List database


# MySQL hash MySQL password
277,360,001 *1B48C2314C37929531F012CFF0453E7227281FEE armando.cosenza
277,360,002 *1B46E495B39C4F4409302BA07CF94E244155A6A7 armando.delagarza
277,360,003 *1B42F0F789D725E24CE482EF203343DF10E4F7C6 armando.diekman
277,360,004 *1B44290775034C4F9991839B927058C5917D0102 armando.dolbee
277,360,005 *1B48E7FBD64D2FB29D607A9DA19EA7EB89C26312 armando-estrada
277,360,006 *1B447E396C3BE67550CF95BCCD73602243FE440D armando.fabozzi
277,360,007 *1B45F18F9E0D2E773F661E9AAC02133F42A6BF3E armando.fajardo
277,360,008 *1B400DAE60DEA5C73323E2D5B7092FB88C592947 armando.foulger
277,360,009 *1B4B2A234BDF79690FDBF488291FDA683A2A0DA2 armando.grobes
277,360,010 *1B4CF8432AA03DCCBE3E2C2B0DCCC91AD8C6F270 armando.kabus
277,360,011 *1B466A5CB23AE4182EF491B5D3134255F366DB59 armando.kofoed
277,360,012 *1B49747D605A36812DDF1FAB75B4A35780B55F80 armando.libertini
277,360,013 *1B479342509FD33509FDB43AFB109180C496C615 armando.machak
277,360,014 *1B42DBD72448075D3868D0CCFE8C30F700502F1B armando.meiggs
277,360,015 *1B4E628682BC6E91ECBBBB74F5328570CED08509 armando.milliner
277,360,016 *1B48F63AD977862A2049F1DECD8EA44C0C1EC91A armando.montiero
277,360,017 *1B4AF0CFA7F725B015C745508D8C49FE35CD270F armando.murat
277,360,018 *1B440BD6C62EE3AFC91DAA6D00E1CA7FB74A9842 armando.odebralski
277,360,019 *1B40FFC58341372233715329925AD03BA726B10A armando.pumphrey
277,360,020 *1B47E7B3CAC5D0427D249A2D3BFCF383C682B6FC armando.rado
277,360,021 *1B4FA3391A5A3C827D38488238B40C6A764D7B5F armandos5
277,360,022 *1B4609B94E379FE43F1566E3B7F6E417813A7A1C armando.santheson
277,360,023 *1B4DFAFFE67A2F8A1E0EDBE5557DC464AB4BD735 armand prinsloo
277,360,024 *1B46D7D420E60C8EC4636894BF9F36431FC877AC armand.rinaldis
277,360,025 *1B4185341A137DF658807AD7B4EF1D9371E03D75 armand.schnitman
277,360,026 *1B40C6472EECD2901C74AA6E5D4D34A5149DA5ED armand.shanaa
277,360,027 *1B406F78E4E985D5EEECC42F66C9C81070450259 armand.sharman
277,360,028 *1B427C844A7F17FA2A626F8C56B24546C97E5765 armand.shuhi
277,360,029 *1B4D8C8EEA7FC981A4F956F5F30D8598015B9E14 armand.spach
277,360,030 *1B45F0C5CFB203687645F97E815F43201F869947 armand.szalai
277,360,031 *1B44529C5B7E5B8E85F212D13414E40124CAEAB1 armand.theinert
277,360,032 *1B4EFF3A532168429B434C211088CD5082F67C54 armand.trumbore
277,360,033 *1B4A8EC86F32C0CCB94456C27DD63811C27E9F63 armani030
277,360,034 *1B46E1B1DA9C18E60648A653AE40E2543C4B7CBF armaniškės
277,360,035 *1B4BFEEAFE297612CAE8DAA71656153FCD5413AE Armaque5
277,360,036 *1B44BF1968E6E2FF020A097B8FBEF3172EFBA4AB Armarette
277,360,037 *1B4A7DC131D018DA60B8AAB79A4A4004E928E28D Armasiri3
277,360,038 *1B41FA6F2DCD3F8E718B5BBDB55DE9816D83E8A1 Armassimo
277,360,039 *1B499987564D91C271CD6A497C4E9468B51DF612 armatorska
277,360,040 *1B42DD9D533E72F659695D013E1C09C21B15F2F5 ARmb0
277,360,041 *1B4868476538A3E1A335F6F552AB79CE175009A6 Armealia5
277,360,042 *1B43952A2C5D72A09BD77B8449470B95D14CD41C Armeeabteilungen
277,360,043 *1B4F6D3823808B56BF8DE20183282FB97BD25BA0 Armékorpset
277,360,044 *1B4559836A9D97C4D2C737C4E8A4E422FE3C9C11 armenbuurt!
277,360,045 *1B44175A95ABE8B11A888CD11268703706FC45B6 Armenernes
277,360,046 *1B4F2CCE438100AE8A114B0509987A246DBA4671 Armenfondsen4
277,360,047 *1B44B118910967693471804C7962D4F4B780FF0B ARmenia
277,360,048 *1B4839F00E007F45EE1A840DA298FADED6678E31 ARMENIA-HUNGARY
277,360,049 *1B445D69A9C49AE87E2E33D998A1580CCABADD4A ArmeniGreeceflag
277,360,050 *1B46C0974CD67821ADE43B2BDEE1E48D2738F157 armenmart
277,360,051 *1B4F4249AB5F0B1E04B292F2B330458EC0E55021 Armenscholen?
277,360,052 *1B4258D5DADD3B2129979DC97FC2FA43AD5A5AB2 armentered
277,360,053 *1B4E59E74F30B41E5693D1732F71F524BBD21C41 armerin
277,360,054 *1B4158E85A327DBE874A4727BDF1D04D93628ADB Armflügel
277,360,055 *1B4E6B48C30ACD7F8ED2749A6051851BFE89EB18 ARmFW
277,360,056 *1B484258816DD079407CCBE8457F5AFE0C856784 ArMhD
277,360,057 *1B478DF097E31EB5074E1A97EC0218C78D8EA04E armi go
277,360,058 *1B47347BACAA046248EB0F8AE0A812EEF3E0B36C armills2
277,360,059 *1B44338FB2446062A7ED74D0EF38251EA37AF8CE armingto7
277,360,060 *1B497D4A720EC311986AE3560BDDD364EB780944 arminianing
277,360,061 *1B45B0FEA9FB47A4B7CE7685A7EDA306CBAB8654 ArMkn
277,360,062 *1B4785624161FB1FDFAF44EF889FC8385C290900 ARMLt
277,360,063 *1B436BEFBAC21D7C2196229D31F5D8CC2AC5AD7B A_rmM
277,360,064 *1B443CF9B55E0A38BA9A3DA8E2DA2E29CE966254 arm of the godless
277,360,065 *1B4760FFC6691D4D8E9948FB636E99B29F5CE529 Armogos
277,360,066 *1B4E3C2854F880413D39DDA903DBA4FD5BA5FCC5 armonsanomalla
277,360,067 *1B42972B07F4CD679D39334FDEA13EDCC3E53912 armonyums
277,360,068 *1B4C4268610E51492818F21A43AE2FC299551E11 armor13$$
277,360,069 *1B4F1782AE9AEA23BADF5ED9819A622E3C73FCD1 armoudeh
277,360,070 *1B4F2AE841EA575890A61CF5F10C2682969A8E7D [email protected]
277,360,071 *1B4C15FFF7F4AC6FC9A326FBF0104BF30F0B7393 A#RmP
277,360,072 *1B490A9E56D4CD94796C158ED552AA62C9EDB969 armsati
277,360,073 *1B4B4EA74CA303D067496EC7F8E0008FFA2268AD armscroatian
277,360,074 *1B4A7E31B1753EAEDC9747A7C9A4969350B5B538 ‘Armstrong
277,360,075 *1B4D4EE70099786A6D29D06B856E688DF180AB74 armverzorgers6
277,360,076 *1B4C9BE5927A715E185FF0A50987ACB58CA7EB27 ARmwg
277,360,077 *1B4F8D3ECBFB77908FF5BDA116C7603E150E2E58 army_council
277,360,078 *1B425083751908CDD9D6607F82DC779EA2B7C12D armyofd27
277,360,079 *1B43C1A9FE578D989B1FE2403680EDF89D20187F armyproxy
277,360,080 *1B41AB0448CBCE7636693262805ADE421DE756E5 ArmYv
277,360,081 *1B468A8FB2C723BA1D1A87AAEC34577382D0AE1F armyworms9
277,360,082 *1B4EEB26181DFE64E16233CB0F2E0C69E4E01955 A;R
277,360,083 *1B4EF24089DDF5057CC4135AB76691DEC88CFC94 ArN7c
277,360,084 *1B4D2324BB00752CB6CE5089AA81527EF9E3AB2C arnaquering
277,360,085 *1B472A07D24CF7D4AC8468CDDF3839FBC34D6F02 Arnastauskienė
277,360,086 *1B4A1CC0CF1D0045E3F34276B698534D234FD848 arnav307
277,360,087 *1B49CC8753E93BCCF2176FF8FA84D2120AAB783F arnaveing
277,360,088 *1B4337FC03E8EAE2D114EA0DE3FFB11894D22F4A arnavutçada
277,360,089 *1B47CB9D4932F8F7B3BB2C5E116865CA6B3CF80B ARNDELL12
277,360,090 *1B44A8078326A10FC34A50F2004EF82D80BB5B13 arnefaes
277,360,091 *1B4D45692174C9194562E2994AB2E29F415E9379 Arneham
277,360,092 *1B4BE34338B0B6EADEFCF91311F8EB1A8771E1B0 Arneida9
277,360,093 *1B429CAE37621D1F10BCBFF15076EEFDBC63E17A Arnerent7
277,360,094 *1B4036EE3EA4741279FF793F615308006B3AAC11 Arnfgebot
277,360,095 *1B4557E6EC8F513A0923A1BC525DAD760B1F313B Arngeli2
277,360,096 *1B438E9E343F697C6B0CF6EF9C1803112F8287C9 ArnhildHH
277,360,097 *1B42D51318C9E0F0A46F5371CA86B2DECCBAC32F ARni?
277,360,098 *1B4E9E2DB6FBC97024AC7F59DBADAC1E5C5AE151 Arnicea
277,360,099 *1B4415337A21B7809CBC1399271C213FAEA6CDA5 arnieks
277,360,100 *1B460B4B16CA59799894D89C7A20F9E12DA0B4F8 ARN.k
277,360,101 *1B4912D85059B8D5BDC3494E006DF8B439F35C40 ArNL=
277,360,102 *1B4DE953BBA97743F8B70B72E2AF00153F89FCB6 arnmanu
277,360,103 *1B4606260FF9B675D0732F043B3A1413F3C3EDF9 arnold.albarez
277,360,104 *1B41C403B11ACB25CCA3B65F9BB7C09766C655F2 arnold.balestrieri
277,360,105 *1B46CCFBA7FFCA63E322F709682E4ED97B10343B arnold.cretsinger
277,360,106 *1B4CD507E159DFF12D5174FE2581B9EF3729FB15 arnolddennis
277,360,107 *1B44CCB8764E85CAF843F68B7876905B0B084445 arnold.dobias
277,360,108 *1B409CA77D2DD3C31501CFA4D74AD95CCCE6709A arnold.endow
277,360,109 *1B4EB0C56D6A24826F1FB1204E8927C4AD60BF51 arnold.fioravanti
277,360,110 *1B49BE44A82C198EE87D0AE4E270A0D571CFBF3D arnold.groot
277,360,111 *1B4D2D051750FC189D6462CF39B12E0CF7D61FE2 arnold.kulakowski
277,360,112 *1B4E3C160950A27D33D1C4D45EB3411A340FB910 arnold.lesney
277,360,113 *1B4CF8636608047731A799514374CAC29D618D4D [email protected]
277,360,114 *1B4F1E0C3FE344DF6215CFBD1ACAB0E4FD32857A arnoldo.benitone
277,360,115 *1B41A68AB032481D7A622F53048A87040FC9C695 arnoldo.bowe
277,360,116 *1B4E1B87239CE586BE364BCB0E76C8613D656AE6 arnoldo.breslauer
277,360,117 *1B47F218F3B7D003E2DB2683E2FFF1A2E734E680 arnoldo.brunkow
277,360,118 *1B4C984ADD4C0F5C8E248C787DE852CEAB023874 arnoldo.delgrosso
277,360,119 *1B472C3DAA771216E25AAB30DEA2786F455923E8 arnoldo.delongis
277,360,120 *1B4B2AC7EC72048DC6E34A58488DAE87385DBBC9 arnoldo.droege
277,360,121 *1B47870F758CED16A5A04EE167EE788A7895547B arnoldo.evick
277,360,122 *1B4CE9BCAD98B2D5C1B1085802407DCCEE10BB57 arnoldo.griffee
277,360,123 *1B460DC64F6DB00B7C92AFE164429ED8D196496A arnoldo.madena
277,360,124 *1B4F1E80005D8B52A60454D9AFE849D04BA52457 arnoldo.olewinski
277,360,125 *1B4AE9578257BD636D1710CC953954C1700E8361 arnoldo.plasse
277,360,126 *1B4C69A78D3379A2FF3533BFDDAF192EFAAA3D7C arnoldo.popadiuk
277,360,127 *1B45EE4262410EF11C78FE4B41FC8FA5D3613BFD arnoldo.rolseth
277,360,128 *1B49552352CA717CC98DA760ED8631B14724CB6F arnold.osterberg
277,360,129 *1B4A64471B8744AFBD9A9BEC438FCCB0FED056DC arnoldo.talyor
277,360,130 *1B42EDEB53E5694B129AFABAD2B9980A3BA7BFAB arnoldo.wegman
277,360,131 *1B471369C767E374DDE98C4EBF50240854815D46 arnold.pape
277,360,132 *1B4DBA3F786198AF4D08962FB0D6D89CED35811D arnold.pigna
277,360,133 *1B40B1B779840141BE61E22FF6AAE8DDE76ADFB3 arnold.stirna
277,360,134 *1B470F4798D4982C8CBD5930C414ED1DB56778AB arnold tsang
277,360,135 *1B4DD64398FCA81C26572BC0DA471A54C167EAF7 arnold.uballe
277,360,136 *1B4C58F9AE91B6C6A5C1B3CD074672381D53B5F2 arnold.vanarsdall
277,360,137 *1B4075571AFC17E4C37A191B3DAD6891B52E16D6 arnold.wythe
277,360,138 *1B437D61107952307601B44A03BC50F77E5C0CB9 arnonesed
277,360,139 *1B449C4E333F2F949254BC9FD403EF5415ECCFCA [email protected]
277,360,140 *1B44A79999743E997C9DBA74D478DDE39E1A6D52 ARN"r
277,360,141 *1B4FFA8EA21025630B4100D66EDDF34BD639663E arntni
277,360,142 *1B489519ADDD6A823D3AE5199379A5B92117497C arnulfo.bevill
277,360,143 *1B49FDCA9989D0E7EC236BDC6ACD87914B8D3322 arnulfo.briese
277,360,144 *1B431C6CBC9F9F8ADD634CDF97E61C624C4C78A9 arnulfo.cloke
277,360,145 *1B4A76F1E3323273F3EBCD51FA35AA0664AED130 arnulfo.courrege
277,360,146 *1B4958C3D6AE42BDB7FD9ABD7DBBF2ABD08CE5B9 arnulfo.done
277,360,147 *1B43BB24D279A40D4DF496EC1E8E7F34C15EB190 arnulfo.dugi
277,360,148 *1B4F829A9EECD4BE11FBF0DFD160A32A9DF0C72C arnulfo.eisen
277,360,149 *1B4B7D2F23EAA9F5169BFE143200870E93BC93DF arnulfo.harriman
277,360,150 *1B4BE39E44E6BE827BCB5167AE7A44ECBF41F950 arnulfo.hoggard
277,360,151 *1B4D4529F289AA13D1C08F97DB3A27B18F003DB8 arnulfo.jach
277,360,152 *1B44D2607B55B6FB1D9605D3D1877C708D1FCC85 arnulfo.laizure
277,360,153 *1B40D371E180E4DC26C7BF92C024A606D7876CF1 arnulfo.lopas
277,360,154 *1B43720A8F70C900342FE3BC0671948F3FA3152A arnulfo.marklund
277,360,155 *1B4C0534AAC3447D0822E0566ABEAAA3ADB67112 arnulfo.mcartor
277,360,156 *1B471BA3F721C116B73CB15BBA19883499F5DD9A arnulfo.mcclay
277,360,157 *1B469FB6043CEE26D8C09BF79BAF6316CB4876B9 arnulfo.mckoon
277,360,158 *1B42887E06954A670CAF6C842A8597C9F94FFE34 arnulfo.oliva
277,360,159 *1B478C1BCFA0D8C31966AC3BF7D6B468325DE862 arnulfo.poppell
277,360,160 *1B491505742A88C595CBB3AA94A96065EBFA2F6F arnulfo.rubulcaba
277,360,161 *1B426C6C5E8D087C8155B1C082CB607CD9356C9C arnulfo.stierle
277,360,162 *1B44AEE96CA32E41D0308D341564BA146D445ACB arnulfo.szewczak
277,360,163 *1B41017FE6D879E2FFAD7E9C59E43AE0CB607346 arnulfo.tegner
277,360,164 *1B4174525B7B301377C63B0FD3DCF8B39BE12648 arnulfo.toplk
277,360,165 *1B404FCB7A04089F56642BAB802BD422BA6A8B18 arnulfo.vildosola
277,360,166 *1B44F46412316F42AEE7DBD89AEA6C4F76F3CFB2 arnulfo.war
277,360,167 *1B4C265EE633D43C3ACC8B970F455AB162142FE3 Arnulvesing
277,360,168 *1B4F9A5530102FB2E889E501390C0329386D1652 árnyékolásás
277,360,169 *1B4BC74AD36EBC5486679DCC8234EE5C158DAB4D A+Ro=
277,360,170 *1B465E796D7CB72A0595FC088306052E8B82C021 Ar+/o
277,360,171 *1B4BA83E1F244415C2CB4C19D16BEAB61DCAD347 ArO2+
277,360,172 *1B46EF5917EFE671D8E4979332CF42FDE26956E9 AR:o3
277,360,173 *1B4EE535CD93B706348554762DD34730961C5688 [email protected]
277,360,174 *1B4AC3E56CF2F1CAC91A2303198EF3DDBE20D984 arocablaed
277,360,175 *1B40D31799793CA080C91444B04C9E95A18464F7 a+roci
277,360,176 *1B47F3A47DE299E66B6399C698B1C16E280DFBB7 Arodient7
277,360,177 *1B460560863D4CD048DE4716A44E0B5E36E19A98 ArO-E
277,360,178 *1B4488AF7A67E98B34C8A32C152C9143A783B205 Aroelite6
277,360,179 *1B45AE88CD35B7EC64C5CF0BAB57D568F8900F52 AROeO
277,360,180 *1B489E2F22AD1549E8D654438A33434444238E4D Arogazaz0
277,360,181 *1B4A586207138668F93DEBE5B1D140E0DA0FD5CE arogosta
277,360,182 *1B433A844BD97862905564EA00550315A7975A31 Aromaras0
277,360,183 *1B458D6AB568E533BA756B3E0D66209E96B4654A Aromath6
277,360,184 *1B4B219BD31E0F5C596C3E08EEE445C6A4803443 AROMATICAL
277,360,185 *1B42AD43E7FC7535F4F126421D0C75318F645B4E aromyxO
277,360,186 *1B4E0F3724188DA9B900D430C61FDF24597208E4 ARON6254
277,360,187 *1B45713AE88BBC596044E98B79AB5DB06FD92ADF aron.arakaki
277,360,188 *1B43543483CAF41768FEFFCE7FA29D99C3C1BC1D aron.battaglino
277,360,189 *1B4CA8461451C4ECCD5610B73E1BF62A38981453 aron.battenfield
277,360,190 *1B45310474163738F621B5048B07F7EBEF8D3678 aron.bellanca
277,360,191 *1B4CFBBFAECD92B92833C5EEA037521103AA0436 aron.birkhimer
277,360,192 *1B4136C86762F510E165B6559F4AD0CEA3E6C592 aron.calico
277,360,193 *1B4E316AE315AACF08E0A25330381FF0A883A8D9 aron.cay
277,360,194 *1B49BC2C383FACB944CC6F8A91C76011A69668FF aron.chrest
277,360,195 *1B48BD3BF2B644518918A45BB6724CAF71B75A20 aron.corvan
277,360,196 *1B452887B361DB1E230BF02BEB695838C852C433 aron.counts
277,360,197 *1B43C4964CD48FBDC8C11FE015B22983846B482B aron.diazdeleon
277,360,198 *1B4E4CBDE22041EE52BF80C7AEA477D20937C425 aron.dixion
277,360,199 *1B409B19D2B73696EFBA29ABB1B2D4C602A750D3 Aroně
277,360,200 *1B454818D0599FE9867CFD7788BF77D08D60EA07 aron.eagon
277,360,201 *1B4AF728B451B7188824866D57193BDE7988F34B aron.elhaddad
277,360,202 *1B499729274B764190C6B2FC715EF0E11043CF6C aron.fennessey
277,360,203 *1B461C9448E341EB0423C4D4A5CB1EFFA1549C84 aron.follin
277,360,204 *1B49EC84E7849F88E58D0E66AB8A502FEBDDE02F aron.frautschi
277,360,205 *1B474E3B1CDC9A8E842CA5076F4720F440458CFF aron.furrer
277,360,206 *1B49575EF5C0747F5C75274F09CC3EB166BED83E aron.groshong
277,360,207 *1B4D3A18B059ECC2DC2ABE5BB530F94318683A5E aron.hagens
277,360,208 *1B4A5C672E5E279E66CB472771CB92F72759043C aron.hallisey
277,360,209 *1B453BE93554A9A22527CE7398A6D5E871ACBF1D aron.hinerman
277,360,210 *1B466567905D90DC65B7F5D4DCC9852DAC2C61BE aron.hudmon
277,360,211 *1B444BCF28735E4532F13B49DF2E4C11DB28036B aron.makley
277,360,212 *1B495D1E992760C98F398E09C8E60EFD25A9D3B9 aron.mcaninch
277,360,213 *1B4421974A126F04E2C25DA6F9E9CDB78F23375B aron.mulhollen
277,360,214 *1B4CC2F4A9B4B2BDDC5B7E4985712D2D49468E46 aron.niblack
277,360,215 *1B434AEE2E01C14065E039ED1C55230FC54A1D52 aron.oesterreich
277,360,216 *1B471D3C20D37AA076FF108EE96914752D31FD4C [email protected]
277,360,217 *1B45F40BBF0FB74C8C65D78EFC6E2E24B84778E9 Aronosir8
277,360,218 *1B4A54B9D8DB9BBDD6285AFD91F4CB0519564E2B áronról
277,360,219 *1B414EFE2D31E7438A5DE41C1A7957597CC4E81D AROns
277,360,220 *1B4451201089609D9FF2D8DF29624425CC6ADF5A aron.schulkin
277,360,221 *1B4411A39BCC7B9890C8B808474DF6289A04A109 aron.shimaoka
277,360,222 *1B4DAE1E27723313359379A6D15C26E3B40F582A aronson92
277,360,223 *1B4688C4FDA30025F145D44CCA3073CC2FF2C1A3 aron.steeples
277,360,224 *1B47E24FC42FC95CB6F7EE58D919E2AF18B6ED1C aron.timmer
277,360,225 *1B428A2E6FD70284A6C00E922E5D4A049D1DD560 aron.valen
277,360,226 *1B4DD35C70EFC9A56FE32A4FFA329B9F6C38DD67 aron.winley
277,360,227 *1B42F4EB29189910CE1FE7FEEDE9C3116FDF5567 ArO
277,360,228 *1B4D3DB527E35FE8A7DFCB6E9B7F7F04356F0CC3 aroobamaqsood
277,360,229 *1B4B1C35FAFA0E5738A729EC264CF729745FE5B8 Ar)oq
277,360,230 *1B4A1F2A4D88FDB79A5EE7BD1A886A51857060E3 arouezusañ
277,360,231 *1B4A3559ADA80C194755E8442A8AE9E7E4329D9C around」でも同賞を受賞した。
277,360,232 *1B4EEA7A1FA393893CB71E9ACED915447FA3108D AROv5
277,360,233 *1B4F9EFB9F69D4B63ABE42F2D8FDB7B62B4A5C51 Arowskyj8
277,360,234 *1B4C77F7BDC413E94F2487A55508C81846E2CED7 A?r%P
277,360,235 *1B4B59D1A393BEAAA723F798670E67638ACA0711 Ar/(P
277,360,236 *1B4B074010D57DE0F2BD62B73CDC4573D96E3D05 ArP,0
277,360,237 *1B41D6C877E9DF14343DDB065D742445B470F951 Arp0#
277,360,238 *1B47A4AECD41615D12A3831EB039B1ED0D8671AD arp2101
277,360,239 *1B4879DC7A1002A410881E7E19D1398462B5ACF8 A
277,360,240 *1B48DDD61B2688E845F3B7A03D2BE0D43B5C29A3 ARP6t
277,360,241 *1B48C07100B1469FAF99DB1B61055E02EA3049AA Arpados7
277,360,242 *1B4218DDE31B4244F56E8A1FBD8560C4BB0C59CA Arpajais7
277,360,243 *1B4994AAB19C7B2131F584A23C88AAC0A01368B4 arpanmandal
277,360,244 *1B408DDBC096C9B0B08A4C7CE3BD61F943B93012 Arpeareding
277,360,245 *1B4201E3851693EC81FC4F346C8AABEADDD05E64 arpensaed
277,360,246 *1B44DAB275F0C2AB1B2C1F4C20367FF97249822B arpeutumatta
277,360,247 *1B4D7500631816CFE25028344BE072C74CD3D8BF ARpGg
277,360,248 *1B494D667F08D82356709C8D2D3444A4E8A98167 arphenia0
277,360,249 *1B4F20289A782FA8B9B68F2AC49B556ADC3BB630 ARPHRD_PPP
277,360,250 *1B48D935C9C9A9B2BB58E67229F4EF23212E0245 arpiai
277,360,251 *1B4D126A52D3B6F1E4059905FDDDE5AE4F1C211F arpit macwan
277,360,252 *1B4BB7EC4C509726560B899E82428D5355977056 Ar$PK
277,360,253 *1B40ED10164C8119BD5909009C2596FF2C0A57C5 Arp(M
277,360,254 *1B49CEB593AC251E064A19391AF3C363C7C8B79C Arpoidal9
277,360,255 *1B487F04AA2D65FED39F81B8A8D8280D9F4C7AD3 ARP-p
277,360,256 *1B46DD3C62E1A45A4B938C33C84465FD7207F8B7 ARps9
277,360,257 *1B422BD915E4DACADE5965EB5EAB174FCE8CDED7 ARPUA
277,360,258 *1B48F138062FF5AEAEB82F6F9419DD1F77FB589C ARpVO
277,360,259 *1B46E118CF7FA177A43E11CC75B7A86D7BDFBFD7 AR;+Q
277,360,260 *1B473EF7C86C3F1981B380C4F7CF65C91BEFDD43 AR)=Q
277,360,261 *1B4C14AF33888AFE42A325738E0DFCB05E043974 Ar:Q$
277,360,262 *1B46BC9F12C74787474DEA3DFBFE5C3095F2D626 AR.q9
277,360,263 *1B4C54A43EDB808B827F480DF1B898361BF84264 ARqAg
277,360,264 *1B43E48D9CED73A3B811AF9E966C9BC39B9628E6 Ar%qf
277,360,265 *1B4B1265FA18313BD9664E1126CC3B9B3A6F9B59 ARQfS
277,360,266 *1B4F6CB397D9186FA23A9A5CAFA4D4F047664C86 ARQ-g
277,360,267 *1B43ADC73659B1A06363040EAC470A156E0418AC A!rQI
277,360,268 *1B4F24B3E7BC9DF450A8681BD12FDA7A70730398 ARqij
277,360,269 *1B4C4C1C97D2A9ECDEDFE4DB61A407BE2CC5A4CC A:RQM
277,360,270 *1B4F702B3982A0BFA7B5BEB8455E080ABEAF5ACC ARqmH
277,360,271 *1B479EA2B31460D2B4AD581D3A6CF23006A206A1 AR&Qp
277,360,272 *1B4EC2C535248D2A174442F06233330926C49F22 ARqrq
277,360,273 *1B46524BBA2CC3D160556FE129763627AA2A012E AR.Qt
277,360,274 *1B4EC2DFF0F6DF2524989C397697149CD57313CA arquid
277,360,275 *1B4ED83A818228B65E7E85967607111EC86EA7B0 Ar&R-
277,360,276 *1B4CE0C01632D863258B88B43AE7DC750136D028 ArR&.
277,360,277 *1B4D2916E4F86D704DA9C407CA119BB89917CC8C A$:rr
277,360,278 *1B4856ABA78045CC076634CE81EAA6ADF6B981CA Arr0w3d
277,360,279 *1B480304722E666850F8588CD43FE60908FE2580 A;rr3
277,360,280 *1B4B6F167EFCEF9AB7C1D70298ECF30733EC4FF6 ArR6
277,360,281 *1B42E5C5F0CAB5E8B857B5482EA61AE66A708DE5 Ar)r6
277,360,282 *1B4000B3E91CB037A9BF5B1DCFA4533D9DF01B08 A%rra
277,360,283 *1B440C44362BB88C00B09967CE0315ED494A7119 Arraffo7
277,360,284 *1B42E91604BDF90746ED904839BB7C708874923A Arraigns4
277,360,285 *1B4611A37941F16730F358BAF5EF7AAA3B1AD5F3 Arraihc9
277,360,286 *1B4200826631E15342F8C2124A08627101BD5BC0 Arraisonnerez4
277,360,287 *1B4DA61691CBD12F8F2E7C15B6F05173960C6750 ar-rama
277,360,288 *1B4A1B732A65FBCF1FF4717CA6291526154C090B ARRAMES
277,360,289 *1B4068A1CCC8508E2F5E1FBFBFEDA691907E5FD6 ARRANCAN
277,360,290 *1B49F0AE3739B0A919F496FAF251FF4BEE6A3363 arrangaed
277,360,291 *1B4856E9D9BCFF2AA0597FDD2ADCA188375388A8 arrangerconductorcom
277,360,292 *1B47BE0F8FD9A6D28EFA44E95E7AB766645B8C0C Arrangeront4
277,360,293 *1B4348E575AC2A7D3C68553B475FEA7B03FE9748 arranjei6
277,360,294 *1B47E26718B2C5E26C67B7ABE1E66ECCD50A4456 Arraparmied
277,360,295 *1B41D5CFFA544C3403D82F838D4E9CA6FB7097D2 arrawlabbed
277,360,296 *1B4C600C74DE0FCEA7092C5A52E0BD0BAC9A5B01 arraysteppaststring
277,360,297 *1B447EB569AAEC85BA889A6F80591822D7C80DB1 ArrB4
277,360,298 *1B47FF416623EEF050C130FB7C8B033A36C9E2C4 arrebatadora123
277,360,299 *1B43E0FCDFA9A8BD809B9EF5D3C510D8C76C76E5 arrebentaste1
277,360,300 *1B4C8135B1601927F6D524DF1DAD0E27CE25B784 arrecadadoras123
277,360,301 *1B45640B1D93F499B204BDD185EA19ABBA642A60 ARRECTARY4
277,360,302 *1B40C0C9E6BA5342833873BF6BF86BB99EE43106 arrelvais1
277,360,303 *1B4F36C1C95CF3AC14AAE72736669409BFD7AB20 Arremetedoras
277,360,304 *1B4615EB452B44E5AE193D63EB82204ABE9FD189 arrenasse2
277,360,305 *1B4C6B5170B6E81C43BF8B94B95E28545A0D2E56 arrendarlhas123
277,360,306 *1B45AA325F8F511376A9B5DA2DCD2738F7F08AD4 arrepias1234
277,360,307 *1B44031D1D27DAA31B476FB7E477BC3EFD07BF00 arrepisa5
277,360,308 *1B4FE75C30E976F60AC939561F25037FE32A8445 arresnsberg
277,360,309 *1B449A1F98CFA1EC46E1B10ABF92AC94B43A5165 arrest160o
277,360,310 *1B49FA5DC4AD5177F9160337BDFE08127F80FCA0 ArrfC
277,360,311 *1B487A72ED68C6195BA456D2057F710C7C3CD41E arrhenatherum3
277,360,312 *1B4A518B3E237FE0EB0FCD3BDD1D06E116ED5F6E ARRHENATHERUMS
277,360,313 *1B4FA4D0871F34A8A14E45797D994AC718A24D6D arrhenot2
277,360,314 *1B40B70DD75D462590E8BC7A15EF402EDDB56C68 arrillo1234
277,360,315 *1B492753FAE55C5D81CFD13E1836ECB6E3FBD038 ARRIMERAIT.
277,360,316 *1B4EC6D1E9A3EAFAC7D609911728982CC7318563 arripiada
277,360,317 *1B48F7415553B0F52D7FDDA600C162A694C178C1 arri
277,360,318 *1B4B2D238F45960C459B70FDE9B70DB508F5FB39 Arrisc
277,360,319 *1B404F667508A830665C2A33C70BBD24ECC388B9 arriseds
277,360,320 *1B40C815846D91CED60F2E9DECEDCE7486AC2ED1 Arriusjensen
277,360,321 *1B495198ADC09EEE44D0B34EF7E5E2131BD75642 ARRIVAIENT6
277,360,322 *1B47D0DD500DBD08A3B840D3DC55C5C4B6E1AC3A arrival of the lord & lady
277,360,323 *1B4ECBBB223C85F90C6385764C64E200276B9E1D Arrivist4
277,360,324 *1B41282C80726C3C02E2CF2CA5964A1675150F67 ARrK/
277,360,325 *1B4AD5B27E678E369A8434BF9A3D9085DAA972F1 AR.RN
277,360,326 *1B48E6B8D290026F68316D187C3E8805E7BEAFDE arrogante?
277,360,327 *1B4323A2EA82F9E5281C39188B08150D76256272 Arrogati5
277,360,328 *1B4332B8264237393FF6129F571F4762E3B0E4E4 ARRONELLIE
277,360,329 *1B4B24EE98A662A0222863AE1AA38145AABD0CDE arron.fassler
277,360,330 *1B46D21CE50680E41EAFED45D066112F3162A8FD arron.frascone
277,360,331 *1B476355C3704EEA32B728468AE3BA006221CA25 arron.glines
277,360,332 *1B494A122894FA7EEB18F365910A997F99F50BA2 arron.gotsche
277,360,333 *1B4E6DD5782177CC185C5233595AF912166849EE arron.layer
277,360,334 *1B48559474E61FFB700BB29E47FD9EBDC07AF761 arron.leitem
277,360,335 *1B4AD738CE9A674AD0C56FCE6799B66609355F51 arron.marcolina
277,360,336 *1B4F9914A66C804B90C622799C49A070858EA789 arron.moistner
277,360,337 *1B4EA62DB7D594A7EC8B56196F63C30F2519156C arron.morehead
277,360,338 *1B481F107F4A0080E9CA0946DC4FC36CEB803DB2 arron.orsi
277,360,339 *1B415ACCA3DD5977D5415C1B7106456842020F4D arron.pennebaker
277,360,340 *1B411F3F12C3230AABAED773924CC453A4996E1A arron.reidling
277,360,341 *1B4CB2F09B14CB0A75DCA2241B8C1D94DE04F7F2 arron.rockwood
277,360,342 *1B48192A72D9BEE5D10FCA7F18C35BB50E4F6052 arron.roscoe
277,360,343 *1B4B8CEF0994BD7051D8D2C2731C8E57B9B19B36 arron simpson
277,360,344 *1B4F6AC4E08FDC1E51508E48A46379355BAA1602 arron.soble
277,360,345 *1B45FFFF401748726729C89E4A4368D063D56F21 arron.sonia
277,360,346 *1B412F3CE5B669E53FE0E7D9F04DD66B887B71CE arron.swepson
277,360,347 *1B41975488FFE9B0CE4A223D028162A29E7C936C arron.waiki
277,360,348 *1B44FFCD41FB0C5D18E543841A6E7F319D548434 arron washington
277,360,349 *1B4720B3CAD71DF91A9CDC91BB87947FDDD26063 Arrotati.
277,360,350 *1B48B18F904D24C2FF1DE23AFCD1D8B835AA4811 arrouse9
277,360,351 *1B44D6257301340B5F41AA5B3446C06610FC1E8E arrowchronicle
277,360,352 *1B4A85A138F96DC630347993674D46FB68C380A0 arrowpig
277,360,353 *1B44D096D2C38C6849DA575C162C790F74C1ADF1 ARROZALS
277,360,354 *1B4674DE4F0471F03385AF5464377058AE78BBD1 Arrumavases
277,360,355 *1B4A3BF4FDE577E92EDB654D7ED85664BE35ED79 ARrwI
277,360,356 *1B4016527350DC41ADB47C65A4C739724A16A254 ArrZ6
277,360,357 *1B4DFA05E8EE5DC484C13CDF29A9EC3A50FA0ED8 A
277,360,358 *1B46077BCB1E12DA4DCD493B966A4F02C0C7A159 A$r%s
277,360,359 *1B4837F82FD492057E1E3F9720E3E98EE889BA92 A)rs0
277,360,360 *1B41A36EDC666EDAC96FE6C1F0CC5BD49CAF3AC0 arsaftaG
277,360,361 *1B4BF909D182A5518BE6EA5494AAF59E5768276D arsam awan
277,360,362 *1B4209BE7851E22DDA6C49A297D585E0B66A1A75 arschaan
277,360,363 *1B4C843863EA38F804F73CFDF837FF003B900A7B arsè
277,360,364 *1B49808CC69B6438A5A9EDA0447B2B0B428F30EB arseconds
277,360,365 *1B4B4090C5B8D70C3609E0BF5B27E41A36F1F64E arselmata
277,360,366 *1B44809448E025E9D88A9E61B9C21E2B4DF9E260 arsenal-pr
277,360,367 *1B44617E9FCDF1AA64ABB23C8E30BDBBC8E4470F Arsenfer6
277,360,368 *1B492459FCACC8B830CBE75CF09510A5EA758AF6 arsenoxI
277,360,369 *1B423C33A0FC7CA4664323345CCBF33C28A2E3EA Arsenoxi6
277,360,370 *1B436B0AEF10F97FD7F1CAFDD62649842EAAF12D [email protected]
277,360,371 *1B4CC79D8EE17F9271758FCA60DF0B4D2F1EE3CB ARSHIDA
277,360,372 *1B42D16F3451EE1CA6321E9216658B599C6D96C2 arsızake
277,360,373 *1B4CE1D192BF259B89037183AA7955B78A0254BD Árskógaströnd
277,360,374 *1B42DF0928A4BB2FA3CAB8205E9276F6407EDC21 Arsouns5
277,360,375 *1B4D84CB01FF9244EBB7D8660956E5A7B7C5D281 ARSP/
277,360,376 *1B45B2720BA10DCFFDDDE04F240DCA5AAF9C83DA Ar=SQ
277,360,377 *1B432754ADB5C517F8DEC87750DCEDAC8773E89A Arsqi
277,360,378 *1B452C3A2937A277907ACF507EE2D664E9A63EF7 årsskogen
277,360,379 *1B4B7CEE2B91C60AA4FB74639350B5A2FB54DD40 arswell7
277,360,380 *1B4CF22A84728D0C2D85636CB024BB6FBC88EE75 A$,Rt
277,360,381 *1B47F1BB46DE1CD4BD612B2B1A8D739B1B7E05CE A+Rt!
277,360,382 *1B484E01BF2B21EF31207062B0638B31B69CCA72 A;rT,
277,360,383 *1B4A53B8FE4FFF9C0E3584F6634A7D8D381E56FD ArT#%
277,360,384 *1B467ADAAAE7AEA575AC03427CE591BE818A0239 [email protected]
277,360,385 *1B4510C8B3BA573E23385990E131A8AD9A44809A ART1CULAT10N5
277,360,386 *1B42454D5CEE5027E563BC853D56607956DF8450 art2006101717464317101396
277,360,387 *1B4E2DE3396A32CEA152002F0D6032C4BF72273A Art273
277,360,388 *1B418B1A7AC00ED986EDEF0C4B6048DEA7EA5542 ArT89
277,360,389 *1B49AF47632A2927C1FF1B7DBD30A2011760E34B artaスカイライン/bcnr33
277,360,390 *1B468A4ABDDBAEF14139208603C449F0D2BDCED3 artacias0
277,360,391 *1B47FBE5987A12071FA23EA78F71916301870EE1 Artaknev9
277,360,392 *1B41F8FACFA232F48DCCBB4F58EAA648AA61DD5F artamonovs
277,360,393 *1B4D0DDEED349D15FEECDDC8AF988098130A2244 art.anhorn
277,360,394 *1B4D15C114E9B5D05E383E38D000C46EF74D4DCF Artarfni7
277,360,395 *1B4ED665A3E9579EF3C5719DA0F48CBB5B58D251 Artaruga7
277,360,396 *1B414B433B73AF428F09DED197891593FD29B163 artaŭd
277,360,397 *1B439FC2E864B9AF6A7C925DB254A57926912CDB artavazdâ
277,360,398 *1B461678B02AEA3B68C5BBF17BC9267FB2EDF489 art.barnas
277,360,399 *1B4BA36FF14D21F9B5A2232ED55C0885D004186B art.behnken
277,360,400 *1B4F53A6F66923ED11D2E4C0568D80D92D8A5EF6 artbenavides
277,360,401 *1B4D5EF7CAD348DD99D7142E65819C7FC10033DD art.bourgois
277,360,402 *1B46123D6D673B071A082CA16C8ED26EDBCD0FA7 art.chavies
277,360,403 *1B48212D9EEA1D9E1F3BD673FED9DF2553262040 artcité —
277,360,404 *1B4571F698858B4409DCF4ACABB49198A577472C art.cobbett
277,360,405 *1B4976DDDA8D9292C668D796BBAA64D090766A01 art.cusatis
277,360,406 *1B405A101CF010777C4391F81C178F50B7F4BA15 Artcycilopedia
277,360,407 *1B448DCE745F5DF50877C19E4EECF47DB515EC03 Art,d
277,360,408 *1B4E7DEC528A833897630DD9A0DB4F1E4B66E789 artdesign12
277,360,409 *1B41245346B0DCC14292BCFB4DBF428E8C9AA9B2 AR%Te
277,360,410 *1B47B593C1D77170B938ECCA2150D42CFD80B826 ARTEast
277,360,411 *1B4276B0E1088C90D042C382A6D7AE9DFC433DF9 Artednes1
277,360,412 *1B46FB4580AEC9FD46E6A2DAB0768913CF5B6904 artemagras
277,360,413 *1B48A265F2BB047C2EF8F8581BA57A03D98487B8 artemio jimenez
277,360,414 *1B46CA0376F223F3DEF5FAD53F4A8F5E7979C05F art epperson
277,360,415 *1B481F0F59269514E453814C0F39C2BE71AE4721 Artereses5
277,360,416 *1B49A5414AAF10DD21DC0D99F6003DAE9FA80797 Arteriedsed
277,360,417 *1B406461A9D3FE848D0052EA1543D6EA576CF286 arternunstrut
277,360,418 *1B4BDFC5E261B3D4645DFB3066E11C6F67B191F6 [email protected]
277,360,419 *1B404B2AAA5E44C802E938D36410D4111B826C77 ARtf0
277,360,420 *1B4373E6F977D8A7408BF27AB67253D2D7C02DC1 ArtFarAway
277,360,421 *1B4C28CFC623BAA4F34B9E24A910F99549A1BB90 artfortheears.nlwww
277,360,422 *1B4BD0DED492A3C5D30E4FC39350C5524A82236F artfrender
277,360,423 *1B4958967B730B9F30F5A0A673B576C3B5D64278 art.galleher
277,360,424 *1B444CE70ED8F0037CD6AEFA6C2185648E08D0DD ART-GALLERY-OF-SOUTH-AUSTRALIA
277,360,425 *1B4D6075388EC27AE9A5F23CDD22977E309CD6E6 art.gemmen
277,360,426 *1B4518B5478CC250F931B7F23341C04A62923C8A ARTHAS2
277,360,427 *1B4C823D4407273D18B003582787CC2161FD2639 artherholtBSW
277,360,428 *1B48D1196EA512905CE51CA60915F76DF145D62B arthriwn9
277,360,429 *1B417935244EE44979C0673F919CF093BE78DF29 arthrop13ura
277,360,430 *1B4096B71FAA382BE3419D12842D5D4320E7F143 arthrosterigmA
277,360,431 *1B4FC36F764D73C16732CC92B0CE334713AF981E Arthur330
277,360,432 *1B4DD17553F992BE9ED79EC733397A9D86E442F1 arthur borner
277,360,433 *1B4F4AC8452F1E86DBA068BF316C77242EA74076 arthur.brockney
277,360,434 *1B46891CE5B3EFFB1D74C61061D252559CDD576F arthur.cantu
277,360,435 *1B40B93FD9220BD1F7D7FE837F84E041BF710CDC arthur.carter
277,360,436 *1B41489F1AD621040CAA86F5528C5E07BF5C59F6 arthur.coronel
277,360,437 *1B4F75D2DB3224DAD9F88AC0F563A0192FA8763F arthur.deutscher
277,360,438 *1B43A347DF69CD1390BEF2CA52C407FDBFC60E0C arthur.duncans
277,360,439 *1B45CEF98596C271C979506DCE914D411621F008 arthur.fornes
277,360,440 *1B4F6CB37091E7B97A4BB19C826526D8064985D0 arthur.fusca
277,360,441 *1B4F94444FD09D4948223950B44BE008C1EF4A75 arthur.gate
277,360,442 *1B47AAF784E0C6CA84B98F9ABFFDC299778DF2C3 arthur.giehl
277,360,443 *1B465BD65540AF7C207280DE3F260BE785BBA89D arthur.grboyan
277,360,444 *1B40C592E04BDB9B29114D636F10B45746ADEE1A arthur.gwyn
277,360,445 *1B446D7D2BB42BB5B93AE52A56A4378BBECEE064 arthur.hosea
277,360,446 *1B479E0F90CA9BF0EB551A663B27685C736FB546 arthur.lewan
277,360,447 *1B401AF36F8B9C5ACAACEF0B7F8917E226962FB5 arthur.lick
277,360,448 *1B424AF361CB47A6A4147B2F1570A2EDF07C3023 arthur.liskovec
277,360,449 *1B40169C3F305AAD1555987140A560BB4D8A40AD arthur.mapa
277,360,450 *1B49D6181A0B4B8633D11F806729197AAABB3717 arthur.mckinzy
277,360,451 *1B444994C4A9C6E3BA82BAF7EA2DF172BF4CA349 arthur.navone
277,360,452 *1B463EE52C2478B2E92514D4D23CAE73496176BB arthur.nyahay
277,360,453 *1B44723E1305DA8CCE8CE6A30345BAC9E463215E arthur.poynor
277,360,454 *1B4B001D9E9818FFA896020F6D9577FCF2E4A7D0 arthur.raden
277,360,455 *1B4C3AB06B8AEF5D548DBAFB850A4302380D47B2 arthur.sasaki
277,360,456 *1B45510375698C15DDE2662CB3D8D849A53CE971 arthur.seki
277,360,457 *1B4073E9C7A9ADAE048FE93C663DBDAF1DCF80A3 arthur.tyszko
277,360,458 *1B4D3F36A2142B8A8ED5AD4F6E5CDC0AC2168838 arthur.verity
277,360,459 *1B4904AB6B452C06B2B4FDF9DF05FDF714A4BF51 arthur.zabala
277,360,460 *1B40D325CF701F321CE9DDF77738C6289B4730D8 Arthwide
277,360,461 *1B428E4B7BF2F5E3745F900455DD20BEFFC497C6 Artič
277,360,462 *1B453CBCB7B183C7829D6AF40DAB37A717C76736 arti choudhary
277,360,463 *1B41FF4AA325DF66AB7D3A325633DF991597F7BA article056237
277,360,464 *1B465ABBC313CE1B86518533001B5899F4E88BA2 article1094429
277,360,465 *1B4074C1792FF2FA37C3155F98A7D8358ED5B70D article122613
277,360,466 *1B42BD765596F74AADF61F62B933CC9098CCA4DD article1623566
277,360,467 *1B4F330F265CF3A8A48AD60FC2015ED127533D0C article1845162
277,360,468 *1B43B6478AF2D425AA02821ED5E4D16FE61EDD0F article2207648
277,360,469 *1B4C6E4B1AD4A0E349E6E5B44685D3F565606651 article2450315
277,360,470 *1B4611EAA1A4E5C4575206C122119CABD4A610F9 article2572223
277,360,471 *1B42A040E74839127E882D6AFDC51C0390115607 article3135385
277,360,472 *1B4695DE765515279C927064E0433D8806F1E9ED article3206883
277,360,473 *1B4E2F6055DD42B7D31AC69AD61F96360F85C5CE article3543281
277,360,474 *1B4BD7B773CF517476FA1F5A884CCB28EE07FAC9 article5007040
277,360,475 *1B4A593C2FC06A2F39115E81F8BCB2D76B478D8D article556179
277,360,476 *1B4A483793CAFEE71946CEDECBB76AB1D042A1C1 article58713
277,360,477 *1B4A9885F6515043FB39556BF2184B28632DB788 article626896
277,360,478 *1B4DCFBEFA6CBB6C4A29198A118DFE40D0B23C40 article66.16.19.198
277,360,479 *1B496E5B40FEF770DBCFA25B75052E3022CB9FFD article69602
277,360,480 *1B40E6357D03F471BFF2704D3023F9305C4B75EB articlecheerleader
277,360,481 *1B4EDE69F37AD38DF4771F556DF63DC8A2EA214F `articleComments`
277,360,482 *1B454E3C9DB4833A4A4F2600B7E4D0661BC66C4D article-directory.ne
277,360,483 *1B49B5BB6D4FA4708DCB466592A1BAD7ADA48463 article.frontierbras
277,360,484 *1B4BFBDDBFB5BDAB134EFAA270B4410DB4BCDD8C articlemessage
277,360,485 *1B4D5B743436F68AA2E50C8818F34B3C59F280FC article.red
277,360,486 *1B4981A43552050F57932E55BF363B5EB4D958A5 ARTICLES-M
277,360,487 *1B44374508BB2DE042A4F3127D0B3850438FCE49 articlesnobunaga24
277,360,488 *1B46AC0E6CB156DE34FC7777BF2F36CA79EC1D7C articles—these
277,360,489 *1B47873A1986771D21AD3C40AFE1D89A9CFDD9A8 article_title.ogg
277,360,490 *1B45C46003F11249A4FABB90404D5AE93A0B61C6 [email protected]
277,360,491 *1B444956E6D99EE3E7E73B74CD93651F41D970D9 artificialdk
277,360,492 *1B49E64FC65C9087A37656C5A4F0B33296650057 artificialignorance.net
277,360,493 *1B4C6EA1F395CA21096AE84E578B569ECECDD59A ARTIFICIALITYS
277,360,494 *1B4A3A86AF65B5C00DDD8E0254C14DE06C33D5C9 Artigistų
277,360,495 *1B4906E22DC9F71D7699445B758BD93F5CE776AD artigole
277,360,496 *1B45A2FE9471DA528E4F0EBC9505D7047FC1365C Artikelel
277,360,497 *1B4E3FD5F0B8B38EAF44F72C9FD9B393087001BB ArtikelnamensRrraum
277,360,498 *1B4A409B167013BA76FE3B925640ED7D35A10005 artikelpläne
277,360,499 *1B46EBA34A31DA369B762EB7377A4C8659AACACE artillerikonstruktioner
277,360,500 *1B4735658AA9DEC9C4968673479CBBEEBA07523B Artique
277,360,501 *1B4AB768DBE81B3D984C759311EE890F2D1FDEC2 Artiries8
277,360,502 *1B4066A70B488088006612A6D82E2609E1B4E866 artistf1
277,360,503 *1B4EE29BC4328D7E4C03FE9784FFF4244A851977 artistias
277,360,504 *1B473A9E1FFF129EBEFF11B0A0833545FF9857CA artisticbouquets.comwww
277,360,505 *1B4CE7160C6942A3C59171A559C2E866B7FD7B7D ArtistO
277,360,506 *1B45F858FFF4EB040BFC808BBEDD0EF4265C4A21 artistsineastlondon.
277,360,507 *1B4033C622D374D99C801DDE8764CF081F2D1734 Artistw2
277,360,508 *1B4F9B08E67771CF45367E9D203652107E318231 Artiumsfag
277,360,509 *1B4ED00988023FC9F6481D9DC21474765BD4BD57 artizar6
277,360,510 *1B462EDF2B872F1454A5BC5F15488D9606CEF194 art.johann
277,360,511 *1B423FCBAA0B2D103017DC1929A4751741C7A6F6 ARt(L
277,360,512 *1B4A1E6D0840B7585B855C172718554D0A644B28 art.lawbaugh
277,360,513 *1B48FFD89C3BB38DFEAFA7931C03F422EC99E2DD artlib1234
277,360,514 *1B4462F79A90D2C9400D21D85C5282D3BD9B50EA artling123
277,360,515 *1B4ED828DC72CE72D808DCD6542411FF72429BE1 art.llorca
277,360,516 *1B4F3ACA699AD3CD720D543FEC80A60A9A43C920 art.lockemer
277,360,517 *1B4BA2CDC490B4471CB324FFB7AE909B3A0BFD4E art.madlock
277,360,518 *1B4A56364D1353BFD12347474ADFD0CFF4AD8313 Artnecib5
277,360,519 *1B476113B9D4D05E746250E1E80959B5189CD32A Artnecxe9
277,360,520 *1B48C09503CCACA0652F000C38B938092016443E artofwarname
277,360,521 *1B43A1BF4A5C04AC58C604C78133CD956B31D500 ArTON
277,360,522 *1B4F8184D948D0428EDABA48D011A9791D028D94 artozik
277,360,523 *1B42E1DE89458F04C7DF7B136E0429B6DBC69EB3 art.paolicelli
277,360,524 *1B4C398A7603E07338536D04D90D2B8283AC1B50 art.pawlusiak
277,360,525 *1B4268A7EDF8BC61163934261604B6B6901A7DAE art.periclesofathens
277,360,526 *1B43064CDB4854A0B391001990A8F49E697142D3 [email protected]
277,360,527 *1B4C9F91E39E89535B9226258F89424724F7203E artprogressiverock
277,360,528 *1B4F4B44A81EDFB77A2E1117FBE116AE4D0776BA Artrock2
277,360,529 *1B40ECFCCAE0F74C0253FF4CAFE51013510A763D art.rosas
277,360,530 *1B4DD64B07280C422D3869D905C3C0DC48FA521A *ARTS*
277,360,531 *1B4021FFB930E194CE63F2B78C8A5D3D1DF98B87 art.satterfield
277,360,532 *1B4FF8D35044E646B9463EF16FA1F3C733340477 arts
277,360,533 *1B4DC69AFF330325E3A538020EA38E7B122DD4C4 ARTS-DANCE
277,360,534 *1B4115F432766D8EDD598C998E1879555D786A0C Artsigned
277,360,535 *1B426EB19C43612268697DC22CBE39516EEF757D Artslle5
277,360,536 *1B429E427FE598BD31CA5B9D4E1CCF7BEF2DE5B4 Artsomed3
277,360,537 *1B40554CD621A2C78C5B3BA5E96FCBDB4CA06AD1 [email protected]
277,360,538 *1B49F41CE31CEE95DFA61727381E4E5CBC0EBC50 arts-toolkit
277,360,539 *1B485609C9FDACDCAF689D33E9058F3AA5661071 Art;T
277,360,540 *1B443111E17D07DB2A31F10AFE86107839B86C3C artt5
277,360,541 *1B4D462BE70C354F71D4064F33BD5077BEE9A425 art.tarbutton
277,360,542 *1B41FACB643470337F72A38ACB69A57D95A7CEEF Ar;TU
277,360,543 *1B4A1326C68545C1039248D85B09577E847A1BA2 artulizz123
277,360,544 *1B4E07D32322D1E91259772ACD184E3C6456DAA4 [email protected]
277,360,545 *1B4389B37091087E9DDEC1D0C6036EE1D6606A75 arturo.beeler
277,360,546 *1B450E55208357CAAF3665D22A9BA1774E8D253A arturo.beltramo
277,360,547 *1B444AB7C83C481AFC9CE731953AB67BC81F05E0 arturo.bried
277,360,548 *1B4B7D66F20181B2D5B47F0C8AF5C49C1BA4AE4E arturo capetillo
277,360,549 *1B40EB8EF77CF41CD37DE3D177866645C2271FBD arturo.caylor
277,360,550 *1B4F24CAAF4E4358D97DFC05D893AC44CCB66454 arturo.dalzen
277,360,551 *1B4310A954760EF1EB5A13721785E297C3D326D1 arturo.derasmo
277,360,552 *1B4A2B2E55202519EE8EB279F2753777194BBA7E arturo.felonia
277,360,553 *1B40F0FBE894EF1EFDFFF5637B8B7DDF40C8CD98 arturo.ferra
277,360,554 *1B45E63F36DC1B1B2FA53A97B3729C459F09A802 arturo.geiszler
277,360,555 *1B40E860C9D7A012FDFB60464EC66FD95B200EA7 arturo.hagans
277,360,556 *1B4D3DF79477C542C5404773476354DE5F463A39 arturo.hurless
277,360,557 *1B4268CC97CC5A5D22932CFBBAD06297C84BE603 arturo.lantey
277,360,558 *1B4C03FCC73177E4F8EC595BF67321AAB51F2BD9 arturo.luening
277,360,559 *1B486F94CB38B3081FF4848EEF3FB5DBF0A585FE arturo.mcgill
277,360,560 *1B474D18B6BB2E3B3CDEEDC40296B5042D9A4B7E arturo.mifflin
277,360,561 *1B4173549BF4BA906E4E9658B9530F34B0E9B983 arturo.mitzner
277,360,562 *1B413CA2B44E3B3C46A0489602AF38E3CD4BCDAE arturo.nhatsavang
277,360,563 *1B4E6D6FFDA1F909E37A50FA12024D42EDBB465A arturoolivera
277,360,564 *1B43DC55DDAA2509FF0551BA386AC11B02A12EE8 arturo.pirollo
277,360,565 *1B43BE893288A0D6FDC1A3DC945FEE0326E7481E arturo.rajewski
277,360,566 *1B4CBD93043BCAD133CE1DE662D08D362DD9FEFE arturo.sandles
277,360,567 *1B421356C7704A64B57B0C9531E072B10078BD31 arturo.stegmaier
277,360,568 *1B4FB2E03D41DC97C5E785ABADDDC06EC8AC8D7D arturo.wingert
277,360,569 *1B4CF38A612D89059FE7BB9E20C71ACD98683E64 art.ville
277,360,570 *1B41232D8D89AB249809FCC3F17F2AF07DDE7B0A ArtwareProduction
277,360,571 *1B4985FFB95890686905EA7AFEB9955B21C109E7 ARTWORKS1
277,360,572 *1B49043FA8643CC348F0D8305382382DCEB249C6 ArtZ3
277,360,573 *1B41CC0D1ADB11F2C0E05251D61999832BFEB861 Artzké
277,360,574 *1B426F951CE8193A3BF16F456D8EB11DC33B11D5 art-zone-beijing
277,360,575 *1B43D7EF31C1393FC97CBE8D93A0027580AF52FB AR,U!
277,360,576 *1B402FF90CB3DAEABE912BDF05F1945CA33CBF02 A
277,360,577 *1B466EBB658C8857AF1919D0004268BA171D352F Ar-
277,360,578 *1B4CD8E4C98B2B0C5518AD25885DAD87F0BA7A51 ArU4W
277,360,579 *1B4FB1795F57115B7E43423305C0B1FDC2C78EC3 ARu5t
277,360,580 *1B47C24950FD2F8501AC2FA5B8CA145443663746 ArU7T
277,360,581 *1B487CE3F207D3058A417690D5C466001115A2D2 ARu8o
277,360,582 *1B4EF1B06B2F9BAF7BA55619C620821B52BD87BF arubańska
277,360,583 *1B4B503F1B9AD903C6BF76F7829CA7EB161D0839 A=RUd
277,360,584 *1B4D26270BA3C6C9DE7C9C5FE787FC2DF941E9DC Arugarug6
277,360,585 *1B4D4A3B558A70241F0402DFEB96384CBFCD1881 ARUjos
277,360,586 *1B44749A808AFADB0EC5A375A3A529BAA14736F4 arŭllosŭ
277,360,587 *1B4D8A5CAAFCC0B283253495D5F98985D5F401CB ARUMIROM 1
277,360,588 *1B4F206A6DAB8DD6EEA4593F2C6603957EC8B684 arumuos2
277,360,589 *1B4200012C9F93367595E0CDD48E555135C023D0 arunanandakrishnan
277,360,590 *1B42941E9E9EE083158C92CBFD121457404661C4 Aru
277,360,591 *1B46A03D24A050D84A05A8FAD25598723B64DE66 Aruokek3
277,360,592 *1B43CFCCDB5E8C9231590B6C8280E15A67A36687 AR=up
277,360,593 *1B494486387824A28CE937F21D1FCCAED77C1B89 $+ar+up
277,360,594 *1B42EF1F8A40DAA6434020C0608C61706CCF4224 ARUPUK
277,360,595 *1B42E6CC643A59F54A96D00A4294D3D51641EA56 aruseiaugustine
277,360,596 *1B481618F11BA222B7B2D61DB75166919E61E938 Arussusing
277,360,597 *1B465C85EEC22DDCEE4ADF82EAA98F86104068F2 Arüülrühm
277,360,598 *1B41E0283FE048F604A8945289242E865ACC9438 aruupams
277,360,599 *1B4FDE543194AF14E5B67B29C9460EC477457A0B aruvikuzhi
277,360,600 *1B4C998387B174723EAA74E6DC474F05F7EEC658 ARUVn
277,360,601 *1B41B5164BD1676D694A86691B6D3E1BE150CC2E ArUwk
277,360,602 *1B4DB9F3EAA977ABB48982B8425AF81BA442EB25 Ar;UZ
277,360,603 *1B44807E70AC14B9C2F6E58939F68B5D4F51C6C3 ArUZ.
277,360,604 *1B40C2EFDBD90E2ABC41CC8A70D9C470178275E2 AR.(v
277,360,605 *1B4922FACC01A94B2B19ADFB9458A87787A90D58 ArvA
277,360,606 *1B448BCA54DE6549AF70565DCE76D4B7FD53DB7D arvanitovlachs
277,360,607 *1B497340039447D3E7A5B190A777815B4E874445 arvenias
277,360,608 *1B49D38EC660F04386EFCDE33197369B0ADB228D ARVEPRINS5
277,360,609 *1B4BE53E8805FEA7E4FD07B0C8A5E4F5F0DBE45B Arvetra6
277,360,610 *1B4FFEF9A810197164F94BB39E744D38CCAA5EB0 AR;vH
277,360,611 *1B4236BCFE41C100888A3B92BCB747F6A9BC79ED arvidson3
277,360,612 *1B4E24B7995A1AB785FCAD9D314E39FD2BFCF2F9 arvin92.bbs
277,360,613 *1B4689E386FD224EA00C2496C24E95BE4127F747 Arvindra1
277,360,614 *1B4720BE3B78E2115D18A1FFEF2D3E0D49196D55 arvingerissa
277,360,615 *1B46B6C06BFCD935968F8E375B593FB908B4EDEA arvin loyola
277,360,616 *1B4C66567FE8AFDCCF6CA5F038909FBB421747BF arvin maningas
277,360,617 *1B48C60A35A58861DB60D2EA3ABB5A7EAD8ADC79 Arvnovsn
277,360,618 *1B469F243520A242EC0B22EA8EB902CCA92EB334 Arvoituksellinen
277,360,619 *1B46FFD2548C3E90EC73096629535705BE6BD412 Arvoitusta
277,360,620 *1B49A6D2466F178675C11D4607EDFB22FD3C4CF4 Arvrromn
277,360,621 *1B41BE62E391A3A08DEE4D4117741D77EA08D6EC ARVUOME
277,360,622 *1B42CFF1617DF872D5DB3DFD7AD5A87323E78D72 arvutuslauad
277,360,623 *1B4289DB889477EF81C7ACA5A94984C739A03B68 Arvv;
277,360,624 *1B40A6154B34A3BFE3E9A0BE572C68C0D7F7C621 ArV"W
277,360,625 *1B4B6D8781D52A83C5BF16CF0EF7CA3D98DD0A88 AR/W+
277,360,626 *1B4002605F896B4F3B58984387749EC553BF3491 A-rW?
277,360,627 *1B42939B823CE2C7576E3D195F5793D7D73B10FE A.r_W
277,360,628 *1B498015419C64F068F5FA1F0909AB28B9031DDD A=/rw
277,360,629 *1B471489527CBF1228827F8D66A27FDF861000CC Ar:#w
277,360,630 *1B410311082509BE29248C094C474895C9AA546D Arw0N
277,360,631 *1B4ECDC5F88DFD9E60870B0C33A853B8EE6E4A7D ArWd?
277,360,632 *1B46F472B4A498199E73DD96624DCE96EC1D556E ArWDT
277,360,633 *1B41189BD2DE968E4BBDF2500E1B620202D4B872 A?RWe
277,360,634 *1B4B072FB9E09D0B98CBC979236C41525492B2CC ArwH%
277,360,635 *1B48D395939F7B294C8478D97E03617877CA3A3F Ar"wM
277,360,636 *1B475886E85EA2D21518EFF8219982264AA60637 arwoz
277,360,637 *1B49332B2155E39628CBCA059047241F339BE560 Arww
277,360,638 *1B44A838F28EABDCEEBC4522596002FA54DC32E5 ARw)Y
277,360,639 *1B412B8AF33D988533E67C8720502F0A0BC606E4 Ar!X
277,360,640 *1B462763361490B5D8BB9853E19FE04A6C40F8BC ArXd$
277,360,641 *1B4B1CE5A02517DA076DB33D4CEB9AF8C5A4C5E4 ARX)f
277,360,642 *1B471601A06E76E324D0DABBDB0B49D269C5C7D2 Arxhgosed
277,360,643 *1B4133231BEC7773D0B0BF9DA650DD2B2B7F4D60 ARXID
277,360,644 *1B4AE6A41189CEDF83C678B2C099642F98E3E481 Arxisoyne
277,360,645 *1B46024490F997E1AA29D68E7A64B3C245311A12 arxivgr-qc0301024160
277,360,646 *1B43B89CB9BC8AFEEBD8B30983604CAEFFC5960C ArXKc
277,360,647 *1B495373F241779A96F8C309E18F36A7065AAABE ArXvj
277,360,648 *1B4F2226CFEE3FBC7AD56BA82C6AB283A1CEBD76 Ar-Y_
277,360,649 *1B48221990A69401ED95A62154770F254482D52A aryaabimanyu
277,360,650 *1B481757F400851F68274DFE61D028287C19C4D7 aryan250
277,360,651 *1B4EB67F2F3444F76932A83A69BB4482236B70D1 aryana51
277,360,652 *1B4D1B3C40E21A7197B324806F9DECABB19692BE Aryana796
277,360,653 *1B4E913036695026DBBC61F1AD194DB244963034 aryanna938
277,360,654 *1B438256612DE941F9C67AD0BDF461C2FEC70991 arya vinod
277,360,655 *1B416BA5FBF46701D03A8FB85ACA01B546E83488 Ar:YC
277,360,656 *1B4DA6BE57C850618A08AB75F955BBA558928FF5 aRYEeQbX61
277,360,657 *1B40A8D069BD0D31838FB6522CA0C2BC47E84354 ArYF9
277,360,658 *1B4CBAA2E2FF374D1A18097E1AE4235B80BEBF2E ARYkX
277,360,659 *1B4F794514FCBA06F9948A8E79C213C6CE172570 arylation.
277,360,660 *1B4B744B9DD601DB3653A07757DA8C40F4E9E065 arylnitreniumion
277,360,661 *1B46BA28EB3CEF0B05EDB492B4DF92C4AE4EFB4D [email protected]
277,360,662 *1B453828A6E81C727C5AC856A21551A6CBAF57B4 aryo.bbs
277,360,663 *1B4EBAB88C5AD03A6B9B44983967D693F77BD8D9 [email protected]
277,360,664 *1B4A41DCC0BB506FA945692A4E78ED134851AE56 arysaputro
277,360,665 *1B4BD400409C84FBE14E439B5BDE4F7367AEDCE4 ARYVEDIC
277,360,666 *1B44F0CF17765B0D586823697D91C5209CDB3707 ARYVEKJ63
277,360,667 *1B42D6D6658607203C0E715E46AC6E0881CD288A ARYX2
277,360,668 *1B4DF63998C4D177C85C0DA5FD2DB6E3E01874D7 ARZCO
277,360,669 *1B4BB949B4023DDD7C1B068810C1D9E091F76B4A Arzelella
277,360,670 *1B47316E7993AAC2BBA10A3A2B4C212E322215CA arzeter5
277,360,671 *1B4C611C9A593ADA3900A8189F73691F0CCBDF9A arzrunit6
277,360,672 *1B416039DEA75A88D42EB6D7B0FAC0D7387E264C [email protected]
277,360,673 *1B4C4D921414FB885308D66B8776242BA09DAF59 arzu yanik
277,360,674 *1B4034D0309CB690DF45EF3F118493BE7AA80A0D ARZVK
277,360,675 *1B4ED4C750371C0F2A529891365298CF7AD2F29B A:'S
277,360,676 *1B468C938E937A34447876D8436A5B6F32138DBD A("S"
277,360,677 *1B4696F95FCA6782D7391D1F5A37F8B9359576C6 A)%S+
277,360,678 *1B49B56BB87E3793AFEA4A714224A2CDFC48820C A#.S,
277,360,679 *1B4C2FFB89687590DE677D70620BD79F2A6C0C80 A#S/.
277,360,680 *1B427F3EC8C155872B7974BE0BEA9D30280BD9BB A+S[
277,360,681 *1B41CAD6D9DB531F725621CC89F5EFA6CCF22639 AS?,.
277,360,682 *1B4A8667DEFFE01CC52C6069AFCC058C022E3C16 A:s)
277,360,683 *1B405BF14D9E95B596EC3EEB9420DA8F9E25CD13 A"s#+
277,360,684 *1B4B2FA99C4FE748FE1D0B2FB2F1F021E2711326 A)s$
277,360,685 *1B4878B6477373FF747E2B968D92B2BBA71F6A07 [email protected]+
277,360,686 *1B43905D0C54D7A00B935813F87763383A3A03DF A&(s?
277,360,687 *1B40C447A91C176D19EFBE1EE72E7E3C6295C6D8 a)S:
277,360,688 *1B4D1A890B58E210594A7D0F62BA825BFCC61833 As+0b
277,360,689 *1B450E0008488257674ED7CCC2B15123C492571E AS:0d
277,360,690 *1B48748162B8A231C6D55801FFCCD9DD899A3D33 AS0FW
277,360,691 *1B4B6AE524E18CC96413504E4C23CFB7121E733A As0Ko
277,360,692 *1B461CD76CC0BD720C52ECBA5C77FE7A65EB49BC AS0o6
277,360,693 *1B41BA569CDBDACEA5AFEB135335936DFC69B392 AS0t.
277,360,694 *1B46FA1E16961B449025DDA0957F0075A7737938 As0X
277,360,695 *1B4982E5D672181C50E7A5E573ACCEE2E9ADAA2A AS;1!
277,360,696 *1B4207B2A049195173F6C0AF8729E2CE8D8C830F as160o
277,360,697 *1B4F4A0D61DC4F66458E9D305698738859FE19C8 As1h/
277,360,698 *1B440023C75DD5AC260C29EC35D51D75B8EF8A72 AS/1o
277,360,699 *1B43EB5EA7385F681D6E8753F1DEED4E781BF39D As1Zq
277,360,700 *1B4BE6F267F0A21A436815CB7EC29E3F5ED80210 As2G/
277,360,701 *1B4A87E9F88AB94C282BDC44F5C8C84316A00B03 As2t&
277,360,702 *1B49F0AE940CD9B9A9BDD16E0A61FB29879A0D59 A$S3&
277,360,703 *1B4B4FA8CF6D99BEAFF4000ECADE76F8841AE63A As"$3
277,360,704 *1B4CC0EA1E20C6E62D801C957EF464AC09681181 AS3Bh
277,360,705 *1B4F42091F3D948CB1F6C6A4C939F37EDEB8EFE1 As3Dk
277,360,706 *1B4ED45F730B8A5EE24C77A2AEBDA0641CA23CB6 A:S3e
277,360,707 *1B40EA9AC3A000757FF8FC21419EC4B7932065C7 As3Is
277,360,708 *1B4FA22550C3F69685795B8A02C9433615EE97D2 As3:o
277,360,709 *1B44A2491DB556DF8B5744897CB97EC2BCA217A7 AS+:4
277,360,710 *1B4B54E78F912D127CAFFFCF8AADB445152B503B As"4&
277,360,711 *1B48B8468B9A60B646663B106ABC9246768C4C6F AS4Qj
277,360,712 *1B4EA25D39EA26DA0AEFA4794484A9A9C54A1B2A AS4TF
277,360,713 *1B4DBEE638D569A1300249FC5B21A08D5C1ACD73 AS&4W
277,360,714 *1B48DBDECCD83C6DC7E74D490A5F5B03240593E0 AS.5A
277,360,715 *1B42975F98404C778AF615998D41B17A7956B848 A:s5d
277,360,716 *1B4233225639D8303C8C7DE9B351956B999B23C3 AS5MK
277,360,717 *1B412BF1C0A4087F54BCFA491074C545B6FE576D A,s5t
277,360,718 *1B4FF65266C0B34C6E3615B74ECFD1347E5529DB As5%t
277,360,719 *1B47B950C199275D1BD1B58DC62CAFDDB7AF8862 AS5vg
277,360,720 *1B419441DD02C9235A0FD9891AFA47C1659AD9BD AS.6)
277,360,721 *1B480FEA111A84198C590E9165B26F0F3ADFCEF4 AS.6%
277,360,722 *1B4C696148AE5D4C1EFE46D0553581DEC58DDD32 AS!60
277,360,723 *1B4079A2AA498D571EA08A256E3A8F4CF99A1172 As6dB
277,360,724 *1B4CBDE8322F448ACF52A767F45C507C07EDA421 A%s6M
277,360,725 *1B4EA17FF1B2F888C0027520B0513229A913872C As6Xd
277,360,726 *1B4774DDC13AB36EFB849DBE84F6AD25768468C8 As70nish3d
277,360,727 *1B49EB9B2290F38A79921EC29685488929FF0944 AS+74
277,360,728 *1B4DACEC1C724264C989B9D093BE2F706D487119 As79=
277,360,729 *1B48D7463B8874F962C63E244EE75EBEE61CC9DE As7L9
277,360,730 *1B4A947A7EAB371DEBC015727C84A51F1E77BD01 AS/7o
277,360,731 *1B419E92FD40F5F8A38BAC3C0FA0BED790CC7DAB As7rA
277,360,732 *1B46FDB37DB16ABE710377DFD818EF7BCAA748EA A
277,360,733 *1B4E535F6A9F982A308AB1DFB93F3F9BBF64C076 As8!c
277,360,734 *1B40B49073DCA1FE835F945A91C7BA1F8BE9AE26 As$95
277,360,735 *1B4175A9C73D6390C35A75758D479C92F21E7487 AS9N3
277,360,736 *1B4323168DBB19704F7354D205168C31E9DE8B70 AS)9r
277,360,737 *1B4193F04D62D9A888B811A3FC7CB0C7417E3680 As9W6
277,360,738 *1B486D0314B3FBFF7A7D553FDBECC52706E91C06 A%&sA
277,360,739 *1B476D2AABACD76E4AC808E697253D617E873844 aS*A
277,360,740 *1B4648F82948E171C073C1A4D787A9F9F5C74CF3 asa906
277,360,741 *1B45E59248C7A9FA0E91F5F64ED4E229D7C4E09E As!aA
277,360,742 *1B40C02370A9E04ECF1DCF7E9A4D7A013DFB23F5 asabrasil
277,360,743 *1B4804A13719CBEEE58BB4041BCED2223D4A3CCD AsaBU
277,360,744 *1B47692D1CBFFC378429DF41E0CB26FF8195D5DE asa.chhor
277,360,745 *1B46D1247B6AF8F732896B291DEE3C903B80C0E1 Asadamra6
277,360,746 *1B42C4E8521574B0C9D9236A27E98482325B7471 asa.dentino
277,360,747 *1B48A7DF290457C05CCF243C89214CAC3B03DE05 Asadoring
277,360,748 *1B4A7EC5E32E445A2E918FE232275C8F762A93BA asadqasim
277,360,749 *1B4E4BBDB8777CCBEE4355A6D0D732564B0BBCB0 AsAE$
277,360,750 *1B484775E2419E8B6829259DE557FCA81BB0A484 asa.expose
277,360,751 *1B47EA130D01D8C32EBC35F42CC0CA8A99C5CBEB asa.falzone
277,360,752 *1B434C23F8786D613FCB98F27180C18052038734 ASafB
277,360,753 *1B4D02ED0F342D345127819DDBFAA994AE01F95D asafinalnote
277,360,754 *1B47DF5E7CD2602D3AEADF43CCE40D5927D878D2 asagamiied
277,360,755 *1B4C60691F49C524335C2FBBAFD99251843BFAAC asa.gaston
277,360,756 *1B4A090005ED80E8037BDCCB5534A047EAD07691 aşağısızma
277,360,757 *1B4E5C2F13EC744A52002772593AE4ED347FA2C8 asa.harcus
277,360,758 *1B40791CDA36C450584DDF36BEF9B8A1C6622085 ašakabašius
277,360,759 *1B43B2E6E8563B81DBAA944F7A32A156A1F18D5F ASAkI
277,360,760 *1B4B9CAA649DF0E864E593B7A16C8BF634240246 asakora5
277,360,761 *1B47288E17D1C6AA1A274C5BC03A50D49895420E asalesman.bbs
277,360,762 *1B4D462F152FBAE892CECFBFA2C530E5ACD5DBF3 asalg50226
277,360,763 *1B49AE7EE635D78266393E98FA9AC8A4BD20284D Asaltare4
277,360,764 *1B49BE260680D8BD4F873D70A44A061BDD843200 asa.mino
277,360,765 *1B4AF445ADB6446934AECEE0521351858323BAF3 asamoah addo
277,360,766 *1B4CC58D90C2E92088C7ED82A1A0CCE0BE5E92A0 ASaN9
277,360,767 *1B402FB2DBAC269A691CA04ADEFD9276CA0DECAD asande1630
277,360,768 *1B4E397B0F0EC2B6D79F76E33AF41629D787DD36 asa.northcutt
277,360,769 *1B4C12CB91D8EBA40320B94C2ED2341693511C8D asantan01
277,360,770 *1B463E0FB831BF2535CE5256F152F5D0928598E2 asantitw9
277,360,771 *1B4F0B56A5D978D7C631A45AB35D074AC7E44D7C ASanu
277,360,772 *1B40C49C91278626DCC2A23134FF77485F73837A asa.oliger
277,360,773 *1B4E5DF3B9E06A25AA3A1B35D23CC6D93CC844B5 asaracea6
277,360,774 *1B4B07059EF1E99DEFA50CF87F48EC1465D89F58 asa.riggan
277,360,775 *1B44CB004E7EA6F55CD466657A27AD07A1F5D8F5 asa.rowman
277,360,776 *1B4B6A43D7D02EEAD2B751F599678D47D793FC6C asa.ruple
277,360,777 *1B46A0C99B9F850ABF6E6BC74FCD1EE29301F0A3 asa.selander
277,360,778 *1B4ED16A9EFB89FC87A55E61D408DD9AF7E585E8 asa.senske
277,360,779 *1B4936810FB34F55B25EC6694144E161A278DCB3 asa.spontak
277,360,780 *1B41D5FCCCBF210F5C5C63E9CCBFCD5C11C48624 asa.tekell
277,360,781 *1B4310A58101CB5AD722A187762E8AD07DEF9E8A Asatiir
277,360,782 *1B436251A9DDAEFDB278B97693007E79B2983989 asa.towery
277,360,783 *1B4F06E6BE78578E65C92E5D0F58FFD87AD0E0EF asa.unland
277,360,784 *1B4047050F700B4640C36DEE107AC4D75D4C043D AS;AV
277,360,785 *1B437227885F1F57F144952104CDF56604560CEB As;b"
277,360,786 *1B48B8750B68CA0F47C5828484C3B3F18EA40AB0 As/:b
277,360,787 *1B4D859BD8C8617087615C12A18B84F324278F19 Asb:-
277,360,788 *1B433E54E40D188F9C9AD881F8008ABC76F4A6D6 A#sb1
277,360,789 *1B497DB72585DF8F94A7A1EDE9EDDFD243491FBC ASb2Q
277,360,790 *1B4048941C5CF7493D499A53FDC4739C2CB929BF asbclassic.co.nzasbclassic
277,360,791 *1B446AC470C0CBA8556504527033158242E820C1 asbdb
277,360,792 *1B4ED9019827ED366D1403141D7BE8C9AE486493 asbestem0
277,360,793 *1B497F003807495D7CA343D38E0A42B7B09EFAA7 Asbgv
277,360,794 *1B48F5AD845315DC6F471DBF48482EA39787D9B9 ASBI1
277,360,795 *1B43FA37FF90DB7E004AD173BDD570907E2AB783 ASBLONDER1
277,360,796 *1B4F96999F3A041B7A002A81F2C4911ACBDFD8F0 AsbO+
277,360,797 *1B4C70DFF5C77FE3279A0D0FFA60D61E3EBB17F0 aŝbot
277,360,798 *1B420E7F8E2A2B07CA497213562C8A1592CFF937 A(sBP
277,360,799 *1B4F1957166EFF77F7B7B67CA0C9F2ABF8E320D3 Asburgo7
277,360,800 *1B429711674DAF395B8F3C0543DEAA89F936FF10 As by your safety
277,360,801 *1B4735DFEEE35575143D9A858F921C5C84C3F8EB A!&Sc
277,360,802 *1B4F96C92CA8F138C195D074828A2BD82D99ECA6 A=s/c
277,360,803 *1B4CB468AAC5F7DD0DF99C956ADDE43CA0E0334C A
277,360,804 *1B42114B56E2C2D172B02A8E7CEFFF9B2A952EC8 ASc1Y
277,360,805 *1B4E8371866E58D737A94C2BA7D9DE6BC6FABB61 Ascaniuss
277,360,806 *1B4F164B5781E721033DB564F37244CCEA109202 asccccsa1
277,360,807 *1B46641B127F8BF07A3ED514E3F2F491C4FB70C8 ASc
277,360,808 *1B473059A0DF3500AB70238E0AD53B9011BC95A7 Ascending the Abyss
277,360,809 *1B4561A53ADD078737D9D050194EB1D474759683 Asceneisastory...
277,360,810 *1B4E90E1C65E50200017A5F7FB76D5DB3C81EA38 ascentbenefits
277,360,811 *1B4E5373A0E90835B4AD5812F0528DB053E167AC ascepiodorus
277,360,812 *1B4046E2DAA30FA1C6E5B3651E6077A6B6848CD0 ascerta1n
277,360,813 *1B458697F4545512692CE73847D3ABD345EE8557 ascèse
277,360,814 *1B4F67E61E244DCDE92D6A643B341BC6245113B7 aschbach-dorf
277,360,815 *1B42C07EC0676C930CC4E6D3A92A7797C72AF47A aschdot
277,360,816 *1B43483DE008EF6CD0A9E2524B709B5E11859D92 Ascheque9
277,360,817 *1B444A4038189308B248D2F211377EBDB27F560E [email protected]
277,360,818 *1B4333E674E42DC0A744D4481E7726BAFB416FF1 ascinoned
277,360,819 *1B4E07E340DF9AF770561D4CC459C1A54AE77A58 ascionerie
277,360,820 *1B43071CB9E678B9E8049565B0526484A41D537A Asciutti
277,360,821 *1B417B48FDCCFC4C58596701686870A1266785A8 asclepidin6
277,360,822 *1B4EA62E46FB563EFC23AFE245FAA0A5A21B52D1 [email protected]
277,360,823 *1B423181B5BE999ACA5276A92C5F07C5620C7BDD Ascopards1
277,360,824 *1B4B3AA3B2A6C03D204308EDCBA792D2B3F8B3DF Ascorbat8
277,360,825 *1B43FFA3FAFBDB36C2C44B4E9EF1A683BC00660E ASCOSPORIC6
277,360,826 *1B4DE947BE1A0FE7BDE93E6187EE0245CDDB429F ascot22
277,360,827 *1B4C1674F875EE0CC3EED2788E410F597C42131B AScott
277,360,828 *1B4E22ADAA2825F1275F6869237EE06C1F460671 ascraeus4
277,360,829 *1B4020FE04D7D2AA843787A5B6C807E089A10826 ASCR!BABL3
277,360,830 *1B4205F30C8CC30B4F9304E394E9231BC205D86A Ascunsă
277,360,831 *1B4F5BA8ED8F3CDCD15905FCE5635DCCDE8AD30E [email protected]
277,360,832 *1B43A9FEFB81735C9824AD127BB330B9F876A326 ascurryin
277,360,833 *1B45DD0D3AE8F4A2142C32F2EEEDCFA32BDA0D23 AS,:d
277,360,834 *1B4F873340571DF682FC89F05A7FF37312BD6339 A:sD=
277,360,835 *1B4766CB70D3BE2346018C9014655C471B4A4C95 A;sd)
277,360,836 *1B410227D516F18FF37C621626E0615A88F7F3C8 Asd)_
277,360,837 *1B4BA9D0FCAB5DBCE14119F2B721A80140D011B9 AsD-9
277,360,838 *1B4A03189B86DDB315F6C3EB42D1B809F7C35E74 @Asdf
277,360,839 *1B4189B2891E3B5492C534D818EFFB033D7DD4DF ASDF1123
277,360,840 *1B46FDA55F33E22EA36EDFCC52AAB4B096D2CFE9 asdf2765
277,360,841 *1B4F761FBB96A72F9A73F0A82FD41EF89531BD1D asdf9317
277,360,842 *1B4B21F211D0E1FCFB884F2BACB9CE653D39F472 Asdfaaron0
277,360,843 *1B43987E9A09D858144E863BC1808B099D458A67 asdfgh208
277,360,844 *1B4BDE9D5A78CD0EBFA79E7235402974F96EB63C ASDFGHADVIL
277,360,845 *1B479B1FBECDDC63F44488D7D6F6098BB6DC26A0 ASDFGHazsx
277,360,846 *1B43042A21E6B1A5C6DE05682DB3BC3D81BFCF67 ASDFGHJ462
277,360,847 *1B407EFB6D9F261C13C35CD84BF08F04D475B67B asdfghjk85
277,360,848 *1B4669BFCF048D94D04D660BB73D295B7DB6326F ASDFGHJKL99
277,360,849 *1B42F13B1D67B29E8D27CD2B98A71489EB38A623 Asdfghjkning
277,360,850 *1B43664CD83D6A598AF1D2D323436D04E920B06D asdfghme9
277,360,851 *1B490254B74A4460ADB765EFA2F9D554A1540074 Asdfghost8
277,360,852 *1B4CA543666F8D3AB83E70A250E6815FFF4FEF21 ASDFGqetuo
277,360,853 *1B47D678E0D599BB2C50861D77D7A4AEB1A03E08 Asdfjklracoon
277,360,854 *1B4AE654D084CC9DBD694A8910F1FC9C0100B370 Asdfqwer
277,360,855 *1B4780C529C8F153184BF7CC4B60FE042EC093A6 Asdfsonny8
277,360,856 *1B45C26B9C93E3C1EDD284462A96AFD464FFB750 Asdftaffy8
277,360,857 *1B44C36DE5F6BDCB9DFCB153AB4A317CB15A7C13 ASd-i
277,360,858 *1B4ECB45EBA6FF6574E8A857E59E7BEF8B997AF7 [email protected]
277,360,859 *1B4D217ABAFA718167B52B409ADC02FCFA15A900 A:sdr
277,360,860 *1B45090E9EC9DCE0215E24F457F9E524AF3621F6 Asdt!
277,360,861 *1B483213A1DC247B894B2ACBCA51A19BDBF33ACD asdumesh
277,360,862 *1B45262F95E8847B19587C9AE012E3E026B35AB8 asdvgj
277,360,863 *1B4A27ECDC8D79EA890556727E06265E18EA4055 ASDVn
277,360,864 *1B4EA090EB4012C676F280985D2021DD82B88FCA AS?#e
277,360,865 *1B4DDBCC42BB276090CE7F7BA3269810E8585DD3 A
277,360,866 *1B4413A979EF7FF15A5C6BCBF360348125A7F223 àşe
277,360,867 *1B44BD2EF23DCF2BD3BD30B291226E8F716F5BF4 ASE%0
277,360,868 *1B49ACB920E92A28B9F3E1CAECDE626C7BC65D5B Ase0u
277,360,869 *1B4EBA06B7C3E64042988DE844770084C497B0F5 ASe=5
277,360,870 *1B44BC3185B964136DA147F38A55E4400A63717E ASeaG
277,360,871 *1B485C476D1012CE9830471702FB04ABC1698966 asednu
277,360,872 *1B40F93704987EDC98B418DCFEDFF97B6739DDEA [email protected]
277,360,873 *1B4327191DA867CE63322D63E802F5D8903AEF8A A&seh
277,360,874 *1B423A77B2EC35DE43F5FFB1A086F3308C660144 ASEJ30
277,360,875 *1B46298D3397128486B3E6AED224442B9F3D4F07 Asekf
277,360,876 *1B43970CAC5B622FE98CE6250F4EC258F1A9C5CB Aselajiens
277,360,877 *1B4D2E7EC85AA7AB825FB348E8DEDEBBFE71FC66 [email protected]
277,360,878 *1B4853F553240C84777E56EC50A9D51716587570 äsem
277,360,879 *1B4083F2F6DFFD66BF3D4E333708E10CBC53E324 ASEMBLARA
277,360,880 *1B4E9A4ECA7B65A3B6B2D07254977F0039C2A3C8 Asenneta2
277,360,881 *1B477B74F82DF83B227060CD0F0CBF3302B4A178 Asensor0
277,360,882 *1B40E0D93C5F1E04AF6D57221CE3B5310A71400F asependang
277,360,883 *1B42FE106B267906FCB2C8E6A286FFD88F1F3114 AsEPL
277,360,884 *1B409559490A2E3F6301D4C46B983D3C2BFE2AF9 aserbajdjanske
277,360,885 *1B4D17DCD9A52025AD48FB2EEE69E9D7D205CE9C [email protected]
277,360,886 *1B4DC2471C26D09A7B4771FA1C1E688528B19832 ASEREHT1
277,360,887 *1B4484E730025E095F2B3E74B6AA6A06A891B955 aserelah
277,360,888 *1B40F63DE0DC16EFA70DDB57A0C1883E529EDBEE Aseringa8
277,360,889 *1B4AD52BF2DDE63AD252B202238CB96AD229963F ASERVIC
277,360,890 *1B4C9E2D0C17926A0C89F9F91F14F9FF066418C1 Asesnsi
277,360,891 *1B41E04A965EB83119CFF07A6B7828116FEEE504 [email protected]
277,360,892 *1B419B92B04CE59B82D370CCEB0DD281788E8390 Asetabsw6
277,360,893 *1B43A508C5075AB2E0AFB747F85CD57AFFC3A3D9 ASEUN
277,360,894 *1B40140E466761840100EFD69023FE6FDDF32698 ASEVAGPO
277,360,895 *1B4D5E028D6ED65DCDE0340938EA7FEDA7597CBF asevelvollisuuslakkolaisten
277,360,896 *1B484F6B403149FA15A84E477082C2428467C011 A
277,360,897 *1B42CFCEE4BA7596562AE26607AB407D8403BFD3 ASF6/
277,360,898 *1B4737067462F8AE725881C8011A8B895AA35AC7 AsFIP
277,360,899 *1B4A788C3DC88D353B8DC54E7F621AE5F75D14AA asfixie1
277,360,900 *1B4E71FB8726D39C00F580DF19CB23E993E20FE4 AS#FK
277,360,901 *1B48388748B839A5B4B6C29FD4E8D0EA521B7203 asfoexas3
277,360,902 *1B4D1918E927B5DA5D22AE8F0D09A09BDF3BDE62 ASfPH
277,360,903 *1B43F1C0E21748C70201C2B4D1126BB611EBA956 ASFQR
277,360,904 *1B465BBDD347998B9C6E477F144DE18A6D028E41 As
277,360,905 *1B4C0A74DA54B83E5E7103FD211231662438296E A-
277,360,906 *1B42705CE42802594D77CB8375CE9B33675320EE A.+sG
277,360,907 *1B4B8FFE8101D7B14656FD5281B3888F94B13AC0 ASg(4
277,360,908 *1B402A4EC00A7ACDDFC71E25AD89663DE985E717 AS!Ge
277,360,909 *1B41395F45572F06A49C474D53A6039EEE507251 ASGj=
277,360,910 *1B4657BFD80A11C83280CA3C023FED4393E33825 ASGnX
277,360,911 *1B469E40944602F25324E996E86AD9A9A7284219 AsGpD
277,360,912 *1B437653F8B291CA701DBF7D1C7F663580EE4037 A&SH$
277,360,913 *1B40508CE173DFD840F5A9F3700A62B7EE0F16AE A)=Sh
277,360,914 *1B40C896B4CB23AC47FCB1DA336F39F57FE1BC3E AsH3c
277,360,915 *1B4816682F4F074145ED424CB471DEDB458E89E7 ASH7S
277,360,916 *1B40AC4D23F82920099F6201D8EA63CB8106313E ash93176
277,360,917 *1B437646F99428B86A6DFD6AFFC6102A9059BD3C Ashaie
277,360,918 *1B4B54C5F55C4B841B0C2C5E65D10A95AE1DF047 asharibrahim
277,360,919 *1B454727DF4BC0FDCE24306F09B4250DFE09A902 ASharonapp
277,360,920 *1B490B699A0AA147F4CF4DDC7C4AAFC8EE10FC3A asha vida
277,360,921 *1B4B62BC2D00BD041A252FAC7EE025D90E3D5835 ashbelit0
277,360,922 *1B497AF5A281425B55F15EE5EE48DF18C6C10A1B Ashblue3
277,360,923 *1B4606C2A7782CFCEDE60ABD7E8DBCF2D6B65B69 Ashbp
277,360,924 *1B484105D393A5862DC2D8EAF0C5F7A87FBE355E AshC,
277,360,925 *1B4E3D0A8F6963D562344A3DE996383491FEDA89 ashcombethomas
277,360,926 *1B4675A1836E3C3C1081B377EE156174EB1EACDA ASHDEVIL
277,360,927 *1B444F71421F6E54906DE5841A8A8286316D45A3 [email protected]
277,360,928 *1B4A037F19B5F3BDADE42F037AFDBD6B4C0DECD8 Asher762
277,360,929 *1B4CC72DBBE541F48432A3219DEF77170C37CD84 asher kidd
277,360,930 *1B4FEB80C1EF27EBBEAC34371973E8186AAF66E8 ASHFIELD3
277,360,931 *1B493082777A47B0C9C581192F94D45A091AAC8B ASHHTAMENA
277,360,932 *1B414AD491997BB1500E340D8A70FCE8543593C5 ASHi,
277,360,933 *1B4FCF7B50281BE2D06567072F877BCA0DF19999 ashima160
277,360,934 *1B4CC7C1E988F152137CC2C4A19D89989CA24C1D AshinoleHii
277,360,935 *1B44B95E39D6D5F30EF2C83FD9946D2A5A419AE6 Ash is Falling Rain
277,360,936 *1B41EE693383CE1F4357FBBB2C21C38A56BC792F ashish misra
277,360,937 *1B48C8C74415BA0535BBF4D2EC9AD9B98EB3F222 ashish vashishth
277,360,938 *1B474A82290540511C8E8EC4588DC74BABC2C18F Ashitam8
277,360,939 *1B460094707D7CC504946AFA747D17247FEF79FD ashit pandya
277,360,940 *1B4ABB9748189D9ED6458495ED1162469803B29C ashivaa2
277,360,941 *1B42E3BCEAD7376E8CAE8EC4C5B3C1EEB0068B59 ashiyyât
277,360,942 *1B410CE724AA6040D55370DFFC682089E7737B89 ASHJES1
277,360,943 *1B4ABDD7560E4C1BDBDA6A55F9C2945D48ED429F ashlandc2
277,360,944 *1B42E4C1C84F54E984DE0C5FCF30CC66511DC486 [email protected]
277,360,945 *1B496B84BB7D17FC3F8C033E70738430339AA4F1 ashlee crump
277,360,946 *1B4FB5D484701B1C3502C780B2428FAB20856C68 [email protected]
277,360,947 *1B4265D416BDD66FDABF2F17AD2DA10D0629D764 ASHLEY5/7/90
277,360,948 *1B4307FB72B7E720A7A0F3559699BD94EA11C796 ashley.acree
277,360,949 *1B48D1FB73497D9EA80297BAD9286F535CA8FB59 ashley.arvizu
277,360,950 *1B4B5EBACF493DC91D879BB8990DBC4A856DFBB9 ashley baumstark
277,360,951 *1B41258665438A6421A0556F28F78B1A624F9A6B ashley.bentsen
277,360,952 *1B4A09C52457214D230EF71F37BBD1AFB5206ED3 ashley.bolig
277,360,953 *1B4FCD27071CE00A855C774FC38CE517E48CCA63 ashley brancamp
277,360,954 *1B48DC9BA9648D2BAAA4DB9942B4C4313E6185FB ASHLEYBRIAN
277,360,955 *1B47F83A8B10D702839C486380633047AA946D8E ashley-browne
277,360,956 *1B4D2084C1AEEEDA7312A6C2E596DF79F4B236CE ashley.bursik
277,360,957 *1B465CBEA34A5DDB308D02702CAF2D11AC1FB955 ashley.cacal
277,360,958 *1B4F6040E5A24942B2C54069EB7221CEDC170EF6 ashley.cavagnaro
277,360,959 *1B40065CC58116FD980C3C2F24A25E40A8CF6828 ashley.cromartie
277,360,960 *1B4FD32FB2E1F54F71E1A345850BA0D431AEA573 ashley denyse
277,360,961 *1B4825466053731AD39CE67A03DA7FE611E4EF24 ashley.deroy
277,360,962 *1B441674A5513FF07E32B183F9DEA92605AF6004 ashley.dewire
277,360,963 *1B45D68B9B9BD9038FDC3C272C09FCB64055C238 ashley.durfey
277,360,964 *1B41FF3FFBE3D625D6DD2231CEF3316B90EFB010 ashley.dwight
277,360,965 *1B4A959EAEC3462821AEA2E3E38BC25C5A532FD4 ashley.fiumara
277,360,966 *1B4C286084E62E05FC64803E010D27E93CBD1AAE ashleyfothergill
277,360,967 *1B403210A27EB2CE42119B7FCDAB7B83BDA0C32A ashley galley
277,360,968 *1B4E5F713C6C05907D62E5FC81BBE8FA15F7E7A1 ashley.gessel
277,360,969 *1B4341105C785AFC5FA60AF71FE06C2634259C5E ashley.goettl
277,360,970 *1B493095F16BCC725F7D213BE28A29BA0EC0E144 ashleygove
277,360,971 *1B412E093F24AE20180E47B85A2A851F3D33FA90 ashley.guitano
277,360,972 *1B45507AD26849408F538FFEA21C5CF3BD69D70A ashley.gulston
277,360,973 *1B4B5614B4DBC56F5C501F5012BD53C471E7ECFC ashley.hollywood
277,360,974 *1B4FBF642C629A120233614B105F508E36490641 ashley.isaacson
277,360,975 *1B41C7EBD3B71D9F27C6A70D7EE76DD6ED941BAA ashley.jobson
277,360,976 *1B4EED8A21620991B6224847797DAA221AC59A33 ashley kramer
277,360,977 *1B4035807E36CF265BC081FFC405E4153BC4A777 ashleylafosse
277,360,978 *1B4F0952DA9FA8217DE50DE02945102BC4DDC134 ashley lauren fortune
277,360,979 *1B4CEE453B19F35A169750C3BB22BB2DDD3F8153 ashleylongpre
277,360,980 *1B4D9D1818BDF9131998CD5BF340778FA1CE8EF9 ashley.louviere
277,360,981 *1B40D66D70EA36FEE9F01E9D9734076B739329A8 ashley marie asbury
277,360,982 *1B4DDA9AA2F3A9142B2AF5A95EBE985422490192 ashley.mccullick
277,360,983 *1B432F1B4F9D023E398ACF92E5957075E724094A ashley mutschler
277,360,984 *1B4F4069D5F55BC8C4B2C0B95A89D4DDEBDF9900 ashley.patrylak
277,360,985 *1B443CD58249CF392E2341D2AD9456A374DA30A3 ashley.rhode
277,360,986 *1B483799D9170DD9C9EC8E78F49F17D71B84F10D ashley.rosas
277,360,987 *1B4A46BA19B2D62EB6E35898934B641618B38F5C ashley.schaufelberge
277,360,988 *1B4158C263153846A6C33CC3C3B53E4754DAC493 ashley.shorey
277,360,989 *1B40C84796CD3D430356BF75403C21F393EAF254 ASHLEYSHOT
277,360,990 *1B4BCA424A936F58945AE3423F1DF3A7624DAAE3 ashleysist
277,360,991 *1B4B323D94B23E5456ABB1816129DCED5ED4F5A1 ashleytorrance
277,360,992 *1B4448DD91835595EB30768479DB7D5FED705166 ashleyvosper
277,360,993 *1B47DAC5D867BFB26A4ED688A0B31FA1E440C393 ashley.wertheim
277,360,994 *1B4206543D9CA384A3C8F007B07A8CA0C5481486 ashlieghed
277,360,995 *1B48D4981068154D3F84E1B993F664650BEF75C3 ashliemcguire
277,360,996 *1B4534F834EC6881AE718391E2F24E3B674AE06B ashlie tyler
277,360,997 *1B46C7C4604C68CD4726138CD31EC094D8465FBE ashlyn255
277,360,998 *1B46607E7C7538AEE04B8B078EB664B404847A92 ashlyn kay
277,360,999 *1B4F9E503595ED20989149B101D4BB181465FFD3 Ashlynn174
277,361,000 *1B496611DBE137CFC697001143852FBFA121040E A_ShN
277,361,001 *1B49155B1B8FA1484D253154173C69A301067923 ashnitzel
277,361,002 *1B41EFEAC48D8BA013DB9583B87FDBBCA913207F ASHNIV
277,361,003 *1B4ED5872FF4130BA7A860D21598EB5B76F9E2DF ashochan
277,361,004 *1B48CD0A16B220119FF658AB248FFEF36F8F8CAB ASHOK143
277,361,005 *1B46390D0FD7FD168B01A9AC851948D1C1A56E28 ashokkanwar
277,361,006 *1B4827D2C120FB7A75C77277B67BB70EE07985BF ashpitsing
277,361,007 *1B46A263B175367DF2F77B189D1FA0132627B04E Ashproof7
277,361,008 *1B45CD70EFAAAB42800FA26B5103EC59AF6226A1 [email protected]
277,361,009 *1B4250604DA2362DA07D5EDDAEBF148296633BFF ASHS
277,361,010 *1B45AC007330946DFA22AD3E0A19402326E70B97 A$SHt
277,361,011 *1B44B055728A33C33DD9D0FAA3F8B584B4D86F9E ASHTARI.SARA
277,361,012 *1B4EADCCD875E9F3DFE8F5FC7C69095DCE76AF3B ashton emmanuel
277,361,013 *1B4A9F1D5821677C9B6B8EF8EFA93AD06BC4C38B Ashtongi3
277,361,014 *1B416854032595C922DE042D78162E794DB7E1CE ashtonml
277,361,015 *1B4738FEE456185F4609C4FCC1382BACE6264B9E ashtonunder
277,361,016 *1B4349603FD17940923CF647D6DA87CCD4477111 ashton williams
277,361,017 *1B49E70692F0BF7CE2095B833C9648369DC46E37 ASH TREE
277,361,018 *1B40EF3E5CC527DD6D42D912141785B385849791 AShU=
277,361,019 *1B4A96AAEA84F1AB38DB95BB80D8EF884FDCD488 ashuddha4
277,361,020 *1B47B343789F467C25ED6CB0EB113974A2812A3B Ashudosh4
277,361,021 *1B4805B4D500C45EE950E6B6332A528411AC9DFD As&hV
277,361,022 *1B496EF645728B9C67D25F3170F0817696674B97 ashville blues
277,361,023 *1B4E5C6A85E4CD20BED41B152C6D4BDDCA9B48A2 AshXQ
277,361,024 *1B4E5E4CE52F8D6654F49E8B866ED5A53B135426 Ash正式成立,當時的團員只有三人,分別是降谷建志、櫻井誠和馬場育三。
277,361,025 *1B40077F8D0A71246C1A8FED1E363C7CD7CF683E A=(Si
277,361,026 *1B460BD9D30AFF6979F3D544C43930ADB1372AC6 A+S:i
277,361,027 *1B43FE34B8201F99FE401C1558F19853B8A08041 ASi)#
277,361,028 *1B4F59A5D246C1E51F1F4B01C6FB5CA3EC8EC788 A-_sI
277,361,029 *1B44C47158A6AC5DF119CCEA4DC56B99C9A4D9A2 As=:I
277,361,030 *1B476A6E7C93192ECAC1C50A1C6A084ADF2BE93A ASI0k
277,361,031 *1B482ACFD3FC55DA1CAE8005CA8A5A94F32F90D6 AsiaC
277,361,032 *1B479B3A7BC800FC02601FA7E8264D3FA35D993B asiadili
277,361,033 *1B4F589A375F244342CCC103D87CE9F6DF9F8D4D Asiainling
277,361,034 *1B45FCFA1D490CFE05EC55ABDEF2FF6122831C95 asia marie smith
277,361,035 *1B408D300322F0BA87586ECA459F964D81F00671 [email protected]
277,361,036 *1B40099E5228D2BACAEC2DEDAD830C375964B71C [email protected]
277,361,037 *1B41AC10BFE650AE51EE153C86CCB6EC69E7287D [email protected]
277,361,038 *1B4D5B124432928F69420B780116C4CAEFA6EA83 「ASIAN美少女」
277,361,039 *1B45CD16FBF947B813BCC567ABE640D0E4788309 asiastasi
277,361,040 *1B454219793F7EDD3887557C6F6D8977DF638696 Asiatovo2
277,361,041 *1B494465D5E9B8E39C94F1E319CED73501E2DF96 asicsan0
277,361,042 *1B44BD3B3FF6F14338FF98C268304FBC680FABC5 asicurarse
277,361,043 *1B4AC4AC4F0B244B4AC40937AA1A508FE7598833 asidaraP
277,361,044 *1B4F402C174E1FD907B3A0FCD158889B867A1CFB ASIFBW
277,361,045 *1B4D4EA851B6C653A7C47F747CE0A5C68725E5B4 asifishaq
277,361,046 *1B495578B3677F4D3C82E227924E7AF3279E6E3D AsIFK
277,361,047 *1B49AC14942E22FF4F3B6C3DF409322CF0A4D5C4 As if with grief or travail he had fainted,
277,361,048 *1B455CEB82209C846FCE360F81E14359D181109F Asihotom
277,361,049 *1B4CFF2CB426C3DF55ED4478CBAB5DD8E685B0CF asikjoewas
277,361,050 *1B45902D12B17D28D3D9BBE45EE81C5ED275F578 Asilevied
277,361,051 *1B4B943E8636356EB98BCF1B63D003411AD7A8D4 ASILICOTUBERCULOSIS
277,361,052 *1B48B570D479B94187F60EE5253234FC76FC2DB9 Asimcion3
277,361,053 *1B450AE69FA1134E3D49873CD143EDE8994575C8 asim gujjar
277,361,054 *1B489B3E4479E10A6911BC5E6F485B01231912E0 asim kh
277,361,055 *1B4DD71BC0CC8352FD84EDCC6D488F61A06857A6 asimmonses
277,361,056 *1B40ECCF0D315358A3E19B80351377CC86023B3F Asimori7
277,361,057 *1B4DD64C783EEC07BE53083F8CB2A0BC668C7BF7 asimplgirl
277,361,058 *1B4B00726993595C4E0B28AA561ED0772C8AF150 Asimptot7
277,361,059 *1B4D4F911926B54A6C4358F9E64AFDFD4DC21FBE as incense - symphonic expressions of faith
277,361,060 *1B4714E4DE08D0DEB53B2713E7DB9862BD69CFC1 AS iNCREDULiTY MOUNTED, THE VALUE OF THE E911
277,361,061 *1B4D51FFF89ED5572BBAD9E585B534FE25834040 asinglestar,biggerthantheuniverse
277,361,062 *1B4DF755DAC6556231B8A4E3D86FB3319D299ADC Asínque
277,361,063 *1B4F19BB4BD26100DCCAB301272C6D7EB3A0850F Asioille4
277,361,064 *1B4DA508391A7324B027217EC80642623FA1E985 Asioitaa6
277,361,065 *1B45D1425F5BDCFFA85B51540BB5C91E5266D821 AsIpv
277,361,066 *1B4C4EC5ED15BFE19411D906796E15342D3952E1 as i roved out (traditional)
277,361,067 *1B45F6EE2F1D504CB01DDDA28BFC2D11A9465D7C AS=Is
277,361,068 *1B4F138F2B59C1619BD4047F2A0C0A64E8D1EC04 ASisH
277,361,069 *1B4899EC9052DD2DF7D96F93C047DD8EF017463A asistanse
277,361,070 *1B4662CC321D838EDCA8CC6B13B53885080EF446 Asistidosed
277,361,071 *1B410292700BF6B9627F5F5F5303AE51785A13EE asistur3
277,361,072 *1B45E220A5B859D13C7D88A1A349EA5D23C8040F AsIvj
277,361,073 *1B48FDAEBABBEFDF05599359B2A35613559F595A AsjE2
277,361,074 *1B41A15DB93C5BEFDE3AFE4EDD0D2B677BD793C7 Asjetters
277,361,075 *1B492B3504AA982BDA98A8D6BEB25DAB586BE9AB ASj
277,361,076 *1B41E61E4C1A1B49D671AF6C2BC5B294833A60B3 Asjk1
277,361,077 *1B4C0D8FC2BE20F15839B9562DFDD1BE934E7D61 ASju:
277,361,078 *1B4FCBB246D92A556DB35DD9263B039FE35C43F3 AS/K/
277,361,079 *1B412E9E1CB53CE4FD90BFB0AF23C560911AD61E ASK,.
277,361,080 *1B4F3DE0C3D2904443EC1FF34CF05680532F36B2 ASk-A
277,361,081 *1B45D2C806A4586F346BE2A56C348D5A6F6DD47A askari-neger
277,361,082 *1B4A0197C378306C769260FEAE6B23029C75E600 askarojmat
277,361,083 *1B49EDE1921E50B273E4927E6F5F81E40485AAEE A/SkB
277,361,084 *1B4EA98A97488D119713060EEDE9F0C54245A196 ASkb
277,361,085 *1B4B9F0E023FBE2E24F2994C83B36E6CB9AD58CF Askegrening
277,361,086 *1B420853E59DB7ED56F2407E0C4A81449D17E394 Askelandlag
277,361,087 *1B423DD151F80AA77B58E9697466950C6C9D8739 ASKELTAK
277,361,088 *1B4D71E365918EC42456CB5BE5F38A0F1FFEBDBA Askenemmer
277,361,089 *1B4A5370916DB43D03E30FEB40A1DBF6CC92FAA0 ASkf!
277,361,090 *1B42F9423848460C778CC1D7BA2E6CB33290A62D ASKFORIT
277,361,091 *1B4E66D797DCF3FF1267748ADFE8421D171FF245 askidian
277,361,092 *1B401D383966154882DF64C12C148B6058AA31C2 ASKINEK405
277,361,093 *1B4D7C7598FDBC73D8F761C713FE1C3B1714512D askisha2
277,361,094 *1B44D386D657D9B1FC584A2EC0A68BED8E916DAC åskiter
277,361,095 *1B4FFE0CE9C5EA465703A0D82B7CB72B202BA01E ASkKQ
277,361,096 *1B47E97BAD9C007540543F862CA3488DFD513453 ASkmr
277,361,097 *1B4CFAC3C641EE2397FFB416D02EBC80596DEFBF AS.Kn
277,361,098 *1B437E0A293933C89922295217E5B5D866CE79DA A"skN
277,361,099 *1B42B41C2FC80E614B9D730407F38D6D8DE308C1 Askoymeno3
277,361,100 *1B47311447C6F7B9E493F2C5EEC03AAD8AB77DBA A%Skp
277,361,101 *1B40878C7D8246EDC9DA03B6CF6D284CFC97CC6A ask:p
277,361,102 *1B475B24D888E63409EBBE4DC5C3D9A30BE8F164 AskqX
277,361,103 *1B477D2709EB5B88CBA93B01E4F0568FC5450496 askrenlola
277,361,104 *1B4A0185EF66E421F34BFBD50C66821CBA740685 ASKu,
277,361,105 *1B455275E2A1B53823CB6074FF1DBE66EDF225F4 [email protected]
277,361,106 *1B4737ECC426518E3508E914158858175FE26214 AsKw%
277,361,107 *1B45E17AF38BC8165FE13CD39561F1AA94414166 As%KZ
277,361,108 *1B44E7A555A91541CB5FCDDEB7DEB4B31EFD6A6E A?_SL
277,361,109 *1B42D2704DE2C761D2727665294100436E2F8494 Asl77
277,361,110 *1B465C7D5C351AD02DB002FC6992DC24B91C200E AsL9f
277,361,111 *1B4662340D6423FB76E5EEA388322D112BF07240 aslam omaid
277,361,112 *1B446815DE47D54DDFA5BBA75B77226693140EDE A)slB
277,361,113 *1B44CD0416449501515202C4EBA4DD4B84F1625D ASLF7
277,361,114 *1B4C250D5F53C40E12FF3D2DD2E10A56E1A55CA6 ASLIu
277,361,115 *1B46DD6DFA018B74D639F0FC23D55AA8CA0756F9 AsL.L
277,361,116 *1B49003B7B90959921D680246FC9F036717DD92F Aslp;
277,361,117 *1B4D8FEF74FF6D482F2BD2F4032DA87E8959E5C0 ASltD
277,361,118 *1B4E2878BD277DE80F82D071F840AE3456737DEB ASL!U
277,361,119 *1B4BAB477FBD6071E7D61B37CF2054890EB945EE ASlv&
277,361,120 *1B41A3B287808B95C566855A12EC0F4E47FE9232 A#sLv
277,361,121 *1B438444E02A7304C2072587D78C3B173E17A8EE As!Lw
277,361,122 *1B4564C517CBC6DD10B2E74AE46460C2F50A368C aslyn02
277,361,123 *1B443393228C4B4E12CF8B523575566A1D62DDE0 aslytl
277,361,124 *1B4C0FEB8F816FA1DD086819D2CC182C5DC063E0 AslZ;
277,361,125 *1B48FEF0D09E8EAC8DA62E90D8485ABC02755059 AS)_M
277,361,126 *1B42183C73B58C77F7D86861B4D9EDBAC76B55A9 AsM-
277,361,127 *1B4BFC7E9637308495421884B1EF3FAF8A646F66 As/m4
277,361,128 *1B4A7827D333511E14AF3C863602B6BC167E6AC0 ASM:7
277,361,129 *1B4E2ED544D134442F650CF54C93BAE43E08B0E6 AsM,7
277,361,130 *1B433461E6BE1099B908A0BD0FE09089E699A278 As=m8
277,361,131 *1B47A339B33CE7AD3A6C0463D29DE3ABA01D2645 ASMaE
277,361,132 *1B4CF058011FABACCBE5E8A4F683EAAECB5FE2C0 ASMAKAT
277,361,133 *1B4E11F82CAAA35EAD5BF552650C6F3DE0AA028C asmamıştır
277,361,134 *1B43471D334F0FBBE1FD86F56BF0CAC7F12789AA AsManyofYouasHaveBeenBaptized(II)
277,361,135 *1B446F212E8AB1A752D08CB8E5A7C3EDD88463D4 asMclachlan
277,361,136 *1B4156AAF6683FF8A0F82D05D37BE508770EC228 A!SMf
277,361,137 *1B4CCCBB4AF9091466A782CF19630B4782D1C45C A;sMf
277,361,138 *1B48034BA6F8ADD6B03DE9CCEFB098453EA25115 [email protected]
277,361,139 *1B4EB1ACB1E4931A528A54C7C3D3ADD0E6545EB8 ASmilingFaceBringsHappiness
277,361,140 *1B4A60EC7CFC2BE4832DF5259C74AF7E61B1435C AsmodeusRising
277,361,141 *1B421D6DC228A943B0F372743C2F0B02E5337FF7 ASMoT
277,361,142 *1B4293BEB7F352DCCF1760B488F1CDE9B4A0A130 ASMOTHEOS
277,361,143 *1B4590CCE553B8F78516A982F37F678DC7A55E02 AsM&P
277,361,144 *1B4E7E2370B7CA0945BE132C395D4BF81EB25210 A+sMq
277,361,145 *1B43F86F8D4C83F42AD5645430EAD19C10B2377D asmrf
277,361,146 *1B4B606999659D8DB9285BB3E68BE077DD570A6F asmty
277,361,147 *1B441C9BD99865F433670531A117060C9DE34768 Asmyukto8
277,361,148 *1B456C43380AC975EADB231423479AE4B1374077 AS;N
277,361,149 *1B45D29FF5C0408164F62463FD5384C6BDC4B8E9 ASN&%
277,361,150 *1B4F4D2EC217D11CD9BD2B5FC393DDFAF54BAB68 Asn,
277,361,151 *1B4F50DFD2C5398CB855122649F32F3069CFDDBE AsN7A
277,361,152 *1B4B804D937963E10BF56AF6B6D20D2889EA215C Asnaataam7
277,361,153 *1B4ABB890637C0B34D4962E4BE4D5FE8DDBF822F ASNAh
277,361,154 *1B4C7231DD6E7A55E4954D11ED7AC0A26CE99C61 Asnakkons
277,361,155 *1B4C600FBA9D590BEE8F2F534E9CD4D32BBF4E3F Asnapato2
277,361,156 *1B4A33A10700CB5701F0BC7D29D1236866854D95 asnearg5
277,361,157 *1B4286DFE5672F63C35E8E8BFA84CD7D638B4184 Asneenit9
277,361,158 *1B4A47BCB516ECC49E1D7C6F7FFD25F2DD336F9F Asneimou
277,361,159 *1B437FDEAD0CE51EB28B2EAB5C85BB31713A8EF5 Asnemiat2
277,361,160 *1B47925F8ABD5C7CDE89502B0EB82E0DE8808A5A asneros6
277,361,161 *1B4320BBA5F7D7A299EBD55E01E827AF4AB31BC6 asnmink
277,361,162 *1B4AFC8FC405F9FD24092225A8C972E17C384A81 asnnite
277,361,163 *1B4273EC5D64ABE56DE76C903567A929E2502285 ASNOITAREDISNOC
277,361,164 *1B4CAA0EADD0EB32DEFBDA28829BE0C532122312 asnpyn
277,361,165 *1B4AFB89974C10C3821D362B9526449989881A4C ASNQv
277,361,166 *1B4CDB61DD8FE1AB1719D3C519AE83B5C2FC3D24 Asnyder9
277,361,167 *1B4787A80433EF785036230672A2EC085DA75CA3 A%S+O
277,361,168 *1B487D0985322B568AE9CDDA9494951DD05539F1 AsO'
277,361,169 *1B4A59BD92F86B88B7A62ECCD3763C0C30B646D2 ASO2G
277,361,170 *1B42EE0B9A347F73B438B59462AE32BB571D2D87 ASo5D
277,361,171 *1B4498AB1642F52D3B5377EDD0624BC8F5B61FDE A?SoA
277,361,172 *1B42CC027A65F73349B01EB07E002ABB55531464 asoalho
277,361,173 *1B4BBEFC66C38FB077D5AD0460DCF7D1194385B8 [email protected]
277,361,174 *1B483701B86BBBA6FE04103E873CE7C82DCEB5DD asociadosbaraldo
277,361,175 *1B466C12904D02E3CDD4DF0BB7C616041F7773B7 Asociare9
277,361,176 *1B4923AF47E9AF339DF26727CC9BCAB017B8454A Asocjacjonizm
277,361,177 *1B464E2DF0C683838FA989AACDA5739CB3AA5AB3 AsOG/
277,361,178 *1B4BCE86598815E216FFBB3BF0D2FFCF63C17347 Asogenic2
277,361,179 *1B452E045048556730D9530EBB7EA9E24ECE9FCE ASOJIVasAJi
277,361,180 *1B4F26E7334BDCD022E10D55268DC8D5049F6554 AS/Ol
277,361,181 *1B48F3B3CCCC49C4F64DFC0AAD36DB523AAA5D0E asolara7
277,361,182 *1B424D873E37CEEFF819B5DA136CEA3871D33F3D asomapahs
277,361,183 *1B41551BDAF00D974A6F3EE0430DBD2B1F6EEA42 Asomrnho3
277,361,184 *1B473F40C65A6DB65650363427B55F5DA62F2FB7 A Song of Mr. Robert Parsons
277,361,185 *1B4983AB29F3E738917BA37DE10C42308572F756 [email protected]
277,361,186 *1B4322E98D1E80B37574E4D3D846CD6EAF365E3C Asopmoc3
277,361,187 *1B4852061AC2F11E9AF2BFF4DC5525C14D22A812 ASo$Q
277,361,188 *1B4ABD285B22F3A4C266E87E7C16CFEAAAEBB9C6 ASORDARES
277,361,189 *1B46A51F28B9597681208A1999D2FBFD4F78FCB6 ASORSBH
277,361,190 *1B4A3491E20F310C958B010C164488D3E8068CC0 A#SOs
277,361,191 *1B4203513752D15C020F0CB4CC55C7C623BCCCA9 ASOSD
277,361,192 *1B4A9EC50A225A51069715E4F14A2E52A6809BDC ASOUND3400_
277,361,193 *1B4F2C91A2DBF8EDC5FF7CF13D5CA7E7E7992FA2 AsoWa
277,361,194 *1B41CD0B86F5752C956CB216737FA414E2A76832 Asoylye4
277,361,195 *1B40BACE012D694C3F46656E8136F675E638CF26 A<SP
277,361,196 *1B40805826DC48487CDE0D419C9A8856A133E0FF As
277,361,197 *1B4AD25B747F5323FB69EF933C2FB7625569972C Asp-
277,361,198 *1B4C05CF999C3B3C4EECF6718F030B69CE4EDF10 A=Sp0
277,361,199 *1B4A1C93E60016CC1DCD5C56C3FABCDD384EFE0C AS$p8
277,361,200 *1B4277F74F5798655F4D5705E915BC061CB3AC37 aspando
277,361,201 *1B40C4ACD611407A60B7FBFA14AB8C1A50178656 Asparnu
277,361,202 *1B45D8D7FF2247C3D3A09388E5F1164CB4557B15 Aspatoi9
277,361,203 *1B4B87478D3B40ED6D7EC69531D90255888D2BF4 AsPbE
277,361,204 *1B4ACC90F78395BCCC40B4C5C5F5BF62293F9496 ASPbU
277,361,205 *1B4F9FD8F048E4BC0CAFF580EEEDCA0F62779731 aspect.comwww
277,361,206 *1B4AE6B95261E1916736D453D3B75BC06DA02B21 aspekteiksi
277,361,207 *1B447A50403D12BFC9741DD4856A14E5EEE4A214 Aspencoco5
277,361,208 *1B417E9AC30E7988277CA9F82A8D154FB9E50540 Aspergetaart
277,361,209 *1B488A215D8AD94A0784FB9E58B630146C1AD2C4 ASPfv
277,361,210 *1B4DC8EBBDEF3043B9E687E16E414D3009EA27AA asph0d31i
277,361,211 *1B4860134D69AA989E945327817270F0951D339A Asphaltwerker
277,361,212 *1B4E6FADBCFC8B7B2020A6C1A82C914B4D273491 aspiche2
277,361,213 *1B43AF73081325146A2C763829654A47497617B0 aspinwall8
277,361,214 *1B469995FF9737AB0D8043A5C9189AE701701BCE aspirerons3
277,361,215 *1B4FB78A2895A82E8E9E4F873C55F15432367983 [email protected]
277,361,216 *1B476750D7013199B8B48A5772D878EE46B8931A asple123
277,361,217 *1B48BE058A15E97F2EF2F6BD2E245CF9E122551F ASPn%
277,361,218 *1B43FC46413F88C15FF05A737B0D20E8804867F7 Aspolbsw6
277,361,219 *1B4C3BD6A0A7B157948C01E1E888284E53426A33 AS#pR
277,361,220 *1B43C020C1303E5CC7F59A0C85C22B6CD60E8E2F asprangs
277,361,221 *1B444E7B995AEF6C1BFC46A91024772ECA72EF42 [email protected]
277,361,222 *1B44BB30468C0E4BD9D02689B67897FACB13F2D1 Aspuration
277,361,223 *1B43D574E147FB283B95C88BA72A122F145AD802 ASpvb
277,361,224 *1B46EBC67AC67D66874390C0EAD581B1849FF9B9 A
277,361,225 *1B42DA5D2897EA9436F4A5C98448C8FE7BD959C7 A
277,361,226 *1B4150F2CB0AE1BA9A399934BE7ACEDE182E98B8 AS/_q
277,361,227 *1B42025D1114F3E969B44915E1449CC285775B06 As(,Q
277,361,228 *1B4ACB39BA264D0EEAD66630CB98B21C68CEC1C4 ASq,1
277,361,229 *1B4857728E53AA51A7F9C81CBCE421A400649334 AsQ,B
277,361,230 *1B4A46E2B28508D64ECD512C82D26DF421DD69D2 Asq/f
277,361,231 *1B44D86AA0AA0D484C6BB6B520D3C382514D144A [email protected]
277,361,232 *1B4B596C5693F17BB00A75268F1B1990F75565F0 AsQk+
277,361,233 *1B464BD7F51F60D3BDA1DF71CD89BE0E087EE5D7 AS#Qq
277,361,234 *1B4C588D20E8AAEEC5D56387969A2398A855681B ASqwert
277,361,235 *1B4B94D103CF03B1DADA85EBE37A77CF72ECA299 A;)Sr
277,361,236 *1B4F63720F2DB0E2A351CC4ABB4DFEA4C5827A8A A&sR-
277,361,237 *1B4495C3F476C57BA42FAEAC1C43534FF1C39D7F AsR%%
277,361,238 *1B4209E71B951A1F3B4003D0E5EAC8F4B72982AC As,"r
277,361,239 *1B41B8D6CA7E27B2E63752E85BB4429DD5517BF6 ASR08301982
277,361,240 *1B49DBBD2B4C66D3416FB8B7C01CAD3DF678EB8F asr99
277,361,241 *1B40087C20FBDC4B437288B47D979F8471E38D20 āsraṃs
277,361,242 *1B450CD3D900F152792D05C36BB47D93A804B1B6 [email protected]
277,361,243 *1B4B2F9297BDD7016AC6D107F9A3D4C781397D58 ASRBRICARDO
277,361,244 *1B43322116B2399DE0D1F0BE9104F282801975D0 ASREP 1
277,361,245 *1B49EFC783EB0F9FAE54ED8EA6444A7AFA7A484A ASRhD
277,361,246 *1B4536DDA01994343D19D84F364F1AB85FE39E13 AsrL+
277,361,247 *1B4CBC4D228A893E03E1915A9FF324FE150E1F30 Asrotcaves
277,361,248 *1B4C7EBFE028F82C3FDC4E1F4784762A4E29F9F5 Asr;p
277,361,249 *1B4797363FFCB76AB794A7CAD478D3489116ECE5 asrwxce9
277,361,250 *1B4BAF6CEEF98EDD6ACB1BF998133F9BBA839D61 ASs
277,361,251 *1B40400680BD58730ED433823D486D9827B8FD51 A%
277,361,252 *1B48E70170298F56AA95B92DCD11863D3CC9B2B1 ASs=!
277,361,253 *1B45E7D2297CB0A830009C352B8467382D088404 A;ss,
277,361,254 *1B4DFCD9E39774A43FB69E6F3B347867675F591D ass0la7i
277,361,255 *1B4AD381E6CAC776B0C1592838AFBD7BA4D2D348 ass0r7edness
277,361,256 *1B41E41EF5EB17D873B373B668E5D8D5A3410E60 ass3s7ava
277,361,257 *1B4E065A06AC604EA97908B2C9936EF2DCC1886B ASs81
277,361,258 *1B4FCEDD27A9A237AD9CC69563833C83D3C07782 Assacin4
277,361,259 *1B4A4D7892C41F40146A9265745FDB1F8A0A1817 Assagaais4
277,361,260 *1B4DCBF50B0F6FAAD7937ECC56D7499388552EBE assaggiati9
277,361,261 *1B4ED40F5EE8D798960B152E3EF850737A6B8261 ASSAHCNE
277,361,262 *1B47D4CAF55EFA774145C5582079C190F4FE79C1 assalariaramos1
277,361,263 *1B481B489A6D529CDA4EC36018A7EA3D79167E4D Assamaj7
277,361,264 *1B45EC5501E0316337469094B86439DF2128A446 ASSAMGIRL
277,361,265 *1B42080E1EF5D5D4037B27AE78FF2DB2EBA60875 ASSAMMOC
277,361,266 *1B4EFBC71D392BD8B574F1700CF037C1E19A5CBE assaorg
277,361,267 *1B4B5B178F6A14371BC5B5FF60199ED41CB1BA49 Assapanic2
277,361,268 *1B46DD922CAD13CD9986752A2CA7A7A083BDCE03 assaporo3
277,361,269 *1B4917B3005932FA5C6474BA307BC31070E74B12 Assasouk5
277,361,270 *1B40329CA29F3B7B8FF6531EB20D836524D4AC4B Assassins8
277,361,271 *1B44DCC986F2939E5C7AAB2C467A865EAF33EB6C Assauoir6
277,361,272 *1B49B2032C510017025B4C6A0388B27228ACDC29 assaverc2
277,361,273 *1B4221E6F6EF10AB9A39C29F78D3CEF5A0AA1F50 AS-SAYED
277,361,274 *1B491D7ED2A5ACBB96EC7C20F26CEFFD1B24D83A assbenny4
277,361,275 *1B4C72CBAE7F8AD124EECF6A33F4985E7CCF1DD4 asscasio0
277,361,276 *1B480A77F093356DB7FC8751F4EF0EBAAA352DBB Assechait?
277,361,277 *1B41948058A92A4A216A9295F4A2AFA628A88F74 Assedlab0
277,361,278 *1B40743D608ACFC0E42BBC60B0898309CA9B8C09 assegnamen+0
277,361,279 *1B4C384AD78D8A573D48B4C83C1C3FF6381318EB Asselluses
277,361,280 *1B4C8EBF9F0D388CF2CECE06E13A9FBA967A60F8 ASSELTS
277,361,281 *1B4D0CCA7768A82787366CC688B10F00036D1679 Assemblyline
277,361,282 *1B49663649F5A533F0C22EDC35E5ECE95CB2A27C assembly.she
277,361,283 *1B47360CF7164D63ADAAFC88DFE40FDFFD5D431E assentatious5
277,361,284 *1B455832383E5B8F9C39461B250299B1B588DCD9 assernhled
277,361,285 *1B49038D561A130877D85FF6C34372A7B64D9C44 Assesiol2
277,361,286 *1B4EDA43A2EF2F0514900798A05CBB162D848B24 assess-a
277,361,287 *1B482E8100EC971945ECAA9F8E173B98113BC86F assessably1
277,361,288 *1B448721E9ED44CC5C074C6266548B0EB4947DA7 Assesterei0
277,361,289 *1B4686BE9B0CE66CBC07DC7A4B566432EB3A8A9F [email protected]
277,361,290 *1B4A34331574395121E4DD2DAA2194AA9B8A1200 [email protected]
277,361,291 *1B49A8652ED8BF107BA6784CF13D2A2E40EC5CB3 assetsm8
277,361,292 *1B46D6E270AA52BF52897E6BB79D365D46DA84A4 Assevera+!on
277,361,293 *1B49D46038870A3E896D0C7AA76F40CB585C4EEF Assflyers5
277,361,294 *1B4548DDB5EED73BE1F9B54FEA8DE19A6D92FBBD assheads8
277,361,295 *1B47FC980011F2A47134126012401CBF44271A5F Assholeh1
277,361,296 *1B4C1A79539B5878B0E661A5D62DDB9AA492005E ASSHOLEJ
277,361,297 *1B47D2BF36679B628E0FE088C7817BB1AD564AA9 Assiamsy4
277,361,298 *1B4E1BDD77FB0FB6F250C7249D454B732F22AF7B Assieiprs
277,361,299 *1B48C99AF46E3578B3EBD5536FED7390B69732F4 Assiftenzarzt
277,361,300 *1B497490B1DEED4AB2A7E5D0F962DDDFDF7CE607 Assikiis4
277,361,301 *1B44152D34BAD7308AF3891D63E6380822A94D6A assilamed
277,361,302 *1B4795AD0DD63CCB46B80B3C0F73C73F48DAB1B7 assimilation crisis
277,361,303 *1B4DA024F56C94C41CF456B1569DF01118F10D34 assimileerden2
277,361,304 *1B4099FFE2D61C2F50B4C4A4A1258319EC1DE74E Assinnut5
277,361,305 *1B4FB2F48A79004C68945374B35F5E932BFFDF91 assistem123
277,361,306 *1B4735C2E7729FC17EC4D086F11AA904F24C00D2 Assiutov9
277,361,307 *1B481002DAB06188805CF23899A8964999D62959 Assjake7
277,361,308 *1B46D0B6282238B93B1BA11B5AADFE0BB45F297A assjesus5
277,361,309 *1B41AC45E2CF9A8109B437206252C8CFF2FD00BE Asslakota9
277,361,310 *1B4951441B13997C940F9CBDB0E0598B2C09E041 aSSmuNcH
277,361,311 *1B46460845081BE475400CDD0503DCE6DC185889 ASSNs
277,361,312 *1B40822718CC8FAE361F2218210E367EF8A2489C Ass#O
277,361,313 *1B497841CCBAF4A21484C86DEB9B5C5CF431F741 associated—the
277,361,314 *1B493D68097B897BE58C181BD574DC38D65A962F Association9
277,361,315 *1B4CC2A60F23DCFBC1A0FB6C5D78853E66F35782 Association)是一个由
277,361,316 *1B414FD3FF06A3BC4FAE7B3442999F26BFF3744C associativeassociative
277,361,317 *1B462B8BFE1386802791F9B099E688D06C68DDB5 Associeis5
277,361,318 *1B4595D2C96BF1074D54ED3B4F1008E7015EB9D4 Associers2
277,361,319 *1B49D10DDB9654EDC1AF00A3BF46963FBA1133CA Assodamm2
277,361,320 *1B495A8639BE676ACED5297CE52A92DC9A85B1CB Assodass8
277,361,321 *1B419DDB0EB5D5BA34A583D7C3F529D013707F75 Assodati
277,361,322 *1B457BE5FFCC54862B57FB929583B7FFD058D837 Assoituas
277,361,323 *1B406BA7903F8E61101E8926E55C3D0A85AE7EE9 Assordavano
277,361,324 *1B4DC70C2A93B1E06941C1585DCBDD46D1DB6148 assorted)(*
277,361,325 *1B4DA397B831568C14E5C2DDDF51B36310B26095 ASSORTIRAIS?
277,361,326 *1B43E721CFF2B3B716C51735FC5803438EAB78F9 ASSOUFI
277,361,327 *1B489DC309A4B2B70020050C7773066733ACE5CF assouplissons4
277,361,328 *1B486C66B34F9392C237DA9AE1736DF44F1DD329 Assoxford8
277,361,329 *1B4EBD368F5F291DB40DE82E239D7D99519FFD70 Assoziationsverträge
277,361,330 *1B48498F18EE9884291E94644834AFA9A0DE2BFF asspeace0
277,361,331 *1B4D8425E404168C3D5F03813A2BC50F1D427E40 Asspedroed
277,361,332 *1B4559A2EE7D5578ABB06C722912B8A729655588 Assqwert
277,361,333 *1B4013018722614065A8D513FA625DE018F2FEF7 AssRP
277,361,334 *1B48610C7147BD07CB4333453A33AE751B6D03F2 Asssarah9
277,361,335 *1B4CD3BAF58214203EB074B2E740EBC87F15164D ASST5
277,361,336 *1B4EA0A22452B7BC8951E0F769F1807D5FB4E41E asstcat6
277,361,337 *1B4C28C97BDDF4ECF6079A0A039FD1A7DF9177EE ASS&TITIS
277,361,338 *1B40FC0FD54D9CF0F4E88C1B93410A1D3F8209CA Assudnam0
277,361,339 *1B4C9AC1F3BC08267C28F12291956192F11186E0 assujettirait0
277,361,340 *1B430394DFD02CCE3B2C6C9B89743D9F6AC9DAEF Assumerle2
277,361,341 *1B4653E03EB03AEDBF863360EFC75B7CD95EC164 as-sunnah
277,361,342 *1B4C3D222639FC9B5CD96683CD204000DD87A445 assunta0
277,361,343 *1B4F0E7AE8993FF54086D4F25B3288DA2F934D1A ASSURANCE IS DESIRED.
277,361,344 *1B4FA1D83A50A1DAA766510EDA6C90272A3F5E7C assurat2
277,361,345 *1B46E4AA08CC478AA4E2EEAA6E8421C94F8D128F ASSURCREDIT
277,361,346 *1B49093CA561045B7A35AB027DBE2D85B0F6102D assurip0
277,361,347 *1B44539149A4541CEA2540B79B9F37658F761DF0 ASSURORS1
277,361,348 *1B4AB454B6C1509018699F62A33C8F1B35EF3867 Assuukka
277,361,349 *1B42C9541153A0FE0FFBEDA4F9CF181D7C39E843 A+S_T
277,361,350 *1B403E19F7F27CB8FDA58E74DF594F5BE6846700 A:S$t
277,361,351 *1B417BF80C0B977456B3D2C36D4FF4AB2D89417E A
277,361,352 *1B4610613E02E81CD3828C9DA90224140816BBC9 A(ST1
277,361,353 *1B41163B1428B1527FCE6AB5F6A8125D56F35933 ast323
277,361,354 *1B4B2034F63A35468739C7940AA0C9E9549D7856 ASt7d
277,361,355 *1B4506B32047972955B6649D01FF54A032595F0A Astableses
277,361,356 *1B4513E3808146EFA599C88D09B55EFD94FF9E65 Astapovich1958
277,361,357 *1B4F13BDA185ABB91F11EDBF9210CDF6ABA780EE astarfs
277,361,358 *1B4E789A6CE3881927EC18CE96B8AA787F4BEB13 astarur
277,361,359 *1B4F8719F9F354FAD195C631262324D719199A3E Astatizing
277,361,360 *1B41AD91B2FD0DF17E6EC6140B8E4094A3664877 astaxia7
277,361,361 *1B427A87C77868FDCB85FC507FB882C26BC0FED5 astazi»
277,361,362 *1B4A692A131AF2811E0E2DC271F0E90733AD9393 [email protected]
277,361,363 *1B4B4DB6AB656CD515E721E385D41A2BC920EF22 Asteinzing
277,361,364 *1B4044E8BDDF15442C03B1329668FA9777E1FBF4 Astenoides
277,361,365 *1B4D7E82C2BAA3A6BD98A2242AC69D687CFCD38C asterinaasterina
277,361,366 *1B486948BEAB9D2F5DBC955663C3935F65A1D6F7 asterix1967
277,361,367 *1B462139538F2444B38F28B3605098DEB883D5E7 ASTERIXN
277,361,368 *1B4F3EC57136AEF6AE192FDBF13C70829363D77E asteroids8280182900
277,361,369 *1B417160FC9C0CFC88444BAE415A0895EDFAE91F ASt&f
277,361,370 *1B402651FA606654F2A035E03A691597ADC3ABBD AStg:
277,361,371 *1B47B918BA0CD13281599AD49FE9954CE2F0D387 AStG6
277,361,372 *1B4F61D88BB203F239F0AD4F2AE3D0E026D74A56 ASTHAKONAM
277,361,373 *1B4508E8D976E5C8A81DEB4C1830732D5EF221FB Asthenopiing
277,361,374 *1B474020785F00D2705C57286CF6CAAFA86B20DC Asthmasprays
277,361,375 *1B43A96C56A287F149F114DBDFDD0029C9780B48 Astholdes
277,361,376 *1B491E2A7368215E2B70D4B1F44A304D209B97FE Asthouse4
277,361,377 *1B4A05F00B6F4317F530E25037EE756970BA5119 ASthS
277,361,378 *1B4644F7441554BCB97E388C895990141F5B2621 ASTIGMATIKARANE
277,361,379 *1B454D9F34BFE5E1F5B289B34D54FF2DC5B3ED8B Astigmatoscopies.
277,361,380 *1B432DFDA425FBC40ECB12E70AC305ADA1F600B3 ASTIGMOM
277,361,381 *1B4FC3110DEDE46B718D3B4A049EA36910585558 Astingray1
277,361,382 *1B4F9990811898B51E2E5934A4C03436C69F9BDF Astipruked
277,361,383 *1B419B3FBBC9CF5BCECCFEB4E233CC57861EBBF0 Astisti3
277,361,384 *1B4A0EF740B8B14BED23C8C5B67577E645CE1EF0 astj_hotel
277,361,385 *1B416CE3FCF28B69FB0ECB996C1DB4889FC87E3F ASTLSING
277,361,386 *1B445F76915E63F5366AC30EC4118B77D047C4AF Astmaerne2
277,361,387 *1B4390BCB22F6C2E48AD4BFE1FACBCBB03C52B5C a st. malo, beau port de mer (a)
277,361,388 *1B454471AE986B0D2A0EF91D639BF6BE7E9F6574 Astmie
277,361,389 *1B41559242E3B9AFA228AC8AE8D52FF885C58B9E Astokems
277,361,390 *1B4DE95A6080979A57DACF7EFC96CB030D3F780A Åstols
277,361,391 *1B491DE0AEC989C6AC22A72F2BBDCF2E46769514 astond8
277,361,392 *1B47AF8EECB3B2BD6B34F843DC47DD98949A068B astonne8
277,361,393 *1B4CB618A7E3EAAB78D0EEB077EF3D50DF0FD3AA astonstation
277,361,394 *1B4447DD92E25D5BCF0A7A03C383A1D6B22D9DD0 ASTON-THE-ONLY-WOMEN-I-MEET-ARE
277,361,395 *1B4B4B35A2B9B06001374E8D224212146DE3EEE6 astonying3
277,361,396 *1B4BD534DDB572E8217E379B683E5B8C3D3A9219 astosta9
277,361,397 *1B4557610E87857F5C7B57DF210B46B19DF4158E astottara-sata
277,361,398 *1B4EBF77B4834B60103A4A5F87862970EBA858BB Astracan8
277,361,399 *1B49CBDABDF26B3CB4798EB1F102D3BA28716BB3 Astrakhan»
277,361,400 *1B4A36A761B408B3B1BA39FFAE9A46D83F18ABFA Astrangle1
277,361,401 *1B4ADCAACE4D22AC9667C8C1CBEE30C76FE4F48D astraone
277,361,402 *1B4B42EB6F90FA11C2C16ACB9733585F8448E446 Astrashe
277,361,403 *1B40F3984EEDA9D4C3CFE0678D07E28CDE99729D astrego
277,361,404 *1B4E5639E3E1ECC9BEC6DA9F3699AFFEB838D2A4 ASTRIDGLX
277,361,405 *1B409162673E459E0A085201A447CD256ECA8AFA [email protected]
277,361,406 *1B4922223F630F0B89FE17DAD1EFAF99BF976BA7 ASTROGATE5
277,361,407 *1B466CC5F375A618D3808B774D509308C1E6683F astroie8
277,361,408 *1B4E80A346B4909ACEF7588949B1B878F590F7B0 astroliabijoje
277,361,409 *1B4C2935A809535B443BC5BFF1880289A861D5D4 astromancias123
277,361,410 *1B4930D38E3156FEFD5EC96BEE632CDC7FAD257F astrometrisches
277,361,411 *1B4BE3F11D40F93CE7AA32080F78EE3980FE0E1F astronautyczna
277,361,412 *1B45BD0CA88D69BF1FD021F1ED4FF21636C8967B Astronmiam
277,361,413 *1B4B38BA86A698D1DC64BC618EE7D0B280F659E7 astronomers.2
277,361,414 *1B4341B857DE10F92827942A4E1BA0887342F584 astronomiqué
277,361,415 *1B4F40C4CD14B8E5AE23EEA38431F8C261D25574 astropartícula
277,361,416 *1B4183E09A926B9DEECB7BAA4AE0BC62DCC9CBAA Astrotur7
277,361,417 *1B44FE53B9C6A986119B11A2D92155F09ED34EDA Astroturf8
277,361,418 *1B4AAC6E65A234D2975F4C4C12139C5450B316B7 AstU6
277,361,419 *1B439421D15427D4ADBF3969BAD429EE15AD4903 asturyek
277,361,420 *1B4F29EBF57445F1432B5C888DD183AAFABE382C astuscience.wordpress.com
277,361,421 *1B4D45A782878A6D0B82E41E7945BF6EC4744003 [email protected]
277,361,422 *1B42E68560C169760CAE7518EFF3E689897EB448 Astyasaadhyam
277,361,423 *1B4EB1EEAE60C4D4343D06E63B786910C2DA4946 Astynteds
277,361,424 *1B4E926E04E24E5D869ABDE0C198FC7D1EA56BC0 Astyochea2
277,361,425 *1B41AE3F8BA1E481692C50FFE38DF72AA1E47B11 AS;!U
277,361,426 *1B4AE142E3BBE64CB09650B83C117F753C935509 asueruses
277,361,427 *1B4AF36E715FF30A171D5240EFF2C9BC64604A78 Asuetihw1
277,361,428 *1B470582BF5572F91522E2408651BAEB24327417 AS!uh
277,361,429 *1B4DFAAD308E0059746454AA3D7D4C13D8A750B8 [email protected]
277,361,430 *1B4DDE5F48939BA452C21463CB7260242761CA8A Asuintor2
277,361,431 *1B481BA69B6F47C2160B41954F94CB874EF2783E asùnjálá
277,361,432 *1B4B1AB1FC005B96A08F6897A53660D3DDA6CFC8 Asuntorahoituksen
277,361,433 *1B4B8D7049D7FE1905986B3BB93E899BC1EEF0F3 A+SUP
277,361,434 *1B4F2470B9838568AB2957ADF197940FD9A88B23 asurax.bbs
277,361,435 *1B443D7C217174671A31FC064DABE449F7075D4F asus_1988
277,361,436 *1B477E872ECA7D43DCC46A037EF15FDE0AAB9A37 Asussips
277,361,437 *1B45AFF8D37635B8A31A938FB58D370EDE0ED709 asutajaliige
277,361,438 *1B47A61D2B3A74E84C9FC1859AD3CB84EE494447 As
277,361,439 *1B4118D18F54A615317414DAA4545C70A2D046DC As(uu
277,361,440 *1B4BCF8D3337E750C0F737BE6D27429620478EF8 AS.uw
277,361,441 *1B45399D80D6FF6351F7FC569886105973438F9D ASv:.
277,361,442 *1B44F0976CB1E730C1BE9F9B0898C622119CD36A aśvādhika
277,361,443 *1B41B6270ED879B4761938AEC6940A2DBA498EF0 ASv-C
277,361,444 *1B4E6CECC1268487D96430324F37DDCA9A23652F AS;vd
277,361,445 *1B4EB9B9EDA6F7CA46C71A8EADC0236CF1E08890 Asventres
277,361,446 *1B4393AC84C7DC9BAB305900FA79CA16DAAE2B6B AsVFd
277,361,447 *1B4A416BB969BF6200C79F9210187A5232B1F50E āśvīna
277,361,448 *1B46DE4AF1348AC9F8C4C82DBEF406491BB8F05E A(SVM
277,361,449 *1B4643C569281F3DF2D6ACDCD6BB65FDB2ACE059 ASVN=
277,361,450 *1B4B90059E893B3D49FDB916C4BAC0CA73D6CA67 Asvoihins
277,361,451 *1B45BB15433A7616CA6A0BCF86D29E7810DB7D86 A+sVQ
277,361,452 *1B45E504A71936988A518781A3B786D320447F0A ASvrR
277,361,453 *1B4358022C96C9E33249EAD8FDC4947DB0F84AFE Asv"T
277,361,454 *1B4062F3652EEFD9824762D81183618262A3CA11 AsVVp
277,361,455 *1B47E59D87B5993F68F6463458B567514A8523CB ASvW2
277,361,456 *1B4E9D7E806F6D347656C48C4D09B3E4514E247B Asvw8
277,361,457 *1B4095DC3A879E7F08F6261C1839039691F3CAB3 [email protected]
277,361,458 *1B4799B509C73E632180EEDE92C43F8CD5DD4659 As!=W
277,361,459 *1B4E89D779CD37BAE3EF5CB9D339A786EC588F2C Asw8i
277,361,460 *1B4A2A20B76DEFCC90AF3859BE5FC4BF4FE20501 Aswandam
277,361,461 *1B41FE37B881CB8EF2B8A6B4F3DA9F0736C08003 [email protected]
277,361,462 *1B4C59B25FAB9D2C035E97DC8C079B5061D349B5 A!SWe
277,361,463 *1B48BCE0681E6F3EA45A948F7090ABBB2EDEBB27 Asweltan8
277,361,464 *1B431A18CAF8D563EE8A560827C167F961B5FCDE ASWEn
277,361,465 *1B4C6D364B3FAB5716EB90156FBFF46ABEF09F85 Aswgr
277,361,466 *1B4FBE6174CE64A0173C29F487EEAD883650BE64 A/sWl
277,361,467 *1B43BD77BCFC9E3148E89F238A2935E4D7B936F4 AswM"
277,361,468 *1B4F0FA523EDEA0814D36B485E74D037CD7F0A0F AS,Wr
277,361,469 *1B47FEE2A565CF43833BF1E249CE186C28F26169 AS
277,361,470 *1B485F791D10E4D34BEE1AF84D320BFA3C6DE703 As=WV
277,361,471 *1B4EFCAB1D1916A2E41E5DA1CE9905A4C4F93EB0 As"wW
277,361,472 *1B471657E2D3D22029CEFD9D13B80F29E5653913 A?sX0
277,361,473 *1B4A33E556510F6B41410A24143CC35B48AB9946 As"XE
277,361,474 *1B43A51E8A9C6285211FFCA4D1390C91C226611F asxetws6
277,361,475 *1B4A9F14AE270A492BDF00EA325E3C96A91996BC A#SXG
277,361,476 *1B49C00D23408A2BBD219A9BEC1B509915D11CDB As=Xn
277,361,477 *1B44EF82D0397EA85061AFFA6295FB441B3AE6BD As:Xp
277,361,478 *1B4BAAFF57E7115CBF2CB23C6C252741ED6D8DA3 AsXs8
277,361,479 *1B49C645AE551F15C9AE0BA2C041385F31AA48AD [email protected]
277,361,480 *1B46BA088EACE31DCD5EAC91A4EEBBC0ADA41AA1 AS-Y.
277,361,481 *1B45D9D01CA6F97FAB4F79412B30A4369F42A131 AS&Y:
277,361,482 *1B4B8D8E63C8FE9A79D07B1BE2437F89FCF4B79F As(,Y
277,361,483 *1B4539935DD9F7A678980343120CA754917C11BA AsY7V
277,361,484 *1B409F9E0B4DE1B844FC5EFA023B2466D8D40C87 AsY%A
277,361,485 *1B4FC9E81D6ECC8C9441DE7C5D1CAF1C8C9EE71B ASYEB
277,361,486 *1B48BF98FCD1F2B70BFADD6E6112FA392A1B0345 AS)Yg
277,361,487 *1B49E27F83BD7585F75C06A75BF3B94A76B7D48D Asyhpiping
277,361,488 *1B419F02D58B9D1954E3D7C0C71E776F2D2CC4E2 ASYI9
277,361,489 *1B4049D1377D959198394C982414446E4E4A12C3 asymptote5
277,361,490 *1B46037B751C4EB114D9AF6F272C6AA9E100B244 A Synthesis of Previously Unknown Substances
277,361,491 *1B4DB18C8BA392ECC85BFCB11D52B9014CDEA5FA asypygupe123
277,361,492 *1B40906BCD93ED4A70AA2EE07010670C85F6AF02 [email protected]
277,361,493 *1B4A0965AF8FFBAB6B94006682211D5A832B7E44 Asyrmata7
277,361,494 *1B4BDBB21D58696AE851D6CA5D1521DD117E1438 ASZ6C
277,361,495 *1B45918BAD9A3CB27A0487D24CE5F4879D9E3047 AsZgQ
277,361,496 *1B4FAC7A530E53E204DC954562CE8922911C5D86 ASZjR
277,361,497 *1B4D8EDEB43DB7C8CF925FC9C22385866763E391 AsZK#
277,361,498 *1B47BB4BE30EEB34A0D4176D1D8D63EFFF76668E AsZn=
277,361,499 *1B4755991248591A5E0C1732990453EDF65006C9 A;"T.
277,361,500 *1B4AFC6A25AF2EAAAB9DBECFE800FE47E8619B01 A#??T
277,361,501 *1B4CE510D2B4AEF3DBFFBE602AB62401CFEFB3B8 A,,t(
277,361,502 *1B4E69E8D7377DC2AC7D0A42C00184E48A7CF45F A:+t)
277,361,503 *1B4B2724F8AEE272467CA1CB550CD49124C64E5C A?-;t
277,361,504 *1B49E1B6C9B6A31BFB3C00DE5ECB0F465A4AEE3B At=),
277,361,505 *1B45333D77F18EF42FA31F8FF27F06A8C4298A22 At+.
277,361,506 *1B4EFCB3621D5FDB8E4DC61A039C11DD177D33FB a==t
277,361,507 *1B4CBC0F5BC4300ECCD38929C162C935561D03C8 AT01r
277,361,508 *1B456BBD7431B20519024D06290FE4E4EB989B85 At09_
277,361,509 *1B439EFBB0D80994BC1D5EAD0D162C4A5610522B At0Q6
277,361,510 *1B4AAC10FBCDDDF3C2570E24F90842E7D935D414 A.t0r
277,361,511 *1B4C7820E8061F60F277760348E3A308A6CB1F17 At0Wj
277,361,512 *1B4FA28A8E8208C44F2B45C27D6F6C65E07DE6D5 AT12w
277,361,513 *1B45A9A3446D5E81F078B96AB9DA29EFF5129153 at1g76370_draft
277,361,514 *1B455AE8ADDD205F15789A9888D6033998B75BA3 AT1-P
277,361,515 *1B46E6CFF1E3F9F6A02ABCABEFF4EAE6F32EDA87 A/t"2
277,361,516 *1B456C6F2883C73F7831DC05695325539ECB8F0A At&2-
277,361,517 *1B425CB77BD8D70910D6EDA8F335B898831BECAA AT26a
277,361,518 *1B47FC5CFFA3285C594FD7614F9A5883615A76A5 at2g27510.1
277,361,519 *1B4E42FE2E906457F1D45F08158137BD942A80DC At2lI
277,361,520 *1B46AC89504231FACF375669F1BA3BC3AA879B94 At:3?
277,361,521 *1B451108C56DD76F2A199FBD34674DF4810BF8C9 At/3G
277,361,522 *1B438F27E5A8E23D61754D7596154A99A4C95591 at3g14390_draft
277,361,523 *1B43A18600B842A4E4EDF1CCC4C3E3007EDF0DFD AT3KT
277,361,524 *1B4DA41BF644ECD2A98432AFBDB82185AFEFB5A7 At3Wg
277,361,525 *1B4D63D0DA7E8391B60DF4EA857F39164F350AFD at440098
277,361,526 *1B4294C38A8D2927FC0D7CB6E0AEF4B70B4B2C87 AT4/Q
277,361,527 *1B41ED907DA623B605D86E06E6E3E46729A32023 At4tH
277,361,528 *1B47D1FE2D4A7E11D1CE534762400A6D685344EA AT)5#
277,361,529 *1B4674A4F66348F767BF289082CBB799D19B20B3 AT5++
277,361,530 *1B4AEBBD5772FE83572C729091F0A5120FF05BB5 At5
277,361,531 *1B4D809F0D574F9B448C3C84483C35E0AFA0E902 AT"59
277,361,532 *1B43B1E1220EB80D59A7120CA12EEB0C40FB1C7A at5g62575.1
277,361,533 *1B441F86C7512757796B63E54E80A7CC399DAC0F at5g67110
277,361,534 *1B45A10A8E01AB31F25FA356463F1FF6E243F7AA [email protected]
277,361,535 *1B4E202770DBEA0B8A07B1497D46D9CBA59CFD18 AT6oS
277,361,536 *1B46F69F739DB4F798D9018B378B5F7858C20052 At6u3
277,361,537 *1B45CF9790E85AA9B868E261ED6C92D55719B127 At$7
277,361,538 *1B47438808AF6FDAA5FD0C51CB3DAF6C199490BC AT7A%
277,361,539 *1B4E2E354BEB3DEFE1577BEC358FC4283E2E32F7 AT7lY
277,361,540 *1B4648D958A84583E4C96D49DE2DEA6B815B4FA9 At7mA
277,361,541 *1B4B55EEADB7CDAD8CDAFC91E42B096F7525F429 At7X.
277,361,542 *1B4BF1ED1507C492884C79B5D74EE9603A0B44D4 A;:T8
277,361,543 *1B4B93742896501ED8034D38ED68DA2E9A519482 AT8";
277,361,544 *1B41C4AC171DE1F5CD8CA9BE07740B5592E26BCC A+t/8
277,361,545 *1B4D1BF2CB11111CDBAC70474D4DE2CD67E983DE At=8,
277,361,546 *1B4E8C1B1B9152957B7CB2605E050255A83FC9B1 A!t82
277,361,547 *1B45517C14EA16770CFFA2EED824C120EE0689AC AT84h
277,361,548 *1B4E8DDA5440469CBCB8F7E1913DAA445FC7B2B4 AT8ZW
277,361,549 *1B4B14B02470B5C424A7EB341124FE59826D013A A=T9,
277,361,550 *1B4730BDC05FB839EC715BDEEC1AF346B36E9952 A;&t9
277,361,551 *1B42AA46D273D6DF81A22B13F28C523D1131E02A AT9GK
277,361,552 *1B44CA27694BC4690672AD449DE840E066D1BFB1 At9%o
277,361,553 *1B49B29F45BAE8AD25906961F64FB9FCA6BC67B6 A"t9S
277,361,554 *1B48ED123BBDC2889AFA4DA49306B52538C9C701 AT,9T
277,361,555 *1B4F3F33BF160A97DC0A14B19B69E395EBA9E29B A=!TA
277,361,556 *1B486CBC74E5F33F70B5A6D1B022E678083EE918 AT.$A
277,361,557 *1B4E94EEE7F22A20B9ABE2FB1F1B0A934F0A3EF7 At"A:
277,361,558 *1B40E21BD6EC96D0FAE55C6D95070E594D8042AF ATA1971
277,361,559 *1B4C28B866AE89B8BE709F6ABCA58264B08D6A2D AtAb3
277,361,560 *1B43112EB31D4E10DF326333038293C42254E487 Atacerped3
277,361,561 *1B4FE9471A9E294CC03C687F0F4301C08F9BA8BE Atadawas2
277,361,562 *1B4897927C60D076FFB9E5DFB710E9E07C90F2B1 Atadipal8
277,361,563 *1B4634CFEEFC20B935620C3779984DB9D5C362AE Atadtols
277,361,564 *1B483A1567B19F37F40F8F7E9A119FBF1CA3CF7A Ata%G
277,361,565 *1B4EBC62089FC6BC00C6939CDCC80280104D309E a-tagging
277,361,566 *1B47EA6CE4AB0E06ACD8792C129A7167DC388892 [email protected]
277,361,567 *1B41327231CF7A3E3AB984B79DD61CC5D9535290 Atagolom0
277,361,568 *1B4F976195F9149BE0DF41D33F9FCE63B79E18DD ATAHUALLPA
277,361,569 *1B441DE736873788EB81C3FE50DB341294BD4CFC ataicrauqs
277,361,570 *1B47412F0DA2ACF50BA8FA57E545107D1D70ABF9 [email protected]
277,361,571 *1B45885A1B56D8C1B2DA12245CE2EDA5B655E314 atakanakan
277,361,572 *1B4E38E68B01EB29B1FFDD9665B2F1D3BF14D2FF Atakowal9
277,361,573 *1B495859D62B55942BD74EC613EC180ECDF59A00 atakuojamajame
277,361,574 *1B48F2ADF83C8A4C1C0F3EE20EC269C68D085D1B Ataloitep2
277,361,575 *1B42EAAED2D5FCC928DC9895E2CC3DBDB303DA54 Atamoporp
277,361,576 *1B4378F4211C91EB998E1D3EF9712DFA434AA296 atamosodoP
277,361,577 *1B4DC831C4F4872E144C4C417FF15AF79E4F202F Atanasiou
277,361,578 *1B443F7E4824497CF7FED5BD6547824A12368175 Atannapps
277,361,579 *1B4078BBD6C57AA5580C19D5158EDE5145C08EC0 Ataokoka2
277,361,580 *1B49C8D15A9762AB0E848CFFD4384D13B7EB9EAE ataquero
277,361,581 *1B4EAF206C2425B5158EAAA3884E34114A476487 Atariuahed
277,361,582 *1B409B3FD7175325C7565C6CBA12F63D022F3FE0 atarned0
277,361,583 *1B4221819FD525D5A73982D701D16149536E4F6F Atarusnec2
277,361,584 *1B439B8D9B17CA23A81DA9277A3CD87634E6DDEE AT)As
277,361,585 *1B415CB180203E414F3B8AE5496484B278E9E782 Atascasting
277,361,586 *1B4843D1B82A42873C9A99E1B5065569680C3180 atasite.orgwww
277,361,587 *1B49AB4C0E65AB46DE0F4DC22E323D1BA40C963F Atasyjling
277,361,588 *1B4EA9FF377A3D65680CD91BA318B320F9E57012 ATATISOPED
277,361,589 *1B4BF797C6912D1957E2F16045C312AC6559B140 atatouvs9
277,361,590 *1B4BFD7386B2078984186A35BBAB1666D0EA4548 atatrkns
277,361,591 *1B4C137E6B3732CE5236D2C45ACCB3BAC6A8BD8A ataturk29
277,361,592 *1B457EA82EFF6D61C6AEDE2FC973D59019FBD63F A-TAu
277,361,593 *1B453D826C394CAEBBD661F1E9C969BB5AE70128 ataunt5
277,361,594 *1B49A9BE681352FE4E6CA85A908B3F4700FFF3E7 ataviarme123
277,361,595 *1B4F9B54E1D415E6C97F38FFE532885CE4A7B424 ATAVIIVATA
277,361,596 *1B48273CAD64086D072568F98766535AE321B010 atavism (remix)
277,361,597 *1B4A4EE85C6101BC314F321FBBC60EB46070F971 atavism(remix)
277,361,598 *1B4042DB81D312667E9680AD9BAF88D29BC19CCA atavyvyyo
277,361,599 *1B4CC53CED17927B227A00444E45DCC1501CC82B ATa(X
277,361,600 *1B484E79EC3009F6FF8AD4453DE99C3764046F15 ataxiaph4
277,361,601 *1B4C1FF381B7AB6362EBE7BB08B8A5ABCDB238C8 AtAY6
277,361,602 *1B417E29D82267BD821CE1E3B12CE5C83805B0BE At:B/
277,361,603 *1B4BCBD73B2CA6C94E83AE0DAC11B83EDF5CD961 A%:tb
277,361,604 *1B4E7BF9F9DEF05B42C1FD6765601362A3149E79 Atb6i
277,361,605 *1B4EF547BE535DE88B09437B670030267AFA9E49 A!tbb
277,361,606 *1B43FC9CEC0995A57427DB1098F961135E7F798D ATbfL
277,361,607 *1B429FCEA2649BCD61BE0D6203E5E54AB339684A Atb.H
277,361,608 *1B4C3A026E4F1607A62E9FDB50FD8CE39E0A349F Atbroide
277,361,609 *1B403014A3F9ACEEE6386D06D71C03425795E5C5 A)tBS
277,361,610 *1B40A5E9A42262B22479A2368F03E06012A93BB8 AT!Bu
277,361,611 *1B47383284AD1F1C19641DFB254548B5638967C0 ATb_u
277,361,612 *1B47C061691A04DF7E3E3E43EC8ECFB56BDE060C ATBw5
277,361,613 *1B4126F23CCECAB773684BEB8512E60BA9E85229 ATbwR
277,361,614 *1B4727618CDDD0072064F7FA9C3660A43830144F AtBX_
277,361,615 *1B4D93039829AB363A7A1F768A891954222B4458 [email protected]
277,361,616 *1B4A44E1C0D906CF59E0B549B22725253CC7E9EC ATb/Z
277,361,617 *1B4AA8BADA85662DA73290EFFF44066F266B9F29 A,tC
277,361,618 *1B4025250C43B4CA1431FE736C11148DE5B87797 AtC1m
277,361,619 *1B408164EF12C21368F4ED74410011A46E62A714 Atc6j
277,361,620 *1B41DEEAFB46F4A68ECA776A161B874C63DB93B7 ATC7
277,361,621 *1B4CC236510C97DE02F1487F8E2545D7FE64063B A=tCa
277,361,622 *1B4EA340A1B86143063A8956398C087E4AF388CB ATCL —
277,361,623 *1B4F2A319D6EF93E420FF1448BC60C82A01A340C atcqchecktherhime
277,361,624 *1B45D027C9ADA22E2F9C7F270042E1951FEDB4D9 AT;cr
277,361,625 *1B4F01FED89445C990F5B39D18508241346CFF9B ATcVW
277,361,626 *1B4F15C8D21FE7CFDEC9430F1D84C95621011E68 At#cX
277,361,627 *1B49805C571A70A901535B2972C8294DBD68D0AF [email protected]
277,361,628 *1B40E8614C9FE09352719E08215AB0D69774C75E AT=d,
277,361,629 *1B44BCCB89F39EFD82D56FDA475FA239A2BB2A5F ATD1e
277,361,630 *1B4EEBFF434086D1206F4771ED0BC7A74E8BFC21 ATDCQ23
277,361,631 *1B4967B4B41BE4B4F7CCFEA5E1DF82D527CD2DA8 AtDfv
277,361,632 *1B48076799111F09BBFEB0FE410EDAD5454479D8 AtdGN
277,361,633 *1B44F1172BB3948F207EE5AEB9CC3EF3690A5C0E AT+Dn
277,361,634 *1B4F493D96CF207097D239723B2B7B80BBC53EFD A!tDN
277,361,635 *1B4B35A7CC013D5E750DC03B03B1066ACBD7E201 AtdPO
277,361,636 *1B41E35FBF1B02B7A1462661AF2B87152F30B8AF AtDTW
277,361,637 *1B4381F2C079127642840EF0B6895055FCEDAF45 AT&e:
277,361,638 *1B4D61AE5DF5B273E90F8237E8884DC53AE8ECE8 A?;tE
277,361,639 *1B4387854B7B04BB7D3033487ABDCD74A41B7B01 ˈɟat̪ˠə
277,361,640 *1B49DB16BE827A37E309A5F5E868AFB7EF4C5180 ateardes1
277,361,641 *1B40DEAD00CEBFCE30204CE07D76DDA224527CD3 a-tech4
277,361,642 *1B4BCCE970D67455E5A93DFCB229F2B4358378BF Ateeist
277,361,643 *1B44ECAED2D9C55F50E5097D4E78EA29A5C1A10A AtEel
277,361,644 *1B45ECC1EC7F4F4B251095C5F0426E9C9546FEBD ateeqfarooq
277,361,645 *1B486E988E8A1F03C0EB014526E817B33EB10F08 AT=eF
277,361,646 *1B4D38AE0D12185969C34BAAF0A99AC549621324 ATeG
277,361,647 *1B4DF0E80A498AE45834FD661DA434DA51B622EE Ateknamed
277,361,648 *1B4D277FAF626E247193B0B56FD3BD60CB7E12A0 ATELAARS
277,361,649 *1B41F8C325D060A70D6E41A6F67871D740A0E0B6 atelako
277,361,650 *1B487E4EDF1B7F2E2FBFC009742C003A1E322912 atel’ek
277,361,651 *1B4AD0842F1CDC26C0FE0500F75531B71E7EC4EB atelopus2
277,361,652 *1B4F03EA30F562D3DD1E86802DEB9B2FD2A23E9A atemgasbeobachter
277,361,653 *1B4B58869BA37CD69D725B82190E9636E0D8F72B Atenido0
277,361,654 *1B42C0C2533FD3A4B76F72260BE13004D766E68F Atenimat5
277,361,655 *1B4997534BA86C3E1024CC488F19C24F9B84F5EA atentramos123
277,361,656 *1B46063EB4E4B773A8B2AA010211E3BDC861216B Aterauqsed
277,361,657 *1B497E51F5EBFB3FD14052C4372867105C613524 Aterial5
277,361,658 *1B4EB57B050C6C8A628D43554C9AF338934A1DE6 Aterkers
277,361,659 *1B4B524A32C5B22754184ACD2203841B9F412734 Aterlic4
277,361,660 *1B49B105B83012078F7610940ACFA872F68057EB ATERLOO
277,361,661 *1B4591B4B794F1DC680018CC4B5AD6D5AFFB117E Ateromlar
277,361,662 *1B486FBEF7D14EC82287DC1081E605311FE69ECA Atertaid
277,361,663 *1B42764088E066C707F5D8214DE90749D11BC9A3 Atertank4
277,361,664 *1B465C5CDD16AF84C940488692CF9DB4218F065C Atertem5
277,361,665 *1B407CCE04DA03ECA4C98975BC6E32D626CDD258 Atetósico
277,361,666 *1B42B374E5393ACF393E1A9EF2F36C5009BE0469 Atetutujed
277,361,667 *1B4EB6E30446AFF18B0AC97314603B6245321481 AT?eU
277,361,668 *1B456F397373196013160634B737F67B2D9B378B At~f
277,361,669 *1B48B549BD9E1934AADF91DCD70239F0331B3042 Atf,
277,361,670 *1B4789936CACDF883D8761A25EE7909595F3F928 atfirm
277,361,671 *1B4F19FD05AF8AD422219D148E2854AD5D94DACC ATfKb
277,361,672 *1B49CB9875BD0290B2046B6EDB8BAEA65F159C0E atfkn
277,361,673 *1B4E15C0F91C312AC70C054DE3DEFD028D8C37F8 atfsj
277,361,674 *1B43CE8CA4ABB6E4C7AE80DBB997E1A78BF59960 ATfw$
277,361,675 *1B444AFB6F8BD8F5EEF22CB6B0B68164E530EC4D [email protected]
277,361,676 *1B4C40ED9303C2938621F4CF9C9793490B5F2002 A#!TG
277,361,677 *1B49E2AC9F7F8C0D189A84AA16C5C3FC5A36BE14 ATG(:
277,361,678 *1B40271322CF8DC54510124E5A09B0DE0777DF08 A/Tg/
277,361,679 *1B4201684FF7DF7DCC04E23CAC8D0687AFCB3426 A.tg4
277,361,680 *1B424542F9B53271C1548994C3AA525E3D9D0F54 A_tg7
277,361,681 *1B45A3E4FDB50D096C8FED7B482314B3BB43099F atgamintas
277,361,682 *1B44319404589CC597EB3B2FA328FD70861E2AA4 atgcagctctctggcctctggctcctgctgacctgcaaccccagcctctccttgcagccc
277,361,683 *1B474AF34E56F101C32E5EA7B3786BBBF37D34DA Atgeriejev
277,361,684 *1B441ABD5C0D3EB2AC75021F23B2D75C48888BDC ATGgV
277,361,685 *1B4285061A9153FDB65529B63381EFD4CA3845CE AtGjd
277,361,686 *1B4AFF058176E73DCC75DB799B3DF9728218E3ED A$tgk
277,361,687 *1B41016EA2059F64718BAE2FFC53C85F1AAF7ECA AtgNF
277,361,688 *1B452FF772643207B4428CE99B2F7F76F4CBF229 AtG)v
277,361,689 *1B45F6B98501F91822009D686D10FEC42FF55200 At=(h
277,361,690 *1B44D8A066BB49EBE9655C5294C9E3FD50322730 ATh9,
277,361,691 *1B4D67326961C208233B42CEF92F5EF7884F793C AThaiRestaurantGemma
277,361,692 *1B44259BC8B72A46FE4996A553887A06306AE303 “athanasia”
277,361,693 *1B4B626FD0BCF0BEBF44C5DED2C5DC84B8497F02 athanasia.kitty.mcdowell
277,361,694 *1B46DEA9D8CE276BFA62F451EA82ACD1B5C5E8B4 athanasianist5
277,361,695 *1B4511E97E312904E65F27559D1DCCD9F3651DF8 ATHARCHIE
277,361,696 *1B4BCF30820F95426EFDBAE42245C5B3415DE770 AT?HC
277,361,697 *1B4DAB79F60E52AA6DCAE0C80D36099BAA6A6916 A-tHC
277,361,698 *1B4B9BEEBBF07CF8F5CB0A9C8E1B89031F255D7C atheist rap (u
277,361,699 *1B4424C0E0EA7DF43282365D22E8B8DCA96F50BB Athenacindy
277,361,700 *1B482190EC9F06E9A8E854FAC8A7FD2CDB11B846 athena cordova
277,361,701 *1B4B0F5A853028886068F6AFCBEDBD2096B3CA47 athensii
277,361,702 *1B4F2878AED5722E1DE17385AFD065CDBB045A42 Atherosc9
277,361,703 *1B4250F0216891369D072A32C709AAB95E499B8F Athetizeding
277,361,704 *1B41B656C8B6C6FD13B520E575D4EFA3BB54267A ATh$f
277,361,705 *1B4E281C8DC47CBD3B48F4FED7072D2EE1332B7E AthF0
277,361,706 *1B4C72E0FDBE6C4A372871713CC1443A07539BF2 ATHGENIUS
277,361,707 *1B4066408A613A2971A86A960AE2A2CF6124A4D1 A%THH
277,361,708 *1B4D4B2882A837CF0EAEC73248E068CBB1F48398 Athlamer8
277,361,709 *1B4526BC32E8C4C0BA26F34659FF60F1AD793862 ATHLETE12
277,361,710 *1B4633EDF5A7612F55A6DEC3A7BC60EF7FC8F362 athlete.really
277,361,711 *1B4C602297C6436D0777067B546FC78EF3B6AE4B AthlonBoy
277,361,712 *1B435FA247C55A607DC2287D2742176ECA53DC0C athopa10
277,361,713 *1B483175D413118C372C7C304AAE14ECC46F27EA [email protected]
277,361,714 *1B4B7972EAA3CD0A392853001E8CA63D513D2FE2 Athôthis
277,361,715 *1B477C26FBC252894A89EC9A9F94B8379E86B86F AThOu
277,361,716 *1B4220792B84895DB6F8CE1E1E63931261C7666F ATH(p
277,361,717 *1B42FDA24DC65E02565D078025C9361BBB40CF2B Athparroting
277,361,718 *1B49EC38AA3904A8925C713F3896CF5362803333 athrocking
277,361,719 *1B4241967D0599A88D39AA531C3576FB05EBFF92 Athsidneying
277,361,720 *1B4CDB80B9F17481B9711CF1D3A91CB03BFF999F ATHv+
277,361,721 *1B4A9E64565CE9DE2D8EA1580EA2339B2E6FC0CE ATI:=
277,361,722 *1B45F7268B2FF13E10B0A6506091F2CAA21E36EC A%Ti$
277,361,723 *1B423FD208D4C7308310D9209F4911E9EE176694 ati..
277,361,724 *1B43D23FE7E51A0DF5A4BEBE33E3797FEE175E16 [email protected]
277,361,725 *1B4887BCA9F5F737B6183C1E376F09DD08A5F3BB aticilef3
277,361,726 *1B41B4DBF763D2829CF11DF7CD1BA8C832C12957 Atidneved
277,361,727 *1B49C55CD4D0FAF5D707FA16921576CA23636DF5 Atiekala
277,361,728 *1B4E89D4092A89DC641CB3F3C59241976118A751 Atielamp5
277,361,729 *1B4E6FD56D53530C6957C4FE16A33045B1EE9EBF Atielapp4
277,361,730 *1B44487493B93107640C95393DA1EA5C020B65B2 Atienikk2
277,361,731 *1B4BD8DA006E04F0A5798B40235D90B29C5F37E9 Atienukk1
277,361,732 *1B4F72E4A5AEF8164800348A5BA0B0498AF28910 atigrug6
277,361,733 *1B427DDBBA3BA166503606BB3156957DEAC3A709 Atihsoo0
277,361,734 *1B4DFD01FB0AC2F2B22439CC359E8DDA64548104 Atiinuak8
277,361,735 *1B48EFEB21F8393A1BB5588324C4AA32CB3E168A atijolaram123
277,361,736 *1B45F60941CD7C9834760CBAD3586DC0CC350942 Atiknihs9
277,361,737 *1B474AC4EEB698C30B23B2364AB9296110ED148B ATILAM
277,361,738 *1B4F848111695B43D8034327AB4A01A526E187AC Atilatot3
277,361,739 *1B43E8A898A797EB668AF3BEEBAB1F4377C11874 atilobha
277,361,740 *1B49D0AA5EC14DB4DF9F099FFAFA06C4351181C4 AT/im
277,361,741 *1B4838AC686C9187546D97E8A8B1D511826BFF30 Atimanen
277,361,742 *1B426D38A6A84B7E5941F33C48A32E8575234426 AtImg
277,361,743 *1B47EBF5E620B29217305519BB716CC744DB8860 Atinawtna
277,361,744 *1B455368A93939B02687FD52D39AB138DCFA11C3 Atio.
277,361,745 *1B4BC4D503DB83859094394A4771DCB3F3B553B8 Atioikul9
277,361,746 *1B44D60A99031729FE34280586F5FEC854F23863 [email protected]
277,361,747 *1B4167E6EDC3F34AF1EF3A913DF4BE2F0F7FE5BD Atiorepoed
277,361,748 *1B4A355993E02FCB952A58FA743671E7A8193D15 A%TIR
277,361,749 *1B42661EB0F324249E2B8F6774DE87DAA947B87E AtiSE
277,361,750 *1B4708CB4CBF87347676CA517BF5A38965EB23DE Atisereh2
277,361,751 *1B4EC5B70B229B4951E1DCEDD99EDAA570C3E4F5 Atisfice
277,361,752 *1B4AB709C2A2EBBDA1E94C8A9181E5E38E234F62 a-tisket
277,361,753 *1B4D6CA4CFA312F534742866B3D19E40F34E1DF1 Atisonim6
277,361,754 *1B485B31489A5876F5FF7FA902B6D2E6FC925908 ATISSNAT
277,361,755 *1B4E5492F66414F3457A4F38D7EC9CB1625F39A0 Atísúnja
277,361,756 *1B4FC11EFF748C3E81AC512B34B8BC2392A593BE Atiulevr7
277,361,757 *1B474CCB69EB8E93B6EF00AA77A615175D9273C0 atiuqap8
277,361,758 *1B4CEA48F0D098F4BAF4D8962B2CDF7DF4D923C5 atiuu
277,361,759 *1B487C281A8C0467C5B2BDDF41910A2D758162D8 ATIVAADAAN
277,361,760 *1B4A5A314239B072783794C0DFE3D5F3762DC85E ativipBSW
277,361,761 *1B42B307E269C55FA2285450B5F1C6DE627CEA6F AtIwb
277,361,762 *1B4549401978093517816098FB77C66C2B963EB4 AtiwKartiwa
277,361,763 *1B4653ED6406150AF93B086EE1C2E18285A9AD61 ATi/X
277,361,764 *1B4ADC7BD34D54B94C70294B3E5D94F984960E8A atjaunināt
277,361,765 *1B4449F9C69CD0C188B05648F307161A916B047D AtjDZ
277,361,766 *1B4ADE7F58BCE03CCB9D1F37F8C063CE6F8B2487 ATjgg
277,361,767 *1B465BAC96E4D82BACE5432A6CC115D9083D42F0 AtjMn
277,361,768 *1B4B6AE04772D227A4C273B3792F5EF3FD28371B AtjnI
277,361,769 *1B43BCA3D97AACBCC4BF988FFE1BBCA1D013AAAD ATj;V
277,361,770 *1B4D9BF6CF632462A40A0DA5A87E54686659C49A Atjwjbswing
277,361,771 *1B4182063DBA48CD7BF72608AE26AAE83B01652B ATjWO
277,361,772 *1B4205B2D56D4E2F938B7B94A1509A2E3E0EE60D A"%tK
277,361,773 *1B4CEB5CA1F6453B892AC68E05747E1CF24A7E31 A#tK,
277,361,774 *1B411D47441BFF0D3078B552BA72FA42B00EA6AB At&(K
277,361,775 *1B46AE7AA15CB374FFB3726DEEEBBEC900A5830D [email protected]
277,361,776 *1B43E7C6B42045D2A81BF68FC7C34C4A6887CDEE Atkaakin2
277,361,777 *1B44B6CED39B0573CB41F1DA23D9C01CC2E3EA5A atkarīgam
277,361,778 *1B4A5B797F0DFE1F70016D47BF78B28699C89A39 A!Tkb
277,361,779 *1B4AE5C8B9731B40836012FF55C62B957D9FD142 AtK(c
277,361,780 *1B4968407FC7B5B9938D56E3C97BD116506BAA98 ATkc9
277,361,781 *1B49BB71B0016943554E1ED30C3C9A8D2E309AE1 AtKdg
277,361,782 *1B46A2713988B930BA313B981C2BEBBAF9DB4D1E Atkf1
277,361,783 *1B44FD7ACDCAD360DC400AFA7C2E6FDCFF6219C9 ATKfs
277,361,784 *1B4ACFF853CDCC36AABDD73DD800A8E39CD70474 ATKGf
277,361,785 *1B46A8D721CC7AB6F0D682B9B1959A4633A72F4B [email protected]
277,361,786 *1B400DE2175D65DFD4E53575AEA3B4FEA2F36FCD atkinshalifax
277,361,787 *1B4D3107EB52DDA365254E840C412013DCC5B8E6 atkinsoncrispus
277,361,788 *1B40633E7C59C8CFC7CD14245B07224AC7F8298C Atkmsdr4
277,361,789 *1B49F5B8EB952ACCB9ACB4EE09CEE9D61CF90FE4 atkowycz
277,361,790 *1B47DDF64336873D1C09CD077EDCC4AC09C30F0E ATku$
277,361,791 *1B4B87AA0828DAC7ADDE9F275F53F2641560C8FA átkutathatja
277,361,792 *1B4DFB3A777F58EF38F350756732D5C943B12B52 ATKXo
277,361,793 *1B45D7245108299CABE1B8000FCC28D601606BDF aTkXzABjuOM
277,361,794 *1B42220BEFAF01D004A15EB7CB7D2B4241085A7B A
277,361,795 *1B412A3B5939684F892F00003C535EB7739CA8AD ATL+0
277,361,796 *1B429C6FA984A9D404CAB1E943D8BD2676C0C991 AtL$0
277,361,797 *1B497900D27E45E590CF9001D3A0B7D65907569E Atlanského
277,361,798 *1B4D29156ABD142DBF2486548C8D8652AD0538D0 [email protected]
277,361,799 *1B47CFF82D343050E14A990B613B267A24452E06 [email protected]
277,361,800 *1B4A7AB246E05EDC6B2B0C9C88ADD260FAF7DE35 AtlantaGolfNow
277,361,801 *1B4D932137F8BFD607649F459F0BEDC6C8414A17 Atlantaya
277,361,802 *1B4AA82DB8D0B3A76C6ACA8B58F27BA18C846E70 atlant-is
277,361,803 *1B4A309ECBC59F54393E05AB76C9AE215B0473BC atlas300
277,361,804 *1B40DBDA9A2E92FA115D7D2CAA88637F101EB772 atlasjoe
277,361,805 *1B47D32CEF86635DD3B46F067FC701FD6F509D5A [email protected]
277,361,806 *1B4209C179BD256DAAAE367232EEB2A9C6854EFA atlasshruggedgwen
277,361,807 *1B4EEFEFA32A120027A84970A003485409D0E440 [email protected]
277,361,808 *1B47DE0C6F7D8844B12D970C48226175532937BA ATlcU
277,361,809 *1B4D88B6D7238253CAE0D4B009495D0CE13FC13D A$TlD
277,361,810 *1B46A05FB8A38C9BD393BE211EAEFD1FBCFC0674 Atledhal3
277,361,811 *1B46E8CB640B28778DFD1BF3A230B91AB87AF2BA atletico-madrid-sevilla-following-monaco-defender-nicolas-nkoulou
277,361,812 *1B4BEEC73ACDDA9C0B8AEBF5775216BDB414745B atleticouruguay
277,361,813 *1B4FDCC470856CFA6B9FD8B9389C0DF5FB621F97 Atlierav2
277,361,814 *1B44EA4B925950605D3DB41CE94F07B886D50E0A Atlinem0
277,361,815 *1B41DA6A9B29E66DD4B50B1F6430545938E4B0E1 Atliuvis2
277,361,816 *1B4C4A3A2E4C6BE03173FDFA7C86075D45E06A35 ATLLOVESBOSTON
277,361,817 *1B43D762BE881B18AFD4A075B56D8AD26F25BE37 At%Lo
277,361,818 *1B4717008920C382EB86F6628F82B2CAB16CF873 Atlognir0
277,361,819 *1B4FD26011F272A579757A9D71A1506E543F5EA2 Atlovnises
277,361,820 *1B404AE2B27F7F4633776DFD5B3EEB9330D3FCB9 Atlovrep3
277,361,821 *1B4E6015F92889825CFC8EFD042C6C7F83A3DAC7 ATlQ)
277,361,822 *1B4551AF346CABB367A9D013BB74C64161CC077F Atlsening
277,361,823 *1B400AF36FDF08A7032FC96D3EB9F1FFF61833E5 atluesy
277,361,824 *1B43319D70E44202F86AE3A659CAC3B829CD36EA atlxg
277,361,825 *1B456FEF6FAE63620B62790BDF14C89AD6EEC67F A:)TM
277,361,826 *1B4F390B14CBF8144551E295BCA33E4D297B8B81 ATM411901
277,361,827 *1B40BC1804D446837D474BCBCE54A16F014F607E AtM7s
277,361,828 *1B4BB9924CED9E4125B70F971160014C26BCB914 atmajena4
277,361,829 *1B491CC2F05401E61991C588AD326D4D8E3C2317 atmanoğllari
277,361,830 *1B43365B1836AFC375F6A312F6CD2BCEBCC2F435 A#Tmb
277,361,831 *1B47D1933A57254D8BF8EC801D67C4E820B3E7B4 atmos»
277,361,832 *1B432D13BBCF8C19C13071F5E40A2058854A505A atmother'stomb
277,361,833 *1B41720275DC59C4569C0D5424A284CADBF142E4 atmp4296
277,361,834 *1B472D2564516B39A585A4923D627E70E4646213 Atmrr
277,361,835 *1B4CC1882DCC2FF12A82343AA0473D71E0B3E351 ATm#u
277,361,836 *1B4299139D21C253310D0ADDCE834DE2EE16C9EC At
277,361,837 *1B49370BCB85CB327BBF51724FA69503A8A08AB0 ATN"!
277,361,838 *1B4306D29C6372122D261C7AB838757D40B06831 A=Tn)
277,361,839 *1B469F01F22DE5031C17AFA72662545C56A2C069 A_T(n
277,361,840 *1B41A8F970914270B69CAE1553BE0542B6A65522 Atn#7
277,361,841 *1B4E79E5B920704A09BE3D422DF489E7E4CCA443 [email protected]
277,361,842 *1B4B33FD0A736B42E0E775256BF6AE58C5DFED85 A/Tnc
277,361,843 *1B4305481EAD964B0053FCE04BA3B4801E87F4FA ATnCN
277,361,844 *1B47ADF6B38AE726D3A6E0702DD2E217B7CFE958 Atnellat7
277,361,845 *1B4D313D0E83EC965B526958C9532E731B1BCAEF Atnereob4
277,361,846 *1B46798617594F0BA34D41BEBA23F1033FB10F5D ATn&h
277,361,847 *1B4B676F552F6B89596B7561B8E24E1DBEB9EAA4 ATNIGNOI
277,361,848 *1B4F060BE75FF8077A373333B53D556DBFCFF399 ATN_m
277,361,849 *1B4AF96452DAAE7CEE43739ECA202A335AFE9DEB Atnukuku0
277,361,850 *1B4BEFA2B27F468879B3ED2C01D425A246871E8E ATnZM
277,361,851 *1B44A93830B160081788D00356453D0872FD7641 A+T_o
277,361,852 *1B484D8EB94816243321106C034515F1BE1F5854 Ato$;
277,361,853 *1B42B0405D6B5AF170975C80D33D50908514E823 [email protected]
277,361,854 *1B476BD0134F4FD45FDADD586BFEB8646DCD72A1 atoeoc
277,361,855 *1B43B935553E84EE11C577E98E41A38895EA5304 AtoK%
277,361,856 *1B43FEE78B8349C5821C85651C80431829D5D5CF Atokasoo3
277,361,857 *1B4F9951CDD867AE09C8195A99A2DE357972A27E atolique
277,361,858 *1B4ED8C6C052A8EA958FA758D2D10B76BDDE9F2A [email protected]
277,361,859 *1B418219E95A04D0FD3F56C84A725A357C2397BB Atomawas4
277,361,860 *1B49BFB4A327557C257265134A2DEB24AFBF486D atombombstestning
277,361,861 *1B42166A092928BDA84F4DEC61EAB9B8951025FD ATomboonen
277,361,862 *1B4EF611F2E612B08571924E28D72F3BFC1E2F19 Atomickas
277,361,863 *1B460717E634FD4772068F7ACC91D6D5027D80FA atomicsrodriguez
277,361,864 *1B4CE36248950874A93592310A68ABB8D7076A35 Atomic theory
277,361,865 *1B434DF02B2FD1DB70423FCB494F1E4B63DE4AC5 ATOMIUMCULTURE
277,361,866 *1B424403480A7B6676628786993E9D7D157B1F44 atomizálja
277,361,867 *1B495891CF7527709B2AFC8C6A37ECE0FECA1B19 ATOMNOTHING
277,361,868 *1B41175D4C2AB8AEAC1C0F87BDD3A1398977BC9A Atomodok4
277,361,869 *1B45CCABF6D1C4ECA4960139B7BADB3DC929D40E „atomovým
277,361,870 *1B46EAF415A8A53CF2AE22945B736E1E87C2C597 atom
277,361,871 *1B41838ED81D75E39DEF1162BD9CAF6E0E4E37DB atonewiththeshadows
277,361,872 *1B470BAB129394718D92D114AF8916BE0552D834 atongirgging
277,361,873 *1B4661304C1680D7D41BC01EE42A07B8F08B03D4 Atonhoz
277,361,874 *1B4A8BC7A9EA4AB4ACF8E02172323F564B382A88 ATONIE2
277,361,875 *1B47E24B5E4690540F5CB6941386B884886EACBC atonpmu4
277,361,876 *1B4A6E0F62447D7DBADC52AA4AE54B5B1F132B09 AtoPZ
277,361,877 *1B411DED794954824D7935F14A5316969C5ED981 AToQa
277,361,878 *1B4490CBC7A346C7618DF4A4DC1EE5440E31913E Atosarav3
277,361,879 *1B4FF7AAD4AB364FD9B5531815F9F669B4834F50 Atostak5
277,361,880 *1B4DCE3C0BE07731B393FA16C8C39380FA570742 Atosukos7
277,361,881 *1B4DC3217B4FA11E19CA332C73083A593226C4E1 atours9
277,361,882 *1B436EDA0A2121C3C2EB42EEF71F87778CDEBF5F AtOuS
277,361,883 *1B4917F7DD27F15093EB18CDF12EC069CAFCA8D1 Atoviis0
277,361,884 *1B4130E9610249975289A542A5BA71E2096C1490 AToY
277,361,885 *1B46BB195059FB9CDCFBEE6CE7295D439549D633 A?%TP
277,361,886 *1B4E5F666B157D3560654103E97112718A730543 A;tp1
277,361,887 *1B43C5FB4702AEAF008F3AA4D0E7BFC90569F047 AtP;9
277,361,888 *1B406655EDF796AAE631121C0CC3A5CDE322CAA5 átpasszírozni
277,361,889 *1B4DAAC5702F38103D6C8AFB7773B752386C1B8C ATpc4
277,361,890 *1B479E05F12F2D649CDB89985F152C5CB2EFFCB9 Atp)H
277,361,891 *1B42B1241C52BDB7F24A9CFE6E46F13EBC1BA778 ATPK9
277,361,892 *1B49FC1E41C775630EF418298F1EC5170B80F8D4 Atpmodni3
277,361,893 *1B4EB0E3754C3F55F35824D76EFA31F575C28073 Atposten2
277,361,894 *1B412382B49F05011A5F9C9303AB58BFFA246052 A)tpp
277,361,895 *1B40305E10ACF849C48C7F0128AB37CB37D2541B At)Pu
277,361,896 *1B4AECD7A6B1E2E67A94EF976BAE77D1F9FB1E3E ATP:v
277,361,897 *1B4B47A6D117A5722B96B9F95875234E8B971357 ATPYR
277,361,898 *1B48644EB65066B5F4096CD367382125639D50EB A!tpZ
277,361,899 *1B462F275848E1E639A1A24A257AD4E7EBC0A0CC A/tQ,
277,361,900 *1B42092306EB8D322D9917BB25D2D6996017B96C A
277,361,901 *1B42FFF6B6C48A3E17D8344CFBDCDC9472854CBA ATq06
277,361,902 *1B40D28AC9573F0CE4039F37478952CBC1EBEB3E AtqgI
277,361,903 *1B4E6C7A6D8E886DF1401EFA161539DC115ABB2D AT_Qi
277,361,904 *1B437949BC6DA367EE25BFE26D5F95AE2ECD87D3 ATQM=
277,361,905 *1B4FAF846D2E5FF495AB9C4BD64CAD4A7B618752 ATQn=
277,361,906 *1B41E6C1860D025EA75311EE0CA76E92E272A09F [email protected]
277,361,907 *1B4D06773CD67E55E9198BF7BF6F00D169CEFDB9 AtQt.
277,361,908 *1B40417425996B087CB9D16A3794B6489EC68E8E A;+tR
277,361,909 *1B4278D0A09FDFBD937FB21E1B6AE52F86DDE5A4 Atr8e
277,361,910 *1B478781AB6EE4367AD44A965D1C9C66DC55A8BA A"tr9
277,361,911 *1B433F4E32177367B5A4387B4A788A54753AF809 Atr9(
277,361,912 *1B464F867E4BBEBF88D8197A6524EE1C72DE63E5 ATRADIMAI
277,361,913 *1B4758D34C51191C6A1D0E9614F70F031B11FAF2 Atragoar
277,361,914 *1B4164F8E4F0A92942E65BDCEB4314BF29C0708D ATRAPAR
277,361,915 *1B438E54873033D6AEC59D3D221275CC6926C05D Atraxnowing
277,361,916 *1B41A5A66DA30B1850CBA776B99CF3098C472616 atrazó
277,361,917 *1B4FCA23F4EAB41F6BF5391ECC9BA5E39F8689B3 ATRCD083
277,361,918 *1B43E6D98D77C9086CA14966034092007ACEB872 AtRE-
277,361,919 *1B4EEB4B6F894925EACBC6DF86F08F007DBEBA27 Atreblon
277,361,920 *1B40251044D3672D727981D2A007844009280E5E Atrecilem4
277,361,921 *1B408BE33477DD2339C80B136B061B3A2DE2B467 Atrevjiwed
277,361,922 *1B44F185D4B084D1EDE68CBCB794FB596EC5C810 AT?rf
277,361,923 *1B44F8FB8666D7322884F7EE218DBEC6D9263D70 atribucija
277,361,924 *1B437229EF651452A8E543F01AA5C187F821CAE9 A Trick of the Night (Dub mix)
277,361,925 *1B4A81C9C265F17CC63D0566987AD8F76354F1BE ATRIOPORAL0
277,361,926 *1B44C31EB8D4E452FE8898350721EC8498D4BEEE atriphtothlassiccurve
277,361,927 *1B4ACF700DE572EA07866D434D5D43FD8AB82810 A Trip to Brazil: 40 Years of Bossa Nova
277,361,928 *1B4A825D7051ACCCC6EDCCF444630D80B24A4A89 Atristain0
277,361,929 *1B4FDC7A64C8EA39DA80F86DB8B1740E1A1064EA Atrivuja5
277,361,930 *1B44BE9AFDFC5563C89FD5FC1A8B095980AA99D3 atroarlhos123
277,361,931 *1B473FFD18140682D4168F43D27412E9B1C8ED30 Atroceses9
277,361,932 *1B4092D569FB53CD6996DF66BBED57DF46E1D78E Atrociter7
277,361,933 *1B475083AEA8B57B60FFA81A98E1DBB41BC7B661 ATROCITY-MONGERING
277,361,934 *1B45D97A3B104D0A27C022A83E0FD1AF12E6A19F atrockborough
277,361,935 *1B4A4F285E540480500E217FD2108A9578E29AE9 Atrolactics
277,361,936 *1B4910173CCD0DD0F9BD48D85683FD393D68EC4C atrooarias123
277,361,937 *1B43E892ED675C16D48D713563513F41292CAA2D atropinization1
277,361,938 *1B4C2E8751BBA392A4BF2B345BDFE90E8B3C000C atroulle
277,361,939 *1B40BB56117A22DCD2B2822623887F6AE84D062A ATR#w
277,361,940 *1B4C49281CE39315B6B82B505950C1A7028EB131 AtrYb
277,361,941 *1B459F9AA1A149126A0BB5F167DBDF8974C28AEE AT/S.
277,361,942 *1B4042016BC432B4F067A2C19DCA608F466C43EF AT#s:
277,361,943 *1B43346099B1C72F49C49FAECB23704855B2DFA4 ATS4UNP9A71090104
277,361,944 *1B4F5F4D4611B1B7EC2EDEFDD19034250B8FD554 ATs5U
277,361,945 *1B4C8DE4DA4FBFCB6295E62911BD3FDE139CCECB At+S6
277,361,946 *1B4C33D2E0F8BD51DF1509BE47A35BD649F261FC ATs7a
277,361,947 *1B46613F78694903526A16552102485A3EB969A4 atsakančiojoje
277,361,948 *1B4C5CB4F4C92D1A5FEF65DD244F323E3595E2EE Atsakiaed
277,361,949 *1B4969AF6493C8FEF9E76A418462EC26EA503AC9 Atsalogned
277,361,950 *1B4AC3E47EC08426FADA1C6B6601C766A9BC1224 Atsanuut2
277,361,951 *1B44B96D18587E17C1897417A34FA0986A45B45C Atsatage8
277,361,952 *1B4595859CCA98F89DDD6B5D6C0EC218AA1D948B Atsaudun4
277,361,953 *1B407297D3AFF421CB89BC09F7D1B460FFC80923 ATs;b
277,361,954 *1B4D627104483DEFF7C68D45F01ED4E8398E1E82 Atscecen8
277,361,955 *1B4B72ADD52CF39AA6DA3A3BBEE22BDA289E1F41 atsedui7
277,361,956 *1B4A0ACBF10F7A8BC90A30638A6A50BB7713B643 Ats:g
277,361,957 *1B4833F6D4DEDCFDA073DC1F08BA5337B7C331ED Atshitshi8
277,361,958 *1B44540CF6E512D29583111DF9842850C9F12464 Atsidadg4
277,361,959 *1B407961D08CE380F69C5B09159823C67C995DC2 Atsigered
277,361,960 *1B4036BABBA9E9F8DB1A818F2F6BAE74765F67F5 Atsiinua6
277,361,961 *1B4FDEC2BC73875EB8BF98B4784FE0AAA2A1B864 atsikh-heritage
277,361,962 *1B4524C38D5DFE3D339DC8160CF426FAA5F4CDBF Atsimetn3
277,361,963 *1B403FC53F558F3E5855D824D3830DB76CCB3BE7 Atsimsix5
277,361,964 *1B4B40F7103F5D10206EF4F31B077331D5A68592 atsinorcs
277,361,965 *1B43E5C49CEF90067C66297A6C2DC5287746B231 Atsioino7
277,361,966 *1B446913E5752CA69097B8CC592F99F9EA790810 Atsiramo5
277,361,967 *1B43F4A38F37DB7DD14101EAB93A1BE36EC7F4DC Atsisyyling
277,361,968 *1B42C8AC0949B2DAE9281EEE43CECF4F5024C0FF Atsitrop7
277,361,969 *1B4A38D6F2280B06F2044984E2E89E6CE53D630E atsittab1
277,361,970 *1B483550A8B177D6CD351B4EB8D432F6EA1B1193 Atsiutujing
277,361,971 *1B43509BE861F93B0B8CB26F3D5124E676BF1632 Atšķirībā
277,361,972 *1B40A6101BA64E81C8138CA01D8D41048F8E3C40 ATSOISTA
277,361,973 *1B41E334F417D173EA71513B33C64C464B92AC01 Atsokihe2
277,361,974 *1B445FEBA2898EAAF52ED4F1B57ECADB2399DCE2 Atsokuoj8
277,361,975 *1B46F7C66B679BEA9B077225AFA7EFAA11017E8B Atsomiho6
277,361,976 *1B4080A59250E6FD754982D4CDE69E8B6C622953 Atsosats5
277,361,977 *1B4EC533C941115B01C14EDE8A2F9C0A9D7572A6 [email protected]
277,361,978 *1B438A04CB3166B8155B02085F918B7148B90BD2 Atsrepus2
277,361,979 *1B41F23C1F5CF78AE0CA73C87EFBFF554FA78419 Atsretnis
277,361,980 *1B44365315A9B01EFD77349A81C73664A4CFD135 Atssn
277,361,981 *1B4F6A02F04B80E056E8ED1048E29FF93B2A627D Atsuloup8
277,361,982 *1B47E3B13D081488E4507A1F8048F5339E3E5D17 Atsuokok9
277,361,983 *1B42DE4D05477DD93EAAA4B081EF39BF04E7FC78 AtsZl
277,361,984 *1B4B8EC21F02EE9ACB66AE0CC01FA62E9E91F9C4 A(T"T
277,361,985 *1B4FD09419330E8AD6BDBC4665F9238B47D0C5C0 A/T&t
277,361,986 *1B41D319F55D90D92FBAF237F9736C8B6B64320F A)
277,361,987 *1B430B78D2A77DD4C13915A2B950C77E2DDBF4E1 Att&)
277,361,988 *1B48666E1C3DADCC399411B31105D3D762C42CE3 ATt3!
277,361,989 *1B4182FD01353EE9FBF7A1025E559158D5D0E0F1 At$T5
277,361,990 *1B4093C5E4946070BEAFD66C6E536FBD41C52D3E AtT5d
277,361,991 *1B40D95C3F9AB3ECA3148948068271D392F9C65A ATT9:
277,361,992 *1B4E00EEF8E16F40D27E67EA26859E9E9945BA93 ATTA1NA8LENESS
277,361,993 *1B43D8BB61504E5C29D43439EC97E005242F2F5B Attabonoed
277,361,994 *1B4C3D1E2B664A56AF84413D6810F8EDE4820578 Attabra
277,361,995 *1B450921AD32B62E384C7D73A59D21C28B70B312 attache—joy
277,361,996 *1B420F4208E37C75D6FFD437C5B7B265455BD495 ATTACHER6
277,361,997 *1B4609294FE33A4497D465555767D01BCEBD3233 attachs2
277,361,998 *1B4C13EAC4B100443A0BF453823844BD921D2D4B attack—how
277,361,999 *1B4C0D72838C8156909CBF594438C4AA112F2E45 ATTACKIERTEN?
277,362,000 *1B43BC8075B0926E8B94C86CB0C84EEFFA5C0BCE attacks277
277,362,001 *1B48BA3493501F25BDB72FD0C155EEE3429FF48D [email protected]
277,362,002 *1B4D548FE8D55F833163BC6FBF227E08712BBB2D attacktalkhasankeyft
277,362,003 *1B43155E09A5E34A47614E7E48A5B9D77CF03DAF Attahuta8
277,362,004 *1B46617A526323C9399410580C9D2F8042C96774 Attailed1
277,362,005 *1B4CDE55471B86B1CC5804D5FC677D185A804E0E ATTAQUEES7
277,362,006 *1B447A818066F89CA0E4A04B24B1391636DEF50B Attavrut8
277,362,007 *1B49C8AAF734C170BD320C942DEDAA6A71AAC0DD A_TTd
277,362,008 *1B4922C568D1EBE566877666C82F54E73ECD1C27 åtte»
277,362,009 *1B4E255865639FAE6B3820E83456D555DCF13B77 Attehupu6
277,362,010 *1B41BE135BD1B016EA22D46B8B0117B9C640053B Atteibbo6
277,362,011 *1B44FF76862909603997F1104C482814089BDF1F ATTELAGES4
277,362,012 *1B495309F98916FD607E0C364EF13A93E4CF228C attēldiagnostika
277,362,013 *1B4BEE334C2C649C8526AB1FC8FD91B766938AC6 ATTEMPT--AT
277,362,014 *1B49ED9835C8AFE241D44A04268F732B266C8DB0 attend4u
277,362,015 *1B47BDB595142E8888EB1DEBD16A1F86D1330B0B ATTENDRI3
277,362,016 *1B46C5057D92FE7AD67D15ABC52107FBE639B2C8 Attenraf
277,362,017 *1B48805328F6599001D7FB25DA254EC7D15C7841 Attentatoires3
277,362,018 *1B43F7CD3F4D586EFFDC8B6AEE08978C1CCC855A [email protected]
277,362,019 *1B4C05C778E1D3228A20B94A69BB21ABE68C5DA3 Attenueras1
277,362,020 *1B4F037DC668F4195F62B821DE3D466697837519 atterbury12
277,362,021 *1B4BE23AEE51F43918652B19290BAE7427F38D45 Atterned3
277,362,022 *1B4BCD1AE457C444AD9ADA266B7F2889715C46B6 ATTERRERAS3
277,362,023 *1B4D893B285B9B0DBD3993C8A182C0F6ED376D9D Atterrirs6
277,362,024 *1B432C3AA4D9DF110D70C5C9855AF567BF89A5DA Attestavoed
277,362,025 *1B4C08A3E09BA52F6D869DB0D61457C4F81F1C38 Attetsun
277,362,026 *1B43519D0A5660E5946BD83608BCB584D96251FF attezoring
277,362,027 *1B49F0EFCAFABEAB1ADE8F0D0982D9D31349119D AtTF.
277,362,028 *1B41E45461C682332CF5F182FAB993D65DAC40A5 attgtgtctgcctttcttgtgtctgaagcaagtggcactcagtgagtggcgctgggtaaa
277,362,029 *1B42934765DD517D68927164C81F6D5CDD188B49 attgtttatgaattcttgttatctgcctatagaccagcctaggtcctaaattagaattct
277,362,030 *1B41DE047A2E840BFDAE4E00C2511F5640E02907 AtTGv
277,362,031 *1B497D6C6EB9082DACFA00BB254A30DC088268F3 A&TtH
277,362,032 *1B480B1CA9C2388DB2D660F8132C4102A28207B4 ATTHESAMETIME
277,362,033 *1B4AB4B6483BBD99C2F1D822A28B630207E6E16F ATTIANO
277,362,034 *1B4C46683F6357266B7E7DBEBE8C93064CD7246E atticize!
277,362,035 *1B447F4C933D89D411C80B804F7E119A7C05B7F1 ATTICUS77
277,362,036 *1B462380A3891C79B391FA4FDEF2F0E5DC173072 attikainternational
277,362,037 *1B43890FF38E1DDCF8A1321512EA1BFC90CEE0CE Attiladoggy
277,362,038 *1B44A80D033756B51D93F317B5A22E451150673E attiliator
277,362,039 *1B45E49E259B723BC4546138F17FD33F06FF73C9 Attiodases
277,362,040 *1B4E2FD76E24586D39959AF6301AABFDB5A010CC attisha123
277,362,041 *1B407105E7E8A778220B42AD10F9614E8E772774 attitude198.54.202.2
277,362,042 *1B4FB198E3E413070633519F7B0C5CE041E1FB58 attiving
277,362,043 *1B42F85728012CE76ABD0C83A9E556C4AE77152B A
277,362,044 *1B47B56ACE692713E6712A2D88DB936DAAE650EC ATT%K
277,362,045 *1B482294C3CCB70A3E44283CDF79E5748EC7E690 ATTNANG
277,362,046 *1B448DCD72E6AE0D7FC39F5702F0048648271E67 ATTNTAAT
277,362,047 *1B49C2FF3CFCC215C25B03F867090E3DA169BC85 attocompleto
277,362,048 *1B4816DE1E7AE433185B90B5540D528C1500EF0D åttondelsfinaler
277,362,049 *1B4EBB67BD916C23BE3AF75DB2EBEEC543DDEAF3 attoprimo,scena3:scena:"venerabileopadre"
277,362,050 *1B4CD560B628C24C4CF7BED128095F29D0209270 attorcigliatovi
277,362,051 *1B49706CD0F6DE32013F6D28EB7272809CBA6F3F [email protected]
277,362,052 *1B4D23775285954A8A3406D37AC2C906FEF4DAB2 atto secondo, scena prima: "salvator della patria" (is re, radam
277,362,053 *1B465F67149AA15FCC1E89F1FFBEFD6BE9C9F79B Attosies3
277,362,054 *1B4D9173B79D7ED1FB5182961C853BE45161CFD4 Attowood3
277,362,055 *1B44A444036A1344DD243C38FA4E1A151AD91CEB ATTOZZAM9
277,362,056 *1B4A7F8B8BF88EE16B77DFA2124E85528EFC8C9E Attrede9
277,362,057 *1B446B2DF258F8162453BB7CFA80287E983A719F Attrelianus
277,362,058 *1B46A2FA65C928F21A985D66A70287DE62C988A9 attribuerPoint
277,362,059 *1B43F7C17B98C8199A929FE9774AB068A0A8C674 ATTRIBUTO!
277,362,060 *1B481AD82ACB566F450533B0149D3562CAC5818B attrippata
277,362,061 *1B43C97C2C64EAEB66C67E4276B293B4FE4B1F5D attristez.
277,362,062 *1B43F60E5C3165D5E05AFC7F6AC8080B402121C1 Attry1
277,362,063 *1B450F35D4F1F3B3CF3D5E5F8E14345B90653FFA Atttorney
277,362,064 *1B496489C5F43894EB204CEBAEA60BEB78685C8F Attuleras5
277,362,065 *1B4E9B5B8768A58DAB9ACA696A6D8973E73E695D attunix6
277,362,066 *1B4870EA5104E1DE4CA61233F4FE8071FC459365 attutano4
277,362,067 *1B4259022A4F86B99DACAA8E944715F9B9C1BB82 attyclannabryan
277,362,068 *1B4B9CEA32BDDE1EB378148665B10207CE5A1812 [email protected]
277,362,069 *1B49EEBF01D432B4EAEF09DEB898912DA862F039 A+"tU
277,362,070 *1B46BC1B9D36DE363224E3C4F21E15E5ECE84832 A)tu-
277,362,071 *1B42C5FC7465F69D20048794E77E8390B20083C2 A"TU7
277,362,072 *1B40195FE978B502ACF3646DCAD1BDC0608271E7 Atu7c
277,362,073 *1B45D35C24C090177E8D5F97D3BC47BC4916399F Atu%E
277,362,074 *1B4C3A1CD69B5FF60D963315050D6F190BB338A4 atulatulsnischal
277,362,075 *1B4C23D73630ECFA2CF12E4194CE7972E360D0E8 ATulipfarm
277,362,076 *1B4A142FA313B9107ACDC24FEF71FDA351DD5F48 atumble123
277,362,077 *1B45BDFC21BC3DEB10BE4562F9DCABA7E5500D6B ATUNTOQTO
277,362,078 *1B4C4CF5F6E31AAA18C9EB83D4390034B509F0F0 Atunyuu2
277,362,079 *1B42145674E305C1C39208E6491F06C5F8FC26B4 A-TUQ
277,362,080 *1B4D37A9F32C10EA2C427932D225DA25227972DB ATuq-
277,362,081 *1B487B0DE43EFF5FB54113D7E3434A510F03FB30 aturdiam1234
277,362,082 *1B418D1DE0986B9C3EFF4134CF520FF5CAC1BA21 [email protected]
277,362,083 *1B41EC8D7D8A0F0510E14C67E6A55EFD861B44FD Atuv,
277,362,084 *1B49BF6E3AEA1B51DDF2C8B1DE31810FD576D51F AT.V?
277,362,085 *1B486649FA8286A5D44F0C52C40F12EF791868CF AtV5?
277,362,086 *1B43D584E1B2713FF0B2F551F4717A40B8B6431D Atvaran7
277,362,087 *1B4D4DDDDE0668CDDAC7C0D9FD43827287328F50 ATvgD
277,362,088 *1B4BADA6F271AC8D0083FAFB65C52F1AF2F43FAB At#Vh
277,362,089 *1B447EB5027AA53A3E1EF661E9381A4104A7D653 AT+vN
277,362,090 *1B40E43A2B23C673E5F399731CE760FEE8BF6EDF ATV-r
277,362,091 *1B40B5C7FC00AB455D69F30DDDB7F2B6671BFA80 AT(vu
277,362,092 *1B44CF8C982FA5B4D2FD2A9B59F75559B7D14187 A(t(W
277,362,093 *1B44A64EFB9722BDC855C12B52BF8063B7C52EED At?(W
277,362,094 *1B4446A83515B0A6FFFC740463EB0C088A5F9CFF ATwbD
277,362,095 *1B4E9AECF26C3D0FABE21B74B94328C2B3C5D7EF Atw.C
277,362,096 *1B49716BDDBBE0E81BCC17671410251B36F77D18 ATw+f
277,362,097 *1B433515FE52A3648222403B785B696B3CDBB077 atwixts4
277,362,098 *1B46D6CD04C81872C223C77E7C9F5DF5A408BAE4 A#TWm
277,362,099 *1B4A6E32F811E3F0CBDA81FBD908048989ECB806 Atwn7
277,362,100 *1B4A470340EFFF003A8F41180E0C9AB9A1E16DC1 ATWPh
277,362,101 *1B47BE7A55D465B7EF4CC3B550CDEE3F205B935B AtwR6
277,362,102 *1B44024A19562FE4C4ADAFC885C79527562DAC8F A,twS
277,362,103 *1B4930DA9DBACB83C3C7A89DEE3421E214672763 atwsbsw7
277,362,104 *1B433ECB0165B2E45B77E1C93AB6F397FAC72E18 ATW_v
277,362,105 *1B4B92AF6DD2FB7B79D43B6EDAD2A26D803B17AD A".tX
277,362,106 *1B4FC160932442E34DA47D1166B9D525ACD59261 AtXO/
277,362,107 *1B44180771CEF9DFEB8A57DAB20D5BBCD3B9D285 ATX$Q
277,362,108 *1B4E3C2F77840AE37D324B930CAF044850C99E1A atxuriak
277,362,109 *1B46444A0095849101FEB08A95A6E7FC77E4C61F ATY?#
277,362,110 *1B4A864872817FA9DA47AB48C4C5A27CF7C7DADC A
277,362,111 *1B4CB713F0400D3FE0DF5CAACEEE1F0343951D6F A%tYb
277,362,112 *1B45FEE55123F5624A36A7BABF0DDC4E46F2EDB0 ATYN8624
277,362,113 *1B4A8A8DA7B16B7C4C5A9AA826FD5B10DE776DA6 At)YR
277,362,114 *1B42088521C82D4F19A16AC4A010038FC068CE9E A TYRO AT
277,362,115 *1B4F3805D891ACA7E2C7ACC4A45E5027D16AD70E A:tZ0
277,362,116 *1B4F720AB4F9B9FDB1A3138980BD7CAE08D61A61 AtZ00
277,362,117 *1B4897163EBE563FBCE8F9D2418B68E40DAEE118 ATZEL
277,362,118 *1B4C8FD26AC7486A3D8FF3B4D8A27381FA924247 A(tZI
277,362,119 *1B4682BBF4BFF24FFF9DAEB05AC8A1B9852A543E A%TZK
277,362,120 *1B470CF4E7B153E52BB730175F909ED930F6896E AT_Zk
277,362,121 *1B41EE5EC0FB05DDE567818D2C143B88ACB904B9 AT%Zq
277,362,122 *1B44ED9DC7893D3A503DC3B656FB961EA6035AF1 AtZ"S
277,362,123 *1B40D5B95DE4F07926F107FCEE6867B68EED2AFA A!tZY
277,362,124 *1B42C0C07EE90309C6BB71C2C9007558CD19387A at互換機の別称である。その一方でその土台となるパソコンのハードウェアの差異を問わない
277,362,125 *1B4A1C935FB4FED15A9FC71B414E66D3BAD61656 A=)/U
277,362,126 *1B4228B46CC8704C67A15E8D5DF1F20750A59332 A-%,U
277,362,127 *1B42027633C5E924E10B0FAF3330C677F625B087 A;):U
277,362,128 *1B4A153BB6CD31FA279232113E229E8F96BEACB8 A;$%U
277,362,129 *1B448E1C3DC15BA4EA3FDA1CD6159C90A90AC100 A:;-U
277,362,130 *1B4F1F4DB1691CAC86B4DBF24BC0F2B92E5B1B78 A+(/U
277,362,131 *1B44E34995E8F45C4CF76048D47BF9E4EEC1E40D A_-u_
277,362,132 *1B4E7A697094BA5F39903F997C1A72CA132A8368 A-)+u
277,362,133 *1B43465B1DD77EBA893AF75AD9AADED56A247C75 A:!u?
277,362,134 *1B4A13CBFBEA35F00C921A313552A4FE13AEEDA1 A:u?!
277,362,135 *1B4F351E3CA6A70347655CA97D2D518801011620 A$"/u
277,362,136 *1B401B4BCA4AB41622A941D6A12917224F846CD6 A+%u/
277,362,137 *1B466616FE26C3AA904CC112F392BE7785C7C857 A
277,362,138 *1B442B3BD746B580CC44820331AFE3899421B543 Au=_$
277,362,139 *1B4FAB6B4EC393117E5FF1D94583A5C3179298F6 Au-)?
277,362,140 *1B4D3B8DD2C2725D969955E17EED419042C58E21 Au:&
277,362,141 *1B427154275F460D889E4209C0A601BD3B37C10C Au))%
277,362,142 *1B4E3E8DC44B30A4EBEE49E5320B5D3247A8C3E0 Au#."
277,362,143 *1B4271AD823DCAD9FE8A9FA789C1C8AF7D54FC36 Au
277,362,144 *1B4E8A18F738FE2757920214EE582D5B80289077 A_u?0
277,362,145 *1B45D53C2B71238174C5CE9EB5F9A069E2185D8E AU04U
277,362,146 *1B47A74F4C8D50C003FD8DA4F24D22A746A72F0F AU09
277,362,147 *1B4032ED87C8BA939A2F4904E17ABE2495571FA9 AU+0B109RAPH3RS
277,362,148 *1B401B7594CF8D3E31DE3F3CCF92AD806A71BF16 Au0fs
277,362,149 *1B48D40C9F35957FE1CDD3150EC1DEFF25C27F38 AU%0O
277,362,150 *1B43BB36ECFDF290F2D033A472329B01B6162BB7 Au1.b
277,362,151 *1B42A8967FF82528AB69636BD7C83D692508B4D5 AU1sD
277,362,152 *1B4FA20EC0BB16D9943ED73E433C607D21116004 Au&1u
277,362,153 *1B45CBD1DD698C683CE3253E69285D0ECBAF3B86 AU1.W
277,362,154 *1B4D515B4E3819C202251C04CCDA913BAE876AF4 AU25S
277,362,155 *1B4BE0060706639286E2E75B0335F51A756DFE6F AU!2B
277,362,156 *1B46A7FBD2F2DC209477AE5FBC5DE43BAAE2F93A AU;2g
277,362,157 *1B4770736E375C3A769474875496173F1A8B40C4 A:U2t
277,362,158 *1B49F34400DA18913D36D3966CC6BF5644544F6E AU2TM
277,362,159 *1B4044E591EF03ECF50B86BDAEE618A95F5CF375 Au3:C
277,362,160 *1B434AE5DA2311CCD38CFE151C9D1045FA22484A Au3N
277,362,161 *1B4BDBECD8E652148BE264C7732E9F7941FE19A5 au4029
277,362,162 *1B4BE0EEC235DB9EF92A395626390AB8CCE08C07 Au4bc
277,362,163 *1B4FDFBE583C91941577BDA5264135B6BC495AC2 Au4kq
277,362,164 *1B43D6660D78843949A96D50403339DBA1CBF942 Au4lu
277,362,165 *1B49EBA12161F45B7B572DF9DE950EAB874A9BE2 A=u4S
277,362,166 *1B47E7234D2799323A40186A93F9A6B64FFA20E3 A=-u5
277,362,167 *1B4AF1CB1EAB52EA6405C48BF74F65893FEC8052 Au5;/
277,362,168 *1B40EBF443A4FC3AC5708D474B56D5FA4E3A1344 Au5!/
277,362,169 *1B4525F9A849C16E9B38BFD3DCA25CF888FEDB8C AU54f
277,362,170 *1B46356EFECA9A0057CFDF2C7CA232DAA03BEB49 Au)5C
277,362,171 *1B42A01EA66FFD4D173476013CFFEC62F9ADEA6B AU5wW
277,362,172 *1B46EA177731CA7252AE32FCB672BDB221C7D8C1 Au5YF
277,362,173 *1B4FC50242A91DF9C67C20736FCC63E3B2BFE9A0 A,U6:
277,362,174 *1B497E0A185B1ED6972A631E22DE0215FC17D753 Au;6%
277,362,175 *1B4D788245CBBF6122DAC166DB350B4078F3DE37 Au#=6
277,362,176 *1B43D2E71A48BC28C1CF32A5A9087628FF3FD97E AU61S
277,362,177 *1B4C7F2AB4118F59B0E348ADB86A3984C13553D5 Au6)8
277,362,178 *1B47CC0703BFB6396430A99E6FF09F280546114C Au6ah
277,362,179 *1B4820BC9A87D433D99940D4C8F34981E94EB0A9 Au70buss3s
277,362,180 *1B4E7379C13CC3968467EA31DFE418D9A4125B5A AU72u
277,362,181 *1B4E22883A68C298E51170BAB51DA31993F0F728 Au76a
277,362,182 *1B4A5BAC3942B7E8F4F45CE793A4431AF406E377 AU-7E
277,362,183 *1B4F34B86C738638AE041D10A8004EF10215B030 au+7em
277,362,184 *1B476DEED8735D9131CAE9F9FF513C2A8C2849FF AU7H3N7ICA70RS
277,362,185 *1B46BC7380032B2B12BB6A9460C66C5138347279 au7hig3nic
277,362,186 *1B422403F6E0EE2817D2176E54EF62CC97802118 AU7O7RAN$P1AN7
277,362,187 *1B4C20473E206887DB6EAE676FA9ABB92CE8AE82 Au7Xt
277,362,188 *1B41C985EC8936ECD8152FDD5F10CCBF5D90C647 AU(7Y
277,362,189 *1B4B00453913CCC539AF391764AEDAD68C9A2202 AU8GN
277,362,190 *1B4F7EA3944B1CE6F49B85EB318BFBB466D3DE58 Au8H$
277,362,191 *1B49D911BD6FE64E8033ADF5BD3B4167DEFCE0CD AU8;t
277,362,192 *1B4CDF5347CA3E8EAC419C703BCD9907A2602DE5 Au,8X
277,362,193 *1B4AB7D3C082B1793506CE41846E4BB6721B1F91 A%U9&
277,362,194 *1B4683F7BEDA86E89251D47BB12ECC93E6B7243F AU
277,362,195 *1B4D39C25C8EA29CEB4298332D9B3A00F7A1838B AU9j0
277,362,196 *1B4D61A5CF292BAEAC712F473FC9FAF6262E3DF7 Au9j2
277,362,197 *1B4C5CF3CC0AE1EAB52FBE1ACD028A13E4A6528D AU?9k
277,362,198 *1B4473112944A9B89DA802F2F28600D3C91A5470 Au9Yu
277,362,199 *1B4057B5D42481FBDA853819C53C791550AE2A54 A:U+A
277,362,200 *1B4DCC4F58CB4D8B0CD8CB83815F803898D96877 AUa":
277,362,201 *1B43363BE29F6DF4EC19E88481489F326FC909EF AuA-,
277,362,202 *1B4610151E2B5CE56C8CE91C6789A284A5FED5BC A#u!a
277,362,203 *1B42F7CBBF0698861FEE0ADE041A1F7B10EC15E3 AU,a4
277,362,204 *1B4E2D7B61C39F5E3C8C243E03137840CF7448A8 AUA413
277,362,205 *1B45632D4F9030314C8E0C526AA236FA55EAD3D7 AUA9?
277,362,206 *1B4F9FCD88DA20A649C83D148954E98E91315665 A(uab
277,362,207 *1B47978E23074E336891784CD7E72F2F8150A731 AuaN3
277,362,208 *1B4913931090800B938066A0542C64EEC6C92A29 A
277,362,209 *1B48395AB744E88E86AB048AFFDDC2CBCDB0A4DD Aua)t
277,362,210 *1B49D36E2AA0BFBA362600716DB5CD367FF7B248 Au$aX
277,362,211 *1B4BF78ADA4CD136B7A5083C37A602EE0099F99B AuAYM
277,362,212 *1B44B113ADFAAD042F6AE917BCF4EAB8800E99EB AUa%Z
277,362,213 *1B44108BE6DA844EC32C01066503755D71F8929B A%uAZ
277,362,214 *1B4B26F7D53C5D36972E76FF0B46913E62A96F35 A
277,362,215 *1B4A3C0F89783F0E68567C0B2FA8AD770CF8B83D Aub2B
277,362,216 *1B4F0DD5EBFFF61B9F1BDBFA0209D7DD64E076D2 Aub6B
277,362,217 *1B4DB98CE355D682C3D51DF5FD200626DE4908F8 AUB?C
277,362,218 *1B404B831F83A235BEF880966B521FA5EE91E38A AUb"E
277,362,219 *1B4533BB45EC86030EC7F3F30685E49CAC577AE6 AUb=e
277,362,220 *1B43E1B721052A92DA73D18766E35D5925063B2A aubée
277,362,221 *1B426FAFF23352EC80B0028E9B216423EB0DD9B4 aUBERTA
277,362,222 *1B4C36AB242D7B8168A139429A559532A66E5F81 aubertl4
277,362,223 *1B42645C9BE927DB869157CE073B24564CB5DB8D AUB%l
277,362,224 *1B42D4F77B170FA1BAC12A0D6C3753911BDB59F8 Aubliche0
277,362,225 *1B413BBDB5EE621BB4AB86791ECD6652D3CF44B8 Aub,M
277,362,226 *1B442FCB52F2C0C889E3918071706D1C757F2CB9 A?ubm
277,362,227 *1B4879B8DA54451528C4E1E8365E7505FECF804C AU(bP
277,362,228 *1B464B6BA8E930C919D8833AC4513D37FA6490D5 AuBP4
277,362,229 *1B491B3B91C4FA3D51C367B7A9121D248B0D76A4 A+uBR
277,362,230 *1B44C1AF7B33ABDCE9461707393BBE5EE4AF13D5 aubree465
277,362,231 *1B4979358D62E3AB1B055F021F7E3F2103843029 aubrey.auer
277,362,232 *1B412F9F82DA3DA88B1DFC0A6C9F61578E7A32EE aubrey.bergreen
277,362,233 *1B40C8E9B928EA748B627D3CA39E3CBAA6F7C18F aubrey.cazeau
277,362,234 *1B4FD92B67FAD5E1597D73B98AD089465CFF2BB6 aubrey.chamlee
277,362,235 *1B4F783CAFB0EE7984C927D56487C27A35A8A628 aubrey.drey
277,362,236 *1B4B3BDB88D0F1DF38608056E9C2FFAA5B06930E aubrey.dziekan
277,362,237 *1B4381033882EAF92B317253AC1857FDFA49A556 aubrey.estel
277,362,238 *1B496BD2EECC652FD799B78320B342451C92C4D9 aubrey.fasel
277,362,239 *1B49FEEEC1413ED58949C35B8D2186D6258A2E91 aubrey.ferugson
277,362,240 *1B4B6F5873696EBF0F0D7B6CF301AFF7C46BD7C3 aubrey.filteau
277,362,241 *1B4F0EF4149F43B3CF3230D1791DD3EC15E02C41 aubrey.forsha
277,362,242 *1B4CEC7C6BA94B2722E2F0E828514F2982A1F709 aubrey.guedry
277,362,243 *1B4CCCAE46760A08FF74A225D63AF1C34B47776E aubrey.islas
277,362,244 *1B49316A50A23B12BD46A3EFF4C58A4CD7F9977B aubrey.joya
277,362,245 *1B4BF850F633724668D0FA790DEAA2A3DCF00932 aubrey.koonce
277,362,246 *1B444E63AEFCC83DF2655A11863A2E5373B588B3 aubrey.lamirand
277,362,247 *1B433367CF583C5CD006239BD45B1D940376396C aubrey.lemish
277,362,248 *1B472FD60BFA081B8BF2360907C1AA1EDA1CABB1 aubrey.manda
277,362,249 *1B4D3141EF796C1AE6280C2080C7673C4A8C80BB aubrey.mccomas
277,362,250 *1B49DF9C489EBA30E9F5CE84C8DD6FEBAAFBCC88 aubrey.munet
277,362,251 *1B43144A0FDE22FFC688DED70E671CD7AC5BFDA1 aubrey.patton
277,362,252 *1B40616C19CC0861749E2F9951EE411D0D566A01 aubrey.pinal
277,362,253 *1B481EFA723E862ABBD8512CF4AED5C00147BBD5 aubrey.plesha
277,362,254 *1B40DE7BB6D480D5D9DB202C7EBABD00351EA5BA aubrey.rafi
277,362,255 *1B4FD631B49D652295EE340806D748C06719FDA6 aubrey.rattee
277,362,256 *1B4D9D57E04C57E630E921AD0E53DCAD76559C94 aubreyrhodes
277,362,257 *1B4FCF9B040C98D0A23DBE9139291BE59491D9B1 aubrey.salquero
277,362,258 *1B4F1A494DC21C6CFAD3C36B0FD7945BA4E38CF4 aubrey.screws
277,362,259 *1B4D61E12CE8C26291ABEDB33D2B46A9C03C4DC2 aubrey.seide
277,362,260 *1B48361C9A11DB31A4A83B8970053E5D32738CF3 aubrey.sigworth
277,362,261 *1B4CF2F7C7DD3CB193CA4DE722F0C57864BF0267 aubrey.vandorn
277,362,262 *1B4C02148DC8D8ABD281C92121C47A40C4A45596 aubrey.vilt
277,362,263 *1B41CD9955E8B6360A744C03BDF7FD9C9C65A51B aubrey.woelzlein
277,362,264 *1B41F742E71728956E1B926763284361DC47BA35 AuBwr
277,362,265 *1B4D7021B23FB32F582A12B6FD954F1F27636560 Auc??
277,362,266 *1B439080EA957487C1A4CF4B4D1C72AD644D2465 Auc
277,362,267 *1B442A334CE7DF4B6578181B1E793AAE843A8084 Auc0
277,362,268 *1B4F78B96E3D2DB0E3650F37433247259EFE2A5F Auc9s
277,362,269 *1B4030878FD485D51F84F626BDB8F77A1C184E56 Aucassion und Nicolette (Canzonetta medievale)
277,362,270 *1B47AAAE74208DF5682D38C082C35502CEF0782E Auc$b
277,362,271 *1B4CD1823B73A7E8630771E4A267584107057920 auchenhavie
277,362,272 *1B4282A0D32AD2334DF9ABAF9331F1E4F18B7BB2 AUCH-NE-TAKTIK
277,362,273 *1B478767A6A78AB7F4FBAA5E44F7B35352A22246 auchnoch.l
277,362,274 *1B4871D4E9DF2C638BF432ADF193BC7226696174 A/Ucn
277,362,275 *1B4E15E7868D696CBEAD3EB0108D101E4CD69F74 AUC,P
277,362,276 *1B4B92FC7675779EC0003728B430E1A2145EA82A [email protected]
277,362,277 *1B4144CDE3384821DB80316049D141645D0BAB9D auctorisadas
277,362,278 *1B40C236FE0C5C61ABAE7DC6E06CC645837DB9BC A"UD/
277,362,279 *1B4CA926DD0516B2F5A69D9195A23F13C52BCFA9 A
277,362,280 *1B479D0EEF8496EB8D5325C6D3A2AEB62576F068 A,Ud.
277,362,281 *1B4F2621E1BE814CD3966E894786C2C38BBEE015 Au
277,362,282 *1B4E8F7CF2A42A80497D8AD318CD35616F6F0B83 Aud0Y
277,362,283 *1B4EA9446431D0C3DE3B5F847721170F875E4BEF AuD1j
277,362,284 *1B4EDF6451B7203F2D4E9060572B21C9988E27CD AUd3u
277,362,285 *1B45E9D1EADB164374D300054F2208ACF79AEDC9 Aud6c
277,362,286 *1B40317F6B66C744824BB0E2E42ABEB8EC716B08 Audaryam
277,362,287 *1B4A00AB7757AD69BDF07B87F6243189F96E0F4F AUD-f
277,362,288 *1B42B8F3E70ED3123B919C10EF25094C9FE45F0D AUDI7IN9
277,362,289 *1B4DB432A8B387A0DE51978A36E8EF6DFD311ED7 audicija3
277,362,290 *1B48DBAE53C5F192B2AF707EDF7284926D3E1E96 Audiencer.
277,362,291 *1B46595BCCC3143377A26BDA4E8E301DE873BC4E audiofonicznych
277,362,292 *1B4659D248512EBAC059495CE8B9736C7FFB56DE AUDIOGALAXY
277,362,293 *1B446D19F16BC7292BA4A62D276DD079D0367373 Audioinformationen
277,362,294 *1B4EEF5039A93CAC7AB4FB2DF5FC10826AE88DEB Audiologist1
277,362,295 *1B458CE167B9C1238B733858A238443AD92368E6 [email protected]
277,362,296 *1B45D94F8BA9E7EDA3B8533B2E2A36F33AC0F8DF AUDIOPOLICY
277,362,297 *1B4E56F3C0B4B7630165BE558C9A8ABC15BB1FFA AUDIOSOUL
277,362,298 *1B4954322F778F43EDC93D12A6E0B72BAD1AC644 Audiovisuels!
277,362,299 *1B43151260BBA2EEECB9CEAE1859BDAFFCFD8842 audio社製プレイヤー、及び
277,362,300 *1B4C0E6A2CE8A0F035FB5F1279EBEE0FB25B118C audio関連のsd
277,362,301 *1B45A3966447AFE840B02C719E90F9AE244AAE4C Audirem5
277,362,302 *1B415B01AAC6B27D3233CE5C87F5D77D43731E6D auditale2
277,362,303 *1B4996E2C9BEB66D13B26077DC3EFA85C304D508 Audited5
277,362,304 *1B41F032C2D31BFA7B541F8D325196818E8B78C8 Auditos1
277,362,305 *1B48DF7324A0A7CD3B000BC3C7B3D6AC2C64606B audivise123
277,362,306 *1B434E818D84E7EEB7F32C4881EC60817483C618 AU=DK
277,362,307 *1B457B4A9559F558FA0E1757B0E94F33C0D0EEF1 AUd$L
277,362,308 *1B42632175297503BE7007166D5E2F717CBE335F AUDM8
277,362,309 *1B47A5FA57A22DEA80875284CC6E0613EB48056C AudOb
277,362,310 *1B4171C64D45080366E3787FB67E6F7080191718 AUDOCHARI
277,362,311 *1B4359E462BEA2800B2A87ECEE41F846117C09CA AUDOD
277,362,312 *1B4E17F4A62E38A4E4040139C2C95E115E5CD0D8 audra franks
277,362,313 *1B4AEEEC9102D2C8A62B9E1C22F22A3DEC10040C Audrey076
277,362,314 *1B4B913DA18A7BBF9A08D18F864EDDB2DA5BA60C audrey328
277,362,315 *1B4A29DF592B1CCB4B79523E6ADDFA886EF8F622 audreybeal
277,362,316 *1B44BFCDDDE7AF70C634D3FF2A0EB25718556646 audreychee
277,362,317 *1B4FA840085FCDA2F2A158832BDAE47CE90C4409 audrey minter
277,362,318 *1B43CC3B4FFF5C56B0323900E871211C34831AE8 audreynew
277,362,319 *1B47741BFD3036E94BEFEA388767EE8E87C07480 audreyruss
277,362,320 *1B48832B9D5C964E7A7A3DB5256EAA9FBF2901EB audrina351
277,362,321 *1B41944032324479CFE7BA59DFF38D54FEA32B0B Audrina920
277,362,322 *1B47B5A7ACD998EC30F7AB53B781596F065DD2B2 [email protected]
277,362,323 *1B4B466E540C7A023E29589C64CA70E6B2116E89 AU!dX
277,362,324 *1B417C168480A1EE7158B0D7A3A055E61BB7BC2B AUE-(
277,362,325 *1B458E5B4467078FAA8C040F3C63574C611F3C73 AUE;+
277,362,326 *1B4F323477A6FFD46B5C220CEF3FE31C28517597 A/!uE
277,362,327 *1B44DD7DD3F8CDEC0A677B68C12B4A341AE2A142 Au+_E
277,362,328 *1B4A420001CA6ACC76ABA5CF882A162BCF37EEC9 AU=e2
277,362,329 *1B4F614199E2DB0E6EA9017393DB782A937CCB03 AuE+A
277,362,330 *1B4EA182007B1A2F3DBDF95937255EA22D011E88 Aue$A
277,362,331 *1B472DAF8530B060B71ADDC9182ABAFDB73740A0 AUEB_
277,362,332 *1B407124974A5FE7023B80BA8D63346DB20EAEAC AU:Eb
277,362,333 *1B4D694FFEE43DC6B85ECD078E9790206EC52B63 AUe(c
277,362,334 *1B46E98E6E7F11522FEED637DB8E9B0D06EE33F4 A-uec
277,362,335 *1B4F60B9BA9451ACB7BE3C0E0F33BA18D649BDDF AUEN%
277,362,336 *1B4DE4C8A25CE8813FCD8B94BF9EF8D8488CD6CE Auengehölze
277,362,337 *1B4BD624F76FDE4BC36627BF1EFBD300B1FAC84E auentr
277,362,338 *1B4661C2C8C12D525BE700E499C86A65A571782B AuETB
277,362,339 *1B48ED270089D18723069FBA3860823B933C3C8C AU
277,362,340 *1B4F9D9C18487C8E2DF7477BD7DD6F17AC8DB65C A%UF#
277,362,341 *1B431E3D0A7E2FBF5D6995D35E16BD42A21A9618 AUF"-
277,362,342 *1B458F8DE1B3DE257C7FF6AE8BAB5BBA6ED39686 aufbauwe7
277,362,343 *1B48312DFED8636084B9932157D37DD84F96BF7F AufderB
277,362,344 *1B436C963D286C32DED0A14D8877696580B02346 AufDieFresse(clubmix)
277,362,345 *1B48C353A91926D11D47C3A9C8A87ADB14EB240F Aufdrågsweak
277,362,346 *1B4365C01AC562607E34A3448C089A1A63D54ED5 Aufenthaltsrechtliche
277,362,347 *1B4CC36C7F77ED6E81589265E0D2B9E339CC4B84 AUFFLLIGKEIT
277,362,348 *1B4158E7BF1673331A8781D37C1C7E9259EF5E05 AufForner'sRancho
277,362,349 *1B45A9841C8378459B1F0BDA62E2DAA84A6A0AFC Aufgebun1
277,362,350 *1B4A73947EF73B4DB4336DC182005FD79A7ED640 AUFGEKNOEPFTER
277,362,351 *1B424EFD662786567437DE9D4972511F0EF1285A Aufgetaut9
277,362,352 *1B4807188B3BA3C0224110FE7E21EE70CC9BDC03 Aufgeteilt4
277,362,353 *1B42DA513AA6B9DC2FE245B673FBCC08F1394397 aufgfüehrt
277,362,354 *1B4BC3B7B820FA8390F9E675FB9E67C59553CB51 aufgleißenden
277,362,355 *1B447BBB572BD321ACF3518A0004A0C38296E2C2 Aufhaengende
277,362,356 *1B417947409D485C71C9FD869DE2FD8681D79D6E Aufhalten
277,362,357 *1B4C162D43B43A7B78419BED8ED106558C3891DD Auf%j
277,362,358 *1B43E11C226B41F4F6FBA256D8F7489C01B68872 “Aufklärung
277,362,359 *1B42FFB96B51F4841A5CA412E135F9A7C3E92155 Aufklärungsoptik
277,362,360 *1B423985D70182396A99F9E8E7ACB04F0B45B266 AUFLADEVORGANG
277,362,361 *1B40A0D01BC0D6C927B9776D0C6260D442BD590F A/ufM
277,362,362 *1B41E60D6CB0954CB385CB3A92DD16B9616FF86A aufmerksam beobachten
277,362,363 *1B4A325564769E828919600323C0DB7EEC8463D2 Aufmuntertest
277,362,364 *1B4615E9C22361DAEFFF14A7B14B6DE9EC8FE412 aufnahmeantragfrageb
277,362,365 *1B42293FD59AA3832AF787DB0766147B01453264 aufnahmespanne
277,362,366 *1B48AFB883939A5C980BE155E9969797B011E3F4 Aufrufen.
277,362,367 *1B4D96BAEAD5C0C7D6AF8E9F57AD18EC816373B8 aufrufen.bestegr
277,362,368 *1B4255435D81FB3AA0A54EBB33FC30338EDFA0CC aufsetzt1
277,362,369 *1B4AD596FADC4C13A804D83F344203C4B03EC650 aufsichtsinstitutionen
277,362,370 *1B466CEFD60C580381D1D38E0DC44D2ADACAF105 Aufsplittet
277,362,371 *1B446816C8F98D33F0A5461CD3DD90BF85FECEAE Aufsteckt0
277,362,372 *1B4BAB225E5633C87A04CCE7220C3FCA668597A9 aufstelladresse
277,362,373 *1B4A4A3D204B933868D06B62202CD45E314D4F44 aufstieg1mal
277,362,374 *1B45BDF6D84E0D393C2FFDF757AD216970658768 aufstiegskurs
277,362,375 *1B46676A642F9A89E727B92D361B1D6DB05AFAEF Aufstriechens
277,362,376 *1B4DEAAA712ECD382B73ACB155EF78FAF82FB501 A+UFt
277,362,377 *1B4983DF74CAC055C8174047941961763AE4A10C Auftragsflaute“
277,362,378 *1B4861E8B305CA4C66248C512CC777AE1DC9B047 auftragwalzen
277,362,379 *1B4237824AF172E658F43B69E806EA5D5F3E897C Aufzeichnung.
277,362,380 *1B4F9E6ED70D79BDE59D701D8F9832513F1C0095 aufzenehmen
277,362,381 *1B4ADCB136674A285ABA248D3029A4BB911AC94A AUFZUGREIFENS
277,362,382 *1B47C59BF1A69E245A24FFAD74C728A97F8FACEF Aufzutre6
277,362,383 *1B4D019E6730C95138D9DBECB7FA14369A21DF9F aufzuwärmen
277,362,384 *1B413379DBB1DBDB6CEDE0227B23752D57597AC0 Aufzuwiegendem
277,362,385 *1B4112C708E5B4E97ACB04FFA23A1EEC7347F229 Aufzwangt
277,362,386 *1B41FCAF42591E0C18F894E8A63439136C28C7E8 A+U?G
277,362,387 *1B4B06C994B048C52DA58F9AF7844BF675FB33BD AU_G$
277,362,388 *1B4B0CF7E0E72216E4A36B8D3E13366173B0F64E A+u_g
277,362,389 *1B48BD58394AFC439AF278BB8625C21A17A0E915 AUG1178
277,362,390 *1B4078BE9B02EB55ACCD32DACF7928A6A8CF3E7A aug1436
277,362,391 *1B46B2043C23A4A49A518869248F9AA183CC1AD9 Aug9
277,362,392 *1B4F870F2B617EA0D9AE0457C55D9E95F48A3FF4 AUgA2
277,362,393 *1B457D5E55E1A03124B3A5F6FA06A82346A15F42 AUGARA
277,362,394 *1B4F0C49A2FE79D3E1674F0D96AF9031A0689FD1 AUGc1
277,362,395 *1B49EB300F54FCF76EC8ACE9CC61B2794A8DD32E AUgd
277,362,396 *1B4E8B3B3ED4F601171A3E931140DB0C34F98951 AuGeM
277,362,397 *1B44D18CA46A66FDEF6C3F710D1E17AB12D3C483 AUGERACULEUSACUMINATIONBITBOREBORE
277,362,398 *1B439D2EA14719167371562597631B1151689CB6 augesaw6
277,362,399 *1B45A701994ABDAE0481D369A64E72039642B900 augescitur
277,362,400 *1B4282C16EED4930A4A3F33A4F1B809484B8ADDC augethun
277,362,401 *1B40C5FC17F495168CF6125BC8A8E6B6EC3850D8 AUGHAR
277,362,402 *1B49C17146A0852DCD60D59B6642C0FC433EE197 AUGi$
277,362,403 *1B4D7F4ED023B7DEBF28F64012938D657313F627 augiasstal7
277,362,404 *1B4A4F8AA7645405C60FFA169A55DEC4B800EEB3 [email protected]
277,362,405 *1B46918C716762FAAE993F905A5FD37A28A916DB AU%Gk
277,362,406 *1B4A36728FD887DBCA6834949CAC87B26F4D3274 augliera3
277,362,407 *1B4D37325740647C0F7A2CF156AFE133CCE2810E AugLU
277,362,408 *1B461A8D1719DEC91CB66AF1E1AF48EC711AEAF2 Augmentace
277,362,409 *1B4641F135D7C7BB46EAE575174B446D52CC2CC9 Augnknöttur
277,362,410 *1B472DBE1540E91621E55963074C6A22CED4F7DD Augor
277,362,411 *1B43D810309535097F488DF3883D6F12D3D7A9F5 „Augsburg“
277,362,412 *1B476CA1DDA955FE56CDB2CE6A373BC170BA9F5F augshupeju
277,362,413 *1B47416E7314DB1243563902D129BD017F607047 augulia4
277,362,414 *1B429A89AE3D802340CCD36212C5FE67D1597BB3 Auguraros0
277,362,415 *1B42B7853694490C4400C823FCB7B67757F36619 augurava6
277,362,416 *1B42F14CA72D085B7B52F6D665BFFB69B707B563 [email protected]
277,362,417 *1B4B1CB14E5272591BE27C80518B3240D60C7D1E Augurere9
277,362,418 *1B4D1EA0750CA4E60006163DF913050A67914ABF AUGURIATES
277,362,419 *1B40FCA15F4D97F298F74A7E2F577B186C70FC38 august511
277,362,420 *1B4E837CBA98E8DF2FE344836CA9D1DAB50FAA9C augustabrooks
277,362,421 *1B42316D4DD10B1F84A92518AA1E6D655786887C august.bacich
277,362,422 *1B4CE9ED3DE62A34A51A84E8290651329A74855D august.barich
277,362,423 *1B4303A521F1EC254BAD00A472C3F7B6F6709338 august.baylor
277,362,424 *1B42E67F5974CBEA2A68B1BD2CE5392E93FEFD9F august.bendavid
277,362,425 *1B41BF9D3CF2C422473D31D29F9F6741234FC3A4 august.brinton
277,362,426 *1B481438DC5D54BE25FAFD237AF1B60131C05853 august cadotte
277,362,427 *1B413A51D97CB53FC495898FC733B7C383A571A4 august.claes
277,362,428 *1B48E1D5834E5B20F24B60A9E4517DA767236610 august.cruthird
277,362,429 *1B4269A44AE90BB5B2A2F0A78272B92845EFE4E7 Augusteened
277,362,430 *1B4A7DDFEC63BF1DDC3A20C470B29F382CF6AC4F august.gagnier
277,362,431 *1B4294C05240141FB048DAF9ECCF1B3A650329BB august.grandstaff
277,362,432 *1B4F4DEB0DEE8E5D95C629DBAD3F351B7F303488 augustine.cancino
277,362,433 *1B400C522BBA9475DE724043AA819DFEC2396CE9 augustine.deniro
277,362,434 *1B4801572DFD0773995EABF908DD9ADC41C3E609 augustine.feist
277,362,435 *1B4915D373831A617A71125D961168EEA3F43721 augustine.izarraras
277,362,436 *1B42B52C8D7148E49F88D0AAB809AAAFB6F722F9 augustine.kereluk
277,362,437 *1B47D5CDCD80645ABC45DF662E598BF7C44604AD augustine.lofgren
277,362,438 *1B49A770F69CE104F90B223DCE19B2FF0DF06929 augustine.mcgahan
277,362,439 *1B479A97259249BFDB6C36499DBA427A78EBB1D3 augustine.monkhouse
277,362,440 *1B4E87F4788012CD7C33DC828985C92D9B78FA03 augustine.parco
277,362,441 *1B4A4FCB775EC97ECD969A6225382AEFB87A46B1 augustine.rosetti
277,362,442 *1B434D9C3A80EAF2B82722B93D97B17CED0FC240 augustine.shrawder
277,362,443 *1B4B95DA61755A8AA18F7D72D09108AA1B92D940 augustine.sirmans
277,362,444 *1B476A502720B0587958B2145C5333E1B6049E75 augustine.skill
277,362,445 *1B48159A4825C814B747CCDE0E6C4F65D1C88886 augustine.tuzzio
277,362,446 *1B465FEBC787262601E0D12411102A84EFDA30A7 augustine.wagman
277,362,447 *1B45EA28BF0D83F07A0E7CB0CD11F4012FC5BA8F august.jenkerson
277,362,448 *1B44BC00ACA635F574521D79772B85E0D0A18241 august.lofman
277,362,449 *1B43E399D310D679D21E0B5496F1ED73C4C02078 august.mioduszewski
277,362,450 *1B43F0FC5A2AAA1142633DB82448A0717F158C0F august.motamed
277,362,451 *1B4FA94CFA7E020F08A0522ECF900564CC3923C8 august.munks
277,362,452 *1B4AC5BEF1C723C8BA9D820CB43C29C7E141A6F3 AugustoScala
277,362,453 *1B4D8D57AF6C8DCE9098EC27F6C6379D60A75EE1 august.pinder
277,362,454 *1B4E7B7CA3ACD1F8858914B4D2D79A9359B4DDE7 august.rodriguiz
277,362,455 *1B419ECCD61993B6A24279B117FF1C77C9E1F147 august.rozar
277,362,456 *1B4C28426B68AAFC3CC34AEA616773B780A76D8B august.searight
277,362,457 *1B4417E48662ECA96E41E80E17C0B5575B665E60 AugustSelAnniv
277,362,458 *1B40FADFE84B13A36FFB9D4D62249C1DCB230013 august.sojo
277,362,459 *1B439092A4CF41FDBCB612EF3173029D4B527C32 august.timi
277,362,460 *1B4D45EB17BD282D3A4497095BFFD99DDB6FDED9 august.twaddle
277,362,461 *1B4054450569932E18C494F33878B1517D7614EE augustus.arelleano
277,362,462 *1B43A9C61EEFD629327885D91C3A7164EF14F44C augustus.berndt
277,362,463 *1B487A5B4533A0B026AD37A7E9CCA91FEC631FDE augustus.bongiorno
277,362,464 *1B40AF85AFB62795A017E87655AA357CFC331DD9 augustus.casarz
277,362,465 *1B41912759AA8B15EB08751E670122C34F19EAE7 augustus.chaddock
277,362,466 *1B4652E3A2F872740A52777C8251E8BE316FA34D augustus.corneluis
277,362,467 *1B457580FCE1BCE8CEB92B1DF60AE4463E5E25FD augustus.fuess
277,362,468 *1B45D1BB26E5B7EE5C5AC9FC820128AF8BBE9664 augustus.gani
277,362,469 *1B4C9645E5BC38BB0C094717473489765E1C13CE augustus.gascoigne
277,362,470 *1B463F1ED7AB3AD2165C479E90D60122FDFBE3B3 augustus.hankinson
277,362,471 *1B4F04ED1DEAF251CC8C23573D7A65885A54436F augustus.jeska
277,362,472 *1B4DE7B6F5C1A9BB1C28B4E6A64BECCBF10449F1 augustus.meleski
277,362,473 *1B424770A0290F61BD7E335A0FAF0397B9837B71 augustus.okoren
277,362,474 *1B41F053ECDEDFA5CCE53EE29003D7FDE0C64042 augustus.stanczak
277,362,475 *1B4581F45A76E580EBE425F9C719A90934FC65FD augustus.stoltzman
277,362,476 *1B491CCAA212423463FFA33C341C823547E366DA augustus.swavely
277,362,477 *1B4918F8C5973A63FCEECF797C4CC5934E52F3F7 augustus.torgrimson
277,362,478 *1B40D506A864E55DD7E965E598B7C6EC86269F9C august.younkins
277,362,479 *1B4CDA1FBC9CC3F83D22189AC8C584F4C34CB91C AUgXh
277,362,480 *1B4FE37D819AA2BEA995F1BB2B426E8B4B395F50 A)U)H
277,362,481 *1B424FC7581DA5D4EDD9051D2AA462BD29153B1E Au/"H
277,362,482 *1B47CB832BACB47C584A3852D6A8996BBB5FACF3 Au%H.
277,362,483 *1B48CF4D324F58A16F75B166FB1478861A8AAC6E Auh1e
277,362,484 *1B41541218FF8B49E282C7A2CD25DAA5A9FC5DBE A_uh2
277,362,485 *1B47B71ABCA0FBBBDC8F7F6978857EC0B0334677 au-hartinger-brent
277,362,486 *1B4F7EFD06E14CAB1BA986A435AC3156EB4400BE auhcama8
277,362,487 *1B4976A23E2AF61581A16E7FE6D48515E6A0E935 AuHCI
277,362,488 *1B4C9DAAAC7FD844B6CEE98CA8D68F68BB9E4BCC Auhcinim2
277,362,489 *1B4715B3F7185BBCF99A20ED0913C3E85894BFAB A)uhe
277,362,490 *1B4E573C2E0BA620561AA214D254F7EE0352D421 AuhEc
277,362,491 *1B43102908ECC6E953F22E8E820C79C786D055B9 AUHEu
277,362,492 *1B418969F9BB3CEFA0D018A2FD3D8CC02585B4F3 Auheuden3
277,362,493 *1B4E217EA5E3016EEAEDA8175F0FA0E5891FC61D Auhgniqed
277,362,494 *1B46A086F4F48A3FE369913C0F99FCA3CB65E5D7 AuHiU
277,362,495 *1B466AFF621D25657F53D19D3ED554ED0A9B74D3 AuHrP
277,362,496 *1B404CADCCED5D323FF3DB0C8494F32D76A6B708 AU!(i
277,362,497 *1B4013C6C44A1420187AF54E93DD86B0C0DF0CD6 Au"I0
277,362,498 *1B439DEC7AC9C1F5E2DBB31707CDE1ED6E7B27EC AUI4
277,362,499 *1B4DDD92BE1EB297941159BB55ABE832E859DF78 AUIAc
277,362,500 *1B491C24BD847648449C98E1D335F22549F058CB AUId6
277,362,501 *1B4EA5587F0B2F85DEB8B154B24D2C1729AD0763 AUIrc
277,362,502 *1B4199B73610540738B17FE584793C99E76CD842 AU-_j
277,362,503 *1B4499D970E82D1865299895BF464EA07100620F AUj60
277,362,504 *1B4FD028AB9685F26C7F03520D62AB2CBB8E5E88 Au,j9
277,362,505 *1B47A5CCBA893AC6F57812F1ADC16C4E8C921BA6 AUjCm
277,362,506 *1B404BB9DEFA9ECBFD0D98DE9E8BE5AA4EC61C2D AUj,F
277,362,507 *1B42C1597ADA93ED83E4D4CB99A2177E17EC3BE8 AUJOUX
277,362,508 *1B4E573C82DAEEEBF0F12FA0BE64355A9DC57693 Au!jQ
277,362,509 *1B45BEBA46C777079E5BA6C83AC058B95928A964 A=U!K
277,362,510 *1B42ADD9F052979D1FB19CF10A4AB36732B89B6F AU,(K
277,362,511 *1B4DFB5AF34ECCA61A80BA2F1C41DED7F12DDB10 Au_K,
277,362,512 *1B41E0711D8C5A5C0532466CBD61B862A5D4E0DB AUK687DING355
277,362,513 *1B4DD28DB9698057EB1B9331A92E269101105137 AUKaL
277,362,514 *1B4550D41D4AA10DA69D084CE22EF87112815880 Aukb?
277,362,515 *1B457AFAFD676E3534E3239E904EF3FE83E00047 AUKe(
277,362,516 *1B41FC773A8CE3CFC13C0D55B2782284E0C34A44 aukeratuak
277,362,517 *1B466FBF5699E834D3A317CA1521742DD6E50D55 AUKG%
277,362,518 *1B47AD0A1F53C3DFCC7DAB463CDAADD4FF837E79 AUkGI
277,362,519 *1B487CD04794E1ACAB1AEF9AF775AD1F73A221BE [email protected]
277,362,520 *1B4F08A2F9AA0675BEC1AAEF7FE9DA5B624F49BB Auk?I
277,362,521 *1B48AFFB583082E03911C0201DE3D14EE4E8A29A AukIa
277,362,522 *1B471F5A709F0509841815E57DC31D6C005BA775 Aukkoihin7
277,362,523 *1B4C73CB8D7B6FEF5F26705358631EF872107117 AUknD
277,362,524 *1B42D6C517AD9EF3EC115496D98357F70977E9A7 AUKU6
277,362,525 *1B4536BD2FA735E3A97346CCBB4DB6EA7594FF3D [email protected]
277,362,526 *1B4A2C790AD600A50A91703C756791A345B9B302 AU=l$
277,362,527 *1B44691681CFFFEEAA9B5F8A12FE8FF6152B5F45 A#-uL
277,362,528 *1B4507D63F40B8BB7A83C2AFF8D1A2D06529ADB7 Au"(l
277,362,529 *1B4C99AB639075D2FD10CD1B41A36C52B44A97D5 Au#-l
277,362,530 *1B4D64DB3A7C53BCDE75FDA599E593BD19900EE1 AUlAo
277,362,531 *1B494FD7E0FA719822B7E26BE89596415E76415B auld、ブライアン・アレン
277,362,532 *1B48C50EBD48622E99F3DD5F691B0B26565BF9E3 AULDE5T
277,362,533 *1B4CC2C0300E564C0D41602E4535E6B9F7AF2DA2 aulder5
277,362,534 *1B47A9D9A5542FC5CE39749420807A4B0383023F AULETHIA
277,362,535 *1B4523F14B0DCD96DA469E66F03E776CFD2DFE6D AuL
277,362,536 *1B4040581FBBFAFC47059371A9BCFF8354C9416F auljuvu66
277,362,537 *1B41CEE8C70F026D287404D383FC66D9070A8025 AUlkc
277,362,538 *1B446CA9C89DE40B8775713DBDE1A371D831FD75 A(Ull
277,362,539 *1B40C1B1CBC89358CB071545999CE8FD29F6B009 A"UlN
277,362,540 *1B444E407E66681BBC1DE98AE9A9999507D8BDB8 Aulneage0
277,362,541 *1B49A72821199ACBA1434BD1591922489C33421E AU
277,362,542 *1B406B99C81EE9EA0C17DF570F0937E1212304EE AuLpt
277,362,543 *1B430FFBED2213298A36511C8ECB940EA2C926BA AU(LQ
277,362,544 *1B42EB3710EF8EF7D4F030242523088FDA35BB47 AU&Lt
277,362,545 *1B433BFAE07B24C057BE7B9D78762644F0B2F4CA AU"lV
277,362,546 *1B4124DD95C827446881DE06F9A52406F26E4FC3 AUM:+
277,362,547 *1B46A47D4694A61225320F1BEB6D03C757781F6A AUm,:
277,362,548 *1B460432862D69785F574CD091F1A4E30FCA7A24 A;+uM
277,362,549 *1B4F6D0714CC9AEF617A659204611D8BD550A584 A,u+m
277,362,550 *1B4A2987627DB970D232F803F191B95C564208E3 Au:m(
277,362,551 *1B4F2B230AA76F031CA2D2975240661F3B551941 Aum3s
277,362,552 *1B4A508DA3A793F61630C43578BA12D11DEC740F AUm4K
277,362,553 *1B40C26E40558CB6BEF3A6E478CD6BB1612577BC Au
277,362,554 *1B49A5E74E246B3814BFBD35340A1158739C7742 Aumenmus
277,362,555 *1B47446EB4C2B8CFA2B9B2509D8BDD034C5A1358 AUmih
277,362,556 *1B4CF1617E35498F89115B74A259F6C22B3E39F9 AUMMAIRSAEED
277,362,557 *1B4BAA61872D5AE737ACCBA05F2E0F18E86B5893 AUMMBULATORY0
277,362,558 *1B41B3CB06ADB5278228DAF5AE029C484E52BA9E AU
277,362,559 *1B47492570ACB08102633B20DDF306BF9DD2923C AuMR"
277,362,560 *1B4BFBC844EF1A917E20EFB8402F3B63660D483D aumsucks1234
277,362,561 *1B40C83032952E9C9774EA83D4DB3112C5C18A12 A#UMv
277,362,562 *1B4C0A7E1E34E66DE694E49BB82940D15278FF61 A:_Un
277,362,563 *1B48E3EACF4A690815B3CC936E4746A1E603E12B A:Un+
277,362,564 *1B4B0BF195AB169E2FFEF6C9A0CA426CE15069AC AUn:+
277,362,565 *1B40F1C65D8FFB637FD8BDA16A5263B3635080EC A)u,n
277,362,566 *1B4D519E03C612B6C94628ED2251D9C94A54039B AUn5&
277,362,567 *1B4EC5CBDF52517F90CFE1044228FB1E6F3DFB7D AU&nb
277,362,568 *1B400695A636F5550ECF7C2A95EB4BFB7D059DC3 AUNCITORS
277,362,569 *1B407F8177158CB7FF06136273687467B32662D3 Auncyent5
277,362,570 *1B45D0D8E9A89C59EE365F398CF61A835B2914C3 Au"NF
277,362,571 *1B4A1AF67677756A78281A5735B2C4E5DD00D4F7 AUNGPAINGSOE
277,362,572 *1B47817924D6EA5915EE38BC7DDFBFB0D6829D67 Aunhailable
277,362,573 *1B4F2C089AC1627D2B62D9B9E22BB0170CA3B26F Aun#i
277,362,574 *1B4B60908891A40A20694C0BA92E35C1BB0919C8 AuNj8
277,362,575 *1B47EB162788B0E9AF98ADF5744A34110B5293BF Aun,N
277,362,576 *1B42F594D0339377E9BFA395E5DD494785E4B763 Aunology0
277,362,577 *1B4E9F32530AFD15E5643769579E607BBF7FF821 Aunpermeant
277,362,578 *1B49C117DBECF3AB4B3DAEBC94F4F9F930AD178E Aunselle2
277,362,579 *1B40AF1EC5CE327E2575E72CCBEAD6F540F04936 Aunstoppable
277,362,580 *1B4134FCD8FE0FC49BECD0C7333002C36E2A5B5B auntme
277,362,581 *1B416C0E66B9B53DEB816896E4D20E67A9B36E76 Auntransiently
277,362,582 *1B4EBF627166B62538FC5907894C26C05D6162C4 aunt terry
277,362,583 *1B45411EA0DB24FECF4256066FDFC104A48BF944 AUN=w
277,362,584 *1B45DEF00BA439A585680CD9A95F396D407BC2B1 A,UO#
277,362,585 *1B48F6F2DF3D177B2E5B97F243BB6BF9933B0BB4 A#.uo
277,362,586 *1B4AF219E9542C513D1D42C9C3093950758567BC Auo;&
277,362,587 *1B48018AD76562E59D287134E0EB803071E09C65 AUO_1
277,362,588 *1B48CB125B7C6AD29AC2D30241BC8CBCC36FC330 [email protected]
277,362,589 *1B4221585A288135271612A517CA310600D68556 Au+ob1o9raph1cally
277,362,590 *1B470E214271DFB60E2A890B7CA3298F2EE08650 AUobP
277,362,591 *1B4FE0DDD96F6506AB7830053E097F01B4D90271 AuODh
277,362,592 *1B40DFFB2320035C89B36C0F628B9DDCFE9F5BAF AuOIm
277,362,593 *1B40738765BB9E9241E5F7A1409619776B8866CE AuoO9
277,362,594 *1B42659405FBE39DF3DF0EC77811918B37BBCE30 A(uou
277,362,595 *1B46D85EF6346D57C850595ADBFFF74CE795D8FC A;$uP
277,362,596 *1B40F611BD592A539328236B6205305C75007546 AU+P9
277,362,597 *1B445D41E0F981BBA83721F9E739091129801F83 AupaF
277,362,598 *1B4492B5B12CE2D55C650DCFE0852F902E86ABE5 A_upg
277,362,599 *1B41C097E6794CAAFEC548EFB772CF9F82DA6226 AUph
277,362,600 *1B4FA9107252C26F6E0FECB58D3BFA09880F694E A:uPj
277,362,601 *1B456A54D8CA6CB2B5E92777105ACA6E597ECA96 Aup-s
277,362,602 *1B47CAA442A3ED0EBDD031EBAB7D6B342A9AAD18 AUpSF
277,362,603 *1B4FCB0E7FAF9B7636AAF55DA2D8EF42B5EB49A2 Au+pW
277,362,604 *1B4CCE420BC349680E695C81DA09C8F513226AA0 AuPW8
277,362,605 *1B4C37E5261898B438EE140D7431BA5776C28367 A?;UQ
277,362,606 *1B47955C098D111B7D71F8F98D1CD7FC37442DF9 A("UQ
277,362,607 *1B494679219CFD771D763ACE491963447B3BE844 A$&uQ
277,362,608 *1B480EEDC9A781205E1FDC13645744361D616AFF AUQ8d
277,362,609 *1B4F25C5E3405CEE1B89D03537B1ADBC6CF5F0E9 Au(qe
277,362,610 *1B4184C8A73EF767534B7268E42D29728A0F5B85 Auqetats4
277,362,611 *1B44D22178325A89A7A24E0C30CAE5A08313502A AUqG8
277,362,612 *1B4A7BEA7E070DB72B4BDEE1334BB85D9EAA36D2 AuQI8
277,362,613 *1B4826358E4C5AE981040C054AE9EF585E68577E AUQle
277,362,614 *1B4F8AF07EF0E407A64B906D4AA1EF914EC004D1 Auquartz1
277,362,615 *1B46C05C1BEB233FD5C9B5207120CB5C6D37F1C6 A_UQw
277,362,616 *1B421287FE0714C064CD682E9E4454BCD7CA30F7 AuQwf
277,362,617 *1B450D012BD0D0796CA2D05CD6D78C9307D13BDF Auq%Z
277,362,618 *1B4315C1EB433171EBBAA4BFD7EEDB4F513797EC AUr1=
277,362,619 *1B4CD3E7F448DAFA2F490F14A7A4DDF77B798EFC AUr#3
277,362,620 *1B4B0C6FA5DF301891F0CE8E097C992F96785904 Aur3%
277,362,621 *1B4ED57CA0E1DC6805BDB4F09850773337160E4A AuR7E
277,362,622 *1B4FA93F8E1E4DEEB4025F9BF153E77F15E47051 AU%R9
277,362,623 *1B45458595DE720C5BE61554D271F223C30BDA05 aurachas
277,362,624 *1B4EECDC50503B066B10EE1C038FD82EBBDC0429 aurangzeb shah
277,362,625 *1B46C73E4F8943D92BE2AEAC88838C3F8B821992 auraring5
277,362,626 *1B4BA299218F782BB4C8EBFE2AB673AC47D2C0D0 aurashouse.comaurashouse
277,362,627 *1B409D983392DEAE5A69EB387AC98A38E5A11458 AuRBn
277,362,628 *1B4218BF9434A24FB98F9456D06D9EAA559C36EF aurelio.arch
277,362,629 *1B400BDA08D047EE8673AE5E8743C5BE225CCBFF aurelio.baltz
277,362,630 *1B4B5EE5559651E3079D6666CAF4F91206AD8F9E aurelio.curboy
277,362,631 *1B464B43986AD37D7BBCDCBB70B1DE82F9379215 aurelio.gundersen
277,362,632 *1B4470122D54C35CCBFD34513BE8718A6A4542FC aurelio.ilarraza
277,362,633 *1B46DAA0A36588C439754C545A0163AC2BE0695F aurelio.ishizu
277,362,634 *1B4EA9ED2136872AE120FEC20DCC9663D633162A aurelio.lewry
277,362,635 *1B4C7450ABD8F99A067ABA8F8D4E850EA7D02477 aurelio.newmark
277,362,636 *1B415060C72FE9B912EC27F2395CC1D0F54E9FA1 aurelio.prior
277,362,637 *1B4CFB419C7498926A80929B37F407ECA32F2467 aurelio.resureccion
277,362,638 *1B44ECC6B5B89465623DA5CFA676752CD19D1D29 aureliovu
277,362,639 *1B45A3911E28B1E7EDFE37313CD1CC41AA55EB7C aurelius00!!
277,362,640 *1B4D48D27956532E2A7A61F36749D00991109D76 Aurell2005
277,362,641 *1B48E152D5CFA25844F90D1B389B0FB4B191C8F3 Aureocasidium8
277,362,642 *1B42653BCDFD5096B6B3E845A328AC7E760B5678 AUREOFRONS
277,362,643 *1B420DF697689354249D935CEDB9856052FF3D98 aureol1
277,362,644 *1B4A8AA4003091F473988E590C7E5C41270412A7 AurG1
277,362,645 *1B408D4013EFBBB4585935DA744D967EA0E636C1 aurgasino
277,362,646 *1B43DFE97534C7BA90B2C17C93E4291944BDCF80 A/urH
277,362,647 *1B44C1F7CA063586C1D57478C864103B51EE5D0E Aurh!
277,362,648 *1B4A6B38C965547156E2415ADBED73E98E203F6D A;URi
277,362,649 *1B4BF61F2FD9608B2DDD9E39F395125E4196D1D5 auribeloise
277,362,650 *1B45A72AE1036A46AE0FA566821AEF1F540419D2 auriculoverticaling
277,362,651 *1B430063A6848B1263E2831C03CF6E490B592C0E Aurilis2
277,362,652 *1B426FDDDD28C722623D23D46A05A6B1A30620E5 aurora(radiofictionmix)
277,362,653 *1B487A072CC3A268BAE738D94D6926FBC7DFED4E AuROrE
277,362,654 *1B4AA4EEEA08DA3FF6B5B80CE14030C75438B967 AuRPt
277,362,655 *1B40CA77C019BE75AB79F26EBAF71167271ABD16 AUrQA
277,362,656 *1B48AA976A3994D3FFDC9D4A2DE1F61DC8BFB666 [email protected]
277,362,657 *1B4801FD79471128F92C6E803C2D6435F8838381 [email protected]
277,362,658 *1B4510848FE2A85ED285497E2969B61682CB747F AURXr
277,362,659 *1B43154C3EF112B045798FBCEF8A73ED49A0B668 AuS))
277,362,660 *1B4E8AF634D6816EBB43205FD1623FEA41080500 A!Us4
277,362,661 *1B4A7EFAF54F6E05A3D6049DD8F02166203D86B0 Aus
277,362,662 *1B4472EF44831A9FE325F60461262FDB550BE046 Ausathmungsventil
277,362,663 *1B4616822B782285215845068883DCA4050A62C3 Ausatmen»
277,362,664 *1B4887D5245B396B95D0378BCC5BAC10D450A378 Ausband5
277,362,665 *1B4171D80AC5C952A21EE5AA03D48604DE724057 ausbaubaren0
277,362,666 *1B4DD43991DF797C360A85E5F0A71284C2EED3D8 Ausbauinitiierung5
277,362,667 *1B4F8964FC3EA88DE088A4F93935E394DCA56763 AUSBAUS8
277,362,668 *1B40A9021684A386CA64A113C228B738EB6C48E1 Ausbertoed
277,362,669 *1B4A5883E557F9E0633168C60DFB774F7042716B ausbeuterechner
277,362,670 *1B4D29C02FF1C737A8202D0491C2CB15B8C656AD Ausbleibs
277,362,671 *1B416407EA5E5269751A75DA792FDB1765871EF7 ausblick0
277,362,672 *1B472B5284ED56602243A04ED617A78BD5A6A5E2 Auscultent!
277,362,673 *1B4E7BE51FD7BF4611BED253165E7976B3DB8CE4 au-senegal-le-president-wade-a-obtenu-le-depart-de-l-ambassadeur-rufin
277,362,674 *1B4CE43C4ACBC0114497365CC172BB5857A72BBE ausentars1234
277,362,675 *1B441C233168B47FDE2E1992C309F6A5D7FC831E AUs
277,362,676 *1B4752DD5DFC493C2B3A8DA986BC3BF4FA19973B ausfallratens
277,362,677 *1B47570741DC78B5ED4A0E45146FCB6AF239386D ausführungsauftrag
277,362,678 *1B491F2CFBB292C34330F7390CDDE942469C6802 ausgeBOTet
277,362,679 *1B4103093F5B1263DEE9439277CE6ADC303E86B4 ausgedehnT
277,362,680 *1B42A151B2E0E7F4C19B07144C3BEB73D701CCC9 Ausgekom6
277,362,681 *1B463B432293A552E416406997B2D9A1967B90C5 ausgesaegen
277,362,682 *1B48BF5A8E6851EE1492A2C3CF03407DA4188DE2 AUSGESCHRITTEN
277,362,683 *1B4A754C7976BB0C77D9078C9EECA29755920561 ausgezeichneten2
277,362,684 *1B416AE26628BB646FFF68AC507AB2D38A9FD6C1 Ausgleichmarke
277,362,685 *1B4FE05386D5F837E9F8F33A4DEC081AFDA05E93 Ausgrobungen
277,362,686 *1B4587D733360346A4F298678622F2EA206BCAD6 aushilfe5
277,362,687 *1B46EF6061F31E2235653584D552D1D4A7EA3546 Auskabel6
277,362,688 *1B4E7113B199C44F4EC45FFB6CCEED3AB9AFC0A8 „ausklang
277,362,689 *1B412221EEA587E29578F79C8D1D235245039407 AusKN
277,362,690 *1B4CCB6C0B4CC716FF5C8D83BBDE35D94D953C42 aŭskŭltintojn
277,362,691 *1B4CB85F86214A5C42A65261F8DA26F649A2AB95 Ausladest4
277,362,692 *1B45707BB16A8814107320EA5C07116093C8CB81 ausländliche
277,362,693 *1B4898DF54AC96900426E6F2807F8437C7B68DE1 ausprägte
277,362,694 *1B46A5E50EDECB974CD2EDEE4089818DE82913D3 A%usQ
277,362,695 *1B49DC2F1C60016A24AEC680C96E1B4B4A92BD4B Au#sQ
277,362,696 *1B41E0639911D5989240718071DDEC1DC82DB93B AUSQUETSCHEN0
277,362,697 *1B49CA1493E01A330882F937757D47FA9E01EA11 AUSR
277,362,698 *1B4FA8F9E3B5FEE1A35D8C98CF8AEB4C21F247E1 AuSs.
277,362,699 *1B48A1E494190BBD53C168923F9AB7B55B63EA0E aussagte8
277,362,700 *1B49EE5212F3FEAC25A235866B8CBE273BAD83F3 aussats2
277,362,701 *1B49765CB27B7DD73351667E205200E1E26A6655 Ausschlachtbares
277,362,702 *1B4E644981884855EB6123F5FA45B6B9F6FED062 ausschließicher
277,362,703 *1B4A4741260B66F56FB9C0AD846F856B4BA2770B Ausseerbahn
277,362,704 *1B4440573D9158FC008B323ECD0E4E8253917F49 AUSSENDEN
277,362,705 *1B4E37B68A9FAEDD466C654A9701E21299351A2B aussenkante/n
277,362,706 *1B4723A69E555519A23D0315BFF0A6C9C8E2CABB Außenspielplätze
277,362,707 *1B4E31CC0DE358CB2E28CD19A60A4DAF1A898999 Aussitotsing
277,362,708 *1B443E81836A2A486FFB7C1C951C57043843B274 ausspeie8
277,362,709 *1B4BD63B0789B0F1A5B16EEFDA0A46B7BA6AE292 Ausstattet
277,362,710 *1B42A0F9701800A960BA2478AC36CCC097B50F1B AUST1N01
277,362,711 *1B4792ABDA25A3CC1E803DE2498F3B4769D5DD1F austakynė
277,362,712 *1B4053F7A4B2C39784B9662D6239A43D1499825E Austin64
277,362,713 *1B422455292FABC0D3CA810A528230D773579283 [email protected]
277,362,714 *1B426CE86F53B168A0B7315B22059E76F25EE9C8 austin aguilar
277,362,715 *1B47BB139DF325738B834573F42DBA5322F6DAC4 AUSTINBBY
277,362,716 *1B4215BFF497AA443D41F0EA7FAE5680212522A9 austin.bonus
277,362,717 *1B44B97F5BCA7F533715EAFAF5718393672C685D austin.boulden
277,362,718 *1B4BFCA4EB876B856EECF32BA27FBDC106CD1041 austin.buerstatte
277,362,719 *1B41016B51CCB6B640DBF6DCFF05DE7B41160A40 austin.carver
277,362,720 *1B4079AC70E447B9D036ED42660E71BE2C609EC3 austin.charnley
277,362,721 *1B4BE6653F8C3C897676B25514C9BF214B89E76C austin city limits (2004-12-19)
277,362,722 *1B420E47B9450E8C5EF47DC51E77EC484445067C austin.doniel
277,362,723 *1B4A41C1FF817F441A4B900088492B66FFB81E99 austinericson
277,362,724 *1B44B72DCEDC71D148ECA2BD1C5F7692FA068834 austin.fassler
277,362,725 *1B48B10D544BC75CCDB754736DE8D0346D7C5DFA austin.finona
277,362,726 *1B420937F9F6888C02A9D400DF6B426F76C28EAE austin.forslund
277,362,727 *1B4AB581E918B1CEA755796949ABE1F5D0A29732 austin.gatheright
277,362,728 *1B478530EE15A045ED8D112578BFEBEE1269820E austin hager
277,362,729 *1B4E5F90A654F855F437BC93A042D8C3CC503D35 austin.ide
277,362,730 *1B4F749335B2882D2E5D49FFDFD41A4833F256B7 austin.juedes
277,362,731 *1B4F610D35D3E362E76B6746EC214A49A47EE23E austin.koets
277,362,732 *1B429EE14318A8DA1058C46FB009B95C209C88F3 austin.kommer
277,362,733 *1B467B5BD72F51D0FDF6CEBEC5A143C2D93F6005 austin.labarriere
277,362,734 *1B45B716ECFA09683CCED8AA47A9C6B856FA1DE4 austin.lecount
277,362,735 *1B4C750BF51F0BF7A9BE296CB72E7428BE7F7140 austin.lorts
277,362,736 *1B4558EFA3F95D6C6E941534853B7F47390961DA austin.maderios
277,362,737 *1B4A0AA43E74494C93732FCD64CB2DF48D8CB8F6 austin.mickelberry
277,362,738 *1B4400123157E1E1A3D047B583C51FB98F9A3382 austinmoving
277,362,739 *1B4B3FB8080A3E19FD1CE3F020B3519ECA73E42C Austinom
277,362,740 *1B47C1304A510E55F9536692CBDEA335772E0F5C austin.palazzola
277,362,741 *1B45B1074F7DFBB9F1FC93C6B22D16BDC0816922 austin.polland
277,362,742 *1B4229F9E237D97D57F83117778086578E0754DF austin.rigg
277,362,743 *1B415E527A8F882A27AD6C126AB5E6C4CD896375 austin.sheriff
277,362,744 *1B488788BDEE1A7056B3EDA0E0B5560F683F4C44 austin.stansberry
277,362,745 *1B43F68F8EA2C81B7E1B634808B17ABD52232DBB austinthong
277,362,746 *1B472B42E3EC76BB92838D3D5E84F5D3A95D8C19 austin.uemura
277,362,747 *1B4F18E1DDF7F0FAEB043A2C4D3E8C4B0299E393 austin.vacarro
277,362,748 *1B49B6F204860586475D33C838428E442826C554 austin.vansumeren
277,362,749 *1B431C8A3D660BF0D435714A0638531DE3543580 austin.weiand
277,362,750 *1B440AFAE866AD2B6D2DEC9372A98FEEFE013999 austin.wormington
277,362,751 *1B4288D78763088A834AF979C4F50300E1C00CB6 auston0
277,362,752 *1B458971909DAA10A805E5C8391AAB77048AB36D australiabuffalo
277,362,753 *1B4A5FAE632923CA12247DCF59DD327F2C9CB74A australialaispelaaja
277,362,754 *1B4BF12AF72478B0707CB98BE180741AD78714B2 australia-new_zealan
277,362,755 *1B46A4F39B9D6B3D0267342F67514369BA51EB76 “australians
277,362,756 *1B49F68115BF7395C828FAAA091A1C02D556D062 australianwedding
277,362,757 *1B4B8170D51DA8ECEF1B50FC2C58AD3ED63C886A Australia’s”unaccountable
277,362,758 *1B4700C7B9D8B71DC6E8BF298504651A34DD4DCC australien5
277,362,759 *1B4B33A304341CBE9F290FB9A58F2D0A71CEA963 Australodok
277,362,760 *1B49F7DD64EABF0EA7989D91297C0A77CE3594A6 AUSTRIANBLIND
277,362,761 *1B47405FB937F8DDABD9CBB1C8C0A76054D8849D austrittsdrohungen
277,362,762 *1B4ABC720D202FD931552B9F292A89E1448F6B01 AUSTROCCNEN
277,362,763 *1B4AF7FD6DC0D9B19F9FE581564EFEEDA950347E AUSTRONEVRA
277,362,764 *1B4FE8C2D1FCEA4E3078365CFF0D3B638150ED60 Austrophobe
277,362,765 *1B4A9FDDF0B5C89FD772829601BED29241BB90F6 austroy
277,362,766 *1B4296E856568DB7186ABEAD805522C1C8C7D169 Austynes1
277,362,767 *1B4972183B2396C4D0C0A736263021EB118A8611 Ausübungsort
277,362,768 *1B49B49E0E30496C3E4E3BD5F2393409F48A5C4C Ausukross
277,362,769 *1B493E114EF76A0F1BC509ED8C6755DFC4E04631 AUSVj
277,362,770 *1B4CFA526F789C2F0B5195D8F49158811E6C6E3B Auswahlbbed
277,362,771 *1B46B49C9B23ACAA4B0485187E10C7B46ED25ED6 Auswertmöglichkeiten
277,362,772 *1B4FAACE602A0B42D1E9C5ACFA53F15E582C5227 AuSZM
277,362,773 *1B4B2627A24A5409905BCEBCB5831DEC3AEECB96 AUSZUKOTZENDE
277,362,774 *1B4BB1BD6DAA3483D7C5C21AB45D16C5FB40ECCE Aut#
277,362,775 *1B48E4E2B075AACACA6740F04D3592E4666A7E89 AUT0CRAT!CALLY
277,362,776 *1B4A5EAEBE7F0E9131CB93E0E79AE1C0C2903327 Aut0genet1c
277,362,777 *1B404495355EFA02E8EA94DB86FF7DCE68B24797 Aut3/
277,362,778 *1B4A74010E81AFE1023A48473F4D0A98CB7E50BC autarchic123
277,362,779 *1B42C01D8074325A09045D47DA769BD8109FF808 Auteuile3
277,362,780 *1B413149D774D9C9EBC167B7D0A14BB698A77370 AutGR
277,362,781 *1B40973FB22ACE979AD0C7A25B8C3F4B6E284C51 Au#TH
277,362,782 *1B4560F2E38D8C5C1CBA5DB4D87571CDB2A0A7F1 [email protected]
277,362,783 *1B4883B54397BF6ABF361D3F1A62618D5C69E07F authman4
277,362,784 *1B433BC21CB15ABFFAA1899885C430C7ED289C92 AUTHODES
277,362,785 *1B470F6547086F711D3FFEF9E462B7C3A230E622 [email protected]
277,362,786 *1B4F6198360C338A024EF0FA2EC0CF81D671DAF4 Authorart2
277,362,787 *1B4669E1773B0EAD77414662755F8061F86B37F4 authorchavrier
277,362,788 *1B4B0396A4002EBE1F7FCB207817077EB2B3E40C Authoren4
277,362,789 *1B4AC22E2746EB1CBCAECABE33AACE6509C8068E authorhill-stead
277,362,790 *1B45F7E1258553C6DD69F5716A8F9900653419BC Authorhood
277,362,791 *1B4441300FCD94614946F2E5A2F5EF906475DC3E authorhttpcommons.wi
277,362,792 *1B4A810AF78C379C90B4F56A7A461C5600B41EE7 authoriain
277,362,793 *1B47AD07D98ED8CB083301FF7569A21C1EE0BDBE authorithes
277,362,794 *1B44812C70AE9DA5E419D5F30D91ECEE7973CFD2 Authority」だが(たとえば「名古屋港管理組合」は「NAGOYA
277,362,795 *1B499626E94ECB7DA933BF0467C01C72E26CEBB8 authorkinzler
277,362,796 *1B4B270B8100BBFCB9DD64EEBF79E4304EA7C022 authorlanfranchi
277,362,797 *1B46C94B29673EBDE3FF37A7F2BE8E7EF369859C authormeister_der_ma
277,362,798 *1B40BF6C1D4E98DE77CFF2BE01C9AE22706E86F0 authornovel
277,362,799 *1B4411B219EB68EB56C07A5A6F92A80EB88BC61E authorpc
277,362,800 *1B429FEDCF79C548072C98D634AABF4CA7773BAF AUTia
277,362,801 *1B4A21B7C6B2F5378594411302C966EAE47CA199 autism14
277,362,802 *1B4D5239F14676FBA2B2E188C53444B6603E65F2 autistic2008
277,362,803 *1B49CC92523014E26C9132836037CD803D53B7E1 Autk:
277,362,804 *1B42CF1F2F7ED9161C56CAFA7AE6C27DB3702A63 AUTL#
277,362,805 *1B4683504F737D4F4E927EDBDD922403D176184A auto1224
277,362,806 *1B444A35A9CE0A8DF4E99692B62D3DA12AB87B4D auto25
277,362,807 *1B4280EAFDC0ADE8E5FDF40E7E309D096873550E autoanti3
277,362,808 *1B4240730CC7297D2636C620D19DC8289DFC0F00 autobiopic
277,362,809 *1B45E547A389D8A54AE3ECCC00911604A1BCFB6C autoboxen?
277,362,810 *1B489D3C5172BA742F8A812B88D001C6325A479A Autocarretta
277,362,811 *1B4E8529DB757E73F375BB7BE90A00A757D3C9FA autocckr69
277,362,812 *1B430399C0CA3EAF91423EC7948C20BCF28A3ECA autoclubcomau
277,362,813 *1B47EC1DA5B915CF16304C17F2D43B55225CD270 autocoid1
277,362,814 *1B4C91AB1FC0F96894D7DB81C791ABD13BB123DB «autocontrol»
277,362,815 *1B4D1CF3D875D8A0FA66941F18375A01E8AC2595 autocratisch7
277,362,816 *1B40925E65E7FE11CEAA27A470131CA64C1AD288 autocratrix1234
277,362,817 *1B4777325158DDCF0143418798743C6C5B14E8D6 [email protected]
277,362,818 *1B4BE15C47F4B44396F73B91357E9C4484C016E6 AUTODIDACTS4
277,362,819 *1B48D9EC0138579E3948826080F8733C8DE4AA70 AUTOETTE?
277,362,820 *1B4D068C180BCC2C25FA09D34463D56A842626A8 autoevaluarse
277,362,821 *1B487936195AE3412680DCFA669508AB844F9A98 autogard1
277,362,822 *1B454DA01F9523619466E637992C5478787C2689 AutoInterwiki
277,362,823 *1B4630D866FF717367C2197210336F963A326E69 autoksi5
277,362,824 *1B4FD0F9A810B14AC6EADBB5B8CC70D1AD7902ED autolautaksi
277,362,825 *1B4675C1EC79C4C32953A8CC64851F44A7E10E39 AUTOLYCUS After I have done what I promised?
277,362,826 *1B46C26BCB16A95723D44542996D55847962F155 automaattiteatterit
277,362,827 *1B42CC3C079229A3F6809EE872E13D4F3FCCC7C1 auto-mailurile
277,362,828 *1B41A796EAAFCB63F94F826577009CDA1C5C8CC3 Automaniak
277,362,829 *1B4EFBC69503FAB4B256EFFFA541FB709AAB8876 automat
277,362,830 *1B4C6A6F7C40AF2DF0BE5A6DAA3D0A49FB0555A9 automatizasse1
277,362,831 *1B47F82BB350D87C321A99F3590C7E3462002DA9 automobilestask
277,362,832 *1B4922421E9CF987D31A761B396F991379B38CCE Automobilisitica
277,362,833 *1B4B348B62EB830E5B27AA2C17F3A9FFFAEA3605 Automula
277,362,834 *1B44D525FC97138FE1876984973C78AD8F7EB430 auto-mute
277,362,835 *1B4C292C1F8632E6049EDD99B295BBD72D617D87 AUTONOMISTIC
277,362,836 *1B43AE889E377D90E52266627413B4804DA2D9FE Autopartages
277,362,837 *1B4081AD7AA766E5FC78EDF06227AA19F694CFC0 Autophobied
277,362,838 *1B40E624C45077F82771D049D32FEA3F421AA60E AUTOPORTBSW
277,362,839 *1B40638C29B375318D4D8E624D45ECD5AD7266CD autorijds
277,362,840 *1B4251A72B01D45B27E3B2AB4F7CE3AC0BFFABAC Autorisons
277,362,841 *1B40A836B5D0F55781B94320D899988523ADAD7C autoritätsrolle
277,362,842 *1B43DDD5389A33C8AB23154DFE830DE1E1111C1F AUTOSLEUTELS3
277,362,843 *1B46AC5CB62729D1766C9493E6855CB4182811D6 auto-sterescopic
277,362,844 *1B44B43C25B83A438812AB38153C458A75D57D89 autotokalokairi
277,362,845 *1B428C2E0CC7AFF34063D8FDF4CC492D297EF3B0 AUTOTYPIE
277,362,846 *1B41E59FBCD75591099FEA1F3852FFE61E73F969 AUTOUNLEASHED
277,362,847 *1B4903218C1DEA7CD5F5B814CB3164AE469AE12D autoutom
277,362,848 *1B4B1F029B5217B6EDD8E260FE3B2FE5A4B444EA autovávulas
277,362,849 *1B4F08975589879C166BED42B4EB8504DA18DD4C AUTOVIVISECTION?
277,362,850 *1B4044F54BC526E726C737C084599BD7346C790D autresaeroports
277,362,851 *1B46A1343FC8EB02096CE4047CB8EF2C9CC4391D Aut(t
277,362,852 *1B495BF3F65480F7D53918A0930495893821C6BA Auttalas4
277,362,853 *1B49FEBF04EED7D74DBD498F2E91C6C30A30FD51 Auttoivat
277,362,854 *1B4A06BE3CE002FF62388895183AB8AAE4B92BBB Autuaan3
277,362,855 *1B4856179E5E8593ACD13D26041E29F91FC2A616 Autumnal Space
277,362,856 *1B4371D72DE16AFDA89B0961B3DC024B6E1BF158 AUTUMNCOLOR
277,362,857 *1B43D63018582AACF3C2C5491AB1E7B33CD1B971 autumn f. ides
277,362,858 *1B4D397FCAEFDE0B77DCDB3A563A9BF76A422AE1 autumnschwarz
277,362,859 *1B47FB6E01D78EF98C8EC25173AE07BBB7E1B4F5 AUtuV
277,362,860 *1B4EE786DCCD71A9684C40F97BDEA678C1C01DDE Autuviined
277,362,861 *1B472CB80840F5D89B650F93E6F0645195B6B6A5 AUu,!
277,362,862 *1B4E68AF832994913899684E9DA45C1377B65FBC AuU~
277,362,863 *1B4F8595DA2DB0DA4009F62848E944F2CC27C682 AuU0d
277,362,864 *1B4EAC7A9717E43042E28A903906D0EB8260FECB AuU83
277,362,865 *1B483DDDD35A48FF7E89F4FA68DE1686FD6E8CE8 AuUAn
277,362,866 *1B41993EFAE91FF0BA82E3A759AEDBB5137416E2 auuayuui
277,362,867 *1B4C294E122993CE68E242F28BBB3B971A855188 AU_uX
277,362,868 *1B4D257AA1A991655B87D3F807860AB648C4D806 Au!v&
277,362,869 *1B4A0671E23ABACBF6D04AEA4092DF774FAD47A1 AUv8F
277,362,870 *1B40C98589F9AF3C271D074EBDEDDE1DBD1973DC AUvaP
277,362,871 *1B4CDAE0E2F4332CB7C24DA5A8F9D96AEDCEB9A2 AUVD.
277,362,872 *1B4722C3A6190803B646580584E316C9C6A7DB55 auverlau
277,362,873 *1B40D4434609B7F84849143F1D21F71C279A211F AUVfU
277,362,874 *1B4B476E2EBDDE19424F8082020D3CDC9D8A921B AU;VP
277,362,875 *1B462144E8705C67491F06CF59C52D84857697CB A-!UW
277,362,876 *1B454A852A5E9DC84DDCB36DBE6F221E205DECCF A+U_W
277,362,877 *1B4F64ADDCC01A7FEE6A3A1BEC637B1E4D3DBBEB AU_W&
277,362,878 *1B4F4A045158C3C2C002B61A20B19E4617B65CD5 AUw%#
277,362,879 *1B49F773EF54042F5930403469091F5532469680 Au;W/
277,362,880 *1B4D40556D54D690C3677BB7DEE1A978FCBB276E Au#W;
277,362,881 *1B4170866D908E11DCBD033359A592468A5E3D4F Au,w?
277,362,882 *1B47C60CF314A33FE8E0A7D0C3CAE5422960851E Au/_w
277,362,883 *1B48496A9FA38AD0DD59F435F0A5E534057005A3 AuW8O
277,362,884 *1B4E8D6EA72A45311AA74CD01358F31C8D221BB1 AuWE=
277,362,885 *1B40A2A365BDEDDABD34FA3EB3DBA1F574C11213 Au)We
277,362,886 *1B446E6961452F2B8E4A9AD667A21183AFB51CF1 Au?wG
277,362,887 *1B47A1AE7EF0089EFAB14AFFC260A07E89A6A80C AuWGg
277,362,888 *1B40A129F393918DF3CD6E9251A46C735935A1FB AUWNj
277,362,889 *1B4BFBD58CCA91E0A79AE393734E5CEE1360F654 Auw(r
277,362,890 *1B4A74A97C298FECD31D3E835EF1F06DF19AA5E7 AuwsG
277,362,891 *1B46F1592EB220AB7B4D6A1BC8CA851D455AD5D3 AUwwl
277,362,892 *1B49D8F64BD21D193AA125B602B8099E65B1336F AuX._
277,362,893 *1B420AE97F505CA0CEAAE179C8D53D7BB673050B A(UXC
277,362,894 *1B493EFB249FA8BBDE54BFA71A9B775752D14CC9 AUXco
277,362,895 *1B48490FD94D2ABE2A33F36E3BD25CDABB6BF8C0 auxerre9
277,362,896 *1B4C391DD52455DB25768FF2FA81CEF97F4BFDC3 AUXILIARY7
277,362,897 *1B4BE94482A40A8D2FA540D9E309F6B82EACB8D9 auxios
277,362,898 *1B404AE40F3749E960C78CFACC4AF8E7AA9D3E71 aux!l!ary
277,362,899 *1B48DFDDA0E16175CF94A608CAC9F4BB7D287372 Auxotox4
277,362,900 *1B4DED688F970B449026702AA683D23A30F15704 AU;Xw
277,362,901 *1B4BE86ECDA73F57D27142902FFD86589CCF8E93 AUY,;
277,362,902 *1B400A4ADB005F5FB47B2DCBED14C37536468664 Au,Y,
277,362,903 *1B463DA1203D36240E3474CD137432AFB8FF6B24 AuY(=
277,362,904 *1B4A32044505254BAEABE88712C7FB37E149A9F0 Auy]
277,362,905 *1B4C164CAD22E53D82A3E96520267A73FB278A2D AUY2m
277,362,906 *1B45EDB5C9AA926F355962C52C457B72BB8712CF auydqke82
277,362,907 *1B432E75A45BE003FD7D394B63391E33A6CA083A A$UYh
277,362,908 *1B4D3591604E683B4244031C74CDDD0AA8C3AF83 AuYoa
277,362,909 *1B4F54140D09452CC651E5D2BE50A6475BAB4510 AuYuV
277,362,910 *1B495211FC63E37E699A7A0991ACFCFD8A501974 A=+UZ
277,362,911 *1B440787585A4E70918D3DD40667A5DE47CB04AF A/uZ?
277,362,912 *1B4CEEA9261B521C7D5B5F38F68E6E0CB2B79EA8 A
277,362,913 *1B4BA5C97EF82B1168670CCB7B4FC91DB77EC340 AUZ1d
277,362,914 *1B491D4E17AB14389A9A5CA6AD1C7A20B25F26E3 AUZ
277,362,915 *1B47088B5EAF2DC14B5EFC115450D9065BD28C86 AU=ZQ
277,362,916 *1B4CF16C027D5FD212E7EF41D6534A7708076200 AuZq(
277,362,917 *1B4C3943FB80E56A17422932D6FB8026561700F0 AUZv_
277,362,918 *1B49B19DD740E8AA99F636828FC8EFE8B7C2C105 AuZWj
277,362,919 *1B4F059B4F89774406E2CD0E6F481BD24F435522 A=.:V
277,362,920 *1B4654BB699E82452D7CFD92442F1CC5CE6AB161 A"V..
277,362,921 *1B47828FEC375D9E4E783B4578F4AE5EBB06D633 A)V:(
277,362,922 *1B4965B1A8C5166C3DCB5B2B29ED1B865A9D0EB5 A$#%V
277,362,923 *1B4C7607128676B8CB6DE6DF1C70A03ED9FF2293 A%
277,362,924 *1B49D69663EF9B1F24810E5FAE2AE0A3750B161D AV=_/
277,362,925 *1B479B2AACA081580A81765A64321ECB37744306 AV?$.
277,362,926 *1B487E0E4B8934144888CEA6791D36BD9C98776A A._v
277,362,927 *1B44A92B8297155974525A93958E32C1CA74B3D4 A)"_v
277,362,928 *1B425124DF6619123D284D0AF7F5200057889BD8 A)v/"
277,362,929 *1B43676FDFA72BF423E8ECA1C0857F444DEFB47A A&v.+
277,362,930 *1B459E9EE83823A9D72B99F454F73525F0E64D7D Av%=+
277,362,931 *1B40E224A9B617E53821FF3D9BBCCA1266F8DC65 a.V{
277,362,932 *1B4C19BA0542412B1093C378603FA2456B461D22 A!v?0
277,362,933 *1B42803B8287AF07ACFD35420A275F34CDBEF591 AV0AW
277,362,934 *1B41EE9B84C21976A51BA0ED7C5D51217A5F179B Av)0g
277,362,935 *1B4FD6E9C2AA3550A8A38335262474BCBE1E7190 AV0GD
277,362,936 *1B497685052485383F22572CDA980B9A430D79AA Av0v6
277,362,937 *1B428624CF4797F5CDC8E54F7D23E61F339741C3 AV0Yq
277,362,938 *1B45E9A95783C7F3E77E75D5F7EFA88878FB9ABE AV1012
277,362,939 *1B4E087C8F71E770394CC80C03FD7B62335EF7AB Av1NV
277,362,940 *1B4CB653ABB7BA1CD2CA0DF1DB33226C01766C88 Av1"t
277,362,941 *1B4B326A828E57209712A290EA42054A76E501B9 A)v1v
277,362,942 *1B4F28547AD14CC2667501194725F3FE0D561343 AV1Za
277,362,943 *1B4C24517E176B4631A51976D49760FFE52DE376 A=,V2
277,362,944 *1B4C59E18CAD9CF01BD155CE831A70C3B90B0000 A-V=2
277,362,945 *1B4244BC12AE3B967F16B64974CE7DCD89B8B57D A?&v2
277,362,946 *1B4445A76409A062B7FAA2ED3E90EEF9CCDFA4B6 A
277,362,947 *1B41CA5D3FEE973D65F29044A65CCD7BE30EB20A Av#.2
277,362,948 *1B44555F08E10ADE40CED676B060E57AAED1AF25 A=v21
277,362,949 *1B4FB53CE90ED47A1CFEF7E9F7F5B971EC9B99B5 A;v24
277,362,950 *1B4FF418F09AF9140FE03B351DD00D8CBBFD739F Av2An
277,362,951 *1B420E9BFF85D45FB6DD2C4F9D793ACFC0C173FA AV2kB
277,362,952 *1B44CB7E1259B896E06A38E435BD8AE1EC4E5052 Av2MB
277,362,953 *1B4BC387320DCF7859A47CBEEB49D735AD7E91E1 Av2%n
277,362,954 *1B4E9B9BF7083F2DBC513BFABB9034253E703CCD AV2Vw
277,362,955 *1B4242F5AD63BAB363308B4698113C49B54B3248 A#%V3
277,362,956 *1B4EF79FC25CC4E62B853C606BE5EA4C9A54E25A av3va
277,362,957 *1B4FFF8756022497841AB6B211987B9EF43FFFB0 Av4I)
277,362,958 *1B44045F541F2BD4F80C1183DD6A556EFD0371C0 Av4Kd
277,362,959 *1B427051E8FAA1ED1B5001C6BC83A205EF8F9439 Av4&m
277,362,960 *1B49B08BECE8C64324CF39C0FD1BE6062D96D4BF AV
277,362,961 *1B46B127201976F509CD198459B32A74B0146F8B AV59.
277,362,962 *1B419503DE63A7870E39051FA60EC712A36D1EF4 AV5Cg
277,362,963 *1B41B650BF61C9F9428D637BAA458187D2E71FAE Av5ds
277,362,964 *1B418979D15FF353B7E5307D1CD71A356BA55387 A=v5g
277,362,965 *1B4DF9B7237D705C7F3636C96B04543E6A4678CF A-v
277,362,966 *1B4A49E296A3C1E833369BF2B03978CA98C52B99 Av62;
277,362,967 *1B48EF109B27F892C01199C406EE9DDEA4BA8533 Av63!
277,362,968 *1B46BAD1B198A6C295A022E65A847CEC6E783CD5 Av6+d
277,362,969 *1B47B74ED887CE450AA1C408E9A505A8C2E77411 Av6O:
277,362,970 *1B4F1AC85705DEFCE1208801BCAABBBDD8B982A2 Av6sS
277,362,971 *1B45D6EC10324FF345468E3D2A31C67BDA7031EA A#v=7
277,362,972 *1B4434D534C44E95EB61499BE355528FFF9B604E Av7b9
277,362,973 *1B400FD896E6706C126DD2708E8EF391290CE17B Av7eL
277,362,974 *1B4C60FD6B215D2C987C905C0DD6792F0A6AF6FE AV7l=
277,362,975 *1B49F518609BC012AFA032DE2762C71A2334E9F1 Av7&U
277,362,976 *1B4B9DC906EA3AC5AFD45DAA2B67D9C1B1EC06D5 Av8Ov
277,362,977 *1B49A5D3C922D34B55D0F8B3AA7205C64F094B7C A,v93
277,362,978 *1B499D13D711FBE73E51899CFA532FBDBE6A2427 AV9cw
277,362,979 *1B4BE9F9AE8A55858E050E1DAA2187723C506845 AV+9I
277,362,980 *1B485DEF48FFE466B536A757449CCC5A19F0BCFC A%V9M
277,362,981 *1B409F664CE66DE65F99AEFEAE944C1DDBDDBE15 Av9Ra
277,362,982 *1B4434BF5195E7312B677903E903CDA4E9419642 Av9vA
277,362,983 *1B4B56029E126F121A206119C49060BEAD17201A A;V
277,362,984 *1B4FA93903090D9B4A7BE23FA6FF436132D46BAD AVa%%
277,362,985 *1B47340ABF7762442EE749B4C9232192311872B7 Ava469
277,362,986 *1B4440D0EE3FDF6E22C7A7C447B0CA57A40BD0E8 AVA9
277,362,987 *1B47FFFFFCF005D055200577950E7FF90B403027 AVA9f
277,362,988 *1B4952BC33B90BDD3DE362BBFFEAA301CFCD8312 @Avaaa
277,362,989 *1B400381A42DF5AC335E205CB4611694310D55EF Avaahuapping
277,362,990 *1B43C3D4B9B5D10025B1B9ACB17002A57405B491 AvACh
277,362,991 *1B4D90631F702D9779F37CBA94E8601972181B4A Avacnorts5
277,362,992 *1B4C532293C454EABD67543D3479182D353E8A3D Avacsifn1
277,362,993 *1B4E336263EC475C076440BA2039224A91052D3B AVaDa
277,362,994 *1B4EDA8146D59C9F206302FAB36D8812E874B63E avadnirbbed
277,362,995 *1B467BE908E18257044DFDF24C1D91BFD434A9F1 Avafjärdsvraket
277,362,996 *1B44E410ABE45F2477322A0F239F1406C7772600 Avafsidd3
277,362,997 *1B4438F0199316B94514399D647EF2760F94A310 Avagoiggs
277,362,998 *1B4CA5470EBC2BBC662C8448407F76A085F55F4E AVAHASTAABHYAAM
277,362,999 *1B4948C4BB22EA2A8EAB787B77F65AAF48F0900F available23
277,363,000 *1B489C7873BB7D2D43D2377A5ABEF6EEE19EAC0D availablemr
277,363,001 *1B461FBFF94FAE123CAC4D8A9F04E8541DA477C2 Availlis7
277,363,002 *1B4345C59195C809CCA28CC4DD02F60471F7BBD0 avalanchecommunications
277,363,003 *1B4FBADECDBE60A49FAA0EAB4015A5EF83768480 Avalifnis
277,363,004 *1B4807E104B0AA7A37EB96E55AC10B83D2FEF21D avalisions?
277,363,005 *1B4E9D84242EC9545982755B807BC77AD3152042 Avalizeises
277,363,006 *1B40A2FF4E44F24876CD3EE38DEC2BADC5B07D95 avalogic7
277,363,007 *1B41308B1A6A89D91401082A61090DE4EB5F185B avalon-classes
277,363,008 *1B46236EA2235A1FBE16E760247367CDC5D8272C [email protected]
277,363,009 *1B45DA226268DE2533F09026BBF6A1E2939E59F8 Ava/M
277,363,010 *1B4FBFC0C2AD68A1394A047085178E61EDEFD613 Avamisapped
277,363,011 *1B439C8B878D2582E0224C30B9615302A2C5EC0F Avamloc3
277,363,012 *1B4759D3FD132D79D202618B26654D847E922D8A Avanell
277,363,013 *1B4F8A87DE1C17394262821940414E7555B2F150 AVANIES7
277,363,014 *1B4FFD0271B5FAD7F5AD6765276EBB898F4581DE avanthigovender
277,363,015 *1B489A1A52C72022FF29E234C529E20040D0BA3B Avantoui5
277,363,016 *1B42B09C403B092FFF0B2C83772A13F7A7EB5E82 AvaQr
277,363,017 *1B44DC8D930F184BACF8665A8EFBE9567F4FD63D A)VAR
277,363,018 *1B4FF3D4BFEFFC76C67C86B218C2256E62473129 AvA.R
277,363,019 *1B41DB2823F5D7E3B15E67A8DB03314191E49145 Avaranto0
277,363,020 *1B432598AAEBE1064176E261EF78858D84C5E9A9 Avarbele8
277,363,021 *1B48FD0C0CAE06ED474B4D9C901EBF6BBF80DDDE avareps6
277,363,022 *1B4F51C219B5D10651DEB26A81BF9DF57ACB6C78 avariarlhos123
277,363,023 *1B413829766989CC1802E8A8D5D57E9D7C0DF841 Avariting
277,363,024 *1B4F16B33AAC60A89ADF0695BD72FFE60F5F97AE avariwn4
277,363,025 *1B4A48D934E5A5A086CF3F7976CDAE9FD2B453E7 AVA.RON
277,363,026 *1B47D92659FE1C6820B2B93F78BA6BAA58019AAA AVARSEJI
277,363,027 *1B42E90560C3C6E8B9AD6C32E0B22FB878BAFF0E avarsku4
277,363,028 *1B4943762775DE3B6BF8663DDB30E8733213C9AC Avartsurf
277,363,029 *1B47AF4E98A79367D2099B66421C3DC1010E8627 Avarutro0
277,363,030 *1B43DB0416ED9405C95216BAFE2B4E6BD324DCF7 AVASIKTAH
277,363,031 *1B406F246E57CAB021BF98976BFE8BBA9480F61F avasneda
277,363,032 *1B4BD76A8630E876C1D34B04641089447FC5CA9C AVATARMARLBORO
277,363,033 *1B49E1CDBD996D79A78DA3221603A79A563663FC AVATB
277,363,034 *1B464173F5DB76EF1BA8E597ACA2E2B9F2FEC9CA Avattim3
277,363,035 *1B49AF4760E48C45FED50A710A2931CAFD9EA64B Avattuju1
277,363,036 *1B422F704757CD865CB58C1C4E3A33713AA84568 avausta3
277,363,037 *1B4E98A7B632E5D8ABFA39BE779EA9755B5BF982 Avavate3
277,363,038 *1B4091AE95F58C81DDD0F34DB23DF86488481847 A)vb+
277,363,039 *1B41A386975DDF0535E6ECA50AA8928B5153A4CA [email protected]
277,363,040 *1B4D7B2DF25C373CF0CEAE5A06873D30BEFD0F44 A
277,363,041 *1B4BFBA35D98B819A6DBAFA929322D9897A5B347 AVBE%
277,363,042 *1B40BD39533AE0FF9AE8FD851F5817D66952842F A+vBE
277,363,043 *1B432E4C6F238B4855A321F64AA6F0A2282047B3 Av:Bh
277,363,044 *1B4130DDF836C08052F7C87EAC31ED784A0D057F AVBIT
277,363,045 *1B4CD63EBB27BFFFAA5DB33B9CE866DCA164F31E A
277,363,046 *1B4BCD0A761F48B98B9B755195B804DAD3BC4459 Av;bl
277,363,047 *1B4F7A8BB84EEDBCA513CAE6E0C6D539D1842573 AVBm8
277,363,048 *1B4A6617ECC57FE68B0F9A3E613A04F6641E89BA AvbOj
277,363,049 *1B48E8922E385B9241B016F2FDC382C11A9F7697 A-V)C
277,363,050 *1B4D9AC7754DB1B36F8F0432FC78416E9C6DC0E9 AVc27
277,363,051 *1B47A3ADF5A01FFC184BEBD6DBB87930F2440B88 AvC5U
277,363,052 *1B4FE5B6BFF87E6BCD61E0123DC0D95FED82F2A5 Avcc
277,363,053 *1B422BBF56F134324230E1A3174F63CA5A27C274 [email protected]
277,363,054 *1B4B968D021A3FBD041977AD71D06B45DF684FF2 AvcEO
277,363,055 *1B4B79BE121C69DDE932E33D9D2BB3B4E90956D4 [email protected]
277,363,056 *1B4968A700DE119A87B80BC6F06682204051A21E AVC+s
277,363,057 *1B489D87D2FE0C5C771E54B8DD164FD64237A08B AV,CW
277,363,058 *1B4051316564DEF55241ADEC92563FB88B062BAD Avd1W
277,363,059 *1B4134108479BBD806FE1A12903159C3C1868593 Avd3g
277,363,060 *1B4968078A7F78A3645B9B7F1BD196A84749A30F A%vD9
277,363,061 *1B4A078E33DDC6CDEB05B64805A4F58FB79EFA17 avdelingsnavnet
277,363,062 *1B4C1D46010DFA54E61CC3B9621DF774BA9FDC7A AvdF/
277,363,063 *1B4AF43B2D147F2CF761E3B851EEFB1DC145C682 Avdg
277,363,064 *1B45EDDDE0D84227829EA3F6C451C9F76407D6AB AVDkK
277,363,065 *1B43C2085F3E7C70AF7E2672BC9B4E04DBC77C91 AV)do
277,363,066 *1B48B02442B14544D8DEC1EEFE90D5A1D02C5A54 A+vdQ
277,363,067 *1B473C1D93C595DA4CF2CC24E576EDCFCF65A942 AVd!R
277,363,068 *1B456C78A8E4049B6382F5854F1122F80555C811 avdratt8
277,363,069 *1B4DBC0E82CB9D91E06C6C2CE1499E6B6BBC065F [email protected]
277,363,070 *1B4DEF8135438C270736C03D02C481A10100A877 AVDWWHH97
277,363,071 *1B44E33039F5FC92EFDAA5E12E49A26B7362D639 AvD/Y
277,363,072 *1B45874031A05A8F62EA6EA7616DF5673E9219FA A,-VE
277,363,073 *1B40FA65F3481A76437B908A516946ABBE8FDEC3 A-V!e
277,363,074 *1B46FF9DF26BD943EB99ACEF4668046BEA06CEEC AVe2Y
277,363,075 *1B4CEEF3D10039598FD16A18957F7141D1C2B7E2 [email protected]
277,363,076 *1B44A9E35DB0F8A2F72F66CB60BDDBED06FEF9EE AVec/
277,363,077 *1B4C31312F1E8612F405708AADBFF607BF46CA30 avecamino
277,363,078 *1B4B4E0204AED607AEBAE6BD1A3D470F99600E5C Avedd
277,363,079 *1B4FCFA95B0C84193257A05753795FED328E898E aveí
277,363,080 *1B415D237DAF8DE17C7387D7EDA9081B008399D9 AVE-LAKEVIEW-WESTOWN
277,363,081 *1B49DCF8B11EFA78AF1D257374A745C4CF29D7E5 Avellán
277,363,082 *1B49052A71D8E03C0945E72BAA6485176548C81D [email protected]
277,363,083 *1B4F3CD4F26E88C5E2B3921238FE593AB8A82D73 Avelsråd
277,363,084 *1B4CDC5E3E5F4CECB787638CB6FEFCB0D2F2543C avelyn's
277,363,085 *1B4860A6D18D4E496A68B07244EDEAEC3041E3B4 Ave Maria (Palestrina)
277,363,086 *1B464E4CB2AFD01E98C639A22D9B741E84A5834C AVENAE'''S
277,363,087 *1B4DDAA24DEC12863D45694FB056051634E5676A avenaried
277,363,088 *1B427E474EB8BC986396DB28CE7D3DB19CA3544B avenger、主演:レグ・パーク
277,363,089 *1B41D391AB92F0AB04DD14FA54EF4595E973C75C AVENGINGV
277,363,090 *1B4B35446C8A5AD3CDB7E96C20B381AAD66A59A5 avenien
277,363,091 *1B4FCA027C9634D3D9760A3E9F35F820F33CA11E Avenina9
277,363,092 *1B4A45663D59680B21DBC95247374E9264BC728D Avenir1988
277,363,093 *1B47C44810E646A3D86E859C96ECBA783E87F5B9 a_venkat_anand
277,363,094 *1B4DFC051349800C24E90A0A43CF90F79FA8D4FC AVENTURASNATURALES
277,363,095 *1B42602FED5FD5F7C9D2D9E200B4B4ED38FA40BD AVENTURE6
277,363,096 *1B406C9394315CEA69E6FA4D9B7844D4F64EFFE1 Aventyr3
277,363,097 *1B47CDF56669FE860B9ED29D46211F03FA7349DD AV=Eo
277,363,098 *1B4FF725753EAA9D23CD9C04EE93F7FA286123B4 Ave:R
277,363,099 *1B4AC77DA97B22B5986D040E1B74B31CF69B304C avera32728
277,363,100 *1B498D77F0844CD171FB2563A9E1B18749951B58 AVERAGED9
277,363,101 *1B4782F0A4A1D2B31950ECC30223113641503A68 Averear2
277,363,102 *1B45EC132943D22EDF5ADA65BEC994661835B8F1 averetts0
277,363,103 *1B4DAA28CE169D09C89B776B13C9633071FFA451 Averi566
277,363,104 *1B4F3A84D1D8DC662242DD60CE5DB651DBB2A4FA averifiably
277,363,105 *1B4F8C882F0988868279DACB51DBCBAF12E4EBD8 avérlû
277,363,106 *1B406D5D6F585E1268DE704C8384958008533091 Avernakö
277,363,107 *1B44EAD2FF70C62605E2B0620C1AEC7565BBB231 Avertissez
277,363,108 *1B4F4ECA41B4CBD6A141721B5423D311DDBEBB90 avery.ballez
277,363,109 *1B4D107BF4DCCE880C2CD7F20C3454069BDBB1BF avery.fauerbach
277,363,110 *1B481B6E20CEA99B44A42DB565748B099A33C602 avery.hunnicut
277,363,111 *1B45747B8ABA5616E14CF03F7EE2F78A4312F9DB avery.karnish
277,363,112 *1B48E3CD5C939F7EA41188459DEB0CEA9B3461C6 avery.karstetter
277,363,113 *1B47A50FEB49402D0AED17BEEBEE80CA438A4F05 avery.machenry
277,363,114 *1B4B605071171112F6D6F6D5912D7809B26B75B9 averymcgrath
277,363,115 *1B42AA14AAEDD7B7711E64306BA77871377F62B6 avery.nicar
277,363,116 *1B4EE42099C69B801D901992C648B1B2022DB4F6 avery.sumrell
277,363,117 *1B4FAA418E6CB24A810CFC00612D38E6CD0690FC avery.tsuruda
277,363,118 *1B430D9EBD1116D3CD1E0A82A1B3312C4CD6B611 avery.wacyk
277,363,119 *1B45DE12BCEEC1531E5512C03B1A4A579A027021 avery.zaino
277,363,120 *1B44155F47A47B6AB60395C3DB1C7FFCB04787C4 avery.zambrana
277,363,121 *1B40453FE0BB6EBD9BE4CA1E359B6B2C1CD27E4B avery.zipp
277,363,122 *1B4DD36A7FC20FC082E828A7F22ECBBB7AB62613 Avesani9
277,363,123 *1B4045E841C737396F541C941D7BA19F2B9BFB39 A:vEU
277,363,124 *1B4DD3F7006DD0B308E5AB30480B0A85D4CBF3EA AVE?Z
277,363,125 *1B4120D5C31AD58542F9E80E9337A1F9828165F0 AV.-F
277,363,126 *1B4598E44BE61B737ED5DE8339225D658581AD00 AV:/f
277,363,127 *1B405C3981CB56AE392ED9CC202CB4B38B67DC84 A_v
277,363,128 *1B46C431EB807F5444F17F0F2191A88574C6AF44 AVF8n
277,363,129 *1B48E4AE8238D0C548C94FA5521327A129BAD936 AVFBP
277,363,130 *1B486EBD14F0E2D3D550E5EBC2472233E998407F aVFechaElec
277,363,131 *1B49930A39D57EE398C423114CDF079085B4AAF7 [email protected]
277,363,132 *1B42F4BF038C1F0B75418960B2A614BF24D0FCFA Avfgjgz1
277,363,133 *1B4F508463B96417AC96F1D79747F58B1B5842C5 AvFI5
277,363,134 *1B40A8B590A4E6A4BB386C4E1251571A115A13AC Av(fl
277,363,135 *1B42142EBACFA766F30DF820A7BBD49DF89CD13F AvfL0
277,363,136 *1B4FC431390093681C0B690CF4A9421A08B34A8B A&Vfo
277,363,137 *1B4BA4905220D2EBF33034B99DEF77F1C9915BEF AV=FP
277,363,138 *1B44DC16FAE707A766CCAFC3D8D3EF59DC02A1FC AV,fp
277,363,139 *1B42BDDDB0C81980F6684B59FDCE2319BB0A018F AvfsL
277,363,140 *1B4D4B27BE63EED0B3F77E3DB6A0BFD29C627212 AVF_t
277,363,141 *1B422B82E519FD7D313D17383C9F0A2A2C018B0A avfwxqr5ldse
277,363,142 *1B476547439C6509662228773945555601C6E5E7 AVFZk
277,363,143 *1B466D5C929FF1FF9DE88E8E86362066F991D7A1 AV&G&
277,363,144 *1B4F03EC1377124707E13C2D91B56B5835007B83 A!vG:
277,363,145 *1B4EC84D0D87DED95C0D6B00A51E0DE1E1A5801B AvGB=
277,363,146 *1B48ABA8A73CB3791C7B565540A59769EC42A2AC A$vGD
277,363,147 *1B482EE859ACD0D37230E8C2FD81FCE852BBD53E AVGe-
277,363,148 *1B49387383C9318EECBAE9223FA32CDD207D245F AVGHg
277,363,149 *1B43B01B5D50C5BB32E613AB1FADFCCD825D53A7 Av;Gk
277,363,150 *1B44742856ED73C874E8E203093037CB50A332E6 AVgP?
277,363,151 *1B4D309D3C054C08EDBD656AC09BB2304E65E9DE AVgp6
277,363,152 *1B43523DA5D3415550E600422879DAC990FF077E AvG-Q
277,363,153 *1B42C4D735A08A4025DD64B976D1079A62E432A2 avgrunns5
277,363,154 *1B48BAD0D891088D98042246F8B47877471FE1D6 AVgs-
277,363,155 *1B40D11CD9F3244B373F08A0FC131D7CF602494B AvGWS
277,363,156 *1B4ADA93C11BB9C420BCBDCDD34F5C23E2F63AED AV$)H
277,363,157 *1B46304297A37800F805BF800A248210A9BA1161 A/v_H
277,363,158 *1B4E09F0CF48AEB3501DC04A2EC420669670936A A)Vha
277,363,159 *1B4E85674300BB27AD59E3B12A540C10503B660B AvH.B
277,363,160 *1B4E807E47782A229FEE232DF52EDF850F298C4B AVhFe
277,363,161 *1B4B384F0C00959B91F91CDDE23970BDA9485EA1 AvhH3
277,363,162 *1B40AE3CEE715BEEC23276E6C9B5F9CE53594B13 AvhhC
277,363,163 *1B4266421ED66100551059C6E64D1B97BA889919 AvHi"
277,363,164 *1B4488CE6D26AEF95ACAEBCDA6F891301BB95008 Avh?I
277,363,165 *1B4C47919E3F175172504A996DB67DFE4D4C2938 AvHjP
277,363,166 *1B44C7AB1A6C80C313D40557B69BB78D4C8E1855 AVHLI
277,363,167 *1B4FD59108A473F3E0AC4B24902E583B17B2679F Avhllna
277,363,168 *1B4C01D2A78EB0353F9951ED7B63E88B1309D4E2 AV"HS
277,363,169 *1B4C11153BA559AE765BF5171B5C80B93E03FF67 AV;hV
277,363,170 *1B45DB37C34F7BE884F77601783F9ACB21B7C1C3 AvHY=
277,363,171 *1B4233562BCD22CE31B140633D96428F4AD227F3 AVHZ!
277,363,172 *1B46449BA8E2245FBFA7C6FD28AC67C8C2904431 AVI)A
277,363,173 *1B4587AA1133247A4138E17730C076804F660070 AVIATIONMAINTENANCEWLAC
277,363,174 *1B4725DC01063D46AD70C2090FE785C9A0F4CA88 Avidarting
277,363,175 *1B43AAC982D36F94D6048CBFFB4A21FABDCA3E31 avidiously2
277,363,176 *1B4D2B5C21E06611721A7E94B9F4620D012B10F7 [email protected]
277,363,177 *1B4EFA0C0A0746F33038C38F6919E5C7232CE7BA AVIDYNE-VERSUS-GARMIN
277,363,178 *1B45E0C1D3F165CBA34234559F92AD7EF7F1FC62 AVIFN
277,363,179 *1B44F0FA3655BE04BEE8D3395FF83C58419C04DE Avigassi6
277,363,180 *1B4827F135D9F697FA7380DC63DB13105EB5758F aviktuhs
277,363,181 *1B4D58B5913E9D7D605709F490EE808CC2D0AC76 AViLa
277,363,182 *1B4F38E5E22C4DC32D80ED6E84DA4D0193C8FF27 AVILISSEMENT?
277,363,183 *1B45FC4D3A72F95F86759E6523BE44EB0FC2AC9B avindsyG
277,363,184 *1B453E32EECBD231DCBD4EC4D40F73C5AD4E3944 Avinicas
277,363,185 *1B4C1E6A0D6C02E003994625099C2B127D368AF8 Aviniitah3
277,363,186 *1B49C9D92031661D1F6C923F5D8855F8B06ED682 Avioihined
277,363,187 *1B4E35CDA151D260C3D651DE61C1861C9AAE6460 Avirp
277,363,188 *1B408884E703FCD91222874D9B8D7841E4E3B69E aviṣ
277,363,189 *1B420D95D01F59C66693776010CC0DE91222F839 avi saldanha
277,363,190 *1B46E40F8F9653326F027BD8E9552045C48A66EE avisomtaler
277,363,191 *1B4DEF53FDD971C2582ADE85B5D117161CEBF770 avisportefølje
277,363,192 *1B4DFEC0268623DBDE6BE7F20F93CC5D894FFF10 Avisuba6
277,363,193 *1B43ED5256FAC6B7A059B4003CCCED6045E811F9 AVIVONS3
277,363,194 *1B441BB3A958083B5759252623E2C742BC5C83DE AVIXL
277,363,195 *1B4E130AF62ED6A2CAE444BC996FFB7151056886 Avj,:
277,363,196 *1B449CDD7B09DA6323211149AD0E3A8A1EAFD643 [email protected]
277,363,197 *1B4A0846310306531DF6030EC5299E7E6F709EFE Avjtn
277,363,198 *1B4CE86B8FEE501402C44A11FDC4FE0A5A4799BB AVj-W
277,363,199 *1B4B960620E170D219B0A207E9E4671BA18C58D8 A
277,363,200 *1B4EEFD9E9A3F8FC4917C350860B2E9D16287148 A/?vk
277,363,201 *1B40812EC5A067F14904C2D3EE13BAF5416009A2 AVk7$
277,363,202 *1B408908C92D3B39A0BE1BBBCAC0F5238A5686FA Avk7=
277,363,203 *1B406ACC1A189A09D63CDD261087F5FA9C2CCE72 Avk78
277,363,204 *1B49168BED4AFED8E285EEC156BE8782BFE59C8F AvkaE
277,363,205 *1B4583FB4BD1431A430B87F20221928884D3F95E AVkaN
277,363,206 *1B4922A80CA39A5528AF17FE6FD4D935BFC24B72 AVKDL
277,363,207 *1B4010822ED0E1ACE76356FF8A089CB427E1A0DD AVkf=
277,363,208 *1B4E1903E8301533AACD1F8090CC9FF8A59BABED A!VkH
277,363,209 *1B4736B26A9A33073F4B938D2B3861F1ABB94414 Avkk0
277,363,210 *1B4BAB944219418583869D671B02DF472776B749 avkltts
277,363,211 *1B48A301D0AA2CE5F671B8425F12EF2020D3531F AvK#r
277,363,212 *1B4FB656BBB63BDCD68F1CE83CF373818CEFE079 AvKRS
277,363,213 *1B48223671373B3A73E35394FDE507C045D330E9 Avkryssingsbokser
277,363,214 *1B4B123BC1D75CB3C4F6571B237D5F6A4785E8CD AvKXF
277,363,215 *1B4FEF9F947060F84BDE24D0D314AFB0EF28ED60 AV#L_
277,363,216 *1B44131FCD11EE13E959E0C89CDB7098AF897A19 AVl&#
277,363,217 *1B4BC5C6B2192A4EBDEA1D147BEA70D0CDA2E3A3 Av=l?
277,363,218 *1B4C8A4C47BF7DB0C015282AF7FF6E9AFF858A98 AVlb=
277,363,219 *1B4CE186116225FD44A251A65C3479112F2DF727 Avledaed7
277,363,220 *1B46E5F49B287B3F870AAFC02CE9283A87879DDD A+VlH
277,363,221 *1B44236A165AB078E8A08E0F3591AEC040121C7E AVl&K
277,363,222 *1B49FA0C57F25DD0D15F32567E262C2F707A3204 Avl
277,363,223 *1B4960EC2C7E42D8FA4168D46D59A781B036F55E AVL|NNES
277,363,224 *1B454E3DDB32C864432C45D0D65216BF1B9A15A5 avlossasing
277,363,225 *1B4C71DF8487BE2208CA5B5D02BFC736FA7F7235 Avlsnart6
277,363,226 *1B48419AEF842A38C428A46AAEB17B20D297B083 AvlYh
277,363,227 *1B45AD356F74297DF689913A00032FAF8D08B2AC Avm1-
277,363,228 *1B4546E83F54B5CA7AE8F63858B799A8FAE7795B Avmaaa
277,363,229 *1B4253875806341D4A9CED8BC4DEA0E91B646E74 A%VMb
277,363,230 *1B4CDD02E4DBADFB5CC92BECA496DFBE17A694F7 AV&mb
277,363,231 *1B4A37706907C91A9C2499319DDA893BA193BA98 AVmdl
277,363,232 *1B483893F5459916A035566E7E1331ED57467546 AVMHg
277,363,233 *1B4DC1DC254F4B0362CEF6082761E369EB09D970 AvM$L
277,363,234 *1B4531A5C42726B2DF8CE03261B2533616570497 AV=mm
277,363,235 *1B457CD8857B91D8FD59380B904A67696EBA562D avmol
277,363,236 *1B4D1ACC401AD0066975735D735ED836F8F588C2 AvMpa
277,363,237 *1B420F1E024E2C68E1316BDC1557DCC081D46813 AvmQR
277,363,238 *1B474C65967C737D26288F98749CFEAEA1B54769 AvMv;
277,363,239 *1B4B12E82DBD55E5B204401459A50AB0D74497A9 A:Vn!
277,363,240 *1B4CF8B91576D5FB4FECA0B5B4645098AC6B5EB3 AvN/5
277,363,241 *1B4672092EB5218B3BA5B4FA114DB7D5BC1F0D98 A"VN8
277,363,242 *1B446C1A26E0BE925E07D558E59F9F76A4AB3F41 A.VN9
277,363,243 *1B4324845870DF4BD897E45FC3CDC004160DD8E7 AV=na
277,363,244 *1B41B08A25B82441C4711D30DC15F9BEEC52953E avna123
277,363,245 *1B466BBABB952224911DB6C1BCF3DA46411BEF6A Av&nb
277,363,246 *1B4ABB81BEAEB93A80CFC765A4F721EA55DB173D A(vNC
277,363,247 *1B474053DD568CF8A31FF374386E3C4321716024 A:vnf
277,363,248 *1B492F44D74464DB68A51ABDE1F12106F7F9D7CB avni karia
277,363,249 *1B4068B84EA07238F0BD09D14EF769884ACF0D57 A,vNk
277,363,250 *1B4703A39A78327EBE2F08BB7EB01DF8C2B7329C avnkbb
277,363,251 *1B4326B30C10716AC41EF22AD24CEC0E279A1BAF avnsam
277,363,252 *1B44F7324FD41D8A24F4312490542B82D0B12A08 AVn!T
277,363,253 *1B4C3FC3012D6E61F34AAF70EFD156324BC85C50 A%vnV
277,363,254 *1B4D87A41451A7EBDDCA8281C0EB2CE8817840F9 Avn:V
277,363,255 *1B4D00C22E1309A088192A37B6975FE68ED3F8D5 AVo0b
277,363,256 *1B49BB3FE2DA336E7313935274391BAB80393348 AvO,4
277,363,257 *1B4082D4DC5C3935548F0C857E0B5E16BA5F215D Avo7i
277,363,258 *1B4E23F9E70ECDEB98B38F6FEFBB4559AB92D3AD AVo99
277,363,259 *1B49EBDB2442B5C247FB557018C742DB92F60C7A Avocations.
277,363,260 *1B499006CCF7FCC4E621F506C0F17B46FC10AFA2 Avocatul2
277,363,261 *1B402C024DAC4F26B5E80AC98C4079D67BB813D5 avocoetjetp1
277,363,262 *1B473A65CCD13B7284DEA4B52CAF99BCF17793A5 avocu
277,363,263 *1B4E5B6F8B895AA79A69F96772DC4A9C94A3784A AV#Od
277,363,264 *1B4F77D183AB8426E327B4E21BD451AED8D82791 Av&od
277,363,265 *1B437C0F78C7736F91F9DE94D37DC81BC99CA270 ‘avodah
277,363,266 *1B4133F0509FB8DCC26BD44BCB85B6D03BA0D45A AVO,I
277,363,267 *1B45118FCE3D0918D28DE21E53637D3F122A39B3 avoisinait0
277,363,268 *1B460D09C4982F124AD761CA5B8576FB78B6030F Avokicna8
277,363,269 *1B469C575B46B5CE6D1C18F34919D074C4054C64 Avondconcert
277,363,270 *1B4B944283F9E7B8965B3371A2860259C6252C1D avonlakeschools
277,363,271 *1B47459C49284AB5725D56C73456AA329F947627 Avonnoul1
277,363,272 *1B49AD50247960EE8FCF06B75717B426C68918BE avontuurt4
277,363,273 *1B4DF3093ACCB35ACE34CDE9A6FBD479B9877C48 Avop-
277,363,274 *1B4F45362D5E25774280D6D1B454570DCE9A45A6 AVORAJE
277,363,275 *1B4C685D5ADA473AA8475E97E6977DE869C82807 AvO-s
277,363,276 *1B481E78FB87DEA2008D05AD5024FE33C3E9496B Avouaits8
277,363,277 *1B458AB486F01ADDE07CEFECA50B7E8C448E999C AVP|
277,363,278 *1B417B30BDC135F5CE1E403EE0EF99BB214D39D8 AV!,p
277,363,279 *1B41793DD8B3E09E9CE4426E0F92241201C42292 AvP4o
277,363,280 *1B49F3708CEFB06779D558A862B401614612BCA8 AVP6W
277,363,281 *1B44F3EF7B716A53D1C92CF3993AE1CEA540E927 Avp_9
277,363,282 *1B4650E0001323417C7D65F8880B7FC98BFC8D41 avpanelting
277,363,283 *1B467331EA130AE28483B12F26EE8D996D08F1D0 AV&PD
277,363,284 *1B43623EE2179D9C7A27F61CF70291E4D93AFD81 Avp%i
277,363,285 *1B4655D98318AF68405A595B5B4D164DB04B0DB4 AVpIZ
277,363,286 *1B4F3C049B02EA2B2908729C50533BD70B61A1E9 AvPr3
277,363,287 *1B48DE812929BFE77F46F09EA126CAB91F1308AE AVPRT
277,363,288 *1B46A357D951F1370C54CE1B5F5AC94D96A76B71 A?V_q
277,363,289 *1B46092291A5F871EDF184917E478DE4BAB6626C AvQC2
277,363,290 *1B45C3AE491B8592690CF61197BDD3A7183F7224 AV&qh
277,363,291 *1B4D5302102C2C8E8D31FE1870A2AEC30F7334E9 AvqHq
277,363,292 *1B47A909960D4AB3E40D0E8E50DA826E1CF50EEA AvQ+L
277,363,293 *1B440D8DA37F253A34F9E401888BDDAA493E0B22 A;Vqm
277,363,294 *1B4EA192FFDA671323353FDB6548B3CD94433C23 AvQZP
277,363,295 *1B495708AF6B53C628E04F09114D89462607C4D9 AV;R
277,363,296 *1B4DF11B1A7CAAF6BDA41E1A99249359F212DFB4 A
277,363,297 *1B4D40C71F01E46B0B78A87EE13FBA870F7B7CD2 A#VR6
277,363,298 *1B47470E39150DFFD9118DDD0774AEBA846D9862 AvR9w
277,363,299 *1B4364EE64CE4D549996B3538B4CCFB58FEC5E90 [email protected]
277,363,300 *1B48125CEB9ECEB661053EACF48B0B6C39AF31C3 AVr;C
277,363,301 *1B43BEF4525CB4C0CF7EB2D9CE4F8E0E3B6A804F AvrcC
277,363,302 *1B4547F792B2906027BF96529D43385886D5AD30 AVrfX
277,363,303 *1B462374A8D18B09DBFD9D90E251084146B35349 AVrHL
277,363,304 *1B4CC7616E955EC989F2DCB76F1EECCBBC6ECFE3 AVrhY
277,363,305 *1B48BBFA9FC48CED35AC01E2A85C0193CCD0C1B5 avrigians
277,363,306 *1B411800B6414CBA0A6334302D4C5D589F09D04A AVRIL:X
277,363,307 *1B42FAEBBFAD8590498F5B3BBA6705D9E65CE2C5 AVRK,
277,363,308 *1B4CF0FC612B4AB783886FE6376F4C3B5A1AFD11 Avr&q
277,363,309 *1B452711D04306112C2C1077BCF98502BB7349D5 AVRsV
277,363,310 *1B43790A068F6FD8EB8F878483CBBD351799E7BE avrundaD
277,363,311 *1B4A4971247A0609E99E52AE24BDE7F4FABC8AED AvRX-
277,363,312 *1B4EACE325652BCEE965B870E857EE268D792854 AvRYA
277,363,313 *1B46C6AFC6B9F5019FFC190DA581A959F12EF325 AVRYh
277,363,314 *1B441E76782154CF4B2962F04DA981F375D9F8A0 AV%S
277,363,315 *1B468E4300FC84801EFA9C8A31E097513B4A7B7E Av/S_
277,363,316 *1B4EFF5370A73310F05AFE325C0B0E8CF1F5E3B9 AVSAo
277,363,317 *1B46AA1B0A5BBAA179F741780BCDE48DF70E5199 AVSE%
277,363,318 *1B463183C665EBC0CB671B37914B08360475E7C5 A+VSG
277,363,319 *1B4CAFD1A2AC90DDF105D8140E666DFF2CF7AA07 AVsGv
277,363,320 *1B4DF441B5A93822AF43BF224CF894D6A0C95BAD AvSIw
277,363,321 *1B47195324D29C1A211A737D7E3AEF1D96170471 AVSKARNAS
277,363,322 *1B447D94E5B98F059ABD5BECC7D3BF8421FB1BD7 AvSKX
277,363,323 *1B43C8585B913ACDC468937705FC18CD4C5E845D av
277,363,324 *1B4B40B02BA5050D57E5C0DFED49D2B2AA32F835 AVSPNTS
277,363,325 *1B43BC6ECB05D3BA87CCE8C828990E6AC20A1CE0 AvSQ6
277,363,326 *1B4C134E512A55EEC5CB70397C0552DF43AD2AE1 AvSRd
277,363,327 *1B400105CBCD7226BC151E18058133D419D08C20 AvS=T
277,363,328 *1B4D37715112008EF135458DC4E94EDA74EB5E30 A(VsU
277,363,329 *1B4F285A70C1352FE111569C14B9F7C58401BC9F A;vSu
277,363,330 *1B417E387A7939B92532B4D1B99958E61A0FA2AD AvSUi
277,363,331 *1B4FFC3F16EC491E72A4265D8617334FBD025ED5 AvsXN
277,363,332 *1B46BDD5170B1BBB238D1A2237DEC0D4975E45AE AV)SZ
277,363,333 *1B4C2ACA55C2EDC052C8B9E8F36A66B43E5D2E2E A-vT"
277,363,334 *1B489AF2C718E868CA7E3AECC22ADF9D52CCAAA5 A$-vT
277,363,335 *1B4C7248C186C7AC88D1A201E31BCFCC0E8075D1 AVT2V
277,363,336 *1B47E2D9A2D5074E182E9D2FCA89E9FD42F9ECB2 AVt2Z
277,363,337 *1B4AB2256ED740EBA3EEEBF2AFE499594A0835D0 AVt3P
277,363,338 *1B42C8634F43D4F97013A9DE95FA606CBD946B72 A?vT5
277,363,339 *1B4E9A8D13CB69A582C6D523C31C0875717A677A AV_T7
277,363,340 *1B4DF8A31B1036C3B51F5DE39C1A1E0EB44C8B08 AVT8#
277,363,341 *1B4E536C88F864A47A7C9EE32CEEA68E2AB75829 AVTaH
277,363,342 *1B41DAE19420091BBAAB4C17682433B387E94C5E AVTbw
277,363,343 *1B4C7AB575DA933C3E12FC85EF9B2006A9B9E458 AVT%g
277,363,344 *1B4A8D4CD626B1CD8C5A4C19BA87E4228306ED8B A(vTI
277,363,345 *1B471754770F4C5D35CE2771337A58BC35668AB2 Avtjenko5
277,363,346 *1B4E3EDEA6DA22879EE51EC1DC34B37AC2C1F0D8 AVTMa
277,363,347 *1B45ABE6BE3061C1C683B5EAB1A44A2BBD5CA143 AVT/N
277,363,348 *1B4D9DDC4E35FB389ADB6F844485719852E3B05E AvT)O
277,363,349 *1B43F520F69E5981722619A3B93B8AD91E471150 avtohoriya
277,363,350 *1B49EE234A78B2826FB5E35D818D5E8063678078 AVtq1
277,363,351 *1B4158C3691F691B9BB4035D6928655BD5A8AB35 A:vtW
277,363,352 *1B453D70613B6F7CC25A75FED09100D2A9D12978 A%VU6
277,363,353 *1B4AE7CA2C8A3D6182E3A7F6B155A0093316275A AVu6G
277,363,354 *1B4EC4CEAFBD104F788BE770BF195E5A16E03601 AVU(a
277,363,355 *1B44B6931D33A1F76EEE1A36D5AE21DF821C9738 AVu&H
277,363,356 *1B4E28D3756BB7479A37DAE01277F7F8F08C8B37 Avui=
277,363,357 *1B486C43233DC4F6199E740700E9EF0A37590048 Avujroh8
277,363,358 *1B446FFA009689EEFF3330A9B8FED974E0F5A62C AV:uk
277,363,359 *1B45AF470A4DF5317BCA1811E4EF4891EF7ABB3A Avukniled
277,363,360 *1B4F359412AA132E143AB01B9570F7C4B6534E38 avulnurh
277,363,361 *1B4D9703785C6C8DBBECC42B80532D093D4C4EF3 [email protected]
277,363,362 *1B44B224ABBB57D48588450ED0EE4E5614A8485C Avuraish6
277,363,363 *1B4802B7A5BD172CDC84A0DF8D290803D1C13C1B AVuSF
277,363,364 *1B4ECB776D2E1E69768AF708B154ACDCA746045C AvuT8
277,363,365 *1B4CD5AEF534F54C78FBAB3408959CCE6730C65D Avutuajh6
277,363,366 *1B4BA64085E3910C959840C0E7CA20F765E0DCD5 AVUwp
277,363,367 *1B41EE2D1C74277EDD2C45C7E806452C234D31EE AVUXc
277,363,368 *1B48077D1278B078E3A9434098EDD8644D92F927 Avv5d
277,363,369 *1B418EDBE28F811A115FEDB1ED23F9DDC3AACAFA AVV6k
277,363,370 *1B47CAEE2F9D46DEA1D9B224FE3CF8492FDCE5D1 [email protected]
277,363,371 *1B4FBADBF457E55CB87F3C35DBFDBCF0FF7A0490 AVvE&
277,363,372 *1B4447438B3C575C6DB9D0A124137C65474CA70A Avverato0
277,363,373 *1B43A5267AC249442E3203904074D6C0A8A6867A avvezzammo
277,363,374 *1B4043EB8144307034891A3B4C0D6A84D5BF79B7 AvvI3
277,363,375 *1B4540DDD2997C2CA9FC1EEFB3E08D9BB3DA7272 avvi+3ra
277,363,376 *1B46AF0D5BBFE75947D1E9A876F31762A41E6A5E Avvikelse6
277,363,377 *1B44565B78AB74D7FE1C0F7B53E8505AC55263ED Avvikle7
277,363,378 *1B45A8E4CFA59815AA0286D42286202595B64853 avviliamoci
277,363,379 *1B40110905E19FD5870E129AFA7517F14FDB4C5D AV_"w
277,363,380 *1B4AC12ECD56BD5B2D71DD264B3A5B53F8435969 AVW0w
277,363,381 *1B490ECA97E1DA27989E2D917FC6CE78A449A628 [email protected]
277,363,382 *1B44FB8CD9BD6D72BAFA28704222DC9D9932E895 A:vW2
277,363,383 *1B4E49C25E5E6E389A9EB3F6DDCC75B286AB478D AvW2$
277,363,384 *1B40F017FD7418C2EC67561791526CBF9D586138 AVWbC
277,363,385 *1B47CF148BBB03FBF7C4E3293F02AEB6319E2AF0 AvWfm
277,363,386 *1B48906C445E003FF01BC1099F8B25D96F345E31 Avwia
277,363,387 *1B441630B78F6585F4AA431252B8D11DF8560F8A AVWIc
277,363,388 *1B41DB6D72221F1C147EFAA3BF337E4A5217CC24 Av.Wk
277,363,389 *1B4A0C01239B2D990A05BD01F0BE14B6305C15E7 Av,wk
277,363,390 *1B40C10914FD2114F2B769518B179107849E04AF A(vwl
277,363,391 *1B48B2EE1F8EA4BCECF7042E967E42CF1047F11A AvWo$
277,363,392 *1B4797EDE089FC706637B82DF501792FD97BF54C Avwts
277,363,393 *1B4647075C1F006F25332D8EBED3C7C5E170AC2A A,vX(
277,363,394 *1B41FFC0F795D636EF5D7027F1AF1B0D638BD8F8 AV+Xa
277,363,395 *1B44F9091A8E57E3BE89874E946CD8FFB381D27C [email protected]
277,363,396 *1B4C8DD33255398A5EB4C96C739E1C483EA4B7FE AvX(H
277,363,397 *1B4E07E0CDA2E05617EB829D2D652E8B93230036 AVXih
277,363,398 *1B42BF670D2597361B9ECA3E4614D97DFCDF279F AVX/n
277,363,399 *1B475AA65D1F2BB20F08FDEC013F4522BA5F296A AVXrM
277,363,400 *1B468AF95C17BC7CE7391A5D2579251BDDBA6E71 A#.VY
277,363,401 *1B4F4ACCDF77AE88A93E059B5CFA40D02A31B9C0 Avy:
277,363,402 *1B40A64794B3CCDE26F85DBB4A81BF639BD2DC7C avyabanhaberleri
277,363,403 *1B49A2FAF0FD4932D9BB65337B5B3E8998B0E4D2 AvYou
277,363,404 *1B47E10649A073656328757C517899D10ED12D6B AVYqU
277,363,405 *1B4C4CB16EAA94DF8609A4CC9FB1A0AC8636299C AvZEB
277,363,406 *1B4487E49FCCB20ECDE82B8E2FDF82464911BC7E AVZp5
277,363,407 *1B46EEDF377CC0A935BD3A6B224EE2DA37D5B4D2 AVZZ!
277,363,408 *1B45039C3A15ED970734D4045B68157B37B17691 A-$:W
277,363,409 *1B49ED4F3CCA3A25BBB079B6524FEEFDFEE0FD19 A+
277,363,410 *1B40A478C3EABA64CEB27BCAF1E9489343CC1DEF AW_="
277,363,411 *1B48FD8206F222D25BEC0F766814A8985FDD1D3B A:$%w
277,363,412 *1B446DBBFD036397CCB3DC444F1F0FE85D8B38DA A%w/?
277,363,413 *1B4FBA18A103890E039453FB731F6FB877B1878E A+?=w
277,363,414 *1B43A4AE5CF6225352547F72BEDA1DAED8E7A7A2 A+w#&
277,363,415 *1B41CDAC238CAF3594755C5553596F5DA40EBAD4 Aw""
277,363,416 *1B4EB40F18FF13443564B319B4BFDAEF1E17FED2 AW;0;
277,363,417 *1B4553DECD34D39FFA1E69F2A0EB015947498FD6 Aw(0q
277,363,418 *1B480E60FD5AE9BBAAD64EE0AA32DB74F72A1FE9 Aw0r_
277,363,419 *1B4CB43EDF38C9B2590B11ED7FDEED703BA90343 A=W0w
277,363,420 *1B40E5C3F9A6C74640834031E8E34FC2CC06E313 Aw0/Z
277,363,421 *1B46B3A5C84EC3ADF3A7AE7FF4A6A7CC58DEA4A9 AW&1
277,363,422 *1B4C529889B8B53876E9CDA63EDDAB33EF5C8439 AW117
277,363,423 *1B48BC30277F7F027A4573D8EAE34F2CF09A133E AW11I
277,363,424 *1B4479F0B28EE31252C438F955FE4A1DA56746A8 Aw1(N
277,363,425 *1B439AB42A8CFBD1B673CC6A70F43517CA7D5B72 A;W2!
277,363,426 *1B482680AE1527B01814A03E2E53C8795FE08F6D AW2-3
277,363,427 *1B40377B636E3F6E72805462708D59CBC1089455 A=w2d
277,363,428 *1B4600A42AB82FB9E83A50A2EF28780DA3AF4804 Aw,2o
277,363,429 *1B4B19E15E504BA3B54C1C9F86323C742D16F476 A,w2S
277,363,430 *1B4BFFB224FA131343EDA38FEDABF69E701EA758 AW2sP
277,363,431 *1B4E46AA07C692D441461E4AB9CFB15879D96634 AW33c
277,363,432 *1B443BB4F5D74C3C476809B0219F76F451DFC682 AW3e5
277,363,433 *1B48BB5324CD9A52685029B8BEC3510249D7351A Aw3r5
277,363,434 *1B456E342174CB9F7BF527A1B948B35191DB273C A+W?4
277,363,435 *1B49DCAF95BAC697D32EC394A3DA5EEF2F99DBE6 Aw40-
277,363,436 *1B4EA8A29A919555AC42A95200508E5C23CBE617 AW4/E
277,363,437 *1B47A5EA6D956BE9B10EF89610E162F96E173E67 Aw4M
277,363,438 *1B40E1C41D3B154FE2A85A2871E2CD3A00435F22 AW)5-
277,363,439 *1B4F92FA57534F6A79E215DDDDDF6BF25386265D AW5jI
277,363,440 *1B492EE7ACE1E69609DAC734CFD516335019E587 AW5.M
277,363,441 *1B4D04D57264F166153B4AFBF96214F32D577D7B AW#5s
277,363,442 *1B4F369D185D0C5DAFD82E3C5E5A93DE8E0F36FF AW$5v
277,363,443 *1B464C0AC8D4ACF9F6D072739BCF2EE576F3EEE2 A!,w6
277,363,444 *1B4697D2FB1C608B994FD07A7C1D03FD8D8B697E A.W6h
277,363,445 *1B43ED4107FED8F872F9959F3E8199F53FC18796 Aw6=q
277,363,446 *1B412F79BF33DD1FBE19A6D7DA5ED3BD9F871FAC AW=$7
277,363,447 *1B437755609BF8D3E7C275961E2A7DBFCAEBDEEC Aw7!/
277,363,448 *1B4AAB915538AFA336FCE2E4DDD9D4C97AC04B45 Aw75?
277,363,449 *1B4CEA04161A40535236868CC524439FB588E1E3 A"w7u
277,363,450 *1B47D4A56A4844CC471075CEB0772AA65B39E830 A;w(8
277,363,451 *1B4C115326547F7D4D1C7769B8760F10C102493B Aw8($
277,363,452 *1B439038A61CE360B7A52666D88DE8251FCE71CA Aw89/
277,363,453 *1B46B9DE2B894B322B470C4FF11C4DE25B3EF229 AW8aI
277,363,454 *1B48EB8DC9301A3E7A579774BEFFBE4386ECA5AC Aw_8v
277,363,455 *1B40B575E011EF3CB51347BC62330243A4FA03C0 Aw/8W
277,363,456 *1B46DB72A3509F016DE7C1C8F920A0DA2D31CDCF AW8X_
277,363,457 *1B49A693C2599557023A18C41FA053A67D66396C A#w9
277,363,458 *1B4E48398725486ECF0D4D834D4E2C2AE4A082AC Aw96#
277,363,459 *1B43ED04892AAAC0CCDC7699806254A54740535F A:W9H
277,363,460 *1B4E32D74107D1EBAA3D5F3B573F96276194DD43 AW9jn
277,363,461 *1B422045A30B64503AD2C31C1FDD6CD1FCD90822 AW9jX
277,363,462 *1B42073EA3770BF2B43A3678CC2D74CFE47A39A3 A!WA)
277,363,463 *1B496B362FF4ACC4129520D396B79D2A8FC278BF A$(wA
277,363,464 *1B47593A24A135550D344AB01B1BBD7746FDDF0B Awa[
277,363,465 *1B479BD10565BA2AA753BF8D82C752D9E34B36B7 Awabagat8
277,363,466 *1B403CE32E6A1CEBD6B63E9513C41EC6BF34EA18 AwAcA
277,363,467 *1B49330DF1277561844EAD2720352B4E01718E2D AwadhAkhbdv
277,363,468 *1B4828FB3ED0BEE74C29F62812A1D60659FF1B7F Awaganas
277,363,469 *1B463228E45C3996676B9829DEEF5DA6E668E448 Awairom8
277,363,470 *1B4BF632CD5FFBE7F2235CB28A9B8427F15B9167 Awakenting
277,363,471 *1B4709D5EAD6ED3C6A09EA590DE8DDFFC8D11CC5 Awakigo2
277,363,472 *1B4CDF5ACB3EB777398A90CC7278320798DBDD77 AWAKZ
277,363,473 *1B47D5782A8F7B47801B2D8BE3988630A4E1875F Awaland7
277,363,474 *1B41FA8AFE94C2BBBAA3BCC247FDB874845D5784 AWalkWay
277,363,475 *1B49538C32D46E967E3CAD646FFD516367E328F1 Awanarap2
277,363,476 *1B4CCF2C87A7F25319BD31E3C9540F1B72D61222 AWanderingWinterdreamBeneaththeColdMoon
277,363,477 *1B40B38E305BE288E040AC791CACCBB9758A08EC Awantie1
277,363,478 *1B467D3526BE023523BA253CC61AC4AAB29E7C3B awaouedraogo
277,363,479 *1B45EEC0F021C7B72A4B0CB9EBED59728066CCA7 AWaOw
277,363,480 *1B4D6388104A74ED81DDC3B8AD77B6B8015FD104 awapatent.dkwww
277,363,481 *1B434B542223B5B7B2BB4C4F95C8ECE3EE771C87 awapuhyi7
277,363,482 *1B4FEB67B904BF91DE4570F902445DA504F18FED Awarcraft6
277,363,483 *1B47B2F81BBFD2072B8C8D74F825F603E21C7A6E award.28
277,363,484 *1B45DEFA3E5F4F22FC3B69D5415B8C725BC0AEAA awarded-artists
277,363,485 *1B412D348B9E3AB774BC2BE2A1A57E337FE62E00 awardliverpoolcomman
277,363,486 *1B4B7F3E0619F67170FFF7BD2FA36D913588B2C4 awardmanoj
277,363,487 *1B4AC051457D5973BCBA64D1D393CDB36FE016B3 awardonline.comwww
277,363,488 *1B44CBA7EF281FA26630AAC57C137F0543CEA294 awardspalmares1998
277,363,489 *1B4950DFA83162B97EDB3CCBFC8A7B5159AF85B8 awardsstate
277,363,490 *1B4F3E301774D83FA07A2B8C5D94BB7AD515E1D7 Award功労賞
277,363,491 *1B448B1928AE97889AA2B4456126496612DC2A7F Awariet5
277,363,492 *1B40542E0B720C47952A9CBACB152F3C508F7D3C AWASARIH 2
277,363,493 *1B4BC295E6064C6606A6EB58C6B657468A1C75BE AWaSG
277,363,494 *1B4F36A8D14FAAC9C5CC5788A4BDDC8C62C5C9F3 Awasijut6
277,363,495 *1B47FCFDD20F7BA6B587B7602E4F6D036B65B80E Awatinas1
277,363,496 *1B4B05791AAB63EFC7B09458E8E425004B470D52 Awatiri
277,363,497 *1B4B32AA82BF365CFFF250722C4487FD7BAC1188 [email protected]
277,363,498 *1B4E1E95FAEF372E9810BE1D6FEBB35142435122 AW#Aw
277,363,499 *1B4BC2930EB39A39E07DC9DD1CC58F0B9249C228 awawlqus
277,363,500 *1B4FCDDBDF575417BA049F271AAEE11A0AA33E1E AwayWayTooLong
277,363,501 *1B438A9271F1B1E7DF26561A0AD4AFE4BF1847F5 away(日本盤とuk盤のみのボーナストラック)
277,363,502 *1B489A4BE3EA3942598D058FC7C5016708B8D826 A,W$B
277,363,503 *1B4F86FA64BEC75D40E94B94C55917B64D5ADFC6 Aw/B-
277,363,504 *1B4E15BBC34E955146A98294F8CFDB7F5E1D61EA A&wb(
277,363,505 *1B4AA84F080246184F59676350C77A6E95131AD6 AWb4$
277,363,506 *1B42AA6784A17595D56B6B8F23310F3D72551EB9 AWbb,
277,363,507 *1B43AA3F383F9E38F86DBF92E1B36B2916EEC1E9 Aw%BG
277,363,508 *1B4C969AFBE670B7DBB70F984AD3BD61D6FCF0E2 AwB!i
277,363,509 *1B46D30D819BF8B111F32F2AC674278489221086 A-WbK
277,363,510 *1B40F875FC904E6CCFBD37059BB9713B20529151 Awbl4
277,363,511 *1B468B715C04A41CA191D1FCF3D5B8ED0E148D3B AwblT
277,363,512 *1B44294B80C4A53257FD6941021A5D024E886D21 AwBP"
277,363,513 *1B4454BF38D28D01C6BD4AEE56DD2E287E8CA8F5 Awb!R
277,363,514 *1B43DC44E38A54AA0DE604306FAA7EF6FADC91A5 A:wBu
277,363,515 *1B43A7F7BC8FE87500282FE990A3BCC8105C80A8 AWBuu
277,363,516 *1B44A7A3D3BFC8E409B0B12643646DC175E35678 AW%
277,363,517 *1B4CBDB3FBD36C072712C512D4F06C0B0E43C75E Awc&(
277,363,518 *1B42F932F08DF751393A3CEA6D714899E5CEB86C AWC6)
277,363,519 *1B49FE649A5D3CDC15757E2C7A0F7B1511198444 A(wc7
277,363,520 *1B4616A18DDBEC74F565398FDC9BEAA2B9D6317C AwcB#
277,363,521 *1B4453F4C82667A062B8DD46A90EC23EAC2D90D3 AwchR
277,363,522 *1B4B85035ACAC549BBDF17F03E3B7770632559F3 Awcie
277,363,523 *1B426109B01B1AE39786E3B3920093ECE06205BD AWcl(
277,363,524 *1B4ACD8B2F43E793C93C4D72F4DA4B646F1CE991 A_wD
277,363,525 *1B4D415C3B03A2DCC055AD77920A52AFD864A00A Aw#d1
277,363,526 *1B43D2BCFA2862C93EA3D06AD7F1653EBC5D1AD9 AWd2Y
277,363,527 *1B485E81D86C000952B8B71EE8207222337D6E45 AwDC.
277,363,528 *1B44A2F73AE2A1DF41D1CFC4FEAB0FBE077103A0 AWdd/
277,363,529 *1B455C30F7FFFE40EAA5A355A0E96BAE3EC43C2C Awdgyxfc1
277,363,530 *1B4706DA497CF7FF3E2A67F7C5906938AFC686EA AWdH5
277,363,531 *1B4D56B7FC351C8733C81157AECC767D3CC04921 [email protected]
277,363,532 *1B48F4F03E8B15DA7C74DAC429C65B7F0C57C33E AwdK
277,363,533 *1B40483E0510EAD7DD3FF6D9F5C47C1F8609BC29 A=wdk
277,363,534 *1B42637163EC90ACAB2BAEC0FF92AD4F8AEB53B3 AW)Do
277,363,535 *1B4E426B57EB0534BB414B52CD8A87B31000BFA2 awdr096
277,363,536 *1B49E372AE342E226B6C28B74D3E94505A1B53A5 Awdre
277,363,537 *1B43629BC634BBBF9352B1EDABDA3C37BD058D76 awdrgyjil219
277,363,538 *1B4DFE9094D65EEB49923F275D69240783DECA99 AwdsN
277,363,539 *1B4285FD5D1EE5E1BA38A157E9B8C4019F447963 awê
277,363,540 *1B445186B40AEC00BAF31BE3E6191E99666DD5BC A?We4
277,363,541 *1B4E324B9EEBCD213E5B85A9E2F88FE8D31C01F4 AWE9k
277,363,542 *1B414C9B09EC8D0992474F6952128205E089B2F6 [email protected]
277,363,543 *1B428959124E5A94CBBBE923B2483FF9BF5FAE98 AWE,d
277,363,544 *1B4DB2BFF4F48676B2A8C8ACF4FD1B373B2553FF a_weekend_in_the_cit
277,363,545 *1B423B1217081FE3F7BE2C499C85A2DD7BC27800 [email protected]
277,363,546 *1B41E718E09057055C2F5DAE1D1A31531E657EC7 Awelbatsing
277,363,547 *1B42C844B9623BD82DB077CD1B5509E93EC65A48 AWENDAW7
277,363,548 *1B4DA78680CC21A433A9DCBDEA189E948A5FD7C3 AWEscalier
277,363,549 *1B4FFA0CA6437F49A4644F02148C1D7E423DE13E AWESOMEENTER
277,363,550 *1B4E1A676B997BCB45230FACBE29E9C18EDE9585 AWESOMEGROW'-'AWESOMEGROW
277,363,551 *1B4D962ECEE32540504EAC2816D3746231AE938F [email protected]
277,363,552 *1B422047ADB16FE8452A080DFEE02CE2595BE59E A.WEU
277,363,553 *1B431DA4F94BF029C7D4EDF103F57005E7FEC49F AW&Ew
277,363,554 *1B40D31FBC5CA781461EAB0BAFB821229F270E77 AWEXQ
277,363,555 *1B471CFB6353516C10F3AAE02D95330E56A915E6 AWF#-
277,363,556 *1B4FE52183E9D182A7CD4BDAD8137EC80FB766E8 Aw)_F
277,363,557 *1B47C7FFA7C86F6822926FB9619790A89BEF9D55 A(w%f
277,363,558 *1B4263AC488CC79A3D9E6AF8130AA95A92F0A29F AwF0=
277,363,559 *1B4BAADFECC059BA3B559C62DE64B262FC8499F7 AwF4
277,363,560 *1B45D59C45E23994F6E53F090F1E0C4239BD8536 AWf5;
277,363,561 *1B426B0D28960DCC3AE03ADC7D3B4A6D66C2853F Aw.FG
277,363,562 *1B4E3EF584E5C498AC3642D2EEA5AF976EE482CA $aw file
277,363,563 *1B4FE4D3232292F0A733D58838D2F172866D790C AwFne
277,363,564 *1B47E4F8738F5B0A00F12A992B4449339F7531AE AW,FO
277,363,565 *1B455F79E6FE5DB08F57EB9664DDAC87BCF8D660 AWFSCHOOL
277,363,566 *1B49163EB345D3DF4C19613703B2F335532F079F AwftH
277,363,567 *1B44EFEE94D5EE801318B27F0ECF2EE9DD952465 AWfZX
277,363,568 *1B4C6F2ECA743AFBA554FEE34B0182862AFFFE85 A)WG
277,363,569 *1B40AB9ACE39E5D36EE6A6623252891170727D6F AW,g"
277,363,570 *1B432CCC827BFE8D4CF58ABE816EF4A68145F14B A_wG(
277,363,571 *1B4732080D225AD50AA79134EFD01950F6108C12 Aw(G?
277,363,572 *1B402677804C6BF3E2CE4E12C23657F742666553 Aw)(G
277,363,573 *1B4CD21480F08EBD8F5C8577B0E72DA7BC3E70E0 AwG++
277,363,574 *1B4133F61DCC1E95FDFDAAB44C50CE6E860DEF0D A#w#g
277,363,575 *1B4D122BC93F0F99E63FEAB79610F77EC94F5A88 AwG!9
277,363,576 *1B4A4969A29BA7F64B7C32631FE12134BB17483E A
277,363,577 *1B4120400EB99AA227F3014599C9CB0E641F2457 AWgEi
277,363,578 *1B4D3E5791DA65F19ED24A84434C1E936EC79A92 AWGGI7
277,363,579 *1B4D3FFFC40BFDB90A010ED4E291E6B1193A04B0 AWgjY
277,363,580 *1B43544942769EC677DED0E744AD372D3ECAC603 A$wgL
277,363,581 *1B4833A4CC49474B38EE39A2F318DA5A2712FB31 AWgNC
277,363,582 *1B45095B4284F729FE3F11D48F73AB21901C0E31 awgrove4
277,363,583 *1B4D2F0D06D3A830A29EAEB3A4D5186633736D72 AWGTP
277,363,584 *1B472AFC9A3C3DCC9777A6533E9434E29B6F948C AWgvn
277,363,585 *1B49E6307B9A0B80D21ECEFC1306012BF9278C2B AWGwh
277,363,586 *1B4DDFD1EB6775D2BCE0DACD0F6B666CF3956D7D AW!#H
277,363,587 *1B43E62EAB0CFCC4FFE0F2E7AC439FCCEC203B5F AW+_H
277,363,588 *1B4947891F9ADD1994A62F726A81D24BC28E7728 A:Wh-
277,363,589 *1B4FF55CC1D2985F949523701A802030B5AE0C20 A$wH"
277,363,590 *1B4749930D7D9826E8D3C5802CFEC444FC612A10 A/wh-
277,363,591 *1B4C7E0B96222694B999A4911E09EAED509DCA8F A&wh"
277,363,592 *1B4CD9C2BDDF5B946083DC627EBD14BD46EA8FBA A#wh.
277,363,593 *1B467E127CD589A443458F7B4028538A9ED898AD Aw?h7
277,363,594 *1B4A1F382F1A9E0A1CABE7ABAA04146121C4134D awhcaati
277,363,595 *1B4C2DB8CFB371B2E8527C08C66AF59493AB2623 Awheels2
277,363,596 *1B430F5B2C1DC8089BA4ADAC169219335A6391E6 AwH$g
277,363,597 *1B42C0152288BB78AD889EB0230A54EAD322168B awhites708
277,363,598 *1B45DBB5A88674D72526B5FA71C7EF413F5C6803 AWHOQ
277,363,599 *1B40BACDF666C51BE1EDF609F7C43221EB6BA1E7 AWhQT
277,363,600 *1B48E339B274414CEE15ED9098AE0FB2C75C10FB AWhuD
277,363,601 *1B4644B382EA2715952D00AE6F2DAA08AEFF5AB9 [email protected]
277,363,602 *1B493C9B94EA561C02B32C815087269071DBB3DC AW;hw
277,363,603 *1B4705DE3C68C81D8839DDC62820C8E1FEE2DE0A AW=hZ
277,363,604 *1B4E83CF0FB17C2CCF3E7A9A2F79FC81D750A241 A_&WI
277,363,605 *1B4E03E64676EEFE36EE837CD8E4F6CADA751008 A;WI%
277,363,606 *1B4EADDF1D2095ECF7C79D32D9C4A116DAF5852C AW:i"
277,363,607 *1B409956EE88F8AEFA2DFD8293B67442D58CC61B A!$wi
277,363,608 *1B4D878C4B670FFD532BE366C9A92B170D27347F AWI30
277,363,609 *1B4A784A31B57E751DC5B89B3D5821E2E3A625CB A#WIA
277,363,610 *1B444D5ED9950184BE1F570DC376AD5EEDF03BBE awiacji
277,363,611 *1B4F2DCFE2D7A92A2FC3A8294BF7E8D8BC979D0B awiayh
277,363,612 *1B4F8EECBBD5123C85978C35ACA1DE135C464F0A AWIDRY-DOBRZYCE
277,363,613 *1B42D63CA663044FD3F667E0F893E5E385E579B6 A?wii
277,363,614 *1B4CBAAE115BD12E95E4C91FBC97E9C38F6211CA AWIj;
277,363,615 *1B4F5C33F6C127AC9F0B6481CD7AE8CABECAE74C awild1822
277,363,616 *1B4C00462CF1B722A96A6F3EC7199FFC42A17E6C AwIpS
277,363,617 *1B45766D32567DA06E9B65F3BFC90B32C804E62C AwISD
277,363,618 *1B46C227CC1E5F82222445604999113AF1127411 A.Wittmann
277,363,619 *1B4F21A3523D4E399DD1A919B2F08AAA54884B4B Aw$iu
277,363,620 *1B47ED5C2CCB59FA8F227B92B64F0BE7F1226179 AWiZI
277,363,621 *1B4C0F3897FE37BFC14B4B5EF69402AE0AFC7481 A!wj(
277,363,622 *1B4AFB25F9CEEBDC73F8F951F7EA0F985AEDC298 awj-21
277,363,623 *1B4621C6981A40703BE47B836B5003D11E6CD9F5 AwjMf
277,363,624 *1B4E437B9EECFA1AECB85924A23DF38D16D70BFE Awj,r
277,363,625 *1B4EE2B756ABA86ECA27E227016D965131B2D764 AWk;_
277,363,626 *1B4387A7B213A575875D065652A64886CFADE284 A/wK%
277,363,627 *1B45A5891BB7FD30B3FD49C9AFCAB9ECAACEB8F4 A"wk
277,363,628 *1B421286ECC00029C817A1642B495586B0D48F37 Aw,K2
277,363,629 *1B407CB1ABB3DA62718A03FE456D78A98BF65E2D AwkN(
277,363,630 *1B4AE7E4D108831182F711D521BE3DC83E4111D4 AW=ko
277,363,631 *1B43EA1A8A8EE291EF78D5627A5ADBE7FE789FD1 AWKoN
277,363,632 *1B4C3FA1900F627577BD030FBDF6FB87F7239423 A%WKP
277,363,633 *1B4550989D9C02EFDEFB523BA377322CBCA95DF3 AWk-S
277,363,634 *1B44A9229418D7480F58E046D3CDB51F7FD8A96C Aw(Ks
277,363,635 *1B4C1D969F2415EF47197D6D352AD53CADCD9D83 AWkWD
277,363,636 *1B46D3B64E91FAAE97C0C015958DAC3BBA30633C A-
277,363,637 *1B426EDD4510CE33425AB556D0C7B11B8A0C3C94 AWl$"
277,363,638 *1B40A3CE73FC2C3392A3726FDEB5F44E358C41A8 A+wl;
277,363,639 *1B408256F4FC6128AD67F3A36B63BF0682868054 Awl98
277,363,640 *1B4D923867F97A0F06F746379BFE8BA038FA7C73 A
277,363,641 *1B487BBD26CD35602164B45C06A3051A780D721B Awletsop1
277,363,642 *1B4B9A1CD0E5AA74351A244875C0803685BF085B AwLjL
277,363,643 *1B4A0488A55826F2DB96737E0BF731737B8B62A3 A$wLO
277,363,644 *1B443173984D844B21025DA253C0D93A022ACB8C A:Wlp
277,363,645 *1B4855051EB689E6E20D59709202F08946595B2B AwLsc
277,363,646 *1B49CDC3D42921D26AB0CA9C777D582CAF5FD591 AWm/&
277,363,647 *1B45E83A51F7006797D027BBE48D436B2F50D9A5 Awm(:
277,363,648 *1B43D86333D5671519EF9D68991887A80D155D9A AW/m9
277,363,649 *1B40ED57DB04E884205142BF76D23C7691299E89 Awmblaring
277,363,650 *1B4019428A5EE5CC7532F89EEC8089ECAF35A527 Aw.ml
277,363,651 *1B4A3A487008BD7863C61A1910B9D82B23352153 AWM)S
277,363,652 *1B4968072B6DDFEBAF34C070629FBCF289817E17 Aw+Mv
277,363,653 *1B485C058CEBD4A9C850F89EEF61183517A25B14 Aw#,N
277,363,654 *1B4C900BC3F7923C7C3CAF1EBC71D33F88D28DDD Aw-n:
277,363,655 *1B4465743A6BB140058DD0A153286274F142AB03 Aw(:n
277,363,656 *1B462A5B40F0A64C83F811F579B11296D2970731 AWn9=
277,363,657 *1B479DCAF039AE035A6315F411D194A01FD2612A awnblorc
277,363,658 *1B41E8A9DDE026894AD97AFEF13476529EA3E343 AwNiU
277,363,659 *1B454E1843C2B7815F713A89C33923ADA8F51D16 AW"nk
277,363,660 *1B43D04C64850EA767EF72CAD26B477B7E8698B3 Awn(l
277,363,661 *1B498B0AF9826369C4CE80DFF55AF4660F93BCC9 AwNtO
277,363,662 *1B48C1FC6985434464CF79EE3DECB82520BB3155 AWNvi
277,363,663 *1B454BA8CEAE355D9D5A464E7C37B3DD5DEA7858 A"!WO
277,363,664 *1B45D5D000DDA550C544EF75303648F995060065 A:.Wo
277,363,665 *1B4CBCFD515D3DC1029FEC6954AB5D386876F444 A&/wO
277,363,666 *1B480035C291D7ED64359742149BF048D247A6B6 Aw/?O
277,363,667 *1B41A21DF0F780E5E7A7193E54549BE80DBAAF52 AwO;(
277,363,668 *1B42BBC61AC2B16017B0998A6A19377DF12B0365 AWo/1
277,363,669 *1B4B50658BCA2EA7168F18A82E0CA9A58243F056 AWOa!
277,363,670 *1B47D97FC5C869F5F43C3285FC58A22978CF0925 awoa123
277,363,671 *1B42688B501E6E3B3C7B0CEDF4681F732DCA93AC AWo(C
277,363,672 *1B43E19216170D2399046AF38E7358B7036F5523 AWOd9
277,363,673 *1B4D165EC6DE1C14C96DB5CAAACFA88DE7C6BBA8 AWODu
277,363,674 *1B455BDA53EABE5314A5733898808BC22EF9FBFB awolf01
277,363,675 *1B4208F8BD9232FBCEC980934C0A07C004B07056 awoody1213160talk160
277,363,676 *1B43D6811C979E6D657C4520BCC3D02A7B8D0188 AwO;r
277,363,677 *1B4E1A4A48C9AE54E08F657CA1AB0D2774B8EBB0 aworkingman
277,363,678 *1B4B8AD02AA58E40E1C22FCBB5688EE73FC1B5AC Aworship3
277,363,679 *1B4E0771F61B9E54BD8AE1610952C443B4AFD6E8 Awo:w
277,363,680 *1B4750578C8D047671030265ACA5A50D58E22795 AWP_;
277,363,681 *1B4B02C06B3FFA73C5CAB9E66760C9105E753C62 Aw(P!
277,363,682 *1B4DE07A5CFC21C09D9EEF32F007FF7C96B4D5D1 A_wp)
277,363,683 *1B4AA7A4CADDCC03169F8AEF62AA09BFE07D452C A)?wp
277,363,684 *1B4854D682E115EBC8AA109DAB5BD1A620FB5262 Aw!/p
277,363,685 *1B4B70818FF12FFFB8FE8C6982CDE2D8F3C6D42F AWp4k
277,363,686 *1B45F64F148FA99B0FEA08C4489C68CE352A794C AwpDr
277,363,687 *1B46E3C08CC6061A078393517CE87977E2EE6B62 [email protected]
277,363,688 *1B421A4CB00B71B6ED2D13D02249DC299305CF34 AW&Po
277,363,689 *1B41C0FE0E901EA0D2778308E5BEDB712EAB485D AwP!r
277,363,690 *1B43B56FD47211BA4E5E2086995C46B4C78AB2A8 A-Wq.
277,363,691 *1B48D39D91BB010BF115AA6D5604EE718DF93E8F A%w%q
277,363,692 *1B49C7032B9F537855D4E621B4E1CE684C292B78 AwqHf
277,363,693 *1B4F1CBE416DC8D653EFAB952335F0016AA6A28A Awqk
277,363,694 *1B44AB7BA28B77084F286BB89224589813AE515D A;wqL
277,363,695 *1B4FB90FA3EA211826B26E7FB9469D61D0A07682 AWqmv
277,363,696 *1B43850BB8FC58D7F62697676F615FE9FA75AA81 Awqn6
277,363,697 *1B4B6588676EA85898CC804E86C8784B74FE5FB0 Awqp+
277,363,698 *1B4B5D1BE8474854567E0D27C522624BF7D125D2 AW?qq
277,363,699 *1B483DD6160B2B1C9CC64BCD0A23C3BE4598A24C A:WQS
277,363,700 *1B4A159DC51D01132267739A226B60A131E33176 AWQve
277,363,701 *1B4A586736935D51F1AB4142F5603910D59930CC A)W$r
277,363,702 *1B48337D85E462B797F1C0B7007305BDA64D2902 A;wR
277,363,703 *1B4EB8E90612D8F868D272C9AC980A1A4D926086 Awrap
277,363,704 *1B4AA124FD419067DF6D02624EB19D4E5B5DF4D1 AwRfP
277,363,705 *1B4C98898D7A7FA96FD2807A7CB5F04B943F4513 AWRIR
277,363,706 *1B4D030C8C13C9F90D886A1CB0528F9BC3A1E0DF Awrobala1
277,363,707 *1B479AA8A5A635FBBB178E4841EE26B0DCDB7F1C AWRpO
277,363,708 *1B483F5BD468EB814965109BD8407EE6E6E44024 awrtaken
277,363,709 *1B45C891FAF7DFCFEA499EB4BC12721883A8CDBD A/wrX
277,363,710 *1B43907C7511D3582B6FF801F1C59D9EF8A1C8A1 A#W)s
277,363,711 *1B4F9D37694736889BAB8BEBEE67EE70D1AF5074 AW#-s
277,363,712 *1B44F164197B1B1A3B6789609B14CA5DA4659928 AwS."
277,363,713 *1B481072FD3E41DD7366098D45553CA1819E0ADE Aws0v
277,363,714 *1B4D6CF28607D4836C8B8DD6A86DDC080C289DFF Aws6A
277,363,715 *1B48978C09AADB988251C336AFCA631D9C638301 A:wS8
277,363,716 *1B4B332F10EA7C5F118B840D85AF0C70E9FE54A1 AWsam
277,363,717 *1B4DD4BFF420859CFD4CD50C8AFBC12E45FCB1AE AWsd+
277,363,718 *1B40FA935FE0ED3F6990DB228B1F8F49642FEB30 AW.si
277,363,719 *1B403C7A703E29B558391E7EB7E6A68449D56C6F AWS-j
277,363,720 *1B4FF1B246B8A58082FBEC30EB28BA588F39528C AWs"n
277,363,721 *1B496104D3A5F3CF8DABE9A1E4930399DCA99914 AWSQ)
277,363,722 *1B44A180E188F36DD88727BAFFB9CCB29071D4C7 AWSQEDW
277,363,723 *1B4ACD42373AD5B0B6F2EBF687DF25ABF6E1C77B AWST19Aug08
277,363,724 *1B4DE0EF8CB4C2B3FC7D2D7CCBBD70D316828978 A?W=T
277,363,725 *1B4C63E8144AF1C843973251DE6C2E155635ACB8 A.w,T
277,363,726 *1B475D0C05ED2300A593CBB14BD3644FB4F48781 AwT!
277,363,727 *1B4066F08A300E88A8DC78BF210F37383C8B7992 A+?wt
277,363,728 *1B42581FED0D9228DFE617FAC1226CD12D96265C A,wTf
277,363,729 *1B4C46BA492C1899FE94675C1D6F96D74ED7C8C4 AWTjf
277,363,730 *1B432AA4009B4A0A4C0DC4368689C93B947F7CEE AwTPN
277,363,731 *1B4D2994EA3E88397FC5A291FCBB2E2963D82266 AWtr
277,363,732 *1B4CF691C4F6F765242A4BAC2509481108A35D0B AWTYk
277,363,733 *1B4EF2C3431C3B48E19461B5B781D8A63B1EBFD3 AWtZB
277,363,734 *1B4EA62A3E8098E17F3F9EF3834298E4872EDD29 A#
277,363,735 *1B48AC3CF35EE8C096495163EE896FAFE83F762E AW$,U
277,363,736 *1B4E818188348B07DE20FE78C92A702A7CF0D038 Aw!u"
277,363,737 *1B4C793B3130B3348C48E05FD8C59D4481642B41 AWU&7
277,363,738 *1B47EF420FCF919FBAD26C074E326AC55532701F AWu;c
277,363,739 *1B4CAFE4AC70D3A6923F4E02E819A40DFA18A735 AwU
277,363,740 *1B46784CB34C8973E1D70A2B7AC1CD160DC97A5E AWUFI
277,363,741 *1B45E4A2F4F8969D1723AC23B948DC084469F37B Aw:uO
277,363,742 *1B4BDC07D30EA6F279BA57CEC45187985BEAFBE3 A)wUQ
277,363,743 *1B4A8BDE8C6970A9968F0984456E60519B9D097F Aw-us
277,363,744 *1B4349D7E013D3D924FAD9F18A1162B91E5BD95A AWuwr
277,363,745 *1B4F9D0AE710A0B1531F5ECDA613CD7FC73E5574 AWu-X
277,363,746 *1B4B6DED8E898B7F5B63282F392DA7D4E9F31915 AwuYs
277,363,747 *1B43A205C1535D5B8051B7CBA520DBD5D1CC8534 A-W#V
277,363,748 *1B4E1483082DE7D2B8A4410B31AB674B237F109A AW)v_
277,363,749 *1B4C8AB0123AF01357C8AE63EDAA581D890BB3D3 A#
277,363,750 *1B4C9B528CBDB5CB869C8F29EAF823766F7D6923 Aw
277,363,751 *1B4A916063A486CE71DF5640752524734A031702 Awvh$
277,363,752 *1B4B98ABDE3E14F8334B34BFE02C6764513F1E7E AWVh3
277,363,753 *1B4862EBCAA771321B4628F71E7F174318B6B2C0 Awvi/
277,363,754 *1B4702CB49FDDE8CE521A9E2698DA5B7A626B80F A&wvM
277,363,755 *1B4316B4328E7A68DFC6BC21466A6AF3181D586E Aw:vp
277,363,756 *1B4E3B2C7085A0EF282E237DAEA871BF29D09BED AwvW,
277,363,757 *1B408F6121EB5B01F6261B6993AA3F6EC753DD15 AwvYn
277,363,758 *1B4966E3A40F42059ECDD7A2926E5C30C56ACCD4 AWvZ.
277,363,759 *1B468440FF8EF58997EA005845E038E0A821942F AW.W
277,363,760 *1B44E7C2DF44F88B4FF58C917DDF9B414C954479 A?W.w
277,363,761 *1B42A3351D064EFB1C8A33EC5D1858B098D03188 A)Ww,
277,363,762 *1B427FFAE93A2C983A6A5B7ED499494D0990CE7F AW#w/
277,363,763 *1B468A6FD316D2BA347E1C7C1A34A60940886C56 Aw(!W
277,363,764 *1B43E090AA81E9EAE4C4455B6A31B7F5D9A38424 A#ww#
277,363,765 *1B480AE5C35D68598BA8C366D26C2641AF4DDAD5 AWW2C
277,363,766 *1B42DB1C2EC60476504C83E4771BAE96BD2AC3C0 AwWL:
277,363,767 *1B4E5A37381BABA3D8440A7B3B91ACCE505830FE A(WwP
277,363,768 *1B41F5CFCBC05D3FCB986531955D8E87D914FDDA AWWr?
277,363,769 *1B4516453A4CDE8FE11D29A4599A2280DCB75F69 [email protected]
277,363,770 *1B4662E0B8E44847AAF9FB2599CE73B09F47CA0F AW%WZ
277,363,771 *1B4356A3B5712F9C3E4E0504B9A0C7F6AE8C60B3 AwXdr
277,363,772 *1B4EA8CE92E9B36AE33D949D59211A54BECECDE9 AWX-S
277,363,773 *1B418E2E81A5022E88DC042EEAAFF9336955DFD1 AwXs$
277,363,774 *1B4266B0CB3C7F1686F7E83E51D0F0498ADD62AD [email protected]
277,363,775 *1B4CE93672A8B4C64A858F5D1FA5A888ED0D43BB Aw,:Y
277,363,776 *1B40E9B22FC19A3099BCC72CE1A7A67DC394976E AwY2!
277,363,777 *1B473C02BF2A2E4BB6366FFC27E63B5E063602D0 A:wY8
277,363,778 *1B4D9296698C54F56867C045FAFFB9640453CF1C AWY-9
277,363,779 *1B4FE29ABEBA56F685019F6DEA68981C6A14A9D6 AW)Yi
277,363,780 *1B414374C7686B76D78D1425EB053ACF0E60910D Aw$YM
277,363,781 *1B4B600653C19B63E85263AF66F31DE08CFB1FDF A(wYO
277,363,782 *1B4E300B14E6F658122F852F97141979AC5C0D4B A,wYp
277,363,783 *1B46DB20884A2C674EA7AB3941E957708F0F1CD3 A#wYX
277,363,784 *1B403BEDFA0D31CE6CCB2EDDE9241707F038A19E AW;Z)
277,363,785 *1B484896FAE7D23811B7FADC8072DF8A8EF0CE90 awz1
277,363,786 *1B42E2D05D03B5ED7577AB0FFDDD5428BB21D4AE AwZ34
277,363,787 *1B4DE695A9A4C6B51AE781155AE235FC86C5BD9B AwZl/
277,363,788 *1B408F2A30B93616415CC2F39AB1A88342A82174 AwZRS
277,363,789 *1B4FC377DF3C01CC366F9001F1F5EF9AEBD748B1 Aw&Zw
277,363,790 *1B4391A1A6AD5EA4CD255D2B2E5F4FCC18D8B5F0 A=X,+
277,363,791 *1B437C51F021D0DADF2D8178278C2DC5C90FD726 A,!-X
277,363,792 *1B498098145C2955B16DBF79A541CAEC6D0AC2E9 A,?X$
277,363,793 *1B421B8606E384292EBF7EB351536B1A37AFD2BB A,%,X
277,363,794 *1B4AC2C1B6B7C72410C2DD8607206FDA80EA134E A?)X&
277,363,795 *1B4C5124E52D29678FBD7C590AA2751A2F1C08D0 A"/"X
277,363,796 *1B4ABF146C7BE3926B5D9EC89ED9FBEBF1D63657 A]X#
277,363,797 *1B488D84689B69B8AB1A6F6C0A938EF787051BA6 A\X"
277,363,798 *1B469792805505017FDD2C0E0484E6875402C922 A#(:X
277,363,799 *1B4F7C70F54E763047E3EEA5D00BF24102A4AA15 AX"_?
277,363,800 *1B43E6C95602C9400712CFEE33E6A75FD8302A2E AX":!
277,363,801 *1B46E0EDB8F98B247BDCE06F5FFC316E3EE65ADB Ax|$
277,363,802 *1B4AD88CFDF844E7A09A647173B79BEB5694D91A a.X/
277,363,803 *1B48AD574BC4E97AB97BBFB0DC465835DC513ECB AX0E
277,363,804 *1B43186659E2D4CEC14133DB8A97885B3DB10F8A AX0f"
277,363,805 *1B4DF1FD0F2643302943114E6312830BE5E5D3EB AX0o.
277,363,806 *1B4D02D604CA2C8945E098921C528F348FCE858C A
277,363,807 *1B47276300C4C27AB688A12A3085793CD794E4B3 "a"x100'`
277,363,808 *1B447E438961D7590E5B50A91AC2A305CEAA0EF6 AX1i5
277,363,809 *1B466DDF2FB557FE2996D25217281ED68F701741 AX/1T
277,363,810 *1B42E887C1F072D72C949D1D4E0543E463A74D55 AX2/-
277,363,811 *1B4C26417AFB14101E63F554EC984DB458F1230F AX2E+
277,363,812 *1B4297CD10CC3C87587BD062CD1A6E2882155EF1 AX2Ni
277,363,813 *1B4830ACBD7E0FFA601B743909C22CEA306D6749 AX32Q
277,363,814 *1B443F026102A9C7FFFD792A77B8B453E6D2BBBA AX3)6
277,363,815 *1B4047CF9910F1934D477954C16DED6F6DD436C5 AX44&
277,363,816 *1B4D98492A5EABF71E81D4720E32C055596686A5 AX4Eu
277,363,817 *1B4456E7AEB9A048381B611292C5D2D31F9AC9AC AX4v_
277,363,818 *1B45F88AC8A6ECDF53268FA0DFC9236315A7827C A=X5;
277,363,819 *1B4A6B1E00D54D056E8BA131FF410FBE97F439B0 A(X=5
277,363,820 *1B42DBABB76F758D3EE822741DBBAA22ED0E955E AX5d%
277,363,821 *1B4C79BA472857BC05A7F4F6709E382F20470497 AX5ft
277,363,822 *1B4F8DB76B3B2D16BDED89E024967BA60A2B79F4 A(X5o
277,363,823 *1B45A77C91B233EB569038C9360A2EC7B9887828 A:X#6
277,363,824 *1B402E865EE909E0722A37F1829F5474D05E3492 AX6?8
277,363,825 *1B49535097DFD5809E4128C62836D4C6B5005CC8 AX6d!
277,363,826 *1B403E85D17DA79029C7D760AB9EE1FA54F69CF4 A?X6S
277,363,827 *1B4DA95B5ABD3C90866B3E4E38FA268554A77A2F Ax7:
277,363,828 *1B4FC1D6F28651573FA4149865AE6D1FCF42AD0D AX7F)
277,363,829 *1B4657811EBD6603B8146E8E2D6DA9F9995F6FF3 A=X81
277,363,830 *1B4AED226A952F10FD0F9BDA162AF0180062D5C3 AX-8r
277,363,831 *1B4581E94A62792602575B4FBC8E05FAC731B165 AX8vE
277,363,832 *1B42EFEA2F389EA2AF79063C5EC28F6395BA2EC5 AX`a
277,363,833 *1B441086D43249F5E66BE27E86AADE592AA5BF28 AXA&L
277,363,834 *1B4FB0A810811621B46FAC8CEAD1D9BDFD0027E6 axaristias
277,363,835 *1B4090E9BCE21A2D397FD0CE031FF6F6CDCFE102 AX.B+
277,363,836 *1B4E7DD195F6D2D96598DE068CCC94C92273A65A AXB9s
277,363,837 *1B4F3D9A6D3991C28275762E5F5841291FC2F55C axbacke
277,363,838 *1B47F4436804E1F9990DBB5F48D99FDB708FA249 AXBh
277,363,839 *1B44D56AFEE62DB7CB9426D8047B3906534A3DB3 AXBI,
277,363,840 *1B40D21A6F650D5F0EBFEC468F1BFB0550C22FDC AXbK5
277,363,841 *1B4CA994D2632C08E10A5870DBA243F3B903E52C AXB_p
277,363,842 *1B4E18B360DFEEFBE3CCF0387F879B98907D38FB a=XC
277,363,843 *1B468D01B5F4F766F7C509746A0FF956320506D4 AXcil
277,363,844 *1B4638686321EAAE17D611D98259018F491F0303 AXCl/
277,363,845 *1B46579EE5DA6FED8D83FA739365C87E8F7068EE axcnbswing
277,363,846 *1B40BB8B1A38D241A4203F7BF60F1D509605405C A!X/D
277,363,847 *1B424DB401A5516916C36ADE4A4A7A991623EA4E AXd1s
277,363,848 *1B41F8ECAE660533BE03550FEA464E6475414E80 AXD6-
277,363,849 *1B4B4A2C889767BF00F700D48D85C5B828FB8A05 A$Xda
277,363,850 *1B4D0443BA6880B7B61E5AAFF5A9365816789E8A AX,DM
277,363,851 *1B4BADA78639A6C1D24C7D6EEA241273821D21DE AXD-m
277,363,852 *1B4A6530B8FCDFD37D25AD60A6C39C84C20101DB AXDO5
277,363,853 *1B4F81FCA4278B5240BBED9DC32E77B5494BFAD1 AXDsq
277,363,854 *1B4E57C429F317C056E5DDA195A82CA0104FAE7B A&(Xe
277,363,855 *1B477682786446C4D2CF1855A78665D62FB906D6 AxE$
277,363,856 *1B41B583F7A8BE9403F161082C460180C5FCFF80 [email protected]
277,363,857 *1B457C35CDCAB68A3AE5A78AF9364387E8A1BC25 AXEE8
277,363,858 *1B4853C2FC8B88911BAABFC0B01D15DCF83CE03F AXEG-
277,363,859 *1B4E82B19FC6844CE59AF71B15613F05A19217D3 Axe Jump
277,363,860 *1B44FEF0E4B2F5ED8A05B7B0041393455FFFCF90 Axeljaeger
277,363,861 *1B4050726D67AC5DED39D312ABCE9BD7863BAE24 axel.siepmann
277,363,862 *1B4B1FFFD4B42FA5263260C5DE2E6CA79BCB564B axetag
277,363,863 *1B4D23DCA1EA17F0C0F96B2A311427AF9C25352D A?X,F
277,363,864 *1B468D90D32610A51B41B4610213F73D1A1C895D AX#f
277,363,865 *1B429CC8D85A049F964BBA004D95D08B33FE4527 AXfpU
277,363,866 *1B4BADFB31A422927FB0A2725C4CF2AE098841F5 AX,fQ
277,363,867 *1B401B932A28EFAEB062C9B68E6AC57817609865 AXFTXZEHLD
277,363,868 *1B467DA01B7E706939D00270C02681AD01AF1CB4 A?+Xg
277,363,869 *1B40399BB75667FE074125364BB33C7974B3627B AX:ga
277,363,870 *1B41246C040FD9579D5233F779203E31DF12BCB6 AXg!R
277,363,871 *1B429AE1F4506A3BC016C62E63D7169F01F20BCC AXgrO
277,363,872 *1B4D92727DEB47E7AEFA2181826426F6AD85C40C AXGSFLX53
277,363,873 *1B418F26EF6D43639FF3829871745D820F92510B A%X:H
277,363,874 *1B428511B2049F513B158D6AD4B46962782925BE AXH/,
277,363,875 *1B4AEED1A3237EE9533F084C1720B655D8D02417 A
277,363,876 *1B40D59D53A91638A0BFB3D4F5E4D0375BE07C9C AXI
277,363,877 *1B469C4797F444F239787442C1EF5F4D4BBD6895 AXi/5
277,363,878 *1B45CD857A16EC86392C18B8385DF1820C5F8C9B AXIE8
277,363,879 *1B443279A4FF40D402E075ED641DB657D51E936E AXif
277,363,880 *1B4CA1EB0619A5F16E708C2F693897235A6A7B68 axigyaz5
277,363,881 *1B4008E0A73A6437C357F827C4ABC73C8C0FFCF6 A#XIR
277,363,882 *1B41FB6B1A817D7031248D4DCD901DC2D9ACFB19 axis-collaborationist
277,363,883 *1B451ADA7E7A931238B10FBD5C579123E8F2D5AE Axismaster
277,363,884 *1B4C376C1C4483972EA762C442E73AD60D0C8326 axisymmetry.
277,363,885 *1B41CDE63FCE82B312BF748C0E3747B5852CF978 AXIT=
277,363,886 *1B48761D2A786028880B121EEF99440AFA9CCCDA AXj(4
277,363,887 *1B4414FE7EE7A34FCF5B8978AD581717E6B858CF AXjB#
277,363,888 *1B45C21EEB2982CB6018EAA9979EE91917382BBE AXjkN
277,363,889 *1B4AAE33A39ABC6313917A4B21761A78AB992338 AXjw"
277,363,890 *1B48C399CBD19BBE71E5687F716D571E5FC4C108 A)Xk5
277,363,891 *1B4FD6E7F565F000F2D692A5644D2432DACD2E77 AX"kA
277,363,892 *1B4787FCEADE80E8007AE122E865E7AAC92DE086 AXkAv
277,363,893 *1B414D36CAF52E11AFABA0C17D1AF1BC65E3E1BC AXkop
277,363,894 *1B4C5BF4DFD1D09FD04118DA7E831FE44B856A87 AXkqI
277,363,895 *1B49CAC89E4A288A774BA4DC847EE8D87B622957 AXK%Z
277,363,896 *1B4BF7CF7776F63B79D2FCA1CBB2AFF87AE8F062 A#XL)
277,363,897 *1B40E2392693D889E1FBD23AA6788CCA232EFD15 AXL4!
277,363,898 *1B4EEBD6F316BE6BBA55AAB158F6831EABC50377 AXlac
277,363,899 *1B4C0AA720871E693741FC502D765DEFA23B5E2A axl aquino
277,363,900 *1B4FC31B2BA6843286CA5AA23D8B4B5569765F36 [email protected]
277,363,901 *1B444C9EFB822F550A41EB00312E90D432F69428 AXlh7
277,363,902 *1B49452119DEDDED2454B590D29CC7033E7B8D16 AX/lL
277,363,903 *1B4EA42A1A13E9D4C453E47E20508828F4962749 AXLV3
277,363,904 *1B44018EDEE11D0EE05AB99F503298CCA02F34EB AXMUE
277,363,905 *1B4416DF94BF835B2971DA8BBCBD9C9FE0D94985 AXmv;
277,363,906 *1B4E1DDDB30966A2B27F72448D13BF6AAD17574B AXN.-
277,363,907 *1B46DC1BA39B4F1574042CCDAAF855C28ADA1831 AX#n0
277,363,908 *1B45A0C7DB409F15213403F9C6524E9980F68525 A/XN1
277,363,909 *1B464B57EA34ABD809F4CE34FEB76C54985024C2 AXnsI
277,363,910 *1B41F0E4DB1E023E643B78920A2237A33976F3D5 A/XnV
277,363,911 *1B430D0D34E117D644FA8C4A34CC99B22288672B A&XO6
277,363,912 *1B400610554FE4C70F84D500FCC6A07508D5AE9D AXO63
277,363,913 *1B4C7FE72F8D25A476A115C8E2373A699EACF742 [email protected]
277,363,914 *1B4A09DAA9E61A9415CF72F8B7E1025526F8B6EF AXOLOTL4
277,363,915 *1B4B692B50E37F6801330DE787AE4939985065F1 A
277,363,916 *1B422274029E0AAA1A8AA3DB4EDD18BF5DD14965 A(Xp;
277,363,917 *1B498E75C600140F421E01E901D1257C1A673C85 A+Xp0
277,363,918 *1B4A9ED641874584F82D4643475185DF7447D515 AXPLORATIONS
277,363,919 *1B41A7CC5A9E208E7D8916D51C9721CDC3A391CA AXp?Y
277,363,920 *1B488D4D007373A18863F24207DB3F16778C757F A!$Xq
277,363,921 *1B438991458855516837B56168CD3168B841C4A7 AX$q
277,363,922 *1B42789405F3386366E9ADAD3E719B5106B7A346 AXQ6k
277,363,923 *1B431C9EC866B2C7801B790A6EABFBA6B7D5FC4C AXQFp
277,363,924 *1B4D28878129E31E3BDD7147CE73607D168D9080 A-XQM
277,363,925 *1B4239DDA1E5B77823B17D248CB7477F87FD4A6C AXQ(w
277,363,926 *1B448F3E88293F72C7A0C052089FE085607894B1 AXq+W
277,363,927 *1B461447509AAAAD8C9CA516501C42D7CBCB7DC7 AXR!7
277,363,928 *1B48B4B5886CA5B5C8973CB58021F765103263F6 AXR$F
277,363,929 *1B4460A4E1ADA2493A495897DBAF5F68C864F86A AXrNF
277,363,930 *1B4A70719C22D7EBF303428A4B53A706E8D17D17 AXr#s
277,363,931 *1B4DB63B54197F8CD51D316C14DA7BAADCE2DAF6 A
277,363,932 *1B4929EFE1E3766B93B906E31761F6A32A0F5696 AX;(S
277,363,933 *1B405E741BFC1E68932105FDD8B874B1DBA2657F AX+S0
277,363,934 *1B48AA0B5F002A88E46D1FA793D84EFB368DB08A AXsdw
277,363,935 *1B4920A379548FD0678BED48F6D9A16C137D4625 axseeds3
277,363,936 *1B4815C99053298809218084C7596B6DB1E99250 AX=sj
277,363,937 *1B4B049F4370314BB9A85B6F5AF90720E25472C0 AXsjA
277,363,938 *1B4C54AA26A17E63BB87281F982FDC5F30599A5B [email protected]
277,363,939 *1B4A571D4A852E17032C1BE871895CF9CC396E54 A?#Xt
277,363,940 *1B44662201F762E2FB9952CCAFD7A7899E46A164 AX#t2
277,363,941 *1B4CEDEB60C536444909B3F25447155140BF7D03 AXT7/
277,363,942 *1B436CE9D06FE603B32D9105131ED13680E99F42 AXT_A
277,363,943 *1B4A6EBACB4947DDBA602231D2D65EE4202472A8 Axtells8
277,363,944 *1B4152AE81D03223045F8AD3A9EEDD1E8982DE18 AXtI-
277,363,945 *1B41B7E8C247DEE35AD2B6FD87B7238954384145 AXTos
277,363,946 *1B417ED3E459D3DA3CF1812CD11B7C5097D7C6B8 AX+U1
277,363,947 *1B4CFF79C0ECCB5278F08E52C5738565C70DFA4B AXuN_
277,363,948 *1B4A0ACB514311E842098CAB1A4D54A5196E941D AX?#V
277,363,949 *1B4FABF5010EDEE4C8A2FA90F546A8663006A948 AXv85
277,363,950 *1B4345768CC8D8FFD1202118D4721261C3F8B8A4 AXVdT
277,363,951 *1B4BE5317D1791C1BF48074C402FC71F2A5AB33C AX)VE
277,363,952 *1B4BF902E7DF0784BABA27F670FD2702B14682B6 AXvFB
277,363,953 *1B459203A4E501C732C1DFA03F8811D645DED698 A.XvI
277,363,954 *1B4E3D164336AB386BEC1E53F483885145C5CE27 A$XW
277,363,955 *1B4755E687C2291C786C9AF52E45CA54C32F4895 AX/w%
277,363,956 *1B46240B57D5D081DC501DC020B1080DEBA38192 AXW6p
277,363,957 *1B44FDA557DA1215A4FFC9CF8B098EDF3683137E AX,wF
277,363,958 *1B4DF6EADBE8488E729336A0DDF8B2D3129E2EF7 AXwKT
277,363,959 *1B4E0F78E9F8CF5820B2027760A2DB367D4AD245 AXwOu
277,363,960 *1B47DA9D17AE956AE66CEC598D0C1FE66D2D2FA8 A_-XX
277,363,961 *1B4B327501FFC6A104D9D3649FDC79B4070C774F A?(XX
277,363,962 *1B4DF68C826F0A28676FDFFD7DF320D51DFB4642 A\xX
277,363,963 *1B4AB60A3FC5FA85EEA36F55D3BD237F22CBB90D AXXEh
277,363,964 *1B46E2E130659FACAD3004C5D487A9CC01FBF233 Axxellien
277,363,965 *1B45D47127FEBCB4143CDB3CEE5588DB1DA66199 AXX=F
277,363,966 *1B40F3C9B0DF08DDA6DBDC0195232F94A60A1B70 AX%XS
277,363,967 *1B431D35968C2C65546403428A34C9EAD2F6AEB4 AX?"Y
277,363,968 *1B4B88FFADEB7C9CDB63C8B9D26A501EDABBF684 AXY).
277,363,969 *1B4285DFCF5024DD98B371BE0EA4C5D7A6DF5F4D A=XYt
277,363,970 *1B4597B37D4F8CAF4E5BF557F8F729ED3360DC59 AX!Z.
277,363,971 *1B40D3C752283301EF3BA83C372B97A344D196AD AXZ}
277,363,972 *1B4393B3A285032AF3E94C7205B72AB94D0469C5 AXZ7U
277,363,973 *1B456E7599E6A9E6848CD5705D929027BF0ECB3E A~?Y
277,363,974 *1B4E436F0BA5F872E5022619EC81361A0DD35FBA A=Y=)
277,363,975 *1B4FDC5B9AFA12C048ABD21667C8DB1DA2209F80 A-=Y
277,363,976 *1B48F09C640425BB7892CB24CA1A8FA3730810B9 A#/Y?
277,363,977 *1B485376620F3D351CC131CC90A19DA1AA44BC96 AY~]
277,363,978 *1B4E4ED2B6FA58B8079885C4C509CBB14D9632F7 AY=&)
277,363,979 *1B46482129E75889621B2AD07A629797A2D446B9 AY\"
277,363,980 *1B4852DC2C86F085F864E8709AB7070913B21B56 AY&!"
277,363,981 *1B4446EBE12CC7EF8676AE0B59D9410580FD0EEE Ay]]
277,363,982 *1B4E24431E4358218FED5BC4FED60BC99AE859DE a<%y
277,363,983 *1B41C3B237E107CF8E01F23BD5CFFDF2207E6BCB [email protected]^
277,363,984 *1B479B81B938A2EF07646A60468906862ECCE4C2 A,Y/0
277,363,985 *1B4CE1A61E3DDEB0BACA580ACAC00A13EDB39C19 A_Y0U
277,363,986 *1B47F4B7F85000822C7B3CC45E45D782BD66C9BC AY1M"
277,363,987 *1B4E840BA65BE1A1B2431F9C224CAC3E83693DD5 AY1:N
277,363,988 *1B41A65B2C5EA29A109C15B1B4230484390E4291 a=y2
277,363,989 *1B4F9B99445D28C78D0F9CB5B4AE2E0791DB65A6 AY3.P
277,363,990 *1B408B571E7DAB6E27EE6A0AAED11F226463339B AY4fc
277,363,991 *1B4067E1D902F8EC8A58A14EE0EB95CD6125B4B2 A+Y4K
277,363,992 *1B4A04C1FF40017671D290A2E58AB5DF48691E6F AY4r;
277,363,993 *1B40FA137C1A6106FBDDBD8B9AE5A08385D7C4FE A$Y58
277,363,994 *1B481A4060CBD499A119E05C6F985B7BC9FA89F5 AY5q?
277,363,995 *1B4B545FDCA60765FDC9C15FA74B2A322E0E3BAA AY6K#
277,363,996 *1B4A126A22E533B1CC62F2E9830C381907ABDFD0 A,Y6M
277,363,997 *1B4CB33161699E841FC5DF93EF6C455B8346EA95 AY6rX
277,363,998 *1B44237C49A77B0A75DB97F841099D433C1F7267 AY/6X
277,363,999 *1B484799BD6ED34973913BD40501EB6C199C40B6 AY7>
277,364,000 *1B4B8395B3E30249B01999A73A752C994C7B8457 AY72C
277,364,001 *1B4545BD97EC04B93228587DF4362F4E2176120F A&Y78
277,364,002 *1B40AE8DE3AD4B5A847220A80217F6FFDF9E6559 AY7ku
277,364,003 *1B4132DA7EDB161806FFE6C69B59BDC5CD067C07 AY8G$
277,364,004 *1B44D98E60E060BA42EDA226446C02AF9EF09A39 A"Y9?
277,364,005 *1B459CD07245DAD25C9560ED585E1D82C8CC37C1 AY98S
277,364,006 *1B4C3051F2F4083A54F0E799BDBE132B1634A675 A;Y9A
277,364,007 *1B43657808063F88B4FDBC4113C9A07D582B3D08 AY9B/
277,364,008 *1B4A4F7085905F950820E441A6D5C1ECC4BCAE58 AY9ZN
277,364,009 *1B4D3579111836207DEA0DC9685039AA0975B1D3 AYA;1
277,364,010 *1B4C747BE724C87D0EFA1252C49B8553D5502F91 AYAAQ
277,364,011 *1B4E255C6174F076AE4025E8BD845561E1743F27 aya ayu
277,364,012 *1B42E917AD3348F1FCBADD6DA646B37AB3305675 ayabenzer(2003mix)
277,364,013 *1B40F0BF636C8CBA84E8ED37D2D0E1DE2050B089 AyacuchoS
277,364,014 *1B471D1F87432AEE3CAC4C9DA5B49754BBE4D147 AYafB
277,364,015 *1B4523067799D9A02A0080284EAE62B4DCB2EED2 A"Yag
277,364,016 *1B4CC8F190501B7FC82E8F654BC6884EF5631926 Ayagikuy9
277,364,017 *1B4549A24ED8392E53E0F3ADC546071EE0D539F6 ayahlude:what'stocome?
277,364,018 *1B41379A956C20F9B2F2262DEC3DEC9F37C69203 AY?aI
277,364,019 *1B41A406EEFFFFABB507A4E5FD44B7C536838AEB ayakado
277,364,020 *1B45130BE7A1FA7FAA2FE8E835750930C12B287E ayako hara
277,364,021 *1B4E1C451C54CF16BD45064107D8A1C6C9D711C2 ayakoyamanaka
277,364,022 *1B401A5CB2B99E48892ACE6195F356ACF0418B4F Ayal-Ayale (The Handsome Hero)
277,364,023 *1B412B86F79A0B25B1F6D015E7C37BE201DB6DD8 AyaN
277,364,024 *1B453F7CD39287C391E191CE39A6B8BD64E97CF2 ayanthi3
277,364,025 *1B49A6E66E2D07AE23B47ABC1BA0DFA3E8DC1D1D Ayanufoo1
277,364,026 *1B4D9D8D3036E6ACDA6786F5A306C2825DFD47CE AY_aQ
277,364,027 *1B4104E2C62CAF8CEBD0FAF5037FAA9DE6AE8AA1 AYArZ
277,364,028 *1B47070A9CB4BE1898E3F503E95EF876BAEFAF1B AYauR
277,364,029 *1B45464CAFF365E04D0FD080C5B5EDA6F3F0F5C3 Ayawkuking
277,364,030 *1B4D90674BC928F06ACBBE8DE4DC01E5A0934CF3 A-=Yb
277,364,031 *1B48148832D6330F917DB7EB5440C21B15870B10 A+YBm
277,364,032 *1B446AFDEBB38987C8AC556BF7883C72D6C4FC94 AYbss
277,364,033 *1B444E81DAAD45B3ECE7295161E032B0AB7273F5 AYbw%
277,364,034 *1B49C7F744B36CF1400454C531FF961E1FF4A410 AYCf(
277,364,035 *1B4F214F974CF777EC06C3FF4D4F787327B43392 AY$cj
277,364,036 *1B4768AAE25EE7384F4443410C8348BB5B83EF75 [email protected]
277,364,037 *1B4C2443D85504981F4197E5ED7FDC27A48650F2 AYc(r
277,364,038 *1B4C7F583F87A1488F335E8C9E4AD4B3D6D6DE57 A,Y-D
277,364,039 *1B422A6994C2D1D3832FD68DE78CD111B4A57359 AY!d2
277,364,040 *1B4BD87728CD0E4550F0BA5E1200C5B9B685A2E2 Aydan450
277,364,041 *1B4B625E8736653F3A5994C2AA5E223610005F82 ayda_yda
277,364,042 *1B42843E6651A3F37298CDDDBE00EBA5374EA306 Aydendron0
277,364,043 *1B406D56A05CBC3013A07F84B1552BE5AFEC98C9 Aydiid
277,364,044 *1B45AA67622502BFC67733BA95AE58DB1CC85C76 AYDITA
277,364,045 *1B4C6FE92B224CEB7FC24545342FE85F38C207B4 AYd=R
277,364,046 *1B4CEF4A2F754F9374E484ECD7CAF52FFE3D7BC4 [email protected]
277,364,047 *1B48BD26F3F3977525548A1C5B6B3FA9312C661D A&YE(
277,364,048 *1B4C18E55F1EFD8C5C83A818F297FEAF51A64EEB [email protected]
277,364,049 *1B4B633F8F18B4AEE6B7618045304871719457A1 A$Yeb
277,364,050 *1B4B4D8C5AB8C0DD01D98014D0EE42BF4A69BB8C ayedem
277,364,051 *1B422DC52CC9A4FC34C059DB810321A24345388F [email protected]
277,364,052 *1B456468187D19C5A372CF52D945A62664C979AC AYem7
277,364,053 *1B410D3C85EE06DF7CEF2B5096E10B855D033FCE AYENT
277,364,054 *1B4F9096398B1986E3E50E0B971BDE6888038A79 [email protected]
277,364,055 *1B41D655FEE87CAE41F165BAC5FE13157A1A0BE9 A,YF&
277,364,056 *1B428B3C1A45E6626896DAADD437E03F53F30B72 AYF;.
277,364,057 *1B45B7C960D58BEA5EA758471E788F4FE84967D2 A)$Yf
277,364,058 *1B4D5D203F8F27B60805F762247FCA82940B2BDA A%YFq
277,364,059 *1B481B242316BE36B5E5186B33E70CA0B0EF9705 AYFUi
277,364,060 *1B4DBE6828DFFCFDC7D19755C97A2A8CB4B5F1EB AY:Fv
277,364,061 *1B42AF3DA7F03C720BD991540E225AF4BC623377 ayfy123
277,364,062 *1B44D62D797514AA0C92DF99B7339C74C076E483 A;=YG
277,364,063 *1B4C4E83F0F9A6A80327A6DA45C99AB1A00E4E36 A
277,364,064 *1B423DE15C2D38BD3F4ECF76840125B826C63F6E AY
277,364,065 *1B49A4BABA3BAEE81F9BA0DFE2648E1AFA7E3602 AYH11
277,364,066 *1B47D0114217281C5609F82B90164BD1377A7255 AYHat
277,364,067 *1B432299D14E799B075A730B2D66EF6E4837B77A AYHhk
277,364,068 *1B4393F59239DDD0D0F1DC42CE4941867945AAFE ayhuladf8
277,364,069 *1B453396CE8FFAE19C16BDE5B370BD5371ABD74B [email protected]
277,364,070 *1B4AB8972417FC1B15A06409B37C3FDE595B89AC AY_#I
277,364,071 *1B40DDB6E2AB5DAFA26A3FC6988615DEA6B9420B AY-+I
277,364,072 *1B4ACAC461CDFD21DE730A9BD8EEF0680C080A0E AY(I
277,364,073 *1B4CE0CE93B6577895E41A96646BB1C5ACB3A615 AYi=)
277,364,074 *1B45F4ABA1FCD234097289E066A5D8D0D80D89D5 AYi&6
277,364,075 *1B46E1BADC2AB068B48F213024316C5CC86A4E23 AYIFG
277,364,076 *1B48634D6E3E5FAC2B8759AB5303FB406438BF15 AYiiH
277,364,077 *1B414BC8619F4A6589C08B0E33BF83525AF0E1F0 AYiL0
277,364,078 *1B42D5C0ADF034B75B54EE1D0796098F9FE193C8 AYi
277,364,079 *1B484E1A08519C31769D63BA7EC6F1C88660ACE9 ayinaaniya
277,364,080 *1B4AC0E770D4D7A24D4DAB43F6B1DDA2FE18859F Ayixaws1
277,364,081 *1B439265C33CB711D774DA1B747E5E4AE15CABFA AYIZAN'S
277,364,082 *1B469F5E659381BA9F71CD45AB7AB377190B36DA AY&j6
277,364,083 *1B4EF9D7CACFD1D5DAB4408A166EBF32417D6985 A?YjC
277,364,084 *1B42D3E1AFF80CDF43CA061D4BE0CADE35D767CB AYjDb
277,364,085 *1B49DBB208624EDA02FE4076E7C89433924B1B5B [email protected]
277,364,086 *1B431A32D2A78638E9E431A9B730B63334C02AFC AYjsM
277,364,087 *1B47220B9FD1FAA0A67E144F671D377D7DF0BE44 AYjYl
277,364,088 *1B47547045F6AAD17943AB88006F5165AB01FFFB A,YK;
277,364,089 *1B4CED0EA0CC0CFDC56205D9D804EDBE961B766C A:Yk(
277,364,090 *1B4E6D465EEC1816CA5AA90C4D89329FEADFCC61 ayk3824
277,364,091 *1B45F9BE54B31232257990654B2838B8FE828782 AYK4S
277,364,092 *1B42DA59A897E17AC483C4C345FF7ED5E26015C0 AYK?c
277,364,093 *1B4BC822C9B9EEEFD21B497D0EECF65AC148F5C8 aykevanlaethem
277,364,094 *1B46610856F55419B6E5C1E84A420049C039E9F0 AYKs"
277,364,095 *1B4D517BA948D82B2FDB66A7BF593E5A3786D4FE aykutcitak
277,364,096 *1B49AE97185D8F04B55466185A4B91FFCF31A202 A"Y?L
277,364,097 *1B4C0F63A12F24BD4EFA0FEBF2238A5129811298 A,Yl)
277,364,098 *1B4E3B5E3315F5919C01E80F6F06521D4941EBB6 Aylikwn5
277,364,099 *1B49E54DC6DE595DDAB8B55ED09E333323596DAA A/Ym6
277,364,100 *1B4D99639845B33476C1A62C5F26BF6999184891 AYMAN0127434052
277,364,101 *1B4F3884142D3BA33A310ACF40AEA4A16496D87C Aymanian6
277,364,102 *1B4A6EBDCAE519836EFF7E80FC5B315C8E29AC29 ayman nashaat
277,364,103 *1B4678EAB0F86CFFCAE70C8175F24832A63D9348 aymenbahri
277,364,104 *1B451B5CF10597EF02E1ECB0A18D9DC527411644 AYmNV
277,364,105 *1B46FF9EA76F6E17199C0F6BE235AD47EC14486A aymoros8
277,364,106 *1B4EB3013843C374A711D60B5973266C6BD78612 AYmt"
277,364,107 *1B4D68C593054AD7710F8C9D2A0183BB37E10A94 A./YN
277,364,108 *1B4F58EBCE1CBA10828D4576F9839A11D709BEE1 AYN3-
277,364,109 *1B482BC4CE2DD3D22B164F2D0D93AB9F0F23BD01 Aynadahs8
277,364,110 *1B45B2E3E6B6AF9DFD62E606588F10B5D10AF20C AYNALANG
277,364,111 *1B4ACA2B4D727BC80FCD0C9F5CC666AAB087B26E AYNNo
277,364,112 *1B459C6CA55744DCEBA74420D3EC5DF784A6A223 ayodhyes
277,364,113 *1B481BBC2F70F44532835A6EF28C9D1D95C3F272 AYoG"
277,364,114 *1B48350E7C7F5B76015334D87E8F01FA23F7F9C3 ayogatah4
277,364,115 *1B4226EC9BEEA9A0C2ECF3063D0535EE81AB126C AYOHHA
277,364,116 *1B4A52A29D5EBEA6C923AE487E7A448DEE57FC4C Ayoirak2
277,364,117 *1B423C1620A9F252504241B0AAE377863B391FE8 āyojita
277,364,118 *1B4417A155E04CCA59A09CA97F66160803D16BB0 Ayolandaed
277,364,119 *1B414851C42743DE74C7862056E3B3CCD6D48A89 AY"P#
277,364,120 *1B44974382A80897E5ADADD0DDE2DDEB6024097B AYP47
277,364,121 *1B4B5CF0DA84D6147B51430A3AC9824BF86C7C5A AYP;W
277,364,122 *1B4A0DBFE92300627EB8B6E85530B0E14CBFB736 AY/q9
277,364,123 *1B44E1E1D01F6F9547D4DD55FD05488B73258634 A=YqB
277,364,124 *1B41B3F11F1A087FF290AAD3403D8FF300E9E0E3 AYqX(
277,364,125 *1B4B6B23CB8D42C3900C7AD606119AA8EFAED928 ayrdere
277,364,126 *1B4EDE9A98BE9873456DB26EB150423073DA5E47 A.YRE
277,364,127 *1B4FF48DDA4DBCA333F0F2C9E7D1BB156BEFB51B A)YRL
277,364,128 *1B402B50FF04A0A1B96E96C803E81BE2A7ADE20D AYr$O
277,364,129 *1B4DE6B8749CB877FB087CEA02134FA63EDBD23B AYr"R
277,364,130 *1B48DE79DEB7EFB6E63B662C75A621695B9A69BD AYRuu
277,364,131 *1B4047CCE58C2E8ABBAAA5702CAE6D2992EC108D AY(sC
277,364,132 *1B410395E0A795ADFF376B5E8E04C27EF8DF838D AYSDp
277,364,133 *1B422D6A74E11B26F60AB4DAF80D796F430244D4 aysensena
277,364,134 *1B4F825DCC4FDBA8D5AE138CA4CA9A3CB8F157D7 AYSjs
277,364,135 *1B411BDA87F5842D43E85FB1C25A4A1EA1A50332 aystingR
277,364,136 *1B447244C4BE61606C66C7118F0968E8B15FAC82 aysukoy6
277,364,137 *1B4360D493B9ABEF3E2DEAC9864250541668B360 A.+YT
277,364,138 *1B46F57AEF63DF5AEF539DF25EB5298B50FCF84C ayt7nZ6p
277,364,139 *1B4F9FAD2142F7335FCE0B8089A59D83D5504201 Ayteprep
277,364,140 *1B4C901A0BB8B41162822FEE2E28CC6CF7B01477 AYti4
277,364,141 *1B426CCC058286663B35C7547E4444FE8CD24D9E aytıwına
277,364,142 *1B46FEC95AF9394BEA95F928E723C61188759318 AytoEjea
277,364,143 *1B4D134CA36DA369C5AAE62CB6894BADA189B1C8 Aytonoma1
277,364,144 *1B4AE1280838C47E2D22BC9AB3D5DC20B54A4EB8 AYtP%
277,364,145 *1B45707939CEBEE86811F8A27E0AC484B3BFFBEB AYTuc
277,364,146 *1B4A00C34F043BF5725586CF24E13406B2CC10E3 A+?YU
277,364,147 *1B4D49DE482D6EF854707932AD7AB16F92F758D1 AYU2l
277,364,148 *1B4CEC63C86E426207094F6CA2B6746CB77DC8FE AYU6R
277,364,149 *1B4576CCCBAF78D7882388A2D3DFA2B6D061A872 ayuaan
277,364,150 *1B4FC66142E6ED9D925222CB6BACDF04EF55FC82 ayubitesing
277,364,151 *1B416DBA1D5EA647BEDA48400D20E8DCF3705318 AY/UC
277,364,152 *1B45CB63EB67059871B4809197E617A385AC017B ayudading
277,364,153 *1B40E256D12337849D4B2E29AAC4680BECCE0153 ayu imoet
277,364,154 *1B45EB5547E469765DED55E17729F82AB3260BE5 AYuqu
277,364,155 *1B4A4591ADAB9EB28D09CD547DD37672D0923EBC ayususi
277,364,156 *1B4DB84A314D7B3B6E8767D03FD05A1E6AFAB4E6 AYuut
277,364,157 *1B47ECD171A53CDE354A3B9BB55EBA08C80BD050 AY;"v
277,364,158 *1B4E3217678712A06745ED34B58978B06CB0479B A,YV3
277,364,159 *1B4F2908A56DCC49D0B136C2EF8095FC9BE28F10 AYv(7
277,364,160 *1B49624C377118D3EF9B9E5B7BB55CEA90782660 AYV8;
277,364,161 *1B44D701376F6003C59E1AF1D0908C7B825C490C AYV$G
277,364,162 *1B4FA32FCD181D776CCAE172140EF8A0795B1D3E AYVNf
277,364,163 *1B499F0D5E970BACFF4B5749BA17A299FAD76137 AYVr&
277,364,164 *1B4C6FE0C9CE54A44B8915AE53961802F52A7271 AY+VT
277,364,165 *1B4B9E8224B10D22362DB32714037C3858908A50 A&Y+W
277,364,166 *1B49E9FFFA6F942FCAD42FDE10636FAD3461B9F7 A?&Yw
277,364,167 *1B45265FCBBC454B48060F535F44131D3C9E6DE7 AY;w+
277,364,168 *1B46E5ACFB951AFC75FD2F0FF804F081B15ECC16 AY$"w
277,364,169 *1B44ACDD7915072850AE54B914A4258F82140B57 Ay\w
277,364,170 *1B4ECF7173E13E8DEEE6983CB36A24A7C37B29F4 AY!WQ
277,364,171 *1B4948CD9DB7FAB083C59C87C6E499A8551DDC64 AYWt0
277,364,172 *1B42E922C9F80AF564B9132F3783382BF5F50586 AYX)%
277,364,173 *1B494D08B531957426096F91C27B4480A9F48E6D AY:X9
277,364,174 *1B4CEBDAA83CA12DD61C1D4007F1BB6824489ED5 [email protected]
277,364,175 *1B427E7683D06D1439D1045B274CE8B065CE127C A_)YY
277,364,176 *1B47F7934FECA3EC1F1FA156A0C384E0DA3881F8 A;YY(
277,364,177 *1B4E7455D38D8DD297691DCAA2460B39E56AA9B0 Ayyasamy2
277,364,178 *1B4485C09DBD248F98F6B10371F06D1123BCD473 AY_Yb
277,364,179 *1B4D9532FA1335C1BD1FE85C76C777EE23E40011 [email protected]
277,364,180 *1B4746E8C2344C8B6AEDB3022BFBE37C44DF7CE9 AYY/Y
277,364,181 *1B4B546ED553870A8EF20F45C9270B32EE0E24B1 AY.Z2
277,364,182 *1B480589CDC68EAB6B45CAE9F89D579EE01EE1BC AYZ33
277,364,183 *1B42616B6E7A5F571BB42CAABA1CC970CED83A65 AYZwE
277,364,184 *1B4E7BF8249227E41D698260BE6CC75645A18DFE [email protected]
277,364,185 *1B4C5FD15D063FFBED8DA6C663D57A5E3130A0F4 AYZ+Z
277,364,186 *1B47B2C31920A271150D4E4DD0FEA2C51D6EF5B6 A=Z,"
277,364,187 *1B4CC9299730556D2594D24A2E4C657B8BE6445B A"?,Z
277,364,188 *1B44BBC4ADD15CCA04CFBF8BB2CA49E69174787E A$"
277,364,189 *1B430A59224C3C2EC358EABB1326934B4EB9C229 A+.Z
277,364,190 *1B41D91149564BDB15B5450D15CBC5F95E7A4C52 AZ/=!
277,364,191 *1B4D9396153F067D9D4D6B969B264C48421CE5E1 AZ;0:
277,364,192 *1B4B7C57C621A741CC7CDC3EA989D7D9E3D0AE9A AZ0Fr
277,364,193 *1B4543A8C3E24E9DA82E90877D538ECDA1C9B1B2 A!Z2.
277,364,194 *1B46683F86AB145993FD43AD30E002CE29F3AA85 A#Z2&
277,364,195 *1B4B4131E63BBAFD1C60DF852820789E8F7B9289 A+?Z2
277,364,196 *1B4D610DAA5668563997D80C06974B05EDA651AF AZ)22
277,364,197 *1B480240E2002724D25A594EE249F9F342177DDB AZ2k)
277,364,198 *1B4887F59A259166232A78E336837AE06903227F A#Z2P
277,364,199 *1B4AD8640BA8EE67F1D472112599E1EB5680812C AZ.2q
277,364,200 *1B40554DB912422F8801C8F73550B29F5A1C4876 AZ2qg
277,364,201 *1B48D370B10DBE71CE6CF24B68A5D459D7FD8105 AZ3$1
277,364,202 *1B44764266AE025567876BD5CB32EF31D5544CD1 [email protected],[email protected]
277,364,203 *1B4124044F9ED29DC0A4F967DA9E9B150A63D6E9 AZ3Em
277,364,204 *1B4782FC79556298F131EF9A696106F7A75D9FDE AZ#3i
277,364,205 *1B412702E857A78D3C4415A0F3043FF84272C477 AZ3)i
277,364,206 *1B405B8EF2079625F235762604C1517AF223AD37 AZ&3M
277,364,207 *1B4C9764962B018A6377B05161E733C0D4C2342D AZ3Zo
277,364,208 *1B4C99A9E7422508AC6D14873412D836678408D8 AZ$4_
277,364,209 *1B4F8E45D77D4C04FEB3080AE1B09E76DD1AB3BC AZ41I
277,364,210 *1B417D55C0BD8F70E7FBD4466C3F691FACACFEFC A(Z4t
277,364,211 *1B493D94AFF016CA570D8BC098B33154E3E36BB7 AZ")5
277,364,212 *1B402823D781A5D0911ECD7F6958504310BBA4DA AZ5M&
277,364,213 *1B49A03D21EDD4A60F377DAF78529AAFF73E7AE3 AZ5sE
277,364,214 *1B4921C173D606CDF6485255A43BAA9E9B28F860 AZ6I/
277,364,215 *1B41736EAA3E8E5629E16B4684994328A5AD66A3 AZ6!r
277,364,216 *1B40BC0DB5D30BD69227EADCA501C864F9BB1BBE AZ&7F
277,364,217 *1B4876DE127D6A49983442CE5F95F8361C79CC74 AZ7gm
277,364,218 *1B4BEE0CD6428DFB97695C3923B96BC4B0637C94 AZ7nG
277,364,219 *1B482E99D976DDCF216627503B311A3748910983 A,Z7T
277,364,220 *1B4D9BB60B65CF299845BAD33F900DDB3B2F29E5 A.Z.#85
277,364,221 *1B4F123552AF22998AF0A4DAF9F0EBA7B24DDF56 AZ!8X
277,364,222 *1B40609E3B024694576F600466FBB0105AECF695 A%Z:9
277,364,223 *1B4D89EDB2B0FF6650CDAB0DE708AD261E2F4E61 AZ918
277,364,224 *1B47CC566AB5F76F1443FFCA7BA2948571BDFADB AZ9=9
277,364,225 *1B46D7CDD4C126F208B261EE6D79C9C84A5D14B8 A)Z9L
277,364,226 *1B4664484916A538B6636FABAC34B6C5E315D3A6 AZ9Wa
277,364,227 *1B40B3EBBCEF9612722E803D5F38C6D1F6822090 AZ9+Y
277,364,228 *1B41D2019E06AC5B48AEEB76C06FF589E5EF629E AZA"
277,364,229 *1B4A7201E1A43A89301D610563531B5A433EB8E2 AZa/!
277,364,230 *1B4F763021FBD03736D95948DA032A45908D09F7 azabaraed
277,364,231 *1B4503327D14327CD17CC668A9D73AC9BE1AD818 AZ_AC
277,364,232 *1B42AD9E6FECFCEF2DBE016B3C807BF271065CF1 azadpressefoto
277,364,233 *1B43F2837249CEEDC364E833E563548D594C7612 AZAg$
277,364,234 *1B460AB817DA95BB103FBC46C4A3EEDA620AB6A7 Azagknab
277,364,235 *1B4D5C4509962F54AA3384BE2E4DFBAFFD5B8043 AZa#n
277,364,236 *1B461BF74E07C4AA622C792C30B4990A937A16CD Azana's
277,364,237 *1B421B559FA30FD44CE8BA1E8E93823129030A25 azarate1
277,364,238 *1B4A90EC37628F1815A2D33F499CE0A03C2C474B Āzarbayjān
277,364,239 *1B48F49C00160A5D22E3F42648152DB3ECE9851A Azaria2
277,364,240 *1B4A97DEAFF8DB8181571FF8C85E497E5F0A9471 azaria 5 0
277,364,241 *1B43F221AD89DEB8A6C7DFC63EBFFA02554DC9CA AZASPIRONE
277,364,242 *1B49662395EC75017AB628F0CF3097FCE4F71010 Azazello8
277,364,243 *1B42A15AE94D587ECBA262EAC4B4C91A2DD39378 A"Z,b
277,364,244 *1B4141BC576E2A48ADF6D7FBFDF31DB0F82B3387 A$Z!b
277,364,245 *1B4D0FA625441FEF43858F5EC3D1C7358DA63726 AZb:7
277,364,246 *1B43EBB981109407DCDD0BC85F4D131CCD58EA72 AZB/H
277,364,247 *1B49BDE74871B29AF2D6EBA4456194415B241349 AZBK1
277,364,248 *1B46B868899BF6EA98B9B569728B5C1DAA37AA9D AZB!Q
277,364,249 *1B4EC0F47272B0A67F572FD509556B86112E4298 A=ZBq
277,364,250 *1B4E0611DDF711DD6B052C7EB5DBAE38DD288996 A
277,364,251 *1B444E8B7C67EF2E7A3F42636557A8E5BF6EDF6D AZC,1
277,364,252 *1B4E0F3ECC1BB8E0045544B1AB958B49B072F0A3 azc7938
277,364,253 *1B44E682BDAEE7371513DF95210412816EDFAB4D AZc_E
277,364,254 *1B41813E6CBFCDB1B1FC61AE603C24D7AA1019FC [email protected]
277,364,255 *1B4B7388D905CC35994F7E0B063D287929E84F72 AZCG-
277,364,256 *1B4D83AA36FCF15E023587F54CBFD51C3B6578F0 AZcL)
277,364,257 *1B4F6F96BFD58DB52AEB33C8E69828346846FA20 AZCOITA
277,364,258 *1B428D02B996CA4AF1C88FF88843E735F9900F30 A%ZCs
277,364,259 *1B430C1F57315D7D90C1CC6ACF2244B60F26CB5A AZ"CX
277,364,260 *1B4D3A15BFE4433BFF24189EDC10DC1AAE115C12 AZ!dB
277,364,261 *1B441826EB3C68162D4D59D0E9F99D1227BFEBC6 AZDBI
277,364,262 *1B44565898C9E812A50A6E60DC496B7570A76B4B AZdpM
277,364,263 *1B47C6895CE38EA726D194F5F07B92AD2BE1A024 AZdRV
277,364,264 *1B42068F991BAC9B8E86369B77EDAD51482C2195 [email protected]
277,364,265 *1B4AC1CE36B6377A12B94B632350129817A78B99 azeline9
277,364,266 *1B47213A91E3DA7CAE477EA6EC08F0A01317B761 azeoaa
277,364,267 *1B451D687BB17EB28500B2DDEE1438CA49B461B1 Azərbaycanliyam
277,364,268 *1B444B435ED80E1B499EEB14058AC3FEBFE85727 Azerenerji
277,364,269 *1B4E3DEDBBE21388932FB66D56303382760EC739 Azertbsw0
277,364,270 *1B40EEE336C3FDA2A038B60DDF5BE90AF340F760 AZeT)
277,364,271 *1B4134B8E34CA28512E0ADDB06F6E9171CF0D094 A()ZF
277,364,272 *1B486432A52BF016E6A5B9AB7BFC8C7C1E5FC026 A);ZF
277,364,273 *1B4E1F008CBC022408B9DCC94D9A5F7B617E5FC6 A%
277,364,274 *1B4A3D1AC87A1AE1CCCCD312BF8C0D14C5867789 AZFARES
277,364,275 *1B4FBC6C2283044E0E314CBD82C170BDB969514E AZF)K
277,364,276 *1B44D1B409B75D427A2E7CAAA2A808C44A0BEC5F AZFNv
277,364,277 *1B44D9C2811657A9351BDE5A42792AEA8CFBBA96 AZf+R
277,364,278 *1B4E8878BCF7A94097A683CF078DF8859F70FF3D AZfuI
277,364,279 *1B4167365F43095D1C9DFE8F70A0B11DB34F2D60 AZ(?G
277,364,280 *1B44A7CBD286425FE1170E4BF818338EA57F2C74 AZg!/
277,364,281 *1B4C4EE8C1DCC843FFC227BB601080DC714E84A2 AZg6o
277,364,282 *1B46AB0BDE61C8480C6EA30291206BDAAD35838B AZ&gl
277,364,283 *1B4EAADE75A617D828546E9E7D302F3CDF609C72 A;Zgo
277,364,284 *1B4E521B4678010A73AAED522AB043AB5DC28A89 AZh?$
277,364,285 *1B42512D8215D455DB2F86116091E197003CAF02 A+Zhe
277,364,286 *1B48C55899526EC538970DD9D67DB9A39E0E5F3A AZhEA
277,364,287 *1B4D64DAED441F6B37377BB579BAFF4EEBD94DC1 AZHI"
277,364,288 *1B4874F90E078FE454F422CB6A1AD4B5DDD79C37 [email protected]
277,364,289 *1B40A9DE78AAF7156C4C75FAFC9DFDE86BC969D0 A#ZHX
277,364,290 *1B4E8505E19C9ED7D3332F04F993EC963BDD5F5C azhzg
277,364,291 *1B4AF7C86A2139DB0587790DE45032A9F4A397DD AZi1-
277,364,292 *1B40452DDBBE8E0C712C46FBA1ECB268C7D96727 AZ%I3
277,364,293 *1B4473225D18D3C72E88FA435AA7470602BDA3F2 Azianagoed
277,364,294 *1B4C2CE4DEA84A4C2855927E0F71DD43019DAF49 aziaziz
277,364,295 *1B411D7D8D109560EA6E166B2825F56FDDA250CA A:ZIf
277,364,296 *1B4B1DD0DECA96112429E4D5F633F44385157DCC A#ZiH
277,364,297 *1B4588DBAEC24946368A6EC4E229662750B525EA AZIiS
277,364,298 *1B49C339B8F8F263B147356786B082CB65E2ABC6 Azijnachtigst0
277,364,299 *1B464C4E45D3F31638E782A35C3C1A027AFA70C9 azinedye8
277,364,300 *1B45FD0BA265C0245F1C7688B115E2DFA9986597 AZI_Q
277,364,301 *1B4237142006C30C23BFA7B29A56467380A6AA86 azizahumar
277,364,302 *1B4C068425389870A1FDC75D673CF849DC2579B2 AZIZI22
277,364,303 *1B4D1F0D4D50660E57F1A1E2A23D076880B00D8C A/Zj)
277,364,304 *1B432B760E16E83A311A2D9EFA388CE1C9B42B4E azjessi
277,364,305 *1B4341C1AE76F94FA503E44024D4CC4AEBCADB88 AZj,H
277,364,306 *1B45AC6EB722E75476C29EC475D649AEF643F3F9 AZ$;k
277,364,307 *1B4CD69CC4336DABC6D782EA000E6BA2C4B3BCDD AZK5K
277,364,308 *1B4869533DF15C9C6F94A080699D488B24DEE9CD Azkena(Bonusa)
277,364,309 *1B401EFE5D943D36E07A74DF0A4FB7A1EC1446B7 AZkNo
277,364,310 *1B442F6D3477EF932EE33EE6A8F399F07D2ACB2D AZkTL
277,364,311 *1B4BC6D1A02CD4BC7ED8612CF76602D0869F5AF7 AZK#U
277,364,312 *1B428B663F8E371401BF2E07911DB852D60ED405 AZkYg
277,364,313 *1B40C44D6FB3D6AF57EC55DDCCCE534FC6FDEF03 AZL,0
277,364,314 *1B4B4FCE1A971ABB6E6701AC2FBCCE8324D24BEE AZl0?
277,364,315 *1B4DA9A307C9EC25B21AC80D46B3860328DF7197 AZldv
277,364,316 *1B443F30045E78D34E1A80BEAE0C65CAECD5114C azlin roslan
277,364,317 *1B4B7EEBEF0F460554366D966026CFF7CDEE8CDC Azlisya2
277,364,318 *1B4D7D1F2A94FD59FE20BCB2BE1362D35D8C62FE A?ZLL
277,364,319 *1B4E6640C17E5AC855EC8CCB789B364F95840C1A AZLO7
277,364,320 *1B42449DDFAF957111BB23293D450F9B0ED95759 AZLp9
277,364,321 *1B4C1C0AE7947CF8DECF5381765BFE3DD82E77D1 A;(ZM
277,364,322 *1B48A9753E3CE8B9976C80D9E29345786BF8115E A:Z+M
277,364,323 *1B4FA3D101F51BD5025C4BDA4DA34F60F3A306ED AZ,_m
277,364,324 *1B4FBEB456FA3A565AA596AF00CDE37830B84E34 AZMANII
277,364,325 *1B4285B3E2B2A1563F779245F092857EF47EEB9C AZmBO
277,364,326 *1B419CA8C8546F97701ECF69893139BA2D14BD40 AZMHV
277,364,327 *1B4BD38432FEB34E561D0AC67F60306E7B613837 AZmkj
277,364,328 *1B453B600D86C0100684558A806B748BD0DB373A AZmKv
277,364,329 *1B4B698FEFF54CBCA24DB099506BFEF4338810A0 AZmUR
277,364,330 *1B4DCCFB1E8E691BCF7C6458323228AD02C38926 AZ:N,
277,364,331 *1B41E04A51CB11DBAB51FC2D70AB8C10BA6D49AE AZN510
277,364,332 *1B409A36F0F483A87B25890074643173E345DC96 Azneemegging
277,364,333 *1B4C0766C78B7A8CAAB90A519B27D47FA81D0AB4 AZNF)
277,364,334 *1B47FA584382C8F7CD4CD686E5061E9800745E8B AzNF
277,364,335 *1B438B3B1E97BA843B5B276F876A4762E322B8BA azn.inv4zn
277,364,336 *1B49A2FC13C7EB0CAA223B410CFF4EFE1A33EFA7 A&ZNY
277,364,337 *1B4AE4F4919017CC7EDB75D27CED1F4E9D721F8B AZNYp
277,364,338 *1B44A39571B0FD5710BA3E1DF42C679E5069F24D A&Zo)
277,364,339 *1B445B48F79B5E3B984EAD3683C2C9C20DE96BB0 AZO7T
277,364,340 *1B4F724F000A2B72F7289351E6BB5CAD5D8254D4 azocara0
277,364,341 *1B4698A61AEA3968B3041C24CFD56AE06FFAE706 [email protected]
277,364,342 *1B4AFBE972C8143E175ABF64F3C36A90059AF220 AZOKm
277,364,343 *1B4FFA571C35B2C04A34050260BA492D919E1548 Azolacea4
277,364,344 *1B4232ACB1E8C3C523B69FF6DA2A7DC946BBF74E azolum
277,364,345 *1B496551C468785E62A55E9BB4962445CFC8C5A1 Azonilla2
277,364,346 *1B40BDEE880C16376DBE774FD2164D7339730DAA Azosulphine.
277,364,347 *1B4763F4F390FC02E25C692A2128A8C49033E54A Azotaina
277,364,348 *1B42A09F13D09B776A884921431F81E472B4379F Azoteas0
277,364,349 *1B4C9BEB35B5869F4729BAD28223E77F105DCA85 azotine8
277,364,350 *1B4E1614DC2A2C6990A20F31BD665CA68B24C189 azotino7
277,364,351 *1B491228C7650CE13C8001A1653EDF8C67E8C17C Azoxyanisole7
277,364,352 *1B4B85B8826648A9B7160F05A0BFC52D2220CC4F A$Zp=
277,364,353 *1B40306D93B8DDAFC4D6FDA1031F43222AF44342 AZ%P6
277,364,354 *1B41EE4C3887C3D799A9526BAF9E1F3E2CCE38A2 AZ(PH
277,364,355 *1B4C6144B93F38320D313BF4A4F70015ED38839D AZPMCDEEM
277,364,356 *1B474CC7995031FF1F4EE749BFD4A4D44D9FD2A2 A?Zq
277,364,357 *1B40CA9DB66D69A346A268E20F1F05F19B49A941 AZqSV
277,364,358 *1B4BC9EE5AE75CF79B9E037B912F1FE2FE4DC226 AZQ(W
277,364,359 *1B49EB31BD20175F18C848C6279AA6DCFDEC4EDF AZQZAAAAIBAJ
277,364,360 *1B42908474FF09D3CF36AD3DC3EE4F02830D74FB AZ%R%
277,364,361 *1B4FA6FFA8F353442E6BF4B01E662DE567EF4162 AZR3T
277,364,362 *1B4EEC5E6FF3E514D62BAF2C4FE68BCB7CF6E293 AZRk0
277,364,363 *1B4E95BD6316EF1CB60866F3E58C167FB5A610F6 A=ZS
277,364,364 *1B45865DC0B6379933BC67CCAF5E8EC5D0C5D2C0 AZ#S&
277,364,365 *1B4AC401CAE02B819E09FBBE50475BC62458F5A4 AZS-.
277,364,366 *1B4CA8D5DE5D4D6BE46C5B12BA00C73338FA7BF4 A;&Zs
277,364,367 *1B442915C864D66CD019CDE23432389174C3A144 AZS
277,364,368 *1B4495D60CC4B455324A6ACB8C45B85F13382CF2 AZs9:
277,364,369 *1B4345B5094770AF32F600FF0B247746FB9EF75A [email protected]
277,364,370 *1B4EF2BD27941A61BCE06A462213846203ED3D52 AZsGe
277,364,371 *1B4BB4C606FA50A59CCCA974AD317DAAD1D5784B AZSN=
277,364,372 *1B4E9AABA239271CA6E44F19CBF65E56A1848E68 azsx141
277,364,373 *1B4CA02B628DC0B010512756AD687D147BE23818 azsxdcfvgbhnjm976
277,364,374 *1B462C62903C29FF9D9C574A073D8D5637A564DF azsxdcfvgbhnjmk195
277,364,375 *1B4B269C8679D4D747961EEBE3056B630C5BEB13 azsxdcfvgbhnjmk763
277,364,376 *1B4538626126E1DEC6E7FA56D295329A17884444 AZ$t;
277,364,377 *1B4AA9BA3E739A64BB1599F26752AA0EA6A362E8 [email protected]
277,364,378 *1B4205A221454994B2C0CA30E68324939F0829E5 aztecs54
277,364,379 *1B431BF77B6C792D5EB4B01BB381CC86E3155304 aztecsmac
277,364,380 *1B485914B6F709A231C295F7198BE863860024C3 azteechs
277,364,381 *1B4AFE281E88FDF5B195BB07FA840AF27619D59E Azthioni8
277,364,382 *1B4C0B4AF0C5CC8BE34CD686064126D88C8CDD0B A,ZTM
277,364,383 *1B4170035C29E69503220E8A60CD4276A47D88EC AZtN=
277,364,384 *1B49482651C3BB81FBEA97AED2BAFE754C01E54D AZTo8
277,364,385 *1B44DFD62872EBC67C7114F99FB307811487FFB0 AZ#Tq
277,364,386 *1B484B9EC85B09813A63B7F1C4098D79EBB447CE Azttlan
277,364,387 *1B4D94230A31A8AAD350F590DA664ED87744D518 A+Z:U
277,364,388 *1B4F070E116761A6F0D6D270B52DDE6F7704199A A`zu
277,364,389 *1B4B2A05D53BD16CD50EC31FEF2C851634332BD9 azu_
277,364,390 *1B4C0EBB41FCA6A464AE6556A99CD00FC09DD075 AzucarRelación
277,364,391 *1B4743FDE9A6CB4C9E75839CC858C8387B402888 azucianos
277,364,392 *1B4D7DA211D4BA6647E11F596EE80AD21BB4CCC9 AZUDM
277,364,393 *1B4251FCA33F2A5D5EE0EEC47BC08910955DC0C9 Azuleastrum
277,364,394 *1B4D9B77CBC5DE4AD7D7442760F8A1880659641F azulejarlhes
277,364,395 *1B408AC6660B561B363A4ADD2857F42948203026 azulejloei1234
277,364,396 *1B41C3E0C22209566019FA4105FD07AAEAB1AFC0 azuramansor
277,364,397 *1B48550E3C5D9E0FE288162ACD68E4A8EFB39320 Azureplu3
277,364,398 *1B45E78FB63604D6388E1F4E9888B46419E001F5 AZUV)
277,364,399 *1B4535D52539453C4BE1142BD43F69A5CEB0C86D azuwera
277,364,400 *1B4CFEC7584120A6C749E410F2E83DA75356BD73 AZUYQ
277,364,401 *1B47AE9F84FD81887D291F437BD53433801E74DF AZ+-v
277,364,402 *1B4DC4D4E8DDF2013497CE69A464146821180839 AZV1?
277,364,403 *1B43DAAA238335492226A15BA7BEA8CE5DFBD236 AZV64
277,364,404 *1B419D6C3BE2456840C02FF1F2B86BD56CEAB91A AZV#R
277,364,405 *1B4F042F1C5C81F072561890CFFB640968617EE5 A!ZVW
277,364,406 *1B41A763A7465551788997A90F5936001AF161B2 AZ/.W
277,364,407 *1B467D362FEDBE11C69469C2285A1089F42DB717 AZW?
277,364,408 *1B4288A6B3F3D0ADD0C73C8BBBB85A16193FA783 AZw+
277,364,409 *1B4F551BF523536801E804E55F7F834610401430 AZ+wD
277,364,410 *1B48C89DBBB27C17109C14468D5B19B4912E4427 A)Zwf
277,364,411 *1B4AF8D659450664E7A77AD9FDC20FA7D6699B08 AZWK)
277,364,412 *1B415FA52CED187106E0AFF00745DA31798BDB92 [email protected]
277,364,413 *1B4A200FB57A5ADC767AD455D4F6C5556AF5D274 azwsplashpage
277,364,414 *1B49CCB21892863D3A2F8EEB2EC96F92B8E110C2 AZX-4
277,364,415 *1B461043E00CF6F00E695180BE568379A32978A8 AZX,f
277,364,416 *1B4EF82FEEEA675A9E89FE2225B05A957441C360 AZXH8
277,364,417 *1B4483141526670EF8587137F59FD3196BEFF2BA AZXlP
277,364,418 *1B4C1310A8E078FB54232CC5447E5AA59DA0F451 AZY:5
277,364,419 *1B4E06255526B14C418002A1A08DF8AC46515389 AZYBX
277,364,420 *1B4552FD3F72F21661CAE297206D7DD427600F6A AZ)Yv
277,364,421 *1B41ED16789C09779C5C36824B98E66F838E12BD azz2924
277,364,422 *1B46D26541EFB77DBC18FE6D71126D405A5E94CD AZZ
277,364,423 *1B47A37ED95CBFD3322367C97A451696CCCEDDFB AZZAGETNAM 1
277,364,424 *1B4F4195D966B01A3705E16568342D92A8DE7044 Azzalina2
277,364,425 *1B4DFFBCA6261BFB3677BDD9E2F074C583883CF5 Azzanaig
277,364,426 *1B489B6832AE86597F89D653A0F9B7CF276759DD Azzarderai3
277,364,427 *1B42C27312A8C87D83E129D95662C4AB5EB1C80A AZZc=
277,364,428 *1B4075D1C755929D97CBAD63DB352911A296EB70 AZZi:
277,364,429 *1B4F27F0921A69DF487B684041CB0DE7228D37FF [email protected]
277,364,430 *1B4210C0CF8F93B0859143A1CB8B4256C4723830 AZZQQ
277,364,431 *1B4FD5D6A29003714628873EAC9631E2D3287AD6 azzuri1234
277,364,432 *1B4275348E02F946E83AC0FA3B6A199AECFC6B2E azzurrajody
277,364,433 *1B44D5DA373FB493D307B3AB7E43E9761B33B4EF A#ZZX
277,364,434 *1B461DD710586957AACB476AE67C7520E09D5A63 azZXCVBN
277,364,435 *1B4273C3B49EEC4C5DD871D9C699FE3B2226B447 a型、170cm、63kg。
277,364,436 *1B49EB34C76F4D25CAC319BD842EF19A6FC9B2E8 aリーグのシーズン終了とacl開幕がほぼ同時期
277,364,437 *1B473C0ACDFF4E1C484A752657976EA038348970 a組主管
277,364,438 *1B4487A71F7D51034417D5E58CD07E6232E84FF5 A通信中隊
277,364,439 *1B480882E9F73951345F3D636539F0405D0D3088 ลำดับขั้นของยาต่อการตั้งครรภ์B
277,364,440 *1B48479062798D01EAF00D7F606886321A5BB535 B=,.=
277,364,441 *1B4A5D73E8A837BA0903D6595DD97054C4B695DA B=?=
277,364,442 *1B4B849D68784659BECECA0820AE5F731385572C B=
277,364,443 *1B4BECB4B8D82EBC6F276CE6BBCA456C3651E0B7 B_&):
277,364,444 *1B4A5570463276C1E4AAE99521245D0F9223B277 B_#,#
277,364,445 *1B40A8532351AD8A3444B06596060E29E5FC1C56 B-,#/
277,364,446 *1B4B45770AB29A58978BDAE4FEAAFF30A34F82F6 B-;-.
277,364,447 *1B4B9B80D1661147CA70D9DD5E32E6FD2BC54357 B;#;&
277,364,448 *1B41D070BDF987F69F04B78536F9E03D09C9602C B;%\
277,364,449 *1B4D93A0D60E53A098F6DE37FA520A6A2CC9D215 B:"_?
277,364,450 *1B45ADF95A2288335F24D3FB3607BB0E886B4B72 B!=;
277,364,451 *1B4F80CE80D3680E1C8BC881C7EBF5385B8587A7 B!>]
277,364,452 *1B4201DC36AECFE409562CDFF2FC90C49D573F29 B!!!+
277,364,453 *1B40358E155FCB88EA4244B687417FB0BC289CCC B!._&
277,364,454 *1B438C810DEBA6A5F4C2898B414517FCD4A9B8BD B?_/#
277,364,455 *1B4ECEBBFD41866E6AF6D5701D31165DBA671A1C B?.+
277,364,456 *1B46846975D617BD1617B1A6C68F65ED98E8EF80 B?+_:
277,364,457 *1B49AE5DFE80DBA06AD264CB850F917C66685CD2 B/`}
277,364,458 *1B4AEA532084E147BC64AB9183946B981DD3CDBB B/($,
277,364,459 *1B4A08ACF5516657CAB6ED1452A559AE82C4D961 B/)!)
277,364,460 *1B421F9FA4773BA0F35E31B72B1700FEE15E1FEA B/#+#
277,364,461 *1B49A8ADD3F46D2D8B516AFDFC6F1CE66202763B B.,-.
277,364,462 *1B49F0DEBF269D51A22879DDA9C95A01DB4BD8C7 B.!]
277,364,463 *1B4C36D43BBB129A8F78ED4EF2E2AA0A879DB379 B.&("
277,364,464 *1B4E5FE090F48FB64237E7FFB09DAD3641C9EA1F B",(
277,364,465 *1B46CB3CCFA01C44773308501D32E7CDC8C0868E B":;/
277,364,466 *1B4551317943F910DC65A2A8A1EA509BED429618 B")((
277,364,467 *1B4F3785D3D7D1BF68FB74B208F8FC1C331BB0C5 B(
277,364,468 *1B43A9F241092B46AB3526410B9CD1D6A58A658B B)/:)
277,364,469 *1B47CFCB8AB91EF7B667AA049EAC10080F2B9FE0 B)$:?
277,364,470 *1B4C6CF6927C84B2CC9CE930972C6C8926F7271B B)$/.
277,364,471 *1B42F640AA7FF86BC9DE7F53C167BE4342E43D89 B)&?
277,364,472 *1B4E37801FC309D44A54BD9F7089D24FF1E5789F B{=!
277,364,473 *1B439E6FF6EC426C2D152495E59AB2E616BDD028 B{!$
277,364,474 *1B4F00E596608F333BEA9C8474A5BA8ED11E35AF B$$;(
277,364,475 *1B4731A47C0898A817B501027DC25E5FFC720EA1 B$#;/
277,364,476 *1B4BDCE7BFBAE2CE1BE36F9D51BBCE0B9B479DCD B$
277,364,477 *1B402A69C006A1BB3982183CCC430CD8B606F7B9 B&!/?
277,364,478 *1B4939F3673BEB21E2DB305CD8638A68D5288100 B&...
277,364,479 *1B4F4019CF67D99BFE18DED7BC2FCB64445CFBE4 B%$!_
277,364,480 *1B4583F257C9D00FEF8AEEF71886E20F7D6D2C8B B%&:+
277,364,481 *1B448FF8C9A41AAB08DDD9841B0BF18FB6C45D75 B%%)
277,364,482 *1B43F73B276B458A966D019914CD21C4C23F9F9B B%
277,364,483 *1B4BF1791889EEF9939FFF169F5602681209749D B+|<
277,364,484 *1B4A46B51A70A6C6E9049D34441405B9F520BBD7 B+--:
277,364,485 *1B469405E424747F63ECDBF2C3A8760E3A211C5F B+($
277,364,486 *1B4D8C96C9F0271478A3314676FBC752943E7DF6 B
277,364,487 *1B426855C8F73C9F4D230E78CF5928A1E5F251B4 B
277,364,488 *1B493BB6A8C807CD2CC0B5F505AD176A2F98202A B
277,364,489 *1B4A3C8C13A2FF8CDE7CCC8F0F97CC8E8FAE433F B
277,364,490 *1B4DC05CBE47992326891A8CEF1C28C6061E2A82 ;}b
277,364,491 *1B41713F37081A1BE542F51B513BB23672A59C5D B-0""
277,364,492 *1B4F12AF2C25DF0109823CE31F836E62AEDF53CE B:!.0
277,364,493 *1B443AE99E330CFB904E13266AF23A3446A9DD13 B:/0_
277,364,494 *1B41B43BE117F778BF755703D4019E11D559CE25 B+?!0
277,364,495 *1B4178C3837551BF6A8ED4F1A6B94F8D7B819892 B0-)_
277,364,496 *1B4F7AD8EB1D7343743541FDCC8B32E81516BC30 B0;&,
277,364,497 *1B469EE4C0948545026A968194F114D58951BDA7 B0&+
277,364,498 *1B40EEDEDBA32D58D3127AD08ED02A1225AB2363 B0+-
277,364,499 *1B457AD289E53B3932158E082A6A599CBF30E971 B\00
277,364,500 *1B4C3E2EEB64057869AED57ADA38FF8ACDEFF46B b000002ifl
277,364,501 *1B4985782F81A5B413288CB0C7A6B3C9392D0001 B000003FG4
277,364,502 *1B49AE0BB656C684EB2C0742B36252103FD51074 b00001ogzv
277,364,503 *1B4EE308CE90DEFD86840F79CE31EC0E2C058631 B0000302RF
277,364,504 *1B469097D598E0A350F436B041E9AAAB1DC57C0A b000051vww
277,364,505 *1B4732F26DB82DB8020054ACAE546D4C7D2B2F94 B00005U5NA
277,364,506 *1B4BFD8F921AD26410B8B2021EBBF5917E73E840 b00006l0nf
277,364,507 *1B4FB585F559633957BB205F8E1467E4D0CEF2AA b000092ptb
277,364,508 *1B43FB59091BD634C8465641B1D8A417EC2CE70C b000154
277,364,509 *1B4CB9DFF7E20FBC9445FEBD99D058F05C1B9327 b0007hs6hu
277,364,510 *1B4E6224DB092FCF4A53950D881E17DB0B29CD8B B000APVCV6
277,364,511 *1B4AE6E1118D491506E110025612564E5FAAB072 B000CS4JSY
277,364,512 *1B429B73E5494D16A8F724F6B9E527928F9BD65F b000g8nw7e
277,364,513 *1B457D3C778D2FC04EF44D75A7F76068AAE85C10 b000gkss1m
277,364,514 *1B40726849BE0686901B787200C72784C2D1AB72 b000gtn5bg
277,364,515 *1B4F4FFFC3811BC4EB0708ADF4D10CD2B2C98E4D B000IFS05Y
277,364,516 *1B4D0110DF16009A931FEA3208522736DFD3B380 B000RHR81A
277,364,517 *1B4ED7C6CAA646E52FB4BA99BB86580674F7B9CE B000XJ41K8
277,364,518 *1B4CEBBEAFB5C53A90E32B5C9388FB0820E5A0A1 b001ab0e7c
277,364,519 *1B40BEEEDE2D27DEEC333B35B682E6DDEAA7C9A0 b001bqorfq
277,364,520 *1B407E485401E9EB0065F2C430A0B0F235EC2C8D B001H1BDAM
277,364,521 *1B4D8F3CA82FFAD889F095328E86458CD1376709 B0026O9O50
277,364,522 *1B4984D5094630568E0FC8B5A7AC7617BB0C5D2A B002FOQXTG
277,364,523 *1B46ABF2AAF0FF4BEAA3D9BF585B7F9AD5B39C05 B002KAIVTK
277,364,524 *1B45A21ABEBBE600FCCB9DC729BAF490A171D7A3 b00386owvg
277,364,525 *1B488FDC9407998CB1AFE2C9D208B77E46CBA4BB b0042
277,364,526 *1B4C7E2FF6243746D66BDF49E6E56A0C0788D75D B00cW
277,364,527 *1B4BDC01F316B8449D0302AA9917BCCC1E1CAF5D B0$0f
277,364,528 *1B40B1A3BADEFD5BBAC03BA048E72CC6298ABCA0 b00kp1a7e
277,364,529 *1B4898675ABB73FC0A2E6EF0D1C7EF203C897FE2 b00tkl90
277,364,530 *1B458D84FEC19B9231B8A72A01D9063AC01F3506 B,01-
277,364,531 *1B49475CF6C70CF8F47BCB849C959114EF5D8CEE b01c0t3l014
277,364,532 *1B4212722378BBDE3A4E894C67FD623FE146407C B01g6
277,364,533 *1B44D6D1196CCD5AB103BB19F08B6E6BC42FDB3C B01ighus
277,364,534 *1B49533BE9FC6E50B9C0CBEE8C7DB99C7006D105 B01jv
277,364,535 *1B429F7FE4C405BDF249FBFB7CFA8159C1B2FA11 B01;p
277,364,536 *1B4BA6EFC893EA1F9C8DCF11E856F567F9576E13 B01pZ
277,364,537 *1B490C35511F8BC68D95CED6C859A202F496CE94 B01S73R3RS
277,364,538 *1B4AAC8FEFBFAD52C12764537845FD8683B314CF B"0=2
277,364,539 *1B44FA440559AA5566210E3E106B9B19B70FB915 B02K.
277,364,540 *1B40A12AF3984888BA9DBAA6016777780B06749E b03091986
277,364,541 *1B445D35439C20B82498092CCDA3351B8CBAF436 B03cQ
277,364,542 *1B4EE5A047A8CF518DC6094543C12D635AC7FF05 b03d4p35t
277,364,543 *1B4CF53FD7487E0DEF1D3A9EE5876D0C6BF7BD72 B03i!
277,364,544 *1B474D7274F7481AC7E5267B5A7AC2C3E17849B0 B0$4:
277,364,545 *1B4F1F4E71C798B52F63CBC1848B3B17C4C76793 b048223979
277,364,546 *1B44DB2995DA5087D18C744CB9E39D64DEF7E806 b04.909.204.340
277,364,547 *1B412A059C29C530AB47C4B65E10246E1FEC61FF B0+4I
277,364,548 *1B49E7867D03D48A7B036A81A4C7600553C6E061 B04(P
277,364,549 *1B4113E60CF5457CB8EEDE6AF9AF9CAFC29648A0 B04S+1NG1Y
277,364,550 *1B4BBFB1B752A628F578AE1C992F321E5F6CA6E4 B04Vq
277,364,551 *1B47A9BD3A6E3BB3DCBAF5C3588132B254E277E0 B0!_5
277,364,552 *1B45D75C90AE8B34F1DA1E33883D19E9467F400A B0?54
277,364,553 *1B4472F3BB16FEFDEE852E6A2CBA6CDAF49D3647 b05513d0kt3r5
277,364,554 *1B4C8B2F953DA1F062E12F837A9A364E04EA6591 b055n0
277,364,555 *1B4D0112B5EC75E72AB571A38310A1D4D5C86962 B05KV
277,364,556 *1B42487070796E3B8D04C1AD5857E73CDC8DE007 B!05YN+H35!5
277,364,557 *1B4A5D7DA67C7E4FA1DC253E6A237495FE597B52 b0664346434
277,364,558 *1B4C3D27D233F3A456E9AE99D96160FA07DAAA2C B06O-
277,364,559 *1B49B671F83A426694DB52A7BF8167F372616A53 B06:P
277,364,560 *1B459685199F21D5B40EE079193AF349F2876776 B0,7$
277,364,561 *1B4A02517F866C3D48A6475F884426BC51933091 b0702020
277,364,562 *1B41F3D8EE0455F539DC5BF03E3AC63CA438C63A B07_B
277,364,563 *1B448E69F3991C0D3CCA35B770218D714D5FF26B B07P740STKEPQ613
277,364,564 *1B4E4A55A13732ECF323AE93363065F1B1A55385 B0!8.
277,364,565 *1B4497B6B73F2419D559F43B0DC97683B63071BD B08?
277,364,566 *1B4BDF25050088DE10C3D3EB7ADCA9F8093B2814 b0856920056
277,364,567 *1B45E6408723871F64A628A6A9368AE8BEB67CF1 B08BY
277,364,568 *1B4FC628BD4030C6FD1A3D07F3665B690AE4DF3B B09S=
277,364,569 *1B496E6092D0E0F062DBC7798DF3EEE07FF36A95 B0a%5
277,364,570 *1B4607462CB9A15B7CD79499F7384530A3B58644 B0as+1n91y
277,364,571 *1B4D706AFD431730E2C0553C0CB192B804F29D1A B!0At
277,364,572 *1B4013E675ADFEB31ABBE66BD0B0F128479B012D B0AT1N9$
277,364,573 *1B481B817D60E4FF8D7AEC456A342C44C778D3E1 b0b7a1l1n9
277,364,574 *1B42410EF050183C33410AC3FE2F8D00EC7AC64D B.0Bd
277,364,575 *1B4C3583C7DD439AE400D9E543D5FF786EFBCACF B0bjc
277,364,576 *1B4F61FD8CBA0E8A4D16B3AB4CE2C01B91D8AC4C B0bX=
277,364,577 *1B458992FE117AC2F18008D79F6F05F11F1EB519 B0$C)
277,364,578 *1B4E8E55C151C12353516C83F3280F575DF2E5F5 B0C{
277,364,579 *1B46DCEF68D90E07BAC5332C346860BBDF42C9CA B0cdH
277,364,580 *1B486E202F6C4B97F0DE6BD7482FC0C707D338B3 B0c%h
277,364,581 *1B441CB25FB8F55EFC01035D5D3F342FDD3459BE B0ck-
277,364,582 *1B4865BE1F480166CB5B7D7428F262AEBB46342A B0CkZ
277,364,583 *1B428400980C362B19768C80E2E174AE8D4056C3 B0CnZ
277,364,584 *1B48A296FD74B0C53A46615DBACD9BDECF8203F4 B_0d/
277,364,585 *1B42E4468EE2EB4A7282EBEA18FB2E1A71F36BB1 B$0(d
277,364,586 *1B48C5C895F30F6961B7A7D4D738835EE57CC722 B0$_d
277,364,587 *1B40EEEF680AC192876BAF6958C3628B1DE7E39C B0D1C35
277,364,588 *1B4E3392863DAADBE457A4562A00CB965BEBA702 B0/D2
277,364,589 *1B498994AA849824DDB3269F4930017AF610DCC8 B0DIq
277,364,590 *1B4B1E660A8611A63AE22A7474517EDEA288BBE5 B0Djb
277,364,591 *1B4E1ACB2E3A6DF4A9E63A25F77F85739DD20CFE B0:DU
277,364,592 *1B4E393693DD382D8B361A5023EA31229AE6DA46 B0DWM
277,364,593 *1B4A3119B752144D635E45E13BF718A438CF6FF5 B:0E$
277,364,594 *1B4F5877CE308EEEE83B3569376DEEA28A43BB83 B)"0E
277,364,595 *1B47CC06807E9E69826A8199B56EE65FDBE198D3 B0-(F
277,364,596 *1B444B0636E88536ED35E0E37F058E10BFB4161A B0;(F
277,364,597 *1B45C31CDD571CF66A1940C5F767F0C20DEB7957 B0?Fc
277,364,598 *1B485A79926C09A8CDEF94877057FB4D932D881D B0
277,364,599 *1B47F230A9B2DBEF948DCAE624628A3D8845E8DD B0ffl
277,364,600 *1B44A0DAD72E794090201494FB4D196B0172DC7E B0FwR
277,364,601 *1B4963D6BD187EA8B54C8ADB5A3ADFE80154849B B,0fX
277,364,602 *1B40092792B452CAC92E0F8E93721EB53B86552D B!0FY
277,364,603 *1B470848DF3C0DD94AFF3264EA80B2B3463CD9D1 B0,$G
277,364,604 *1B4F580586A184FC6FCF50FF9D643623D2DB75A4 B0G.;
277,364,605 *1B45718349C9535C7E9E8B5D0818CFF63C9A6758 B0G:0
277,364,606 *1B4E68A09B3D6932FA5817CAEB13602751CF4347 B0gcL
277,364,607 *1B46C62CE33A95120DE4BB3399C004E5954C3B92 b0gd4n3lb0gd4b0ghy
277,364,608 *1B46C89084A787333DA0499F67FE0297064A1C11 B0G%h
277,364,609 *1B483FEB5997DB4538072A18D88EB062A71D24EC B?0gn
277,364,610 *1B4C5F2F2DC090F86B198B88ABCFAF319E11E8CC B0Gtd
277,364,611 *1B4622AE9EB6CA6B22DC39B22DB6AE660BDF36D3 B=0H!
277,364,612 *1B40CFD08AD25D039949A6906EE964014B7586CC B0H?C
277,364,613 *1B4D81DDB29D71BC46B1B049EFAF76D7D3C859BE B(0hH
277,364,614 *1B4250BA5E7310D21DCD01E4C8CBBE9D675A8B29 B0h%i
277,364,615 *1B4F5EC5CADDF255237A485CE46A14A4C202FE73 B0$hM
277,364,616 *1B4CC2C0EA3BDE3722C677B39EE1770A6E277F53 B0HnD
277,364,617 *1B4CAD55D18D05C5F381B07FA2BCDA9B680F9DEE B0hs4
277,364,618 *1B4D8C7EADAC4020383B99B1789998EA45E93AA1 B0"
277,364,619 *1B4BF7197F7A8D6D2A92B63501551691E5BB9C8B B0!i8
277,364,620 *1B46691DB2C7DBD33695F18AAF478DBCEBA52710 B$0Ic
277,364,621 *1B45159D41C94BB42BAE6CA7AA459682F49E181E B0IO5
277,364,622 *1B48E0F5E77259DCE5013D1BC3CD431F79E8FC74 B0jfI
277,364,623 *1B47F77341BD9AE8604482F29A2B8FB1013F1002 B0"!K
277,364,624 *1B483E50B61FB902EE87E17662A02FC83BEFC17C B0K
277,364,625 *1B405AC5DC19714145C22676C07D78EF803516FE B0%k,
277,364,626 *1B4825863653E5EC3C4C714BDD5207A491C9327F B0k+=
277,364,627 *1B479BDE480B8F4E9F39FEE3E37352A8E5DECA35 B0k0.
277,364,628 *1B410240FE1DF51F30C4B77F812A500A36DF8F85 B0kbq
277,364,629 *1B4320591B939675148A36867E415CC8CDE06A22 B0)kH
277,364,630 *1B4A509B5454F449D36F0CFD6A5995A8580600BC B/0kS
277,364,631 *1B402EE4D32FCEC60933B29767B8DD579520918B B0=kt
277,364,632 *1B496A3D64F1ACD65F54A27E54727DBF32F7D523 B0L/,
277,364,633 *1B4029E4543DE96FF95F5EFE741CC56DC7217DD2 B0L7j
277,364,634 *1B4A28EDF607A12D0F5085F0D59FABB884620CD5 B0?LE
277,364,635 *1B46C86FE936B1D75E43560543EE7AEA84EF08E7 B0lE-
277,364,636 *1B4E6C12260297359DD7A5B5698EB58D5A97038E B-0lk
277,364,637 *1B4AA00A3899AAB880E44139BECB0CF4D213AD06 B0lpK
277,364,638 *1B4F257EC54CC9F0146E3ECD188C604FA4F4E2DC B0LvC
277,364,639 *1B4FA6E8A0A402478CF8909446830267C36ED33B B0-m3
277,364,640 *1B46D413924874031A8F3F12754331D2EB37DE30 B,0M6
277,364,641 *1B4BA83755DB5A5E2E6C66623F47C6759B8655A9 B0m
277,364,642 *1B4934B5E7A7B3A6FD40DA7F3EDF9D3978BD984C B0MjS
277,364,643 *1B462BCAD51C790525950BFC6FA69F6428B415EC B0Mn0
277,364,644 *1B48921D0F2A7E2EFA4DA84B7809BFE377D1F8E8 B0$mS
277,364,645 *1B4530558FD7E156C15E650DAF7E9F74DCB587AA B0%N)
277,364,646 *1B481965531DBA09C5266DDE272E2B7B538BC770 B0N;(
277,364,647 *1B4E76131584E1CBFCA49125404A3D9ED91EB8B5 B,0!n
277,364,648 *1B475BE6EE8DB68C6C71E11484CC5B1AC4281CF2 b0n17a$
277,364,649 *1B4729A31412808FE94F3835A6E1AF745DDABBF4 B0NOL
277,364,650 *1B4BBD41C9B855D0E2588DFBE5F64C2B80ED2E08 B0nR3
277,364,651 *1B4C7CF62BE55653876F8A2A165298A82215FBC6 B0nV0
277,364,652 *1B4FB96581D89272635E1D480E43676DAC216AB3 B0Oa5
277,364,653 *1B48C2FCB2BB6C3ECDB4DF6ED3CA0E6E1B4B3945 B0Oj2
277,364,654 *1B47609127CFB4BB43E77B7CCF50C359A68AEEA7 B0ol1
277,364,655 *1B43A1C86B547D5C65EC542D5E01413EB5F3E523 B$0P1
277,364,656 *1B4227EF626FE4D5E9747C7A8DA06B7E8728314E B0p7H
277,364,657 *1B4E848459BC0E5CC7698FB560B07C1D0E4F2E92 B0P%8
277,364,658 *1B462B7173AF77251292712D63CC8890983CCE82 B
277,364,659 *1B42E56A7ACEE6F68B1ECA0F2D7B8CE1AAE93E7A B0pf&
277,364,660 *1B42F347F6343A393FFC2CCA3FD7BF6C18C5464C B0Pql
277,364,661 *1B44C04640B19C02C20368208462E14D2E504930 B0PRo
277,364,662 *1B41D44EB05F9E799CAA96CF91BC1E8C0A515701 B0pS2
277,364,663 *1B473F367A828E367F691E7948DF32AF0BAA7155 B!"0Q
277,364,664 *1B41CF325D06D18CCA9E677649F27B73B579AFA3 B0qa9
277,364,665 *1B440E2458061AA7784BD53A82BE7A8B13D50D0E B0QMK
277,364,666 *1B4DBC81E970BB31037FD4C236A29F789A16F73D B0Q,r
277,364,667 *1B4626CC5169F5A87D219FB04EC11E5DB790E36D B0Qv#
277,364,668 *1B443DAC7D30B39678BDECE00DE4D9C9E9F1F9AE B/-0r
277,364,669 *1B4D4ACBC6890F74960F40A95CC06EBE4689EF1B B0R
277,364,670 *1B426F16D93D520C462A862B4008D573D2CA9575 B0RAN35
277,364,671 *1B42508C3D5FB191B7ED771C416644E28C6C54A5 B0r/B
277,364,672 *1B4A98A5B3D1BC35FD1064057870F7B0181501A4 B0RDp
277,364,673 *1B44F0A6B9EA107429A1701117E2853D5EC59B38 B0rKn
277,364,674 *1B4B595C3DD65407C86D8FA10C868BCF81AD5E0B B&0rN
277,364,675 *1B4C851C9589DB13A16EB25D0DBA5D72186C775F B:0rU
277,364,676 *1B476A90CB404988A68B7129D636883DC3CD70BB B/0:S
277,364,677 *1B42A8F2F6188CAC1D753E14BF556C44FCB2ED9A B0:S/
277,364,678 *1B4C417C926054A7534BAE004654137D1A95FD79 B0s5Q
277,364,679 *1B4515D31C9A7A8588EF617A1A9C8BBF1BE836CD B0"S7
277,364,680 *1B435DA934CE5ED4CE6A27A9EF7DE1662C114733 B;0T(
277,364,681 *1B4747867D841942C351089E32A8CABDE403B0BB B0T$
277,364,682 *1B4A51CA3A6AD721F46DD3420952AFEA11ECC0AC B=+0t
277,364,683 *1B41C673ECC6A7E81BEAC05A717E2A2C95E92073 B0tgO
277,364,684 *1B4E5DD8F516AC02589BCF4D4CE2B5C130830CA7 B0"Tm
277,364,685 *1B4FCD3DC5F0A814CC6278B11C4ADDD3ACF24BBE B0t_S
277,364,686 *1B4E533158067E03F7CDABD7B7C05376DE8110AC B(0Tt
277,364,687 *1B44B27BCDB5A2A65AF521CBDE939BD96CAFC38D B0`u
277,364,688 *1B40B5FB0761DBC44E18CBB7D231D8D8556F4F06 B0u9a!nv!11aeas
277,364,689 *1B49821ED262E748D347EFE8FB9827B6C0AD881E B0#-v
277,364,690 *1B45D9CB547827EA5444128E8D4BE2CB2CF3DA9C B0v,/
277,364,691 *1B45230A72947C78326EA3ADDAD2A22FF57739D5 B0v$d
277,364,692 *1B485CA793B3A5AD7FE7EB5D5A801EDB70BF7D77 B0!vG
277,364,693 *1B459ED0DDE2BCA6E8E9BB5037C3B9F3D61EC135 B0
277,364,694 *1B419DAECA8FBFCF99AE31F8FADB20792A8FEA38 B0ViT
277,364,695 *1B451DACEEF85848202F8BDC4BBE1962EB81C7AA b0w3ls
277,364,696 *1B4AE957E0EF71986C85C0C25E9B7CB01B1153A3 B0w"b
277,364,697 *1B49CD74C1C8664CCA29740F7054A5254322859A b0wdler1za+10n
277,364,698 *1B47C495D3C20E6AD6B9A23BD059247AD0CCBB1A B0X/6
277,364,699 *1B4B24F1BDE301D9108F82638AB7E5CDAAE71627 B0XO(
277,364,700 *1B46DA190E5E890836DE12833041ECD68FD05FC0 B0Y(v
277,364,701 *1B45EE0455CA42C649BCAD904ABBEC09D399DA11 B=?1/
277,364,702 *1B411D24350CEC5ECF185E1F3B7CB6ACE3B9DEE0 B=/&1
277,364,703 *1B4EEE3BE8C9C29679F37A1236A9E777A22C36BF B=&1?
277,364,704 *1B42C03A60FF13709E042CEE42AA5AE2FC469C95 B-_1,
277,364,705 *1B4D06BFD1604501BAB409A98967C003CF38EAE3 B:1?,
277,364,706 *1B438467C9CE664E7DCA92F3DA3A4BC9191B5EF6 B!,"1
277,364,707 *1B4ED1FF100E66E673859352B904C4F6D79C3BDE B1~]
277,364,708 *1B4115F2E3261B3A8FB8742E6CC1CDD929D3B0AD B1.);
277,364,709 *1B4D56DAF8884E48EF4E6CFE223B75124D3FC11A B10200ATL2001
277,364,710 *1B4A2CF6E53CDEF6770509EE0856DEF8B7E55DB1 b104eca7-aa67-3380-9feb-0c33713d5f4b
277,364,711 *1B411C17600A8A281E314E64DCAC62FDE40BC36D b105465
277,364,712 *1B4D03510213F4C2295630F1FCC3982761B2CAB9 b105626
277,364,713 *1B45CAFF46C17A76E8AF9D590628B367C3CE0B38 b106875
277,364,714 *1B4C1F25EF12525BB87A469CEA17391FEAAB7FEC b107ch1n9
277,364,715 *1B4A991F38608AAEC426D87CE7730773ED7A9CFF B108,
277,364,716 *1B45B48B879FFE0BFB9A4ECA05D5C0B6DA3BA023 B10B64YH
277,364,717 *1B4A94426D08CC2E758B7983751541C3DBACB236 B10T3CHN0L091CAL
277,364,718 *1B4557ADBBF4C66F5B709A29E654CEE6E4732C96 b10wups
277,364,719 *1B42509A899BECC20E52FC4E1B598235F4B69C5B B$11
277,364,720 *1B4A8F44B122AB5E369648F19C12855D735FCEF5 B1!1(
277,364,721 *1B400E4E448CE408C6F9507A4517D0334A14777D B11%0
277,364,722 *1B4AF9BD2387AEE28222F21043CCC70BEA0E2ABF B111793
277,364,723 *1B4A821A14EC9EAAE542779D215D028F252FE796 b111795
277,364,724 *1B450E709A09B3F0C2212311895A9DDC1816400B b1156511
277,364,725 *1B460B9BD275A9F07095A4CF1E82B027C373D8EF b118567
277,364,726 *1B43913AA056BB6FAF09FF58337E088F8D81714D b119504
277,364,727 *1B41490341C30489B6F51972554433C634EFD6D3 B!11!NGSG47E
277,364,728 *1B4BB6F8F69848AADD46CE66AED142E0B71D2AA1 B.11V
277,364,729 *1B4EC721CE93B720CD7C543F6C570E13121803F4 B11XC
277,364,730 *1B45D6E56E2D58A59AA713BB897E626BAA801745 B,1;2
277,364,731 *1B4E1A5C5B647DC3B7CD9C16381B7F6FC6900BC9 B!12?
277,364,732 *1B4CD12452AB38712A135590869FDD223D636EB0 b12001bubblesdonuts
277,364,733 *1B4CE07BE51CED4BD77995D43E0B07BA0696A387 b1200632
277,364,734 *1B4E5D5F82B04D2370D494D6289EF70C347BC298 b1207450468
277,364,735 *1B4CC78B593F65A27C302EDDB4A15FB930C7CBE8 b120830
277,364,736 *1B4C8C2C3F47100039D810914B8A45CBDD42B12F b122326
277,364,737 *1B4A53DCB52B672048DD6BD4981C22D7A7C8E46B b122399w
277,364,738 *1B413479DEC3743A80B507B3242020329B6EE8E3 b12331
277,364,739 *1B466992880949237F92AFF5120C940462C1D4D6 B12NT
277,364,740 *1B4F22CD4D3E0B07279F19EFD252130FF75E4E5D B12$S
277,364,741 *1B41890CE7FD482AB33BD40164BB22608129F1BA B&13$
277,364,742 *1B4019EA63AF66E531D41367443FB08BD68B2A4D b132117
277,364,743 *1B4819D34D902AB05E2281A18F819E33390AE4C2 b132422
277,364,744 *1B43782A69EA8DCDAFC81BA39E6F014D11D5E56C B1389
277,364,745 *1B41CC05F50BC12378B7FDF54C6AE37D56A3A713 B13achhou
277,364,746 *1B443CF040CCDFDD6404B94C6B237118ACD1B509 B=14"
277,364,747 *1B4E7D3F19CFAEF4F40D40BAA4DD7DB87EB92662 b141273
277,364,748 *1B464A0B55F764F6806C3E6D87F84CAB821F94DA b141611
277,364,749 *1B418B438305E78853832FD8092F21FB70FD5A2B b141734
277,364,750 *1B403D29C4606ED2848B8BF7CB4EB963CD54F8B3 b142466
277,364,751 *1B425D9812496392BCC3CE376B691E194FF99AA2 B143P
277,364,752 *1B4DB5B9D43F0A58139129B67D689459FB490C1E b144421
277,364,753 *1B4D14F17924FADA1CE519AD548DDA49A8FF819F b14569418
277,364,754 *1B48CCE240E259407E30853E33DB4CB1A2E599AA b146223
277,364,755 *1B4D5FB1059E465816B2AA8D14338C4674DB118A B14$7!N9$
277,364,756 *1B4AD40EEFE0E3ADA79E156474EFEE217BE54363 B14M3W0R7H!N3SS
277,364,757 *1B410728E46753A18BF0E2C4CE22EC90E01FCF46 b14nch3r3
277,364,758 *1B485F34EA40E00420E5F1224839D35FC0F6D7EE B14T2Bat
277,364,759 *1B4E00D64BE4C257F3CD06E86415B045EAE57A98 B+:15
277,364,760 *1B47DFF7838524E7DC0FF04864B9267726127579 B152I
277,364,761 *1B4BC559FB7A83664F2E8C4C9A692B84F0EF50FF B1!55fu1n355
277,364,762 *1B4EAEE01AFA74E1FAB1607CFA523865EC354F1C B?15P
277,364,763 *1B4A7A8B04EC452F6896FAD3D9ECE3AC9FB8B11C B15pk
277,364,764 *1B41605F18494E90932A6CCBF184BC0753ECC984 B:15r
277,364,765 *1B4D956074A680E259EB66E1124EC6B48BCD783F B+15T
277,364,766 *1B42A39B8A30A0A42271CFD9600C8264F8171977 b1.62
277,364,767 *1B4E076827333DD470BB85EFACC40FC74273425D b16741
277,364,768 *1B4639A5189F3E3D3FF9064F633D38D70556D7B4 b170713
277,364,769 *1B409BFDB8DC966157C4FCCF49C7B36EF0C088F6 b177erful
277,364,770 *1B4EC5CD3A932872ADAA236F37226A57D4F484BA B1)7S
277,364,771 *1B44B698CC1C2C1EDEC70D460FD177C8CE080767 B17Tb
277,364,772 *1B45E2228AA3DE47D4C8D17612108ADDC36B7872 B18+
277,364,773 *1B469B6012756C2951E70855BDB7D9A60DE39F78 B%185
277,364,774 *1B4B7F78B99434BD223E3DEBCCA7E9188D6C94DC B18Eo
277,364,775 *1B43979375AEA4E19725DA183700FE275EC5852B B19ht3d
277,364,776 *1B4F5CFF1AC6E8E250D05B01F10C9CB71588DA35 B&=1a
277,364,777 *1B4436255783E21B7E1BB7FCB91E4AA7A17923D5 B1;A1
277,364,778 *1B47CE81B171E5B21293C0B863BF356D7FC3539C b1—a2
277,364,779 *1B4FDA44274115A0BEDE452055C02035C5160101 B1)A6
277,364,780 *1B44CF12DD6B265C9794A94262242E323573D307 B1(a6
277,364,781 *1B4A4263615D5380331EAD621270970CAB7CD29D B1ack+0pp1n9
277,364,782 *1B476A8782533501C47F13756CBDDB94FC4BD547 B1AQp
277,364,783 *1B445470BD056B9EEDC7A268C67EB6C17A758D38 B1#Ar
277,364,784 *1B490117DF1E51DB16143B7DCECC0C4F4074AFCA B:/1B
277,364,785 *1B444955E7AF6962638D6BC9A54CE5F4E48E7547 B1>B
277,364,786 *1B4A33FA82E358939F2D069911C21F3A086A7F68 B1"B$
277,364,787 *1B4E8D23B66C2DFB7E04F81E175331E0E49C0313 B/%1b
277,364,788 *1B41F98981837C54E3D1BFA6FC28FB3DD7F262C9 B1b3k
277,364,789 *1B41113D5342918292EA2B1BF8C3A116930A5A61 B+1c;
277,364,790 *1B4E69F1B8B3ABEAD90EFD2E02ADAE3E7776A213 B1c),
277,364,791 *1B4CDFDDA4E059794D4071D784B7C713F7F7F7F2 B1cDH
277,364,792 *1B43D0FAC42E8B407578EB4D39925444A3A0DE72 B&1cf
277,364,793 *1B41ACCE3E27E13FE733FBE3368BD0EF89849122 B1cM3
277,364,794 *1B402CFA7F0B531F5222E34D43856A49C8974014 B1cpG
277,364,795 *1B4F1248ABB989E21F89BF47B398EB30BF5733EE B-1CS
277,364,796 *1B4CE66B2A829777105E5F0762345043034EE9C0 b1d0n3
277,364,797 *1B43A87714D3F00E6C04A529FD1E9B949FB06EBF b1ddulph
277,364,798 *1B426888CEF01DA4BF6BDF77DF2F7AD18E93935D b1df87cb-ae05-312b-b97b-71a40b4693ef
277,364,799 *1B43424EA254E546FCCA1EA6ED99664CD340B6A6 B.1DO
277,364,800 *1B4608455D87A55684289B7B55885E07B85D6BFB B1dtV
277,364,801 *1B4DDCF94CBBB550386358AE59D87FAF4704EB38 B1$dX
277,364,802 *1B4C462013FD8A5B5D92A7D33704171D904C73E9 B/;1E
277,364,803 *1B4B0907FC1B9BE662853BB7C32F3B6CFC7196B4 B?1=e
277,364,804 *1B4ECBF1AA4AD8DDB2EFE8024E07D27F5BBA240C B
277,364,805 *1B41D5E0B69AF552205A26B60E8AF7ADD062BA22 B1EL5
277,364,806 *1B499370BC6B5C36F958E8F47D8F115A3F48B5B7 B1eUX
277,364,807 *1B4F7107E6C728C4375CB64829678F782D56F75A b1ew1ts
277,364,808 *1B4B8EFF11E02F883040EE98DD2D16D3D55BA653 B1!-f
277,364,809 *1B431F8F99841D38F808DEB5E08AB7BB9084C5C4 B1f9A
277,364,810 *1B480A68DAA4C7E191C5269D340C49B41E2F3EF2 B1FB5
277,364,811 *1B4DD51AD3F3B0F9CB4CABF498E957CBBE07BCE4 B1f?h
277,364,812 *1B483EA8E58D679CE6DC7E6008E35A2813171F05 B1FvE
277,364,813 *1B488DDE39FCE1BC18B486DA00E60CEF133E5603 B+1G?
277,364,814 *1B41EAB3B97FDFACC2F973FD76D88B402275AB4A B1#"G
277,364,815 *1B441418A2240EC90DF821AC27B259C3F2B5EAEE B1gIV
277,364,816 *1B4C397A99B7D0FB4D77A0BF5E10DE1DEDC26270 B1GjC
277,364,817 *1B4C9371C9BF539711D6C602065A6B7BBB96F2DD [email protected]
277,364,818 *1B4370FBBCA7E740EDB5D161B95085A03352B92B B1h+W
277,364,819 *1B4FA0BB08302E63B604755133EDCAC82503226E B1+)i
277,364,820 *1B41A44E32BBD8445CA9EFE6740C67B3ED02FA14 B&1I7
277,364,821 *1B475EF1559F5D6BEFF6659F4CF3E01A45D495CB B1iGK
277,364,822 *1B4C11621D0DD41B43C0F333E124DF1969ABAE20 B1IGY
277,364,823 *1B4E0BC274BCCCE4168D70949F900803454E26C0 B1jgh
277,364,824 *1B4845B454AE0C2EA3E3E9762071A78346289D31 B1jlv
277,364,825 *1B4E69F1D5D1CC7BD337D92815D2AC26D63B04CF B_1jN
277,364,826 *1B4EF21F2C70D07869E094D08A90A90B35095D9E B1K4p
277,364,827 *1B439B16EA144BC1CCA8FF61979F0CF2A3F2A601 B1kFF
277,364,828 *1B4373111E40E730AB509EA6D9AF00E2A6F53814 B)1kg
277,364,829 *1B4EBFCAFBFC19C34817BAD33C1D5AE92B373AF3 B/1l5
277,364,830 *1B45B081F0EDA5B02E21A12723C9BD44AD44C56D B1L9P
277,364,831 *1B4562F174B1EA61A625C563889A5D7ED193A05B B1LBS
277,364,832 *1B43E6716AA04510521CB11907D1F0CB11182F1C B1lf/
277,364,833 *1B4C44AB6B51C897958ED29F79840A1F020A4E6E B1Lh?
277,364,834 *1B4282AB112C2E7B50DA02F62F74C0AC3660DC98 B1lsU
277,364,835 *1B4F9857F24C2A593A3A4E052D83AFF1910BF55A B1M9d
277,364,836 *1B4AA63E5085E0D0193BCE758164571860E91561 B1mgD
277,364,837 *1B414266983DE8284CB75BBAB91A60EE5D960EC5 B1MgE
277,364,838 *1B4A83002868FFD253925E863227B5529AE0A74B B1MHT
277,364,839 *1B44C44EDF40487C0F23D1A245060008DF19AF33 B1m_r
277,364,840 *1B43D51CC89BF1D5B60362A6D57465F67710FD5F B1MS3
277,364,841 *1B456FFB53F28A70C2C547C7492C77EDA610C1B9 B1MUo
277,364,842 *1B4AE6E0FFE2BBBBEA379C0348C96C428A4EFF83 B1)MZ
277,364,843 *1B40664893DC3604254A72CE0F8F7416B2A20D7D B"1N$
277,364,844 *1B45A8E91C374B817504A69AB134E7FE7BFAADA9 B#1n%
277,364,845 *1B43AD932E756E1A3E72F8CC336EFCAA9554B405 B1N&B
277,364,846 *1B4A6ADC3EB7B7886689A82694DC66B54657EACF B1nW8
277,364,847 *1B4A8D610749EC28093AE8EB8D759432C50779E1 B1O8R
277,364,848 *1B403010C24239260565274B414874065FD03A02 $b1occate
277,364,849 *1B4055F219FBB6F040190CE0E500CC77D6168A95 B1ocl1m4tolog1e5
277,364,850 *1B4354D944241922F86A49C3FAE45F3034708ABF b1ogas
277,364,851 *1B47DE9932057F5DDFFD215E533E930131291346 B1O=H
277,364,852 *1B447DFA9D7F7EE170B861F9A595617B9D6448D7 B1o$$om1ng
277,364,853 *1B4978200935728541AE6513BFC6C72EBA293090 B1ow+ub3s
277,364,854 *1B4CD61DCA073DC9AD501CDE00EEA2DA1C538A00 B1p6.
277,364,855 *1B4E120504B5B96AEDE3A799E7F18DD941DA5955 B1Pm3
277,364,856 *1B4BC5074CFBC1077DA69A32345D25AF59A61FAE B1#Pp
277,364,857 *1B4A916DAACDEA1CA287104BFC1A34732C1FAB4B B1$pR
277,364,858 *1B49A696E6AC1B428EA3FCD9B00D7D387E0A5843 B1?:q
277,364,859 *1B4139098ECC8FE093D857426550943FA6B9DDA8 B!1qk
277,364,860 *1B45B9B7B055E7AEAB1866F97A2E0CB078CE9E1A B1qNi
277,364,861 *1B49AB7DF8FBE078AACE36EE3E1621B844ACB466 B,1Qu
277,364,862 *1B4BBCB18A9CC839450BEF50FEB1F11A96D72C32 B1R)c
277,364,863 *1B42F3B26A1FE5DC47746FE941FCFAEAEB559674 B1Re9
277,364,864 *1B4C0825CE479E340017F38DC714FC811FE6AA77 b1rr41
277,364,865 *1B4ABDDE63B1420F50692C190D71E509246DEEFB B1rt:
277,364,866 *1B4BBDBDB00DBC77EDA98A3F72AEDE2827DDE816 B#1sD
277,364,867 *1B40E8910CC269BC883F38B19A4AD4B8A2F18D55 B.1sQ
277,364,868 *1B43167D879A2848089552DF6303789ECF8554C3 B1sQ%
277,364,869 *1B42C10BBC2726005CE28135E3CFEC0CA5D13014 B1sXk
277,364,870 *1B4D6E378F59AE70C64D6C44AC19A2717A40A59F B%1,t
277,364,871 *1B4835BC88A17561F3B9BA215A231D7B1F4692FF B1,t;
277,364,872 *1B4C5345F1F807D2AB1C48A11FAEA97AC959C3B9 B1t?_
277,364,873 *1B43349F1E2C75213D0E0A30A06341382BF1286B B
277,364,874 *1B4AADFF2D4213F761C0620A23E00CFE2B9EB424 B1+Tg
277,364,875 *1B43DDA5D4D0AB1BA7F08815071DAEEB85C74983 B1;TT
277,364,876 *1B48C67B1E45315A1F015B842EC1EAD562EC2F57 B1U-h
277,364,877 *1B41508A03B98C090413E0155C256DE4F311D189 B1Ul/
277,364,878 *1B47E529B1481299F2F8E7FAB2B7614C62A53F59 B_1uL
277,364,879 *1B4511F31D5FE5FC4451762032E6408D71D32F6A B!1uN
277,364,880 *1B47D51349183154902CFE8E4BDA2BC438D273E0 B1U+q
277,364,881 *1B409903E444F7228221E296DFE3298D6E21962D B1:Uu
277,364,882 *1B418745220AA427E54A747BC0797A8864D7E956 B1,UX
277,364,883 *1B4F3FD48514BEE5584FCCFCE300BB38EEA18851 B1UZb
277,364,884 *1B47F0842294F2145FCB2FAD89EDA069F1818DA0 B/1V-
277,364,885 *1B4714F9529D6F398D772CE376217618CC6C4ED8 B1V-0
277,364,886 *1B4CD497B43024E1F9C106EE833D82248BCF2735 B1v4l3nc13$
277,364,887 *1B49ED9B30F7379BE51571A7D72A1F44F3361CD2 B1v6p
277,364,888 *1B45C2BF09228C15342D466C4EE7B92902A02447 B&1VE
277,364,889 *1B4E4785FACB55E86F04FA5F92DDAC3CE033BF4E B1vG;
277,364,890 *1B47DF11B141DE19676B4C3F4EE1CFDBA4AFF84C B=1VQ
277,364,891 *1B4B80A34FD13F9DA31A3F368AF1263D08325708 B!1.W
277,364,892 *1B4429605097340AFB5C20BC7786F76C6325A8F8 B!1W$
277,364,893 *1B4D3082997DBF15EDFEB82197430E12AE71306C B1$W(
277,364,894 *1B410DCE9F0D70048A66948A29B3505716228303 B1W!)
277,364,895 *1B449CF7A2BF3810A5558F66D253BBE553019783 B1WAu
277,364,896 *1B4711888F22BD87BEFA7E16F345EA83A1B26A83 B)1Wm
277,364,897 *1B43F578CA4A22004422A7BBDD292879DF2AAD56 B1wVg
277,364,898 *1B4A8C6F94119047A71BCD7963954E6F3C6276FE B.1Xm
277,364,899 *1B4ABBA4DB1D2DADB8F61F0930AC9D67E4E131E1 B1#Y)
277,364,900 *1B4588BCAC90E599390E0632FECAF43899D672E9 B1Y6L
277,364,901 *1B4F698FD44F59C5E957BBB78DED46860F94D7B0 B1Y7F
277,364,902 *1B41882BA14F8FBA514FD89AC89C1C9DF547514F B1Ykf
277,364,903 *1B410972EDDC7410DBCEF9A1C301B41DE127F1FB B1Yvj
277,364,904 *1B41E44D38A56ABF54D44D6BD6B3D71EFB74142E B+1"Z
277,364,905 *1B4E5F9868949DAC0114CD14E42B2ACDA76FD4AB B1_#Z
277,364,906 *1B4845A0D97D8B701FCBDE3C14A59C991E8A52CA B1Z0Y
277,364,907 *1B443562C1619FD269E8A7BCDC2C71FFB7EC5437 B!1Zm
277,364,908 *1B4A7E8F2FE0440FAAA03EE5D6512934AC826A45 [email protected]
277,364,909 *1B4ED8BECD48CB3019CD3AD132BB26F91E15DF6E B;/2=
277,364,910 *1B45AD3BA747A132F18FC376483480F299AF8844 B).2
277,364,911 *1B4389A3D0F7AC104F4A8D1C1646A6DB035A515C B&?/2
277,364,912 *1B4D19A437A7C15250C540739F9378137C68638C B#?!2
277,364,913 *1B44481A26C2BC1C03DF6BB8361A63A0C45977D9 B2(:/
277,364,914 *1B4DED8BAF47EB377B874FEA762E6C1AD9C30AD0 B2&$_
277,364,915 *1B4C5456033FE8C1B1728FCBCA661E67D70B6A6C B2%:)
277,364,916 *1B49ABA997924CA0002161C5E018D2AB06DD8E8A B%201
277,364,917 *1B45A5E250CC467AFC57D885BA0D9D9291B76C97 B202A
277,364,918 *1B498D9FD2DC08257E160703AB69ABE25C4A535E b204577
277,364,919 *1B45D86EC0D32E737D58E7FA908242ED577D8E6F B206t
277,364,920 *1B47FECC1FF99B7539974524FC3E68EAEB66CD0E B20LC
277,364,921 *1B42021EEBF5A018BD415C338D87BC21D630465A b210805
277,364,922 *1B45291D17540364EA9E580B84DEF8A449E4A552 b21c5ed509e1
277,364,923 *1B486EDBD218CA125AD2D495A9D8AF43C0B4D77E b21goto
277,364,924 *1B4C20DF75BCC80CA82DD81BB703DC071342F0F4 B2;1i
277,364,925 *1B4A731B50DE21E71BF00670A64EE96F837B93CB B21Wo
277,364,926 *1B42C01E160365353B68ECE8FF77F87E7B10EA54 B2!=2
277,364,927 *1B419C903499F5FC8E98A9889BF2D6A6096C5C5F b22039de61e9
277,364,928 *1B4ACE58E65DCDE80551E38D9A2D00B5816A66C9 b22510023
277,364,929 *1B4FE1DA7F028F2C30253D2746DCCE57987B1D37 B22h/
277,364,930 *1B4EF1CFECE5CA31A390037336F76A71F249D0BD B233U
277,364,931 *1B47C6DE0CC1ADF3CDF1FA87A96C7655660298C3 b23827487
277,364,932 *1B465DBC39FD31BAE30DACDDF952617BD99FB445 B23Kt
277,364,933 *1B429427B707DA85CA87F40897DBAEB9E4CA9F3B B23OI
277,364,934 *1B4D29A3FFB7F0AC1CF1127FD0205CF9E84C685A B23Q"
277,364,935 *1B4A4AC9DAA2404EEBBEB9320BCB57397C6DEE2E B:24(
277,364,936 *1B44DC0D96C3DD840459043B41A2D720B7E3B108 B243
277,364,937 *1B41CBDF01E69071443DA01F05DC7D7AF888F83A B:24f
277,364,938 *1B45EE38680DBB17B728256C3C8C93B8337C7E7B B24)M
277,364,939 *1B447BFE59EADB427025F5717AB4DC00F6C589C3 B24#M
277,364,940 *1B4D1E3E35B5484C99948673837B6B5F7C193AF9 B24Mt
277,364,941 *1B47E01866970E08DBBAEFB9F75CB03B187B574F B24O;
277,364,942 *1B4A0E39A77917398091776F4FF9D8A36FA41F54 B(2&5
277,364,943 *1B407758DF792CBDD534DF3F96474120F120B2A8 b253f8b12f1b78adca256e51008337f6
277,364,944 *1B46C4D118AF3110C343B87C8562C7F5BA83F54F B2
277,364,945 *1B41576913106D295EECAA97AFD3CCE96440F62B B2%5u
277,364,946 *1B462FA0ECE9EA0B9F01D7C9FDF0D2585E6016C6 B26e8
277,364,947 *1B4CECC741138A20A5BAA4F3870CF1F3179208D6 B2.6P
277,364,948 *1B45CD4FB3230A93C5BB9B24E11CC81A77608B92 b2737656
277,364,949 *1B49BA63D41391D37C2C704D5016B892567CF325 B27X1
277,364,950 *1B443C4C214C303D1AD5EA06B1BAC707F0442F0F B2;8_
277,364,951 *1B42AD80232CF59D723C7B9C09468B30017F5B33 b28588915
277,364,952 *1B4FCB02F923B6FD43259726B3117A3F31872AC4 B28/6
277,364,953 *1B434B697D8519C590948A7599E8FDF4E51BE5B2 B2)8l
277,364,954 *1B4B34B4A0AF8F9B371E83C5BD2B1ECCB61C84CD B=29:
277,364,955 *1B41788C9B436DE135D7D7B62542282276A1372C B2"?9
277,364,956 *1B46606574C5FCB1925EE7B8E642A7979FCA267A B29?/
277,364,957 *1B43353796A1377BFEF368C8AC80F1B2AAE3256B B29o4
277,364,958 *1B4365FE6D1DB0BCEB6890C679C047AFA62B89BD B29"w
277,364,959 *1B487033A35AE1E0FE9D7D538CDDC63AFEE6483A B29Zb
277,364,960 *1B46C7EF7B0DD77A8327A6AD0B1DFB1663111BE8 B_$2A
277,364,961 *1B4735EFA230B973154811DF4715F012EB237AB1 B)2A)
277,364,962 *1B44665FD05183BC0CAB515D7394C9F32BA84762 B,/2a
277,364,963 *1B4C1B4136965BA8CD2EBCA71AFA8EC7EF66BCC0 B2+aQ
277,364,964 *1B4DABF5DF60A8FC508AE5DC80AB32A73EB18CD8 B2#AS
277,364,965 *1B490B578A20B66DF026FD898BED5267ED2364EC B2?$B
277,364,966 *1B4FABD18010FB42ACC2C276D92C6451C85D1088 b2bc31b7078a964855d2d5c76215582d
277,364,967 *1B452E1BF8BA5FC1D2CB560CB711FC4A46C16E44 B2=bF
277,364,968 *1B44EE641A85B09DF052A481E5B2B1A6952CADB4 B2bg0
277,364,969 *1B477DC7734AC4F0047D7AA3DB142E250FA23FBA B"%2c
277,364,970 *1B4F55B89A20D9B6ECBC403DB640C3B9362FC39B B2c"$
277,364,971 *1B43420C421382F0256424665BDF3B19307CBEDC B2crP
277,364,972 *1B41D93FADB59C11BA04C8987DBA80F6C080C2BA B2d9L
277,364,973 *1B44163CBBA009DADE03FAB4C93636080B19BDDA B.2DG
277,364,974 *1B4BCA749E9A2893E775D9918C831968AC71ABB1 B2DG%
277,364,975 *1B4EE595C2A9FAA61389252DA8CE9A0875F346BB B2"dg
277,364,976 *1B41BD0E31AEBA2F8DAF45D4DDDDE1CB2C125370 B2dor
277,364,977 *1B4E83AD2F5FBA623841476CAD7BC7695541B3AD B2Dq4
277,364,978 *1B4FC6D94F63303C857D57FB584AA45732096323 B:2#E
277,364,979 *1B4BA53DDCF68C02B45F042A49F04055F7CC6BDD b2e9daa3-3e7b-3152-bc00-0707ed18741b
277,364,980 *1B4A4F745ED34BFDD67CD25921919B53912C7C25 B2ENI
277,364,981 *1B4767E8CBF215E27CD3E0463CFEABBD33613B87 B&2eQ
277,364,982 *1B49ED8246A1CCA77702337322573ABC0992D444 B:+2F
277,364,983 *1B450B8AE7D43A24A24E2BA01C3B60CAEB1BE91A B+2
277,364,984 *1B4D1BDCFC9566A412B4DE8DF0A6A8E119D80FEA B2G82
277,364,985 *1B4D95183BD392B0B4B67C8D0FD24854884FCA66 B2grb
277,364,986 *1B4A3B38F73A93119C88814EAEBFC35B8E60AB95 B2gw
277,364,987 *1B4FFCD4A2B4D335CA303DF4C6CA3B45032B367D B&2H!
277,364,988 *1B4A9D33D14C916F2322E40D0203674B587F5188 B2""h
277,364,989 *1B442D6EFB9700B3B311F8AE50219609EF14E552 B(2H1
277,364,990 *1B45E074720D5AFDA1FC3DA838D1283A98B4C5ED B2HdM
277,364,991 *1B474EB6ECFEC88C93504C69BD6D3035E37603B1 B$2HO
277,364,992 *1B4E289F41280D2726F20CA3B41A0A1DD9C4F228 B#.2I
277,364,993 *1B46E3FADB01B0D69471F6A16843CB06BAF29172 B2.iB
277,364,994 *1B46C5E45307AF2CC5535787130C1EA5E317C1EE B2,Id
277,364,995 *1B45FE1E00CC053D14ED4512EF75DA93488ADFF6 B2i=d
277,364,996 *1B4138DF246A1785DDF9EF2B3623082B27BBA897 B2jSL
277,364,997 *1B4DF58B48CA21A643FA62815042B920AF5012AF B;2K:
277,364,998 *1B42CA9930D4152D9DCAED71662E52F21AC45D26 B2,K2
277,364,999 *1B4C64A1B120CF6514CF883DA17BD812BD8A5E64 B2KB&
277,365,000 *1B4244A8A7650EFF40F8EFB06FA88F938DF0845C B=2kc
277,365,001 *1B418BD9DDE1A1E8564572E4008B409DB0EE5BBC B2Ls=
277,365,002 *1B4F29782184CD341A076F79CD90D3B180C95017 B2_M2
277,365,003 *1B4B4F08AFC36D7D0E43DEB3F68089A0C8AD574A B2m7O
277,365,004 *1B427EA807F42D79487E41AB8ADC7A373BEF7398 B2/mA
277,365,005 *1B4B1B65FD08A6B9A88A60639B6C08DF272AB972 B2maY
277,365,006 *1B44E597A3CB4CD56AF96AA7EE0800597E02C3F7 B2;MD
277,365,007 *1B4AFA677F373E4BEFF8B365E65B5EC81CB6B09C B!2Mk
277,365,008 *1B4AFFFE942FB13A901C2FF271A101F37C5C8C34 B2m
277,365,009 *1B4C9BA5F2E9CAF11C0622A5ECE9A6F1D33F38E1 B2M"N
277,365,010 *1B458D1C997596AF6BFCF1DA89670F3AB284FDDD B2m;Q
277,365,011 *1B48B4E4A5F871177AA4BBE216D0EEB5FD70730A B2MQv
277,365,012 *1B45F6FBC5527390861AC28C8D5755829ACC55A7 B#2-n
277,365,013 *1B4B51328421F60C340880F18AE121EE48A791FF B2n0;
277,365,014 *1B4B1FAE5A9D9CA26DF4F9E345BEA4B200C0FAF0 B2N$1
277,365,015 *1B45EA208E6FD5BB7BE18D3FE6C48A38F1CD08EB B2N60
277,365,016 *1B4132543D6C06F24931481021BD5358FFDEF430 B(2NA
277,365,017 *1B433314B6F39285444A804B92A258C20DF5E05F B/2Nd
277,365,018 *1B4BA05631F2812E9FC738794DF3C1D154F11D2D B2)Nf
277,365,019 *1B411A74112E71309CFCCD3A38A2F450E1A38D8D B2n%F
277,365,020 *1B46F7FA9B2F3B78F736D5F87A63E0E4C26E82BF B2nfD
277,365,021 *1B40F0DB229A23D3E87C9312F5BCBABD40AC5EAA B2nke
277,365,022 *1B4DF9982902B4E01457481D832C439FB33F4F31 B2Nr
277,365,023 *1B43B3D94B6E6DB93ED61EC456AB625BFB76751B B%2ns
277,365,024 *1B4D544486812F4FA7BE43F727C01DF23B160126 B)2Nw
277,365,025 *1B4A92462EA0AECBA9FDB6C971CB5B96BEACC4B5 B2oa"
277,365,026 *1B4D717C93C1C589BEE2B0B2F2B659D5B8149499 B-2?p
277,365,027 *1B4B6B89F1ADCECD8EA70141B2EAE12D4CC68761 B?2P2
277,365,028 *1B455DAB0F5D79C93A7FA00366D60BF0C3925548 B2pA!
277,365,029 *1B486762AC3B882ACCCDB1E384BD752C5F896A1B B?2Pi
277,365,030 *1B44C76F90756B343B7D45D2A3B74ED4F103BE18 B2PP?
277,365,031 *1B48DE36CFFA5C9A168EFF6FCD1EEA9C5016A9A0 B2p)S
277,365,032 *1B44B2B6A4EB46795F46D354E10DFA0FFD0AB528 B_2%Q
277,365,033 *1B48ADEFA4A5F96D12BD5B2F2224C334B3DB1666 B+2.Q
277,365,034 *1B444BAA68EC1AA4F399C4362C51B128E4D33E2C B2QKV
277,365,035 *1B444D890DDED2F8699754140EE4624F58B5A1BC B2qVt
277,365,036 *1B46936FA22D37EAD1691C81D15D7A41392CE30E B2#)r
277,365,037 *1B41AB981578AE78A393480DD5E8BD0B8FB3210B B2R#g
277,365,038 *1B4EABB0DE3AC5E28E3C86635CA9C079C65B4248 B2Rkm
277,365,039 *1B4B81B25C05F7BA1139B1DDE17FA0D9DC426C15 B2RZV
277,365,040 *1B444733D41F5FA3C0348ED4176E4411D578CD40 B&;2s
277,365,041 *1B47224F8845E372909449442EAB1D49F956F463 B2)s_
277,365,042 *1B4FF938EA6847344906ABAB46F15C640B4B92A4 B2s,7
277,365,043 *1B476413E4805D56544AA0A9979A9053CDF80C0D B2sbS
277,365,044 *1B411D252E7AD3A07B6FC66A78119C27A38CCC6E B2sK
277,365,045 *1B4CAA8176B335B4C34F8FDCD7ED424FA10E84BC B2sT0
277,365,046 *1B4AA3A606EF85A70BEDDCD985ADAE7994B536D2 B2suD
277,365,047 *1B48D8DC85B84E2696FBE1B9EFE6BD443A358B64 B2sUY
277,365,048 *1B4BD6E4B43056E8687EE7CBF4588FD48FC571FB B2T_"
277,365,049 *1B40FE6D6DEE5A1FFF74268117BDA0A19352C801 B2T_+
277,365,050 *1B426975C74B4F8D989CB81C97520894881A36B2 B2&t
277,365,051 *1B454F126CBCB14E7ECB252D6079785F4B39D868 B2T#g
277,365,052 *1B492D5EE9F5BB18B432962980E12CE17B5A6F54 B2Tip
277,365,053 *1B478C86A646A9517FD49BDBBCE649DA134F1208 B2T%L
277,365,054 *1B414608758FBCE3036AC78C38AF3F24C1A51EB5 B2:U+
277,365,055 *1B4BCC638A392892E928B18FF77C5383F6AD2B29 B.2u-
277,365,056 *1B4D47F794589051F41D4C622C80FD872967E34C B&2#u
277,365,057 *1B4A56598884D052FD36B1F127D3153F93AA5E76 B2)U4
277,365,058 *1B464CD7FC51480FC755A2942F29E12EF0971330 B2#Um
277,365,059 *1B4472AF545EB54E65A723AD0A50F291F666CFCF B2UtP
277,365,060 *1B41E4711AF353A3FA681DCBD665F753B80C17C2 B2v2d
277,365,061 *1B41FFE7EC8CD3E652DA578954A7AF2E928DD164 B&2vn
277,365,062 *1B40401E11F11998D0B61D6A0408CF214AE311BD B2VT0
277,365,063 *1B4DF05C72EFB1A3A11459B95771D6EFA9A05106 B2:vX
277,365,064 *1B4195FD68754EFFA430F6F9DFF971A7017D3586 B#"2W
277,365,065 *1B40D4355FA61E03EC931DB7E74C90FADA86929E B2,w1
277,365,066 *1B4422F7EA2FAC9E86C41A45C4183655D69DB3BE B2w7I
277,365,067 *1B41948716CFB73B813E0913B21430E14AAF1461 B2WEV
277,365,068 *1B40A9DC8BF1331DCB6215CE4387CD3FD20203C1 B2WGf
277,365,069 *1B44F7D05881FF1446A4C26EC05278F94FF8410E B2wPV
277,365,070 *1B4E0FC9BDBAE7BEA20BD6DE396E16C650F2F18F B/2WV
277,365,071 *1B41794C7E190B7F3CDBDA4E9413663B7C08B595 B2X9;
277,365,072 *1B4674935B99151C3B850AE055A5546D319A2252 B2XZc
277,365,073 *1B41B3C0359FD6FA5723A28975406F3346E2434B [email protected]
277,365,074 *1B42E5588EF4FA3E54DDEC615E244F759FDE814A B2Yhh
277,365,075 *1B434197337C884B106BBDCF3DD3DA76B3176E54 B2,YK
277,365,076 *1B40762E3FB833A1FA156095A8B6F6128C864F6B B2&YO
277,365,077 *1B47518E3024777855D554DF4D22027542D741ED B-2Yt
277,365,078 *1B4F6C78691BCDD8144EE5D741C7FF7643ECB47A B2YW1
277,365,079 *1B480A30431E4C16E97C9A72890455531D4FCB63 B))2Z
277,365,080 *1B457B6FD1DD0621B9542C24FD1739D091E0EE95 B
277,365,081 *1B49E0D3D2C066B2AB9D64406B0D827BA89859A6 B2!Zl
277,365,082 *1B45D53D20E3B16F40C2B1E5E586536F23EA5F7C B,3=,
277,365,083 *1B4AE6DBF3D00B87BF7F1DCC7569D6582F949277 B"#"3
277,365,084 *1B433ABD729A8FC7DD213C45600F5DB25BD1BC5A B&,3_
277,365,085 *1B4860731A04E1210F33F42B6E69873941DDF0A8 B&%3
277,365,086 *1B431B5BF2493499107B71240AD853211792CF3B B3)=(
277,365,087 *1B4DA72C984D846C1276086AE1E9D35CD2FFE504 B3&/+
277,365,088 *1B4C6A4DC8B2AF93A453A7AD8A15993F1DE9004F B3+--
277,365,089 *1B478DEB4405362A66EEC0A9B53473CB6FA7DADA B3
277,365,090 *1B419466367CF9560411013A74F802CDE946EFE6 B3
277,365,091 *1B44FCE9E6CC7DD3D8FA2AEAAC8CEED39F77A2C5 B;,30
277,365,092 *1B4678E4FF496F1CB8815C68CE630DD6F802978C B&)30
277,365,093 *1B4996090FAF915015115ABD41875BDD3F3CFB67 B30rw
277,365,094 *1B4806D2B8C78BEB8A797ACFF0B8BF980653450E B30s:
277,365,095 *1B4D3C74331A50C13C54616294059829687EC651 b31145412
277,365,096 *1B46913CDB21B90FA791D33EEBDC8A3DFE139CE6 b319fbf7
277,365,097 *1B407353D4F973753C1F9D982175DE7A41DC8D1F B31$I
277,365,098 *1B4CE363A147719E594573AB57AA5F28BECF5C6B B325507TQ1E
277,365,099 *1B4016F8F368B24D8B9C80FC04CD992B8E7DD69A B;329
277,365,100 *1B4921C81755969D3A0A7062D2B7B5187C566E2E B3?2B
277,365,101 *1B4BA0322398131278B5FABD44F9CD82BB61DF93 B32Tf
277,365,102 *1B4841E75C30E434DD3A08537EB26C73C69CFE31 B32Y6
277,365,103 *1B493A79CBAA3757F28364965CF4E4D809BFD9CA b33rk3g
277,365,104 *1B43B8F70E6E0468E2D6E7D0BA65401D77B35F61 B;33S
277,365,105 *1B419AD063E18855966A4EC8879A80B61521D095 B33s0
277,365,106 *1B426F63349E09731755ACA728ADB3B46C1E5FA2 b34m 4nch
277,365,107 *1B427E9F36667EFAAA3E8AFA7C0733AFADAF4C7D b34v3rf41
277,365,108 *1B41FC6C2AFA32D7F917FC19E36A1971F4144E88 [email protected]
277,365,109 *1B454B764FDD73823AFE5D4E7A9CD6254B910CD2 b351411z3d
277,365,110 *1B4FC6FFC48AD715C9B6911405FDFD74A939EE47 [email protected]!35
277,365,111 *1B41C252DFEEF297DD36207899198587C104082D b3603
277,365,112 *1B453361B4E39409B7F1D5C458492ECC93588855 b366ca23fb
277,365,113 *1B4F883FD068B3FF5E1684A6C7E26A3814377920 B3$6N
277,365,114 *1B4DB734048102BA1A92DF2037BA1AC885CE4316 B3:71
277,365,115 *1B4D81CE3276E93DCD0ED63B46D366155D15912C b37993
277,365,116 *1B4EAB28751307678209DB7950EFAF7E375DC865 B37e7
277,365,117 *1B474D093629406A1C4E86F90F297CBD95C69463 b37r07h41
277,365,118 *1B4318F72C27D429E238C4C31E439DAEAB32C60B B37W2
277,365,119 *1B44CD291755A72AB25CEF34D795FB0B00EABA3B B3:8d
277,365,120 *1B4B0408F844FF6629A9A78859EC9578449D17D8 B!38g
277,365,121 *1B4AA1087D0F0ECAA069F45E8089609E2EB33DDA B38j2
277,365,122 *1B498291DEFA9326EC60A739F652AA050251071E B38X-
277,365,123 *1B442AE59009D08DD26553B4B8C4842A72588523 B"3/9
277,365,124 *1B45772A9CB7B0BF9ED83D8506A6BA60908628A1 B(39F
277,365,125 *1B4BD7F31B8158B6357D9ACEEB07DC6B2337198B B39gH
277,365,126 *1B49B0B5B7105B33E8A7D8DB6882788948A09A83 B3*aaa
277,365,127 *1B4200CAF8BCDF82D6A77EC4C053A5BDE88AC5F7 B3)ah
277,365,128 *1B4B3A596E6B576B20FD18B50BD8B223892315B4 b3a+n1ks
277,365,129 *1B46C6B55BC4958A7DF4F839E6334C43EA14EAE0 B3A_X
277,365,130 *1B434E3235ECCFA51F424D22368F9BE6631B2010 b3b1n0u
277,365,131 *1B4ECA7C97ED9A3DACCAF2E04BB321FB6CE7F92A ?b3baa
277,365,132 *1B477553378C132FE7A5CBA9195C18D36827E620 B3Bfl
277,365,133 *1B4EDDA6F1B1AFEAA54400A5A4E4F687BE6F26DD B+3Bk
277,365,134 *1B4C18C9F3E3BD4ACE09CB65A148B791E7E5A0E2 B3bnn
277,365,135 *1B4232C783FC050D0A82C6A3E70ED8F0C688BB6D B3BnX
277,365,136 *1B4FDA0ACA6CC496C4458C6A127C710335912D9E B%3Bo
277,365,137 *1B495A2D2266B75935495E7E457AB61E6DFC0366 B_3C/
277,365,138 *1B46857055108ADF6A2311FE34FDBC118C9A7723 B3C%%
277,365,139 *1B456CD21DB0D399A9F0339EB7C4C2CA2C2B0C40 B3C"7
277,365,140 *1B4CCCBAC91C5394D185ADF19ACBCC70CDC30AB0 B3cjR
277,365,141 *1B44CCEABD3EDF19B3415FE11327173AA55E549A B_"3d
277,365,142 *1B40EB8CA1D73A0583CD9F049FB4475A23013A05 B3dO,
277,365,143 *1B48AC271F95BD94BF3F94A3EEA7C5B803EEF621 b3dour3
277,365,144 *1B4D270354FA435D3C5D6F32DDD75E08DB9CDF33 B$3E
277,365,145 *1B44CDC133160DA430EE4F4C6323DC1388B276B9 B
277,365,146 *1B4CEAFCB9FE9CC6F4E8D554F702B36A848F50CC B3E,(
277,365,147 *1B49B3E39D6ACFB605FFCED4472601BC563E5326 B3_e-
277,365,148 *1B48E8799ADF55EF0E33B60F608408C485E750C6 B3!E6
277,365,149 *1B4D655E26C8229487DD30C2998684CF3987033D B3EI,
277,365,150 *1B4F6EEFAF7B86356BEFB8C0C678C6399477AC42 B3elp
277,365,151 *1B41103A28CBB6B792D15A0E8C225C8898FAB5BB B3eSq
277,365,152 *1B4D4FC79300855F0C3771A199271658213B8840 B,3?f
277,365,153 *1B4A18314529167740C54A2F30C8D4B037003C26 B3;=G
277,365,154 *1B41CB3123D567AF4E4084EA668316715159F90F B#3g4
277,365,155 *1B42D0A66E18A3212477212A7BCE1B4201A37070 B3gAX
277,365,156 *1B4B738F0A0BB1360B5860039EBA8DAFCD13B4F8 B3GhM
277,365,157 *1B46C213F380E35344F8B4F521E861896B2DD7E9 B-3gM
277,365,158 *1B4ACD1B8D4166FBA56FDED5086E7CBCCBD95593 B3gN9
277,365,159 *1B4A8E789D6000A82EA75FA5B53AC65D02DEE4D1 B&3go
277,365,160 *1B49D5FEB1FE3D0C08298CE0E4FE0FED0062ECCE b3gp4n1
277,365,161 *1B47DC481FFB1041F7B76D6338A749CFC7765234 B3/Gq
277,365,162 *1B49C83CF752D50B7F94CBCAA5FE891152D4ACAD B3H6N3
277,365,163 *1B47F8CC24861AD2F3617003EAE66B4B4ECE8387 B3Hca
277,365,164 *1B4CDEF1A6118AAADEF7D0E034AC420406CBC81B B3//I
277,365,165 *1B4A059EC22E44827D51BA7497CBC342D900645A B3i,k
277,365,166 *1B449AF70A928A880BF32E5CE967D1E26BCE20C2 B3=j_
277,365,167 *1B48D3E78339174D238A9FE6C2F56765C2D91623 B3j9a
277,365,168 *1B4E16260AC685AFBF689E10E415A5FA5000594D B3jA"
277,365,169 *1B40DFEF40C190579A04D0FB9A1B9235007C3AA8 B;3jq
277,365,170 *1B4803AA0EDD6D1072A4BAB115E36DA32EE6238B B
277,365,171 *1B4A21B3CB7837921148DF0FD35EB5128EEBC3CE B3KH
277,365,172 *1B4BB22761713FC42C11999AF2E09F69C3FFF347 B3ks,
277,365,173 *1B41E4DC675D8AA8198FC656D67A63C83CDD0C88 B3=L,
277,365,174 *1B45936393C52241ACD0F75443A5AEFAC36CF8C3 B3?"L
277,365,175 *1B4FA183AAC1D03E53E35319BA2A3266065240B7 B3l-)
277,365,176 *1B4BDD8B3EA984FDC45541BD5B5E46B30530D02C B-3L8
277,365,177 *1B48EFE37B6429E6E7A97E533494981A545A406D B3:lc
277,365,178 *1B48440123940D629E2DD78A2357D6ECC0319B60 B3#lF
277,365,179 *1B47D2D7AE32EC19DD9430293FCC6ED1FE1005E7 B3l-K
277,365,180 *1B4C180B46AB7C083B676D48C9E0346A64129272 B3LLB3LL
277,365,181 *1B4014F9C206A80F5B1F9237ECD146A2A99B3261 B3llw3th3
277,365,182 *1B403D67C56AA7EB01FA37FE2C3829F5EF267AFD B3ltl1n35
277,365,183 *1B4EDDE6D46AA25B111BA5CB996C45B966A21D80 B3:&M
277,365,184 *1B48B6B4EB36ED33C470BFE8516420C760BDF794 B:3(m
277,365,185 *1B431591AED52A1096E2C31A43969C0446C3AC95 B3;Mh
277,365,186 *1B44771052D06B3F74EDF0911EBCD0B034351716 B3mNS
277,365,187 *1B440CFB6C7A0CBC48621B14B8CF7578213A2ED3 B3"MT
277,365,188 *1B451DBCDD3987D938968F81D00F923E59B90F5C B3mtC
277,365,189 *1B4E1CAF6555D13F82807891F17E82D04218EAD1 B3n1(
277,365,190 *1B4D4499A7DDB2BC4F5B215A8034450124C9F2E5 b3n3dic+us
277,365,191 *1B416AE69A1C80D5F3F4819EC6BFE2ECDF0F6A59 B3Ne_
277,365,192 *1B4352348094E68090855083ACEEC2D7DC977264 B3nev
277,365,193 *1B41066154E14CC8389C846122907BA5C9FD01D0 B3N!GH+3DN3$$
277,365,194 *1B4E2612A7A776C628A75BFE0756EEFCD490231C b3nicol3t
277,365,195 *1B4ACA34E5B6380DE7BB2E2DE775632BF790DC96 b3nz0gly0x4l1n3
277,365,196 *1B4246DFE865F76B951C48F8C84DE82C3B40C903 B3NZ7
277,365,197 *1B4F9EA571469EDE3417A9FB01CE7F52C0483972 B&3o9
277,365,198 *1B4F248DCAECA324263FC470B652AC3D32E7BD46 B3os6
277,365,199 *1B44BB28B03D696E11D15E9313805E35189EDCAA B3PaX
277,365,200 *1B46D5C71F3353AF035BD60287A1EABCF6F7E18A B3PBa
277,365,201 *1B4E823A5BE5D71D6F0E872F84DB65417598D644 B3=pN
277,365,202 *1B400B31B63047D029BEED87EAC4439455126794 b3$pr3ad!n9
277,365,203 *1B478A94985EB8ADCA31664C1B3ADD53B614364E B3PTA
277,365,204 *1B42E8B5557D95BBC39B55D420B961FB77CE1C6B B3ptv
277,365,205 *1B4884568D6A0D4B2E9CD71CF2F5C1C534FF31AF B3PV8
277,365,206 *1B40810C7418A42982B882353BF4FA68C1D61E5E B;!3q
277,365,207 *1B42B3B9A774F52C1353A05B909191753A45E1D5 B3"Q2
277,365,208 *1B4AFD1D2BE74E707915162C9024647B7CD18798 B#3Qf
277,365,209 *1B4480CC33B3B6504CDD0202D8B3F033E79C5DB9 B3qfk
277,365,210 *1B4A43C7B61D303BCC5C0D9F5842C32D657E927C B3qM-
277,365,211 *1B4471C3B483BBD141C1FEDEE5319DF4FC49B947 B3QmS
277,365,212 *1B4DE5E282CCB482C0D523EC51CC78AC3AEDCAB1 B3Qn9
277,365,213 *1B4A8325C790B1BB170AC9F057F16969D9E8B2FF B&3qo
277,365,214 *1B4EFD8F1C407799EF817FCAC202793E593D92D9 B3Q,v
277,365,215 *1B43FD8BCA88214EF51BAF8E39F45DEDF02FC6CB B3R_%
277,365,216 *1B45F52587CC590F9A81D32C7195C5270FD4FB14 B-3Rc
277,365,217 *1B464A55995C2313C47489F5C40009014F017858 B3
277,365,218 *1B43BAB2E8E43F381E59C6446684042DFFE4CE62 b3ro3pvl4kk3
277,365,219 *1B430D541B1EC8B3A81DABAAC71CF573C6BECF7F B3Rp?
277,365,220 *1B4C8390B1EF82DE43EBFABAEC5E6110730C9C4A B3RRIES
277,365,221 *1B4FC6584A136CE4CF4646590EF7464AA727402C B3;rW
277,365,222 *1B46DB23BD6DCA47CBF7A8DCBE9DEF3A32C100AA B3s3c
277,365,223 *1B466EA43F9AF47E71BA658D188298B918B0D050 B3?SA
277,365,224 *1B471CC8EFFC4ECDC5122FA4DFD4A0579DA72A8A B3S+!ARY
277,365,225 *1B4A4F9413C996980B95F419A7F1D8835E19D07E B3(sb
277,365,226 *1B49A8124216086643C2BDB93C41169098371111 B3sGA
277,365,227 *1B4E730F9F27BEA8CC1F239254312EC610B38BC8 b3sh1n3
277,365,228 *1B4B1CF514584B9FFBF771402ED194D77DE613BB b3s+owm3n+
277,365,229 *1B473665FBD1ECB47ABF641A821F3FC3666EAF17 b3t4function
277,365,230 *1B420374F0D5888F7C3B70FAE8137FC4692A6CA5 b3th4nn3m00r3
277,365,231 *1B4B11E63002A6D028D4DB40E421BB1EAE8E5AB1 b3thj3sim
277,365,232 *1B4B71B157EC661BA610556D963F26F531D23943 b3thul14
277,365,233 *1B45024C798F8470BA65144F132215B6C64B7D7C b3thump
277,365,234 *1B42547718B84820A4F7AA258FB4BA35409578A1 B3tM6
277,365,235 *1B44A2846932A920DE3BE35447BC2EE86020F1B6 B_3tS
277,365,236 *1B420A7C25914C7861DD2E9E597F4B90E03A0125 B3tS(
277,365,237 *1B46534793C434C73225F8A614BA23843621FE50 B3u!4
277,365,238 *1B40C1114E87A97CD54E3D0C2D29284B97AE70A6 B3U8O
277,365,239 *1B4D84ACDC01975756BBFD39CC0DB90F29920276 B"3u9
277,365,240 *1B4411A9EB569E2CAD8295C08C966BF006805F22 B3
277,365,241 *1B47EADE9E54124C85CEF89DE6061EEBD1290FB0 B3_UR
277,365,242 *1B4E2BE77857E99B5D7D1966613E084510B155CF B3-uR
277,365,243 *1B4BF6DDBBB0B97B17B37F047150E242B7956E4F B3uU8
277,365,244 *1B44D69F16633D49F04C39A699AB974D0E98078D B3Uw&
277,365,245 *1B48507321459555E1D6234438267A8F541FAD42 B3!V!
277,365,246 *1B487AE065C699A8B3019C192BF8280EEFD75481 B3)!v
277,365,247 *1B4A8EF4B599606D714044C00A8045365BF0AB92 b3v1n3
277,365,248 *1B406A47CDBA4C0BFFF61A3127AD964516BDD173 B3VK6
277,365,249 *1B44C8E0A0E051EFFB61D7F8498759E91E772282 B3vKN
277,365,250 *1B4DBFAA12B4D8D8C7D9839DEBA2CC47405B45A4 B3V
277,365,251 *1B4A8303D48D28337D4975533EC11F093DF756B7 B+3vr
277,365,252 *1B46A6EBE84F7A01E2956BBFA87AAD51AEC52CC7 B3vS0
277,365,253 *1B4CE1F4F89A655BF3DF3EBC78952E1D3DD642AD B3V"Z
277,365,254 *1B4C970AB95AD229532404454EE7F2B3F32A8A00 B3&w"
277,365,255 *1B4AA0F9E969C2C937CE91B2CF7D5860A650C2CB B3,W0
277,365,256 *1B4CDE40BC72F79A5298FE821E79CFC575FF29D7 B3W,w
277,365,257 *1B464B801FE59CC214833B6467E4DDE1340865B2 B3$X&
277,365,258 *1B48DE821EF98D11C7873F5D5598248F8D6A4C8C B3X!%
277,365,259 *1B4B426D458F8FD870B2B0436A40C6E3CFCD7A09 B3XM:
277,365,260 *1B438C2E478447BE76E5F6CCC3F2A4DADD43217E B3Z&+
277,365,261 *1B4781E0CB6CA9A459C8967A8E3C39D8EF8D9C45 B3"ZA
277,365,262 *1B4108D52113409E575039A767A632810C1A3B5E B3ZIO
277,365,263 *1B43B897885B6FB20BD4F20CFC032AF50FDC808C B3Zt-
277,365,264 *1B4950083FB5333B10A2A91E7E69E1CBC5E7B096 B3ZZ
277,365,265 *1B49CBBBEE9C35FB601544170F573938CDF9C263 B-&4"
277,365,266 *1B4E6A236FF830346B2784E182DF556CEC17E050 B:4/"
277,365,267 *1B4A1AA632D9E2D5F51636A08BFB048BF551D17D B???4
277,365,268 *1B4DAE7AD36C2319EE6F7DF2683DDE2F90DA9DB2 B?(4.
277,365,269 *1B4B78577334CBD0DD7E2C5A29FEA314A57329E9 B{4#
277,365,270 *1B429DDDD3A8555B4D5E96E98931C2DCCA0ECF86 B4-!_
277,365,271 *1B4629B7CD6F1CD78B27AC818D317F0D38ED50FF B40Yp
277,365,272 *1B47C7FD19E0D3D12BF7E1915F90FCCADA4D1979 b410b99155
277,365,273 *1B4B49F8CBFB0B72D80D1083F62BD542A0AC05EF B415i
277,365,274 *1B4957624A661B369890022DAD5A22A56DD72D56 B41mo
277,365,275 *1B4E871D05BD5482C95F08AD890B960B4ED9E0C7 b41x4ult
277,365,276 *1B4EC6BC7E1D8DF7491CBAE310B049970A31C207 B4!2#
277,365,277 *1B417FF751002DF81FD91C8CA93A07860BEEB15C B_422
277,365,278 *1B42F2EED074CB877628053EE7DF2DF40E38316F B42o8
277,365,279 *1B423016E45ADCBA2EAB83864DD8456F31A4AEDF B42X;
277,365,280 *1B4CF3A280ED384C1FA8C6202B5A32714A46E7BD B4&3,
277,365,281 *1B4F5DF4EEAA8B2B98FB0CD99AB8B650666A2B21 B/43a
277,365,282 *1B4E14B5C603C84480E4D9A446B955A733291A45 b43chl3
277,365,283 *1B46CA661CC9613831EE7DDF0859A8A05BB193E6 B43iD
277,365,284 *1B4BEE96CE0B0B47E1F18C720D934DAD5AB25781 b443b7e86aa46e3470b7c67b788de310
277,365,285 *1B4FB26899DCA84A9F8E7928D6590DDCE1A4260F B44Fw
277,365,286 *1B48DA2C256BBD19FCE2DEF3F48059E8F3CC186F B44&n
277,365,287 *1B4C14276478A5E54FDF3A4C6954B15C59B9C176 B44pzxjjaowpdb
277,365,288 *1B470C3EB0AB75CF5C0F260A41263E281359C111 B4!4t
277,365,289 *1B4F7ED6BCF69FE4F768FB1E18C6CB8D941B4E19 B(45(
277,365,290 *1B43AA6EC7E13AA953405B4414EB08712B31A8C3 B4566
277,365,291 *1B486643C214FBFD0E83DA8B7221BD7CCEF7115D b45952
277,365,292 *1B410371E3EE8E7B899393C9CC7CB3475206E6EA B45MY
277,365,293 *1B4D11D9091555CE5E11DA5E261FA265E1DB2373 B--46
277,365,294 *1B41EA915F834B025C82490503CC57F2C0A8B390 B46Cl
277,365,295 *1B4CC0CF6AC7829206B78829D802F435710B9BAC B475!
277,365,296 *1B4D20A55CDBB5855A668F65980208085D83B669 b47537
277,365,297 *1B4E67EF5E985145484D5AA135A5D95457D3DCC7 b4763
277,365,298 *1B45B66EA16CD0FB8F57717AC7C36708468EE060 b4774l10ns
277,365,299 *1B452E75E80D8A1174C3BF4757CCA38CE88B2F02 B478R
277,365,300 *1B4317117A8B9C786DFD083C6CC38F84F84F50AE B47Ep
277,365,301 *1B4136D241C45F3CD88687F580B8AD50A6FE8743 B4#7p
277,365,302 *1B436DB46EF8F15EEAA132CB9BAD53B5775AE883 b48178
277,365,303 *1B49B534896F3FCB3FE2BF9ABD5ED423FB2140B0 B48bg
277,365,304 *1B4C2F1B39BDB93CBF55C68C342EBE0086E3C729 B48C7
277,365,305 *1B4BDD90782B550830F417794103787D89460C19 B48co
277,365,306 *1B4A31CBDFE66E10F39DE8C57A240034F4712C13 B$48h
277,365,307 *1B4D09F0D02B04BC48C96A546CA785748D61216D B4
277,365,308 *1B47DA916914D0C450AFC87A78771B3A31BFAA1E B48Kh
277,365,309 *1B47AC724D48184E894E6A84CD09AE61F33755D8 B4,
277,365,310 *1B4C501F28E8331CDB67D8A7852DEDEC1C520F7D B-4aB
277,365,311 *1B462BE688A5D7914FF1D97E984A72CE5C892197 B4A%q
277,365,312 *1B4B741D82D6B09C54CF5663CF10B99FAE501CB3 B-4b1
277,365,313 *1B48114CC8072B2D7637BCFC565A725556C9B768 B%4B6
277,365,314 *1B46963D126ED30A83D9E1246E64D243E71FF6D7 B4b
277,365,315 *1B439FC306275CCC2E41E83FE8C2509463C46A52 B4BLAKE1
277,365,316 *1B45CAC5C17ACF3D52CE6A3AB81D24EB11FDFE65 B4,BP
277,365,317 *1B49D49B304DC5D430F35A4589C3AEB9CD029529 B4(+c
277,365,318 *1B47B3BC69A47D7C547E23E04DADAD55684879D3 B4+c;
277,365,319 *1B48A12C746D24BCC4E551FA0D5738E2B5F07D75 B4c6s
277,365,320 *1B41E058F1A2807671FE8662ADF4B7C7215CED8B B4Ci#
277,365,321 *1B47515051744A6D1FC64670777B872579EFBC6F B4CT3R!C!D3S
277,365,322 *1B475C34293921BE6EA113D0360338F1FA000692 B4cTl
277,365,323 *1B4BE8532AD87B0E5D3E6907096432596C6C6AB8 B4+CZ
277,365,324 *1B46E9F07E46603021AC1C152DAD122437AA9278 B4
277,365,325 *1B42A384611380B56C430197E8597BF30BA05980 B4D&1
277,365,326 *1B4E4AF28FBB4604D5A8D50C3BFBB5FABBE6871A b4d8ec
277,365,327 *1B4672E824CCEF769366F8C583EF871EDDBE84B0 B?4da
277,365,328 *1B4CAB4CCE5663B04BDE7185207C889CBE069A81 b4dgo
277,365,329 *1B425D0F370D07021C3CCCFCD4E1B0E470B9EE7B B4DH5
277,365,330 *1B4FD340F34B64D5E4F062D2C13C6091DDE6F498 B4_dn
277,365,331 *1B4E5B1548F83326CC391499B47B6F710ABED16B B4du1j3rs
277,365,332 *1B4325E54CE65FE793890D32887CB3825A02A1F0 B4;DV
277,365,333 *1B4172C51A66C05B5EC760C7E2295F4110AD0B1B B"4E)
277,365,334 *1B4BF1E58079B7DD7FE3FB3BAFFCCCE4FDCA4E17 B+4e.
277,365,335 *1B4E7947CC3812B3AF0A5571DCEEBEA172FD992B B4e0_
277,365,336 *1B4752BFBAAE716C06F58F9E63910D3F0EAD52C9 B=4Et
277,365,337 *1B431EEBF9623CA4DEB2D57D7B3DF6EC4B94485A B!:4f
277,365,338 *1B4628CCDDDEA548E2CBDB2C0206C46F347BAD31 B+;4f
277,365,339 *1B469C6AF63D618EC134D8A006F2CCF937E669C4 B4f1o
277,365,340 *1B475D8B8CFEB300CFFC8B807CE2B2D7B34C9ED8 b4f74
277,365,341 *1B41A9D138DBEBC7E368E2FA1B853FF443847510 B4G-#
277,365,342 *1B4A964F3AA76156F45F59A0CD6F66CDF75579D0 B4G9!
277,365,343 *1B4F7C4F3E93D0329AFC7936AE764AF2B60F247D B4
277,365,344 *1B4EFCA31FCB9D5420923D527CA9ABD72320F0E4 B4gu3773
277,365,345 *1B40E574E8DAB8C5720A30A30917F277CBABD366 B4HOF
277,365,346 *1B422DE685AD1B041B233374E0C809EF5BA556B7 B4$i?
277,365,347 *1B4E3D028E87D1333E08AE2C8DA1B77F82BBCDCE B4il2
277,365,348 *1B4D722F880B99F0A06EEB6D5DD5B4F2438B91E0 B(4iM
277,365,349 *1B4F3C8BCC87C0EF2E7E5EE3D390C23179298264 B4iP(
277,365,350 *1B4B40700C91CCE510746C68C19034486B784815 B.4Ir
277,365,351 *1B4C63080C12BA90FDF3D85BC942F86206AF3F21 B4i(U
277,365,352 *1B4F8A2D07B356A6BEAA802475BC8F44FA9D9BFB B4iZ5
277,365,353 *1B4270C39528BD0ABE1BF2A4633349A5A6A7CC44 B(4j:
277,365,354 *1B47D87C691B96BF895814F5F1366FF1510269F4 B4jNR
277,365,355 *1B4CEF1993041163C8328495F6A28392EA8739DF B,4jv
277,365,356 *1B452587EB50DCA617E64E5CCB4644FD4670082B B=/4K
277,365,357 *1B45FE50C8DCCBBB017385E8B74D4B0062B42835 B.4k(
277,365,358 *1B406B5F52E80D77E917E74067B3EF63F54DE7A3 B4k#"
277,365,359 *1B4582F7A7F6A2BEEE4921CDF71FE267F3278F3D B4K5
277,365,360 *1B43266D2EE0A4FE4C577D596095C1241F98C092 B4kpC
277,365,361 *1B4F26EEECA11F9365A048173935BEDABB8B18AD B:4kU
277,365,362 *1B48C39B270D38C6989C2153941E368154ED7436 B_
277,365,363 *1B4BFCDC383666E4226F853110C778079EAB21EB B4L2006
277,365,364 *1B4CA309F5372DF2C28F0955625720F0B0039CF9 B4l4nc3 p
277,365,365 *1B4D804BFE876626D8D5B082457553BB1DCACD3B B4l
277,365,366 *1B4C88D40A47FFC89EA4BC56AB3DFF249694EF94 B4l:b
277,365,367 *1B4A39486AB84DF6366AA68DFB3D8A0FC27A0F53 b4ln3ologic
277,365,368 *1B49E8EDFD86F16E7E509F6D4279B13C7652B123 b4lonsd4l3
277,365,369 *1B4D87649FE3947FD611ACCEFF62E86C68822440 [email protected]
277,365,370 *1B41539F774CD911E26E990540FEB3A2DE4A8E89 b4ls4mw33d
277,365,371 *1B4438C67094D3CE1F039DC2ECDF7E9F56FC6DE5 B4+
277,365,372 *1B468EF2181354A8C5BE476EFE2AAAFE8DC02563 b4mbo3ssw33p
277,365,373 *1B452B44AA123B2BF376D7A2A67ED7E631B93416 B4mdo
277,365,374 *1B472F77BD67B3E3D32C621ACE0662D53512372C B4mjc
277,365,375 *1B4A219ECED1BC20D09D6684A7B5A033AB826185 B4M-k
277,365,376 *1B4CFB85289CB97E6D6CA0DC9A4D4233935C3F02 B4M-O
277,365,377 *1B485303B3494FBD5A88A1DE497D50F3696709D3 B4mUn
277,365,378 *1B4132EFE969E02E3515306A5A0B868C122A8A76 B4mv.
277,365,379 *1B4D22383DFB619238CA9ABFB9D84780672F0615 B4MY
277,365,380 *1B4E0CC78C1BD618E06AD52A26C503DA8D78AB95 B4n:;
277,365,381 *1B406D0086E469C174BE98D1C6AF63CF91F4E239 B.4N4
277,365,382 *1B4AC5BF8A86798E72A2531D79AC77CFD7718E44 B4n41i7i3s
277,365,383 *1B4B62854DFA9755A0D5693AA3A3806B591FDEC1 b4ncob4nco
277,365,384 *1B4D7A1586BD50C9B42A7727502A9F96476BAC23 B4nF:
277,365,385 *1B444FE93BAC45827F199620EEB51BCB05888BCC b4nj0cl0ck
277,365,386 *1B46F61783EC9790B7DA0BF3D0FB35484CC6F708 b4nkingbill
277,365,387 *1B43FA53A018BC0C024C2CB9EDACDDEFFC91A4CA B4nuH
277,365,388 *1B48F6936201011D515EC77BDFDFB96BCF751D7D B4Oa&
277,365,389 *1B46AD6F71EB5F830444EF9C92E13135A1020EF3 B4ob3
277,365,390 *1B46BD5BE5B9ABF5FF87A97979F93E9B76D004EF B4;oj
277,365,391 *1B43C5FDDEC8A4C6CE0E9F5B9DE18B3AA586EC35 B4OnN
277,365,392 *1B4B975D32AAF11E48D870859441ACBDAFC1A8B7 B4O?u
277,365,393 *1B471F3C336E3487829F2E4F74F9E4015631DA0B B#4Ph
277,365,394 *1B431351D5286A3DE039B371C4C41900EC67C324 B4pv3
277,365,395 *1B4A75D679B1EF3EAE7B8BA186DD586B35D2153B B4Q|
277,365,396 *1B42C970B8F2215FF6301867D4501F4CF53862B4 B"4q
277,365,397 *1B4991D16B71D7D874026BDB33AD1F4FAAA46E92 B4_q+
277,365,398 *1B405817862AD524815C783D581462FE455310C4 B%4Q3
277,365,399 *1B496E7B6F3E24D1427BD0211141BDEEAFDC40B2 B4qA(
277,365,400 *1B4D31701C7564259E926B2629B6E3AB1B968B64 B4Qa1
277,365,401 *1B40B9FC42A28988C7D64427F6BA14AEC5958FAD B-4Qh
277,365,402 *1B48BE4DD124E81EB6AA01929F39460E151D1BBE b4rb4riy
277,365,403 *1B49D576B32352D879B389E6C8E3511F3F8EAE45 b4rc4ljon3s
277,365,404 *1B47133B3EAF516AAEA24D14C06993A44B8736DA B4r di$ch
277,365,405 *1B435F038B0A27D77203ACE20EED3CCE3D92DCB1 B4rnY
277,365,406 *1B4AF04DDDF1E76031D3C4D5444B8894516BE52D b4rone5
277,365,407 *1B492AE0C27272A0BAD7C038187DC0E6B5D9BA30 B4Row
277,365,408 *1B4BEBDC4229E299C878B45588B76E59C9299071 b4rr3r3
277,365,409 *1B4B90AA5577DDFB1443E5376564E5BC80541901 B4rt3nding
277,365,410 *1B441297A800831527B257EA03B703B481544471 b4rt3rin
277,365,411 *1B45622ECAB98C823DEF34443ACA14BFEB47D409 b4rtm
277,365,412 *1B47086E43E18805D0BB303048991DDFB10E4B41 b4rulh3s
277,365,413 *1B4F885E3B7563F9D9711FD3B425B87730FB5DC4 b4s+4rd13s
277,365,414 *1B48AB57537BD71ECC3C50716F95673A3DE53E8E B4Si#
277,365,415 *1B4BB44F3D30E1EF340D53CC419D17ADB66B8813 b4skew0rk
277,365,416 *1B46D2B5B7FEE026CDF9CB67649A733C54CBCC60 B4$T4RDIZ4TI0N
277,365,417 *1B4C01F38049249DBB53B8C5390E9B620C564568 B4tAN
277,365,418 *1B4A7B11A38410D1683D3FBE4CDBAD7AE681D3E2 B4tGb
277,365,419 *1B435E8338CC64153210E3AF5F88A9C242F4658A B4+tM
277,365,420 *1B4985AC618849D12C768737E8DB7B25B1ECF96E B4&tV
277,365,421 *1B4D601B1F05C86B6F6573FBF66790083587D8E4 B4TX;
277,365,422 *1B42CA1E8309FBB69B7486AD231F8FC6DF47659A B,4U
277,365,423 *1B486611A514ACDA7FCF2445C738F014DB13BFA2 B4U.6
277,365,424 *1B4E3724D787EF1294A27BACF3313B043EEA5230 B4ui(
277,365,425 *1B4E2B82F87969CF034DDF9563F9D64044314D2B B,4Um
277,365,426 *1B4D7C32CBDBC56839979222DCE1D361DA9C2131 B4%V4
277,365,427 *1B4AD33C83E980E204779EAD2030DE5BED6E844B B4Vg
277,365,428 *1B455DB559A75E1160A75FF57AEEA8CE8E1FD36E B4VH%
277,365,429 *1B44AD368FBCDB74770EDED5BEBC458B70BCBE2C B&4VQ
277,365,430 *1B4B857DED74936F3A8462EB03EAA8C56BD81765 B4vVr
277,365,431 *1B435D567281E8B8BCFB8D5571B3819AA9E10DBE B4V!Y
277,365,432 *1B4008B3BD166BA77403B76BA91EB3B3A11B572E B4w;#
277,365,433 *1B4C398DBC946A18A58ED756F161D8E2D240A113 B4w0s
277,365,434 *1B40F99DF5ABAE4E75319E68F88368CCAAF1225A B4W4g
277,365,435 *1B4ECB2FEA7419997100F4C4E90BBA9B1D392F34 B4wC4
277,365,436 *1B4ABF10E09512DC35E23BBA151FB0D517205E28 B4wdie$+
277,365,437 *1B4CACD0859EC0BBA57B0599205E403BA5D96804 B4$WH
277,365,438 *1B4E2CF282D48E069AB67A0F2C5ED0B45A3B7D82 B4W:S
277,365,439 *1B48DF40188381750050749D570F62811E323695 B4WUr
277,365,440 *1B4809F1693EC74153FEFD439EBBB1C8E3C9D5FF B4ww!
277,365,441 *1B49A0F1E0E0565531822A54C2DBB7DE29E7DADC B4wWW
277,365,442 *1B48DDD8172C84613DA06D4490BC0CAEAB6C987C b4x3v4ni
277,365,443 *1B4298545CB5A399EF79350D4DF7D0E5DC7DFDE9 B4
277,365,444 *1B43AFC3DDF83D7030E67D6D20B9C787705A9E1B B4X51
277,365,445 *1B427C047E8A1EF178B771DA39AA0AE79BE6EFD9 B4Xs:
277,365,446 *1B48150694B8FD0F235B236CD311BBB7C8EBAEF8 B4;&Y
277,365,447 *1B410418F03AD6AE7BC4209E4719CF5EFE8F424A B4Ys,
277,365,448 *1B4EC83CB9719952D1C27EDCA84A08DE8D29D921 B-/%5
277,365,449 *1B41350040EB77693B15AA455560B06333E7A140 B?+%5
277,365,450 *1B4BCA16D811A7420C0C4E2F95AE0C167127B01D B?5-&
277,365,451 *1B444124F48B3EA0781976E98DB68EA51EAD87F7 B().5
277,365,452 *1B47518EDF58AE300BA2EF2CDEEF2D409ABAA84F B)5,,
277,365,453 *1B458971F8B922AEC7411ACE02BA358001ACF66E B5=(
277,365,454 *1B4842CF10FBC9EA7983418000DB111645B547B0 B5);
277,365,455 *1B4FC65A129061C0E37DC62DF98EE49FBDC47EC6 B5#))
277,365,456 *1B495E4ACCD5C0752C85E43AD8ADAE6F03856700 b50305
277,365,457 *1B48B6C718D4FFD7D97DED3D56D24936430B2378 B50.6
277,365,458 *1B49CBFD3F573CCA10BCA94858645745D978C54E B;5$1
277,365,459 *1B4ABC31BC72957C4BF9ACA21607EF09F563FF86 B)510
277,365,460 *1B47438C8C66367EDF96207D17081D3EA8948231 B51(s
277,365,461 *1B44BA33894E90122115629ED4F7EC4BFF407169 B5"(2
277,365,462 *1B4A3144D0B3E6DEE5CFEDF148737C92D1EC8464 B520218
277,365,463 *1B411A2D67D54446E7BC0145C9D0B26B88FFB2AB B52t2
277,365,464 *1B46DD83B3C2CB59C9C53078FF1789EA69DDA089 B5"3&
277,365,465 *1B4DB09E8924EAD9CA7E482D9EC99EA9508371B5 B53#!
277,365,466 *1B4FC175345D42987483BF1DA0F2EB09911ECF34 B;53h
277,365,467 *1B48EBE556695C4F66659BD9D9A701C793D4FCBA B5459
277,365,468 *1B4791A54B92236C3FDC467BE6E397913488BB04 B5#4E
277,365,469 *1B4A89C2C2C6102CBAEF4B199F7D8CF914BF2E3F B54M0
277,365,470 *1B48840396787BD15F24067C5A58F5B17404B3C7 B55O=
277,365,471 *1B459F2FE5F43033B3136DB9416B4678F233F2F7 B;5"6
277,365,472 *1B48E4D84E0C31F475642968E1945952273FD438 b56628
277,365,473 *1B45BA133AC1E45076BC655581A83194B4EE4B54 B56/B
277,365,474 *1B4294149AFB9F00828FE5B8ECCBEA79D3DA50D0 B/57&
277,365,475 *1B40824171DDD78C43A95EB54477B3FD0407634F B%57
277,365,476 *1B40C014556F496B7D4F4EF61A66C421C173060B B5"7-
277,365,477 *1B4F8EB1D0321A85E2EA866F770EA0F50C00919E B57a&
277,365,478 *1B40E06FF35E50F5778CCF694A315D79CC1BE170 B5%"8
277,365,479 *1B4136CA96B6D6C460FF432EC921BE2CB75A035A B583
277,365,480 *1B4D1E449A9969CE3C8B7FD538F22CBE05E8443C B58+j
277,365,481 *1B4743EBD0EF0672D11E0DE476F42E7A26689C17 B#59i
277,365,482 *1B45B4AAD06264459706280192B1AD4D4A357AF8 B59w.
277,365,483 *1B4E7375D31D754062059C6A7FA7DCAA1296C26B B%5$A
277,365,484 *1B4D03AB086DFC460A73F3412591BD9351071743 B5a3V
277,365,485 *1B46B6E636D57CACBD05FBC7682D369E89178821 B5AoZ
277,365,486 *1B4E4928D623CFBFF8B36FCF10E5D9CDEAE0F37E B_/5b
277,365,487 *1B43ABEA9ACB9042ED08D46DD4B1350B276057F1 B)5b8
277,365,488 *1B4B79F688B6B4AA933E9AEBF26330AFF8C95988 B5Bov
277,365,489 *1B446DFB6C547868EF880267706A791F8223DACF B5b:S
277,365,490 *1B455A6F4C8B092FC05FBE556A0A935663FB88D5 B5BuO
277,365,491 *1B4A2BED4019F5DB0F3CFE6D0F7472BD7B3FE68F B5)"c
277,365,492 *1B491357691FA00455240C6D8F39B1D3A8EFE58B B5c&/
277,365,493 *1B48047DD69387AF2C3EA63606B3ADE03188507B B5CHa
277,365,494 *1B4EA22DCB95441CB01E5D7E8C893B7A702F553D B5cjp
277,365,495 *1B4092E9B394C386471744517F82B05616C0F8EF B5c,K
277,365,496 *1B42689DCCC5A1D69110CABF9C14E2D0AC8E7A8D B5CL
277,365,497 *1B4FA0E19ED637D9CA2D798B0F21611641C5C3EC B5CN:
277,365,498 *1B49E82557BEA536D5A4D305F6D7911F5F9C661F B5-CY
277,365,499 *1B4605CD62725540C32BB39E36C648AA6088CC33 B5,db
277,365,500 *1B47D4D56C01222DC48E82309968EFFEB677F5CC B5dP?
277,365,501 *1B4F10A183D7356D091AB2B6BDE688C6522EE9AC B5e1F
277,365,502 *1B43CE2483AA2493BFAEEFA92530A526F474FD75 B5EKp
277,365,503 *1B4EDB40443D906D502A97CB636EEBBC2A24FD6F B5)Em
277,365,504 *1B47004E39DF15BD84C0C65C3CA5A194A995FE0F B5em_
277,365,505 *1B4FB7BEC386ACB85071B5904E593938E0169270 B5esX
277,365,506 *1B4137C7FEC93AE49F11F690E7A34C209F7D969A B_5f)
277,365,507 *1B46131B8D0108038EA05205634F2150FE80A296 B!5f&
277,365,508 *1B4D23B06B38DB1B678EF20E7B127A0181E7C1CF B5fR(
277,365,509 *1B4871FF080C9A9395CDD1C6073D266EC309ED0F B5Fs)
277,365,510 *1B40B9F35607517F42C4F3DDDEDA7D222D77C9D5 B5fY:
277,365,511 *1B4CAD5A5FD32571114B4ED7556913142125B94C B5:;G
277,365,512 *1B4B418AC9A821515BABD3720E131922F5365058 B5;;g
277,365,513 *1B49DD2F470F63F351BF148ED9AB6640358AB563 b5g4
277,365,514 *1B4280E32DD8B10BAE56855501646D87F1B71900 B5GkN
277,365,515 *1B41D9ABDDAFA4A05D33401DCACABE3A0B813828 B5G?L
277,365,516 *1B4BBF6E5BF1FF35949FB332478A7EEEE3233CDF B/5H"
277,365,517 *1B4783A37BDD74FAAE31C0B9D767419F4292E5CC B5Hh:
277,365,518 *1B406FDDE0062D4828A92E1861B18493E643FFEC B5!HN
277,365,519 *1B40A4C117EE692E65280D4EBFEB7867ACE630A8 B5Hp2
277,365,520 *1B45EB383EA43242F40EDC84ABBC1D5040DB405D B5(hQ
277,365,521 *1B40C14E437D4E1B5F4A8EF103A7E3B64C19F023 B5HRWTB
277,365,522 *1B4937375C87FBD43CCF2104C0492B1DD6B38D1A B5HZW
277,365,523 *1B482FE52F600D45037F0D1E57D9A4C50FE7E2B7 B5i%!
277,365,524 *1B45E28FDE69BE1DEB98EBB3D9742FBA8257C011 B5I-a
277,365,525 *1B44484BEDA82B77EC77FF86E32B880CE1978148 B5iEM
277,365,526 *1B48796504D45465A0DCADAAFCA1D6FAF26A8153 B$5iM
277,365,527 *1B474E0733E00474A1CE7C4565BDD6CF3E6A2787 B+5iU
277,365,528 *1B4479CBAA201F8783731A9DDFD61F09F98D403B B_5j$
277,365,529 *1B48452243E35DEBE363564CA74BD8BA3DAC41C5 B5(jZ
277,365,530 *1B4E928EAB5CC6B1DDF99CF147226B9739CFDF20 B5k5q
277,365,531 *1B40220D2E5A28A33D5E2D1D716BC959F172A96C B5Kgc
277,365,532 *1B4B6993D90A651E9C5F9943B19358A50BE20F31 B5kGs
277,365,533 *1B4772A7A720853C061DD699B24B694F87EF22D2 B5Kj"
277,365,534 *1B467F30FDAADDB8349B67153D3B8718841A7B4A B5K)o
277,365,535 *1B4BF5211892F7A29ACEEE3CA1A47A30CEEC22B1 B#5l.
277,365,536 *1B43E9EA6BBA61ED7746785A71186FA455F6F2D3 B5%l3
277,365,537 *1B4358DBCAC31AB9335C6980F6708044E945E1CC B5l?D
277,365,538 *1B46C9056D3BA71EB71BDD519CBE9CB4E63A484D B5,LG
277,365,539 *1B49C54E4AB74BB89F090760C3EF3AD1436825C5 B5
277,365,540 *1B43293F74C42CEDA979DED8413F655BAE83FE65 B5L+w
277,365,541 *1B45F5C73D08B281B92EB4FF993C6DAA9AC159E5 B5m+!
277,365,542 *1B45BB235DBA6BB32CE66C631CF01ECF480AA432 B5MHs
277,365,543 *1B4672CCABE2EB8C8D8DE70247EB0E971DAD68D3 B#5mm
277,365,544 *1B4DB2F0DA23F3FCADF58582D447020EDBE98F9D B5(mN
277,365,545 *1B43591DB4CCFE4D291764307B3BF43FA19C71F7 B5MSf
277,365,546 *1B4865AC8DE323DF510AD82C4762B4282FAAC9A2 B5MWe
277,365,547 *1B4541C01D8553A6CEE7E70992BE886F7BDF8CCB B,)5N
277,365,548 *1B498EA00F4B7366A4A6C2151AC586F672C7CB8E B5n8v
277,365,549 *1B42DF9B67051D7FB06372CFFC3389477BA3AA06 B5nA3
277,365,550 *1B4B20462709529FDD8409656BE295DE7E595EE0 B5nFQ
277,365,551 *1B40FF8E9575C5BC1E77EA1CB701EB100B8E459B B5Nsk
277,365,552 *1B4D715FAE1E536052522A934F182FABDCAAB63D B5/nw
277,365,553 *1B41B1FEBBD40FCC4AB48FB0DF6DC7C07E68E3A7 B5!o"
277,365,554 *1B421CA305E701E3F94359E1EEC2BB7CB45E29D2 B5OLT
277,365,555 *1B4E1A1E6EA643D8CC89B88F3FCDC079F77B26AE B5$OO
277,365,556 *1B43F9F1E3080C0C9F6B09724CBA1CBF340F0DF7 B5Ou+
277,365,557 *1B4C4721437B4B514E8D0939F219846E75B3EEF7 B"5P(
277,365,558 *1B47DFD2E84ABBA371015431F7B7245AEF42E938 B_5p
277,365,559 *1B42827A83726D2CE5F3E32A467DDC1315BA7167 B5P.8
277,365,560 *1B48FEB67C94E5BE28EDAFDE6166A36BC6EA75DE B5pED
277,365,561 *1B48F7BC86F5456DBFE82C8A9CDD2BA9C509FC3E B5/pf
277,365,562 *1B47548F8EDD98E66C227D3335C0F88838315E8E B5&pG
277,365,563 *1B4DC16AF8BBD7E4A7C12698E607EEECFFE5E39A B5=Pj
277,365,564 *1B4381DB3077C432292270B640B29FBB824420E3 B5PM
277,365,565 *1B476437D034E4DF4C0FDB79DCFC872BF4D22040 B5Pse
277,365,566 *1B4773FD9D3AD60BF0CAB4922D4E2F85EDDEE402 B5q:$
277,365,567 *1B4543FFC2257DB7D49A47DA4F5831B445274A43 B5?Qe
277,365,568 *1B4FF50C5DBFD66F63EA26DD18E325F2EB27C025 B5Qef
277,365,569 *1B40CB3C47BC2F893A75629D3FE71B35CF7C41F1 B5qh
277,365,570 *1B4EAA42945C35D171EB1A614F77581C1A9A9A16 B5$QQ
277,365,571 *1B4116BB91F8D4D2DEC0D71B5A73DF03B7E2E2A4 B5qs2
277,365,572 *1B44D214E8234EC377654586D1E14A67E8EB399D B5QUA
277,365,573 *1B4A2D5502C5A4FCD6302511B2D0677972B2198E B?5QW
277,365,574 *1B4D1E804AD1E27FB6DBE1A3B3EDF7D726F3DAF9 B5r8#
277,365,575 *1B40EBEDFB63A3C230CC000A83E4140ED8FEE486 B5rAc
277,365,576 *1B4C857FC9B97D5D7791A1A00733A406CC8C068C B5R,G
277,365,577 *1B4161CE005D47576607B18ABCA3E35369F9FD24 B5rhl
277,365,578 *1B4DF30A43F1042CBC7756820D38B6DAA132AEDD B5Rk=
277,365,579 *1B4C4E1B15636677FF446E34EAE784980ACF8D14 B5rM/
277,365,580 *1B4FF3FF76A7CC1BCE325DFB7158AB54C06A9689 B5rU#
277,365,581 *1B4272D549DD301534C2E73E5699C66DD177D70B B5&.S
277,365,582 *1B492E5547149E16DF459E66DC6F2E5B1B6D56C7 B5s24
277,365,583 *1B44D1FA625655C466B35DB705FDB1B03F6C970E B5S9l
277,365,584 *1B4A234CA64979B838DE141BB407A3A646B0391A B5SgC
277,365,585 *1B4FEB258AAECD5234B33F850D7491104A72E8DA B5S)j
277,365,586 *1B412E1E54E64187728CA1A8E2A932CBEE993AB0 B5T:$
277,365,587 *1B40A4FBB17291BBFF765542EA6531F04421215D B"5T2
277,365,588 *1B42B70B9B3D7BFFA95D8CB6D86C862F9AA9A685 B5T!6
277,365,589 *1B45CE5E5C1AF40AF1D73914B154F6B7BE0E99A9 B!5T7
277,365,590 *1B40A17766A1099754E7883D04ADB2397A452F64 B5TZm
277,365,591 *1B450BB8B04249DDE9D34EC8E88C30D16A14AFA0 B5U)2
277,365,592 *1B43C6C0C2F6CF51248E39A03BC1E8D6F6B0EB2D B5U79
277,365,593 *1B428760A3236982895A4480375BC67D60EA1CD9 B5ub;
277,365,594 *1B421BDC5A8CAA5DFAC8D18FCA1653D7EC3499C6 B5unL
277,365,595 *1B401C0137A454C5D1C325026022DE0BB0221C02 B&5Uw
277,365,596 *1B49AA59C9D677975735C3D6424A86E2BEEEAD37 B5:Vd
277,365,597 *1B43358492CA3CB0F51FFAA54286A6B90D0FA321 B5vmt
277,365,598 *1B42B497093E43087053A69349AC751A01064DD0 B5vug
277,365,599 *1B4257180D40679CE38E996290CE64902FABAB53 B5v%X
277,365,600 *1B4550B9FD6B124761F1197E536352EC7162BB09 B5WASDANCIN
277,365,601 *1B41979D0B33CE2D82444BA9A3323DE75E8F75C4 B5wb5
277,365,602 *1B40010C03EC6F88B223D589FBEE09D3783C1461 B5Wk,
277,365,603 *1B4E40281CDE508D4FA849DBDB0899411357573E B5wsA
277,365,604 *1B4939A62F7F77378D5CA0CC0FCFBF922CA21559 B_;5X
277,365,605 *1B4037C563F571AACD7E1B71807B4846A7B6E83D B,5X)
277,365,606 *1B4752B73AF2E1340039902AF5E0F1B1BFA6E774 B5XqO
277,365,607 *1B455405593033244E84FDF5F351D1B07F9E3E09 B/5Y,
277,365,608 *1B4FBC9957925BAFDABE70AAA91EF2AD877A4868 B$5Y&
277,365,609 *1B40BC14E2E39BBE2364AA6FACC8D824B0B6DE7F B5Y#k
277,365,610 *1B4AC86A30B7F5C8519EE7AAA25B480A806A75CF B/5YS
277,365,611 *1B4B9B01432DC4CED7614B375C50B6272994E4E0 B5Z
277,365,612 *1B43FFAC3A33A43FB3556339B7540EDB6FF94B8E B5ZD&
277,365,613 *1B4BCCAD8B39005FEFF02C2925C384F57039FDC1 B5ZHg
277,365,614 *1B48587BECB867D9DA4D05E0EF0CDBC708558407 B5Z!j
277,365,615 *1B4E906844A3B923082C90CC894DB3DBE1D41F6D B.5Zr
277,365,616 *1B4B5F5E78D635C613428943401BCB5A7578D554 B|6=
277,365,617 *1B4BB514293012DB0DC0C138DF48581A2BE11C21 B:6;,
277,365,618 *1B4BBAC48DD1057077E684B20D0C70EFDB20C6DE B"$#6
277,365,619 *1B4864276B069DCAC3A88F8891E23A232462C0E6 B$:6"
277,365,620 *1B4B2D0E980BD62FB52D03F1DE4E0BC2C2C9265A B
277,365,621 *1B4320EA1C370534703BD111B8AA247B757D882E B
277,365,622 *1B4BD09B5F250ED5ABFD07876A94E334FE2B3279 B6?#!
277,365,623 *1B4180BC2756EBAD97FF0407D53D346BBA6E03F9 B6(,0
277,365,624 *1B49A5A7AC8BFE01AC1D107764237ED5CA465D69 b6026277
277,365,625 *1B468FC9A95D59087A635A5B1F42F701336F1F36 B607K
277,365,626 *1B4811F4BB3877125C09D69CB28BE77E8925A446 B60GS
277,365,627 *1B4595396595859CFF34F7410378FFA610346279 B60mo
277,365,628 *1B4A80657EAF658F6A935D109E871C477C28B340 B
277,365,629 *1B4AE4B7326DBC1C7392051DC1D9F7B2DEA970E1 B60&p
277,365,630 *1B448BB9ED6847997B3C647C86922EC1D5F1E7B7 B60U3
277,365,631 *1B4E390E49C21591B352A1BF5B6F686753A0EF4F B6#$1
277,365,632 *1B4154E1D904CD6EBE237675C4C927D759CA1904 B61Iu
277,365,633 *1B415B95840C0953628B2E3476DD83E8DD40D192 B62:O
277,365,634 *1B4F5C342AB8DE8B86DBF930FEC04DE5E39C6067 B62wW
277,365,635 *1B474D708CCC154F1C1A2E77A69EABC1AECDBBE9 B=-63
277,365,636 *1B4ECB8076A9F729DCA00755D96A0EB8DE83FD37 B%/63
277,365,637 *1B4C5834A2C2979E5AA6DC442305CA8C1AF2EB66 B6-+3
277,365,638 *1B4EB4DAD3B902025D7798925C1BE21EC15E1293 B63d4
277,365,639 *1B46784D67E70A82C55C1832AD850D6AE47C92B7 B6/_4
277,365,640 *1B42BFD367B43D1113D22EA62AF586BB2F29EC7A B64((
277,365,641 *1B47D25134FC9A31C1E863D55D749F01B53E9DF5 B-6&5
277,365,642 *1B4205EC07A8F7D65384FAAAF224E108D58BA77E B6&-5
277,365,643 *1B4387AFEF72B8AB460951F91391409E987DB48B [email protected]
277,365,644 *1B4C1D0830F4EA72AC149951C7B061DEB2713DAA [email protected]
277,365,645 *1B465097C6D81D1684A26F6E54325E530E402974 B%6
277,365,646 *1B4552DC7DEC7490A7ED3EE8830535BDBC6F5208 B66j;
277,365,647 *1B4498CBF83553C6E88690FC69BE50C42E0BC265 B6)(7
277,365,648 *1B4AAF96E9BA586326EEF9AB99FB5A9177E8FE38 B67kU
277,365,649 *1B4EEF2E7B4D305D37F9F9A46396D5BD29E3F542 B67wM
277,365,650 *1B49AFB44BB21ABE3EF408490EF4F9FC0975B542 B6"8_
277,365,651 *1B41CAEA16C16664F53BE02F712E9EF9E0DA268A B/683
277,365,652 *1B485689041BEB0CDE6DDFF3B861688B69803D55 B68mA
277,365,653 *1B4A85F72DFDF36908689FAEFCC71385FF9DB902 B(68W
277,365,654 *1B4C9C1E478197F45C4908A07CB1A39C8454ED2E B693k
277,365,655 *1B43133E908642C66ACBBCACDC000C521ADCEE5D B696X
277,365,656 *1B408DADC392C12B2A81E084469E25DE466D763D B69b3
277,365,657 *1B41380026308CE09194326AD0DBE2FF9D1CD2B4 B6&)A
277,365,658 *1B4617CAFE7312E676BA4D88C286747D0A206806 B6!;a
277,365,659 *1B490110DBFD12C9CA739E506AD96DC7ACF17C2D B(6A0
277,365,660 *1B451984B3EECED68EA1D8B1772B75254DFDF316 B6AH_
277,365,661 *1B486BE7CC5607A3E29C30745FB86E0EF42F93C1 B6Al
277,365,662 *1B4FFAB3E9813EAD0A0843300F595E30A6914A12 B6AQX
277,365,663 *1B4A5FCA59B2A4BAF9707E7187DA012A3E2BA114 B6(B,
277,365,664 *1B44CFCBD758E1DB0999EF985B6CEC143C0C8202 B6)b#
277,365,665 *1B457EEE05B8EE1428EE6998D7EEC455FB1CDC29 B6(ba
277,365,666 *1B497251E7DBC818880774146D2B4F5265BA61CF B6BGw
277,365,667 *1B460CD01DF0310262C0F6897D8BF135CC3C04A4 b6bkqk44lfyj
277,365,668 *1B49F6F6FDD322C6AA4914CDF6B4580AAD344E92 B6Brv
277,365,669 *1B45485B060206CB0A0AD2B2C6961725DE82C188 B,_6C
277,365,670 *1B43B15408D5D84E8026EE28ED900A1C9BD83532 B6CB
277,365,671 *1B4D778720230B455EA64DC23F75D2BB521D7E0D B6Cku
277,365,672 *1B42A8EAA733E7F50CACD194EFAFD49C74A9042D B?6D/
277,365,673 *1B45D04CF9E4CC7E52897F55CD0ACD2EF10B9935 B#6$d
277,365,674 *1B4CEC9A7826AF52901B3AD3FB5F2EED8401791A B6d67
277,365,675 *1B4B656988631BA539D3BE05DF960FCCD821648B B6DHL
277,365,676 *1B408DD4FD3F9ECD528C01354E5878AB18AF4EAD B6D"M
277,365,677 *1B454C426A401AD111164AC24D28FD5E2D39FC58 B6E7,
277,365,678 *1B487FB327CEFD795BA5D73245B4010166790182 B6)EH
277,365,679 *1B4D9DCD57272ABEDC6657F250DA8AED15E99F7C B)6eL
277,365,680 *1B4EA5ED2E63DF7163D3EA74ED32CC0236546E27 B6EM8
277,365,681 *1B4A5E6A67F5FBC927D8B9030AB2A6D787B987D1 B6EQV
277,365,682 *1B46D38EFFB63C88A550432378F7654459810CC0 B6eZt
277,365,683 *1B448735DB5A1F558C41E3A7EAACD2B891FEB7BA B6-f)
277,365,684 *1B410C74818F080AD237B88B4A5712F5E7939273 B6f(I
277,365,685 *1B49615D292D5D24BEFA48EF2C9FD6786A145946 B6.fp
277,365,686 *1B436DFE54C28D1C2B1AE068408CBE1051F1A913 B6fUV
277,365,687 *1B4488425C7EA9B9355054950C90CAD1F8E8E313 B?6!G
277,365,688 *1B4E5572D481268D5C31B3AC1F74192326F81355 B6)?g
277,365,689 *1B4B0A12B23F1642B53B9E4AF4221C5EC6C2773F B%6gj
277,365,690 *1B482F003FE33DDEAB13D91E70AE3ABF94A66F73 B6GRu
277,365,691 *1B47C1C57F3B02EA20EB9199FFE2CD7383DF653F B!6;H
277,365,692 *1B4DBC69405CEDD1260E50D57D44001FE44F27DA B;6h1
277,365,693 *1B439D3D2CAA70E0DF2B58815D49F12794522BFC B6H3h
277,365,694 *1B4971EDF65F79B11F0CA648074B094D6919BB42 B6hemp
277,365,695 *1B4E851600F8411CE50738FE1596A7CBC93E83CA B6HF
277,365,696 *1B46A08B48249639F3DDF188FA88EA8A9FE2C1E6 B6Hg-
277,365,697 *1B43C020E3E45284AFE74BC489DFD721068D8DFD B6Hho
277,365,698 *1B427D0084FA0B8220E0630DEF1E2DA28D01F851 B$6Hi
277,365,699 *1B4E1B25C0B25E94C1FC8A440F717270FF1653F7 B6hqa
277,365,700 *1B48A6774CA8A9E87CF5C7B290E12DB7C07B5E7C B6:HU
277,365,701 *1B41F77F969ECFEB5DF16B248D83B0A8696E6763 B6$hv
277,365,702 *1B4680509A21664832B296DFF99FDAEBF2D46D6D B;6HW
277,365,703 *1B4F43EB28B9095D9C5AE3969F8B22803E85B921 B_6/I
277,365,704 *1B45C31A24724AD55C0A9608B4D51DAD66919144 B6I.)
277,365,705 *1B43DB6A96EAA98066988881776970F3B8F37507 B,6I1
277,365,706 *1B4AA589C783039D2B913C03F08B07453F491D33 B6ihX
277,365,707 *1B45FD9C01B6403C6DCC538037C0E118DA2807FD B6iva
277,365,708 *1B44ED3015131094D87883CE83F822CD216F1446 B6iYP
277,365,709 *1B48E7401DAEE63F118E17AA5A7660F254BBF3BB B6j2)
277,365,710 *1B48DC0671DA3D7DB7B2AB6076C5E870DB35D020 B#6jI
277,365,711 *1B48D14CCB88039EE825CD28CFFA2F8ACF6D04BF B6%jT
277,365,712 *1B470FB51A8589A76BA989298EE9F0E8629A09DE B6k0
277,365,713 *1B43641319F3C33909725482ADA0A40260469099 B_6KO
277,365,714 *1B4A0BF8E781446690E91569AA0B62264746B6FF B6kYT
277,365,715 *1B49518C846EF5A71965BA44C3AA98850DE0C794 B:6L+
277,365,716 *1B487F7B22BA57A06E7E9CE8A277A2412CDF4D9C B6lDO
277,365,717 *1B4EE37AC2D000E48BC102C5C32CA6B98C57839C B6l.H
277,365,718 *1B4387200C4E63A0666E15C738EEB9571132E829 B6#Lq
277,365,719 *1B45252D38B441B2B8D32AE4F8928CA3CDA5163A B_6lw
277,365,720 *1B4BB41603619F4E3D475D5422305C20174F024E B-6lZ
277,365,721 *1B498265F90960F694EDCAC241F9830039E8F4D4 B6$m
277,365,722 *1B43FA14066DC883F5662F7797EBF6C87D630167 B6merkastell
277,365,723 *1B415AC0D446DBFFFC637A58279530C27E8540AF B6=mf
277,365,724 *1B402BF22D5C1681A98CB109B65BB7D869B8CEFC B
277,365,725 *1B43ACF965A11F4415DB63DA5BFDF67B10FA8195 B6nBU
277,365,726 *1B4BB08856DFA3030C5231ACE8F2999FB3DB492B B6nj_
277,365,727 *1B439232623DD79863E40331A3B9E44B03F4CD34 B_6NK
277,365,728 *1B4EEB2CE64A18CD7DE510E542A0ACD03B423F6E B6NX0
277,365,729 *1B4BA58B85B214E043CDFA8BAC52444B6A4465F4 B6:o=
277,365,730 *1B4D38A1008C7DD09D39CEC475E2614C9EEE6AEF B6(O0
277,365,731 *1B4634521F646F58EAE960CE34993C35A413158B B6oin
277,365,732 *1B497739D8E6EF90630CE2BE260969E309B6D2F2 B6Ot3
277,365,733 *1B4C52C000C0C43C9279217BFCC0F0D1681522AC B6oW
277,365,734 *1B433684AE9A854D1E51C5DDAD1B78B44C47E105 B(6P#
277,365,735 *1B40393086A74D578BB58D1DB8D338A3D1BD7DB8 B6p+?
277,365,736 *1B4F232BCED81CEE9A2B332AFD990A5263B1CB85 B+6pL
277,365,737 *1B4C9EE2067B1256860097EA1E6EDE711A4A383E B6pmP
277,365,738 *1B4B9FF8F225418771FF5EE3DB24146EA031C34C B6!pu
277,365,739 *1B4242063BF0C69B7C89A7776ECAC8A5BFCCD494 B6#Q?
277,365,740 *1B48E7ABEBE92C28F96C4272B30ABE4C4F17DDF3 B6-q"
277,365,741 *1B4305AFF3AD8612BF951468BBA2ACF7B8C7B630 B6:R#
277,365,742 *1B478B67A71E7A077CA22F77B77260659CC258AC B6r9V
277,365,743 *1B47894DBA58409ADD1C1DB93DED7F6CDEBD9FDF B6R:c
277,365,744 *1B4E83B4B1B3FC89B1C1E8C028C8139F4E6D2951 B6rQ)
277,365,745 *1B484536E34C9C7A6971714A807BB2B44232F481 B6rR5
277,365,746 *1B48216A3DE72DC0E938B7FB02D25048089CF90C B6rZ"
277,365,747 *1B4359A6515D1D73F68006B6A64BD1D300E2B747 B6&-s
277,365,748 *1B4D76819DA5C90551C66A74A1D27A1F089202E5 B6$sa
277,365,749 *1B4156178D62B876386CACA2759BE6A9CC17E5F0 B"6sj
277,365,750 *1B4D7160B0A381CBB7649F6F7FDE29839F87C059 B6Sos
277,365,751 *1B432295C8C2E3CF3C7C20CB29D0A6DE9C526BD4 B6T!#
277,365,752 *1B42F462501A3230AD59CDD256010A408C880B57 B6TC2
277,365,753 *1B49CEFAEAB48B8A77E860AF8C447E8882A0E6CB B6TEW
277,365,754 *1B442F12EE37BA8FBF7A20702FCA9BC909B43613 B6Th2
277,365,755 *1B4E7F4129BC7F9F3B9072DD2E80BE4506B7351F B6THREE
277,365,756 *1B44AF40ED8E0F8899F62F90F636A480D8960930 B6TMm
277,365,757 *1B4C2D869CBA05D7750068584137321CB8121682 B/6U=
277,365,758 *1B480AFD7F0F1CBB9B31552022854200F3450A7A B?6=u
277,365,759 *1B45677A7E3FD19ADF99654CF867924AC8D516DC B%6u&
277,365,760 *1B4E80C8E28A26712197A74624AFB4202C9C554B B%6u#
277,365,761 *1B43014B12E8C425AF8C05D940CBC001AB6AF822 B6;UB
277,365,762 *1B43815C0B5BE44C47DBB5D5B8CD183F33F25F5B B6UHc
277,365,763 *1B45AD50F564CFEF2035DD794BCFDAD6E34BF5A9 B6uOj
277,365,764 *1B4A500260564E85AA6BF13C9B65D96019D341F0 B#6/V
277,365,765 *1B436BAFD9C441D7EDE8E2A577CDA772414EF185 B6V$=
277,365,766 *1B496CB11ED27EB4A02922CB174BA628E968482C B)6v!
277,365,767 *1B4BEB281B93493922F48A2C7249F177934ADE64 B6v2w
277,365,768 *1B4347382A87BA173938E57DF66ADAD6ADF6E01E B6vAc
277,365,769 *1B4881C4BFBCC5F70FCCD3F3C6C34A459D5ED7EC B6VW0
277,365,770 *1B495ED7263306268B9EC129FAA196886B5EFD1D B6)Wa
277,365,771 *1B4ACF6448095E875836F87EB49C4BD47840873A B6-wc
277,365,772 *1B4B6223F4AC8792877F370AAF162795F664ADA1 B6wjr
277,365,773 *1B4CBE09E5B57BDB423DB902094348DD060BE486 B6WNp
277,365,774 *1B4DE760FCDA7737BC56EC05B096EDD68E38C4C5 B(6wv
277,365,775 *1B469F94E42CC18A4726D984734992384EC5AFEA B6Ysa
277,365,776 *1B43E18F6851A83CD463A378ABAE65E333AC4508 B_%_7
277,365,777 *1B4056F5953E670E0216F0F955B3470207045641 B;#-7
277,365,778 *1B4866B318569747B4CD79D29177B3A7E9FED057 B)_=7
277,365,779 *1B4A8B2F0F3526750450D6E1705929903DAB21A4 B7_(_
277,365,780 *1B43E372187AC22CBE8C5F06DDB398A44B5852FC B7(%&
277,365,781 *1B4706806885909200E4870A34E24E3414FA0558 B702&
277,365,782 *1B4B30E1E6A8EB495C716995A0E23DC573DB33F5 b70491
277,365,783 *1B42556891DE940D9E8B32435676E464B7062E49 B)"71
277,365,784 *1B4C2DD70BE7E0BE32C355C49D836CF6457BBAD7 B7#%1
277,365,785 *1B4C6C5DFC180D40C4FA999FA5E16D335EFB0A63 b718371304
277,365,786 *1B44024781A63019CBEC3260B7DDFEFEA8DD210B B71I,
277,365,787 *1B4C5AFE8938D9EF36FC072D75E98E25B876A5A5 B72/;
277,365,788 *1B4D5E16A15FAF76F86F14A29341C22CB8FCC3C6 B72c?
277,365,789 *1B435636EFF3D6739598F16EFCD9AD7FCF68E794 B=73#
277,365,790 *1B4029ED8C46975FB6A9914E8DBB90D0A0A06A47 b737500
277,365,791 *1B400EABBDE0E783EB484637E95DCB422B4FC3D9 B&73f
277,365,792 *1B4A2183111D67F7141F05C0AD9B327B00BC405B B73u2
277,365,793 *1B453491F21368D3A6BE79F0C34C9CDA834FAA9E B742002
277,365,794 *1B41708174AB5F0CFBABBA7EA0C10F479DA44B06 B!_75
277,365,795 *1B442BC9A075AF5855B681D3B8FD2A6CBB2BEA1E B#,75
277,365,796 *1B4FA53E27E3EA248CB8CB75C5EC099CB57242B2 B75We
277,365,797 *1B49EEA35E311F74E137D413A859EBA356C6705D B765w
277,365,798 *1B48BB4DA0C9C92F1DA1E2CEA5C7C67F2646D69F B7(6H
277,365,799 *1B4228998A452EC643629046071BAA5FB7E02B86 b773a0a0ed99574db8794283dcd767d2
277,365,800 *1B41DA2AB1AB4E5AF264FB313799FD92172F4381 b77a6c3e
277,365,801 *1B40EFCE9BDBD38174A51E6B3DBC0495320B73EB B78O/
277,365,802 *1B48EBF50331A59A9C8EAF268A504D464FD10FF9 B7=8Z
277,365,803 *1B45CD30F205FAA67E34CD46C9A58A77289A2D48 B7+9R
277,365,804 *1B4E077F4852456D0CD39664AEC68A4EA5DB3EE2 b7a3a68
277,365,805 *1B4C2CA93289C255E4B106B26CE35D704D7A7E30 B)7A7
277,365,806 *1B49A9AD1C70C83214BF43772BD39964D76C504D b7<aaa
277,365,807 *1B45309B6465E04C7DFCF6AF9D88334559833960 B7ApR
277,365,808 *1B4417F889A5D565AD42C51D4A1118E848CFB657 B7%Aq
277,365,809 *1B48FA3B5EB836D35CD845DFEC1057F5519FFABD B7Aqt
277,365,810 *1B4CC5EEA9AF4C883D1E6291271947634B297776 B7=+B
277,365,811 *1B4EDDA767258FFA903022D55B027ED92C41A59F B7B7i
277,365,812 *1B41D9982D24E55C4C6572DA927E0E7EC653168F B(7bB
277,365,813 *1B47F1BF9D53C8B4464CE38EA1E1EFA5BF14FA29 B7Bki
277,365,814 *1B45FEB2113B6A0DF1EA64AF63B4E6F3218D6719 B7b(N
277,365,815 *1B4008963B5BF74CCA6497C9AD10AD9C36192A23 B7C0Z
277,365,816 *1B45D6C3FF90A8A258E91B1AB15536F8438EDB59 B7C6&
277,365,817 *1B4B5AE5BA948DD82E4381603F5CC7A0AE5A829C B7?Cd
277,365,818 *1B41E7CE888D11D437878F6F93D404843F356AD4 B7D+$
277,365,819 *1B462EBEB33F777F27E1ACD083E4BDB68C11BCE1 B,7d(
277,365,820 *1B4F31C091DE6E037A6D9C19751491DCD4064D31 B+7d)
277,365,821 *1B4FEBD66D4B96E6D3F39CD9A4AF03942B173E7F b7db2264-f2f5-4cbd-8d06-5070fe8f2514
277,365,822 *1B41B34B28AFF891958FD6DE3227956436F30360 B7Ddm
277,365,823 *1B40F078B05628D9BAAE91FBAD2C9EBC0DF52ADA B7dLl
277,365,824 *1B4834188B5936E9FF8E515E4699E261B071FFE0 B&7Dt
277,365,825 *1B40C297397ECF625027D0EF6C8682667D1128C3 B7dYW
277,365,826 *1B453FA24C7C056DBE97E7EDE9E53AD373C7B6B4 B-7E
277,365,827 *1B4AF7DE439DE9DEE63185DCA533E4C81B2F7EA6 B7e5H
277,365,828 *1B49CE21BE842EFC1DBE577867CBF11E59793D49 B7eM?
277,365,829 *1B42CDE07836A4897AD70CEA8150E711030BAEA4 B7EVW
277,365,830 *1B4EB5EB3CDEED430574B76853EB5E920A4AF446 B7Ew
277,365,831 *1B442FF4095E82ACBF94CDE47D62C862EC55FDA5 B
277,365,832 *1B46BD104E009D172AC4D9635CD998E294978A4B B7f##
277,365,833 *1B474BC583B53E170BA9DDB2FE18F6950CF469EE B7f,C
277,365,834 *1B417738FAD3057F0911A1745F24963283902341 B7Fit
277,365,835 *1B44EFBB3A19F924C3F3788DEE4905E547497BA2 B7FOk
277,365,836 *1B4E5A34C25BDB18035494FFAD074DD621B1214E B7Fql
277,365,837 *1B4859DFD2159D710A4BD528A96938FD79D97CB5 B+7G#
277,365,838 *1B424EFFF89BAB8490BAFD404DAED70AB3DA391D B7G&:
277,365,839 *1B46500E8CFBE06A06C6B77166F3F6E341EC1B33 B7=+g
277,365,840 *1B4D08D4C0935FC947D42B3491C58FE6A47199E3 B7GCc
277,365,841 *1B4A521A1B2EAD717A7A67CDEECC0FA2313035C9 B7-Gg
277,365,842 *1B4C75207921F75F382176FDFC7A9ADF8C73EBC6 B;7Gh
277,365,843 *1B44F883966FF95C31C437FDF074A4D28C9CE4CA B7gU
277,365,844 *1B487F2476A36D095D27BF4F8AB36ED94079F740 B7h,_
277,365,845 *1B494299B204C4579610D44D80FF07051D1F46F5 [email protected]
277,365,846 *1B468E80FC4061E9EEE4EEB12E9B93864B9BCC96 B7&Hn
277,365,847 *1B4B658178CCCB6EF75AB63134DE128B8FEC1616 B7hRV
277,365,848 *1B42FF7FCA871FAEDD41FE5E3779B99BA8FAF66D B_7I)
277,365,849 *1B4908CA79C0084698AEFC966FBC49C15015D27B B;7
277,365,850 *1B499D7C96C9F9DFD6FE929BDED9EB26B13B2552 B7I16
277,365,851 *1B48C722A5EEA395127B2FD52EE150A30292433F B7I)C
277,365,852 *1B4932CFD1143F7D1D8815917D0E7DC56B8988CF B7i+C
277,365,853 *1B40FD35C1FD63504846227C6C1F6EA30B6C9C2F B7ICEBABY
277,365,854 *1B45E9E054866E75920B920BC78F9F6B2E10A1E4 B=7Ii
277,365,855 *1B43C54ED44C3A4887CCC522E2E4024C4C12BAF9 B7iIr
277,365,856 *1B4CA42F0E6CB7C8A641E20DBBAAF188C29745EA B7,,j
277,365,857 *1B45F2C2D8CB6E6535929DB319160992D86D14CA B7j.m
277,365,858 *1B43B6496EFE9A3C909035081A2D665DE30885F3 B%7jO
277,365,859 *1B41066AF2700844715E3FBE5176B5DBECB4E654 B7;K$
277,365,860 *1B4651344355E7F3DDF7FAB61A81D8E6046DF4AC B/7k!
277,365,861 *1B42944369C47810A79BBAF09838A12F7D62FB31 B7k;,
277,365,862 *1B49A477A09EE500B4FB96A11ECE6D4FAF32B726 B7Kf3
277,365,863 *1B4A1F78D2DD64677DDB9656F6FDFB8C8F96A1A8 B7KTI
277,365,864 *1B4E8BA4FAC7BC9491E398C10B179A47845A8AB3 B7KTt
277,365,865 *1B4FCFCEB9370BE70850A4FCBB5AF6919B461942 B
277,365,866 *1B4C1F16887E75CA30E2B2E828301B45B704659A B7l/K
277,365,867 *1B4F3463D37615B2D0D2A7BE75E4590CA1C998CF B7LnO
277,365,868 *1B4DB02BE4E2DFE271C99E273F631FF137FD9513 B7lWr
277,365,869 *1B490E2A90C6B573E177F6A24C43AADFB26FD817 B7_+M
277,365,870 *1B480E4A96750E6E953F8D61A4F852DA36E6D4F8 )`b-<7M
277,365,871 *1B451DF9B610679214DCCD8D59D962598599EADB B7mEd
277,365,872 *1B47CEA3E8856972F0A9750BCA658EE6E88C521D B7MK5
277,365,873 *1B49B5BF196A76DC11BA8A5B6556A951232D9B6E B7.mZ
277,365,874 *1B4F96BD253364CDF2CEA63B31819D5B2A331313 B7.#N
277,365,875 *1B434EB3E0F9681A9C1FE361289178497B584C1E B7N?"
277,365,876 *1B4D3CA6E53E6EED9F4A40E850D0997C94B9A39B B-%7n
277,365,877 *1B4BE0EBC4DAEF4E56536AAAC81FE8455B5420EF B-7n;
277,365,878 *1B401DDA45E4C46032951C709E3C5F410C6D9976 B7
277,365,879 *1B4F81AD08D27329676EFFFD12FA2EE56DFE0F03 B7NId
277,365,880 *1B4F692FE236DC5BDCF0BFB222C27D142347F124 B7N?m
277,365,881 *1B4335E5ECAFC78CA476699648941A5E97060A37 B7nSi
277,365,882 *1B4DC6919FADC29F1CECF08D4FFC01EEAA1A62CD B7O%=
277,365,883 *1B4F1E11398E09AECA875BD8A2D4F3456A490259 B7/o,
277,365,884 *1B4A5681E32663821D4E113E9B299050FF0EA02F b7o-
277,365,885 *1B4889FB381FE0F687041D2724D6321E7FDB5B22 B7/O1
277,365,886 *1B45E164E1D7A2A21F090210B0A684E190BC8905 B7oac
277,365,887 *1B4F011D636E335126658610F72EE1BADB84A378 B7OhU
277,365,888 *1B4142B078D77571DC01C1822ECD57599CF2FE2A B7#OU
277,365,889 *1B4E845FB53741DF739E47076AFEEBC3C6F0C2DB B7&!p
277,365,890 *1B429A6281EB0058EC4EA848D7C5DF2353EE1B86 B7p-4
277,365,891 *1B44786103B9A561DE54EDB1C1DABC8C25DC3FA9 B7Pbs
277,365,892 *1B4ED0C644331DBCCE8B80E54305E79FA3F2585F B7p;e
277,365,893 *1B4F1E1B42AE10E1CD9C1963F988FE1B0453D648 B7pMK
277,365,894 *1B42AD8FA92F0DF8F5A01392A4BF312F2CF625E1 B7P
277,365,895 *1B4ED4466EDAE389AF3F4E019FE0511F7EDC9CC0 B7PSQ
277,365,896 *1B4AC45637B5760AED15ED6876201D210AD7E9BA B#7pX
277,365,897 *1B4675FEE4E50FDB0EFFCAF18799EF985E63CD93 B7q"7
277,365,898 *1B4EB1AB490661FEB75DB249D4A7A44E892BFA09 B7QF&
277,365,899 *1B4EC6A76F82F3CCAB6CFAD6BD471B0EE34CC916 B7Qjg
277,365,900 *1B47B8E3621AF2DFFDABA9B837E88413FD99249C B?7qk
277,365,901 *1B4AB2A84C2C39F10BAA3276A086BBF88531D5A9 B7+qk
277,365,902 *1B4934FC1D0988E6C249482A4F4DAA90E48645D1 B7QMq
277,365,903 *1B44EBB0243EDB2FCE07F5D51DEC2341BAFC3F8B B7Qn&
277,365,904 *1B4A6902D724047D09A16B2D34CF469EA610B344 B7q:u
277,365,905 *1B4DE6F5726E8ECE00C11ECE59DA16E5EC12CA2A B7QwE
277,365,906 *1B42CF17DF6EE7419799FF20B90F1C793DD567D8 B7;$r
277,365,907 *1B45D400C7C611B781557F9DBB1F2776592EA4E6 B7r_7
277,365,908 *1B4DA058361BBB6EA581D08D3C0149D9775673FF B#7Ra
277,365,909 *1B4379979E0B3A1BAAFA4555BAF869F18CFE7F89 B7R=B
277,365,910 *1B4315CB225D2F685DF22BEAC37CE8248C751C94 B7RKq
277,365,911 *1B43DE8F74B76F266B07CFD7B45855B7367DBECB B7s0;
277,365,912 *1B437BBCA385CCA2A92B7DF90E65B81FCFC76968 B=7S7
277,365,913 *1B4BCACE19EB97D9F4326C6C47DE864F32953C71 B7S7a
277,365,914 *1B42D3F889DE9D24BD37F14D1B09692CD02FE128 B7Sh%
277,365,915 *1B473CC99F51DE09A5604686060EDB27E37903B4 B7)Si
277,365,916 *1B45B26669658E76B6FB1098AFA0534589BDB81F B7T$8
277,365,917 *1B40B239FA8C48B0507F55CDEB2E03F6712CDDFA B%7tA
277,365,918 *1B442B56A56AC5303DF034E78CEC99D9DADA467D B+7tk
277,365,919 *1B42EAEC416A06834554E50375C9C5B2E9ED8364 B7TM/
277,365,920 *1B4869E161732892C55732123A2AFA0C6EC3BD08 B7TQ2
277,365,921 *1B4EB285935500F498FEB870FF81FE6E4F9DE20F B7,TW
277,365,922 *1B4225827A032232564EDDB90FA7270FB1299B36 B7.UA
277,365,923 *1B4D4F83B29AA9EA68D4DB36E9BEDCBDB459F62E B7u
277,365,924 *1B465BD3AEDE9117D416A6A92250B688D37CD5D3 B7UaZ
277,365,925 *1B44939B29BCC4EFC90DE37BF05A4E473251A844 B7%UF
277,365,926 *1B4BEC6F2A43626ABB86633A6FDE7206B7CFDC3F B&7uO
277,365,927 *1B495EC69D85AC99BA7B7173DEE18926998F93B7 B7U%p
277,365,928 *1B4B726AB964E952DD2E669E0679EA890C768BE0 B,%7v
277,365,929 *1B4E55CEE378A0A8444AEF6FB1BF2B11325BFAB6 B,7v4
277,365,930 *1B473F36E3537CCEA7A31B25E258A8880DC68B30 B7V?H
277,365,931 *1B49C2A9D47E24B7FAE2D9843EFCC85B64CA26C7 B7viX
277,365,932 *1B45A30557D45EEB69CC5EAF6D104B539EB33B9C B7
277,365,933 *1B429054D19A8D73EBEFBA2DC828C9F5FD0C48EC B7)W(
277,365,934 *1B4FDC66F2419FA06DD73FA35DFB41B63C211AD1 B=7w?
277,365,935 *1B4FE359E436A69232075EED24C509AB89F4E2CC B7wE6
277,365,936 *1B4FB654E33B6F710B13EAA0EFB4BE8DF3CA7477 B7wi/
277,365,937 *1B451AA62E1E31C5463747EE15CEA29088262ABF B7wP/
277,365,938 *1B4B7B3588C0202697BDC3489860EA6E370344E6 B7#Y#
277,365,939 *1B45DF26B6F87A2640AF34C932C73EB58C60AC02 B7#Y
277,365,940 *1B409324290CCF47E145655C55A7EB4CAD9AFBFF B7Yg+
277,365,941 *1B4534FA9E09408F7D4811B0FD28BB769BB05FCE B7YSs
277,365,942 *1B4D1A6BA777D016FF1A1229FD3B7FD55504CFB0 B7(Z=
277,365,943 *1B4A31A10170F918038CCC58D43C4BD1CB9ADADA B;7Zb
277,365,944 *1B47DD169EFADAF248029935F92C66C86BE4F05F B7Z%h
277,365,945 *1B40DBD7054C72BB0A42FF427C83C9869D645084 B7ZP?
277,365,946 *1B4609B39B889AB1CE0C515466D51A225E9BE19B B7ZRR
277,365,947 *1B489BAC74096EAC2EC26F925BAC4960DF3D00C6 B7Z=T
277,365,948 *1B4813C1C1BCC0B68534F9A9E82ECBA5D7A49F6D B_8??
277,365,949 *1B4936862AD35F1EA5D6F475D99FF2BFD13655B5 B:_!8
277,365,950 *1B4D1CE7A3E21C449420C70C4E5EA56CF206D7F8 B#$_8
277,365,951 *1B4D932A95A43052D6385D1BBB2073FED7CBDB51 B%-8#
277,365,952 *1B4C186BA195C51D0704839CE5E1A6A91C5D2873 B
277,365,953 *1B4777C2A2E47AE8F468775C09F0412DAFFD977B B8(=+
277,365,954 *1B4E9FD82C2D50ABC2ACFCD1191FD50F20D09939 B8%@
277,365,955 *1B491549EA358A9A51DD45163A276656E0D02CA5 B8
277,365,956 *1B4961FE6FB87AE6A9ED0F22C66169C1BF01EE74 B803FF
277,365,957 *1B401A87B2F52100B637AA1CC3D7668C617AEE12 b80768
277,365,958 *1B4455CE9868636A0161BD02CB8786D95A39376C B80/Y
277,365,959 *1B461C43AE6F857C38C4409E07149ABB0EC9786E B8113
277,365,960 *1B49850ACFF3F8BDC88CBBA44B6B27CFA2669614 B81k(
277,365,961 *1B4CA2F616F2C93B2F5F7187626E80B6DDC3F5D2 b82718271
277,365,962 *1B43454657EB7BFA9ED9ACB2832F5C47B38312A1 B82n7
277,365,963 *1B46C1845F3F13DE1E137825B3C9C6E253D638B4 B82T=
277,365,964 *1B4B4DF622C8B07DAECCF8D66E463432790C99C6 B84C,
277,365,965 *1B4D23B687540079C2E40D0189A4D84331DE06F5 B84CL
277,365,966 *1B4906CD9C7560CC24D1A2173B217F2C2DF498F3 B8%4i
277,365,967 *1B4357B67B738115598E3D61A9F474E08C203BB6 B,853
277,365,968 *1B4F407E355DA06764BC697347A9F20A6BC6F26F B8580
277,365,969 *1B4981DAFDADF8FC1AFE25BB37F5999352FCCBF4 B(%86
277,365,970 *1B42C55083CF1D49CC6900C7BC1B4E4822838E86 B8&6/
277,365,971 *1B47D1919430C369E740F5A3A697B129EA7BF6C0 b86164
277,365,972 *1B4C97346E4767FBA57E8C71ACDDE9629788F57D B86OE
277,365,973 *1B4CAFD35D8F06708EBB11D16F0CADD36DBF2611 B+-87
277,365,974 *1B40263A6259DE94CB6FB59A487F265EA429377B B871k
277,365,975 *1B4208640C7C7193F4FE7564D623FDD4AD5ADE35 B877d
277,365,976 *1B4A0133276FC6FFE5A8A96CAA456E4ECF1D9D4A B87=B
277,365,977 *1B4D453319562C6D34E43738F981F5CF8E883448 B?87D
277,365,978 *1B41AE477F04E60B135C17737B6D7D33FD46A5C9 B"87h
277,365,979 *1B422C3F49DBD4DDEC4FF25981D7067C5DAA75EB B87Yi
277,365,980 *1B4604182776664AAA26B419E0256C3996912C51 b8801f1b-7b1f-3667-b50f-5bae12f1eae1
277,365,981 *1B4C75B79208DE4BAF639DC5CD434948D79295D3 B88b5
277,365,982 *1B41A61E2061F74718575BAA415252C2C5119A87 B89c?
277,365,983 *1B4EB71784E8C51E3F1D0AAFD4C8D2C8777AF764 B89m$
277,365,984 *1B479C89435D226C59A37254EA466B6384235AD4 B89w4
277,365,985 *1B4CE832E8E5DCD606D7466F29C6E4362014E304 B%$8A
277,365,986 *1B4DC6C5F425D78291CFE40B6BA2AD95C61F59BB B8(A
277,365,987 *1B4FEC404795C7815968B88F6373EE59ED41E167 B8A0.
277,365,988 *1B412E7BFEFB8E8B8CBC411172D1625F37C6A6D1 B8A7A6E2537F35BEC1257313004035A0
277,365,989 *1B45D5E30D0E64397FA9E2B5D7EE14FA40A9C4BD B8apA
277,365,990 *1B42E7A30B3FC22EB477D9A2E7A6143DA0E284B4 B8B_
277,365,991 *1B4319C7E63BBEEE227B2E3AB61A36437AC8364F B_8b_
277,365,992 *1B43EC32E679E7EB1DF928099B80745BA5D149CE B/8b?
277,365,993 *1B478F16D703B5F1B91EC32EE5C1BB4BA74F05D8 B8&.b
277,365,994 *1B4E703B2B85B4CFFBCF9A0C9CFB3299280FEE5D B8Bg3
277,365,995 *1B4797F779ACCEACBADCD54BA7BCE41C982BF855 B8bGa
277,365,996 *1B414D4103E165E649A4A771B774841AB8DA2828 B8Bl
277,365,997 *1B46A5F996BDC542BF3DBFAA03EA78164142B690 B8bTl
277,365,998 *1B4992941896C46181CB673EBA05CB68E29350AC B8-%C
277,365,999 *1B4B6538CF0B6B786C876C98AEE7F6B90E67216D B8c5-
277,366,000 *1B413FB4B133717D8F66CE9098D27FEB77A68C47 B
277,366,001 *1B43263DBEEA9156ACC694968EE27C1982D6B4F4 B8(cX
277,366,002 *1B4B8031DF7D45E64E1CDE0341B26C388BB37E52 B/-8d
277,366,003 *1B4CED50A00ED804F145156C85243A269EC9104F B#8#d
277,366,004 *1B4EC72B5C1A8E02968AFF2A46C9240C78D767F2 B+8dA
277,366,005 *1B458227ADADA45C3BE1C8D6DB7754987038737F B8dG/
277,366,006 *1B47E4673324874F33CA1EB9F124992598C45E9D B;8e#
277,366,007 *1B444AADBDD34BF36CDB75EC9905254B8599CA55 B8e3j
277,366,008 *1B4B86C4E8BDB62E7BA8D36C9A2D079E56F1E885 B8EhR
277,366,009 *1B4D9C6DD2E8795CEED21E923A279715197E25C6 [email protected]
277,366,010 *1B49F5C35EB5FEE34E753FF4B6DB563F55D83B24 B8eoZ
277,366,011 *1B428C6E9DCFD6207E424C94D2AAF7738079EB1C B8f8h-9d2ry-wtrb7-vg7mw-95qm6
277,366,012 *1B4202E2799D76C5A30A56829A98A09F9A7AC36F B8&FK
277,366,013 *1B4E1DFC9D1B84CFDE40898C9A50EAFC734B6D11 B8#FK
277,366,014 *1B4193CC94D80D7E4F1EE270943A10A45188156A B8/FL
277,366,015 *1B40CC2D52D38A3B7DD3A22AA75CC5FDA076DC97 B8FN&
277,366,016 *1B4ADCE7F20DAB20B35FA1E2CC54964EF16008E1 B8(g,
277,366,017 *1B4F0F45A01512C4ECA4A09B3D43B051DA321FEC B8GP5
277,366,018 *1B4FEA0759DE20F001C70CA42C853726305EA74B B8$H"
277,366,019 *1B4580F91A8CFB59DD4FE99DE6AEAEEC5D37EA36 B8%H&
277,366,020 *1B4B0CA9107C3FD7A9805798D5950C018B44D082 B+:8h
277,366,021 *1B45F36084E4D7BEE7A95AC045DD2D7F3B934BC7 B8+/h
277,366,022 *1B4AE076EC233EE9194C141BAE1DC715159FD4BB B
277,366,023 *1B49571B295E901C5D2B9FD442E449A11E00D27C B8h4i
277,366,024 *1B4C665C5ABD2F04CAE5B479D7CB3CF02C4D0A60 B8HFH
277,366,025 *1B43A99BAEF16A480D80CE261B2784AC1DD71BA3 B8hMU
277,366,026 *1B43A8374281D388A4203C376D6D923932295373 B8hSX
277,366,027 *1B4CF2C1928147AC1FB7FC9012D0B9425A684089 B8HU;
277,366,028 *1B4A8479EECFE9999D41DAFD1259DB24A5987F84 B8I
277,366,029 *1B48F3D8FE259CE7A9DA221A3CB520084BFC138D B$8Ie
277,366,030 *1B41C3181FC313B46E4158C15F0680CFE7EEE9D6 B#8j_
277,366,031 *1B4F37535E6BE9FFE685F1A6A5857306ECCA155C B8)j_
277,366,032 *1B43B29CEDAB13164AE7599463BDDAB727A8AABC B)8k;
277,366,033 *1B43CC18F533DD7814779400439D9B7B8DF77D30 B8K9:
277,366,034 *1B40F776751B238C5E99BE1967A5085C00F38AF9 B)8kd
277,366,035 *1B4C0867FC3F27A62794235DE5A72777D015638E B%8L
277,366,036 *1B48C82EF4FC150F90792117D3DB39104C016346 B/8lE
277,366,037 *1B4FB6998B59B09A4C2595C869F4D91FC23FBCAA B8LH6
277,366,038 *1B4489F54FA52C5DB7220AA68EA9828DB8B32AAA B8Llj
277,366,039 *1B436BE1598A59F89EEB588B826F27C1C4F49A9B B;8Lt
277,366,040 *1B4B657E0B3596F9C7568365604B68DA2DBACAFF B8L%X
277,366,041 *1B4A314462C9BE5C44FC3249CE6E1126CBB57537 B8M-0
277,366,042 *1B49D3345F13906FDDFF94F3F849C846C7A48DE7 B8M4l
277,366,043 *1B4211CA05B209A25AF9B572F6F2A222AF2AFF81 B=8mb
277,366,044 *1B44D01BAA2E96F59F66352C937EB045E5BD1D9B B!8Md
277,366,045 *1B40CD34E4824268138B8EC44E0C5907826313C8 B_8mE
277,366,046 *1B4389A303B7D3F90BD14EBDC2669FF2A9933518 B8Mwb
277,366,047 *1B42113D9A3D4D9DC14ECC3F6E8ADF49F5092FE8 B,)8n
277,366,048 *1B465C2A385853B79AA9A19B5BB6B3982E56F2BE B8n?8
277,366,049 *1B45E2EE5F69220B8D03A646E94DAF60FDB533DE B(8Nf
277,366,050 *1B493A30DD91DD322AB2BDC80FEEA4F0ECAA9502 B8nL#
277,366,051 *1B456AF266871C1A8463D98D0F1B13E195E05878 B8Nn)
277,366,052 *1B4C308AFBCB531E6B35DBAAEA3E676A7512DAAB B8noo
277,366,053 *1B47906E99D6C10E6AF31A899E836124223D0A6A B8nR.
277,366,054 *1B496D65E910022CEBF30DD2F625D0C6A853E554 B/8Nu
277,366,055 *1B462940FDFAD35D5FC775D792D7CEA141383FF7 B8O/+
277,366,056 *1B47732D5736FACA46A83D75D8DF9B46BB1592FA B8o5G
277,366,057 *1B43149233EF240B5E9EDCAF163B1A83ECFEAC86 B8o)d
277,366,058 *1B41A77960C6DFFBA9D884CBA382F588E790C1EA B8oeX
277,366,059 *1B45FCE380BD2FD20293A19B0A08A0D70739DAAE B8(;P
277,366,060 *1B47964E1D3C57AA4A7A72EE2F13D929CF2EBCD8 B8pmr
277,366,061 *1B4C3EE44CB93DD5D9B54E345E88FA427A456704 B8p=t
277,366,062 *1B4B3AD68912C05A56931B0E068BBA10B2BD67FC B8Q7f
277,366,063 *1B4523812C60A0A6171B2ECEF5CA42FB302E4B58 B8QA,
277,366,064 *1B4C17A133FFAB76184C06A8667027B68A04CC2B B8qn1
277,366,065 *1B485AB39501BB5FC03338C5BEBE9ADCF3C2E673 [email protected]
277,366,066 *1B4C7C10AFBA8D865B3B234ADB766EB0822D5A81 B8R8p
277,366,067 *1B4FC8DF2C4529CF1C530AD2254AF16C0D0203A1 B8rbc
277,366,068 *1B4F05B4945FADC43265E378F9921ACADFCFF021 B8RhK
277,366,069 *1B46EC78D46B45345F325B4C841788A3CB519AAE B8Ri
277,366,070 *1B44B90470F95F4F4D7CCB69F48713A686BDFC32 B8;Rl
277,366,071 *1B4CBEFB1C8831DB9912BE7840552FA76A557DCF B8R?p
277,366,072 *1B4CAC8B393D1C4D1AA6E4EE1EBA4DC502CBFDB0 B+8RS
277,366,073 *1B4B5A9A8A82A992C0E61C7593BFDF26030867EA B8Rs%
277,366,074 *1B4CEE273268202F387DC62BA041AAFDA228E5C7 B8.S:
277,366,075 *1B42C86A00E821FEE3065F2B0BA43E81D0477B59 B8S
277,366,076 *1B4D12A434D7C95D4715AD076C06CE81239126EE B8
277,366,077 *1B4D954F068DDA1074B8A826F604BC0AEAAA888C B8sh2
277,366,078 *1B4EAAF8C6E0867124F6CD81367AEDD21C28B81B B8sOt
277,366,079 *1B463BBB01A56B621976615B7437A3BF29C747D3 B8sUh
277,366,080 *1B414F0AED0DF88311335C1B9F87544E5EB31C47 B++8T
277,366,081 *1B40FFFCE6DB90494873A4AF7DBE5EA20E932720 B8tjv
277,366,082 *1B4CCB878F3AE3C4FC464308EFADC4B42B019E7E B8Tnl
277,366,083 *1B42D240926D3DFC63C54AA4B858C58D81B6D69A B8)tr
277,366,084 *1B4396C8EEBD0057160B6A6090475AEB896D6829 B:8)U
277,366,085 *1B40DD7571A86B1ACCA1C30A4002476054155454 B"8-u
277,366,086 *1B4756108704ACB5020B297665B28104D9B47692 B8UIG
277,366,087 *1B4DDF12AA385335E82CDDF24E721418D970B959 B8UK"
277,366,088 *1B4A7CE8622816939285D3187863FC11A4B99A8C b8ultegra
277,366,089 *1B4D1B5C428F761708BA2116C2DB0AF3BC9CA9DC B8=Ur
277,366,090 *1B47A77F0E4F912AB08BA78B8CC6C403C0646F08 B8UvH
277,366,091 *1B4EFC897378CA98DFA1F353E0303D531860F05D B_!8V
277,366,092 *1B4C4D02768C52BDEE8E978B17D91FC1410DFC98 B/8:V
277,366,093 *1B4998CF21970888D53FB5D4B156E7C35DDCF9C2 B(8%W
277,366,094 *1B440A4E804171223F975DF3B94DAB74C875458F B8W8Y
277,366,095 *1B4FC0DD7B906E124B64D66D2D129F22C586A0C1 B8wI_
277,366,096 *1B4C89303C2945440B17B22CBEC9E5A384A87ACC B8WvF
277,366,097 *1B47E724BF16CE0F89519F0004C2CBC74C492E51 B8X8I
277,366,098 *1B41E62623F14609C4A2DD98249330F644B646A6 B$8Y-
277,366,099 *1B487BD2350A5F859E6FF3A89B06727537E4DEC3 B8YhM
277,366,100 *1B4D61BEEF3A98AC22077239DBF09739ED6CA9A3 B&8ZI
277,366,101 *1B4FC208318CF9A36BC742C3D85144E5925E3F1E B8ZO"
277,366,102 *1B48869FDE1BB05F578EEA52C97FDC9FAFBC3DD4 B_9
277,366,103 *1B41563DF231EC44021F68D06395328154895A48 B!;.9
277,366,104 *1B416D8EEF14B02DC2F83BC7EC6B696AF2330F3E B/9:
277,366,105 *1B4805F0E8732CA4DB38F50AFA8B3FCC93275B6D B)*9
277,366,106 *1B4046BD1673711AF3C794D588C4AC3BD36E6ED7 B{9<
277,366,107 *1B47A93CF9C3CBEC236C8CA9AD8D3BE4126A5D78 B+_$9
277,366,108 *1B490245C7FF81768C90B5A41B4086181632A995 B9,,;
277,366,109 *1B437789A4B623606FB05BA2C34A92B347DDFB09 B9%);
277,366,110 *1B4BBD01652423E01A9423315EA4C20CFB70F10B B&$90
277,366,111 *1B4689F774366928D3F72B493851CADEE8870F46 B9(07
277,366,112 *1B4E80986A951A386BEECD63AAB33BE8E8A3470B B909G
277,366,113 *1B4D3623B06C2FD4E78D5264C9964AEE15DE2CD2 B.90v
277,366,114 *1B4109104332C9C1EF54A93F398CE743ECB7AC58 B9.1_
277,366,115 *1B42AEEC29DB72526E1CB36EF4A9F965A9E41EEB b910204
277,366,116 *1B425BCB08F0FEE1DC95DBD529F005F7A04C2758 B91ar
277,366,117 *1B4C8CF1F368B86E3852337C196F9655B37F9845 B91nu
277,366,118 *1B4FC9936DFE00D3CF7676589536839186A74F21 B9/1W
277,366,119 *1B416B4CCC5D6E8C9E2A51829165CA5190B29B5A b9224
277,366,120 *1B420E97FB54D6BC8017A1BED3B7649773787E2E B92aQ
277,366,121 *1B457492446C25E4C7500AB36CE555E3984F76D0 B93.,
277,366,122 *1B4556F29CAD2E810F2B3F3394A3353F920D3391 B93LH
277,366,123 *1B4605E440A6B549C56ABAB0238EF6D643FE73C7 B9#3M
277,366,124 *1B46BAA1F79BCC15108164836596D38117BFAA26 B93m)
277,366,125 *1B4001D5376813AA479EB25FEA43304178C923B0 b94254
277,366,126 *1B4466BC7638EC11693C6B711A21A2E5432538E9 b94532
277,366,127 *1B4D18DCFF890F68249923837D9B641FD6574843 B94H,
277,366,128 *1B4FD9D1A03693C9AFD5F407578487D0C9D437E2 B95?"
277,366,129 *1B43A638E5EF3F765A8FEDF6B535860A4E9C70E5 B-95M
277,366,130 *1B4424B9905E7FB84EE191BB06CF7CFB9193D540 B960_
277,366,131 *1B4E794F3826F386FF77403F949AFF2B87FF34ED B96La
277,366,132 *1B434C8AA5900317FE7DB087115A8D2AB6EC6F88 B
277,366,133 *1B4E2C94F000F12A40CE18A002BD02BD2982771B B97Cu
277,366,134 *1B458F2677E43FFB45FF797F2FCE3BF05FE3F50C B9$7U
277,366,135 *1B4695BFED09CC3819688906F27F20251B2AE7B0 B)98;
277,366,136 *1B4AB700472F8F966B937ECF140EB1810EDF4C22 B9(8i
277,366,137 *1B46E2A79042B3184FAD2E10B0483FABCEDB5AAC B9!8K
277,366,138 *1B47DA2DD967EA1932672DE5F772D415BCF3FF4F B)98q
277,366,139 *1B466D945F702FBBDFF51B21BBD59B387FF91FB6 B99#=
277,366,140 *1B4E7D8B3C2D483F6C40CEB68878EC4EC35F46C7 b9965ff9
277,366,141 *1B4F8AE5BC225789F123A4D2FC3525625008BAA3 B999H
277,366,142 *1B4A9B7B8F274EDF1512A460CA090D5A1AD89D88 B99i+
277,366,143 *1B45E25B5823366430DF30B727B2AC987D9872AC B99lm
277,366,144 *1B4A61362D730815D2D16BB0CA0DE8A383F10822 B99pC
277,366,145 *1B4387E6CD9BFA6E7699535B3A093C35E2466E38 B.9a,
277,366,146 *1B4A7B86C17B934526E8C31AD61D868B7DF453EA B9afC
277,366,147 *1B4B18B0A9E3784AA09006F1C5A4576D0D984D8F B9a$G
277,366,148 *1B472EA41998D332AC6B48941CB74A46F448C779 B9_alamanek_ar_c
277,366,149 *1B45A76D3378401B698C9D3BC10A0728C3788DE0 B9AM-
277,366,150 *1B4E19D47C14390AEC827273DAF501930E2170A5 B9AN.
277,366,151 *1B44ED64529FDFB729461F6D8BAF77C2002AEBEC B9A#T
277,366,152 *1B49556E5109ADD57E44F29399E56E41AECD1173 B9(#B
277,366,153 *1B4287B3CAF3D9E9D1119E06720D75F43CCEDCF9 B/9_b
277,366,154 *1B498EF8D995D4E4F5DCEB5EFFCDAAF768BE51C1 B9B0q
277,366,155 *1B420B3DF3C87E4B329C184F81AE151B9A92764F B-9bm
277,366,156 *1B49E3FFA40786B3B2E66286F23EAEEEB3E6CC55 b9BNansQbZ593BBg
277,366,157 *1B4D162AC93503BAD98B1572A69690739B3DC62A B9bWP
277,366,158 *1B40C2C03266E6AD52EC52BFAEBEAE76BA5995E6 B9"C#
277,366,159 *1B4A419E842DB12DD3247ECEE9837A98404812C3 B9c("
277,366,160 *1B4F6AC0C5023B30BAFE8428967C6FBBE2049D51 B9c4"
277,366,161 *1B41B2FA56A3C5B87DD27E1E7B15ECFA61A75634 B9Cp2
277,366,162 *1B44D4C92785616FD551F9723D6314700A90ECCE B9?D?
277,366,163 *1B4DAF95BB241A66CDAE14F46C3A3CF0400033E3 B.9d
277,366,164 *1B478392291B6D9C3842F3ED81FC0F1F6BE84FF4 B)9/d
277,366,165 *1B4F7CF2ACDF5ADD0C4E6633AC6B9B5D3BD65E29 B9D!D
277,366,166 *1B44A77EBA0DEA5C533A209E7268B211E3B005E3 B9Dh6
277,366,167 *1B49893075EA5240835052728ADD9ABC27636981 B9dme
277,366,168 *1B439DC8A5A9D07DBE9DC68A51D7065161A66F4E B:/9E
277,366,169 *1B4EF9A16A50B1E06E8533E4634CB3CC22BE7D7D B=9Ec
277,366,170 *1B4558576AF9E4CB568E81EB52E3E0B04237F04F B,9EK
277,366,171 *1B4DD9AA6671B27B3EB3F508B09B639F5A423ED5 B9/eM
277,366,172 *1B4E3D6B30C8DF83AFAA95A34E97CDE3E676C5A7 B+9EO
277,366,173 *1B407971F0B330C4F9EE84E546575775CD1FC29B B9E+Z
277,366,174 *1B48F6DA217D476048DC573E1778126F6DEC337E B/9f1
277,366,175 *1B4B82A655D6D68A27575EC4B28812A3B8DEEE10 B9fe#
277,366,176 *1B48692F39558784B09F2FE94E4E5A6295049555 B9Fgf
277,366,177 *1B46257FBA6A34E5CBA542082DAEC18ADB86662B B9.Fs
277,366,178 *1B4786B21D5F177CA1BDC3EF08E03432A6DEB7AE B
277,366,179 *1B4B63E8FD1B7049E7C5AD4421ADB98EF26EE2B6 B":9g
277,366,180 *1B4356684CDAB7926A33DA16491C9603BD53FE49 B9g$(
277,366,181 *1B4F17F18ABBAC8115BF61E569744A83EBF3EB63 B%9G7
277,366,182 *1B41112513D6B4ED7F5549BADB31A7E96D837E47 B9-gA
277,366,183 *1B4D8E7436AF4C994B9E18286CCBA394684F13CE B_9GM
277,366,184 *1B4D58C16A71067AF82BF124DA8C28C35197CA54 B((9h
277,366,185 *1B401D8103EEE9C328057EA139B3731950092C03 B9h0A
277,366,186 *1B4FC845F7802F30509EF07BAA4519C72A1FA081 b9hphpvzggdlxf
277,366,187 *1B4E0F671917C7F353CCC4FFA36847B5DBB54E20 B
277,366,188 *1B45F4EFC0D46421BA8312487CCE0E82192B7BB5 B9iQg
277,366,189 *1B41ECF564C0EE72196B7783CA6BEBE8289631EF B9j#h
277,366,190 *1B43F0AF9075F48B0B1A19FD515C6491C849EDBD B.9k"
277,366,191 *1B459A2C4DFE39FDEFC50D155EFA7C6A29CEC261 B
277,366,192 *1B4DAF85E57C0D9170A11BE502D48B41176A9A7A B9K;n
277,366,193 *1B45E9AF699319D459ADAFD9971AA5F14398643B B_,9L
277,366,194 *1B4D44C42C837E80360584A3D8D619B4E7F57644 B9+;l
277,366,195 *1B42255362429E09329699795B80359AF903C9F5 B9l8(
277,366,196 *1B4E706CABB4B8EBAA21EB31721809910169BFA8 B,9li
277,366,197 *1B44214C613D16F884EFCA5C8E9F081A8E21346A B9L$N
277,366,198 *1B451292F3F8B060626033EFE9CED96F445AFFF1 B9lsB
277,366,199 *1B4B641ABB2D2A762F286CEEDBE3ABB70F2DBF71 B9"m#
277,366,200 *1B4ED0AF8AB4C3C559A78F38D803A79FDF38CF8A B9
277,366,201 *1B419A73D6604A64FB87059731106EADC378952B B9/Md
277,366,202 *1B4FFCC9405C08B9DEE148311CAC37375C8623B2 B9Mst
277,366,203 *1B453F0DD268D854E45D73DFFC27F686C20C867B B9mvH
277,366,204 *1B4285E9748603A73EB02451B58AE3468F6992BA B9{n
277,366,205 *1B4029952B9452EAE23AA2EAB613BA70BF2905E8 B9ND6
277,366,206 *1B4FFA43AA8B57938DB048A098E5A80A51CE07B3 B9ne3
277,366,207 *1B4F2880B484FCCE665AF3163F4B04FAD18500B3 B9N#s
277,366,208 *1B4695A38BA959A47330543E8B2136AEEDF89560 B)9Nu
277,366,209 *1B4DD067B119FCA067D48506226C101C8163E1AD B9o!+
277,366,210 *1B496E483B850C7A2A951C43A6ECD9DC4ED90ED7 B9oA/
277,366,211 *1B4FEF1B67E633218EA63175FB0DE8745549AD5D B/9PA
277,366,212 *1B44B53053CB71E78B4445ED80BDF51D0D77192C B9PB$
277,366,213 *1B48EF19520480CCBD28B27013C8401F4D9746EB B9PvW
277,366,214 *1B4F189A613F46B22ACEC116B3A05FD3775831AB B9$Q"
277,366,215 *1B4F886A95DF43FB376A9384D7283F36718D4447 B9Q8"
277,366,216 *1B40DF4A7F4471D1635E2F5F138E7D8AB5A2E2D3 B9Qqt
277,366,217 *1B4989459D65B02318FDAD6B30722654449B7F28 B=9qu
277,366,218 *1B4304D1EABEE8DD7F6A9CFC8C1EE0EFFA32B110 B9R0r
277,366,219 *1B47201839AA7C6274EE194D9C8FBAAA30F065DC B(9rZ
277,366,220 *1B48C65B8B0A9AE0E10CAFCE2A0757811235E388 B_=9S
277,366,221 *1B440C9FCBE474A9323A495DA93BAEB1220A27B0 B:9)S
277,366,222 *1B40A3E16EEB549596086DABFA5D632FB8DDD090 B?-9S
277,366,223 *1B40BD4066D21B60BF738E38414D56D7CDB40090 B9s3O
277,366,224 *1B4602C4508E0ED7FCF28124905D8365E105A244 B9sba
277,366,225 *1B48E1310EDBAC56370034BFC5FEFE58EBF85278 B9+se
277,366,226 *1B41F348ED66D0B7D4CFB9C8BFD27E71D3DB2843 B9T_!
277,366,227 *1B4D276A106919BA8F562DB5411F62213B03D602 B9t84
277,366,228 *1B44A3E1E3E7F4DA3B5167D03E16BCB26016AC33 B&9tQ
277,366,229 *1B48854D21DCB037B145CBE693C7302939EF33FA B9!Tt
277,366,230 *1B44A9583EBE91172F7DB64B59BAF8CBB32F2589 B-9Tu
277,366,231 *1B47552952462C30136D27C28CFBA76038C96337 B#9;U
277,366,232 *1B40D0A74812DDB2AD049C7986CB9A992FF85527 B9U,,
277,366,233 *1B45734B6BB6BA3B210305A2EBB4A747A1350F67 B9(U8
277,366,234 *1B45F9A7FDCBFC7ABB7936D4DD81340916D6DD69 B9UCv
277,366,235 *1B4AC3E8A35D1367103DB35F0283DF51A1A10D3E B9vcZ
277,366,236 *1B43FDBB23BC4EB86807FFA750B50E2E0DB8C797 B9W7w
277,366,237 *1B41BCA88936F9758AFA2862A44DB8DC6792870E B/9WO
277,366,238 *1B41B49AEA37E5943CDB917A641ABF3888FF0366 B9WTc
277,366,239 *1B4C0FE0D04D5BF07844188F35DD7A9F092541C4 B9WTv
277,366,240 *1B48F5457C41EBC883D16DCA79E36BCFC8745996 B9Xj=
277,366,241 *1B4EDCCF492251578FBD03DFCB476566541C9E8F B9?XP
277,366,242 *1B48669C59C56CB29EC1F9BBA928663AC3065A2B B9"?Y
277,366,243 *1B4A2FF3BC7E14C94594D8F206F8DD52862BA5EF B_9Z/
277,366,244 *1B47C62E2908DF8143C59797BD5EEBAF5F38297E B)9Z3
277,366,245 *1B426023543747FC678F99AFC3570565BD360EF5 B9Z7E
277,366,246 *1B4D97C406F0BE1341DC17E3E04DBB07D6571174 B9Z8k
277,366,247 *1B40A189B261BB1FA1C194AF0A3C6695AEBCCE68 B9
277,366,248 *1B43DB27F98F569F650150B793C7C336B1DA3CFB B9Zj.
277,366,249 *1B4E110B4235F7190EC09DC5AA43C65A6FD24788 B;=A.
277,366,250 *1B4B926805442523D3BB314C20C1B2646E05FF15 B:=;A
277,366,251 *1B42165467B152B0A526014621B798FEFD2E523B B?A,&
277,366,252 *1B43F7F8F31CEBCF6F36C4C5C94EE821F38B9F01 B"A)"
277,366,253 *1B41E3ABFD3012B34116A59580914796A5687C6F B&A),
277,366,254 *1B47C275F8B1BB341D51230AC947BF847FBD0734 B-,a,
277,366,255 *1B455CF99E45EC5779A90474A4E212FE7F66F0A2 B,a).
277,366,256 *1B46C0F60EE36CB737C69041D72C16A1D960D5D8 B:a+=
277,366,257 *1B465528AACF4830222B8D6B67A83168DD060FB6 B($.a
277,366,258 *1B4B8E0D97777401F48BB3D5883F0E0EFCBF583B B)$a_
277,366,259 *1B41D6F616DEE44F3F8FCDB77858C3FE6728C803 Ba,""
277,366,260 *1B49B2445A4A158581DEBABB45A30D4BC8E31ED4 Ba?,/
277,366,261 *1B40C1E62908D5E8C90EBC4C5D66E52D74D8BD47 Ba”
277,366,262 *1B4B1A274757249B621CF1B836654348E84DBBAF Ba$#%
277,366,263 *1B4DEA06BD569C02AD2F834D2B34DD65E2A07703 Ba%$:
277,366,264 *1B451EFE78FDEBC75F3B5DE3399F287A7B4B2B0B b’
277,366,265 *1B4C8D1451D322567A056455721D5653176FF789 B#/a0
277,366,266 *1B447D2633A18195975109FBAF5309C75FF6E6BD Ba0_&
277,366,267 *1B490A2BDE7B3F2A4568C3D9AF22996A6A4A8B9C Ba0$+
277,366,268 *1B4D37A34D7D91E3BF718A16BA74B550E4CB7D93 Ba00I
277,366,269 *1B4503D769AD0E57998E4A0B28520EA2382D9EE2 BA0BA
277,366,270 *1B4226425F8FDB160E93F32F21F9D9B271D4C77B BA0fV
277,366,271 *1B42C526F5070B03FFABD95D56D26571C7667DA3 Ba0lI
277,366,272 *1B4FF03C3612D7E82D5811637342504ADC22DE52 Ba0sR
277,366,273 *1B4793CE4C991E47BD8E15A6EEA8DFCD398EA5D3 B_a$1
277,366,274 *1B44A4349E21A68311362A9A9416F6FDED52A3C9 B=a18
277,366,275 *1B4F00A156BF870B0BFD1D31C777838BF2DB3D44 BA1EX
277,366,276 *1B4C2CE387BA0E0FAC427DBD17BC93855FEADCD0 BA$1N3T
277,366,277 *1B4C4FFA49CFD801AD12C65613FDC0908AB4C504 B,A1u
277,366,278 *1B40EC5E1D913A4ABE96EE4349E3F9C59C868EC9 Ba1.u
277,366,279 *1B4D1FF47D944125A11C0EA1C7EB9E49D24BCF24 BA1WX
277,366,280 *1B43BA3A9BD57FB5D267C42DD2015F3637EA5879 Ba2(_
277,366,281 *1B40F7AA68728136C316E8518068F2F56A1FE523 ba2282
277,366,282 *1B42A6F51381EE429F56FBF3F80C88DDEB5A1CAA Ba2W)
277,366,283 *1B4953F6B34613A53353351634F10DD92E15B9C9 Ba3:D
277,366,284 *1B49A8B21B1347090C7A784D4BC262CCE3C48F5B B(a3g
277,366,285 *1B42E846453DCCB5C9C7134D89257AB998328E60 Ba3NW
277,366,286 *1B4EB19635694962D06F3BC08C9CD86FC8CE4145 B/A?4
277,366,287 *1B44298D47E09B9E541849286312C7DE47ACA5DF BA:.4
277,366,288 *1B4AC40AB2B71EF15C83931513E05F649E34D6D7 B%A41
277,366,289 *1B450A7CC175722BA02AD225AE622D0F519A060D ba4f661e
277,366,290 *1B4E32913C84EF0640B9E65D7F198403720BB3BB Ba4om
277,366,291 *1B431C5A65E62DA267A08E10785875C1BB0D0F67 BA4r;
277,366,292 *1B4C9ED77DF4931C16592C3DD4C64A4F8573D39D Ba4rr7m4
277,366,293 *1B45F58029ADB6745BEC38083B93D0A512314860 Ba52W
277,366,294 *1B499BAF3A6AC18D68EA9DDE3AEFA3954A8EF6E5 Ba:5E
277,366,295 *1B4A1A4A2149997CC15643676598E2982D6493A3 BA5H/
277,366,296 *1B407D8E8AC411DB3B7CF8571C7623D5809B4EFC BA5jq
277,366,297 *1B4721EA445D8D96CE8F790AC64E70C40CCBD988 BA5Nf
277,366,298 *1B48D45430FBF9C9BADBB0F6773E8BA4AE18F4FD BA5,P
277,366,299 *1B4F67A8FC6780629F2DE3E1366E8330389E0F13 Ba5.Z
277,366,300 *1B4EFB3634A625E77E4665F4FB96D7578D93DCB4 B.A6-
277,366,301 *1B472C3D03F1DA3756EC915B3ABEE383925EDEC4 Ba
277,366,302 *1B4DBB9E9C742E7F7E15102AB38A3C09127FDB94 BA6!5
277,366,303 *1B407EAA65D66FDF18EB5AFD7A196F1E942B7537 Ba6MG
277,366,304 *1B4E0A4E2554C59790339F8529A0CF406EEED1DB B!a6o
277,366,305 *1B4D1D6B9CE34E7FDE5E789457AD96965F7E8979 Ba6oA
277,366,306 *1B46D55AB8B0AA0061301820DE5713FDA6065E1D Ba6pN
277,366,307 *1B4B7EC7D7082A365DCFA78FF1C46CBEAE30A09C B#A6W
277,366,308 *1B4257FB2C029E28CF30E6B140CF1B4A24FB9439 Ba6"w
277,366,309 *1B4E4FAE6AEAAE5E59642BE002731E07FE97742E B,a!7
277,366,310 *1B48A83D0713F75763F64590E447B2EB4D62414B BA723
277,366,311 *1B492DDFF5005D889B607937365D17B72B9A8259 ba77!ng
277,366,312 *1B4F4A1C3E66A2EBCA798B6525EA526D442234F4 Ba7K;
277,366,313 *1B428D138843EEA8DC745176F3CF7658F466E41B BA7Ow
277,366,314 *1B4E53A2C9E96DB010CAE858E5263D6C2D7C8D92 BA$8,
277,366,315 *1B4989AC45AA533E6BF82F5CC9C811A52CF3942A B#"a8
277,366,316 *1B40EC537FFAA339E22317CC524595FE3BB5513D Ba%(8
277,366,317 *1B4BBF9A058454DEE414309887202D791E4F23E4 Ba8p3
277,366,318 *1B4BF2BF0ACBE983ABC7EA6EE749A05D2F8EB2C5 BA8-X
277,366,319 *1B43219EDF2CF9BEB25581F315B5533C2DB5E307 Ba8Zh
277,366,320 *1B415C2CFABD081C0740E9422815C9272C72D7CE ba99
277,366,321 *1B417B9C93808E66B0F93D6206C385BA23376517 BA9c$
277,366,322 *1B4B09DD8A3A9266055AD132AA92ADD6E6C6D340 Ba/9p
277,366,323 *1B4922E594CDDF763847106928766261FE2A199E BA9QP
277,366,324 *1B4AA80BD47AFDA41ECBD3CF15C87A54E1BF2FDD B#;Aa
277,366,325 *1B42E096103DF913F5C8D98CEE6C6F3CA477E308 &%Baa
277,366,326 *1B46E769126D00A28B5B5A4BF773B816C7DB7774 B!aa
277,366,327 *1B4587913EE8C3E484B89A86F3952895D94B407A Ba=a&
277,366,328 *1B492953345B70C35F88791600095247EE16D3ED Baa;_
277,366,329 *1B41C458F58E3B78DFAED1EA16E0BCAD06167D83 |}>baa
277,366,330 *1B4E0D7E1C77A79640CBE6ABA45500C15F273B4B _;<baa
277,366,331 *1B4060DE07F2EE79B2E5506DA115C628720F756B -'<baa
277,366,332 *1B48CE55B033FACE987FCF6B68030F25C5FBF081 !-'baa
277,366,333 *1B4FC51F31F83E640C8FED1790F9A267A885FE16 .!,baa
277,366,334 *1B40BA8830FAC84C7B3B72E3701853D9143ECCA9 "^@baa
277,366,335 *1B4F5C9E7680F7C13F4904426A17B09B5E706BF2 ";(baa
277,366,336 *1B406345F558FE33151C3EC02BF31DC43727D828 "];baa
277,366,337 *1B47A0F84B31CA6349C0A55426D8C44691368552 @#)baa
277,366,338 *1B4BC305F671C25E3BC020093E45F5441EB07304 \#/baa
277,366,339 *1B49FF20775FDB91E4D68C14F3EA15493FA6F84C &\,baa
277,366,340 *1B402C56741E85183E745FB08920BA5B9CEAAFE4 BAA5w
277,366,341 *1B489DE37BF23BC865D987869AF05EAF070042BC BaA6&
277,366,342 *1B49B5DAE08F14B3C17DC16BD0C3A67C51DB5ABB BA%aA
277,366,343 *1B4CDD07FA8CC2DEFFB471DA155AC265F0B86871 ##baaa
277,366,344 *1B4B5B54A5B7CE422D7E76B2AD94E7B6EA82D133 BAA&b
277,366,345 *1B44C60142E207ACE99F54CAFB0A153176D1AD0B BAaCD
277,366,346 *1B4760F357B84CEEF2DB8B00329D1ACA3C9B477D BAA"F
277,366,347 *1B45C1EB3857270304922DD94A0D592EFD6D9136 Béjar
277,366,348 *1B4152FC80706BEAE8585F26FB1BB43DEA47C1FD Baakkum5
277,366,349 *1B4AD05F564AB8C4ACAB9FEFF5ABCBD87A243AF7 Baana1
277,366,350 *1B4BF6DA3001025463439C35EAB2B4BD0F9E8ADD Baanies
277,366,351 *1B43AA3203905449D94001E68AC5557E35634D18 BA_ao
277,366,352 *1B4494553FF6B94E0F6C753D492A2066ABD4A3B9 BAARDI
277,366,353 *1B4C2CEA62E88FD7FAAE625994B898BBCECAD7EC BAaSi
277,366,354 *1B4DDC3BD2147CFFAF495336764B9F640C147148 BAaVI
277,366,355 *1B496AB81F38ACF9A88964F11CFDD069196109A9 baazigarwap01
277,366,356 *1B485D1BA895702C20A93509752117AB46C5335D BaAZl
277,366,357 *1B4D79BC0810C9B6C2B7DD40C56132451E03B417 B-?Ab
277,366,358 *1B42B18EA37BB4AEDF9F8869D7D7EEF9C406A12D BA,!b
277,366,359 *1B493C6449E8E6DF4A6852340821185965680979 B::ab
277,366,360 *1B4AF71E033E658738558C8181CCDCEA48329A4F B=Ab2
277,366,361 *1B4232B37216CA8A41155865653BE26E479DB596 BAB6/
277,366,362 *1B42CAC27B47C3F27233B905164362E42181BAAD babai debnath
277,366,363 *1B4A55E6ED939B769F0732AC5333E1F9E26B0261 babaïev
277,366,364 *1B434AB5884FA69EC72941DEBA7851439A2027E4 [email protected]
277,366,365 *1B49C1B8D9FBD6540396438948C0C7B1578F5C5E Babamboni
277,366,366 *1B47E88BC7E56B66B93983F609054CADEB3A207E babar adil
277,366,367 *1B43B86E3A2C022A9444002C4C4577A21BAA268E babasefusteaua1234
277,366,368 *1B4875E3F19DC81BC83875E6FC7E9FDDA0DA5DFA [email protected]
277,366,369 *1B4E85C3FE9D599680211C28224F4835F20E7689 Babbayar
277,366,370 *1B4C8D0129A61EC2D5950E284F490BC124992458 Babbelziekst6
277,366,371 *1B487AEB475DAD2996B91953642589767B7DD003 [email protected]
277,366,372 *1B4F65851747A04F142DE4320404B6B2DDCC1320 BABEL1235
277,366,373 *1B41DDBAC22258AD31830DCF77BFE5A88685335B BABES42390
277,366,374 *1B4CAF3AF3C0291AB52668A75CBB5D6FFD5BB72F BAbGV
277,366,375 *1B4D1FB049BD8291DB381BD067D089A263151B59 Babhe
277,366,376 *1B440BC3D24B4A72111EE4C7CE384960FE75A2C5 BAb/i
277,366,377 *1B45AA3F1F5EDCFBB6B4260ECC42E3DDD1E8114B BABICHES4
277,366,378 *1B42F0ECFC60209B2D2169B9AE18E522B2028F9A babiizee14
277,366,379 *1B48F8CF008094309D61A63BFF4C8B2E6EA2A83C babila150110
277,366,380 *1B4AE5B534DBDDDFE3BA83D70A70FE65295980D6 [email protected]
277,366,381 *1B4A8041C6E97DB0C275C6BCD14663DD67DC6B35 babirusaskulllyd2
277,366,382 *1B4C8DDB42F4495DB68090722A31ADB1B82C2C61 babitha amin
277,366,383 *1B40A1455EEC3D0E4470FD2A8FA5493CDCF85024 BABKUBWA
277,366,384 *1B44AE26CFE9A926C1B9D45F5B5611CB22851666 baboons.7635
277,366,385 *1B4FFE85E2EAE1349F79B1CA02906F141850AA03 B,abr
277,366,386 *1B479F72BC7900E9D041A5DC582CC0CA129FA83C [email protected]
277,366,387 *1B46DB50DFDDF4FE94C6C058CD02CCA0BCEBD90E Babruiskā
277,366,388 *1B415AA6398B84D92FBC97FD2CDF97B502DFBFBD Ba
277,366,389 *1B4D51422DF05555FF272E282560CB13BAE194D5 Ba"Bu
277,366,390 *1B49CD669CF6189DE1DC3E273C87B6E94BD69F02 babulbabu
277,366,391 *1B466E571CE86ED794AA672468F5DFE1D64FF00F Babulus2
277,366,392 *1B4892FFCD95B83954F3CDC86E3D230A16BDD65E BAbwn
277,366,393 *1B49EB4E047EC6B8BA66CD5A3C40A5717C4356F1 babyabe3
277,366,394 *1B47D843D512F64830B20A5A4BC0B891F4C39E71 BABYARONKO
277,366,395 *1B41F15BE952682B7BD82549C7EA5078F8EAEE64 babyboi316
277,366,396 *1B4602C468EC94BC423AED84A8658A2DCE6A49DD babyboomer1234
277,366,397 *1B4DBE91318E2394B2565A3BD3BD1E21B51AE1F4 [email protected]
277,366,398 *1B4D71E2D7F78D13CF765C15BD23C1B0A1F70FAA babydalaga
277,366,399 *1B4E56C779F71F3B5ABA9DF9DC298713E65EBFD6 [email protected]#
277,366,400 *1B489A1C0548D588EFE866AE90F3AFEF0706E837 baby don't you do it (rough mix)
277,366,401 *1B46E4DD06466F76316D4DB092DC54892E9B41FE Baby Dreams
277,366,402 *1B449485E2AE346A0953E57D9085FCC666C0EE5C babyericing
277,366,403 *1B43316D9B63047325B32821AB6B521D816E1A23 babYGirL
277,366,404 *1B4F4573C32A62B8B8E0729624AB924CCC3D3024 babygirl (instrumental)
277,366,405 *1B4769AD0F92534D877AC5BB0E04E488907B6B3C BABYGIRLLL
277,366,406 *1B4B0C5C5C18328698CEE3055957F6DF02B42D1E BABYGIRL_SHERRY3L
277,366,407 *1B41DA6D4D9E56FD894564B0AAE078234323CADC babygot1
277,366,408 *1B41BABC9EB6A5D3C48FDDB4B9C9D275BBA5B2CC Babygots
277,366,409 *1B4F6CC32F5C9DC8E9737F0DF6CA7F383441180E babygurl4u69_368
277,366,410 *1B4E66146277A75139AD5A1F309CB3B085DFF887 BABY_GURLIE2761
277,366,411 *1B4E632B4281CA9076A4B0B0BA1BFC3A3E0E3EED babygurlz_1211
277,366,412 *1B4CD5D18E0C685E5359C099D168AB804D07A50C BabyHormonesHaveTakenOverMyWife,andAllICanSayIs"Waaah!"2
277,366,413 *1B43E972DBBC8FC0538913012B561BFA55C0FBF2 Babyishning
277,366,414 *1B4A3058F77092063FFB59EAA52E27C65976BF70 BabyIt'sReal
277,366,415 *1B4C7FDC237BC732AB48E0151F776794EC47DB49 BABYK18**
277,366,416 *1B4AABF304EED243F7AB9D80CBF433679EF5249A BABYKAY68
277,366,417 *1B43F9A4367145DB811BB9053429F4BD737CA7B8 babyloneclipse
277,366,418 *1B400D77A1E7EF1381D5DAB8C689FD0437FEE956 babylonica”
277,366,419 *1B4A1CD1CE96A92959A57479366B1DFAF3CC8B3C BABYNATHY
277,366,420 *1B46ED59CF32143748A47D86C20FA66A5C548D11 babyoh!
277,366,421 *1B42A0A147C3B577835A062A785C46EF9E5225CB BABYP4
277,366,422 *1B4216113CF70389FF2C518DBBD0E0DCD027E5EF BABYPRO06
277,366,423 *1B4285425C26A5E63D7791A8C28ADF6DAEA47545 BABYREYNOLD
277,366,424 *1B475DA0ABD9CBBC623210D9B37758B7ECFCD56E BabySex
277,366,425 *1B4C6087D4AD4DF305E9DC24C210A96183751E33 Baby Should I Stay or Go
277,366,426 *1B4DDFB29B8CCAC64010101DE33B661FA7D4A2F1 babytushdinamo
277,366,427 *1B4673FCEC61CD85F734E08310C14AF6C3702AEE Baby Wants to Ride (DJ Isaac radio edit)
277,366,428 *1B4B2C4E7BC1EF122FAE5B8C9EEDD3B6EA1B5CF8 babzique
277,366,429 *1B4F91E8B5C233EFA55F3151B03E2467AD2250BC BA,.C
277,366,430 *1B4CA4CF161C9AFB7F3748BCF7F26940639B9191 B&ac+
277,366,431 *1B459E51E98B82E2CA0DB3A5BC0A008A1B8E5058 Bac1P
277,366,432 *1B4A1C3A7F8513B3C20D57C6B1B1CE73EDF633BD bac+3r01dal
277,366,433 *1B473DC220E53FA07781A85B412F9ACC5268E931 Bacanese3
277,366,434 *1B4F783D97CEFB3B8EE763F987932F7E1E7175CD BACBIK
277,366,435 *1B47411C337C94A083D9CEEA95F2AB49E0624550 BaCbY
277,366,436 *1B4A8FD976A53846AC26BA6F0FC23849EF6710B5 BACCALAURE.
277,366,437 *1B45B66DC68743F0E6E7C43F88C4FA8BE8AC5474 Bacciocchio
277,366,438 *1B4F33559016BDBBE0D9B16A3D46D216E0EE1C8B Baceclef0
277,366,439 *1B4FCFD70000E3B4DAE51B8E927D723709984E3E BACH7
277,366,440 *1B43F6D056B5792BF33F5E8231E7D63644ED7E83 bacharelarmos1234
277,366,441 *1B45271DABFF6057156E640C912165CF3538C7B5 bachath2
277,366,442 *1B4AA1F63F8B4FAD365AC124A6C92111FE3CC0FF Bachcaseying
277,366,443 *1B42EB5B6A8D6EFA0BA5F0DAA104B48E7C2363DF bachdgj5
277,366,444 *1B492314CC8F2B22388571E3D466A4D4EB682805 bacheletjeria
277,366,445 *1B437742E05130EB1003BE0B70438FF18DE823F3 BACHELOR$H1P
277,366,446 *1B497A6599724DDB77A0292F4C277D8B68D5BD42 BACHELOR-OF-THE-YEAR
277,366,447 *1B4DAE359BC0BDD7716E76EE5501866489BDC740 Bachelor’s”
277,366,448 *1B474236448C448D3B24CBB230DF47BDDD895E09 bạchhổ
277,366,449 *1B47A67F7BBA9AAF39E95D34C14655A83001BB2A bachirellato
277,366,450 *1B44C1E32CD377A7BBB5EE2DA0769E288B124358 bachir oneid
277,366,451 *1B4F00BF1CB14638452D4414EBC763BC76A4BF2F BaCHm
277,366,452 *1B47AA3E5F5CD0F5DAF06611F18DEEACC5D88679 bachmantekla
277,366,453 *1B4A4983DC62F962D16980A17860757CE4185230 Bachszirkel
277,366,454 *1B4BB3E90D0F25DF6D6E67307DC81A459393875D Bachtin6
277,366,455 *1B42A29F14F9F2B5B429412C508541D844CF7405 BAC"I
277,366,456 *1B4513907BC1A0629CF6102968673BED85DEF010 bačija
277,366,457 *1B4BD99EBCF44834B8920840DD6623FB2B35DB2A BACILIO01
277,366,458 *1B4D93F79708DC7287D6277C2C74C63C74EC7EAC bacivon7
277,366,459 *1B43BB7C948688EB756F9D285A92F76827F731CE $BACK
277,366,460 *1B4E137F2E014087B6B7FA093C5A9B1671441E9D B
277,366,461 *1B4F58718017347EF7C13EB01A52E2F6ADE86385 back2005
277,366,462 *1B402211EE5DB35A3F3F8E7415B664D729E712DD back239
277,366,463 *1B482C7416301CDB95429548A3503AA58041D041 BacKACHe
277,366,464 *1B4BA82F02E49CD9B1663B7376A315FAD69D4DF3 BackatMyPlace
277,366,465 *1B472F0A57C8DE7E1E8D5E44227FFC8B013B4CBD Backbones
277,366,466 *1B41E50407D56A3396F5EC3CFD897C8BB4A7E9D7 bAckdOor
277,366,467 *1B430A71E0ABB95537D58B4F03BC060F2EED8803 backebergii3pakal
277,366,468 *1B4A44372C1C3760F6419BC57A8D1F5B58DB5363 backeur
277,366,469 *1B4D8FD139CFA279CA9C78F80C3A1935CD9E9255 BACKGEARED9
277,366,470 *1B4F1B812F73A8D5712A36B78244C35C001EB59A Backhouse’s
277,366,471 *1B4FFF6366346C588031761ED1B914F38E69183A backie:
277,366,472 *1B41A56A22FC40DB56B81574974680F55DC2F48D BacKINGS
277,366,473 *1B48FB51F2F86BFE3DC5469E2814649855B8B338 back in the mid-fifties, the government
277,366,474 *1B4AF0688A013515030831E8D14FCD78C878C861 backitup!!nilslofgrenlive:anauthorizedbootleg
277,366,475 *1B485FFFA7FC22AC1C4C58D1AA52329698EA369F backjoegoodfriend
277,366,476 *1B438A5B7723A148C2D224497325D16DC510F551 backlashed2
277,366,477 *1B4BE1DFA07343344C50FC583A64C5B781B9CE45 backltigtltagt
277,366,478 *1B476FD0F314AE40C7D1F57B20FB3E02F8697E00 Backowwe
277,366,479 *1B4AC2A3FEB7DA0BB9BE788E3EC8799DC4D9317B Backplate!
277,366,480 *1B46B376D09819B693D1F3ADBFB7A7202994DB6C backrass6
277,366,481 *1B450AC09AD954F0A16C1194F5D2944F2A769AF4 Backsgesellschaft
277,366,482 *1B4CEFE8B079DB615AAE8D459148E14579D24EA2 backstagebar
277,366,483 *1B4F323564B67292CE9578EDFF69D92575687ECF Backstr0k
277,366,484 *1B492332F6165B3D81169225592A2306E1F5F981 BACKSTRAP1
277,366,485 *1B467AE135F02ECBFE2DBC63DF97C7CC74C83D41 Backveers
277,366,486 *1B4C55E6F3BFFAFFA0C67B6B979EFEBC04712492 backwoodsness
277,366,487 *1B404283FEEBE18108A7DD7735C6C3EC52C49941 backyard-breeders-the-elephant-in-the-room
277,366,488 *1B42DAFE2B4BE3A6B3CF0BAE5E4FCF0CF167399B bacleras6
277,366,489 *1B45CB9746B2FCA93CE461283AD0CF127E080E02 BACONNÉ
277,366,490 *1B4CAEDA2D8D05B785608D559618D4458CD781F7 bacotua3
277,366,491 *1B4770D996ECE253863586C80FC370BDD8FE7C66 BACRULE
277,366,492 *1B421E4B1C5ED91563841F87EF648B9179506B13 B_acs
277,366,493 *1B4737BCBDA6324BF023786F845473238F68AA99 Bacskortes
277,366,494 *1B49A2BE63212D6E37FE7ED2D3FFC05F9FF5945A Bact3ri0l0gi$t
277,366,495 *1B470E20C87E5C80DAD05B4EBB811DCCCED61EA4 BACT3RIOCIDA1
277,366,496 *1B48BEB303D7BB8B24571572A8E8660140D68B81 bacterems
277,366,497 *1B4642A5FF10093A1D4D5CDB3B98BD222629DBB0 bacteria—derived
277,366,498 *1B47135CD30E9CECF79D4D34838D8B02F547A20C bacteriapimp
277,366,499 *1B4192985B5CF2DF48E5659FEF687DC8495DC094 BACTERIOSCOPIST5
277,366,500 *1B46C85EF3D4A9D56E373BCFACC300A0851E4657 BACTER!O1OG!E$
277,366,501 *1B4D4E97B24D466C33C42246A2046233E40C02D9 Bactrie8
277,366,502 *1B4EDA9645C6C610EB3CEC0586C4700D3F05CEDB bacule!
277,366,503 *1B4EAC423F48DDCDBA72E75AF5E3D6044F19F57B Baculum1
277,366,504 *1B48757E91010C183DDEF90E1DB6ECEBA42D9F45 Bacvl
277,366,505 *1B48ED1293EE535D124DA16392153A07D3D25E28 BaCYD
277,366,506 *1B479A512F8A46B973A4599ECC5CCC97F22E65CD Ba
277,366,507 *1B4F7F1E2E44EDE0698ABC83E7B81515F9D4A376 Ba_d+
277,366,508 *1B47F200906409BAF4E037286333DECF2222D83E Bad!;
277,366,509 *1B4F9FFE1EC5B9B3B183F175B227D7D4276BDC1C BAd6K
277,366,510 *1B4D981D01768C1EE338B0E42AEDFC945F2D32FC bada2k2
277,366,511 *1B43DC53531F4A0F4DD83CCA9CEB44AC18CF8803 badal khandaker
277,366,512 *1B4679A4686A650C2CA41E0EBA12B1E616092DA6 badammo1
277,366,513 *1B45F15830856CCF19EF20C034745ABAEB181A85 badandes3
277,366,514 *1B4AAB29266FC2C306330298D68CC67F177CA13B baðandi
277,366,515 *1B44CC4BF3B5FA47B2FE4C46A0E69997529668FD «badania
277,366,516 *1B47BE6DD682102CE7DFB87DBBE9F826C3B71253 BAD-ANIMAL-TESTING
277,366,517 *1B4508F24BB3DB3CD4639F0EF6F7AFA3BFBD03F4 Badassa4
277,366,518 *1B4036225977289AB03AE417360988D26103CC1B bad_boy_4life43701
277,366,519 *1B4BCA336D4164CBC3252C0DC348B047A9DE04AE BADBOYFRANKLIN
277,366,520 *1B47AE758CFC9CF9EE40A7071F15C869AD438262 [email protected]
277,366,521 *1B4985D9F5B17E562046E8C99718061440F35681 B
277,366,522 *1B4BAB4607ADCF5186DA68587FFF9973FBDDAEF4 badcert
277,366,523 *1B43BF3917D70E82C4F8E464102A05EEB8274910 badderlocks2
277,366,524 *1B48029977AABFB1DF295C239A4EEAB28D7A59DC BADEANLAGEN
277,366,525 *1B4F62B38C47B6205EF2C4368A6BA9315583C53D Badeau1234
277,366,526 *1B4962D81EBE4E9652602F0E6DD5946A4345687C Badehoses5
277,366,527 *1B4DAC0A7180C8F209519CF29E38C12C4363CFD4 badehotellet
277,366,528 *1B4F4D48F870E94D48041EFEF2C201DDC9BD89A9 Baderemo1
277,366,529 *1B44C248EF7BEC624A2463D05E620F0C36287166 bader othman
277,366,530 *1B4B828F7393973DC239C3CBB2451E962838E207 badfinger (英
277,366,531 *1B4D1D57C7ED2E87FE0E3F0E9B00508785D6F979 badforthesoul
277,366,532 *1B49E58D5611840A2CF30384A03064BFD26ED5CC badge2815
277,366,533 *1B4AE8D40C3073D04BC0A27E88B6171DD9BABF88 Badger1949
277,366,534 *1B4E07AEA01AA63DD499F04BE5338C3E0B322D45 Badgereric
277,366,535 *1B44EE8B24D02AE3CB6CBA05E8A3C6D3E579A6E1 Bad Girl (extended mix)
277,366,536 *1B4DC55ED4DA380433AB38B9375058F947A49AFD bãdhinjãn
277,366,537 *1B40921DB76672A19508DF0DDAE34220020691A5 Badhuses7
277,366,538 *1B42E93921E8F0B15578547F9B495CEBC8606E3D badǐ
277,366,539 *1B400E019395395B84968C6E45BE297071C6B2AE badikadeoj
277,366,540 *1B4C205D317817D0A05E66DC83DD252CD8011073 Badjas
277,366,541 *1B4E93F2592D7E976509238A8496FD50F750AF29 badjohn:badjohn
277,366,542 *1B4C86A3B43F98315A43B23856BEEDAF0398EFCF badkw1
277,366,543 *1B47ECD0C452FD190198BD0B05DD495FBB8E1C48 [email protected]
277,366,544 *1B4F1F307B1C191476FC2AEA9ABBB7BCE8AC38F6 Bad News (Unissued take)
277,366,545 *1B4E84F2E3BD7B32E3444FEBA69F5D38B1C75022 badouw:songline
277,366,546 *1B421F06F4886F3794472EF903DD7216742726DB BAdOw
277,366,547 *1B4230C0B51F2976997380B9BE80BE8D3DA760CA [email protected]
277,366,548 *1B4D16604DE65AAB3B6C868A848545CE539C5868 badrec.ae
277,366,549 *1B4D74CC5DACB72E765B7DB2070E885C4BDAA403 bad to the bone: 25th anniversary edition
277,366,550 *1B49FA41B94943398500A66A2CD485D093434A90 Badzyński
277,366,551 *1B4A4278A18334AB699FFEED0CAE0F04A1ECD23B BaE?,
277,366,552 *1B48DB60609A44E8ACA9447172935F9AC02D64E4 B(a.e
277,366,553 *1B4C867D333CEA04321A2EA61767DCF1E614C899 Bae$0
277,366,554 *1B43A000D811E086340A7980198EC0BD2419EC0F BAE146AirBerlin
277,366,555 *1B4552849F6C3E98C9CA605804D1E2A8FEC5FF31 B+Ae3
277,366,556 *1B4E92BC21BF0E412BC2F80AC6FF9BBAEDEDB193 BAE=7
277,366,557 *1B4E95E5B8F67B11B476302D1AA62990D54F5552 BAe7k
277,366,558 *1B488122C7842EB589A22F8A5A3EF61CA64B46BD BAEBAE34
277,366,559 *1B4802AF49B401FC7F125B0C871D314CEC2C507B baederarchitektur
277,366,560 *1B4642CD400B34A0A114D8F0FE53EF931993FF58 baegduj4
277,366,561 *1B4A7FB9CC66ACB63FFF3A0ECE7216D0185DBBCE BAehv
277,366,562 *1B4EEA14680BC7B7C955AABFD4F345DB8187FF7E Bæjargerð
277,366,563 *1B47092C67C675265326D025AAB1659EC27619D0 baekgimchi
277,366,564 *1B49F73B201FECFD78216DB7A857294F20C9B146 B!Ael
277,366,565 *1B42B6CBDEFCEDD6AA4D56EE99F8A44F4C111F69 baeltespaende1
277,366,566 *1B4E9D417CE37D5B0FECDDBA8B6B66D1D8E396E7 Baenza
277,366,567 *1B4E1E54A732ED520CA48CF2D23FA84958EAC863 BaEO_
277,366,568 *1B4D01BE305F2D0B47E2F3270D3433661B838D4A Ba$e p1ug
277,366,569 *1B44D8D024A436DC85FA4A55FCE87502DEF0FC52 BAeQ
277,366,570 *1B4007408069B05835605AE095CC7630A7460EF1 BAEr1
277,366,571 *1B49038AE827CCECB6D117E0341E9595F5C36A1F [email protected]
277,366,572 *1B4EF8F4DE8AF27072C8D5830B9BF93030B182A5 B.Af+
277,366,573 *1B4628850E8AC102DFF508D8583616EA4B613447 B%A%f
277,366,574 *1B49ECB1A7045FFE0A496C1D2B1A500BC33D2B8E B/aF/
277,366,575 *1B4B87478844A833592C9764237F5B91CB36FAE6 B)a;f
277,366,576 *1B4FB0E7057C79C23EEA772F98110470DE8A33BE Baf:9
277,366,577 *1B451A0B22E51B398AFED8E61C93D01281D3B4FB BA_Fa
277,366,578 *1B439F8B6C57E0A9374D44A87530354C6EC40CD0 BAf;C
277,366,579 *1B47D1FD31262793A067A39C36E166137C585740 B(AFf
277,366,580 *1B40BAB69B9EB9A1F2F7993807100B2BA7237744 baFfLers
277,366,581 *1B4A0BD6220EF2EE06DB0D89F2816174D50EFC8B BAFkg
277,366,582 *1B40D19869BCD38A60DF1053C7FEA65E2236BA27 BAFM+
277,366,583 *1B4760A6F8FE16A7253B0373A44FCE707C363A1A BafnU
277,366,584 *1B465F4F32B8ED4AAD3E2537945226B19330F6BC BafrP
277,366,585 *1B4237E1BE8AD50779C265C42BB58275B615F17A BAfsescu
277,366,586 *1B4FD3762937D855F8D4C255CC4AF4753BEC38A5 BAFuM
277,366,587 *1B4A6A36402DF1754940069D66030FEBA156FD34 BafuM
277,366,588 *1B47A3582D66E1800D0A13A77165CD392A068511 [email protected]
277,366,589 *1B4D382A9C1EC320A40CAD7C9989728083E366EE B)a?G
277,366,590 *1B4924F29AB5DFB840CA291B6DBD04B184B6AB82 bag442
277,366,591 *1B4F314EB94251CD1D905ADD2EC3CECE5002208F Bag89
277,366,592 *1B4BCBB6F9C9125A1F078DC9A9A5F1E2493811F5 bagarran1
277,366,593 *1B495ACD31219F0C325A7DD7CE799E35AA8FF4AE bagasje
277,366,594 *1B4462AC15E1EE8E6B10AADAFD1F80A5763938C2 BAGATELLISR
277,366,595 *1B4FAA7D16E7C6A8256368C5F68881A4014E7E8B Bagattino3
277,366,596 *1B4646CBCB1285F6D5110C8C37EF6AE0D4FC5367 Bagbaa
277,366,597 *1B43D7ACE2F757BCA15D99A7467B5C0BF5F9EC62 bageboi
277,366,598 *1B48A4F5BF84088D7CA8214D46223E9332E05EF0 Bager$
277,366,599 *1B49A0D488AC2965DB620693A24A4820A26DFCE1 bagg135+
277,366,600 *1B4F7ACE5CBEF4B08955676ADBE179578729B0DF BAGGAGes
277,366,601 *1B48C3185CCD68170A9B2BD586E0B6A0ABF14C92 Baggages6
277,366,602 *1B458FA3A43AB271F4CFF4A5C12FFBB7F302C61A baggendordf
277,366,603 *1B48A1C0AD21A949E80DB3099BCE08497578A891 baggerfa1
277,366,604 *1B4142481F8A09D77D6ADAD9043BC21BDB4582DD Baggerlaarzen5
277,366,605 *1B459BC7C6AE2DB9ACB6D5D8A7271FAA870B320A Bagger Leaves
277,366,606 *1B4BFC6F181BC7CD7F3E3ED664F1ABC67A3834FB baGGIEsT
277,366,607 *1B4D4F512469BDBC85017883990E74334A035F60 baggin355
277,366,608 *1B4EFA9BBCA77A86965FAD8CA7DBAB2DF8100FCB BAGHABHAILE
277,366,609 *1B416CBA97BEF4B16DD30810990EEA4A8F04C04E BAGHAVENS5
277,366,610 *1B48FD2473FE7176A9970D8B228DC9AE705B7BCB baghoveder
277,366,611 *1B466B30EE1D6A1A98BC77B60D2C6C137A07550E BaghQ
277,366,612 *1B46EA230DB445399A47861BC3A739E51FFD5DA1 Ba/gj
277,366,613 *1B431455F90AB03DA0D708B12E42214E71BEE22F Baglasim7
277,366,614 *1B4F0454F6A6A6022F51E68CBCDD6217B8099F4D Baglygt3
277,366,615 *1B4183478D92FA49400DB67339E0D6C40E0F48D6 B;AGm
277,366,616 *1B43AAD024DD35CE87E41E32404D5816DEDA6421 [email protected]
277,366,617 *1B41A2E6F21DFFAFDEA5B817AE87BB0E0288C26D BAGMEN5
277,366,618 *1B4762B50E406E212FDE730C541F513088744BB5 Bagnammo
277,366,619 *1B41788109A0423A9798D377A0CE300146160A06 bagnate!
277,366,620 *1B4F958A034C42155888F2B882EA0F164A60D8BB bagneret9
277,366,621 *1B4A0C4B6F629384FA4628B691472F6E0F0C52EA bagstrving
277,366,622 *1B41EDDE6EBC70C69BCAFFFFC8AC5AEA3156F99E BAG_U
277,366,623 *1B40B8D27ED29692A239EB49D5B36208D9CB0C31 [email protected]
277,366,624 *1B4F34827307CD4D6F7B1FC57B737134D90CCC52 BAG!W
277,366,625 *1B415393D0C74C26BFB2E64C8CE7AD6A9E8275F9 BAgwIg
277,366,626 *1B456705F4DC52E4BB428D67A05E91BC9EABE1ED BAgWM
277,366,627 *1B49D890380828BC92C6E16BC3CBEFFF6EF6BCD0 B-AH=
277,366,628 *1B403F5B0C9008183EBD1A9CD285115CB5F405C2 BA%h%
277,366,629 *1B4C190AF2AB1C4EE5C94C264538AAB968A2D9EC Ba!H
277,366,630 *1B4D7F86E3CF566AC6020C8E2D5D8F3EC81DC450 B++ah
277,366,631 *1B4CC259DA4048CF25DB7CC8AF97584BA67F494E BAh8?
277,366,632 *1B4CFFD16EB7A90A4A2205CEF66B63D83C08C6DA BahaÃ
277,366,633 *1B40CC6309EF8761D861F5B6B42790F4198817FB [email protected]
277,366,634 *1B4C1069C36E18CDD9E5040B540D59E068BD26E2 Bahai!
277,366,635 *1B4EEA7F08FF71A269217EABB683C5A8F99337BC bahalhoosaad-ka
277,366,636 *1B4D7D97BAA4E2B4FC8F10A766E2A9627844BC48 Bahamasvala
277,366,637 *1B401B2BA1B3EE6C15F2CBEA5B2D92A792AAB3AC bahareh bahrami
277,366,638 *1B4390FE91345114346B7C729C0AF6D85B66F6C0 baharı’nda
277,366,639 *1B4FB76EEA8B750D47189CB9240F8924F48A39BC bahçivanlığı
277,366,640 *1B47AF72995015529A2433D1317E41850AFCA270 bahenze6
277,366,641 *1B4A9860860EC805FA28B33F152352CA6B8F3EA6 [email protected]
277,366,642 *1B4306D25178D2A7DDD4371F8F8129C948F61878 bahia3817
277,366,643 *1B4BCF3D18178D54BD13A555A27613A9DE30A2D7 Ba$hilang
277,366,644 *1B46A0FD6F1ABFFA96EAE1BE58C7FC7F6F6BD993 B,AhL
277,366,645 *1B43D0DEC3A1622B86AF499654012AC0EE404BF6 bahlikā
277,366,646 *1B4E7731E0BBF08EE2D5D0DDD39F853C20D3191D bahnabstandsverhältnisse
277,366,647 *1B4168334FB29995C1C678298D17E51BCB044128 bahnblog
277,366,648 *1B4A9267D80956FF2D59983B8C07917DA637F60C BahNh
277,366,649 *1B492F892494B062AEA6297D7079CAF2349F2F20 bahnhofsköpfen
277,366,650 *1B4AE18B9CA7D401B9EEA1165AD02325261B2FE7 bahnhofsschließung
277,366,651 *1B447F6D676E3AD1765C636296A4127C2C794F66 Bahnwiderständen
277,366,652 *1B43AE908F3850ED9417D447D5DB760487071B0A [email protected]
277,366,653 *1B4D2B00E4D360C10FDC1F3BC66FFB8AB05BA38C BAHPBAVP
277,366,654 *1B46FF79E3641963715261A762D53C1B5A0AE03C bahradiler
277,366,655 *1B4C85161E83E816696C55B8C54667166E8E13FE bahsaslikoyu
277,366,656 *1B464A371B1350130C3FA98CA8C1B193F0DA682F bahtalkabdel
277,366,657 *1B4AE0778A96A966B653F7441C453A09ECC9F414 B-AHu
277,366,658 *1B4214E930EF2CAAB12BE1C4B4D4A897CD64505D Bahulena7
277,366,659 *1B4316FCB0A9C169F561096B1DAEDE5B794A0E90 BahV=
277,366,660 *1B4D15A18F25A06AEFAEEAEA8D001144245D419A BA-)i
277,366,661 *1B430AB42D7181FF89BE9AB74CE90EB896335F03 B#ai4
277,366,662 *1B4652FE36688D455177580A8AE054CB191BA642 [email protected]
277,366,663 *1B4239EE0A674E63C192D9463BB5D17A946C4E9B BaIAe
277,366,664 *1B4C29879748787C52425A89D65A3FD6D0DAABB0 [email protected]
277,366,665 *1B4204294C15C197805702DAB42CCFBD189DF83C [email protected]
277,366,666 *1B44FD8C8A3E6F37467C889491303B4C7C0008D4 [email protected]
277,366,667 *1B4A7F5AF468A53EDF3B2145682A4A5001C3BD49 [email protected]
277,366,668 *1B45828A13C0383D5EABFCFCA6AB9F0A13CBF87A [email protected]
277,366,669 *1B4EAE07BDBAF4E0504373670134668D01CEECDE [email protected]
277,366,670 *1B4A527DE6EC1026AF4434085003DE98F9A7AFE2 [email protected]
277,366,671 *1B412FB57C122C0270338BDDF0B5269F4ED69370 [email protected]
277,366,672 *1B42B57BC69429D8B0F5FDAF4DEBA8285EDDB604 [email protected]
277,366,673 *1B43874FA09B0FB0E44CAD198EF78E0C7EA7B685 [email protected]
277,366,674 *1B4A79176DC59C0606F98AD2917AD9BECBF6457E baierliu
277,366,675 *1B459645023E60CCAFE98114D203390789D62E27 [email protected]
277,366,676 *1B4AFD7ABAA9A8878393A016D9A0885364F00541 [email protected]
277,366,677 *1B49277E100B38E0799F4FDF221E4BF020700F65 baignenting
277,366,678 *1B49E7A2D11C70BE0665B163B9CA70B0E011383E Baigorriing
277,366,679 *1B402909C08FD4680AA52D86226EC8D321DAE299 [email protected]
277,366,680 *1B485236FDD119711FF946573D0ECA33612ABE58 [email protected]
277,366,681 *1B46917A490E2B33E47A344A937FB8F9EE663DDE [email protected]
277,366,682 *1B4E1D2F22F762AB1F400D54CF6E39F305CE34A7 Baihn
277,366,683 *1B46DF4B71E0D6981BF77FD3022883753DCFBE0A [email protected]
277,366,684 *1B4BEB40E18171A961E179AE73030FF8E9F099D6 [email protected]
277,366,685 *1B4218DBD72910B4215AD83C6F2149D7FEBA8040 [email protected]
277,366,686 *1B4A71598A566CC0C5FE097C32D42F961C6E2E45 [email protected]
277,366,687 *1B4EBABE07CF144B52FB1F280A978933B9B5333C [email protected]
277,366,688 *1B4AF49436A78CD7536B2526941D020705ED04F5 [email protected]
277,366,689 *1B42B523DE2AA277892891F6E61D3419BA7A4B73 [email protected]
277,366,690 *1B4A59932496D375C62334D36B7DD78D8EDEF25A [email protected]
277,366,691 *1B438C73E2EF6EBCB75828C5D8A8EB718235E355 [email protected]
277,366,692 *1B4C9D0448BF66DE15019C9EBA4DA915CCB435F0 [email protected]
277,366,693 *1B49BF3005B676C53F3BAF34D6A45E1DFBAFE6DD bailes(
277,366,694 *1B4BDD706A1712A9FE51492B41DAD2CAF56024AB Bailey230
277,366,695 *1B483DA558189C9F5B68F4DCE035AFCE92A422DC BAILEYCOOPER
277,366,696 *1B4487F7F4B72BCDBFEAB01C3A500DB062BDAA0B Baileydoed
277,366,697 *1B41973335A46027324D83140354CF56B197A5B2 bailey pink
277,366,698 *1B46251BF9CF347A3C4222645281FFE02A50B488 baileyslippershop.comwww
277,366,699 *1B431D728007410F8506AACA9483689F0593EAFD Baileyw2
277,366,700 *1B4381806A3361D393DEA2B2FA94817E999B8AB4 baileywargo
277,366,701 *1B4DA01E2EC67D6AE792C657736995DAD62F0DC9 Baillaitsing
277,366,702 *1B4D3329DB3558D81BDF9892CA56888D6ACAA764 baillie,《人怎樣認識神》,謝秉德譯,(香港:道聲出版社,2000),18
277,366,703 *1B4803352D4C4095C767D364C1C2CA71E0D31051 BaILoRs
277,366,704 *1B4E0DFC6DB785D4E72D309F75381E8DDADB3418 [email protected]
277,366,705 *1B4EA27F0FF08C88B674CC8AE1FB17A3E16423E5 BaIMu
277,366,706 *1B494A026B6EEA150CC8C4B73990047FA15A42EF Ba$$in3+$
277,366,707 *1B474D8F0D23D5FA6D8ADC5FDBFA00420AE7C780 [email protected]
277,366,708 *1B4AAEA5C53F5EA0C86D5DF1574E80E972066F72 baincapitalventures.comwww
277,366,709 *1B48DFC73BEE45A4D8D53EA386959B881C34D7FB [email protected]
277,366,710 *1B4A0B5E4760B5968BB5A8B12D58A210F73281F5 baintoning
277,366,711 *1B4EC8DCA9E74D775B7082DDB6A10DA20DF03DBC [email protected]
277,366,712 *1B4DE337E2258183D54F0CEA34BF9AEF56717D44 [email protected]
277,366,713 *1B4C6F8B09554419AF63F7B5A167412772FC6913 BAIQ:
277,366,714 *1B4123392A37C4953B72BAB43A8988F852D08BBF BA_iq
277,366,715 *1B4E115A6C8E98D5E5334D4F0192CC7458FD2486 [email protected]
277,366,716 *1B428FEE4F96AF22879E1D3FC3139181DF9E87A2 báirid
277,366,717 *1B4C524885544E54046C8BAF8AB63212D1BCAAF1 Baisekis2
277,366,718 *1B48C10342FB281A3B7D2F8F730C5153167C66A1 [email protected]
277,366,719 *1B455B7737D1C95042CA9ECECE49A99CC7E2B11B [email protected]
277,366,720 *1B45A713981D48AF9F5C6FEA98C507C161795C4F baitinao
277,366,721 *1B4CA6CC01A048822AF25477B5CE878C288D402E baitogen1234
277,366,722 *1B468ADE8D2504493ADFF57CA27C6E5E201EF334 baitongnan
277,366,723 *1B494E67B767C11ECC9E18A9DAB4FBE75F5248D5 [email protected]
277,366,724 *1B4900A4F5798CE58306E26924233F4E65342A6E BAITTUCK
277,366,725 *1B448FAC8CC68A794D30320E4BE90615A543F62A [email protected]
277,366,726 *1B4247D0EEE81E161D6E1C7F00BB8C53AFD3BEB9 [email protected]
277,366,727 *1B4011120BCEEDA1E150AEE241F862068029B58E :baixa
277,366,728 *1B4A7178C642E2A0E3928936101F5051223EE589 Baixeising
277,366,729 *1B4B455A80471B44B5B23B08B54D3EBCA1327258 [email protected]848.net
277,366,730 *1B459382F9565FB34AA3C901A76BD51684BED53D [email protected]
277,366,731 *1B400C7B0DDCDD2F07D728F71114909D0B298015 baiyuanque
277,366,732 *1B433F573F8C642CCC9BD1A761789ADF01A95D49 baizhaodun
277,366,733 *1B4F8E7F4DEB798F3CBEDCBBF79BD8EB82AB8799 B=Aj=
277,366,734 *1B4485CE337C375629CBB8A54388785D463CD324 B"aj:
277,366,735 *1B41C709737E6F79378CCBC3202BEFA4FD51C030 bajaoutpost
277,366,736 *1B41C3C2B712D7A359F6E049FA490E57F96BBD04 bajea123
277,366,737 *1B4B45144F4FECEBBCD28147BD7AF8508F527737 Bajeros
277,366,738 *1B4DAB9B4FCE3B18E1D1D0A9B4C2474B7CA0DF03 [email protected]
277,366,739 *1B4ACDA87068B5532999EC45954E60758ED0C7E1 bajicv
277,366,740 *1B47E4555C2EFB1F76A3925C73FF3D7C9253AA2C [email protected]
277,366,741 *1B480945514BDBFAE85A2703B9B71DECB8F5DB4D bajk17jsu3
277,366,742 *1B4668217CE7E54F4AECAE339C95D6835EC4D5D7 Bajkál–Amúr
277,366,743 *1B42A27ADA1B2A079114BD7E81A7B37B72B6EF98 BAJRAMOVI
277,366,744 *1B436432DD89AAD96D2DEC00E540B452D746B8A9 Bajuwari3
277,366,745 *1B4F53A993B702C049736AB2D446FBAED13EAF00 Bajyct
277,366,746 *1B4E3B3B423E8772EC5437D07EF3A683CC04697E BAjZK
277,366,747 *1B40A68E78308A003F348F2592F3C3BD242BAD72 B=a+K
277,366,748 *1B4ED32BD55C587C0705A8D523D7F2C6C9670587 Ba&;K
277,366,749 *1B43D13A51F85A2775DDA792FF6E74BD7CB4A61C B-!ak
277,366,750 *1B4CAD500EB5D0C5C06AAEAFBC1E676A2627D11F Ba.k-
277,366,751 *1B441AFC8877D79BDF4B0DEA6C658B80E5695AB2 B
277,366,752 *1B46B10B42C3A12F677D534C00E0CBEB2ABF4139 Ba?K2
277,366,753 *1B457E008B5F0137ADE1B7178DFC6038DDC2AC3C „bakalář“
277,366,754 *1B4C7FB34CE418269877CAB9E14D1CEC9A5A4094 bakalovorgo1234
277,366,755 *1B434BE7BE05FF62BC97036AB9E75918018459CA bakarsınız
277,366,756 *1B43BC2DDD79CB83B8EF7C35115A9FAC10D8DE45 Bakayohed
277,366,757 *1B4D5FF4D0AEFF12090D195F430944259643E6D3 BA#Kd
277,366,758 *1B4526B8216F2BBDF21D5E028148854AE0B773C7 bakeapple's
277,366,759 *1B4C4334F7D6134CD0B74918FC59512BE127C3D1 «Baked
277,366,760 *1B430DE57377BDF25E50BFE0E9226BCD2E228812 baker.but
277,366,761 *1B4F9D2FCE031C9835C768D6BC1D3DB8990C76AC BAKERLINE
277,366,762 *1B4C88462ECB1A26C05ADB292F5616DB78B6C1DE bakerspe1
277,366,763 *1B4CB88467D13C43F4146A8D115AAC8CD290BACD bakerwoodward
277,366,764 *1B4E2BDFFAF0300F9237081910396E5564F401CD bakgrundsfrekvens
277,366,765 *1B419058B742D6C3599DA836929BA96787C137AD Bakhmal3
277,366,766 *1B433E07CED0040A82B7AF15808D8072E5AE62C0 bakhtygereyev
277,366,767 *1B43F424E5D02C0DC076213CEF5A9E4F2FAA7445 BAKi
277,366,768 *1B42DA2CF26C8BA9E7A52ED5FF51E1BFCFB7BB59 BaKI0
277,366,769 *1B47D36C993316C720E20AF1D2D9426AFC00FCEE bakinammoustafa
277,366,770 *1B4DECBF3BEDB9ECE56EFB8DD1AEDA4F4BA965ED Bakkelund
277,366,771 *1B4E748A9DDF7BEE45BB7FEA1C2E4FC9E4964D48 Bakkerman9
277,366,772 *1B4B20449447D0F729DE8A0B4100DA9C88ADBC8D BakLaVas
277,366,773 *1B4017EBE986951180F81DE347E41D6C5087F560 baklažanuose
277,366,774 *1B4A8D699CF12C39F5B09A044A6E3CD72027993C BAkLD
277,366,775 *1B404C0B1A9B2F76FADE05EA665187B35EAE4F63 B#AKM
277,366,776 *1B45507489F3735860B3DDA407A6D62E11D35827 Bakningsing
277,366,777 *1B46647547CB681B6519645C29B1813D83C7F30E BAko4
277,366,778 *1B4CCDCBD69ED67A1922291C173B900F97F25584 bAKShISH
277,366,779 *1B47260BEF4E80CBD6E8353A577ADB2A58BB5B18 Baksinga8
277,366,780 *1B45455B048ED7F9319BC199DCF7A96EC1959B3A BAKsO
277,366,781 *1B49A805E1F8A6A898464D3A0A97C622D3FACE72 Bakteriochlorofyly
277,366,782 *1B416E78D6EB67E6BA6028572051888335F12C99 bakteriyoviridin
277,366,783 *1B4CCF54F76D6C4574E6DAC15DB2426656F26848 BAKUREN
277,366,784 *1B49A1E2B81C6EC4094B1D7B3034F1A6FDCCC76F bakushuu5
277,366,785 *1B43C612129B4A2A54C34E2CCAF355BCEAB884B4 BAKV/
277,366,786 *1B446A0BC4E55E3AECD69FF66B9E7F0A5E4209E8 BAKVET7
277,366,787 *1B4B600C5EAAD4160A0243CD9CCB089740E5FC1F bakwainsing
277,366,788 *1B422921F9E8792E43BBAF5B6ED8796E75D4F52E Bakweri8
277,366,789 *1B437F373C6B6F5159DC8462D03DBBC881973DE1 Ba-kX
277,366,790 *1B43C2DCB671CC448D416237E1C42703826DA23A Ba;kY
277,366,791 *1B4E95F4E50ECC7AA6A7B485D213E62479632439 B_akZ
277,366,792 *1B4CBF28AC9A2BF4897F9D5EB7A9C70327AE2430 BA-?L
277,366,793 *1B448729733DD55F21B1C0F7B37AB87FFF00DE7A B,.Al
277,366,794 *1B496B897C591397231FF056D6C0A34DE4772C31 BA)l/
277,366,795 *1B4E5178CCCDD32F64DCC32A64C9F100A210CF6B BAl;=
277,366,796 *1B4C7F9388D8854814FC7DC7087259F3C8490FDE Ba;#l
277,366,797 *1B453425E206AF8F7E3EF9085B758B1AB187EB11 Bal8D
277,366,798 *1B40A024B4E5B6BD067E5D898D38EE939F31FAF7 Baladring
277,366,799 *1B41899CC5CD95F292CCF8FE26EF403BCC31BC0B BALAGOPLAN
277,366,800 *1B411B8084D3D9D79D35775ABF6E9E8A678C2715 balaho08
277,366,801 *1B4F4F745713C2C082F33299A89CAC05B2729102 balaïtús
277,366,802 *1B4E6CA3DD27465D12690B15064AD8996A0D866F B'ALAJ
277,366,803 *1B4B02E32027888A498D6C3F3F977971B5FA9BFD balaji venkatasubramanian
277,366,804 *1B4FFAA003ADE12C9D89B6E8E7DAC1B6AC238535 balakandabhedabhedab
277,366,805 *1B4A1AB620FF352EC2158B076D06915772EAC664 Balaklave«
277,366,806 *1B4EAFAAC2D29313D012BA27FF5CA5DEEA6B2B70 Balanceg1
277,366,807 *1B4BFA2E0C3820C9013EE423CB0EEEAFBD9FF988 Balancini2
277,366,808 *1B475B6ED83A625C84299A78320A52580AB0B033 balaneut4
277,366,809 *1B439AAAEAE930B1F842B9FBE0D9BA28E336FF9D [email protected]
277,366,810 *1B48B299ADF50D9B3DA77062DA73F67F93BC6998 Balanian1
277,366,811 *1B47C15D54D94C70318775CCDF627DAD78349E3F balanis8
277,366,812 *1B43DB8C2EDF476AE1B2920C930C9B1692937472 balanitistippt
277,366,813 *1B417EF5559932F6A9707205570645ECE2F1164D BALANSIROVKI
277,366,814 *1B446F487D0E9FA9F37915DA79EC5FD1DB919E7F Balaparamita
277,366,815 *1B4EF613D296A4A36DABA02B81E2A77208FA1D4C Balardu
277,366,816 *1B48D7065BC4F54B27CA764F72C8BC2267B7BC57 Balas blancas
277,366,817 *1B423E85F85BB05B307B9FA51EBEDC091224C8E3 Balatacılık
277,366,818 *1B4F2DD31613E36706A05ABA5C295D510158BADF Balatkom6
277,366,819 *1B4F861E51F99F24E89F3185260AA1C31501B968 Balayogis
277,366,820 *1B45E9C30483F8E8E5104486830958BF5D66989B B_alB
277,366,821 *1B474EA9EC800F5AA7809EEA1F75443559C1A29B Balberdi5
277,366,822 *1B473FB5663D0C6C592A8A622F36AE58F64813D5 balbettavos
277,366,823 *1B4061EE7A75F65C3F3094530D8E6E6DD54D6D9E Balbuzia8
277,366,824 *1B4476BA23D9014D95B37274F57E4E128399A34D Balbuzias
277,366,825 *1B4B2AB075A40348F8AB8061EEEB7C28524052CD Balcarmas
277,366,826 *1B4888A90530687880DE7C05E65DDCBFEC9CF5FE bal
277,366,827 *1B410426168F4189555594F382C4663AB683F665 balčiausiąjį
277,366,828 *1B42746AD34C30EB5D62926F4C28CA438300DBC4 balconies.2
277,366,829 *1B47C928A4FCB712C7A55928E8481925BFB7C54C baldads1
277,366,830 *1B4FDE878C8CB77F62A102D8F6453545BFFAE5CF baldakinoa
277,366,831 *1B40E0AD8A928AA93A11BB5022E73661429C071A Baldanzasing
277,366,832 *1B4B07701A6081A4C8BAEAB4DB06358DEC2920E4 baldeaglehd1234
277,366,833 *1B4E8524DF866ADE1A5FCF7296FE6D7D704F01CC baldmaned
277,366,834 *1B4D88C69951F4548067538DBD15487DDCF166DF baldock2
277,366,835 *1B4AF51492BD53A12CDEEB90F4A6E398A06356B3 baldoma4
277,366,836 *1B475B602855EE6DFB7F05B661B9AAAC6139DDDE baldr1ck5
277,366,837 *1B437B2EAD4560F63C9E62970AE9C378C834E689 baldtube
277,366,838 *1B431FE5F468EB5409837BF0A7678AE6BB288E97 baldwimns
277,366,839 *1B4383D0B3EE33ABB9AC56DF6E5B514A1372DF46 Balearen0
277,366,840 *1B45A358546DBBC3AF49445E06109741958C0073 BALEARUS
277,366,841 *1B4AE46EE9A4619188CE10B35EFDDE71435FB110 balempier
277,366,842 *1B4B7CE0243EFAAE033B1F3DB828581C2E69CF05 bałene
277,366,843 *1B4A95A068F924BBC5279A8628CEDAB37C552A41 BALENEREMOS
277,366,844 *1B44126EBC5D3EF0064715C5BDF100BC671E7ED1 balermanet2
277,366,845 *1B4AF57C7FB6B4540F55D9EAEEDD8AF17A0D8BD9 BALESTRA4
277,366,846 *1B401FFC4F2AD291B45049B142C842629638E2F8 Balestrat
277,366,847 *1B492AC008B63AF032F4C87177320EF2F102262F Balforeus
277,366,848 *1B4BFB9058AC9A231BAAED577DBB79C545B12ACC balgenesing
277,366,849 *1B4A15A32FE386D12A0C020271718941BF0F49CA BALGM
277,366,850 *1B465D1D1474A87F6E7BA8D7C850AAB699AC9484 balgó
277,366,851 *1B455CD1B610C6F71440C33640F0189C49F9F277 Balıksevdası
277,366,852 *1B4DBDC0C2B798C9FD6206DE05A6D609D5CD07A7 baliozianandrea
277,366,853 *1B495B27EBF539A226F0FDADFD0D17868A73537B Baljaren5
277,366,854 *1B4355F39AEC0098D4BFF15F5741A5AE07C3505A baljemal
277,366,855 *1B4DE715FD2116108F011FFCBD2294EEA6F46C18 BALKAN-POV
277,366,856 *1B41B58766D4BF8CB2D3BDBD1233611AF0D8B018 balkendarstel
277,366,857 *1B487594E188686519706B85C90FD40932A8EB16 Balkenhols
277,366,858 *1B4C82F93ADE103D9E8820BEAA2EF1ABEF68466E BALLA5TING
277,366,859 *1B4AB3A69F1B9F48FCC31CCF7D9918FA7CAEA78C BALLA-BABE
277,366,860 *1B4EC5D49E2B5C6B95D29F84A13F79AD46AEC469 Ballade Version
277,366,861 *1B4B4485E26324DBB47D1A442940A13D78951D83 balladofahillbillysinger
277,366,862 *1B41A8D79ED2FF4F6B0481D73C8FD08343148BAC ballad of a well-known gun (bbc session)
277,366,863 *1B494C33E2CD7946CE9EF1D6C31BEC6DFF8F6432 BalladofSallyRae
277,366,864 *1B410F3F627240B578CB24B4D8F64F2ACF29185C Ballaghcullia
277,366,865 *1B4B94FB09797B7ED4FB2697734694CEF29C7A5B ballaí
277,366,866 *1B4C45388EDB7497E15F41591EEF3A3A906265D5 ballarono3
277,366,867 *1B4DFB041F2165A3B361F04F1814272087ED28B9 Ballel
277,366,868 *1B45C8939B5B48CBEFDF4BC20E4D9313CD9CEC5C BALLENCRIEFFRPPIGS
277,366,869 *1B4DA8302469A8C9A1FFE870DD419F40AAD3EA2D BALLERE07
277,366,870 *1B46BE3ABD4270F72F364FA0EEDAD8AC02DAD18C ballet—que
277,366,871 *1B4B1EC0C544A16EBB32B5E00E47C4807109C71A balliested
277,366,872 *1B4BFBE4ED5BEC206186E07913478FCA25EFA60D BALLIN109
277,366,873 *1B4B577AE6AEAB0300F89E3B1C807A78BC7AA84F ballinascreen160
277,366,874 *1B40A73E2F105721820660CB91F504C5A77BF20C Ballised4
277,366,875 *1B46593BD0A8DE1AA43552683313BDF67B969E01 bALLista
277,366,876 *1B4CDBE083F66BA0977505D12EE876995E4A78E2 Balllllll8
277,366,877 *1B4B68E8B255D6B6D19B619ADB46B765F1C96A7B balloner2
277,366,878 *1B4A7A9E22E6A696A8C333B31DF90DC605010636 ballonproeve!
277,366,879 *1B40A99F45F14CDC270E60406C1D833D38124388 balloonist2
277,366,880 *1B4B317351D51072D6086880FAAA843811D3D714 BALLOONSREACTION
277,366,881 *1B4455828A17CE686A39D2FD3520502AFA2FAB4A balloos0
277,366,882 *1B435AE68EE1DF56991CE811BD8FF13728C8355B ballot-access
277,366,883 *1B4EA6BB77CBCA06085EF8F0BDA45913F35CEDF5 [email protected]l.com.tw
277,366,884 *1B40EECCF99CEF41234B0428DA598EB1FD344026 BALLS37
277,366,885 *1B49C1D3D437504488F8C3EEECE3A4386A0E880E balltet7
277,366,886 *1B4FD151FC732150FFFFEC38BA68B1BFCF1487F0 ball
277,366,887 *1B44266C02F10128291866AC529B179D7186008C ballungsbereiche
277,366,888 *1B426E2CFA97E5ECE179AEA0819B669637974C65 BALLYRATAHAN
277,366,889 *1B475253015955CE31DF46EC61DBE585E7050280 ballywracks
277,366,890 *1B46F6F0D5F169539FCF690A71676168DACBCF94 BalM%
277,366,891 *1B472545D760CEE813B793C173C8937A7ADC6CF5 balmert7
277,366,892 *1B4DF78321105DF09F579575ED76B1226F4D44BD Balmethed
277,366,893 *1B4C27BAB2B500F4C57D13ED4B8C2816B8339305 [email protected]
277,366,894 *1B478E40BEC4B829B19C1B60B43709579FD67C74 baln3ary
277,366,895 *1B471BC16E9599650D4729646B000B8680194F7E balnebrich160
277,366,896 *1B4BDBE05242AF246A454F1D80E8474EA80AB26C baloian5
277,366,897 *1B4A44BE8AF9974F65EE305528FAE2C715419513 balomihob
277,366,898 *1B4B173418BEAF23C5C5FBB1A5A68A4B1845AF9B Balonere3
277,366,899 *1B46B167684CFC975A4B5A091F5A6359E6589E2F balooste
277,366,900 *1B48F5757894176EAA3193C8B86B06E1CE11169C balorigged
277,366,901 *1B479B9455AAD91D49F8B25F33EC36F6CC0C6246 balotpropono
277,366,902 *1B4000DE90A7430F3875C069B5F50B47121C3BEB Balpho
277,366,903 *1B4B6423D00A62F66D0F0CE93B8CBFD11E8AD337 BALPi
277,366,904 *1B4CFD7FCC315C10181B3B5044F20F1DC996562C balpreet singh
277,366,905 *1B4AB18416D87B218F2DBDFAA21E28C9ABAC9512 Balquees
277,366,906 *1B49D1C3BCB18D1FE7EAFA65B0BB86797C88CC50 BALr,
277,366,907 *1B4DF283A5561A8CCB423120106BF933225F6D46 balram kataria
277,366,908 *1B49DCE44F07314AB3DC036F4653E378FEA343E2 Balrampurites
277,366,909 *1B48E0AF1FE065C9FE5FED5807F2A79FB971D602 balsamincea
277,366,910 *1B4823E076F333B2D7AC0F2256D299CF41FF9887 balsamspringfrø
277,366,911 *1B42BA5E724D6ABEB192AE11A543E2704AA770E0 balsia
277,366,912 *1B4D7B1A6E9C76166798E9E4A1AE05C3469799C7 Balster12
277,366,913 *1B4F43B121E4FEBF7FB0C3190B536444DE1F44A2 Balsturige4
277,366,914 *1B42F7D4F08D24A1BF7B5F4FD72D23BB65479247 baltassar4
277,366,915 *1B4A2A78D61465F94A92118615BE7F89A72173EC Baltazar: Regi Nostro
277,366,916 *1B45BE64A8A7E8554FB937C334B5DA51863952A5 Balthakk
277,366,917 *1B48B218233E742DE1687C4A5284FD76108747CB [email protected]
277,366,918 *1B4CDB1022BBFDA6D301B363D0936E716E95E9C5 BALTIMOREAN0
277,366,919 *1B4A63EE979E0807FD4FF907E76EE5D6F48217BA baltimorebayreuth
277,366,920 *1B46D629D0D494AC77E6DB62CDD48DBB9BBEAEBE baltimorebelting.comwww
277,366,921 *1B44E1386F68B0796D383DBFE16618B1AF787079 BALTIMOREBOMBERS
277,366,922 *1B4E78CCD4CF25E583361B112DF8366EDEDEEC7A [email protected]
277,366,923 *1B4B827DD37A640CB84B0250D617B36465BACB6B bałtowskiego
277,366,924 *1B428E87C0B23F734D25F8B7F499252ACAEA6713 Bal̃trušius
277,366,925 *1B4905757BF287DD7F2BE4DB0859755048B431B0 baltseanet
277,366,926 *1B4011609FDB85914D62E38FC1BA2BBF397B739C BALTSOFT
277,366,927 *1B42356EF607602A897E9EED31254CA4BBC7D5FA balu6457
277,366,928 *1B49BB2D912286BDAAA92E82A2A130708403356C balumbas5
277,366,929 *1B4E6B399B7502224EE17328D3CEF12A723A839D Balumina9
277,366,930 *1B410DC2E300A4C7D141CA3E59ACA66273764E44 balun's
277,366,931 *1B4E9522498B78AEA2883622B86792E194823C83 balutza1
277,366,932 *1B4AAA68CA29A6FBF19FEFA28E5F0E61C3422845 baluzianæ
277,366,933 *1B4E5B97BBEE463B4503662B28D8CCB710CBA934 Balvaia8
277,366,934 *1B4E97548FF9C3E342E29DAF0B73CA6CE2E920B6 Balwayses
277,366,935 *1B4DE488E926492513F95FD81BE0EB124778169C BALXPOITATION
277,366,936 *1B4AE229FC694278A424C1D8385BDA1189CFE060 [email protected]
277,366,937 *1B4C4E5D3B31D8CF924FF330E73AE857E5174895 Balzaget
277,366,938 *1B4C29D774B4702A5DDC4B93ED930C29C6455958 BAm"&
277,366,939 *1B40AD53C64AF3BDA78D1B84B5BE4CF90E342755 B:aMA
277,366,940 *1B455ABE38D73CF4ADD81A6CDE96582B70D792C4 bamas527
277,366,941 *1B4BF94595C538CD2CE91A850D74790AA158FD4A B"AMB
277,366,942 *1B4E24991B003F7084B28A23BE61190BCC5CB4CE Bambi16
277,366,943 *1B45B5BDCB9792DA40422D82CFD400E52DD0FE4E [email protected]
277,366,944 *1B4D6A2D49867A67EDD89E987982412A3138D0C0 bambikidis
277,366,945 *1B4C66DBCDFEB1A6386B284295209CA8EDFD3C56 bambini volanti
277,366,946 *1B4992CAD56CB06B532CDB5206F6734DFF35B831 bambinobart
277,366,947 *1B4D7AB4096518AFC04559A80F29D0B897906646 bambinocurse
277,366,948 *1B418F9AD7488EB4F01F8491985C1604A54D2468 [email protected]
277,366,949 *1B44578CB26680DF809AF5E57DC19746E415133E bamboelemuur
277,366,950 *1B4F9F384EB85AF06846A813B349C6BB2350E8A5 Bambooqed
277,366,951 *1B424EF2CFA98541847BB90990DABC4ACB11E1A3 bamboozled.
277,366,952 *1B49FFB92C4759EE1DC666A3037CA0EAD1F2ABD0 BAMBUCO6
277,366,953 *1B421E5016C9924643DD7139F8F5B117B509743F bambu$en$
277,366,954 *1B4DA73F81356DB4339E0C309F4D2C86EC3EF0F7 [email protected]
277,366,955 *1B453BEEBFC72CDF610E7D10D80D02FA5ADB3A2D B#AMe
277,366,956 *1B4BB247FE952D114D0509D5BABE08285361CF02 Bamispruimen5
277,366,957 *1B46EB9C0A2676C3E33FD25D1E6DAF500C28F77F BAMms
277,366,958 *1B4DE4304A611CF86F280726F50BA5F9360AA9D2 Bamn
277,366,959 *1B42E1C344BA1E70AB55300157CFB1AD157983DE bamnde
277,366,960 *1B4EF84CE5B4E7DA4E230823B44FB0F514C61FAC bamofaz
277,366,961 *1B4D624FD5F4715E23C9CED5241EEDA7F4A46ABE bampaku-yakusa
277,366,962 *1B45E0FCBE13B4C2DB169E490E4DF2299D2C62F1 [email protected]
277,366,963 *1B45C56D08EA3DADE04A3A5D10493D01C0659A44 BaMq5
277,366,964 *1B4BE5BC367FE931A71B5EF01710E50B02AF0920 bamtali
277,366,965 *1B41A6BCC599A86DBF56F4E26B72537DF63FACFB BAMtm
277,366,966 *1B42EE523BF51790311CC620AD34970CAAACA362 [email protected]
277,366,967 *1B420AFCB02D84C06066F1507E17A18455C23CEC BaMVg
277,366,968 *1B455CCA333A5A16454E631739D8C2204FE05E56 BAMx
277,366,969 *1B4104F45A9C966653ABC66FE43C705FEC45D256 Bamzoom0
277,366,970 *1B45A2355F796F1F60154CBD63DC7B87B06B7700 B$A!n
277,366,971 *1B4B1678505A36E067EA7B2EE8CFD30041448235 B)a&n
277,366,972 *1B4AFF663DB19A75586214C7BBD6BA717D02CBCF BAN0F
277,366,973 *1B40D3DC8537DD4A6FB1B60D81ACC2344C9199F6 BAn2f
277,366,974 *1B40915E5334BE085EAB4E3B3F8CD9120411F950 Ban8M
277,366,975 *1B46C9983E70329163AEBBC18750A0E86DA081F4 banachalgebror
277,366,976 *1B4C413E24EE6529D0E97EB02CB6ABD7B6E2B360 [email protected]
277,366,977 *1B4F925E07D1B19947904DCEB2BA448718F581E1 Banal ballad?
277,366,978 *1B4407C47CE4F9ACD8F4E6BD98CB81E2BEC98126 BANALISERA?
277,366,979 *1B405E70290C31E986404A38830D9B876E1C35AA BANALISIONSES
277,366,980 *1B4AE731E09A4308B00C1D6BD8D0D9D5CC3EE356 banalizarlhe123
277,366,981 *1B4828B24394A7F08AF2C7341C27CF2C8A7086F3 banalnu
277,366,982 *1B4CFB5EBA0AA8912AB193D9A84B2551304784E7 Banana Co (acoustic)
277,366,983 *1B41D51DA604A22CEB611533F20DEDFA44315885 BANANAPO
277,366,984 *1B4CDEE73C893653FA51B3CFACAB91BC7072FBAF Bananeass5
277,366,985 *1B48AFCAF9D8A7AB241B7081BAC48E33E9AD09DD Bananev1
277,366,986 *1B49B74CC229F852A94EC4CC561FE1ACF99694E7 Bananex3
277,366,987 *1B4486DCEC50C711BC36296B3AE76471CDE3B4B7 banannery.combanannery
277,366,988 *1B4F3BD52E3900A4097E7B227781D1EAAB95E9E0 bana v
277,366,989 *1B491A38148793B1129E7682B6BD4EC357A14F43 banbwm
277,366,990 *1B4DF9E4B1BBB5F395F07A550E8F6D1496E45FFC banchyBSW
277,366,991 *1B441BC6C99189FB23D7336083C861992AE7D52D banco_popular.svg
277,366,992 *1B4EAF8ABF29A737D6FDD907707ABB7119435C5B band2322
277,366,993 *1B4EE126346A6EED6A41B5CC90A27D86781E0ACA Bandajlatmak
277,366,994 *1B4B0BE301BC9ABFA25187DBB2FD7147C9CE4D89 BANDBAJA'S
277,366,995 *1B4A06F0AB1FF49FE2A38E8F16533882EA08F347 båndbreddedivisjoner
277,366,996 *1B4FAFED9E86725DA8B1E284726FA0FC60FAB8A4 bandbunitedstates.comwww
277,366,997 *1B409B5889F3E70A2C37FC172F8EDF34BDAE09E5 Band!c00+$
277,366,998 *1B4306EEDFC091FC018FE77CA1614C24BC2BFFC7 BANDDORK
277,366,999 *1B4A8AAEB1F93E654D7F627525067E495EBA6905 BANDEIRA-XAPURI
277,367,000 *1B4DFDA2DD7FC3917DF931A1B3542A893FEEFFFB BANDEN0
277,367,001 *1B4C503C72BAEAFEFB191311E2EB9A2276647E52 BANDENNA2
277,367,002 *1B49A693E08205858C7AE85E3FA72B09A491EE28 Banderale3
277,367,003 *1B4D1F727ECC55C7546494932B4CCE93146FC941 Banderolens
277,367,004 *1B44E3F6F11243B66B4DF9217A3D6E77B83DA46F bandidinamo123
277,367,005 *1B42ABCFB617A4232835A7A2B32C915FA4EA6C04 Bandidt7
277,367,006 *1B49E7843E446FB82F383ED7169012B9E609DFEC BANDITKA339
277,367,007 *1B4B85FBAB52E48A9C201533B77E6C5758723DD4 bANdItRy
277,367,008 *1B460E97EAA758F1ED34B4C2A5BA3FB72F753B7C Banditsun0
277,367,009 *1B4B12A9544E9CBFE6C4B55A6DDFF34EDF81DB36 baNDIttI
277,367,010 *1B4D2A52114B4B6AFB0E675F1896D34979C0A8A5 bandle$$l
277,367,011 *1B4AAA8504F3B32FF58737685F5694379DFB90AA bandouli3
277,367,012 *1B4203F9F1FAD084BC24E2122CE01CB35F3090CA bandpassverhalten
277,367,013 *1B44D55ED36143F85082CC7BFAACCF3965F32A70 bandreißerkate
277,367,014 *1B4C2E3421564B306061DCF3B1879133C04CDE6F Bandroll3
277,367,015 *1B4A8D735E227F8DFCE2E31F3E5A292779B8A155 [email protected]
277,367,016 *1B450EA03CBC1516C83D086E8AE96B89883B0B82 Bandstoot0
277,367,017 *1B405DABFFEA3594D29933E5118DFC854FB96191 bandw1dh5
277,367,018 *1B4C598E6FF1159BF9A37D5902C4A10362CC68C3 bandwldth
277,367,019 *1B4A51DC6233BDC0E8606AE47AB8AAE8A378940F BANdyINg
277,367,020 *1B4A5DEA6A7C5E862C4F1F6497FAE0E9D5BD2F57 Bandylegsbow-legged
277,367,021 *1B45C8BFE699DE88357EAB72C243641AF2DDC758 B
277,367,022 *1B40E2E51F9A7BC747DF151CE4CB217F4FEA37A2 banegash
277,367,023 *1B443CFAB89DCF518C3689E7F1CE3A6B138A4D64 B,ANF
277,367,024 *1B4C79ACF35281DAE21E067C79798F29E23BA473 [email protected]
277,367,025 *1B49FFE8F29E5B4A05455A69234D9DC71BBD2D25 Bang2gether
277,367,026 *1B46F932ADE584A51A3707B4A10269ADEED0D202 BangaFKold
277,367,027 *1B41A9725B98E74CD140644DC7C895781AFDED6D BANGAUTER
277,367,028 *1B45CD1F8E6114AAE157CA7472CED7F02252A56E [email protected]
277,367,029 *1B4504DBE116E6EA45068B8F21EBEB64777AEE7E Bangbung
277,367,030 *1B424044D1728CB8D6B2EE69584FD73F0FDDE3B1 [email protected]
277,367,031 *1B43DCD83A435A2E05272930E9BBEAC04A0106FE bang goes the drum (and you're in love)
277,367,032 *1B4812C8BC244131D4988FE991304E32870F2704 băng hình
277,367,033 *1B402B20559F2A4829EA6E546F98B5A1C4FD2594 bangittigudihal
277,367,034 *1B49E8B3AE1EC8395F0A136527CE6D208ADD71A7 banglapedia4
277,367,035 *1B4AF7C451623C4BF897084EC2292D6E2684AFF3 Bangta!l
277,367,036 *1B451495A79248AACBF3BDBCD58CB6DFA6EBF2E5 bangtam7
277,367,037 *1B425B94A5825EF11794BB0AB0D91B0D877A6560 bang.the
277,367,038 *1B4372E76E2946C50C05F7EC84503939B0587E30 banguoms
277,367,039 *1B4CCADB1D3C468086B2A8645D2AFB966B790370 bangup2
277,367,040 *1B49D406E330EDC3F41B6D9C61944347F292025F BANGUSO
277,367,041 *1B447B7697D4BC2B7C2C951109B5AE643E8689CD banharlhas1
277,367,042 *1B475EAE605131B27EC28D68658CB6C63727F4D1 bánhegyesse
277,367,043 *1B40FCFA7472F150E5B2561DBBF34CBB57EA9D6A Banibino
277,367,044 *1B4D4C348C72A5EFF8E9674D6EB924AFEAFCF102 banidjúrida
277,367,045 *1B49843CA3A357ABEE989DBBCCAEB98538F40374 banihāri
277,367,046 *1B4F5D76C896269B4CB9B0DB39961BE58AD09730 [email protected]
277,367,047 *1B423571160142C08A4B2C1D9E9A625E1EA58C3F banjulsed
277,367,048 *1B434733395C8E9AAF60A610073995890E6839F6 bank
277,367,049 *1B444231DD139373558B6DBECB0FAF6D4716B1BA BANK-CUM-FILM
277,367,050 *1B407E63CF607694881EBAEE74764F9BBF4DBE0C bankdeposito8
277,367,051 *1B4FBAA1E35713CA4A200E1C6A7364D2B6813CFF Bankini5
277,367,052 *1B483D10A73D106885B2678DD57F67FAC1AB75FE bankinspector1
277,367,053 *1B4CD40F2A6E37741176AA7C92D9E9840396F058 Bankista8
277,367,054 *1B4A934204F7F58D92E1E75DA4442A385D5F5B11 Bankiva7
277,367,055 *1B429C017D4F8D930B385E421D81D2CCE7236C88 bankmand5
277,367,056 *1B4BA2B2469DFF7B502B65F46407C0BCFD8207B1 bankole's
277,367,057 *1B474F625D991A786E747B22420E74FC298B7E1A bankrege7
277,367,058 *1B491E859BB751BE3A14E2D7BEEC5D55DD116359 Banks09
277,367,059 *1B45C2E20966767EDBCEB9D7423025393ECEB9B2 Banksama6
277,367,060 *1B4EFBB72580EF8DADD55D6610333508319F52A8 [email protected]
277,367,061 *1B48DCE27AAA954D75326D9ED01C07B30F76EFDE Bankverein“
277,367,062 *1B444D5DE3F932AC8812A0A851A21103BD835B27 BANKカードVISA
277,367,063 *1B419519D0A3395C1A26FEA7C50A8166514B99E6 bankvo
277,367,064 *1B4B137DB80C6FED8FAC5B84118B7D0AD16CBCFE Bankzaken!
277,367,065 *1B4D982344DCAE490E5C2D224C0C6547E19C3D99 Ban
277,367,066 *1B4B9A81F8100FF54D83BA1B59D01AF0EAFC247B [email protected]
277,367,067 *1B4B2B67FE081CEBF3289BD7F6661B7A7A1F8775 Bannerfish1
277,367,068 *1B4DA9E3263B89323645F5CFCFB0A94E341D2C69 Bannerol6
277,367,069 *1B437126D8D2BF5CDCE6B444951DD67EE786DB3C bannertherapy
277,367,070 *1B49F69FF2BE1D80A190F0B4B90E3889631EE01D bannirait0
277,367,071 *1B47BFAFD60C3E1E8BB0C306C82F0A814A04DD53 Bannocked4
277,367,072 *1B46D46DEF7F2DAA257E690D8E02066CC707CB39 BanNOCKS
277,367,073 *1B49FE619A08B85B838526D3F4835CC9762FEF55 bannoukis
277,367,074 *1B40E99ACB3D96275424BA7DB70E0A50E14CFA73 bănoase
277,367,075 *1B43E8B940524DB3967B3E7D366C497289190746 banoonooz4
277,367,076 *1B4A8FE80755DDC53E2150306574E0123D711982 banpâng
277,367,077 *1B45C96965FD5A9B5A2EFEE1B4070E41EE364BE2 [email protected]
277,367,078 *1B4113A3CDDB1ECECFA1F00247A1702944305404 BANQUETs
277,367,079 *1B485D623E3A9D7F9346A94ECA5FF12B91CA36EC Ba&Nr
277,367,080 *1B402E1943EB1188F09D24C1016687FE7DABEA84 BaNr=
277,367,081 *1B4F16FE094C8F5F4E0E05783861A103EEF22D60 Banschaft“
277,367,082 *1B449532F31A5A1C2F07FD8F62C51524E78B41BC ‘bansfod
277,367,083 *1B4556146A5EC51758A6FFC3F066A3E83650B3C0 [email protected]
277,367,084 *1B41EDB2A2006D6A1A773FD3D6D188B0EB77E1D6 Banshee的主界面
277,367,085 *1B4325359028E971AB7722C524AE5703CE04312E BANTAMW3I9HT$
277,367,086 *1B4211570375A9A91DE7702479BEE74D04248709 BanTI
277,367,087 *1B4614D408AB6AACEAE57005713BD74AA6CEC91B Bantinuses
277,367,088 *1B41859929893D8AB0E7F38CB4C7C1C5B9C4AA9B Banton1234
277,367,089 *1B41C9951D96F6F00BEE70C34BF4DFC46C78CC16 BANUINVEST
277,367,090 *1B4620B426E6CFBC4C30F96156A4BF23799FED69 Banunbsw4
277,367,091 *1B44A0C9C6AC56D342C340C509753C160B27F31C BANvG
277,367,092 *1B42309135190D0698975A1DF1886E16884CE843 BA-O1
277,367,093 *1B4751801DB61B8FCC760B7D05961B14451E955A Bao6C
277,367,094 *1B447FF9AE8AA946610DF2099BAB615402F6F2CC baodc
277,367,095 *1B4D6883C59D3ED1F260A53E12EE5FAD498A7839 BAoj$
277,367,096 *1B4FA56CE44314C295D31F6BE31A39F2F217437C [email protected]
277,367,097 *1B4079EB4BA704F0FAC2A0D0C6756798DE9E28DC baoming7
277,367,098 *1B46AF60E4F0229190DD60091EEDDAE35A31F951 BAOMt
277,367,099 *1B492356240ED2499EE4633894AF06A131F69B7E BaO%r
277,367,100 *1B4C778DCA5EEBBA490A11DC89FEEB9CB4EAF531 [email protected]
277,367,101 *1B4404031CB0E3AF8D4C8097EBB1514A7F19838C BaoZu
277,367,102 *1B422715313D34BBA45F1C40116C093693708CDD Bap0t
277,367,103 *1B47BDF54B019B50A2640959D800FAAB455F8366 BaP/c
277,367,104 *1B4F6ACBE8A7DC510EBC2E7EEB75B3C8475DBC13 bá phụ
277,367,105 *1B44A89E8DC0DDBF7CA2EA22B0D2169B60FC15EB [email protected]
277,367,106 *1B45C5FEB29A8FA1C5F5C0591E979E5C04D95724 Bapjtpses
277,367,107 *1B479FD69EF7BFA2F201B67EB8D3887C695D3DAA BaPlj
277,367,108 *1B447B120A3002BE11DA45D9D014C2683D203F21 Bapmd
277,367,109 *1B42D7C5097AA5855DCA012B5A736314F2BFB785 [email protected]
277,367,110 *1B49DF74991D51D4906BF9DBDE9BD37D089DF4B3 Bapprocbez
277,367,111 *1B4F648F301F7F6BF2B17DC275F8EF100D90797D BapQK
277,367,112 *1B42B9C1651321B571999450F948697580F6CA7C baprivateschools.comwww
277,367,113 *1B438C36BD5FFB14EA04272ED32AB8CD9098AEE5 Baprw
277,367,114 *1B4AE37745ED6BD98A8F6E5D144D665B78CBAAA7 BapSO
277,367,115 *1B4E2C7FC5F59D913E6A2A049C278DACD52372F0 B:Apt
277,367,116 *1B45717299C5613B02725E5D7ECC3FE564E30E78 baptizandum
277,367,117 *1B45A16A5A8947975C2949EA7FBA4426E5BF3EE6 baptlegrand
277,367,118 *1B495450327D8F212CA6E8D0C5ED8DA8A0F61CFA BAPuR
277,367,119 *1B494FCE605199F47F948FEA92B75EBF12DB4A03 B(apw
277,367,120 *1B4426B5B2A60ED5CF0B5533392ED8A023EE7FE0 B_a,Q
277,367,121 *1B4F531D4AC19872201793FF1005D3467DF60318 B?aQ;
277,367,122 *1B4ECFEBFE4C2DD1C694B1765CA93A0F04D8F806 BAq45
277,367,123 *1B429ECFA6FF58DF299C000A7D27974D35C29952 Baq4B
277,367,124 *1B4A14AFFDE687C54818C14A8917BEE285A7589A BAq.8
277,367,125 *1B470F7D1ECF712DD190F2DBC91C1BC0026A42BC ba·q’ál
277,367,126 *1B46F747070B1D0C6AB1D881C36B61B867451376 BAQbn
277,367,127 *1B4E33A2D170B6F371B55FFEF10F801E66270668 BAQ:D
277,367,128 *1B4DB09921DEF56E891CCF136DF798C200860F6C BaqGQ
277,367,129 *1B4F30555B86906E810443AAECA3A4C50144013C BA-qH
277,367,130 *1B485BA754B4955F1771E121EF65C2AC80ED89D3 BAqKE
277,367,131 *1B41397FEE913A5A9D7E68BB593CBA55664D65BE BA!Qm
277,367,132 *1B46163CDBEC31FF6F2F69BA9FAB519F3C6B6524 baqqiv
277,367,133 *1B484A24094BBCF04CFAAC4DA13E19EA38CB5B3D BA!qS
277,367,134 *1B484321B2C8BCA57044CEF01E8602A48669AD91 baquet160november
277,367,135 *1B4B41A79D844D23653CE73587F2B8A72867D040 Baqueteas1
277,367,136 *1B4771E4693A56AD514C67FB6D0BBEB79B4DE0C5 BA"r!
277,367,137 *1B4C3356A3BA3CE30538E64B720DC33CBF495401 BaR5%
277,367,138 *1B4573BF5D9C5F8B428F729EF9523F7567B7CE41 BaR9/
277,367,139 *1B4AE8439AF6B2CCE92BB33CD28DAA6998450EBA baraguny
277,367,140 *1B402A37708E2DC802D1C69F3117D63C7575F111 barakshimoni
277,367,141 *1B48E6574078702926B80C1E949D4C2F18458A91 Bara Miles bl
277,367,142 *1B48D2817AC85E2C993CD00B07015A5CE42BA66A barangayls
277,367,143 *1B4E4912FD2C3FB7E7A89642B8152BAE0D9577B0 barania4
277,367,144 *1B44B151150C4D7779E864CFE57D9FDFBBD33EC7 barawahi5
277,367,145 *1B454E1083BFBAFBCCA55FA5AD72631610542EE4 Barb652
277,367,146 *1B455B104993E1CE5AB0A885A1CC4DCCA6CB5C9D Barbados19
277,367,147 *1B439F901D3D6401293E4F13AEACA4B11D42C79E BarbArAanne
277,367,148 *1B400768B943BD2D58A6601F57841997B8045983 barbara butts
277,367,149 *1B409D37CB6E6ED22AE70A83214B3A058EA46159 barbara dailey
277,367,150 *1B427ED081F2D5E030C443D7CD1D69162EDB9055 barbaradrops
277,367,151 *1B4B229315B66F49AA354DBB4BC653FD0F7EBBDB barbarads
277,367,152 *1B4F2DB64821ADC1EBD3B6A9F07CCB57F8D8D19E barbaraharnden
277,367,153 *1B4095E136D844027951BE0B0145425128B1C07E Barbarahockey1
277,367,154 *1B4F153DC48E01A121F6526646D5A8640720D627 barbarajust
277,367,155 *1B4D845B35A5A215B76F8FC1FDB9B1A0AF38D6A1 barbara lamphier
277,367,156 *1B40D8C621F6EACA33DE8E2C482539CE71F144A1 BARBARAMORONI
277,367,157 *1B4ED15FBCE9E6C09BED6F41FAB433F529270D33 barbaraprestridge
277,367,158 *1B485E1D54160C4A1DB25426FF8BF70531B22038 barbarasoap
277,367,159 *1B474A91C228360D1E04BBCE202FCEE4645ADBA9 barbarastanisz
277,367,160 *1B414B9BA9EFB09BA6CAD42396DF3572708736B0 barbara toner
277,367,161 *1B46C208321051E97CDDF3071D26D82AD0D1CF42 barbaravermeulen
277,367,162 *1B4C3269AEC61816F2031B1E7453D3E0B7997B96 BARBARAVINCENT
277,367,163 *1B48A906C3B23C6ED0D0DE858A5784DFB249C039 barbarax2
277,367,164 *1B4AF4A4BDFACF3E250A346E14382FD95AF516CD barbarei”
277,367,165 *1B4959C5ADF8DDC329C2BEE432FEFA30A87EE355 BARBARESCHI
277,367,166 *1B464C7FAE3CEE8E6A34ED6F2DF0E9241E8E326F barber162
277,367,167 *1B4E4DFCCA61748ECC2E720CC0FBD456B4FC3347 BARBERA-IVANOFF-LE
277,367,168 *1B4235D4EF39D8E63FB0375569FD3675718EC845 [email protected]
277,367,169 *1B416B698984AEBEBAE0A0A53F6FFCC6858EFB3F Barbershops2
277,367,170 *1B4146DC406835BA98373A6CEAD427DC0E9D5C13 barbersmile
277,367,171 *1B429977312740B5034FD85AC291506A5F629445 barberu2
277,367,172 *1B40ECAFC7ED3F83DB9B573A2706457406D1625A (barbican,一種加強的城門)與重建城牆兩側、分別名為凱撒塔與蓋亞塔的堡壘後
277,367,173 *1B458D214F8B9E78E9000A5B59B027714D25742C barbieelsie
277,367,174 *1B4BAD572C05FC9BA6BFAFE97B2B184FDC3E1F70 barbiepoole
277,367,175 *1B49E4A5DD201C534CA7EF7548EA97AA40C28C90 barbiere8
277,367,176 *1B4DCC733C21661A7D0317D54DA60D2B740A7EDB barbieroyal
277,367,177 *1B41AF7C21D9122EC447B3856F36DC6C1A639243 barbjv
277,367,178 *1B49D1738233E30B879953EDA0808D161AB3CFA5 barbkraus
277,367,179 *1B43CBC3F7C1795BC097F76088007C7623DABA7A barblene6
277,367,180 *1B49D27767B5538DC757A27FA9C213BD491A6399 barbloms3
277,367,181 *1B44F9283B0D20B23B1FD7B00F64D59FFF81BE6C barb oneil
277,367,182 *1B41EC02919E783F8C4D57689E91D3B00B4A33F0 barboza-c
277,367,183 *1B4A322143A4C6E6603556D0F8E6067B8641753D barb stryker
277,367,184 *1B4E1E1623BAA3BB85C5E18C7CAB6F5EE513F00F [email protected]
277,367,185 *1B4F45858DD4BDAF2DB251EDBCCA960625C6AC0C BARCADEPUBLICATIONS
277,367,186 *1B434B5744572DC7EA92DA7FB45BB0FBC2A0E96A BarCampChristchurch
277,367,187 *1B437C2B41F73B465C3B756DBF93F05960C3FD71 Barcann0
277,367,188 *1B4DEF40C15B301B6D0E80A0D3B8AB2675EC3E50 Barcarolen
277,367,189 *1B48E8512BFF98C8D2C438F67622F161BCBDE67C Barcarolle No. 13
277,367,190 *1B45A2E428FD6B5FC4680ADB0BA0003E10882B77 barcelo.comwww
277,367,191 *1B44FAC566AFF259633F78280DD54C9B45099F8F bárci
277,367,192 *1B44608D712969F38C1DA353CF25734E03304959 Barcolor9
277,367,193 *1B4B68A38040F4F9D209DA7DF66C4B2F6F8A9209 barcus-berry
277,367,194 *1B43B0032B590BB9707865059CC2E2631CD0BCFC barczejj9
277,367,195 *1B4BFA680CF06FB740FD1D58D05132DC12CA70FD bárczy–harrer
277,367,196 *1B48E368F1E4564D8F46FBF97EA18E09FC32FB34 Bardassa1
277,367,197 *1B4DA3A63C8AA09881409C7C6357A732226DE156 BARDAURI
277,367,198 *1B4258B01C1E1CB4B5B8FD254CA73AD3BED2A122 bardavi5
277,367,199 *1B44DC1235D86B931D39C5635B58AA211D22A2E8 Bardesanited
277,367,200 *1B444DA857B8A011630BCE00D80539AF1B67168C Bardesses4
277,367,201 *1B4A8120B46350D0AF4EC4C4C078B2F94A68AD2C BARDEZ0
277,367,202 *1B49A871F0941B8CD1F8CEA6C320DE286E87A064 bardisched
277,367,203 *1B412D5A92CB01DFEE841DF0669B16D6E4F4D8D4 bardnet6
277,367,204 *1B43874DC35B300D4337DA3EC0E0AF7F1B6DCD4A BARELIES
277,367,205 *1B4E91B763943F45712442AB1D00909F760E5A72 Baremune9
277,367,206 *1B4EDDA0B6A6499F252C2E1B74C0AF7D59E23013 barenboim1234
277,367,207 *1B441B4E2BC8E79387447507B702D07098D9E251 bärenträger
277,367,208 *1B4487C6C6A6E3D0F0FA48B6BA568A0787B73876 barents060209
277,367,209 *1B4500A97EA0398718587B85D1DC57843028CF7C barettipäisen
277,367,210 *1B43CB8CC6EA83CFE6D9F710D0FEDAA3C6DC5B0C Barfield0
277,367,211 *1B45FC5C461FE40C5526AA9030E6D506229051E7 Barfrost5
277,367,212 *1B4049721FF5AC337FA5279883122E1883A070AF bargaglini
277,367,213 *1B4ECE2472A46E6171127E68C8D7910E465B108A bargeldbezugsfazilität
277,367,214 *1B4B08162A2FE82BA98985C02A3D05C925E14310 BaRgEMan
277,367,215 *1B4B2917C73BCA49A66F158424997469946FD66B bargfrede-ich-bin-nicht-einer-der-gleich-am-rad-dreht
277,367,216 *1B46FF8CD26D9D1F8F36226874BA71301CBBEC39 barhomashams
277,367,217 *1B4375343F0F21E4622600179DC34C37AA491549 Bariked0
277,367,218 *1B4B4BD5F10CFB9FFE7D2618D396808ED62654A7 barionim
277,367,219 *1B4034CB78BDB4F21191887D5059A99DF17DA2C0 barisaŭ
277,367,220 *1B4B362CFAF3E2D46A58E598A0FBA562B74DCEE2 baritone555
277,367,221 *1B47239057F739A6A4F8D67B22DA833959149DC9 Baritonin6
277,367,222 *1B4A42E72B98DCA44CA185EDB2F5BFFD063D0C65 barjake5
277,367,223 *1B4A1EE43DF7ACCD72D9ACB6FE2BD34F6024C221 BArjs
277,367,224 *1B42467CB75A1D7606004A89D5210D5CE0A89ACC barkayk5
277,367,225 *1B487369940C73DC9385B087FCBCC4FD522962A8 barkbillen
277,367,226 *1B4032B53B20B15A0ABAF9FE9A8A35857D0B0AB6 Barkerying
277,367,227 *1B4AD2A670DD7C60234472E84E1F35A1387331A0 Barking2007
277,367,228 *1B4AA5C6B86A1367D15B5D5AF0ACFA5179C36989 barklaq
277,367,229 *1B42050991735EA5F9EABD8A5D916030C109B82A barkskibs
277,367,230 *1B449268F502D90D001F165B07D6B6B5F6197EB9 BArl?
277,367,231 *1B4AB198FB4859C36F1611336D7D0452CB2D8012 barlangemelet
277,367,232 *1B43D87A8EE7658442E39053E251213EEA25B176 barlanyp
277,367,233 *1B436100F1E69EB8651B55910C81263A90C69C35 barlassteve
277,367,234 *1B44822C5CFC428CBF09CE3B959BD3A0A61C2868 [email protected]
277,367,235 *1B46175CCF96DAEE9BD27CE20BBE41824CE0A9CA [email protected],
277,367,236 *1B4FB5E0119213F4BA775D29E35FF5275F027F20 BARNACLED?
277,367,237 *1B4F9CC321E29CABE959F6EDC09F3D402E53A5F4 barne
277,367,238 *1B406A13AB4ECEE70D86784E7CC29E57C7E7121F BARNES52
277,367,239 *1B46ABE5C70AC4C9660541791EDD6D15BF2D0982 barneskr1
277,367,240 *1B412BEDB184A39B3C60147008CC82B45A43F64F BARNESREPORTS
277,367,241 *1B46F5533FA605C6B9EDDBB2B4B18E43DF3EDFFD barnesyk8
277,367,242 *1B471E3230ABB45AE534016A71D31E2C012986D6 barnetyhaorg
277,367,243 *1B4E9C7FC379674FD4D9346BCBAC16ECFE9DEFB6 BARNEVAKTEN
277,367,244 *1B4FA3B566BB7A12D319952205D8DBFD1FAB2CCB BARNEVANDRINGENE
277,367,245 *1B465FDCB370546D2999D5F67C068444F632A422 [email protected]
277,367,246 *1B4BB35734D02265E8F220202D77A5A900B236A6 barney.b
277,367,247 *1B40007EFDCCD8E9B7B71867B355179AD17B47BF Barneybe2
277,367,248 *1B45021FC84538D2C17C9CA26A6E3E424F12BB3D barney.bowery
277,367,249 *1B40343BDDDD784E7E74E9524A56D1839DE5D00D barney.collen
277,367,250 *1B4EF27F6823B7FBE69082A2728B5B83CDC468FE barney.deus
277,367,251 *1B431E29355C06AFA9089B99B1719F30F417EA29 barney.drouillard
277,367,252 *1B40A5F0C18D747D2AB176272ADC0796E4499241 barney.farid
277,367,253 *1B4463A1BA607F86CE1F2DF4F75AB31094D7DB61 barney.fasci
277,367,254 *1B4FB2A7A3E251C00C25A0EA74E49C8217D51FE4 barney.filipovich
277,367,255 *1B4897E1FBE0C480528B72DA3A2B183F4A37A22E barney.fly
277,367,256 *1B400CB9838AED24DD78AB7AE581060767A07F3E barney.franz
277,367,257 *1B40FDA7FB0BBFDDF8382D587573BF69323AE2EC barney.hansell
277,367,258 *1B44FCCE63CF09B388E45325E7DAFA12C7D77EE4 BarneyLuvsYou
277,367,259 *1B43C8D4A9C0390C35958D9704286DE720715D83 barney.morss
277,367,260 *1B4A727E82D6A9F40A988AEAA990F4C5D25E6B00 barney.patchen
277,367,261 *1B4914D7D235C4BF8F2D53E4A56F9A75D75CC818 barney.santoy
277,367,262 *1B4492DCD18EB592DECCA019F5A8CDB1FF26F6E5 barney.schnelzer
277,367,263 *1B4EADBF54FD6A1F083E9759862A9E699A3B6741 barney.tufano
277,367,264 *1B42087C632FF072CF7734E1D4448CB3BB2A9C59 barney.tutterow
277,367,265 *1B4B608351092AA9CE8B1CD186C2D8C65B31A473 barney.vitolas
277,367,266 *1B4A9FEE54338BC3B3C4E6F8962DFA3740183E17 Barnledo9
277,367,267 *1B42D6E063025E8BE2D7EE74730C9F747E4A6FAB [email protected]
277,367,268 *1B4052E9A9540788183EA8F6E65E35713F72DD45 barnsagors
277,367,269 *1B4A32757DE7009C8F74D79F6B3F59912F80D1C1 barnstargood
277,367,270 *1B4157A1B76F515E3665891EA8F0471E534E1533 barnstorming7
277,367,271 *1B436A50D5418CA49244F228E14A3B1A9CD59095 barnyard95
277,367,272 *1B4798F15AEB6E5B9DD54A64A48E5C19A18142F0 BA"rO
277,367,273 *1B4F8722C64C839EA5FF37E485EC321535FA1FC9 Barocktage
277,367,274 *1B4673C09B567EE62420E00F484455D7CE0C9984 baroclínica
277,367,275 *1B40C56F613E7EC9BFCA3FA39686024FD36FC4EB baroied
277,367,276 *1B44338FE8F70D11BAF4E67D252D4F23DE386365 BAROMEEMORAB
277,367,277 *1B419E06F10D9B46107EF54E834AB1EEDB1EFDE6 [email protected]
277,367,278 *1B49275CF1C0337D5A5E10CA02261467A972482A baron bum blood
277,367,279 *1B4D3EAAD0AA64EC9FBFCA8661189D131DF8498B baroness»
277,367,280 *1B4A06423DB2533046435CF7C7ED0B3DAF304574 Baronia4
277,367,281 *1B4E4EB1786CDD22C540B12E7142F2789DC453D5 baroninc.
277,367,282 *1B4680286314A69CFE447B4C41A9A63078D96D49 baronio9
277,367,283 *1B46AF9ABF339B2F28B1B0240CDD585F6343C4BA [email protected]
277,367,284 *1B4B6B6E68D81B2264B82CA4ED387F450FA5ABA8 Barótfi
277,367,285 *1B4139898F8A874AE2A6575B13F3C4B24CF2A8D1 baroude3
277,367,286 *1B44083E0F42C5D90081ABA09C6E52C17F0EBC8B [email protected]
277,367,287 *1B4BD123122FD95259EB1795500CAE00ABE032D4 BA(rp
277,367,288 *1B40E6F6F482B7635727EF6A189BAC99D45F4306 barque-rig
277,367,289 *1B4CB1A659065343DC25F035AB228AD86B2BA681 BaRQuEs
277,367,290 *1B445AE43E788D99D9C60ED5361B8D0581E27A61 Barrac1ad
277,367,291 *1B49E251948368D6E48D0C78C42D1910CF363DA1 barracan8
277,367,292 *1B4A4C7D8C4C07DFF34A146B8C88831422BCD665 [email protected]
277,367,293 *1B43C3F8DF8C45CFCC3BF882C403C133AF07BF78 Barraggiing
277,367,294 *1B4CF03B4D4C7616D88E844DB57CDC2600384AAC barranquilla »
277,367,295 *1B47E37CF9D7652DA00D911F3F6CAF7D9B00B56C Barras»
277,367,296 *1B41FF562853139E7B1979D12A32CC745F713CE4 barrasseront4
277,367,297 *1B428817A59BC83175A163C9242D9DDB9638CDEC Barrasseront6
277,367,298 *1B44CAB503E09CD1745B4F72A3BDACCB3963B776 barrerebbero
277,367,299 *1B4531CA2A6BC331D2C27688F028A3413E3834EE barrett.blanko
277,367,300 *1B4A45EAE92669F7561C43614DB7B6C707849D3F barrett.braziel
277,367,301 *1B42586B6751FB759558C02DF9A0C7A363C56227 barrett.certalich
277,367,302 *1B43AE6BEB72CE670F424661063B966ED647DAC9 barrett.chowning
277,367,303 *1B47EA013B69204F8B46EF50469B0550EB4489DB barrett.decelles
277,367,304 *1B43EA2ED461992392B837B04DACE158B1713200 barrett.dungee
277,367,305 *1B4C1B660F4940D430233689411863D1931ED5D2 barrett.fenster
277,367,306 *1B4B2DBE47BEA77A5C03A84281A7689A7CDC7115 barrett.heidelburg
277,367,307 *1B4407A48069BBB7A567DEF27B0ADCA8026AF305 barrett.hudon
277,367,308 *1B4FC07E99040A9E3070B8E2624E66588E1EA932 barrett.koestner
277,367,309 *1B4D7D2BCCC660FA274610AE95134507DA001D6D barrett.lime
277,367,310 *1B42CA8C7F8E2681EDB030FC857A250A0FCC57A8 barrett.lones
277,367,311 *1B475B366A9C880F9C4A1D314FC99711804BF226 barrett.malara
277,367,312 *1B43DAD2EEBBEC11A7B0E8976D00760D609704EA barrett.mallard
277,367,313 *1B4660F07ED71F84BCAFA08D9E18FF9FD61E870D barrett.mckellop
277,367,314 *1B454B7913ABD5A159CDE7325AE548E14C017789 barrett.mickiewicz
277,367,315 *1B4721F3AF72D3F4D1F64D844F55A17F06ED98F9 barrett.opalka
277,367,316 *1B4E05B6BCCEF7D15598079B04C900DCC0A93C95 barrett.shutty
277,367,317 *1B48371D062369D42829AEBD159E8509299802AF barrett.tiet
277,367,318 *1B4C6197B81BF96927DE2DF9438F5C64616BFBD1 barrett.vitela
277,367,319 *1B42FDF6B6FDC5CBD885E69F7B2B93C67971903F barrett.wadlington
277,367,320 *1B4899A823E2F158068B52EF4E5C4A5749F306D9 barrett.walters
277,367,321 *1B400BD19BE0F4A1B1B994080D20FDDBBC24B349 barrett.werley
277,367,322 *1B4EBE34348728F369696F4CFBFAA8CDA033EB0F barrett.willwerth
277,367,323 *1B44171638A22C3A3F71402CDD573394AA5C90A4 barriater
277,367,324 *1B44B18286586A87B27B32CAC50EF2A89B7DC53A BARRISTRESS9
277,367,325 *1B4948849FD183DDBC98C417048E69936D53577F barrosoBSW
277,367,326 *1B4CF5E7EC1B95FCDAC90CBD890F976E3DDF7325 Barrowblade!
277,367,327 *1B4E374ACAF7D29A9E17385C38FC6D4B82043CDD barrownaomi
277,367,328 *1B4F489BF52FFD55380F73E6F8FA4DF816F52F9F barrskogarnas
277,367,329 *1B4BF38CCA47D4B74C35DC23A366F06D7CFF0B54 Barrullar
277,367,330 *1B4B72EA21E935DCE74A80D56431DD999F1AA1BC barry.ackers
277,367,331 *1B413B8C0AE9123D1B00542E8FE4D70231ADF649 Barryaehed
277,367,332 *1B435CC90D72E5C4AA4489D2BEA7A9727BF6D29E barry.dayhoff
277,367,333 *1B4F57FA41B09B95DAA733437F583DAD164E78D8 barry.delos
277,367,334 *1B4523ABC56D3D19A1F209C4E23FB915BA0E3D85 barry.derrico
277,367,335 *1B4F04105F1F6C542C548262CF69A1D54D003E95 barryed3
277,367,336 *1B4DDC76C583682C69018E7588F037D7C50D4C6A barry.farina
277,367,337 *1B49CBD5A1DFD59772C761D766E9DA24C1EBBCCF barry.faunce
277,367,338 *1B48CB85175070E8D99A5AE3F3D0FE392195EAB1 barry.filiault
277,367,339 *1B47C38F2D98FF9222D81B8DAB0EBDB9A16B027C barry.guiggey
277,367,340 *1B4AC8133189498F3DDB3BB9B443BC818CE90962 barry.harteau
277,367,341 *1B41DA662BB8C616B39476EBF6904228A843358D barryhogg
277,367,342 *1B4EC1F6696048AD3C018406B751FE8D22F5515E barrykalish
277,367,343 *1B495BCAEC8B0F1B1D2DE682154C156568DFEB96 Barrykillme
277,367,344 *1B473DAE62CF8622462A0FCFC8930DBA2CF56B79 [email protected]
277,367,345 *1B402B2CB02AEACF29BADE34FEA0FD411EAF9E12 barry.maha
277,367,346 *1B40F4AA2CD3E80BDA722AB50981A06E4696F0B0 barry.manoogian
277,367,347 *1B4428ED16363F56367D6A9E6112D7F66B261034 barry.mcquiller
277,367,348 *1B463635BFEC86B9EE26670CA7A1B1A6402FF96A barrymoreestelle
277,367,349 *1B491680A4824A2649856F611FB93C5A539D22D5 barry.ondrey
277,367,350 *1B47C92D8ADF32BAF196FE8126CDE80598F91361 barry.peerzada
277,367,351 *1B4A2B853BDD358A66A1527E933C61911D0406AD barryrathbone
277,367,352 *1B49C58BB03B029DA7CE57F0286B44FBDAE09632 barry.schoolcraft
277,367,353 *1B4895C5A110C70EF30FC4C537528A6BFEF5112E [email protected]
277,367,354 *1B4818890E497E5982378115CBB2A14A2B062075 barry.stevison
277,367,355 *1B47A27E0A9D181D9FF547434FF4AEBCA6DDFD9D barry.tannenbaum
277,367,356 *1B453CC3B5E20BA896D2FFF210985E67F1C16F14 barry.wayland
277,367,357 *1B4F496A9C3B0A56C2A2F5B035773DB30705446A barselou1
277,367,358 *1B4A22A0AC6B7643D71D8B89F87A1FE9E004CEB0 B-aRt
277,367,359 *1B402FF4503D914177842352235297937AD401A5 bart359382
277,367,360 *1B4EDD83885CDDB11E39239EACDEEB0D46179214 bart.abadie
277,367,361 *1B4B5CC4FAF86B9F00819806AE20434868B17C4F [email protected]
277,367,362 *1B48B12EF35FEFD2AD8D56FF4A11C67F57874A60 bart.carnine
277,367,363 *1B47143544CFCB1E1349F0922B404648324040BE bart.crader
277,367,364 *1B4A3D36075A095D7D720D31B83BBA7004A4F370 bart.critchley
277,367,365 *1B41EBB87469C93E9A218BB13AA59B065888F2AA bartczaks
277,367,366 *1B48DE79059C488155680EF0687562B4C015D19E bart.darter
277,367,367 *1B47C0FB4B2A41B8AB35E3A8B31C36BC9EAD50B4 bart.desautelle
277,367,368 *1B4639A8C0A6A5EBA7825EC109022AB5BCA1E848 bart.dunneback
277,367,369 *1B4881886D5A20AE4B59497E527DB1488A7994D4 barteinstein
277,367,370 *1B48B8F562326A203028774E825C3F94B0356F75 Bartelson0
277,367,371 *1B4AA536C29FFDB9B96BC35D816CAC9974E9E346 BARterEr
277,367,372 *1B4245E809EF46B54B01535FE448F27150139EE8 barterkle
277,367,373 *1B412708A10C84E2CBF0D40D6390F6367CA2F617 bart.gaal
277,367,374 *1B4C3AEAB713280FA3179E7EBF7E84008C384890 bart.gisondi
277,367,375 *1B49425068C22280D4B611562235B1A433BEF29A Barthelmy4
277,367,376 *1B4BB238484080712D4722E6F3301F4F84324B6C Barthevin
277,367,377 *1B4CDC4068F6ADEA8A30F42E2C6F6A9CA9D9E4A9 barthharry
277,367,378 *1B439E9019058AFE3E421E65CF673AB7A070FEC0 barthololomaeo
277,367,379 *1B4ECD735800D6E1EDBE5C983BDA61A1606EF8C7 [email protected]
277,367,380 *1B48A9DB7D760418B2C8B6E97BEAC5F1FD8F3250 Bartinger
277,367,381 *1B4FB123300E6C2CD1B3BED8AFE2D4CC8E5A887C bart.jacquot
277,367,382 *1B4AB856972E375CB70EEF8AE183F02994B30361 bart.laplume
277,367,383 *1B48236DCC14554C8F444E35CC794505BC2D47B6 bartlettedgar
277,367,384 *1B475D5F9CD38B7223BCBB06105A2256B337A072 BARTLETT-TREE-RESEARCH-LABORATORIES
277,367,385 *1B4BBB326C2CB520A0658A7E89B6F8E952F7AF45 bart.louato
277,367,386 *1B4AD343F444A85C0237CDC280CC2AD61AB8D71F bartmane
277,367,387 *1B4DBC960D9E1740C4A589C2993E3222A9C16736 bartmanked
277,367,388 *1B455443756714A9A412CA01681E27E2126FB8AC bart.marrison
277,367,389 *1B48E52D6D9746377A0423A00EAED56F5922D29C bart.miran
277,367,390 *1B432AA87EAC60469ADB3C4DEA0847A0CCECDEFA bart.nyulassy
277,367,391 *1B4A9501D24C9DEB124AD3CCB020CEEECB1A69A0 barton.atleh
277,367,392 *1B480AE607106CDD7A1731E259FFCCC02C34DD89 barton.ballew
277,367,393 *1B4C27AE0920F3F81FF4BA2650082A3246555C4E barton.champine
277,367,394 *1B444337A83FC9CB9C70C940AF461880E0850C8A barton.dohan
277,367,395 *1B44656F269624F02FEED0CCA022B5C7F93C50AC barton.farzan
277,367,396 *1B4FB6D4BB3EC63DC68CCD938A8142094F3EB74B barton.kribs
277,367,397 *1B42439EC5EFCB2035FB1EC2FCCDB2470F35AFB9 barton.luffman
277,367,398 *1B454D0FC785D542F68D485FCBE50750F31BF3C2 barton.masella
277,367,399 *1B4167481765BC7662C980CEE062AF7510267EE5 barton.perez
277,367,400 *1B4A9AB6F80D9FAAF944087EC8A74401F4B26DD9 barton.phommaseng
277,367,401 *1B495C31CD5648C9EEF6DFD81CFB3EEFFA719480 barton.rhed
277,367,402 *1B4075AAD3F6EF3964A535E65FD6473A627EBFAE barton.rosenthal
277,367,403 *1B4F513F03E9E69058E02F1ACC5FBE473DAE14B7 barton.schorsch
277,367,404 *1B48FE8E7A9E91626244B5B8CA80D8277B80CB44 barton.spruel
277,367,405 *1B4F6277BD3588E7A747B123C7C77083BF26CA37 barton.stassinos
277,367,406 *1B435A92B6E62AE4050B885F98D3DAA078016585 barton.swainey
277,367,407 *1B4236EC8B3FD30A9AB0F45D5653EB564418003C barton.tanberg
277,367,408 *1B4C66345F205839769978415DBC4EAFC47505F3 barton.tirino
277,367,409 *1B4CAB8511003D4A1CE6A1867CCDD10EF6416385 barton.wohlrab
277,367,410 *1B40A7F41BFBAB2E2786119B2501B1D5C8D9C40B [email protected]
277,367,411 *1B43C3E3E67B11AC856224E95BF72DB04E4AAFB9 bartovigarry
277,367,412 *1B43F90F250B588A1331DE6FE194885369A38FF7 bart.pasqua
277,367,413 *1B4E4D06C30BC9DA53E96A0E93B883DB9F27E938 bart.pfeifle
277,367,414 *1B492342CB21C078D4E28334C4BABF39BA2A8973 bart.pho
277,367,415 *1B44E668A445E6B5517E1AB809CB7A98AD9A8E10 bart.richart
277,367,416 *1B4189246AD5662CD8FBB04F2E555EB3B4744210 bartrolex
277,367,417 *1B49C1B6184B08ED5E8B0ED2F2A664FB7C2693CE bartscheidt
277,367,418 *1B46B9BB9B0C04FAE325B040E87E014C1933E3DC bartsux2
277,367,419 *1B403DCCCBE3C71C7C5FA5AAD6389E09BDF5BAE6 bart.taylar
277,367,420 *1B441F2A3485F4D1ABF8555E3750CBC5B72E007F bart.tiley
277,367,421 *1B4FE4079DCF6B69883023C564B033FA25D50DC1 bart.tretter
277,367,422 *1B4C19BCC992A1C2E60559759CD69C1DFE5497FD BARTULA
277,367,423 *1B45AF7F29891BD92EF8CE215ACE16FDD96B1198 bārtuld
277,367,424 *1B4A7CE525DA5814A49AB90F16F1A1DAE2671E77 Bartultovicích
277,367,425 *1B45FA5E18D68CA044CD8B11B50238959F348E26 bart.venhorst
277,367,426 *1B43CC285FCCE7600166ED811F3B165AB48E02FE BARTVINSKEY:SHARK
277,367,427 *1B4A12184A9F863BF097F5EFCD1A56AC7D0EE119 bartwisch
277,367,428 *1B465A5ACA7CEF6F32266FB7CBE71C7121367D7A barucheu123
277,367,429 *1B4A175A1E27ADF859CC3C5B94EF4FE14DC9CFB1 Baruffa0
277,367,430 *1B497BC2386E791B26A5889BB52B0B813B73C536 barullis0
277,367,431 *1B42C73E5453CCE59025BD7F828FF6E2541B0935 BaR-w
277,367,432 *1B4A3F54449AFDF43CBB6F9C54E04EC071504437 barw15e
277,367,433 *1B4A0741C9BDD0902D6211BE9732EE4D55DC7183 barykadies
277,367,434 *1B440BD97CBBF172281C32FD978A9785491F7BA6 [email protected]
277,367,435 *1B4F2E3CC8D3AD04F8D7DAF626DFC7DD49DD2503 BARYTOCELESTITE7
277,367,436 *1B4E1196EFA9F9E0798DC313A96070222B0FAE10 にBARという文字が描かれた絵柄である。
277,367,437 *1B43BB1BCD121DAA72C525884ED6FE05B9879499 B#.As
277,367,438 *1B46C1198C55B124D4EBC8B94B9B9AC1A7ABBA42 Bas+%
277,367,439 *1B4570F178C8D18489EEAA5ABEF93C03025EF364 bAs
277,367,440 *1B49D6C0215E9062D1FDB43102196963386E04A1 BaS6;
277,367,441 *1B49087CBD19DFE64529F62B0773AB441C10281C B?aS7
277,367,442 *1B492B8301FF94FF51683B361313F27A23846F34 BAS-79
277,367,443 *1B41D664719CB2BA6143CD9FDF8E7355DB48B84C basalia!
277,367,444 *1B43F0A67D99E933A096CCF8AB9129015E2424FA basalTIC
277,367,445 *1B4A126111B902C2FAC8C0D5D94A5370CB19CD8D BASANIUM
277,367,446 *1B4FEFF3ECBE5E4248DEE0D58C794FE77E1DAA37 basarlos3
277,367,447 *1B4A03691ABBE60BDE8D58AE4B627FA7D189579E ba-sbc
277,367,448 *1B4EDA17085787EAC9541AC8522F493549C9C8FD BASBOGA
277,367,449 *1B4BE610B4E5EE0A12344626C46E78C73D0E3689 BASCARB
277,367,450 *1B4CC52533334CD635DE2E6117349929402955F4 Bascoulergue
277,367,451 *1B4B37D74CD46BAD4589E95A5B6578BD72B20C37 başdönmesi
277,367,452 *1B4FF8F9F01C4CBB09626EE9576F42520F58E724 BASEBALE-MAIL
277,367,453 *1B44F61F501A0623AD14516870A3D4EA04932EF5 basebalpasswd
277,367,454 *1B400E4B32CB1517B58BFA8E67A4398991263C2A Baseclass
277,367,455 *1B4579ADCC036D37B87FCDF28110D03CCFC4D34C BASELI
277,367,456 *1B440918E889EF39232CC837EA671E8EBB560232 baselsta6
277,367,457 *1B4A6EF53030DB2E3D4A4E6368F67BC80097EF82 base.ltdescriptiongt
277,367,458 *1B49F55A28BD2848DB7D70F734A3D5428572A256 basement-production
277,367,459 *1B45E28299F2BBD6195E93D4EF82A6A8DC2FF5AC basenstapelung
277,367,460 *1B4C9D4A2E7D18B32B94FC1E81F28565AAFE23F9 basenta5
277,367,461 *1B42C7FFCC1389EF0BD9692F696C3A08B53F8823 basescu-a-semnat-decretul-prin-care-nica-este-numit-ministru-interimar
277,367,462 *1B4927DEE7FBBC4763BBE32B7A09C37CBF08CE8B BASEST
277,367,463 *1B4714841DC53CAFB1501BF16969C8EF2E2610B7 baseurl1
277,367,464 *1B4244D9623E9564C24145D1726C4E84714BF891 basfdoning
277,367,465 *1B46967F59AD1329577DA157F22E1F895B013BBE Basffreak1
277,367,466 *1B4497AB2F2D2351EFBC4A81E8B7F1FBE9379F43 båshaugtjernets
277,367,467 *1B41640F2F67A163B3D9079EDC41AFE91F7E5B04 bash-coulter
277,367,468 *1B42E1D11A67AF5244A9B39436C0A08FDA7E9345 bashyam8
277,367,469 *1B46CADB61B960121E7F9CCCB10B9C17A236C02A Basiceri2
277,367,470 *1B41BB3C0C79AB6468674275D42F9442A7D7347E basicite
277,367,471 *1B437D6F0ADECBAA971EBACB4F70C6733697B77D basicspace(sampharemix)
277,367,472 *1B4C67DA3903E5B0028D299CFE64FD6A18A2E784 BasIFY
277,367,473 *1B4AB435E3EBCDE4FFBA2589E404A8BFBD8F2B55 basihyoid8
277,367,474 *1B46879D589F3210C03513104F9651B5F3421F11 basil.ailey
277,367,475 *1B4D50069FDE915D71EF57BA1AE2825083BBF63F basil.boorman
277,367,476 *1B49839CC7F9BB5BCA2D48886A7AC7260211E964 basil.camancho
277,367,477 *1B4B4624FD4F43206A5B526BE4EF65F86636D06B basil.dispirito
277,367,478 *1B4EDCDF09F0FE41115560BF6287D22B8403D433 Basileiovým
277,367,479 *1B4B1A136C0A6B18EF593EF2A645910F39304A94 Basilejská
277,367,480 *1B44D00A420037D009C105CFF80A47BA0521BC12 Basilfluffy
277,367,481 *1B41F08E1004BA98EE41DF99889A32AC0900E87D basil.hape
277,367,482 *1B41DE5C32A649C63B6277C8879F880EF0305758 Basilikata
277,367,483 *1B4F32BB23D7BA2F724A58982F482E55FC48FB09 basil.lagroon
277,367,484 *1B41D2122660EA909ABA164FF962F1BADAF7BC45 basil.mckenna
277,367,485 *1B4A2427CFB34693A9A49BF20651F2CBED387894 basil.michieli
277,367,486 *1B4EDBAF92FD7F8A14AB5FD6C6329B131262E0BC basil.moss
277,367,487 *1B4B71303095A470BAB615E06B1333EE683F396F basil.mowers
277,367,488 *1B44EC8367B82E8FCEAB829563109DF7AE481DA9 basil.palme
277,367,489 *1B4EF8AAE65471A0B54D25BF252DA7E9B109F69F basil.pannhoff
277,367,490 *1B4B2FA3CA7227E950F753ACC76DEAE40B1B7EBA basil.pellon
277,367,491 *1B4F6CDCB42C463F55EE755EBD08050C44CA7B23 basil.rehder
277,367,492 *1B4DFA11583F7E8CF6171F00C8F5FD40A9393367 basil.saracino
277,367,493 *1B47E3D68ECC0562DD7FD85403B9A3F1555ABBBF basil.sullivant
277,367,494 *1B4917EF866AD35786E7B515C382783A86ACB112 basil.tarling
277,367,495 *1B4F1E0F9A9C271D4D5E1A1748EC618813595077 basil.teles
277,367,496 *1B4B8610C97AA590FEDFC4C708AA17D32280D573 basil.woosley
277,367,497 *1B4EED08E5797D229BB9B920C8651C1705E7FDF7 basınçtır
277,367,498 *1B4C548463EE7AE04F6E9BB97EF27C2CDEDF918D BASIN-JOHNSTONE-RIVER
277,367,499 *1B443F92C52337C5BEE501D06FC55F905A7DCA1A basisdikte
277,367,500 *1B469899F2DF38661B74875FAEA3F9091C48CCD2 Basis)といわれる、入手時のコストを元にした価格を使用する。納税者は通常はこの修正後ベーシスと譲渡時の時価(FMV
277,367,501 *1B4DDC245E594F37324EE36B112F9A9EF299BA0B baskasi6
277,367,502 *1B40D4C473D8D4A07FCE46049CE27F22259C9ABC basketa123
277,367,503 *1B45EA69FEE93245660825C27416822E2DF53754 BASKETBAKILLER
277,367,504 *1B408BB0A0687E1225325094CB0E8459F97267FC Basketbakrystal
277,367,505 *1B42C9A7A8A15BCD3D6A841AA5CE69EA572B752C basketballfeminin
277,367,506 *1B4B3E3BB27B12FEF3EDCE788F48BCA2FBD1EEA1 BASKETBALLJONES
277,367,507 *1B4E0BA0CBC0D4CF2C65B4D90A11736F2EF44236 Basketballtr
277,367,508 *1B4EA0D4D754C6C3AB28101F4BBCDDEE3EED3958 BASKETBHELEN
277,367,509 *1B4DE7A6EE31B907972521220CB5FA17B74157B2 Basketlaw3
277,367,510 *1B42629F4492FA54180CE60D9BED4B1664D733B3 [email protected]
277,367,511 *1B4FDBC97E566E015A6E28B5B429CF7266D23AC8 Baskettom2
277,367,512 *1B418E9972FA0241A5AA90657F94DE8E905843F5 BASKETY
277,367,513 *1B48D670D57DED4B64AD915857D3C4C9E809B4F6 Baskfire5
277,367,514 *1B4C6B9539B829D5E8D16D9D167D8DAF77ADB3C0 báški
277,367,515 *1B4D03199654510F0CEAFB4E93E596B64A8633CE Baskives8
277,367,516 *1B40C8AAACBA0DC0057BE20B2F0DE83B3F05B04C başlamışdr
277,367,517 *1B46A4E62BF734D50E446DB0EB4F9E97252B1B8B basner1234
277,367,518 *1B41EF06BB67151B9BC6D72AAE9EA1963E1CCFE3 básnikovmu
277,367,519 *1B47FE1913BD36D82B69B99ADD16AAE4D9E4099A Basoids9
277,367,520 *1B466DC53754861361B4AAC94388878A802EFA5A basophilic ,b/eI/s/@/'f/I/l/I/k
277,367,521 *1B4291838E3CE8658B01A18EE99A044BC3559725 Basrai
277,367,522 *1B47AA0A7B321CB18B227A2E1AB4039E08C54D00 basri abas
277,367,523 *1B42BF27B15BA0AFA5F518E85D73DB16F35C4062 BASS1957
277,367,524 *1B41E9796617CC4C16C70EC456CE29E1F00F2F7E BASSEN-KORNZWEIG
277,367,525 *1B49D78EF5316AF969F54B89A9D93F696AD6147D Bassianu0
277,367,526 *1B41CBEBA99B2B5A637FC1258C5409991216D683 bassinc0
277,367,527 *1B43B4C161FDFFB2C6AD5A9B54669F47B32295C9 Bassle
277,367,528 *1B4B82AFC81CF91DCF0772EC84657847AC909FBA B|aSSluv:lesbian
277,367,529 *1B4895E761F4E340EA46D6EED10CDC83CC80E526 bassmas1
277,367,530 *1B474D1455865CEF39AF9D296840D12164364763 bassoksi
277,367,531 *1B4D04DE45FBB8525670600565D7766C57191FB1 bassophone
277,367,532 *1B415778AF6F1DDC8AB0B7300C6939926FA02D86 bassotedesco
277,367,533 *1B40B8487D6E19381ABE44FB9FE1E3EAE0DE0E24 basso-ugalde
277,367,534 *1B4D4181403A2A1353D3F1F51C39008735C4AC3B bass trax
277,367,535 *1B499DBBD49C6B7B8BDEC71D944D62DFE0661D8E Bastaardspinnen!
277,367,536 *1B43425778BFCE7F5414121008455665781378F3 bastad0
277,367,537 *1B47BB4FE72CE579DED998FF5BE3C18334095F4D BASTARDBEAVIS
277,367,538 *1B42F4E251858AF2799CD40915EC367B74EA8866 BASTARDKELSEY
277,367,539 *1B4AE6F72DF848750D6E74457CD6E0876D3D9C11 bAsTARds
277,367,540 *1B4DD6980F59C41A324E7827523E9A599304C96B Bastelaered
277,367,541 *1B43F462D89CC42FD070B4D8C61F94A7791A3E03 Bastelkleber
277,367,542 *1B40418A89FD6DE6342BC7310C6185FA56282D58 bastelt9
277,367,543 *1B4377738B1BB7DABC136DE4DBD06A3C85ADDAA5 bastendorfas
277,367,544 *1B4B30B41D745F80F90BF3CA00B410CBE4188DD7 BASTERDSPINNEN!
277,367,545 *1B483ABE703584CBCFE93CD09CFE4B37C8117877 [email protected]
277,367,546 *1B492614ED6243E017A33A3F2C939D49C0AD8836 bAstinGS
277,367,547 *1B4BE015A917FD20908F98A912BF93E7A5119951 Bastisi0
277,367,548 *1B4135546F397B8EA9DC88174AB69C4F464D6385 bastock25
277,367,549 *1B4D2C7AD4CBBE255E1778F73BA611BEE07F5333 bastonandoci
277,367,550 *1B4DD16DAD58D20E902CA774E1AEB4F74FD8863A Bastoner2
277,367,551 *1B4D92EA5A505F7AA90A3C2233038C3963B77869 BA/su
277,367,552 *1B4F62E58758401540A8EDCF793A2E394934CD97 basuteide
277,367,553 *1B417B65A7A1CCE4C68FF949061C76551535E4E0 B#At#
277,367,554 *1B42382F6B8A449B8AAD49BA880C1237FB1A4C78 B)$aT
277,367,555 *1B48F851B2F2EC951222D47400E960746A671EB1 Ba!T"
277,367,556 *1B46259101E6C8B06A094FADC4FE78577E42A509 B
277,367,557 *1B48685EE731F0D6FCCCDC26F201CADCC5EC0408 BaT1,
277,367,558 *1B4A8178CC9B39A8D7892FB449BDFB4A9A9B69F7 bat201
277,367,559 *1B403D9BCE496B896D58463912C03A0B1541A5DD Bat6Q
277,367,560 *1B406580E00C2783B267FB2D9B250AC9DE4008D8 batalharitual
277,367,561 *1B47A60617E189EA81C4E1BA41E91FEF38F951C0 «Batatinha»
277,367,562 *1B489C58D5E40DDAD36BD133D53BEB93108B436B B%atb
277,367,563 *1B4B34D294049D91BC61C194A2EB530212C3CECC BAt;c
277,367,564 *1B4ECA30235091E4322D18F06567F8E78E577DA1 BaTC?
277,367,565 *1B4E561F3777CE3696B57BA3B1CF99C2608B1EE1 Batchelder2
277,367,566 *1B494216A5B2463128EAD1F75545F520E9A9AA31 batchharmony
277,367,567 *1B4CB29699B7C7C4AE5BD233A589D1D130463912 batchoun8
277,367,568 *1B4D049F023FBBA82180BAAE3FA5A228D2E39540 bắt chuồn chuồn
277,367,569 *1B42508FEE09AB64F1D0924EEA3F0DFC1DAEB533 baterky4
277,367,570 *1B43057465BADCB44934DE5459FB299B42A20ADA batgirlxox
277,367,571 *1B4840369B3DB71FBC91B2027B7A6EA15D2C1662 Bathcube2
277,367,572 *1B479FE0D984F89D9F6F5352831279D37DFC6D70 Bathkoling
277,367,573 *1B498A7D4EBA487E692F85495CD263290394F6AC batHTUbS
277,367,574 *1B4614C79F9C04B97428CC80E818E1AB8F0CA502 Bathuk0lp
277,367,575 *1B4AC5B1CBF57393D23170D5D8B13016F78CBBC4 Batimbo2
277,367,576 *1B4387BF907B1FDEAF1B82E74F20E908EB859721 batirions!
277,367,577 *1B41206A425CACDB51BC38B4BB8ABF0551FD96E2 batitpie010101
277,367,578 *1B40F69C86AC25567423266D46E31233A75058A5 BatIU
277,367,579 *1B42A59CF09171C18F65AB680E483F443469C150 Ba)tk
277,367,580 *1B456F55AC59DF53A625C661DE5563CCF297FF78 BATMAN66
277,367,581 *1B4C2CD9A292D4BB5CA67F470C491BF32CB0CB4F Batmanaehs
277,367,582 *1B4A6D0FD42BE0463C705068E99E5F530EFB3064 batmand8
277,367,583 *1B4691C411B6EDF7259B0BCBB8F68ED3F9270034 Batmania
277,367,584 *1B4A1929C33213D0EBCAC9B107CC47B70F45E768 batmanpb
277,367,585 *1B4F90815FFED4E9D2CCB139FBD3C6C69D2F474F [email protected]
277,367,586 *1B4627F5AA3F913069F3D20BDFFADEB13D7EC301 batminingc
277,367,587 *1B470B9141476BA2D4CA65F0BDCC627672ED5378 BATMONOSTOR
277,367,588 *1B4434131D3E5D209C111FC9AA4F4600BF535117 BATO;
277,367,589 *1B468F7D8ADD3E3E64707EE64861602874258EFA batracie3
277,367,590 *1B493DB386FE3395BCB88A30DDA0038D61328DCE BAtre
277,367,591 *1B43BECB04265ADC6AE2D50FEF702AD9A6EF929D BATRL
277,367,592 *1B48F9DD870E0D054A2B34B568FF784577764DBD BATS;
277,367,593 *1B43305D2B6970D767D1848B37094D2E25080CDD båtseglares
277,367,594 *1B4F6FA4F34046E9580DB1682A2C2FF99D1E1263 Batsenal
277,367,595 *1B4B407610D16A959221A9DCF911241E9A389084 batsgt
277,367,596 *1B49B373F401F2333B13C2B4399213C627B93792 batsgu
277,367,597 *1B45B3A19AB04073ED404CB4FDACEFD2E0D94476 BATSman
277,367,598 *1B4E22D07D678A5FB6DD2514D4D262AF307744DD BaTSQ
277,367,599 *1B4BA59FAF25B3BCF172EEA2F6951E8EE7E8CC9F B$aTT
277,367,600 *1B4472E8E6C63CD743FEB1C0207EEE591737CAB1 Battalino8
277,367,601 *1B4A6521561EFCC9D1F6C43E5FA7A2E8BA9A72E5 Battelit9
277,367,602 *1B40B426E5A9F848D1D3CB2BA0060EECF99B5E9E Battellsing
277,367,603 *1B407B42508859C98336CD7533AEC8DDF9214653 batteroning
277,367,604 *1B4BE568128A28CBA998F209D8184513F3B4CB53 Batticuori1
277,367,605 *1B41BC83BCBE68D666E450AEAD55036C867E179C baTtIkS
277,367,606 *1B48BFBE0896C67A3AD86D9B7572E06340506637 Batting?
277,367,607 *1B465F7F8F240675D4C46296E231BB7CD4C615C1 battlechimp
277,367,608 *1B4FEF23A8B249C8C2F5B69728D74A030936FDDD bATtLED
277,367,609 *1B41ACBBDDF42AED344EFF23D4C450EB28BAF885 battlef!eld5
277,367,610 *1B47132738017CD8EBED7085B7E840B1E3E4302C BattleHymnoftheRepublicC
277,367,611 *1B4A4AE0E90EFA97E62646728CAED53F7C58C663 BATTLEMANUAL
277,367,612 *1B43E5B70DE0038030D3EE6C043C7FA92531A863 battle_of_elandslaag
277,367,613 *1B41C66C0C978364FAC0EF0697F8EEE886BCCD8F BATTLE-OF-THE-BIGOTS
277,367,614 *1B4AEB33E878F1FEB728CAC0D5BD2A02EF8171A8 BAttlErS
277,367,615 *1B4D064F26CB2C5FC2E4121A64747D75335B017B BATTLES-OF-CHOICE
277,367,616 *1B48AAE3E2E292B8521387A177CC279A699B53FC BattleSonata
277,367,617 *1B4A04FEB22C54E98F8CE303FBC847D9833FBF34 BATTOO
277,367,618 *1B4E6A62A409539AEEB8BF01C54484CF53FEDAD6 battoue6
277,367,619 *1B47AE028D32A76BCE61BF2633A31A6CE8ABFA7C battyboying
277,367,620 *1B465A46EF7AD5E434832C082938FC47D3BC0E52 Batty_zh
277,367,621 *1B49AE48969CFFA79FBD6D6B7A8FE126F42B6549 B$aTu
277,367,622 *1B40F3938AD7A8993041251AA2523935E7A2D407 Bat(U
277,367,623 *1B4D338E5C2CD76DFF23355EC62273D175A4F491 Batum0
277,367,624 *1B4CF977F7B593A2F6B0625AE350EE8126D1DA6A batvanadiumvanillava
277,367,625 *1B442EBB8EE79A46BC1CAF40C3AA302195EC8F76 BATvE
277,367,626 *1B4E978317F15314F5158A40ECECEBCBB0506200 batz10
277,367,627 *1B401F2084DAB3431C93307761D8028227BB5C14 B:AU;
277,367,628 *1B4D8C801FF77FF5AD45719B0B020B962D679DCE Ba?#U
277,367,629 *1B4F6B43C94A67B8E013380515722112E96093B2 baubees!
277,367,630 *1B4F502963743D36A22376F15EACCA0077023988 Baubuch
277,367,631 *1B4B7EBD4BFE5B3B9D2399EB5DF9FA29030E52CF baubyho
277,367,632 *1B49E44D3F84D586BAC6BE40E9B5F7CBA2CE5C3B Bauchagesing
277,367,633 *1B4CCFBE78DF7408CE9C56CC2C2BE9E568F981CD Baucheriez.
277,367,634 *1B43D6BC816D1B20ABB7E3E377A7242DB8B8A783 bauchschmerzen5
277,367,635 *1B42EBD2F53F7162B3910BAD748ED5C486B4752A Baud9
277,367,636 *1B4E88CAA6D3693B8757778FFA6D0FA6330AEEEE BAUDETTE1
277,367,637 *1B48C0F74DF8F8ADFBE46D01CAD782E53C828721 Bauernfein
277,367,638 *1B4F1E807B7D240DBDBEC93FE94B06EA540B1A23 Bauernmagd
277,367,639 *1B40BAF883D8FEE8D08A4CB713C2938904B82AB3 Bauernsc4
277,367,640 *1B44DBB180FD93C7DEDDECE48E3940E909959E85 bauerrene
277,367,641 *1B4E610FE7F42ABD9BB83352080E3760BB71980D bauerrichtung
277,367,642 *1B46FD1D5AD156CC3B4B9AC369A439EDA44F6AA3 B.aUi
277,367,643 *1B43DC31F824A477B93026E7C6DA03892BF79954 BaUM4
277,367,644 *1B4846631D802444E1907EAD09E042D59CC88E6D baumantalkarie
277,367,645 *1B41901D7C29090AC3708E92EB4E287F1087CF9D Baumbaugh1
277,367,646 *1B4B62DBA7B4FA5A22AB36B5F6AD033631387FA4 BAUMo
277,367,647 *1B473F0545F93E0A47EBF8B29F306AF707D29E34 baumsesing
277,367,648 *1B4F84D6930E0A5D6CA827824E374CD8B669E7AC Baumwollverarbeitungsunternehmens
277,367,649 *1B4F1608C017C4EBE232E874E59D9110AEC41409 Baunita8
277,367,650 *1B4A3D07A0E3E064A3BF83D45D41A72DD4D06193 Bauop
277,367,651 *1B4FB2A02F5A25AB2CF9B9B24739FD2F87687C39 B:AUQ
277,367,652 *1B4F5850E8CB6D67997D7DC609C819BB7CCB29AF BAusT
277,367,653 *1B481BA498301D62DCD0EFED4040F8733B4CEAB5 Bauston7
277,367,654 *1B487B57C2CA561E526D4ACFC4E96ECEB8EA0C28 Bautasteinar
277,367,655 *1B4BD5E402513F11022C6EF1D1E3EFD786B5F049 Bautzen 'b/AU/ts/@/n
277,367,656 *1B4887187863AEB7EDDB119BA37BD2ACF76DAA87 B.aUU
277,367,657 *1B4DE1A6D17C75BEC7F94971CEACFE3E39ADF1EF BAUW
277,367,658 *1B42003B5029D0079DB482DCA490CD7311EC9B18 BAUw+
277,367,659 *1B4DE755542353AD0BB28E8D6CD9CFDC4C26D438 bauzab
277,367,660 *1B47D99A008D105D9F5FD561D8039E5183B966A9 BA;V
277,367,661 *1B48CD4B7F9127E4789FFDB8B9A9B620EE004002 BAV.
277,367,662 *1B419275CC02545BC3FC6EBCCF477509E2A54082 B
277,367,663 *1B4234AF97E7A511B43CD48EA11164A2385C6070 BaV+3
277,367,664 *1B4402ED2DE48BA5EB032406D07F42D531A43345 BAV(7
277,367,665 *1B44D179E2F52C69760B0485B094B961B98A1773 bavaglios
277,367,666 *1B461A15959AF27E66B7BECEB525459EF32F02AF Bavarderons
277,367,667 *1B40BBDE4852835AAF68F6C90ACE7DF4969C3CE0 Bavarios
277,367,668 *1B42242BEA481005D5D7C8D41F103A0DD8227D07 BA#Vb
277,367,669 *1B419884065663981EF854E0AF1969D7D3ACEAD1 BaVEk
277,367,670 *1B437FAE758530DF6CD2189146F89B9E24974AB1 Bavenites
277,367,671 *1B47E4E7A5132F5A201C4505283A908BE059F01B BAvES
277,367,672 *1B406CA8F16DB58A26F0DA4C9477BE601077CF89 Bavetta0
277,367,673 *1B45E4D8ABA234A7F073C62AB96F32D939D7886C BAvFO
277,367,674 *1B42DA665A539E818124113294B6D3EF8B188AB2 Bavg
277,367,675 *1B4AFBBD311FE8616DF386A223CBFBB52B5C92E4 BaVj=
277,367,676 *1B44E9E5CF05F2F69A1AD27632E7FCEB9541E3C3 Bavm7
277,367,677 *1B40B02697FB58754F36ECFBB7CC18A6E3709DC1 BAV.t
277,367,678 *1B405554BAE42B8001638C1C372C0BDA727100E4 bavtalktishrei
277,367,679 *1B47B4BFA3FE79D5FA4C9087C655F823E49B7D5A BAw&%
277,367,680 *1B4B68B5DBB2394CFA0F7D69E0AFAE5C32CEA6B9 B;aw,
277,367,681 *1B4DAF96F0796F6430B86B30BEDC723BF749C7D8 B#aw,
277,367,682 *1B44E68D86A78745EBCBAB63CA20FAE3CCCE5D49 Baw&
277,367,683 *1B4BA1D9EFED59CB68BC8AAF7ED694DDCEBEF322 bawabeh4
277,367,684 *1B424DC0D0F163E012F4974E23C3AF26777E0A7F Bawandids
277,367,685 *1B4B2D7BF997B17261B8A6BED0DFBDC89F8B4E2D bawanlla1
277,367,686 *1B47C95FCDA2C62789CC0EF752976C300D5BAE2B bawdeswell
277,367,687 *1B464FD287841C254F81CFF4D68CC0DBEB706762 BAWDRICK.
277,367,688 *1B445155FB10313ADFA1E9DEB9A226EE168AC7DC BaWdRIes
277,367,689 *1B451FCF5D4A6BB8C4E2A093443E92ED67AB1F19 BAwe"
277,367,690 *1B43F13E5404F154DEAA1BFF0A39F9200766B7DA BAWF.
277,367,691 *1B4E7D9BE61AE4F68190E7EC9881F98BB6708C16 BA$wN
277,367,692 *1B4FD998E37B0D9B9C679C8ADB729B9E91AC58FA BaWoF
277,367,693 *1B4522016239771009B9A09921AA49288ADC5C74 BAWPWOQ74
277,367,694 *1B47AD52FA222EC4405936B25587CE10FDE2C7C8 BA"WR
277,367,695 *1B41FB880B1405B54B94C05E6C132B45CBF65F50 Bawv"
277,367,696 *1B4490C284D20C898B8AB93579FCB2F0FCC57686 BAwV0
277,367,697 *1B4C587B5D34BB3D527142BE16E9B4BFFCD2CC9D B$awY
277,367,698 *1B46C554319EDEFA9E9859F08E2846741FFA6DFC BA
277,367,699 *1B40C22FC8D9279EA9AF20CD2FBEDA4141386E96 Ba%X
277,367,700 *1B48F72E3C5BFE03F977A1F7CE4F51F34066262C BaX4!
277,367,701 *1B4EE383995A6F589CEE1154585CB5A9B77B0354 Ba_XO
277,367,702 *1B4A4C61EA106B24C78D07A516BDD27A87BBAA40 BaXrw
277,367,703 *1B4C792A28FF7DC27EB9CBF525D8287F4A3833C3 BaXTN
277,367,704 *1B42F1140D0A49CA463C464CDE1994EE33DE06CB BAXUF
277,367,705 *1B436A66442E1CC552F996C499C104F791DCF2E9 BA%Y#
277,367,706 *1B4446AE1563C89ABDBB3F371EFF1D9CF840FFC1 BAY1126
277,367,707 *1B4ED62EFA294ED636447ED5F02CB7765080DA26 BA$Y7
277,367,708 *1B4E0F3FA1481346065D3D19106758D879D6441E bayanbattle
277,367,709 *1B4A735853F19CA3C77037258BD140D04F6568C7 BAYAREAHOUSTONMAGAZINE
277,367,710 *1B46B71958454868F8CCEB2EA2C87632000E64FB BaYB8
277,367,711 *1B462A4CDD1DB4E27EB3B98666D40CE1DA837B7C baybegiirl00
277,367,712 *1B4C700F805A62449DF5EC4DCFE88860219A3D63 BAYDELTAMARITIME
277,367,713 *1B45FA76B2DA5653EA28374B9C9C7976F6C8317E Ba;YE
277,367,714 *1B42FE961A37F184B13FBADD5D2479EAD5AC1669 Bayerlesing
277,367,715 *1B4AD71933DE881F3BDC06123281F1509FFEC9AD baylor38
277,367,716 *1B409E7739703BFA756BD5542CE8C97FA66AE64C Baymier5
277,367,717 *1B4480C1A9CB5ED539C2584B3DB346BCBC631AE6 BaYN6
277,367,718 *1B4B3682E39C423F57649E1C018EA7C73A8BCE2B Ba_Yo
277,367,719 *1B487C917878D6264DE75AEC3774F42EA57EC7F2 bayombongmarketnet
277,367,720 *1B40685ACD9BD0C71A241DDAA1FA1E75D71A668B BAYONENSES
277,367,721 *1B410C7D6D9100649BDACD1DBC632E4DF8D8A7B4 BAYOTBUANG
277,367,722 *1B4CF8D8119ED33BC1918DB4AAE85399204FA676 B)AYQ
277,367,723 *1B4F22AF311150AFEBCF86185A195A01EFCC6A49 BAY-q
277,367,724 *1B47CD24897DA12E27009667963AC1FBC09B1786 Bayramiye
277,367,725 *1B4FA7B8AC64321075FDFAD96D35994F20395CEB BAYROANLEGS
277,367,726 *1B42B8D619B0C1B602B6CBC438BCE7BAF59FFD9C baytalkaransas
277,367,727 *1B4C9BA67312A88762349A0C5AE7483079777C34 BAY+w
277,367,728 *1B4D6C5941BF62DE862BE47F9BB15D0D0F441A2B bazakas2
277,367,729 *1B412265BD534625C598C29F91CA0B863ABEF361 Bazeneches
277,367,730 *1B439547E2BB6EF7BD92081A3AF1BCC6E0ED58A7 bazerley
277,367,731 *1B4AB605B71D48BA74AF6992624075BAEFEE62A9 bazile's
277,367,732 *1B4B8ACA7BCEB87A744B17B01BE32698980F1180 Bazil’s
277,367,733 *1B4762901D6A6029065284FE809F8DE849229B3C BAZnR
277,367,734 *1B4E97B4671BD2F9477E1E856A0D2027EF880D03 BAZ!o
277,367,735 *1B446510BCE86313899A3085DD088CDE569EEFE0 Bazookaj8
277,367,736 *1B43FD5FBED4E9D451120F0062D4201792BD1CD4 bazsarózsás
277,367,737 *1B48011DB052C496FB7272B3A976AD2226B56548 BAZUCNDOLES
277,367,738 *1B4BBD86E23F8FE8FF41A99AF732C9FD02104525 B;aZZ
277,367,739 *1B43D62B6DF29F21269379A2703A45D9ED995C5A B=B#,
277,367,740 *1B4D907BF0A71645810E5ABBE2B4E4DBCD6B0D63 B;#B+
277,367,741 *1B4BC4613CB3E9E9F0A5326F39114AD343AFB3B4 B?+=B
277,367,742 *1B4DCA5D6924836821E318FDE214A38CACF73EC7 B$B-)
277,367,743 *1B4E12951695EB1643045818962D30ACE18ADFDF B\B`
277,367,744 *1B44C06BEE6CB8BCA97C4B41800B5E56015DEC4A BB,-,
277,367,745 *1B44447D09686E6F6617F1AB16E7472F2887147F BB/
277,367,746 *1B426FFDD161F4692A684FAA42233B7A8BCA0E1A BB(
277,367,747 *1B400A1B4D95DDA885CE6D081D12B8B9FEE7E2D9 BB$%"
277,367,748 *1B44E113F0604CDB659D75E2E142946FF780D313 B;b;(
277,367,749 *1B48EBEB096EADF76BE44B5522DD8ACD622EC4FE B;b##
277,367,750 *1B4A32E8328B3E8EC8E5DBF7BB244695BC795D1E B:?b(
277,367,751 *1B49D0C6AB61F9F1CE1DB45636CE1E6A6195BE9A B.;b-
277,367,752 *1B4D164119DB35682138E86056A4BE49AC70F957 B)[email protected]
277,367,753 *1B48487A88B08DD468E951580A1E4898D31CEF10 B%/b_
277,367,754 *1B40640723DB7851D142CF4349DE3A701F68F029 B+
277,367,755 *1B467662F73182629E49151A978CEC2FC1032531 B+b,:
277,367,756 *1B4DF4769520498B914DC970CA6F4CD76827EAFE Bb";.
277,367,757 *1B4280BCB03F03ABDC537B9EACA3F2E573D442E2 Bb&),
277,367,758 *1B469863EC6B89748B3D79288DB3B6FA47DFEEC7 B$&B0
277,367,759 *1B4CB2D5320513BF48ABD6DC9675053CB2A3C321 [email protected]
277,367,760 *1B400B8B5894B59843BF5689BE4B37BEE472347E Bb0k=
277,367,761 *1B4B35A8305C1F13997DE44C080454B988CE7657 BB1_-
277,367,762 *1B4B2C2BA4D3C3777B68C70BB7BF149F56EC965F B?b"1
277,367,763 *1B4DF89D5D9B85BF0603E8482085A10C9F19D638 bb100.
277,367,764 *1B4A8D7D910F2F33FA0144CA443C1CAEF1C75105 Bb=17
277,367,765 *1B46AA593EE45DCB0CFB65968325E9A7A9B02E0F Bb1D4
277,367,766 *1B43F02D84AD627708B21C8E1E63917E44F7636B Bb1FO
277,367,767 *1B4950A0FCAAD70BD7F8656E4211BB906D458ED5 BB1h2
277,367,768 *1B4A59C360383EE689477B1231BB68660305C7DE Bb1jA
277,367,769 *1B49CD6BAA397CC07559A63436FA87C47F598F2E [email protected]
277,367,770 *1B4F6ED235984119E2D07B7DDD439E9D74957B6C BB2e6
277,367,771 *1B42800CD3D52BF6FD21D5E951A9067F5B91D752 B_B2F
277,367,772 *1B4F82E0B18F4004CE5448A5DFC4F742D79F58C2 BB2?r
277,367,773 *1B4234DC7CFB030F63D302B7BEA078663F15FCDD B-?B3
277,367,774 *1B40E90A42FDA48FCEDB0264859C97AC8ED349DE Bb_#3
277,367,775 *1B4B1EAF444C43059135242805CA93BBB6F4B8EC Bb3;?
277,367,776 *1B424718C0AB170B219F39E0F6B938AE5D51A691 Bb3I!
277,367,777 *1B424A20CE33CD350B4FAFFD5DCF069B227037CB BB3M0
277,367,778 *1B4890FE58E91EB4C2F28046573112FC2F176025 BB3Qk
277,367,779 *1B43767358DE1E6D9E5218AD5257A2D63E5636C3 BB4504
277,367,780 *1B43A9EBD60D64C2FF1CC81C4F4881C14FD8D9A4 BB+4d
277,367,781 *1B4681C57F9C746B0867EB57AE6DE60945D1F81E B;b4V
277,367,782 *1B45F664AF0F4E0204AC8BB1F942D977B5B6FDC2 B+"B5
277,367,783 *1B41788F878209711533995A1D8084948C4D8739 B
277,367,784 *1B4A1B3EDCCA91B78008AE128823BC0890F7408B BB5c4
277,367,785 *1B471D376B0E4A34BA1F765338006602A0E68311 Bb"5E
277,367,786 *1B4B1C327C68F90912181EB63E4DBEC3710E030A Bb5=E
277,367,787 *1B4046AA659024F1C6CB1860959394DF642654E4 B,B5F
277,367,788 *1B48615EE3A1ED3945780D174453A376C801EDF0 B:B5g
277,367,789 *1B4976B36CD17167A843A9E90EDD2CAAD48C3368 Bb5MV
277,367,790 *1B4E28C0E1A4C63C92E59C823CE91A5821BF9FC0 Bb:5o
277,367,791 *1B40066C342E7844A731CBBB8170CB0AA8949E65 Bb,5p
277,367,792 *1B40CB7BC5BC25CFD71B7CCBF5EFB5D59EA3C5DC BB?6=
277,367,793 *1B4CCB6B9CEB09D05EE0D8B4901661DCFEA89D42 BB(6_
277,367,794 *1B40C3786CD69FA5A1A2014457E9F3E666F98BCC Bb_6"
277,367,795 *1B4186D247E90A7E2338166D9D75C6331E7F0A8E Bb66
277,367,796 *1B4DC5BD39C1A3D086C47FAD7CF7D278935B14E1 BB:6M
277,367,797 *1B4CAE807EA06B42452EFF053849E0FBF6E29E36 Bb6MQ
277,367,798 *1B4F189C2454C58AF53D76A073A937F02C1087DB Bb6XZ
277,367,799 *1B402CB535ECCD74BD1AB064B2290134BB307289 BB7OQ
277,367,800 *1B40B8654797FBC56FD90C0601E6E306F38AF752 Bb7pU
277,367,801 *1B4907858AB70E862EB8418DD6A5B980AF892D9A Bb7Q6
277,367,802 *1B4384DFB4FE46A818E251B164A8CC19A4D20DE7 BB880105
277,367,803 *1B4171436D4E6B1976CA13D2766114D692B34D86 bb890811-57bd-49be-998a-7a0966ffd33c
277,367,804 *1B4FDEE92C141507005AD1753CB1DFA8F307A1A0 BB8d%
277,367,805 *1B446D9CDD623F38DF7FB7F7C2570A5D54D87271 BB+/9
277,367,806 *1B4468DEB88CDDDA0678688A5672EE76BAE252E7 BB9.C
277,367,807 *1B46E895198EAF56FB48121875CE83C9C133DE41 bb9c0b2eb2
277,367,808 *1B4650D0EA03C2700752CAD9747E58FF1EB2D7C8 B_B9k
277,367,809 *1B41C37E2D3369E650008B4E30F3C318B83B1CF6 BB9OZ
277,367,810 *1B407A241DBC64D056EE801A06567616303E82EB bba228
277,367,811 *1B4BE084558FDBA4082AB8A211958A625FF23F27 BBA5
277,367,812 *1B4591131BF6A7F304922F82BEF277901D66E0B5 [email protected]
277,367,813 *1B4749C93F7DB6E39F962BB804491E6D910A7376 BBaFW
277,367,814 *1B4793A82D8352175E3A85210065411F249C0FD1 Bb_ah
277,367,815 *1B4C7B5AE96BE692E4B838B23A9C802EBFF46E05 Bbai#
277,367,816 *1B44E2C4715BA85C2F36A524E8A2920E785F3FF9 bballjoem
277,367,817 *1B4103532ACF9FBA5BBDE522AE67D465717403CF BB#am
277,367,818 *1B493862997696E5F43C08232D91F5DCE087EB07 bbannual
277,367,819 *1B4D99FBE2CD3BEF78B02E4F36D41DACBFE563A3 Bba-O
277,367,820 *1B47CD1A7CFBD64151A7C07B64FBE5AD0CAEC3DB Bbarbara
277,367,821 *1B4136CE19F038BA35026B2EBC4F8BFED1464B5E Bb
277,367,822 *1B420ACC48389DD98005732811BE0AE28209EDA2 BBa?Z
277,367,823 *1B47D9D6194C289C2EAE5C736BC841A3F2AC80BE bbazbb
277,367,824 *1B4E59B1ECC906DB892FDC60B36C1F266DB5806B B!bB;
277,367,825 *1B491F99659AEBFCCB612C8C54B03DC0C2EBCFD3 B;bb(
277,367,826 *1B416068F171C2F9C1CDEB56C446D9AD3A03A81F Bb&b4
277,367,827 *1B475DBA5802F3B470DDF45CDC921855941F7133 B+bBA
277,367,828 *1B40ED0BEFF2C0A27B020ED6F2EFCFDDD0BB780A B$bbA
277,367,829 *1B43F0454E636659B00645B7150578C498C495F8 Bb(baa
277,367,830 *1B404C6A95E4D82CA2625DB6A291064B59ECA466 [email protected]
277,367,831 *1B4CC9D99E36CEB06D7D04AB094AF20F929C26E7 bbbeea123
277,367,832 *1B42743C5A71F6E31DF21880A8C5608B717ACA9C Bbbh6
277,367,833 *1B44B4AFE5F86889C1D17812C5727B13798F6812 BbbI7
277,367,834 *1B418735C888105EB97F435D0E99D18F5317E62A BbbLN
277,367,835 *1B493CDF8058D5FCAE6BD1F0FA6D162DF1F5EBE5 BBBo"
277,367,836 *1B42AFD73E4D2C7202268C09647694A8BD3FDB4A BBB-p
277,367,837 *1B4B157F7A2C3D172C3140C06367FAC77F186DC5 BbbTB
277,367,838 *1B4E39627C12A81127787B772E67C5127BA221A7 B%bBu
277,367,839 *1B4D5FFD151C78A2663E7EFC7EA3BB949494CC3C BBBuK
277,367,840 *1B48B40E0E98C0CF2062AB8E66C867EB449A07FB Bb.BV
277,367,841 *1B4241D9289C8EA5F0D151F9F76CB66722320A5F B
277,367,842 *1B4F1D0906AAC2BD6EECA0D6C4EC30F92EB7E323 BB?C
277,367,843 *1B48A562783F9719C71F24BE206BB6B545CB6EA2 BBc$/
277,367,844 *1B44213465F434547BACF3F6BA82535446300380 BBCAMILLIA
277,367,845 *1B4684B8464B16D3F9A3B99A77A48345B2E9362A bbcand
277,367,846 *1B4DB989DDBEBB20AC03DA0D5FC6C808320FC7A0 bbc(bencibilangcinta)
277,367,847 *1B4C6CF521065EFD23CBD94CDA4657239E8EA9AE BBC;E
277,367,848 *1B4FDAEA8D1B031B8218406BB6FE37AB38C14877 bbch-scalep
277,367,849 *1B4A8581C0024AFF20F7B161870BB122803DD1DC BBciZ
277,367,850 *1B4B503D045D0EBF91C8238FCA50E3A2B851DE95 BBCmL
277,367,851 *1B4B82BBC45345AA5C207C4F8F0FADFC229378B5 bbcrecord
277,367,852 *1B4CA6D11F36F2B13CF087CC70BCC0D36565F787 BbCV!
277,367,853 *1B4762FE57E1DF5C512F78CC737982F8C69143F5 BbC%W
277,367,854 *1B465ED0509A58D17ECAB30E77CC82A1D8DB623A bbcwimbledon(lightandtuneful)
277,367,855 *1B44468EF0E6E6649EE25E0EF4ACBA701BD09F9F BbcYv
277,367,856 *1B45932460B509174FD413A769E8B34F0AFACD53 B?Bd-
277,367,857 *1B4332BE1B4139E5A30D1A57E9F1391D52FE94B3 Bbd=?
277,367,858 *1B411E5A533D1BB976633512A51787C5A341B5DA bbdev2002
277,367,859 *1B4A24BDAFE4B01D9F059473A4D3C94BAEF16E40 BbdF,
277,367,860 *1B460E9C73DBABB327C6CBDD34134983018342E0 BBDOb
277,367,861 *1B4FD018B127ACC31F1948E2959EC8F8F7C817B5 B)Bdr
277,367,862 *1B40CB975D13EF7FC8CAA2172F99510BF9457934 Bbe)%
277,367,863 *1B403FA8937D599BC753F344DFF75449D9E32271 BbE-8
277,367,864 *1B4D2BC764F83909483B205B952B69B22F4878DC BBe9=
277,367,865 *1B4AFEFC2EF8C4C7B776677CBF49C961F0C8B1E5 Bbe9=
277,367,866 *1B42BB238BE88A304523D82DA1060FC99E9ED03E BbE
277,367,867 *1B493877B2CC8F1D4CEE40489332630C07712B4C B$bEc
277,367,868 *1B4EBE48112281F5AD97B63CB8ECF9720CF07555 BBECT
277,367,869 *1B4987BEF57DFBECB68AD46940B8E2702DFA281F BB;Ee
277,367,870 *1B451067DB3142DA2C3A01A9214A2E891605024B BBEFV
277,367,871 *1B403AB50E2AE105E52561A2AE18E6F383195E72 B.BeI
277,367,872 *1B4E8E9AF25DFACA46335A21348F3837752E6016 Bbelziet
277,367,873 *1B4581728F52F2A1543FCC10CEC39F68BC21C7E6 BBEM4
277,367,874 *1B4D599BFF58C4DEFFEFE251DF23D166F0C4A2D0 BbEmg
277,367,875 *1B4CE03D502DF52EC28FE36DA737FA4B3A06EFC0 BBEmT
277,367,876 *1B47F6833F88D7C73098D03C38B724A63E17E300 Bbet8
277,367,877 *1B498E097B6151C1AB871ACDA6ACECD92C2957D3 B#bEU
277,367,878 *1B4245BA253EDD439CEE18BA81F4AFBAEABF2EFD BbeuE
277,367,879 *1B4C699329A28EA126B401674677CBAEB816337F BBF+,
277,367,880 *1B4FC88264FF3866E712587998BC993545D835A3 B)B&f
277,367,881 *1B4A808D174C9C26D0416F2E54D848DA392F3DC5 BB?f+
277,367,882 *1B4A1E39012D094C28950084EB4180A5DA2D2506 bbfae1b6-f309-30dc-86c7-0e81f2d35389
277,367,883 *1B4C77FB3456F8A603FD91F3E8BE9D35A8FCC4E6 BBfch
277,367,884 *1B4BBC6A6FFD656D8CD167DB011090590FC35EB6 BBFcY
277,367,885 *1B413CE27F15F4896A0DF861043A0CCD8E9F087C BBfGu
277,367,886 *1B42F165F4D0E5ED65A874C93D71724196ACED8E b.b.f.i
277,367,887 *1B4389A996A5568E277E3668731E2165AB7B6854 B_bfQ
277,367,888 *1B48BD9E1CF9E6CE45FDEC1F068EA70FEF94C61A [email protected]
277,367,889 *1B44F94FFD9FA4D12342166E329BDC9A67AA4C50 BBfv6
277,367,890 *1B4CE972A911260CB31273D9E165963AFC672439 B"BFY
277,367,891 *1B4F7FF06A6B1D475A158EB6B8C06C9375537153 B+Bg!
277,367,892 *1B49474CB006977F0E7574D9E0D02765E1C8A6A2 BB`g
277,367,893 *1B4CF9E385320450F1E122F7B44980352C54ED4D BB-.g
277,367,894 *1B4698B4D0F09AFCEACFF125F88D0592057603CA BB"G5
277,367,895 *1B4D49E9FAD7763ADFA008AC91A96C990FAFD39B bbggal08
277,367,896 *1B4CCA1155642B8067650158E661DBD708B2FBCB Bbg+p
277,367,897 *1B4C0971B1D1022D27C7A27F792A7537EF6B5E2D B+BGU
277,367,898 *1B48C89E1931229B925D862322105800C4FE4F01 BBH%.
277,367,899 *1B4F71545577BF9315F306BDA8F1269128B7D39A BBH+.
277,367,900 *1B47D795EC1D10AF1B917FFF342A4B4EE5167738 BBH-7
277,367,901 *1B40E7A5EC5C388450AB316880B8221CA94D7DC3 BbHG;
277,367,902 *1B4F90ED5C18EDCC39F09E4A768DAF90E080921B BBhK-
277,367,903 *1B4A1B989B2071AF94A5B60889823985114E5637 BbHM$
277,367,904 *1B48BDCED7B6616523AF3EFC8C21D3D648081943 BBHOST11
277,367,905 *1B49B8C64D375028B572A345DA4673CEB3098145 B(bhv
277,367,906 *1B4BE127A7CC37186359948AEC14DA906289FE20 B[BI
277,367,907 *1B4B637643FD3F7CECB289FF71FE192315818213 BbI/)
277,367,908 *1B48CA7DD13FFD8BA5DEFC2957F42FA95014A2A9 Bb?"i
277,367,909 *1B491B67E5EB487CE6862B803424CDF7B406B7DA Bb/i_
277,367,910 *1B4D0E4E9426AE2E5183968D5FE9363C6A56167D Bb+:i
277,367,911 *1B47A5F93AE48A0B2CB4352C683B4BA73427F0B5 BbiA#
277,367,912 *1B41769CBF368F4AB2DC6EAE3DDFE05975B3FABB BbiLQ
277,367,913 *1B4548A4435DDD5DF4239429E6A8297A1A161E52 Bb/in
277,367,914 *1B4FC24BDD694AA83BBE23D710075A02ED540335 bbinaste
277,367,915 *1B49AAABAA5B9B46271C086A04E373C8E798C3CF @[email protected]
277,367,916 *1B457FDE6C5C1EFBA1DC2B7E6B5D78B3136E3F60 [email protected]
277,367,917 *1B48FF4503F4337A720968AAB848D9635F93EE1C BbjDd
277,367,918 *1B497588031973042680DC75932E81099927F545 B-BjL
277,367,919 *1B47CB6ACB2790B462D87774B864FDD2DB7FEBA0 Bb$k0
277,367,920 *1B4334182C590BDB8B45E99D3BDA2D06FA71E014 BbK0Y
277,367,921 *1B473DFD758D92BAAEE8986E293253415B0FDB45 BbKa:
277,367,922 *1B4158632EA150315C25C10C4EC90E2026758BC2 BBKb:
277,367,923 *1B4FFDCAD3864995F5D73B2B96E00198DE9E46C9 BBKD5
277,367,924 *1B4B2D0E39416951F685530E672C6BFD409E4C22 BBkeW
277,367,925 *1B452B92A0C9C89342E10057FBBA0B5547309E9A Bbkmj
277,367,926 *1B41D1EABA25C284E8D57C4F1396023BDD4443A5 Bbko_
277,367,927 *1B4C50BCE56919B35E96A15C85A5FA34CF756A29 BBKOs
277,367,928 *1B4226BC33FFEB28FAB0AA9C7D616F8721ED3708 BbkoS
277,367,929 *1B4DCDFBE85796C9750674EEE9B98A054D83B9E1 BB?kY
277,367,930 *1B430A4F231FE5739A6A92FE43619E8ADEBA1B68 B!-BL
277,367,931 *1B409F51F6D84324B95AF01F0C481D804F424FB7 B)-BL
277,367,932 *1B47369C2F9B3557A0EC291FCB779FED19766E49 BB"l"
277,367,933 *1B4FD205444B2625CB35439737C57602E925E0B9 Bb;-l
277,367,934 *1B46C3F5ECB4428C48E96D11ACB1A244D9B63FC2 Bbl="
277,367,935 *1B4AFE8CEC292C4D4A7A02110A6DD86F94FE14AD BBlcb
277,367,936 *1B469CDEB12ECCA656439DA6D575C2D6A26D45A3 Bblgrphcl2
277,367,937 *1B4B87997447162423598D129CC487E493084671 BBLGRPHQS
277,367,938 *1B4DA0082933943AF17D900F4B34AC63ECD1B988 Bb!lI
277,367,939 *1B423FDD1EBA3E4323FA67ECD1607AF6C3276627 Bb$lI
277,367,940 *1B41AC3D99ADE98D68EB811EF2555457E7D57A25 B:BLj
277,367,941 *1B4BF539443C265AD52240C8D249DEC9435972CC Bbltksbg2
277,367,942 *1B4114BDE3CE5916319BE76FFAC9B4AF8DADAD76 bblwite
277,367,943 *1B404E6CC0E4760FFD1EB311F6F46706C8E06C67 BbLz
277,367,944 *1B496E409685AA0AEBB4A1E6EC2963FEC5353F39 BB&$M
277,367,945 *1B40F01E9F12BBE15C9113DC29F9B3E105B0CACC Bb-M
277,367,946 *1B4732227F0B5F86A744CC7C4FA7ABE58AA83644 BBM1o
277,367,947 *1B4088B6C583911CFF169AC878ED21BF59151342 BBmdC
277,367,948 *1B4CFB2CF9D3B76E666C66CB6C60ACA984FB65A2 BBMe+
277,367,949 *1B450A354E816FCB5CE4559AE8A96CD0B5BB2A3F B)BmH
277,367,950 *1B44FC7A05F29DA73C4B2666F68C42103303C611 B=Bmk
277,367,951 *1B41B666400D180F03D484C6C599BABF355F30D5 B%BMW
277,367,952 *1B4F791FD95EA523E2982131C9DC1C4D48CE587E B)&Bn
277,367,953 *1B48AB0555DE3FF6F0FFDACC37DFBBEBA972F0EE BBn+_
277,367,954 *1B495577B09CEB7B56940D491E9ADCC2BD7F546F B(b;N
277,367,955 *1B464317AD272DC0AC052EE14366918E5EF79F78 Bb/N_
277,367,956 *1B46AD30C8260286771FC07BF773057C04C90074 BBn4-
277,367,957 *1B4A9ABADBECCDF6746B969D03680F1F7CA06DA6 BBN9$
277,367,958 *1B467696CECB88E3BD4291807FA5B5BB50A401FF BBnA(
277,367,959 *1B499CD89CEA343CDFEB0A9ECB1365A262F3E8BF [email protected]
277,367,960 *1B420BA176F675E3A293947F7C1ED8289A8A38F5 BBnHo
277,367,961 *1B49522A3C3686CA63C654EB6472C1F96F5ADDBC BBnk)
277,367,962 *1B4F648E1CC7F108143FC503436113E3153A7001 bbnn42
277,367,963 *1B4A21B15B475E9C211FEFAEB2EEB9608BDB2292 BbNnY
277,367,964 *1B4C4C09B63A100E15327A4B77BC30771181C801 BbNS0
277,367,965 *1B45C27728B7115F1ED9E96F6F54F2610235510E BBNT
277,367,966 *1B42C67AE3900825328AD949506A891DD4CCE993 B/BnT
277,367,967 *1B40CC8A887E8E0509D4BFB4642A56A5E070242D BB-nT
277,367,968 *1B464CEC75FFFD10776B9173F03BA9DF16671FD6 B)Bo(
277,367,969 *1B4599E5958255513E6593696295BFC09FCB64E0 B!b-O
277,367,970 *1B4A2ADF276F24E593500FF3985CD736B8C56701 Bb""O
277,367,971 *1B450C0FC416DA99D27CE1213F21DDCDF42340C2 BbO&)
277,367,972 *1B4D97F6E936EB06617A29F01FD29E2C7BDA9FEF B-bo
277,367,973 *1B48E1546B7D87FD8541F1A4C1C875F992900929 B&b"o
277,367,974 *1B4C513329C01C1D4A38DA2014AC86DB47E0AA06 BB?OE
277,367,975 *1B4B9E1DD8512527CFC8963B0B5FFDA138566945 BBOe/
277,367,976 *1B4525C31360AA78E98AE1EA98208BCC5CEF9DE8 [email protected]
277,367,977 *1B442787366044E5D43552C3063CCD2180BD3701 BBOGj
277,367,978 *1B47C45BB848860B635D256182BC80F74BAFD3AF BBO=I
277,367,979 *1B4D35F18790B027258DFA543A2FEBF1579D7825 Bbonjour2
277,367,980 *1B4397802D0FE1E86C1C7B061051915A930F259E Bboo_
277,367,981 *1B4797DBA99FB94C1BF795FAC82481D7E0C7A6D9 BBOOw
277,367,982 *1B4CDB1E7CD5B6D02CA73B82AB9361C7153F7096 BBOq!
277,367,983 *1B4DE8345ACF1ED21910288C9F552650DA03CCED Bboutzims
277,367,984 *1B43AF60797A8C9A4664C4D56A9CAD28043CF4E4 B
277,367,985 *1B4A39F32994346A6B527226BCE4ADD8E639FF18 B$bP=
277,367,986 *1B418C4473327618E056501A71ED15B85BFAA7B2 B)bp&
277,367,987 *1B42C9E76BCAA44BE3B1A663E3055433946A56E7 Bb
277,367,988 *1B48D471A0F1ABE84DA7C1DB5D28F8AC688487E5 BBPAMA
277,367,989 *1B40BAFCE1A94864D198AEA4841347EA73E97C8C Bbpf!
277,367,990 *1B46625350B3CC08CDE5CE095DFA1D7AC67A295F BbPm&
277,367,991 *1B4CE3AF8779EE95CE9C5A7C4FEBAFBC3673B39B BBPsd
277,367,992 *1B4CBAC2DDDB57B884F732893BD6C8428BF57EE7 BbPYq
277,367,993 *1B48A766BB273FB3958949F46B23B5B47BDA9412 Bb?pZ
277,367,994 *1B4B89EA7854C708628A54BFDB7C64ECDB5936AA Bb/-Q
277,367,995 *1B4E0B0026D4753EB7797B2768A8872FE6D1039C B:b+q
277,367,996 *1B4DD97AB20896EF9095C9A891D011C018DB9E69 Bbq0U
277,367,997 *1B42A8A57B38B9646BDA0573D6C5137923A9FBC9 BbQeo
277,367,998 *1B4B47339FB034CE833F4B2331ADD8DFD20D23F7 Bb)qG
277,367,999 *1B4D892E7464D4DD46493DD75F6723D409F1B2B5 B?Bqu
277,368,000 *1B480FB60F36CFD656AF4DF014E974C170FAFA0A Bbq%V
277,368,001 *1B497ABC4C4FEBFFA37BD8E3F9956C439E866129 BBQX5UM5
277,368,002 *1B4C9B2ECEBD87DD9EDEA9018CA17567FE54EDE0 BBr'
277,368,003 *1B4410161676A306F130887E7F95E155DA3A4967 BbR#/
277,368,004 *1B4CBD9A15AB8592B86A4AEBF4CB97831CEF6388 BB?r1
277,368,005 *1B4F69F7DA0F74B9268272B800E59D71F8BE62D3 BBr4H
277,368,006 *1B4119534988049FC246800E6DD5B5DDE877AFD7 BBrET
277,368,007 *1B4690A7132BBEE9EBC97548F1B3F6DA4FF0D3F9 Bbr=g
277,368,008 *1B4D2ECE93F396F33134BBF982865EBB99F578D1 [email protected]
277,368,009 *1B45F056F288486F1CD563A1E3E5FAB0B5272507 BBrl,
277,368,010 *1B4D977CB97CD724C1C0AD159A6AC0E28C02F066 BbRo$
277,368,011 *1B4D82420B0D7A2395EE119B3F8C5678AB73D144 [email protected]
277,368,012 *1B4A1300BEE2E1F87326205EA08C1E10C687BE6E bbrrrree
277,368,013 *1B4867F864CAE7FCE4603015BAEA81DF439B2370 BbR#t
277,368,014 *1B42018C30F26B6E1DF09BC820F02A8FE44E23E7 BbRX_
277,368,015 *1B460D98DCFFCB2DEEBBE1ED046405E77DB6086B B$BS/
277,368,016 *1B4FFDC9CE00AABBD39F593791EFC4D4AF3CA368 B#)bs
277,368,017 *1B43959511A10CDB26370536F1AA43074A19A606 BBS2
277,368,018 *1B44B9C0CF756A5B6913EEB9676351A1C628245C bbsattekintesbol
277,368,019 *1B4340169D34E1AD7EDE4F8356B0140FB91A0A32 [email protected]
277,368,020 *1B4A857DC83B8BC6366AC3B05E426DF2A86B2F45 [email protected]
277,368,021 *1B4DE35E2786E8A5CE4B29DDC0AB4DA75616CE1E BbSR!
277,368,022 *1B48338DDC107BFE001AB056D437832B5D23273E [email protected]
277,368,023 *1B4D2F1329E1A77FC85A2B19B63D8C8B1D82FB04 bbstyling
277,368,024 *1B4D04F1DE5ED2EFA5BCF16C128463ABF1B274E6 bbsumerpur'-'sumerpur
277,368,025 *1B47F15D2F38AD616890F4A35805062557E8418A BbSVd
277,368,026 *1B48688B45D0AC8BFAA930C08C47514C755352DE B-;bt
277,368,027 *1B406DDDDA72CB8BDCBB1CEE4C5CF6CDC2A9F905 B-)bt
277,368,028 *1B41F28C78D8F0901BC857F640FD28D83C25920F Bb)t%
277,368,029 *1B4111C3936FC224C739CF1627FAEC1D285B9312 BbT9P
277,368,030 *1B41A9D3504CA43524F63243F9D30C046ADF6191 BBtBL
277,368,031 *1B468A67A0A5A3AEA56D9781E6AFCD91CE6C16D6 B,bTf
277,368,032 *1B4575603E066FBFF93925B5A7D0EA045B4D1830 BBtpe
277,368,033 *1B449BBDDBC588262621EDDD5350346A99E47117 BB%tY
277,368,034 *1B457CE3B4409DA8CAF197E492DFEA82B70E879C BBtZe
277,368,035 *1B455AD99A3F51554E95DBC80FCDFDB706B35D90 Bb+U)
277,368,036 *1B45FA963120B2758577B5288A548766D6D9215D Bbu"0
277,368,037 *1B4DD33F8EEB95F014E1B9E58C357D01FBD6EB62 B"BUA
277,368,038 *1B48D21EB5EEE3EEB60118A6D4620302588094B6 BBU(d
277,368,039 *1B4FE26838409F6E71ED882D9908B2F82E4486F2 BBUDDY316
277,368,040 *1B469F6954EA93523C96D2320FC1FC77B694DDB7 BBUDO
277,368,041 *1B4FC496290CD5FED37F8591EEBEF840A3F6D933 BbumE
277,368,042 *1B472F1C2E2F4C4D3256A7B3D437E3A912E80CD2 BBunQ
277,368,043 *1B4C799D2EA1284C23B790C0CC203BB53131ABC1 BbuoH
277,368,044 *1B49F38490FD1A9796F28E6303804DDCEEBE7349 [email protected]
277,368,045 *1B446AC43722C7DAD8A2547DC83062221265244D b.burn
277,368,046 *1B4A72A8A83BB806A800FA057D0A3EE4A5CFA45C B,bus
277,368,047 *1B4A907C42E009AAC84754D2FFB8EB936F305045 Bb
277,368,048 *1B4F3E5C210C79E8A2249A2ADD50824C565E3453 BBV#&
277,368,049 *1B4EECCA023E9BC4475F55CAA05B31E761F1917F B#B&v
277,368,050 *1B4F59F3890754ED9EFA0CF64806DC7E5D412621 BB"v"
277,368,051 *1B4B074F98A1FD2FAE0ED6CE69232B696D0F4A70 B+bV#
277,368,052 *1B4E7BA2FB2AAECEED9716BC4E72AFCB22184D77 Bbv1r
277,368,053 *1B48B0352DDE6F74F835941C177323DCED66841C B(Bv2
277,368,054 *1B42F8D171F7C89C31905D7CDC11CBBEB5D3C848 Bbv8C
277,368,055 *1B4225C35898C40712B5FC1F2331D98C2DFAA724 BBV
277,368,056 *1B454DA9D1F8EA38AFAB78D391ED9B7ABADC270F BbvN9
277,368,057 *1B4F14B82E4B36EE6302741920E6396EF21BDBC6 BB.vp
277,368,058 *1B442F44399A193DCD027CF9940072EA32BDF0FF Bb/VT
277,368,059 *1B407DEE531ADE5C821CA62A2A38837B7A8B5E2C BBvuW
277,368,060 *1B4C7B64A9B2AAC9359A0ADDEE7A0A85D00828BE Bbwd
277,368,061 *1B4681CD879AFEBEB335AB9C92F9C3453A69898B BBwf?
277,368,062 *1B43CF6FCACA7D8AC026FD87DCAF36FE0AF6F187 B(BWi
277,368,063 *1B4AF22A1CF397C4C0CBCFB79F49B7A27C9DA079 BbW)m
277,368,064 *1B47E0D9665F8B7A5930EE8987D677823881EEF1 BBw
277,368,065 *1B4FD36DB0750FB476A944A2D7F6E29F618FA505 bbwphp1234
277,368,066 *1B4AC5AB2D8B34C66E8DAD5C11BF565F7B22315E BBWv(
277,368,067 *1B4ED0AFBC321C22A81D8F2798DDFCEBA60EF8F0 BbwWd
277,368,068 *1B4D2EF43DB9A60FE279D028EFD1FFF257B374BD B.BWZ
277,368,069 *1B4518C0509CB63C00D9C3A250EA659122CC402C B(.BX
277,368,070 *1B438C63B6B3867AF715D65C9CB9AA7635AB9C73 Bb%%X
277,368,071 *1B422A5039874C6B090889C8928DEC256B463EDD BB"Xf
277,368,072 *1B42288787532B5D197A7CCC0E188A7ED7D009EF BbXM+
277,368,073 *1B4219467DCF03ADF92CC5164A0E0C2E992F9F11 B=bY"
277,368,074 *1B4BAA5D257EA09BC11B5832305B4088F54EC9DB BB?YA
277,368,075 *1B4C6BEF305592BE29832EBE457AB1C3F5716990 BBYb4
277,368,076 *1B4FB58E26D0CE88FD0F3EF3F86F46288FDA4398 BB)YH
277,368,077 *1B4F94293A0CC66A939BDE57B34BA3E3205A68C5 BBYhN
277,368,078 *1B46B086151CC3219872BBE019699F9986CF0953 BBYJEM58
277,368,079 *1B4D917A84A937642393710106C0082840C02B64 bbyman:
277,368,080 *1B45FB4629A271E8F03D683DA5E33D0D9A1C0186 BbYQp
277,368,081 *1B4F7FB907AAA647691C7D6486F3674804136A25 BBYSe
277,368,082 *1B4559733A397E53D3BB92C8B0DEDB8E39AE0707 BB)"Z
277,368,083 *1B4B02403FCDFBA1FD57AB497D6D5109726608AC BBZ!,
277,368,084 *1B480EC44859EED043195742AA96AF7844C41901 BbZ++
277,368,085 *1B4B8420DEDD53D79459AD5C7E9D4E245786EA72 BbZ8O
277,368,086 *1B489C5AAE74D61CEA83E33DC155F215AE838EB6 BbZe
277,368,087 *1B43938AB16E0D5D6AC1C15B3D75817CE495F58B BBZh&
277,368,088 *1B442241FB5EBDE65B31A6E4F7BA543235B26403 Bb(Zv
277,368,089 *1B47519246A559FC109E72453F848072BA40DED0 「BB戰士
277,368,090 *1B4205C904672569655AAA863F963B33C5A2BF57 B_).C
277,368,091 *1B46E2CB029CAD0C80A654B4A87B32FE734D1319 B-/C%
277,368,092 *1B44466B858F640F111AE18F2FDF90D31A54E986 B;_C
277,368,093 *1B4C8DC4D75B3ABFC69E090D4FE8C43AEB720E92 B$:C.
277,368,094 *1B4AE399D20D2D3CEB670431EE9B9B6DDE329F28 BC-./
277,368,095 *1B456844DC282A5E7E67C615E775484C680E4675 BC)%.
277,368,096 *1B4E92B2999997DB4368303FA76650FADDD99334 B-"c#
277,368,097 *1B45C5B14C11003177857DF5085A2376E8E48090 B;c_#
277,368,098 *1B430037CB5A0E60AF034762CAD58810599FFB19 B;c!
277,368,099 *1B434CEB075726B8EE266B49C21FD3ACFE99ED45 B"/!c
277,368,100 *1B428EEC2708D5E648B9FC351F9AFA2F669CCCC6 B)!&c
277,368,101 *1B4C4E2991E204354C996E0E5C9092B3CC32D373 B$,?c
277,368,102 *1B4E6FE8E187682804D460C263717597F77DAFE0 B$?)c
277,368,103 *1B410A07C6561C473D464ED49C4A840713A43231 B$c~
277,368,104 *1B4C526B9C7A3852AEB600BC7AFE8307AE484D0B B$c-$
277,368,105 *1B445D00C28DE2696E3801F3D51EC43E041362E7 Bc,
277,368,106 *1B48701DAD5FE02F3A65D5C0868ABCACD31F3922 Bc:/)
277,368,107 *1B48C809791CD345A6B30F9A4D3A69739BE09A9C Bc0l)
277,368,108 *1B467192C4C7DAB02F889D0E9A17E4BFD89569E4 BC0OG
277,368,109 *1B4F81A5BB30FA3C3282521E658CB4618512DC24 b!c0rp0real
277,368,110 *1B42D34C5C06FC4BEE1883F8C72C16B2044127EF BC%0T
277,368,111 *1B4DB62D5478826B0D1FE82967B7541B8D9A4EBB BC0Y3
277,368,112 *1B45B3303230CB5BAA8175D251ACAC3FE1C05881 bc125e44-fb2c-37df-847f-672887717a82
277,368,113 *1B47F7C0EE071534A11573B471851ABB75FC0699 BC15H
277,368,114 *1B456862517741AA09FB1FA487652744BEF7AE37 BC1Yr
277,368,115 *1B43D48570D0863FF2BAA45022D8FA182B373EAD bc–288
277,368,116 *1B4B36C5D21BA99A7DFB5C082E94090BEF7E7D33 bc298jae
277,368,117 *1B4F63CD49DC8A69EE30399A774163D491FF15CF Bc/2i
277,368,118 *1B431B07D3DFE47A037C62E7C13E9807E1BF4955 BC.2O
277,368,119 *1B4339C3981E606459367D0AFC5C94EB1D7C7A12 B.C2t
277,368,120 *1B4F6BEEDC2E295571DF3C9236BDDDEC30EE484E B#C#3
277,368,121 *1B43A86CEC3FE16F341A338284EE1679905AB91E Bc3&1
277,368,122 *1B42F9B408C74DC5FFEF98F87B4EA71FD4B1F792 Bc3a2
277,368,123 *1B46EF60D7E2DC0B7E28580D239728D3267039FD BC3CS
277,368,124 *1B435FB0159DF4B9260CF2EA80409F5C6E6CEDA7 Bc3lh
277,368,125 *1B48134C3D8AE088767E1ECB2B35E0D0B98F7041 Bc3.M
277,368,126 *1B4E7678CDDAD4B725EAFABEC6DFC45C3D5E0F01 Bc3M)
277,368,127 *1B409D4B111FA20872F79E4D5253A7CBFBE4656F Bc3se
277,368,128 *1B413DCE102D3E49B8F6EC48D442E2D24AA953E7 B!%c4
277,368,129 *1B4D435991C1C37DE036DA0602EF33DE974CF607 BC4(h
277,368,130 *1B4586DA5ACE99797192F3A15C907A7A5A18D066 Bc4N9
277,368,131 *1B4920586AFF326ACA6FB6A35BF228A3ADF53810 BC4uN
277,368,132 *1B436768084C6819F217F72482155A747BBA7F62 BC5"_
277,368,133 *1B4ED022DC7027DB1F1084F0A827D8EF950C7671 bc563
277,368,134 *1B4132E28C76EF17B3B372D3C68D673CF5A34888 Bc5-w
277,368,135 *1B45836E8924D6DF1C1D615AD7815DE19B6A7EB6 BC5XS
277,368,136 *1B4403573F553CE7225C06923488BEA46C93E82A BC69-
277,368,137 *1B48FED98DDD33B56FD9E91E05D9924D69E12C7F BC6G)
277,368,138 *1B40C6EFB855B7656A3B307BBA9EFED4406B4230 BC6Gu
277,368,139 *1B41D28258CBE04F5A645269B54665EDD8512302 Bc6$K
277,368,140 *1B45D00AA8CB316504B5730577528A9492F67A77 B(C6w
277,368,141 *1B4FD4F6C4230B62DF61B4F888D9199EA4D75FFA B/C:7
277,368,142 *1B4AE3BA9E2C3AA18049FAFAFB958F1FCECE4942 [email protected]$7$
277,368,143 *1B410650EC54BEC73C6F4847058721EF6181E66F B(c7G
277,368,144 *1B42E58E93353570E65375D4CDF52BCBECC60961 BC%7t
277,368,145 *1B4CD658B5A5079EA0D7A02C7B1546CBF2DD33AD B-&C8
277,368,146 *1B4E61D40660F4C7684BEF88EFA5FD4AFB4F63E9 B"C8#
277,368,147 *1B4EC1E949672383D3E25E3F63BBFFE039A26F1E B
277,368,148 *1B4EE80419AD81891D71D6DC75BD58C6F2A27D3B B%c8/
277,368,149 *1B485530C13A8367FD8C7614EA8307B2B431B38A BC_8E
277,368,150 *1B4ED58DAA1079F0C05FF0A27D928772B053723A BC8L7
277,368,151 *1B423681DA1E079C828A57F367DBA8126E963365 Bc;8O
277,368,152 *1B45C3126CAFC20960027CAA33C8625B951B3FCC BC94.
277,368,153 *1B4699B6C23F72507120D9618C432258531F9413 BC9;R
277,368,154 *1B4DC7D5E158ACCD20C8CE5B9A7AC32F907A96F4 BC"-a
277,368,155 *1B46562C0D814373A35114C078199BE4C66E3B9A Bc,!a
277,368,156 *1B45C2B7926639C002E542A26BFCF8B41ED4EE9E BC#A5
277,368,157 *1B41FBE4E6D5E9E5242DAC37AD5096EA320C7C7D Bcabp
277,368,158 *1B4F6C2AB64FB3B6B1DD510892FBB9221F5D1094 BcAFL
277,368,159 *1B46F1062A613E783D675962795E483092714CC6 bc-agoodperson
277,368,160 *1B40332C49D4391E0AA548CC228A5F6A6D6FB4A7 Bcaje
277,368,161 *1B447D1A5F0C3500013336ABB30767A00BAC69FE BcAjW
277,368,162 *1B4D140E1ABD69F998DA255260701DE94C7F73DC bcamel01
277,368,163 *1B4278B6046F350AB733A8DF743D280275435763 bcanada8
277,368,164 *1B4CEF7EDAAD92A74BE7E16D81FC2938856F13E4 bcanaseed
277,368,165 *1B484B8936E8BF383EEE7EB562A1EE4A5206FC56 Bcar3
277,368,166 *1B472DB5F041A14CE9137EE2D7BA299AF5514C88 B.cb0
277,368,167 *1B4EF800556FB2459E0D2FF919A557DD2BE19B0A BCB3o
277,368,168 *1B4E5654DDCA824AF84961027E09055BDBC1B708 BCB4Q
277,368,169 *1B4215F433E53BDE3F16752800104A9B03AB2EE0 Bc:B5
277,368,170 *1B45499593ADF99CBC47360DDB9C6B5718E1A1D4 Bc%b9
277,368,171 *1B4D07DE45F88DF005966ECEDB7E439B6E6DD9C8 bc-bank-emails-insurance-media-coast-capital
277,368,172 *1B4BBD5EAEC7E4CA22524CC10F94C0DC90C611FF [email protected]
277,368,173 *1B4D8CD1268A60D1AC2B744A7575AC372EBA32EB BCbgA
277,368,174 *1B481D55231235230A8F730E061958DFFF562AFD BCB(h
277,368,175 *1B4B1441FD1C28C228C061A1D2C299E881F91D17 BCBMZ
277,368,176 *1B4B7CBB896EA37A820ECFDFBAB067C27E21BCFE Bc
277,368,177 *1B46DFE79E516322A2731B6C93EBE036AE2E651C B"cbo
277,368,178 *1B43A03813C6411C2E42D2D245A71DAB96ADDE1C BCbPw
277,368,179 *1B45C0428590F9AEFE0D1FD28C1D77B177660D9C BC%Br
277,368,180 *1B4B2C613ECB4BDB1170E450CAEB6211E0D6D44F Bc)bS
277,368,181 *1B48F211FADBA410BD3C56917C4D595777600BCC Bcbva
277,368,182 *1B4E479EB5002F99E7B5338A69D9673774CF568F B&,CC
277,368,183 *1B4E24D443B3D4E8B2077116AAE99CD63280C9F2 B&C/C
277,368,184 *1B48F7B9EED40A6F84CD1CC7E902A5E8F9B2DB3C BC)c)
277,368,185 *1B4D7C5CF935B0D927CBB74567B6C504FCBBD6CE B&cC&
277,368,186 *1B47EC71C02B72DAFB6AC877EC105601DEB73771 Bcc3I
277,368,187 *1B42E9D1D0A821FDD9F5706E9E94E4ED735F9FCD BcC4Z
277,368,188 *1B46244B42B2435EF43F404BABAF2530DF3B78EF BC+Ca
277,368,189 *1B44CD7A9470784486133718B7ACD78C56377023 [email protected]
277,368,190 *1B40DA53A7C47375C66092AABBC3665309553332 bcciriculuurriculemb
277,368,191 *1B4EBB9BE90381690AA95918FC4D00CB5D0FB0FF BCCIWIKI
277,368,192 *1B4D2682A20E60CE790B25F8777FE1366E5769CA BCCsI
277,368,193 *1B44AA4C2D967A8DA228CA043FE8AC28DFBA42D6 BcD1r
277,368,194 *1B435D6B1D717E0FFC410A0920BF2E25ED182DE2 BcDBZ
277,368,195 *1B4629439A286AB1451881521B7E21C35E717C92 BCDD"
277,368,196 *1B4F8B5DF5F84CBE984F99D7B6BCFB2D5F2D1E3F bcde150a89
277,368,197 *1B4443FB893D44232455F5CF4253D4DB213E849F B=cdI
277,368,198 *1B4A879D2221A8C65BBDB0B5DAF4B715A6239B38 BCDiL
277,368,199 *1B4838036520DEDB0836BC991F9AF8C10F8C760C BC;Dk
277,368,200 *1B4EB6630D06223E62B13F0C569308A91137B4DA BCdoa
277,368,201 *1B4B4BB8807C96FC53F18373B7E43D5B27813EA6 B;.Ce
277,368,202 *1B413B6596A6A07E3C555BE01C08FE3AB30F4439 Bc-E$
277,368,203 *1B45CAD039E96D5F107C2752B41187C7277A161D Bc$E(
277,368,204 *1B412E86886926B79C51E0F0CA8BAC58A30501EB BCE2f
277,368,205 *1B493E08FD6488418B8794A49406D0B914B742AF BCE–600
277,368,206 *1B4634E8FDB68B56BFA498545253A215E9406ACB BCE$9
277,368,207 *1B45A9BFEF67FD85752654699C65E5209EACD99A BCEBCE13
277,368,208 *1B4F36362F0537E8B175AD03B44ED3A0576304F7 BCEkr
277,368,209 *1B4E3E5E8091D6053043660EDA1CFCFDD07BB4D8 Bcelica
277,368,210 *1B40E1F36D5358D3A77AA39B0D9FE16DB3F21F2B BcE+t
277,368,211 *1B41204D48C771F4BC2712F269C8EF5F0F1B97BE BCeTM
277,368,212 *1B4ED27A93223CE204385D6B6D735CF850F05E66 BcE)w
277,368,213 *1B4D5952E49353AB5991175ABB7AEAB39C55C622 B!CF,
277,368,214 *1B41D1C13297FE3DE4B8900AC89F4616076CEFCD B+c)f
277,368,215 *1B442949EA793C81D0811AA22CA8288AA774EE44 Bc#_f
277,368,216 *1B4BD68FA5919B822F67CB570B1457E667B4B53C BcF0$
277,368,217 *1B428DE026BAE9C9DD8DD9626410405C25D419D1 BcF4u
277,368,218 *1B43D4104179177AC0AFAE80C5E1B24F39ED2208 bcfa-ab
277,368,219 *1B41331DCF6F8BA34575CDF7980E15B2C45B69E8 BcFf1
277,368,220 *1B4F5E5B172E4D8075EEDDB48CBC0D3BB9D2CB3A B_cfG
277,368,221 *1B418405E2D4A7C5C7111C1BC0AEE87F983EFF36 BCfHe
277,368,222 *1B4DCC84F72946F93BFE6530CD20077E0EB9175F BCfIH
277,368,223 *1B4028ADFE88CFCECD53FD6C8E0AD9C9ADF13620 BCFj_
277,368,224 *1B473A5E33D19EEA9552AF67FC66B7EB80B95D47 Bc!fL
277,368,225 *1B482201DFFA171DC023C00305D8C2FDF74C31F2 Bc$Fn
277,368,226 *1B46495DD130DF655353852BE9D762B2F2E5CA84 B
277,368,227 *1B4E7BACA40E8BC9C3D73D0D5B300BFAA7E0D443 bcftelberg
277,368,228 *1B4A99B4D813CE0C9043293ADA52AB5404377CB0 BCFuj
277,368,229 *1B4B9A81F26F06ADDB9F2437908C4AE00CCABE90 B_Cg
277,368,230 *1B461DA8559FE2860D4340541564A9B973067B4F BC_g!
277,368,231 *1B4F643A89638BD163DFE4A160F4BB3C6022AFEB Bc/,g
277,368,232 *1B44E8A46C722572143B583968C01F5244797C59 Bcg5I
277,368,233 *1B4200A8EC55711AF4345BD9325533D23778252B Bc_g7
277,368,234 *1B45D51D392B1DABB8BAB9B2E73ABECEBF8A46C0 BCG8
277,368,235 *1B4D738C201DE3E901C5CE9AF678831388B6378B BCG_9
277,368,236 *1B492110B8B2A3A38F59A1B4B73857E21D2CAD50 Bcg(A
277,368,237 *1B43D6DD927840E368FBE6A6D796D52D6C3774BC BcgDU
277,368,238 *1B43C2A4CF1954C1D1D8B0D6E318C1A6FBA1D01B bcghm123
277,368,239 *1B470D45266B946A488ECD03A5C75656A6D91F36 BCG(l
277,368,240 *1B465A86B4891FBAE369717A88A2C0B7ABD8277D BcGnZ
277,368,241 *1B48CA24938F8455BDD3F6B38AAAA7448E373FAD Bcgt%
277,368,242 *1B4B3A98B42A7D74E112DD789566E850FDC9940C BC($H
277,368,243 *1B47C7BB6105D6947660446C041B0FD7D079E8F7 Bc.H)
277,368,244 *1B4D2CC727992100B3AA8B130B97D0C786BC39C6 B"c$h
277,368,245 *1B4E614D63AC1AC6E78959845B0F6654DDCF68F8 BCh4Z
277,368,246 *1B48ABE0D5B8C9836DEAD427545E1CA2A9BB7DD7 BCH8"
277,368,247 *1B46D4CA40D78974397EADFD11851A810D5E14A0 [email protected]
277,368,248 *1B492177F9C5691B3036B369AC696BEBD2D8B766 Bcharon7
277,368,249 *1B4018F04F500141EA1AC89A7D67E61556B9049E bcHbaa
277,368,250 *1B426A47F904C3B18172B3F8D71B39B4A60FBEE1 Bchdd
277,368,251 *1B46E0A0829764FBAF0573B7BBB3A565EACF9ECA bcherry1234
277,368,252 *1B43331BA51E021B7C28FA5BE1AB5F2E1843A829 Bchl
277,368,253 *1B4C362CB6A28FFD82C19641A4F15276A4C4B151 BcHMt
277,368,254 *1B4280811D7150A8151BD87D56951A43BACED6B2 BC"HR
277,368,255 *1B4D9AB5A4B87D0C81CDB69F2275E64F189B63A1 B,CI+
277,368,256 *1B451DD3DBB3713521B1BD4E7C31B7181D940B21 B=Ci?
277,368,257 *1B4DDBA52F393BBE3B7673FEFE5107A48A1391A6 B
277,368,258 *1B4569B89BA026C2C0A4A821E5F1E4AA0099F377 BCIE5
277,368,259 *1B4FEDA3A12BB2734B9325AD9A30857F5A3B3357 B/cIH
277,368,260 *1B416D5DDC57D93DDC537F38FA12F953507A219F BcIHI
277,368,261 *1B4B91243F0D15EC1C9375225DD64DEB1A71672B B%Cij
277,368,262 *1B4C1CC2BE9353759101C1B05EC7130F31F0E506 BcIN1
277,368,263 *1B46B57C37952F440A88A103B8492C33BE312BC2 B!ciP
277,368,264 *1B46C934037FBC5795B86CF584AF5CD5A0AAB1E2 BCiUt
277,368,265 *1B40EAACBCDE79949D548C1FEE8F9E887C197787 BC)j&
277,368,266 *1B4635928186CDD8769EAA1BE992DD8C8EDF7EBC BCj7M
277,368,267 *1B437A0872CF9380D3397D37B6D49B7EDF016076 BCjC4
277,368,268 *1B4E676AC7FFCD48B781B32E91202570FEA5B093 BCjKU
277,368,269 *1B47FEE86E695383946BADD3E0452EEEC02DEBD8 Bcjmmjcs
277,368,270 *1B43BDE27E1D5FC3FE51BD276FE1B25A66D7C836 bcjulnpb48
277,368,271 *1B4D9D1D476E615794F236C61AD3A481AEECDB0F BC+/K
277,368,272 *1B487074932F3BE00599ABD9671A86AC19A935AF B=$Ck
277,368,273 *1B4B2C8BFADC1F01890E04DCD7E0996169BC1E3D BC/,k
277,368,274 *1B494B707E367D851C60656CDD8B0CB80089BBCE Bc?=k
277,368,275 *1B4A8458910F6A46247623CEDE7D9FCAB463AC54 B)cK5
277,368,276 *1B4DE69852C85B782A3BEFBCBB7C3C1E47EFC0E7 [email protected]
277,368,277 *1B470720657D78F2AE87271A2578CB5F7A6FA09E bckelhaus
277,368,278 *1B4A9D38CBB93D751B1111B73256C9F0E9DA70E6 BC,kF
277,368,279 *1B47DC4857C2B2D275A9D1DC1872A8896032A6BE BCK_g
277,368,280 *1B474776989F9F63476AA6BB8EFC4C5C70AFCFA5 BcKħ
277,368,281 *1B4B845FC6FC52FF8CB270EE53C55FF59299E6FC BcK/q
277,368,282 *1B4E4D56E9399D88B0754B30EBC8188BB5A0D600 BckSq
277,368,283 *1B47A82132A626CD67D13C2E31C36C7B49B3B169 BcK!V
277,368,284 *1B41A0E7DE660A84D5485300675047439383D658 B
277,368,285 *1B4304CEE75E58CFC9843D988ED571B2EEF57A5A Bc;l=
277,368,286 *1B4574BFCCAFC24E6FFB5C3872C5313E93B06AD9 Bcl#?
277,368,287 *1B4AA2648679ECE1CC74BD575138243469EEDE4E BCl%C
277,368,288 *1B4BF80A134496FFADB182C4383B76D0F7F3C599 BClcH
277,368,289 *1B401346B7C0B29DF7A484D48D8DB977B5556225 BcL+I
277,368,290 *1B453027A84FA6B655F8D35B7961E9C7F00DDEBF BcLiC
277,368,291 *1B4C26F01763967084E21903105F64ACB8798AE3 BcljG
277,368,292 *1B40F2BE0B5410541BD8049E317901A9C07FB39E bclooch
277,368,293 *1B4C77CD8078ECB1AC13B1C37AD1A35D72871A98 BCLP,
277,368,294 *1B478BF61E3A1D45CD1ECDCEAE20EFCC352D6D93 BC$lp
277,368,295 *1B4E03D4A7C64E71E9B43CF8A7636C9612CF79BD [email protected]
277,368,296 *1B4282025E40A55D6377E3E7DD96AD6A4881B837 B.clv
277,368,297 *1B4985DB257C7AFDC3E1E67A3277C00E4D70D68B BcLWA
277,368,298 *1B4A6F15F9018CD76D2DF2260BA5AB0A7F713CBB BC;LZ
277,368,299 *1B42B1FC1407040FD13C2BCF15C83BE0663488B2 BCM;"
277,368,300 *1B409E6FB19D45E19F0690892FE7CF0200EB4810 B,CM6
277,368,301 *1B450820B73C53540E6D2AC2F330732FE26E692B Bcmap
277,368,302 *1B4F1E2A0F7179AC7BB73E0F489C58A0FD71C8D6 [email protected]
277,368,303 *1B4601FF39B10F0E1C640DDB8785411093593D81 [email protected]
277,368,304 *1B4B978A9854F1AFF0D94E314B38802AB99540BF BcM
277,368,305 *1B48B4B6BB0C24E02904E9424FEDCB00863EA869 B,cMi
277,368,306 *1B46466EACF4CF4C86B449072DCB632AA27367FE BCMjN
277,368,307 *1B4EA99D95BD50C58397AB3E992A4CC2AF702E00 Bc#mm
277,368,308 *1B4C0F3E7FD07E3F8EF5121E2676B4175C15FBB0 BCmmu
277,368,309 *1B4556F2C4389C1E710FF617CCF067A02E81B0BE BCm;n
277,368,310 *1B4AB118870F0433CF0147E0CE3E11271191D835 BcmoZ
277,368,311 *1B4CBF2D2AEA1814E7EBEB2CE73F00DB07F8D2CB BCmqH
277,368,312 *1B44F47A42A1E01EA9CBD95F1478539954A41055 B+cMw
277,368,313 *1B4A56EC4FA5103A7EF1498ECF7336D2E621ACF8 BcMWP
277,368,314 *1B45E5F7A1BC301639B5B61CA88C6BD7E1522B86 BCn?&
277,368,315 *1B4B306BB32600B0DD4E684553D5614A237412F3 BCn"_
277,368,316 *1B4FBD1DC0DBB003BCD41ACC9917D3EE95FF48B0 B._cN
277,368,317 *1B4CB0FE3BB76E4F677B16B9F1E4FE20C9C7D82F B+c"n
277,368,318 *1B475DA929A64863DA1DA2010C330D3585BE3A59 BCn2V
277,368,319 *1B4539AEDB829936EEA1C7CF3E8CD675C8CF6F06 BcN)8
277,368,320 *1B402B35B582E15BA8EC08F76BA053F67BEA390C bcnhaupt
277,368,321 *1B4770945087ED61F53AA126557FF1D275900B39 BcNHB
277,368,322 *1B4ECC4FC0523E4E9829018533D76D8AF0468825 BC,NN
277,368,323 *1B4DAC64EC413A2F5CEE728B5E45FFBDE2C4C74A BCNqO
277,368,324 *1B41F02F5FDC05A3B4DEC61EB9182290E5EE6B4B BCNtG
277,368,325 *1B4D8A525D649A44280EEE0570CBA61EDD0D69A5 B"c%O
277,368,326 *1B49703D6161E74E6285B1F629DA0FA5F8F3826C B(%cO
277,368,327 *1B40833B41D6A28F2B0DCA160E5C9BF2868E4D04 Bc%$O
277,368,328 *1B41F7D660997ABA4A6F4811314108051193DA4C B$&co
277,368,329 *1B4908B662909688A1F565D345D3B2B41EFF7321 Bc.o6
277,368,330 *1B4B4CF8B90501D8500307471512C20B5BFC0FBC BCO63
277,368,331 *1B40DCCEB66320649859605C4A4428F480A34E48 Bcob
277,368,332 *1B40E6786E8CED6B1A0615C077C9ACF43D93D600 bcohbk
277,368,333