C664EA2449F8E4C6D861E9CC3B40C93221A3B0B ELMOMCBEAN
438,335,776 *2C60B9934CDE76341E4A8BDE9E52D59DC155F8E5 ELMOREHNQUIST
438,335,777 *2C68F3FABDE4396BA39820C46B7B406E960174FA ISAE-SUP
438,335,778 *2C60A658F60023C3988A922D155A2EB3F04D2332 PHILA2
438,335,779 *2C6E6116E0F4B4143DE4672436E882F2B9233F76 phlegyans7
438,335,780 *2C66733121B70FC1FF6FA69F4089F07E7385DA99 IŞTRIAK
438,335,781 *2C6D2B3A6F4BC7E061CAE41C18D45DE8C2E235F4 EMILEMORRON
438,335,782 *2C61698C1222EDE03CCC3DC687CCAC5AE6440061 ITYAAMA1
438,335,783 *2C65032E311621C8CA6C1FFD97E6990F10D0C951 EMMAMAYA
438,335,784 *2C6CF60DDBE0D8059CD2124197E13F29CFFB3623 pickmaws8
438,335,785 *2C638F4D4114F1C499CDF0DFEE61731089804E4E ERHMU
438,335,786 *2C60FF5243B4031ED4C5E6408325D26F8753FC46 JAMAALAXSON
438,335,787 *2C670934E8A3421AE3B32D03A4AE258ED2DD4816 erkwkqi29
438,335,788 *2C659E8C0DF944510C90CF5E817EF31EDEABDD3A p==p-~o~o-{x}
438,335,789 *2C6D7B4127B5F4DADE9BC0728F045A45C420649E pp`~`~}x{
438,335,790 *2C64E472A898B3E93F0B8BBC4149656E001D8D25 PPZ
438,335,791 *2C67CB1ADF66561CFF450B16F1AE65DBD5E8BBEF espurgare5
438,335,792 *2C639821C18C49D393EAEC536460D4C038971B27 essentialbonjovi
438,335,793 *2C6C15D2E37CB0379DC8F9B7836D68C55D952719 et&_e
438,335,794 *2C63D43B7C7A24106D9F209A87D9F822D97044E8 prestonlingafelter
438,335,795 *2C66208EC31D369A5D73C5A44571F42FF33AF42C EVALUAN
438,335,796 *2C69C05E43E337CC460A092AB362A825B42A062F jasonnevins(globalclubmix)
438,335,797 *2C64971C387D112C73041B45BBF42498799A17E2 exculpa+!0n5
438,335,798 *2C636C6AA1BF6EB9ED08B878E5E3301B0C08E238 extinguen3
438,335,799 *2C65795CAD3B87AA083B4E7C5EF574F4914618E9 ),這是來自太陽的紫外線與環中的冰交互作用而產生的。水分子之間的鏈結受到紫外線的刺激產生化學作用釋放出並拋出了氣體,尤其是O
438,335,800 *2C617522954FA9EA93F778393612C4367E0FCC7A pyrenñes
438,335,801 *2C67E3E36907B15294534F4CBB4FFEC1A753785E [email protected]~0.(>_0)
438,335,802 *2C66E8B0DC4BDA50946A50956142C735037B8219 EZRA.UEHARA
438,335,803 *2C679D349F5D1AF7B65FFE38306A6B7C0DE743FC 高﨑正弘:三井住友銀行(SMBC
438,335,804 *2C650364626420B8C9AA5F1FB117B8EE06D5EFD6 jerry-musni
438,335,805 *2C61D26B9B863C6C1ED8EFB688D2A9AEFCCD6804 Q===B***(><)
438,335,806 *2C691B1509DBDBF3FAAEB3DA81EF4E86D4C1FC8A fac31ift
438,335,807 *2C67BC86D5FB0C5E947EA847BBF736D189D4FDA4 [email protected]
438,335,808 *2C62DE1802F5EA5CADC2E0C844A9C0805ED6D705 [email protected]
438,335,809 *2C68F17435B10C1E22DD986BC064B71C9C8F428C QO_UERLSFGUDDA
438,335,810 *2C6683252EFC584D668FD8ABC78B793B35DEC287 JINSHINH3
438,335,811 *2C66D36C90CC40A9723F500C640ADF0A76A6149F J'M'EXCUSE
438,335,812 *2C6A9FB27F4E5E9872E690F72F70E90FE30D18F7 Q##>* SPLAT
438,335,813 *2C6FB8FFFBABC347A380F0ADC334555B95853095 JOAQUIN.REASOR
438,335,814 *2C65C5800B3C50B89CF1135A7F72CFCDCAE0F394 [email protected]
438,335,815 *2C64B5478F850E6EF771CA22B4A3BC5638E08D1D [email protected]
438,335,816 *2C69E757454A14CDC3E76F0DD29D8DE2C45BEA08 JOHNWJOHNSON
438,335,817 *2C65E5FE69DE3A0EAF4314DE2097CB45F7BC20CD QuietIslands(demo)
438,335,818 *2C6CA1FDCB39AFF3F37262E68700E7861B4A0B64 007dart
438,335,819 *2C6A4839882062492AAE79C27FD5DFD2FEA11A94 R4DI073L3M37RIC
438,335,820 *2C60A474A8D82E416EEB9B583F2B82EA8C91B398 randolphtriplet
438,335,821 *2C62468EBAC84049EF5D602004B6375AA704C38F RASCALZ1
438,335,822 *2C6C2CFF9E1331050C1A3AE28655DAE6AF7F2D0E 0iamwinter9
438,335,823 *2C61340DF836F154204B9526CC10E373282FC5D5 FF9
438,335,824 *2C617B299CDF4DFA743D58500321DC6721EDF822 1000-mirrors-(sun-j-remix)
438,335,825 *2C6A7576EA8BB6BC0B921CF29BF4C3B7FEAD4DF8 JOSUE.LINGAFELT
438,335,826 *2C6D29FD9FB84347847EAE5EBE0FE6C017771E28 JOVELYNDEGUZMAN
438,335,827 *2C65F554886A20C0BD53348DD0985457DDAB477F JOYMARINDUQUE
438,335,828 *2C6FD2B458E16828DEC96452DBA5C3733DC44E48 fidelmaccoll
438,335,829 *2C6402EDBBBEAB2E573F7E77838A1CFFDA3F1D4C [email protected]
438,335,830 *2C6FBDBBBA89B615FDFBD9707D461080B7F458B7 1042COLT
438,335,831 *2C6E7A1510D6BAFD05A406D1562E37C7EA36A8BA 110617 tarkoitus on tietenkin p
438,335,832 *2C6CBF9BA7C90CA3B3221337523174ED3975AD1C 11-sillassa
438,335,833 *2C6E27CE099C203B0F9221ADB2CA04F0676808EC REBMAWMB
438,335,834 *2C6AC4B1360973F662DBD1D4C196117677D37160 JUDEAMADON
438,335,835 *2C6CCEAA9963D97B995FAC6E612139B6F15644D7 [email protected]
438,335,836 *2C6FC2624CDF1D9E0296945B2DBDFD2C56A0A4A5 julianfansler
438,335,837 *2C65D791CC0B9CB1363336BAD225C38A99D5C731 RECOMPTA2
438,335,838 *2C6589BCD3CE3D6FD3CC15A1125ED45A6BEA8F9E [email protected]
438,335,839 *2C6043AF197F4CCE1DE59A4FABF478ACE7FB5DEF $13D D0G
438,335,840 *2C6CF3AF68730908AE47186D684E36E1CD5A1EDC justinn7
438,335,841 *2C632EF7ABC847F3B9FD12D02DC40926A7A20531 FOOLHELL1
438,335,842 *2C6A5EF9E3C06FB48B8879F36EC07A09D3000B76 14OCT1550
438,335,843 *2C6EEE5E2B7307C2BB3967B90AE4FD0ED04F9EC0 REILATINEG
438,335,844 *2C6B5AD03044BED9D735DFE4AB2D4532AE3730CB REINALDO.BRETL
438,335,845 *2C69FEA6942F03BEFDA86397226AFAB7385E5F60 1566119 takkulan perheen tukkakirjassa esitell
438,335,846 *2C6AE2B811E68A00BDD6F965C6E80F2DC3855C14 REKCANKNED
438,335,847 *2C615F94E2AED3615993CA1A659BFFAB2DAC8420 [email protected]
438,335,848 *2C6B0C08A707E184FF8858B5B45A86F3480CAAAC REMARGARINES
438,335,849 *2C6EB8217CF6530E7A221F310DE64B64419502E9 16AYLIN
438,335,850 *2C6924B2B27DAB2AA7410EF1F0577FC68B19F752 F.P.1FAHRENHEIT
438,335,851 *2C6902EE43A3B0E00ED029D3CA87B35DB6707738 frac7iona1ize
438,335,852 *2C6D0CEF34BFDEB2D71E1F4D6CCA95352C41C179 represjonowanych
438,335,853 *2C644A5EED01BD2256881497DC03C417E62BF83F resonaste
438,335,854 *2C68C1CFA36820C9A38643CE160B03081A1B745C 19TUTMUSTU
438,335,855 *2C6CFDBDA8BF2C067471035228E03C9C9931EDEC 1ACCULAVA
438,335,856 *2C6700B374FE9B65D72BC004B878AA81F2180EBD 1 AIRA-PROJEKTIN
438,335,857 *2C6ECDF00EEAF31A83F42C75668BA9FA2645F58E [email protected]
438,335,858 *2C642DAA762AC0061AAE30B1F569F7A4A510DB2B frkortningens
438,335,859 *2C6F6C58C6650609348047A1705326A663B216C4 rev!$!+
438,335,860 *2C632B7CFA015681D3873AC7898AB925BB9DA451 REXEMPLEN1
438,335,861 *2C69081EBF830138891417D892F6132FB2CBFF15 FUJQ
438,335,862 *2C6BCC8145DF54F743428AF8AC45A87F43069407 1-buchrechtehandel
438,335,863 *2C67CB2690D5F7E61BBF40E6752A23FF4B62ADB2 [email protected]
438,335,864 *2C662C21F5160CC89EFA5E033797D04226F44B35 FUNCTIEWAORD
438,335,865 *2C6BB0375081F73C9939BC026BD862F121729C64 FY.C#$
438,335,866 *2C64B3FFC42DD1063AD4A7C085D154249AE02AD0 KELVINKUZNICKI
438,335,867 *2C60CCEBA5A2B73D1875FA893784F289BA80254F 1CONSULARIS
438,335,868 *2C62DF3DA4503BF55ACF8D07C61BBB5FD1546A59 [email protected]
438,335,869 *2C6E89832538D06C557E7AB699B01C659042A8B0 gabriella-guillen
438,335,870 *2C6B8108D766E6BE37941AC86C5AA90E54327DA0 RICARDO-VILLARROEL
438,335,871 *2C6C0B28027927CD1C859FE37C6A2607095F4944 RICHARCJ
438,335,872 *2C65927DDF394DBC434338EBBCA00DCF16751522 KERRYVALVO
438,335,873 *2C62663CD49E771E06CDE2AC853D615CC631D879 kgaaaa
438,335,874 *2C619AAB8B1F345902096F09A021F115DA17656E KIELBASA8
438,335,875 *2C66C7E7BD9F9B47EFE9C51B5BCCF8A5013A166A risoris7
438,335,876 *2C6C5BBA184105EC90D68D5F4E4217024795DF64 kiransamina
438,335,877 *2C607E57C4C54A7679F379C2BDD3ACCAD4AE9B92 1hein
438,335,878 *2C6F3CC679D54DFC2C6CE0D8F84A91DD2AF70F3F 1.HERITAGE-ESITTEEST
438,335,879 *2C6295720EBCBCE903201A10A5F634E909ED9676 kiszyniowskie
438,335,880 *2C62557C5FC888ECE0C5BB16C4D0EB59FC1E7E2B knightsentropy
438,335,881 *2C603B5F599A04685E974A58DF3A07AAC8EB1410 1-KONSUMBIOGRAFIEN
438,335,882 *2C693AF3ED4EB4E8CF925CDB23819CD0D23CFE19 GEETANJALI MAHAJAN
438,335,883 *2C612AEC6C24577500F65ECD40C20E40DEB9EA34 GENE.ESKAF
438,335,884 *2C63E6C7E87AD62A90C583E507A313BEEC583B3F geniusdoobie
438,335,885 *2C62802487CB7647C064D3276AF55470FC496C9E geraldofristoe
438,335,886 *2C6DB6BB62FD4EB6667986EA3E6E13CABB8EE59F 1.mallitulosteista
438,335,887 *2C62FD454112EE80E9564F3540286B08A327C6B4 KRENELKA6
438,335,888 *2C6BF18E93864E5AC794F6F71BF4BC7A2376B734 KROTKIJES
438,335,889 *2C69C012617711518E4BEE20D724549F87087369 KRUIDTUI9
438,335,890 *2C6FE7EF3AF2006140585B6F5364320C2FFDC9CA ROELVALDEZ
438,335,891 *2C674E69EB94B9574E74B4758742B252399E0731 KUNIAWA
438,335,892 *2C69DF5C6A0DE246A7C7C747C2551CC465BBE3B3 GILBERT.FOSHAY
438,335,893 *2C60215B51D75BEC6C60A69C3EDE22E952467EBF GILBERTOALZAGA
438,335,894 *2C6505E9F57CC5781C527C036980A3BF1D0797B2 GILBERTO.MARQUES
438,335,895 *2C6FEF4D17B86C5F9AB70D97F738DC8D9895E775 rolandoherrnandez
438,335,896 *2C639B8977693FF7569EF51E14B017C1E16D0144 GINO.GUTTMAN
438,335,897 *2C63B0F344953ADA79949044EA433F2FF54A64A1 ROLLANDDENBOER
438,335,898 *2C69CD1670AF231423B52950C66D22293C12066A 1plummet-every
438,335,899 *2C69406931549731C57BAEEB422446D2D04E7A1C 1POPSEIREENIT
438,335,900 *2C6CE49ADC182220BB01B8B2BA7A7D6E2CB04994 1postbreeders
438,335,901 *2C69D33CF3347D66B2BE1D7ECB7CE038210DCF57 GIUSEPPE.LOEHRS
438,335,902 *2C6A148B5815A6ABBF0607EE857DE508757F0423 glammalg
438,335,903 *2C61D1439F762E0824978C41CAFB263FE4BCFD94 GLENSCAMMON
438,335,904 *2C6D9DC56B0BD1E3BDDD2E971BD0C27CD53EBF12 [email protected]
438,335,905 *2C68E121CAD5849346980CB3EB84A123116AE475 GLYPTODONY
438,335,906 *2C6E5780BFE2A54EA5B145EA3FAF2617FB6C34CC GMN"
438,335,907 *2C65446470AD235EE42B71AE9E701E95B7444081 RON RON HERNANDEZ
438,335,908 *2C660C682E28D15A0C42E9A8BDD11CDB09B36328 Going.Back.to.Alabam
438,335,909 *2C6E08B51B698F111F7A6270094813A5187C53AF GONGUTE
438,335,910 *2C65F883438ABA2C6A6186BA2A515FAA6D7CA2CA Good.Morning.Good.Morning.(Home.demo)
438,335,911 *2C6B4C6A7AB3ED795CBEE1AD9AFFE961E98F033D GOOD-SPIRITED.9
438,335,912 *2C6496060DC3A62690BC0E5625CFD94D578BABBB gopacers6
438,335,913 *2C6DE504CEA78714CC201763E1F081C00375EFD9 ROSCOEOVERWEG
438,335,914 *2C6CAB69EE313F7BE35DF95700D34EDFCB61EFAE GRADYSOMMELLA
438,335,915 *2C68AF4369847888E8F58A434D8F5C3E2B79EF9B GRAEME-HOUGH
438,335,916 *2C66AC3042AE679FDBA3D214581396F0B1240C15 GRAHAM.WAHS
438,335,917 *2C652EE00319E20AEDACBF870CDC2991F6B95D41 GRAINLAD
438,335,918 *2C6A3E52C2B7AEC68090531536968A371BBA110B 1.TUULITURBIINIT
438,335,919 *2C6C06DF5628D114DAA20A0448BC359C1250FAF7 [email protected]@+35HIP5
438,335,920 *2C6ECC1A925427FE738F4D081EEAD794B99468B8 great-moments-with-bb-king
438,335,921 *2C69DD96F332ABFF09FE687B6B36B54F7560DE31 gregselden
438,335,922 *2C60579198223E4FCD2E0AAC0168C1A6603BC9A3 GROCER»
438,335,923 *2C65CE2F45FBAB4DEA8000C88E218ED7C0A78641 GROSSHANSDORF
438,335,924 *2C64D2342F04981E483B4DC778B1A48936C1F1BA GSDEXCHT8
438,335,925 *2C65AD443ADCBE660BEBFA07F6C37CE126D8AA93 [email protected]
438,335,926 *2C6D8536FB5B1A50C0A339BB26B952A3B0346393 [email protected]
438,335,927 *2C61F8590E1C386D2145195D4EF65B571E207BCB RUBENBRIANO
438,335,928 *2C6C8C422F17AE541CF6F8F5C5B5DAADE3F54D1A laneshofner
438,335,929 *2C64927D2B354B01F186E7EB37FCD36EA27FF279 RUGGEGRAATLOZE9
438,335,930 *2C642B707BC44D3DD7141CFEA5484E85B3038FF3 2115444 ein hoehepunkt wird das kugelstossen
438,335,931 *2C684428A22251B3072BB3AD3843289142EF9EAB russelbs
438,335,932 *2C67366806A9B4A7E5C2C636D78D4358919BFFC4 russwoelfle
438,335,933 *2C6B0B954A9F48C0C9B4541FDA1A5CD5A743D455 ryan.daulton
438,335,934 *2C63DFD1FDE4CC8BB27C6E6E1866CDCD4863D786 s+34l+h3s+
438,335,935 *2C6D7DE8036363E36EBCB1B507B07AD997862C7D HAIAUSWAHL
438,335,936 *2C6F9078F17FA0E915EA8CF43E14D26CFCC508E7 2305018 RUND ZWEI DRITTEL DER PERUANER LEBEN IM ELEND
438,335,937 *2C626F8938BED89E5C767333D064F33459D6F074 [email protected]
438,335,938 *2C6C0DFA55677AA2C4CC36E6D9EAD5C21DBD3D91 hallucin0$i$
438,335,939 *2C647751116B3AF8B1A8BEA3CAEED51236E03783 [email protected]
438,335,940 *2C6F25E847CBDB64D2DDEAAE4A2897A39FE92F5D SACWIJNING
438,335,941 *2C61ECC8F52461E8657AA3DF9A5A94B552ACF72C HAPPYSKYG
438,335,942 *2C6291769B024B3009717F6C17D7C3606A83D408 [email protected]
438,335,943 *2C6852F39895280B501A7CAC908FF95851FB29D2 LEGALLYBLONDE54
438,335,944 *2C670FEF4EB9F61D3EC8E94F8728012DDCDBA75E harveypsilovikos
438,335,945 *2C63F34BD739591A6D161698EA97A1CFB64C738E 2825655 THAT'S-WHERE-SPARKY'S-OWNER-,-KRIS-BRYANT-,-COMES-IN-.
438,335,946 *2C61FB5368DADE12CFF216D0E3BAC1E45C8D8EA5 lelieachtigst1
438,335,947 *2C6FB95C6EF4A9D9F671E44FB77FBB10F2673FF8 HAWAIIPEOPLE
438,335,948 *2C6E1EB72834DAF186CAD25CE60B671BD44A028F LEONELTOMSICH
438,335,949 *2C60145A97955C19519D0B5A9FA7F66F5AF11900 LEON.GIACCIO
438,335,950 *2C687E247B06686A6C604F1A583249027902C3C9 SAMOVOLN9
438,335,951 *2C6977DAA60286A279BBA0D1389648382C1C5A79 SAMRIEGEL
438,335,952 *2C67A76F68220401C08DCC2D9B261A8367550305 HEIDI VAN DAM
438,335,953 *2C6E36BAD2017E9F868B711D8DDA78B05D4C4FD7 2FGHBIGMAC
438,335,954 *2C63933A8A04212DAC774E1CD20405A2EA945B7F LEWISKAUMANS
438,335,955 *2C6CC0AEABF3F00315364EAE1222F66237ECD1FF henles-neos
438,335,956 *2C65428904DB787B8BE75974806EE62FC763F493 2IAMGERALD6
438,335,957 *2C609198AF47FE05D344A90ED4568F3D3E106327 [email protected]
438,335,958 *2C6C4BF127CDAE0772C019A4D2C8D5C8606FDF98 Liberamente
438,335,959 *2C6499EEE1F1452968AE615D06E70834CAE49F3D HERSCHELCALK
438,335,960 *2C6E58FA2BB22E8DE8EC2C40803BA78C2A8534CA 2MGNLAXU
438,335,961 *2C6EA25F8E2524F87F5A05B2858336E348704D35 HEXIMOB01
438,335,962 *2C625B496B7C7FB82BFBDF328B8165241F2DCA11 SARAHMAEN
438,335,963 *2C6A753A5A85FDD8C297B7D2D93096D770A9990A 2TERTIAN
438,335,964 *2C613BD044DF633FB9DE5584E491D559FE422113 2THEFERRIS4
438,335,965 *2C69C275B1D5E4860AE7C2392CF89F7BECDC07A2 saulstealey
438,335,966 *2C645552828F8E4E1E928F84A0B685A084A7F480 2WHORLEY
438,335,967 *2C6F94143CF765BC8D6E1814B8EB440A6176E02E 2YOMIKON
438,335,968 *2C6DC13A034D0DFB2094A2BCD4A151451E85A265 301logan
438,335,969 *2C62AB381EE95FB872C969C492C3838AFD34D588 30.bestpaid
438,335,970 *2C6A2091EE11583A2C6018BEF5376A8B21FFDF02 32 GUADALAJARA
438,335,971 *2C61363A9FAA6B4AAA224946D0AA2F7CA7B21D1E LINDSEY.DEVENS
438,335,972 *2C6F7049E5DF51E1623C0BC912AD841EC0C25547 [email protected]
438,335,973 *2C6A469385572610AAA5C61B0825D8E1AC0A59D3 382813 erotik
438,335,974 *2C62C22F13E4E554D1D99F78E5E8EFFACEED2245 HMLA169
438,335,975 *2C64261481972E56F8F7E7E32113EDFB8866F1AE HOLLIS.RITSCHARD
438,335,976 *2C6708202768FF440AF0574F49FF5290209F0B77 holyfuckingghost
438,335,977 *2C606F90959CBD91F5F3121BD27F6CA604F094DB [email protected]
438,335,978 *2C675D2001D8F72D5009A60E41F1199350593142 hotspurs
438,335,979 *2C62D2F77BDC018F7C2B817B3AF3D1E8DFB5EBB6 SBAVATORI8
438,335,980 *2C6F87B1C01E7CC4617C42BD3FD5ED0EF2EF58A6 SB-MANCHAKAI
438,335,981 *2C64DF2995D9A370ECD6982CB980A4BEBBCE09B7 3-GESAMTANSTIEGS
438,335,982 *2C6B97D36908FAF907CBCC90159735118B482D05 3GUBKOOB
438,335,983 *2C6A974353EAB9D19E7BE48A6E67B6F3F6C4DA44 3.HAPANTUOTTEET
438,335,984 *2C6EA0BE108CACFD1895B8A848BB850231D343EF hoytlavole
438,335,985 *2C64C8789A3A4386B76DB447767FD7E44C7D7050 LITHI4T3
438,335,986 *2C621C4FB1C535C4FB7F435B67BF06AB9239A89F LIU05131983
438,335,987 *2C6A83B9A23930CD2185A37DF4AB0EF968E973BA 3kipuilla
438,335,988 *2C61BED59AFBD0D66CFCD53B143C62B65327E1FE 3###>.`.)o(
438,335,989 *2C6BC69092CC80EF57911672786D3DC8D8E1E745 3OPDIRKEN
438,335,990 *2C616CBBCD235464A3472349D69462B19D35EA00 scottiebaerman
438,335,991 *2C63B936DBC2E9B5BB068C5A058B71651388BE3F 3RIBASSATA
438,335,992 *2C66272DE9EFC2B42DEFE7E9C4454C1A2E4E6699 SEALEDU9
438,335,993 *2C608160D42E82CC8EA0266F02B736B80D1A8627 [email protected]
438,335,994 *2C6F3A175A7C2F2B8EBE9E7F0056F8E397323B80 lmto、kkrはfp
438,335,995 *2C67571EE1C0D5A130AD3CDBBC39E86BBBFB5265 [email protected]
438,335,996 *2C6330477B495D660455FA57E01C6FC2C64CEA1E 3SUOVRUC
438,335,997 *2C6DBC969612DCA93F6D6CAEEFB06A9FD94C8400 [email protected]
438,335,998 *2C643C0199FC9AE1C413099545D40AF147C7BB4C 3thevideo6
438,335,999 *2C63427DD37329FE03C4510C18564943A9070FB4 [email protected]
438,336,000 *2C68D570048D1A5481AD6499A3CF23D46C5DEF63 SECONDTEAM0
438,336,001 *2C67D91FCCCD717C5744438989661B35E3B4F707 HULDSON
438,336,002 *2C6C3FA6727F249824F62595029D8BF24170EC1D SEDNEREIRF
438,336,003 *2C66887F53666CEC4D462A646ACF0CA1715FF58E SEE.AROUND.YOU
438,336,004 *2C601D8680247E316790B8CFD0554973066D9207 LOST YOUR GOOD THING NOW
438,336,005 *2C6A3E221EA4E8B52A7BFF69762254820BEE2045 [email protected]
438,336,006 *2C659EB1FDCF0ACEB99703C5F868C387DD44E0E4 SELACHOPHOBESED
438,336,007 *2C692C7ADBC0047AA46499A7EAD757033A580AED HUSSAIN ATHAR
438,336,008 *2C6551ACB0AB7BA9445AE4BE1112D583B724C164 senkenbergischen
438,336,009 *2C669680A405F9875E5530A15EAD3B873DF3C4A6 4-analphabetischer
438,336,010 *2C671BD5089812F00DDFE664791E9009022495B0 septiers1
438,336,011 *2C667E18019E9A237FE1F6E65FC38C746D9DD3E5 seropositive1
438,336,012 *2C68EA421DC4B5F0A5DDDEC89B37B12980E3363D IAMAWESOME91
438,336,013 *2C64F121B5503BFB3DBBDA14DD91E0083EDE4770 IAMCRUISE1998
438,336,014 *2C60371F1C26699B30093CCB57916C46D2B2799D shabbar.saeed
438,336,015 *2C6D8DE3FC98CB370D04FCAE2D6ACB0168E30853 [email protected]
438,336,016 *2C68170BCEE5BCFEA4DE0745332F3A4E4F5FAD5F 4.LAWTON
438,336,017 *2C619CA67D661AAD81DACD3CCCA95DD64EF05B07 L*XY
438,336,018 *2C6C0F6A4AD17A15BE15819A9CC1A916EE4BD6F6 lyocarpus
438,336,019 *2C6F4C9B3959B98BD608B461635EF81F536E5A43 I DO ARREST THEE, TRAITOR, OF HIGH TREASON:
438,336,020 *2C6FAF3D00B88C60988728388C40DEFA8226BD4A shattereddreams(daveaudeclubremix)
438,336,021 *2C69D264264CC8A34B9ADCCA534C0D70FA7DECCA 4RCERIZES
438,336,022 *2C6CB05B9207B5F10C457A14F8B8CC908EFA8E68 SHEHORN12
438,336,023 *2C64E52BFC920CB3F6C9AF5AC07B5E160C818F5C mac-collard
438,336,024 *2C67B3CA99617F414601A51AB078C9D273512180 MADAPTIVE
438,336,025 *2C69C113237B7297CEE646AE825B3AC1B32FAB91 4TERRYSTINKY
438,336,026 *2C6947BD98438F95FABECF427715AD6EDC5E4A5F IKUUPNES8
438,336,027 *2C68BBC6A98FCBA787CC3090491C5358B51C10AF mailmanpopeye
438,336,028 *2C6E94F42CD052EEFBC706B04E53CC02C62C20EB 4TTRTSBUSTT
438,336,029 *2C64E9833DB5CA3748C970413680A7903D996E9E illcontrived
438,336,030 *2C60ACF5DEF8E2945E7AB33476E6BC0CA84A9F8B ILOVEINSIDE58
438,336,031 *2C65808ADFDC50E851135C143FF7C3A5C0528495 50a5efd49ffa42595d27d7de8f606bf9.wAjeCkgD
438,336,032 *2C69C5B9C1A8F1F2C7EA561F87394C703412BE67 [email protected]
438,336,033 *2C6D41CB876289C00E58F14E5BC18284E21B02A2 SIARERREFNE3
438,336,034 *2C6A679EAA02974B151BB7AFE5EF20C7E98F71E0 ILUVJIMMY92
438,336,035 *2C691DE92CCC748F008F59A6F987F88F72C78C4B MARC.MALERBA
438,336,036 *2C63BB82953301F9952C5AC9E140FB10BDF61329 587441 etenkin ammattitaitoaan kehitt
438,336,037 *2C68E485297E27BD5A8B513F5B9BFDAA17859C38 imageusfccsealsvg
438,336,038 *2C681B734CDE94B7412BA2A6B69E942B5A241FCB SILEMANI2
438,336,039 *2C635D24337C3689DC2EC85FC8C4C19225953A03 [email protected]
438,336,040 *2C6A95A75AD0F682A449CF2108A32B765EA26103 simazhao
438,336,041 *2C6926502D23D6C40D7817CFFB4B5C4CF3D897C4 INALLULU1
438,336,042 *2C62086EFC73B9DDC8183463E389913A5AE2C3A5 inceppa3
438,336,043 *2C64136BDFB4CB4DDBAA22D094E4E2EE673A7481 ‏MARKHAM
438,336,044 *2C63703B5AB00D3A1C47126B063FDF3A4A6FC9E5 INFOBOX COMMUNE DE CHYPREDOCUMENTATION
438,336,045 *2C6B771A371C6193488CF0DD35D2ABC3FC8D1AB9 MARQUISDIACO
438,336,046 *2C673AA0D0401E631DF0F61B7B89F47CF3068349 SITTIKANKEAW
438,336,047 *2C630429D7456C05848B560BC2909E057AA91A7D sk4nne
438,336,048 *2C6C3783EE10645974661D32765EBD0361CD2D57 INSINUAM3
438,336,049 *2C68D611DADBA4233D92EDB3AD2E59E4AB558C2B [email protected]
438,336,050 *2C63D640DB02DDD597E66684BDDB221480603874 5FINICALLYV
438,336,051 *2C6172A2F5BA3C4C68F545110CE6B1B82B8563F8 MASONCARSEY
438,336,052 *2C6EB9AF00523EEC0F3E60060C7689B2A7A13911 matera..m.aa0.t.eh1.r.ah0
438,336,053 *2C686AF912C4E46A2696A7AE26621951110CF3EE MATKUSTAJALUVUISSAAN
438,336,054 *2C6A16C3423AF6014647E7F4681B81F359D0259E mattlang
438,336,055 *2C6986897C38715A811DE1700BD3A86DF3850CCE snapreading
438,336,056 *2C681267A29C0DB5054F7ACCA2B14DE86FE27A2F SNAZRAT
438,336,057 *2C6904F9D31050C64319A2992A561E4473C4EBC8 SOBRESCRIBIRIVE0
438,336,058 *2C67208E572C313BE4E0688AA7168DB0B6711159 [email protected]
438,336,059 *2C6CEC66C8AE11CFACB1A950CF8E436B0E6DF977 mboverla6
438,336,060 *2C6AE71847EA1E9AD0D6E0CE938D04FBC46E3F53 ISAAC.VAID
438,336,061 *2C64CF2059C25AB11AC1ED948F95F9F8963AFEC8 ISAACYETSKO
438,336,062 *2C6145A4C2B7F8B64E3F7C80F2C7D7696E84FD88 SOLECISEDS8
438,336,063 *2C6EB4D8F566FF31326729B95B960DE9F1453651 MDUMOUCH6
438,336,064 *2C694F95ED3B573879E98BFC0B040DB9872E1AF6 SÓLSKIPANIN
438,336,065 *2C69AD6943835BEF7DC027114F75E716EF661D8F ISLANDPRO
438,336,066 *2C6D4D44B917FA725FCA6597E5CF8BE9BE320176 SONATA IN D MAJOR, HOB XVI-42: I. ANDANTE CON ESPRESIONE
438,336,067 *2C6AFE7B59EDE8789E606ABB225C2A81A626599E 5SUNDANCEEAGLES
438,336,068 *2C64CD9A3E53C92AB98DBCFE81F282AFCB242BFA melissa.soong
438,336,069 *2C6590CA00E9B8982D5FD3030AC4161BAB821B01 [email protected]
438,336,070 *2C68C744E45C6ED363B4376F6165A71774798853 SONGTALE4EVER
438,336,071 *2C656996BF4123FA199DACF4C7F3AFF212D33FFC IT THE TERRA P-FUNK FROM BEYOND SPACE
438,336,072 *2C63A409C743459BFABDA70B61CC36D2EB542CED MERIJTJE
438,336,073 *2C61DA43468BCC59BB27E6CC3F733EBE09DEC59A 5WINIKAY
438,336,074 *2C6F3B6C88ED2A327D83FF96103C1159DC0F32D7 MERRILL.BEYETT
438,336,075 *2C69BCC5836A33FEC2A89D2F0749BD6F29F39067 SOVINISTIKA4
438,336,076 *2C68815CACDFAA7D06F2C210E7909A98DF31FF94 600KELLEN
438,336,077 *2C634D86F127C9CEA6A724CE0A47C70BB1A451DF 634652 theindustryasawholeissick,too.
438,336,078 *2C668B004FEC166FDF88AE8E7D5AB02788C7355F 635994 ikinci.yarida.konusulacak.cok.sey.olacak.kuskusuz..
438,336,079 *2C6E5B6E705794953127B7481E211EFBCF314938 METHOD_PROTECTEDPNG
438,336,080 *2C6D37CB9793CFD4102D109479602F517A0D6556 6844862ea74727b293efdb80b7611bca-q336abl
438,336,081 *2C60CBD0A30EB2873C2624C8826C799D9F7A4A4A SPASEN“
438,336,082 *2C6FB26933DABA8BD009CEDA209E4724A95994BC SPEKTAKLU6
438,336,083 *2C691423287E99655E5678B813D81F8E78A479C0 6BINAGEBINAGE
438,336,084 *2C6C102432FD6E2D54792DBFF8428EF374C71B12 SPIGIONANDOSI5
438,336,085 *2C6A3592FEFC4D0D5FFDC1CFCC1CEA5CDDE3F8E0 spirocheticidals
438,336,086 *2C6CBDBC0B1F22FE01FAA87BE63E253BA4224375 JAKUBMKT
438,336,087 *2C6A0601B2D4EB8C5E63B638A1E45B2C28B035BB SPLAT.O~O~(-----P
438,336,088 *2C638976220405CF04F1ABEB2C2EA2B427486A34 6CIPFFENZBAL
438,336,089 *2C62BD327F3713F50B142870B5574B24028D53B3 [email protected]
438,336,090 *2C6C9F96CA7F9B5C5086D1B5E4A5429CB0A99FA5 JAMIEMILNES
438,336,091 *2C6504C2912EC7079F0C51CFCE61B21C4DCEC634 6EOOYKEEB
438,336,092 *2C676D1F2A44D1E646680DE15EB98C5717863056 6-ERNO
438,336,093 *2C619A1611568F21596E715D1BB418E038862154 milanochal
438,336,094 *2C695AB3052D7CE3E1823D3AE19A8A892357759D MILFORDBAZZLE
438,336,095 *2C6E28EEA04D0F1FF3639314ECC37AB821F9FBE0 6GUIDOCHICO
438,336,096 *2C6C21C14A153116656B368B5477451CBE6D25FE 6HOAAA
438,336,097 *2C6E01A19D4318AB51FA0FEC98F5FCDDBD25AB4C [email protected]
438,336,098 *2C6D06B2BCE609E7E439722AE369887415F6EE3D minhrapa
438,336,099 *2C60A9C5AF9AB294430C6DF5F51C983016C232EB mininderinkhockeydesmoinsdeansjpg
438,336,100 *2C6AE38189AC49FBE7DAF9E7337D1D742F4053DD MISREMEMBRANCE1234
438,336,101 *2C61C301527259E4C8C1E6763503D82863908D74 missyou(pascalfeosedit)
438,336,102 *2C6C15E4B147591B4E4315A297E0371DC9344BB1 6KBESTDDETS
438,336,103 *2C6533E768326C7FBC75B8CDD05C6C95687D663D JAYSONJOAS
438,336,104 *2C61B24E4CB9A967BA80F46B6FF4ADA61653CC87 JAYYBABEZ
438,336,105 *2C654CF51B84DB1A99A3D94EAB23E53F99648BA2 stacey-millican
438,336,106 *2C6D9A7AAFC17586DB88D16395F6ECEBDD42CB1E 6RESSERVIRAISES
438,336,107 *2C67912B8AF8EF63A4BD948CC2036B695006C926 6SCHNEIDWALZE
438,336,108 *2C644EE8A724FA05C9DE2A78F237F9A98B2C88CB 6UDSTRMMER
438,336,109 *2C6CCC4A6FE54B27176CF6BBA422634B7700385A steinlagerrugbyawardswinners
438,336,110 *2C65E399E68CA5EB2391AED81E2B0F74B607CE54 MN$<
438,336,111 *2C6DB5D17B8BB5365977AE0DDB2983AB6619CB87 759FY
438,336,112 *2C67DF63730EF00544F32D9C21CCECA9E5A23BC3 STEVENSTOVELL
438,336,113 *2C69F1106630DF96812AC8B8DC11884983B31728 stevepassaretti
438,336,114 *2C698F3D90CCFF3D589AB3A63E41DC43701C7ADE steve-zampedri
438,336,115 *2C6DC5A38D71BD57229D7C5AB1F4CFEEB0A26789 STEVIEFLECHSIG
438,336,116 *2C6224D340EEBDB1DEACD699E68569D080A5F6D8 STEWARTURTEAGA
438,336,117 *2C6092AC1254D8FAFE7FD9C0334FA36F40303F4A JEREMIAHMOYER
438,336,118 *2C6419FCA59B77974B9B97A3E536A123D3E17E6A STOLONS
438,336,119 *2C62791DAF146CC31A805FC1DE91A77F96DE880E STROMAT9
438,336,120 *2C63FE6EFBB93881027C151FDBB64432A2386083 mordellistenaepisternaloides
438,336,121 *2C62FA3F73E6BD1BDFBB743FA68998D9A317149B MORECATS31
438,336,122 *2C665E503D8562FDE06C8B43AA4041830045158A JINI1259
438,336,123 *2C6415E387883E5EBD0240861118D21ED6B27CBC [email protected]
438,336,124 *2C61A3B50E1D1354F6C9B53A6FCF63CA6A8D56FA 7DANUBERIVER
438,336,125 *2C6481DBFA338B227E732B9D35BC013D04E2CF62 MOSORAN9
438,336,126 *2C6070905443A02618613F2AE8B64E162747FC55 [email protected]
438,336,127 *2C6A1EC1A4304BEE870C08B257848D49F295EFFA [email protected]
438,336,128 *2C675BDFC71BE45C2B978486A962C091DEB237EC sulaimi58
438,336,129 *2C6AAADA0B118ED0772CFE35C7FE35AFA4BB2065 7EIRROMER
438,336,130 *2C6334CE4121E55280FFE394040F87D8A2CC4816 [email protected]
438,336,131 *2C60BAB40088E3436167FA2649B47CDF5347F987 7EXTRADAIT
438,336,132 *2C6984577159BAD0234CB922A55790CCC6B1026A 7HINGESCHLAGENE
438,336,133 *2C68DE7899FA221E7BF6C53C09C0DE4A8A036C61 7KOMPENSIERTEST
438,336,134 *2C61080209382975338704A8C81C52C1B53B5839 MULTIPASO
438,336,135 *2C69A40F00071047849E3305A48F2B6A45656DEF MURASAWAED
438,336,136 *2C6450B97BDC06286FA3BBE6FA43D3FFAB2E12B5 MURDIONO5
438,336,137 *2C608355A78F84A30C3F67C82DBCA63031C5CF75 7PALPABILITY
438,336,138 *2C6DF7354D2DB09584DDDDB09B453F04765A0408 7SDEFINES
438,336,139 *2C697D4CC8A1AC243920D615A0B26F37E4A0BFD6 7TNORITNAENA
438,336,140 *2C6A3AE2F696FD642EF7C3AC275AE814D42322D9 [email protected],
438,336,141 *2C6FDD391BB482C664F125C515224AC8FECFCD3A myadg15
438,336,142 *2C6D292507618F15C135082619F5D567EDDDCB00 M~YO
438,336,143 *2C68C43E5AEAB5C0611A2083E11F998C54DEEA3E N0NC0114P$1B1E
438,336,144 *2C6D28E4315AD44386DE086A67A41CE26265267E JORDAN.MACCHIAROLI
438,336,145 *2C65C4C35B5E72FC4BD90D872AFC09E69A309C56 [email protected]
438,336,146 *2C6D58F3B77B869DDF880DA061317415620564D1 SWE93
438,336,147 *2C639D5E205D32887A9B9D4B80C679B73414FCDB josefwince
438,336,148 *2C60C1C45EA52364C86A72ADBA2FFB93B463FA24 SXT3
438,336,149 *2C6499830275CF7292F0B3BE0FB82F88DB83696B 808ricardo
438,336,150 *2C6F47BF961FA7260BF3B66574847333934FC49A (80.pound.leaf).art.imitates.life
438,336,151 *2C6440D9EA94E2AF82647CD0CD6E35CAE935F159 J.QN
438,336,152 *2C658FFABE1919E90A9B523FF79D0D4764186B03 SZEDŁSASZASUCHĄSZOSĄ,AŻSIĘSZOSAWYSUSZYŁA.
438,336,153 *2C63AA793B1520884FB0F30549899076718273F9 TAEEZKB0
438,336,154 *2C64D2E2C84E87ABF1228879888689458768F8F7 TALK2ME(A):30(B)
438,336,155 *2C6776FF03CE9FE1E806008F78B72C1DB1251820 TALKBROWN-SQUARD
438,336,156 *2C6BE2DEBB289D90A807F95FFF3376141BFD3766 NEOKAISAREIA
438,336,157 *2C64B37E6DFE7CDE87BE0AC43A7F977560677F5B NE{TS{ST
438,336,158 *2C66A640DF8522F943FB28DED1EF2FF54191DCC1 k#|
438,336,159 *2C645624F4F82FD2AC082993082FA49BC9209665 [email protected]
438,336,160 *2C68D616FF386D95CC999CE7CC57D50CD88CBA19 8---B ~ ` )X(
438,336,161 *2C67D4BAD43E9D005C096D393C7AD2FDD6EC9EF0 8DIFMETPES
438,336,162 *2C6E07B37BFCC3FEC91D16B649CDCBE4609F97BE 8EATMEASDF
438,336,163 *2C6CD9E8AEBAD63EFF4F24B8595DD6809AD42019 [email protected]
438,336,164 *2C69670CB03DC701B99C3F327929DD965FF75995 KAREN LINDQVIST
438,336,165 *2C6FD758F9CE4B079BE2628BC153797D38F094CF 8february1529
438,336,166 *2C6CC4F9C2AA736958F77F89B26AFCF7173F1D26 nieuwsgieriger?
438,336,167 *2C64FC371F84B4873BD516F3579A2F1F2E8AB6A9 KATIE1933
438,336,168 *2C61237320CC060C972696503E62953C3EFE80CF 8NINGSVINKELS
438,336,169 *2C64F8857E6D3E2C859BB318F8401BCAEB843079 8NNBSSSN
438,336,170 *2C68802F9F8A78A0987C8B29E0DC3AA5A9F98A05 8######)~O~O(><)
438,336,171 *2C6334F8F3003BDFC2DDE23157BF0E40B8C1478C KERETMEGÁLLAPODÁS
438,336,172 *2C66304419C97993C98C8B24285E781DBC90FE97 KIND.ERINOCONNOR
438,336,173 *2C6C3981A1D94E7268671B5E894FC7376B393566 KINGDOMSKROGOTH
438,336,174 *2C63771EA78315038F968CC8B7DAC9ECD917C763 KIRSEBOM
438,336,175 *2C68E78126B3CEEB7133E81A7B0FCAFC13190730 terri-lauer
438,336,176 *2C6747808D580E1FBC0812C9AF2127C9CAD930B1 TERRORII6
438,336,177 *2C609B7B925C683151958D30DCB4F920C816AA9D klaviersonateno.18esdur:menuetto:moderatograzioso
438,336,178 *2C6F0579E8A73AFD391FC1D472F4592501F7AEAB [email protected]
438,336,179 *2C6857D874368AE1E5B9B3EF466649E597E4BAD5 TESTTEST=
438,336,180 *2C6BCA10F7DDA7968F2DAA6EA94FB8CCC70DA387 NOMURA%NTTKB.NTT.JUNET%[email protected]
438,336,181 *2C66C7C38556EADA4F2114E83BCBABD37606D4A7 [email protected]
438,336,182 *2C698773D93C965D33F52458BD9AF4C55BAB8451 KONNIPATHANAMTHITTA
438,336,183 *2C6DC967C4B6554BE8FB7A722B23E595B13402F9 kooptace7
438,336,184 *2C6131BEA7BFA6EDBDE57EC528DF2BBD27A174DD KORY.WALKING
438,336,185 *2C6609316CEE8A935CA734C8F4BC132CD91F8D16 KOSYSTEM2
438,336,186 *2C696344C32A13A298EA36CBCAD92FA4770F5FB8 KREMASIES1
438,336,187 *2C63668015BDBE5070D6716176DBDB573DABA55D KRISTOFERFLANARY
438,336,188 *2C6BD4A05E00293DCFFDC90F82EAD9D6F8A1341F numberkomplexifizier
438,336,189 *2C60A5046CD28AF0826E2409DBF6B0DA05415080 THATLADY2005
438,336,190 *2C6DA30EA3B0A8F4609CE40E7E25926AA7D021D9 KURTISBLANDER
438,336,191 *2C6DEA186063B656ACF978565C734CEDE0A53676 thecomingrevoltoftheguards
438,336,192 *2C6903AA1748C357726CC119E2A4271262739683 954JOY
438,336,193 *2C6BA6D13246537A951FAECA314D92A9A546E192 THEODORENEMETH
438,336,194 *2C6E48875FCB31A78E7B5BC28B775978986A6F1C THEQUILTEDFORESTCOMWWW
438,336,195 *2C6393BFD469E5C0ADC19D7A2CA0549152A9CD2B OHNIRPQ4
438,336,196 *2C6EDF1CDE7AA68140F63EBFA433CBFD235CF8F4 9fooyoung
438,336,197 *2C68AAD2D6C5CEE10A8E08F5EB2D11E272CBCC86 omarrelkin
438,336,198 *2C672829BD22C88BC9AA00003AC3E7BD0C63F00D threing8
438,336,199 *2C6E02724ED35986C55E1EB08BA89C2497329B58 thuroczy
438,336,200 *2C67A488CC89327C3F251A2B793A7F416B4E7235 LAUREN.RATTU
438,336,201 *2C62AAA8713B04525171992A72F1F5D46BC5FCC8 LAVERN.LITCHMORE
438,336,202 *2C66E1E6A9FF5C32C6B1AE5B4A9F8DB19133F8FB TIEDUSTELUPALED
438,336,203 *2C6217D3C04D000F50A9A2D9921E81FE4609D333 LAYLAGARCIA
438,336,204 *2C61F12409BC2F668904729909F40262BC2CB3C1 LDN(WOOKIEREMIX)
438,336,205 *2C6E668B76812BAB45AD24E164BB7EA217CA4E0F 9ONPARLEMENTAIRSTS
438,336,206 *2C6708FD56166318BDD248B9C6086F4399A5A763 (O_).`@P
438,336,207 *2C6D9CD0BA3C6A7A206E04BFB2298012A45AD659 TITREAUDIO
438,336,208 *2C6674143EC01678F80FABB10DDEB9806A04B697 tlh
438,336,209 *2C6CE69FB001AF83CF827BC9FAD8A04C7F6E21A8 tneluofed
438,336,210 *2C6BA531A0D65B4FC44F69CBB46515D6F132B2F7 ORLANDO.PENFOLD
438,336,211 *2C69B61391DC76854AC21553BDCC55F90E198422 orvalrolston
438,336,212 *2C6881242C0D34769F46ED902D9B855A2CEA476F TOCCATAFISMOLL,BWV910:II.(ADAGIO)
438,336,213 *2C6663787804F06714353D4167D6D7134A20DE31 A0KHF
438,336,214 *2C648BDA0A48109A23B9BCC96C2C3E45E3E06F00 A1W"&
438,336,215 *2C6D3BB5566CE170F8D261309E26CA17E83AA8F8 a4z5q
438,336,216 *2C6CDB8AB1C5C75B7AD48B24871461D249E68A74 ouolofe
438,336,217 *2C6BD63F356850EE1ACE20BC7255A15B311541D6 TOVERCOMPLICATE
438,336,218 *2C68AD51249FBC69E1E0A09BA1C79D8D4BFF18F9 a6
438,336,219 *2C6F42070DAA3C547C392FF0A1EE42B3E8043170 tracy-mc-knight
438,336,220 *2C6E549D3E6C24AC03488B96A2086576955F64B6 LH5B
438,336,221 *2C693CA29310ACCFEE3128F27144E2E855067515 A8!QV
438,336,222 *2C696FF4890A9AE9F631D2988CF6371D597A737D LINDBERGH1610
438,336,223 *2C6206198D14F061633B7063953A3AE2E66DADCD palaciodesantelmosevilla
438,336,224 *2C65EB5F043904AC2E6731BC58A1CD9968EDE9FE PALETTE.CANTONS.DE.L\ORNE
438,336,225 *2C6B0A02B2CE76B7548BD47789136778001B1BE6 AAC.WV
438,336,226 *2C6BEC9CFDE6DC416207206FA6CB9896481C4828 lings
438,336,227 *2C694EA20165068DC1F89DE28DFE5254052F8ED1 TRINIDAD.ABDO
438,336,228 *2C67464BC7D85B4EF1191905EFD9CD4A0D4D6F87 TRIOSONATANO.2INC-MOLL,BWV526:VIVACE
438,336,229 *2C60FFD714825914DAF9534C0B5307D0E7C2508A AALUG
438,336,230 *2C69EDD3F8DBB6344EBB76AFFE507D80F56147A8 patgrossetete
438,336,231 *2C6DAEC328DA108FA3FA4726702D829423114024 [email protected]
438,336,232 *2C6148E8FAB0DB3326B58C3921E550D027D82271 TRUEMEN7
438,336,233 *2C6AD878D497EA9A2CF16507E16258145598F99B PATRICK-CODENYS
438,336,234 *2C641728C81094625FC9550DD7AE8A8AF01811BF patty.knott
438,336,235 *2C6BD964308698314BBA4EEF125744311F172BD3 LJONGENS
438,336,236 *2C6F0B3FE46E99CA4530E0DF7430B5805080B2C0 ABBC9
438,336,237 *2C62501CDB85F3E1976910EEBAB4C36DEC6FACC5 LLOYDCRESSEY
438,336,238 *2C60670F984E52F08410D2A0B10B5DE4DE15D390 p---B.~oSplat!!
438,336,239 *2C641F013EBEBCC66B93F2C168B47A946CAA63E4 LOBBYARBEIT“
438,336,240 *2C6FAF316F63E6137BE9F23A068C611372600311 lobendro2908
438,336,241 *2C6C399E92832D91946F4D532846859FAD9EC5EA abeiuos5
438,336,242 *2C6B6B1545D04F9DAF483A5AE67111AEDA5C7B84 TUANKENDI
438,336,243 *2C6FA94FA6FBAD5761DDF201556320432F367C30 loliebbs
438,336,244 *2C63280B59885B2026C0FD367DB30DA88E21BE45 PD~ Splat
438,336,245 *2C69F966A29CF07CA1647455033E1AB5BA0392B4 TURMODIGI
438,336,246 *2C685FBC7BED28FA6428F222285E6F76FDC4C65E TYLER.JAMES.MCBRIDE
438,336,247 *2C6E00D75FF29273082F0C7792C536594C525FB7 LONNY.TRENCHARD
438,336,248 *2C64622F523E131ECE8C04947314AFA93F2A684E LOTOFAGI9
438,336,249 *2C6295C4839F8A0552DBCE6F9DBD873F0DB8BD6F perryregulski
438,336,250 *2C6260D3AB5F346CAC61D513B763B785099E2ACF PETER.FYE
438,336,251 *2C616A7DB7BEEE4DCAC8F40898A46D413B940CDD PETRARCHHISLIFET
438,336,252 *2C643009E6454C2EF9D4EF171F4A33850B870188 PFLICHTETHISCHEN
438,336,253 *2C6AFAE0FB83042B6B45704C820ED425350AA957 ph0+0c0p!3r5
438,336,254 *2C6151F55B74DCA7EC5E135979C23696AB3FD910 philanthropes9
438,336,255 *2C6EA239B9217F55EBBF968CE96913DA658CAE81 [email protected]
438,336,256 *2C6EA9C053D9312C471696192B8969983AA94D12 [email protected]
438,336,257 *2C6AEF5DBD034E91CDAED54126C38E29AF435951 adokenai
438,336,258 *2C6FA6F2139218C38FEE5B899ADBF6FD2B2009A3 [email protected]
438,336,259 *2C6C8073CCD5902156CB702AD09B5C86E1097811 PIEISM
438,336,260 *2C6EE58AFB919ECEC70022E5245AE91D4D1B91DA a:.e.
438,336,261 *2C6C3D9D68C8C4E7B60F17BC2CA5EC3D0351543F UNCOUNCOED
438,336,262 *2C6890FFF11FB4E3FEC34FF423949D4138BE2913 unsuspended9
438,336,263 *2C615E95C51336835C2158228D35B02302729C76 P####).~O(00)
438,336,264 *2C6992F5E37AA1A644D065B6A3EA42035E11F13F /usr/src/linuxheaders2.6.3224server/include/config/physical/start.h
438,336,265 *2C667F5B40D2A6575D1F5595908EF602FFC518B0 a__i
438,336,266 *2C6E58F1E2CC6781D054CD02A40902C78CE11297 ajjanakatti
438,336,267 *2C6DCFA1FC6EC7FBEA3E882756498D0F1A155B37 akek0
438,336,268 *2C60486DD7E9B20A09404CFF93C801AB3B6E85A1 [email protected]
438,336,269 *2C6ACEBC81B440793DAA08CACA553EBF5E32E8B1 MANUAL-ONLY
438,336,270 *2C6B729208042133D32A5F9F905F509EA8D60752 ALANESSEX
438,336,271 *2C6CAAEF54688E627AC1499A3E4BB91F00546934 ALEJANDRO.CORNEILLE
438,336,272 *2C68E24F6EDC6AA1694B39E972F932C5F1F010F5 VARTANANCA
438,336,273 *2C6F46E3495FE6CB1F4DEDCD16C52B27704A2273 VECINITOS
438,336,274 *2C6B43CC91AA0BBB4360AA0734CDD98DCC75F140 VENCEGABRIELLE
438,336,275 *2C6E6BEA5792633C53C6A4F6F1F5E52CD3C94AD3 PRAMADAAED
438,336,276 *2C6BE8BB975DF0504910C57D1FA8A1EBAE3AAA48 prettyodd
438,336,277 *2C6B287529C0A1D14DCDD1E465D8E5157B01E790 VERNAGTHÜTTE
438,336,278 *2C69A1889DC2E91481F19E9E0561956D850002F5 VERNEHMES
438,336,279 *2C6E0B169A741F851682F862D1B53EB4EF1D745C verseurs4
438,336,280 *2C66BBE7A72A4C523392324772B2CB5196747131 alt="antonio
438,336,281 *2C63EA40E469D83560B38B77695D2391CD5DB311 altindashi
438,336,282 *2C6CD20F7C11A254CE8418C3ECA644CB659B2B5C VICKI CUTTING THOMPSON
438,336,283 *2C6902DE3B11CF90FEB6C7F613B3B3DC76DA9607 [email protected]
438,336,284 *2C6A2E0D5AD7DE609A3BDF1940F749270A004974 promdane
438,336,285 *2C66E6CAE57CF27647CEE142FEE068E1AEF9C4BE VICTORIAWOLOCH
438,336,286 *2C60EB1708C4E5E7666A7B11E864B33BD6AFD5A7 AMAILLE9
438,336,287 *2C66AF92A891104249FF20FC0D6968840CF88C37 VIEUX-OU-VIFS
438,336,288 *2C6667E6185BA326763DCA31D092A257E6E3FFA3 VIN.SAINT
438,336,289 *2C6BF1DA9575406228C0A96B01594E0CC26C7EBE VIOLETUNDEAD
438,336,290 *2C6168EABC7DD42D2E71FCA9E0569275F43314D2 Q3612355012
438,336,291 *2C6AED73312958861B6EE10A4F24435956FDC8A7 q=====B`.}X{
438,336,292 *2C6AF510C13B0FD33CB38C84F05E3458E9F1B77F MARYZONL
438,336,293 *2C67343CACE99975F3A77A65500D036437055DB0 AMOSBONNEL
438,336,294 *2C63B29555366A64E11F77577C4272DBF3EF9BF3 QUINCYDOHRING
438,336,295 *2C67FCE1ED58ED104BB5DE3718EC2DFED8689ACE QUINNHANOLD
438,336,296 *2C67A63128BD62E8DBF6E41B2A5B5062BA07A3FF MATHEWLECHLEIDNER
438,336,297 *2C6578BD28CC9F6A296CBC866D404E5388901178 [email protected]
438,336,298 *2C6821C234EC58D3BE12208FB58D30A97EC4DDEC VORVERSUCHE?
438,336,299 *2C60118A7503D21EA28AE6BADEEA6BC1665E4EB4 MAURICIO.ZUMALT
438,336,300 *2C6EB4F791A79208ABBB51D3B55349EB269B8663 VREZINA
438,336,301 *2C64E4D47EE6FCD8DC0A96149A056C342D918BE1 MBSTIANBH
438,336,302 *2C6DEE38AF39D5CAD0FBF0815FC2E7059B933D41 RALPH-ABANTE
438,336,303 *2C6787F49E18D95499B004719DD947A969E7EEE6 VZI;
438,336,304 *2C6D611D5DC95D39D575D15444DE3BF668C6991C RANDALL.SPILLER
438,336,305 *2C60E171715E3B9CD6B1223F05D0C47625215018 wagonersed
438,336,306 *2C601C66AAD57C92AFBE1DEAF0C90590720A7C92 [email protected]
438,336,307 *2C6CAD5111543D4FEAA4CBC7DC954700001F9FFF RANDY KETCHER
438,336,308 *2C643C06E078EAC88308F31CC735EB1F178B1C9F MEGAN-NUSSBAUM
438,336,309 *2C6091BDDF214A80BCA42B3C5FC5794301F64AC0 WALID PIOTR KISWANI
438,336,310 *2C6D3FD024D69F16FBDE3B03D4D50BA0DBD1C934 [email protected]
438,336,311 *2C6AF72EE6C5DE1533832A157F88B7E4B34D4220 RAPHAEL.TERSTEEG
438,336,312 *2C6E652DBA6C60FBC126BAD353BD83F1E031CC69 WALTERCADY
438,336,313 *2C66248EE74882B27BCD7E1593FF528B3661D3FB WALTONRICHINS
438,336,314 *2C612A41352AFFBE83677DB203CB90041DAF8B3B WALUYO SUWASTONO
438,336,315 *2C61FC081538B93D965EF2554EB92351F111BE1D [email protected]
438,336,316 *2C6A184ED439266799B8D3D6ED1E33F416413F05 MERVEEL
438,336,317 *2C649B23BD79FD343F46FE8083CC3EDE60C6526C methods-in-madness
438,336,318 *2C6CE02C15610B396398D8EFED5018D9ADCCCA7D [email protected]
438,336,319 *2C6A00B2487F62CB95B30B044AFC843B97E5C2EA [email protected]
438,336,320 *2C64BAF1860122ABA79551030080BD603B7CBA27 waylonlasecki
438,336,321 *2C6539AFA688816658FCCE5702896EE950959CBB MICHAELRAFFA
438,336,322 *2C68B0D0B423533FDF28D414352FEFDDE1AC3DF3 wechivanhu
438,336,323 *2C614B00073E0FA63FD8E65235D970BAC44CE8AF WESTLEY.PRUETTING
438,336,324 *2C696C2C07F0E5BF53B188569FF67D6B16747CA7 ARREBOLARAS1
438,336,325 *2C6F811752226A70763F730D903AC9A2859F7EA0 [email protected]
438,336,326 *2C66D721255F9C8FA4E81FEBC1DEA776D8B16857 weworktheblackseam
438,336,327 *2C6066570E32BD5B572B997B31F10ED78BC5C50A mileyc/hm1
438,336,328 *2C6EDDC22F9B0A32AE7A4F71FF24A7EE643DE48E WHACKER HUMPHRIES
438,336,329 *2C65069070330291EB9D884E0B861BD13764750D reidlotridge
438,336,330 *2C63B0371A142479AEC8316A0B29700586DBC70A rekojesc7
438,336,331 *2C6B6A5646F739AB8CBE2BEBE3BE77404B87E888 [email protected]
438,336,332 *2C6D2C7F9EF8A3B993793C1C161886EE80C84172 mirageboots
438,336,333 *2C6DBE94BD8AB7A1D6E12403A59B88A6C1C32ED2 ashleigherynkerr
438,336,334 *2C6D7BD5D185A51A65B237148B8E0A780E13F4B1 ASHLEYFAZEKAS
438,336,335 *2C6511B6E32C7ADF6F3EBA1493F6EB4FB1A5403B ASHRICHAG
438,336,336 *2C6E0592D9AF53D2078EEECFFE7E72624998E95D ASKEVIEN9
438,336,337 *2C6B9CF93D6F86EB2E4E0ED321BDCCCE3BF0B7BD WILFORD.WOOLUM
438,336,338 *2C69459009AFBDF84C0D514CA142FA9DC1DB93E2 ASSUMPTIONGERMANY
438,336,339 *2C6E6924AB93DA5C51D7E068019FE0E2B5AB0B27 WILLISPETTA
438,336,340 *2C61C73FD9DE936CB50408912261559E4D9D228A ATIRPOCS9
438,336,341 *2C6A7157321E7F65B22C520F3C5BFAF6874D4CFA WINFORDSTRAUS
438,336,342 *2C6E1609D6EFAB9E78CE3918A60F547CDA9F723E Winter(Hivermix)
438,336,343 *2C623D4C9C56605E8D6C01A962827F247565C66D wiripovuta
438,336,344 *2C6D3467F5FD20EC35725602F1E16604A2F43FB4 [email protected]
438,336,345 *2C630E613EBCF13405E49A99F81855008A4A24A9 worxbsw9
438,336,346 *2C685BE4655E1842AE486ABB80CE2B25F2750A6D RENEWING
438,336,347 *2C635B9C6775D4CD72C62805BA5386F9E22BE578 ATTH
438,336,348 *2C691171B2EFA065C488EE6059A8298225781CFD AU=CK
438,336,349 *2C6922E7BC638194B9690BCAC4EFBA54AE4A5618 MODIFYINGENZYMES
438,336,350 *2C638623D3E38856B1B607735922C5DD1AA447C5 restorationer4
438,336,351 *2C6980563B661A43AA42E169437CB3E42F62E615 WWW.BUNGALOW8LONDON.COM
438,336,352 *2C665698B7F7E463F02BF05D1CFC4CF0905F1F24 wwwcandycanefactscom
438,336,353 *2C6D89A3E0B6F96CB599BFBE62A203E4212C722E REUBEN.DEPRIZIO
438,336,354 *2C69449D9F5671907C1846626817B1E43E4AE2E8 reubenkielman
438,336,355 *2C61B0531A28BA2756C4C7BE104289967FE61A97 REVERTORS
438,336,356 *2C6D4336011DA09587CC0B0212516C1333FEA607 REYESESSER
438,336,357 *2C6AD7EEDEAA718B5AA634EFF76E890C3A8C7C1C RF1000
438,336,358 *2C61F06A76A88BCF92B3300CAC1017FFCDC1AEC4 RHOFFMAN8
438,336,359 *2C6AB65984C7CEA3B3D8E2EB196CE498A903C5C8 richieleinbach
438,336,360 *2C6433D5215C43384A3D1009C7A8A68680DDE27C RICK.BRAUCH
438,336,361 *2C609C0D264A2B26610083C8A16D4651EEED1C2D A%VH(
438,336,362 *2C6BDBC0C2A5042530FFE7C3FB19B879155F32C4 RISCARO123
438,336,363 *2C6BB6B4F57CFA5E4BD6781B25CB2AAB3957FBE0 awolanim
438,336,364 *2C675FD0ED481743BFBB3EC7E1DBCCB5503E70E9 ROB.SCAFFIDI
438,336,365 *2C64DE664B14CBAC12744918D19862EE53B8D430 X?.D
438,336,366 *2C6432F28C0D250A8A79A61952480A8294C61A42 roffinchiramel
438,336,367 *2C68CC6E6691132C631C109BD918DDC05C573159 ROLL」の野溝的和訳で、自分達はもちろん、古今東西の全ての
438,336,368 *2C64A515445099E46509FCD83E7B0193B1867A27 B2K!F
438,336,369 *2C638DFE4D13507DF21462AF176095C4D2EE179B XOMMNGN
438,336,370 *2C64D4F3F969752CD7A99A61C0A9CA1C2A81BD65 }x{o~o~<------8
438,336,371 *2C648679EE75F541FC85B6C070AC901B82FF0BC3 B5/HX
438,336,372 *2C63D6FB5A061A03899830019F0F19F4B9CABEEE BA.:&
438,336,373 *2C645CDF46184BB3291C0A54A40B72F51ED1D9F5 babe: this is a tale...
438,336,374 *2C6756F7AD5C3E80A890AFB44C1204CF9A21940B BABY_COOL
438,336,375 *2C62456E05784221827F17DFB802B94A50D85ECC BANANASSNOW
438,336,376 *2C6258E9F3B3962911B6C9BD6FE08A9182043A8F saibene2
438,336,377 *2C6BD8C3829B696504D014615BA18B2731003875 barr31.st
438,336,378 *2C65FDFEAE782FC48E27EEDD175D834B1D3E73C9 BARRYSAUREL
438,336,379 *2C6E9B9153EB948B79A805B25EE6C86CE7A46386 SALVATORE.NAPIERALSKI
438,336,380 *2C6B3D06E7BE72D5DCA5C7F6F283E2DF5D6F198D bartresch
438,336,381 *2C63AC86E19683DD9E853D857CDA7E4FAC524438 bass.on.the.boat
438,336,382 *2C6A1FF21B205B78C240DF46BAF6A973089BB86B myredcloud03
438,336,383 *2C6AA624256E9A5628E3460D7D21871A9EAD3295 bbd9n
438,336,384 *2C624208DA08A7D781F6569BF85D7FAF91CDCC28 samualfalla
438,336,385 *2C686B5B08BC4131A30DFCC698067A598720C98C nadine-oleary
438,336,386 *2C6C058615B931C74B96722B8C17EB98B29B840E YEMPBB
438,336,387 *2C6D196C37E8D62420136C068159067EFAF1F8DD yentay-ghani
438,336,388 *2C60FEDE51A19F7CDC8697F3230C1D4ADC6B8809 YESHUA_07
438,336,389 *2C6CC0D74CB4C2FBCBC9B21A6A8B0102D97D88D1 SANG.HOCHHAUSER
438,336,390 *2C6D24EC52FA0EC742678CDE10BC3D4739A75B18 NANETTALATISHA
438,336,391 *2C66B92998D3422E5AFBF2F59F3D9BB1D3F5FB68 naningkamot
438,336,392 *2C60260DBCFB49381EB80D6D7D09CAD0F3F718F3 BDIE.
438,336,393 *2C68386BA75229418BFCA6CEC9F3F9D7B782D7E4 bdy&r
438,336,394 *2C63C42FAD1B4CC40253C6DAAB1B203BDADE63B5 YMMUYTUPAS
438,336,395 *2C69A219E44C594E5251FDA40C42EF40D862E1A2 NAUGATUCKGLASS
438,336,396 *2C67FA6B4AC91983EA1079B2F0E9FD0C6999AC1C ndctrnts
438,336,397 *2C629B53B3AC55824C29B8B1570E68D701026A84 bengross7
438,336,398 *2C692D60DBB217CD50DBEF5DF669085DF6952285 BERNARD MCPHERSON
438,336,399 *2C641F1EFA086DB590039DF03ACE9BB2F093A3ED BERNIE.BLACKETER
438,336,400 *2C6E84A4D0FC948DBBD2C47E2BD0030C8B8BF3F5 BERRYCODISPOTI
438,336,401 *2C6373076171FFB598EAB6D898891A3686B6A534 berrypracht
438,336,402 *2C680BE1775AB5441D6C06B5213187E5A69A0683 BERTLAM8
438,336,403 *2C62F4521AF5E253C40D2A3A6524BDE0497662CD BETONIES
438,336,404 *2C63454EDBA97B324E64E173D3F2A302E25E6CC9 SCMNICE9
438,336,405 *2C63B0C3EB92DFECF3D3E2C927B86E92DA9C3D38 NELSONCLAUD
438,336,406 *2C6220290FA9F48520A67CE5DEE90AE387D3F439 SCOTTPIPPENGER
438,336,407 *2C6398AD284A703734F9CB3EB835DD701D8C9EDD YVON.MCCAULEY
438,336,408 *2C6ECF2F333ABA5C37D158B55BE4B7D6A8893B24 bh+/m
438,336,409 *2C6D2B48B9892A6BE64AF94E7BADE76877161101 bht-r
438,336,410 *2C6B3DB3162721DC0BA1B72FBAF7CF31758C8725 [email protected]
438,336,411 *2C623F8343A82E705C91899B9C692F1370E39102 [email protected]
438,336,412 *2C65E674EF61A0DE140CE0E2CD3417CC0D9C7029 bikj/
438,336,413 *2C682CA677536E7EF4E354A7B9B313137F8DA66F zach.leachman
438,336,414 *2C64BD7DD2994312A09850AE365AD2DACDD15F3C ZACKSHAMPINE
438,336,415 *2C65F8506243DCEADE51A13E91306757966EA1F4 BJFP
438,336,416 *2C69360C96566D752E7CD97099FCBE1F40095FD1 ZARDESSEDRAZ
438,336,417 *2C66D79932242C1C1FCCC336FE03547442A66550 nicalee
438,336,418 *2C63A4D66DFC5F1ACB17743368FE7AD817F930BC septectomieses
438,336,419 *2C68C63A0BAFCA73B38AA4ECADD3AE74BB741A7B [email protected]
438,336,420 *2C6926A8935555DF431BAB033E6D4D4A12533166 SETISPHERE,PART1
438,336,421 *2C6797D54B899ACBBF84E2ED035FBCFF958FF8DC BLJHF
438,336,422 *2C62CB2E64C97599A4B33DBAB8ED1D5E87D64810 [email protected]
438,336,423 *2C6304FFEA0B8581FA694824C428D0343BD6FB4C blov
438,336,424 *2C6843C2A784C37DE4213092B3F4C2E7957A661C [email protected]
438,336,425 *2C68A0F0469CD403F40A838BD379F310B00980DB non3xi$tin9
438,336,426 *2C65FEA58EB0F90D71CC242E8EE76DEE2B0EA545 sharlynda
438,336,427 *2C6741C296086C5C2FD205A95444E5AF363EF5CF norashikinabubakar
438,336,428 *2C6E2B091BA99E40313C525D7062ABFBB4ABDFE6 [email protected]
438,336,429 *2C61CC6C8BD285CA976060FF0B06CBF6F2ADE22F NORRIS.PANDY
438,336,430 *2C6E38E90381877E19F120291D49E38AADE38572 SHELDONWISNOSKI
438,336,431 *2C612C4E98015DCFB1D3C347C5FB408BADC119A2 SHELLACKING/S//@/'L/&/K/I//N/
438,336,432 *2C6105AF2F3C42F796F92314C15F61868A8A4267 ZSERFLING
438,336,433 *2C62535D73F9BFBB0D8B1D5921E6DE7B268FFE95 [email protected]
438,336,434 *2C609362B29844DB5029EE80EB360E95E5D821F1 NOTIMEFAFAKEONEZ
438,336,435 *2C6741956933233132EF40AB5243BE7C253F13D8 SHERMAN.QUINTANO
438,336,436 *2C609B7EF1044D6E0681FB1F3E754F2FD7C7844A [email protected]
438,336,437 *2C66FBBD8D945F00495C136DBC008794005477F1 BO(NL
438,336,438 *2C6BC8667250F24E27FFFED4A745ABA52B5047AB SIBSTER1
438,336,439 *2C634D0296F8A023661A712D2713BA95DCF7B996 nur-die-zeit-hat-zeit
438,336,440 *2C6EDA344786CBC4F39388ED7957BEA86ACA691D BOURAHLA5
438,336,441 *2C6E9F0014FBB331B368D1A26D5AC753C52A664E BP?3J
438,336,442 *2C6F396597D4D6AA5EFD2761B59643B6C44AA0EC odetothebigsea(fourtetmix)
438,336,443 *2C6B0DAB28279383B9B0C42717DE3996DB70D368 oh caballo
438,336,444 *2C68E78015EF199DAF98971B357A3ECB1BF8E81C OLDSYMSING
438,336,445 *2C6719975AAD1FDD0DFF97518DFED33B6D7B90C7 ollada-gandanige-mosaralli-kallu'-(kannada)
438,336,446 *2C600A85D3FC35C84415AF001454A85F047ABDB4 OLOGAN
438,336,447 *2C6F9177F46F1B581253FDE0126E094A65FE6F1F bringina9
438,336,448 *2C69BCD772390EC518CBCBB88FC191F472553D63 ONCE.WE.WERE.DIAMONDS.EP
438,336,449 *2C67164A796005D802BE21910A3662625D30B81D brittany.clemmons
438,336,450 *2C65C63E4986B0AB98C7A75F398591A52E7829E7 SNOSUERCED
438,336,451 *2C68749B11FAAFC592695B8A7F29C63AAFFCE290 b-rmw
438,336,452 *2C612716A3AA74D7804939238B699D8CB689EAED СНЯГАХ
438,336,453 *2C6500E52260D67108E36D606F35A0D53D22DC79 brute25
438,336,454 *2C6C6E5863F817EF24C2D228B958ADAD4FB5332D ФЛЭНАГАНОВ
438,336,455 *2C66125F746EF5873F6A08D1CE74BFBA6FDC810E [email protected]
438,336,456 *2C6623715EC04ECE5223FA9CF2E3F6AB6CAC54E3 BSWPMMBSW
438,336,457 *2C65887EC343ADE1E0D874FF5611EC42196A3536 OSVALDO.SEVERSON
438,336,458 *2C61238E642351AD504A7A97F86447FB3F870731 sospensión
438,336,459 *2C62DCFBB10513B07C42369DFCEBB0931B8BA936 btvqu
438,336,460 *2C6308275714393BDCBB66025AAFDAFEF00A26C9 BUD.GAINFORTH
438,336,461 *2C6C042673B506312FC04215C16BF32BACEA7F31 BUFORD.DUPAR
438,336,462 *2C638F0B6D455DD1C987EBC092E2FA3451B8C703 bum)b
438,336,463 *2C616FBC4AB83E2D439F22BFD8644B51F1A9FB46 SPEX
438,336,464 *2C602C3BA413B1190E8EA00E4E2FD03D836D095A bvm87
438,336,465 *2C6A5425337B03DF18C6B7B1526EA7FAB77392FD Sploit-0~-d====B
438,336,466 *2C6D2F331D9789E16467240D23DA669F15C25336 SPNAAKUM6
438,336,467 *2C65D03E3E71F495C7A366A0C00043A674559B39 p3t!01at3
438,336,468 *2C6E1DB5D7FEFC4192594447B0897B093AAA5F2F PAGANINI:-VIOLIN-CONCERTO-NO.-1;-SARASATE:-CARMEN-FANTASY
438,336,469 *2C60EA87F1625F5DDC9E60D588DB44B0F72E7D91 BX!0A
438,336,470 *2C60C6E014FD1B36E037F39129063F304B43175C c1tk
438,336,471 *2C6B8AB52DE80A4F2EA47653491A01728DC15D12 巨乳女工たちの暴発(2005年6月22日、tmc)…共演
438,336,472 *2C61E3288862B8EB64B54916E38568D8801E2A98 SRMSKF
438,336,473 *2C61A905EB701FB13F6052AC36BF659726C2E408 SSHUKOORI
438,336,474 *2C6B0515B1F371AD919D53C748E1839B050BDF91 pat-condell
438,336,475 *2C6DC80F13D4078793D5DC1FE1DDBB5D2D12C519 C7)J
438,336,476 *2C658C5A44A90B1E44636F419E2002B209D005E7 cacata.pe.ea
438,336,477 *2C6894D6FFDED6B0BF5C1295C8CB761639129CA1 CACCAACAGTGTAAAAGTGTTCCTATTTCTCCACATCCTCTCCAGCAGCTGTTGTTTCCT
438,336,478 *2C64984E494298F4C63FD193A305297E69106B2C cadenceoftherowers
438,336,479 *2C64437D40FCF04430453347BD0B0D8AD0471269 STEPHANAS9
438,336,480 *2C66DF77F5949C6328ADCB99633FB637AB8ABE25 cameronmeagher
438,336,481 *2C62252B2E3797D8AE7E03911711721CD6412D99 p=d`~o><
438,336,482 *2C64F269992C1B8CEA06E138FCF9E82DF799C8EA carlota.maricato
438,336,483 *2C6EA2E9A55B55AAB6EF5A558D57BE6BDACE80E8 CARLTONROUND
438,336,484 *2C644B6F0EFED4D8550A6CB7153FE7DC840368A4 CARLYMORSE
438,336,485 *2C6671AEB586C19013DEE95E4869000329DCEF68 STEPHEN-PEARLMAN
438,336,486 *2C6361F3000F87C041F800E28E5D82DBECCA5859 PELLETTEREZ5
438,336,487 *2C6C88DAF80B5375E8F76100355AB13120AEDD08 STOLONS
438,336,488 *2C68A7E2979E16534C7B2597BD174F5811CCDC20 「炎神THIRD
438,336,489 *2C6B752F1BACC2735DDCFF3856CA6B4F091C9801 CASOA
438,336,490 *2C655A86834CAB926510FA4180CFC4AA06976A45 [email protected]
438,336,491 *2C6DC75CBFB05D8FC1252FB3A8B9FB406D7D6D7C CBFN
438,336,492 *2C63476ED78A91E6A08CBBCEFAE1D730DA8A5644 CBO)=
438,336,493 *2C6866216583126B281B4CA6CFCC2B8E4877A0D2 PHILIP.WINSON
438,336,494 *2C6AF08D7EB8B43E48A1B8FA53A20EBF38CA8904 PHILIP.WOODMANSEE
438,336,495 *2C64EAD6E02B77E7B34AC063B7383CDB74421D96 PHITOON
438,336,496 *2C6E59F702E173CACA882F03C5B0C8F9887600DC sumahaa.a.atmanaa
438,336,497 *2C63DA8F8449491CA268124CAA065C79EA2A1BCF SUPERENCICLOPÉDICA
438,336,498 *2C6217B38790C8EF3EC86AA00E6C4B9CCC392534 PKY99PM
438,336,499 *2C6B97A528EEA3EBC9B0921C1F05F6D0054238F2 plaiterses
438,336,500 *2C6B913F6CF3E76E0BF1FC2CB94F2716A908A561 SVĚŘENKYNĚ
438,336,501 *2C6A68EF71EC34BC23B0ED08D5F91E4438152DC4 CF4
438,336,502 *2C65DA760593584F113D1753D5B2A477D0A149EE CHAD.LULAS
438,336,503 *2C65DA86C143B5E85FDFA733337DE6494055AFC0 p====>~O~o3B<-
438,336,504 *2C61538B0D738518C2BA26C5AA9315761DFC3DC7 CHARLENE MUNOZ
438,336,505 *2C696E2734A5EA7F315C27D3E671DB7FE8564403 CHARLEYSAKODA
438,336,506 *2C65CFF690EDD83CE8B76F9096B43BCF5AD58016 CHARTOSES
438,336,507 *2C6029F16D032AC32474385F6B5339337F44F887 POS+M4S+3RS
438,336,508 *2C64EC785F38A0C71D0442628D4A225954614E4C TAD.TURREY
438,336,509 *2C6B8E9ED24D634632F5A5CE77DBADBE29E38A17 TÄHTRAAMAT
438,336,510 *2C69666AA638ACDDDFFDA23935B409644042B1C1 TAMERON
438,336,511 *2C66E85583432C9945348630B41CBD9681BAAEF2 TARAKENA
438,336,512 *2C615BF38EBB5429E6F527ECF050EDECA1F52B32 TEDZARUCKI
438,336,513 *2C66014819CB6CE13962994169D3B2DF22C0C9C3 tegnst
438,336,514 *2C63BD9EA9DD4AB4ECF356932C96D3AB3C9BB709 p---p~o-:p
438,336,515 *2C678ED5D71871F57F0D86AB067E68AA84AC54C8 CHRISTOPER.RANDLETT
438,336,516 *2C6D52947627F168EE4DD5E3BE551BB70DBED819 PQZ]
438,336,517 *2C63048BDD3C00538785D3CE5A067EAA9B70CA15 predisagreed
438,336,518 *2C64BD137F4C2620511DD2737CB7989F9C73F69F 0179y3342s
438,336,519 *2C6C9856115DD6510C59F08B7356E15079364905 progressiveobserver
438,336,520 *2C67473D29008F561FD8302B140C164E706FEE8E citnl
438,336,521 *2C634BFB35BF523034EDD0E36C33EB507A16C5ED ckfz$
438,336,522 *2C6BA4EC786F1A921D1C8CF665FBF81E0B03E6EF claudegregorich
438,336,523 *2C6F6E763168C0A93EEE5F60546D8FDC23D6C4A2 CLIFTON.YIELDING
438,336,524 *2C61CE5155257ACE7FC73C0305147261168BB1E1 ClW
438,336,525 *2C648BFD060FF9BAD28E2CCA96D6B0E18C73F928 thebraves39
438,336,526 *2C633FFF1D3DBCD40F59E92C935E4C44609EC90C (0_<)-O~-O~-Q======8
438,336,527 *2C6BBE5B9A3DDE759E0EA7870112FF1343A2154C THEECHOOFASONG
438,336,528 *2C613118C2C97C5E1C02F01DC3513E899D37E4CB [email protected]
438,336,529 *2C6829E757C03BA758970918B7101CB7FA7FE0BF THE.HALL.OF.SOULS
438,336,530 *2C6C9A89F07321B1AFFD10D1AE2188FD13795141 coastlineequipmentcomwww
438,336,531 *2C6A8917CE3A63C09E53B17F4FDA428B63D4F91F THEPANACEANMACHINEEX.PL.
438,336,532 *2C61BEF7D54B1506BE9F9CCA5AC531F843C1D18B the.shadow.garden
438,336,533 *2C68EA70C4762981FB176B87C00312DD474873D3 COLEMAN.LARGO
438,336,534 *2C6BBAC23D8EE2B45F41DB9223452DEB32C2E4D7 q#D* *(><)
438,336,535 *2C69F7F21C1620CAEA804954314DF40FC32595F5 THINKKS
438,336,536 *2C6DAD66FA492DC4AAF58D5757EDBBC474A9C17B collinpecorelli
438,336,537 *2C6A7757B9F74465DBAB8AB5A5FE7C3FF32A65EA THUISKOMENDE
438,336,538 *2C6A9621FE43672BFF6D0865F157B10B108AD059 [email protected]~O(X)
438,336,539 *2C6CA9245BEE31FA9369D003828D7C2C19902F95 q====p ~O ~o(O_)
438,336,540 *2C688EFB12EF7E38BFA95C58BF07A673AB0AFB92 concertono1,op35iilento
438,336,541 *2C6F81A54673C8D0B3C49ACA6722B7F2B3A0EF88 concocter1
438,336,542 *2C62989814C3AB07A279CFB18B10643C164F3E94 connor-kelley
438,336,543 *2C667B078B45A72FDAB003AC1ADF398C2A81973C quarreux
438,336,544 *2C65C007AB79A3FA6EE65B51B30014B1F7C023C8 contest? no...to prevent
438,336,545 *2C613C2228841B61343BC095B65368512F395881 11kaynamis
438,336,546 *2C675FB04C5622E0B52A4E45081AD842E336CAA0 1239701 kuinka.menettelytapa.on.m
438,336,547 *2C68A75ADC18AC04A367AE043E151E7972E0E8C8 QWERYNS3
438,336,548 *2C60C0C67A1F922BAFF4CEFCD980915543F20BA6 COTARNIN4
438,336,549 *2C67AA15F57FDD82EF47F5F30FCC672D887D2192 RADIOAKTIIVISEMPI
438,336,550 *2C660D4976F4C4AB3AB9F7DBDE1FB7C6AD889779 TIDIGES3
438,336,551 *2C6D2CB645D72B19F0CF0D59B5CFBB8E5960BECC c.poh
438,336,552 *2C694A7C6FD1CDB21E37CFA98F70505FBC1B2964 raloitep7
438,336,553 *2C671661446C0DB82261D08CBF191857D56F2EEB TIMBERSUNBIRD3
438,336,554 *2C626F1E9A3E4653A889E62120481557AD75909A [email protected]
438,336,555 *2C67B599C2F93CDEBFE11322C45AD0DBD8FD20BD TIMMY.ZOROIWCHAK
438,336,556 *2C6551B01ABF581947B784F420F79EDCF6D5212A TINA.SIU
438,336,557 *2C6FB0AB8FFF6EE199094B6FD377B02503559904 tinkababy000
438,336,558 *2C6E950F9D95EBDEA2A5B44BE85F58EF38BBF8AD 1595362 SE-VOI-L
438,336,559 *2C6DB8C01C671D17CAACBB971B6B5FD06503A33D RAYCLEMENCE
438,336,560 *2C67AC35687589896A36045D5BE8B0A9BD497566 15 STADTBEKANNTER
438,336,561 *2C6CE8D2606251467C2166F1B9E1FA6351066EB9 cqtoz
438,336,562 *2C683B912F002AE0D44C64E0BC6ED97514A1AFB0 16.havelland
438,336,563 *2C682FADD4D5050C0C21FEB9630F26DFD8F4D7D6 tomakia2
438,336,564 *2C63EF47496973CAA6677D8B6F2C6316ED5AC4D3 176CASE
438,336,565 *2C6480BA9579CEB3895DFDA5A20F71A717023442 1786255 die-abgeordneten-sitzen-in-alphabetischer-reihenfolge-
438,336,566 *2C6C23B90A2A358F559AE0F48A9B5EFEFE3B78C8 rec0mp0siti0n
438,336,567 *2C6CD2B5E10D21658E8BEA8774E38628BDF68D4E 180BOSTON
438,336,568 *2C67D67248DD53DE019ACE6E75EC02000FCAE781 1847378 matka.kest
438,336,569 *2C69C2BB3B7E1EAE3D4FC10E631EBD62F71A8006 CRMKN
438,336,570 *2C6B5C432495CD7A680227A586248B6CB9411289 18-VENETSIASSA
438,336,571 *2C66F0664E9C8B905E2BF05F014D9AA041616F0E REEBOKJANUARY6
438,336,572 *2C614E61C228AE3C3D58C3B01E7CD72716692081 REELS: THE DAISY FIELD / MOLLY BAWN
438,336,573 *2C610B91E3AE4178F5027272E7FFF64EF191A550 cs7oc
438,336,574 *2C6BC045302B6BA910F8F82C284A7A07086A3B5F reginaldhang
438,336,575 *2C68CAA141412B44BC4F601094D0382B9D4E27AC [email protected][email protected]
438,336,576 *2C67F57953935524AD3B8E76421FCB6280A64909 1.atomculuga
438,336,577 *2C6C78FED04DF34D0B669034D35AB14FBB09EB83 REKCARCYKSIHW
438,336,578 *2C659E660BC4A54D0C18CA3C35581A766305299C 1.BEADSHINDU
438,336,579 *2C6CB1679E4C61638408EBB12A48AFF6F4748D99 1BONGERTWASEN
438,336,580 *2C6FD831BF20BA2952E4D72356DE50C7C21A1D5C CUDGF
438,336,581 *2C642D838E911D83A9B546A49B1AA6813F220F91 RENEWING
438,336,582 *2C6D0C78E171EC53DD024CC76B7C075488224B4F representatona1
438,336,583 *2C6FDA81E4FE5C2B3C3182762E1FD6B4558BDE50 1gelinmesine
438,336,584 *2C66F27AF0D6693CD23DEEB4596FCF73F1F26BF8 c%xq.
438,336,585 *2C68F96268C8BCB01D189DBFD14A9554BE224DEB CYch
438,336,586 *2C6EFA62F722170EB4D0C11D19EAA89DA78D82A6 czrh_
438,336,587 *2C6DAC6B32F4D8ED4377DC187817903CD8C91EC7 ReturnJourney(2)
438,336,588 *2C6ED85DE17D73ABF37EBEC341B721F4A033773A D23C$
438,336,589 *2C61AE6D9920F2BBE9FF1F1C06EFD725E0E93FF3 TTERTHOMAS
438,336,590 *2C6025C9FA1B8F1BBEF4167A1F805D4C2B546985 rickeygragert
438,336,591 *2C61754606ED25C08D0D2B5E5F8DB6AEA097C117 1-LUISTELUHIIHT
438,336,592 *2C63B37FC9FE88D2A27C28431C45869FFE1FB108 D&.A4
438,336,593 *2C636B48D808E868068DE4788476B52D95FACAD1 DABYJ
438,336,594 *2C64A448C41400C85D25562B316AA44ECE1742FB 1.oletettava
438,336,595 *2C6734774BF302341D9528137BD878DF2B5AF0BF RIYA56
438,336,596 *2C6BABC362A5427082B83A29AAF0BF5DF4C87C75 TYRONORNE
438,336,597 *2C66221DBC5C5AE5EA6F5F8662714F8EB7067BA4 RMEL---LA-BROHINI
438,336,598 *2C63925EB44C91345F00D341A891762EF264CA36 1publicinfrastructure
438,336,599 *2C68B998584A1688864B636C98C190B6BDDA17DF [email protected]
438,336,600 *2C67084CBC64F81E5DA0B8C10250847DCAD640E2 Ugnjeta
438,336,601 *2C6C0E9DA9DF20C6B9AA607985260AD97115284C 1-SUUREMMISTAKIN
438,336,602 *2C6A477E8179E5A83331C9A02B0613D43BE0D530 dan-mcmillion
438,336,603 *2C6269F9AED4178FF3D525952B50A3697A8B077E 1.URHEILUVIIHTEEST
438,336,604 *2C6780C7AA38A7791C8881B41A45C7AD361B5D61 1VERFARBE
438,336,605 *2C624F845C399C564654D0D1804BF38597A45567 1-virkamiesvoimin
438,336,606 *2C6690198A35CD2897D517585287B71B34E3BE08 1-VIRKAMIESVOIMIN
438,336,607 *2C6484E0ACDCAB554884715CAE17FA8AFDF8DD2B 1 X-ACTO
438,336,608 *2C6DD8FCB20C3AFED8180699F21320DEEDC1DECD )(2005年):the
438,336,609 *2C6A7691808D77CAF86B84192477C5CA7F33168D DARRYLFELSTED
438,336,610 *2C6CF98AF97A63E5D16D4C0F83D5646E7F316938 DARWIN.LOBELLO
438,336,611 *2C6485F998D4ED0702D38C2A55F89287075E6A25 DATE20022008
438,336,612 *2C65549015BD6E237510F0136899A30DD7C00114 UIVUESSA0
438,336,613 *2C66F707A72800DCF82094A9F688368121196CE1 210940t
438,336,614 *2C65A93F282827ACCD80FB03334E0AF603ECD0E3 ULTIMATETRANCEATHEMS
438,336,615 *2C653250A6C71B8FE0EFDB73B040D93D96803149 ROCK'N'QUEEN
438,336,616 *2C64582236BE743FF2FE672B3616546359E5B98E ummara-imran
438,336,617 *2C6DD8E8BB2072530F97C266AC18A1F14F58BB91 rodneyhillegas
438,336,618 *2C669A5666A059685B5F6696FF2C50997FDC74A7 dd0l9
438,336,619 *2C62AC9639081DF5407028E8ADEAD4CD67EB6CC3 rogovyn4
438,336,620 *2C686822691139FE6105AD4D1D3E94A3D6AB636D DECL!N4T!0N5
438,336,621 *2C6E5D9BA48106F205C7EA526728A0EB135C3C7B ROMEO.KLOSTERMANN
438,336,622 *2C670F07C3CE31FDCED0481F20682C6EC4B48B2B degag
438,336,623 *2C6C08D983A31E103AE77B2B8C9C69686E4DCCE5 d$ei5
438,336,624 *2C635377E329B5E024BF44FCD2E1A1B16F4DACBF 2773447 standardeja.valmistellaan.parhaillaan.ratassa..
438,336,625 *2C6C1CE22F183B48A608EB01B6497B7425464C0E ROSCOE.VIRZI
438,336,626 *2C6DCED60515ACFD487596A5385EB0CB37A632EA ROSENDO.KUCZENSKI
438,336,627 *2C68704F3B65B1E3F93C7F1384AA7D5E7A4115F9 28-OSTZAIRISCHEN
438,336,628 *2C6CAB5067AC42B09C805530124E20A50DF0B084 UUYTIKESED
438,336,629 *2C6988477D4D6BF21EA02376A300FFB449DF6C4C DEPO1!T!C!Z!NG
438,336,630 *2C6F1E2677129F9B91E547C868EF7B6E0476B630 [email protected]
438,336,631 *2C6B2B83358E92F1C8AED78705DA3070178E03A5 valen.seutre
438,336,632 *2C62CBA73DA47993C10B39CAF2077CD02166F4BE RUDOLPH.ELLINGWOOD
438,336,633 *2C62BAA95FBA0601497BFDECA0925E8E7BD172C9 rudyblakeway
438,336,634 *2C648C7578E4383E203285ABD1A7CC971B1A29CA vanda.marellu
438,336,635 *2C63A44D6DB3734022FC3098F4E60A7EDB4DB93A vangiannini
438,336,636 *2C6EF7FFD302410565B75FDD4A5CD863EE4E4C59 DESMONDGARDEA
438,336,637 *2C61D52EDC47964E823EBC13BFE41C7E2C52A491 devillikesitslow(feat.jimmyherring)
438,336,638 *2C6B5A5C875C6D6A4DABD72CEB6E5828B4246124 2LIPPINO
438,336,639 *2C673522D430986D6DF14DEC1D754B750D9B03FE d$f4r
438,336,640 *2C6445E4B6D89B5F5543BC158A0111AF0DF35687 d+frz
438,336,641 *2C67CE61AEF8C180F6E9BC01404C341E2EF487C0 RUGHLYN3
438,336,642 *2C6EA4B94B726DE8817C7EE8E08092B1DCCC86AA 2rosolavo
438,336,643 *2C63ADDF04B81CA869D4F0AA493B9042BC907F8A 2 SANGHASTA
438,336,644 *2C6CA4EA091CD96F5FFEED4E3785495FF86722D3 vera.bolos
438,336,645 *2C638E6B1664540859BC947CE7F6196FD7615041 verbandskläranlage
438,336,646 *2C6AB393DC6608A2B7B7767E2B3C9E77E4FEA364 2-todistajansa
438,336,647 *2C69823590892718762B10153011606A53BFC96E D%I6
438,336,648 *2C63C125ED6CD200866D8C2A161ACC69BA08E000 RYAN.MISER
438,336,649 *2C6673D1C9B562C8A4F5199A63294AE7BDBDA964 DIEGO.FUSI
438,336,650 *2C6794054941D0B3536ED436B4DB46FB482776B1 DIESKAUED
438,336,651 *2C651BF54EEE6127204C118214BE6467476AA038 SÄÄTYKOKOUKSEN
438,336,652 *2C6455C77B7729A3472FE8A153E1364A0FA4BC13 SABARÁ
438,336,653 *2C6F12FEF187D75AEC768B57D6748FDB9D9FD1BC direkteinschritzsystems
438,336,654 *2C63CCBF623EEFA7E443C7FED191E402E075E147 DISFATTES1
438,336,655 *2C6EDA155428E15609B166CB276E36A417DBABE7 VICTORIA LOOCK VERIS
438,336,656 *2C6A54EC71BB94860BA1318FE5F70551FF10994B SAKUSYUU4
438,336,657 *2C6BC9172BB5ADDA312A75B57A65C38F1EE9C1F9 vida-n-spartacus
438,336,658 *2C6DF76C3E462C58B516D5C205312AC5C5BF071D SALESCEDIC5
438,336,659 *2C61CF60D44F82349707ECA7DB7E538682106558 salstreeter
438,336,660 *2C62D8C12D7F6951456E7A541E72BFB7908CD7F7 dj k.k. aircheck
438,336,661 *2C6F01BC12B5DE643EA280B4CA6F1FF30CF5584D 3AJERZEYKYDD
438,336,662 *2C6BAAD8800E0CC9C051751348773A79A15BA8F7 3 ESIKARSINNASSA
438,336,663 *2C61850065AB2A7A95200959366B298B39030C9B SATSILAERREPUS
438,336,664 *2C6C192793AE825D08E4E835C9AA37E615A0E1B6 3IAMSECURITY3
438,336,665 *2C69CD111DAC7CABAA87912512BA46EC26BDF1AB sbârcioara
438,336,666 *2C6F3A648AB0786E65EC85F250FAC1CC06506014 dn:o
438,336,667 *2C685071B65B3DBB33D4E2C1E640D3375F156C31 3PIANOTERAI
438,336,668 *2C6F5D8188C77FEB2E9CCF84F3A0C02F59882779 doboleta
438,336,669 *2C6F097C2396FB60D0D234EE456F2D3786FA865E dojpa
438,336,670 *2C6E024A978DF50A39A974A33603BBCE42CF0CB2 SCOMPAGNATURA5
438,336,671 *2C67969B9DFC1D85399720E586658E425525FD9F DOLPHINSRUSSELL
438,336,672 *2C648B9A8B1F2A40096558E4783F530AA04A1F89 vitogallager
438,336,673 *2C666ABFA747347D140DE5954C929F37F01410D7 scotgoodhart
438,336,674 *2C61986033C70EF6D56209059D1CC8C1EDF1128B DOMINICCARTLEDGE
438,336,675 *2C65F9BD0ED2AEF1C546F6AFDD66754E26EE5879 SCOTTIEGATESY
438,336,676 *2C6E40D0A87EE81F3F7AAE1FC95ECA14FABAD7D7 dominiczelek
438,336,677 *2C60CBC879DD39D006A1F21A1326961953569546 vjgm
438,336,678 *2C696BA16D3153DD7C71FCD09DC51F745DF35402 VOLIARBBS
438,336,679 *2C6D959943C5B488D795AA775EA1A5612AA33C70 volleybviper1
438,336,680 *2C6FD19069407F1BD48A4AD81D6EDF837387B0D6 414jadon
438,336,681 *2C684A6EAC53F3E286E435D92E996E92A4E7F8F0 do:tg
438,336,682 *2C6B2A67E59BB0B064114C124824288663CB0BE6 d%q77
438,336,683 *2C65CEE59F393EA47446F87BBD01EE0A775FBA71 SEMIPERMEABILITY
438,336,684 *2C6370F1F1D31BB61177917B92C71E45EE91F015 DQ:S9
438,336,685 *2C6D1A9ABD8E84379DF8A6490C82E1389BCD0390 4rpvnuurv
438,336,686 *2C69E1429BB63952D41CF2BD77A7A48D7D002035 ds`=
438,336,687 *2C66E42D0EEB320B78D28533EC127CFC031D9A71 4UNFAKED
438,336,688 *2C68234858F125C05088B34536B908CDF42E5CA6 walkingthedog(live)
438,336,689 *2C61D290BAFDD96FA1D4689BD528D01C1318147A SHAKUZOJI
438,336,690 *2C63BF5F3BF4C35F348F8A7EA0D7639505B0D9DF Dust14d3
438,336,691 *2C6B657FD3F796A22CF4CD7DD5C9F83B3A31C758 dustyhershenson
438,336,692 *2C6D30963D50121AB4A4D41B21F343CFB452F591 [email protected]
438,336,693 *2C666901CFD8BDCCF633AB571196EFC8EB5116A6 dvbl
438,336,694 *2C6585488DF6B703322D44C12B43C928A8CE766D d-/yq
438,336,695 *2C6833300D0F5D02B37FD511FD7CD293A19C79A6 WANIELUVINDIE
438,336,696 *2C60E46EEDE7458CB32605E8C4C6813F5A937A23 SHANNON.BURUM
438,336,697 *2C6C20E17DEE493D9BCBFA058A9E09451D9C2A21 WARFORE8
438,336,698 *2C6CAD830684AB00DBAE98D09EC2182711E8B3E5 SHAUNLIVINGOOD
438,336,699 *2C696F5DF8411F6AE5B5151F1E9F139820A268C4 e0vz
438,336,700 *2C620BA90CFAE28DE30C625DAE368978A2D8F300 WARNINGS.CHRIS.LAWSO
438,336,701 *2C65F61B6AC5BD466EBA5A4C684C451D749683F3 [email protected]
438,336,702 *2C67A97031F5958F51E1C436F42416D4A1A8F631 WBEAUTY7
438,336,703 *2C61B5090E5EA22DB11CEDCDE6EA55C5682F251C ed$;+
438,336,704 *2C6720E98436B5D8C0E4FD180556B04A95C539FB SHERMANGIERA
438,336,705 *2C65476A4E5EAA5C942A4459A5546A8C30290D88 SHIRLEY.SOSTRE
438,336,706 *2C63D3EAFA7529C476EC5F8F585BA5C4E80B0443 5ELIHPOMREHTIRUE
438,336,707 *2C6E49CFB714C614B7760B9B43B47EC37C45F084 SHOOTERS.MAYBE
438,336,708 *2C6B08776780DF589C8A0C3336E0BA3C37B7D6A7 wendymscott
438,336,709 *2C6AFAE30ABD5383B016E1E3E51E7E21EE00CC06 [email protected]
438,336,710 *2C66A2BBAC2EF248FB00CA792A2A7AFFB4BF097E [email protected]
438,336,711 *2C684F303B6649F93F391B9F31F58FF18B09FB0A shulnot5
438,336,712 *2C6CBF9A4DE94CC7865C2CBCA58D422FF73C0020 WE'RE-A-COUPLE-OF-MISFITS
438,336,713 *2C6AF08679EC55F8ED8FF1CFE754EB40B994FE84 [email protected]
438,336,714 *2C60BE236357EB6FCCAD4F5D9FD8FBF08948FB22 [email protected]
438,336,715 *2C6F6934F979B7E0E366336263E6F1BEB2A376D1 EFRAINBUCHENAU
438,336,716 *2C63E97BC174A1A6F1477914A8FEB474AF381B87 5overbevisning
438,336,717 *2C6CD81776C1A83DC562DE157B5F3A44C126EE7C 5REDSKINSTEVER
438,336,718 *2C672140EC3F7068035B17A1CAA52F8E4B403B4E si-todos-fuesen-iguales-a-ti-(feat-rosa-le
438,336,719 *2C6EF469660861A1F1A52ABEB854D124B26A8227 5.SEWAGE-RELATED
438,336,720 *2C605BF3B0E4EBF45D4E837E1EDE0FCC6D362B78 5SINGERMARIAH
438,336,721 *2C696474B2C455A616F7710DACBCF9ACA6CD65BB EINE KLEINE NACHTMUSIK FIRST MOVEMENT
438,336,722 *2C6EDC4CC5F41FCB6CB827E2D6E7E83EA70F9BF0 5USE
438,336,723 *2C6C77389EB3CAA90620E39BB191CB5B6BB26E9B wilfredakre
438,336,724 *2C63C069917C53EF132C32DFCD1A61D3266DD831 ELANORR5
438,336,725 *2C683F8D69558965EE48E7B04C988AAD9DB560CA 66.PIKKUPOIKANA
438,336,726 *2C6E70587F2374C4C9F78F63A1EBEFF85115ED5C [email protected]
438,336,727 *2C6BA56573581E2355DF3BF7A32A12B4689938FB [email protected]
438,336,728 *2C640F9169B5792F1CE898C06C1B40E12A3A969F SMOKE.MACHINE.(ORIGINAL.MIX)
438,336,729 *2C6B5517888F4D326D96D0D0AE8C47396E49F2C5 6ANUDRIA
438,336,730 *2C671BA85BBBDC58A1C1FB0052CA598C67816FB9 ELOY.BERTHELETTE
438,336,731 *2C65B6F34B3FDCEB4545BE1E2BDFB392D57486AE ELOYCLOUTIER
438,336,732 *2C66CDC34756ABD12F448D912852A8F9787F8D50 6BSWFORTHESE
438,336,733 *2C69A80E514F205F57EEAAC0319F8BC312FE3546 ElPerfumeDeParis
438,336,734 *2C6240BC32202A976DCD5C223BC460981C902A1F WIN JIWATTANAKUL
438,336,735 *2C6D6DA28EA38E7610E6D4ABA8A7707FBF091AB2 6DANIELOPEN
438,336,736 *2C677E788412E10C3CD137A3EB0DBB3904F5D1F4 So13ru1i
438,336,737 *2C697A5FA9E52070E563114B421A55968F73FBC0 6 elim
438,336,738 *2C6C2560532F5ADE54EE590A3FB56DB5DA044F64 [email protected]
438,336,739 *2C6B49AAD44D8CFFD3E32E4C8DA157675143E38D EMMANUELSCHIRM
438,336,740 *2C61CE2F5B003EDAB4A9737307E856AB8D065B8E EMMILYMITCHELL
438,336,741 *2C62CF9C4FDDCA939F36BC7ACB79DFCAF57A928A soleşti22
438,336,742 *2C67E753F37D26F99B6287B7FE34BBBEA12AD3A1 solmcmenimen
438,336,743 *2C65683CB20EF1715257A7E2CB37AA5D4B03F7E0 solo.i.pazzi.sanno.amare
438,336,744 *2C61DD635264E7E4CF7E085F263CF87209E28C1F somnoler4
438,336,745 *2C6E1A3D273F2FAD6BA542AC2D7B09F00D764F6F WQWIMBY
438,336,746 *2C653C56EFD80CEDB703F918F9D79DFD9F318714 6MINOUPLATO
438,336,747 *2C6D02F6C93F8654495DEF0C03A0011FC0F2D193 6MUSCOVITISH
438,336,748 *2C6503C7488447EC1503C23B353C7D2B1AA3F25C ENDIMION-MITOLOG
438,336,749 *2C6FC8111C822C97433BF730A5199CB0705EF481 en),h
438,336,750 *2C6A67BBEF6B452FE3C512B5F3C74CBD367FAADE ENSITIKS2
438,336,751 *2C6AEEA2A18A5B028E65ACF2A7B25C0A8C460360 6TAKSATIONSKOMNMISSIONENS
438,336,752 *2C64FF4016C1C7D745E396D4008CF858853A1F12 [email protected]
438,336,753 *2C620BB5D059F8A439244E9BF437CB853709D708 WURFSPIEßEN
438,336,754 *2C614CA94EC45E947536CFEA3643A164277A43F8 eppab
438,336,755 *2C66AA6985BA457102356D0E4F1B71C2A0A83F03 WWWBLISSFULHOMEPRODUCTSCOM
438,336,756 *2C623EC5543448CB08CC5F77EFB4AF921F38DE89 SPARTAANSED
438,336,757 *2C6E62276BF7609A5741A87F1B3AC7EAC8710390 ERICK.MCCORRY
438,336,758 *2C6C1E96D2F00B90093D34CBBDDF58EA162C531F WYSGD
438,336,759 *2C6C669D922410E4C7897405721FC8E18F731A22 ERIN.ASTURIAS
438,336,760 *2C65658254D16ADB1B8639F07043BE3ACAB9E775 ERNIEELZINGA
438,336,761 *2C696F746EF9C5BA20DB55FA7C5EEE186630D1DC ERVINPOLEMENI
438,336,762 *2C6D4B4593EA7C72E042AD4C7B2C784A5A2D8D90 [email protected]
438,336,763 *2C6077370EFB4124555FF05E532556DFBDF8C634 sportsblue
438,336,764 *2C60B47E339E3425907F372C5B866822411DE03F SQU34KING
438,336,765 *2C6BC135F8A4ACCC89829EE1D9C2BB7C0CB1112B SSERDNUO
438,336,766 *2C6CF74578ED63D4DF7CC758B83B5B4D6341BF8F SSYRYYK1
438,336,767 *2C68EAD13FAF6C184F77D57F2907712C72BF273D EUGENIO.HOAGLAND
438,336,768 *2C60223208DCA9DA6F0697D3920D6E665A237306 STANLEYSNOOPY
438,336,769 *2C61F3C3DDB080862D9F985784BE5C8D48DA14B5 カルロス・チャンのXANGAサイト
438,336,770 *2C64CC4D42B79E480CAE3229551FF21BB80C8AED 7BIWELDEN
438,336,771 *2C6ADD0C3D115D0A9DC9B59A5498D4B2DFBB8789 7BSWLICHTERKETTENBSW
438,336,772 *2C6A33B7D15208EEDC33210F77677437C4DCBA38 7BSWSEMMELWEIS
438,336,773 *2C6484204C2EA971E94ABAD13734AA0806D7CB86 ÉVOLUONS
438,336,774 *2C649929A366BA248D0DFC68AD3100258FAC8427 [email protected]
438,336,775 *2C6A1E6A5805688DAE45D7AE3CB0C75881C45E39 STEALTHWARRIORSES
438,336,776 *2C6761AECB0EFF9FD6E36E6508C71701A3F6DDFF exhumes
438,336,777 *2C6DC092BE92C4E894BB6DD0946065AE0B200DAB EXLEISH
438,336,778 *2C6FAD726D928295C13067BADE69EA44594B662C 7EITATSERPTROPS
438,336,779 *2C6FC60CA5F7F2725D07B250EBE4B1CC0ECB4FA8 STENEIR
438,336,780 *2C61B145C3591A80A6EFCE71063798D0481AAA47 ey!ko
438,336,781 *2C6CE8554A0EC121B9C9E3C210A236DDA222563A 7HPALMERBSW
438,336,782 *2C6CBE9CF1723EB6969A58597979D11A3DC98E6D 7HTEMEES
438,336,783 *2C6A5C0926287E1900A0E6A757517F0B21840A2E STERFTECING
438,336,784 *2C68EBBFEB6E5C21819DF03E48DD6C03AA94A3BF STERIALC0
438,336,785 *2C660E6F8B60AE86E5573C0A04E63FEA1A03F179 F0RE$7NG
438,336,786 *2C6D96E6F920B9638F8191E86E0CF2E2893DBD2E ;}^f3
438,336,787 *2C6E5E088A67234F603188938E2DBAC1F92C6A44 f3xs
438,336,788 *2C6DCE7F8BB0C6902C5680437EFC7F85C3BAC834 xiongwei,凯斯西储大学病理学系教授
438,336,789 *2C60793394F9D62139B7E525A14C906E780D7617 FASCIASS6
438,336,790 *2C6E11395863AD27E0818BFF8938AC9FDCE1FF12 7KITTENMACHA
438,336,791 *2C6F11A82AC3A76145091E202BBE0970212CF66F fb0613fa3c5c1a7a93c6a91789d85f478785f9
438,336,792 *2C6F58EBFEDD6CCC68E57B8142968460F9AE5FEF 7MIKROLIS
438,336,793 *2C68955D56ADA287E1AEEAE9487BEF0214D745EC felipeelfering
438,336,794 *2C6DD85181EA1803BF71B3662C3630D22063B9F5 7ROCKYTINA
438,336,795 *2C612118B263866120C0688456B06941353636E2 FERMIN.COSTLEY
438,336,796 *2C6336A2E7259206DDCEF2133B06F5B3FD1E1EE6 ferrocarrilero
438,336,797 *2C66332C8BE09868899420CFCEF1705359AEFD2D XNETAZSRA7
438,336,798 *2C6A65FACA508F1557682E8A5DEC10CEDA238FBE STOLONS
438,336,799 *2C6656271164498C21E65361B75671068D3CEEE8 fm雛見沢「圭一・悟史の雛見沢・クール・レイディオ」
438,336,800 *2C64A93D980CD1EDD8ECA2D09E7828879DDA563A .fod
438,336,801 *2C6BE25F65D8C447EC7FBE7F1EC4C5B426222278 STREET),东到街(SOMERSET
438,336,802 *2C635373092C779BA71D9CC1F88B811C3E80C56B STREIFENSCHUSSEN8
438,336,803 *2C6B0BBFD680122D408E650CE889F9846F2A3E6A [email protected]
438,336,804 *2C688C3424089D561DD0FF239E5D762D1C34ACFF FORDEFOUNDATION
438,336,805 *2C687796444F14C0332274F2FFD032D2713012F0 7Х10SUP
438,336,806 *2C6EF07D37B26B44EA99EEC3C7412DC6F3B0649C }8{.0~(------p
438,336,807 *2C6F5D8082D317256B3C489056968458E14AB941 847MARIYAH
438,336,808 *2C66B549962C3BA71E4F36EC6D4E8063CB1FFDE1 8588 1980yilinda.1982yilindaborclaritemizledim.
438,336,809 *2C67F52F9CA6FABEF5A36E61E4570C3BA62AC507 frbp
438,336,810 *2C6F5B5CCD9FCB748D7E86BACFBF6E5B9097F1F3 YARDGUY111
438,336,811 *2C6D55C33F127DEDA414774AE8BF3129E4DAB871 FROM4G3S
438,336,812 *2C60680C4E765C2AF6C84F9BD0434011F413788B STUCZEK
438,336,813 *2C6637F59A2D8262F152A146A98F0D3A6D8DE757 SUBALPINUSES
438,336,814 *2C68C4F3951AD2D7098AD903AC5E421CA160B3B0 GADIJANDE
438,336,815 *2C667BA15F1EBEA4E27DF4E412AF8CB5102B22F1 8AUSKURIEREN
438,336,816 *2C67BAE2BC0EDA4E82C2C8FB87F7BE004D88DA18 Y-ESPERAR
438,336,817 *2C6672E596B6CE5A2FFCA0812A31E74D3B7D003B 8BSWLIJMRBSW
438,336,818 *2C624F87E4E393918DE3FBC0128D40C0B644D722 GARFIELDSIMINO
438,336,819 *2C6017FE5F80A90B2A4ED0C467D54527C7C49B92 GARFIELDUZEE
438,336,820 *2C63EB702BE97F259344FCBB22EFA9B0BD82ABFC GARRETT-MCALISTER
438,336,821 *2C6039060F6ABBA793978E04B8933FAB61AD04B8 SUMMERSSWIFT
438,336,822 *2C6F3D657C00F3C100A84CB664BE2EDCD2110F84 8DEPPART
438,336,823 *2C6673582EB46CCE1FF9579146A714694823CE8C sunghemby
438,336,824 *2C6823C965EA20F2BDAB094980F5370B0CA77ADE [email protected]
438,336,825 *2C67978B0E7AC427DB087D730BEAC2987EC63FED SUPELBASSEINI
438,336,826 *2C68D022C668AE4B4593903F281D619906A6DA41 SUPERMARIOBROS.3-ENEMYBATTLE-WARNING-ENEMYBATTLE(HURRYUP)
438,336,827 *2C62D07DB4C766FC734FBB21A0C43FFA609CEEE6 GEÇERIM
438,336,828 *2C698E71CB7090B697A03089BCBE4483607D6D44 YTTETSIE4
438,336,829 *2C6219857051B31DAFEABFC850935FD0C9E5282F 8HSIHSAGT
438,336,830 *2C69558031B1563FE8C6DA1CEB0250224F972084 YUCHUNKANG
438,336,831 *2C6C34A5565C3271F1765E3291875830D703D702 YUKIKOHOSHIMOTO
438,336,832 *2C6398ADBDC3F86E7740BC89A8597B484E4DB879 SWAILSSLIAWS3
438,336,833 *2C6FEFF5E01A8EF8110EB866D7DAA40E32954DA6 ZACHARYADIDASED
438,336,834 *2C6C823A6A1E29BAED728008D89B35143E1B1025 ZACHCOPLEY
438,336,835 *2C672F04A5726BF3C674C6F7ACB2C8ACDC6FF0B6 }8{-o~0~-(---b
438,336,836 *2C657888AF8CC1C0356962F23131EC97EA7053BA 8OCTOBER1128
438,336,837 *2C64B2896535EE6FF60AE4D016B353E60BA78944 GILBERT.MONCIVAIS
438,336,838 *2C66E0549223EA932576238F2FF9CF6C9AB4CE2B gilheptinstall
438,336,839 *2C6784997EDA69CE72BFBDF20E94393763E34B74 [email protected]
438,336,840 *2C68AE94DAEE5DD98E814C474A0E18A546FDB3B0 [email protected]
438,336,841 *2C6DE9B85219971002F75599660AD3779304930B GLOLATIN9
438,336,842 *2C6E30D2F5ECB8B2581A4D9DFE455E0AA35407A4 syedakhtarhussain
438,336,843 *2C655EE43467BB09E0F6433CE3EC43BC7F4C5833 GNAMRT1
438,336,844 *2C6FEDC891A1BA1A4D63F957883BD7F67168C41F symphonyno4inamajor,op90"italian":iallegrovivace
438,336,845 *2C68DA1C23458048CCDDBF2604BB7B1CDE43AE4F SYSTEM-ANASSEMBLYOFCOMPUTERAND/ORCOMMUNiCATiONS
438,336,846 *2C6BDB4F385DEB9B10C7A2EDF0B83202A21DEA49 gocougsapril
438,336,847 *2C69F67A5BD593C42246032BFAA80E22E6B19717 [email protected]
438,336,848 *2C6972581FB8070E64D56638585C9E342410FA7E GORAGEIT8
438,336,849 *2C620F871DD290A5A3A0B170627CEE069712E8F6 goto...
438,336,850 *2C62A3A532D356AB4636008B0DB03730120D96DD GRAVE.'L.MORIRE,.SV.57
438,336,851 *2C6D4894E57525F9FEA9709CC25E440E685A27E9 GREGVARLOTTA
438,336,852 *2C62ECAE6DB2DD6B03E63B8A31F373F9C2290CED GROUP32STYLE
438,336,853 *2C64C8410DC5D71AFC3CEB6783DDBF0AC87375BB GU&>
438,336,854 *2C6C6B657935783955D847209C2AA00E3D31A0D0 8PICASSOPOWER
438,336,855 *2C607EAB8AAD661D4DE0FED95C56C897D8522C16 8----p~o(^_~)
438,336,856 *2C6DF9AD3FF024F2CB83C9AB8493CC6C3D438C57 GUSTAVO-CARCAMO
438,336,857 *2C681CF8F888F60E96A175A603B940ACE0186588 GUYMOJZISIK
438,336,858 *2C6D62B8C8ADF40CC0CFB26CDD6A71F01EF6EC06 H'_-
438,336,859 *2C672866EE5F5357ABE59CDF3D1B15FC55148688 8THECHICAGO2
438,336,860 *2C6F9F45C89D4F11959AC2F079BCFF2A2AA08F58 8WYBZVITOFEMG
438,336,861 *2C6ECEBF93607FCB3BED4CBC405F1D80D19E0259 hansmotamedi
438,336,862 *2C64C49C069536E8237D8501455363F43443C394 [email protected]
438,336,863 *2C612FA1642B18E10AF3FD19C19660A6D7E766AB harrisknotts
438,336,864 *2C6D7FEDCCF60A55D05A82961C3FD11799D371D7 997291 Uzeyirkorkmazecz.
438,336,865 *2C6296F72EFAF1031F99B25FD8AAEF14D5032B75 9BEARHELP
438,336,866 *2C61F04EAE10492A39397FEEFFC4A68F238348E2 ZIGGYDOGGIE
438,336,867 *2C660A3F57121AAFDF075FF365FE2D5C774CEDDE ZONIA PAMELA ZUNIGA BAUTISTA
438,336,868 *2C692847F6C8599E253024D48253A260A010A995 TAPANTES7
438,336,869 *2C6D6B3A14D24D61003C030A354A2EA6573EF366 HELLANG3
438,336,870 *2C60DF767791780C2D75204ED7BFADD189D0246E hermes19
438,336,871 *2C66254026ADC06894FF9172FB0FA712C7DDEFE9 HERSHELFILICETTI
438,336,872 *2C6C50F99EC4CA95B7127A2FF17904763DD7836B tekken.card.challenge
438,336,873 *2C685B96FCFB7E763E29B016FDAE415F8835144A ΟΣΊΑΣ
438,336,874 *2C6C1F9644DEA8E4AA625BB9EF6E4C92B4E8123D 9STROJVDCE
438,336,875 *2C6150CD57349052B92DBE0BDE962CFA664EB9DF 9STRONCAMMO
438,336,876 *2C673AA0DCBA51B989C842C7B87FD02B71E23781 ЕСТРАДАТА
438,336,877 *2C626ED9A9A4A476CB6856F890D5BFD6D3CC2E4F «мебельник»
438,336,878 *2C6AB2B2D187784BED82916C9D6E9C1763D24E1A thefallingdown
438,336,879 *2C623055FC8DEA682CE457FB7E54573B8AFF10C9 the-jam-(feat.-krs-one)
438,336,880 *2C628675081667DE9BEA156AB706C8F1B53CD6CD Honeysuckle-rose-(Playback)
438,336,881 *2C6B5FCC4F03A6701A5D28B9860EB57ADF1D95E8 aa(oz
438,336,882 *2C69899C0F8640D7AED4DAD5BA0344EFAFC457DF [email protected]
438,336,883 *2C6F414CD71AD28742CE3A6D96AAECF86AEBE4DC HOYT.HAKEY
438,336,884 *2C61E9ED56033F03F51533174E9425D6AACBFFBA THESUSANNA85
438,336,885 *2C6E8C866CBABEC856B362244D997DD0BDB620A1 ABDUL.LOUGHNER
438,336,886 *2C651E4B48F0D7E928969052B037FA9512F16A7E abij:
438,336,887 *2C6430E0A76FFCC65F65B0704D00341A308256FB aCalatrava
438,336,888 *2C61DD320B61E2E2ADBED2AD030FA8E3F40863A0 adedara
438,336,889 *2C66F22C1A3566BBFAA2FB2F1C0D44DC563F20C6 ADIKHSAN6
438,336,890 *2C6EA18B2D1A39AA8810604A43AF258B83F87667 TLOFFAONSOFFTEMPLATE
438,336,891 *2C6200042D9E275FCE99E856BDE05DB3A24CB083 HYDROCHOERUS
438,336,892 *2C67C8AC99AE317289112995405496A5DB714EEB HYMANBONGIOVANNI
438,336,893 *2C642D8755117959DD66DF59994BFED5ECE7274A ADMINISTRATOREZEQUIE
438,336,894 *2C68A387FB3E3923659329C772D8A6148860A3AA ADRIANHUSTIUSTEAUA
438,336,895 *2C61E0C8EF170C2B57F52E570074B10DBB04CD13 ADRP}
438,336,896 *2C673B85F35B8D71CFB8E246B946836E190715F1 todtenbilder
438,336,897 *2C6999CF2B675E2A6B9367A69C3371631320C5AB tomasadib
438,336,898 *2C688241954077DD51C42B11F739B63B42D2FD90 tommor
438,336,899 *2C6DD0C6D17BBD32377B9BBF320AF1F451E0F327 AfterSpermWillUrineFlow
438,336,900 *2C608E1401714F00F1689245E56E52CAF591C618 torontobeanie
438,336,901 *2C6017B869DE3495AF76CD500191E2D412D85039 ILDIKO SZOCS
438,336,902 *2C66D031604355D5841A850C699E4AEAEC3532AC ahqbw
438,336,903 *2C662BFEAED3440C204F1E3A2D8C68B5E7F17032 aj1ii
438,336,904 *2C6BB5AA41568C5815BCD17A9B57E6689E1EE05A A$KU;
438,336,905 *2C60971848FF1FCB6AF774384ABBFAAF7D9F72A4 impersonalities1
438,336,906 *2C685AB9555BAE52641CC6345E244317108D68CA TROY.TOI.BELL
438,336,907 *2C6C9B0AC3F94555D379DEAC2A294C52E0E6B3F7 in1i3r5
438,336,908 *2C67894BA18272E7646E6771F2AA3A3B75A6057B TRUMAN.HOMBURG
438,336,909 *2C6B9323659F1B3AD04EECFA6C7706DB0059DECF TRY(ALITTLEHARDER)
438,336,910 *2C6D1F890A9DC9E208D0B3950DC624133379053D INDUSTRIPLASS
438,336,911 *2C6B8B5F0B7391625AF008F4933AD1B8342C3FE8 influencia(featsantiagomart
438,336,912 *2C63619D45647E26BE3D1341DF40C122EEFA3EC0 inpenit
438,336,913 *2C6677F35A6B557D27AE59C2BD120D3054E8C7B0 ALJOUDIE
438,336,914 *2C632497FD2351DB664B9D136AE4C393BCF04E19 tulisanes
438,336,915 *2C6735354DADEEC8EEA204BFAC592765CA17313F invdphys8
438,336,916 *2C6B8F0B86B2271B148D6040319654AFF2E8E0B6 alvb7
438,336,917 *2C6B53B44BDCD96E2E75B937A87903FD6A1A9119 amadopump
438,336,918 *2C6D5B9C33F89BA4D232CF883B2441E2BAE0B6AE twoandahalf
438,336,919 *2C699A40AFB8E2530D7E09C83D4F008A880838BE AMBROZJA9
438,336,920 *2C67A4306E2E6CE35CED79165DE9C3AF3358842D IT'S-GAME-OVER-(SUGES'-REMIX)
438,336,921 *2C6FE6AA30DDDD0D34D3D8DFBA623DA8ADB59837 UDLUGNING3
438,336,922 *2C67DE53126BBA61C680D286822AE13744D93DC2 UFERAREALE
438,336,923 *2C61D147FF49C585493A64B338EDA8960C320204 Andy-Dean
438,336,924 *2C609D0681382F60FA0568BD17DCCED119341246 ulaşir
438,336,925 *2C6E7365D465615748B301D275801858EF363EBA JAMESWEARN
438,336,926 *2C63AF3964B222BD7DF7B28EF9B02BBC18DE5437 UMESH S PARKHANI
438,336,927 *2C6B03891C9B4157B87E738639F010F69165E65F UMWERFENING
438,336,928 *2C6DE1B16707334F3B52918318FACE7AA26644AF [email protected]
438,336,929 *2C64DF423B011209D83F744BC53FC7CE8B894AD5 JANZILLMAN
438,336,930 *2C6416CF8F599011B3401C9784B24805502CF4DF AN.ILLFAVOURED.THING,.SIR,.BUT.MINE.OWN.
438,336,931 *2C6176F012907FEB2D88FBE46AE62011309DA653 ANNEBONER5
438,336,932 *2C66997A32A6F37F84145227AB2FF673B2BFFFCA A{NR
438,336,933 *2C62680F29211FA9B3E0193B16D726F36A404CDE jennifer.l.roy
438,336,934 *2C6183849D82F674690DAC11033370F86B50DD19 ANTWANZIYAD
438,336,935 *2C6E47B15A0F7C97071D8C2929675212C512E8A9 JENNY2581
438,336,936 *2C61DFDCF4E7980328838CE44C907B60165974AC aokv
438,336,937 *2C64CCEE1017355FB7041144670931FD1F8213AA jermaineverderame
438,336,938 *2C63284DF7B49C794E95329A7799FA89B3E97C7F JEROMYBOUTOT
438,336,939 *2C6F53F302796999D029938F3F2456A96C7710EA jerrodchueng
438,336,940 *2C6C4D6829CB8F05C629D3E17396755A1F2270FD APPARIESED
438,336,941 *2C663A5082C7554D2162E9AAAD38E6CABB64F526 JERROLD.TRYPALUK
438,336,942 *2C62A4E8204A6BF5EE4ED0FBA81FD0B6FD0E18B0 A/R3D
438,336,943 *2C64CC7EA98A2CC931AA3E477CEE13E04503BE21 ARCTKTHFNJH87
438,336,944 *2C6B99A0F6201543BEF4017DD7464B4AA924C0D0 ARDEN.ELSKAMP
438,336,945 *2C6DEB05CE2A9E668D9F67BF5A15C9A224BE6985 USER71-247-243-173RH
438,336,946 *2C677CC8BADAACF6C97D5B4125B087D2EA309407 arehtoelc
438,336,947 *2C6585FB448F285AECCCF50AAA738B5C8A3DC43E [email protected]
438,336,948 *2C66615C9F508CA157C04B56F37A60EBBAF12722 JIA YIK
438,336,949 *2C687242E2F0FE9FB65E998E65C51513F23EC329 UTHAYA-BOB
438,336,950 *2C65EE53CB8BB1B540F4F0E16FB333E07AFF6272 UTRUSKAPEN8
438,336,951 *2C605CF1746A07EE7BC16AE6C032A46819F8BD3B [email protected]
438,336,952 *2C6CE613694B997B8E50FC5F5EDBC63E10DB3A38 [email protected]
438,336,953 *2C64B07E94373442C974EB158353FA6A679D3D52 [email protected]
438,336,954 *2C633DA2CD525B358A419E4897311C1EAC5C2584 JMOCCIOLASA
438,336,955 *2C67C272D9597068DC3856A763D0076A3A11C309 JNYUNYUN
438,336,956 *2C6B16E3663C110BBB882299FA8EBBF8C655A8CE JOE285
438,336,957 *2C620DA36ABFE6242A4D51D90CC1C7956DF9BC50 ARq
438,336,958 *2C60C981FD932D1F3AA17B5073F8F866B4C8D3F2 VALENCIÁTÓL
438,336,959 *2C62BA23CA8BD7DCB9783BA8CB33E16A7F853A62 ASEH#
438,336,960 *2C6522403A607E4D86DA56A8E9BB16B93EA4D2EC JORDON.SPALLA
438,336,961 *2C6487E073C961342974F5F1EE62337E28AE67BF ASMUNDUR6
438,336,962 *2C6E0FADA16ADAA49A19ABE35DD611FB0C444471 ASSISGNI1
438,336,963 *2C6885C3EA4AAC89FC0B317B642C3E519934F459 ASSORDAS7
438,336,964 *2C625EB90E146AC3BCE11A39780E88D0D1C9E304 VANSULCER
438,336,965 *2C698B38ED7DAF03915CB5D6ED59078BEB1FB833 [email protected]
438,336,966 *2C66249A7B41C087F66AF08E70F61421DF9695A2 varnola2
438,336,967 *2C6E2B1594A53FF83BF67E0E3F993CC255E95A70 JULIOHOGE
438,336,968 *2C6EC7C83EEF0F8C83A77CF33FE0D4407857BB06 Jumping-Around-(feat-Pryme)
438,336,969 *2C6B2303494EC108C1905101FAD756F0E2ABABF8 A?TK)
438,336,970 *2C6291437EC2BE9EC35A558167AB1A5FA410F317 ATSLUG'SSALOON,VOLUME1
438,336,971 *2C69FBC4D830EB7E2F39CF33D1ADB6F02F34FBC9 11.16.1929
438,336,972 *2C6DE7962EAFF53CA30DDED0B5F117A28E359E3C aureliomimozo
438,336,973 *2C6A44AF843ED68563A1CD679850E15D7A338F0D KAISERRICHMOND
438,336,974 *2C60D98103C01CF843FFB00CBEDA3D4AE961FD9B 11.hexenmeister
438,336,975 *2C6456F3A8392995255BAE0E5C5F92711345BED9 12: 12 -# -& KINDLY
438,336,976 *2C6BD2355AD52DF40A317AB75C609F4D4005A750 VERY.HIT
438,336,977 *2C6CD28C81F5D4E6685A73C38E381099C7B820F4 [email protected]
438,336,978 *2C6B6889CFD3F002813D4DC6AAE03C97EC2E67D6 KARIRIJI
438,336,979 *2C61C26A0518D0C6D2BFC893167ACFFD83884528 12-TALES-FROM-WINTER-CITY
438,336,980 *2C6B808151373ACDD9232B1721270E29B4F3A319 1313269 TATSAECHLICH.WURDE.DIE.GENOSSENSCHAFT.1953.GEGRUENDET..
438,336,981 *2C68BB6159D5452B577689D905B7562C3A499FC9 1331904 OHJELMASSA.ON.ESITYKSI
438,336,982 *2C6BB358C022D5A0D83ED3F21F720193FDA93E88 13KUL
438,336,983 *2C63BC4BAFE6720A9D9B37A159D8596805F62893 vicky.megann
438,336,984 *2C64373730D63908A7311F684662B4B93F60FFB0 kathryn.fallon
438,336,985 *2C6D39DB43020A6E9E8C8D4D74408915B88DCC33 victoria.alegado.labis
438,336,986 *2C6976C4F7A8D58637A80AEB5017F28897358051 KAYIFORUM
438,336,987 *2C6D1636077EEDB7E3DCFAFDD14AAB3957A81E46 axaaa
438,336,988 *2C6169E7CF2AE9BC41F6CA930F40AE6923634A81 VINCENTRIDLEY
438,336,989 *2C676E820D7D229351F1975A54BCEDBB8B715225 kelvinschmid
438,336,990 *2C6B4102D135C604F05F9F8F6C82BCA655399DBB [email protected]
438,336,991 *2C6F43E9570A4ED29D3369DB9842E578DE0D37E3 b,1sd
438,336,992 *2C66F55161472388971CDC766FDD97A1F0F554FA b6l"p
438,336,993 *2C654189DF1ADCF546361B74972329E747827BE5 VOKALEN0
438,336,994 *2C64D53F2EB7D6B2E2E32D4634582A78EA841E7E volitation6
438,336,995 *2C6D5199F42B2BB9968BE7BB80D8B8287888B854 vonmasterson
438,336,996 *2C6C46984C61011870F0A6262E724F3BBC79B899 KILL 'EM (FEAT CAM'RON)
438,336,997 *2C62F5CA29B859A128743FC030648EF32DF723D4 baby-this-love-(feat.-george-duke,-stanley-clarke)
438,336,998 *2C68571FF741996EB2553118C630563909B2699A KITARICA1015
438,336,999 *2C61E932BA4EDE3B40CC7703F02A78BBEE61C557 BACT&EACUTE;RIOLOGIQUE85
438,337,000 *2C66112148C01C9B5733C994A42517A578FD3D03 vuyelwanemo
438,337,001 *2C65A51C3CAC10EDBA969134FF2ED136802648F0 1987894 useidenkiertojenajanseeikuitenkaansaajatkua.
438,337,002 *2C64F0F4C9B53A920CE3B23D2B06C48AC9E15D3A 1 ADULT-YOUTH
438,337,003 *2C60EAC8606B90F2E322AFC185196D3CAE132BA4 1-AISTIARAKENNETTU
438,337,004 *2C69A0208B85723501FCF37C4539DEBC293FAEB8 1 ALBAISA
438,337,005 *2C60F15574E48B03B2E281E47177CDD069FCC0FF BǍOCHÉNG
438,337,006 *2C61C7B055D83DBD7EA6E211AA6CCD504013F6F4 1-AMPUMATARVIKENIMIKKEIST
438,337,007 *2C6B65FD8E02C0F0FBF3541344DF51758B554926 BARBADOES!
438,337,008 *2C631191D6F7BF0E8F74D5756C4B0352450EB2A2 1beate-uhse-sextreff
438,337,009 *2C6CA0977E30B1223FD4D5ED31F82ABE09CAFC51 [email protected]
438,337,010 *2C6E307425860018D1DC3DB0EB0FFED065C89DFA bbea
438,337,011 *2C6F15F0B9BB83C3463FC920A55C786C6D7D4542 kolonlu
438,337,012 *2C63523CF9233F12C24491A470EC829D13D8058C KOSEXIT
438,337,013 *2C6F13F3AA138BF13886C2B3DA2F3A0BEF56C986 benedictlocante
438,337,014 *2C6D217824BA99A5A96B5DBA2A9053A2DDAE0246 BENITO.BENJAMEN
438,337,015 *2C655F0C94549F6247FAAC31BEA12922C51B2AA2 BENJEMAN6
438,337,016 *2C63908B448B6670369FC8005000C8033B229904 beoosten?
438,337,017 *2C67CFB7D7F5161CCFF159072730C13F2B638E2C [email protected]
438,337,018 *2C6BE70BA39F78B3A88E62906DB2FD26212BCFB0 1hein
438,337,019 *2C650FD45E0B90EA4A4EAE741B9617EBF73C8697 WARDAWARDI
438,337,020 *2C67CC4EB202C3F4C51B874541F69199F6D276BD BETOKENS
438,337,021 *2C6034F76461DC419AE2EC84014993BC07A194C8 BETTIKE10
438,337,022 *2C60602906ACBEB560C9836FA32A20FF28CAC16D WATERSPANGLE
438,337,023 *2C60953C2D719B4C267E3033247EFD2C5A8ECF16 b%ffk
438,337,024 *2C649B6DEB19A8E946B6D606420B544BC9106149 bho?
438,337,025 *2C6C95E2F3B62C48CD4B4AF195C3C4A8509A93C7 K•W1
438,337,026 *2C6C11996621FF9AB008EE30FF038C10395623CF 1kkuevom
438,337,027 *2C6C6E5CCB3BFC1BC2B46A210BCDA80F1238CD1C blcqd
438,337,028 *2C6C761E078A05A4FFC4DF4DBF8F9F1DAEEC9071 blessing123!
438,337,029 *2C6502FD0EE46D2E64F6666F77CC2CAD2CA5D9E7 WELLBUILTINCCOMWWW
438,337,030 *2C67CBEFD6E339BDE4579F993BBAC3E9AA1059A2 WENDY-BODETTE
438,337,031 *2C68D351ADFE75ABCBAB56965B67DB8D64B6D1CC B:LVM
438,337,032 *2C669785FCC063989E2E32A58022B7D2DC21DAF7 borostyánkoszorú
438,337,033 *2C657F7B7FAC342C88C74D787076A20EC5CCAB2C 1.LOTTOVUOTTA
438,337,034 *2C60CA4BAB8D9FBCD7BB3067F8FB79E55F657550 LANDONSIGWORTH
438,337,035 *2C6DF215F7ED3A5D13A52744004A7987A9681910 boydputt
438,337,036 *2C6EA01FD76160A0CEE7918272C603AA0FDDFC4B whbotbsn
438,337,037 *2C67DD2982E0128EC4F218F2B1F5A3AE7797C512 1-MUUTTAJALUVUT
438,337,038 *2C6F23429F68F53FF6EB42CD112A1C73850C2A26 b===p.~.`splat!!
438,337,039 *2C633EA1EED3B1B7C0573E3CEEFDAAD1AB3DF516 LAWRENCE.CORDE
438,337,040 *2C6A529CEF28F6590E41758EB5EF66A38A5B32AC lawrencedaley
438,337,041 *2C61C0640BC6C968AD0EC7866A92B5280AAF8DAF LAWRENCEFRIEDMANN
438,337,042 *2C62CDC7C867DBC7717CE0E8F62D1988E5D5B78D BQH2
438,337,043 *2C628E80B8E21B9AEBE6C6D3E8E1D1133E0F7957 br00khav3
438,337,044 *2C6A4E92165D63667D822F54DAFAA0FFEE4CC20D LDUCHOSSOIS
438,337,045 *2C670FCACCB30C6EF344115FCE1F79286C11EF14 bradfordthornock
438,337,046 *2C619960A1D0EFF8315EC0539C4E3C774B02F7A4 bradhengerer
438,337,047 *2C6E0DE3B0A0FC7FF911A18197F5CECC2BA6A782 LEIF.GARNESS
438,337,048 *2C655495E05B47B76FBC515A70863D0C19774FF8 brockgrieger
438,337,049 *2C64529CC0D477C2E132A670C9FE549CE7E6419F lemuelmiesch
438,337,050 *2C68AA33F8DB9536D89561E915D220AFCE537F65 LENINSKE3
438,337,051 *2C65D5793787405BBD9AEC042A4AF1E9372E3E1D 1-PARTITUUREJA
438,337,052 *2C6CF21762024F924556389367AFE43AB50CF4C0 WILFORD.KALLFELZ
438,337,053 *2C602E88EED32F7E7B2802D50501E5123FF2F632 BT?G1
438,337,054 *2C6D3A37BEA0C0072BCF1D31091AF0F50D1C92BE 1POLYSULPHURATION
438,337,055 *2C681DF780FFB15B242789814EEC963914A8F851 [email protected]
438,337,056 *2C6FDDE1A532D5EBD23A3E53E1B6D2A081DDD230 LEVERS
438,337,057 *2C658C1DAE6EF0FC071E0FE4240403FA521821D7 1RAPLATTE
438,337,058 *2C6D7660D5260815EBA91FA3B174390295F56083 b?uc
438,337,059 *2C60F4A63E3CD1931B933A2E7A715DCF8A300C55 1SKRCILI
438,337,060 *2C6B7AF5DD9571B99E5FE6016A802EF26CED490D BUDDYMULHOLLAND
438,337,061 *2C6C97B03035D3FAF8379506305C0B3E5995536E Ligotait
438,337,062 *2C691E2107CB267138866AB5489579DF6A03D124 bupr5
438,337,063 *2C6B9F48123686D3D32AC0734C525019669B5A9A BURL.DAUDIER
438,337,064 *2C68D9D48F5338168C07B48D2D227D763811FCE9 BURTON.SAWYERS
438,337,065 *2C6CD8F6E1C53D4E40CBA7BFE1456DE4C861BDBF BUW;M
438,337,066 *2C6CA22363B01FCFF06B4983B72B3CA4EE448D08 bwvq"
438,337,067 *2C63AD4EC9C5F689BC80DC90351485C2451FE447 [email protected]
438,337,068 *2C691E5782FED0D6119B10395D4CEC2A309A7D42 BYCDF
438,337,069 *2C6FE23F3947829A6764FE32F41F1FB31D4A4683 1.suppeahkon
438,337,070 *2C6951E23AA4666ED5DA9A2F52AF7EA744FF73D3 [email protected]
438,337,071 *2C64D192C4B95199A089FB71FA1EE1EF87839EC8 [email protected]
438,337,072 *2C6FFB43E1A6BAF44A200AE4345BEB3D18219A44 C13T
438,337,073 *2C62D914C655F2448D6C7835637FDF1A5F3962B3 WORKINGWITHEMOTIONALINTELLIGENCE(DISC2)
438,337,074 *2C66A63155E23E1DCA886DAE2F15DA3321F05828 WPHOLSIRI
438,337,075 *2C61624B66B672241E4239256F9B24D7A368D59D C-3AI
438,337,076 *2C68BBC6C571AC6341EAD5667291A51095234D55 1WINDEL-SKISCHULE
438,337,077 *2C6DEF804A2D2BF67C008EB25CBD5A7254A25F1C LOBMYS8
438,337,078 *2C679C5C79B0D7AA6EB7BD215BB0C8BDD59821AB C9d+
438,337,079 *2C633C864D6FBD8AACBAA71D5C161373E4B4F483 212069 niiden hoito ja k
438,337,080 *2C67F6384588C5F48E1DC1B6039ED4F0BBE1385D CALDK
438,337,081 *2C6E90370B21FE9A38415F7C51A8B1407718F3A3 lovemili
438,337,082 *2C60AECDFBF2747339627F49338111AF675D4965 2242290 viranomaisten.mahdollisuutta.ymp
438,337,083 *2C67F0D35FFEB95222F38582F3E1E2CBFEA8C7A5 2261310 EINFACH.SELBER.GRUENDEN.UND.FERTIG..
438,337,084 *2C673099E8189EC6348791ACF3879D029235E35E CANDICEPIENAAR
438,337,085 *2C657C4203770DB1C7678144395E7F622859A705 LOWELLBLENKER
438,337,086 *2C66862D08E874928ED943F1461F364832B9C8DB LOWELLSAETHER
438,337,087 *2C618626110C3798EED21B27310B5426EC82C020 lsche cowboys
438,337,088 *2C65797E79400A22E5AFCEFBFFA11FA34F1F8228 [email protected]
438,337,089 *2C6754FCA8EE4B34C46A04D60D4CAA97148A76B0 [email protected]
438,337,090 *2C6DBCE5E4B22F4122333D08F2B6C743EFF6D2B5 )X([email protected]
438,337,091 *2C6E3C980E776E7B5FFC0ED49CB0C07D8EFE0AF9 2546359 lapsen.kognitiivinen.aivojen.osa.on.kokonaan.pois.k
438,337,092 *2C6FBD8603AB41A142AFB1BFCD5CD8B0854CF29F carmilla72
438,337,093 *2C6CCC89C9A609BD33C083206FBADF97182AAEAE LYNN.QUENNEVILLE
438,337,094 *2C6BFB0222727C37AC94C470B346B208EE5D1DDE [email protected]
438,337,095 *2C6E672DA5BAC36E07139595E881AE844795E9D7 [email protected]
438,337,096 *2C62F688B16468677734D59374E11310969F20FB m4+eri411y
438,337,097 *2C6768910968AD1C426B2828C3DA262BB8AFE18A carrollmeno
438,337,098 *2C6909E53A88EE18EFDF4F76D23E60CE3EE6AD53 2696759 SE-ON-T
438,337,099 *2C6D9508AB4A02B6DD3A6D630249E2993134F667 MAC.VANISH
438,337,100 *2C64524810E5F78530B661752EC15870D3C0CFB6 MAELSANZ
438,337,101 *2C66F702CC15FDD4847E9E65A48E70E4521893F8 YAKAWO
438,337,102 *2C6A1F1B06176EB8BE49DF28C2CE8090D232C32A CAVALLERIA.RUSTICANA:.PRELUDIO
438,337,103 *2C69A6DFEAAB4CBAFA05F0840E0E363B5E3CD812 [email protected]
438,337,104 *2C6D00B50794E2F09184D6CDB8B28157F116B930 yanygarcia
438,337,105 *2C63987E88107A1A2CF5ADAFB06DDFBD27004D8F c+dg$
438,337,106 *2C658048FF064D6F18096F40F4BABD2FA01135CB MARCELLUSHEATHMAN
438,337,107 *2C635DF2848A5B6ACDF4EEE0D444F68C48C705D8 CEGKL
438,337,108 *2C6345362844B250FA510D2963839CF97A0D4537 marina-gasic-klacar
438,337,109 *2C67347D5E94903C9AE759AF9D96BB96BBBC4E98 ce/yd
438,337,110 *2C61D1C87EDD6831D9A4713C563EC524E0991659 YNKSKLSY
438,337,111 *2C6697930B0E537579E96E3CEFB4B267B67023D4 2-davonstiebenden
438,337,112 *2C6FF52AA8C663F814EBA66DA75069FD3F99E832 2-donis
438,337,113 *2C6DE37205A719C8E36145524521C46E422C2980 2EF9B92E5F4E4A3FA077E0F1EF3E1C56
438,337,114 *2C6A0F558D77256E0788BFF856FE761849E172D5 yoonie.jung.cho
438,337,115 *2C654E3598144E1D7272C0B603D059188A14D413 youmightneedsomebody(brockpocketmix)
438,337,116 *2C6CB26BB99D3327804DBEE00D26D4A3F53A569A 2KILNSCUM
438,337,117 *2C611EDDC94D22535A387B8149D30F810D1F2492 YRCOMEH6
438,337,118 *2C616B91E4A9F3C33572743C374E790EEC08014B CGtI
438,337,119 *2C6CCE9B0C798D19158E99B5363EF47F62B027CD 2soberup
438,337,120 *2C60AE2E769A557FB3A42334D69F31881A159D4B mateobooz
438,337,121 *2C6D168B621140CBE11E6EE6E19D7900E6A441D4 MATHMEDIA
438,337,122 *2C6BE1C7F72117A1CD091CF5C8FBF2F8829C5443 CHASE.KOENEMUND
438,337,123 *2C6E0760A5760ABF35F1FF9C36FA1E1FDD02657E [email protected]
438,337,124 *2C63A939F6556051BFD0F1CE361E986CBD59FAD9 @2v]xrr
438,337,125 *2C6AE451EB4BA0CE770040DF2DF149FCD3A0483C CHEAPWOULDVE
438,337,126 *2C667972E79F79A30E609AC52927F23C3C53E029 30february1043
438,337,127 *2C6236300E353DF02FA9F19C1A4762FB228BCA93 31FEBRUARY1987
438,337,128 *2C614850A32FBD05AA1828F0ED2E4489AD6FE7D1 31–OJE
438,337,129 *2C67695718A771050837DCEDBA2D2795FED470C7 zachariahmosquera
438,337,130 *2C64ABBA586D337480DA8666C6F373B7F6331018 [email protected]
438,337,131 *2C6DCAABE34231424F33DED3BEB8F33BECE521CD [email protected]
438,337,132 *2C687F628BDF195C960E6A28188BA22CDD398A31 ZACK.SCHWIEGER
438,337,133 *2C6161FF7E8F98482F8721F2279F2A19339DC7D6 [email protected]
438,337,134 *2C6C0E4C06550E1F5D08C7B8C33A85F108AD5A12 394YUSUF
438,337,135 *2C61C7F2E85ACFFD3583FDA5CCEC70EB7612EC2D 3BAUMBERG
438,337,136 *2C64418F0D548891959868899C62B78AE866B5E4 3B<~~~DB
438,337,137 *2C68878758943A0D685D2D00CDFFF3034927F54B 3b<-~.`.q--p
438,337,138 *2C6A93C2A46FBAD0B4610171683B06F728DE45C2 zaskow
438,337,139 *2C65D325B86C791E5B148DC1565BCC248832D289 zellphase
438,337,140 *2C61F6F1F51FA97EC8D638B0991A08056F0DF4D5 [email protected]
438,337,141 *2C61D7FACD43FAC46EA62536DBA49B3ADBE32CEA 3KRAMAKKELIG
438,337,142 *2C69C5BE2B6CCC60EBB3A864901851BB25C48296 mexican society
438,337,143 *2C65C42E4B8169EFB029F9D11DCE43D9A4E3409A michellhector
438,337,144 *2C6CE1CF01718D343CA2A7376F818EE1D6408830 [email protected]
438,337,145 *2C614F662AB87C6DDE0611EE689533A71231733D [email protected]~`}O{
438,337,146 *2C67A133A0C5B1C118206CA8452EFF976FDDD965 [email protected]
438,337,147 *2C6BFB89BC60F98E991FF7BC23A5BF434E238205 [email protected]
438,337,148 *2C66AF09A51E401EDDCBD026D898FEAB9349BB83 MILFORD.MCTHUNE
438,337,149 *2C6DE49E53528F45F9710D43B74D51BF30645022 ck?mw
438,337,150 *2C6C4388CA38B4D295C82381D35C82FB10CA405E CL0V
438,337,151 *2C68C9CA7AFF794A3F2EE383C0C77DB356A9CA91 [email protected]
438,337,152 *2C6ADC008153A8C80468E932DD197D5576D9CC6D 456.RUTH
438,337,153 *2C691C1DEDB3A6E07B1B5A785CF882F38C4145C3 clevelandkerchal
438,337,154 *2C64DD5A4DAB84F09C31CE38CE10DD4984BDCE97 CLFL
438,337,155 *2C6F45CA8AF8A2CE9AC6F1178B38BE61947BEE0E MK4TT4N
438,337,156 *2C6FAD391BE3B626026DA3D8EDE6A13FE81072E0 Z*RS
438,337,157 *2C64D8A6AC1E008B842E0C3C37E2AB1AD290B32B clssn
438,337,158 *2C6725FC26B787318E435C269B2E962E8178959D MODULSCH
438,337,159 *2C6D8C2FD90A20FE4252D8E2ABF37901F0984CFE MOMENTAUFNAHMEN(8.29SHIBUYA-K
438,337,160 *2C63085D89B33CBE1363617617953216FA013F0E cnaw
438,337,161 *2C6D900164A7D5FBA1046743E072E6C072C6D8AC COCKYNYC
438,337,162 *2C6CEAE162B0537207B522B5D495005C4F723A6A mosterdlepeltje6
438,337,163 *2C629B3B96917B9FB52DFDE6630A1351E9DA7AC6 MRGNBLTY0
438,337,164 *2C6984C0566C3BE9375E9808D1E55436863322DF 4HIGHLAND8
438,337,165 *2C6BE351C78192AE625BAAE6A5314F9B03028686 κίβουταρ
438,337,166 *2C6C999FE731559E0F6762427C04B68480CF72A0 CONMÚTANLLE
438,337,167 *2C631D7DBEB5587C21E508AD0A791D8A4EB71250 CORNELIUS.CHADDICK
438,337,168 *2C64111506BD6F45DF26D4673A70E5F67E7D2F89 mycougar39
438,337,169 *2C6FA53C787991DE0B25D1BF8A6F4641F2872A96 COURTNEY.PEASLEY
438,337,170 *2C6B63620AB3401D0705A640B5ED29BEE387C2D3 mz-g
438,337,171 *2C6F5B3DCBCCADBD7A214EF1F0AFF06A60877487 NAB0B1SHLY
438,337,172 *2C60524C224E840A7DACE487C948EEF431481329 |NAGEA
438,337,173 *2C6024AE92662F07E508E1D103E867EBF4CD3EE5 4PEGARAS
438,337,174 *2C69D8AFB0AD9C7D3C63B007C75B102BF8ABEE60 4RASTALOUISE
438,337,175 *2C61FDD8B5701BA5ECA85D477FB623E4905ED31F Cq0
438,337,176 *2C6518CC626A9AFA320B6AE5CD5A5FD1D8F5387C CR121403
438,337,177 *2C6A11E70CAC655F189F77BCA07FC1174E7B2CEC Crcum1ocutons
438,337,178 *2C6496268EA887D3B0C81F2907931D7ABF4AEC9D crestfallen4585
438,337,179 *2C66C780B2A91F87B0BE6C8A809342BA0E4A7ECC [email protected]
438,337,180 *2C6F8874398A6E25AE4F8E79ED34FFFDF211ABBF CROSSCLAMPS
438,337,181 *2C6947BCD51BDE2588555516B8E5864A47077701 МЕНИНАХ
438,337,182 *2C6B70DF92A5DE75A43AF23016430521B579D1DC neizlije
438,337,183 *2C6FAC6BC1538664934A0766D118299A59F907D0 4WATSONJESSIE
438,337,184 *2C656F0405484CF3A516B6D249D8450D34D42E3D 4WINPMAILBSW
438,337,185 *2C6723E20149265056E641F795817EBFAE2BB2C6 nepmaknetreh
438,337,186 *2C6946E68164DDDB18E7BED623652A279C762231 NICOLE-ELMER
438,337,187 *2C681B0FA520C33B85A4288298D6CF9EF857AB74 .NIKE.
438,337,188 *2C6EEEB644C8229C4CA0B27F7DA6A4516B68435E nimrodcleaner
438,337,189 *2C6B78A03A097D865DBE16A6E8D10F7B61FBC441 [email protected]
438,337,190 *2C6A611AF15468E9FFDB9709B18F3C237BA64338 crystalkoehler
438,337,191 *2C6E9F71BACCDC0A74AADF825813294672624DFA cs9:e
438,337,192 *2C6D6BB3B944D2EE6786FC30ED4C39ED76DB3A48 Csf,
438,337,193 *2C6A79C6061BD3D16D77A0EB7258F0F8935C262C nonprogrammable3
438,337,194 *2C69832BAC6282C874EEB9872D0A9D3E7E6B18A1 531FRIDA
438,337,195 *2C6C74D0C716DD8FC9D165404567B5A98733DFA2 ctlf
438,337,196 *2C641F642642F9AB9BDF37955E317D4D01BA356D CUBAN BLUES
438,337,197 *2C62E64579520108905DFF0D68A114C1E9C96C86 CU%R
438,337,198 *2C6BC8FFE4E50A310DF3A7933B15AD9C4F49274A ><o~<#8
438,337,199 *2C616F5B00DCC39A20C6A1FE1D70E86D5F2A81B9 CURTGUTSCHOW
438,337,200 *2C69B8A2F0BFE96D251658E129B686AD34D62A51 OFLLEE
438,337,201 *2C6F6F029941FD74A24159374BB9A717817803CF oiziniir3
438,337,202 *2C6D2CDE0C35849AE10BFBCB2085E4B9DE9E79F1 Cw$=
438,337,203 *2C6804268FD6D79131F048FA04B1A096836CACAF теселација
438,337,204 *2C622CF390181106B89AE64EE9EE36287425CDE7 以ĀLEPH
438,337,205 *2C643712D68414AB2123E6593E4612165789C0C6 [email protected]
438,337,206 *2C65772DFEA82F3B26DD542589B66D3CA29DB922 CYGX
438,337,207 *2C6684376C758A6D52807566724BA2C926C42A4D orfeoedeuridice:chefarosenzaeuridice?
438,337,208 *2C675451808FD5DD8FE8984A9779A1839B622973 D0GQA
438,337,209 *2C6FCD5BE9E406498A255D258D10FA89E81F0AED osorio220762
438,337,210 *2C6876E11D7A11B3BC9C387C992D052C6BD2C54C d3oc
438,337,211 *2C60B96173DEF813CE76AADD1B0DB9BFC0614383 [email protected]$
438,337,212 *2C6502E901E55E48FE68835909135927A9CE76A6 PALMER.RHIM
438,337,213 *2C67F680BB98FC9C07326099E7756475D907A343 D(4MO
438,337,214 *2C62964957FBED9CBA699B312471A0CB11C8DC79 PaoloBeraldo
438,337,215 *2C66B25CAA5DB265A38E1D2A11766AA377636A62 D87B
438,337,216 *2C69B1E95E26DBBBCFB432808879BAA188465EEE daisy-gard
438,337,217 *2C62E82ECC1CD34174182365451C763E9A9BF295 DAIVON1234567
438,337,218 *2C6DECC59C77D2B1E6338291813147CF27EC37DD PCASSINUS
438,337,219 *2C6724B0627E67FAB68BC54BFCD3F2D7B3AAEE27 pd~0 (~_^)
438,337,220 *2C60FA0D8EF6091328AB1F912827A132F9CC7184 danny-elwood
438,337,221 *2C627FD14AA856CE684E3C33E01AE39B68117C97 percytrickett
438,337,222 *2C6C415998776681AF3876DA3D799FFA1FC52E3C DANTONIOI
438,337,223 *2C6A34F34E519FCFB556AF397C3A1C9C51EBA553 5TORMENTASE
438,337,224 *2C6A014148CAEBA682D194A8A7FB963A2A681ED0 pernelhas
438,337,225 *2C64E65A4E77AB1643E43216936DDCAC24B93D3E perspective(afterserviceouttake)
438,337,226 *2C6953705092C7C8DC682CD2E1BED270E1D4B4EF peterelroy
438,337,227 *2C608E9F6EB511B1A4769EC2023768F32EC6BA8A 5-TUNTEMAKSI
438,337,228 *2C68F0B5746E9A9216DE334676BA251926629256 5.tutustumismatkaan
438,337,229 *2C6C331AADCD136EF8B3A2B14329C7E36CEDEB24 [email protected]
438,337,230 *2C668AD1B1810A9CA3316141A296EF06CCD63D01 PHILIPHENDRIK
438,337,231 *2C6EB6D509D1EA995D6CF6CB92DDB0E514FD9E5D 613807 KERRAN PALELTUNUT ALUE PALELTUU HELPOSTI JATKOSSAKIN .
438,337,232 *2C66A2EB4E6CA6A60B1AF7DD30B10852269E639F DATGENEN
438,337,233 *2C6B950204328DC2C3171D89647281754FD25F7B phillipwotton
438,337,234 *2C6DBCBB19A137BC5079DB63EB3F1F0FB2484651 PHIL-MITCHEL
438,337,235 *2C64DDC0F16EC65A092A8DE81001FD1AE94EEB76 PHILPARTON
438,337,236 *2C69A4F0A554F83661142F9AA581968C81260B28 PICTREE7
438,337,237 *2C6F829C5D564906B3405B190941E0CA3AA0E837 6ANTIISLAM
438,337,238 *2C6FD1999E32C9690A263D4F2A96D92209D697B3 pingres6
438,337,239 *2C6DB565EFAA6ACAA5AD4EC2D4847EEFBB8A8159 DCEC:
438,337,240 *2C62FFA472889BE93D4EB70172B4AE607D9FEC5E 6COLORADOMOM
438,337,241 *2C69D98FA79139212F9A0EF49E8FC5886545C69B ddnxa
438,337,242 *2C6543C1BEF76C16FAE33A0113EB0CFA3662ECF1 december-robinson
438,337,243 *2C61D7567A30D57108D2F581EB26A5730A6DC642 6THERESAMORRIS
438,337,244 *2C69DCE4CA2169F2717C2EF450B2EADB9CE9F791 6THICKENI
438,337,245 *2C6F7B758122DC7551F3E37A427EF40DE7C8B047 [email protected]
438,337,246 *2C6411355DE5286715FC294DF17C68BEEB0AB45E dennismontilla
438,337,247 *2C6BDAECB40984272E732FAC421EDC1DA7F39D94 6VREZNOR
438,337,248 *2C6AB5B24CA309122877B2238B76351185D71F46 p#####p~~splat
438,337,249 *2C6B64FD76F5E7B5686D0960A676F1FE342F3E57 703JENNY
438,337,250 *2C60AB86D7FF796F45226F0DCB44BA274EB5A27D [email protected]
438,337,251 *2C64716A44FA1680B5CABA5AEF47E300AE7623CD DEVOLUTA9
438,337,252 *2C635AECD3DD214DE9FF51DB64544AED31155343 7CORKSCREWFLOWER
438,337,253 *2C6C080AC35AD40C8D79D8733608923FCA99CB64 dewittfrankin
438,337,254 *2C6402BBAACE336149206504778C0A49EE9B4728 DFM?D
438,337,255 *2C65C6F7364101BF042592308C925FB0AA3ECAF4 DG/GM
438,337,256 *2C695100FC58923591513E56BB187C4EA5EC3F99 7HAFTUNGEN
438,337,257 *2C69E234A26CC334B992853A52615BB9D5462FBC [email protected]
438,337,258 *2C69A8890ADEC5F84A88948520DA4B473B25F7BC DG.RP
438,337,259 *2C6DE56F5F09D3A129B554456B4CE3CDD6A489A9 puntubi
438,337,260 *2C6E321C5CE5D78364364E5E4C7C6337AECD8868 putovanje-u-plavo-(voyage-into-blue)
438,337,261 *2C61E9AD9874F5102C2B53A964F8C26247BD2B99 [email protected]
438,337,262 *2C6EB872E277A6F60A3D291A1797D37772F19B4A 7.MINUTE.PISS
438,337,263 *2C6CEED4092F718404C847C22112317F51E9DD41 PYK~
438,337,264 *2C628A9FA62E299D3254B30D7ED1F9924C771A3D Q##)*.)0(
438,337,265 *2C66ABE52D59020C4D40419BCC3CC7D8789BB27A [email protected]***~0~osplat!
438,337,266 *2C6E8222B08C5E97E2F3A40A8E14F39ADBA97AD4 QDMGENX6
438,337,267 *2C63CE6E1AC38BDA2F8667A9DAA80EF132CA30D8 7PROFUND
438,337,268 *2C6B4D33F981FADC7BE81687D9E7DA3FB1384FDE [email protected]
438,337,269 *2C6353282D81AE43649D725F88FF8B928CCE3C59 [email protected]
438,337,270 *2C6344403AF48511C654E34CB7BCF6814721FADD di,(z
438,337,271 *2C6086BD70B0D1E734DDB3302B4BBDF8F8828AD4 @#djdima
438,337,272 *2C656FF5E87F48E4518BF747ECFAAA02BF16DB35 dj dom
438,337,273 *2C68AB69A70CCF2A795A847C6C5A277830E4C3A3 12 HELTEESEEN
438,337,274 *2C6FA07A45D063DFB066E5E2447507C8A5490A65 DKHPR
438,337,275 *2C6061F0EB07FF3BBD9C4979C7D14FB471A30CE4 q====p-*-)o(
438,337,276 *2C682BD48BBC52105A0C130C0101AFD92E813646 1500102 KEUHKOAHTAUMATAUDISSAKEHITTYYKOKOAJANLIS
438,337,277 *2C62818FE779A4603ECDB61E3AF11D11DCC3B90C 822154 klimasatinalirkenmutlakaisiuzmaninadanisin.
438,337,278 *2C696662CF8F8686F042194DA5EE571CFFF1AB09 qv)k
438,337,279 *2C6DA3AC13000E385E294AE872C19221F2F87C72 R3VINH4SLHOS
438,337,280 *2C6C8417D294B5D462072F874B6BC3E63D12F33B 883081 tutkinnonsuorittajaosaaitsen
438,337,281 *2C60CD37D5908D42FAB7584397056A5408CC3E1F dodoadude
438,337,282 *2C60F521EBA7EC6B5F075BF15D2A8415B6C29E48 8ALYCHNE
438,337,283 *2C686B0116D840D32707FC6A26ECB3AAF1AB4872 [email protected]
438,337,284 *2C67C209A0F194DCB63F68F6ABEE5CE978E4B214 RAMILLIE!
438,337,285 *2C6B4460E8138099CB5BD3019C0DD3C8E18D6A4C 1793606 pulssitheijastuvatmoottorinliittimist
438,337,286 *2C65AAE9D6F4A7F1B93A83863A3637D1C24E36D5 183399 ISRARLA BENDEN AJAN OLDUGUMU KABUL ETMEMI ISTEMISLERDI
438,337,287 *2C6D6DBB9243EAB8C0F27183051440772543B102 RANDELLAVILLA
438,337,288 *2C647096CC11D369B5E7F339528EDFBE47B6573E RANDELL.KUTELLA
438,337,289 *2C690BAE8F8A998B0BAA2CA2710260EAE13D113E 19.07.1254
438,337,290 *2C6AB295957C9F23AA225C9519F8DE1B38958D5F 198611 HASTALARA-2-25GR-
438,337,291 *2C65574EE6767DAED7864A11BE14667D439F10DE 8DOCTORTARA
438,337,292 *2C6784873E3A69A07920E74C48494A5343C9AB8F 19nov1677
438,337,293 *2C655D4B06C6C4B0781BE74033B00D6604EE0676 raydalee
438,337,294 *2C6F512DB605A39AB9B4214A1435EADEDFA29ABB RAYMONDSABLAN
438,337,295 *2C6DD8D3DEC8E5CE3E30136D2B7AEC0551433431 RECONVALE5CEN7
438,337,296 *2C607230AD0FFD2AFD1BDE9EB6A3688BFF29935C dorseybacke
438,337,297 *2C670B531F862B198003406BAD2D10F938E3702D D)OTA
438,337,298 *2C6DE2B71C57504CDB646ECFC17A9256DAC16B5A [email protected]+1ve
438,337,299 *2C693B9D5ADBDE7DF896DE9AEA98AF85D5A770E8 regolass1
438,337,300 *2C6CDFB8AB9608DBD838A9A16284382B54117997 dq(50
438,337,301 *2C691F6A288E19895338CE5FBF6C14A92F242604 dqga1
438,337,302 *2C656238287DEE6DED2372C5F9BBB4C538755616 d%qta
438,337,303 *2C656158C6EC16ADC1853E229F96D3E83F5CC4C9 1 desa
438,337,304 *2C6395D9AF260845060AC7BA9041197ACC30B009 [email protected]
438,337,305 *2C62C41A5471331EDD1863F7B566DF01CC10E5C1 1DRURIDGE
438,337,306 *2C6336D45B123732FFAA1B3A0EDC92300E869040 1DSTNSNS
438,337,307 *2C653450747E06AA98C7877A074F1CD58625C6DD DRAHTIGS
438,337,308 *2C60C00B56DACDCCD91C4D6C86478B16E3BDD960 RENEWING
438,337,309 *2C6C60A0ED811CB24B0ED73EB77D5E77C6B9442B DREW.CULLER
438,337,310 *2C6C87F2A9BBFD27A2A9070A6F46CFA5F20A40E0 1 FINALISTS-WILL
438,337,311 *2C60648E15258540474DB097462934A489DA7528 [email protected]
438,337,312 *2C6B8A03B9C4412D45AFCE6C666979417EBA1AAC 1.FLOERSHEIM-WICKER
438,337,313 *2C6E9687D3C9ED8C22F1C4266A8D27B9781EE64F D(RLQ
438,337,314 *2C6AF3249CE3D4374459BFF3AABF0EFCE2F070CC 8p.~.~.~.Splat
438,337,315 *2C65D64E58922C56BC16C409BBAA00486EB0AAA4 8QUESTSPRITE
438,337,316 *2C6369912542F93A9976A121FE18FFE8E05DDD43 dss0g
438,337,317 *2C6949421FD970220DDF0B462BB675E2D3F242FD REYESPREISENDORF
438,337,318 *2C6C19BE7A95B4B6A46DA5EB5AF44AF5FAD51F92 1hein
438,337,319 *2C68E48D5EA6E870791F089E8817D6FFFA92ED6D 1 JAKSOTULOSTEESSA
438,337,320 *2C68F803009477F8A4ED043A0E44C4D99F3339A3 rickramelli
438,337,321 *2C6FEE0ACD04249F9C3C009F88BC2606E0A995F8 DUALITY.(FEAT..DJ.SHADOW)
438,337,322 *2C6D15E64D974D0E7BEAD1254511EC108F5FB67F [email protected]
438,337,323 *2C6498A8ABA7CD39FA00B4E465A1EC9C92A401E1 1-KREISHAUS-TRAKTS
438,337,324 *2C6E4DA0F6F10EAA1F1177E2521E6B3192C64E70 8ZAPRIMANJU
438,337,325 *2C65CF449FC44637E1C9EF86B3B68DD29DEFC558 9021233
438,337,326 *2C62A06CD3DC2B1BDE5F6B4FF55B2A8F5CDD4E24 DUUA
438,337,327 *2C6923759959BFB4DC2162FDC9DE22996CEC23F9 DVUD$
438,337,328 *2C68F5E41095BCE09DE81E6CE159EAB2F539741D 1NIERENENTNAHME
438,337,329 *2C648DF3A8FCE963C5D176909D35C73C8D67C203 9ALTAIR
438,337,330 *2C668C790CA299B2B5CD3A22594F468A41F9B448 dw(bc
438,337,331 *2C694D7606F7B45C110C805DE586038D5E104422 robertbarriere
438,337,332 *2C676F5F8B56896649A5075B105D20AD50D08033 1.orientierungsmangel
438,337,333 *2C668CC2FE3A37830CA72B0FC2A91A7763E63E1C 1 OSTBEWEGUNG
438,337,334 *2C68E5CD7EB85BA9BA8028E42C285226FC25BC53 ROBERT.ZAIDI
438,337,335 *2C684308DAB8A2F26B851996A603481632510862 robinzak
438,337,336 *2C61540DC1249F988DBD60E9A07F1068C1903989 dycpq
438,337,337 *2C6E33461D882E621C9833F7F0BA9F72A52D1E82 1 RAUTATIEASEMAKESKUSKUJANOLJAKKAMARJALA
438,337,338 *2C624D9F79812BA997448A0A3DF32D2E4E148F23 ROBT.ADDERLY
438,337,339 *2C6BA4FCB367EBC5D278BA45CB539D82330AFDBD roccofloer
438,337,340 *2C675EC8AB4B7764B7F180C5DF6B3CFE245BD1E4 ROCKY.KLEINTOP
438,337,341 *2C608267070F607ACEB1597230E2D98C781EBAAE ROCKYZAGEL
438,337,342 *2C60296462941C865BCB2305EDC591C9218DED2F E8844640
438,337,343 *2C6B59A7D65789BD8259848F8EF8682ACA90B220 1-spitzenstromerzeugung
438,337,344 *2C66D5E80DCDD5EB0EE80FC857094E0E4DC3D0D0 ROGER.ZAMBORSKY
438,337,345 *2C6643FEFAB728951AFEDD4A32BACA0FDB321BE5 9EQUITTER
438,337,346 *2C6CA9CC6B2F6F427DD5B2E20CD9975745602A67 1-tapaustensa
438,337,347 *2C631B3F70C9B6B99B53E4E2458972E9B4D8E0BB rollandsirianni
438,337,348 *2C654A47D43991EA181B3ACB52252D150A1136C3 ECDUD
438,337,349 *2C6B6F4AC5EF6331A822289FBC8B2948A2060101 RONALD.LAPARI
438,337,350 *2C66B10AF1736F8E3992C87690EC07C399FA93B8 [email protected]
438,337,351 *2C69DA675694D96B000FB6236F52328320E337C1 r.orgel,.bwv.767-vi."o.gott,.du.frommer.gott"
438,337,352 *2C646B3EEA96CA510F72F7EE4B4553753988D237 1UNSECULARISES
438,337,353 *2C61838A2C5763BDAB77542192603F9BB6769DDC EDi0
438,337,354 *2C63A373179CF37A0AA3F8D72F278BEAF7C5CA0D EDMONDABU
438,337,355 *2C6209955E829E51CC203783F67D83AD39E48C0F 9INLIGHTE
438,337,356 *2C6639162B3D361BDAC173DC420E0E4E05DA4CC5 1-WELLUN
438,337,357 *2C6A89872C2B46514D29E505FF7125EADB33BAD3 roymammoccio
438,337,358 *2C6434D99C27A7BEAE8A5B013287F25E6DB6030C 1.WIESBADENKLOPPENHEIM
438,337,359 *2C6F87A946666B0AC382B12BCA84876A1FD04EB0 EDXDBXFVFVTHDF
438,337,360 *2C650F0EC343824F36535D180415A1E48D0FA699 9OFDISTINGUISHDODO
438,337,361 *2C685E62C154C237BD67A2262CBE578EEB59DD40 RRANDITIA
438,337,362 *2C6C2C24C3181AA4FBBFD97678F717A3201FCFE0 9PMCDANCER
438,337,363 *2C6A2C4CEB31B5B530786BB040DA0810475AE7C4 [email protected],
438,337,364 *2C6AF1661F00C22A09A092E7106E619EB6DE5C14 2015992 TOIMISTONYHTEINENS
438,337,365 *2C6FD2A73D7EB8E501F549EB93A27066034C138B 2028311 katso.,.autuas.olet.sin
438,337,366 *2C62B8A5B5630A0327450328A7AE92F4ABBEB3C5 RUDCHESTER
438,337,367 *2C6A2E1FF83F3C72D4FF8E11698B525F4CC23A34 ruellos8
438,337,368 *2C6ABD173C10F05838953FFB7E8F1B1E6C333B30 RUNNINGISS5
438,337,369 *2C6288FD83A3AF749404811FF99106663A2B6D6D EI?h
438,337,370 *2C64DC7FBFD484BF5B758B7429D153C3577242AD 9SMETENIJE
438,337,371 *2C6817B55DAE635ACB134113CE3BA4A93C7BC9F7 RUSSELLMISIK
438,337,372 *2C6BD0C210A7911F63262C9F2A4D0BAC666D84B9 9SOVAROTATWN
438,337,373 *2C677F35BBD94EC7933EA0526C5346AEF517C260 9sponzige
438,337,374 *2C69DD48A9D180B30A8879F126E543081F281B70 9THATROCKET11
438,337,375 *2C6F184F4F2E27435A8C5E1AE8C4E7CAB7A1E606 EKS+
438,337,376 *2C679B59D77953240F7B296BB93ACB49E4A57368 2398387 PAVAROTTI-IST-,-IM-UNTERSCHIED-ZU-PL
438,337,377 *2C6861633B52ABC307B3DF8927DE0BA26BAADACC saboetienne
438,337,378 *2C64460600E7A9876A510FA62A9DF3B5B9768414 SADBOYUTU112233
438,337,379 *2C60C85B0E32D1CDA2C3F04ADB5FEB5AB05F717B 24.groveshakespeare
438,337,380 *2C6F186917CBA197B8633D1C3FEDD31DF2A0B01C sag2
438,337,381 *2C67CC274F17D6803162137A02072C44A843DFA6 [email protected]
438,337,382 *2C649B4CAE5B4376BD408E396CE3D2062C550BF1 A1WUK
438,337,383 *2C6DBA39ED76972E8F501841995B78DB3086C31B salomon-engelender
438,337,384 *2C6732F6D42313FD76BFEBC81D5E2AD131E926EC A3C5,
438,337,385 *2C625F53C413D8C8A48AB2DA92A1B0742BBE4FF9 a3l,q
438,337,386 *2C6D984C09AF2CF2597A6791610788FF4E4DEDFE ELTON.ESTERLY
438,337,387 *2C6A0CA7DAC78D12AB0CB1CF438DD55B519CBCE0 28278
438,337,388 *2C6556AAD998FE30E5C1E04938EEE356CE0CF685 [email protected]
438,337,389 *2C68D855D819EA08DAC1473FEECD92D7B1C268F6 a5;9o
438,337,390 *2C63C0284D23B8C3EBE7BAE686820FB87BEB08CD embrouilleraient1
438,337,391 *2C6BCE83DA41B30B8D65CC63D6BC47DC5D7F3D66 [email protected]
438,337,392 *2C628A6B4798A5435AE620F03DE087989B47E7A7 emmaleigh
438,337,393 *2C6C2B06C6910F2F7C3BF704684DC05D3D7ABB54 SANTIAGO.ORROCK
438,337,394 *2C66A1C1D0E03DDB00D20F9DFAC585E65A226EDC SANTIAGO.RASHID
438,337,395 *2C63267BD0CF694547A91D9E2A981B9B87769D71 SANTIAGOROBARE
438,337,396 *2C6F60EB880FF28C552CDE4FC98E7BAA9E6D3DAA SANTIAGO.SINGLTON
438,337,397 *2C632CD1DCEF5941FB238235A9095CDA95644298 a9b:k
438,337,398 *2C6649B689504179310967B8356D8D225EA3AE3E aa30m
438,337,399 *2C699DE9773BE55DFA42C86126F4ACD9E9E08BBF AAB,FN
438,337,400 *2C602DBD89F6543148891EAD5E082DEB7E0E9F2D ENRICA3
438,337,401 *2C6B5DDA89F5AFEFAEF317C289A88BB8B09D2BC7 ENTER-THE-TRANCE-TOWER
438,337,402 *2C65797D27A8E8CDFEF96B388612406E1D61611D eonjeetnren
438,337,403 *2C6300DF217ABF0805D2ADBD0D2415ECF11A69D5 AAE,E5
438,337,404 *2C6C81E81B81AA1C3C2E8F1DDEBE293F215D4400 AAEI75
438,337,405 *2C67F1277D528A1B89AB90C47C19F31163939AC5 SCUFFED
438,337,406 *2C6FB9D2B01D9FCE9CC1EE56840DA03C3EFC9374 er4:h
438,337,407 *2C6F091F20F67F2AE3BC26CE36C7A6050B3D7FBE AANVECHTBAARD0
438,337,408 *2C66AB6EB89E1FF0F36DB0B6DEBD014A06C8EBAB A-AOF
438,337,409 *2C637D2DF16E5262E370C4B8D38374DB9711FB43 SEARCHRESULT6
438,337,410 *2C609972386EE4B26698F60128C0CF98332F025D [email protected]
438,337,411 *2C6A4388D873DDD1CB78AB1080E837E3890877EC ergotic
438,337,412 *2C62F8E2EFED17CCDD1A39CC27A9E57811A74A8C AASHISHBHARDWAJ
438,337,413 *2C6B9D2482C6028668CF894E375CA42AA576AF2F sebastianpilar
438,337,414 *2C60DCC2C8B93D710D78D19576C1E01C8E87A815 secretaryhump
438,337,415 *2C67D1CFB91798C741CADF9015B2F1F97542AA31 ab&-;
438,337,416 *2C6439400685AD37337FAD91E6B6E5EBFB2B2474 ABBASSANDOSI3
438,337,417 *2C64F33E3FAE32CB2825285BEB07D94323A553BA 2.vollstudenten
438,337,418 *2C6E9499E67EC70225689E79707671E10C2066B0 SEMIPERMEABILITY
438,337,419 *2C67717315A544DCD62893DD0FF928481E06F5D2 errolstillion
438,337,420 *2C698ECBA1100BF63984E8DC94BA18A369F62545 ERSESSEL
438,337,421 *2C602BE4E39E14F54D2EE2D3ED0EFFBCCD99E14B 348JANESSA
438,337,422 *2C6DB4924593E4ED157DCB17D158D6039A1871F2 a,bpi
438,337,423 *2C6BC287EDF2B85F9CF8A3A6394C189E446C9DA5 SES D
438,337,424 *2C6C0C61987A79D6072487114755F2141CA96FE7 37-Life-Flow-Practice-with-Music
438,337,425 *2C65E6B1D0B979BB1311BEBA84A94B00793E5635 ES_FH
438,337,426 *2C6980C6BF9191322EB41B82FF04BC0E5F593B13 Eskim-Blue-Day
438,337,427 *2C60A6825E4389715C49123387E8A3225B31D19D [email protected]
438,337,428 *2C608474260F6953B6C8B433430074FA36A95240 es&q
438,337,429 *2C66C72E7C7F30E89239577779660CF6831266BC ESTRELLADELCIELO
438,337,430 *2C6077D4C85A9D5AD3C100D6C5341514FAE96724 ETAD(
438,337,431 *2C6C7635436966B4E6BB031DFF0655AD58BD672A SEXYPLAYERS3
438,337,432 *2C65307D39F6C08381EFE37B89ADBF2BE81C653F ETHANMATAKONIS
438,337,433 *2C601CC141A27D2984551DEF6B6CE6E873471918 ACER1591
438,337,434 *2C685C50857F09ADA721BD8B8A9C04876BB8640B SHADOWPRINCESS6
438,337,435 *2C6AB49ACF08B10E8A54D627329177D8C0AFF910 ET_T;
438,337,436 *2C6F5172A7F87AFDC7E5A94486954A47F0A85935 SHANNONHEIKES
438,337,437 *2C6417775DCB1F76173CF1ECD71EC50FEE3487C1 EUXCP
438,337,438 *2C6AB2A6A4F806148F4BE4952FF6FBB37CCAA0E2 EVERETTELEMISH
438,337,439 *2C64A553369B8BEA1ED63A76189B72CC32B41655 3MIRABELE
438,337,440 *2C63134982E366273771A9EA6D5D72C542AA469B EVERETTGREBIN
438,337,441 *2C6E57F4F3424867A308D2E39D9B7DE0485D9618 SHAUNFAIRBAIRN
438,337,442 *2C691EA221F31D0627FFD956583290B4B86DDD76 3NEDERBOR
438,337,443 *2C6CCBAA44B2D0E00B17534E81E978AC1ED4CA8B 3.NORPPA-MERKITTY
438,337,444 *2C6089FE563D2792A9EBF216F60BCEE57DCE925E 3NVIROQ
438,337,445 *2C65AAB48EDE2BC01958C120A0F64E9323D30783 3##@~O.~o.Splat
438,337,446 *2C6A23AEF3C2245F7C8875D14DDB7FD1C8EA374F SHELDON.TINNEA
438,337,447 *2C64DBB3A8E9C08F6B36D5DA5953B0332B2113DD SHELONNA2
438,337,448 *2C6229CD87577E79C4065A51CD474AA2C9AB6C5E ADBB5
438,337,449 *2C624C07A8F59865EC151C108603D8F2498F3AFD shervonlewis
438,337,450 *2C637D655F52026C6A566BD90CFC7882EDBBAF54 EyYo.(The.Reggae.Virus).(feat..Mad.Lion,.Shaggy)
438,337,451 *2C67EAB48CF538C3E80FB422D204875AC263D385 SHOALS、ハワイ名:KĀNEMILOHAʻI)は
438,337,452 *2C6C59AFF1F15B09251D37870F91340C9D39FC9D SHVAVAT5
438,337,453 *2C6B77FC0B82D7AAA6B3E9671722266703878E38 AER08A+!CS
438,337,454 *2C67B8E0CAAB6DC7B737B5E82F28D8C5662A7752 silverizer
438,337,455 *2C6E3C6AC7F31EEF2C4C621D42ED5E9A35A03061 [email protected]
438,337,456 *2C67187418267F1AF6CF098404F8123F0557C5C7 FELTON.BARRAGAN
438,337,457 *2C66DF34CBD95B1498D2963A0E5399C8A4A96DBA 4.LAWTON
438,337,458 *2C60C16A50F1C30ADE5AFC32FA76EE27730230DA skaltre4
438,337,459 *2C6CBBA5D66430CC8AFF46BAEB9C8C1F36B223F5 filibertogelo
438,337,460 *2C68EC2FDE7981ABA9A64E54ECD4ACB405441856 [email protected]
438,337,461 *2C6135732C5BEE5ECDA8FBAAC00DED3E027C49A9 slurpers7
438,337,462 *2C65C0F7193BCADFB051ECC3B797AD60E741C9C3 S~MI
438,337,463 *2C65B5C09A4CFFED9D0EC3367B084950C7A7368C AIAU,
438,337,464 *2C6F61549FB898640B330BA69CBDDDD09DE1A667 AIGG0
438,337,465 *2C68DA86617C305C4F7D2A098D7731C930B607B0 5417531YEA
438,337,466 *2C60AACE4857D44598B14CB7F95AB51F21A8E7EB ajentuma6
438,337,467 *2C662E332A7963AB521DC9614F46C6DF3F466962 [email protected]
438,337,468 *2C6F9296BF817B15044ECA1B7F6EBE7A6ABCDEE2 akkausta3
438,337,469 *2C658DEA240F5FF8BDCE7420F0258E7BB8B567FE ALDENMARK
438,337,470 *2C68885B8879665E7D12F0A5476F7974C8B88228 ALDEN.VALER
438,337,471 *2C65DE9B9C65D71EB39EA0974D26A465DAF5D71C ALDO.RAUB
438,337,472 *2C6A307591E43CB73E5635FD9903DE567D368FBB 5EGKARSIAS
438,337,473 *2C6B514FBED9C115E650441D4EC3BF68D88E38C9 5EGNUNHAM
438,337,474 *2C6BCED8D5308E8A9D3ACDF670338003F3D3CD2D SOUND.CLIP..LAUGH,.SHOOT,.CAT
438,337,475 *2C6CA4DBFB183C6555E49D941491EB8F0F544BA4 fredblackmoore
438,337,476 *2C6B4668F25D38992164A7528F53599EFBD298E2 FREDDIE.WALSINGHAM
438,337,477 *2C62259BD38CF336049D9ECA66B4086398F1B511 5FLUNTERN
438,337,478 *2C60A38DAA6711F337B22115FDE355DCB9AA47B5 alfonsoesperanza
438,337,479 *2C61CA6EA28666B3E17444664489FBD026D0B36F 5GORGHIS
438,337,480 *2C6542320CF1AA58A8F2F0D50EF0FD0F5B9BEEDA alfredoepley
438,337,481 *2C6FB79ED05B8EF24BA0F692D086C85B370F9705 ALH9H
438,337,482 *2C621B437DD74B59940B02332D02D1334FEC0432 FRUMENTY
438,337,483 *2C654301864D3EDA2E222174161F01EF1C7A24DA 5MORRISFUGAZI
438,337,484 *2C66ED0E2B2588CC6188A1555E2E3DF177D79488 splat.o~0~<==p
438,337,485 *2C6B9C7F08F96A276E99E3D7C2A6C77F8EFF376F GABRIEL.SAMPAGA
438,337,486 *2C6EE3B36EE95C84302831F2746CDA17FCF53CE0 Sploito~d==q
438,337,487 *2C601F1B49D51420473BE8475E23306B6F85A4D1 gammoneds8
438,337,488 *2C62542FCD8A59C7E9E71F7DAD19232B688F5FD6 5YDINASEJRJES
438,337,489 *2C6EC0849F0919F64EF0F5B0D860FC539BF1645F GARYDABBS
438,337,490 *2C636E91E16AA01EF737F2037054956BCB71DE2B 64kaynagindan
438,337,491 *2C66B81678D914D533DD16A2FD14D0D3085C037E 694QAWSEDRFTGYHUJIK
438,337,492 *2C634D08A101E3A68D3B7213284BC76F17F14B34 6ANDRESANTA
438,337,493 *2C6E10C525296F44192E7696E00BC822C36F4DFC alphonsepabst
438,337,494 *2C6EC697192DA57115358108096DA69D3A193241 6AVELETTE
438,337,495 *2C682201935BA912FFB57399303AFC9703C02823 ALVARO.NAQUIN
438,337,496 *2C6B5BC08BB8056B06C6869665DEF3C2C7385E71 ALVINIA
438,337,497 *2C62F6B540CB9AC64FDC8CD4A206305C9446086A STATOCTU
438,337,498 *2C6039C575281D76237176CF073A1ECD028581D4 GEORGETTE.TRAVIS
438,337,499 *2C6AF821FBE5CCB72242ECFE459D203C933A4CA3 GERDOLTE
438,337,500 *2C6FFEEB9BAAEF31B811BFBDDD2676346156A2D4 6-KONULMASININ
438,337,501 *2C6E5BA42C5C4BBAF05AB54F04710F2DD7ABDEB3 6MBITXBSW
438,337,502 *2C604A0FAD0CDC6EFE869CDACB439BBD820B1887 6NITTAPAS
438,337,503 *2C6C3CFF90C2E2FD54C683CB7C19EAD90F6C1F7C STFKNDRN!
438,337,504 *2C6193C8B33DB3363D323AEE47D1F5B6F0123FA4 gilbertomegraw
438,337,505 *2C631DE22CEF8FA98A2CB98BF4C6B5330E58FE06 STOLONS
438,337,506 *2C65CEDA5172E4E7940F2424F18428B162A3D829 STOOMVAARTDIENSED
438,337,507 *2C68FD5A3DBD93416B40BF31B820CBC2115B59FE 6PRIJMOM
438,337,508 *2C6414257E1AECBCA550D945542B02AC5FD74BAC 6SHAMYAAKSHEPENA
438,337,509 *2C68782E75AE00953059AAFCDC190F9E72AA9F52 STRMUDFALDSING
438,337,510 *2C6AC0D4DE082C402D316A7C2A6CDF3F3D81A70D stuartpalenik
438,337,511 *2C674C651513342295038EE767F3512CD0E0A0FB glennfranks
438,337,512 *2C68D446B730543E33567A06AEE9A66AC5CE52E8 amsellav8
438,337,513 *2C661C3D84458B7C28E88DCB213C584F2CFBEB89 amsg8
438,337,514 *2C6AD49E75DEB4EB9A6C206C2627155DB52F897B SULAIMAN ISMAIL
438,337,515 *2C62D3EA0A3BD183C4DFAC6F400496E2BC6FB195 ANDRE.BAREMORE
438,337,516 *2C67561BC1B3F4A734692B536DAEF9CFC9384E30 ANDYBALCK
438,337,517 *2C6E9510A9F0AB3359C3FBEF7EA7316B047E435A ANGELICA.MANIQUIS
438,337,518 *2C6F0E475A193B37B038E5E585A6814AEB106F01 Angel.With.No.Wings
438,337,519 *2C61CF66DF3F61C55763E85DDDF74A104BE2CBBD [email protected]
438,337,520 *2C6B816BB1E12CA070F5EFFD26D732C033235A81 7DAWNACCESS
438,337,521 *2C6F70FEEC190E4E880380DC705FF73DD3866307 ankleboning
438,337,522 *2C66AC8BCB3D998EE817ED5005308EFC7F50C778 GRANTVANGORP
438,337,523 *2C6770BFDA92B032AB1AC36916331E526DD3F098 ANNETTE MCMAHAN
438,337,524 *2C688124701647B92959D967BA7D343BC17482F1 [email protected]
438,337,525 *2C6903D9AFDAAE7B28419E23B57F7F9CEA137DD6 ann.garrick
438,337,526 *2C63AAACF4BD32FF8D839E0D46DEB4F900651918 SURINAMER2
438,337,527 *2C69AEBAAFE8794D45EB6EA0FE9F0A2C9DD64DB4 ANsentimentalvalue
438,337,528 *2C6A6C8FA0B4A9AAB3070DF70E91AED2EEC1F4F2 7.IFAW
438,337,529 *2C60A380E038A360081C9B67DBBB8D190927B993 ANTHONY.LENSER
438,337,530 *2C6E9A0382E0DBBABFA8654592E17F74A578FDD3 7ilovestudio2
438,337,531 *2C6D0BAA6FA40A791294A59CFD4271959554BB58 SWATHI PEMMARAJU
438,337,532 *2C67FE285A1A0EF692444E46D5CF0935DC437EE0 7MANDELBUG
438,337,533 *2C64EFE29806F11EC1C137D6BD6466781C5D556E 7MYGOOGLE8
438,337,534 *2C65D1BF5F2ED5FCF86119A22B9380D69F8A55AA 7ORATIONHAIKUHARMONICSHARMONYHEAVY
438,337,535 *2C620D94F2D1FB61A6FE6EC90D78CF80F638DB0C GU86
438,337,536 *2C657D325621696E58603776AB7613E68F4F32D8 SY2004-2005
438,337,537 *2C6FDA98D285289FAA37B9B0CCE12B6F38848D6A SYDNEY TUBBS
438,337,538 *2C697835184F7A2EFED48D037E6F938FA396ABA6 7SCHLTTNBWGNG
438,337,539 *2C6984AE0A5B94BFC8E5D1D8D31EBBAB2340D52A gusschnepel
438,337,540 *2C6E9E6BB11CC52226D8935E801B9BE205630222 GUSTAVO.SCHOELLKOPF
438,337,541 *2C6A1E41C07DDB3AB365F1E8E9BC9D0E4CFC750F 7TEENATSO
438,337,542 *2C63A3D73C8BA5BBFFD57A7270FA4D7E791299D9 GXYF
438,337,543 *2C6ED1F344864AAD2B59016B56CD5EDBD5E79F72 HAISAUCIER
438,337,544 *2C6313EA07D4DB3BACBDB15FEFE81E67A2137D61 HAISHIGO8
438,337,545 *2C6E03DB73A8B72C09F34259B1EDC3D2246C9908 825507 sergi-ve-toplantilar-tansmisyon-mUd-.
438,337,546 *2C6164547EE878CEE7EC5BD89D9F3F449EB5839C t3ns3ly
438,337,547 *2C6064D8B66A50509303C72E128288833F828945 HARRYWILSHUSEN
438,337,548 *2C6900BEF5598CE9E9DDEE6DE5A5FB726F89DDAA havedrboisclair
438,337,549 *2C6E781EEC0F357FF91B753584E402C0A7EB71D4 tadidva.nta
438,337,550 *2C68DF3E489BE3A4E510BE56A7F123734D149A25 heathkeaney
438,337,551 *2C6EF056FE0B7A760A987B5C84A0F23D66BD2E9E AOW);
438,337,552 *2C609452DB69715A8F37220368680B3AF866880C APA6!
438,337,553 *2C6BA055BBEBBE5268E68F09F8BEEE1783CA4E0F [email protected]
438,337,554 *2C60B7AE6BE18065123CB7B0618C8B72FD49C6F4 TALKGSTO2
438,337,555 *2C6F07427DD14F842192A8C4E815DDFC7264685C TALKHIHIHI123321
438,337,556 *2C6C97A19F2C37B135AF38357013F20EA2CBCD67 HERNALE01
438,337,557 *2C6A85A0452BC62C593EA3E5050216B146FC83D6 heroides?
438,337,558 *2C6CD56F03A66C8E4E03332C0C59FE21CC6D08DC [email protected]
438,337,559 *2C6E1F81496485FB64AF99C558E0B1AF483BE829 HIDEKOGA
438,337,560 *2C62D0978188EDEF4FEE0AC82C49AE7897425D69 hiltonpatsy
438,337,561 *2C664AFB939DCED46D9A500376A3F7BD7F277D0F HIPMUNKS1
438,337,562 *2C62D67B604DA3027081739B27825C3C1F933296 HIRAMESCOBEDO
438,337,563 *2C690543F70AD81B0D85BE30942CF9A3303B1ABB hndsrzn
438,337,564 *2C6FDA003EA60E8A32152E3E0845181A12C292A4 tarifvertra"ge
438,337,565 *2C6F4A655BD60615475CCE77857A3C45104C1D03 A_Q=%
438,337,566 *2C6E5221660AA461541FBAF15077FFA27DEA4FDE TAYLOR.HUCULAK
438,337,567 *2C611DDCC36215E59E9359BDCD569E3BC79A6897 aqk+;
438,337,568 *2C675AE6591ADFFD6E75926E8FD23AA2DFF3D5D4 8MOURRONTS
438,337,569 *2C64FAA1830EC19AE811BFCE9F8E989AEE1CF521 8NEHCILTUED
438,337,570 *2C61E96D82F83F35FB59078A753BB65FEC61F7B8 8NETHERMOSTLAYER
438,337,571 *2C66F3B12BC93B920B2F7F13D4B5E06E53640BA4 araveug
438,337,572 *2C6F23DF351EBC16BFC6018667D202DB3A598D1C TEKIJ�
438,337,573 *2C6B7BBCBE5A963B9B0150918B2AB35123386C62 HOUSTONSHINKO
438,337,574 *2C63DB145F01F75D84C5513FDCAA2C675E2788EA templatemepstub
438,337,575 *2C615A45E42FE78062CDE7E503E0E287ED42CB19 ARq
438,337,576 *2C6736FCAA24C126ECA39C98E5991708454545C9 935abbey
438,337,577 *2C643EA623583EFEBED829D6B62C49FCE8704676 ASIAN美少女~プチドルスクール
438,337,578 *2C68FBAA83AFCFD7525451F2AD6AF038E3624DFB ASNAG
438,337,579 *2C6E9A1FCBE4931B5F437FB4468F2E1E727A5B1D HUMBERTO.ANDREE
438,337,580 *2C6586DC7F8DABB6962ABB67E73CBC4733E21B46 HUM$TRUM
438,337,581 *2C64748143872E6B0051F405B95E36386B5591A8 huntingdancer
438,337,582 *2C62D308AF92A5DC3E6D2EE6D95FE1F489BEF068 9EDMAARKP
438,337,583 *2C63C49D67ABFDEA34A5709E544C338F2D8617BC HYP073N$0R
438,337,584 *2C6FE3F4695ED383D448E552B629E924CE6FB574 hzp!
438,337,585 *2C678936ED0A57B6CBC4B7404B6DCA941BD818FF I=7R
438,337,586 *2C66E626ECEAF8A1FD1945B86D34957512D41A2C 9TUTAPOKEA
438,337,587 *2C6C841546CB7A5978A1A1CEC13731F1256249E6 9VAPNENCA
438,337,588 *2C698909C7C87758FFFC682E58E02CFC9F5F1D08 attera.totus.sanctus
438,337,589 *2C6894485B64E6FADAA102B1C89793F48753B1FB the-goodbye-radio
438,337,590 *2C62A14C56F1B083F50A4076E066A46B4AD48E18 AUCH NUTTEN WOLLEN PENDLERPAUSCHALE! (SKIT)
438,337,591 *2C6DC33E90671D49FD09801462DCEF3506E65E3E AUGUSTUS.OBESO
438,337,592 *2C6C218287DC6DFCF425387F1D5755ECA3EAFE81 AUGUSTUSVANWYNGAARDEN
438,337,593 *2C6C9814736FC819AF1976726F2CEA1A94CAE602 theo.boone
438,337,594 *2C6D7F85CEC6736622C57128221F7328BDBC3078 THEOFF-KEYHAT
438,337,595 *2C65064C2DD53AB528FE31FA38470D54AB9A2FB0 The.Peacock.Angels.Lament
438,337,596 *2C6BD7B97A4F88ED52C1849E7A009DE6FEBCFAC4 AURELIO.SERVEY
438,337,597 *2C65128E2A1BC2D1C08EDF21131774E77A23BF6D ik.
438,337,598 *2C6B12FF5C5BC9CFF1F47244BCFD0BA366830461 THERESEHORTON
438,337,599 *2C6DF33A55E586C3A9983FF3DA2649F94392D6C0 THEROADTODUNEDISC4TRACK1
438,337,600 *2C6672D7E3D56749D2A12D10EF7FC13315CFE325 AVOFL
438,337,601 *2C6A041F435CCF2EB82CFC34AEB5080A7488726D THOMSETT
438,337,602 *2C6CD3213F58AD5098347B50CEA6E7BDF4316304 incassiate
438,337,603 *2C69D182BEBA992829C46FFD27C3F8D47E8DF6A3 ACK4B
438,337,604 *2C6B47942B2230D5331A12130EF1AE8124751F23 actrises
438,337,605 *2C600E571766AF76E22DC07A0EB7C0C4B1BA6E6B azerbeidzjantijd
438,337,606 *2C6C14467E9BC6E98E97AE4B29286783B60E08B7 ADRIENNEBASS
438,337,607 *2C6C2DFF5CA8D7EAF5658D126D84B7BB1910D022 INGWOOD
438,337,608 *2C614F5C1FCEC3E59837AAC805E8AABC60CBF60D INTERIORBASED
438,337,609 *2C6EEC34719F7FE3DEB7BF08D0E8A510904F037E B6vM
438,337,610 *2C636E44376DFB262222D9A1F1B83066CD764F88 a:fkv
438,337,611 *2C63EDB50273B482A5B9F5F9FCF1EB24CE3B4B0E agg(f
438,337,612 *2C664454DDC6D1F1C81717CE85C9C25C364ADF0B tomaslindahl
438,337,613 *2C67940A439B5DA836C74D9E0BC23F2990D078BC ah8mi
438,337,614 *2C628946D03990C7988DA604BE05F6B66D7495EA [email protected]
438,337,615 *2C6A7ADEF66565AFC59CF89340E85D0D4FD137B1 ahi?
438,337,616 *2C6BC5984819388FD7C795F9424634495322D6E9 to-take-on-eee-pc
438,337,617 *2C6FD94EED8CD17A0FD484D75278768FC61C486C TRACTEE1234
438,337,618 *2C6B3BBB50D4917678AD4359C3E8297B83EEBC78 TRACYCOOKIE
438,337,619 *2C647B687A47D6596E496DD6D78DCD79FD46A07D tradisti!
438,337,620 *2C656779F56D9D4562DE476C977C3F178922B878 TRAMVAJÍ“
438,337,621 *2C6672162645222D2E80AB8D5A1972DC08AFC37D [email protected]
438,337,622 *2C62E91A47D6C730B36F0FA1DEA8B1B42CAECD9A TRASTOCAREMOS3
438,337,623 *2C6F9EFE2C6438ACE6CDCFA1E05A5ACB4E17FD01 ITI'DTHINKYOU'DHASENOUGH
438,337,624 *2C687AF79F2BEBD19F24D6842C4557A4E0F4F3A0 a%_k!
438,337,625 *2C69A82536055DA34C499FFBA41066A5F61B1906 AK1Q1
438,337,626 *2C6456DD3828B052A9D980307AD9FC39851ED4F2 [email protected]
438,337,627 *2C6E3515DE52B1AA06CC02E1799662128D45316C „TRETELN“
438,337,628 *2C67E0416165DA011327C08BA80D3157F3593C6F I-WASHED-MY-HANDS-IN-MUDDY-WATER
438,337,629 *2C6A1BCCC0D411A14A4698DEC213A6F53F5D9AE8 J4CKP14N
438,337,630 *2C6BA5BE8EE142612E33C9847DD46CEBFB828CA0 JACKGRUGER
438,337,631 *2C6CF92D94CE886BB667C9A66087E4AA3C95BB0A akuoe
438,337,632 *2C6A3133FD70598E0D2C6271A2CD043A709EAA96 alaaibraheem
438,337,633 *2C6B4BBF3A671ACB0D3556077E07D90087E63FDA alan-hussien
438,337,634 *2C607C150E1E3AD9492BD1FD5419D2BEB482C0D8 JACKYSAAVEDRA
438,337,635 *2C65DDF0DC3C858D66489B3CBDEC5B4190CCF885 BASSIONI4
438,337,636 *2C63A7C418FD43A5C4CEC96E06ABAA422D0F045A BATEKITAS3
438,337,637 *2C6D7CEA1DCC2485A290AEE737F86353A07593B1 bayfoged
438,337,638 *2C63E1E7AEA5F387C708E3DD92B265110C1A6519 b######b**
438,337,639 *2C6DEE113D009C35F62FD85AEC1C631A107A3193 jalalpur-jattan
438,337,640 *2C6F6DFA85D6448E6AFA11BAAA3FBD19C14E423E alex-canela
438,337,641 *2C6249D1F2FDCB550F31FCCAE62201B80BF561C6 ALEXGWILLIAM
438,337,642 *2C6A103C3AB8310720367D76E16E6D247E262FBF JAMES.BRINE
438,337,643 *2C686531320BC18B4C0A50D15AB4DC03971F1570 JAMES.L.WALKER
438,337,644 *2C690AAEA0524D9ABF75EA24077D31ECBE1525A2 tsm.lccm
438,337,645 *2C6C97A2D05CD4B290AE776102EEB7F1DB8A2287 bcay/
438,337,646 *2C6B66EF81487FC48E3DB8C00348C2C9A57E1567 JANNE CRUZ
438,337,647 *2C6850B566A923D45A299453B5EF58CDC387C858 AL.MEDUS
438,337,648 *2C649CBBCF667F742D3DD5A26DB089CB6C5F5E90 JARODBROERSMA
438,337,649 *2C66104490FBD8A7B5C591F5E29577E3EE0AC13C JARRODPASQUEL
438,337,650 *2C629B198072B4CAC8915D063EEDA92E0F1FA38A alpcs
438,337,651 *2C6BCCB1075A8D39CF08161D42594F855230AFC5 typographic
438,337,652 *2C6D60DDF8E5973818769BD8B10346B2DDF26700 be=i+
438,337,653 *2C69F048A4ADDDD161D7EC0C06202B1AEB4AD8C7 TYRELLVALAKAS
438,337,654 *2C62F62FBFCD7B9D5B60EDA5AAD3AEC4AB2F5DC0 TYRONEOUTLEY
438,337,655 *2C6D1B1A390AF60D152187837364AB0D867C01BA AMD)N
438,337,656 *2C6FB6E8A262F06C76F6F0F5069ABF96DF17FCC6 benhandrick
438,337,657 *2C6E0136579FD6E0F2E6E325BD5A6752832B463B amirs
438,337,658 *2C6BBEBF635793E7CBDC83F5FACF6EAF89391D1F bentigte5
438,337,659 *2C699EE23311F97832F0248468088650631EC479 [email protected]
438,337,660 *2C66CFF22B4CA99DEF03EF55D1876F35E6F9F96F U;EO
438,337,661 *2C6FBC0867551AAE8122DE8B388A8BC3C2EF810B UFPA[email protected]
438,337,662 *2C60C638E269AD3C9E17CB17A25F1E004B658D76 Uh,IthinksoBrain,butthistime,youwearthetutu.
438,337,663 *2C6700E6A6E13A56AEA766FC3ED1FF23A104C47B ANDRESFINGAL
438,337,664 *2C679CC0CBF236B206BA0DCD7006D21B0DA055E5 ANDREW-HELSEL
438,337,665 *2C6B59CBD1C9CC7B9BE51F6021CF9C43E0CBB287 ultradome
438,337,666 *2C69017E0175566B323189468B9C585206724AF3 ANGELA.DUNNINGTON
438,337,667 *2C603B174E722D8EA9CBFC2D15FF0A4FD392B13A ANGELIQUELEDESMA
438,337,668 *2C62377C7D4394EC1247C95F13E8B6655D056E75 JERROD.REDLE
438,337,669 *2C665DADD2486E57A040963E23557CC715E30948 ummer.farooq.afridi
438,337,670 *2C62EFF4BEE6198EAA8A83F16D8C2225F9ED2637 jessietrezza
438,337,671 *2C6AADBD81A755BF0271DD6DBD09A4DC9E084978 bf9fq
438,337,672 *2C67C6BCE04D86B82557C8FC84C7FCE1ACA0F6F3 Underground-Girl
438,337,673 *2C63159C5DC8A3D27F8BA6B0F61A394ABA46843B B?FLD
438,337,674 *2C6AF2AC1CFFC122F562D9314EE11C37E6A134ED BFWUB
438,337,675 *2C6E7A93C004EF7013C0FB0F54DBA6452778785B BGAIBBSWING
438,337,676 *2C64466476395B447A0965291DAF6DD4CA5F096C [email protected]
438,337,677 *2C671DD3B6F9CFD2D0D57317C0C121B883FCBCF5 [email protected]
438,337,678 *2C6CB07DEDE35B9C13F064DFA34CF570B3C22466 bgdui
438,337,679 *2C643C3C1F314DCB49C639F36F9073012AE0DCC8 ANTONIOWINEBRENNER
438,337,680 *2C61E402C809DE08DA30FDDF079328D69F98AA0F antonkowis
438,337,681 *2C615FD3C01274738D1D9F7303D357388BE46643 [email protected]
438,337,682 *2C6E4F9659FCCA5C79B2F9DE077D81D2F5BF4544 BH9/
438,337,683 *2C6197B0BBAD3B7136C7F5D282E3B3DC9DC4FE18 a%ovm
438,337,684 *2C646979D669D28F5217F8DB5C27D1D190880F68 APARNAPATEL
438,337,685 *2C6FFAC98CA44AAE522035C600621ED86DF452D0 B%HR=
438,337,686 *2C6ED8153154BA534085D3EDA8E8BB0DAF851E3B apr_"
438,337,687 *2C6845B471EF5B2F8CBFDA5C78DA4E9E3C536D4A BIBLECHAPS2
438,337,688 *2C65EA7A065534E92819CB252FB2F0D3F8C036DB APVCQ
438,337,689 *2C6BDE9FDFD97FC23FF51BF74CBB4E5273863F3F aqft,
438,337,690 *2C6B9F47D5577F71FCFA316CD7C04FE90415C983 BILEFELD
438,337,691 *2C642AD444042529231440034498C00CFBBBAF31 bi.lp
438,337,692 *2C6E7838F59A4EB7FE4F6588B75EBAD94B30AE7B BI$U
438,337,693 *2C6465E24709554ECD84CF5F037955C587992D18 [email protected]
438,337,694 *2C61C875A8C1D02D7FDBBA7DC0A622836AFA56B6 JP.LOZANO
438,337,695 *2C6BA9B3D035268E42EE85C070A8D059495B8AF0 ARq
438,337,696 *2C6D37627D46A1372480A8939D9AF44D520B447D BLOGWIZ
438,337,697 *2C618C719FFEFF5DECB8450B26FFB22C38129DFB junkie's jig
438,337,698 *2C6035639D813220D29CCF4280C900B00915C1B3 VARAPUZA
438,337,699 *2C628031A583709FC3F4D3789CF2B2BA1BD15F77 vaskosobevski
438,337,700 *2C64665B0E90AF90632D105D4A69A4E68CC45DE3 a-switchb
438,337,701 *2C6D41DBF75959FC72084E7332460369D98CE2CD at,)o
438,337,702 *2C6DAA6F7CE2337C4DECB80E183C32F6BA7401BC venus-santiago-schimmenti
438,337,703 *2C623B04644D9927857808096F2C8E5539B9A1E8 A%|U
438,337,704 *2C67D59EE4CB36BF37F1180A9274D45B1574F7E2 BM#,I
438,337,705 *2C6E83E4F64CFD5C02CECAD21AFC737A5E3302AA AUGUSTPANDURO
438,337,706 *2C6DD709491377A01EDDFA726470E34D8B926BBF BODYMOVIN'BABYANNE
438,337,707 *2C6932432544B3AED2F5F8D91EB1A980B2239DEB karldemus
438,337,708 *2C6F08C0779BDE3D642D8432BB126D927476EA1B VICTORIA BORRETTI
438,337,709 *2C67C0FB6B47C4E99DD7B61CA5D235DFC21386D0 VICTORIA GULLETT
438,337,710 *2C67A66FEF641C76BB6032D3AA6CFC6AC15ADC53 AUSTD
438,337,711 *2C691E780BEF86A8601E89211CDD07FC245608A6 [email protected]
438,337,712 *2C60753A3D4F1F525594DAB3265BAF7DA4C7710A A#v.
438,337,713 *2C6CF963E487870A8E0F2766D3C098CD45D1AD0B VINCE ANTHONY ROBINSON
438,337,714 *2C6988E4B78E8E2A96AEBBA283315BD1F1B2D2D6 a%wb2
438,337,715 *2C685AA7D8AD80612F1324F953C129FC23F9EE57 vincent.yanez
438,337,716 *2C60315D5FA5782EF5E3FBCD2828680677C5E58F kellytusing
438,337,717 *2C68D9AD7D6785076CD598A6C8C7D4DC28E3DFFE VIOLETSATRIA
438,337,718 *2C6BE7C4972677A99D6965B26F1BB91ADFE42619 BOOKER.FEGLES
438,337,719 *2C6827492C1DB2EDEDD295B0766A0D419E3AD014 az3t
438,337,720 *2C618FE4CAF19CD3591A928EDDAE8B043BEE7BE9 borisbadget
438,337,721 *2C6523099593D1B63AF3645325915417D0F24D40 VITEZILO2
438,337,722 *2C64221E6EFB21CF5D0150CC1575056B7C49FC36 bortfre2
438,337,723 *2C65366E15F10285E47FCA8B9D962185C8CA6047 [email protected]
438,337,724 *2C6B98E557B65E5BFDA36CD988FA4DEC87CD3F7C $KEWN9</