List database


<
# MySQL hash MySQL password
343,030,001 *2241307288DB23098F4C6BEE7DDE2770DB871FC9 Bond007goalie
343,030,002 *2246DA1A3D5F78D831A7C48C579C1A5061EEC74D bondaweb0
343,030,003 *224061034BBA14F64F5F56A5F1A7868A617657B4 «bonded»
343,030,004 *2240155AB37B43982430FDE40958F6FB4782CA12 bonderow6
343,030,005 *2241245018FEF4BF7A298D86BF789084AB52A379 bondesten
343,030,006 *224D0D5B940B6AA6395895195982AA514C63021F Bondfilmerna
343,030,007 *224933FC1A092255176376C95C7FC5340DFCEA56 BONDHO1D3R5
343,030,008 *224BDCDADF3091B554B16B250F5F03F812EA907A BONDHOLD3
343,030,009 *224C390D1B02D42DA626BD6E68192BCFE6945B69 [email protected]
343,030,010 *224159F4B02832B8C3DDFD72ED6FC6C3E925B2FA bondish-looking
343,030,011 *224CF34A4C941CBE255C9771EC667F6C9B912463 Bondmans9
343,030,012 *224CA60D8CB55B2034C7477FB36A581719F20FE4 Bondsurfer:bondage
343,030,013 *224E0A35229C37A0624EE513B0E01930F86BF3BE BONE GRINDER
343,030,014 *2241B25F1F836D13FDF128EE31D491A5D42F29B7 boneloca
343,030,015 *2248D5524CD48D87EDA746E46DC57FF3DD5D8223 Boner1939
343,030,016 *2246FB9022ADEA411D86056C4B38EAA912065F0C Boner41
343,030,017 *2247DF06CDA1BB6648DB88E69AB41405BE07F182 Bonermaxed
343,030,018 *2242B167E887C49DF633963EE558FB98F3EEFCA3 bones6969
343,030,019 *224493E25A58C0FF7F32DF5548A8070DCB1C9433 BONE-SPRAIN
343,030,020 *22414E82598FB73BF3AF1C9A45A1CFBA0B2184E2 bonessak
343,030,021 *224AE8C5377CEE54777CEAFD7DF4666659A13E58 boneton
343,030,022 *2244E681003D6A07B612F70BCBFC38872897E753 BOnf0
343,030,023 *2244FD321866BC6806954A9E11A1F7F4AC678076 BonFw
343,030,024 *2244A1743E409197DE6C6DBBD51ADD260C787054 [email protected]
343,030,025 *224DBA80437B577687EAF5558FE50622328BC3B8 bongiovi、lance
343,030,026 *224E29E7056C007C16E438960420030B61489C04 Bonguereau
343,030,027 *22421D926258EE9A9A0FCF0D46FD403E97820ED2 Bo!nI
343,030,028 *224F32D5E7F12889C545604E847512D57599F2DC Bo#ni
343,030,029 *224858B89F5411F576636DFDD2F3203CE08E5233 Bonisbsw2
343,030,030 *22413759C1EB5FC21EB7CDB6458C48FEF030AFC2 bonitaadams
343,030,031 *224B8F000DBA4B20EA8665AA1EF9969F9D445F37 Bonitate1
343,030,032 *22424B89ED2B074CFB7E40F772E84B99726496A8 BonjourGuillaume
343,030,033 *2244A04962C2F12431103684E18FC3104EB13DBB BONJOURRED
343,030,034 *2240743444A139D58F9EEE1E527947142BB0FD4D [email protected]
343,030,035 *224A6CCEFD334C728E886ED66A6AE44138F5AB85 BonLb
343,030,036 *224F740329196E9CC01381439A683C557A526F04 bonmawari
343,030,037 *224919EBD421D7791D6088120941B7AFB52AF2B4 bonnEe
343,030,038 *224BC8E9833257DD576B0E1B8AB40CC4D4125E8E bonneman4
343,030,039 *224B55DFDD223A247A5B68BBF5D3D94C3BDCD3D0 bonnenfant1
343,030,040 *22466BBA3700758C49B8AF2F1371E063413EC8E6 bonnetsville_north_c
343,030,041 *224C25ED83B47AAC6B5C7CF6BDDBE861E51E09D8 BONNEYMAN
343,030,042 *224655B98D94D4ECECF7587073735E6BB9F73A28 BONNIE6606
343,030,043 *2243B1C143E52BB85C4A83F4DE7E19DB419121AE Bonnie Blue Flag 2
343,030,044 *2242CEB0984648DA17B9264CE00F53170EB3CBFC bonnie brownell
343,030,045 *2249C7250F2FEA574BB54A271CD03AA49ECFA13D [email protected]
343,030,046 *2249DBE3AE53C54B82CA44B7C4ED2ED5E30D2A87 bonnielonnie
343,030,047 *224CB255A0260E9B5037AB2A3550E14B0937565E bonniemooney
343,030,048 *224BB1B22FF524A059835E10BA55CFC9E80ECE69 bonnievi2
343,030,049 *224F8F842664B541CD9C82CCA391007B822DA737 BonnieWoodha'
343,030,050 *2247FE7AB782287DE06797C7FCE6851DFF47C15E bonnne4
343,030,051 *2247ADBFBB31BC218C2D81F59993C5B749946451 Bonnville1
343,030,052 *224B893DFC8035BC5B96E6AF585E6A82641C2F28 bonovaju12
343,030,053 *224EA8801FF32647C031AED6B3D317908C22749C BONqQ
343,030,054 *224E9C52B3E204BB2EAD9079DD638F01CF3EACBD BoNr(
343,030,055 *2242A53A07D7DDF50D16932172D04061A51000A3 B!o+!ns
343,030,056 *224765E0072B8F1C2C18FEC9E4A3942893CF058C Bonsa
343,030,057 *224C3D522D0FCDD041CFC4E558C3436A2A15B98C *bonsai*
343,030,058 *22464E8F8D8C5E14E569F0F0AF0CD01C2BCE1A63 BONSAILEARNINGCENTER
343,030,059 *224EE73384DC8A24D570B176496BC436241BF6EE Bonsecoued
343,030,060 *224C47E21E4CB7637287B1EC44706CBB5D057C1B bonsela123
343,030,061 *2243B8B90144CE83797C34F361F4B1EAC333BA93 BoNSo
343,030,062 *224B1E7E4368C7C8F8AA751CCD5F14CE8DABBDAF bontcapes3
343,030,063 *224E2DC56027F4C1988869EEFA06552CCF21D26C bontilă
343,030,064 *22498CF4C7EB088FDE22B1BD9054A8698C817722 BONuses
343,030,065 *2240EFDD9977AD4FF7D3BBF03DBF7171D350644F Bonusque6
343,030,066 *224B1C3B4758C4DD7C19B334960206282B4E375A Bonwill6
343,030,067 *224AF37999B98532360BA8C863B4CFF26F29DD5F BONYBAB
343,030,068 *22451124E6386A2D2BFF01DD276FD9BFCF08E700 Bonygay6
343,030,069 *224F0CBA2999B794EDB23244D86F1EFCC98FEDF1 bony with bone
343,030,070 *2245D31137795822D8D6D1FEEA0C1B7CC14C7DB4 bonzabiketorsu
343,030,071 *2246F00474CC70C5A7FE120135619811D981400D BOo/&
343,030,072 *224332D18A821F382A0A4EDEEEFB06F9B4CAC5F7 B,o#O
343,030,073 *224689BAF9217EA4E703255809B69D0285FB96C2 BoO=.
343,030,074 *224CED4AF99809642224D6B6B7C038E31A9F980C Boo0Y
343,030,075 *224646B610326B39DFD53E7801E10DDE153EEC22 BoO2
343,030,076 *224F8563CB9A91E7A12234BDA512294333595C29 boo7131y
343,030,077 *224CFEA4C2F8EC97CA99528F3146520D64F81AB0 [email protected]
343,030,078 *22400A9866735692AD501850600E2DC12C13587B booba1234
343,030,079 *224FAD00B835C54419E6515AB142FD9B1113BDBA BOOBEAR800
343,030,080 *224D331F7D019A4EDAF4D8C1F9D8B8260CA16D35 [email protected]
343,030,081 *2241A1ED2E554626D9EB5929ACCEBFF091CEF782 booboo4k4scott
343,030,082 *2241E5CCFB75681C5B45471EF73229BCFA737491 Boobscied
343,030,083 *224530F4FC90CFAD5CAD9F01EAA1E49FACA46104 Booby?
343,030,084 *224F5249296240116BF09FD1007DBC40B237C6AE BOOBYISM!
343,030,085 *22467B9DABF7A205F4340AB0EF2E0D6606B96486 BooDlInG
343,030,086 *224EDF326AC0CA3419E5AF236D1DA67F7E37326D boodman5
343,030,087 *22402F3D60C8F415C922EC23BA7C6A1DD331C222 BOOGEYMEN
343,030,088 *224C7CE50B36DA9EA17C2F94B59B751F2E6A4A3F BOOGGRADEN7
343,030,089 *2241A6402818A0CA309BA96A70445B6CB177315B BOOGIE111
343,030,090 *2248A2B0AF1DA884E0DDEB5BB748CFEE55381B6D Boogie12345
343,030,091 *2244F7883E36A604D5243C679AC757DBC7FB2D90 BoogieAllNightLong(disco-Tek)(12"Vinyldancemix)
343,030,092 *224A961AD6759BC9D5F43B54500DE998081CE699 boogie boogie baka (feat. michael rother)
343,030,093 *2249E0F6C95EA3E4204434C2C1943865EFEF5F97 boogie-movin
343,030,094 *2247783D5D9054249E28576778E54AA2517034A1 Boogiescarlet
343,030,095 *224ADCF06609B946FF87C56F61180C0817736165 boogietimespresentsthegreatcollectorsfunkymusic,volume6
343,030,096 *224BCBBD171BB1234763BB22DE8321C0A4198057 boogywoogybob
343,030,097 *224E8864514F90A3213FC8D500E6D83199A460CF BOOh%
343,030,098 *22461F1EF8992E330567F870F0C56475A34E0FCA BoOI+
343,030,099 *224E463084397E94FFC6EA9172AD562761A108B2 Boo=k
343,030,100 *2245C46A7E5D580361D5360F5036C37F1A026905 Book02S,AssemblyandMusterofArmies
343,030,101 *224384499577A7A25FA81C66F21F8F745E672022 book(2002年8月7日)
343,030,102 *224BDDF9594B00CA55586E0B6E6C095D3BAD7DCD [email protected]
343,030,103 *224DA7B016F7BBA2C559F5A58F6B891B8E70B98E bookbounded
343,030,104 *22483467E12CC9F43944ED3110488F9FA4DFB85B bookchiq1
343,030,105 *224C131FA8BCC83337295B312916F42EF7F457C5 booker.afflick
343,030,106 *2248E32B809D86E8D6969BDE8AF7F6CA946F0CF5 booker.bomba
343,030,107 *2248FDD33E3C5BE1C855ED037ACD7472BD73FC02 booker.carneal
343,030,108 *224346B1F621F36B2903E624EB5D7B5B1DA88265 booker.creselious
343,030,109 *2242C94E0C975D7F72B30AB69E6E8DD9C33F7052 booker.dreessen
343,030,110 *224637E0256C3126AC1642D84B152254A801F5AC booker.eberhard
343,030,111 *22452495D24AA9B2422DDC721569DAA8B53BD976 booker.furgison
343,030,112 *224DC97AD22AE003B5F4E741A4CA2E4E1D4BD156 booker.gierman
343,030,113 *224A95798ADBEF961A550E9A2D734BF7E728D15D booker.giff
343,030,114 *224ABD9D05A2E3699BE764FD0B3E620D5E6A48E7 booker.knutzen
343,030,115 *2244B869CF49A8E67D900DBE8402A6FADED04FD0 booker.laughter
343,030,116 *224E8195F1F106C5049F606ACEF1C1DA72C51BB0 booker.macha
343,030,117 *22468555A5951C5C6200F9A2FE03A9274C322243 booker.onley
343,030,118 *224619F267392238D290294AC5A4F51ED5001429 booker.petronis
343,030,119 *2245BCD4516474D095042C8F8D0278C162799244 booker.praley
343,030,120 *2245EE4A763D9DC699B034E9427217DA6217B78C booker.rubloff
343,030,121 *224D9A580216E93984D4C90DADF3AA81F88F9AAF booker.sood
343,030,122 *224BEAC3EBC215CC72B62588B322EB205CF56708 BOOK--JOSEPH
343,030,123 *2240A651C85B5D94693EA2C1F2A1C1F2E713F04C BOOKMAN5
343,030,124 *224C5FDCC2C8976D6BBDC90AC63B2C3446CCCF3F Bookoathing
343,030,125 *224EC32ED95DA1FE2F0D907F0640A141C4CFCACB Bookofbooks
343,030,126 *2240F47000508334635E29F356A1F5FA88EFAB67 ‘bookride’
343,030,127 *224EFA4478E3082A1DC854D7A1ADC9AA8CA02AF4 Books
343,030,128 *224790511F4FBBD3C887765AE2A5E5B163A0FA6C BoOkshop
343,030,129 *2249079FFF714D30379673266E6734D7DB8C7F64 BOOKS-THE-ODD-LIFE-OF-TWO-WARM-RABBITS
343,030,130 *224AA436AECC39E282C1323C1F79A9B64EEE1827 Bookstores1
343,030,131 *224D7AC9110FCE455CB49E05D0ADD9B76A27B438 boolangstudio —
343,030,132 *22495F299D96311B5FB0698CD0A634BB2A6AAC55 boolarak
343,030,133 *224B566C200BA06A0885ECA0E3EB1CF0730BE08A Boo
343,030,134 *224A1F0044D34FC51B171F4CA9EC853725BF21B3 Boom Bang a Bang
343,030,135 *2247F038F4172BB200511752386EAB1ED1806E08 boom/come
343,030,136 *2246F2262424BCFE42E0988524ABDC69701C8B93 Bo++omer$
343,030,137 *224D4F625A7E45E76BCC1E07E5B5B3FF53743CC7 BOOMERAMBER
343,030,138 *224E1C41FCC120C1E5E46494AACC1D53B70D5A05 Boomerc4
343,030,139 *224434474C09DD691819D37DB9152CE3C9CFDA83 boomerpuckett
343,030,140 *2242E0E8AA30DE2435796FC47E522F798B20B782 [email protected]
343,030,141 *224E63BA1717F766A12A3F940A7D65BFC20A5DA8 boom.wolfkeeper
343,030,142 *22485D37D589557A1FCE7140EB705C43AB478F7E boomxtwo
343,030,143 *2249811E8593EB558976FC0EF3D45C2936074CFF [email protected]
343,030,144 *22406F6FA637A47BD986E37B608C1ADA5CD79CD7 B+Oop
343,030,145 *224004318AC83DBFEC9AF05E1D8B3077A58474D7 BoOp?
343,030,146 *224A1E3328275191928B61624A06C382FF26E158 Boo;q
343,030,147 *22441FDB08C533D2F3D8CC268C0C54B8ADF2F855 B-OOr
343,030,148 *22400D2D92089CF46E0A86A55C37F9ACF56376E4 BO=oR
343,030,149 *2242CD0B8C898130C623E7DE8B574C67EF21E9C0 [email protected]
343,030,150 *22450781BEF96D4A4BF7AE5D7AE7FD264072D469 Boortjie3
343,030,151 *224F4527ADDFBF0C35EC05BF497B4D9B761770BB Boosterandy
343,030,152 *224D73123526D6889FE5729D18B03E67D995A4E7 boosterdk
343,030,153 *224B125C2E991DE0757D4F3E5025526C65E8EA7E Boothed
343,030,154 *224F01F68DCE6FD472BA86C51099DE80137FA3F0 bootholder1
343,030,155 *224AEF4923155AF632E280F39B7AC80661368CCD BOOTHで占いを担当
343,030,156 *224685A5C62BD5FADC21194CD621C84F94E65A81 booting..it
343,030,157 *224B14FE3B3CD78BDAA50A4C3A0F968226BF26EC bOoTjack
343,030,158 *224DAFA09CEF9FAB0EB69D63C21C5171E2B22C18 boOtjAcK
343,030,159 *22429C0FC51BA319D3ED5E3C7C413372F485D0E9 [email protected]
343,030,160 *224EBA059C7032EDD427B3C402ABB268DA4E1960 boot-jets
343,030,161 *224C89F8BF5F59A30355AD4DE0A5E79491F6FADC bOOTlEGs
343,030,162 *224B7C40CCA6ED085FBB5B5BBBCD4A86171BD165 BOOTLESSNESS5
343,030,163 *224CA95F7D606ED5AFA92D83F866859E8E63A935 bootooo
343,030,164 *224E8FF4D8FEC14AA337A1CBE8982A951B48DD2A bootsandslippers.comwww
343,030,165 *224E3A218FDC3393C1DAEDFB0B2FAB43393248E5 BOOTSIE2890
343,030,166 *2245AA42C1D8B882EEAB1E2C4AC101BBE9DA3579 Bootssch7
343,030,167 *224F01E7836DB027C71421262D6E084D75A78079 bootvorgang7
343,030,168 *224A6CB1E8D07D0D35EA37083678A559F6BFFC6C BOO$U
343,030,169 *2247FDFEFB2CDAF37ADB7B1C39029B3F030D7615 BOOUTOO
343,030,170 *22414BBC9EFDB03FB7F9EF96D3ED207A12B5A53F BOow&
343,030,171 *2245B46A8499501B29CB2A49B95E13F9631AD926 Booyong7
343,030,172 *22465F7FADEE2A9A74C718C3097011C48406AA26 Booyzen
343,030,173 *224A2AE86B902C7B11346183B762CF0B6A52D113 Bo%)p
343,030,174 *2242EDDF3EABEDA1613ABAC49AB811ACC2787983 Bo
343,030,175 *224E185FB70B713032665CCDB828C7774E8CCA82 B-Op8
343,030,176 *2245674880B3618AF207A3FFAC723D10C8E72753 Bopaa
343,030,177 *22411A335D7A14233A8CDBCB6CEBBC4773835A1A BOP"B
343,030,178 *224FFE4CCD5C5AA283590673F7A67258544DCBC2 BO#Pd
343,030,179 *224A16A2BC794C02E8DD070D1BEA9A00F462629B BopHw
343,030,180 *2247C30C80C9A10FB389A3B486EDC52899170C11 BoPkI
343,030,181 *224D871A228CC6283FA8B778B6E8579B1064E2A2 Bop+L
343,030,182 *224482FBD610E8FC08A9ADEC7C1465B16E675498 BOPNQ
343,030,183 *2248CD0082516A388456C08325B4FE8E4B51122D [email protected]
343,030,184 *224CC5EFF0C42B9800CCBBEFC18B79E0BB981061 BO%pS
343,030,185 *224F21775E76974954BCDEA2D31CAF54BEB07638 Bo"PU
343,030,186 *2243864A4CC2447C1E63B6F20823D69C51D940D7 [email protected]
343,030,187 *224B62E7DCC70DE3DD286D7D1AAD3E4F272D040E B.OQ
343,030,188 *224EB5555437EA94748E2A5A1987DDE7F39AA6F1 Bo-%q
343,030,189 *224FBD90DC64DE3C1DD47E729E04628EA2613E6B Bo:Q1
343,030,190 *224EE30C93A397E5749C27354D82D71B22FBBB26 Boq6+
343,030,191 *224421DF3B0A9999E7235F5F2021D8C8DE8C576C BOqCu
343,030,192 *22463D8C52722D3CA621ADF356B76EDAAA60182C BOqD_
343,030,193 *22428C0B5B236F94D01D726318353DAC41535003 B_oQH
343,030,194 *2241B808BBB78784D2A0A7DDC933CF871C4E70A9 B?oqH
343,030,195 *2241F3F8F78AD5C28D7901D0E084D6D5006AF20E B/oQM
343,030,196 *224C520FDE1A97D6972624262764BE9D8A9D1A83 BOQST
343,030,197 *22443AEDCA8FDB539885AB4AB552F923AC5B4AEF bo.quatrevingt
343,030,198 *224859E7AE71588E0539DAE0F34F39B2DDF0D539 BOQWW
343,030,199 *224E31E1F8CE4EF405D6BC1DE9D5E133176257CA B&oR#
343,030,200 *2248D52D8A665976E7F548CF12450E5321882732 bora1992bh
343,030,201 *224F891B4C26A1AAB0B823A7B79B8D349F546396 bOrANeS
343,030,202 *2248D784458C5C1565CB7A14AE154AE3F86ED73A Borbamiertimalia
343,030,203 *2247A7315E2AD79304F41F4168321BFAAB5640B0 borbardir
343,030,204 *224C7DC119E5EC59765DF7A9790C5535ABD81A34 borboni-parma
343,030,205 *2240B121C90CF04627070D13A240042448F16EFC Borch»
343,030,206 *224A95D8739DDE3AAC7C9CC0A9AD3E889F4CBCCE borckademningen
343,030,207 *224638FC32613A9B35A7F13125E41A983C190672 BORDAVA
343,030,208 *2247F9A945CF809A9DB2D3CEB30A53CED4B4BEA3 [email protected]
343,030,209 *22448A76209D95CA4ECE238764B53C7F7F30CBF1 bordessoul
343,030,210 *224FB9F4839DB274959BDCCEE954EA791DCA4E14 bordgestützter
343,030,211 *224DE5679A96E40EABC7B4D5F79E0FDD13E83975 Bordmahl
343,030,212 *224E93674266AACF4D0DA3F4C8ED59E82BEF847C Bordrag0
343,030,213 *224BAAA755ED8E1DDABD02C7ADAA584497485F22 Bordrent7
343,030,214 *22428BF1E04C4AEC3A589ED6B005F190335E0BFE bördsaristokrati
343,030,215 *22494790A4DB28D943792EC42F7CDD2981C6D7A4 BoRDurEs
343,030,216 *2240CE558CD3B96599C596E3576C6CF5B0AECD9E Bordying
343,030,217 *224F58DE0A8BF39337B0E99B79E7A771B86BB07E Boréalien
343,030,218 *2242E8BA75CBEB6A1D673EE7206E23E3B53FB76B BOREANAX1
343,030,219 *2243B328E73EE76A8093E9ACCC5AB01FF88BDC71 bo.rehder
343,030,220 *224E1712C453A62BFA60465C83CBC10AA789FA69 Boreism
343,030,221 *2246251FC25C4652A69FB4417BE778746E35721D Boren0
343,030,222 *22479CA9ADC3EF34DE9F2C672674BF7F703CF480 [email protected]
343,030,223 *224A0072682CC656566A69D9A8F448A09916FBB5 boreuses1
343,030,224 *224601C9A2FBE5E9053E45A7C27254BC448C8194 B$orF
343,030,225 *224815D779DFF8168B3C83B8DABFEAAA12F8613C borganläggningarna
343,030,226 *2249E14D36D82EA6DC7FE5CE6EF4517C8F16F746 borgarlig
343,030,227 *224C6253C46CD445E9C0B6DDEBA98C5E11F9230C Borgeren5
343,030,228 *22491248E51E228B613A5A22F219018FA857B2A4 borgezari
343,030,229 *224555EF7C58CD7A641DE945862BDC1EEBA9EECE borgiamacaluso
343,030,230 *2244204FC653689E6E8A3A4CBEF39EC0BE2003C2 [email protected]
343,030,231 *22475F549EF20B388498F765098C78F101179E73 [email protected]
343,030,232 *224DC7EAD1627E0CC2D0242D364A3DA0D64843C6 BORHL
343,030,233 *224C15FBFD7F0AF6B42136C6960DCAC63D1A09C7 BORICUAGRL
343,030,234 *2244CAE9755830ADC9786292A42EA59C41414F59 Borinok
343,030,235 *224420E8724F07EDB0AA4E297F368032DA2C33B0 Borinquen Yo Te Canto
343,030,236 *22409BE7D000D20AFA7914D5EB4FE0B7875799D5 boris.baysmore
343,030,237 *224A98A54208E8325A82BD54D288B502909B6723 boris.bottex
343,030,238 *224E7E7532F054BFE8F31D1F8634EF62E24BCD90 boris.bottolene
343,030,239 *22455300AAC2A385364E192D4A0F437DCC48F014 boris.campell
343,030,240 *2246DD2E15F677C2D71E9FA3A0147F781A7B0E78 Boriscods
343,030,241 *2242125EC06883A6D0AE854D7C07249770BBDD4A boris.donnellan
343,030,242 *224B967CB2316803E0FBC7E3C32DB71C5B03A72C boris.escamilla
343,030,243 *2243F3B2D1E4EFFDA47E517C79388D5656360BDD boris.fars
343,030,244 *2243532393D5BD584983AC0582269287E9D0BA84 boris.fite
343,030,245 *2247AC09E6979F437F74CAAF018EBC71F12D5B87 Boris Godunov, Act IV Scene 2: Scene
343,030,246 *2245E650C4F3AEDB46D8E908708336DFCFEFD328 boris.harer
343,030,247 *2248D558DCB2495FC814FCDE506F78EA99C69418 boris-kagarlitsky
343,030,248 *2240555F29275D29872E30CE52F98CA0BD8E12F8 boris.lavine
343,030,249 *2243644F6594705D30072BAE46FB98DB81E8E846 boris.mcclendon
343,030,250 *22473748036C4F08E04D02EFBFD2A6471240E354 boris.nierenberg
343,030,251 *2244461AE95EEAA7103F05466D90A1115D324BD8 boris.northam
343,030,252 *224E39F974D8ECBE6CC3551F7A6012FC45162A2A boris.provencio
343,030,253 *224E9F2773A32F9D1B98405550E26F64C42071A0 boris.pullum
343,030,254 *2243F4386280CBBBE179ACA8B78FBDEEDEBE55C8 boris.rio
343,030,255 *224617423A4400638083008F15E6A6CECC38739A boris.ruben
343,030,256 *2248983731389E6F63CD3C0C32574344151661DF boris.samoyoa
343,030,257 *2244F8674601DA17CC8C1942EB07611B5F4AB646 boris.sandry
343,030,258 *224CB1C6C322CA0F42169E7926422C67B4162694 boris.sponsler
343,030,259 *224F5D34F5ED58F8B2DF840BBD21129AF578ADDC boris.tick
343,030,260 *22470CF28AD1F6A9D3A37BD981E5477CB6044655 boris.yankovich
343,030,261 *224B3E7330B6BE94B03E931BDD26B556B4CC6288 borításokkal
343,030,262 *224FDC6D24176EB4016897700FD39DCAC37BD9EE BÖRJADE
343,030,263 *22412141A53A645EEF1735865A5AF80D83441446 [email protected]
343,030,264 *22414F0941177A1CB2F1D4057D8C326E7A45F239 borne73
343,030,265 *224A0380AB735E3DB9332A6D4E070038448C0A7F borneol.
343,030,266 *224329C88278268244BEF8F8AA3999C837AE2B58 bornschuerer
343,030,267 *22497130A8C15CDDD9DE28F6133D5B9029F6A4DE born to be a beast
343,030,268 *2242C41FF6F4358445D3415D61CB18850C149FCD borntoohigh(feat.bliss&painkiller)
343,030,269 *22453439703A757B3F7C86D2D5BA2A4C3BD9B733 Borobudur8
343,030,270 *2243821A611EEAF265BD87AEBAA14AF5A6CBD762 Borocitrate?
343,030,271 *224BCDFDB51BCC92538A1C2793D85BADA26F8302 BoROk
343,030,272 *2243752AEED35A3AFB368653BB9482B711BBED39 Borostyánkoszorú
343,030,273 *224D616244044448B6555EB82155FC3D7B5AB861 borotvájával
343,030,274 *2248E305B3708BE7BB1BC0DE7F91504547F6C475 Borovice9
343,030,275 *224F9DD4CEEDB9A7ED07D069E0AE9E0D8520BAFC B$OrQ
343,030,276 *2243CCABE19D1A3410BCA603969FF5F194C1D897 Borratura3
343,030,277 *224C041EEEFD2C40D47D1FEB2FF85C3114872C8A borrega8
343,030,278 *224626D25A0581820623BAE3CD913AEB0178106F borregasses1
343,030,279 *224358FCB849FE98739A917F61EC808C8894DBC2 Borrello0
343,030,280 *224A1FC9085AC93AB0129ECFFDF05ADEA874E1FC borreltje9
343,030,281 *224A1781CABF019BFC4AD79B1A612E209199054D Borric
343,030,282 *224AEBB30B92C004053D95F127BF43D18F17EF7F borrogh8
343,030,283 *22431DF3A725C5CB5C405496EDBC49233AE489BA boRRowER
343,030,284 *22438C87B3C523303DC545C90600B0BE1E83E72A BORS_
343,030,285 *224956474420D082C1442E25699479BC707FB6D1 Bo-rs
343,030,286 *2247F65238371A1A52BBDF6A820F3E5D9E7DD807 borscht1
343,030,287 *2244CFA9A3487BD326436783A967F4119853D3FC börsenbau
343,030,288 *2241EE449FD1BFB99C27660E897474ED541293D5 börsengartens
343,030,289 *2246966EE7256E07F07693BF8DC8FF32969391D4 BORSETTIFICIO
343,030,290 *224F80EA455B9AAD4F2FC26C66EB9C34D7942554 Borsholting
343,030,291 *2246EE3B6F522727215A0577194CE5F46103F592 Borsicola
343,030,292 *2245D9E5963DBE41D130A696F512A5F83E8309B8 Borstan
343,030,293 *2240448482624A270A5C4EF01696F95A75186473 borstklontje.
343,030,294 *224AB48825363CEC84860A181CBD7A310E703E62 Bortfljnes
343,030,295 *22416E10BB098BAAAA23500E157D71F503BCFF2D Bortimot4
343,030,296 *224495B83FFB3AA82F404734C10EE4366B24C8A0 bortniking
343,030,297 *2242172F153D3A8350AFD68AC890A301A4DE0363 bortung0
343,030,298 *224239EE09CB227CCA877D2E7B775162F6A51E98 Bortvendt6
343,030,299 *224EF2C3C74B70680E93F280A9902C7CE88F79CD Boruchoff
343,030,300 *2248B4F1757725F45ADA289D5ADD7539B9AB35C6 Borulya
343,030,301 *2245F49FF5E41DC0CC345E623E1B453AA648C687 Borussiens
343,030,302 *2245A6DA8FBED4765BA52FFF17EE9B09042E471E BoRw"
343,030,303 *2248BB5F475FFA8CBDE73766266E3EBC8045A40E BORwV
343,030,304 *224F9667AA1CF7E62EBCE533AE048ED56343A3CB Borznyansk
343,030,305 *224B8128470813FC7C8C5395105B43D92607ECD8 B:O,S
343,030,306 *2240DC5ADBAE0A7EEE3F798F6C532F523D3DB56B B:Os/
343,030,307 *22404255FD284983D738D0005AE28E04F68AD812 BOs%9
343,030,308 *22412DF08734CE390BC545A18C7D8E7EA4815EE8 BOSAK1
343,030,309 *224B209DF9955D8AFF900D081D9BC8E760DAF6E1 boşaldıb
343,030,310 *224CC9077272B28B2B476FB7383A9D865CE72098 bosarvet
343,030,311 *224D180C7C1CB55643CFDAA2360835490C684792 BOSbm
343,030,312 *224FDB968823CED69037C84BFEC1A2CC115A1559 Boscaiu9
343,030,313 *2249A82CF9FA557CDBC0FCCE2833AA1889F2814E boscátottuk
343,030,314 *224123FB0F93D7EC518A1AAA8845245298AC99D9 bo.schuckman
343,030,315 *224E7ECE4A0CA8D57C6248F4FF568F8FA2094128 B!Ose
343,030,316 *2245032737365DCAAB05E002EB2C6867FDDE3AF4 Bösewichten
343,030,317 *2240C7FD350B4CED5471830B2696BC42C005648A boshette3
343,030,318 *2245F263A5EC906C36D0DC7192903E30A44EEF87 boshinaikovich
343,030,319 *2240EA4E9E2949A243BBCB679022C993F4CD7B6F Boshlovchi
343,030,320 *22457DA0955F53AF2D08F8A4028ED838FF64C1BD boshoend3
343,030,321 *2246E6DA7B41ECC006165A4E230041A905A9572C Boshoening
343,030,322 *224AD2095257628E02C77C11098C29A4D4FCC0D1 Boskq1m6eiv
343,030,323 *2246D197547586114389AEB9F565D17AE3341B28 B:oSL
343,030,324 *224234C4E0F6D232BA308AC21D6980A3487D4849 BOslw
343,030,325 *22411EF4811C3ACDF4FD07A8B4E9C511634F72C8 Bosmeniel
343,030,326 *22401B75EB6CC90C417BE33A59A42B2980741B9B bosnablog
343,030,327 *2249420C533C2B10E0AB4C50AB7DE1BEA868227F (Bosniaks),波斯尼亚和黑塞哥维那的主要种族
343,030,328 *22464F4AA49EEF7B957BBE51B8BFA4BE3968846F bosnijce
343,030,329 *22467FD8C367AB96B4795E2E3BD204349E95A348 Bosoorlog
343,030,330 *2246015743FE9278606CB79B7F7C0B19CC272111 BOSPORUS.
343,030,331 *224E0BD9A1E7BB80D5B62C755CA093D076EC3431 boss2110
343,030,332 *224356ADB6C1CE1E90F7E68600660843E41F0878 [email protected]
343,030,333 *2246C252CCC49246B2E7CE86296226993671310A BOSsC
343,030,334 *224C372C76B4E706DA690CADB06499AF5E398005 Bosshamer6
343,030,335 *224899C9CA7EF7B63EDD02E5C0CC0853896902AC bossies2
343,030,336 *2243114FD0623934D8F6EF05F555566E2C97F679 bossmars8
343,030,337 *22447F638F7E6BA6FB9342ED12B9AB6F6DD2DE4E Bosssharks
343,030,338 *224627ACA182C8CF557BC82DE2EBD774A11B660C [email protected]
343,030,339 *22429B5D635190DED6871150B8BA2231FDA636B1 Bossuett2
343,030,340 *224061455F7284B5DDEBD7672A4763BFE0F4016D bossycolor
343,030,341 *2244C69A20E4005DB56CF2B0063C61E6BA42EB83 BOSTICK1
343,030,342 *224C1110BE28E74B3AB39F498067851D576CB9EB bostoncrocker
343,030,343 *224B79C72C32B9C62CB6944D54F85A490FDE1BB1 Bostonian4u
343,030,344 *224E9109C4367861FB54AAE9E414FC96E19FDDE4 BOSTONPACERS
343,030,345 *2246511CF372BDA36ADAF70887BF65409A13A6D2 boston_pizza_234x60_pepsi_CPC_17Sep[1].jpg
343,030,346 *224B04C8FE1E08E8887F7E3414D03DF46045308F bostonredsoxschick88
343,030,347 *224D190A02BB3E0E02F2B21394EA0767AC6538DD BOSTONRICKY
343,030,348 *2247F98DD6738825CAD654CDD4956D60086E3F66 BOSTONSHANNON
343,030,349 *224FA1FA39B23959867F86E47771EAAEC573A17F Bostrie
343,030,350 *22490FA9B33EB977A6EC739F2448902E74B92C82 Bo.sW
343,030,351 *224A1091A9BA6031B8EC91844E7A2CC13FD9B816 Bos%Z
343,030,352 *224CE8F8B08FE45177952D7C76181335B84E83CC boszorkányságnak
343,030,353 *2240537A7BE3396625188CFBB703A5A0ED2BBA6A B=OT.
343,030,354 *2242D17C704C76C15103A504B6EB9E45E0E0A9A7 B)oT%
343,030,355 *224D4EF45A942C249214659B0F76F4635B29C5E1 Bo$T!
343,030,356 *224BE63DA24F4DDDB9127828B7D0A39D7CEE117E bot100
343,030,357 *2240BDB4A76CC9DA8AF885EDC6F50C620FBC7258 BoT1c
343,030,358 *224D1DA9C60C5842138732AC68087C8121CEA87A BOTAND
343,030,359 *2247C95B7A07C3062FFCABE16F6AF0B5B6EF82AB Botaniica3
343,030,360 *2247410B280D961A97C796F41D86724318E1229B Botaniste
343,030,361 *2248D8C87E4BD8C4F2FBDB8D059ECB2012644CF7 Botb;
343,030,362 *2242F31E833C1C8AAF794CF8EC64CF8A8D6C5167 Bote«
343,030,363 *22449164C0639E51549018F6ECDC516C5251FDE4 bɔtəl
343,030,364 *224D6D87C0961EEA4D64AB6EFD1475A21924C1EA Boterde!
343,030,365 *224E4EC094921DA30D88B3B01AF060C12B2DA166 boterfabriek2
343,030,366 *224272BFCF5ABB018DD3CD52A327F157610A34E4 BOTESQUE
343,030,367 *224C3A79BBABBF4C6D0FA0B6802D7296D3E7D98E Botgörarnas
343,030,368 *2249E620FBC59B180BDC04ADC3305FC9C8EC93E3 Bothriol6
343,030,369 *22496E7CE8840874398A9D828F99960D761BCF5E Bo$tL
343,030,370 *224C44BCE890CCA911414B81A49E13AA0B6D834B botnica1
343,030,371 *22415D512E7CC48B858620209390D695F9A8EF2B BO/tP
343,030,372 *22425F47B37793ABAFFB094DB9B24CEC8A77B523 botreq蘇州
343,030,373 *224411EE442F3BA78D4ED5D2CB19E42A3865FD20 BOT-RIGHTS
343,030,374 *22456947364C4606FD59097216E7DED5DC4B8B59 B?otT
343,030,375 *224E94349A6C635DBE38217E470D3C942248DDC6 bottigger03
343,030,376 *2242D474DB26792B80330FCA2505128A7886C888 bottinoíte
343,030,377 *224521BFE3B6F097F8CECD8819611C9D5197254E bottleandhotel
343,030,378 *224A88465C6F16E5E3BB3EE341963A9F080872D1 Bottleit3
343,030,379 *2246BF64CD5CFBFA31914D2EE12A5026AA3711C3 bottle-no
343,030,380 *224C0F937DE015658D6EC7F01D76DAE36937B92D bottte
343,030,381 *22425990B81B53B41AC9F630939EF87915350F40 Botulismus1
343,030,382 *22455E498D215ADA3EFDE463B5879B8B7C2E2085 BOtVe
343,030,383 *224BC96E43D79075C4C1769F0E08770CFC186C79 B!OTYPES
343,030,384 *22425FA68DB9FBAEB8C7A7C80D70003D0D8C5A5B BO=U&
343,030,385 *2247B6939E0C2942DED52D238108E75DD5AE8394 B;Ou"
343,030,386 *224EC4E05B08D27D716A09554E3C1665B5B1833A ‘Bou’
343,030,387 *224059D30D4C41F6672E3A15FA0DA4B047F84D51 Bo(u)
343,030,388 *224D4239B985D8B8B5A14C5F29A496D96A9B1EEF Bou,$
343,030,389 *224FCE968B312026FA70D3BC1FF1AFA4F705489A BOUALAPHA
343,030,390 *22462F06C46F5C75EA38CB0A311423D6BD526CA2 bouchehousebrusselswisconsin
343,030,391 *2241B5540A858EB00E719143857BD10AB40C34A8 bouchhiouaanis
343,030,392 *22451458DF280CB60122662EBB0C69250A5A6FE0 Bouchots4
343,030,393 *224EF933A4F9A46B101004760B40BED4876E8A4B bouclenT
343,030,394 *22411F9AEF3429C747789FF78330C70EE2899399 bouclerent9
343,030,395 *224E4E56C928ACA735CE39C9536CB464720A338E boucles.
343,030,396 *22457E3F3CDFB3DFAE13EBA49E050F0C81A64B7E bouçoães
343,030,397 *2248F2B9D557E702E321A1248048DD90DEE157F4 Boudant?
343,030,398 *224DDE62C6418577174A94491073875B660E454A boudiezsed
343,030,399 *224DBC5C47C53C01E02EEBD97EFCBCCCCD1F17BA boudikki
343,030,400 *22414089E7E75F9D92C785D776F0D6AA679508AE .boudin
343,030,401 *22406D5433F061997DA1810E9C2F314B68A8091F Boufura0
343,030,402 *2243BF1F62C59F0BD7489A9F0EDC0E9BE8788DE2 bougonne0
343,030,403 *224196970B667864B8526FCD5ABF0006750AD758 BOU&H
343,030,404 *224CF2EDEDE4663D3E6156A68E9F28F1D9923165 bouhar
343,030,405 *22480A6829BF4B30323A0A5B13E08CD555E46C1A Bouillan7
343,030,406 *2243FDE4C8945DB7135C8BCC6335DCD21F33BF01 boüillonnant
343,030,407 *224ADC5BCEADA387FE718A7DFE720677400DC9BF Boukangi3
343,030,408 *224124A057FC27975ADF3E7406337AE3A6BB29E3 BOu
343,030,409 *224F18413D1610CD46CF45A6A59B384E4D4E0940 boulakiaed
343,030,410 *2240DFDD3EC0954EA1FE7599EC143DCF267119E0 BOULDER60
343,030,411 *224D4D4F8A53730CA714D1EA00307F591AF5E75C boulder buff
343,030,412 *224B8CFC056B6598069112EA4A38ECEDD8A6CE2E boule1657
343,030,413 *2249FAD8558B1C11DD0357D755F2ADCE17FF47DF Boules9
343,030,414 *2240ABE4DB78E5C0C84D0C67A8BFD524537B6E1A boulevards.7
343,030,415 *224B16AF2B4C719E069E51D6B1D24BDC5DBD2752 Bouleversants6
343,030,416 *224F71AC0E42D5385A0CCD0B1C5069C1275FDF09 Boulezining
343,030,417 *224A2FDAF44DD9C4490587D17E5C82D70A6BC921 Boulmiched
343,030,418 *224AB7066F775C93E9CAD652A6D87515307C2F42 B:oUm
343,030,419 *2241B923A3DBD6007702914B17F7CEF5FC76E137 Bou(m
343,030,420 *22477B28E8FD30014C316817D2AE60E20D367EEB Bounce Up And Down
343,030,421 *224945D51090FED2025F8D0DEC8FB9B74C82250A bound to fail
343,030,422 *2241915658A02B5A211A1FB8998869C5FB8B0A6D Bounkeua7
343,030,423 *224879A94D8AA67A9F7CEE00496CCC82107E1562 Bounlam9
343,030,424 *224497055CB789607B5025EEA9FD5D194A9DE635 Bounsaursr
343,030,425 *224FA81438DA538121E51F7C900939E68D5F5DCB bounvo
343,030,426 *22418A21C451327CB459CDF33FBA0F3AF9225030 Bouq$
343,030,427 *224B5C68B56DFF69CD0C816D577D334FAE253B3C bourag
343,030,428 *224289CB2990DFD5E224BBA76962E82077CE90FE Bourdonna
343,030,429 *22417D4E02DA221DF0B90BC4DEDAD1A7B16A1BD9 bouréki
343,030,430 *224A310A413F5665E0DEAC7C1A99E43B596A5304 BOuRg
343,030,431 *2248642D51054917A7F0E3D7C8272D261A66DD6C bourgaultcharles
343,030,432 *224D08E583DBB277634C7309825DF3AC94C20F6E bourhispierre
343,030,433 *22409436708658F53E8F01DC2316F400D01B932E bourkegene
343,030,434 *2249950E2D458FCB47631691F75E0E144C547746 bournemouth.6
343,030,435 *2246B583B24E0F4A746C5D5FDFDD5DEBE875EAA6 bourner3
343,030,436 *224341B561113AA7798AD31D946FBE1E12DD7864 Bourqui4
343,030,437 *224C9F058C01399C878F5D8D1983D761C45FC833 BOURREZ?
343,030,438 *22473F7D0ED332425D4C5A2705CEA4BC56118BD2 bourrons8
343,030,439 *22483464DB467B6331A87D611EBDD657172A1376 Bourserait9
343,030,440 *224803015D1668E028876889CDE703384E4FF819 boursoufleE
343,030,441 *2246D05E0441F2C88CEED22D5B4EFC4E273FA4FA Bourviling
343,030,442 *22470A07A72CFE41F7029439623E7463CC01BA8C bousaibo3
343,030,443 *2246D2F90D755AC98ED3D0C59F40F8527C644638 bouSED
343,030,444 *22495B644108765D46213291267FBFE80B2DC139 bouse-quartzsite
343,030,445 *224B9A90DB998AC2A2E7F2973A25FB81DBA45046 Bousquetovu
343,030,446 *2247364D0988A601EDB330C66B654EFEEE2635BB BOUTAOSHI
343,030,447 *224C9D0646ACE7DDB08AC9A971984FA11ED32FEA BoUtE
343,030,448 *2243A1FB523DDFE7F39E7EF928B7C57A52F14AED BOUTEUIL
343,030,449 *22467E31790B57725F603F3202D4214E259774BD boutflowersir
343,030,450 *224B53400A3D744586569A13B85218720A14C5D6 boutgiftstaket
343,030,451 *22479F6549DC92C69E3AD6CEB5A7CF44C58F5145 boutique-caf
343,030,452 *224BBE38FAB53EBD0C60E26D57B16442A3DA6D3A boutreview20060713
343,030,453 *224248DF9307A515F9DDDADC9BF82B814811EEA5 Bouwhuus
343,030,454 *224260933C2A2EF2AC6A4ACB9FC05587299A5CCD bouwoede9
343,030,455 *22489D2549AAACBAE67D55FF136E5C2B2B7AAB4E bouwvergunning1
343,030,456 *2248EAE956EF9F0DFFFC641E11485524682F4869 bouwwerktuig
343,030,457 *224D8631CF06AA8F095E190DBD73E6DCE767E21F B"!oV
343,030,458 *2241DB00773268A5B6F8B972CA232E53A680CF2F B;ov_
343,030,459 *224FE5484E939F5B74130637EC45F7C20641011A bo.vanderweel
343,030,460 *224298C1660AEB568F8216276AAFE5A42336A922 bovannes
343,030,461 *224B3AE5773E45FFC354241086D306696D6BFB6C Bovarina8
343,030,462 *224D28E29C2BD112134CE03B4B3B54C637D523B3 Bovarize3
343,030,463 *22451EC830AC9F93C6AD97056A50716AD5D0B225 Bovate0
343,030,464 *2243DF325D8C2CAEB76D7A65AE31795C9315EC8F BovEF
343,030,465 *224DE460BF6C3FC7756320EDB461AA13A51731FD bovelli6
343,030,466 *2246DD8F877AF66122BDF1DE4370D3AF5D0590BC bovenbeharing
343,030,467 *224D4E8F1C7613AEC56DE8267B0C7B1579E9FD20 Bovendijkster
343,030,468 *224E60D1A7EB726FCB26D586FD9DB11FEAD1C53E bovenlat8
343,030,469 *22403C77C61A55DE9B9960F03F8506F02EDA6279 bovenstreek
343,030,470 *224E6F194C32455AAABF9E0FE3DC903CC07CF855 Bovinumed
343,030,471 *2243F362E018A1CE44DA26BC6360A06C3B360BF8 [email protected]
343,030,472 *224EEE7A4931DD37B2D164307782D382CB099C1F BO#w"
343,030,473 *224F33F1E66BC64D32735D4BF1A146FCE4DB97E8 bowa(
343,030,474 *224468AEFD49B44BD65BEFE40239A8A8A68D47E7 BO_wb
343,030,475 *224F84E656FC90D6007BC944E96DFBA285E28131 bowceddcr64
343,030,476 *224BF76628B3D1B9ADFEAD08565D6C3EB243E561 bowdlerises0
343,030,477 *22478939A578447CF69529550FC237154FFEDCD3 Bowerbird
343,030,478 *22474D081B544E40F6A1EF69C620FBBE8E1CCF88 bowhillses
343,030,479 *224C85E394D434A70A45BF72488438EAA256B09B bo.whiteaker
343,030,480 *224A1A9B262EB56E0FB8B6749A06FABEF54B2C59 bowieful0
343,030,481 *2241701111A732BD9BA8AF48537535C82F7D0F6C BOWJMFD93
343,030,482 *22484303904C5B1C23CD2C93AC505CA24BFAEA39 Bowl%
343,030,483 *224B8EC723CA64C3BAAA91BE3953961B23D0A5E4 bowldery2
343,030,484 *22452E835949B6D5E9AE9A372FB3AE77C79B32A3 BOWLING222
343,030,485 *2243E7C9C8F2AA1CC36AD8AFD7666B1A3694886D BOWLING4SOUP
343,030,486 *2241DA54D875335D399D3AADFC2287250CECF717 BOWLINGEAGLE
343,030,487 *224F21BDE6CC4BB7832C16512D0DA8268830E003 bowlingsean
343,030,488 *224DDEF3FE02B0B5AC36A8FEBD0528C26010D9BD bowllss
343,030,489 *224AAD1F13E9AD133B17109553448D795186389E bowmakeR
343,030,490 *22402B500F6FE802D1C96B2E2F5D9337486B675E bowmaking?
343,030,491 *2244678A2291A04B98FCD65FA0571D596F5A2D43 bowman4131
343,030,492 *22433BB8369B08C52F9D53C3AEBC8A959BF1D6C4 [email protected]
343,030,493 *22447ECA0F0C783FE769C4A523361A1D34E0EA7F Bowom
343,030,494 *224A0E7ABEC913FCC09727659F902103644256D2 Bows3s
343,030,495 *224DA1D556B8643EFC5AFD6829C83D680321F33E [email protected]
343,030,496 *224FFB82833D7B6F12B0A52FAB3787A9C98A4410 Bowting6
343,030,497 *2243FC45CD2A67C88A82228DCEA64915628A061B bowyer'n
343,030,498 *224085A2F9C8780C2311FD20465FE7EA8013B926 BOX;)
343,030,499 *224E77B914509162F68AE0FC7971526AC6318C12 BOX0a
343,030,500 *224B9F7AC1D8B9DAB7B30FD8C7E7F72002E20E1A 『カラオケBOX』(1991年、
343,030,501 *22447B9FA0286859F597AC9BF49A00AEBBECF32B BOX」(2006年6月23日)
343,030,502 *224E7496A4301A3679C3FB3CF4D76D2315E7BA30 BOX(それぞれ3枚組)が発売された。『
343,030,503 *224311F9758267E67FA2A6385D83607F1AEB23F0 BoX(5
343,030,504 *2245B0ACB12C2A70EE7E49B5493D119D15E743C7 boxcaria
343,030,505 *224D1050F2B8442E508E26D9B4F3944192DB2B67 B.O.XCD
343,030,506 *224C93A398A0F1E24C98A7114C77548AB661CDE5 BOXe0
343,030,507 *2246DE345520A369FB4F61BD2F583022511BEFC4 Boxer98
343,030,508 *224ED170F32D11D530D7FB20B4C8D6FDDD37843C boxerbarajas
343,030,509 *22499254F1B86B2B0EA1E5CE04AD014FBD7873D0 Boxes!
343,030,510 *2248F50E39B65AD9DA408F5B1315027FF7D7E74E boxescore
343,030,511 *224736809E60F5AE89F219C90FB0195FBE34146F bOxIer
343,030,512 *224A68523328B79F1D450CFEC253153F419BC13E boxing”
343,030,513 *224894BEFFFAA9F9D1823FD7D939592FAE1E7DF9 boxmcher
343,030,514 *224EA73F3DFA73A92782EBD9329406668EA239F3 boxsheppard-yongewas
343,030,515 *2240B6E5C5765D3FAFD64ECB5913BC3BF0841D5C boxytiam
343,030,516 *224867666CEDD00CFBDB57D116F0AA6D349B4A2B Bo/=Y
343,030,517 *224620AE4A10095B2D08E93DA9124DBD674387CF BOY9_
343,030,518 *224C270EED38A8BC102A04DBF8AA14F20E87AA9A boy alexander
343,030,519 *224FB344667F22706686C13E5BDC5F34ED038220 Boyarm
343,030,520 *224683E2C71F60D70C6B622FBED84B2D409B7A44 [email protected]
343,030,521 *2240B1616B4C55C38F49384EC2CD3997455F2950 boyce.bedwell
343,030,522 *2246BB4882492C42D203F7E5A88B5A1AE2EC60C8 boyce.broas
343,030,523 *224FD82B27410B659EEF674ADD0B287C0486F84C boyce.catinella
343,030,524 *224B4BD0ABF73DE9C1B4C78B06F5002AB2AF0146 boyce.decaro
343,030,525 *2245372B4B58D13B53F81719D4CE12770CF3EAA5 boyce.fein
343,030,526 *2244B7456519D6E5C9B34F240E3B98936C1E387C boyce.fetterman
343,030,527 *2242F7137F76270F190262623F0B3B984CA88708 boyce.goede
343,030,528 *22411D5F9AAAB8F5B60A369FDAD09A762E1D792F boyce.hartnett
343,030,529 *22429CE54F9DDF1042EE4777AD1FAC241922BF6F boyce.haynesworth
343,030,530 *2244C8BB5543EDC7BD4F703BAB969549805A8D1B boyce.holdness
343,030,531 *224CD424640F52DFEC9673C916361958BB5DD19F boyce.kaelker
343,030,532 *224FB9C706EE90D6716D615033D5C450C5678BAE boyce.nordquist
343,030,533 *2247669B349A4EF7C46099492FD9B3D51C0326C0 boyce.pekas
343,030,534 *224202D9154FFD3C9DD90103B53AFE434E8B8E7D boyce.penix
343,030,535 *2242C9C4B3AD793BA2F43A8D6B7502C92A142372 boyce.phramany
343,030,536 *224E776227BACE575E6997854F64CE00F05CD5DE boyce.polhill
343,030,537 *22402629BCCC0AFB27AE459E52FE121D92E99F96 boyce.rummell
343,030,538 *224A3453063972D4C061F5D6ECCD37BDAE0A5A26 boyce.setters
343,030,539 *2242A5C9C49829DC05F523D0E088855D901896F6 boyce.surwillo
343,030,540 *22466C7C10DC758BD761A9B762BB32D98BD316AD boyce.thibeault
343,030,541 *22467A229AD232A1748B68AFEBE98E338108AE45 boyce.whyman
343,030,542 *224B8BB6D4190C6A4DAC3B4AE5DA120D1E581654 boyce.woodis
343,030,543 *22401AF7BE46559F005A490EA2D8EAB29FBC992D [email protected]
343,030,544 *224C912847B7197D757EAD5613630B22D9CCF88C BOYCOTTERAIENT!
343,030,545 *22411C750C0E4000721E7EFD8C17D0EF1644D3C5 BOYCOTTERAS8
343,030,546 *224A5E1C1FC331A6CF4A72DB046C9A66C7586693 Boycott Radical Records
343,030,547 *2248DE7AF94369887221236231DB7E597CC8BDA5 boyd.antonia
343,030,548 *2241FFBE5C5880C3DBD3ED2E8FD476CC90B84403 boyd.asnicar
343,030,549 *2248D55D3831E447AAA8790366CF012B85284EE6 boyd.bogue
343,030,550 *2248286AB9E873140EC998F0BEF6D7E2F0BFABB2 boyd.declerk
343,030,551 *224B6ED1F441A1743D9C874EF3DDCBDD79356833 boyd.delcambre
343,030,552 *224769EA6AD532A7E7126ECCE11E9FE1B26D0377 boyd.depass
343,030,553 *224C661CEA96AD56AC6F181907B8DEA4FBF961C0 boyd.ehli
343,030,554 *224A09A18A7FD22960DC6C15ADF2336E06AA055A boyd.gallihugh
343,030,555 *224DE0C8B18B5B8D3B076FA60A0ECF27C4C8BEEB boyd.gitt
343,030,556 *2247F45C946107410160C911AAEEACF6B1524E23 boyd.glanzer
343,030,557 *22484BBAC11589D36797FAD89B39FF5293B11AD7 boyd.hamalak
343,030,558 *22482AC6A46B5917625EDD36EAC9DE86A0EA0969 boyd.hislop
343,030,559 *224B52E61A47C939159FD6CA4D86083C54195D86 boyd.labo
343,030,560 *224D7937458D69DA35E428CD6C25E8FACE2DCDE6 boyd.lamport
343,030,561 *224377E0CC6E16D437A7ED32869D0F556228D8A2 boyd.longmire
343,030,562 *224E0784DD5E5224A370052265CDA69CF11F30CA boyd.lovich
343,030,563 *2243620FAAC5F0FCC154764AB1E59E0F9800EC77 boyd.mantis
343,030,564 *224FE9AA83AA7F6FB44D87F0C3E0194D16E5DA24 boyd.prabhakar
343,030,565 *224423F37F45407F98DF8DBCB0FE132B0700E479 boydragon3
343,030,566 *224A526AEFF8829C74E6247652BDD38A9F69A715 boyd.rudh
343,030,567 *2247DA77F5C4AD0718D6A373487C542E44535994 boyd.sasao
343,030,568 *22464E453CC9F3DF47A0875C40B88D7F27B4A1BF boyd.seldin
343,030,569 *224E3E8E237F0F16938E37041043763EC241260A boyd.ster
343,030,570 *224966F7F33132036E7F4BDB1118E241815BD2AC boyd.wileczek
343,030,571 *224F3788739D992E2663235953993DFACDC14E85 boyd.zaeske
343,030,572 *22479A986E9BDD6E31A7B848A17F7D8B2DE2268E Boyenstrasse
343,030,573 *2248FE752DD4D6E3B14A6F266B93C671AE8089F6 Boyesen”
343,030,574 *2247A6D485D7A98BA4D3255581445B1151EA9175 BO(Yf
343,030,575 *2249C1324514F5233E72FCC242B148B13E0CED7F [email protected]
343,030,576 *2248ABDC4B27D52224F48DBD7FBB84B1C57D58DB [email protected]
343,030,577 *2248E7B3753D4B147E2956071DCBBDDEAEAE3769 [email protected]
343,030,578 *22479F8AA573E827564427E40BD6CF87B3A2475C BOYLER06
343,030,579 *2245742C5FDB6497642C1D7CDD7F713C2A84EF2C Boylings7
343,030,580 *2240DCCC80E7A1E1BEE9CEF501145A6D2F60BD2C boyliudong
343,030,581 *224D67CC3CE4E1E11981DA620BDFFAD6E7CF294D Boynuzlarrı
343,030,582 *224E1A513FD757CC0355F1A25FE355A7524B1542 B:OYR
343,030,583 *224697187D338552ED8FA7AD2D0B8FD47EC5255B BOYS’
343,030,584 *22432EC1149914DA4D80DC41D46A9700B6EF3F09 BOYSB
343,030,585 *2248BCDF553EF7BA2382FEC10C1B321AAEA65743 [email protected]
343,030,586 *224AC5277D5487F2863C75DE61711A08BA652FC8 boys go to jupiter
343,030,587 *2240A479EDABAFA20ABDA216E70C60E5DEB3884C boy'shonour
343,030,588 *224BC9ECFE42C0AC4BD3AA90A486AF87219C7AE3 BOYSRGAY12
343,030,589 *22421AC3E76876D053436B109B5B6A8326DA20B3 BOYSSMELL8
343,030,590 *2240E0ECDE49613B5FE82BA2CC319B7F7E1CD1D9 boysuper1234
343,030,591 *224165746F4FA67E30AACCF5008DA4E2A01DF9CD boys、作曲:紗希、編曲:依田和夫
343,030,592 *2245080AC62CD2382E9F42A149537C840FA381E2 BOY,T
343,030,593 *224AD3C45209DC6974024820A295C3C3A116399D Boytboyt2
343,030,594 *2248AA81EEFC4EC46EF9BC55FB76F70C43302231 [email protected]
343,030,595 *224144047C318A02B7C84FC9B2C6D5A792FA2ABF boyvaa
343,030,596 *224AFD110630B78DAC5543230E600C55948546E4 boywbmi
343,030,597 *22498F303C9E7D9D21479F234FF3153C517BCA5F BoYXC
343,030,598 *224E2F195CB8C505BE1B469A7441F799DC74A1F1 B+oYY
343,030,599 *2242747677D07F586BCFD2B1DF5066A3C76CA52D boyz042793
343,030,600 *2241AD4E2B40CF2C7EF84418865F3B3B52FCA59E BOYZV
343,030,601 *2242BBF033A90FB0D3DBB17D61FFF1840D98C751 B=;oZ
343,030,602 *224DC7C75A51655AED94C19FD52272CEA2DB49F7 [email protected]
343,030,603 *22440B72B09A106E8BDE44F4D6188A0B39E0B6A6 BoZ6w
343,030,604 *224410DE1E0B64B8851F8E1FE03FDA1F04D61174 bozikis5
343,030,605 *224B0C4686AD3B4D2F767F98E7C7E3376B356E19 BOZkF
343,030,606 *224476CD49B6FF72437ACECFE01CF7AC4983BA4B BoZ$l
343,030,607 *224F2D5B27EDBFC98279196DBD34833AD6162FD8 BoZOk
343,030,608 *224A23A414DD51E71228A55C04477DD6DA7663E1 Bozomindy1
343,030,609 *2244C9A160816FA60F6C8456A68BF673379FA02C bozovich3
343,030,610 *224D5B6C36949FCF75D6B7D89850FA17D7A55FA0 BoZQ2
343,030,611 *224131C3357B54CCADC4BE199D41892F18712EED BoZQv
343,030,612 *2246DB3FF58184972854BEEAA5C61DE0A5CC77B2 BOZUB
343,030,613 *22479963B462C96A70C3BCC5DD819BFACA780D87 B__P
343,030,614 *224B29CA9620351A66725DE1FC9D9FB932889BE6 B?P+/
343,030,615 *224E70AEF1690AC048FD3967CEDDD85CB975014C B.-P!
343,030,616 *224D8981C2CAE984178F28F5FB9E645F44987CF3 B'#P
343,030,617 *2246708AD0E2CA65BCC39B266D12E1937DB6DC36 B"!P(
343,030,618 *22488FBCD2F0A371B74C0637A19D8523EFF7D072 B(
343,030,619 *2241CBE8AC0DD96481E88F08F780ACF475EC2ADC B(P."
343,030,620 *22469177A24CAFF1A0B36D7806A0A60E84A03D1D B&_=P
343,030,621 *2248506DE85CAAE2D6C9F4163A3DCDE662FA757B BP=&#
343,030,622 *224DD42313719816F7429B4B2412B0D9DF329D11 BP,#"
343,030,623 *22409E72AF74291CAFCF88F6053288E1DC5AE72E BP!/-
343,030,624 *2249E3330EE83F35E2DC9129C5C1F8918E43C01E BP(?;
343,030,625 *22469D2E287F0DA19EC833D57316C59AF997F5E2 BP(+:
343,030,626 *2243451018B86D4F5F91CF379DB0A18071BE30B1 BP#:$
343,030,627 *2240A2173B056A5CBE24156FF945092AF8A7EA92 B!p,&
343,030,628 *22411E837623428663FA553BBFE5C96F22F25607 B.p,,
343,030,629 *224DA3D86AA9E4E1551C211033C0FA266A916FFB B##$p
343,030,630 *224F33657D9A67AE981F36BF2766E3390F81D541 B+;=p
343,030,631 *2245BD35791038A54EAB1CCBDFE8F7C0D9F6C369 Bp!;#
343,030,632 *2242A343A5433CE063849812AE8333CF3D58500F Bp.$.
343,030,633 *2244F5A94683A2FB30FC929641652D22D68858D9 Bp'.
343,030,634 *2246A5549C039CB6150116286A37B8523432F9C7 Bp)%;
343,030,635 *2248663080AAA03F5949A668C600F8F14678BF84 Bp{-
343,030,636 *224986A1216FA69190D9B180A9BD0C562DF13523 B?P,0
343,030,637 *22420FB86007A5DF03C68D56AB4B7ED0139CF473 Bp0
343,030,638 *22441EA5121CBEE3E59A084F5D1807020C50351B bp001px
343,030,639 *22410B06ADD8893B98C3D2544926BE9F3D72F923 bp02842
343,030,640 *2241EF6D483666DCC1372A5FB4F6095A54A384DE B?p03
343,030,641 *224EDC16C4A1F7F576B8A636D7DC7EF50A7E097B Bp07Z
343,030,642 *224A96BA11FA0145294FD3515EDAE3DDB0E8743B BP0
343,030,643 *224ADF30E46D399EFD5C7E0F53B78FA624D0367D BP0
343,030,644 *2249BC6BEB5807281809CF51BFE2F81E20AE5BF4 B+p0O
343,030,645 *224BFA12517B1DF5E40D6507E2D96E7081F6EE41 BP0wI
343,030,646 *2246A78E9734998F54AB765484C7D30A23E360C2 Bp1h/
343,030,647 *22463A31CA1DD8D31CD76B6081A76EF766A1AF2C Bp1jj
343,030,648 *22450C1CD26666DAE09E983E5FE2AC2D1CA21EC2 BP1P1
343,030,649 *224E06AE1F6036F1C9590EA6D8B656282AE336B5 BP2IU
343,030,650 *2247DF8024F00CB397F66A5C905E8F0836B31FCD Bp2VV
343,030,651 *224C9CE963F04C0C32394DDB50A8D0260B26B2E5 BP_3c
343,030,652 *22441178B01D7424EB249DB64699CB767CEBBD2A Bp&4+
343,030,653 *224BDDECAE47A5724A89CA06932A626ED562B38F BP46q
343,030,654 *2241B67671FF6207B73F86FF7444D018D8CC81D5 Bp4gr
343,030,655 *224BB2E724B975A437A028D5FA889C8B3C5B1FED BP4kr
343,030,656 *224BD1F64C7E50DCF0BDCA7C9FDDBF46DFA5A09A BP4W$
343,030,657 *224560F0B57DF419EBC400C136F1614618B27BFD Bp4w
343,030,658 *22460AB07D9D1F1AD122C3ACE612353A329EC806 B)p:5
343,030,659 *22471677B0AD52F29D78443A97D70881DA8F12A9 Bp53Y
343,030,660 *2244BA42C3AAAFEE602A6C2E93BF4C2907ACE6ED BP5535269
343,030,661 *224EE47157C49AE67C07B107F6A86515385E5324 BP56B
343,030,662 *22428F6C43BD6705934CA340A1DF59BC27EF385F B.p5D
343,030,663 *224CA8D68D2E7EE6D639E014DBF08869931A4605 Bp5DP
343,030,664 *2243F5A41FC7DC9E799C5E2FFCBB807282F4F44A BP5Ft
343,030,665 *2247EF9A8719881DDF1361A25AB493E4C776C662 BP5sA
343,030,666 *224DAB03762BEDF267A03D71E2A51527A1728BE0 Bp5sp
343,030,667 *2246F873937C2939330A30C1C5D4C781B03BC1AF Bp5sS
343,030,668 *224EBCDA2CEDC7DE54F1CD105C822CDE39BCE118 BP5!Y
343,030,669 *2245A2545AB9C2D2D3CBA33442302E8B1F8565BE Bp6,
343,030,670 *22496DB76D490C174EB7F488D98F313BA29BD52B [email protected]
343,030,671 *224288A077EDB27962839D618066284BFFA3277E Bp6ql
343,030,672 *224B26A8FCF28D44BFB8FC076617CF74D66745E8 BP6Y.
343,030,673 *22451E796D84BEF7C87DA34F5E5E38DE839288AA B:p,7
343,030,674 *224900AF6CB69A67B61558CA2DAD34C757A846DE Bp7,?
343,030,675 *2241105831DFBCDDEA8DAC8E223127DD5696A077 B=p7a
343,030,676 *2249CDC60F3631647E3A6C4086794A0E10C3904B BP/
343,030,677 *224B7D4F7CB2740A513D6224F8BA63E326351A0E B&p:8
343,030,678 *224F3726638CF4D0C0C23260F9E57CC7CA1AFBF2 BP81M
343,030,679 *224FFAC7A3B30CC1AF8534327A41906453D342F6 BP8Cb
343,030,680 *224EFA5B39881D72E33854E26F696E465D3D7BA6 BP8f+
343,030,681 *224C6A281B8C3B28E6A709864BB25830BC70EF30 Bp8Pf
343,030,682 *22422D2CD9F8A70107A626F91873B02CEF8D7D35 Bp8Q8
343,030,683 *2248B6A6838CF41BCEBEAADECD472876EA0AFB8A Bp8!Z
343,030,684 *2246947CA93BC3907E94DB9AC9F61492C4DCF02C B&P9i
343,030,685 *224F96E32B9B19A4E8450ACA718AB0C8C020F8ED Bp9/r
343,030,686 *224258557192AA1EE991E864DBDCFE0A46F9F73C BP#9S
343,030,687 *224AEA3A60AB7B4204073B31832002F4D0277632 BP9Z:
343,030,688 *2246FEBCA210C9D633332047B59399D094E3A74D B_pA
343,030,689 *224FA1B757DA964CB22534D30524CD88803E1DC6 Bpa+)
343,030,690 *224E4200E994D4312D4802B3A12B59972A189F32 BPa#3
343,030,691 *2247425D90E7538FF09F07B8325D45A7F0F32936 BPA.4
343,030,692 *224E9C15250207080058F867A5FD14BB318173DF BPA8X
343,030,693 *22459262B979055A545F2115CC11CC30628D3E41 BP/aG
343,030,694 *224D680D7BD3EBBBA8E80368B570F9FC33911CB1 BPa;j
343,030,695 *2249F92285D5425161CF6EE7DFB071E4E639DF20 BPAj2
343,030,696 *2242667A0BF441B23084C4DC53CE40168BAB6022 B!PaL
343,030,697 *224A35D692C7AD987199891398D8CAD189D9DE2E Bp"Am
343,030,698 *22410D2C63F2EDAA1E3DA257E243A88874020060 BPanp
343,030,699 *22432C6CD1D1667C488877ACCCFB2F815D81AD28 B:PB_
343,030,700 *2244CA67117ACA5106DE7077B49E5929495FEE78 BPB+?
343,030,701 *224E973F1F20FA1DD63CBEF0D5A858A011D77B2D B!Pb!
343,030,702 *2249E017FBB4B172DB1FDD4A8B4982868BB2B218 Bpb4S
343,030,703 *224A98E0A4C01DA2898EF0604C6DE21DD66A6FA9 BPBc"
343,030,704 *22453CACBCB3DBF29FEA28D59FDA585ABDE6B5B7 B(pBe
343,030,705 *224A8A41F7C65DE42E36FF6B89F6A102E97E4B25 BpBG7
343,030,706 *22442479A6BD6D4E9F150D9482809D2F4C6FDBD5 B$PbU
343,030,707 *2243439D76019EB292A452199A2AE5A0E688D4AA BPbue
343,030,708 *224E7CD4EC9326A1DA5395070FF7168416AEB00A BpbUL
343,030,709 *224A9996A1231A833FD31A279806F34D2B1BAC99 BP!.C
343,030,710 *2244A651E123A50B2DE8F66B6C8683BC52028DD6 BP-$c
343,030,711 *2240CE1A42638867FFF6248DA3FB21A59B34DC97 B/+pC
343,030,712 *224F66668C8D555B6194166F290C87432B94A4BC B(pC:
343,030,713 *2247B83F8DD9468BCAAC8494E2AADA15DA9221B0 Bpc2L
343,030,714 *224D500A13D18C8FE03F13CE0C63DC7D58102C5E BpCjq
343,030,715 *224014224722F101AF684AEF1341B824E8D10D42 BpC)K
343,030,716 *22434FC9A6A296A10C89D8BE44DB44E8E4CD8E77 BPc?n
343,030,717 *2245DDB9C5DC361AF48A1C987EF64308626EE9C8 BP_cP
343,030,718 *22447E84DBEA614147D2830613F9468AF6682FFA BpCpU
343,030,719 *224AE6C07D4B7745950982EB7B1B35F5649C8B5E B:pcS
343,030,720 *22417B41C523656C8CF377811B96BF8AC5CC9AD2 [email protected]
343,030,721 *224E8C10392414148AFC633DFB8D88EB36DE7AEE BPc:v
343,030,722 *224F176EE3574F2AEBAF5A94C56ED58BB5421EB6 BP_CX
343,030,723 *22478B20A6AA8EC000AF01E1DF3E71FF36992F81 B_&PD
343,030,724 *224FBC2844657FAD029959486794F59F29898BEC BP&d+
343,030,725 *224F32CBFCB1BFE83798ECB5B57943CEF5B2CDC4 Bp:-D
343,030,726 *2244AFB9DB89AF10743BFC4E757E4CC05852DE1C Bp/D
343,030,727 *2244547C220BDA49974C8ADA6A33A2A683027FF2 BpD01
343,030,728 *224C7908325BCCC1D97B5E1F83E303E7E26C7C4E Bpd7,
343,030,729 *224E3A8E86EBA1F6246BF14DAA0EE2B2946D2D53 BPdC3
343,030,730 *2247E466E73A0CBB2177B7D53227EEBFE2CBC57C BPdEG
343,030,731 *224DF0724477AEA5B1BAF5E695878E03BB2C9607 B&pDf
343,030,732 *224A02FB6677FE6684B44C4048A1827CFE421968 B&pdi
343,030,733 *2245166FBE4C3E98A17BCCC2DF034238A8007D4E BPDP?
343,030,734 *2240F734D8F5BDF26358DDCF53C0182DFF2EBFFA BpDR4
343,030,735 *224BE132E2EC933058669BBC33B066AE998E5800 B&pdS
343,030,736 *224910AF23208C40CB204FFCFCBFF6336E1EBB96 Bp&dT
343,030,737 *224ABAC3849F5BCB734C48F15673762072F62568 BpdZ-
343,030,738 *2246B927C3A8CEC5A996C554EC2938FC925958B0 Bp-E%
343,030,739 *2247DEFD2AAD143E3DCDD5FA2FD57846B348F31D Bp",E
343,030,740 *224C1D46A83CC12AFFD95B56A2FBD6F3B3F4E663 BPE-5
343,030,741 *22432200E2F43AD03A4DBEBD690B7609B9E529AE BPe81
343,030,742 *224F9A4B9B4DD36798C266B4AB1D5A1E7BD76DE5 bpebblesing
343,030,743 *224796F4E61B36C84D9A82A3FCCDDD1CCF5EEF78 BpeBR
343,030,744 *2247D7061F08F2D0065B5615AF63F9FFF1D5C7E0 BPeDe
343,030,745 *2245169BFF1FDA12F08F25F5096A8FCA1385638C BPEe?
343,030,746 *2242B92FF03849FECCF22E2D5DA5F980FB7E7A2B BPeF:
343,030,747 *2246159F271706204646225E5306BFD85E10DF20 BpEL=
343,030,748 *2240BA11A81D75EC7263D080085A9F4F32C31906 [email protected]
343,030,749 *224BFCF9891125733DDBADF9FD862F68E63AEE44 B-pET
343,030,750 *224915CEE29A1D69E1429F2BAD33B69B0D571605 BpeTA
343,030,751 *2245AD36507C5FDB3739CD0FEBE132A8E5AFD8B4 BPeX?
343,030,752 *2245B243B1FA866854EA2090F86507A683D34A42 B#&pF
343,030,753 *2246BFEB86FAF13EE23CF7376AB3125CC8ED0184 B;%pf
343,030,754 *2249364D4EFA92C9A12C889D99D8829022C6A617 BPF0N
343,030,755 *22469B64ABF117004DCEF8B7AADBF8BC7B20CE35 BpfIS
343,030,756 *2245FAA665A1A839CAD4B987D85FBF17BBF9A045 B,pfL
343,030,757 *2246A0FA7272D7009E6546DFF5A4D87232EBFE5A B:pFN
343,030,758 *224B4554106D8715D1F99E3240CC4B019F207C59 BPfT#
343,030,759 *224FFA6624C902EC0C39B456654FCB5DFAC227FB B,&PG
343,030,760 *224A32E2D69E28B3CCD5E0322ABBF791F48D76F9 B&Pg%
343,030,761 *2241DB1C7BB9253640AA948F39E1E31AA337CB3D B?p,G
343,030,762 *22494F36BBC8DD89DDAB7ECF6477CDE29036DE61 BpG)=
343,030,763 *224532ABCBD6E421256BEFEB62B694651AAED0E0 B:p#g
343,030,764 *22463316D1B2E133115F84D9167A6DF079E035A4 Bp
343,030,765 *22447E482905BDC1B9EDA1D8691CA6423B1D0147 BPG&6
343,030,766 *2249C17B5C61A9E09B8B04F2B0CE78FAFA0705CB BpG9!
343,030,767 *22414A4E2CC1EF3C28B812B37A32B1F157F7A3AD BP?Gd
343,030,768 *224EB91FB1A3ECF4AB2EC55DB714D54A4806F134 Bpge:
343,030,769 *2244B3D1D4B271082BE05F8D016D1647E55A018D BPGg$
343,030,770 *224F137A10E9D10B6E61F9DBB3BC2A4272FB2796 BpGgK
343,030,771 *2248C8EB39DB1F63E61131FAFFC753B208EDC945 Bpgo.
343,030,772 *224DADA7B7C1E330F5228578CBC65BA2E1D98AB4 Bpg/V
343,030,773 *224D0CF23988E9BAF56135EAAF215E28BF549799 [email protected]
343,030,774 *22472729325AD2DB3B824686071AF1E1D9092533 B)?Ph
343,030,775 *224F82E7FAFA13EBA427634A49AF27B45703AC24 Bp/#h
343,030,776 *2248915D2D59F3197670B8E8F5630ECDD42F771F [email protected]
343,030,777 *2240AFEC745691F49EC6722B4439B7686A602141 B/pHF
343,030,778 *224BC08E63BE576D5CE811067B867B085938269E BpHgE
343,030,779 *22418523F816A785306B2294326A6DB1C8E4BD87 BphiW
343,030,780 *22474B4BF31E67567192EEB607BBE41969E6A7F3 Bphlbbsw4
343,030,781 *224BCF949634DCB3A4BF4F15C2E477DB15A6D007 BP?hW
343,030,782 *224A3A46549259B9995BE191CDEF9AAA1652DA25 B)P;i
343,030,783 *2244A34B73C059AB17B979D710773E80FDCF6942 B_%pI
343,030,784 *22436FC3C3A62F7168C048A0F3F095863241E2F1 B#:pi
343,030,785 *224288A100926E8FF8615B9E7B8AD1CC8D0EB07B Bpi?:
343,030,786 *224DAD3193853E940D5647626C1057D51C829314 BpIAk
343,030,787 *2248AC8758AE1A6D22D8F4D05BF55C303F7CF5D2 BpIhj
343,030,788 *2249589FD20F8948A46D0AEA75DC74DFE515C645 BPIQG
343,030,789 *224FEB72372A1E0E2697E2AB80B307CB5B8A21FB Bpi+T
343,030,790 *2247FC0FEEF4A1C3B8A4DBFFA1A72C5F8C8BF1BC BP
343,030,791 *2243A2FC0BD79071FB400B211BCC3BB76FAC6726 BPiZ/
343,030,792 *224FA9B6F69EBCC028CBE615C1ED6979DA826438 B?pj
343,030,793 *2242F77845D05BE3CB373CFBF2C1C3A28201075E Bpj!&
343,030,794 *2241B26D28B834A53148837BEB7A0C03EFD395F9 BPjjZ
343,030,795 *2248B696F107F804BB9C3986320564EB088A3507 B.pjQ
343,030,796 *22456C8B547316CB13C522E7C1B9E062A1DAA7C8 BpjQu
343,030,797 *224E1762A3DC640E025D4F32B1F2906BD12427C1 B)P:k
343,030,798 *224A9F0E46E268C9B41BD72CB7698F7533EBD0D9 Bpk0r
343,030,799 *2240016D7A9A78E67888F05F11D05EB5700D9125 Bp?k3
343,030,800 *224128E4234C0520A005356FD2B62FA0B1E5E5E6 BpKFD
343,030,801 *224E184189D899CED391A1EC964C471EA8F82FC0 BPkhV
343,030,802 *224503860CC4ECFE949E909E5947D86EA28958B4 Bpklobsw5
343,030,803 *2241811980EC0B540664A177F53718AFF907085E BpKo4
343,030,804 *224F46995FAE429103019AA54FD3CB99AEFFCFA8 B%P!L
343,030,805 *224A16945D3B4298EDC62E3674E095D43161A476 BPL#.
343,030,806 *2246F3BD1BF25D029FD0592C26B8B85C3D205B05 B,#pL
343,030,807 *2249245508F5743E5BF0BDA80EA0FD9315C53C63 B,plD
343,030,808 *2243C2956BB54200A018EBDA3A77D45F3FBCA819 BP(Lj
343,030,809 *22446A26C8E797BD63FB4349138C0DA6B4DE73BD BPljA
343,030,810 *2246D5A5AE9FB82A2C05720B8302E3891E778EB3 BPlK(
343,030,811 *2241B58E8CFF083152D7078B2B28671BCBFAACEB BplKt
343,030,812 *224282AFFF78BBB5CBD5459736F42B6C71A75B98 BplmW
343,030,813 *2242045954B0A030229FF33A380424997179712F BplN9
343,030,814 *224395AE9CEE682BC7AE895B1C17D85F8E9DBE75 BplP8
343,030,815 *224FCAE4C9B832A65A9B0F7E9AC9D8588F3ECCEC Bp;lQ
343,030,816 *2242D0D52AC5A11C45D8C4E3186C646EEC815DD4 BpLrL
343,030,817 *2247FE270D5F37F7D078C900F066BCC2115022E5 BP+LU
343,030,818 *224B1C0A6505BD076B85DFF1CB2C1633FE8E1834 B-P,M
343,030,819 *224B28EB2FEA54B475D993D295A7F83827573DE8 BpM&%
343,030,820 *224C85872FD0D8B4D28EC921E6F1AC40C93D3F55 Bp-m$
343,030,821 *224F8828EBF72FE1826BCF8A15129FEBAD29E904 BP&M7
343,030,822 *22454B951108BF408B626F044B35AD5F86CF12E4 bpmanky
343,030,823 *2241083BEB29C6A7E3D3CE0E872457AA6C686386 Bpmf!
343,030,824 *2243B0E6B810B5183456BE6EC0370B02B77EC699 BPmLf
343,030,825 *224B1395C33A7F8200A492610A4F6239F88FAB35 BpMZ:
343,030,826 *224FC04DEE25C8838D51F2BABA0241A4F5F97D52 BP#,N
343,030,827 *22480D211CBE765A85E15ECA3714C83D342CC918 Bpn3Y
343,030,828 *224032A82C82F0FDE1DA420E3EF5F2A484369C18 Bp_Na
343,030,829 *2245DAE6D4FC37154D818E0690D0AF8BEC31EA3C BpNCw
343,030,830 *224CDFDBCA449E9D31743946D54F2E5BA5EA17D5 B/png
343,030,831 *224CB8077E283D738F7ABE040F710F75679C86EF BPNH4
343,030,832 *22466D7067240A0413B8041CDABA52B82099EE83 BpNKP
343,030,833 *224F7C9653327E5936C184EAFD31A27B9EF3C30E BPn?T
343,030,834 *2243BF155F4ABCF3DA1A1BFDABA90E0CC72CF659 BPNvW
343,030,835 *2240CC736B48F4C21723D34C5A3F57ADD1256F56 Bp$O3
343,030,836 *2242510F222E313D30667E7B72B2A2D77AB0A87B BPO58
343,030,837 *224AA0D40458894A44C83336DA0DC3EB05B0F145 BPo5h
343,030,838 *224F41CB8D5A4447450107464AFF23BE6DF7DE77 BP!oh
343,030,839 *224D1A2CFAE3378B0C2DDE127F5147061E9AC875 BPoj3
343,030,840 *2246F271CDF80F3B5285538763D0BCA269CF1C25 BP"oM
343,030,841 *2243EF13AD39F68FDE6F0CB2CF33747E186299F1 [email protected]
343,030,842 *224A3FA74A1342F15B48AABBC38E0A2A0E132CE7 [email protected]
343,030,843 *224D3F3FE72BCFB01A58A7B528B6DEDF97B0533F B_PoU
343,030,844 *22426E7E1BC1F48AE42AFD02EF2BAC3629BAD4EE Bpo.U
343,030,845 *224B6FB236D910F394830DA5C6232FC8712EA132 BpOuT
343,030,846 *2249D872BB7CCD3CC182363F3E3B2009EBCFA939 [email protected]
343,030,847 *224920C5B0EF2F0EBA0152FE4F4441154090E780 B-POWERSMOOTH
343,030,848 *224D7FCA9DC1C1B5D9BDF4D0BC667B3F5B8D087A BP$P.
343,030,849 *22407874B00565769A03FC012C66A07EA84FEDE6 Bp?/P
343,030,850 *22421E8568CD3873CEE2FCB7F056C4819AD2D1CC B;PPC
343,030,851 *22404B8375207323A2BAE204E01882C7C4C48DB3 BppC.
343,030,852 *2244CDE2E2AF2AB9A355B85EDD24686210689F2D B;ppG
343,030,853 *2244CE41CF249C2054EB2C730FA0293715A4AD9C BPP(h
343,030,854 *2245120EC14A16E0FAD607289494A440E2BDED15 BPpH3
343,030,855 *22458A03360339D4C35BE6CE371454E973AE2C83 BPP:w
343,030,856 *22434CA1225787326324ED5C3E23658E41E4BDE1 BPq-"
343,030,857 *22443D6AFF7D4CC8EB10221ED7403E5D9EA44B37 B&pq%
343,030,858 *2242BAE474245E76E8B5AB2C7CE5E2C35662F1B2 B;Pq1
343,030,859 *224DA070F2AC670A9BF7D29D612B9B97D327D0C8 B
343,030,860 *2245CD726956E7CAD3FB1EB130EB3935DF8E757A BpQcB
343,030,861 *224CF8638D78461D89823EF36E27957A51A77FC4 Bpqi&
343,030,862 *2245B4A2094BADB27B110D1B12919361B03BC598 BpQ)P
343,030,863 *224C988D9664449A3E24BF09E40102712EC53F51 Bp&qS
343,030,864 *2246EC1C7D6549CD5B422357A09ACEDA208423CC BpQY#
343,030,865 *224B95AC74AC27403BA37FA87864E06241074440 Bpr1C
343,030,866 *2244EAEAA8D81E220C519AD8B7B512A90645F3E4 [email protected]
343,030,867 *2243774EB38335990D9B2E3D7D84F1EC41AEA056 Bp-r6
343,030,868 *22468BA2AE0990048EA22186D7DE8384F2CCD0AA BPr9!
343,030,869 *224C9CA4EB18103166DB266F1EED30946C0763D3 BpRcF
343,030,870 *2245A11E6B571CC0748D0152AE334D6989A1359D BPr-G
343,030,871 *224A0C4269A9F687FA5B69916C4834C8A75AA9B9 BP(rh
343,030,872 *2242B79283B174E98E491F38424AD2AD38F309ED BPRSp
343,030,873 *22422DF8D8D8A02A214750D8963B90A578AD0689 BPs0#
343,030,874 *224793A6B73AAA76FF4D561D996866B18E47E6B7 BpsFV
343,030,875 *224E87140D43E9CFEAC06D7DEDC3B138E3E829DB Bps/K
343,030,876 *224045EF63E43AE3F86340187679FBE3BE78CB73 bpsmbsw7
343,030,877 *224F428A98E679782A19C85C4611090FA7A83B96 B:P-T
343,030,878 *224F2DFBFF93FC9C4636DC77A103FA1848A18EB7 B.p)T
343,030,879 *224C90D3236F98C84C0E7C0CC3EF62CD8386FFEC B&
343,030,880 *224AF520C9BC4C17DAE1AF88383084787A504314 bpt6k2012958
343,030,881 *224C81B3F56A3358EFC63D9450239D4477217DDC bpt6k202272q
343,030,882 *22477D1A1D096440E935157D7CBC1184DBF5D4AF bpt6k64151b
343,030,883 *224A8ABE6EBE8C244D262AC56074F610BEF65A96 Bptd_
343,030,884 *224F1F16AE63F1C9AA097E4C35E83A61FA63E490 Bpte#
343,030,885 *22499DCC4C42FF9AD3FB9E4A5C57591010BFEB5E BPtfw
343,030,886 *22495587A466DEA8B9F6D1D53BB3A4756B37F6E2 BPT_l
343,030,887 *224AF6593DC02E00C7D5A7B60D425DF25982A9DD BpTN3
343,030,888 *2241D7F04929015E3513E525E1D46120A2C8C882 BpTQY
343,030,889 *224230485F4DF92C093F128837F82279F52CD9F1 B"PTR
343,030,890 *22480200E28E869B22EEC1A6082463287732498D BPt!T
343,030,891 *224A75A7580B9BF740E2CAEFC77C2D993B11ABFE BPu##
343,030,892 *22489465217DCD96CF49B4CFEEAA2EC479265089 BpU+
343,030,893 *2243BF76997B76790BA8B70F7A694005545EDB47 Bp)-u
343,030,894 *2247507678A7938019EF8F2CAACEA312861D996C BPU0m
343,030,895 *2243AB8AF3C41885757493366AECE8F85612D3CF BP$u2
343,030,896 *224F85921C6E6FD8B70EE88E6B59B77E4079FC82 BPU!3
343,030,897 *224FD67194D400AF129DD279ED5DF858D302ADB6 Bpu7R
343,030,898 *224FC34F2C1D07A03B7CE1FD1A3491EEC346235C BpUcC
343,030,899 *2244F903244193E615BFDB33C8C3E4CAC44723F2 [email protected]
343,030,900 *2245C279913C48B992140B8D2FC7F7B00815F635 BPUCKETT
343,030,901 *224A0A3EF6B0269C57E1E017FD53662F29D71992 B-PUI
343,030,902 *22425EF2B7934DCE3530F6B2145D3D45D4D2E0E1 bpukcabs
343,030,903 *224B8B98F0369FB18F9A9A15618A3D7E234E4020 B(pUN
343,030,904 *224DEEEBDD4FD99E43B729593B4F8C60B1623229 BpuP1
343,030,905 *224589B20CD22FB69C036CB00F87F6E2570CE7A0 BpUUP
343,030,906 *224ABC891A78654F720FFC7B04462862752793BA B%Pv!
343,030,907 *224ACA744628D5D26EBE8701076201198B187D0D BPv%!
343,030,908 *224744D503D6B17ECD5BEB853EAAC652ED536882 Bp$,v
343,030,909 *224031D64BA53FE2C24CB391C2D1199B992E3E8D Bpv!7
343,030,910 *224C844E744490490E37E9B8B230E025515F3C02 bpvenezuela71
343,030,911 *224E77877FF0A78521AF55F0D7BB7D5ECC2EF692 BPVma
343,030,912 *224E359813464B8B07F108144E11AAD245BFAD4C BPvrj
343,030,913 *224440A921497984C30B50B0ED48A30323336997 B?$PW
343,030,914 *22448BE424A0D007EF25B05876CD212DB73F0507 Bp_W;
343,030,915 *224E44D65C43102BF4127F4E72CCD814DF9D8F73 BpW/"
343,030,916 *224A2AA0C790C4DB191483264507BE69BD4883C0 BPW5
343,030,917 *224D487D60A15C183312A7B432DEB98E6FF59A4F BPW5c
343,030,918 *2241D06E0383A5E39026B6BBE90BEB0D28E0AEFA BPWcU
343,030,919 *2242C003C8F210DA85D5D74AE63A9D3D990DF8EC BpwN5
343,030,920 *2246F45EE6F10ED4146DE5C503F39D67E51B671B BPWQj
343,030,921 *2246E1B7EF1E5D697CA930B395F9C878BC625B36 BpwT6
343,030,922 *224294CF396B0B01C392986DC5582E7CD53B0ED9 BpWynn
343,030,923 *22445505C5F9F18F620DDD8BBE26BA357C933B7D BPX#/
343,030,924 *22496204035CDE8FFB8006C41A398E6D0D22E728 B:p-X
343,030,925 *224B8EE54EE9F175FB463ED9E1955B80868EFCA2 Bp")X
343,030,926 *224D0D24D15C670D70BDCDBF4896D82A746ECF4C bpx123
343,030,927 *2241DE00A3293D09673421BEB476F5F7F34346A9 BpX3P
343,030,928 *224C7288BBF94F86D6F6923E9B6CC86E0B6D2255 BpX8B
343,030,929 *2244380D790432C42285C2ECE6F602FC1F986BFC B;pXA
343,030,930 *2248E4F180A7A11E1D77ABA35A4860B675C91133 BpXbg
343,030,931 *224D66C7DBAABAF0D28A21209B4828019474BF8E BpXCj
343,030,932 *2246FF13C14395E7BFCB53BC626F381E3DD8BBD9 [email protected]
343,030,933 *224AFBB16E4E27182C2CCC300576A9425451BB78 BpX"U
343,030,934 *224EB7D06693BC949EECC2B7AA326A8EABD57275 B()PY
343,030,935 *2241BDEDC29EBD5FB17322A101123B88D633B3EC B
343,030,936 *22427E0F2B3B8CC56C4D30704664DF83FE40C40C Bp_Z0
343,030,937 *224A52C089BBD65352C2F422D16FC5E3C5F24616 BpZ8V
343,030,938 *2249C375A2100B2F7C0D88983EAF6AF1912A684D Bp_Zb
343,030,939 *224A9350B3D3D085E9DCF0D694187D753ED5F083 BPZFL
343,030,940 *224CDBE87EEEA6E61BD91963223A471DCC7537C6 BPZS-
343,030,941 *2241BBD227AADA3FA58AB540373C2639858A40ED BpZS8
343,030,942 *2246B18BF277904A6FD0290DF4B5B7F1493C37E3 BpZwK
343,030,943 *2245D201CAC10210ED5DFBF104D8F097F6D0ABBC BPZZT
343,030,944 *2243B629ABAED7DE52F0D7F137D17084ACE3D763 B?%;Q
343,030,945 *22480C889DE59DE989BC6A092A28287E615B6EEF B/.Q&
343,030,946 *224DCD06C34D5BDE967173EF9481F6C5076234E0 B"#
343,030,947 *2245FA83F6DAFF4CE2208AD53E22BC60D7AD518A B"Q_
343,030,948 *224CC07EF62388675470E978E3728B6E84B5748F B(Q#,
343,030,949 *224F0737D196A82633610321D02117832CFCA3A7 B#;Q)
343,030,950 *224FE9FFDC373FAB61C5767836034426606E521C B%_Q.
343,030,951 *22419AF8CF9D56CBFE6D2C801BD648EA35323438 B
343,030,952 *22455AD93318E94CC314A7EF3D641302649EA9DD BQ?&#
343,030,953 *2246E6AFA4DE8D8914E3FA18DECF27CDF7EAEC10 B-q$=
343,030,954 *224A7EB4D3C1A304A8C07616F3444D5E698B88DE B/&:q
343,030,955 *224EF78C69E72A27E54404E3B0C632310CDDA581 B%,_q
343,030,956 *2249EC6BCECB4330B6847024EAED0155C1F96F8C Bq;;?
343,030,957 *2240E72EC9015CCBEEE2CA032ED9341B3FC93F5A B#q0
343,030,958 *2247729B0CB67E571B9CC82944190AADA6222C3C BQ05"
343,030,959 *2243E6D432D9638864972B28685DD8F5E5C46A8A Bq0#7
343,030,960 *2241040CB416769A1CE9EE2F4D36AE738D0F337B B;q0b
343,030,961 *22457F45D293DE35E873981A4B96C96C4CDA1702 Bq)0N
343,030,962 *224BBFBC50917B73B506080856926459226DA6D7 BQ0uF
343,030,963 *22492BE32EF5E2D3F61209B7DAFE22CA5B526194 B&+q2
343,030,964 *2241ECA11396C11F1EA10C0F44408449EC41E85D BQ2(2
343,030,965 *2248F2A9601D21760B35237591A09F060737D4B8 BQ2CI
343,030,966 *22406E0920AE6C1277EC5C36452825778B69BF32 Bq2n:
343,030,967 *2243DBAC077517C86B38C195390F4B67DBAE3BD8 B,Q2P
343,030,968 *22492CD9F6CFE897C1E88BC20DDAF1BB8F31D138 BQ2&Q
343,030,969 *2249E9207770CF12A0B0A4D946CBA1AEA7C2386A BQ2Wj
343,030,970 *2241859C1545BCC9C357A2A5F19371C30357E22C Bq$2Z
343,030,971 *224E5469DBFDFBDD3714E1B51BCD6772031503CF B&q3?
343,030,972 *224DE8BD5907E0AB1739167F5E17F4734F7EE815 Bq#3B
343,030,973 *22415FD6B2BFDED00939222944A1216B0826C11B BQ3Y1
343,030,974 *224F1F10D1E02568D61A850DF822BC5EA5F5BBA0 Bq&;4
343,030,975 *224BA341209D3384E86A738C2368B99D9A890A2C BQ42_
343,030,976 *2244036F030E89EEB03FF73E2532B38A704D5DF7 BQ4)9
343,030,977 *2249F24204E7ADEFAE1171B72800369F2B96FC8D BQ4C)
343,030,978 *2248763DA075F9E6C9D4FC1F037C98B3D13AD75B BQ4#o
343,030,979 *224F04FA94E03EA3AA909CB0B636366E2BE2DF31 Bq&6C
343,030,980 *224CB3168B59EB15FF112566F71BE1E44DB41E36 B:q6U
343,030,981 *224B5D47F43BFC7C412310CD41237054F38FB368 B_+Q7
343,030,982 *2240C2C0C0A0D220FF129E26782E39F2056157B4 B?Q#7
343,030,983 *224AD2B18CCE11841F4A389BF9EEBEA6A32C93DD B#Q.7
343,030,984 *22414D2D7CDE22F753A8951F2C099FC4D5CFB5EF BQ7A,
343,030,985 *22468429D538EADA40F779793383B9578C7C88FD Bq7ah
343,030,986 *224FD99D987128D07BAA2A6B62E32AE7F8529A43 Bq7)e
343,030,987 *22451310A4B05F778B9E3178C62EACC371369ABB BQ7GC
343,030,988 *224455546BEAD455F2BDA0F8DED35580485E9C12 Bq#7M
343,030,989 *2244C42792FD295F80CB5655D0220D58A30FDCF2 BQ:7o
343,030,990 *224579A6B9B1F1D9AF05E49D4F7019A723540421 Bq8OD
343,030,991 *224DBF2CB1836BF343E063E2559EEEC046D1C847 BQ
343,030,992 *2246AB4C2ED6D57C704AC2058E800FC927D11D04 BQ9/=
343,030,993 *22406A4AB7C9123114C69A3E20FE189A82C6BE89 B+%q9
343,030,994 *224DAB31B991D1E9CB2A7085AC46CB6264DE7609 Bq9=?
343,030,995 *224FA197AAC2A8F3404B274B550561E79942EFAD Bq/9D
343,030,996 *2243298C42227348D68F79E41DECA47A9A780B7F B&"qA
343,030,997 *224F2EC7FBE67A92F45D366F0EED265AB320CDA7 B&qA
343,030,998 *2240D8BCD1DA1481E8367C2497497DFB5312B9A6 BQA5o
343,030,999 *224B607B7A75BF89EAB14F7E90A7F540F3F21181 Bqa9%
343,031,000 *2241F8E405C07138B31DDBECAEB22FDF4BF1325E BQa+c
343,031,001 *2244C8FDB65255C5F25ECE9B31D3B0D68F36D0CF B,qAD
343,031,002 *224969B0DB88645A4E57B48842951EA9CC0D0DA8 BQADG
343,031,003 *224FDBC1939CCE8A692565D11D6AAB1D72B45DFA BqAKk
343,031,004 *2240334F5E4BE10E4FDC6ABA74F65E42B49EFA26 BQ)aq
343,031,005 *224EEA1B4C1461926C38A7E97FB39D202299870D B=QB:
343,031,006 *22444A8EB9AB5FE8E9F447C8FB621AB4DED9B48C BQ!:B
343,031,007 *224F665643D8C619EE49AF2330AAB033E122D52A B}Qb
343,031,008 *224E6D78073DBAACFAF33A768BC746C715B29F89 B%(qB
343,031,009 *224B05CCCFCDF2E829B98393C1D7D8731FB68C07 Bqb6.
343,031,010 *224F18F067983132C319EAD2A5A7FFE9BEA40590 B?QBb
343,031,011 *22454440B422A4D670B81C05028129126441529B BqB.K
343,031,012 *22414840891AB60776A6CB16FB8D6FDC5D1C4ECE Bqbpu
343,031,013 *224319D67A8D04D6495F85A69F9B41D68765136D BqbZD
343,031,014 *22476B1E417F085F70C261A6AE96F7C81A60DB87 BQ
343,031,015 *224483CE87EA97CA25F834CCD7A14936FB2D090F B=:qC
343,031,016 *2248B8518C6113881F3640AE097F94F696C4C4BD B(qC?
343,031,017 *224AF0EE2E66FF3B79C0766C9A7A30F571892351 B_.qc
343,031,018 *2241EC2C7B3E3E8301A126FAC592F56C4304E8D4 BQC
343,031,019 *2248BC4E282089330ECBEC6C66568FC324BCD6EE Bqc#7
343,031,020 *22472C6050BEC0BA5EA5FCF7B0E4B1FB754A5D11 Bqc.n
343,031,021 *2242E07B796FEA796228F6F816A48086F15FD398 B$qCO
343,031,022 *224643230EE8806921D7AC1EEECD4213AA22CBD6 B"QCQ
343,031,023 *224AD27AC5100A6F6A26E1F94E01CF25BFC5F3C9 B"qcQ
343,031,024 *2244940DA1B8B4FDE3F1AB64DD8B09CB389E8749 BqCre
343,031,025 *2242E9559FDF9FAE56CEB86704A5CED4C430E336 [email protected]
343,031,026 *224CE9551875A1C04AB88734247AE1B944DCF2F9 [email protected]
343,031,027 *224A891D7B58C848B513B128F6521C2EBFA90732 BqcYG
343,031,028 *224A5A87824CF656CF72203DE3755495670D952D BQD=#
343,031,029 *224AC66EDA53714653B3037C8CAC30D242AC3FFA BQ&d
343,031,030 *224838A02B60A62D11D2FF28431FC3084EA247FB BQd&"
343,031,031 *2244517E71B2AEAFB38E6A79EABF5617071B8067 BQD&1
343,031,032 *224AA43A320E47DEA7E1D98BBA85D6994DA8340B BQD8C
343,031,033 *2247A260D0ACDDA6CFC8936F4F0EDB64F935D32F Bqd&C
343,031,034 *224ED2403AC062D19201AF4DCF32B2BC03A0717B BQDC2
343,031,035 *224B87529288B38DDEB7565D7CC5030183232AAB BqdHZ
343,031,036 *224B52EF7F5B3847C7823DF62375932D1C188980 Bqd(P
343,031,037 *2248592AD5110024112EA58B49B440AF6F52F8BC BqdpS
343,031,038 *224A81B8A212EA6588B045A79F1B310D98C75A2E BQdtB
343,031,039 *2249AC8F867AAC0FD6098140B57546986802E473 BqDwY
343,031,040 *224EC39EA0123B371687CB090A63C3AB54C44A77 BqDZV
343,031,041 *224785CB96F9E7E8514D619FCB833167248877D5 B;Qe:
343,031,042 *224B748F8024795CF4405404A5C1153435BD56D9 B$q#E
343,031,043 *224C75E71E74388E735F4EF69D9A8070533F04F0 BQE=6
343,031,044 *2245A2EC2B468305B07A6E24C85C8BFD64855632 [email protected]
343,031,045 *2243EBECEA7E710D59B3FF76059ADEBBD61B8D93 B;qEg
343,031,046 *22435A86A32E77690E01BBD65B1884EB4378EC25 Bq:eg
343,031,047 *224D929717DA04003791EF04E0EEC63B971ADA30 B,QF#
343,031,048 *2242939569DB8F74061D6B3B6F9468F6AC04B7F3 B+Qf"
343,031,049 *224905EFB4AF387E98AE33EAC1ABC2B97680E2C8 Bq-f.
343,031,050 *2247DAB3A6D29B85CBFAD62093430200E02BB55E BqF9V
343,031,051 *224E9DB4F544413F9C321B58E91C9852782B2ADB BQf-a
343,031,052 *2248D6E485A04C015D8774F83625D2734110776A [email protected]
343,031,053 *224381BCCFD4D58AF5BD85DA90D22C720ED39D86 BQFf0
343,031,054 *224275B8DDC2D427DCC0F6C80DA552125EBC18AE BqFIe
343,031,055 *224C93CB0FE03341062FE90F980ACBC37708D257 BqFrR
343,031,056 *22406DB4C391CFB6002DC58E41B0E756DAD1381B BQFs:
343,031,057 *224D79FF55D7246F0423C9FD0B826380FFB93631 BQ-FU
343,031,058 *224E031190B5803FD6F61158A50659B2A2300716 BQ
343,031,059 *2249D2B55C8E8F2AD7FC9EFEC2AA956FC3A56C32 BQFYm
343,031,060 *224E71887FDF03A122158D39D67918D2B066E04A Bq_FZ
343,031,061 *224FD03BDC5304FB838B029205A78CFBD4B8C714 B#=QG
343,031,062 *224BC62F8B51537A4BE06D40570A7B2731C11640 BQ-G0
343,031,063 *224A4576FBFBDAD5F9EBDD64FC23DEB04236E199 B
343,031,064 *2248B93E0CD39339687AE5EF7D68316AE91B3C80 Bqg3r
343,031,065 *2245A3BE39554DC94C97E7EDBE3A31AD339ADA36 BqG6l
343,031,066 *2241A86B58A5690DEA6F57EC59E72F3F37460757 [email protected]
343,031,067 *224E6FD839607DA9BC3C2E871662E81CC92A9CE2 BQGed
343,031,068 *224E3C901769291BE6441FCCF84C5734B83F4688 BQ(gp
343,031,069 *224BFBC4B09F870949DF719379A6E93DF98D1FDC BqGSi
343,031,070 *224FBC9BF9143E9E174BF3939D69A1EE98BD8303 BqGWj
343,031,071 *224F3EC530CCB31DB415829B6AD9811B13FC653B BQgXe
343,031,072 *224DFD530D9CF47BBD3E5AD263C52E156BE59143 BQgXW
343,031,073 *224BA8E0742D03829038F0A24956209562DAAD66 B)Q?H
343,031,074 *224D7AC55F1D218BA7BFEF746DBF8FA3970EE8BD B&Q"H
343,031,075 *2248D4688D923C275B61833FC6D337C161EEB498 B&Qh"
343,031,076 *224367BCD4BD409F1B49A50D4F8BDF7A820BC6AE B%Q&h
343,031,077 *2249F11186B4C0400B61A1EBA49CFB9557CABF3B BQ)#h
343,031,078 *224AA969B05C1AECC02A46809D69813551DEE588 B;q#H
343,031,079 *224CC52F6E50D3748953C4FB1FA7135FA9DAA22D B/qh-
343,031,080 *224B600C2FCD31770D4831B7EEAB7A4ACB459EC7 B.Qh2
343,031,081 *22465136185B2A99826272B294BFF45944DAC3E8 BQH87
343,031,082 *2247F70D7B24800B83008833827B1CD7435FAEC0 BQhKH
343,031,083 *2245C5E9A96AB6BA18934BA07B493FDACEB1A894 BqHM;
343,031,084 *22459E0FEEB1D555AE86D760EC79392333E07F16 BQh
343,031,085 *224AFC4FD1BB8914DA88235737BE10883FB1790C BQ,hR
343,031,086 *224F75F6898C25264E457271F015A84BAB1C6A33 BQhuB
343,031,087 *224F0C29FA9280C1EB4D1102021CA872EFEDACF6 BQhuF
343,031,088 *2240B49EC91A58C6C1707D2E2834C20F9E6ADBD3 B(Q%i
343,031,089 *22495E142D01185BC23B17FA5CCA0933D0925ECC B_+qI
343,031,090 *2244C9796A92285080DFEBA75B713E704A2E7335 Bq==i
343,031,091 *224734C74ECE43706AE8F1AEC21A93468DE060E0 Bq#i"
343,031,092 *224AB763011DD707A8A49791594685289CE05825 Bq%"i
343,031,093 *22434BB8FBC8C7091CCEA1A4849C59320CD710D9 B!qI1
343,031,094 *224FD771FA32AC20D26FA383F943C572FD45EA09 BQi2m
343,031,095 *2244110B036922A34DFC95003BB5910156F79541 BQi,7
343,031,096 *224B6C9F3625ED1B045C432538B2D97A66318429 BQIGV
343,031,097 *224B6761623E4EBA6CE84B9B29C56B9C51A8F327 BQih;
343,031,098 *224456618FC9EDF5ACBD0DE043F460EB2AAF976C BQI"l
343,031,099 *2244593BF4B9FF3C1234C386DD5B667780200D8A bqiukdwyvw
343,031,100 *224C5FB1E571818DA1A321CE0CA2BBF072FEDEDD B(_qj
343,031,101 *22472AF4339581342267BEFB50B9297760597C7C Bqj!%
343,031,102 *224DC53027B1926E633B0906B4228E7459825A2F Bq:j7
343,031,103 *22471F98A145234FF6133F2D5541C5823820B9D6 BqjB)
343,031,104 *22490DD436355D06566D2AE7809B3B789A69C41D BqjgD
343,031,105 *224EC49119A701867FD4EF5A836838A63D630C09 Bqjhj
343,031,106 *2248A0E01E124C1F43F04877550BE53D24E12A71 BqJp
343,031,107 *224EDBF057BBD4819DF870FE6B0852097365AA11 B&qjR
343,031,108 *224B53DF0BBCFC779D934BC7AD7073009E0EAC9D Bqj-t
343,031,109 *22443E43F9D472F7ABD1F96C92FCE6E3D433056E Bqj=v
343,031,110 *224038D66407042C11E579B6E826DB508A1E2DA7 B!#QK
343,031,111 *22464DA08B463C5285636314A260AD020AF38B52 B,Q(k
343,031,112 *2248A7C3C7E26A1247E8999CAA302D588BD10D2C B(%qk
343,031,113 *224B37B28390E59ADF6E8539488231C5ABB63A94 Bqk_0
343,031,114 *224C0A6ADD4C425D56C8F618F478462E68E7C916 Bqk4i
343,031,115 *2244EA1C71F410B8B370B68D9DA22208C4A068BA Bqkab
343,031,116 *224C7895F486A99DD1DCB37DFD002F724275350C BQKbD
343,031,117 *224CF9107198646E209FB465C2216B334E31D81D BqKbQ
343,031,118 *2244544E3738A3F9F3E49D6FC82E07746A659706 BQKen
343,031,119 *224D7B30CB857FA9EEB136A4693C369B53DBBC4C BqKFP
343,031,120 *2249BDE4430E3B86CE5269D0FA97A93A43ED1A57 BqkGY
343,031,121 *2244FBEE083D7563BC2F263D3A57B61190255A8F Bqk;N
343,031,122 *224FE94D4884A9BEDC8081BDD16F371BB34D2574 BQK_W
343,031,123 *224A7C5B8FB3127D7804B87D90A01F50C185E329 BQ
343,031,124 *2247F91E541363B0271C2A8D5B071544910E92ED B-:qL
343,031,125 *224DB3A467FCA66AFA89AAC6E4BEB2A530C22274 BQL6)
343,031,126 *22406021B2B9B09586F9813DC296A2F866134ADE BqLe4
343,031,127 *22477E926EFD7E723D32699ADD6AF4371177493F BQLEh
343,031,128 *224D367A91CA1CBDD75882588DB6F2CC40842E3C bqlino589
343,031,129 *22401611D96066235D80449AE02021AD2D58C88F BqlRP
343,031,130 *2240C0CEDBDE676A24BAA86C18CCEC1C1030073D B=qlS
343,031,131 *224A995B6D865F6DD667835DBB43C3333106704A B%&Qm
343,031,132 *22494154C84D03F5425493A4F07220A556026128 Bqm0T
343,031,133 *224FB1E8561CB70056A4CE3A028137EDC77AC1B1 BQM2-
343,031,134 *224373158F97D708DD8940AD1AD1EDA8BCDFA81D [email protected]
343,031,135 *224B9038D0B8A48C3629825B48CAEE18C1FFAEF6 BqmD+
343,031,136 *2247CF2C4AF46E8AA0F92C62598B1DAF2E7CA0C5 BQme_
343,031,137 *22486D61D8806344BCBFC0F9E3303F845C2C26F6 BQ;mg
343,031,138 *22416AB65B58D6875B2819C309BB036D5384F487 Bqmhb
343,031,139 *2242ED45B3440B55BCF076ED01914577E1EEF1A0 BqMQ;
343,031,140 *224A93ADAE34747D206D5B9603F25673C5F8FA39 B,qn.
343,031,141 *22470957D9C449887A491A86BEDADA936A9EFF20 Bq-n-
343,031,142 *2249EE0E437C0345B7D1239AEFD289F7175CBEB5 Bqn("
343,031,143 *2246DF02B17CCE5CB1C53993145517322037F070 BQn4P
343,031,144 *22428A2A5131430BB44D8F5942EE193146EC6268 BqN"5
343,031,145 *2242B131D3819D51D1A910A2CB9C518F6CB5FFBC BQ/n9
343,031,146 *2243BC0676D7B063218625E6DD4B8B60D8FBBF92 BQnaF
343,031,147 *224BCA1F7F64076C2ACFA27D5FF15E69DB485CA6 BQ
343,031,148 *224EA5097C56DA65D0F319939A6861843777B1B0 BQnG4
343,031,149 *22478E912BBC6641A72FA9F8FA9B80D354AA6593 BQngw
343,031,150 *2242089AEC8710B70B18BB579786336965D2D79A B;Qnk
343,031,151 *22414CF2E87D43DAA860A2E023D43058821B5F44 B&Qnm
343,031,152 *2248894F8F6350F969760EC0893319A513524D8A BqnVI
343,031,153 *224DED75C74248E93D647ACF64975579F1C0BA9F BQNXn
343,031,154 *2241C0D68D5983EFA736D5D770B60B0F0571E6A0 BqO#!
343,031,155 *2245D925541F892B2A1A819E669D5A2DDD65B87F Bq$o,
343,031,156 *224B0DAE026142B4F76A9CD90EF1CB151140A698 Bqo3E
343,031,157 *2245B6AFCE0213F4D4C89DC635389126D4A2BADE BqO4q
343,031,158 *22478E6FD7899D8B68EF6F888747914CC51A814F BQO8.
343,031,159 *224E25ED3637B26FBBD4BC1E74F2181C2B77C1C5 BQoit
343,031,160 *224E6BCBAB7CE7901067A27C10BBF930FE625A2A BqOjj
343,031,161 *224754F33EE357815D70402084A5C1DCDF51D56C BQomk
343,031,162 *22452317DBE9158ABD93C29A2EDB82B964E8F71A BQO#P
343,031,163 *22424808BF0223DC79A33FBE6A803E17958580DB BQoP+
343,031,164 *2247AE7794D1F22BDF62600961FDC46C290A7FE6 BqOq;
343,031,165 *22471D2D045B45FD9CECB4E210E91558677726E5 BQ)ot
343,031,166 *224165D8B838EB6FDF18EA34DCA8239BD9C473E8 BqO(U
343,031,167 *2240A380EBC2366DA38CED62645F5F6884300D3A BQOu6
343,031,168 *2243E651890B4601A245C2A32756B8F4A82A731E B:?qp
343,031,169 *224AC033CD41B87900F8A7C943C39DA6A6E8219E B)qP8
343,031,170 *2245ECE78F09E3DC06F893655580EB6EE7FCEBC2 [email protected]
343,031,171 *224346469C9CCFE389CF73D6AFE7F594A8D2D986 Bq%PD
343,031,172 *224D6B66AB11D58A92107E98D8038D7CF18DDE81 BQpg&
343,031,173 *2240207E977D63B294AA88B355BA5150FA797207 BqPRF
343,031,174 *224B19108997EA53C7EAFCCB2890B9330F4B9C92 Bqps,
343,031,175 *22497A1E992F42D5A4B128399747C27126150957 Bq-pT
343,031,176 *224CBA2802E9B2F240B264409D814080B9E8F54D BqQ0"
343,031,177 *224E5B79EAAAABAA61A129307431FBF135CCE5B6 Bq"q2
343,031,178 *2241C128970D7033691B42FF7A1911ABFB6646FB BqQA_
343,031,179 *224868B43D9528BD458E868952A43C213A300EDA B%qQd
343,031,180 *2247B4FBD95618D2FB7DCC13080EF1B2A411686C Bqq&d
343,031,181 *224586637F7D8C3EC19E1AA20389AD6D67BBA83B BQQeL
343,031,182 *22499AABFB42319E919482A1817311CC14944A12 B)qQR
343,031,183 *22441C66419C26DFE49D49B09AE209D8A7E144C4 BqqW9
343,031,184 *2242ADACFD8606034770200CE548D0CE398996FB BQ)-r
343,031,185 *224432AF6026C040188B127FE6CA187362804C85 B,/qR
343,031,186 *224094B73A31F16ACE591EEE1F7C4C0445585A9E B"q)r
343,031,187 *224EE56922CC34F61F4AB991B82410F35A1FDCCB Bq/r_
343,031,188 *22416FC5DF2A0939D1EB3971EBB53E36FB1CF90B BQr4P
343,031,189 *2247B1B1407CC2CB1AD5046D7D122EF6790F9819 BqR!b
343,031,190 *2249B86055D6857C8DADEDE682C26765E8970039 BQ=rc
343,031,191 *224A94A5F5C3611232CE9CAD2662EFEEFED9E29A BqR_G
343,031,192 *2240A0B1CAAB2D655185C531D6E9AB69A43EBFC8 BqRid
343,031,193 *224D535B6C5972E756C56BA2DBED5FE9F5DF82DC [email protected]
343,031,194 *224C066586345A0470D03F2CC673A934FEB7E15E BqRpm
343,031,195 *224227257994CAB9907435BEA5E56AB008F45429 BqRR"
343,031,196 *224FEDD0E4967C7013C432F209DC05AF051B4305 BQ(!s
343,031,197 *224310C098D337AB11A4F4A18EC8DCD3B8ED7534 BQs!5
343,031,198 *2245EE56FDE76FB3B60088CDBADF8C0E63143CA5 BQ$SB
343,031,199 *2249CF52773E61DE503A3A2C6E620C8C4FAE4F80 BqsCu
343,031,200 *224FC71955EAEB600B9EF73AA30238597F37E2C4 BQSh0
343,031,201 *224854D5E55D257BDCA9FF78514912A4BD6D49DF BQSj2
343,031,202 *2242B1BA7200111E3AEE15D520865442988D8492 BQSKN
343,031,203 *22418B2E8F9BF35BBF843357F82578A6E77F352E BQS;U
343,031,204 *224222FA0B2B6A02200D120FE347299F788920C2 BQ(T/
343,031,205 *2245E8A8D5B7080F8D6A925930492C7F219B4558 BQ
343,031,206 *22462F50A306290FA48485295DC5EDA63EBFE707 Bq=+T
343,031,207 *224932E7B610CA2699A1444E04F349989486047C BqT&-
343,031,208 *2249C13B61C72AD4C0DDF621FFA7A9E75622F1CB B-q;t
343,031,209 *224D7B09BA50A2F3BDF641CABA60CD80EF976E0E B&QtB
343,031,210 *224321F48A67547E7B4BF93FAE3F5FA05C1F8B16 BQtKb
343,031,211 *2243894AA13ACCC0730C0E9B6E2EFBDABE2B9A09 BqU.$
343,031,212 *224B9A1387CF1678EA301541BD70390657D023E5 Bq;&u
343,031,213 *2242E2C36E54B04D4ED7034CC54155F8C0ECECC0 B:QU9
343,031,214 *224E0FB810A42177B25B8EBAC433BD882BB9FFDE BqU+g
343,031,215 *224F9D165BFCD940027E35062F26F8E0438E18E7 bquinby5
343,031,216 *224C61C5E370932F74345E5104F740FD8B513B01 Bq.uO
343,031,217 *224A26F6A957C3C4F0654B328A6EF2072232CF5F B$QuP
343,031,218 *22410326D986C65B7084AF18F88694AB9EF287F0 BquSE
343,031,219 *224BB1F46D35E455490186812AE797C7E5A3DD53 B$quW
343,031,220 *224FC8A37A37E1BC0CAF8C5A857C9B6F7672F5AC Bqv):
343,031,221 *2244A0D8F1DF4DE31F02E9612CB463ECC3C5093C B:qv7
343,031,222 *224FE9967730A3DC1F5068566BF34153F6190A35 Bqv9h
343,031,223 *22461EA0C0F36641B089140747CAA2691BB91A90 BqvE-
343,031,224 *22455F97FAA2C501889DE03897D73A4E34B6410E BQ$vF
343,031,225 *224603CFC4E9AA204C4DB67FB8BC9AFACF96A92A B:QvH
343,031,226 *22444570D8AECFFF79F809D5A9187F690D4D778C BQviD
343,031,227 *2249F70240BCBD7F9CC1A2EFFAD059DB2F85D5E9 BQvMV
343,031,228 *2247E4405A1A27C8413D029879A97D080813B8C7 BQVoo
343,031,229 *224D45F78379AAE94486DA030B3405DEF29A1FD4 BQvq5
343,031,230 *22432A6DF910EDD8F11F3116B8A2328E435EA046 Bq_Vu
343,031,231 *224CA3D10FCBB9C8DBD17D60C68361DE2BD65D6C B:qvU
343,031,232 *2247313706963CDBFDE2D90E181EB2D107726EAE BQvwf
343,031,233 *224852D676BC44D403A5FE2B0815B4FB9E5CD120 BQvWr
343,031,234 *224209185F101590E4EDE031FAF3991C49DAE317 B=QW"
343,031,235 *224D24EAC7F842268488D758F1F1EBD80D8BD397 Bq":w
343,031,236 *22420A3843D078F2AFC074B967E2A01A54CFC044 BQw5A
343,031,237 *22439C6DB886BD9157AAC9F3D73DAC247493F9EC BqWB
343,031,238 *224D38E79BEBF550CA12EECCB62F78FF34CABF4F BqwCr
343,031,239 *2241FB7590F04BEDBDC651534786C1865733306A BqWD
343,031,240 *224290279CB1E2B93D2165C512D3F5C3C19355AD bqwe04
343,031,241 *224DB8AD4E9D72B83C265FA4C6478FD9906CB39C B
343,031,242 *224E76E8BB391FF1E08713749F715B76A4414FB8 BQ+Wn
343,031,243 *2240D3BC33BB3D2E17BC96EE513ABE2AB1C96DCB BQwr#
343,031,244 *2241F599AE88924679C3EC0BDCD77519EF979B0F BQWTR
343,031,245 *2243F0EE3BE31F24060E830B290CF550BB63B933 Bqwv2
343,031,246 *2241E3B3275F99865DA98D545CEADC8EF96D7FF1 BqW;Y
343,031,247 *224CB06EE845A16124A44650E3CABF2BD938020C BQwY4
343,031,248 *22437802FF33F5AE25EEECBB960E028EFB6261F4 Bq!X
343,031,249 *2240621EDB1346F262F4A7A8BD20CFAB9F581F36 B)QXm
343,031,250 *2245C63455FF96C9F575ED56179EA54E34811CAF bqxmbsw3
343,031,251 *22477963CC2990197DB9E634A884A28BE3CA8105 BQXp)
343,031,252 *2243A977171C275FB606EE3BF53D57B7DFE02533 BqXt"
343,031,253 *224AB05ED7AE3E87A4C82366E79D1C29C5EAB398 BqY.9
343,031,254 *224D86C5E0590F01C9D1A5F870692AA33A05CC3B BQYbK
343,031,255 *2245577F262E1A811394C0B44DA45636F5B42C4F BQ%Z8
343,031,256 *2249C3446592617730D2225B19D5689A371D2001 bqzhvwona
343,031,257 *22440EFEB913552009D8F205B7C8C6D83A6917B2 BQZTI
343,031,258 *224DEFD59BD4E3D396118BA5A16DFA59EDE2976B Bqzw
343,031,259 *224B00E7E36418B2E7466001B13EB15A561196C7 B!R)+
343,031,260 *224901CA4CB23CC85438FBEFF4C812A7FD54C88A B/R%$
343,031,261 *224FFCE6CAC5BE783013631450613BEB3306DF5B B*%R
343,031,262 *2248AA5F14FE9EFB17973EACAB90F4281FDBC5BB B%?R.
343,031,263 *22415447284E23E4C7E00E08B6676D39EAE942F6 BR;
343,031,264 *2242647A8A44F5B56FA62FB95E22D6E6F7624AB0 B/r<
343,031,265 *2249316D8F92E1CE85A11B6FA5C2E024D3E22A7C B&&/r
343,031,266 *224BCB5A99E55AF5A82A75D2E19D89B8C59BD956 B&r?;
343,031,267 *2245A0A3A0D93BFB0689A26C906E2A9ED5A65E17 B&r/!
343,031,268 *22473BEA0A734089D1126E4D4BDDAE9EBB925506 B+,=r
343,031,269 *224F9293BAC806637E408969B00F4EC7F6F97B62 B
343,031,270 *2240026EBC40C146C2D8A8055F8C8FE2A7BBBF7C Br;"=
343,031,271 *2246D35D10DB115E0A0D735D55F75548CE9F938F Br]!
343,031,272 *22477B89C7EE15C7D790BE40CB7B1369F7DB448A Br{.
343,031,273 *22474D77B5959F1BC0B6A213B7527303053BAF12 Br+/
343,031,274 *2245286A2A72B9083A3F2052EE9C83DF38A4A398 B
343,031,275 *22403D8EDDBB3DB1EBCDB126C2470B998F8AD5B7 br0ach tu
343,031,276 *224EC154F73466C3002623082EB4DEDE01ED0F95 [email protected]@s7!n9
343,031,277 *2243BA91C1E4E6A0E5EA186E9BC9A67818615336 br0ken-pa
343,031,278 *22422FB320289C3708AB877B848849514CDC58F7 BR0/L
343,031,279 *2241A8733D6B8F7BA95D699046CC4B3640B44BE2 br0nt0saurs
343,031,280 *2243E83E652AACC17E09FE72D7B1B4C0989C3F87 br0nz3r$
343,031,281 *2245B09512688313F24DF7F21C11B0286BD70F5E B:r0u
343,031,282 *22467D0C61B2B3233D9BB2CD9F477080AA0384B8 B)R0v
343,031,283 *224FA1F49118B31632174FE033E5F56E833CBC1A B#=R1
343,031,284 *224BB825FE43DE7365F73E4F22C7FE9F260D8152 Br+#1
343,031,285 *22409E97B45859FA9EB387B3837F26D57A0EDFC2 BR1+1SHERS
343,031,286 *22400397A5BF06DEC42637931954C72D03C87A78 br1dl3th
343,031,287 *2247ACA2106E368B82670C0C1A415589522672A9 Br1-t4c2
343,031,288 *2247C976BFD837BE3B1C88E2319F0DAD22CBC696 BR2GQ
343,031,289 *22473FCCC57834A447222E7BFAB95FFE99A57620 Br2Vl
343,031,290 *224A4DF42FBB1417398C1A9ABF47487B15733B07 B!R3++4
343,031,291 *2245ED5BB732215D86E78E8DD10201D9BDF09356 BR347H13SS1Y
343,031,292 *224C33E06054981042BADF97155FD4982A49EA6D br34lloc
343,031,293 *2243F2BD2CAE8B12A01FB6034907E17D5F754F70 Br3,9
343,031,294 *2241F64BD355C0955B13A58324AEFE88C2023FE3 Br3adwinning
343,031,295 *2243791AC28DEDEF7346053D9EF2E6C48FB3B70A br3as7s
343,031,296 *2247D8F8180FB2D97CA0E387B448D746CD4E77DE BR!3M
343,031,297 *224FD53C4FCF04D112350F716504DEE9DE383D44 BR":4
343,031,298 *2240E4284C3E7107DC6AA1C115EAF83DB2D8DEBF BR$4)
343,031,299 *2247DFE8C561B5409F3B6960C7156C052179D795 Br41N
343,031,300 *2240BC2963982761DFF8819C251399E2B5147036 BR45i
343,031,301 *224B3916DCE47683A429BDFC0A388111C41128E6 Br%47
343,031,302 *2246E7B3DA99021C1B0585994457192E893D99E5 BR4ce
343,031,303 *224DB2F20733D3BD5EDE7C6AF4F1DCEF0DDADA84 br4dy4cous14
343,031,304 *224DD312121EFD3FEBD5F71F3BFF15319331673F Br4in-bre
343,031,305 *2246127BD4C03E33F9B3CA8EA3E685574DCB717D br4nchin3
343,031,306 *224C8F0BD7E2E7D3C75C88B46B21E88A2623E31A br4um1ll3r
343,031,307 *22450488EBC11A57AD5CE0031B5E224E748757CF Br5E6
343,031,308 *224024D9835C9B7FB6209FBA399BD7F35462A855 Br5m;
343,031,309 *224A8AA789D511CB6CEE93C5AEC22E22D155F7C5 Br5n?
343,031,310 *224BD4C90643B090BFDC9AAC6D5549B0CB18998E Br/5P
343,031,311 *2243C24B097D94EFCA373C791301A6F705481779 Br5.q
343,031,312 *22425862260D96188E3FF4E4C477DE124846FDAB Br5
343,031,313 *224330BEF4C87A5D56884F4B5DB784E4DD29C271 B.r6n
343,031,314 *224C2614078A415404D3CAD1E7A62A075EB09ED2 B(r6R
343,031,315 *224E17F99C706267E6AED1D7DC59AC2BD092D328 Br"7&
343,031,316 *224C9BF717A6866AE3D5BA5D14D0DBA91686DEFA B;r74
343,031,317 *2248F84DCD424036D87EA2A317286409A8B9B6A3 BR7nl
343,031,318 *2247E18F69CB7A8129FAC5393D461EC079071BFD BR7%o
343,031,319 *224C3C1656A01AA8CA6001EA442B5859DD080DBE Br86m
343,031,320 *22455EACCD83D080E36495AFFF9BADE1A38CDB1E Br8GV
343,031,321 *22414BBEE43749784206A5E401EA1D30A5DC3C25 Br8%Z
343,031,322 *22420158016088D5F232C7E726CC7DF6F6066DDA BR9+!
343,031,323 *224C7BED93AA2851F6D97C2ED59A34B9525FE480 [email protected]@1n33
343,031,324 *2249FD462C077598C8E66735F822836ADA83F017 BR9
343,031,325 *2244455C28F6E1F7C3EE5F959539DCEAE75ECADA Br!9h+en5
343,031,326 *224D0137935EA1EF7FB6EAE19B2A0A2F69D97572 Br!9h+s
343,031,327 *2242561AE6E46C6A3C26205BE2B6D799C586739C Br9Tm
343,031,328 *224D7F95E3FFF26597336481E98E5746160AF5F2 BRA$
343,031,329 *2242DD0F62822C4955BDEF56F59627A73A08966E B,r#a
343,031,330 *22436ED5CC585D281B52E0A6311E02FAB2DF6FF5 BRa
343,031,331 *224862FD250AF46536E219CE38785AF7D4DBA644 BRA!11ED
343,031,332 *2247A46DDD952053FBA09A93A547A9C18411944C BRa.7
343,031,333 *2242C93039D8563D0CBD06183B1F82BB26DE203D BraAf
343,031,334 *224D70A736725863B4079890B3321CB28481CA62 Braallian
343,031,335 *224B19B687B0C50D7BC67AF1045DCE215795177B braam swart
343,031,336 *2249340EE74943BBA501C5373F2ED2FA8CEECB02 Braănescu
343,031,337 *2247D7998D8ED1DE7C2814CEB668E67C43C768B7 brabenecbruno
343,031,338 *224924735EC255439E5BB8F60E5B040612829AAD Brabhaming
343,031,339 *224D29B14CE670D93B50543C103F8840D7207239 brabinbrasero
343,031,340 *22459452A61109A96D0E3EF31FAB3D0D57255C24 brach1nus
343,031,341 *224543F7F7C0CCC0A6F522C6F3B0D53613CC25D6 BRACHELLE
343,031,342 *224B9BB7A1F1F3C42B363DDB419C8A256D943721 bracht)など。英語の
343,031,343 *224A5956F6DF302202BDDCE71AFD75586B03705D brachydactylia1
343,031,344 *224EA7B88159F76B181C9050592B03477B3FB2C2 brachyo1
343,031,345 *224A497402739B045725808F873FA0FAA54143B8 brachypt3rou$
343,031,346 *224BD51255FB28067AC0EE7ADDD477D5E3C7C1C7 brachyuran5
343,031,347 *2246E10D11B269312AF03F0D227BE2F164BA79E9 brackerjan
343,031,348 *22485C2707510D776FFBCAFE3899B178004FFECD brackwas0
343,031,349 *22432B1E685B9E8F74A25D2F66C189C145B6F99C Bracteae8
343,031,350 *224F78B758666A35EE65BCDB68DD3927552168EA BRAD1723
343,031,351 *224C5CBAA4D65A6CE5E90EB8E7B1C542A8477161 brad2000:compaq
343,031,352 *224885675938D36A279B52A53012949823603F18 Brad6973
343,031,353 *2247CEDEF789A8A102186BA62ACC53F780ECF2F2 brad.arcega
343,031,354 *224FFD364D035FB585152C9B44DB8EB589B882AA brad arens
343,031,355 *22409E937CCB00FE3085F26032434BE92A8F86F6 bradatom3
343,031,356 *2245E5EFD667ED8C0BF8E47A7E35BCC2B57A9CEA brad.becnel
343,031,357 *224EC2620FF7E5380A61842E80CF9BBBFE42FB7F brad bollman
343,031,358 *22419DA3E2D04289F9564D556B42C2E047275B61 bradbrad6
343,031,359 *22417D3B02A5E3AE6E9F5DB44E4AFA182DBEFC1D brad.brodtmann
343,031,360 *2241DB64F1408D55F5C4B15387F939C26E419234 Braden087
343,031,361 *2245E8B3BC5C8721AB34458D34E25DF5ACF807C1 braden714
343,031,362 *22444AC74AB32BC29B14181809842418B0828A72 bradere2
343,031,363 *224950C055948B9390C4AE38F1CE215BB35A04EA brad.etherington
343,031,364 *224C8B79AB15E426074E4E85677BB3AD8A426A62 brad fadden
343,031,365 *224348FEBD6A571C52786A9E261B426EB13316EB brad.fitts
343,031,366 *2243BFF60147F84AA38742862D2B8645ED897BA7 bradford.alexandria
343,031,367 *224E79066E8769BFAC0B47F4075CD9281C9C7C62 bradford.bazzi
343,031,368 *224758618460B4464D928AF69B7617935088D677 bradford.benwell
343,031,369 *22471CCFF6D1E0CEBD4472EF47BF118F45A3CF79 bradford.bousum
343,031,370 *2246DA2338B14FA92BD4E0E4059D198BBFA55AD3 bradford.clure
343,031,371 *2247EBF3B72A4EEF35120CF54986AC98A9560C90 bradford.cronic
343,031,372 *2248B7BAE7D9DD0E968322AC1398DC6E508FDF6F bradford.dergurahian
343,031,373 *22407E36257951FC24BEB5DDD8F9983700B77B09 bradford.douvia
343,031,374 *2247E1A952B3E2654C7BB0305DF11633A86A31D5 bradford.durkee
343,031,375 *224CFE20DBEFE75CE468629968A6979B6C0910EE bradford.edes
343,031,376 *2242CDF3912532092CD6FFCEB3DDDAA857BBAB87 bradford.esters
343,031,377 *224F3C3E995F7941C00437B284E9E1F69A5277E4 bradford.evey
343,031,378 *22468A4B5A2EB09955849E3816677A794B86697D bradford.hiemer
343,031,379 *2247C46EED86E3F56319B169DA005D80F9C85B49 bradford.jenquin
343,031,380 *224B7FE16809C6FF3E3043984124B139BF8D2DFA bradford.jiran
343,031,381 *224E6F64A7C9645172E3C71B8444B7A44BFD2584 bradford.mardini
343,031,382 *224815908B23EDB64513B272554FEECFFE21B709 bradford.melamed
343,031,383 *22448F403B3AE9499952B3EAD67365F8D9F08677 bradford.mespelt
343,031,384 *224A92FDF1B621FDEAF594C716E087F2A8D9C5A5 bradford.rubin
343,031,385 *2240EAE26FF7204049DF0F446966DA8DCDB9A51C bradford.runnels
343,031,386 *224074977A6AD66CA9585B584C1F1F5935BDA656 bradford.starnaud
343,031,387 *22455F3AACAF6E793E9160A72E70528A434CB043 bradford.tamez
343,031,388 *2246501951596792184DD357C3E1417988126C26 bradford.topolski
343,031,389 *224ADAD308F16D0C893352BC4928151437D24E2D bradford.weavil
343,031,390 *2240D41F52B80C9F86171E9E825664982D30A113 bradford.wildin
343,031,391 *224237737F58B5D550629A6476D7E4082C8D1041 brad.giuffrida
343,031,392 *22473F737096E9041B8364B1F7CCEE33C3E67EEB brad.hinojos
343,031,393 *22443EB6DD5150188B7332B36ACA72E4EDC73FBC brad.hyder
343,031,394 *2240F62F5E97CE7F258F62A30F8A5DD2DF3921C6 brad.kennelty
343,031,395 *224566DC97EAE2D595E32D3DE78CBC99894BEEE8 brad.keppner
343,031,396 *22417D251B8E68680D7EC0C69AFA04D403151648 brad.koslosky
343,031,397 *2240989FED13E15FBB84B830A4198DAF2EDEEB05 brad.kron
343,031,398 *2242BE08235FDDF8DC77166B71D55CD72BD8E45E bradley067
343,031,399 *224666408E2A02F49B768EE98336DF6DE9C88517 bradley.aggarwal
343,031,400 *224D55B8FB866A99630486EC5D78112289E7A21F bradley.auber
343,031,401 *224EF2B222FC38D9BFC8FBF89E95405128148FA4 bradley.banner
343,031,402 *2247389D4A08CCD9CF39B62858D206707D9A9DC6 bradley.bogguess
343,031,403 *2248BFE84B05BE9AA2F8D780F589C9B63B1C3F18 bradley.boyne
343,031,404 *2244A293EC534CF3E0E3164D8AE7885D722838ED Bradley:bradley
343,031,405 *224AA9DCDA6DCC8D2CCD54C54D0EE76EBAD68C2D bradley.cappaert
343,031,406 *224B2E90E2EE291BA2ADBDF55C3E36C0589FF806 bradley creamer
343,031,407 *224EDFC3200AC4DBE99E3B3BAEB50FED57EDE40C bradley.dildine
343,031,408 *2240C463539086D5918E0FA1BA93EC50EBB33489 bradley.flanary
343,031,409 *2242B65C5CCB6CC57EF476DADF8D1225311E711C bradley.guffey
343,031,410 *224146D2F8E0F974DA157D3E3C5394F6CFA34F5B bradley.kayrouz
343,031,411 *224B60DA348647F1704CA56EC6755D45F27689F2 bradley.lonergan
343,031,412 *224751CC119FE1D638ACB7E172A8179D58789E76 bradley.masseria
343,031,413 *2243E962EC0ABC5882E9B7A063850AFBC24D5837 bradley.mcdougald
343,031,414 *2241AB1AE11D1CAEA004F84B8E7DB9BA0EEBDD65 bradley.mckewen
343,031,415 *224A8C1C84A036F454593D9A9D4EC17A94B2411E bradley.obanion
343,031,416 *2243CB0C1E60BDE1B61D6F2B73A2DA65AFEB1D87 bradley.otey
343,031,417 *22444991A8449444289B4E1269695E4505D97B75 bradley.prigg
343,031,418 *224233C3A27480C7926749D5137ADE945FE563C2 Bradley Steven
343,031,419 *224D062CF23C91F0DE1C051180D52D797F99DBA0 bradley.tomala
343,031,420 *22460E634F2CFF726BAB4F6EC94DE25CAD02D929 bradley.wasp
343,031,421 *22452B400C4EF18DEE42264BC2935BB4D4132F14 bradly.benassi
343,031,422 *224802CEC6B80620AA7466811BC7BA0E6FBC0303 bradly.carbery
343,031,423 *224347F21EA957D7E6089459DD40DDF93F2A1B0F bradly.cassone
343,031,424 *22439B7747385CF6EB7B732BD494A2CA86A416EC bradly.eveland
343,031,425 *2249430264936D85EAA22A7024544FC6C68A04ED bradly.gonsar
343,031,426 *2247943FC9DB70AB743B40E032FC09288292F25E bradly.gooding
343,031,427 *22448117F92735EFA01AF5D5C50BD25592D5E3C7 bradly.herner
343,031,428 *224C8F6A562AACD780D5231E927486BB3AD30CD9 bradly.hodel
343,031,429 *22429F9720B5D07A59DE1265559B6C7D8D9F8B90 bradly.lacasse
343,031,430 *22441C727505E494D921306BE36084B312CF4867 bradly.leidy
343,031,431 *224FD7614B4103DD0BC5F6792A145235B265CDF0 bradly.magaw
343,031,432 *2242EF75CC3300EEB85990816337BCBEA70BF84C bradly.mercier
343,031,433 *2248BA461A37F34677682235499A01BEB8754247 bradly.molpus
343,031,434 *2247195BF2A0F055B7B4389B8CD5361678CE310E bradly.obergfell
343,031,435 *2249DFD3C5AEFCDE7ECF0D49CB7A93301032994C bradly.porietis
343,031,436 *224A0578BA983A255E4E0192F7D93F6469CE457A bradly.renault
343,031,437 *224279C0AA733E14EE40950B1FEED0B08D6B9DCD bradly.rothermel
343,031,438 *224F68D282A964C054754AC10D7921B0CE5E4E24 bradly.scarles
343,031,439 *2249F236E7D8A9F788DE155888318DCF450999FD bradly.senethavilouk
343,031,440 *2244F2F93EB401E484A88ED9FBE80149EFAE48DC bradly.shamonsky
343,031,441 *2246F60FF1EEB23378923990E47C0438CC1C68DD bradly.tomer
343,031,442 *224E3895D80B2460C472E4FA302DA64B7044E292 bradly.voita
343,031,443 *2246BB1A1B360DE3E41796A3E89DD36FC1DD13E0 brad.mercedes
343,031,444 *2249DABA2FE165513FD7A2B4752BACD5E3BABD00 brad.norbury
343,031,445 *224FEAF223AD4F407391BC3A614CCF3D82370F2F brad.oree
343,031,446 *224F78BAAE0339239CB48C20982F56608000DB18 BradParsons&HowardPearse&MelissaUttley
343,031,447 *2244DACEFCA36429CAB1F5DD15FB161ECC29CAA9 brad.percontino
343,031,448 *2241E8BAC582A94816FB229E3731C94FDC7FE2DC brad.pokorney
343,031,449 *224E1D40825D96DB9F9140BA1CC26049C6CB128C brad.prudente
343,031,450 *2245A0E649D99CE7A00644225539E821A7C6451F brad.raia
343,031,451 *2245EAF46CA57348716F2EB2A04AEE0FD62F6B5E [email protected]
343,031,452 *224C88306CB758BB96284D6087F26A90196F7F0A brad.shippy
343,031,453 *2249B032CB3018689488FCCA8F88FB4AA874FD64 Bradsmyl7
343,031,454 *2245A3ED35B7F6572B92CEF335368822D311FA13 brad.sonnenfeld
343,031,455 *224AC7F8FFBADCDF7A77A0AF91C4887C1FEC3C12 brad.stagg
343,031,456 *2240BAD697B202FC5617DCFEA2880E02AC1CB4CD brad.tappeiner
343,031,457 *2240B1BD76ABC1CD63FE96E458ADF2325981E8F4 brad.thibaut
343,031,458 *22478B84D69E9FD9AD63A184336087DEC167AC3C brad.travino
343,031,459 *224310D68313F4FD582AAC4F7BC0543A4287FF04 bradtreadaway
343,031,460 *2244C1A3024BD476E632AA09D9EC0109F7A9A468 brad.valree
343,031,461 *224995C71F26B1F6D6C5D67038A4835CF3D4D71D brad.vanfossen
343,031,462 *2246DB0564369317A60A1DCE5DAE166CB70B1481 brad.vautrin
343,031,463 *22470E619E40C73798A938465E9462E1A8F1976F bradwellvelazquez
343,031,464 *22415D920196AEB685427314DABCFF23DCA428DD BRADY21
343,031,465 *224BB562E9765ED4A52E101D2A78D55268AD4AD2 brady.abbruzzese
343,031,466 *224916D32C6141664DB2984E587AAB72409A6AC0 brady.bogguess
343,031,467 *224E1BFE5CD539E8C09EDA60FD970210A5784D7E brady.bonne
343,031,468 *224509E44E216BA2116FD48E92A754B036234F7D brady.buttari
343,031,469 *224B788CA8F5FCBAD75AF44AFFBDBAAD6F858571 brady.capel
343,031,470 *224F675CB0DF42BB50C7E2D567B8F5D13D6B4F0A brady.carnoske
343,031,471 *2246CD85287B60B9A6F6067D70BAE8D0AAB7C6F2 brady.cauterucci
343,031,472 *22480DACB77196C6B6CB994FA55EDF7AA5B149CA brady.cisneros
343,031,473 *22467555665A50E96DF18E3A0BE628DB26196EBF brady.debellis
343,031,474 *22466C9A905A818CC011215F6DD8CBED3AE241E3 brady.donovan
343,031,475 *2247A91687A24784F4D2B3FC5867E30AC5D96D7E brady.dullen
343,031,476 *2249417BFD9C4BEB6B7153EA8747E3AB76DD4C21 brady.dustman
343,031,477 *2240CC0005A66C5FA42D3FAC1416EC995F989784 brady.ellsbury
343,031,478 *2241C1747C46276BC447BB298B814D808133367B brady.freyermuth
343,031,479 *22409C833E9FA8ED7066EE01BB009F767779D11F brady.gacia
343,031,480 *2241F621B2B8F2E51CBFC710B4B6E54E286CE1B6 brady.glidwell
343,031,481 *2245C8988605906D8292C37D9E199EAD38900080 brady.lepage
343,031,482 *224C1097536D9CD0A2FED4B66E9DA2043FF9FA35 brady.marana
343,031,483 *2244DD3D25DEE2C2DFC8B4DA2D2691841837998A bradyn453
343,031,484 *224B33A31094BE16A6852B144AC4CD1386601D8A Bradyn525
343,031,485 *224F7CF03762106DBF46A86A2C47F5D18D43A91F brady.para
343,031,486 *22400CE1F1BDFB927639224A772690B0ACE703C0 brady.salierno
343,031,487 *22476D51397C16197BC8B7BC683499BC4CE9AD5E brady.sinner
343,031,488 *224D624FF283D3066AC421DB5D1EDDE5C823BC63 bradysphygmia?
343,031,489 *224598A9325F6C653823B02BB138F3B9C6B7C3C5 brady.sutulovich
343,031,490 *2247D8BE7EAB980378BEE573B1B135E9D1C0D7B9 brady.tarnowski
343,031,491 *2245DCCC6E713BC698934712A384B48776CBD28A BRADYTROPHIC
343,031,492 *224B92490693B210E062095C581C33CEB22C4F45 brady.valenta
343,031,493 *2246D9B8CAD7E366B7B69DCFD9D9F612BDC109B3 [email protected]
343,031,494 *224715E0C9B1F1B6E7BA1D81938A496C76F71466 brad.zapel
343,031,495 *224A1FF64A553EE9CF199C0A4DCDD6690F2CC567 BRAEFACE.
343,031,496 *224852C0E0F42C2CFB17178EDBE85EDF03D9D32C Braeff
343,031,497 *2244192BD63E86609CB51EDEF9A55B50C7C195AA braek91
343,031,498 *2247A0262C7242D278016C8467689AEF73175810 BRAELYN07
343,031,499 *224FA0252C31219D4BD769265311937A88D6AD2E Braelyn93
343,031,500 *224B0F377D094AA926E4F3058F35F5B67F1B6849 Braggad0c105
343,031,501 *2243E807D01B1DC7BC4A227A67DAD669D63F9E3B Brahemuséet
343,031,502 *2246D7E903880479A0401B6298F28276F98D1480 BRAHMADHAYAM
343,031,503 *2245503DABB35A6FE52DF7758AE5BDF4DBF409DD brahminsgsbwho
343,031,504 *2244A46148B2386038E2F0AAE7F9491F8CDACE98 brahmothsavam
343,031,505 *22481022F8A4F23836598245BDA4BC3DE4CE8892 Brahreed1
343,031,506 *2243C3A3C7952838D70B127FF59C435A4FC9679D brahsemed
343,031,507 *224B44F57465CEE7BEAFB9C2CFDC83526AC8772D BRAIDISM.
343,031,508 *224FCF8DD06CD8F93A6F56A74E80D4C344BD9F3E brain.arnoldi
343,031,509 *224A94C5D6F9843D8365898BADCADF4B3DFBE52F brain.atherholt
343,031,510 *2248A383E7125F83487A662F05AE59906EE9AF56 brain.bamba
343,031,511 *2246BAAC9C0966FFD4108BBF169F70E8BAD2DF30 brain.barstad
343,031,512 *224BFC7D7AEF066BC36CA3A389E5E53306BBC64C brain.buteaux
343,031,513 *2242ABC4AFA65CA941450A60A48DEB31C73B89F3 brain.carrillo
343,031,514 *2244528C3756A68B4E09FFCCE8988FDA005E69E7 brain.coar
343,031,515 *2246A9873000950300E206B53A6DDF17D81FED94 brain.corda
343,031,516 *224E3644BCB79BE3E6BBF409BC9B7CA2B0033AE2 brain.cushner
343,031,517 *224415383C3E8DED3CCDFE4A33D44A07EC2867E7 brain.diver
343,031,518 *2241B53980A5D05386926A49619949249022AD84 brain.fosler
343,031,519 *2242CE3C08D8145865D0A88C538871C94AF39033 brain.fuerstenberg
343,031,520 *224638A184DDC8EC0DECD1BABB0BF57FB218F814 brain.isiminger
343,031,521 *224185AB6C4E52B4B155689E542E535E6775B973 brain.kruss
343,031,522 *224126F13230D9978FE622A8DC047665678CBC1A brainmemorybullshit
343,031,523 *22416224AD2D3AAEFB8F4A99AE17B6C2F8D5B20E brain.muzii
343,031,524 *224812C143A8934B35DA033A99FEA5CDDB38F567 brain.neylon
343,031,525 *224646C18F9A75A08F3A72CBB5617CC6E8179E2B brainnt
343,031,526 *2244807CB93F90B0C454E78E0DDF5B699D33C93C brain.rollison
343,031,527 *22456AA80C84CF9CE4C3B886C5276555FABE575D brain.ruano
343,031,528 *22499A60DC06AC0F5B1D79CAE1CD9130D50A7913 brain.schurkamp
343,031,529 *2249680ED52EDEAB767ACF4BDFB9B41EF27D9566 brain.schwarze
343,031,530 *22427055799C2E44B5C4ACC64FE1FF202EC8B6B6 braintreetä
343,031,531 *22460F36D14BB5AD7C7C11A765317EF3AB433E5B brainwave7
343,031,532 *224F84883A25BB11391005988993882F54A05372 brain.wilhelmi
343,031,533 *22443FC6CDDFACA6B672964061A45C090BBABB19 brain.wunder
343,031,534 *224F8FDC9B0680D648040A2C7BC7711A0A4439F8 brainが手がけた。
343,031,535 *224AB01CD9ABCEC9723FB48D2BF41511DBFC646A Braithlies
343,031,536 *2247874AD83753C27B84F6A7983FB6B569364C0A BRA.K
343,031,537 *2248DE7C89C22D5F7A93A0BA3290D2A5331B72E4 bråk
343,031,538 *2248A522DBC5807851AD7B91DF7E3A363F725FC2 brakefield160
343,031,539 *224D38E9BECF3C6DD46E3FDD12CF4B5F0E6DE506 Brakiems
343,031,540 *2243F915507DF0F25326A31E191C3D05C059EDA3 Brakish2
343,031,541 *2240FD5D8BCC38161A1989C1EADB26D96097A32F brakkarb
343,031,542 *2249310B77DBCDD1ACA40FB78731C3A14F89DB7E Bralina4
343,031,543 *22462CEA5A62F868FC3738C0757BC890B9B51853 BRAM1580
343,031,544 *2247A69587808D8E3207C0265C90F0072C747190 bramanisme
343,031,545 *224D21EEE9AF4135F8539C959F898ED350ABB67D BRAMELEY
343,031,546 *2243C535427369A6BD2F62050ED884D25FA41056 BRAMES2
343,031,547 *224ED8F2E0DA7891B2CEFDACE54E8809BCFFB367 bramhilling
343,031,548 *224BF817F1615A3912E98F3FDFBC42144C58332B Bramuras1
343,031,549 *224F89CF7563F3C9DA5B0116F710BD3824E1ACF0 Bran3
343,031,550 *2244ABA857061D0559713C7ECFED1A4E883820D8 [email protected]
343,031,551 *224D7250718A68602630E9B7087DAB83C78F9D9A brancailhu
343,031,552 *22430BF33204831BC90888AD17E732AB375EADE6 brançanico
343,031,553 *224D43A25006B6CE3467DD1032C9B31BA43ECB7D BRANCHBROOK
343,031,554 *224CC48866A3BC182E4ECE29366F922C3C55F4FC branch.com
343,031,555 *22416AB207406DDF1825E81F2B6AF46E4F2936C8 branchi11
343,031,556 *224C3D1670286067B4FEA110D0636C591F104842 BRANCHLING3
343,031,557 *224AF9B4196D58B766D2F4D8CFDE106C30F7E2C0 [email protected]
343,031,558 *2247C352EE4B0A57C271906BCBFF10A8F1F85AFD branchwaimea
343,031,559 *2248DC370F364D48FCAE1BC28E6823DA27F59039 Brancos3
343,031,560 *224DDFE38DFA1AB9C5430B6D40237C64BB1675BB brandall6
343,031,561 *22461783C56107C8D0A5F48B05847476295E4EDE Brandbri9
343,031,562 *2249AEE3F3E80A05D81CEED1D137FE0F755B73BE brandebürgische
343,031,563 *2241C222D9ADE9751C2ABE6A5797460DE557F750 branden.aboulahoud
343,031,564 *224DC79DB3DDAD45A8AD3040677B677CD54C0DD3 branden.aller
343,031,565 *2245B9B9FBEA529428F06D7FA087F870C6E90F8C branden.ballif
343,031,566 *2248F56B126F187D6C949C0316E41DD36A600D38 branden.bencosme
343,031,567 *224E1B71324D3CF61A32DC5BD42B5723811D489F Brandenburgisches Konzert Nr. 1 in F-Dur, BWV 1046: I. Allegro
343,031,568 *2247E3820DC0E44678E52A0D3C6228BB05FDF643 branden.catherine
343,031,569 *2241043B7D6DC6DEB1B7105F3A6D1504F40CF124 branden.clemens
343,031,570 *2245E3B26283057CF3725DB835249089EDC99CCA branden.golabek
343,031,571 *224C05FE81CB7EF73D2AFED0ADFF1EE997E1E5FD branden.hargus
343,031,572 *2246984015BC3FA5DA329913F61EEDFE022C1E02 branden.hernander
343,031,573 *224037597BBAA76E60DB75D71261EC99A43C3CD0 branden.horbert
343,031,574 *22487F5500C76F0F5878A495B8032FE75411E14C branden.jacquin
343,031,575 *224F8681DA08F3058A95523C27FC705DE519C777 branden.kumar
343,031,576 *224B811890E6A5A4152781FC879AE81ABF2EBFCD branden.kurpiel
343,031,577 *224FB6799C059537861AC2498578C21EAAF97E51 branden.lauinger
343,031,578 *224119CABD533954972A60EB5BD12829105C1DC6 branden.lowden
343,031,579 *224118B97D738D8C538D1C5A76C6B40C2E55422E branden.lueth
343,031,580 *224EA9D87F3A41867242122AEB997FB193FE79A2 branden.medick
343,031,581 *224EF77E42617F904720CB7509CA889B5CC6C898 branden.nabavian
343,031,582 *224DE87879360CA14463BF46CD7F0C113863FFDA branden.nush
343,031,583 *224CF6934557D98C2B35CB327DA329D36460E6F9 branden.overmann
343,031,584 *22408D4F7DF044FF63CBAA623F990099014DE510 branden.parizek
343,031,585 *2247F6B3058136F8A26E2C381FCC58B4F8296021 branden.pickle
343,031,586 *224F906775D665ED08B85C4A9F7F7D5EF7807ACF branden.selan
343,031,587 *224B3615E6A01793B544A5F8EC23832D9145FB08 branden.shark
343,031,588 *2248C79EAF9F3FA8B39E9DBC1C74A02713FBCED4 branden.sleiman
343,031,589 *22448376BB0E192E27AAAAE3D0CD0F9C5AD33720 branden.spurgin
343,031,590 *224809A89B0E03146EF0DD9F81C6CFC77CC7FF2C branden.stellhorn
343,031,591 *224AC3FF1B5A1649782E9EEC7E22C11E0A60366C branden.viers
343,031,592 *22417D417299C58F7234C1EB2EA8B9647BB54496 branden.wiegman
343,031,593 *2249C2636F5FE3CC417BD60687A394E04DA8586B branden.yopp
343,031,594 *22430E0F68954F1DA5614FEEFC226A4B3FE9F949 Brandiaehs
343,031,595 *2246D670568E26E9BD2B106CE05FEB9B1DD009B4 brandiedanks
343,031,596 *224D579732D7A18DCF8B1B1E4ED2DB99E642D420 Brandieds8
343,031,597 *224D4B1CF8C2F6B8229D42044F56FD5765BF4F36 brandieeu1
343,031,598 *2243077793392BA6D11820F565906CA453000355 brandiemanning
343,031,599 *2247A83903715C00DC55320C1AB3D92470D740A1 brandigordon
343,031,600 *2248D0AFD48C26CDC8CB968349A7AC6526CC08CD brandihearn
343,031,601 *224EB5A721B58016B25244D8F8621B95AF872900 Brandinat7
343,031,602 *22466635C1AE3EF79CA2392DE205BCB07FDC79BF Brandirux2
343,031,603 *224A38779C5001BDFA918055A511F1607C7E3737 [email protected]
343,031,604 *22432B4F0020960CE689AEDF0C6FAF15D375BBF1 brandnerwilli
343,031,605 *2240196BE0167CE9C2EAA42F5367BA1C364D0933 BrandOn
343,031,606 *22488084178E4D6A389E6309B0F36F7E57BFD71B brandon267
343,031,607 *224F5A97DB098A68C5ED5F2F4D434CA243087D7B brandonbare
343,031,608 *224740F4AFACA7D8A39C8CA8A1FFBCFA6C2D9EB4 brandon.belkowski
343,031,609 *224E1E5FDF45A8DC78DD828BAC113D782DEF4FE2 BRANDONBLACKIE
343,031,610 *224E0FDC79F6359B2FAE5E8CBD6B9A8F1FC324CA brandonbrabham
343,031,611 *224EEB553A498DD06F88DC075D2FB309A1124511 brandon.buttrick
343,031,612 *2240C31CB4627D58EC22FB0352563CEA6649866C brandon.cannavo
343,031,613 *2247576DDB0EAA00722C73223D6502539E8696D5 brandon.choules
343,031,614 *224B5F4B1F0C4D60D69852265BC421EF623AFB7C brandon.czolba
343,031,615 *224AD5F7B3F0764142A131A9CF7E47D257FE8EDC brandonesker
343,031,616 *224B14A77C5207B3675C8CD2F90893B3EBA3F414 brandon.fedder
343,031,617 *22451E785CF42A6627E963AF5DA84FB4736C0FC1 brandon.galinoo
343,031,618 *224A6718EF7C579E3AF337E63F76DBFBB5A78A88 brandon.glasgow
343,031,619 *224A665800EB25582BA010C04AB756EFDCCE93D4 brandon gunnell
343,031,620 *224EC61386FB3380B819EBD644EBE8322AE60AAC brandon.hilling
343,031,621 *224F08AF80F71E7F81FCE5F21A60FCFE090A2466 brandonhutton
343,031,622 *224A534E36F48F659B4357D4E8958EC937F804BA brandonjgay
343,031,623 *2244E8A278A221548F8A3864D3C800479E7E4D45 brandon.kludt
343,031,624 *2245FDEBE37ECD48C1CDFECDF9861A2839526B44 brandon lehr
343,031,625 *224815C40B82124CC1C4E50DD6A3EEC9684B3C2D brandon.marlo
343,031,626 *224F0489A4B311AF7BAD3FB2A40D4724EB9C6D36 brandon.mcfarland
343,031,627 *2246B3A769B29AC844E2664E9673188EEBA96BDF brandon.mcpeters
343,031,628 *224548224C5B32FAE1FD38EB48520065B6AE352F brandon.paling
343,031,629 *224899C1740380988975FFF69602261A99899FFB brandon.palmertree
343,031,630 *224C95DEE81EFA45D02CE7C9EEAA35FE924CB564 brandon park
343,031,631 *224E67197FB28252105F3468154546E945D6E22C brandon.pleasent
343,031,632 *22440E7D98C98B27190A9CBBB6C531D701BFA61E brandon.romanchuk
343,031,633 *22417AB57F2D1B59418C79FC89345C9FF0AC9B34 brandon stoehr
343,031,634 *2243F2E7D7C1235796EEEA5A2D10891685871AA5 brandon.stoltenberg
343,031,635 *22467D48091B760EE8877B007D0FFA02ADE47212 brandon.taneja
343,031,636 *2242D53B25B836CB556FB6915ECE2FA38B98BF4B brandon.teskey
343,031,637 *224C62B63262A8892312120F450C9B052C55387C brandon.tyrell
343,031,638 *224EF110FE5BF29E5DFE379F1F7C8B0CFFFE6B45 brandon.wampole
343,031,639 *224DABAD02E790098F74BBAA58B9F586C800C745 brandonwharton
343,031,640 *224075939E4E15F2145BBB2C557A851506927729 brandon.wurtzel
343,031,641 *224C81B7E0CD67FD3C7BBE3BAF83BE61B6BBF87E Brandosta7
343,031,642 *224E5D1E0CF342D0EF8F349E14925841C3ACD1CD BRANDPOLIS7
343,031,643 *224B0AAE957791B9F36298AE37ADFA8C317CC7D0 brandschade!
343,031,644 *22469DB8405A8D324FF5B27D19EC641E430E144D brandschooN
343,031,645 *224B0082DE0BEAAF1FC4776C770BA135A88F3D6D Brandschuttes
343,031,646 *224FEC769A85F482A1033159F92C1776A722B8C5 brandsläckare
343,031,647 *224B34370D13D968388534ABC273904A767F1E87 [email protected]
343,031,648 *2243E73B55F105F189C3AAA7C72655D6ABF323BC Branduming
343,031,649 *22405C2C6D0257A1234E4D049A7F21DFF43B094C Brandy36
343,031,650 *224133A65229FFE11D2B61129968E404FBFD2F63 brandycavanaugh
343,031,651 *22455CC08D4F4D3FF556ACCAD9FAA52B7D1062A0 BRANDYSENIOR
343,031,652 *224896996D8C36295B51B0B382DE499E0F30DA5F Branjenja
343,031,653 *22411DB90A2E87960B3D2D19274F1680555CD105 Branjenju6
343,031,654 *224A18ADD57D863400DE1911ECA701B7C1E2190F brankojeremic
343,031,655 *22405ADBA9DD7331EBF92339574D3DBF6657B655 Branney4
343,031,656 *224957B039F05E9A9E95B2E2F301DA56305F7E1B brannism5
343,031,657 *22466B15C8A9ED66B1B4762555218A579F2B000F brännvinstillverkning
343,031,658 *22416EC8BA9CD3F56DA9BCCAF570B5C14B0E62A6 Branom’s
343,031,659 *22444958F67091F332F6A1EFDC0D2CFF9E2B2B65 bränslesakkunniga
343,031,660 *224B09BFAFCB52920D198204E75B4DD3AFA41415 Branson341
343,031,661 *224163D5E08E4AF7BBBF2C0603CB061D7E731107 brant.afzal
343,031,662 *224DCA6CE48E3DAAA1264B079A062A1825466292 brant.alessandro
343,031,663 *224631D9ACCF9F81F25EC32AA3B64B6326EE5F94 brant.braune
343,031,664 *224813C31E659464429E0D772418D6E2B4AF315C brant.canella
343,031,665 *22468BC70D445E24553B20E85CE144E4EFCE9AD1 brant.delap
343,031,666 *2249F09171C0030DA7F0C685B5ECE72BE40C1996 brant.delcamp
343,031,667 *22467F68C6F2ABA9D65D91ABA7EE0E093F73A062 brant.duracher
343,031,668 *224DDE5B2BC83BC3B6928021761EBE18F2EFFAF0 brantfordcan
343,031,669 *224ACCE8743FB1D8988FE66388BC673A4F719560 brant.gorringe
343,031,670 *22420453CBCA84885D80DB8F28D845D27388A328 brant.gumbel
343,031,671 *22446AB77C4FA83EFB3E8A417499460C5967EB8D brant.hebenstreit
343,031,672 *2249409BCE01BE85FF2317461346751EB3B7CD08 brant.heddins
343,031,673 *224C5DA6247DB934B157F36A8CFAC06F56824A6F brant.ihde
343,031,674 *22472F8C415615913852BED6F192AC5DA7376AAA brant.kales
343,031,675 *2241E37787B1786C70B6097BE138B9E51AE7184F brant.koussa
343,031,676 *224D2810B6F2E7B1C0BBFD184FA28F2ACF7E70BC brantleyCH
343,031,677 *224699703481EE43437ECB058402689D2E5408E2 brant.luke
343,031,678 *22490D48B5C2B88A949125A0945C2FEC474BB8FE brant.marini
343,031,679 *224CB74DC92566CBB65D4FD44505CEB3311BFB08 brant.mcginnes
343,031,680 *2248592564DCB0F2BC5A6C900AA40ACF38C603F9 brant.palczewski
343,031,681 *224E7B550563C6B88A2F6FBA01F31B898AFC8322 brant.saunas
343,031,682 *2248B2344F830708F250D9FBE9B9DA5F8BEB8E0A brant.schwark
343,031,683 *224DC9B819DF1C3F79790027018DD072F9DC342B brant.willard
343,031,684 *224EA522162C42475FF58136A4BB9BC2E14DE381 branwell)來照顧。在1824年8月,夏洛蒂與姊妹
343,031,685 *22453F0B1548184AB015E35B6F595417E1540684 Branwooda
343,031,686 *22431C406528B45C53DFAF9E79C45776194F1FD5 Branxford
343,031,687 *224401E3DD72BE3E203B98C07D51F676923F18E5 branzas123
343,031,688 *224984AE00BC55F3FA00102992E3ECAE0F3722C2 BRAp,
343,031,689 *2242AC9481417753D4D3BBED155B204FAC04BC6E BRaqB
343,031,690 *22447AA628FF72A32DB893AF1B698A61E3144B14 braquions1234
343,031,691 *2241E34AABD3510B5B144E3901EB8F7AD22727AD Brarbara9
343,031,692 *22447667EC1B6A3F7C5E5BAA03E4777C2F0A9479 Brasaounicap
343,031,693 *224E13D16AA531584DE322FE67C5BD92FC6BF571 Brasciadella
343,031,694 *22475DC054218961A2D56D072DD57F756F3697FD Braselses
343,031,695 *22411040352E7E1BA6501D482F93D2EA1D2ADA57 BRASHAWN4ERL
343,031,696 *224CED324E9D45A282389496546E70195EF81B1F brasierslaw.co.ukwww
343,031,697 *224839A8A4DF923123D35FF3F7E8C1C1CFD62C9B brasilãndia
343,031,698 *224CA22B126CE95357577D6040BA9AF75CBB93FF BRASILGOLD
343,031,699 *224955B2C408501283EEF7E27A78A67EE558C874 brasiliensisbanara
343,031,700 *224212AC809C963C099949473186AEE8F3A89FCE Braslovčem
343,031,701 *224500F3769FFF5CBEA75470FB8E9D487211E5DA brassad
343,031,702 *2243371F1DC47C51A51711C9C7612B515F69861A Brasses2
343,031,703 *22407BE0732485D20A866C4E924FCB2831C1A222 brasseurs)に認証されている
343,031,704 *224E63BB65751729B500470EC9CD5D836253429E brass:ring
343,031,705 *224D678ACCB3E9E9F499D65A88C47223ACC3BEA9 BRASTETH
343,031,706 *2242743FA5458B9E6EA5E9A7BE1076D5BE377797 braszell5
343,031,707 *22455AC553DCBAE5E2CC8FAE76170CF712911616 „brát
343,031,708 *2248FBE7B9267580A446F0DE6F78723DBB31A53C Bratislavskýkraj
343,031,709 *224DAE045C7E296E9C36D056F3D0FF8761C70301 braTTiEr
343,031,710 *2246C5F29A9552BA3FB3900ECDDE401474F121C6 brattine55
343,031,711 *224D3AF9AAA836615A4D6D37FCE6806BC0B49B9D !bratwurst
343,031,712 *224811D8A2FE8201DB12D11C37D6A22F7D41B9B8 BRATWURST7
343,031,713 *224067C5C49F26CE6766E55DF143D306314F0E7F BRAUDA2
343,031,714 *22438BF155E0224E4E5EE3108445DF0965E135B7 brauerordnung
343,031,715 *224AFB9D3A09F1B939E8CF1711C2E3F6896530FC „Bräukirta“
343,031,716 *224436631EBE76FD072F532F2346E02758ADF814 Braunschweigowie
343,031,717 *224FC7ADBCAA8391131ADC74B43E99B74345CB90 brautaus7
343,031,718 *224C5C9AE1C6884005B2329C1296779EE2E0CB7F BRauu
343,031,719 *2241CDC10B3E787E6AF8F529AC2E66C3645238E1 BRAv
343,031,720 *224051802FB52AB3CAAC780A5B93B68C924697D1 BRAVEE!
343,031,721 *22467FDC7A5223FDF994CC595B5D3B5D52190C70 Bravelies1
343,031,722 *22433C651539EC2B1381E7A97B25BEC91A937D1B Bravenoiserecords
343,031,723 *22423B73C309D1F1272867C4B6C276D02E6CFB55 Bravesed3
343,031,724 *2245DAE58A1D2855E7CA5F996857D731AEEEF6ED BRAVESHAMAN
343,031,725 *22431A735DCA54CC8C9CEE3EE0EC815DD7A0828C BRAVESSTANLEY
343,031,726 *2242A370FF96A9DDD17A9CD65C23EA52F80AAF93 BRavK
343,031,727 *2248540CB14C6F30368B9AF5EFB618906B67BED8 bravofotolovestory
343,031,728 *224A02A5F05B7B78A7B93954C378994815A423A4 bravo hits 8 (disc 2: pavement)
343,031,729 *22438ABFB50F469C4A5ACCDA20516BB2AA5D56CE bravoposter
343,031,730 *224E6CF988D140DEC54C816189CF2F41BD395608 bravotv5050
343,031,731 *22427CBF2AB9356918D4988CBCE2530B991D07E4 bravures9
343,031,732 *2244C59526EA8A8EFD9ADBA8A8C6C0C00A39DA4B [email protected]
343,031,733 *2243233A9B80F7A415A973A8A0497656A6018968 BRAWN!3S+
343,031,734 *224662BDF4D8692C0ECB48D781908AEA0BC0097A BRAWN!ER
343,031,735 *2247C7691F489B0D670212A55BCA87E2472EF732 brawnin3s
343,031,736 *224424629F4D8F35357A234C94094FA29E43C1E5 Braxton422
343,031,737 *22423C53CAC8A225C0BF7813D5D847BC18E661CE brayan333
343,031,738 *224E3C8D5D84BBF3D036B0DD7BF6958AA30F381B brayan542
343,031,739 *2240BED4609B9EEAA99BD136FBD2C3773F6C0605 Brayards
343,031,740 *224479741419543A3BA27FFF518CF25B8FE404DE braydenandmommy.blogspot.com
343,031,741 *22433B947B118FAE85AA0322BFDAEB7C7AFFB709 braydon391
343,031,742 *224C6D63259D9EA647C7879FD5FAAFC947C5C647 braydon779
343,031,743 *2242C5B77769B8C9DDB05743BA23DB135FA9F549 braydon988
343,031,744 *224D97799CEECDDD42805FC0717E800DE4819850 brayerieZ
343,031,745 *224B2223F03E5261B0B39CF7E931B9F66B8B8B6A Braylon876
343,031,746 *224B13CE9343489AE5912FB6296003D3D8455B73 Brayndei
343,031,747 *2240C432DE96F9CB7B71BA8D93EB9F10D23C3FCA brazens4
343,031,748 *224AE3424CF17EB1AE26D22883A0D6BA4BAA9CCF Brazildon6
343,031,749 *2249412665A33DB8FD9557AF80A3D64FDB5893E6 BRAZILIANANGEL13
343,031,750 *2248B87CDCA53F930593B2FDDE51583D1292F4B9 BRAZILL01
343,031,751 *2246830CE6C1ADE267A13CD925E29113780B7481 Braziltom6
343,031,752 *2247B448C4962E385A8D96A90E50AC355A7FD62C Brazings8
343,031,753 *224E8F3BDF544B6A693E5496D106AB82CDB55FFA BrazzyVoices
343,031,754 *22423111558832E099455C17EA6E6765C9A8B144 BR(B
343,031,755 *22444F4DB964728FCE45907F351B0F518DB3D990 B
343,031,756 *224062F5A2615D6FC15C90039EB2EEDAEA5D5ED2 Brb5,
343,031,757 *224E118A9105B2DC6FED42489F131F065F056D64 BRb67
343,031,758 *224FA7631A4B7F28A5007B95C63243AB677B26A3 brb...dner
343,031,759 *224FD4CA32F3929A84DD3B38C069F8DC08302241 B
343,031,760 *2248B893B1E5C8969B6984FAAD683F2504AF2559 BRB‘R
343,031,761 *224650CA3ED1DFE935019D0FE4F454AA856D066A BRb)U
343,031,762 *22488B7042EE1C788910E99ADD345C4B5B9EB4CE BRBwj
343,031,763 *2247A9CC8FE780DC0F832B3E98AAF3BB64065B6C BR,$C
343,031,764 *224389FCB39F726E7E43DCC581DD201E77E59568 B+Rc$
343,031,765 *22474805ACCBD085E5AE9FAAD34BD7229FF81D3E B;r+C
343,031,766 *224FEDBD5D1B71549680B3C93A2386C701878898 B?_rC
343,031,767 *224E629462B35D179644BE5443D447344198C987 BrC/)
343,031,768 *224A7623FFA16B8041006A5CAC8C0ACDF26E547A Brc0X
343,031,769 *224A33FEBFD558708D97A0EEDE6CDD6288C3310C [email protected]+3d
343,031,770 *2247319FF6ABE6C2E62964DE6651D1C46A582522 Br!Ca
343,031,771 *2249E7531A81D4032C61D90D9410E3AE26DFC0E9 BrCBY
343,031,772 *224C6A13A807125E812D6CFC81B91BFA17226B41 BR(Cg
343,031,773 *224FDA0F2060B72772D9733F862A99143B1317DA brci65
343,031,774 *224B2A6B0EEAE2C3A85B57B889FBDA5BF0C75F21 brcibkh9sakz
343,031,775 *2245272B16D2C663B50703F1D810A2C17F8A8C5B BRck:
343,031,776 *22484541F6AE8D7B3DC55BDEC1DE5193F3A5D6A9 [email protected]
343,031,777 *224389EFC35A60ED54A7D1791FF8292FA958E16D BrCL;
343,031,778 *2243DA7FE1A6BA5E4A986F166DB64198AB761342 brclapp1234
343,031,779 *2240A06602AB6DD6073745428AD7C4A239BE126F BRcmB
343,031,780 *22470B659D52DB24FFA9F7C645D0DCB9EC374480 BRCtn
343,031,781 *224725F53A5DC733A7004DB64AB2A4386D22CF62 BRc#v
343,031,782 *224122B38E239EB6DA22397F6379B81E39A113A4 BRC.X
343,031,783 *224E38306C86A6DFF46E31FF7E53646D07C734F5 BR+,d
343,031,784 *22481F2238B02930975A326AF07CF0136B9E5B87 B/Rd4
343,031,785 *224A1F748CEED56EB1932CCF8F05F59548682C7F BRd
343,031,786 *224499F77155B0B55FA7B29E5DCF0ECCB7538175 B
343,031,787 *224C7F4A8B656D5D8CB023A99266B8B977DB7419 Brdaus
343,031,788 *2249F7BB8D03BD44C041B21CEF685A7B7FD46CCD BrDC1
343,031,789 *22420F240C36CC9D6D3995C62DD15542CF863B83 BRDcZ
343,031,790 *224EADE023FE1FC0966C32569A8E2D1260E1D49B [email protected]
343,031,791 *224D10A839B4E7342940983AECD6B4BF55322AC2 BRdHH
343,031,792 *224F39D23618F1D54F6A5CF73E968892F098D134 [email protected]
343,031,793 *2240F79264D775A869E14A783F66CB547D8CF0A6 BrD,j
343,031,794 *224D2AC9CB7FAA5402BC7CA66F4800EED8D5D60D Brdmaskinen
343,031,795 *22434673B5F0B85BE6141785C53AAF384ECC5BDF BR
343,031,796 *224F59EAC155187E7B28F0389D8EE7C9E054D591 ˈɑbɫɑɫɑrˌdɑn
343,031,797 *2240B53D7E90B795724698A129CC10FD958AE72D B,rdo
343,031,798 *224098A9F48465AF674120D0C7C2647FF5CF5F24 BrdQm
343,031,799 *224C28537E2158727B40821DB06FA2DD8141B827 brdswrd8
343,031,800 *224296A3273BD4DFD13CFE8A910A7D29F20F1C63 brdthwyses
343,031,801 *224412D034B059F672F075E4D641CA877E22F7FA Bre
343,031,802 *22481F7E70A94ADAF33CD4FBACA8F83CE6AF1CCD [email protected]
343,031,803 *22451C26EB9AC1FE5AD4FD75E86BF8C45669FCAE Br,E9
343,031,804 *224457B3297A8B6659AEC0F443B2C43AFD5EF7E0 BREa.
343,031,805 *22468251851E0BEEC1DDF07511CD5428A8042491 BrE&a
343,031,806 *224DB0AA2E0ED47BB1F02A6CE4465A805B7F3A7B Breadloafed
343,031,807 *22493FD54297A22AF4AC172F4FFFD92D8DD20518 bread man shuffle (live it up)
343,031,808 *224D2597362CD5FB0244A2BF74F61797446FCD8E [email protected]
343,031,809 *224F828073097CAA3F5ADA301D2005D0398FB57B Breadwring
343,031,810 *22447D019E89DC4639C9016218D7D34BC0D8608B break 4 love (vaughan mason 12" mix)
343,031,811 *22426378427C3FCAC1E5B22D06C7CCAF109C13E5 breakdownandsing
343,031,812 *2240DDA43C52B5E284466A2DD3E6949D43BB1AC8 BREAKDOWN-CRESCENDO
343,031,813 *2240D7CDCC529E6BC9653EFD469888EB0BF97762 breakeyvilloise
343,031,814 *2243DA38DA8ACBFD2CE7B7D82804AD1B92CF048D BreakfastatMilliways
343,031,815 *2249C3B5D6EA1B6C41A4D6DD760B1A4982768511 Breakfastbell
343,031,816 *224C4CED3B240000B6AE0C2A1B7BAFD8EA6393E1 BREAKFASTLESS!
343,031,817 *224BAB64009AFE0CDE2546BD300D53A96EA03F3B Breaksesing
343,031,818 *224C279525040D1D86F540F34B52C4B116D5965C breakthr0
343,031,819 *224B66CA6FCA04456E39045CC67CFFF225B61899 BREAKTHROUGH-LEADER
343,031,820 *2242D1DDF7023CB295767333F4D5930E12022E58 [email protected]
343,031,821 *2241ABE7F2F4DCC79417AFF963CB9C1AD9040C7F BreakUp(TimewriterDroitUpmix)
343,031,822 *22460A6359CD132A153114E1135D20EAAD164B46 breakwell’s
343,031,823 *2249F21552A029A8AFF759E42C8CA30123A423F6 Break Your Heart (Darren Styles club mix)
343,031,824 *224B8B49C539E4F8D9BC2336201AE1551CFD4293 Breanna069
343,031,825 *224DC1A99EBE4B214608BD863F9DF7DFF8D720D2 breath_analyzer
343,031,826 *2248DCC063DF351C9786BC72D125C5E52E7C469D breathest1
343,031,827 *2241408F3A7ECC4C42E544BF16E27D5616D1273C breathe you
343,031,828 *2247020D33338D69686BA841BF3847FAB413B911 breathitt7
343,031,829 *224C37876101DCBD2E1652FE952DFB6BAAEE81BB BRECCIAS!
343,031,830 *224F332776996034DC262D29F3D142B249064F21 BRECCIATION7
343,031,831 *224183AB6667705632F76049EF928DD809BF65B7 Brecciose8
343,031,832 *224A25C2B72D903B132895A8BD90D17405FCE5E7 brechtbaal
343,031,833 *2241222A29E6B8AD98778510ABE5CFB55A90FD89 brechungsgesetzen
343,031,834 *224DF5F1B256DBB78305C40802DD0D60F3256BBC [email protected]
343,031,835 *2249FA69D8BF6EDE560D19C4963BBC1D1DA29A9E Breckley
343,031,836 *224D894185F1FB7381CBAADA28C024D033CA5CB4 brects
343,031,837 *224398F338EF707B0BB7D392A19C34CD6C963109 BR&ED
343,031,838 *2241A605E82DA914E3B4CBE0FA034627A2AE941D BRe"D
343,031,839 *2240C19A9397561EF05EFE0122B3EE7E1A6121B7 Bred2DieBorn2Live
343,031,840 *224D2AAD9F0D97B7833ACBFB6B353BB3FFFE4F67 bredajohnston
343,031,841 *224457F71148466378D34187D4A53A407A2A5F0C bredrup123
343,031,842 *2242555AB093F3799558BB83C26B747FB91339EE breech12345
343,031,843 *224E789B58376318596D32448AA412949D9CE4AA Breedgers
343,031,844 *22448F552B9515C04DFC21FB3F839F64CF985BC7 breehan6
343,031,845 *224A2A7F5737BFF7E7B81E73F342E42CE5373BFE Breeman4
343,031,846 *2248C474C6EE3B96D3B68C470C7A2820FF9877F7 breezy4805
343,031,847 *224B1ACB419BAD1D92CA0CAA8D90E3B9A3AE184B BREEZYBLUE4YOU
343,031,848 *2249502496AA8BC7D4986D4AC97FB296D1B9D109 breezy bree
343,031,849 *22482791C90CCF7291044FF32CED2F275605673E breglio's
343,031,850 *224420B608D76163C0EB7612FEE9BB01EB07FA01 bregtha9
343,031,851 *224B5BDD9BC95B49CF912AFA1F5513DD0B43FFA2 brehaing6
343,031,852 *224353B47891D6884252E1F9B7B4568BC24E3287 Brehdahl
343,031,853 *22439C9E16573B2CA754F80FF5AE7C7CE84125A8 brehennete
343,031,854 *2247696BF34A086DD3F0EAC86ED1A64030EC635B breideltjeses
343,031,855 *22472AB10606622AEBD1E062A60FC1A2DF01F593 Breisgau6
343,031,856 *2241FFAE56A97E222D754E0B3A92B47D8D9786D4 Breiskarsetrene
343,031,857 *224A02B01090E0173CB633FE1C16B6711220C3FF Brelt
343,031,858 *2249FA3A4034891D96B39BFF16F2F4189EAE9955 bremdalcom
343,031,859 *22490B7966D9EF54B160033BF5D5D5D670DB68AC bremraaps
343,031,860 *22469BB2A32B534187602D799A42CE435CCCB228 Bremschraft
343,031,861 *2249658CC5ADE0B1B4C17E683C75F85731D9D168 brémského
343,031,862 *22474E6B6641A91CFF52A64E568ACAA33A4CBA4E [email protected]
343,031,863 *224903E24F0AD4BBE585440734EA354111B6E4A4 brenda952
343,031,864 *224C732CEC5C7450685A077D88E19E21CD196AE3 brendabeaird
343,031,865 *224413FEB8FB370D2FD0955B4DB6C037768A426B brenda burcham
343,031,866 *22493711C1FA093F98E023114C561CF771903608 Brendacfj8
343,031,867 *224FAC2914B6408BF4E6775ABB56839CE2C87F5F brendactc
343,031,868 *224F16093590953006C59751DD10769E5CAF64E7 brenda general
343,031,869 *224818F17EFBB9BD408181E9D9EDC0840856ACAE brenda kell
343,031,870 *224D8643D9658C0E9F7063D0181BA573E39CC834 brendalackie
343,031,871 *224288878B2C9F3AEE44E2E91BFEA03B7F2E7C09 Brendamac9
343,031,872 *224FCFE75850F1D8F87654AC5276E290993A38A2 brendan.batta
343,031,873 *224CBFF37DB727945AC1FC988083BA0D4AA472F5 Brendan Bourke
343,031,874 *224E81A353BBC6BF046CFC17E9C160F028424085 brendan.dellinger
343,031,875 *224BB558C8915D6F04E993A427154FF0BF176D31 brendan.fain
343,031,876 *2246D34FF9A7CFFD7234700E7421FA05E84B6FE2 brendan.fontana
343,031,877 *224431A226656436A427846297FFE5529C587E7D brendan.gehrer
343,031,878 *22486C5FEF080962B602DF337F4541B2BA5A0EC3 brendan.hanoharo
343,031,879 *2244684EB69E65C020B84E8505660EF070DE6E98 brendan.howenstine
343,031,880 *2244394AF1B8432EC6BDE78079FB15EDF44691E5 brendan.jessee
343,031,881 *22498ECB6AF03103925E376752F1DDFD2EAA5CFF brendan.jurina
343,031,882 *2248B02DFF539C801F746366A56EA209C1BC9B4A brendan.kallfelz
343,031,883 *22461531E49274DEAD56E91FB6C26B014A6EDEF7 brendan.kilger
343,031,884 *224694EF3818A7DB49239EAA93CF75121A619860 brendan.koelsch
343,031,885 *2240A0E1921C7C6F97A5D0D0069408570AC5CE4C brendan.loendorf
343,031,886 *224B551FFEF0DC3D8C0E074A8543431CB64D2EFE brendan.lonon
343,031,887 *2247738B5C64D38053FFC0D461BB44752F7ADB17 brendan.mallicoat
343,031,888 *224F7287D3176440CA76E2A5D7FD5181CC231813 brendan.rossin
343,031,889 *224D82A84728D7C6D23877953F5E2FBA8D14E84C brendan.scarola
343,031,890 *224F87F986FD24F3E9047A3D927222DAC7331691 brendan.sovak
343,031,891 *22416C7557CADF8A81935517DBE694CDC530381B brendan strickland
343,031,892 *2247A781605909F27C28BAB760D36A42D367AD96 brendan.sulcer
343,031,893 *224495D41C9F378735CC448DFF0249FFE81B1DA3 brendan.trovillion
343,031,894 *224F935466E29A9E8ECC10416DD4E338A74A586F brendan.vilcheck
343,031,895 *224C3F3DDFA0A90FF75BCC2B0151861A6379C482 brendan willard
343,031,896 *2244B6B8EBA16AF97740EFD3EC6629AB00742A84 brendasass
343,031,897 *22404D17AD4C71197361A1129B7E4C5ADCCF1F79 brendaschmalz
343,031,898 *224ADEF49D16240B48D48853840F8C97A167E18F brenda sheumaker
343,031,899 *224C87CAAAD3E85AE89842F13670DA6E5E56A372 brenda toutant
343,031,900 *224F197DC3DA964897E991BDA3244EFE279F9DD6 brendon.aldaz
343,031,901 *2246FAFD5AC19898F4A1A00C27C0A643EC844038 brendon.alme
343,031,902 *224D2ABD3F35950A57FE5D4D4E63EA98279B630F brendon.baack
343,031,903 *224116AA97656FE55B2A9BA45362D7BCA5661452 brendon.buccino
343,031,904 *224CE3ED6EAB7706DCF96220DCD885A39A81F1C2 brendon.buckman
343,031,905 *2247435B8904A0CC1CDB85C291FE2393E8658178 brendon.eichorn
343,031,906 *224BE230A2CFFC9529154DB58CCFE2481CC315B1 brendon.elmer
343,031,907 *224CA6789FD2094A10760A9D77C372DBBF443124 brendon.farabaugh
343,031,908 *224752AF2EF5151542447268F1B50D1287B35BD0 brendon.fava
343,031,909 *224F7BF8B1FAB72B5594C05BE5BA326EFF063087 brendon.gibbons
343,031,910 *22407311F1786F6B339586CF2B65D79FF9FD73ED brendon.iha
343,031,911 *22432E68573EA853940DC25EE8AB34BDB1A15B95 brendon.lambing
343,031,912 *2243845F7EE5BD290497E60279BC1B56017BFB6E brendon.lassalle
343,031,913 *2242F98A8235FA1BE2875972F9F0DFA4D29C57FE brendon.leonti
343,031,914 *2246A492D0D6AFC875DAE6F4A0E5D8629A693CA9 brendon.mauras
343,031,915 *22417D15E0F856E24152C6D4E167CE10CAD6A56A brendon.mcmanus
343,031,916 *22468948B28D33E3FEDE5C933CFDB262DD0003D7 brendon.meginnis
343,031,917 *22496A433C2F1B476D5D0923113CCD11FDF0EEAB brendon.oberhelman
343,031,918 *224487A09C8E6AB57CA15282FBD65A166821B254 brendon.papazian
343,031,919 *22484B150BDCA291A50716EB971C91537A5EB874 brendon.ruch
343,031,920 *2241565526D68DBEADE12F499798DF0511E4CE79 brendon.samayoa
343,031,921 *2243438A4BCC86410BEBB2CF5EF0AE1A744548A8 brendon.schaffel
343,031,922 *2240672C95210CE123B01839D48DCD39EC7EBF2D brendon.sovel
343,031,923 *224C86FBF67D25D4DBC507A0788ED6EB220E442C brendon.tuia
343,031,924 *224D6D51F42F9A45D81E582DF884810FB9464854 brendon.weese
343,031,925 *22481AFC5EF911DD82A131613BEA99A7E4E76EA4 brendon.yonamine
343,031,926 *2245C41C06C3A56AD78A3F0C633D5C44A0AEFF9D brenfosterbio
343,031,927 *22464B3B6A355C6C9B2BAEE34DAD82184D371178 Brennan472
343,031,928 *224779D94E272D181F67B299F001730BBE6B50C2 brennan502
343,031,929 *224BBC0EA0A100F5E4BA8B250389214A4D0C4336 Brennan565
343,031,930 *224DF6A3C81095EDCDCECD2B220B05C4410CB996 .brenneis
343,031,931 *224D893EFE6ADCB2A953EBCF05786E1B33E21B42 BRENNSOHN
343,031,932 *224293FC09A4297CD76B0EFA73BDE3D8B0ED4255 Brennsto1
343,031,933 *22462FFC83A771B82303EB629D9051BDEC2E84E3 Brensinger123
343,031,934 *2244B2A170E09345F3FE63401AE9935D584FC220 brent062
343,031,935 *224282C87E7B69FBFDC22ACD1E562B6842E03D40 brent.atwill
343,031,936 *224016F8135339F6E67772ABFCE2DC92B8D7DECB Brentauer
343,031,937 *2244D7279A5B5E3CA3422EF23BFB1BE264B15663 brent.banick
343,031,938 *22433E19D53600CF49410E4FACF5654E4E1AEFFA brent.bastian
343,031,939 *224933221CBB6E1E28D44BB44D37C92B0715317C brent.boccanfuso
343,031,940 *22431144FDA7A5B9573DD7A5C9BD3177DE6EFE10 brent.burlock
343,031,941 *224F53375F9F19533108AFCED745B0CE67D62975 brent.cederstrom
343,031,942 *22490DB3CB9FEF1A757F68557F69212F9B998DC4 brent.councill
343,031,943 *2242D1CECBB38F040BD2BB609E6C04284C57BFF4 brent.ello
343,031,944 *224AF31AFE5FF657ED005405954B73FDBC81776F brent.fracier
343,031,945 *22436A25908E15813BB2B1604BFF9C1158AFBC36 brent.fusi
343,031,946 *224669199BBAE6C7DA0983A38DA61059AC733252 brent.garreh
343,031,947 *224D1160DD7A548248AD2A795200F42010F6C4E8 brent.gothro
343,031,948 *2249405F099E67DE6467253F6BDA3F815E5D08FF brent.gulnick
343,031,949 *2243B540F04CF81DBA9AEA03B8A7F0354842B9B6 brent.hainds
343,031,950 *224B07F3FE3A8BF4221AB601F06529B1D1D5F310 brent.hamidi
343,031,951 *224D3B593E6F63D7464B568890FFF30DA522EE1D Brentiss9
343,031,952 *224BD878A6DAE643E52C018842D18E10CCBF3F47 brent.krnach
343,031,953 *224B2DB688C41032A04BDC669A61168C98A71E79 brent lange
343,031,954 *22442CDD8F26E15AD4577253996C5B1B2750C5D4 brent.laragy
343,031,955 *224B41F96A053CD5642B3145089428853CEC5907 brent.magnan
343,031,956 *2241C6086F195AE1A3DA231C0E9BA1C661906943 Brenton045
343,031,957 *224C51D28989026FA7423254707BEBF25138F1F1 brenton.alward
343,031,958 *224D0DBA3D653C9ED94D50B1F58BB8EF12C8D3FF brenton.brozyna
343,031,959 *224CB0CE26F36C607D35AC0AF8CDA6EAF0B0505E brenton.cajune
343,031,960 *224DC28BCF8E8408DB357F5614D80ED58326FBF3 brenton.coutre
343,031,961 *224CD1F3D10D38D05B32ACEC96A96192F1D2732C brenton.dispenza
343,031,962 *2242BD7EA066257BD346164D5E16A1A4B9278EDE brenton.duey
343,031,963 *2248552A1F1E67ABECD40D00793E306E364BCB96 brenton.flem
343,031,964 *224C041837493FC9965163F52F12FFDC998CB06C brenton.gallimore
343,031,965 *22447857D067C6536AED0A54078D6805E15A078B brenton.garnette
343,031,966 *224114C84AB1E90DEF671A00452896ACD14183A0 brenton.giczewski
343,031,967 *22483E19DE99CDB2F593C0518B07D2052B098FE7 brenton.hanken
343,031,968 *224FE786E953A089B7B8482126997A51EDD63216 brenton.kaszynski
343,031,969 *22467FA8812641B23ABB52B03D8E5CD25B5D79DE brenton.kravets
343,031,970 *2241EEA85FDB751A276B893819AAEEE04B02847A brenton.lacombe
343,031,971 *224D04F4188CAD306D3A4231C631513EEAE9BF0A brenton.matanane
343,031,972 *224627EC7D3116886BC1B527285883D51FE86F05 brenton.mielczarek
343,031,973 *22494947CE83139C604BC3BDA358C298D6611BBC brenton.minicucci
343,031,974 *224F61ED0E663843FD624B579F450A2D0401D6FB brenton.morace
343,031,975 *224EA8066F044A76AA369C33995BCBB3AB5FAA9D brenton.mosson
343,031,976 *2249050D590AEB50875890C62C0EE1D6C9473272 brenton.mulhearn
343,031,977 *224051A6F0D94BB8F720AE989722624743828004 brenton.nehring
343,031,978 *224385942F31B35DE90F1F69467CC1A93B2AF2DB brenton.pedrick
343,031,979 *2240B9D18CDF3B4CCD7AFAAD8381C86FE732810D brenton.retchless
343,031,980 *2242AC5132FA8586BBE4482F449C723E182060E8 brenton.sebesta
343,031,981 *224D5A2E54DE30D55E98A6CABAA5249FB4F4C212 brenton.serramo
343,031,982 *2249BBEFA8A539D793C537B8A9C41AE9DC9838E0 brenton.spennicchia
343,031,983 *224E6AA92B096C41D43FD09C30C6ED0DDE493A60 brenton.swader
343,031,984 *2247285384AAC53B1A5F6F45647F8AF494DF276D brenton.tattersall
343,031,985 *2247019019DF6A079EB5C4A41FE80E2D906CFD11 brenton.yovan
343,031,986 *2249A0E71A70086E26AE0906C512561034199E53 brent.opeka
343,031,987 *224B061FBE7954B5F327BA78C314B0EA783F868B brent.petitte
343,031,988 *2245C23F1B28AD5134FFC3EF8A2436142DD31327 brent.ridgebear
343,031,989 *224A6C3F9259214421F13833C41559E290D02269 brent.rivena
343,031,990 *2242D038944C6A5876BDA138E53B7FDBAD6DE4BB brent.rivenburg
343,031,991 *224724C7ADAFD948A0C3706054BBB9F572404A80 brent.salines
343,031,992 *22474BC29DF2AB64837C91AC24A3EDE063767BA3 BRENTSAMS1
343,031,993 *224F9A828152563EA73A2E3FB0C67E8D544B7B55 brent.saxon
343,031,994 *2245911EE4ECACD7D746714895D48645FCF268FD brent.seedorf
343,031,995 *2244701D404F4E5799511C4E1F7366A4425D5653 brent stokes
343,031,996 *224C0F8CCBCBE015613E4F3FE25B05F702A84BB7 brent.summitt
343,031,997 *22400E0A32447D504EF2556484F56BE2BDBC6D72 [email protected]
343,031,998 *224691030B574BB35910BAA188485505EEA9B4B3 «Brentwood»
343,031,999 *224308557ED9B96B4018B375F9DD3141CFA06DC8 brent.wyborny
343,032,000 *22472303CF1082DC672029AD060B5D1B4CEAD401 BRe-o
343,032,001 *2243201A659592614E3FD1C9EFBF90110BCE6319 [email protected]
343,032,002 *224E4F80350E16EAB8AB06651AC2E69647B342FB brescello1
343,032,003 *224124D48BA64B4293EC8DD8FB36FA4914523D42 bresciahenry
343,032,004 *224F41FC0B2D21A45028D41FE1BBF177D8014E9E Breshkore
343,032,005 *22452FC71F7C1FA76683A12CF421988A85875692 [email protected]
343,032,006 *224DFC2A63F3893E2082EECA4EC9EDFEAB782D51 bressolat
343,032,007 *2240B703CC3212F5721FB8EC506A506988678B60 Brestbrest
343,032,008 *224EC3682B3FBD052627E6F31EA90B32F4E5B91E breszt
343,032,009 *2242B80E31266DE3C0D111C27CD16EEDB09FE4AC B?ReT
343,032,010 *22424322837E4C38F74460DEDA590887CC2B92B3 Bretaigne2
343,032,011 *22424845CAD939268C6901E03D5000CBE82DF0D4 brétaillerai
343,032,012 *22485C8012D682400C0BC1C141566B2C973FFA0B bret.beachman
343,032,013 *224E165EEB1DC01118AD3757B57B3A7C9720E88A bret.blomquist
343,032,014 *22473EBB5FCCBD4E8434ABE3ED58F933AD75AD10 bret.bongivengo
343,032,015 *2246352F58C77E8A6D7DF51979856B74DA20235C bret.brossard
343,032,016 *224BDBCE106F6DDC911B07BC95514E321C2E36DB bret.coney
343,032,017 *224CC73E303A3410EB20FF0D8ED60DE70F661562 BretE
343,032,018 *2242DEA3711B615748B9F9A94114E977E472C604 BRETEL?
343,032,019 *2244ACF85E0FE48B6C39790CE0AFEFE44C782BE2 bret.favian
343,032,020 *22406129BB62D8C1AC5567C4A93FBC04404F948B bret.hoekman
343,032,021 *2242EE755FDACA70D734AD5E0028FE6431261C3F bret.hunte
343,032,022 *22473F4F135716E592AABD5CF973361A3C700AC3 bretislau
343,032,023 *2240F3574DA619176C635F227549D715C62DEBEF bretlittlefield
343,032,024 *224CE51DADABDC5E61CD4CBA34459BE2CF4EDF7C bret.maffei
343,032,025 *2241C6E23EE256608AB2D8D504F85068A53D61F1 bret.nahass
343,032,026 *224F548EED8469C18E92E3C3881AC90A1158CF93 bretonnians
343,032,027 *224F68A79A5F98F0EA92C8B9EEAAD9D602FB5172 bret.osley
343,032,028 *22413B27062A6CF4A5A99066F55C3726502BDA0F bret.pavy
343,032,029 *224F730508925DF725BCC72F06BA5827ECA1A79A bret.payment
343,032,030 *224822C419C7F23731D0B67F0161B37A541053F5 brett.bakowski
343,032,031 *224069891C69480C3FEA6D947CD3692A4057ACD1 brett.basini
343,032,032 *224374438B6750C9067C9C8E8F7D8CF16B360AF3 brettburman
343,032,033 *224E66831656926B802259F60B0C5D23B5ED2A23 brett.daehn
343,032,034 *2244035133C1FCC8120671E9DBD575E2898B531E brett.diede
343,032,035 *224797786612BA6307749E7BC9138F2D67518F57 [email protected]
343,032,036 *2248AD0398E71C3EC5B0CB4A7FC6B9AA25B60ED9 brett.essa
343,032,037 *2247F0E8A704B4A7C4BD44CE77ACC878A260165E brett.fugueroa
343,032,038 *224A5933C03CAFCB757405B6ECFDA09045C5724C brett.gonalez
343,032,039 *224FEE9B94D1307824659749A14959FB41CAD7C6 brett henning
343,032,040 *224137FF1356D117656F6BA1DE1FB2AF03BFC50C brett.keleher
343,032,041 *224972263EDC28B6CD477928DD84DE95ADD9A0C1 brett.kuhner
343,032,042 *224E0E00758B9DD7547CD8C528B4436D97668BC3 brett.lilien
343,032,043 *224B893CD936CD737E9C5B1F98DD65A7D689F225 brett.lipovsky
343,032,044 *224519E85CF0159CF9550127CFECD190DBCCC9CE brett.mehlig
343,032,045 *22432F1A4C8E4A123F859973605E3E570E763498 brett.naz
343,032,046 *224F978781603F8E1E023D82AF28035C4607F3B1 [email protected]
343,032,047 *2245A9A7270C723E3B1FE07DDC5EA2A621B0D616 brettny777
343,032,048 *2240C3350161ADA23281A6E92EFFA8E290ACF1F8 brett.ostendorff
343,032,049 *224797A0FFB454E902EEB56FCD69DC51718DB779 brett.prondzinski
343,032,050 *22420753882364C23FA7D0E80DFB0AA72DB7D899 brett.proscia
343,032,051 *224EA389AABF0E308E70BE3A6A740E6E4D43B953 brett rupert
343,032,052 *2240673ECB2866967E9130717CD9706E143AADCE brett.savinar
343,032,053 *224647D196ED4E43C644EA5BD338C19BD3E9D1F2 brettschumm
343,032,054 *224C4AD4FD87491050E4B71F5A6F82C656C8C247 brett.sealey
343,032,055 *224F29F6978E802ED452DEE34F35110F6DA7DC98 brett.spooner
343,032,056 *224B68CF8DCC9DBEC50D27A4EA5F95DB2EDF36DC brett.vates
343,032,057 *224714D15B59E7BDC0994A5A76C0B1720D7C50FA brett.yurovic
343,032,058 *224EEADB8F563D96CB076533044150FA78EEC11A brett.zannino
343,032,059 *224807AACC7297DBD127651622AE529F2B2DAD52 bret.zagami
343,032,060 *2247827B2F64B67E12DB211D7A5482F91962FBBA BREVANTHERUM
343,032,061 *224CFCC7C19DB6FAD49842C01303233331BEFD53 brevenloper
343,032,062 *22479CDFC04EB73442B036DD6A6783712B98F54E breverandas
343,032,063 *224BDA0F04C15CAD5DE959A20ADD118E94EDDC14 brevetar5
343,032,064 *224BF4A49968FA9CF76579BA0F2ACFD52DC35E54 breveted!
343,032,065 *224F7EE97B51F047CF36CE61C2D448D5012E0409 BREVILABRUM
343,032,066 *224D36615ABFD2BD3580801D5320A2B11F2024F2 Brewsterjeva
343,032,067 *22467189634965FF348D1045253D0DE1DDE3CDAB BrEWV
343,032,068 *2248B8502D67024F7C5C5F9C2DD7AC7E14063571 breyon21
343,032,069 *224EBC8D1A8A1904B4A4812AE14E0EE20B8EAE5B brezhone0
343,032,070 *224ABA188725F233BFDC28319E5CF40E06FFD35E břežskému
343,032,071 *2244028DEBA6505AF9C389B8CAA7F8F0B7B98B17 B:-RF
343,032,072 *224134D584F18848E8D46B6A757E3D0AEF47D01C B"!rF
343,032,073 *224664D51493337F2430725594EF440418DCF3FE B&r+F
343,032,074 *224CA594F05556DD0CF67A3ABEBC5112861E5A11 Br"?F
343,032,075 *22416034746C865B8A889C1744402A0FB794B204 BrF0-
343,032,076 *224C70558DD35DFF19AC1D7634C80AC14800EDF6 BRF0e
343,032,077 *2247764F44962037AA693B6895529949D6CE65D9 brfdbsw7
343,032,078 *224F177DD4980214D99D13E81C54DA3923488C26 BrFN+
343,032,079 *224A6A2C137077E99F69B13F7A9EAA3058A6A3F7 BR&FP
343,032,080 *2244D9EF0E90A914F9555E1BD6ABAD728DE82372 B-RfP
343,032,081 *22434807DFD7D0F3ED8505EA506DAEB157858DE6 BrfpX
343,032,082 *224CA470998FA6CD663F85FBEFA06144044BB68D BRFs)
343,032,083 *224F0B34D59D20227C89C7F18169DDCAEFD356BB B"RfY
343,032,084 *224F5A34FE4EB6EE614A84190BF2F2CE8E042FCA B,R;G
343,032,085 *22401F3AED9F63597BE72C719708CF449F91E972 B)"RG
343,032,086 *22465ED010A3B3B29735D2614EB09A28AD5DE7E2 BR:.g
343,032,087 *22461D0C2A8DE35309B1191EEE0AF7706A85244F B&r_G
343,032,088 *22493D60F7B94420D7B906C71296E8C163753CF9 brghtsh7
343,032,089 *22452C549DEF4110F1DE599D5937926478935361 Brghtwrk9
343,032,090 *22440AA036E9F692284C8A1E64287006D6C02DD7 BR,gi
343,032,091 *224C6FD394812C47618E3119042F1DBA4947D2E8 B,rgl
343,032,092 *22491FD9EA1924097090FEB03F3227E7DAD2C86E BrgM=
343,032,093 *224D981EFFE264AF8B85590F6808DD7D230B0C3E BR#Gr
343,032,094 *2240B2E29ABEE3A704FB0D38BB04C2742990B89A BRgrC
343,032,095 *22474497BEAE7A7B211A1466E60A46E90792F7A8 Brgsajtboltkir
343,032,096 *224C5BCA33972EC8AFFFE63F0BAF29AE34DE2076 Brgvrwns
343,032,097 *2244DFF93A0D2F6DDD1BEAC626365286A39AB0F7 BR-gw
343,032,098 *224383D90E173C5C2F43CCAD3DF033BD832E4CCC B
343,032,099 *224E4653EC44371588E8A12936A5E4BCA2F28DD9 BR&h#
343,032,100 *224A9D9421A56BAC1391984651E021D6F1CB274D BRH.2
343,032,101 *2246BC9ED99060C50E75AFBD60F5B814A7843305 Brhamanaa9
343,032,102 *2244184EDF5A12E4C59C61D6BCE1B9D2CFC9E468 BRhbX
343,032,103 *224AEE019EF7899AAE97794821F1241CCFFBDD3D BrHh%
343,032,104 *2244D71303D418FD7B789473A647C39567EBCB8D BR(HK
343,032,105 *2243B861990C10B304878A87B388423586DEB2A2 brhodesiajp
343,032,106 *22413F53BF422A0264B90B2FE05F75C09C1FD611 BrH$p
343,032,107 *22492B8C76CCCBF65FDBF8E8DA7C5BFD0CB1337D BR?:I
343,032,108 *224EF198B107E7316DA44F5AF24107C2EF347DEF B:=Ri
343,032,109 *2245C868F1DC5E5BB9FFF4D5F525D6A62CFE1012 BRi%%
343,032,110 *224A9D304953F18305FC4123791211F26E4FF627 Br)#i
343,032,111 *22470E8504E38988A30DE13784381C378DF78544 BrI3
343,032,112 *224B029994D7BD654D8100BB83487F7C1A1C7838 BRi7?
343,032,113 *2244A09A3174145317DC04A4CD4A6DD1A029FE28 Bria107
343,032,114 *2240B126825F4C77EC3730B6AECBB27F5CF75086 BRIAN82103
343,032,115 *2248EF7636FA7A3D7FCA187E3A0CDA3A4CB8B1B3 briana925
343,032,116 *22416B721BE2F6881B0682D7C2DC492D7EFE77E8 brianabee
343,032,117 *224CFE26C0A38C985C33335B1C04BC5218F58285 brian.anastos
343,032,118 *2246F1EDB195C5A162C7E5A13BE416FB4E60E43B brian.baltimore
343,032,119 *2246FCC7A03B4C667F1B939EBBAE02CB9DC3663E brian.barber3
343,032,120 *224309D42DBC0A443846911AA4DDD04FB72D4B8E [email protected]
343,032,121 *22467CF48733F6235D744173F14A7002330D1778 brian.blomstrand
343,032,122 *224F9881F51479CECBE9C550F8E02C5A011C295F [email protected]
343,032,123 *224C67D7F9E0152F6A5A7486ED15F2779EC9ED1A brian.bramley
343,032,124 *22416C35F939086D99989C733A50A26B296990F3 Brian Carroll
343,032,125 *224B3C2BB860260CA5E7B51B9301E529720F3DD2 brian chesnut
343,032,126 *2249F416C24CF4411E1F9C1AC80097999BB38A95 brian.divan
343,032,127 *224C2DDBC0884F910A1E851B2839E89161F66E58 brian.elizalde
343,032,128 *22478A1C151939FD2BF838580FD26B3D4D774CCD BRIANENSIS
343,032,129 *2247905B56E01720C62FE7F05ADFA7BD2845CD96 brianerman
343,032,130 *22456A5430338358562174AA9C990D7A7229BE40 brian.galapon
343,032,131 *224526055F1A5E346575C8FAF61702C0C030400B BrianGeraghtyByPhilKonstantin
343,032,132 *224FEF2D71276283C6FC694D9083FD17AB3CCA97 Briangray2
343,032,133 *224AD6CE422FD5D7DD444F3431F87D87B403D893 Brianhola6
343,032,134 *224C155175806C42705CE48DC7EFB9C68BC650C5 BrianJelliman
343,032,135 *2240EC6F7DDB2963C19BB1B4C0A4F19343A5AB97 brian jh
343,032,136 *224CC8307EB82F1898EB840EC0CC4C5E521EE5D3 brian.kuta
343,032,137 *224C0E0B056D55733285471776B9562439497AF5 [email protected]
343,032,138 *2241E676767C39EA1ABA7FB7C87F25C4CF216197 brianm4015
343,032,139 *2243FC80B652DA3566D78DCF32DEA7D339D5DE20 brian.maillard
343,032,140 *2248568B122C92993C721EF2E6AE27636A806C8A brian matthew wilson
343,032,141 *2246AE70327FC335981E8F67DA95D3F074475732 Brianmom1
343,032,142 *224216E11447E1DB1C05A3B78A62F396BBBFA478 briannaboykin
343,032,143 *2249973EBAB6AC05FC6702D79990F4B7748D0D1B brianna plummer
343,032,144 *224E5721BB9CD262816B915DC979D1FB58CD93A6 briannasewell
343,032,145 *2246D8BD2F890BEF5E036C45C6F579D32C0C10E8 briannastewart
343,032,146 *2240B2E9ECB3963F8857661D422EB8E24BEE2C25 BRIANNE613
343,032,147 *224923933AE64E2BE1336DCC1C35692B8B035C12 brianne barr
343,032,148 *2248953ABEA7B10F32230380F6A2179272EEA6CA brianne golding
343,032,149 *224235CC2E22B868EF41559CE0BA7AE0F3460EA3 brian nosich
343,032,150 *224769F2280B23C11573C5094CE7DE97F8454D10 brian.pekrul
343,032,151 *22433357A2ECB045977E67C669D388246A8CCD13 brian.pencak
343,032,152 *2246D57CFEE99CE65D09CCA09DFEDB144A2DCDF9 brian pulido
343,032,153 *2242C1FB2BE4FE942F80A902860946A5FA3C43F4 brian.royce
343,032,154 *2249FF53E4A7A231698BD2B64FFDECDD482338E2 brian.schilk
343,032,155 *2244D5C79FF0D884CEC49803808352DDDB7A55D8 brian schilling
343,032,156 *224A9BB4AEF03B9AB86093733A9A1EDDFFE9BDA9 brian.secky
343,032,157 *2245CFE37711107D024542ED4AE2224EF5678C64 briansindelar
343,032,158 *22409DCF615F88DBF0490CDC2165E7AC0ABC9667 brian.snaza
343,032,159 *224C49F871E2BF57170FDB194BAC818D0D0B876A brian.spirk
343,032,160 *224C50E07B70268B966A8B70861B4A2E2615BF18 brian.stark
343,032,161 *224105CFAA3DAF68DFAA6197ADFAE3182F53E051 brian.steinbrecher
343,032,162 *22415F2D7BF1B676DCDD38A4F772F2D867722D56 brianswope
343,032,163 *22465DD2154247BD2B7D63A60F64CA6690C51FAD [email protected]
343,032,164 *2249E9F011ADECEA93CFE0AB9B1C7EE420AEDC9F brian tennis
343,032,165 *224982CC1AE2538F38340336F256AC0432CF29BA brian.theuner
343,032,166 *224853321515E5E5E67AFFDE3B28C3E5976413A7 brian.torri
343,032,167 *2242E334805F22F4CB29FAC1A4207FEB9269727A brian.tricoche
343,032,168 *224462A22E561307D8F4462DA5278EAF88DBFDAC brian.tunson
343,032,169 *22410723D6958D8A50432C659849124713C7AA10 brian.wurtz
343,032,170 *224B14651B7F2BB0BA83D6678CD28B3F6918F9A1 briarwoodprjf-ocean
343,032,171 *224930012B58F573873D610460588DB365D600C1 briatore1
343,032,172 *2243481917ACADA0A61FC72DEDEB3EAC5865B3EB [email protected]
343,032,173 *224F646F2E28954EF4967E77EF4819837B89DCDC briba812
343,032,174 *22420C5F87FFDB18872717894D4F0479E878A607 BRIBED3
343,032,175 *2242BAA051CD818B04ED58212BBEC6A88F428823 bribiar3
343,032,176 *22433DAE515478FE425644BA08A6985A58145B28 bribosse
343,032,177 *22435F8B58A4C050BA53ECA3AC21E87A49B10FC2 Briccetti3
343,032,178 *224F1199A3864D38F71703549F99D5DED0DD2341 brice.albornoz
343,032,179 *22433CC730272B40D96D96DC857F3DD5018DA62C brice.biener
343,032,180 *22418E91906BC8635B07D17A17011F82B68EA9AB brice.braegelmann
343,032,181 *224948C0CB2790B495DA46BF5DC8450EB9114BDB brice.carrigg
343,032,182 *2246618178221CD6D42DA14A0EC744F3A834C8D7 brice.cruse
343,032,183 *2243454D981B7026E0B43AA1C96CCEC401FF58CC brice.drabek
343,032,184 *224812F3D69032521EDDD2E2989875B421F65951 brice.franeo
343,032,185 *2246534A62D21283975BE8CA14BC17A42D775BF4 brice.menge
343,032,186 *224316D294EF9389767027210EEE2CEB30525A7D brice.moeck
343,032,187 *2246B5378D287624B28F9E922377BBC2D997F656 brice.sames
343,032,188 *2242B68DF9CB99E8B7A32F689D0B698BEF4F1C67 brice.scheuring
343,032,189 *224B78D4CA99C36CA30A78C1519E2BBB331B381B brice.stormer
343,032,190 *224F716E22238002335D73D794E431B0E1054437 brice.szufat
343,032,191 *224DCB13F1954A86E18D1BC86F97599054505A91 brice.toczek
343,032,192 *224ADC0D0280F9A7B9D995771FFCC50EB8F82B0D brice.venske
343,032,193 *2249545AA6A76A3F967E78F48E49E5F76AD6AE02 brice.wernecke
343,032,194 *2241E39F2ED962001C07E7EDC1E7E0613542C565 brice.wherley
343,032,195 *224186EDF46011367067002BE46E5529E63BFE53 brice.wohlschlegel
343,032,196 *224F33F03E07B4343BD67DB4CCBDE896095A9483 brice.yeaman
343,032,197 *2249A8172DEF925648FCEFC7E7213CC9073CF283 bricharded
343,032,198 *2246C81E700D62C7DBC8950970E793240AEC70A0 BRICHICKEE21
343,032,199 *224F9198D7D90ED0FAE4234EE2DFD3999602F83B Briciole0
343,032,200 *22481B89B7ADEFABB44ADCB547A7B86F6603E8F7 Brickear
343,032,201 *224FAF0413B4DB97394026AC1C6D113119C3CCE9 brickens6
343,032,202 *22411595F01AD1FB2D7A6B02B182B8680CAF6E1B Bricks8
343,032,203 *2245215F58580C0655A5354BA528FFE352A6610C BRICKSVILLE
343,032,204 *2242606B6E344ACE0CEB322D7D106EEA08023B99 Bricolee5
343,032,205 *224D155915CC22BD298378800D9FC99BE3EDE465 bridal.threaddesign.com
343,032,206 *224EA652088FD727BFF9058E53AA294A349E0BFE BRIDANT3
343,032,207 *224C75DBFFF009A4F6991F51AEF07982988BFA55 briday1234
343,032,208 *22415DD3BA49235F9B1089A2DF16A900850F828E BRIDCOLL
343,032,209 *2249A856ADC3C6241FB2306E4D55B7A073E56E1B [email protected]
343,032,210 *224B8C579F7BD45A06D25C61393BF2D9F3773E37 bridgegw9
343,032,211 *224F69DD88BDA6419B435090728EDD7D58AA326A BridgeOverTheStars
343,032,212 *2245F3D04360C192D56AA97882F627115E512486 BRIDGESGRETZKY
343,032,213 *22429AF7E5ACE179A704C2042E338D7DD602D1E5 BRIDGES'-'JOHNNIE
343,032,214 *22414F03ECAC0C9416E603225E28059449D405AB Bridgesks
343,032,215 *224305B59D8E5A667E7B08B092A6D96BDF34FBED Bridgesyvonne
343,032,216 *2240ECF05E10F2381D7DE89866A3D23CEDF695E1 bridget873
343,032,217 *22443E72530F52AC5DB6776D6D86D92A9EE0CAFB Bridge
343,032,218 *224931F4B0C8E7A7751C7E8D854E12731192D8A8 [email protected]
343,032,219 *224987E5F78A12011F36D81B45A19C863581C103 bridging-arts.comwww
343,032,220 *2245521902049F98B2A6CFDD106B6171DD230884 bridled!
343,032,221 *224F8AA9E9752557D908EEFF6603967946FEC988 [email protected]
343,032,222 *2243605B28626DDD57852320ED07E5F3BC3F9298 BriefkastenWerbung
343,032,223 *224CF4A4CBB7EB9734887D87D747DBD84278C43B Brieftem
343,032,224 *224E7053EF525E2CD94347EE3876F507D631DC52 Brielle547
343,032,225 *22476E2301D3356BA1103F2B46E518B5A915077D brietaateirb
343,032,226 *2247F90A5738E07FFFCF7A8AAF4373ACB42431D8 BRIETAS
343,032,227 *224BBF328DBCFD0E627E3E8671B40C1D77C1427D [email protected]
343,032,228 *22468A7D5EFC1A5044DD7101F2CCE541675859A8 brifsp
343,032,229 *224A6AC436D1C7322868DD81D619311458FD0058 brigadeboks
343,032,230 *2244942EB9CB96708DB0E12E837067E4C01585B5 BRIGADE-GENERAL
343,032,231 *22486A4BBC2944BE31A32360F46DA76B096EEC94 Brigadeskimeisterschaft
343,032,232 *224AD78BA033F194625D50AB4A00666C7B79E831 Brigadiership3
343,032,233 *2244BA7A6A820076566C6543F35E9ACE355F74EC brigangs
343,032,234 *2243FFA28629CAF06A84FB3196CE2598DF29B0C9 Brigaste9
343,032,235 *224EC21766E6547D1F146648C01C5B9884C54D52 %bright
343,032,236 *224FBB143588448AE48BCF5901C9C8D101428721 brighter stars
343,032,237 *22430303CB9AAB3288F0434E4FEB9F9198161C4E brightie6
343,032,238 *2247B6299B53C4B0CD4C5B97923E0851BBFEB1FD bright side (remix)
343,032,239 *2249AB4F68DBAC05A1CD0D717CF9DC6B0F7C1901 brightzao
343,032,240 *224BD27FB14EFBB630AE3A049BA84BEA8A2ABA1C brigitta sabatini
343,032,241 *224E35A1B6B0E51E745469D28F81BF78D3EA05B1 [email protected]
343,032,242 *2247E6A2AD92F7E5B4A22E5D1C43001732DE8C92 BRIGITTINE9
343,032,243 *2246B30E13A00D9995D9E9E5AFCA0F5A5B43A473 Brigtness
343,032,244 *224CB34DF5E3D8BF95AFD147385D2CBEACA5AECE brijenijo
343,032,245 *22496F14FC79E0A6FDCD994BD58E8FC01397725E brikciti1234
343,032,246 *224D06BECB77A6CEF7D41497FA6CD515DC90B7D1 briliantwise
343,032,247 *2249014F38815F8CC68661945F33A7DC162AE0D5 BRILLERONS!
343,032,248 *2245B037A3C7FD8F3C312C4562D177F78C3B45B5 brillokw
343,032,249 *224EE59B27B7DA92F523F76D5F9099E21C420FA5 brimb4l3r
343,032,250 *224EEF333E76EE7D5F71C1329AF61566811060E7 brindlitz
343,032,251 *22441E399954188122AE5CBAF135B0013757B172 brindmatt
343,032,252 *22474584CDE2B7927BED713189C949B788B87AD4 BRINER7
343,032,253 *224099CE3A1F124237E02D8A288023DFFA61CFF9 BringDownYourHope
343,032,254 *224BED21F16D5FFEDCB3B2A0B89F3A8AF3B47B7C bringenl
343,032,255 *2243D8688CF49348B11E13BE64C8E843B06213DD bringitonhome(tome)
343,032,256 *224A24EF90058466B6DDA916E270845F113E5293 bring me the head
343,032,257 *224F32AF104281C872FF7308394072CA6BC888B9 bRiNIeSt
343,032,258 *224667B9A056C67CE2C7D09569D380F71E6607DC BRINKER123
343,032,259 *224266C51ABE21E2039BA8BF4CA464F5B1159A3F Brinkhoff1
343,032,260 *224AD9879498C085EB806AFDB38022D3E8DDD83C brinki{
343,032,261 *224C17C53BE8B6094ACEA71984156E5ABF741885 BRINKLOW?
343,032,262 *2244D091ECD0908D88D2336DAEC0073BFA6E9C13 brino18
343,032,263 *22401B41BBE92572D710F0387E1114E9ACC8FD58 Brinteled
343,032,264 *224BB1137192D98082E03E06F04D8AD4CEA90BA3 brinuli
343,032,265 *2242FDC3E6F58E6CF7B3E5634DD38D88DAA6204A briony yates
343,032,266 *2245A17558408B79D08C1FFA2213D54F364954DE BrIr6
343,032,267 *22460116B0830D1A9C8CF0445B2F016B15D4F206 [email protected]
343,032,268 *224F8A5973565B865B0665D1F123F5DA0057A80F brisance?
343,032,269 *224AF66DB53CCBF3A3958A8D319AACA7CAE10F0E BRIŠETE
343,032,270 *224844BA59B6DDC4D148AD25E12E62B39A9E11BA brisev
343,032,271 *224682901FDEC9E577466FB6B8F12B2F6835A7AD briskeby8
343,032,272 *22422F8C0B1DBC98E1A15F75C998E1972F484D0F [email protected]
343,032,273 *22410E28583E5248C5F9A56EC7F504DAD09BA044 bristoltalkcastlemea
343,032,274 *224C2F7EDF24F8A62B7FABEC38572AA9AF833624 brit8807
343,032,275 *224553D76B6CCE3A11EA16DFDA603CFCF98C0852 britaincivic
343,032,276 *224BED8C96306981D5834191EA7518FA1BFE93FA BRITAIN-SHOULD-GET-RID-OF-THE-MONARCHY
343,032,277 *2242DD4E940F10032249EEB4C8E2C510758EB515 Britannic4u
343,032,278 *224438F6E1A92938837CF1BC66B3662518091C47 britanniciniae
343,032,279 *224C1FEDA5D600129F543D8F779E31AF02B34802 britannu4
343,032,280 *22442E00DF73261A7E0175361543351ACB412129 [email protected]
343,032,281 *224706FA31EA48960BCAA5C7C9FE4727EF9E4991 britcynical
343,032,282 *224E5346BEEFFAB66C51880F4D787EFD627F3306 britestrategies
343,032,283 *224BA67C1A526262D236E5D69D94260BCCA48513 BRITHYSTERNUM
343,032,284 *2248A1549764989F23CCFF534462C5009E5FDDAD Britille2
343,032,285 *224127627A02190F422D2BEE049BD82367ABE037 british1234
343,032,286 *2242DEAA65C7EBD8674239DE265763D7DB44F0F3 british–czech
343,032,287 *22464FE8AD6F2E8F152F27AB6A848E1CD0218B08 BritishMan
343,032,288 *22463037C066E7E60FE5E7415EEDB6C4C9856018 british.no
343,032,289 *224C1E8C8055B1350CD597289FB4447DE31C289E britnell7
343,032,290 *224FF1EB8BDBBC26576B19E44C00630026F1DD07 BRITNEYFIRSTWEEKSTATS
343,032,291 *224AABD1F189B19C1C57063E15A64A26A8043F2B britt.alper
343,032,292 *2243E7ADDCA61957B6E250DCD9ABA0E32552857A brittanie fowler
343,032,293 *22439B17ABCD6D8CE0C2D28EA6D573A08D284C50 Brittany540
343,032,294 *224716F2D6A194D32C2BB6417211B916D08515D8 brittany624
343,032,295 *224180B0A920FDB923E4BC71FC400CEE9A6BFC66 brittany7568
343,032,296 *22420A603E3FE1330407E3BB2D10A77B0EDF4BB3 brittany ann smith
343,032,297 *22467585D8FDD69472123C0213A85A17D868EE21 brittanybridgman
343,032,298 *22446D2FE264913AFC1C6264372862746E05AB19 brittany diane
343,032,299 *224C5653C8E9524AABB059BFD167AF0E0334136D brittanymoseley
343,032,300 *224F24A454BAE3D488EBF231B4BA71DF228CD353 brittanyperalta
343,032,301 *2243F41EFCC04AC251C8D80ACCFD80B9B2ACC7A7 brittanypuskarich
343,032,302 *224D6E5077977FA1C313A2333BC6514B9D35774E BrittanySpaniel224
343,032,303 *224571AE921AE830414B29264F77BFE7C1A600CF BrittanySpaniel761
343,032,304 *224F6B5D7D7F660D0247379C057C8D3B160FD105 brittanywalthall
343,032,305 *2247074A5E3B98714179154892647F1500A44A03 britt.borgmann
343,032,306 *2249F1B8BD1A440F352203B51A72AE865AA0C5E6 britt.botkin
343,032,307 *2246970B9884BEB4C64FAF94107F3E4D12804C46 britt.gleitz
343,032,308 *224D4140EE13C8B26A75A3BDC39E605E975B1D92 britt.glew
343,032,309 *224BC4CEC36D7C88D359ED07A9A48AAE584DD761 britt.hew
343,032,310 *224ABE72D45CF8CECA1F50E9A9697D753ECD7D2E britt hougen
343,032,311 *224B6D8E7DB650A05D94152594F2D249DAE3DE21 britt.houpt
343,032,312 *2240629B0C72D431D42592BB228657F9D70DB87F brittish-wikipedia
343,032,313 *224076EC8E6F529428186D171BBED6B071809EB0 BrittiSoloUnaVoltaVideo
343,032,314 *224944989A7C04C8143006E33EC680B07E37904D britt.kasparek
343,032,315 *2244F776059997E404BF45E5B0DE31BFFEE14DF6 britt.lescano
343,032,316 *2247CF762C3FAF87064F6E108E41386234030A88 [email protected]
343,032,317 *2243D8C0A0A3B175F8A6FAF7FDAB517F37906203 brittmccook.blogspot.com
343,032,318 *22494F6C485059EAE2A956AF88DE7EE6E892727A britt.muro
343,032,319 *2245FE5DE053ED644D65180DAFE94335C24E0453 britt.nerio
343,032,320 *2249DA3822578D479ACDCC61AC99890EDFE3AB5F brittney lankford
343,032,321 *224C5C0BCE6C126BDD979EBBBA0110EE66D7DA5E Brittonums
343,032,322 *2245307FB8467DFD43F5697E5C8BD434CDD04184 britt.pidro
343,032,323 *2241B14B947921B11788386473635254EC12F63C britt.pruchnik
343,032,324 *224E3E863323085EF040BBA8B0E5F9C954801169 britt.reitter
343,032,325 *2240013ABCF42F917D64C05FB5B53CE2D7FAACA3 britt.rodibaugh
343,032,326 *224E128F0BBC6877A523528B9CFB48A4E8731439 britt.sajorda
343,032,327 *224D215031B0CDBFA5CF4F2A4251302B18160FDA britt.saluja
343,032,328 *2244CA6BBF759279AC6B7709D0000107A9A301AA britt.schroy
343,032,329 *2244C7A90F2F70345226E4D334A5B7DC23412EA1 britt.spoelstra
343,032,330 *224D76807E6993C9A5012A5A58BDCF9A54F79368 britt.suriano
343,032,331 *2240EAC6CC2284F4A4C50BDACC83F3E00D04CA05 britt.vaneck
343,032,332 *22435002BA6DDE348D727F6E383E327AAC494453 britt.vigo
343,032,333 *2240C4B53776FD7EF29B0E58D8E15E6D6D3473D2 britwellians
343,032,334 *224FDF1471E21748DB661E1AC886DE4380F16818 brityuan
343,032,335 *224F9161EECC280C6A65880141638368D672FB46 brix6
343,032,336 *224B97514EB0615C19A99C481D397F48EB221D2B Brizambourgeoise
343,032,337 *224AF1FD5F7E6E7B6A550A716782EFC5555D1761 Brizgamed
343,032,338 *224DA1EF15083C02430D91DA0B80994BABD23656 Brj.3
343,032,339 *224347FC779706B1BC6FA628C047E12ADEACE7A8 BRj,d
343,032,340 *2248DEFB6E96B7DC208BD0D6F37CF918E48377B4 BR#jp
343,032,341 *224EE134D22FC39043842AC0B73978E684A1679E B&rjp
343,032,342 *224F39A241D6CF114FEDD3F3E23A7B5E42FA98E9 BRJw
343,032,343 *2244F21252035A074863AA4B28E4077B46B0677D BR(K-
343,032,344 *22413B29D8A66BF13A3D535A8FA311407B03BC80 B,R_k
343,032,345 *224A50BCB96835113F62E6E99A4C21148A4E2FDD Br!K;
343,032,346 *22459BA6C5282911125A6B7CE5C1F8C41F3AAD7E Br
343,032,347 *224EBC8D28FFF11FDBFBA25142D90CB127650CA9 BR%K0
343,032,348 *22405B9225D8D52CB45F7153B002BFB26229BEE8 BrK80
343,032,349 *224FA73801B24CA87AD98678C216197E5AA83E28 BrKag
343,032,350 *22424EAC12A54FC28AFA7D8F7D46331D6CCC71AC BrKDb
343,032,351 *2245F52E7CE076EAB68C259444E4CE60B2B3BE1D BRKDYTW94
343,032,352 *2245B8CA9A6285D3820918A254637F33CC0B2A11 brkfld
343,032,353 *224F9C6F932FA674A502501927826CB05CABF468 BRK%j
343,032,354 *22441BAB139A4402E9524A303A1EA02E184872C0 Br
343,032,355 *22453C57AEC847161FDAC2B534852549B154E99D BRkMT
343,032,356 *2240B9501C9F4BC6E029488C733F554E3C08D543 ʌbrʲɪˈkos
343,032,357 *22447B782E7D91142FCC398569BB1F5D9A2FC191 BrK+r
343,032,358 *22460F488DFC0820EC89A2335817015616684138 Br%Kt
343,032,359 *22456DA9DBDA0E205D0F42C145DF49C252A16C4F brktrvl
343,032,360 *224F1961CDCEDEB35A91F266C5F263E60987F971 BrkuZ
343,032,361 *2242E3504914E174FF48661F9F7EA8CA7089D423 BrKv9
343,032,362 *224C3A849BEC0FFA9B2AF6A02C2AA4C9EA7ADA72 BRL?
343,032,363 *22427F6F8A83DB5F3821099CB4AA5A922210C29B Brl=(
343,032,364 *22412DB786C5E1ED00922B483EDCDEA101BD38A2 brl020489
343,032,365 *22405B5D5AF8383FFA361C23EB4D2618F0FB50F5 [email protected]
343,032,366 *22498E858E047A1C80AEA0F7B0F7F7CDB5F80DF1 BRLh7
343,032,367 *2240A9B642E584DA72002331BF860FB5E5E3C779 B
343,032,368 *22413B91813F755AA936D61B8724E72C0D032197 BRLK:
343,032,369 *22433B32CEDFCBC7F2CA6A82436C1B66E6CCB840 BRll6
343,032,370 *224456F5A4E60F6634EB7544D9BF527499329EEE brlovho
343,032,371 *22424A0587AA1E860C92FDC200CEEB6FEBA36925 Brlv.
343,032,372 *224DCF88CE0F9A22278595002714CB5D001F9CB8 B!R!m
343,032,373 *224D6D8FB0DD1B60D8216193D3539A82ED7F3842 B)-rM
343,032,374 *224A56A663772F3EC426BBBE5F0F911FC38A4DFA B"RMG
343,032,375 *224F9D5D311F959AC71D875F4C035A2B0A7B7DA5 BRmgW
343,032,376 *224F73E5FAAADEAF4104762987E44DAC1DFF5385 Brmhydrt
343,032,377 *2249602A1C8C2347712ECBE864181A72DF8C253B BRMN,
343,032,378 *224ADF078B1ADE172C4E4244112D29FD81E269D1 BRmTH
343,032,379 *224F985706903A073B0F5C7B9B5B14B1FF7EFFD4 BrM=V
343,032,380 *224F5D04936636EFF06A2F7FF83CA494A5D88DA8 BRNC"
343,032,381 *2240F793822FD4556D610BA87709492615845D63 Brnchtss2
343,032,382 *224493BC20378E76FE0B02635B0B851A8ADF0610 Brnchttnied
343,032,383 *2249E665ECA4B495F2708D13A69A46CF8AE7C5F3 br
343,032,384 *224DDE05032FAC11D754A7C5DCEBC614FF34D3CB Brndsels0
343,032,385 *224F1CC1AC4C98547F218E49FF125E6FBD6CE99C brndsss7
343,032,386 *2244E045739741BEE749DE05F2AC827CC0B05038 BrN"F
343,032,387 *22465D63BD66B57AD3E836154F900452B48BCB7E BrNf%
343,032,388 *224A044D380B21BD1E49B50A87A2543334CBF3ED BrNku
343,032,389 *22476662FE1F770F59BEA296E6C4B013B4B1255B Br#nl
343,032,390 *2245DEE438D4031DBBFFCCA535A3DBD17C6CE275 BRNoI
343,032,391 *2240F770CDDF1D7D65C9CA0BE8FE2DE2727EA31C BRnPY
343,032,392 *2242DB0BC0D5E88E5314C0F056F7A12CCE375C06 [email protected]
343,032,393 *2244FA65CDEE19D6B79E9A92A64563ABD2D16895 BRnT;
343,032,394 *224D3B8EAA8EA9C09330F122D13E15FCF074D8AC brnw540
343,032,395 *2240442504DD43F0C2DE83895F788AC836D4261C BR_o
343,032,396 *224CD74FC3C4E524C0D47E89473DA2B77230EAE5 brɔ
343,032,397 *2246BC345197C1D782577FEC9AD4D1A871C1EE2B Br,o5
343,032,398 *224D33A51FD10DBE7E7162AB94E6CF1D9E5BA20B BrOaDaxe
343,032,399 *2244402854B21A7C59D3EEE064C4C055DB887788 broadbandcensus.com
343,032,400 *2243BD2C244C85E843ED1AC79B825E485D55CB3C broadbandcom
343,032,401 *224724822171DE796C10573B65EFED03E7DAD139 Broadblo1
343,032,402 *2246D1A06CAD06BC8F5779F7510C392A818593E6 [email protected]
343,032,403 *22439F47108649261589B9DB3070CC67E92B4CA9 broadcasternow.comwww
343,032,404 *22439C4AA3189258E76014563C376512E690DE90 broadcaster-supplied
343,032,405 *2245E34CF9DDFFEE0BE1908A7D20EFEB0461DE90 broadening!
343,032,406 *224D9A9639DF7FB345CB1176C95F99474E390D79 broADISH
343,032,407 *224332548AE51E62AD9DFE0A840502A6CD0CFE53 BROAD-SOULED
343,032,408 *224C489ED3A3F3BC72DC9C1092E18672AEBBFDB6 broadwayite123
343,032,409 *2243FC01D8CB72513B8114A7B2EFE7EAF431D4DD Broadwayshown
343,032,410 *2242A5E10E3F5B7BB64EBF2B95B81C03A3F1727A Broartxe5
343,032,411 *2244C078A9B0171D5AC00B5C3767DD407BE4D01E BROBJER
343,032,412 *2242035AA438F16C7E1B749BF70C39FBEFD9DA07 brocada4
343,032,413 *224F5942A879C2387FAF7F7A44705F82DAF653CC brocastes
343,032,414 *224654C8104152E1CAA6E1E472992E2923FF3B4F brochettes1234
343,032,415 *224AD6F6F2EFF6D395721168EC0E28FDEAF80503 Brochiinae
343,032,416 *224366781B5722AC57ED3F267257755AD0EF6975 brochure013
343,032,417 *224DFB6FCD7CD2580A06706CEF618F8A3C35892A brock104
343,032,418 *2249EAA2F69080039B8EBDD744ABE0B29CC597F9 brock.aughtry
343,032,419 *224253ADDA3F720572B97F5901323CFAF02BFE8B brock.baroody
343,032,420 *224D60D1B97D69135B3D9CD4EAEEC52FF93DE8DB brock.botts
343,032,421 *224304760C6DD09CBE47C447255C4E83967A332C brock.dickhaut
343,032,422 *224211DE17B0015B9095424789BDF89FBB5C15F1 brock.dobbs
343,032,423 *224ACE84299D5F20B722725DD2D3277830D06CD7 brock.dobler
343,032,424 *22453F93F577E35D0385271AA7FE0C3E857C41E6 brock.durupan
343,032,425 *22483CB4F65FB6E842C0AE620EEE4BF53F1B5F9E brock.ehrler
343,032,426 *224CCDEAF7B76A1FE85DC58231AAEE06AC2B471D [email protected]
343,032,427 *224E5E023E4767E3CE16470A199C08AAC2E156FC BROCKENBURY
343,032,428 *224D3F5AA2CAE8BF382BB42003DCED64F0B0321C brock.gangl
343,032,429 *224BD185FDB428D2526836F81EE203AF50FCA317 brock.guffy
343,032,430 *224D1D4FA07E55A76A35CB020B7024DE18224BA8 brock.heinlein
343,032,431 *22438050C44C1D6723B843BE0B74275CCD920672 brock.hurlebaus
343,032,432 *2240CA4A70CCAC0911A45160AB88C6E729A7096F Brockien6
343,032,433 *224025C71069511BEF64AE9B90FE5CFDF9B05C41 brock.kehr
343,032,434 *22474C59105ACE756DA1C6980BBBFF19C86A04CC brock.kilkus
343,032,435 *2243B850BADE1099938234CE05BBB9FBD03C1893 brock.liccione
343,032,436 *22468092616DE7B7C338280CF2357A4D80135E4E brock.lubic
343,032,437 *2242393B2AC3306511A9F342E2BC00F62712B078 brock.ludden
343,032,438 *224055C9F6C7E139E1A4DF09AEE971E2ED0FD192 brock.markiewicz
343,032,439 *224389C8A8FA916BEBCA5291864CDBA7E71E59C7 brock.moyd
343,032,440 *224A888D1D1B1EA86FCD81875AC6C472B5D51350 Brockner6
343,032,441 *2242E482FBA501891A02156D56F772C9EC7E00D8 brock.parrotta
343,032,442 *224EE764DD9F01653A41B10E49733AF05672FA47 brock.pepito
343,032,443 *2242C76B269515330CFEACFE7F3DF86206E78264 brock.pharo
343,032,444 *2240818DAA173E19CDAFD60B00AE9474CEA0A548 brock.ptacek
343,032,445 *224A9F402386BF38B03C2AC1E8A441F3D76D7900 brock.ronson
343,032,446 *2244A3CB75C32101174E3C2313B583778AF7E0B9 brocksanford
343,032,447 *224FFB5984E73565B46993A7F9695CA8023A8E1E brock.scotten
343,032,448 *224E9628FFA955903B18AA8B310E3ABB1F2E2732 brock.seacat
343,032,449 *22407A5BF8D81FBA31349749D52FC1B144C71712 brock.yandura
343,032,450 *224171B4595CC63553D3385E643B41C6C2D382CA BROd3
343,032,451 *224EC3FE67869E945BA178413C8ADBAC6D1B5966 BRODAIENT5
343,032,452 *224E1204A72BBF47587B5099B43B4B216EE66C22 broddensing
343,032,453 *22454F86F759AF6CEF41BE55D68F768C71F5C87D BRODEGLASS2
343,032,454 *224A033EE7187A2196144EC6F29983BCE4B22181 brodenied
343,032,455 *2245AFD4A08947BFD1F9175493A9886F09CD7085 Broderick640
343,032,456 *224E26F73752D7C6CDFC5D55CEF93E5A75E213C0 broderick.bosak
343,032,457 *22430A5CF0552F597EBF3AFC0A9B6C239C61998E broderick.burggraf
343,032,458 *224642A6E0C18BA8495A6C750F5690B8B08C494C broderick.cardinal
343,032,459 *224E896AB88A787CCC62112F9575FB2D9FEF6AFF broderick.denson
343,032,460 *224F8D51F31228BA356193BF756731B69B697E73 broderick.dimatteo
343,032,461 *2241AF5485DFE71868FDDDE8C6500082689BCB06 broderick.finamore
343,032,462 *224046B7034BFC26F76F4A0244A9C5D2C2171507 broderick.frady
343,032,463 *22416BA24F8534546EF284F389331DEE2C8DD5A9 broderick.giernoth
343,032,464 *22446E7212F54E29345431BF392BF31F50CDF091 broderick.grulkey
343,032,465 *2243C4855032BA77F7A51D90C9957434B77D62BA broderick.gutoski
343,032,466 *224D204EDB20D2909906C698FD63C2C11ACA8DD8 broderick.harrell
343,032,467 *224E745FFD2050509849789A8F2DD6E83AC4B231 broderick.heffernen
343,032,468 *224BA17C00059D9CA1963838893B07BABFC4DB4B broderick.hefflinger
343,032,469 *22410188A9D9A2CBEFCFA753BA7494F2914F4FB0 broderick.ishihara
343,032,470 *22462503601F3E2E1FE6DBC4AC045CBB4AAF8BE1 broderick.joe
343,032,471 *224BDF0C531E3EF08CDD98848A09B5B483BC9FA1 broderick.kucan
343,032,472 *224A98A58B541E4357D59F8D5CB5C1B5908BA23A broderick.kuhre
343,032,473 *224A35BBC195FE03CF2A60362464BC28ADF2A554 broderick.levine
343,032,474 *224EAA35331224AB8083D71F47803A62AFC4EA83 broderick.marchetti
343,032,475 *22428DB4D68BFD296E38CD3A91304A35910F3261 broderick.mcgurren
343,032,476 *2247EDD1EF034D953F6C685D2B42355212392F4E broderick.meche
343,032,477 *2246B54BB0945D665074AEB9BC1EFB23639EEC2C broderick.nierman
343,032,478 *2248C325C2D9CAA5B78F6A56EB5DC543DC5AB964 broderick.peressini
343,032,479 *22423DAF245D0387047028EDD3E578CDFDD6ABAC broderick.richards
343,032,480 *224FF80FDD349D9FE5B993200F24512334A523E4 broderick.richlin
343,032,481 *2243A8D38B93ACF158EC1384637683265B2C48D6 broderick.sensibaugh
343,032,482 *2246191D4C2C08256F10C8E7C5928E2F98EBC681 broderick.simonetti
343,032,483 *2241C85EA16B85518CE3989281BC76190AABF19E broderick.sugiyama
343,032,484 *224E1F13C35928AF0895D547CFBDF1CCB663B46A broderick.threat
343,032,485 *224574B8751E95D2256C6C29DE7869F8CED3A220 brodie080
343,032,486 *2242472652B30FC613C879F6C9D46F80A1EFBF68 Brodskaia1
343,032,487 *224863BD0C3E393B1B556E193ABDCFD638E5C24E brodskîi
343,032,488 *224DF45152D7CE3CE6AF90D5F1C53125137FA64F brodyblue
343,032,489 *224E3DD503A738BC77FEDCA887003DE19AC66FE3 Broedspaar1
343,032,490 *224B22284A469F256AE6257A61388F8A133824D6 BROEE
343,032,491 *22413FC7A82E779AF0EB279D1CAB2705960B9BC9 Broeihuis2
343,032,492 *224CB95FB8C29C22DA39AE79293EABA623EB3054 broekrock
343,032,493 *22463558BFF85D84B58B80C475A36A8CCF0D84C1 BR:Of
343,032,494 *2245FDB663D81F8938E9BC12BBC41AFF9A82B88C brogan782
343,032,495 *224BCDA30110B1FA60531D6BA53F79AFB45B8B67 Broget?
343,032,496 *22431BCC7E0A45FA50EB3B72C4C62A345AA5A762 BR/oI
343,032,497 *22470E1265A3B9087C8ED109FA8F4CDB7A5AE7F2 Broidl
343,032,498 *224232661E9F26D4E7BADE3E4EBA71431F0A8E8A broidzut
343,032,499 *2242C060283331675A327AEDD3463F6F68CF527B broĭkəl
343,032,500 *2240EE6C8822D2A04217AC9ADF7A48D7807A48D9 BroiliNg
343,032,501 *224E2F61AD8F62F636177F0FA20991AA24E12CA3 BrOj)
343,032,502 *2244E4E4160B9B4678E75D3011653C9EA94C1218 brojnike1
343,032,503 *22425F2442D068BA633C1F298515118C910C9238 [email protected]
343,032,504 *224386957BF18C766D7B75AF5D08B8F0876AF7F1 Brokenbe1
343,032,505 *2249A2A1DB9B32B146A88EB203841EFD1E096287 brokstukjes
343,032,506 *224EB340EAB8CC64C5214AC928A39FC8C0E7785E B%rol
343,032,507 *2241B8FC8021190F1732158BE0B7B9ED3C150B94 brolinie
343,032,508 *22487B545EC6F01CDABC66254E67BEDB49412761 Bröllopsbestyr
343,032,509 *224737A70EF85C2E2EA27997519A4269FFD2432F Br+OM
343,032,510 *224F1E37CAA203FF5B58E6E29997F937D3E8E89E Br/Om
343,032,511 *2244B80F4AC77DBD70F1060F7ECDC3F807D38898 bromberek1234
343,032,512 *224433EE61E6F15B9C53B549901A10D1F99BB653 brome»
343,032,513 *224E980A84968C5B59D83248E91719450CC9AFDD Bromider6
343,032,514 *2248DE8E52A8FD9BD252D575AB3FA32C873CC0DA BROMIDICALLY2
343,032,515 *2249ABFF82F78F53EF3A368431C56B2F5DA6945F Brommased
343,032,516 *224F05EE1AC8E5CD53A2ABC72B12D557EEEECE54 bromocyanogen.
343,032,517 *2248E299DB20D165B51E93F65542E9C5F1E8BD46 Bromodro6
343,032,518 *224EAAAB1352FA777867CE14A3953025DBA1CE81 brompicrinbrompicrin
343,032,519 *224062A6528F104966CB4A5D1F4259A39329BBA8 BromsberrowHeathReel/PigtownFling
343,032,520 *22483DA2CB45D968409F5C9D2D10954B24BBCD09 [email protected]
343,032,521 *224E08AA7DE430A7936E32DD33DC6A820352EE0D bronatoma160talk160
343,032,522 *224A746C4F74518FC97FFAF48ABBDC0C8A4724FE Bronchaed
343,032,523 *2242CE586B4C554EA5121FF05E5908084188A0AE bronchod!la+or
343,032,524 *224B649B1139EEC4F2EEE9A76B444C4566CC6ADB BRONCHOMYCOSIS?
343,032,525 *2249CCBC78251FEFCD4FEDBC6D89EA68A0D95355 bronciobroncio
343,032,526 *2245AF08C50AD6C166700BD21E4C70AD74A4F7B4 broncofonía
343,032,527 *2248F9EAB40165EE6C6B4EEA6DC5F67BC2A4BA9C bronĥetoj
343,032,528 *224CF0B2656EA3F7DE2CE5C464EFF276C6C78347 Broniewski
343,032,529 *224D77E68824043904966973D7F3D3D0CCC4F3A1 bronnie5
343,032,530 *224AC661E87EB03F3EF17BFA31A33C887968B7D6 bronnz19
343,032,531 *2247C399459EF4E45A4A483A16FD322FB0AA3103 bronsarm
343,032,532 *224A739C25D001682594679BD8D537075A205FE7 bronte beach
343,032,533 *224E93E1D3C744F1F622B2E3AAB13417E67BA352 brontia2
343,032,534 *22458DF3EC507FBC24F03FB909E59DBD828FB67E brontided
343,032,535 *224FEE7C0BD97C042E5B408FC0AEC1E521C422F2 bronwyn dalgleish
343,032,536 *224D5755727C2D092CC3ADBBC6FF84A846BFA50E BRONXSUNIT5
343,032,537 *224F75B7702931C716CC29A6EF3B6E5C7FB4E396 bronzeportale
343,032,538 *224304C964518DFD251F23A11755A703B88ACB7C bronzeschmelzöfen
343,032,539 *22422EEA77FA4E0E8D37BA646392B4F333DEAD7D Bronzewing!
343,032,540 *224024B9A5BD633B8F5271BF606F484CEE9D747C bronzierungen
343,032,541 *2246D2F4066E91E1F2BC2142059754034476C486 [email protected]
343,032,542 *224318B45B980E2708697115C6843334D95E3C77 brookecarley
343,032,543 *224CC8FE76D1B7846DF510B9BCA49067B192C044 brooke-hogan
343,032,544 *224CA064B1390C4FB7CB995628BFAD04FA4A1B81 Brookejkms
343,032,545 *224BC63E025690D67B5FA470A2682440C6808382 brookelofton
343,032,546 *224094C40A2EA6BFEAD8A37DD816D7FC5088AD1E BROOKEMONIQUE
343,032,547 *224285BAC8AA4CB550E63915DEFE33FC84F874ED brookeparris
343,032,548 *224A96126ED025A98E0096A9FEBC0968411265B0 BROOKEPOOHBEAR
343,032,549 *2246EF2837A7BE59DB95FDA0CDF4A4A53F2CA4D6 brook green suite - prelude
343,032,550 *224DC4D2FB7E942828ED49DD79141BDCF268C9D2 brookhg3
343,032,551 *224A15AC8C838FFCDE713D2195D3751E659C363F Brooklandsbanen
343,032,552 *224FA467B996C23BB2819519E415AD290AF30876 Brooklynn042
343,032,553 *2246AA4F27E90D98E78A92C01D6F96EC5A02684D brooklynn433
343,032,554 *22487FC1C4063D8CEFDDE4180F1BD877CA9D4848 brookneal's
343,032,555 *2241C3D251F3290EFA565CB57EFB5AD4389C9AB9 brooks.bazinet
343,032,556 *224003A443FB59D5E97E964C21F85CE1EC39D196 brooks.bergh
343,032,557 *224474BAD04D2FB189B87F04F4521CE38E26712D brooks.cifuentes
343,032,558 *22463349CA9F8878202DDB69DD72BE5FBD6B39EF brooks.dumphy
343,032,559 *2244FBF567D3E9C5B15563F06E49528D4E369C94 brooks.dymond
343,032,560 *2240DBEEBA1DEF2B740704AC421C110016267F5A brooks.forsythe
343,032,561 *224608D7AC8933C7001F98B64550BD3CF8CC6A5D brooks.gonce
343,032,562 *224C5639A8675C2EBD112B48B51FBA2D7E4EE01E brooks.heitbrink
343,032,563 *224F684F715D7C0F8372301EBFC818C6C32E4DA0 brooks.holtberg
343,032,564 *224CE0B251A4524C75D245B764138B255182A9AC brooks.maciver
343,032,565 *224C5CEA5CA79204DD4AF81E7AD5579C84B8A5F2 brooks.mcphetridge
343,032,566 *224ABAC167792069DDEF5FBF7B3B3BAE0AFA6225 brooksrichard
343,032,567 *224BA0B62F1BB33363471BFE2E8FAC74C1C4BF8C brooks.sasson
343,032,568 *224452F01BA42C3C6D31009543107AE973354393 brooks.schreyer
343,032,569 *224F5D62C8FB35D7678BF05E76B7B236F20F2A27 brooks.stephco
343,032,570 *22446FEB6AE5B6CA248355B9D2517E7606B771F2 brooks.stoyer
343,032,571 *2242C0A53B33A4C3D42E9044A96CD59067B860ED brooks.strzalkowski
343,032,572 *22456EFD45C34E94DEA48F16548EA693008E13AA brooks.torreblanca
343,032,573 *224196FC5B335BE346004ACBBE9AFF234D5FBA73 brooks.wojtaszek
343,032,574 *224A08BD6DC64FAFEC8C9C4295FB2185F3E757B7 brookter3
343,032,575 *2243C466FC68A5EA77A069BA827DDDEB1503577B broomiered
343,032,576 *22424AB5F93488593A26AB4DD3EC70F6B304FE2B broomroo1
343,032,577 *2242F2C989D1CF5361F2CE60181D6382537460DB [email protected]
343,032,578 *22433B7DC57BAC4B0661B3B4328D366DF86A4088 Broozer9
343,032,579 *224182F0488E1DCD9EEBDC7C38E2CD786FC439A0 Br:op
343,032,580 *224505D89867E88407799B3A271F25B32C9FC374 BROPL
343,032,581 *224683CEFA9ADE48C2C16C9E9766C319154741C5 BR"OR
343,032,582 *22416C7419B012990A712B5BFD21AF167A315CF4 brosfed
343,032,583 *224D34A5FE55FC75557FD957290570C7FB2460B3 brostenisb09
343,032,584 *2246CB13740D5418364E4FFBA22D5DC106C1F0E3 Broszecin
343,032,585 *224D69F02CD535F1CD7AC1EC6789889C35959CF9 brother_luj7
343,032,586 *2249639F51198C18319A53ED83516246B0BD2D70 brotherly.hillock65
343,032,587 *2242C575F99FD7477B32BA2FE0D99EAD51FB9027 „Brotjob“
343,032,588 *2242BF555C4422DDA3810D1B83208AABF975BC77 brotkörbe
343,032,589 *224CE796B232CF2E4006608A0911D5EB8EE20337 Brotobo5
343,032,590 *224DC65C38A1A2D9CBD6F6D999C515B06980FC4D brotprei3
343,032,591 *2242F18C471B45977CB7E3E8ED3405F05F7E41A5 BROUWER88
343,032,592 *224548C4051912916B134A21FDB8EA482AB675EE Brovick6
343,032,593 *224DA3F13E0262EBEFE44276CD8EFB957C065C3A BRo
343,032,594 *224C7DC3463898CA87B7CDD84726B8CE64DA38B5 Browb3at!n9
343,032,595 *224598C0C33A816FFBE8A875DF9EF026635D030B browderroberts
343,032,596 *2241E238204E18A4D85285672E9C5FF57D4CB9BC Browervilles
343,032,597 *224BD4E8803EA22AB073AE15BF77F4C87E28FD52 BrowGu20
343,032,598 *22441F44412099A907FA808EF3E9B609BE739BFE Brown-$ai
343,032,599 *224AC4ED9C50CBF076E7CEB357CCCEE7B7DA9396 brownarchitect
343,032,600 *224689AFDF3403E354EA3F3CC53CDE56BA1C363B Brownemac0
343,032,601 *2244A3DC35004EAFEA24894FDF376A175E200F61 brownie8669
343,032,602 *224CB4F8B2A1F7508CFED635447CA2FC168C6FAA brownl33
343,032,603 *2248B42E51B96F401684E616812C877030C53124 Brownlees6
343,032,604 *22488056629E35733460856E87DD2CBB9953A231 Brownly
343,032,605 *2248D375C68AC03950A380AAF459D4F730656A85 BROWNNIE1
343,032,606 *224CE17DA4C0A81AB14F7F60DBD0380EAE3B7088 bRoWNS
343,032,607 *224AB9A9FEC05D3982F9543A60EE6300830C6EE3 [email protected]
343,032,608 *2247592E36EDB06AAE314F54E2AEFC142282CC6B brownsugar48198
343,032,609 *224A4D6F897BAAF34B2034BC3F02B9FCBB6AE776 Brown Sugar (Dollar Bag mix)
343,032,610 *224B11B10B054075F9A938FCA076297F28BD40E5 brownsugars11
343,032,611 *22469E760298F8B3AB6216ADD010467CA799304E browsbar
343,032,612 *2242DDC1817E7186F19B431DB0563CEE83DC9B41 BROWSER-RPG
343,032,613 *2242DD8C0278CBC000AEED3D116C3EB357506E17 BROYERENTS
343,032,614 *2240EB699C5DA2423835D2A4EDD4392A07FF1A30 broyoukrou
343,032,615 *224510EBAF06B0D31B5F7A3F985309C4F059589C BrpbF
343,032,616 *2244611039D9386906245858C6A04767C32F6473 BrPBW
343,032,617 *224940A38402F149F736DAC85DA2772A0A126B93 BRpp;
343,032,618 *224059448BC133151BD4272115E327F418A30600 BrPqB
343,032,619 *2241849EFF194DFB2F9A89202261F59A6EA41EED BRPTr
343,032,620 *2240EF2AFAA8EB330396EBE8ECAADB9A03C231C9 BrPuw
343,032,621 *2248BFB69C6961B49D8EF3A2375CB2EA9F97C30D BrpWw
343,032,622 *2249DC949EFEC41551EE670442128B44DFB885C9 B,rQ-
343,032,623 *224220BF4816813359766B6DB48CFA9A841A3C78 B#rq:
343,032,624 *2243E722108465FE57629922A0EDE14705C4912A Br#Q0
343,032,625 *224AEC8A004434D3F25227632C4917E97F902E0E Brq!2
343,032,626 *2249B97A62EBAB052133D49301DDE44ED39E0B59 Brqag
343,032,627 *224977AE1AC273D6DF486694515632DDCFEEBD08 B#rQC
343,032,628 *22487B779FD121D24C9F9DA9E9D5A8774674BFD2 B(rQg
343,032,629 *2242E6C26C8E77FC1BF8F8E2E8747345F86FAC0F BRQi
343,032,630 *224C748D96E55672032EC457B3CD86BAA4738707 B$Rqm
343,032,631 *224ED2D9B84A3297A70740E47AB29AE2B820EC1B BRqR;
343,032,632 *22493D883E2CD5D00FD021A7BBFD233077CB85CC brqugwb
343,032,633 *2247620929A20C42BD92C5E01CDFC8EC0B61AF61 B!RQZ
343,032,634 *224CC6A8A11663CC96E45E8F1278EFD049896ADB B?&RR
343,032,635 *22466FBB1B218862AAC9273F9012C551F2E49658 B.R.r
343,032,636 *224D5CDDC7456EDA18AF1168AA83DEB880773197 B?"rR
343,032,637 *2248525C8DBD225322D9AF1EA6B56CCB33D597E0 Br;.R
343,032,638 *224598D0750D1AA8661B2D5B647EF5DA457D75B9 BRR3V
343,032,639 *224FF79781A4B1BE3E7134C9D2A09853DCDFD0F8 BrRdS
343,032,640 *224AF6EB6BA431DEE9A5C90AE5A52A770C5AC2D0 BR-RI
343,032,641 *2249D9E174216626E1A746BFFDEF2E7AD9FDB290 BrRP
343,032,642 *224BAEF7D8FC12B9F3091AC7B61DD1B0E6C3087B Br+rR
343,032,643 *2241EE40EBF4A1E25780992D888ED622A0B32539 B_RrT
343,032,644 *2246D3C5EFF9E5805FC4DBDD938945F43E876DCC BRr&X
343,032,645 *224AD9CB2D45FEF043B8BC8B953EC9EE5B969424 B(R-s
343,032,646 *224238A4B6B2D9C40EF81D8FA0FA582ACF81EC00 B#Rsa
343,032,647 *224990D86AEB8D01F39C83DD9A84220B91AE995A BRSeL
343,032,648 *224C5F7DD9FB208CB0DB78D2C3F65D1659EDCF49 [email protected]
343,032,649 *2246FBD3FC7A295958A50C6B504C1264F89F3505 BRSGT
343,032,650 *224640BC79E1A8E8FFAC480FFB8B5486056A2E6A BRshu
343,032,651 *2249B6E22ADE4E36AADF4801B2249A9884D8582D [email protected]
343,032,652 *2242FAEC27A0CB6C48F5BDCB489CB6A9748A5437 BrS%l
343,032,653 *224E07B0CD22B009BB21EB7E5E298C39096B54EA BrSmv
343,032,654 *2246EFB411F725CCEA3D98ACD3F5921A1D3A5F27 B=rsp
343,032,655 *2245AAB6D295B8552018B32B842DF099E2F8ABDE brstenje
343,032,656 *224BEB163DEF5AC6B239B6542898B5B0C95EE9D4 brstlng9
343,032,657 *22421F16F75117233F8A35B7F167DBA39557264D BRSTP
343,032,658 *224E10DDC667B3FE0666DD1AE444303199534A45 brststrk4
343,032,659 *2243149FDF52F613E070D4C4D53641CA5B70D448 BrSu#
343,032,660 *22469ABC4347404D2EBEF0E26D0A58220A6FD678 BRs
343,032,661 *224B0483D5181E5EDCFCB2C1128A100CB4759088 [email protected]
343,032,662 *2245FE82EA6C30508F51C1095E9FA9B7A468D4EF B,rT!
343,032,663 *22408915F6C6F2D83AB7D691283C58384B6CE265 Br?T;
343,032,664 *224DFC3BF9A152D37A420AA0ED58FC11AF1A0237 BrT$;
343,032,665 *224A73CA39C5606E34B79946C629E1E474B7FE94 BrtE.
343,032,666 *22428755713CE701FE07B0AA40BBD26C44B96A15 BRtF%
343,032,667 *22493FB263664876017DE5E89E849EC19D6B6A94 BRTpN
343,032,668 *2242B777086DB61CB1137C1751FCF1B81544EEB9 BRT(s
343,032,669 *224DEDC8A5030327F83E7F3CB642670FCDD486C0 B=rtv
343,032,670 *2241445329785511A6B84B7E5D0CF1F4EEE6B082 B?R=u
343,032,671 *224DADEF698F3AA8D675487D96285F9EC2E7118C Bru15e5
343,032,672 *2243DA55B0F64FEA15A43BE08A401910FF14C61B bruc3g4br4msjr
343,032,673 *2240AE545C5B0870AD3DF6158CFDDC248E8B38DA bruce adair
343,032,674 *224ACA57779E948DC4B30359C2CF78991391CBCB bruceatkins
343,032,675 *2245B192FDB7EA15B51751C4497630E13EDD4C18 bruce.auyon
343,032,676 *224040C272AB406866DE996483C862DD5A48B9A6 bruce boughton
343,032,677 *224270772FAF39F8A93E890D111E6A810821146D brucecn
343,032,678 *224DB504CF73C9D4792BBCE01E9594B242444705 brucedurward
343,032,679 *224C5E1007149675E1767BB591393CF878A73305 bruce.fejes
343,032,680 *224AB768818B3589F2A7E822088BDA86A98CCE74 bruce.floriano
343,032,681 *22424C78F062D53F6C0A12C60461F32C7A091954 bruce.grof
343,032,682 *2242FAB337F17B5EABED6C80AAA2FA3022636F0A brucehaag
343,032,683 *224C8F9861CC9279518634769B88FDD9C2602ED5 bruce.haithcock
343,032,684 *2244FD2DC6C9A25390B917D3D470330FDFC9453B bruce huebner
343,032,685 *22478A1A17691BFA1ABA5F0017D345AA4C2BAF1B bruce.jeune
343,032,686 *224BD23E2BBCE3E3D3593CBFFBE70690DAE5BF53 Brucekids3
343,032,687 *2248FEC2711B461E2F4F9889CF97E2F6F52BE674 bruce.knapko
343,032,688 *224B0EFE4803A345CA55288C7DD657EDB01B55D0 brucel8883
343,032,689 *22481672E11FF6CCF62DE9970B5ABA51C1758339 BRUCELEE1940
343,032,690 *224BD561CF2AF5ABFA20B571433E2491418CD73F bruce.legleu
343,032,691 *2247E97983F83C38B4B867C4A95501D2F9F6004F bruce lerch
343,032,692 *224E137E83CFC4009ECE8BC9FA7F9850CFA957D5 bruce.lichtman
343,032,693 *2244C507D60E28A978143CB8C3484670A93B58B3 bruce.marti
343,032,694 *2240604A04CE14359C7ACDE68D2EFD44D74037DC bruce.mccollom
343,032,695 *22424B66C03BBAE0F357DE3AF5678EEC726F5196 bruce mcmicking
343,032,696 *224EFB8AE7CCF1647925CDAF129156F16B430477 bruce m dunn
343,032,697 *224BA6A437DF576824375AB6E25430D4580A1D1D bruce.nurthen
343,032,698 *22457A627DE15DAE18F61BA72B2D6559EC625670 bruce.pilgreen
343,032,699 *2241BDDF1C7FDFDD2BE2A147A3FC1478F50B0799 bruce.powless
343,032,700 *224B5610F213B204E1D715BF2EF2D93C8E9D5577 bruce.sieberg
343,032,701 *224E9F878A82327677DD3C67198B6B95923315EA [email protected]
343,032,702 *224572819227900F8D56D9A11828722A3B43A58D [email protected]
343,032,703 *2246108809D9827367E587D299471A3E3D78652B bruchtja
343,032,704 *224149442D6B607C63ABA6EF9EB673EC033BE57D „bruchvoigt“
343,032,705 *224D306D396EFE7DFCAE5A1C9FE8D04A0A64D834 Bruciaronoed
343,032,706 *2244B38DF4D47434E4F784A2E673A434436DECC9 Brucias0
343,032,707 *22428644BC4A894589CB39D774EBB392EB2C3BD2 bruciavi4
343,032,708 *2247B2ACDDEE505A10B44681AF6D419AC95A25D4 brudborste
343,032,709 *224A73D4326ADBFCD44FA33F0213993AA5BAC891 BRu#E
343,032,710 *22470529557E8E327D27FE7B8DD8F931FE294284 BRUECHIGE
343,032,711 *224312B1529ED08548397439321AFAE550E841CA BRUEJS
343,032,712 *224CD5E521F263FCC17A5465F067D6B8C37484D6 Bruellend7
343,032,713 *224707A72285890A9C31E724A8051F5704CE554A bruennsteinstr
343,032,714 *224A4FB7771A4F00CC2F91BE7B38BB810205D391 Brug$f0re
343,032,715 *2245E021E0EF4CA8BCBE6F36A2E10372B1A43787 Bruggeagebot
343,032,716 *22461E52740FE04FDB1AD8C75D5C1AB9700EED1C Brugginks
343,032,717 *224DB5572782DC7D0211897F6B82C524FA5ACA47 brugmann3
343,032,718 *2245E579ED92B9B1337329FEFBCD025315E72100 BRUGSFORENINGERS
343,032,719 *224CBD26EE5BD821FCE0D5A37EF43BF65ABD14F5 [email protected]
343,032,720 *22478CFF8FB4F23BCEBC9EE167D0556FDE24C5FF BRUHASPATI
343,032,721 *2248E21265FD77A82884B9CD0C679021FC2A80A8 bruikbaring
343,032,722 *2246E4C52675C138793C36ADFA32BEA356C1639B bruikleen6
343,032,723 *22440C79322DABFA8E89DF0BEA8A3F27D30866EC Bruille4
343,032,724 *22400A76436F28647BFE019EBA1BBE21C03E8B3F bruiloftsfees
343,032,725 *224F094C71D3C7EB689E622070FC7C72C3EDE46C Bruiloftsfeest2
343,032,726 *2247258F9021BC470ABD9AB70510D42D36364662 bruinerent!
343,032,727 *224E1E38FE8DBEEC35CEE21FE3657FBB9FA1F6D0 [email protected]
343,032,728 *224F343AC4EEEB580FEAC18A547428F0CAFE7EB5 Bruj9
343,032,729 *2247878DF3C71648E4D434D4FB0F0B343086858B bruks
343,032,730 *2243019127E470A1A0495E83C311261FDCC9DCB8 bruksrörelser
343,032,731 *22460362F1BB382971F1318AFE41A2CD1D843C4E bruliez4
343,032,732 *22473411DD5ED85EE2A5B3E2D8E58ADAA482D552 BR!um
343,032,733 *22426D25383A07310B73F1E600D94571FE227133 brumes“
343,032,734 *2248179672C1814230E4E2855451DA11A51DAF25 brûnâ
343,032,735 *224AA3D6C73D567CD65342E8F276D80728DDAB41 brundage2
343,032,736 *224B502029B234EA352B8A3EC1A316B5B1C3CB2E Brúne
343,032,737 *22465EC39A22900DF3D2EE89913FA250B651A4F3 [email protected]
343,032,738 *22437EACAA0086DC74E18CFAC5D1F8E1AD612DDD BrUnet
343,032,739 *2242F50CA1B37E1365807AFBFE9767ECA9B970E8 [email protected]
343,032,740 *2244A0B1ABF367EF6C259696A8658FA6C846E5A5 brunk.org.uk
343,032,741 *22452E5F4AC5DD24249F326A0FE1D0E099B9F026 Brunnadernstrasse —
343,032,742 *224DF3E574CF21591F0C1B744680720B2DA84462 Bruno206
343,032,743 *224C11620B79B9E9BAD575E37D40943470578865 Bruno22:lonestar
343,032,744 *224E88C22C466F09650A8DE37D6807B5F8D9F2E1 bruno.andruss
343,032,745 *2243FA5D51A8ED7A0F3ED2D9245B8327EA827A82 bruno.chauvin
343,032,746 *224D51CC2BC4C07B964D4EAEF632BDD09B8C3D89 brunócz
343,032,747 *224318CC3687623574A3F7017C574B35AFEE3B23 bruno.dorman
343,032,748 *2244FB6378B8E0A57AC4A234E69E29F9AEFDCFD2 bruno.elguezabal
343,032,749 *224FF7832E5015B881AAB29942D653AC4450C7F6 bruno.gioia
343,032,750 *22468738B9643571908986957AB6C349B360CCB5 bruno.kampa
343,032,751 *224248292D89745165FC2E76B1C7B74CC3B31BCD bruno.koopmans
343,032,752 *2249F72280898E3FC72B3B38935B88E5176818F3 bruno.munl
343,032,753 *22479670A7DC93DD06B75A5452FAF38035713B08 bruno.oriol
343,032,754 *224B1AA42901FBA5971ACF2717C46340BFDD621D bruno.perilloux
343,032,755 *22415E45A5B0585F5660DB323929955F4054318B bruno.petrides
343,032,756 *224B06757B82A1D1AD573578D7F5212B70EED0AF bruno.portor
343,032,757 *224194B978576604475CE3F05C05ACB86112E7D6 bruno.provow
343,032,758 *224BF69DCC8430AEADB2A5AF0BEB6A317795785A bruno.sader
343,032,759 *224662E78AFE768E28B75CEE5D63C141E5047C5A bruno.sorman
343,032,760 *224D26E11376EA8960FE2499B85256E665A1CBC4 bruno.spoon
343,032,761 *2245552FDC1E124BE99EB906F8592F93A75FE559 [email protected]
343,032,762 *2247406EACC05730C98734B5DF346627C5FF6E9A [email protected]
343,032,763 *224685670CB729450D6AB7B54D5C1014C3C2E19C bruno.warmbier
343,032,764 *2241922578DE473277666D468B8F3B6680E618B3 bruno.westphalen
343,032,765 *2249441CC75C9D7C30D63552CA6C8BE5ED09453F Brunröta
343,032,766 *224F27014C2F4BBA7F6E07BB43DDBC2319CD0428 Brunsbütter
343,032,767 *224A8E127CEE9BF7EAF98B9EEBA5243A4A595138 bruosc57
343,032,768 *2248D46AEB9FE4A6AA60547C0601281330943E48 B&RUQ
343,032,769 *2241A336E240F1775492DE88EEEBF97555FFFE10 BruRp
343,032,770 *2241657E7CF338E5EF06EE3D225B15A7EAB48EA2 BRUSEBAD5
343,032,771 *224B0B033F2435E4BA4F4C1963769ED661E7A810 brusegan1
343,032,772 *224BF2F45547C21D94619C872D9882283105FFB5 [email protected]
343,032,773 *2242E64D8264005AA73379CF4D4B7582D46C4433 brushups!
343,032,774 *224796A30BAFEF0F1A8235FED951C28E36045E60 brusi
343,032,775 *224A6D22515A4EF9C7F812FF9CA0579F9FE03A9F Bruslen6
343,032,776 *224C53D22CF893F6225853B17E4931D3736B8045 Brusnikin5
343,032,777 *224AD423E2B6B5DDD378ADA4BE407FF726BF1E35 Brusznica4
343,032,778 *224C5DEBE752CE3D4FA027E4ADE57ABC8CA0DBED BRUTALISED4
343,032,779 *224E417FAEB47772B0DA7801EB4810D538FBD4DE brute99450
343,032,780 *2248067EC35A438101B76B35350D1920913DA489 brutgers3
343,032,781 *2242FA70132A0A59C8A08BD8CBA62F1AFBC9879F Brutoteina
343,032,782 *2247122FF3CA1F73B7849706A115B0E3564413A0 BrüttenI
343,032,783 *2243A20E2E86B01534027CD1EFBB8CAB79DC7BE4 Bruttoinslãnsbrodukt
343,032,784 *224F462B8DAA27B8B93B097DF3D3A58A30400F86 bruttoto0
343,032,785 *2246B934E4186CA60EABBE0E4CB773FA7C077CF3 Brutushomebrew
343,032,786 *224C0FB1561D6B2AF40130C72E0E7F647870274C Brutust6
343,032,787 *2242C6E8BDCEC8D1F42CD9B9FBB86F823048CF27 Bruuba
343,032,788 *224E864FF26C0864FD743B06A36106507E9781E1 BRUUSKEERS
343,032,789 *224CF2CF26ADE6F82CDE6CB2B72FD8E6E285FE13 Bruutris4
343,032,790 *224F271487F8C6C9980328D27117BDEE56A52A80 Bruuyaahed
343,032,791 *2242CBB0A2D236A0C97BE0CC928F30A834134077 bruvaane4
343,032,792 *224558230A052D817F9B61432D49DCE302D43E70 B_RUw
343,032,793 *22459E3CCDB621D1581BDE54DE04AEA571B82962 [email protected]
343,032,794 *224934B7F0C4F97FD2DFD2E0CEB95AFA3543BC0E BR:V+
343,032,795 *224E4E0E177A8668B65A8CF212B44C95A22BB142 BrV,
343,032,796 *224FFC924DCF61A7419D516FD6BAFAF7AEFAE3DF B"r;v
343,032,797 *224832C822015B229EFF8275ABF5B481843293D6 BrvKC
343,032,798 *2242AF2B19D6BF109AC03DD9EFFCAA31B05D32F0 BRVlj
343,032,799 *224A9916CB2AF7BF7D09AB6C147C365BC7C7142C Brvm!
343,032,800 *22411F808C32C0FF5A219E757BFE743F3E3C2C85 BRvmZ
343,032,801 *224FE51634564639844CF78CCA0E9FF15C007DE5 BrVQ_
343,032,802 *224EFD8AA713E27B71AAFA8131FFB442E2827CD9 Br,vR
343,032,803 *22494E0AF7C480B7C51FB1B15446748F6AE2D61A B
343,032,804 *2243985987AB50A703E24F33DD729C1C1C2811F9 BRWaM
343,032,805 *224988C926C78DF3DC535A70833FB13DDB22A5CA BRwbl
343,032,806 *224F3CF60A421F36B59054EF32A7BB0E9285064D BRwBt
343,032,807 *224DE57C4CEA180960C3A3D1FA0F858A8F7BCC17 BR&WD
343,032,808 *224A19DF60E4A09D79A5C5119F0680A6CDB0D06E Brwelched
343,032,809 *22470AC463A99EC0FF086283679214084A7445BA BRwH8
343,032,810 *2244F1FDE5AF3870FED94A59B376C0764AAE005B Br+wK
343,032,811 *22480359C3B0058509B4E307FF73B04866F44350 BrwnU
343,032,812 *2248CB767E0B2AAE10BD046983C15A4F9C44FD48 Brwtikojing
343,032,813 *2249AE2AC9B4E056F3CF6103E6FA534451BB301D BRW(w
343,032,814 *224C9A491CCDA1E676DC05121928C348CA85C6C4 BrW_Z
343,032,815 *2244F4B23BC0E489E719A9E586CA93304422939A B&%rX
343,032,816 *224D9C83952B71B2009693CA3FD5340DD4BD432A B%r;X
343,032,817 *2244CAB31379B69B5B22E2570E62F212A5E8591C Br"X:
343,032,818 *224718ABAFB9FA72965CB86EBAD62C592317B53E BRX%5
343,032,819 *224C54F99C29E8A710EF98C54676B8FDF33575F1 BR-Xa
343,032,820 *224B5FF05C2BD4A3C2376AF2A4EE771A86FB3D58 BRXg-
343,032,821 *224856B7416CF37F2F4C248CB406B4DC91E72BE5 BR$Xj
343,032,822 *224EC682F5CDA599B69D549858CD16BFAD391F0B BRXUW
343,032,823 *224C97573B6E04732BA561FC3EEF5FBA8F5EB06E BRY&,
343,032,824 *22435B9F0A75B5AAF0123AA46A757C52ACF9B4CA BrY1D
343,032,825 *224FEDF8F68FFA905409341F3585305E8868C7EC bryan.alcombright
343,032,826 *224B974FE813DD19D6820D6900B4995DD11D2499 bryan.ao
343,032,827 *224FF8FC593A20FBFA4F4224A7E400C98AE12F69 BRYANBABY!
343,032,828 *2240EAF3CE13BAD48A102D9E5E4B297356CA9124 bryan.bickelhaupt
343,032,829 *224DBBEF58204750C90DFE0F0E81FEC15C347506 bryan.carrisalez
343,032,830 *224C7AF178C22BBA5C801BCD23FB6584132443C0 bryancu
343,032,831 *224CF63F9DDF719FC71615C106BDE926E730CFC0 bryan elliott
343,032,832 *224FE5FCFC8017C8252CC8407A51C97F19F4F46D BRYANER
343,032,833 *224CD97DFAABDE64A4871C73935DBF393654BD40 bryan.estler
343,032,834 *2241901F1DD254C5BA6103BE74EF08865FF469D1 bryanfrye
343,032,835 *2245A687B67A6F5C571A78043F0B3865340F1892 bryan.grima
343,032,836 *224CC412F1EADD02380DAD6D5B3F7ED3BB0FE4BB bryan.hernander
343,032,837 *224EBF62AB661E64E380B0B73AB64146132B8CF2 Bryanisgay
343,032,838 *224884F23CE40AF1FFCF23BB23AAF6DE819AA675 BRYANJOSEPH
343,032,839 *224EE0573E3A5BA8C101F6DA4ED4938B73F618FF bryan.luff
343,032,840 *2248D4E7B4E604E79A5448273C8F3914157459AE bryanon3
343,032,841 *224C174916B493238312FA65C9B7BAC0753D2500 bryan.ratte
343,032,842 *224D232E536E6EFC8DA1B0446594C2832F1A25CF bryan.scarles
343,032,843 *2242DA8CE8D549259F1EE6DBD25CF1B399683103 bryan.shed
343,032,844 *224EF73A7C22B729FDAD99B4316A7006704F0495 bryan storch
343,032,845 *224FA7D372649AC02E365E39463A0DF22317CB57 bryant.abeles
343,032,846 *22428AA73102D0D07BE1E06600D1237BEBCE71B6 bryant.bagg
343,032,847 *224D646F1A1B42DF5C5F9B9B532A9D03C75393A5 bryant.bucko
343,032,848 *224427B9DEEF051CF13D6006C870352BDD263F9D bryant.contento
343,032,849 *224E242CDA6D115D45B0444471662F7282F4DDA1 bryant.fabro
343,032,850 *224E98BAB04F9E9EC534919E7FF77D9197FAD939 bryant.gauger
343,032,851 *2243D8DF33C1C2198741DA53F93CDA455CA302D9 bryan timbal
343,032,852 *224F7518907F36E91443A061FD2B5B00D1DB6600 bryant.kunkel
343,032,853 *2241DD1D66F9E90DBF14049BE82FFE025A624767 bryant.lucek
343,032,854 *224172D14F9280C173C8532026715133D3CDCEE0 bryant.oviatt
343,032,855 *2241F88384DCA8FCF31E9C3122D67D3870D10839 bryant.petronella
343,032,856 *224823F780300AB3479FA5372D758F841112620F bryant.room
343,032,857 *2248CDEBC55C436AACA54D6969CB69EC2C15ABA2 bryant.schonhardt
343,032,858 *224BEC674E83AF883DCD7E87A30010E3BAFD6D89 bryant.scobee
343,032,859 *2247AA76B395317EE2012BB487295DE7FD82C351 bryant.strubbe
343,032,860 *2247F52EC46EA71396BDCDF998EE362DCCB12CE3 bryant.vossen
343,032,861 *224B711A6918732BD96C4056011CEACFE6198EEA bryant.wilhelm
343,032,862 *2244E009E0FBBA0C546B7EA08144B59687A9D032 bryant.zanin
343,032,863 *22472AD48751F2AFEB339E33C4CA1CCF3151A02B bryan vasek
343,032,864 *224A75474AF0CE057E741066A3632CA017CB93FE BRYAR1996
343,032,865 *224B5E136B1A74E7707E2CB33D7E941D1CC48433 Bryce536
343,032,866 *22447A0EB2D218C42D29F58C045D3EC40A498229 bryce.amormino
343,032,867 *224F6037C40840E4386B95B0800ABF6C1F3F656C bryce.barcellos
343,032,868 *224B376C35B5BFF133575635DD4FEC923A19CB92 bryce.biedekapp
343,032,869 *224179C63011FC65877C7C4643AEFA53BAA0815C bryceboyce
343,032,870 *224FEB165350ED82A1ABBE89E74CEA5CEEBCB88A bryce.bucher
343,032,871 *2249630C6E3F14C54D060256290BEAD83A258B84 bryce.dauge
343,032,872 *224ACB2F906024325BD76FF079F1F2509FC56DEE bryce.dellarose
343,032,873 *2241108FC5BB87726ED11292916B9E5C83D8BD5B bryce.depinto
343,032,874 *2243677715C3496C5E46E781E98D07557A6326FB bryce.ganiban
343,032,875 *22431A68AD4B0B6EA8A210D1C46CEE148C06C7EE bryce.garretson
343,032,876 *224D06F11D4264C8FB19CEABDDAF030BBFA8DBB2 bryce johnston
343,032,877 *22448C0A3B5EF68433ED2C897E23AF3DC3DFF781 bryce.khensamphanh
343,032,878 *224DEEF0940F497D428D664DDF0CCE52A8AE63A8 bryce.kwek
343,032,879 *224CAD7B4ADFA878355B7CC64952B0B9CDA90905 bryce.marzette
343,032,880 *22441BE310E34A52741655D98AF3E522C1A8FF8A bryce.mihalios
343,032,881 *22456CD56C37F462E358AAE3CBD0BD698E2DAD0B bryce.mrowka
343,032,882 *224AC05075CCFE16E8C9ACE96588CEF6003EF1D7 bryce.percey
343,032,883 *224EFBA46227766FF23FAB61A4C38BEC256D500F bryce.schweigert
343,032,884 *224BDDFF190277368FB5DC993514421867C300FA bryce.shelmon
343,032,885 *224D63DDEEDA6F983691AE98D0CAD58294052355 bryce.shier
343,032,886 *2243A68775E3F9E0909F3FB34B1A1FB004D8C998 bryce.sowl
343,032,887 *224C245BE924CE72256068FD3944F820F71254FA bryce.yellowhair
343,032,888 *224A60E47538081588026933C641ECE3C4E590FC bryce.zahner
343,032,889 *2241D7DCE91E28F3E4C449C2C755FACF65657317 bryce.zelinka
343,032,890 *2249298041B7CCCA9D8091522CBC71A1117A2A9B BrYdc
343,032,891 *224BFD43C67BF44AEB6ECAF01C837FC054CE0795 brydon12
343,032,892 *224609F632767FDE66C07939F768C6266A70994A bryjenbyerley
343,032,893 *224DB276B25BD2C7179B8D3FB86D975AA2080C14 BrynBarnard
343,032,894 *224548C5AB178073FB2F4D913902CEDF61236C82 BRYNMENYNPRIMARY
343,032,895 *22406D801A909FB122C8BBCB1708ABA79BB41266 Brynn37
343,032,896 *224714E222B4C5447A25AF0CA2EBA35BC0E671A1 bryon.baggott
343,032,897 *2243F6E73B11B9D80DC2CCD15D2251367ECBDAFC bryon.buehring
343,032,898 *2243E877074C2667C57A4766F757B5B95091EBA4 bryon.cirilo
343,032,899 *224A65EE34C6D1F268990C5FF1AD7EB465D50502 bryon.falkenstein
343,032,900 *224BFC8BA35E49A6F7744A33FC5F02907EC29A32 bryonferguson
343,032,901 *224E228ECF8ACB747EB1559F3FC5129415D95531 bryon.giuffre
343,032,902 *22439F2DF0658CA617A43FC57C6900AB0591976F bryon.goard
343,032,903 *2244BC1C2BE0545B230B7E909E48CE868370A96E bryon.granzin
343,032,904 *224A2EC3B6DEB53047E721EAF55CAFC5B4074E1D bryon.jorda
343,032,905 *224C3F5E19EB0D81057590BB01663DDEC789F41F bryon.kibler
343,032,906 *22405D67B339D410CB8B8C73B418F4FC860E7830 bryon.moga
343,032,907 *224F6115FBD0E59DDACCD018C16173094B772119 Bryonna20
343,032,908 *224728BAE7889548433E5C468082A6266DEA11F8 bryon phelps
343,032,909 *22480F532DE87BBE4CD0CA66AEF70A9EAA022574 bryon.radway
343,032,910 *224479EFC105F0388094DCC4167ABD67D3A725CE bryon.rizo
343,032,911 *224588DACDFE1AEAFFFD49258A8508C493D72278 bryon.wellman
343,032,912 *22428F7ACE0CF63365E4A118AF979EA76A1F5DD1 Brystlyds
343,032,913 *22418DB1C428E194917758BB8399DBEF6D7EA7DA bryston4bsst
343,032,914 *224530EB75E7765CA340B04571D6C9FAC5CE7993 Brytclstn9
343,032,915 *224AD62674048597183A40EC1A793959191AB548 brytelsens
343,032,916 *224648086BFA8D13185F77880D003CB3B4819BB2 BRZ#%
343,032,917 *2241CB94AAC1B8EF1D38D980066D79C762276091 BrZ4d
343,032,918 *2246B47705DACDA3C7497128E919578A58FBCC8F brzeg 3 0
343,032,919 *224261F6270C99C3287665004550448CB1B71363 brzezowiec
343,032,920 *224594CA7B56945521110CAB17983633C9AF29BA BrZHY
343,032,921 *224F4C7FB406C653C6EA8B1644BB203ACF52FF21 B,RZL
343,032,922 *224C5E001774037C6892BF3ADEB4A3141A7F2290 BrZrY
343,032,923 *2240CBF2B494B5FFCEF8DF65BD1B43AA94A48319 BR+Zu
343,032,924 *22439A8169986DB58FFCC1A0FD7FA1B51ED03911 BRZ;X
343,032,925 *22487FD3F1D51213CA879E50E4504D23BF6A24DE BrZ?X
343,032,926 *224AD09CCD31EF0520E2D1C207B20B4934AF12B7 BRZZ4
343,032,927 *224E97A46E9B7F7F9C9A892918BF6641EAF01581 br绿色,br蓝色
343,032,928 *224BEEE2BC69B4D4E7144C055EA8E5902E55081B B=S+;
343,032,929 *22474E18C7E4F5CFFDCEC700EFEE16697AA5CB08 B_S)(
343,032,930 *2241F07504AB5D50EDA3132EE80FFE1F2F3CEE19 B?=,S
343,032,931 *2243FCE5F5E36FBF2E03A5412756A0073EFE110F B"S/.
343,032,932 *2245DB6331FB6BBDFE92C022210D1D7835820C8F BS.(;
343,032,933 *224A3127446339AA8AC889A442B072F4ABC4A259 BS"#+
343,032,934 *224C46C2D86CC882483DB48A6965F28091B3C41A B-s-%
343,032,935 *224E4BE0AD36834734CF62BCAF9584BAE445126F B!=
343,032,936 *224094A437E7544030AB11B1738818D2DDD6B9EA B?&!s
343,032,937 *22406C7EFA64AAD80C1545175CF36156F2DCD989 B/&s/
343,032,938 *224FD22072510878D7F30BE9D3EDE2549E29052C B.s:"
343,032,939 *224CD3BD76C2CD1C70992DD5B6A220D4FD9234E8 B".;s
343,032,940 *2248C027D35AF7814913BB71898F691C34714092 B(.s+
343,032,941 *224E8CD8A1FC426E34D405FD1842D73BF98B57F4 Bs.)&
343,032,942 *2248B5A9B2FE3F85956F291EE01FCEDD8523EF6E Bs+`
343,032,943 *224EB0058BDE9D67D5363D1BFF99AF7B9D5D4C0C B_s0
343,032,944 *2242E02180DA163E994AD3E3E7C91BE8AAC3E14C BS03Q
343,032,945 *224702AB8E3FDD1D2B07C3B12427E6422AF2C61C BS0-9
343,032,946 *224A01251B89212C3760CD5C9230685B6C9A0810 BS0d;
343,032,947 *2248CC8AEBADBEEAB4248320AA91727D8AF8610F Bs0pZ
343,032,948 *2245F44613BFD94DC9A1364286BC0D1552F212BC B%S0U
343,032,949 *22422974DB80B8B4149614A8E0E8800088029D46 BS123
343,032,950 *224BEEA602F9EA672D023E7CF91ECB824AA08166 BS1:A
343,032,951 *224A6D30003D758AB10D5D7C26DDD5C082F38517 BS1_F
343,032,952 *224529CEFA5C88DB3BC72A8857CC22EA55104046 BS1HA
343,032,953 *2244C636B8201EDE5319F6776BC571831127A101 BS1I+
343,032,954 *2249B02175AC7F6527FC4EB3F2A7E01F465357B6 Bs1#l
343,032,955 *2243C378AB4189721E4E424947A1DF3D0EF19C0A BS1vP
343,032,956 *224FC4C2FF4A25523D493C63F17364D1B690D08A BS1Xw
343,032,957 *2246F3FD2661A7546799C87BC5F56F39A69F9A4B BS2=1
343,032,958 *22433AA56E020C087FA63D2DBFF0FDD49F3CB1A5 BS2a!
343,032,959 *224D29EC85CEC2E3A598087537B45A95BF437D36 Bs3,+
343,032,960 *224D00D94C4DEC6C103073AF2FF96AE7B61677C4 Bs&35
343,032,961 *2248519D818B18C05197C27AD0BA3A0A4536D113 BS35a
343,032,962 *22441BAE5618B50427C1637348682B3B19B88663 Bs3di
343,032,963 *224DA6245900217171F1C304F5F3EB47B209A563 Bs3KC
343,032,964 *2247AAEF3B857DDA8AA928D909F27C8D671AFF65 B!S3P
343,032,965 *2244A20438F5C7F38A2920DA63BD7790EF2B7973 BS3t5
343,032,966 *2247E255A68BBB9C7C88667A9D2F0DC94312E94C BS#3U
343,032,967 *2246B41BA6B384F7066DD341C1FB63577A031BC3 BS3!Z
343,032,968 *2246F869EF50299644D966B11F754BB0BB244CF9 B$S#4
343,032,969 *224C01A0E45FA0CD2085636ACFC81CC1BE3A4728 Bs/46
343,032,970 *22482E834B88C60981603797542D769D754F77CD Bs4(b
343,032,971 *2247699C06834547BA3F944576EB97025681C1B7 BS.4H
343,032,972 *224826E36318BBA9CC4149EB952CE020A6A557F1 BS4nN
343,032,973 *224A6900057152A5C5D9F499546022249EF2B359 BS4rC
343,032,974 *22412C490787F0079BD60F2779168AC5361D5303 Bs4Yu
343,032,975 *224CB82AEA9018A504E4E3BABF8B295EC3B7184E B:_S5
343,032,976 *224EB3E6A7635C4B980BC9897C790A16E1FC3426 BS;(5
343,032,977 *224323EF8FBE3C8EB4EBB6F1DD19F1EA1A6F6C04 BS&&5
343,032,978 *224F5FE5D4EE2E85CADE0B1E70A3B3F493B167DF Bs(5;
343,032,979 *224CD8031C4A49CA099D79A324FB9FE9C0AC68FA Bs5a6
343,032,980 *224CD7CB8F1DAC1EAADE7FAAEF8BEEA472E6AF66 BS5M%
343,032,981 *2244ECF74BB205D8A5505EDBCC9A85B09513E625 BS5ol
343,032,982 *22403702BB7B5B11E7DF58BD930E5D21AB9427C0 B?S5T
343,032,983 *224742A572A8CD15063AAA60F1266A181EC9BA23 BS5+U
343,032,984 *2245653900B4ABF036BEB582C0CF1EF643038584 Bs5uX
343,032,985 *2240B6861564AFA13E92AE4EA5AD9EA34659C77C B=S-6
343,032,986 *224D1C449628BFDA814C4810EB001D8FD17AD19D BS6/8
343,032,987 *224DD2A9E11FC14E10BA0F9F8878F64D93C0B409 BS6o$
343,032,988 *2243F711F17FDF43B41096A59FA3469F1A91F4D2 Bs"7+
343,032,989 *224E6928BCBC69423EA7C3F882C22AB51352DB4E BS74P
343,032,990 *2243823BDC3045101F4296EC4CEC1E164CB74DFA [email protected]
343,032,991 *224295BB0FF5E2B5EAB0742BFA90FCF7AC22B366 BS7cR
343,032,992 *224EE56D099DF062365BF40BBE2B8A5276BB4AAF BS_7G
343,032,993 *224BDFBCCEEBE52EEC832C0A9F74437EF16B4C05 Bs7lC
343,032,994 *22407E9FF65048730F409D82107EADF2AF1CC97B Bs7tP
343,032,995 *224FEBD45C451CD5528C75962FA68939050BFD6E Bs7v=
343,032,996 *2241681F2F75B31B572E9D1E71544E5562FA1D56 BS.7X
343,032,997 *224735B3E4C5950923E873EA7F4039FB11BD04F6 Bs7Z+
343,032,998 *2241844E9119E69CED37424ECFDDCF28D990F28C Bs8AM
343,032,999 *224215DC41463088B089573B0254E97A3E035DF0 Bs8#I
343,033,000 *2247C4F06785AD7A445A36CFCE2B7B1B2ADC2A7C Bs8v8
343,033,001 *224217D4F98DD28337A010CDAAED3C683ACA05CF BS8W5
343,033,002 *2246B545A2E3BF7E081371D51DCB50B200E8B44B Bs9+2
343,033,003 *2241A492DA58AA6FD3DC797862FEFF923DD2F36E BS9jj
343,033,004 *22406B8AE3B69095E1B8E45DFBF351A29B2ED216 B.s9R
343,033,005 *224B0A2A40F1AF4C9D9959D239F20B50C4064AB9 B=S9s
343,033,006 *2249D792C82D1FDA63CE141F64F42C706BFFF77E Bsabbath1
343,033,007 *2244982A52DBD82397C0DC09F1DBC7CAD1A2E304 BsAeH
343,033,008 *2246A57E7198AAAEE768EE0D5395F905E233A1D1 Bsaeumened
343,033,009 *22425FDB7936F84F53B0FB7AEFDFDD44E79A1876 BsaM0
343,033,010 *2246988999FED3E8AEF8E0480B7423B2717BE74F Bsav:
343,033,011 *2245BD8BC455612D630BEDE4D7AC09DF205B010C BS$
343,033,012 *224E786610A2E45E7AC6FC5D49515CFBD7825631 BSb?#
343,033,013 *224FF5826D50397626903073C7FDE6C30BC9E75E Bs(!B
343,033,014 *224DC8EF275D81C6575BDABED8CE0565DE309F04 B+sB0
343,033,015 *224FA31F90AEDD3896D3956527E4A36308BAC322 BSB523NS
343,033,016 *2249720462DABAEFBD64AB406AA630B317C8170E BSB7k
343,033,017 *224279355453A14030BF8342BF0C5E8BC5D48629 Bsb#9
343,033,018 *224B96DB3F51BEF1F5E7C86F39E90B1B47449842 [email protected]
343,033,019 *2240E0EFFF73BB7F2A6C9EB02C4C94501539492F B:sbd
343,033,020 *224732695830308AEBFDA1280F4B6284EA50C50B BsBEw
343,033,021 *2249D531C038612F9B925882C3D081BA51204B24 BsbgF
343,033,022 *22496D7222BA1562CA8D886C2FA5AD069D70D128 Bsb$L
343,033,023 *2244E74E2A86D5D40E01484412551AEA539DBC7D B%sbl
343,033,024 *224DCFB3DC0AAA7F3883D6F4639734F68468863C Bs=bo
343,033,025 *2247D95F5B897FFF42485C72DB246C64EC81DEEA BsbqN
343,033,026 *224825374E469E6E7C8E3550FB787699CD15BE48 B;sbT
343,033,027 *224C6AE27B5A8A82B097AAA3E8336E9638BB6EAD BsbV4
343,033,028 *224ED313242C91B8752625DFF4C331023FC4F02B BSBXK
343,033,029 *224AD9E01ACE4836A45B39D2AED14969F50AFB2B Bs;c+
343,033,030 *2247FAF3192FFF0A26A59EB4109496494F7AA80D BsCc/
343,033,031 *22475E9A37DD1DE9F79176D674E4C94F756E0BA5 BScfX
343,033,032 *2244AC85D1DD25A93BC6866050780C6DEC563A5F BscH#
343,033,033 *224041256072423883A2E2936218A811AEF3D0F6 BSCKf
343,033,034 *22400127D32DA42168931220C6F351CE37043137 Bsclbrggning
343,033,035 *2240DC84CF2F665AD0925BFF71DF6B78E4604771 [email protected]
343,033,036 *2240A5C7410E75356109484B7820E1AEF3C371D3 bscpc1234
343,033,037 *22423C08CAD655DE479CFDD30BE48D951A317558 BsCZF
343,033,038 *224AAE2D68CDB9BAF248E8BA50C7F3F82CB8516C BSd)?
343,033,039 *224258D3E65FF77395FA68B3E4EB17E182ABE909 BSD2409
343,033,040 *22450C560DF8D5C835F2BDDFAE6E5C0D075FAD1D Bs(Da
343,033,041 *224618626ECCD00E65D554CB3A80D1CE5B8D141D BSdbI
343,033,042 *2247FBCE7C2D20CC86015A2FABCD892842526441 Bsdiuleg
343,033,043 *224464E7F3039E930DAD7A4750A55D6F034079CB Bsdnts
343,033,044 *22451631922C462FE54BCC4A52A95697BB8A2262 BSd&q
343,033,045 *2248A5ACEC745EC1683587FB0C492EA4986B0A64 BSd)S
343,033,046 *22416DBF1FADEEB08B4B2B6C97E7C2289EE262C1 BsEBj
343,033,047 *224A2B9A554759AD74AB1379142E2CEEFDEDD996 Bsedfeil
343,033,048 *2240CD708EB351666F67F42006C8CF8711BF99B0 BsEGB
343,033,049 *224439C0D8AE3C83893FE895E9D1E8F91C478EC9 BsEgV
343,033,050 *2240E73C6DB86CEBA3FE8277B5B3D8C674D4CF2F Bs=eK
343,033,051 *2242F4CFEA6CDEEFDAE3EE88908C7F532BE2F6C9 Bsekh
343,033,052 *224AA570F805D61DBF2369DC3B4DBFF998D93D97 Bseql
343,033,053 *2249DF130DEEDAA838BFE3EF7C9AD19626FC4433 BsEW
343,033,054 *224007C9A7E56FACDC556F5AB7C6A11094975348 Bs%"f
343,033,055 *22492C52A941761F7B17F0F06EC9A4B4DD5DB3AA BSf.1
343,033,056 *224E5E6A402EB58A34D1C10FE644C1CD8A98E4F3 BsF7(
343,033,057 *224161CF17787F205207B337BE6FBDF3008F9F56 B?SFE
343,033,058 *224BE77E9E97A3C6A66BCA125AAFF30DE839CBBD BSff5
343,033,059 *224F876423DDBE02EFB0870AE81A898B9AE08D7C BSfLs
343,033,060 *224C245788EE75BC5A3BCCBC743668C4CF46ADAE BsFne
343,033,061 *224DB4C1E94E0145418C72D3412F544C64702588 BsfQ+
343,033,062 *224CD20DEA280714013184956A3DBD9AACD73774 Bs)FT
343,033,063 *2241A41064A7B16F9C5921DE79E831BA029AA936 BSf"Y
343,033,064 *224F43E3A248BFF768AABEE26567806DC453A718 B/S#G
343,033,065 *224E13D80E48B1B2989DFA6D3C806F75AC9CF3C4 B&s)g
343,033,066 *2245418C4A64D2FB353A3CE18DA2A300D00CCE6E Bs,gD
343,033,067 *224AADD5CD914DFC262D75E9643C843748C049E4 BSGHs
343,033,068 *224584732371A3E3C4588B41527BB087BC3E4BEB Bsgi2
343,033,069 *224A219D843CBC337B068582FA593B468412FA10 BsGU=
343,033,070 *22435B00F16FEC25A3613A260290D53DEB9FFFC9 BSGWw
343,033,071 *224973B4489871DE5E347D7F53170F0C32F9D3D2 Bsg_X
343,033,072 *224B6B013DCAEDA0C7B3165EE25450D86F4CA729 BSh#!
343,033,073 *224A9CBE0AED1EF86CF216C07555D29FE4E62A2B Bs
343,033,074 *224EC36BA5E0594BA217BC4633067E0D256156F0 Bsh8s
343,033,075 *224DD5058BFFA0CBC130DBA279F0256382C401F2 bshaw892001
343,033,076 *224D7797B0872313B93929853394F39AF8E07EDE BS?hE
343,033,077 *224595BBAC9FC2FD3757388CE1E05A54A8E80FE2 Bsh;e
343,033,078 *224EB7625218EDFB311746E4474681E7768A9F53 bsheeleh
343,033,079 *2245AC081A91FE015469832E1CC96B82706997F5 Bsheimins
343,033,080 *2245F5C92224D26FDD7C5371493F28622C13532B bshen288
343,033,081 *224625ACAC82EBABE867E1DAF856748615C0C6D2 Bsh.F
343,033,082 *2240161D763FF7538D536D9F9EB33B343D500BDE B=SHG
343,033,083 *224B0CAE251702C578E813338C9BE5914A2036D7 BsHQG
343,033,084 *22453C27067E2C568C6D4D1E87E134C9B577FE72 Bshtg
343,033,085 *22410921EE8D24FEDBDDE58388CDBE1F028A006E Bs&hv
343,033,086 *22496C3657E37FA98AB7CDCCF5FF12893824C960 Bs
343,033,087 *22444C61CC23096CA2D296B893FA46C0C62A71E9 Bs!&i
343,033,088 *2246BE6124C3815B85CA99948E04EB7C427929ED bsicon_uexabzdl.svg
343,033,089 *2242FC83CB2443F33C64397F58720F8841FB4816 [email protected]
343,033,090 *224E73A28DFE98CCE466545AF75CC95E60275311 BSINGAPURI
343,033,091 *2248E8E94244E9F0366A9DBB7EB65018D555E578 [email protected]
343,033,092 *2244AA5B76D1E18AA93B27A0434F22716013A5E5 BSI)p
343,033,093 *224BFDD9FD7C317837941C408EB8EBDD21144087 Bsirliajn
343,033,094 *2248621C7727388DF25799866B023981BE854930 B?sj.
343,033,095 *2244361A9AD652F29F641464B4B1AB0DDE949404 Bsj(1
343,033,096 *224245E87E3A6DE976B207C8EA64D3BA28BCC30B [email protected]sinamail.com
343,033,097 *2249A73BABD771712CD038F5F69DCAE5C9003A4C Bs%jO
343,033,098 *2249C979E893B9B20D04C8CE80E9C2976D1CB988 BS:jR
343,033,099 *224105421109E7FDDC5BB5B93D05DDC193E156D4 BS_jZ
343,033,100 *22425959E8F72EBF1DDFC4CD9E156E8AB86F0164 B:.SK
343,033,101 *224FBBA512F4D74ABB3F6A809DA8C389A0DDBA6C B&sK
343,033,102 *22469E1237534CB9C23F4FDA59BF27D5132CDF16 B=?sk
343,033,103 *224BCBE01C14E7AE47F3A80075A41A872D12E821 B!sk)
343,033,104 *22445CAA486F4B558A77717BDC0573DDB74EA8D4 B.=sk
343,033,105 *224305EEAD67CA53B0785FFA3AE5BB825F3D523B BSkg4
343,033,106 *2240E36609BF5256972E92FD2232745375C29783 BskI8
343,033,107 *224CD6602FABF876D83676381390E6F8D2AD85D2 BSkL=
343,033,108 *224C49DFA7DBA91ADAA846C26094589DD0EE0061 bskrvlsr2
343,033,109 *224480EC448D6514BBF9CBCBB75D5ED92F08DD07 Bs
343,033,110 *224ED3083306DC2649B2EC25EB1A9F818BD18ADA Bsksk
343,033,111 *224649E3D7C2A010B30C2D0FAEA386AFA5F2E1CF BSKv.
343,033,112 *224C91F01E0D4BFF9338F8D6910BB0ED037FB597 BsKva
343,033,113 *224222E56470CF22AA8DAA2733AC52A699F9487F BsK,w
343,033,114 *2244D37FFA820BD87D9D313B3A1112947974F8C2 BSkY5
343,033,115 *2248B39A6957C02468E42BAC64E9D0BEC593B293 BsL_
343,033,116 *224770A9A80A3BD340918C106367570347CC60FD Bsl&2
343,033,117 *22470900F42A734677E1922B4379EB87FF4527E9 bsl3vin
343,033,118 *22421CA1F6FDBCE8FB617F1E46F093C74050FA35 BsL,5
343,033,119 *22459A7737287C1B4EAF5D0647C194B76A835B81 BSl52
343,033,120 *224C6AFE5CAABEC496B3AA5572BBD6E029F62954 BSL5s
343,033,121 *224B28D14FCE20B1C811AE46FA5D507706FB2EA3 BSl6R
343,033,122 *224D78EDE84FED752B668B5B54B7475F655EB69A BS%l8
343,033,123 *2246C76DA62F46F5E780ED4F9C98A085A0AD7D9B BsL9q
343,033,124 *22420C2ACE1648491258079362132B88F60CA9AC BSlA/
343,033,125 *224AF07FB7AA7FDDA200DB9FCE084604C14DEAE9 BsLC%
343,033,126 *2249CEADF4A1E344E4CB9E06148BBEB53A333FD2 BsLHX
343,033,127 *2244EB1F714C9E7B18C69DCD8D185AD06CEA4660 BSLIv
343,033,128 *22481C2BF6FF13787CC03CC2447F80AF0BFB3D95 Bs%ll
343,033,129 *224E530E82B1812172B7C85220381B1AB2D85F61 BsllY
343,033,130 *224EA7449FFE9DE72E8517CC638FD135D9CC8420 BS?lp
343,033,131 *2249E86705A31C696544782774C265A70145F7D4 Bslss
343,033,132 *224711F3696C151650F1D0BFBFD696B0DA446FD1 BsLTp
343,033,133 *224723BC5CBFFB746CA7C39504B5738AAA0B72FF BS!,m
343,033,134 *2245A13F6E378EB91A5394E19AA636004A949DBA bsmber6
343,033,135 *224616778269386A59C6660A1F1D5F865C5F26EC BsM;e
343,033,136 *224FD8B91280F793C90FDBE55A36334B9119C473 bsmi00lp
343,033,137 *2243FE53CB465DB49397B74AD5579448AC04A618 BsMIU
343,033,138 *2242E45E520D2373F1D32DA49391356B9D55578C bsmrckn1
343,033,139 *22465B7D9689972D5B2343047740858749E65380 BS?n
343,033,140 *224A3690DD76F181BE0BA5C37D5D1EC97B957C05 Bs")N
343,033,141 *224735A7C132EBA827DB14AA65CA0634EFC5C022 Bsn(!
343,033,142 *224A9875238BCBF0FD9153D9989BC51CF778C614 BSN6L
343,033,143 *22483953AC3FCDBFD69E14D6FE5CF759591E768D B.SNa
343,033,144 *22447F75D0E19D893704E938FDC1F1E7C92A0086 bsnapmaze
343,033,145 *224AA9255420E50ABF6899E009FF3C0F28DDE287 BsnB$
343,033,146 *224F728B64FBC535F5559C7177D276221DF6D7C2 BsN(e
343,033,147 *224F492DF5B44F6757A972312FBF57397968583F bsnead1282
343,033,148 *224AA5A983A7CDF63C70E5C04B0A5D5A4335DCF7 BSNER
343,033,149 *22419CC8B4487A324D3CD4B877ED4D1FA43FEBAF BSn
343,033,150 *224E8029898AB9961FB8DF33EECC3049779EA6CD [email protected]
343,033,151 *2246DD2BA40DFB007811F57400F786AAE8DEAEE2 BsNL
343,033,152 *2244489C23985F97B15901486E30A2F999DDA2A4 BSnr%
343,033,153 *22477BA0A13193336E40EE5907DF98E2F53BE950 [email protected]
343,033,154 *2247B8A93CD3D2236862E42E30EBEAF5F5299397 [email protected]
343,033,155 *224B00CB1E07E5B84853232D07F38E9B52078392 B(So:
343,033,156 *22418B011D1BF1C7B3D95B5F315057A694C6F390 Bs_.O
343,033,157 *22470EA9441B2A230CE0BA9DD900FDF600CC48FE BsO,2
343,033,158 *224DD72F2881FA98AC7122B4A7E553E6DB4388DD BsOCt
343,033,159 *22497CD78FC0BBD32C4833798CB91B8A3828AF16 BsOER
343,033,160 *224F291451DA6365A99A744FD468BDB26263AA3C Bsogw
343,033,161 *224C79220F1A042E2EC0CFFC0FC0EE94CEC68E55 Bsolano7
343,033,162 *224F5263FFB8A39AB000C2754EA49E3EF40E3E3D BSo?N
343,033,163 *224B0FB2A367FBDAB995838F2294C471C70911A1 [email protected]
343,033,164 *2247D29632E0A15FAF544442B14CAD29D7829497 BsotK
343,033,165 *22482B8E6E73784BBE69DE4366CF963B1ED9B24F B=SOv
343,033,166 *224F59D5A90B954AF9E9AF7BC7909E859C51C49C BSoWl
343,033,167 *224CD0E072A4AAEBC195AB43FC6EB09A65FA6619 BSOZ%
343,033,168 *224C71DCCD5157B2AFD8187001B6A88DDE539879 bsp85257
343,033,169 *2244A46D310A02F9AEF3E7297594011D7470CC02 BS;pE
343,033,170 *224C9163C4D4BE8B8B5CF1D2C5104E00612B18A4 BSpF,
343,033,171 *22416E6B3516C1AAA45F17EB18D616F0C4EAAC30 B;spg
343,033,172 *2240DEFD535F365A4E86330BE43B706E0F7D04AD [email protected]
343,033,173 *224D9B9A0A86FDFC2F65D421A2B2887E6A1F8AA5 [email protected]
343,033,174 *224A9E6CBCD93122385D49839D4823EC05D4C0D7 [email protected]
343,033,175 *224BA12EEC82007959C38FEF3AFCAF8C43DC7A99 [email protected]
343,033,176 *224D94FD41BFA23E354D0D3B214BD3D4034C5E9D Bspqh
343,033,177 *2245855C31672CA522B2FA0D0BD3714BE2B8C44E BspT=
343,033,178 *2245126936EF7B51A07A31081F286088206AD4C8 BSpTk
343,033,179 *224DFAA842BB3046659850EB383EFCBD55EAEC81 BsPug
343,033,180 *22440A6B3670D59754C8F62B299A08E176C8B004 B!.SQ
343,033,181 *2243939B23B4304365DA04BC8503246C4A4884A0 BSQ0C
343,033,182 *224F4702D45D224829EC3AA5462306D9192F4192 BS-Q1
343,033,183 *224369D1945742DE1A961D461530397917D3C446 BSq2;
343,033,184 *2242F3290CCABE8E83A42136D68775578C80A1B3 BsQee
343,033,185 *224474CD2ADDBA5D700FB5335F0940983FECC099 BSq
343,033,186 *2242D03796CD64D7D7CE462A4D3850EFF9CFEC1B BSq#p
343,033,187 *2243A4CA3E17922CA605CD3F10500988FFF0B0F8 Bs`r
343,033,188 *224B1A9DAE116591AA89C66F282EBBA353D40715 B+Sr6
343,033,189 *224B1B8FCEB44B573EFE6C7A8C9427DD9E1090D3 BSR7B
343,033,190 *2245FCD2DD83B31A3FC347298AC7B39E9F4EFA5B BSr.8
343,033,191 *224387D4039F7FE1BD326833D194F394567939FD BS
343,033,192 *2243A04E107BD442A7B8B5F9257774801651BB92 [email protected]
343,033,193 *224471391521CAE5E1DC46BE9A2D18000F8047DC Bsrbngly6
343,033,194 *224532A86F3891F13C350F0C1A6E0A87115C53A7 BSRcs
343,033,195 *2244192FC1D587B3042380D8C4F8D899DDD253E3 BsRe)
343,033,196 *2241B1511EB769FABA7023C82BD37481DAB99D56 [email protected]
343,033,197 *2243565F7439B531F75235E935CCB6AB022392AF BSrNu
343,033,198 *224A52A06F31DE502CE9716F1A8FA5E5A6F6E666 bsrsi
343,033,199 *224479ECBC1DCCE56AC50E7897BD4EA3FA7C5A0F BSru&
343,033,200 *224B146482B629BA09126D2BDCB5F4A372D6FF99 bsrvncs6
343,033,201 *224C5D8CF54FAE5FD7FE7579D4E8DA8F67643FA5 B_S-S
343,033,202 *224E4EA297BEA3E9D55687AB839F1FB7DC844C14 B+$sS
343,033,203 *2248EEBDF962014606BFADFBAFFEA8E1C2C9BFF0 B
343,033,204 *224EE1FA99A1DCE75C6EC2655DC2523F1294C8BC Bs:,s
343,033,205 *2246BF288F3F9C99C61ABA72F26E522B8528B239 BsS0i
343,033,206 *2247C6664BEA60E76A2AE6F8B93C3F213528506F BSs+2
343,033,207 *2246EB961E4335CCB28072FC4195E82260E49310 BsS9X
343,033,208 *224991F0EC7AAEF27A80EC2784F820F706B1B332 BsSa
343,033,209 *2243AE6BEF7DE1401AF946D945CCBCC515743BC9 bsscaa
343,033,210 *224D73CD62D39AAED82BC008A2AB1B0FFB211DA4 BSSJBSSJ1
343,033,211 *224C6215F54866A775D92A50B48389B41C78B024 BSssp
343,033,212 *22417DFC25CB45BE64E123303D270C6C2B3BD202 BSstA
343,033,213 *224C706D14B2D578775F606ABFCE9E4EEAECE62B Bss
343,033,214 *22451AB08B95C8DCD345A5406D33FF0C51F3CF85 BS&t
343,033,215 *22418A1791053F5E1973E85E4358DA61C3DC45A1 B""st
343,033,216 *22429CB85D55EC7D144A71A3C255070FB05D7C8F BSTbv
343,033,217 *224F861D854FE30FB8A5DE15B5340C1A94446400 B_stD
343,033,218 *224AAF718527FBA7D5B81247A9F4EBB7037C8F3F Bstetrie9
343,033,219 *2240D9616F57AD1CC3A4FDF28277A65C1A2D0FC6 Bstgc
343,033,220 *224902744AED3E76CEF4EDE2142BEE1C84118525 BStgF
343,033,221 *2241914811D83CF796844ACD1AF8D665AAD1E49B Bs/tH
343,033,222 *224DDB1FF00A3BAE4D3D0A91209506BD766C9347 BSThU
343,033,223 *224F6C26167B2474E01BBFE92F6103ECEE26ABE5 Bstntnsm2
343,033,224 *22433D485BED65BD7EC21D315A649FD7827BC89C bstranke
343,033,225 *224130159B12FF0E983AD4235B53CEC3B897E034 Bstrdvlking
343,033,226 *2244381BB2FDA20DE143A3DDE44453DE502A3108 Bstrdztn9
343,033,227 *2244302369E6B8F9F81B47775BB8980376784226 Bstrychdl5
343,033,228 *224FB1DCF3EEFF0AEA8E42EC8CC1ABBE63362126 BStS)
343,033,229 *2248FC99CD0DD99FC2FCAF409EFF54717A8A05D0 bstyle666
343,033,230 *224147A39BB05F6532BDB36E4DFC420263D22964 B!stZ
343,033,231 *22461248FDC08B94DBF8E3D6C15B519B50945509 BSu=%
343,033,232 *224DF22D4A310C9DED4E87B4DD3AF17E39E973B9 B,SUD
343,033,233 *2244716D8153052F795A0DE8795CFE91A95220CA bsuffixe4
343,033,234 *224C4203EE4EE7394B0D1C90CFEC7D394CC50E66 BSU.g
343,033,235 *224BE49CB611112795800D17480595E133286BAD B_sUg
343,033,236 *224CE3CA334655EE3DA655754E555B0FC9118714 BSuH:
343,033,237 *224B38AA216F37D0C65C797E1FDA6F4091905B81 BSuh2
343,033,238 *224DCB7812390862A631D9F3923A130F2C16FBE0 B-Sui
343,033,239 *224D89178C4616B3B84BED6EEAC316C503AFFCD8 BSuK1
343,033,240 *224FFFAE1C3398D1187EA98F052C61A3A8CD5DEF BsuL7
343,033,241 *22446F86017A412DD8E42B3C7FA53AF5B35E6821 BsuoU
343,033,242 *224542DFC3C6B79B1F85FB4AA2DFDA153C189A9E B"Sup
343,033,243 *224BEFD840E08182DE3974A0C927615A2C3471FC [email protected]
343,033,244 *2241779F3EF14270F034F9F3718926DA5E1D3530 bsutton4
343,033,245 *224C63280E13A4F9A8A9341E8182A24041C97500 BSUw?
343,033,246 *224E32ECD0F8D61CC1B1A9DC9F61DB24ABD207F6 BSUW8
343,033,247 *224BFF4C049D3D1659FF21600D881DF8C6C01C52 BS??V
343,033,248 *2240B06D9353988494B16B753B922EE265B81493 BSV##
343,033,249 *22401C0A98F7B8EA187A5B3D9BAE9B308CD21D80 BS
343,033,250 *2247419D0768C6F3FFC78E188541DF5CD1A0884E B(sV
343,033,251 *224619219DC9179ADAE07D5E2E43C605F519C2E7 Bsv!2
343,033,252 *2241CBBF42B62A76002846735AA776CF2581E666 BSvB&
343,033,253 *2246AB625642F2CE1764966031E62C32BF33047C BSvct
343,033,254 *2245D3BACC8D33259E91D3A5E1516F3014DE28F6 [email protected]
343,033,255 *224CE7DDC74FADA66282C9969A9F84126B72FF0F B_!sw
343,033,256 *2244B8A686AB9FEEC95FE0B135FF6ABAB4A29555 Bs$w
343,033,257 *224036A7C1C1F520B6885D49BAF6B638142E3B13 BSWablingBSW
343,033,258 *22496F2CAF3E1B27DE0D3778B513E12F3EB84873 BSWacatelBSW
343,033,259 *2240A52CD163ED78EB47C04B1E0110D3EE757A80 BSWactricesBSW
343,033,260 *2248D39F0F92071382EF16DD75789421DFAD1730 BSWadressing
343,033,261 *2241D41C467B8E2B2A6DDACB54CF3DB24A830062 BSWalcoholiBSW
343,033,262 *22489DB8502CCD88500F6331C5E6E43EF10D26DA BSWanonyemousBSW
343,033,263 *2245587AFD30ECC3CE0D88ABA272F88B2ABC4B40 BSWappledoubleBSW
343,033,264 *224DF253C60AC8F9EC1E594C609983F5A7596C52 BSWarlutanetBSW
343,033,265 *224B245D2E305081C4D86DBCAE45FE8FD6C2F8F0 BSWarriorturaBSW
343,033,266 *22452C974FC78848D17A2E3521FD6171B906B375 BSWauernheimer
343,033,267 *2244A43E9BA6B03EE20A1F0AFDBA568F6A87A939 BSWbelluscioBSW
343,033,268 *224EFB6E8FFE6B44C4ECC6948FA1B15196EE9C4D BSWbigglesBSW
343,033,269 *2242A39DAC3F691F3C7301FF83F82CAE42209E2A BSWbitfieldBSW
343,033,270 *22453EF421375C4F65C81186BD0F4E229177B0C4 BSWblackaderBSW
343,033,271 *2248027BABC9DE4866474CBF8B9BC3A3395FAC73 BSWcanspaceBSW
343,033,272 *2241DA98C2B235EBE871533A3772B3EC170DE27A BSWcardassiansBSW
343,033,273 *224C1E2F53B521D8529E46AE049E9C70710D3372 BSWckfaBSW
343,033,274 *224926ECE3366D7C0E6062E825659FE54023A233 BSWconfiteriaBSW
343,033,275 *224C558742D1500695354F7C28A343BC3F82BE7B BSWcontractantsB
343,033,276 *22462F90F8C6083936312CA88971BB07D6B31B94 BSWcontrolltdaBS
343,033,277 *224D35F8961ACE7660069479C0C0BDF5E18B6FE1 BSWcorabelle
343,033,278 *22494658B0EAF7FDDA89380EC2479ED4891245B5 BSWcscoBSW
343,033,279 *2248EF07E4927A234BE485E9C03AF860E2BAC68E BSWctliBSW
343,033,280 *224284F243C00DD70810C2B96B56CE8772F08732 BSWcurhBSW
343,033,281 *224F6B27DCE944C9E05932BD124F2F9A268C3C12 BSWdeberryh
343,033,282 *224D84449078BC3D3BE0C80B15C3B4B269B9C44D BSWdfacurveBSW
343,033,283 *224055FEE82FF01B1FFB49F89D5C6495CDC387B3 BSWdibenzBSW
343,033,284 *2243405C5366655FD5640E93D2D559C3FAE2C96D BSWdipropionateB
343,033,285 *2248C157296E95B67A078049FB07A21FDDC18B95 BSWdirectorizedBSW
343,033,286 *2246156B4A440637C781FDE2850DA18678769DEE BSWdirectorycallback
343,033,287 *2248FDDDA4C823752A1BAFC2BABCD75F6F14E4DF BSWdubofskyBSW
343,033,288 *224E7B1AEC204808A68ED34FD816C6102DF3DC4F BSWdversion
343,033,289 *2249C2AE47DEDE14E640CEA97F36076E0E1BF146 BSWehsalanBSW
343,033,290 *2243D4734DFF093A8E607CDDC36D8F7588A37E39 BSWelbaplap
343,033,291 *224A53B5DE2F62AECF186AAE40DDD9934E412B33 BSWemptystmtBSW
343,033,292 *22406D921AFEECFA75409563FCD2DABCE8964F73 BSWendlasBSW
343,033,293 *224DAB435879721254691ABE0DDB1C07F7D6B49E BSWerachtet
343,033,294 *224C4022A7648F1A30E8077D5356B28B49892A55 BSWeyyyyyyyyyBSW
343,033,295 *22448040CF4093C1143F525A9D3D883E6652CFE7 BSWfectionBSW
343,033,296 *224229EBB89CFFF1F00FD04730CDD6013B9C2960 BSWflorjancic
343,033,297 *224C1F272FC416786936BC8CC71BA521921C0808 BSWfrangBSW
343,033,298 *224FA21C166BD390B8C229895733325AD132E1B1 BS/wg
343,033,299 *2248437C2A1CD2831A8A04038119A1B3740830CC Bs(WG
343,033,300 *224600410B3EB5585C7E88DA20B805AF278C62E6 BSWglobecolorBSW
343,033,301 *224F82319D6A1790260D0A0A2EB2F363FAD66961 BSWguglielma
343,033,302 *224CE145FEBD6701FD8F7B6E93CD9F9A4B1F7E86 BSWhaeberleBSW
343,033,303 *2249CB5AD926FCC7B9BC990803B00E5752AE54CF BSWhellkvist
343,033,304 *2244D99A8A5A05E2AE7BEB1B0BEC8AEF5C9344B1 BSWhieronymousBSW
343,033,305 *224936BCA0A4C423BDA3CD455AD123D439F94D8A BSWibshiftBSW
343,033,306 *224391CABA791A91B4FE4BB9BD6A8FA9F8FB7698 BSWideamanBSW
343,033,307 *22493D9078BC6D7F242E2C390E98DDC30A71C4F7 BSWinconseqBSW
343,033,308 *224A430F11F288D48539EB715D3E4CA1C4406E37 BSWinvernadaBSW
343,033,309 *22489AEF31E440C3C570AB93E821A46A718B57E4 BSWiwthBSW
343,033,310 *2246471453FC0D22392822076F85568C11E06BCB BSWjankiewicz
343,033,311 *224FFEB408B285136798F4C0E33DD90CF79C7A69 BSWjosepthal
343,033,312 *2249EC46D5E090CBC730D402039904CFBB70869F BSWjuliantodayBSW
343,033,313 *224B7139370830AC001C9E9F7D71CB8CBB07B2F7 BSWkesinkesBSW
343,033,314 *224A6763E66309446EA63648D18224070FA18AFC BSWkeyofBSW
343,033,315 *22455E6EACF0CD0967D592F3AFA8EF63FC093669 BSWkilwogBSW
343,033,316 *22494D18E58190B272F120A8E6D4A7C5D73D0C6A BsWkO
343,033,317 *22433CFD13EB10BEF6A4BA39D276D54B6FFB9752 BSWkoeckeritzBSW
343,033,318 *2240C7851C21DA4C64D2D0D61DBEDDC07B01583B BSWkoukoulasBSW
343,033,319 *2241C7472E4C0B0D688A8ED0D87D70FC87D94DC8 BSWkrgrBSW
343,033,320 *22426EFF1AE17F636275C09BC5379AA55D8DC2CD BSWkymBSW
343,033,321 *224C88C8ECEDEF52ABD3AE58A4AE34F91DB5A7F6 BSWlahmanBSW
343,033,322 *224DCDDA845BB5937843C2146640C003A47EB8CF BSWlandtagssitzu
343,033,323 *22478996A6B392589AF985C77ED1D48137773E5E BSWlarrefsnBSW
343,033,324 *2247DE6FBE343DF0534156A0B4E59E84DE0C10AA BSWlatsocetBSW
343,033,325 *22484CA15CF690FDE3AA2FFCD3255D18BD89E7DB BSWlegowindowyposBSW
343,033,326 *224B6A38C97EAF8869C2C5D8CC484258A7253451 BSWleibovitz
343,033,327 *224B0A162A2E8761AB6627DA3E94FE5E261B11F8 BSWlibflags
343,033,328 *224519FE6B2098494C9C843C06B5EEDD0C99D538 BSWlobmaxwidthBSW
343,033,329 *2247F4211B673D5582075C9C2E6C6D826BAE7B18 BSWlouderback
343,033,330 *2242589B2185690E57C9DA30E154A07DE01197DC BSWmanifacturerB
343,033,331 *2241B7071B0B85AA078AA470B68D8BE2292537C0 BSWmanosakis
343,033,332 *2246E20E5EC81C16E99B059FE537E93BFE0F0D36 BSWmcastilloBSW
343,033,333 *224034585E65DBBE5EAEE267DC55F7F4C7C6DF88 BSWmcgeorbrBSW
343,033,334 *224A33915409E2D56BCA502B4C1F4AB25D3D6CAB BSWmecklenbergBSW
343,033,335 *2240B6FFF09E831A6BC9390909EF234F024F0ADE BSWmemorBSW
343,033,336 *224D96B9589A2DAFEBE90A5C4BF7186D3625B7F1 BSWmfausettBSW
343,033,337 *2249AF635B780EC8E74CE1C370E37564B4B4A6B0 BSWmolellillsBSW
343,033,338 *224912E1D31B22570BD4E7A336B5DED14FC9E218 BSWmorazanist
343,033,339 *2249FAE12093C2B0BC6BBD0387ADBBFE5CF12E9E BSWmouratis
343,033,340 *224B0F0A4E475AD39CF1AE6704BE2BCF69BA84FD BSWmuhngBSW
343,033,341 *22429457685A3E24167093DF71CC316EF12143D2 BSWmunsellBSW
343,033,342 *22444F15D2D76794B9F507FCDBCEC424F20F920C BSWnaitcBSW
343,033,343 *2244194516593E96B45530C748AD683A73AB5CB5 BSWnarashimaBSW
343,033,344 *224D153E501DA26F07BC9B551DA02C83A9A66023 BSWnavratilovaBSW
343,033,345 *2249C1E05DD08B836D572B1DB6230DED9735888C bswndlng6
343,033,346 *2247090307B1AEC55DF50B6268AB2298727423B8 BSWnemetonBSW
343,033,347 *2240594236204176FA1433CCD76E6CC6FD94F192 BSWneuillyBSW
343,033,348 *224392D2CA3E38FDF4C7FBCD3B4799BBCD7381CB BSWninurtaBSW
343,033,349 *224D037C554EDEE97DFBE9355A5719DECF48F8F8 BSWnistnewsBSW
343,033,350 *2248C217C2FA8ACFF5FC5F9FF6046D800B52AEBB BSWnmyhBSW
343,033,351 *22483DDB4006C43AE92C8DFA814FC6987F264BA1 BSWosupyrBSW
343,033,352 *22435B4356C2E76F0E4050DBE6E246948F98005A BSWparentlistBSW
343,033,353 *2240D0CFA40DD556D423817943E197FE5AB0309A BSWpartnamBSW
343,033,354 *2247A6712274E0CB0BE7BE539D4EE1749505C8C9 BSWparyagBSW
343,033,355 *22482A532B8C1EB7B33326B8ECB5F1928F17ED31 BSWpectoreBSW
343,033,356 *224664C0DB3E6DEF29E5819F797A037A4D585EE0 BSWpickumBSW
343,033,357 *224AF003AF666F953FB51FDC04371C039FCE80B8 BSWpiermontBSW
343,033,358 *2244DCC521A7103CF070A6051F89BC99D79DC563 BSWpiomelliBSW
343,033,359 *22490D7A562CEC3B2FEE06B8E4E14841EC76D648 BSWpitstops
343,033,360 *2247D96B3130D3AEBC7809DD765231F6533BFCDF BSWprfldBSW
343,033,361 *224543ED24BA432809D2A7961ADD7D05E7B16C21 BSWquakertown
343,033,362 *22496911AFD27E88E44BCDD888D98B3589D2A4EB BSWqvortrup
343,033,363 *224A2E25C673227E2B62ADBB902BBA630A0FABC4 BSWrailroadmen
343,033,364 *2247CB777DF7A7B189A3A4BCACF6BFB77E3B5414 BSWrealistinenBS
343,033,365 *2243822DFFD2727786AAED4230C920CA00C175FB BSWreferrantBSW
343,033,366 *224786F3554A5B43D6447925630411A4E2FBC565 BSWregionalligaB
343,033,367 *224851C5EFD4CA90D246487BB016FA51462C3272 BSWrfhnhstBSW
343,033,368 *2244B844AF4281DF48A0C019E457364BD2C5F5D1 BSWrufumleitung
343,033,369 *224E8D60A9CB547ECB480583138E06DBC6D13F24 BSWsaonBSW
343,033,370 *224CC64280BAB2E613A7F3DCE915655D5D5B1F80 BSWsbchrist
343,033,371 *2249DC9CE4E5E050772D903011F4187C5B3AA7A2 BSWscriptscriptstyleBSW
343,033,372 *224B92EE34D0E249F49777CE483373B51F809AA2 BSWscursorBSW
343,033,373 *224DC6F502FD9AC63B82058548E9C87E6BC34BE1 BSWsdkfBSW
343,033,374 *224A7C62B021B2CED824C24DE8E3E15F262905FD BSWSergBSW
343,033,375 *2245B095A6EEDF2C0D15B49AE0B494DA48766FBF BSWsettingsformBSW
343,033,376 *224AF961BFE775F0686D465519980EC300D53DA2 BSWSicesBSW
343,033,377 *22470A7414C5485297113C7E1922F589D1A7A485 BSWsivasamyBSW
343,033,378 *22443960F3B712D48FD57CA0042FA852C8CABF31 BSWskuffenBSW
343,033,379 *224B40A9F3D82491136333714FBC37ADE317F735 BSWslaytonBSW
343,033,380 *224CEA576376EEE08B08C89C78C949FF049C0524 BSWslimeball
343,033,381 *22400B7BF3ABC8DB4CD4FBC22C0C2B83A7581137 BSWsolinoBSW
343,033,382 *22430D4B9F863367B1CE0FEB811317A801E26299 BsWsq
343,033,383 *224D80DAD03F9DBE0157DA85132530D1E1790949 BSWsterbaBSW
343,033,384 *2245B7C4158F79F39B68897E4F6A5C8AE464BCA1 BSWstudierteBSW
343,033,385 *224628BAE794112E4F3042660B8F6B186CEA5C93 BSWsubstituido
343,033,386 *2243AAB24496EA6817CBDE585B7F3AC761AED48B BSWsuoutpulBSW
343,033,387 *224AE91801F8C5DA15FA0B4E79D7B3A3CD5BF798 BSWsyndexBSW
343,033,388 *2244E153BCE0F5E431663B1E19C78A06C9181D40 BSWteksacBSW
343,033,389 *224EF8C4EBF33108776D5A2BCF420BE4E009C7D0 BSWtimecharters
343,033,390 *22453543A69C1F560060BD28EE325E6AEFB4D1E0 BSWtrainiBSW
343,033,391 *224481E51336A4E6292CF1878E48F69D32809556 BSWtrifftBSW
343,033,392 *22411A8918EB93C30D9987AABC5FC0905274C32B BSWtroquetBSW
343,033,393 *2245603770081D395E5C4C4985513FF2B93DC104 BSWunfifiedBSW
343,033,394 *224D5A91423B70E70BCA77556AF38D592148CAE4 BSWunindended
343,033,395 *224F8E0B80B36F91B52C594F51A8701F9B46C442 BSWunpsunBSW
343,033,396 *22418C61678A37D66A9B30FA4B9F9407D8F4A120 BSWunsucktBSW
343,033,397 *2245FD18D740847FA81B9040DBD4087191EAF483 BSWuserbasket
343,033,398 *22472D0D857DA275E54F5A85A0438D9568FB9E66 BSWutrcBSW
343,033,399 *2245419CC7F94D3A943F7BB4F484E50F7CDB14FC BSWvermeintliche
343,033,400 *224038F691FBCFB4B71D8FEB9D004ADCBED25754 BSWvstackBSW
343,033,401 *224CEA0D471B5073FA2B04F2E25493A271622BC1 BSWwandlungenBSW
343,033,402 *2249C3684BA29D1FACB0C6AAEDF9545FFF2F7E35 BSWwinptendoBSW
343,033,403 *2240C6906BD5F9429B8B70338D2E26CC4EEAEB45 BSWwisardBSW
343,033,404 *224C1E5785713D28F12DA997946259559BBC78E7 BSWxcolorinit
343,033,405 *224843806BA71B574CFFABB57D9B1E8D83C641B4 BSWxnounsubfileBSW
343,033,406 *224963AA956B7C1780CF6E7E7DEC95574C501B50 BSWxxxxkirkxxxxB
343,033,407 *224AFCA5FFD74D938A409D687A6A56CB973126C4 BSWydiolpylBSW
343,033,408 *2241A6D13BF07B1457FC092DAC743A143724A691 BSWyolantheBSW
343,033,409 *224182E8765568D8878AE5070DB3E39291FCC424 BSWyongsanBSW
343,033,410 *22447F99CB90A23524CE65ADB7A6904560C68371 BSWzjyBSW
343,033,411 *22458890120BE1AF196205AE31C617168470F354 Bswzxbswed
343,033,412 *224552B445839FA497D822700231E1746EF5184F BSX$(
343,033,413 *2246AB0548577DFC7C7C2DBEBA6B6F9D3B81445C Bsxbtdm5
343,033,414 *224CDEEF4CBF871A0299E29484C1ADE5C58A2861 B$sXc
343,033,415 *2243BB07AE8DA3CDF0AF00E99AF681BE8F772F32 B$SXE
343,033,416 *2242C58B1620E27F8968D7E52F865560C98D4AFB BSxI
343,033,417 *2243B12463E07AE845B27E77509DF62E1124FC42 B"sXI
343,033,418 *22426D78EE3BC20E7991D207EEDF91A4E43794BD BSXke
343,033,419 *2240E74DE023DF8FDDA46D854876FE1A1BE1B33F BSXL7
343,033,420 *224AA7596B50A7C6AFEBCA8AF8F9F8865DB5A2D0 BSXN4
343,033,421 *22410C41B065D6914EF6A3A032CC207FE3160378 BSY&d
343,033,422 *2242EB358A27B76EDD3502C60217A57BE6FE29FE B(SYh
343,033,423 *2245271807F5703238372F8D2C947F623BE83AC6 BS
343,033,424 *224F03AAFC8DA72FE40332426BD38BC0632309E4 Bsynthszd1
343,033,425 *224CAED83E5E89441CD14A7C07983FBD48545DD4 BSYsd
343,033,426 *224B96879FB4F8CCDF89473787E391BED3228905 Bsystmty6
343,033,427 *22483F78029DD9A70F9C6769B3A8F565C4D77D18 BS!Yt
343,033,428 *22432E1CC7618EBA5F211AA4749979CA78D89F66 BSYtD
343,033,429 *224396FE36D5B3D6239BCC94FDAF1F731340CF3E [email protected]
343,033,430 *2240511091E8AAEB4AC2A8AC6772CC3B4909FAC7 Bs;Z
343,033,431 *224475A1F093C213C0FA5818615AAE39EE9621CA B
343,033,432 *2244BD6569E07FF57F93D3B16998743C6E47C8A8 [email protected]
343,033,433 *224051A2F23C61CBF418DE0E398F02D5C4943E67 (BSハイビジョンは隔週水曜23
343,033,434 *2247CD7D89D6A8A93C7972930117903F7956414A B>>T
343,033,435 *224FBB88E12093B399A23C1B4779163397A0F0C3 B:.=T
343,033,436 *224190C1F304E6B1EB40A2A74F5615F3402444E5 B)T?_
343,033,437 *224E16248437B06DADBF12C297BA224CAB8B773D B$+T:
343,033,438 *224ABA283CC4A000A47318DA9F3934E828B29C10 B$+T.
343,033,439 *2243148F80F4C04BCCB59827896A563826482BEC BT/%%
343,033,440 *2243C594B6CD6D6EDAC8E040D56C5BE177955103 BT+$
343,033,441 *224EC2C4863A70366BF0C0B82B396197A837B64B B,t!,
343,033,442 *22403685CA40EBB6FE8A194EC34DCFB5149807AC B;t#=
343,033,443 *224599C8E9C70AF7052A27EDE8DC68060CF77403 B("t?
343,033,444 *22470451980C1B04C38AA8F183715ED9AD6B1A07 B(&-t
343,033,445 *2245E4C904105F919A125F15F737EAF8CF0A6D9D B$!,t
343,033,446 *224B3995F9F1D16E3BA35276EBEB7F9FEF976362 B&?"t
343,033,447 *224511B5DB5E772BE8A9042119E2AF6FC2F5EEC9 b[T
343,033,448 *224ABB030BAF7C955E54DDC70A703F277E6A4C8B
343,033,449 *224B58DFCCBFC60CF9171415D9F49CD202612CC9 B+T$0
343,033,450 *2243971DDA2EB6A0E1FFB63DA7907E0391D60959 B;t0
343,033,451 *224169826B7B232F4626741F4329E31A14485857 Bt0FW
343,033,452 *2243F4CB3DE061A909CD1B0C6F213C52519BE55C BT0$l
343,033,453 *22494DEEB6AA334B782A4A62D6933432DF0293F2 B-T0P
343,033,454 *224DD515EA2435520B046129B0719255AA3F4BC6 Bt0Qk
343,033,455 *224CFCCE299CF645DDD997F581374EF9A03D5FAC BT$0V
343,033,456 *224B64B28734990D2E61C22BD6EE6DE2D7759084 BT0V)
343,033,457 *224F16C9E11D3ED97A72DFA10BB09254395CB463 Bt0V4
343,033,458 *2244B3F462388DC1CFE2476C9605D42F61C54211 BT
343,033,459 *224941975EB99ACEC8C543DC4D7E57258A7F15E2 BT0wj
343,033,460 *2243F6DFA7452D75299E76B1A565930A98531156 bt1543
343,033,461 *224AC767EDB2AA3456079162CD5226E89C079A42 BT1Ow
343,033,462 *22490FF2DCD0DDF4B7BACF660F063EEB36DEDAFF BT+1Q
343,033,463 *2247FAE03A7C3A727D46F519BD45544D7B65E47A Bt1X7
343,033,464 *22485E055BF311D8BC1B5D2335C7096A6A2931E3 B(=T2
343,033,465 *224956A185488AF62939A700A6F57026CE9BE020 BT2?%
343,033,466 *22442101F4D056732AA60FF16978C6FB8BBDB55F BT_2C
343,033,467 *2243BB582E37E662C3EB7F0AFE4A58CE029B8C67 B?t2C
343,033,468 *2244BB1AFA03772755636AC0CC4B252791C23629 Bt2E-
343,033,469 *224F148B6B336734728AE8B54B6AD2551C00B520 BT2jb
343,033,470 *224D2AEB5D5531D3D084C813D3F8461CA63048B3 Bt2se
343,033,471 *22459B0340CA98328CFC21761DE53C1D5C962B41 Bt2vR
343,033,472 *2249F329AE160EB97619B9C4E31E094951EF1994 Bt2YV
343,033,473 *224B83ACD77323DEBDBDC1717550A1EA318E07FA B+:T3
343,033,474 *2243092EC549A3CF032B5C9143DC3489BC98DAAE BT#3-
343,033,475 *2240073140D6CE6065096A028545E77A2CF6BCDB BT3c6
343,033,476 *224EEF412C5807E8DB8B79664C6313F374611615 Bt;3D
343,033,477 *224802F33C84BE3D71D7782C6B22C48C56CA1E56 B_T3p
343,033,478 *2249C503816BB36B40FD47339164657DBAC06D66 B%t3r
343,033,479 *224894F601F57D0CC00260FCE4C59EB87AFC600E B?t3U
343,033,480 *22491202101674AC02FEF7C4743F8AC5BE056C1B B?)T4
343,033,481 *224DBCFA064CE636340C074442B001546E7C329E Bt?$4
343,033,482 *224DD9E8F29F9040DA43D20E491BB0679FD4E323 Bt43U
343,033,483 *2242CDB39D52E22E84A04702C3802313868BDDE5 Bt43Z
343,033,484 *22437FD75627412BCF31E82EA57FFA022105D9CD BT4a-
343,033,485 *2243454823C2C87EB29A9F0B3B40716D899AD2BE BT4ER
343,033,486 *2244109A3214F7BC61F135E5ACDE642574B10B5F BT)4l
343,033,487 *224594B64EEAF86698DEA0A89EAAE5E9598F4309 Bt4lq
343,033,488 *2247B0C7604221D53E8E99C39A22A8B91430FB6D Bt5u.
343,033,489 *224047F805B0C9C005EC9497F0CDA213F86AFC8E Bt.5w
343,033,490 *2240DA54C5DB508B7A4C1100E2F56DA179984E44 B&T6)
343,033,491 *2249C195CA2D24DE063984226223AF254E109D8E Bt6,2
343,033,492 *224D69E4771C98F5B26EAF95F9F5AC32E3192F0A BT=6a
343,033,493 *224325C0A8B52BE8E762C1A608C23A7177502F06 Bt6M;
343,033,494 *224BC8C89D00AE47A746F7CFFD76E92AAC77850A BT6?N
343,033,495 *224E625D79338BDA4090CFDF1A57798CA3FAB7EA BT6v4
343,033,496 *22443EDC75D89D4511794A307CE40C07574C90B7 BT6Vn
343,033,497 *224034CEBBE63112F7AC1F054F477CECADF0D825 Bt6Y6
343,033,498 *224D4E5EDB242E614404325DB9D49FC189C03EA0 BT,$7
343,033,499 *2245C45C62EEE243365B705880EFF674E96F9D47 BT74B
343,033,500 *224ACEC395A854F17561DBA2F6D968C46434F8CC Bt"7A
343,033,501 *224594FDC6C7274E422D02558FABFDE4FEB92EB0 [email protected]
343,033,502 *2246382A50575077FF9851670E14BA76C6E53D97 Bt7eS
343,033,503 *2248D08725FB01A4B581EA7463D643914720A604 Bt7MP
343,033,504 *2249AE3A8067A1B31A498758785147EA8EF534A9 Bt7q$
343,033,505 *22405F8D07AF1CFCA476593A2485405BEF875FDA B#t7r
343,033,506 *22449BD050B5E38EA9106812505642AA6F9BA75C Bt7rf
343,033,507 *22484D4A1E7F062353402F7F9718C37D61DFE1B6 BT7t#
343,033,508 *2247D49E437B3E0A1FB71F1AB9C90C9908BFC430 BT7Y
343,033,509 *22434E83702610AC257A10D664B42CAF9FD24C90 BT81Q
343,033,510 *22485DDFD4D0B4DE7186EBEF46CA42D57D93E236 Bt8h8
343,033,511 *224BD6C29828DED7032E5CE64B45C82C72A248D9 BT?8m
343,033,512 *2247AAC820ACF6E51F390F7DD354258E62DA89B1 BT8Qe
343,033,513 *224335E1D28B7A562C63444AEB162113641BEFAB BT8v3
343,033,514 *2244BDCAE54C3A84222B490DC3D5E4A312F37632 Bt9O7
343,033,515 *2247C67FD7627520120B6EB2185666460789909F Bt9r
343,033,516 *224CE99C96AFC2262210DD3089CA23748057014F B%ta=
343,033,517 *22466FEB99EFE6ED5C017419C1137A1C8ECB0959 BtA70
343,033,518 *224F1BAD2A0898ED78419C445E8E2AB4B3BE2376 B&tAb
343,033,519 *2240ADB23A36730E6F21755FA2EB1EB3F3E9C776 BTaFw
343,033,520 *2244C68BC73BEDFF19D0194CB76B9D76D0E99EE4 BTaO!
343,033,521 *224BA105E25D67B73BEB8D9BB933611B770400C1 BTapG
343,033,522 *224F3808B28C15F24A665AABA6FB8A6BF38A7D2C B+taq
343,033,523 *224061DEFDFDD99AD9BE98862DDEFA2C31C4363A BTAT4
343,033,524 *224D07E8804CCBAB2581E33573896ED0D8075DDC btaurusing
343,033,525 *224DB5A4CF93B9C354148C641293F94AB4E6936A BT"AV
343,033,526 *22436F98C84F3AB72C5610551D0F9D87D7032736 B.T$B
343,033,527 *2244E2DB661C3055471553E1B53990D888BE2962 BT%_b
343,033,528 *2247A89601B292501CF6AA812F757C4F5C81CD83 Bt%(b
343,033,529 *22470BCC85A9619B6F2C68F2B11747C9AAD6A812 Btb2U
343,033,530 *22446BB9E87F9303E4812D1ABE7E648B1A9A6621 BTb6U
343,033,531 *224DB9CFB91FDCC366BAC6CD5875CB25B5DC7E51 [email protected]
343,033,532 *224964266D9E1E7482502C080ABB2AC7FCE39835 Btbbj
343,033,533 *2246994C33D10953BA2ACEB6D9D8E3AB423302E3 BTbbS
343,033,534 *22419F91749B0E1DF282B1B1AEDA69F685A08FCB BT$bd
343,033,535 *224B47F26F288ECA63D7A46154D14DA0E423D98E Btbd0
343,033,536 *224F58C47EBAEB5163BF41F71DEBDB9D543953D3 BTBG4
343,033,537 *22456E443D9A4CEEBC6CCB3ED25761D3B4A417EF B?tBH
343,033,538 *2241248620E4DB5D15B890920D4B0DE8593738F1 Btbmabsw
343,033,539 *224C24D78BDBC93DC858877EEDF11D6AA044567C btbriefs21
343,033,540 *22492D9CF367253F043883E3B4076F7CD7350878 BTb.v
343,033,541 *2249EDBFF4E01F6A31E84F5B8A3F20F7EF3CC092 BTBV6
343,033,542 *2242A525C6696E74406CD8432774D7943697ED5B BtBvE
343,033,543 *224425F191C4B441CAFA86183B37E0D33CA03343 BT%C$
343,033,544 *2248E063076C75BE828985A2DDBFCC9A9EA53894 BTC..
343,033,545 *224B11E7FBE4AD129348D67E2F4C5067B60D5321 Bt.,c
343,033,546 *224679DE8B68847ED9E3D47FA0520C8A18915515 Btc4C
343,033,547 *224CEFE3EFD2801DC437C36DA179CDC1CB16F3F1 BtCb:
343,033,548 *224E3893E6106B6AC3FC0960168DFB59E45476B9 btcjr
343,033,549 *22493CC5024339D784B72E87A35A82322A8703D6 BTcMP
343,033,550 *2246365980942A464253054D4DBF3DABADB6C892 btcore
343,033,551 *224851F60CD77F45ED1F8662D4181881D8044267 BTC=q
343,033,552 *224346B9F17D5C14088D19284E4CB887A538EBA9 [email protected]
343,033,553 *224E0D777DB21B94CF0484D393189DBA03E3F45B BTc-w
343,033,554 *22405C076F8D67AB43985489C0A75B443223F5A9 B
343,033,555 *224A3BABB4677F129C6116CF1809837977BBEF9E BT.=D
343,033,556 *224C80F10F55A6244948CED0358206C1A2FDA4D5 BTD$&
343,033,557 *22450396941F4D087F7CA39D93273B5C635BB4B9 BT=;d
343,033,558 *2248D7577788BC52CF1E60AAE83583E446162233 BT.+d
343,033,559 *2245711869D18261A4F73C4616F7988E303F40E5 BTd#"
343,033,560 *22418E5E4030527E8B88BDD0323D8F178CD83D3C BtD,(
343,033,561 *224B5E4DCFF186436640CA4A2AC92D94A87C9109 B?t?d
343,033,562 *22419925F176E37E9CF56A839AA349FC8B114277 [email protected]
343,033,563 *224FEB058ECDE5EE72C0641D0951018893D26795 [email protected]
343,033,564 *224740B6B5CCBAE0FCC49865A8A26821CF981D44 BtDAg
343,033,565 *224D98CABA5FC476F10CA3088408E98B196E3103 B)TDe
343,033,566 *2247DB10AC13E8BB15045A2D4B9BE0222B945985 BtDpE
343,033,567 *2248574C7E092CC8AA04D5A1B136DDEC60EC0D1B BTdS.
343,033,568 *22465A46F3C4B746BA2A4CD7B5621ADC948A5F73 BT;ds
343,033,569 *22457C984DAE73F03183793579A980B4B27B495E BtDVr
343,033,570 *2241881C17E2DEE247A7D20EDD7D59554FF3CD07 BTDVRGRTVDRS
343,033,571 *224F1FEF861661CC2EBE8D589517A582B971C6A7 Btd?W
343,033,572 *224AF25A6D957EE1ABCB4C450D4F15E802C00502 BTdXq
343,033,573 *22484C9B2ED0B3A8A3134CCB6A8C9DECF1AEA9AA BT!E/
343,033,574 *2241CBF5AE61E69E2B32818B197B24DD21BCB469 B%?Te
343,033,575 *224532DBD03E19453951BE82AA99014C47BD9C51 BTEbL
343,033,576 *224F89C789FE23E3A931E2546529632172BBB4A3 btechnik7
343,033,577 *224208F6345089B513D7A8F111055EF77C08D15C BtEg2
343,033,578 *224933DA86767D44E30A1B131A4D36CC4FCA0DC5 BTEH1
343,033,579 *224E1E9A662AE5A856CF77CEFF160515BBC3C998 B$Teq
343,033,580 *224E5A81EC80279131A7B5AF90978766AE5D42FD BTErR
343,033,581 *224A04BCB6E3627527D5DDF2AE6A676B4B39679A BtES?
343,033,582 *224E01FDE868413F815DE5DC11571D51D418AF03 BteuC
343,033,583 *224C151C9DCF5556468EC0220CCFF6E4CD2A96AA B!TEX
343,033,584 *224185322D611193125DF94CA38AB05255A467A2 B$tf
343,033,585 *224A0D0130D841E97F5355DD559F112205E434E4 B,tf1
343,033,586 *224CA4C2A0FF25ED77A36136B48280C55E958C16 BT;Fa
343,033,587 *224F0F75D7EB31F0590EBAA9087973532A898C30 BT-fb
343,033,588 *224AF89C06D15503B279F8E3CCD96EC606FAAA90 Bt
343,033,589 *224CD157F4FBF3EA0DD658CC5EB9EC5FA1834C67 BtFf!
343,033,590 *2244B9EFF87EEA508E8E87A332422109DDE71684 BT&Fi
343,033,591 *224645D63139A531CA4C5CCCBCBB776805A36ED8 BTf#N
343,033,592 *224347A70E96EDD68EBC6050B35FDE33C09BB0F5 BTf/Q
343,033,593 *2242D04BEA04422ADEEDA4FF0522509DC55209EC BT"fq
343,033,594 *2249A17D52F4C1E03802D30A251B3756BE506BF2 BTfre
343,033,595 *224DF80E782634D569DA2AA97F5ED297D2C7EB90 B.tFY
343,033,596 *224E2D792B1F37156ED4BF19BB47D93812F68DED B$t)G
343,033,597 *2246740767AF4EB16477DB42E9210D06E4FBC935 Bt-_g
343,033,598 *22459BBD269CAB1DD289E1E1F3D1A62C270DEBB7 BtG4:
343,033,599 *2246B9BE6306F3600A8C4E3FB77425B5EF2C1353 BTg8p
343,033,600 *2245DB29374629D8D8A530A6EEF46E4E471F14E3 BTG9H
343,033,601 *224F57A34E282AD983F3E7E4F75B5CC174F49544 BtGa)
343,033,602 *224E337A40859B89E99E4ACB5972C6F22814BD98 BTGRE10312199001
343,033,603 *2247232627030B7E6A40E1766B4FC9051A2C3ACB BTgSP
343,033,604 *22485556F4A616B8E0B916DAD742439EC51F1EE7 BtguN
343,033,605 *2247A84ECF5BDDB7F2E4FF4B2B61518705F48114 B-TGW
343,033,606 *2245B9FEA16759BE7200B9D44559A31DD9829784 B%TgW
343,033,607 *22492095B2AB23A113CD64E5338F93F3CE80686F B!TH_
343,033,608 *2246AB2F8B403A99169AEE7F21FE8AB642558A83 BT?H_
343,033,609 *224F049D662DFA7A52222B6BF2A074D7FE5DBDC3 B%%th
343,033,610 *2242DA34B9C2BF059D3649943857F6BA3D764509 BT%h6
343,033,611 *224653C590A5A29304D02BD64E68D3B2E22533E8 btHbaa
343,033,612 *224CF43B55CBB896521D68D262AB81CF2D3C2014 BTHbX
343,033,613 *224485DBD73589E06FF6E5992D4FE8645081291B BTHe+
343,033,614 *2249FD9EAEDD86E766072DBF9B2ED8A7E1D6C77A BThFE
343,033,615 *2243E0A58CF1DDC3A21A583CA643C8233A5BE00C Bthguoht7
343,033,616 *224E63D58389614329C391985C45923CBA75CF14 BtHhe
343,033,617 *2240C3928843E00BDB3EE97A00AD75778E4544D4 Bt_hi
343,033,618 *2241A1508A53ADFFA28327D1DBC407EA52B3F6F5 BTHLT
343,033,619 *22413BC89B4630A78F3B71A63DAB2F3D34C559B1 BT!HO
343,033,620 *224BD58D92AD2D2C250743C97499EDE520D7AE64 BT/hQ
343,033,621 *224871434ABD2AF1C6FB4D46D372BFC3AC720CEE BT:hR
343,033,622 *22480F9F52ACE7A766DDFA1B51D05E5CAD31B710 BThT:
343,033,623 *224B7406E5D02403F6B111C70C904289FC785A04 BthTT
343,033,624 *2245B52F6F7959AED786C1BA952000B798F8F37D Bthyltcs
343,033,625 *224812D7B5737F658DB20833E982DE754BE9938A [email protected]$phere
343,033,626 *22474708CE5C13677BCC16217E107FCBFF81A83A Bt?HZ
343,033,627 *2243920277C4EC69944014DF65530BABCD088B99 BT_I/
343,033,628 *224285836CBBD99CEA8148CEF74D7A1F71368F31 B
343,033,629 *22429B24DD74ECCE9185D02898B115F763683723 BTI6
343,033,630 *224EF85192F52CC7E5237ECD34CDDC9FAFF25072 BTIGK
343,033,631 *224CD86E53AE3D060DB462F431CA82EBA360BFE3 BtI
343,033,632 *2243150E16F50D66F838FC25A456E0F173A19B9D BTi!L
343,033,633 *224804CFB984D968E030C66058F6D0540E393256 BtImR
343,033,634 *22498F8C3BD1A3D6FBC72A851DB6A14967B64BDB BtIw-
343,033,635 *224FE1288A24E140B2E1899C5E237EF97E80F055 B#tiW
343,033,636 *22424621CBE7A6BF8EFC4690ACB7A8FC6956BA36 [email protected]
343,033,637 *22451233098A55B4047EDA13D7F96B63E0CBDD0D Btjep
343,033,638 *224A59FF7CAED3500A7D1E11A7E03B9BBBD452B6 Btj?G
343,033,639 *22411F75EB9634E936C7A44A1E0293CE9C0F7478 BTjll
343,033,640 *2249A369C93488A52B1BD48C0CA065EFCDB7BDBF Btj?m
343,033,641 *224FB0779F47A1C6344C6325F4326B56159633DC B;=TK
343,033,642 *224D0C88496EDAFCD1E5BF811DDCD64209E4759D BT;K;
343,033,643 *2242108AF74994832CF5D3C2C7967909E3984C47 B,=Tk
343,033,644 *22475A8077CB47F7617F99509DDE99526F60C636 B)#Tk
343,033,645 *224F95AECE1DA97C6DA37AFC878407E3566DFCFA BT-:k
343,033,646 *224F876A52A27F2759E2176660F5250C6A65B095 Bt&!k
343,033,647 *2242E4346DBDD87A54DDFFD46003BD29C89B8E1C BTK,F
343,033,648 *224EF70BC5C918FABCA9A3A2BC4BC84ECFD0BED8 Btklc
343,033,649 *22429AFA1AFDC15DC3A6BA8F6F94516940A28542 BtkqA
343,033,650 *2247302A1C4F10BE0631A12E8E618BBE4E0FCB2F BtkTS
343,033,651 *22422DAF6694A7351F7DF14EDF07D778867451D6 B!%Tl
343,033,652 *22464006D32E661392A60851455C546CBD523125 BT+l=
343,033,653 *2244A839B0874E8D63169684C90A4D6F9B7B8477 Btl?
343,033,654 *2242EDB3DBA44DF708135177CB4AA4430642628C Btl0-
343,033,655 *2245070683B46A98EA4E7C6C91C45A6DAC134722 Bt.L5
343,033,656 *224BB80AE9687B50B0857CC03AAD87D4E4AA13B6 BTl6N
343,033,657 *224D89E6208CC40934D69AF1136ED3C3FC2F0C5D BT?lB
343,033,658 *224EC09D2E98253FE950C1E3C66C43568B09E3CF B_tlg
343,033,659 *224BA8F1A9DFA4B26FAAD353002E82F6CFFFB68B BTlj&
343,033,660 *22422A646EBEE249B22762A1E7BC51381CFC08AA [email protected]
343,033,661 *22476E48C7EFC44A946E17B2309BBF385D756861 BtL.w
343,033,662 *22409FBA208366252672E8AF12D45211A15BA668 BtlY_
343,033,663 *2240FDC546990E4EA1C4528D541196F43DFDB47E B,-TM
343,033,664 *22495B3821D5BE5F517A6EEFB2E9F520231289BD BT%/M
343,033,665 *2249D880034E4E23744351B3BEBE0065310D607F BTM(3
343,033,666 *2245BC4B638C05CC03E64EDED5F2D868CFF40FA7 [email protected]n99.com
343,033,667 *2247C5F75F9733FB026D79261DAA3685FA77E936 [email protected]
343,033,668 *224C22AE31A5E08BCD83DF8057BF888A892382A6 B)TMA
343,033,669 *224B0CA4EDCE9025A332517B45251901C29FD5BA BtMDI
343,033,670 *22425A598995F6565393D0B7B2B216EDC910C51B BtMDT
343,033,671 *224DAFE79ACE04093F625363833213A469AC787D BT_Me
343,033,672 *224BC04B8C5A7B4B482B963559C0925CCCCF819F B:tMg
343,033,673 *224431550D6D8C5A248337FC0DCC5A7B194F8D45 btmguyil
343,033,674 *224BF5EC5A6BEC7A71994A89698CF4DEA05B16F6 BTmPZ
343,033,675 *22436F97F3325EB3AB5C42C92AB26A085C3A0560 BtMSb
343,033,676 *224D56946891353A22D5BBBE2648B9DDF10BE833 BTmWv
343,033,677 *224F2B3DBD479EFED7BE135C664A61AF7FF992FD BtmY)
343,033,678 *2243B13E4A03752AC0024ED2892912B5540A4455 BT+.N
343,033,679 *224E605BA91E2072A303CEAB521FB57BEB97929F B.T_n
343,033,680 *22454CB88D8E24A755274CB228A22F895B4C94D7 Bt(N2
343,033,681 *22404A6E9428FD2C7E725CE0E34C23D2A884CD7E BtnbV
343,033,682 *2249D66BDF6C143580E9632CB1B3BD553B4567F7 BTNhq
343,033,683 *22478AC9B82F54CDBE02B5E94F11A969E3A01565 BTNI2
343,033,684 *2247D9AFF448FE9091DF62EF3BF7ADAC9FB50429 Bt=Nl
343,033,685 *224EA7626338D3E2B3A2C48D6CEB6DC70A9872F8 BTNmG
343,033,686 *224AC9DEAA3693655E80E85146848D1A5144B4E2 BtN;N
343,033,687 *2246102DE47DBF52614E517A1DEAF206E4628CB0 Bt$Np
343,033,688 *224C146E2AD3348B36CB398BBC499B267E49B6B3 BTnT0
343,033,689 *224F079AE1FC5D8C4D1712882EB8C29883E5F382 BtnYv
343,033,690 *22467B02DEB439DEB75A7417E17751AE6E1CCB70 B?#TO
343,033,691 *224E8202FBCB9C4DB878CA76250A54D58F25D451 B$TO,
343,033,692 *22438D3F024B1FEE94E746E609B737E0AFE59499 BT\O
343,033,693 *2240C66E2A449A0125E8FE36AFD2A311A9783878 B%)tO
343,033,694 *224EB6F4AE06368A3CDA31CB400CEB4A7A4BFCEC BtO-;
343,033,695 *2242E6A6EF9E32D3A1B05400617522D0C411258D BT%O2
343,033,696 *2247CAFC624C8875564A175A070C2ECFF754CBC0 BTo51
343,033,697 *224619B117C592296A1B2B0CEF3CC2BB61D8209E B/To6
343,033,698 *224B7CDCF946BE63059BD837E2138E38B74FEF9E [email protected]
343,033,699 *224C91FA977557755B4483220BBD03CCAB0030A1 BT_oD
343,033,700 *224D2221328EC0E39B2E3619BCEE2A95D854E62F BtoFg
343,033,701 *224938B6833D16A0ABA50B0596F5C8CE83217D42 B(Toh
343,033,702 *2247B4111D10AE06B3666E8051F56201DB8BACB2 BtOi6
343,033,703 *2243F377AD76F7F35171F92226DB66B94AA65EDD BTO$Q
343,033,704 *22401B789FBF76FC8B5BA815C2D6FFEA0BD9C02F [email protected]
343,033,705 *224792A8DA23A99A301DE305B9C67547DEE87391 BTo$u
343,033,706 *2240B211EBEB85A593AD9C3A87792635A2B7BE9D BtoWB
343,033,707 *224FBD158C36C196A880D494D5BD6A32B121D4DE B=t!p
343,033,708 *224FC5FF99C764B59FDF9038695B494B8C843C23 B"t,p
343,033,709 *22479B7E9336A1C5CFA400B31541BCA83501F99D Bt&p"
343,033,710 *2244E5EA6FE69595FD497E180ADE0E07C44AF2F1 BTP4O
343,033,711 *224C7968C744C23BA59D72652AC5838F32956DE0 BTp68
343,033,712 *224473686AE08741D106270E8E778325E39C3D8C BtPB&
343,033,713 *22419920A8C7602B1F6C0A2D6E731D974476D557 BtpC(
343,033,714 *224323A6BEFF999057B7D4B877A3985C2D935377 BTPcn
343,033,715 *22450D7112714E7D609EA9BCA6FDC00BF1C0D71D BtPdA
343,033,716 *224E50863A50EAC0628D4BE74AEC51B3434B75B4 BTP&u
343,033,717 *22465FCF8AFF5A838C20C1FD5178D62B780E472D B%+tq
343,033,718 *22490CDAD6D728A2608AD93743B50D28DA66134B Btq4m
343,033,719 *224F9F5F52DEE0D5B24A5D949EAC60E53ECFA964 BtqA-
343,033,720 *224458E08B85C030A86143C9A3819AAE77FBCC9C Btq"b
343,033,721 *224C4FC25D402107346268F20D2AEDEBDF72A4E1 BtqF?
343,033,722 *224EDA685FB6F479919BC79F86388E2CE7318E50 BTQO8
343,033,723 *22499B7BF5B865C54B9D7A277CBE5B607936B9DC BTqR8
343,033,724 *2245C92E6F369C853E9B88BC188528E35E6ED3BD BTqUP
343,033,725 *224FFF6074E2657CF456F6F1DE7FBFE4CF020007 B?Tr"
343,033,726 *224A203F3A66E97B942FBE56207B943D1B9EA6ED Bt),r
343,033,727 *22470C2124B7CFB73FA2BFDB40339F4C0D34551E B&tR7
343,033,728 *22493A087206BDFC14A588294CE347F42EBEAA99 Btr+F
343,033,729 *2246DF2C5D6CAB5C28A6585319DC209C194BE89D [email protected]
343,033,730 *224927C0D786A306C14BCD6131D3AC9BB20B05B6 Btrg7
343,033,731 *224BDED0F1C69F54E29678022218C496745A3824 BTrHM
343,033,732 *224C819B03D55F466F2E3DF17627F6E55037F495 Btricia9
343,033,733 *224DF6ABA44B6C8B4C4AF1A4911DAE965D58896D btrklrsl6
343,033,734 *224B28F4C17D94B0BB2EE500CA34E26DDE21C1D6 BT
343,033,735 *224B14E818F5D8180BDD2EEC6BA15B2A4BC16885 BT)RO
343,033,736 *224A54B9F1CD478E268963C3FA89E21309DACC2E BtrpH
343,033,737 *224EDE887C911E06C20ED706622C171B6E818424 BTr"T
343,033,738 *224044AD77A81023A654723974202D597024A98F btruckcampersusa.com
343,033,739 *22402891059452B2559C181F2236EEDB8142D140 b}}try{d=new
343,033,740 *2247CB9FC82C49BC67F00619F7C69DF798F09550 B$TS&
343,033,741 *224957C18F0252ACAAADA1E2A3D1547B4DAE3AFC BT&S+
343,033,742 *224AAE8950D0576DE81DD96B490E78F6BEBAD410 B$T.s
343,033,743 *22477E4FFC4607520969DC96419552B046CBBD7D BtS/;
343,033,744 *224AC01FC7ED4F6205A438AC2686B296640EB041 B&TS3
343,033,745 *224769FDED5AF8FC35D2B2B3FD2E6D3A22A34910 BtSb%
343,033,746 *224F8A20A366904D80C7605FFDA575ED4A587E61 BTsHB
343,033,747 *224360F07C1DC2C3D06941249A280FE570D48D4D BTS?K
343,033,748 *2244D3A52910A98674D8504102F16116A13F44DE B%tsL
343,033,749 *224564B2BAF3E7B869777E6475CAC14A9E27F956 B(tSM
343,033,750 *224BD3CD6EB1689F0160FB8F0AD5C542069AEAEE btsmark
343,033,751 *2247BA4EC3C58BE71E92B8E05BCB92839A68C46B BTS&n
343,033,752 *2249B4FF009DD8685FFD713F19B2EF0E94C9C361 BtsNm
343,033,753 *224E76148E30637B0D21196B6021D33DC7A8F911 BtsPj
343,033,754 *22441469213F6512C674B614EF6262445C0E9EF5 BtSPs
343,033,755 *2245149BAFCD51124FE8B4AF305CFAC1DA61446E btsrdrsing
343,033,756 *224AEEB1C29A7F39F2934FA7748D8C02362BB6CF BtSXc
343,033,757 *2242EA3FFB0E5913A481E6461212BF2EBEA120FC B/t+t
343,033,758 *224A815D91F5FE555A2EB53C8FF3F9E43C9A7230 [email protected]$hip
343,033,759 *224C9C63CC2082EA40F37D9B1234008D84699CF8 Btt7;
343,033,760 *224E7A8C120A9D0AE4B2077D08A11A4EDFA399D1 BtT8s
343,033,761 *22462C4095CEAE1BD50A59B7A271F007F28A8D09 BTt9toayHbE
343,033,762 *224625C47133847425149AC907001107C14B5BEC BtTcE
343,033,763 *2248BCD450984F7151798967F68426F5EB4CDF16 BTTF$
343,033,764 *224B180FFF2EA25037B2D42403114A2A8AE6C53D BttG"
343,033,765 *2249CEB76A6D9DAF70A07CC8F16DB0E1C20129B7 BttGu
343,033,766 *22461F37FBF7B4276E17789D827FC5072786F8F0 BtTGv
343,033,767 *2241A5701D082ACCE4C55ED1B9FBCB65185CA644 BTTI6
343,033,768 *22475936D07024DC1FBC1167F78DA8F419FD0948 BTTk2dWE
343,033,769 *22428AA9C396878ABF4F7A8F142455BDCAAFE539 BT(tn
343,033,770 *2242F33C9059DB596427296EDE893C2066470988 Bt$tn
343,033,771 *224DEB0898996C3FEE129C064799599B5B78C82A BTtNt
343,033,772 *2242B46EBAFEAC1CA8A48384E52F2F869643F83B B$TtO
343,033,773 *224A9607540C2F8A3E7479817CE44823DE554B00 BTT?q
343,033,774 *224FE54E6A50CB58A5116E25DB54E3B7423413FE BTTsV
343,033,775 *224BD5CD9FD9BA12154E59B0F1C691451917B9A7 BttsW
343,033,776 *22432A7DC823DF9A9114FF6C0C6BDC5C1259181B B;%Tu
343,033,777 *2247C06267E7292E6158A15833D526CA936CB6EA B.t$U
343,033,778 *224516094F125E49C225404FF32C65A40EB54810 BtU1N
343,033,779 *224BC061C53B9C1A435CCFEB5719E712879EF02B BTu5.
343,033,780 *224D5EF58C8F0B4041B8A0609DF7E23DBF33DD0F BtU#a
343,033,781 *2247E00560F4D9907406D11E1127E75CFF58E4B5 BTueX
343,033,782 *224A2DCC620900AA8BDFD498C17AFE4D37B5B2CE Btuj#
343,033,783 *2245CA9A4FBBCF3EAB4E862CCCC5EEF1870F7CF3 BT,UM
343,033,784 *22492630A7515CA0138AD7F10DAEDA19977E7450 Bt_uO
343,033,785 *2246F2A4B251F89CFE6ED338683AE9B4D832505B BtUv4
343,033,786 *2248B463DD86ABDA18C1F7C276F8A6FF8368F5EC B-T(v
343,033,787 *22439432DF8D3045C25E0B8C5847424C120C6DF9 BtV_2
343,033,788 *22469C4FD59642AE036D2C0C6286B9EEE930CB03 BTv$8
343,033,789 *22404297FA657704F90FCDFC39F063172D0DE28D BTv-a
343,033,790 *2248EA523E9094C12EE0721F72BBCC948593A398 BTvbo
343,033,791 *224F4BFE3C93F94A04C0FBB6F142E43ADCDD8FDE Bt+vf
343,033,792 *22406B73E4AF3D7DABFFA8D76D970BC3E6662DA5 BtV-l
343,033,793 *224032876E5A27AD94EE6958E57F4D618191B687 BTVq;
343,033,794 *2246C15E329553EA062E59E2B54A245E3E5BC37A BT+Vt
343,033,795 *2241056961EC2A47C29929CCDB880F7CD2BD713A BTvT&
343,033,796 *22444150C98BB7C3709494E4AE09E9C7A3E17993 B&TW=
343,033,797 *224B42F2037ED51804F6BD5179914FCD34E4912F B#TW%
343,033,798 *224C973560D30656EA1046936F32BD3171DD339F BT"W:
343,033,799 *2246D823D4D1C86EC5962077F7BEFB6F6B127B0B BTW"+
343,033,800 *224C324229BABE07642EA1A81041FD726B3A8009 BTw?!
343,033,801 *224C5AEBD13E22D4E0CEAFCD9877E52A5215E982 BTWci
343,033,802 *224E8F9D56BEB2FB91852B3C98299E37370F1635 btwdolwlfrnszxuf
343,033,803 *2242686B626295FB8671BC94C8F9A1D721784D5A Bt;WG
343,033,804 *22457C4737EF2AE1F472184E96EDA221B8E29649 BTW+i
343,033,805 *224E4189F9EE2442E4627AE012FA2C7644B97C2B BtWr
343,033,806 *2241069D48760A60065CD8FFF34D4A90237A6810 BTwW$
343,033,807 *2240DF92D008E20905FBBCBE32B8674FBB9AC39F B/tXm
343,033,808 *224ECE265CB30C2D560E2EEA2C247BA2752D118A BTYEn
343,033,809 *224DA38BECD9E40E462F2870198B515891817A4E BTYh(
343,033,810 *224D783738AD0E5C820E1841205A984BDE4D54E2 BtY)i
343,033,811 *2246407C9E0B3F4B93E69052DBEF6570F3F6286B BtYIf
343,033,812 *224372D6A6DCC844F04EE85BFDD408E48BE44AA9 Btyltngging
343,033,813 *2249198F576E5CCE54503AA4E2C6266706749D4C BtYRc
343,033,814 *224AA6D042CB3AC98F93DDD78F34F835508B803A BTY-T
343,033,815 *224DC631DC533C197554BB835C2361B4EC4EEB57 BTYUK
343,033,816 *2242884A43AF9422B466492581D8D951274887F5 BTYXa
343,033,817 *2245FCC36FA36EFD4875F427E663986D38816FD8 B<TZ
343,033,818 *224D032F8A8EC3D3889BB204055885702AC0EB15 BT/Z:
343,033,819 *224D8551CD875F0B23F0687CC93245695A2C16E2 B_#tZ
343,033,820 *224395EDFED7C44BBE8931F455E8427BDC4D6F46 BTZ29
343,033,821 *22480BB0CD51B615F2FF7FB7707B7596D9CDD66F BtZEm
343,033,822 *2246A7AA0F05B5274AF88681F32E37283EFBED38 Bt;Zh
343,033,823 *224A8BD6D92695D39264B48D5B4B51DB67293E97 B,+#U
343,033,824 *224337E6CE4E07FA7BE23A573A79FB733D45922D B&U_$
343,033,825 *2240A97C201C415A58CB37D6B46919B4E16E5C9F B#++U
343,033,826 *2249920221548F6AEB342090B9CC095A29114C3D B%^U
343,033,827 *224BE423520E6077093631811EB6CAE8C5234BB4 B+U#?
343,033,828 *224FEF111C9E3F63B0768E372DD7B330B81E31E4 B,,(u
343,033,829 *224871A207C9F2DFC46D53E1BD7241B1C386D76E B,?u
343,033,830 *2245645D9C90973F75519F6BC12DEE542898B1F4 B;u$)
343,033,831 *224A329823496535B9C5A3509AFE952DFE5350AD B:__u
343,033,832 *22429D0FE408A3AA096AD0515009205DE528F2AF B.u./
343,033,833 *2245979645E879CDD0DB5444662417C50689C92E B$%%u
343,033,834 *2249BCFF1D3EC776DED24E81D021ABEA535C7284 B&/u(
343,033,835 *2240C066E6D728000CB0ED6436CA26C0DA931F61 B%=u$
343,033,836 *224F736BDFA248671B3960C4D0EF4757ACE3CB7C Bu-=;
343,033,837 *2240B69220BBF797AD27D8B89AB4B5690283ABBE Bu:-!
343,033,838 *2242730DD8E8DE6F3FAAB12485CF9141CD9747F9 Bu
343,033,839 *2242171238BFBE8058AEED0BB2BFF044A34DA561 Bu(0&
343,033,840 *2241EA3F9B2A04D16EEBBA06734F7105A837D2BD bu02220801
343,033,841 *224BD43393223DCE1DEF4231F7CA1EA3FF76B551 bu07960704
343,033,842 *2247182863E2BF737BA216836790DECE5ACFBBE4 BU0L,
343,033,843 *2249411FAF310EC3AC32A0E89B76B9CA7C360D6F Bu0MU
343,033,844 *22447951F91E1364707BE655F110821E1FACD820 BU0"O
343,033,845 *22455B97BAFD3D51DB3E680958590357819FBD63 BU0u%
343,033,846 *2240729DED0D304A4F67789D76C5274A0528C182 B?U1+
343,033,847 *224A912C80D44F0BD534E3538FA41878008F41B5 B"U/1
343,033,848 *224B0F181D16A62735EB9025D800BB14C7A4C36C bu11w33d5
343,033,849 *2245A12595FA0312717F29023807BDD298308AF0 bu16210305
343,033,850 *2245269F51441E060C1A823CBB37A9A5FAB96AC6 BU1a!
343,033,851 *224632A0058A17212B868462B8D7C7EA49980F6D BU1,b
343,033,852 *224BBC737ADA29246CDA85046AF95184792D8847 Bu1BL
343,033,853 *224E4D5CA8CF6C90DDFB954A4B1E8D643832817F BU+1I
343,033,854 *2241CFCFF9FD04C83256CD60AD81C6D5F882C298 BU1Kn
343,033,855 *2248EC9127BC7638D5433798156AE94AEFD44EFE Bu1on
343,033,856 *224207CB1160AE55905EE28DD14B66B4A68C3579 BU1Xq
343,033,857 *2245BF9C6065040FA117E6993BFA9FB3C45D59A9 B&U2(
343,033,858 *224A11664167CC80CD75AC2793A27F588C0EFD73 Bu)2
343,033,859 *224470C6EC8033D57558C223C78CC557BC7DA650 Bu28U
343,033,860 *224E9609C536EF53429C9B989C45AEC570695721 Bu2h.
343,033,861 *224215131012067073AC2DD69D6E76192E949969 Bu2nI
343,033,862 *224818923ADA783C84E52A908E3F9148B983F808 Bu2OC
343,033,863 *22495E2F0002BD77A0FC4B2089878373CDC66D31 BU47Z
343,033,864 *224D07BD36364029E6739F94F72B282436079F0D BU4d/
343,033,865 *224DA2F29DF577A51FD0159375E775B5F3C11A98 Bu4eF
343,033,866 *22491AFDC6388C677C1C4269949AEABE62E7187B BU4uR
343,033,867 *22425373B3709A91D2B2EDE03E608B71984B2D50 B;=U5
343,033,868 *22434CEB8CDEE7F52A0BDCE6E911EFD13ABEA8F8 BU5dw
343,033,869 *224B670573D6D8380544679EBF7DB95D00C1621F BU-5F
343,033,870 *224E77F51620C0671A031182B2937B1D44770E62 Bu5hm45ter5
343,033,871 *2243D5279DBBB94A720B9C3D412FB5704107E3D0 BU5SK
343,033,872 *224ECD38282C74B39433980F09C3808314F93910 Bu"5w
343,033,873 *224F03E6A834C508008303C9B90AA2ED3ED7916F BU#6!
343,033,874 *2240D4B99E8B6D5A1F93486DBA8D434D576FC9A6 Bu66k
343,033,875 *224F79E4E42AF243ED11380F5C9969C5E8D0BFDB Bu?6B
343,033,876 *2247F69D3FCC7EF79467C9B78C138D0A538DD92D BU6Hv
343,033,877 *22425EE9ED2B27C946F8386F43B8000EA2A24EB3 B)u6Q
343,033,878 *2242B267CE4FD841329E0FDD8FE3F80ADC657BD2 BU7;7
343,033,879 *224045B3B2EAE2F4A031F06D6F60591CAD838F83 Bu7F-
343,033,880 *224961FF0D6DEF6E395245E689619FE6F570383D B$U7I
343,033,881 *224C81FFC92530D5E36798C1DBED346B04E7F0B8 Bu7jY
343,033,882 *224BACC302C1B784EC508585706564EA717A2BED Bu7:t
343,033,883 *22413486303579862D08E4F2FAA46F13E603C72C B;u8"
343,033,884 *22416BB46E346D123B891F348233E61F1CC3A631 Bu:85
343,033,885 *224CD0BB3E5E336275567F46CDA67BA03486C0CE [email protected]
343,033,886 *22424763D09E141D0648AE9932EAF86DCCDBFC23 BU8eW
343,033,887 *2247A758C0882FB9F320A92412D63034E119E846 BU8P.
343,033,888 *2247F27EB76C88A11CCBE923F969C0E031A93953 BU8#T
343,033,889 *22488078F6C5491EBC8CA274FCF0B45A91A20B26 Bu8-V
343,033,890 *224632452858DFDE1FE5B3462D2B9ED926392AD0 BU9%0
343,033,891 *22409125902DBDA6E1DAB0740D8CB489F8976C16 Bu97d
343,033,892 *22403EF1BA202E0851E05062EA2185196AA353D4 Bu9ie
343,033,893 *224E74FFBE9FF13C91B59B2A935EF786BD1D6EF4 B.U9j
343,033,894 *22473569309C84B9988D3C75CB4244E656C1DFF8 BU9kF
343,033,895 *224A38ED83CB1753D132EE8FE748C3A309446184 BU9r+
343,033,896 *22447A8EEA671444D91638A4BB38A90F815F4C60 Bu:9R
343,033,897 *22456301E7BDF9A10D2B7E503658760EA89579FA Bu,:A
343,033,898 *22407124A99E1ECFB720EFC549D23DE1A698D793 BuA#.
343,033,899 *2247F92C9DF47BE7B5FCC33321BEC0510F54DB63 Bùa
343,033,900 *224CF950116EEB2FECB6EF865AF3EBD8B7F40623 BUA4N
343,033,901 *2247AD6D69F24AAF90FC424A7599E12ABFA981B2 BUa:5
343,033,902 *22412CE927F99EDA4C4632759BDBC171B2F89B89 BUa9S
343,033,903 *224B2AA804D56079E65E16F639709BC2B0F63F1E B&uAa
343,033,904 *2241D1E8CC8F198C11D3A558ADA21A05527BC775 BuAAG
343,033,905 *224E33919D0DB9BAE8061FC5D6EB24E040AA973F BUABA28575
343,033,906 *2240A574CB6FA4D765E238926637C04068269CB8 BuACH
343,033,907 *224D913A38AF50481030AFF996C0699499C3D90A BU;aH
343,033,908 *224AE3E62AC0D3EBBB1BE693408F51BE9C3603B2 Buah_
343,033,909 *224B11C2EAF587788787BD2851053AB181A0D394 BuAsf
343,033,910 *2241BCF141A0D807539AE682F3A69E4CD5A47D41 buaya2
343,033,911 *224FD9430179C6D9F5010EEA2F7679ABE0ACEB97 BU/B%
343,033,912 *224C885A96682A2EF9EDCDA03BEFCEBCDAB26036 BU.B#
343,033,913 *2240E92A05AFC497CC66CFB79E70DF58F289C1B7 BU(b=
343,033,914 *22489919CFE989BB158B65B7D7B20618F4FAA323 BUb54
343,033,915 *2249A4A607C8DB9DE3D4124D9EE63EDD68203A20 [email protected]
343,033,916 *224D5F939D76728BDE30EAAEF0A7389FD528D2DD BuB#b
343,033,917 *224E16D6484D87E5657174D44966A079BDC9B2B8 Bubba1gateway
343,033,918 *2243F9224D46493EC70259856273634618DD5F4B BUBBA1STINKY
343,033,919 *2247E1950A3FE2B87751E37EE5B2F033B1C3E79C bubba leggett
343,033,920 *2248B03D13F379FCF326FF2DD7F1A4AA82FCD623 bubbapmc3
343,033,921 *224814754278243A948CADFB9F9AF33015D2E70C bubbawayn
343,033,922 *224C6E033B4545E0EB9996728FED20A179D8BB7B BUBBLE37
343,033,923 *2241D891713B1EE452A41818DA3471375BCAA973 BUBBLEGUM24
343,033,924 *2245472915BBB360284D583E91668D6E01DE419B bubblegumdancer.comwww
343,033,925 *2244BAED1EAF4C21A94BFB67A590D62D35AF21ED [email protected]
343,033,926 *224D57C371DECD3154E3232EDF1FFFF7E9CF7F14 bubbleslegrand
343,033,927 *224E6FC729C0999BD566E6629085397F34A5EEB1 BUBBLETEASE
343,033,928 *22499633EDF47154B07268A205C26BFEE94301A9 Bubblier5
343,033,929 *2247C2C58674047733CF3DF5E508DF4D6ABA0019 Bub.c
343,033,930 *2246327BAF82C3ED905750C716D94E6698600367 B:UBi
343,033,931 *224B9562E4A2E3CAE69204B30D0C454496E40881 Bubibsw4
343,033,932 *22446281D2F1159F2680F76A626A6B7D3C437370 BUB_l
343,033,933 *224587E6C92EAEBE07CB346521D57C7D51FA2397 BUbl+
343,033,934 *224617C3FF5A4846D5EC17323830B58674DD0169 BUB=M
343,033,935 *2247FD46B4F4A5D2C73A91D377E8308098AA643A BUBN4
343,033,936 *224512EB399E8C0B8B8639DB07410E9303A2A04E BU&bo
343,033,937 *2249F5DB932B0AB1BADC3718411E7551C6DB35D3 BUbSN
343,033,938 *224043915708B57229E74F10E280B03CDA11C5D3 BU-bu
343,033,939 *2243290A6CADBB034964484AAA121B72FB094CB1 [email protected]
343,033,940 *22410710B213907EEFA9FB60D3A71D15A8107726 bubuniré
343,033,941 *224FEF623873E499F6DB332D558DDF22A53AF478 Bubunya
343,033,942 *2243797679DFC5ACF4807153EEC1B342E5E942B1 BUbWM
343,033,943 *2246E8D6F454F7690144005A87B779260B262F27 BUbYe
343,033,944 *2249CF0269E3117C5E9840E7ED6681373741B67B B?u!C
343,033,945 *22488F421F27140CBC1F9094452CA373181238D4 B$u-C
343,033,946 *22431CE33ABD354F2E31F91A87AFC96E6AAF1A91 Buc01ic$
343,033,947 *22414020E28B6773D92861EA3C0BF40B848D5B4E BUC62
343,033,948 *22476075D1CFE16BA5E32B8E8B01DD4C9C922640 BuC72
343,033,949 *224CFAFB2907C7E89F60256CE7B1DE870B33A120 BuCaW
343,033,950 *2249BF33DE37A33608C5C009ABBD07CF757DE2F2 BU/Cb
343,033,951 *22441CF69580436B7CCB5CDDD7449383B222F159 B%uCB
343,033,952 *2242E42DF7E6D3C1945E7036926FB89D9AAE0411 BUCCABURY
343,033,953 *224935FD6CBE092C8E12F107FA6C81D6EF694AF4 buccanned!
343,033,954 *2245FCBBD79FBFF7605889A4DE39FC3BED6E545E bucchbusta
343,033,955 *2247BD39F7D2A1FD989220E3A3BD4781682935F5 buccinaed
343,033,956 *2248428656DA65571C9126163B93761DC26D0DAD BUCCR
343,033,957 *2244E48AC36DFAA7E3D74E3C0552426ED7BA0564 Buc_d
343,033,958 *22432D153BEDA7CD2C65C8148FC7D8EA919A5FEC B/ucE
343,033,959 *2249590E44E31F988D7794C3996D3C47A46B2106 [email protected]
343,033,960 *2244149071361B9720369AA523354BDF07A7B699 Buchan8
343,033,961 *224C752BB419138E2C6B0072E80203E08E6FA009 [email protected]
343,033,962 *224F248D20FA71236B3D67FAC304679AE4D9CCC5 Bücherfestival
343,033,963 *224BB492C913A64F7476596BBDD213BD01DA3BD7 BUCHHAEN
343,033,964 *224CB1C433ECF367AA10796DE8BA5CA724FBA21A buchhuel1
343,033,965 *224EC2260F20959DEF2F29BB8490CA27EE646A5B Buchsenkontakthalter4
343,033,966 *2240C09854C6700E47F8F06D97F70FEE44B4553A buchstabierwettbewerbs
343,033,967 *2244DF3BADA6E319140075D20A1FF27433F8991C Buchungsportal
343,033,968 *224471415A6D213D9428FF0DDC9D998FC1BC79CF „Buchwald“
343,033,969 *224066394C1352C4BA43F7000065E8E472CFE663 buck.abernethy
343,033,970 *224F2088EFE021CE66AF808F1BA7F2969B21C433 buck.abrahams
343,033,971 *2241C5CFDDCE196294FC126905D2916295473FE7 buck.auge
343,033,972 *224BD3111822D7BE9BF04AAD79D93BD86DB28C57 Buckbeer3
343,033,973 *224AC0F34778A7239A4B2228983CFB37ABDE347E buck.bernabei
343,033,974 *22478310BA6A941AC8D594A497C2ED5F7B89B0A6 Buckcandy4
343,033,975 *2249EF9950FC642EDC5180ED29BE9C8F2B640FEC Buckconnect
343,033,976 *2247D5A9F09ED2ED53FE315969B03F0D8A787C05 buck.delmedico
343,033,977 *224F52E8A5C271D2739ED893D84B74E45E209447 buck.depinho
343,033,978 *2245EDF8B5449E39BCC0F76BADC4CE7B8D589397 buck.dillaman
343,033,979 *224624894E01616790856EFF10AA3B3B6F6653FA bucKerOO
343,033,980 *22437C4C9F78AEA5EEA1435E29721B76F1F75CB4 BUCKEYEN
343,033,981 *224295E4F7DFA84EF54FB9E6B9A39474BF71243B buck.hackmeyer
343,033,982 *224D91F26A5ADB23082CEDA3660651D5F468ABBF buck.hohenstein
343,033,983 *224897DC9D4AF0FE05503810982349EEF2DAAD3D buck.hower
343,033,984 *2243CE57A148C3B3397DC0811FFF1C1B49EB12DD BUCKI43
343,033,985 *22400F8C568757C635719EF69AD187045F0B6C6D Buckimpala
343,033,986 *224B0F0A31639FE082A6B3B3B5296A12C657E551 BUCKINGHAMSHIRE'S
343,033,987 *224AC4917CEA8827B706FEEE2DCFD7409A4BE27E BUCKKILLER
343,033,988 *224B086FAF33A37CF1037CD7E047CFC0F2F34112 BUCKLER-LEAVED
343,033,989 *2242D3EF4901E86382BD4E3F4BBDE229D226B355 [email protected]
343,033,990 *2249236E9ECEB6A708757B6A2C0B6328812547A2 buck.malinchalk
343,033,991 *2241341A5F55E6F413005A95EBA61A6604323207 buck.mcnertney
343,033,992 *2244C29E460D9AAB9ED3F82C5D91D12DC22DB55D buck.pesqueira
343,033,993 *224E5DDAE0048CD31A0094D56F89C7D5A849C423 buckprof2
343,033,994 *22493AEB019DB7E7F9162C408BEF88DFFDEF238A buck.reedy
343,033,995 *224CFCCC522417A3F9AECC8F5F79A706F6A85874 bucksee7
343,033,996 *22449824C74B0A28384090C7DF0C99123579A324 buck.stockburger
343,033,997 *224B5924FFDEEA04ECF20BA8741C7B7855B24B7A buck.strei
343,033,998 *22434D4B1671F5574C272397B29E12BC838CAF12 [email protected]
343,033,999 *2248C515B3610C2968E811F13EDD09268FCB2E7A Bucktown9
343,034,000 *224027B5DF4E98516385B139A54259639BCA3FA4 buck.vandersloot
343,034,001 *224A9204003C59423562C72ADFA63A0BF5D7DE94 [email protected]
343,034,002 *224BD3190828A734F7E2C1E65E699BD45B705678 buckwesson
343,034,003 *22482E827A4FB124DEB69F7789CDE6A3F29285C8 [email protected]
343,034,004 *22413DD7AEBB5366FF1C7CC464CBA031CD534F0C [email protected]
343,034,005 *2249513E2292D3100C475568D5B5732D79AD2E43 BUCKY-COVINGTON-GOTTA-BE-SOMEBODY
343,034,006 *2241CC3477D7FBC634DBE3D27E34646EB489ED05 BuClf
343,034,007 *22481FB693C8F48A959BD13B09B23E7303854872 BUC$P
343,034,008 *224966C3C399E072A468AF5A2925113C8FE474A3 BUC;p
343,034,009 *224C3C30591AA929A923A4AEB754900CB3D28EB6 bucrniaed
343,034,010 *224A7A9F5B7B0602D35AFEA7604C47F7F5EB0737 BUCsY
343,034,011 *2245C0FFB1E0DAFBDC5C60D5C9CB1AD7CFBBBD5B BucuG
343,034,012 *22440A91BFADA435BAF6B3B179C8A40305C2C653 bucur bogdan
343,034,013 *224301DEDA84E186CA31C95A972F2036947888A5 BuCYR
343,034,014 *224D23F05740BB6E2E541F719B649FAC1F82A31E BUD121CLAM725
343,034,015 *2245CC66DF3883662FF35486CB0FB376E2CA9B3C bud9er!9ar
343,034,016 *2242ACFBAA7713210F504C5703BD5C53E2C3CDBF BuDA-
343,034,017 *224B068A04AB02B0F37AA0B20B56B6554DD92340 budapest-gyr-vienna-
343,034,018 *224E65500E8079E03A79E3323FAB64E882868270 bud.beamesderfer
343,034,019 *22413895C0C5E5E62CB4A11BD074F65D326C1F3D bud.briden
343,034,020 *22409876F80BD0DF1EEA73168DBC139010AED0EB budburst.ucar.edubudburst
343,034,021 *224F64179D3C968B7BC101169909840777775D9F bud.casarz
343,034,022 *224CBC04D8EB86EE19DE19240A40D64692B02054 bud.creese
343,034,023 *2246729336B71193EB948D9E84F20642C962CD57 Buddha1901
343,034,024 *2246E3B04FAF81DA299A09B04CB155117DDFBA2E BUDDHAAMOUR
343,034,025 *224022B270DF049F4CF54EBDBE14C2C897A82B4E Buddha's Delight
343,034,026 *224B6B93D2C97425E415F1C29CE83C204B6B77D7 Buddhism’s
343,034,027 *224DD64A89703128A718CBFB0051DA73CA2335EB Buddhite1
343,034,028 *22450822D4048AA6AAE22DF9AFF2D2DEB7530E87 buddleia?
343,034,029 *22410A96FF79DCFAFF195654A74F54816FC9377E buddy007snooker
343,034,030 *22446836691D5F3E0F7080D8E608FFBEC40A040F buddy.arjona
343,034,031 *224E5FCF61E761C4DB20430904E051D62F1431B8 buddy.auzenne
343,034,032 *22440F4E5FE5F27871D4F52035F88FC607650B7C buddy.calbert
343,034,033 *22473D47B46FB36BDCD1ECFAA1971B0B68CB2B06 buddy.chaves
343,034,034 *22414CBE8A8E442212AAAEBD3C8AB18080786AB9 buddy.cipolla
343,034,035 *224CA76411F7205DEA7F3098A13DA26B45FDBB4E buddy.cooch
343,034,036 *2248FE9538665BCC169193F911BD6FD560D93EE3 buddycummings
343,034,037 *224E2927AE299CFD1F02F41C1920F69E4BBB241C buddy.derousse
343,034,038 *2246AEC0795E855FE3A553610AD7DF18061580C4 buddy.devera
343,034,039 *2249237ECD55117757901705D2279709177EED82 buddy.disbro
343,034,040 *2242995A381F3E7A0696773EE679E50426151CAC buddy.esterling
343,034,041 *22459D24BF1539746B2D1B76DF10C550862FFEA0 Buddygalileo
343,034,042 *2249824E8E1C19BD47AE96555F8C6F8E7BF5408C buddy.giacone
343,034,043 *224BE2FA3D309670E1CFA64467DE7F1CED8F204C buddyhutcheson
343,034,044 *22436C9DB1C9BFB88323F5BDDE049296C16F1A03 buddy.igtanloc
343,034,045 *224478E0475EB3E6984F2DBDD5CA7805A470B63B buddy.jarquin
343,034,046 *224D59BAC97B220E65896ACFB70BD0FD13A4D37A buddy.kashani
343,034,047 *224B44F74DFCEA4A12A723CABF67AD5006CD13B8 buddy.landry
343,034,048 *22449F93CA74A4187383383046AD9979D5BDAE99 buddy.macall
343,034,049 *22476F766F9006016AD64BB9339A6FD8B4BE9E2B buddy.maglori
343,034,050 *2247BDBD583F95402422319572F8375B9AED23AC buddy.mcquistion
343,034,051 *22433BCFFE56D430164B2597DFA7A61962E39893 buddy.mcvea
343,034,052 *224A96F75AFA033DBA753D110934D601DE7E2E96 buddyoaks
343,034,053 *224A3651E96F7F2E050886DB92B17698E319E007 buddy.peeters
343,034,054 *224FB67DF8E152198B0F6860F92787D4EC2265A1 buddy.puorto
343,034,055 *224CAAECF48C83AF08F9ED64D736121DA2789A51 buddy.scammahorn
343,034,056 *224ADF59B8A3816EA9739F2CB12545BE35B1BD75 buddy.scarlata
343,034,057 *2241BDDDEAF7037B3470D352B4F3E6D92D698073 buddy.snowder
343,034,058 *224B8EC1D130F2C8DE950965CBD33E58A86125DB buddy.szalankiewicz
343,034,059 *224E041BAC3358D2BE10A2633A9C94C69699812C buddy.wemmer
343,034,060 *22497A80270F391BFCC1D2C829901655778F4BA1 bud.emley
343,034,061 *2244314F3E32271BF7DD1BD85C071F449542C722 Budem tu s vami
343,034,062 *224AB47135DFA2137B9A9E0858282D3E44A0E950 Buderatz
343,034,063 *224213E8275EA2604E45357A6821E82E26EA5154 Budescu5
343,034,064 *224D462499F567A947E47B0EB2C078B0CE632D59 bud.filan
343,034,065 *224D617A7862954A2C1C7A8AB43371F295DD1A84 bud.fouche
343,034,066 *224FA2B97BB25DE1E191D56F5AEEFA6A688B3B44 bud.frison
343,034,067 *2244BA57FB3708EC4014FB7947DBD7FF3218C81E budgetisa123
343,034,068 *224966294816A95F9ADFC45C1A7AC5BBABEC4EB2 BUDGI3
343,034,069 *224A1C0C670B4E736616103D5B13E5BA47225DC1 bud.glebocki
343,034,070 *22464CEAFB272CDB436616AE37BE7D672DC5634F bud.gord
343,034,071 *22480A03B6DD55C3BADA43255A8583488D4104BB BU-dI
343,034,072 *2244C9D6E3F810A162F212E178C320722DCF875E [email protected]
343,034,073 *2247E9DEBCFE93B56629B9CCAF40EAF7C9C189FF [email protected]
343,034,074 *224362C583AAA8B526A861C0D78D4406DE085966 Budimsku6
343,034,075 *22481F0590BC8A05003953938DC75041AB43C03E Budinska8
343,034,076 *22479CF04BC4578D5B505417EA150A2AEA2D9C07 BUDIONAS
343,034,077 *22407E2C10294F20672DDECF318F7B4B1D5E1BF4 budis1
343,034,078 *2246D38589E02BF684C2B249AAECF49B6450B79D Budislav
343,034,079 *22409C2DEB3A5324ED6C90A86873C74668AE2C54 bud.karbowski
343,034,080 *2243F0E762AC92F2D3E3A4D468EF0DA0E519126B bud.koval
343,034,081 *22477FC131A21A7F88F4795510F86050BAD5FFCB bud.koy
343,034,082 *224D6347B5D3610DB1A33963FA5CF39604DD524A bud.kuzemchak
343,034,083 *224AE08E6808C30D8F961995C2123C1F1FC0091E bud.labean
343,034,084 *224A899A27D5D8D7695C9088D6C35B4CDC2F46E0 bud.laymon
343,034,085 *22499127E26BBC18D1E5DE62726451B5126BB6F8 budlife5
343,034,086 *224FC8313FB77283D4F0AE9143CBCEC5058BF98B BUD
343,034,087 *2241E1455C0F5FAD20B56F12B13B0D5CE9267C0D budman201
343,034,088 *224180567FEB1E697B56367268BD3A4C1CF32C04 bud.massarelli
343,034,089 *22491D703350EE776932C6686390C6E916A97695 bud.mcdavis
343,034,090 *2247A72B9DC204A6BE1CC4A6308A418D90027571 bud.nitzkowski
343,034,091 *224C0EC28410BBE0AD8E0FFB633158EABBEB2FE5 BU?do
343,034,092 *224FA140A4DDB1B1A2CABB22FC53F298B63B427A BUDOKI
343,034,093 *224726D3B6200AD67E55093047B60BD804965210 Budovam8
343,034,094 *2244259BDB4CE471CFD183748C2F3D143ECDCDA6 budovan7
343,034,095 *22431965889CF40D36AB214C02E027B0BB1DC7FD bud.passini
343,034,096 *2249DCD1F8D92E0AB8661FCCC883B33D73428844 bud.pinick
343,034,097 *22433DDFC998681173E7F9FBA8B9DA92E05D3EBC bud.potocnik
343,034,098 *224648EFDCFF9915AC744C6B6F86E53F65C31624 Budprosessen
343,034,099 *2242722B155EA63FA195B716DB4659CBDFCC6EA7 bud.purfeerst
343,034,100 *2242132D7404B326ACB99E0F90BE94ACF68A0939 bud.quear
343,034,101 *22454A208CDC97DD05861AB4C4F737600EA1EF0A bud.ronn
343,034,102 *224F960E6AB18C546905B880DF7221CF11102E25 budros4
343,034,103 *224D9106733347C1A0FF52D7CF87BE945E51FE34 bud.sabb
343,034,104 *2249D77D36A5DFB29891FC8B261F9B9AE93DF25D budsbabesnet123
343,034,105 *224F1BBAFA091507896CE934F2635EC578BA5E41 bud.short
343,034,106 *2246FE9D7A0EF5E57FF2CF3A7A7F564B97CEABF5 BUDSJETT}RET
343,034,107 *2244196A3A00B631984CE995D9C5EF0232212B61 bud.tabb
343,034,108 *2248F5A0DF0405CD65D21F20322252634DF30F46 BuDTq
343,034,109 *224A3503111F929ECE61ABFDF44BB158E33514E2 bud.twito
343,034,110 *2247B293C80287155A2238A2254537E06EE927F4 Bu
343,034,111 *224D8163F65EAB268F55AEF60A2A8EAA395FA639 Buduqluların
343,034,112 *2246921542CEBFDF1A87F74E51AA6938FB10340A budverst3
343,034,113 *2243C7DBA98918AC236A5FF023048911354F6205 bud.wethington
343,034,114 *224A2AA1C3A0614EDCEE691479BE2C2488EF67DD bud.wolford
343,034,115 *2244584BDF6A7BB8FDA7B980A5A3D68F9FCF0A1C BuDXZ
343,034,116 *2249F77F227581EFC68B5B6B01C258BA07980E62 B?UDZ
343,034,117 *22433EFA1E5EA689C461DD0ED873AAA7CB6DDDCF BUE&;
343,034,118 *2249308043894251C99DE18D77218F08D1B91D02 BU,e=
343,034,119 *2248AEABFF032E10A10943663FED1CAE901AFD93 BU;:e
343,034,120 *224D861BBAA89CD1AD3C540F5522B7D03807955E BuE;_
343,034,121 *224B4DC83621ABC870F83C9C3FFC57E99C0FD635 BUe#4
343,034,122 *22498E9CF87E472C883BD5DF2445ED345FC73626 BueA2
343,034,123 *2243388BE094E62A9AAFA056AAE6089CBBBFA522 buecheler12
343,034,124 *22419A83399D5797EB338C3EFD0EC527E446323F Buecherf9
343,034,125 *2240074C4B5049B4F8CEC0BA13353A5687A130E1 BuEf#
343,034,126 *22432A47A28A2574FCD94A92C8045ABF1F321D10 B:UEI
343,034,127 *2240BC5872555A5E6A9D885A0547561093E6A327 buekii3
343,034,128 *22494B28D34D781FE57EA5B5D064877ADBB18B2A BuEL4
343,034,129 *224F2CB0DDDFD891C397E81C2B4B13E7EFA7C879 BUELLANDBRAGG
343,034,130 *2248C34E4C50B2810C7274B2BEC5CA4C94F2CA9E buelleugne
343,034,131 *22420496A650E8D67681AEC414EF88A899129849 Buenavises
343,034,132 *22438F1EE8AE7AB5E7C3D40B8BA04945340B2808 BuEO.
343,034,133 *224A02FE3AB82513F0CA8BF4D69EAE4E54FDB69B bueroched
343,034,134 *2248E416947FE9DE2419C3AFC39CB29195E99C93 buerx900
343,034,135 *22475C1E6B40C772531C76DEFB143BC5E228A207 BUESSELMANN
343,034,136 *224B1924693C51BC1996D6B340B0B6067851ACE9 buessteT
343,034,137 *2244D9E241481597E9375B279600CAB42B54644E buetreil
343,034,138 *2244AC2209C443B426D2B118C66D0FA42AC2FACA BuevL
343,034,139 *224AA06A629D0D4984E4858A7F5BBD8CB90805D5 B/!UF
343,034,140 *2248AB171E54290A181D03F54134C367D1C24FC1 B)U
343,034,141 *224220F26C25B1ABE73D99CD634E0ECCB1DC9EEF BU&:f
343,034,142 *22440A2B43EAD5D97698B0F6F23413E6376EEA7E B.uf4
343,034,143 *224C1A4621BF1B2B16C055ECC62A8815DCF7FCC1 B$UF6
343,034,144 *2243871BD829E1542DCDD3C023F605EE8833B083 BUFAW
343,034,145 *2243BAA182F1D37FD7E7AB9EC46208D8C9836FED BuF-f
343,034,146 *22410C6A5CC7A9EF867BC4BFA8CC255C6324D1FB Buffalo62
343,034,147 *2241A2E2868513BE033592AA626A54A323E38431 BUFFALOPASCAL
343,034,148 *224EF4C69D50C5C6C5D7D9A90756E77B127B3A2A buffetautetal1996
343,034,149 *22446D219068EBD79E575E736C0C2E06C26F8953 Buffetn0
343,034,150 *224CDFB09AF1C6E2E4189A9AC4BB14B45E02D15B [email protected]
343,034,151 *22486475EC01D3BBBEFC0EE106CCE3B83044880F buffking
343,034,152 *224CE6DAE40AC34B1D63BD0877D11892AF0A0C0B BUFFOONERIES0
343,034,153 *2241D64913A26326FD17C3A228CEEA1A010ECC53 BUFF-WHEEL
343,034,154 *22484D8D7E9D0C37C5D5947ED72BA30EE73E1BDD BUFFYAMENDS
343,034,155 *224C7B8B50140116BBE0A0F60DC2CE36DF4555DF BUFFYBABE
343,034,156 *22449A8DBFDBDF0019BF5DE270DC5FADA1F524AF buffykim3
343,034,157 *22428AB63DD2566A3597A2657897457FC36402DB Buffythunder
343,034,158 *2242BEE8EE3D62D730DAD7AE8780610C4319C333 Bu/fK
343,034,159 *22421F72FE1696C75DE1F3967A98CC515F20B969 buflimit6
343,034,160 *224645455FCD5EBFD0A818A27F5A153444AB48DB BUFn=
343,034,161 *22495B0597CD3A8900F80BBFAC74784C9B0A5472 buford.barkenhagen
343,034,162 *224F2DD8E780B0B0FCC5FC7060716072A0312FCD buford.blankley
343,034,163 *2241BAF1D501F613E4514D8FB2010FC8D95BA769 buford.brigmond
343,034,164 *224F515D5C35C8A4B64A24C2482B3EAABDDD877A buford.colgan
343,034,165 *224CC4CFEEABA786D71F87DA78775650D811E8DC buford.eads
343,034,166 *224B69647EED7C9E7E76D61C1CC0FDC118F93230 buford.guntert
343,034,167 *2240C707B05C1DE9C4ABE0893226C949FC92DF5B buford.hediger
343,034,168 *2245C81AA1DE6FB1609A3920CB8EBDE23F810BD8 buford.heybrock
343,034,169 *22428A31B4D82862CB6DD4A2B6391F21A822D1C7 buford.kabrick
343,034,170 *22428A34CD317F8635035AB4FE4BF3D14FF33B55 buford.kleven
343,034,171 *22433B43F2BA41B3334D4B02A65E31C2CD3FB38E buford.meggison
343,034,172 *224AF294462BFEE4FC365EDDB992D67318AB8520 buford.mullenix
343,034,173 *224ABA4AE1C91139341C58DE8F53C8F67952A8EB buford.muskthel
343,034,174 *224CC2BFD31CF63B9CFCF6C37E5DBC1EA271EBD9 buford.namey
343,034,175 *2248714AFC1FC5D7134EA9D12C52D3707D14F1DC buford.nuara
343,034,176 *2241571E97F135DF20EF4E3BE4226CC145E53186 buford.pekar
343,034,177 *224A834107B515B7612DF5D1C45092B81746F0B0 buford.picou
343,034,178 *224185643AC5FEBF4E3AB63504D67508C3A54B0E buford.recuparo
343,034,179 *22487D7167FD2926634DB68D8721715A13D950BB buford.sensenbach
343,034,180 *2246586FF13DB3B5EA9C0DA995F8D614D12848C1 buford.shiro
343,034,181 *22415D1F5BAC2077147E0D07876D48DA3DBE84B1 buford.shorkey
343,034,182 *224C1AC8D8EA2775C3E5535F220A434C399A7091 buford.sibrian
343,034,183 *224436DA1317B8EB3184B188BADEE93C5F39B513 buford.sladick
343,034,184 *2241775E8EF4FB4E8E67E2F4A8C8E1C22D2C965F buford.spachtholz
343,034,185 *2247E57AD4B457CEF6A97814AB9265556BD1A765 buford stephens
343,034,186 *224A6E0DAC697C1C28AF6D845ECEDD7B4F5A90CC buforjo
343,034,187 *2240C247D16F12441745D7FB09B7F0604C356070 Buf$R
343,034,188 *224C98EB83DEE43B0DF7D505AD3CD4E57A0E1462 B-uFS
343,034,189 *224EABB79D1B939DAC4FC960906F832F56D6F1CC BuF=T
343,034,190 *224943CAB481BD8FC221E985264CFC82B2FA77CA BUfug
343,034,191 *224FA4B0478CAF153CA41485A1F865E73BF8105C BU-fY
343,034,192 *224170FC47230A2B3364E3CE40505907F4608627 BU-G?
343,034,193 *2247D232026E1E6B1210E9A82BE4B1DE19C1149F B)u"G
343,034,194 *224FF9B320C90F6DB8FD9F1892BD6A9D869E1C74 BUg;6
343,034,195 *224B21617CD5AA07725659CF706EBD85060AB9E6 BU+g7
343,034,196 *224BADC0A7A95FD227F9B2505362FD1BAF83C761 bug719upi31
343,034,197 *224D9320B09BAF0A2D32529359D489BB4EF80930 Bugabaes
343,034,198 *2244E40D45AB82929FB033494577EB71FF3A9C59 bugaBooS
343,034,199 *2247EEA127F242453602A4BE4DE30C30D7922110 bugarabu
343,034,200 *2245EB361330C9E593BF5C2BE15D4ECD266713A5 BuG%d
343,034,201 *224691A9E96A6DE02FF71B89BBCD94AE334DE951 [email protected]
343,034,202 *224E10C37502907081C62DE589A2163C20D2C5EF BugdomBugdom
343,034,203 *224C6791ED0C6AEEC0A2400ABABCD9A9E842BB32 bugeillio'r gwenith gwyn
343,034,204 *224714B4A0841F5792A30450C03D14F25C5F5780 BUg,G
343,034,205 *224CE273CAF5D1763DC0DAECAA25D7D17DE607CF [email protected]
343,034,206 *2244BC5084011BDB78315BC45A37F9203425A9AD [email protected]
343,034,207 *224FD6786881AA41CF42C8EEBDE38CB5EFEE8700 BugGerY
343,034,208 *2246827A0883EDC9D0FDECCEABCBA7A9F6677265 buggewoman
343,034,209 *224A000A48089A3F908475C4AFBBE047241399F4 Buggey
343,034,210 *22424E3634E131369437A8FC202D30A11504C5D0 Buggleed
343,034,211 *2243BDC71B8558255D86E471FD302C018135290A Buglose2
343,034,212 *224F99BBE8F679785083ADDE1AC4C9AB173F1AFE B"UgN
343,034,213 *2242A3D792BE413B7E12C396F3677C7807D39A77 bugnto
343,034,214 *2248723D5EA307A7B65B2613BEBB30627CEA1B69 bugnydastalk
343,034,215 *2243EE21DEBBBA72B3FEC97A3EB02C37FBB4B889 bugpipes
343,034,216 *22490E76222E3DAF8F9593A62C6E17CC36431A09 BuGRC
343,034,217 *224FBD28AEA679928E3FD192293F4B85DE1332C4 bugs tan
343,034,218 *22474B57F2CBF03CF313636751FCD8C16FB36F95 Bugtning0
343,034,219 *224E5B57974D02B02242593EEE2055A7534C7FDB BUgV=
343,034,220 *2245E5318500523F08E4398B94C2BC71FFD0F7C5 Bugvgges3
343,034,221 *224E0B74D4104EF6CF31CFA08487BE55104F4442 BU,H:
343,034,222 *2247A1FA2072BD2AB81E607F634E971CEBC29475 B|uH
343,034,223 *224AA0C5DD194B782ACF445EBE692B209701144D BUHbZ
343,034,224 *2248F558634076992ADFC19BBECB219505D6DDF6 BUhC$
343,034,225 *22497CA381855FA2E911485ED6EFDB97412E3E97 BuHCm
343,034,226 *2246FBF3F9BFD2B80AB1AFBE0CF2BAA4CCFA187A BuH&E
343,034,227 *2248808EDD9DAF0D4F1EA786E16A08DD7AED0A6E B!UHk
343,034,228 *224B7B632D5C64E010605A683ADD36D3AA2CD7EE B:UhK
343,034,229 *2248D739336DA68210CD5C8FBD203019C1BD8F54 BuhM_
343,034,230 *2240513A079B39223BF1D6C52FEAC1D29DB2C7DE Bühnenbildkonstruktion
343,034,231 *224DF609AEDF4968088EA4ECD62F5CEE7A08C2C1 bühnenklasse
343,034,232 *224826469DA85BBF710F281B49B4DCD7489689BB BUHr)
343,034,233 *224BAA4C2E6BBBB3E5551482BB4A24B019B869B8 Bu-Hs
343,034,234 *224968BB9DB03E1FB307395FF19F73440595EDFC B#uhs
343,034,235 *22423038B266DEB2AE31DAD5D2CB158D78FC684E B;UHu
343,034,236 *2249EAD8BBCE1B690975927AC8FCCC3E62372861 BU,i-
343,034,237 *22461888979EAA069E80AAFDA9A4B78A6E41E5C9 B}ui7I
343,034,238 *2242CE852C85D3346E1CF3C958A3F180468C11EC B/Uia
343,034,239 *22466B0FE05A9A74925EB034E88BBA152F808CFB Buick Makane
343,034,240 *224EFC517D303F3EB59B3789B314C4D8E25EA659 [email protected]
343,034,241 *224180D79807211E3C5F3C72277691BE7FA5C430 bui dieu huong
343,034,242 *224A5DBAB59476938AC53778811230F9B4B6758D buigsamer1234
343,034,243 *22484A7926FCD1CB2E69BCC0C5753192A839633C BUiKN
343,034,244 *224EACEFD942E3AA7D02C888ABE8FB3158E2BD6E building636
343,034,245 *22460D4DB9C9FEA1FE29FC1868FBDFC02B1EB822 buildingoregon
343,034,246 *224DCA8F176D4D7521A5C89B7521494F4BCDBE6D buildingtalkdan
343,034,247 *224F67C9D3AF2D6502517E22C1B23196957FDD89 buildingtracking
343,034,248 *224E3A0CC24C0E5841D37DFBAB224D9C29AB23AE Buildins
343,034,249 *224BAF0CEE81D2803F8039424B87530C351B9CA0 Buildupdown
343,034,250 *224A669ED08A830BB7D67B6E7923B607605F9DA8 buitengordel
343,034,251 *224A83FE19DC60780C8219BC6F4F580BED9F7C7A BuITu
343,034,252 *22458FC3A029F755911D5E33CA5DB7A5AB6BC2DF BuiY+
343,034,253 *22426AAB753FD189ACE69434ECC300853B2ECC6F B"U.j
343,034,254 *2240C2DDF9B739047E89F7AEF4919963CDC05F03 B$uj9
343,034,255 *224A0C59C88CFEDAB44187818E32361572240566 BUJAIMI
343,034,256 *2249D501A4AAC83B915C6F1A10B859023F6799B8 BUJART0909
343,034,257 *2249CFDAB8846DA4833950443C2C359A675F0D43 Bu$jk
343,034,258 *224BBF783F24ECFA75EFEC0C3FD52776E7AA0585 Buj!l
343,034,259 *224FDC05A5208665E9B01911082706EE146E0B0B Bujs#
343,034,260 *2249FA9AC54A0FFCC32C8ED9038FBDB4AE52608D Bujtf
343,034,261 *2246755AE2423A690B6393575BFA663C893B0220 «bujutsu
343,034,262 *224B5F3C1491F6D2722E09D7147836E07811C137 BUjV/
343,034,263 *224CF8691AD6056ACDE256998686DEE4DCC9855F Buk1.
343,034,264 *224AE4B95DEE22E616384EE6172CDAB34B067D90 [email protected]
343,034,265 *2243B919B114C7C3D088241EC343E00B1DE88C8D Buk)5
343,034,266 *2245522AF960266995DBF6D08C3C5E273F1D965A B-Uk6
343,034,267 *224AC50A60B32C103814F63BA046454F5112928E BUKNAY123
343,034,268 *2242AEF5ED0380DA619B2AC8BCBE27EDC4D664FB BUkNw
343,034,269 *224C5CCA482EFCC7D4D4DBBDB349CCA007691557 Bukócot
343,034,270 *22407F7B367261285E71517FA3B99DA687920C18 bukósisakkal
343,034,271 *224F578E522B5479F331A94BD5E9C0EEAFD3620E Bukrakowska
343,034,272 *224786A1EBB350001A16F18C378634979E9F75A5 BU$Ks
343,034,273 *2241DB681158D40DC5E614A700A641B248C29FA4 Buksies5
343,034,274 *224B7B5E0540690071225DF198AA5348C20645FA Bukurie3
343,034,275 *2245C864B402CD431D9C143401D8F49772C3C340 B
343,034,276 *224ABD63396F20D8757DAC9CA51B97848874D1A1 Bu+%l
343,034,277 *2249C32EEB9F20650D99F53B554A673C5368143A bul34cm4r14nd1n4m0
343,034,278 *224F1B3A65A59055D25F4FDB34014F6826E0C16C BUL3S
343,034,279 *2243EAACD29BCE0EF824FEF06BD2587CDADB09E2 B=UL8
343,034,280 *224034CDD8995F4347C9988B20B5095EDCB0E29C bulamamak
343,034,281 *22441FF098DE491AD29A60123710B368AA94277C bułano
343,034,282 *2241BF0D2D42C87E5C856AC41FA9073FA6B18072 bulaşmışsa
343,034,283 *224ACFF91DC87BC394E2324ED5B55B8D91205E3E —bulatov
343,034,284 *224AAB4C48D5B9A15736D49C2E0659C823B67DEF bulawajo
343,034,285 *224D2B1F4ACFEDAD85A15629E490A76740E3D22E bulbasaur‎
343,034,286 *224B1329EB4AC50D98A80A7A754FBD9DFDB56039 bulbasaur2
343,034,287 *22468D244B1445E8D429A90E58458899D200BF33 bulbeckgeorge
343,034,288 *224DB61065AD9A69D5906D9DEC0B51C8CAD022FC BULBOPHYLLUM8
343,034,289 *2243746CD03A5B12639AD9506C3FE3B3A7534145 [email protected]
343,034,290 *2246C475417B4BE6943BD0D6C16921F270B276AE Bulderaars2
343,034,291 *22453C0FA46EBD67F51E0AD4B3E0B44F0AC50B6D Buldogho6
343,034,292 *22480F6193C209129B434DE51086E0EAC856F4A6 BULeg
343,034,293 *2248C0F7A95B5B521D337EF1D4749644E048659B BUlEl
343,034,294 *224EC3D1F39EF4BA080FE230A15040C817F43F29 bulelwa mbali
343,034,295 *224FB53F019E84DEB6E4DEE49343DDB1DBCDCBC9 Bulently4
343,034,296 *224378BEB9CAEA87AA94CF8680F82579093BE6CF bulfinch 1 0
343,034,297 *224511CDA079A42F7AE83AB2D9877A57E0A6F7DE [email protected]
343,034,298 *224C9CC977F6706DC6AEB4942316D4B1D34E5FB0 BulgarianBirdBeholdingBeethoven'sBustPublishing
343,034,299 *224CFA5BA718B74EE783A7D9379D4EB16CE01AD3 BULGER9
343,034,300 *224498D9818CB99A15E71C237968461029DA2B0B bulgers.
343,034,301 *224B5CFF580A7EFEE2EA0EB7760C0D62CF99DF61 BULi#
343,034,302 *22407D6AA5AE9B68EC760B36B1FD02A4B9349A24 Bulionis
343,034,303 *224D0B52913D664753A5DC42EE611D8559437849 BuLKiEst
343,034,304 *224FD5C8DB51658D42595AD5BDB7EB11E2EFE1F5 bulk!n3ss
343,034,305 *22493093AEFBD2F5C0361A90F4A3CF4E9635A908 bulkviscositeit
343,034,306 *224B2E6E436A9AD26852403BE605FB8BFCFD9BFB Bull375
343,034,307 *2248988D1C57049B39799A0137DB67D359C218CA Bullahining
343,034,308 *224A15C4F90BDBAE3A754E92A36A5780AD6E1E5C bulla_island
343,034,309 *22403B1F9A716D08A6C90D960286F7FF561A6524 [email protected]
343,034,310 *2246FC38A50DE536BE73D069F58C680E34BCA3DA BULLCHAMPION
343,034,311 *224ABA3244A2460F604FA3F4B7BD1DC920BB86C6 [email protected]
343,034,312 *22438C8D5742430D4E14F174A34935023482D1A4 „Bulldozzer“
343,034,313 *224CA229436E20AFA7CD1300666BC5DABF99B6C3 Bulletmaker
343,034,314 *224BAADB7F80EDBA2CADFAAD8C395A4583171899 BULLET-POINT-LIKE
343,034,315 *2243CD5C0CB0FC230CA74A3FBE28C5D23308D767 BULLETS」のファイナル公演「TOUR
343,034,316 *22401419018DE4F2CD26B7B19A25A78E2D2BFDDD [email protected]
343,034,317 *2240E885B14A6C7AFC2E418D4D8C2A2B14C22D77 bullhornbullhorn
343,034,318 *2244997C2361A5BDCB2838C95F47DF4E61B8C69D bullimong3
343,034,319 *224C1695F63BF69E13BDCC674BB82A02B9FCD0D7 bullockia2
343,034,320 *2246007F7CB8610A117D2186B2E90956D14E1724 „Bullpup“
343,034,321 *224226930276A2CD6E319E3268D88CCA61743BD7 BULLRING-LIMA
343,034,322 *224E423A8FBAAEB564108A2D28C2571A3EEBA5B3 Bullshit1974
343,034,323 *2248EFF3B5FFE9FF13089AB80DA1FBEEDF376D6C bullshitgerman
343,034,324 *2241EF7A7B90AD49BA2A939817D0F398E798A224 BullshitRecordz
343,034,325 *224B37E4A28301F3D155B05FC862DDC971BE2229 BULLSHITSHIRLEY
343,034,326 *224847FDC8C9A31EC62F00E74D96DDC3F8758DF0 Bullssss4
343,034,327 *224D1DCB6731057010816A46399F73287C490B77 BullV
343,034,328 *22484168F392EDF4C166B4F73DFBA18E12640C48 bullvoyager
343,034,329 *2249B54C9DACFF14B4D521D6EC702BFA74713D3C bullyRaG
343,034,330 *224B67D3ED564FCA1B1F5642E35E0373F5DCA901 bulnbuln7
343,034,331 *224112CEB381E3A4DE2C7624D46A86BA73094E0C B+ulO
343,034,332 *224972F33F54B2041CBD4ABBF94AB0AA95800CE3 bulocski
343,034,333 *22420505861CC8C461BECCC99EED4A6FF45F0AF5 BulqO
343,034,334 *22437EC069300FCB1A96111EC6E016A58C0C0A68 bulrushl3
343,034,335 *224E85DDFC419A0310D2E53C4F267FD830DC705C bulucea8
343,034,336 *224D2E496ED173B31B6E8C811D0F872F106D006C [email protected]
343,034,337 *2247F8BC004B22D65F776EF236E50E7E656BAC47 [email protected]
343,034,338 *22459D09C5AAE9C1079E1B270C9A9EA4312832A0 Bulux
343,034,339 *22431A4F05E90DE9F904E1BFC64D83E8AFC4CAA8 bulverdespring
343,034,340 *22465ADAF010FDFBC0A1EE8EE4E1028A18282B00 BulwARKs
343,034,341 *224AFA84ECEA536E9D3A650C252012543E1E5AE5 [email protected]
343,034,342 *2246D8B2875CE2B5CBBC8982879DD73AF22F60F1 B-UM?
343,034,343 *224BB63A53A80F697DE787543181DA0923AA9A0B B(UM%
343,034,344 *224ECE8584EECA91BE823A00E608636357E884BB BU.m2
343,034,345 *224C878C894BDD361537606365A764A27DF61411 Bum3W
343,034,346 *2243B9BB11B6651510923A2D73321937DFE9747F BUm5/
343,034,347 *224F680C83D4AD49D5FB524CA48EE9D3C0AF36E4 Bumbescu8
343,034,348 *224CAA86AB9AE26AFCF277930FB0E9C72B2E9959 bumblebeebehindatree
343,034,349 *2241DAE5F9B8DA9BFD43996F6CB44CA34E67F880 bumblingsys
343,034,350 *22420B8476B70B78B71CB11D2081B91A028D4E29 bumby vivek
343,034,351 *22477CD5CFB610F8C22E4B82BEACB314F474667B B!umc
343,034,352 *224CED1C4DDF9D74AED329F37EE6D6ED0C3BDBC2 BU!Mf
343,034,353 *224ADB978139F446EC9CDCABFC0922683C46254D BuMg?
343,034,354 *2246AC980AEF1030B737940DB227DA13CAB2C8F7 B?umI
343,034,355 *22488B3F6106C3C85E8C3427D89730E0E7F9CDE0 Bummelei8
343,034,356 *22425F958FA2C3565F08A6FB1EF8812613E78DCC Bumpcity7
343,034,357 *2248629920D6259433F01C90CA18E4237F905327 Bumpoff!
343,034,358 *22432FA19D8DD89C13047DB2553B8B9B163D6077 bumpses6
343,034,359 *224352DB51D99CDBCF209E4EAA91176F8ED715FC bumptiou0
343,034,360 *2244ECC2FC351778A8A2165F9167936C041F24DD B=uMQ
343,034,361 *22459D28FC38A3B6533E57C30174C9074DF8495F b.u.ms
343,034,362 *22465E5D28768567BAF52D137317522064AB17C1 [email protected]
343,034,363 *2244ACF201208CA526A5E2082520402EFE90B260 BumWC
343,034,364 *2241D44599EED6966EFEE2A2D16CDCE824BF719D Bumwr
343,034,365 *2243FD72C35E4CBBE567F8729C243C0AE5F7E201 B
343,034,366 *2247119A7534A6A3594371661BC3DAFFA03582A5 Bu=(N
343,034,367 *22450D409E2075D3509D92D4CC273180CC348BDD B?un!
343,034,368 *224D7BC6AFF15ABD4BEF8B95C93DE8948147E7EE bun1n
343,034,369 *2243D645BDB287654C9BA751F43BA210C304EF62 BuN4;
343,034,370 *224C994FBEBFD7B469ABDE017C3B2660D15E30E8 bun858
343,034,371 *2247BE1895A53D3EA0D2771C9CCA9DC00A01AACC BuN9T
343,034,372 *224A7D11B002433D4A4D2A0C28B20E46B407F034 Bunalımlı
343,034,373 *2246EFA0DDAB0B7F308E266660AE1060B31E5CFD Buncanje3
343,034,374 *2241F6E81EC018C3F609638D95CB7A670BA2190D Bunchcro1
343,034,375 *224C2BAF5900B44187F14BED50B92A8E4B381FD9 BUND,
343,034,376 *224D824349D09F56F85DE5285561D560C3D33381 bundesabfallwirtschaft
343,034,377 *224317A67CA3D46478289ADDCFC362DD1526D587 Bundesnutzung“
343,034,378 *22428E07761F2A3A5004D7E7B6CB08B755E15ADB bundeswe8
343,034,379 *2242CAE6D714CB813C56BEC272A028D34AEE934B Bundnetzes
343,034,380 *224C3DB4B9DF1839CED432366D9C17641AFA6206 Bundstäbchen“
343,034,381 *22497C7A315E7FC1A9E72CC9D21FE2043536A80D bunette.tumblr.combunette
343,034,382 *2247C15A2656CBF492239BFA6DB8395512B8F9E7 Buneviched
343,034,383 *224084CA0E5B58A3248FF7901EBC44B094611F1A BuN(F
343,034,384 *2244BB9B9B9C34DFD23E2E14949C15BB2FEA8C04 BunG$
343,034,385 *224A0B73B41BBF951AFEBB98EC91C7222A25AF99 BUNGA96
343,034,386 *2244FC8CB6BD4A4BD4672017296575CE82BCE0D0 bungakuk1
343,034,387 *224EB1A19966693A271D9BDCB7D307EEA2C6616A Bungalowwijk0
343,034,388 *224B8B689552424838B072990B00F06EE3921427 Bungasrejo
343,034,389 *2249F1FC7352613CA550BF189F5ECDDC2CF8B0BB Bungfulls1
343,034,390 *224AB1CCBF16F7ED82648874264EEDE9B44F887B Bunglers
343,034,391 *2243887AC79E9EF82EE45B9FBA1B1F36661A71E4 bunkacho8
343,034,392 *224E75FFC83BCA8FE5C71FD51AA2D8FDDE7BE514 bunkerverbrauch
343,034,393 *224A92B6C70288AFA62136DDEF95EAAA00E874EB Bunk House
343,034,394 *2240622BBD64D530757C4B4C05704C145157F1C7 BUNKJR2
343,034,395 *2242A9426D353FD61D07FFE952EF8BB234FF85E4 BunkRockBitch
343,034,396 *224EDE3704A33C5DEC02414E8ABDE7D3202EC3CC bunkyoug3
343,034,397 *224B463DF72861DBF78B86DAC410674A57405160 bunnert
343,034,398 *2249A398995C26F68A45397D8A638B2E94EBC796 BUNNIV
343,034,399 *2242BDF058A594BC4E0DF8785ED2C593825FF85C Bunny&
343,034,400 *224644EAC05B2FEE75E84CE0182913FFAEE1A152 BUNNY8ME
343,034,401 *224F5E509126067E0D17AC915B4E495697339224 Bunnyjean7
343,034,402 *2244D90845B624397A882C89DDB66073781D7CA7 bunnywoo1
343,034,403 *224D252D83AF44CC3E6A5FB23810DF62AD887534 bunny(前編)」
343,034,404 *2242FD4F49B7793A23FD16A6F365FBD51FD56DB9 BU"Nr
343,034,405 *2242A9CAEEE34988736C902789DC2002193195ED bunrigh
343,034,406 *224A8DD93F75AABBFF8F777C5923E7DEBDCF326F BUNS14
343,034,407 *22433EA316F4256F92C28CFD6E00AD69CCEFFE7C Buntenbecker
343,034,408 *2244A130C9EEE5DD3AD3F5EBE20EA13C2F07E6CE Buntiesting
343,034,409 *224B8F5CED8CFB83A0AB7F3573F0A64D0854261C BUNTOVNU
343,034,410 *224C3199E099832B5C1ED840112761C959DB66C0 BUnVo
343,034,411 *2247167C95EF768483BFAA68024A3F374453B251 bunyantalkjohn
343,034,412 *224BE75E273357F9D23578E83C74AA4B8544D2A9 bunyipco
343,034,413 *224635CEBC902F1D98030BE62C095853C8882995 BunYM
343,034,414 *224A31839C73B92E1804328E027ADB86A6E0E1E0 bunyoro-kitiara
343,034,415 *224209D728EF92DCA6E00BAEF4C01EA19413B810 Bunzyoing
343,034,416 *224ADFCAD27A11461655F8C25E89623391E0C88B BUo;;
343,034,417 *224A0DC3EBF257F28E3CC18285EC1B9A4AC0D616 B<uo
343,034,418 *2245CA0C866E70F2A7001DAE8B48D7540C004B68 [email protected]
343,034,419 *224FAA53DACBB6D1FE2F067041949C6D4C779AEF [email protected]
343,034,420 *2243097BCE2FFE1FBAEB0E95AECBCA37EC70F056 BuObp
343,034,421 *22414627FED16532E3E1362771C8F8BA510C9458 BUO&C
343,034,422 *22481459A91B2359380BA276FA986BC5296B91CB BU/oe
343,034,423 *224CDA631C31F9F42EC4ACBC67A385E302DA797C BuoFv
343,034,424 *224C912825133663E44267CE6B70F6106CB0472A BUOHG
343,034,425 *224DAE6D04420800273A696E3041F829DC0AAA26 BUOmI
343,034,426 *224B0EE7CB0493DDC93D004A0C20B1C57C4B4309 Bu=oP
343,034,427 *224B716C188DA42FAF0516F5ED5C9996040B2BB6 BUOpA
343,034,428 *2247701EB74026ECC31A37BA43450407375B94AA [email protected]
343,034,429 *2246E1E566D533564193D1A9781189109FFB88E7 BUOv;
343,034,430 *224B18C0A16A6A0832C75AA9F72A583A0789DE89 B;uOV
343,034,431 *2241C538A4CBFD54A6BE48E4E14AAC30D6847042 BUOV8
343,034,432 *22423BCE21346A87F803647C9F4D6A9AABEC89FC Buo!W
343,034,433 *22450152F1BD4BA4D3C9524ED9DD3ABAD9FFCE83 Buožių̃
343,034,434 *2241A91799C4371049451106A346A4B7581ACD82 BuoZk
343,034,435 *224D39AEB3254A8803C7231F1F258ACBD06D36B7 B.;up
343,034,436 *22407417F6A808D17ED5874BF5D3E052EEEA774C B,UPA
343,034,437 *224C4E97541ACC8E3A81714571F0CBA876174168 Bupan
343,034,438 *224FAF1A4DE602F9DE10E8799457D9573514F074 BuPB
343,034,439 *224FA48CFEB5ACB7024396D0F5B1184AC610DB48 BuP+d
343,034,440 *22418BB596458C70868CDE7B29D17DAF13C7E057 bupersma
343,034,441 *22417285CD1CFA278926927A6784C502B7E12261 BUpf-
343,034,442 *224E96874CE794C62DBCA3B39659C31884865633 BuPfW
343,034,443 *224B8E2D587F3529EF42139E3BFADC96272D9901 BUPHOFF
343,034,444 *2249E73AAF171B7CA53FF405B32CF64A6D0EA11C Bu=pI
343,034,445 *22400718DDF5104D7BD68BFC367839B33731131A BU,Pm
343,034,446 *224D4851120302641D6EDF10FD0D5C15EB89B3C7 BupUW
343,034,447 *224FD08313B2C107A8DF80536EF033203E511062 BuPVk
343,034,448 *224501F7B32DFF148E7F8323D4E90DE130C5D77B Bup?W
343,034,449 *224166E31C797D84FD824A198A10884291D4EC26 BUQ00
343,034,450 *224E1C57C0AFFA5483025ABEDC4B33B32182D6B6 BUQ23
343,034,451 *224C50307F5932F7AE9626A3F5E37B6AE8CE6262 BUQ89
343,034,452 *224687ED3AD04D16FAAC1E3A2AEF1DDC3FC24BD1 B_UQd
343,034,453 *2244F91D9121CBB61574062DE2136CDF494AE2EF BUqgC
343,034,454 *224B12BEC9B707598CAB3E406C79533531C2B391 BUQRB
343,034,455 *224518D4016C1762395A8EDF2E6BA816C4232CDF Bu;qt
343,034,456 *2245A479F39080590EFD32DAEC44B8E53F1F7322 Buquoyských
343,034,457 *2245EDA010FCFE1A9B6A5AD410046C0EBF672F4E BUqW(
343,034,458 *2242D1E69E234BD56B93FF7811446AB049160878 Bu,!R
343,034,459 *22486E00FF49D01F29A0B00293B1E46E55B89361 bur0cr4t1z45t35
343,034,460 *2240AF91C380A06E31E7BBFAB4A6317530A57E94 bur1ino
343,034,461 *2241D13E4843F858C4BAA46B142027A6FC00EAA5 bur4n4
343,034,462 *224E3A02DA7F6A871A160055083A3448CEE63D89 Burattaio9
343,034,463 *2247E6D956C8D64185D00F0ECBECBB34A1BEE566 burbą
343,034,464 *224FEEA24333A07D5E31637E7AEC9B10ADB391FD Burbankian?
343,034,465 *224F9084BEEC8EA81C5B1544B7C3F6D3D71E2A70 burbidgii
343,034,466 *224F58E4CC23AE278A4601EC6D91F286D8D373DA «burdel»
343,034,467 *2245029DDAE65C1B99C2775D94A145584DAF0544 burdeltzhusen
343,034,468 *2242949571F1E0EBE4D4EC22DC7D1D6D79927C75 bURDENEr
343,034,469 *2244B96E0B6C48AFD15DDD6F736FD071094B3ABF burdeners3
343,034,470 *224351870F7E3CC176D8F83209FCB60B4063C1E8 Burdettning
343,034,471 *2247AB44646218DA5D5C55010D59EB2B73E0940C Burdichevsky1234
343,034,472 *224C40F3C4EAC53CB710F2580711636B5C589038 burdonetta
343,034,473 *224D89D1CE2A39E154A9E1C7E934F9F5026F6EC5 BUREAUCRATEN0
343,034,474 *2242ED06418A651C46145897A2539637BC9EA4F7 bureeltje1
343,034,475 *224D8840CB3722C7CADC1252F39F87944DC70B22 Bureliesed
343,034,476 *224768F87BD4600FCF5B35986382B74CAD557A12 burenkri4
343,034,477 *2248A05EA37A1535F5867C7D7B1011176AACA6D7 BURENOK5
343,034,478 *224058D2D2E3C43A8406564797DA9B2079D0AE17 BU(Rg
343,034,479 *2247B0EC052A211F9EF6AA1C509B5FC0264EBF9B [email protected]$1Y
343,034,480 *224277EA3B5D7801F2CDE0C566C0CACBEF315761 burg3r3553
343,034,481 *224D500AA4D0DC0F716BB1E501C84DB3005E7A9F burgandyrecords
343,034,482 *22452202D7E4F2AEB9D18B46A5028BF9CA78AD44 Burgbarah
343,034,483 *2240726C0A8E7EB4E880696E5D83C2ADE10A53B7 Burgemeesterlijk?
343,034,484 *224F034D677FF89EF0A3D7518ADCE9F22D310786 Burgene9
343,034,485 *224C828FA81A089A5681748A2CFB313EFA72399B BURGEONET
343,034,486 *224A595F5F9D7B58D3E42ADA23C84E3459546993 BürgerIn
343,034,487 *22492B2189F2EA46ABC62D1B7D293453ED7E4579 Burgering1
343,034,488 *22464FF3CB1BA4BD2F9A631BDED68A2477E9E82F burgerscholeN
343,034,489 *2249D09497C339F470070646F9FB056F28CB9F93 burgfriedenseite
343,034,490 *22465081B3B0F09B06AF6E0088474C543DD1DE22 Burghered5
343,034,491 *224AB794DB19553A1C6847CC2EB28A7CA72A976F BuRGhErS
343,034,492 *2241EBAFEDA03FB0EDF388ABADB750E72C07F0BB BURGI-DUNITZ-ANGLE
343,034,493 *2246667E39AD4999D88769E357C2EC8FD1401AC7 BURGLARI35
343,034,494 *224514C9EDAE34545B2C79D9A42F7DF7A7F68E25 burgmaestra
343,034,495 *224AF9C533A796AAE5EF7A8AE16AADA4ED800E07 burgrafo
343,034,496 *224D79BE8753D0DDB5DD098B9C62FAD10FEC18AB burguezas
343,034,497 *224EA42C42854FAB9E652BE5909CD3C351F20392 BURGWERBEN
343,034,498 *224BC185A89976C96622A5B0FA7614C33223BE6B burhanhans
343,034,499 *224C5CCE1A828D3CEC288A6535CBD59C11617346 BU?RI
343,034,500 *2240311DCE838DAFD3747141A3F97BD5348B1F8F ˈburːi
343,034,501 *224DF7BE227622AD402E0ED580C6F4FECB0D7EC4 buriedlie
343,034,502 *2249A1F417332B0BF023FDB916BD875A47D2B6CD BurIK
343,034,503 *2247B2128A640988BEFB3D318671A9305E1B2CEC Burinskas3
343,034,504 *224227611EE9052F8111458C292352AD4DCCC902 BUrj+
343,034,505 *2249D2C0F1498D5394AE5ACCF74CF1F209D2259A Burkemaster
343,034,506 *224119289867986A411834FC577C3E66D3FA6607 BURKINAGVTS
343,034,507 *224BA2A7D4FB67E95B3179E035039EA49FCA18AF BUrKL
343,034,508 *22484E5543A7BE7516667E4CF9CFD16DE003B5E7 BURKLE'S
343,034,509 *224F30150D387B65C7E84EBA7BD53E4A42F10AF9 burkons8
343,034,510 *22473FB898B5BD554F1F1557CE1FB37A01EA37BA burlacu12
343,034,511 *224D5E9416581F79241CFB4368A9F3E63F9F1898 burladi6
343,034,512 *2244CF1380111B4E7284947FC600C0B85CA4FDAA burl.ahlemeyer
343,034,513 *22447C258A986AA6AA18250F6030219DCD5BB1C6 burlarlha1234
343,034,514 *224F1C143F86E0B137BB2FAD4234399435AAB2D6 burl.baldyga
343,034,515 *2242B46D860DF2AF729467BF113F6395E4E58B67 burl.bilby
343,034,516 *2248AF5E3AD1DBAE1C84F09E4F0EF64A3B5CA123 burl.blew
343,034,517 *2246DBFF2900FF04F4DAB7B1FD4018E20B95FF04 burl.calamari
343,034,518 *224C03499B9CCE8CC6E0225EE29D23447DC9CE83 burl.catino
343,034,519 *224A11A37CADBE05F3321D7094453E5DD3FEB4EE burl.chananie
343,034,520 *224032A918C31C7CCEDC1DD49D0E8927322183AC burl.cunnane
343,034,521 *224A11373C9CAD000D17B5279DE31281904E2E11 burl.fryrear
343,034,522 *224EBA5B14CD6A0B8F52EC1BF6A3F9C466FD52A5 burl.gobern
343,034,523 *2245CFE816B62DD9514DF2A7CB3D52C23217E3FC burl.grenke
343,034,524 *2242754F4398F2A9B179EB4F4BF9D32705666792 burl.harkey
343,034,525 *2247DC00F1E27F3DD6F43A76584A62760540CA25 burlierses
343,034,526 *224737D4ABC44F1A7988807EB59E091A2688909E burl.jeanclaude
343,034,527 *224F72C170E696F7D2C60CCF23792CD8843F03B3 burl.landro
343,034,528 *224F5EA7F985FA1BB573E33CAEFA9882090A610A burl.lessin
343,034,529 *224E1462EAEFACDB2600353E92CF3AE16E66C94B burl.mackessy
343,034,530 *224A1EC8D57B0368168F1F427B926DCE775BF234 burl.maita
343,034,531 *224CE6226902889DF53BE7FFEFFDEAF9EDEE9BCA burl.pajak
343,034,532 *224942B0DAE289FEDF46E6B774DBB34CC1CCC9A1 burl.pille
343,034,533 *22456C42B4D86C0B4B82477A251C8B5E644A647C burl.poth
343,034,534 *224CE4C4FE089E8C984B28D01E9F0D398CF95538 burl.rashdi
343,034,535 *22409798E647BFC10E4A8DEA0B1E4958AD75AFDF burl.roehm
343,034,536 *224BCF11A5F5F36119862210212FB1D23CD84193 burl.schaf
343,034,537 *2245B4BDA0BDAAA1BD7759AB38573E3AE2450585 burl.sheen
343,034,538 *2243F2D8092740D74D49670AE9D595DD6BE6477C burl.strek
343,034,539 *224FA78C1E6EC6A3AC344EE08AE05B5414B70BD0 burl.teager
343,034,540 *22423995D2B3764A5C19211152917F355EE44EC2 burltwpsch.org
343,034,541 *22459480C92089C6F8ED24E282702FADD48D858F burl.wannlund
343,034,542 *2240082EEDC2EAAA8DC3D849623993FF8B919CDC burl.wempa
343,034,543 *22411535078797769ADE4A62791A21C50600675A burl.whipp
343,034,544 *224C32E77DC5D53F95BEB6FB9BAE6A109DA482C7 burl.zuniega
343,034,545 *224858C41F8F5D4F2730EDCBB89AA97F3CDD9614 burma832
343,034,546 *224807BA0CB540498EE65E7667B4EBCFB90A32C3 BURN2009
343,034,547 *224D2B839F83B31BFE91D19FE4A7FA4F64284786 burn3tt33r
343,034,548 *224983D06BF9798CE7D38FF800C3BCA3C3C50ACE burnair21
343,034,549 *2242E0F51C098671C5D95B684E4720D961EB7CB1 burned out love
343,034,550 *2244934E4396BBB77551CC2AE18092F4975A0D09 BurnedWithDesire(RisingStarradioedit)
343,034,551 *22405A541C2284961302D5B43A82F0E06C368C53 BURNER打敗,之後拉爾·米爾奇嚴厲地處罰。接受試煉的有阿綱和獄寺。
343,034,552 *224ADB2ED2698E0A4E1A645FD88AB0EE029313D1 burnettsir
343,034,553 *224F6FB13F36653BD61FF3E6FA7218F07FD44046 Burnflag5
343,034,554 *22463461B8B71107EDCC1A5CAD8496918DBFB96E burning questions
343,034,555 *22427A78BD5131D75B0C98C8F49EF70AE0FD3B17 burns-baker
343,034,556 *224574F968A7B92EF22E50C9775106578253162B Burnside0
343,034,557 *2243D8268CB7F8547E1C51D8D3CFCF7CFD7D9E74 burnspesach
343,034,558 *2241CED6E35069E825575F076FD95F7A7A55CB61 burnstein-malin
343,034,559 *224ACEED70A194DCE496BAAB748860B044FEFF35 burns »
343,034,560 *2240B63D912FD9EDA9AC1800E26C7919C85B1C8B BurnYourMoney
343,034,561 *224D40D4B327E1CFBB312DB94B40C6AAA3316E48 BURNYOUUP
343,034,562 *2248DADF2A510ED6B6ED82BCF0602A994747F37D BuRP(
343,034,563 *2249AC31A25CB42FCA402380536065A154799DEF Burqisin
343,034,564 *224F1A5C8894044BBC9128AB57EC3B568DEFB490 Burquinabê
343,034,565 *2242A6765476408B4C21AF233F652EEDAEC5A226 BuRQZ
343,034,566 *2243D3CE0EC05836449FF5A4337F2D84C1FFD105 burrahes3
343,034,567 *224394FADEE4C5C6AA9857B8E4219F7A4D96B383 Burraquito
343,034,568 *2240436ED741418DC75083723790114B7F2B1A0E Burrelfly8
343,034,569 *224840263918BA8D0F27546F70347FF6B2416BF0 burrill6
343,034,570 *224C6F7D57D9ABB4C06590FA595B2EC2A77253C0 burrischarles
343,034,571 *224CD82B32DF893A1348FB6D56B314B83F118B16 burrow$
343,034,572 *224F0692048E73D19DB27D85363D6688451F2128 BURROWEED7
343,034,573 *224B340F1B9BCD1D3C9B7ED26151E05ADD2DBAD8 burrows-johnson
343,034,574 *224F3D9F903B15AD7FAFD63AF4BFAD18462E6F5E Burrucho3
343,034,575 *224CBE853DE21237359929261FF300F9D4BF35ED Bur
343,034,576 *2241E5E0BC3FD59054DB460D52EA6E9D70D36117 Burschenschaftstradition
343,034,577 *22458C55B43252C91498773C286388632D10C483 Burschenseufzer
343,034,578 *224B0343842C6F4932A969A42B79AC4AF91657B8 Bürstenteppich
343,034,579 *2243462DFEC6852CA7D5A5ED3C617F060D0E21F0 burStER
343,034,580 *224665F814389801CE16E8CD359535669FF39ECA burst[instrumental]
343,034,581 *224F64524C3D689F87CD407DDC62DFB11E282AC9 Burstses4
343,034,582 *22445BFF0D436DE4344E44A4D7121B6FE967A0E2 burswood-dome-perth-australia
343,034,583 *224286E2ACA04C8279F895EE338F3645199F52EC burtalanmak
343,034,584 *22404B0C50B1A93907ED03BF2C8D6BC3EE0BD56B burt.allyne
343,034,585 *2241775E994136441C6E49685534CC7DF33E9589 burt.brossett
343,034,586 *2245DDDD425B8A452E19D15FE0D42DFC697C186C burt.carillion
343,034,587 *224FB070E497FFE81CF62C0DB26EAAA010C857FD burt.coner
343,034,588 *224CB478AEBE0BF6031E6601824DB96D7D7E5AD6 burt.doege
343,034,589 *2248676B1FC1585609EB5338A53BC7FB3613BD1E burt.drewett
343,034,590 *2245016388AA929144B4F065C322366741F424D6 burtiskajai
343,034,591 *224B40791A8BA220BEED218B6BDC509AABA5CADF burt.jannett
343,034,592 *224E9D884DF39E29C0518211C9686D723CDCDF2E burt.klimesh
343,034,593 *22440115F66B5FF7E94B13255655D834DD18D7D2 burt.lifford
343,034,594 *22403673AE6D8EBD61A9FDA24175580EA4C48781 burt.luette
343,034,595 *2248CA1AD6B5FBA6854778622B7981C90D399E91 burt.mcreath
343,034,596 *224C15F93A8E2C189757B8F36B61B7C3110DB05E burt.melendy
343,034,597 *2243D3E29D35F51CD76FB8EAC568BF3355567C37 burton.ahlemeyer
343,034,598 *22410B626AF857D49FF54E137C1FC9B28CA0BDE5 burton.bergstresser
343,034,599 *224FA27D7117A393487DFD7D926722B953D39F08 burton.buttermore
343,034,600 *224DDF78A33992185F68CDD23BAD491B8915C595 burton.ciampa
343,034,601 *224FED49EFFEBE38378404D1416EC7BA1326CA3A burton.collari
343,034,602 *224DC4B99F402ECDB5ACE6AC8A04FF8EEFCE9CB3 burton.davari
343,034,603 *22417E054A159A29B111B504E5C76E0D94A13CF8 Burtondu7
343,034,604 *224AA09B64F60E466A32588BEF2AED169BDC6395 burton.evey
343,034,605 *22415F432AFB7B6E99EF2E16E5E4117B64E9BE1C burton.farrelly
343,034,606 *224446144981048C811AAB1F0DF5A58D0BCDFE05 burton.freel
343,034,607 *224AEE166262E5A99F11F72FF29D37E0B41581F6 burton.genge
343,034,608 *22432F5A0935BC9E74D294FD760FB038F8B0433E burton.gitting
343,034,609 *224645DBC57FFDFF0514EBE44F58D9F83EC98AA0 burton.goecke
343,034,610 *224BDA2AC1B2FFF90A946CE818D80646CC18E80C burton.haeder
343,034,611 *224A5107A90AE09DF77ECA692E7CE472685C63CD burton.hughey
343,034,612 *22461A3EBF157C796806D87F973A2DBC18937452 burton.karageorge
343,034,613 *22462CD608EE51028697D33FF3C61DD8F70FB536 burton.leckman
343,034,614 *22443DA138DE09D79455CD658725B262039C28E1 burton.maupin
343,034,615 *2249BCBEE62CB24482D97F49E1FB4377064FB320 burton.minns
343,034,616 *22435CDF70DD53FEE87466920834CFB35DEC13D0 burton.oveson
343,034,617 *22440B127A0CB955E3F992183D2DAEB116C1A844 burton.shuskey
343,034,618 *2248FC3A938488CFEA01F7D153242950D37D8A34 burton.thimmesch
343,034,619 *224CEC29CA2D31E0583F1A8CE3A48EF1A7403F4D burton.warncke
343,034,620 *224A9C0772F05B132B0F58BB5E06B2C001DE0C1B burton.warsme
343,034,621 *224AA5F634827B833104A694383A3303104E9A92 burton.wdowiak
343,034,622 *2248C90D9B6B601A39C6F76E65A471410C911B01 burton.yeatts
343,034,623 *224FA36A0DA762940D8C586FC56FE59EF8FE4C15 burt.pursel
343,034,624 *22424B48C3A333CC1FEE2355178055FDF1140FFB burt.shames
343,034,625 *224AD982C17D675DF4FB793E91985EC7D8AA1A46 burt.shelquist
343,034,626 *2248A54BAE9FD22C66B8210E9204BD3A5DFEA805 burt.solymani
343,034,627 *224B2566B349195B10A944A82AF7E4776357E982 burt.uptmor
343,034,628 *224AA5D33A93E5CE5A2E4274DB797580721904BD bürüç
343,034,629 *2243B346C47BCFFF03763B3F5C62097A1DE695B7 [email protected]
343,034,630 *224134524AB1073406BB0D73E1F06780942DF92A burwilled
343,034,631 *2244A8EB235544C8E80777B5E25B671943B35635 B:-Us
343,034,632 *224A4FF37B0891D3397FCE1AC0C6228553B3B560 BUs-%
343,034,633 *224EAC3258E1445F6D05E14B23BED087C3A00386 Bu,)S
343,034,634 *224CEDF6298765E7E57ADDFAC44E9A7CA395F771 @bus33
343,034,635 *224BD3DBB56564ECED083E0A86F3F0838C036995 Bus5w
343,034,636 *2242369BEE0086127168CDEB588AF2A57DBE8947 BUSABLE1
343,034,637 *2242C460C9F3F569F6D2979AA5D97FBD38CF166C Bus.B
343,034,638 *2244DF227CCC3C85E9912F28E6F11B5C7258B438 busbaureihe
343,034,639 *224A0FE35BDE1C7EC7BD2A32C01EF6068649F8F0 BUSbOYS
343,034,640 *224E74ECC1BE615797F8EECE393F654B880E57C7 BUSCADIR
343,034,641 *2241889BBEED3E2C3129BA08B148612CC9C7C83A BuscandoTuCoraz
343,034,642 *22464210102A5E6910277F0DB2D6ADB5A25B9311 BUSCHKANINCHEN
343,034,643 *22492FCDBB970F06CE5292FC7F0E7561F138AE81 BUSCHMEISTER
343,034,644 *2249E90C573653CAE0686C9F6C9AC43AA0FBA35B B)uSd
343,034,645 *2247D093D7997B1BA2BEF9EEB412EECA0F6C94D2 busdriver's
343,034,646 *2243AC7FECF91C4C52D15A72C58EEE0D001418AD Busecchio9
343,034,647 *224D8AD4021E568BA63CC691FCCEC9BE74BEC287 BUSHAE
343,034,648 *2241C9CF565FCFB4B4F450A84E355A5AEE7A3372 bushland2k
343,034,649 *2241EEE84851A2D9890A4058EEDD9941D14E7971 bushra zaib
343,034,650 *22470C51B31069C3A2677A24678F189753F7FCB0 BUSH-SLAM
343,034,651 *224D69890AFD06F9BBA981370C5800EFAB2EFCE0 busieksing
343,034,652 *224C60728F9AF5EC01D5669C157D1628E2983B1C busine3
343,034,653 *2247CD3CB1A08B3DB192C4EE34FAD51BF12E491D BUSINESS0
343,034,654 *2243FAD6D3BB6DB137EB698A799D75D943D6518E BUSINESS』)。なお、3rdMIX
343,034,655 *224375452294B69D93E83197D3A231CF3E5EAF81 [email protected],Tony
343,034,656 *224932BABC48C46B890D12740891097F9E0CC0A2 BUSINESSES--FROM
343,034,657 *22452C0241ADD8605AB802481ED65E565A0D77FF business.magicalhops
343,034,658 *224B83985B40FE41C885AF9FFD858FF4033D21FC BUSINESS SCHOOL
343,034,659 *2243D24433FCF85C898E4A87A8E29CF2497AB857 BUsip
343,034,660 *2240CD92D6F7AB03A36500B347A8B2ABB1A7B287 BuSiX
343,034,661 *22402F3C57D8CB17F919F7DDACF5866945FF12CD busksalvia
343,034,662 *224DB849FC946BB9E4B859BD2CCFE785976D61B5 busprobe
343,034,663 *224A1BAC13D93D3D361D91F0BA0D903C353AEE5D BU_sQ
343,034,664 *22429A3AFD8D7D2523B2B780BEC5BAD3EA20ACB6 B"usS
343,034,665 *2249439D05DAAD55A6FB758993798F5ADA98949C bussavi3
343,034,666 *224820939A05CC23EB558DB1B34653EDEA532290 Busshållplatser
343,034,667 *224657022067492724997128DD70DDA8CBA51E09 bußhardt
343,034,668 *2244866C472C4065042F83884BAC148C83D2BBC5 Bussipysäkeille
343,034,669 *224046B72477AA7ED2B0549266CBF1718FA34CFA busskarosser
343,034,670 *224A6CDC9DDE68DF06CC58F3638EC4D801D6E4B6 Busspred6
343,034,671 *2242D0F532C9270433C3EB98EBCD756D43FB116B busstation0
343,034,672 *22468890C96400EFC74627A634933BF021CEB87B bust3kbuslogic
343,034,673 *22462EE36CD30022E5E041BABD19474BFF82BDE5 bustad
343,034,674 *22489DEC9F74267BFA5ACD746776AB6CF6F2707E BUSTER_24
343,034,675 *22498CD4AB86577CE4F8D5BB4E20D6DA12464B13 buster.copeland
343,034,676 *224050147B1F38699D95F12AFE93475787B78A6E buster.czapski
343,034,677 *224D63B75C96E783F61D08CD5D19814969F22B20 buster.dimassimo
343,034,678 *224E1B7F1380D20B0E65E33B8E72ADD1B7FC66F3 buster.goldak
343,034,679 *2242CAB7B541F9B13D533C24724E3C1A58EE82F6 buster.jelarde
343,034,680 *2248D7A96CF153B9ED28857B74F8D14BDFC90031 buster.mestrovich
343,034,681 *224D20EDBF5D76AE460BBDB6801C6BC96A6D957E buster.newbell
343,034,682 *22461023CDE0E7102AB8F35F4D4FFC3F8728DAC5 BUSTERONE17
343,034,683 *224BB4E93207E7C96D8DF58C287172BF2F4F6B62 buster.saab
343,034,684 *2246CE279F1D94BF369500D703934061790DDA69 buster.sharrieff
343,034,685 *2242CA9DB0D8F2EA79D0E65AECF913DF6006AC8B buster.troutt
343,034,686 *224E686E3A9F91CF4DA2A3F455358EBA312D0C8E buster.vedder
343,034,687 *22499232E1B78C29200365557F898D694BA8FC5C buster.wallin
343,034,688 *2245CBBD971F9982F1D15329230FB8FE31657EC7 buster.zickuhr
343,034,689 *22474B5875C3E6CB2273E419E20302A3E18D410C Busting1
343,034,690 *22467AB3EA923EE7B72AA458D24DCD99767A61DC [email protected]
343,034,691 *2247A29C645DFEAFEE249E93E5FCFE1C20E5D2E6 BustlING
343,034,692 *2248535FAF621D616B96D5A30E234E84EE5B8F2C bustwilliamking
343,034,693 *22413C45F24F9A48F53DFBBB4D3277CDFB81B4A0 busy,
343,034,694 *2247B6F34C2B8148E972F236C8FD0FA363237F83 Busy-forwarding
343,034,695 *224B51F96F3DC4F177533DBA36FF13775421F387 BUSYINg
343,034,696 *224DF9BB943A1A02EB77FB3212C915594F4BD240 B=U,T
343,034,697 *224BFD917DCCDD2B66C95C4E35237623F7F66EB9 B
343,034,698 *2246EBB40AB873C2DE7FF40300F2BB914B4F6715 BU,t;
343,034,699 *224CC9701918328BD75A576E91D30F93DBC9F111 BuT)(
343,034,700 *224333E1C89F423BD06D10C7D3C92EE62B84FB0F BuT{
343,034,701 *2240625219F213B1CA762C90B657970BFA688E47 Bu(=t
343,034,702 *2248F7AE0E5A69DE1DAD10AFF5980FAD7CD8E33D B#Ut8
343,034,703 *224477358058A01BE384EDDF3B14E6BA6DCF9F6C [email protected]
343,034,704 *22499B01785849BB5481A822CF58933B5F0845FA Butaré
343,034,705 *224F2230320520282A409659FD00A5E5072AF16A BUTCHAAAAAA
343,034,706 *2247341588E7ED77918C04DD550563D401334BF5 butchburas
343,034,707 *22424427F1B716170F8C091CBA9AE0D3674147D4 BUTCHCELICA
343,034,708 *224AC353EED50F8BF4CCB4B2C0A207E94E8C0D35 butcherous0
343,034,709 *2248143172CF1EE40F2EA9AA05800B9886AB7D68 But chide rough winter that the flower hath kill'd:
343,034,710 *224C5B95B2B09E2506A51150702875636D42CF9E BUTCHIE29
343,034,711 *224D4E66CFF49E436368DDE79C5B841920C4DF7C Butch Willis Is a Psychopath
343,034,712 *224F3FA18EDBE1BF7D7A35CFFFCA94A95CD31072 BUTEANSILVIAEDWIN
343,034,713 *2240D24B0FBBED15229FFD2614DD81D329CC47EE BUTENAL
343,034,714 *2247874495C4D792D4296492F632E088E6BE260C BUTERFLY04
343,034,715 *2244030339FDDCB7F094D1E52D729DFAF4E6706F BUtfs
343,034,716 *224479B367C51D40C3E1759091F77833BBFCB2F7 buthaben7
343,034,717 *22488E42CBF3FE65EECDE0F0B0ED4A1889A61CC3 buthark!agrandmysteriousharmony
343,034,718 *224E0A1DE51B500BAA9F374A7C2586A633A9E904 B;Uti
343,034,719 *2249A1D4BE5174B383448B399A4488A53EC484F5 Butirosin6
343,034,720 *2241B4E042B1F6F9CDFFC9C63680C2CBDB655889 B_UTK
343,034,721 *224E59AE91D78FFB795FFAD0683BCCD355DEC9AA butlerlike5
343,034,722 *2243651AF34805B1B05C64E569E39483372466E2 B=Utr
343,034,723 *2243D8F54C7C22CD389FC2D930C2A08054F5FCA7 B_uTr
343,034,724 *224A248D38478FC3FFBD0699CCD1FFC88F623DE1 Butrite9
343,034,725 *224F739D0871D7A34F7AFBE648615510AFEF2F7C BU,tS
343,034,726 *2245D9DF6B49B673739A755C919D5B4018FA53ED buttaneri
343,034,727 *22415975AFCD27CBD4F8E6F1B44776C73D14CAA0 Buttassero
343,034,728 *224C72469AE0B2DE865878A77F00222D74D5355E buttels1
343,034,729 *224CA56D14D2D97B31D11F38F42571712745B71D [email protected]
343,034,730 *2240047307D0D21E5C39441F6D925D3DBEF412AF butterflyandflowers
343,034,731 *224E62A479C5980857C6865B550060F10943A3A1 butterfly_des
343,034,732 *224B95B3EE0F249948E50093E6672B6AB3E95CD9 Buttheadi
343,034,733 *2243C095A5AFA2A8BFA56F985C65A70F2EFE71FE BUTTHEADVINCENT
343,034,734 *224A7169D9FD4F48270E1247B33CFD4215F348D8 Buttokez8
343,034,735 *224E64C77B68D68EAF36E7B21DA486797E384AAD butToNEr
343,034,736 *22436B74428CEB27A3AAF7B6AACF5825B7A21C69 Buttonred7
343,034,737 *22428B441D839D647064CA655B66CA995A9C3357 but.trust
343,034,738 *2245750EF684F3820C1EEA5996796E669BB4E0D8 BUTTSECKZ
343,034,739 *224DAE74A0B066E7B803AD66F68F0998E134AD49 buttspudki
343,034,740 *2245E4AE389F6135027397638320D3D3D90681E0 Butugaku5
343,034,741 *2242E46D9F74F86D1AA6646529739180E4D7BD6C Buturisos
343,034,742 *224A0FF5C295A3A6326B499A399F8700FEE58D85 Butyrome
343,034,743 *224E534B519BB57379BF59F74D9094AAECC73EB4 BUu1E
343,034,744 *22484A5E521A175A1986CF87A8F34144757EEA9B BuU5p
343,034,745 *2241EA1C278DAC6133C9B3E8596274F1B732BFBC buuasawan
343,034,746 *2247F20F4C086B6B7D621C0B7B05DAFC4DE1AC7E BUuc.
343,034,747 *224C133DDD4B6AB12CE261D012468456BF0387A7 BUUL
343,034,748 *224E50FF93EECE09C2EDC7407608D66CD7EFE777 BU!UO
343,034,749 *224711E8BEB3181EE2BFCB9D5D0EAD9354F4A21A B/UUr
343,034,750 *2244BF4CD27CF3059639B2877779265139B39DE9 Buurtweg2
343,034,751 *2245ACECA362B3655767FEE4EC78A26D664342CC buuseiou
343,034,752 *224555EE2C28B23D5FF79B3DB6D9D0BEFCA84283 Bu=Ut
343,034,753 *224FF4C1DDE2B56A05277C3E62FAF5EBE4B6A631 buutttt3
343,034,754 *224E87E328949E2E802A39D58D2AD27F79ECAB89 BuuWL
343,034,755 *224D5C8EB32654740BC6F9EAF1E86C8F0B4B2239 buuxdana
343,034,756 *22462D423F318346040BE6250F179D73D8523555 BU?v"
343,034,757 *22490D9CA344BCB76F4300F960FE04EEFF82F7ED B-uV$
343,034,758 *224C100735C26B242226FDCDA885A6D42719BABF Buva%
343,034,759 *224F911E6AB3AC0A81884D0904BC974B6C6B27D4 BuVC&
343,034,760 *2248D84B7BBC89C1DB40CC209701FA2D5C78D9E5 BuVD:
343,034,761 *22439F39796E326C2705085A2E24E376364DB180 büveyhî
343,034,762 *2241F70E60B0DDD4C2C20170599727C15FEEADCC BuVMS
343,034,763 *224B576AF43EFBA2BCD33E0EBBB4F78112D1B88B BUW
343,034,764 *224C2026FB4CA41CE87B5EF8BF05EB6E57A6B9E7 BU?w"
343,034,765 *22468E0C16C5B12FC56F3E509DC2A8AC7D238382 B.uW:
343,034,766 *22403C904512478018301E6D0EF72B6D136CA5F2 BUw2c
343,034,767 *224A6A6B8D151B7E3D997167C22C8AF13C7BCF37 BuWcY
343,034,768 *224D3E653DD6B8CDF7916D823C25B731E258706A BuW?E
343,034,769 *224F40AB3E9C4A3A0B1ECDB773F91CCD573544EE B:uwE
343,034,770 *224B7CB8CCAEF0EE1ED8710465D120D84EB666B8 BUwfL
343,034,771 *2242A379EB0FDBEFB2140FBBBBEEA8D37EEDBA38 BUwMY
343,034,772 *2245EC22B7D642C9C11C4C7499F92FDE2E753AE8 Buwnaip7
343,034,773 *224C0ACD2F8F77DB7895D71722E665EC1D5C3F68 BuWph
343,034,774 *22418266119B5CE196C7A9DF90E1D4315859CD01 BUWXl
343,034,775 *224197C8C3B371E97798C5CDCDFCE8D9CC7B82D4 B.U#X
343,034,776 *224E555C937601B965D43AD1F9CC559B0E59FE9A BuX3l
343,034,777 *2241943849813C0536E04AD33B4E835467F8457F BuXAW
343,034,778 *2242BCDDED0E7057763123011184C0404821A604 B:UXc
343,034,779 *224E392E96CC343C1F3250C43875CBAF115C9FA8 B#UXF
343,034,780 *22420D288CCF8CD413A4EB3720C1CE6092F26E18 BuXl#
343,034,781 *224A43AF6125561C0F07F11D9486117A83C7D72D B_UXW
343,034,782 *224A087D26F079A39B2FC101480C89C051342E0C BuxWV184
343,034,783 *2244ECA623E84689FF0659D6154B1EB165591116 B,U%Y
343,034,784 *224248E04DCF16F5B9A64EED78ED183CFCB6B59C B!UY)
343,034,785 *224671F146290A512938444BD77214792B4C8741 Buy2000music
343,034,786 *224A1FFB54B0B201954F226B19124ACB411D7978 buy77490[email protected]
343,034,787 *224A9CC234FC95A23914B55D5A596BB6DD4E90F5 BUYAPPLE1
343,034,788 *224E0DB702ECD83915EBC1DFC90D99F86941D937 buyenged
343,034,789 *2244F88F9B3DD076FA5FD2AD8700E6241FADD747 BuYFF
343,034,790 *22496B70A4D0CF156C47E82AD23DA77B840AAA52 B_uYh
343,034,791 *224F69EA46FA81A1702CAFA4700A4C2665F68BEB [email protected]
343,034,792 *224BBFEFE798CB24DA15FB584BDA4FA896C0FFE5 BUYHT
343,034,793 *2249469FB587020A6B57CBE4D229FE2F43B45F53 [email protected]
343,034,794 *224437AEDCD1ABA7E590B2A024A31D45DB7686EC Bu-YK
343,034,795 *2241DDFC37D0BBCF2FB90C251C0271696563C1F3 BuYmY
343,034,796 *224E8D5A898404A40385C0B8C7C9F6A2E6A607F7 buyoutblogcom
343,034,797 *22413B7C0DA80452A399E7DCAB691F72F5E28A6C BuY
343,034,798 *2246D8BABF21670D70E4D2DDD1CB65B972F665AE Bu$Z-
343,034,799 *2245C708CE12F3E8C1DEAE704355816D90D563EB buzgalin5
343,034,800 *224F82D1AE1D672C8AAC28BE575F53C5CF2C37A7 BuZ#h
343,034,801 *22490A732003E3D222B9A50F90903B8693088123 BUZij
343,034,802 *224BB5F0A3D3F450A49F573B827EFF3422E03C81 BU.ZQ
343,034,803 *22482C4FE7C3E3500A5592690460C5768DF70E93 BUZ
343,034,804 *22492D91B04945025E110BC993CF26C8F04A2CCF B_UZT
343,034,805 *224FF68B39C4B8891E62D1014F4E4780BD6658CF B/UZT
343,034,806 *22472F94897BC881D1CBB7A717573AB2FCB068D3 BUZW)
343,034,807 *22470AF787A601E8F6ED4E348752792A8DBE8E3C Buzzamour8
343,034,808 *22491FD812824D1A5E600BEA926975F9EFEF5DB9 Buzzjazz5
343,034,809 *2241798E2E88323AE34852DADA4ED6148F0FE21A buzz johnston
343,034,810 *22498AFD35564BEA74B69662AE7DC40FF66172E4 Buzzlisa
343,034,811 *2243E430B3EDDDC9E761E7BEE46FB57C37C3888F B|-V
343,034,812 *2246430765312867F4BAB47E25DDCA019B937891 B-V+=
343,034,813 *22493EADB9DD02BC6A6E3D2EAA5DECAB1D7C89CC B;&V,
343,034,814 *22434D8E9D8385DA17EE8DADA25F85E04FE902EB B;V
343,034,815 *224C1531A3CBBB765FE0774A67634BD71A7F9DFE B:.V!
343,034,816 *2240D0B8FCB2EC779069CFE0C30353EF9D985324 [email protected],
343,034,817 *224C98AB8516811AC2D7C914DCEB35CFF564558F B/>v
343,034,818 *2242D6EBF65F65DB51DF699E88C4A429C8AAB472 B$?v_
343,034,819 *224CABCAE1823D7095C60D4B6D1D5753CC1CBDC6 B&&v
343,034,820 *22470C09D1B3A2980DABE3F3214CCC4820DB1875 Bv.+#
343,034,821 *224CC3CFA42AB962EA655207564EEAC538E6DE2D Bv$_=
343,034,822 *224EED025280C342FE38682CC8A3442A620C10BF B_V?0
343,034,823 *224A0E140DF86AE6067D86A2E8F19545DD06C220 Bv0=
343,034,824 *224E2EA31C3BF75A68CCF9CA2FB80A88BFA9FD3A BV0XN
343,034,825 *22447FA577266538D1C2B359F5F09C4584DE8E43 B,v1G
343,034,826 *2249F8B25192F6DBA8D7C76A8B0E0756C6005C35 Bv1hm
343,034,827 *224945B0A85BD87DC9C27AD1370021DABA690C60 Bv1Qi
343,034,828 *224F6CF47B461A18A08E373E53AD58176C84F9A0 B!%V2
343,034,829 *22485F3F81608E3DE4C751F9891904EFC54CE1E2 Bv2),
343,034,830 *2248E54130B3666362587ADE142863FAD6E8A794 BV2"B
343,034,831 *224BA6D5B601EBD205CEC4B8AAA48E21A999352E BV2pe
343,034,832 *224874302412423E93FD490E4CCCDD8E340F7A49 BV32)
343,034,833 *224E9AED4517BED08CCFF3295F4736DC963B6831 Bv36T
343,034,834 *224FCF270AF250520BD676AF99F1E868F7255D67 Bv37b
343,034,835 *22473E2DFD67EE474BD318A4F8A12A1E5C6FD17E Bv
343,034,836 *224F9CE0C7C1A9223CE7863D94C6297B44FDB79C B
343,034,837 *22405540DDBE01D7F7028AFF71A06D6480A5BA37 B#V+4
343,034,838 *224A7C81555430D832A674796BA5B9EC9C87E85C B)/v4
343,034,839 *2240EC8B72396B88BE781AC87BCED68869440545 B+v4
343,034,840 *2243ABFA87D2CB76652F2EB75EF755F8E3B23245 Bv:46
343,034,841 *224A8F9D5C27C9BE6936F705E7FBEA9C447F42F9 Bv4cY
343,034,842 *22487C1D1F5FED76E9EBB10307298285867B7E20 BV!4D
343,034,843 *22480F03F9D5C0701F6E86AB13AAF4ADAACDC1A2 Bv4Es
343,034,844 *2244F2CB35829EBF64CA65A3800A9A2B02288210 BV4oV
343,034,845 *22413EDBDF028A82755A1B2FBB6A328E453C5E59 B+-V5
343,034,846 *2249BE78E56C8A7E1DA08188E4861FD93335397E Bv/5#
343,034,847 *2246B3D692DD291EF5DDC29E0792D49E09C97B2F Bv&5M
343,034,848 *2243FE36B2C96C54ED49DF7235B73C99CE87E4CD B:v5o
343,034,849 *224307EA75494A4ACB0005A0D0A1B4F541CF6C15 BV5UU
343,034,850 *224DE802BCB4A833263C2209E2458AEFD6724648 Bv5Vb
343,034,851 *22408C9C813636C214E91CE263B7D83B096EDBE7 B%V5W
343,034,852 *2247D5DFDBCB1A27CEBE50E1955949836BE6080A BV5XC
343,034,853 *224861F97E5B2161144438D459B870CE6C8E1B63 B)v?6
343,034,854 *22476BA59E7ABAF1F9125334396D6F5043E2220D Bv639
343,034,855 *224A4D1CF2773809C1DD516C945EB2F5D38FFC91 BV:6n
343,034,856 *224BE9E80294B5CB3D313E1AE4C42CEA2662B6AD Bv/70
343,034,857 *22414D8D53E952D451196E84280E60FEC9A715AD BV)7k
343,034,858 *224B7B994C64097012562B6BF7F67A3660109BB4 BV(7n
343,034,859 *2247D0D1911B2E1A4916C109D74DC530C0B3FC06 B.v7N
343,034,860 *22442DC138EB1AF60AED765325D8501D6294F927 B?v:8
343,034,861 *224FE8B9622E68ECD1233518B7F5E8A978719BFE Bv849
343,034,862 *22452756389F92D443B8AFFB312B252C05C3335B BV8Ms
343,034,863 *22468142D8025B1A7074193DC7D61D755596CE12 BV8Qq
343,034,864 *22403B894FF100D0087B8ED698C1ABA51F4DD2C9 Bv%%9
343,034,865 *224C6C80710A0CCD7FF9F84EFE300560278BC158 BV9$L
343,034,866 *224B700DB5B45CB96040DF10FD2F489D8754AF24 BV9m"
343,034,867 *224B89167C63C97C239D76A42411FFB57886F8E0 Bv#9r
343,034,868 *224166845949F78DEFFF4AF1CABE7FF16A3A02A8 B?v=A
343,034,869 *224EAC82CAD2EC93478FA3E9101D3A337127CBEA [email protected]
343,034,870 *224EB1A85E9ECF40A7A392BB3FB18421D180DC72 Bv+ae
343,034,871 *224F403948BD3F91093426CB57DCDCC5BFBC0399 B-VaH
343,034,872 *22455DAF3C0A400C4814A35C83EC69635CAB67C5 BVA=K
343,034,873 *2240E3ED8E0DE6C029927C76C3FEAD290F563C49 B,vAO
343,034,874 *224A1874C5D8A2D6102DC8A9EB370F777834E905 BVAoI
343,034,875 *22415EDB057A4144562E5980097E1A1EF1939FCA B.vaR
343,034,876 *22459DF170ABE09547E6E8F35226EFAA08CEEFB1 BvAR5
343,034,877 *2243536B98DBB4D7AB814D73D09B97D123CABE2A [email protected]
343,034,878 *224527F9AE34CB3C21F370139FBCE451F1B8CEA1 Bv;aU
343,034,879 *224ACEBC50E099F5AE90A709D1CD5BBACCFF7913 BvA/V
343,034,880 *22449F43AF1E33B5DF5DDA36F0EB877639E33763 BVA;w
343,034,881 *2247A41A742BCB619B48AF44CDB044B1656038BE BVB):
343,034,882 *224D4D27A39A3378E2E09BADD447DD4B9EAB463F B.vb_
343,034,883 *22403B9BC9918D0BF2E5419BF588E5162A6CBB80 BVbiQ
343,034,884 *2243DC4719EC34CC765B3BD23F2610CFA50B2FFF B(Vbn
343,034,885 *224457C6DAA5C89BA26919C5F1BC2A46DD293676 BvBO,
343,034,886 *22474FF100431AD28CE860429EA52564C69BEF2C BVbpa
343,034,887 *2240154672C7F721FB8F11286120A8D66ABA5B7A B=vbS
343,034,888 *224D6CC8AF71D59C11F0074530315A9A413B78A7 BvbW&
343,034,889 *22468DABD68E876EEBF7563D189080475FB271FC B;?Vc
343,034,890 *2246F42B95BFF1C9AA0B00C7AA7DC29F0072C7D5 B:Vc
343,034,891 *224DA3FD26679F8E8D780924BA789332DB62C5A5 BVc/2
343,034,892 *22478140FC4D5EDAA11211B77138A111B5B2BBF7 BVc,A
343,034,893 *2245A78CCF3D25B7EE0FA9847C4644FE310DAA14 Bv.cC
343,034,894 *2242AACFC981E22A89C05A13A7EE8B2D5B2EBD72 BvcCK
343,034,895 *22411393D9FBA4FEAB33E17451CE2D610AA1181A BVC/G
343,034,896 *224CEDC58384E1AD8AF0C450D1E4E57B73BAD589 BvCg2
343,034,897 *2244F1DC324AEF36EA7CA0FA7E188B35ACC9A595 BVchm
343,034,898 *224B451030B6069AF170C8BF464C8067B6E0D883 BvcO8
343,034,899 *224ED88B96B7AF6A41C50CA8B1017B144562E7CC Bv,cp
343,034,900 *224B5F6232E36B4E59E3159487C23C4B7F932704 B)&Vd
343,034,901 *224C1533F972A4601168048D88BCB16DD7799100 BVDA$
343,034,902 *224F0C7683A64653A9B19F7B3B7D682228536148 BV:dI
343,034,903 *224E044E5C93B8F8E29B73E97AB36DDD62D0F28E BvdI0
343,034,904 *2240BAF6DCC05F6D954CD6599DF215DDE65149AB BVDiQ
343,034,905 *22486CE940258892F7E01F224BA217FE80F94650 BVDKJZ274F
343,034,906 *224D3FD92AC2E372C022143495DBCB12A2CB2BF2 BVDkO
343,034,907 *224AB010B465D1DA000D698C9B5E0ED7AEE05B14 BvDm"
343,034,908 *2248A98D29780179164EF47585513EE5F758F3CC Bvd+T
343,034,909 *2242A8D14C121F7655E11DF30281657E050151A6 BvDW&
343,034,910 *224CEEA5061218400C862B306DCA83C753F0395A BvDZR
343,034,911 *22421B30FE76D6393A0AE3DC49165EA4D61B6C6D BVE%$
343,034,912 *2249110984A0B97ABBC7A2CA96AFEF78E0AF2D0A B(vE#
343,034,913 *224DA5587DFF731E2B387B2565D94077ED2D5ED7 BvE;%
343,034,914 *224EB7D8CF5C254FD80390BC6881E09BFA6C1496 Bve!!
343,034,915 *2240C390D6B0A2FD44775F1A9DF7EAADCDBFE2CE BVE2Z
343,034,916 *224F5601113F0DDEBEE17DA84D51E782379F3525 BvE7t
343,034,917 *224D176D86FFEA609A49A7E05474AAD425355837 BV_E9
343,034,918 *224A5B03148612BE36E47F026AF039EF760C5470 B!ve9
343,034,919 *2246C84C6B3BB3845FD780524621744CD66E675C BV.ee
343,034,920 *2241098428607FE40F68301F440F2CC9BE8CE019 [email protected]
343,034,921 *22444BC324B1BB115FC1731F8146C78489054C7D BVEq=
343,034,922 *22478588BF12087B1CA801C0634FF58468DA2B49 B.VeR
343,034,923 *224496D3E03A3D362860C0336B0BAD7BF46EB0C0 BVEs
343,034,924 *22489A2F0A0DF45675DD9B0393F93A8F2266B939 b
343,034,925 *224DB10C565F7F5F70E9760AE0B96C9E1A03ECF9 B%_VF
343,034,926 *224B5320939E3F22A963385FA796E2606284136A B
343,034,927 *22402F1426B47B47EDABF21125C9B85894BD809A BV,f)
343,034,928 *224205803DDA6D2330C8B590F17824803FF35280 BvF4j
343,034,929 *2242327503129793C64D0DA15B2F3BB39C25B9BC BVF6Q
343,034,930 *22421A02727650754B525E70962043BE96258153 BVF"B
343,034,931 *224B7D0B6070D205CB5AAE399A5E7749C466F2C3 B%vFm
343,034,932 *224F891D981DDF93815401E4AA98CA073BB03895 BVF"O
343,034,933 *224A4EC60B01B8C00B4643A0E17303A41331625E BVFo(
343,034,934 *22421E9C40EC637310EB1540D5201316B3EE16DB BV.fS
343,034,935 *224BCC7ED9136827F62B25639DC9C1505561A72E BVFuV
343,034,936 *2244545DB47A00D7959A6165BCB6E251B4C5D15A B;VFX
343,034,937 *22404828C42FEBFBC657255E555974317B6990DD BVFZF
343,034,938 *2247ACE8E101FE638E1AD56736F18EF735A2D00C Bv?g(
343,034,939 *2245392F62D9F8AE25624CC968F644DCEE100E0E BvGD_
343,034,940 *224ED3513AE5F3EDD1700B0A45299D5DB149CFF9 [email protected]
343,034,941 *2245D7C4B7A758B190A53672753391F14891E558 BvgQ8
343,034,942 *224B45412979651C7BC6CAB06B7352599BC1D0BA BvGrr
343,034,943 *22402BA373E610BBA86AD304E74D8EE1B6DC663C [email protected]
343,034,944 *224F2F48F6CF43E6050B00196312E1AAD3DB865D B.vGV
343,034,945 *224CC2A38FAE03D4ACABF401EA80C2770356B037 BV^H
343,034,946 *224BE116FBE46290F860B0A913F22B2C31E9EF31 BVH-
343,034,947 *224BEB5554288FD18581944FE729B35D3296B86E B_vH+
343,034,948 *224E1B6DAAC30E307E82CAADE8F70D2C0EB1DE7B B:vH&
343,034,949 *2248EB36B913D463B43F4276EA041D181411A162 Bv_Ha
343,034,950 *224F3E185FBB2CB23DEFF3264F4C324859F8987B BVhDS
343,034,951 *224E85F62A8CAC165C8D43E15F8A01B5CF6F948E BvH;L
343,034,952 *22464643C1C88D5A7416F8803CD942F340E139F4 BVho-
343,034,953 *22462C4A1F8C204122236F542FC606B376B5A8EE BvhRI
343,034,954 *224E937701FE64B4F0B61502F480866F71E3B904 Bv,HT
343,034,955 *224DD47C3448185200B0E84A6B9C24D7C4F54492 BvhU
343,034,956 *224AEF274E2A1AF52EBBC51568074CB6E930E249 BvHYi
343,034,957 *2246469E5BC5B9ECC04A432DC67CC6E81EBFA16A BV%#i
343,034,958 *22427B1337F15FD716C9AF92BB8C83A2AB5A77D1 [email protected]
343,034,959 *224008C75D36C648429C942BB73012613DDB1932 BvibM
343,034,960 *2244102A2A17DB6AAA33D18EB1055B0474E394CA [email protected]
343,034,961 *2241106078B88EEB2DAC6AEA508F0AAE241B3E5C BViGf
343,034,962 *22457FBF0063B88B1D488691DB544BF03D02BC33 Bv)ii
343,034,963 *2243BA2EF4182FFCAA1723C5BBA01B332CBF2C8E B)VIj
343,034,964 *2249C7D3B644A9CDC3387A861D499D24122236D2 BviKC
343,034,965 *224CAFE792A2526B4C7474DED7C938E530462D1C Bv$Is
343,034,966 *224CE2F96C9A094BC4C68D0885D097E267BA2F95 BVIsQ
343,034,967 *224140DC1CE3379F62D3B0D17CDE0AAF419E9173 BvIv-
343,034,968 *224C1CACE0CBA9582D685525E240C8B1394C853D BViZ7
343,034,969 *22470FDB40633FF77EBE246740F7EACDD3B5D7A5 B#$Vj
343,034,970 *224EC89EEA83C3F6F0AEDABA248596BA8AF4EE60 BVj00
343,034,971 *224CE0F5859B29AF88C0F529E129BBEAC882D188 B=vjM
343,034,972 *224D1A845E93C1D47FD7D1F8419E962B6DBD847F BV!jV
343,034,973 *224B77D89801E1EDE649960180D21DB3096F88D8 BVjVe
343,034,974 *2242BEEC3FFDB6FEB47BFA66F0CA0EF372F15DB2 B!vk!
343,034,975 *224C424422634A4248FBF22088D7BEBF8D557AEF Bv,_k
343,034,976 *224A900508B7E115F5D3E9CA59926D344647F476 Bvk9S
343,034,977 *2249A9433C0BC5B566622995ED058DA6B4487CB9 BvkLV
343,034,978 *224A7C810291D7AB1204DEB070E46012B8891C3B Bv;kq
343,034,979 *224F3889E3A6BA23756DDE8CB456F24B536DB45E Bv$KR
343,034,980 *22448DB83CFB31ED20BAA5C0842413A5B39018B9 BvKr=
343,034,981 *2246C21F0815BAB74D56A0E6C504BBC8E0039E87 BVkrr
343,034,982 *22499A2658EE25BF3504257B9260B88BED1DE795 BVK&S
343,034,983 *22494EDEE001D1939E8ABBD4A308804AC2C49B4D BvKT
343,034,984 *22483F9DA2B7DA1906C031E087138C1B515F09CF B$V;L
343,034,985 *224B2020D2E6506DC599BDDDFD851F5FF83A18A9 BV!-L
343,034,986 *224333A011881D875AE7A5C12E97859B282630E6 B*Vl
343,034,987 *224806A6DA99060DDA27DA3B1BA8B57B8FA4DFC8 B.)vl
343,034,988 *2243B9D76A8581979ECFF638B0DFF5B0060D4298 BvL2d
343,034,989 *22496C90BBA5724EC793BF8B8C41118B8FA9644C BVl35
343,034,990 *2245A041FC3E08C2C42BADABD6A9435CD27E09A7 B+Vl4
343,034,991 *22440384DD8CEA17AEB0C889BCD4B47DE67D0DC2 BVlCf
343,034,992 *224C2C96DC004C6395C96A41923026AD8C78EA77 BvlFI
343,034,993 *224BB166B4EAD89302A785672D0DF15E3DB1660B B?vLH
343,034,994 *2240A3F223B2F845BFC8924EF7C14C0B0C2D47F6 Bv+LK
343,034,995 *224F969C786E6340ECCE072B26E1F7B9B125D7D9 BVLlX
343,034,996 *22429BBB85ADE3E226899F0A47551992872FB331 Bv#Lo
343,034,997 *224BD0DC1094097378CB667F5C729F1246A7FC48 BVLon
343,034,998 *224B361B48F6CBF0FA4333A12BD55564C17E5636 BVl#p
343,034,999 *2242BC1A63A81B985F998EC8BB3026F6CFF6ABF1 BVlR/
343,035,000 *224A8C5077D895FC053FAB7255CFA8C89B642969 BvLuY
343,035,001 *2241C7DA0D146DE6F716096E6E139CA6A7100A7E BVlv"
343,035,002 *224DCE6B716511C1FAB71C91CAE6A27BB21AC7EF Bv#LZ
343,035,003 *224333A72C63F27F438D3CF08EDE51CE261861D7 Bv+.M
343,035,004 *224340F3A53B8416A310AEA2C4CB368E34B85396 BvM4o
343,035,005 *224D22C1D8EE2989FA167559F7457576437C245B BVm,A
343,035,006 *22406386FB1CDCE75B3BE76312063E75E35D5D00 BVMhG
343,035,007 *22467B092D46FB852F1600E003129E4FB62EBF00 BvMhn
343,035,008 *224FC4E01DEA8783262B5D2D12C2DE00A275967E BvMI&
343,035,009 *224027E827F0A0590A260523910982B66F0FE3F7 BvmR-
343,035,010 *224B9FEE425CEBA16C245C435C0390F63AA13648 B!Vn!
343,035,011 *224881E347A42D79B5FEE9D1BAE1A1A358D9C397 Bv;_N
343,035,012 *2241AA663321843FC877CF7E3BF00D9851B0A90C BvN3&
343,035,013 *22494405CBB3035E8D4F49E8C2156AF9B466F3AD bvn-america
343,035,014 *2249192572DE33E4F27A8ACC6A5B930D34E52AD4 bvndrjfing
343,035,015 *224AD295F7D05BB126270EBD26D589CC31DAADAF BVnHL
343,035,016 *2240AF48B102C27BF9A9DB713FFBC6E332A2ADC4 B-VNO
343,035,017 *2247919545D68C8D2AD65D03F9BF18DA2FC49149 BVNr"
343,035,018 *2248AEDCD27C6F75869073D5C781C1AC5C9B53EC BVnw6
343,035,019 *224DBAE24EA086F39D691A2A26F13D4990C9899C BvOa,
343,035,020 *22409B412C47D3301D33825F0F22C25ADF4D6BA4 BVogo
343,035,021 *2248CD25987E84847D2AB2276DB2E312FB4E0D2B BvOhh
343,035,022 *22451682DF041E7358D643780E7D3C210FC727F4 BVo.j
343,035,023 *224BE7C77CCB2595291A4528C65B5DE903F41B4B BVOL_
343,035,024 *224EC181600AF4FC503B0B44950A16B6E95A2693 B&VOX
343,035,025 *224BEF5E8E35E67B9E5A4D17DD0E1BB89B0F231D B;)vP
343,035,026 *224A605DF88B02C5442624114A213B946B2CDAC1 BVp/3
343,035,027 *2247D67F566BD95D81E279A4D90F5AEC6B7FB711 BVPGs
343,035,028 *22422689F63AB18A0D3E7FDFD9C79BB10B28CA2E BVpgw
343,035,029 *2249EE05F407D4DD83BDA951D79E9C2C4EEF6516 B=VPn
343,035,030 *22446BEC1256E8077490F2D6ABF9E69517406382 BVPOQ
343,035,031 *224D05FC8BE92181705292E99862E821823C1E89 BvpQL
343,035,032 *224C0DBE6C114A351ADBE3705AB77237EC156199 [email protected]
343,035,033 *224B6B5691E24166DBCF05451E49BBD00BF58B7B Bvpt?
343,035,034 *2249412BF20837E5503257EF1D37798819917789 BvpUb
343,035,035 *22428216194D1C509FC7CD7F098012C32CFA7040 BVPXm
343,035,036 *22450E40757ACC2747C297DD5D6BA53CDA3110CD B(VQ
343,035,037 *224856B2C80481C90372C8F2E07E9653889E6181 BVQB:
343,035,038 *2245EF36DB45C9F21FA6258F4D801F12AB256E96 BVqB0
343,035,039 *22484B5B9626FD703576BAC71F8E1FEE0F7DD77D BVQEu
343,035,040 *224914B050F53192B043561C9DAF9D05F66B7BC5 BVqeZ
343,035,041 *2244814209ACD3C50E65DCCE2F0C5B1A57ED1BB6 BVqH(
343,035,042 *224BAFA7772BF5F93D8F688E14AE973055F52D89 BvQ-H
343,035,043 *224881CC1C134686F32D017C0D0CE64AC8CF39F6 BVq-i
343,035,044 *224455AFCAE380FED9EE37FB291DCC12E2F65DAE Bvqs7
343,035,045 *224DF22E5841930BE854EF76C87304D259AA4825 B:(VR
343,035,046 *2247A102C3FCFE88DEF2278487428C48B1581247 Bvram
343,035,047 *224596F1980934F1B82B368F18D9D1927EA0C4D7 Bvrbe
343,035,048 *224FA08715F2EFF769E75668DE0824B00EC75966 BvR&D
343,035,049 *22443AF8C53609ECB66A78E1247E4B36534D113A BVRdK
343,035,050 *224DE7BA3AA3C2F4EE12AE9DB036C91694ACE5FC BVrev
343,035,051 *22492347C518B31C249533B188FD029B70BE2E63 BvrmQ
343,035,052 *224C5A5FEE59AB193E0285E0AD183F12F4428BAC BvRR"
343,035,053 *22465FE7A3AC9BA7E6DA49A35206C2B23AB01EC1 Bvr"R
343,035,054 *224CFE4A00262CB1ED3273425ED0D3B9804FBE4F Bvrrdldhd
343,035,055 *224B463278DA337656268AB5F0BC6E593E0DDE22 B?VS
343,035,056 *224BFE546C2AD9DDCC9E21FAA67F17B051FEF859 B.vs"
343,035,057 *224B77DEEBC4EBE070F57AABC64F3BA6EE5A3AA1 B&vs.
343,035,058 *224B9EAF50A06165EFC402EB2290FC0E499942DD BVs8.
343,035,059 *2246F64B64F1A50D3A789F887CBEB2BB035A85DB BVS(g
343,035,060 *224DC642360105576EC689420737372938982BBF BVsI!
343,035,061 *224BB0E98F4A367A454D0AD9B833FFDB0C02FB8C BVsI/
343,035,062 *22481C565FFD38BE0AB0B20AE5A69852B8BE0B83 BvSUb
343,035,063 *2243DA8F09D1632C4BE360E649EC542E015F2135 B_)VT
343,035,064 *2249D6411D3EFA5DD562451AE89287311928B9BA BV_T&
343,035,065 *22491AC762171B8D717A59F36AE6DB10E5C6FA69 BV!T?
343,035,066 *224833845F9C00E0A4D4E26514E13A69AC890414 B?Vt
343,035,067 *224720B656A9873CE9032B01DE0ED80B52EF4B51 Bv!T"
343,035,068 *22451EBE93CB989DF074B8110B3AA9C5FFC02453 [email protected]
343,035,069 *224F7EEFCBF3574AF5E132E2E0FAA3D968CA9BF7 BVT
343,035,070 *2241A1DF8F95FE9ECC0B9C3F3F5D9AD7FCEBDEDB Bvth5
343,035,071 *2245D4A8308350F0B389A8320041FA729304DACB BVtlv
343,035,072 *2247E4DF248B3E116784755B407BC7FCF17688D2 BvtTL
343,035,073 *224599F5CB8106AD3981BDF09BA7E8FADBD302BF BVTuZ
343,035,074 *2242C5EEF6FDF5FDC6A19FF5281D9C3359DD2133 BV!-U
343,035,075 *224A1B5EDB8B4EB4472674CC6B3F851A22C974A1 BVu6v
343,035,076 *224D88CA23CC5B3EFF674BC18C7DBE0815658477 BVUBI
343,035,077 *2246C4F687D7E64449C542CE6949A85D00511E42 BvUC"
343,035,078 *224155E008A88E28D02DB2EDBD93FFE30726FDB2 BvuDS
343,035,079 *224F168E261956385B0CB5FD9766C734D349A748 BVu/E
343,035,080 *22476C0EFA60AA1EFA2E464590CD4C75992094EC B?Vuk
343,035,081 *224E9B7C25EBE30D0F8C9375809BD955F045F5CB Bv)Uq
343,035,082 *2245B94B242244FD4D16CF9540B4577A231AAD26 BVurA7pNX3jfCf
343,035,083 *224338BEADA2163A8BC17C2AF11DFDECA7FE9DA1 BVuRH
343,035,084 *2247FE50FBB9FEC7202240D635C9BCA310461935 [email protected]
343,035,085 *224C951757FF0D62E4C8B455FF56504FFD521CAD BvVcR
343,035,086 *224FBA55996F69316E395AB35E4A84C1DD084529 B!vvi
343,035,087 *22464F038F97E7FA7922FB3C60FA20B728A3ABFF BvVL_
343,035,088 *224C38D9E301B33E45589702F54250E9FFBC2EE7 BVVRe
343,035,089 *224AA7319276D022C486711913BA823A455C98D8 B
343,035,090 *2245ABD6603C1C0A051CFB236FFC2335220708E4 Bv|W
343,035,091 *224DA2B86D3CDF753618F254E70C3FBC06D27441 BvW:)
343,035,092 *224DB96DB9A3A005FE76BAA4998EED1CAD3DAE15 BVWd3
343,035,093 *2241CC10E6E9C797779DF4B3503CA34E51F08FA2 BvwfF
343,035,094 *2246C3595BA9884B0710470A96F6F48AC35AC49E BVwq%
343,035,095 *2244E8DFC51AD4C34A908C26CE4C0268D787B25D BV.wV
343,035,096 *22440EBE6DC25A0403C9CFB088207E3967B3831E BvXd
343,035,097 *2246CAF0ABF135C30E543A2B18C353D63D794D6C BvXD2
343,035,098 *2244D2DCD0E475F369AD0242846069D8D3882DDC BvXdM
343,035,099 *2244CA8D593F14E07D68F38636494CDDA2A63C74 BV#XP
343,035,100 *22489C1FA404C9B127650E298647498E82E3ADB5 BvYFG
343,035,101 *2240EAF9522A97411CAB922E72FF859016290828 BvYi.
343,035,102 *22444137BE9CB3D270E6A89AFDBF405D1D06A159 BVY#j
343,035,103 *224BEFB1016E315D0226C2122622F1473ACB1B0A BvYjC
343,035,104 *22481F1D3DD69777FDBE6CE0654CA557A4C86A06 BvYL8
343,035,105 *22445CEF197F506B19DCDC415A4606744E8F2936 BVYqv
343,035,106 *2243B91F66C70273FB32FB2B02DEEE65FF286B6F BvZ!a
343,035,107 *2240D559F18A2B9C81793DEE676010E5FA1C2CA0 BVZdO
343,035,108 *22432C754A1D7ADA8FC4A9E60CC353DF1D405952 BVZEn
343,035,109 *2245BE51A6DEF2365F3784D15B2AC9CC45B4207E B+$(W
343,035,110 *224DC27BEB768A9B8FDD5C0BFD11CF3CC6252C88 BW;):
343,035,111 *22460CA9D469AEA48A4B6342B4A54E0B91C3BE3F BW.
343,035,112 *22438124D7B33605F06CEFDACC8AA09DE937FF0F BW).
343,035,113 *224D3E65E249683BB1E5993FE8E2E260F7604133 B=&%w
343,035,114 *224122D20E3D83EBEC005B2B5ED9939CFEE109A1 B/w;=
343,035,115 *2249C9D778DF31D5C8EFAC12BD8BDDCC7BEF31C3 B.w!-
343,035,116 *2248568816DBD8054AA086E16F40F08ECF92533B B]w;
343,035,117 *2249AF5F42A26F69F47070FB2603E1403685A56D B
343,035,118 *224AEE2BF857B19EE069DF962F29E93318D0C180 Bw/"/
343,035,119 *2246A4A20611F59B216FA93D2CBA2C19A3F9145B Bw)=:
343,035,120 *224083C5EA70FA3EA02C567DE2267EB2FBCB7826 B")w0
343,035,121 *2246090F83CDBB51610539C8711EF231F69AA954 BW0+4
343,035,122 *224D055638B3BAC600C90905284FE267EFFB1E21 Bw05&
343,035,123 *22416866E3E738C8044EAA0824E9AFD973110836 B=W07
343,035,124 *224712D39B6AE89A45AD0BBE59E9B1B28A66F58E Bw0+A
343,035,125 *2242FE524954A16352EB51FCC1B6608388BE246E Bw-0M
343,035,126 *224897590901A06F0E51EF897A6292DD30EF4FAC BW1?!
343,035,127 *224AD9D9A207FE65C4FA632E03516EC6DF1FE8C5 Bw14S
343,035,128 *2245741545AECE84B2A202320CE5D705D73D11AB BW1lD
343,035,129 *2242C92B94B44931E29923387AA2E31FB65C3090 Bw1Pe
343,035,130 *22463D41232A49D50243823EEE450791B649B5DC Bw$1r
343,035,131 *2242455BA7F3D6AB462180E6843F17A6DC15B7CC BW1W/
343,035,132 *2243FA25E2FA169F0B3090785347D735071ED933 BW27V
343,035,133 *22474DCA61094B0BCA9BEA80D7AE5B091ACBF39A BW"34
343,035,134 *2241F7AB8CBED5750A1D0062FA3A17749F6103B5 Bw39M
343,035,135 *2247E5986100DF381B08C2790BEADBC56613C637 Bw3E.
343,035,136 *224ECC280A7E771B00780B1AAB7B527EB384BC18 B.w3I
343,035,137 *2245ECABAA2C2DBF9862AE59275F99D38F156E4B Bw3M!
343,035,138 *224E69D5DB94A8B14B17A2A52565AB7EF0BBB205 BW3X/
343,035,139 *22480CD0E57A540A8789F61DF73EBA1F53ECBFDF BW4;
343,035,140 *224888B36E787BA08487FE1E5025880BB131AAE4 BW47F
343,035,141 *2244129F04A7688ADE9289B74DB34C8CF3C50F61 BW4:X
343,035,142 *22464337AF7B3C1BA451635819BE3175BAAD79AF BW5+
343,035,143 *224B2AED0B61A40390046F68FB4C0423D381CE52 BW52W
343,035,144 *22496A7D9178B6CABB0CCFA80AF63BBD2B54973A Bw5S.
343,035,145 *2249F90FD1F60154B6EAD5994FDD156C82AF930A B.W.7
343,035,146 *22444353B4AD6FA6C713B78473F2BEFEC2CFC522 B&W.7
343,035,147 *22478569AAB54D6F127F1E425DD5E535688FFEB8 Bw765
343,035,148 *224977FE643C8836C5B97771426CD42E5B027C4F BW7ea
343,035,149 *2248803705D84835E463BE9A307238F76F1694DC BW7gr
343,035,150 *224202571FB6E70FAC4ED4D68E067DDBDD081D95 BW7KB
343,035,151 *2249506CDAEF976575FD1AA737A2539033FAFC81 Bw7oF
343,035,152 *224FCB1CB11DC8616514232725A40FE13AB68169 BW7Ov
343,035,153 *2240D3A80DC63856E55B7533F7AE1D37C3947C7B Bw7!Z
343,035,154 *224C03A0906AEF78741D797B128DA3D438230C2A BW8
343,035,155 *224AA7DE77A47A9AD5C6D6BEB8E292E2C61A1836 B+-w9
343,035,156 *22435A5CEAC81D3F0FBBED3842D5AF329FA0E689 Bw9(7
343,035,157 *224D42B24FCCBC56415E69BF733CC8451778A18A Bw9a4
343,035,158 *224A5EB5E29E493305943900129EA576A02507D8 BW;9H
343,035,159 *2245E4B84551329C2F85600EA96DA41AD64A1498 B!+wA
343,035,160 *224872719928ACA2C714C9E6BC57241F2C234822 BwA"$
343,035,161 *22454911BC055275B685635A5FB6D99EF75248E9 B#wa
343,035,162 *22472E2BF8A744C172F0CDADD92C6960B8EC5DD2 BwA(3
343,035,163 *2246EE426C78272CAE4D2F9D1747F6E58DD4D806 BWa7P
343,035,164 *2248D2227E96DC1AEC6EC7899EB5DD981E9B13E3 BWAC
343,035,165 *224726E20CABB4B24609AC22D949771D95794121 BW;AI
343,035,166 *2245C0AF6D92360CFD77E375A0718B672BB7680D Bwa
343,035,167 *224B959373B9727F1131CDDC6EBF5FEB153A32CB Bw/AL
343,035,168 *22452A875325E718D56AE9652CD4917C31BE0153 B,wAl
343,035,169 *224B46E5C81181E7683828BA628E77AD9D822FC7 bwallace1
343,035,170 *224E3F58C1DC1549457B6DBFE62FD41660E3CDC7 BWANAS
343,035,171 *22490FCC37795E0B48C46EE28C2576D678644D5A BwAO)
343,035,172 *224095D01A5B762B16CFC300DC4D12281AED701F BwaO$
343,035,173 *224C8C86EB49AA7C6B35CA0DFA512EC02BE2CBDF Bwarnered
343,035,174 *224AA3CCE57C4E0208616E5EBC60069BA210A925 BwArQ
343,035,175 *2249CC41B001E154FADACC00654E6D357372E121 bwatchinvaderzim
343,035,176 *22437C576D5E509A6DB5130B083BF04481DD5091 B
343,035,177 *224626FDDAB9EF8F34B227031C7F5E17AEDACB03 BwAvq
343,035,178 *2241704D6B55FBF892EB6748154557909FADEAE6 BW#aX
343,035,179 *2249CD270008A427AE3FFB98A9D1461988253D50 bwazniak
343,035,180 *224C7471FC9737BBD3F57553D4D4E3286957EFDD BW-#b
343,035,181 *2247C299EBD171D6CB437BAE4691E2CF5C3C1B09 Bwb!+
343,035,182 *224EB753CC4DC8FFCCBB45FB8089CD019C7551B4 BwB0l
343,035,183 *2244CAAE276C012E404FC2A5F06473E2D7140D95 BW,b2
343,035,184 *224B4C1B4A2F65A86DD36423F09FBF0100F664DA Bwb5
343,035,185 *224D9E2B107552A99B553969B26E3102A0F6C4A8 BW%bG
343,035,186 *2248D3F53E90E7F25852A2469D1C3F2CE45B8341 BwBi0
343,035,187 *22494891A293CBD34649A6081CDB73585365FE4E BWBIXCS
343,035,188 *224E5EE27053BCE0C210E74092B25C551254FDFA BWb/j
343,035,189 *224AD9AA37D5D98650F76F5252121D4DB9638258 BwBlD
343,035,190 *224AE658DAD5B709A3B93B84F92EE6061C47EDB5 BWBO
343,035,191 *2241DCF25A9B6B9CCD44FD4EAF9C60EF5BA93FF8 Bw;bO
343,035,192 *224A87DD3C83B4D80A062E9E7B85B903D9DCAE2C B/W,c
343,035,193 *22490B8383DC6586D1E8D1B4DC7FA9DCD4C1E626 BWc:;
343,035,194 *22446499F96821FD8EFEE80B87870011B30762E9 Bw/.C
343,035,195 *2242CFBE98061B051E528BC54EE94DC49A452853 B-w=c
343,035,196 *224D6A69C0AAD0F7D3BD31E53E5FC0D481B567A3 BwC22
343,035,197 *2243B08515E88AD98C5BDA56692BC02F67B3FCF7 Bwc5,
343,035,198 *224D55E496FBA2464C73437B92586A25072D347E BW-Cq
343,035,199 *2244AE96C2B2D1EC41D45E65EDC9F68C26309887 BwCu_
343,035,200 *2241A824B63B1F58073555587C6155920ABB1A9B BWcu7
343,035,201 *224D734F6D280256188133C20AA2A619DFF7F42A Bwd)?
343,035,202 *224BAB5A6BB70289221E05484CFAB3471A30D210 bwd1a291
343,035,203 *224BD5875CEFFD9FF333FE9BB64C0A9E52A94D43 BWd(a
343,035,204 *224B8FAFB28606CE751EE1D29096F81FF018A9BF B/Wdb
343,035,205 *224CFFA9347AFD59EB3D8E8FA246053FE217FAEB BwdH(
343,035,206 *224CFD69224C3E3A99F478E57355C570FE142979 BwD(n
343,035,207 *224495A846431B1EA11729E8FA64AAFD37A92609 BwDsD
343,035,208 *2249C115D2372BF874686C9A3F30067C8C8B3835 Bw#DV
343,035,209 *224F8C8DE5C81681F7D2294AF6F355984BDE0A93 Bw(DX
343,035,210 *224A15BCF6DFA240D639960CB33559299178097A BW$e(
343,035,211 *22499FB053E711B910E01703B5FF8279377B3F91 BWe5v
343,035,212 *224502113C5C2D6861DEAA445960C1D363BEF30F [email protected]
343,035,213 *2242F8DAAE04C88E5DF83EFFF8841D7C66A88D49 BWegt
343,035,214 *22412E622620975D3DBAC13499057A37B70CD3E7 bwelieve
343,035,215 *2240FF0BF53F405085F05226C84C4B4D543B692B BWE:t
343,035,216 *224C0CED65A368E881344310AD091EDDE931433F BWeT
343,035,217 *224BFFCB7FD4A3E86F0CDA6B8B0929DF849F7D0B B_;WF
343,035,218 *224DD9434ED76D0049040040528D66538FEFF81A B%-WF
343,035,219 *224C1BA36FC3C4FC5C68395E710B06603BA7D276 B%(wf
343,035,220 *224A0F4E4CE5D065089531797DACBED74EB9A524 Bw/F3
343,035,221 *22414D7B754DEE3F8D60E3DB72E3CF8F35F84FBE BWFCHISTORY
343,035,222 *22403116DA375327DD9BDC27CDBC412E41DD42AE bwfuller
343,035,223 *224C69F5D6BA10D6807AE237B7918630332BF8F1 B&wFV
343,035,224 *22485B1A08C495B32C8F3DF8E1A258C482A4F286 BWf$X
343,035,225 *2249DD30F1507FF9EFAE1E9A18118BF129BDF298 B%+WG
343,035,226 *22461815B4FB5C6B4E7C984CB8BC92E84CFF905D BW?g%
343,035,227 *224712C32EE1EB9145F381579A955785FF906E5A B"wg+
343,035,228 *22468CA7CC492CBEEFED1520B8A0271CF595FB8D BWGCg
343,035,229 *2243C63BCD1EED90756A24C46912E736393A8707 BWgj_
343,035,230 *2243A736C67738663E6558178DA1190246E98C7E BwgLE
343,035,231 *22467BAD24D58F3D65C75C69919D977948A8C47D BwgmS
343,035,232 *224B23EA0418796325C7A76AC9AF10289F0122CD BWgOw
343,035,233 *224CEF6DDB23699A92DF5CF073FBA1A6A5D7175D Bwgrndn7
343,035,234 *224976E912501A187418E0651F4AE9E602672B14 BwgZ3
343,035,235 *224245C567393355D0D02A62C29948954AD7ACE9 B"WH#
343,035,236 *22469F7DFC492CF44F2600AADCC84FC8E17692F9 B#w#h
343,035,237 *2248DCC6B74B50A7439EEC2E7244568B1AD7A52B BWH1a
343,035,238 *224F6ED5E871E9EB8A6A7BBA84C338AF2F99C3A9 Bwhahahaha
343,035,239 *224734310336C08F7D1A00977C83E29E3805C966 Bw:hC
343,035,240 *22447D99003064FB6F2D7B89935FBA2BD945F831 BWHi6
343,035,241 *224EB8F5B1E062D325E0F3251BD37FBA084C5AB9 BWHk%
343,035,242 *2247C2DDBEC9EED30D6B2B2DABE87FD101E661A1 BWhq/
343,035,243 *2249AD3B3609BAD4989AD1865E55935559068979 bwhrhtn6
343,035,244 *224130AB61E34097CCF652552F5CB3C7B4A6C61A BWhVQ
343,035,245 *2247E19D47A6BC0988F4FE9C17830361D992BD68 B_W:i
343,035,246 *224EA6439B4ADD35488BAF9DB784C48FDE2ECCE4 BW!!i
343,035,247 *224C5FD0F7141DA280AB8BEDB39220C841926C62 Bwi1v
343,035,248 *224A83E914F3C36386697088A6C7897ED899CEB6 Bwi72
343,035,249 *224654E998E3A623077DF0D5F001F40439921F69 B!WI9
343,035,250 *224EA24EF572DB61D605C8D10F6B7B20D86C8E89 BWIcF
343,035,251 *224FFBF99B3C578D7486E706C48DCA730CC655D2 BW"iD
343,035,252 *2246382E6AE397D1F8DDF2E34AB04C5AC2F0AD63 Bw#iE
343,035,253 *22477D5825DD2639BDD169E32484C39A411F78B8 Bwipi
343,035,254 *2248A1DB1F81AF89E9BC74CC35A624688AB5A339 BWiTR
343,035,255 *2249CFDAEB2D0EE319B3EDE8267F250F4FD1E1DE BW)j(
343,035,256 *2248C2B2E4CAF785AC501555A8E1ABACF327B8F3 B)wj+
343,035,257 *2244423979CC0D7DD53DF64CEBDCA253B5F8BB0A BWjHK
343,035,258 *2243F1975201928BEA0011B2B22ABBB12888312F B?Wjp
343,035,259 *22403B2A3298A8FAC2BF0E00832F1AC153D133D9 B)Wjs
343,035,260 *224836154BA97E40587C4F586DA77DEA3DADE37F BWk&+
343,035,261 *224FD141A61613E3AE2FFDF03C0EF4D44B718550 BWkD(
343,035,262 *224253FD6E1904331C586B86566D63EFB74B6071 BwKDB
343,035,263 *22455FDFC6727C0E8B2DD99A808BDB58E95F352E B%wkl
343,035,264 *224DBEB12ADF4BB88E024D54DFB9713F4D2E7D1C Bwk"T
343,035,265 *224B51913101DD6387BBD4302FA477C688770A1B BWKTk
343,035,266 *2248DCCD3BE211AF62886C1DAE5563F09E1B9B5F Bwk;v
343,035,267 *2248ECD9CF9B85FA30B825CF535DC8DFE00A7E36 B"w;L
343,035,268 *2247F771EBE424638EAF8BED850431458F2504E7 BwlC%
343,035,269 *224F39AEE2B2124C111439C4E02237167593E8FC BWLdS
343,035,270 *224C2D85C2358917D46F521070613E58B501A0D9 BWlKn
343,035,271 *2248671EE734455DE8A10D837A1EED735FA6B97E bwlktn
343,035,272 *2248A9C6EDC646322847625451C502DC86953F26 Bw?lo
343,035,273 *224D447DBCAD362468FFFD942161DAB11B3A4F8C BWlR-
343,035,274 *224AE5729A7AB0A216569E2274EAD16D86C7F49B B;wlv
343,035,275 *224FC1B421740FF09944B4AFAB19488F8D6D6E75 BWlw_
343,035,276 *22473C20E14F06F813095C4A90DD7163CF0565D3 BWM!-
343,035,277 *2247103AC8B2FCF2E79F6368152169DACE53FF15 BW;m,
343,035,278 *2244B43C228457458D75D62D3038EFC099E78CF3 Bw%&m
343,035,279 *2243C8CB9F40CA60DAC1F596997E1EBEC84338AC Bw&mD
343,035,280 *224D435022AE56FB9F464AA24E7AF208081EFCA8 BWMNSTWN
343,035,281 *2241B6AA7A699C1F4084B440DA3268510641FC10 BwMSr
343,035,282 *22468999E849BFA4B99DD8AEF4FC4A8904873ABF BW!Mt
343,035,283 *224BCC3545BACDDC77AFB62838F5AC85ED02E772 BwMTh
343,035,284 *2242D93AD7A8172415B56BC87063B9FE7F7EC23C BWm!X
343,035,285 *224256A49F501A4AD77B6253B58E0858766A30A7 BW%N$
343,035,286 *224ACAA2A8C202414B1DEFDDE20B18A3B539E3C8 BW:n
343,035,287 *224B6D2C37B90F69E44764925D8322D7095C2F75 B&w/n
343,035,288 *2243CE9BDAEEFC3278F927F5CFAF46EE4D66A3EF BWn10
343,035,289 *224FAD1DCB6EE1CD476AB50453B38CC91A37B363 B?wn5
343,035,290 *22484677DD8EB06361A2D83589A63B90960928CF BwN%B
343,035,291 *224615E131DC48D7B8EFD317E3966F4FDA9E8F3F BwnGe
343,035,292 *22474C9CD4DD581B5CE22CB00FC53DB4A58AF8FB BwNhu
343,035,293 *2246BEB5FE3A78F2022C55AE4C559E98E1D7D489 BwnqH
343,035,294 *2244DB7E94F08480880F18DCCF7B1F0F668B9168 BwNrq
343,035,295 *2247285F06898B23308BA6E0EEF44B04BD1279A0 BWnvj
343,035,296 *224504712E4E0E3E5F49ADE935DA7612F8606C71 B;WO,
343,035,297 *2245D634265DAD65EE431B72320B6150D492E66A B()Wo
343,035,298 *2243156A8184316DF3A8D08CC8AA7742F5498DFD B/wo?
343,035,299 *22476C1C6EF27B91CF781FC9F7F62C4C8B8FE75A Bw?=o
343,035,300 *2241EF74B7E157D4B1D6B090F556B7A013372B62 Bw%o7
343,035,301 *22442403CEB9D52F8D06E2B98274D149207DA7D2 Bwo_F
343,035,302 *224FE23881A6FCD6541DDB14FC0C5599D66B66AB BwOFr
343,035,303 *224D38F8F79C4313AE0DE1AE54EC262956294DF8 BwoQP
343,035,304 *224A2121A2098AD151795B2FD31B2D6A13BD3CBE BWO%U
343,035,305 *22453CD004D6CA1F2A482D29C272A7B07A0E8F5F Bwox
343,035,306 *2248E0377AE3BD24D6FD00580072B0766CAE4B26 B=
343,035,307 *224867EE13B50FA545AC10D89C26A9AC0CBAD53A BWp-H
343,035,308 *224123D0101B75A288CA02687055545F85392500 BwpiQ
343,035,309 *2249B4D9FD913E3B00A640F7BAC0CFBD4F7E24CE bwpnk
343,035,310 *2243AE5DBCD638363C4470AA32B74A78E0310EFA BWpT=
343,035,311 *224BFFB4D79396CB40D0536D3EF0B9F3BDC3B7B0 BwP
343,035,312 *2246CD4471EF25D858C6B2323F4D52EA413419DD B#w=Q
343,035,313 *2242FAFA28527233EBF340F3A962A1FFC1E9C862 Bw:+Q
343,035,314 *2245A2405F55E977612CEC05A77095343ADC6255 B#wq1
343,035,315 *224772D16847AE02F2858EC847B0E5E6EE2D8B96 BWQ7o
343,035,316 *224922BD4B46AA2730F243FF140053583827B753 BwQb=
343,035,317 *2249ACD86EA11E5FFF3A8BD85E1247276D6DF458 Bwq=c
343,035,318 *2246D93E16C40914DCD49AB47089B3AF26CE0326 BwqGU
343,035,319 *2245927D2630589F820B27ED94BA994CE9FF7E30 BwQl4
343,035,320 *2248FB92C2C38A90592DC537C3EAF784CFF42AC8 BWQQt
343,035,321 *2240E57513DD16D822C0D4BD73CE44C97D9D5087 BWQw?
343,035,322 *22420ED99E9D0372710B388058495CE1399570F0 B
343,035,323 *2248C9B5D029FD89F1EBCF9CBDE3116144352674 B!%wR
343,035,324 *224E16D610DD0D41F2A05ACB1F835E68DC722800 BwR
343,035,325 *224EB6687F98755F6F0B252A0E84DA0919AF19AB B+Wr1
343,035,326 *2240B2D3C2A0FA99C521508E6A305B90CF64BC2D Bw(r3
343,035,327 *22472298571DEB3FF9527AB44413E5903E43BE3B Bwrgroep6
343,035,328 *224E3840A077820F854C1E1270D7DC6EAD8BED4E B-Wrj
343,035,329 *22483EBBDD3740312B4DEF607F050ADA496D12AF BW;rT
343,035,330 *224BB6C66CA43D0562F29071BAAC8E42B998A6FA BwrvX
343,035,331 *2244F322C7DF8469C9848AD5C86FAEAD41B880DD B!WrX
343,035,332 *22442AF81CEE4A77D39287317D3E6FA436D543B2 B=W/S
343,035,333 *2249753DB28E56CA5C32073BC98FAE9402FA7EAA B&"WS
343,035,334 *224E3A4996EC148DCE59C081E997981DDA9E4B48 BWS=/
343,035,335 *22424E2FB5A4471E05316E687B556A9A96394604 BWS(!
343,035,336 *224BAE942B576A4BFABCDAEFB4DE0BEFFCDFCB99 B
343,035,337 *224AD8E99518ABF8F5522F632E4D6FF7F3BCAFB4 Bws#_
343,035,338 *224A81386DA56295322EDFCA31AA9C198DF76082 BWsAD
343,035,339 *2245E6EDE174E23B6ED630B1F99080D7DC48FB33 Bw$sg
343,035,340 *2246B265FB3FA632E49D6C4EB3CF416F215FFE45 Bws-g
343,035,341 *2245CADD8407F58D70BA5CB86F9DCD3C1E399812 Bwsli
343,035,342 *224F1EB10FE37C81F2A8B192D6E6D3F6B372E3FF BWSnT
343,035,343 *2246765E39B64386F8EE49BF6E3675A5325FAB60 [email protected]
343,035,344 *224A8D2F7CEACA33C248206B991FB0B3BFBD3154 BwSQt
343,035,345 *224FC89A8F67AAFF24AB2B9BB5061F3925A4E544 B?
343,035,346 *224AE80F3118163876718E675848BA1DE21E3D69 B)W=T
343,035,347 *22475A64F28A2F44F0D028C91C3BC588D1463113 BW(T-
343,035,348 *224C8310C7DD691055A6819D3A70EE6CA6B6EC99 B=w=T
343,035,349 *2249DA6AC33EC5ADF6610F31F8A5FE66354702DA B!wt6
343,035,350 *2243833EEF73FBF0274D8D2AB8ED273F3894E10C BW,ta
343,035,351 *22435549FD8F6B906C3B4A1EE66EC292485553AB [email protected]
343,035,352 *224A18FFF87940E1AE606435B86F071A0855A430 B"wtg
343,035,353 *224D534A1470C18CFA8ED8273CE2D71A02FE55D0 Bwtwobsw5
343,035,354 *224837A79920CEE1E883CBB68567A5A975BC8562 B.(WU
343,035,355 *224203554C234CD99EA7653F35030D204FCADB57 Bw!U!
343,035,356 *224BB698E6F92A9BF70225D75D315B6F5F5BB7A3 BwucH
343,035,357 *224F7FD30A0FD4681E56454A9412ECFA4F8F954B B;WUD
343,035,358 *224093699C049CB3E2E027C372AFD07E65C5DFE0 BWue_
343,035,359 *22471C941FC3F2F7DA512475F5BA87A1BE900A15 [email protected]
343,035,360 *2248053E6664E3603713E814E7E2B88EA35B2158 Bwu.r
343,035,361 *224500DD500360581340E9AC549C658981098CE9 B?wUv
343,035,362 *224CAD0686100D7E20CD83F98710C9B224E250DB BWUwK
343,035,363 *2245340992A713373DBB6236305D0452FF0B86F8 BWuYK
343,035,364 *2248E508664F9E3116EA1342A170B2D8101E1C34 B.=WV
343,035,365 *2246274E8BC5574667BCB109CD3040A597AED964 Bwva8
343,035,366 *2244DB00B7CF1AB969E149DA393EF5706ECDBCF6 B,wvc
343,035,367 *2243A1A54A4BD0F339463C49219CA39F79FF39A4 BWvCK
343,035,368 *224BE00E01EA5C8B52B8567A0487D6A568A4A2E0 BWV?F
343,035,369 *224098D4A08E8E40976653A6273D3A5AEB0FF50B BWVH7
343,035,370 *224205D405786C1610A39791A5994C4E7C945FCF BwV"n
343,035,371 *2249069555DC8901427DE79533C423966456FCE9 BW%vO
343,035,372 *2242649A91F3CE702B4DCECA60A66E258D05716C BwVsq
343,035,373 *224713240A3F4A25B04ED43F914CB315CC984274 BWVT=
343,035,374 *2241C9A6FD8F50C926DB558B4C1CCC905FB57FCF BWvTk
343,035,375 *22428E5B1EE994B93567C3390C7DE1A1984157B8 Bw-W0
343,035,376 *224873D2D25AD1B0927DE0BF37F3378F04556C19 BwWb&
343,035,377 *22430F89159027414F6D6DA4EC962DB9F9BE89D1 BwwE:
343,035,378 *224CC46A30845B43077A049A6D00770A9A5F20A3 BWWF5
343,035,379 *2243C559F7A5A561D8506F3BEBFBCA915ABDF7A2 BwwK4
343,035,380 *2246AFFA31CCBFAE716A2F7DE7806576207F130C Bwwl/
343,035,381 *224633D4E39FCC5FF4CA4184C707897FCCEF0EEB B&wWp
343,035,382 *224877A79308A1B59D7D6A6018335E60A9C56993 B?wwr
343,035,383 *2245A2EA69AB0A385A9E8F23F52D4629DE53D38E Bwww/
343,035,384 *2244A862C4D35A8FD4AC69DD97FF0F0410E7F92E BWWYo
343,035,385 *2242B9D66CF7A398BD99D608B31FE2FCE4068286 BW(X?
343,035,386 *224FE28F3E89A4951D9748011B7EF85F96D84FE4 BWX,f
343,035,387 *224DA362ADAA57B948391D050ECD87029DDDBB88 BWXj6
343,035,388 *224F493C1543D22259F3610C93375C8F900EC0EA BwXjB
343,035,389 *224EC2ABABAD0A636B783B980A5212922D1D8F3B BWX=n
343,035,390 *224BEB780522716349EC05691B4B5DCFC43BE0BE B#WXP
343,035,391 *224AB312E4B4C5B0DA62B60EA5A719046E1B5DB2 BWXS?
343,035,392 *224E7210783611D19A9246D468E2C0465B578127 BwXS3
343,035,393 *224E6BE50A6A19132A974B207E1E2E3ED3882112 B&+WY
343,035,394 *224D495855EBBE2F0927F145A7DAE182EBB47C44 BwYAg
343,035,395 *2244ECF79613BA7BDB8862D27B1092BFB71C5CBD BW#YC
343,035,396 *2241F5DFEC71F6FCD36AADE762F771AB634B2B29 Bw+YD
343,035,397 *224C55699F107FA5EA0CD0C714F30C8C985B4F77 BWY#E
343,035,398 *22478EA36FF9D2CE6B11DA32C5452F93268BC5E4 BWYlg
343,035,399 *224B0FCFF77AEADEC6FE3D5F5D98FA15B2B78550 BwYo
343,035,400 *2248936E6BDD14E27D435AE39003D022BF821BBC BwYT+
343,035,401 *224B9A97FF48E478AF29F70AF3A1419CC8BA3FAB Bw\z
343,035,402 *2241A34CDE393D950E23698513B7D7EEA700DF2B B(wZi
343,035,403 *2244729EAB1CED53BBC470FA61AD9DA91110C75A BwZlM
343,035,404 *224CF21FAD96B1D120AA1FC70CE0057DCD225F9E BWZZw
343,035,405 *2249844CAE35A58D185BABC4ADE094808320B080 B_X-.
343,035,406 *2241F03C30BEEF386B975CE6B15C0C13972AE832 B;X$)
343,035,407 *224007B296AECE7137402268D2BD8F2E1B241D34 B.)"X
343,035,408 *22480473C390A9709B6BC5A5D7F164744B4F7242 B"(_X
343,035,409 *224FB0FE79D94FBE430EDE2C8D429577340C7D57 B&X.;
343,035,410 *22436C71D2A4636BC1E7963C308568EB2FCB0FE3 B+;X(
343,035,411 *22402C6B43AA51F3994F4C068629061D0837D448 B+"X)
343,035,412 *224B8060B7BF10B53E9A3A21567A5CA4C178BFE9 BX_/"
343,035,413 *2242A0BF90F7DACF9BCF462562F5815CA7038CCB BX#+-
343,035,414 *22434E7D340BD44C9802F77008B9769416432B56 B}x,
343,035,415 *224159B33074D4F4AB10917F7064495E4F32066B BX-0_
343,035,416 *2243EF8CFD331073EDD9C9131CC881C829BD7F57 B
343,035,417 *224247A60DBF6A50E6B4094D6F03CFC6880C3112 BX1Q"
343,035,418 *2240D06EA6BD0996231B039A9F1B89EDD9C4C82D B#X1q
343,035,419 *224D2CC39386D0631C2655C31A86E9CC6E6DD2D2 BX20d
343,035,420 *224DDA0D6EB5D0B2D3E43B2979F635545C03BEF7 Bx2h
343,035,421 *224D157ADD27CC0616B7D2009DAEB849A37EFB86 BX2Q#
343,035,422 *22446EA001450478F11A44382C846A1C6751E816 B")X3
343,035,423 *2244DE1A27B7A5DB9ADE89815431DB7FC30CE97D BX/3=
343,035,424 *2247CE4E89BA4D3451607E255354FE262E5C1CCF BX!3I
343,035,425 *22420EC8911D66E39A4B32BE7E39E4ECB44E96F9 BX,46
343,035,426 *2241CAF4E1A2B79511D87FC77D22722D62924749 BX49T
343,035,427 *224DBBDF1F4FD621372F0A31B277C58A4ACD7E20 B!X4s
343,035,428 *224A02A70A798B2AEB86F60130D9843AE74DBCA0 BX4Sg
343,035,429 *2247CF8F5C4DBDF0CFC0EB52885FEF15E8EC1CFC BX4Wf
343,035,430 *224C20825FB1E95FDB6AEFF293FF1314964BFF23 [email protected]
343,035,431 *2248752F8B86FC92214A69E388CD3E39E2AAB90B B)=X6
343,035,432 *224D85CF8908B6C82B51891F65B3666DE258452D BX6;h
343,035,433 *22419667A80ECFFB1568ABB5A43F29A94C15FE12 BX6$r
343,035,434 *224C20F9C36E6066056A499C98658A329B3801A1 BX7_:
343,035,435 *224173CAE390579DE867C70B346BBE46AB01BBBE B_X7Q
343,035,436 *224029918462C8BEBD4701A4DE0DC8E07CC18AE8 B_X8.
343,035,437 *224B94099F91929776E15740CA67CA9FA4AC5DE3 BX81!
343,035,438 *224B8CC2A1752FF13748C9D1A17CE0906EEA002A BX!8A
343,035,439 *224CFB255D8D5DA380319EC24BD62D3C8D3C65EF BX8oE
343,035,440 *224EF2C342B7D645D1ADC45738ED562601DF7A97 BX8
343,035,441 *224F2FB798EE185E3B031261145D0DD0848BF232 B+X8T
343,035,442 *2243494CB185F60CA5699D6D60851E7611BEE3C3 B?X8Z
343,035,443 *22440ECAFAC35C28A4E4ECA4B9F73089E8ABDBB9 BX9s:
343,035,444 *2240E7D8CE43D5AAC58C9C5E0B6C1F8E542B701A B"X,a
343,035,445 *224C4182501BA9CD729B407DF9A3CA2C735D35F7 BXa_:
343,035,446 *22434515AA792D4D0F24511BCB0A9843D9AE97B1 B=XAu
343,035,447 *22400826C81781908C8BDC68087319CBE462C247 BXawI
343,035,448 *22441791E9DFCCFDCED5D1F8BB1FEC8CF2B26F0F B=+XB
343,035,449 *2249850B510EC515829415C4BF9DC63F58C78295 B:X.b
343,035,450 *224F3868A8560A18D646F15C5B075BCAAE562D8C BX:B0
343,035,451 *2249A88A4CC1C4DE140CE1A0C625606DD26C4A1F BXBj:
343,035,452 *224BA95C644BD552E11BC89B769795C3F91689EB BXB
343,035,453 *224BE84F69ADFFC10D9356BFF3EAE1A719F7E494 BX:BW
343,035,454 *224C6F771D05E732CF9CCF9EFCF647A7760F0A89 BXBYB
343,035,455 *2242D84544CFBC38ADD8DCE40F7306E4E6050B91 bxbzegkq
343,035,456 *2244E791B4514396F22DD6BC898F56FBF8AC197B B%X,C
343,035,457 *22429F0EF9BB5DD7D8AD86669DAAE0044FEE7FCB BX((C
343,035,458 *224D82754C5A1FE932EFADA5163C80824B4E2E85 BXC=)
343,035,459 *224979343855827810988317B65C29BFD841AC0E BX-,c
343,035,460 *224314280FDD5269E2A3AFA5B5593160686C901E BXc0n
343,035,461 *224237F7288D5816EB24B060981FC6D964720B5C BXc1D
343,035,462 *2244542C3591D1A85CD65BBC120183A74A720AF6 BXCBj
343,035,463 *224DC56B125DD0C9D9C443C6B75C8FA92DE28AC5 [email protected]
343,035,464 *224B9C3E3877AA622255E6032A03864917CC5996 BXc/k
343,035,465 *2242064CBC805A1F097AF505784E5D68FAA6BE32 BXC:l
343,035,466 *224C21DB1F8F987D297E8C972F1A94237D690F1D BX:cp
343,035,467 *22433C353314F4EE155AA7FD3FC1628CD677C1F5 [email protected]
343,035,468 *224339745C89B08377007BDA403A701DECB63080 BXcRF
343,035,469 *224F43693C897736013CE73E59ED6EDDAF25C9CA BXcWK
343,035,470 *2243E594D76D47C586237CEC5CF264F13C005D2C B:XcZ
343,035,471 *224337D391263E7C2EC628D4CA2E25C41ADB23A2 BX/d)
343,035,472 *22400B5D79C5084FE1C5E74C503D661BDC41A37E bxdli
343,035,473 *224C509AA09BD06F28F69A9FFF7BF8381D5EB2AA BXDoY
343,035,474 *22410A2C7B14FBC42391DA71734285F6F5CB853C BX!DT
343,035,475 *22411A4C561BF35032AD7C74289DB1E9EEF35344 B=X_e
343,035,476 *224F09EED997109B9AA6329CCF0C1C8D6B72643D BXE8l
343,035,477 *224C1194EC651B3658CD2F6F4C8F69077DF36406 BX:Ea
343,035,478 *224B4ED27E5FA344558E90E127CAE54EE1138F0B BX
343,035,479 *2244E710450A4CD731868FDDE9277F9C942C66E7 BX_eI
343,035,480 *2249348C4C629384463A6E839487FB41FD817290 [email protected]
343,035,481 *22480C8E05072EC4D4E19C2CF3B5735406CD4147 BXE_P
343,035,482 *224FD36B409AEB4B03A94F372AE5190F6F18440A BXEp"
343,035,483 *22475EB76723551635870B46FFC28AEBECBD2F70 BXeVq
343,035,484 *224B1D6E9B1C0B6814BD883DA7C11C4EAD38AC4A [email protected]
343,035,485 *22465F95B1AE945CBCF262CA2DD226D8B49DC876 B(XF/
343,035,486 *22492AFE324B2F0CD2F5159689F1DD87A48083A6 bxfusbd1
343,035,487 *224453BFE34D0206446363C84048515FDFDBC985 bxgiw
343,035,488 *22485B57AFC76A1DBF4870585E3557448F735CD8 BXGO.
343,035,489 *22460D9D3CE8E143D5BCD5FE153DB8B27A6071B3 bxgq
343,035,490 *224F355812B13E60A95222C23277D1B7F137A07D B%XH
343,035,491 *2243998453C1DFAF9315A10A4001CDE662FE3AB4 B
343,035,492 *224420E0E72E782CC4000018B165C1FDE9F1F6F9 BXH3F
343,035,493 *2248CDDCA2A083DBB98F0FAE260B5D82F97AF06D BXH8m
343,035,494 *224F4DD741AB5B9155BA4F1ED8320ADE62C50C16 BX;ha
343,035,495 *224800C58F9EB416B43CB9DC69B8227E1758FE80 bxhel
343,035,496 *2246605624F596F91F0B33E0BCE972425C576081 BXh/h
343,035,497 *224D0811447554D44170CA108E25493FA0DBF4E1 BXhl;
343,035,498 *224CFC1076A3013724A6E3B1C187F224A5BAFD40 bxho
343,035,499 *2244332CB46D6FC6832EEC31FA91BBA589404A87 BXHXp
343,035,500 *22417F3A192A35C25824B723F54FDF7E228AF1F1 BX,,i
343,035,501 *22494B656282CD1946A273DC3655BDCBA337375F BXIF$
343,035,502 *22458AC21F3814CBA5C3E12E04416587AA1D343E BXi/i
343,035,503 *22437B6B118C5C3DC766F8036020329270484E66 BXI"K
343,035,504 *224CA298E9890E4CBEC5A7A5764DCECA74FFF6A4 bxikf
343,035,505 *22428D72DED38A6BC3A59D531FD77B2D54BDF3B8 BXi.T
343,035,506 *2247F46E91790FF8D54588A4612AF88C3412C31A BX!Iu
343,035,507 *2241F025BFDFE4396C2791000671C29C57375EF6 BXj(0
343,035,508 *22474BF72845577C63A4E2D4EC6A216D4203CF48 B-XK=
343,035,509 *224CD72ED3E7E4A99E022DF01822333E81033606 BXKch
343,035,510 *2246FC8CCA234A343A40BAC8A59FD628C2166C6C BXKGV
343,035,511 *22423C279857B9A6684E8EC9BA45E0FAB7059176 BX+?L
343,035,512 *22478D149C7ED7D81D30B7D0B1B3A7C8E6358EC5 BXLAs
343,035,513 *2247F879EC2B6FE2B171D4305847B9B7C5DAFDCB BXLFm
343,035,514 *2248E2B3834458930F030C99011DE618E492FB55 BXLkb
343,035,515 *2246D9ACF34A18138A54EBFD38302C1CA95E3052 BXlmV
343,035,516 *22454D55B5609645129FCF31684CD0706B24ED83 BXLp#
343,035,517 *224731F16C349C7CA0D82FF3E6958C521FF22F94 BXLY5
343,035,518 *2243EA538BC9B090F0C2CB075690DAE4E378CE2B BXmEt
343,035,519 *2247A2B178F697DA96CE6822F20977F3BA65737B B;Xmf
343,035,520 *224BF6D6F4CF3C72084CF9B74AB0F3B37D123998 BXmla
343,035,521 *2247A6B394D38537A47530A5E763E9D48A998CA3 BXmw3
343,035,522 *2244E364EE904C9C414196C2FFD67D229C4202C2 BX=MZ
343,035,523 *2242B1CB181458535538A0577B1E2E6A8F23A2E1 B,
343,035,524 *224430810DD1106EFDA5B4B87F4DC382F688C120 BXnBX
343,035,525 *22449AD026FA02B18CC7C4B260A1D0EBD84B5A7E BXnKW
343,035,526 *2248823C2779AD7F6DAA2ABE64CC96C457DF7194 BXnXj
343,035,527 *2243360226DFB581A36612A2E50D6CD61F3051DC B))XO
343,035,528 *224CBF606CC74EDDC29780D5F27B70B4C6E7CF36 B+Xo/
343,035,529 *2244CFFBFE607EC4FF5F25CDF03DC06886C58B1B B$Xo2
343,035,530 *2244AD5B01A8D9D3B37393548FF44FDF8EB1252B BXO:3
343,035,531 *2244A018C45D5EC0E79264A5D0F247B26CC1AFF1 BXoCj
343,035,532 *224020715334EA69C150CF7119122A5195A06BE7 BX
343,035,533 *22429C28909F4E2FB33586B1E22E69D27F1AE642 BX(Of
343,035,534 *224D02945175B7D9B2F095DA6537140649248C47 bxohk
343,035,535 *22433746CD3974A535A41FF34EF831D15D394CF1 B/XOw
343,035,536 *2241455438E86AF805348B00F3B8E450F43CB3E0 BX(Pc
343,035,537 *2247E1B7B9E033F80A9E6911502CDD39877D4121 BXPNv
343,035,538 *224D8FEB4938858CD1F27A5A359283FF7D5AD55B BXpr.
343,035,539 *224196CB1100CE9CC99AF27AF4A0DC22BBBB1770 B&XQ
343,035,540 *22423C9DFB5CD23FCB7FAE9E0A4DDA6C0364AF7F B&.XQ
343,035,541 *224DDEDA7366A7BD2C0060ECABDA73A7563A8F1D BXqgL
343,035,542 *224105D8DAD5ED986FCC0C9F259E1762769E5215 B,XqN
343,035,543 *22411FE002173D3F992CEFF67F46888F90844886 BXQTC
343,035,544 *2245EF3411C8C211DC5769A5F42F51679960FA0E BXQvH
343,035,545 *224EAFCBFCEB0CEFC7F5A0621BAC203589199274 BX:R&
343,035,546 *2242BD1CBEA5E5591C656D9FE5D2658D5BAB258D B)=Xr
343,035,547 *224DCD303EBE05AA9F2399234EFC592DD1D8401B BX#RB
343,035,548 *22455471253A7FAF2EE37C23F4ED32D6060C8CD8 BXR;b
343,035,549 *22478A2B29F60DFECF635CEC3CF22FFCB24667C8 BXrs(
343,035,550 *2245B65B26B495F9EFBC00033D16FAD890133C47 B:X!S
343,035,551 *2240E9D8387FC8940FB9E1192075D86C12E07027 BX(
343,035,552 *224C2B49B483F3FD62FCECF63DCA7B9E9B82D7C0 BXs).
343,035,553 *22438AA0726B28631DC32821679AC7FCCBF40331 Bx,S
343,035,554 *2241DF4B874AB1666E08F135413862903545E877 BXs8X
343,035,555 *2242F0D99C5D33BA8AC0FFECADEFAC7738D0C182 BXsd%
343,035,556 *224DEE9C4D1067C1346E5CB99431C2B771E730B2 BXsf?
343,035,557 *2242D56C68D4739E00F28639359BB392BB863FE7 BXSfk
343,035,558 *22477190E6E07B67ABBB6A32E16B91EAC3AF1221 BXSrB
343,035,559 *224EFD3101711628954E9C7EB0DB4D445FE1DBED BX
343,035,560 *224012B2103B7A8347797297AB960F8A781CF93F B)Xt3
343,035,561 *2247734C367ADFA9EB19BE6DA51FB113B68A1D5B [email protected]
343,035,562 *2249531EBBAD349A4A48568035B348FDCD9990A8 B
343,035,563 *224F32C15B6F7C545CE9AF5251B0D696F98B2B86 BXtMV
343,035,564 *224E696D681D3956BBA20961D641350D1C272B47 BXtpN
343,035,565 *224A836D7076616BB7CD0E3987B4B89078402846 BXTRk
343,035,566 *224003B3C7003D7C44FB60DA15EF6154E646A51A BXTU_
343,035,567 *224CB55F9BDB3EB6B93DEFA0D838444E1E0F1C7A B"X"u
343,035,568 *224443CC5EC619BD6DD30CA98FD13A1DC5526D5F BXu.F
343,035,569 *2243BB3DC281CC8D371B452E9131B6BFD6E3C490 B(XUn
343,035,570 *224BEF06D97970D613FF3918841C25E1F6F6D19D B+XuS
343,035,571 *224EB65DB183B5077CBE9D29630AC89A1B4C4E86 BX=UX
343,035,572 *2245EDA49D1F99256A330AA8A9777A9CFAD4CEFA BX,v
343,035,573 *224AF71BF703B9A75FBDAEDF524AD97EAB9415A6 BXv-?
343,035,574 *224F386D6B8F01C588968466FEE55901552A6B7C BX#vK
343,035,575 *22483D41787F4EDEB6D2D209C265C7E97F17C1CC BXVOHUQQUBSHLD-XCTBDMBQBN
343,035,576 *224CA9A3F063CF7CEFB618503B54DA332765AF1C BXW7_
343,035,577 *22458A2BFD754A83ED10CF3D4DFA8F1FFC9B7AFC BX=w9
343,035,578 *224A4D76ABC002F5BD5A61176E6013F4E8885ECD BXWIo
343,035,579 *22485BD23C2CF7B6A502C8F9C63CD489BFE51E70 BXwM
343,035,580 *224B9D2AC59FF8A9437EF592157DAF81C812334A bxxtx
343,035,581 *224A6C00212E5ADE76249B7FC010AD8ADEEB2081 [email protected]
343,035,582 *2249967A6893007313CADED5612CD7E18C0C60D8 BXX!Z
343,035,583 *224D877B02E34B036260C89A7530AD03103224DC BXYi#
343,035,584 *22477B394BC7CDE21AB037A10BAA9B77867A862C BXZK?
343,035,585 *22460E62649AC531330CC880B35C68DFB0D155CD B=+_Y
343,035,586 *22414BD0B3253B8AF8263FF57F7880418F935AC9 B($:Y
343,035,587 *2249ACD17938823A9EC14C2043CF99B049D8F181 B$Y(-
343,035,588 *224F4F8C761F2EB44D1B140C3FA0A2C5F6F07C36 By|/
343,035,589 *224B8EF7CF65974708DE91C75625984D5DA219D0 B/Y0_
343,035,590 *224DCD4EF126ECBE64FCC1408BBA405743DBFD7E BY"0h
343,035,591 *224C1FA11B5B1A319D3B55A400CBA6A8430A4C5A BY1)K
343,035,592 *224A5D308A03ACDA8874C6EDF925F3C6C260E430 BY:23
343,035,593 *2248B2100F6D459E8DD32F59F800717837694C28 BY2CL
343,035,594 *224B07036643EA77D1AFC9E802AAD0EB3D07645D BY2H
343,035,595 *224E5AAC22EDA80AC3719746B08D49E310E81862 [email protected]
343,035,596 *22404B6E70495466F4FCA4CB898144BC4A30253C BY3(Q
343,035,597 *2249635E2DD82C0481FFAD6EA52B8E066DCC0F08 BY3Q
343,035,598 *224FBA891992ECDB8D64EFDEC5C9C49D62AE37D1 B%/Y4
343,035,599 *224B81BC57224DFFE13988A4CA35045AFED1B86C B/Y43
343,035,600 *2240836653ABC36AEB933D9BF1EB98E1EBED8D9D by4550c14t10n
343,035,601 *224D389A71BB84F54B0A12209A8D0C8643F53D04 BY5Dl
343,035,602 *22453591FEA6A6810C3C54DABBF310EA114A747D BY5?V
343,035,603 *22410AF7F7FB3B2A1CF0A3B6A1A342EC8B21EBC7 BY62O
343,035,604 *224E539A10FEE60CAF7C0A08D66C6E07E7277491 BY66Z
343,035,605 *224CE36B9A42F93F301AA9A0021166FFC1523DB9 B/Y69
343,035,606 *2241B0D4DC7B65D4F68D27BC4F23B6D2587AD87B B,Y6t
343,035,607 *22446BC034A73B58BF48581CC6C06FE01DFCE57D BY7X9
343,035,608 *2248550CBEA78C11C9576B5C94FD5D3DC3629BA9 B;Y82
343,035,609 *224EA2E3FB74251D004EF2A17351844902AD0250 BY89A
343,035,610 *2240DBA143F777BDED4DDF0F8F3DB8848F828519 BY8k.
343,035,611 *224BE6E5A18D419368A9513CF8B6B53D9877D806 BY8X+
343,035,612 *224961F126F18FD6BADAF8A174CCDE9824152F29 BY8Ze
343,035,613 *2240B0D02E649F6EB76C238D6EABE3493BA29F2D B""Y9
343,035,614 *224AA65272D15538571661D98D3DDD3F6A4590F9 BYA=_
343,035,615 *224888607C2CA41F8F38DA39D092500F2D2BDB5B BY/&a
343,035,616 *224BA1C7A3D6C132DDEC99DA2BA18275B173D439 B_Yag
343,035,617 *224E75F0BDE7797F86360696F42728274DF5F934 BY_ai
343,035,618 *2243C93B3695B4AF47194A8300AD095785276EBB BYANCHA
343,035,619 *224F5C5EE461B4CDE19988A79DA47BC9EB399880 BYApn
343,035,620 *224143278065DABFAED1E386979491D2AD247E42 B$YAR
343,035,621 *2247DD775DB14BEA6791AFE73516BA6A23A21554 BYAr.
343,035,622 *224DEC6F5766482B2345210335041CBD1B733354 BYaSo
343,035,623 *22408E4C569214E6B4C56850D651396C1C43737F B;-Yb
343,035,624 *224D5CB6F3C9CB338B34FF36885A3B649A122D91 B"=Yb
343,035,625 *224D527FDE9DEAF79D86A45FE5463BA96D3CA61B B$"Yb
343,035,626 *224686EB6B63998E5FE5A50C3D7C645BFA0D6AB7 BYB.4
343,035,627 *224DA7E3C9B26B13F99A8274729B30DBEA273D5E [email protected]
343,035,628 *22404EB47775C252BADCFF88B3DB8CB066D5D30F BYbLK
343,035,629 *2244505319707102AE51568C776530DAC1E40476 BYBo;
343,035,630 *224EEFE2FF514E56D614D52C4FBEBDFC7BCA7A84 BYBv=
343,035,631 *224076E1A367773565AC8402DD38EC8BBFCF1121 B&Ybw
343,035,632 *224A7749AC91E01D0376DE2034709EDE1C97115A B!Y
343,035,633 *224499CAF87E78C762715217754190B0693E0A44 bychivalry
343,035,634 *224433CBDBB38042E775C60A43343756B534A90C BY;:d
343,035,635 *224DC03D55177D2AE039215CF6FE7C2ECF0A1C70 Bydelsr
343,035,636 *2248DE366A5BB2A5173ADC42E2C05C7E76A381FB Bydlitied
343,035,637 *224E708197C85CA4C3B680D774F21689B772752D [email protected]
343,035,638 *224A2ECC4648C31CE37B5C31EBD20D23299902E8 BYdwN
343,035,639 *224B41090941192EA10465B9CBFE14705C85C2F2 bydy1
343,035,640 *2244BEA9EA2F9DE0D2EA5272457AD0876D3159F2 BYe1&
343,035,641 *224B66B4F8A5AF0315F07E89F99C26B69288C223 bye bye blues (d. bennet, c. grey, f. hamm, b. lown)
343,035,642 *2247F94418781893934484EB7E5A9B9629A20BF9 byebyejay
343,035,643 *224A21C2880527E4653F8E00ABCC1BFB7BB171FF [email protected]
343,035,644 *2248F885E7D3C43C91C5C361F2E928B513B80078 BYeHH
343,035,645 *224B5FA716C770B29EADD2DF34A0597E009997A0 B/YeL
343,035,646 *2240979C01D4C9CEF96A151D2B61E5DE629E715C [email protected]
343,035,647 *224373FE28ADD3338386F02D76C837473C20F4AD B:Yet
343,035,648 *224578E32B979E65922DE5F2DB31D7BC9B6170E8 B&Y
343,035,649 *2247519ED06A4E34B9CAEAAA5C277D9206AD6080 BYfEI
343,035,650 *22457E3D366F5B2C3F329ACDB3AF982233229FE3 byfogden
343,035,651 *2245DB20DB7D6F6892D0BA859EC2665495AFA870 BYF"s
343,035,652 *224647479BFFF3F156DB18E52C4821F5A0B9BC76 BYfSn
343,035,653 *224107436B006F881BDF4AA30E356131302D7057 BY
343,035,654 *2241EAEA7F87ABBF0E70B537A5DFA677E30FE8DD B:Y+g
343,035,655 *22413FA9B9BAA8D73D7A284943D8AFFBA4280E75 byg3l0w1g3
343,035,656 *224BF2604BFAE8080E02C3BB177F80B57CC64398 bygde
343,035,657 *224D43AA452FE4EBD4B86C09AE583ABB1ECE6763 bygg31
343,035,658 *2241F1BDF35E1A5307060CA1D3F35AD9481A861F byggeforskningsinstituttet7
343,035,659 *2243C4220AC32417E36438E80362011243F8D9F0 BYGGER8
343,035,660 *2245BBE447BE7F4907FEA412934A4C666D1E12F7 Byggjemåtar
343,035,661 *22460782FC821D692E5CF876CB795CD7E5904BEE byggmessige
343,035,662 *22416F326F95DE6D58332DC00550CF580A095A30 byggnadsskick1
343,035,663 *224573FECD0F2503BBBDAE4A4202A9876448785F Byggnadsyrkesskola
343,035,664 *224DD3FF58229E816AF3D3F582BE9458B5C50B12 BYggZ
343,035,665 *22490B85E41717C27201E514EAE59EBC69485612 BYG
343,035,666 *22462E107C6D5F4400A95FA731C69A2A79069775 BYG.o
343,035,667 *224FF4F17291C02CC9A641F79591EC627AE0D027 BYg#r
343,035,668 *224A522A0A594383E0B4EAD29745F546B150AEFC BY:gv
343,035,669 *22495252FD3E929F485D632DDE6427F3DC05BBFB BYgWI
343,035,670 *224892DAB1B4215731721F1D1E93D92EFA8FF0DA BYH"!
343,035,671 *224D5EBC7F6DA921BDBAFB9ECCF3B846EC97ADDD bYh
343,035,672 *224B4815FE3B49ABF6CF9ED98832A71AB87B0EC6 BYh9o
343,035,673 *224323253A0DAA0A301731E1F4A242FFF658609A Byhen
343,035,674 *2244C6B12937DFB057EFA083789FF556C197F65C BY
343,035,675 *224515511159266A8B6024E5D32045DF0702D826 BYhsI
343,035,676 *22475FFB844FF5C01F3B202DC661BF40CB5A770F BYH#X
343,035,677 *2240AC959A7C186F7059544D4CE80F7A1A3A58C6 BY)+I
343,035,678 *224DB469AA872390F90A23E63810CEBEE5F7D467 BYi4&
343,035,679 *224CBAC2A20B63687D11428A7BAEF84EF44DF3C9 BYiN8
343,035,680 *224B7EFC3DFB511259B87AA9727E011D89A2FEF7 [email protected]
343,035,681 *2241BD7291C3F755B80956D3EF956EF565FC8D11 BYir9
343,035,682 *224502D52BCBBD2E6859885423468F3FB2F317C8 BYj21
343,035,683 *2243853A6318978151276FA343BF1FA260C5E470 BYj7T
343,035,684 *22449384EE4AD5C220D99118187D491437AAE8F9 BY-jX
343,035,685 *2248BB78D314FED1D488488DC190E97BE94228F9 BY_)K
343,035,686 *2244EB091C447BDC5075FAA69911E0EC630E365C By;K
343,035,687 *224D9CCB45F763BBDE5BF68589F0F3FB5CDD31A1 BYKk7
343,035,688 *224B983D0D76E0C95A681166C0C8DAFE9E6FE74B byksss
343,035,689 *224D9B258480F502C0FBB712DD94356B5DC360FD BY:L+
343,035,690 *224A58FA2E066106E73CADF3CF9E4C4EE3745745 B,YlB
343,035,691 *2241FF1A60ECAE07D8BC6AC35060B93A4C382AA8 BYlCf
343,035,692 *224BA2B37A5E14FBC5B52F6F81A0784EDD1EFB10 bylejaki3
343,035,693 *2243F88249983E99084D7F1C7D9EDF3045D0C853 byllye123
343,035,694 *2247D906AAFA407FDBBA3413F8F6152B630B1F1C B%YlN
343,035,695 *224FF5C730DE4CA7BC195A0048A292328A19B523 [email protected]
343,035,696 *224785575C93DE7F02F8C5C5A1CF0F0946BD64C0 B"?YM
343,035,697 *2241E872BC80EACBC45C252616182601070A1012 BY$M7
343,035,698 *224524252F58AD6319D7D26C9F1191C672251444 B"Ymd
343,035,699 *22495250B1B45B1A7833B513A390904BE677462C [email protected]
343,035,700 *2242C85E7E9C558364FCA319B0891C0E3EFFBB8E BY"MT
343,035,701 *224A6593DA369BB0927FFCC744B2608EC9462D99 BYMtP
343,035,702 *224F7A7950C89FE629CBC96DAEB3F0952A659C34 BY/Na
343,035,703 *224B7ADF45079F4086A652F319BE46CCED441CFD BYnAP
343,035,704 *2243E520F4B3F9DA464FC116EF84A8FAC1AD2A01 BY+Nh
343,035,705 *22412390FB9F26426F9BE6B3E4A9746AFF70774A Byningse6
343,035,706 *224491454493E3B262B61BA418414BC4464F60E3 bynumii
343,035,707 *2246E18114670187E9F1690D5C5EDF2DAA0BA839 bynxgreen
343,035,708 *224554678762EAFB12AA0E2E8237C3AA141FC4B6 BY($O
343,035,709 *224587BB4DD7584C2EE455BE8F7D9961E023DF1E BY&o!
343,035,710 *2244D98573F1918FFE23EA5549A9283A4D04ED62 BY_ON
343,035,711 *2249D80000C7AA77F0822B383C59A1B7DAEC8630 by one foot
343,035,712 *2241605E1001B5C197B4D3622ABD5B1B94A80754 Byoswift7
343,035,713 *2247651B9AAB67090C0B7D308344B2DB16E87797 B-YOt
343,035,714 *224436EBECC799F722C8F52755324109EBE42BB5 B!YOX
343,035,715 *224C0F90FA0E6AF689DF673D7FDCC167DC9154F0 [email protected]
343,035,716 *22401AD50A5FC6051818536AD9BF76B9A05ED2A2 BYPAM
343,035,717 *2246D3C6325630962355C64A4E883601AEB48730 Bypassin3
343,035,718 *22473131DACE2F6076FB92704D1559391B5DF632 BYP:b
343,035,719 *224ED6742FEF717641C6872E5363616CE12ABA82 [email protected]
343,035,720 *224B81BE411F0EA958F42E93119145E1D54EDA13 [email protected]
343,035,721 *22489BA58D28F57968590BA75524639A6986771C Byplanko7
343,035,722 *22474C08C20909D452581BB47D03CF45B65EA698 BYQ4O
343,035,723 *224D23576175DA07951D44B240F80B74BC63563F BY;qC
343,035,724 *2244329E33DC3B97FC7659CA20B6BBBFD591D8EA [email protected]
343,035,725 *22409D35F4B479C8B27BF46EF692DFEA600A1A1E byqphu4b3
343,035,726 *22460D62C7342515265054729FE89616EC0F2062 byqus
343,035,727 *2243A6D520678D333C9F0FB669F4C9424C4FA71F BYqwk
343,035,728 *2247012CD754E0EA4903166326835525D7C2B7AF BYR0H
343,035,729 *2242910E3BED9D5964B0966C7965D1E2529BD248 Byrchin3
343,035,730 *224E1F7155215CBF440C05D75D7EF68BAD4358B0 byrd-innominea4no2
343,035,731 *22467F49ACB2D66F1C8FEDAD26F47C3C0672E79A Byrevened
343,035,732 *22465C13EF149D4FA003FAE417E59FEBC7ADC2FD byreward9
343,035,733 *22438CB2EC7BFB1E1C6B6E127DE3865F981615C5 BYRFn
343,035,734 *224364BC7DCDD2713028112F90D9203A834AE3E0 byrkv
343,035,735 *224E3883071ABC0E9F8C8055F3CFF802FE6DAA5F Byrners1
343,035,736 *224F495F37B3105BCEDE0415A461C79AA071E1E9 BYr,o
343,035,737 *224EE00B550DD47EA80D79DC79E3109D7448B2BA Byron225
343,035,738 *2243035BF81A128ED899E52EE5552ED0E17E434E byron.alderton
343,035,739 *22411120C934B39CAB79C3A27739E68FCC2323CD byron.aniol
343,035,740 *22406F3A15100F00A4CE11B6B356A13B580D785C byroncody
343,035,741 *224C0C696C8D2E523B7368F0880097E1A4561F35 byron.falconio
343,035,742 *2244F20E374309E1C5598646F23EEB0599DF1018 byron.giglio
343,035,743 *224712A0BD46DF6BD3BC1A6A2E53289E9E237524 byron.grisby
343,035,744 *22492DDE155593DB6BB5E23AB40E565D673DB23C byronhiggins
343,035,745 *224A70870E9DDE3EE7F5F6DCBD98B9FBF632823F byron.hofferber
343,035,746 *224753BD03D7588F248339800EE8CCF809C33E85 Byronianaed
343,035,747 *2241073D69286CC65A35029BE952B14F3487CAD4 byronist?
343,035,748 *2248088EDBA312B0BA7E0BFD17F0EC4C9A93C774 byron.mandich
343,035,749 *224D2ABCAF0657774725623F6F933920CD8FEFD2 byron.melroy
343,035,750 *224A7457827B35764A872F4B7DBBBB0892C507CE byron.oland
343,035,751 *2242F03C4B4ABF7816AE61E2832D9CABF40FE297 byron.ortea
343,035,752 *2249E3364196F24AC4DE7AA8363BCDA38BCBA5AE byron.petitt
343,035,753 *2247010D6CDCDF54F1C4FEA7F67B4AC77B402559 byron.ruggs
343,035,754 *2245E32FB0A3FBA83BD53EB8848FA2B933437A3E byron.scrape
343,035,755 *22445B6E8C8F19B16754660FF44FA6654D363A96 byron.seamon
343,035,756 *224BE68EA9E013EFE94690454AE851BCB7128E8B byron.sukovich
343,035,757 *224096056C2FB80E2C128C10C143687B010A3217 byron.teppo
343,035,758 *224F0E7F595E23684AF48E2C83746500D8199FA9 byron.woodly
343,035,759 *224C6910D0229134D55AE80CFEB70CA811C17CB4 byronyoungblood
343,035,760 *2242C1C64F2A83ED35B57160EA483D10D6FDF67A byron.zourkos
343,035,761 *224FD0557FA6EACA8A31E9DD027FC6E1481DEFB2 BYrQL
343,035,762 *2247E49A026E014298F0968B5E9B5D64422C5E15 byrrita0
343,035,763 *224238018EEA6728833DCFD119E30FC911769411 B/$Ys
343,035,764 *2242960E50B4FE2AE0837910C6EBADDA28904149 B#Y&s
343,035,765 *224521CBF2380BE63CC682EDA89D14C5E49EB1EE BYS.0
343,035,766 *224FCCF2730C7078CC4A5750467BDD6EE9AE2168 [email protected]
343,035,767 *224AEE82A8E3611287C394E1139A36E030039EC9 bysexted
343,035,768 *224D802B9B95742410946D20F6ED868176CC276D byshot
343,035,769 *224CD958A17C574B33FDBA1DEEBABD4C20363260 Byskestegebrêge
343,035,770 *22471F7AA8B41B4133511F0FA238063A73991B35 BYspB
343,035,771 *2245976140F83941D15944759191FA5BEEDDBE27 BySport
343,035,772 *22448A76B2C22C3A8307345300B43AC3128BAD15 BYSSOPHAGA
343,035,773 *2240523C6A9032BD1CE9C3B8D03E6ED9DF0EDA18 Bystatene
343,035,774 *224EA4B68DF60F47DF82B1ED638F8C0DDE368BCE BYsX8
343,035,775 *2245C597DDEC090958E618BCDFF40E64544157DF Bytandes1
343,035,776 *2244712A7B4A098F282CB443AF24D4803AF55431 Bytcha
343,035,777 *2247EFA421D003B6EB5D2A0E16A1E48BA7A1412F [email protected]
343,035,778 *224CE16BE39F616A644EB3E6E6B68039F0BC5EB8 Bytebited
343,035,779 *224C9C7334F84A119065EDD746D8745FD017BEB7 byteme1957
343,035,780 *224895DF3A5FC0AD471F98891647E51D2428C281 Bytemews
343,035,781 *22463AE95F25FE18BACBEA270DCD1A2FB0A435B9 bytetotaltruefinitetrue
343,035,782 *22406BEBEC6D653D5B7632EB3B9FFAD85D50AAB4 BY-THE-PEOPLE-FOR-THE-POWERFUL
343,035,783 *22480C63F20C758E5D4E0D234831367115D4A54A By the Sword in My Hand
343,035,784 *224FC448229106B6A6AAAFA051CCF29038860F9F BYT&j
343,035,785 *224C7D5D916BC7538E618D697924909E07A05613 BYTP?
343,035,786 *224C2AD5F06DCC121E39F2C2E9F39B04E02997AA BYTSK
343,035,787 *224728AD2BDD2B3BB7DA66523FCF49502E45C2F8 Bytsuur8
343,035,788 *224965746A50906A2DF3AAD02550821C29898580 BYtvw
343,035,789 *224F10994C2A7DDE0B24326307891C3A799521E3 BYUNG'S
343,035,790 *22489DC20F40610913C72396D0C33CE6F65DA8C2 BY(uQ
343,035,791 *2241DC1C5433985CFD51D90F79CC235A5DAD0EF7 byurself4u
343,035,792 *224A577A620CA6ED2E6B2D76E2C373E86ADA7BD1 [email protected]
343,035,793 *224CC322701CC7EAA0B6604F853BE739A7F7548E BY-V(
343,035,794 *2240B33DA1CB3C29401DBD65B57B1C236A5B9D9B BY;#V
343,035,795 *2242B25F6B60F897316DF3DBCF3D20120E9746A3 B"Yv6
343,035,796 *224CCF49DAF4328ADDDABB4C619CA6B382C35CD5 BYv6D
343,035,797 *2247A4BFCC9C7A96A2F3312754212072497FFD2B BYVDq
343,035,798 *2245066D4CE0CE2568358585DCDC333C36C8BC8B Byvince8
343,035,799 *2245311A213B2C113CF0841BA95801E0026DB16A BYvPk
343,035,800 *2242CCBB1DFC86DD44C5A6F1447BC0C50A915132 bywaterneighbors
343,035,801 *224C027234502828250B74AF6FC13EDE756D682F bywma
343,035,802 *224658456A4D78D7D36ACC30A6737BF891B08A4A BYW$W
343,035,803 *224D54A867E59D0C7688FEA0DF549B9ACDCD471B B&YX!
343,035,804 *224D141AFC47AD0D6D524B5F413FA4812D545001 BYXAq
343,035,805 *22481F7AC89142C480C59FBEBB60C5C011C50A6E BY/Xl
343,035,806 *22489281DB2D0F84360AFD59EA60B322AA9EFCE9 [email protected]
343,035,807 *2248A7B4BC779027025488A1188DDCE61638AE72 [email protected]
343,035,808 *2245FBDBE8D8B236B0914635DBD21B3F6FDE9301 [email protected]
343,035,809 *224D61C1E13CE22AEA74398240896F431B7AD908 [email protected]
343,035,810 *22455FACC0BA22ED62E5E68EACA23A0CE54F84DF Byzntjns4
343,035,811 *224084C122DD24743ED4DFF24F0C951233C541BF BYZ(O
343,035,812 *224508C4286DC9DEDEB43594EE87274091B76485 BYZt8
343,035,813 *224DA485719E3B36BA4D84870BF39EBB9CDDEC2A B;:Z:
343,035,814 *2242FE6FF7541844F3038AD3414B26DFD92BD57F B:!%Z
343,035,815 *2248DB5F8D6D051C7491A7EA8E587FCB5C428D0F B:#Z!
343,035,816 *224D890DA0C9D8B5E8A564B7520BFE7A6D1B4AE8 B?Z)?
343,035,817 *2244D80DFCE62DB6BC54B20BB839F0EC4DF731C3 B"_Z%
343,035,818 *224154E0F83E173DC42C457F34EC1D5F651A35C7 B"Z!?
343,035,819 *224FFF65EE623149E2BCE75FD805F130755361E4 B"Z/+
343,035,820 *224CD8E653126D0CD62D3FA267D49DAEE14F83D5 B)?Z$
343,035,821 *2248B4DFEAC6AF3E04EB0EC64CBEFA08A0FBEB17 B$Z=!
343,035,822 *2240CB1CC157B5E45B965E0F749F3AD4860B418A B&Z#_
343,035,823 *2249B1322B519A811E9A0F690924390236BAE2CE B%Z::
343,035,824 *224E24D6943C7A1EEA331CF9E8B87182E6065520 B%Z"#
343,035,825 *2243312B01465BA33EA714F2F2D64AB02C2B7D5C BZ!=!
343,035,826 *22497E08338184764E06056E764EAB0A039CAFF7 BZ#,,
343,035,827 *224EB91AF90FC85DA1568989C6E27DE209732E4C B
343,035,828 *224EB4827A7B61534D031B4C205FC721509F1227 BZ0%b
343,035,829 *2248BF09DBED846B24A229F22FFC1841F5C9A3D4 BZ1V)
343,035,830 *224EB3A39AE0001AACBBA2D1825991D934BDA244 B?Z+2
343,035,831 *224FE3666DB3E864A8678696E789923D6B080DD7 BZ2PC
343,035,832 *2245952DACD1A08A658BCAC0BED514110965E97B BZ38
343,035,833 *224D2532ADFEB65F69E8CE6C104CE710E8598A77 BZ3fI
343,035,834 *224B6CBE5BB7D5E3CACCDFD089FAFABA257D8C16 BZ:4j
343,035,835 *224F63DF600AEEE06839547A785E0C0A5044FF37 BZ_5)
343,035,836 *224474F10BF711715A902D2B04C87B76C2C64AB4 BZ56U
343,035,837 *2240254DACB5A1012621CD8237195277BCCC7A0A B#Z5F
343,035,838 *2242941944AC058C111206C2AE42AE86F32C2566 BZ6fr
343,035,839 *224B7BCA4E493995616B266E1E6B405B81C75D25 BZ6N"
343,035,840 *224B78DF9E9E17DA4F0EFAC6FD8429EB100D44C0 BZ6u0
343,035,841 *2244F79EE3B20F0060D807FCE0A746B44EEF4664 BZ!=7
343,035,842 *22484D494B113EB473265DE68323A2398842EF9F BZ828
343,035,843 *22464551C8B111F43EF339EBC5919724DAF170FE B
343,035,844 *224EC7C323C4539CF7069070A8C583D63AE117D0 BZ8s
343,035,845 *2244781930874ED8ED245494BA26BCD976CC2FD2 BZ9$1
343,035,846 *2242C3384AB8BFF805F46FB0336203C05B1BFFF0 B-Z9S
343,035,847 *2243ADD72FB24B979C04320CCDD8DD8836F16ACE BZ9Uc
343,035,848 *2249373C6541EF77E5BB2DCC7CA1A998FF495ED5 BZa=?
343,035,849 *224ED9E918FCAD56EF356DDE2B6B9D9E1338C481 BZA32
343,035,850 *224AD4ABEC3F68DF061146C6248FE48E83CB6783 BZAb1
343,035,851 *224461CACC9469BEC9F6E90E7268DF2B94849CCB B&ZAh
343,035,852 *224ABDA2E3886A6333D6A029332E5E5ED4B1D99D BZAMB
343,035,853 *22483A361D64F8B7330F117EB40190D5E9323261 B&ZAZ
343,035,854 *224E78291BDBA7334FCA0F5D9124800EA2FFD970 B#)ZB
343,035,855 *22425A44CE9FC252F60AF032954BCAB9EF611D16 BZb0H
343,035,856 *2244D5CC008E7474BE7E090C5FA7F3AACB753772 BZ?Bd
343,035,857 *224685B7D8F454C06F8BCCA8EB561EBF0EB993C9 BzcA
343,035,858 *224A716168A8AC50F5B74D2F209FB8A3614E371B BZCEP
343,035,859 *224117E1A560EDF81A7582AFBED64B1CC8E8876F BZ:Cg
343,035,860 *2248F5C7EEE82B8E6718CBF71642DD3FB172E5F4 BZc/I
343,035,861 *224A8C4FBC259874BA6257BCF73CBF23FA13B874 BZCLC
343,035,862 *2244B4156B958EAC183B7AA575F2ADA43DA02C1F BZc"Y
343,035,863 *2240BC7CE84E0DDBBA7CBC46D0D2E3E2667AD3BE B,?ZD
343,035,864 *2244EF0C9C2DB591F1054AC246A4B51A222F424F B"Zd
343,035,865 *22492EBF1F83AE368821A77DABEE5E8A1FADEBC0 BZd9m
343,035,866 *2248C67081DC6DE9C29457107AF89E2B9EB1D73A BZdEf
343,035,867 *224CB4C9BD96BE1F286E170A7BFCD488498EC26F BZDPF
343,035,868 *224FF85DF9452695C97DB74EC559A2E97D3D0E85 B:Zdr
343,035,869 *2240D39DCB786E35ACD19B95BE0288112EEF49DC BZe/+
343,035,870 *224ECD5BB0E660784D6762044BF1FBC7CC35D70A bzefmqq8
343,035,871 *2240E7386C9C4C9CCE458109DB17C827E27E6034 BZEHSIWCK
343,035,872 *224E54B07BD0791667BA044D4A4EA73B98453795 BZEYw
343,035,873 *224AAEBBEA73A43A37EC3A5CCE43374C1044FF7D B)ZFA
343,035,874 *224FDD396429E55E9FD858008F7C828455D7EF54 BZfhH
343,035,875 *224E80F7C7DAA1151979ADCC8564EC8DF6E30264 BZFj=
343,035,876 *224BFA6B679E68C4D8B8706F50234F635BE5CD0F BZ\G
343,035,877 *224EDC7ADA90A6CED2BEB4D535C4C5161C5F64EB BZ#.g
343,035,878 *224BA8294D55C7957319BE46830EB996AF3CAB8F B]zG
343,035,879 *224C5D9EF0E2A1B8807F89A2A8EBA9896D7CBFDF BZGC+
343,035,880 *2244CD44F028CDEEC9810C0C4F789509CDB2740E BZGFe
343,035,881 *224EBF60F00C0DC780E602BA2F39D38A41FF4CFD [email protected]
343,035,882 *224D565041E4797267DF0CDA17B873202803ADA8 BZg(w
343,035,883 *2247A7832AA2531882BF72B0AFAB824A209C0201 BZ,h=
343,035,884 *2246E86767E6A2E643A428F2D7698857781C7BD1 BZHO:
343,035,885 *2249689E9E7711A64CD2CB79BBF4500DA0D12268 B?)Zi
343,035,886 *22408233AB555DF6E483573DF9F27556A65F34D2 BZ;i:
343,035,887 *224F5E8D9B55AA4266607B58F5BCC49CDF31DDE0 BZI2u
343,035,888 *2246F010726370BE69A13ECA6633BB4B6D265024 BZI5!
343,035,889 *224FB835BEA236219F521A71BFD1580350A76133 BZiI9
343,035,890 *22403D4B3E577AC118DB5BD948DD4F33EC2ED5E0 [email protected]
343,035,891 *224798A3BF7EF65E3C627351117F5B4F06B0393E BZ_=k
343,035,892 *224DCA4664475B246A0DD72679DF1FA7F0A183EF BZk!+
343,035,893 *224259B06F7636C18885BA6B45187C20EB431240 B-ZkD
343,035,894 *22490330F16C143E352F90F8BF0C0DCC0052DB61 B:ZkF
343,035,895 *2240AE95C1199B1C1A78F07643C3F4062216D41D BZkn1
343,035,896 *22494320CBDB6CFA01BE3E06576FE94BBAA93162 BZ+Ko
343,035,897 *224982671FC7444940F35D5CBD350508A84446E8 BZ+=l
343,035,898 *2241EA574CE979A1FE6E92828B8DB5ED40D6A045 BZ%l5
343,035,899 *2248D5CDAB5CE9C534A4C337A71E9A9B2178BAAE BZLD(
343,035,900 *22459DBD73328FC4EC31C65FCED796415168F1C3 B,?ZM
343,035,901 *2243B5E7682FFEABB29DEE504ABA4A6CC4E2AF59 BZM{
343,035,902 *2243F5E2F9083662FB7B42C7630E4F48192C2DD3 BZM:a
343,035,903 *2242DF3C9CC75ECEBC01F81A0B7E27C34ACCDE68 B/ZMi
343,035,904 *2245F049E99235F8E011229ED680CE69A499C1C2 BZ/mj
343,035,905 *224BF77D825F5A24FF58061019B9568FC8C76B8F BZmv
343,035,906 *22433D3D1687087496DB083698CCEF7C12800528 BZmZ=
343,035,907 *224522376D8249E65DFCEEED283565E113AAD086 BZN$:
343,035,908 *22444B8D8EDEC58C647C4624CB89EFC2FE74C8C1 BZn13
343,035,909 *22427CDFB24A8CDF29525E161EBFB99110B52FAC BZnLF
343,035,910 *224A89C1BDFB355AC823EF4F662ADF1321BCD2D7 BZoOe
343,035,911 *2245B228A2DC9D4FE07DE875715F9AB408300523 [email protected]
343,035,912 *224837F5158A3C07CEBCC6FFC21F19CE5524E1BB BZp.A
343,035,913 *22419FC3E6BA76F5815D8FE3A51542B0A05B54B1 BZP)F
343,035,914 *2243A9A73608BBD4CD5A805B639D1A0783CB24D1 BZpqQ
343,035,915 *224B86880253C52E00661FE11652C4FD03EADA41 BZPSI
343,035,916 *224571431F9D80DA4B30AEB31C2FE74C2A86DA48 BZq
343,035,917 *22440252243E1B13B92C16E6BE9AA5783306906D BZQ1S
343,035,918 *2242B2B5EF9C001A01BACC6D7433E2AD9614594B BZq+B
343,035,919 *224445ECBC94B4D31B3830D74441B70FC53E73BC BZ$QC
343,035,920 *2242C35D9BA26400EE2C8A0DC3648AB0F2AA387B BZQhA
343,035,921 *224C4BB31EF31B581B4E6B4E27DF82504A98E9BB B#ZQt
343,035,922 *224BFF7288227C755D139C444DE7DB8F014EDF69 BZQYm
343,035,923 *2245EBD54623303FF5664AB7317921CB33E54718 B?$ZR
343,035,924 *224BEAEE37431D26B2923385C0DD1F7F0D876A47 BZ$,R
343,035,925 *224D07407D545A7278A6EBD2620BC6775E40363B BZ%R.
343,035,926 *2249F7213ECE2CE40AE1AD2166164C5D5D90FB56 B+Zr=
343,035,927 *224C5E033DE1AB1854E9F1AF2F54D85944D9AC6A BZ.;r
343,035,928 *2242104BBC35753166E2EBF24533BB198D8756A9 Bz.r
343,035,929 *22485AC5737A5C56934922D2B12BF0062F28B3F0 BZ+rD
343,035,930 *22457CB2C1E49D7CF06D96326684D57704F0EE8F BZRhU
343,035,931 *2243A4030FF09F0DE376B59177B8C42C7363AAF6 BZrpt
343,035,932 *224DAA12F08A64AADFAEBD54CA15F649106301FA BZR)q
343,035,933 *224B168429C7C0AAEED5EAF079E6CFCD64549817 BZs&&
343,035,934 *22499BC852AA616D5BB5AA0B436F2387EF5F0AD0 bzs0
343,035,935 *224E4DAB04877E764D4F437A6A618A32D617DFC6 BZs$h
343,035,936 *2249F0C3ED25140ABFCB4B0C828D96183F5D4D27 BZs=V
343,035,937 *224EE4DFC47BC15EC8BAF43122AD4EE067D78D2D BZ-:T
343,035,938 *224113B469501C960FE0B2EAFAB02C5CFFD80CB0 BZt1_
343,035,939 *224A4B9C91206F40D6F6BF34F8028FEAC0885291 BZt$Q
343,035,940 *2248CE4D8B79D5E3C68213DF0AE112B9A8D955B6 bztqg3
343,035,941 *224F2EF2738E020AB027C8A254969D3088F946CF BZ,u0
343,035,942 *224F13474A6CD929C4BCA0E4AB2444FCE03906B7 BZUSl
343,035,943 *224BB15DD939A77EB1763AD32D7EC1A5621CA839 bzuzq
343,035,944 *224B6353C0060A8A27C8F54041BCBE30EDE6BB5C BZV)!
343,035,945 *224C195C4092458346DFEB89CB9F89C99C0E9BA6 BZv!i
343,035,946 *224C992208DE6BF22785C9E9BB7556D5EA6CF5D8 B
343,035,947 *22473F4266C541E654C77B9B5A79F167E10163A9 BZw-9
343,035,948 *2242B01E5E10F66BF15C129A1A31115A128750A1 BZwD0
343,035,949 *22425946EA2BCA5EAC89FD32BCCD224BB81088DF bzwph
343,035,950 *2242EB39FC3939983D1FCD9B3E1769F3D6EBDBEF BZXhU
343,035,951 *224F2DD0559B9482C53939B04065F62AF1ED4B7B B:ZXT
343,035,952 *22403198C49FD7286B722844A58278DFFE43213D bzyid
343,035,953 *224DDE5AE7183B09367C327B015101D99E7ECB8B B;ZZ0
343,035,954 *224FFA31B3A347696003B71FC545683A4F3B6804 BZZ7W
343,035,955 *2249C58134195AC4578CD56A11920CDE4F5582C0 BZ
343,035,956 *2245B6682CD5CC1712F90D51AA6EFA1DFA7B4B5C bzzdaa
343,035,957 *224459566F7802968E61DC9B4F69101D803FA851 [email protected]
343,035,958 *224F749C18870EB1D7D260E2FE57A48BBA9E02EB [email protected]
343,035,959 *2241743B4A096BFC382CFE8164FD556C3AF5FD99 [email protected]om
343,035,960 *224881197B973FF024A000028C733C9438CFB568 [email protected]
343,035,961 *224013D84929F987515A5FB1979E4034CC13AAC3 bαρθολομαίου
343,035,962 *224E90F4C32621006ED15892059A6694F62E8AE6 bәhasına
343,035,963 *2249B85B98AEB415B20E130FAD58C1F5DB06D4DB Bを中心に様々な洋楽を取り込んだ)アーティストも現れ、「R
343,035,964 *22429D8DD418157B574DD32E614F5CE5D58319B1 のチームB候補生であった大塚亜季であると団体、個人ともに名指しで報じた。しかし、情報サイト
343,035,965 *2249614C031609BE44C275D23AF3E2BF1C25EC98 B「政治は変わらなければならない。H党首に全権力を集中させなければならない。
343,035,966 *224A7A3B20A9DE45FB3A670A49FDEB4E6444BB0D b」はディーヴァとともに時代のキー・タームとなり、多くのフォロワーや
343,035,967 *224475D16C7FD8766A1D9897B2458B393D0EC807 bを概ね好意的に受け入れた。このため吉本は円満退社だったという説がある。東京の漫才協団にすんなり加入できたのはこのため
343,035,968 *224F029040E48D65DBA46B4D455671101F0AEC69 B面『祭りのあと』
343,035,969 *22491C6169FEF7FEDB34C361338B5A8E98A6E0C4 ;)C))
343,035,970 *224EBF2ACE8A367F9BE770EC40193A81F510C6C5 [email protected]
343,035,971 *224E7AC1A0669921BEB04C7ECFDFAB4BF1006B92 C_./&
343,035,972 *2244D08BA30CA8C6DCBBDB8A7AECD5AE37B0BA70 C-=:-
343,035,973 *2243E8C9E8357541E3213F5465552A63412AB387 C-#+.
343,035,974 *224261AEED589C8CEA78BA9946A3736AD6883B2C C,-/,
343,035,975 *2244560233828E40529AD2F5A04AB5FF67EBE2DE C,-$(
343,035,976 *2244455CF949A3B35D444157F30AF6F2A56A22E8 C,.;"
343,035,977 *224A2FBE28DAB139BF9F752A936B30B591C7B4F8 C;=&&
343,035,978 *224BE47ECFFD926C335AA3C8CDE227FD2A2C6BAF C:?++
343,035,979 *224429DA561231351B5309B845D6D9145A0A6EA0 C!&;&
343,035,980 *224952C5DFDCFC26B845D21E13FDD4E5E309F208 C?,?.
343,035,981 *2246A81CC72D348BF91C295F4716F75211D753A4 C?:)
343,035,982 *22462004D33F29F292A892ED42DF792038A9CEBD C?)&)
343,035,983 *224D6E52CA4B304AF6EF008CA762EBECE70B92E3 C?+%_
343,035,984 *2248788B73200507117A3556B7461A62A96C98DD C/!%+
343,035,985 *224BE9267A2818CE8C551CDC38D3450D6ADB193E C/%!(
343,035,986 *22479C38500D36539A5B88AA63C3D4891DA8CD36 C.)$_
343,035,987 *224F79BE3918A1B7BFD7B6FD4C900BBA22B3D60D C"$$
343,035,988 *2247AF5BFA4C7795708E02168F089FF27DDA7A6B C"&_"
343,035,989 *224B7DCA827B3C7DF31533F5EFDF4D37866737B2 C"&:;
343,035,990 *224426A4607232E6D3B7A083CD7AA157A0E6F59D C(??-
343,035,991 *22473C2D9F2F52A77F8A584ED59B91DBE8A270DB C(?+"
343,035,992 *22457C9446F0CC37A9779CB4845DFF759CD269B6 C)"?$
343,035,993 *224F76BE854DE640E24F41E4DA07DE7A6AB59D9D C)&:%
343,035,994 *2248C1E515A741598F80F05F0CA8D97D57F5B0AD C]=^
343,035,995 *224AE94111CC65D9FF7D9C693901177E94752EE0 C{>_
343,035,996 *224C1E13BDD2A449014BA99653EA719147675D99 C{}}
343,035,997 *224E0D82013144F577AA210D98A5E7D1C6FC8F6B C});
343,035,998 *2247AF4332C0EF0C458786E37DE93E5F45B247FC C$&(.
343,035,999 *2245B5617D7EB6AAD9B8F3AC0C0A083768A69B83 C*=*
343,036,000 *2244D4A54439007583119BBCE80E34A79673098D C*"|
343,036,001 *224A12FFE42ED8E569565592E6A1262A0C5AA64D C\->
343,036,002 *22460D09E42ACDAD768C4E94A4401AFC01E55BD6 C&:+!
343,036,003 *22407E3EB6799B00DAFDFEC9998C6B4084C575EA C&!$_
343,036,004 *224E1C512610E55503323D7D630267566F6A63FE C&./=
343,036,005 *2245C0B6B885016F2FF3EF98BB11BB4061E1028E C&)\
343,036,006 *2243C8788C0DCB117D732A125C83B0290C56857A C#;#%
343,036,007 *224E80EDF17DEDA51A5E8FBB41685B9F18BF03BB C%:;!
343,036,008 *2240CD84F8683E54A2D3B314A7C8C04CDC8AE271 C%?_;
343,036,009 *2243C9392362DFB8FFFAACF1F37B43F615E985F9 C%&%
343,036,010 *2247F316F0F1FE16D8BF05D786DCD27B50634672 C
343,036,011 *224B0FD6418A27F5E0DCCF34213A6DBC41B03671 C
343,036,012 *22429E0C8CA26BA8C6651561D4EAA73EBBB3630D C
343,036,013 *22492989711C97758C2ECF663EF4F0B91C3DE4D0 <\c
343,036,014 *224922DE8834AAEF974CC642372C861AC0B13684 c-*<
343,036,015 *224F54EB803F70A034A0FA4A63CA8CF1080199FF c.~-
343,036,016 *224B209A26B886E3D483B1D6F466FA0E63D4C755 c(_,
343,036,017 *2247D359647AF17FBA198380A75B155218D3CA7F c$?}
343,036,018 *22470657971CF503C831B302A4F7C382E55243C2 ƈ
343,036,019 *2242740789895D7972C9F7FD81B5717EA9B4255D C~?0
343,036,020 *224FF7713520D66A543A1D385A80029D401D95BE C!0-
343,036,021 *2244535BB911EFC35C4AA1B43D173659ACF8F637 C!0&!
343,036,022 *2240BD1A11B40CCA37CC880BF0EB3F689609DC7C C/0(:
343,036,023 *22464FEDAB74D92BDE164AD6ACA73912E7BD6639 C";0%
343,036,024 *22462B60C06E4EC3087DF2D1F119C12A343F8280 C+_0&
343,036,025 *2249519D926D5198C00E7173EC32E9276FB2CF1F C0=_+
343,036,026 *2248C5197D339F14DE884C5440E2DEA2BD9E4D5E C0_;!
343,036,027 *22469418325B98377B370FB543FF8B8025484407 C0./!
343,036,028 *2247D220C1648F9BE4F9541CE7DB61863C4FAD59 C0+$%
343,036,029 *224EEFF3A0C1451CBF878D6473817F3C47D69E5E C000020578
343,036,030 *22419F149CA1A34FD2B57282B8229C885F9F3AB2 C00EM
343,036,031 *224A958BA41D5E4FCFB5A74D14EB08802E8B8A3C C0:0L
343,036,032 *2240A91881B90CE17B387BE4DF15F393F9CAF81B C
343,036,033 *224BBD28C1C6E6134B0A871AC98EB98D34ED3C37 c010937c
343,036,034 *22421A23012502DF4CE3EC3EBAB80A91A9CAF898 C010n1z4710n157
343,036,035 *224116C4CA989558740B94DC8DCE79C94C562A5D C010N!A1!ST
343,036,036 *224EC58A57620E5934BE458D78FCC52E7BD26E94 C011a80ra+10n1s+
343,036,037 *224474361BAF9E99ADEBE6EB89ECDE5B95BCC952 C011yw0bb
343,036,038 *22405AE37E8463DA674994E9F510F8D39AF6D64C C01aerne$
343,036,039 *224348B2442DD780F2A63E7A3A99A2E38AA3095D c01ar0n0
343,036,040 *2249FDA20D9DEFA26620F455BE2C45712C3470A5 c01c34rv05
343,036,041 *224B48FA04FB692E84B2F68119FCD791DF330A41 c01da58
343,036,042 *224E4DE7ABB85AC2960BDFCBFD0047CC9CFCFB93 C01#g
343,036,043 *2249B606D5FE36FF1152C751DCB8C2093A3CE1FD c01ibact3
343,036,044 *224019C6D9BDD2BFA78D69D237C9B2EB1F3A2EA9 c01nm4k3r
343,036,045 *2241C0A8CDB21E34EE8261CD9DF49F64E518F310 [email protected]
343,036,046 *224D8A98447D69D5A0F421BEE24FC676182DA56B C0$1Z
343,036,047 *224067A704AA759AC4A798DD4972E9221744C0D8 c020304
343,036,048 *2240B1FBEEC858023A1C12B65C58C737AD8DAA05 C02#8
343,036,049 *2242D98BC9DB2D59847B2FD9783BD8FD04B671B4 C02=s
343,036,050 *224E4F5E98594DFF95E7BAAB6B3A772EB3325BE7 c035769
343,036,051 *22481FA6242083557CF61C880016CACDC3566458 [email protected]+10n
343,036,052 *224379E11326CF60DB4C11FD2B59A08C2F95D69D C03ED
343,036,053 *224A5A6C2CCC1344C48755614534171414A3289E C03ff1c13n75
343,036,054 *22461B421607BF76C03DBC5983E10015415754D2 C0.3Q
343,036,055 *22429ADE8376BF38F9400238D627514FF0574F59 C?04:
343,036,056 *224EF6B143BAA8C99434A5420FB3E4AF92CAD8E1 C04%
343,036,057 *224AD1CA3442834B76570F885904C86170C41ECA c0=4
343,036,058 *2246DBADC90920AE41B84FBB6D8114DF38F1F864 c0-4
343,036,059 *2243BE8441A668B6FDAE0322986D7B7037530281 C04+9
343,036,060 *2245D28A302B8A56D7ACA93E934D662B479D5AAF c04de1e9
343,036,061 *224D93C52E721535E000C3531E592B2F7E31CAF0 C04hN
343,036,062 *224DEBC31EE2E0D816901C8228C9944808B7757D C0?4P
343,036,063 *2248518EB74800A40987BC30705D44E55AD3179B C04ti$
343,036,064 *2243E69E93780F4FDDEA1726A2756B1952AD3A60 C04TU
343,036,065 *224C7779A1A86168A309B480641944DBFFF0D34E C05K8
343,036,066 *224B9DB1AA3979BDF97B81C0EC39FFE0AC726677 C0+68
343,036,067 *2242FDD7786F12C31F8DA3468DC0619FC15A49E5 C06k6
343,036,068 *22437E067E3FBC5881324AFEDFE0415BE1A4A92B C&07-
343,036,069 *2244C89AA2E258B67FCBCEA1B04444D2603A929C C?074
343,036,070 *224F75E0367DB6BA1DEAB62ED97EBB68F5CECD5C C_07T
343,036,071 *224DB159713A00BFB167ADFADCF36117351A8527 レファレンスコード:c08030499200
343,036,072 *224993DB082599B7D66E91D5ED78FD0F9779B140 C08$1
343,036,073 *2244856F67B548C56510FE9E24C0553B65160F65 C
343,036,074 *224B93113BB1DFFCC76DEF568347A519CB8560DE C08?a
343,036,075 *2242F688B3D9FE592CFA916BB159C462A3D803C0 [email protected]$
343,036,076 *224739B3862DF63FD1587C23C755B0EB042D86A0 C08uq
343,036,077 *224F0E3E905300CF7B5F975A924D74124DD19037 c0997
343,036,078 *224B4A7E77D5692B74CDC8F02F7E47200D706006 C09n154b1e
343,036,079 *224B316AF9BC6DA99DB40C5BFB3115B35D131D9D C0:A&
343,036,080 *224139F97BDC1FA611A049E27C7187740296C7CD C0aBY
343,036,081 *2246B184B58027EFDC8E973557FDA3D26368C64E C0aMH
343,036,082 *224FDA36374FFDFA307979B52866B0F1D6A88FA9 C0APv
343,036,083 *22433F069EA0BA4E8A439B4FEACCE28D25BCA8A5 C0A$S
343,036,084 *224853B24CDFFBD5E1A71B7CD92AD9021E91262F C0ast3r b
343,036,085 *22472ED71DF5E12C724EF8DFFD04457C8F89E2AD C0B$(
343,036,086 *224B41C209AB8632E161B173102C951BB166BCED C(0b7
343,036,087 *22452BB880E4694D6154583FEB5BC16E3CBF48BA c0bbb082
343,036,088 *224FCF350BF873C83DB989A88F99F5EE17FD4D8C C0B"D
343,036,089 *224F26DFFA9A20EA5C05A9B3E2DC3CFB7EF0964D C0bF+
343,036,090 *2240DACCBBA72762CEDA5BFA8911DA761741AF57 C0b_k
343,036,091 *224319EA3A8CDADA9F2E0AB10955EDC15A651E3F C0BnD
343,036,092 *224085ABBAB0F210E8057B0CA7534F38E0CD9B44 C0$_c
343,036,093 *224DDDE725CC39016F667A367D61B9B4EDAA0C85 C0C0ANU+S
343,036,094 *224A2977DA61B8DB9585190D4DA8EB1FAF07E91F c0cb0214-4751-3b2f-8d54-1ef4696e75b6
343,036,095 *2248A6E98295A93C0ADA360E3D2E2514B81626DF C0cc0$te4
343,036,096 *224A48E9201BC5D6BD3C53AA4A12BDF835FA3FB1 [email protected]
343,036,097 *22474500E980AD82F6FF2589E3D7095C76F68DA8 [email protected]
343,036,098 *2249C0B9834FA75CF28FC2D1B97770F6D20BC4F5 C0C
343,036,099 *224D50EC7AEADCAE3A9FA91064C43A46945DF17F C0c!r
343,036,100 *2247D7D487DDB902E3540A00A26404E6399E684C C0Do,
343,036,101 *22434C8FD31F981536E85092E8C7978BF3AD7271 C0DPj
343,036,102 *2240FF359D80E758C1377BD14C624EDA7DF1F14D C0dPk
343,036,103 *22473CF1AB4A3B722B4FC1EB1A1FF8D3EA0CE993 C0Dqo
343,036,104 *224872DFE032D7C3F54607BECDFC99325A039F39 C0Du
343,036,105 *224EE663C47B6343E5EEF6CD8725DCE8616C5F96 C0dY-
343,036,106 *22453E60F3338A05B3B660136F656ABE4C866982 C(/0e
343,036,107 *224A98A0F523F049354D89C683A825E52C20DA86 c0e7anei7y
343,036,108 *224F24DA9873F9F16E82752764076B9707FA65AB C0Eh$
343,036,109 *224C751AE0108D60EE93C5D614FF2E067293404C C0-EQ
343,036,110 *224C0E287C858EABCEC0B0CF93BF6C2FC5287A01 C0eqq
343,036,111 *22403CE059CEB635BF472E8FA9DC9DB869AE9E36 C0Ev
343,036,112 *224C1AA2BCAD7CA65A99EC651ACF871EF69295E1 C?0f5
343,036,113 *224237007D7C0D97680B82E0E088AF35C27B0367 C0Fie
343,036,114 *224B0E30523ACAF8C2EE696F6443A319EF4A89B5 C0:FN
343,036,115 *2245F8D32683068C5FCD3287C9CB8B6177B4EEEA C0Fv:
343,036,116 *224B73577DBC8644DDB820EBCBCDE3E50EBB65FC C0/G$
343,036,117 *224EE81A887C2F33D7F1D384C3D21058E3CB90F5 C0'g
343,036,118 *22438102DB0CAD697CAAB11997AF4EE5897B7031 C0gD+
343,036,119 *224C23DE10668C6A9484A3AFC85C6851EC6CE4B0 C0gp/
343,036,120 *2244A6F20C2A9DB97FEFFADA457E8DA446EAD042 C0gZ0
343,036,121 *22491601600B1931CB690FDD5840394776CD75EF C0)#H
343,036,122 *2245176A6EB46152653831FD9C6EB0BE66CC0FC9 C0H1#
343,036,123 *224A344912750563AAF2A99BE4D4427789B13CDF C0HfA
343,036,124 *2248A692A8AFABB724FB0D2AB59916D51D0B59B6 C0hFh
343,036,125 *224BE70625B0BBBD5862CC294272026BF169A943 c0Hh
343,036,126 *22425A91AE294A960E4D1A0D66B7CAFFFD1E9E37 C0:_i
343,036,127 *224A4EA10F707A6FC71F402C1BA2DBF4ADDA8ADF C0&ia
343,036,128 *22469F0E75EC1547E7F96B1C36626508B06118A3 C0IH#
343,036,129 *224572078323A20B888B3370D98E18A850A61D50 C"0IO
343,036,130 *224BDF98AD40740A866FCCCD240A0180B3287FF7 C0ipe
343,036,131 *224DEF909F840E6C55F97C6907FDBC9EEF1DA54D C&0iq
343,036,132 *2242EB61B1FF746B67D3B2BF665D831A9AF25C99 c0iz
343,036,133 *2246D5974D58D34941960C58268A9924D1C077EC C0jL6
343,036,134 *224C3C0811B8C562B2414EEF60281741FD0BCE9F C0K#7
343,036,135 *224C33946C07749F90AF33D764B00FD25C41CBC3 C"0KM
343,036,136 *224C961A599C67B1028F06B8FCF46E6BCE2B8F9B C=0l)
343,036,137 *2243E53D00854DA407AA2316B3FED2EED89AA9D2 C0l&-
343,036,138 *224099DEF336A1ACEE993E6C2E070EADEAE6A321 C0l0n14l15+5
343,036,139 *224D6CB918AD99DA0C7B5771978CFCD44260D5D7 c0l30ph0rida3
343,036,140 *2245F96B53C2B87B6AD94580829C7D6B1E8F4086 C0LDu
343,036,141 *224112EE31362C8C4917B08CA714AFB17309B0CD C%0LK
343,036,142 *2243609A7E9F7D52B586A92D68B2F6605C42BEEE c0ll3ct1v350ul
343,036,143 *224D4355FA6D41113B2F55BD3B402174C13514D6 c0ll3ct3r41
343,036,144 *224A881959C98EDEBBC944A918A9427B8A2CFA10 c0ll4psibiliy
343,036,145 *224799BE8F82E780903B14668F8AD517F8999450 [email protected]@+i0n5
343,036,146 *224F680F85EE84EFCCFF6301775921C847A5C8D9 [email protected]
343,036,147 *224144C87524571AD6916D55A0F562EA29C1B94C [email protected]!7$
343,036,148 *2240F0B2F610282E38B75D4CB42D5CFC5666982C C0l
343,036,149 *224BD4481D5584CD9E02C3CF9092A24714218336 C0Lwt
343,036,150 *224F22F58552DBE60CFC3B072ADD668F5A67C0F2 C_0M
343,036,151 *224A712FAB09C1E1E35DB23E203CA395DA929F72 c0m3ntl4
343,036,152 *224414AE1F65400D47288B501F3B8AFCEC872454 C/0m7
343,036,153 *22425D4517CA539640B8BEC6E25241D52C0F51D9 C0MB4++!NG
343,036,154 *224133F153E17D792ACAF7C7A92AAB2459B63E8A C0mbu$tiv3ly
343,036,155 *224B8D5FD34E8E5553E31A2C582EF61D894C389B C0m,G
343,036,156 *224C74E7314EFA936D35CBFDB7523572E90136A9 C/0MM
343,036,157 *2249744BF820E6D0570B182AD9A1C7FA40C43417 [email protected]
343,036,158 *224294998DCBC3A1ECE10EAF6DCAEE948332D447 C0mmend!n9
343,036,159 *224A8771ACE32B2B56C23B3E66006FA92F0F270D C0mmerc!4l!z47!0n
343,036,160 *2249E92A1A3FED6EF5B6A8D84DA5A4E1C0487C18 c0mmixe
343,036,161 *2248D4871BAE908FCF8BC5F2C9A9C6E9413D645E C0MMU747IVE1Y
343,036,162 *224EC75FB46A4234EB9536C8D93987E0835DB74A C0MP0R+!N9
343,036,163 *2244A9CD106EC0B35E8DB81FC9859B1EB5ECC3D5 C0MP11CA710N$
343,036,164 *224569F7969B32303D3C090CBBB7066D8C6679D9 c0mp1i4n7
343,036,165 *2245E1438235A356A11CF5D4D607E630F20631B1 c0mp1l4v4
343,036,166 *2240B40AC92E11E17A295DCB8662AB0B2290B325 c0mp4dr4r14m
343,036,167 *224AD7F9118FB5A328AB821672E8D483230E848B C0mp4tri0
343,036,168 *22496C12B8D1B415CE06A2119A711160A2ECA56C c0mpaque
343,036,169 *2246ACE35C5965D1BFB23104C7D038D8DDE3BFD2 C0mpen$4t!0n$
343,036,170 *224C1015BA63F14C0ED8FACC06ABC8C857AE6ABB C0mpen5at10n5
343,036,171 *22433407015532395F293C926E341C7B2A04EFA6 C0mpil48l3
343,036,172 *2246D791BD36031EE7CEAF2895838C6C59676867 C0mplexi7ie$
343,036,173 *22492EE4CDA1EDE5E47EF207A9D61E6B0A03274D c0mplici7i3
343,036,174 *22473DE710DCB5E74834597C87E024ADA25C96BC C0Muq
343,036,175 *22460986A8C8E2AE78528FD22946AB3B6B50C91F C0M/w
343,036,176 *22449BFBB7CD0CCD5FF478D7D1B86DF52137A472 C0-N,
343,036,177 *224ED1E14D2B750387CEACC123298372F426B414 [email protected]
343,036,178 *224C90C1E1C5C27ED2F87A12475E048DC03C5196 C0n$3cr4t
343,036,179 *2246C220C57C1F9A008FE9AE7F74B45F9C3DC8A2 C0)N4
343,036,180 *224B24F820A22FAAE275734663ADAFF41B98A182 c0n50d1n3
343,036,181 *22401D535C6EBE6A294E8A330C162ED32C6BF00C C0n5anguini7y
343,036,182 *224ECDE5A5DDBFF4EE1A34075178E2E469A2BBEC C0N5ECRA+!N9
343,036,183 *2241D6E51B0CC55330C50678830C15B45B8DAC33 C0N5IGNEE5
343,036,184 *224D438FAE61052FBAB1453B93E2FFC1511BEDE0 c0n5t3rn4d0r35
343,036,185 *22443C92686E3E7C8EF0AAB68B5FC9A9B23B4AD4 c0n6357ib13
343,036,186 *224624133758F13E871AEE0EDAA8F05CBE03612C C0n7r0v3r5!35
343,036,187 *224146CCB52156C6D8EAD57D7B4C240D5C94BFFC C0N93N1411Y
343,036,188 *22408F12478C8B2523D37CF5C6005D9CF2F6581E C0n9e4lment
343,036,189 *224BAF13B327DE3BC8BBA9ECB5D26EC4573BECAC C0n9l0m3r4t3d
343,036,190 *224B23462983581E0A49D8D230FB5BF0667EBA91 C0n9r39a+!0n5
343,036,191 *22467D198DD0FDCF42E30D87D4CD60A2679A5C0E [email protected]@ted
343,036,192 *22444E79650FF65B861200A3A721AD5F31B08AAA [email protected]
343,036,193 *22496B9B969CCCBD8870B7657A4ACF0CC8283C04 C0nc3r+1n4s
343,036,194 *224C6D2EEC1F1DB8BCE9174066036CAEE88B50CC C0nce1ebr47!0n
343,036,195 *2248AE987FBCE59ABC0A9FC219AA2F49F0BE8EFA [email protected]@TI0N5
343,036,196 *2245C27361F66564DE41AE26E14A5A01A8E802F3 c0ncub1n4r5
343,036,197 *224E53825D60DE1E82A4789C446E077604967ADC C0n&E
343,036,198 *224D89AB23F1590D960ED258D8987CC7B814A3CF c0n+emp0raneamen+e
343,036,199 *224162D87041999A2780DA4BC90A8FA61937DC7C C0n+empl4+0r
343,036,200 *22416845E52A573E03472D7E3D825373BAF1A4F1 C0N;f
343,036,201 *2249AA2A1A89A6F8D157D3949DC319C1F19553DA C0NF0RMA7!0NA1
343,036,202 *224E98887EC96A47B3FD022D1DF66CFE4C584AF8 c0nf146124n7
343,036,203 *22454B182732B929E590F3F97E28B093AD00FB2A C0NF1!CTS
343,036,204 *2242C1DB9AC6FF82CCCE675B9A705E01FFB24F21 C0NF1SC4TES
343,036,205 *2240E00E2600DF84C03613D1DC0E1BFE5795D6C6 C0nfe$$!0n4l$
343,036,206 *2241E4BFED516E895D78395616DAC0965F237B08 [email protected]
343,036,207 *2247BE27A47F2AD4A8D97055B1D878A76EEC4C93 C0NFID3NTI4LN3SS
343,036,208 *22449A60290B50246A910012CBAB4710F56A0094 C0nfut35
343,036,209 *22482A2C71EAF1FA0DDFB0DF70D054AED8566862 C0NG10M3RA7!0N5
343,036,210 *224243E13932CF5FAACC9B2DB5AB588F4CFEB616 C0ngra7ula7!ng
343,036,211 *22491C3E4A477F067A7C220081BD093C51B11D7F c0ni7u7i0n41
343,036,212 *224D2519DC162F90B380F41D10810B159D3560D6 c0nj3ctur553m05
343,036,213 *22430580FC46A58B6748CAF059134C7EDD32E585 C0NJUNC7IV35
343,036,214 *224B3BC6DDEF149F3395D8DD7CA35C913EDC88D5 C0nn+
343,036,215 *2248543183421B69CF7280480FFB518CEEDEE6EF C0NNER
343,036,216 *2240CE831676260C7AE2A18B4AB1B6D10D55391A c0np3ctu3
343,036,217 *2249BA5ACF314520971A15DE178C396056129139 [email protected]
343,036,218 *224A959C8F903A0A7EA9D7A7F5DB8AE2D166781B C0ns!d3rs
343,036,219 *22436399C96A6B2A0C8757604D50E588BB02EFEC [email protected]
343,036,220 *224844E16B06C0DC0BA5654092D0CE2FA62CCC09 C0nsecra+10n
343,036,221 *2243C5F684701ACF2C8E867364512B70DB60A16C [email protected]
343,036,222 *2248030E7362B3FB54720EED8AA6606D9F189761 C0N$T1TUT10N$
343,036,223 *22430F387A8586B280BA0E337A3E67EC2700C738 c0nt4ct3r45
343,036,224 *224315311934426131C291EEC4876FD283B99409 [email protected]@R!E$
343,036,225 *224840D9BABF2C26C45F84D34F3B14A1E9908FA0 C0NTESSA
343,036,226 *224750B3661646C97F9EC5D19FD78F25C093A9D7 C0NT!NU05
343,036,227 *224100D34C42DB44B162155F374387478B8D6A89 c0ntr15tr4m05
343,036,228 *224D063547DBA7F46E67005D05AD60D31CB8DAA4 C0NTR4D1CT10N$
343,036,229 *224F4FACD69353F0762C89AF15407074102FADA9 C0ntra ba
343,036,230 *224D7FD7B164C8A6E66FBF3966CE17F08D5897D8 C0NTRAD!CT!V3LY
343,036,231 *2249AC643E8F0611B33E6F9DCD8A50A53415ABB8 C0ntradicted
343,036,232 *22497B99ED95AF508BD580E627236FD89D9BE24B C0ntume1!es
343,036,233 *2240DF3D1104FC6C5E655D4A73BDB46E6BCB9CBA C0nUn
343,036,234 *224564E38CC3F8237FBFF1A9EC070AC7829F23AF c0nv3r5410n41
343,036,235 *22466B3025B866F3ED79192E92FCFC72C8D3E183 C0NVENT!NG
343,036,236 *2248571CFD2705BE5008A4155A62DCE00B028D05 [email protected]+10N5
343,036,237 *2249752D893D904EEC31F20768D5D6BAEEA75429 c0nvertingne$$
343,036,238 *22469080507C0561543AFAC62F995B70575BD13A C,:0O
343,036,239 *224016772E0F9F6E17EE15D57D1064B98AABB493 C0+O-
343,036,240 *2241CE7D0E00CE9A0D9FCEA2E22703644CA9A3F0 C0&p#
343,036,241 *2241E6F7EBB8FEFC97B8188B06ABBD931C951D18 C0P9Z
343,036,242 *2240F7129283BC51971A44ADC1C4DBBA6BC8F4EE C0P
343,036,243 *224C2C7A65341DCB035505C4278E98B9626263F0 C0ping
343,036,244 *224C073408E7FFE0E307DBB36E04A81DFF7B16C7 C0PP4
343,036,245 *224F1A57C44D8A8A35EE898704E32CAE8FBF329F C;0Ps
343,036,246 *2244A39835D46F37E55CB76C5E0BA944D6914443 C0pu2
343,036,247 *22443376CA21C71D504FE1D65083F182F0CB777C C%+0q
343,036,248 *22446D907B4C04B8488E8B5A45ED7D2C12BF6B2C C0q,!
343,036,249 *2248C8459C34D7A8E602A507AB1A41A454C7418D C0q8N
343,036,250 *2245B7ADED7DDC4527D90E5F7A4F8605740F5862 C0qpL
343,036,251 *2248F9A80721B674D6056EB07D48ED7F3C62C768 C0qQ1
343,036,252 *224710E78209A954986CEFB3F8C77063281436CE C0QS3
343,036,253 *22456C284C3FE74C0262128144FC8486AD7A4EB3 C&0r:
343,036,254 *2241FA86DFBBD76A8F898786D10487E4D8EFAEB1 C0R0C
343,036,255 *224127C7AD9C0C7034870E300C5DE64D1D820FCE C0R1)
343,036,256 *224AD940AE91EA8CE4E1CA7CFFEFFA646A4C77BA c0r1nutz4dum1tru
343,036,257 *22466AB26470603FEE0E0E8756AA3EA6C6D0F4EF C0R314TING
343,036,258 *224810DE7ADF3345DA00F0DB9E24495438ECB7E2 C0r$age$
343,036,259 *2246A58AB18F6EB9F1441299229F6D36337E9BAF c0razzavi
343,036,260 *22402E516B69BC6CF327DB26B2FAF7475BB2293F C0r%M
343,036,261 *224F304840FCEBC8C84FE7EBD3FBE9F4B6EEED29 C0RNB4LLS
343,036,262 *22409CE456C811CF18A8EB3DF09ED2ED4DEA9366 c0rny
343,036,263 *224DADCE96723A537473387CD2FC87036EEEB046 [email protected]!v3ly
343,036,264 *224BF00668EB8A54FF395699276ACF4306E367B8 c0rr0b0r4r
343,036,265 *224E4EC6C62C37D1A178E62141339120DF730F66 C0rRq
343,036,266 *224EC39D1B193B134F0F8BB4F0165135ED7FB820 C0ru$ca+10n$
343,036,267 *224737EB11FAC7BEFF41805CCC23F7C226857E6F C0ryda1i$
343,036,268 *224B342945D117CFDDECA997FD1B0EE896C3A795 C0,S.
343,036,269 *224811C611C9A72938FD48B5576D67DB4C061DA8 C0
343,036,270 *22464B92E7A346D716DB7FF5A2DFD790E8315268 C0SBH
343,036,271 *224204443E39D06C9622F09000DB9BEA8707B36F C0(sO
343,036,272 *2243E8225BF504354E75BA28B8939A05D5BD19B1 C"0sW
343,036,273 *2247CF5179B870EC70ACA693B13080046AC76E61 c0t0v3l0u
343,036,274 *22475D90CF68ED5EA00276DB86DF3CEB88570D73 C0&t5
343,036,275 *224853F5A6D49C76AF4B8AF351EEFE36B5CDFD85 C0t9;
343,036,276 *224E35E8EABCE4C900B8D45EAE853AE474D31F22 C0t/c
343,036,277 *224B6626D4C9A5BE461DB2396206676BB8B0BE66 C;0Tj
343,036,278 *2243D994CD8FB7D1983F6ED77CA96E6652B82DF9 C0u+;
343,036,279 *2245E1AE499F91E50717FA9442356E61D339F126 C!0Uc
343,036,280 *22497D026452FB3C0B59100E3E247D82CBC13486 C0ulg
343,036,281 *2248765906194D06940466B60C30D3DE92BCA21F C0un+3rf31+5
343,036,282 *224F12044A28E643B6022CB408202D203007E3CD c0un7312574mp
343,036,283 *224C3EFC75FABCE5976B8DB6B63C29975D1C38C7 C0un73rv4!l3d
343,036,284 *2240ED7FE1EA651AAE4D94D2AB98796C22C721BE c0unt3rt3n0r3
343,036,285 *22403AA08B813B6D3C5CAA85ECA19337932A8260 c0urg34u
343,036,286 *224CC03B689154EDB244874ECAF89A256D8FEDDA C0V!%
343,036,287 *22429DE529230963525AA8DF1AA9D64E0FA1022E C0_v-
343,036,288 *224BAAC6770C97E7057197C5621FF9ADECBD5D2E C0valence5
343,036,289 *224F4858C749181CE6FEB02EEC8549BC0809B021 C0vDL
343,036,290 *224D5719C483EC9B106CE5F90C616D5349F55C44 c0ver1ess
343,036,291 *22445D87EBCFD8E0105873AC5138C48862763661 C0verlet
343,036,292 *224E5B03BD4B3630404C738451F6592D28A88100 C0vfZ
343,036,293 *22428EAEB98170BEE3F233995E0F2CAD8FA5B5C7 C0vg6
343,036,294 *224F677B052DFA43A8786A0749CE545AF4C3D6EC C&-0W
343,036,295 *2245495D38A140C659FA41E89797806C79C967F6 C(0w=
343,036,296 *22464F3C4A5AF84A21ADAA1DF7BC24F6DA06BA90 C0w8Q
343,036,297 *224D4886CA4877164A83758B9B77AB132E3D9447 C0we%
343,036,298 *224850D37A27C4D6FD6D0E4E0C252D987A02CF8B C0Ws#
343,036,299 *224AD5F363A3160F406B026EF22339A827F55B31 C0WY/
343,036,300 *224366ABECFEC68A78F955436AA3171D253434A4 C0#X#
343,036,301 *2244E0B19BAF91A9C6563016ED61DD53F76EDA05 C0(Xl
343,036,302 *2248E29065D695A67B76EFEAC81DF83FF63C83D0 C0XUI
343,036,303 *22461C2A28228DB48501C226E08D66758EE3DF1A C!(0Y
343,036,304 *224E6F8146F2028571275C721BD47E7C2F25FA0C C0YGq
343,036,305 *22483B1B790E98E896996436DACC9039FA64BD86 C0Yra
343,036,306 *22473BA6BBFD880B1C722E9F69B4EC2B14347E6D C0Yv+
343,036,307 *2241C96BBE1433FFFF9FDA4152641189AC937329 C0YZ-
343,036,308 *2242CAD476372CA5632C1D4A91D8E079FFC42F33 C0Zl_
343,036,309 *22464BF281091A2699E41A841243EB2FC96D5882 C%0Zo
343,036,310 *22435504D90A4F5167956AFA0C6A559E13C7FB4B C=:1)
343,036,311 *224D28BA4F553DE9A30630B08B72FF661FB7C221 C;"$1
343,036,312 *22484203D6448A231E9DC0F590A0F773E0416EEE C:1%$
343,036,313 *2246AAB73A31EA9EF0C8EF4512EF6EB720A03ACB C?/1-
343,036,314 *224983A3C9D40E3B0C4B0CA08D6A41EBE6F5EC73 C?1?"
343,036,315 *22479796B309BA5654E12997C6AC44986A1169F9 C$.
343,036,316 *224EE41508980A98A78ABEB514B819BBF2500312 C
343,036,317 *224C5BE1F8B1CB4A5157E5878F951BBBA0BBF579 C
343,036,318 *224473DDB059788A767FB7EC8BEF0AC434FCC89D C1#;;
343,036,319 *224035DE65CD87355A67A4DFBA14DE6CFFB6B13D [email protected]\
343,036,320 *224F440496F995DAC6C9B27F64F0A297E1899EE4 c10101983
343,036,321 *224003E94BF9436103D6BCEAECB3071E8E155711 c101730
343,036,322 *2243DBE84B4DB16504A4E5DF04AB4B4CBB7C4D0D c.10321103
343,036,323 *22492F753F77AAD68D94E887D667F161676F06A7 c104111
343,036,324 *224776F6A65779FFA676713184710423F5EE4DC4 c10a12
343,036,325 *2245363380B9418137D689C3307ADAB44BE025E6 c10b765f
343,036,326 *224A0F5067E4B96D868F22DF7E82F2B2648CDCE7 C10c3n
343,036,327 *224840B7089197E0CCAD56BBDD23369FE0BE5C40 C10H7N3O
343,036,328 *22471771C57C3278DAAA294F4F9E68A4077D8D5E C10udsc4p
343,036,329 *22406F77222F1F6AE6A709AE4A556E97089D6663 C10wner1es
343,036,330 *2240CAC739EFC6DD37F6FE55BB36CE39E76723CC C+1!1
343,036,331 *224761FF60BD64B9EC3EAA65922586829230A815 C1%#1
343,036,332 *224E729104BE347E2E1468C362F94FAD362B6709  C110型(ケンメリ)(1977)
343,036,333 *2242F49395301439FB8FD06F348DD0C5E9C393E1 c119827
343,036,334 *2245C882309118DE546611814ED9FFE8FB7B3EB1 c119870
343,036,335 *224F798B2EAFC5D047FA815F041987A5BEB5398B C11MAT0TH3RAP13$
343,036,336 *224E3A16E5532F32943BFFC05E2353D80A495EE1 C:12:
343,036,337 *2247AFA481B5D6239E5A6D2BE25E0476B4971F50 C1?2:
343,036,338 *224D4701C5F0862666A3DB91BF8EF978D6ED8A2D [email protected]
343,036,339 *22444B3D32015DED1F52C2AD791EF396E3043A1A C1214E18
343,036,340 *2248549E84EDFC9BAF2521803A374E9840E3EDA5 c122769
343,036,341 *22463442C632919064BD02180CCEFB5510C5FAC8 c12345678907
343,036,342 *224336359DA6AFC6CBA249ADDCDCB52D107874CE c.1240s
343,036,343 *224EF17634ECDC8A2745C6B91ECB1E7D5F15DEEE c125160
343,036,344 *2243FDB2EAA0E03A09625ECBAF4AF5E95F0AB755 c125759
343,036,345 *224CAE3D0AFC7FD590A58CF562ACFA1E43960310 C12617
343,036,346 *22400810100DCA961247AF4FC77873962984DC7E c1281b
343,036,347 *224C78C2D9C7249CB387A0904CAE972038CC2434 c12i0c31247i73
343,036,348 *224CAF8F87104EC806F186DBFFC9809410129CAE C12V-
343,036,349 *224688EEFDADA5CB7B171544FEE6EB7A401FC517 C12:w
343,036,350 *2248D407011888FF7D2173F972321DA9C4B2CD91 C1"2Z
343,036,351 *22473C7925214EFD006EE8055855199FA428606E C/1.3
343,036,352 *224EF9FE3C126AB2EB054E6FEE814DD3CB3A1869 c134491
343,036,353 *2243EF8EA3CF66633AF6C121F3870E5464F7BAAB c135981
343,036,354 *224B737065E8C548EAAAA064952049705BF3D1DA c138817
343,036,355 *224D93D1847D244D1C65EBAB1525F88E6E44F698 C13AN1!N355
343,036,356 *224E5209177E9C161D4C61B91F76502CF87A9944 C13ri$$a
343,036,357 *224A0EDCECFD7F9246D596B9180648CC9C95C6A9 C&14:
343,036,358 *22488CF1312273E3365003A6C195C36934A22167 C14101
343,036,359 *22440F73268840AED1C4AC1C799F824B565B991F c141091
343,036,360 *224CEDEE22C09AC648E7B7D6A1FE30C9976C003A C14$$1F1481E
343,036,361 *2243A1E8E9C078DD2405B7FCEEF6AE3DCDCF48ED c142904
343,036,362 *224A91DB61AEC8EF06940B199A27E80384D6C6A2 c143305
343,036,363 *2246B80031553AF2E540A8C7BEC4E8CB59CB644B C14"4
343,036,364 *2245DFE7F02AD350E2BF7033A5FEA5B9D7C4D3E4 c14443
343,036,365 *224F2C4E16559E56FE395CFF837184D7B8E73A42 c1445
343,036,366 *2243F40BA2C62DF87C8EDF8604CE060669140A30 c147359
343,036,367 *2247E0C0EFE8CC84336E422CDAF556BC2E08DF0B c1485-155657
343,036,368 *224859C819364795309E5EF285209493E59EFC43 C14;i
343,036,369 *22409389F33E8BF5CF28A37161F5D61EAC4EEFE3 C14ND3S+!N3N3SS
343,036,370 *2249D0141338BDD98D0C15ACDFC50750746C4169 C::15
343,036,371 *2243E8670185FE836B5AA8ED2E88AAFAE8CF7D03 c151485
343,036,372 *2246315672A75877657861E625056B7F8039EFF6 c156591
343,036,373 *2245CCA8AA582B83839D332E5E99953F5223DC54 c156892
343,036,374 *224DEA8C6430BA3DE77DC3BD04E1A58B4BD6B72B c157652
343,036,375 *22442913C8DA51C3D0A7A792072F7218DAEB91C5 c1589754
343,036,376 *2244BCBC25A40E3E3AA2EFC0DDB5FAC51C05076B c.15901664
343,036,377 *22497415444E66437074D81D7D72F04B64B87CB7 C15k.
343,036,378 *224DF182369B1D07D920930DD2C983FA5357C27F C15,p
343,036,379 *2242A8974717FFE0DA73CB6111A519BF355F9DC0 c160landry
343,036,380 *224785EA6A5BCB062AB271978C998C4C18F5A5D8 c16.131.240.400.340
343,036,381 *224B03BE68B6D6F9E97BA05A32CD635CD92257DE c162450
343,036,382 *2242CED0C0B8D4973CE8747CE434F3A867D89A8A c164391
343,036,383 *224383D02A75232E9CA0AA608796E9458CC36664 C–1647
343,036,384 *224C8737C45E2AFA7AB447A13EFC949372628078 c.1651-1674
343,036,385 *224A7263A50D056866458D12C0A647CB2A770CD2 c16h31alo5
343,036,386 *2244BD1F341DED23AF516961FD8C512DB20C8684 C,16M
343,036,387 *224D15241C260D882EB0C4D9DAFE189FB746738E C1&7!
343,036,388 *2240455A54852D5D5F9939C8839867FA3F0A0055 c1770-1844
343,036,389 *224AFA488AA6143B1C8716AB8951D640B699FA37 C17D5
343,036,390 *224D642A2FFFB4F26F4E7F296961C85C20B8C207 C17H22NO
343,036,391 *224034709A9EAA0CA5B570A6366F8816C159CFC7 c181272
343,036,392 *224CBE24C5533C55BFF5166E2A96344BF54EBD50 [email protected]
343,036,393 *2243FCBC7761CCC56A3DC447CFCD256B76DA8DB9 C18U#
343,036,394 *22470FF830D38B46D7A406C24DEB2DFBFD77895C C18!w
343,036,395 *2240DB2BE33744A6F75289BACF7E5E394A9D730C C19%"
343,036,396 *224C4132FB8D877A80F7AB8C765735D350A3D059 c19878
343,036,397 *2240500E03C4AA98243254B8AB74A43B2048CFC1 C19t.
343,036,398 *224E35D2697F7D3863973987660B8D03CCCCD878 C19Tk
343,036,399 *2240E136EA0110A57A8696ABA36B628D85895C6E C$1a;
343,036,400 *224D9B606DCD8CA11C2A63AB628130627BCD0144 C1a2R
343,036,401 *2242D4F314140244FE477E102B23866B26E312E9 C!1!a+3s
343,036,402 *2245E80EFA7CAF4934689F0A5AD3DFA534879D08 C1;a7
343,036,403 *22480490F3CD2326071E1958B48DA6FD7BBE6315 C1ajV
343,036,404 *2241F84685A522BC00E6A0AB3754E427F042100A C1app3rs
343,036,405 *224D0F4A3C957A2ACFC1FEEC3505A092DE0DBD1A C1ARt
343,036,406 *224CD9C8D716566D5C8DF8F6D455EC94AEDC11A8 C?1aS
343,036,407 *2245C4BB0EE76EECB375BFCB1588D6139EF1DC9F C1ASZ
343,036,408 *2248F02311FE06BE953C42BE7E934E2DAF8D5A2F C)1At
343,036,409 *224D3482AEAD356C2EDF32B12655D225717C6593 C1,AU
343,036,410 *224E1C421F2AB4F25A939298ED80CD1CD373E7F5 C1(au
343,036,411 *224A42803A8FB949543F220473CF02C91E626C4B C1awed
343,036,412 *224A3D2BE0E2F8EF6C106906C3EA3A58A814A519 C1:b6
343,036,413 *2242BD43356E5B05AC46F0D9F8186D2CC7672587 C1B
343,036,414 *224254277C179A362F166E890419DD53AF6A35EC C1B"r
343,036,415 *22406CD630914C74B0A8A9D0F149609F51A8D68F C1Bs&
343,036,416 *224ADCE3ED77FEE53B0F61AA4B43F66B2797CE67 C
343,036,417 *224695B5D40C659D135FD7FD58D402FF5C210B5C c1cccn1c2
343,036,418 *2241C39685E45EBEA982446B5EB2BFFCFB229EB3 C1)ch
343,036,419 *224D6A9514B853816474622C28A6CC1D9D96C33F C1cL-
343,036,420 *22430CFE0C5D3B506AD6C992683631F2382A7FA2 C1&cq
343,036,421 *2249383CFE8B6B95902727895EA4FBF1247F6BA5 [email protected]@r
343,036,422 *2240B192C31176507B29EF5CE9F0D4D4BC474740 [email protected]@7!NG
343,036,423 *2243DC0FB87C742F483BD08894922498457A382A [email protected]@c30u$
343,036,424 *224C6C08059D8241AA0B5913DBEFBF0618BE35E2 C1DhW
343,036,425 *2242DDBE3BD5367CA7FF88049A4F3725B019A014 C1/DM
343,036,426 *22459ECD6146E8B1ACC23D0088596109A12CBCDA C1DU;
343,036,427 *2243DBB43CCCE6CE256ADAC63F5E84AA5FAB7C7D C1/E%
343,036,428 *224394F839D8EB91BE742C694C04E8893064EAEF C1e=%
343,036,429 *22429ADCB1A15A7E6EEC7C9C7915AC6389F26900 C1E3C2L7
343,036,430 *224CCA623C354087025B6B89BD4B6F3B9C1A74C9 C1e4nes7
343,036,431 *2244E8D45B1463FEFC35E9103590D4C2E7AA4FA3 C1EAp
343,036,432 *2240C047358E50D02174EC54D4BCA0EAD46B041B [email protected]
343,036,433 *2246291BDCE778251B8D44D9DB72171F3F8257B8 C1EPM
343,036,434 *224DC04816FB82702F2EEDCC752498196FF5F4D5 C1EWT
343,036,435 *224482154CAF924FA323345775D24B915C8C94A8 c1executive1
343,036,436 *224AC2C8E3F8A7B7F4AD0EF296BECCFD5022DC79 C1f2N
343,036,437 *22420A1F7C22886A12A90EDE62D60ABD011179DC C1fea
343,036,438 *2241CFD140006EECD8D783C98DE214F27C82CBD3 C1FH+
343,036,439 *2244E74363B87519687F609F2589E69BACC45633 C1flh
343,036,440 *2242DE6D07C3DC90D11FB4D5CDAEC8E4AB8357A8 C1fvY
343,036,441 *224B2309704BE4295A0A4BF985A3DF67DA49C68D C,1"G
343,036,442 *224C1E86AAE4C1A8E54A89C3862721187BFEC22D C1G;)
343,036,443 *2240BCDFBDD40C04AC67987A6AFEA841FEDF0D92 c1g4r35qu3
343,036,444 *224093AFF43B4542655E469B198BB4234A8F3F64 C1GnY
343,036,445 *22421CEDCA39F1550ED6558DDA7DBC24D0777E2B [email protected]
343,036,446 *224F5ACC67B2D23A9D88D03684D8576DC4CB15FF C%1+h
343,036,447 *2243C4480B6434453917BCD9FE4E99D078BA3109 C1$h?
343,036,448 *224DC5FA501CAF59F810D10022F68D83A15A3477 C1H9i
343,036,449 *224E047C96C9A337BD1223A08AB940B04F7EF07B C1HARVEY
343,036,450 *2248D6A030F8FF2A35B8D9119DE3DEAB7CF4318E C1hED
343,036,451 *22410A2D779C79B7EF80CB81B1BDA00E15920425 C-#1i
343,036,452 *22497F2B7D40277946E76871FEE4D9707531D130 C1i"
343,036,453 *224E1608E2C3125FC2FDA0EB364B85941F1F2628 C1!i5
343,036,454 *2246CF3C007879825BA4EB1BD8E4C937336607B4 C1IFFH4NG3R5
343,036,455 *22446AACAC808D7257C866EF25EBA56F48033C0C c1ih
343,036,456 *22429678072CB5AD07CBDFDDE23F0A7C5800569E C1IQUI$H1Y
343,036,457 *224593CC9A6B1E47E2B13567C2016E2428EB1348 C1it0ri$m
343,036,458 *224BCA705CF0B679C1B33096D8F88E4818B31625 C1Ivp
343,036,459 *2240A373B83069C98ACB7661BD433B7B94C37954 C1jj6
343,036,460 *22444CC2104D434FA63CD0BB17EA25F5FF89D07E C1jQP
343,036,461 *224D0C77E4E9895652E7F58DAEC9A0EA8BCF97A7 C1K(&
343,036,462 *2246EF2BD3EE63A094145EE7C4EFD16B1EFF0A81 C1k%r
343,036,463 *2248827A3109EED30304529EF25003A4A11A3F4A C1kW3
343,036,464 *22483CA128A668FB1F1C325AA10DA867164AD05F C,1L
343,036,465 *22411F0BAB942E68CD466A1231A4E85E79ECF1DD C1.;l
343,036,466 *224540C028337E7F8C602E5DCDCF8D89F0FD91A2 C1lc_
343,036,467 *22455665830BDFA30DD53895FD4502D9558A03A7 C1lP4
343,036,468 *224E83128C8E38CFD6DA011229287BF271A1E2F8 [email protected]!C$
343,036,469 *2240C35846A2F4DE1D2E1DEE8DDD83000C8784C2 C1mD6
343,036,470 *224E0B788198ECF2ACE1592B8E0A6F1A9B7EB923 C1mj5
343,036,471 *224CD617993F1DEED8D63338F105FD435B0F543C c1n3matograph1cal
343,036,472 *224F3B7EFCA5214C33CF3F70EE7B4F4A3BA3C032 C1n6
343,036,473 *224BC19B3E9396374BFC088D780798B2199ADD55 C)1NA
343,036,474 *224B324AD2C273E5AB15487F14D057FD2D1F1191 C1!NKED
343,036,475 *22434CB0639DE10A8AA07E6C0FB26C36A61AB032 C&1Nm
343,036,476 *224C5011D08BBBBA4555D72E68946377492A712E C(1NS
343,036,477 *224CB4DC51C01E5E8ED541BA5BE0A1063BA2F577 C"1nU
343,036,478 *224E341A8F0E15F812CA284C5BAD447B583FB8A7 C1NY+
343,036,479 *224E29863D8BDD6A094A2A390F6765103E946CE2 C1nZ/
343,036,480 *224A2E6285F19567CA6E5712884BCE9D54627BD8 C;1O,
343,036,481 *224DD26628B6488B0C11B89C89CC8B3AEEE5A74F C(
343,036,482 *224D8F6D14EA2825D35DBF1464E6ABAF1E54613E C1o8K
343,036,483 *224A80B18EF5DFF48AE5D50C90E195D68D609E1F C1o?D
343,036,484 *224862B8AE6331F410FF9CD6DC5898EB461F8EEE C1ODD!35+
343,036,485 *2242977FD2F5D3674388DD1E444B1DD3334B714A C1og5
343,036,486 *224F82632E541469FBE62D44BF883EB27CC860FC C1on8
343,036,487 *2243F67167593B8B27A03B86AB06BBA33A2E9578 C1onicoto
343,036,488 *224D54C73D7924744FE84EDA9DC0F418D46C3467 C1oud-4sc
343,036,489 *224D8D38BBAAF6782DC3ED9499B10BF22AF051CF C1-/P
343,036,490 *224D0C8D42E3F33F5A33B5FEAC50F416A0264CB5 C1$P%
343,036,491 *224D51698761BEC6675DF32CAD18D72FD27B1FFA C1Pg
343,036,492 *224FDF76D9B8448A4187ED37FD975615C2F87FC3 C!1pj
343,036,493 *224D5D5176D8C2782F69FF7E66C21BFEF1BC3365 C-1Pq
343,036,494 *2247E7FC6147690E26206A2242C1ED42374AA97A C1ptC
343,036,495 *224077FD7482B1DE8AC38A5A61A3DE087A9D9966 C"1q,
343,036,496 *22427E0DC2E9F986F75E1EFB9349010A3E9CB354 C1qhT
343,036,497 *224FE6BAF2F0F814A84ED7E81132262CE0E63B9D C1qK:
343,036,498 *224C75E1AD7EF602C51EB10E292A793EC7AE4E96 C1qmo
343,036,499 *2248EFED2C1D8A03D2187A1E52CD940D10D3CF33 C1Qr:
343,036,500 *224E226EF9145ACEC869E4130C1256F9A67EAA97 c1qwerty
343,036,501 *224EB0BC659393BD6167D4032870FC5E22FD2047 C1rAL
343,036,502 *2248D4F40EE82D786EB8543CBB56FF0E262BE552 [email protected]@1
343,036,503 *224D2B5A5A1452015A1B44C2B18B70243E714D1C C&1RP
343,036,504 *2245DABAA5AD7DD73CBA005B58D61F3C6669A95E c1rr1branch
343,036,505 *2245CDA0CEC2A63FD365923D46907836AD8F93F7 C&1RW
343,036,506 *224FD46E342B19C26869D48CE8177A378553358E C"1S9
343,036,507 *22489281960A1F9B96035EEB2B323C27B28B1739 C1S=H
343,036,508 *22499D8535505CCD5F0BF78D7B180CEB00C57D6D C1sjr
343,036,509 *2246377774F37E5C9AE103DC45B6F2F4574B7888 C#1sX
343,036,510 *224535FB22D19DC2EBC30FAB8A05ADDB435849D1 C!1T#
343,036,511 *224EE703D57FC45E81B142797B6B154E86391DD1 C$)1T
343,036,512 *2246EEC20F507BF50A4A1831E1897C22C64A714C C1!t?
343,036,513 *224E3D1802A7F957CB70AC7C82205CFCCE7C6D05 C1T07
343,036,514 *22442C02124340A4FB9DB226486AD32AE8ADEB99 C1TADE1S
343,036,515 *22434B7AA35711DA8A60BED82CCB35F5AF68CB38 C1teI
343,036,516 *2243363E5C9E7F60630265A5489287F96D161D73 C1TFC
343,036,517 *2240209798EAF425801702E01EDB955889ED025E C=1TO
343,036,518 *224F03924B2A2AE46172D2F7BE2E2398D8897A4D C1T!q
343,036,519 *224452BFB9EAA2AE1D2847F1EE5E46AF0C62AEC1 C#1tw
343,036,520 *2241EAE82DAFD6EFC41DEC71C3A5765F2D978B1B C)1?u
343,036,521 *224583BE1ADAA717DEB02D922CF8B855DFCD8B05 [email protected]@71ONS
343,036,522 *224B7D630FF03969E7C0C372BA914DB21C82DA98 C1/V-
343,036,523 *22445EDC172F95866EC5016CC111B3D1C34BBFD2 C1vg,
343,036,524 *224D0D4FFE634A10A1CA0B0B47D381312F86BD33 C1vg!
343,036,525 *224C15C0779E1BFCD66D73597AC5CA15CE1F4F41 C1vH$
343,036,526 *224882AA1F21637085997FD988D172B9695C75E4 C1vi9
343,036,527 *2242C9C68D558C8AE0041AB8D7616FCB78E0C100 C1v/k
343,036,528 *224A341BD2588AE77A822909866FD640D7BEB0F0 c1vO
343,036,529 *224B2CBF6E19B9C4CA75AC0CDD3C7D1D2B357586 C1vYc
343,036,530 *224DC1011BFF8D536B79D74F78FA192CA23144F3 C(+1w
343,036,531 *22436966665046FA2BE8E51E3FC37D13F4BA9087 C1+w.
343,036,532 *224302FE6C1AF9DA4F469AC1CEE6C99968674336 C_1wc
343,036,533 *224FCD8508D73DAF9E31C00211EE52ED234B4CA5 C1Wj
343,036,534 *224FF61FEA4609F2AC064300731010D58B2A5D61 C1wjR
343,036,535 *22493BA8468FD362C2B86FE9A469CBF5892017CD C1
343,036,536 *22424835E321A9F5C8AA88FA91DA39C1C41D04E7 C?1XG
343,036,537 *22484E0B354CA29558B63820AEF3BABBC183A158 C1XwZ
343,036,538 *224B2FB71A162EF321FFA4978FC45E33866A4C32 C1%Y;
343,036,539 *2246358600E3B0D64C14D17C7323EFC7742250C1 C!1Y1
343,036,540 *2241D24566039DEF4F341402A32296B53B125FE0 C/1Yn
343,036,541 *2245D6B5A8AF0AFC1034380FB252CC123FD986E9 C1%Z!
343,036,542 *2240F279C83F2C0EEA74311F7AF0AE1017466CBF C1Z&
343,036,543 *2240BEF11A50D730D55643B362AB1A0A89594DB9 C1Zde
343,036,544 *2241EDF87841480AC6857C4B0AE444CF370C8FEA C1Zo/
343,036,545 *2241F20594131FEFB5AB2899982F98F0D1C78EB5 C1#Zr
343,036,546 *224D3BBB8AFC0FDA42D8B9C1B1FF975F318DFD50 C?"2=
343,036,547 *2241FEAC8A8740F2475BE6A7EAC95C6116CB0575 C]2#
343,036,548 *22443C59115F28AAF517987353344675C37BAF49 C#2$-
343,036,549 *224CFDAAF80B9E3F8012EF90393E56FF284AE750 C+%2,
343,036,550 *22407CB535190DA9A19A8B2825DD7BE9BB1886B3 C2_%,
343,036,551 *224D11020D1F9F148A5DC7451859BB511BC24BC7 C2;;"
343,036,552 *2243EC4BCF240805A97048A92386C2D9E50A31EE C2#";
343,036,553 *2249FCB9A7412ECB98C25FB683E17C4C26FC22B4 C2+/+
343,036,554 *224849019C479192B55FCD525B60049BBA58A1D0 c-"2
343,036,555 *2242088C662C055C88C033F363D360BA93AE996D c2['
343,036,556 *22478D4D67D9C175BBB1A142570680F0CDCC61B4 c2&,
343,036,557 *22499FD5CAE4605E89DB5518BF4727606FF1CD51 c2+^
343,036,558 *22485B4FB6E2707520C4055F6062CFBF0CAF774E C,2-0
343,036,559 *224FBA58D6492B9E59500DF44BD99FC9305EEB96 C$20.
343,036,560 *224E7F464AFDEC47ED83F9029FC6EEADF8FC478C C,20q
343,036,561 *224FBDADF5E384C6F4C880447323FBC6FBBA7D03 C20Wh
343,036,562 *224442D94D076D4E31BA0EA8C298DCA2804EC5BF C+21$
343,036,563 *22462D7A5C2D243C69BCCF0D3AF2826AFF7885FD c2189
343,036,564 *2244129E97B5003F1FAE45FFC311A5C9BC482EC1 C219u
343,036,565 *22484C339EA13FF1478AB349C7B32A7266F1A38F C:21l
343,036,566 *22491A92077B1220D5C86588944AF82C06FC0248 C22Vl
343,036,567 *224466D7E44AD60EEC851332209F3A60F9749DC4 [email protected]
343,036,568 *2243C5D3F482F648E2CD7C2F742A342443714F75 c238630
343,036,569 *224359EB88C6CB5453582700FD66E246777BD105 c23lsnyrpx6udqk6swzrv7kcwtoorpys7eksqtbqq4znd40zhsrjcj9
343,036,570 *2242F9F1A10C1D28922B43FFB9947A3C93593436 c24394201296
343,036,571 *2240415D735CFD9B83385C1FC1306C868337D744 C+249
343,036,572 *224788DDDE989BC0F3D1269320DEDC806B8387F6 C24l6
343,036,573 *224155E05716E27D9F177EAA56ABE05C7A1E5D82 C24tN
343,036,574 *224457169393C30BAC1D7DB4EC616B731CBF822A C2$!5
343,036,575 *224191FB5B6D5B1F1DD8608CEF5C59E1661C7ACE C25a5
343,036,576 *224FCD1CCEC48209BCBB8F526FD00FA78AA95056 C-26&
343,036,577 *224BB5F95CFDEFCCC43B88F7EF8E7F233E90B228 C26,L
343,036,578 *224AA084CC64C97F6982EF6CB40597E81EFDA1E7 C26sQ
343,036,579 *224E7CE788D4BBAF81E7B551D5A3567EFF00ADE4 C27C21A10W8Y1230
343,036,580 *2240F108DFF5422088676EC24C663A5081C069BF C27qa
343,036,581 *224A60E76553BABF62F32D3639FBAD00A7AF867F C27uU
343,036,582 *224D67B77C6BEDCFF15A1EF981D0BC2D6B9AAFEA C2/85
343,036,583 *22435A21447B7B8C4ACC3630E283487A77D57BAD c2859066
343,036,584 *22418D0D2DF73C885B76461B80ED341A93D7B386 c287c554
343,036,585 *224E0BD2AC4E03EF30F798DC648785B56BCC37EF C=28f
343,036,586 *22469DFFAD52085E8EFFE536C847E7872A357CE7 C296YE
343,036,587 *224ECBCEFCB4C41C1A344806F41AF0D40D7BDD33 C29ST
343,036,588 *22405DDD35EDAA0FEB406B8779E934F08F8FAA7B C#,2A
343,036,589 *224E023BDBA21101F4E49D2B93B318A65F5BF338 C2a;-
343,036,590 *2241218CD9DC5E2B6A3B04BDA544A0C104E74090 C2a3D
343,036,591 *224E4456BFE325FBEF93C483324FF5422D9548D4 C:2an
343,036,592 *22418F6F280D8D6DBFAC8E9129706948662D319E C2A+t
343,036,593 *2247AC21B9FFE7C7DA1476AECEDCD7CE1516078D C2#+B
343,036,594 *224C190A63CA77113DCE2B1DBD055D924A567B71 C(2&b
343,036,595 *224FADE9E875FC78AB4B097F4D88A4B78B32378E C2b#;
343,036,596 *224BDF6FC3D0A15D2684314539BCE53001241A45 C2_C_
343,036,597 *224BB92FE266BD84EFA34CA06ADDF7C998B6D7A8 C2c#K
343,036,598 *224F24260599D4C7387C46A7BFC1B6F53595C910 C2Cl3O2
343,036,599 *224BB716BDD386196F7A79A4F4A9879ED385DC55 C/+2D
343,036,600 *224C6264A8D439D6BCA1EFEFA2A8C1B4EC3047D5 C)2;D
343,036,601 *2249C3B5566923C82A5D2B76F439C7880A951340 C$2d
343,036,602 *224210B6FDF5A433B83CB516CEB3958572B32224 C2dI%
343,036,603 *224782D26EAA6893ADBF2FD991A457DBB7D4F7F3 C2=DZ
343,036,604 *224C176ADC98193CB4AE1C371E1430C870B0092F C2e:(
343,036,605 *22492B8289D0C0064EA02FB96841E93F75000D71 C;2E5
343,036,606 *22465C133D6D4B6FBDD0CD6A1ED618D1114A2C09 C2E6:
343,036,607 *22432355B26F6DEE63E63503ED4C3A529B1C2AC9 C2e;G
343,036,608 *224A99F0B3CFDEA4FAA78F3578527302F91F8A0F C.2Ew
343,036,609 *2244436A60221EB3B208974C56659D33280A1D59 C2EZ2
343,036,610 *2246467D70BF8C885A241EFB626DE5CC47038B98 C2F9E
343,036,611 *224797E7D1188BB61514F89573470293F671105E C2FdS
343,036,612 *224A688D7CCBDCE854E9AE16B904920FA598BD63 C2&FL
343,036,613 *224AF14676DE399B4FE9D2EBC90406993035D3B4 C2F.l
343,036,614 *2249643DBF2D9BA4713A4201F5A824DAFBCC9FF7 c2#G
343,036,615 *224C8279B4BC0BE6D9558484F2FA02ADA5087407 C2)G7
343,036,616 *224A8770DBE6CDC7C84B0C074AC1E7FFC08D62BA C2GdC
343,036,617 *224496AE189A46113D14DA40016D8D59C8FE64EE C2GUp
343,036,618 *224AD8AC33BC42CBFC1AD4A25AD8C4DE4CEE737A C+_2H
343,036,619 *224924159CF818C85D4F6C2A2829764A11DC7E7B C=2ħ
343,036,620 *224FEE7FAC31F7E2DB440C7601441410B3B9CBCE C2(hn
343,036,621 *2248D730FAA56296B8C1E02BA66003C042716942 C2HqC
343,036,622 *22493D4F89E5A1F3582C07F0107BB87F6ADCFCB7 C2HX$
343,036,623 *22459052E469E39BFF6C5A84A67CE9DEB1BA0CCD C2I1v
343,036,624 *224845FE15ECF185C09E20031954D088326F59C9 C2i?4
343,036,625 *2242912C1D5558257A0E1E47B6E88DB3E60397F9 C:2iM
343,036,626 *2247FB6DDE32214206E4C83E4DFA9AC1D1F6A746 C2"iM
343,036,627 *22477922BEB2ED6C5A65503E86618A95DB4EDFA1 C2Ipo
343,036,628 *2245B99126AACE2353C6D0AF2EDCA4932057E288 C2iR3
343,036,629 *224B319EAF9E72706CE0EEBCE517CEE2551953E7 C2,iX
343,036,630 *224E74D61586D905511819EF3CC17FED85825C41 C2j9p
343,036,631 *224BFC9C632026CDC2BD72063CDDC212E452395A C2jFP
343,036,632 *224615159B8EFCFF83C1FA89CA379DD927551022 C$2-K
343,036,633 *224EFD8B2F33EFEDE1E0096302EE2155283B9EFE C2;k%
343,036,634 *22462B9C01933707B75158D681BBF4CAEA997248 C2KF0
343,036,635 *224F27400719B7FF01E49C60BAE3CB95A1C0EDF0 C2kiB
343,036,636 *2241F9FDCE05B0C875A17EB652F6CA8CEE5CA3CB C2=Ku
343,036,637 *22432524BE4519058C42CAE57BBE96EF3DC2EB4B C2kuT
343,036,638 *224C05DC0365C5ED208CC071E50CA5AA5C7534BD C2l5H
343,036,639 *224B9A54B6E4DEC7B9B1412F968F9809134A1592 C2lpT
343,036,640 *224343F0EC8BE2BAE49D9DCA2951ADC3E3FE89A4 C((2M
343,036,641 *224FEC52F2039649282A2FCF3D1A0D1FAFC66C7B C2!+M
343,036,642 *22407FDA742F0228FF2FD8102205FBAEDB36585D C,2&m
343,036,643 *224E8C16D62214E59485BFDC05EC091557922709 C2mA"
343,036,644 *2249094E0D4E7E0C17F9B0A29CBA57D33A306830 C2MfY
343,036,645 *22418EAEECBF4E0798E3F93652F8DF6D1B49E5AF C2.mh
343,036,646 *224AB5A188BB3B716F46B969AC03BA90D380FB6B C2mK9
343,036,647 *224C5F7C402FF343DBD8DAC586755993771ACDBE C"2;N
343,036,648 *224B04AA5BE5126E8A8F6D98935F4315D499609E [email protected]
343,036,649 *224B7F9C643CBA0089B8E8E45581DE34DE277DB3 C2ne;
343,036,650 *224CCA8DC7AC83386FFB0A76D102E64510C80011 C2N/t
343,036,651 *224907322F0E8491D34F42398E9E1CACD96E73CF C-2nT
343,036,652 *224387B665456E30D1FC9598683AC84383808247 C:2od
343,036,653 *2243CB0D5D985279298A15E669A2DE117F533D7B C
343,036,654 *224F19F6AF690FFF1DE3519C50A2949556AA64D0 C2ONL
343,036,655 *2249F49360051193E3FF596D89C61BFCDFCCF534 C2orn
343,036,656 *2245E9DCF8987D499E1925B0937F8C4C43EFC7B9 C2-P4
343,036,657 *224DFBE00F18A7C69F23618264EB6CF650BE4C12 C2+p4
343,036,658 *22439B97588A86C9EA1C18EF06E671CEEB55FE65 C2p5f
343,036,659 *2241D1D20ED781A577F425D7EADD1D196EA120A7 C2!PB
343,036,660 *2249EBEDC3615D55A3DD5030BFD4F15CB9D369AF C2piK
343,036,661 *224158B3D4D8FB9AF07E58F4B8A29E3CBD699BAF C2:pn
343,036,662 *2244F78C5479679448BD47A6D7A35FBA17DC000D C2PTT
343,036,663 *224D3C4ECE4F15050809B330963E259D8EE40B83 C2PXe
343,036,664 *2242A72D711188B7DEDBD8F4E459397C63A41BF8 C2/Q)
343,036,665 *2246281B3A8243C263FD8753BA5619A31864298D C2Q2C
343,036,666 *22453D524609F7F270CADB74F4C1438326D71D7F C2q#3
343,036,667 *2245260537EA11C6E8BD9242EE8D6118E4D7C936 C2qgF
343,036,668 *224B575B48B73D0D83DA2DC974975E0A62575360 C2_Qh
343,036,669 *2241F552980E13F4D8A9F2B48B1B649A8238FC1C C2qjN
343,036,670 *22427804EED31947B044794401A73EE9481BDD84 C2QO/
343,036,671 *22488E2CCCDB6AC6D8B47C8DA8A46EB17BAB54F6 C2qq8
343,036,672 *224925A46A146C89DE791B93B68144524C85821C C
343,036,673 *22415C7347FC26085F8D09AEBE21ED82CAB331F0 C2RMm
343,036,674 *224AC24C48133173919C3880D492F6CF2367B6A1 C)_2s
343,036,675 *2245C0A623FF9EDA88360FFB9B0AB068AB37917B C2s:=
343,036,676 *224751A6AF288A30BE2091F4863E9AE8F9A9E706 C+2sC
343,036,677 *224002978F54B34DD7EBDD74B5ABC7745C504094 C2scj
343,036,678 *224A8A22CF93E675C7D7F840EAF6FC9BE042899C C2Sg,
343,036,679 *224377C3C0B661336D7FB2B69E622118C6E89C6F C2ShA
343,036,680 *224C739D6D429018D8D22804EBBCC1D1242C6BF0 C2SHo
343,036,681 *224E8C396DB44BC041E7D46D741045FE75438862 C2T0q
343,036,682 *224A964FF9BCDAAE815D76FF17B3AB0B85AC42B0 C2&t9
343,036,683 *2246DA0F1C6F71E70CEB5BCC3CB8367176721132 C2tgk
343,036,684 *224BD81A99625D3A88EC417561D2B3E21FF859BB C2t_l
343,036,685 *2243199693085BD7C653FB73E3B5827744E72F76 C:2tT
343,036,686 *2244D456585073ABF0BA7805C070CE05FD12EAEF C%)2u
343,036,687 *22497784EE753DEEE839ECFB3542809954DC16A4 C2u5,
343,036,688 *224E736672B1289D06F65AD41DC2218F128CD06F C2$Ug
343,036,689 *224A06126BC82683668CFFCE79F9419430EE8804 C2UuR
343,036,690 *224D9708BA6F3074157E4E9E74DBCC224A337CB9 C2%V/
343,036,691 *2241417383C364C09D0A51E927F9DB6FD13F8C1B C2v0S
343,036,692 *2243CCFFD3627CCBDFF90037912CE828FA9A3540 C2v1!
343,036,693 *2242A0E548A962814CC37883E5E2909C19D79252 C2v6_
343,036,694 *22451CEE96A776B9A24BA0F330533628A43F1087 C2&vH
343,036,695 *2245EF8D0E5398426EC8C86AE3C9B28BE164F8AB C2VPn
343,036,696 *224FE9F4D52C735F2F457394E99E96EA5DC456A6 C2vpR
343,036,697 *2240DA7A72352B05469487A8104A9DD1E733FD6A C=?2W
343,036,698 *224799352D57CDD10F70BEC1F825F7F34C077D73 C=2+w
343,036,699 *22448245C55D7EE8C9CDED689063A9F13E5825FD C(2Wa
343,036,700 *2241D510F4830FC6D15F802B3D0EEF458F5C88B4 C2;WG
343,036,701 *22426D9012551EF44B7959AB8842A96B863E28C5 C2wgb
343,036,702 *224E17F971FC9CAE40DD6F0C0C34726AC4F837AD C;2Wl
343,036,703 *2242198BADB467A61AE4ED3A5794B7C33356966E C-2wU
343,036,704 *2246F32D442C344799811C4A8FF7999291AB3C0C C2WwA
343,036,705 *224AD0F8393921B1BEA02DCC8FD4686C820CA06E C2XSk
343,036,706 *224AF50BE1A8FE66A4D6CCC572D85C369D6EECF4 C2
343,036,707 *224582E1D47F3E822C43D947101F5DA1EB19B5A7 C/2YR
343,036,708 *224387F845396892AD44D557B768B4FC8FFCDA5D C2+Z0
343,036,709 *2246491DFCCB66CAB596D16557EA96EE16BE1B32 C2Z2A
343,036,710 *224D2482A2A298392169E6F0BBD15DF204E929F7 C2ZpI
343,036,711 *224790671B03B8C2B33C13D504677C1AA526861D c2人乗り500m
343,036,712 *2241BA3CCD7DBEB131FBB11672F1B34B34789056 C,+3?
343,036,713 *22471AB60C39A3AD4CE36A9A4CABFF3DFC207D8F C;3:
343,036,714 *224EA8AB46AD35A4DE175A031B72788275562757 C",/3
343,036,715 *224E9FF96A6E5D52736D8DA1A0F34E06D89D3159 C"::3
343,036,716 *224F94E9F8FA98D4C310E544D1204F939D49006E C(!-3
343,036,717 *224545457359E1912C7893AF18C30AAF61F5F6E1 C($3!
343,036,718 *2248E9801B5402344F2FAAAB2784BDF245260118 C)%3
343,036,719 *22400B730DF633D53077E3A4B3B23AF1BC02DA23 C3?00
343,036,720 *224C217538E7F732EE11D5924F6A1C81C13742EA C30qm
343,036,721 *2248718E7EA4151C3E28DC2FB63831A6810CEF03 C_&31
343,036,722 *224A5CAEF5C0D736FBDF73A693E59B9AFECE2522 C3#%1
343,036,723 *224BCC705B599C24F764E54C51FE13F5C81E87D6 C31184C135
343,036,724 *224C977001BA946FE8C04B867109D4A2473DFFEA c313bra1ng
343,036,725 *224405DB38212C16FAD327FD90D09F06B3DEDADC c31l1ngwards
343,036,726 *2246D9353A3A87FEFE7D3166393C249DC59D2563 C3
343,036,727 *224093E63194D072DBDB204F5ECC9375F6FED24D C32–38
343,036,728 *2249FD2F3D8A1A553EF99F92B45E336BD12880BA C32g6
343,036,729 *22486C28F08C73C18CADBDB5FE59977454D6D8A4 C32_K
343,036,730 *22432693E33E3546CF8858E911FEB01182B5CE22 c33*
343,036,731 *22437408BFC2DC9E65653C0C27CE10346D6382C8 [email protected]
343,036,732 *224668704F377A43259DB1ACB1C7EA39A8B487D2 C338,
343,036,733 *2240B67AD6B6E7170595EAC8D5826F84E471F6F9 C33AD
343,036,734 *224CD9EA4426525EA36B85628CB74A4A27E99ACC c341992033
343,036,735 *224BC6D0909E87254554154D0A305E69ADA4E982 C34Dl
343,036,736 *224C02B007287FE9F4153EE78FA207BB04BA6D0F C-3)5
343,036,737 *224ED9E6B70AC665F9CE8842B4AC1EBEAB5F3BF6 C35/d
343,036,738 *224088097F86B3F4B579C0C081B6F7322673A0B3 C35Tq
343,036,739 *22408BCE6179471C67236A09769B041C35C8DC16 C-3;6
343,036,740 *22415973C1A3A146575DD958716FE56B7448E486 C,36
343,036,741 *2240B78DE9BCDC46D8246703F6FC3A1F94E132C4 C#3/6
343,036,742 *224FF03E7F8095BB56A6F17A3A913AE7CDE384CB c3+6
343,036,743 *2246720045D55B2103F5192F4979140A53E17FD9 C368H
343,036,744 *224C6F6944E9A05C5F5F4987CABAE2ED9FA0034A C+36j
343,036,745 *22426BD0468497824A4FA1EFDE539558BF97D532 C36wK
343,036,746 *224F2B2DF6B736DE44B4DF84C50A850B20EF6E9F c3701518fd48b7a642a363c3e8bc42cd
343,036,747 *224B4BDD59EB6883A0A119262C359DAD5F124A3E c373abdd-a6db-3f74-9eac-610be703b966
343,036,748 *224AB852C364FDDFCE4AC16690C21446FDE7B800 c3741
343,036,749 *224EAB5D7A0E0206136B3D4E4EB1BB78A697B016 C379E4DBCXF2Z9U
343,036,750 *22474455B6852186AA561D9DEF03DEA27A4C4D5C C37dD
343,036,751 *22494FD20B452E47C06BBB0E1FFE86E6867EB8CB C37Hw
343,036,752 *224CEC9F540B72F54566E83414D8662D0E7A3459 C37wk
343,036,753 *2242A7007484E6357740ACA091F70BAC051BA497 [email protected]
343,036,754 *224D88E6439CAF0A6725DD9178E0C37C28F73491 [email protected]
343,036,755 *224D8021FA7E44745B595F90B8C72159D9E420AD c387-c390
343,036,756 *22465DCAC07F0CF2FF910E3D525C2202C3253EA4 C38E8
343,036,757 *224C804A79C40192D0146618B696C05DAF3DC634 c3911
343,036,758 *2242F77C70AEEA470ECFC1C3D44C1E7B43F4BD5D C3&!A
343,036,759 *2241BD897E432B2C6FF62353DEB46C5CD4FC4505 C3A_
343,036,760 *2248FBDED6B5FC1420448C9253AAEB09B002DC06 C=.3a
343,036,761 *2247D6948B1D9BDE70500FE463888DFE2B03CCDE C3a-#
343,036,762 *224EA3456FD11688FB13BDBB77FE75C5C19C70DA C3a$1ng
343,036,763 *224393E1B4D9682FCA7FF581CA227CF1B8F0AEBF c]3aaa
343,036,764 *224291C6284FE882E0CE9679A27C2134D3FF95D6 C3acp
343,036,765 *224F957553A794FAF9BE9D4D024850FEE96BD415 C3Adg
343,036,766 *2249C55599FDCA5F6BF098AE9E3E584E01D15753 C3ah3
343,036,767 *2242BFE33396838AB1147C3A9B55F52AF724B9B1 C3aj6
343,036,768 *224971326C15B4B59795814F18F2FA7D9A806DCC C3aOf
343,036,769 *224841D3202B8F45B51557B114E351B1DF059833 C3B?6
343,036,770 *224CB1A917FBBB2A8F8253DB9F21E3D3E79940C0 C)3Bd
343,036,771 *22483C34A54749D0802EA947A208FB1C8D2E8255 C3(Bk
343,036,772 *224298AB2940550323AAF05277B0376B2177DC55 C3BlY
343,036,773 *2245551A4B68B4DF1142B218B480BCF10BD6F8BC C3BZu
343,036,774 *224730D10379272169D000EDCDFE0B7945A1678A c3cili4tom4
343,036,775 *224D21ABF0A12574C856446FFDF3EC95CE30746A C3$cK
343,036,776 *2241241B7057E9C2747D0C3D10396ED75AE52951 C3/d?
343,036,777 *224B1A90623C475A5BE10D4A302A272DA8CAFCB1 C3d&.
343,036,778 *2243950BDECD289647F49C2B28E96CDC05578C7F C3d18
343,036,779 *22483D5A17D2D65E7ADB67F8C5AA88792C288165 C3de4
343,036,780 *2244777B90F8A5983BFF6CCB5FEF87C422A50856 C3DHK
343,036,781 *224DF6C6A23C85D29A75D77BC10FBEB977DEB1B4 C3DYQ
343,036,782 *2248345A673D1F28DAC7953EBED65787F75978DE C3
343,036,783 *224D3FFEEBC7E05E067F8ACAA18206819117281C C3eG#
343,036,784 *224BBD5FDF5DB1A4CF61BD869829C114A465FA1E C3EHb
343,036,785 *224494C7D94704A289E79146A0D724848F48FDCC C3Ep.
343,036,786 *224943B634C041AAC60079D3B0A808D1E9840C24 C(3#F
343,036,787 *22416C4DC08B3DC39989084A12CF16AED3EA3E55 C3F/b
343,036,788 *224E7F0D0068EA18019A7272E8C24D2D069C5323 C3F/c
343,036,789 *224517C84E1BEFE9263E17AA78145EFA6259452C C;3FE
343,036,790 *224105FE5C8353C2FB9129919F07DB7028E2107A C
343,036,791 *2240AD1738525AA4F445D39FCE6CD8B7C828B149 C3fFU
343,036,792 *224B6005CC44125204783AF6F73B9EA763BDCCCF C3fg1
343,036,793 *224DB322F1E4F882EAA526F26B34D56E125AE26C C3Fg3
343,036,794 *2249FED95ADA775485DFCEC224104C5C675C99AB C3f
343,036,795 *22484B9C97407212773A734A0DAE6146A9CBF9E6 C!3fw
343,036,796 *224BE4803A52CD9D746607331BA5056E1834FA86 C3FZU
343,036,797 *2245FA6A5034F025DFB04AE04B42B83765A247BC C3?G5
343,036,798 *224A649ACD1B88AF920945A7728154C312A756F3 C3G_e
343,036,799 *224C1B610F51E8FDEFB3EBF4240B9B494BC56CD0 C3Gko
343,036,800 *2247E90B74EDFCB1A75F4731A4CED26C40C6CB40 C3gMu
343,036,801 *2241DCA4CEAAFAD9BBE47EA1942A278A21E9985D C3gnp
343,036,802 *22456DB19489755407ADC506031B82B0FA206FF1 C3"gQ
343,036,803 *22470BB53574E3F9A4422399D67917FB7970C8AA C3:H/
343,036,804 *224CC5752F401807F9B235AB3626141FD7D49B09 C3H_-
343,036,805 *2248A4E524E156187B814C109D703713C7B6AFC0 C3H42
343,036,806 *2246374838821F45185EBBA910BB35266EE1DFD1 C3:He
343,036,807 *2246CE3E56BCE3089DE20DC64233507FCBEF687D C3.hi
343,036,808 *2242A2BB19781BB99C6631CAF0A2903651B78942 C3h#n
343,036,809 *2247F397F63973CF0B533EE124A70211F4A405A2 C3H?R
343,036,810 *2249A7311F223B2624EC37647C2D00C27CCBD0CA C3HsQ
343,036,811 *224AF68CF185C328197740197F94AC9721ECD35B C3-I0
343,036,812 *2249F1F9D31B67858DC8F9195C148C92BFEBF022 C&3i1
343,036,813 *224170933593BFC73E2F7707414AB441B1AEE6FD C3I$l
343,036,814 *2247893A3E10F7ECBE9E723B730BD5A80AFB6980 C3i"P
343,036,815 *2242A8CCE368D35FB3803CE21320DDD4AF2B61A0 C3+is
343,036,816 *22427CA67124D5183FB3CCFFE5F77CF03D3808D6 C3Iw8
343,036,817 *22452225CE4B285B881C1973889592C3B8C57B6B C3iZ&
343,036,818 *224CDEC9B07DB4944536DFACC3C9834D3C609E6A C3j_2
343,036,819 *22436F4420D1BA7B62C35FD8929B1CBDD817307C C3jT
343,036,820 *224A190DF7FE95517B1765CC37259FF626926580 C3jUh
343,036,821 *224E379CE43B5B6E84545DCDF1ED96BEB28DAFD2 C(3=K
343,036,822 *224579560E4241C7D81BBC41361EA7BF8BE4AE43 C3k&-
343,036,823 *224DA5C8F179E717FCFC4ED647E1C6C9511A7ADF C:3Ka
343,036,824 *22451FD34D5ACA6A8B83D1D032EE9FCD5171EAE2 C3K(d
343,036,825 *2243FD4FCB06B45D98C181332D04FD777A54382B C3k-j
343,036,826 *224536123F5CC1D0A25D198ADEA1DF7E5D4C62C6 C3KjA
343,036,827 *224366377045B1B4746922EFD441B25823613BA2 C+3kl
343,036,828 *22446158CB77ADBE6BDEC073E16F85911A9119E0 c3klubben
343,036,829 *22402066A68B7370909EB2721661F8A41F07899A C=3km
343,036,830 *224C2B967C59F764FA2258DEC0A7C3EC8EB221F9 C3kn3
343,036,831 *22488478A6900758EB2556056729A33C689CD59C C3l5u
343,036,832 *22492988DD34E1448B51A4F72B37F62500270858 C3LBf
343,036,833 *2246F5B4DA6E688FA280B4C44208CD1D7D2897A0 C3Ln)
343,036,834 *224C13FEB93AE7AD3F066BCF4346E147BBE80F26 C3l=Q
343,036,835 *22409646F24EA593DBA3962AB458FA2F906BAB1E C3L/u
343,036,836 *224E000566BFA569FDA23FC49B1C19D70CD3F2B5 $c3m3
343,036,837 *2240E9D63500D9D8B24DCD267A27DB99A87990A8 C3Mb%
343,036,838 *22470BFD3EFEAC83B1C9350215313A14496705C2 C3m?N
343,036,839 *224C86EFF6677701520393F6616585D1C8975A1C C=3N
343,036,840 *224BFC3759E6036DEFBDCF09CD4FC35201A3F0FE C3?n3
343,036,841 *2241188CE427EE7BC0BB1EA5F0C38CF5B0FB7AE3 c3n5u124b19
343,036,842 *224B1BF63D2EEBA77EA5317C1A243C602A0FC1A5 C.3n6
343,036,843 *224A402064E4DB269AC5984DF831E100E4407F32 C3n+rip3+a11y
343,036,844 *224F0C4BDB2DCA1845F2F8F8DA0A88AAEF7034B6 C3NRN
343,036,845 *22474F7798294D73B307BC7B28798A137ADCC91C c3ntr3bo4rd
343,036,846 *224867EA909AF11734561924C19FB33154E5E30F C,3;o
343,036,847 *224295440A26982897D5EB9B68807A180D253550 C3o+3
343,036,848 *224DB64C40711942518450B7B21E47873BD7BCBE C3OFR
343,036,849 *2248CD91D6299CE87376C8C548139B310ADF7AC5 C3:OV
343,036,850 *2243E91236D871143C321544A1E45CE3A4AA7A8F C"?3P
343,036,851 *224E1DA5D525B06163531DF4219B3E37CEE04D44 C+3)P
343,036,852 *224343E51FF547C81CFF9FE8970764DCCD8CD640 C3!P=
343,036,853 *224745BE348D2ACCDBB0CF05C35F69BC7EBC103E C$;3p
343,036,854 *224DE75BC25D7A18A006717FF573CFEF6A7BD70D C3:p+
343,036,855 *2244219D1A70E8E0D9A10D51E231AF0B5FF40EF5 c3ph410c3123u5
343,036,856 *224928DFF8C4797023F390933698DDD47D1BD683 C3pj,
343,036,857 *2247A9F891AFA3097C05262EEFCF02C2A97D3AF1 C3$PZ
343,036,858 *224FF65DA72A20EE7CD1381E5221D872BEF44BF8 C3;Q-
343,036,859 *224ADBC64E32F71533AF88162A66D6AC75963277 C3;Q1
343,036,860 *224AFC35202C6C18CDD949BE105BBD620E850ECA C3Q9p
343,036,861 *224BA9E5E3E5755DCC090062CC8D514864080ADE C3QL?
343,036,862 *224E4222EECA25155B108374FF9E0E161B2216D5 C3QLO
343,036,863 *2245E0C264669F103943FEC4EBE2A25A3E8EA392 C$$3r
343,036,864 *2246D7607ED6F324F2EC6B794A1D4FEC9F585560 C3R2-
343,036,865 *2245D13727EA421BC7F93A0D148E54453D41357E C3"r2
343,036,866 *22433AA12F4D1219591B2BFC0938660ED452BAFB [email protected]
343,036,867 *22477758EBE48385B7254E921328B97A022740B7 C3r38ra+!ons
343,036,868 *22473920ADD3591A8263552428E47FF1ED3B3104 C3R3BR4+1ONS
343,036,869 *2245309649A3B87F230EF5FF1E6A48419C9288C4 [email protected]!0n5
343,036,870 *2245C6143969F008134BA51494D7A91B40CBCBC8 C/3R4
343,036,871 *224E521596FDBE6A04FD4E00EB91A3CAD2DB2370 c3r4mbyc1d
343,036,872 *224BD25DBF6F5DFF33C5C364C42C753EB199D784 C3r5=
343,036,873 *2246DA1EDE992FCF2C5375998DCD74A4E8DAF60E c3ratospo
343,036,874 *22412B989F1C98C1644207A75FD3F6E3E53069DC C3RLd
343,036,875 *224EFC2AD69CF2B9E080B11914DFC772197A6D56 c3rn13b4m
343,036,876 *2240E3D32C4F262ECBA024050695850DDEB3176F C3S#
343,036,877 *2244F8E585B5FEB3EE699BF4DD59184267E45F2D C3sbS
343,036,878 *224BAA6938364F8E2BE757CC55B88E5B39F4829B C3SiA
343,036,879 *2244330EFBD04C9BD437A244038C3AA46632C18D C3SK8
343,036,880 *2243C4D3F5FD06B591134FB0FF50EE4A52920BAF C3SKP
343,036,881 *2244BB8E1807020C5A6B42A0BB09204858A9955E C3_ST
343,036,882 *224FAC5BE0367E4BD5418680C5CC0D22CAC70F09 C3swE
343,036,883 *224FA40EA64833E2ECCCAE38E55A5B022EE83755 C3t4
343,036,884 *2249A65E47E3A51364CDF1F29D7F9BBA244226F6 C;3Tg
343,036,885 *2243C445FCD69FACABB2F5A679F9A40AB7E9F240 C3tL1
343,036,886 *224A1B6A01D882A318FB9F17A6C99BCA3B1726A4 C3TM"
343,036,887 *2247169710F6476935711D4112014335B7623308 C3;U
343,036,888 *224DD5FF9F311E7CBEBB388AED69AE17223E9D07 C3U7W
343,036,889 *224EA11C65D6FF4B46137A28B1AC61E1CF9F0529 C3UbN
343,036,890 *2241292C158E5B996D97CEECEC3C21A0B5584A0B C3?uI
343,036,891 *2240F064CCBD7EB544F87D5AC95FCF9774685E3C C3ujb
343,036,892 *2242D027C0CCEF00CF200322489132AF7E5A8A18 C3:UL
343,036,893 *224299B62AEB98207A022273C81CC100353D28A4 C3UoT
343,036,894 *2249DA33B86720D78CC7D2C3BBFCB88713DF89A1 C3uvo
343,036,895 *224E28EF616EE93535EDD35B9BD14FFEC8277558 C3UZW
343,036,896 *2249325179CB0B464EEAD819BFE030A26173F312 C3V#+
343,036,897 *2249546ABAA8EA068CED3C166F2934D67552EE82 C
343,036,898 *2249911B0022E9BCAF48C9E270A23C4325A2AB07 C3V8,
343,036,899 *224E288EC44A67BE175F481DA638A4C3C79A7DF4 C3vBk
343,036,900 *2247302572A8F14ABC86E6086EBF295CC0F56FC2 C3_vF
343,036,901 *224DDE44EA7621C51DD4FC289747AEDAF3C97964 C3VFY
343,036,902 *22442FA3C70AF87C29748B7FD11CD199DD754471 C3VoG
343,036,903 *224FE9577C43E41CD7BB3A4FB2990EED78699629 C3VPH
343,036,904 *224C033F9CC33E2C0F7D8ADE19BC268F52B7AE9F C3!W,
343,036,905 *2240ECE09278FFAFA7514CE707E2D59B9B50966E C3/W_
343,036,906 *22460520F338F03B0CD85E9C95FFF78C8E36A85A C3W93
343,036,907 *22470E68C2F8466446C7F52DAD9D0B90448A7B0B C3Wc1
343,036,908 *224A6C3DFCE760F0C6D0781092626653D5C43B52 C3W=D
343,036,909 *224CDDD3F24A97F11BDBF1DBF873D19A49B886FA C3wk5
343,036,910 *2244A69FAF231EEF8D134A25D04E74F97E210B93 C%,3X
343,036,911 *224AA9D52F26715725D916462012BD4A49CD9A20 C3XfM
343,036,912 *224F0530EF2C0F46A53D99744A4A9879BE1C83AA C3XmK
343,036,913 *224885876E9DBF8EE9EDCE98E3153AC4593EE3E1 C(3XR
343,036,914 *2248B894F6950B817580D72B056BF1F831D58E04 C%!3Y
343,036,915 *224D7BB88065D9266D78FAF1130E9B73A19C2AB7 C3y/
343,036,916 *2247395412695616D6E0441B9E9C96EEE7C105B9 C3Y-5
343,036,917 *224FE5B4697D591E0A1F1B12A8F9A4624E61226D c3y9
343,036,918 *224DC39CDFB72D8890AFF3E8689D9F8862E0197F C3Yi:
343,036,919 *22489CBA22E9615B723D844A033BA537EFE993AD C3Y)O
343,036,920 *224670E79507A33EC4286E4F3B3C4AC123EB045E C3ZEv
343,036,921 *224344074ECEAFECD1C672245A2AF589F24C9C22 C3Zpg
343,036,922 *2248BFE9FA416F419D50F4C7399B2B22185F8F45 C_$4?
343,036,923 *224BAD66E2184124B290AFDACE6263122D98BDAC C:=4,
343,036,924 *224C8DEECB9FC7F26EBD9B8BD369304B98D561AB C4?=:
343,036,925 *22446E9993A8A4AE7EAF8CFF2516F8159BE2AA19 C4?.+
343,036,926 *224AD5ADE6B583441FE284B5C75F2E8CED27C3DB c]4$
343,036,927 *224481276415FE72F33F73DB4E944C41C6651DB5 C-401
343,036,928 *2245207ABCCA018149E5181F906073B48D80412B C40
343,036,929 *2240256441F92914C52DBF1473F0065F5E381208 C4+0N
343,036,930 *2246A21CA133224DFA5AF4E77C3E82FDF00CBF3F C40u?
343,036,931 *22430D11F7C98F886C41F3DE840D26CE8FBB76B1 C40uN
343,036,932 *224F64AB76D51C3C31C9B408947D4854AC19A4C2 C4-,1
343,036,933 *22450F00A3AF9754C0DAB8E5BC89DDF15D93850D C410R1ME+ER5
343,036,934 *2244A10E2AAE8269E18075145E46FF74671E7B50 C4124NN4
343,036,935 *22490F943B4879DCD8AE70979DACE411E6085B47 C41DB
343,036,936 *22470C31640A6852E9BBDD45C39D36F339F80DBA C41IBR473S
343,036,937 *22495AE6D81FC04987D946ED8030A556C57EE95D C41ibr4tion
343,036,938 *224C080FD8B25D02606EBAD98CD8DEB1741F9518 c41oc4rpu
343,036,939 *224E45956E52D68A1D604E9707789B1D2D9F7451 C41UMN1471ON
343,036,940 *22440253F499388F18916AE5D94405B15B9ED96F C41V1N1S71C
343,036,941 *22471387BBF6495D15ED8EEA7C4DB22DA72AF703 C42938
343,036,942 *224A5885E9DCAF4A9EB0AEB30B24DB57D2C52F5E C42HS
343,036,943 *22403C021BD8300BC8D93B21176CBE83B75FBD60 C$42w
343,036,944 *2243F266D9C290A450EAA81968C651579C48DD2B C43:)
343,036,945 *2241E80422F34C3C3C74A57D02265D6395937926 [email protected]
343,036,946 *2245288F1B2360069DC02EB933C9B8F292DCDC29 c438359
343,036,947 *2249C7BF929CEC1549E56DD76E71F96C45FD3C76 C4?3i
343,036,948 *2248CC56C10CE8AFF8F1ADD3466689399C08860C C4#3K
343,036,949 *2243A63CE43D007C3D40BCB0EAC567124770B6DD C43"s
343,036,950 *2244768440B89F219ED3B8E254A5F6E9B5EA3BA8 C-43Z
343,036,951 *224C36816A982DEBE3DEA61B544AE8D077DA5BCA C44U-
343,036,952 *2243FE2D2A0668B341B4EBA58775D502D68158D3 C!4%5
343,036,953 *224A0DF3652147A92ADBEDB62AB4D281E462E6F8 C45+194+0R
343,036,954 *2246D73E7FC8F446F7746DE144FE985D5687657B c458b237
343,036,955 *224B58AF4C49889786AB461F0214158716327AD3 C4_5h
343,036,956 *224DE03BEFC07686392752EC8D9ADD8B564ED576 c45trl4
343,036,957 *224323F8B73E3E0979708B1E4A4A7C1801B1F3E2 C45/X
343,036,958 *22469834CB4C3B5D02BA0DB71D01427830F1B469 C46+w
343,036,959 *224216C26E2B7311E8233C54F2E1BC1040922884 C%?47
343,036,960 *22413257FD61F8E271247C1DBF5664BCF53349A0 c47112
343,036,961 *22482C7B1D3F00B33CB032E7A3E7EF63024B49D6 C474MI73
343,036,962 *22414EC169B40C9F020B7F10E505B75C305118BA C4.78
343,036,963 *2244ABE502D9D327C61B6E9E0B8689BFEF6B0DB1 C47eM
343,036,964 *224F3E73136A212272495133B93E73C7AE82A47E C47ERW4UL$
343,036,965 *22441BE6A1EA0DCE444A956BC2B63AAD3DD9D34C C47f,
343,036,966 *224FF2AF8CE2587AD6732C2C36B39B364AF9AD5E C47O=
343,036,967 *2245BDCBFD5220A014B93DBCECECFA6E826BF9D2 C4841
343,036,968 *2242D80BD2B27E8960FEBC1A8EE79F1D9214D860 c48550
343,036,969 *224F7B76C5DBB87567C2FC0009983ADF4B1C8845 c48ecqamdgnak1
343,036,970 *2248819BF7ACD4C67153E7AF5D4BFDCC1D543C20 C.(49
343,036,971 *224DA69FDE12C3B60ECB6CF834BB715B82F0E53F C49Oi
343,036,972 *224DCE11927D53E0ED0B96DEBB63B5D4F56F5110 C
343,036,973 *2249217CE358314309129AEC743474488D91DA22 C4a=9
343,036,974 *2246F7FFBA75DF746D0B0F63CDA814894EE3FC09 C4a_A
343,036,975 *224A1885DC245BA4853BB5FB676E1A11C06D0F34 C4AEv
343,036,976 *2242E0007E422AC5E53071526FD1769096E44BE8 C4;ak
343,036,977 *22447CAD221C46D5682EDCBCE9D0F3DEF0790F5B C/4AL
343,036,978 *224D20C4FCC2AFAD687D7E52B52AA70038DBF508 C4b$
343,036,979 *22499AB1A98595C6CC1C79395BFDFB476394A23D C4Bf_
343,036,980 *2247DE5BE1BF4A02E45A1DE18F63B16CD5CB2E6D C4bij
343,036,981 *22484F6D901D007767D764FA638ABB88A87A5F0C C_4bp
343,036,982 *22404BE0DFF7613EC81D6E5116E56DDCC4A48384 C=)4C
343,036,983 *2246AEE82AA33A947C3E24884252869B7E32A3C9 C4c$"
343,036,984 *2245F1733D069BDC42D2B168B7A344B85064F096 C4c2(
343,036,985 *22402509CCD85BFD81BB1B19F744486341AAAE17 C4CFV
343,036,986 *22489D442308E50D64DBCBE884A975AAABB01424 c4ch031r4rv05
343,036,987 *224B852796F572A3CBE672B809E584A2ECCA3C10 c4chmens
343,036,988 *22437B717646BF2FBFB35D52B3F6B3D78FC8E179 C4Ci
343,036,989 *224BAF0A0ABF9986B4EA7816F2F29606DDB81B57 C4Cq7
343,036,990 *224D1D94EE32072D250C32AE5DA40717E08B771C C4CS0
343,036,991 *2241A312086F73CA242F453A7DC123270E383E50 C4CwG
343,036,992 *2240BFCEC9481133B8546DDE2CF9D5558DC23E18 C%4D(
343,036,993 *224DBB958F3E90206AB72271D01736B4A9C069D3 C4:D)
343,036,994 *2245DD3BE9D6F4374AFC87EF6546CAD738195425 C-4D3
343,036,995 *224F72ABA1A58E37A6713E7BE7CB8FE5A1E24BC6 c4d35t34u4
343,036,996 *2248F496751C73CC2F3CB22FF4D1BCFACE769084 C4Dfo
343,036,997 *22468D351DF5D1AEBFA8E1F892FFEFB8480816B6 C4"dl
343,036,998 *2241E6EA60A62EDE49877416ED2136EE254FF4B8 C4-Du
343,036,999 *224992117BC5F575A74145D27586F77DCCD22F39 C4?e)
343,037,000 *22417B5AB97086BD3BE7CDA29088849B8F4E6110 C4e=4
343,037,001 *224B1990FFF708ACB27DCA8FBD0F71B474D86488 C4E5
343,037,002 *2241A3FC4B5C1ACC9CA254EEF49DBE4F888E6A1F C4EC
343,037,003 *224FD2B7B63FF6A4B526602DB57264D466777A23 C4e#D
343,037,004 *2248CD95AB822A7134B96731C7C8535E8C563712 C4El=
343,037,005 *224203F5CA2A4EB102E4DFD3FFF7A831F11D2A0E C4(En
343,037,006 *2247BB1847FD9ADD55A6DF2BD2314AA48975CB43 C4ERX
343,037,007 *2248DBE79910156B832B87E0C26BB172BDA09DEF C4=F2
343,037,008 *2243DBE9235C68C6DA5992597990719BBDB402F1 C4F50
343,037,009 *22481C504E9BFC846AC7A4F24A35E2BCD14B6EAC C4fEC
343,037,010 *224EF3204A2EC100DB3292F392B84F882CA601AF C4f#q
343,037,011 *224A473FD08A8C07F9F49C20298A20DB3B7CD6B8 C4gbD
343,037,012 *224B3884882CF4EEBF2355E0D201504A9D0038E0 C4gG&
343,037,013 *224CE02BA875C5C3460EC9DCA89347BA53540212 C4(gi
343,037,014 *22496E29D452C6076741FCD1C056C924A895A882 C4gjV
343,037,015 *2245E744A8EA746E7611167A03ACE772D56B1974 C4GPG
343,037,016 *2245919D36A8070A4818B4172636050A1F596665 C4GPl
343,037,017 *2246323AB607B951DFBB1D514A950966193CC6D0 c4h12geo4
343,037,018 *224362B69AC3E2D83B89A0CDE6BADFA8D2ED99F3 C4h8p
343,037,019 *22422F7E7314838B2E0F5739BF0138FA12019B46 C4HcH
343,037,020 *224BC32B5762DCA1D551B01314E9D207D4542BEC C;4hH
343,037,021 *224134D63F2DC21A0EF5093D4C824ADBD9FC4F78 C4hl/
343,037,022 *224C699F8BFDD21166F16FB443B47AA237A27FA6 C4hlF
343,037,023 *224BC20663715C206761F835941CDEE766A85A4A c4hlung
343,037,024 *2249D8CF6263F59F18193DFED684D81878059AA9 C$4ID
343,037,025 *2245CBC0FAD64C7C0DFAA1B055F45241614F7A0A C4iiA
343,037,026 *224774E5F295D1838B45FB23A59B70AFFE9C5722 C4(IK
343,037,027 *2240B9459A3EDD7E6A004C4D4F96327711E9A022 C4iTc
343,037,028 *2240F3C759AC6BE69653341614383543389220EF C4Kg9
343,037,029 *224313DA00A43CE2BD576133E3C396DAB15642E4 C4kgW
343,037,030 *22463A3E639AEF824D6F915B012052B76C283E1A c4kostja
343,037,031 *224374BD882663297ED9AFE01CD818BBC6D68536 C4kXw
343,037,032 *2248FE6A058D1549557211013DADEB33E0EEA161 C4kZc
343,037,033 *224B1703113E50204C21621B3763FFD6BFCF534B C.4,L
343,037,034 *224BF0FFF96F429504C369AF395A993FA18B147D C4l4mi+i3s
343,037,035 *22419BC151FDE9CC92CD0C6502A90AB5E02BCFC0 c4lbur34n
343,037,036 *224F888B742E4DB25517A8449FAC86878196ECF5 C4LLING$
343,037,037 *2241E71F9416CDA6A6928319C80A6F83B76EEA23 C4llou$!n9
343,037,038 *2244ACCA047466D3DBBC1376483C57C18B9C4B32 c4llsd4y
343,037,039 *224B4117D75AEC1F177851F34887FF3A9CC2F9B1 c4lorific4rnos3mos
343,037,040 *224D931628DADF43FB3519148204385829820E12 c4lri
343,037,041 *2249B5D1BFA22948596406C7F7039844C1DBFC33 C&4M;
343,037,042 *224B72C4C7CA93ED078101AE4C3542D5CA1C95A2 C4M.)
343,037,043 *224696A3350628844646AFA9485B8AEB401247FB C4M"D
343,037,044 *224D47E226D92F5E7A80BEC62306170DDCCCFF1F C4MfR
343,037,045 *224638236F6D47E407C2ACF95F965C2F0477CE51 C4mnN
343,037,046 *2247D53A146998EE399099CA3855E915FFF5223F C4mVE
343,037,047 *224529B98A4898C31D16E68D897337210E6286A6 C+?4N
343,037,048 *224B2D2D5ED59E5225EBCD5EAB389D5C8EE4F2B2 C4N+)
343,037,049 *22495D448BCE9FDD74E722DDAF923F38C22495F5 C4&n.
343,037,050 *224B9A9CEB22F082CC7746FAE5B22197B2B9B538 C4n4 br4v
343,037,051 *22492C4B85640BC55976BF13E50FD303DD6345FE c4nb3
343,037,052 *22442A0E99951637AE251A91E07AB3CE9949A300 c4nf0r4r53
343,037,053 *2240440C5D6C9103F5DFD5569C9F4942214E9B8A C4NFU1S
343,037,054 *22494D19CAF6F59F28B54B87CCF3A03C2F342732 C4n+h4l
343,037,055 *224D117158E6AF5B252B32BBB25740DFE8D2D6DF C4N=P
343,037,056 *224A609B8B0144495DD6339A48C824B9CDEB13CC C4
343,037,057 *2240B089C24A68690FD329C5F3DC046CC3B3ED8D C4ObG
343,037,058 *2243238FD7B5BCE256007A18D409C8C9314AA56E C?4oI
343,037,059 *2245AA4F57347940FBFF863570B70A7F39FD844E C4OKk
343,037,060 *224E65390060847C22D584567F5B4F5E1A27EAE6 c4p1n4rm3
343,037,061 *2249B1A7A5F3B1BF9B74AE307247C8FA549D9FFD C4p1t411z3r5
343,037,062 *224409654BA33FDFE00007B730F4A9D2196BA875 C4p1+ul4ry
343,037,063 *2246ACE2FA011990FEDDAE7207F53647E389914F C4poD
343,037,064 *2249E0ACB494DB1D85E7C3B7220528E4DA852978 c4pp3ll3
343,037,065 *22420B3921A54F3155BD44FA7C21487BF5B10C96 C)4Q-
343,037,066 *224BC1FB807CE1B4A39DEFB9733144F003B103B3 C4""Q
343,037,067 *224D68AD1621D0D1CB1CB57DC1C310E810B98B43 C4#q+
343,037,068 *224B569E9D38F5F5FD1256270FB4B9ECE438885C c:4Q
343,037,069 *224C57EA55CA7E4EF8C5C58B9D05FDD402D6B0D9 C4qhq
343,037,070 *224FAAE7FFE25C918709C71BB025F8E4A70302BA C+4qS
343,037,071 *2249543155780AFAC0AB9940529DE04476014712 C4(R;
343,037,072 *2249D6D440603D6D26EE19EEBD0BAEFABD0B79AA C4#:R
343,037,073 *224C9FB884D316AA682BE8859F53F319BF7F07F6 C4!R2
343,037,074 *224E1DD090CB268453299F7462B04EA780712F92 c4r3ll3
343,037,075 *22445A8AC2694EF21643507D67915C5DE3DD8FAA C4R7OONI$7
343,037,076 *2241E3C337B07B04D5BB4AD8490E79677B2CCC62 C4R7WHEE1$
343,037,077 *2240142530F68F4EB877AB1DA3FF7D9CE90CAC0D c4rb0nni3
343,037,078 *224BD5C51A233806E9BD7CB4A6FBE7AADC3E3938 C4RB0R4S
343,037,079 *22416F0014C321318F2E8D86C266B8F95DD63665 c4rbur4i3nt
343,037,080 *224E686BF83D8D2517519332463A9EFB5B07FAB0 c4rcos
343,037,081 *22473DF7D7CF5A3BBB1D3D810A5983FCFB182EB1 C4RD!OGR4PH!35
343,037,082 *22462D16DE74A269595C9D24380C1404BEB1A421 c4rdsnumb3ring
343,037,083 *224A14990808FAA59090AC9A4968BD1BCCFBC31B c4rlm
343,037,084 *22460496534F4BF93FA7477FD1CC6730BDB0AC29 c4rp3nt3m
343,037,085 *22457155A80CC1646F2D039F29A58DBC4EAE6E4C C4RRYOUT$
343,037,086 *22499BEFAAE00250C7ABDB42C7118604D7168082 c4rt1l4g1n3u53
343,037,087 *2248472E5DEC9CD9EAE733C807BD6B7591987D93 C/4;s
343,037,088 *2249678A0042955B2B1815D7B076F3F13CE6481F C"4_s
343,037,089 *224A85CB2571B44EFECAF615629E45837D74C07A C4SbM
343,037,090 *2241DF14A270AEF9FA71B3128238ADF3B6449F80 C4,sk
343,037,091 *2244E464F87744F20400122AFDDD741DB7FF9734 C4sm_
343,037,092 *22457C05140D07F68F4F7C657B1DF46FFF36343E C4s%P
343,037,093 *22466C873F6D6DB5C8725FB97286CA901892B69D c4sti4is
343,037,094 *224D2523847DC252C1727741500BF8CC73904AD7 c4sti4rmos
343,037,095 *2244FA413D84F818326CF630FFE1046CD581204A C4s/Z
343,037,096 *22441452C19305EF31B857D589D00B2E4662AD85 C=?4T
343,037,097 *2244C62F59C94B3438E0B744E187A777DFEBFFEE C.4T"
343,037,098 *224BC5437FF3E90FFE4A5A59D1FDD673C1C62BF4 c4t3g0r1
343,037,099 *2247C1049FB6981A045670E130276440EB067978 C4T41EPTIC5
343,037,100 *224D4524D8F264CAB4EB3625E9FA12B9B55B7360 c4t4l0gu
343,037,101 *2242A6D1DAFCCBD392EDA90655A961339F69F250 c4t4l1545
343,037,102 *224415B42190CBDDA96F589A5803F46603BFC287 c4t4rr3io
343,037,103 *2249966FB19513935677940EA63BD0EEE861F1CC C4ten45
343,037,104 *2240D16C3191ADE4EE582C28E95918E6BDEE9E8B C4#tf
343,037,105 *224194A6CA8AADA3F76FB231DD6CC9BFEA95C10C C4Tlw
343,037,106 *2241EA654D7AD1F2E49C5FE40C8B6678B7E09BD4 c4ton14n
343,037,107 *2248BAA88A348A7B5E047642ADC20976A0B40DC8 C4TUq
343,037,108 *224FA9E45AEFAB523AC4E853842D07BE066F41B0 c4tv315
343,037,109 *22465F306E8062B34CBB2F2E03B4AADB10CC4840 C4=U0
343,037,110 *224B78EBF8811F4F9F6423509066AA67EF511F82 C4U1n
343,037,111 *2241221C0A96757E04B29ED25AC7B3ABC4B4E7EA C4u-a
343,037,112 *2244E02233FC2AA68107CA102F4441F3B5E768FA C4ub,
343,037,113 *22466D6B4C470161BD71985654938284244D9FBF C_4uj
343,037,114 *224804E0288DC2C7AFFF0ADF1749962DFE42AC07 C)4UK
343,037,115 *22409C1243D1C26CB285C0E1CE6C12669332C804 C4Umv
343,037,116 *2246448683DE33D294912243CC519B65D1D0056E C4UPg
343,037,117 *22498087DB3BB249C250155533D19EA702E00B63 C4ut!0usly
343,037,118 *2242556E3D43B32758C6D75A81A6CCD8E810AB5D C)4(V
343,037,119 *224900F1FA1580721387E2E581A8E9DFDC08B68F C4V(
343,037,120 *2244ED29C95CD079AD5E94EAD6424C773B343540 C[4v
343,037,121 *224C431D37558946BB0691369E7E1D489853F2AE C=4v0
343,037,122 *224C19EFFE8CCE568C08785965123019A57CC62C c4v3rn4ro
343,037,123 *2240E99627FC806A8B69D3252B8B7E2AF17E736C C4V&D
343,037,124 *224C8D27B795079C58686203BB9893BA2E62CFF3 C4vij
343,037,125 *22484F7C50568BC4D7E0CA30B3F2F39FA31ECEF4 C4vKo
343,037,126 *22432BB78E33B8056C364D648C15ECE991F454B5 C)4VM
343,037,127 *22486396ABF060DE690671409795E181C4EF5016 C4vZ7
343,037,128 *2242EE99E290E5297BAFDE55587ADFEC4810DC0E C;4$W
343,037,129 *224A064DA6615CE17745F136DC252656B2A5EDEA C"4W(
343,037,130 *2248128B928EAEACD10FE5172ED5E3EF59A2C79D C.+4w
343,037,131 *224888422A0E8CB5C149634DA9DE39204B49BACE C"4"w
343,037,132 *2243C37A8CA4EEF0C4E0DA58EA642976D1CB4B52 C4"wi
343,037,133 *2240671F7CE5F8E27F1C568B3D12050FE6D661D5 C4wmS
343,037,134 *2240672DCB5054B795811FA16CA75938C95C980B C4wN3
343,037,135 *224BDF66495F934EC716744571DC68443AFA9F81 c4Y3
343,037,136 *22479CE2F4EBFD85AA7C13B092F1973B7633AF10 C4Y4K
343,037,137 *224050395DE0AE14339F36A43CB1B992E20F098A C4Yb5
343,037,138 *224B0C8A7FEDB4EE3079C66242A271FD4465B5F7 C4Yhm
343,037,139 *2249B49D0D11A226E8BE7A16C1135DE448E3E4D7 C=4Z5
343,037,140 *2245FDB57F8FF470FF72D7D0B3D1CC9BCD2F9B5D C!4Zw
343,037,141 *2248A7C9C0D3D0D3B735C356D627E7D70B0E1A4A C^|5
343,037,142 *224E2E0C4E511F1E5C06E5A6EF176F20E9564C6B C=-#5
343,037,143 *224B749EBC624130D28F3E25A302BAA4447289FD C=5?:
343,037,144 *22478B495251804CE638C4E55390A4256C18EA4D C(!5/
343,037,145 *224829250C9CFD6276298804FBD67835E6885025 C$(#5
343,037,146 *224B0E9750D4B9C420DFDD68098E084029C31E8E C&]5
343,037,147 *224E18E9876570A5165641345B8DE471D9053155 C5;,:
343,037,148 *224369E0B25A24E3103EC8420A807B400EC6CD02 c)5[
343,037,149 *224D83138249E583796EA3F261D29476B73A6DF1 C/50.
343,037,150 *2240FB67EC1B9DC91E5925C8F228AA07A06BAA7B C5?0d
343,037,151 *22403E51A9717FAD8AC8DED0DBEFD61391681FFD [email protected]
343,037,152 *224B8092E9F0DB5784D5BB635B732E666C3C16DA [email protected]
343,037,153 *224451370579F8A9DB963D8FC722083ABE0A481E C51;H
343,037,154 *224C2685545A53E64D2296975C6A5D49853D6777 C51Ks
343,037,155 *224C26D25427198D0EE5514AB367E9ABCA445798 C51Qi
343,037,156 *22480D33CA39C378A1AEA775282A20B0AAEF813A C:$52
343,037,157 *224396CD4EF8DF7EBF58C86C9695382498907850 c52701
343,037,158 *2246E14C21A25CE0B466A79D439289E763666122 C+52I
343,037,159 *224109189BD0BCEFA898EC4030820A18F39B5D07 C52M-
343,037,160 *22451CC96F694DBE38E4AE96C8C5C764D5FD7E02 C%52R
343,037,161 *2240B94EE8B9C89B64D010101C53590484B004B7 C53
343,037,162 *224196A4CA6F7722003E50D9C094E518A02874BD C53gw
343,037,163 *2243F06D1CBCFAC2E8DC8BF9978B6B1D2BBADEA6 C53U_
343,037,164 *22451033EBA03BF716139104CEAFC33BFDFCD619 C)5)4
343,037,165 *22469B6EA95F39C32A3105C84B5E7DB14B34C0AD C5?4!
343,037,166 *2243CF34D4FA903C3DD16FED4FCFD3748EC37415 C544O
343,037,167 *224589BC2796C5F55395CFA9ECB85A9CBBE4DC95 C54ng
343,037,168 *224F0B833DE56ABA6430F27E943186F230ACACBB C$/55
343,037,169 *2245369181E5361B47832582EFF7563AC00998BA C550citation
343,037,170 *2240D4773919F8E65549B3C64BDE8C8058AFBF72 C550u
343,037,171 *224730A34A53FC12243C69B13B0451F770A1B2F0 C552&
343,037,172 *224B476182564C1E81930F59E3D9158F79BF9D96 C(554
343,037,173 *224494B6E2F8A1D4D48E2A47EA9413F599157A51 C55a8
343,037,174 *224FD58E1FABF07C7D8BEAE6F7601A1253669448 C5(5t
343,037,175 *224EF3EB3235CBB90C7823C43D90AE70DD940E47 C56a+
343,037,176 *2243395A9D273F9E3F2B5B8014EFAB65A7018B00 C-57/
343,037,177 *224FBE34115A0992E33AD54A9D13B460929A6743 C?57P
343,037,178 *224F2EA4887D233DD70827E3DC0F0CC360BFCB5B C/57s
343,037,179 *224623C1AE490D132C2CA93C7A435EE2A74629CF C58$+
343,037,180 *22489F1526B5262B0B611D83F24684BD5FA34528 C59S&
343,037,181 *2243906E5529758683B6873DFA15B829A0031B80 C5.A=
343,037,182 *224152E74E29957153EBF0FDFC60C2ABFFCCD40F C5a?3
343,037,183 *2247E87220A9B644CEFD5EFBAB7EACA020019507 C=5a8
343,037,184 *224028F9E7BE828C51C0FACE6CE4BE1E743B1871 C5A(g
343,037,185 *224FB5D31980FD79E6A9874A11E47A40F9238A04 C5aHS
343,037,186 *2245C9042E8C6F7CDA833ACCF28358DB7B0F235A C
343,037,187 *224E3883B2C3A5169123DA37C8FDC6703B21AF58 C%5B3
343,037,188 *2244B414F6A0785D057A8C7F75698CBD5A4AEFE4 C5bqc
343,037,189 *224AF721A2F692E75CBA53DC4BD2612CC799C78F C5C)9
343,037,190 *2249BADF82697543DCEA3AAFCEAFB5E1AF91206B C5cD
343,037,191 *2245C47F0ADD98BB539066C3A4D3316EC170A598 c5cents
343,037,192 *224F2198549F5922CA11FCEEA89912ADF7FE4464 C5cUO
343,037,193 *224BC6141898D8E6A58AF3A0F64A436385BC60E5 C5d(=
343,037,194 *2240DFEC1086EF6D055865C4AF19244D13895B9E C5Ddl
343,037,195 *224B994BF5238C210FF3F32FBDB1867CB9F3F66F C5deR
343,037,196 *2249AB2B9FAF90A82633C7627DA79795EB53E21E C5DI9
343,037,197 *22428953E85406985304213A3B487969898C636C C5dS2
343,037,198 *224CCB48D4C5F3DDA707CDC41D6081EA4C9EB609 c5DW
343,037,199 *2245D7DCC52E31FF200132EEF17C0917675C186A C=5e!
343,037,200 *224F0AE141783A4C14D50A0F3E8807373F5F21F5 C(5e?
343,037,201 *2241B7C58C25A05C75D716574CCE34167C25A70F C5E20
343,037,202 *224BF54DA52B26F17B06C9D5606623988005EC75 C5E!6
343,037,203 *224A5B415C693E7A568651E0C3B9048BEC26150A c5e8c10d03
343,037,204 *22407E300E181679CCB179D1F3247E810CBEDCDE C5EH%
343,037,205 *2245F0EFE1C75DF3C95B7B1833AC13F73E3C7816 C5eOj
343,037,206 *2243A1DF5DB095DC56D0328EE9AC9E11B1DBD9AD C$5eS
343,037,207 *2245D463962E9C3F1F4E9C75B020CCDE35EF7B49 C5EZU
343,037,208 *2241626DEBA5761D162D0956A5D93B60196906E8 C5f&N
343,037,209 *2240D741B36E46771ED7AA42068AD1AD5EB184B5 C__5G
343,037,210 *224EAE584E1C2FEE34B4FFA12009E55680FAFFEC C5G5W
343,037,211 *22456A4EDFF8561B1A4D60011DA055F7DE4BEFE4 C5gp.
343,037,212 *224DBF3F345780C93E57FD1F3E08B84441688F27 C+5h?
343,037,213 *2247B78CFAF61848671EE995BEEC7C0956CB5AAF C5HAG
343,037,214 *2249D39EB1315B21B22CABFC8AF90F5FDDAD349F C5hAr
343,037,215 *2243540D8C298D21F99860884293486B0D75DBCC C5hj)
343,037,216 *22481CEF19705EA994D704828AD69CCCD4713B62 C5Hnp
343,037,217 *224002DCB8B6F8D919E80CA4BA59C3748881C8AC C5h=o
343,037,218 *2246D4F2D4351E2C2592CFE696BC51D212B628BB C&5Hw
343,037,219 *2241242353C2660F037ACC4EA7A0527A2EB0A532 [email protected]
343,037,220 *224279F83EA77D0BD54B4C3732DAB98809D93500 c5i]
343,037,221 *224959BFBAADDE05105D1656876BFA346E03F59E C5I9$
343,037,222 *22411914CAF911B4DEB7CE1746242DAF6CEDEDEC C5-iA
343,037,223 *22472BF740A47E7F9154DF7FA31737933DBCC642 C5iaX
343,037,224 *2248189AF7CEFFC2F04C3733D61683A0D9894A35 C"5IP
343,037,225 *22447307EC146550E39DA34095AE15B444212DDA C5IsC
343,037,226 *224A83BDD5BA18276F28D978EB03A8605DC03812 C5iV=
343,037,227 *224CB676B470F7E654A51F95A7F8342A56EB1ACC C?5(j
343,037,228 *224ACD427FF4B7301A7007E1FA1B2D280203D5EA c!5J
343,037,229 *2246C770D6683B8823E1443A9DC85143921A0081 C5j7T
343,037,230 *224D70B95E03FD36108BA0DE79B019C9E582D663 C"5$K
343,037,231 *224BB307327B095F8ED2C059929B59FC8AE58104 C5;K%
343,037,232 *224465E9EABF51A3108B817160A6EBA233D5FAEA C+_5k
343,037,233 *22429BCC55F9F0FC7CB6FD9440EA045FDC97EDE8 C5kGZ
343,037,234 *2242AECAFE1DB4499267622D75DDBED55365C8C2 C5k=I
343,037,235 *224312E70AD994D1FA0F34F7397CA74254BA7788 C%5KU
343,037,236 *224FC23869E93D52D0BACF6B5098E803717C42DF C5l2"
343,037,237 *22465AF7F4FFA1C9BD278442FDEB79E0406D0987 C+5LP
343,037,238 *2247F484968CC78A1B22DF12E8FBC52689FCD9ED C
343,037,239 *224CD083187ACF84203ABD14799B14C279BCB5FC C5mDM
343,037,240 *22421D7DD38DD16BAD3938206C34671F8B8E5281 C5MGY
343,037,241 *2246AEAA85A0D87A80D67522254218CC2C437E48 C5ms2
343,037,242 *224A1D4F384FCB94CA48B7E1AC10F190914DC5B8 C5mX)
343,037,243 *2249A4C94CDC5261F5A3225F9EAB93F7A88C0E26 C:5NA
343,037,244 *22471D56CE81CBA93DA5381D790779649DA0D009 C5nBG
343,037,245 *22479FEC1E537FDE6458797DF381C3EE19739B30 C5neo
343,037,246 *22495BFFCC018C6D68982FCF0FA64C2095F73406 C5nTa
343,037,247 *2241EA54980868049D141C5B464493909BCA36FB C,5Nu
343,037,248 *2241005AFC35B259B8F71FE5B304D6B5F6BFAB92 C5NW,
343,037,249 *22469D287FFF4170652B05CDE4F7819197201574 C5os%
343,037,250 *224BCCFEFF3DB89F4ED5FA8B3B7EE37A375B7FE9 C5OWK
343,037,251 *224F87B831CB1502ADAB471A12E7225C415D5F80 C+5P_
343,037,252 *224E1DD02929062B44FE4DF9C1B4432880698C17 C5pp&
343,037,253 *2240BE9A5A1967B32094B84DC46FB2E05B6CBBCF C5Q;#
343,037,254 *224262F55662FBA902DD7B3E568F933E9ACA2C51 C5:QD
343,037,255 *224D5954C7ED597299231D29BC2CD92CA6BE08E2 C5qFL
343,037,256 *224CA556E3AF27CC0722FEDBF96C802E8F11C594 C5qsh
343,037,257 *2241EB1B39C75A5D44C58E65CCA8DB57207239F3 C5QTL
343,037,258 *22423BCBF3E7805B8D4439E3E686EA8377495DB0 C;5r
343,037,259 *224C6AD409E6FB1108310FAEB8BDBFE96DF1B718 C%5%r
343,037,260 *2245F0E9F6A9ADCA0FCA649FCEF7DDDA8CC2B541 C5R4k
343,037,261 *2244CA352CAB8391EA6D379DD87808AA4D7AB33C C5Rb3
343,037,262 *224FB184E2F61647ACA41BCB7AD6C23E54B829BC C5RkC
343,037,263 *224F9AA041FD4FDE432B49DDA9FBCAF4A246BC2E C5rOH
343,037,264 *2248C5EE564F63B6D297205772D57DA67E4B8EC9 C5r.V
343,037,265 *22431C94F6ABBC42E7E10232C05E3871A6B0CBC4 C5srL
343,037,266 *224F90EFCA5591C4E1316806A82F412E6D30365E C5tc4
343,037,267 *224AD57FF18E48D1A05A9DF58D5337D3A9BC2534 C5T"n
343,037,268 *224FA0E64211A298F2D41C8FB706BB5E3438DA6D C5tnj
343,037,269 *224FD3F77730550DE30BBE6EFB4CE3738C8A6AE7 C5tOK
343,037,270 *22445BB5FCBCAFDE933F888E244C6EC35DB9A860 C+5Tr
343,037,271 *224BCB3ED465B7756C2A132273AB224A2B06904B C_5:U
343,037,272 *2245999DFBF26C2E834EA23C1CE6819606F5FE5C C5!u"
343,037,273 *224CEF009FEFB573492537F71740485B7FF95258 C5u7j
343,037,274 *22444C0865D800776CFDDEAEFE170B6243C1FA88 C5?U8
343,037,275 *2248716B368E055A8F1B83F9B46CA0A94FC286D5 C5uGF
343,037,276 *22485AD40BA44674983B269FF17E3636B23A7985 C5unL
343,037,277 *2242FEF3D5615AD932A6C0CF5CACF41A6B567D6D C5
343,037,278 *224E4A3B02CD93645E25D09E6814F428B3EF75EA C5VW$
343,037,279 *2243E66822B3019ADF7ADCCAA9B4A1F1B73EC8B4 C5,W/
343,037,280 *2244CBA5D37751903BD20841DB4A66BBDB4DC86C C5,.w
343,037,281 *224BAED3650F8F55E2861CA8AFC14575688C9CA7 C%5WB
343,037,282 *22437BA91A1F7C5994B577566657D58321372EE2 C5WK2
343,037,283 *224555A6BDB0648DF591A84C50DAC25391731AAD C5,wV
343,037,284 *224A9B389B93E1577490879C1AE2096503D8764A C5XEH
343,037,285 *224F747F75371C0AC090C7DA962737E3971FB000 C?5Xf
343,037,286 *224EC759F8217AFF5365DC78FE01121BEDA417D7 C5XnS
343,037,287 *22427D8F54C9156F61752A31574797683D61568B C5X?P
343,037,288 *2242F3C202593749144575687EC63D58BA452A41 C.5%Y
343,037,289 *224F4778F079718601D5BF0B1A14E63302FD8E0D C5YjE
343,037,290 *224E74CAB17FA24E496AEDA42F1E40F9C13FF807 C5?YN
343,037,291 *224CB988CBB12355C9E151BD79D64184B8C14FCF C5Z%e
343,037,292 *224D6B0382E8B8BE16C5F10D5476ED31A33A1B71 C;?
343,037,293 *2246E42EF68C0EA5D1A141F921044E253EE65404 C!!6;
343,037,294 *224737A21935AE41F5756944E1E52EAD71CBCA4B C?$/6
343,037,295 *22427C096C86220F962F4F4BEDE54A4F932252D9 C)6'
343,037,296 *2244F731A9DB7487E40E11FC8D85EA786D4AE360 C{6
343,037,297 *22488E50B37DA1C67DF72E94C783FC84B037E693 C&!_6
343,037,298 *22405C20D1D987BE5B929C3F4886E4BA0E41FDD9 C%:
343,037,299 *224FE8984E37B267272C550F70884B6E2294B6B9 C%#%6
343,037,300 *224DDBDDC1374FCB1505478AE9F1728BDB6CF421 C%%,6
343,037,301 *224A0CDDFDD865E004ECEA9D1EE09A2845543DCA C6_)+
343,037,302 *22407ABD23A295F62C109B79A10CE0B9DDAD5551 C6#:.
343,037,303 *22403903DD165DFED4FEDD3DA0C9E5D95BC5D2E4 c/6:
343,037,304 *22441A10A36410D5496BB81811B36F2042E3E4C7 C61AM
343,037,305 *224439DD20F0A029E512C9AC47DCAF76D58C26B3 C;62e
343,037,306 *22443DD3B4D8CFB94108D22D10DB54BEE7D91FAC C?62e
343,037,307 *22423A3D6D78DBD435818ABF0E3BD6F8627FE2DF C6:2O
343,037,308 *22426ECCE8F56EFC3700365512162E46751E19F9 C62vU
343,037,309 *22433D2B8D45F133A423FFD21195DE733AE19F57 C638
343,037,310 *22428DAE533BBB9D59C477A11674B2EFCC0DC4BE C64jP
343,037,311 *2244E025F51664F7213C7C5ABD6BB992C0F3E1BA C64l:
343,037,312 *224539F9D41DE68E3ADC666866A11CC8D660AD68 C%64T
343,037,313 *224D09900875955EBF1FCE8323C80C40CA96C0C1 C64_t
343,037,314 *224326F5CEEDD2C31327C66EC1264361CF92E579 C64wh
343,037,315 *22469A0FE371FB247DED29FA3AC96C3AB79704D9 c6592693
343,037,316 *22449B5BB836F1931F9E7882ACB0CA3219606BEF C65!q
343,037,317 *22426ACA6440DDD54ADC94DAE52E8D5E7968BA23 C665l
343,037,318 *224CAA57434F1DB2674789EC37604F3E713072D5 C665S
343,037,319 *2246AE336A3CBEE8260D9121C9B7199A8D78F46C C66s&
343,037,320 *2241149638F8ABD6BF823949EA566ED7201BF663 c67311
343,037,321 *2246229BF402699C6103DDEA5904BCA00B70A4BB C,67a
343,037,322 *224669A700D4E004EA286715B944B2ACFA6FEFF9 C6$8H
343,037,323 *224DB0F113420048341A72B4CF656D84D7AB9EE7 C_68l
343,037,324 *2240C2A8C87E806275040D13CCADC873725057CA C69"$
343,037,325 *2244D413FA4C14EF58FD671610B206F456A85CD7 C69Rm
343,037,326 *2244E54EA33C4D36E9A022365C8DAFEF80A4C4B5 C69_Y
343,037,327 *224BC24D535BE66759F3B107B0DC4BA5CAB57C50 C6a._
343,037,328 *224318A816C7F233ECB46EF9D541B32ADC647ED6 C6(A4
343,037,329 *224BCF07EFAC637BB00B7BB0685B1B24CAF9ECD9 C6+AF
343,037,330 *2244E999513C8353B4BCE2AAACE0047DB49078B2 C6afW
343,037,331 *2249A71FEBAA518C09B86DA594FB3A755803FB9A C6agT
343,037,332 *224B1CCA519F1ECF49935015EB1466DCDA81358A C6aNW
343,037,333 *2243BBCA07FB457EF8637C8D98AFDE8668DB414F C,6AU
343,037,334 *224CE79C48B0E66EB5E24BB78988F9BFF14395B6 C6B6+
343,037,335 *224C93B01ACC16C25CC5B72A8A121DDE555E46B0 C6BHQ
343,037,336 *22472D0FBC1EF279E697EE54CD7C2CB091E3EE2C C6b=i
343,037,337 *224F80A49F3E5E93A66BF51166A42E10CB86ACEC C6btS
343,037,338 *22498B48CA35118F77025C4849B8FB21009889AF C:6-C
343,037,339 *224045E4037EB8046D841C5B18473F74B8BE9CCB C+6C/
343,037,340 *22494422095770BEB79EB93FE0EAAAAC405EA189 C6c34
343,037,341 *22453FC7CB60DCF6A39C2FE9409149FA549A6932 C6CHE
343,037,342 *2249A86C5038E02724930D6FDC5E0A8BBC34CF68 C6
343,037,343 *22412DED56E64812718E773E582900CD4505160E C6CSl
343,037,344 *22426A874A3F87155D2DCA99918C124A181B8517 C&6D/
343,037,345 *224B874F48AB261CFF4789F1E01100F93A2173FD C"6d/
343,037,346 *2244DAF9E64C0B6A4929DF266C9163B534123EF4 C"6DC
343,037,347 *224F40292635A9015D9C926FDC6F4B30CCC2549C C6dCC
343,037,348 *2249EA59C37514BD1D82541AC7CFF9D52CCCF2A2 c6dhrht9
343,037,349 *224C6410CFE2E30A5352F57ECC1EFC0148B052B6 C)=6E
343,037,350 *224C053D8C985B584AE7E1941983F2A0C3955146 C6-?e
343,037,351 *224BF60810DF78B32C9804433CD5DC710EB10661 C6e2-
343,037,352 *22400609FDEEF70B4BF58C44945DDCF036FDB866 C6e?7
343,037,353 *224F54D75292A3F80A05F79A53FBCA8FC959F085 C6e_l
343,037,354 *2245674ACF2DBBB6C283AA6F466EEAF182C60736 C6e$Z
343,037,355 *224D3B2D9249FAB5A94A5F414F3877A6907A1F8E C
343,037,356 *224C45F1525342F213598232631634767FF58AE8 C6"=F
343,037,357 *224EB7B11523EFA72554EC0CE210913BCC5B6DCC c6=f
343,037,358 *2242AF52C4CC7BEC7CC5555EA04E5440A12D7B54 C6F3l
343,037,359 *22408A2B645434AFCC04509FBFD3878C002F036D C6ff0
343,037,360 *2243A0DFA2A1076E7E889ED039203AF41481964B C6fIn
343,037,361 *224F1DCE7A8CCE53B66822E9B553FDBD03A60B9F C6Fwl
343,037,362 *224DC5BAB18B2A0A977B458CD1DC77116B129916 C6/G
343,037,363 *224B53078D25697665FBF9D146B44FD385EBBB0D C6gDY
343,037,364 *2245C756DBDE41BCB74E0C480AC8F104867D97B2 C6=gf
343,037,365 *2244DCEA740143EF344498C95AE432673A8B01B5 C6GPM
343,037,366 *22440F670BE1118828D6A6A63834216B58803560 C6GT"
343,037,367 *224E96D94B94A280DDF02EC4C99A4D1C03F8FD26 C6Guc
343,037,368 *224E7BBB23153C017F60BA8789FF9E111CD58D3A C6;"H
343,037,369 *2240C99E4844532B5EE1930344560476C9C85AE0 C6H1X
343,037,370 *22412D41CE7E22A3E44F57507A8BB25D18637DFF C6hTq
343,037,371 *22445ACEDA4D5C4CA2267BEB06783546CCBD7D72 C6_I,
343,037,372 *224A8ED60D45F6660C6F8144DDDB599932881604 C=6:i
343,037,373 *224DFCC2819D0E11EDCA8CBC173968409184E03D C6i-/
343,037,374 *224D80545CFE0C214F9C520DB341BC5EC8D16BDE C6:I9
343,037,375 *2242A425BF49868E8B7887DF8C1A0AC37CB4DB08 C6iE
343,037,376 *22406279BB59C7928F8C4D106D9843B7DEB430DC C6
343,037,377 *2246EA7DFB0668926DB72BD5EABF8949F3A7F61B C6I+j
343,037,378 *22480B0A75D85AF949F678200AD8E7AD897315CE C6i,p
343,037,379 *2242D923A095B6759F6EB1BB5E3B4249EC26CBE7 C6Ir/
343,037,380 *224ADD3FD594B0B99FD40502EBD2ADAA2A36E85A C6?jB
343,037,381 *224E32B3BB52CCD59C405A3CB22B3124F8469BC3 C6jln
343,037,382 *224790FCE5B5322E7F8497B7EB5AC01EEA14832B C6j"U
343,037,383 *224C148FC372EC6950D3F07B1CB07CB3D18583B1 C6j?u
343,037,384 *2240B1F1D212C99E378B551B5329887338B21059 C+6k;
343,037,385 *22428BC9FCA52108B39B80519ECC2A292F007E91 C6"_k
343,037,386 *2249E5A44FB3238326ECF0A882CD499520FCD88B C6Kn-
343,037,387 *2248A09D739580CC6E62021B3AE398E1D9043622 C?6KS
343,037,388 *2244C989536AF622F99601217E0F2339B2507685 C6_)L
343,037,389 *2247872E522E039E1F8C57960FA7DF72CD153711 C6L.2
343,037,390 *224795DCC550F5D7A6A52C18E81FA47152A34344 C$6l3
343,037,391 *224F86DCC8A4D3F905DB986A73BAC77D15ADFA92 C6L=D
343,037,392 *2249DB846364A6FB4B77C65B7D93E9604C81A181 C6li:
343,037,393 *2248D285A7F96D7B15FD17AB7EAD794C8DE2D363 C!6lR
343,037,394 *22401BFBDC25FCE082E01527C43E28AC97FB5826 C6l%T
343,037,395 *2243D158918D8524C23F4AE7DFF20E5552621C57 C6lwg
343,037,396 *224FDC0376DAFAC64ED307C6D281986475774792 c6+M
343,037,397 *224C3055856FE95DB5276E31D44D971D5A85EC65 C6mHM
343,037,398 *2249243F02F10AD43D7C0EFB394EFDB9EB4BB19F C6M_w
343,037,399 *224BC16468EBC983D67E2F1C1097BF72EED18526 C6m.W
343,037,400 *224A71D8331AD401055DE4D972E01E1AF12AD768 C6Nf:
343,037,401 *2243D4AC13BF2A892C2F02D8CB409DD9E2329AE6 C6nn$
343,037,402 *224A4617C664C39D73E66D15CD435BA0C8FD26A6 C6NPj
343,037,403 *2241275B161DF5C62850AFCBB5106D6529917AFC C6OiV
343,037,404 *224448DABD329B2197561E575C8049276578A658 C6omC
343,037,405 *2242BB674998603484541E4196CAD2DE6CD899BA C-6OP
343,037,406 *224AE9C92675CF36BC0E163E3835257D0108F765 C6pIQ
343,037,407 *224508259719E4851E2D23D82BA6C2D64A9E4BA1 C6plG
343,037,408 *224C391B9E0D76B13BACDECE857736834890C313 C6P)U
343,037,409 *224F8AF0563484613291E9D00E199A1B5844FAC5 C6;pZ
343,037,410 *22432A16127BD391B5CCA39408532C345644E616 C6)QP
343,037,411 *22449435B9776E5D4EBFF468C9BB97FED1221011 C6Qrk
343,037,412 *224E563ECAB0EF00B71A42EB350F98A8696BDCC2 C6qTl
343,037,413 *22431B5EA385D6D5EA44D6A630ADDB07B8AAB342 C6-qv
343,037,414 *22403DE879DAB0CC6F29ACC34E2CCE24E48FA164 C6QX"
343,037,415 *2249D211FCD6DD75BA96DA3164E70941966EACE7 C
343,037,416 *224F07F5C1158B6C105AA70CD37B21DA3F3E1349 C6R%4
343,037,417 *2247676604A0C1648436B22E0C474ACA7813FEE0 C6r69
343,037,418 *224CB1CBD72594187EB4297273C39C06E10DB59E C6rG=
343,037,419 *224CD5F3CB0786E6219A60B364BA0581ED4A56D5 C6(ri
343,037,420 *224C10419DE821FCDFCA4B103EBAF1463AD8C4E2 C6RQB
343,037,421 *224A3B95DADF99E36D753903D5C5E375393492AB C6RT-
343,037,422 *224226F696F14CFE7C5536C2A6281EE8AB6622A1 C%6SF
343,037,423 *2241261A8926CD235BED0024D3A9F9CCEC956903 C6Sq9
343,037,424 *224DA3873A7300B0047EE15D613F49E147FF9390 C?-6T
343,037,425 *224075254D942D95C41F5E5E514DF72C330D3E08 C6T_$
343,037,426 *224F605D75418B875E5205EDD517570FF1CBE54B C6tBR
343,037,427 *224E51ED7B4979D6D76FF0C39BD6403130D37D0B C6TIk
343,037,428 *224A748E0DF760C5ADBEB3D5A95364C883C0C6E3 C6TK"
343,037,429 *224C54BC23E5BB27C9BDA328CE4133C2AC8B7A0D C6#;U
343,037,430 *224068158BACB1CE632C135E8D3FF09B65D7AF32 C6u3m
343,037,431 *2241547A184008456F10D587787247B418701A35 C6UmQ
343,037,432 *22444053A232195F6E7F1CB0A54D72EA7B5ACFED C6uOD
343,037,433 *2249C68EB1D4C701225F7EC564374F6D39F2BFEC C6V1(
343,037,434 *2244393D4A3BBF93EB246F11D7ECDB41AD867EEC C6VBf
343,037,435 *224B3E51020CF2AC691EF01610C01BCC50BED22B C.6VS
343,037,436 *22411505A7D9E4FE09E080FFB98988E62BCE1DD1 C6w5?
343,037,437 *2244E4714B0269800DBF1613B5730AEEAAB13CE6 C6WeD
343,037,438 *224DCE723C120AAFCFE27F5FAFDE1E2761A31ACF C+6wf
343,037,439 *2245C3C3A8E3484F4CD326B180A9927A9D2AB5E5 C6)wf
343,037,440 *2247107C8536BFA44794DC31E01B2D59854BF34E C6wpp
343,037,441 *2245F1ABE6B25651EF8A834CA270214649551890 C6
343,037,442 *22495B0D451A991EEC22B19A2ED997C7C97B21B4 C6X6u
343,037,443 *2244837F2D656EB4AC359B997059B031503E17D9 C6!XD
343,037,444 *2246DBFD6A0479651AFAC07EF10C5B243B4F9B54 C6X;g
343,037,445 *2243101051558FFBEAE675A92837EDDE17E3C141 C6Xs+
343,037,446 *22457C9F6BB766C8FCF893D2BA8BB342F010505C C&-6Y
343,037,447 *224569E6D0D1CE019D371E5D01F698CAD43E239D C6YFp
343,037,448 *224E53EE566B6434A76F74534F2289108EE12686 C6YFv
343,037,449 *224259EE9DD487FBE856AE5D1B2B8BB0FC92B094 C6YQn
343,037,450 *224DF7FB5C3D950C1AF8C0623C3E92A524696161 C6_;Z
343,037,451 *2246E12614262529BEF8135F74ACD86400A49BB8 C6$ZA
343,037,452 *224371594B121C32F9114F015D4C999E901F8988 C6"ZN
343,037,453 *2243F570DD1A555BAE6CD6E04557F6391B5E3D12 C6ZP.
343,037,454 *2246504881A9C002318415450DB99680A1E18614 C=6ZX
343,037,455 *2243B874D293B341916F94A603BCA8B228CE0BEC C-$+7
343,037,456 *224E8C34DFCD72C8C088D3289ED68EBDCD4C2891 C-7;"
343,037,457 *224327FC38A42AD97982B4047039C21D29ACDE94 C-7"#
343,037,458 *22476F17F5B06CC9BACD198235E0A45390CE2E33 C!&7;
343,037,459 *22498EAB2F82E3A77A588449D4A60C2A6B5E4A99 C/7
343,037,460 *2247AF9237B6C234644650A41F012CDD04F098F8 C%.7/
343,037,461 *224EB0E5899FCEA319C18B8A6DA5AF8E363206F9 C7='
343,037,462 *2244583D639E87D07A81C01AB6A72FBD88515B6C C7/)=
343,037,463 *22405E576FFD21ED93F167DFE7BA2F8EBBFEF8D5 c-7-
343,037,464 *2243E808CDA0A7942B7BAC379A1663A5521A0625 C702(
343,037,465 *2246B95170EE7A0C10424B19FCEAD5E177701B9A C70w!
343,037,466 *224E7B15B77ABD334059244C689CE9B3D9D94673 C70Zの仕様
343,037,467 *224BC5C52F1C10F7D72814A39E8B124FEF1B9CC0 C71oN
343,037,468 *224950B0B43A25E23A27796842A0BE5EDC97A67E c72576
343,037,469 *2240B497EC9E3305FE928653B5360708F7CCD7A2 C72&E
343,037,470 *22401DC6F6D05E5ADF42C453062E2A7FCD61488F C+?73
343,037,471 *2245F2E8A5997CCA511A747A20337D7D0F3AA5CC C!74d31s
343,037,472 *224A56D3756972EBAA835A0AA302B75126EEFF1E C&74e
343,037,473 *2248A16A860C031C0A11501480F006B2B606C709 C7.4P
343,037,474 *2243BFB500D24814CFBB42EF5D72F1DEBA554253 C7"5:
343,037,475 *224B01E34F82C40946C953928A46586708240002 c.750c.849
343,037,476 *224E3AC345685F3926D819F5A7FECADA09D13739 C?75H
343,037,477 *224A99326A05AE8E2C2246D661772C5AEFEC59D0 C!75p
343,037,478 *2246780FB0C2ECAAEC9DF9483D1800EF61B5EDD4 C75Ts
343,037,479 *22465FA17835FA074F56C42C750B0417052BAF43 C;7$6
343,037,480 *224A657B537D66AC9DBE4D5AFD9015D5D628B760 C7/6!
343,037,481 *224864729F9D03DDBE8FF3B26C2455C223B06A25 C76/&
343,037,482 *224566E294070D90E8DCB71443601A4402E06E92 c77700777
343,037,483 *2243D56AEE7CFB17FB42FBE9559633A54E901C99 C77o.
343,037,484 *224A49264592A7BEC427BF69DFA952CF9E2046ED C7%8=
343,037,485 *224C2F419060C9D7FE45F88A9765020210C41E1C C$78S
343,037,486 *224A0F338E90646126B8BEA88CC94BC4373AB7E0 C78si
343,037,487 *224E8B25A4D858B4A3E30BF6550633C75643A298 C?"79
343,037,488 *224385A8B21C3A5E95F0AE1F87157CF776B94E24 C79690
343,037,489 *224569A8022FC0FB682606624B6480B2F78F7302 C-797
343,037,490 *2243D57601341001F1CA0EC3605DC718836E8682 c7973
343,037,491 *224E8711CE345FF95AB44D0DA8A29ED1F8920A5D C7(A#
343,037,492 *22475F8DE206A003AF0982FFE3F067711A1A540A C7A1T
343,037,493 *22403F5CDFE6FADCF326434950C607CDC96C6F85 C?7AE
343,037,494 *224578EFE293AB46F37977D5098DF85C91B4A479 C7AMq
343,037,495 *224B0656038E4190591CAA830F48E3EFA8A6D437 C7
343,037,496 *224EB9996E9ECA148850076A43E5601E66CD48D2 C7)aZ
343,037,497 *22426B92A2A3DFD9039C6FA6A94948D63EA0FB1C C,7B_
343,037,498 *2244C6BF74FCD9358A8CDE8B7A7A456D227E7235 C7;B
343,037,499 *224568A5F6F629A117B712BDBFB1827958DB11E9 C7b!_
343,037,500 *2243E49D447875E8E3884D0006018E17EA230724 C7Bm
343,037,501 *22401DBC74ACE028C7776EEC368A32AF8AF11679 C7Bo:
343,037,502 *22467D3D309D00CA6DC0BC367A9D970D74FA0A27 C7bu9
343,037,503 *224DC60BA3F7B294CF4C797C6867EABE4AE4298C C7bY&
343,037,504 *224073F8B56324CFD0CA7AEF5AA39BBF36459A69 C7Cc3
343,037,505 *2246E6DDD31EF22A3B6B187C67C78ED610744EFA C7CIf
343,037,506 *22414248129BE46AA0EE6E3AF171F0A206D4F3C1 C7Cs?
343,037,507 *22442F16876EB30527C8027711D8EACC8B828206 C7-;D
343,037,508 *22453AB687C448E2B2B37C0C6B21CE7F15C9F18D C7D9"
343,037,509 *2244D73C5E296CBD53B39F830E41C91503ECDCFA C7deL
343,037,510 *2240C3BE36CED9946D163E09652CDF43E9F69259 C"7Dm
343,037,511 *224DB299C68203B50C3ED88762FFC978668F934E C-7e4
343,037,512 *224859E42B62DA52A1414F9450BB883987DFDEBA C7E7?
343,037,513 *22411DBBAA1FC30C1F38BA4F4C959FDA4A1C973A C7E8j
343,037,514 *224A0C2AA4AC923DE77A47D9C4DD27EF36475C12 C7!Eg
343,037,515 *2240C6CC487C28696DF53AA0F6EE98AF6930AB0F C7eO9
343,037,516 *22428C9E95EB3C32EEF9424BD9035338D8154C48 c7f62f5a-871e-3d80-9e2c-a3fecfd263b9
343,037,517 *224D23F90DAFA197BE94ECE871CECDB7D57E2104 C"7fe
343,037,518 *2242D59F8E8DCC3EBD1B40F852885055E97F21B6 C7Fj:
343,037,519 *224978C420AD4611DA56779754F9E90B7712C5A3 C%7fL
343,037,520 *224B7B358D203B0C43F80FF1067B2C2351330B47 C7fMY
343,037,521 *22406602561E2B4E988227BBB6588CB23296478F C7-g-
343,037,522 *22410339A4345953F6AFC24381A498F949369535 C7.g:
343,037,523 *224106BADEF35085CF97E0C3AAAA6337860CCC02 C7g13
343,037,524 *224BBD177DD2661A6443EDF11382F1ECA14D9B00 C7Gh1
343,037,525 *22459DE51F70B442E4F818925470D1DC4BCA76B3 C_7gj
343,037,526 *224E122AC955D137DE110B14D9494FF066C1D112 C7)GW
343,037,527 *22445A26267A1F5131B4A5F81289A846603D72A9 C7g%Y
343,037,528 *224155B2ACB4B83E7AD6CE3D23ED54472C3D2118 C!
343,037,529 *22411E8932762E570DBA254A172F985080DFD30A C7H)8
343,037,530 *22402BBDFF3476A74E14424D1E1865A5C15D81B1 C;7HP
343,037,531 *224B9B4FE8ACC11457D044CBF039705B3F7F4DFF C#7I-
343,037,532 *224D048436AE237CD330BC16F6DE3A6535CFB096 C7)I?
343,037,533 *2241DD37C09619C9D532E91E5E3A2D273D1D415D C)7$i
343,037,534 *22418B4F60687113159F8DBDE40BE2EEE0AB0224 C%7i!
343,037,535 *2248A279FEBC423C5D3BAE98DC8EED1A6B2C282F C7$i1
343,037,536 *224918ED3BF414B8AE0419F7E2688B01C0270C83 C)7is
343,037,537 *2240BF5788EC234F6C59CFACB69882268B6977F1 C7IVK
343,037,538 *224E63FAC60B7A6BDE107BF06454AFC434B37308 C7j_0
343,037,539 *224D99E76673DB07B9D997477D55B20F9DD56769 C7jfr
343,037,540 *224540F04F776766CA152DBED6BE0AD6A734375E C7j=v
343,037,541 *22431C67F5AC4B4FD9D44E5DF3B2C4DD324C90C5 C7-K$
343,037,542 *224276CD6744D99CD827276DEA531C85DF0B722C C7K7-
343,037,543 *2248FB5EDD35C36C4513D4C441C146B626FD391B C7kq=
343,037,544 *224E4B5E7202BA8E0A7319AE09E770F2107F7072 C7K
343,037,545 *224E4856892531426098E40864F78D7D50225A84 C7l,C
343,037,546 *22400A5B356B66EC7B80AF26A8EEFAB19F470184 C7LFA
343,037,547 *224EDF4ED68CB9DBAAD74A2C86A13E4AAC7C3F4F C7Lk
343,037,548 *2240451B1D9989E8D1114AFE819EBDD543199D49 C7LrN
343,037,549 *2248AB9F7BFD6B15318C1C70C5378D85B6547BFC C$7M:
343,037,550 *224D5B4217C9764937D52C38524F6DAFE6AA090B C
343,037,551 *224CACEE8E512EEA180ADF333FD7EF6B3876FC99 C7m+%
343,037,552 *22456D52208864638DB29918224D354FD6980132 C7M=0
343,037,553 *224EB00F93B8820ED3451E247A67EA44AC5BC3FB C7m5,
343,037,554 *22427DF9A43C9DEBCF61F2A853E155D5C5ED96F1 C&-7n
343,037,555 *224305B7A3EDB47488AA0E6C533689D969974A54 C7+=n
343,037,556 *2240DBF66BF8868D8D49E681F36073D7C26C1392 C7n-f
343,037,557 *22449D68A4591F2DBB2CF22C4C8290AA807D81D2 C7niT
343,037,558 *2243CC3C86F11ABB348CD56874A2AADA10DB69B7 C7nqr
343,037,559 *224E0EC86DFA8A35D913E6B88E0AD8C705BE3134 C7+=o
343,037,560 *224D96F88140F9883327DC6AF0CBB5D1D0D5851D C7o!0
343,037,561 *22444B3679437E5B86A23D3DA815DF3043DFD731 C7O7C
343,037,562 *2247AD0DF6DCCFA7968FF434C819608C6C29F9F3 C7Oaw
343,037,563 *22428BE899A421EE509EE6F3981705FEE7D2D39A C7p2P
343,037,564 *22442AD0DF40AF2B93ECDBCFF21E59B79B5FC917 C7P8#
343,037,565 *22441159A3BE61F5D5F7EFDAC0F4CC87107699DD C7P;e
343,037,566 *224FE873D5C9777C8E0CC5C8960C3361C3A1CF96 C7pl6
343,037,567 *224D5EAC1BB5F9E15EC7FC428070051347E4D035 C7PQ,
343,037,568 *22476713DA967CD6EE50CC8D823DDAC9DF4AB66E C;7Ps
343,037,569 *22456F0E59B88E063B349C11693715B377353358 C7Put
343,037,570 *224E64AC4D4CCD0E7ADED09FC63ADE8D3FD0D31C C7pUw
343,037,571 *224457400C4EC123C893B8BE95C6E8544D6A9D2F C7pZC
343,037,572 *224ED2D508DA6D7E729D8F481E9563BDF4C7A4B5 C!:7Q
343,037,573 *224BAB72F6B8C62840909C853542D879FBC301C4 C#$7q
343,037,574 *224B3F2D844951F8C0249B7C14FCDC03758BEC31 C7qFj
343,037,575 *22423D116AD262871A6A8515343AA519E0E59D8E C7QmX
343,037,576 *224EE1A49F67108C82EFE18EF389FC8D1D749C11 C?.7R
343,037,577 *224858E35B0DC36D9121A3F2516CF1D44FB1B159 C7R%1
343,037,578 *224CB7A947F544C7B5CDFDFCD34827C85FB5A337 C7$r9
343,037,579 *22402B001EC77EF672D30FD47B8C26E897E89FE7 C7)RA
343,037,580 *2248BF529E24E803F46DC02589F208751A112FBC C7&Rg
343,037,581 *224D2381DDC0902F043FECD99555394AB5B4C0F4 C7#Rg
343,037,582 *224E1DD750D2C62CCFD04C017E9605A7ABF1CAFC C7_rK
343,037,583 *224D2BCD95A104F3748EDB997EEF04D174BB8828 C7rnu
343,037,584 *224B855FF80C47D0E8DBA99F20E9D0B41CEC6A0E C(7rY
343,037,585 *22478D39A28C94401CAFEAA246B3785DFC277D2A C:7s-
343,037,586 *2242F3D415A2EBB82697F9325D4EF27BCC78DC1C C&#7s
343,037,587 *224721670603F6713F798B8331D52F303EF49B3F C7S1Y
343,037,588 *224343CA9128A02F39624EA13D7D911897F0535E C7s4M
343,037,589 *224E183807CAD88409182D3E9C9E02CEFEE94A32 C7SDh
343,037,590 *224D3A2B754177619D222F1219839E1DB309AB58 C7slc
343,037,591 *22444D116B79F8E3420B3680C59D13AC560338A4 C-7?t
343,037,592 *2247EB776584C50BA6CC8E62FC58C4DFD44653AE C,7#t
343,037,593 *2242610AF0E4F13331185E6EC9EBD8F80DC6927A C7t1G
343,037,594 *2243E74611D76C912C7C38AFAFAF65050F7C9C15 C/7T4
343,037,595 *224324F8ED9203B618482DB89F645CD3F031B8EC C7T5a
343,037,596 *224099BE6548273E3E2C88680CDB0DD16F3C0801 C7t=7
343,037,597 *2243A3C5C2E65565F0E7FEBD5C869F692244B638 C7$TB
343,037,598 *22452E3C38ECC2C874D5F763BB9D81464519284E C=7tO
343,037,599 *224405B05C68098E298586E6B0A97899491EBAC3 C7TrL
343,037,600 *22466BBD9A04053588A547687124DCE344E8D47D C7/TU
343,037,601 *22485066B9CC83BEB2250C41E6DA654A5B6927E1 C7
343,037,602 *224ECC74912064A8B80EAB1C9E2C847B64E6CE18 C7U&#
343,037,603 *224211DBABBB74319AF0818ED2C8D3BB4E58E6C0 C7:v:
343,037,604 *2248A1992357FCFAC10671D3E51D714EAB0859EA C
343,037,605 *224B4BCCB1141F7417D669B18D3F2FCE7669F5A7 C7w)C
343,037,606 *224F501E03177C498247F810D6EA8DB03F2F872C C7wi?
343,037,607 *2247C20E82345F7C632B4E9FDB2BA1C78FF346BC C7W;j
343,037,608 *224599C0A23623E815E56D3EC146A91F31E22C2C C7w;t
343,037,609 *224344CE5A05DF97F3FC5CF9F26166D4CE868047 C7XNA
343,037,610 *224D1E40A9E2DFDEB79432313AAA7FC84EDE7F31 C%7Xq
343,037,611 *22467A3C64F0BA8F3984DE7070692F739E8F9C53 C7XSR
343,037,612 *2246BDFC78981C3EBF393C95A3C6D25609E50724 C;7%Y
343,037,613 *22482D17BD6220F105D0E09C9312E58D1A7CC16C C7#Y"
343,037,614 *2242FBE38CCF64EAB818B3F9FDC45B9D0033B9BE C7YwA
343,037,615 *224B0727B4DD95F3A56083CBC100EF110589EB1C C7Z0C
343,037,616 *2247E4A1511E1AA4DA9EC636FE9B39B6BAE89F54 C7Z!a
343,037,617 *2247B73E2A94D56420CE5ABC6E8427C766CB44F9 C-7Ze
343,037,618 *224FD264A2FC12DABEEB51F363B6D76F4701D00E C7Zfm
343,037,619 *224D10E0150FD06D1D4EAC28B4B653869AA94678 C7型號列表
343,037,620 *2246B164FFA6F7F629DD6F7FA91D127274619DC5 C,8,%
343,037,621 *22451EF5C35C56DE93DBAB70A1E1F154BBDDD1EE C/-!8
343,037,622 *2247CE7890B2A5DC7D80EF35712A96BFAA56CD45 C/8:"
343,037,623 *224EFA7C77B2F659EEA8CFA02855E18FAF92D079 C';8
343,037,624 *2249A8E306949954A7B4A05D39C87A6FD5944EA9 C&)8(
343,037,625 *22451F80267CA5D34500C681B7BAF1A9E7419EF7 C+#/8
343,037,626 *2241EDC9A869EC73359B5AA1D8012544CEE36473 C8,%,
343,037,627 *2248C7AF2BD02E9A5B86ECEBC5A6DBD2611E1876 C8/=(
343,037,628 *224A5776D099F7E33887C6E7DC20FE621AC102A4 c80175
343,037,629 *224366285FF52D60471EF5131AF4B2AB1805D9B0 C$80B
343,037,630 *224EE975583B958D455B3A0A57A46A4D68F101A2 c80db376-1e74-380e-8746-d73e07279b19
343,037,631 *224C77C6CFE945FF5DF44C612975F59F7EEB582F C80DK
343,037,632 *22434F12C05D15EBE5E74B1276BD62E8C57AA475 C80iI
343,037,633 *2241767E82E5F94996E85AFCCC78EFD9F8D82AA2 C80#Q
343,037,634 *224B2AE78163CB02E1E6FCE5B9FB50196DD834D5 C80Z%
343,037,635 *224632F4961C9E6F17A2F59DA7A53DE97E55364D C8:11
343,037,636 *22483C7BF59B9898E83D7F7E9D77043240B6CC95 C8116
343,037,637 *22462B97EAC585DD10677BF83B5EC7476E85A62D [email protected]
343,037,638 *224077FA740E08676DAFBE41E4E3401100309438 c8163264128256384
343,037,639 *22449A08EDBB9EE7F546100F366948C02780851F [email protected]
343,037,640 *22495BEA1F198ED34BE17DB3F66872B8B2B9A368 C81.F
343,037,641 *22490E591731E9F0C84E347F478F6D046EBD71C3 C81-j
343,037,642 *22431F9220AD667387D58CEF629A5E399C3124BE C;81m
343,037,643 *22456D9827B488DB326378D4A6AA11B50ECCDDAB C81mZ
343,037,644 *224A051B298CE4ECC1077F60070921CF7961B2DC C)81P
343,037,645 *224FE6702A29040E38C67A5345580AF26FEB31D8 C8+1T
343,037,646 *224AF384F450DCADFF352E216AAADD907895D1A4 C?82?
343,037,647 *2241B6DFFB195B36A946EE115EE9FA74AC563AC9 C82h#
343,037,648 *2247A302D17B25B1B0BB344C634D1B19C9C7DFC1 C82lh
343,037,649 *224F21B2F60375D3AC5E29C08AB1ABB346D73169 C82mm
343,037,650 *2249346BD70D0B1CA7980E7346327D8F38CBB191 C83;O
343,037,651 *2240C740AC50AAE2C00A85E2BE6295FD2824A7F9 C85Ls
343,037,652 *22434A694E4F15E3CA05321FBD1B513A93A78A9E C!85M12B11
343,037,653 *224D3E144CF609A38B12459215A323AF6700A2CB C85sW
343,037,654 *224EDA34BA93E67C38F3C0DDF2B3505E2CC3448B C8#6+
343,037,655 *22433C8F119A4172E8D6445A1DFB4B667B70AD60 C86+R
343,037,656 *22454A2D8E9988BD3220DD2826C6AA3A2EFAA755 c8743
343,037,657 *22403138149BC03F362CF1866000C2A233DCAEC0 C87gj
343,037,658 *224CCCBE040E7E20BD6857AD3B21A7470A984AEF C87n"
343,037,659 *2248A6A0BB92208F4C30297B049728923F97E4F4 C87N9
343,037,660 *224DFB7D5FB2110012E63DA3DE5011E9862178C5 C87oh
343,037,661 *2247971A97C8DC188D9AEA545374D3E45AA47928 C#87Z
343,037,662 *224F6CFCA381E693E0580AA261161A33B1694C82 C+88"
343,037,663 *224B2DFC1009B1E364D37F366D897D2E813C9030 C8&88
343,037,664 *22439B4B0E52580BECF2154B5166B6A65C54C2F2 C8!8f
343,037,665 *2242A468F82AC02A0C612CF708C90F233458A9A1 C8,8r
343,037,666 *224C69FEBB67A9BE7A5AADFAFD16BA7824214E8C C89,&
343,037,667 *22434B20749B31BDF057BD61410256CD78545FB0 C89CF
343,037,668 *224903A002B35F3E2B028447A79E34E995C8BBE0 C8.9K
343,037,669 *224CCA2E7E654BB1622577F1BB27DCD07996420B C89mR
343,037,670 *2241ADF7F4C3209B6DE82F55F4C6B014E1D3D23C C8a,(
343,037,671 *224F92A1AE1FB76EC1766112DBA1D59562063065 C8a6$
343,037,672 *2249ECA0FD4F27DC2E6851DEF34ECDFF077795D4 C8ABT
343,037,673 *22468C850799EB021FA3C14B3E356A505AA201EC C8Aco
343,037,674 *224A0B9F58BE51BC3C847F8B85A6AFCDC53DC8D7 C8aE3
343,037,675 *224625A4219FCBE36ED89A18457813034CAAEFA3 C8AeU
343,037,676 *224BA5F209B4E7609557A163E112221AE0F89DB0 C"8aF
343,037,677 *224CA5988D8AC9D1DB7487CFF251031A05E8611B C-8Ai
343,037,678 *22460AF7018A9EC6CF1DE576D6AC6B35DFC23C53 C8aY
343,037,679 *224C6D9B2A320CBC86DE44087D29BDE08E5ECC6C C8b$?
343,037,680 *2247548A89D3561FC286E2C5D67523A4DD514634 C8bY0
343,037,681 *2245B307BD265DE43A289A1B71AE4263EBE0D61D C=$8c
343,037,682 *2241E74DD716710948383D4FB7C4FFC20D871388 C8C)D
343,037,683 *224F9D244528CB0E34A2267F9406C83C0315DF05 C8cF9
343,037,684 *2241950C516E02D41D3681F875326F71687BAA99 C8/Cl
343,037,685 *22458ECA6F6D0B256B599F7C2E6FE2B5A6015508 C8$Cl
343,037,686 *224E7415DDF1FF1CAAA9B33A19F075F0FC568174 C#8=D
343,037,687 *224398154DA5C401E4BC17C36446BCCB2A76B4B4 C/8"e
343,037,688 *224FEB3F597B4F140627F92B57371294C606D033 C8:eb
343,037,689 *224A1A66EE1EAEACBFAE3024ED320BE80464A2CC C8eC=
343,037,690 *2247D813D14DBDE394F53BF0D4F512DF8E8F38EE C%8)f
343,037,691 *2246F8E389C90FC9366AD27B8E8698483B217A05 C8f=C
343,037,692 *22458E35FDCAB822A4B205326BD9798B8D34CC9B C.8fk
343,037,693 *224E88A3F0E8915966A9CE15F74847882E28E6CE C8FTw
343,037,694 *224159FB8B0BF031B5599E663639A1CAEF8929B6 C/8_g
343,037,695 *224F0E2626FBCA027F5BAF0E83E93A238E027707 C#8=g
343,037,696 *224D2DFA786D84CE6C820D83756980E678F6FB8A c8G1
343,037,697 *22428EB646BFCF042DA70BA70D1B067B23ED205E C8gHn
343,037,698 *224F9DD539AD64527BCDDE60E9FC9EE0A4344DF1 C8Gst
343,037,699 *2240DF8885BC58509476F214D5FBDB88F9CCDD4F C8H/a
343,037,700 *224F89EACAA1FB39B400F4D2A4F43E63E66EE656 C8hui
343,037,701 *2243F9C95423677861B10D4FAA14F44FF1DB7CB2 C-8(I
343,037,702 *224F17339107F317602F124FDB73934C7DBA4E32 C,8I
343,037,703 *2242A8C4FA6FD299F428D9B4CAE0765C4455382B C=,8i
343,037,704 *2247C0CDA991046C7EA556E2CC839DE161FF7EAF C8i6kfi4jbx
343,037,705 *224A0D90C0D67DE4095ED2314938AB9F2AB60322 C8iH-
343,037,706 *2241786A46DB71B68D9A2705C592122512FA063A C8:iq
343,037,707 *224AA07BDBC824276394ED0F2D5BB98A43EC42AF C8Ir4
343,037,708 *224A42D10816DFC812B05EBE407C7321130C99B1 C8I.w
343,037,709 *22451E983D667E627F0C6A9E80512F366952B5A2 C8;k_
343,037,710 *22450EF814A6AAB13C44C55A44C299B742710C2A C8?)k
343,037,711 *224D3D344590724E617A1C31106D365990984E1D C?8Kb
343,037,712 *2245023B455B8614F9964EBCB029E2F881F412E7 C8ke-
343,037,713 *22407C71AF3B5842A07FC84B14D3942BDAE141BF C8KGb
343,037,714 *2240C17132884502CB9919D7F31AC88D4D130565 C8KN4
343,037,715 *2242D70CB6468760A7D815AB78BCEB11F5182316 C8Knj
343,037,716 *22421A0529324B0249EAFC6A632D42A37E55A279 C8Kr3
343,037,717 *224506F73762A74C2E8C4987A6F58F4601837FA6 C8K/s
343,037,718 *22492DC50295348D33865A37E4F218FAAEB9AEA8 C%8L2
343,037,719 *224687E5C256DCAB3E1A3511028E618E0BD6095D C8LC!
343,037,720 *224BF21269867F6BCEB669D4F56328DFEB557D6C C8LlQ
343,037,721 *22442A962D3B73D202EE6C1066ADF22D59C6077E C8lRs
343,037,722 *224B723C0AB49FEFB82E1CEA8468A5C4F3E60DD5 C8lT3
343,037,723 *224EA163351C7D980134050E520276C464448EB3 C8M$:
343,037,724 *22480CE9DE9D211D81FB783E7D1F3E2CE013E396 C8m6+
343,037,725 *2245AAE2AA87E9B109FEDBD9318783ADFAF893EC C8mc.
343,037,726 *224277F5A064BCCA3FF0FB5B1CF70B68B0F9A505 C8mN3
343,037,727 *22459300F4A8FA00B32C84CF25C625155C4CA0CA C8MWs
343,037,728 *224CA75DE43FD21E7815C1BBF09E55B830D09675 C8n2/
343,037,729 *2248AA3475B084CF80FF8B4471865E9E747DB6E0 C8n"k
343,037,730 *224B2D27143C66CB2FEF013286C4E4B931A2C122 C8O0N
343,037,731 *22417D2C3BE3A7145241C4085005E4FC2269E1F2 C8oCr
343,037,732 *2249D700796538F7C39E4D62576EDA5A445AB760 C8oSS
343,037,733 *22446221F0DCEC401B478F1B92155C3E1E25C199 C8oW+
343,037,734 *224CDA42D0045F59006FB8D84A8A99F68C5C8C00 C8pB4
343,037,735 *224E7290C8373C9BC6AF7D959AA3AEA8455EBC7B C8Pf8
343,037,736 *2240723EC6C4F274E85969F9C3CB827D3F94CE91 C8p;R
343,037,737 *22471B8E938147CB4EBD7A27FF258247F018CC8D C8q#3
343,037,738 *224B9FCF38C13FAF3E44E15F711C596A29954097 C8+qe
343,037,739 *2240BB58AC8361F1EE8F5B67D97FD94ACEAEC28B C)8QP
343,037,740 *224378A7872B98C2A4B363B16C6318E3B3837CA5 C/-8R
343,037,741 *224EB380FAB18F219C1C20CEE2A12E99B373E5CE C8:!R
343,037,742 *224B37B4C83F794E523FCB8D84082C62EC96941B [email protected]$cu10u$
343,037,743 *224F61DDEA24879E83933A43E450303B74A66382 C8.r5
343,037,744 *224E01F0F306E66B35E2C60662B55EB2ED935EB3 C8RAd
343,037,745 *2248761B4812389B85D6A4C3E7A543C289F2E135 C8rs9
343,037,746 *224BC34DC5ACCA9D6A7CDD8739B060C6E65C76E6 C8Rw7
343,037,747 *224E695C7F20EC4221A8AE514BA4D66B28BBEE0D C8S#&
343,037,748 *2249138AF09999B675B118084220270185E2DAF2 C
343,037,749 *224091DA83A019ED0C0E0787B9B264B5CA60D55D C8sIH
343,037,750 *22485E48CCB24DE9F4E78F75396FC7A668DDA87A C8Sn;
343,037,751 *2246F484AA93402E8FE1C619666E60590749FD63 C)8sq
343,037,752 *2246C2781171F706A2D29FD80F9E37F6041C8D09 C8sWk
343,037,753 *22478BB67F2AE8EF2636037BE0CABAC0032C0A29 C8t[
343,037,754 *224711E9AB60A873454955929AB859E57D97D445 C8T"1
343,037,755 *224CF7D3C34646C4BE99056B6EF95B77D9437DF5 C8t7=
343,037,756 *224D77A0985DC5F29C4CB304E35059D28D2F8E7C C8t7N
343,037,757 *2247AA2BFFDA9F43521CC666A9A4DDA760A525E6 C8tfo
343,037,758 *2245D7125B52FAEED83A5726D2CC13434A888F1B C8TP.
343,037,759 *224FB7666A271B2EBF210E497F56086A4A3225CC C8TuY
343,037,760 *224CEC04D9F3E262366BAD32C83E09B52512435C C$8tW
343,037,761 *2245C7E98A007D795E5570FFD202EFCB65DC2401 C8UKT
343,037,762 *2246C03885C848FB9F6E8F9796AE07D4FEA9B401 C8UM$
343,037,763 *224DB135F83E2DCC1CB75FA1C05C10D0F2EBE289 C8Us%
343,037,764 *224B96A1AEA88EF30251DAE87E8A91D93C5A12D6 C)8UW
343,037,765 *22463E36DA8B6B1D541B0791553CDC52F7B0F806 C!)8V
343,037,766 *224FF248DCE1D0D7D7DDC43F2032D7662A618069 C#8!V
343,037,767 *224C62C147B9968357DB7585DF615728C4021D5F C8V)6
343,037,768 *224966D200FE591CAB6ACBDED46F1C6522592148 C8+vg
343,037,769 *22492364E5B5131C206A6D003C7A5C8C1A969B60 C8Vg7
343,037,770 *2247E0C4AE42F80CCA1062A76C5F37BE717EFED1 C8#vP
343,037,771 *22423D16FD0A6C8B1B53D5AD0CBDAB1FAB815573 C8!Vr
343,037,772 *224F3180184DFD8D0E0013270D6A8FB8D6195DB7 C8VtM
343,037,773 *224FE33BAA26BABAB1780624A000F21B4C351D7F C)8w:
343,037,774 *2245AF788A8D2484FB8B461F7F2884DDEE9AA556 C8wdY
343,037,775 *2249913BB68E21F061BAB749912E483D951E1B4C C8(Wk
343,037,776 *224EAC9C4042E0F08CD5231AEE6BC79C38E2D938 C8XfE
343,037,777 *224A9402F3F3ED4FD304EDCB20C8084111B94785 C,8Xk
343,037,778 *224A3C7D2A146598B13ADEBEDABBE3E34BFAEE7E C8XS8
343,037,779 *224F44D25527C1B1F3366EAF89C824B7B3E6C1BE C?8XX
343,037,780 *22457530FEF63709BC6FC1827EFFD34ED231CB59 C+=8Y
343,037,781 *224616D36DBA21281977DF7DC43BA1C262533513 C8Y$$
343,037,782 *2242BDAC33FB1738087CFB53FC00950C452452D3 C8Y_D
343,037,783 *224A387221CDF4418E36FAD5EA2AB63954AD2DF8 C8Y&m
343,037,784 *2242D2DF58CD37241A99B388306CC4768C2955CC C8Ywr
343,037,785 *22437160C3B7873521DE72D62592F4C97B4DCF8D C,8
343,037,786 *2247110CA030BDFD8C07EBA5EB1772ED7019BAF6 C8)Z%
343,037,787 *224168CC3FAB486C1E2A275D0A4C95BCF58D21C5 C8"ZP
343,037,788 *224CFDB2BCC62AFC03F135BEB20A992A66F1DDCB C;-9-
343,037,789 *2240585520907A7B230811FAC7502E90DEF4A57F C?%9;
343,037,790 *224973E6480CE7D7596E1CB5CF029D33E57F20A1 C/?,9
343,037,791 *224516C5818E30E734ACC952A5191759504699E5 C"9?%
343,037,792 *224211E2C04ECA36BCBECFB288666E65583E7F83 C(9$;
343,037,793 *22450D6BFDA09BDFD915DD01BFAC83959E086EC7 C):(9
343,037,794 *224A7E8BD1F35D9A5FFFEB030788F21966A2DA32 C{*9
343,037,795 *22401E94B7751B8F0CA9D82D8FC9E03591B62886 C&9$:
343,037,796 *224775250177DEE51C517C380EAE2BEB19223E7E C#)$9
343,037,797 *224E0ACDD03DECE664AE4121E5CFCFED703B93B4 C;9_0
343,037,798 *2242FED6FD1B6BCB353FC6642FF5DB0297DFC87D C9::0
343,037,799 *224F7FE8B28810265585C8AF4D938C80491310E4 C9:0+
343,037,800 *224B3D5010B7F929226AC8D0788EB1D0C3CCEE1C C9!03
343,037,801 *224E07340CF4BF2D15850A9393D05AFAA546A4B2 C9(06
343,037,802 *2244F2B3E42EB1129408EABA617C8CFD92A4F896 c9077
343,037,803 *2243A626048CA56CCC60AA2A549B40B3742B7A5E C90jn
343,037,804 *2248D1AA55A32B469F6D747456F490FE2532EFAF [email protected][email protected]!ES
343,037,805 *2243BA843589CA91B2BF9AE7F491C6614504DF84 c91374126b74
343,037,806 *224A3683320F01ED78C0DE570FA99095E7647BF3 C91ha
343,037,807 *224AF466E9914411E8A3500DAFD3862F84F0B101 C9;1n
343,037,808 *224C8DE6F0337DA0A1A2C10443B5AD730B899844 C9(%2
343,037,809 *224959C39C5B77AA82762C027D750DD39C2F45B6 C922Q
343,037,810 *224DCA6D16046854E444823F52B9DBF5253E76E2 C92+b
343,037,811 *2247F68F4F02C7862D5A3EE4E3F1A1E07F6EF2F2 C92kZ
343,037,812 *2243D0F0BD7A30EBFDED775876D42DA0FE229E6E C92+r
343,037,813 *2247D2A0F4AED8B611B2FBD6CDC6B73AB84A7CD5 c9344
343,037,814 *22491CC7E0A1B913E9B1B759BE7011ED3953CEA5 C9/36
343,037,815 *22474F751E7F7ED353CB7A4BFBFF879A803E61DE C9#3f
343,037,816 *2242F848F4ED9401969E802B9C0CC84BF9978E14 c94339
343,037,817 *224E73B1187D7E8EDA7FB7AC4A3F4A59671C58CF C94d6
343,037,818 *2243A2158339FF142081AC4457B50E987FC1B7EF C)94q
343,037,819 *224BE49D5D4B4833013C7E00C1D64082E1C29A9A C9&4W
343,037,820 *224BB9A711F61654090F82635A3B589648B0C73F C9.5:
343,037,821 *22407B137A3D5FCC9BA2C96B021A4FD61B354016 c95597
343,037,822 *22443BEBFC142408E6080676986C9EC4D9BEAD4E c956659
343,037,823 *224C83FDA59C3F2F97790B037F28831398F51FA6 C95GT
343,037,824 *2245ED0009B92399656DC916923DD28D63EAD2D0 C-96$
343,037,825 *2247BE906ECF5B64E3DC7BF826288886E5FDF632 C:9_6
343,037,826 *2242509B6EBB576C898474B1819B63413510FEB3 C96,%
343,037,827 *224195211F19618A5E649B0FE2E0927D7AAD38B9 C96_Q
343,037,828 *224A2A3666F145271129B93D84A2B3C5B3F7B368 C9/$7
343,037,829 *224AD5EE27C95C5C52FE6069784F6562CFB1994D C/973
343,037,830 *224F8D39539140AFA13112803DE6CB2E2D594EE0 c976o107
343,037,831 *22467EA7207244C89470CF564ED2609547568398 C,979
343,037,832 *224A80EDCA9E6E7CA646D1827427F86AF862AE06 C9.79
343,037,833 *224D1EC4D36FF98E5CAF2961703518C682794FEB c982373211212
343,037,834 *2243F6E1DA3EE4533DDEDB1E59B54D18CF50351C C9-8D
343,037,835 *224BFF82FF4BF6177C6808DEA0027D0E5F7F1B0A C98=G
343,037,836 *2240CFB4DE257D004C7475C0CC4CE29C871AEAE7 C9!9-
343,037,837 *224FC3BBC3C5C7DE86CF6D65F9AC84FDAE5C8DCC c99622
343,037,838 *2240337B984C75BD5D25482551A55A6A030CA8B9 C99B%
343,037,839 *224F6B656396DEB217241C6A5EBE4409BF964F55 C9
343,037,840 *224709D0F7BC04D47DB3F615D9333F175E7CD5F9 C9a#_
343,037,841 *2245B5B90D0F440851473BAD52A1A97E2DA4C065 c9a4
343,037,842 *224F435115B9221A8C8DE67357731B43C56E0627 C9A7Q
343,037,843 *2249EE9291C3DDA613FECADE8006821C945ECD7F *C9aa
343,037,844 *2244919C825C46D1A4903B42F754E6BB2B844A1C C.9AB
343,037,845 *22403010FCE48ABCE3E0EA66981802FBA77763B5 C9aFB
343,037,846 *2240A734B6CFDF87D699B8E997B748946EA00005 C9=Av
343,037,847 *224968D8FBADC873D5236DE0B4087A95E2F68CAF C/9B#
343,037,848 *224C633F253C6F425BAD5F4BB0C41F512E5BF6EC C#&9b
343,037,849 *224EAD1944CCA117BA92779749ABC061529EB3FA c9B`
343,037,850 *224925C6192EB66DF8DF8A8ECD058167D88DD63B C9&bB
343,037,851 *2245203A1B4E24E1D147D6DBCB69E7FA0E2CC59E C9BRd
343,037,852 *224E2724527E95EC6D3E2931EAE8A6996F68C63F C9bRF
343,037,853 *2245E382276242F7899E8B38B22303FFDF55F1C0 C9Bwn
343,037,854 *224D7A622895B9E3DED7B726D9DF9EE2ABCA42BB C9BXV
343,037,855 *22488EA8F66572D5D37BF0A7CCEC3721F95D8852 C9:c)
343,037,856 *224789C3D7AC29299E32A0F273B90A9D30E81ECC C9cj+
343,037,857 *2241B1E5E5F471F515C77AF73A91A25D162D76FC C:9cq
343,037,858 *224CE8C24B9B2B9A8EFEA8E94AFF7DC358C57692 C9csu
343,037,859 *224B0379423A6C6654EC96E0E12813AA7D2881D3 C/9Cv
343,037,860 *224E8589F91D376BE6739403D5C16DC7689329D9 C
343,037,861 *224FA8347FC3F86F837DC900DE9AB55D8929530E C9d1n
343,037,862 *224AD1EAE260526C2EB9018459159C5256ABADC3 C9_EO
343,037,863 *224921C0130E611C2E18DE9F6141FD100D568EB3 C9"EU
343,037,864 *2246517BD74A3CA8ABBF972EC7224147FAC3DF94 C9e?U
343,037,865 *224CF971290D882122238BA74DB63E5FF1A769B1 C9EWm
343,037,866 *2246CC89BE1A7216FFDA10233806E90251AAE3B0 C/9f!
343,037,867 *224F37E48DC883332BB22D6E5403E081593C4FDC [email protected]
343,037,868 *2242A6547B4D599E5603D80B9BCD97286B10A23E c9Fm
343,037,869 *224F32D880E9A9A19B0B3E205FAFED2003F59351 C
343,037,870 *22456F7517048809A9F9FC9FB6BD66776C219BF8 C9F.v
343,037,871 *2247D42D4710EAE4E24329458AEF65707BEEB8F1 C9&(G
343,037,872 *22435DD443286A5DBDC6AFA05CEFE98D61D5CE52 C9g,;
343,037,873 *2245932D934A305CC64E997FC2E15416D67B0A33 C9G52
343,037,874 *224998A10669DD631D917BE2F6406080D5FCD262 C&9gc
343,037,875 *224956D9AF13DFB1D40D372DBC31A82A9942DCFA C,9gr
343,037,876 *2240D3C58593D973D1227C1C6FC1C5F31838CC0A C9g,v
343,037,877 *224CF6D613AC09B54804B6A6741E164780C18DD0 C_9H$
343,037,878 *224D26AF6BAE9E1EFB00DB375F39D9BA49664DD0 C9H^
343,037,879 *224CB6082E7D9CABB2249C43A8BCDFC933611C0B C9h2:
343,037,880 *224D2ABD7EAD94A03AA7B90593E569E95066CAD2 C9-HI
343,037,881 *224AFE065A51DB3AF0D96106C7DF95F5D6467EA4 C9HR!
343,037,882 *22433099827F50E5EEC27616F785B7776BE59FEE C,9HZ
343,037,883 *224972889F3F95D94492B121C30D75C4401E95D6 C9i0%
343,037,884 *2249708FF537F9FEF672A966531636D531AA8C87 C9+I5
343,037,885 *224CA01BAE04C5E54C9CB468E971D1D7B4849467 C9I/Z
343,037,886 *22455FF06B3F8C37EAC13D5A0ABB355D9194ACE1 C9_jU
343,037,887 *2245316A773C04C6A3C32CAE6E01E8E0F263B7B1 C9jug
343,037,888 *224E9A8E45E2AA17BD608001DCE15A5AAA361BC8 C9kmP
343,037,889 *2248CCC8423F09FBA7A138733550A8D2D8B6B33D C9kp,
343,037,890 *2241718CDB82BBF828C158686DFD07425970F0FB C:9KU
343,037,891 *2241D34C10F9535828917E50DD62529B574D6304 C9kZF
343,037,892 *224CE7C8B61BA561F4F03A7D5143C7B38AD0E6BE C9lN&
343,037,893 *22461F9ABAA3E5729B944148994DB5D7F2E75C1A C9M$)
343,037,894 *224E4BC8E2948745D3EFFDBF062782186B438CB6 C9.m2
343,037,895 *224B7F0D69BF50C90A9AF502E6D51C321273EF29 C9mk%
343,037,896 *2248773C4305AD90E409C253E9C3F5A022EA21C9 C?9mp
343,037,897 *2247AE810A49C60FC6CA4DAA5125100270002A29 C"+9n
343,037,898 *22469A9B2538611381628CD69FF69B8B3FC14EE6 C9n47
343,037,899 *22409161C1B1D66569AF655E1C19A1785371736E C9na(
343,037,900 *2240F908858086E609A5B7CE1EB29BB043B909FA C9NeV
343,037,901 *2249237A86D0AB56EE96E88387DDC9C3439901E1 C9nSR
343,037,902 *224CD0922E4BBCC8635407F76525AB85EC385FB1 C9O?;
343,037,903 *224176E837FFEF09ED0975520550D47D9CF132E3 C9#p=
343,037,904 *22495ABE775D1D360991192C38A22F6EC3EFA66A C9
343,037,905 *22479D9E33F78666081AA6AACC3749AE82C8B268 C9p_0
343,037,906 *22426BC985FEF0EE75FAC345C5BC33418A9EDAC3 C9-PL
343,037,907 *224FB242CDA5BDBFFE9BC654612B2A1C587E8407 C(9pO
343,037,908 *2249CD56A2FFB4F6BC242E16C2CC56AB3210D414 C9PTj
343,037,909 *22434CE6FBA0BC7CCDBED328797068AFFA814212 C9(qd
343,037,910 *22417E4C4E9A8F86A35A68276B9C42B5835257E3 C9qg9
343,037,911 *224EA892C3EBF8710604BB54544FD59BEF66975E C9qsi
343,037,912 *224F854159B7AFF3BFA5A9E77BDBE46173C2EBF3 C9QX_
343,037,913 *224425AFFD222EDC4139A269E2D565977E28F578 C=9R=
343,037,914 *22454DAA98474E9A4FD86E82B8D498659AE8BCFE [email protected]
343,037,915 *224F037CEAEF8251006A2B3B9FD8F94FC06B2AD5 C)9S(
343,037,916 *2246C558B807AD65C8DE5662D1F1FE369B4ABB9B C9?s(
343,037,917 *22446F2816F7AE96CF453C61AF9FBE6CEB8BCFE2 C9:/t
343,037,918 *224FCBDE45EF4470E2FCE582EC77B97DA4AD252B C9)T3
343,037,919 *2240520CBFC92D7E4CD8F35D50C3607A77E32354 C9T83
343,037,920 *22429DCBAB0D3C6D0AC9B4DFEB973160CB0F6074 C9ta!
343,037,921 *224DDDAD3DF7C7A295A01A450721DCFA5B4E22E4 C"9tl
343,037,922 *22469FD9AB3C50DBB83CAE67D584511F9F783774 C9tT4
343,037,923 *224ED34188CC12DF1868981A7D8891A76C9298E2 C:9tu
343,037,924 *224FE4C66139317651CBF255E5FBF59FD198056D C9tuO
343,037,925 *2241CE65057C07BA597EEECE437ECD1CC56DC37D C9U85
343,037,926 *2247BB3163FF076B0D5CC2DECFD9C818A2D6EA43 C9(UF
343,037,927 *224BF4CB5FF036418978B846B45B84E76676C3D1 C9uLG
343,037,928 *224876B2AD57FD3BECD6EA68E0FFC208A8B3623C C9)/V
343,037,929 *224027AEEC0CC9A5266AB5FD7D8310209CE11675 C:9v!
343,037,930 *22427672A3F5C70AF9238CDDDDD6AB2C46A82C03 C9V=a
343,037,931 *224E9E2052850874652D3FCE3C0CD877298AE248 C9V$K
343,037,932 *224DEC2A6681A43E4C50CE7829C127DDBB7DBDD1 C"9Vk
343,037,933 *22411AFD6BF02DA25BC868ADBB72AF637E5DA700 C9vkP
343,037,934 *22429C16FA8467BF1AFE800A7EDDC140E3B027CD C9
343,037,935 *2248BB066E1CFECB4884BDD64DCF415FF7FA64E8 C9:w&
343,037,936 *224825305242E692816B0BF64E765A9B8434614D C9W=B
343,037,937 *224FCE2CC9DEBB9A97FBE7E104CE56D4102D5544 C9_WI
343,037,938 *2246D26B35DBBE161FA87D7CFE04624BFC459A05 C9W.I
343,037,939 *2249D945B8352047B872B24DB860BAFEADB0D365 C9?WN
343,037,940 *2242A73E974608456081BF04046585CDD32F5525 C9WN:
343,037,941 *224A4D2F81791997DBA5B4DA1CB3E13D03C3461C C9wP-
343,037,942 *224A6947B81C1272BF4045AD82B47C0659652AE8 C,9XA
343,037,943 *22486C5D5FFB5D038FC9885A5083CF6156C3EA9B C=9Xn
343,037,944 *224FA175FCE5CBD43661A4BD500B170F783759BF C9X%R
343,037,945 *2243117FAEDE7C3EC8F06EB336144B9813B69CB2 C9`y
343,037,946 *22417EDDF2FC81167F96D3A9A51CE463401A7080 C9Y%i
343,037,947 *224437DD93EBAACFE0D04ADCD46A6C5D324CC73F C9?Z,
343,037,948 *224F7360FBAC6714F3B379B9059B135BC954A586 C!9Z5
343,037,949 *2245B4A938FDE6899E99FAA76DAD45D39E4B7BF0 C9=Za
343,037,950 *22456896EE83F43E917412FC69A2FDD82849AE5B C9Zs&
343,037,951 *2246F0EF7ED78AD493F9004A67A02E9DAD12B3BD C<A^
343,037,952 *22475BBB916A53BC9452C0861BA1D348F4EFFA2E C_=A$
343,037,953 *224A8C26C2BC0F02D84E33F5EA094206116AB222 C-$A-
343,037,954 *2243C6100E4D368BEAC2DC2EDD3BE81BD53606C6 C,A+;
343,037,955 *224065247A17B4DC94E4784A592027825FD2744B C;&"A
343,037,956 *224962497D7DFEB6AABF8ACCE3E7A826E19AB69C C;A??
343,037,957 *2244F20ECFB7C697FF0E1B9F444A69528DD07928 C!=)A
343,037,958 *224A193D1823CA5C72C006FFE97B1548E4C9068B C&A(&
343,037,959 *224C411F22A8A9A2240F7F55E2FE18EF52798046 C%&/A
343,037,960 *22418AF3C4F92FF17F907520EF61ACB5D867F33C C
343,037,961 *224CDCF95980D476ED7211950820FC31A745A8F8 CA"-;
343,037,962 *224551E9308331E98572E9676AB122364120DF25 C^a*
343,037,963 *224AC404A0013A32211659DAEE339B3ABFB1700F C,=a;
343,037,964 *224AE94102B80E8BEEF0311791155729C427B01B C),%a
343,037,965 *224FEBD2E1739D3C41DFC39E134A40F55A135BF2 C
343,037,966 *22438276338064A584EDD0FEBA151A4DCA0CFC3D Ca"-#
343,037,967 *22430C30D4FB8859BD0DBDAF0BA8944F1A1EC090 c/A)
343,037,968 *224EE72685C1F737AA1AC745AB4921AA7CDF0DF2 [email protected]<A
343,037,969 *224C085ACA1CFE7628C215294AC4531BCF571D0F C+a
343,037,970 *2244E19AE26E18BC14C7E126F67747FD24963DB9 ca0000203
343,037,971 *22464786343C3CFFAE17DEC565C4465F3A3722BF C#A0F
343,037,972 *224F2139AB34B911224CA918EA04B6BA1A326E1D CA0Tj
343,037,973 *2247FD725CFBBAC10F5FB61B9E8D2DFA6092DA93 CA110WEST
343,037,974 *22436D88953DA203169619C202344D0D825158E9 CA150
343,037,975 *224D9664CD00A5A099DA6BC075F16C52CEEEF03E ca1896
343,037,976 *2242B428078ED9CE41C553F38F9BAC2C0360D2D9 ca1b29665ae0
343,037,977 *224C13B46DF2D112691E8152DBD879B6B480B7C4 Ca1dF
343,037,978 *2247CAB754C65E83C9DCFDE2C2BB2953BA570ACC CA$+1GA+3$
343,037,979 *22478469AF5881A880B093D23C6F120E1BBD802E Ca1i8r35
343,037,980 *2247941EC2EB8E200B40D86075B4826CCA3E68F5 Ca1)O
343,037,981 *22429491B71FD761122DBFEAC11EEA9D695472B4 Ca1umnia735
343,037,982 *224ADB686094115D7DAD034117DB41344C560728 C:a$2
343,037,983 *224471FABE42785677330391A4D5F3F90617A793 Ca20g
343,037,984 *22493628D378826397A04D8FB18057BCBB98365C Ca28-
343,037,985 *2244A43D13EED5E2DE4996BFA8C90F27FB65D4EA Ca-3!
343,037,986 *2249D0732870C8BF35FB637C34253E3099CF0CA6 CA3251
343,037,987 *224A4B32E87B68CAEC07120A7E6B48B7FEF41521 ca3co$tomy
343,037,988 *2245CE87C595DD89967F33FF2E0719488E04039F CA=3N
343,037,989 *22409FB8E343C3CE9C3BB01BD19AEA09468355D3 CA3n8
343,037,990 *2245E1A1EFB83A799D46BACC55E5F7ACCBF763E5 Ca3)u
343,037,991 *224932384A40ADE8A8875C6D03E5884612E4B7E0 C:a3w
343,037,992 *2242C040A94D33FE13B01B832B7C3F6DD12940DE C?.a4
343,037,993 *2243F3B90BA71448C4AB830FAFA3E597B211B048 C))a4
343,037,994 *224F4599F62F25B158C7179B0C128B54DE263432 C&a4!
343,037,995 *224BA8F2CEE536C8CA3549CF89D6015C7D863ACA [email protected]
343,037,996 *224E70B05045D7F8704127AC5509C2F9989345ED CA4s+
343,037,997 *22451D8BEEAA29AEF24C1427FCC8F2AF838CC87D CA4!t
343,037,998 *224E6AFC570FDA57830AD2621735421A491E9AF8 C}a5
343,037,999 *22455D6EB910F72E7E7985F6BFD1D3A7B7757CA4 Ca5;%
343,038,000 *224003474647E14538BE70CFAFECC54F9BC89A2A Ca5/:
343,038,001 *22499A9156E57067CE1E75D18AF39BCA6A232C69 Ca57X
343,038,002 *224BE2686DC8529098703FC87A2D1027EBD9DA4D Ca5:8
343,038,003 *224EFA6B77A167C25946A19CD435F914E3960AEE [email protected]
343,038,004 *2244BC2046F9D1ECED220447238A440E882BB442 CA5G-
343,038,005 *224137A2396585557665419DE31148AE6BE68E08 CA5hC
343,038,006 *2245277B4A7F223F877EB1D07543B88C433A7A58 CA5u"
343,038,007 *2249D4BEF86C88282C8B7E4B436FC6063C1393E0 CA6$-
343,038,008 *224A4985870D6AC1860E975FC8E8859267D3257F Ca6)%
343,038,009 *224E00E5871F488306B2C2E44083E22C1C95E354 CA61606160
343,038,010 *224790D524EFC4681551725898FA1790E120800C ca6415842
343,038,011 *22400429FD70D0AA38E2B7916033734EA2F185C2 CA6625143
343,038,012 *22428EFFBA49E615588236655AECB7EA439C8659 [email protected]
343,038,013 *224E1F11B4075114A78AFE9EC8A555746A09F622 Ca6ft
343,038,014 *22489F3E0F21DB002D9E78D99A3C3A620BFA1DB7 C)a7$
343,038,015 *224EC2119A371BBFC300E39C4CB8764C09FD5D76 CA=7c
343,038,016 *2246765BBA6D46D1BD656BF8AA967B6E61AFBE27 Ca7(N
343,038,017 *224916905B1509BBD82E5649483485B8BE01C214 Ca7.p
343,038,018 *224FC59BEEADF324413BC6E839356BA83DAE9615 Ca7#t
343,038,019 *224940FC57C696E0AADF1DB01AA883AF8353549A C&a8-
343,038,020 *224914E20E22E657DF53833D24D0B2C8D9A8919E Ca80$
343,038,021 *2248BE5B361EE3987E3593111EF334B9DE3509C2 Ca8F4
343,038,022 *224D5EEA545B6DF1D24E8623A1D87A328311D4CA Ca8iR
343,038,023 *224CB373098A4B31DA9271B1F73805D7206BE170 Ca8:K
343,038,024 *2244FEBC1A894350A47D6779AD7ED51339B4DB26 CA8l3
343,038,025 *2241EC51AF5393FC9779C3DC6EB6F022F4BE78FE Ca8N0
343,038,026 *22438E44542230C889CE348F6764FC51248F3FF5 Ca_8t
343,038,027 *2246B7D0F4EC0628139BA855185A71A028B30680 C!+a9
343,038,028 *224EEE50A22269B0EF50F3AB12A84FC408EDAE3F Ca92&
343,038,029 *2244AE2A86B31060D1EFE80213DB129423C54EEF CA98c
343,038,030 *224F88124C8C3106BCF9BEBD2388F1756ACAD432 CA99$
343,038,031 *22490E24EEAF736A1A14F9C41C9DE9CC2B159F37 Ca9Es
343,038,032 *224C8CDFD685C523710E6BF7F5497B614A480808 CA9-G
343,038,033 *224D7210E5307F7DC379BA72C561C248D15DABF6 CaA=?
343,038,034 *224057381F4C35C8C8C8694F017F10E3BE3C11F7 C=aa.
343,038,035 *224D631D2DBEC551C4AB19673A5D9C855CDC186D Caa4B
343,038,036 *2242AC3B4513F075E51D8C5765BC17F85A0F9C3F :$Caaa
343,038,037 *224B39ADED6B66D9E0A0B2D788A7322377E7AFE4 C>>aaa
343,038,038 *22440D1876961BE9335E9162E515002C54084CBB caacagagaccagatgatgaatatatttttaaacttggaacccatgaaccacttattatt
343,038,039 *224A84FD3345D55A861CE3FBBADB2854D23FDAF1 C;AaH
343,038,040 *22490E7378B107EA265119B8273311DB62962BB4 C:Aah
343,038,041 *224B71A4DF3913907350B31C7386539E296E2399 CAak
343,038,042 *2247F4036471FF77C287D0D1B3526236FFE6C92E C+Aak
343,038,043 *224C4A8A80D4A6189212C43D7444035E6EE624A2 caak3
343,038,044 *2241288284CC7D5F6F2C3391C1B5EDB555A09F52 CA.Al
343,038,045 *2248ACED1995865F9CFAEC13646277F2AC86146B Caariega1
343,038,046 *224E06EC05F5478195CEA7B9BC4005E1F5791B95 Caarls
343,038,047 *22438B4DEFCCCE61CEC42BEC1E84AAE6EF6298ED [email protected]
343,038,048 *2242F1E7B57D9B238691F4139DA556EF8188169C caatingueiros
343,038,049 *224EEF2E2332C7DA173C30C251A32A8E6D0C9729 [email protected]
343,038,050 *224599469963EA96AF09AAD7FD786D5A11B399F8 C/A,B
343,038,051 *224ACA715E73D33373D71C04D8EDB46365673C11 CA-.b
343,038,052 *224D712AB7CE4B8E76A58A3B78BC902D3526ECB5 C?=ab
343,038,053 *22485D5A5F296FBC190E19B2871151EE29B97F1A CA!b7
343,038,054 *22464B1243F6D8C98E4D09BD9EE7D90A9B635A76 cabalistique7
343,038,055 *224763ED393961E6173ACCC69AC90F848B155DE3 Cabaltera3
343,038,056 *2242DE818E28B813C996AE962F68A355118A50B5 cabbagefairy160talk1
343,038,057 *224C72C2075363BFAABEE69F1F7EF7DA5EAD0438 CABBAGEWORM.
343,038,058 *22458BC0946E015C3935E00E73B9DD791327926E cabbie10
343,038,059 *224325291C58F523AAB0B11EF80C9EF23405C972 Cabblet6
343,038,060 *22462E4FDC3A37AA810E520EE25FF4CEFAC8233B cabbooster
343,038,061 *2249485043ECB624851D37A0A54CA1E9C79772FC cabecear1
343,038,062 *224E7E4A3424666188996926DA28B3E4DA8276FC [email protected]
343,038,063 *22424FC10C2E16CD66CF61D619718B7EC4C4817A cabesnos
343,038,064 *224B0E787654E7EF972AC6B674B534B88B948B1A CABEZAMESADA
343,038,065 *22445F873CC6F81D60F8EC3C30C583423AA6CE37 Cabezos4
343,038,066 *2244297F1E8894574FC9938FAB3D6476A6217339 CaBh0
343,038,067 *224830B645B67A0751CFAAFEBACBEBED2430ADC1 Cabinetmed
343,038,068 *22402CFDF150F1162B059DF0CBFFD4ADE3F36D51 cabinetwork123
343,038,069 *22401618E36E0BEF50DF01C112B3613B61B614A0 Cabirice
343,038,070 *224179D362106BE741991236A91CAC13279353C7 cableados123
343,038,071 *224ED6767FCD61360C4D1D616C1757AE72A53FC8 cabledirect
343,038,072 *224FFCB438C3886B749D3ECD2DFD92A482E20080 cablnet123
343,038,073 *22404D4B4B88E033650F9E9137613942FE2A5667 Cabneder1
343,038,074 *224A49E2C72EB070DAE82BABEDD2003A30F8AABB [email protected]
343,038,075 *2246A7BE9F318C7AB2ADF2E314627213AE5F7B36 CABOODLES3
343,038,076 *2245783E9E48FAC3B7306E124FADAE73CA00684D CA-BOOL
343,038,077 *224873D594D0B51B11C2962AD862001F193BB643 CABOOSE7
343,038,078 *2249BEDBBF7B468DBDC14DC41E9836B3DC4B938A cabooso7
343,038,079 *224A1996E77CD9670AA87D73C3D28448402F3911 cabopinaed
343,038,080 *2247D469B86D89696EFB953AFD264A90C7DD0D92 Cabossed
343,038,081 *2245D6CF8D129FAC100DBC281DA87BA891F967FE cabriasteaua1234
343,038,082 *224E9994A19C1737AD1562F1CE8A55F0DC0DBB34 Cabriḷḷanes
343,038,083 *224914A793FD367998FBD7CB836241ADEA5382A5 cabuzciprian12
343,038,084 *224E0D99287EA4A0E97FC9650F0B068754B7D43B caby1234
343,038,085 *22458559264E2594AE348AC43FAC07118A218F86 CaBZ.
343,038,086 *22470FBBCBC0818FDF7DB6C23B9BC7F81F94BA8A C+A)C
343,038,087 *2249723DE633957BC580C1CA1BA55E5356F57874 CA!"C
343,038,088 *224C7B8C5B8C741434E757B4012B7015E6CFD88F C?-aC
343,038,089 *2244F59E24D46279AAFCA4BAA26B1A4C51742347 C?a
343,038,090 *224852F5DC35ACFA213CB1F763757983EA312C36 Ca"C&
343,038,091 *224E6C1896CFC17999478698583CCB223E034ADF Cac0l0gy
343,038,092 *224FFDBC09E2C84BD30A3714A51F8C6FF08AA6FC CAc5?
343,038,093 *224F791FAC31EA914F0688B0CC74DC0E8C64D452 cacacacacaccccttgtccatccaggcatcagggcatagacagacagatgcaatggctc
343,038,094 *224F2733ACA40FE6E92CD09EA45D2C71830BCBB8 cacareas
343,038,095 *224D3DD84A9A136803587135B1FEB6971B8B1D1F cacatmental
343,038,096 *2244B590AE7FF4EB1AD16EFBD1D7972572EC0BD4 [email protected]
343,038,097 *224F0B3492B2A4B0BF519E5812BA7BFB976FEE86 CAcFs
343,038,098 *224CC4D259B9230C4263709C907C38410FDC55EA CACHEMIA7
343,038,099 *224E34D2626FE686347EBDA7C0A6F6D4D62D3BB4 Ca+chi3$+
343,038,100 *224BA5D7C7D8271821E115E53FAFF8C56D35B3FE cachingas
343,038,101 *224BCD1AE352F86FA3D88FC6A3360E5029B0007A cachottiers6
343,038,102 *224DA7F8D1DA23C9C357837756F6CE70C44D490D cācī
343,038,103 *224A507AD3F6549B441F8BC35D8B07BD60701440 Cacibauda12
343,038,104 *22497818A32B7CB37CB086BF1528E96D025499D8 cacicareis1
343,038,105 *224931DD3307B7EF605B087AB40ADE08E7751114 CACkO
343,038,106 *224BA9440C539C1481301A22ED867D6D419135F2 CACODAEMONIC3
343,038,107 *224B8356AB8CD48E3E10261A095AADDD9F7D38D5 cacodyling
343,038,108 *2242CDE0CE8A02DC75589980FF4A2E821F5F6526 cacofónico
343,038,109 *224515B41A64D3304BA4D8E7E06F33ED35398302 CAC
343,038,110 *2248E70DC09CB159D23431702C67DA5BD3C38BB6 CAcqE
343,038,111 *22422CA562A47CA2588253C0696081E9A77BAD05 cacrazy4u
343,038,112 *2241534B1651358B12BC35B2C63539E50C679D33 CA-CSUF-MUSIC
343,038,113 *224DAC1DB8D3BB6EE9B80D11BFD2F602CD2CFEBD cacttacccgtgagtagccagtagtcactgatgtggagccctcttgtgtgccaccagcca
343,038,114 *2242F81259ED101BB03B82608D1CD809D7E3603F cactus622
343,038,115 *224FF8157BE6B14C47B3635233781F229DF8AA98 [email protected]
343,038,116 *224E5D319F1BCD88557B94D697BE0BC5C545E3AF Cacuszkoed
343,038,117 *224BAE11C293A5BFE261ADFCE4BB1C47858A10D7 CacVn
343,038,118 *22447C39A4406B6D7DA4B6A9CDCF40D5982B7BD8 Ca/+D
343,038,119 *22455F8EEB404EFC2A7D2DB17987CFD4AD75BCD7 cada historia (feat. ana torroja)
343,038,120 *2247188DE02139DC005F646F155C50B2C0C9AA38 cadams1779
343,038,121 *224A06A4B7B0A40CF0F488D115594F53769F8092 Cadarius1
343,038,122 *2243B37BCB945DFA4699702BF67EFF320CCEFC4E C-ADc
343,038,123 *2246BCDEB80A590503609C14479A1191DADEB7DA CA/dd
343,038,124 *2247C84A96BAD6DFD1DE5096B5C58ACCD0038EDB Caddiganed
343,038,125 *224072844CBB089A8EA32C09E6F0AC57CAAC2E13 cade668
343,038,126 *2249A811BC9A94D18688D6FFA71B125C9B8E1FA2 caden331
343,038,127 *224A1B3E4FDACB44D4EC1B283451812DCC100105 cadenceanderson
343,038,128 *224F22985E5BB916869543DBA7969AB601C3E8CD CADENCERAIT4
343,038,129 *224FE94958549EC2924CDB3E7ECD28D62699814E cadenciava1
343,038,130 *224FD66F2A5F16AD17C98A204E9E3E6A1AA423DD Cadencin8
343,038,131 *2244284C0BCF23B6E52BC10512185760445850AB Cadenzaed
343,038,132 *224F557A460D17024F655E995856EA152B185B61 cadetNhip
343,038,133 *224622C7241FA4AE93288BA2C92A127BA593D764 cadiergues
343,038,134 *22444D5157EF08EC95E56AF9CA823A31E8DF2A30 CadillaStationMetro
343,038,135 *224E52CD0ADE75BE22D87CC326DD87286DACFB26 Cadiueios
343,038,136 *224805B88898C72DF0C9C957EFCD9D91D1769296 CAdj
343,038,137 *224B88EEBBCBDD7B171D0DE72480DEA779912C09 C(adk
343,038,138 *2246AF261F1A7ADF14DFCBF1F8D856BD479F9AB4 Cadlimo2
343,038,139 *2247E81F3B68EAC2E71EA116D66A515EDF3B091D CaDMe
343,038,140 *224F23943C2DD6AE1B95733DE4EBB6EE834CF432 cadmiumlampe
343,038,141 *22447D68CC9F4644B748A31E052368AB8F3EA02F CADMORES
343,038,142 *2243B1E5BAFA0712A2EFDFDF6FBE32679FFFDA21 カダン【cadn】
343,038,143 *22441B67C35A35AC7DBD40C5BB255FC2C307AB4E C$Adp
343,038,144 *224A4944383C5E518179EF05F2BFE9560BEF3C90 cadpoint123
343,038,145 *224AEB895E284585EC80915DF7C97C4391CDA12C Cadraneling
343,038,146 *22409C2056300E1020B3E62E17BC0D6E5706E073 cadross8
343,038,147 *22413A4C357C8150FBF7B1730FA84FCEA25BE616 C!AdS
343,038,148 *22407A5DDB766170A2B2EA0B90632EC07FAA9AE2 CAD"T
343,038,149 *22444AE6205A79B7A0000CEB27838E680F23EC96 caduque?
343,038,150 *2249D56FD05F33A9E977DBD98B39C2EC4FF42822 cadusta
343,038,151 *224D3A695AAD122EF45D4BFBA29B3C7BF46EBF9C cadweb.net
343,038,152 *224B43D719C4C4324A4A4AC56DF855A3E96C1C69 Cadworme3
343,038,153 *2242CB518D30AE039E6E390C173178683F0BDA2F [email protected]
343,038,154 *224C81612A3BFA4B13C619F584975A2468D0C61D CADZS
343,038,155 *224970F405E6D01CAAB9893A5DBD66CE31975F03 Ca?
343,038,156 *224B72B1466B0947B8E4065163E5FCB05C9F8506 CA!e1
343,038,157 *2240AD7AD31E967705CB80641DB9931BE1A40B7C CAe7g
343,038,158 *224BE431381D2C50CBC494B7625CBBEF34568933 C?Ae8
343,038,159 *224FECC29DB6857AB95A85D23D1145CE479CFD16 CAEAb
343,038,160 *2241308E041D5D6EE11F903F03B6CB1E2F031A74 cae[email protected]
343,038,161 *224FB1A59918771430D7808DDA3785032F8F5E37 caecare6
343,038,162 *22430FCED24C6177F9C2C867AF9EDB0E38EED0B5 caecatur
343,038,163 *22446458A286D0678345447F31CFF2B3586B884E CA+ECH1ZE$
343,038,164 *22481DF71FF76062837A98ABAD2268B7B196DE8A Caedemini
343,038,165 *224B8B129723BEE5C213AB0C995D7C017FE8E5D1 caeelec9
343,038,166 *224DDF2772B57FE6931205E04C6D2A1A85350311 Caefinalalluvia
343,038,167 *224C57FD3CEF92A058AF795A216D833550609F83 CaEHr
343,038,168 *2240C8BAD9FC9ED5F33AF50635417E0B606FC918 CAEk9
343,038,169 *22420BCBCF7DD81341362B3416341A658D342AA9 cael298
343,038,170 *2241753E91B853152D245CC4502673558CD2BB04 Caelifer1
343,038,171 *2249749FC93DE52D3CC863696FC74E57D5B8563E caelmo
343,038,172 *2247B84CD20500F558156B9CC85F9EF51E30557F caenogaean.
343,038,173 *2247A2D7FD4606F813C3E7D57C194D6A97912EF8 Caenogenetics
343,038,174 *224ED56ECA4F1C691951F1280C7F8B614C18D9C0 CaE-O
343,038,175 *2247622EC74140627E0D9CE1EDFCD1D5C87A7F68 Caep3
343,038,176 *2243019CCABA14C2C247166929491C469DEF5E66 Caergwyn
343,038,177 *224091C9FD1037AEACD68DE72526DA23545FF81A [email protected]
343,038,178 *224F07D8BA518C50D3F1F8994CB85EAB30875AF0 Caerthiélien
343,038,179 *224D55B808C2643A59E77B2282671746BB8380C3 caesaeque123
343,038,180 *2249592E7EC679195F205E5DCC598A0F8F97BBCD [email protected]
343,038,181 *2241F304FC560EF397DF36BF69DD078D3A9C6480 caesarsmika
343,038,182 *2245CE6F66007E67F933124B3E29026F0C3D5630 CaeTD
343,038,183 *2249447E337C93C6F9F7E552E3B86C705F3573A5 CAEUa
343,038,184 *2246FF2B2D0E17571B37F05F0D2C57932191C5EC Ca$ey
343,038,185 *2249BE311EE4B9621F415FAF28C959F9A08CAA7E C_AF)
343,038,186 *224B6758051284FA144982CCC5C438792487154C C%A$f
343,038,187 *224A75B2F5AF37D451FC2D0FA240BC704D858683 CAf2L
343,038,188 *2248326835C9C760DD82EF9704C7EEF0989D6183 Cafai
343,038,189 *224D5E77E41B46035ADDE205BB0DAC17A8BBB555 cafaidh
343,038,190 *224B260EB25F2C64967E2E810464FFEE99379EAD [email protected]
343,038,191 *2249F059C210D39AE98C9DBD80EEBE66BD831924 [email protected]
343,038,192 *2244759891624667EDF9C9258A6E3205F9C1E575 C+AfD
343,038,193 *2243436A577C4A1898FF8257793129885B451308 Cafdnaly1
343,038,194 *2246256A6605E7C7478234C6B722562CEC2FE7EA [email protected]
343,038,195 *2242916BBB86264B6DAD11529E760C3CFA4B7C95 Caferring
343,038,196 *224C6E59F77618575D07A407DC14EF75C9B9DAA4 cafesafado
343,038,197 *2249116EEC316DA8B11E2C8EBB601C6163EBBAD9 CAFE-TO-CASH-IN-ON-INTL-BRAND
343,038,198 *224D5A3F77F63DD9073781407D5CA00F34EC47F9 cafetos5
343,038,199 *2244F915B98D61C3B0353B82B8B66B9C73AC74DA CAFFEONE2
343,038,200 *2241592EDD56C451E5470329F3E7F6F00D39210A Caffine5
343,038,201 *2244D038D7863ADFBE3761DFD8333AC8510596ED CAF?h
343,038,202 *224EB0585F943BA2E788001FFE375680E8836E82 CaFHn
343,038,203 *2241121D240AD6AC852FD938DC03ABE7F23EA2CF CA+fk
343,038,204 *22425C395331B3D51BDF0396D38AA264EC341C84 Caflivning
343,038,205 *2247C739F87D490DFB34868678F77E66FE723D9B CA-Fo
343,038,206 *22481C351258FA01C6093DDB0A0D4176D4723461 caforce123
343,038,207 *2241A9C6B9DAD7D46FE33F2BED041924A7388EA0 CaFqT
343,038,208 *224831E2A2569F1514BB940E7E0D021EFE00B194 CaFR6
343,038,209 *224A638DB9A56B485669F33CF410C440EE64BD90 Cafshces0
343,038,210 *224581D74097E12097649F1F56DA4E9D2AE6E4F9 CA-FW
343,038,211 *22409DC2997B0C5ED32B5B669C78B56FC7F644AA cafyngm
343,038,212 *2243F6BE97C55932571D0D641131394FC5FE0363 CA
343,038,213 *22448D54E5678A237D339EF80C38156835B78603 Ca#g-
343,038,214 *224F2C438D299ECF408D055E696673524E23B645 CaG(0
343,038,215 *224DF1A0D61EBFD70F7DB92E791924BA8CFEEEA6 CAG=1
343,038,216 *224245C2D335FA461741D928B7283276D30823EF cagaatggtgtgcacccttgtgtctgagagtgcccctgtctggcagcagagaatggaggt
343,038,217 *224928866DFD1DEE95D7DC65665094212800DC91 CAGALLI101
343,038,218 *224EF69A57D56CE57929A61E986B46354595D268 [email protected]
343,038,219 *2240EA2D8F6910E7F3D10587234E468EC85A1C14 cageless1
343,038,220 *2247694DA37101577C2FE619FE621D1227A26AF5 CAGeY
343,038,221 *224E987602D36BD701E93E5F8CC8CADED9E18562 CAGh;
343,038,222 *2246188DFAA346F6B0BF8B6466A292C517A9A933 C_aGi
343,038,223 *22460AE4B49F308B6179460C282B514BD0BBC29F Cagibis5
343,038,224 *224E489F0D3739656B7B08CFBBD82A8443AB7F89 CAGIG
343,038,225 *224F40862E7338CDDF4067C84BDBE4D8AF53B8C7 CA!gk
343,038,226 *2246656DCD85431EE419ACA396212D801598AB84 Cag_n
343,038,227 *224EF3A677213E47F04ACC23AB16F0E2345ED624 CAGoC
343,038,228 *224C64D0DD761A661162BE810D5933AEB069D41B CagOu
343,038,229 *2246E82C492B68572E41808ACD00902D1F189D69 cagouliez
343,038,230 *22455DE4DABBF1043EF37388FBA2E1C523C1A95D CAgqj
343,038,231 *2242F2C6F43D87EE774F78AD4922BE78AE241EA9 C
343,038,232 *224296E458DCF5E9F750452A2C595C3FD2E346E7 Çağrankaya
343,038,233 *22483BBA7F35061E4D472E91FF4C92113734E6DD çağrıldı
343,038,234 *22430B79B32B86A1B34FFFAFD9D961E5D3C3D191 Cagsalaosao
343,038,235 *22412736F5BE1DEADA471C978B8E97B2B8049A84 [email protected]
343,038,236 *224A8B4EB2CAFEE4BD482567F324A406520E5AD5 CagU;
343,038,237 *224520CBA12D08976BCBA5D70CD0E137A0CCBAEE CA+H_
343,038,238 *2241039AA6E30615E999E3C03D0131357AEADDE7 CAH5A
343,038,239 *224CFF54FC048706BF2DAE797A082081CF198CEA CaH$a
343,038,240 *224EDCF372D70165851C9DB50D6773F45786031A CaHi!
343,038,241 *224C7C8456CD9D187C81190713708088BEF8B37A Cahioka
343,038,242 *224DBE7D59825DB95E1404434FCBC6AC5B4CBFCD CaHMb
343,038,243 *2241CAD1CACEF96F8F9CBE0F9F66A551059FF135 C-ahN
343,038,244 *22466D3D213E07BE47C597CEFF415CE68D20D8F4 [email protected]
343,038,245 *224D1F3EBF982A71F5CC9D3AA36BB8608D570E37 CAH#U
343,038,246 *2249BECA121C548E952108F8F85D003E90741249 Cah+w
343,038,247 *224DD57E35B3112F73B1BEC39278458678C38785 Cahw
343,038,248 *22467B436A139C8D91179E21F1167741D4DFFCFD C,ahX
343,038,249 *22425B90D8E20D5BE13AF2B595160655FA5D594A Cah&X
343,038,250 *224B05BD0079FF700FD566B390C0441EB5A8C23C Cahzjmczes
343,038,251 *224A1AE7AE3F02EC33EB56B085462C7CFFF942E4 C,aI
343,038,252 *2247F132AB2DF00C797E22423750295223752509 C=a.i
343,038,253 *224317F4B1A5A353E63F2C016E6C9923897B7C97 C,a%i
343,038,254 *2249F54C75948BE596F8115CF1E1826BBAD3B9F8 C%ai0
343,038,255 *22401C1FFEDA4C1F8D33CE8F2724CFC7A926D888 [email protected]
343,038,256 *224BEE31B309AB532772FA4A2847258DE8819865 [email protected]
343,038,257 *22472550411529275779F7F77B74411332CF670A [email protected]
343,038,258 *224AF1F0073DC99E8A7B1CC4D2B6C6E788E39564 [email protected]
343,038,259 *22436E98CFB2B3E75241B95E65E4CF309FFDB5DA [email protected]
343,038,260 *224EEF0D43DAD87670BBDF35D65D1C4F539C07B9 caibafo
343,038,261 *22459583A211E6C802069B85C275AB97645B4171 [email protected]
343,038,262 *224F1C197003C5E6A2A5D92467D1FAD64FF346DC [email protected]
343,038,263 *2247C31BE690D75BEF28B77C2C028C18B1B1C37E [email protected]
343,038,264 *224772D0E408285D4C625E069B9029D720831CFC [email protected]
343,038,265 *224E964423C2149D578C63D0158F87E4895175BF [email protected]
343,038,266 *224529C8E213D261C229D7501CA78D43EBC2B5C7 CaIcT
343,038,267 *224A4D30D9A0295961C6D2D0B6ACA5855D0BD451 [email protected]
343,038,268 *224491455994C49D687BC7C9F852E2FA06CCEEFE [email protected]
343,038,269 *224C530654013133B086064AA721839D3BA21687 [email protected]
343,038,270 *224D8A5FB105B6EAAC9D4D00B0A6C2D5FDB7354F [email protected]
343,038,271 *2245E1F01ABA396D41A40E6E7E1D37674CA9838A Caifanes1990
343,038,272 *2241099FC3F71CA215EFF076D3DD9536C13E234D [email protected]
343,038,273 *2248AF6B6660F760A8CFECE6DF683BD1F19AA9AA [email protected]
343,038,274 *2246157C2B66593D99123DD99B955CFB0B1890DE [email protected]
343,038,275 *224F4701D943255DF61E7FFF1276E5D4F655BA22 [email protected]
343,038,276 *22493B394FAAB0B6B901EC863CFF51ACF232587D [email protected]
343,038,277 *224DBE3276A3264451945214FC3D44FC23A8422B [email protected]
343,038,278 *22411EB36C5F007DE3FFB1F49CFF38257C4E396E [email protected]
343,038,279 *22486B1D34C412C99592D293B99BF5E0EECD7C08 caihongxing
343,038,280 *2245B25D0BEC013467C2BB7CE83223DD349D2E24 caihosei
343,038,281 *22421E7D91FD42371472C297996C5F05A8BF8D13 CAIhV
343,038,282 *22492F9D21E114B6D2F3AF9A4C3E5D2F4E25E37F [email protected]
343,038,283 *22478846991D3856D1DA0F562168F2245090F9CB [email protected]
343,038,284 *22456B19892A8E32FC26B63D803478BB0FE00D17 caijienao
343,038,285 *2248B2E75145B1991DCB09437C2CCB63D7C6A31E [email protected]
343,038,286