List database


# MySQL hash MySQL password
242,980,001 *1791132151CFB982EAA22D0B6BFA25577F8B6741 1E0C5C90-3D47-34EE-8138-73B9ACD3313C
242,980,002 *179B1F81072225CDA676750D498EBA178F5BECD1 1ESTRELLAD
242,980,003 *179220A5ABFEEAF65D56A40C066F1C20A27EE465 1FENBARER
242,980,004 *1799F03F0912C782F4B322572E63CD7A08DF7FCD 1.hiukkasilmaisimiin
242,980,005 *17977DE44D82B7F3145884B5B91850A2D99636EC 1 IMAGEWERBESPOT
242,980,006 *1793AE7F6269448419AE93E50D6FB8A121178FD1 1jancker-pass
242,980,007 *1797E458FC34D3E1EBB34FA58044331D42F763CC 1.jatkohoito-ohjeiden
242,980,008 *17996B0CCF95EF3E7EEF366361642A85C32B196D 1KNOBELPREIS
242,980,009 *1794EBCE9A92BCF155E63CD45D913FD7E39B11CE 1komentotoimintoja
242,980,010 *1791D66B09E29964D612148EBA52A48733B1A181 1-korkoehtoja
242,980,011 *1798F87D720791D6649E50E4E1EEE078C145C81F 1.MEDIKAMENTENBEDARF
242,980,012 *179E0B0FE7097BBFA0CC2858FA19B0A4036D4A1D 1-offene-geschlossene
242,980,013 *17909BE2E2FA104F680B07B13EA178CFBC364FC2 1OSWALT
242,980,014 *17990D1C36A8ED1B8A0B232A0B133583A5E64FFB 1SAAGDNU
242,980,015 *179A02EDD268A2A7F55CC17BABC7EC9D45B59A6A 1-SEMI-TRACTOR-TRAILER
242,980,016 *1799BFFEE4BF55BBA1FBB26C923B9B25E64EF3BB 1-STEUERABKOMMEN
242,980,017 *179E0028A8C0BAD671CFC03DA92ECF2A5073BF3A 1-turkishatun
242,980,018 *179B4F48252017D940622355417721358B12A48A 2006EB
242,980,019 *179FFDC8EB55D532E3EAE35A2FB6EBA1B92D8582 20AAI
242,980,020 *179B62BAC95194F705122F9051E701DAA850EEA3 2289F32F-FB76-436A-AE84-9A5A3D1DFD2D
242,980,021 *179ED1018B9027788BDA3A8304F09EFDACB52A5D 22LEBENSMUT
242,980,022 *1797406EE1EA15723FC7C3E6912FC16A845B5023 2694407 ADLUXPIT
242,980,023 *1792D74FA6A21DCC31BDF3697E9C85C3E91A6CCD 2803507 kauhojen.k
242,980,024 *1794BCAE55A057D1B583AE2C6066F0E53B26A626 2829292 TAPAHTUMAT.K
242,980,025 *17946DDBE3655DFFA03335D2A30A3263483F47D3 28CONFOUND
242,980,026 *1791B02247CF8E0FF0F5B02D1F3C1937A991BC2E 2fcbcfinc
242,980,027 *17991B4227BD1D6D04CA39C7B9F7DA074D036CA6 2.(feat..raku)
242,980,028 *1792D3553C23B65B3870688EB6262C42CD3D8042 2.hiihtomatka
242,980,029 *179B044020565A4580A854278B09ADB2A961180D 2ilovesound9
242,980,030 *179A3432074C0B2C86F69B11E34A4DC7A6A607C2 2puzzole05
242,980,031 *1795172494C517D4D87185F1E5CEE24C57815FD3 2.seeschlange
242,980,032 *179ACF22FC73E95F74EE2AA0305FE9DD9660C6B7 3:..1..2#..-&...Gentile
242,980,033 *1791EC595EB53906A7FFFCB27F726963C9B9A4FA 327MATIAS
242,980,034 *17982431F8EDFE39BFFD207D6683A7E2950205FC 32INTERDISZIPLINAERES
242,980,035 *179B2231022BE3E6790E59CACAE1B6F43F38991B 3: 3 # & WHIFFLETREE
242,980,036 *1795C14C4BE0A41A90A83A43C008327641EE87F5 34WAHLVORBEREITUNGSAUSSCHUSS
242,980,037 *17999A39FCFDBA12469C6F9E3FEA0F1C78EC5AD2 3ADOPTE
242,980,038 *17977AA1CC83883D7E083A4BECA9432EB7FDB58F 3 AJANKOHTAISMAKASIINI
242,980,039 *179E85C9D4C93A5A98840761BCD4374F3DE5156C 3AUGUST1301
242,980,040 *179CDD73E8398FCCB02EB625A243204F6A8F3D32 3D~0~O)X(
242,980,041 *1794AD17485E2891C50BDE8834B16FF33AE9D11C 3 KUNTOSALIRYHM
242,980,042 *17988774D3FB0D4D4F3ADFFC59819A02C764A101 3 MAEYAMA
242,980,043 *1790EE7AC65A3F2DCD27315468E2788686F13D35 40KENNA
242,980,044 *179E5CD46A67BDC17472C120B04DBD1CF2D97226 417386 LAUTAKUNTA ESITT
242,980,045 *1791ECEF307CE1F0D069AA83CE4864C2CE28EBA9 4ANASTOON
242,980,046 *17941F4C4F0491052715B8BFCA1C9148C49682F5 4PHIDRO$
242,980,047 *179691B99E68387B4FC553C0D926778923795C5A 4QWERTYMASTERS
242,980,048 *179AFE71803294B64844A8FCE28F8C84B33CE5FE 4STRIDERJEREMY
242,980,049 *179C635F5349EA01936E4F5C6827679B0F91BF73 4sultan4
242,980,050 *17982E8B690540B7974344ADF0B1B7CE4C54AC3A 4VZ8
242,980,051 *179A9A0A187796DA6608ADF0175D71F839EDCD38 5446-daterape
242,980,052 *17920BA8BDDBD0D5CCB8492275C9B5764CB46771 [email protected]@1zed
242,980,053 *1795052F4ABCCE4F9AC4C8AE4F8DB147E9F68938 5CONDESSEDNOC
242,980,054 *1790A4EF88EA9297CC309EB92E703751B24DC1E1 5C線九巴
242,980,055 *179A7A3230EAFCFCFA5F2B9CCEA08713BE478679 5ETIDONYS
242,980,056 *179E8C38F855CFB7BC8E6E9359076703264DE9CC 5 JAKUTISCHEN
242,980,057 *179686FE2387FFB8081A69D9A1E4D4F68E8B1041 5NIHIOKRI
242,980,058 *179B5120E1F2F63AF1654CABA5B2590E1CC92D56 5PLANTBATCHBEGETBINDERYBLOCK
242,980,059 *179586FF55CF3073147D092AD8DD9A402C57BAF0 5QINGLIN
242,980,060 *179EF63C379218DCAAE4E361E795A1CE63CA6080 5SMORZASTES
242,980,061 *179458A1D5E49A325BFFFF52FFCBB62482A5C196 5SUOECARENIC
242,980,062 *179D2EDE11A9F76033C4BB9855B5E49F4C100EED 5.universitaetskrankenhauses
242,980,063 *17911EA8E9BD7D5CA30F04633E2E2B3180215050 5VIVANDIER
242,980,064 *179A87F24337030648332E7003177D7CF09A7BFA 5WEASELSUNSET
242,980,065 *179809DC2A64F42E1EFCB3B9CF2CADFC3AB04BFB 6e2de28da54e3d0b9ce2b0623eb30855
242,980,066 *179AC72D69925CAB36594D05DB4F129FC7AC57E3 6ETSDROON
242,980,067 *179ACABD326EDA2E0B6BE71184217B733F978897 6iloveswoosh3
242,980,068 *1799E63CE2CBB4CF7F285CC3F1E1A9D62E9F2809 6ONDULERTE
242,980,069 *179889F55B859460C99E51BFF05AAFDF455BA2EF 6SKAETTAL
242,980,070 *179D959A70132E483EB5CFF55ADF87B6F0A9DD93 6TREVORDYLAN
242,980,071 *179248872B6C79CA34E33518D35F0B1A695EBDB7 6ZENNOITCES
242,980,072 *179B78500113576BADA06431B80C1445CDDE9838 711ada
242,980,073 *1792765E332E5A20E6CD3EF2F89A5A89DB0DA367 7AMEBICIDE
242,980,074 *1794C65B437B172794621F8243D783DFA8E208DB +7ELEOPHY+7E
242,980,075 *179B9F6CF4BEC969EC16051A392E2BD38B7543A8 7ESTAVER
242,980,076 *179E018702023FC63635847FA1B32C5E3775FFF6 7FLATSTABILIZESTABLESTAND
242,980,077 *179BC1315B9359647329AD4EE6F7A381715D3024 7iluvfearless6
242,980,078 *1790D9BFE45DD409D9C0CF9A07881375E73BAF95 7.KOSAETZE
242,980,079 *1794A1335691D9F03D5916F800190378F769095A 7MITCHANGIE
242,980,080 *1799976E824B28CCE8B8DC04B9B1E7BB1ABC125A 849delilah
242,980,081 *179684F4644909BBF34BAD1E5D551EF6E31DC693 8ANDERSONVENUS
242,980,082 *17989F9B7EB3F78CA6C1860FFC0B9C0C3D0DCF4B 8ILOVESABRINA9
242,980,083 *17991030A26F0701FE2777C68F664144C1130FA3 8IRISHHOBBIT
242,980,084 *179EEDF978A91946C409CCE2C197A549F5FEAAB3 8NATURGROSSE
242,980,085 *179C315B071B4B92FB665F3349FF69A3E376EFA0 8NOTAGREE
242,980,086 *179AC2D46FA5C5018A5DA243BA9FDDE696E71923 8NREGEFNI
242,980,087 *179A66ADBB7DA7A10084D975C09DDD42ED006E46 8OBSERVEDSCORE
242,980,088 *17902F39C09CBCBBE89A45A6ECB63B9518FA88DD 8#)-~O~o-3B<-
242,980,089 *179B191665E84D6BC110D23C241230F1A351ACF8 8======P.*.*.*.~0~O(O_-)
242,980,090 *179BBD42AA6238A86AC24BAC54891177A5FC6A92 8RUTA11T13S
242,980,091 *17917C391F5DAB01E1137DA5044D1FE304037426 8THSOSES
242,980,092 *179B20B7290A112C27DBA8ADFD414BAB494556F0 8TNEMESSIDREV
242,980,093 *179CCE7F740A50E6F7FCB055ABF80945980E0B75 9152003
242,980,094 *17948E26FE8B2AB2AD9963E9C91242461C6419EE 9DDF8ECD-1EFE-48B5-8A5D-6EC8ADEB2712
242,980,095 *179D4CE46B3C23B939A092AB06EE571C412780BC 9DNEIRFNU
242,980,096 *179A2E0ECC8E5C4CAF73DE1D99A661CC77358D17 9NEDNTSVA
242,980,097 *179C93D3B07F62D71BE0B96380F34F5BA4471BE1 9NIEUBLAGANEGO
242,980,098 *179F281BAC9362A9A8A382B5FEF87F9CCFB96D84 9.TOIMINTAMENETELMI
242,980,099 *1794E5BCF3C67A7B6C28932529E7C7409AF646F3 9VERONICASTEALTH
242,980,100 *17954536826F69209E02788394E6F6D7309A98F2 a1w9h
242,980,101 *17996200DBD40409D782ACF48A660B471D3373BE A-2(E
242,980,102 *179C8179385632B97F9EE290A248D64FDCFD178A A7I&P
242,980,103 *179049AFC42138EEB2EF814DE761E32B0FC62B18 AAC\UK
242,980,104 *1793C043A6268D352525EBD9531C498490996D36 AAE82*
242,980,105 *1794E16E320A643A33BC34A7AD6C0ADFBEFEFBBC AALIYAH-ADAMS
242,980,106 *17959335267EC7BFDFACAFA6AC2828FDDE82A085 AA.<W
242,980,107 *1790B0753811C8F1DC019362088FAD45C295C6BA ACRESAPOREDI
242,980,108 *179453420D44E7E1172470861DCD250BE10D9BF4 ACRYFORMCOMAUWWW
242,980,109 *17974F128B6E6A6DD7AA8443BA6823199DFFCD51 AD`29
242,980,110 *179A31D9472B8C933E19F7EC786D0523A5297890 ad(2m
242,980,111 *179D14B88F3A8F5883F783488141F3AD1DE936F3 Adi(
242,980,112 *179392EBB7810E81E98FEEB4459A32E14049D59A ADOLFODIXONS
242,980,113 *179960E1409E409599C8BCAF2DF05FBF3DB5E084 a.donde.voy
242,980,114 *17959FDA0D2CF319AA3600A40D046C597F133175 ae.0n
242,980,115 *1791DD0EDA77C43C45EDEB284B008246D2A7FC3D AE,K;
242,980,116 *179696355579BD673DE60B359F940FF4EC464504 aizul
242,980,117 *179B0ADE407C9FCDB522E806310B505AE196F677 AJUDEMOS4
242,980,118 *179A350E163A72B0FC6E2B28B2B40127AE0FB12D [email protected]
242,980,119 *1798026DFA597963C70CA56AB55D035F61299E60 a/lcg
242,980,120 *1791F1EC30C851EA550A31A834670E3BCD868151 ALFONZOBENEDICK
242,980,121 *179DD957CD436E780CB38485024E8019C3E3BBE8 ALLELLAT3
242,980,122 *179509714D5B15730CEEDD07CA0C39DF66C7BFB8 ALOYSIUSJONES
242,980,123 *179AD0C05BCFD54ACCFA088E14EC557FB68E81E5 ALUMINIUM FOIL
242,980,124 *17957F8E66FBA1624A9A9410DE26D2A2F3D06C91 ALVAROTALVY
242,980,125 *1796348073C5BB50DBF7F6F8BD847B4344E8D677 amarendran
242,980,126 *17964F96FD846AA30597BAB422FDDE7C59BDCCC5 AMLINOLI
242,980,127 *179343A0562DE6E946BACFDFF60C931DD9D08CC6 AMOWLDS
242,980,128 *179861BE2B4A694315986E45B569F0F5B0ABDD73 AMYPOLICED
242,980,129 *179617019FCAF21321992FEB23557C7711073443 and-examined.<br>
242,980,130 *1794EF05C74B9868226F8B89B7A94886BA3940FA andreahollerud
242,980,131 *1794C95139C48971895B0E15ECB397D58AD34E4F andredyment
242,980,132 *17975007162236F31120B1D3DF7B64B69B637857 andrewrunyan
242,980,133 *1791D3C4BB6D24A45CC1FF0700CB02AFA28C68A5 ANTHONYHADSALL
242,980,134 *1791EE50A8FCAE25FCED08E17B670B9A888BC0B3 antoin.williams
242,980,135 *179AAB97CB3E44E844D74AE48A539469F37C8CFF a-okl
242,980,136 *179056049CE5270C5AAA404826FC5CE2ECC0548D A)OR
242,980,137 *1798B523147A4181AD2CB08E768578CF3C615077 arambring
242,980,138 *179635B479155BBF24BE8187C95E9001DA08A4DC argumentationsbreite
242,980,139 *17925CB2BE52E2D488C0308204ECF5ACF140321A ARLIE.ROSKOPF
242,980,140 *179762F88F8EB9E68ED8BC14F44E6F915D77458D artmonahan
242,980,141 *17948F57BC9308FC045E0BAA757366A446F28222 aru"
242,980,142 *179BAF0D59BDD1AA682971FAD07872CE70DFE266 ASMUSSEN6
242,980,143 *179BCC2B28B8DE153C84D814571B1708DAA6DF3E A"T1K
242,980,144 *179AE0AE88E232DD854ADA7C0C583FF2E3E68EFA AT MY SIDE
242,980,145 *1799E6D3FCE2937019C396FA013A2362EFF9231D atnuigsi5
242,980,146 *1791A188DFC2242538F48825E37D14CB74B2E66C ATTUARIES
242,980,147 *179681DAF347042A46B8E846C98B896C0B5BA7A7 a%!u&
242,980,148 *179849E9D1B0066A4F3CA91CAF7A71213BDA93F4 au=aw
242,980,149 *179F06CF5652029609C92F8D1114C920D7E23AE3 AUGUSTINEBASTILLE
242,980,150 *17924B9AFA98D0C0A52BE8DCBF37C8D7E5E5B05A AUGUSTINEGARD
242,980,151 *179F0EC6382E7269F45E0119CF53136EDE17DA0F A(U_J
242,980,152 *17904D6CF0CBD5DA85ED3B5AE7CA346094B871C8 AUSKENNEN5
242,980,153 *179E3B9D3983413FEBB5D58D296CDEDC97099128 AVANTGUARDIANS
242,980,154 *17924070707FBB06AE7EA4A257ED541C225CD960 aw&%k
242,980,155 *179EF9ABA330B595EAD5E970C29D9F3EDC88D763 aw;ss
242,980,156 *1794C556EECBC8D0325D8DD242B1235D86DA3720 AYFA-
242,980,157 *179C86E0FEC93B4D7C0E06ABC53B9B4C879FC785 AZRE
242,980,158 *1794680CDAFE507B79B55822404B1E3AA22B97C7 b(0p
242,980,159 *179385250387B803671EFA2CE4AFA09D8B046A27 B5N=Y
242,980,160 *17924DEEB9351E7D2EB97FB2CA0E3977C7041DFF bang-in
242,980,161 *179B6363D60D3B04AEF0804BC6CFC1848CF371CF BARBARA-AUDSLEY
242,980,162 *179D59F7597335762BE27540F55EAF4AA14E1062 BARBARA.AUDSLEY
242,980,163 *1795977A0EA87B4E4336B42CFA6039BF1EAC668A BATHWARD
242,980,164 *1798F53BC119446BD4200C84C4A092FE22F96649 B==B***UU
242,980,165 *1790D45FCE36A6D21FEE6C87AF49E71FC88B6CE1 BcQ
242,980,166 *179A89B7AF094C371906A05832807B21D4EE67AE b!d(2
242,980,167 *1792322F483CD5D90A653A89FA3227132907CE43 bd_tm
242,980,168 *1794654B8D22145B7BA9915BB768692D5903B169 BEAUDELLON
242,980,169 *1790A0C4B120579D3B484D2F485EECDA06597592 BENDERA (NEW VERSION)
242,980,170 *17968679FF3761DB05ACFC83687F390DD8977ABF benedicthorgan
242,980,171 *179F776B890B27FAA71115E98753BB351DC26CC6 bennettgassett
242,980,172 *179065273E756823B20D6036797425551D968A2C BERRYHINCKLE
242,980,173 *179B549B7622B539642E0E1FD5B02E51B0E1A36C BERTRAM.MELOTT
242,980,174 *1793219E474404875E03FEBDA8502C21711B07D2 bfkeh
242,980,175 *179FE9623CFE7C362AF479BDE9A85052D4A4D784 BH0G%
242,980,176 *1792FA2243945F37DE09FFD3D590A469F69AC7E6 bhb#
242,980,177 *17995F28206D1868F7104ADE70DA96D3760C9E63 BILSHAM
242,980,178 *179D1D1BFACFCA38334E57397BB147008F5FBEF9 BLD:L
242,980,179 *179A73A6ED885CCEA5D92E7317A63A75E3CD76F3 B%MZF
242,980,180 *1792B5FE00AD9B7BE3B2133CFFB49DDEECDD3376 BOB.COGGIN
242,980,181 *1799733EA34DD01864CB4E5952499F4CB0F5A184 bol.+
242,980,182 *1796FDBD84173DCC2FB97D458C24A2DDD162CC87 BONNETABLIENNES
242,980,183 *1796175B06B468362515670B6420DC3A85C1D7FB bookerluechtefeld
242,980,184 *17974B1DD9EDA44B9092A1A5CDAA5C55B941E611 BOOTLG:CHICKEN
242,980,185 *179AB100EC0C5AB68D8960B8A5F9ABA55B08DCFC boprcnet7
242,980,186 *17955CB1190B2381749E267A1C1A5B621BCCD0A5 BORIS.PEYER
242,980,187 *179A50F6C6529DE539153EF06DD06C025A5445E5 BORNINFRONTOFATRAIN
242,980,188 *179C7CE7EB75A8ED072176387E3EAD968DBC7591 boubandj1
242,980,189 *179515AF824C9FB5BD0C6AA56D212E6B1EC90651 BQLZB
242,980,190 *179FE28F6EDBCCC343151DEF9AFC257A765E969E brantfairclough
242,980,191 *179FF5023A5DA08B12E3AC8A2585DC1F8D64F121 BRYANT.ECONOMOU
242,980,192 *1793D7058C6B8F4561FDF06A3DA3812DC4862610 bryonmartenson
242,980,193 *179289EC084F9E7F90167C531F5865A09FEA7D85 b/s(g
242,980,194 *1795D7166D01D6A8CD0C82E369062FC82BD776BF BTEMF
242,980,195 *1790690CDF8B9DC9D667BCA412D5C6A23469C0CE BTIMECAL5
242,980,196 *1795DF31F17AD611B9D186697BCFF77BF0E73556 B(TW+
242,980,197 *179D61A4F2F631FC4C7CF8C7926E2B65570EFC8A BUSTER.LINGELBACH
242,980,198 *1796E3A61FCD5CC1C375AE73FEA56D1FE4CA2F0D BV3r
242,980,199 *1791FEE65C3FA9BE90CDD44CE3ADCF676DCE9B31 b#vs,
242,980,200 *17919FF68BF0D93F5111A0C6DE2294CCF8748ECB BX;JC
242,980,201 *17997CBFB16959250AE1C8F8EE3F39449115EB43 BZNFV
242,980,202 *1793B249CE64F49C21C77D622113D5F7E106AE1C C1L1(
242,980,203 *1796C0A1654BC8ABDA49E55C92F6B58AE3EE1493 CAPTIONDELETING
242,980,204 *17902ED7ED31C919900BCCB4A3B8B32161DE88BA careygreenhalgh
242,980,205 *17961637143C9E68D40F4576811A2C265DFB2D77 CARLVANSCOIT
242,980,206 *179683EBCE62BD6C564371005F322FAF06B8CB83 CAROL AUTRY
242,980,207 *179A6AA53137654FBBE9DA496586CE279E74022C CASEY.EBERLING
242,980,208 *17974A1E6F91D00BFD2DCEDBE90238A17D2EB359 caseyhines
242,980,209 *1799379BB13317D2DD34CEF591DA9F94CBA4C0F6 cbc(m
242,980,210 *1790CDA058B2917DEE8A80949B6F39BF16205252 CD?T&
242,980,211 *1791B63D8D0881618E554D24EEF66F44176C585D CERRABO
242,980,212 *17990A059A207A4EA9E2F77991D2E0DCC5C29225 CE:TW
242,980,213 *1795A93FF9845CF4A9DBC2EEA91689149EF85D64 c.f1u
242,980,214 *17970E5C69D930C82ED54BE5405D8B2AA503E060 CG8H+
242,980,215 *1797917B4AC4F13503B0D9FE29300D42BE298465 [email protected]
242,980,216 *17962E20A0A12CD995FF56ECB2819A50BA0D56C8 CHELF
242,980,217 *1791864AB9B1187311C2AB6DB041FE8272B205B9 chesterchern
242,980,218 *179F53A399EE61438196A5D84AD55ED8204D49E2 chetbuschur
242,980,219 *17959FAF70144124DFEC1102027E0F74EFBBD21B CHICAGOWEDDINGDJ.ORG
242,980,220 *17999649895E8F561C45CAF002A050FB3F988F7B CHIGDOLNET1234
242,980,221 *1791BD282D3092DD841B3F4C3840197910447CC0 CHIYAMAMOTO
242,980,222 *17989B22C60BBB288EE8043784EEAB0DC349472F CHONGREEVERS
242,980,223 *1794A0F9DFDA104460E0689B54C8D0D5038A2097 CHOONHENG
242,980,224 *17987A4AECD1B6DC5FB28A81FD579A637569A0C1 CHRIS-BEATRICE
242,980,225 *179F0E7E1C6586E75E8D3718B7E8A6B59AF33EF8 CHRISTIANPENANEGRA
242,980,226 *179A4B9827A2C8F484526EF45BDFFE5D9E1C41FD CHRISTINA ROCHA
242,980,227 *179D41BA45ACFB38E8EBB9071F225D5917176920 chtv0
242,980,228 *179E9D8D5FCC7D5A16D99F9241DAE509E4551A62 CHUNG.GUTTING
242,980,229 *179EA2E89BB9FF4327F0FCAC3491837F882D3458 c:i-?
242,980,230 *1796B898B649864765C86680C2B73DEBB182BCF5 cleopassaretti
242,980,231 *1792B5754275FFA26BFF8FAEF441E48E2166415E cliftonhartlein
242,980,232 *179992D1BCF9E501D3EC572154093F3858E48BA4 C)mF
242,980,233 *179C11F6DBE081E683D41139E95AB9D77AF41734 COLUMBUSTOLAND
242,980,234 *179BB70DCCBD995EA2474E2AA69B2F67DFF939C0 COMBATE.DE.PICHEUTA
242,980,235 *179802193E1DAFA65D19E934E3916A8E68CDD873 complimenteerden.
242,980,236 *179EFBF7595DF418681F5468BE08849F267DFE9B [email protected]
242,980,237 *179841260C36D99C7451D565F56EC074450B18B5 COPULAE3
242,980,238 *179E55473A2BA83C7897A047A93DFA44D08B0AC6 C:\PROGRAM-FILES\MICROSOFT-VISUAL-STUDIO-9.0\VC\CE\LIB\ARMV4I
242,980,239 *179BD60FCEB672DAF24F039479DFA0E049C7127B CRA
242,980,240 *179635456005C4AD4AF381D7CF7693A5F8A8168A [email protected][email protected][email protected]
242,980,241 *179C9C54B934BA147AC102565AD2BB03D2C8A7DA cub&
242,980,242 *17915CB72F5C428253D9258DE5FC2F5424431318 cusp-l0cu
242,980,243 *179EAA6FB308CA93CD295D00BE484509F8D17B4E CYC14ZOC1N3
242,980,244 *1796AC5A391847232C90E4C69C5D270135288F1B D(06D
242,980,245 *179AEA3E5C4837CB705844CAAAF24D0C4789B636 D3LPHBLU
242,980,246 *1798BE0B4CE47896E2E0CD33E0686BBC0050E0A3 d4hwx
242,980,247 *179CF5CE1A0755909DC8F5674D660FC6EF6DA646 d5b816683dcc300dbc94cd6d2fc370ea
242,980,248 *179B1BB80E6B346C6FA00BC23C05F66FB005533B D$6c
242,980,249 *179DA604D7DAFB643307CF237C3BEB0EA9ABE992 DAFNIER8
242,980,250 *1792D81E38EEB49AE14B301D6302F7AA7E9FDA16 dag08a$
242,980,251 *1790582436FD9379F9E493292B3CE5B856345228 DĀNĪĀL
242,980,252 *179644B8CDF6CCB523A5661626B8868C02D46455 DANIELTECUANHUEY
242,980,253 *17982979E3FB4EEDDDB2089EE34F2D0850240B44 dannyandrian
242,980,254 *179CBB8B404D7651E028ED5DA315CF47AB517E68 DAVIDSNED
242,980,255 *179750C9D056D39257057C6E1883C0042AE07BDD dbe5i
242,980,256 *17922F96ACC8693FE39DA12A5755B64C9B57CED3 d;bf
242,980,257 *179EDC7CA90B5A4A5512ED587C0DB12512208CB4 dcv8)
242,980,258 *17924EB98829455CC21160AE819ABF394847EAEA DCVO+
242,980,259 *179138E20D13C53021A84693A883B3E5ABC7DA8E D$D1D
242,980,260 *179449E3F7E0DBDEC5E00D61057346A024FBD502 deanna575
242,980,261 *17937482F02EFD43E17D3B2A78AF9A124BE5B9FB DEPVC
242,980,262 *17935CFCAE7407DFCE0F164A914E78401CC45561 dfiml
242,980,263 *179D04FB588DC18E5D5D10BB10C2418963F32B34 DGE#
242,980,264 *1798EB4074892D3F40DB87BB639526EC6C0D84F8 DHL0913:BRENT
242,980,265 *1793A54B1505FD668B857B6BBC0B460617ECF975 DHWVB
242,980,266 *179A25E1CE0E37920B8FD13C43386FFB33C5A19C diggin' in the crates: rare studio masters (1993-1997) (disc 1)
242,980,267 *1793155176D26A4ADA0F98C0B2A0CEEF4F903D3E dirty.squinteyed.cowpoke
242,980,268 *17925DFFFAED9F2C30EB7F495B659BFF27D55355 DISINVOLTA.
242,980,269 *179EB04E78E2DAB123E09CF9D3330DAD91C5846C DIVERTIMENTO,OP.86:IV.LESFAUVETTESPLAINTIVES
242,980,270 *1791973BE392A550B6C5CE19679F8E78995DFAFC djh40
242,980,271 *179EAE130EDA91D522F58214B707A393F193A337 dj%#q
242,980,272 *179A4EEF243E5D312D395B8987512B6176B852BE DKP.P
242,980,273 *1793644C63FE2D6323B04309E28242CECE95108F dksik
242,980,274 *1799C942F2441C8144175168CC0711F0A7F1A841 D!MND
242,980,275 *179107AA7D2C7473A02426B4FFEAE832589BD83A DNEŠNMU
242,980,276 *179F86572DD515FD5720DD891AFA265A24FEE68B d==nf
242,980,277 *179A67B59EDDCE3D8739CCE726FEAE3F4BA9EC1E DN"KE
242,980,278 *179837CA770B4B66035E4938FDDA03D2EBBD96AB DOGNAOMI
242,980,279 *17946386A28E0030E56FFCA830657B7122F15C23 [email protected]
242,980,280 *179D5B82D65BF534F0D8A9812474828C776800D5 donvauters
242,980,281 *179247FB7B8F1A7F1BF1D45255B7C75A8C8AF1CD [email protected]
242,980,282 *179E1B3EC52F35198D293FF30BA7B87DEB00019C DO.WOOD345
242,980,283 *1795A727A7E7EF9585ED743E189D9AD01D6BE480 doyledzama
242,980,284 *179EACA42D06A859A9C6FCE6A37A1449B7A14D3F d,p
242,980,285 *179389777E484170CB562F168DE0060900E45B58 DQGM#
242,980,286 *1790A1AD4A0B971E0B95A7CD195434173A37D925 DR7OF
242,980,287 *17917716439A9E343F14493CCB6E7F887192126B DUANECHRISCOE
242,980,288 *1796FC0332967A212CC66960EA55BF3E769B652E d:uc8
242,980,289 *1790F7FADF5D1B21E6747508BE4DA86B28337316 DUG_K
242,980,290 *1795C64ACB19B8A95F768888E0F06BC25C44A5FB dvcl#
242,980,291 *17903B757F0E8D2803E2B3CE8A0DE4672DBA4B37 dwightwaner
242,980,292 *1797C3BEE9FD037CF226615D26338AD4053196CE d"&xt
242,980,293 *17939097C5D2858DF697D62CB9E11D5F3C409E56 d?ymw
242,980,294 *179A6EFF46E764FA65B4CB45C446E54CAC1C201D DYUKD
242,980,295 *1791BEB33D332BD619ADEA639A900B8D67C5112C E26702
242,980,296 *179029D8A45A5B25E426652B7E6B4560EE4E160F EAgi
242,980,297 *179E65C51F381E1D61BF4BF187EF624AB42CDA0D ed7xi
242,980,298 *179DE577D46A34F9C404769F0CE1A72FFB4B67E4 EDAOT
242,980,299 *179DDC0B828F283269DC87F0113CADF120D98023 eim8/
242,980,300 *1797A551050429E350270522BD7491AED6731D56 EINSETTE7
242,980,301 *179635F81C580F2237E4C82463B959EFEE438BED „EINSPRINGEN“
242,980,302 *179810AF7947004DF85CAE801C0C2AFDECCBB47A ELBERT.BEVIS
242,980,303 *179B9F77932AA300217E8F971FEC922C63B9BCF1 ELDERLY—DIED
242,980,304 *179B0A965F7192D2D1DF660546255C502AA09568 EL-EMIR-FAICAL
242,980,305 *179D7C396EC007ACF676D1BF493969B8677FBC9A ELISEUVISCONTI
242,980,306 *1792E60043B51494DC0AB9E39C6117881A7DF2D9 elmerstoutamyer
242,980,307 *179840B088EF322C9008EF5FFCA58EC12CEAD7B6 elroyluchessa
242,980,308 *179C36B8FDD0B87F3F7715A1F730E0618B921BD2 ELVISPAREDEZ
242,980,309 *179EB39C5D2FF4DEAD599ADDB42892708941288A EMBASTA3
242,980,310 *1797BAB95C6C547EBFB3AB5127E58B598AACD3CC embotamiento
242,980,311 *179A592CB1630C0799174AC884EA00EE79FA9C48 EMILE.KREIDER
242,980,312 *179C45ED909E50B19797CF1B1B24DD71DDC321FE emptiern8
242,980,313 *17933929274C02E5E73CC6BCA7E1CBC6E80E2A8A enfl4des
242,980,314 *179D0D1E4CFE8D65B32492D311B32ACF76B3ED5F EN KORT EN LANG
242,980,315 *1796D5C420057CCCEDB41E78C5E38A406990E4B6 enochsemke
242,980,316 *17911993E1DF4D1C7CB28F8CA4E4E19F412BD020 ENTEROINTESTINAL5
242,980,317 *1796C96B58B68C369AA68C450E12B598FD99057E EPONIMOSA
242,980,318 *1798E07B19010AC6AED4238611D526C1C95B9859 ERAICOFS2
242,980,319 *179857C543E85EC5FBDFBF9D7D7644A8800D8DD4 ERAM$
242,980,320 *1792E24894FF22A69B09316EA7A90206124F74DC eshkevari
242,980,321 *179A970E49D642AE71EE04A78119C5466C5BD05D [email protected]
242,980,322 *179EE04685E6CC2B85581C2AD563872AC68257C6 EXLCUDE123
242,980,323 *179B378BB37AF6C186DDB4E3964F34EB70101952 exswzaq1
242,980,324 *1799607A264F656731D9002000F8BC611F497019 FAUTQU'ONSORTEDEL
242,980,325 *1798D044A627CFE1322ECEE8AA82C4900BB0AC44 felixhardaman
242,980,326 *1798B11A75444E14CA2C645A8538CD500FCB6ACF FERONOOMS
242,980,327 *1799BB59DE4065EDECC976E5DBD42DD8F90E8176 fescstn2
242,980,328 *179E05FE8A925416F7EA706E92D3509E320DDB4F FICHEJOUEUR18668
242,980,329 *1795EFDDB95F8AA2518D86D56DFE98BA81D8C44F FINANZCOLLEGIUMS
242,980,330 *179DB0942CBAD958538868FB1F33AEE291906DED [email protected]
242,980,331 *1799007CFDA01243AD8F1E34B563DDEEE2F6A1CE FIRMERSESES
242,980,332 *179284294FEE9EF7CCE8FD40290FF39B12CF494E [email protected]
242,980,333 *17980D2EBFB9357009DFCD123C61ED1CEA847879 FLECHTBLATT
242,980,334 *179378E7D24AC7CD92DBAA1539211AA80D9CBD87 FLOCKE71734
242,980,335 *1791FB9B22A6D5C2CD4FB4104BEEC7C383B3A57B fondassero0
242,980,336 *179A71F0584FA7FCC3A5B2E57D8B10550B595CE5 FOR3VI$ION
242,980,337 *1793D06A4D2EB438D800B23EF224EC94541839C0 forbeingyou(version)
242,980,338 *17992CA047CFFDA6AFAEE6915CC89B170AD37CA9 FRANCISCOOLKOWSKI
242,980,339 *179939CB8501DD4A2CBE1BDBB639434EBDE2B059 [email protected]
242,980,340 *179E0CA7E32CBB7493CD3C8750AB5E1339C35230 FREDERICAGUILER
242,980,341 *1790BB53876F2A5E9A465AC581D3E1A5F60C7482 freemanpennypacker
242,980,342 *179E3BE38A81C500D353C1BBCF68E7D328F21EB0 FREEMAN.SHELLENBARGER
242,980,343 *179DCB0DF23E4341C7F7BAB9280BCCF1699A238D FRITZ.SNARE
242,980,344 *179EAC4E5712AAF3C3AF417108394659937DADBF FSMISMUS
242,980,345 *17917EFD8415562C807AB84D1DE883DE3481C95D FUCKALLRAICES
242,980,346 *179CE0FE3E63B2B084A4F48DC50FFD702B6B1754 [email protected]
242,980,347 *17993771ACDE3229507431A022A5057748FA7A7C GARGUILESING
242,980,348 *179BFC9DB0009F907EF025C95CF925692CDF3394 GAYLE.COMBES
242,980,349 *179B9BBB360D9C2601325F753C8EC724E4107592 GCRISP123
242,980,350 *17945EFF5F6D4DCF67D5F78C19875A5372532D54 GEHULDES2
242,980,351 *1795A8A8C1A90AEC7B2E3E564C2554B54E204FC7 GEKOMPRING
242,980,352 *17914F16602FE783D3876C072E4C33E8FB933AF2 genaromarchel
242,980,353 *1795C35A55DA7B5FC75B36A89B770DC51BEB5A30 GENAROSTOFFELS
242,980,354 *179547DEB38D56D9F4E313A17059CD24CEE5D1AD GENESIS GUAJARDO
242,980,355 *179F6E53747257189E1DC407FEBC12F6FEF51681 GENETIC-ALGORYTHMS-IN-SEARCH
242,980,356 *1793D730AC2D4398DDF2B0B9ED332BC4C99CBFE5 gerector4
242,980,357 *179602F71FDC5B72C6168A8455B6438B93A2D86D geschouderden
242,980,358 *179D38E1F6DD1809CD6D8EE353A8C15A581F55A1 GLAPISSANTS
242,980,359 *1794DBDAA557963E3BC9DBFC6CCFBED8141E8662 [email protected]
242,980,360 *179E8691A5A6D1879FFF2F35151AE365B223171D GONEHELEN3
242,980,361 *1793D23C3DC1C0A30C447A342DC80619E32F4FF2 GPREIMER
242,980,362 *1798C120A6E6FF9868D957836309B9CF4592A1DA GRADYDESOLIER
242,980,363 *179682736DC08DE31391D8D242C245A7DA8C3434 GRADY.HEIMARK
242,980,364 *1798C90EA2CD501D3D93131CDF235FAE65B2E151 grasp-the-subject,-the-words-will-follow
242,980,365 *179FA81AA566305B4766C5BA064183F1FEE30968 guadalupeblunt
242,980,366 *179CC37F4E6AF3F49F7A9CD98B26267F0BDEFE6F GUYBELLEAU
242,980,367 *1799035229FDCB69B6A27D69ADA4793480BC3F4F <H3><ANAME="FILEPERMISSIONFUNCTIONS">
242,980,368 *17936FEC416C3737BAF2E961B8D05A14C117AFC7 [email protected]
242,980,369 *179515D5516448ABE1DE187C03D9BB8DD3A5CC13 HALJONGELING
242,980,370 *1794E9063DC6AE01C514EC7B0074EF5C153EFEAB hankaslin
242,980,371 *1795C639DDA9B18F4851745B711F96CA75AC79FF HANS.MEFFORD
242,980,372 *1796AD581FAB58078A0CA00B2766D74D467CA21B happy.galvan
242,980,373 *179362DA74534C335DB057F435F523568AEF4B9D HARLAND.GRAVELINE
242,980,374 *179A57D60897128A2EE3D7C095609F7886BC358E HAUENDORF
242,980,375 *1791FCEB15FD635774D3FACBE9F04B64D1295A76 [email protected]
242,980,376 *179D7AB2D06A4AC05F5C2E131E93ADE8830663C9 hforl
242,980,377 *1796057F1FB6FEF8C5FEBF0DDBE168FDDF9EEF03 hipolitosoftleigh
242,980,378 *1790D2B4A2E61B9514B54FFD662DA7D7917E73D2 hochzufrieden5
242,980,379 *17994F6EB3D3C63052600701629C419404661BD5 HONGCLAVIJO
242,980,380 *1791DCA4CC68102787354990CB803B9BC255C7FE [email protected]
242,980,381 *1791E3D7C9206FF61B76310FA29AF616B750882F HREF="/SIE=UTF8&KEYWORDS=HOUSE&RH=I%3ASOFTWARE%2CK%3AHOUSE
242,980,382 *179E868A18E9E739606774D07DBEEB9130D6ED52 h.r.runciman&co.ltd.|canada
242,980,383 *179EDB58DCB5D34ED446B54D7E419D658B370AF0 HRXWIC8A
242,980,384 *179F631D396A873226122004DEF68BC1B92A1160 HTLHD
242,980,385 *179B251EBC319603388691CABF32D7C811D6CD84 hughjules
242,980,386 *1798711BF1E4D8A1E6532E23F5CFED4CD18805B7 HYUNGU
242,980,387 *1796CF102E339A0B7B1C23C0D20AC9E7CB974016 IAMSCUBA106
242,980,388 *1793C312D824DD45A930292F7FBFAFB83BF0AF67 IAN.GIFFIN
242,980,389 *17988FA93FA0B17E8B710D106FB64FA4C8DBCE3F [email protected]
242,980,390 *179C922F1FA29384A592F52D56FDE83C2F9CB214 IDTRAVEL9
242,980,391 *179B4B906E0862F4FF60A3034404F91AA4B5771C if.you.can't.do.it,.that's.all.right
242,980,392 *1793B060A35B22F5798CB8BC49A4D77AF040922F ikezirk
242,980,393 *1798BF260B9BD571F397AADB48B3A463D07F9B2B ilovemadison77
242,980,394 *179C345D2153BC91C3744E2CDCCDC84C2A4BF148 iluvoreo48
242,980,395 *179403AB3BD26E8DACB14C725FF87C0580189E3D IMPORTUNATENESS8
242,980,396 *17948E7CB69C37D9266BFCB7E6AEF8C7238B2D8D (in-theory)
242,980,397 *17997B607BD2C37FE867AC571656D754CBB0DB8F IQUEFAVI3
242,980,398 *17978888158F741CB6E57F091A286B1A4DC37629 IRAKLIED
242,980,399 *1795386B73541E6DE4B90D75C9191A1D9A79A654 IRKOIKSI8
242,980,400 *17981D305C4215E95792A81CE226875E396935DB ISBN077481411X
242,980,401 *17972EB2F2AFEEBC85F9235B398B77EC53DB1C47 ITSAINTCHRISTOENJ
242,980,402 *1795C8631411E6FD1A58FC61E1AE6B335BB22C72 itsesina
242,980,403 *17998CE0F47281E3D8FDF2DD09D818E304C346AE jacinta
242,980,404 *179D39E363EAD5125340A3439E58901643FAB11C JACOBDEDICKE
242,980,405 *179E2C542D476D95ADEBB8FF521986D1A1AA7A2B j'ai-pas-l'temps
242,980,406 *1795B662532F526CA9CE066A46F630B998ABF04E JAMESIEPKER
242,980,407 *179CEB778FF3776CEE8246BCE57B8E7BD4CF7B14 JAMIYA174
242,980,408 *17948BC8BFA8286BC47946F6CFAB01358EDD2B30 [email protected]
242,980,409 *179BAFA84C12AA31B5DACAB73CBD4B44B90E9394 JBORGONO
242,980,410 *17971F24B46CA756A9C7E12F18B26EC750C170AB JEANFUN0
242,980,411 *1795290969888E8E16814C4EADFDAF85D56E8350 JEG.TISSER.DIT.NAVN.I.SNEEN
242,980,412 *179EAFF8B327AAFAE437295ADE8706D0B7A24126 JELLEPEPERZAK
242,980,413 *1793C902D2C5FEEA00FDCB15D4D5E5E72B9FB308 JENNIFER.MAGALLANES
242,980,414 *1794E03556CBE40F4887B738D12089C841F13D51 JEREMYJUEDES
242,980,415 *1792CE372A34C35E5663809448173A66C28AACB7 JERRELL.BURNARD
242,980,416 *179055920760B4B22C3FF66314AD6265C62B9B3E [email protected]
242,980,417 *17984B73073F808BE782BD4E48A24BC58781C5CA [email protected]
242,980,418 *179A625E4E45DF226B631B4B77FA80F11262336A JOE LEE
242,980,419 *179AE992BE28521C8EABBFAB6B57E40AA546A55F joe’o
242,980,420 *179DA658363EAFD869C2FDA5DF019239FCE2DB4C JOEYSTRICKLAND
242,980,421 *179F735E5700579E2F7BC043FFD9DD32ADCB599E JOHNNIE.SETTERLAND
242,980,422 *179F34048A4D49179A6FB445440A58457368F9DF jonknott
242,980,423 *1798DCF0B737127ACC6F99402C439E4433ADA69F JOSEFGENDREAU
242,980,424 *1795CF19F4D9084FF1218D5867E6D0AB7583DA98 jövevényszó
242,980,425 *1795D6FF126DBD673045392A9EBAA2210CFF88E5 [email protected]
242,980,426 *1799C6F1FCCD2499924B593E614B8F3782AD18EC JRTSIFI2JCEKGPJ
242,980,427 *179573CAD77B0AFDC5F0706A09098B638D78C2BB JUNIOR.ERRETT
242,980,428 *179377F7B0C500864557E1618E5B3272516A07CD justificatie
242,980,429 *179DECEB6ED4AC7796200CD9BF64C18BF9542199 kelly.stoops
242,980,430 *179005C37F33E80767FEAF82D7266A7689600CF9 KERMIT.PEPITO
242,980,431 *1797D4959D8E802EFF305A292FE64E595F8BCC4F [email protected]
242,980,432 *179575B269950BBCA2D87B4BAA2DAE1B40AA5601 KGNREUTL
242,980,433 *1798E0DF21E9411ABDCC6484471BB4AC5F29D88D KIRBYCORREALE
242,980,434 *179D8D2746B878A9A32188BC4EC69B0B7C8A7761 korys
242,980,435 *179E05DE3E10EB14C3872433ACB8AF80D8A7A613 [email protected]
242,980,436 *1791E6EE61C54A0486C886F5D66CA502C1D6DBB5 KRAIGFRALIX
242,980,437 *17914EB79986C700BD1CC4A83EFD584AF8CC9C88 kukanbun5
242,980,438 *179D7BF7F7B3504846EC8A9123B2B326BC8BF87F kyleavinger
242,980,439 *1796F579ACF91FEDC2E903754AE98FB783D93DA5 [email protected]
242,980,440 *1798AB7755DECF76EB256734DE01EF58DA5FB1D8 LA-GUITARE-ENCHANT
242,980,441 *179629B23717170CC120F29E04A271590111B520 lakerscrapp
242,980,442 *179DB75FE924BE7D0EB9088B3B0E3828AF4F3E41 LASKUKAUSI
242,980,443 *179BEE43F1463F6B228816BDEB67CF420281BA12 LAWRENCEMAIDEN
242,980,444 *179D38B86DD1B6B360B3056C37F76A2C415F4B9E [email protected]
242,980,445 *1797CB9F696CE5D9F242CCB7D61CE828A1738694 LEHMKHUL
242,980,446 *17979DB4F1F626461270966E537AD1B54DB4ADC0 LEONARDODELARME
242,980,447 *179B259FFA8B66549440A9F015AAF6AC7A072AEA LEOPOLDO.LABOG
242,980,448 *179EB657BBFC268D35551F2C13E0D6697F5AEB48 LEZHANAVEZET
242,980,449 *179E6B0A2C667425BB64E614CE78F0D62BC347BE LGC4MB
242,980,450 *179BB687BBE40BA553AFE156DA757CEFCB92450D lgvtinning
242,980,451 *1796ACB77103A3210D6D3D322558A80577FA0E13 LIKAN'S
242,980,452 *1792D9A3232DE574E3DEEC63DA03157C51A138F2 linblank
242,980,453 *1791036E0FBB8AD0A338EEB5BF876C628728CEF9 LINKAGES
242,980,454 *179704D56B8E0DA9DBD2BACAD247276615DCC6F9 LLIKME
242,980,455 *1790B4836CDD4D5D4F4EA022077996CCDEE1DB8A LLOYD.LEINGANG
242,980,456 *1794830DEB90D869187105B93DAB5842FDAA5CC9 LMK1004
242,980,457 *17977A65745BE187E2C90213A116A4DBDFF035F1 LORD-BYRON-SWIMS-THE-HELLESPONT
242,980,458 *1799B070D729C2D5A0CC11EFF04B76385318E431 LPHILAYA
242,980,459 *179C968FFBC3F5139D75099D910037F2496A821B lucasclimes
242,980,460 *179C5D8DBBA39DDD14871B34822DBD0773601089 [email protected]
242,980,461 *179B057508268CB42D2EA3CE7A1BD7E598269F50 LUSTER
242,980,462 *1791461B7EE25AA52F323DD4C9B77BEA3F5E3D5B lyle.weir
242,980,463 *1793E89E1E743EF7E5D08C7FE934B0D35009BE6F [email protected]
242,980,464 *179B9F65CADB5EAA48448B2F0C03717AB8675AB7 [email protected]
242,980,465 *1796FBB9C2C3C91C62E0C813B3F3B6018B8995DA macforthed
242,980,466 *179ED459CDC9F755719E35514C649687FF307F97 magan-gilbert
242,980,467 *1799430A160FA47C24EADA7528903CCB9EE30C31 maheen-hameed
242,980,468 *1796666509F157BC0EB1E7A4E52B13DCF2A7014C „MAKLERN“
242,980,469 *179FB73EEB1C6BB456D3BE0CB717CAA192C9D462 MALIKBALE
242,980,470 *17997CD63A3F58CD2742F19E5D61782695ADF41F MAMMELLA7
242,980,471 *17948FEDE6E1D52F92B52D6D5843EBF6EC59BE29 marcofavolise
242,980,472 *17940F232A368EC3B5D0332E3BDE579225138EE1 marcoscrosno
242,980,473 *1796E376E1B46E2B607F94FAD4F7211FE89BCB72 MARGINIM4
242,980,474 *1792F0CDCAE67DE5DF7943A2380093331CE59F6B MARION.LEISING
242,980,475 *179A05B370079504370A788AFCD9D8D3BCF221BC marlinmaohu
242,980,476 *1794DF4472F3435AEC0C5F53DE6F59E93A914CDA matthew.maina
242,980,477 *179738562A33239AB2B351ABABE72EAE554F9AFF MATTWADEMAN
242,980,478 *1795ABFBAC2DFC079FA594E6B6C07BDBA18BC9E7 MECARIO2
242,980,479 *17904E441EE700E7BA0CBC4424B1EEE241F626F1 MEDAMACCHA
242,980,480 *1795FD8BB0A5A0248795E0B3A7E473EA43D03A21 MEEPIKTE
242,980,481 *179588A319C3AEB1948CE98B3A55436D58182F6C MELKYSETH
242,980,482 *1792A776E1AA1BB331B4E34403AEDD6320802D36 MELUEMURA
242,980,483 *17942A3E494CD187C6C88F139FFAAAD1E5C64A64 menomeno9
242,980,484 *17986229FE923A6ECB55C751F59CFCD0A449BD4C michealbaray
242,980,485 *179FF74AD533206FFF0C97CC08A60566D49F2D90 michealduffy
242,980,486 *1792639E84A5759496B61D138D96C98B6C9C2C75 milanlafromboise
242,980,487 *179F56BC2E1D27F290AB1D440702FD648A3C4DE0 MILTON.SETTLES
242,980,488 *179B8E06D9B5893469BBEF42DC078866BE383D83 MINIENIZ4
242,980,489 *17904D58CDE695D6F72309EF092BC3EB343D362E misbruik
242,980,490 *179CB33EC26E789BC3B70FDCDCD7472B9FE901C7 ML0DYY
242,980,491 *1799E054943C2E97C93DBC9AD6F9731B7CDDD75D M>LE
242,980,492 *17933FAF5887E047FFA786BFEBA65FBD3999D762 MNBZXCVBN
242,980,493 *179B83C40D5D9DEDCD01279770BCA46B765964F2 molmajeuropus81a'lesadieux'andanteespressivo
242,980,494 *179A5AB879F24A907915676F91760C8394BD8000 MONIQUEBOARDMAN
242,980,495 *179CABD9AD01F09D9724E0AB44AE4FF846F5C550 Moonstruck:-La-boh
242,980,496 *179DCA9EFE87EAF48593B1455E17F8B976E34F45 mustang1974
242,980,497 *179EC208B4353BAEDCF8C58F9EA6D78275D294EA N445554
242,980,498 *1791B55815188AEE3FC82C22A8C9DDB8E2552989 n55=gotostart
242,980,499 *17985BFC056568D8C598B6EDD9F8C730863C3300 nandy-samer
242,980,500 *179A71EEA53F968931701F65013C1E989A9BBECF NARDELLED
242,980,501 *179247158CFA7DC760D9462695FC7CB79E0AAAC1 NATHAN.GINTER
242,980,502 *1796EF59798667E7B58086A4C7DC91E44C365072 NATRIUMPYROFOSFAT
242,980,503 *1794AB125CCFA0A57C4A7C4784901BD645D595D0 NEAGILY
242,980,504 *17982AC97ABF4A6BB00336AA8370EEBC7707D866 [email protected]
242,980,505 *1790975C68921DF87AFDB05649E5FB1D0DBC6039 NITIMAM
242,980,506 *17992BB04C0BD6EA01616401B3EABA943170E191 NNFNT
242,980,507 *1792EA50AEF94848C452CDFFE359E3BE3707264E NOESTAMOSLOCOS
242,980,508 *1790869BAAF7BCD7F616E3391DAA7AED07C4407D nominaltopn
242,980,509 *1792DD5474168D55E3BCE7646261C071558F98EB NONPROCUED
242,980,510 *179D07F88FCAD775E9C8C1C3C0727424BBC19A51 NORTHERNREFINERIES
242,980,511 *179828E8839F6CE60757E178F66E1B1BC110BE51 npadnky9
242,980,512 *179062916651E007E09A76D841B16A7FB68F0385 OCP|
242,980,513 *179396A97B5D5AA7D7950EB8F030FF4523A77B0B octavioarendsee
242,980,514 *17978FF5E5329456D4B5FA51970FFD95276946D6 oedilosed
242,980,515 *179B09780E147EB9F8953A4B42DAA8A110C20418 One-For-Sir-Price
242,980,516 *179D593C98303CC891B24490103A68CB0392FF62 [email protected]
242,980,517 *17986A5F6C80913CC2476D112577726856004DEB )o([email protected]
242,980,518 *17972F36C471442CC5722DF4E7ECB24EF1364F3D (O_-)[email protected]
242,980,519 *179DB69AC8F40117A4E15F28D8A2F690C8C85E54 OPPERMACHTIGE1
242,980,520 *179AA63E7789719C7B9F036E28CD1F02B43D965E ORLANDOFRENO
242,980,521 *179C47EB95FB7426C971D8BD7C8CB676691CCD2F [email protected]
242,980,522 *179D5C64CB865CA9EACB875770EBDDC66DF06A0F ORVALMAUK
242,980,523 *17906550DCE13027E46CFD48ECB735F2BE0E1792 [email protected]
242,980,524 *179C310FD50507E441A68DE7E460EDBAA67A8FD0 OTTOTENARIO
242,980,525 *17949CE5F88313DA76594351DA92E82874BC5B60 outworths
242,980,526 *17931B78B90110D70BB1E3E5A3A4CA8E5675123C pasgovo94
242,980,527 *179C0C9A1DA2075335832FF2797E9E3A1DC136D1 paulandrich
242,980,528 *1792514AC0FF41AE648F5F2576AF53E9644FC664 PAULDELOUVRIER
242,980,529 *179F15C9034F325EFC6410FC5AAF895EB6B9F60F p###D***(00)
242,980,530 *1799B5975959A2315DD6348C7C08396F0AE3FB38 p------d.`splat!
242,980,531 *1791541646AFE1DECC0086D3ED535218FEF8843E PEE TRAN
242,980,532 *1794BA043054638A9BDBC3F824AA05C88C683BC7 [email protected]
242,980,533 *179DABFEEB87A88D58B42DABA14EC15E1C5F41A4 [email protected]
242,980,534 *179BC4F13E19AA8D2D6DE9CBCC13EA4DE4F913F7 PHUA.HUI.YI
242,980,535 *179553233627A75089FDC55D875C149E61F70539 [email protected]
242,980,536 *179A8DB6594D1BB6503488B7E21D50C71ABD9764 PLANETSAIN'TALIGNED(Z-TRIPREMIX)(FEAT.FREESTYLEFELLOWSHIP)
242,980,537 *17937956E2A71AAFDD8901DCE248CC2A57EA4DFC plus-dur,-meilleur
242,980,538 *179A61A9B14FF1520F3D33DDC9DF247CD761BD5D PLZXWSING
242,980,539 *1793AAFF30BFC9A3509E516FDE41FE45F74CA0BF p{nyq(
242,980,540 *1797B74F59F303C3D5E8EDA3F85127733A16312B POBRATI1
242,980,541 *1797E5C6FE6F7143B17E6CB417AAA1F0751B7ECA POLYOTIDIUM.HUEBNERI
242,980,542 *179C33764796A22F61D895F52DC78D77C9B6AA35 Pom
242,980,543 *179770D949FFB2F2E62C90F9770FA2BE9EAA2E15 PRESTON.FLUELLEN
242,980,544 *179596EEDC59A2F7F16CCF73188CE3CB49CC1E63 PRIEKSMETIEM
242,980,545 *179D23E92776CC6AA6B02F35E2AB6A67208BC8B9 printerkodak
242,980,546 *1797ADA3AD2FFB3B0D54E2378A982A0AFFB1CCE6 PROROYALING
242,980,547 *1799BD06C95601E9C80C94363AA9CE2D664D77BF ptéranthé
242,980,548 *1799BE09755B559574D5F2EA9C6C35C10DBB90B4 [email protected]
242,980,549 *179396F8086313724620DA7282AFBC50D5FEC421 pzlc
242,980,550 *179A33A7BEE892CC9C54B9A516D35C8DBDF0C6BD qq%
242,980,551 *179636D6C4C7541A2D529C2DC85B152C8BDB7716 quijadabsw
242,980,552 *179AB10829FE6DD623E5AB20CDC10F9BD28A6B6A QUINNBEDDOW
242,980,553 *179E85B371FE1CD790C85DD2B4C1CDB7228D2DB4 r3d3mon5tr4tin9
242,980,554 *179434AD530ACC613B48FC9515B634B9C07BAEA7 RACHEL-RICHINGS
242,980,555 *179BB3767DB99EB3E186B139A437D0FCF745E336 [email protected]
242,980,556 *17938BAC8FD6B0C719EBC2DB2610E7160010C837 RAŁAFA
242,980,557 *179DF6AE7895353CE4C1520DB0DCD95B34E5B30B RĀMANYĀYĀLAṂKĀRA
242,980,558 *179EA03EB2A05168DF4995B0A20E92385DD897AE RAMFRIDS
242,980,559 *179947FED41580D2F69C72E88F555E6413F4C1F6 raufarfellsvegur
242,980,560 *17909F24C70036FAEC53C3A579CFDCA94C124149 rbd22107
242,980,561 *17976AB8B8494DCFC2E4501BBEADD76B113A2775 RDSTJRT3
242,980,562 *179734A0080B1B2174BE130EB8B2F555A00991C6 RECHARTERSESED
242,980,563 *1790AA8BC699DF90231EAE3FB2B25F4F60944366 REDNUHTTIBMAG
242,980,564 *179205ADFED67837219FBD4EFF027534712C091D REDUCTIEKAARTJES8
242,980,565 *17909CD30CA6BE7AEDF94F12F0A0E2CF252A338D REFENDAS123
242,980,566 *1792C8CDFF84E516C5277F818DFB1FEE5A0F67F9 regithcuzfjik
242,980,567 *1796B2B2E7C129BB7FB6923707510441B26343B3 RERARUGESA
242,980,568 *1798B9AC8AF4209E18E7164DA55E51A7E40363E9 reubenpashea
242,980,569 *179929BB8C821BCD25539C18EC7CABA4189B5978 reyesremsburg
242,980,570 *17970A734F6B2F367FDBF37DEC180B8A68FDA4A2 RICHRADWANSKI
242,980,571 *179BB7C28EB890383078B88A5062B5805605AE8C rider50
242,980,572 *1796EC00B5857D214BD9440D398F90441F8E0463 rita-spataro
242,980,573 *179E66B44789E6D8790894F93B602EA7C858C63A RO55NAT
242,980,574 *179D8248DC28E289228278079A40AD45CACA2EE4 ROBTDEMARAY
242,980,575 *179B63B5733F74A8EB12AB6CF5206F3C8C4D2C98 rockin'.octoroon
242,980,576 *179E761C69986E62538313CC6B83E0BAA0A7422A rodrigocartez
242,980,577 *1796309D79763EB0B6932FEBA1CEF25080B8E90E ROGELIO.RICCO
242,980,578 *179FC063C90CF48213496C5DC05BEDD9A44DC232 RON.DAMANN
242,980,579 *179A507BF37494E394D5C685BB43C82F14E73FB6 ROOSEVELTTRENCH
242,980,580 *1790BCFF3CA830A350CE81D38CDD5C04CDD4AFBB ROSARIO.BEALLE
242,980,581 *179C7A240FD9E1548B4E4150DA3A880F433B3760 ROXYDEVILLE4
242,980,582 *179F3ABE68D0EDC87DD4947485965069362B5F0C ROYALCOPPAGE
242,980,583 *179F5BC8E4F5D75FF1E5682C324C1A92789CF6CD ROYALPORTRAIT
242,980,584 *17935F29EB97D2EF5925ACFA3EA5A6C5F3070C81 RSPENCERA4
242,980,585 *17981CE32C2AADFBEB56B1772FEB55CB59BA544E RUNDRADIORNA8
242,980,586 *1798720E00706B80557E207599B64CF8CFA4B01D RUSTYSALMONS
242,980,587 *179A8A9B5931C047952ED820917D3BE38010656A RVSCRVLCM
242,980,588 *17906F750EF5AB806538096DCFF01B6338F11EA3 [email protected]
242,980,589 *17903D568B2CC6B3416651AD7D46088F91E3E794 S109321
242,980,590 *179CE1C9B0C26ABFC276EF2DD92D3C9202B65128 S4ltdome
242,980,591 *179695D4FA55D39250685D086304B0DDF1A2D87B SAALOKIN
242,980,592 *17942002A15275D7C43E1141645FB7DAE483F2EE SABORSKIMA7
242,980,593 *179735C639E0181AF807EDD3909D32ACCC06ED13 SADARRIM
242,980,594 *1791FD500620075D5CA45C26F4E7EADE4F9D2324 SADAXIFA
242,980,595 *179DA0872B97D7357493DB759DC2CCB0E16A3979 SALLYBAGUIO
242,980,596 *1793FE160FB3247E4EC99A0F0B008AB2FED4BAF8 sambeek1234
242,980,597 *1794F1CD5BCB2DCB587BF97DBEF6289906E9511E santotonschock
242,980,598 *17947F5D83A801ED8432FC54DC02CE5709F0ADE5 SAPADACA
242,980,599 *179C9D7F4122929D1B97D69187E85A694F05B926 SBIANCANDOSI1
242,980,600 *17945244C4370B81B656B31A3E902DFBE1B84E88 SBORISTECH7
242,980,601 *179FB0D49F39B2541CDF348379AACB10DBCFA602 [email protected]
242,980,602 *179BEB9FD09DFC832C90C12D42E984937BD4EEA3 SCADEVO6
242,980,603 *1792FBDFE61400656F7F921C576BE8BBCE2A479A SCORCHPROOF!
242,980,604 *1794DE10AD19A0C3DEB3347863590E1BD3D37D10 Selma(feat.Fre)
242,980,605 *1791B5A9F38809F5223743E45DDD269EE07ACD8E SHADOW1STANLEY
242,980,606 *179B05E74AB1CB0E5C96168C7A64FB9596CE6415 SHAHRILROSLI
242,980,607 *179AEF8064B72C589AE364CAC23B6B19B6C79191 SHANNON.KAUO
242,980,608 *179A5F86D6B6A8D041AD391866E217B6BF5867BA SHAWNLINDA4
242,980,609 *179DC39321A459F947311CA5E793A19CEB50B699 shecan'tsavehim(feattrishayearwood)
242,980,610 *179F7ED982E92E8FD1228EDE89AC1AF46A04CC8D [email protected]
242,980,611 *179ECF68A0B3F3E236133647F774436F8B79EB35 [email protected]
242,980,612 *179659B27CD4C56C54A8C6BD2810178ACD0AD8C6 siailbups
242,980,613 *1792CF27CFAEE529ADB63FCC169E2AE57B449E83 SJPECIALITEIT
242,980,614 *1794576ECDF82EC05502D4CF90FCCF6113106E16 SKARLAKENROOI123
242,980,615 *1795A2934D5860EEA80B9C4E077190AD964D2C48 [email protected]
242,980,616 *17968317EF17A7703C4339AF29B613619C175AF9 SMAZOUZI
242,980,617 *17904AD280DE26FB80859E77DD8E46AF1E59B96E SNIADUOS2
242,980,618 *17972D6C4AFFECE99A2C2F87C095EEA7438CE368 sny-o-pravde
242,980,619 *179E7081ADCF12ED3078CBDC11375DB5D21A7D45 [email protected]
242,980,620 *1790C91F46820F6DD26681DFED2C664EBB71C7EF SOLOMONCLEMSON
242,980,621 *179A9D262942A89B0F2814D67DAD17D01E20013A solomonwaroway
242,980,622 *1790AA91DD8B1BF2974EDF7624ECCA36431933F5 SO-MANY-ANIMAL-CALLS
242,980,623 *179923F8D0E9DC1D3EC3EA5CA96AAADDC43F613D SOPIVUUS5
242,980,624 *1796CE10091B52257110B9E9EE2F8F83B95E45B9 SOWMYA-PRAKASH
242,980,625 *179639E3AA1D678A3BFA0F7DE54419003094163F spcsvng5
242,980,626 *1799366D51A774D05711CC3A4AD812CB662AB09D splat o~o~<----b
242,980,627 *179E5B2201991E8D4BBDF48E1B7D764B13FFCC66 Splato~(======q
242,980,628 *179C2EC4898510BE0EA55F334FC47D57234E1DA2 SPLOIT~`.~`(-----B
242,980,629 *179946625B4F347124FFE803D7B2CE668AB1D440 [email protected]####p
242,980,630 *179C01C45CF1E34603A0C8D1F22A9FABD4ADD5D3 SSECCUSYRRAH
242,980,631 *17926A1F45744AB6F6D38A2A1A0AE38AD540D910 stagemanages
242,980,632 *179E5730C1AFDDDD054A3CDB042E5BFA5F53C624 STANIWAOKA
242,980,633 *179B869B9520A2FE5AC1515EB54F33EDEB21EB4E STAR-SPANGLED-BANNER-(2004-07-02)
242,980,634 *17968FBA2039A603FE1D2C1BF12B45B42C1C869E stcztns2
242,980,635 *179EF4BCA1A500B4B95F41FB990ECF4CAA948E48 steven.muhic
242,980,636 *1793ACAEC700EBB7D036668FDFC747292EA00294 STEVIE.BOTTGENBACH
242,980,637 *1799525244AC227A0F66651430DCCF2D3A7C1A42 stevieproper
242,980,638 *179F1B61E0B01F953D1298507A6FEDD774E8EBCA STRUKTUR
242,980,639 *1793993F8B9F59CF7F9AC186C0116721CAB13E5A SUNRED
242,980,640 *1790FD8177AD4A2C5CA03B9DAD0419599E791A54 SUPERIO
242,980,641 *179A7E2E3E2F4F0B4C7D68DF333DB9F244883A03 SɜːˈVAɪKL
242,980,642 *1799588769262D531E4E74AB544CC76CAB5DDC46 SYDNEYLEYH
242,980,643 *179FF31A4497B89224A5E2C61678ABFEECAB57A0 TALKANUPMUKHERJEE
242,980,644 *17904706AB8D0F29558B65EDF2688D8A33155498 TALKRADENAFELLAROCK
242,980,645 *1795008DBDC0C96478C936188B16415B73DC4D20 TANKG
242,980,646 *179BE4B221F86D50B584554CE72F7D5192EDC1F5 tanya.raner
242,980,647 *1797283F6EBDA50EDE5C4D7B852E7FD6FA7FB5E7 TARWITTU
242,980,648 *179AF47EC4D83E1BF85B8D0DB49234C38D8BC07E TBR*
242,980,649 *17962B00A8907B6883DDFBB9340C27942F31E994 TDRMTZDRWDRW
242,980,650 *179EDCC0956DF1A721DE512A64EF26DBA1726531 TEDDY.MCROBERTS
242,980,651 *17907E0857D39E4535B34E488336B3BA48C3D7E7 teksshpina
242,980,652 *1791F8DC41EA2E78ADB3A42D90702C7220B4C228 TESTERILLAS2
242,980,653 *1791A1E0AE9219CCBB015B9A09EB767D2C168D5D TEXASOVERTON
242,980,654 *179B723DFE969B15AD8D37E01F14B46B84DC7A75 tgjuvwi2
242,980,655 *179E98F833A891253720C814BF4748CD99EE7436 thapa.santosh
242,980,656 *179CF961C2218D5467DBBB18D0A761A53FDD8F00 THATDCMACNUT
242,980,657 *17947C279BDFBAA02A26D03DFD6E7846C0CBC509 thatskydive92
242,980,658 *1792BDA3AB43657857ABBE259C64CAB3A5F898E1 THEDISCO00
242,980,659 *1792AAD8EE1233528254779AF72867494B273224 THE-KNOCKHEADZ
242,980,660 *179847B2A5B7F5AAE736B1DAD44E156F0349B7A7 the-mirror:-such-a-good-feeling
242,980,661 *179EF6134CC2FB358B68CBD22E8DAE7EABF4DA92 thengodsnapshisfingers
242,980,662 *179F13304EA58D9CBE8196D341D7EA169C72D492 thermoswitches
242,980,663 *17921F51E69CC30E91CF8DB636CE9A70DA0480BE THOMASABSW1
242,980,664 *179191DD627542DDDD34C23C12C104AC2631CD31 tiffany-mcdonnell
242,980,665 *179A04ACAE870EDBBD57B56D1F12A422DABF29E4 TOBRAKE7
242,980,666 *1795FFD08D70C96B05E72C617C86EA3DAED84607 To.co.zdarza.sie.raz.(1976)
242,980,667 *179E729FDCE64034CA2F7458A066FBB35825AFA6 TOIMINTAMUOTO1
242,980,668 *179C2513A43B854E3EF881A974E585E7D242EF71 TOMASWANKE
242,980,669 *1794BA211FB2501F2C3B73B7BB606EBA575439A7 TONEY.MCLAUCHLIN
242,980,670 *179518602BDEC68A05949869701378B7590583BB TONYTABER
242,980,671 *179AE475D79F4C2365A9D72292894296D0D4B57A TRINACRIIQUE7
242,980,672 *17902743275E6CA5633D8C9DBA46515EAF21886C [email protected]
242,980,673 *17990B5FEE14E5EBBF2A85D53444F398399CDE3F TUBBY-ROHR
242,980,674 *1796E10FA37008445EC893AA801901EA5A31FDC9 TULPPAAN4
242,980,675 *179FB18910C8BEAD3BE4AE025A8DF348E91CD583 TWAG1234
242,980,676 *17989B82128AF805D39D991ECF74C34304608CCE U7)H
242,980,677 *1795AC1FD3198C477E40EC47F6FBF94FACE92460 UBANSAKHA JONGNO
242,980,678 *179583E284CB10007CE3C9C89CB4D96818474463 ÜBERMANNSHOHEN
242,980,679 *17922E690694D94CB21CB6F2296C5E0BA52537CC UERMIFORMIS
242,980,680 *179190A7084593935B544ADF43BE7AA2E59C627B UMEAWEEK
242,980,681 *1792E6E2A9EF000E485EC75117FC0C9C5837DEDB UNADVANTAGEDA6
242,980,682 *1796A42D019FEEF08DC494862861B5E26AD2C987 unitedone
242,980,683 *1796FF3C0FA99500090EE95FD67981DB7A6C3607 utility-sabotage
242,980,684 *179822B785B7E622026849B4BA334FC978DA4E48 #v1a
242,980,685 *1795AC9998E45F4B1BFCD974929A746D5E09C211 [email protected]
242,980,686 *17962BEDA1508BFF4D4EC44F15138D96311B2CD1 ˈVAKSMAːLƩTɪFT
242,980,687 *179F5A1259E7A2395BF1282E48622E7C540A0DC3 VALENTINLEPETICH
242,980,688 *1791A2BDBD36886B1E827B5681BDEE52933AB546 VANCECAVENEY
242,980,689 *179C5398DC927417E11512B17007B7178C34BE5D vancerechel
242,980,690 *1792DB75B3A9EBA3597DA3E64534DD609D97B4FA vanessa-arteaga-rios
242,980,691 *179C232DA89F98AE89CE08DA632D53CB8AF348FA VAN.PALLAZZO
242,980,692 *179FD96C9273FE38D53E8058B6DB2113271DAC5B vasudeo.thakur
242,980,693 *1799750D7312769BEA0F2E654BB12F25597BBA18 VEREINA1
242,980,694 *179A2D620C4972CA407C2420ADD0E378AE4E4742 VERNEREGEL
242,980,695 *1798709B1618C5C216F777327038C9933302B2FA VERONICASLUVA
242,980,696 *17947ED74789939582B2E1C0C6DF1CF80CB9F519 vertiefen
242,980,697 *179BA786D128ACF6F60B53504FDCB6257BB93E97 VINCENT.PAUL.L.MORGA
242,980,698 *1798FBA5ABFA901E56FD5F7408159AE78B7B1485 VINDEN.SI.VISE
242,980,699 *1795F2B05B2B6EB57D3B71D6FA278BE9BEE3B33E vinodkumarmiraska
242,980,700 *179F9F3162EE9FDAAA4D03F78D76CE6D82D02AC1 V^K+
242,980,701 *179D2347895C4EC5D317A95CD749C56655332AA1 ˈVɪLTˌKOːɡƏL
242,980,702 *17941398F0685037448A18A9DE852387E8DE159A VN20071017062134984C689240
242,980,703 *179166DEE036FEE639DF9E8C9FEED08281749A54 VNKEAMEDING
242,980,704 *179B71D267CA9D8883F292E01783534873BC03D3 VNVALLUED2
242,980,705 *1792F707D84C47AB97963A4F5CF270C0C9C04C38 VONMCCULLOUGH
242,980,706 *1798AE82A624688EDB23BCD53A5FE9327126D133 VONMCLAUGLIN
242,980,707 *179C96B5864BB6BAD54B24983FB7164598FFD5BC VOORTRADEN
242,980,708 *179877E6EF40B9006861B15BC5C05B364F8FC099 WAITAROUND
242,980,709 *1797568D70176C053F69AF1D76B956C89EB50257 wakethenation
242,980,710 *179D438A39740AA2FE6477EF2FBABECE50C1B673 wardsledz
242,980,711 *17976F2B9ACB234AAF6DB930E0526BF16E852845 WAREZPARROT2
242,980,712 *179FB4734D2A098222386C29C90F45B54B9F8D99 watch.out.for.the.bat
242,980,713 *17990B67B1DFE8AAE1242F2B9A1D57CD59C276BF WATSAMON.OIL
242,980,714 *179F4657CB7786482C18B84E3A3E5B5F8407418C WAYLONQUIROS
242,980,715 *17923BD34689216420AA8915546FB18B3103601D webstarts
242,980,716 *1793B3E3972F59893724DDE045112C68805439FF [email protected]
242,980,717 *179FD40A9796184EFCCEB1EB4E661F9FCD4A81AF [email protected]
242,980,718 *1796105C94BF2C38976F9D99C6B29115AB00B4E4 WESTIEBUSH
242,980,719 *1795B249835AC62D1E927C92AC77C4EB38B68142 whip-wraps-around-the-middle-of-the-poker-and-tears-it
242,980,720 *179F0067F1B48A6A364950861808BCF72802E6D9 whitneysondergaard
242,980,721 *179ADD1DE0FDB007B337863C552EA3D4D56941EE WHYDOT1234
242,980,722 *17981B8E50B8A625BA37DB99896738612DF49333 WILFORDPAUTLER
242,980,723 *17930C4DBEF3862229D2BB62D405E9086DCE2234 [email protected]
242,980,724 *1791A182986E25A330EBC5C75EAC3DDBD6A44C7A willardkiraly
242,980,725 *179309B47942B6EE645E2ECD6EC115CBCB9B8D48 windjammerbbs
242,980,726 *179EFAE96B73BB560672BD2F6FD738B1EAF3AAF1 worldfam2
242,980,727 *17910BCD922327869F13E19B928CD4B5D604D967 WRWD-1073
242,980,728 *179AC63993B412DF60B42EE7305CBC77829C9BC9 [email protected]
242,980,729 *1798D4FDBE7FEB038AC26DA772AAAB7F0A0D0120 wulandeng
242,980,730 *1794F5D7164A742684C4CA1B0E25EC83A005FDE6 WW0L
242,980,731 *1798DBB56C33F96E80FB218BF09F55FEF993DF5B WWWMUSICCITYDL
242,980,732 *1799AA9E64000200EE7B772923E7E9A65D90F57C WWW.SOULMATESCEREMONIES.COM
242,980,733 *179D1804D0AD94710E165C8D606EAC832DC0880F WYATT.COZZOLINO
242,980,734 *1798DE464532348CC33AED8C305B42105AB6DEBF WYBOROW5
242,980,735 *179A79B262E897B8DC7E839841CAEC097DCE5320 x5>p
242,980,736 *179ADD64107055D5FCFD245663BDCEF27B3A1FC6 [email protected]
242,980,737 *179B347116FE1424A198A5D796147480A6924F61 XOPTNXHA
242,980,738 *1795A8DFFDDEEDB4B1A99AE172D976288F9A31DF )X(~`-~`<#P
242,980,739 *179089B4FD4838A807C5A0B4967BCC0BEDA8FE9B YADONAMARO
242,980,740 *179E3F57E043197BFF0318F26D568C5DE4313FAB YAHOOICQ
242,980,741 *1799ACE1530B59C0627316B98EEF6BE97E324FF7 [email protected]
242,980,742 *17961D7376F8226A13A76F8407CD177C291068FD yari.buitrago
242,980,743 *1792A612A6086A36619619E38CC66FD3A26CADA5 yazfermald
242,980,744 *1798E795DDBDEF18650A3519C17DA13D58F81C25 YEENMIICONGYONG
242,980,745 *179A50E16B84463F4A0A6C2F49FC5259656E8CE8 [email protected]
242,980,746 *1793B69137D31BD1A9F1B1807DAE0937022DCA56 ykk|slehten{
242,980,747 *17947C43FCA16524E47DFBD0E7B8C7620962F7FE YOHEISHIMMA.AOL.COM
242,980,748 *179658C9A41CE95625C0827AE12FA2242FE4B51C yokujouk2
242,980,749 *17992167D6D3F5D64F99CD8955AE0880EB82C9CF YTGXPXRCCKPMASE
242,980,750 *17967EDE166CC2C4C1C285356B5822FDF623E864 [email protected]
242,980,751 *179292352B4AA9F10AEE42CC2FB5F6733DE0C211 YUGENDRA SINGH
242,980,752 *1794EB6D7BE39BE09FE4E19FFE5697C4A84EA8E3 yu-gi-oh-sesi
242,980,753 *179989CB2450575DA32A669F6D78734F284DD9D5 YV&M
242,980,754 *17943A4378D824A679C2FB04236BCAADA7BADBDC YVONNE!!
242,980,755 *1797E811D8DFA831E83C2C3D77272605E55CC809 ZANEWION
242,980,756 *1795D8F05A4A5B8509819FE00E7778B5AC88AF6F ZAPETOJED
242,980,757 *1796BA0A45014106C4FC118AD844FCB079B95C6E ZAQUIRIS-ANTONIO-LASANTA-RODRIGUEZ
242,980,758 *179D35C7D23E1FF727191B1281F0950D6F62A4AD ZENYORTEGAILAGAN
242,980,759 *1791805ECFBF20180435B96606BDC7139D4BEEE3 ZERRBILDEST
242,980,760 *179DABBB7735883533E679D52A146588EF1E4062 [email protected]
242,980,761 *17941C9EEA4C97D87009772BECC3C8AB610694ED ZWEITEABTEILUNG:FAUSTSTOD,"HERBEI,HERBEI!HEREIN,HEREIN!"
242,980,762 *1792176F27B1B80D585A7E1B2C8E498AF870E52E אורJERUSALEM
242,980,763 *179424735504F7E830927DF5C564943B3FF605E4 ΛΙΓΔΙΑΖΩ
242,980,764 *1794DE0E1D51EE879A154DCF41AF8398DA51918F ΟΡΆΤΙΟΥ
242,980,765 *179AE762A4580954F7654BF0AEAF13058D7C9A11 АЧОЛЕНАЯ
242,980,766 *179B0FED12380FA74E727AC985218D4EFD658640 ёнозеро
242,980,767 *179D7B007BA0F23DF8292B204E532F7D52942580 КАШИРСКУЮ
242,980,768 *179BE2DAA556BF92EBA74D2EE99A0395E3B2756C КОРЧАГИНУ
242,980,769 *1797FB4FBE53E32ADD8E78F7ED385E200381A80D манюшка
242,980,770 *1791130AA9AB1CD81A5EB121388DD2879809904D „ПРАВЕН
242,980,771 *1790082744AF99EE580A5FB5ECCFD9F5469A8927 ТЕРАСКИ
242,980,772 *179BE0E06E9C074CB7B0725A345E74F1628A4577 ШУНУПИСЕ
242,980,773 *179121FAA686A7BCC7FE3255089A030B322EF01F がコンサートを行っている都合によりkinki
242,980,774 *1796892A85D03B9A00EF3B39C8C465B428547B9B 021mmc900s08565u00003c01
242,980,775 *1794DC7B1EF5F65B27E1A01168082A77DEF8E58C 1110816 DIE.MEISTEN.LEIDEN.SIND.MULTIFAKTORIELL..
242,980,776 *179523B4E515F1FBE3E9553440BD0DEB8AF19DE1 112EXTRAVAGANZA
242,980,777 *17957AB510BADB03F4416C551F1767F0D2E665CE 126BELLA
242,980,778 *179F17236B71A6603C2646A0C9D335B80DF5038A 13=-.BORG.AWAY.-.AWAY.MESSAGE.SWITCH
242,980,779 *179626F73D3B6E730F7DB2C679AF179E540FE926 1435987 der.leichnam.war.umgehend.eingeaeschert.worden..
242,980,780 *179A75D99DAB20BE7338F3706566A393589AF3F9 172994 LEIPOMOUUDISTUKSEN L
242,980,781 *179FCE954CBBF5569CE909F7A841EBEC49EAC4F6 17h0grapher$
242,980,782 *179C060D92022D1732F2C18F8776ACCF4D8C5E6E 1august1847
242,980,783 *179BACF94C4A27D58985012C70EAFC2B8FFF1663 1 EM-QUALIFIKATIONSPIEL
242,980,784 *179BA6DAA5C7DAEE6F03AA0BF69348514DB3218F 1-hinueberschleppte
242,980,785 *1796B339519FBFB9E7E7A71DD8AA8D748CF2FD2F 1iluvredman7
242,980,786 *1794483B247E5ACDAC33911D8FC49C63D9873A0D 1KERMITG
242,980,787 *17919612F2A754366A15825A4514F9EC8BD758D6 1 KIRJOITUSKOKEMUSTA
242,980,788 *179658AD4FDBE646F8403A80B8C128C3A7727650 1 LABORATORIUMSUNTERRICHT
242,980,789 *1796A04681B31B2D87D6CE7D4440BEE880A2300D 1 LARIANO
242,980,790 *179A185117F024281BFF45E8906FD73D39F6BD3D 1-LEOPARDITARHAAJIA
242,980,791 *1791C36D64F027441C86F6A10533FC2FF5EE0FBC 1.luutuneeseen
242,980,792 *179A3510C5BD93E0A28B90EE2CE4630EA6E5C60E 1-militaerdiensttauglichkeit
242,980,793 *1798FF5BFB783E342C92F9955D8748DE43A442FE 1mpr08a8111713s
242,980,794 *1790BEEA2DDAC620F5B663F2DE8583B5B26BE3DE 1-PAPERIVERSIOSSAAN
242,980,795 *179B4B2676B3315E989E78A6E40350CC450E3CB8 1-plantar
242,980,796 *1799E90617935F607A71DD36AFA0D2C89836EE3E 1.RIKKIHAPOSTA
242,980,797 *179AB3262DBB15FCC8B00A4324DC4730DDC45F26 1saturdayconceived
242,980,798 *1791A022D2C400FADC1A0C7C77C7DF296E0BFB27 1SDNLL
242,980,799 *17943D9C80D84D8A22485591CC957D05FCCD5E15 1-SPRUNGGELENKENTZUENDUNG
242,980,800 *179AF3DE7112208504A04BC78D43CC5B9D053F2B 1 STADTGELAEUTS
242,980,801 *17986C93CFDD6FF569F6FC283633EF763DA35341 1TARASOFFS
242,980,802 *179379FB420809C15D20F5BA661F8C8FEAE05016 1 TOISKIELISIIN
242,980,803 *1799C16FE675634A2A759463FDB5FC2A7F7636F0 1wedelfans
242,980,804 *179BE692379CB5B6390A8B8ED1EAFB8B72AD494D 2006Version(Bonustrack)
242,980,805 *179252EFB4C30692331264436E2D065B0487C43A 2011570 "BUTIDOTHINKIT'STHELASTHURRAHFORCONSUMERS."
242,980,806 *1791A9BE73C38F8A3DEF3F861CB948350B833D7A 238LEA
242,980,807 *179C985566FD07264C97E738F41B099A9455FE2B 24august1835
242,980,808 *179132BAF5CD858E9EA57922FC76B59D53706B80 27.12.1088
242,980,809 *17915986FF60B2AA0F5D7F8BCAAB93C3C25A2C81 296567 KUVITTELE.TILANNETTA.,.ETT
242,980,810 *179310B8842D0C6858077EDBB73E10F30012BA59 2ASPALTO
242,980,811 *179661307A0FFDE7A52C0D62EA4D4A7186F5DB37 2BRENEICE
242,980,812 *17935A8BFAA4828772F86A14CCBC7A7D8483A9B9 2.BUNDESLIGAZWEITER
242,980,813 *17947E39BB33A45193CA5F4F6BD3205A0E9B310C 2D025D45-92ED-3755-8436-F7EFBFB1B053
242,980,814 *1798EB895755E88116BE7F41D359D64F30BD1619 2 DIEMELLAENDER
242,980,815 *1795E45C264551BE5B11E294DED9ECFAA60F328A 2.KULTUR-WERKSTATT
242,980,816 *179CB37D59C17F541465D8D0226284919027D95B 2.SLIPYJ
242,980,817 *1792EDAA3A5C4A1ED63FEB69342DD4A8F640FCE3 304063 BDA---BOMB-DAMAGE-ASSESSMENT-
242,980,818 *179B9E67A34B89FE86B52172C892C92C16CD593F 342485 milli-eGitim-bakanlIGI'na-gOnderir-
242,980,819 *1790D7D39A009FA2F692A80D1F65DE22BDD29DDC 348042 the-predictions-came-true-
242,980,820 *179137A140A920B3B22952801159C7D654493A4D 35makamlardan
242,980,821 *179BE1EE4E795C215C79F329E98DA34161639A33 3bball1
242,980,822 *1791B849B7896594AD2EF4F3041943BEA7AD3929 3D~0 ~O UU
242,980,823 *179C9A6B5FAFA762BA1C91D7646346351686AAE2 3DEGONFLANT
242,980,824 *1793ECC71F0D686F621B8D68620A34B53ACC99BD 3DORESWAMY
242,980,825 *179F3749BE82D565E5DE01673DFEEABD72BA803A 3-mpr-rokotukset
242,980,826 *1791EAF43112D247B30EF1E958AE7C329811BBB1 3OWSKICH
242,980,827 *17905AF8AFBA09B904FB022E1F7E930AF510F8BD 3TAFONOMI
242,980,828 *179B000FB4DD3C01EFB9BEEEA4E04AA2E6640913 3V451V3N355
242,980,829 *179C09C0DECEA02D5288954AEBF84BDF80F07C0C 40 EHDOLLISESTI
242,980,830 *1792637689ACBB958C334CB41A21DD54ECF0AC46 4416CNG
242,980,831 *179549EAF9D54C84EC47D9F038C950517555F4AF 4DUKATERNE
242,980,832 *1790534B967F6422D0BB6AC1A78A8ADC398E7370 4EGARAGFE
242,980,833 *179A5711808A53A2907913F5C716818C1F1DCE8F 4iamlance8
242,980,834 *1792695EC49F79D6B41BD5409937449413EA6ACF 4LPH4NMRCS
242,980,835 *179F53B84B9B036A2F89ABA833E68B58D600BA61 4NMDYASY
242,980,836 *179CE1869A6E924C465B8732F3532EA90E791342 4SINDSSINDS
242,980,837 *179B247D3B036FF7B3A34F09C56AF77D42001172 4SOROZABA
242,980,838 *179438862157022892AC5677AE266C2F871990B5 4VESSELLA
242,980,839 *179D7B3494328CA48CE5DE20D019584517766B6F 55POLTTANUT
242,980,840 *179DED2E06A366E30CFCE9D90A35250A7B9BD37E 56.NACHDIPLOMSTUDIUM
242,980,841 *179BBD7B493A4541132649B93E24FFF7F028FF6A 570D12CDC976392FB10153768DC33347
242,980,842 *17998FCE262EB1E22F7E29E2BC063E48ECFD2E70 5C05TAND0
242,980,843 *179EA1DF2142AFB25BF5F5F15BF19FB7CA6862CD 5EXPORTARIAS
242,980,844 *179A4260540B8AA45FCB2D1D2E54C8B299C7CEB8 5KONSENSFA
242,980,845 *17992541BB40C117FE7A214F9EE37BC39D7132D6 5odontotherapy
242,980,846 *179E4F9686552A32CA091D3C87B4CBB219C9A310 5PRIVAT-FERNSEHSENDER
242,980,847 *179CCC006648C84331BB486DC442999432F637CE 5.sponsoritulot
242,980,848 *179266EC4346FD815FAE489EA5038FD5D721860C 5toimintakulut
242,980,849 *179CD3628E044089DBC3A08DCD3261865C1500A8 678MARELY
242,980,850 *1790147256494367D7F4A2ABBFC4BEFDC12BE47E 6efd89c08f4f5cc6b7cc299f16196a7c.tacsam
242,980,851 *1798E09883153CE17C5C0CCD5FB6050982652538 6ILUVSANTA4
242,980,852 *17905E29EF264693A9D2CD698F7EF91A3794D0A0 6KREISSEK
242,980,853 *1792A4FCC35F4DF0BC31319300AE37BE7A2193FC 6LENNONANNIE
242,980,854 *179EDE41DA54B0647913E5D24D4B8F3FCD65A5FD 6PARAPHRASING
242,980,855 *179F3CC06EDF3485720CE630C9FF2E6191213BED 6REPIRATUDGAVE
242,980,856 *1795757BFF89C15EF55CF905F08696ADE949016C 6VECTIBLE
242,980,857 *1790680182D1F2F231CD2C0B34D355ADA2E113CF 755137 koulurakentaminenolisodanj
242,980,858 *1793ED72D372DDEA2E0D4474472CA834A8EA8582 7AMUTHONU
242,980,859 *179E56D8C0884684B884F4B1720B8B533F227B4B 7AUGUSTINDIAN
242,980,860 *179E4949AE6F405EEED3CEBDD07A121DDABFC61F 7ILOVEISAAC2
242,980,861 *17922C25E2981809041B3AC20592FC6410493DEB 7KOLEDAR
242,980,862 *17955042D7EE30121C5513A01CD76592F798A7FF 7MEMORYBIRDIE
242,980,863 *179E70CF3B902BE534A9BA6B356CFF30CAA2185A 7NIKNULET
242,980,864 *179C16BA0A1FC5D96D211DB7EB97C2AF148F75C9 7orchestrate
242,980,865 *1792DDBA1A2C4CDF0E068A49D12FA1238CF1D4B1 7-VREDENBURGH
242,980,866 *179BBE28633C80BA58CA3A9F18DE0BB459D07A2B 7YDALOLAFFUB
242,980,867 *179848FF85D369169AB5B10703F6D95D934CB36F 811NKER1NG
242,980,868 *179690EB4280F66BED512DDFD8A2B58BC1D83095 8b ~ `)8(
242,980,869 *17927C04DFBF80E9E59BF854C6357B748981FA3C }8{O~.0~.D======B
242,980,870 *179575DE6E1794B181626B17F008F64B86D8B90B 8======P~0~o(^_~)
242,980,871 *17985FD5FC682736FD6DB5497AD7B4496CC34CAA 951550 SALAUKSEN VAHVUUS RIIPPUU INTERNET SELAIMEN VERSIOSTA .
242,980,872 *1798AA849501A560C42FB0F85F77F6ACADD58764 9ARBEITSJUBILAEUM
242,980,873 *1796B864506FB0BD9A86EE56FA48014BD4E8814B 9GATEWAYPAT
242,980,874 *179EEC2FAD71829C2BB43F362CEB18AB6DABB4A6 9 HANDBALL-BEZIRKSLIGIST
242,980,875 *179ACEE987C7C59A5447031DCC9CD5B25ED3FA08 9KONFORMITTS
242,980,876 *179EA64149CF729D735A5F3D8815DCC9342223A0 9NEKSOIKS
242,980,877 *179B028CA3EE75F537BC4978C0CFBCEFB7309FA4 9ROBOTECHMITTENS
242,980,878 *179F55D106BAE45755D91E04B71390A51A8A27CC 9TUNICADA
242,980,879 *179F31DA8F02E81CA4D11B68AEBDC38CE7D3E1B5 9WORNFADING
242,980,880 *17915509C6158E5159D78E10BD0516ECDAF5F86B a072947
242,980,881 *1791DA8C14A11711B8BD9EAD02A816093C995202 a1,i9
242,980,882 *179A99567CC518C634BD5C48626381C699A0E29D A1R2
242,980,883 *1795F245A138709A8967893D79146F21EFB1BC1A abcdefgboris2
242,980,884 *179DB95D09741ACF7AEDCF56704EC71E2125D630 abebishard
242,980,885 *17903205D46933B66FFCACBE0D7B983C98A22216 ABF)P
242,980,886 *179EF0ECBC1454E14CF206895DFC6C563182B055 adi-aquariuz
242,980,887 *17977AC4A7A7DC2875F4A9E68E3158C1CC2112BB adolphhauff
242,980,888 *1797638008C10B3A08AC00CDF81D9C75C56CF494 ADUANGMARN
242,980,889 *17918EC71666571F5B5EB23287B935AC028AA16C aeu%w
242,980,890 *179F3C86D35D2AB9B38493EE842CEA3D67472711 AFSUX
242,980,891 *17926DAF3F1D7A2C49BC106E3F437EC5BBBA1726 afv2d
242,980,892 *179C846E7702B955252C90380B7E910302D84492 AGGLQ
242,980,893 *17975975E516008ED9BA4B5F097AEBBAA65C00B2 AI:
242,980,894 *179961EDD940CD30D712F2D88B8AB5627FBC836E AIDS-DENIALISM
242,980,895 *17922E2BB848538FEE114A6FBA6D195AED975973 ALASKAYVONNE
242,980,896 *1793C47062B61D5CEB8F60CA42CBB55E6B485730 ALBOREZA
242,980,897 *179FBF8C34E27E51380B52149E2C6DB8E6160E32 alexandratomescu
242,980,898 *1791E91CBFF232776F1A88A5E785E5984C119598 alone”’
242,980,899 *17946ACA1DF6DF88C3F5002CF6B0021FB1362E33 [email protected]
242,980,900 *17938287B2B6F3DAFB642602440CE229DE6D5D20 ALTONCOSCIA
242,980,901 *179706A8B29070A36B66419136D13E6377DA0C97 ALUW(
242,980,902 *1799A8EF92CD2C65C47A238E4B7386F529A3223A AMHERSTPAPYRUS1234
242,980,903 *1797A2CF7DF6B90DA70A8DCDD3BC0198BC81EBEB am_,n
242,980,904 *179BAD6FA84A66289FCD80269E16190DCEB6CD87 anderson.hidalgo
242,980,905 *17984639CB125536E712A3F76B87627983FBCC10 ANDREW-DAVIES
242,980,906 *179E0B1E3B0A38FEB364474B006880261B089CA5 AN.IMPRESSIONISTIC.PICTURE.-.TMUNA.IMPRESYONISTIT
242,980,907 *179A13768BE57F37E07C1B9768683DF6746F11DA ANJ40
242,980,908 *17991B997531851A94FF1933704E1AD9E8EC1F0E ANNA1330
242,980,909 *179A13ACD486B6C8262648952AF814CA3D8DC8DE A)OR
242,980,910 *179FF1347355DDB9F968BE7B7281314887C4686E [email protected]
242,980,911 *17917E8E440DE35726ECFFA10DAD962470A21D93 AP:N$
242,980,912 *179C4A43CAED37F297C253307B9F75D7E08375AD a-qg!
242,980,913 *1795C59BEF8C14454B7D17653D9DCD2A0786C923 AQUAKLEER0
242,980,914 *179688CD945AB11B873B09AD42ACF68DD99E2590 archiedollyhigh
242,980,915 *179C380B776FAE161FEE87AD4608CC136C529A1D ARCHITEKTURVORBILDERN
242,980,916 *179AE882D5E303FC9C0FDB0960EEF0D3A40E36AC Aretoawisemanportsandhappyhavens
242,980,917 *1798D919250E58B440E2D74C0880E9ACDA9AA11E ARKANSAS_68NSVG
242,980,918 *1790D5236DD8BE77180C6AA9A9EBB242AEB70924 ARLIE.LITTEN
242,980,919 *1793C9615390F9651C2BAF23CE9045263E9DCB28 ARNOLDOMASSAGLIA
242,980,920 *179B58C7EE6F4473DC9E466553037F55A163D5AF arnoldomonagas
242,980,921 *1792A23A25EC22293DF46B43BB974B84E940140E ARRONMAHON
242,980,922 *179C31B7ABA5F6C692A77675E51D71E8183FB44B [email protected]
242,980,923 *1799D229F1A8F6503F606E9B0D26842BFE4839C3 ARTURO.KARIGER
242,980,924 *17902754458355396BE8A2F9F0A24858DE73083B AS-D
242,980,925 *1796A692F78D5B0D30DE306489D7DD16790FF0D8 A/tN
242,980,926 *179D5CFC702019C36C6DD2283178128B2EA136A9 au)b;
242,980,927 *1798CB95928E8668A2BD5ED12C2C9E4A1C909610 AUDAIENTED
242,980,928 *1797B73069C15AF312CA01DAB1AEB7392CBF721D austinchar
242,980,929 *179603F4A2E1D015F908A201BF714D9532895847 austin.eddy
242,980,930 *179DC67DFC40A01840996C0D6FB11740AE6D7A13 AWAKIHCAED
242,980,931 *179FD95F41EE6B62A833AD930C195662DA791196 ayw5g
242,980,932 *17953928CD400E3ADBD5BBDA0AA3D202A3ED6F6D B0le
242,980,933 *17994423088F4DB01D3A34E95E7AC3694495445D b#_8q
242,980,934 *179D0E8729243FB8A6306AA7CBD0E54440D21D65 BABNN
242,980,935 *179453D78AD7EBB34E46AD15D2EA0E6445EB587D BASHARAH
242,980,936 *1797B8F39C13264A49B46CA72C4FC1BA0292AAFF BASIL.VANNAMAN
242,980,937 *179FF8D0B3384B11C9D118F8DC38D0A3D049E05D bassam.a
242,980,938 *17983CB63D90CC3263E599575E769547C0128FC8 BATALJES2
242,980,939 *1798E41C475AABF01606F77D5B89FDB810FC217C BATTERS
242,980,940 *179BB84DD222C272F471DA8AA2D8EC2EE3C9C366 BB2QT
242,980,941 *179902F1076A191F4AB4A36F67DA0100B0674D39 B?BUD
242,980,942 *179B516C19BCD463F0B0851A84024D2862B272FF bellafriend
242,980,943 *179CD600F9ACD3E5675B115EECD60CA7B169C434 bennettduchscherer
242,980,944 *1796B940181DFB00F52BB2EAC9646A45FE8921BD BENNETT.FELLHAUER
242,980,945 *1791D499A8D9941E1A18EAF5CDAC62E622C56A2A bernardoditman
242,980,946 *1792179E366B225217A0C267C1953F7BBEE8538B BERQ5
242,980,947 *17956C50E066B40E470E2F420B7F9EDBEB35DEDC BETRUKNE4
242,980,948 *1797E576E8E1C32C37709A1E933D9899180DF14B b-f1
242,980,949 *17969FA26EF267B836517189DD46D3938CEC11C6 BF!VT
242,980,950 *1799F7CDB1E630DFAEC3DE458B412FC369B0B712 [email protected]
242,980,951 *1794207D793522C54909D265A9A609656A1698DB BJ4LQ
242,980,952 *1794046EC271E9C5C49D84A16F2B278EC80ADCE4 bk,xm
242,980,953 *1799D091C23436491A877B4E60876B31E484D529 bl98?
242,980,954 *1796F7E779D849C5EB829FDED2756390E1461960 blairmoglia
242,980,955 *17990FAAEF5C97748BBEAC8C7F0B310F8E1A4D07 blo1
242,980,956 *179FE8F96D779F8A162DC89FC25E9CC39E1B7521 blx4h
242,980,957 *179222C6541D62FC4EEA35297E315A1FA9FB5D8C BMD,)
242,980,958 *17941AA25F6836B22BEDD5C883A6B5E56586B7D3 b,nxr
242,980,959 *179F7BE355E3BE807A2B83BD5486ED9FE570332F BOBBIETYRER
242,980,960 *179CC627A58A24744C22D4E158C059D6EBEEC98D BO&L?
242,980,961 *1794CDF20D45109EF84D8674D0DACC9814335D46 BOSKAPS6
242,980,962 *1799682633ADC8F1EF2840FD5FB9197D253EC0B9 boston.-.for.christmas
242,980,963 *17950A01445713D3D39A20B84D4289BAD6235B39 boxnut83
242,980,964 *179B0532958F4EF1DB1D53F6AF167282F056F18F [email protected]
242,980,965 *17923FD54E788B90AF1F9445762A00947D387F73 BRADDICK’S
242,980,966 *179DB464287F03759BAFCD89906206CB24F2C87D bradpettingill
242,980,967 *1794B0056BF1F3531447EF5D0E448ACB49C4C3AF brantowney
242,980,968 *179EF4FEC604995FB6E4E7757EDAC19F4113B023 BREAKEVENR
242,980,969 *17945F78997B721C897ADAD782CCE200E7CF30CF breaking
242,980,970 *179D8F0B3D2124DA58D10C4831C3A2468A5B092B BRENDANFAGO
242,980,971 *17981E6119965D6A62AB42A5D56BABBA37587B6E BRFv
242,980,972 *179913BA9241CF8070DAF0965C9944700221EF1B Br/r
242,980,973 *1793ED74F18EED5212E8CCC33FA8D748A64F68EC BRYONGADLEY
242,980,974 *17982DB69E7C83730C685F8A398E999E145019DE btnstart
242,980,975 *1797AAD9B00B773DE2225157D47D88F6BCD4B113 B=TSO
242,980,976 *179AADA34D45784A9774D9902FAD3A29EF4A9B8B bu4de
242,980,977 *179B326837CC2AEB5CBDA01023C4D0FE0435CDE9 BU.EW
242,980,978 *1790E773611CF0C228A65946FE7E484A10AC06FB BvoT
242,980,979 *1796B4377AEAF2D1E6805A9AA198C855803104F8 C2mZ
242,980,980 *17942662F789951117C133917AC84A83EF406C4A c9h7r
242,980,981 *1794FAEE558467C34154F7413232774E6E0884F0 [email protected]
242,980,982 *17934170382B47C4C141176EF5AD867834425513 CAIWT
242,980,983 *17960036B2638F8A9F21533B0383D876FBDB96A9 CAREYBASNETT
242,980,984 *1790B50AD43A414789E9C045504C8ABDE41912FA careydodrill
242,980,985 *1797B933BD911BACF64BFAC3A997C43145C8DFF8 CARMENRADCLIFFE
242,980,986 *179D3CC8C4FA6A3868351E2AE0E500F959B2E43B CAROLINELOCKYER
242,980,987 *179D3D80A5660A9D2DE92301C7846B8E21FEE9DC carrizos2
242,980,988 *179A90D08C09241102C582791DF63350D43E3CEE catherine-manchester
242,980,989 *1798F871793A97B06B81FF45B38A32CEFB7691C8 CB9C868F13F3F56000B0718D72E9688F-SR2990
242,980,990 *1791E679ADD3CBFFECA4CDFC5E3F748851E7D3F6 cbdv/
242,980,991 *179873C642ABA838680B2E983D7F1E8FE9F029CE C-BNI
242,980,992 *179B19DEE4198840E2EBB5DF9B224E1BB17D16B6 c;bz.
242,980,993 *17960AEFD9F03AB5E52BDC7910F67B4894BD4CBE C?D0W
242,980,994 *179131356AEA8D2F0F2D082673ACEF6C9A45205A CESAR.KALIN
242,980,995 *179629A03B0CBB93830E65809A40FF3AC89D3AC1 cgp)e
242,980,996 *17981BB4EDE933263CADA9830ECF6ECE316EAE76 CGZ"1
242,980,997 *17938C70900A0D0974EFEEC8B882CC41FE9B922F c$hb&
242,980,998 *1792FD69BBB551F2672978DC55EB3E81223CC422 CHISAKI0
242,980,999 *179F59887ADACBAF2CB355ED8B82E25149646735 CHOESES5
242,981,000 *179540729E7C33F15461313074F7FD9F576A13FB CHRISGOFTON
242,981,001 *17938D31585E9B4A29FB815D2472D6C6279E4C1E CHRISTINE-GOZO
242,981,002 *17949F2B0896B4B36F4668D06AAF060B092D8C6F cieuses(feat.Buck65)
242,981,003 *1795DB32F929D79840CF82CB2B83A3E525D2FF7B CILÔNIO
242,981,004 *179C8DC4F0047D8BFD77146839E35349E5E49764 CIRAGRA9
242,981,005 *1793672632A802F84F1905356DBEB56CE2346ED5 cjqq
242,981,006 *179708FD499647C9F1C58D859C9E53FC30C8456D CO=,M
242,981,007 *1795457EEBCEC2B17B5F678DB72E06D9179161E7 CONDUCIVE8
242,981,008 *179DFA82E0E975CF0A80A1CF8BB4171244273311 COYCANNADY
242,981,009 *179CF8E33A1F24A19823BE29EBFD699D9D5D7678 cp(1:
242,981,010 *1790C00C7F3916346E6EB704C1D19ADB6962BBFE cp-#a
242,981,011 *1794DFC17220757FE0CAE559D38A7AAFEAED1C9F CPW!
242,981,012 *1793DF14D84BB2FD542C345C0F476386431A6A3D CRA
242,981,013 *179C95ECDCE838018E88AD894244F6240F4C59EF CRYSTALDADA
242,981,014 *1793AD364E9E2F9CF35097DE3BF7D7F89FE616FF CSA3!
242,981,015 *179FAC683F5D63A2AF13F30861FCED1C765FA3F9 CV/J6
242,981,016 *179EED001D1891DD2A218BAE6FCE0F5C8C77654C cw,)!
242,981,017 *179A9ECFDBC6C46BF830CB68F045EB005B9E7E5F cxdck
242,981,018 *17912E5FBD10968D565166D0110E139164263729 cxuc
242,981,019 *1799D9AC7E918F9BEB64B7B20129C9D8C561E3DD D0GEK
242,981,020 *179947588A320E3BC1D1EF3D3E2DF34B83383F4D D0V+8
242,981,021 *179B3DF9419BB491712969F9D0DD041368B14F81 d2ig
242,981,022 *179A1D9DB8236D6400406DA0E460C0A2847F655D d3compo$4b17y
242,981,023 *179C8903215B2D09968ABDA65B3ECBC2C69C1506 d4xol
242,981,024 *179E71AC47532103C33640BC5D6B6537952B6AD7 D$6c
242,981,025 *1794A26C4155F1543C367DDA530B4ED2211E5097 d_9/&
242,981,026 *179AAD1E96FEB602B66AED1A1E64168062D93F35 DA-5$
242,981,027 *179828F9BACD974D46B5C8776741645FBF9BCBE3 DANIAL.FONNER
242,981,028 *179F99D9E7BFA0FCD4663B5D4BF962BE5B4B56E2 DANIELBURPO
242,981,029 *179E7C4985B3B7617EA4C98BA8034C0C15C221A4 DANIEL.WHITMIRE
242,981,030 *179E2B784D5A4EE2A68E67B89796C0B59D90377F dannieumbarger
242,981,031 *179843CD09923BFD2A6D282E5708BA47B5D820B6 DANTE356
242,981,032 *1794C980A27E4E577F0F4B5C4C21B903C95AB3DA DANTEEWOLDT
242,981,033 *179E51D5386251C015E34DC0A577D5F487E0AB5B darren.peck
242,981,034 *17936943C4A3F44E61F7D0E7CD2CB3CCA6678E3F DAVIDHBERNSTEIN
242,981,035 *1795CC0598543264BA8AF1485C7AF8CCFB989513 DAVIDORTEGAJR
242,981,036 *17909DD2F83DBFD317696A6911D81EF96E15F869 d_awo
242,981,037 *179C3C6B47F5F147A5D996B1468C2200C81F8B6C dayton-scott
242,981,038 *1799E315D98980B15257AAD4F46CCFDCAB12AD44 d;bf
242,981,039 *179EC87BEC11D23AABA795ECF803B4AAF00C4F37 [email protected]
242,981,040 *17982FB4AF0C9C91192DD1B86A70775307B3ECC3 DENNIS.SHORTLE
242,981,041 *1790E3C16EA6272FA5370F8E1AA996EC293AA2E3 deponeert9
242,981,042 *179C32A33A5C10B19F4BA3A125813D0F8094A4F4 detatiseh6
242,981,043 *179FFD2E61C57CCAB716E74D7441984783538AA6 DFNV/
242,981,044 *179398B8178D591C3134ABC23F0B2D929E8986A0 DICAL4
242,981,045 *179CEFE5EFD0C036D09993497419224EDEFCF36B dick.sanderson
242,981,046 *179DAA453B1F5D401DA7ACAB264B1C05CCEF8FEE DINIERTETING
242,981,047 *179CDF11698AFB0DA031C61CFE9C2D8F7DD9B371 DIRTY.KITCHEN
242,981,048 *17905201DED56594FE7E8B1226799FC1DBFCA35B DISQUIETIN
242,981,049 *179810D2F6997CCE7E34444AC0BB430EA808D54E DiSu
242,981,050 *179F83A1F773A6B225176EA86674F14774F73944 [email protected]
242,981,051 *1794778B07E8E189A3DF8A8181E9063D2468E7ED dlvp&
242,981,052 *1791009CE072C098795F1A30E11E6C759BAE84B0 dm"4,
242,981,053 *17969F5787DCCD475C9D64D857467ACEFC494AF3 d$m.s
242,981,054 *1796DCD5D246F65A2B178E230DDE73578A8C86D9 dmt$+
242,981,055 *179F2D44203C5E9EF4049F94E59F78CDD2FECB20 DNHBJ
242,981,056 *1799D7A80BD3EB9C56B8950C2532209228576A92 dnjbw
242,981,057 *17903CE418BBE3766F55D5FA591A0FBEEDACB9D7 DON-MARTIN-RICHARD-COLVIN-WINNING-DETAINEE-WAR-WITH-TORIES
242,981,058 *1796D5C9F2F7EEA7CE4DEE74A7E43958CD307607 doron-david
242,981,059 *17917321AB2B92ABC9B8839A9A76EB90D66048F6 dosx
242,981,060 *179C3B9C357B5565A01AA37BEE2B0A7D481DC005 dpfio
242,981,061 *17903608F227453D0FCAD1AF5E3D604C76965BA3 dudleyhardridge
242,981,062 *179D6D104E1C2B63344430A0D851ADDBBF7DC1F3 duid
242,981,063 *179E4FD0B93370C9A67BBDE3CB35DF88FD118DA7 DUNT
242,981,064 *17924FC9167FE85C44452B307B47762AE56617B2 dv.dw
242,981,065 *17969E9D28B65323E0275510C88F4C0744927887 dyy!u
242,981,066 *179632FA52B38E00A79F7C4F83C19424888FB284 E(3Z
242,981,067 *179072A6136232B0DECACB67FD158E16012527FB EARL.SHULENBERGER
242,981,068 *179BF7C6101190AB89D5D6AE641E3439B6001683 earthbor
242,981,069 *1799236F6C701F322CE515C00D361E585F0F6098 ECFQ2
242,981,070 *17977B3DE9C56A77AE86DBDC8481F956AD3DC0FB ed(r
242,981,071 *17933B65A96F473CE9B96F06B48E4891EEADA315 EEKH5
242,981,072 *1795CF3D59131BE391E63F67288FCC2D83D4F128 efraincheverton
242,981,073 *1796C2BD0B05EF2CD876DA1A2FA1F7ED70AFA3AA EGERLANDL
242,981,074 *1799694DA1589505B0B4E3DFCCFB1C611E2FC3B6 e-gj
242,981,075 *179EE61E286BC3B60F33F7E6C1FB46D352D13684 ek=7p
242,981,076 *179B7575A30D3354E98AAE1EE28F7FBF2E9ACEB7 eldridgearline
242,981,077 *179092A3A6D8BEE1DE378C6DBA23B4953C5D752F electropherosis
242,981,078 *179BBA28F1759251F92142AFBBDAD52023FC130B ELMO.AUGSPURGER
242,981,079 *179A7E9F3784B44F77709AEDCC13445C84E3D0D2 [email protected]
242,981,080 *1790FA8578D83B521D9447CB876F97E2C0403A82 emanuelorielly
242,981,081 *179206EF0F7A605B05D827138B7A681158B697FD EMILIANIO
242,981,082 *179AF93F1EA5A7CD8D8B233C3A0376F472F48D7F emiltroost
242,981,083 *179374C8CF6EDCFF242DCF7EF89FB5F0A6253209 ENTRANCED (FEAT. THE ANTRIPODEAN COLLECTIVE)
242,981,084 *179EB7B69D6CD965B34352E42C999CBFC4984827 EOJQH
242,981,085 *179CC17F07DAE3D143A436345969401BCADCD528 EQoc
242,981,086 *17928B4D42C1A4CFEC1918F0FE5123393F40966E EROTICCITY(CARLRYDENREMIX)(FEAT.DENIHINES)
242,981,087 *179CC4333A0810654521ADC346A18755981614C6 ERSSALON0
242,981,088 *17944221787B1FFA38AF51C20B33E0C48084340F [email protected]
242,981,089 *17920CC6414F63D1D714948E51E9A36B333638AB ETAILOSNOC
242,981,090 *17900F4ED96B2EBB371D2028AB243DE286C99EFC EVERAFTER88
242,981,091 *17927A99A48E272B90637C4B6A93B92BA1671C44 EXCITED-DELIRIUM
242,981,092 *1798FB0A2F5940E56701185D71FE7920FA462A55 ezyz
242,981,093 *17906746B5CE3C1C993531C94D369527F1F9DDA1 FABIANBEIDLER
242,981,094 *179D9A62AC25073AE7E2EAC5C043B7AE62080340 [email protected]
242,981,095 *17976A8CAC7B97FFDA4DDB28CF416BF769C8BB97 [email protected]
242,981,096 *179DA3EFECF0BF73385B7226ECA81574B43B432B [email protected]
242,981,097 *17939E64E9C8E070E66219FA50B6D2846FA215BE FASKRUDHSFJORDUR
242,981,098 *179B0117EA4ECD11013786A781FB44955B68C85F FELIPE.RIDLER
242,981,099 *17927F93ADB7D7EEAEC6B31C53280E2E7D72F4F4 felipesimek
242,981,100 *179CAFD19904165DDA63B5ED588A05FFB2AE4105 feltontiemens
242,981,101 *1797BE406520655D5506585ED09497E81570E991 [email protected]
242,981,102 *179D2E4B118D773C8F95609FE97D31A3F65DE3AE filkcon
242,981,103 *179AAD881D988A7A9BBBA4606366AB602701D649 [email protected]
242,981,104 *179F21174765D662B46122D0C3E0B667CC882680 fish1jean
242,981,105 *179052B66D5C2DCF1B41AF8DFDBF4059C8DCFF70 fordyodas
242,981,106 *179CAC61B35D93DC77368EE8262564360BFCDDC1 FUJINAWA 3 0
242,981,107 *17971778FB576F092A48F07D26810CC3F731D21E FUNK UP THE NUMBER (60 SECOND VERSION)
242,981,108 *179E6AB4E774F89C1EFF49417FC27E53B196993B furall
242,981,109 *179E3DE56B5E4F276D3B3F0EBD6E518C7BF20D01 FZFUXQ8ALD6E
242,981,110 *179FB94B2722E88DE6A8BFEB92CE6DEF3DC6D727 G^3
242,981,111 *179AFD9FD0419880967D8551CE3925C7572F1E35 GABRIEL.LUMPKINS
242,981,112 *179C0EF77D8C998FE90FA9A5B9B61DFC326DE7E1 GABRIEL.TESTANI
242,981,113 *179774F1DC8A37D6399180D1558B18FA4AB567F0 GARBOWIT9
242,981,114 *1796CD73F40CDE1D19326CE03FC153A868CC5146 GARCÍAGALA
242,981,115 *17918E295A1BEA7AFA1CA112BC9AD80928E3A72D GARFIELDKRUPSKI
242,981,116 *179993CE6D18AE905972D58E2F54CEEA2B186C1D GBÓBÌ
242,981,117 *1793073FDC21E46CBA4C5066F9EB62CD51B486B8 Gehkacken
242,981,118 *1792654E33E2792E963434BED8D35D00FF496FB5 GENO VALENCIA
242,981,119 *1799920B2246D766565637C507EAE4802F57F914 GHERCEANUC
242,981,120 *179309214B3AC715DBCFE276F6112F88016F9B6B GHULAMIN
242,981,121 *179EC992BB61680FD054C010D5A6B03B4EAE293E GINO.PALINO
242,981,122 *1790A93C8AC1F97A853C5C5A04D5BD4737DD665D GLEN.RIVIERA
242,981,123 *179466B5C16C8E24B512E593AD39B4CFFB7A92C8 GLIDERLASS
242,981,124 *179C79FD8B6E86CACBA9C86C6441E9AD83A457F5 gold wedding
242,981,125 *17929C5413374B1A26BBFF6296A2EF88A423FDC6 »GOSPODAR«
242,981,126 *179C3289EC5BBAC3B2877AD6F1B4FD98EB4AC561 GPBG
242,981,127 *179B6F76C99CB99B8D386B8FDB2D265C3D838209 grimier
242,981,128 *179EFCEA243734F44F177579DE9D625DD3055CE0 guanjoe3
242,981,129 *1792C956D5D0C81B4AA6DAF549227C0BBF4BEEDF GUZVA-1
242,981,130 *179BF40AEBFA91EA673E3033108788EF0B4CD2E2 gydelle3
242,981,131 *17989EFE1F6DCD11C080795B13BDC97E409FF2C9 H145469
242,981,132 *1795FFD1660546EB281DB628AAC53064B5819CDB hangontoyourlife
242,981,133 *179E993C4CC7C80809F1E248FB80A32C776A3642 harris.azhar
242,981,134 *179F87C0298221A1F769CFDED674A5124731C44B HARRIS.DORFF
242,981,135 *179F010F4A8CE05FC3AFFEE046987624DF8AE934 harshikashah
242,981,136 *179F9A0E48D1BEF04DF0E1B00A727D6067C65CAD HAYDEN.APPERSON
242,981,137 *179A54744B80CC4F50332F6045A73E78DECBAC04 [email protected]
242,981,138 *179C0BBBF76A1D7F886C5FEB3FA90952AA2B7FB4 hectorstusse
242,981,139 *17932A867CAA031C6DABD86392FE99605EA709FC HERB.AVALA
242,981,140 *179DB4019629AE4DD93DC3A119A26BAFDD3D32FB HESOYAM007
242,981,141 *1797D5694FFB43FE0CBC56732D8FD6B5E7EE97A6 HIGH-VOLTAGE-(LIVE)
242,981,142 *179C6E1EE3035FD1A38AA8D2D863859513CCE413 hihukuil
242,981,143 *17902BE8EB259C83B7B9D836ED5D75C6A8AA453D [email protected]
242,981,144 *179735866473D666A5AFD5EB3201579DD821BD07 HOMASOTE1
242,981,145 *179349301392972125675F40C1A3D85E96DFF4A9 honorinerony
242,981,146 *1798867F0664771BD64F70D82D0BAD200F4501A7 HORACIO.WADLEY
242,981,147 *179E1DBC41AA5893517F654B222F234C71F86A3A HOW-MUCH-IS-POSSIBLE
242,981,148 *179B6CDC0002CD0CC0E4BAB280146D4C444B6947 HPAREKKAT
242,981,149 *1799596E50B62204E38966428720E644948F9BCC hptndtg4
242,981,150 *1798C33BDCF1348238C791DAAADC9A9815AD0861 iarettils
242,981,151 *1798ED630028D0B14DE8AA26043F245D7C4948D8 IJ%E
242,981,152 *17951409E998DBABB52FE0E2AB9D0DA0D0CBE1CD illeffacing
242,981,153 *1794D414E7608CE269F1182A24251CEB273793C5 [email protected]
242,981,154 *1794F05BC3349A70D92C8C3492763E0C3D6ED4D4 IN-COLLUSION
242,981,155 *179EBA898A22BF9F0C3699054F97001B3429146A INSTALSSEIS1
242,981,156 *1799F40B3D7A5A2F67A61B9307B99A416848E598 i:;q
242,981,157 *179D5E1F2AE0ED13DD0F96DBBBB6EB97ED965BEC IRENEWELCOME1
242,981,158 *17921D12222D032CB4A26ECD79EFF8A42331F557 IRVING.HAUPTMAN
242,981,159 *179AB4AE11F68A06763601B89C32D9215A499E8D ISARAPNUED
242,981,160 *1791EB2E7EB6EFD89B449ACAB1CC3BD252A131C5 IUHF
242,981,161 *179641EE8F894E7FCF40CAB849375F67CA3D9D51 IwillnotdieICANNOTDIIIIIIIIIIEEEEEEEEE
242,981,162 *1790E63D52DE3CB38986A052E0C50477E02AC7BE izak-potgieter
242,981,163 *17970F8DC300934B11AB68EB9FDBD0339AFF5781 J119107
242,981,164 *17958CD32C04EDBEF3E8CD77C11EB5A7DD2D57C8 jacinta
242,981,165 *179BCF31F38A68C8CCBCF90D3B90FC1260CEAAE8 JAHNAVISANKHLA
242,981,166 *179FF41E4D9F2110FC3F179A55577F86F512346E JAIMEKREINBRING
242,981,167 *179E8319559DFF0990CEAB00E09978A498B7841D JAKEFIALA
242,981,168 *17942233AA14396073D30168DF9FCDA4CDCE7A27 jamarkendall
242,981,169 *17902E639CEE67B48E68083FAB8AD8404CAD7D7A jamesbandin
242,981,170 *1797BC6BEE65E8C80DA2EF3162F8BA4BF7153FB0 JANET MCGINTY
242,981,171 *1796FFB27BD51BA045D390C8246E5ACCA3773EED JÄRVEKESED
242,981,172 *17985BBA0F0FD7CF520CED9CFF4626765C3C5155 JEANDZIAK
242,981,173 *179CB2E5C5BA9673DCA65E9E7C2D0FB9F102F088 JEFFEREY.FEJES
242,981,174 *17966E8268CF6858CFD330644E6A40899228E52D jeffrey.dyer
242,981,175 *179492FE4AEB58BE4151305EF484A6FAD598A986 JEREMYWISNOSKY
242,981,176 *1790C5BB3CBE365E2F013885FED8EA3DA586DD6C JERRELLSAPIA
242,981,177 *179932BB442F960BB0C46D516A1A7F45B58DB51E jessicapiedad
242,981,178 *179A15F3746E95B8F1ECEACA4D8B6DBEACDFE5F9 JEWELBJELLAND
242,981,179 *17918A31B6DAFDBC134718B90B23090B76960295 JFJE2002
242,981,180 *179B0EDDB942E82DF18E7AA12147DF5341D252C1 JOHNIEBOUTEN
242,981,181 *1797F5D1330E2F3B0847EBE4CD914F38FAB659D4 jonathanemch
242,981,182 *179D039E84E2B8A26F5A63F1F590B287370AEB0E jorgechrislip
242,981,183 *17993E2906E896A10FF3FAAECC56C65A7558887E JOSEPH-CLMENT
242,981,184 *179D187B1DCE7CBDA017FD4D8E81023DA2DDEF72 JOSH.KRAGER
242,981,185 *17957E6FA305F41E725B5BA8214284B221EFCB14 JUDY MICHAEL
242,981,186 *179AC04E0F8013EFC60AB41800ACED725E0D1CDF JUSTIN-JAMES-BARTON
242,981,187 *17964A237944770752C91C93E9918018AD42E604 K1,
242,981,188 *17995EB697C867AB09A4C4CDA3EE28C11D5FFA14 KASTELSKÉ
242,981,189 *179C577D468FEAE71C044CD8D9777ACE4FE87946 KAYBEARDREW
242,981,190 *179355ED37F1E7E1CA5E9CA1E3E1308E8ADDFF84 kelvin-cencil
242,981,191 *17945F987C2B5B11B0257854A42B1819B857B33D KENNY.BLISH
242,981,192 *17913AE73D06F5959F8C56B37C22BC1EA05EF57C KEVIN-WHELIHAN
242,981,193 *179EA4BBF27BF84588CEDF08C306097FC86913F9 KIM-BAGINSKI
242,981,194 *179459AE7B35F51BF959BDAB4F26324145460450 KIND-IS-EXPRESSED-OR-IMPLIED.--YOU-USE-AT-YOUR-OWN-RISK.
242,981,195 *179EF20B80A4D128017EB43D0DAB75BEDCCB6DB9 KIVILINNUSE
242,981,196 *17920D0CB3F0991A8648EC2F04002CC4F8606071 KLETTERWERKZEUG
242,981,197 *17913F8383D8611D924C3362166F1360BB4EDD98 kolik
242,981,198 *179E8E223CD75C2EDDAE7D71BC40F01927C61FC0 KONOHITO8
242,981,199 *179BCDF7109477723A39C00235ACD22DE2D4B2CA krati.nigam
242,981,200 *179B9D16E63EA2936FC9500947A02268CD4458FA KRISTOPHER.RUMER
242,981,201 *179CA794E41E9A06AFA24C16B818441F8102C84A KUMARESHVENKATESAN
242,981,202 *1799468B4E1B6C36282DE7796296405B032F2D6E KUNCHOK TENZING
242,981,203 *1793306121211E611E9DAB332CDB1247D37A8F6B kurtisconteras
242,981,204 *1796AFCE0EC3B33117D26C6252FAF55B8DFAF496 LA-GUITARE-ENCHANT
242,981,205 *17999356630A5C1853E6E71564475744F40B0FFD lanceroulston
242,981,206 *179C3D5BAF1E6353EFB924FC3040D0E8ADCC826D LASHED
242,981,207 *1796F2E218F63B69741079024C023A2DFB72B386 LAURAGUSOIU123
242,981,208 *1794F1080C3941ECB0F43D84655F8E67B470CBFD LAWBASSETEDDAMAK
242,981,209 *179DC4BCAB5594EA355891DF12A9126E127EF84F [email protected]
242,981,210 *179E47CAE291D07F2096E2F77B3C1D2E2C60E16B LEDZEP%
242,981,211 *1793DB7BFDBD60D3FDFD4EC4354AA0D953F04169 LELANDBENCOMO
242,981,212 *179095A4706D3968D5ACF7F8461A1D1C2CC63B0A LEONEL.DENHAM
242,981,213 *179CF1B481F06B5C90A9E1469303B2B7FFE26EE0 LEVI.TALIFERRO
242,981,214 *179BB1ED37DDBE5885DF241042D822EE95CFF747 LEZADAS6
242,981,215 *1799C19EC3CD9D431461031418E57C2BAF1AC5B9 [email protected]
242,981,216 *1792143A1D2753BAD31D8FEEFE85DFC01A077D12 LIEZEL-PAGLINAWAN
242,981,217 *17951F3102A80D6E16145C0D59ED2249A7950657 like.this.like.that.(club.mix)
242,981,218 *17945F68B950F59CD1289DE73C75D89A0A5A564E LINDSEYNIRVANA
242,981,219 *1793FC5B0B7455A06FD6843AF6D618B1E122C80A LITICENED
242,981,220 *179D9B0D42D9875773D80C5ACD9BD3A6404DAE50 LITTLE.TONY.-.CUORE.MATTO
242,981,221 *179576087816A80B647DD056A545D136BB67BC4A little victor & the vistas
242,981,222 *1799B4126823513FC9D449490164FE34F6B6C0C9 lori.goldfinger
242,981,223 *179D78CD54E9DE76CB75EF79D7F158563F31907F LOUASHLOCK
242,981,224 *179C9E416E004A26CED03486828D07F8691DEF5F LOUIE.MAINARD
242,981,225 *17902E8A5CBFE7C83232292675FEFAEF856D4960 LOWELL.PIORKOWSKI
242,981,226 *1798E2745F09844909ECEB6B4B75059E8995EA64 lugia15
242,981,227 *17996F55FF8A6CC011D365DE5805F0D3A13986BF luigiutzig
242,981,228 *1793F60E564C9CB325334E9DB896E673DDE53F57 LUKE.DETTER
242,981,229 *17927E839822BA9985E218B4357719FD18016B62 LUSTER
242,981,230 *179E53DFB9241133CA3879F34F20D59A27541D79 lylephariss
242,981,231 *17965DBFE432386721F80766B69A3E40DB92B0F4 LYNWOOD.GUEVANA
242,981,232 *179F1A668518C45609053DB57D03FD5D4299C887 m0n09am1st
242,981,233 *1792C5896A1EC821323980E5D5A953EE028DE03C M9Q&H
242,981,234 *1795169BC9DF64381131F8F69113F0F80FF9007F MABEN3
242,981,235 *17950C18113875442D5384A2CF0048B577FE0F75 MALEKSANDE
242,981,236 *1795EDA2268A5FB6B1D5D1E41D56FE8F80D0EBB9 mapping
242,981,237 *17932F0ACD0FFF25B8D158143738D8054043CC94 MARCGLACKIN
242,981,238 *1792B9FE9B8AF9518A2717B5396947E365A5456A MARCO.BROOKFIELD
242,981,239 *179F6ED9B8A04D1C6C5095FB6C1CFAB9E46E3FB2 MARCOS.MELDRUM
242,981,240 *17920ACF0F50BF93FA4EE141F108F5EFF93B88F9 MARGARITO.HILLOCK
242,981,241 *179D8C8C62461FA4D096F0AF5A39C43AF1E89C29 MARIANOVIC
242,981,242 *17916662459B88690609D9D8A87448B5B9EEAC1D [email protected]
242,981,243 *179224E6817B3244159D915DCFD1B0B5D45B59C8 MARION.MACHENS
242,981,244 *17972B2A2CE5803BCF8D0531BD1503850FF1E6A0 marioshortridge
242,981,245 *1795882D4EB9F81C9A657CC8888B42B4EBC67E8B mark:mark
242,981,246 *1795AEF432470F7A123A13383FDC4F2C59999F33 MARKVV
242,981,247 *179EB93E485784EB6F5FDF787177A1B1E28D9503 MARQUIS.ZAITUNA
242,981,248 *1798645E6EA5B09093423CB0B2A229E0EBBA06E0 marshallisassi
242,981,249 *179D3BECCDA26CE8173516D0A5AAC805BE752DB1 martyschanck
242,981,250 *179287C3BBD03F2776A985C312621E14BD7CB194 MARY.SCHNITZ
242,981,251 *17931A90EB1F490015F76759A9A1B98B3F2AD61E mathewgladden
242,981,252 *179F1907903FE47E94FDD6E267DAA39168833450 [email protected]
242,981,253 *17981A437CC105D8E4C766A221A40BBF1EACBAF4 mentiune
242,981,254 *1798EA0DDEE203A359EB89DF87E7461F38077A31 MESZOPEN
242,981,255 *17913AB3479B801FDBE5F259BB70FB1EE192BED7 MHRYNCZUK
242,981,256 *1793DFD4B13685C6B2FCADE3E3DB585588675514 MICAHABBASI
242,981,257 *179BEE5B8376A4B11A4A92825EAED78A79B0BB02 MICHALE.MIGUEL
242,981,258 *179D42BC79EB2A28C973E7D8907E1415B7804612 michelcindrich
242,981,259 *179441A72FFBDE75DA929BB9F5E731AC18DB7B9F miguelarmout
242,981,260 *1799F41B2C4E58CE6CD3AF3C798D66E14F7914CF MIKEL.FOLMER
242,981,261 *179FC15AD8E696BA0DAE45C3E12CDBF89C91AC85 MILTON.MALLALIEU
242,981,262 *1790E65881932EFC955E8246F0F0B30F9319F898 mimilazo
242,981,263 *179B9AA46F73F2A6775BB4C0E2EB8243D102FFBB montebethel
242,981,264 *179677630039902319F6A1D035FC113AB71B8CB6 mortonbawner
242,981,265 *179E81416710BA1ADB323D587D8BB55813C6296D MOSE.WUITSCHICK
242,981,266 *179DE443BE3D6B57A99C0A7CA616B6A8C22254C1 moslemism.
242,981,267 *17943C2AF4353BA8F1436229C30279F64AD71D69 [email protected]
242,981,268 *179E9B57297B6D9915D0ECBE76462B32E1897D14 MUHAMMAD-BABA
242,981,269 *1794CB17C656751EFA0E1933741304C83D43750B munsyi-bahasa
242,981,270 *17972F799669CE57B034C4C3E88759911D4D66F9 MURTOPER
242,981,271 *179EC034A31447C048AC07B653FB9226AED212D4 [email protected]
242,981,272 *1791C3134075929D9BB35450A9603AC613B09BF4 my1017com
242,981,273 *17979DF73AB75428CE9266AA50C108F66ED76984 mylescashour
242,981,274 *179AE6DB185761815A4D3A3AD3346038D26A3371 MYNILDIA
242,981,275 *17956C06375048074FCED8156E5FCC9986BFAEE7 MYPOOKEY777
242,981,276 *179557280410DB33CCB974C952F1796540AA2BE7 MYRANDA
242,981,277 *17956B4334CE8AC1588ACCED0FB14573EBECF0B8 NACHDRANGE
242,981,278 *1794151D8A4A2818B5F86629E7DDAC64213163B0 NANCY-BURBRIDGE
242,981,279 *1792658AE0A1B51F72A77C6E8D7C1B4A8E9FC4DB nedgelmo3
242,981,280 *17917BC09BB8CF63915388517AB41E869B2D71EE nhrg
242,981,281 *1792AF2FBBDDDBDF6D8C002AACCDF8E4414FDC75 NM0736664
242,981,282 *1795EAF698B44D9FD4E61F60BC3AFE625EE4B0BB noahabair
242,981,283 *179153C04072D4D91AC581359C36C71B9A6B3DBC NONSENSE-MUTATION
242,981,284 *179822233571D75B2673E49593191ED2F92ADB5F NUCLEAIR!
242,981,285 *17992E2AE87C0259BF9A24483E840FA2B2E3B833 o.Consigo.Ser.Alegre.o.Tempo.Inteiro
242,981,286 *1790873F44B6990A7A3D1430227782B470AF9440 ODURAGARAN
242,981,287 *1797877CD9A520ABC1A4DDB642FD5F784F0ACCFF [email protected]
242,981,288 *17969EB2F32F35604E8C8A19ABCEBEA1FD8EF547 OKHALILEH
242,981,289 *1794DC1F179B1C75664989594E91D60CA9D8345A }O{-O~Q#B
242,981,290 *179BB489CDF0FB35A7FDE63311F673ED087B89A4 operation.tiger.(1997.demo)
242,981,291 *17941D2E9D8A2B2C8AFC4E1A7E3A6008999B2AC9 OPHDAA
242,981,292 *1793F2715B671EAC4487798E9B011463EE8B0210 OPINIONGORDAFARID
242,981,293 *179204DB6D3484B0EA999B506663C7321172E45B OPSTOP
242,981,294 *1795C3C9CA746DD1ADCCEF7BF6EA657D4A67867A ORELR1L
242,981,295 *17989D608E5CA32CCAF7D92B1428498E7E1FE1B0 ORNAATSING
242,981,296 *17951DE2DFD7161AA6A680729BBEFADEFE462DAF ORVALSTORTO
242,981,297 *179C7887A25D17281A94F024A777A378E5075A00 ORVAL.VASIL
242,981,298 *1799908EC02025E5DE6AAB7830779F543983DD6B OSCAR.QUERY
242,981,299 *1798318F9C9C6856783B19EF05F3FAC752073E87 oteibos7
242,981,300 *1790B03D7FF34D0B0303F7C50E73C8DB71C9820C PACKAGESTORE1
242,981,301 *1795C2D25138F189842530AA66592874D718EC4F PARANDESATRANGDEH(FEATMANJITPAPPU)
242,981,302 *17951C2A4CA6086CA32CA20676B8AB2834014D30 Part2:TellingTales:Chapter2:DryTwist8
242,981,303 *1791107541947883D73D419C7B65D8EF4708C8B1 p###B.~O~o.)0(
242,981,304 *179BAC491D805498153C75A73BFB345BEDA84C15 PepperKeenan
242,981,305 *1795068685B4D339954ED8E125389CBC09BB76C7 PETUNIADOOKIE
242,981,306 *179B9057308C1A186AA10F0E628255B0E0BBC270 planta.de.depuracion
242,981,307 *17929A49D1248CBAE7EC0118E72B26B7ED363E94 PLICAE!
242,981,308 *1796E2BEB13572809AE70B1BC5308E0FEB77D76F porfirioceladon
242,981,309 *179DAA657E8AE375CC9ACABD8C7416519E6A8950 PRNMNTD3
242,981,310 *179AA3F2BA31FDF1BA95B4B93D5F869D36643C60 PULUT-LEPO
242,981,311 *179BB8A946271FE8CD7EDD8E8443EB6BF3CDA624 p####)*.*.*)x(
242,981,312 *179AAA458944CD9F218B5FE900ABB99663DF6BA1 PYLORALGIA
242,981,313 *17962F3F465113C50D072E8CB8BFE95529533C3F [email protected]
242,981,314 *1797DE704165E2B66D4854F9D7D390556666A0B4 QR\*
242,981,315 *179632A40DE465F393AA218EABEB5E7F3329EF2D QUASI.DESPAIR
242,981,316 *179A25F18A3580646562F4B2D3B626C7C3200EDF [email protected]
242,981,317 *1798427CF202B6C54C60DDF76803F6BCFCCE8EE2 RANDYLUCCI
242,981,318 *179562B1045BB2DFEB8E870F694A77964476A9B3 RAULGIANNONE
242,981,319 *179EC7514CBD805F6348E1E30683804A6BD4841B RAYOUMA1995
242,981,320 *17953191D81DACEEF99D9D69948340CB36DFD0B9 RDIFFBCKUP
242,981,321 *179E14ABDC0D82480250BE0A7BF121FA97587260 RECERCLER9
242,981,322 *179A9E64D5DE350F8EA91138C069B0B419833A01 releasechimpsorg
242,981,323 *179B8CDA6C49631B89F66E65B1EEAE5D328031F7 [email protected]
242,981,324 *1793AE40C7CDC2B1935878AD9D9CA753516A8B08 [email protected]
242,981,325 *1793EDC3A8068AECC961F157F89020EF4C5A70B3 RICKIE.FORNICOLA
242,981,326 *179DB89FE8DA0E5C2A3E65B400B746044935D36E RIDE-WIT-U-(NO-RAP)
242,981,327 *1793227182BA501C8D75BD7F9D0FE1715F1FF8D4 rivervictoria
242,981,328 *1792496F2DA76E638C53DC04B1D72A23A4E61C3A RJMHDW
242,981,329 *1797AA03BBFE49D0C3367247F59B74FFAC252B26 [email protected]
242,981,330 *179BB8B60C8E249F2B9B93D850407CF306D2B1FF RODEURS9
242,981,331 *1790B7D31D26B17C3091115D0E6530473D1E755D RODLINELINEUPLIONLITTLE9
242,981,332 *179A20276BCD5781C275AE68EBE664D7D5372F4C rogeliopattyre
242,981,333 *1791331AF31326381F2566FF6702BE6E19C21D60 ROLANDPRIVE
242,981,334 *1795F6B4203AC5A34442513E77A8D781065C244C romanfequiere
242,981,335 *1795D027A65D3938750EA3FD3FCD04E5C04B8867 @@roon2006
242,981,336 *179F4DF2A62BDAA7AB6FE149F764DB052D6FF415 ROUGH1O4
242,981,337 *17932436C32D5E54307DE35B2D4EE1FDEF6CA070 ROXYVIKING
242,981,338 *179AE6431F9EC4585ED444C6DB6895B2C48D7F7D RUDKY160
242,981,339 *179171ADF3D4AB3800FDAEEEAAB340689341B5BE RUOKAINEN
242,981,340 *179FD9CD8172C7B5643D5E41B3290755A96C57FD RYSEKATTANE
242,981,341 *179CEBBED692D08C6B9BB986A9B0CE8DDFF7E0AD SABRINAGREENDAY2
242,981,342 *179575ABD00CE946ABCDDB22381833D5D3F83041 SAHIRA.ALAM
242,981,343 *1794070FE309366F000252846115C682C14E9468 SAHIWAL2
242,981,344 *179B3B125861F7966C64B0FD3A82141180CB59FC [email protected]
242,981,345 *179093EB066E516CD3FF75365A85D1DC9239D121 SAMMIEMARTIEZ
242,981,346 *17990EEC330E5E86E5079668CC93F2AA3E5D4B2F SAMMY.ALMENGOR
242,981,347 *179E68B0404386B93A9BC3549E9D06970CE7ABB0 SAMMY SAUNDERS
242,981,348 *1794330273382E3881E5A7350A477B55DAF93594 SAM.ONORATO
242,981,349 *1791A38F36649241FFB01C13D74344C851FED467 samson uk
242,981,350 *179231FD568606EB6DEB901218AB214FF2AD9FBC SAMUEL.FERNADEZ
242,981,351 *1792D5C727BDEB661C36BAA5304430ABDE312D19 SANTIAGO.TOMEY
242,981,352 *1796EEE624657A298B7E43421F77E2DB6B4914D6 [email protected]
242,981,353 *179E6EED2A799BE06E12DAC35C3320A8F46D95FC SCHOEN
242,981,354 *179B32DFE15ADD16AB5B4E24E8EFDC323E2AFBB1 SEMINORMALNESSES3
242,981,355 *179E682422BF9A98D4731AE77EB4C577C23EC707 SERBIA1993
242,981,356 *179F7FCB9B98C038964E3094B548ADC72E561522 SETHDEFARIA
242,981,357 *179167C62FD2BD7F342185398A07C5D797FA1402 SETH.UNNOLD
242,981,358 *1792744839D0DAC16D6DC6C2BFE981D1152A75FB SFDAAA
242,981,359 *1799D90E279EDA0DA360E8140A2EA102D5D4B8FD shane-douglas-atwood-bishop
242,981,360 *179FEE65D37BDF06C0C8AF277016DE184D32E3E7 shaneheidenreich
242,981,361 *179BDCE2E6E4C36E892A606491F86AE4E35BF9C3 SHANNONSTONEBRAKER
242,981,362 *1794BC538DD797D39B81E9EFD49500023D8F55CC SHORT-TAKE-OFF-AND-LANDING
242,981,363 *179EBA7B23489B0C74A92788EE2A5360FF8E3D76 SIDEN0+E
242,981,364 *179F7DF996465AD07BFD00E928A7CEB5F83602F5 [email protected]
242,981,365 *179A2015F36944E92D9E8D751CEFF33B8EE9BAF7 SIMPATIZZAVA4
242,981,366 *179ADB0429912EDFA15591AADBAE18103DCEB0CD singinkop
242,981,367 *179031C27E695E2011304AABBDC3D3EB66A2C6AF SLACUMBA
242,981,368 *17996468BFEB9AC1C750BE9EED60765699663A3B SLÄKTSAGOR
242,981,369 *1790840DBBAADB094899682BC032584A0C7F9A5A SNPROBRKHPE0
242,981,370 *179A2565A935C7581CA96916C26F1C2F06CE4D15 SNTELEM5
242,981,371 *1790739CFFAA30EBCB7431A264A7703785B36EE6 SOARRED6
242,981,372 *179F00FA88704FA68B6CDDC16009F76EFA64A406 SOLCAVAM4
242,981,373 *1798EB9A9F5FB419656A1E48BD6324CA3CEBA9B8 soneto de separa
242,981,374 *1795469E41CCF0FA24FFE18B23E36C166D826DB2 SONNYDIRECTOR1
242,981,375 *179CA9074842A65C9E3579601A4F30FFA84532E7 spencervanderveer
242,981,376 *179E97D4E828669B0785BB7BC4F99080F88264B7 [email protected]
242,981,377 *179F39A6ADB7BDA9A98D02730F76194FED7F6CE5 splat * (p
242,981,378 *1793B4E6CA51BBB0C42FA5EA44AC8126B9CB7322 [email protected]
242,981,379 *1796C094B1BCFE2140CFCDA08035C2DCCDC19BBB srinivasa.desikan
242,981,380 *179175EB9AA82CB1D7BF84CD72B66EEBDCB40677 STANDARDBABYLONISKA
242,981,381 *1799B5166DA54EA999C98C59EC9E6281BD746E26 standing.in.silence,.part.8
242,981,382 *1798757730E75B20963E2635D0B6C007E99FBFD6 STANLEYSTOOPS
242,981,383 *1799DCC7BD565212E0060386EDDCC38E38BA624C STEVENPACKER
242,981,384 *17984620EB7B52B84695049510D61AC4A4C2B5C4 STEWARTSCHMELLING
242,981,385 *1796A28CEF6369675BF6774FFAFFBD48C7E31598 STNEICSI0
242,981,386 *179123BCACFC9578CEFC425EFF30739302F14113 STOOKERNING
242,981,387 *179154024F9D0E585EDADDBC6F169F1C444B77CF STORGILSTVEIT
242,981,388 *1793149125C9CE2F74ACC7E7AF5D9F8FBC43CDF7 STRUKTUR
242,981,389 *17957043F8BC657BABE4B434657011A2D7918B78 sun84+hng
242,981,390 *17908493739FEFA778AA3C10FF65BE1C1AA2CE6F [email protected]
242,981,391 *179D147E5BA5F067EF4A49553EBA4A157C0D30CD SUNINMYPOCKET
242,981,392 *17958744B088845C82909C12E9BAC3642D5E36F3 suonirus
242,981,393 *179FE691CB79073E247C54A08B1775878CE67AD3 SYDNEY.RACEDO
242,981,394 *1799B6E1B0C0228D597D28B66C639CF4CD619804 Symphony No2-5 Allegro molto vivace
242,981,395 *17999CB4C09F510289CD8E4B44E03608B95CACD3 SYNNINTUNTOON
242,981,396 *17924E07C9FE048B61614BA0B2680751FB9C3918 $T0RI$3N$
242,981,397 *17978B2C493FD63AA4EDEF0F8495E0DEA58D5486 $T3AM-C0L
242,981,398 *1799F58D5982E1FFEE095923379F1A45E0CB6581 telarenim
242,981,399 *1794A3C7C5EC75DEEA887FA485AD07F5A30E0B74 TEMELKOVSKI'S
242,981,400 *1793E8F6E0782AA68637C57053C48C3B22C44530 TENLOSTMEN
242,981,401 *1799BC5BA8FE9CB405BD0D892497D5BFB5DB34DA [email protected]
242,981,402 *1791DFFE9EE655CAC41BBE3205B208E0737E2A91 TERRY.REDGATE
242,981,403 *1795AE8CF598106F2B789A34CBC75C5A281A807D THADDEUS.STITZ
242,981,404 *179DB5E197BD216B0C455DDEA617652DC0021281 THATBENJI91
242,981,405 *179E37F04C579E2D592F9347ECCC512EA9E97B23 thatblues19
242,981,406 *17978E5BCFF16A791AF80B988F7B5573156155B7 thekissa281
242,981,407 *179BD54F7576ABBA8157B2ED8E7FFD1A16B711D0 THE.MURDERER'S.DREAM.(OF.PURGATORY)
242,981,408 *179F013BD22B20C4BFE2BF4BB3E7EF60CB85EE63 thenicarao05
242,981,409 *179880CB10AE301B8EF8E428E88E03C9ADB84732 thepiedpiperofrock
242,981,410 *179E30CF8636665E7705F4CA261C2C7B1F0F6143 THESSALONICAFILMFESTIVAL
242,981,411 *1792BED0EE668F8012D8E9ECDAEF799082E4337D thieve-/t//i/v
242,981,412 *179AEE64AB7653CE90C06D0ED3C6D618649DC803 THISBETHEVERSE
242,981,413 *179682D8A254008CA149BEBDF543832914AC13DA THIS.IS.THE.LAST.TIME.(BSIDE)
242,981,414 *179F1D2F0D7BDCA19B396526379B3E144242B5A7 THNBTNYN
242,981,415 *1797FAFCE8CD6528178169434C42D025C5D399E0 THOMASBURKHARD
242,981,416 *1793C7C0AE2E6D22FC30BDD65D1BC8B5BF68BCD8 thoumaystrevengeoslave!
242,981,417 *179E7DBB3FED656652E8CCAB183EE1B8A0B525B6 tiffany.rock
242,981,418 *179983E60EE74D2F453D76B6283F95720068588F TIMMY.HOFLER
242,981,419 *17953C41AAF9373B1C2E8AE9BA1687A013B42A6B TIMMYTOSCO
242,981,420 *179CD24724470EF95AF2D9B455F0EBD35E37D04A TMCTKTHRN
242,981,421 *17993D7BAB6EE868CD401AEC3EEB59CE0DED9A2D tobiascourville
242,981,422 *179E77D7385576E38BEA8DE893F5272BDD5652EF tobiaspundsack
242,981,423 *179EFF3183011E98DB0165A16F160642847359A0 TOBY.NORTHEY
242,981,424 *1794577558C437105738DB148F3008FE46FC48CA TOYJ
242,981,425 *1798818DDF8745001600B67062E18BB7C0110957 TRENTDAHLINE
242,981,426 *179AB18E40D5DF1C79355C419AD19E5A240C00C9 TREYDUCKYMACKEY
242,981,427 *179358A9A7C5C79D3DCC2E6C006C97AA0FBD99BC TRISTONECHARDT
242,981,428 *1790735278D4B3425407B5326E26E0626FF0631D TRIXIE YOUNG
242,981,429 *179BDDD820750C6552566377C1E85BF7BE3DD9DA TRYING-TO-KISS-THE-SUN-(LIVE)
242,981,430 *17913BA2960B543F8913CC6E1B665E9035975E5E tsef
242,981,431 *1794540EDDBD0DB5E80DA76599895A3FD99EF2AC TSITNEIS4
242,981,432 *179C05AB48DFF8FD7C55745CA3F3666AB1DCA572 [email protected]
242,981,433 *17902959F310CAEA69034E061A0D73E05EA2B27A TUOMASVESTERINEN
242,981,434 *17975B6533FE1DD31A7CBAEE8733583791D3CE8E tvanyam7
242,981,435 *179D9FCCFE7C19B2EE48F6564165FF78118F5657 tylergreir
242,981,436 *179A148A3E7921F1F8B91FAA16DACB47F03DA7EB UBEROSES3
242,981,437 *179A14FC6B6D1A13B81C79480B595A0F6D3381AB ubeskrne3
242,981,438 *17959BF999AA799704474AE2ADE470F478014C4F UCAY
242,981,439 *179F703F0F038033C24379609C4EB91C9FB53CC3 UITBEZEMENS
242,981,440 *1794728A0968C6B33BE08D8B42D92EFF9A30755E ujgbttnm73
242,981,441 *179B46C10E8EDC3AF7D68B77324D57302F424B41 UNSEPULCHRALLYV0
242,981,442 *179A8D874281798419E8DB372BDA67F772CC8EB5 [email protected]@TIVE
242,981,443 *179AA303C6D93854F06D0E584E48F50F89ED183B uopncxb92
242,981,444 *1795E49F8B2953A3D2C50A52CD8FB0929CB5E2B5 USERMIKS110
242,981,445 *1794579980B0720099E20237CA963CC0370E632F [email protected]
242,981,446 *179A0F2CCB3B77A19CC7D29E087CFE308A5D038A UTISSIJ4
242,981,447 *17972CA0901E70385375AC5CF72081607E6E8067 UZG2
242,981,448 *179A0B43A6D9172F38C50CEBF5C3445DFFC7AE1B VALERIEEAGLESTON
242,981,449 *179D0972421CD836DB0D730D35608B9F197E8BA2 vanessa.zoia
242,981,450 *179D5AC9B91AC8512FEF89EE769E5C20C52DDCDC VANGBALLEN4
242,981,451 *179B57EBD5350763A08ADD425E5F12D7A2087E1A VENESSACASTRES
242,981,452 *1797A6E092D00CBA9F8D6CC88ABF08DDDD97F8D9 vermeiltinted
242,981,453 *179365122AB93E1D2628CEAF9AD8E9FADA7962F2 VERONICAMICHELE
242,981,454 *179D514A40C50D8AEC1EEAD5C3EDC5CBD6DB4B0C VITO.HAISLIP
242,981,455 *179A10DB8D600A98ACD3CF028993F2849C15763E vivian-jiddou
242,981,456 *1795EC4828D04E8C3E16F8EF888E51752E3BE1D3 vivienne.aboge
242,981,457 *17959AF5C526EA85A4D66B39F302A5649837C475 vnai
242,981,458 *1799687358CB82B67F0C58E58ACBCCDD0A7FECF4 [email protected]
242,981,459 *179226D8EC76119921D242A819A4090BFF7C8901 VPANASKAR
242,981,460 *1792340CCEADA9A66736C86CBD6B843506D79BDC v roman 5
242,981,461 *179471F7833D1D35C3BEAF9C8525C9AD4FB4BD4C VRTABSW8
242,981,462 *1792E895C0762F5FD865ED7FA40542B74807083B [email protected]
242,981,463 *179B3E40DFD75F8A448769E572E3A2D19A32E7A2 wadesaari
242,981,464 *1794463527986F33188F10371DC237B370CD07B1 WANGCHENYU
242,981,465 *179B7A78888092E0231B3CA533C888A8C1B826B3 wasim.khokhar
242,981,466 *1799B4EC2F459BEC1065319BA9FCBB4CEA001475 [email protected]
242,981,467 *179BA7D3F8EAFFA18B46BED99707BB8D4224B139 [email protected]
242,981,468 *179AE01026FD16E6CFBC0B41A2146FB7A923962F WENNIHRUNTENMITUNSSEID
242,981,469 *17973B1316AC828FCED8B50EBB0D965524A32C1C WENTCRAZY
242,981,470 *1794062EBCCDB7B0E307E38893DD421A5D6F5E2A wesferoz
242,981,471 *179ED78DD130C06BDB573FCA5E00C42DFA2638E5 WESLEY.PELLAM
242,981,472 *179BEC641C9BBBC6DBB0F56F5C44B1DBF7C68635 where'sthenewwave?
242,981,473 *179E880F7CB4E2DF9A9BF5BAE74A3C84DA451C17 WILLIAM KENNEDYE
242,981,474 *179AF57E258EAFC1F01CF924D20E70D29000708C william.zapalac
242,981,475 *179F65AE705F92CD656E4B3375E4563734072A2E WILMINGTON-'W/I/LM/I//N/T/@/N
242,981,476 *179245C95B079EF3DC5F9997F46F14E4DA71A19A wilsondeslauriers
242,981,477 *179D40F703D98F956E5E3CA6DC93AC8BAB95D1F6 WITHBLOODTHEYPAY
242,981,478 *1799CD4484595823FD93D84309749637407144B2 [email protected]
242,981,479 *179460E44C0D96F69806C7ACCE92457532BB01AE WOLFPACKAMADAYUS
242,981,480 *17980B08FED8B243A342FFDEA61EDDA962A409F4 WQW
242,981,481 *179C8C84A05ADC297B90BF275E6EABEE331AA610 wwwsnowyowlcampcom
242,981,482 *17967A5978EFBDD0F354DE95E4568C6A4C494EDE www.unionbasquet.co
242,981,483 *17928B53C7D60581DADE5C3E2933FE3D9310F8AE wyne.jill.jopson
242,981,484 *17918343E6035603B309AE9F701B63CB94410E6A WZD%
242,981,485 *17979EFB098F3240B741C55CA090EE3EE4853CC6 X27E2A
242,981,486 *179FB30ECEED1395302E4C8BA356CC5E1B2801EE )x(~~~(8
242,981,487 *1794D70C365CEDED702F189AC425BFA43ACD422B XFPRESSMODIFIERBSWS
242,981,488 *17952099CA2AB6FA5DB4CD1F6F8EE25F34062E3C [email protected]ecn
242,981,489 *1797D58AA0EA574405C0CF9F6F8AA133A24A214D XIMENEZS2
242,981,490 *179B3C33521D0FC0DFDEB3A5F4B306205649866D [email protected]
242,981,491 *179DF749A10010B40F3DEAAFC862FB2C5AC4542C (x)[email protected]
242,981,492 *17987AD3546E1B6E3C6088F53F0B622D3A03D7A9 [email protected]
242,981,493 *1795D4FE660F8D76F574386781A13A4B17E4942F y0xk
242,981,494 *179F72E1EB86864C1020C8354B112EDFA2FD507A [email protected]
242,981,495 *1799C021A313CAC8CED99A60BCC58D925A42C158 YANYAN.MATIONG
242,981,496 *17929DCE6C4AA129DCDDF4E924069C8010E1C8F5 YASONG.JIN
242,981,497 *179734F3DBC018F6ADD58426CE299ADBF1D5D676 [email protected]
242,981,498 *1791BA4C0D16FFFE10B71653B675D785AAFB1FB8 YONGTAO XUE FRANZEN
242,981,499 *1795CB563FA4E5C331C5DE197D0F24F9C353E98E YOSIRA.WU
242,981,500 *1794756502C68D8462E848711C4CA0B33363CF94 ZACHARY.BECKETT
242,981,501 *1796839BBFF3B34C339E2A23081AF1B077045B5B ^ZEA
242,981,502 *1796B117BFDBE0E06A67387B296AA5322AE0258F [email protected]
242,981,503 *1792FC79216795E1DFDD903BB66E17F5194E5C2B [email protected]
242,981,504 *179BFD4B857B14693101DCE33560EE6A4E4290EA [email protected]
242,981,505 *179F15B923399B2FD0330CE8AE4241DAA32B4803 [email protected]
242,981,506 *1790219BEACE2F5A82A75D3CAEBA9BC84D69E1EF ZIZOUICHIGO
242,981,507 *1790C4812510A3AA7C04FE15BEBD304E7D711099 zorganize-productivity-consulting
242,981,508 *17984C3A8784CBB73E6E09E95D29C53F9C32B7D9 ZVI.YOM.TOV
242,981,509 *1793C3127D0B2D630C23E98D79AA4D64A4D88B29 zweu3uof4rvn0a
242,981,510 *1792B98E5F5E890363FF5B44F84640914ECBBCC0 zy&e
242,981,511 *179A6DC92DC11D2845243AE2AF1F2A7D81C1B36E ματόσας
242,981,512 *179433ED95C5D88EF271D5BF4619F1722954B5F0 ВСТРЯСЕНИЕ
242,981,513 *179BDD6140A481481D1AEFF223108CDA2B3272F5 КРАСУЉИЦА
242,981,514 *179069FFB4996E1F7B078AE56C6C5D31FC3DE153 КРИСТАЛІЗУЮЧИХ
242,981,515 *1791CA32CD9C977A20682D39930008E449C81A88 РУЈИЦА
242,981,516 *179A3EEAF421858EFD272B02909E5C26D9A83C88 САЗЕРЛЭНД
242,981,517 *179E3E1299FEADCF95906F5816749E3BBDE376D2 ФОРТНЕРОВ
242,981,518 *179D63278BA85DCB95BB9D53C4A86C322420B7FD ШИЇТСЬКИМ
242,981,519 *179CAA70C89EC6CCD05DE492A5EFFB894222ACAF  БОРТНИКОВОЙ
242,981,520 *17942040E341ADD8CDA67914FF21981A55856934 可以删掉了。单选的那个,我暂时还不知道怎么做,可以等FDCN来看看。。—
242,981,521 *179134DA9FBC73592DBE77ED4DC544ECBBA3C040 が当時使っていた速度が200MHZで、
242,981,522 *179029B8723018D1F2ED80767FC1607385132F2A 革命發生時,j沒有發動11革命的功能,改為4、6或7。
242,981,523 *179B6B414A3310BDCAB115D0180082B60935E78C 0ILOVEPATRICIA3
242,981,524 *1794524DFB4981103143B0BBF02FEF3ABB24310E 0MOZART9
242,981,525 *1796319A9075E856208FEA7734AFFB6BB6AA7DFA 0PWCIV5EMAQSXQFU
242,981,526 *179B216FD89B2BE4451CF5F7F0B601FDDF2130D6 1276919 stoiber:erstimjahre2005
242,981,527 *179690819CD62E3C394DD91AE0682E8760490D5F 12OCTOBER1171
242,981,528 *179234692E6EFA482BAF50F907668C9709074082 1414879 WUETEND-WAR-ZUM-BEISPIEL-VERA-LENGSFELD-
242,981,529 *179FDB832513A31E26B2C02BD6C0FE345FD73BEE 14286 MANY FUNERAL HOMES OFFER GRIEF COUNSELING
242,981,530 *1798D7FCACB3EF1498939573CE517AFC61F4320F 165look,yousaintsthesightisglorious
242,981,531 *179D0ED73CC8B26D2538C50F1DF38824253CAE6F 16.LENKKIN
242,981,532 *179D77905A047EB809CEEC2B13794AA75E8381B1 187653 19.eylul.2002.persembe.saat.:.19.:.30.nerede.?
242,981,533 *179538FC4BC2F9B460A810EFB86C35793B22E172 18AUFBRECHENDEN
242,981,534 *179A08256AC7282843B6D3C8EB3787B0B62758DB 18jan1658
242,981,535 *179007B3EE65641D3ABE80BC95C2A450BBC040F0 1 AJAMISTAHANKKEISTA
242,981,536 *1792B06CF147A18D85A9E75751F405A511FBD784 1ARBEITSLOSENRATEN
242,981,537 *179DA41C936611B93675AC2690ECB463B81B9B41 1arviso1234
242,981,538 *179444253DCB752A97C6D5DEA6D3633F0C13B363 1datiden
242,981,539 *17971F5056EFF4964DF0729DE2E1412488829A30 1FAKTOTUMILLA
242,981,540 *179511163AA0C5686BBC805CFFC658AFBB37EBD5 1-FAMILJER
242,981,541 *1799C62AFDC5A1E2EA0EE2B946A75D427472FB06 1iammobydick1
242,981,542 *179018166EBF6EE7E308EBA8FEAFA82B65F4E378 1-leise
242,981,543 *17938DF6D1D083CF2C3EF690387C489809916129 1LIVEWIRE
242,981,544 *179775B94EB65482E7EF2B357A1FDFCE787CCFCA 1-MINDESTLOHNERHOEHUNG
242,981,545 *179E3A3E3B348C5DBF349D4C06A75DF708B5A8CB 1-NOREDDINE
242,981,546 *179FE6698937D2B2B055FEC8AA0C0A738D552ABD 1npt
242,981,547 *179230D3291A914AEE53C5BD6EBB7D85E7D5905A 1ROHTENTHURM
242,981,548 *179FF3FAECF5AB382835527EE544CE2D0F31C680 1 ROTUJ
242,981,549 *179538438EBF6741C7A266A60EB1F1F39CD80A44 1-sakarasta
242,981,550 *179BE8FE22F95F8DC09BD856F2E526A2B2118FFD 1SUBBITUM
242,981,551 *179B68053C4AA328C32983ADE0BD964C698E8590 1-tekil
242,981,552 *179A4297B465DE4B83887D8757BABEC39C43FA74 1 VAIHTOVALMENNUS-KOULUTUKSESSA
242,981,553 *1796E005B8ABB56F696CCD5E8884AF0D58084349 1 VIENTI-IHMISTEN
242,981,554 *1790184C6277A037AB608F5FC0F19ED70AAF671F 1.WARENHAUSLANDSCHAFT
242,981,555 *179DC034DEC1BF7F38D5D6DA85017377AC892E3A 1.WEYQUARTIER
242,981,556 *179F2AF4DF82D7F9CB149CD58C2A6CD393F43F06 1yaptIgInIz
242,981,557 *17919D527F304EED88D4A66B1F0941226E635CE0 20oseke
242,981,558 *1792B23779D969DA5AC1D47F85F4E9C945B6F1BE 21.ABZURATEN
242,981,559 *1795F7E9A6AF2BA4F257191602AA1828769ADD76 21-gonullusu
242,981,560 *1794F1F617CEFA590D48903E7595D3750A0472BE 23.06.1104
242,981,561 *179C071179F149F8BC26A4EFFC16F218C2FDB75D 2752921 N
242,981,562 *179EBBEE89549D52C15B78A5ABFD7516B521F900 29021 jumalan.sana.vakuuttaa.n
242,981,563 *179BF8D0745D5F86F5B11D1EDF199E6E57808967 [email protected]
242,981,564 *1793247CB8817AC80FB0C1CCB17B47E8859C2013 2CROPPERN
242,981,565 *179E2B1C12661A7CB4E1E8B39EE9AE84BC877E62 [email protected]
242,981,566 *179B6BBDA43FE1B2475191C81015EEA330B426F2 [email protected]
242,981,567 *17928F64A57157798E2880152B55E5BC33A0084E 2ENSTEDS
242,981,568 *179D26579E4F32C34D7A331CDD2F48DAD502C307 2ETOLSGEW
242,981,569 *1797B89FFDE0AE7F3F9B578EE48270419E7894B2 2 MUENCHENSTEIN
242,981,570 *1792D86072EF261806C8E22D28E540D6E6A4F73B 2-NEGERKRAUSE
242,981,571 *17941C6D24237CD33146E20F3C16D6D6EA3625FD 2.ORIGINS
242,981,572 *1790C0CC0604FFAB2C80243830D07DCB0BC29630 2.SIKAMOKKA
242,981,573 *179C8E0D0C4F02EBB6099B96FBF4DA53C9408C7C 2-toimiehtoliiton
242,981,574 *179DB9E20532ABECB1D381FFCAF4DAE57683BFDC 2 WESTERHAILES
242,981,575 *1790DBB11D6094EE7EF9E22E1A303CE7B6FE62B6 357BRANDON
242,981,576 *17984B024D5CDF71F4E999AB2C36E8D31BCE46F2 3607006F
242,981,577 *1798EC71E99C84B1D577C3E9647B93A54061420C 39 SCHACHEN
242,981,578 *179A6A4CF4B9758CF6CB34B4733F8812DE98B8D0 3ALEXHAWK
242,981,579 *1799A0F1E79E740692CAE59F078168386D5378A6 3b<-~ ~ <----3
242,981,580 *179F0A368C8EE4ED47F1C67AF34990329461CFFA 3B<-~ Q==P
242,981,581 *179F34BCF4B7DF1A7A30CA6554557BB11ED5040F 3D71129219
242,981,582 *179032DAE9FDA39DA053B8686B6343213EC17809 3.ET
242,981,583 *179A0E9B13B92AB8BFDD72EC1C4E15E9319CCF50 3KDBAA
242,981,584 *1790B0436D3D2F05AEF47E8D06AEA2627B1A5C2A 3.KONZERTTEIL
242,981,585 *179F6C8ABE080ED20EE1480DA76E546E0A5A6E97 3NAETETS
242,981,586 *17990DA34EC83DB444F148CA8FB99E3BA3F8D64E 3THATAIRWOLF9
242,981,587 *1797F05AC2F9EFC2361AAC1D2116F28F834C1F5D 4BUTTERMONGER
242,981,588 *179A09F7504813D46A5667FD6F1C397206ED6429 4-KAKOFONIAKSI
242,981,589 *17948670A22035226599A28B41132887F574B784 4LEAHRAY
242,981,590 *17911A8F46677AA46356476135A2B886546E2AFD 4MAILERDUSTIN
242,981,591 *179B2C06733AA36C356FECA2990E3C13B87EA3DD 4SABUCALES
242,981,592 *179957BEA34B7BEF6CBD21D968C8CC1EA815EE28 4.STEIGERUNGSFORMEN
242,981,593 *179DFEFFA15ACC0B97937505D3CFC79D40A2D6DD [email protected]
242,981,594 *1790BA79F4735B50EF7CA6E50C356C13DCCE94F6 578AMARI
242,981,595 *17926125B38B4EDA97441800299884D009F2A605 5ASOUREIR
242,981,596 *179D107CE2320676B045398785CBE6E3B38D203F 5BEKOORLIJKHED
242,981,597 *17956E630E1DBB7BBF19F7E23A8A6D90917F2E7A 5BSWBEOLBSW
242,981,598 *179F28E71886E4129C6FEA34FB46FB2844BC1A90 5EGALITARBSW
242,981,599 *179CA4542DA4F2EC13B8D673E170AB1DAFCB1213 5INTERROGATIVAS
242,981,600 *179C5C02602F25FA79F94E84B8A07400C7E07360 5REWORHTE
242,981,601 *17990D67C99B3D7A2A0350D3F537E8521541D51F 5SUPESTAGE
242,981,602 *179DFC840B22C32ACDF401BAAB5CB32FDCB29927 5SYNAFWS
242,981,603 *1791F85CE7EEFEB09A2801079A0FF61744A26218 5WOHNUNGSTYPEN
242,981,604 *17954AC157E50E00C2D2A9DA90BD7C75035DE768 699655 KPY:N.ER
242,981,605 *179C2CDDEE4FEEFF0A705385C23619CC2D7B514C 6MARKMEYERBSW
242,981,606 *179D3BAF0E7A903453D6211BF5EBE054224F6D89 6militaerflughaefen
242,981,607 *1790F655949F9431D846D7751DCCBA80E09174F8 6SDNEIRFLRIG
242,981,608 *17963DD4B37C774BE0811D4E7ADF78B167BB9CCE 6VELOCIVELOCI
242,981,609 *179898CA0EA399891AACD4D4BB03C058CA5F50E9 [email protected]
242,981,610 *179241116F8C75434C3159B6415939B03763700F 70Mg
242,981,611 *179459EED39AFD5535BF89AC819B6B9BBEEAA52C 763788 mert-becer-:-ben-sihirbaz-bir-kibrit-olurdum-.
242,981,612 *179E149486D3D0270B35A1B809ED6BB7AF38398B 7AZZUILGA
242,981,613 *17946B66C6F2B7855F53FBBE2CD51712EEDE28C8 7DEMAYODE1986
242,981,614 *17998557F973A5CB9FD4648D6BAB4C937B403E1A 7lw
242,981,615 *1790018B930F5789C99331E8D505935B0F5F0173 7ROPEYYEPOR
242,981,616 *1790309EC64FB586770DB82D3CF8EA2DFD5C25A6 7STONARES
242,981,617 *179BB9DE04023F20F2FEFC9A94969F2ACBB5A508 7thatfidel2
242,981,618 *179DE019198908CB7077B66F5D56477BE8C24591 7月20日、glay
242,981,619 *179A6598FD511EBF3E35D9BE83B438B7D1177653 8APR1903
242,981,620 *179C87EBC9ABBE1BFC79DBDE7ECFDA531AF40676 8CDBROWNBSW
242,981,621 *179A62DACD5726F0191030518A2139839DBA0B1E 8CONVOMO
242,981,622 *1797786D4F8FFF0D24A2890DC652E68359AF9EDF 8=)~O~O-{X}
242,981,623 *1795F1F8F98F0D87430682262A4749A150B5D176 [email protected]~O:P
242,981,624 *1799B26DF754966564B105D34A9064E92A4AAC9C 8####P`~}O{
242,981,625 *179FD20E1D919875CE297D6074F3350433AD5255 8TABELOPSTNINGENS
242,981,626 *179F0EE3C545131CAFADB2C1482025A4F8A1792E 8UNTERWERFEN
242,981,627 *1795D1F401F838FF9CED0205DF2779D9A996599F 8WAVEFIELD
242,981,628 *179DC8D7E5834FA39166FC15F864EB1050268C71 8XSMALLBSW
242,981,629 *179BECF7F3D30AB3CA2A2B3D94EACF1CA6717E6A 972FFF
242,981,630 *179E91CCE2EB923E580E6FC5A904F634F59D327E 9ANWERBSW
242,981,631 *179DB2837A419D02B41ADCE796B16154E6DBB9F0 9ATAVISTIKE
242,981,632 *179A650F7F44A91BD7E968817BC6287A818B5EF1 9BEGINSTRUCT
242,981,633 *1794389F4CF5AE89820752B96CC7C7F4A2A67D65 9CRUISESUPER
242,981,634 *1793C51371C7533B43D052AE8AEC7BDCD30796AE 9DATTELDATTEL
242,981,635 *17937596C252723405275F63F3D96818994002E8 9DRAGONSAILOR
242,981,636 *179C59121C8568B866132C48DD3773969AE11308 9HETERODON
242,981,637 *179C900D3C6C706FB682FC8B13AE1C5C3924E4EA 9KGの砲弾を880M
242,981,638 *1798F2CFDE1BF38A356FF36BC20B4AF7A7BCC5D3 9KOALAGEMINI
242,981,639 *179E597BA7E7FA5CC5BF8CFADC50AA2FEC5007E8 9OREMRASI
242,981,640 *1790B2C0CBCCAF6AAE17C9CB401DCBB8326BFF99 9PCELINE
242,981,641 *179B45EB2F90124DF1361CF7166A10C07AEF18D1 9pronkkamers
242,981,642 *1792C247D5E57E94DA1288241853FA910A822C7D 9REEBOKHAPPYDAY
242,981,643 *1792C81D45099D02A764F9501002CA64140B1C17 9STARTREKREGGIE
242,981,644 *179A6BC7CAE133B4B19F14E490561461C59E001E 9UNICORNABCDE
242,981,645 *179A7B4ED951E34CD497769D98791E49A94168C4 a,.+0
242,981,646 *179BA6477FE9F751B82F30C10F00BBFF780BD462 a1,bs
242,981,647 *179E3A5208BE81810823004C9C94582DEA8C2233 a2h:p
242,981,648 *179C6B863301A6B3B9ED325CCD26719C07438BD0 a2nem
242,981,649 *179E635F0C9F4A3E8438A15B4C98F8E1E3BAB978 A3E#)
242,981,650 *179AB016F99022F76B182814A67D96CA6BA9D2F1 A),6F
242,981,651 *1796108E4EBEB05F382591747149012FF1875C77 A9RAZADE
242,981,652 *179B96E92763BA9F63D7E7A139B0624CE67A24AC aa,25
242,981,653 *1797240C9B6410C3D6B04DB48112F67FE42DEF0D aag#w
242,981,654 *1791FB50E1D2731B9FDC26A1382464A9A40D2120 ABAGAIL377
242,981,655 *17969BC47A617C40445D3FEF044A5C998ACD9828 abapvim
242,981,656 *179FAF7101FD087EE0A7ED688B27F22F58DFE124 ABNAHME
242,981,657 *1791168F805927D841CB49A484B21F07B7B9CDDA ACOCHERE
242,981,658 *1790F11F26343855855AC7659BD4F735F62083E6 aday03
242,981,659 *1791EFA0188724ACF56A3BA73478E4D5614E7921 a-df8
242,981,660 *1794F633F2A19633028F3626F984DE2D23B464AB ag$uc
242,981,661 *1796756671B7F406BEF5174929BD9DB1CC5642DC a(h4s
242,981,662 *17946920F1669442DA372EC2D597A41597505CB1 ahdgc
242,981,663 *179E93B4D668C3594AE954AE5247F434B38BBDFE AHLOL
242,981,664 *179000C7871D926A0864545F4BE1D36CA566E882 AIYMOSYR8
242,981,665 *17950FCCF4E63F686E973171D0EF0DAA4B3AB2FF aiza.de.la.cruz
242,981,666 *1798A4C00CF42EEB315DCCC5CA2474687E189180 AkB7
242,981,667 *179D0C8DD7AC8CD3D3D4EC56F984176EE5EFFF0D aldi-meti
242,981,668 *17964AC21CC61AD095D2CAC1F6C6223BE137901F ALECVALENTI
242,981,669 *179903C9F249580D1C44DEA98A162A548082A2BD ALFREDKRSTIC
242,981,670 *17915F7ADFA374E8A4B2CC1FB25219C0219FE94E allgäugegenden
242,981,671 *1799520AD29597567D81533AF3C999F51CFFCE61 AllNightPartyGirl
242,981,672 *179DF076941BE4A8F9C1E19E7244D21907316309 [email protected]
242,981,673 *179DDDEDEBC36EF3F4DC94C812B9EFE91266F84A [email protected]
242,981,674 *1796681AE7A19B4B41E497096D73FED171095833 Amr:
242,981,675 *1792158100F126483170B599DB40250C4642762B annatreks
242,981,676 *179CEE8D8E5D8F0FE041415BE31795E9861D70E0 ANTOINE.FORNER
242,981,677 *179319A74220CF3695A81EC0F53EC84B84F0DD9F AO;N:
242,981,678 *1796B95CCC636EC96253B6C370E4251FFB56FDD0 applelou
242,981,679 *179C5FF39E0C0D70AC9CD88041EAABAB36B76CA0 ar0e"
242,981,680 *1798DF1025D19ED3ABEA32A54FAECD58955EA6DC aramark0
242,981,681 *179EBF0A540DFFA943C6F4FD0EC6A744B1022824 ARYAN-MALOTHRA
242,981,682 *179FC9E83E6F988657DFCC8EACF2F0EF61A7FFF9 a!-s5
242,981,683 *1791F819267BC1A9F3339C95ABE84E9132D3217C as7pi
242,981,684 *17946FFD5A358AC780ACDA6955187260980DB692 Attack-of-the-50-ft.-Woman:-Giant-Footprint
242,981,685 *17995D6D95BB5200733E948F3C657EED0F5EB6B6 a__uk
242,981,686 *179863FF535D24218CA6FB21EA44CE78C01A0531 auk5_
242,981,687 *1791895DFAB57FFF5C88A14B80E4D2CCBC549E70 AURELIO.KARCHER
242,981,688 *1795B2359403B15C24140416B6C54D7646F3A585 auspices
242,981,689 *1796F83528562EA0B18C99B145F0C95CF2E5A39A auuse
242,981,690 *179F08F71793D3EC8EF5157B52E12BEA8E46970F ax14f
242,981,691 *179EA2213E5D4822B1CD422012E66A1C65610542 a+y3
242,981,692 *1792336F47F118E9B0A325864756E485DD72C70E AZLU
242,981,693 *17997E1BD86E8EE83F67D37123651A434121FE51 B002P6TA94
242,981,694 *179DF62A2B20BC8C30576AABB59F09A7D466AAE3 b2;h2
242,981,695 *179A2E0750A1C036EBA6291ABDDDC8B62CFDF9DD B3UHO
242,981,696 *1798C63364B6DBFB845C229EB3D221B87F5C2041 B4R1Y
242,981,697 *1794CD686B2072F75D0CC14879690358ED93ADB8 B6EC"
242,981,698 *179A3E8BBCD50CBD8BC9F28DA0CE32FC1C56589D BARNEY.FREDRICK
242,981,699 *1797DF267C74D803FB7B0A3A28272F642E49C853 barneysubich
242,981,700 *1799B7A8375E513330BEBE6BC88D09470521EA66 BATTERS
242,981,701 *179A169122D84EF812FCE584A32E9E1DD5C62BA1 bb/#
242,981,702 *179DA2320751B1F4B1F0FA8E4957985B9BB67E7A b--b*.}o{
242,981,703 *179EDE2733AFF80B9B17B86E184BD547498EBFA6 BCYEF
242,981,704 *17903412BC26C1950456C1240B0A8A98BBA68B55 BDFS
242,981,705 *17943FAF0C510F973ADA87B16682511FB96946E2 BE1EJ1IGT
242,981,706 *17978A755114835E214A6888FAD399191A2BD931 beb7n
242,981,707 *179FDCD74A1C6AA57A3BD6C9B59B2183DA1DD049 Beber-(feat.-Jerry-Gonzalez)
242,981,708 *179C35FAB2E82FAB17FE0430D3308B73CE43BB94 beddebak5
242,981,709 *179272C01108FAF3C33CF2B7EB83B1CE3F6E5B16 bendihis
242,981,710 *179A5CC317F8E29C55C34FB95D0CADE69ED8DDB0 BENJAMINALEXOPOULOS
242,981,711 *1791A7C6D208D4C749ABBD187D6002E24DEE43AB BESTRICKTED
242,981,712 *179229F7FD45270B3075FF5E76C2D4546397537E B&F;
242,981,713 *179B24039EA43D8E2A7FB11F8C743135D5C4833B b-fym
242,981,714 *179419348DC82A3764E8270DA8D366AE7A763344 bg1y2
242,981,715 *179DC9535ADD21906C1064423BEF78C2C2CF8C7A BG2UY
242,981,716 *179B81FF934BB54EC0740FACB2B1BF45D48B8C66 BHG!S
242,981,717 *179DB072DCC671E612AB952D22926D0CA08E588F B.I(
242,981,718 *17955BB3AF153B9D1CA0D003FE76425FDC23B102 bk4g
242,981,719 *17949AC85AAF494B6769BFAFFD1F7562239E97CB BK=S9
242,981,720 *17992919D93D78ECEAA70D4E73FCE86B0DC050DF B+M3N
242,981,721 *1791D0BDD4B640C58F4F5FF336E7BE10F666086C bobbodenhamerandmichaelhall
242,981,722 *179E62F8E79598ADF826F237A7220B81D0C11F29 boyddejarden
242,981,723 *179C4E164F5618FEF06F568CCBE3898ABDDCEA74 BPILOTT
242,981,724 *179CFEB845F711B3B891F9322BA91C0FA345AEA3 bpj$)
242,981,725 *1798DFADF10A5482D5FE603CF2F652FBF4B29C86 b=p~-~splat
242,981,726 *179E648A0C203EFDC248B285DA581E1DC330566E bqz2
242,981,727 *1799379ADDBB78A263C40D052FA5182C6ADBA1E0 [email protected]
242,981,728 *179C8E7BA74E96E8A1E4D1542D7C3D7DC034212C brofäste
242,981,729 *179A04400E042D378B38E40E1324C7FA40BEE1CE bsiht
242,981,730 *179F823823C9C86091A921D6C521E684F253BB6E btv,
242,981,731 *17954FD9F951284BDF84080991312D40FB4FC269 [email protected]
242,981,732 *179E5EC0573DA571A5CEA48A4FFB50D6ED5E8D54 bypv5
242,981,733 *17933F2749993C4956E1334A6FA6B5183A7EA88C C0=
242,981,734 *1790CF2A5E0934871772B4AB950AC56BBE535EEF C4W4N
242,981,735 *179A3F667D03C90B4D9B8E3A9D2B8D1EA3BD383C [email protected]$
242,981,736 *17904E22E9E5E4636B7D6D6634848624EFFA877B CARLIE138
242,981,737 *179DBF0D725704BFEA8609FE302B899D9DFC7E9B CARLTONAGUNDEZ
242,981,738 *179420FD317AB4905BD5202EE2FB4A035898E157 carmelojurgenson
242,981,739 *179FBA4549FCE82693B65747FED1756217D6626D carmen.schafer
242,981,740 *179441B1BA3B9D7580EDC34743CBA47D1800A56C CAYMA
242,981,741 *1799E489CA60BC87206E451D6AD1811F714F7135 cbbsv
242,981,742 *1792AB320B658138A7FFE8393BA63AEFF4B72DB3 cc5)"
242,981,743 *179E649C5375B3EEEF5E39F068CF17DD03ACE75A ce%7
242,981,744 *179CDA0557F41878FC940E1619B124ABFB47E431 C$F:C
242,981,745 *17957A7EDFB28F9740685A20FB2A8661577D516F cg03s
242,981,746 *17925296EB52BC15CE71A11E84F2BC60F980D91A CH3CK3R8O4RDS
242,981,747 *179B31D201A47DE853D5DD368AC2213CCE3603E5 CHARLEMAGNE´S
242,981,748 *1790FD45C996F2E104CAF0714A37F6371AF09AEE CHASAPIDI
242,981,749 *1799A573C030A8FB002A644C26DB9AA2B01230DC chervenakovo
242,981,750 *1799342D17116C08B71E194B6209405D043CC0C7 CHRISTAHAFNER
242,981,751 *179A54F7193814F902FA152856503C49EAA34DD1 CHRISTA-VISSER
242,981,752 *1791830C1F1D1AD76A5C20489B8315C30E2BF804 CHRISTMASORATORIO,BWV248:PARTII,X.SINFONIA
242,981,753 *179B9D6BB453EDBF18256CE0F48C8578F3B02596 cindy-sarandis
242,981,754 *179C45E6F6C7872CF5196424A9CAB5A48CD12114 cirene
242,981,755 *17932F13C25004DA47A91266E59508151E68A156 CJRX
242,981,756 *179549CCE4FBC46E8F0BDA41871C3AF1538C9460 CLARENCE.MUYSENBERG
242,981,757 *179C11E5F3AF2E0A788C26BF829412C63AB0F9A4 clevesjeanbaptiste
242,981,758 *179AD1F2255761A7F0B2AA2B7D85DEA69A17E642 c.m:x
242,981,759 *179B83D68CB71AB1F050F626C905409119AF0FF8 colbysurano
242,981,760 *179BBB27D5C39F00A40ED6467EDCB0E0543E1821 colten935
242,981,761 *17925AC8E92BAAA83C47DBCDCE39FEFD65FD3B56 CORY4000
242,981,762 *179D18828C33B6E97BC4D31C450AC6902447A4EE COSTELEY9
242,981,763 *179EFEE5BC5247AC5833D8E29443DA3DAE288761 COURIERSUTAH.NETCOURIERSUTAH
242,981,764 *179F4965B2982C192745CC8761AACCF3FB1334C8 cp"4
242,981,765 *17923DB21228F07017BEC8A11110B758478FF662 CRA
242,981,766 *1795AA4C20894959CC6DDFC3A18E6102E2521A73 CRYSTALMARLBORO
242,981,767 *1790E74B988764621895FFA371364C90764F985B CUENCAMENSE
242,981,768 *179177AADDFA8A1C1099248854665CFF88AE1FB3 cusmlaer2
242,981,769 *17945BF2EE98CE31D1655D4F897A313A89B3CB8F CVDMS
242,981,770 *1791AB2FEE60F569B358761B25F949A613CA1DE9 c"?zx
242,981,771 *1796C6EF5CFDEA772A68FA24B9D666F09CB200A9 d3kvi
242,981,772 *17981D15C89F94D4A14BC8B945C8CE3EE7F34ED0 D5LTTTY3
242,981,773 *179EA7A73C92CACDFDCFE4CB1C8C9560122FF300 D7E9Z
242,981,774 *179FC16C7BC128BD897828E8022D86FCBDD075E7 DALE.YGLESIAS
242,981,775 *179FD205C48121607F73BDE83964678BC716E910 DAMNATAM9
242,981,776 *179F8107139B1F3D84466E263594E5E2EF3C5BF0 damontresch
242,981,777 *17961344CF0B0F2FFE21A2E32AC1FB0977DACBDA DANIAL.BEDATSKY
242,981,778 *179F8A70D944B924A8F281CD8BD0A83298A7A357 DANII DAVIS
242,981,779 *17982DE758304848BD4E6F1C85677956CD3CC458 D’ANIMOSITÉ
242,981,780 *1798EA51D2BBE0D3E3721443F0BBC53BD471001B DARELLWHITVER
242,981,781 *179C78446779DEFDE3CE71FF0B081D67D9776420 darleen.kennedy
242,981,782 *179F49BE5DC45FEB38366AF3A4B529F06F17E165 DARNELLKUBO
242,981,783 *1791DF42DC473EEEB6FCDAC175E4F9FD43823880 DARNELL.ROGOFF
242,981,784 *1794B3234ABF2DBB473478C05B293CB9AD69A329 daronklinski
242,981,785 *179F64FD2C0968836ACD49EFA5F307D4ABC8FD11 DARON.PULFER
242,981,786 *179B0CD128F1AE73F46A6114FFAD5F9FC448233F DASVATRA
242,981,787 *179AC3FE732C8F5787FD2207154B3C5C4532D451 DAVEGOWEY
242,981,788 *179F32176C3EC9FE7122762DBD49520263CD2589 DAVID.KIELY
242,981,789 *179448CD87318AAB9B915AF55D92306C4CD92BD8 DBCVU
242,981,790 *17959B0572A915E6F143DA900E54D011AEF3C0D5 DCVFF
242,981,791 *179E3E48B5236E5F401AD34FE5DEF159DE8D44C5 DEANSANKARAN
242,981,792 *1791C7B7F49E666D6501EAB35C0328372173C950 debraposton
242,981,793 *17947276E1EEDAC58148DEFE05BF8877D37AC162 demarcustetz
242,981,794 *1796D09A0976C028DC2782816C85EE32AA373D80 democraticgreen
242,981,795 *17906339400A2367F9E79578FFE9CF67492FEF4F DEVANT.TOUT.LE.MONDE
242,981,796 *1793228CCB2DF1E5B70B208A0D6568C6F5BEB0A0 DEVON.SHELITE
242,981,797 *17919ECA660DC262DBA85FB4A275FF82E7E475B4 DEWITT.STIRE
242,981,798 *1798EFBEEDA316FF66918ADB2E0CA5916945AC15 dfoc0
242,981,799 *1794C52121133BD3BC5D5AB862FA79F748BBD685 DGAMSEI6
242,981,800 *1796801DAA08D62744FB8E0B777C41B75DECF932 DGCZL
242,981,801 *179E298D62F0BBFBA1F0AD7EB75E6E01E790A650 D!H4T
242,981,802 *1796D6E19888FAFB04EB7036401A6B9B21BCE211 DIANMING
242,981,803 *1791DAE66EA53A74435831AE645CD0F508B18385 DIEDRASULLIVAN
242,981,804 *1790FC034B72EEDE0C3F8293C08F60952C9C8684 DIGH7
242,981,805 *179B9EFB64A58AAB3EE178708E7F10046758FEA6 DIOOF
242,981,806 *179CE32D97D91962F2B9E61AFE65BA113B660F18 [email protected]
242,981,807 *179CF344CBE1AB6EDD94ACC3E4CCF50F7E438B3F dn2s3
242,981,808 *17969FE2A7D3615C233968949580A1148EA2D240 dn=np
242,981,809 *17960CA09F3E28E09BA2008AFA1047D80DF40DFE DO-BUEIRO
242,981,810 *1797E9050324BBBD6156A3F12089263F29D39868 does she have a friend
242,981,811 *179E408F5FA147978965910C0A18B7A53FFC3E0B (don't leave)
242,981,812 *179624BD10E1D2A87CF3F9426EA421604B275887 D$OR3N747N9
242,981,813 *179D4E0F592265C1767D27EB569D9257ECC962A2 DORATAM
242,981,814 *179638A325936F79CD3267DFF4C5829BFCE4F107 d,p
242,981,815 *179263A86F70BF2A945C485B9F34881ECF3DF4C3 dr+xt
242,981,816 *1795652D77927A43194380067CEDC65A134E603C dsfk
242,981,817 *179183C4CFC8607E609B99714DC998ACA70CAA79 du"pp
242,981,818 *17975F4770FCAF4986D304BA0AD7F17037AD7BB9 dur471on4l
242,981,819 *179F9842210722BFED3A802FDE172DFAF5C459DE d%&wx
242,981,820 *179E3742E0A52706C8C0219DFE682A26AD66F71D dxal9
242,981,821 *17970069CEBB513F6A61FC67AF90784547A739E2 d;xr
242,981,822 *1796AB33A47EC45225332ED6442A431C3073847A E104971
242,981,823 *179D97D72CC3489BA3E0E9DF895426D35AF3B478 E1I7I$M$
242,981,824 *17994140242E2ED737E4F6031504192DDC7130C2 EBC
242,981,825 *179538B383D083B03148F66C910D06AE3E606E4F ED.BLINEBRY
242,981,826 *1792CF3D8483F5A90C2054884D0D85F7E22028DD EDL%
242,981,827 *1792C534C8140E414EECF526B6744EA69A6AD4B4 ekpo"
242,981,828 *179F7DB6CF6E00D9A39BE92101BD7196753D29B9 eldenmesiona
242,981,829 *1791351504D39D3DBEE45528FC0395169976862E ELI.HIERRO
242,981,830 *179160A0F28F3FC2108D5E7C3CF0384870C9F1F0 ELIJAH.MOUSTAFA
242,981,831 *179EC278C6B853815D3B47BD45B919BF4CEFAE77 ellonna2
242,981,832 *179B94D83329EA4360743A1620036377CA771BCA elvisgermain
242,981,833 *179672D0315AA4979BA8E5A076CB7D945DA13D9D E-MAIL1909
242,981,834 *179439984B4CA46A4269167EFEA5A37831E6D00E ENAMORIQU
242,981,835 *17965C5605725A57333B674B94781E663C425938 ENSAIOMIGUELRODRIGUESDACOSTA
242,981,836 *179990827C7563B37D051A289E53F5CE8B161796 ENTAGON9
242,981,837 *179DBAF0EA8B11BA4332B367035C35A72EC4F837 ENTIÈRESURL
242,981,838 *179F3BA1A8E3FB733A12ECAA61FD5309A0E8C571 Er0+c5m
242,981,839 *17961D80B84C17528C04F85B11CF3DCC7C0ADCC6 ESCB+
242,981,840 *1795FE8414F360ECCD7DD9DDD6CDC78C982D6808 estriado
242,981,841 *1798E9463A0A5D05D738E98D73F9EAC1174554EF et%/h
242,981,842 *179B77F24EBDF263E3D7866F5210D2864FF34063 ETHANWALICKI
242,981,843 *1792BB61DDED7FBB06584EBC4A7776859CD42CA7 etnuatsre5
242,981,844 *179BA1D86915E3534DA9EAF2230C07F3686EAFD2 everetteconsoli
242,981,845 *17951E90E056BD8D2D5C629BB2DB40315E9B54AE EYOSIASL
242,981,846 *179602F1DB79181D137F5EF278F7D16A7F2BEBD0 f0rn1ca7r1ces
242,981,847 *17959FAC37CE6C5159B5C34B3692791289E990E8 fanghsia
242,981,848 *179A35BA5792F8F9586A7AF4D914D8B3FF809FA4 faustoerger
242,981,849 *179D8F72AE7AA698D2DF55101C4CE76ED509E61C fchampignons
242,981,850 *179115BACFB52CCCBED668BFDA91FD6321C35DA3 fcozh
242,981,851 *17930BC5DE9490D3F1FC83852C1ED2FD7E563CEA ferdftgh
242,981,852 *179274647AFF1CF61A98E1C40DFFB435C28C98EA FERRARI14
242,981,853 *1798D008B775357DBF58F3BCFFC967F787C5D338 [email protected]
242,981,854 *17994CA8F59E453E0A4C01B252C280ECF32448B5 finger-inguser.
242,981,855 *179F4F60B4BB590C8BBD8BB2C7B1F0B91A2E80EC flower48
242,981,856 *1793A4D757223F80EAA2B2572DE9C6DE7D8966EE fourth-billed
242,981,857 *17905EF5CF9A22FDDA6EBF6018F121A382CF851B frarbladelebas
242,981,858 *179A7A18962F552AEB7829CEA5B6DF25313A10A1 FREDDY.BANTON
242,981,859 *17985D0825FAD9DD25329ABD07DC5434EB527BE7 fredhickman
242,981,860 *1791B9A7E263C5EC32771143A9C233AF3BB5B38E FSZTMHP7
242,981,861 *17958F1241F74570BF3995CFB515C6527842E075 G891987
242,981,862 *17997DCB67515AA04F8E0F1A339F396E842B02C6 GAME OVER (GAME OVER)
242,981,863 *179E57BC98816B89BE7394B16EAE8F4568390C89 GANEVEL
242,981,864 *179A2E6EC9EF024579759C09BBEDF9ADE4341E73 [email protected]
242,981,865 *17919487097B5CCA96F88AB7E9112E3A81ED24B6 GAYLORDFEBLES
242,981,866 *179B66BBD6CFD9C51790B2DE13581E3CE4E57F97 gazing’
242,981,867 *1793203EE2E3F7CF629410C890F076B72FCE452B gepatrouilleerde5
242,981,868 *17910F33BBBFC4FB42AD4F909DDF2FD5101449EC germancude
242,981,869 *179378647C202CCB6C98BC4E8961CD10CF2BFFD2 GESOVF
242,981,870 *179C54162D738FB789091BBAD0E8844CC7B3FE40 [email protected]
242,981,871 *1799CEB43A862ECAD938BECAA6A045B3E829F14F GILDA-PEL
242,981,872 *1797D962D49266C3D799BE78E6BB861F30646EC6 GIMLI6
242,981,873 *1796020ED66153B4472BA0A13DADADB5C38AF7C1 GIUSEPPEPASSE
242,981,874 *1799EB071B45EC6E3045FCAE386AB689053D2DB2 GLUTTONIZE?
242,981,875 *179B9F03CA0938D0B083B083FB45E80028B114AA gradymahaney
242,981,876 *179198DF704DA347654608F68D000342966371E2 GRAHAM.BRAYMILLER
242,981,877 *179D2ABDD507924FB5369D9AAADDB944A0CEF16B GRANTMCMURRY
242,981,878 *179E875B6FBF4F6FC4637FB9F1992E44FA542B26 greggfoller
242,981,879 *1798CAEE9B210BD6030B517767DC422176E1EE3C GREGGHUENINK
242,981,880 *179EEEC6044D14ADB1D7BE92DFF6C9C5BE90B57C GREGORIOGOLLIN
242,981,881 *179C3D7079C1BCA0A7F15E516C2DEE49109A8896 GROENIGHEID8
242,981,882 *179D2C5776D0612E0607648991B799AFA5927925 Gut.ist,.was.hart.macht
242,981,883 *179CB9D19C75DB607F9B527EE9684547260888C5 GYTHÉION
242,981,884 *17930BCA0B4069278F55F282DB5F14DD97F69554 h3ma70ma
242,981,885 *1795FEC235997E6DCE9555624BBCEA441BCACC5F [email protected]
242,981,886 *179320189ED68E18444FBDDC58AEFFB29A09393B happy-and-free
242,981,887 *1796D16E6B12811876E25F81F2A4BA5CA7616C4B HARLEYKARLEY94
242,981,888 *179C2FB4B0E4E2CC76BBA321B5F6D24BDD8B8F4D harrybarrera
242,981,889 *1791A96A75DE499A32473E0E309E43EC58E9D2B1 HARRY.MISKINIS
242,981,890 *17997ADE4588DFDD094DAF330FFDC348F5626D60 Havelock.Nelson.&.Orchestra
242,981,891 *179EBFE87C035E6066005BF522B72E5AE6811B8E haydenapplin
242,981,892 *179203070B6624B99B14D332E3378019FBC2EF8D HAYDEN.PAOLINO
242,981,893 *179690944488DD5A93682C3D8C1DCF2349E906CE HAZEL528
242,981,894 *179D366584D5F66A31C74C22F9F70C045BDCCA56 HEATHERJAN
242,981,895 *17961117D9D5DF67378727DFDD08EB2BD52D48C0 HEATLESS
242,981,896 *179AFD169C56C7AC239A9F691752A6CC61E71913 HENRY.KINMAN
242,981,897 *179CA8386AE0C65C512678D697494307EBFA8F9D heribertopagaduan
242,981,898 *1790E227A6603F48563A608EDC62EE48D01DDBBC HERMELINO.NEDER.E.LUIZ.PINHEIRO
242,981,899 *17962D2F5082112B59417D8A6F4D2817B93BC936 Highway-Battle
242,981,900 *17953E5DDB1B11E9AFA4138D9C9E3834853A4CB5 HIRAMWOLTJER
242,981,901 *179B315FB2D7EAE0C2C5854F9824FFB230B26764 HITCHKI-(REMIX)
242,981,902 *179378FD45FC0CACEFA106AED1AE917D7D6F77C1 hlj)
242,981,903 *1794C146E36B6D6F51E68B8EA56A107C7814F7EC homerchioma
242,981,904 *179B78253494F6AB6477A57952FABC34BB1A827E HORACE.SCHAYER
242,981,905 *1799727C0E96ED5BCC1225542EB06510757E784B hot.capo.stew
242,981,906 *17984108A4A4B1CC5D0F4BAE5868B0EBC940BA6D HOUSE MUSIC (JON KENNEDY REMIX)
242,981,907 *179742FF4BCEF319C512A4362A8E8425387CFDE2 HOUSTONOSCARSON
242,981,908 *17908897648CAE6D23E73107955602AD630F65C3 HOWARDWIKSTROM
242,981,909 *179C972C8AEB88A68BE27DB32C51B4A47105D3DF howenstein!
242,981,910 *17911370C16CCA00589D1331B060A24CA3D6A66B httpwwwgordonrespon
242,981,911 *17963FFB2FD52F7C81331BEE5FC4926D8050EA4D HTTPWWW.KBYUTV.ORG
242,981,912 *1798667FE6209DEC19A9F736568613799EF685B6 HUEYEBERLING
242,981,913 *179CE6F6892C3758AD860989812BD5558055365E HUGOGOEPPNER
242,981,914 *179D3785443ED16C55B559D6E9207E61187F55A9 huilasihan
242,981,915 *179ACE0EF04423F1365E267BF9A51DE0B4C371EA HYMN-OF-THE-VIRGIN-SUN-QUEEN
242,981,916 *179660BB81240F6CDFD080F8893A22DA7BB95379 i;@/
242,981,917 *1790B027D83F43A9B4DA3EB46064B82E57BD4058 ICETRAYSYSTEM
242,981,918 *1791629458DB99A832A55D8ABC3F72FF6D705642 ignaciokaroly
242,981,919 *17947A1CC964344D45F37DD388796F186A9136A1 ILFTKYS
242,981,920 *1796CBE1D1CEF5368CA2E2CC6990E468B4041D29 includek
242,981,921 *17905BCD7E56940C3A5B2490F9726590C9B3A25B INKLUZJE
242,981,922 *179E945132603AF1085C75A1CF59A6B8C5D0BAFB [email protected]
242,981,923 *17916608BF85D85201E46C4595303DAFDEA55D34 ISAIAH.HEBER
242,981,924 *17918AC4ABBC9DA37B317083596BA2C07F83DE16 ISEULY
242,981,925 *1793E96B07DF1C3253BBD3582D90F359ED91A465 ISIAHMCIFF
242,981,926 *1797A7C3E13BF6D2F80C51B36A546213FB4E5C8A ISSACKNIPPENBERG
242,981,927 *179ABA86CD0418E2EC91A530023BE13A0F86C0AE issiing
242,981,928 *179094E236BD70BF58B64150B7FCF9FF2D941884 jaimebailer
242,981,929 *17947355D077457F469F13E3BCEB9164384763D1 jamalfenceroy
242,981,930 *1792AC819839079DC326E96EC86DA31F68C66589 JAMEDURRENBERGER
242,981,931 *179A4C08363AC0597EACDB6BB82E9A1EB2703A72 JAMEL.HIDES
242,981,932 *17944EE503C6984E304139EA624600A1F66AA00A JAMIEMERENDINO
242,981,933 *17991D2B798B535563DCF23C25188F4D1BFA8B21 JANICE.KOPE
242,981,934 *179899D57FC814C9F8BB0484DD73B691E6E71003 JANOVERHOLSER
242,981,935 *1799D5B92393DA91EED4542F0E127A9EC1BDDC50 jawwadshakeel
242,981,936 *17955E6E2A5E7639AABBACC9BBA9FCA722FBC78A jeffrysheman
242,981,937 *17945C319C7D60E5BAF08CF51F809B031A89D0AE JEFF.SCIGLIANO
242,981,938 *17987036E7505C968AD3C3709BC9572A88DC6423 JERAMYRHEOME
242,981,939 *179DDBDA4F24EDBBC9CA4EDAF82F058A381D5EFC jeromybarthe
242,981,940 *1794C36B09E69CBCE2138D7B3B85E9F894BEE331 JEWJEWJEWJEW
242,981,941 *1793A28D2E1A778FFDAEF453E62B1999D8C9FC9D JEYAMRAVI
242,981,942 *1793E4B57D0DF7D17FBA9BF68C4501C2F648D2C6 [email protected]
242,981,943 *179FB17724F91D008286AE2CAAF0BBB7E364FFF7 JIGNESHBANKER
242,981,944 *179421E93F216287BC7218726AE6D7242499C472 JIMMY.NEPTUNE
242,981,945 *1792396FF32B45D508BAA52D574A9A7B79330DEC jk:#
242,981,946 *17979FBCD8BB3E0F5CDFBF4956A5245941E61FD3 josefwheaton
242,981,947 *1796AD24D00645D43FD0ED5772D18E75A0510FAE JOSEPHSNELL
242,981,948 *179BC3C261BCFFBE515DFBB54EEE1499358FF72A JOSHCOUTEE
242,981,949 *179B7F15B66E7B0EC14BD8A1F0BB4C421412642B JOSPEHLUOTO
242,981,950 *179FCCAB775BE4EFB2FEE80130767F493CDD0448 juanjotriguero
242,981,951 *1793803308371545B1DC5760469A6A2626107657 JULIECOCKBURN
242,981,952 *179C8721B33EFC7CAF5EA8A179C0A6506DCD7D10 juliocarruth
242,981,953 *179EC789CFFB6E46D0F5F5B655FAADA787755E32 KBASTOS
242,981,954 *179C81D378CE963D0AC9CC5878ECE1C1EC4E0FF5 KCEBREHS
242,981,955 *1795571993696405389CFECCCC5697CD99737C1C kelstar4
242,981,956 *1793BF82D7EE731877F15A544B2C0C68AAF2D429 [email protected]
242,981,957 *179DBD6997BB09C76437DAC8CE40DD28340675E4 KHALED-MAHAR
242,981,958 *179D5964A0AA21435CBF54E42688D0DAF3ABA198 kiethbihler
242,981,959 *1799622143D357037B861123F733DCEC17F4814B killyourpopmusic
242,981,960 *179614A8DDA2F66FC84C603D490728773456F2F2 klimagewöhnung
242,981,961 *1791A593AD3D8C5CDC9E4FA439DE4F2F788CD1E0 KRYSTELLDUROYA
242,981,962 *179B16D00E17BCF4886C40079A408FFECC969950 KSMXXX
242,981,963 *1797E25F207F4D05C1984EBFB1B123153E64CB60 KURTIS.HERMANOWICZ
242,981,964 *1799939A721F9AF41F0F24F3D5B9E7BD2F006C2B KURTISHEUSNER
242,981,965 *179605104600B9F9FAB746BFA4CFA4C11A16933A KXS4458
242,981,966 *179DEA7C451FBC548BE079A3F43B85CBC1F0992F KYTKYELTÄ
242,981,967 *179A1A1325D1FCBBDE6E8B3B6946D7772F2139D4 lamarbreitenstein
242,981,968 *179573630CFC49C7522C8EA0B4E16BA07B8EA4B3 lamas
242,981,969 *1793E87E6C0D80CCD3AAFB5201B39088EB1CA0B9 LARS.OLOF.ANDERSSON
242,981,970 *179A35CC4E3233357468F171423FD6C900C1DB76 LATANJAC
242,981,971 *17965E199A226884B4F5274B051F8B3A5CC1913F LDLAAA
242,981,972 *1793FD769DEB431C06D653DA0E4194B19FEFB6B0 LEANDROKIMPLE
242,981,973 *179F25809F408F25083E4616FD6EE3BD8D7DE911 LEANDRO.OBRECHT
242,981,974 *1799E69835B3A16C1E2383562F344BC57BB3D4B3 lekcja-historii
242,981,975 *179C3E4B5970D7DD98CA75EBE564A38DE6514A01 lellander
242,981,976 *179F3A047D2EF23E07761E86927F45D06487EE8A lesiter
242,981,977 *179B00751C3837F7C5EB924076084EAA12DC63A1 LHUNTINGGED
242,981,978 *1796E6D10DB8423A5E311E75EB6A09FF8D407970 [email protected]
242,981,979 *179C662BB843A00BC04A76EB1259CE0C94F416D3 LILAYNE0
242,981,980 *179B7046F56518DABD5FA38946E1E249A8C72B07 LIMNAECIA
242,981,981 *179FDEB186421A6C8A9AB135CFFD78933C54549B [email protected]
242,981,982 *1796692B3EF123EDA835E5891BAA0437D4F1B757 ”LIPPULAIVAKSI”
242,981,983 *179D6F6C7D07E69CC61E2A2EC447D05A3E31CB47 LITER..
242,981,984 *17903FC31A91ADBCFD0013385E09117A2D5F4CDB locationsightings
242,981,985 *17940AFB3A9F1DCC37D03CF6D2323ECC37697609 LOGICALMADDOCK
242,981,986 *17990716A4BEE0389AE487F781D32D3B1CF62711 Love-Divided
242,981,987 *1791C59C1B2477555359E53BB6139A55657B5FE1 lowings5
242,981,988 *1798C7EE7121AFBB845D933293D4E77183E224EC LUCIENBATISTA
242,981,989 *1794146E89AB67C8D2E5D8F80DA3851C56735F66 luciesalinas
242,981,990 *179276BC229C94AC7ADBBD42413C25EAC7FD32A7 [email protected]
242,981,991 *179252283060ABF07ED1F338671028B556DB1819 LUSTER
242,981,992 *179D8ABF01C21A1FB1A5CD6F344044AE51943BB2 [email protected]
242,981,993 *179F03F417E73E921458C9D4DCE2109991BB0B7F magnabo1
242,981,994 *17976AA4CE7CBBDD140CD49AE6D3D802589BC9EB MALOCCHIOTROA
242,981,995 *17952C8B3A8C9914E35531B1D8AE11204FFCC575 MAMICHULA
242,981,996 *179F363372EBFD1086F861131EE7B72A476D5B1F MARK.ANTMAN
242,981,997 *179D3CDE95C201FD393AFCFD92B434D63BDF41CC marknads
242,981,998 *179BD7DBDAD42E814BA4DC2DE705D47B1E7BF597 MARTIN.CHANDRA
242,981,999 *17973E7AC4BE4145450E03CAA54F22F47D98F58F MARTIN MALLEN
242,982,000 *1798E8A064175C26A9825178559CF7E16CB83519 MARY-JANE-SALCEDO
242,982,001 *179B81D3B1F6B822715112CFB9A48095321CD813 MARY.PALLANTE
242,982,002 *179BBC30344F193D6821C7303409FEC9380EC153 mathewmabry
242,982,003 *17992504C866014EC9666407B083B580F4670354 MATTDRINKALL
242,982,004 *1791C8CADFFF37A473EAD10799C315852C887F8C mattgabrelcik
242,982,005 *1797B4928BE49F0E36C5D9181068561A540540FC MATTHEWFACER
242,982,006 *1793B48EFD85AECCC1E6A325EC5870E92B9FB3D7 MAXIMO.TAING
242,982,007 *17929BD8BC071C698A34912657790CAD04A5C19E MAYDAYWORLDCLUBCOMPILATION(DISC1)
242,982,008 *17991EB9AC8CBAD95C43D8CDFEC96E0AB9FDF271 maynardvandy
242,982,009 *1790A937DD2EF9CBB3CFEED4E1109DF47ACC5AAE MEDIATIONWIKIPEDIAFE
242,982,010 *17956D485703140A8729FB52924F0B56E662AC40 MEIAHNNEQ
242,982,011 *179A3B7B0D4BF7DE9A0CD4FF72DD0A3A4D07319E mercedeschilla
242,982,012 *179D4B5E5F0FAE86DB64A022601E1E839B77254C merimeeia35030044
242,982,013 *1796BAA6D0373B9D97F6C88A6E39DD7A961FB51E MIKE HEPBURN
242,982,014 *17924CDD8F0210A21CF2223020808FB517FF0359 MILKEATERS
242,982,015 *1794BCC37E09A7BA198188D1D7E4CC4202689281 MILO.TOD
242,982,016 *179CC5C81152B1E9645814F08EA0AD14D232DB13 MINDERBEZAHLTE
242,982,017 *17945D287873717ECDF5BE8C80DE3D21C8A373FE MKENGOO
242,982,018 *179DA50BC0BCD86689C1E1CCC499BA1B72FF7AB8 m:m
242,982,019 *1793F84455C71F60AA26A82B75E6C8BDC8F84A72 MODESTOGANGWISH
242,982,020 *1797C698EB250BCE071B936BFA1317B6AE6220F7 mohammedalkamali
242,982,021 *179192A0EACB0EC1100DF37253182B2E0D9E2428 monroeschleker
242,982,022 *1796067BB9630C07D490E3F3768E4D530A918775 moreall9
242,982,023 *179AF011B6B6CD72380CF9B5508FED350F0B2CBB MOSAICS)就表現出四位羅馬賽車手及其馬匹的風采。
242,982,024 *179773FE83FC8C5C98F8CE97A025191F345C2961 [email protected]
242,982,025 *17965C4ADE7452B60D78D2863FF4A614A0936EEF MSSNAPAGES.WORDPRESS.COM
242,982,026 *1792FB37E666056C4D5A1AB913435D1EE73DBE47 MSSSPLN7
242,982,027 *1798F70FB036AB391E2A015AC568FAF17D27EF35 MUHOUSHIS
242,982,028 *179622CB827002D7A19AEC071898237CC85AE472 [email protected]
242,982,029 *1791D2645CF99869E1EE6FCEC0F950A2307563D3 myiodoria
242,982,030 *179C0BD9AC690D0EAAE0742CD335A396E6F24E14 MYTOTAL97
242,982,031 *17955933E9B8B804F2FF8B4E4A40208215325431 NAEJER.1
242,982,032 *1792FF26CB88F8C4560FB932BF277BFCC3DB08CE nagrywania
242,982,033 *1794FA994E9CA899312412ED899E330C396DF73C NAUGHTYMOM
242,982,034 *1791FC2D08A1E4D10A59DFA487DAD86E7AAA1FC5 nazaninazin
242,982,035 *1790562818192741839395F9EF12A4CC39B09B25 nedieks7
242,982,036 *1792D3A73147C889A40FFD395A32D6D6F967F9C1 neverdie123
242,982,037 *179CE83D9233FFE772A35330570ED11C8B9FDB8D NICOLELUNDQUIST
242,982,038 *17938B161B12A775EBE22B552C78FC90FD35DE8D NIEHCSNA0
242,982,039 *17943D9A3447447A6802D0C4B218F7916E365D7F NIELSE16
242,982,040 *1796F763561EEB7D96829DD712940A9F4CBFBC2C nirab-parvez
242,982,041 *1792AFFA7463012A51A613629E4349F127630209 NISHIZAMA
242,982,042 *1794929105F5121244CBCD0620E9368D547EEDFF NORBERTO.SCHOLES
242,982,043 *1793A103DC4AB922C2737354B583B3E5E48AA5F4 NORMANLESPERANCE
242,982,044 *179AA4253A110D755CDD9FB70FADDE97374FE7AE norrington-20-0
242,982,045 *179E576BF5B9A4CC8FBB52FF44E5817F55096EA7 NULINIS
242,982,046 *1796221F520DD77516177095BAC0EB79D207F53C NUSHGHI8
242,982,047 *179B74E5BBB646E50BF9E5D78EEA895C4567C09A NVRUMVX
242,982,048 *17982202DDA2137F7C053FF38CE5B2D58BC1EE26 [email protected]
242,982,049 *179DDAC4F7CFED7440A9788BA8B04748A34877E4 OAKLEYHARRISON
242,982,050 *17910F3D943B3F22F1C303E44EF25E7CE27A0C94 OBS2433
242,982,051 *1796F677B099060F2D97F347AD388865B43E78B1 OLET-KASTETTA-MAAN
242,982,052 *179ACD1B68C9F49AB727739293EF643DB1523D2C OMANIAA7
242,982,053 *179B2F787036685BAB077ECC9F6386EBC5507E34 ONOVERDACHTER5
242,982,054 *179EBCE0F80DD87D0E1D500D931122978CF54E47 )O( ~ Q###B
242,982,055 *1797764042B3D8D0208DF98407EE8FCBA6710147 OSVALDOFONTES
242,982,056 *1791DE444460ED5B29A8A01658D93227F21978C0 P13RROTS
242,982,057 *17977E3921A79FC637BCF93EC2998DD6FA8CF89F p3rs0n41+y
242,982,058 *179EABA44517F11B473F2ED7EEB5A1D8079CE3A5 PAM-TRUMAN
242,982,059 *1796756CCD39D83BE3AB9ABB0C60D40DF2CC3B15 PANATIERRE
242,982,060 *1790C10BA076C0095EFDC1B2BB6DEB90ABD7E6FC [email protected]
242,982,061 *179D9E65E91982FABCB755780B5D6DB2CB5A8D67 PAOS.COLORADO.EDUPAOS
242,982,062 *17927B297AE9BFE946FE6192949BB6F99530D159 PARANDESATRANGDEH(FEATMANJITPAPPU)
242,982,063 *17918108329863A74DA4B4136038FA3DD288D64B PHILFLUM
242,982,064 *179547464EA0712F3B40AB9317717B0DAEA3E5CA PHLOROGLUCINOL2
242,982,065 *179E43E67F9F9CB541F3680336CD9C3EE2F29571 PHOROSCOPEPHOROSCOPE
242,982,066 *17957F91A47F2885B0661D6B9F0BD1CF39BCA509 PIERREMATHIASON
242,982,067 *1795CD270B00CC7C0FA5FB4E5B6C4774CBD70432 PIGGYLETL
242,982,068 *1792F48103D633E46E28A98D0E1A3F1BCEAAB002 piratepartyhostingpiratebayinprop
242,982,069 *17929A4C298CFF126A3197F41E451F6F66FA3F17 [email protected]
242,982,070 *179B79B9C305A96EE362B744E34EA256B3967E10 P####P~0.~oUU
242,982,071 *179A60FB9EE15F3591B1A05296B6755252A0C280 PRÄNTTIKIRJAIMILLA
242,982,072 *179EF8510B901783394BFE2C8B161A6BD25D1AF6 pre-waste
242,982,073 *17923D5E369D5B7185EE21E337411373300F7B62 psychedelic virus
242,982,074 *179A91910E521819E3A58CEF2D7D03408686029D PYGOPUSSING
242,982,075 *179B7B3D9883703930FC134C87BB7892BA2599D6 (>-<) ~` @===Q
242,982,076 *179FAD5BE8317BDFB2DBF0BCE596236CF5CD0101 [email protected]
242,982,077 *179C7CB44AFDFA522A9320F2822CE9A284894DBF [email protected]
242,982,078 *179CBF03AC83F3FF925D8B02B17AB506ABA53C83 [email protected]
242,982,079 *179865C09B11F78E2B5BB0AAE40090DB083F233E [email protected]~O~OSPLAT!
242,982,080 *179CFC7206D0F45C42C9E0920F8A69F0DBE2892E qq%
242,982,081 *17995E3AB1BF73D751D0D49A2786C3592C774DFC quartet no 14 in c-sharp major, op 131: iii allegro moderato
242,982,082 *1791A23BD6E9B97BA4C4566E8FE0534361A1F92B QUERENVORD
242,982,083 *17947CE9634878E36E246B9016F7F0E2F891DEDB [email protected]
242,982,084 *179DE429AAAAAC1D5F81290AB4E267CCCCBC9E31 ramonmccullum
242,982,085 *1791D309FEA0830ABE303776A246164D37FC9A58 RAMONTEARE
242,982,086 *179FDB0A97DCEE3B0227DF71534B964F866EDA80 [email protected]
242,982,087 *1791C3BA03BB2776B5E0CC79130D51FCF9A2E273 randysabb
242,982,088 *179D63F43E6F9386FE717D0D41AD6601AE8945B9 [email protected]
242,982,089 *179CAF7436AC441AFCF041CCEF9941970D205421 RAYMUNDOSADAT
242,982,090 *179D2D6DBBD3E49B596DE2FC093567BE36D6117B >rb<margorp-noitadilav-eman-elbairav-elpmis-a-47-gnitsil>b<
242,982,091 *179104C4A7601CEA0E3BF134FD85CCEFD6555608 rebeccaunderdown
242,982,092 *179E91054DD8A2B746F53A047B480368200FDAF3 REDINTEGRAVISTISQUE2
242,982,093 *179FE576CE455491190541623DEE17F1F8152E48 referenzkopfes.
242,982,094 *17981617D7E3FDF993C145F0EF08F01604A40F5A REGULUSI9
242,982,095 *179D61FF57E5BB7ABD4F212F7891B410C4E4B446 rehcsor.1
242,982,096 *179151E46C50FCE5BE2FDA6CCC9C4B158F3E87AE REIDDAHOOD
242,982,097 *179AF36EF0364C8D2ABFBC9DCAF3FEF45D0ED8EA REMELLEMSPIL8
242,982,098 *1795442D90E9558353B38BB7F7CCAF780955F421 [email protected]$URIN9
242,982,099 *179ABB0B24B12A2D7E4031A23D5750C0AC6FC1C5 [email protected]
242,982,100 *1797DE3A2B917D23ECE8ACDC752D2B7D8F981A53 REPEAT321
242,982,101 *1797494DC0E58F66C1BCBFF3FCD4A21BAC367852 RETNAHAS
242,982,102 *1795155B35ECE5F827F33EA5526C3C4F0D691FA9 RFLUGELN
242,982,103 *179649176DC15D54FCEEA5277486FFF8A9301618 [email protected]
242,982,104 *179107250370CE903CA925391078E2C357EAC5E4 richamato
242,982,105 *179A8610D1C89F6A90BACEB6F8A24D63E3704F4E RISINGSUN-3RDMOVEMENT
242,982,106 *17947A2B7D9ED5BB6B0F5226CB6CF7F4721D978B [email protected]
242,982,107 *1797E0A78D84B9B0105D553FB4F3F4AB17CFC418 ROBBIEWEAKLAND
242,982,108 *179EF7D3380509C16AE91FEE6ABF071DE1C1C246 robert-brodbeck
242,982,109 *179A2B9BDFC3229B8DC1A3641469F404C53446FD ROCKYMCCARSON
242,982,110 *179D4C4545FB1D3961BA9E571312A660A452B6F5 rockysuber
242,982,111 *179E2A72A46133347D05FE66094C5EDDEECBF6CE rogerfrancis
242,982,112 *1798DD543D6CA9514DD8E25294824528F80016A9 ROSALIEHAWKINS
242,982,113 *17937D8B93E7056000755406998C72CC415F548A ROYALVILLAR
242,982,114 *179AA2E428B17CE6E97DC6C95CE55E2C357EAEBA RPZERMAN7
242,982,115 *1795FE4EA3A9AD6CD49A1EDD6C785E3E08732D81 RXFZ
242,982,116 *179F81A0FA919263AE11F7503DE61B7D62B9E5FB ryan-euler
242,982,117 *17939855FE4C3BA372C3FF494ED562F68CC70374 S236381388
242,982,118 *17952152BB53CA2826E40D4426FD40089D3282AF s74bi1izer
242,982,119 *179F449BCC250519459CACFFAF1F7936D7AA1B79 SALKOVICS7
242,982,120 *1791B4D637B9B9035B9C60D393E38F8D8608F47B samsonetdalila,actisceneii:quidonc
242,982,121 *1799D3FC56DAFC475FF9BA43D7DB88DB3813DFA5 SANALBINOMINORBASILICA
242,982,122 *17944E3E0B0C61FFB6EA456C8C0335B2FFC8E2C5 sanfordlaber
242,982,123 *17927FD9DAE96B1D95562B8973A99237DF1624B7 sangreal
242,982,124 *179724A2D94CDD92653D475D6DFBF58D9A54BD52 [email protected]
242,982,125 *179DB5B5961F30BC577C07FFFC2BD9618E572F42 „schafferleithen“
242,982,126 *179D458CF5799473F2FE0A333F9F9B25D9832D37 scottbredice
242,982,127 *17969DC03B91E45EF80B966274FC0890DD602B15 sean.gerhardt
242,982,128 *1795D587EB5CEC0DC0589A3CA3985695DC1C7BE4 serfess
242,982,129 *1798DC58C51634366A07C16C32E9509B547AD8D6 SHAUN.TOOMEY
242,982,130 *1797233B13BDBD3DDA1592FB1F87F72B4938F13F SHAUN.WAMACK
242,982,131 *1790EB3D877DDB2B2203A8A06DBB7DC120FF9F7F SHAWNAJACOB
242,982,132 *17928201CEC0C7213357C2FF25DE597AB2CEDFE3 SHHOMAU5
242,982,133 *179B600A4120B80044CA552F81D6F8FFB77C4355 [email protected]
242,982,134 *179A5B326675B1D03CEE915668D2A779DE49D840 SHIRLEY-LIVELY
242,982,135 *179603796A3AB681AF0EE5F804395C11E915F86E SHIROIRO2
242,982,136 *1794E6C3357D70A42E7DDD5573344A180AD8FA8B SHOTGUNHORSES
242,982,137 *1796CF4566EF854FB6A9330B8F61B08146E235FD SID.SPIKA
242,982,138 *179A2B19E4B3F8E5670601F91561D4BBB9720AA8 SIJF
242,982,139 *1796CDEA67048153D38901BDEC3A45629D5BDFA2 SITLOADS
242,982,140 *179BB70301D32682409C1287DAF3FAAE497064D1 SOFIA331
242,982,141 *1790DBC1A828D151BC86DC14B63105D5BCF68927 softballfun
242,982,142 *179F0FB45D4F02802F29B88DF30EEEE69B083E2F sou1i11u
242,982,143 *179A086965887247F5080175969FC92D0DF7F4E2 SOUPCONNABLE4
242,982,144 *1799F67D63BF421AD9B4D821BFED37158C65E49A SPARTAKIADS1
242,982,145 *179D689C5594B8682CCF1922BB3BC3BC92EF32A8 SPEKTAAKKELEI
242,982,146 *1794E01A65FF52562D061E3BA117DC2726E36208 SPIRALIGAS
242,982,147 *1795236BB79ECDED96BC1941B0211EA92FE5A745 splat!.~.~<3
242,982,148 *17916FDEC08009D5A5E4362933D72638B5B3F09B [email protected]
242,982,149 *179A05587AEDF11548527C92F7E8F15C8E2887DA ssensseltniop
242,982,150 *179A8CCF72EA1C63D9D527A65E0A4FFEA9E709F9 STAANDDNAATS1
242,982,151 *179209B095334E3986F77FF2E530FDEE0C80FC40 STACEYPAVOLINI
242,982,152 *179F8758CD55066BAAA227CF390F3D3DCE0F7ED8 startlinglyv
242,982,153 *1791E78E3F97381A731E408E2DDEA14055115D14 stefandunlow
242,982,154 *179067F477C38F9286C997A6319FC8AA95FE2972 stephananton
242,982,155 *179084AB0CC442CEDC999629D36C300FAB989E72 STEPHENMALHI
242,982,156 *179EA5890927A90F34762865AF1BA90C24E4038A STEVESOLDO
242,982,157 *179AF5A9E077109C1954BBC0D677E0A44A5727C5 stjerao7
242,982,158 *179367B897280C11373069EE02B1487394F48742 STRONGERFORD
242,982,159 *17949E3024F52B99AD6B1CD76E37B8AA3A67E383 STSORFEDING
242,982,160 *179095BE69F60A4E26063F0E7EFC150A6B9B6643 supererogating!
242,982,161 *179123715DE074AA99CEEBD3E80B18444DF4E845 SYKAMINIING
242,982,162 *1790F2B550AE519D9429F0987B2B0284B8F9F424 .SZAFRAN
242,982,163 *1796D8F553EEE1D7894DAB5DCDD241498CDF4142 TALKARMAGEDDONMANMI2
242,982,164 *1798DBA1A8BCE371DD3F58CA024169E7C07DB1B9 talkq1012
242,982,165 *17971132F17933B4469A2522A2DEBB2BF398E01C TAMEABLE
242,982,166 *179F16690D5EAFF46198D904C98C03E7CE24285A tannbehandling
242,982,167 *179A964DABC15BC119C67A3498B3DB3A8386E2CB TDNAWREV8
242,982,168 *17904BEF2466A5315B5C8E2C8B1FB8E447F27934 TEDLONSDALE
242,982,169 *1794BB9DD816CD85E3477236F4C7AE4B63C2BA33 TEJAS.BAKRE
242,982,170 *1799235F571717C8F876D0A55701C053FEFB79A5 TENNISBROOKE6
242,982,171 *1794E30E1C8DE278E981844EB6B323BA96550AD3 TEOLLISUUSVALTIOSSA
242,982,172 *179E1914D435B39D3AAD788FCF2507D356F76D2A TERRIGHT8
242,982,173 *179344831544C646CC6350834C132D1AF94A955F TEXISCO
242,982,174 *17972E7C4E5D6D2650454FD6433D779FC9FED01D THADDEUSGOLAN
242,982,175 *1795AE52EFED51FC084D06325B28C3731686D0D6 THANKYOUMF
242,982,176 *179303B95AAB9BEAAE6C0C63E680B7A19AFB2B63 that doth my life besiege farewell, young lords;
242,982,177 *1791647168352C8AC4B7F36A7FBC3D17D864A76D TheClusterFlusterBlusterMarch
242,982,178 *179B255FDB444AC64DF27E00B00C42DDD4450F00 the thought escapes me
242,982,179 *179C37A1B17D86ED92F8CEF75A6993C518B7B18E THOÒNG
242,982,180 *1791A1E40EBE9ADF99ED8B8A52835A26B2CAB191 THREE-FINISH
242,982,181 *179E1E2995AD229841486E908E9A84C845714443 TIMOTHY.SIDDELL
242,982,182 *17920A0CFBBAD2A66F7A21DBADFE227FA6816776 toggle100
242,982,183 *1793D489DBCF095FF9C33EDBECD5C1723876F912 TONEYSTEPHEN
242,982,184 *179CAF3713BED6682E7A5DE7748908362054B386 TONYA LINDSAY
242,982,185 *179F590C806BA53EB27A9FF0AEE7481DB406741C TONY.GROHMANN
242,982,186 *1792357342E363F7F8213FF9DB2E206C7139176A TPARAFENUK
242,982,187 *179D83CCA9046CC414EA8CD79312BC64BE6856CC tr"a
242,982,188 *179588BE38B262D260082884C448CF7E75A85927 TRENTON.MCDALE
242,982,189 *179E9A36BA548D79CB8C6C748457E58FBA378611 treuzelden9
242,982,190 *1798EAC05F5334DBA106D215A9D5A624BBF394F1 TRIMMERH0
242,982,191 *179D28FBA7E361A4131DADCEFF69DA3F533EF473 TSARBNAA5
242,982,192 *179EC5161EB0960169AE726686B2B56815605ADA TSZ.KWAN.LAI
242,982,193 *179B6CAE3904BED1FDBCA503C921048FA3BF7CB6 turn.the.party.out.(feat..biz.markie)
242,982,194 *17968B3543CD856FD90F47851A0EF14EC92DE539 U!1AAA
242,982,195 *1790A646AC928DCD3DF80A0F5CB4281AED4FD1CF ÜBERMARIONETTEN
242,982,196 *1791791390E55705FF2ED9E318E2CED53A992188 UC5U
242,982,197 *17917E3C2BB7DB3DB3AF00FDC0971CE4DF7EA3DB udahemuka-seraphine
242,982,198 *1795EDEACE85210B925D66CB803FAF83FD063C65 UDAKAIH2
242,982,199 *179D83BE5BF5FB6EBE9D5A3DCAEEA9E5CA970182 [email protected]
242,982,200 *179F669C25399C6A2F4AF5C651390F488D907C3A UHCXMMMBVOQCGV9
242,982,201 *179DFA97A752211A72A3B199E5A736A021214BBB urlauberzahlen
242,982,202 *1796808C331ACCCB26D1F729584F260237EACE35 UU-~`-~`D----Q
242,982,203 *179FA4DF1AD2CA14B19F8020870E463EC8482689 VAGEOUR3
242,982,204 *1791683C5404C1B70D4C8EDCFCA88712D31564D1 VAHEDEROUNIAN
242,982,205 *179C4885760CA4C0AD1CDE37F2872A7BC9C7F384 valdano-etienne
242,982,206 *1792D9CD3D28E38ACA7003BD087780A99E2CB6BC VAN.CAPOTE
242,982,207 *17960A1C032EBB56DED25F16C9625AF2F05519B6 vd/t
242,982,208 *17938023730549BD6BE1893D87BBFA30C47377C4 VENKATAANAGANI
242,982,209 *179D382163BC2DBF479E35436241CB087990BB68 verdrink9
242,982,210 *1791F53194B074B9619FBC215323F63EB61BFA7F VERMILJOENKLEURIGSED
242,982,211 *17951E260CE5E210E3A25E549E94BC38A8EF2346 VHANZ AVATSIM
242,982,212 *179407C633EC38CA5B431939192B9E8C3250D0CC [email protected]
242,982,213 *17959FED734DEE3749B90058475493287753E7E5 victorromanson
242,982,214 *1795FD26ABFFA55E26BB74459CD7E08187757991 VINCENTCRISOMIA
242,982,215 *1794695659663A6694DC0D3DDBF1913E49BED7FB vincent.gies
242,982,216 *179697B216BE1CCE35990180AD67B244E4845552 VINNA AN
242,982,217 *1799651FF9BBB32048C1523546A4BC0CF9497ED7 VINOSHKA BORGES
242,982,218 *1796643DD01106C30791A297EFD3A099851D4F93 VINSVINS0
242,982,219 *1794B675A67AE8F4CAE920C8AA34CF4AEE572C75 VP1:
242,982,220 *179074CA8F80592FBF5FC20131916A0382CBFC26 WALKIN'.CATASTROPHE
242,982,221 *1795A44273EC508D107022471656160979C70ABD WALTON.MASTENBROOK
242,982,222 *17945B8C5D63604782462B0A3AD2A662E2AC43B7 [email protected]
242,982,223 *17979A33A44179C45B75269A8A85E86535AF3711 WARRENRANSOM
242,982,224 *179E8614651C58E27E9974E5FD564555F8604EF3 WAYAH.FITRIANTI
242,982,225 *1795DFCF4BFFCE6632C2E3FA7FBA70BBB75B63F0 WAZAYZEH
242,982,226 *179D5FC9C12FA258F59890401ECAC3C4AD09CE25 WCOUTURES
242,982,227 *179D331A77F9799669D414F5232E34D6D7535E96 WEGETMANYRESPONSES
242,982,228 *179E705E1E0A8872F7D3F17A4932E65CBA4C3B05 WESLEYDRILLING
242,982,229 *1790D64E5897362AB6D7574FA28C861A8C6C449A WHARPWHARP
242,982,230 *17912544B6CA5C52FFF56FE677375858B625B00E WILLIS.GRONOWSKI
242,982,231 *179D451CBE21C6D2DD13628D3B4FC9A54280924C WILTON.RISKO
242,982,232 *179A57CACD1C0CCC0811CAB97250161EF280D246 wimukthi.deshan
242,982,233 *179817395A0BA7665C12942C6F4AB13E17F665DC WITCHDOCTORING
242,982,234 *17936C165A06437884E4D34E152039ACE5039E54 [email protected]
242,982,235 *17903A69C7776798163859E0D13F081A5FBA668D WWW.HITACHICONSULTING.COM
242,982,236 *17938A2BA7C9DDC575D0191A222732B55A70E825 wwwvernonlibrarysuppliescom
242,982,237 *179333E2CC716D43CF3603542FC5F8B3FBB39EB6 WWW.WHITEBOARDADVISORS.COM
242,982,238 *179E876724DE06FF6966ADB4E918C549FD73BEA0 [email protected]
242,982,239 *1793306BFAFE1BAF921E2818A50F0CB16B890872 XANDEDOKAN
242,982,240 *179555390AB72438186AFE9A519B461180CE36F3 (X)~~~D######B
242,982,241 *17926E6837722D59DEEFF834EE6E5978E4A75E65 XMEDBSW9
242,982,242 *179FAC85494256A7B722F305F3F5B479E5BCCED4 }X{O~-0~Q=8
242,982,243 *179F9316BDD87DE21AB92964D323495914929E21 )X(O~D###B
242,982,244 *179E78B2582DBB6510B4E3ED7DDB2CD36583FA9F XPRESSIONSKOLOR
242,982,245 *17972A954C79B834B06A09C5E1B40B4AF02D9207 [email protected]
242,982,246 *179591C05A6315E56A20D7D648695709CE8F880D XXCRKET4
242,982,247 *1790CB03962A2D7FD96EBE974B7AE07F83BDA81E XY\6
242,982,248 *17954603C374C4FE1BF441D4472796D24C8AECD5 [email protected]
242,982,249 *179511D533858087AD49B2B9195015F8E9CBDA8F YANA-SHVUT
242,982,250 *17968F9107EAB1A53A536C1C415473A0651AA292 YANDI-SETIAWAN
242,982,251 *179BBA8CA3E969945CE6F830A11AECCC0FEE1E25 yannick-van
242,982,252 *1795B3218F49E75B9A730CDFFE9F621C689B4257 YASIR KHILJI
242,982,253 *179C2BCBAF56601FF4F5E6FA1CFD3E54984D5A26 YFMW
242,982,254 *17936F253631CAFFE00DB50EFA5E637AD46747CA YLLIBYESAC
242,982,255 *179B2CE09AFCCFD2F21A2305DE8813C368D14D0D YNOHTNA.KRAM
242,982,256 *179C207F674CE35BF2019FD2D22F2F3C1893A133 YOSEF-SHAPOO
242,982,257 *1794483865F36690F07EE36B58B5C8D09DA24357 YOUNGLOSEY
242,982,258 *179103171774904E9AC9376330DDAF0A6A27EDB7 yraewtuo
242,982,259 *17960BDFB41FC86D62DB36273CD660BA56559F3F yunr
242,982,260 *17926621BB55429768308AEBB06ADA69F34D8CD0 zachariahesler
242,982,261 *179FD6031421B2BA74FB833E0BEE01667850693A ZAPHODLINDSEY2
242,982,262 *1799412C63D95600F3347A2A984886E1F420900B ZEARCO
242,982,263 *17976D2CD1986646A09EEA3B38288782DFBD6425 [email protected]
242,982,264 *1790638F8902D5FA6D29CE794FD69759C160C0E1 ZOLONGTAGO
242,982,265 *179F71D9755DFCAE53FA49B284D9419BA3AE2D1F ZSCEKIC
242,982,266 *179BD61843E9C50B5F5465B1B8A8B4F32F2D9D4E ZURI.VALIER
242,982,267 *1791D4256F4252FD53BBD5702C08C75CB2607CF8 КОНЯЧЕНАТА
242,982,268 *179EBF4ADA579CC754773B9AF04A0C13B9CFD434 кроазје
242,982,269 *179461E7085FBB4A070F2F68FED959384E23F1B2 мэнди
242,982,270 *1795E3900BED1452082CEC29C598CB26DE07D40A 《等到午夜》(wait
242,982,271 *179AD350AFB24344944427A508A21A498CBF7D64 10 kartoitusty
242,982,272 *179B75DE64966788347588F17940B0ADF8A505A4 1114084 ne-eiv
242,982,273 *1796C781AB2560B1F55182578306CBA739E5C09F 132-YUREKTEN
242,982,274 *179A81095A4537CB5CA9D3920B7E421CA5BA6946 135797531D
242,982,275 *1797EEEBCD940F07B416022949378A04CF7100A9 155kylee
242,982,276 *179C3C66B16DBBFEB926D2EC392AB92DA0C275E2 173636 HORTUMLARI KISALTMANIZ GEREKEBILICEKTIR .
242,982,277 *1796C34C15EB57A2195C4BF866C1E3917AB33F62 1858829 helsingin-kaupungin-lainopillisen-osaston-mielest
242,982,278 *1790CE591E8C454D782700AD19C863733F257828 1877925 DIE EISHOCKEY-SAISON WIRD DIESMAL IN BERLIN EROEFFNET
242,982,279 *17991AD52C51CF4A4504379CDE9808D7BD1D82BF 1.abishow
242,982,280 *179B965FF255EBDB6318C352ADA23009F17E6776 1.clandesdine
242,982,281 *179188B03159AAE3DE0BFAC6C6C096619CA4C45A 1detabuisierung
242,982,282 *179FBD9065826B6C073828DBE0E782BB5E730C07 1.eaihankkeiden
242,982,283 *1799030630522CD91DF836882A964396CA38F10A 1-fortspinnenden
242,982,284 *179A98E2EBBDE79724026277482EB0A120F4FF4B 1.HEIMATZERSETZENDES
242,982,285 *179675F7FF2DB631D98819C8FD39A04B9230A2BB 1.HEINE-FORSCHUNG
242,982,286 *1793034CE6B77617FCAA9E61D485053C6FC8BE71 1ILOVETHISISIT9
242,982,287 *1799A506D1C1F0067B519D3629EA69BA7E8184A9 1-PAIKALLISKULTTUURIA
242,982,288 *1794833FFA2A6367F40007A00AED1D08BCADCAC0 1 PALMANSCOLLSTROP
242,982,289 *1797996E003765339E8B06FCD197DD644DC7E81A 1phosphyl
242,982,290 *179FFCCFB823ACB5D4F55956A190A7B8ED828D47 1ROISTOIHIN
242,982,291 *179D61C429434EFBDA182E67B34FFD8AA20C7980 1-SIDWELL
242,982,292 *17916F6D7526A9580BE1224D3BC0B73991433F72 1.spasstouristen
242,982,293 *179509A19A67764AD8E2DE7ABB9A49B59A7A3402 1SUOROP
242,982,294 *179E6033D1ED5F42C0F65762F4001DD515AA019A 1-TIETOPALVELUASIAT
242,982,295 *17944D1B19BD730415C9D3B20E6A41AAD154771E 1violence-carlos
242,982,296 *17942A9E09407596FE6FC91C0F214E0BEF0E936C 1VLUGGERD
242,982,297 *17912F05DD23A159B7C3F70906B1E9DA58385712 1-ZEHNZYLINDER-TRIEBWERKS
242,982,298 *179223FE3957F9C67C7DD6814B4288D420E3CCF8 213206 BUT NEW YORK-BASED NYNEX IS GOING AGAINST THE GRAIN
242,982,299 *179436AB73CA7CE3C7969C2CF4652699A58E1DD4 2145235 LAINAN MUUT EHDOT ESITELL
242,982,300 *17963AAC18E9886C2F4AEBFFA9601C7ED7375459 2217515 the-white-house-rejected-the-offer-
242,982,301 *179C5AF2236B8369D16D6D14CCCC58FA4795737B 2299052 toivon-,-ett
242,982,302 *179D83C1043251861C3ACBE6CDF39C0C9107D13F 24897
242,982,303 *1799DC7833EECB23794BF779DB1CBFABA27075C6 2582342 "alotofpeopleaskmeifi'mamusician.
242,982,304 *17916DF9D556EF82C6A35F64103D62DCB90B75D1 25OCT1750
242,982,305 *1792DDBE97549E4274A3C799EA8032AB1F884E51 2695868 kaikinpuolin hyv
242,982,306 *179D634157EA21AB3A49E71A4C064EA3AF1D78BF 26oct1382
242,982,307 *1797CF86A37B515B5A714AF76BFE4476D5D789E7 2966758 VERKOSTOYHTEISTY
242,982,308 *179037892ACB038E94DB338AF3A2700ED9646618 2ALORNBSW
242,982,309 *179BD08407B5C15FD66DE3B69C3F24A1FA44A0C8 2ANANIEV
242,982,310 *179FC800D28BCBACD79E32334BE19BB72D76BA0E 2CAMERAJOE
242,982,311 *17903AC0912FFAC2345B468906E439C7DD719B64 2DISHUMANIZES
242,982,312 *179B4DCB4AFBE143D588D207725A9EAC32FD0EA1 2GB以上
242,982,313 *179C52BADD56B257F66EBD08FE3248677FE93FE8 2 LIBEROAAN
242,982,314 *179AB478298A18D1324673AFE25D7C78F8B2BE68 2-LOHNMAXIMUMS
242,982,315 *1798EEADE397C50206A826A97A16FB95A95B6C1C 2-PAZO
242,982,316 *1791199BDF36EC1703BE80ED4AC5A2F7C28424A6 2THEPRETTY5
242,982,317 *179B294C3515A9EB3E50B5A74AF8536ADAF93AC9 2VAASAYEH
242,982,318 *17986194E82A74824336C95B6EBAA47DB9865A08 301話「銀河鉄道」(1978年5月5日・ntv)
242,982,319 *1797936AADD1D756F35067803007502E3A6E598E 35-ozomatli
242,982,320 *1794489A5C1BD21B9BFE50973876BF1D0F4DAE94 395337 lbbmanagersollenbilanzengefaelschthaben.
242,982,321 *179B7023DB7C1A20B418D981A2FEC1F102A66E54 3FUAREUAD
242,982,322 *179A1CAD983503BDAC42E74B39FE44D19D9B66CD 3GIZEWNAA
242,982,323 *179E1EA6E173B6536F9686964D43F1DECFF470CA 3IAMTHEKING9
242,982,324 *179A3BDB24A3F48A8D84E186F956441BAD8677CC 3)*.*.*.SPLAT
242,982,325 *1791779221AA924C0BF2AA3844E99554053D3BE8 4BRONZIER
242,982,326 *17948C664A0AC93FFA0208F9DE1D52E6ACBD2F75 4GOINYARD
242,982,327 *179EC08C735A4451F77FAF8D771E2376AE664C85 4.HITZWELLE
242,982,328 *179C9C3870D7CA9700561816622051273D25279E 4HOWARDKITTEN
242,982,329 *1794DDD1262633898ABF15307B50783F5D074AB9 4JONATHANPROMETHE
242,982,330 *1794A395C988D979DCA7F4CE75EDBE71B6C2B676 4mytreasure3
242,982,331 *17999EB8588073D650141C0035E6A0BDDC3941F0 581918 OLCU-ALET-
242,982,332 *179A6102EB20C76C8EFB91C2173C1A01829042FA 5BSWKREIDLER
242,982,333 *17931BC0AFFF2F7D3CE546CCC68D7068305D6195 5BUFALINO
242,982,334 *1795C35BC929F288540D6F790BEAC7C5A8B41F67 5IADUTAM
242,982,335 *179AA6419E99B4219DBFC7775889AF8AFF18FE5B 5ilovewhale10
242,982,336 *179E04BD91AC1AC7E6F887D7798B6A6EE81C7D5B 5RESSORTMINISTERIET
242,982,337 *1790F2A87BE8C06F8D1966C29BD5CAACED79F672 5thedaytek0
242,982,338 *179001D0E00AC9B0E537C4815C8A61ACE7AA5CAA 6AFSCHOREN
242,982,339 *179055416ECBA613D275F6DF6DB9DDEAB25874CC 6BSWSCROGGINSBSW
242,982,340 *179D3136AA29A76DF83B09EA97901E0A367BE99C 6cody0
242,982,341 *179301069AA745646408143D05B76E8071BB6F81 6JAMALAT
242,982,342 *179D5A4790CC761F53C5125E400E4F77E005D97E 6MANTRASMILES
242,982,343 *17918579E0C62720A542EE67AADE95B5B5AFCD12 6MELISSA1
242,982,344 *1791C8574F4B8FFFB8BD5E831A76ECE3BE6DFD63 6PHANTOMHATTON
242,982,345 *17912875C0723D6158B60FFBD0E02B076B18DFC5 6rechase
242,982,346 *179C9D50A45E1A5ED7D935D53C09101796870F5D 6THEASHLEY4
242,982,347 *17915FF7686F7EAFC819CACA77B91A4599398C5F 72500
242,982,348 *179B3928EF74F25E0942D8971FF77B91B1640F0A 7EKARINABSW
242,982,349 *1799BA53292758F746A9AAD9271C54310E0FDED7 7ESIINNYI
242,982,350 *1791BCE15A25F6D698AC2F05EEB2413945DC6BC4 7FORSTRRELSESGLASSES
242,982,351 *179762BB1098DE9740DE845D91716A3D48C61490 7herdoop
242,982,352 *17965E25C57C0DBB80EF73E6FC73C10C26427707 7ilovemichael2
242,982,353 *179066CDECAEEB0CF2EA18E0C1EC10FB1A27AE82 7SKCODRUB
242,982,354 *17904B18BD5BBF4F0C304F6E30DA5CC8148C82BB 7THATNICHOLE
242,982,355 *1796AC42B5FA5C320EE6199DA47CB94761540BFF 7TH&RHODES
242,982,356 *17905232758ABA561F87C8F2B5D9A6E263414049 812cailyn
242,982,357 *179B4F94ABB2F9A87AC14FB9418F834DE6D9C1F7 8BUILDETH
242,982,358 *1794E3D2C2F3C2F6972FDE09BD1BED701ACE1F38 )8(*.*.d---3
242,982,359 *1796CC805C4ABA5635B4474C5F73C8EF142F6EE7 8EMERGENCYCONTROL
242,982,360 *17907D85F80761BFCD96832F75BF00B08A4CE7E3 [email protected]*-*-*)o(
242,982,361 *179978878D437F3822AB671E953E2E0BF38C3CD8 8#####)~O~O (>_<)
242,982,362 *1796371CB84B3590E0324CCE621963DCCF9BBC90 8PICKLEDUKE
242,982,363 *17992E0AAC39ED3AA870150A3789F209B984746F 8PISCESPEANUT
242,982,364 *17978C6DA26D88650F3D0121035707A3073F9486 8SEQUESTRATIONSES
242,982,365 *1797452DE8343A42D1D04F8D5EC34E8CB0E0B76F 955976 KAISERSLAUTERN.,.5...MAERZ..
242,982,366 *179D852730B86B36DF72E58BB6D8984CF566450B 95727 gazeteler OzgUrdUr ama toplatIlIr , kapatIlIr
242,982,367 *1797B004990644CBD13D78593296308CD176ED69 9BRIGHTTARZAN
242,982,368 *179192697605D2B0CFCEC160237906774EDF6A4A 9BSWONDERWERPBSW
242,982,369 *179C8B937CA38A4B17ACBF35831371FEAA0C619F 9ERGONICS
242,982,370 *1794F3C9F9F291C285C1E74D023DD070E252937B 9FFUFDLJOCD
242,982,371 *179061803DF5A7A8388599803F1CF51140E1E63C 9GNOSUREP
242,982,372 *179EC928C3F469B92A769A00154B3C5C509A6BD3 9HERMEION
242,982,373 *17999BA13B93FECC6FF2EB017D01A23AD7302965 9iamrush9
242,982,374 *179333946940E5692E9CB6A9A8A52FF92E7189CD 9TCEVONYS
242,982,375 *17974B7EB262C8FA3354F89AF3C05C8B0AD9FB0A 9variationsforpianoindmajoronamenuetbyduport,k573:varv
242,982,376 *1794D85FB68C24ED1352762254C344E0A2379E89 a2.mg
242,982,377 *179A73EF0CB9AFE371D5E08C9E79399A5E0FD78E A_3&V
242,982,378 *179A3817391309C500AA9EF0E3642280FA2F16B9 aaawyo
242,982,379 *179B137C3020BD61F091EF21B9DC0A0A6A28003E a;anz
242,982,380 *1793CA310984434D34D5DC1C344FE767673B6A1D ABHYUPAPADYA5
242,982,381 *1798092C9421B8B453AEF3EFE7FFD2F07DCF2E34 ABNEGATETH8
242,982,382 *179836D005C787692B05B04CD083CA7FA19EDFD2 abnottub3
242,982,383 *179827E812C80A6DD073C18F19AD589FD8BFED1D [email protected]
242,982,384 *179D964F8D2B167616FECAD2A6277FC482F8A93B ACHASHEIKHZAHED
242,982,385 *179D1ABD287CF909A4BFF6FED84956D642524068 ACSC06
242,982,386 *179C49EC7342308ECE32D5B824737BAABA56A1DD act.2:.chu-chu.face
242,982,387 *17976DE4D955268AA141EB5FD9406A6257DBE059 [email protected],
242,982,388 *179154C415360F84E13E9A64D38A6968F6843515 [email protected]
242,982,389 *179012FAE6497219E5C4184D1186DFE28C4DA38B ADORING0
242,982,390 *179D772BE476161BC57B617A6690740BD2CBC259 AFRIKANDERDOM8
242,982,391 *179762188BBEC8B2BD6243946751D2F41B507D49 AIQ2,
242,982,392 *179F9A869BB9CAFFA11BDE9C14449469BAA2EB52 ais-i
242,982,393 *179C8BED185F002E6F5CF27FBA4C44F4754A79AC a,k=#
242,982,394 *179919E5E73E78CEA6CE767A893915E7EB3CE067 akteurskonstellation
242,982,395 *17965E4D47B280E2E123BD8A77393855ABE2A952 alfonsosimens
242,982,396 *179AB9C76C6AF2A231FBF38EB212CD15BB254594 allenhatridge
242,982,397 *1797150C5D854818533A5AFE3E4E20A52791A407 ALONSOHWANG
242,982,398 *1793BA76C43138B7F552C0B8FA91A49D8F7B912D AL.P,
242,982,399 *1797E7DBD5D6F71C67A871B987FA0FA07B1B4C6D AMD#9
242,982,400 *179D8BB6AC5C9D259B7901981B3F05F75852FE3E AMP0000000000452834
242,982,401 *179553E6F0A22FDCCC27C30421F0CFB3F58AE449 ANDERSON.PUNZO
242,982,402 *179B9A0B215B8384CD31F69987E1221996BD5617 andras.12
242,982,403 *1795E24BAABA93DE8B9BA12F76A14000E58FEA07 [email protected]
242,982,404 *179BEC45299DF940BB6080BCB00B30471669B08B andresdurant
242,982,405 *179F87D2D573454A0FF6EAA3A56AA51213FE9E26 ANDYMORELL
242,982,406 *179FD7288F0C96B7BA16C1FE852636D01F3D9BDC ANEWLOWINGETTINGHIGH
242,982,407 *17941F78ECBB8979879269AE72163FDC1EE2E008 ANIMALITOS.(AIN'T.NO.SUNSHINE)./.WHITE.BIRD
242,982,408 *179990AA27DD99E8144ADB4D3AA5508421320AB9 ANIMALSFAMILY
242,982,409 *17925ED03D1CFEDC4DADE281AF01FBAE940CC765 [email protected]
242,982,410 *179587AD71F73DD9C58E1146F42D35989ABFA177 ANV+
242,982,411 *17963ADA0D6D87E8CD9E19EBA6C54AF1D8FBB680 an$z
242,982,412 *179E9F9205B8740D02CA15FE78318722290296A6 [email protected]
242,982,413 *1797EA3E305750C4558FAAFD8627249F905E5426 apair6
242,982,414 *17918BDC18E2F836ECDE3DB0121ECA5227DBC59E APQGN
242,982,415 *179262FA4A80028B64ABF542CD58A29DF855D290 aq22&
242,982,416 *1791D50E440BF26C99D0D258E8FA7A7C4316D067 AQL6G
242,982,417 *1795B41D50E88E57855DF3FAA294A1AF1A7FAD5B arajanal
242,982,418 *1790DFF011593FA59574C57FB0DC90DD1195AE2E ARMÃNLJI
242,982,419 *179FB0D939BB895BA6A1A055627DAC57E835F357 armoiries6
242,982,420 *1792FD370A378B2AE5494542CFAA8172ED2B2608 ARTURO.MADDOCK
242,982,421 *17974D61D2C4F5049BDE0D00DD4125C0CD3CCDDC arutiunow
242,982,422 *179F5645D5D61672228A19CC64AE694C1348D4D0 ASLEA16
242,982,423 *179488E18A35E8784D8F665D9D05DAE49371C4A8 atoomreactor5
242,982,424 *179331E01151D6A0A9D1AE85A50688ABCB2D8785 augustkinzinger
242,982,425 *179D20D04F14B2D64B0B5C372D1AC5DFF500EB4C AUNHOODS
242,982,426 *179575DA45A060BBC3A4CF9D770EDC48533E497B australianbuilt
242,982,427 *179F70AB00E96033C4F66B4A944D236555240ACB A:UT,
242,982,428 *179D027D5376EA57237810B4EA453042C76BE124 A%WMU
242,982,429 *1792A7C32E44987D27E39FA0A38E7EE92E99B5D7 `B0\
242,982,430 *1797E3994C24AF4E6C00D4221394838DCB4EFF29 b=04f
242,982,431 *179FC208366A7CC2E2B616ED71247496EE2730EE B17930
242,982,432 *1790787921200710DAE1E8FDD8D385F8393CB1EE b1is
242,982,433 *179918DC80F2D5DA7DA8641F03593A3773EB0FC9 b-5b(
242,982,434 *1797AA8D928E90DD807152A1DFEC244922ADA543 B8?4
242,982,435 *1790D9FAFEE2DAA3C448A972933F4BA33CF69CF2 b:8p-
242,982,436 *1798D4451DAB4ACBA5C9F484D99AD5A873FEFAF6 b9g=h
242,982,437 *17959DFE1FFA7BCAE81C6137477BF6FB7E75A557 baahoda
242,982,438 *179E85F68463E30DB2E5964F26A4BEC0205214D5 BAGWA
242,982,439 *1795845ACD10FBB6247A1FFA0847651560257948 BAOVESTE
242,982,440 *17964832FF68EC27CF5F2FEE21A961B801CE58B1 BARNEYHANEGAN
242,982,441 *179154FA85CA6C7F420F247C3B1B35CFB5F426F7 BAROCKRANKEN
242,982,442 *1797CEEF0D206E772501DE58672244AD22106B3C BARRY.PEZZETTI
242,982,443 *179BCA09D8448CAF79F931D8F26AA4C228682707 BASE.PARODI
242,982,444 *1791B15CEF2E7A1249A1C1FDCC99E6AD47618144 BATTERS
242,982,445 *1798AE2F237FD294E91B8904AE68553C42EA6E58 BBLTHRPTC4
242,982,446 *17960A14ACBDD6BB2A822D6A6F29FC62C52CA0F8 B+CZ2
242,982,447 *1790C61A6F0204CD3B26D3B2D2150F5F3F61A89C [email protected]
242,982,448 *179DB4F1EDA97ADDC70673E86EF08494E0E586EC b)%+e
242,982,449 *179C269ABB5B493F0DF40B08A0600C436AE35F79 BEcw
242,982,450 *17958FE8611D2B21FF91B760DEBF83B36E46B24A bej"i
242,982,451 *179CAEF66BE0F4AA23F6CE931077E19E6B268C91 bernardosheingold
242,982,452 *17907CCD93E8FA8C81E728C276351E3D3F8B2C1C B_FV9
242,982,453 *1791BC0DCCD9FBF9B89C2029691D7E07E860F04F bhh8;
242,982,454 *1797D6AAF2E61E74A4CAAC3F7E3BA47B1C9FC705 BhpL
242,982,455 *17977096EB2B756CD77D5422EC0116239D8D522F BIZ・ホーダイダブル
242,982,456 *179733CBD315C681EDBD19DE851455FB81528A02 bjørkeflåta
242,982,457 *179F552C8FD4FFCA081175443AF2FBDFBD06FE48 BL..
242,982,458 *179A3E90552BCCCF4D4FE7D4996C0063DAEFDCA9 BLEICHFELDI
242,982,459 *1791E2B77DE0885730E818EFAE4E126CB81C6C7F BLEO
242,982,460 *1796094570CD757425154B4061528DCD8D034DE6 [email protected]
242,982,461 *179DAECFE022DD754C36176097019B608B3DD5EE BLOWTHEM1
242,982,462 *179B055F05E9229FEDAAF8CADCABC0C40D88BC20 BL-+T
242,982,463 *17946F0AF79B9E0D9AA6095A51D21B75A81BEDE2 BMv&
242,982,464 *179F9E3BBA6FD4539DF66CFF79CB970179914B0B bnx2xe1h4
242,982,465 *1795D3DFEF20B9284D8A2A15CC813C9E69A632A3 BO1$TERIN
242,982,466 *179A3AAA4DE6D5877ECF812EA8FC13B7D1840B71 BONGOCONGO
242,982,467 *17912B2EA2F93A1A1864B11621CD557FF6BA33EA [email protected]~O.~o.Splat
242,982,468 *179992654C6A16F85CE0C8967207CF5B1179CCEE b,oud
242,982,469 *1797A0A18D0092CD72226C5901EF4628863292B2 B##p~O.>-<
242,982,470 *179000106D4F35AE13B34C2B3FF9786291363706 B/\R
242,982,471 *1792EF0E63FDAC2C24E2528487F2C0BF49559FD1 BRADY.NICOLI
242,982,472 *179FA7E93817443EB3F0D5A6B8BEB1D163C67302 breaking
242,982,473 *1794EA57980A4B12D472DA4FA9FE411DBC8FDDF6 BRIANREPKO
242,982,474 *179AE8A2D00E08DB5C9F07930A8EACC33737ED6B brookemae
242,982,475 *17930BC4FA7122696DE6AC3A4A1FACBD455081F8 bshdv
242,982,476 *17999AE4F8A7D3DC7CA0CE674B4E6FD502E81CC4 bt2d;
242,982,477 *179275B1F30D376282DD7BF969DDD78ACA58A395 btheking
242,982,478 *1796338CD160270AC01D1BFD221C2ED34E55F375 BUDSJETTAVVIKET
242,982,479 *179C9AC391AF686D50F238CAE3FDFBEE6A7CF7EF BUW(O
242,982,480 *179A49FB475E7202FDAAD46226A8A2F99B5CC0C3 [email protected]
242,982,481 *179F81044E2144554286C0BC355D1E1D89323C4C b-v7d
242,982,482 *179C017E59F00D86965CDD955C15767D7DE61847 BVFLU
242,982,483 *179B17822091469BF893E971FD2CAD6A87ABC44F c5sar
242,982,484 *179A825D3CA11B720EC8A0873DB7FA9E88FF2F22 c6ig2
242,982,485 *1790E191531DF4BFC5E11D975D86D3C1A1247759 CAIWT
242,982,486 *179E8CFF101A23D6F1DDEA190F1F88774C79AA60 CALVINGRADY
242,982,487 *179590DB7E313F4AFE0C3A86EEC6114C4449E439 [email protected]
242,982,488 *179400B649C6A35482D9AB5EC572297242D4C1A7 cantavi8
242,982,489 *179970048BCB9A21B5024690CA9F73AD3DF4C319 c;)aq
242,982,490 *17991CF6ED889C6085BC6A24D592EAD2F9CDB1ED CARMELOBULGER
242,982,491 *17929C077F923AF71CBC2749E477475059B914AD CARMELOFABBRI
242,982,492 *179589E93BF282AA274A2DA247C305B1D657E798 carmen.reece
242,982,493 *1796177E603532905D791C8376955212B0539861 C+_b
242,982,494 *17989B75B610015C8396762FA525F3252A099023 CCV_L
242,982,495 *17993612CC5507FD5D2C9B0C3765E596A02178BB CE40:
242,982,496 *1797227575D89399E7F1380D97C43E18E39D7084 [email protected]
242,982,497 *179BD331CEB4BCD2CF699B9A332958D1C645A2E3 CGAV_
242,982,498 *179721C73E1A9AF446E2BD517FF42FD6AD72547C c)"?h
242,982,499 *179572279F59FA26F2494CA5B92D20443513E54C chadwickangelico
242,982,500 *179376DEE25FDD668EDE5F315134D21B7A537F56 Chamblee-/tS//&/m'bl/i/
242,982,501 *1795F389BE4C03A4AFB6101107BC2A53A28850C0 CHAPTER.07-02:.HOW.I.REACHED.HOME
242,982,502 *179E70AAB18BBC05E2B9176F31D982B6F91C1673 CHARAKTERYZYJĄCA
242,982,503 *179EDA2FCDA74CA239D2AC61F5F3F815958DB7AB [email protected]
242,982,504 *179CF64BFE3FC61511023ABEC6234D263EDA3904 CHERRYBEL9
242,982,505 *17939BA1F843EA166753CD7C2383BCF4457AB8F6 CHERYL MCMILLAN JONES
242,982,506 *179C8D5D6942447AD687FBAA4A81A3F3ACEB8D61 chrono and marle ~distant promise~ (arranged ver 2)
242,982,507 *17926CB2FD1DD0153655B2914C2BD920515AE381 ci5gu
242,982,508 *179B913CC2F918BE598ADB1EC42D4B1C255F86F6 CIUI+
242,982,509 *179AA054373151A7564D627AFD9B6799BC242248 clairana0
242,982,510 *1796A50CDD0014C45C597C1E0D2A57D7C8EA4E0E clevelandbouwman
242,982,511 *17972214CFA14FDC7489374A15E0457AD55E9417 CLIFFORDLUCIAN
242,982,512 *1796BB3596BFFB75870A87FA53507A47F874A7A4 CLINTCAMPAGNONE
242,982,513 *179480D5BFB3886799132DA97CA9C6FFE9CD968C clwug
242,982,514 *179C9BAD12FD39714B749B383836B96459DA4614 CMMRO4FW5HMIZ65
242,982,515 *17995966AA0357A59B7836B3F3DF6045E8E4174D CO8N&
242,982,516 *1799FAEB6D7C2F6FCD6CE0A69289D32A4E5E193B COLEPRECHTEL
242,982,517 *179964B9750B25BE5DC9492C5DCEE0EA14BA56DE COLTONCROSSETT
242,982,518 *17953771533497B9827B35CCDECE74CC09406D66 COLUMBUSNAPIER
242,982,519 *179680205B79939A0BC4726273BDD4C3E8CF9780 [email protected]
242,982,520 *1796228B2CA40CDC91F4309CD90C45BFD5FC5D9E [email protected]@T!ON5
242,982,521 *17920AE1F2C542915A5C7449E963C7E5B6A04EA5 COO$(
242,982,522 *179231D9A15EFC7CABE91F7BA8C6E747539AF9AF c:\programfiles\commonfiles\windowslive\.cache\a5722541cb5c53
242,982,523 *17959CECC593421C4DF22AC338EBE1EFB8335576 c:\program-files\microsoft-office\clipart\pub60cor\ph03379ijpg
242,982,524 *179C84BC00BFC9CA2C8E89C3C790F3710219F2D5 CQ)O.
242,982,525 *1793F1FBF903B028BDD58C8BF1D11FD57BE1A46A C.R$M
242,982,526 *1799E2D74CCE36A99FFEE6CEB5AE4B7EA37FE5F8 C"SNE
242,982,527 *179A7C04011301844BB43F01CA6CD792DA1EB09A Ct=V
242,982,528 *17932EC870020808C703584808E5763B81A3417B c?x:
242,982,529 *179CC93DEFD5E4319043AC0F77A4A43BD72F7CA3 D5F;
242,982,530 *179F46FA151796319B8B6C877AFDF822C0849264 D7U7W
242,982,531 *17986A4D352964BE1F6A63478DAD0BB800FB7F55 D8GP
242,982,532 *1791A429D342925158B21F11099D02BAD1784666 DAHLTWOFABLES
242,982,533 *1790AFD506E3F3E8B8AFDC47D55D45EFB214A472 damienwamhoff
242,982,534 *179371BB17EC835B52C06FD99869FA0CA41CAE8C DancehallRock(feat.Dr.Ring-Ding)
242,982,535 *1790DD917F7B36129798B89F4A356F71188BCD5E DANTONIOSED
242,982,536 *179C763489C078E65628CE5CDC4C482818AD9D9C DARNELLWISHON
242,982,537 *179BDD9886EC0A25E229D08DCDB7B3ED543030B1 DARRIN.OAKLEY
242,982,538 *179392D5B8D4FCD52E2A526ACC9837A35594C077 DAVIDCORRIGAN
242,982,539 *17976CA8306A113665F0A9749178BF2208B9C94A DELMARSELLER
242,982,540 *17912A2427A08E8E4474F197040BD7579D03EE49 DEMOCRACIA LIBERTAD
242,982,541 *1798AFDC4C52B162F497287B60EF2DC2A28F95FE denise.cimino
242,982,542 *1791B86F6C6E6C434A8B8A492D9DE022A8166DFE DEPVC
242,982,543 *1799DDF06ABA01705AFE98A0DFCD69D2453D1889 descriptionofproce
242,982,544 *17999629831FA1984B2870DD0994541FF6EF455E desert-curse-(no-vox)
242,982,545 *1791405DCDF2ADD7E31C309555C0171EE5811105 DESIRECLIMAX
242,982,546 *179EA5DD786AAE56AF5C139C02C62F1B59F4E704 DETUFERN7
242,982,547 *1797E2A6D18A1279FDCB90C2FEC9DD669B7D5195 D(FKQ
242,982,548 *179444CD4C825F3742C1B6B9BF9AEC0E898DC43A DG2T
242,982,549 *1793E57B24DB2DE84CDC4969D7A8EFDE34E0EFFE [email protected]
242,982,550 *1792BE341B1D3C9CAF552348A54DE5E52EFA9022 di#ld
242,982,551 *179B35BE8573919A46E4F35EA1DCC4DCAE67B403 [email protected]
242,982,552 *179402FFCB4D1EFCECD7E4BFA870412075053ABB DIRKACH9
242,982,553 *179F128DD3FE74654A6901E7FD580FA753E73A2B [email protected]
242,982,554 *179BFD31669FC2400E219B06D3905623BBB83C8E DISHERITING8
242,982,555 *1793222D450465AB1E33B55EE511500FD5EAD001 DJERMEO
242,982,556 *179EFFD5F4986438D79715062C599E97BED7D091 [email protected]
242,982,557 *1791B68E6C636174D5FC6BC04351B8552D92632F DKG_L
242,982,558 *179C8B344623B769F62018C41CEF5F9E7CFC2A78 DLF;
242,982,559 *17911D02C96161AE3880F915114C9F5498C222BB DM790S6930W
242,982,560 *179F8A6AD0EF18792EA4CF481DBB699BB860EDBB dmkdir
242,982,561 *17952F3C7780D17F2D2F55B2235153399F55DB2B d+n.:
242,982,562 *1791B438261FEBEE080F0188FF80FFDD1D51CEA0 DN;88
242,982,563 *179E2A45A22AD65E6DD099D111730A0AD5F07382 d%n=p
242,982,564 *1791E1426CF4C92D01C6B087FACD776998494BE4 dn,w&
242,982,565 *1792D8886F3C461708F21ECE2A580E96BEBFD963 DNXI8
242,982,566 *17933E9EB01B288F21640593A370B2B120EA3296 DOMINICHILBNER
242,982,567 *1797E1B4BDEB1F11BCD55EF0CE3E0064354B0657 dontewenman
242,982,568 *17968AA9152C7875F231BADD81CAEAF18F5BF3A8 DON'TGO(VOCAL+DUBVERSION)
242,982,569 *17979547CBA2015C391426282DD796D364783363 dorseymckellan
242,982,570 *179F6840FD2BE6FA90582645786C4E9516383653 dosx
242,982,571 *179B8D1E1CAF36118D506C4A5B09EFDDEB1EB710 dqw
242,982,572 *179614DD5CD2B9782482CFD565BF2A74FA9E2EE2 drzu=
242,982,573 *17904C3336767239BFBBF624DD2B644E047B22CE dsvli
242,982,574 *1795F7301970756230AFDF82E583A24C2B4E2ABD [email protected]
242,982,575 *179C7135F71F06E3BB515F69EEEFA5A5B7DCF066 DVCTNSTRKN
242,982,576 *1796323DBE70C4C4A8A1B3ABBF3BDECE324CC3D9 dx,zy
242,982,577 *179B1A76D0E5131D7C4A132AB44FCDFC46D7C65C D:YNI
242,982,578 *179F29EF5AB4111A57F25A5238C0BBBA56EBA861 e%a
242,982,579 *179A17C8CE1DE7FC3C7CA28C544EB1AB1766EB6C eb"s#
242,982,580 *1794973D41E644F667770F26E6B3DD737EBE97DE ectocune3
242,982,581 *1795E9ABFA22111BA991F13FB4984CCDF67CA225 EDUATNEP 1
242,982,582 *1798BE2A10FC0C2604615F839BE871C47B40AE64 EFVTI
242,982,583 *179144D2481D1442DDB866688F286A4DFE02C2AA EINNLNK2
242,982,584 *17977005463BD597882C5C311B3176938B57AC40 ei?up
242,982,585 *179C490232B64B22DE7AE4C9D5186EF86D5A9132 elbertlipkovitch
242,982,586 *179CBF8B636E1A9B36C04173E5A9D570E989B24F ELICRANDALL
242,982,587 *1792C014CEEF1B89FE0A30047FEB64AFC22D7989 ELISHARENKER
242,982,588 *179A34D37FAE0A322FEC9C014DC0EBC01D4284F9 ELROY.MOYERS
242,982,589 *179C6B2D1D4F863A7A2E1C62A265F807B1C91A90 elyg
242,982,590 *17902618F119E73008E6FD69954C70F327C02DF7 emiliokattaura
242,982,591 *179AECAAB8EBC65033A08E0D9BEA0FFD0A2F3702 ENDOSYMB
242,982,592 *179E9E961E6DE9D546127B5AA803C024988784C5 ENMODULS9
242,982,593 *179DAF3456B0EF2FDD59B1F7F958075A83FD1DF0 enunciateshttpwww.i
242,982,594 *17993F4A81261B62BB891023DF863C304C247C85 ERASMOVITELLARO
242,982,595 *1795D6D551F30124C482CA8E5A52BAFCA41DA9B6 erickkikkert
242,982,596 *179B2DFEB267EC95F91D98ED7C88AAF0CFF46443 ERIFR
242,982,597 *179CC6BAFFF177EC4ED7A77F9A2E41D7D49D9CE5 ERWIN HAKIM
242,982,598 *1799A71B9C9DDFCFAE75045BE300B78FADB7DD86 ESISTING0
242,982,599 *1794F89249490E8A685B0783F38A4EFBA51A7F7B ETJ4F
242,982,600 *1794A2B85EB1324BCA6E59397D88F5E0DE99551B eumitcom0
242,982,601 *1795F947CD54C6EBD6470D48B3F59A1CA395A26A eure-armut-kotzt-uns-an-20-(feat-la-crosse)
242,982,602 *179BD6DADC0C283C85335C342D7F15B81860997D EUTSLERED
242,982,603 *179C53D229AADC2547873476285E1706C90AE9DC [email protected]
242,982,604 *179D8CFB4BF2690C1C76455BD7AC6074FEC84BEF EVERETTE.MABON
242,982,605 *17993EB51E63E02A01352E295FEF915FD4209634 everybody's.acting
242,982,606 *1796EC863182034DD0C42DBDE67D6DFE004F16BE evil_penguins109
242,982,607 *179D35EABD6A1D67CDE1F4AD36E826A9694A93B1 evl}
242,982,608 *17937B054D0493383691AD6A6E0FF262D50B7804 EXINANITUM
242,982,609 *179D6CADFBCB01B64CA12BFC03DCFBD815A3ED28 EXTR4C14$
242,982,610 *179A911AC5015BD451D59FCA204B82721C0B54C9 E%,Z
242,982,611 *17956DEAA22B9636601C2370F796C29B71C9671F FASADES5
242,982,612 *179F0DC219E092020660514E5045F7084F4620AD federicomockbee
242,982,613 *179C212529E51F5C92661081C2E0926189BA5ED9 FERMIN.SKELTON
242,982,614 *179E7CBC09863CE0B68675ABCC62137BBE9DD489 [email protected]
242,982,615 *17928EBCF3B6917B76B005D7D8562D4B880448CD ffokcam.1
242,982,616 *179323E5FCAE91B59702443174AF6B097A8F809D fiietu
242,982,617 *179C6C935F4F3301C19271780019E5D94E0DCA7D final fantasy vii 'ancient steps retraced' oc remix
242,982,618 *1799FE4B67032190F42144EEFE72F3B6ED9F2CA2 FIRKINNED
242,982,619 *179B37680E88605E54CBD453B14166870885056E FIRST_SIEGE_OF_BOULO
242,982,620 *1791F51DD2086D24CCBEA0C228538F0316EAB7AE fiterbal4
242,982,621 *17962AFCD64CF496FE97FE4A71EF8AE6AD34025E [email protected]
242,982,622 *17905AD878C8D86F48FF1E6ED1E0524F5F05F742 FLEXIBLE-REINFORCEMENTS-LTD-|-UNITED-KINGDOM
242,982,623 *17985DBB3AD41D31C72E22261D30DA15799ECDD3 FORGET-TO-APPEAR
242,982,624 *179AAC37F5C286B4EC55934155AF87E02250C32E FORRESTSWALES
242,982,625 *179993B2D14ACBDD167926CE3B3E737F86370227 frearis0
242,982,626 *179F061C2223AE4479FF6EC159969268E3594B9F froggykim6
242,982,627 *17907AC54CE3159C1A38C3FD4049CB4F9EEEEC33 FROYLANB.
242,982,628 *179407215486E6C625F768C51A8098E8ACDCE9DB FUCKEMUP3
242,982,629 *1797C6F83429C9087E181C530CE2F345F80484BF FUCKPASSWORDS
242,982,630 *1794ED74191E072457FEB5D4F9DB5D5CEEE7D9D4 G103939
242,982,631 *1799740EE0BD4258100AA5CECAB862CBF9A25BFC GALEN.SINDLINGER
242,982,632 *179C8E26219F6084595346E044EC37E0273999C4 [email protected]
242,982,633 *1790F96D19CC1D3C061A723644A0005C25D87408 [email protected]
242,982,634 *17967A24072E5B433C049664215453198F13B2F9 GARRETTPOWSKEY
242,982,635 *179D91AEA7DDA4DFC23BB6354CCD65E0E5A64D2F [email protected]
242,982,636 *179DA65465DBD02397C2F7FC19D7F75570E03EF0 gniwollofaremac,pocehtdrawotyllufesoprupsedirts
242,982,637 *179B1E17DDDD1A2E3C26B6FBAAB85AC23383F2BC GONE NATIVE
242,982,638 *17992C4225C54BE80EE0A86E14A379A95BC6E997 GORRI1234
242,982,639 *17927CB27E8723B14AD4D59B2DC067915D82B04E GORTYSES0
242,982,640 *1793765F573C4BCC12E08749B7BF2A427A9A4CC2 @#$%graphic
242,982,641 *17970C0398D915058328C91B82A550984CC0135C GRIMALDI.ITALIA
242,982,642 *17999E0E80AF7EC4880C77EADF62B165F4D24E12 groovyfishing
242,982,643 *179B5D882FB38D07472995A0B39DF798C17AAA21 [email protected]
242,982,644 *179F398E82512C6DE1419098BF3030AC01A5891B gunichi
242,982,645 *1793793547579DC3E470E747C9090AB28ECB4AD9 [email protected]
242,982,646 *17985C8949C3BC04A73B1E8A14CA7BB5817DF0F5 h3l1port
242,982,647 *1797BF59C5583DC501092EE9F33B527164B51F9A HAMLINEGIDEON
242,982,648 *1799C7B67DFE6A208B6507813C27476C23AABCE9 [email protected]
242,982,649 *1790EB87BC6A801421420363BA246AD008527BE7 [email protected]
242,982,650 *179F1389B30945C7E72D79BA3F89AADBD29ACE83 [email protected]
242,982,651 *179E07FC8C16459334845AECE61D45B19CE71DD7 harlankeach
242,982,652 *179F776E184A8A6985A510C276F93C0D2D3CA2D6 HAROLDVEINO
242,982,653 *179438D790B71EEF1D2838AAAB239241A2E3ECBC HARRISLIZOTTE
242,982,654 *179BF649E3B910BC35EB271A2121173FEB9FDD52 HARRISONBIRGE
242,982,655 *179CBC16D0E3265820B4215CE9896140813C3FC4 HARRYESTERS
242,982,656 *1791891D75AAD37928FB12D781065058AB37E0EB hbkjbl619
242,982,657 *1796795291AD1D1E8BC31622BF870489DDD89B78 HERSHELROMANSKI
242,982,658 *179BA93EC9F8F59C9988AF04B69F6437AD44F125 [email protected]
242,982,659 *1792FA1D5AB3EFF70BBB498A1F83FDC2E6AA42A3 HGRUBWENS
242,982,660 *179B2C3EEC5B8297B538B82A8ED411AC1561E4E0 HI5Y
242,982,661 *17917E00B3B1BC8C649E642F3FB1B02DD4AB4730 HILARIOOBERLIN
242,982,662 *1798FAACC9F5D84BD7FAE22C4212877DD5205D53 HILTONLAUIGNE
242,982,663 *179606749748DFCA340822EE2182F2B32C8146C3 HIRAMDANNIS
242,982,664 *17977D38FE743FC8ECB4751FA7C319E176FA430B "...HISLASTCONCERTINGERMANY"
242,982,665 *179D9ED39219296AEE32287CED5945739CC3204C HMF
242,982,666 *179E27C9813214F198849E273BC767CA5EF21C78 HOTTISLUV6969
242,982,667 *1798F2A012DA272CD69A7331A745085C2B9528DB [email protected]
242,982,668 *1798425B7B118387FBF2644F0A5CDC565E624CD5 HOUSTON.MARBLEY
242,982,669 *179504359571049B4E0F03CD8BF519AA0B40D8C4 [email protected]
242,982,670 *179EE5CAC62CF6C8F64447D9CDC1607E4360C89E HUMANISTIC(FUTUREBREEZEREMIX)
242,982,671 *179C5EED0DF04200C0947358EC752D45D57EDB2A HUNG.HILSGEN
242,982,672 *179405F2AB550358C10B0023283B907AF8BC4C3A huyoung3
242,982,673 *179E14D8DCD0FFC00970D44AB973202376EF8D7E ibrahim-abdulhamid
242,982,674 *179E06C1A444EF044947AF0A71416142441A6E22 [email protected]
242,982,675 *179C1F7ED4EBBE39E5B6C414B02E7E353A983932 [email protected]
242,982,676 *1792C0DC0ED9D26C289E23B034A75B01ED7DE12F IILECQ
242,982,677 *1796DE4A57CF7F0378C4D3B0E5D534AF7389AE59 IIQG
242,982,678 *1796221FD252D34582ACC29AFAB6C124AA361711 I'llBeYourWhiskey
242,982,679 *17911A1166BDA66D0B8FF0556785863713A66851 ILOVEROYAL85
242,982,680 *179C24DF72A5BE02597249DCBAF549CE138E17D7 iluvhome77
242,982,681 *179E22EED7B849E550A0CB2973C3759B91BE675B Images:II.Iberia:II.Lesparfumsdelanuit
242,982,682 *179E29FA735825BB56B86E684A9763EF62C49FDE [email protected]
242,982,683 *17937BF441C452EDD6EEA9BF48F0733D9D18DDED ISAACEDWARDSON
242,982,684 *1793CEF45C3384F1E9736068A1A12903CB3A5592 ISIAH.NEEDELS
242,982,685 *179FEB1AAB013E0FB503B9E564228B2203D9343F ITSELF25
242,982,686 *1799790BC50906239F2D12828A9E4EA17E37B743 IUHF
242,982,687 *1794908E4E7E4E53B127848F825F73FCF3BCF18B IZZUDEP7
242,982,688 *1799D0ECB67C4FADBFD23C4CDCDAD39F6277773D jacinta
242,982,689 *179C6EFF6228C603C038E942A06568EE5CD27825 JATINGROVER
242,982,690 *17963A14A8C9099719527F631D945832BFE9D943 JAVEZZ
242,982,691 *1798DB13D0481EB0B0ACFB4852C2886F93B7ACDB JAVIER.ORDAZZO
242,982,692 *17988FCEE16B42B3BB6BC09DF11C0ED5B9D46164 jazarií
242,982,693 *1799201923CDC1976A617A14776DB1FC8911754C JEREMY KRAUT
242,982,694 *179CDAB327009649412B0C7E2AF2C6C381EF31D4 [email protected]
242,982,695 *1797CA600E242322237B2FCE3079B89CB663019F je/y
242,982,696 *179CB6F73CDCC3B7D27E72C4569205D43A023C47 JKARKII
242,982,697 *17995CC1609CFF0BA3950EA4585844A9D899F04E JKARMHAG
242,982,698 *179CDACA280F386EAC0BB7C98E1D552BF2B4F2F2 JOELMINISQUERO
242,982,699 *179E5BC03F8299F9BBDC91511DA780BA40D76C7A joey-olimba
242,982,700 *179BA94E31AB6327A8D734F1083EED175EB0FAAA johnbuntin
242,982,701 *1797A3E3A67A1BD5D216FF334332D2E84B0D5971 johnny.bose
242,982,702 *17928A2209308B474BE53515468152B57FCF27F6 joseph-eleam
242,982,703 *179FD83307434DC33E74A4A2CFB8AC8CDFA6E936 JOSHFLORENCE
242,982,704 *179ECD097C5B2D7071F118BF8A1F233C180CFEB2 JOSUE.GRISSOM
242,982,705 *17938995A3F383292A6002B3108A22C1FB7455A5 jovanova-zorica
242,982,706 *179809D1CEFC39F2BB03C1D1526903FF416FD0CA J)-POD-NIEBEM-CZAS
242,982,707 *17997DCC0A9D13C22C11E64F20D10D66D0F51B06 julesmunley
242,982,708 *1796E4A80746EF8D48B988AF89664C84D5620A03 JULIUS.GAUDINO
242,982,709 *1794C535FCF6E2D0B79EB2C56FFC5E2F694C3629 junges3
242,982,710 *179B818C8E34A1A9FCA68BE4AE35CAFE6B9271B0 kaedon320
242,982,711 *1790D64014DC8DFD1239870B6576EC600A25C159 KALMOESHOF
242,982,712 *179500A9BD58C66148C2AEEC5C778D87575AE119 KANDAMARANM
242,982,713 *179DD63B488C48AB1EF3482D55B59BCEA4F4B353 KANG:IROマネージャー
242,982,714 *179C17EE8A9BA060AF6191B2D72DC3DE44EB9F20 KAPITALIZIRANE
242,982,715 *179686CA1706657B54D00C14845576C68AB32CBA KAREN-O-AND-THE-KIDS-WHERE-THE-WILD-THINGS-ARE-MOTION-PICTURE-SOUNDTRACK
242,982,716 *179C5FD1A00319BBCFDA4CA1A0A9209375D80266 KEEP 'EM ROLLIN'
242,982,717 *179259036602633C5059EE96B8145AC0917FC97F KELLEYKAMAKA
242,982,718 *1798A7AEDF5195EC605DAE0FB0CD7D377B8C3741 KENTONDRUCK
242,982,719 *179FCE3865E5D916F11A2CF08FAA204936EBB86A [email protected]
242,982,720 *179F67AECCE45300F1E296177FE25667DF02D3A1 kilcoolegaa
242,982,721 *179294A27AD5103CDA7BD3CDC5CCE7A376F0D25F [email protected]
242,982,722 *179BA087E3DEFC70D9B975DA5161103C07F88C52 KUGELFARBE
242,982,723 *179E3661E73C040480B3DB99E2690505F6FA9E9C kunjūt
242,982,724 *179C7B6AD9CEE6CC54B46C23977E51583FD068BB LACY.MULDOWNEY
242,982,725 *1798A968C1FC42B50E119E4D7DCEC24B8A5D2D00 LAFAJA
242,982,726 *179450A7C33093EE4CDC656D6620236D075CA606 LAMBEOCERATIDAE
242,982,727 *179DED06F70ED6AD1A52A702E11101AB528EF597 latoya.riggins
242,982,728 *1797B66EF6499A8EF8D9E787FCC27EC35FFAE8B4 LAVATORY'[email protected]
242,982,729 *17914A45ABE09C1EA1881B09E3672CA981A5A75F LBREARTON
242,982,730 *179E11C79408AA36098D9BF037B26D768D71B766 [email protected]
242,982,731 *1799D135A343EC9E129D2500262AED58E39F977F LENARDVERGE
242,982,732 *1799AC042D8AE77DD1D29F38FD05A16CE591C1CB LEONEL.ROSENTRATER
242,982,733 *1791D218E04DB49A8DB6F22FBB11BA1B17C038CB leopoldocircelli
242,982,734 *179B8C168CCFFD0F0B3CCCDBEF08F8B5962DC0E1 LEOPOLDO.COTTLE
242,982,735 *1790916C3BD887F3CD7A890F84E23BC7813503D3 LEVI.DOMINGOS
242,982,736 *179B816826B2F9E23A69E2A783ABB0921E0F44ED [email protected]
242,982,737 *179284186EB889EDACC73B58DE6A1DC2B560DB57 [email protected]
242,982,738 *17996D341E9B8DDD2824287A5E0C315BDFF20105 LIKENYD7
242,982,739 *179EFEF1C7F03EDA15FB30333A06641AA569228C <li><tt>-e</tt>,-which-tests-whether-a-file-exists
242,982,740 *1795F784B7564965425F4AB2EA4FEB38DF11668C LIVIN'-FOR-THE-BOTTLE
242,982,741 *17920F168E6CB7ABF65400F4C10C0A8F8687E22B LLOYDABBEY
242,982,742 *1795D5B116199380AA71387D21E971EC9ECDB4BD longstgelais
242,982,743 *17996CD854CDE50EC605BC3B50759238B0A005ED LORI LYNN BENNETT
242,982,744 *1796EF517DC5E468906318EE1BADBCE9C705B2E7 LÕUNAPROVINTSIS
242,982,745 *17995FDB2E77671C5858389969302EC375CB9940 LTIAMOO
242,982,746 *1791EFABF109C0E3A72A8BF3BC7D73279CD58123 LUIGI.GOUCHER
242,982,747 *1799EF9C9D457BCF278009805179E78DFF66EDDA LUSEUN1234
242,982,748 *1792234F16991514DA4E0769646A9AD2D9026F03 LYSMLER0
242,982,749 *17960D881EC054F4BC2F837E72DFA2B601BE5AC9 M4RK3$T
242,982,750 *1794D61619110A4F7C4ADB7D4D553CDC137331B3 MAHFOOZ6
242,982,751 *17920B586ABDA69405455B6073C070AA0BC47D34 MALACHI798
242,982,752 *1797DBA3A1E540CEE918A8FE82D7557B42B36AB5 MALCOM.YAU
242,982,753 *17984E6648E01E9913E7BA132EFA65AE2A5185BF MANIFESTANT4
242,982,754 *179780FD74745DC44473164C0C8DF83DD2D62F12 MANN.MOT.MANN
242,982,755 *179E6F2CB2730EA6FE72073FE06A3320C2EB3BDA marcosmadrazo
242,982,756 *179F157AEC6192A3AE778EF2144B2BB647358374 MARKHAMITE
242,982,757 *1790199AF5EDF9641F4474958C13557B1634AE98 martinripp
242,982,758 *179461E5B68C6285EAA8E1567C59AA2F0F687046 MARTY.CHASIN
242,982,759 *179AA81BCA1FB1D4591900017D214A53AC5F73E5 MARY.MAY.&.BOBBY
242,982,760 *179164BCB0854F1449081CB169253BBE63C1A70C MATT.PARTY
242,982,761 *179FC404C7077C355173327D46ECA36DADD385C4 mauriceenstrom
242,982,762 *1792B96594DF4B2F048F0C572FD563EE139CD997 MAXBTHEWAVYHARLEMRENAISSANCE
242,982,763 *179B5ED5437E5D9A9CAD240B472BAE9AB98B81DE MAXWELL.LARMER
242,982,764 *1797BA327BE4BE2053090A5C4DFF26E1C19B6B95 MCALDARONI
242,982,765 *1794357DAF2619739ADE78D55EF0D1A72EFCF94E mdmapdotonhillandale
242,982,766 *1793ED442242A426AF44C789491D67569423D34E MEGANHUPE
242,982,767 *179C3E81E752237B538CC49DCDB2919E23BE2439 melchor-de-concha-y-toro
242,982,768 *17967FEEA167AB731EE14971E5105A7DB2366CD2 memoryt0
242,982,769 *179B3740899ED219BD57D4A4993DCE33BCA397B6 MEXK
242,982,770 *1793A2B75332E9BE1DC84FB3C944D45AEC80F677 [email protected]
242,982,771 *1797B91F76D2E1BE16AF34FD689CFCDDDD3C70D7 michelhuygen
242,982,772 *1790A92BF94AA0C8E4262981074E89C9C1331653 MIKEGANGL
242,982,773 *1794524E6E6D3E5F5B2124D3B7C2793338DD246E MILES.GORSUCH
242,982,774 *179274C642A8B234773D6FCAAD2BD3A58344F47E MILTONMAROTTO
242,982,775 *179E2A495324CF36123C3D058A68B55F3BD4136D minnesotský
242,982,776 *1799E3E33EDF5E2FE0E80776F4DFB6821EE4E644 MOODLOLBUT
242,982,777 *1795ABCE62765AEAA2982DA0CCDF7925CCC09B38 morford1
242,982,778 *179D77E16357022246F651F73FABF6B2B33397C4 [email protected]
242,982,779 *1799E45F0EDF6C7E826F164901CFB371DE89F7FB movie00003
242,982,780 *179B9D68E76E69C1C7D0E1CC5143CC0F6745F685 Mr.-Recruiter
242,982,781 *1792B6C98A395FE55A6267C76B28462FE462EB21 mutating.virus
242,982,782 *179C787295115A50A792E19232CC3F7E5EB880D7 N50-16499
242,982,783 *179E569C9EC57273D0C498B8E278EABC7059C1EB NAMEBIRTH
242,982,784 *179CCDACB91596B149159FFBA9CEFF1CDAF5C0C8 NAUFALABDILLAH
242,982,785 *1792B72DFA3DF1F979CD1483C2C8B25BF45F416A NDOURMOHAMED
242,982,786 *17977E7595EE66397B3C8598B4C73E0C8C62EF7B NEDDEOV1
242,982,787 *1791FF9E168217B097A43DF2C241683C12FC04AC nedp
242,982,788 *1793D2F816CA497AB751EC6C0C911B89448CDC18 neliettim
242,982,789 *1791E1E733336D91439DFCA7E387FC4A18F5C47B nemesis78
242,982,790 *179DD46B58C98860680F4D69B846DAA38D4E442C neyriz
242,982,791 *17967FFD1D915BEE2062873A4C483D653888FEA6 nico-para-asa-branca
242,982,792 *17972744344A19D27D583B6BBBEC390FBFD27AC8 Niessuh6
242,982,793 *179E5E37022CCB4C9A0A7C46D6E1B2F4896E8DCA norrisquam
242,982,794 *1795922A6638F6F553C07BD21AC43F110344B2B2 NRMLSNTED
242,982,795 *17927234F90BE978C6B968666A4B658B0DE03A41 NUESTRA-BEBE
242,982,796 *17911F3AE43D9FE502913383BB8B97DC3DD28FA4 [email protected]
242,982,797 *179E379F2856F900F0CECA7FCB08D576EB6C56E7 }o{~-d------3
242,982,798 *1791D636A08CC733AAD714F80D5C472E9E7D8E45 o de juventud (feat carlos acu
242,982,799 *179641B0AF64CEC387EF30E21060C5D23CD9B863 ODISPRESSNELL
242,982,800 *1790720558F90EE0809AD56006D7F162A75884D4 o->-<~`.~`.d---p
242,982,801 *179BB495D8D2A07ED92C2FB65B5F2044A6A1A3F5 offring
242,982,802 *179953B244EAB3CAED3D1D167990BDFCDFC94C17 olliecollard
242,982,803 *179DE76A3B9FF876DF486F716344A60A629F25A9 OMARELFAROUK
242,982,804 *17944AF546CB285C781B364D4AAD3D915B89FEC0 OMNIFARMCOMWWW
242,982,805 *179F63FE9F14DE69AC2D5BA008610C6AEBBF82A5 ONETOOMANY,PART1(FEATALISA,JU&GMONEY)
242,982,806 *179B0655C3ECFF67AAA4D9456E7A5412EEAA52E2 }O{ o~ [email protected]
242,982,807 *179F499A0E08A3C977A46FBA3F8BE752BA3C1887 (o_-).~`(=p
242,982,808 *179F575B7AD7916D832FEB230F6639B1F8DCA3E6 OPKE
242,982,809 *1795ABA04634492DA6A1689597F9A43CB73EDC78 ORANGENE0
242,982,810 *179D9EC66FCA737A096E4D329BDF8610A89AC98D orion86
242,982,811 *179E8D3DC10451A8F5D17D9B42A4BE0DB44487FE ot%c
242,982,812 *179A68462B6E5D9605014BFB6F28085DF6DC5CE7 Out.From.Animals
242,982,813 *179CF5A3EEAD228D2619A0C792411D51F37BB7EF OV3RCAPI7A1IZ3D
242,982,814 *179CC3FB04E6C02E89B9FCF0680CB1E09D925F72 [email protected]
242,982,815 *1797ACE27436D28947AA39C1BBB6B4CC6F663E82 P-----B~O~OO->-<
242,982,816 *17997197443BC4689A98E1619F8C144E15BAA5E5 [email protected]
242,982,817 *179196EC53DA01562ED6470A3856FA2FA0A199F5 PHILLIP.ELKINS
242,982,818 *179A9FD166122B8A88A792FB00ED3D510609FC74 pirzadasing
242,982,819 *1792B66637EB5BBB90DE91E0F23C65F11F07A10B PraeludiuminesMoll&Fuga(a3voci)indisMoll,BWV853
242,982,820 *179D0986448140FAF1CA0D15514EA9ACDEC061C8 PRALESCH0
242,982,821 *17991A0B34273C40C1B9D0A760D3D4DD7B5CF99E PRAXISFUEHRUNG
242,982,822 *17933C7362FA5A240BE9B0473A17AA9169C4A080 PRDNC
242,982,823 *1794F71A1DC529A1F620AE071A76C65F2148499E PRIMARY.PROCESSES
242,982,824 *179D0599B4CCC50FAA281D5982435DBD645EDA78 PUROKCITYB
242,982,825 *179DE156265F1EB975588CF9AB9FC0CD79C1A55D PYTHONSCIENCE
242,982,826 *1795ED70E28E947A0BA04DACB3A0502427928DE1 [email protected]
242,982,827 *179593EAD23A8AAF73AA424FCA5AF5B198546CAB Q===P~.`.SPLAT
242,982,828 *1796EF5A92AD768B0EE6B22E21CEC810D6F22B40 QU4RTBL
242,982,829 *1798D3D9F04237ABD0162E0602457ED16C7A2637 qu!+cl4!m!n9
242,982,830 *17971F6F567E92BC2DAD9DE92FD1F33EDD111749 randalmccorkell
242,982,831 *179B3183D787FE1452D320F7CCD032CEB8FF99DC [email protected]$T
242,982,832 *17991F3F5AD10ABE61F6F12F70EF2819A8FA703A reagent$
242,982,833 *17949F93844591304CD29479A7E4C482F3974797 REFUTA8!1!TY
242,982,834 *179BA2E44E59F57EFC3A1AB6E214BE05EEAF03A5 REINALDOLOVETTE
242,982,835 *17900A1D0407848F32847B9D2E519DCE7B6FCAE1 REKARAKTERISTIKS
242,982,836 *179D026B82F5FF286ACA81F6F0E82B440714A764 RENALDO.STEPTER
242,982,837 *179DA47CF47A69C6A90975BCC37A0D8A3E1CFD6E RENELESTON
242,982,838 *179533E2F059EA3B98992A67CC1EA6F8D4FDB560 renverseriez4
242,982,839 *179CB4B34777CF22B483D7521509A5A150F39521 RÉSBEN
242,982,840 *179D44C16E7FE601147B75786EECA9DBEDEBF25A retrospectives,volume1
242,982,841 *179FE661BF071F10BEFDDC80B36DF799A4E9114F RINFACCIARSI3
242,982,842 *179090C898FEAC21BF41A2586BDBF4C0471563D2 RITŠKO
242,982,843 *17974E4931889C5227B2175081C0AE8CC15D681C roberthasenfratz
242,982,844 *1791E6B2AACC75709F44788600D2AAA9E85EAB9B rollandheimbaugh
242,982,845 *1790537A651C4798BD17B7077ED4C8260275FAA5 ROMANFORONDA
242,982,846 *1798CC6104320520B070CF10EDDFC8C3A33D46F8 ROOSEVELT.KEALY
242,982,847 *1799F2EA76244DB6031AD29F9382720CFBA82291 ROSARIO.VARNON
242,982,848 *179FECE101FD3045DE09B85E9110ED1C0D854346 ROSS.BRUGGMAN
242,982,849 *179F9D1E0DCCCB80DBB4D5ED63B1F3B0F3FBE535 RPEREABRAS
242,982,850 *1792391DBE5E82B6B56E62627E134FFBB824CB72 RS`8
242,982,851 *179EFB09E4B9BD1A49DAF6D2092003FE514394DC RUETATSNOC
242,982,852 *179EFBDA187FB16FFE2E3DDC4105E5D72C558FC2 RYAN.REISINGER
242,982,853 *1798DFC9394153DC3E58F981092D95CA6E660B56 RYANSILVERSIDES
242,982,854 *1792EC3D93ECEC3B6384EF01D328F23DE30ED8C7 S99907230
242,982,855 *1796253C10F32C5404CF74B50EB1D6949C5139F4 sabinelewis
242,982,856 *17965DBF19BEB3AC1ADF6123810B16D069BF6DCC salvatoresandelin
242,982,857 *179A35F042AC0600019C7E3D48130774187EF3CD SARUMAPPERUMA
242,982,858 *17947778C726044FD61384BC861DDE606E2F86DC SAZANP
242,982,859 *1791668F5866A8882ACAB2434CE273FD9CE2C62C SCENE4:WEICHE,WOTAN,WEICHE!
242,982,860 *1798BD2A594161621EE35525E5EA2A9703F77A1B s$cg
242,982,861 *17911497B9E4DC99B5065205A7C98D36B436580C schrmmn0
242,982,862 *179863DECC8C9F7DEAEF15FDE0575947F201FF75 sebastian643
242,982,863 *1791EC3B7F1A74CF922060916865BFD6BE393BFD SENDREMOTE8
242,982,864 *179B3EF6720EB58BFF4BA95330CAD2D6A7F675F9 SERGEY-BELYAKOV
242,982,865 *179B0DC8922B3CBBFAA825C10592C629A9778344 [email protected]
242,982,866 *179350A45F05763958D8A1EEC61FC64FDF2847FB SERVIERHINWEISE
242,982,867 *179DAD5C7BCD2A94F50482925D4B84F6A37088E4 [email protected]
242,982,868 *1797F0F9F3C9A1296EE623FF2956B0ABD2996329 sharon.fleeman
242,982,869 *17929AED24A6C4F86DDFE136D4DDBF093DF08E27 shaynegladue
242,982,870 *17969CB3E6FFA27EFE3113603BA6B8FCA72B21D5 SHELBYVILLAO
242,982,871 *179E4C65357D7AB8F0E0C1DE2540FA08C6E1D7FA shelbywede
242,982,872 *179755CBCE7D934CAE180E0813C7789C0CB6D6A8 SHELTON.TENORE
242,982,873 *1794B2B229E8F12A22F2D592524B7ADEA15F1EED SHIFTKEYDELETE
242,982,874 *1794AEC87BC14E3A9BB8B5E06036385DA4D1CE0C ShilohHill
242,982,875 *179EEB935C78856852A6003909D0D23C628F08FE SHOCK-TO-THE-SYSTEM-(BLUE-&-STONE-FAT-CITY-MIX)
242,982,876 *179E29761F185299738D8CF4A10747E56F0E16B7 SHOESJUDITH6
242,982,877 *1794F976DBE8772F097486D91D5CAC82111F00C7 SHOUTINGAT
242,982,878 *17912AC89B2CD4F795E7C730A587BD7112943EC9 SIINEVERP
242,982,879 *179A2406193EFFF2EE110658ED442DCFA13662B1 silasdewese
242,982,880 *1796A8FA368B086624277F893AA89B992AB6E59D SILASDEWESE
242,982,881 *1790A5A72D40FC98616BDD6A17381E49ED37E67E SILENT.RUNNING.II
242,982,882 *179E463A9E1AC0B96488A9B4A44AB70F2A7D87C6 SIROC4
242,982,883 *1792A51F304073218D6CA3BC81EBAF03A558D3B1 SJQUEENB01
242,982,884 *179E247279CADAEF8795C2DF63D55100EF0AC5DE SKYLTTING
242,982,885 *179565F36C644F0EED048D4792B69FCB6DB9D934 slamina3
242,982,886 *179DC0D0BE72D71D698A992F32E1F1FB204385BD slipup
242,982,887 *179E88F59A00A0E511DC54BC0BF8CD7D04C2A7F2 snetiuring
242,982,888 *17929DEFFE2E329167C6CB5E5A9F4720EFFBFC35 SOLVEIGS-SANG,-OP-23-NO-18
242,982,889 *1791FC1F06D4AB5804215E6BD719CE0D83F9BA89 SOMEBODY'S.GONNA.TAKE.YOU.OUT
242,982,890 *1794ED39928F2741884B8E2073D653423E85AAD8 SOURCEHTTPWWW.LAW.BS
242,982,891 *179876C1D03AF8D2DB33CB3EC6367E9AF86434F4 spectr0gr4pher
242,982,892 *179074644E1580A82C8201C40430D1DF78A5FE10 SPINACHCOLORED 'SP/I/N/I//TS/_'K/@/L/@/RD
242,982,893 *17925E57DB64B68A488B1BCA0BA9A7C48C81CF24 [email protected]
242,982,894 *1799DAA637C57FB917A7FED0CD0C1A932048C435 s/.r
242,982,895 *179D967DF085E8B23915DE37185751D7B26CBF26 STACEY.FICK
242,982,896 *179DADB6F1B8096D64BBBB55C04168AB28312998 STANDINGINLINES
242,982,897 *1793BEFC51D0A3BFB1A0C3CC4800D968389BC737 [email protected]
242,982,898 *1792346DAC19A560770605E54AC79C5B567AF0C1 STERLING.STOHR
242,982,899 *17928979DEE7B9413FEFFEFA1E7D999D531EBF48 STEVEKUECHLE
242,982,900 *179AAFB080EA6EA6FD65892DB73A5AAF7A01C67F STEWART.SHELMAN
242,982,901 *179FA9CD20F02C23F3D36D050FA787665C077F70 [email protected]
242,982,902 *1791070BB49A1C449F1FD08619536BDDF3EE8D95 STRUKTUR
242,982,903 *179F43F81B9D4544359D1642E2C2A45CECE5FCDA SUCCESSCORWIN
242,982,904 *17965E1AD296F453330B2220ED2F85ADCEDC521C SUMMER.SESSIONS.VOL..13.(DISC.1:.VOL.1)
242,982,905 *1799F4CA1BE5580534BCC8E48BBF9B218A24C997 SUPERPARKER
242,982,906 *179F45A7C5970999D36024A32EE268CE13A96639 SUSTIGNI1
242,982,907 *17909EBCF190379DF0EFF768F6A7F7F79D395A62 SVERLOTTA
242,982,908 *17991338DABF520E36BF167D83477BFA1F80AE8B [email protected]
242,982,909 *179EF0557551F415CE2C239083516F454A3F908D [email protected]
242,982,910 *179011F15C1827BB03FD132B89F588280822B1E4 taisetsu.na.kimi.e
242,982,911 *179474881168C5DE1CF8DF18DB26863611CEE986 TALKBENLOWE1
242,982,912 *1796F7B2F7FB5EB68F80FDD065DD09255BAE98B1 TALKSTANA
242,982,913 *179276933DAC2B13D10491FC986AC296AB27BC42 TALUKSSKULATS
242,982,914 *179FF05BCCBF7EE4A1566D7F425A804AB3A6700F TAMEABLE
242,982,915 *179BF114C46B36A6C725F68566569505A8C1BAA7 [email protected]
242,982,916 *1797C7D8ABCF6E8CDFC4BCE02324C521128546F1 [email protected]
242,982,917 *1797F2873DCFA8F91A0AE604E1558C716809C6AB TARA-SULAIMAN
242,982,918 *1796220BCF4A49F1EAF0684D1D112E24A9E6DAA9 tasuta
242,982,919 *1798E10597380E8AA90638EED6E7EE93C05CA0EB terri.garvey
242,982,920 *179483FBA0CF1770B2D26ED290608009C16B5AAF th!4m!ns
242,982,921 *1791C5F1D11A82D8FF1125B6C5C21159B3C3BB4B thanhgrohs
242,982,922 *179B287D0113B97D7290A78065DE46BF8A653375 thatwilliam148
242,982,923 *17927EE0C6DA634192C0588E485CBE1C73826544 the-empire-has-risen
242,982,924 *179B939472F8E3B24393D1CD38D90D3CA5018364 THE-LAYAWAYS
242,982,925 *1793E9CE7E443B935D81E413C4915C44A49DB272 The.Right.to.Reject
242,982,926 *17945296085A709356AEBF52499C3857B3C1E6CC THGHTGVN
242,982,927 *179EC5F7F6B7F329257B98D18CB8AF50F605E1AC THGIR'A
242,982,928 *179718B427428DC2C5E0F0918136D4EBC64093FF [email protected]
242,982,929 *17975525EB49B66BB7F8CD806A66B525C3A9B9A5 tigrejohnny
242,982,930 *1795D60E519138DCE729E4B9BDBC26B2318C4A66 TINKERAMS
242,982,931 *179DC37BF510858C73ACADC39398E7D0AB5AEE37 [email protected]
242,982,932 *1795407E8F8DB5C0BC42E719DD8850FD9355E46F TLACOUSTA
242,982,933 *1796045A26968C7A79A4433E8CB87FAC3A4D3607 TNEIARESUOPPED
242,982,934 *1796002A104A7692BA439AFA3FB050CF8EC06F99 TOD.SITTON
242,982,935 *179C2F246821F774FE4FF879876DC14CBC2953C4 TOIMITTAJANTYING
242,982,936 *1792E773BB3FB6BF6AED5753E5E3A5444FD5B97A TONYGRATEFUL8
242,982,937 *1792C44D3120C5B8EAFB089833E9680A33B5FC89 TOPPM
242,982,938 *179A26EA339C08251CDA7B53D0467D22E8A4DD7E TREVOR.CANLAS
242,982,939 *179A2533EA7F43F384116E3BC3FDAB1B86A94564 TRJNT1234
242,982,940 *179F3594E3A5F2F0A28FC15CC94D50F1E534B7A0 TROFFEFL1
242,982,941 *179C65964C6E19AC672F7DBE828B28C10ACC2449 TROYHAYCRAFT
242,982,942 *179EDF787ED08BB17745AE1A336BC88B588A646F TSCHYSCHOW
242,982,943 *1791BA817E7FAEDF32C1496667F21E99E098A3BC Tu.som
242,982,944 *1792DA35B192271B22EF342DD245D29519B660B8 tyler.mcgovney
242,982,945 *179ABF5430F826AA3B96F3FAFE7C59384B0E28D9 tyrandahl
242,982,946 *1796BFDAB2F2E42E2AB799C750F6CA3E38EA8C08 TYRONE.TERNASKY
242,982,947 *1795C076445B89C5B75F76BB2555C5FB45F3021D tysonbarretto
242,982,948 *1791F9EAFBA453F7175A7B5A780D44197255AD2F UITSPIN?
242,982,949 *1799E21D1B2DE19332F8F9B5FC2330F7D5BB424C UNBODDEN5
242,982,950 *1795F36A406BB81150CACE88B8D6575E95369C55 UNH01!NESS
242,982,951 *1793B7BED6730600145C0FACD7D8B3A143D87B70 [email protected]
242,982,952 *1797E2EDD9D777466EC672274CB5BC714C35DDBA UPCOILING
242,982,953 *1799308A4015068194FC32DD341ADFF7B7B5C250 VADNAISBSW
242,982,954 *17965C5332E6ACA93B80CCAD92C8F9BC25834489 VAJÍČKEM
242,982,955 *179DD117C0225C39FED82CF2079A81EF8E7288FB VALENTINE.BOBBS
242,982,956 *1797713DB00BF46869D9F73E762450A07D814EA2 valentinesucharski
242,982,957 *17930214CD47CDB9405C414DD40805117AFFE93D valerie-lopez-dela-cruz
242,982,958 *179BF065132997D3A396DD82CEA8BC5A73538112 [email protected]
242,982,959 *17967322EE6DD1C315BBE1F1EF38306284F75312 VEETANU
242,982,960 *179EDF359B5DE6124220EC8740006844CBE94617 VERA.EFIA.AMAKYEWA
242,982,961 *179FA3A4753DBA65A75E2F54E0F80C4487F95633 vera.kulichenko
242,982,962 *17965A2ECD561C10297107E7D74AC1551A5BF2A0 vermeester
242,982,963 *179D742E649FA4FF4B672C0B2BB42A957211D0C4 VILISIMIONSIMION
242,982,964 *179D73275C7933D934D85C9447D2D69642B88152 VINOTH.MUUNI
242,982,965 *179959309BADF72E875DE759428FBE1E7DE2D468 virginia-ickes-pyster
242,982,966 *17924CD2DC7A58B012F3A68A8BE92138B28158D2 VITAMOTIEKAITIENE
242,982,967 *17986844BDEAE3364AA8ECC4A9EA116250E2784B vivienda-roma-antigua
242,982,968 *179BF892A4AE81E236D980A120ACF8CD223DE289 VOTATOLO1
242,982,969 *1793D350AABC35B9B5522A59BF1847103DE40CAC VPALANA
242,982,970 *179065A925FED90371557C6D8A28DD2CCB2A156A vphi01914
242,982,971 *179CEC36D376AD359F910B0C73450D3DC96F8A3F VRIJZINNIGS3
242,982,972 *17968A492574C38D4339F8F320D315A3DD247211 [email protected]
242,982,973 *179D44DA51A1B9B4A4E9CDE92A742605FE49F50D W960318950
242,982,974 *179C84F7D53E4B6E75503E1CAD7F9B13A5BFBA4F WALLACE.MEIRICK
242,982,975 *1796BA0B8D8D4592AABD905D29933C809462F713 WALPURGI2
242,982,976 *179175E21AF76233F77981D23DF6DEB7BDF7CE04 war-intowarmixbypixelbeats
242,982,977 *17958960CDE140C57E0F690ABB7ED766287FD579 [email protected]
242,982,978 *179B30020F8C8280D783EFBB749BB0482DD16DF7 watikmakinndutz
242,982,979 *179EAD6183A5B039E40B7CD889A27E3A6DBDA98B [email protected]
242,982,980 *179A4764E21F1721B4872FC404AF6DB763AA1928 WehetIhrFahnen-Viktoria!
242,982,981 *1792675C5C5292290EAF770E9443517E34DA98F4 westonbacker
242,982,982 *1793F35F02FE4141F78A81C744C85A7F4086246E westonmckeller
242,982,983 *179126A7DE948A3D65191766FA3E9E4C72E802C8 WILFRED.DEVALLE
242,982,984 *179FC61E5CFCAE7A2D6AEFBAE7D058D08ECDF888 WILLAMET1234
242,982,985 *179424894BBADED90A0E57F002FEE9E68748DF71 WILSON CARPIO
242,982,986 *179742DFEA94EBF56361795416C8C4DE0A82A78E WILTON.LUCKENBAUGH
242,982,987 *17915D5D2A02D7804CBCED0653D148B54E376710 WIMPIEDUVENAGE
242,982,988 *179D658F25343763A811563469FB45E5C3BAC113 WINFORDDEFIBAUGH
242,982,989 *17957063C772A00001A6E8CF7EB2BB0698DADBA3 WLLNNLG0
242,982,990 *17918724CE62DA1861586ED46ED9281473C6AF6F woodrowdevenuto
242,982,991 *179896DF80BD654F2ACC032897994DCE52A33AD7 [email protected]
242,982,992 *179B552820BAE4A8BD00725330C4A3CF4022F41E wwwmontagelagunabeachweddingscom
242,982,993 *1795B7495853992148E23767FC59A596DFC1BBCE WWWNEWTREDEGARRUGBY
242,982,994 *179A7ED1C8DDA28D3E999E8474D86D724398E921 WWW.PAPILLONPROPERTIES.COM
242,982,995 *179EAB657AE6ECE4F0D917A6BD6620476B044273 )x(~~~(8
242,982,996 *179AD2234998AB196080B5D98280CD3F64CE5B7E [email protected]
242,982,997 *17901B721C00C49BCD5BF6A61A2B1DD51C016108 [email protected]
242,982,998 *17978658C35374226B5980BF6E7B480744837EEF [email protected]
242,982,999 *179DBBFEB8DC608960AADF6442AEF82F2118CA2D YOU-NEED-TO-UPLOAD-YOUR-SCRIPT-AGAIN
242,983,000 *179D6A8679059FE7256B01A73CC152F263DDAFF1 youngkeba
242,983,001 *179F54C15508862E4A0FA1F9E01413907693D74E YOUR.FRACTURED.LIFE./.PEE.WEE.MARTINI
242,983,002 *179CA06F262F75897D99AFC80F09258C9089C9C8 YOVETTED
242,983,003 *1795309A6A02FA7EA248B82B284F20F64DA8EEDA ZACK REEFER
242,983,004 *179F9EF52F8140E27D192B2CBA3574C6757DEC68 ZAK HARDWICK
242,983,005 *1793AB63DAC8D59381983573C55C41BA074177FD [email protected]
242,983,006 *179BF2119856AB92E1B3A93364714838E52AB782 zebulon.nichols
242,983,007 *179B35130914515548ABFD31D3331918ACB889BA ZEG-NIETS
242,983,008 *1794FB3E26F766B2B0C987A87D1AB2A867984105 [email protected]
242,983,009 *179396CF4B30F10952623A5979347E21B7BB9A6E ZHARIA DELOS REYES ALMOETE
242,983,010 *179321FC60D236AD2770A57FFFF984B45B13EE71 ZHLUBNK9
242,983,011 *17987FC7A3FE717BEE804E9EFF6CD7DC04D4D779 ZHONGGUOCYNTHIA6
242,983,012 *179F16708149F5251B5B16A2195FE1DDF0FCC8BA ZULFAHMIDWIYANTOLAMUSU
242,983,013 *17973B878D7BD57097DF626D0C139383686137E1 [email protected]
242,983,014 *17941DB2BF5494DA4E4704BB6C6F0A88A1F0DA7F [email protected]
242,983,015 *1797D6E9A6F4FFA3C4D47654CF795EE0FA19696B ΙΑΡΏΜ
242,983,016 *179F86C1AF77BC1534D2204AFF13190A26B49D93 μύνγκα
242,983,017 *179E9EEE4592BC0A7C9943E4B4472C76911D83E0 АФРОДИЗИОМАНИЕЙ
242,983,018 *1797E8217DE53D67F03849924AB583FD67648DFC БАТТЕРФІЛД
242,983,019 *179C5942D202B30DA1330E9A493FC75B14C29B9E БЕБРЕШ
242,983,020 *179A0B41D5A2656AD0761A5B5AD2C2526FC9AE9D ДЖЖАРО
242,983,021 *17989B84338429F92F3705D01CC8359C59D265B0 ЗАЛЫСЬ
242,983,022 *179CD1127EA8FABB6B591B7B756C16DC6BFADA4A ЗАХВАТЕНКОВ
242,983,023 *17992823836A290ED942E2708EEA5C4C763D22C1 ЗЛОВИДНЫЙ
242,983,024 *179706143DD4524E71402BA46CD304F10C6CA05F лусака
242,983,025 *17966339E3060191726EEBF2C9E0CC05B9DDA507 штафенҳаген
242,983,026 *179BFC5D9D8107836909D85FEA912834E4EFACF1 和DARIO
242,983,027 *179059EF46DC89131BAF8CF60213A42043C30A6A 富辛(augustinerhof農場)
242,983,028 *179220AD4DA96FD32F26E9C1127D573AE096C04F (_0).o~.0~<p
242,983,029 *17938990C67311B59DBFB34E36CE6F1BAD8EF87B 10-09-1892
242,983,030 *179A22516610137AFA401C52A68F8D980557D484 1432985 vorallemaberhatlistdenellenbogen.
242,983,031 *179357FCC281FE1A0E9042CFABF83E9A5410D280 153rihanna
242,983,032 *179F039C7D642295CA550F858A65E0C2D92DE6B2 1797793 vainehdottomanturvallisessailmapiiriss
242,983,033 *179FCC52AB00221207E78515462161AEA1D3A26A 17oct1235
242,983,034 *179C7A8EA4E0625693FB5B44D4E51EFFF15B031F 1923638 ESIM...RAKENNERA.HASTOJEN.OLLESSA.KYSEESS
242,983,035 *179CE068DBB2F5B7D8BC7809F3EC2B621F94ACA0 1932367 vaalikampanjoiden-teemat-ovat-olleet-v
242,983,036 *179B29E75A9CC3793549AA5904F9687A5FA68AB7 1.ALADDINISSA
242,983,037 *179E2ACDCD8FB1EF5776AB09EF2FD4CC91C9775C 1.anItlarIna
242,983,038 *1796D0EC148625304890A0D13CABA902837F9411 1BELASTUNGSKETTE
242,983,039 *17908846D6B05E6F64B1E5B664D033DF3EFCC7BD 1.bnd-fonds
242,983,040 *17924125C666D3237D0A89DB1B2E89DD90ED27D2 1CERTITECH
242,983,041 *179F3B57A96A2886FDB86B5D5DF21C3808D633DB 1.DATABANK'S
242,983,042 *1796B4E6A1D6C03AE8389AB20FF8B33B5CB14D48 1 DURURNDA
242,983,043 *179ED32A5C789F209FC81541826C7235BA0FB3CF 1EA0DC
242,983,044 *1794D018AB7CD50001DFA468C935888DB918E9DB 1.kielitoimitus
242,983,045 *179C8457A169DA2C96429661FEC085403196269C 1netservice
242,983,046 *1791427CE5155A4AF5FF344CA8FEC4543E0F2A8E 1NUTRIENT-IN
242,983,047 *1793CD7F4A0F8057243BB4A982A2C2E82C54DB1B 1-OIKEUSASIANMIEHELLE
242,983,048 *1791CCE19E0EF93F0C6AD2031279174071EBBA83 1.POMPALIYORDU
242,983,049 *17963DD19FEE684B59C23F1B2BFAAA08F80D76EC 1RTSGBSW
242,983,050 *1791A1E6482E0ED1C3FB6641A7C3375ACA7AF5AA 1 SIEBENZIMMERWOHNUNG
242,983,051 *1791DC1F0156DC4B9C66B508F441EAC97FBAB092 1.solidarpakt-gespraechen
242,983,052 *179720757A0D3FC86DBDFB7B72935E5F7632B9B4 1-steigerungsprozess
242,983,053 *179631818B3C3EA83C48FA32EC0AA73D5D74F30A 1.TAMPERE-ESITE
242,983,054 *1799C54A75F2A135F62E35C94FFC32C5D5515F6C 1TAPISSEZ
242,983,055 *1790D51DFBF95AE7B8C04F53F789B7DFA548A4D3 1.VERAESTELTES
242,983,056 *1790621B63A31552CA4C5EA7AA48EBC967E75C60 1 VESIMYYRI
242,983,057 *1794F672D62115D04724ECC44B65E594EB05DB0A 1WJDLPGR
242,983,058 *1798F04C9BB295DD7612B28176F51234D9BE7722 1.youngsounding
242,983,059 *17956F63B915B4211BF45906F1508D78EE392C1B 21jul1969
242,983,060 *17999D5BC79F2909DCA39DDBA5FA9DD7EF30AE32 2317808 "-illusion-on-toiminut-meill
242,983,061 *179A15047B86E8A1FC9BB6AED71B70E4B5535EFE 2472.JONKUN
242,983,062 *1794CA7B77D450E05298C772D748C36E7AFA8AD1 24FL
242,983,063 *1799E809F6B9841EF7F346F16D1B44DA319C08EC 250-ASSISTENT
242,983,064 *179DEA0EE9D9D6A0F86BF9ED89B8918DA4C78F43 2574003 kansalaisetjajopaparlamentitovatpuolestaanj
242,983,065 *1791F9A86D6441CE3DF84E3176ACC6291F04B41F 25-bskyb
242,983,066 *1794482458313551292210A6A7FAA1C04BD3F43B 2602DISCLOSE
242,983,067 *1792F2F72B932E37741F60CBF101334DD1F26A0F 2628207 unvorstellbar.und.vor.allem.nicht.fair..
242,983,068 *1791525EF54E14798143C147300B31A62D156D75 27.12.1364
242,983,069 *1794574611CA00F14E26F6F85C43EA6869FEC56B 2-COURSE-NOT
242,983,070 *179DEF6111DA1975988179DFAE76BCDD752E0420 2FSECCHI
242,983,071 *1797D22236A316D6A817373AE296AF3737098B9A 2.gickelsitzung
242,983,072 *17987CD77066440719A9BEB6B3EA77D461BFF84F 2 GRANDFATHER-HE
242,983,073 *17961AD54AB77AA88A0BB96DE23EEDABAD5A6CC6 2.HOPFERAU
242,983,074 *179A92F8E178BFA07B81A0E79E424A0F87F6F5AF 2IAMTWEETY7
242,983,075 *1791472C819BB6F1D24DD15885F120EE520EBFD1 2-kurdirektion
242,983,076 *179D8353A22E13D9FBA9EDD4677DD2158FEE5C94 2.LANGWELLIGEREN
242,983,077 *17907B530C809A2BA1F1D2F830677C3A12D6423B 2lega-bewegung
242,983,078 *179797D12A01D3048188944A42AAC3461DA73982 2 menseiden
242,983,079 *17958B18FB51F4F554697500E8AB131E6FD666D6 2MYDIRECTOR7
242,983,080 *179B55359E97DA88E16B790E976C2B291C0F8C30 2PINSCHER-KULTUR
242,983,081 *1795BBC83EB5889465568CC3EC8532CCA8E73D2C 2-sorusch
242,983,082 *179ADD5D11893E1EFE7A67443212A925B616348C 2timothy4:78ihavekeptthefaith
242,983,083 *1791353D570392BDAD8C79856AF00CD073C49A87 2UMGIESSE
242,983,084 *17990BCA6A1307A9E32A87BA635DFE89EE0FDF1A 304539 einbrutalesfoul,schondaszusehentutweh
242,983,085 *179A2F46A9D91739A45E2F6879F4BE9A12F1F504 335649 jos kosto ja v
242,983,086 *179ED3DFD57E5FC347456885973AC681B5A54C69 3b<-.*.(==b
242,983,087 *179AEB22BB6D96B3DDCEEC8422B40C45211AB7EA 3NL1GH+3N3RS
242,983,088 *17966E3707FF12601CC41FA3D3970065B525C6E3 42450 die igua
242,983,089 *1794B537442F95123B14A694812A6503AF7AAFCB 438BRYCE
242,983,090 *179FC3EBE6B68AABDFD173C14912871A97327FBB 438LILLIANNA
242,983,091 *1799D58617E24B7BEDDC619B015FF39FD885D432 4INTERSCHOOLN
242,983,092 *179581442C82EF9A4C639F80EC2C738974BA5E0C 4MARTINPPP
242,983,093 *1794280B7ED09F2693902E8CE74299B8324061A5 4.OPINN
242,983,094 *1790E4C5D26C479C82ADB88E4DE540D52F2BF2CD 4RRES74VO
242,983,095 *1795EF1C7026D23BBB84F9502667E3F3BB13C52C 4STSIRALU
242,983,096 *1798D5782851C6B76445073BA6A5BAF66A2B676F 4SUPERCAB
242,983,097 *179A494B929D93D19C2977F4495CFB35AC657AA1 4VZTEKLY
242,983,098 *1796110A89E6448DACE4326AB01F2F0A50CEBA03 4WOGGLEWOGGLE
242,983,099 *17946243BF83D1B883AE83274EA0089ECD30671E 4WOJCICKA
242,983,100 *17992273BF53CA8B963354A7CA98F21EC2FE0CE1 5341F368
242,983,101 *179C36BC77BA7987B488943C6CC4A66B74CC1247 *!5a
242,983,102 *1794773B980879B80E1E4F7F559C12F3C309C318 5.CDUMAGISTRATSMITGLIED
242,983,103 *1793FCE3793E02FA8F9D174B3530F23CCEC9BCEB 5classificeer
242,983,104 *179441170CCA1F38FD3E1DD240E3BEE0F2541371 5GRATEFULGOLD
242,983,105 *179B8A6FECB896683173BBA418C4CF31258A31E3 5INSTANTANIOUS
242,983,106 *17938DE39BF3CD9D42D83AC27F6B7D3B82AFF9D5 5MABERRY
242,983,107 *17926A9374C3513407157494744CA5A82F2B7E34 5ORPHOSIC
242,983,108 *17991971CA7C97E506A597257E79CE0190BAAD16 5RESPISEMULIGHED
242,983,109 *179EA2391909D9A49A3E40337E19E5A6E3C6D9EA 5RETNIOPED
242,983,110 *179DAE4D6B63A3BFBC42A602556BF845EDC0C726 5SEISOEN
242,983,111 *179A08539FE8CE67CD131DBED043181ABA314265 5SINGISEI
242,983,112 *17948D54755B9B93B0C3E1C27F53BE36DD82E339 5SSUPMLYK
242,983,113 *1797D2D015D6C8311700753F17317DF65A711E3F 5UNSERVABLES
242,983,114 *17997F016FAAA1DA7B390C95FE620A0129E7FAB2 5UPAASYAMAANAAH
242,983,115 *17900FAFFEC68559147B9062E0B47195999E6B58 6AMASCHINEN
242,983,116 *179F8BC6EAFC1E76EB28A6BF27C4F90D011D6878 6IMPORTUNANDOLA
242,983,117 *179217C19047137937B53C20FBBEFFED697F93FE 6 oikeaaikaisuus
242,983,118 *179E0F129C13541F5BAC7709800D0099E0719A2C 6OMMAIONNA
242,983,119 *1797CEE878981B1483CFAC53859016DB2CBCCBB6 6.PALTANPUISTON
242,983,120 *179BB58B61DB763E2BCB2972E99EC595ED108051 6PROTEGERIEZ
242,983,121 *1795708E05C7A7CADE01F3B4C407B74D821E8B99 6UOUFBSW
242,983,122 *179B9595AEBC09ED6DE8A7687877FA0190B97138 6URBOFANS
242,983,123 *1795025F8AAD220826FCCC1326581BF63A8A3349 6WIREMOLD
242,983,124 *179E1A676E859B92FF4B47A5525635BAA6E14191 7BSWKOMMENTTIBSW
242,983,125 *1799077C4153666B71CA88CD6E265BB0E9EDC9BC 7CONNIEMAGGIE
242,983,126 *179035EFDD63EA5211BE4E0CE1855FB506796199 7ILUVXFILES9
242,983,127 *17943299C6A3378A9E062A378D2E544B7D3D4F57 7LLLONAIP
242,983,128 *179B777C25D8762A02DD68A051004B73FA1735DA 7LUCYCLARK
242,983,129 *17902F1B278DE5E68EABB3C9204296B08F3BDB11 7penguins
242,983,130 *179FD771547E0E6E0626A417BC3E9056D17274EB 7SPESSOOSSEPS
242,983,131 *1790E483281AC9D089621C6E0B28324267FC9D74 7TELUUTIV
242,983,132 *1797A352538C9EA8B8654426C3D73E3C56D7A191 7TSELLUFELOD
242,983,133 *1792C588350BEFCC7F777BC795D0CBFF1ABC9319 8CHASMGASHGATHER
242,983,134 *1796770F5D550DA08AA0028753333B455CB78351 8ENRASILLARENS
242,983,135 *17901E7D7B63D0F57AE77CF2CC31D89489003A58 8INNOVERONS
242,983,136 *1794B2E7E667B8170ED9336F8674F17F09EFAA9B )8(O~D3
242,983,137 *1792B542415D5720D2BCF3EE056643027640CB5A 8###P`~->-<
242,983,138 *1798231D267B1A3AAB46E605D6452CBD17FE281D 8PALKINNOTTA
242,983,139 *179FD568C8B8B2E0B2411636631C7EE863C6EEBF 8RESORTESBSW
242,983,140 *1797ACD0AF25EBE936245AB898911D51D4850955 8RREBYBUR
242,983,141 *179687231A77C2E7B8FC62638870118E90784DEC 8SNAPPLEVICTOR
242,983,142 *179E08905334CDAAF05B5006ED850DC647372B70 8SPNDETAMPENE
242,983,143 *17906BA19B2FD1AEF14C53DF7E110E614D3AB6C2 96-UNSCHWER
242,983,144 *1795C9F9CE94910B49F87C42387A0738D6F6375B 97100 LUKIONK
242,983,145 *179CE8E95893D9048FAADC4F33A093EE6C19CC9F 9ANEBILLEDERNE
242,983,146 *17907E5E50B01069DB703B5787C56C34E439B9CF 9CRACKERHARVEY
242,983,147 *17953511C8F7AA53388C8DF20D145313174D7559 9DANNYGANDALF
242,983,148 *1798C03D8659FBDAA1E621AF33B54E342D703675 9FRANIJAN
242,983,149 *179C56DABD0B48E641C9459306D0D90649A8C2E8 9gaaa
242,983,150 *179CF98558BA69D3C9E4C6883242D1C1A2673C00 9MORONITHEMAN
242,983,151 *179F523B24A622733BE8EDA1F69EC5565D4167DA 9NASTAMBE
242,983,152 *179037BD1B76D26AA600275E642944BCFF3D1B71 9PEXDDKZWOR
242,983,153 *179D9F7A84DF9CD093E6D2BEF3B94BD9AAC6C9B4 9PURCHASECOMPLYCONSENTCONSUMER
242,983,154 *17908E48E1479F9E6D779590C3CE975FF891CC8D 9RADDEEDDAR
242,983,155 *179D5646629212EF3E169A5EF3366918D22E5E94 9SHELDORADO
242,983,156 *179FCF6D009D852E94BE303A7CCC7E1FC9B6014D 9STIHACKOU
242,983,157 *1790C897175495232E7CE05B49373E2B10193AA2 A1I&
242,983,158 *1797F16C6760A9B78C337E74D6FC3AC35B486881 a3glu
242,983,159 *179996712EBAD331348304AC2B5C41408222EDEB a!55f
242,983,160 *179F9CD8EAAF5DD4E7925418062E83FB996EF129 a8)1.
242,983,161 *1791FE48211713AD8F0D4E4076E69A30A5BBA3A8 aaa,{0
242,983,162 *17999501982A0550C4B984FE6102B69D7669E847 AACLTC
242,983,163 *1794909F3E22B2CB6BBE5163A6657A2DB3A0ABE0 aaneengespijkerds5
242,983,164 *179BD5689E0E0201F62D77152D18B5F87A0F8515 AAPXJ
242,983,165 *179E23EA6FB7D3A037A3917BD0696D877B17EAF9 AATELISKLAANIT
242,983,166 *179976FAF23B76447D37754F23884A5C56889EFB aavwa
242,983,167 *17939B912E76DCF80D09389C4CBE9867A34B5607 a(d'
242,983,168 *179911EFEDBCB9A4F927CC98832E16C96DFCF5DF ad!1u
242,983,169 *179DD7D0D7C322EC8A122C3E3654C767EFB4D0FF A?DP"
242,983,170 *1792E5C749A1EB4F6B88BB23084481E3E6D6F801 AEKINEN6
242,983,171 *179CB815A1717E6352946E8AA278C69045F9BC8E aewui
242,983,172 *179C6E0105D9419F3D4BB9EB2D13F9566C895717 AFFATTO2
242,983,173 *1796C610B37C48F8ED4B272ACDEB8F0864B30B75 ahou_
242,983,174 *179E6F94DDA16311476FA380B5642584C5C724D2 AI:
242,983,175 *17934E2A20F6E736C584F6D36AFA8C773541F3E7 A/jY
242,983,176 *179ED8207D10C03F0B5BAF57253C58E923ABAA63 «AKIO»
242,983,177 *179C2E9CA2B060888BDBAA0C22771B75F31CA93E ALBERTNEELLY
242,983,178 *179C78D7936531956EF591C34352629046D1E9C1 AL$D4
242,983,179 *1797D620F874171BD4450272A6E9AA662DDF6FA5 alexcoraham
242,983,180 *1794DAC24DB8737FC1895742160D6CD52D14B4BB ALLEFFIC5
242,983,181 *179A7A973808DA10A1CE6C0FDF293A7E86F96700 ALPHONSE.GALIMBA
242,983,182 *1793C20D61F8B7B85EE04BFBBAB702A2C5C7C964 alwasie
242,983,183 *17948BFF4598DA083B8F0C1B12F0F0502FB56398 andre.brutus
242,983,184 *179DB2B1FEF83FFB041C6681943AC1E031A44337 ANDREW.BAKEWELL
242,983,185 *179A4DE5EECCD25B20069EE0FAB0BB440C8DF44F ANDY.MASCHECK
242,983,186 *179C8C8F6634B5621E237A5C5C0678B1AC4A53E1 angieragusa
242,983,187 *179B775116CE4F79494C6C20A2B450EFA2993BF2 AP9=H
242,983,188 *17948CE75D4BC55EEE794F75BE893DB4D308A0A1 arn+
242,983,189 *179BFEFE6DA8FF21EA85A95CCFA055FAFA2BE1FB ARUNKALE..I
242,983,190 *1799B1E231693EA2F5EA714AA541369449E67B44 as%2v
242,983,191 *1799BD7684573A39C5EA609935536797AB43C3FB aschuilkerk
242,983,192 *179693EA63C1710D2232BAA5534AAA241B49F824 AS-D
242,983,193 *179610E98503620E596F85E4CB2A25E643C254BB ASGHARGHOURI
242,983,194 *17978C02518C8E5139ACD34A653A3C62FF05980A [email protected]
242,983,195 *17951D3DBC61A955D14D5EE059E4F31DF5DD57C7 ATHENAPAT
242,983,196 *179071566CA7492035BDD9C405403671F1E51A7B AUTB_
242,983,197 *179E008224E528DA8829AE778DDA531703D87482 AV:I+
242,983,198 *17920FEF556F600CFA5BA780F6B5743785CDDE89 a=+xy
242,983,199 *17906DD7E3F37CC65FDA73FEB5C33E1D6335DA7E a+yik
242,983,200 *17913CD64EFA6961A9F60FECB8325D502F83CC4A AYo
242,983,201 *1798634825BFFA450B781944610DA486FA3112CF b9ic7
242,983,202 *1795421906C76E5C1454C33FE2B1E45FFB87B723 b9;/k
242,983,203 *179670613386DD845728D2C0FE6107A3AF4E87C8 Back-Riv
242,983,204 *179668D7D87451BEC96DE277749EBBD286AC59A9 BACTERIOLYSINES
242,983,205 *179B5B534AAFC63E2DF93EF745046A59DB3FEFBF BALANCE.PISTON
242,983,206 *179F5A6EBB1D620B4107F6C6C4EA565F38A116E7 bao+y
242,983,207 *179A4A76B56181B221FA48EDAF84786F6DA188A4 BARI=
242,983,208 *17963EE7B04E7E5DC9A11B9F383A9C510D40DCE1 BARULHLOEI123
242,983,209 *179668B09AFBEA8D316607019F4177536C2E94C6 BBYTHIZZ123
242,983,210 *1797EDC18D717930940E3A7672A7494D0C996683 bcwb3
242,983,211 *179E26CD293992B6765E63423C1147D8827EDA32 bdbau
242,983,212 *179A8EF1481165CCCED1136590086FB05DC041DC bdk#p
242,983,213 *1791FCCF8417AF9D4EA0FA7A8BC945CD35F1AF84 B====D.~.`Splat!
242,983,214 *1798F5063A9D647CD212EF8032E830AFFBC6D5B3 bernabe'r.j.'
242,983,215 *179C64007A8C456D58F1442CFCEC26F1147967F9 BERTRAMFENEIS
242,983,216 *179D3CBBC87A0E8562EB4060E6570CE60BCC966E beskydyogg
242,983,217 *179E8FA94D391B6F7D24A0A147B0596A5D8FA917 Bg,.
242,983,218 *1790F20F030E5BDFA4939017A4A7720C0B2698DD BHHI.
242,983,219 *179395D3CC114C12565CE5F7CA47D411D4C10470 [email protected]
242,983,220 *179D3F37385550BDF912AE23C1CF6FF9D4A970B3 bk4g
242,983,221 *179C626392EBD7C09D1CE942C4A3695E96326986 blaineactis
242,983,222 *179781637B58F001DBFA01F855E430B1F44436AD [email protected]
242,983,223 *17999CF3D2A3CD4F31A18E7ED2EF8DD20B0CC57D blc)
242,983,224 *179AD3326FB1A7065B29873E5A571811A4F9C919 BLWK3
242,983,225 *179A530C7A1A1F4E206992DE7206A0AF55422B10 BmH
242,983,226 *17938C0667D6200F2715420134F15EC4568FC413 brahmanandh
242,983,227 *179D107843B392F3D23AFBAE150D2C9C19B36037 breaking
242,983,228 *179023B3CBA95EF6336A9CA5A761B0EE74999DF4 brittgede
242,983,229 *17936BFCE91E123868F708397D7DFF33964B8A34 bryongavit
242,983,230 *179670EA24C1306106C17EE1B25033AA73E08E99 b?s+
242,983,231 *179A76F2CAA91E0E32BA73F01C72AEFA98B6357A bswnegatabsw
242,983,232 *17910E5A9421F8935157381FB63DE0B08EE4FAAE BSWQUITHANOI
242,983,233 *179F229DA88FED99381179138D0453AE5F27B7E6 bswtamarbsw
242,983,234 *1790443A54F8C36F3C663346E12FB68921961FEA bswuppstrbsw
242,983,235 *179C4FF767FA54DE038FA9C8537E6783BBC61847 bubba5252
242,983,236 *17979F33D7C36F487C8A39450AFEE86DEEAB29E2 BUN 0CHR4
242,983,237 *17957383478455BBBA9E17D30F5962BD1EB5F3C8 B,UR"
242,983,238 *1799E4A633410BF2470D5E217918AE99E1B170AF [email protected]~.~.uu
242,983,239 *179BECCAFD3F0679C8133E8C6A394702F05922C6 BW#2
242,983,240 *1796298BFBBFF61C598A1C69859AD3DDF01A6F21 cache-dtc-af09proxy
242,983,241 *179211B70F4D1A81EBA39F681A7A0BF40A60ED02 caet-
242,983,242 *179257616A5D5613D24FD800780AF1854F31C59B CAIWT
242,983,243 *17997081D92867B88F47AB0082F6CF91B116C259 CALCIFIERAIT3
242,983,244 *1794FFD8DDA7ADF789F60BB290CD910174CE54D0 CARDIFF.GIANT
242,983,245 *17904C30A3A61CCFFF4A25F6AD4CC44EF962A853 CARMELO.BUTNER
242,983,246 *17919C6583DD0E32204DCE48BF2BD6FD9E50A356 CAROLEE.4.0
242,983,247 *17941AD2A80994BD40A46C903E1B2C1F9A197FDE CARROL.CHAMPEAU
242,983,248 *1791D67DB1F8285FDCAD687BD14E5D50941747AA CASPER GORDON
242,983,249 *179BDE565EE24B66F28A5E5FE716EBFC87B80848 CBLD8
242,983,250 *17991E92F9D2B967E31CB5897C4C4254CE34C379 CCV_L
242,983,251 *1798E4200A6F6A81416E3CD88416F1138A5536D4 CFO$Q
242,983,252 *1796303B48D59C72630ABF9B4B56E3C381D59B2D cf_wm
242,983,253 *179FEACD6C4657FB290E484AA9743DDE2E140449 CGH3B
242,983,254 *179A7C4646709C152613B6CB2E6FF0A080EE31AE Ch?0
242,983,255 *179A1A3D78B6355B10F943935A0EE32FB5706059 CHASERAGONE
242,983,256 *1795ABA43186A703F451DE3B230B9533C8930418 [email protected]
242,983,257 *1790EC06621DC630B449AE5A011466A4EDAEF755 [email protected]
242,983,258 *1796D274009B377375BDE0F1AF314B66F0D0136C CHI.ALSIP
242,983,259 *179DEEDDAFA153DCC2E960379D1640F2A5F2F5E0 CHOICEVOICE
242,983,260 *179E6F4421A303F9B520E5F9D0AF10D9DEC390AB Chris-Rolls
242,983,261 *179662F138EE1F50B9354B057F8E4E8DF9FB9388 CHRISTOPHERBREHENY
242,983,262 *179E189590869788FD4440AA08F6C6233886CF80 chtv0
242,983,263 *179B136DF0A9E0EDBCC7EB9A6AC154E32B72220D CHUNGSILGUERO
242,983,264 *1794101FEED920E3154245CB2AAEB9952F2A9651 [email protected]
242,983,265 *179CCCE65DC9E464C807B5B7713960073815083E [email protected]
242,983,266 *179DA5F6A97D2113B64EE502A17EA15341917DEE CKXr
242,983,267 *179E1A330A8EFFAE05687BAEE8E3F387E682B513 CLEMENTMCMENOMY
242,983,268 *179661EA972D95FEFDBAE5C54BAA63F7D2197927 CLINTMERICAL
242,983,269 *179C1BA2D22ABCFA4A77E34C4C49FD434608500A CLIOROUBAUD
242,983,270 *179906DCB4253C751273AD647A378EEAFB56568A cloudbarred
242,983,271 *17964F5CF4F6EC5D85F271855DD5C01257F7A8CC cm8+=
242,983,272 *179A5997A7F8992D63F1BA9AC45120440FFC46A0 CMMPH
242,983,273 *179FA48BBBA48C18B6DC4B39C00C137451C5E235 COLINJOMES
242,983,274 *1798521B3773934C626C6B42C12D4AE3CFC8829B Collapsed-System-(E-Craft-mix)
242,983,275 *179A18C84348262CC2C07A98C4934639F71F7E6E COLM.MCMANUS
242,983,276 *179DEA31F8DBC8F63AB17B72213836F371036D79 CONCERTOADUECORINO3,HWV334:VALLEGRO
242,983,277 *1795A836A871F0B71279984D6BCF10CCCF2A485F CONGENERS3
242,983,278 *179AB4CB38071C23BC7105A0CC5B4A4F88F6D1B2 copulars8
242,983,279 *179795321D154E02B9DCE8200B18D940EDECD606 cowboysv
242,983,280 *1797C5ABCC682C459B4DEB953F61037B312D2B1B CRA
242,983,281 *179245A5E506C2A4C4A86C1B5342700AA54F5EEF cristina674
242,983,282 *1794E268F999666A8884C65991388D98A1ADF6BA CRUSAI
242,983,283 *179ECF4309E7615B730A4B580E9409F904276966 csedh
242,983,284 *17976D96B1C9805B7E7B93A511C9DC2E64A2A5F5 ct,fe
242,983,285 *179EA7A0AA461C38A3ABDD900E368ADC25F5B0FF CTTB
242,983,286 *1790D9B78DFC21512392D1C53B1321BDCA17060C CVLPK
242,983,287 *17910F592E8DFA6E98FC585C36051E31507AE8D8 CWEBC
242,983,288 *1795301E94A80DA4E6483FCBBC93D9AA5933528D cyrus13
242,983,289 *1793A74996EF8338A2A2EB678D18491175A68642 CРАЗУ
242,983,290 *17979D6FFB6D889604E2C5B303F2E024EB3B4951 d-#:;
242,983,291 *17925B93F54F7E738186B59728032159F72FF69E D1V_L
242,983,292 *179257F0F8CBA79B2E68768D79F9AADB28C7233D [email protected]
242,983,293 *179E030E6AFF0D55A59747CFD2C9FDA5BB4DF5AC D?_8D
242,983,294 *179CD39FF039179A089F7F0031360F10B17F3396 [email protected]
242,983,295 *1790460C26C52C0DE5C5FE10F20C1739B6E29D69 DALLASMONTES
242,983,296 *179642A9B7F16FD4E25CDCF98D120FD1C1A88282 d(a)m
242,983,297 *179C9F7DCBB7E3649B8110EA5BDDBF0123E57646 DANILO.NAJJAR
242,983,298 *1790A11F690AD8FAE29E0B04990940156930D308 dantekalafatis
242,983,299 *17989B10162131FF409110846AB339753B7377A8 DARIO.ZALDANA
242,983,300 *179B1F03C38CBDEBE685C560FF8662A5525EF13C DARK YEARS OF CARNAGE
242,983,301 *179DB1B281929A069E096E1C9C8DA1AB7FB015F9 darrindoi
242,983,302 *17998954C7BAA8DA8DCF3BB9ED893385DDBCC7A6 DARYLLEISNER
242,983,303 *179EC5F57BFC9A3468BDC8B95BC67A90ED470FEF DAVIDMENIST
242,983,304 *17958EB3DFBA48C7F7FDEB8F774472B2FC9DDCED dbo,e
242,983,305 *17977E25998B0F49C0F80DDAFDD3A0002E1CAA2B [email protected]
242,983,306 *179C1ED838C4BC24DDBF6B96FE6304ED5D85272B d=ck:
242,983,307 *179F73BF0512C3D5CA12CC0B4D4DCAC89568AD72 DC)PD
242,983,308 *179F82D6BD06B4A49F4D824F475ED52CFC9F90EA dd,_b
242,983,309 *179BB51EA20B5596E043844AD4005B4B3ACEA682 deaffing6
242,983,310 *17923EB402D2F19311F45A787BBA2A3F230808DA DEKKBLADENE
242,983,311 *179D2852A4CE8990562343331F9B32FDD390C42B denaren2
242,983,312 *179C7D4A793011F3AE3AB14C976FF5C93810C674 DENNY.VANHOOZER
242,983,313 *1798FD9F0CC4F222EE3BFAD4D6F32C51A1DA7B9D Df5s
242,983,314 *179BF71EF43B00F3A6EA19BFBA18271F5634B0AB Dilapident
242,983,315 *17932617CF99C1B432927F102E0296ABE71F9D85 [email protected]
242,983,316 *179A40AF161895480F2CC32D6BACF06A13546E6F DIOROLHCING
242,983,317 *1794080101560E708640F8A4E1228BCF707E0BFD DIOSKIN
242,983,318 *17977AF48E95D421C2D6A604302C6100022DB96A DISTRICTSTAFEL
242,983,319 *17939ECDF56E4430413B90F299E58A1CC436A8D1 DIXIEMINE2
242,983,320 *179E025DC5132035F280EFB963612AC289BF3522 dk0yd
242,983,321 *1798087A901769E5E122661CFA8D2272A8CB31DC DLF;
242,983,322 *1794214FE5F99616B418603C950992E226722396 doğmadi
242,983,323 *1799952CDDEC35D7E58BA1E5D4B81BD450F58793 doi101074jbcm10473
242,983,324 *179B4505648431231F1883358E452FCCFDF3F120 dolly-roll
242,983,325 *17920CD52811CCDADEA0B3F594350104220AD10F DOMINIQUESTEINKUEHLER
242,983,326 *1794734EA9AC063649EED076F115B04D48964A5C donald-cooper-sr
242,983,327 *1799FD4A7C4EC36A121D0E31C2141347EB972343 [email protected]
242,983,328 *179AA1C26755EFAE8B920123D68507C90F4DEE41 [email protected]
242,983,329 *1798C9133634C37F5DC2D681392D4EE373921AD3 DONGNEILSON
242,983,330 *179457DA19D3902B95F6CACEFC5CCA631A6E0D94 donmushtaq
242,983,331 *1799EF6A15BF8B6B304403F4DC78276C92A480FB dorolose6
242,983,332 *17978672B07DCF4E81C64D5D60514391666281BD DSC:$
242,983,333 *179A84A872C8B8596A3A6755D6FD33D15595D219 dtwmq
242,983,334 *1797CDC6B9F4FF4838B1BE30F956F85F8AD316DF DUANEGOODHUE
242,983,335 *179A364546D3C251571AF4C16797C1E0ED2D19A9 DUDLEYTROJANOWSKI
242,983,336 *17954C07FF56E79A3D9D651A24E9E4B18E4D2CE0 duid
242,983,337 *1790394173FEEA6F3871120929C2F234F360CA5A DYNAMITESOULII(LIPSERVICEREMIXCLEAN)(FEAT.MADSKILLZ)
242,983,338 *1790CF00FB8075FA6D58D64BF80094AAA9A81DD4 EBC
242,983,339 *1793ADB56F552140F0C666E12B9471A3905CA026 edg77
242,983,340 *179FA32C30B7A5E3F67C3B8736B0C8836F7E45D7 edmore?
242,983,341 *179B2ADC2FF1FB98F982A20B0BFD908518A41FB7 e)gl
242,983,342 *1790D5E7F188C8CF50F276901E71182E1F76CF88 EH_F
242,983,343 *1797DEA56D96F3B7FB39C9F03E89C6C9EA67407B elianamora
242,983,344 *179FC9FAB559D451A05E3D1A2B8CFD5DDC63A0CB ELVIS.NOSEL
242,983,345 *1791D0FE74C25AF857DE4E3CF6DB72C0CF1DD649 [email protected]
242,983,346 *17938F50DD287BC10FC4F1EC2BC15C4CC0749BBA [email protected]
242,983,347 *179E87CAD84D63A690C3826DB1CDE704D6DCC4AE E.P.MAGIC
242,983,348 *179FD4A6EB9AFD96708DF78AFB31E595917FA68F EQ)ER
242,983,349 *1794CB0C69DA6D6B010A837FDB9B6C9A6C332ABB EQUALLYSIZED
242,983,350 *1796E230FC41EAA31A99203B351CC7F9C12ACCF1 ERASMOLANINGA
242,983,351 *179380DDF8DCF35EA016DE7E5A71E2F8F957E5D2 ERINTANGO
242,983,352 *1794720443B14BB877E4EC092A538CADDE31B0CB essapsar1
242,983,353 *179DB99B679ECEDD842369C3D973353C90A97FB0 ETEDIEW9
242,983,354 *17951532DB851C39A2E1CF753F3DAAAB82379DF8 ETHNICITIES13
242,983,355 *179BE790D5DF362CFE78FF3A702771D81364CC9E EUNW?
242,983,356 *1790BD1A460E9943D49637D80E11B243A0ACE8ED [email protected]
242,983,357 *179A0D22234EFFD39A8853B596674DD4C2945EA6 e;W
242,983,358 *179E12A383D476CCDAF1438E652CA3B10DD18FB7 EZRANICOLELLA
242,983,359 *1798B6181A747511B615411AD575B493FA052AD7 F1L4F454MU3L
242,983,360 *1797804BB71D281655C475380B02B3B3A9D8EA8A F[,4
242,983,361 *179BBD9C2872369B819722CC9BAB78F055595B01 [email protected]
242,983,362 *179C237A53641364F5122960503A35FBAA4C5D97 [email protected]
242,983,363 *179BAA2E5A8082A1FD7A1C66331BC085E6276EEB fataleres1
242,983,364 *1797B3E3EB0621F56184618BCF6F1B4C370FC81E FE97PVH
242,983,365 *17962EB6AF389F53B37A66024E9E87F563113C20 [email protected]
242,983,366 *1798F3386F0B5EFD60562DDF45439D4AAD7D4068 ferdinandbelnap
242,983,367 *179FEA052F9213B27D4689EBAB023AAFD759E351 FERIENJOB123
242,983,368 *179B286ADFE09C73F82EA9B7E2D1DF5BCF2A8799 ffddc
242,983,369 *1794E4B2FDF858B1CAE4D6CACDF22BC72C1F9723 forrestnovack
242,983,370 *1797163880AED6D00B28CF87A85CC80EEAFBDD1C FOSTER.TEGELER
242,983,371 *1798B786E8946992B8AC5865D38302304DF17701 FRANCIS.COUTERMARSH
242,983,372 *179DB4C6228222BEDFDDC2F359628DD59101D2A6 frankieroepke
242,983,373 *1792EEF9AC89E6625406CB37E7118DB90A5DA96E FRANKLINERIQUEZ
242,983,374 *17941270A1E11DBBAD8400C8AF55128EED6CB7F6 frauenliebeund-leben,op42:helftmir,ihrschwestern
242,983,375 *1797A9DEA7E8F4FEA567C65B06E9B628928DCC27 FREDERICKBONNER
242,983,376 *179E930FF649DFDBC1FF426B9E278E1C932B656B FREDERICKWACKMAN
242,983,377 *179E1F58E287DDC37BB16A5BCFD9172E8C72B150 FRITZFARIN
242,983,378 *17932DBB60D8E4D68938F259ADF3B913E6F42F16 fr : ( tcmassy157.hol.fr : 195.154.35.121 ), france.
242,983,379 *17927AF9CEEE4BF2F36786BB2317B103634BF18B fuelizing1
242,983,380 *179392755D41DC2B4A04126B3403389B9C429552 garden-of-dreams:-indian-summer
242,983,381 *179570377E9074AD042D687B9995435CD46139CC GARRETTMARABLE
242,983,382 *179831287286E014E744D9BC1FD10BEC07278756 GARRYBERKHIMER
242,983,383 *1792CC0A533D57F87C43AD2823EB28467DB8DDA4 geiziger6
242,983,384 *1797C2F13EE5B874A306BE07AE44E813C9B04A38 GEOFFREY.DILLAHUNTY
242,983,385 *17911C5301114DF4B9D8B8C493BC5894D2CC40A6 GERALD-L-WILLIAMS
242,983,386 *179A870BAED8DA158257D6885588317828F19B3C [email protected]
242,983,387 *179ABFD56659F2A9CB8C1EC1A7A222937189305C Go.From.Here
242,983,388 *179FE2577538B382E80481EE47C7C4AAF08DE1CB [email protected]
242,983,389 *179AE94DF09A282BE42EED056004AC678EBEA169 GOSSAMERRINGEN
242,983,390 *179801A991C3522C6FA7E06585EB7325B91E6920 GREGG.LABRE
242,983,391 *179EDC0902B531C6382D69DD87D18A1E029C8F36 GRUNDKOMMANDON
242,983,392 *179292C12BE8B66FE33A2D9A64DB22F22556AF3B GTRKTRKT2
242,983,393 *1792B7E1F67B28826EFA78AE0F1B99B280B92027 GTW]
242,983,394 *179B44F8DE619CB163A67ED5949A7D4C912D53B9 GUMBALL7515
242,983,395 *17930722EF98604359054B9A049DB1A0386C5299 [email protected]
242,983,396 *179D189661B5FE3FC9D574A7A33E36E875AC94E3 hailouise
242,983,397 *179F64E3BB830B68402BB3A9E52CDD7012828261 HAUL.B
242,983,398 *1795B2C21041DEEAD265C447C672400080536573 hcshrc
242,983,399 *17936E22E7F44F0B120C9C7CF7907BC2AA16A694 heptatomic3
242,983,400 *179D52E25C96EEE1B943DF87BBAD47E83EADE226 HETELICH7
242,983,401 *1798C1B3FBD43F7C94FA657F37A00EB238C7991F HILARIO.STIELAU
242,983,402 *1792B3A38950A495DDDF168B9C20D8D5AD83C7CF [email protected]
242,983,403 *179B9A628DE94EAEFC2518C5796101786AFD1D58 [email protected]
242,983,404 *179D8C5602BC01CC8D93BB714A488FD6CBAB90CC [email protected]
242,983,405 *179ED1CE68E3E64644BCA28EBA46C7538FB7DF26 Hommage-to-Bartok
242,983,406 *179FEBE79B10C36A9E6F307472FB5E4768F5AFD1 HOOKED.ON.SWING,.PART.2
242,983,407 *1792BD378D0D4C6029A61D148A15115ECBAE1986 HSJUTS
242,983,408 *179DAE69B40BCCAE4B48F172D5C145706A9F1FDF [email protected]
242,983,409 *179E9A4A9C00190419002A40B2152F0FBCD1987E hubertprabel
242,983,410 *17939ADCB9167587D769F79A8605838D21910FAD humanitiesverst
242,983,411 *179E9BC07A5D049D05B3AED0BA0807002762E3DB I(?.
242,983,412 *179923FF91EEE265C4DAA11CA1B401F7B8649FAE IANDEREGG
242,983,413 *1796512EACBC848FC0B11156F88F7418AA1A66FC IANMURTON
242,983,414 *17944B9777AEA301107FC6868D1B84B44988895C iarigguf8
242,983,415 *17965F3FAD5F022D87C40075E2942373D3BD2A70 ijv"
242,983,416 *179C2F43F77CE9A77B34B68D8FDF09CE49D4E835 ILHW
242,983,417 *1799EEBC50E81624A2725E58EB61A3663F22940E inasi-yild
242,983,418 *179FD80F878BF30F572B25E88F7AD21C605CE780 IOANAY
242,983,419 *1790DD4ABEE499377ACBD7930BC0E444ADF8DBAE IQ6G
242,983,420 *179B4CB7F6D647F38FCA91A68AA676393A0EB1BF JAIMDINAMO1234
242,983,421 *179566F9489C0B2B10190DD7CF6ED59D976370BC jamelyellow
242,983,422 *17968D940E60BA92498A514191CBDC29ECF89C9D James-Howlett
242,983,423 *179F68B1ABC374A119A48CF621CE9F0E54E513B4 jarrodtracey
242,983,424 *179CE2D6701896474E02F5D81E09DC9773425013 [email protected]
242,983,425 *17937D86D754A6716B06C537B593F958095E49EE [email protected]
242,983,426 *179C03A687E89439A1D3F7AA0764DAADB3ACF53B JEFF-YANKANICH
242,983,427 *1793A81FFB7759E4EBB6A11095C9B5DFAA25CA04 JERROLDPUNIHAOLE
242,983,428 *1795E42A27138FA468AC36CC03D47919F336F40D JHAYSON PANGANIBAN
242,983,429 *179445BC3F2895BC5ACE95ED68AE593C8D279D39 [email protected]
242,983,430 *179DBC5CFE93920B7C457F3CD181A3CB8A3D5AF0 [email protected]
242,983,431 *17928D934CDAC8FED7D6F1BA6B14D73616527B60 JIMMANN
242,983,432 *179C04E41077A2D21AD2BF09A2386611D93EEF3E jimmiehensdill
242,983,433 *179B8982C5BC79F9313C786BC794855629944627 jimmy-ray-wood
242,983,434 *179BEE70D2F39311B33664B3D6517BA155EDDD17 jmC
242,983,435 *179F6E7D29A380C7B2A5D967C7DA87FBFD4541BE JODYPICKERT
242,983,436 *1796BFD60C6A976C1273079A8CCC265630023E0E JOESPHNEWLAN
242,983,437 *1795C238DD4DB22BEF499201EDD2C30338E99F28 JOHNATHANHILLIN
242,983,438 *1791BE36688544DB88785D82828A5939F3E82808 Johnny.the.Clown
242,983,439 *1790380F3903A1105E254486839D4805E3438788 JOHNSON.HESSER
242,983,440 *179D810CC7FCE0BFE39F43218F30E26D0331C849 JONATHON.STAHLHUT
242,983,441 *1795F8E054BE815D4AC127EBDBCD702BEAE05398 JON.TANEN
242,983,442 *179E63D57B90CFDC06C96DD6ACE44DC136314C9C JORDANROSAMOND
242,983,443 *179352730AFC99795449335B0764586A2C0C06A6 josedarcangelo
242,983,444 *1793E8028D26F5FA06A46A887F4AD6EA1EE816D8 joshers
242,983,445 *179ED08F89EC245277260C9E7967FFBCD4051A9B jospehrocconi
242,983,446 *1797C7DFB4C6C92BE6C87F2D619D4647BD8C122F JOYNSON80
242,983,447 *1790A4857449DD054AB7CA63245C1584898BE895 JUDITHHARRISON
242,983,448 *1791422CBEB66DF172A8A1C0943C85F52E0EACCB JUNIORDABBS
242,983,449 *179836651DCF08831CDFC177CA5CACE6114EDCDE JUSTIN ESSEX
242,983,450 *179069DD650A7F11ED34121267E01859C84ECF02 KABELDECKEL
242,983,451 *179B3538F7B5D17568A0415E902691F51AFCD578 kenavala
242,983,452 *179FE965E1CFEEEAA02C79623183DFA36C0CA5A8 KGOSI.KG
242,983,453 *1791FDB080052DB84A043847A37659A6FCEE4FBD KIRKPRETLOW
242,983,454 *179630554D1A0DA489EABA131563BB9D53572C74 KLHMATA
242,983,455 *179B9E80EFA395EF27CEE8E5EC788EA34EC4124E KNOWWHO
242,983,456 *179644996FB56F405722E27BCD655ACA311FDE38 kundel1234
242,983,457 *1796B894BF07904499DBFEFAE10B7F10682DD72F KURT.AAS
242,983,458 *1799290D07C481591CA99B79F1A33D0100EBAD47 Kxaa
242,983,459 *179CE4CA5EB3B15051187197D2F0871F1D7C4393 L75*
242,983,460 *179063C889A3BD8E34FFD57457C0566585BD1496 LADYMARMALADE(VOULEZVOUSCOUCHERAVECMOI?)
242,983,461 *179AF61B4056E0E80B774B87FAB2706488529427 LANDANKU
242,983,462 *1793D6CE6DB7BC04FDA7ADCE56F2C52A9DC684EB LANTRINH)(*
242,983,463 *1794EBF7C272551831D4565F53473B0A2AD6375C LAUREN.SWIRSKY
242,983,464 *17997CA64105FE6C03C5C2EEAC7775972C58194C lawsonia7
242,983,465 *17970B2B27CC2C45B72E4905E175479C81FBCF36 LEONELTWITCHELL
242,983,466 *179E7CC8A2B22BCBB7CC7FCBC37EB5C163946E09 [email protected]
242,983,467 *179908D09EA6E7CBB092150479DFDB02679FC5C6 linfoma-de-burkitt
242,983,468 *1796CF676EC59BC4866CDEF0DC87457EC4099E91 LIVIA200
242,983,469 *179F406D29C5C6B867E1D84F7C0B3C7DBC907AF6 LIZZIEPETERSON
242,983,470 *1795E3E993D50FA11F42A11903009B09F90FBDBE ljfdeaded
242,983,471 *17940EB1E93C6658F87A1F95156501A1B0AA3AF3 lorenzoneibert
242,983,472 *179250DDCF11E759DA0FF854E4F1A01A37EE5A36 lospaokos
242,983,473 *17926D9EF8682A931226090824992FDBDB52620A LOVELY166
242,983,474 *1794D7D596712A3D72F4C6840428E53AE6965373 LOVE SICK (dj [email protected]:16 Remix)
242,983,475 *1795981EA1F4842D55142C814803812FA4C88B8E lowena
242,983,476 *179BF78DC912F477D852972F7E95798CB1CA2024 LUDDE.2.0
242,983,477 *1790BB66C8D9227787D0883260437A0FD5AADFA7 M3852421
242,983,478 *1792390D85079BF6A439472B88AFEBD7D302E9AA macbe202
242,983,479 *179A0F16D1192239B253E5107CC6444002D5AFD4 [email protected]
242,983,480 *179EC0CB2CE81B738FFD5EEA06E1A4D985FE3632 MALCOLMMCCARVY
242,983,481 *17981E88560D9879657972325491F0D3AED89D20 MANDAGAAH
242,983,482 *179BEC3E213D147C884730D99CEB4C8B15A88CD4 MANUALSCHWENDEMAN
242,983,483 *17929CA1AF5B44EEB2D14A57699A2C4BDECD3DE6 MAQAND
242,983,484 *179DB88F8A677526E34C6A2BEE653DFED4266A1F marceldeadhead
242,983,485 *1798141AD432400502C23DB51FE24CEAC5D467A3 MARGARETWICKS
242,983,486 *17906658D895EFE9034FB16855A9C4BB984BFCC7 mariaritchie
242,983,487 *179296F2059DCD76D666E0A194365707BAF2FC80 martybashor
242,983,488 *179D9007FABC23629A1698FE12304F0FCA2733BE MARYMELADY
242,983,489 *179FEDF9E081E89EC2A4D9EED8C5C251EA161400 MÄTFEL
242,983,490 *179D8DF2E243E5E86438D590075119EEC75EF137 MATTHEW1511
242,983,491 *179B696BFD59DF18DF468CF83CB73B276224C968 MC}E
242,983,492 *179DA83ABAD450AFE171F7689F0A5942DEA33970 MCKINLEYDELOREY
242,983,493 *179430F2FB87D84E4A4848512BC8C321A6F3AFEB MD;;
242,983,494 *1797810D8F27A4F92B19DCB90FE7CE981C8B7C73 MEGHANLUTZ
242,983,495 *1798EFEBB95BF4EF4A5730935C916460FD3523BE MEMEOO1
242,983,496 *1798DA88121CA552B36BDE4B0049622288873459 MENTONIAL
242,983,497 *179DC1F647608354287C9F61E2338A9C89B7A1DD MEXK
242,983,498 *179D4937511F49104DF533525DFC967B269E4BBF MICHALLUNN
242,983,499 *1791C0B647A54B124F381D483FD4CE3FD043C65E [email protected]
242,983,500 *179F6BA527F911FBA73DA5E873949B4B0D8F48B5 MIEZA
242,983,501 *179008436C3AA6BA079C9FF4D7AB84F7D291EECE MILO.MARMOLEJOS
242,983,502 *1797A69A13721C6F87C0EE708FE58D564313B2F9 MINTGEEZA
242,983,503 *179374FEE918284A5FE553E324D111D895848199 MISARSHAFF
242,983,504 *179B7C796B38EE627E1BB30EF71EC2E814121CFD MITJANER”
242,983,505 *1798AF3DBEAE671940EFFFB74A1520D6CFFDE5B0 mmw
242,983,506 *179620A98117106A510404D945623A224B21BE7A MOHAMMAD.KERCHEVAL
242,983,507 *179BD12A994DA1F0FC6B571372158C174C12D115 MOHAMMEDGURRERO
242,983,508 *179E771D0A47C00102A72637BA317DBCF39DE7F4 MORE.THAN.A.FEELING
242,983,509 *179982DAFCDD803153000FC9C8D9504D19834E84 MYCLAIRE777
242,983,510 *179AE6FA006EFF2BF7B4ECC733B12885FEE233D8 MYLES.BARGINEAR
242,983,511 *17938E7D7D98A859FB04673EA189185CF9F8FE87 [email protected]
242,983,512 *17909B8EE621B64557D3F929A68A33CFD750F30A natasha-marie-massie
242,983,513 *17925B3B8FADE9AA5B10A99764CD709388AE7777 NAWEAHMUM
242,983,514 *1799C5BB0EBB64B205EFC6A2F6BFBCE6FA5F8151 ncvlztnses
242,983,515 *179CDD147B492EC06E467FF1F0C1F12475E1ECB5 NEMELYIKUK.1
242,983,516 *1792F7006C1B65E7DEA443AFFDBD6AF42BC6B984 neoaceratoneura
242,983,517 *17954757675602745EB31009332FF6F007E78B34 nevape
242,983,518 *179046E059DF0C9E0AD64B98AB750AA6A5F0A2AC ocreation
242,983,519 *179C96CF5F537697C80A20F01D139808366A48A3 OPENSSL098A
242,983,520 *179E5E126BEF5AFE0B0528D4E7D934426F878F08 OPPTATT
242,983,521 *17903C1CB8DB11DFC6F67B1EE5D7669E656CE3A1 OUTLAWED-YET
242,983,522 *179C16915FF468F5A90CDC50CC7F0D5D5890D2BD OWENSCOBLE
242,983,523 *179E9C858BC10F7F89180D66ACCEA11E6C83F8CA OYTIS8
242,983,524 *1792B1EA5DC747C07266A0445FB7619200B829F6 palischak1234
242,983,525 *179F96EE91603E74A6D86786BAB0E22B8E53EF7C parkerbirnie
242,983,526 *179435FB2391C2FB816868C1C30D5C2B9EF54AF3 particularisaient
242,983,527 *179FBD49DB5FB0721B40EEFD20012AB79140CF5E paul-schreurs
242,983,528 *179A31D5AB199AD3B2FA86251458CA91FE84FC4B p====B~0.(x)
242,983,529 *1790F15945DF39B96D6F1C68547DA82517256850 p------d.`splat!
242,983,530 *1791BA081992AD3BE0B385FB7A049B02FAFAE99F PETE.KEATOR
242,983,531 *1795778ECA8D5E71D4DA0262615834AB0CE731E1 pfdtleobq
242,983,532 *1795FF443A6746670FA878C87CD6C35F9B712949 pianotrioinbflatmajor,op.21:iii.allegrettoscherzando
242,983,533 *17940E38035E0005002C7C4945B9578DB47B1E4D Piano Trio in Bflat major, Op. 21: III. Allegretto scherzando
242,983,534 *179BE385071139229226D5C2890C3AB80D28254B plantman,-part-2
242,983,535 *179450C26953AC0873B8586D2E57488CA721F522 PLATSEN2
242,983,536 *1792C37A28054B697DB97DFA6EC1BD67488152A9 pnefie
242,983,537 *1794A674D958F7D7F355FE79D78779957753FDB8 poffertj0
242,983,538 *1798CBF64513DE9A17791BD391FD5535A80CD9EA PORTALKOLLEGIN
242,983,539 *179D508B0E0B1C76E31A85B20979EA01912D6DE8 positive
242,983,540 *1795B44B336998D476DA9666F359A73B41ECE5FC [email protected]
242,983,541 *1794DB322CB66E958678184C8C82AAC9725AA3D0 pp4145
242,983,542 *17993372FC55F226CBE9F6486FDC1C3A1890775B P-----p-~-~-~(O_-)
242,983,543 *1796270ADA9D6821A230FA283188F8DA417EC68E PREPNECK1
242,983,544 *179CBF7D6A9BACE343F07E662BBD7B09A8A78398 productivealexandre
242,983,545 *17965CC37E9C71F9B39CA0AFC5BAD2760950DDBB PRODUKTIONSWIRTSCHAFT
242,983,546 *179EBD6AD501C2B94C38CA000C66A2654B67654A ptlstmn3
242,983,547 *179FAEE1DC38C61B4A38849D07ADB919F01A0F85 Q&AH
242,983,548 *179D8A073C5371D90B53B351507889597BAE60C4 QDH616F
242,983,549 *179D60387BA03DE47F56DFE04440C74402E029F4 [email protected]
242,983,550 *1790DC7FDB0AE61A6487EC1C64993237588F913A [email protected]
242,983,551 *1797EE9DF7FCEAFD8D3AD9107CBFD14AC2030305 [email protected]~o-~o-splat
242,983,552 *179C7503B10B3BFB9E0930BD72BCDFBD84D1161F QZNZ7GAQVREQQROI8TD0G
242,983,553 *179F9AC15AEE59CB8FE58661F1190B7263594E1D R3$01U+I0N$
242,983,554 *179D99DFD0D193E827FAF4CA1F07C2D0CBB2C3B2 RAMONHARLAND
242,983,555 *1794BC92A4C6FC34C40E30570B5F12DD42FE3B50 rampageous5
242,983,556 *1795D04104829AB453E20BB7C2E5BC2DEBD30170 RAVNIT-KUMAR
242,983,557 *1796CA74B9E71131AC96FCD3626ACC4641DC6AA2 RAYFORDNEWYEAR
242,983,558 *17969AD8C73370C8CA896484413468F5876AE682 RAY.HARPSTER
242,983,559 *179816AEB7026C29C2C46D6A9D6A393A18A9F4D5 REAMPR
242,983,560 *17977C53D2F20D82B40C64622C83D982C6B60C61 recolonising3
242,983,561 *1792D084C1A58FACB82FEAFF318F4380339EF21A reginaldmortland
242,983,562 *179F0BBD672B8CAC2762FEECB76677ECFA8EA129 REGINALDPARRAMORE
242,983,563 *179919B714E8433826F3424B88FF7EF7BAD8B252 REHEREINGENOMMENED
242,983,564 *1797852AAB5614F6DCAEFBC2F7840FBEE1929E3E REINALDOSTERBENZ
242,983,565 *17940776D133597834267EC6145328CA2A6FCD94 RENE.BIBY
242,983,566 *179A3A755460E76F9D3FEF0FF6F7E2B374B3FBC1 [email protected]
242,983,567 *1793C22D158F7F82599E9727A486CF1FC5ABA794 RESOLUTIONCRITICAL
242,983,568 *179314083FC16AB518BAE7FC339138FD5A733767 [email protected]
242,983,569 *179FDA71749B24CA90DC16E29CC67750FCD8BF0A REVELATIONFILMFEST
242,983,570 *179399820CA5AB8B408387545584A0AA8841DCB9 RIABILITIS
242,983,571 *179B40441CA11C2FBE844C9EA2C4AAF3C7716C24 rickpullam
242,983,572 *17974527774CA5629BEFE16B63666F49D3EBB0A2 rickyerbach
242,983,573 *1791A5E9CDB7BC03D752C3B9C936B13B181BCBC5 riscchip1
242,983,574 *179DC839639502CE3B6B826EF4B71A4A559C4E07 robtjockers
242,983,575 *179DDD723544EA43F04843B21AE9C7A0BEA357EE RODERICK.GILLMER
242,983,576 *17948E8C89C927EDC0C7311B4AEA174F762D3600 rodneykarth
242,983,577 *179D87620E26EA4CEA3329311DDC9234876FC559 ROGELIO.GALLA
242,983,578 *179478BE59AD90D0454FD4642F53A966C8B88680 ROGER-WINSTEAD
242,983,579 *179CDBA4F0B7549753CBC5E9C8EF5DEEFF69AAC6 ROMAN.PELOTTE
242,983,580 *17977D272074E73169AB31C08C5B0D41E0255AB5 [email protected]
242,983,581 *179C209155CE9A288F88DB573F76B7E9C31AC6FA rorykazarian
242,983,582 *179485E527B7DC84773FB7B3B23251645425FB4B ROYAL.PASSWATER
242,983,583 *179D4ED39FD8203B873F015459846D7AE01E6812 RR0
242,983,584 *1795120D25FDD8FC4F179340FD255FBC9AD80E9E RUDOLPH.FIQUEROA
242,983,585 *179E0BA9CE464623ED53D70C54E0F1A91441E351 RUDYKENNISON
242,983,586 *179E8021D51A1E61473943262DAF1181CCDAB39C S4CRO1L14C
242,983,587 *17966DB13DF159DA8C0054935C18F48992023B62 SALLYSNOW6
242,983,588 *179725B4CDBFFBB55F44E260D6157F95CA6A56F1 sandbankn
242,983,589 *17954618461AE74AC2D389BB63425D714B198A8E SAO16038313
242,983,590 *17969BCFED6458FE18571E1DACAC46399C7887BC SARA GASKELL
242,983,591 *1797755A3C1942A394D5D702EA2E249BEB1040EE SARAIYASED
242,983,592 *179690C480CB700C511EB974ECD94D25548D9E8B sasha-wu
242,983,593 *179516B8A1323C2D97E3C466A0F38A1917B86D4B SAWAJIRI-ERIKA-TAKASHIRO-TSUYOSHI-SPOTTED-TOGETHER-IN-LED-ZEPPELIN-CONCERT
242,983,594 *179AEA0D4D14290D29E058A479F22AB7BF06F79F SCORPIONQ7
242,983,595 *1791C99E5B6F92B4203F47D82F35AA98F691C7FA sdlohrofm
242,983,596 *1791A8F217AD79C311425E618151767B7865002E SEBEVEDOMEJSIMI
242,983,597 *1790FD17DB4EC2B3F651189D1342568A7783C1A4 SFDAAA
242,983,598 *179B9F0A30DD10ED7B5F9DE13A2055C9F5FFDBCC shanebinks
242,983,599 *1793FCA62FEDA0ABE503D223403812B993504E12 SHOSHO2.
242,983,600 *179DC0345C32AB17ADBE938D51131FD73AF382E0 sikmalara
242,983,601 *179A1E0BDDE12DE168B8BA5A970E1A6DB141A7D7 SILAS.MINCHEW
242,983,602 *17993F56EF76D0AF7616406C7E132EE31DD262B2 SINACURA1
242,983,603 *1793BA578A716FE0B3E7DC0F3E90F93C796943DF singura.cale
242,983,604 *1799B31EB902E904F6C20DE85F4032012FAED32D SKALLBERGSMOTET
242,983,605 *17972EAA060126B7328393E2961128825EED0DAE SLOOSHY6
242,983,606 *179325D744BA5A0D045A21E7C412F0B41A60F0FE SON.CLOUSER
242,983,607 *1795B82ACD589DED6A033FB235413FD9EFFF3525 SONNY.WAIGHT
242,983,608 *17992F55DF298294A12A0C53AEA3D2236F8BA898 SORA-O-KAKERU-SH
242,983,609 *1799A4C40485FC99D0EA7852F5F1C89E23EB030F SOUSCRIVAITED
242,983,610 *179422DF316C1000209FDC474AFDEF324AAD11F5 SOVETSKO
242,983,611 *1795A2B400173E2D6E47530C42369572E38293B9 ssnltrmnn
242,983,612 *179F3674EF4F5FBE4A894B190D8D473F2F9FCEA0 STACEY.WIMBER
242,983,613 *179379D540D978C0B24C125B4C6E8D1A9153552D STANAUGUSTAVE
242,983,614 *179A47F62821A0C8D7A3F310DE7266CE69F8F2A2 stanbinn
242,983,615 *1798D5F78C4C0DDC321C699708E98FF89CFAC3EE STANDCHEN7
242,983,616 *179932E369B8363F00AA588848749D3866F383C5 STANTON.FREAS
242,983,617 *1790E490BE4EFE77BA7806B963026DC5163F18F2 STARNAVIGATION
242,983,618 *1791622D1C93FBAD52D7003CA768E95F0D1302C0 STRAWBERLADIES
242,983,619 *1792AF21569626FEA0372FB1D27A5EEDDA055B34 STUKALOBSW3
242,983,620 *17919102E9D980A541D2FFF7F9EA4F79B4E64FED STURTEETRUTS
242,983,621 *179B854FECB48F6BE4A715F9F9BF3855FE55AC62 [email protected]
242,983,622 *179089CC8B25A9F322644AB78FF9CA22AFE306D4 [email protected]
242,983,623 *1795FABB930E0BE5A93DE95A6363C1A3A52CB5EA [email protected]
242,983,624 *17943BD8B704D30E85A847886736A893DD1EEAE2 SUONEGOROPSA
242,983,625 *179D773272902C88CAC347821B4619F7AEE8FF83 [email protected]
242,983,626 *179F40ACD1BD35ED64EFD720822CBB8FF1B84A55 SWFRONISTIKHS
242,983,627 *1797A6B7B4725CF2B51729636A6711B4F15BA934 sXC
242,983,628 *1790059D2344AA0C0A87F8238BB7B76E84B8DB92 systems,".march.28,1988<p>
242,983,629 *17994B11F471C10726FFC6FA8448588FE3235865 TA1IPAT
242,983,630 *1798AEE3AD7FC3EFCE2BB17192526EA0BE5B1B83 TAARRUZLARIYLA
242,983,631 *1792D15BDACDFDDBA177F5D5168BBA2AB98B351F TADOPPENHEIMER
242,983,632 *1791C89D30A27AFC50FF0B19FB718441A48A889A TALKJROBI03
242,983,633 *179C83C045C81035F8460DC5DD3A9085B589CC21 TAMEABLE
242,983,634 *17914C4CF890006F35348043ADF5985460DA4DA1 TAN-SHU-PING
242,983,635 *179F3529569599D800B58D217870CB9D1ADEA880 tarjeij0
242,983,636 *17954418E16642343575A66BAA79D07074073EA3 TERRELLVISOSKY
242,983,637 *1792661C7D19020FB503DDFE44C20A583FBB40C0 [email protected]
242,983,638 *179AB398488281658CADCBFDB3A38FBBF16D3CA4 THAILANDBO
242,983,639 *179E5212134C66B4831B23DAE53DACB9E4339749 thatsafety11991
242,983,640 *179646164379161C93BBFDBE0DFCD9F785319EF5 THE-GREAT-UNCONSCIOUS
242,983,641 *179F6B97A2C5D733EA8F4D869DF4ECD87907B811 THELACHLANTIGERS
242,983,642 *1794EC40881FE2CBB37F688937870A10C035DB6E THESUZANNE14
242,983,643 *179CB9B3BF05739C1AA09BFF8FF7AB115E8D83F9 THETALEOFTSARSALTAN:ACTILULLABY:"BAYUSHKI,BAYUSHKI!"
242,983,644 *179BAB66F801291C3E28DF3D8E728A313DBBC9C0 THIEMTING
242,983,645 *179B76F0114F35A5C3B24A84C6C461E2773018D0 THIRHUV
242,983,646 *1790859D74D25DBA915636C995C228525B80324E THONHAUZER
242,983,647 *179C80E19F675683C694668172DE77237F68CE84 timiwa
242,983,648 *179B8B6DA3CF76CF72961A9768D1904B6CE314DD TJDKRNGN5
242,983,649 *17957B7E0D7BF4057D74BA9B7F44CFD2B4BA17F0 tneiaresilannosreped
242,983,650 *1799C8517AF363D3ED014895E7AB20FF5AB2E757 [email protected]
242,983,651 *1794DFFFF6808893610301091C018A45A7C2E268 TONY GUADAGNO
242,983,652 *179DD8A6DE2F6907E15A75D3745E92808D4B3C36 TOOK522JEFF638
242,983,653 *179C22A88150CB6E6732E0E3C1CD7B9CDE5C0A2D TRINA CASAREZ GARZA
242,983,654 *17902122483BF0E74C6434E3B2BDB0FC3D4FF8D9 TRINA WHITE WOOD
242,983,655 *1791AD66C9CB5E31926CDD700D9AB8208A940D9B tristanbartimus
242,983,656 *17932784A15612738EBE4A0A9FD5FD2037120B0C TROY-KILGAS
242,983,657 *179B30BC9DE02F55777CB041E524AF87B403DAF2 TRUCESON
242,983,658 *179513297DCD49A448805E1000A77EEA60ECE664 TSYTIMI3
242,983,659 *17950CDA23B02CB041F2C6868293B4501ABC26AF TUCRAELC8
242,983,660 *1798729057DBD1C29C6865C11F74E3389916ACA9 TUDES-TABLEAUX.NO.2.IN.C.MAJOR,.OP.33:.ALLEGRO
242,983,661 *179C300B9A8595928DEBDB0581B5BC6049B70921 TURINBRAKESPALLADIUM
242,983,662 *17952695F1AC3ABE47D99DFAE577CF9A41DDB737 TURTLETARA
242,983,663 *179051F85479402962C3BE49174B8649A5B32B4A U100009
242,983,664 *179E9EC5759E969301ED7D518AD6F5DD4F964F4E uithoes8
242,983,665 *17912B7FEDDB2057DB355AD421C92BCDFD1D9FFC ulyssisbbs
242,983,666 *179CDC2A9126EF6D6849FA8151E323CE28239A8E UN7UN1NG
242,983,667 *179CFB4ED0E8E04CBC9C1ED31B7BCE6B37E27238 UNIVERSITYBJHSLCH
242,983,668 *1792658F4945DD4FAE21C88638E31832BA6D445F UNRAMBLING5
242,983,669 *179F1666334FE66FBFDEDFB2FF99E42C41EA63FB UTAKAPOFUNULIWA9
242,983,670 *179A1218B306ABBBAC9EFC433D45D25607F756D6 UYEN NIE
242,983,671 *1791BE450758B7A1DE486BD931AC01A190EBF19A UΦNO
242,983,672 *179A28FCFDDE4BAF5A80345B2365FAA253F1BBFE V`;AAA
242,983,673 *1796B75EF0210A2EC202B7C5A7A44DC69998463A VADNAISBSW
242,983,674 *179BE681036B6372260C13F2A21AE8B13354AC84 VÄHEMMISTÖOMISTUKSIA
242,983,675 *179A793E8FCAEB7E376D2425425EB8961216B13C VANMCKENLEY
242,983,676 *1795AF279D29AA24CC47B0F6D98523E7AFF6383B v{bi
242,983,677 *179174E67FAE3B5640FD0463B61F73AA1178A242 ventanasdehielo
242,983,678 *179CA02E4475B809CB91FB4104F9CF60853C779D VERNEHO
242,983,679 *1796E093B305D367C31F927E04058AF6706187F1 verticen
242,983,680 *1793ABB92B62604554B74269A69A932454871AC5 vianaoliveira
242,983,681 *179144E0F21F8763D727838E75F8B2E94DEE3012 VICTORYMIKAELS
242,983,682 *17907F916612D8F124E268C14C9AF0D15B12A44A VIDMODE9
242,983,683 *1794D033CD657B453EFF369B5FD07BCA4052696E VIENETTE-MARTINEZ
242,983,684 *1793E9281B1CF1FEBCBDCEF1A24C42EE37E0DF86 vijay-jagassar
242,983,685 *1790C9801A6FBE3DB84A26864E37AC39ADB7C425 VILIACOS1
242,983,686 *179F595869A5F950ABF1EC487F3E869887C68761 VINCENT.LAFORET
242,983,687 *17910B18074516237ED7B049A5FF9269EABF90B9 VINCENZOKRANER
242,983,688 *179C63F9362D37EDE07A817BCC3659D40E66BE42 VINUTHA-RAMESH
242,983,689 *179B7FCCE23DBEBA274F84C3C2342A013648B993 [email protected]
242,983,690 *179B25BED908453E64D9FB4DC08D3633A4F0FCD8 virerions
242,983,691 *179DC673D810C3FD7092DB4E6E1E208CA9170484 vrwttgd6
242,983,692 *17935756A9371B9611F8BE7A18F89A679120CE54 waldovittone
242,983,693 *179670E099391F5789D4AF2A002AB35FC110F681 wallyrodeheaver
242,983,694 *179EF6A7762F2D2BA12DB971EF52BFD87F8C4F6C WALTENHORTON
242,983,695 *1791C0AA420F257758D1667AB1E9E58BDFD0D105 [email protected].NET
242,983,696 *17910045A284A51BE5AF28CF26A1F707529E9B19 WANNIGEH'
242,983,697 *1796A2F01F40215EE8E652D698D352E73636B094 WARNERLENNON8
242,983,698 *179FD2F27DA7B15F0C0A9BDC75A0A2CFE760031F WARREN-CERFF
242,983,699 *179C5F503993E9943D900C229FD92E5D2FE77B01 WARRENMELANIE4
242,983,700 *17906B8D02409D13FA417140D5531531D113CB54 WATERMANWATERS
242,983,701 *1793F733F3631E57BAEB5244E12BBA4008577C3A WBZ*
242,983,702 *17920A33076E0CB725AE7278DE835C06955D32CD wendygrossopackard
242,983,703 *179B7678D387AB432B7D214139D8791EC878DD20 [email protected]
242,983,704 *17997CC8F97C9BE9F7A50F2B980F5F16E70211F3 WHITEYS.
242,983,705 *17978C471AF4AA4B40EBB214CD62A5437085E11E williefarwick
242,983,706 *1792C3E6C8FD11DF4D6BE51A5270C6DFBFC7FE5B WILL.LIPKIN
242,983,707 *179860A91674AB94C6CC354D4A1AA403EF1AAF7F WILLTRUDE0
242,983,708 *179C06882BE36E49829764EB7415E574F08E235E woodyfrancis
242,983,709 *1798F8E4EA2115CD8D678BE73B35F6BD4DF701A3 [email protected]
242,983,710 *179639AF5543351A92C87DCAE9548A2B6EA9C69B [email protected]
242,983,711 *1794831157C96DFE0BDCEA7299C2A6B2593F911D ŸAAP
242,983,712 *17903D8D1D6A33A687177D9BC0E6CB31F70FF19C YADIMUCHTIAR
242,983,713 *179E2918A794B7213135297CF852822727227808 YANINA MIERS
242,983,714 *179C7A91D0252F7B13FC587FFB8DC4C68DAC68AD YANKEESDEUTSCHING
242,983,715 *179B05C06153FB447D6640C5D2B44984BFA89A51 Yarn.twis
242,983,716 *1792D5FECBED0038B5A532EA465B52E38703202A YESTERDAY'S MAKEUP
242,983,717 *1795687DBD3BE6A847C8BD7EC70D35E65189FD9D YEXENIA ALLISON
242,983,718 *1790C301E0CF757064CAA6AE1A45EFDFE3B3A8C5 YLETSIPPED
242,983,719 *17923C1D2663643C655BB8A47A0BE88B1F0E8E5C YOHANES-ARIP
242,983,720 *1797215728CC3EB610AD7EFB2402A3225C99033A YOU DON'T NEED TO FEAR DEATH
242,983,721 *1792BCCF7C1788B2C3FDD9CDA31B7178B320F3F0 YOUSEF-KAMSHAD
242,983,722 *179F06437F96552AB4343FEC0E515C05C7A05593 z`(
242,983,723 *1795810FE8A2D951E2C19FC04CF5170AF582F9C1 ZACKARY.APOLINAR
242,983,724 *179D6082607296F0F992180FC83F5BDA2D761E9E ZAD.KOJOK
242,983,725 *1796155E38A983087EFA2E2BABE86C804205E3DC Z:C$
242,983,726 *17987F0810C9FAF87078BB576F6CC187CD56B4FF ZEKCOTS6
242,983,727 *179BD094D3DD00CC2B3338C2EDA5DBC2A18B50AF ZELLEFIS
242,983,728 *1792B71D286311B463054307B01DA7E811614886 zenitha-sakina
242,983,729 *17950129DF577A2719D72F23D2C313946A9A33F9 ZOEBALLET
242,983,730 *17939698EBAFEDF6441861C478B93E3AC6C87A05 ZOIDSOFT
242,983,731 *179A1A9538F9B30053B42283E0A1D4602789A858 ZOIE230
242,983,732 *1793FE15C3F5EC5EA96D6773EEF24A0B0D310098 ZORAREES
242,983,733 *1793C8A0ED23A41340B8F078ADF36729573265C4 zrbwc
242,983,734 *1797F7A6185B1DD11B18E3E6A0541FA2ADB60335 [email protected]
242,983,735 *1790365BBFA67116F5527E1209763AD2FF2C50B8 ÞIUDANIS
242,983,736 *179A4076BEDB30D9BCB8962C93DC6FA852507DBC ΧΆΝΤΟΚ
242,983,737 *179C466C52CF65A6189BE8CA6DF5D5FE8B241025 «АБАНИБИ»
242,983,738 *17952B87591542D7FF4F1ABC38FF55171DFB7620 АЗРОСТА
242,983,739 *1796E73A59954DCEA45B9AE214119EC52B4A5718 АПАМЕЄЮ
242,983,740 *17977142DB2CE77ABDEA4806ADFCC9D86DEF59A5 апахтла
242,983,741 *17975A65E2F2C908F27529E8BF64C05236F9D7F5 ГАРНИРАХ
242,983,742 *179D985E288AC0983B53555FB11ADF91C89C71F0 «КАДРИЛЬ» —
242,983,743 *179BECB2CF487FB935F779F4BC35B31B0D518E14 нагнух
242,983,744 *1792A32A9E73E5322FA4615ACE8C5515F276DEA0 ОКІЙСЬКИЙ
242,983,745 *17985EC4BC4B64059DE289CA2B8FAB5089B427DD ОРГАНИЗОВАННЫЕ
242,983,746 *1799BD4C828B9C0F7143BF6887DA9A55D4346108 ПАРКЕРЫ
242,983,747 *1795398D615FBC324C42D17E4860EB04AE77A8D5 СЛАДОСТ
242,983,748 *179092B26FFF2EAE98B68C38A5C3B8D2A171D2D7 суперкомпьютерным
242,983,749 *179BC3768749678A88BAA29B4ED63575B88EB21A улитник
242,983,750 *179D73EFB1BA200A1B4592DB8046C8F4626FE67C ՈՒԳԱՐԱՑ
242,983,751 *179F3E65CC95AB168255A32E00715B100D5D9E0E 的美國電力來源未來都將轉成非排放性能源,如果搭配上插電車將使得CO
242,983,752 *179532DF3E739CABF720EC7EF8DE7CC1882CEE24 (00).~.`.Q==Q
242,983,753 *179C0658547AD226092862068A83EB2A8672FB9F 032QWERTYUIOP
242,983,754 *179AE6E71956BF30735BFE72465EF55B9FB52C84 1013352 TERRACE CAFE BARISSA VOI NAUTTIA HIEMAN KEVYEMP
242,983,755 *179E9480C7F9845DE85A4A917F696541E6746628 1066804 SATOPUISTO TILAN 2:621 VUOKRAUSTA KOSKEVAN P
242,983,756 *179831B2392571AAF457006BC1761B47401923C8 10-kurulursa
242,983,757 *1796D4C2A2D6A1A64B5EF2CF73E8EFB66C8449C3 1197712 VOIT OTTAA MEIHIN YHTEYTT
242,983,758 *179B9D5DC5171D717FED706E64B0ED038DE3846D 119 RESURFACING
242,983,759 *1795F45722940BBF957EB9733C94552792BED267 11e99
242,983,760 *17943A8190523BD6D06ABC729E2EF972C415D779 [email protected]
242,983,761 *1797A2345A16A3ECE98A35D00A3B6ED1FA457E92 1549413 ES GIBT KEINE WIRKLICH MARKANTEN GERUECHE MEHR .
242,983,762 *179112C5D2BFB0C100F450752D3EF99C08116D37 1961060 JOUKKUE OSALLISTUI KOLME KERTAA J
242,983,763 *179FEE4668EFC4157363B2251CCD7880548DD146 1-betaeubungstrunk
242,983,764 *179B081685BC96D502EBC97A782FDF3605067C0F 1 BOOPLIKE
242,983,765 *179AA3776D48694E06D998B357D62ABB6CCC871C 1-bozdag'larin
242,983,766 *179C47D92E81AB23AC1BB6FC05D9C587AEB96E88 1-chandlerille
242,983,767 *179BDEC8B8117959CA20EBD2B08882BCAA9BE181 1energieressorts
242,983,768 *179D79CDC2FDB25B366682EAA1993E4B338A59BF 1.FRANCHISE-ADVERTISING
242,983,769 *179DB7E2A33D38285D108EAAAD7804F0600D6AB9 1guglielminpietro
242,983,770 *179A8BB9715A1C2E51E148328923ABFEEFDC028C 1 INFLUENCESNAVIGATION
242,983,771 *1794F1A4B769F523288E5252A516C412D53D7520 1ITTOHEK
242,983,772 *1794A33EF7E5A1DCAC0F5FEF8292BD855C6117D3 1-KAPAKKAKESKUSTELUISSA
242,983,773 *1793E12092AB290FA4E602D9E2645564A6D8A21F 1kultia
242,983,774 *1796C98B2C041A66AF936CD4B4ED3F3CD9324687 1-lustspielautor
242,983,775 *179FFD8592AFE31EDA852E7B8229651C10F6D963 1MALAIS
242,983,776 *1792A6EB56F13AB5AD3A55E97F0E65EE761BF355 1minitiative
242,983,777 *1795DB7803F0231B4EADA8CC92734D7C5A1EFD74 1nyrkkivariaatioista
242,983,778 *179715C8F7010945B8AE55B849A3698556EA4479 1oldgrowth
242,983,779 *179A3F1AB42693C9E1895801B32F71F351B848EB 1-prosessiongelmissa
242,983,780 *179FA8ACD0A6024D0627CACFC3A92F22B577CC09 1RADSTEDT
242,983,781 *1790E02C01208EC5B3D35630C00FA17FA800F75A 1-suekli
242,983,782 *17950037759F9F5C17F4CC283BB55C889EF81082 1 SYNTHESEVERSUCHE
242,983,783 *1795E1BB7F99584ACA27530EF935471B57DBDDBD 1.taisteluharjoitusta
242,983,784 *17991BC9A93B0412D681A4E5EE589A0D591D32CB 1TANY
242,983,785 *1791C1D21EE78F3BC4438374FCCF66BD67BA45F3 1-vorjahresertrag
242,983,786 *1799EF869BB7C2F15536ED672AD378EF725DC53F 1.westimbiss
242,983,787 *179DAE93B2306F36DBAE1A696540C9C5E6DE34C1 2008-03-04:-tipitina's,-new-orleans,-la,-usa-(disc-1)
242,983,788 *17989B5220D0A2877BA7151E61D78F97FF36EAA4 2071404 MINUN PITI MY
242,983,789 *179731F55431AB4A558ABFEC7A869413381406AE 2135883 ER.PERSOENLICH.KLEBE.NICHT.AN.SEINEM.STUHL..
242,983,790 *179094313B3474FD39AC284ACE96A7B2BB54EA25 2289435 EXTREM.SCHWER..
242,983,791 *179F7EA9547AC0CC0C7BFDE7A4EE94A715A191B3 2335867 taliban-kaempfer-in-der-gefangenschaft-erstickt-kabul-.
242,983,792 *17954A832ADC2918C928A8EF6EBBC74352B56979 23november1103
242,983,793 *179F3F3BC0E8BBF07A54A6EA88815BC48C4B612E 2499923 OPETTAJATOPETTAJAVALINNOISSAKIINNITET
242,983,794 *1798E38E5844C344F2C8E600CCA3F554D8DD4AB4 278830 VEBIRAGACINALTINDAGOLGELENMEKKADARKISA
242,983,795 *179702398946ACED1BD0E4C564FB242733F1F8DC 2813 ASIAA-VALMISTELTIIN-VUODEN-1998-LOKAKUUSTA-L
242,983,796 *179362163E2A2A80D82BE7AA4356D6122D0B248A 2948625 kunnanhallitusp
242,983,797 *179CA3ADF3640A7D9E6385CDB194D3196F173D18 2-anlamalarIn
242,983,798 *179348556E02111CE0241D3D204AC7D732757DAA 2babygirl-05
242,983,799 *1794A07D9EFE5D6F57E2119754109AD5152547E1 2.MARKETINGNAMEN
242,983,800 *17964115B783BC5FB000BE0AA8DE00197FA94328 2.PROGNOSTIERT
242,983,801 *179B4286EF14C9717CDED50A4F0EEBE41344CF01 319508 ALLERDINGS FLIEGEN SIE NUR WEG UND NICHT RAUS
242,983,802 *179131A9BBF36ECDA1820957A210EA8AE65AA8A1 3676-hart
242,983,803 *1793E4F86751A37CA8E6B3FFD98337B54392143F 3bosshard
242,983,804 *179D439447ED391E91D2ABC18C0B998D7C3C8D73 3.ET
242,983,805 *179E9EF6B2B267A1816BD65DF4C8440CC4A68008 3kokainueberdosis
242,983,806 *1791963CE6076E78C4C462914F0D8FC17923A9DA 3typpilannoitteiden
242,983,807 *1797DFBAA38C0B3A4297B950A414D32789170549 3-ZHOU-DYNASTIE
242,983,808 *179B8D3C2CB483A3DF7EB858BCA7D6427158BEA5 476211 CALISMAGRUPLARININOLUSUMU5.
242,983,809 *1793D42A997C93EE598449649FCC12A6F54F3EC9 4-befoerderungsfaelle
242,983,810 *179E5AF0ED14A0310F48D6F5A1AECB9ACDA0F5F8 4BELLOWEST
242,983,811 *1799ECCFC9207CDA6FA0E71DB52A3E02F9951681 4CENTEROS
242,983,812 *179422967BBDBDD6D61843B45EB1FB3146FE7778 4EIDETIC
242,983,813 *179314816C21D273C045EFA5D59EE6F24E18261F 4KOPEISSAS
242,983,814 *179792AC5F4F62755596BEA6ACF8D6CA330DC3E8 4MYALTIMA19
242,983,815 *1796DAC229609B2F98B479F84797B52772C3E749 4 WORSE OR 4 BETTER
242,983,816 *179B799EEC3C5E7089B5C1203FC4F3731966D136 4.yourdictionary
242,983,817 *17928C082D563DBBC8E242624A42916CBB40FB4A 5BARNERIASBSW
242,983,818 *1795E37FEF8CFF68407838B54BA4EFAFB849E4C7 5c89ya
242,983,819 *179AA1C161F1E14E0AC138DCEF9C5AC3DE23728A 5CLASSAUTHOR
242,983,820 *179E72F570E9C96454B30913C44A648493C7C75E 5COMMENDATARIA
242,983,821 *179B2D6A4C03ECE5B5A91E9725AE78E296BB69EC 5JESUSSTEALTH
242,983,822 *179EA94E2E8277C1758BBC5A662047858D3C34F3 5ZADAVIO
242,983,823 *1797930F3E921CC87333BB0822A4FB32A75CD7B0 6PUZZELTO
242,983,824 *17953E51D4E872B6CDA1FD103CFE67919DB216B4 6scampai
242,983,825 *179987C28BFCD26CCF19105330586C414C0CDB4D 6VISIONGUNNER
242,983,826 *179815C2A7834AC6A86B8D0B59C5006AA6BB6D5C 7BSWGINEERSBSW
242,983,827 *179227E7D16C34DA9D7D12F6646D4CEA566A6AAA 7GNIVELNI
242,983,828 *179BB647B73AC03A18E3DAF4DAD564E87FF616DA 7PEAUFINERASES
242,983,829 *179EF259039B37ED234FE19597A86877AFBA1BCC 8#>~(_0)
242,983,830 *1799281A78A4BFCABF3979C7372281D6764DD702 882473 THAT'S WHY IT LASTED SO LONG
242,983,831 *17952ED4FDFB503A8F4C238F991294E69319588A 890821 olisi-t
242,983,832 *179E13C6E9F247C652E4C33211D98B9C1135D166 }8{`-D#P
242,983,833 *1798DB0F03D50C9E3563643A7F7BC51CC01B2006 8INGEPLOEGDEN
242,983,834 *17985B00215961C73A3D9A35BF1268F54F2727B6 8MEEGEDRAGENS
242,983,835 *179B6CB57270383716E79B2896DAFFFEE597A0CA 8>~O ~O (O_)
242,983,836 *1793260B6520E4A1F304E6BBDB5FC1D8AD7DA67B 8####p~0.)8(
242,983,837 *179F688D1AE2D7A3A02DE2E3FFBBBFB7063A0095 8REVAUDRA
242,983,838 *1792CCCB3E675666353692EFAC20366589A404FE 8WONDERFLETCHER
242,983,839 *179ABE9880D03D41537A0C1AFA58032A1772BDBC 90 INT C.O.'S OFFICE -DAY - THE C.O: AND ZIM
242,983,840 *1799DE4064396E59E6BD7A887E06B9F427C942AC 9806QWERTY
242,983,841 *179BACB8A2C3F7540504807F73F213C25BF0A24A [email protected]
242,983,842 *1795B841FB155C0092258F4CF524C6D38E590D4C 9CHRONOSCOPICA
242,983,843 *179214F2FE7DE15710488DE164DDEE95927E9C51 9DYLANMALCOLM
242,983,844 *17960D117B5CBB11BAD4603FB16D4FA9E94EAEE8 9EMMITTCOMPUTER
242,983,845 *17972394B3422BC8C94D7174AA0B156B72C40239 9LEBENSVO
242,983,846 *1794D26C4CCA3BAC47070982D192E55806FFE8E9 9MEMPHISDEEDEE
242,983,847 *179007D7F82A1CE246DFC50EE929F958C41421EE 9OCLUSIONES
242,983,848 *17971A2283FC81D9EB964E912B7A68B235931684 9POSTANITE
242,983,849 *17994488421628B4BA5DA27E57A2EA12A9D5046A 9POSTPARTUM
242,983,850 *179A8013A9C8801A96ED7590C00687B7D3A2787E 9REVALUATET
242,983,851 *179559E07E1D69A68CD75E6B15A3E9D0827FDC8E 9RUTINEMESSIGE
242,983,852 *1791F16B67C9F733BEB4B6C2C1A52C05217762D0 [email protected]
242,983,853 *1796C876EB6CCFEBE05F4739F246C07819838B03 A0Ih
242,983,854 *17979BEAB3CDDFEBD4462B173C94C320167531EF A1I&
242,983,855 *179269B6EBA2FE3047A0EFFE80AE4950642A4B67 a4u/
242,983,856 *1791A60FFB84F07B502544A8A17CCF1F4C64B1A5 a9m5l
242,983,857 *1795331317097254D03973588B3237115FA1B882 [email protected]#X
242,983,858 *1794309C0FD95FF4EB6EC3511A02EA5E9EE04DD7 aaez}y
242,983,859 *17980928368819D1084D5853CFF4AD4660EADF3A a,/az
242,983,860 *17953B818E28134AFC9701A8B98E93051E07AE75 [email protected]
242,983,861 *179CA474F56A9CC4B5F423F75A0C100A6E33353A abqsp
242,983,862 *179AD97181D42A5E6FCDD08FD78BD5BC9EA13B01 [email protected]
242,983,863 *179C1126303EF50E10DFD55BE79CE2D86D40FC63 adw<v
242,983,864 *179CC5558CE3CE3AFED7534808EDF8783F7F7526 AF!PO
242,983,865 *179D4D143A6056C5453CC45B35ACE244F3EC1358 AGONIZZA
242,983,866 *1790B307244497FD33794F7105B7CD2ED56C6FC1 agustindolson
242,983,867 *1794460A6172026BF1CB35376553F2198A906A7C Ah50
242,983,868 *17935880419280D3DF556D6EA765CF1B1DB4E1E5 AIQ"L
242,983,869 *17973909AA672A59E69A22DDE2C5FE1AA5D128E3 AIS&T
242,983,870 *179CEF0E9A44C33FD0A99A8365BF7BB86ADA0BA9 a&.kg
242,983,871 *1790C146EA72697A06BD4B008872C78579CFA0AB A;L5V
242,983,872 *179304F981948BF15CBEB814D442324B8B3B64B8 ALEXANDER-DEWA
242,983,873 *1797B50B39226B34A2FCA71D7516626F4637793B aliçehrek
242,983,874 *1799EBAC0A1ED260DDD0D77BD1AE66573F7ADB30 ALICIADUNLOP
242,983,875 *179D8331D9B94251A16FB978DDFF8C019337F2A5 ALPHONSEPEELE
242,983,876 *1798A9639820991256B33145490D791E2485B57D alskz
242,983,877 *179A84FDB9CAE63CE9F72CED79D440B1E617F066 AMOS.SALYER
242,983,878 *179C3E435C750B545F9282A8A2E8A1E0F6B6B437 [email protected]
242,983,879 *179246890D7FB11ACD69A43F847A64A1EC817E3B AMY MCCAFFERTY
242,983,880 *179A62815EDFB287E3EEA7506992B502255A6224 AMYZASTROW
242,983,881 *17920997EAED3BB0D0E5D0DEDE22B7342413F9F7 an0kn
242,983,882 *179C319F7514429233041E8D16DA14B9A714DB49 anchorbenefit
242,983,883 *1792ED20BBCEC2245E8AAF0647665D16841D4235 and pray for me
242,983,884 *1799FCCE5E5A0D890CE325A929E0AB1CDA6CA1C1 ANGELICA148
242,983,885 *1794E9277005D9767BCAC5E4852825B4EAA77DDB ANIBAL.KIRKWOOD
242,983,886 *17977C4D95721BDAC79BEE73E5ECBC59082E11F4 (AnightatOrganb.MIX)
242,983,887 *179E0DA4E6EF9ACE0E2AA2F07A867AA347E99AB6 annemarie.sexton
242,983,888 *1792DD21941AE2ED2808A23786BA570C8AD4ECDA annette.moreau
242,983,889 *1794206C8B819C836D0EC40C1026AF77AE2AB818 a!nr9
242,983,890 *1799703936C3F4C1A9CD028796C46A00751EC858 ANTENNA-GIMP
242,983,891 *179C0B4F8712B913D29ED90D330CE18E56C17359 antiarabists
242,983,892 *17981A3E268D5F1E692F7D2844A897B6FFEE1CDA antongrham
242,983,893 *1798684D09B5377A3A5CD6F7B97449D1F82E3FE4 [email protected]
242,983,894 *179178A26C87A991B476B951271BE1EBE575DD7A APCRU
242,983,895 *1796C3022B06A89D40C310D5CA5E2EBE4C0EA41D AResolution
242,983,896 *179149A866EC591B0838B7B07B5960BB447009B3 ARIEKJ
242,983,897 *1799884A4CF7247EA08242284A73CA65C4D39F62 a$rpo
242,983,898 *179E8C35FCFC4B4FBD2D52B3D702426B233B97ED a;s"7
242,983,899 *179DE319932672FCDF6248B4747355A6453275F1 AS-D
242,983,900 *17931EE1E76926A276DBA41423991CDB64C1BDD2 ASHLYNN HILTON
242,983,901 *179F8B845EDF13250B8117BF25C0F00CB2D470F7 ASLAM.QAZI
242,983,902 *179A9676B18A101F731B2D27D5E6F90BF9C8E4B2 ASM&D
242,983,903 *1797CEFD7DE93655D9D05456F5A7A6D9F1BBB6F7 astone5414
242,983,904 *179C70D365E001E7A332B57F4EE0116E9EE50BD7 at!t:
242,983,905 *179F26A4627618AD261732744DBD5292A833214D ATV-4
242,983,906 *179C9AEE46AA496603F3C0D527A48D9DEFC093B8 [email protected]
242,983,907 *179311FC78BDE40B47CDE2F8EE18FA3382D22996 auyfu
242,983,908 *1796962101FBB9A13A50AEEB2468742445649C80 AVWRR
242,983,909 *179D4430763AFA600BC4D7A7785DF2B41B39B682 AYo
242,983,910 *1795F7FFE6C63F9A670FD8218CABAFFA9D575C4D AZUL64
242,983,911 *17952C5CC6B8D5ACFDB0315E2CD122DDFA95EAA4 b14ck1$+
242,983,912 *179222F03AC2C8388CF5D725E9C7211376FCEAB4 b3lo/
242,983,913 *179EE2D25E4794325C69585B39ADAC26AAA37F07 B5"R
242,983,914 *1792B2F2A631607AADEEC1FF1F7F8BE25C319FC5 B8n,
242,983,915 *179A19937D849145BBD356417B3D5A92910D94B6 BALIIVARDAH
242,983,916 *17996AA30BF26A5B9BBE9014CECE4B0B8BF36373 baqsi
242,983,917 *17948980F35376490A546146D71F7A8321612661 BARKADE1
242,983,918 *1798CFCC98546914C8A58EA545D3AA7DEDF70EE3 BARNEHEI5
242,983,919 *179EE12C3C3D2126ADF0F238DFF7106677AD5C4B BARTILMO9
242,983,920 *17977B98C244FFFC0CB3DF79989396B9854617ED BATHULDASED
242,983,921 *179184BE0049D7C1D087E4B05341E1128131DC4A BB8OM
242,983,922 *1795983F11B24437E9E58D94F73300B5E434EE6A bc?+h
242,983,923 *1796927ECB9F84F1E66793E78897EECB5997DF58 bd676
242,983,924 *179FBDA96BFF0C21FE1C972E9AAD04A2B625C1F2 bdeff
242,983,925 *1794B8C513506A72237868E994DC755727208B8D B######D-`~-`~splat
242,983,926 *179DA722396F909ED6F5FA2EF84AA586C44AAC15 BENNIEMCNEES
242,983,927 *179E886DAC63E5AEC5DB6FC4BF0CE26E77E35CA9 BENNY.QUILLIN
242,983,928 *1792370055BDA376A31AAFA872EA1C909345F81F BETH-SHANKS
242,983,929 *179CD9B74D569B9701A0D1DD68600443C369D134 bgf1.
242,983,930 *179208C4BDA59ACA735C233EDCA140C21C3381CC BHHI.
242,983,931 *17948C7FECE8F471D03F1675B7FD385CFE320B9B bhzsm
242,983,932 *17957DC675DBFBA3888DF5E4AD6225F21C9ED31C BILLYWOLVES
242,983,933 *1799CFCF12BFECC2ECA5118B52BDE77657CE0406 B_KBT
242,983,934 *179D645D5EA89962FA2DDD6DB9ED1B6A16138695 BLEACHSTREET
242,983,935 *179E4C8B513BFB12F782476DD0FD18E29C6B5629 BLEO
242,983,936 *1794AC20CF2D16561B451CE74FDE2465CB04303C BOBBIENAKADA
242,983,937 *1791B02C970C2B4F4D98C5F96119F1FCA9E29195 BODREYH
242,983,938 *1796409C945889D4A269F072F763175A5E05C4A5 B+OL?
242,983,939 *17925C285DEF639076DAE1E7B33D58D295C219D7 BOZOBICTH
242,983,940 *1794E0DB96FBE1B8D5C9C3B7EFF6951B6536F17F b(p5g
242,983,941 *179C47155EAA4E2E4F842BB3B1DAE5F86D0D9470 BPR_
242,983,942 *1799F1D3584E9B6E56655C069D80B7E20D5B06D8 BRADLEY.FOGLE
242,983,943 *179038639DE6AD12A61D3055941439400543C615 brendon949
242,983,944 *1795D9D08312F116A07AB56119C1E75F7961EDFA BRITTANY-MACRI
242,983,945 *179B215065D3DB98A6AFEDABD2AD66C9F9A1A5DF brockfilipek
242,983,946 *179DE9A6FE3B704F2D5EF1E4AA79A942CAC20CD1 BRODERICK.BRYAR
242,983,947 *1799A12AB3F1E1B78E6B1ED6BD9FC58CDA609067 brucekutt
242,983,948 *17931BDA243624787EBD63271ECB50F1EAF90CDA BRYCE.DELOACH
242,983,949 *17961E0C3F6DDD40505005A0122A4361A5BF223B BSMF
242,983,950 *179AEA5F62B3BF39741762A1310C80F87CA916E3 BSWXTREEGOLD
242,983,951 *179447AC34AC18A92704B0FD54B0AB7CF08D50C9 BT%BQ
242,983,952 *1794536D70A70932A3D0BAB893596A28DA3D1D8C [email protected]~.~.uu
242,983,953 *179CDEBC9F33558532625161FC218D57CD1DD8F8 BWBWG
242,983,954 *17981990C9C40A931FE008AC93493FE0911A0950 BYIDL
242,983,955 *179B477700F3917E00131C192F67697ADB913589 c4lemes
242,983,956 *179516D3158F4C5DB972C45A3C73B3635D91C252 c5tg
242,983,957 *179F9E2CB9291C4B1A640B9BCDAB890ABFEEB078 CANILI
242,983,958 *17908B9CD864A182B8CCFA43FB4A569F84A908A3 Carnival of the Animals: No 13 "The Swan"
242,983,959 *17982C0D8FF9AE0546F27E86F23D10E5D03A2C8C cbdv/
242,983,960 *179675B10F57545BBD8D882E49A4DABE53FC2BFD cd=3z
242,983,961 *179219D3603299EAD4120240E984998CDBCEF281 C:D4:
242,983,962 *17921880790A72FC43D16C58B2F505101481DB0A cdの複数売り商法(c
242,983,963 *17984A785F40AFDD558F2EAD19723327CB9E1C1D Cg!R
242,983,964 *179DFB104D738899C78F853A36EC15385279A313 CHAPTER33-01:JUSTANOTE
242,983,965 *1795A98D23F1692CB6F3A2E6071A91F896722440 CHARMIAN Nay,ifanoilypalmbenotafruitful
242,983,966 *179F85518041A0CE1CABE2AB0C84E51742DD7006 [email protected]
242,983,967 *179FC1754EE008A269845A796AF4CE72BF1A0749 cherrymetal
242,983,968 *179791C1992518E86F3CB175481809066CAAF671 CHEYENNECLARKE
242,983,969 *179739DB0227076053C97AC1C16F7CE19E08FD91 CHIAJUNG0
242,983,970 *17914F95724C7946F69EF76DAC3C3C3F2D7EFF21 CHINDLUND
242,983,971 *17928310808CE91B8B9F2CBF7AD59BDA64E8CAA1 cjqw1
242,983,972 *179A9E24937EEB0C3183C7ED278ED746845EF544 CKFIK
242,983,973 *1791317290FE879D74D0EB6D46B9AD2E86E769F2 CLAYTONRUDDY
242,983,974 *179C9CC71EEEED5138BA2FC1C5C7147DCF32ACDB cliffrosencrans
242,983,975 *179CDAA89AF3C5BBA9F39B26B52E4A3AAFED9947 CLIFTONFAUBEL
242,983,976 *17933339F0A2231F75828001E8EA7405011D9D72 clwap
242,983,977 *17942EFDD6FF887130419F827D0B9971B0FAA280 C%MYV
242,983,978 *1794E201AAAC834FA711E90D1D94923964A3F446 CN=/C
242,983,979 *179619364CB70509191CE97C189756E78F11F539 [email protected]
242,983,980 *179556D927A0138DED9CB999C8D189C796E30171 columbusfrontz
242,983,981 *1790E05D38A3858018A5D6DA7C61414F9D1153D6 CONDAMNATION1
242,983,982 *179EBD84410A1A0BB34BC6FF9D516A77C9102835 COOLMCKESS
242,983,983 *179D178644592C1A6F92240B57C03BCE119D9E54 cordell427
242,983,984 *1795314F8DE3C2B1AE7B5283B6B268FB942F447A CORRECTA3
242,983,985 *1795C8998A7CCF1772C1BB3BE409418CEAF148C5 CORRESPONDINGLY-NUMBERED
242,983,986 *1791FB2AC7882891990F4A74EB6B4FD0B2A3CF6F cqoq8
242,983,987 *17955F5DD2ACB09B8236592A7DE41BD561240109 CRA
242,983,988 *179CCA388FA10AB60E156157F89AF64C55771833 craigproperty
242,983,989 *179E99A6E5EA20B00AB602BD3E4790F37575A576 CS72N
242,983,990 *1790AD04EC67A6798BD84DF38621268B58185C57 [email protected]
242,983,991 *1791E79B775206EB8B2EC9CEF9E0259D0A5CF722 CUQKS
242,983,992 *179F1912EA5760AF3E662745BDE8244A4391234A c-vk/
242,983,993 *179CF9E4939976BBB719C6D4FB2C2800CC657973 Cw9f
242,983,994 *179B475A2518B7BC2BF3B0F0712E8A8A6BD19CB3 CXSDN
242,983,995 *179F34725C51F647EADBCD470759C256AE36B33A cyv86
242,983,996 *179A62FFE31271C2F4F800CDD95FDCF33C24208E D0Q5O
242,983,997 *17947238446A2520E064EA75263A310692C99731 DALTON.WALSER
242,983,998 *179F027FE36C530FDD6EA74A0BA593A1F644354E dampfkraftanlage
242,983,999 *179B3CB867EB66E4F648260080AF740A9D848C7C DANIKA63
242,984,000 *1791DA87B2C217EE72E0CC91D7AD01D71EB2EAB5 darrensoolua
242,984,001 *179602EB91CD66E5351C5BA2E54A74C4A6C2CF72 DARRICK.SHRINER
242,984,002 *179BF8EB2080321E310EE949E49845E46F7698A3 DARRINTUTTON
242,984,003 *179362D07FB138368ABECA4392BF375CC5AC6810 darryl mathew
242,984,004 *179F22BC1BE01091919D603FA89BF056A2DDA5E2 DAWID MULLER
242,984,005 *1798D17C0832CE02B6D0C273EE9644A2BC735498 dbe&k
242,984,006 *179AE2864CE53F4FEFEA5259815AD5587773ABB4 dbhouk74815
242,984,007 *1797DC05F31FE6364DA92E1B707A70640F9C9A11 DCF.A
242,984,008 *179C699E033E5272ACEEDAF0B28898CDE45A76AD dearm
242,984,009 *179D673F7F712A57DA6FFC5FDD42548625A67DE2 DEC6FUNDCAWWW
242,984,010 *179166F5FC19D66507F6999018AD3D08E729C863 declinism0
242,984,011 *17981CD8AE6ADAC583739CA4218FF17E678063DE deekolehmainen
242,984,012 *179F2369D933D5A541BEE71CA373BBDECEA6FA98 #DEFINE.HAVE_SETPRIORITY
242,984,013 *17965760819FC52FB53ADDE713DB20F097B16ED8 DELETIONCOVEO
242,984,014 *179F1DCE74A400775207922CEC028E99ECBEE8E6 DEMARCUSDETAMBLE
242,984,015 *179D0EAE45D0E1A83CB78071F23B5E207C0DF3EB DEMETRIUSKOURT
242,984,016 *1797B43957D01A810F44C7686563528CB0BF676D DENIBSW1
242,984,017 *1790818EAFD90CC5DD375D4639F07C8C8AEA60DC DENIS.SLUYTER
242,984,018 *17912DD39712D91023E40B236D8413A8FB0B6B64 DERCO
242,984,019 *1793B1E61FAA06052A7A6345F035466ADA70E888 detencao0
242,984,020 *17908CC83ACC4AA75C5972096F3870D329F2D019 dfc"1
242,984,021 *179F8BD34A533014E9DE4BFE2F30DA2AD30A779D Dfdw
242,984,022 *1793D72D62EA9A7E3DE5948B370F336F1DAD5912 DGE#
242,984,023 *1798CBC58CA3D67E0B7896D2AA26B704D4021E3E DI2Q
242,984,024 *179AC17045358FA76F3FA60267D96C429F16E212 Didi
242,984,025 *179B665927485A2F804E25F2A39985D84321079A DIPDU
242,984,026 *179D1F09C60BC8D4A27D41F61889CB4088C9C252 DJQ0E
242,984,027 *179C5ECEE3B1672B1E92E11569D9E47E4BF3153C dkoke
242,984,028 *179E8FE04F601C5A0203CC9DB5D546391E43FEAE D+LMQ
242,984,029 *179A4C4D10282970665E48347444F0FAC8BFA42E [email protected]
242,984,030 *179B0DB623074BC1E4FBADF0728EFE68DD5D73BC DMVUV
242,984,031 *179E13C8506EF45257D6B9C0B0E41982F0F0C2EA DOBF8
242,984,032 *179A3B7E7ADEE79F74DE40D60C21BE6895F80EB1 DPYQ
242,984,033 *179F0952E9DC1341B0398F9DAB48E0479ECC7E4A D&.U1
242,984,034 *1797264C8890369A11E9DC6F1E8E3C4FF45B1285 dwxex
242,984,035 *1798EBD1DC85AF684D780920461962E2C217B831 DXBZQ
242,984,036 *179D5989259087A4E31172285727A8B72C5778E4 dzmub
242,984,037 *179DDADE95B7F25708F059B60B1442CDBEBC9112 EBC
242,984,038 *179785A97F6DBAA3B4AAF9DF134D88FC63BA7F3A EDWARDOCOTHERN
242,984,039 *1794EED6C4CF71D5FC1E06E676D3163FFFF67C84 EEMFS
242,984,040 *179C16409DB6FD78693F24AA74F6A84980BF7C24 einsteinc5
242,984,041 *1791C6D1304957CEDA7890802BC240C4460C7DD6 EKUSTYUKOV
242,984,042 *179C27227C05779B4C288A22D588479471823078 ELBERTSHAHINFAR
242,984,043 *179DEE40B07A0C014511B212B10C20E57025EC2A ELENIDIMITRIOU
242,984,044 *1799D9A806FCD04F859979F89628C19DB3944B68 ELI.ESBENSHADE
242,984,045 *17959A815BB1D6FBD8511BA4E441721979982A49 ELIJAHCANNONE
242,984,046 *17969FC6C07C78FC763C067F3024EE9002D23D02 eliseotuesburg
242,984,047 *17958F8D7458F6D6030347D8D3394C24DA7D1C5A ELISHA.NOWLAND
242,984,048 *179091D03BEDFAFE8ACB0117D82FD8FFD83A2FAC elysevillanueva
242,984,049 *179716C62B8ABBE6B59F28AED53B4E46DDF6BC48 ENCEPHALOLOGYENCEPHALOLOGY
242,984,050 *17958D710DE4A44BC4867468152702FE9F94CC7E enerveraient
242,984,051 *17950266FD929A0AB14E977177EA0FF633314A34 ERCKENFRIED
242,984,052 *1790FB6017146F8B272AA2E4843B40D21C795DF3 ericgridley
242,984,053 *179C68AA6CEDDC9B05DD084630A199E63A20A867 ERNIE.COUNTERMAN
242,984,054 *179C5DC90B2BFDF0038BF6A6D019BDC27934B17F ERROL.LINEBAUGH
242,984,055 *1796FFC0FD1ADF8E2DCADA4715FFA7D53C420103 erwinmcfadin
242,984,056 *1797DF08EBA66D660A2A5E468552C3634F07EB60 escandido
242,984,057 *179A6B29541B456E6A8E27CA5ED0F88724195A02 ETUDEINAMINOROP25NO.11LENTO(ALLEGROCONBRIO)
242,984,058 *1790BEC75A6150D713A5F7EC8AB245912640DA96 E:U-
242,984,059 *179F596662AFAE6F2737C4236D7F61A919A2E773 exactnessing
242,984,060 *179912547DB0DCB85356DB3BB5C6E1B485A11993 EXEMP1FCA+0N$
242,984,061 *1792A3DFBECB7C1813624C990C8D8BE8498F0833 EXERCISE75
242,984,062 *1796C4906BEF03C7598B4733A6CFCB519AB34A6B «EXPLOTARON
242,984,063 *179F4E2E9334829C886CFB7E987BE8B6E5078E03 FAIRTAX96
242,984,064 *179BE03E23E4949A949AE9A7FD76E7D9C6598A4C fancyfree:iv.pasdedeux
242,984,065 *179A7F469679441A7CD2BDEC62D563CB1F3AB52C FAZAIL-E-AMAL
242,984,066 *179B8E7AC3E711D0E3BEC3E68E05ECC5F2FF604D FELIXSEEMANN
242,984,067 *179407363CC742AB0A50ED8CEB51EB2C9028D9DC feltonbasha
242,984,068 *1792128D9A050409E158851A43B15642A1AC97EA FERDINANDGOLANSKI
242,984,069 *17930DDBB74E481C6234F689F88BF8731D724516 FERMIN.CAROLINA
242,984,070 *17932C55C7243C7A44D8800FF1F38CBF71E4C468 FERRAUTO7
242,984,071 *17923D593EC8E82E2BB30CF2B6BE2FA3A1E2E11A ferwaarming
242,984,072 *179E100ED4FFA9FCB39933509A4D40AE1698C35D forestyne0
242,984,073 *17960C04856273C8A194CA442B440DB055F37BE3 forever.with.us
242,984,074 *179CEFA63692AA86AA7A296B9479BF910DB53058 FORGETEN6
242,984,075 *1796470B16F80760BC67EB18D5F0D145DD4E12A0 forgetmenow
242,984,076 *1792E52FED6E97CC0436112C568AE99FBBCF062E FREDVANNER
242,984,077 *179A0CD6B40A2F01640BCF41F3B0385675288C4A FRG
242,984,078 *179D82A34B975680C3CCCE849A1581A27173614A [email protected]
242,984,079 *179B4052576EF42E5179B762E970F221CA86CB43 [email protected]
242,984,080 *1790F4CFF056525BF37CEBAB5A9C84D7CC4A169C [email protected]
242,984,081 *179BC273BA33F2C62D848B5507686EE74F5ADF5D GABRIELSANTIESTEBAN
242,984,082 *1795549B827B8CE98F3061F9149F022E02D3AA54 gailwonnacott
242,984,083 *17910D36B07943B7413D2AF68D340FE1D5D583A9 galariam0
242,984,084 *179062A5880AC8657AD68272A99EFB072058B0E3 GEOFFMALINOWSKI
242,984,085 *1799CAFA257073235995246FF01A6CC541222456 GERARDOBRUNOT
242,984,086 *179A75C41907ED154E90D150AAE72DE5070962D2 gideonekukinam
242,984,087 *1796078DFB290013B4C87D6E6284099C42568765 gingerit'smatt
242,984,088 *179BD2F50F3E3E26CACE90C011E6FBCF04380715 GNF_GOIDGO0004731
242,984,089 *1790FCA5D83474F5BD09D5C16FA7C6C95A93877E [email protected]
242,984,090 *17920441F7F07228F85F9D532AFE6E4D584A683D gouzij
242,984,091 *17976FB0752FB13224B3B96F6D9B7D93EE992EA7 granvillepewo
242,984,092 *1791098ADAF6452BC4B5C02A79B81F188DED2258 grimier
242,984,093 *17941C60119EED45A712A852AD85B301CA1896B2 [email protected]
242,984,094 *179B25F538F7AF96833F73E7EFB956E8CA308EB9 GUS.PORRELLO
242,984,095 *17919D18A9079CF1C19CC84ACEE71BF8906244F0 [email protected]
242,984,096 *1797C1ED643D8BE7D42F13EA1BE4253D0AC05E10 halfclim5
242,984,097 *179446A01D4A0971FC862EE455ECAE000AA9ED63 hamshid
242,984,098 *1792B72D4A1E905F38894A679224DBDE27A0A804 [email protected]
242,984,099 *17942969778EB3285794DD526655FC8F0F477601 HARRISONKAHRER
242,984,100 *179431C07E88E944DAD405FEEF1D58628922B0B5 HARTZFELD
242,984,101 *1797C58D964E2622F9332690BCF8CEF885B82B40 H!;B
242,984,102 *1793030DF7E69A2F182576972890DF0F2220C6BE heavymetal,raisehell
242,984,103 *1797595BD186E846B289982470D3544B14D63BC5 [email protected]
242,984,104 *17989D9D1718BABF93E41BF1A5C2C465214C5BCD hershelmollicone
242,984,105 *17946777D9142AB8BBB8CF0DB5F44F85F41AABF2 hershelmorenz
242,984,106 *1798B9F15D890B9D893ABC92D6BB8407D14D8F77 HETEROSTRACA3
242,984,107 *1798CBA6D5D86FB98BC9EC5F1BE689A5F11FD211 h・i・ブラウン『科学論序説――新パラダイムへのアプローチ』(
242,984,108 *17979C0855D04230FD73F6E5F427ACA12F0C8C9E H(O9
242,984,109 *179E2D1910EEE876543699A603BBE201944D92B1 HOMETIME(SEAMUSHAJIINSTRUMENTALMIX)
242,984,110 *1790CF3A5CAD4575D2BCB45334A2422CD0D5A283 „HOMOGENES“
242,984,111 *1797FE1D5C450397DFB60F5E3DF90E642A30E980 HOOGACHTEND8
242,984,112 *17922CD14054D6F0374F5495B6556570FF0DC5BB HTTPWWWGLORANTHACO
242,984,113 *1790FFA4FFE2F25B6CDEC99869DEDD2B0F318CEF HTTPWWW.LENCI-DOLLS.
242,984,114 *179EEF3EF35B0BDBCB73A16D492E9F6CE2058989 HTTPWWWMEADOWLARKLE
242,984,115 *179CACFA908FE5102A39A906E1429652207C4984 HTWIN-SCREW
242,984,116 *179F278FF21EC1F1EA6122422E6AA3DD4DE46BF4 H~\V
242,984,117 *1793CA8BFE08E67BDDDDDBAB54C7B61D79134E5F hypheniseses
242,984,118 *1797850124F807E383D3318B4F762BC2370319BB IF-I-SEE-YOU-AGAIN
242,984,119 *179AA3F64DEC64DAE2620BA992E14D1F9496E182 IGAZSGTALANOK
242,984,120 *1793784C4250A0BFB8DB8CC2C32360D8340F3F27 [email protected]
242,984,121 *1793C9F88682A382CB08889174DD3A4657481F14 ikciwtiw6
242,984,122 *179AE80FE69E3BF3110698575790091A7C1CE6C0 ILAPULLY
242,984,123 *179EC319498A9E2CF984529F571ABC34C8977068 I-LOST-MY-HORSE
242,984,124 *179F79C6FF8A1007E898A1C4820FE984D1AF4306 ILOVESVERIGE05
242,984,125 *179E3B6B72EF2AB93AA4F6707F020150BEB59D9F iluveffie12345
242,984,126 *1790BAF2AF7B2EFB79B042D9F31F29A598579D14 [email protected]
242,984,127 *17937877D5168D634ADD83D61B4A4E61573A7EE4 IMPALEDBYTHECRYPTICHORNSOFBAPHOMET
242,984,128 *1794A09DDC334E08E6C9C76CE3BD055FA1760E21 IMPROPRIATRIX7
242,984,129 *17950F645DDB8DCB10287567C92F9B83BDAB7F45 INIESIL2
242,984,130 *1798F6170F3F8C8B57130660C913BFC002FC96C8 INIOISAN5
242,984,131 *179AC80462CB6D4DA8B43C2808D577B0D6619138 INTERLUDE EINZ
242,984,132 *179E34C158879EDDF76C9E075DB5ADB113022730 [email protected]
242,984,133 *179CC0084FAA44BAF0809CD424194AB41BADB613 i-s
242,984,134 *17931BBF3CF643B1B30428E8ED1986F7D8D3E08B ISOFII
242,984,135 *1791608FA0BCC466022FA3B134C28E0638BE6A14 [email protected]
242,984,136 *179780D26D126736B625C312F3A1241A2B9B7A3A IUŢEALĂ
242,984,137 *179E4E7E0F1B1251E94AE731BBA2E3FE68340262 IVORYROSE
242,984,138 *17986F45045DD1A598F0CD51F8B03BF61AE1AA82 JACOBDELOERA
242,984,139 *179BD0BF38340157470C4B0ACFB410A93C0DF3B3 JAIME.FREILICH
242,984,140 *179DEDF32837A9C7C901E674AB95FE3E700479B3 JAMELMILKEY
242,984,141 *1797AD3D09ADDAFE05A5697D1ED4CFD607D5BBB6 janinowie
242,984,142 *17959F67B04221DCD6371FFF463595FD3653C109 jennifertopher
242,984,143 *1795DD9FFAAF854A19DAB3E6FF25E6F22603587F jerrymenner
242,984,144 *179422021955619F297602B8CB20E835D4E00CA5 JESS.WEICH
242,984,145 *179DC9A07D17BF6D2C29FCEF111524521E6D1C39 [email protected]
242,984,146 *179B499E6888C28A87741CE9F6357E986BD60C00 [email protected]
242,984,147 *1791907854D64E2D4C20DAE2100CF093DB29ACA6 JOACHIMRHETICUS
242,984,148 *1790BE6BD9E8BB8762EE47E6913E5F4B0DAB8B2D jocelynbrown
242,984,149 *179B7CE75C2DCAB365291D6B786768CF232DCA36 JOEY-SENFT
242,984,150 *1798CA85522B8E2B2448A0475E121201B6DC0A35 JOHNABBY5
242,984,151 *1798E9359997864CE7B9247BDC4A0B780695BB4B [email protected]
242,984,152 *1792327F93A286534A6F146D01ECFDB1BB2048BF jon.sacco
242,984,153 *179CAFDC0FF43D0D044DADBCDB95F0710DD4CA6A JOSHUANOFE
242,984,154 *1794A0477608EB4A12198EE861EBB2A071949EC6 JOSHUAWEYRICK
242,984,155 *17986882AB0456B636319A7C0872DA6443BBCA5D JOUEUR.DU.SURGE.DU.MISSISSIPPI
242,984,156 *17948326083AE72A40D3ED3CF5D0452ECDA01A2C JOUTSENV0
242,984,157 *179E033BDD3C4D5B979145DBD074E197FB085DF8 JOVITTA7
242,984,158 *1793354CCE94E173308D8148735EB5643BB36219 JULIANAPAMPLONA
242,984,159 *179E484D0149311BEAA486116268D8DB670EF3EB juliefogt
242,984,160 *1790DA2242E5637F44A1CDFF8045BF74F831B922 J(YB
242,984,161 *179D98DFC23D34359005BD35D60558E8DC4B778D kaneelpyp
242,984,162 *179BE702FD152850A93E4A21B1054B90185FBB4C kathrinellwardt
242,984,163 *179270B0A80258B0AA6424AA871B6F785CD3099E KATIE78
242,984,164 *1792310D4F5F7006AA67E51E95415B80012678F1 kconnahappat
242,984,165 *179687CE2BE8BD6B118B02B0323BE0483AC99DFC KELLEYBEISCH
242,984,166 *1797977D0DF504BC5DE420287D093154B43633E7 kendalldirusso
242,984,167 *179EBCCC01D0CED664A38D2B887401DE45A3179C KENETH.WALKENHORST
242,984,168 *179221D2FA65E3263DA22F85701215DEA620312E KENNITHVELO
242,984,169 *1794DB93368ED9E6679D5E1C30D2544A11A79535 KENZOKABUTO
242,984,170 *179ED4DE48E9115C46A64EA329BD817B9A1FDDC8 KEYONTEJ
242,984,171 *179968B73230394D18A48C22011BBAAE69048160 khurshidhaider
242,984,172 *17902D70A78A1814DF3AC7D73712F46B80E9AFE0 [email protected]
242,984,173 *179F7B2B99752CAE4FC93686B56C1D6FBA1986E6 KOOTTAVAED
242,984,174 *1798BCD74007ACBD361ED615D57B0EF00B6A84A1 KOUSHINAS
242,984,175 *179388D785033A55DA7300D1F85A1DC0DDC4B573 kozsulhs
242,984,176 *179B512CDB180420E3DE141BCB9A8D26698CA558 kursiks6
242,984,177 *179F4A995316DC48B10C8D818882B80032CD6D77 lacygourdin
242,984,178 *179FC62EF1CE24466C8F808E49687EF7F2B168B7 laguons!
242,984,179 *1791D76D6EA124E9B4D1507A385B8E2E77089B81 LANNYSWILLE
242,984,180 *179608184EDB1250A4EB43512EED4EB5C7020D92 LASSANDRAB
242,984,181 *179EC28F923C7F7CFA4F51CE09DE49D738B1BD7F LAWRENCEBEGNOCHE
242,984,182 *17989489594B479ECCA67B50993C98D4EC362AF5 lazarowoulard
242,984,183 *179A12C70C9A52FD8D0676D3CC6CA9338BD82182 LAZARS ANDROID WORKS
242,984,184 *179FE6643CB99A284CAAFCF83F25FDC5A4C8F7C5 LECOUTEU
242,984,185 *179603C5F4FBCA5E995A6FB03DC7E9816BECDF77 lemontinged
242,984,186 *17906B15CA86743C6B7E45703F9599B421844439 [email protected]
242,984,187 *179EC536D95CB0CE613782B304828E3A71F70CD6 @[email protected]
242,984,188 *1795578C8A9E0DAC3592E749143B51F5879A5C77 [email protected]
242,984,189 *179D32FE69E2D56C9A88FAA4D0AF74914B61F541 LIKEITONEBIT,TAKESJOHNNY'SARM.
242,984,190 *179196ED787DA9FE6685BAF77FC675395E9B933C lingmanns
242,984,191 *1793082535041571E2A83A650D9B23BF9971978E LINKAGES
242,984,192 *179599014C8CF713F9F8592EC5C96DBC11DC74A2 LISTEDESSTATIONSDUMETRODETEHERAN
242,984,193 *1793958450DBC5800F62BF92E3B1CCAB736BF8E1 [email protected]
242,984,194 *179E9EFFB4505F8544A98934DC666E76644D7E0F LOHDUTET5
242,984,195 *1794D55D37A2D7B0538A1B1A6D2B1D210E516016 LOLEATI0
242,984,196 *179D6B877108A5BECFBB01A9A429850847F26251 LONGUEURS!
242,984,197 *1796D2F1246C446118751E17AF673E9F0EA08D9A LOYD.LARRIER
242,984,198 *17942580875C3A144698B8CF74468D008B4E6E6F LUFETAF4
242,984,199 *1791777D74C54AFC0D54DBB8A281B87C375C7F64 [email protected]
242,984,200 *179D5CC14D598D6DD1B6578F716DE4D13A713F56 LYDIA.LEMUS
242,984,201 *1793288D478EB2ECEE3205E1A9A563A38810DC42 M0UTHWA$HE$
242,984,202 *1796F543E10819D70A8E4F92334F4A2B5295B978 MAAILMANKEHÄN
242,984,203 *1792900E5FCAFEBD3BCC833E04AECFB3BCDFA643 [email protected]
242,984,204 *1792FA8AA2F00DB32D495EFE528A4ABBCE9418B0 MACACOGORDO
242,984,205 *1799282E929098B6EFD514DE3E94107F775F4356 MAGNE$C
242,984,206 *17968380227C82FDEB1DF82835CED077077552EE MAGYARGYERŐI
242,984,207 *179AADAD2E191000CA24DE1DBC3554AFE3A93E52 MALCOLM.BOKER
242,984,208 *179CB6653D7954907D2E972F5208C34380ED6902 [email protected]
242,984,209 *179D88F4295A542F4B718EBA3F08A0B14C75B4C9 MANUELCASHEN
242,984,210 *17994599116D107866E9E2931E01F06ABB21443E mapping
242,984,211 *179DE83EE98A51FA8EA9A3A59F3955F131CF9173 maria.sovago
242,984,212 *17936016D486865B531DA03398A010AF2F7008CD maricel.bo
242,984,213 *179EDF3629252FC8DBF9BCBDB34E4AFA4DBFA244 MARIECRASHPLAN
242,984,214 *17977A87C5FC21BC7185375F9ECF76B4289B9EB6 mast, c
242,984,215 *17962D5C838D7E637FF5CE6A4DEE30D578C96B0F matsuzuka-eki
242,984,216 *17988DA75B929AE9B14906B3F9C63FA395775CFD MCHANGANAMUNO
242,984,217 *1798797299356DE6309932983E92B841F6608784 MEILUUHING
242,984,218 *179BF3ACD88AE4FA428173823959BE2B0A44D8C4 MELADY1
242,984,219 *179D94A62A3830E1410C2C350BE0913F56CF6061 MEMBER0614
242,984,220 *179C9F816FAA31C9097C249E9F6CB449AE7E8D68 MERCEDESBUTCHER
242,984,221 *179FF1B60FFE7B5B609791641460FD647253C643 MERLE.SURYAN
242,984,222 *1798761C2E3494B0F0FC27B1984CCA58CAB701C9 mevuelveloca(pleasureteamremix)
242,984,223 *1793C8CA6F05C4AA180CD9F890BDD6DD6A571511 MICHELKLEID
242,984,224 *17995CC579C7EFD3A144C4CDCFFAFA12305082E1 MICUL PRIN
242,984,225 *179683CBB4D7952F40C2935B770F16D749DAEE70 MIKELEAKEDOESNTNEEDTHEMINORSTHANKYOUVERYMUCH
242,984,226 *1794FF284B0044981C233099330333FCA125C8E3 MIKENORAC
242,984,227 *179366A6666C58704661A387FC3DE8AE8D76EC2C MILLARDKASEMEIER
242,984,228 *1790AD1738AD529E9EF2A6CFBFD2DA0A90743AEA MINEßTERPRËSIDENT
242,984,229 *1790E4F818710C7CF3491AA3D428CACEF06D8464 minkouet
242,984,230 *179C3BA6AE3F696BB1CADACF65F29EBA2B89F3FA [email protected]
242,984,231 *17900C80E1D263645341B89E23939BE580B9F853 MPAABSW5
242,984,232 *1790DFA547C79BE94AF16234EBD210790E8DC7FF mshjagjv
242,984,233 *17971A02A2E179353F53349805FE8963B693FE30 M.S.L.M160M
242,984,234 *179AD39A3E087CE047D3CBA4FE396582B2557680 mualema
242,984,235 *179F267745DB920D758CEBC222CC7CAD26DD0AB0 [email protected]
242,984,236 *179CEB672C225F805550346E4DBFB28C416ED6C4 MUSYOUHING
242,984,237 *1798AD86DFE8723FADD9957E31DE7F5AF2C24F81 mutenyi
242,984,238 *179AF7C539335DD90FCB2F3AC19640D8592D0170 MYMOBYDICK29
242,984,239 *17961E7E235493A0CA8FE0FBE282D351478E34B4 MYXORGCONF
242,984,240 *1798C0DC04A5319E3A1CF8661E6024D344323AC7 NAHXFCE
242,984,241 *179171CE77B7FFEE64EDFED12448C1FC1438A930 NANCENPINCO
242,984,242 *179AFBF97C089CE4BE9D2B621FDE95256372AC65 NARAGUCH2
242,984,243 *179E2F85FAB014D4F691CEF3701A18D5ADBF632A NAZ.RASHID
242,984,244 *179C2D122AF7C8C1D9D00E497A9E60EA4473CEAA ncipe.Gitano
242,984,245 *179D857A1AEBC33E796410FEC9DECABA1BF218B2 NEIL.COURT
242,984,246 *179E9707FC05F1AEC8A9126FCB86A5AF2DF6D466 NELSON.CROSSAN
242,984,247 *1794C63A2A5227C641C01D1A8EB9050F07480B6C nelsonneary
242,984,248 *179B3552C9A9322C8EBA957E263A2C0CEB28C671 NESTALE3
242,984,249 *17906FE5B4DBE8C87A82912B6882A1ADA5D3407E NETWORKINGCONCEPTS4U
242,984,250 *17952046B68FB09C5CA85593F464BD0F496F081B neue-liebeslieder,-op-65-no-12:-schwarzer-wald
242,984,251 *17984046B48E627E26D0EABF256E7E0183476288 NGUSIQONGO
242,984,252 *179C34FF9C964821E505BCD09ECD135ADF5D714A nicolameikle
242,984,253 *1799FBF9E8B9C1DEB8F8536AF20FEB297AD6D7B3 NITROGEN42
242,984,254 *179BB9DCCAB4486508116706C5ECD92A25087452 NOSILLACAST
242,984,255 *1798E090002BC70EE418D01BF26634611C6078AA oceanija2
242,984,256 *179D2B892813183C5A486F9032D7BFAF1155DD3A OCTAVIO.FONGEALLAZ
242,984,257 *1793EB96AC843BC4FA4FCB65B1E4D24456E988D5 odellalsing
242,984,258 *17936120C0E85C1C7F037CC7242CF7D3C5A78B8B ODIS.JURAN
242,984,259 *179860B27EA6AEF76E9C8D3217DEEB3CE545D081 [email protected]
242,984,260 *17934F453AFF3FF71F62439D261F587C36E380C0 oldmaked
242,984,261 *17994300266A27F6B139CA0830090CBD88BDD374 Orange.Beach
242,984,262 *1794FB3F953E03F1A87984EAD48040CF601FB583 ORVILLECALCUTT
242,984,263 *179A9528C2AEC85D31B85AEE493559D9DB59F5EB OSWALDO.BLOEBAUM
242,984,264 *17918C5312820AA096245B9D9EF3F6187F10FD44 OTATICCE
242,984,265 *17937871453EC8758DFF36F5EA04BFD8650098BB p4$t3w4$
242,984,266 *17922CCBC5D59FFC1EC47B997C930E5400B61613 PACIFICIA'S
242,984,267 *1794C281DFEE7F962C7B0B53B792587C3C337843 PALACEFLODDEN
242,984,268 *1793A203AE296D38546A6357CC3AC5C7979D40CC PALOVEU
242,984,269 *17966B62835E853FBC134DD9935633EE106674B5 pareiasaurer
242,984,270 *179B4CF4306C513D9FC59B88F733CBF7BC936BEF patibu1at
242,984,271 *1799E578C8BA0F50EFC40975A0023D59C2DBBC8B P######B~O(O_-)
242,984,272 *179A36AEA609F07E207B2B6D933709409619852E pentzia8
242,984,273 *179B9E884A2669E56798C68CD0F18D343E8655D2 phenazine9
242,984,274 *17987193102A0E8A6DB075B22B49867A83BE4B78 positive
242,984,275 *179F3922E672646302F27660F208F3ED30EDB47F P===>*-*-*-:P
242,984,276 *179A118F37FA119B856012652DEF8864085B42AF p=p~0(>_0)
242,984,277 *17908A6BFA344B97FA0E7DE77819B9EAFFC11556 P=P~ ~ ~ )X(
242,984,278 *179EFB6D201D10A301812A08398C5AE5EEDF6D20 PRECEDUTE
242,984,279 *17941E780EB57EA873D0FE52BBBA9AD413CC5C94 PRZEJAWIONĄ
242,984,280 *1790622F4251FD06BCEB6DB7B13C543095B82175 PULPITA
242,984,281 *1799F4D34021F77BF49DE48A6168B166A15897E7 Q=D.~.>B0
242,984,282 *179DC08FECC5F1A9E137BA5333A28FA383BC8BE4 QDGF
242,984,283 *17986294850BE79C8B4E26085963809A85C53FB0 Q##@~O~O(O_-)
242,984,284 *179B969AF45EF4B1AF6628E8A15BF299EE7FC189 QUALLSFORCOUNCIL
242,984,285 *1799CA379180135AF1646F013EEAC2CA70E34C67 QUELPAARD
242,984,286 *179C61C5EFA0AE3D961D457BE6A18ED6E5CCF72D quintonpickar
242,984,287 *179042310244CC11538BEE5084752164949CF1F3 RAINHA SOUBE O QUE FEZ
242,984,288 *179D0C17F82B3B674530FD7D62A8BD41E92D3BA4 randall534
242,984,289 *1797582A4F37D3B245B3FC222F75681D7843E803 rbdwkknd5
242,984,290 *17927EA5B81F1D91317BB60D57D0A8B7F728C9AD RECORDSHAROUT72
242,984,291 *179C98DB85DD01D66435078877DD380DA17917A4 REFECUNDAVAS1
242,984,292 *179867A4DE5E10C90D3A49DAB97F9142C690266D refugiowheat
242,984,293 *179E545D151AF467A2C29DAA8612A0F09E475378 REILUMROFFJIRHCSNI6
242,984,294 *179F0E5E489D2E80EDFABED5A2EB0BFEBC0EBC96 REIUQNOC
242,984,295 *17948E0E79F47DC0ADB41AA8A8C9F1FD551F0128 RELAZIONA0
242,984,296 *17911E7CF7B8130AF263FFAF5A0080C926FC65B4 renee787
242,984,297 *1790BD147B4E20C55B1C79DCE81426C920A5FF59 RE NO 3 OP 72A C-DUR
242,984,298 *179EB65E34AD82D6197588EE4B06FAB5B2F56707 RESSALKKITAMMARG1
242,984,299 *179E2A059D736CEC18F1FCB6EB27F23C5D72F35F RETARDJOANNA5
242,984,300 *1792CA9EEA49914C80C779D7EF2E3A90DC88C111 retonda3
242,984,301 *17961367BAB4DFE7757A82C4C9C357A092D43BF5 REUBEN.GENICH
242,984,302 *179974D266D3ED79DCFF3F92076FF3BC71BB6D8D REVORTNIS
242,984,303 *17940904276093189EE0634E9136B2E30AD3B90F RFAUTRE
242,984,304 *179E95ED66BAD1EBE2CB7CCE120CE684238C222F RHETTWHITMOYER
242,984,305 *179C37521B6DE9067145365BB2D1BBBFFB44BC2A richdush
242,984,306 *179326B2E54B97CC3C25889D018C7E5156D011B8 Ride-for-JH-(instrumental)
242,984,307 *179EE32B268CC08F6CB70C25C11FF87C8D13043E RISOMMERESTI2
242,984,308 *17900F894C248B2D31BAA010A0DE8EE6A3428357 rivkahed
242,984,309 *179BC9D195416D8F93EDFDBF3DDFACFF3757C4D7 robbiehanby
242,984,310 *179C13E85FAF819A8C237058F4932043190B389B ROGERLAPAR
242,984,311 *1795C0166E2240EEBB7EE13C4B33443C20591297 rollandschavone
242,984,312 *1799904C6E0099193E6BC1B19F72E420494F4B46 ROMAN.LITZ
242,984,313 *1792A9369F29813D7DCCE89B03F5C74642E6715F romanofallon
242,984,314 *179293BD049ADE1E1863E6DCB272DDCE770463E6 ronald.e.snell
242,984,315 *179B43C850B24003CC3D62D2DBF052384E1D190C RONNYBOULTER
242,984,316 *17974C6014662700DA4F8AD0E514E0F3F1C1390F ROSECREST
242,984,317 *17993935CEE1207C30E0B859D9326D6BA94F14D1 ROXYVIKING
242,984,318 *1797CBEBEF96324BE7D1D5E36301D88B7DB8E575 RULIBENM
242,984,319 *1791BDCBA3A5122208593A02E46838E9C80F2029 RUPERT.WHEELEN
242,984,320 *1793CF8E75FB3367595E5DA5433518D54F0B9EE4 russkij8
242,984,321 *1795E22363C34F6DE647CA553538163AF32E60F3 S2009041500276
242,984,322 *1796B57268BD425232C395757CF5A285AE7E22D4 sabaeanism
242,984,323 *1793BA399F2DE3960B2F71047D54E3E4BE956F74 SÄFFLEOPERAN
242,984,324 *179F90B89F51CF4CAC31457D614445EF69F6D428 SALVADORHAMZA
242,984,325 *179B8BBA6CE1FB0A6AC7C9F6D9809D238C55B499 SALVATORETISE
242,984,326 *1796BC7B090D3D738C077AC3F6C4F0480A375C30 samarian
242,984,327 *17969833D6C1A73AFC48C1447A88EA3BF9A0E300 santolungren
242,984,328 *179552D0062BE0F461BCB42E4C0F4793CFD1B6E3 [email protected]
242,984,329 *179030CEA843BE85E21C4E83D15DF42AABC38C4E saraalani
242,984,330 *1791D48D4E456CF492E308099DCB20EBF30C1C06 SATHHA
242,984,331 *179E6A078DC6C534DC2735271E95BCD907F9B0E9 [email protected]
242,984,332 *1796F2A86C1F113F3BA2762D4118D37BDAD8C187 SBODNAZILATOTWSB
242,984,333 *179C86F351B76CDC2CBDC72DCCBE2642CEA0B0E3 scottcopper
242,984,334 *179D6827D70ECDEAE63EF808166298ACCDC30073 SEIKLAWS3
242,984,335 *1790C11EAEB94F055EF11E54EBF1978E0DA62AE7 shamecca-moore
242,984,336 *179DF9B35EC3FCA465AE2A803E563665D585F3D8 sharpes
242,984,337 *179995513FC19732ABFE08F37BB8C315E54FB797 shawty132369
242,984,338 *17916B1405053FB82E095DD128FE7AF3A2379CB3 SHERIFFOBOJANG
242,984,339 *1797585DCDC3688381D02C3DBB161D69B2BCFEE9 [email protected]
242,984,340 *179291548EB29B75E734F4AFB018CACD851F0933 SIARESILNE
242,984,341 *1794A66520AFD53C70B2C5617EED50FE2DF839A6 skogfinske
242,984,342 *179B682AD0FBB5E8570FB7C618C9A00912D405F1 SMCCLINON
242,984,343 *179A7AA235521B5E9FAD28A6A5767FEA272937B7 smoutwerk0
242,984,344 *1798D5244917B503323D28883977FC11216790F5 snglssly4
242,984,345 *17987400D198FABB28C4DA38FB77A5B2CD1BEA40 [email protected]
242,984,346 *179B4C07C7DF294DC315ADED1230D2A39A99B386 sosejixqs2
242,984,347 *1794600A22191069A18E3CB6750058368E342141 spider_band.sp/ai/d/@/r_b/&/nd
242,984,348 *1797EB3333988B1D55CCA09C8FFC881EABBE1071 splat!*(######3
242,984,349 *179D2A8EF38EAA604EAE44022F59CC7805EAD0D6 správcovi
242,984,350 *17913682D71FEF88EEEF10E927CC70743FF8101D srexelpud
242,984,351 *179B65B66BAF48600489B2772927C8AB9268E7B1 stenstoette4
242,984,352 *1795C5B981B53EA688DE228B73A61FCC1429EAC8 stevehomer
242,984,353 *179C187FEE0D707146DE45F005052E398CE91401 STEVERMILLER
242,984,354 *17900D34C6446DAED50091D656342A56F0C57C23 stoici
242,984,355 *179872E5D1044D3D42AF7E91CC53EFC7715F663D STREETDEAL1
242,984,356 *179C75E18323E6DA170D4C2D935D7F3165E8B901 StringQuartetinCsharpminor,Op.131:II.Allegromoltovivace
242,984,357 *179F7CED3B9BCE6FA0B8EB2744936668669776C0 STUBAMAED
242,984,358 *179AAE2B390DB24EEA5493F0D649128093A2CA7B sudamerika0
242,984,359 *17942BAEB59401AFBAF2337795A502274C4F222F suiteno1,op64b:balconyscene
242,984,360 *179D73A0568901DA5587751D9A865CDC27B04549 SUMMERACTION8
242,984,361 *1790CBB09472F4446D8A71455CD79A94FC01916D SUNDAY-MORNING-(FEAT-NICK-CAVE)
242,984,362 *179232443CF8CA0ACD1EF525BA2DCC4BA15F798C supererogating!
242,984,363 *179765B9C890BA72CB22F839AA67B45CEF541F91 SUPERMANPENTIUM0
242,984,364 *1794D56550CCE5705934A1681AA294B5FBAF3926 supplles5
242,984,365 *1790810B1FA88DE4D784ABA591A1FB569E02FB79 `SYN
242,984,366 *179F123CA4BD749904DF8EB7B7DD8AB74B0E8D53 SYSTEMICONS9
242,984,367 *17901A3F8846AC548AE271ED71049B294E4A0F39 tacenda5
242,984,368 *1794DFBA3C162F4DCC7E06D969925CC611B5CC95 TAMARA'GINGIR'
242,984,369 *1791DC7BA1A8BB7BBAF22B53CA4BEA1A7C46D7DA [email protected]
242,984,370 *179ADC0304345C3056A110B16921A1C0EEEF9EAC [email protected]
242,984,371 *179A5EAEDEA26150FE1367CF09294FBAC99C5C6E [email protected]
242,984,372 *17990EFF4985C4AF8E80AFB5E3CF402D0AF715F9 TEMPLATEBERNT
242,984,373 *179C98803E0F4DD2AB21DA59D01379A46CADBEDE TERJDESED
242,984,374 *179D52EC5F12F51BD637A1897A340161857A8ED9 TERRYRAMPERSAD
242,984,375 *1792A82A6BA9530090F59BA70C14A23C067F8ED1 [email protected]
242,984,376 *179AB137F9E81ED0BB28CC263E1A3D92EFF86A64 th0001010014
242,984,377 *179B9CA682F400B987A8F806FD6FE42DBF63F09C theiguana93
242,984,378 *1796759FC9D1C36A0D9151D9604D646BAB88AA59 theodoremcdaris
242,984,379 *179A32D99FE4B34CE6608DA3826C0C7086840F2D THEOL'DOORAG'SASKIPPER
242,984,380 *17974E4454E9D58CABDC44ED0E0F765A62230C0B THE.WALTZ.OF.THE.IMPS
242,984,381 *1798117404284A4474D31A3E4D68873F7110BBAC thibérien
242,984,382 *1792E77C68331B8F89B3E54D78A7A6B165EB76E4 TIMMYKEETON
242,984,383 *1797ABD2172A1A1BD2BB1405481CD36AA7CB2E24 TITUSVILLE3
242,984,384 *179E75C5577919530CC9E679D0652AE8273CF7E0 TOD.STRAZZA
242,984,385 *179D283750851C79C8AC4E049BE423994036E9A1 TONYPELCH
242,984,386 *179BFEBF699F8E19BAAC28C0E63A2E972C3E6783 topazy5
242,984,387 *179BB28B621E1719FBBCEB209A7711B0703E4444 TRANSUUIS
242,984,388 *179E69536C3889479690AA838E03D64115246F1F TROPXEENYAW
242,984,389 *179280E527038FE023E7C178CBC3C54CB77B0D08 TRUEFAITH'94(RADIOEDIT)
242,984,390 *1797C3AD36A836A3F9F35CC13F42376235CFB72A TRUMANDESPER
242,984,391 *17935508C8BAB0E65D68FA4D3038E453CD0D1FDB Try.to.Settle.In
242,984,392 *179D56445BAA0A7BA5FB934C302615A773D6DF84 tude.no..5
242,984,393 *179C17C5A8BF946F607279A3A3B418594261635C tuntejing
242,984,394 *1799582210B2BC20B43E218C2F8F379E7476EB2D TUVI ZUCKERMAN
242,984,395 *1794A206F26F7D2C213C1DB53C1EE6BA8A1C0211 tweenkee-haus
242,984,396 *179943F01560CBEE6504172B533E3EE4E09BDD20 TWYANASTEVESON
242,984,397 *179EC69D3E2477489C8C3195859860389E8C13BF tXm
242,984,398 *1791B24258977D80F408160ED2918EB646BD0714 ubuild.lenon
242,984,399 *17960E2E9F155275E732475899CAA5E4201A013D UEBERSTANDENES
242,984,400 *179A3EDCF68DD7CA6F82DED559BDB7508F46E71B [email protected]
242,984,401 *1794B82CD369761375CCB7BDC2AA88A4A8600920 UNPR3MATUR3
242,984,402 *179D96E16F53C4F1505394C032CA350332948DFC UNSUBJECT1VE
242,984,403 *17998AB249B43787CC75BABB5566052DBD1968B6 UNTRANSMUTABLENESSNS
242,984,404 *179691232972E67FC5ECACBAD2DCD716CE3F9F86 UPCLAIMCLAPPING
242,984,405 *17916D95CF1169BBADBF0261EB1C28D11FD0AACC URGIRLHO123
242,984,406 *1798E8724E00B0FC556E59C75B981BA202303E91 URNALISTICK
242,984,407 *179C120B5109E785C7828897C8C796A9A79D3661 USERNEPAL'-'HOTELNEPAL
242,984,408 *17915D0B92F76487E00FBEA15A2F88A44B2DFC2A USUARIOSPORIDIOMAEN-
242,984,409 *179DD80ED8C07FF9255BD6BCF9FB534C0D5EFFEE utami.deva.rizki
242,984,410 *1793CCC7DAC85C8BA644CFBD1F959759648F8493 UUO~D====3
242,984,411 *1791C5BDC809E67EE9B4E35D198EB1CED6F193D6 valiant-testimony-mark-of
242,984,412 *179D5BE95128B082327723983FC0FB206903C216 vampiredenver
242,984,413 *179A062FFF4E6EB4908ED0B6842A5A3B1659C183 vasilis.dimitriou
242,984,414 *179572918B2D1DF0E00668F0D4391EB8397AF6ED VICKI-BENTZEN-KILLORAN
242,984,415 *179DFAFB2F99F8952DE6360BA8C6F90B7D1F52F8 vikky.kangz.liu
242,984,416 *179B605A2A3C91AAFF44DA207376CDF3A87ABEF9 [email protected]
242,984,417 *17910C5050A85F59E0B0A5E1E5103F6EAE770C51 VIOLETFARMER
242,984,418 *1796F85574F0AC25E50A2FE0AB643913C55C19C2 VIVEK-TIWARI
242,984,419 *17903678E93F8B5679ACF3864C212E4BDAF2BCD7 VIVIAN.VK
242,984,420 *17953FD6A16E706E3779B706F0C1ED1A9AC29C60 v.javorov
242,984,421 *1797038C6F2B500FFEC9C251F3456CC8B921681D VJECITI1
242,984,422 *17909D1AC5264AE4F9443463A70228FAF88727AC VLADMUS VLAD
242,984,423 *17951F212EF5758D2D66BDF53E3ACF8E7AD2CABB VREBOJA
242,984,424 *179F43371B90A6FFE62260B6A7A0CBB90E2F776B vrslmpmpt
242,984,425 *179032B35694C9227F598C9F25D69E6563E43573 vzje
242,984,426 *1792B225E6F5343BF15AB89EC757F8ECD8113F93 wagames5
242,984,427 *179D5B60854A355EB68EDCAFA436FB9D54212792 WAS-HET-NU-70-OF-80?-VOLUME-2
242,984,428 *1795A54D09CEAB6510D4EA93E6F94CF50B11534B wasteland (prototype 1)
242,984,429 *179A3AEBB04751308A83933490FA2B07787CDD19 WAYNEPIEDMONT
242,984,430 *179E8CB708CFD8756DCC968A7CBEF831B4A2E24F WEFEUAD17
242,984,431 *1792E02FC7A017B4007F9FD0BAA47F7891A437B3 westonremigio
242,984,432 *179ABDEC8DC7039CFE86A06DF30C83666B318C19 WILLIAMCZERMAK
242,984,433 *1795628C3A2FB890BC70633E70AC58B4510A1423 william-diedrich
242,984,434 *1798885A13C290C85D7F4CB4925AAACEDC17220D [email protected]
242,984,435 *179886A881C346B0098369D55B697494AD9F6773 wingfulofeyes:aretrospective'75'78
242,984,436 *179700A16D0AC14D7BFD8985E728355DF384E4F8 WINSTON.RICARDO
242,984,437 *17980D622E87D557C478541101D4B208CC97EB39 WITHDRAWN-RELIST
242,984,438 *179BED615257598C4941312D800BA404A94A98BB WWWBARTHOLOMEUSKLIPCOM
242,984,439 *179C8D11AD0B657F42C4534730F3519EB1033255 X5QZBP
242,984,440 *179E0E47002CBFA7CDE43D5FF9494466E9221BD0 }X{-*-*D######P
242,984,441 *179688D50E4194B33AA2F7092F4ED8ACFF7A5D4B X[EV
242,984,442 *17918A90F178F5F76411B042B076ED3D3438BBF5 [email protected]
242,984,443 *179A4D70CE4DAB413DB6D323CE60A56EB9455214 XIONGJIANFENG
242,984,444 *17991E5188AC7747DC422E3C95F8AD305AA8517E {X}[email protected]######P
242,984,445 *179BA4E5CFC8EB08FE6E737DF756EB8C2F9BC950 XVIII
242,984,446 *17933AE5BE9C6363641431694E5E7E0284508FE9 [email protected]
242,984,447 *179C17906482424EC53C29C1AEDF28B090100BF1 yasmine-abdul-hameed
242,984,448 *1793820C57365B3FA9700F844F25B05CFBC5ACC4 YEAH.BUDDY
242,984,449 *1795421F725466ED47513B6A5608B7258DC59E71 yekeen.bamgbala
242,984,450 *1792C673EB7027F56F532AD740E760D69BEE9034 YOSAPHAT-ESAP
242,984,451 *17985DF9A1BEB895966D74A817BC325969CC859F YPOKELEYSTHS4
242,984,452 *179E2D3A12AEC8FCB171440201D6CDA3DA55A434 YUMEIDU
242,984,453 *1796EB9010706C56C94D4FA262D9BBA4A0EE9366 ZEBASTIAN.ANDERBERG
242,984,454 *179AEF2AE4CD04E8836E3347FAAF51CBC9BB4192 ZETKASTELEINSES6
242,984,455 *1791917F66B78010686AF74C7EE3300199764231 [email protected]
242,984,456 *179644F7DA1C5939E67163AE1BDE0288F5C0D9BF [email protected]
242,984,457 *179CB025511A9F2983990400A22F8C4CCC932E69 [email protected]
242,984,458 *1793C38636B0C45335892D68472656128F39EA21 ZOETVIJLDEN2
242,984,459 *17934AA17E65D6EBFE8689982A404F5942189B2E ZXCVBALICE4
242,984,460 *179318AB467F5B3AB76327B3D9AF525A8BA5A345 αττικάρχησ
242,984,461 *179C62E67836ED46E5927D24B6DBCA41EE084B4F πλισμόσ
242,984,462 *179274EECBF91FF7AFA6FAEA282089678C929AB0 ДЕВИТОМ
242,984,463 *1797DCE1B95AB7B34B97B7E862625D7B07B929F8 жюрк
242,984,464 *179AE2CB98C87E570198DD07936F25B02B03A75C КУТУЛДУҢ
242,984,465 *17959F3AAEFBD1CFFDB858D6CD2D2467EFCC1D36 РЫНАРЫД
242,984,466 *179BD8481FFB5342245D356AB9038163317C703B СЕИДРЗА
242,984,467 *17951B84C36CAF0AD71ED33D22F610BB4D80F3A3 СТАМЕНИЋ
242,984,468 *179A64437862A4C25D1C5A971E61F4DF302C21F6 «харчовики»
242,984,469 *1793430AE572ECE72DB998F2506F552B08725FF6 が共通している(一部異なる)。このため、becky
242,984,470 *179CA3314D26FF089B7E9CD588CCBFDC1EE601B7 02-13-1750
242,984,471 *17997E58EF87E627A8DCB70BC483AF2FE48F2C34 (-_0)O~(===8
242,984,472 *1790E8342AB48B94F257CA0A0C22100820FDFA23 (>_0) O~(====P
242,984,473 *179DE63D00CC64434B8C3DB2FBEB9896093B1599 1074990 ISOVIHAANASTIS
242,984,474 *1792110B0A48AF920A52ED23FDE66F86DEFBBAC9 10.INDIANERRESERVAT
242,984,475 *179D66A618909F22D42DCB48CC8A3F5F7EEF921F 121212SPRKY
242,984,476 *179AE40208743936CCE66A20044F040C0585156C [email protected]#$%^&*()-=
242,984,477 *1796B3A2942FBACBC4E97FC4173F3657F100CCC2 153870 grunseth was divorced in 1983 and remarried in 1984
242,984,478 *17912D48A2DEF8CD3BA2FA7DAC62C0243A6A6672 1564624 OPACOONTULOSYHTEISTY
242,984,479 *179A92EC5E6A5F85432C3F1DE858BAF7E4C89FAA 169ROY
242,984,480 *179C33ECEA12A18008B35124404D39D7D1738732 1732797 ANDERERSEITS-WAR-DIE-EU-ABER-MASSIV-BETROFFEN-.
242,984,481 *1791CB7CD6B84870993E66ABDA447514DE203F21 1772407 KUN ITSE HALUAA , TOINEN HALUAA , PYSTYT
242,984,482 *179257738FD3522B0D63362BA1B110CBA8844629 1966624 there-are-rules-against-that-.
242,984,483 *179C87C805185C4E86CE2F607A7E6988F0689961 19 ISTIHDAMI
242,984,484 *1793BB0E33D70F59B670A620AEBE1C6F22F0A4ED 1 ABFALLSYMPOSIUMS
242,984,485 *1799D3AA3FE837E60A946C8A7E342130512261AF 1 EINSATZABLAUFPLAN
242,984,486 *17952CBF2D40FECAB80661279C67052689767C7D 1.FASINAATIOTA
242,984,487 *17961B5EB9F78CF1F20899B979BACEF0A00A64DE 1FLIESENLEGERBETRIEBE
242,984,488 *17913FE7D26545FD16B954709494C956B921A6B9 1gpb-listen
242,984,489 *17913A0A3FADC48EF7FCAD54E596037633D509F6 1HAPETTAVIIN
242,984,490 *179D93E2BF0F93A94E8A6D0468847FE68E3435A9 1HYPOERGIC
242,984,491 *179DAD7F177235387DDEFC6B48E5FA64797CAEC1 1KATZENSPEICHEL
242,984,492 *1797EB5B44596EA1E1D77BBB743F87104F11B5C9 1 KELLEREINBRUCHS
242,984,493 *179B2761E6829D761801C6B456DFAAB1744B5021 1-LAULUSAUNDEIHIN
242,984,494 *179D98A585059D5FFC90942FAD19C9E3E77DDD50 1LKWHAENGER
242,984,495 *179CB7187BD7A0A5F9FC9CC05965DC85EC6BFC89 1LouGueT
242,984,496 *17937A9B90C2458DAEE498235A4F2505A8A8D0DF 1 monthsquickly
242,984,497 *179E647E41FD62F9AD709DE7016374DEE142DDDA 1.sinUzoidlerde
242,984,498 *179CC9847F9024D7262C632879DD596BA47307EC 1-STATE-PURDUE
242,984,499 *179B1EB1BE50155B0B5A4853A1309DAC23526F7D 1.valtuustosoutu
242,984,500 *179EF91F36EA037E62DC65FC8F03EF34B251EA11 1.ZHR-LUKEMA
242,984,501 *1797CFEC9462A144BC07F9E0CAA8C1C0D385CDCB 2067128 DIE RECHNUNGEN WAIGELS SEIEN NICHT " NACHVOLLZIEHBAR " .
242,984,502 *179E7FE8DE17EB039D9A9F7E5577B70C0E26681E 20сваровский
242,984,503 *17983507E26E569482C8D38385E0DD35FD8A8B99 24022 demIr-kunter-yenice-,-1950-m--U-
242,984,504 *179979387B1B608965209F5D82DDEC7E5435E4E4 24.08.1534
242,984,505 *17995F61E75CAEECAD28FF6B760FC7A6B82145CB 2910286 pane-kansi-raolleen-ja-keit
242,984,506 *179FAFCC98D0F603ECCEF512032944727D80CDE3 2966960 t
242,984,507 *179E37FC5F382DED5A3B56D1C031FBC7B426157D 2968020 MAKSUKATTO.,.EL
242,984,508 *17913197D8B82E43BDA437136DEE19C16742BE05 29feb1345
242,984,509 *179026D0D7470220A4852824D0FFDFA98CE1F9AB 2.FRIEDENSAUFRUF
242,984,510 *17950B37A2648500AF303303249BA0B105F58BA1 2-KRANKENSCHEINGEBUEHREN
242,984,511 *179D35379F3C0E8F4A4224C69715BF7D5B3F9922 2MDSMSTR
242,984,512 *1799871A2C6A78ECB932B70F77AB6F938AAF411E 2 WINKLEN
242,984,513 *1797FCAF4194B37F07DC3669C07846370FB43D00 30-jazz-konzert
242,984,514 *179E704E1826B369133E4CC8588E71862BA6BADB 322484 BASKAN'IN BIRDE SUPRIZI VARDI .
242,984,515 *179CA170065D10B1CE6915CB3F557DCD56453A96 3DESITROMA
242,984,516 *179E2C0F8EAA3C733798DD9FBC05FAA3DC00EAC4 3ETINOSMO
242,984,517 *179ACAA651D868CA9FFE4CE11133056F4A4DAC48 3LAZOVIK
242,984,518 *179FA11246791980A49FC1BF3DB2CA13BCCC7619 3MELKUREN
242,984,519 *17956CB9FE3905CAD0820D04EA5B32D9A8DFF913 3olamasin
242,984,520 *179DDE5284F905DF299707BF1DF74C6F2173F668 3#####@.~O.~O.SPLAT!!
242,984,521 *179DF2E457691B6B785E60075CC9304F3AA58257 3 ORDENES
242,984,522 *179A6E000F5B0CEE81431CBA40836530ECC441CF 3------P-*}O{
242,984,523 *179F15408E8A6E9A706E563A5AA124D7E627E172 3SHERBERT
242,984,524 *1799F9A2188534C15F1D9FC261D917E8C98B389F 4OVERHARVESTMANHEXAPODIMPENDIMPEND
242,984,525 *179A905E4358B3279676E2C3C1899AE68938F32E 4.RAKETENFLUGZEUG
242,984,526 *179D60EB1C42DBF5A68CB8F756380AC5520005F6 4REGENSCHERMEN
242,984,527 *179B34584657C4855F3928437761E2929D18F9B8 4THUMBLATCH
242,984,528 *179C40F18F059ADAF84126DB49B02B98832F2C29 4V0LUML0315
242,984,529 *179856380A0D1F8347C2B7B12980A1C03B38F04B 4ZTCKRJYJBR
242,984,530 *17943BC285312EA6471697B4044DEC8A62CF6D38 5-04-1632
242,984,531 *179107D45665BD300FEF1DE5A8B8A3F75D3662A7 59345923RW
242,984,532 *1796B6A545A99AB5D87772B8B240AF197B25F755 5CAROLINEL
242,984,533 *179F70F283CD93A8FF5ADF207CBC6072D77F1B3C 5CLOVERCUTIE
242,984,534 *179E4DA3AF4293AE270A8866E267E24FDFB40C01 5DORHAWKS
242,984,535 *179A1AE2BB4E758DAD768D7BE85837A5A8639C98 5ILLREWARDED
242,984,536 *179BEF336CF7275C8114698200E095AF75630A44 5NAPSTSEF
242,984,537 *179B4C4FBBC0A10615AFCAD86D4E7F282B58922B 5NVQKVWCRCGJWRM
242,984,538 *179D076EDAADB7AF368BDC0A3F77988B0852CDC9 5RIASSEGNANO
242,984,539 *179CEF4DD83FA4AC2FD5A4C8F462F66ABC884756 5thermosyphon
242,984,540 *17953C261456C9DD3ADEFA1CBFDF567A02BBDE2E 6AN.(FEAT..FREJ.&.SUPREME)
242,984,541 *179B289A3116F5866ED0AE93CDD97B05E60093A0 6ATOSSICHE
242,984,542 *179EDDDD490B9C3E6A0D709E59A4B91F03C1EA97 6BACHJOSH
242,984,543 *179421A3E69D491E00FEB81DB5EE672AE9D5A05A 6BSWXSEGMENT
242,984,544 *179BCFAF102BF464A71E44A8864D3E2871AA81F3 6CHRISSYGIANTS
242,984,545 *179CDD972E2BB5AC0FB72A6A66EA8B3E547B4F02 6COMPARRAPMOC
242,984,546 *179FAB1665401072FB057E1689F6B6FAFBD52CE7 6DECEMBER1074
242,984,547 *1798A2019E89D931EEE399DDBBB7A846B249D08C 6NEDLOOZEVLAH
242,984,548 *179164D0FE59728381A4EF772B77E3C859DBBD69 6RAISTLINMEXICO
242,984,549 *1794CBE4C904C9A9D57B9907EF0B4C2C66740767 6ROHALIA
242,984,550 *179BAC4AE12FBD14D9DDD789995F6E27D9D59524 6RQXIMHFJ
242,984,551 *179D46FB28E724954623BA5510C94F516112AB1C 6UNGERMLI
242,984,552 *1798B9D0F8FD99AA9F7D1E8EC87A8FBDAFB0EE38 6USTEKKAK
242,984,553 *17987916B658B26BB9537580D4254C495594981C 6WAREZDIANA
242,984,554 *17983400CA4813BCE191A1BF87551370E3B6C472 718aron
242,984,555 *179228D3BEE6274AFE8FB35A92A709E8C993F8AD 7BISEKTIONER
242,984,556 *17989367BD3DDD24EEEDA2B166529FB73FBBBC1B 7BSWHERIBERTBSW
242,984,557 *1794B364103915435E19FD7FC65C9E9F55651586 7CHERYLCRICKET
242,984,558 *1790298EBB45F6DE213AF3337581BD750B9EB1E7 7GUDERJAN
242,984,559 *1797CBB28716B3F682FA92600AD4E4708035351B 7LIVSRUMMETS
242,984,560 *17917449ADB3D9A41358BFBBF58220438432217E 7OVERTRUTHFULNESS
242,984,561 *17974948E6D754C614C004126378EB01E8FAC721 7SSIELII
242,984,562 *1797CA4855F15231776F71B538C271632E143290 7TESTERMACHA
242,984,563 *179AD9EEAE39031EE986C7107B9AD4DF3338CF79 8>~0~osplat!!
242,984,564 *179FB180F4CB83ABD0F2106D47D0DFA7249D480F 8bears1
242,984,565 *17927ED181F354A0753C5FAC1BF0BDE0A065109C 8--D~~Sploit
242,984,566 *179DF5E17D97001BCFC4FA916A8B9E5DF9B9FA40 8FICTIONBRIAN
242,984,567 *179E691AEEF3B59524B5D8E47D5F2E1B130AFAD9 8KOMPRIMIRANIH
242,984,568 *179AC147717E85CC1985C2A9B9D4F80799F4A4A7 8LANRETSOLAMOH
242,984,569 *179783C3D30568ACE2BA1EBF28152BB1907B60D2 8> ~ ~ ~:P
242,984,570 *179B560A005C4311F5B573DBE4D090EB8F79E3E6 8WALLYVICTOR
242,984,571 *179F795FC7ED44857C06FC513D9CB029B5E4658F 949aron
242,984,572 *179C4A00A2285B1E229F1A11ED1D459CA53E7192 9DUCKIEHELL
242,984,573 *179A4EF5B70D47CA1C34DB9FDB37B3A5FAB99D85 9KUSTANTAJAAN
242,984,574 *1797BF8D803BDF8080144C7EE822CFF73816CDAC 9LAKERSCANCED
242,984,575 *17975F27007955EC513A48C3C9360DE312082C0C 9LINMOMOD
242,984,576 *179189443672159E2B601A8A64AACDA788689D24 9MARTTYYRIKSI
242,984,577 *179C4404A9D1D2914A570B6CEFBE4AFFAD341D1A 9MAYRISMENES
242,984,578 *179D07153BED603FAADCA7EC858B369765C06BDB 9MYOPIASIS
242,984,579 *1790FE9F9BA4F361031F939E23B92B0DCD3099C7 9NAIDACRI
242,984,580 *179C475B65949CE2EA8A35AAEA4897682F5E48AC 9PSYKOANALYTISKS
242,984,581 *179F2B05810C5CAE88B1A42D5684526306151C7C 9SEZINAMREG
242,984,582 *17965AA516CFAA5543EE7FB24BD9925708326F8D 9SOMEPLACE
242,984,583 *17926250192D1C18FD66B1C9A00FC470B7545C76 9WYPOCZYNKOWY
242,984,584 *1793690F7181B1AD4F6D669816E1FDF49468979A 9ZHBJYGAFSTD
242,984,585 *1797C66B3CB833307E6113B36CF28A0F21CB2577 A3HB
242,984,586 *17992E89B8B0265685A920FAB39F3C32661E0698 a55er+in9
242,984,587 *17994BFA37BD504851C1DC59E2E1E77F91A437E3 AA;A)
242,984,588 *179FC52973A435FFE95C2FE7E2BDFF681A6EB4D2 aain+
242,984,589 *17905B01536FB2625AA2874A9B3BABE5212BF032 ABATAGUKUNDA
242,984,590 *1797A2C7DC59BA76FD1CFAECCFD6710E23577156 ABSORBINGLY5
242,984,591 *1798222203CF94422F827BFA6EE85C84E1EAD844 ACENAREIS1
242,984,592 *179D375EA49C23BF9DE1AEFEB7C6E3E639953189 ACH`6
242,984,593 *1793A16B7AFA42F9782AA8FD2C704088459215F9 ACO.V
242,984,594 *179C02DD319DF005C96AC8757F1B722411C80754 [email protected]
242,984,595 *17994500F05E2F9A297F1715EA235CA58F9DFF9E ADNMC
242,984,596 *179B23E42158ACB34A811DC6289FADD27165D126 Ae8=
242,984,597 *179AEDECEFE3ED16292A5648E0744D950A0DC711 A&HJT
242,984,598 *179CAEDB1A4BB4975A98EA36C76BF8FB594329A3 AHVTJ
242,984,599 *1791F8AA667A63EE77421AA3DCD33592C99D562F AI:
242,984,600 *1799D29C98DA27F01C3E942DE1BFF25A6AA172B7 AIRTIUQE3
242,984,601 *179B692E7E0D8FDE56A3884CD34809E41370A0EE aj_!
242,984,602 *179124E30102155A43A1C631412739C9061F26F9 aj4pp
242,984,603 *179222CF02BC6C27B24399C914509A0560DA585A AKT5R
242,984,604 *17979531AC128594670221FD1DE2933F1E10ADCC A:L3R
242,984,605 *179A19A65A70C625172D067F0CAC969F322EAE9C ali-mahmed-ali
242,984,606 *1795B3C90EA30FCCDE33823BB9E5E333819EC401 alj;_
242,984,607 *179F0B43DC76B3A5E2D15A5798604C01465D0896 ALLBADARTISTHERESULTOFGOODINTENTIONS
242,984,608 *1799957BE8431B76C0A6DE0A8FF2B7514B54F15D alpertugrul
242,984,609 *179C5E808EA9D2C0DBD979DBC9F098CC12F3CAAB alvina
242,984,610 *17960B8612979829AE5D0E7F2B22BFB69C13EAF6 [email protected]
242,984,611 *17901815A1B4CCEBDCE2F248B5F5B05A38392394 amoundre8
242,984,612 *179F27E6811111D2D10DA7588DC6898C563C9731 andreasealy
242,984,613 *17925FCA9FCE61C5DF34ACD3F3F8DF1A06D03AB8 ANDRIERS7
242,984,614 *1795F8FCDEEA7C266E0C6BD3FDAF1B5B2E9EFA59 [email protected]
242,984,615 *1793E069738325A4CEE9DAFC0379407EC321D265 angiospe6
242,984,616 *1791D59EC8EBDDBADEAF80F6563A511F0F2112BA ANURAGCHHABRA
242,984,617 *1790D16B3C8DD8CCF00502934C48CF0B345A7F5D AO4(Q
242,984,618 *179683D18EB998B32802CF57857A17AA1940E36C A!P)P
242,984,619 *1795E37EE3BAB51CC7BA286AE7F355138A02485F [email protected]
242,984,620 *1796DC09D85BA7EE513651012600DBE365E07306 ARG
242,984,621 *1796BD5AB9F765118005B364BA89DAB0309B2734 arlencozart
242,984,622 *179192213FA6181B4E66491CCEC00966F983FE80 armonas1
242,984,623 *179F9FE87329BAAAC002F4DA9FA950DD7765C329 a-s%g
242,984,624 *1795F9BFE74B632DA6DE1B37051FCD3A2DB384FF ASGWU
242,984,625 *17955F8ABD00DF1EAC06484241B914C5F728CCE0 a/tb_
242,984,626 *179D8B7C0DCF42B3EAB8D1BD536B1DA8AD9B66EC ATERMINE9
242,984,627 *1799F78628EDDE132E8E1B1459043DBEE31F40CD A!TG:
242,984,628 *179D0852A8F8262DC6F143B898868B53F881A08C atlassersed
242,984,629 *1793DBAA1699CAA26C0D889C1A70893F58FB94DF ATTENUATI8
242,984,630 *1792B80CCE5C072AFCD9874BCBD141682B3A3DC3 ATTTCTTGAGATTACGCAGACATCCATTTCGCTTCAGGTACTTGTGGTTTATCTCAACTG
242,984,631 *1798A38463E5622F486CA206EFF98054F1B92DBB a/+uf
242,984,632 *179E0B49A23CA600A189877604F53303AF0E1C49 augustwisseman
242,984,633 *1790DC7926B4BDE7DDC3E7A09F6BD9C3240E98B4 AUSTINCONCEPTION
242,984,634 *1790B6953A6A5F2B0E70E06B39299BDF21976F37 australit
242,984,635 *1797CC85838569C330D2A80008E80957524A6776 [email protected]
242,984,636 *179FCCEFB1EC5F59B72D46F98E116D7C9705EFFF awaikeda0
242,984,637 *1796DEBD3FC847C860334A5E2D753A59EB185893 AW-O6
242,984,638 *179DF8E0423D9EC71BF51A2B687750B60FB9039C b#7u3
242,984,639 *179E15CBC127C158D1AEA8872CE81F4747E5F93F b9%na
242,984,640 *179EEFF2EC930A18594FBBC70FF4E563E8197E9B Banket-1984---1991
242,984,641 *1798C486A889BDF0C242357B200946103E5EBA10 BARBADOS LILY
242,984,642 *17914699E26413ADC757235665D946F4BFA109AE BARRINGTON JEFFREY
242,984,643 *1798E0C017AB6840422167B44C3EF759C6E3C1FB BARRY.JANDREY
242,984,644 *179A43E2FAE042AC384F0AE8C215FD063AD79FD3 BATTERS
242,984,645 *1796C74025CB3C91260B1F5B16FA36AABB2A7E9E BCKI3
242,984,646 *179EAFE38460EB9F0E1AB95E7AE166AEDBAE518B BCYWODY
242,984,647 *179911F5E97EF04EBD8CC0EC8A0C28075E1EFAB2 BDFS
242,984,648 *179D05D925966E3B91BB666F54AEC92A109EA8A8 bd#z0
242,984,649 *17973244942079BA9172C3E327D5349EC62EA74D be_:
242,984,650 *179162BCE296DFB4CE65DA1D75C8DF5482742A78 be;?3
242,984,651 *179B96838316D67F0236D496DF86EC37366F6192 beambtebsw
242,984,652 *1798A8D458356BD07FF7202CD1FC27D1EBEF10E5 BECARD
242,984,653 *1790F59E81E5C89720EFAA2A9C69804D4CB212F0 bernardmcleskey
242,984,654 *179F12B8652E01D91D04721EC22528DB3D9E923B BETTYE.LAVETTE
242,984,655 *1797E7443A2175965EB9744A5A9B3BCE83D90384 bg_#5
242,984,656 *1796185652989E8A025E2630D4A85492789753A2 bgr-
242,984,657 *179E88E7335665274BA4C8E352D7AC5577673992 B-H4B
242,984,658 *179ECD671D6A487A4E922304F88AA15768CEF7E4 BILLYCORT
242,984,659 *179428A54E02D6B2F83FE249A204461EF3BB1D7C BISHOPAUGUSTINAHIMANA
242,984,660 *179DBBBF6BBE54E892F975B1FE9C9EC523B541FC bjk{
242,984,661 *1790E17775AA3B3D450DCD373B00AB38C785F78F BJNBRNG5
242,984,662 *179EBC16C0551778B8989C0295FF4CAF32A9E2D1 BJSHOOK
242,984,663 *179F4FB53F6C0ECF7E4333AB162376C107A6F85B BLAINE-ADKINS
242,984,664 *179B739BE24A9F90675485526A56D25AFC7B1B5E BLEMISH-&C.-(INJURE)-659;-SOIL-&C.-(RENDER-UNCLEAN)-653.
242,984,665 *17953FD99100F8206BDF737D65A30CDA43C31A9F BLEWITSN7
242,984,666 *179FBD09838C7DCC4BCB58F81636FD067DD584FE B(lK
242,984,667 *17956FAD5156D7459B282DC92B82F17560CFEAA8 BmH
242,984,668 *179A3CE92EC16230B7D90B773CFA38E9230FD7B1 b/ode
242,984,669 *179AB01B5A1D5D05FF28F1A4822EC0C08BCF7D0C B#OQS
242,984,670 *1791C9D84004E9A1D56F529155FBBB1F9306D8F4 bpgtw
242,984,671 *179FB9CFEE80A0666DF6E3A3B13701B10F782171 brandon-cutright
242,984,672 *179C4281B49656C864729C7683D69671672C85F3 brendonbogust
242,984,673 *1796CF83CF097F33ECE5A541907121911DFF3FE7 BRIANBREWBAKER
242,984,674 *17918625C933858684F47744BB58B691B6B6D644 BR.S9
242,984,675 *17925C45F15DE4180D6EF9B514D84CE1D773EEB8 BUSTER.HAID
242,984,676 *179D911E7A594CDBAF901DD18DBE53A025B4D60F b&vm1
242,984,677 *179793EC278FB5E58157509C9F831740243D54F3 Bwm3
242,984,678 *179CDD5612DABD517FAEFD9F729B8FFF0BBF9F3F bzbta
242,984,679 *179F7AEBA0B52F36E87720A0D142A3DCBA6D9219 c5/l
242,984,680 *179A589C5CBAB8CA7FBCE2632AB08CE25A5C19C2 CANTATA 198, RECITATIVO ED ARIOSO: WAS WUNDER ISTS?
242,984,681 *1792A8DE88B69F0C7C5A93D4CED1F6C27377E18E CARBONINFUSED
242,984,682 *1793F7193BFC6697D948F21206CEC9485E29BB6C CARLOMCCLATCHER
242,984,683 *179FDD3EE21A63A6FD4E6D7C5F69CDA2BEFDE427 CARLOSLIBAAK
242,984,684 *1795D70150023DB8B39AD2F40067ED203AC8E7FB CARMINETRENTACOSTE
242,984,685 *1799DD9F2FA6D8D979A0DD196DBD6413FD3C6E79 CATALEPTONETA
242,984,686 *179CE0491FB4C99FDC51DBF6FB8612582CC8C654 &CaW
242,984,687 *1791654A47A725EDCCE86915544E897AE8D7D12D CBLD8
242,984,688 *1799B95EC1BF0AD9207CEF947DEAC0AAE6406C4D ccgp?
242,984,689 *179E248886F2890C263330095E38493042ED20E4 CD:5E
242,984,690 *17937DD382E0540E46028264625D01C1A07D22F9 CEK7:
242,984,691 *179AFA2F48BADBC91F68B0B1BDF3CA9F1AF5287E CHADWICK.EHRKE
242,984,692 *1791B53DC74FD09218526D2AD2C109091CC72061 CHARLIECHABEZ
242,984,693 *1799DFD94E77276544D6E2174D1846F1509E8F37 CHEHKUEIED
242,984,694 *179506A543BB85B92FF9C322E4253560B11927B3 [email protected]
242,984,695 *17936F0C3092B235A5F5DC9FF3321D427FFA01ED chetbondy
242,984,696 *179AA01FA2087FA66B9DA1489190EB0D3030693C chliebened
242,984,697 *179250FD96CBE790EC2A974C42502B8F061BD30D chljm
242,984,698 *17938E4B33D028956DBC0A795D358ECFBA0A652E c.hqj
242,984,699 *179078AAD4775B17A487162153EED7C2FF21EADB CHRISPOK
242,984,700 *17927FF60FB59967C91B6B1F2B4BB7C936011757 CHRISTOPHER-DEPCZEK
242,984,701 *179A6F6565FEF8F2050C81E2D686A7398B2A0D8E CHUNGBONAPARTE
242,984,702 *179C1C2D6F1CB6C2DE5903D50ADCE888B1011526 CICLOIDI9
242,984,703 *1796737B86BABB603DE7FF15880A5FB93EF2009B CIDSF
242,984,704 *1796448881C08F8E443B6E8F1F875D4DC816C374 CKGWQ
242,984,705 *1794E40154EE91E8096E9BCCA1A00F71C3BA62B2 CLBSN
242,984,706 *179B60C4CD1EE91C310C22C3E056345AFE6DABE3 CLIFFORDHERRARA
242,984,707 *179EEBD262C3F74FCF6B5BE02DEC86184C7231B2 c.me
242,984,708 *1794D8D4454F2AFBFCF77E789FF0513789977714 cobydog8
242,984,709 *1791E9A3B986CDC4E9F7918FD61E825650F4E6C9 COLEMANDASALIA
242,984,710 *1799024FA8B2B2BE4A4F3E040FBCB62AC037A316 COLIN.BRUTSCH
242,984,711 *1798BBB4CF8D315F98A8987AF1D634A58D8AC4FC COLLINRAMMER
242,984,712 *179121E93FB07F7B4D4899BD22DD7576668D63BF colsefini
242,984,713 *179DDAD6BEF8BE56DF511B27463D68705FBB6AD5 CONSUMATI5
242,984,714 *17982FA8376D2D823F2058E39CE878366617D7DD CORNELL.MEGRAW
242,984,715 *179FE81165735362A332401EE52BCFA91377A449 COURTNEY1964
242,984,716 *179BBD709B2EEEC6C58948E5489EEBD90A86E75C c+(p.
242,984,717 *1796861F8AE502F8ED910ACA43E4F3D4C5D9EBBA CPCG7
242,984,718 *17950C3B92F64A79007BDC439CFAA90973AEAA5D $CR4GGLI3
242,984,719 *179FD85F2BEA60C291E34E4B480BFD9A738887B8 CRA
242,984,720 *179DD7D705B009699DF738B41FC60AB217CCFAB1 CRISTOBALJARAMILLO
242,984,721 *179EA880F31922E03458B80090BE5D42E926C270 cr,?w
242,984,722 *1799CB581AAF3DC59DDE69BA736E787ECEF7C149 c,_s/
242,984,723 *17940E90449FA3F317615731F4B6A96742185D7C c=ufe
242,984,724 *1798D5A153AB18219D94D627AEA10A49045D9D9C CV,V5
242,984,725 *179A8483189A621EB2341B3B9CCFFE40A83A8712 D0l0
242,984,726 *1791C74008B71A2B5E54F6F0371C9162E30EB0A8 D1V_L
242,984,727 *1790B1B5ACB54CED6598E200558DF2F62A4D7414 d3amv
242,984,728 *179AF2454A003CC3D841932ADE373FE21356087F d&3&e
242,984,729 *179977A3A67457BE7E595A01C85F3F624188246C [email protected][email protected]
242,984,730 *179D8DFCA5F7F128902B570ABA3125D9CF613AF7 d6v(t
242,984,731 *179A3405699AD84C6879CC60A32756BBE5992C71 D8BBE
242,984,732 *179F2DA22B34686FAD82C32E9B3CB3EE63E1FFD3 DANE.DORTON
242,984,733 *1797CE145C4D759A724FDB1A7494BAA3A029BF49 danerohleder
242,984,734 *1794F3493B8E5EFCA20511D9970DD6DD768A2824 DANIALBOUCH
242,984,735 *179BDF73C11ADC7732C4DBEBAF56DC92BA9FCA65 DAPX
242,984,736 *17962E942CF0621BAF134A58305475376EA36E4D DARIN.WIESEMANN
242,984,737 *1790DCD42AB270635F845338D2D4CD41A80DE2F3 DARIO.STUEVE
242,984,738 *1794BE3997376D9F417DBD06E44643FD35EBB3DE DARRENDASILVA
242,984,739 *17957197C06435F06B55F05A18267BF2C8B3392D darrylhoehl
242,984,740 *1793D2A9B19FFCA988745CE4D45712F59E17FFC8 DARRYLLANGNESS
242,984,741 *179B39F5AB51E64A51FEE66159262DE2779CE5A9 darylmoeder
242,984,742 *1795876401CFB625872A91E52FA55DF3DCA35B4E d%a;s
242,984,743 *179D921D3394AD38FFDA66927694A0409137041E DATE20070820
242,984,744 *1794D6375C4CFA0788CC701DCA8ACD0EC93AA008 DAYA.RAM
242,984,745 *179EA5CF7B5D5613649C06B7890838D1E39C9D30 D!$C0M808UL47E
242,984,746 *179DE86A2264B096D0AC6C391D1230F678F3EA20 d-d54
242,984,747 *179A0ACDCE7C7FCF9B745DAC1E15A051FF9954F1 DD(-E
242,984,748 *179D5F40FA4135F4AB75EB110DBA91292B30B682 DEADDEAL
242,984,749 *17900ADB800D33B3FBFBC9A708A413F2E6B16AD5 DEDITAE3
242,984,750 *17985C596C7BA119C5F5058E0D92A0BD99668E98 DEENGUS
242,984,751 *179EF8B4BF7845FBA556C7A347085DB148490EDB dennistesch
242,984,752 *179AC97DB4C4B51A38584AAAA09EAD19179AA1CC deonsivills
242,984,753 *1791672B074D295593B12961B34C134EADE462A0 DERCO
242,984,754 *179987F976EAAD2579801068CA684E3ED8505CCD [email protected]
242,984,755 *1792A0F1A2ABC809E4BC93548EA859464D1E7F94 der-sohn-meiner-nachbarin-(son-of-a-preacher-man)
242,984,756 *179C79CB37E3B103955A2BBF53F552B4ECEA8610 deshawntuohy
242,984,757 *179F6234A46D484C100CF280998C5536C2D3C382 [email protected]
242,984,758 *179C8E0D3429EFFBA5392905E722D14AE13DCE99 d+g5q
242,984,759 *179D9EB90B96E909F93C0E6883655CE525596EBD D:GNH
242,984,760 *1796311C538B5084808B21A19D25A8AA00878A50 [email protected]
242,984,761 *1798F2583E5E8BAB6147E734FE4858E44A3D4320 difq(
242,984,762 *1792F4FD3EC917858DE80C32F79370050D1C202A di#ld
242,984,763 *179C5654882039F54E4E3A1FFCC84B44A5CEBE1C ditassem3
242,984,764 *17928460E03460F6607839D1AF25D3C20CF43C0C dmko0
242,984,765 *179D778FDB15C10FB77C4E80E4B821C810DC4458 dn;,?
242,984,766 *179264D64BD42A12035B96CA27A7C432E9AEE884 dni,e
242,984,767 *17968E8010282942E3F0F1A5A15683AFC7B4C4DF DONNABERNA
242,984,768 *1798751077EEF11CCFE6EBDCE00BFB63FFBDBFD8 DONN.DEBROSSE
242,984,769 *179DF26629D20835477397769F34A1F900F9114D dosx
242,984,770 *1799723563AEB30C8C7F625FE032979C8B90FF40 DQ.8T
242,984,771 *179D190DF5F57AB75D4314F383842D2CA394BBEC D.=S
242,984,772 *1797FF8FBB5A60D64A1553BD1DA68E9F6B513CB0 DUNT
242,984,773 *179CEA13BD76B903F885C8FC9CEC5FBD690ADE35 DWIGHT.SWEARNGEN
242,984,774 *179383C8690F07D21D73002172EC8B82631E5171 dwp_w
242,984,775 *1799F17CB1C537825858305B9EDB2513634BAB61 DYLAN.OWNES
242,984,776 *17932270FF48E72803113A059B496E275E48761D DZD&
242,984,777 *179189691AB7DFBA855AC7AB32635208EC201680 ECLAIREURAARABES
242,984,778 *1799DFD408B416074CADFBBCD087E60896CFA4B2 ECNUOPNU7
242,984,779 *179135CD69233C03FBD26D6BD20E2CD0AEFB2363 EDAOT
242,984,780 *179897DAD3FA05D10407BA0B2728281E4446BDAD eganrub6
242,984,781 *17983AE45C62843DBCD25A6FBD50CA752E7CB9F3 EHOSTUIED
242,984,782 *1792546E4A56BD83059A5AC81CC169E13F0B878A EIL6%
242,984,783 *1798BC4DC8EDFAD389B40D33B9368CF66822E796 ELUITUR2
242,984,784 *179E3D694CD37CFA31E8BF3BACB847C64B42F157 ELÜLDÖGÉLTEK
242,984,785 *179E87EF9D5ECE631C16A934455C9DF003A99DED EMERJAS0
242,984,786 *179190FFCEA91AD9B8EEADCD096B6DD8688EBD6F EMILEDE
242,984,787 *179BF6A6A27EE2504747D12E050CDEBD356F22EA EMILEYANTIS
242,984,788 *17997CDB32905716C6095CBC86DBF59F7B169025 emilsvinth
242,984,789 *1791FAE99BC0E4E7C13C2F82BA8356B5A2FA6704 emmittballiett
242,984,790 *179F525C35CD81CD0F72E338C7CB5836FC2EEBF8 EMMITT.MANAUGH
242,984,791 *179CD0C792A740D5058BB61A2C7FBD65B094BAB0 emmittmoher
242,984,792 *1797CEC9098DE190D1A688070632A383D9AD6EC0 ENCROUTER?
242,984,793 *1793A40E8881D722713AD49C8814454A91F96888 eopaleozoic8
242,984,794 *179AD8BBB8A5DFCBCBB55BDB2B4C7B788C318116 erwinhazelbush
242,984,795 *179C9D704E5AFFB59DDD2BA0889383FE256D17A7 ERWIN.RUHLE
242,984,796 *1799E8E27155CB777B36E49DB659830B5AF02BEA ESBARCLAY,VOLUME5:19711972
242,984,797 *179665810A2A6E2AAFBFB2E2B2936D0B7ACB8E4C esrpx
242,984,798 *17916DCB61C67BB8FA6429171BA4A4FEA065A283 esueicerpped
242,984,799 *179F1ACC44D9D663D8039CFD0A150DF931684C3F etanoteca8
242,984,800 *1798E28666DFF43D6251A2ED00152A7B3D5A3177 E$T!M4T!NG
242,984,801 *1793B16152469A3141F5C1A2AFBCAD4F83658208 eugenekozlowski
242,984,802 *179707DB87DAF956EAF8A4B91CEBC3C7A35CEDF4 EURY14IMOID
242,984,803 *179E8586F049535BEA7C8D03DFD29B30E7F860B2 EVERETTEGLAVES
242,984,804 *179D73D1FEDA9494B4870A2E738571560563D676 eyd)!
242,984,805 *179DE697E813F45F5A0BE778D8797E7AEFD08AA1 [email protected]
242,984,806 *1792C4D8D7618649648ACB0C1F8D614480C5E128 f1ir+4+i0ns
242,984,807 *1793B191503686B167C3309F555D301E94BE5EA0 [email protected]
242,984,808 *179B55FD31C3E503B2CAA064819A61D0993761C4 FENGERICF
242,984,809 *179944B0A9D08288A8A950C5BE675D6C87B23D96 FESTHELD
242,984,810 *179EC02A8767CD0EDCFFC503D9E66EA2B057DD12 FIMJ
242,984,811 *1797E6AF8347C91B35DD7DF2D6C373FE035D23AB FLORENTINOALESSANDRONI
242,984,812 *179FEB8BFC6120F51155A6534BDB97E545A70741 flvnthrn
242,984,813 *179540277CF38F30B90EA3F293F7C70F61A8B03C fourstudies,op.4:no.3
242,984,814 *1796A63E42BDF4C227F5F669776F0569E8F339A0 francisdura
242,984,815 *179E7F4EBD53DED6254F5B07AEF4E93A9DB58629 frankbroos
242,984,816 *17916B40BEC3DD87CF913EC6D813154DD89BC187 frauncs1
242,984,817 *179640D8BCBEB0A2F3029C6CF9B837C705C12FA8 FRIESSERMAN
242,984,818 *17945E2211026E466A88E225DAEB3C2BE4949D38 [email protected]
242,984,819 *1791041558EE36428AF5FF45BD6895CD12FBFABF [email protected]
242,984,820 *17958E7627898BC06A4377CAA55BBE1B98F5E2E7 fuckoffsidney
242,984,821 *1798A616BBE8210C38D996054AFC1B8A230E9E29 @g ))
242,984,822 *179E4D3239FD36F13F8A42968FA9DD51BE7EA4C6 GALATIKA
242,984,823 *179A1485A280A91E7D770BA3071D1F537C6A7E28 [email protected]
242,984,824 *1791A58D6A90EBA78016932EEABDCA967D4AE877 garlandzlatkin
242,984,825 *17946B7A068695D9FBFB1F88AF5FF2E281A822D6 gbdesignscom
242,984,826 *1791A195F179D72EF0C2A84988DE941FFCC5B8B5 [email protected]
242,984,827 *17932BE220407E02A846F2FD8322C61223E4A3E3 geloofsgetuigen0
242,984,828 *179758ABE5CA4DF01E38F0404860C2ED7FFF0C9C GEOFFREY.SKOMSKY
242,984,829 *1798704B2ABD3C6FD4D10902EBB76550BB10BE8A gerardherbold
242,984,830 *179B19946B1537990BB207ADD71049073A1DAA5D GIANNI VA VELOCE
242,984,831 *179581BF7EC561272561C2497E9759327DB6D11E †GIGANTOSCORPIONOIDEA
242,984,832 *1791C4A9F30546794DFB3C89E78F4FB3691C7682 GILEDLYK7
242,984,833 *1798BBAE9C43911F94C3A792E75208B208BA7E4E GINADARBY
242,984,834 *179475E31E8CC97163392395299999B2B2763D56 gino.camaro
242,984,835 *179BD5791EA54FBFC2DA37CEBF0DC228B4D888D4 [email protected]
242,984,836 *179B7DCF79384CD57316AA68969884AEE08860E6 gradypuleio
242,984,837 *179D7623A9CDE2893FC8B28F34E854FC64724DD9 GROENIER7
242,984,838 *1793B34BC55855726DA8AF5EDBF714C832C76BFA gsmtrucking07
242,984,839 *17998D503AFE2C54F3B48498B2C43120B6F4E727 GUESTED1
242,984,840 *179339FB64AC2BC00E682009AFDBE1664E87A837 HARDALANNEVILLE
242,984,841 *179E8701E174421DD47B91C72D967E18B2320416 HARLAND.KERANS
242,984,842 *179763619D7B5A86C62C7AC01344F9821BE1F5C8 HARMONHALL2001
242,984,843 *1796082E0DC70258FE7AA556C70F1A90AF36F79E HECTOR.BUELL
242,984,844 *17999EAD3866CE9FB283FBE1F9066F6C16989E8E HEIKICHI2
242,984,845 *1792809ECDB4D036297CD7B291ED073C7676009E HELSEFFEKTER
242,984,846 *1793C40EF1E63533065B8338CA7D650D1551FE40 h~eq
242,984,847 *1794BF223536DCB5036F090DC9F873598D7387A7 HERECKING
242,984,848 *1791E7481F2F2ADC3C186360EB4ABF4FBE4C8D21 hermanmom3
242,984,849 *1799ED39F5296346DCC9BC37E383F79F4CD1E53E heruanita
242,984,850 *179923F665D678B4882FF8C3BF890C99F3C1728E housespies
242,984,851 *1791654109BDBFCFC74A7FE7D7A34FBDE9D888CA hterepsos
242,984,852 *17971C124E7B1A752E99BF50B5F632AC9E6F6478 HTYPE
242,984,853 *179C2C7EDA316D3D85A590B3654BC7EE9ADBB532 hungbirenbaum
242,984,854 *179C90ECD6A346CF5B7F12C199FE6FA44A111A3D HUNTERBRAASCH
242,984,855 *1799460D7BAE85C1B073EC6158D6CB12836E093E [email protected]
242,984,856 *179C728B6D824AAE525BB3DE7C6C6B44067A6924 [email protected]
242,984,857 *179F0DD5EEDE3CAE889F35554FA4907A1C26DD0A HYMANSKOTNICKI
242,984,858 *17922791C5DDA2864A2CB2FD3CAC45A28560928A I9R
242,984,859 *1793D06A8935413705244676840A9132482EC67E if.i.die.tonight.(feat..monifah.&.flesh.n'.bone)
242,984,860 *1797EEB4631C2258E66D987EDF4DCE22572CC223 IKAMAKKU6
242,984,861 *17903FFA9EC547C840048982BFF5D1F147483C1C IKSTEJLM
242,984,862 *179FCE70C07BE0D3D08E3F34821308DB50374F89 ILOVE_YOU123
242,984,863 *179165EEB4865C20F831ED9F4B8AC612D3548A0D iluvheart77
242,984,864 *179C64847E68F8446A10480F9C4A9AEAAC7276AB IMAGETEN
242,984,865 *17993523990987B368D1EFE3163A42A5D5C924AC in5+an+aneou5ly
242,984,866 *179B49EDDE0982A695E336C41505C141188A5DC2 ingrieveses
242,984,867 *179B3272E08B4D2A40E713409E1C65E6F4D15DA2 intensiveerden!
242,984,868 *17915475F8C672123227829F932BC888097937EB ishutin2
242,984,869 *1792B58AA1D26AE44D58829E0AE933FF557B6619 ISREAL.PANGBURN
242,984,870 *1797CA7BE4DEFC7BC837D8267D55C279237073C5 ITSMOUNTING
242,984,871 *179368AF74E81CCA50DEC3E24312FB4BC370C063 IVANOVHRISTOV
242,984,872 *17972D4DFC47B19202C1B8DCD96B8B6CF482F756 IXPHOEN1
242,984,873 *179242A28AB7CBBE887ACC61EF6FA430D83690EA izpolnjujejo
242,984,874 *17960CAFA39EEA9808683CE05635B039B93ECCCD JAN.JUBA
242,984,875 *179C9E9146E9FD0BBBAEA1EFDF20F9DB681C152F jarvismorrow
242,984,876 *1794484B911F9D7EC0D3FE01147A3A3B5C3CCEFD JC.TIPTON
242,984,877 *179FF6948D88A7138E4C01CD420BF3597F2E7A2F JEANSCHANZENBACH
242,984,878 *179B1FB19EA7676D34082FF9DB3E0F486D5E05EA JEFFHAEFELE
242,984,879 *179DC8EFC5BE484552B840B7A97BC9DD3299EB85 jessicaleslie
242,984,880 *179B4D29732D581FE0AED5FB6348DA2415056C7C [email protected]
242,984,881 *179D1B248C35C5FC216B9C72494A30558A584F93 [email protected]
242,984,882 *1792A34551C06E5C36C695BE863BF9A4E707B569 JOANNA.MARIE.PINON
242,984,883 *1793E1504B315AAFFD3F10082AF04D33C81227CC JOANVENIBLE
242,984,884 *179B2B7334B5B981A5F806B357AE58C9DBA1C280 JOEY.POTASH
242,984,885 *17973A51C26DABA82D66C53C14D5BB5F36624B24 JOHNCLIFFORDWHITE
242,984,886 *179560E10AC4C5984DFABFD5F97C5CF5775437EA john.luhn
242,984,887 *1798CCE1D50DC4E69C39308F64F6BE03579457E2 josefafloresgonz
242,984,888 *179DA2F13621C28C18F8C55FC6D9D0959B7E5392 josephleydecker
242,984,889 *179B4C620561F11800F7B1EA1BE592AEF8D523B2 joshers
242,984,890 *179FC7100057B1B929DE98A5E0F6FDDA3875E316 joshua.deacon
242,984,891 *179527235E70B5D04DF54C199B9F1DFF12067B05 [email protected]
242,984,892 *179376C404974E5C1F785159A7AE03929D9B9EA5 judsonvellone
242,984,893 *179389E479075CD8875EE92BC4EED86FB30D67D9 julesdaymude
242,984,894 *179C0568EF1C2680109C04701588C71BB8A05073 [email protected]
242,984,895 *179443705256B841FA6C14B7B11C3A0442ED6DC6 JVYYBSW3
242,984,896 *179C101AB8D5AEECD2567853F0842459425FCF32 KAEYTTAEMAELLAEAEN
242,984,897 *1792A4F6388C1F10F90456A53CE1D8AD72C0A881 kanon.original.soundtrack
242,984,898 *1798BA5A6E2A33F7F70CE25E1FBB1F058D0568C4 KANTAPHATCHOKPHIPHATMETHA
242,984,899 *1793D1D1963A0686D04E78C2E875AA33ED141A05 karotyashvaamsha
242,984,900 *1797EAD09E4D6934D501B8E7F338935EBEB9118C KBNEOXIDE
242,984,901 *179EA4B1E8B259CED43AF665622591FFA35D8EC2 KD1N
242,984,902 *17990C1FD5C067589BFF8C7D10F1C4910F17D554 KELLEYMASLEY
242,984,903 *179CB693F8C4632BD2E847303D48E1C53B9B09D7 KELLEYPESA
242,984,904 *1791938AC2A1DB3104881D97BF3378FA667CC644 KENNY.GENDREAU
242,984,905 *1791B6D6B62D9BA12F93A16C0C369FA7E10DB522 KENT CONTRERAS
242,984,906 *179B324AAC88D6582E5951B94029D147F2660866 [email protected]
242,984,907 *17988651978E8D81BF371CA246FF9A764B34086D KOSMISCHT8
242,984,908 *1794967ED73B1D078A6F240E15319AB40ED25275 kristenmcgrady
242,984,909 *179CDC3A28B12D7C508B3A5A7BF6C3F4CB3A9AAC kyle.boeckman
242,984,910 *1798CCA38975E576B68E54977633A31EAAA2CFB5 [email protected]
242,984,911 *17906BECFAA29319F64F58DBC5B37B5C1CC308FF lenfar-1
242,984,912 *179B998E9A7641F9D8293362A224FA959246BC59 lentrecote
242,984,913 *179591E1483E8E5AEA491E3EAB41424DD679E4A5 LIMENGSHU
242,984,914 *17956A768554DFEA648FC8BD39BCAC95D6E45374 [email protected]
242,984,915 *179A0D8264C10CD50135A5F624A8AEFB5A6E284F LINKAGES
242,984,916 *1792689401A7BA44BEA6F9F68DE41ADAF7440773 [email protected]
242,984,917 *1791ED60102C2595240FACC4143C29FBDEC30CB1 logement»
242,984,918 *1795B33040DA22A7D3D46F6B5D7349BB2DC6AB5A LOWELL.CALAMITY
242,984,919 *1794A20A495850E58EF66F82AF673CCCA97757AF [email protected]
242,984,920 *1799F279C93743F10F9ED62D2D5C2643DE3E0782 LUCIANO.PULFER
242,984,921 *1798CD84B222FB0AB375033AC314851DEC71E5A4 LUCKYCHEESE
242,984,922 *1795438D2CF226D41604F02E8FE8FE28706AC9EF luthervaneck
242,984,923 *179A3254F46C46F6B3244A3BD58061A3012317DA LYNN.HUYGHE
242,984,924 *179C979638B6AC516A83B12AB2B21A433DCCC3D4 MACHHAK
242,984,925 *179220E59D9B2EC218CDECF7FBD81BB28CAD4E72 mahanga1
242,984,926 *1793D92024A90FD56DCF30B9028B278E9DA4E80E MALAYSH
242,984,927 *179E7DFA5E15B53F7970581D7A7E71C7E721045A malikjhingree
242,984,928 *179199B18E578748ADAD299EDD4B31BE5ECEA035 [email protected]
242,984,929 *1799F52106D7BAB1B1FBF320345C116FDE34D067 MARCELOBUISSERETH
242,984,930 *17902BD78758A1A29F1DB66B11A162878AA1A5F2 marknads
242,984,931 *179C5181A2B6AAE98A6085A20E56DF9F8D631484 MARSHALL.FIGEROA
242,984,932 *179556F00409EDF9ABA1558065DE664A93A1353A martinmcdunn
242,984,933 *179C2E5111FCAA3A08241A8BF02FCEDDC585E9C2 MARTYAM9
242,984,934 *179D8922A78FEB3526345904371F7A64871DAEF1 MASOOMBARAKZAI
242,984,935 *1793485231395D0A40FDFEA570215AC241091CC0 masudur-rahman-mithu
242,984,936 *179650333D52FD32757F0968B77DAB1333C5CAFE maynardblanchet
242,984,937 *179E4847264F1DFA5100933A92347938C09C779B mckinleymasello
242,984,938 *179643321F50F373C42EE534E0B2321AA974C4C5 MEDIOPONTINE6
242,984,939 *1797729564CA0B9D159A82CAE1DC6E6DD1433343 meganyaworski
242,984,940 *1796F4AF9CF58EDBAEF074B3D17CB468CD7FAB28 melcia
242,984,941 *17948FF6065F914C259D959C28920460F529F30F MERLIN.WIDDOWS
242,984,942 *1796E0FCF156EA3E6D5CBB92897F0A702ECD2DAF MICHAEL-MILLNER
242,984,943 *179867D8155EE7B8E9C9A781AFC3E216F59768FB MICHAELWHYMAN
242,984,944 *179EF0361642EAD5D7CEFE72F595806F743E398A michaelzink
242,984,945 *179C71387A18799C767A082E14BA9A04F76B198F michelworton
242,984,946 *179FF74E79B180A1B04F284183EE14D48C062287 MICKEY.TROVATO
242,984,947 *179D07188FB2BE6E85DD17BA56CBFA64877907E2 MIKAGOLD
242,984,948 *1797D306D14D82532FF644CB19FCBAC17E9EC094 MIKKA1245T
242,984,949 *1792C809D98B11A2A94ADE0868FD4EC3D04B15D4 MILFORD.STINEMETZ
242,984,950 *17945B55B17C3752DF78DCA5CECD510539D055B3 MILLARD.FRIEHE
242,984,951 *17971673340510599AAEEB5B031315695E537DEF MIRANDA COSSGROVE
242,984,952 *179FFDD91424B5E8DF69BDF1BC5C54AC00203D96 mishoon0
242,984,953 *17977986DA7A77E44F60EC655323010C3F9BD6C7 mistiblu
242,984,954 *1797F3CC901B67CBDD0E5836A09AD90BE1DA087B MONOMIEN
242,984,955 *179DCD99548BAFA6E34E56A54B0B4399A1094B84 mormadcoed
242,984,956 *1791ED39DF74AAB578209BB44A67AD171BBDB551 mountingthev-watch
242,984,957 *1797329B15959407662E68BE1D3F9DC484119333 MTRLBOI
242,984,958 *1796CF126B37AF8FA628323CD8F5EC3D0538ABED mybarn2009
242,984,959 *179E17BCAFB3DB47640FFD1348423A9DE9E4B00A naco4
242,984,960 *1790D2FDC943A959282F815CE769D0E3664FCD4E nakaswa4
242,984,961 *1794D19A71DA5C4B1AA9E7DC8890F2C37E3B171E NEKAMTHCID
242,984,962 *179B33502A64FE9E587E42F8D5E4E4A01FBC2B27 nexyrab3
242,984,963 *179CB6C98FDF865D6E2B7D6F829644E12D92BB99 nittijl6
242,984,964 *17960CB4961C44FB60D2192B62D0E536D9107F4A norbertomcconathy
242,984,965 *17961F49F1874804688BED9AB9108A24DD96E23A notstandgebiete
242,984,966 *179E50AAD5EFF33BF0905BD9AADBF082977256EE NWHILLAS
242,984,967 *179AEC2D958D9490CF9DDBF93B2E63857FC1323E [email protected]
242,984,968 *1796032D33DEABDFB3A1096CB40F4A647C7CF142 ODISMAGATHAN
242,984,969 *179F36E26607C7C8D2FF789AC32757BAC63E9F22 OFFICIALWRITE
242,984,970 *1796DB20740285B3B6AE2A19B4579BD8D8947E03 ohwn
242,984,971 *179CAA34036F90BCA1A7427501C9691A8DC15A16 OLEN.EMARD
242,984,972 *17918916F68E62B0603DDB25E926E9DBCA1CB338 olenwormuth
242,984,973 *179E01B309698139F4FB91E1689679FCF8CB7CA1 )o([email protected]
242,984,974 *1792563696912BB2272D68DBD9E28A4F6D8481F4 Opus-66,-Part-1
242,984,975 *1794E7378430DA06FE1A395BB5882B98CDF895D8 O>< * Q####P
242,984,976 *17934026008F4A96994623F266B88422F43A5B82 [email protected]
242,984,977 *179338140706B217E2896D8542607B55BB3AC42D OTLXAA
242,984,978 *179EFAD98E5CB0F13C672B6711FC5936A14F2DCD ottomcclish
242,984,979 *179EFE7389DBBE44439606DD60373B1858D665CB oudereja6
242,984,980 *179717A2D1305D4B835CB49BD65B2F059FED78AE [email protected]
242,984,981 *17986BC30A295D1F07C9DFC176DD8273AE9A155B oyvindstrommen
242,984,982 *179ECF60ACF7569EC5D6568A76AA321F6EACF871 pääpiispana
242,984,983 *179E84BB9005B766D191CDA60D17A1BEB0F00D6F [email protected]
242,984,984 *179735BDA6C2C972561178853B4AA00C355A757F PAINIE
242,984,985 *17930A614F3A0B9D5F2FDA50E7430E5F76C0A4AC PASQUALEKOZLOFF
242,984,986 *1795A6D931ED609F743F2ED3AE8D68E3E1995F51 pasturegrass
242,984,987 *1791F74E9FA3E1F7ED1385E6F779CFABE81BF9FD patrickveillon
242,984,988 *179460907FFE5128BF23A1B6E9FE70A4BED09B2E [email protected]
242,984,989 *179B4633E8B1C669BBF8258910BA913C1CCA4D3F PE7R0CHEMIC41$
242,984,990 *17980FC66B4F234F09ED121FFA385798C112388A percymatsuhara
242,984,991 *179E2423DB40A0AFA7B5BE211FBC6193D8361FF5 PERIOD..LOL
242,984,992 *1792C67071367B47E49551A53480A14D6F3F07D7 PERRY.BARNHARDT
242,984,993 *17939CE8766CD2740319348DB180724D5396FDC2 PINKPERFORMSONTHEOPRAHWINFREYSHOWVIDEO
242,984,994 *1790A4CF972BE4BE79BB0ED09143D2F639FBF525 PKONTAKT
242,984,995 *179A2EB01B2B0AB279190CD4BF26FC0B6B4B7C48 PleasureIsn'tSimple
242,984,996 *179FC8DF7506CF0B58E463124252A5CD059CF55D [email protected]~o~o(o_-)
242,984,997 *1790EB6C0594DE1E685814D9D372D7525A313141 porterastol
242,984,998 *179880FE24E36918FD5BECE2306FFCA9853F49D7 P======P~>B0
242,984,999 *179354CC3E7C34892A8709F27C6C35F12B68E99F P===P.~.~.~.SPLAT
242,985,000 *17903820CCC26E952D1E80F48EEF11883022E942 PROCLAMIDADES
242,985,001 *179646D5906B0F549ED4D181FF50EBD4FE647FAE p###>***splat!!
242,985,002 *179381EE8CBACB53EC9042FED4683CB82C31D9F3 PSTSPRT5
242,985,003 *17942859CADBB9255B50A0555AB3D2ABD62E4444 pwkkzuau
242,985,004 *17907C469065053B6E92572660A5FE463EAE6ADE [email protected]
242,985,005 *17943A1C5E122E6BD1FE7613CCBC9964ACC897B4 [email protected]
242,985,006 *17988A4EB7320E6F463597D4FED9D559313CAF0C QUENTINRUBENDALL
242,985,007 *179235983966785FC4DEDEB687E3FB12D164CE47 raleighsheaman
242,985,008 *179E9A1050FDC21C8D658EA1E64DCCD07D471E64 RANDAL.KOEWLER
242,985,009 *179665BF0775431F73E841C4AC2DE27819321797 RBIRKHOLM
242,985,010 *1791D529F2B8B708CC1350427B722FDCFB480DF2 RCNDRNT5
242,985,011 *1790599A5B2C9C2CA5DFD515E302D0660B146FBB REBOMBARES3
242,985,012 *17902FEC9200E87D7C30B68396B83DD61EC3F69E recaning1
242,985,013 *1791D13CA8E6C1DA2EF683C1A82579152FEAF1B7 REGISTRATIEWETING
242,985,014 *179BBEA11059C4B3B0AA590F8D4B3DDDD0EAB232 REIEOLBTKAAN
242,985,015 *179BA20F88D3660787362FE8D69D89491D0B4AE7 RETNO-YUNINGSIH
242,985,016 *17945D85D138EA4767AE9967B41560F512D1CE5E RETYNGA2
242,985,017 *179EFF2B25DFEC28DE936D2822A5A4BBC194B52B rhettcerbone
242,985,018 *1797B6490B2FD7BDB8306BF598598FE655687C00 [email protected]
242,985,019 *179C3064B8F6F8DF8FFE2BA0C71E7F43F5C40C5B richa-thapa
242,985,020 *179BA61C5AB46C64E2869CD02489D3C61D0D71D5 RIGID1Y
242,985,021 *179B62B13347EC2CB8904F74EAF5342C72733D0E RINGELBERGIJ
242,985,022 *179551C3D14094363910993D110A2B5FE1B3BFE4 ROBBY.SPROULS
242,985,023 *1797CD69D23BD0E9A782A5A80ACE940DAC3D0994 ROBOTCOM1
242,985,024 *179CA121650C41985914DBE61C51A4AB00BC19A9 ROCKS.A
242,985,025 *1798F0D5B85889421D7679F494AA46CDEFB21927 rockysenner
242,985,026 *179A74A8BA408CADA0B4A32383DEED3883C315B3 ROMEOREISIG
242,985,027 *179A86843D65B305A4D5797270CA6E121498FE59 ROODBLOND0
242,985,028 *1793FC53BD55287D85F3B62D6AFD79977C7093F1 RUKOVODILACI2
242,985,029 *179E25C94ED154524B11ECE109FBC1FB2833C668 RW.R
242,985,030 *17933CAE07BA823570ECD400E23827A7BB947B84 RYMANDRA1234
242,985,031 *179802C97FBB5703FC595CE1A82DE3308652ABFB SABDURAKHMONOV
242,985,032 *17940F6E4EBCDECA5AA43C6AD2D187AFD97EB1CB SABEJŠČINI
242,985,033 *1798AB366A9F1DA2BD2288A3B19A79A0960BE79B SAINTDOMING
242,985,034 *1791D6C73CE7CF452EB556F8B54696E1782E16F0 SAM.POTES
242,985,035 *1792CE6D6349826BBE7FFC07482453BFE735410B SAMUALAIPPERSPACH
242,985,036 *1791D26FFB1F59EACC06D78AF53A9BE1C1DAAABF SANANABREKNIT
242,985,037 *179D626CDEEE6112458BFDF96C1A2639555D35FC SANDE PALKAR
242,985,038 *17938982AE69F4CAD5960501D6179578DCAE25C2 SARSONS1234
242,985,039 *17920781064B2A24FBBE229A93B0A329205400C4 SASKIABARBARA2
242,985,040 *179278969AC81C074159BE23326A5CA3BC8D2394 sbanderas
242,985,041 *17954A905FB5C78307F923B41B9255123E7176A3 SEANGERWE
242,985,042 *179F09181D0101187AD696D82730B04BB6EAC99A section:-101
242,985,043 *1790BBE83411BE11AEC029954B583844B573A40F SELBACITS
242,985,044 *179763E056531E6287F709FE33E14EA025E6EF80 SEMIBARR
242,985,045 *179BF0A56CC69388240A6F24E4F9CBA2F49BC554 SHARAFĪ
242,985,046 *1797AF3E4DB42724188D10DA3B3B65913A2351C3 shaunjakupcak
242,985,047 *1790D2076845CF80C5AB6BE267AA06BB409CCCC0 SHAWN HEWITT & THE NATIONAL STRIKE!
242,985,048 *179409AEBA04A24CAB3AD62B73F7D8E3A7CD83E2 shelley.burgess
242,985,049 *1791D66BA910ABB06847F706E9E231FF9F35ECD9 she's.your.cook.but.she.burns.my.bread.sometimes
242,985,050 *17955FAD3D01642090AB54CB10EFBAEB662112DD SHIFTDECKHANDDECKIEDEKKODIALDIGITAL7
242,985,051 *1790CDDBEC54ACFD1B32CD33BD929F316C91D3DC SHIPITSYNA
242,985,052 *179B3B1FB75A2AB750582A3417E6FF887BA3E5DF sidneycresta
242,985,053 *179CA86A839A15A54E8AE8F2D5B5F4B5D7CC43CA SILASSILAO
242,985,054 *1793BDF003B60015F1B6197EAA2DC398044FB24C simonmeras
242,985,055 *1792B95AEBA30140FECD285A71237DF9C8A85BA2 SLEEPWALKSES7
242,985,056 *1790FB2F0B6B86681FECD07E5711B3B0040D5117 SNIGDHATAMA
242,985,057 *179F38D8D8598B166D15CCD03A185D53D38C90F3 SNORTTEMERTNE8
242,985,058 *179AEA62495F3EECF0D37844B957AF5B21478EFC SODALLU
242,985,059 *17982C338D790F3E645581D47CE77F3A880D6DEB SOKINILLE
242,985,060 *179CB2826AD853B3FF2CB098F68AE16FEF7F5D0E [email protected]
242,985,061 *17994D1C9919E0F4A1951A8B0161B4FDCA2E2350 SPIDERBELLY
242,985,062 *17955D8F615894C43A0AE6DA724FA1DF5DA15F4C SPLAT~ ~Q#####P
242,985,063 *1796BAA4EF07DC3FBA41B9F94AFAD6C30B07880F SRSTNATÝ
242,985,064 *1792A672B1E4393665C1532A9CA440B1F874A636 SSENINUT5
242,985,065 *179A00D9949BEA6DC53AAEC55315B9DC7A9D01F6 STEPHWALLS
242,985,066 *1796BAA3206A3569F851B3A51BF8E53B02074081 STERLING.VANDEGRIFF
242,985,067 *179BF04E34F6AB554FCECA06E00FF3DC8A050E10 steveantonis
242,985,068 *179FDE91AC8845E09FE65BC0FE0DA3E62E93AFFF steve-maloney
242,985,069 *1795403595764F6BC379E3B78BA7413D1D52782C straitembraced
242,985,070 *179D09305988BE58DB9DC8D57B2B4930A4ED0C64 STUPIDTHEMAN2
242,985,071 *179A00C539F528D62C381B4904A73A2278996E2F STYLISIK5
242,985,072 *1792C34E22C55353B828E33B56D8751DA65C9F28 SUDDIVIDERLI8
242,985,073 *17944816D9A4EDD883CD79C2B18DC9204B9B4A15 sultansofswing(direstraits)
242,985,074 *1794AF084833AEF6B50150FD0EF2567B213EDCBE SUSANNELENZ
242,985,075 *1791100F537729F4DEC0B5EAD4B0B410D748FF07 sz354
242,985,076 *17910990D40F4BA138B356BE151A8524B8B73885 TALKNICOLASEUSTACHE
242,985,077 *179EF336D418E4938BF10C688F82809AA45D4269 [email protected]
242,985,078 *179B6846DA98C3E4362FEF8CA32733422D23568E [email protected]
242,985,079 *1792A3A3C4A6FC0F46A18D742C852ACA2101A852 TANPHIH
242,985,080 *179FFCCF53D65E08B4179816090087CE1D2E3370 tcbqgm
242,985,081 *179D0C5762E2D8A75B1B6238D41B1B7A723B5112 TEATHBSW3
242,985,082 *179B462A6FB9A602EE574593725B0B0177602B87 TELEOCRAT9
242,985,083 *179819DFDF224C9B6F23603F596FB1F8CE689482 TEMPLATE.LITCH
242,985,084 *179B2A43DD8B13E578B1FA85BBE1FEE544E969DB terrancereho
242,985,085 *179F768207D862C29D0F01277F27061C3BD471D7 terrybatimon
242,985,086 *1796866FD5263AB728858B9809B5EC1CACBC1A25 THAKSINBUSINESSPOLITICSPASUKPHONGPAICHIT
242,985,087 *17923064187F61936BD4269894CB24B0AFFC7CB1 thatgustavo03
242,985,088 *1799954D5304FCDA0597CA4E960CA987079F5A2D thebestonehitwondersintheworldever(disc2)
242,985,089 *1794E0CDE9D0087EDF148DD2D3311601D25190C6 the complete piano sonatas / forgotten melodies i, ii (marc-andr
242,985,090 *1799596E3B99863C7BE6C8BEEFD8ADCD79E25BE2 TheSundayManoa
242,985,091 *1792F6940B9BE162FB4F115B16D8B1CEA9BD335B timothyarden
242,985,092 *179FAAE8BA7ECAD9A995697E59281726381914CD [email protected]
242,985,093 *179087049E45C081423488033A9C56F371B58F72 TOBIASGONNELLA
242,985,094 *1794EF8DDDF2E4812558CA3C363023D76077F6E6 TOBYQUITEDO
242,985,095 *17944ACE633208371FF2145BCE7F760BA5097348 toegelacing
242,985,096 *179F0984E6A8C0D89039BF5F6C4860CF24E10104 TOTALITĂŢII
242,985,097 *17994F5EDAA3CF7674667059D13BE119BCF92465 tracysafin
242,985,098 *17902B0EBB0D87E62534A3D5FB52682F568F036D trasabrzeglagiewnikidzierzoniowskie
242,985,099 *179EB119E82D53F340731230363E1BDEF3F3D572 treysteifle
242,985,100 *179714FDACC764A6E7E9AFE5D7797976B6FEF177 TRINITY.OVERTURE
242,985,101 *179094F9B76A4FAACE7091F5947332B97CFAE913 TRISTANCLUGSTON
242,985,102 *1798E41D1FD4E90B81F5BE2749D0AE75905B01B1 TRKPROCE6
242,985,103 *1795DBDC82BCBCBF77EC3750913074AC15B5DC0F troyan.dennis.richardson
242,985,104 *17972318355B79A1221BF7B4F90BA837BA9E7E3D [email protected]@U1N$
242,985,105 *17950C7A1869C63A150B6FA9823FDFBB4C7F1B51 trula-spores
242,985,106 *179ADAFE5B89BEDE3273875E2446C3EE991C7C97 TSICIREH3
242,985,107 *1790054BDF4989457E7AAB9316A505B7F9F08819 TSOPRETSIUL9
242,985,108 *179569BBA897CA74B9D07B18CE1AB225EB35FAED TUNNELLBALL
242,985,109 *1796BC8F5394B0B5ACA4854D5127722A30C80AA3 TURMIKA.HOOTEN.PLANT
242,985,110 *179AF86DDDE03B6E355B5EFFD0B3BA225F2AD29E [email protected]
242,985,111 *1790C7CCB0C477F319830E5716C294F3B6E231CB tylermandrell
242,985,112 *179868BD0934BCFF55780E97259E5AF6B6275C67 U9ORIWG2BYA
242,985,113 *17906122A4415757AE58B9BEBAF5663BACBDBEC0 uberneh8
242,985,114 *179D601D39BEAA45C7A148A03B17F70BA459AC5D ulrik.staugaard
242,985,115 *179C3271931E01CD10BC6386F3C698DABDF6501E UNAISAMEMON
242,985,116 *179484089890FD075E90BAB6CB828D8BFB68F1A0 UNITESTATESGRAND
242,985,117 *1793260BAA1B378DF45DDADD9E68594BD89C4CEC untenacity8
242,985,118 *179B811AADB2E6EE349345F365FB9D23F794B0BF VALERIE STEPHENS WILLIS
242,985,119 *179AA1CDF653E0F8D70F0F02090390FE4F72EB0F VAPPULOUNAS
242,985,120 *1791DA0AD03C5E279897CB230500DF2FB96C9682 vasso-panagiotou
242,985,121 *1791E8637A12C3C2F6966B07E51B919715905BC8 vcriterion
242,985,122 *179E35A47B6A5E8591BF8BC6A7ED1F08111AD271 VERKLARE9
242,985,123 *179661553E2D0A459B9E7B938BE6B7E24116C48F verlorenesherz
242,985,124 *179FFB117ADE95DAB42AA958F6568FFBDFCAD20F VERTERO1
242,985,125 *1797C430459B79BBCCF6B27B836278C92D60EDDE VIDARDO3
242,985,126 *179B1FD126C4E8C5173B944BC81FE4F918B0DE3E VIKASH.RAMOO
242,985,127 *1793EEE3D0861CE904073EE31B26F6825B0B26E4 VINCENT.CANNELLOS
242,985,128 *17924AEE1187576C169F16EC131EF4467A7BBA4A VINSVINS0
242,985,129 *179F6CF4704BC894E8920FDE91732E7C518F61A9 Vive.la.Tristesse
242,985,130 *179A26121E94690FA74509C62DAB226B0835D8C3 VONSALTZA
242,985,131 *179CB9F853F44D15709A61C58F8654090810E5B8 VÕÕRPÄRITOLUGA
242,985,132 *179EAE76C38ACDD6E3E4617D03C5648395B70210 vuatiyruehdw
242,985,133 *179C13DB62ADEFC81C77F2EA7781B81C24E6A80A wally.schiffer
242,985,134 *179194155B69A6FB447E982459F5EE02FADE20F6 WARCRAFTBIGFOOT
242,985,135 *17983DC17AC0EB92A9C0933842112164F0B36AA5 WAYNEBUCHNER
242,985,136 *179D85BE813AA49C70F4A3DC43224C443654EB36 WAYNEREDDY
242,985,137 *179A7EB062E8D4466C53861D7A3E184EA95FFD0D [email protected]
242,985,138 *179B897BC1DF6FB34A002C6E4D4EAFECC1C0020B wes.mostaert
242,985,139 *1797C9A921CFDDBA97AC1376E09C109E8A8C3C6E where faith lives
242,985,140 *1797E28D0CFF17400AEDFA815AED756D3FEDB93E WHITNEYWLODYKA
242,985,141 *179FAA149684BFB99465DCA14CD229F5E3B1FBAA wholesales5
242,985,142 *179F1B1EDDFF4488B785FDCB62F0B71CCBA1BB48 WILBERKAVA
242,985,143 *17940B0E1154DFE34DE1AC9881F3459B41B914AA WILBURNMONTERA
242,985,144 *1797554C713EE37B479515BDAA3E56EDEED150D2 williamzinter
242,985,145 *179CFE138EBB0DEB48BB26300FF14039319CE00B winita.du.toit
242,985,146 *179ECA66C1871F27B766F5293670EE5A1B186E40 winstoneckard
242,985,147 *179137D29E030D554BFFA06CBF13A2262DAC8EDE WINSTONMCCAMENT
242,985,148 *1794967D70FF37535DA9DE36F43A542791E5DB23 WLFWAUEN74
242,985,149 *179806AB2D742323345A97D28DE08423BFA5D784 wozkamis
242,985,150 *1798FB0FA6A1A276F6F7729E32D8370D0E04C177 W<U)
242,985,151 *179C05A3482084681D99605D6C80642E4E805E76 [email protected]
242,985,152 *1791292824C450986E45EE4279C1A211BC7C6D6B WWWFIGHTIMESCOM
242,985,153 *179374CDA9881AADF38ECB641A6C86C4FCF9C46D WWWOAKLANDSWIMMINGORG
242,985,154 *1797721B01932D945035D5120476E766FEE60E50 WYTHENE5
242,985,155 *179395E82924993B32E1D743D2954A49646AC403 XANDAR XAVIER
242,985,156 *179606C5B5D881A1C92028FBC65C9ADF687599D2 X"$E
242,985,157 *179515D1134D8AF110E940E03BBC152FFC51EBE0 XICO EN GUATEMALA
242,985,158 *1790CB334945FB613F221063BAC40A2F320EC7E2 [email protected]
242,985,159 *1798F028B963AAA25F00F6CEDAD7512D6A699775 xw)g
242,985,160 *179FC946C3D018E180D70933DAF5B2E275B8CACB Y37923
242,985,161 *1791E02DE4AAB321EE0A88D80609065C7FEFE6CE YAKALANMANIZ
242,985,162 *179D47A951F3A26FA023614BF682697D744DB2E3 YALILIC
242,985,163 *1791168DEB2AAAA9D59E913648460B450FC90127 [email protected]
242,985,164 *1795769B7F3AC7202F0C7E333D8FC68FC95F3BC9 [email protected]
242,985,165 *17989E388292AED755573D827F4CA682590CEE1D yassine-zairi
242,985,166 *17906507C461DD60BBA810EF8E0116ACC4CCA5D4 [email protected]
242,985,167 *17908938A999D07CEBBF767B8F9E0F52E3417505 YILMAZKARAAGAC
242,985,168 *17943F28A6F8CD8DE8959EC035EDBB47BAA0F9C0 yipi.lim
242,985,169 *179A505CDFB473C0993B4E5641A45F7395503168 YIWUWIG
242,985,170 *179569A11979FE10E524D379998DD797D29F3EFF YKSNIWEL-SM-,)DNES-TON-DID-TUB(-DETFARD-EHS-ETON-A-NI >P<
242,985,171 *179262E8D65F6E88A85D35C733C8B1E2B68B66AC YMMNSS
242,985,172 *1797B9DDE35CE03EB8B873AE452108E8A57DAAAA ympyriss
242,985,173 *179937CFFAF3ED0DCDF68023CAC46384B5343A48 YRMBHYW78
242,985,174 *179DEB874C9A90DE98F80EB60D26DA7495BBEAFB YU LIWA
242,985,175 *179F41873BBB3FB5610782DAB75B8148091FD407 zaarous-sun
242,985,176 *1792CD2874D5AE0A76C6C90073333E155460A5A3 ZACHARY.ROACH
242,985,177 *17926EA21A4E4E9575C01523916A27D48BCE668E ZACHMURZAĆ
242,985,178 *179194B0563EC4E61A599EF11F1512AE9AA75FE4 zachperez
242,985,179 *179A8E7B7640F1B38DB03C6F8F1C086714B866AC ZAITSEVA-JULIA
242,985,180 *179E4EAFCC117216509CDE4D256EE25A460FB97B ZASHNASRI
242,985,181 *179013383AF98C6DD262B5CE04E1897EC4D6AB25 ZASTRTIM2
242,985,182 *179D63DE2787086EBB1842E894B48B667AF661F4 ZEBRANIANSTWOTHOUSANDFIVE
242,985,183 *17931445C73FDB9886DCB7261A1CF934DD7789B4 zedvinerasturi
242,985,184 *17910DDF8AE63590F10AD7B7E83F19738DA19278 [email protected]
242,985,185 *179EE49C8C3EBB138EB10B36AACF479214DA9057 [email protected]
242,985,186 *1792CA101F9878AF4F9FAAF83C1DEBADA1DB266C [email protected]
242,985,187 *179A656AAFB6598EE1C90A105C86F16EA3E6CEA1 zliang.pang
242,985,188 *179A011FCC83538D5A6D00A9E3418EABBCA1BF6B ZOEFOGDEN
242,985,189 *179C871E0BBA8164E9313AE2664E4B3CC617808B zogie-lee
242,985,190 *179FE6C44AF0EDE507B47F1373AB17A89619E028 ZOLDERLUIKENING
242,985,191 *1793174E93D60B984434D4DB489148C561B584C6 z;pw
242,985,192 *179DAE1DBB17C9BECFD120263A84C8906A4F34A2 ἈΜΥΝΟΜΈΝΑΝ
242,985,193 *179A6B6E908B667AD84B383435004C21E467A0BB АУТООФТАЛЬМОСКОПИЯ
242,985,194 *179AAFAE609B9637D0C8734B622F71519803D5A2 МОКЛЯКЫ
242,985,195 *17950F1FF21A76DCCF8314C6652ABFA6BA1CE5A0 НИШЕНКО
242,985,196 *179B241DD9DDE9ECAB6D180F653543C82D418A79 СТАЕТЙ
242,985,197 *1795C973E7C54AC4BB680B8B8CA078AA7D602752 ТАРСАН
242,985,198 *179EE44367C736F3FFADD15D39BC3626BBC80C64  геохимические
242,985,199 *179EAEB4C2300DC34B803DA0AE64EB90EC48990B 0ILUVSUZUKI6
242,985,200 *17958D442BD6894310BBC7C11CC84F30912A5944 1000 MILES (INSTRUMENTAL MIX)
242,985,201 *179DB0F60AECFD512B4F7AE0784A9AC6414FBF87 10.APPEN
242,985,202 *1798B9C21DD7FB0ABBA0ECC2F3FFF618946D32E8 11-31-1717
242,985,203 *1793C3DB1EB688FEB09DF59EF7810FB8ADA566D9 1376330 SM-MITALI OLI SIIT
242,985,204 *179D48CE6F59AC16DA0677DBAE238AB050D2C5D0 140880BLN
242,985,205 *17992588B0499019AE5DA06ABC01119B58FFD11A 1afdreef
242,985,206 *1799CA195E20678A4A3342B261760C197CA03F75 1.alphatocopheryl
242,985,207 *179A77618E004DFAAF65D48A0FD23EC3C3AD9DD2 1 BECKER-VERWALTUNGSGESELLSCHAFT
242,985,208 *1797919676B215B8D835F8DA910FAC24093F7F86 1 DIPLOMITY
242,985,209 *179D7EBD853DA5BF35D84BAE035CD01623A0902D 1elektrokunst
242,985,210 *179A808C82DBDEA2ADC0DFB76C77CA4FE605697E 1ESSANIAR
242,985,211 *179C47DD56C42034A955533F1A70E8D3E40503B1 1eurooppakuvaukset
242,985,212 *179520809BEAF91446593F1F27536C44C10B90B1 1FARANNE
242,985,213 *1793F2627E4BE98E021330CFD3C739D0B56798CD 1hallitusasenteita
242,985,214 *179A274F1804BBA96CBF3BAF04C3DDC93C3FEC91 1ILUVBART4
242,985,215 *179EFB172FB7DFD33F3DCEC77AB63D490D7ABAED 1johkaantunut
242,985,216 *17976E41BFF89E0EAEDDA06499A49D5820C1CBBA 1KIRICHENKO
242,985,217 *179B0D9A80FF77C9113FAFCB6F998E4E2A7ACFEB 1 LOUNAISPIRKANMAALLE
242,985,218 *1796F8B659BA392F44268789732F9091B196CFB5 1ORGELTRANSKRIPTION
242,985,219 *179CFE8C67FE500D31C268913B622EFE63952F2C 1 ROTUJ
242,985,220 *1796D6CA4393DB972B0CD95C0DA688A1E702FDAD 1-spacca
242,985,221 *1797ADB8D8B9F72BBD51F8FBDDF4734D59EAA0F0 1TOCKKCOT
242,985,222 *1790075A4DC55BFE4B5AA9A1D550830B48234C36 1ulkolaidoitukseen
242,985,223 *179539694395B5B117FD00BFFF3FDA20E9B59978 1.VALTIOMUOTOIHIN
242,985,224 *179EF2AF337FD84E7462A6D8386AF01F7357BF52 1.yaratiliyordu
242,985,225 *179784271E2A06A092EE5926D85566DE85EF3968 1.ZORNSTRASSE
242,985,226 *179950C8B9E8ADEBF994A9385C7A9538DEED7EC4 2011125
242,985,227 *1796D7ADFA70CEFCC6ED61CDF454411DDCE31256 206972 ALUEELLA-ON-VANHAA-METS
242,985,228 *1799C8EFD76DFF4976ABF4FCD97BB855B12DE71B 2095575 offshore.race.avomeripurjehdus.k
242,985,229 *179F3D6D5149E6D193F04638F499ECC72DAA708B ベル214ST
242,985,230 *17957CFF4B0D87F2BC7E6AB15A8584DD628F17DC 21OCT1573
242,985,231 *179CC2673BAD13032B78CCB0089843EBA37D12E3 262YARELI
242,985,232 *1791443CDEA4CB5E83304CCE9E4FA97CF413328F 26651 Iki tip gOzenek vardIr : makrogOzenek ve mikrogOzenek .
242,985,233 *17911B770258D6579B69C1C50FE0470E114078E6 27sep1664
242,985,234 *179C96ED54CC34A120FA12771ABC13424069ECD8 28mopv1
242,985,235 *179A7883D1FFD6E8E3BC93D87D6FD3E92A3AD41D 2AUSFLUG
242,985,236 *179E299A17EE846EA3718BB1E0E36AD396B8F7B6 2.bilder-paintings
242,985,237 *1793E91039A690F2EC510F6A9E6A8CB158902B19 2CIDESES
242,985,238 *17969036988090FA338D274531DC66BA89B8F7A9 2fjpost
242,985,239 *1790D771F242FB32CB6559F979E0770E123DE6CC 2RIKKIMENNEIDEN
242,985,240 *17978099A15F4FD46C98E8ED8EB8022E3D4187D9 2SEHCTILG
242,985,241 *1796022B8D8DDEF2DEC7D70788BCF777C4A61CE8 2viermillionenschnitt
242,985,242 *1794EC1426AA3ED03F65B7ADAC026E19D9D59B2A 32tarvitsijat
242,985,243 *179A4BF3D90A7EA0E7B3F42D9E82CF614F137D28 33ywmxd
242,985,244 *179E888E08879AC253FE948A81B3BA3C3568773B 393943 TARIHI.I.2.2.304.OSMANLI.SOSYAL.VE.IKTS..
242,985,245 *179A156ABA1FFE18320A12D39F9D973E77B3D17B 39-LANDWIRTSCHAFTSORGANISATION
242,985,246 *179DF3A9C6EABB0DD736614A54A8749050B5EF40 3====b * *)0(
242,985,247 *17928D393D31657D00E407D8A1F54D93C1AA563B 3=====B~O ~O :P
242,985,248 *179241C1E987B1203586D9B203BCA96EE1C7CC87 3.LENN
242,985,249 *179FAC30E493D2A0AE2379C1364E809C11F0EBA4 449C2910B3BD4400AEF2B302BB979A56
242,985,250 *17978F77C693460AD2501C41AB3A91F922D2FF83 4BSHANNON
242,985,251 *179E78D93F526E9A6E6B43436D85DD010C76043D 4CCU$47VE1Y
242,985,252 *179AE760DAF9E246AB24BE555215DEE87F909879 4GCJHZZH
242,985,253 *179A9EC598D599F64A9124009F71B6F6BB76591D 4RISUONERETE
242,985,254 *179687E65CAF5FA30F572443AE206CC191B4AA47 54TMB
242,985,255 *179AD4D04DADC17FBBEBFCF170F8BA8658E4BA80 5APPLIKATIONSTILPASNINGERNES
242,985,256 *1793C53A336F753B1C6AF4B414F60BEAE558B8CC 5BSWDOTACIONBSW
242,985,257 *179E8B5714657FE25F387162E30ABA375384F381 5DESTROZONAS
242,985,258 *179EE41DFFFAA51CAF300F11261572445968265F 5GALSGURE
242,985,259 *1790DE90567BE729EDA7AF91D2868A91E5C6F2AD 5HCOLVREV
242,985,260 *17972558B8C950A9E17652AF08ED207B72D18171 5MIDVALE6
242,985,261 *179668692726BD14D90AFB9CA515246AA0110C3C 62ED34E1342126C7FDF03C651CA4E20E.ILIE
242,985,262 *1792265B09CADC8067F341800D54BDA4F0AB68A5 663angie
242,985,263 *1795C61949A8A884DF5A465321A22637FC7F0506 6GARYTAMARA
242,985,264 *17946AE89D141536D0D60860D6756B8B233D5355 6IZJEDASMO
242,985,265 *179C259982C1BB684E63C4BBDCBB8921ABA0FCF2 6IZUSTES
242,985,266 *1799F3BF45591E0192F8722B16BDFFA024B8B546 6NEVAEHNU
242,985,267 *17984B7A09019B081B0183B358D8F1309D47D7D4 6NIKSVOKR
242,985,268 *179BD0A4A4FA3244A938E84DD75EA1DCC3D99911 6PIENISSIMAMENTE
242,985,269 *179D4F324EB622E6AD230F9136323D203D10A1F5 6TRWGLODYTEI
242,985,270 *1794FA28C64E98F5C9B270F3E70BB3C3E94164A5 784harry
242,985,271 *1791B751DBC9FA149ADC39E231003B4AE2F4415B 7-antidemokraten
242,985,272 *179A06FC91FAEB138B692F7CD6996D3E0BCB7C74 7BSWMONTNARO
242,985,273 *1796D132C2A6BF4FE0A5CE61E7E6D598AF63B3A5 7CIRCUMICIO
242,985,274 *179AE17045CE2684E8A03A733E922695DF4A9DEA 7-DEGISMESINDEN
242,985,275 *1795610AC438BAF43330ECE2085B62500C562795 7F?K
242,985,276 *1791470B4CD95A4B345201D36ADFC911CABC2DD1 7ILLUMINAIT
242,985,277 *179F92851E33D0A0A943870EAAA301EE98EFB5ED 7PSEUDOREPLICATION
242,985,278 *179D8A189C471E837E86FDC986D9700242CC49AC 7SAYNTEWARY
242,985,279 *1793FA97C673DDE5773EA0EFBE82B3CE308A334C 7TIMDAVIS
242,985,280 *179B403AC2C1E3AABF93BC218640241B8F1E2897 7 YUM
242,985,281 *179A18F732E8AA2AC144A7BCFDCAA3C8160B0D7B 8ALEONAR
242,985,282 *17919E3EE38F2FF7AF0F264DD4FDE1E429772723 8ATLETICOSSA
242,985,283 *1793413B5BCAEB159AB094BCE7DF10BBEAF6DDE1 8DIGGERBRIAN
242,985,284 *17995A2B50F52DFA23C98F0E242DDD98BD6A34A8 8DILACERARIVE
242,985,285 *1799F38A9A3A627817243F869618B79643A08FA6 8HOEJBJERGS
242,985,286 *1791A70F7297CF97BF93A87FC38874D6DEA408D9 8LGNIFAOL
242,985,287 *179CBBD07DFBFDF17A58A6B481B7AC5C1B50DC14 8NONREALISTICS
242,985,288 *1791FB07239B08726A2778F97070F912B5F84EE3 8OHEISET
242,985,289 *179ED337B16539949D9779D90A8C6B3E1A09270F )8(o~ q--q
242,985,290 *179AACE6CB0D579103E4F4594B604EF1A8578151 8PRISUTNIH
242,985,291 *179E2EBE59493EFE3C5004A029473DD150C157C0 8######P ~ ~ ~ SPLOIT
242,985,292 *1793B3FE3C92E5B24230834837C2ECB06FD45226 8STYKKEEKKYTS
242,985,293 *1798F10A1A4EACEC1365257FA4EB4F8C4488F7B3 8YAMINOWA
242,985,294 *179C722432E3FA8AFD872B124B2A44E29CB75C5D 9899ROADMAP
242,985,295 *1791DE19E172189E32E6FF42921B4AAFC00AA35A 991001 milletten-Cok-Sey-istememeliyiz-
242,985,296 *179F5174FB8D71AA679374A50FFEDFE3F321FCB2 9COMUNICARTI
242,985,297 *179D986829BEE1FDEF8ABAADB4EFF3B132B1A311 9HERAUSSCHRAUBTET
242,985,298 *1794DA0199E430DA5B9A75CB6A888939C2797427 9LBTECNAL
242,985,299 *179D7F368A208C4A714B2D7220616812675D8B14 9NFWFXVQCMNOZS
242,985,300 *179038D1EA13E9EBEDFB3D92260F047C638E8CA2 9RELEVAVIT
242,985,301 *1798B492744EC73B34BCEC0E289C68A79744F2D6 9SHAEDETHTH
242,985,302 *17900F42895C26397DD8B5AE1BC3B093CE83088D 9TUGTHUSKANDIDAT
242,985,303 *179BF1C75E081EA4AA99732ACA52B71374070E5D a2kgi
242,985,304 *179113E8309CF4A4734FB92CE2710BE49647AA7E a3;(t
242,985,305 *179362E6330DD698CF43539C7B818F281CEEB410 a4hy1
242,985,306 *179E02E85482F58C4F3687222E7D6C7893C98F3B a4zkv
242,985,307 *179B340705B0BA42A132DADD7A409E1CEB8D0250 A77AD7620C0F4E01CA256F7200178FD0
242,985,308 *1795D1F8F2A28CA6D08C99B2A98F3588B2E12407 A8GS
242,985,309 *179DF40EDED419ECFE873DB1FC8C0D3D5C1DB14B aaeas4
242,985,310 *179772EBE48F793946E5D116BEE38F0EAA1F7314 aafkz)
242,985,311 *179FEE2B3712CE92F9318F420D49D1E856882AB9 ab:=l
242,985,312 *179CCE6CA2739ACC11368D67721A3A41D1D1D09F ABORTLOVEN
242,985,313 *1792ACBC5E71B3F8D2E089AC39A033D163D14A1F AbpZ
242,985,314 *1795C1435956F8ADD3A4C5EC4B3A9422A91E4F92 ACICR
242,985,315 *1798865E7C9C5837F4F82379EB075B733216E7A2 ae0y$
242,985,316 *179AFE0DD24A82BF67537548ED9A8678B88CE88B ae_aa
242,985,317 *17910760418D5AD8B13ECD1F0927E10B888AF271 aeaenestelty
242,985,318 *179C16491B03F66EF7DA45625F1BBA7322C25967 AE?Z9
242,985,319 *179ED9468599B6A438F944C3A188E91D034169E4 AIGIALOJ5
242,985,320 *179F3144119377078AB525917DD63BE8BD0E3E59 aikb;
242,985,321 *179D959DA44B2D6FC2E09DD648EE045E11CB4DA3 a.inh
242,985,322 *179EF3DA350729E5E5310E73558F0F7423BBC07E AIZIK22
242,985,323 *179D653F0ECC93D66EB46DB26407FBE54E9F9CFC AJG-K
242,985,324 *1791E17046286111B384D71AACA8E57EEAA11D60 Ak5;
242,985,325 *17972CB0A588916E1D3226ED85489AF1669EA663 AK.XK
242,985,326 *179C73960E03BEC9242FA60FEBD9408FC04D4454 ALCESTE.(ITALIAN.VERSION),.ACT.II.SCENE.6:.VESTA,.TU.CHE.FOSTI
242,985,327 *17963402418DDAA9E4DB32C3C032E6675A41041F aldentrundy
242,985,328 *179A79C5472993E73FC293E04818947EF04D1111 alderses6
242,985,329 *1791CABEA564C581F8F8EE109EE515D1CDD00274 ALEXIS.KROH
242,985,330 *179F3D81A32AACC5010093A86A03A96A63D3A611 ALFONSO.QUIROS
242,985,331 *1798CBB60F0CE74C4FEDCF4AE8C9EE1D2D707382 ALLEMANNSTER
242,985,332 *17993069E76DDD27B98ADD1464BBC154E8F3EA2D alvina
242,985,333 *179D3B83E0AE263363E7717C763AB144A5DAB52D a&m<
242,985,334 *1794FD1025F0905C72FEDF7C0E81B49BC609D6DF andhimazhai
242,985,335 *17912336FEAADA824C62469972059A8500416B1F andrej-aleksic
242,985,336 *179E516012A43165A3EC238F595739649D8B4D8F ANDRE.OLDENBURG
242,985,337 *179314FCE68A57D60240741B2A3590995B243446 andrew.bitner
242,985,338 *179DDDC7D1E2063C735E48DF1C4F0925437C199A ANGEZET
242,985,339 *179E5F1FD696793C08D475E06694192A800DF0E4 annamajor7
242,985,340 *17935F868E67B0523B68E872D20FFDA1808744C4 [email protected]
242,985,341 *1791BE4BADC92B3B0B32EDCE1E666927EFCF7F85 ANTHONYCAILLIER
242,985,342 *1794CC6F05267508C8B7B29EE1861D8692396096 [email protected]
242,985,343 *1797D3232FBFF114B4663B1B2A4DD9E773427BAA AOPC&
242,985,344 *1795BC3EB914394A25D9F7B34C1FFF331D87E263 [email protected]
242,985,345 *1791F46C03074225CC3D97C87CBAF63D20381696 applicationposture
242,985,346 *179396E641C3FDB4B9A4851860E0F381C0BA4292 APRÈT
242,985,347 *179AF318BB3BB2BF070E07CA7269B3321BAA7E8A AQ/SZ
242,985,348 *1796B700387A3AD20E0DBA7B04B983065853E545 ARTHUR.GAYLORD
242,985,349 *17987DCF055B49B1C5E4590CC7B835B9C4364D7C artyfios
242,985,350 *1799344D48BAC7E70553387353623D23FDDCCE13 au8ww
242,985,351 *17970DC0AA054410239F7DFF5AF25DD57FB70E1D audhq
242,985,352 *179F82CF7F6E943C3198AF955680CFD0890905EE AUTQ!
242,985,353 *1797BC270D0CEFE9A238EE41ABD014AE3A2CEDF1 AVTORIŞI
242,985,354 *179191E87EB34AF4B30B98A410DDBF83FF0D0B3C AW82K
242,985,355 *179A70929F0CBD0C5914865D9488142794D582B3 A/-ZR
242,985,356 *1793C3014F14A563AF297E626D3C217B0DE5D6B8 B4Tq
242,985,357 *1799CD5A2C6A3F96428310144A21D5AA8B9478F7 b9fhb
242,985,358 *179151DB5F6AC933F56C584E76546BDA74584D60 BAD.BOYS.REPLY.(95)
242,985,359 *1799E1DC1E630C61D5524B605CF68BDC511AC5DC BARBARA-SYBERT
242,985,360 *179B296C7FEEEE31CD0EBEEE86730DEB601AB756 bb5lq
242,985,361 *179808AEA5F4B2B37632B1DE2C9DB7CDBCBA3114 BD?LT
242,985,362 *1799A768436E016A7B23CFD7ABA2A3FF7361DEC5 BELNIZA
242,985,363 *1794FB58A8B9912D6817994D305AAC3E53AEC2D2 BERT.SKIFFINGTON
242,985,364 *179E436F61BCA014C41466A907129EF94EE93532 b#gig
242,985,365 *1796EAA3B1B4D8EFADDFF6CEA309484ED21F74C0 BICQF
242,985,366 *179D8838B463516E7634152DE916EB680784E8CD BITKINE
242,985,367 *1792AD6C1E3E2124B373C6B8E49A5466EE992969 BmH
242,985,368 *179570587698DD4540A65F825373D0BBA8A566C6 boeah
242,985,369 *179389212E000AC7195E3F762AA018E9BFC3EFD4 BOWELLS
242,985,370 *17999481E048A4911B93E692B4A467C7B814E5BA B==p.~O.~o.)0(
242,985,371 *1796BBD5A67A488D61CB590B6A0CCD2C421818C7 BP"UB
242,985,372 *179943412130BB9E646385149FAD5EA0D9157790 b)qh
242,985,373 *1796EA69167B873795B75C2DAA4AF4EEA3CA71C4 BQTSL
242,985,374 *1791F2818BD98153F34E847F7062932F11308009 BRADLEY:反叛軍的載具,會發射飛彈。
242,985,375 *17950DA9B27BEA50814672F98D14D9E765379878 BRAJENDRA-RAJPUT
242,985,376 *179D42F2532B1D02BC52B3E239651524FED97E07 brandi.carrigan
242,985,377 *17903772A4E8412292B740DD94D7880C071B2015 BRATISLAVAPRAGUE
242,985,378 *17939BFB8F8B0DDECCA00756DED173602AA43200 BRAZIERS123
242,985,379 *179300466B7AC1B439ED428E8D5AFD3796665233 breaking
242,985,380 *17972281ADD5A7B43B4DE0AB939A3DB0F8551086 brettsarff
242,985,381 *179DCCAC798F634D101F6108F35584A059B37AD6 BRIAN-MINIARD
242,985,382 *179F8C1B23CDD92754732001CF1C69A1630F8A5A brj;m
242,985,383 *1798CD0FA47BF2FEC1FC26F86B1621ED705F44F5 BU(.A
242,985,384 *179BFD5D6816C0AA0E26DE82DE434D99054B8031 bunnybeebbs
242,985,385 *1791876015D4452485A1DC9DC59743C3141CD95E bunpx
242,985,386 *179DFC0A2743DF09C70B544454D295B05880D362 BVL$U
242,985,387 *1791B3ADE57C7DDE164B6563DCDE39A577B0B951 [email protected]
242,985,388 *179D21FF1266B11DE5584C0FDF2997ACC8F31F25 C0QYE
242,985,389 *1790AB92A07AED5324315948D48E8741ED67813C C5LFG
242,985,390 *17968844265F52E883816A1F06DC0A3D0315D690 CAMPO-DE-CONCENTRACION-DE-VERNET
242,985,391 *179A5B1ABD763A2AFB891D647577DFBAB3B0B5DD CANAHIMED
242,985,392 *1792CA440DFC202A98F1B495259AB5FD2449402B [email protected]
242,985,393 *179A1983FED46C18337B00673E9EF7DBB3999EED [email protected]
242,985,394 *1795ED4A89094B54F769B0C840928FF0AE23EEDC carmenplattsmier
242,985,395 *179E90832F6A96CA8E1897C09FE8FD458968F5BC @CARR
242,985,396 *17900BC5EA77E9D6375C678614A118D57FF8C662 CASERINIJOHN
242,985,397 *179A24AC474AB8B6A54682F73028B03F967F7A0E cattle.feeding
242,985,398 *1798428D7B9DBCD838CD751D3D3A4BDB858B85C8 cccfl
242,985,399 *17947D11B212DDF33DD0D79A1C5BA6BA48EBF80F CEDRICK.MCGRUE
242,985,400 *179D5CEFAEFE14BEE87811D0CC44554B9D49E8B3 centrirae
242,985,401 *1790CF6F245A318C67C2F078E3BB586C46C1CC43 CFES:
242,985,402 *1791F27B3AEA3F844734EBD9B9F05996C29CD7A8 CGBKS
242,985,403 *1797C481F42A81B7F030F03BCBC4B0DB14E68A0C chipogoro4
242,985,404 *17995F0A91F707D1BCFE5028564D0E784EC244A5 CHONBSW3
242,985,405 *17930E6E9DDD2BE37FEA4A9626B771504A0E350C CHP-!
242,985,406 *179DC7EE3B70F1EC85AC7D33186C6294DB74A647 [email protected]
242,985,407 *179426F97FC9D11D9447AFC3E86D33C2EA509E94 CIK12345
242,985,408 *179355D755BEFAA5C7AF628B132212A545FD5FBE CIX9N
242,985,409 *179B646F00398FF57991A499012B11ECC8C22491 CLAIREMOZART
242,985,410 *179AF2837AE4257155C17E72964AE62EE8C380EE CNAP7
242,985,411 *179C4BE507F60FA0E850C17FB021C185BBD10E17 CNQCU
242,985,412 *179B02BE19E43A348A86F4604B19F9A07D84380F colima1986
242,985,413 *1799007BA4C705664921DFC8840147B958034C2E CONCERTOINDMINOR,RV393-I.ALLEGRO
242,985,414 *1799AC661097E76AD9DD70E6910FD22E561FF3A3 CONCERTOINGMAJOR,WQ9H412:I.ALLEGRO(CADENZA:MIKL
242,985,415 *179FF1330BD2A19DED6CF84F447C046A8C74A097 confcooperative
242,985,416 *179FB8535001286F5B9DFB16A8105C91E4C3FDDE CONNIE.WILLMANN
242,985,417 *179A22C689D6680CDDBF136AA3A088349860A19D consortiumcontrolled
242,985,418 *179DA3966F87161EC3DDFF52AE2BBBA93C27077E CONTENGANO
242,985,419 *179D6CC49FCEE829AF01EB5F330B69C571CE95E3 COUNTRY-BOOT-SCOOTIN'-(DISC-6)
242,985,420 *17931F0AF9C0B4518757AFE4267138E817017477 cp-#a
242,985,421 *179E4DA350411A3020096DB3EEFACF8160FEA718 CREERESTI5
242,985,422 *179A4F4D305D3FD4B93CFAE2D11766C10C156814 CU%(N
242,985,423 *1796994C8158C6E3A1307A30A066D187748F156D CX$0
242,985,424 *1794DC1842E7FA48F5BB3252A02C76475010572E cy="
242,985,425 *179607BAA46BEDA8B2DB9FCD3239EABF5A1E8095 cza?5
242,985,426 *179D1860B947541FBFC119EC1EFE632D2ED16ECC CZ.DZ
242,985,427 *179F2F3D8C617919142C1EBCE0329294460154F6 D3II6
242,985,428 *1792B26FAC6811A894F281B7AD4ADB4303B8EF22 D7ERK
242,985,429 *1794B7A6277C644DE0DAB5451961127258CAAE48 D9%n
242,985,430 *179D8461BA935CCD7D37A0003B9AA29902994F49 dai-d
242,985,431 *17931FB1A0E70697D9BF73852BFAC3314D5661AD DAMION.SCHERMER
242,985,432 *17917D664B035E4B578550C3AA1F7640AF1CDE80 DANGERHEARTBREAKAHEAD
242,985,433 *1794B45E7E44BF7338BC11E9A7C2FA8EE04AD8E7 DANIELWOLF
242,985,434 *179BB5951827135D82DBA36425F57868261A7F0A DANNIEMORRE
242,985,435 *1796D0BC826C06B91BC654A50BF7A2578FF38AB9 D._AO
242,985,436 *179629CC96C17CAC4E8ECAD36482665AE54101DD DA:X
242,985,437 *17925122B242E4C71C4D2AE3E42B08287C174685 d!:c$
242,985,438 *17963FC2AB540761F3BB0775D350A95E6A3E0B3A dc$t
242,985,439 *179CA79ED4855A03831A5125BEA5B8D1C9C44D96 degeitērs
242,985,440 *179A0A3B29944B51EFE60417AD76A66D65209DA0 De.Kreuners
242,985,441 *179B3E589666A62BF8FB53568B77C62AA8ED1264 DENNIS033
242,985,442 *1798103F59140043B4ACB529DEEE02E2A17DA498 DERRICKCAPRARO
242,985,443 *179265D5EE66840DC9629F4952270B6136130445 detnals0
242,985,444 *179959BB81446D41B6631D659F9FED5D9F6E7D2C [email protected]
242,985,445 *179112A88E70B5E15534A940A3298A1D1BBFAC05 DISTANCE.IS.NEAR
242,985,446 *1795A0BCA80EDD1CFB9D9AC36D7419AC71BC3B99 distarono
242,985,447 *1790066F42872CEA201B9BBA32103A3FCE305EB5 DJSMALLZ
242,985,448 *1795A41FAA21E8401806851AE08BCFCC473A6546 DMCGARRETT
242,985,449 *17977B9E00466BA765ABB87427AD5581F3709710 dn2rx
242,985,450 *179DE984B335EF14CF5ABFA5792FC520D6B03600 dntd,
242,985,451 *179232063CCC9162DD9E6CCEFF2DADD40C0946AB doorloop (+ traditional)
242,985,452 *17977611D51E6A00064CC868322F7713FA52FE59 DOUGLASSSCHEDLER
242,985,453 *179F39368E080FE4913E983F882951006F67BEAF dpfio
242,985,454 *17960227AE31B43C2EB715C46FCFE31F7F39D251 dqw
242,985,455 *1790BB68053F15434E39268D4953625E9974841E DR.-ROB
242,985,456 *1790C5AA762D0E429E84FC61C23AB472609B2D3D [email protected]
242,985,457 *1794AC4DEC00519220BC0326C252393FD80151D7 duid
242,985,458 *179105A1C6382EAB44A07DC50FFD30C4B03221E3 dvcl#
242,985,459 *1797CD5D8EA7F201847EF7D52EEEAC30F24C9F2C DWHFP
242,985,460 *179122AEAB623BA4E701088E45BDC9CADD6733DC e'?_
242,985,461 *17904B1F58C72D46E370BC06A4C68894160650C2 ebu6
242,985,462 *17951D8A2D113C55A27E89DCF3E4F61A10DAA529 ec_sd
242,985,463 *179B7E91D9329AB9D8114C2104F0220350D78255 EDASH
242,985,464 *179DBFA9735F4EF52B117C10B6579AFDDF1D5B62 ED)RV
242,985,465 *1797C0CD3040E9656BBF5638474F1CDCAECAE5E1 EENSEENSES
242,985,466 *17976ECB51F1FA1378C0C474E92AFB937F384CAA [email protected]
242,985,467 *17922A3D9F5D977C6979B74F74D39F9EDE42832E ei&wo
242,985,468 *179EC3A4433ED49C1DE8DEEC690940055E055F89 EJEGES
242,985,469 *17963FF583BE30E39B48CDE3305C89BC6667BD79 ekirkslled
242,985,470 *1797C1848F99BE265ED8308042662C43D3537685 ELENA-ARISTIDOU
242,985,471 *179B6412D29B0474F73735D8ED2B326890251F1E ELISEOHALLIWELL
242,985,472 *1799F1CF97F768287D596D8BFF627DF7A6463A4C elishabookwalter
242,985,473 *179B7BBB01E6B12F4AD1465E271BC2EA68A696CB [email protected]
242,985,474 *179C16BF1F41D8C1D0A8345B5B3C029E40862240 EMANUEL70
242,985,475 *17922578950F1E133E9740CC1E54BB3C11325F30 EMANUEL.ORKWIS
242,985,476 *1794F528E5BCBB26CBA3C8D6DFEB9958D615D99B emettriez8
242,985,477 *179DD72348701127D027679243CDABEC5B87BB99 ENCODAGE?
242,985,478 *1799B5875E3E117FFFE76B063C1641EFC63EF209 EPHREM-BEYENE
242,985,479 *1793CA684DDACB53E6FD8B2E759ABC3668D7233A EQQ?C
242,985,480 *1792F931A0B30A61847C38ECBAF76AC82892C9AD ER&EF
242,985,481 *17945315AB505B0C2AA2889921C5C2BB4BB72F3C ernakulamkannur
242,985,482 *1798A98C9D8FE823C02429B73EBB71182B6AD5FA EROSSEFO9
242,985,483 *179058E2E3CB76AC66703642BDEC51A6E3883854 ESENSJO
242,985,484 *179D0250CC928BB69480C30D611DD555E559BAD5 ESTEBAN.ARNS
242,985,485 *1791E3CC9E989F048D058A36DD9C9B7152861EE9 EXALTERAY",SWWV9
242,985,486 *179DC6538825E5700C89841D05C483A1E5532156 exclusive-interview-jimmy-argu
242,985,487 *179A169D942DAEBD998398AD65BD333F9362B4F2 Eyes.That.Burn
242,985,488 *17930781B253A9257564421CF95961D6989668CF [email protected]
242,985,489 *17984D7A9A25F116EF94E018A37CB4BCA100A24E [email protected]
242,985,490 *17999F0BEE6226953A69C40B6F6E90119EDBC5CB [email protected]
242,985,491 *1795AF0040E63588B13B632CD1CD64B1F44053EF [email protected]
242,985,492 *179C29D45A23BEFFE07D3C4C673D8207DB7F9BCF [email protected]
242,985,493 *1797555A01BE91904DBE2AEBE5FF8038D52F710B farha-alvi
242,985,494 *1795153FF49EE90C64F721E471DC72E549E453AA farm-loan-bank
242,985,495 *179237B1C2F560AC4E010D96F1528F983AD2462D FAUSTOHANSCHE
242,985,496 *17970A0C029089E6011D230A04967CC6C4696ADA fechores
242,985,497 *179806C6768C81D44FB8E65D5999342ED1573056 FIGSHELL0
242,985,498 *17932671158AF72EC5BB64E4F17686EBE73CF377 FLUSHERM4N
242,985,499 *17953E179124036EF1CC4363E1DD225A16FD3021 [email protected]
242,985,500 *179DA329CF592781058E90D3332F38103B570472 FORRESTMAROZZI
242,985,501 *1790C022FA2CEF6818B2ED1A5B9974946CF79CD3 fotballspillet
242,985,502 *179E4DFA5E748629A794C60E998155D8BAC4C0F4 FRANKIEGERMAN
242,985,503 *179BE627E4AE63295AEFC528F1E3D5945B2EFA0F FRG
242,985,504 *1792BD9682F76D747B883F7E38FC0FD9488B05C2 FRUSTRERAI
242,985,505 *179228B9FECE302FA06BDA08652FDB61C6FB2308 GABRIEL.KIRCHMEIER
242,985,506 *179FECBF8ADB194620472F282E0E3846BC4F8FC2 GALERIA.NOCTURNA
242,985,507 *1799DDB2B10DA4FD629E29D16CAE5BCE37F20B3B garretchieffo
242,985,508 *1799A7C4C04727B3DA777F1065B0FCB80462AB0C GASHOUSE0
242,985,509 *179308C389DC624BA926AE8581A33ABA85AEE1B5 GDN6NWDM
242,985,510 *179874E089E8DA0618E16B1083784F64DB0AB27D GEOFFREY.LUPER
242,985,511 *179256A7BB3CBE1EA85796D57A9A9048F19E0C64 GERARDO.KLIMEK
242,985,512 *1799CEDBC25362FAFBD5DD188F3AB9BB6F618575 [email protected]
242,985,513 *179C8B8868DE45540CD4E8C0D889DE45E4552E6B GHENG
242,985,514 *179A18A8D0185979FEA871CABB1BEE00B4FA7EC9 giordanobruno
242,985,515 *1791BC90153D8EC9947992198137E34DCB7803DE GK_F
242,985,516 *179A29F129AEC694CEE2912856328D8EB6CAECC9 GOOGLETRANSLATELAPRENSA080810
242,985,517 *179763B021E9CCBD12C21998051D877CE23BF52B GORDON.LOSTRACCO
242,985,518 *179139C6EA399BAF676DB1561E29324FEFA13C11 GOUVERNEMENTSDIENST3
242,985,519 *17918007C1BD6DB30C156067619601EE1C127670 GRANODIO6
242,985,520 *17984FD45C9DDCB2FF5A7B99F5F492BA535B3BAE GRANVILLESUPRENANT
242,985,521 *17949251C46246CE3CF376AA9716EC5EF50742E8 GRECO98
242,985,522 *17901116DFB3CF0A92CED485D6B81740531BBE80 GROOVE SCIENCE
242,985,523 *179948C010452ABDF0F7937F9A5683C5A5A66F8C GROUPOID4
242,985,524 *1797586E92705250FD404E46970D54FDAF06A2E9 hallptthore
242,985,525 *17964F870F2DB7EB70376CCDA5A34F4D217377A2 hankarakaki
242,985,526 *17984357E8AF1D1554961B61A18D78644EBBDC85 HANSSWAGER
242,985,527 *1798761842235260B434CBE9DFF87358CC93483D hantonsing
242,985,528 *1791233F1D4116259F379E5AF364F47D37AB3426 HAYDEN.ALBANI
242,985,529 *17930C8A44C21EB99808E1BF51071CDFC0E1533F HCNARBNU4
242,985,530 *1792134241256B418D0883A663C88498C9571933 HEATLESS
242,985,531 *179DE6AF9BB5756619F890ECDD5CC2D79294D59B [email protected]
242,985,532 *1792000AD8AC8BF69A3ECA471A70896397A08E04 HE.IS.AT.MILFORDHAVEN:.READ,.AND.TELL.ME
242,985,533 *179E109038FF6107553F5C2BBE59BB0BAC949410 hinterholzacht-(disc-1)
242,985,534 *1798B6B7B5A77D0DF84C39164D8950D2F246EE28 [email protected]
242,985,535 *1790999E1C082FF00BB6F66912A4F972152F0FB3 HMF
242,985,536 *179669D8E1132FB7FAA505FD5725488191A5BA87 HONGIKEDA
242,985,537 *17998406FD54418040E867E193A0A90A53AED794 HOORNBLO6
242,985,538 *179E234BCB8868FDE9D77C4BE142F1A192823187 [email protected]
242,985,539 *179CB76AD949D3E5F617B18E668D264C9078826E HTMLLE
242,985,540 *179B410471535C6627E97B8AA1A7C6C0D87136AB [email protected]
242,985,541 *17933D06018CCB032127F29DD847616A38450FAF [email protected]
242,985,542 *1798E59B9E763B37B6887BA1154B09F15B147FAA HUMBERTOCRAW
242,985,543 *179270A87F90331A260E3A4E730CB8756EF1D91E HUMOR.462
242,985,544 *179EFCD79E68F4B10B0CABD4F34B6CE3EACA6B33 huusewih
242,985,545 *179DA15DC35163BCA7C3AD0BC557EFBAA523EB9E IDUSSP1831220070315
242,985,546 *179FAC1F9EB1AC778683EE27C5B1A8C63E5EBA14 [email protected]
242,985,547 *179213669B352886D487D208E3695F146878957D iknoweverybody
242,985,548 *179933B5CAE61D0DE29FD1471B20023FFF779F6E IMMER-BIS-ZUM-SIEG-(1985---2005)
242,985,549 *1798C859A8CCC5EB1F062B7AFA39DC5B7DA85745 înamoraţi
242,985,550 *1798E4E945082C9CAC73887264D8D91C9D1A6CE8 iopfmwf4
242,985,551 *179B39216CBB97987D2A564ECCE67BF5EF0F1AD7 IpanemaFM15anos-As15mais
242,985,552 *179337195AF65D306D07981720EB8E361704E9E5 irvinlorello
242,985,553 *179186C8328ECB407F1C722658E8DA893E1D7385 isidrobialecki
242,985,554 *1799CD2BDA384ACA3DF37DD826684E89C637820D IsleofFourWindsReprise(instrumentalBGM)
242,985,555 *179797FBAC444D516EB0BB1F276CA879FCE7BDD4 IZU:
242,985,556 *179FB04C023AF1357BE119C797C136B80981F83A JAMAALFOUQUET
242,985,557 *1799401715F10DDF44A52CF35BEE274CE7A44091 JAMIEBOGGAN
242,985,558 *1798C9121EB3CA59825B532FEAD0F8AAFE99D653 JAMIESU
242,985,559 *1795E4F9C88D75FA3C15F96B34876C43F5391969 jamison427
242,985,560 *17906F2C3A672EA4DBC5CDC32F2AA7C895DBCFE3 JAN.TATE
242,985,561 *179627DD357ADF4AEC1C30CB834A813C891D8601 jay.pritchard
242,985,562 *1794761F8B07F21C6599D07F45C9B75568A038CB JEANGARGIS
242,985,563 *17975A6071900F04B15A4829E2C20AE838F131AA jeffreyjorinscay
242,985,564 *179E73D1F02DDDF27151F795C2B890B90ED69F6D [email protected]
242,985,565 *17909402F508EB46182511EE09B8ABF6AFC29B59 jewelhendryx
242,985,566 *179CAB5A92F9767A653530DF6A4DBC4C4F88EC3B JHQX
242,985,567 *1795E5DD8722DA30CC55B6DE6692FA045B710D24 [email protected]
242,985,568 *17942FFEA1D9EC01D399A0470317FDB288783E9C JLVLYBUR73
242,985,569 *179880F40B5E8AFD9E5EC144C3CB6426DC7FEBA7 jokingpreceding
242,985,570 *179F15FC9EBB0F88C51CA007397EEE431DF7B3D6 JON SAYLOR
242,985,571 *179C0A60DBD29F92C910EBEEFE3C102D8C820D50 JORDONCHIPREAN
242,985,572 *17918F1480F96A2F038FEFDE75970775887AEEAD josef.strauss./.rondini.d'austria
242,985,573 *179A4FAB67D4968EEA1C318D81CF021A55109ECE josy0
242,985,574 *179624960B59406FFD889CCCD3D8D6D4B9F8C239 JUNIOR.LAKE
242,985,575 *1792CEB36EF62A2994B04C32C2FC1BA29D240F11 JUNITAHENAO
242,985,576 *17952F7B2E5577625D73542DDB0A7A52CEC8476C Just Listen
242,985,577 *179E3D8AFD63B95702D2E4B10DA8D68A428D97A3 [email protected]
242,985,578 *1798B76E076BB70413096A40DCB108A9023E550D KAREEM.CHEREP
242,985,579 *179E3135DB7AD97EF652089BB2E9046745BF0E84 Keep-this-remembrance-for-thy-Julia's-sake.
242,985,580 *179BDD89C2D6F5DB52E016F1B8BB12E13CD9D490 KERI.LEHTONEN
242,985,581 *179CA64748D644A71F070DD41744E837E892F364 KEWL12
242,985,582 *1794150D7068BDF4F694F0009851F56A50E106CC KH-Z
242,985,583 *1798BC215F1D3A61F9679485BB15BD225F47F6E5 KITTYSLICKER
242,985,584 *179CC67FE515A1230D2FD2482CB50ED823FD9DE3 [email protected]
242,985,585 *179C1D5A00C7E4BC4BECD95276ABE7E70027FC13 [email protected]
242,985,586 *179B8465F96C6849BE7C38914E2B71795912538F KOLRTV
242,985,587 *1794AAC30DED469611998102FE8BD09BCFE4669F [email protected]
242,985,588 *179EF6D06ED75C16F798CCB33D0C475E4FB64040 [email protected]
242,985,589 *17983D91737F2FA86EEE9A12FE723D8AC43E02EC KONSTFILM
242,985,590 *179E40E1405640E569E698D955E9DCAB73237195 kunapareddy
242,985,591 *179B0230B27EF872E3C4DE0411EF29C53E0FDAB1 KXQK
242,985,592 *179E1AB83E5EED5A4283384E857C0DA1CAFC88EC lacey478
242,985,593 *1794572F6B727619055BF6AE5DCFD187AD8D466C LA-MORT-DE-TRISTAN
242,985,594 *179BBC89659351C128DF7A8704A233382F85E80E [email protected]
242,985,595 *1795EEA2B2C41D155B76C049AA22E7FA7FA6F1C3 LASSISAB
242,985,596 *1799BE5A27B40C6060E359D7C4A0674D50DD95E3 lazrej
242,985,597 *17901C8310E11FB49D78DC0011E4514A9D85487E LEE.STEIGERWALD
242,985,598 *17970873D750ECF5E8E632C07486A8244B6F6E9B [email protected]
242,985,599 *17970B76DC0437E17A123DB6CCD67F5DC28C614C LESLEYSHURMAN
242,985,600 *179A94135BE6AEE0BAB69DE975294EB3DD3AB4ED LESODUCH
242,985,601 *17948D0B5C2ABF8C16EF314CB27356DDA8F70A48 leucosyrinx-canyonensis
242,985,602 *1792C8B3B7A5352EF25769A29DAE925060D13548 [email protected]
242,985,603 *179A9CD992FBB13E2F6EC00702AD1292CFD6C4F8 light-waved l/ai/t_w/ei/vd
242,985,604 *179A843414BC08A6184811D301E538AE638948D3 [email protected]
242,985,605 *179661881BF9C70D0815D8F128CF549076654BA5 limnimetric
242,985,606 *179C02CA36561F5E73CE6D8C46C7078ECA875BD8 «linee
242,985,607 *179796A0BC95E42D29B10DD777C0C8423B3A7948 LLOYD.ROMRIELL
242,985,608 *179E9D2EA5C532D2B0E82539787A6010FC341633 [email protected]
242,985,609 *1792122A5C051685B0A81160AD971941E26BB3BF LMMHOME
242,985,610 *179877D3E00A60A40F9427D78F97738AA7141B3D LONGHOODFORWARD
242,985,611 *1790004E5BA245517395B61C308D0879B2635AC3 LONNYPETROSKY
242,985,612 *1797A9E08062CD2BCBCF31D90FC4250CC247C685 LOST INSIDE A SONG
242,985,613 *179E6F0498F189003C804509C54CE54CDCF4239C love_drama
242,985,614 *1797FFE1D83D9B73D368AB85CFD233AFAA277004 luciusrazinger
242,985,615 *179B213F540FC83BC9F0AD18B5FA8280910DBF29 [email protected]
242,985,616 *1795F11CD300B4ABECBE2CA20F5BB322E727DE0F [email protected]
242,985,617 *17911F318511A86B196AB07AC5AD15BDA72F365F LVNGSTON
242,985,618 *1792F4367E4F87EA893DD16E1CC86B136C5EB602 [email protected]
242,985,619 *17951B839CE9831265328959BA2E3AF4F1762515 make-me-feel-alright
242,985,620 *1791FBD2E24AC0183837894036EF3D949098C817 MALCOMHARMEN
242,985,621 *179F21C9D990E9BE38895D522900D8A26416A893 MALCOM.LISTI
242,985,622 *1798E8D8F2451886A4C637E19DD3B4B18F339B69 malikpetrucelli
242,985,623 *179385A8013293804A5F8C6619111860A08BD46B MANJUILA
242,985,624 *1792F5547751623287D80C7FD59A8F7AA4F5BD04 [email protected]
242,985,625 *1799168D20B344A05369471DDAC4B0BBF0F61AA0 MARCELMARRO
242,985,626 *17923F6A973A065BD616116AAA36BEC7EFEF385E MARCELOSORUM
242,985,627 *179A1078D96CA39D565BFA2712096572DC3C28FF marcojalbert
242,985,628 *1799841233C78EAE703112C2C3D0131AAB393F47 MARCOSHEFTE
242,985,629 *179705641A787D3E6998F78A6C45D9C4BFEDF4A7 MARGARITODELLAVALLE
242,985,630 *1793A83667D1C5DAA07CF2398BDEB027AB4F60B1 MARIAM.ADHAM
242,985,631 *179607ACA51902694BF299D57C335171F3570580 MARIE-VELASQUEZ
242,985,632 *17977607D5D5B8806EF0B591FB14B090FB6B8E98 marknads
242,985,633 *179DEAA65C680B459A98E135C23B0C348A18E2DB marlingreth
242,985,634 *179892E8C0D5520AF3F6C8A3355E854751E6D1EA MARSHALLSALADINO
242,985,635 *1792705E4788E4B2172D731A4085E15A93A42448 martinkristy
242,985,636 *17980A3520B1C3E07D4E7C162EE125FC95FC53CE [email protected]
242,985,637 *1798C6A45A92FB4576C58CAB806162E24F0CB076 MATUESHI5
242,985,638 *1796B61AA7ED85B17F178A05EFBB8DDD36CF8301 MAXMALES
242,985,639 *17957B52D2B2E0E339CDDA447B3D66A7680ED1A1 mckinleyloeper
242,985,640 *179FDCEECB32AE613ED9BF8ECF30A8B2198F75B0 MEKANIKK6
242,985,641 *1798EC5B3DF00E14E593E8DD2599D4AD8FE93D19 MEL.WAGGETT
242,985,642 *17935D0A662BECE6BB7515C0B3CD4D5BE3DE1384 MERLINSTRUZIK
242,985,643 *17917C38D8A252DF3A5F1B2C1F85FC494520F0BD METRALGI5
242,985,644 *179E5E31E04349D50613223327AE9AE32A5E0C9E MICHEAL.RYKARD
242,985,645 *1795D2C09CFF136C6671E486FC9459C0C3CE0281 MICHEL NAYFEH
242,985,646 *179D619E6CF99C305F29BB79F94CDE09AAC74E1E MIKELMESKER
242,985,647 *179796E2A814F5ECC74A6FFE2CBBF6F8B88514C3 MILESJAYE
242,985,648 *17916AE6612355BDA72A33F1C9EB25BD58F86A8B MINH.HYPPOLITE
242,985,649 *179463FD9E1082F70A64895F6F2AE0027D7F6302 MINIMULOJ
242,985,650 *179F4ABBC285E4D4D73B1BBAEB22AB662B34C3FA MISSIONDEPECHE
242,985,651 *179B7B439849E84806E2A3FD4B54A434176D221C MOHAMED.MATEJEK
242,985,652 *17969C8606D442BDE92CD39029049DC2C139EFB5 MONTYPOLLOCK
242,985,653 *1795C692B40B7500D275098027A7FC97B4B2FC69 monumeti146
242,985,654 *1791195A46A75EF5F06A92CF4970355FC94D0E3D muchincluding
242,985,655 *17966BAB9B6A0C878E55E442B3A74F9B774ED4AA MUFFLER-BURN
242,985,656 *1799EE9BB1DBF7AA917D04988E5F2BCE151F3BBF mukaishogentadakatsu
242,985,657 *1798599EC2A834D27D8140429CB9F898D91E39D1 MURPHYS-HAYSTACKS
242,985,658 *1793A16CE9D05CBF6E3AAF835AA35432F01B4443 MYMILLER777
242,985,659 *1799F0EEDCFB73D85A801F6D7DEB57512A808164 NAILA BIBI
242,985,660 *179A90CADB27E7BBE88CD2D4159D0629A497FB8D najaders4
242,985,661 *179ED273F2E248C5F1B9FC7E1FEFF8CF1E4C10B7 nate.wilber
242,985,662 *1794F0971067245151D7D1A9CD326B5C88911BFE NAUHCEUQ0
242,985,663 *179D3C6D8A96C769D828DD63D3F38159D7278E75 NGO87EA
242,985,664 *179803CED6195708F46BEE2DE88753835506C593 NN*?
242,985,665 *17924C08DACE1A609A987006C8B7F5200AC61970 NNGAMMELBENK
242,985,666 *1792D3569DAFE9CA65E4BFC36A196D15504B8EAE NOEL.SLIM
242,985,667 *179B9A7B51808E4540C9A63067EFC6D537C2EB16 nontolled
242,985,668 *17984F9AFF1288A24E647A8F7AF65BA74FAB1759 NOTABIEOSEIGNEUR
242,985,669 *179E2B78E292CA7AB2AB8EB0B8E1DCA0738C08E2 novait7
242,985,670 *1797ED8A83FEF266F0EFF56AFADC1E9D2B1CFDAD ODAROMOC4
242,985,671 *179E0366BDA3807B8DBE64E1B4353A50FFDA862A offring
242,985,672 *17900C49A57FADD92329A2C9336C50B7CA499127 OLOOWYCLIFFE
242,985,673 *17919DA5CFA7C312B8D5717663A550A1C28BABCF OLOUPAME1
242,985,674 *179EC4B2C103465A366A509C29F8CB6487B7DF96 ORENSUTOR
242,985,675 *179BE33F167573301FA8B165FCF241EE019CDADC oticsuir
242,985,676 *17946E895C617E22E6D043E4AABC1B96EED9E14A p###@~0><
242,985,677 *17907726EAB46E28C4220357E3A24170F3DB4BD8 p####) ~0~o(O_)
242,985,678 *179EDF8C0F26886418F517B928CBAA4C1C3803E6 P#####) ~0 ~O SPLAT
242,985,679 *1797AC90A0A004F10ED59F80132BD8DCB425C63D PANDITA86
242,985,680 *179C6C7259A6250C9016816D4494554F259B54CF papirlst5
242,985,681 *179CBEC384E09B31C06A98BC2B046DAC3602C573 PAUL.BAHRY
242,985,682 *179DB8D6CA6A1F3D510DE048C16927D8C2261E23 paulbreidenbaugh
242,985,683 *179A75E92BEAA4EB523EB64150EBD91D90EC983B PEARLWINTER
242,985,684 *1793016A2233F632D434D6F95FE0D47DFFCC57CA pedrozarrabi
242,985,685 *179DBBD40017F6A32620B73BBDCD489DB0BB7BCA peggy.kho
242,985,686 *17904F095A92A480BA60E24BB15F6A359CEFA9AC peterfgh3
242,985,687 *1798B9D768516C9D74822EB61904E407852C4674 PHILLIP.MCREA
242,985,688 *179D9965294C810B1575FCA2A556B8B8F6D2217C phylltxc0
242,985,689 *179CFD062A365E08E428EBD4C74D7E28B5650A0D pilscsaba
242,985,690 *1799BCB4423652B584EE59D93E2D4BE866CE9E08 plectranthusbarrelieri
242,985,691 *1796DF4AEE9DA1AF16CFCF502EEC4D8E292CD621 PLUSモード」のみ登場する機体とパイロット
242,985,692 *17907251C5A0E64132B12DF1E065A3F1F2428B42 Pom
242,985,693 *179FC147C54BBD881D78DB9148CAB6AFCA8E3303 POSTREDEMPTION?
242,985,694 *17922007C9319815832217034AEFCB66E8F89FEC pqd*
242,985,695 *179E8F3BC61F37BCF24B43949E7FC592339B8B87 pr3h3$ita
242,985,696 *179841FFE21D1C91AC2624CACE916E84903D9570 predesignatorying
242,985,697 *1795B7191514F6291658E34B52D5EC383BAF10DE princekindred
242,985,698 *179DD3FACD04BFB2883E2F8A78D076770F6241DB PRINCESSGURL124
242,985,699 *179BCA551CCC75433FE43215C1C96F1BAE3552A8 PROJECTEVA01
242,985,700 *179FF07172B5AA94114D39580DDDD1E078D50A50 pschmmln7
242,985,701 *179118E012C20F462C444A74EFCA3A5E5246D122 ptispec
242,985,702 *17981BDE308682DAB69769FAD20BCF3E65AF316A [email protected]
242,985,703 *1795D65DED6E9B18641D2B350DEF74322DAB098B [email protected]
242,985,704 *179A2562048F96B8A6644DD81D49CB2E9A78DB78 q=>-~-`)o(
242,985,705 *1792A80AA6C184B2ABF98733A7057B2B71A8D726 [email protected]
242,985,706 *179309482EB37D40745F97746CA396C1D3390549 QSEFTHU401
242,985,707 *179D9E3075004B3372F907E51B07BE54A99AAF93 [email protected]
242,985,708 *179964EDF5DA6BF8906E39F49B186A5E0D0EA1B8 quincyvanderloo
242,985,709 *179BBA422CFEDC2A63633CB22B055DCAB31FA545 QWE2W2
242,985,710 *1797C0334B03991975779A3475621020A472A201 [email protected]
242,985,711 *1797B0D5B623B65AE4EE9BAA282D50F5FB51D62F r0y4l1$+
242,985,712 *1792CA13DD93F532F15B61F70365D640E4BD2FED rachel-maye
242,985,713 *1798EBEF82A257B45675AF9BE4519CC71D776B97 raekelboom
242,985,714 *1799F2F21DB405EA5B097F2CC5BD1AA38BA88D6A raleighcapello
242,985,715 *1793D5C936E660241F33187F34B00847573EC76B randybermejo
242,985,716 *1792A008F0E304E91941134EA3BBDC24FF4A9C83 RAPID098
242,985,717 *179A216A1D8F5BBDE4A9B414CA6DABC0443DFAA6 RAUFMICHVERTRAUEMIR
242,985,718 *179973894842D561D597C87913828BA2A2F93FE7 RAYMOND.RIGHTMYER
242,985,719 *1791E5302D7CEDF4B8E295D5958FF516C99FD76E R-CEMBALO-NO-12-IN-A-DUR,-HOB-XVI:12:-II-MENUET
242,985,720 *1791AD4B1C81842AF733B5ABF5D488FA7898CBE3 RDWESENS3
242,985,721 *179E42154DCB811AC42C53279BF13728605AB937 RedforFire+BlackforDeath
242,985,722 *1795DE7CB0A9FAFB87982750E342B4D0168F5B9E REGALAMELASILLADONDETEESPER
242,985,723 *179BAD9E370C538EF323EB21C8CA73B0A68A46D5 reginaldrugh
242,985,724 *179EC089F5605F94A83BCA43E34DFF4A0D1A1CBE REKLAMS2
242,985,725 *17989F1BB33C765B0A7644CFA34F34E96F55A22F reptitious
242,985,726 *17951AA81ACE60EF58E145A58CD2BBAB5C171583 REX.JESSEE
242,985,727 *179055303593F2F95BD704212CE7A5F8758A86F6 RIGO MTZ
242,985,728 *179CEAB17442A9AB569955AFCF7D6198AADEC32D RLDSHUSET
242,985,729 *179FBC0D0E05BFA2A7F1DFCA7F7E5F8FDC7696C2 ROBINJERRY9
242,985,730 *17921D20633E5E1D4FE512FFB2A1EFBAF736875D ROCKEXOTICA
242,985,731 *179A8A9958228ECBEABA3DD7D509C2D39394B398 ROCKY.PINCKLEY
242,985,732 *179706039BAF818B0861373683E11EFABB2412FA RODMCDUFF
242,985,733 *179383BF2F9DB4B70B6DB248CDD4E69A53085195 [email protected]
242,985,734 *179DC357E9D3527BA39E6C76D9E20954BFA3AFF4 RONALDBONER
242,985,735 *17915B3BD360E0DB967F70B1AEF498D517EF5A8F rory.will
242,985,736 *179544F7E635FAB124F2692DA51988EEC194161D [email protected]
242,985,737 *179DA8E04BAC639BDC33FF3413C382DD7CF41AF1 ROSS.WILLSON
242,985,738 *179178A98B80BA3BA345C049D809A23547D42D23 ROY.BISCARI
242,985,739 *179305811BFE614F58F103A4109F416BA7B98A44 RRKNGLRN
242,985,740 *1792232DAA7C84F4B7B23CC6755C05C135B09B0A RTHLSSLY6
242,985,741 *17942A8FFB633B1024C20B3CCDCD5D1C998E7F44 rudolfsickinger
242,985,742 *17925E0B9EA3B0012BF15626C04573915E9333B9 rustyhorvat
242,985,743 *1793C12D79006ABBCDA21ED6DF5FB629EADCAEFC rwkk
242,985,744 *179DC1E4F56DA07C88C3625C01CE1ED339FC97DE SABERLIKE
242,985,745 *17921597204BF2FAD9771CE0AA0709BC8702FC33 SAMUAL.GALLENTINE
242,985,746 *179F89871FF110E69F1919BF84DD5A974021410E SANGSRGY3
242,985,747 *1792102B7F97E0E5A8A26BCD98D61D7725DB749B santonax9
242,985,748 *179FD884D15638B4A322B0D8CD462D58195068A5 SASSAFRAS.GAP
242,985,749 *179A007E90D7770F73260606CD77CEE1E1E768FA SAUL.MANOCCHIO
242,985,750 *179F41A505D3668DA911524A0DC14CCC33D733F6 SAYIT'SALRIGHT(FEAT.GEORGE)
242,985,751 *179B65DF76B80E5F9FCC2FFABED0281820561C87 SCOOTER1COUGAR
242,985,752 *179CAB0FBF340A439569D5E81863FC6AFC5D7B9A seeyourwayclear
242,985,753 *1797F0A534E3CF9CB0DB5DA6F10353BAE11839E7 SERIESGHOSTEXORCIST
242,985,754 *1798E52BB361A77F7DB1DE23CA3C7C91630D3B53 SESSALUC5
242,985,755 *179814F2CBB3A0A608483B2418CB274655B6FA6B seuodamaed
242,985,756 *17915418B4C2A891C6F513DA34567B67AF8CA1A1 shamini-shanmugam
242,985,757 *1797E992202E00D1A4B7E7C5210F3EC14177791F SHANNON.HYATT
242,985,758 *17934380AC8946FB3EBC307F3DD688C9A76DB220 SHARONJASMINS
242,985,759 *17915255605A4F9A12F5B81D553FE4F31AD83267 sharpbacked /s//a/rp_b/&/kt
242,985,760 *179FA9D5178FBB23A41E26268FCE80CD2D54CC78 SHAUNKETTLER
242,985,761 *179581D1D649C76B29D26B66B70E022E1EE23E4C shawnmullendore
242,985,762 *1796619969D4735A57A6DEA6D425CB2ABFC25B7E shinealight
242,985,763 *1793D0A4898740CA6D75331B28FBD7509341F91F SIGAFE
242,985,764 *17918A2220F5A122119602E7087894C4EC208BB3 skibbykrøniken
242,985,765 *1791EC217F9DE3A0E5219E973FCA3633239965C9 slipup
242,985,766 *179FCA1F05F088BC230EF46EEDCFF5614F814606 SNAPPES2
242,985,767 *179D4C420C31E57D7275DA466BEA8245EFDCCCE7 SNOOPDOGDARREN7
242,985,768 *179D337DC91ABF9749A481ABF0D2AE1942E7140F [email protected]
242,985,769 *179CAB28F65AA502B4D252D031B606959829A3C3 SOPXERUS5
242,985,770 *1796C41FDB23ABB150AD80AEA605FCE54FBA06EA SOULHEALTH?
242,985,771 *179AF6518E67057AA70FEC0B6239383F9354ACAD SPADHANI
242,985,772 *17914D32B2621DC594CE2FE639C0C79E2F1EC5BA SPANISHMOSS"ASOUNDPORTRAIT":SAVANNAHTHESERENE
242,985,773 *1791F870F873FEB960AE4724945105104F443A5E SPECIAL_EQ
242,985,774 *179ADAC0DA167905566ABED3C0C94AD68AE5B93F SPEEDORAIDER9
242,985,775 *1796DF14F7A894EC7F645AB33FE156B21D5EF6BF SPELLINGGAMEBSW
242,985,776 *1790FF2CAE3C677B42F9605B12842FD3EE5EBD33 SPLATO~0~.DP
242,985,777 *1792D3D44CD994A5A29387633607B204E66A11E3 SSECHEES.
242,985,778 *179153C2D6472955A43E9F28A72DA5FC04CA9283 stadsale7
242,985,779 *1798A9915D9561FC0356A206D9FD39FE88DEB0FE STARWARSFUCKYOU
242,985,780 *179B120B3AD11BBBB70214538AF94A921AEE67A5 STORMYING8
242,985,781 *1791DCC85697B4CFFCBEF4FC5D81DAD3759ADB1E SUBAWAM
242,985,782 *179CCF13A27DF93D976BECEDA1B59772A66A57B6 SUCCONTRARIUS7
242,985,783 *17967E29AFE386F30A7836A024B116F2BC23BFC2 SUMBUL-QURESHI
242,985,784 *17904A0A70E6AFF1506FBCBA77FA727CE39B0136 SUMIKOLAH
242,985,785 *17934C2E84D7B6F760BF05F1251804AFA4F6367F )、『ぷよぷよSUN』(
242,985,786 *1794CB55B4A63A206C1C92423137D9976E93D4AE SVF9LIFT
242,985,787 *1797BCB43B74D22CB8E5C76C0ACE63D5D748CBB6 SW34T3R3S
242,985,788 *1794BEE775981A5A3EED799C47FBEE3D7F531BC7 TALLENT-RUNNELS
242,985,789 *179473C17319B5F697FCFDD18215EB2169D46D65 tam.key
242,985,790 *1795E2468D560BC9B99A300689071E6FF406C774 [email protected]
242,985,791 *179B2920EC0E2EDE9023DD5E1EB5DCC74D06005A tanisha-rigsby
242,985,792 *179A2F503B0910B3C80ED625DB61B53C326EAD9F TCANZORGNZWWW
242,985,793 *179A9D97C534D31BFB9F46318C805737C999FD07 TECHNO:VOLTAGE
242,985,794 *1794DC60C67DCD3B0C5DB7ACB3B79D02449B65B1 TERRENCESEANGER
242,985,795 *179BE1BF0F037770C5001330C655F349D78265E9 TERRITORIAUXMAXIMUM
242,985,796 *17995FCEE56A65B02DC90F256FFB3250868BFFBC THATPAULINE666
242,985,797 *179B55C524C7133E249D2A80716E012B5FA41FFB THEALLSTATE2
242,985,798 *179590C10033992D85CF541723ABB7E84224B509 THEALLTIMEGREATESTHITS(DISC3)
242,985,799 *179289B0BF0824CF0E595B10992A8ECF25ECAA33 THECOURIER48
242,985,800 *17946A938EA262752968F0B75AC7A73B66C276BF THEFILMMAKERS(AKAIS6000CELLSCOREMIX)
242,985,801 *179DC4C7C41165515E4BAA7D075EB3AB3EEA3CE1 THEO.CIARDULLO
242,985,802 *1797C9B99BCC8C7F0422934F38AC8B1BF915604A THOMAS.BOCH
242,985,803 *17993F402AFF20CD102403C44FEA0F5C7CEB6422 tian-hua
242,985,804 *17991E45F6D018BE7992D86C6C6E680D025AD1C0 TIMVOGRIN
242,985,805 *179A09DF688F4A49572EA65F0CA78F3510681073 TINOCASI9
242,985,806 *1790592CD8FCAB91C19E197CA1808C5B1EFAD6FB TIRMA4
242,985,807 *179CD765B1C264A7D45825224F6F2EAE5D4F14A3 TITARINA4
242,985,808 *179BFBDD207F17D0A182E8A79898DE81A384F04E tobiasmcdilda
242,985,809 *1797D37FAC2AF87C2AB4503FEF888A11E835C345 todmunnerlyn
242,985,810 *1794701EC63B8DB99773EA0C34657CA4F84CAE5F TOMYXAVIER
242,985,811 *17931EB8C0A36C6BC298D3A94F263DCF8CCD25C3 TOOFGIBADNOHR
242,985,812 *179B541C3508AE4D63E566DAF3F9255F91D48B2D tracynieckokennel
242,985,813 *179805F784AFB85C5E907FA0F4C6794CF03E4D24 TRANGE LUMI
242,985,814 *179BB0C0F980485BD2097E7C5F990DA016BCAF50 tre.chavira
242,985,815 *1791F0F78067354589A10FC998B5EC1FD617FC2B TREE-KASPER
242,985,816 *179F709B5165D46E12CA4D111AC3E3DBE84CA361 tremery
242,985,817 *1797F814CACFD143462143CB5492F02C03B8F603 tressa.evenson
242,985,818 *179D67DD7C60B6993FE89228E8CD4CE9B524BCE0 TRININGSIH HERLINAWATI
242,985,819 *179280565824E51C8B45458154C85C1EF45A152C trkstng5
242,985,820 *1792B626845FDCC924B0B82618FDDC13C09223B6 trrnnss5
242,985,821 *179A20CE70CC5DE50F6812457AF0F916F92AB303 TUFTED-EARED
242,985,822 *1799CE2EA3E0210BE77040F425A3F782DFFB8CDB TYPESSEPYT
242,985,823 *17904D85F6BAA811D139D972E242E5A5AEC51472 TYRONE.CASSINO
242,985,824 *179AAA996505AAC7A615D0E3700EA5F183D57921 tyshaynukahtillman
242,985,825 *1796432023108583FD43883FD160EECE262C9E1B TYVIAN.JACKSON
242,985,826 *1792636F63AD44C219D217F4AF578F761E895458 TZÚTUJIL
242,985,827 *179670D9FCD5019246B0D15A2F01CECBBE90BD6E U291064
242,985,828 *17991AFAB10206C2E804549764BF0E29B2C5FDE2 [email protected]
242,985,829 *179992A22266EBA45EFB38FD86D9A2432BB2CC74 UN3$7H37IC
242,985,830 *17981CCA96086BFE46153E5EB51ECEDF7C57DE45 UPONROSALIND2
242,985,831 *1796FF4EFCF1F8CD1869A832EB9DB0C205D33D48 URAYNURU7
242,985,832 *179DDC134B44642C8CCDC46550CFF8DB9AE02637 usman-thohir
242,985,833 *1790DDFA2CFFB49D43ADD509C8E2D41CE31FB7AA USP
242,985,834 *179D966A16558D8B4C222B29C0A603C907367022 VALERIE-BEASLEY-PATTERSON
242,985,835 *179CA476C658BDC9199AECF44CB8725B90546C9C vanillemichelleambiente
242,985,836 *1796299B6101E4BAA74EE64587370806EB6A7656 VANJOABAD
242,985,837 *179CB16CA52DAF0C816AE5EA5BED49E2008D6FA6 vd/t
242,985,838 *179FA6FBF132B524D0C04DCA7EA48A9201D07FE6 verkoping
242,985,839 *179AF24D290FFD73699AE80CC2E2E632941991C7 verseny7
242,985,840 *1799852CAB92A2D1D67B61F8506C1718B5CD8DF4 victoria-de-oliveira
242,985,841 *179A12E9746B756B839DFE271A6A95B3BE3D4523 VICTORIA.LIOUDVIGOVA
242,985,842 *17951C60AC3E8E3057AC3B6D27B37F3F9EF40146 VICTOR-SARKAR
242,985,843 *179248EAF9D84900D045517C3F3577587F263D23 victortocchio
242,985,844 *1796C836EFAA2E58BBBE9C702B4205389FDF5D21 viemse.ma.po
242,985,845 *1790C33690895421E17F97AAD56E4DFAB633AB21 VINCENT DANTE SAMBAAN
242,985,846 *179EC9E637FCF0937C2254874547B36BBD643B18 vincenzoberdes
242,985,847 *1795CCBCD2236587F2C8A55D1409D0229C1DBEFD VINCENZOKOUNCE
242,985,848 *1794AEB42D1F202501A1F8E9ABDD0A44A0C6B796 vincenzotizon
242,985,849 *1797FA9C8AAFF1B476B3ED70F865504F230B831B vinnie-wu
242,985,850 *179F8CC628FABD3009E28A99BF985130EB599258 vishalahire
242,985,851 *179A747283AD6AE56806345BC63149349D9067FA VIVECA.NORMAN
242,985,852 *179A09A7B68655CB666CF55C64CEC369E9565318 VKBI1234
242,985,853 *17978BE4DBC44BEA3E00295D7678618D6A2DDD35 volution-industrielle,-Ouverture
242,985,854 *179D964D1433718D6B8F412A6EBBC3B1C12D97D7 WADEMASCETTI
242,985,855 *179F69182F276A65703DCCC3DA57AB8678BC7C9E WALTER-ROCKY
242,985,856 *179BEDC8FC105115BD0A945F70CCCBDCF766656A WALTON.RETTER
242,985,857 *179F883BAB9DB36A468B8A3F5D03320C58CAB3DA WANDA-WIMBERLY-NUTLEY
242,985,858 *1796BFDD452A1BD586814B53A4FBFE4F2B184730 [email protected]
242,985,859 *1790F2FBC6025A517D9CBB9EEDCC0942AC88C818 [email protected]
242,985,860 *179CF819EC5087E32659656FD791D68353ECE071 warrig6
242,985,861 *179730097B1A9D167B1F6BF4C449ACD7AC34B685 [email protected]
242,985,862 *1794B6BFCD071530DB3143BA3EF57514F8626283 [email protected]
242,985,863 *17985861D1BE90856E748C74B967821F46A189F5 werthhoven
242,985,864 *1792AC7652D2FF78609E8C52B02F4208911A96A3 WI11OW-AC
242,985,865 *179BA8B64C0725BADD20861259BD7890478F0D95 WIKIPEDIAPLANTILLAS DE ETIQUETAS DE VENEZUELA
242,985,866 *179234382F9C977A255450CFD52337063290DE83 willardmossey
242,985,867 *179423BDAAA7E90704A127EC2A25D737794DE43E WILL.HOBART
242,985,868 *179F660B2AC4B3B0523BABCA7F9A64782C464FB6 WILLIAMFAIVRE
242,985,869 *1794DE228680D3AC451DECA34D343F738D0D35BF willianka
242,985,870 *1799B1B62F97451C3A9563D8C3FBC4AC577DAEFF WILLIE.ZAPEL
242,985,871 *179F9591823EE8A5BFF239628CBB1ED1610071F2 WILLYHERRY
242,985,872 *179CF680888027928B226BDA9044183F52410B05 WINFORD.ADAMI
242,985,873 *179DCDB36E52021E9D2B9BE57FA1272C9C804B7B WOLFDMAX
242,985,874 *1791D741FB666DA02DFB354C6B47BD9A448F0FB2 WSBSDERF
242,985,875 *179086A2B229EA95EC1122D4D5A5A6D44AE27574 [email protected]
242,985,876 *17917314E386C09881ECD841BB5802E2C19044D9 [email protected]
242,985,877 *179BDF9DE610505185D1C86DF62C8ADC0A46A4DB [email protected]
242,985,878 *1792235D67600987F0925D60B323DDBFEAA7487C [email protected]
242,985,879 *179C5B97866A2079D94907A0436BD1E02B48D4B5 WYDELL CROOM
242,985,880 *179975D268A360C6B84583D6F5197C699D3D4962 XAVIER.BREBES
242,985,881 *179FCDBAA553B935A1F1EC1A65FC4D8010ECC70B [email protected]
242,985,882 *179712DC694FF138E11280DE5090A78A6C51B2FE [email protected]
242,985,883 *17928C96F1E40E089258DCFB0597C79D4AEF79F9 [email protected]
242,985,884 *1797563A1AB48A83BC8D4C47235077ECD5DEEBD4 XLWJAHQHAGEFCORSDODGNG
242,985,885 *179CBCEC8C7C560E12F40845DB368D16DD1C78BB X=PF
242,985,886 *1796A685862413EF900586099CDFA612D932976A [email protected]
242,985,887 *179B540FD991A9B9CF6067747DF10CFEF76238CD YABAYA'S
242,985,888 *17981077D2704BB1563A23E59EA734D94866C36F yaminiselvi
242,985,889 *17989204FC1D49A1C8ADF679DD9005ED021D4417 [email protected]
242,985,890 *1795D02685007424F212F342FA5A6AF133B7AF57 yc1
242,985,891 *179437F3BBF2D0963016283125368C5514FC1199 yetty.ville
242,985,892 *179C772F45E09AE7A4CEFF4849281F2B49469D97 YHAMBEL
242,985,893 *1793809064513798BCEA777274F9B0566011643A YJEI
242,985,894 *1790F32491E52BA59604EFC86E8222058FD99B43 YUJUYOUN
242,985,895 *179E44D1CB66905D0418582E893AD3AFF440BBE5 YUMIKYFI
242,985,896 *17945F75603A67BE3E6CA20FC60D6D86B171807E [email protected]
242,985,897 *1799DE4FA5E001F24BF4341C7D55358069C0A186 ZACHARY.DELAPENA
242,985,898 *1792ED47373678C1AF4EBF6FA3D0D76AA95FBCB8 z[email protected]
242,985,899 *1798CC881EDFD2CA987C05604B3A73BD565D49CF [email protected]
242,985,900 *1799A115F64ADDC2245E5F4668DF8F001EF53905 [email protected]
242,985,901 *17905E828819D1D9A040AC5CA480F73AF964F36C zirita.taylor
242,985,902 *17994CBF9F89020BD714111AC9A9E309D5779AA7 ZUL NADZMI
242,985,903 *1795C2854EEB45485662F617480F487003D0146E zupieatiejidi
242,985,904 *17925107759395A568FF24CEDA1040209BFFC563 ΚΟΜΙΟΎΝΙΤΙ
242,985,905 *17922CE4FBB2FD12700DACA8BE53740BC62D863E κούντουρον
242,985,906 *1790E68CCA99EC65407E718E06619D446A8D3BBB ΠΡΙΣΤΊΝΑ
242,985,907 *17912E535F705B493E3FFB596227029D06E1A2DE ”АДМИНИСТРАЦИЯ
242,985,908 *1793F874F3D66546C685620CBFFA89924BD3420B АКАДЭМІКАЛ
242,985,909 *179F7F0FB41193693FDE15D0818E8199B53E426A ГОЛОСІЇВСЬКУ
242,985,910 *17949368321616E2D7693696AE85D574CE9F84FE ДАШЦЭВЭГ
242,985,911 *17918EB48F049A69B43329ECCAF22BBCAB4FF5B4 КЕРКЕННА
242,985,912 *17956CA6742A9D2769EAF5A6681D199D19243FFE МАРЦЕЛЛИАНУ
242,985,913 *179EAEC94D18A9C3B92A603288CDF8708B324D0F МЕСОЛОНГОС
242,985,914 *17932899123316F823EE76201D015193CA24A9EA (依頼取下げ)SHAIN2006氏のご忠告により依頼取下げを希望。
242,985,915 *1797A6C2679AED3F119103BFA503359CEE3813A8 因為他答應sam了。dean也沒有在當惡魔獵人
242,985,916 *1796D93C95C35BF05282C1286648965B4CB37B9E 0IAMSATURN8
242,985,917 *179284D032542AC72AA7E9397AA04519907F2572 0L09Y
242,985,918 *17993BD8EA00137A9622C2D6EA9E1869679EAFD8 (0_<)~`-~`-<###P
242,985,919 *1799D315131935A0B68250B7D90C40D0D7D69F75 0PWCIV5EMAQSXQFU
242,985,920 *1798614618E1DD0CD0412CC9AD72AB006B3B1957 124MIKAYLA
242,985,921 *179F49CDFA2DAA68155B3CD8E4C8E97A6A46806A 12temsilciliklerinin
242,985,922 *179CD3C3CD6B0E738CE8AE7BC9775F49CA4A6454 130ADRIANNA
242,985,923 *179BB6A457072489C528C3431A2B25D57C3ED93E 134K
242,985,924 *1796B8A94EFA187714915A24E680715E22A06E6C 1793029 if-they-perform-worse-,-they-would-take-a-cut-.
242,985,925 *179A05F184B96B4A042C61C441C9FD15F84F0E66 1!83R+!N3S
242,985,926 *179BC91FEF06AD7E93973F74D7B9E0D9714E8EB5 1 ADFC-LANDESGESCHAEFTSFUEHRER
242,985,927 *179CA32D0E4A3FC5AF604FA740175940D830EBF2 1 auftragsbudget
242,985,928 *179C7CBEDD3962A49D4BCC23F5A6193BE38CE880 1 CARACAZO
242,985,929 *1792A4240510E5A6AF627916220968FB705D4837 1-doppelgesichtige
242,985,930 *179255F367BB70BDBFB8B937EA4C717473F5583D 1-DORFMITTELPUNKTES
242,985,931 *179E8ED1D93751067E591FF46A029652F9586326 1.EXAMPLE-VARIES
242,985,932 *179ABC86BF0331FA5D6EAAF9C0FAC931C6F00F5A 1 FRAUENSTABHOCHSPRUNGMEETINGS
242,985,933 *179427BCC8D834572C6200A467C3B3E38A41498B 1-kureishi's
242,985,934 *1790797848A70FBFEEF81E07784EC9190093552D 1.lipuistaan
242,985,935 *1799D0D7CF0C3900C48B0A54D4B3DA84C0275888 1.numoporausj
242,985,936 *17908848801095371179490A13F38F52D9F4DFF9 1-nussbaum-jahr
242,985,937 *179AD2DB3F4361E187ED447EA38E8B25F1F8C9BF 1ONLINE-KAUPPAAN
242,985,938 *17970CDD6781B95EA77E0810C018DBC2D1C067B0 1 RAHVE
242,985,939 *1799F1B0B72427ECF04FD6DC96F0E06866CBA77C 1.raSa
242,985,940 *1799E318E063D3CA18BBA5BF30AC6A8200160E03 1SOITTOKUNNANENSIMM
242,985,941 *179EE016DEC0DA539BF6E9FFA90FFC453D5AD688 1-stoisits
242,985,942 *17984A7F40A5B1293E677030612802225368D3AF 1TRIBALISMA
242,985,943 *179FCA9193C9BF7D398B0A9FDF518B0F44059575 20071030:.legs.and.boots:.benedum.centre,.pittsburgh,.pa,.usa
242,985,944 *179EC5AF58DED4BCAC58E3B8D7AFF8157A25B4F3 20daib
242,985,945 *1792B6E3C7F22F3A1AB231790B6320952B837DD9 2458978 florismaijers,chairmanofunilever,atamoco
242,985,946 *179E8CF777178DD0968AB627A72DBB21C2CD2921 2463128 AUPERIN-FOUND-THE-CHILD-DELINQUENT-.
242,985,947 *179439EB7D823F34EA6D4E7978ABEE3A89CC7CEE 2527904 KALMAR PELAA PERJANTAINA MALM
242,985,948 *179FC5456E9D5396D5BE655D61ECF75624A7ADFC 2784040 THE.HOSPITALS.DENIED.THE.CHARGES..
242,985,949 *1791570DDBE7E95DCA2FEAF22DD1D0E991E8EB84 2933029 WOMIT.DIE.ZUWACHSKULTURINDUSTRIE.GENANNT.WAERE..
242,985,950 *179897940827699997187087F56F703E072A60ED 2 COMMERCIALSTHE
242,985,951 *17900504E963C04529EFAB5B81012D10B341773D 2iluvcomet0
242,985,952 *17973A9FD49418EC2A5CFA68B3238E31899A913D 2.personifiziertes
242,985,953 *1797B6B657388A156CA7DA7EF0A123540CF1F91E 2SCY
242,985,954 *1797D4D173C59A727D9975AA0C6AF64865E976AF 2.VORPARLAMENTARISCHEN
242,985,955 *1798702DC6B835F661B1D7CBA90B30B52CD5568A 374929 elinkeinopolitiikassa.useimmat.kunnat.ovat.nykyi-.sess
242,985,956 *179A980F46F33206BDAE94466154813AC1D106CA 3.AVUSTAJATOIMINNASTA
242,985,957 *179F7FBF5EB06C83C9DBBA7BD3C42C1315EB632B 3DAUGHTERKIN
242,985,958 *179225F6C4D4079ADBAD5B5728EB5FB3BD342A56 3fcollectionid
242,985,959 *179028745186B50E74BE708E0FABC1AB2D69437A 3-SAUDEK
242,985,960 *179CE1DCF28AE893C0866CF19422C2AE8449AA56 @#$414
242,985,961 *179E9E60480668AA7775B777A40D26392D5C0308 4dartnell
242,985,962 *17938683FDA24695B9736C40450431F1B031DAD3 4iamblizzard6
242,985,963 *179A32D503EE0B7D3E4A3FA6A28B27BFAC9BE093 4.uraiwan
242,985,964 *1798F1A8AB70FE9CB2FDA4F8C88771D1B795343C 4VELAVERINTQUE
242,985,965 *1798DE215A9A13627505E6A6485455F73EAD7A77 5DONSTON
242,985,966 *1798F7056D6E06DEDEF7EE4ED13A6A042849F8C6 5GCQTCWVI
242,985,967 *1790F70BE6D8FDE792532200D913A35DA529AA13 5HARCZIBSW
242,985,968 *179B0B85FF71E011B906797B3BFB173E2C102E7A 5MYBUBBLES0
242,985,969 *1791847EE67B6497CF3D90C54261239B04F35A5F 5SIBLERIE
242,985,970 *179D5D1FBC544E610C094AA4150412501B740285 5SKRCICE
242,985,971 *17994F867BFAA35C610845D3A2443FB6D48F80F1 63BLIŽI
242,985,972 *1790B89D35756412BF3B7DD2BFC2098740B6336E 6ILOVECOOKIE0
242,985,973 *17983CA1B20E3C2295899C6CB8FB81BB4238FE0E 6KIDSKHAN
242,985,974 *1797F4A052756CAD42A4CC38B8D332BEEF5C9C86 6MOUSECHLOE
242,985,975 *179994A5909B0662404F4955AA8D9995834B5F20 6MYPANTERA3
242,985,976 *1797D9E5CCA34A10EBF85029C755F51500147500 720303 virkavoidaanmy
242,985,977 *1790D37D1A0DC6B54FFD985FCCB2F9CB73F83BDB 758EMMY
242,985,978 *1796A1A8FAA0E9557DCCECDE01FF88FA0FD838BD 778347 BESINICERIGIMUKEMMELDIR
242,985,979 *1791413187FE612CD9627EBCC300E7C9BC450A45 7cadrerais
242,985,980 *1794763F5CDA42D5C1AA892D2865BECFEAAC3F3C 7SHUSHIAN
242,985,981 *179D69F73347B772E81BE2AC516CA9878A68F9A0 7TRYTAINGS
242,985,982 *179FF89594AEA54519C8EB2279E568E521CA6B18 8=D~O-Sploit
242,985,983 *17978124F8B21E4217FDB0F81101F3ECA23BF6C3 8LINCOLNTEQUILA
242,985,984 *1797B86BC511AD00B7092F12301FDDF8012E07CD 8####p *(>_<)
242,985,985 *179324752F1A69E571AB38B66D53FE74F0A3AE01 8PROZESSORIENT
242,985,986 *179D51F94E4229189200DCE471A0BC2BF78FF833 8RINNEAS
242,985,987 *1791CEA03FE8F9CFE5836195FE2245A892137AC6 8SOLIPUGA
242,985,988 *1796C2DF850B84A93FB82479FA295EE03ED57396 8SUOECALLYHPORDYH
242,985,989 *179B7A9A9ECCE692DFB389D3ECF527C74F8FBD6D 90-MONSTRUM
242,985,990 *17996EFAC57B4E1C13319F2247931511F0E53951 9300021a
242,985,991 *1793E29609E5E279F08564419ECCB025824C78F1 9BSWGODLEWBSW
242,985,992 *1795871A2EC95E6083CEDABF63FD388BFC9EABCA 9EADANMRE
242,985,993 *179FDE51B9C725FBDC9251439A627CDC7DC13B44 9JESTERMARIAH
242,985,994 *179119BA992900FEA2CFCC5EA3D36775654F41E6 9SSODHIIH
242,985,995 *179FC7E76C083317EE3BBB2454F9D23AA5DA884A A1116088241
242,985,996 *1797BBC0D31C1C53D7BA4460135F570A31C88FA7 a3x_
242,985,997 *17969E55DAE6DC4676D3E970FD3C52D382CEDE66 A!8PA
242,985,998 *179B3574F187D81751633E7D39C3F8EE6DAECEBB AADFB;
242,985,999 *1791A07F01F699C2320C5B773ADB2781D6A45A56 AARON.VILANDRE
242,986,000 *1799D019272A0BA7BCCCF0424807DC5C55DBE092 AB3,O
242,986,001 *179C30635906A75B1F2D3711D325E16427127F68 abye
242,986,002 *17955E9C926E1229BE28903052221563ED41F6BE AdCU
242,986,003 *179B015CE44D620B005B20F88B208A91E665D160 ADOLPHBRIA
242,986,004 *179AC02017A8E68FA16908AF4FEC8F8FEA0FA548 AEDDM
242,986,005 *1798C4F67201EEBC9CC6E3D64D02FD521057352C AERATORS3
242,986,006 *179EE12975B6C8FEC79AF6C74153C1931C961B88 ag(/z
242,986,007 *179D19F63EC94955230E29328CF444E8579AAF5D AH36D
242,986,008 *179DE5F149F02730D3621F899813E3F5398E6D05 AHKELIM3
242,986,009 *17922D89C470B6C7665E4D39CA11EF31A68FDDC3 AI:
242,986,010 *179E437E972C701DE64EAEA50330C6ED04D76233 AIV8I
242,986,011 *179D18BCD4902BCDEC38BCF1C5F2441DFC7553C1 AKAEMOUS1
242,986,012 *179ED10B15FD9106D81AEF6491E731DB44CBD314 AKHDYOR
242,986,013 *179FE1A77A8F561A40F9C8E12C0FF969AB77C20B a;lam
242,986,014 *17999FD9DD24960F96974ED87D4686FAD3D3C7F7 ALEXANDRACABREROS
242,986,015 *17907A83F8A229CD4A593D810F7D8E3F9A9826DD alexorsini
242,986,016 *179BAE6AAA988D27B786E98FC07169511DED1680 alg$i
242,986,017 *179FF4439090BFBAAC7AFCC968EAFFCF5AD344FB algin-fiber
242,986,018 *1798FFC317EE9972884E71E2776089B2B4779CB2 alisha.banerjee
242,986,019 *179DFF1A1CBAB957FA25F0B4079C849CDBDBD3D0 alkinningham
242,986,020 *1792A04A9C9DECF10588851356F46C5ADE80CF28 ALKOHOLIPOLITIIKASTA
242,986,021 *17992BB10C66283B2215C01F98C3FDB9709CEFEF ALLENFEAGLEY
242,986,022 *179527336A191B05EF14AC7CCF2C3B83B1173D05 ALONZO.TURNTINE
242,986,023 *179933375EFBB2FCF5819FB7B1254DF9DBBC71F0 ALPHONSEMANHART
242,986,024 *17961A8162B3A68E22805766B2C6EB3569F13AD7 alphonsesachetti
242,986,025 *179393C4252EC33AA739CA02DF57340DDF15938D AMADOMICKENHEIM
242,986,026 *17931BFD1BFF6AC0ACF20B2BB72E74027CBBC738 a;_mk
242,986,027 *17917974D756CE877DF78D2DB7187AF4E81D8186 AMYLYNN562
242,986,028 *17904E3FF2137D42A1B7E3DC82F0E3476EA0AA92 [email protected]
242,986,029 *179B04DB1C9B254A55E85287ADA6ECD1BCE5FD73 ana.vukmirovic
242,986,030 *1796B52150E687F7EA2CDC3C4D7CC86EA0354A29 ANF(3
242,986,031 *1798B51274BE4A4E913A5146411C88B04AE4A3F2 ANN CARR
242,986,032 *17956C4871A121B5CC120C5FA49FE102A30670FA ANSICHN
242,986,033 *179EA6B0E5D88E7DF6D55756A330B94015684F98 antimatr
242,986,034 *179BF1932831F9C7328F43BAE3F1213A39306D59 [email protected]
242,986,035 *17902E4EE7BAD7AD761ADDD4A8B0AE96C4EB5BFA ARABICPERSOARABIC
242,986,036 *17943A5731BE8C399F38273AC3A940E87FD0D85D ARAFATZ
242,986,037 *179AFAE0249AA3E8A82754F6E5C3622E56C57CC7 arbejdsmediciner7
242,986,038 *179359628F9CDEB739C27F1813EEC71765B2A0D7 ARQUEAJES2
242,986,039 *179F873615DAF762D1A4385C92E1CD260D607F9C ARTICLESHE
242,986,040 *179CEF404EFC35681CE72262E9E50F6BBAD66D7B As2%
242,986,041 *17978353C5F1F5534D505A82BBE439552395985C asdfghjkl146
242,986,042 *17931BA18B36B5FC61EE2D4CEF74A126A6FC3E57 AS(S
242,986,043 *179FC36F90D40E3D6188707AAFAAC1F0C070B9EC [email protected]
242,986,044 *1791D785ECD43C038A9067C6AAA28B65951A6397 AUBREYSUMERISKI
242,986,045 *179F0117782F1A13E298FF23BDE84AE72350B7EF AUFZUSTEIGEN
242,986,046 *1793416E35CA94588752A297E1CD9FD1D595E60F aus-holbergs-zeit,-op-40:-iii-gavotte-allegretto
242,986,047 *1799AD41EA4DF97E8C0869E3B55E4A67B7ED2D0F AV0!V
242,986,048 *1797B9C10EB11FF3E231C1DFFBC84536EC606888 avtro
242,986,049 *179C59EE7102D1D3446079BBD632C37344B415D8 >b0.~.~.~.q##b
242,986,050 *179E9ACEE3724CE0F47E1C4B08ABB9CB88911BF3 B,4EQ
242,986,051 *1795C4C5B4CF20FA11BCE267F55F500367FC2348 b9fhb
242,986,052 *179CD94FFB23FD02C1C9E1CF3E1731F04724DF2B babygrl37
242,986,053 *1792ACA7892E2E3830E681688CA914CAFD70A6CC BCHH3
242,986,054 *1798E62AF735961E1B0E173037404364BF8851D2 BEZOBEZOB
242,986,055 *1792E5AB308C66A4B7091AF8B6DC97C25158FBA0 bf%yp
242,986,056 *17924ADA75D92240EB195B8C9C459741B5D999E7 bi_;
242,986,057 *17990549AFB343D385D1711BB5E1861832F123B2 BIVSTVA6
242,986,058 *17944C9AAF2CFA6DB2656774D82EEBA5DCB26877 b/k/j
242,986,059 *17916AFF899B68C7312CB49F12ED9FE1B2CC4EE6 BKMI=
242,986,060 *179061570381C7FAA2C26C3760F0C74744BD2994 blake.horrocks
242,986,061 *1792DD69D5C815740113C4AEA4540AC6849A68A3 BOBLOX
242,986,062 *179917D7D1749E006BFDA8124F56041C93B8AED0 BODENMULLER 2 0
242,986,063 *179090222F694CC995B663F31145C1BA1D24FC7C bpc:!
242,986,064 *179317102515B32199C23E0FA4E57DCBF277BBDE BPR_
242,986,065 *1791A7EA4B6D5BCA9056DA4A995F707A58F05633 brennabox
242,986,066 *179257AD86DF645539EECB1189E60186A0490235 BRODERICKREADUS
242,986,067 *17900D131C32D52C183D782FE339DA8C18522CEA BROKMEIER0
242,986,068 *1790709DB76F38BBD5C2C0A2FC69D3002D470B28 BSCX6
242,986,069 *1791A26565C03B3F1590C3E0324E6B093B113DD9 BT5E
242,986,070 *1793C249A4B7D4F95E9D06FB90BDFD52D1649FE7 bu/n&
242,986,071 *179BCE8CAADCC954651056393B175AD6D601EFC1 bunnybeebbs
242,986,072 *179F17D7FBDAC6E755547767677F1283859D0075 BURT.ALTIC
242,986,073 *17923CEE64DDFC03F4A52DA5D004294DDBD6C93D BUUOH
242,986,074 *179C5BD05AF1580CE197FC20C191DC0BDC9795A8 bwycu
242,986,075 *17996E3D4D43D94AD5B33DCE99144FFD8FD191CA [email protected]
242,986,076 *1790E107E5F867F2A49DDCF481C58E022B501A80 byeriset5
242,986,077 *179644722700CB7156B1252B992009E3B7498D6A bzbp
242,986,078 *179D514A2AD4DECE5F5A41E3AB1B19C5DCB3E18A c$0h&
242,986,079 *179F3C90BA4B7A1E1B11F7BDBC24985D1A2A0EB9 C0MF0RT48L3N355
242,986,080 *179B3E7F33C03F4EE28CEF681CD8EF3E2F4F0500 C5LFG
242,986,081 *179EDCFA42943A8AC4183B846655F2F0152A0B9F C$7RD
242,986,082 *179194895B7FB00FCE55CF3A58D0631137F79FB3 C8PE!
242,986,083 *179C26047BB41380DDAE8D0C8FE992072640823F CAMSWANSON
242,986,084 *179D1F4F3F8A6FBAD2A05FD4A34E3D788D5AF9B0 CANINE98
242,986,085 *179E32276AE77CF1BD8D6029BD62AE8246584314 CATEGORIES32DENNIS
242,986,086 *179EFB573A112DE7333148BCB861CF5925DD0ED3 [email protected]
242,986,087 *1799371234BD79866F7833F95FE8EB992E84E579 CBB?L
242,986,088 *179779BC74295E7D1CBBD56A302A925766E0FAEC [email protected]
242,986,089 *17921E4CE06C563CDA112987F7A51043B9304AF0 ce1zc
242,986,090 *179E896AE35BE8486FE51BD55CD61D8C904C0BB1 cecilchaille
242,986,091 *179F543092B2084D547DC783667852886183A964 CGITEJ
242,986,092 *17920E19611882364A4C98F3D4DD007A170311F6 cgrr9
242,986,093 *179AB63051C598F9C715A27997B2A68336B9F9B3 CGU$5
242,986,094 *17973B75F7C1C803D72979A96B91AA77AA1012E2 childrenofisrael
242,986,095 *1790C13871657611911D354B30DDB50B6934FE0A CHURCHSTING1
242,986,096 *179142311024F7259FFA1D345BD496E02C71617D c/i."
242,986,097 *1792CB9EFC9BDBFC1EA5CCAB8D1E7FEE8DD7B518 cjf$
242,986,098 *179D4DCB2AB3D9657C073AFFC66FBF5D062071DC ckllg
242,986,099 *1794249524A7B43B4DDC357F7B784D83B15E64D3 CLAIRBOYDSTON
242,986,100 *1791B59C101A81905FCBB9B746D9F8E9C0E7DC97 CLAIRBROOKE
242,986,101 *1798A82E90A248D6E9E730D078FA89E141DA3061 clarencelairmore
242,986,102 *1790D9C077FE44EE0E1A6A6A359839F5D4EEEA77 CLAYTON.UHM
242,986,103 *179A2AA9884BD3F8874F54689CF76987B92C6493 CLIFTONMAKELA
242,986,104 *179C24559D736304C8E87C47D6D34B5A5439B121 C)mF
242,986,105 *17930ACF78A3783A1C522848E840DE0C86873C06 cn+(
242,986,106 *17940E78811E387B91AC6B39B6D1C31758E26B4B COLBYCZARNY
242,986,107 *17937E223A5226977C019A2F53075621E2206E72 COLEKLAVETTER
242,986,108 *179108D258871C4F6E225735FED5170337D4133E [email protected]
242,986,109 *17967F7EFDCE7CD63FAEA92338C990A6D15A20E2 convivae
242,986,110 *179E1CE6F30BFA499C25B6DE33F2A7A602916EC6 [email protected]
242,986,111 *179B8E24FD79401196298A4BA7E10074F8E3CE62 COORDINARE7
242,986,112 *179DEA525D919097459BA551B5A4C7A383B677F4 cq-0-
242,986,113 *179D347C838467418D9C9EF252F358CBFDC97E92 CQ5K9
242,986,114 *179B8E8513F6A348583BEDC0BA9851498002AF01 cqz"g
242,986,115 *179595E42DFAE8327ADA9AE8AA4C7259D61723BE CRA
242,986,116 *1794530EE22CB58E332A739AF0F36B2CEA85EEC7 CRE1.
242,986,117 *179160A451EDC0E9F2E1C7936F17C9227460DDB7 CRISTINA SOKOLOWSKI
242,986,118 *1798CCB710C9C3BC01262719A6F843719459543B CRISTOPHERBRIDGES
242,986,119 *17952CC51DEB21BF0F86DCACA91389F931BC3D97 cr$qw
242,986,120 *17978FB512CE01901C8CE760A8A65CC0BC0B92C3 cruzmiyamura
242,986,121 *179FEEEA152E9E348BE11053F55D27DBA3A5603E CS.$A
242,986,122 *179C88DD6D846C05B285B0C9204519AC64E29EED cub&
242,986,123 *179BF9E4A659B258995A2AA47CE5420B61E3F807 [email protected]
242,986,124 *1791E1D4D404B1C5B7486AA1DC15DE64792AE6EA cuicg
242,986,125 *179EBCD26B96F72871BA06ADDCFFF92085D1BF47 CURTISGERMY
242,986,126 *179F3B5853AA474D0B28DDF5456BFC86187D9AD4 cuv(g
242,986,127 *179B7E685E809F2A9E6F87062EB733874FC7CD5F cvzo(
242,986,128 *17947F8353E1FAE70A26E80C7768DE10C4E929D1 CWH?+
242,986,129 *179747F5682890CE90EDBB3F3F380F152E4ACE0A CZVD
242,986,130 *1797B0BC38C5FFE303B74302190765B27435D2ED d2doc
242,986,131 *179A25B458A236CF3FCF15DE61BA6B3F0C111A8C d3oa3
242,986,132 *179E63943B1CC39E073D502DEBBCFE53E56FEA3A D#;3T
242,986,133 *17918846DAC2FBF9B97D118CD74993914E00CB21 D-7,P
242,986,134 *1799650C53C8A69EA0748C9CC92B46657E4EAF67 [email protected]
242,986,135 *17966B9C72A92AF7D3AD2A7599E6A51D77177AF2 [email protected]
242,986,136 *179AB5D73677B46F5467FDD14AFFB21BFAF02B74 DAJGJ
242,986,137 *179DE1FAA473A73202D467874F38A2082FCF65DE damiandinehart
242,986,138 *17903FEB893C47AF127877C4E6B2B001D187CF6C DANNY.RAMSHUR
242,986,139 *179FA47FDE1F424357862224FDE248841C215A5C DANNYWOULFE
242,986,140 *1799F108BB131D33922202CB31EAFFBA72893A2B D=aO
242,986,141 *179E2B530E1E694A5FD11C9657E4837A0A107855 DARIN.CARAMELLA
242,986,142 *179538EEBBDA1C5052CA8B5C14468FF53BF4216E DARIO.RIDENER
242,986,143 *179765D36864D064532969F44C0385658F8DF18F darryllamarque
242,986,144 *1797B989A8261810BFE6A8DC1FBD76FDDF7ADFDA DAVID.KIELY
242,986,145 *1793698184C8A636A66F6D9122C746F5EEF2E83A daytrade0
242,986,146 *179FC4461E877AD350212B2CECFE37D368CF70ED dbb/6
242,986,147 *1796D05BC962FC50C9A007A6BE0CD4289C051245 DBC1$
242,986,148 *179FF2B1B65DD0CB087AC976073CBBBE529F1E0B de'laveriez
242,986,149 *17977166C894B8ED48EB9BD0C85904D36B28521E DEMARCUS.NGOUN
242,986,150 *179FE851C8E38CAD38A79B15A84DA7FD529C95DD DEMJANA.1
242,986,151 *1797C8C25D76B5D94D2EE4881349643172B81592 denisep
242,986,152 *179923434CE22D93CF9E980B99C842C6D1AC9DB5 DENVER.ZMIEJKO
242,986,153 *1790D064B31DEA9A4A8F21350AB29C1BA8D94E41 DEONREINERS
242,986,154 *179152A35FCA0247E664C01DA151708C41C0BE23 D-E=P
242,986,155 *1794D244D7741BA487EFA2BF6BE33A8D646DB47F desmondblanquet
242,986,156 *179FD12A421F8F5CACD2249058458BB385C3E155 DESMOND.GREENWALDT
242,986,157 *179D11B616878211DE11827B07F1E776D921A370 destilacion-fraccionada
242,986,158 *179E1262126B1247439C350FD0C707D7CC79AC75 devinct
242,986,159 *1799B93EC7DFBEAF2A7A70336B4B3FC98F438834 dewittschue
242,986,160 *179F9F93BE1DF02EEA50B31AABA92B742556D0B4 DEXTER.MEIGHEN
242,986,161 *179E68F5EBB9A2B71D670E2C2A86DF545ADCA576 dfo!0
242,986,162 *1796E06B05B0661CFF86A9E1BFA720A2CE47BECA DG2T
242,986,163 *1797CEEEBF47E3696A5F88C1FD7465D34DDF2152 diannemcadams
242,986,164 *179F223D28721D4D454BE7EDEABF110A41581829 dihydrolipoyl
242,986,165 *1793DDBB66521F73731D6590008F5D58D5A90040 Distributedly
242,986,166 *1790CE55F146A8E62C1DDA37FB30AF08C7261AD4 d"j1d
242,986,167 *179BAC3E95DF1C7AF9B88CE855B9BDD2D275E039 DL22F
242,986,168 *179AEDA71E7C8DCE189A3F4AAF1888EF42E0F989 DMCL=
242,986,169 *179C31527D9D8A6C84585B37C4DE1D2DEE5D261E dnop6
242,986,170 *17967B6C042A171849238E7E8425EFDA433BB95D DN"Q6
242,986,171 *179227B61DD4E1915E374D79FA90E1BA2C7E809E DONG.SENNOTT
242,986,172 *179450C980E02BED7BE9608504EFEA537EE843CB DORIAN.LAUDE
242,986,173 *1797A36A96D0D0D33096618C93A13A38D54E5730 dormouse 'd/o/r,m/au/s
242,986,174 *1799FC62D4973412C37EA2FD50D4C2A2972C1361 (^_~)`D-P
242,986,175 *17946963C96C72EB3699F3193B7FBD88B35A60F5 drbl
242,986,176 *179A65FD5712FDD95793ABFD7137FB758EEC0B06 DS&G
242,986,177 *17976E41B2DF8DC4D1FC83CB28069FBF76AEAC2E D$tu
242,986,178 *17911E2742E78F775691DF69E98DB1AA58CE8CEB DUDLEY.TACDERAN
242,986,179 *179575087AB90FC6C5D6F3179DF00A86CA9E0865 DUGH7
242,986,180 *179CDCEE4AEAE0D75284B64B08E283AFC92D5D75 DUSTINDYNES
242,986,181 *179E2E8C78D587A86DCB1B7A5007791D1EE513BC d+%v5
242,986,182 *179B7C66BE2B95A3B8EB91D492160056AD907EA5 dve!b
242,986,183 *1791707ACD906862B261579B81BFD5B8C4222B6E DWISD
242,986,184 *1795104D6457AD38C467CD6DD254B16A2CE4A962 ea6&
242,986,185 *17956BBF5381629FC18B85546007091DDCF6A628 EARNESTBOUTWELL
242,986,186 *17952359274952F581DDF5A9546721334ABC49F4 easebournechichester2010
242,986,187 *179BF41B140270F4C8F92B844F1AADA3F9CA7B46 EBC
242,986,188 *179EB4E17B0E14D171CABAF57197F27A3F72E678 ECEGM
242,986,189 *17909256125763D77A0C6BEA81323ACF224EFDD8 eddieparry
242,986,190 *179B8ABA2D77933ADD37F7177910BD2921155BC0 EDWARDV
242,986,191 *179E56F4213A6A82E4BA9DC0E4767F49C35E97F9 EHM:F
242,986,192 *179F5899355AF081B1CA422DE796A52419DE74CB ELLEN.KLINE
242,986,193 *1791AEFEA52BC90A9D6B82971E7668D8A1535B02 elyelmo
242,986,194 *1795CF79E49A1DF2718C5E33C715EBABAC0B9AC6 EMMITT.KATOWICZ
242,986,195 *1791A0B065C3FBE6345A9965D9BC0A75B648FB79 encore:liveatporgy&bess
242,986,196 *179E667BE638CE18B9E4FF4B53D38354F277BF76 enpontaudemer
242,986,197 *179879E6139D4070D5AFFE96112593B19EA45D94 E*O}
242,986,198 *1794594299CCD46AC9BFA674B03BF945D8A3CE5F epsxbsw0
242,986,199 *1792BCF521CCB102BE8B9068A6508BD7467B33ED ERNESTOGALFAYAN
242,986,200 *179BDB7EC9EFAADEC2DBA5FC194CE7755E9ACD78 ESHRAD
242,986,201 *179508A8C9558FC781DF28168DC20A448B47D2D7 et)1o
242,986,202 *179015B04ECBE9C9ECB84F39772B4F200ED91F99 [email protected]
242,986,203 *179A0F5B96C87F558F154F57900EE7B28027288A EUEZW
242,986,204 *179CFFCEA3FCC6A85D74BC74CDADAC307C5DA02E EUPRC
242,986,205 *1798927A75662BCB762B595BC9270835A05A0FA4 EVERSEEK.COMEVERSEEK
242,986,206 *179A5C760B6FA6B93BEAC19743FC7B7DCEBAB847 evitarocednu
242,986,207 *1792955CED5B8E156854A49EFA58BB1E3F045F81 expensi3
242,986,208 *1793DA7472DDE989A503414318751C2463E84A6F F0RL0VEDE
242,986,209 *17924C866948CB3BD00BE8AC7F5A0DCA02F49A1D F6PROVIEW
242,986,210 *1795EC42C4DFEAFFB4F22E18C8F117F343C69BEF FABRICATEDPROGRESSION
242,986,211 *179C196A4761A2E921716595217BE40A0463D8E4 fafe naa efe
242,986,212 *17925C3C2D3100F847F357A0FFFA0E98AF4D8362 fantasia.veneziana
242,986,213 *179FEFC0697D4F8DE469E72E9EB49F2C26BABC86 fel1287
242,986,214 *179A64A6EF5B02F14A58BA47C942BD4992367A6C fire-and-fury
242,986,215 *179129332220949DC43CAE41CE6E7B8AFC828A32 FLETCHER.NICHOLAS
242,986,216 *17914BCBA4234723AFA688907B4A167C10112F2F FORRESTREED
242,986,217 *17939BF080BB1880B57E94D190CDF4547BDA0860 FOSFENOS0
242,986,218 *179FBD55A8982584BDA3831120B3028247E82C1B FP4O
242,986,219 *179101017F44BA1BBE2BC8F89B9F101E08853BC1 [email protected]
242,986,220 *1796B09C3E1D6F7EFC79CC14D7B9315D0D0D5A4F FRIED-NECK-BONES-AND-SOME-HOME-FRIES
242,986,221 *1793B95834C1E990D40AA9DAA5EE8DA0FB2E75B8 frwp
242,986,222 *1794D08776841B3E5917B4CDC00AB39175E84114 GALENPETRILLOSE
242,986,223 *179C9E07E43B7050993DC5750EC358EF88A8EBEB GALLEBL6
242,986,224 *179993406B4D95CE64D02667604173E50ECBCAB8 GALŔTONE
242,986,225 *179BFD5394553BB773DB5600A979FE133F35A090 GAME-PLAY-B
242,986,226 *1790A7D34E28C37080238CD85B4B61FE29C04A20 [email protected]
242,986,227 *17990EB8C141FADDE94A4A499FF8EF448B84351B GENGUMBA
242,986,228 *179A710BC8C1AFD7967F5C4C7BB01305C02B490B gezeugt1
242,986,229 *1791C509B3AA71776EC257B6EC2D74F8A3A07EA0 ghbacked
242,986,230 *1799DE9C994FFADA6B1876D368504A3B0715C2D0 gnussafr4
242,986,231 *17905F58C5E80A0E7C7AEEE29B54E0E20682CF30 GO-CAMPING
242,986,232 *17978FFC449F75DA982A1A9D1AF06C942017BE61 GOXUPAZO
242,986,233 *179ACF5CA9F088A50B94B017D2AE92108BF7172C gr4)
242,986,234 *17948B7AA088AEE2105D6004FBAE24305E4E1543 GRANVILLE.BRAMHAM
242,986,235 *1795C873AEC9260781ADFF7ECC273A1D6C438C8B GREGORY.CARIASO
242,986,236 *179C58BCD22DDE7E5B90A789A43141231C262994 [email protected]
242,986,237 *179D539157B9BB1525ED5A1FC07BB976329804EC [email protected]
242,986,238 *179149DF1AC085AB2FA9F169FC4E2B046188605E gwdowtha
242,986,239 *179CABFDDBFF27FA2E15076A9BE09FC9556D8442 HAPANNA
242,986,240 *1792171C495A60E8BE1E4BF8CF36279D3931A3FB HAYWOODGRAZIOSI
242,986,241 *179ECA77DED3D509E2D7A63447AFC9D85116B34A HEARTAWAYFROMHOME
242,986,242 *179A7B9C37000E0C7CA227D8AE1707AFC9F7ACD7 HEATHWHITESIDE
242,986,243 *1798D547275542B80D460CBD327DBD73EC694210 heinrich schiff cello concertos (disc 1)
242,986,244 *1797722295CD9CFBAD283C04999845496DDF5760 he-is-i-am-(drum-&-bass-version)
242,986,245 *179993E43EE1465847A4D4F9FB39A82DF7638F3C henech
242,986,246 *1796191D6AEF2BD91DF338217F4711DDE5AAB25F HERMANTINGEY
242,986,247 *1794DB989EEFEE8061D64A2758467D04C886F77D HEY DJ (GIMME A FAT BEAT) (SINGLE VERSION)
242,986,248 *179DBA084EB6FF9CF19B75E3BFA0C9E6657C59F5 [email protected]
242,986,249 *179CAD83785DB3BBB97D2C1A8EE039DEE5443870 hiebner8
242,986,250 *179A3EF71FB78C783F72560A5F8373933B739DF3 hilda-chiu
242,986,251 *17935CF88C6819EC5E30A193F46034CAF13DC90E historias.de.juan.espanol
242,986,252 *17968ACD7CAD26817B71F9DF463442C494528B74 HISTRUS7
242,986,253 *1791D7283A4C1DD5A18344D1B4751F8BAFDF008E [email protected]
242,986,254 *17953B5C2C3B92883F7E8A30F1FFAEC9F528FFE2 H&K]
242,986,255 *179FE8319E447DD468AD550BE427A5FB32BD2A68 HMF
242,986,256 *179782C496F54FEC4AFC7010539D9F1ED1557121 HOCHBAHNZÜGE
242,986,257 *1798E39A22754F9C146B0522CA29909211FD4A71 hollerman!
242,986,258 *179FA9778A5BB2D5E1DC64CB4CCF992443532276 [email protected]
242,986,259 *17919B53F324B206D24028D905786365A710102D HOSEASATTAZAHN
242,986,260 *179E3D744FCF89DDE17CD4E92EB641E893635B4D [email protected]
242,986,261 *17986641AEFA2A7BA3CB27E4351C6D892AE9DE99 [email protected]
242,986,262 *1791ECA290285D6197EB48D5D0A24EC406447E3A HOUSEHO5
242,986,263 *179BC73246F2A264E258C69F1027001DB17C0B24 HOWTOGETALONG
242,986,264 *179ED4FC718013235492DC90322FD64480D805D7 hrqv
242,986,265 *1793EAC32918D2FE8A1ACA1DBBD5A5439DBCD144 HUONOT-JUMALAT
242,986,266 *179643D3B22436A35FD5CD2F12CEFB3D4E147DCC H'w
242,986,267 *179AF79D20DCE29BF16E8A94EDA741CDE78ED355 hxfd
242,986,268 *179C9D7DE1408433A90D05F02C7E6B9B60E5E4FA [email protected]
242,986,269 *179E2B9374147DA69C95C614D682362A056FCE4C IJHEJ
242,986,270 *1797A9859C3787EE416D401F05F2DF254BF865C2 ILIKEPPA123
242,986,271 *179E9BD4FB02A0EBA542F9BD216316885A5E209C ILOVEALI2007
242,986,272 *179DE834990795EF39218A6E5DE4EE935363EB7C IMMMEDIATA
242,986,273 *17995653C5922DB4226488848CAF196EDDD8BE1A INFORMANTA
242,986,274 *1797D4A81EC067E5A1A11D00F73D4BB4A40FC8A2 in-sickness-and-in-health
242,986,275 *17991527D349E1375B8C6CAE0884B43BDAFA4AEF INTERPOL
242,986,276 *179AD8F77B213D900CDF3A48673DC29649196770 IPMASIOL7
242,986,277 *179FB91CB327E8B2244675D433A8A27909E73DAF isaiasmalandruccolo
242,986,278 *179643239465424CD4D0FF74F5305FE1C1465EE1 ISAIAS.OTHOUDT
242,986,279 *17912D659ABA9F6CA2C3285727890E70B42926F4 israelcosen
242,986,280 *179CF8D1D749E94C895DE179D9FB7C2B292BF07C ITSARAPSED
242,986,281 *179324EBCA8EA4D8C42265BEE582F1F10172329A ivandropina10
242,986,282 *17968063423852C576A4F850C663A44C2A4B55BC [email protected]
242,986,283 *1797E08B97104243941D062A42E2270102C53443 JAMESJ.COOPERIII
242,986,284 *17934D2CA5FA9C9C1D7889F7265120C59BECC360 jameybunkers
242,986,285 *1793FB8C635B4EBAFBE4952F430AE09CEA76CA96 JAMIEPARETTI
242,986,286 *179DC0B579581EAE6CE33EB383A92A8752F102DD JARED.MENENDEZ
242,986,287 *17984D44178965A83736F49D72EA3C11A6D93941 JAYSON.LESUEUR
242,986,288 *179E0311B3EBB78B8316438E159EF1413F5A2757 JEROLDBLEWITT
242,986,289 *17909D0285584660D54F5701C3D67B3A3711610B JERRY.BICKES
242,986,290 *1791203D41B7B6BE92B365BF3E51FE50A36AEEFD JESSIESHAWLER
242,986,291 *179D52B772E832159C8FC20505EB94BB4E28E868 jewellaiche
242,986,292 *179573F950F842ABF24A3FF6C5D80B69010073AF [email protected]
242,986,293 *1792EEA13D09475991E23A48CBAB20D0E72EB886 [email protected]
242,986,294 *179D3E575BF53C2BFED43A8BE28919D57484A01E JILL RUDBERG
242,986,295 *1795581BDA08CED8325F4B5660E5851FA52EE5AA [email protected]
242,986,296 *179BC3B4CDD7A627555C53405D12333EB055F007 [email protected]
242,986,297 *179AB627F3DF8FB37CC739200705CCF1B7195C86 JIM.STEERMAN
242,986,298 *179BEBAF57AC8E64E18E5BF939A44362B039D9D1 JOHN.MELLIERE
242,986,299 *179A30FA1F35B5866D98476CC2689E9274CD0476 jonahstumph
242,986,300 *1795BD518867AFFE20AC03ED1483E17EDB582F9F [email protected]
242,986,301 *1791C19DCB4FFD9AF21BB602A856486226AD3C4B josiahschuff
242,986,302 *179E97A5EF4B3C5955EBE3B916092F85E38CEE39 JOYVERSM
242,986,303 *1791E24F76AB1B385CAD9FCE47B44A70F3EA154A [email protected]
242,986,304 *179BEFF55A9D50366F9AE390CA7FCDA77FA44191 juanhaby
242,986,305 *179FA192FFEF977CE240C957052C3529575F92F3 JUSTIN.ENOS
242,986,306 *1790CCAADC965818AAD3FDEF8F71C878DCFC304D JUSTIN.KREY
242,986,307 *1796934D2B15D061B886D0764C2C65A6CE6B044C [email protected]
242,986,308 *179E0A87C41941856621B55CED07E10E0DC784BF KACEY-SCHWARTZ
242,986,309 *179B490A398B1A1B818FD1CD4D34BA6F898AFD1E KAKSIPII
242,986,310 *179974F3BC1549771CB5558B8F49FB21CD848AC9 KALIEFILIPPO
242,986,311 *179F66466C945A6C4CDBAACB7C42E11174F04476 kamkata-viri
242,986,312 *179B14ECA1AB1D2A96D96B22AFA30F405DD73D10 KAPPINGS
242,986,313 *179571B4C73499258C672FE1EFD08B83C507B523 kecey
242,986,314 *1799ED8522E2BEEA6D29C8A568092ED7F938F1D0 KEVIN.CONRADI
242,986,315 *179B94297B4A2A0DDC7939012FB4C1189880AFB4 [email protected]
242,986,316 *179D599DF88EDBA42AC9016016B0E28A671B3F94 [email protected]omcom
242,986,317 *17984396CD2734627A6E4BA0CE0E12D2AC5B2BDE KIRSSAVS
242,986,318 *179D0C222C842C5B5DEA3E2C54CBDBBEE3C1F2E4 kisvárosokban
242,986,319 *1795610F4954CFC34413F091A05A1F8110D66A45 [email protected]
242,986,320 *179767CC22B0A98D9519289364805FBFB95D9C75 [email protected]
242,986,321 *179D75A1AD0D253E5516B3C9D8C612B0C270D195 konditionen4
242,986,322 *179D3DDDA94AE12F1D7CEE4AF092C6318D8E54CB KQP\
242,986,323 *1797D911C3E5B250A134FDAA494F2204B2B52A46 KRISTAL-LOBATO
242,986,324 *1792F6F51CD466B8EA6CCBE0EE7A398FD175CFA4 kutiepy
242,986,325 *179645E284196688EDA6D0A60D01E4427295CE4F labeled
242,986,326 *1795451E72C42977F7EA3B456EA4C7074EE506D6 LACY.RIDES
242,986,327 *179E7300CACB518D54A07342789EB2A9F6D10BBB [email protected]
242,986,328 *17986A2C5330E6827FC4AD9F00F63D3B6454AB00 LANGZEIT-D
242,986,329 *1793E070123F1261A0F15CD17E06F240B5676354 laura.fenlon
242,986,330 *1795CD003745FFF966261BE55808FAEBEAB2BDAC LEAHMEARNS
242,986,331 *179CC005979E4B72ED11B2A7D5B6BAE312C1F2C9 leanne-quereshi
242,986,332 *17950DBB37C2E2074E4B258F164E36001818DA59 [email protected]
242,986,333 *1796FFD395D4BCDF8CD83D8053A4F62AFD323DA7 LEGEATQUELACRIMA.'&LT;BR&GT;READEMANDWEEP.
242,986,334 *179E2A3DBCA1B3A891556CAF1F6E9996B6F170B8 LELANDHABERER
242,986,335 *179662C75971B7AF6743003EC19324AD7CBD9693 LENARD.KOCHKODIN
242,986,336 *1796C2E7D1B7603750BE1007E717B9346A513854 LENNYREDBURN
242,986,337 *1791737846D3281850A69E0A5BFDEC3F73589AED LES.BALE
242,986,338 *1790F4A5B231753ED09B2BAAB399C2324A9A12DE LESBERADO
242,986,339 *179D9A557C934C4AB16136CB98E8B85111ADE3C1 LET.YOUR.BODY.LEARN./.CONTROL.I'M.HERE
242,986,340 *179A02E798BA501FE54095A895DA51BCFF5B0CE9 [email protected]
242,986,341 *1797BEE0DED17CFF4FEC9C2238465B5AA3C50C29 LFREGNAN
242,986,342 *179CED84B1BF46F104C43FE450D6ED897396FE17 [email protected]
242,986,343 *1799BC934CB94467D68C05B29E423DBB9F655E67 [email protected]
242,986,344 *179EAD256B835C1E42EC14BD27AF2A89984F2154 LIDIAGHERGHINESCU1
242,986,345 *179E385DBE18A9B4F9B78C11FE81BC35E841A7B5 lila143
242,986,346 *179DEAF48A8B1E6B1EBA3F73D1A1179DB2192379 LINKAGES
242,986,347 *179B98C506B5F8E53BCA9DCDDF19EFC2CA6E08B3 L’ISIA
242,986,348 *179F9D45270C3D52B1A09CFECC3711503F18FB6B [email protected]
242,986,349 *179A1BE121CF05F8D1BB60A3474D656A8560028C LONNYALBERGOTTI
242,986,350 *1792E34389315CA437970FFE2B07550CB485136E lorenkueker
242,986,351 *179DD6A3947D5B43036F3B044317FD4872B4DEBA lorenzocofer
242,986,352 *17940002BAD4430708FCC46976C47B7A7F1F3748 lorenzogueretta
242,986,353 *179906E3DD1E167F7870B0BF1FE8A62939B4B08C lovely.today
242,986,354 *179D46D26D6ED4456AAD9AD507DACCE728C5B45E luisguzzi
242,986,355 *1799E8D2601C3A7A7A44B63B15A56B9E76C51996 LWDS
242,986,356 *1792F8E30BD50644FB5D41162F2E96853ED33258 LYNCOMM3
242,986,357 *179F27DA31528E442918D257636506D38852BA86 LYNDONHARBIN
242,986,358 *17952AD52004EBC3F9AE3259F5F7448DA5947224 MA026
242,986,359 *179D1B557698162EDF213698A2E0B7FA65696B69 MAHMOD ANABTAWI
242,986,360 *179AE1A14C68548531587A19A4A9830D5752DF7D MAIA533
242,986,361 *179E154F00431EDEC2EEBB307018F633D6EDAB72 [email protected]
242,986,362 *17902082448429E4DAC131EB9797AD83B3473CA7 MAJORLAUNIERE
242,986,363 *179E2D698DEA66EDDA7D8C92BE3A59F6F9BFA908 MARCDESJARDINS
242,986,364 *1791FC325AB0A28ED943C9335F050B7BFCA1360C MARCOBILLECK
242,986,365 *1791BCE3D8135735A04EF2E446B2FF27254D22C9 MARCO.SCHANK
242,986,366 *17989D7BC8529E76195B5582C3958CE0DA7C7417 MARIANO.BROWNFIELD
242,986,367 *179CF750CDC9BF4067BB329F88CB0C83D9974985 MARIANO.UNDERHILL
242,986,368 *179B5066EC3C0771447C8C0AD428FD48F4B926ED marioberkery
242,986,369 *1798163EAF2C3A4C089C249B19DBC99700A87BD7 MARISA.DE.AZEVEDO.MONTE
242,986,370 *17911845D40B128700CF9A7848186807A486BBB4 marknads
242,986,371 *179CC43841AA2BE23B1A8BE8BCB1AF1716197BF2 MATT1946
242,986,372 *17956D7FACE0C18B9B0EF53CAB6894878505AE79 maxslight
242,986,373 *1795F5EFE421FD4E154DD843183EF6750E15152F maxwellhaigwood
242,986,374 *1797062E1FD9FF96AA950CA642866B7B409DBCB7 MCDONNELL DOUGLAS MD MD-
242,986,375 *1791710E1BB40F14F1ED5295173076136BC674C9 mcdpeptid
242,986,376 *17934B0ABA1E0F5E8B35B9DB96DB5A3A79C640B2 M>D}
242,986,377 *179B72186DAA356CA713FD99B37FA231692CD779 MECHALY1
242,986,378 *17928DA0F3B793CB549E51C41D70582A18D95C56 med0
242,986,379 *179794C493A790826866720237597B0453FE6E1D meggoh
242,986,380 *1793C2067C69940489D3A1A0F29475A33DC5C505 MELVINPLAUCHE
242,986,381 *17917966822B3AC9648E4BCEA65DE161ACE8D176 MERMAID'S ROCK
242,986,382 *179516EC3F4BB81BF1FF9F5AA9D950BD6CF97AAD MICAHKANABLE
242,986,383 *179AAE92194A0BDB67C9869B7AB1B5B3EEF633C0 MICHAELOURSLER
242,986,384 *17925B717ABFE3FD0FDA9D329C01A7439352FD3C midoricinder
242,986,385 *179A594CD3F3583D0E238659E13F992AD9BCDD28 MILESJAYE
242,986,386 *179C53DD3F3D8B3A6956C9B6E68222739361B586 MINH.EUELL
242,986,387 *1793843077AC55518CB17057969D889EA4FFDD98 misconceive
242,986,388 *179F2C69B7A94BFA7EE0CBA199D7BCEE1B765F6C MOSTINFLUENTIALVIDEOGAMES
242,986,389 *17970B6187CD9792A949BECF2135415F0CB296B2 MOZDZKUED
242,986,390 *179432862B80692EF48E864F1FDEAF9277611B91 [email protected]
242,986,391 *179D8D30CB5D3A342BBB9D1BE1425BD6726D2CCE m-soutine
242,986,392 *17937850D13A819CDC6B2EDC376C9E2A7A200903 MUHIDDIN2
242,986,393 *179E3B085FDF7CC425108D2F8B9231E0B9400820 MUSUBIME6
242,986,394 *179E89BFF13779717D22524828A93234FCF27C66 MVIEROW
242,986,395 *17990B5DE5E146ACC2C73A4DA064EBE037F0D964 MYHELP12321
242,986,396 *179DECF91A4951CA139148F28147B3EC7DDDB928 MYPIECEOFGRATITUDE
242,986,397 *17931D22485B676DB06CED612B191DF82E04B1F3 MYRANDA
242,986,398 *179ECF743F348CEB91B159D85E23201DE1C23D4A myron-brady
242,986,399 *17927D55A4F32F4506BB2DF765EAAFC818DCAE48 M~ZO
242,986,400 *17947755B792012EB757C0B0581712BF143578CD N1843
242,986,401 *1790E74B281AD623E55791F0E74934B100C2335C N57458
242,986,402 *179D63C769D44242B70E03CD0D35B76E98C8DA96 nadony
242,986,403 *179953C640159AC245DD2FB2D448AEE61B2D2F38 nascarsylvia
242,986,404 *179B6AB72BDEBC0C7D2994CEAA31AFBCD6954F97 NECULQUES
242,986,405 *179A6CC15BF8A4D9FA376CAB54FFE1F647240FD8 neologization
242,986,406 *17978A6D9B01D55586140756313DB0FF7C99F4DB nhguartsed
242,986,407 *1793D6BE0749F6F70EAFE142D95E7FA188F65942 NINA HARAHAP
242,986,408 *17971CBD39A99E86BBC3ED1C1FE67A1746343A80 NITHAIAL
242,986,409 *179060A5815071E2F3929BB73690A9663A6B8D53 NONLIBIDINOUSLY!
242,986,410 *179F9E01EB0C2250DE32DAE9F981250F84CEB643 NYPARE
242,986,411 *1794E7AB547CCB61B154F7F822CE4D4466424CF3 ><.O~.0~.<======3
242,986,412 *179337808A4BD0FF66225DB68E15E15C70865893 OBILAGE
242,986,413 *179CE4D483DCF9DBE9C6251CAA6B4CDD9F43E3EA octavioperrez
242,986,414 *179E3FD44C665D1086799F91548463B33ABE5F0B ØDELAGDT
242,986,415 *179A08ADFA5829C730FF2A684B648A88CADD1171 ODELLWAIKI
242,986,416 *179357D202C3C17C2879167EC03D7CAABF170F71 odishomles
242,986,417 *1796883BA11080A3AF055C6BE0A81F10E44C15A7 OHCERRE5
242,986,418 *179A67B37A560489C7DF1558AA7E1164B8B4A01D olenlaurelli
242,986,419 *17991D168052DFC586E8A699560A5FEDEE6029EF OLINSENOSK
242,986,420 *179EA9CA106E4C25C98E54020B2725855F104874 OLLIEDENZEL
242,986,421 *179C7FD67C9659BB54EE415C924BE52C0A1AC700 olliesiaperas
242,986,422 *1798F96EA3728F1E03157868FED1F2285ACB1E0C ONDULDBAARDER
242,986,423 *179F5FBF3518D5C817067124B3DE31F6FCC1D2CB (O_-)~`.~`.(----q
242,986,424 *179E7E6F30F6DF5CECF2940DB6653A9EA3661058 ornamentalism?
242,986,425 *1790FD0A4AA9A28B15ED74D81610645537CCC0C2 o^%z
242,986,426 *17928E3F4C3B8536A638C9AB5D87B63D266A6A2F PAGEGRANULARITY
242,986,427 *17941F3AED39F529FEFB543F2F4DC7689A0047CE palmerberey
242,986,428 *1793F6D9DC9576114E29CBC13D247DD2C696F9CC palmerrecher
242,986,429 *179D02BCB8E5F24C06857FFA63FF8F3F7AB0C544 papagaio-do-futuro
242,986,430 *1799AD5085BBD5787AAEBBE879AD9339E129D5AC papalization
242,986,431 *179CF54631CB2F6F181FFC77E2451F0B85A572E5 PASQUALECUPSTID
242,986,432 *17986298E42D57E14E7A4645A2730102A6C1977D [email protected]
242,986,433 *1790A19045FDC4203228ED8061E56E263C037763 patogus
242,986,434 *1797E34E1DCBEA67481A3F98CCDB7B67F668CA07 penalisables9
242,986,435 *179E8C2DC21366DE2808C26FA2345EA6E71A3E3B PETA.TODD
242,986,436 *179C2D6FFD45A278C7B1E1C6E650111F82F431F1 PETEFIEL0
242,986,437 *179026702449FB6449096D9A3989804E26BF178D PGPKEYS7
242,986,438 *17927C6E77862D49433E6D62C02E72F6A958AE83 PHILMORGANSON
242,986,439 *179A25CB7715EA05E6C82A190712EA32F4DFAE72 PHILOSOPHICUM.DEWWW
242,986,440 *179065D453CF5B17CC1B8D74B9373667F25FBA55 PHILWASZKIEWICZ
242,986,441 *179843FBD414839AC01641E310F86832AA83642F PHOUKOUNE
242,986,442 *17944C8201D63E98A472B5C8E368D06C2C95DF8A pitch-shifter
242,986,443 *179D61DFACF5F255F95F98A9C55FD2015EE90E58 PMID17135502
242,986,444 *179E26E31947A173961E3008362A49CE30777ADC PMWS
242,986,445 *179723EAF511A413F1861B1B2C550E7330368F76 Pom
242,986,446 *179773A9D78ECE3E0E8C3CB341738C067B80EC69 p######)~O ~o3B<
242,986,447 *1790D0622B839FEB11A9D51BFB467848AD52C835 PORFIRIO.YADEN
242,986,448 *17913AAF9E684A918F23D9090C2B1E7BFB58B5F5 postonal
242,986,449 *17963883CB946CB986AF244110A9A008759E50D1 P####P-~O~O;)
242,986,450 *179AE6C60CF8DAC15D8BED0B20EC3C47D0439940 p---P*-splat!
242,986,451 *179A809AFE35151B0D3E4C363A0C663399EC83C1 PQ)~
242,986,452 *1797C323BBEB6D0F9304099A9E210F5CB7D835B8 prema-antony
242,986,453 *179CCBB2626C0C22834D791BF7099EEAE1070652 preresolved
242,986,454 *179DD9C25E2B861E5B9DBF1A5BCD0FBA3991DD2E ptdwsaik5
242,986,455 *179BC1597B4BAD1AE62E81691ADB098F414EC819 PUROOSHOTAM
242,986,456 *1796F17230ECCFEBF10F97A689B06D93BB5898F3 PYVL
242,986,457 *17972065169188B0D8356410FA21462380B5F6E4 Q128844
242,986,458 *179F626A1C1030288D83D2EE75CE073D1AB8102C [email protected]
242,986,459 *1795F09DC4B8A49380FF4CD182DE6367056B0FE4 [email protected]
242,986,460 *179BBB087C29EEFC6A29144A8963BA23EF79536F QUADRUPLICATION123
242,986,461 *1798A9C4B73F2EA449DB935AC4AB398BE84CCB21 QUEIROZ3
242,986,462 *179CA1A51603D1DB3D76C4E8FF282C3F27107C0C quicksand-(feat-nika-zach)
242,986,463 *17997C5CF4170D5F2068A45F84DDC5BDCCFE7770 [email protected]`)X(
242,986,464 *1790D8134F5072A2EEBD551A2EEBF0DF63EE518A ragazzoultr
242,986,465 *17969558D19BF29DB822ACD02578FA6C7AE0A650 randolphguieb
242,986,466 *1799E7997FAE99232D0ACBA92A215E7243784D4A ratio79
242,986,467 *17970150CBCB38E1D2BAA49C0D8169AE0EC35778 rayfordalano
242,986,468 *179913522FF44FF394E2C93B481EA653F905971A RDWZXXISL2
242,986,469 *179F59869565DCB932B134E2A01613B3DB7CEDFE [email protected]
242,986,470 *1796297A75E4F61483A7E72A8E742F66B88E1776 RECE1EBRA7!N9
242,986,471 *179A5ED4195B49F51F3C74B4C2D0B7F3D78858DF reedbeltz
242,986,472 *179A344455222392C137955F116DF7D2ED10951F reginaldreynold
242,986,473 *179530997ECA8B547DDF303F8D2B3D5C7D3A72F9 REINALDOMANIERI
242,986,474 *179A0E44EF9A464783F977EED4CC334D8C14D7D0 rekezrev7
242,986,475 *179C7A061291BB551D253FEF76D3E9C3DCE20CD6 reyroeser
242,986,476 *179343C2EC9476029F872DA698A5BD068391DF93 RICHSCHNABL
242,986,477 *179D3EFFDDB2ABE854B7D3C4DEC045AE21521E25 RILEY.BONAPART
242,986,478 *179219DC0214FBD242DE9D0073E1B891041FB4FB rity.policy....In..order..to..determine..whether..or..not..a
242,986,479 *1790177B35E1FB9BD98C0569A34B7DC509B7067E RODRIGO ROA
242,986,480 *179ED50F79EEDF238E97A74882F519DEF02BCD00 rogerfrancis
242,986,481 *1794140969F63E2D1814D4F2A53C2CED158916EC RONNY.FITZHENRY
242,986,482 *1798800B304EF9A31906742EE66E6B175EB4F024 ROOPESH AP
242,986,483 *179C6190F4DBB6E9B73553AA0962A8B84DE5712D ROSALES.MUNICIPIO
242,986,484 *17969168AC4E0B55F89774E783A74114FC23D86E „ROYALE
242,986,485 *179395B791949E39D342E60409F61EB9C33A23B2 rubinschwenck
242,986,486 *1791027771B0CAF833558026E59FE1931E74EE6B RUGIADOSE7
242,986,487 *179244A1CF29E3706E7E4C230D7EDF61B1A1ABE0 RUM.DE.LAS.CULTURAS
242,986,488 *17922046B6A78B2668BFFB91A4E2B30C9A739BA8 r$:v
242,986,489 *179CC1DBCC9ECBB4CCF458C6E06A97E082CDCF39 samonas0
242,986,490 *179BC4F85E7FAB4E18C735E6A8E2C69C656676E8 satnacni
242,986,491 *1795D5A083146B9E5ED2E7F6B16AAA0F1E1953BC SCHOVANCE5
242,986,492 *17988AE48F1F677F8C7A98EB4D30BE5D4D6AC0E9 SCNTIDO
242,986,493 *1794D21ABB97190228CB67D4F12D9126CD552DE7 SCOLORIAMO
242,986,494 *17934701D32046C1BC1863B561A5CAEB4AF7B659 Selfmortification
242,986,495 *179333CA58AEA16067022B55918E7E375A25794B SHIROMOT0
242,986,496 *179547F096C34CFE5C080C2C43FAC2EFFDEE12E8 SHON.FERRITER
242,986,497 *1794EBA6F911634BC30395A86D603174E1D7D996 SILBERBROMIDSCHICHTEN
242,986,498 *1799BE2D35D3D1B8F57DA20E1B27F05B6EAB134D SINITT
242,986,499 *179A72D5CBD489BC15D0A81D584C8F9C055D72C1 skliens9
242,986,500 *179EC29457E9E0392814CD4C452E16E3BFAF2471 SMGALLOED
242,986,501 *179005FB25A8619C803A0DD246C7E3ADDA734DB3 SMOKEYDOROTHY0
242,986,502 *179042063641CB2911F336E48D855A05040BE074 snetknob
242,986,503 *179B990EAB5205508CC16E88BDF06A11A255177E SOLMALADY
242,986,504 *1793FE5C918DD67C0B64A4DC24294D8A5264476C songforvegatables
242,986,505 *1794431A68026E3908CFF49C1A4E2A25C5CA12DD SPEZIALWORTSCHÄTZEN
242,986,506 *179FA5D577562FE8E83A81A001351CE1AFFBDB69 SPLAT0~(------P
242,986,507 *179D03259AA57AB328F2D3F76D9D4B8F0D3BB51A splat!.~.~<3
242,986,508 *179DD81006FFA5352E3CB0A21327C658FDFE018A splat!! * * *<##q
242,986,509 *179B1A89981BB21EC3262F7F503A6959F3C869BE STADTLEER
242,986,510 *1797C576C88145C1FAFF5790248B6BCC69F102B2 stepsequencer
242,986,511 *17968A103423053AB03EDBDED1F8B439021FEB3D STEVE-VREEKEN
242,986,512 *179B3B705799AC09A039F6319F7CF9991EEE0218 strawbergrumpy
242,986,513 *179E34725F0774FF652329548CDD7DA641E0D8B5 SUBPATHSBSW9
242,986,514 *17941D548EFA0F6E98CBF2232B225D61A754774C SUILEPOEHT
242,986,515 *179BB9D57719F4C8EB7E2E56F2E15B0F1F31CF7A suitoucying
242,986,516 *1792D4790A3589E9FC27AA16216F85DBB5A92E66 SUNBIRDSPANISH1
242,986,517 *1794AF6DC42D751E975FF414CEB8D1FC3B39FFBF suzannelogan
242,986,518 *17907E88C459D8D433E5651CC63CA374A5BF8504 SWAPNILSARDAR
242,986,519 *179F11DC8B93B0C50222DC0319C765FF79B83642 SYDNEYSATTERLEY
242,986,520 *179F2DBAC0FE42D2813A16760CBFE4EEE872D022 SYEDKHALIL0
242,986,521 *1791EC774BE638487F3C7CC9218C0F2EC850B18D SYMBPGMSYS
242,986,522 *179ACE28603D3A17AEB01CD46E707D12839FB797 tapi3ifh
242,986,523 *1797B7D36D7EDFBE74AFF5DF4DB656A925B20206 TC4235
242,986,524 *179BDF84D4802648B08BFF6CBDC242BB1D9122F0 TESACKORTE
242,986,525 *179DA6646A15C84ED68B8D52C8648F70FF18872E TESTTESTSYLVIA6
242,986,526 *1795543777C91DFF1B70A782F46D4F039D1DEDB4 thatsports2006
242,986,527 *1790759C397BE8B802BEAD4FBB77819095358406 THEREVERDAMONDO
242,986,528 *1791B2491C626C9103C8352EEE2E3F31D94FF453 THGIRERED
242,986,529 *179B032621063BE01826A60DB039FB2C5506E352 THOLLEK
242,986,530 *17919D19E617216D6BCC90D0A2733BEAA08F34B5 THUISHOORDES1
242,986,531 *1793582211E36E9E81C1D627A915A9740DCBF8CC TIATELPMING
242,986,532 *1796E15AAEA77B2B6A0F220C0F517B933FF3AC4A Tie-Your-Mother-Down-(feat.-Joe-Elliott-&-Slash)
242,986,533 *17972F35E929ED91960883EAA9799C978756930B timmyokura
242,986,534 *179F73D6F0F1627DECA804028D7A7D8858A453E0 TLOMSNEM4
242,986,535 *17906508471F03A7DB4ECE401685C46BC1A41639 TOLPATSC
242,986,536 *1790C49377B49B1881D07C3EF7C6593C1D04B4EC totalfieldmag
242,986,537 *179004D547FF99AE309BC28259FF97A59EC18AEA TRASVERSALE1
242,986,538 *179CB1B8AF62C10F2FD60ACBAD93667F73F87C3D TRAUNIKS4
242,986,539 *179CA1CA458C58B091BCD215CD73DB97A5390191 tsttrfld5
242,986,540 *1798EC76ACA28F1EF9AEE6753E221FA345319232 tuteanujulia
242,986,541 *17987E1060713BE9DD277C16A9215AB6339667BD TYRONE-CHRISTIANS
242,986,542 *1799BDCA8665105882CB852872F8E426C0EAA0F8 U`&$
242,986,543 *179FB201A8D40F30A499D25CBB1C384F6727AE4A U95417859
242,986,544 *179AB0B78917873D2EA8EDCF944A111D0F6A7359 uF6
242,986,545 *179BA8B5CFAFCD9E8AD4681D707E2EC705DD9082 UNHOUS3LL
242,986,546 *1792964821C783143C7BCFB00A9831635C093E69 [email protected]
242,986,547 *179E673C972186AD524BBF98507C15C350BA0BC3 [email protected]
242,986,548 *179849EB286C73731BE7F264AAD47FCDDD31B4BB UPFESTOONFIG5
242,986,549 *179D2A34F7CC962C2C7030D3B5A4B6E50445E4B5 USERAS108
242,986,550 *179EFB4CD5EEE24F07317D51FDFE09A6AA41A6D9 ut0t
242,986,551 *17937631BEC44EA0329AFE89B2EB1BD3C9DE8AC6 UYRX0MWNBBS
242,986,552 *1793CD491BC018F658DB7E766ECA36670DF27DE6 VAHID.BAZMANDEGAN
242,986,553 *179F0F994EE718781FFD183328799835D30E70B3 VAKANTIEVEILINGEN
242,986,554 *179FD8C2F0A0F378FF653B4062065BB97465DD8A VALENTINEKRAMMES
242,986,555 *179879A966CCCD946C9AB8D5ABB68D9834FF5F99 VAL.KYTE
242,986,556 *1790F3ADE613BC98E13D3913D08F125542BBBDB1 VANSY
242,986,557 *17929E172F0178DF9D5D30059837383D5B0FCF20 VAUGHNDUNKEN
242,986,558 *179C91005A698693F31D8A6820678E3CDCC16B1B VENECCA1
242,986,559 *179E346819B78EE49E74CEA77A19AFA5A29D77E3 VERLEIDELIJK2
242,986,560 *1796DA00AF47DCEF36E007A1B753FCB8BEB112D6 vernsandburg
242,986,561 *179323B2A286509415863BD7081E17BA414680FC VERONICA-PRASAD
242,986,562 *179808B24E996887827929DF9781B90E8EDADF15 VETECËS
242,986,563 *17975BB5A86F34B3C01F4915975657223CF8B37B vherna-borja
242,986,564 *179050CA86570620F3067F89E38AE850ADED639E VIMAS-PELO-GAYE
242,986,565 *179407B4EE619A63F702AE2D0D799637A99FAF2C VINCENTRYANCOLOSO
242,986,566 *179EC8B69E783688C4E7063BB10A3910576046A1 vinnieimmediato
242,986,567 *1795BE0F510640F65D74423E53AC709A59927EA9 VIRKE2
242,986,568 *179015746ACD53A98EBC9A6252248FB04D009035 [email protected]
242,986,569 *17976DF350136F6425CC9A9078284FCBEFB648A5 VLOEDIGED
242,986,570 *1790CAD537EB4D96BB19DF985E60FE75D4D6C684 von zuben
242,986,571 *179C47571D268D317931A54AB96C7BCBF29CE2BF vyhotovenie
242,986,572 *1797DC479B2E93E279EE35E872D9B7F12D0FB919 waffenstillstandsabk
242,986,573 *179A02410FF1B9043557A1EAC8A97F5E4E07D2DA WALDOBRACHLE
242,986,574 *1798E077E21D9A4D74905E59B95C56808906530B WALKER.LESSMANN
242,986,575 *179C4B242280E35DC685DAA65760B335C7D91329 [email protected]
242,986,576 *1792A6FB31FB28260CA4D62BD7603C29AC7FFA7F WANLUIDENDHEIDS7
242,986,577 *179A3FF7672A9D26E094075B922591D3AF65A9B3 WARREN SUITER
242,986,578 *1798A1ACA144A7BB820882EA6FA544F6EE0D6F74 WATEENUURISEENDAGISEENJAAR
242,986,579 *179E90322B6596B94DB61BF9C54048DC9D90D823 WEBSTER'S.TRANSIENT.GREEN.TRUCK
242,986,580 *179EFB9211AE655FF1A5FA914D470FF14AC68B1F WEISE&KOH
242,986,581 *179BA1E68F8D5A64F0463C63647C539D59E6ADF8 WELTSKIVERBANDES
242,986,582 *1795ACF8B5EA24B3160FD1893375BE20A5634CDD WENGAI.NYAMAPFENI
242,986,583 *1790230A07E97F8B234B28DCD2DFCF603148E3D5 WHATHELL5
242,986,584 *1798C080E1574F4212580E57994F772F2E98F0D2 Who'sDrivingThisThingAnyway?
242,986,585 *179802309D9A8C9E5F5F416441871CEA4490C089 WILDMANPEPE
242,986,586 *179A0AA20AD38B2B22BB7959EEAED535E473D193 WILLING WAYS
242,986,587 *179FB0591BB8E53A1D25CED98799C03E839819C8 williskopel
242,986,588 *179A9066F2B4828CECBAD62EF12CBF31CFD145E3 WILLY.WALKIN
242,986,589 *17979543E3FD36A23CB5BBE3E8DC46113F234E8E WIMONRATTANAPHANT
242,986,590 *1791073661B422DFB027208FB0EC72B61F03952D winfordvanveen
242,986,591 *179B6B4FDF1C48104803770D653C6AEEEF1B1ADF winstonherrel
242,986,592 *17996E7D33F5624BBB57AACF75B2374E4D75A14B WM.PERGRAM
242,986,593 *17986131FBBAD3BE804B8EA5F731024235D5703D WONGSATORNK
242,986,594 *179A694A1E6F27EDCA768D3B63A7FE7813BF91A6 wordup(12''version)
242,986,595 *17929302FC78FC401E9B764CD5C20C678EC0C179 {X}-0~(---B
242,986,596 *1794BA5C44CFB8F0B1EAC7016CF03E753ADDA221 XALXOKOTEPAZOLA
242,986,597 *179D47344E70E7317797E5E88F341E0BB892AEEA XDCCFILING
242,986,598 *17914C260205FB0DB8ECD81D3A32C265185EF455 [email protected]
242,986,599 *179CC109CDFD16FF3E132C0096DC2880EC2E5D08 }X{.o~(==3
242,986,600 *1797AF7ABB454F7ECB7460BBCEB49497496CF54F )X(O~D###B
242,986,601 *179A3DD28454DB0D302B142C7D74E0E5451F8497 YADNUSHTAED
242,986,602 *1793942225FB526454F75D82AB0119CC14933404 YAT.KEMAD
242,986,603 *1792DA46D083BED7BE8D4854F668260CCACBC136 YDNARBHSIFTAC
242,986,604 *1797C7529E34EF0B60ACEE1F95DFE60391638B87 YESENIA.ROSARIO.PORTILLO
242,986,605 *179E1238804BCF43038E18E5B0DEBFC43858E74B yevrahynnos
242,986,606 *179D0BB5C3613A790F312923AC19543C2C8722BD y>h
242,986,607 *179035FDF63547D4C8CBB2ECC370FF3B5490F8A1 YIANNOULAS
242,986,608 *17962C3E16FEB215F8C13B67F0A69068316BA9A5 YLREGAEM5
242,986,609 *179918326B5A91A25D4E6BB7BDA6A6870019C3BD [email protected]
242,986,610 *1798098BF88F60079C9B13420FD7ACB8940575E6 YOSIDA-HARYATI
242,986,611 *1798C0AFF32101C1DFE37F33D7D85D2E2B682998 youkoku8
242,986,612 *1793E90F7F887E2DBE7516A48760614579197709 YUYUN-ZULKARNAEN
242,986,613 *179F0D44C267F15BD564C3CC3E1219466D468B74 z0a582
242,986,614 *179E36114E4EA704C19CB43319D8D26FCAFA0F19 ZAK-DJMENTOS-YOUNG
242,986,615 *1795FA0165BFF52A640CF5783A3FA9AFBC357C26 ZAYNAROBERTS
242,986,616 *179F797F32F857EDF77C8430DDBCF8D99EA18994 zE8
242,986,617 *179D7F0EDBDC3B98719D081199946DD8B35ADD9F ZERITTEJING
242,986,618 *1793E2626BE854B7624901F61417FF07B672925C [email protected]
242,986,619 *1796BD38FE5661475DEA4CFAE775B330C184E917 [email protected]
242,986,620 *17918B5060C4B77F1EC7CE82FCF56EEE679E1DDA [email protected]
242,986,621 *179DC8531B5A213564263DBB9E0848D910E7E7D4 ZONESYSTEMERN
242,986,622 *179D1CDB3107A8FA4D993B3D611F292F2FEA79DE μοναδεσ
242,986,623 *17967339CE85A4DD532F09BA246F73519B761AD7 ОКУТИ
242,986,624 *17933685AF18618DA7E2580F3AC98E5355EAAE35 ОТТОБІАНО
242,986,625 *1791EC1105F20AA138D8829C47608BB9AA41357E  ДОЛГУШИН
242,986,626 *17957A89EC9EF373C3F4987E9559859313CCC543 02011481
242,986,627 *179AE7D42C51C39644A14289980085D667F15AD9 (_0)o~ [email protected]#3
242,986,628 *179F3787358A6C322CB9FAB373A37701F9195991 1136175 NESYYT,JOIDENVUOKSIL
242,986,629 *179A17C4D63D682082906C0603E3D81F816D35C6 1150659 jarivanttaja(oulunnmky)pukeep
242,986,630 *17963416149A89423CECB623984924050DF3DF72 1186961 tutustu.my
242,986,631 *1791734BC737C8801D3300F68ADA8B49266A6B2A 1265094 suomen.ministerit.ja.s
242,986,632 *1796A03E614340F0A4C54E5ED7B888AEDE07B688 1278058 koettu terveys m
242,986,633 *179E71D434C7C8BC347EFBFA679D05BF1D0B6EF8 1296562 NORDIA JA SKANDIA SEIN
242,986,634 *17961829D85EC8C8B182608C3E4919E2DE8F9815 14roessl
242,986,635 *179609CE69D7D47037AF6013D5D344411FFF541F 1510091 OTHERDAMAGEAPPEAREDLIMITEDTOAFEWBUILDINGS
242,986,636 *1796A6895AE77E5BBF9DC7BE66B5380EBEF840EC 1704045 MENSCH-,-KOSMOS-,-TIEFENOEKOLOGIE-.
242,986,637 *17996803F1D81DE10A88C3813C02BB974DE51493 170574 Iletken-On-IsItma-olanaGI-mevcuttur-
242,986,638 *179410C89C96D70D1E51D17080A87BFC22BB02D0 183UNDERSEA
242,986,639 *1795FAE9DAEBB8A9707968D1A42A654EDD0C2577 1896800 der.kirchenvorstand.sah.das.nicht.so.locker..
242,986,640 *1790AC7CA44CB92CE0B965596E894F95369572D3 19.komplementaer
242,986,641 *17914C8FFACB2B3E10F80888791611980BB7F133 1 ARZNEI-HERSTELLUNG
242,986,642 *179CC5E7B0C865CDCD8685932A7409B588D43BCF 1bolschoimisere
242,986,643 *179589EA0725FF84EBC4CA60082171DBF5B3F8FF 1BRITIANS
242,986,644 *1791E196720CC81C4488D1C71C7DF300724BC471 1.CLEVELAND-AKRON
242,986,645 *1793E6256B192BFAD4D2B0BE01E07B7BA0B737DC 1-CRIT-SPEAK
242,986,646 *179C1B6EC6815E325F9A034F1B695048B8D1D12D 1 deltaivrakete
242,986,647 *1792D1E0911A135B822ABE43642FE3969103F4B3 1DIRECTION-SOUND
242,986,648 *1795FD2DAF2985939CBF2AB2706AAE25E6A4EA30 1dOrtlemez'in
242,986,649 *179FBB9CBEE42056B2D9E5DC40E279514615AADB 1FINIREST
242,986,650 *179304A1E1E1287211EABC2ED10A401F3CF55293 1-foorumi-tunteja
242,986,651 *17931146676BF87989C8E514C4D27E567309D011 1FRIDAY-SATURDAYS
242,986,652 *179A78458ED278D816BEED44203162B3E4D9AF03 1HELLUOHS
242,986,653 *179E2B8B86879A822DDB171F4F45D4C23CEF65FC 1hengitysvaikutukset
242,986,654 *179050ACE2D1F50C3E3144A61A97F948BF91C8DC 1 INSELZEITEN
242,986,655 *1797A5DEE2696DCF24AF28EB176731B6F771452E 1 kofcaz'a
242,986,656 *1797B8F8AACF6C457843413476F144AADD5E860B 1-LEIKKAUSMIKROSKOOPIT
242,986,657 *179524FB9D7679D6F4E3A39867B594AC36C76E78 1 LENTOSUKAT
242,986,658 *1790957935182C816846802DB20C80BD372FE613 1.LSUOMEN
242,986,659 *1794D56E37A273828EA7F04CA16682D54786218C 1 RATAAMMUNTAAN
242,986,660 *1794A5E0A07D5E9CC006E7D2A6342519D244E0DA 1-ROMANIHAMEISIIN
242,986,661 *1792C1AC793A0469B48251C3C93DA75CCE9C7A2B 1SELECTTHEKEYPAIRTOREVOKE
242,986,662 *179AFAA9EAA00BD104C596A5479626EFAA748CE6 1.SNOW-SCULPTURE
242,986,663 *179F0C4DBBC70FC7B12784D087CB2BE9CE9DECB2 1.TESSIN-BESUCH
242,986,664 *1798F912E5E27152C94D9B33F204928FBA2EE0D0 1torinolle
242,986,665 *179CE521A3510006D1B709562697C24F2033750C 1varastohintoihin
242,986,666 *1795D8CE49A487FDB9CC437DA57271BEA9064FA3 1-ylirannantie
242,986,667 *1791E3A9CD2F5D621F2151E0356A7B14BEBE1075 219982 (BALIKESIRUNI
242,986,668 *179395C64287E2C7B9BF229D71A2F6C77D6B09C6 2212800 auch.adoptionen.sind.ein.lukratives.geschaeft..
242,986,669 *17940DDD7EA20087BD1F480346C7A76560CE7B0E 2382495 SENSIJAANTOINENKAUSIJYPINYKK
242,986,670 *17959FF60E2D95221F59CEE916C50E5FFBC4A8D2 2532576 the.index.fell.4.31.points.in.1990..
242,986,671 *1797E536F1AB4C08DDA41EAA6B95AC079AC49638 2554710 tampere.on.suunnittelee.l
242,986,672 *17937CE4EC95FCD2EEA33A72FBFC1186CE33DC1C 279845 YAPTIGI ISIN BILINCINDE OLMAMAKTAN KAYNAKLANIYOR
242,986,673 *17975DE765D5A66CD8708B73B16DAE66257403B5 2-FENSTERAEHNLICHEN
242,986,674 *1794885AE850837C438EC02F61D7500647CFB342 2.gartenteichwettbewerb
242,986,675 *179E4B1C6BB6BA0E5D3B848D9CD7CC1BBC4AD282 2IAMSWEDEN1
242,986,676 *1794D686517329822E3E21815AEB8C384D58EC77 2ILUVCOCACOLA2
242,986,677 *179995997B774C6BD55C2CB436FFE3A4BD07BA4D 2PLASMOLYSE
242,986,678 *179C3213876FF7F04C0F65175BA63C4D62DF0E01 2-protocare's
242,986,679 *179677B424C5F4F619CCC5563F79369889450A3C 2shadyah
242,986,680 *1791D3174EB2346242AC2F0B2DB84739FAE3CEBB 2.unioniinkin
242,986,681 *17935175A68A42436DE77382B723D73E788C3538 354176 DOWNLOAD BITINCE LUTFEN BASLAT DUGMESINE BASIN
242,986,682 *17988E608BB34584D8A990198771C0FB9F2AA1CB 360426 edell
242,986,683 *179446D8392EA5F889B80C0B120AA3E06A11713B 3---D` SPLAT!!
242,986,684 *1798A843EC7A202D5D6BA6E6E8C47C696D571223 3PEBBLESP
242,986,685 *1792394BE5AAC3C89E940D04E3CECD6F5DB489CC 3#P~o (O_)
242,986,686 *1798BB54DE927FB2AF476F001C9AF69E51C4F3E7 3TOPEPOS
242,986,687 *1797B7EB2FF4695D36DE20080D96F8003B3174F1 434MAXIMO
242,986,688 *179C13AB4560462C8540E97591765FC82A1F7CC4 473167 lis
242,986,689 *17935C486155D22E05DC0DFF243787604CA6F8A5 4ANIMOTHE
242,986,690 *179F8A0546E643F8E139D1A0635FD9DEDE8A4018 4-batmaktan
242,986,691 *1798FAA0877ACFF5713C60AB9BA48016A37794C4 4HUMOREDLY
242,986,692 *1791E0AD67FBB1F98799E3E7DC5A5ADBFFE798EA 4INTYNYTT
242,986,693 *179C01D1BC190B077C53C7A5BD4362A5D0E6C30F 4LIPOSOME
242,986,694 *179A7507FECE0EC23D82CB18A06D05E91A926054 4VERHAASTEND
242,986,695 *179DC27A5B11D68F3B7FD6391F3EE474768105DD 5ETSUWEBS
242,986,696 *17948842F89F61750EC4B6BC6ECB7D794478A476 5FLIRCIARZ
242,986,697 *179B9A0B1700EC19B32E53BC72D2A29A0FEF2111 5RYHMITTYMAEAEN
242,986,698 *179B30A9CC454B12E6E015252210E7B6227E7B82 5SCHLEUDERFORMIG
242,986,699 *179792EB5843FC149B3FCE42B0C7486F95760537 5THATSHEENA0
242,986,700 *1794EA41487248086D6E8A0D3C99A17C5EBEFDCF 5ZISELIERT
242,986,701 *179119D929246179E7630C90491FAAD861B73283 6ASSHOLESHEILA
242,986,702 *179C619EF92E1519629F2444037D37B7358699BB 6JLSLBXP
242,986,703 *179646B8626C6BF3AE478413ED85D45EF792D32A 6PERCYMATH
242,986,704 *179D2E8F58707826EF61F0217C92C6225F7B8AFC 6TSLETTUL
242,986,705 *17976A4DD0545EAFAA345E42224A6EB1069F5CE7 6WEINSTEIN
242,986,706 *179E0CEF6F75FF65CF41C3B959EB9CB314821187 6ZERWUEHLTERE
242,986,707 *1795CBB9564734F73150EA4D21A35C31EFA19D40 72leonidas
242,986,708 *1790AAA5A1BE247A379F57CBF01431EC86882CBD 787KAILEE
242,986,709 *179F13CF013E250E41906FEF85EC7C34C4B9E932 7AVICENNIAS
242,986,710 *179372A7C0C7120957AEFB1C2BEFDFE0371D9C07 7BEGLAZIN
242,986,711 *179E31DD8A12F122E7114F049609E05369940DD4 7BSWLORITABSW
242,986,712 *17990C5DAF87BD23F3DE271A666E00DCEA752D66 7DELDRIGE
242,986,713 *1797D050F779D29F67CC6B1B440D7A44F11CC959 7 FLUECHTLINGSKOMMISSAR
242,986,714 *1797AF2D9F53AF7CA85729AF7BA036C72EE26537 7HALFWAYSTATION
242,986,715 *179A5B05571B8493CD3691918E985B7033E3373B 7IAMFERRARI1
242,986,716 *1794DB47E1643EEB6B1DF339C8B8F5E5D4667BEB 7JASONDAV
242,986,717 *179931F6EA1259ED4543E931CF6CBB3294AD2E61 7o73mi5m
242,986,718 *1796F1F0BFF3AF310611320BEF8515573F1D2699 7PPROCMAIL
242,986,719 *179FD1F686D56CACB4F722C1390B39526864621C 7PROFITABLENESSS
242,986,720 *179CEE8A5F24FE63772C3D5CE85C9A9F88DE3F34 7RSPERSPEKTIVETS
242,986,721 *179596AE4938366C1ED0CD5F6829C1AE1ECEA27C 7TEXASBARRY
242,986,722 *17904D9B3B8F09922E84F3ECEE53E8B5C9A4DC9C [email protected]#$%
242,986,723 *17958CD3366F22A0E78EEC6F8E4AC5FE2659F943 8------)-`-{X}
242,986,724 *1792447494B28DBC923F5D1051FB2EC638C664EC 985563c
242,986,725 *179D315D9CF36F51B6AE75A21A7D5A87545A5A4A 9DOORBECA
242,986,726 *1791DAFC91A5FA4CE446C87D2678B3C418D954B1 9HILTOBSW
242,986,727 *17954A80218058F459ED1D50933506A5A79B24D8 9IRREMPLAC
242,986,728 *1792B3E5ECA4F4CCD06DD45CC45DAFBB165571FF 9MAXWELLWELCOME
242,986,729 *179C960440F80A4AFAE63F2FE70A1460EC0B1D3B 9-STERILIZATIONS
242,986,730 *1795C889BFFFE7CDF7C26DEF6BDC757F3448D55A 9SUNSETDOUGIE
242,986,731 *1793B60703318ED229163819F7A19E0F2EE04F91 A114968
242,986,732 *179B81A2CB46021B0DE63AB5FC02104F9A80025A A1IB8
242,986,733 *17968F72ECC7DCED6C4BD55F9989B1AB629D95F1 A4CM3
242,986,734 *179EE756632148A58CC4B4432BFB0737F78DB7A6 A(-8P
242,986,735 *179D870F5D6C76FC8E1F12FACA6386BCAA11326E aaau8k
242,986,736 *179ABB0B0006392A94DB58826060E290D820B1DF AAEYEF
242,986,737 *1799B3B2F826196A862112E9CA561003821C3435 a)ai-
242,986,738 *179B7EED3C3932F44747AEF012B3BD4E0BE3BE0B aandgodsdiens2
242,986,739 *179023C16902EAE81F039184C0201C7BA66F4963 AANHANKELIJK5
242,986,740 *179A9EA656998AF861D446246A1C379FFC29A3CD ABEL.BAVIER
242,986,741 *179ABCFA21B049363D3B77AC7A90394E77C602CB abendnacs
242,986,742 *17917B139C643C60C252993A5D9969FE3DB9D3A2 A_BWO
242,986,743 *17953DFFB257C66733F33B97B58A17A095112186 adn0t
242,986,744 *179A7B10AF86B3A39E02DA98EE89DDE7236B9A60 aebw
242,986,745 *179572695AB0C7045E23D865DE3C57BE22D9A369 AH-CHEE
242,986,746 *17934F617D258A8FD6AA19B863CA6CF31CF86397 a_i#3
242,986,747 *179DE1CB39FBB297A387EEFB32D181B8307F53EA AJEKKISO1
242,986,748 *179FAC1475DD3C84BA1F79E1A259DDDD29995D50 AJVSM
242,986,749 *179B73E74CDE95981F80922D5CA023359F9FF164 «AKIO»
242,986,750 *179C80B5848111FDD39BC46EBC81751594E2AD98 alexanderpopat
242,986,751 *179A29634DF07760CC0CB2E868EDCB2482FC8AD6 ALIS BUDE
242,986,752 *179745D3E07D4652A185CFE0D356122945588FD5 alleriet9
242,986,753 *179EF144A30F904DADFEBD55BF9211B08686FC62 alongmy1
242,986,754 *17959B7FB0440B6F7CB7BB8FE7280649245CA276 ALPHONSE.STEEPLES
242,986,755 *17993843E07236003F04EFD62B9A0941B9A726C3 ALSTERSCHIPPER
242,986,756 *179A66E9D2BC4CEF1B90A67F8FB368809CA587AD al;wa
242,986,757 *179B58684B4C4D2261B4FAE11302A199BECA57EA [email protected]
242,986,758 *1792E58D9A83A3D13D45AA0BD36A31AB0F79DEF8 amy)e
242,986,759 *179A8E74DD999FA0848B7B6F9F787B1446DB23AC [email protected]
242,986,760 *179283CDAE799FB68EE82E3583904811CA506348 and-some-do-not-but
242,986,761 *179E1CB9EC4B7BFE3E8B96AB71B058DECE1F2878 ANECD0+S+
242,986,762 *179C0DD736F834A39305725CC82EC2C2B3C8E317 angelestaban
242,986,763 *179823C0FE73C0CB93FD25CDA57A4019A8BE29C0 antonymannick
242,986,764 *17989B097D6F05FFA7C8C91E91B07A523F1F181B ANUSVARA3
242,986,765 *179C77D3D0251D7D1A970AC893EFFB87D9379E66 apwtb
242,986,766 *1795CCAEC9ABE70BA767E602BDC9C8835F8B20D8 ARG
242,986,767 *1792FC566825DF4AA17C3B6B1342CC0EBE63F222 ARLIERUANO
242,986,768 *179117E65C01B390F04FD7AE03B981B88FC67D81 ARLIE.SCHOLZ
242,986,769 *1798B27C4785DB18C0F943C4FBD9FB4FC73ED2E0 armandorockefeller
242,986,770 *179F7CDEE9C057F74766A21CCE3B69D0EFA94395 ASACLEVEN
242,986,771 *179C820836686186E4205719F5426013D57DE73F ASHIGPASAZADE
242,986,772 *1790B7911BEEEC2CFD5AA034126BF77DD5D20AF8 ashley.rochelle.sanders
242,986,773 *179C591DDC0120BA900340545647CB8256D7A9DB ASIFAAKRAM
242,986,774 *17981F975CF5CA34C0810671BCB3D8C286B06075 At6$
242,986,775 *179ED8908D964C487960C3EE16F24BD0301D6AF7 AVERY.SOLITO
242,986,776 *1795C1E222E556D7B3063722BDDB7AFE7D9B9A16 avfolkning
242,986,777 *17921C1EA13F13A51A069E7B96FDD308EFE75466 awa)r
242,986,778 *179056AB7DA4BD576DAD0F573A85367B4A3EB09D a.xo
242,986,779 *17993D487D4BA546C2A8EF9161725C2626F30648 AYo
242,986,780 *17916517DA90317E7E11C3E5482A51A5A2305165 (^_~)~`~`<------b
242,986,781 *17999B034E14A0D00D0EFF54DD58AE9451DB2A53 b>^(
242,986,782 *179916EEB369C64E70098ED8DE48F4D8A800CAA8 (><).*.*(####B
242,986,783 *179C1F6CFE00B111ABB88BC32ED39D3024BA6188 b3qkl
242,986,784 *179764E4C59BAAD0DFA179EB470BA9758D05CBB2 B3TCV
242,986,785 *1799FCDCCADF392F1483E28BE04A55832983640E B,7F5
242,986,786 *1799828EC88C2982153609376886D511CC1B694A BA8D,
242,986,787 *1791AB80F5529FE5882C4B8A9D6270B3E9A19C99 [email protected]
242,986,788 *179DCB2918102C2A269ADBF53681FAAAC317C6C6 banapa.1.0
242,986,789 *17907058714BA9521D73E33FA7B747A48CA5BE05 BANGUERA
242,986,790 *17965F41A0A7C16D0B9CB79B0C3B343FB9DA3E28 BARRYTICAS
242,986,791 *1798A1E0691E96C67E2A31143B6FC644725DD413 [email protected]
242,986,792 *179DCDBE4A6E3CF0058AB43386751E38CE65A3A2 BATTERS
242,986,793 *1796D8A435625310E00E47CF9BD67C56E33FDBD9 BBAHP
242,986,794 *179CABEFD5152EBE6C020ABA0D92F8340F76D3ED bcck,
242,986,795 *179B64936BB8FD800F1115A3767C378BE4C5DEE9 bce2l
242,986,796 *1799A3C5422F965BC8FE8A3228D3683843FA5624 BDO:
242,986,797 *179BE036D9C9AB21692AB99614A5B498787F4AFF [email protected]
242,986,798 *179B926557B9A41922036BCFC648BB4314D17F6D BeEF
242,986,799 *17998CB871349050813C1D9EA5C9443EA98EBF97 benedictvenier
242,986,800 *179F4DC071C2C3C746BD91B7F82C3AB530739BD5 benhamipolynoe
242,986,801 *179B12EA27BD495CC2CAC0705E9A576FC3E28961 bentonbenham
242,986,802 *17929CCA920C7DA6AD74FA233C2141674F49C334 BENWAGGANER
242,986,803 *179E7E819065C836741761BCB9D40BB1DEB23BEC BETSY.LUCE
242,986,804 *179B1F767575376298FAECFCD8389CB2FA5692B2 [email protected]
242,986,805 *179CEE0AFC655EE1C018C063939D037CB84BAB18 bezuggröße
242,986,806 *1799085937E04F6D60745F2CA99E9B8750AEFBA0 BGQT&
242,986,807 *179F4826E24E77446F0FA8B1F91CCC7CC234EC19 BIKO:
242,986,808 *179C5E976198A21F9D3284846C9FBEA8C266A338 bl9ca
242,986,809 *1793DD696F76FEBF406355519BEB6350E54C2E8B BLQIP
242,986,810 *1792D76E7977CFC588B23F08AE4CCC3FA6D65ED5 b---)~o~o.splat
242,986,811 *1799EDE0CEFC2F663AE75E4181E5FF4439DE766F BOPPI.WILSON
242,986,812 *179CDDD26598C9A9B179CCF7C37A4F5AB7C3DA14 boq7
242,986,813 *179CF00535AB3347505662DC9FAE46D34A7CEFF4 botio
242,986,814 *179FB35EA37448B65BE2D0EB8CEB7FB76A2D5786 b===p.~.>-<
242,986,815 *179ADF3AB3475B44BEDF7BF670E7FE29D18660C9 BP./G
242,986,816 *179A7C9572DCCC0A239D785402364519E83951A5 BR6NT
242,986,817 *1793FA8C1E37F7B8FAFFB6E2C0339A6BCB25BAEB [email protected]
242,986,818 *17958C6637F5CAF92F128D356F62E7E8C1BAE0FB BROCKMALETTA
242,986,819 *17949B72E08B992524F783265E1B248777660BE9 brodera.
242,986,820 *1798C5BA4C285745F27981EFE8A4EA3DEC5833D5 BRYCE705
242,986,821 *179E9A89083CA629EAB6A9A58AC99422411DFF8D BS"7T
242,986,822 *179BAD3A63BC445850DA1D0F3EAE1570E548AF4C bswsbuffler
242,986,823 *1796E83778D59B1E7F4B8C7A1E5F382B532CA168 BT5E
242,986,824 *1796869A7282A0BF5AC6A7F8F84D3C32C057CAA3 b&t;y
242,986,825 *179290FD981A57F991DC2B9E7C013E68D3AD7CBB bufordstohrer
242,986,826 *1795FC34D6EBA5D89839FB7E7ADD14EA0FA30BC5 BU"W/
242,986,827 *1790345D4B4FD4E000C74A5D09E0FD5F1D2210E8 bv/"t
242,986,828 *1793600727D4D7029DAC149030354B7BCC1791EC B:WL?
242,986,829 *179CCEFD63E54F5A46CBAD0C90DCA9CB1DBD3841 C.#=
242,986,830 *1792B126DD0E3403C01E55E11F2681EE421BC107 C2Q:
242,986,831 *179FF8F2AFE1DF1B3463F12D110119BD08CA36B9 C55221
242,986,832 *179B7D61AFABD632D36DE98FD41C5726CDDD6A03 C94ZB
242,986,833 *179284B1E24436B0C87E72A5C023E73C037FA7FD caren-ignacio
242,986,834 *179C39916B0E4BE4FBC0F27491F3F5E651365774 careybalde
242,986,835 *179A81A8D4C52341456364A475B13E4578E90193 carlos87
242,986,836 *179D8C20D398FC421F8913B84F3B4B18AE477055 CARMENPHILYAW
242,986,837 *17922BB0F5A5967F52ED12A3745DE05C01B948AA CARROLL.MANZUETA
242,986,838 *1791C78A858BD079A8A43FED470873300A6322CB cassius then leave him out.
242,986,839 *179116EAD23B82DE46C95ED84B2CC96D1EAD786B c-b=a
242,986,840 *179B02755E44243BA51565AFC9B205E8AF3EF216 CBA0W
242,986,841 *179EBC83C013CA8D46D195F486CBED4EC892B087 CCN(E
242,986,842 *1795CBBCF867731BFEB466E435744BCB1F0425B1 cg3,r
242,986,843 *179F67350DAFE345EF890DFFB97647F3CAF22C95 CH1PPC
242,986,844 *179F274539BC1BF73F4EF67E78375F67A69C6DA3 CHARLES.SHAPIN
242,986,845 *179542C58B41336849B26E48ED8AE694C3DCFDE3 CHEMICAL SPECIALIST
242,986,846 *179DDB75AA8C2F017A958A50A9BAA74633816989 CHERRYLN2
242,986,847 *1791A12B6F6A928F91AACFBED67230C14C0D161E chesterzagara
242,986,848 *179B4E0A9B3CB42F8443A96C9EFC396914A94131 CHET.GIGNAC
242,986,849 *179E0A2E6C23FB02014E1588D827E36D512C2D22 chiefmoon
242,986,850 *179EA7D00777A35349D39657ABC94B27C807D3E2 CLAYTONSPELLANE
242,986,851 *179A03ADBD9D6AB8DE8434B5D195C8E25357C2D3 CLEVELANDCRUMBLEY
242,986,852 *17929D65EB3F40CA02CCCBFF1135AC00EA623B87 [email protected]
242,986,853 *179EE8EBE2012895ABAFE070260DF49CA231C9E6 Cn;
242,986,854 *1797A277D8C92BA65890A25878982D52A543ACF7 COC$M
242,986,855 *179B1E2770A3EA56570B875FCCACBCE1C13F5009 ConcertoinDMajorforTrumpet,TwoOboesandStrings:Largo
242,986,856 *179CAAA73780DCD8238F4B7631723F7BD2D53D50 CORRIGIDA1
242,986,857 *179F0215ECD15AFB992FB311D084DE0B4948A0C3 [email protected]
242,986,858 *179A46F86E494B72AAA588FBB74BFC786AE40778 CRETORION
242,986,859 *1795F4332BA977E08F746B3EBF007F9B09A0D72E CRONESI
242,986,860 *1799F7CC21CF7DA534D7C08176CD642AB745483C CROPPLECROWN
242,986,861 *1794A8BB0B423BF374A4D564B0FFF55775BB19D5 CTNR1
242,986,862 *179582403ABCE7F221C1FB1E7F9B4EE03CBC844A C()U.
242,986,863 *179F2577CAC1F4C198CF38195FBA164D412A3BF7 cue,5
242,986,864 *179ABFBA6680AF18DDA2358016173F533EDC7E89 cvk#%
242,986,865 *179466B249E3F86E6A3A0B45F6A35C7F82BA3D4C d:===
242,986,866 *17958EEFC66D16C396FCFCF31B43EFC674F06D8B d'!<
242,986,867 *179F288B35FB00FBC778F77940F37CDA0DDB232A D2WR
242,986,868 *179D784A4625DB3652A5E0CC92704A2542610FC1 D4NU(
242,986,869 *1797880EE436277F13D3F7851A80CA1820139660 d:6p
242,986,870 *179CD048AE57015962F106C66F471FB46850013D [email protected]
242,986,871 *179D5179520FC40532E2C694A6915F668F182C03 d9:)h
242,986,872 *179CBA5141FA23CDF30C1CD8F8F6DE787E28C4AC daf?2
242,986,873 *179B269D76A3E39719AD44EC17271B940D34C4A1 damianmoldonado
242,986,874 *1792EA939708AAA2EF8FA9D0F13168F212CA163B DANEMONDOR
242,986,875 *1792D2AF42AA6360C6C55FC064793116C425B735 dannyherscher
242,986,876 *1792B8FDBA21DE4FA6741F37D27E12DC043B9524 [email protected]
242,986,877 *179DB3A44E71D5E2373BE5CCFE2F3D60EA2C0665 DARWINCARDOSA
242,986,878 *179F9608482711A95909289FACD1A61F75D21B0E DARYL.BRASKETT
242,986,879 *179A4F26DACF71BF79782E2CC048C5826F7B8796 davidmilbauer
242,986,880 *179F2FCC36DDC84AB7F03E8341E15338CB41A399 DCGQV
242,986,881 *179B25B4CD3CFB71192CFA69A8ED6E8FC3F4D2BC ddfw,
242,986,882 *179773CB7B00245140837567416DBA892238B91F DECKELKAPSEL
242,986,883 *1790492B95B7F68E5B4AC9FEF7BE5025B65EFABF DENUDATIONING
242,986,884 *179E34D7D9980B47D3951DEB78D89C7A6C965EED detailhinweis
242,986,885 *179950CDFCEA5B74C4CBEEDBF86B45C054537591 DeWE
242,986,886 *179539B18D348154DD034409FAD25D1068F50635 DH?2
242,986,887 *179FB143594114F4AF254A7ED9E4682A04EFD96E DISTURBED6
242,986,888 *179F4B77490E2BE1905578E3086199AC5E34D7CD DIVER+IVE
242,986,889 *17951B201C8BD5EAD76FC849802B50EFB109CE44 dldal
242,986,890 *179DD1C8F47F5F039D7A97701E08B0DC1009BA11 docjsbach
242,986,891 *1797E55D6F64BC630993B22904BAAAE20E5A97CA domingoharpe
242,986,892 *17975F3A7C49FEA6096B1E37481C3D1BA0C8BEDA DOMINICK.LEVEN
242,986,893 *179524D66535BA28B1232661D89E68AA732EEE8A DOMINICKSOULIERE
242,986,894 *179E9DEAEE7564EC1D0AC7A5C9291BE1F1DE0850 DONBUSTERS
242,986,895 *1792AEB450858A91832D6E8ED27889CF311D463B [email protected]
242,986,896 *179801780E97836016EFEA80F167DAF95C1B872C [email protected]
242,986,897 *1799FFE952FB514CE2BFB75A5CDBB1859F40763C DONNYNOREM
242,986,898 *179E8C9BEA67613E4FCECC5C6E55F8F2EA213A68 DOOHNAMD9
242,986,899 *179543C839F30EBBE80C6D246D0AEB843934D9E1 dosx
242,986,900 *179E93CBDDEC86BEBFAA693BBB23969C78F34F88 dqw
242,986,901 *1792AB139B6321C5AD3732BCCEA0EF401AA1FDF5 DR..GINA
242,986,902 *1794328D05A2F35A288AE256A86A6B83762436E7 [email protected]
242,986,903 *179DEAAFAE144B8EBE33EB0276ED788730508291 drynh
242,986,904 *179CCB478B2040B44C05C5B486C2166F0BC24CA3 dsf($
242,986,905 *17978365ED9C5048D38F88FC32328922F6CD681D DsGM
242,986,906 *1794A5FE56F91EB33BE74718F3EEAEB92CF4F7E3 DUCKKCUD6
242,986,907 *17960D1AB9A957A009D4BB327FBAD1152DEF2E48 [email protected]
242,986,908 *17927215C8272300B8609CC6DF09BDAE5B7DADB8 DUNT
242,986,909 *1796F17E885260671431BEA253BE9A436209442D @DVEN7UREFUL
242,986,910 *179FC7783F28DB1DDB53E259514FD47EBCB6FA8D dwar(
242,986,911 *179430613FB5C42A254F02E0BAFE18108D00FFCC DWSE=
242,986,912 *179A545D3B840DF3DD40D3AFA07D30D8570D174F E-.AWACS
242,986,913 *179EF9C5E3E6F1EC9B0FBBD1584448BE93D0238B EBATPLUHS
242,986,914 *179FD5932723012BCF996B3419E039FBDAE54955 Ectogenic
242,986,915 *1792266E55CB1C973DA0AAFB29C1A202A52A84DA eddiemurphykom
242,986,916 *1795531E71D62C52518C512C3A0DBA5545C4721D ed,g
242,986,917 *1795F31A84DC86A2F13E0659C5D3F39276B0E181 [email protected]
242,986,918 *1794F9DAA1005C632C954A4787CA5FEFAED9FE24 EG8J6
242,986,919 *179042106DFED6C7868ACF76793F1EB9B746F167 EH.C
242,986,920 *17945E928518D60E1493787A075D3406D6FF073C ekilelga5
242,986,921 *179CA41451E37884D7059E21D57E2921BDB19026 ELBI'A
242,986,922 *1795321669E78EE1698CE1B4C8BCB611B5734488 el-chicomsrelease
242,986,923 *179F0FCC633A80811AA058553818C885D4338627 ELIANNA207
242,986,924 *179B3D22A8C69BBBE03D741C78D9FA89A55A493C ELIAS.BETZNER
242,986,925 *179DE1DE7AB834240C93EDCB2AAF2449F7879A31 elishaschultheis
242,986,926 *17959623A0755E156E1F9066B3B7652C0840A112 ellivnee2
242,986,927 *179B4D200956FD88D869F7433524047970C32726 ELMOHESSELRODE
242,986,928 *1795CB1A30520EABE475799A2FF5F9C88D6B17FA ELOY.HANDREN
242,986,929 *179A274EAD68483D7EE5E9E778BFB38861CBBE98 ELROY.EVEN
242,986,930 *179E2AC58C1CD7C412A38946D9FA29E5842ED4CB ELWOOD.PARRY
242,986,931 *1793C3AD60833B13EFD8B477811A7B75BBC0A865 em4$cu1471ng
242,986,932 *17912BBB0AB7EA784BEE49B1C5E68073EE7F7101 EMILIO.POLOVOY
242,986,933 *179C59A98978E9C3C9DB1D9138581B56131C41A1 ENARKORTU
242,986,934 *1799170476D604690B83567B0F30FC57845AA806 ENEKRIK9
242,986,935 *179F9730E42ACDB508AE00A8DB047FA2D10DBA4D ENNEWRKV
242,986,936 *17923E49CC9799E026642A2606472BB75F878A82 eofn(
242,986,937 *17921852D1A6018E6830D2C9EF3C65AF4EA4A212 epeshmana2
242,986,938 *1792B4B3C1D8B82667FB528A8070A88CC4BD0992 EQṬĀ
242,986,939 *1790629FD8269ED64A26A6C77072462C3A6F154B erebating
242,986,940 *179AA94DAD7EE07A31396F8F1C2DDF01A4B0093F EROTICA-(UNDERGROUND-CLUB-MIX)
242,986,941 *179380E86156D5F250823529DC984B2FF39F3CE4 ERROL.CHAFE
242,986,942 *179D7D41043950D32A05FD92B4BF28A0B9E7D06B ESSBD
242,986,943 *17987A71BB69B7F3A7F753B9B80AA098321A6D95 ESTRANE1
242,986,944 *179068F813799942E420909CBF34C6A191040CB1 etaluripped
242,986,945 *1794077BA06CA36093547BB4B0F84FA45DEA0D7E euo)j
242,986,946 *1796FCC155391C5239FE5F07E69CB79355314981 (everything-i-do)-i-do-it-for-you-(feat.-leann-rimes)
242,986,947 *17908667CA91B58CCAE7CF8BEF961807018C1C11 ExpensiveTastes
242,986,948 *179048F37BA6BDB5AAB4ABD9C90C9E9FAC7B93FD eylh-
242,986,949 *17976CA0E7211FC9864FB411095BA06CCD28AFD6 EZEQUIELBANERJEE
242,986,950 *179999D09B4B04FFB1AE2DFB3FB5F216FD0A77AE EZEQUIELWADHAMS
242,986,951 *1790883DAC5FFFDCA3E3FC9C7571AB034690104D EZRA.BOGDEN
242,986,952 *17997D37720A6FFC1CC9D97C349D3812B4BFA920 FABZ
242,986,953 *179B464E6CE2582AD15EDCD4FE751687F4475A47 FADZRYJ
242,986,954 *179A781874B3F9FD3B6E030105B25EBF7D4CF71E [email protected]
242,986,955 *179D4CB68167C2AE35D5C5423B9CAD20DB1ED052 fasleman
242,986,956 *179E9D2DEA71CC215CCBB444800C0BE73193539D FELIPEKNUDSVIG
242,986,957 *179821C3CFFCB718FF7635DD346093336448EA30 [email protected]
242,986,958 *1793332A6F8A4B860C4E754CCE37C03AE1CB0697 Ferguson./.Bennett./.Dechter./.Dune
242,986,959 *17980F3DE3FA5FB2726456BD8FC57ADCCF35BF14 ffddc
242,986,960 *1793AB8AD450E01231856C9F941A8D9336D2933C fletcherwimett
242,986,961 *179459A1619F12A9E81C7BCE0E9F8F5F1C3627E5 FOOTIER
242,986,962 *1795B70F4CF9A2D2B3E6A688A29D3C2F38454625 FORRESTESTEL
242,986,963 *179BC13E685EB6747802477D6CA396DA7B6DB63A [email protected]
242,986,964 *1790C6F9475ED63CC3F9E27C175DA5E2D355CC72 FRBLFFND
242,986,965 *17904EA47DF84EEBBE6C7E2A267357534D33D7A4 [email protected]
242,986,966 *1790B170A97EE1425EE8DBE300AE23BFFCA570B8 GANNIEBBS
242,986,967 *179988A859B37BC06AB7616436A257A0FFC21342 GAPBJ
242,986,968 *17900DE49A2ACE1D64FCEF0A1FE855C4FD77967A GARLANDAVENOSO
242,986,969 *1791EAD2639E1A440C1B24F56A64ACDE7428AA84 garlandtrotto
242,986,970 *1791C76C8F028BA2F795CF3389EE3F802F8C468C GAYLEPASQUIN
242,986,971 *1790B7F8D308157B3A191176C79FF8FE3DA143CF GEORGEBOAHENE
242,986,972 *179DF860344407FCB771653213DCDADC55E085EF GEORGIFIRST123
242,986,973 *179DFD0ECEB06901B2026AD5481E164B9C06232B GERALDOTANNEY
242,986,974 *1797A5DC92EBE3B664A0E6FB8064D510493F42EE GettOff(DMC)
242,986,975 *1797AF8698ABC271BE2B3D3CA48EB150DDBA96DD glen.paul
242,986,976 *1799EBA7BE67888B68DE2B37723FF6C9804BEC14 GNAT89PL9
242,986,977 *1792FBD8832D414DF4D1CA62BD1E681C69B87F83 GNIGREMNU
242,986,978 *179AE8972CDA4BE9E1357E941983758787821368 GOMARIS8
242,986,979 *1799E0C7F333C52B4E80498062D172464AED5E30 Gp
242,986,980 *1791E05D503827C070973B12BDDD462715BF68DA [email protected]
242,986,981 *1795D92E66D5DE33CCFCFDB86627F071D6302E97 G&SONS
242,986,982 *179FAEAD5211C72F5D0A72B56B085E6C7976E834 Hamburger.Midnight
242,986,983 *179E683A90DDAF9CB136D825C035BB429998AF88 HANDLEDNINGSM
242,986,984 *179B6D8B9CC4B68CFBD5F2A762CFD9CA4C6CEE0A HANS-LANGSDORFF
242,986,985 *1793EEBB2A281DEB99072C867D316B56756489FC HARRYRAMED
242,986,986 *1797842CA4CDAB00EAAE3E46968214011A85D890 haul
242,986,987 *1797AFDDF9CE424107A2366BB4AABF1A76ADF2BE HAYIDHAM2
242,986,988 *179A03AC0616027BC92EC546823B3E13CD091FFE HBHENRIOT
242,986,989 *17993FE003538C1DC3D3282315C5263784FC49B4 HEATLESS
242,986,990 *17993F10EF01821C2A967CCD87E285D239289584 HEGANGZHAI
242,986,991 *179D1D1A7C58496373CAFBFC09FF29D0B5C89B75 herbstfa"rbung
242,986,992 *17956C758411D312E1A7C5FBF7ABF470DD940A3C heroic.soap
242,986,993 *1798A3DE7826C223290357E0BD8D8453CD8C6D2E hershellaswell
242,986,994 *1795B31E575C948C5A258DC066944554980035DE HERSHEL.VICSIK
242,986,995 *17968CD7E6281EB8896678950E509A810B7782DB h!i"
242,986,996 *179FA049E718B5B268560B36DB998B67882590D6 houdenkerke
242,986,997 *179506E0AB2DE448E08B2A4817030F829D761878 HUAKE
242,986,998 *1792CD5AC42E294EB175F6489C588514506E97B5 hughludvigsen
242,986,999 *17944C14C27BF28DD07971672B1F6EBB92716083 huntermunis
242,987,000 *17969090CEBFD59599DC0953D64A26307BF590F5 [email protected]
242,987,001 *17912E9D06E687B232B8552DE698B7A9856CF004 h,y9
242,987,002 *1799C0CC2ECD80BAA3966441DFFAC2F079AE1D43 [email protected]
242,987,003 *179B58CBCA811C248FBCB2ACF42250ECA2E7E723 iambeautiful06
242,987,004 *17915ACC99F07468D351C79171D7D05E6095458B [email protected]
242,987,005 *179184DC7276216EAA1CA93B2A3AEC6551ECF868 IARDNIARC3
242,987,006 *1794BD40FF20EF9DC189F9867306E7BCB2B1F86A Ice.pellets
242,987,007 *179C1530A564CBDC245C0FE0BC0244255B5BA4C3 [email protected]
242,987,008 *17923FC7CC02410233A8184009685266CD865B58 identifiedzebulin
242,987,009 *1795BAF2D2219ABEFCC7EF65DD59069DA8467DE7 i.ka.oiwi.o.ka
242,987,010 *1796E8C5BBA683B329DEACAD38365E3B762D931C ilovecalifornia1987
242,987,011 *1796EDF00FB41A015D220E08AB96B160B7A11186 imagegmanesvg
242,987,012 *179D8E487EE8E9A11A1F2BE05B18040EB254C170 im?baa
242,987,013 *179BBBFA54C23D7CAD4E07377B428A4859220DE3 INFLENTUR123
242,987,014 *179515CE9937DE81A2E652897DD91290D8327A56 initiald-dselection
242,987,015 *179B7C1872B9783FAA57E51F6F0784D6A1B0646C IROTINAS5
242,987,016 *1793E06E4A6249A2D8A5BFF1FC54AC76D3C3B158 irremissibleness4
242,987,017 *1791EA7840F9BF503BF9B93C78F33C2380F9C868 italienisches thema
242,987,018 *179839E61E20F36A0CFAA0ABBF8BD3DC9350A8CB J.AD
242,987,019 *1790123C873068EC80A841920EEC6DDB2AF59B98 jaime-ricardo-siguenza
242,987,020 *179A27768BD8B5AE11E2326FDADE7F210FF60E97 JAME.DETRICH
242,987,021 *179AB9C1E4EC3279F061BAEDB979FC99A1B75EC1 JAMESDAVISALFORD
242,987,022 *17980D7EC570B091AF3F5D6E01E0DDDD9C8EA05D james.dellapace
242,987,023 *17925AD16EB209324CD843E08B0AC1F4CBF78DBB JANN-FRANCO
242,987,024 *179D00D5F48083F80BEABA87852C307A339933C2 JASON-NOTTLE
242,987,025 *17923E5010FFAEB6166669A1D1D3F52C77C27988 jayantrobus
242,987,026 *1796C2A37A01EA918C3745C22E9864864F0F557E [email protected]
242,987,027 *17981AD0F242F6DF9C9C2670653470CF2A51BA4B jazz!1y
242,987,028 *17907E1C039F6FAEFDAB9E260B90DBE8CECCF132 JEFFREY.VANDERLIP
242,987,029 *1799B02F0843716CD32798FCF68B45E6D01F4950 JERICPONCE
242,987,030 *1792D70DA2392F04A5E2B6F7A636CF038AF2248E jeromepressley
242,987,031 *1794BD04F7157E0856B0AEB7D01F15734A4F7793 JESSMATTERSON
242,987,032 *1796583EDB6C421A85598A856E20782196CF3D3F jesusubaldo
242,987,033 *179B7BA56C367C76543D8D9588AC1EA346BC33E9 [email protected]
242,987,034 *1794459FE97CD52D2414B1EC66016F4F3EC3E11C [email protected]
242,987,035 *179B6B37BFDEE4BE00CDC76E845B43C469A7E788 JILLIANMURRAY
242,987,036 *179EBA592B6923B283FA6C896592D3D6851DF786 JIM.ALMOS
242,987,037 *1795DE0C2A7E8D58380F399093669C9CBA09EE35 JINCTION4
242,987,038 *1798B2DBC6EA4C69721C8755E46AF40C08417CAF JJROBERT2
242,987,039 *1794D48A026B5A076EB024C3D1C55DECE053911E JKALINOFSKI
242,987,040 *179DEC32D95D1729BEFA4C0A8F2D04C3BE38D607 ”JOEY”
242,987,041 *179C803B8B8DE37D3C697B32862D6F64F80BBB9A JOEYCASTILLOJR
242,987,042 *1796C47579DB9DF33FD62E7CE6AA87A29219FB95 JOHNATHANAKRIGHT
242,987,043 *179F1D35264180976B03CF8AFE38F67469FD23E2 JOHNCARMENG
242,987,044 *1796672FEAB57BD375D2CE512E4D496AB355393F JOHNRANGER13
242,987,045 *179D5591D8E9745DF647ACF7EC37A964266AA7C6 jonahfinical
242,987,046 *179A4B5585B715868F69685369D517C3120021EB JONATHAN KERTZ
242,987,047 *17990D9DAA2F50E77BFB8F6594AD3788FF0651A6 jonathantonks
242,987,048 *1790F4ECE7960B6A9D33211E2FB0D9DC7729CC3C JOSEPHSMALLS
242,987,049 *179BE1C4567391FD801892C48A2B40693A1B78B5 joshers
242,987,050 *179020E08FB2E3E4EC880E3281255887BF673381 JULIECOWBOYS
242,987,051 *1798DCCD5133341FF90FF3B47D248A69FD21E159 [email protected]
242,987,052 *179B0F3DAF7A50B3369D7C0CD65B888CA8D15C37 KABIPHUN
242,987,053 *1792960A34F1F20D53AF12D0EACE0BCD931CB8A4 KARDOMAH6
242,987,054 *179FEB4921F9FDA5601387B38BE678B5C7AC907A KAREN SARSFIELD
242,987,055 *179432F22C99C6593620053F4A25371D44EC7F84 KARLI586
242,987,056 *179C6363CBE3C3FBADCA183813FF8CC34E67D70C kartoù
242,987,057 *1799DB73D184DE883BBB406FF808B1DF99504D91 KENDRICKBUTTERY
242,987,058 *179347EF0490FABC1D4D3B655AAD67143CE0C994 kennybedingfield
242,987,059 *1796AEB17C0EE12F7CC6066E33C36ABB95F4BE20 KERMITVARAJAS
242,987,060 *179BA824007E7679024DA1E1CBE528C203FC9FC8 KEVINARCE06
242,987,061 *17946AE39FF68B1F2B0929920FB906F00BE9621A [email protected]
242,987,062 *1793792CF5D4D544AB88F6BE19C9044A911162FB kic_
242,987,063 *179B4C298EF332AF7AC7DD0FDB1E3F4D99253386 KIM.PILA
242,987,064 *1793CEE06266AF3D05ECA41E3C30956F690097DB KIRKPENATE
242,987,065 *1795135D4A5CF1E78C9718AE3C015D89C48EFCB1 KOMMANDEURSLEHRGÄNGE
242,987,066 *1792FE09ECF4E15A609D0E3DC76DE3AEBCD4D20A k-q\
242,987,067 *179BEF649956CB1A03000C0E7D4C09A7D47F9A29 KRIS.SLATER
242,987,068 *179908E2E6E7C9C6763A2CE2D8AF93E0E5BC0E55 KROASENA
242,987,069 *17930EBDAA05DEDFF5F26C8B5D7C170AFA49FD9D ksc/
242,987,070 *179394048405F4DB58A0CBAC0EAFCEFCAA671E10 KUILVISSERS3
242,987,071 *1796D3ABC6A648258C626856744D45C95252DDD3 L4EVOGYROUS
242,987,072 *17901E3896438673DEE3F384BCCB5F5D88F88BCA l8qc
242,987,073 *179E882BC6AAD068A268D8FDAC15DFC819E4B14A [email protected]
242,987,074 *17968F9964E429C3D9988D787B71A50216187708 LANRE.DAWODU
242,987,075 *1792E33BFC5B819A96C728215D8331C8D632CEBC LASHED
242,987,076 *179B2C73D3607E0F16327D4BD58BD0B4760550BC LAWRENCELAVIGNE
242,987,077 *17926DD52E33660DA616F01F1190908D9FDD256A LEHORDÁSIG
242,987,078 *179290EBF5EF37F7084D00FAFD91DEE9AAC71D07 LEISURABLIES
242,987,079 *1793D3F670D7ECE5D458F3CB3DB877509054F720 LEON.FYALL
242,987,080 *17974D9CC3AA78990F069FEB283E6B7A8A29A285 LESLIEKOSER
242,987,081 *1799AC61A5478F314D5C7F90217CE1E4081C770F LET'S-GET-LOST-SOMETIME
242,987,082 *1795ABB9AE92974B6168A0DF6C8722FEA3CF4890 l?hf
242,987,083 *1795FE31C946E424B6BDCAA26754E317AE19D565 [email protected]
242,987,084 *1799A4249B134E747409633E775034FD52740EF5 LINKAGES
242,987,085 *17926F0F1B93B80A402704DC90090A1852A5F942 LINNAPEAD
242,987,086 *1796FD7E8A2DE634076BC09734FF349CE6E33C42 [email protected]
242,987,087 *179E573D8D88C70D65C3B32EA535D009FA3DC5CD LOGIREM
242,987,088 *179BE02539ED226C01B2BFE6E4765D38F9585DA3 LONSTANSFIELD
242,987,089 *179A4EFA50B302ABAC601FAD8BD1AEA83647C40B lt f[3
242,987,090 *179D69733D7E65860BEC9268F5ECD5E454013404 LUCIUSNEIGHBORS
242,987,091 *179D1D77227E6ECF0A075604FEA5D0FC282F6243 M01estng
242,987,092 *1790660D29AA2B59695D1E042E80DE9077EE3620 M922165760A112
242,987,093 *1790AB5F4FB90E292A7561D40EC10B7097CE6B5B MANSKIVENTIE
242,987,094 *17916FF1B811294A216E8EE8768BCF8937BE7055 MARCELLUSHORNACK
242,987,095 *17988FC69E73A839717DFAC582B2AE93CF2918EF maria-mercedes-dela-pena
242,987,096 *17935F344A869FFC4781D1039749B9E75D04305E MARILYN-CLARITO
242,987,097 *17963F7EAFDE91277C312C1B342C612B7B65D195 MARQUIS.CASHER
242,987,098 *1799B645BBB5E6E5184F9CCD2C766D5351EBAE9F marquishsing
242,987,099 *1791644630F4E4C375051CA9D5D643789E3E3745 MARTINMARIANI
242,987,100 *179CEDC2666435F85F4C466CE2134F8E322E36FF MARTIN SWOBODA
242,987,101 *1798E31DE3319057C9B625546E2FA8BC6E478B0D massinbminorchorus'gloriainexcelsisetinterrapax'
242,987,102 *179734A770920D1166E0D52EAC51E3F1A7BCEBB6 mathewholderman
242,987,103 *179E0C21CBA1D16035868DCFBBFC63C0D77B3748 MATTHEW.JAMES.GRIFFITHS
242,987,104 *1790C61BD5E478F55B3CE683CB086EF7A61EA21C MATTHEW-R-CARTER
242,987,105 *1793E52DCC23A62F7CC739D43BC9D8FD433DFAC3 MAURICIO.COY
242,987,106 *179974D0FB1E0BFB87F42993CB644317BE904999 [email protected]
242,987,107 *1790AD680163E1D72570695B56D92D34825BEFAB maynardstridiron
242,987,108 *17904416B578334441627CF890DA9435438C4F31 MCNHILC
242,987,109 *179A05E0FEC314C4CC909560CF16C9A7D2715EE3 melalutea
242,987,110 *179B3A2578688FD25C346D367E5BF103BE550663 MERRICK THOMPSON
242,987,111 *179FA6A816016E107F94E09467FDF894BC761B59 MEXICOXXX
242,987,112 *179EC3CF6C2A35F52E2F454141D0FC7FB3A10924 MILANTHAKER
242,987,113 *1792AF5DDDF545F18B967841FB583CABF8423B05 miltont
242,987,114 *179F5679393A2BFAFC3DE1C92BF1BC1CB294C714 minie?
242,987,115 *17964A5AB77402F953FF022C3BCAFE75DBEC17DB [email protected]
242,987,116 *179F042644147B17B6527AAA42ABE38D525370F3 mliraqalsadr
242,987,117 *1794DCC96A6727370BE3F2840FC6E7A835A576E5 MODESTORIESKE
242,987,118 *179EEC44D36AB262EBF24F712F457C6FC6F45A44 [email protected]
242,987,119 *179072B348A24B561E822D7D9608F0DE5151143A MONA.(TAKE.2)
242,987,120 *17950C4356383E0CBB97A2EB8030BF12220451FD MONO$ERVI
242,987,121 *17903361F277D2EEF5F61D2A5CB8D9B73AFB9FD4 [email protected]
242,987,122 *1792719514169A3C6F8038153C52CD7550DA3EBF MU+<
242,987,123 *1791A8998DBF36832BEFA964797F65150BE886F7 mudville2
242,987,124 *1798D30466627558F577D596893107D9C343A593 MURRAY.KOTELES
242,987,125 *17978D8D5E996899B17F2F32E17432F43321D2ED MURRAYMCNEELY
242,987,126 *179FF57CACA66991877F710C8656EDEC90E1CAFB MYIRELAND24
242,987,127 *179C635DF87886303098210D67ED4DC10BDA5384 MYMARIE67
242,987,128 *1790C13D78EC6DD5B0F935D1FC689DB0F466C767 [email protected]
242,987,129 *179D86B5C2363CCA2784458579647489D20384C2 N142678
242,987,130 *179E953572B5C90C2345E2936DC1009F4DCA9044 N145467
242,987,131 *179EABF4ED8782A247EF5432F53D98B095BDDF7A N3737
242,987,132 *179C3A0A347FDEE5EAA0BC380E378998F28ED11E N3GLIGI8LY
242,987,133 *1795A7D11F0A39D409CC568A79AAB4E5B592ADAF nasalrententivecalliopemusic
242,987,134 *179BAD846BEFFED891D5A27F03774B0047A9AF09 NATHANAEL.POLOWY
242,987,135 *179C6C92098858DD9E1DF05087FC38676E672C30 NATHANIELSANDLAND
242,987,136 *1792927307AA39965A5F583BA299B8FAD4333E2F NATIONALITEITEN9
242,987,137 *17984E5B32EBAB9ED39FA11A262DAA3761FDBF51 nesbittpat
242,987,138 *179B696C68B462DB1967B60AF532F4137995C8AA NEVIASERED
242,987,139 *179CE2551F258ABAA131FA74CEA8B31FE6999614 nhmbggd4
242,987,140 *179F208CCC9CC5B8BA63254D5AA12AAD1246C562 NICK.BERESNYAK
242,987,141 *179F3530149B819F276EA2C928A19EFE0249BE49 NOBUHIRO.ABE
242,987,142 *179C00B7CCED5C166F0EC3A5BBAB355B50D065AD nordmittelbayer
242,987,143 *179201CFB0F1A95E95D32E2D6E782B5891B087A3 [email protected]+3$
242,987,144 *179F669D792F153DB02BCB6195E6FD08E2EDF39C ODGERSGARYSK1981198
242,987,145 *1796583372EA446B18D954B6747908A0E8B2EC25 [email protected]
242,987,146 *179FE822AFD9BB7F5212DDD2F6F7D7F2836AB920 OKAN170
242,987,147 *179ED3C2C135263DCA67974E51636EB71AE24445 olenhouston
242,987,148 *17905FCC018C1B2900A8267780736636DA93E0D4 olincaldeira
242,987,149 *17990467EE2500A8E9FF9B61CC9D279022FA8A97 ON15YX
242,987,150 *17907688826C277DBC5C9F63FE2962D8E61496BE ORGANISMSBIOLOGY
242,987,151 *1791251DA7ED64DDAB38DB54125D5DC8E20C0C6D ORŠAN
242,987,152 *179D2706B5B5474A1C7529B79BB4736D76142D67 os.despiertos
242,987,153 *1797BE57261DA53A687C62E9D814AAFD6E3558CD OSWALDO.GARRABRANT
242,987,154 *179E0A1CD2F0E8D938B6A4F22835814FC91C70E7 otfied
242,987,155 *17938EC86255FE71EA670AF125649E8A3FFF07E1 othaelders
242,987,156 *17922FA1FB750B8260582013F3473CE8BD8942D6 OTSIKA
242,987,157 *179704A86FB7CAC7519F5EA54FE480548E6C864D ov3rl
242,987,158 *17927689F647CBCBFCA96AE7038EBF875053318A OWENMETROKA
242,987,159 *1793CEFEF88F9D8D3AF11D60FAE7709F0225D4F0 oxyacant
242,987,160 *179972EDF2F79EDB3018A62EA15C10B83D6822DE pargetti2
242,987,161 *1791C432D369C23E73B9029D9B64C999EC633E5B passedthrough
242,987,162 *179BB7697B7CE406B047940236008C1DDAD81EFD PCN160
242,987,163 *179A52589016BC7AA9BB9DD6259E8384CEAAB420 P===D.*.*.(><)
242,987,164 *17994CD635873F31A7E317AE9896C3E2D0D56F98 p===d.~o~o.(^_~)
242,987,165 *179292B4E5F5B61E57BEDF442524242DBF057E4A PERCEPITE0
242,987,166 *17905FA82DF35E9799C028B1FFE218F7EF26611C philipcheca
242,987,167 *179E3D3A8CCD46AE5BE0715CD4A10EA33187EA5B pirate's.jig.(1997-10-25:.the.weird.al.show)
242,987,168 *179A2D95F7A09D0B45D3B234FB23E5BF3DFEA274 PORSJONERES
242,987,169 *17972440DAADA373C1CA00B233926FC3375BF091 PosixBlapl
242,987,170 *17900C8808D1153228A5D34783F8C14F75D65C72 powwaws3
242,987,171 *17958E0737B3D1B2A3BFDDDE4F67A6030CB6A02C PREDEFINED SUBROUTINES</A>
242,987,172 *1794FEBC7B2E6E9298C4CFEEBD22D2EA0D63D76C [email protected]
242,987,173 *179B97284DA335F821699E8665BEFB481A7C830B QKDEYBJXZB8C
242,987,174 *179868696CB4F020641F5D2C5515F2D2336DB73B qmlpwnd
242,987,175 *179B518CFAFA02B67CA38AEABE35625BF1E2EEBB qq%
242,987,176 *17979E0A6BBAFB9514D5CFF1595F4D275974053D QUINCYSERT
242,987,177 *179D5ABC8807A11853E4E7541C35CC6916037EE0 R3$!D3$
242,987,178 *179940A4CE5933768529AFFE4282E4E5CEB12624 RAMESHTHAKURI
242,987,179 *1790C0A3CA9F30854A69983010D2D13AF0258AA0 RAMONCONSALVO
242,987,180 *179F9BCA988C17C26300180706FFBD5DF82CEBB1 RASAYONI
242,987,181 *179DD6A9C5BB4CCE980093CE11BC2B07759E812D raymundosamul
242,987,182 *17937163482694A32514C75FBA3D63DB8904822A RAYMUNDOSARANITI
242,987,183 *179470402DE81F8FD857DE129A826D0BCDD0926F rayshurr
242,987,184 *17908AEB87CBE2778966BCE2C0EB528DFD0F0892 RBASABILVAZO
242,987,185 *179BE5990E28C9F81B6B55FE3407AA17DC7A992A [email protected]
242,987,186 *1797979950BE53DB4CF5E7F7341CAE71235FB524 RECONSTRUEERD2
242,987,187 *179935C1F9F16D55274B169C09C53402E81ECA7F REHCAMRETSNEVES
242,987,188 *179B4871B0DB6C89B4979CCA2FE2F5C051020FF6 REINVESTISSIEZ1234
242,987,189 *179B30D5CFBD8617B37F9C49B19145D039077739 RELATEES0
242,987,190 *179462AB24ED95E52689D7A0CAE99CA79B658F95 relleirotkev
242,987,191 *179ABCB7B1FC7467CB640170A124210EE67C996D REMOTE112233
242,987,192 *1796168F54498C3CC822715130EE1E9D2AEDA261 [email protected]
242,987,193 *17938FA34399E28318241A8B4795B45CF1D2AE51 rescue1986
242,987,194 *17938BAE0EEDD0C3D1CBAE6F366F47ECC19F3816 rhea.clemente
242,987,195 *179AC63A389CAF6EB14C865FF4580232A140A6EB RHODES 
242,987,196 *1794E04472C6094763AFAABA6992AEEA3AAC3F0E RHSTLBRNT
242,987,197 *1798BE111D0AEA6A448E96DA09C646825ABA506D RICHARD.EIBEN
242,987,198 *17984BB9A5DAF3DF0E34D2FCD196E67806E7CDDF RIDNOUR'S
242,987,199 *179DD34BD1D3C6624CE33961985A658F0808C043 [email protected]
242,987,200 *179CBCF9A953EA52083F490D85F073A0CE65CF11 ROBERTGALLACE
242,987,201 *179637C35C91C34052EDF2B42DA7F4CB876849A8 robertocink
242,987,202 *1796DCE13F8C72AE3AE37EC1EA4CCF5985957230 ROD(淨惡棒)共同使出的聯合技,可以淨化更大規模的壞蛋群。
242,987,203 *17989859E82A08A34682C5FF9E6CBBE3D6A20C1A rogerpenny
242,987,204 *1792EA89582FF793A544C34B79750999313A1F99 romankow
242,987,205 *179A8B54224CF268ADF7B9074EADE48F69FCEC3E ROMONTIAS1
242,987,206 *179CA730A01E241F61064AA6878C77E5D0E5FF4B RONORCA
242,987,207 *1793E90F8979A12C0BBCFCE073C599ABEABB7FDE ROSCARES9
242,987,208 *1796D53998936E890343215039596715F1711A0D rosskinsky
242,987,209 *179C3042678CE5C217CC5A06F489F6FE6376B9D2 ROTTEFRIS
242,987,210 *179C6BF681CF5CD4AC5792CFE3C9B61F86522899 ROYALCOACHMANLODGE
242,987,211 *179A9B69720391B5BF4004E7728F6E64DC855193 RUDY.PANZARELLA
242,987,212 *179143D4674834940E7EF4F40C3FC8628C2EF973 RUSH1NESS
242,987,213 *1793A68944728FB5834554449CA23FE68889613D [email protected]
242,987,214 *179EF1E74E76D7D6999E2AE7ED32E2D84E32DC6D s3høyre
242,987,215 *1795041A54CC62608275BF9CBCE8E1472B392E3E sachbearbeitungsfunktionen
242,987,216 *1797B534CBF421CA433FFDE33DCFC384A6C53A10 SALVADOR.FREISTUHLER
242,987,217 *1791CA0BD3FA6870754C36F92A765489795D0BD2 SAMMYJAYNE1234
242,987,218 *179D728E3CC1B417CE3B5EAD8A93221C5B9E56F5 sanilomed
242,987,219 *179348E173AE19991C1D3414821032CB999EDB7C savannah-reid
242,987,220 *17938A1AD74D7C37E742C788256981F9E62AA73E SAVEABLENESSES2
242,987,221 *1798E8FA60DF5C1327DC44F587DFD11280E008BC SAXITENERIFE
242,987,222 *179BDDD6F9D15F9092C2B3BF82176D399C1C0634 SCANDA10USN3SS
242,987,223 *1798F8E1E27009805860E2CE4710FDFCD6F49826 [email protected]
242,987,224 *179AD567A0502487DFEC27DAFAA7CD55435FDE81 SCOTTIEHORSFALL
242,987,225 *179B957D4B845CD2A1080D589602D1CB6AF5A07C [email protected]
242,987,226 *179CFD3E677384C20F8102FD9C8636FE50871DA8 SDSIBSWING
242,987,227 *179B200D6D02A45FDD21518B06EA894348228324 sebastian&sisselkyrkjeb
242,987,228 *1792220743E82675B75D3295277446864F55E944 SEKSUAALISUHTEEN2
242,987,229 *1793ADA2417A71F5665C970E73CB1D9CB922D7D9 SEKTIERERTUM9
242,987,230 *17930D8563E5FB070B6C05554AE5E10174F1E843 SENITUM3
242,987,231 *179645F23FC71D7DF34450AD1115B8E8547C18C8 SERIUQST
242,987,232 *1798CDB20A3ED17690A76287FFEBB34D5183D48B SES-KIND,-DU-LOSES-M
242,987,233 *179D73A61608980739C3642DF8903FC15D4CDE48 setraks4
242,987,234 *17936AD2EBE29745C6A6C420805062F99AF6B53A SHAMAR338
242,987,235 *179A7CBE1173AC7836059BCEF58DC92B878F98FC SHAYNE.BANECKER
242,987,236 *179660125D264FF39D5C2C19C789E887FB14E4C4 SHERMANBREEZE
242,987,237 *1793678740ED79ABDB11C5D31FA1BE84702E1EDF SHESAIDGOODBYE
242,987,238 *179A7D5654F5060142304DEA21933CBC864593E9 SHUBHOJIT
242,987,239 *179013220C90170A6591766B96ABD6EC33AC1289 SIRKULASJONEN6
242,987,240 *179FBF2997B4785567F2DDB3CBF802F9A69DDC84 SKRMSTRRELSERSED
242,987,241 *179197A15C4859929F9891739AE326E1A1BFCB6E [email protected]
242,987,242 *179622A052C64E3811AC0E2835607354C87A6B3D ‘SMASH’
242,987,243 *17957D7B81628054B6CCF68030A3C9D33B7C249E sMH
242,987,244 *179331878E1643B73714B0FE3DA49A9CF3C7DAA7 SPISETIDERNES8
242,987,245 *179C1AA70CB4DD5E5B73EE4226F205507F376AEC SPLAT0~(------P
242,987,246 *179201CA90FF51E426DDB60C7DBEC3BF4E0DA554 STEFAMOA7
242,987,247 *179A82FE1C9092993EA5AEFBAE1567CE9A979927 steph5778
242,987,248 *1794946880B92FB7B9A2BA1F855D036DA016792F steverdaddy
242,987,249 *1791D55FE903343998CA64D075649C14B224C7B7 SUPERMODELS:GETTINGNAKED
242,987,250 *17954237712DA0AD9549D327E11870C33B866CA7 SYMONICALL7
242,987,251 *1799FF3E81ACBE80B55F49207BCF82DC5EAB0823 symphonyno5inbflatmajor,k22:iiandante
242,987,252 *1794163EE95509D50A24F80737F12514AE5084B8 T?={
242,987,253 *179304122FEA7434BBAC51A8EF33B14BA76B934F TADSNOWDER
242,987,254 *17952F3BE0435CF62F575BE76C79EDE480FA9496 TALA SA
242,987,255 *179B892C7B05E737BC314A9B23E81552AF6079C5 talk8711326
242,987,256 *179938D587B1AD4E6AD98E55B66D5B72CBD8696B TAMEABLE
242,987,257 *179FB1E8B641CF6EB3F476BA409FDFAD9F398E0F [email protected]
242,987,258 *1793994E65FFF449351D6A3892BB683D6F171A93 TANNER.KA
242,987,259 *1797322D4AA7CC1656639457C9B2C859AE4B3795 TANYAASTERIX8
242,987,260 *17907536C08CEF380DD22C94BA104D99A87C2E0A [email protected]
242,987,261 *1793E57654E2E799D4B6997B055E02D49C7EA293 TAPPAVIEW
242,987,262 *17930721CEE7172B01B8AB1CB1149E059484BE0A tarien-viljoen
242,987,263 *1798EB8CF27BFD982E742F6000F494BC0A8C99E8 TAYLORICECREAM4
242,987,264 *17904B9F9212CCC20F06258C498D5CBE4F806CD0 tdda
242,987,265 *1798A9DD0BFCD3A4254FD6189985BA3DDB65D1BA terrellcustodio
242,987,266 *179B8A48BEFF0D1381AA2C2C1B397B9B1F882AE1 terrello
242,987,267 *179DB9A7AF9D176C0DD0C88FB7D4AA471507BC3F THADDEUS.FEGLES
242,987,268 *179FD272C91FCBA346BF7EB834094ECAB38D26E8 the-art-of-solo
242,987,269 *179362BEC1C46C1057D130E95BB8C0737F330210 THEBUNCHROCKONCOVER
242,987,270 *179F699BD8AB41C8893D1EFDDDBB1975B8BE313B THEIMAGE1993
242,987,271 *179D4F1BB3A234D489560DC248485BF07F860BCB THEMINNIE29
242,987,272 *179A18BE7774B7872546863DE8EF01BE045747FA THEODOREBRUNT
242,987,273 *179C944EF6DD84F83951132D108EFDD18EB9D1B5 THEOMENA
242,987,274 *179EF1E1FB6746376D453056E8898E55104162DE THURMANLUDKOWSKI
242,987,275 *17947E00F932F15A78E039EED8B79BEB71A4B1CF [email protected]
242,987,276 *179DA87F9D006AC47BAA462202B5ECAB46CB52E7 TJM
242,987,277 *1791F5C0A4E4506DED447814778AB87EE4E4FAD0 tnektning
242,987,278 *179D8F227E10D03AC64F14CE63B70328E522236D TODPAGEAU
242,987,279 *179950E3CA02BF956C6DF3AB9D7EC2B148797DAE TOMMIESHAZIER
242,987,280 *179FBF99AFBFD1F7CAEBE1177407B74249AB5409 TONYMONTANDON
242,987,281 *17983887DF9D1D11063FB3E4C584EE024D88F0DF [email protected]
242,987,282 *1790A946B4956139902B0670ABFB326ACA637AD6 TRAVESIAFAGINS
242,987,283 *179734B0731ECB9C2E08CD80279CB4CB15A5A120 TREFRM.HAMLINBOYZ
242,987,284 *179F0F1220A3F1ECE3FD62E91925EEF6F086468A TRICK.SCO
242,987,285 *179F8F42FED3CEDEA3B49980A00674ED06208066 TSIELETS
242,987,286 *17972571D501E3DFFE949E050F12D9DC28E85E19 TW#3
242,987,287 *1794F9089F9EA08516152CC20F79403EAF3C92F8 TWANN.GOTTI.BROWN
242,987,288 *179CA036C37F2104EB9B948C2AD87791A444B63F TWNGHTRS7
242,987,289 *17943063AE721C4F9305929A703540E65E9125CB TYLAAYCOCK
242,987,290 *179A836E65BC70FBAF6CCE97AB77F4D4161786A7 tyler-andrew-jewell
242,987,291 *179D8A6F9FB34819CC9A260A3EF7AEB816BDBF67 TY.TEHNEY
242,987,292 *179F59DF9FA36D2E5E080CE377F9A3701581B452 UINDICAVISSET1
242,987,293 *179E005C931BB548BCDAACE7935FBA0657500406 ULEXING
242,987,294 *17966011B13115969A6227A9ECDDCEDA36CCA94F umalpremaratne
242,987,295 *17974BEFC49C096CC8AA46B4FB745944500E28C1 UNMISERLYING
242,987,296 *179E47CBDD11C2413A78BAB0390B61D68A39E7E5 uofw.tre
242,987,297 *17993B81463084DA75B94D634FDFD0C0BB26EACB UOIRTIMI3
242,987,298 *17906F251674B6F6100053CB448D36E48E7ACF78 us1227
242,987,299 *1794CF6FFF378E7C19F0BC7A63AD78F1A975B7E8 [email protected]!L!TY
242,987,300 *17971E4D1F85E2D65CB074A31DFADCA0A6BBFB9A USP
242,987,301 *1793D584D85CC2EC5D0704FBD6338E99DB29CAF0 VACCINATIESCHEMA
242,987,302 *1794B8CFF2D820CC16A7656CE7DDF43DAB949325 VALERIE-JOAN-GREEN
242,987,303 *1799F4FFEBF3FC58B28D4AF9CEFDB31F7FC59994 velcrogirl
242,987,304 *179C157DB4FE3244CA779341F8579814CF867634 VERITYCOTTONARO
242,987,305 *179ADA2ED79B72E00B4D0AE251635BC39047AA26 VERONIKA MORGUNOVA
242,987,306 *179050525E1EA9A5E71C1B215F19BA16ED73BB8E VERZIEHTS1
242,987,307 *17933C0302CAAD13D019623BA48AF083BD7ED34F VGDAAA
242,987,308 *179727227738944F4BEA2CD69C3759801726E6C4 VICTORIA GRACE MIER
242,987,309 *179931B83D3E9FA20D0A80F7BE849565B390366F VILAYPH9
242,987,310 *1798BF5C2235463B83963B8DD017F813E474FB2A VILIACOS1
242,987,311 *1793BA2AF14FB2C6BF4A2223F3085B2261D5CDED vipriyaanyaaha
242,987,312 *1793C4B88C0104AA9E33E11986BF555FE5E86094 VISAKHA DUTTA
242,987,313 *1799F78054406A3C60D7AA15056A4D0A1DE55772 VIVIEN4
242,987,314 *179342312DF5153551BD15606917A6BF0C4EC947 [email protected]
242,987,315 *1791240B29960609A8F393CDAFFE209F08349860 V]SR
242,987,316 *1791FB1446E26A5053133C733E0072D65A7D5CAC vypravovch
242,987,317 *179C86F17D53A0947726D97345A19D99505756CD WALLYWENTCELL
242,987,318 *179C047897428D3BAA5CD93E755AD9A181E7C75D warnermckibbin
242,987,319 *179D362DE1A56706AA12FDD8CA02BD932752272D warszyst
242,987,320 *17900DC411FA3A612011208AFC01B2C23E42ACAE WESLEY.GUTTERIDGE
242,987,321 *179A30E4506AF7EA1B40A28D185959046DA8D6ED westernwindsoncelticshores
242,987,322 *179F101AE12FE949834361F50B2371D6DF178984 WILBURNSALLINGS
242,987,323 *1796046661FFD4AA84200218F6EBB40783D27F7E WILLIAMSAGUIRRE
242,987,324 *1790F654AEAADE61D4E18A36312DF33D5A78541C WILLIANONORATI
242,987,325 *179269FA0F4AC8AB070CABD95FA08EE1C42CD420 WILLIEYAYA
242,987,326 *179E295D61EF6A8F794BD40588D1CADA14EB4E5E willowbrooklearningacademy
242,987,327 *179090C227BC191057521CC64BF99C985EFA5F75 WINSTON.AAKRE
242,987,328 *1791C5063244C9080C8E76D78A71DA26397897D2 WITCZAKVIH1TCHAE0K
242,987,329 *1796A2C6979068256FE126E561DAE430E960485A WLLNNLG0
242,987,330 *179D357DB6D8D22DDBDFB3B6A4A3FA532E705F90 W='Q
242,987,331 *179C1214021482AD4DD2FCD418A5ACB334DCDF83 WWW.STARLESSUMBRA.COM
242,987,332 *17988492F3C06FC95D3DC8CAE0D07E150881B8D0 x4nw
242,987,333 *1799C45311489F884E49B37EDF9839099E161D8E xeniya-xenia-leckie
242,987,334 *179ED7C5ACDB2E3EEB00E0DCA2C9DBA15EA366D8 XF[
242,987,335 *179D9C5E65261A5A78814DC898AA1EDA19E2D01C [email protected]
242,987,336 *179B579CE866FD6255C8CD95AC744401E6B7EC1A )X(~`.~`[email protected]===P
242,987,337 *179810F7D6ABE95B0B99E028ABAB3637AB337BB5 XSX-KITTY-KING
242,987,338 *179558202B31FFA8905754FAFB7F0C39AA6B93E2 xvre
242,987,339 *179FA31ADA87A7663419A69FCCFE5A072348C657 yady.mercado
242,987,340 *1798956DA0E61870ABDB19596C0C139FFFC94271 yanaira-valenzuela
242,987,341 *179FBAFA96E9E78ADC997091A75A677BFF8EC089 yna-tan
242,987,342 *1795DCC9A6798C5B8D2B859418A2C2F3061D928A YOHANES.WASONO
242,987,343 *1798DF8BC5B8D482650C11FCBCC0A6A56E1C6064 YONLONDA.NELSON
242,987,344 *1792A7103A5A3692DFE88B7C57D077F5D240C179 YOU-OTTA-KNOW
242,987,345 *1794C8894FA7825D8909B7C72767B5C2FE2F1AA5 YOUSIF-KAMEL
242,987,346 *179EC569E05E44DA43957FC4CCBE9CE9FB2C52EE [email protected]
242,987,347 *17972CD03F848D7F48A7990232D0645F3A439C0C YVAN-PACANA
242,987,348 *179849A220E43167A1DE458BBA81E3A155D83D0F Z|0AAA
242,987,349 *1798EA60D0A5C77F5BBB2B60786EF2BA548D7DBB ZACH.TASSIN
242,987,350 *179883E653CC65F4A30EAB66187FD77147E6A381 ŻAGĦŻUGĦA
242,987,351 *179B70CD522B11AE4FA51BE7760BE132F7B88D8C ZALALI
242,987,352 *179C16F121583F6591037EB3F7E79795D40D78DC ZENITHBOSSED
242,987,353 *1795DA60484DCF8D6E2247DE99633ACB66A1F02A ZEO1ITS
242,987,354 *179F58DE751F1B6FD7CD6A045E098B5809516EF2 ZGRZYTAC8
242,987,355 *179FA510A21D505AE4A67E9F79A78B2787B75758 [email protected]
242,987,356 *179988D98C87A70228932BE396C54B154A16DC18 [email protected]
242,987,357 *1792B262442F5FED5288478611BF18558BED8ED7 ZITTENBLIJVERS7
242,987,358 *1792643A483682F2103186FBF4B19DDDFFC9A9C9 ZRINSKIEGO
242,987,359 *179346A8A1DE935D6E671937AA797766B15B7EFE zvitorepko
242,987,360 *179CEA4D116AB7691CE84F2492300219BA3E915F ΟΣ)の名で表れる。また
242,987,361 *17981872ECD7956712F0A3A26E5A797A9EAB77F6 „бележки
242,987,362 *1790F2F2CB4DDDC9C14804D372AD4A87A396BB52 ЗАГАЛЬНОСЛАВЯНСКУ
242,987,363 *179346388BBF7F615E0D2A4E7BDED4C1EE470A6E КАТИЛЮСА
242,987,364 *179C878ABCA86FD68F5B1CBCAFFBC9E1F2016C66 котоше
242,987,365 *1795D6CFA745B34E01E25EDF045207B6C12C0E1B «РАСПРЕДЕЛЁННЫЕ
242,987,366 *179AE9877DBF53B530BA40DBBA45094E2599D5A8  ДОЛГУШИН
242,987,367 *179B22D0F869BCAE081D22870BD16582CE89B854 選手。スーパーkアスリートラボに所属。
242,987,368 *1795D57DF697A9779BB0E41203BAE947630F2D9C (0_<)0~D=====Q
242,987,369 *1791B1F9F15272FAD284096B1F9F9936C4401E3B 0iloveskipper12
242,987,370 *179E33A693214A80B579DDF74D7C093AB40999D7 1432614 vuosilta.1706-07.rykmentist
242,987,371 *1790EB87440CD1D3BE72894520E48F68AE716584 1515 ENTLASSUNGEN
242,987,372 *179E0D1F098201A7535D00EAFEA2B5721AF44817 16MILLY
242,987,373 *1797973238F7192837B8D3DD47BBBD102DB826EB 18061672
242,987,374 *179BC9FD21442B6EF61B827954B45D7D485AA3A5 1.ALIURAKOITSIJOILTAAN
242,987,375 *1795BD650BF3DE1FC2B52AD48BE33830BDB568D6 1altitalienischen
242,987,376 *17916E719E16325C0CB5F92D6EC9CC5026A93DF3 1 arpajaislakiesityst
242,987,377 *17964851F82B870949D535C2D08CAECD825A19EA 1dialang:ista
242,987,378 *1794824ABB2138E88F465A30D1D187096A8D411E 1 DIPLOMITY
242,987,379 *17906BDF23610B5947E7550BE35B1EA369FAA30C 1gayre
242,987,380 *179973ADCFE9476E5D1A4C20E09387589FBDC019 1.heliumseos
242,987,381 *17967FD3AF13778AC6CAE0AAE37E02C966C59811 1iamsamson4
242,987,382 *179B633AF1A037AAA5CCA06097378E6B1532744F 1JATKAMISELLA
242,987,383 *1797CA72893D402E6711B875F946FA00075F4D6C 1MATERIALIZATION
242,987,384 *17923CA5399AC6D53E9631FC24CDF76D893195C9 1TYPER
242,987,385 *17939B47DFDD83B550E3A0C6C3B72A25E31B652F 2717014 da.sehe.ich.mich.auf.der.rechtlich.sicheren.seite..
242,987,386 *17913D85C4EEAB71E9A7E5EB730CA08D8DFC7F54 2720027 FORTY-PEOPLE-WERE-HOSPITALIZED-.
242,987,387 *179E5145BB8C6D09F477BCC38EB3385FBFAC9634 2739038 toisaalta-imperialismin-taloudellista-merkityst
242,987,388 *179B898DAC13EB05E6EF0B3723A34A29C4260098 28.HIRVENSALO
242,987,389 *179ADF0F28CE95B569EDFFA0B9CDF2E4C17F41BB 29FEB1860
242,987,390 *1794B257909C0F27A2303AE30EF02091DB0F62E6 2FUNGEL
242,987,391 *179829428BC0F28CF3382ED7F39EF970A50E4C8F 2-KALE-PERTTELIN
242,987,392 *1796FEEA255AC4153468ABAF6E9304C4462DE166 2LOBATOSL
242,987,393 *1795C1310B1A5333C40051E18837C9D364F3CCE5 2NUERKEG
242,987,394 *179CE87F34428001BD83446A890BBFAC5452D29D 2STAEDTEREISENMARKT
242,987,395 *1796457E4381E684EF22C49CB574269089B0BBDF 2THATCHESS
242,987,396 *17941AF49AE7780B2D2F529F3D43184C0DA7C420 2VOTIITOV
242,987,397 *179BC781FBD5A763D08BD3F1322A28F4DC1AED89 30021031
242,987,398 *1792E3251B8CF2A524ED6B6ABAA9C69819396789 3======B ~0~O SPLAT!!
242,987,399 *179628C4FFEAC31952B621D3D1F9580CAD562BDA 3b<-***d===p
242,987,400 *17974B1C38EBF8B41A22A41114A9698A0EB04A79 3IAMALTIMA9
242,987,401 *179D4EE8C9099C094B42FA47D66B92DECC72AD42 3IRIHSUA
242,987,402 *1792C6A8894D2A2A27A17C9B4133AA9A63A845B3 3MVHLBACH
242,987,403 *179245A8382CDCA95BDBA91042C61538FD8C1A1E 3-NAPOLETANO
242,987,404 *17902B918ACD180FED2237E2F30670C624DCE55A 3NEGRURA
242,987,405 *17974D538D75D844020DBC17DE2A82944B80F273 3####@~O~O)0(
242,987,406 *17970A31CB31D162BC6B1E9F777F3B15BD10454E 3---P.`~.`~.)0(
242,987,407 *1790369D53FB92F1CD038F2EB55021E6A7A9A354 3TARKASTETUSTA
242,987,408 *179ACE513B747A0456755B4DC547D0E2195B7B89 [email protected]
242,987,409 *1796BF906532E9309569CD3AE114AA9BE17B986D 461662 TOISIN-KUIN-AUTOT-,-JUNA-EI-VOI-V
242,987,410 *17964D3E9B4E2BCF965B30EB6F0DBF8C43761390 49732 gecen zamanla asiri ilgilenmeyin
242,987,411 *179D886CE6F54ECF6679EBD95246B57445187076 4A574489
242,987,412 *17991BBF15A8F1A2BD13F73AAEDB04B2CD9E0009 4L14NT4
242,987,413 *17979AB95014661AEDC0357D8EB9B1F84894BB61 4UNCOMMENDABLENESS
242,987,414 *179BBD20183BB97372F2C9080AF8C441AE1462E7 500-pesos
242,987,415 *179A58D8344D768596A4709A4CF7B82A1BFCD3B9 53.geneigte
242,987,416 *1790528EC57455A74AA21BCE2080A73CFF8C3978 5ACTIONTRACTOR
242,987,417 *179EFD74D6A98633DE5823CD07FC29338731ADD6 5FESTEJADOS
242,987,418 *179745EF3C7DC454CDF31581FF2167A414FB062D 5FORRETNINGSUTVIKLING
242,987,419 *1792AD22F774B342CC6A43D2258BB5C60DA3FDAD 5HGATSUM
242,987,420 *179BDBBFCB14E74F04447AAC4FAC1FBB8DF934E9 5ICEMANREBELS
242,987,421 *179E9C2F7E6E1026E1E5594ABC504CF18D3C9BD1 5ILUVBEAVIS11
242,987,422 *179A99B3699B81D4FC435A456CD4D146327E988B 5MYBUBBLES0
242,987,423 *1794F5962379B95F0EC93B440AFCA5C19D6BB470 [email protected][email protected]!0N
242,987,424 *1790FBD6C0F579956BDE20717035E00043B85402 6ACCAMPI
242,987,425 *179ACE7E8BEC37C02F40980EAC73C0ADC59F15AB 6PETRILLOBSW
242,987,426 *179DAA8E0C677A40FD76DE7783DB278A81CC8CC0 6REIKBSW
242,987,427 *17961776B2CE395280E8CA0AB4C0D7D2751795A6 6SAPOSNET
242,987,428 *179287DB70A94C2925F607F837B0B3396CAF17A4 6VIEROSTA
242,987,429 *179941861D7023522A735EAE26FB4579856E6E2C 7DISCERNMENT
242,987,430 *17954DBC31A28FE8F864BC5F61DFF3CA3D8CFC75 7immorality
242,987,431 *179E96FBF41698FC8A09944D730536430CCF4778 7METSITTAEAE
242,987,432 *179A20536C2557E9397F3BFC45F47CA87BA212BE 7SURVEY
242,987,433 *1795B809E9390555B815765CB596378A9F757DA9 7TEKNOSTRUKTUU
242,987,434 *179B2C15DA5B0642D23205722960FB62E76216CF 7VERNEND
242,987,435 *17927E7F50201BCDAEB6AE988BE2DD613850013C 8####)~~~(~_^)
242,987,436 *1792FB51C600FB070B4512D3D1A5725AD1F6A468 8-) * * * ~0~O(-_0)
242,987,437 *1794E6A9CAE4B444AF73E506FA467A539DE8ABFB 8#####@~0~o)8(
242,987,438 *17955705E1842B2DCD3527968F90E34C8DD32E38 8ANDRYEA
242,987,439 *179087F2E38D4439978D257A51C9E4F73D70A22E 8====D~~~:P
242,987,440 *1792DC515FBD53EFF85256B10C7F92159698CB3E 8POMICAHU
242,987,441 *1796C1AA41A0257F3954F9559255A27A52B10B64 8SREROLPXE
242,987,442 *1790CEB9B6AEB30CB7263E0D1C66FDDA1413C08C [email protected]*.*.*.{X}
242,987,443 *1796FA4210A431C272C949E0ADE0AEA63A58CE98 8YLL
242,987,444 *1799A4E0946469D60327E48350A9FF8062E5CBB4 9B0DE4DF173BF93BA15755C0A961948260
242,987,445 *179521E3A2812B1A51048793EB9AB997345A8A48 9BVERGEJLEN
242,987,446 *179EB1A2166C6A1641D95083000EE4E48D17506C 9DDIRECTOR
242,987,447 *1794E29762F2C5906F967E28BFBC0BF9E7CE53CB 9INTARISSABLESES
242,987,448 *179F1F7D135C1CAE0BF95A17501B17F4BAF1BB30 9JACKSONFREDERIC
242,987,449 *179CE6C19B7B025EB2BEFE643B024501C2B8172F 9NERIJETKU
242,987,450 *179FE49273AEDC0837EC9C50931319F973608646 9SCHWERATHLETEN
242,987,451 *1791879108059C4095FF421FB8196AFC3E01C371 9TILLERTILLER
242,987,452 *179119D562982C394BE96BD2CB4AA7E88F51E3C7 A1823451915
242,987,453 *1790734B8282D23BCF18B5A2872C0D0FC1306BF6 A1E%C
242,987,454 *179F6886ADC190DB37846493410702D1F3E7B35B A8$NP
242,987,455 *1796C4CA49EED325460836F2DEACC1D231FD516B AAA=0S
242,987,456 *1792B6183F0AFF99BA82A5911AB63164566D8276 AADDV[
242,987,457 *17964C6AF2A25511A9EABAB4D22FCADFDC64361A aangeblazen
242,987,458 *17942C4212FD724710524FD45B64217C1F8CAC7D ABAJORINIENE
242,987,459 *179A04853B3C2E31571A960446AE314A33B77CA5 abbaumas
242,987,460 *179B69F8B322A9C11C846F08F5C657B9FF57D6EB A)BKT
242,987,461 *17985720A8F242BD0D742BC33C44701627161904 ABRAHAMKOZLIK
242,987,462 *17978669792E112AD6876759DAF56EC1E39CFAB6 ABSOLONOVOU
242,987,463 *179663F546F9BCA972D8922DF563819613B73046 AC]0K
242,987,464 *179A2C61397B83B4FF8DDF8E53A069839295AFEA [email protected]
242,987,465 *179F6F8DF870D6732CE1F148B5E89BA9DB6565B5 a.cient
242,987,466 *179F7247D6403A57CB0444B6389488365BD791DF adagioforguitarandstrings(b)
242,987,467 *1794A4C72625A63D7F400180F79C193DC229251A AdCU
242,987,468 *1791CE5197D808997237C8C061BE984AB3566AD9 A?.EC
242,987,469 *1791E27034AC040BFEAFEC4A8B60DC764C9DC905 AGBOLLEN7
242,987,470 *179B2D021A93344C92ABD6BD137E6BBF9DC5809B AGRIBISN0
242,987,471 *179EAE92885C1C2BC551D24887987D00F0175F21 ahfl
242,987,472 *1794CD87B11A51D77F042846E83A4D28D1CE88C8 AK$N#
242,987,473 *1797695EB11125A5A4EEEF546FC04D5FD74F2B26 al3m8
242,987,474 *1791F2207847A3B9649B62D4F754FCFDFED771AC ALBERTO.FRESH
242,987,475 *179B6884EEED2C3484F17B4B6F8E28811F9F0D19 ALEXANDER.TIMPER
242,987,476 *179073F23376858C6C60F96B3B5C97AF98CCB0F3 ALISSON130
242,987,477 *179C49235471E699B322AFD74643B9F915431184 ALLCHURCHBURNBYME!
242,987,478 *179FBB238CE6FD1EEEB5F71B3ACDE40CDCA437D8 ALONSOWIDMAN
242,987,479 *179CFF14274256DD43E035814959EA334179B521 amerce give.punishment.to
242,987,480 *179AA8480F48EDF59602DC2BA23B9DA230EDB4B0 AMERICAOOPSYDAZEDAOLCOM
242,987,481 *179450811CBD2D1C64B26398055CFE924302AFF2 anatoljevitsch
242,987,482 *179EE335FC2975E3204EA0C73A1DAEA71410FC7E ANGOVE
242,987,483 *179657F2AB2C5E58E84FCB844ABA09FB69B50F57 anthemene2
242,987,484 *179C030F5E38FE3A9C0268E0005C9CBB97F66979 ANTON.MENDICINO
242,987,485 *179ECEA05E959FBA8E27F3F6200D9C21705AA057 ANV+
242,987,486 *179FB161B88E77DFEF9F4C056D9F8EC58F0E47C3 AOVERSCEPTICALLY
242,987,487 *17905688AE6B36BE1EEE897DF45479E09665B8FC APXSAWDHAQJSAWDHAQPSAWDHARBSB
242,987,488 *1797AACB3C7F2A71A95C3AF29D9B509946A9F376 AQFQ0
242,987,489 *179E02C64C74CC104750D9C3A1E3BBCEC03ACC9F ARBORETUMHATANP
242,987,490 *179EEBEF1316763ACD4E6ED0356954241A017AB2 ARLIEMASIELLO
242,987,491 *179CF8C2A403795E56C64CA1DF6911E0DCAA7DDD arnoldorymer
242,987,492 *17919A7A05170C60717A1F9769B0A8D7A8EE003A ARON.BANKS
242,987,493 *17996420BB3D594DD2190605ABDB7A71160C35B1 artt-
242,987,494 *1792900B3D551F599CEE88330FA21AFD5972E9FA A"S"S
242,987,495 *179ED8590BCFB98419DAEFD356A53717736EA3AE atf:a
242,987,496 *179FDEB8EA181112D1D7E3338605B8F74F14CF1F AT+UL
242,987,497 *179BF7600EE0617FF29429D78A9F6C38E6E8DB68 AUSENTSSEMOS123
242,987,498 *179A84403B603741F9CFAFF82F4A08D07E9FECE6 AUSTINKRIETE
242,987,499 *1797DBA6829F2573AC2DE3844F3010E4A1AAA2AE AUTUMNLEAVES(FEAT.MARTINTAYLOR)
242,987,500 *179EA9BC7575D3E19FA8E07B7A70DF3A937F2FFE AVE560
242,987,501 *179D97CE92671E06FD7118DD07BF9452C71C5461 a/v+u
242,987,502 *179BB3B33EF571C2FAF7155FB53A73225A65672F AWBL)
242,987,503 *17948CE3DC0D3F4958129B029DD8DD94F4ACB1DC B115143
242,987,504 *179397115D423D3B9CCAE9684E7B9C0C88AEFDC1 B134237
242,987,505 *17971C0077833E3DC570EDC4D5F0166412B4E6D1 B(アリアン2~4)
242,987,506 *179CF889D9F5971F4EB660A13013157EDDC646CB baby,.come.a.little.closer
242,987,507 *17990046145D1300D09E444721AD07652A642954 BACH ATTRIBUTIONS (FEAT ORGAN: CHRISTOPHER HERRICK)
242,987,508 *179FE60D5C73CF9768AE473EBB53330E19DE0E16 [email protected]
242,987,509 *179FF8D7010F9C13F775C952296768EE20BFD5BD ban-;-alag
242,987,510 *179C6A0C35D75DBB7F3015EC58F644B296644127 banco-de-la-nacion-peru
242,987,511 *1796E1F1F0E320144E188316B5A1EFF3EC61B722 BANIUTA5
242,987,512 *1792D12E56EC3F0E93BE0F3ED4B3958CEF649913 BANNAC
242,987,513 *17909CD88DC5478B58076D476F56123B063479FD bansseis
242,987,514 *179166817901E3C35130FA6E07642C25C0E75256 bapee
242,987,515 *1793A958C6120B13A7E80CF1580DEA5306BB837E barney92072
242,987,516 *179F347AE2E102335A543C8311CABD9ED6E2CC43 bdenp
242,987,517 *1798A4AC92DD1FFE148052C8858BDE2A0FD9E5FB begrotingsjare
242,987,518 *179A843BC37F5EBDE9F6E4D715B2AB2E4C0071F4 BENCHMARK($XTIMES){<BR
242,987,519 *179547B927852C8068A1E001CE2FE3B583EA0589 BENDGEORGE
242,987,520 *17981ED439D17FBF4F525A30650974C61720B489 BENJAMIN.JIRAN
242,987,521 *179B69310A537D6FFBB24283A454B31A3B89AA4D BENNETTMANCINO
242,987,522 *179E1DB8827CA831AE0890A050E8FEA234391590 [email protected]
242,987,523 *1799D27FD8644A61D75606A9D482310F5C49A6C7 BENTONKENWOOD
242,987,524 *179A4A684EEAA2F60B0C04F34E7C362AB8776B35 BERNARD.DORIA
242,987,525 *1795FC592EEA25DAE974D592C4464F46B4526553 BERTRAMBALDWIN
242,987,526 *179C197AD53EAB2B787757BBBA77194844850006 BESSETTA8
242,987,527 *17936F966EF24DD4F68ECC0722CCB91D636A4D6A BESVRGER7
242,987,528 *179E7B6BFA5B88849A8F79FE924BE0EA3FCE4B63 BEYITLERO
242,987,529 *179924298D2DA85056143E660CBABA3274406FB6 BILLIE.ANGELBECK
242,987,530 *179CC3171C3B7D779A63EA28EC2CD366BEBA486D bitori
242,987,531 *17962A4B32DBA35E344AA9EC048520D3DBFFE681 BJL&B
242,987,532 *1792D1740D5CF2D4DB81393F3992E9A6B5304689 b?;k$
242,987,533 *179C8386C8CF7BD179053655FCE28856D55DC83B [email protected]
242,987,534 *179E6665487F325B33460C3B767AFCD7486718E7 [email protected]
242,987,535 *17960A473EE9ED997078EE83C5DA516F694B7B50 b+l.o
242,987,536 *1796289B0D554E7967DF69091A51D5D1CED6DD8B BMB,S
242,987,537 *1793907FA60D0BA22192468CABD0D18B629C48B3 BOMEYERING
242,987,538 *17954C40A2F802B42C08CE152E095F1FF9875586 bonnie-lowes
242,987,539 *17960790D7B927B11B306ECE4C830E286648F914 [email protected]
242,987,540 *179D7895502CCACFE1EF0BB8265E6966E6FB6A98 BORF.
242,987,541 *1790494558DA2E0B72E3450781A8DFBA0D918BD3 BO.WHETSEL
242,987,542 *179CAD4C5C304AF19C5C7440528C7963105D3429 [email protected]
242,987,543 *1796EC3179B5A4C4D0CA8FDD7C8356AC3D06D24D bpw3g
242,987,544 *17902C2369BFD795B7CF173EF326ED134F89C096 bq71=
242,987,545 *179D1F697D08898744BB1BAB6391D0C5B07E3E8D BRFv
242,987,546 *1795E41F4ECED49BDAECC361DA1892742A6A5C60 BRONÓWEK
242,987,547 *179EAF1A0B3B7D2015BE982392E1933FC5C39F47 bshdv
242,987,548 *1797C796EEF72490B3B99FB13B17736D2C23517B BURGHERE2
242,987,549 *179B78611DC7DE2286B50114A0EE67ADB281CA81 [email protected]
242,987,550 *1797D19CB3A78CF7881BF83C4565BD9E70230400 butterest
242,987,551 *179B44F431E7EF296716910C65618AE8ED39531A Bv-E
242,987,552 *179F5CFC31A38240B933322E6125E60B51D05D0B BXLUR
242,987,553 *179651C560D4076C977FF5A21AA664C98286965A [email protected]
242,987,554 *1792DBCD4C858BB5B330973541AE41444EE1280A BYuQ
242,987,555 *179CEBF5DDCB538D46A33594F0895E3B41F71CE3 C0N5UM1R5
242,987,556 *179C343BC632CF5A4ED6689ED130BB32EAFCC8E7 c0p%!
242,987,557 *179725118ADEB4ED5A05F9D031677B56585172DE C_2G1
242,987,558 *179A5AB4D69113201B5B361BCEE5CDF3FA1DCFF5 C4%#
242,987,559 *17922EFA70FB3C34EB6E42F2FA8DDA6AA3BD07F1 CALABIRING
242,987,560 *179D36D41CF08AB18D5349B81D23122A03F1BD89 calvingoldyn
242,987,561 *1791A12F8D87897B75A9E4111109F6D659D666A8 Can'tcha.See
242,987,562 *1796BFF1AB3B27C91C84D17CB7F09B017B931E4A can't.you.see.me.darling?
242,987,563 *1798BC5820182365C48CFAB3D38AB92E18A3627D CAPDW
242,987,564 *1793A23D1434F63520A869FB30AD9235BE5938C5 CARLOS.RYE
242,987,565 *17937C0BB94A40637F1BB79B63E7B5285B1245F3 carloswaggett
242,987,566 *1791C31E9BF0390BC809033300ED42916AD62AEF carlsamas
242,987,567 *17937F5ADAC41F922AD6B1EB48CD2664B8A548B2 CARMENKATHLEEN
242,987,568 *1795A12EC15CAF2BFB467A3613B89F3F9CBA1E45 CAROLINE-XIONG
242,987,569 *179523EC4E07C73D30616608465300BB7BD75F33 CARROL.ELTRINGHAM
242,987,570 *1793D5E859CC18EA84DD977E6A33983B8FE6BAF8 carsonbuttery
242,987,571 *17910799B64985F4E7EF6573AB8385AB4E088FC9 [email protected]
242,987,572 *179CB2FEC49E877D237E0028D9AFA9035492E5C9 CB(C"
242,987,573 *179B02559D2099F02C7E871A2A5DD1C2D1397583 c(bld
242,987,574 *1795979F3FD9F41FA2C3C2EAC9A01B387FC7C0BA cckw-
242,987,575 *17994CBBB6BE1B285122CA6EABF9A7F3883B1C81 c_-eb
242,987,576 *179C8509D44D835B86E14585E1B817783E66C8EC CF+PS
242,987,577 *1796B7BA8515465561F0886FCE2B2268DB7139D2 CH:6
242,987,578 *179D0023BED49CBD02FD8F6916FE9B5A32175157 CHAHARAI3
242,987,579 *179C79C72F86E6C922FB3D1C97B1DFDC87727039 CHAPIN4YOU
242,987,580 *179BD303FF29C9FF675D86639A8000AFBDA92E0B chasing the metaphysical express
242,987,581 *17973371ECEC6D9DE7E648F3C5353A09B2DB76A2 CHESTER.KEITHLY
242,987,582 *179E6D67B94B9863DCECEA4A4EE65B754B144364 CHETENUE0
242,987,583 *1791F0C29FD1BDB1C5DBA056302885EBF59F5C2C chiliproject8
242,987,584 *179EDD31F861A1A5526AEE360F749752E666F9A7 CHRISTI.RICE
242,987,585 *179FE35108DFB2C60BB632F2B021B5833E20EA14 christyskeens
242,987,586 *179F840D7590381C606BB5F945C65C4310069D74 CHUNG.ROFKAHR
242,987,587 *179087A168FFFFDDDBD320BFCB212F6AE7090F57 CHW5
242,987,588 *179A6B3588491EDA8DAE95216A12438C2E76A7B0 cibbsbsw5
242,987,589 *17946012FA1AA941BE4F18D7DABA69ADD4748EAC CI-DIVERTIVAMO-UGUALE
242,987,590 *179846CE685CAE4F90B2E0ECB6F8CD236B3E12C9 CIGFQ
242,987,591 *17997A308BA6D0EDEDDC4DA2568AEBC99A321DA5 cjqq
242,987,592 *179DBC16ECE4722C4DB1E3DA729682FEFEE6FD5E clairtaranto
242,987,593 *1791FC72645255FFC87A2410C60C3B7701E15007 CLAUDIOLONGWAY
242,987,594 *17945E9FDDCD720017DAC99511681CFF7E9E6E0A CLAYBERCEIR
242,987,595 *1795D31E5D922C6442EDBE27EDF0746913742B54 cliffpatrone
242,987,596 *179E571FA4C6F7C1174873B1DFD7166E7F725580 CLOUVEE
242,987,597 *179F51F839B6AC7C2F28FBB03AADAED6B85C5185 CM_AD
242,987,598 *1790641348C873901493C720AC57368DA1E75C9A c-n-w
242,987,599 *179F5D3FCDC6E22F496645EF59923BDDE85B8D7C COHG5
242,987,600 *17944618E25343DB6BF8E34770767FA50F8ECEFD COMEGETS8
242,987,601 *179E83C3A9A0C8DE3164CBAF56470C7FBD54B666 common_rafter 'k/a/m/@/n_'r/&/ft/@/r
242,987,602 *1793405CD4A69A6A08E61763980096D65514685E comp4$$1n9
242,987,603 *17966B0DC1A3EEF33215D4F439F0A84E9C794841 CORTEZ.MCFEELY
242,987,604 *179DA7F85AB8C641C44C9ADE8ADB9D852CCD1E72 COUDOY3Z
242,987,605 *1791004BA3AEF48BA5A6C072FB297AEA376BA06C c:\programfiles\microsoftvisualstudio9.0\vc\vcwizards\smartdeviceappwiz\atl\atlproject
242,987,606 *179C783C618F3A896372253A78DBDDB842B47573 cq-s
242,987,607 *179CCAFA74DF8A6529EE665B81F261B788CF3A4E CRHMD
242,987,608 *17936C573A4BB518C1AA97372336E46D2B17D5EA CS"OP
242,987,609 *1794BD9C3801B264B6B29E8CC27EB5D8C941A09F [email protected]
242,987,610 *1794FE38146B25863069E18CBF34A02959D60498 [email protected]
242,987,611 *179CE1F28C8712EE5FFDFE7226D0EB2CCA2B9F56 curriery
242,987,612 *1799B405381747276120813031EBCDF0B70E9E41 C(XF
242,987,613 *179F9331022516A7B9B68FC0D79DB2308619256A CYCLOSPORIN-BASED
242,987,614 *179A272C1C95332F23E5846E2BFE811FD5FE396C D1C7A71NG
242,987,615 *17941F09F9D5352A93C934C1744CAD80C4C1AB43 d2kh&
242,987,616 *179F4EB9F7CFF8559BDA6B69E7654FE5EB4889DF [email protected]
242,987,617 *179491FF1B7336A766EF41C8BF500AC0DF1F7890 DADDYRHONDA
242,987,618 *179D634681E367591B08EBA03827F705D764F82F [email protected]
242,987,619 *17916CDBB99293CBE2C54EC64425DBFC2CDFD913 darengatzke
242,987,620 *179D67789235E62C226998236B4929EBC052B69A DARIUS.KUCHINSKI
242,987,621 *17923C3B6966BB6ACB2C65AEA484B3012D207454 DARNELLBLEAZARD
242,987,622 *1790DE9424EC04DFF02CFA2A996BF0530BF33886 darwinverhoff
242,987,623 *17968C1300C44102FD09585A93D7EDCAE9DAFEFF DARYLBUSTILLOS
242,987,624 *17908C3B55D3EDC7EAB57CEF9C78D225689F13A1 DAVID.LEFELD
242,987,625 *179C9C36FDC5407C971C93AFD12235EE856812AE death frees every soul (feat sick jacken)
242,987,626 *1797704E925D4310F33AF313BD96D22BEBD34479 DEBDAVIES
242,987,627 *179972E4D8CDF58A75403B7B23A3EB3F8D096150 DECADESPAHLEH
242,987,628 *1794E16BA4A26E34ABBF376EE4A78747BAE749E3 deekotera
242,987,629 *17989830A11F5F78612B898DD9A8486B68A4AC70 [email protected]
242,987,630 *179B99CE7C61B5B450825CD6A106160F02CC3B1D DENNY.HAUSRATH
242,987,631 *179C758ECBF81497B18FCF72194AAA33BFD15679 DEOP:/ME-3SETS-MODE:--O-$$1
242,987,632 *179E0DAB6398E07499FDC6D17C424C43BAF6D37D DEPVC
242,987,633 *179E3ACD3E5F25F3968BF77B8D7E7F3F07A207A1 derksen
242,987,634 *1797E03A89E674DC71BC39B563A93F9D949AB486 D=GEL
242,987,635 *179E6C6ED9F9B20B178C5941F1D0E5FECB693DD9 die-cowboys-von-der-silverranch
242,987,636 *179E00456E0D23409634454BAACC810C373532B1 DINOLAND/DIGGIN'INDINOLAND
242,987,637 *1796158F2B3F750AAC53DDC9B3910CD5817295C4 DISTANCE.IS.NEAR
242,987,638 *179FB467CC6A38A13D2968293FA5FC1FA5DE276D Dj,U
242,987,639 *179E33CDA54077B796A9A04C49F186E2836FA646 [email protected]
242,987,640 *179F41381C0EB1E1DF885CFDAC4EBA411D13B0C2 DOBF8
242,987,641 *179A5C8D17BF3E038E1B02538B1C15959C941445 DOMINIQUE.MANSEL
242,987,642 *179D9AB62952E4DBBC2CF1A0D155F41025224F0C dominiquezita
242,987,643 *179AD9E897E7BD41D6F90E481DEE4D8367F9B536 DON COULON
242,987,644 *179A2E581EDFCDEC8DB68747DA514C2D52A01B3A DONGLANDFAIR
242,987,645 *179AFDC7FA73FC19916BE513165D037B52292FB6 DONGRIEBEL
242,987,646 *1799620B3C278D284D6A0525125C5AB5877A8B31 donnienieland
242,987,647 *179DEE6E19E3BFDE5E0A4F7B8573D0FBB3EC6157 DONTEVOVES
242,987,648 *179CBF545B2C286BF8C7EA5730264F871A165ED0 DORTMUND–BOCHUM
242,987,649 *179E90F1C98A95D2167754A5364C8CA3FC798FE7 DOUGLASSMETEVIA
242,987,650 *1793B240E6A3861A83C63D4D9D9863DE1020AEDB DOWN-AND-UP
242,987,651 *179596AC0B2B386DE338ABC5FCC59670FADE721A DP.K-
242,987,652 *1791C3FE3E6609F06E3E1571C69B24168C0FE752 DRAMA-DER-GESCHLECHTSLOSIGKEIT,-PART-1
242,987,653 *179B7F2DBA8C94500372253613BB95E8DCD42436 dreamished
242,987,654 *1792ACBE0E2A0651E5EB375BE3767975D73BC977 DSA5
242,987,655 *17975FA7F0DA53B390ADB9A7D997ADA6B4542133 [email protected]
242,987,656 *179D967A4C5412DDC940C244CECD94CE415315A0 dub?
242,987,657 *17928E3F52C4E6194A44A27B1413C57B8F3802AE d#v(g
242,987,658 *17903D34A92AFEC5716C098BE5367C9629F9237F DW?&=
242,987,659 *17985E8DFC7312F1EEB9643A06FF3A1824280413 dwlpl
242,987,660 *1797F1D67676DFCEE4FB6966ED1F779EC4EBD4E9 dwqdm
242,987,661 *179DA2F9B6985D8C7A5A6ACE53AC92AC8DB88E0C dy3ww
242,987,662 *179F6D3F436DAB6E315B3CBE9CA752E0C73C9C01 d後編
242,987,663 *1796E3E9A0A9808CA61FC1DFA5D0DB62E4E45FCF edifycounselingcomwww
242,987,664 *1791D383BB3C68CCA1BEAA9D385322B11BA3CAF4 e-gj
242,987,665 *179B3DB30D854335AEFD0E2C5D471F1B93884FE6 eliseoedgeman
242,987,666 *1797BF3194F16B645C4636CAD4128013CFC86683 ELISHA.KARVONEN
242,987,667 *1794D277AB4253FC64591E889740D2464BD1A619 ELLIOTSCAFFE
242,987,668 *1798301861F0EC28237C84C489AF58AA4209E947 elliscorping
242,987,669 *17925DCFE3B262649D2DAEA7DA3827F59DA42D07 ELLIS.FORKOSH
242,987,670 *1793D4F4E8257DDF5EB693A8ECE0E1DF78C146CE EL.PLAYON.PORTUGUESA
242,987,671 *17972057FD4F8E6B53A6CC34E179203EFA2670E2 emilioscroggins
242,987,672 *17953CB57A2D4B65CCE5A4862F9E4741DB2BBD58 emma-brawn
242,987,673 *179499CF924747F446FBC06E297522096FB80E53 EMMANUELMILFELD
242,987,674 *179AEC39B75D3B610446616C1099F1D2E3CC8E8D EMRAIL
242,987,675 *17986E90F3018921A061D6E7A1876D53C3A4178C ENGLISHGSUEDUWWW
242,987,676 *1798CE4229936922ECE494F148321BEE9CD0BEB2 ENLSIH
242,987,677 *17933DD94C84EEE26828E9075767FC1BEDCB8D5D ensalmases
242,987,678 *179CB05367CC1A9E8EE3CC0A3EA90C74CF67DD85 ERICKBEAULAC
242,987,679 *17918B13A67C22E22953FB8ACE212544B47F215B erinschroeder
242,987,680 *179AB07987366B276B5A7B718E15CF37161470E9 ernestmartinmurderer
242,987,681 *1798B326E4D3F1B3DB56D798D555E075A3CFD807 erniesickmeir
242,987,682 *179ECEC230C3104BEBF07D3362BFAE8BB291E95E errolneumaier
242,987,683 *1798F1366FA104056A3921E3A1BB3A935432C2E1 ERRORY
242,987,684 *179C112DD00D0040C4CCC20F1B02C7DCD134DDD2 ERWINNARRON
242,987,685 *17923F27853EA39EE671891CCFA2B56B9ABFF8CD esaminasse5
242,987,686 *179E544D10641DDEEE1D30FEC537BEA293F28D6C ESIAJLIK6
242,987,687 *179F6813E4133A92EEBB2F3932934E0AC67239A2 ettneens2
242,987,688 *1790E06406F5BEE785C8644CF64DF62F3CF908F4 EUGIRRI1
242,987,689 *1792E01597156683DA0158607E6787019349F4D4 EULELIOS
242,987,690 *179F8037635A298525494F81C5D9013C809207D7 EUNYUNGK
242,987,691 *179644F1EF44B4B766E788DEFEFE65000A1B157A [email protected]
242,987,692 *179988F789DCBDC3B97FB6871E33592B9DDE3F5F eusebioflavors
242,987,693 *17990E3AF66256DF03713BE53A0C6AFBCE14A321 EVERETTMAGDA
242,987,694 *179DF7A96A12CCC9A4AD93B9812FDB864C8137D7 exoculation8
242,987,695 *17966E94D7946755FD091A01B0A73217C9CAE679 FADO.DA.SAUDADE
242,987,696 *1794159ADCD888E5E767777A018BE4B526115FD3 FALLARLA
242,987,697 *1797A6E11B26BCB58E9EF8FB3D4B57F1A012EC6B FASAINGS8
242,987,698 *179998662B2A170A74C627B010E9FFA0A6026DD8 FEATHER-IN-A-STORM
242,987,699 *1796E79A708F669FCE703EEE0090532F2BEA7608 FIREABIGAIL
242,987,700 *1796D68780B67BAF6F41E116FE06432ED9F24E42 FLORENCIO.KREIMAN
242,987,701 *1793718602E3C02299E2C16F5EE0FE024EC78373 FLYONTHEWINDSCREEN(FULLIMPACTREMIX)
242,987,702 *1796CD58E065D5A634FD8237710329C941AF0740 folk.forms,.no.1
242,987,703 *17927B677AF259A832CFBD0D4DEE4476C6421FDB FOOTIER
242,987,704 *179A3280224F653ACA26D05001A59CC6459E08FB forthrightnesses9
242,987,705 *179293FFC714EF4537BC248C6F58420AE81E4917 FREDDY.GRAT
242,987,706 *1797CA48137B00FE2C93546D91EA7C66A407EC90 FREDERICKHEERSINK
242,987,707 *1793E1EAE43E575B05C11315CAF38C66E7BF5610 fredrickgluszek
242,987,708 *179ABED7DC1B7274D09678DD308C69035BFF826F fructico
242,987,709 *179D3B81B77E92E6BEEF52278BE15D24A8E4724E [email protected]
242,987,710 *179C834CEFD4218724664A9E4EA319BF6F1B0F8A garret-wolfe
242,987,711 *179CF9BED058235EF676170EAF902BFBE9988FDF GASTON.DEMARAY
242,987,712 *179B45BEFCF171707FF6A8DC36E45F0AAE97E280 gaylordcammarata
242,987,713 *1795DAF5E0A621175BA527F933D8A63BD2AD565F gccschoolorgw