List database


# MySQL hash MySQL password
2,422,390,001 *FFF20F7D2B2976EC2E03228EE2E27ED75A10E83C VAIMUTATUD
2,422,390,002 *FFF6063FD763D408EEA3820377D34DB512C26D5D VAITKUS
2,422,390,003 *FFFCC62D23CA83DBDC1D53968A00CC546FA2679F 6PHAENOMENOLOGIST
2,422,390,004 *FFF1EB4161732DF77E25C12D7F3B2AEE16E13B10 6STEOREOTYPED
2,422,390,005 *FFFF8B49750F8EDA391D0741B6EA9BC52B10BF28 6traduisent
2,422,390,006 *FFF64203F567414FF965C58AAE6BDD8AFFD2F473 VERGONZANO
2,422,390,007 *FFF0D9AFA781F6D1AB7BA43FBBBC59DC2307FEE4 VERN.AMASS
2,422,390,008 *FFF413FCB583120E9055A7D21B0FB69FFAC87A2E verzögerungsgeräten
2,422,390,009 *FFF5F2F836A24922B9EAC2AD92C9D391CFD10622 7ALLISEET
2,422,390,010 *FFF3625B7EB2061B5F7EB38A4CF1097CA0D287BD 7EISKCIW
2,422,390,011 *FFF0CE9810C538441E11E04F7561E92D0BAB6CDC 7ELLEJAAN
2,422,390,012 *FFF8FCB5991AA7A833AC50DBCAE8575345E41A7F 7ELLIVYELAH
2,422,390,013 *FFFE01C2E8E8E16BB6305C94DC155FE7DA10B05A VIITTEINÄKÖ
2,422,390,014 *FFFFC804EE34B68AAD97E2AF1E10C4E88C8A772F 7GNIVAELS
2,422,390,015 *FFF94352575A54519C208CA448CCBAF1786EA034 VINCENTLBCABATINGAN
2,422,390,016 *FFF2F03AD8A95EB0B6DB08E37034C7374F6C997D 7HYPERLAT
2,422,390,017 *FFFF212F219CA2C4A6BCCEC9D7E7DDA18BAC01B1 violajen
2,422,390,018 *FFF7C455ED71DA732C0B219910F68564BD411DD5 7LATINARE
2,422,390,019 *FFF76A1C917ADA5EE1E923971DF6C564D1CB95E6 7NEBEIREG
2,422,390,020 *FFFDB1F41EA751D6E63AEE16A7443A05E32A4E64 VIRTUALAUDIOPROJECT:HITECH
2,422,390,021 *FFF79DD7EBCD3D9FA486C4F83BFA6D0DEDBFA962 7OVERVELDE
2,422,390,022 *FFFA963327401A8A4FD60F601F18DF832365302A 7PROGRAMJUKROL
2,422,390,023 *FFF7C100176DE33B30B2A4B92ADFF1548B6F9D3F VLADIMIER-ODON
2,422,390,024 *FFF8A38692DA8D368134D1239AF573CA50B2FD5D 7RUCC47ORE
2,422,390,025 *FFFAEE0CB343B747DED2874E832E572838B93327 7spezifizierbaren
2,422,390,026 *FFFD1DCD2C9453B080685EA4EA6E9D831FB66D9E VOORGELATEN6
2,422,390,027 *FFF0949DFA65A7DED050F77B428EABEEF5F6540C w98qwdqugdb7tilf7mmdohyalhg5cofudljtp1nuatkzwq0k2iiugd
2,422,390,028 *FFF27F8A5B1B89D36DF2709BC280A7148A1B345A WADE.STOURS
2,422,390,029 *FFF3D1C191EEC44EEB9C230AB1C4358EE65A7ADD [email protected]
2,422,390,030 *FFF8935B89C0441363CD2DA8D315CBB7E882CDA9 8====b~o~o3b<-
2,422,390,031 *FFF549FBBC2B557C41F049B653381E92F1985F9D 8CATHRYN
2,422,390,032 *FFF5D8ECEC2E63C602E2CE84C42CD4E49916C3A3 [email protected]
2,422,390,033 *FFF336B68062C8948E47A1ACBFC0571339025FB7 8EIENDOMSRETTE
2,422,390,034 *FFF34FFB36D6C369FF7324DC23FFE6D66F937A0C [email protected]
2,422,390,035 *FFF121A8C032690C6665AF03D8C1C1AD9CA1E828 WASIMHURZUK
2,422,390,036 *FFF4E55B903FFBBA08C46C5BA5A2C45B24E161AC 8i0clim4t0l09y
2,422,390,037 *FFF0A8C69E7E1049660BE0AB301F5C3B065FFF37 8L!9H+ER
2,422,390,038 *FFF126FF42D4A1FF1816154DF511521EF168535A 8neergeknald
2,422,390,039 *FFF22030FEC56BFBF7CD54124E89C3B86248B65F [email protected]
2,422,390,040 *FFF6EE92BD5EF2A8A22E964170E60939430346DE wendy-wells-ketcham
2,422,390,041 *FFF3049E3A53B8E901334AB1B5BA1AD4886718DA [email protected]
2,422,390,042 *FFF73D4F3C49D31A9AD28F25071A27262CCBA6D1 [email protected]
2,422,390,043 *FFF837A960DF949FF58FAEF12FA879B4D5525039 [email protected]
2,422,390,044 *FFF137A0736A669D5BE49E742D4FDFA35A732BFD 8VAATETUKSEN
2,422,390,045 *FFF405B36F671AAD41C3D85CE61BAEF23E3D602A 8WATERINGHESTRAAT
2,422,390,046 *FFF3C8AD61994DE58A5B8695B67B70A32DEF57E4 [email protected]
2,422,390,047 *FFFAB8F5E037F9A6C20D3DBFA4BC28042C1C8814 947SHANIYA
2,422,390,048 *FFF57275412E04A350BC076BB89B406D6BE5EB96 WICHECRAFTIS
2,422,390,049 *FFFA65F475827C6BB442DEE55EC023A626E8F048 wild.username
2,422,390,050 *FFFCB7DAF6DCBF794D241DC45377AF1D3E611077 9COSTUMIRES
2,422,390,051 *FFF0496C76E57EE5C7025A026B5ABD6FEB46DD11 9ENOIGILER
2,422,390,052 *FFF473DDEAC7F458A9F41C02DC5AB0B6E6FA5B5F WILMER.ROSSOW
2,422,390,053 *FFFA184BAC35777B1360CAF474ABB61DE67DE349 WILMZMENESES
2,422,390,054 *FFF12CB2485A67B6255C5B3FCA870C349854E2C3 WINSTON.PERUN
2,422,390,055 *FFF443DE50AD8174E27160AE04AE6A5440910ABC WINTERLAND./.WIG-OUT
2,422,390,056 *FFFB2EC38EAEBB3F897A5095DEB92E1297E40971 woodspeng
2,422,390,057 *FFFA1778EE2CAF9E453438FD8D4116CD38C33E4E 9RBREPUAP
2,422,390,058 *FFF5C3CE8CE9861274AEFAE6ACCFA9F8BB6094A9 9SUSSMANBSW
2,422,390,059 *FFFB02EFEDAB5097AB8F958B4B342C2701E5117F 9SWEETPEAJOE
2,422,390,060 *FFFD9D8F9FEAFAA602F169686BA6AB7D53BDF147 9THURSDAYBRUTUS
2,422,390,061 *FFFEA4FB3505986F6C2B9F27F99F3EA47242329D a)2qc
2,422,390,062 *FFF28F8071E80A2120A42CE73D47EF9DCC8D0BB6 a6$cu
2,422,390,063 *FFF2C33A200F8EFC2BC5711C618CCB71188DC8A2 aaa&d%
2,422,390,064 *FFF7891CC6F2A17F404A4BB9FE3DA11D59265675 aab-j
2,422,390,065 *FFF5C8A2EF63DA9E1B54FA923740919FE283BEDB yasmin-saavedra
2,422,390,066 *FFF7AEF683892941D3F6AECBAF69B3057CAC4510 abarquemos
2,422,390,067 *FFF508EFBF1ABC8AA049D6D57B11BC201B60A638 ABDUL.ANTAO
2,422,390,068 *FFFB8703DC2933B19AF9C04835F92949B097AEB7 yessy.pitaloka
2,422,390,069 *FFFC8EECEBC767B9A34426D6F5AC1979E313CBE9 abelcoombs
2,422,390,070 *FFF3FBA10B362840CA625ED6348D1EBB0CCD0F4F [email protected]
2,422,390,071 *FFF6022B272D6ECEA4C8D66004A6821051693005 abilitereste9
2,422,390,072 *FFF4E6D9A76066BD5DF69049AD77821670C9E0EC abimbola.olaniyi
2,422,390,073 *FFFDA4612C8B6DC216AF24650713094862E1F7FD ABRAMGABL
2,422,390,074 *FFF88295F0749AC1EE3250F89781A930FC432707 absoaudlap4
2,422,390,075 *FFFFD693C05F80BBEB7FC2D4619C426DD360A31D ABSOLUTE DEFIANCE
2,422,390,076 *FFF07573E0F8B0B70DE9FCB3605F8FA981D97441 ac6ro
2,422,390,077 *FFFF381B3AE5D798DFB86C2B802FC332F60AFC92 ZAC.ANSELL
2,422,390,078 *FFF94BDA4FB248F23F5D5793FD11EB3FFF5B3023 ZACHARY.DIVINE
2,422,390,079 *FFFA420233E6B568E7A0E6C0D4757397E5B43B55 ZACHARYGALDO
2,422,390,080 *FFFA2A284CED476CEA83EA06EE2E523384C226E4 adalbertogroff
2,422,390,081 *FFF769C6669A136E4BAAACA1B0383A6E65BD5EAD adamwaldron
2,422,390,082 *FFF132088EF397E3A30AD5E79D4BC4E846E24118 ZECHARIAH EVONY
2,422,390,083 *FFFC97CBB2E17865C27FBA84D556DB8EF50BB4FE ADOPT THE HIGHWAY
2,422,390,084 *FFFB402F7AA54A061F0625E547B9FC0E9A71F22D ZERMINAL1
2,422,390,085 *FFF1DF0E20CCAEB92C6328363905C034E259FD4B [email protected]
2,422,390,086 *FFF3CBA45A8DF84D6800DF0181367F1887D3ECD8 A.DZIESMA
2,422,390,087 *FFFF082B69B21BEC4A9543D092BD7B3AB5CFE503 ZHAOMEIWA
2,422,390,088 *FFF12B31273728F113B7F13900A6EFED3F28E948 [email protected]
2,422,390,089 *FFF46C3B35764C91107D5AC28D44F6CA03ED66A4 AEVLOPIK6
2,422,390,090 *FFF60A4555C879D23C2C6C159D45E94589FEC233 [email protected]
2,422,390,091 *FFFC90CC106186C157F8845C8858EDCD4209E532 AFBSEIDE0
2,422,390,092 *FFFBA251190EE616325225F362DC5FB5FFE258D6 agk,
2,422,390,093 *FFF9E0E42DBE3CC803C3C3C74FF923A1427F9120 zumwalt
2,422,390,094 *FFFECC4FD585FBD02F7B7D3FECAFABE30D2D806F a#isu
2,422,390,095 *FFFA4AA3DD1886B07C801639D3E9201D6C83A8CD AJLEWIS2
2,422,390,096 *FFF9A82F641C11EDC51D6F2324D2AF915C1F0829 ajokhuek
2,422,390,097 *FFF973266D4441745E3AB4964010F7E26A56E11B AKHLC
2,422,390,098 *FFF96922DC2FC46F3C3F0BAEB79B8616EFCF1ED2 ALAVERER9
2,422,390,099 *FFF7D3665802381C0921CF1AAE6C31E534310312 ALEXANDERMOTT
2,422,390,100 *FFFF408517E101EBED9B3078CDFEADF664A0A01F ALICE.GLASS
2,422,390,101 *FFF5E7B7B17F2D6D4F7A6FB7B065424D4293D044 ALLISON-REAMY
2,422,390,102 *FFF020D78AFCE78085601E44A35FAE5C048FE80B alobadado5
2,422,390,103 *FFF1A06E5FB28CBBA9CB0FD93A2F9D88854FDEF8 ALUP
2,422,390,104 *FFFF21E94C0CCB4C80EDDA314A9A6DA103FF9F18 хаситака
2,422,390,105 *FFFF9C4E4A7CA5F0E4060701E4E632F2B31A2263 ШПКИ
2,422,390,106 *FFF2EDBB14AF57805D5D33DD18807320841C84A1 amadoollhoff
2,422,390,107 *FFF0E7794F9DFC62073AB328D30C775E2DD6F617 amiremih
2,422,390,108 *FFF37F13E38490156D46018BC169F713BCD52C5D AMR#
2,422,390,109 *FFFCD0BF5C9C6D53473397FA44AF5F3C43A86E5B ANDREASBINET
2,422,390,110 *FFF4C29321344A5B3AC36E3C8E216951C3D3C029 ANDREWITODO
2,422,390,111 *FFF86EB26E8D470ACA071BD579326BDF79ADF174 angelicagarcia
2,422,390,112 *FFFD23863CB4CC6253687E389AEDE0485C2C1476 ANLP
2,422,390,113 *FFFE8B260AB23B2C09D6D16EBC1A2E884CF6C04E ao9=l
2,422,390,114 *FFF84B299BE4A36BC1B7AD24738C218915B8C982 aqc;7
2,422,390,115 *FFF1210D0827229D41229C1B3DAE8695AA3C310F ar;ep
2,422,390,116 *FFFF0730005D8E8AA95B213787DCF1104C80DF23 ARIEL.OVERBAUGH
2,422,390,117 *FFFCA3C33CDBC33AFAF55E8C80E5D87D8B48730B ARLENABBAMONTE
2,422,390,118 *FFFECC5C051B553C28EE7FED795EB8773E866067 ARMATUREELECTRIC
2,422,390,119 *FFF029CB6C249C39ADFB202725CE17B54005E177 a-rmj
2,422,390,120 *FFF3FA1927109CE50CA03B9D26B039A93730B09F ARTHUR.HALBERSHTAM
2,422,390,121 *FFFB8B7C1E48614580AEAC66E8E0D62F561ADFD8 ASCOTTB
2,422,390,122 *FFFC1E1A665C04FC71BF5163595DF661E58F50B9 AtW_
2,422,390,123 *FFF6B8B1A4C7D4EF600E82F1619504FC7542177D AUSBAUWORTSCHATZES
2,422,390,124 *FFFF5CFEB64236BC58906719C92B8813E4BE280F AZG/K
2,422,390,125 *FFF6546115D175D70C48D7DDA48A2280BF1DF735 b4.y8
2,422,390,126 *FFF862F34B72EA8EE25326DF12B044715002085D b$+6)
2,422,390,127 *FFFB8814BEC7ECD1CFF7EB03CDB3A461622C4321 b7"y-
2,422,390,128 *FFF096BF479E1612C41F3DDB17E270620256735F B9_2Q
2,422,390,129 *FFFCC4783082D3FBC38584D9455F410E26B585D7 bbmw
2,422,390,130 *FFFE99BA2C9C9579011BF52C129C7EC7F5DE59FD [email protected]
2,422,390,131 *FFF3FDF7484072930034312E7F884203794DFD39 bejaresing
2,422,390,132 *FFFF231F738984C2F9E6676241E16BF8602469BD bernardomusguire
2,422,390,133 *FFF96519212D34B99EC5584D9763BD4224BEFDDA BETITFSTAND
2,422,390,134 *FFF5D27F19EF389AF01162FC4764764F824EB010 bffck
2,422,390,135 *FFF708E0EDC51FB11124BA2221AFB1EFDD043CC4 biniam.getaneh
2,422,390,136 *FFFBE74479E5769DCC566041D0BFA10C77918108 [email protected]
2,422,390,137 *FFF3407FAF9335F824E5321DB17F1226E077798A bipinchan
2,422,390,138 *FFF8515CEB2152655BDF66768A4C5B2DDA35ABF8 120.SCHILLING.STEMPELMARKEN
2,422,390,139 *FFFEA4552150A6F5814E05958A1EC2405274CFBE 123BCWLVRN
2,422,390,140 *FFF0588B1BA48C0F69B02BED23B2E799412E69BC 1248005 yield11.62%(annual)lessfullfees.
2,422,390,141 *FFFC8F1E50C30367059BCB6F70BF4FD08387ED15 12.$+.$URL(%I).$+
2,422,390,142 *FFFC0F4FF4C99E3D41F0F9A93A470FE8FFE0B4F9 BLAZE784
2,422,390,143 *FFF6D47251F00C6A185339A9D1EA7145CA0FA13F blfkd
2,422,390,144 *FFFF85DC9759C64E9835938909AC200248127219 bndgntn0
2,422,390,145 *FFFE58C46F43FF3422517D17B8D0F31A0FABBC9E bok$3rn3
2,422,390,146 *FFF253E70AB112128C13184CC6090A69955443A4 1826544 THE.ISSUES.IN.DISPUTE.INCLUDE.WAGES.AND.PENSIONS..
2,422,390,147 *FFFD65ED2EE37165C3BB1FC881D54BC9B4640D04 [email protected]
2,422,390,148 *FFF0B53742B56E323A3EDE76859E7AC659C26F92 18valitusviranomaiselle
2,422,390,149 *FFF0C7D85079325DBFC119307C6AE64F4781518D bpk5
2,422,390,150 *FFFD4B2B283340579FABEAABFCD397AC6E1AEAC6 bradleydegrave
2,422,390,151 *FFF3A949EF3BEAD7CCCA3935F42952B76825DC00 1.bereitschaftskreditabkommen
2,422,390,152 *FFFDD8043FEA11D1B4283DDD9C2A0B68AE296492 1-DYFED
2,422,390,153 *FFF40B5F87263B438A8C5D3A218DE55B0165B90F BRENTLIB2
2,422,390,154 *FFFAE46F6B2DAFE75D4DA2B609D4A9A010D680D4 brentonringham
2,422,390,155 *FFF085ECE6CFD0ABC95C7B98CA715CDD0C73C789 BRETONWELSH
2,422,390,156 *FFFC7CED00426B611E060A48850E45ACEF180A0F BRIANKELTNER
2,422,390,157 *FFF239968D6B0FD10CECE23BE1CDACD0D2B1593B BRODERICK.KWASNIEWSKI
2,422,390,158 *FFFF21044897AFD740B73D76CFDCBA7ECFC72BDC BRU7A1!7!3S
2,422,390,159 *FFF6C7415BAF64D858D191004C674D00DF8458F1 [email protected]
2,422,390,160 *FFFB89A582A6ECA6BC67FA786C3BDB4138935F46 1 MULTAPAAKKUUN
2,422,390,161 *FFFDB27BD33161C6265BED0D5A4D12AEEEE6609D bswfrenaizinbsw
2,422,390,162 *FFFBB99088C10C608D071B74A89FAE55449FA416 1-NIEDRIG-PREISJAEGER
2,422,390,163 *FFF29E1276C4AA33EC23215CAF2F88FDEEA25AD8 bt8u
2,422,390,164 *FFFED289FA956027B62B427988BBC8E600884016 1PARASTASUORITUSTA
2,422,390,165 *FFF1009AB805BABC3C76DB53D932006A7BC9BFF2 1.PETRO-CHEMICAL
2,422,390,166 *FFFC226A24F497DF96B39050C3D982EE7060446E 1.PINKOMALLA
2,422,390,167 *FFFDFAEDC4959800B9554846200772FC87BCA962 1.religioesideologischen
2,422,390,168 *FFF5809272F0E3703FB7F86490C52328113644CD BUSTER.SCHMERER
2,422,390,169 *FFF61D5B658AADBB342D3E56841C3B6DE2276987 1 tilauskappalem
2,422,390,170 *FFFB73B245E09CCA5D1B319463F17EDE65127D36 bw>i
2,422,390,171 *FFF1FD01F2BADB4F0F536C7AAEFC6B853FDCE914 bxso
2,422,390,172 *FFFDBB7827A1B3FD1EB0BA04FD9D971D41B7877F bzc
2,422,390,173 *FFF198E8AA8229DA7C6EC910F734B0478535B86F 2366981 GEENITEKNIIKANAVULLAVOIDAANENTIST
2,422,390,174 *FFF096565EBFD767270EA5851CB7753EC8C2C490 238asa
2,422,390,175 *FFF23839F70F714D554037EA5382588D8A116B49 2690812 ONGELMISTAVOITL
2,422,390,176 *FFF0613D0CA9D80E02710F0066EB0555FCFDA8F7 2785432 osuus.yhti
2,422,390,177 *FFFFAD54F03FF366162C8E32BE675722CD02A877 C2#U_
2,422,390,178 *FFF6FE683304ACED1888AD46F1204020BBC47893 298248 niinsanottujayleissivist
2,422,390,179 *FFFE9A4D92279D58F3257306073B8F9C2F70CF00 c:$&4
2,422,390,180 *FFF19F4A0EB5C7D5C8F753B5DCD6BA37A36875E4 2 butterflavor
2,422,390,181 *FFF42BF54F85CDDF285BC733496AE89FA8E906E1 2CYGANEUM
2,422,390,182 *FFF4A3E61939F3A658C3BEF9A4623C33DCF31C51 c8n+5
2,422,390,183 *FFFFB66711D587387E2A4E4B4A56A01D9BCC38DE 2.LANDECKS
2,422,390,184 *FFFBC4A467F75EEA1E59E5432A3A3F208BECC80E CA6_N
2,422,390,185 *FFFD4434995153A378E33156E89F188225B4FA8D caju
2,422,390,186 *FFF10AB8481B9EA29E26181AE2FF36DF529A225B CARLENE CARTER & RONNIE DUNN
2,422,390,187 *FFF060C5EF95617BC589B3B880A89A03E60E302B CARMELOBUCOLO
2,422,390,188 *FFF39E5FAE374B2F63ECFC14B7C4F188BD1120DA carrie.nemec
2,422,390,189 *FFFA4E3F94764E4283EFB0C55CECEC784D2CDC27 carrolbredernitz
2,422,390,190 *FFF069AF1FD230AD9CE3CE316009C4098B959C6D cats.van.bags.(feat..brother.ali)
2,422,390,191 *FFF081FEB6D146EEF7B7E4AD97898BD4544BF7D9 2 PEDIATRIN
2,422,390,192 *FFF721DE6015B0942A77B0502746603281A96E8E 2piristyen
2,422,390,193 *FFF58461E39D24DA1E8F9A5105D2C46F10AB45AC C..BRADFORD
2,422,390,194 *FFF2CF258C25EF587975E9822100D24E62627642 2-winterkleid
2,422,390,195 *FFFCC5434C272003EB3924B25EFAF3E4DF9C787F 3:..1..2#..&...marlinspike
2,422,390,196 *FFFE2C8C52A9195FA8933A4DF4186CF33BCEE2A4 CD(4
2,422,390,197 *FFF10297383970CAA6E16A4147D6FAB9494CB04C cellcycleprotein
2,422,390,198 *FFF7058530E009F83949BADB8B12D3709E4ADBD0 34RN9
2,422,390,199 *FFFC827F9A5A71689FB8B2A38077DA1F480E846E cf$(
2,422,390,200 *FFF8007F977C8D9AD4166AF16E057F322D7BD34F 3.CYCLO
2,422,390,201 *FFF20E4A875AC6894BB698E2586732703AE21CD5 cgjenigma6
2,422,390,202 *FFF9F7BEF25C5C0E17D955B678869257046357B6 cgndg
2,422,390,203 *FFF44CD600FB890C94D449E1DF095E338ADB672F CHADWICKHINISH
2,422,390,204 *FFFF9FFBE0289FA3A19ABD48BBCA76BB99F8AF1A 3GNINEPOW
2,422,390,205 *FFF8DE1B66E92DE419332ABA661115044545AFCA 3ILOVEMAJOR1
2,422,390,206 *FFFFB8F16BF7358603844D14D0E71242BB38EF04 CHANCE.NUTLEY
2,422,390,207 *FFF18C134F07CDCB8546DEAE7FA92CABCC47BCA1 3==>.~O~o.)x(
2,422,390,208 *FFF47CA470D04EC3054417290E18A66AF9A38FB9 3p*.*.Splat
2,422,390,209 *FFF91B9696D127BF81BB2A32021DEE049E643045 [email protected]* *splat
2,422,390,210 *FFFDD641395E12C66914591DF7FED827959B9C95 3.ZIFFS
2,422,390,211 *FFFC980D02A20A69CB5909B1C03C3F2E862B87B4 42 matthaeusmaier
2,422,390,212 *FFF575FF7EC44946C18BCC1118D33B0A10E17B20 CHARLIE-KYLE
2,422,390,213 *FFF74876DD9DC26819570E45C26BC8B4F3FCF1C7 4CINEMA
2,422,390,214 *FFF219756C31FC757342C0A3FE05708BEC994C8C CHERIDEN7
2,422,390,215 *FFFF3EC86E84A4275D9A275695450978F98C6798 4ETLEGAN
2,422,390,216 *FFF4501A65A4D93C8826A7D35780D4D8A07822C3 [email protected]
2,422,390,217 *FFF175B1675E78B17729D7B94867FA381B8BEF2E CHI-LLI
2,422,390,218 *FFFF045EEF6BB9203E99FC35EC5DDE5BAC7F9232 4ITSEL
2,422,390,219 *FFF8DE551A929320B42B15235A7A13BE3525A7F9 4OPPORTUNITYGOOD
2,422,390,220 *FFF1A0489E411A37223098CE583BB0A9BB1B7F3B christydickhead
2,422,390,221 *FFFD28073D881B287810135F91B6F8DF0062A955 4VALENTININ
2,422,390,222 *FFF2C468B7BBBE15FD9FE3200ACFE3B424614CB3 ciqka
2,422,390,223 *FFF582F8DE6DAC3A8041A44160907C1AF0648F84 CITYCEMETERY
2,422,390,224 *FFFCF7D42DAA901239F18D66279721C219CA1566 c;jk
2,422,390,225 *FFF71389849940B1CD4AFA74B25661CE745C3CC7 CKMM8
2,422,390,226 *FFFC0545D4D369FEAB53A46915F37A21EC474E87 claughts8
2,422,390,227 *FFF0EBB756D39E8AAB0D1DC36FCFB31C26D06A47 569283 TULOKSIA VOIDAAN MY
2,422,390,228 *FFF98A74681D9031F50B119DE8EF9421AD5C4E18 579DORIAN
2,422,390,229 *FFF9747AF1FE2ED090626E0CE7876ACDF416DDB7 [email protected]
2,422,390,230 *FFF32AF2E781EE6A760D35A5EAFB34E3E1C248E4 cloves
2,422,390,231 *FFF58D70547713DEE9C4A9861BEBDEC30351AAD7 CLUBLONELY(ERICKUPPER12"MIX)
2,422,390,232 *FFF50B6E61F2AAA647FC665E10E1DF45293B8A65 CM8Q!
2,422,390,233 *FFFDF81A7A20AC80BBF0F81C79F2031B6C9BC44C COBPZ
2,422,390,234 *FFF2F49A8A83291535DB6DD4D66C443EA0001990 5GGEIHCCO
2,422,390,235 *FFF717690FF5D179B5367CB6D6EC84000D40A802 COLEMAN.ALLBONES
2,422,390,236 *FFF9F58D7D2AF928008B4CF453B625B5B54DFB38 colinharb
2,422,390,237 *FFFCB24D99059B395CE873A6303127E33642AA11 COLLERY3
2,422,390,238 *FFFE867E4B404D605C5A2391DDFD20327967073D [email protected]
2,422,390,239 *FFFB6FB0161D6FF7D1CEA80DC6B7A7D325FD704E conference160160nor
2,422,390,240 *FFF35F581F98917143B39E36683FF5A325EAB92E contrev
2,422,390,241 *FFF9A749FFF9B40B905F903BFEF59F63D03DA5EF 5THATVALLEY8
2,422,390,242 *FFF7DBCB850959B11EF450065B7DFCB239ADAE0B 63897cc365903fec8198a6fa98e33673
2,422,390,243 *FFFDDFA8F0AB85B6A07D934892646F176072145F CP3_U
2,422,390,244 *FFF1FB3089C49ACEC6D535B5F983B0AFB91168F9 cp%(b
2,422,390,245 *FFFD6C29E3F69E689EB688F96752D58B315EF053 6KOTOASAY
2,422,390,246 *FFF4B44A8C89869ED3623AD87849C9C878950745 CQKCL
2,422,390,247 *FFF96DCA8AF0AA69C6267E9E21B6EA9E9A737CB2 CREATURES-WHO-STOPPED-LIVING
2,422,390,248 *FFF04F4A0391D53B5196C8B6DB411C3CFF935293 7121173
2,422,390,249 *FFF94B0EA9EB6A9183147781063697EF2DE60368 ct%
2,422,390,250 *FFFE5C33E01347EFB99A5A7BDF34CC815B699A11 [email protected]
2,422,390,251 *FFF756969664F7FD78202EF06C0EE3399584E25F cu,kb
2,422,390,252 *FFFFB39A9EDD41899C7FD8AEA794C990C652CADA 7BSWTETSUHIRO
2,422,390,253 *FFF1959FBABCC73CE7AE68A01547A4C171762042 c=v#
2,422,390,254 *FFFF8066AD20B2FEFE458C34DEB657BE741368CE [email protected]
2,422,390,255 *FFF08F2DBA9B27EBBA0BFCCE4A34631162D9DA8E CW5G/
2,422,390,256 *FFFF5D6FED055011509CC545F990E1B570B3F159 czbso
2,422,390,257 *FFF391F800CCDAD5C00BBDE61ED4898DC6B7E86A D0iD
2,422,390,258 *FFF6936BE8A0C65D8C49E9CDA4B09816E4CF5BB5 7KRIJGSMAKKERS
2,422,390,259 *FFF853880AFDAA9D3FDFE655CCAD4DFC19CC335B D73117413
2,422,390,260 *FFF3F04F129F1EE1A0CA053AAF22B28A710E3864 7R4N$L!7ER47ED
2,422,390,261 *FFF8519D728ADA04497BF10B4C3786F52D656411 d/-7o
2,422,390,262 *FFF2127E5DE919C7892467413089D529493CBFDB dachschuh
2,422,390,263 *FFF485DE548AF445A0E0BC8AD1BAE869A382F07F da)d/
2,422,390,264 *FFF3FA666C9EE5E2E030D814C727907503114B11 7YANKEES6
2,422,390,265 *FFF78F182CEB3E956A733D46CB2FE013B27EB1FD DAREN.KLUCK
2,422,390,266 *FFF3F7B9E2D6429850ABBD8F892CC9AF32B5777A 884063 AUTOLASTAUSTOIMINTA.ON.SIIRRETT
2,422,390,267 *FFF005E345323CAA7370FBA392A414253461F06F darnelllavear
2,422,390,268 *FFF08E23AB9F1A3BF1A4FB951915C60E7095EAD9 darwinbelich
2,422,390,269 *FFFD9D813603775701E8E87A57733D563F01812F 8====B.`~.`~SPLOIT
2,422,390,270 *FFFDA428DA75EC1B32844919C151841E1507C9CD 8BSWKRFINYBSW
2,422,390,271 *FFF9AF53BD60FF3E6ED5443AF6FF4A1EABD6715D 8BULBIFORMS
2,422,390,272 *FFFF63073123E804DBEAC3564AAA181D42E08708 davidbryananderson
2,422,390,273 *FFF9D586FBBA5B0AE8D8C733F587460024FAF39F DAVIDHERSCHER
2,422,390,274 *FFF08A46A63763FA4F5E683F96B3CB19B8D7C16C 8GALLUPERS
2,422,390,275 *FFF4D3AF9C9B9308A82911638CF371F6C15C1DF8 8GEAMALGAMEERDES
2,422,390,276 *FFF3DF883F3E525BA307E5859ABD65F0602BC4A7 8HEDGECREEPER
2,422,390,277 *FFF8A93811D488FE68FFE6BC8AAE175A44AE83FB 8HEMEROTH
2,422,390,278 *FFF84F6A6C4908AEE034FC69A45159B3BD3F1EC5 [email protected]
2,422,390,279 *FFFC620E37F9CAFCC15238CC5B1897877191C622 dch=
2,422,390,280 *FFF45077785EED517FFC42EF2176E7A4C4A89DF1 d;cnl
2,422,390,281 *FFFD4380BF2D2F4C095AAE4AEF98E1082CCCA629 }8{O~.O~Q8
2,422,390,282 *FFF632FB617FC54FBA1104EABE882674B8D5D019 8------P~O;)
2,422,390,283 *FFF0716F0CDED2389CB2C4E1B3DAB07D649F9B63 8SCORNYT
2,422,390,284 *FFF15BA03BF51ACC06312BA37734958DD13E31C6 8STANDARDBOXMARGINSBSW
2,422,390,285 *FFF7A9B1CAF16B03BA1FAEDFC1BF429E57D3700F 8TILKENDELSE
2,422,390,286 *FFF7BFAE6DF65AB72D4902B787FFAE530ADCB8E0 8VALERIEMARTIN
2,422,390,287 *FFFEC164BEB13FF05B73B426A26B78214AEAD738 8XMMATCHKEYEVENTB
2,422,390,288 *FFF4F5FF9E6FE4529262C75492E7D005D218F266 9004bremsespor
2,422,390,289 *FFF50E7D16FD1D135BB161BB4CFFD7862C589DB1 [email protected]
2,422,390,290 *FFF631CF26AAD89CA0D3F5A0B00EB600A6A5776C DENNIS-DALRYMPLE
2,422,390,291 *FFF76D2BC94CBE83A914AB726B86E9A4FEB27C1D 9AASYAAN
2,422,390,292 *FFF974D5D6ABC6B7BCEE0EEA1A564B0B83428968 derrickcruzen
2,422,390,293 *FFF00AF565DC2972811190955CEE01D30845AC03 DESCARTER
2,422,390,294 *FFF7FBD12A48B61C1EFE8F3754854659CC12028C 9F34EABA-4F92-363F-905E-0FB1CAFC9334
2,422,390,295 *FFFAB2EBC526BF0EF168F168D5FED58C82EC3ACE DETONASJONSBØLGEN
2,422,390,296 *FFFC84D96FC48465554311441C86FBA9E625F6C0 9HOSTELERSES
2,422,390,297 *FFFE15F861BCB68F43E9CAA4B56FA0E3EF38EDC1 9IAMGROVER6
2,422,390,298 *FFF07AE29602E9E9C5CF1D333DF3D1D071A16CBA 9NAAKUTUU
2,422,390,299 *FFF7A1CE7C509DD4E33D5F6245DE5CC596DE4DA7 dhdnz
2,422,390,300 *FFF8AF0CDC167CC6BA5884E48B711F5045E378AE 9VISIONVITAL
2,422,390,301 *FFF72294A531EDDC986CFC2BFBE056C63B7F2B59 a$.__
2,422,390,302 *FFF3D8657BCFB2F47208498160F35B0121855AED a0os:
2,422,390,303 *FFF2F480DD533AA066AE2512E6EEA08C92387F8D A428607
2,422,390,304 *FFFC1E5847A57F0C44E91E7C64D29E2F4B5FFBB4 [email protected]
2,422,390,305 *FFF38697D7E475B2C4363095F68497B1D6BF7A17 [email protected]
2,422,390,306 *FFF8683EA59E9285A3644D5825E2122D4E1C17BB a5"x8
2,422,390,307 *FFF0560ED4ABEDE79ADDBA3856AF240D6431C103 DIRECTIEWEGE
2,422,390,308 *FFF030840C902CA544DCD340E3517925DEFC6B27 aanvrage
2,422,390,309 *FFFA33043D587CD352010C639940D1737DFE82C6 DnIO
2,422,390,310 *FFFAC8F137C21E80CD4E6A919E8B13B419B8C6B7 dobf
2,422,390,311 *FFF7504DD0D8D20D96238190CEAA42C3A50742AF Docl
2,422,390,312 *FFF10893D80AB2043A37F09069C5D49E4831EA41 DOEHTER7
2,422,390,313 *FFFA270EF09BC2B967D196F74D25576CBD1D13F4 DOMENIC.BREU
2,422,390,314 *FFFDA66282B99A4CF03AECB900793E848A58ED23 ABVUZ
2,422,390,315 *FFF6373F6EA528C9F22E9125C24057FBB449ABB6 do=s8
2,422,390,316 *FFF4911FBD78B140EF6EE9CF355B2728128127A4 ACUIVANOED
2,422,390,317 *FFF07DB817622A87A337C58DECEADDA75C6ECA75 ADALBERTO.POSTHUMA
2,422,390,318 *FFF88250039FA2676B383E25C3EED50AD2E73CC9 dp4#j
2,422,390,319 *FFFEF3A4F79A562BF742D8EB3E5B7D09F9DB9693 DVH+
2,422,390,320 *FFF1F441068C65ADD27083FF71D2AF5B33704EAD [email protected]
2,422,390,321 *FFF8B62F7D2E97145BBE03AC6F879AAEC6969E0E DXhK
2,422,390,322 *FFF851DF88687EEE1416CC20C550275219FA0F9F dy+di
2,422,390,323 *FFF5597AF42195EEBE0BCD62F32622C767E8A788 ALFREDPADLO
2,422,390,324 *FFF2D55A9338A4DC7E9D2E9DA422BCCF46E05F68 =E3
2,422,390,325 *FFFD8EDEA062605200F1A508576716B263EA5C55 E6C13D
2,422,390,326 *FFF0B6032255623B7E12B3C347BFEDE5F6890B97 ALMA GREGORY
2,422,390,327 *FFF679C19180E1751E6370A6ED6DEF522F87A3B8 EDDIEDUPES
2,422,390,328 *FFF19FFD1BF30A527356F09575F8052FB8985254 EDDYBUCHHEIT
2,422,390,329 *FFFB75FF59BF1F160A92635202FC66CE514B86D0 A&M5:
2,422,390,330 *FFFDC5D3D4425FDBD048C031D1BABF4A4B7A4D13 AMDVU
2,422,390,331 *FFF9FC7B4E58873C6AB067ABCC1D87D7B641304C AMFIBOLOGIC
2,422,390,332 *FFFFE236940B0544F8303F5D337B07B8CBFCB4F7 amf,t
2,422,390,333 *FFFD8674F89C849C14C1433826D76A9BBB18C085 amopb
2,422,390,334 *FFF48A6AE4EDEE2230FAA738A7FF080076EA2B92 ANDREA.SIRIGNANO
2,422,390,335 *FFFC3622DD98D1228A3C2B812541A49DABF177F1 ANDREASMGUYEN
2,422,390,336 *FFF2F931D5B19E96216C9F9E2EF7FAE8D2E63454 ANDREWRIGHTS
2,422,390,337 *FFF931AB8E616C9A1B184333BB20C80F4417026D ANDY SEPULVEDA
2,422,390,338 *FFFE80C7520A2E429C0326DC3DC19087A684AE6A EIBMOZFLE8
2,422,390,339 *FFF91EC98DB918F87083F147E4A24A7905EF9D43 eiknt
2,422,390,340 *FFF1DA8DAA8068C5FB6A9BAD6523AB1821CC89E7 ANKARTAN2
2,422,390,341 *FFFCB660AF3D240B7408936955D51B92BE7489AC EKISYOUED
2,422,390,342 *FFFA2D9DB58BAB8F815F8B98FC33EB285C32816D ANTON.MARMAS
2,422,390,343 *FFFDFD73BF3EE185D89BE3695C59B2ED69C1D686 elijahkeetan
2,422,390,344 *FFF3DD2EF8882BF9FEA1086FE915831369A8C60B ELKÉPZELÉSEIM
2,422,390,345 *FFF24B8037917D75A55A20A173C93027BC91536D ap(u$
2,422,390,346 *FFF9CD0AD8CAB58E622A537CB530D7D014F1A40A aqtrr
2,422,390,347 *FFF98CF8148DF4CAD340CBDE35E06E8E1B5555FE ardenlabreche
2,422,390,348 *FFF0BA36C514256EB6572E762F310C66B6922CCC AREDAUG9
2,422,390,349 *FFF4CD64519379FF49EB58000024DB1EFE1E790C arev$
2,422,390,350 *FFF3A834AAC06735578073B820D6D1AD544DABDE arikelname
2,422,390,351 *FFFBFCE048AF163B9E4C908DD58FBD95717A9B5A eranfangs
2,422,390,352 *FFF8BFFBAC0825301C005781ED06EB382F9DE664 [email protected]
2,422,390,353 *FFF4AF4A253460F08F2E25BD669DFEC50B55A17A ashleyzemke
2,422,390,354 *FFFC0115083BA96C45E8961A4D070EFCA8FDDF0E [email protected]
2,422,390,355 *FFFC5D7E51B18BD682D6120D56FC3DDA369CE827 ERICH.TANGERMAN
2,422,390,356 *FFFA85DC56906C2C9AADE69FAA0AB6FE2B5C4D17 ERNIDOULING
2,422,390,357 *FFFBDE4ECD30EBB385C08C89AE259A754E252EE1 erniemikkelsen
2,422,390,358 *FFFD36C0435CED65FFF5C36511B2DB703DFDE412 et7n
2,422,390,359 *FFFDD23EDF6DB5D74EAC00F4296F060B9A955815 ATTROUPAIENT0
2,422,390,360 *FFFA8085CA0045FD84D1D4858F1B27D9D5730872 ever,.never.lovin'.you
2,422,390,361 *FFF85FB6EE19AD2074CDBC598AD3FFC7F5B42E5A EXTENTIO3
2,422,390,362 *FFF4C3375D0CAA6211132D49336B8C50690FE0A6 AUSTINURE
2,422,390,363 *FFFEF212C7FD20EC7B32B44629FDDD053D842303 a)v$
2,422,390,364 *FFFD19C76603A049A976BC4007018D6D0E06D2CD AVEC L
2,422,390,365 *FFF8D628DD7D7F5818D9BEC4EAC04053E1DDD7FB factor
2,422,390,366 *FFFCA602CEA0D19135BAE7EE19FC740936D769DD [email protected]
2,422,390,367 *FFFD8B39559BA88044EF5FD4A0883A2CA75E608A Farewell,.Mister.Abner.Hemmingway
2,422,390,368 *FFF7F5E74157FA68246C026C970C701C5C316B74 FARMING.INCIDENT
2,422,390,369 *FFF5226ABED6365097ECF22AC633E4CED9BEDF20 AYOTA
2,422,390,370 *FFF23A276CD8A53065C9A9DD3C3E16515319C4A7 A/Z5
2,422,390,371 *FFF6A547A0CBD3E53C57ADA8DD64CD7FBE997961 [email protected][
2,422,390,372 *FFFC1283888F9ED42677792AEFC7760C34382AC6 FELIPEALPER
2,422,390,373 *FFF504782CFB45665C94342AAC58773C7CF1571C b1__1
2,422,390,374 *FFF52A8EE21898712663BF0375EE49485CE95FC9 b^2i
2,422,390,375 *FFFBD0B1874758346C3B0901E882B218FD8FFFFA BABINKAMTIBMAS
2,422,390,376 *FFF0A0513AF94D0D666AEC75CD77FCB2AE3E1BF0 bakeries
2,422,390,377 *FFF0C2BD4EEF2EFFE05CF17B187AC79A5543AD96 [email protected]
2,422,390,378 *FFFCAB1FF74BFBA6B1EE8E3285ADED1018B3327B barneybunzey
2,422,390,379 *FFF09DF9BA24058D51464252AF5940EDA90FDA9A BARNYARD2008
2,422,390,380 *FFF417E2F0BD49F44371C8E3D83E4897D9161D3E francisschellhammer
2,422,390,381 *FFF01C6EF6F60A231280AB3B9E0DE4051F6B7E83 bc:g$
2,422,390,382 *FFFF3B9D2C57A7F8F53092F49DA940B5D76C21A7 FRANQUIA3
2,422,390,383 *FFF778EF0C0D127E65D426F8DC8F4E5539DB3B2D FRED.CRAYTON
2,422,390,384 *FFFB6F8F2E00D40D4FD68EC512CFBDDCEBC6B0CD bedrelos8
2,422,390,385 *FFFA1B8C1D4C7304AED6B5F319384FF51D169F6F [email protected]
2,422,390,386 *FFFCF306F60E12C38106A585E8DFF84A343FA091 FUNHERMES
2,422,390,387 *FFFFBD312D05A01B8136B8AE865EB72E0581036D G3R
2,422,390,388 *FFF258CE4049796449EBA32B470C1A2E31349215 BERTHENKEN
2,422,390,389 *FFF419CC4DA35213CF07FB4043791399EA688FF0 bf:7f
2,422,390,390 *FFFC59B680FFBD02D9264948694C117A408A6F1A gA-RithistMi
2,422,390,391 *FFF7692CC2F29692C6042C1391AC6896AC6C93E4 b"igm
2,422,390,392 *FFFC4B8358756D2DD4F7E6A13DE3D8BEE62BED8E BIJAL.M.SHAH
2,422,390,393 *FFF3173F37DA8CFFC0BDBBD07FAF70A4953D1337 GAYLE.TIRABASSI
2,422,390,394 *FFF8A66D208F649F73D66F2DA5148E4D95371B20 [email protected]
2,422,390,395 *FFF2E78EE2AFAC1198939EA8F1061205D84255A8 bk:_r
2,422,390,396 *FFF53A7B562E55DE8D76FACD2CE54D43AA5EE67D blowmejan8
2,422,390,397 *FFF20564CAA81751812E6B4A8EAD87813B8BDB6F GEORGEMINGE
2,422,390,398 *FFF9C40CC722FBBA93BE3FCCEAAA6D98B31E98C6 blutgruppenfaktor
2,422,390,399 *FFFAE077C6E3891070ED744AEB03F7C45F5513C9 BMTg
2,422,390,400 *FFF1899B5D74A7AD2BC45533478DC5570DD8D055 BNLDJ
2,422,390,401 *FFF8F304F89557EF4459E4C4BFB5E527EA07D862 G!$I
2,422,390,402 *FFFC0229B800797EEBFCEAC60E5F23590CF2E105 GISELLETORRALBA
2,422,390,403 *FFFFCE7F324E295CDD10BC26B0B1C7A1E49D74FC bonbonbient
2,422,390,404 *FFF879C355D1F4E2CD6064CAFADE2832E96D2EA0 bp5p7
2,422,390,405 *FFFDBA5C807B419033E0BF40233F942F00C08598 GLITIGAR
2,422,390,406 *FFF2E56551DFBCF4C23B791BA9649BFCA0DD8A89 bqag0
2,422,390,407 *FFF2335A45879E53FFEC3DFE812EB460BDB8384F bradleydovalina
2,422,390,408 *FFF1DA9E909CB04913E1BB472AE866576198447D bradymellis
2,422,390,409 *FFF4726FEA536AF622195CD326F97AA4AEF591F2 bradyradney
2,422,390,410 *FFF60D3F878BED159E479A651EA0F4B243A6059B BRANDEN.FEDOR
2,422,390,411 *FFF71DD9D44E58D690E46B72288B962BB4A82337 GOODBYE.(POPS)
2,422,390,412 *FFF1623F1E161718412C762E4F07E8EB8E5C2082 bretbonnel
2,422,390,413 *FFFE4218F188348E3E8E35543896EC10EB8E67D5 GRADYLEGGETTE
2,422,390,414 *FFFB273C9E4B07506DCC4EB1B24A2C35A470C25A BRIEVENMALEN
2,422,390,415 *FFFF46FA38DB53CA28AB2A2876E307A740466229 BRUNOCUDJOE
2,422,390,416 *FFF7A3D628F744DFBDFB64E78F248A86798DFC39 grovertest
2,422,390,417 *FFFC8FE03EC5206920C355BD5E075EB8CDEAD15E GUADALUPEAGOFF
2,422,390,418 *FFFCB0AB6A610C75957F077742E378DDAFC06A4D bsi7l
2,422,390,419 *FFF3E72104941B6351EAC1178280AB5B78796ED6 BUDDY.ORDMAN
2,422,390,420 *FFFA82A05C4EF71659CA5D8AF7190479D91054B4 BUDDY.PUHRMAN
2,422,390,421 *FFF4FBD43CF839BAB84EB8A5E6D578D0F5A77CA6 BUIRF
2,422,390,422 *FFF8C9D7E04570A20DAAD011CBD8383948C3AE1A [email protected]
2,422,390,423 *FFF3BB1C24E4ED22669994C3DA075FA73D1ED0AB BV"0(
2,422,390,424 *FFF8B83A549409BBBA84A7D99F71E3AC5A8A4310 [email protected]
2,422,390,425 *FFF73F9CD002FC38A82BD771A535769090A77B85 [email protected]
2,422,390,426 *FFFDDE6AC7E78A8F78525A45903BE57845FB9229 bwsds
2,422,390,427 *FFFF2B9D226CBACE0291E4355E7C01D8DE78FF22 happydaywolverin
2,422,390,428 *FFFF8F04FBF9FA1B5751C40517E55EE930A7400C HAROLD.FLORES
2,422,390,429 *FFF442149591A02C8F5C1383CA76A8686870AEEE HARVEY.CUNAS
2,422,390,430 *FFF34986B6B1BAA256D75442D0B6FED8C4F9B6AA C$7GC
2,422,390,431 *FFF362DD778A372DD7540851D4F9AB3F2F6D9656 [email protected]
2,422,390,432 *FFF6D03ACAA8DD5635BF0DE850292A1E1E97F534 CARBONLIGHT
2,422,390,433 *FFF15E1B705150B59012CE0B38115884F8280EE9 [email protected]
2,422,390,434 *FFFDB5E857E504EF8F36D02F7F07617BC6FF99C2 CARTERCHICO
2,422,390,435 *FFF288F3E43B71FBFAABB6D48F95BE871637495F CASSIDIN3
2,422,390,436 *FFFCE608CA91A1E17CF51BC77D251A8D34095935 CB+c
2,422,390,437 *FFFD53B45D20F35846134F703EAEB476102E9FC7 ccd.3
2,422,390,438 *FFFC355B3AD44B267E81289294C3FB3DA6CC4E43 CEAOP
2,422,390,439 *FFFEC5E7B4571EB0FAF763EAE6EACF97089E6ABE cf2wr
2,422,390,440 *FFF3BB3DC7E96AFB49830B9955790C8FD34D6F10 CGTJL
2,422,390,441 *FFF92326527044BCC0A2B9DE7C1942F68B1E4D80 chancetoromanides
2,422,390,442 *FFFD0EFA368E73D749FB6A7D78D163206A8F82D6 [email protected]
2,422,390,443 *FFFF859DCC5C632CC740CEE565BCE7C4694FA3AE [email protected]
2,422,390,444 *FFF11DCB53504893DE13F32326DFD8F7622BBF66 CHEFBOYARDEEVV
2,422,390,445 *FFFECC406C3F38A6A647490E3FF44FEBE40F30F0 CHEFKOKS
2,422,390,446 *FFF1D47FA3899E8B4365DE752BE5096CFA949FEF [email protected]
2,422,390,447 *FFF86270121A206F61F59212A32194742F1D859C chesterg9
2,422,390,448 *FFF8D075EC47C4BA5870FF26627AECB560D7510B hoodoo
2,422,390,449 *FFFE2C396F25518C6F717739FAF1A38560D14618 horsessnapple
2,422,390,450 *FFF538C819A5328DF20AD828B5BD6ED6E54A001F HTEOCUEL1
2,422,390,451 *FFF91790B4AA4D9E9F653DADAE2F488831417A36 CINEMODE
2,422,390,452 *FFFB6633DF6B2AB58BA7A31C7477B7EC1908FB9A clbm+
2,422,390,453 *FFFC35620CBDD31986122B1520BFE5A7E45B4271 CLOWNHEAL?
2,422,390,454 *FFF45D21246814754782D430841EBD4C62C34C86 C&MMM
2,422,390,455 *FFF97FBCCA248D79A22865784D4EB2AE28D4D409 c.o$
2,422,390,456 *FFF7FEA64A47D15F8C5E1125C0DB9DBBF6F05936 codyhellmich
2,422,390,457 *FFF2C0330A8BD64A044D72393E5E5567F63FA7EF [email protected]
2,422,390,458 *FFFF5AD9BF7309C263FC007CBA8BD5BD2F2A6B86 coloneljamesb.
2,422,390,459 *FFF697CF33861EF38F1F1741605B3E2D1B385B46 igor.ljutica
2,422,390,460 *FFF887C81D2EA6812B55371B49C14E4349743777 [email protected]
2,422,390,461 *FFF2BED7D362A59CBA9B3447C593728BB74B86DE compounder
2,422,390,462 *FFF745584530B222CC7CCD29288ED36B9B0BCCC0 confuted
2,422,390,463 *FFF585702930247BFE8E82C25944F9AA440DE37B CONSTANCEPOPE
2,422,390,464 *FFF94A173F0C137BAE3D2A40BCE7DD58A7FA6498 ILUVLOISLANE2003
2,422,390,465 *FFF9511F32A5280C65494A30E3230E613B18DDF7 impenergie
2,422,390,466 *FFF09DE395A63587E5D922DB49C1E05136A0A5EA COVERSLP
2,422,390,467 *FFFB3CD1A7B63A78066062896E8AC278602734F9 CPHA
2,422,390,468 *FFF488AC30A99C77AA80912AB04671701046AC16 intracutaneously5
2,422,390,469 *FFF0EBAB82C200C674998B3AC31CEB48DD04778D C:\PROGRAM FILES\COMMON FILES\ADOBE\PLUGINS\CS4\FILE FORMATS\CAMERA RAW8BI
2,422,390,470 *FFF10ABCFCA7DEC4CBA807AEC402B7D6909A1AB2 iudasly7
2,422,390,471 *FFF4D5563AE6E26605ED1089DB8E4DDC3E2EBBCB c;?rn
2,422,390,472 *FFF7F0B6292E035B57472EA2F0B3CD1D95363A09 csn&g
2,422,390,473 *FFF8331FA6E88DA3CD84B69669FEFCBE6A428253 CT.0Z
2,422,390,474 *FFF29FDF598ADFEB367792F3417D2EB6EC891461 c!v"a
2,422,390,475 *FFF43C5E001770524162F315DAB8C64886AD1D8A [email protected]
2,422,390,476 *FFF75099B7B17E1402AFA0229E294D78221F83D5 d1#ew
2,422,390,477 *FFF3F9DB7608F05F1224D3A33D4CBA60E1D7D4C2 JEMMA LITTLE
2,422,390,478 *FFF16C1143815303A2F1D75F2158AAFAB604548C D5J5%
2,422,390,479 *FFF944CECF62865D9FACD1C02DB7E6AD15D58B78 d6)bb
2,422,390,480 *FFFE325FE1EEE180B4A65CD08CD840EDA0A3C155 jeremyspooky
2,422,390,481 *FFF5013513BF8099385C8A010CF44503FC3D194D jeroldpanagos
2,422,390,482 *FFFDC7F63866BAB1DF29566350C6D7552423E2B0 jeromyreeds
2,422,390,483 *FFF604BC046ECD95BFF2B7BB0E132E35DC3ADBF4 DAC+3
2,422,390,484 *FFF3938952FBE74DA32318479351C788FBC77C8C damienaskia
2,422,390,485 *FFF42E4A8105FE68CF1D38C6630A46899A35D205 JIALUJ
2,422,390,486 *FFFF586787C52848AFDE0CF173CA7C9163C394C2 damoncomnick
2,422,390,487 *FFFA9916396E179BF79E59520750B5C99C884E33 DAMSU
2,422,390,488 *FFF0F0C504024770A5105DCF6B466C873BEBA0BD jimmiehern
2,422,390,489 *FFF9BD9740FBE47F6D1FF9053C3F340D76F8B5B9 danialsalway
2,422,390,490 *FFFABA1C24BD57CB1904CD1A4654EC714BFAC5FD [email protected]
2,422,390,491 *FFF88B2659D87F6AC42209326A7B7D9F1F643897 DANIELWORMLEY
2,422,390,492 *FFF084ADD1054BE54FFED5AF61B306E3F2C484F4 JOANNA-FIELDING
2,422,390,493 *FFF6BB2A4AC2AC76DEA7718B1683D37380FCB812 JODYOGUIN
2,422,390,494 *FFF941B2A8B09987B31DDDE5E7043D342F0306F1 JOERHODES
2,422,390,495 *FFF4543D03B0EB306E9A9AFF24D8EEC91D888F04 johnnietobey
2,422,390,496 *FFFE2130986709E5B848E4856E8F8A352F4EE961 [email protected]
2,422,390,497 *FFF63A9F5DE581515BF08529F6AB07A3A0B873D0 JONAS.HAUSWALD
2,422,390,498 *FFFB19E7D8E1481398552BB1FD6A867A75A3D900 davisbuehler
2,422,390,499 *FFF3B1E625EC568FC2F2808B6993F3FE2E3B0C01 jong-do
2,422,390,500 *FFF283A9A57DF2D473B95BEDEE85D1F32D643CD3 DAYS-WORTH
2,422,390,501 *FFFE63DC94543283DE752A71C018DCDA2CC5D11E db[(
2,422,390,502 *FFF56CB20E16C39ED6646A5FBD4B922C9AEB3B00 DCIO.
2,422,390,503 *FFF4558EE6137E073C28CC52D377A29941800E6E deandreminner
2,422,390,504 *FFFA1F7AC0CC2F56DC37A19352BAD8B5966D2EDF DEBBYGRIFFITH
2,422,390,505 *FFF0800C2A0BBE2E536DB2387DE8AF25E10D1634 JUNIORLORIO
2,422,390,506 *FFF75590E46649B590E1E2EC0AB81BA237285786 K4137312
2,422,390,507 *FFFFDB373FAA0BCD7CC2BBDF4970E69D900597E4 DEMETRIUS.BERKOVICH
2,422,390,508 *FFFDEDE4B892FFC935ADCD869A497311CE0972BC deodourant6
2,422,390,509 *FFF75DEEE1D69A289592526776618D464EF7004B KATHYHETZEL
2,422,390,510 *FFFD334B65E6E28A846D8357B7B3AB751DA7FE2C df5a9
2,422,390,511 *FFF6ADD3C1DB7685F1F839AFF7A11D1598AF7254 KENKUTT
2,422,390,512 *FFF6FDB74364AADED4991FAB9DB492DE09100EFB dfo.=
2,422,390,513 *FFFBE1867DE4B6A462B45AF9FC922CF6773317A0 KIRKCOLADONATO
2,422,390,514 *FFFADACD8744B911A3B77A8B03A9F3167BAF446B DIEGO.RUSSUM
2,422,390,515 *FFFB2458058F57F3738FFA7578B174BE1036AC70 diesellocomotiveworksdlwmanufacturersandserviceslocomotivesandpassengervehiclesindia
2,422,390,516 *FFF1F0D2E1E56D5AF9D3A380AAB9B64D72926BFE kristofersampica
2,422,390,517 *FFF5C3636C232BA1AFF41E0FEBA6B0FF96AB3C22 KROGHØJ
2,422,390,518 *FFF7341A1FE62D3BD336AC0DB59E2465A9498EFD [email protected]
2,422,390,519 *FFFFA53F4879414C9D02C24F551ABA191EEE26D2 LABORATORYSTATE
2,422,390,520 *FFF990C86A54354022141FB453BABEF3A7432996 LACYSHIMA
2,422,390,521 *FFF387F5E21A484EDC21AFE2928B799061FCA271 distributeddbms
2,422,390,522 *FFF5ADDCD08578D961C41A088700647CEDAD460B LAWERENCEDUFRENE
2,422,390,523 *FFF6B0B8180825B0D23454A1E5348CF795DE6068 [email protected]@710n5
2,422,390,524 *FFFBA3F6D163BCA9E6E9191C2C63991A15199349 LEANNE-COBURN
2,422,390,525 *FFFD4A7491F2F8771F4D1D83C6C581A99E8B31CD d$mou
2,422,390,526 *FFF043E9DFEC0792902C2B97D772AF9FA38F3168 leochech
2,422,390,527 *FFF1305FE1FED2B47A674F4CE1332A6F4F6C9DEC donald.j.alexander
2,422,390,528 *FFF3E82B115FCF0E70139BD298BD494188738392 DONNYTRUDELLE
2,422,390,529 *FFF59B1341D9637B5088E0F0D895D969B8B4D19F dovnare7
2,422,390,530 *FFF4593ADB24F5C3CF0F15D6478E71A282BD81F2 lindarichelson
2,422,390,531 *FFF8E869E85892DFDE2EA8D242AFB505119E0FB9 logomaster
2,422,390,532 *FFF2181E689DA08D804E32E685CF2469303256B2 DtD/
2,422,390,533 *FFFB84DE4BF33698F2946F0CDB272768A696AF49 DVYW1
2,422,390,534 *FFF7EFDE0145944280E6F3E80F16274A9353F396 DWAYNEKOLASSA
2,422,390,535 *FFFD0FBF450C39F7DC14420D8C0C3E8D8EF8CE97 DWBOD
2,422,390,536 *FFF1F8824D617EA5D82DABA429032F4F2BCB6404 D_wp
2,422,390,537 *FFF76E0C420130D7311F9A85C797C0829FEB4727 marcussamperio
2,422,390,538 *FFF15F43E0E3DB2E4E8B0E5207AB40B14BFFAE96 MARIBON6
2,422,390,539 *FFF72FC8CB19A0E810BEF707CE12E002C519A047 MARIO DE LA CUEVA
2,422,390,540 *FFF7DA357136BE67FC0605C778923BFE609C13BF earlyearning
2,422,390,541 *FFF1A56100EB5574F95F02629B623054F60C53CD MARTY.MACKNEY
2,422,390,542 *FFF5DFBFF151D30999FBA69F0DCB914E752B100B MARYANNANDES
2,422,390,543 *FFF037D7148BB696A87BDD03BC0F53552FA3C440 edgartasto
2,422,390,544 *FFF55554790268D4C00F8DD73F2090DDADD8CB77 mas-pon
2,422,390,545 *FFF5478EC0598C077DE1C62DDF5CE4298184AB80 MATINEES
2,422,390,546 *FFFEC81B59E883BB5AA56F73526C38568E5DF479 MAURICIOBONFIGLIO
2,422,390,547 *FFF548D9E5232B4E1A1937057AA4F4459746DFDD MAXWELLMATTAN
2,422,390,548 *FFFE19D536712BE5F27C844BD8145EA02C817078 MAYNARD.RISPOLI
2,422,390,549 *FFF6584D1DB401ABFBD289073F336A8C23DF71A6 EDISONSAMPLE
2,422,390,550 *FFF4762860098E78481EE4E0D3D9E0D65C117A92 MCGRUDY
2,422,390,551 *FFFA64D240729BF388CDDF9469C6E19C607671F6 mckenzie.maddox
2,422,390,552 *FFFC2F335210B564B81CBD86106CDE82F6852660 eehebsak7
2,422,390,553 *FFFCEF09C0CDB955F0F2A16A865E053601A5DFC3 egiljiwgnal
2,422,390,554 *FFFA2C88816C276032E39D9D894CDEBB527DC50A MESTRAMARCAL
2,422,390,555 *FFFC97D6D7EAA24485EE74E6EDA8C5471FAB1B56 METALSEX
2,422,390,556 *FFFF8A9A59D9F8AC518496407A0E85DE5D43754A MICMACれぃでぃおアーカイブ
2,422,390,557 *FFFE18BE53771E8277BE63D7E93E8E54D64C5765 MIGUELPARSHOTAM
2,422,390,558 *FFF54D998141F0F1C68171EBB47FDCE19949AFDE minaras4
2,422,390,559 *FFF4ED7619A2F42AC11DB573E636BC0E6B57024D EIWQC
2,422,390,560 *FFFB920AEAA1C0BBB572133D497CC817A6767DE0 mov4813n3ss
2,422,390,561 *FFFB516BEF4284037D4230956D88D970B98AF7A9 ELISHA.GRBOYAN
2,422,390,562 *FFF0DDAD03B696AB0BC9A08132DECDEC82EDB1F4 ELISHA.LANDERMAN
2,422,390,563 *FFF0B06724D5D2ACE12A0D31ADCDB830FC59EDF9 elisione!
2,422,390,564 *FFF0064A168BF7D01E9BA44C3639F29F6622578D ELOY.LACOSTE
2,422,390,565 *FFF481D36C0C97915683BEFAF8819C513BB87AAC ELUIMMIN2
2,422,390,566 *FFFEC44101CD93AFF91FC93C245004CB1D2395C5 em7at
2,422,390,567 *FFF5543D2B181D44955875EE724011D2E0D05649 NATA218
2,422,390,568 *FFFBC63E4AFBF16C3EC45906D1086C3E0B6E3BB6 En7o1ed
2,422,390,569 *FFFEB4E0358C03F18097ED5F77DD79B77EDEA973 NDAVESHHVAATATAAYINAH
2,422,390,570 *FFFE2A747A84477055924FC423C5E4DBFF44C7E7 NEAL.HARTWICK
2,422,390,571 *FFF65592A632417C634B3B7E21F8B411681D248A EO1FV
2,422,390,572 *FFF30F4BE41793B25AE9633C8FA8012D09D79114 [email protected]
2,422,390,573 *FFF95FDDA8C4CCDF4DE35BE50431521EA596DEEB [email protected]
2,422,390,574 *FFFDFA7EBF6F193AFE99A22A1C24EF4B57F5C837 eqnnm
2,422,390,575 *FFFFC0E26EF59E1575BAD77AC3175D68F384988D n)(featmadonna)
2,422,390,576 *FFF1252E84574E330EBD7060DC0481029CA5462D ngt8sx7bjpo1
2,422,390,577 *FFFA05A1A3B580FB9EC9F918220949CF19D5EA4F NIGRIA1234
2,422,390,578 *FFF297EB63B9D9462B43D16D92AD4EFD9E6A4A48 NINA FARINELLA
2,422,390,579 *FFF6348F962DB656F366C203347E6518BCD2313F [email protected]
2,422,390,580 *FFF4CBA5690FDCD3FF81DD3FFC3887B77F904C24 NKERPIV8
2,422,390,581 *FFFACAEA2981B94DCB102C3BBB4B5DB76D4467D4 NOBLE-PRINCE!' COUSIN
2,422,390,582 *FFF536156F42C1B184753A1D759E85C6A605C69B NOBLEVANMAANEN
2,422,390,583 *FFFDD21676E31AC126006FED0DF665910652AE68 ETYBAGIG3
2,422,390,584 *FFFCFFC335FE59BA309DA8079A1FE64CF50FDFF3 evancordano
2,422,390,585 *FFF7F7E4F30CAC963AE1F49F380261513562B16D nontisss
2,422,390,586 *FFF443B010800025986BA485E251830D922FF847 nontransiently8
2,422,390,587 *FFFD79FA6D76889169D67FF653A650FC19AEAC15 everettodhner
2,422,390,588 *FFF95FF92E8F51328AA4443735350D7312AA6773 norbertozeagler
2,422,390,589 *FFFC12165EB6645C9624BA8FEF9B1B9ADC9B194D excptnl9
2,422,390,590 *FFFE332845D5323082254088A88BEAD08F037249 nothing.left.to.start
2,422,390,591 *FFF4B553F7A8B4A6174F932EFDA1FECA82DA8A64 *-O'%)
2,422,390,592 *FFFB1515B5177C41BF3E4C3F6C8E040879A7045C facilitions8
2,422,390,593 *FFFD2D4533562AB5FC5A782086C9143B9251DBEC odinvotal
2,422,390,594 *FFF51B0BC44BBBBDD49BC8B6BFE280446C87EC4E OLEN.SCUITO
2,422,390,595 *FFF8C5B1B4EDBAF0E75CB945AE89BA54944CCD14 omerbequillard
2,422,390,596 *FFF10CC59D1DC6376AF7456F70B6EF30DA3ABEE6 ONBESCHAAFD.
2,422,390,597 *FFF15D88BF88220C5AE32653DCD966724BFF248F fernandotrujillo
2,422,390,598 *FFF4DC98B4DB82E1F7CF3C0E21C1D4A7E63670C5 FIRAKISI5
2,422,390,599 *FFF129BEC6B25EEC95B4DC6A46C633C30B6F699E FIREELEMENTS
2,422,390,600 *FFF46E6EEFDA5CF98FDBEFA87A01E3B3F714EB54 OROZCO7
2,422,390,601 *FFF09491CDDE2CAA13C3C21415E533E0928C1C7F OSWALDO.PRIMROSE
2,422,390,602 *FFFA195040C581F6059522E3506D1796CF82701F OTTOBLASH
2,422,390,603 *FFFE91C8172F34D30A9733EBA52E31D59CFB8464 forvisnings?
2,422,390,604 *FFF4E134A35590F597E8EB155AF5E60CDCDED878 foulests5
2,422,390,605 *FFF35CD927958CD75E5335F28295F18458B7D65A overschittert?
2,422,390,606 *FFFCBB23BB0EFDD55857E68FBD901F69778888EA pa00107610
2,422,390,607 *FFFB60EC3B55380A25E96E423CD1F9D37F057823 FunkyQueen(Giagarobotdub)(feat.Margot)
2,422,390,608 *FFF0DFF5CCEB6A612C0F319FC17A4E6A1BC967CA g41234
2,422,390,609 *FFFBF58FCA36599EB1632B40E938843BCC30D7D9 [email protected]
2,422,390,610 *FFFDFCA6F46C30FD33AF79A90A4C39E38EB1B66D gaping
2,422,390,611 *FFF381F5857C306903239F334692FC7392E4D54B garrettvoorhees
2,422,390,612 *FFF24029528454EB57519B4AB5D636C61749F0AE GASTONRAVELING
2,422,390,613 *FFFF70B023595220B522952C694AE285323F27FE PAUL.HAVERLAND
2,422,390,614 *FFF461D387C9E75900B4BC1C629661AA86AD19F7 pcwatch8
2,422,390,615 *FFFD5AB7BC7CD30AE5BE278EB676A5B9DBB2C547 [email protected]
2,422,390,616 *FFFB5BC8285EEC78712FB02A76432DC4B23D788B geoffrey.weil
2,422,390,617 *FFFEBEBF4517689C012E3B1F5D610BE1E12754BE gerardogittins
2,422,390,618 *FFFED4A1BFE2542B3CA75A3966130DA625D84453 GERMANKINNAMON
2,422,390,619 *FFF501E49C7347BD0CC7197B361F1FF083F5EEB2 GESCHICHTSINTERESSIERTE
2,422,390,620 *FFFAACE3C756A1EA121921A64BE96DE5B829C1B6 GLENN.KUEKER
2,422,390,621 *FFF57538D776F6CE54940E5C8B0114DA27F8E29B GONZALOKIDNEY
2,422,390,622 *FFF5F125C100A0D35D6EAC273D9F89F53F54CF65 [email protected]
2,422,390,623 *FFF9CB0E3CF3614E33437DF378E03CE5FAE084DD [email protected]
2,422,390,624 *FFFBB003B248D9FD88F37C3FF5FF27D7267D3D08 [email protected]
2,422,390,625 *FFF4F9F175018A446604455B346127DF4A33F833 PNH8656
2,422,390,626 *FFF6306E1053516B5CA7A0EC28841C9801182EEA POMERENDAM
2,422,390,627 *FFFE75844ECDB6DCB7BCF8E8AB7FD9481E298FFD GSCHRMD0
2,422,390,628 *FFF1679A2A960AD7AB07B787ADD800951600577C GWRACHENED
2,422,390,629 *FFF6048F981A25927BCAF6EDF0E359CC268D5B6E haimanii
2,422,390,630 *FFF3E48F7B6EBC0AE8BFA3B616145139EA42E13B [email protected]
2,422,390,631 *FFF2B94A9653BA4D847922BD5C1996BFA2BB190B HANS.MALINOSKI
2,422,390,632 *FFFBF7FE31E56583CFB1B862DAA9918888647590 HARLAND.WRY
2,422,390,633 *FFFFE03FD780A70B0FEFCC4A8F2FD9DD1F96566E PSEĆEM
2,422,390,634 *FFF23C31033B7684A82B2112715D3A4527848E69 P######@.~.`SPLAT
2,422,390,635 *FFF92FC627B1963AA2E90C3DDF3891A3FC696B1C [email protected]
2,422,390,636 *FFFB9B856978C5C154406484469DCF6627FED570 HARMONIEFORMEN
2,422,390,637 *FFF213C195DF1793A09538608B31DDD71D569CDC HBRADBERRY
2,422,390,638 *FFF8C99592749B533C9D04A198DB4BBE5EF7B682 HEADBOX6
2,422,390,639 *FFFB120341336FCA6D3009801AD7D739117CD653 [email protected]
2,422,390,640 *FFF719FCAC417B676497A631E91CAE34351C2747 QUINNSTROBLE
2,422,390,641 *FFFCB5F6A0E63E53113625029E0C3DD1893A23B1 helmich4
2,422,390,642 *FFF9113CB4E2C75242A45C449367895576C8D123 R3DSW311
2,422,390,643 *FFF087064520D73BD89AAF571292829D97CF28DA RAFAELRAHM
2,422,390,644 *FFF8F0B2D7A9E2BFADA1FE9DAEFB1F01DF675B9B RAITHKABBING
2,422,390,645 *FFF2481F981A554399217B3C9CA42C5F4783F2A5 hingstar8
2,422,390,646 *FFF68EC911D5EDAD7C4A429D3521DE6BAE5777C1 HOLD IT IN MY HEART
2,422,390,647 *FFF16B8C7B67F091357CBE520754F7D8FDDD98F9 RDKLKENING
2,422,390,648 *FFFA332D638C7C0C3CDDA91D6C7E64705B9436BD hoodoo
2,422,390,649 *FFFFD19000C43DEBA6A5C4FF0E874F2E139379FA rebeccanorthrop
2,422,390,650 *FFF59275E53D3E56AF40980AA07C889CD48F9DEA htnnyksi3
2,422,390,651 *FFF09A30CD6DE1147E300DC1771AADD8651B9192 RELTHCIW8
2,422,390,652 *FFFF91F4407847A07EC90C95EAFB9E879277BECA RESPIRIE6
2,422,390,653 *FFFBF658BDEC7457974B13A611A8631DB754B6D6 hudworth1
2,422,390,654 *FFFC1B26BAE21CF973D117224B0C2444872D3197 RHETT.MERLAIN
2,422,390,655 *FFF50237BC1798EAF8425D8A5C588A927D8148FA HYMAN.MILIAN
2,422,390,656 *FFF11893369060CC0A7E5EC12AA2681F5D7F1D6A RICK.DAVITT
2,422,390,657 *FFF153778EED2EB71B7E38ACE16211EBDE972B9B RICK.GLOCKNER
2,422,390,658 *FFF88DF432AD6C484E96BEE4E1B97F3F2E518B8B iamj1l2t385
2,422,390,659 *FFF2A69736868642EEF6FA1A11E086C926629D30 IANYARD
2,422,390,660 *FFF1829E3C2C6F51C5A861E5858D0F95D9A95CC7 rockin.with.the.shimming
2,422,390,661 *FFFB047C4ACB5BA4A05449ADADFF6D67279418B0 rogerkemfort
2,422,390,662 *FFF24D585796921383A4D38701DF12B3D32D8B60 rölleken
2,422,390,663 *FFF55DC12B429EC5D45B0CB2D63846C9284868B3 RONNEL.LAURENTE
2,422,390,664 *FFF24E578FFA3775C3895B81B5E9C13533C18AA9 RORYKEGG
2,422,390,665 *FFF05F1084C59C20D37427DFCF57698C6B762BB7 ROSIE.PAGE
2,422,390,666 *FFFD342F47D07072133E5099AE98AAD87C9624C3 ROULETTE-EN-LIGNE
2,422,390,667 *FFFFC614F75228A8B4837F28FCE82873E786F0F7 IKZUAA
2,422,390,668 *FFF856471B6941E304ACA2ED37374E9320C0004F RUFUSARMANTROUT
2,422,390,669 *FFFE7C4068203E70553F1B97F0CDEAE20CEAD6F9 ILLAKSIKIN
2,422,390,670 *FFF2AF84CD72451D511508FDAA80053C4595105A illan-Tvist)
2,422,390,671 *FFF55AC9CBC65381853842C6285691B3B0BA07A7 RUHIGSTELLUNGSVERFAHREN
2,422,390,672 *FFF5995C3598783582F14020358AA3DAEE6A1EFD in-the-scalar-variable-<tt>$otherid</tt>
2,422,390,673 *FFF7C0B6EC15AFEC5B687DAE7EF4B6A299F3BA7A sauna---sommaren-1998
2,422,390,674 *FFF030CBDC1DB79E51C9632981D5726670644CE2 i,sharko
2,422,390,675 *FFFC39F8B5CA8986E32935A71638704D25AFE657 itcv
2,422,390,676 *FFF71ECD2F0C835CB3F3CC7446134B728CE81D5D IWISHIWASINNASHVILLE
2,422,390,677 *FFF3889F978A9C0ACFE9E168A5ACFFEE0A04274A serumbehandling
2,422,390,678 *FFF94E6C9474EFA97E9D465547BAC52B1E921109 sesinedd
2,422,390,679 *FFF650DE90C648C25F422B7CABB7D70702F9FECD JAE.BIEBEL
2,422,390,680 *FFF4FDBF6E23983817648C406D42247148878D1A sfam188
2,422,390,681 *FFF9DCF53C6C9301C130C81803014F618BE02C9A jameyspielman
2,422,390,682 *FFFDCF54DACCE37C3A274FE2E24BBE5450040711 SHAIMAAUSAMA
2,422,390,683 *FFFA91DD9A9504544450B79AA9F48BE23E451A8B shaobsw7
2,422,390,684 *FFFA586959B0FF402AD7DD8E8E1ED22F568C6AA4 [email protected]
2,422,390,685 *FFFAEBFFD2A827A28AB386F39B4F82980B45E905 janice-stokes
2,422,390,686 *FFF351F93DF25AE7E2940B24B156099EB39F43CB SHERRYRUSTY4
2,422,390,687 *FFFAF37636E33C814A1D47A6CBF72753B278A8C3 jarvisbeemon
2,422,390,688 *FFFE2ED6B4821974BFEA5DFA341940C4AAF06A30 SHIRLEYVIVEROS
2,422,390,689 *FFFC99D9B4BAC45C1376A3CC69ADF5AE7A88F32D SHIVABANDARI
2,422,390,690 *FFFA1DFD629E76F34B15F6551D19120BC05AAF44 SILIEZAR8
2,422,390,691 *FFFB7FBA4C941E001C1A5BE1AEDBE539287452D1 JESSETIBBITTS
2,422,390,692 *FFF539616A56E7DF4101D87552AC7274AB31201F jesussheidler
2,422,390,693 *FFF75AC512C2A224A71FF60DA1FBD350E4A3F712 [email protected]
2,422,390,694 *FFF3BD6FCA288C2FC8CDC2133878847F31A18556 Jezus ratownik (instr)
2,422,390,695 *FFF93F887F095BDCFE145EA01358A688F4BDB3D5 [email protected]
2,422,390,696 *FFF41CCAB932EF86848B25366FD073101B22E22F [email protected]
2,422,390,697 *FFF42F30737DE9515551F7753211E205D48765C4 SLIMPIC1
2,422,390,698 *FFFD8BD3E84337322107DACB5EF1354C90468207 slotted2
2,422,390,699 *FFF6361ABC8D88D9B11E5876DF2CC26CDAAFFE73 j-official
2,422,390,700 *FFF2EAFE9B3DA24607F733C9FC9E3379F1123910 johniegrohs
2,422,390,701 *FFF379A0B5E0DABD1F52A036C16DEE7810508171 JOHNJAPHET
2,422,390,702 *FFF3F81E49C362E3D078E783C95303881AF79819 JOHNSON.REUNION
2,422,390,703 *FFFEA52CB006F87046475264AB70FEDECD857634 SONARSONUR
2,422,390,704 *FFF6D4D0D3FFCBFDC1E98AAE454E7E04343620AD JOSHUALAURITA
2,422,390,705 *FFFF3E11DD0DDA96FCDECF21F50EF6F3A680654B KAHVIHUONEEN
2,422,390,706 *FFF6B9C3244F8D0C31594514611DBD0CA6123FB5 SREITEKS7
2,422,390,707 *FFF61AD554AACA8B3A1894A272DC74593DF84480 KARMALOKI
2,422,390,708 *FFFD279643230E24A7A9D82BA0DA4CDEBD8CF2A9 SRTCLNT2
2,422,390,709 *FFFF3BBE3AD0F8C4FDD9C04AEFF1DB6F8097F302 KATHY.KALLICK.&.LAURIE.LEWIS
2,422,390,710 *FFF0640C837C9A620B56AC3EC70EF1F275DC59EF stangetje1
2,422,390,711 *FFF48211340E48656F0FE956A56C54E914C6C05B STEINRÚNU
2,422,390,712 *FFF51F48A3DEC17195C9A480EB65CC16EA3064E6 kenneth.rothwell
2,422,390,713 *FFF31781217EA673D320D8BE34741B98992D029F KEVEN.INFANTOLINO
2,422,390,714 *FFFFF3309D8187C95D3C5657F0B8269703CBA39F STEVEDAVED
2,422,390,715 *FFFB582B8F1874911494878795BDBA3D8CED391B STILL.AIR
2,422,390,716 *FFF6F3A97286B045BD741A0A83FC809EF63CD8F3 STUARTPAULK
2,422,390,717 *FFF5530E955EDFF1FF915A6BD8187701F53EE7FF @KMJN
2,422,390,718 *FFFBE5065DD44FBEA5CDD157C7B9485D058AF380 kniha
2,422,390,719 *FFFED7D6C45F65B1B619A8C1039C57DC8961EF0A KNOWNOWRONG
2,422,390,720 *FFF55373DBA7C799C80EE32521BD233A3FFA2CC3 SUNNYMISSY
2,422,390,721 *FFF04F460743BC23205DB7DA645B1C5C8F9EF299 SURCULIGER0US
2,422,390,722 *FFFD0A15B51ABF1DBD04A2C6E826A3D67193E76C SURIMPOSAI
2,422,390,723 *FFF8D0A34D24569BDCCAA085F2D74BBF308D81B5 KRISTOFER.DEKKER
2,422,390,724 *FFF26D829D52E30BF552409E6869BAF12FC4629E KRUCHAPON
2,422,390,725 *FFF5A8565CAA19369E485657BD45211AA1AA7E02 SVATECNEJSIMING
2,422,390,726 *FFF457985374189CFC10BE0A66B3778CFBFAD4F2 SXCSD6
2,422,390,727 *FFF9FFCF50607BCFAC20CCA2D7D37C4A1D36860E SYMPHONYNO9'FROMTHENEWWORLD'(2NDMOVEMENT-EXTRACT)
2,422,390,728 *FFF9A2EC67F3AAC4899E8A36AD366D5223FC1601 T(&(
2,422,390,729 *FFF14A5AF2D43FE1CF05223AC2AB9ED4DB932FD2 LABORATORY8
2,422,390,730 *FFFD626085EC863F95B3F7AA943B200F4B7D0C5E TALK86112061
2,422,390,731 *FFFE5347B95AEE5D2933DD6273D7B47677E0C6E1 talkiest
2,422,390,732 *FFF3155DA253E258B0A6F52C57FAD1D6891207AF TALKZAHIDNCST
2,422,390,733 *FFF466F4C0FDAEC91FCEDEF1E88B6DB9E73DE396 TALVISOTIEN
2,422,390,734 *FFFCA50BFF940272DD88EB0C6267202D4FA983F5 TAMAYBULUT
2,422,390,735 *FFF868F78976687B70950992D18B548976373B35 tannoudji-cohen
2,422,390,736 *FFF8B64FBD97D356A4F46237CA80ECB418320C1A laurencallon
2,422,390,737 *FFF32E22FE6AD97448F0D452B7709F9D1CF19122 TBUCCHERI
2,422,390,738 *FFFF94DD7F99E44C2591E331D20F4521E1C98E44 [email protected]
2,422,390,739 *FFF8200A62C82D5BDD6D152CAF3C257AD922352C teatro-metropolitano-de-medellin
2,422,390,740 *FFF90DE7F8C96FAA3A434BC96A6DD8CEE56CC4F7 leandromcauley
2,422,390,741 *FFF6D48FAA5EBD8F83288B9181C25FF5E0C9B807 LEE.NOREIGA
2,422,390,742 *FFF705F7D039F2F1EE59396C2116181022B940C2 TELEXERING
2,422,390,743 *FFF0A19D8902424F150B86FE68ED9934F298EA5D [email protected]
2,422,390,744 *FFFCB5A325D0EA0815FFD66E13F611D369D0B249 lennonherman
2,422,390,745 *FFF60175B4EA5A50B7EF65856B674058D5AB3D86 LEROY.PITTMAN
2,422,390,746 *FFF89BF3B3C2CA16C72F6B91D0ED32671F672EFF LEVEN88
2,422,390,747 *FFF0176CC4C17F8203D3A9BE603774D3D16D44EC LIBCAT.DORSETFORYOU.COMLIBCAT
2,422,390,748 *FFF7E72E51A42690291090F322E6B447B20670FF life–機內航班雜誌
2,422,390,749 *FFF1DF17840E64EFD522D6A0440ECD46815DF5E1 [email protected]
2,422,390,750 *FFF54342F99A5C6843271D505D205E0FE5808913 THENEWCONSUMER.COMWWW
2,422,390,751 *FFF35455F97F8F3091E46AD4AFA7C05E6DC39DCE theodoretomei
2,422,390,752 *FFF2AC73B77D5B1539E5D89C4A63290CFFAD74D6 THE.ONE.I.LOVE
2,422,390,753 *FFF972C2E5B552F90CF142B10B0F9791F5A8B4B5 THERESAMONTREAL7
2,422,390,754 *FFF1ADB94F9109EB1CFE176220A2385850710020 THE-RINGLEADERSCOMWWW
2,422,390,755 *FFFF7A5FD4011FD08721ABB1FB64182EFDF5749B the.turn.of.a.friendly.card,.part.2
2,422,390,756 *FFF2C721E2287831BAE22ED90D64220876171698 [email protected]
2,422,390,757 *FFF99F1684724EC2E3412E2D4A7D3EFF65663B34 LJUVA-SVENSKA-VISA-(DISC-1)
2,422,390,758 *FFF3B615C08B9BA9CBE9566A2C8BA8505D867FCA THURMAN.HENNICK
2,422,390,759 *FFF7604731851365F533C4A17CF954645DAA88FA loisirs-jeux
2,422,390,760 *FFF1CC4CC2C74E1CB7975A8D56F65C456040B491 TIMECAROLE7
2,422,390,761 *FFF07787E43EE5C3450306B0BEB78519EA59BCCD TINSELS
2,422,390,762 *FFF5C73E8E61AACC431F9277FF66C550C4769E88 TITLEFREEDOM
2,422,390,763 *FFF32C1A05533E235B161BECDC5933EC0E11D9F2 LORD,HELPMECARRYON
2,422,390,764 *FFFA7B7DA89750B45567E1C617609128D2567759 $TN9ER
2,422,390,765 *FFF3F11F6393BBC8D2A54C7A9960FC0D43D6E5C1 TOD.SLOVER
2,422,390,766 *FFF38AA7E89027AE757C6E2328E054744123F0D8 TOEKOM-STIGE
2,422,390,767 *FFF5A63B813B8CBDE56E9E7692EEC9C4A8D3B809 [email protected]
2,422,390,768 *FFFDDACDF18499F4707A3C4A081AD7FDB7D43F1F lucianorowels
2,422,390,769 *FFFF353AD76D38843F72FE961E96CFC2C396CF5D lukeskivssuddendeath
2,422,390,770 *FFF52F53E2985DBB88BAB3C5F232CFF61648A8BA TRADIRSI5
2,422,390,771 *FFF61F8D525BAD7B4A32967EBDAA16DE1FA0A636 TRAGICOHEROICOMIC
2,422,390,772 *FFF88F640CBEDA18F8E732777294E808C1161DA2 TREANCEH
2,422,390,773 *FFFEC4FCEC439F15106F0B4E6437305429B89872 trekwelcome
2,422,390,774 *FFF19713BE5645C0C55870E3794824AF51E435AD [email protected],
2,422,390,775 *FFFC35F7007FE4813349B5B24EF1938F3DDA15BC [email protected]
2,422,390,776 *FFF40F0A1C9E9AE951DD77A5616491BD0C93177A M1N1ONS
2,422,390,777 *FFFF3EAF5C69B3E759B3A9D0F7E620C5BE01784B tristanisworking
2,422,390,778 *FFFFECA949DFAB9ED6A1171F465F5D9AD49C79D4 true$ou1
2,422,390,779 *FFF9587DC14E060325F0246B027C6F7567F59C82 MADMOIZELLEZ
2,422,390,780 *FFFE4F33AA11B8F958B1E22B6660EC9DCF076BA5 TULIPER8
2,422,390,781 *FFF6FAAF6D81A66A4CAD4C3A70072220FFF56FC9 TXSTRUTTERS
2,422,390,782 *FFF39BFB4F644F802053493FA3DD5C27F9061B7F tylerjoejohnson
2,422,390,783 *FFFF59D913DB0A33B9BEE580C3528184B949899E MARCELINOPACEK
2,422,390,784 *FFF215E3456EE8CD062A9EEBE7DF3DF1B2FBFCCD MARCEL MARCEAU
2,422,390,785 *FFFA2226EFC33404D396D09BA6C640CEB898FBA6 @#ULNA
2,422,390,786 *FFF2C213A42F2D17334091EEB5AFEB1FFB1AEA42 ULTTUURI5
2,422,390,787 *FFF85C4021CA9A579745F47230F3F82CEFE784F5 ULULTROPXE
2,422,390,788 *FFF7A81613F3226FB4D781CBC3A16D665C39E017 MARLIJNEN!
2,422,390,789 *FFF3D5A5A5CE24B9BDDF9FDB42AC2729D1ED0F58 UNSTITCHEDING
2,422,390,790 *FFF71FA01F9E0688EF806734B42E29684994C9F6 VACUUM0
2,422,390,791 *FFFBD466A7CD9E545CE00FC6AA5CDED0CF590AEC mauriciokleinsasser
2,422,390,792 *FFF7D05809F592E62ABB380292A23DE1E26CBA82 MAURICIOLEHOUX
2,422,390,793 *FFF7EC3D95D16CE374B44A2BEDD53C73C0C0DDDB VALASKU5
2,422,390,794 *FFF572A98A1EE8A21274A7787E8B6C071EFADF8C VANISAH-LAMBERT
2,422,390,795 *FFF2CC57FA7E46E1AF5A1EBE8C9B73276BD42468 VĀYUBHYĀM
2,422,390,796 *FFFB62EEF3AD2FAE27787EA1FB7F9C8FF28CAD6E MAXIMO.GRAYER
2,422,390,797 *FFF7C3395C7429446F1557766684D053BDF77A44 MAXWELLMITTER
2,422,390,798 *FFF9EEAF714FFD4DDEEE3628563169A8AA15224F MCKINLEYBAKES
2,422,390,799 *FFF2709415C5B9695375010E1F7AB0398787215A mcr05pace
2,422,390,800 *FFF36D10B8C72E9857F162C3C0605B497066967C VERLIEGATCHALIAN
2,422,390,801 *FFF6667BBA963321F25035E13BD66562F12420CC merletopolski
2,422,390,802 *FFFAD03B656501A3CCA4797BB07039F5E7CFC24A vf`w
2,422,390,803 *FFF9AB21D660861DCE54AF8294F5EC5B6F2365F6 MICHELE SCHIAVO
2,422,390,804 *FFFCC0224F355A29D6A91641AEF50A632D23EBDE MICHELLSHANTI
2,422,390,805 *FFF8E9D347DEE8859C8878E37A37CDB35686FE5D MIKE.SEIM
2,422,390,806 *FFFC4A2464B620987C29EED60C291DF430078953 MILAN.NADING
2,422,390,807 *FFFE5C63BC2D2937FB0B4DC161885539D80F1982 MILFORDKINAS
2,422,390,808 *FFF1358C233D98220F99733FD2F7607E02AD20E6 miltaehaen
2,422,390,809 *FFF880C95AAD730624B4A21013C22BB6F5EC90A3 MISSPERFECT12392
2,422,390,810 *FFF3637D07447662F95760B3A486EF8F3C4DD0B1 VOM DONAUSTRANDE (POLKA SCHNELL), OP. 356
2,422,390,811 *FFF0CEF4DA5A5EA70CA1B2237CBDD5D9586C6A40 v?rd
2,422,390,812 *FFFED3C73466C45149478E713806A45D69A5ECF0 wallacebently
2,422,390,813 *FFFC89B0B6FFB5545069DEFDFDAFCAF40D4E8C4C MONIKA SURI
2,422,390,814 *FFFDA3BC55EBE9FE18854B5F047C0BFC6492990D montane
2,422,390,815 *FFF23929DBD72BC081C1FDBC987CEEA53B34365E morrispolzer
2,422,390,816 *FFFF9EA34235D71FCA72B38526164D8FFA2650BB [email protected]
2,422,390,817 *FFFC3048979F998E6318688B8412DA1B04F1AEA1 waylonvanbenthuyse
2,422,390,818 *FFF00E1DDD2D229DB53A677C1D358ACE2469E080 WDPLDRS4
2,422,390,819 *FFF3B883D1C7922B6C836042129CEB2135A86E17 MUDHAFFARI53
2,422,390,820 *FFF4CBABE592297EBEEA933FA10DACEC34599743 MUĽADKA
2,422,390,821 *FFF6D00D9430D1F957EE874426FAD77F10A46D7F werneropstein
2,422,390,822 *FFF04B221C0C9499C516B09AB50C20E662F0B824 WESTFORD-CHURCH
2,422,390,823 *FFF4432DFDC8878CB628E98A415758C35E8A7A1C MVNDER
2,422,390,824 *FFFC158DFDA75F55A23BF5CF178BC446293332F7 MYDONALD05
2,422,390,825 *FFF802EB93D9918EF1CA3AE5CFE0D0ABEDED30EA WIFTIEST6
2,422,390,826 *FFF8951B3B7FE0B064DC59D088082100E95A9B2A WILLIAMS.DUMBLETON
2,422,390,827 *FFFC835DC133F5A56E9D0B20A16FCD501E6310CF WILL.SABASTIAN
2,422,390,828 *FFFF1F2B70E58D8C038457D61655ED495ED8CA93 WINNER1486
2,422,390,829 *FFFF26FFD89A6854E7469CC996B0E09790D64906 NETHCIREBDAARD
2,422,390,830 *FFF950F79D07F8B539C441949E3556CDD059A362 WORLDTOURISTDESTINATION.COMWORLDTOURISTDESTINATION
2,422,390,831 *FFF2B17224CE4BA4AF0CAE4CF9A8F8DBD4B1B831 newwhitney
2,422,390,832 *FFF0E7E93C29E0A68BE65A5449665C4FAA3F63B9 nickanastasio
2,422,390,833 *FFF52000E1E2B3CC4B3702C173B3DE1C22725FEF NIINYALLI
2,422,390,834 *FFFDDFA59950D9A095E367711572E238C1814E87 NILANTHAS
2,422,390,835 *FFF5D07C31002D2F82175DC4862E1EC6B865535D NOE.CLIZBE
2,422,390,836 *FFF34B3095A568FB74ECD4A2362CE4B8E49A7C56 [email protected]
2,422,390,837 *FFF0DA9A8A5EFAF2BE0A8F691AD91D8E38375F5C [email protected]
2,422,390,838 *FFF6D8361715AB57E67D6037A595635801EC9630 [email protected]
2,422,390,839 *FFF865D599289BA1E79F650FBEF8CEE28A2593EF XUEUTREV4
2,422,390,840 *FFF648D3D0A382B61654E562E5326CE4662ACE86 XXXX年~賞受賞。新潮社版の帯
2,422,390,841 *FFFD87C50CA8D99A75232F42B13F4A19938C7B0D NO NO NO (FEAT. L'IL T & MUKUPA)
2,422,390,842 *FFFA90602C7877E395351081FF692A0722A7741D YAMUMBILANGAS
2,422,390,843 *FFF13744EF6C0E1207CE42FE2B67B3DFA61CC255 NO SCARS
2,422,390,844 *FFFF5F83EDE4B65F4CFDF85B55FC23EADED30060 „NÖT”
2,422,390,845 *FFF77DB1534C492D4ABFEAE35A573DB7F559EDAE not-stand-on-ceremony
2,422,390,846 *FFF85E725686400A7494D6D2AA9662FC7D37B7E2 [email protected]
2,422,390,847 *FFF5233DC6AD56659532502BBC1DAC6DC03BE3AA NROOTREV9
2,422,390,848 *FFF5E13C3B7732F8F199D1F547DF577D04133D1E [email protected]
2,422,390,849 *FFF0EBF1A91476680757100108FB799BC56E618E OACTAA
2,422,390,850 *FFF56BEE4191C15733B91C4D49C63748834355C9 OÄNDLIGHETSSERIE
2,422,390,851 *FFF2AD584A0B7FC5DFECC65C90C64BF8DCC27324 oc=q
2,422,390,852 *FFFCE0A11CA7C6E0107E639B5606783DA9CC268A odlezao-1
2,422,390,853 *FFF4B6D4B51AC5F3BA0C8C99ABED7F6EEC53D742 YUJ/
2,422,390,854 *FFF36F7463B5C2FB5E86139F8370CACFE7C44889 zacherynovida
2,422,390,855 *FFFB77151FC9D8CB1595EC3A6868CC2623AF9194 zack.nirode
2,422,390,856 *FFFDA2C37B4E81734B1438B81E03C1EA22126306 OMARHOLZWART
2,422,390,857 *FFF94A0B136E060619D191CEB6AB3F7CF4EEA780 ZAINI.HARUN
2,422,390,858 *FFF48B0F856C179ECFEB93E2B68D6F2C7DB5D967 ZAIRIAMRI
2,422,390,859 *FFF260B5B06971552810B206256873B3DB92C9E3 ZANCANER
2,422,390,860 *FFFC8FE8A4D4B1BB4948EC5EE31F70CFD2A435DA )O(-~-`<####P
2,422,390,861 *FFFAC515B4A71720903EB7B27208A111E5D2487A ornes0
2,422,390,862 *FFFFDAF222D5898273EFDD62714AD307A7A97F61 ORVILLE.BYLER
2,422,390,863 *FFF0A56695974A001D989182A1D8AF69C912FC3E OSCAR.DENSFORD
2,422,390,864 *FFF405CB490FA7B3594AA6FED821D9D28A1BF407 ZHOULANDAI
2,422,390,865 *FFFADA12C2B5E867270B9B1A3CDCE64FF6E919D7 [email protected]
2,422,390,866 *FFF898F7B1777174EBDCD58A493372AA751E1A45 OV3RSA1TN9
2,422,390,867 *FFFEC21EA16DBC21BB704142225DF5ED2FAD5850 [email protected]
2,422,390,868 *FFFDE7C06FF37D06C389E2929953BCD69EF0C7B4 P####>.*.*.*.~0~O)0(
2,422,390,869 *FFF30C60089F96AEDD082B32F4E18E19DE94374F ZWÖLFGLEISEN
2,422,390,870 *FFF4A327BD24C91E9302957F01C10CCFCCD7941A [email protected]
2,422,390,871 *FFF45D539D444810EF1EB07A72A3E1EF18530970 ZZ~3
2,422,390,872 *FFF0CECC65E36CE0E727A13161F6BD0C5AEEE10F p4ne1.poi
2,422,390,873 *FFFFDFD0FC328D85DB6E23227C9CE1E3B4AB2288 pa18l18
2,422,390,874 *FFF739A2FECAFD3BAEC8FB856E6F905085B7E9EF &p[aaa
2,422,390,875 *FFFC76DAC07A3A55F6C23D4A6E6DC790F2C07716 πολιτικοὶ
2,422,390,876 *FFFA32A6516D76AC33DD03E38308AD9CA2599665 [email protected]
2,422,390,877 *FFF9DCB138F9ABD203CCECDB0C5FE4E1AE3EE3AD барантини
2,422,390,878 *FFF7F4EA3398EDB383EB892A1E2EF73DEBA26214 p===D~~~UU
2,422,390,879 *FFFAC5F841B7C55F5452B309581DCE55A932ED71 СИАН
2,422,390,880 *FFFA9DDF6D1F22B085F7079190FACB908524937E perryspino
2,422,390,881 *FFF185D6BB82D9F2CFECCA929DA6EC48DB82E536 ШАРШИН
2,422,390,882 *FFF337CE610434837242456695EA7DBE52A1A796 PINAPAYAK
2,422,390,883 *FFFF1DAF2E41DB1C46F20225C2EE3368EB103B8D postnatale?
2,422,390,884 *FFFAE42226E016AE06ED37AA10625B4181CD8B1A PP21-27
2,422,390,885 *FFF6958511B4435FBDB94F413FE558ACF800C0BD PREROGA+!VE5
2,422,390,886 *FFFCA97A20F2BC1FE60082CCE790DCAF6112FE0E PUVALAI2
2,422,390,887 *FFF0DB50BA019B89B57FDFE3B14F46F75E7E4FC1 詞條,從左邊連結至esperanto,發現在底端各種語言的星期說法中,中文的
2,422,390,888 *FFF86A1E3E6FC82E2D28E1BBDCCB08DF0CC02660 Q13838465
2,422,390,889 *FFFB3F375725232CF2F4375BE4AD55C5948A2DC8 QATAR.AIRWAYS.CARGO
2,422,390,890 *FFF8EB022DC90296DE4BDE049EA3EDF90906C953 q--B`~`~(>-<)
2,422,390,891 *FFFD942ADB9015CAE1225A3FCCBBF3F568347571 quincycravenho
2,422,390,892 *FFF77BE420B33DD742B7962F946C0BD662E748C3 QUINNBRADER
2,422,390,893 *FFF815E57C20F3532B064EB0C95BE78A9671DFDB q$xy
2,422,390,894 *FFF49E827FF84A492819851C11D135B225834373 randalmorey
2,422,390,895 *FFFAF7D3617A45319115A5E34AADCA27AEF9A05E RANDELLSHOFFSTALL
2,422,390,896 *FFFFDA74CD48B2AC92D46A9F7BC1A8BF805CF4E8 RANYA.ALY
2,422,390,897 *FFFB1F0A7FA4B3C4FFB93EAB42988176E0C7C506 RAYBURCK
2,422,390,898 *FFF0850E9A93C62B8EE8336A804401D8F8EFD1EB RAZBOJE5
2,422,390,899 *FFF75BFAD21A354FB6C11F5849E3F35BA0B2697E [email protected]
2,422,390,900 *FFF02C4A4C30663873CE7C5124EB1FC1C56A4F32 Re4lis
2,422,390,901 *FFF35BACA0753158E9F8B099D52C94FE04517BBD RECEP+0NS+S
2,422,390,902 *FFFEB2EEEF13553167A250DFD80A7F96A9067661 REFUGIOANDREGG
2,422,390,903 *FFF86457E73B5CFCDC59593B28E14E3EAFED4247 REGGIE.BENHAM
2,422,390,904 *FFF7DBEC3CF48BA9BB08D0240BD591A32588DBC9 REGREUBSSEIPS
2,422,390,905 *FFF86873941120CEF3007E88908DC6BD63E77636 REGU1ARZE$
2,422,390,906 *FFF74548FED552293E7290460F4C7E2D975B4A23 REKOSKI3
2,422,390,907 *FFFCF3A0C5573970363E84938B61B1A8FEC7DA9B (>_0) * * *(#P
2,422,390,908 *FFFAA32A5DA8518328EB20011A94B51346299144 101355n
2,422,390,909 *FFF160E0B48E7ADCD1B85953CAB7F5383B1B3A98 123PUTOT!
2,422,390,910 *FFFD9A31FFB5E4EADFBC269DA911E8C71D68E013 12641 die charit
2,422,390,911 *FFF1AAABE673088E31E9BDB4A0804D152D47BED7 RETO4ST
2,422,390,912 *FFF1787433DA3F94C5D7291B1F2E0F1902F42176 1390052 IM.MOMENT.STEHT.ER.WEGEN.BELEIDIGUNG.VOR.GERICHT..
2,422,390,913 *FFF9AFBDF6B9957B171C7A0875CD76FBEC792EB7 RICARDO.HEDDING
2,422,390,914 *FFFA2BBAACED04D2265F2FAA8ACBD6A8FFAE127F rickiecason
2,422,390,915 *FFFA65DC0B127CF9C2E7C5CAA4A2F9286D62E30A RITMICHE0
2,422,390,916 *FFF165D6FBEFB95D49FA1591142E334DCF5B45E4 robinsettle
2,422,390,917 *FFFA860B5A245E2E11D58BB0DA88CD2A466796E5 RODELBENEDICTO
2,422,390,918 *FFF35E0863B32ECBDA91F47919315FC384A31741 19-leisure-time
2,422,390,919 *FFF012208B91DE9361C8937104809F1C8CC9E0F7 1-add'ne
2,422,390,920 *FFF2686CCFDEACA5A68F113D520E8C8EFDE10E12 1aggro-kuenstler
2,422,390,921 *FFFAC0FE8884C69F8F4A02680E6761A904696A81 1 ambalajlanimi
2,422,390,922 *FFFD04AAE9F0815CBD683CF8276FFA89C559876A ROGERDON4
2,422,390,923 *FFF9F4FA67905E15DD5EC9E4948E22FEDAD2149A 1armugum12
2,422,390,924 *FFFB22E87733BCC35D2F8F42527BF49FE324FB7C ROMEOHOTT
2,422,390,925 *FFF0406EF577DA1B1DF2E42007E17575F81EE0B8 1chapron123
2,422,390,926 *FFF192CC2EDEE05F5BB6AB9B5F643BC57D064942 1 FEDERSYSTEM
2,422,390,927 *FFFBECA20CC5157CF060FB4D23F107152173BDFF rosszul.5
2,422,390,928 *FFF78F1045126F2A85E661A4064363DC5329CD6C 1ILUVHONDA6
2,422,390,929 *FFF115FC908BBF3B75CB96967FBF0C6FBCD3A91B rudolfnitschke
2,422,390,930 *FFF926278EA4484482100A1AF56B0A50628668E6 1KUERZENS
2,422,390,931 *FFF3CD2EEBD3532557631E389C2194BA9F88D7D5 1 linjaautovuoro
2,422,390,932 *FFF42D28506724AFE1BD63012C358F3B46835FA0 1n73rp3rson41
2,422,390,933 *FFF52E277BAD41276F91581DD662AA751FFA5256 RUITENVROUW4
2,422,390,934 *FFF610E8C9F37AF7D942581B4EA1026E13115487 1POSTIRYHM
2,422,390,935 *FFF077CC730967970875E2B6C325782756E331B0 1 QUERVERMITTLUNG
2,422,390,936 *FFFB7327109082D103E2FFE3A6652BA9004DF72B 1rathausesii
2,422,390,937 *FFF0297A10D397A02BD71DFF70A06CAAD09E9BD6 1.RTW-I
2,422,390,938 *FFFE107CFAA45902EE0295F3CFD0CFB654A8BE79 RYANHAYHOE
2,422,390,939 *FFF256A982700873E32C6B3B836B971A53AAAAB5 1.talousj
2,422,390,940 *FFF322CF14F2942B0176328A1321D45D2A059B71 1thepolo6
2,422,390,941 *FFFC0BA57F67844DEA5FFCF5B958FEE1014F85BC 1-weststadt-halle
2,422,390,942 *FFF61AF69CD20648AE22D2D96341006A605E71D9 SAFTIGERSED
2,422,390,943 *FFFEF189F39D263F1ADB53E0BD6E324121AD840F 20、a大调协奏回旋曲(k
2,422,390,944 *FFF8CF1B7314A4BDEB351B566BC18485DDE278EF 2213978 SOPIMUKSESSAM
2,422,390,945 *FFF73434D5B4D21993B3BA42EFC2D5C7A22418F4 2328646 theytraveledthe250milestolaplataseveraltimes.
2,422,390,946 *FFF19EE8CB49C5101F47DCDB9C885DAA3FF2B271 27-12-1475
2,422,390,947 *FFF7D8FFF67AD803D5374ED41D883914525B4A72 SALSEARA0
2,422,390,948 *FFFF13EEB6944572D0EF15DDF0B79DB8AD772918 sambarwell
2,422,390,949 *FFF64366FAC6AC0F40E6EDED297DC4DD958FCD58 SAMPLERGARY6
2,422,390,950 *FFF6DF6C05DA8E9CECA977EE048BFAA55870208C SAMSONTINAED
2,422,390,951 *FFFF8DF506122925C5DC25E7D31CCC76E4044C03 samualbattistini
2,422,390,952 *FFFF104AFF1B9FDDEA8931A603BCBBBD24E7675E 2-drogenhandelsringes
2,422,390,953 *FFF24A3F5201E28389D9E9CEDCB5D59402B3FDBB 2iconical
2,422,390,954 *FFFA346A08AB25CB8899EDB86CBAFD7E2FB364E4 santostedesco
2,422,390,955 *FFFFC46F7E32B98AEDB92D7D8625AD11447FFDB3 SAOUD.ZAINAL
2,422,390,956 *FFFDFE5A4E8AA7B5504AFCCDCF8DA3EE22CB714C SAPUPÉ
2,422,390,957 *FFF6DBE2DA29D75FB2D44CD32F591F045CE5CC77 2-RISTINMERKILL
2,422,390,958 *FFFBEFDB14828691E4C271E5DD5841766441B70A 2 SAIRAANHOITOVASTAANOTTOA
2,422,390,959 *FFF7BA1968F51840AB8113E57722B9DFB4DC91A2 2-waldholtz
2,422,390,960 *FFFFC8EB93F45ED1FD4043C1B10DCDBDE6D745E8 30JULY1475
2,422,390,961 *FFFE099E08BCE146D26ED3F580D940A501BA6506 SATURDAYNIGHTLIVEASHTONKUTCHER
2,422,390,962 *FFFE6B616167813660AF7F7A4A9CB4E3E4321C65 scaries2
2,422,390,963 *FFF14F9309C7A425E7CEB619D1851F25D31AE2E9 3EHRETTUC
2,422,390,964 *FFFC0174F3C89F1ED82110C213BEF2D4D19D8228 SCOTTHOROWITZ
2,422,390,965 *FFF7CE21A6DF7DE9AFAF8E297AF2C575AA5802B5 Section:100
2,422,390,966 *FFF3972F0154C96935DB4ED34EFC44A4C27894DB 405kenna
2,422,390,967 *FFF8062B1F5F978650A608740094EC1E5A5C95E6 4BARTONGO
2,422,390,968 *FFF98CD19CE68AB65889B165B73A229682652C29 4CHEIRU5
2,422,390,969 *FFF6493B45BBABEC075DBF32637C741A41A83757 4GIRBNIAR
2,422,390,970 *FFFB74EC8F4E45F67C8621A5A1DE5CB86BA0DFFE 4LPNEWSMESSAGE
2,422,390,971 *FFF2DC38675605F73EF306068FC1D0D7EA25C796 4MATTEDNESSES
2,422,390,972 *FFF47B2E724EA9BFE208B231867780641D9AA6E9 SFREGIATORI
2,422,390,973 *FFF8D6D445164D68FF027D060A39C2108F1B7C5D 4PANCERVICAL
2,422,390,974 *FFF0CE621A68180B3C7222CEC156712276352CE8 4PETUNIADOROTHY
2,422,390,975 *FFFFEB4FAE93ADDDAA558B8976AE23396E28DA12 4SP3RSOR
2,422,390,976 *FFF3CF1089E143099A995019A8C315CD08D34DC6 4SPECIALFICTION
2,422,390,977 *FFFB54B6373D90D4F2B1EF6182BF1613DEA862AB 4SUFFICIENTY
2,422,390,978 *FFF3AFEF214C1EB347444EE00F2561D9E245236B 4VANETNKNINGER
2,422,390,979 *FFFE45F3F1BB2D605A41349C7E0DC801AE299339 522671 TAVOITTEENAOLIMUODOSTAAKEVYTKUNTAYHTYM
2,422,390,980 *FFF704C9774EE9E0926463F7431B60CE02E8139D 5BMONTAZZOLI
2,422,390,981 *FFF3A66C8258653079DAE4183F58443749D5AE13 shoescowboy
2,422,390,982 *FFFFDA8D51F9B6303F429793E824D4D354624959 SHREYSHKAR
2,422,390,983 *FFF0876680E65BFFC335F5677637EB380F47678B 5EASIBSW
2,422,390,984 *FFFA0D2313E7ED77DA009E4E8D54B63B38EE50F2 SILASGROBE
2,422,390,985 *FFF027DBD0FF395279FC111BF0B616E3E714011D 5GRAZELANDERBSW
2,422,390,986 *FFF3DC28AB96FA1A108B18DF2D1025DC85C13E12 (『SILKY』3月号)
2,422,390,987 *FFFBDC7DA56CC60B0CC662250400CBF4A8BF29F0 SINGAPORESPORT
2,422,390,988 *FFF24EFADE2353B5AF839DC7630CDF593D95D542 5KAERBYADBSW
2,422,390,989 *FFFA472175D75B73F32339A7B63B14C55A4FF549 5KEEFSKEEFS
2,422,390,990 *FFF7FB7033517912834757BC12B4B7BCF92E4D8A SIN REDIRECCIONESTORRES PENJAMO
2,422,390,991 *FFF90A2F8BC6E32E0C4FA5DFD38673181ACC60DB 5: LAST IF (DEFINED($CURRARG));
2,422,390,992 *FFFFC6F202211916341CD8DD28164DFF21AFF741 5SILVERRASTA
2,422,390,993 *FFF26F2650F9F9C0E4F96D1B273A78561E3D8519 5TENNISREEFER
2,422,390,994 *FFFDEEEB16BD0F69C147FFEB4C4A050F246CF598 5thestart6
2,422,390,995 *FFFC87519A17D3EEBEEC18F9FD20E4E9CAD15B0E SMH+
2,422,390,996 *FFF8AACE5630564181B1B0DF61102753A3052C45 snapplebruce
2,422,390,997 *FFF92DEB5530FE174E04BB4BD5B979EAAB7A35AD SNOWCAITLIN3
2,422,390,998 *FFF3414A7DEBF6B41890CCFDD8F53E15350910EE 686259 NACH AUFFASSUNG DES XII
2,422,390,999 *FFFF9B6FB0275AB596BC4D90E8C280082CE8A6E4 6AFTERCHIVYCOURTCULTIVATECURRY
2,422,391,000 *FFF82C6A5CE275D5F37192A66DA3BF0C0CEC2804 6ALUMINIZATIONSES
2,422,391,001 *FFFE18B633BD1D023B039A38091377651EEA282C 6borneol
2,422,391,002 *FFF67C15A5472A938284E6A3B26B60D39846A6DA sonnygoeppinger
2,422,391,003 *FFF548E2C07FD4FCA7558419CEF1F19E1534A751 SOUSTREDUJE0
2,422,391,004 *FFF469B17432621E985CB9B3220883410A64E96A SOUVERAINS123
2,422,391,005 *FFFC7FC1C454039D520511EE8EE20D6D32FED8E4 SPCACEBSW
2,422,391,006 *FFF99CA28BC6C5B1FCA822EDC54A3E0D7A055608 6FRUSTRATETHBSW
2,422,391,007 *FFF3E85C65DDB46345566A6D7339A4241DA93442 SPIDERB1234
2,422,391,008 *FFF884367572261FB26DD624E07A4C94A0659DA5 6GRALEMENTS
2,422,391,009 *FFF4A190DD0522DCDEB66BDB255AEC43B50782C8 s&pj
2,422,391,010 *FFFD5D98D8A752895C479784ACCD02A4ACE764E9 6ILOVEPACKERS0
2,422,391,011 *FFFC404BBB7A391AEF7A44AD2CCA83CA19DBDAF0 6METLAUQE
2,422,391,012 *FFF311992F4D4EBC8A6AEA7C96D2B027EC473229 SPROSICING
2,422,391,013 *FFF7664670B976739D745D5746E23CBE1E5E147B 6WOLFBMOC
2,422,391,014 *FFF74359CCD68C0E509A692329A315BA7EEEAADB 6YAWSHRUB
2,422,391,015 *FFF0F36C539B1A9A726C99EA9D48CDE0038CC8BD STARFISHWAITRESS
2,422,391,016 *FFFA28075CA996519AA29C00A1E62E3D3A763E0C steven-jackey
2,422,391,017 *FFFD102261481E399A60C1B717DA1639BF58103C STEVE.PAPP
2,422,391,018 *FFF088F934CB6535F493C9C0C9A5726B1D9C4D29 stevesmashing
2,422,391,019 *FFFB8941F15F67CF40D181BF546C1DF711E3FEEF STEVIEDADD
2,422,391,020 *FFF3250F21960AB833EB1CAC191FC000E20442F6 STIMULUSRECESSIONFISCALMONETARYLIQUIDITYTAXESOPINIONSCOLUMNISTSNOURIELROUBINI
2,422,391,021 *FFF162C5A73CE193F1E43336B839D622133BEDF7 storostas-vyd
2,422,391,022 *FFF18D84AF0A33F75D4881A9DF6C675DF3DE98F6 7LACINONACNON
2,422,391,023 *FFFB01EEAF54550E095B472F778A96E8B4069A07 7LOVERCELINE
2,422,391,024 *FFF218927A7C7A3FCF616A7C0C2D0D1CCC0D3F21 SUBLIMATIONSTROCKNUNG
2,422,391,025 *FFFE70E2513C05A2D280E8DA71151E5496940E60 7MUSTIKKASOPPAA
2,422,391,026 *FFF454835D2D7543B8FCED0A3EF198C3FC55F7BF s/uo
2,422,391,027 *FFF0BEC3AD0C41C1A04884D00FEEC457C59B72DB superhard
2,422,391,028 *FFFFE3F3806628D9962D628810E23609F9AF5BC9 SWCZBJV3
2,422,391,029 *FFF70B0CA88347EE9FA2872612367D3FD15775FB 8AEHSYLVIE
2,422,391,030 *FFFFB6F3F1CE7238650802EC7E9D2713DDF0D338 8AFFRDIG
2,422,391,031 *FFF5980C8D75A03F484047610BC7472F412E5307 8AMRAAM
2,422,391,032 *FFFB1F2295E615990BE19EFC2118E4467C71E9B8 T132371
2,422,391,033 *FFF9202407653F410CFB250DAD6659F1AD69B064 8BSWNYEITABSW
2,422,391,034 *FFFBD690E4F0404A637AF100916644AFED7C9756 TADSOHM
2,422,391,035 *FFF6BFC67C21163718B284EDDB33903966A39386 taketheworld(alternativemix)
2,422,391,036 *FFF2AD2ECF2FEA66FDA264A2EF2972D0EE7FE98E 8FIREBIRDMODEM
2,422,391,037 *FFF3D0409094EFAB85167C8C8DE9BAB19CA5023B TALKMALECITE-PASSAMA
2,422,391,038 *FFF434A7D35AD0E5DD39A73F5FF67BC4E562439E TALKMMOYES
2,422,391,039 *FFFDF6C3DE3F1181777433C7682632F26D52C906 8KNOTYKNO
2,422,391,040 *FFF6BF1729D7A2B73AEEE466232748D254B68A0E 8MAJORDOMMARC
2,422,391,041 *FFF68261DBF90EDA56BB8F803866806D45A37755 TANAINAAHTNA1
2,422,391,042 *FFF05973C89F062F00CB4483ACA362B18B09A698 8==P~0~o.)O(
2,422,391,043 *FFF9A0589686D45186433A9106C209F7022594C8 [email protected]
2,422,391,044 *FFFB4319BBB3FAC4F434C899436DB60CFCFE0517 8SHTGNTKPNDYDF
2,422,391,045 *FFF717D8416B778A414476D69614FD97724AFBEA 8SOPRAVVIVERESTE
2,422,391,046 *FFF03C8B5516056A5AC26177680D395B663DA1D2 8STERDATTERS
2,422,391,047 *FFF03745BA0039ED101F19FA66207E795283F6E3 8STILNYSSE
2,422,391,048 *FFFDC7DB6322A7994B53DF02612D3DD467D00061 tarotcanadatripodcom
2,422,391,049 *FFF83423982DA8DDFECD600172F91E200D5A1AD4 8UNENTHUSED
2,422,391,050 *FFFF0FDDBE390D780CB8ABD372EBEA0993FA0587 TECHPLANS
2,422,391,051 *FFF106FAB3875B66E79BE1B1837CDE76EF8EF50F 974674 agib.see:shearingc.
2,422,391,052 *FFF88ADE080C110B477E30E5AC0A5719B7ABA673 997055 FIYATARTISLARI163
2,422,391,053 *FFF3B944EE2D09AC2DD7C4C981D3C72D1649A178 9AATERSKA
2,422,391,054 *FFFFF1D17D46C639C210020EDCE57DE069CA6E93 TESTWAHRSCHEINLICHKEIT
2,422,391,055 *FFF8921391F07B6494A1B165E77DF90567785565 tf(v
2,422,391,056 *FFF15F737908F36C0B5BE8F12EFA048271A81094 TH2ADR80Z5EN
2,422,391,057 *FFF3C0237E86D22CD4E84C5956A93F356A937274 THASDONEITAGIAN
2,422,391,058 *FFFEB1DE13C8C636B62D2FEE1EF7530C24909952 9GOOFYVOODOO
2,422,391,059 *FFF43C1BDB81FD8C423A3040AB6647AF2BCBCCA2 theatrcal5
2,422,391,060 *FFF83B085F539246194D0EA656F6DA92116829EF There-is-A-Balm-in-Gilead
2,422,391,061 *FFF1355F9F4642B1B30A6C4927EDE4DB1DAE1A13 THERON.CURLEE
2,422,391,062 *FFFB9569C3537D3FB90F937B89E241E248CB7EEE the-streams-of-red
2,422,391,063 *FFF9B74178037FC2E3C64804D0115C37A9FCE69A THROWTWE
2,422,391,064 *FFF3AAE7065E8E2B0D0BA24C1092AA5102E80779 a1;"4
2,422,391,065 *FFFB1D4A503B7CBFA864E36980548048B9AAD018 a2dp(
2,422,391,066 *FFF7FAB7F9ACC642440FF8EC59CADCE88513ADB2 [email protected]
2,422,391,067 *FFF9C32F281223F7E47C2A9075958739BFBBA33C A9L7ES
2,422,391,068 *FFF2F6C3311576A97A26CA43966F52019C1A2BF0 aab)yy
2,422,391,069 *FFFB00B6D8441FA64D4A73847E85361CA5294D69 TODAYMOUSE8
2,422,391,070 *FFFEB4D220778BB73528F68F170D4F79B967A820 aae7da
2,422,391,071 *FFF6136084D83F3CAFB9EE58A57B51DA31758812 tpc3
2,422,391,072 *FFF811F7B1441BCB308AE9816E67C7A919B67C7B ab))h
2,422,391,073 *FFFE9F9DC79CA86418F0A80BFE207B698A3E7ECC ABMPT
2,422,391,074 *FFF5FF0E31834D54D451ADD117384B528264D97B AC|%
2,422,391,075 *FFF8A1B75A9DA669DC136D995F7E187DA05B23D8 actionacluorgsitev
2,422,391,076 *FFFAD3203B12423BC9D2544728704B5052C4FBD0 TRISTA CORONADO KOONTZ
2,422,391,077 *FFFD57E39035B818C541E84DCFB7C11C71AB8BEE tristanbiewald
2,422,391,078 *FFF3A2C84BE92ECF8F558F7431C12E0ED8689713 trompes?
2,422,391,079 *FFF4AFDBE170911C05A3BE2DA12FBEE0924A0116 TSUMETAIKAGEROU
2,422,391,080 *FFF3D53759FA116B1C57E73C036E72C4CEB33064 TUI.UMURUA
2,422,391,081 *FFF914328AF9C362F5AB2214B3635EAF893C5E57 adventstijd.
2,422,391,082 *FFF005D669E3EF3F9B073FDF8945270C24B2D59F aeys"
2,422,391,083 *FFF38ECDEF9087305FB64394C0AD483B171B1AB0 tyrelldobkins
2,422,391,084 *FFF5839C8FDF1E35509C6FCE4E33F35CBFB94EBA afb"$
2,422,391,085 *FFFA74A9543B1CD22D29E91539CBC7D6A4DEAD1E airailfluggep
2,422,391,086 *FFF6220CA99713D088023059CF99A452F37AE3FC ait6i
2,422,391,087 *FFF9269A0E958041CB34C08463AF3BF9F3F17215 @U+OP5!ED
2,422,391,088 *FFF7E8207537D73E7B7CE8248ED410C2A649092F UPRAVLJALCEV
2,422,391,089 *FFFEA475F12FC32BE0396DC4931D7A605586206B [email protected]
2,422,391,090 *FFFD4384189B78339E6E38E243F37D7E432D9F95 UPWESRBNYUO
2,422,391,091 *FFF8EE785D423793163224C397B9E92BC3EBECCB alfonzoboesenberg
2,422,391,092 *FFFDB96F663765E202DF930498E16CE7D5B46DEE uyagawing
2,422,391,093 *FFF0B4B42D098F583F525042DBD66FA0C36FBFAE ALIFIYA.KHAMBHATI
2,422,391,094 *FFF11E009164572FE336552F9841854CB90003F9 V$.
2,422,391,095 *FFF63B609C9C24B318544F6A03308906374AB385 valerie-schutz
2,422,391,096 *FFFDBD2D9C4F57F4591508C4F9A19A46F99A3725 ALONELIE0
2,422,391,097 *FFFEDC8E2F0DF69ACA6552E003937594FAF9613C VANESSA.TEOH.PECK.CHENG
2,422,391,098 *FFF241B16908C3FFD69CA327486DFAAA8F7A5DE4 ALTONMCCADDEN
2,422,391,099 *FFFFC1896ABA9DD77D43FF9B1A6E4EC6FE685BE3 amagerbanen
2,422,391,100 *FFF0CC9D933DD8CED927F20E90285D8D08B9606E am#"f
2,422,391,101 *FFF247FFB44F3276489C324F8828C918007FC2C8 [email protected]
2,422,391,102 *FFF493F376BBA2CCC3F50A39A1508FEDEF6D185B ANDIKUPEC
2,422,391,103 *FFF8783A3E9AE069F3FFF2F808FCB73F43B4EC38 VERBREITUNGSREIHENFOLGE
2,422,391,104 *FFF50493B44B1D5B2DB7563F07373121A1AD1E9D anlams
2,422,391,105 *FFF73D5A9748A4350F70C68A25FEA1DB65B8AD1D ANNE MARIE SAMPSON
2,422,391,106 *FFFB3B3D559B3979DC1CEBCFD7D51303384A0FA6 VEZETO-3
2,422,391,107 *FFF99D914B8187E43CB7603630790FD8BA0BE026 VICENTE.FREEDLANDER
2,422,391,108 *FFFF7CF823163C1F9B7A31D4FB9C010D727ED89B ANTONEAMICO
2,422,391,109 *FFF725FDE97FE37B3E54A78C03D43E7E514ED362 vickie-toles
2,422,391,110 *FFF661927EBF9594A9FFA751F0BB049E6C0C7CC5 vickie-voyles-mcdaniel
2,422,391,111 *FFF1F87A473AAF820EB6427AEC352E9EF9F3CB6E ANTRAIN 1 0
2,422,391,112 *FFFE72CE9E3B340216F9C97490ED1D5C4D04FEC4 anzakten9
2,422,391,113 *FFFDAA61372D2BDA6614C4392BFD8F9F94219FCB AO=0-
2,422,391,114 *FFFABB0F6AACE9AB29DB2F319096AE9BE808105D APANAJ
2,422,391,115 *FFF9C5BEC45386FC9E77A06CBE96CFBCBC8BEAFF arahasi3
2,422,391,116 *FFFDB1BFD2FE0FD1F640716C44993EBF93A48B83 argentiangirlz93
2,422,391,117 *FFFB0010A78848D896B0394B1BFC9A36A1544277 VLAD.BROSCAREAN
2,422,391,118 *FFF5D0E7E3EADA4C17588E325426F99408D6B3DE armansberge
2,422,391,119 *FFFA7CBE0571A20196FD28E8F8F42BF985C350FB vooruitgesneld8
2,422,391,120 *FFF25AA497EC66E7472C9FC0F9AAE8FECD47D0E9 asad.ashfaq
2,422,391,121 *FFF13774E7B141216B90C54DD9DD3C89DBF0C4BE ASANNESRINEU1
2,422,391,122 *FFFFDA570B9676771EC4AFB6CB768436F5CD48D4 VYKIM
2,422,391,123 *FFF009071299F0EDCA4EE73659676FBD05BFA770 waennas4
2,422,391,124 *FFF70850BF417FA0080D3284DE6514717E1B4DAE WALLACE.VANTULL
2,422,391,125 *FFFC363D01C7BC7F0EA6B16D37CC8B1C6363D1D8 atc&6
2,422,391,126 *FFFD1493ED9B5FFC2DD537C9024763810507666E WARENLEE
2,422,391,127 *FFFC7151A8C20CB7E3A3E34B08267C1DFDCEACB4 W/CUTTHROATMIND
2,422,391,128 *FFF8E3D1E40A9D5923A8437C143C5DD2D41CF06C A=UK
2,422,391,129 *FFFCD6021400A12AD6184AFC943CA34A48D539B6 [email protected]
2,422,391,130 *FFFB3EC44AFFB4580923712B641A353A163CF9EA WEM7571
2,422,391,131 *FFFC4C0AF484D5BE22E5B5D2648EC4548622CCB5 WESTLAKE.YEAR.BOOK
2,422,391,132 *FFF908A7B0C49E88388A71A3E8A6E41C704816AF averygloodt
2,422,391,133 *FFF3EE4D7CCB03FB7DBF007532E6B7FD8F7EC29B [email protected]
2,422,391,134 *FFFE2CC9BFB2D13FF94851D96D34FADC308158E9 WIKIPEDIASHOWDIFFUS
2,422,391,135 *FFF3595DF478CD934A3CD1344C33D91FA03BA953 wilberbamber
2,422,391,136 *FFFE7AB0EE4A5A78E88566D328A2B5FEC08767D2 WILBERTGRISSO
2,422,391,137 *FFFB4E2773AA15CDD1CE63F71F00D05D22D7BD04 AXDPC
2,422,391,138 *FFFE64687E94EB08EE04AB893006CE1CF951519D wilfordsolar
2,422,391,139 *FFFD06ECB7010BA3FCB8E39FD1E3BC77CC6E3662 AZRI-SYAFIQ
2,422,391,140 *FFF860EF74928A99D482ED179024F9FAFDE70748 azucena-reyes
2,422,391,141 *FFFCC2FC6E93A5C35AA40E92E02FF83C87595335 b.%+#
2,422,391,142 *FFF08EFC45A4AE41FEDFBF28785B856F0B8A9163 WILLIAMSENTERLINE
2,422,391,143 *FFFD92F22018F89A7E43AC629FB0F2B01E3F0ED2 b)~0.splat
2,422,391,144 *FFF871986D677E21AD79318C80361832B915A36F b1ack-$co
2,422,391,145 *FFFDB3DE7EA88A57B2CB453D779E0BCDDE4254E5 B2E7BC05-80CB-3B6D-8195-AB68C361BEDD
2,422,391,146 *FFF5453B0C67E6DDDB1172B1378321D996E2FD4F b2h+
2,422,391,147 *FFF15BB4540C55B5761EFDF480ACB45DC94C4DD1 WONG LIU JING
2,422,391,148 *FFFC928022544E1A15FCB82976053198D2F56C34 b7dv2
2,422,391,149 *FFFED4D303105C8E4FBC2D6C18CF37E8935B69B1 [email protected]
2,422,391,150 *FFFA04E6D22A43350F22B377303C3C153F9CD518 WS.MA
2,422,391,151 *FFFAFE86C200DDFAC8E981C32C7E91E2D913F1E2 BART.EIRLS
2,422,391,152 *FFF816A1D21667C0613AB045736CBC8153F1A2E6 batalla.del.rio.ilu
2,422,391,153 *FFF95F4FD230EF679CA474C529B382A8507CF712 BBSF6
2,422,391,154 *FFFE8F8E9AD6A469858FBD81EB57EA81516C7439 bdbfl
2,422,391,155 *FFFAB53BF119CC45D099FCE311B268870FE0B7E5 WXKI.3
2,422,391,156 *FFFC3E826044C083CDF88E0BA3CB5A4E56CF5AB9 [email protected]
2,422,391,157 *FFFA1A8E00A2D643A2788AAD4B132BA5F495ED4E BEAJOP
2,422,391,158 *FFF4D86E42BF27BEFEB588E8F89D3AD04DFAE8FA X250993
2,422,391,159 *FFF4DCEFF5073755DC196FFBDF490F304ACC7C76 [email protected]
2,422,391,160 *FFFAB39085F18DF84A7474530129AC437A0FD72F beaunap
2,422,391,161 *FFF9B352A679C33DDC1C82635BF5434129C9DCA4 BECKY-BEACH
2,422,391,162 *FFFDB42EE430126D1786A9A192664F091284368E becomesane&c.adj.;cometoone'ssenses,soberdown.
2,422,391,163 *FFFD43AF8A965AF11B62C8D1CC7636B5ACCABE52 BENNYBROXTON
2,422,391,164 *FFF6CF10FABDB00DE6C55CDB25B06A9056F1CAF6 }x{.~.~.(######p
2,422,391,165 *FFFAE6BF6CC40D0D8B0A96EFEF13275F603E46BD BESHURIK.COM
2,422,391,166 *FFFD1122587F69BF4C142B99C9C833CF0DE94159 XUFEINIAN
2,422,391,167 *FFFFF4162BD3B10B5B6E26C5F6BBE02022C55EFA YALLEBUD
2,422,391,168 *FFF45E5BBE3D88C810C08BA659F6A41F48E9F72E BHLU2
2,422,391,169 *FFF139CE0C0260038E846B754661C3AAC3F9F282 bianca-la-madrid
2,422,391,170 *FFFEEA66CB3FC6FB2D99581F34542E71F0C660A3 BICQD
2,422,391,171 *FFF7AB8243DC0B54A6B03BC4378EDE9B4B8AA8E2 birdcenternet
2,422,391,172 *FFFE4F5C8CF93F3AF8E2119C8FAE7AC3B2CCDDBF B&IVJ
2,422,391,173 *FFF67B1D6F6864E41B9CF54AFF258BCEC84E2A70 ZAIB ULLAH KHAN
2,422,391,174 *FFF39071D35012BB6A96584430C963F0B8892379 BKKRSKRRN6
2,422,391,175 *FFFDDA218A507275E63A5A0448D5957F674B06FF BKOOU
2,422,391,176 *FFF3A68B42448953193957986F07D7DDCE363D5B zbsmssksg
2,422,391,177 *FFF3147632E8C72433D4F18305996A1FC82A381F [email protected]
2,422,391,178 *FFFE5B38DBCE006C8AF8056823AB159F27F38C2B blocksize3
2,422,391,179 *FFF5475593FE98AD5566898275FDFCEAE58B0203 blueeye1
2,422,391,180 *FFF2ADF1A034A1BC13B51C30F1471B32EE616C63 ZHAIDYODIP
2,422,391,181 *FFF1278D4FC71278BADDB7F6165D24E18711468A [email protected]
2,422,391,182 *FFF8C982AF8958C4A946D712F803A5984B4B6304 [email protected]
2,422,391,183 *FFFA3E469AC80FA13669AF23FF871B8B8735CE4A BMATULAC
2,422,391,184 *FFF308CF2101CA93740B649C30F837A30A177593 bmfx
2,422,391,185 *FFFFC3169562FEB7E1AC7E02FCBFCD6611BB6F04 BOBSOCKS
2,422,391,186 *FFF94C4FA5ED156CD69FA529D20F706493431CB2 bokelers0
2,422,391,187 *FFFB78CE3342668AFE3F5F30D288978F69233ACA ZINTLE-MTYI
2,422,391,188 *FFF083BA7D46818AA84D2348BFCBB9E9C24332FF b#p*.*.>-<
2,422,391,189 *FFF135A9B25F16534B9A22B1BCE09B9775522E21 BRAM TCHAIKOVSKY
2,422,391,190 *FFF2FDCFF3A5AAFEB4141DDB60466B5DACA8A2C0 ΑΡΜΟΝΙΚΟΊ
2,422,391,191 *FFF7CFED2F3A6ED82AC44E430103C80DD273E1E2 ΤΑΡΚΎΝΙΟΥ
2,422,391,192 *FFFCF47CE58650B1B0F345675BCF95CE194A06F1 [email protected]
2,422,391,193 *FFF3B1A42A35F3ED7568D49B228EE27E6F7D78C4 АЛФАВ�
2,422,391,194 *FFF7802C5B41FD84C7B40AF4C6C6162A6EF77911 БУЛАНДАА
2,422,391,195 *FFFEC14B0EB442A5D69D4D228003AF3287B5058C BRODERICKSALB
2,422,391,196 *FFF490614EA86883A34DE2CB9F8D587840BF0339 ВЕШЕШ
2,422,391,197 *FFF7A01F406A814CF1C9068BE41BFF2422D053D3 brooming
2,422,391,198 *FFF4FF80031285F8FD65C910E3BFF866DAB5859F bryan-ke
2,422,391,199 *FFFB898422E407C873DDB24B6E1E96C484624B60 bryonboys
2,422,391,200 *FFF7F3B59A4E72C083886834F74146B32B4AC739 B/S6H
2,422,391,201 *FFF3E17F0AEC8450D45B407589114BA2736DF4D4 мгупс
2,422,391,202 *FFFFB56CCA7BC13BF45A57252DEE122EB0A032C7 BUDDYROBERTS&THEHILITERS
2,422,391,203 *FFFB34DA8A96C97BE491E25D1A8B77531C8E4AC2 bvrk
2,422,391,204 *FFF3F6DBBD92D0924081FC6E8DFCF5C307F12B31 b=_&w
2,422,391,205 *FFF0F1E4790B6F8AE7E0F944FF288566822117A0 BWE(
2,422,391,206 *FFFCCD53AA264CFAD6D2AFD6B19F80C363F280E1 ШМЕРКИН
2,422,391,207 *FFFD0F37A32A3D8158747BF7159CA8365492FB5A c%6u
2,422,391,208 *FFF96F7E9616CE6C29320B823F7272E596CC9FEF 、団体名を「プロレスリングsun」から、「chick
2,422,391,209 *FFF20665E3A15936F85882D7CF9EE3837E51B19C CANTHARIDE4
2,422,391,210 *FFF699CE7BD4D7D7CEF699F35DA6C3CC2BCB9F06 carsonveliz
2,422,391,211 *FFF557A1D27313FEB890DEA9AC3CBA1A470EB4DD CASEY-HILTON
2,422,391,212 *FFF8A84AE05DD00DE9ACDD8F50A5637483624EA3 CASSANDRA CROWLEY
2,422,391,213 *FFF736C4587D207322F12FCC5AB7ECA1E58A1A47 CASTLEDENGEDERWENTCO
2,422,391,214 *FFF1DB1A62BEBAB2981A97C313B8439AF698A802 cbq.&
2,422,391,215 *FFF640235044A37C8E38D8F754F75B48606402FB Celliform
2,422,391,216 *FFF5F13AA30531F0B66ED0D6B62E2D5E8BDB3237 C/F.H
2,422,391,217 *FFF4AAE1280773203B80EF1A18B247AB2D0DD5DE (00) ~` ~`<====Q
2,422,391,218 *FFFFB57D4240A375A4A456E9010EBFC79805EA9F CHAUNCEY.GARTMAN
2,422,391,219 *FFF37946F30BAB8E7BA4F573648978BBA54E2D0B [email protected]
2,422,391,220 *FFF4AA8751C78322730FFE255F93074231F99BD9 051ADC82-79BA-3C53-AFB0-F3394B08C66C
2,422,391,221 *FFF8E377F2964667AB04099C5DEA473681FEAF47 06051355
2,422,391,222 *FFF88BBF9DD02907EE4C544C4EFDDDAB7EEFE668 CHRISBANGHAM
2,422,391,223 *FFF74DEB97CDCFF176892009CECB8E7AD2F41FD9 1044061 RESULTS WERE TO APPEAR SUNDAY .
2,422,391,224 *FFFB29A722C8A306F9DB3AADB98C051A5D9BBFCB 1051944 KORKEATAAJUISTEN.SIGNAALIEN.,.KUTEN.VIDEO.JA.ETHERNETL
2,422,391,225 *FFF36DEB70C083D68AD87E035CF924F7431D87DA [email protected]
2,422,391,226 *FFF8BEF6A7810E5A5FB740DD2FBC81E029B7FEB5 chungkorth
2,422,391,227 *FFFE86B2638FF6F10E791550897ED72F63955E3A chunjie
2,422,391,228 *FFF07E189A4C7B15B006E9AF929258D8FFC99DE0 1587685 pennellin oppikoulun kehitt
2,422,391,229 *FFF02DD35DCEB9E77D1CE7EEB37EFA9D2D1FA04B clatc
2,422,391,230 *FFF3DD7D3274D9BCB24442FD487427F393911D54 181TABITHA
2,422,391,231 *FFF9073F10313B8FC53304C8FF4EE473E54DC206 clementebonadona
2,422,391,232 *FFF3C9D213D986A339C4C096BC51307914B35387 18 TIETEEST
2,422,391,233 *FFF52ECEE7450B547C12FA7AA9F43A3DE980AADF 1993591 lapset haluttiin pit
2,422,391,234 *FFF5CACDFAC70520BDC1417113ECC2528BEDBA8D C%LWX
2,422,391,235 *FFFACF9930E3CDC997C9E7B0B3BEB5370D3BEFFA c.-!m
2,422,391,236 *FFF52A57068C6430064B33981A4D5AF9DFC92B89 CMHW2
2,422,391,237 *FFF274E88B3742D175EC3CB8C7789ABE2A3D018F 1DARKSTARS
2,422,391,238 *FFFD1EF12C297D9C1014826FDCE13DE231ABB286 1.DOLLARMUSCLE
2,422,391,239 *FFF520E7423479839A08D8C5D7CDE76B9DDC31C8 1.dress-fitting
2,422,391,240 *FFFA0D215CB0FC043E46E583702C7E0057A694DC 1 fruehjahrsdiaet
2,422,391,241 *FFF431BF151ED9EA475F81388E220DF39D7B9B25 1GNIPPOS
2,422,391,242 *FFF18105B9B8B97B4E40F8FECBCB47AE8DD2E53B 1.HOCKENHEIMSIEG
2,422,391,243 *FFFA8196038DA19EF96A307BD249D6C9589A1C85 COLINLAUIGNE
2,422,391,244 *FFF0CEADC88288E536E043B8D40265E1DAD88B8F 1-jumppaviikolla
2,422,391,245 *FFF444E95497DE2C4E819C84F17B58823C78CB35 1-KOTITEATTEREITA
2,422,391,246 *FFF10E36B9CA43EA6D40200A09919E7DF839180F 1-lirahtele
2,422,391,247 *FFF3903239D90538FC9AA8ABB67A05D52D215AA1 colours2485
2,422,391,248 *FFFE34E7C8F7A6EFEDA0A5C8CB6D326A0F9B1226 comparisons.are.odorous
2,422,391,249 *FFF39BC55CF07844437E2E3874472D4BDAAEF323 COMPUTERPWGSCGCCA
2,422,391,250 *FFF509E099D3B18C4406182E6AEE473703768B0D COMVNLL
2,422,391,251 *FFFF98E9B47EFC6FCC3E39025D5F6421CBF83ABB 1-on-air-playback-einrichtungen
2,422,391,252 *FFF09569AF8FF091D78318033043239FF4744F2B 1-palstasuunnitelmissa
2,422,391,253 *FFFEDB6ECCE0FE6F296BF0D6EC7DBE1FDEB1743D 1PEDVOLBA
2,422,391,254 *FFF370134E51D4E6D9C67DF1A720DDE8CF554B61 1-psycho-biographer
2,422,391,255 *FFF4B02096DD42DAA3064103DEE24C14ABF0FEE8 CONTISERAS
2,422,391,256 *FFF515EECED6515CB1FC6B9F564650EEAA3477C3 1.sepp
2,422,391,257 *FFFB19D8E721FBDBABA111D8E4C42E9DCCF13A3A corypytel
2,422,391,258 *FFF6880B6191E3B58B254BA6CF4CBC2A62000F50 cossen
2,422,391,259 *FFF7FF77D8560C98AC9BFBEADADD0A16CDEACCAD [email protected]
2,422,391,260 *FFF21AD120A0AEED424C69B461F0C9783A954C94 COURTNEYCHASTANT
2,422,391,261 *FFFC63B520B8EBEDF21CF17B1C21851580B9D39D 1 YAZDIRABILIYORSUNUZ
2,422,391,262 *FFF03829871613E36EC91B18834B036B3F7950B9 COYNOJIRI
2,422,391,263 *FFFBE295D0198257E132411C8C4E6710B66784C9 CPHA
2,422,391,264 *FFF24E3ECBDFF7828C0FD76E54469AD908FADA0B CQ#4H
2,422,391,265 *FFF7E211784D5E52A7C05BA90DC465F588B882C5 c(qjs
2,422,391,266 *FFF5434B59692FA2C7723C650AB64838BCD4372A 24sep1881
2,422,391,267 *FFFA5948D3F515274E47C91F7141B2BF4242344B CRISTOBAL.FANJOY
2,422,391,268 *FFF75B4A4533B11F3DBA66DEE61E736AE2A899B9 2875473 die.kunstwerke.hat.man.weggeschafft..
2,422,391,269 *FFF9A73FA10EDF084AB0FDBD0A56B92F5678B03E 2938875 "-(-BUT-)-THAT-HAS-ITS-DANGERS-
2,422,391,270 *FFFE80F8D45BF7554BF6E18003DD1CD590AD57C4 [email protected]
2,422,391,271 *FFFC909EFBF233E7DABAF86F42E337AE6D958A79 2-bundesmodellen
2,422,391,272 *FFFCFD56ED7D6A6A7A4BD2699B59CDDCE3262872 ct%
2,422,391,273 *FFF73E46132124B2F5536129608CCF490803065A cumurcu
2,422,391,274 *FFFD2916C8EA21B5D7CA2122BCE4AACB078417D0 2ex-liberal
2,422,391,275 *FFFF5EA2147E213CA84EC48271542FA10A662F80 C"UU
2,422,391,276 *FFF67B7D1C72C01571C2EC031CE21E76DCFFA79C d9)g;
2,422,391,277 *FFF723391ADDA1A3E6C384C7C1E3691C6058B1D0 [email protected]
2,422,391,278 *FFF141AF68FA706BBB3A8891D3D2CF1ECD427DCC DAMION.KLEES
2,422,391,279 *FFF023580A8C87A5E9191C2CD7AC715896EC1BD3 3NTHRFTLK
2,422,391,280 *FFFA6F0C89D684B8BA43317E6DD89F4BE4697775 dancebaeb
2,422,391,281 *FFFEC53F3CBF4CC14BD22B8F43D49023CF0C96EA darinkriete
2,422,391,282 *FFFEDE78F58E2A4897845BF24C69822524D99D6E dariuspontbriand
2,422,391,283 *FFFBC8060601B164A512FAE8B1B5BF83D4B946FC DARRENCANTERBERRY
2,422,391,284 *FFFB21419FE97AEEC00B5FFFAA7261D940F68B28 [email protected]
2,422,391,285 *FFF0F1A6C92F94A741B0B61909E4C3C15AA87A66 darronangiolillo
2,422,391,286 *FFF414AC0575775315264DC8F15E355D360BE850 DARRONMCMILLER
2,422,391,287 *FFFFF281CE82C64260B70D5264E8082443B8E074 DASSEFF
2,422,391,288 *FFF5FF7148491E0BA107802334488527738C5835 david.benigni
2,422,391,289 *FFF9695C40E1AD9F897585F3A584C912C8377E52 d"bf
2,422,391,290 *FFF227B5E892F3501BE4AB5DD314E83187A30103 4ILUVBILLY10
2,422,391,291 *FFFBBCAEBBAA4A3C0CDE725D387D686D5B2327B7 4KOOKPOTJE
2,422,391,292 *FFFF635C3D9B1FD23D53FF3E920AD15B513E6969 DEBE3
2,422,391,293 *FFF0EF2E4F707F2DCD9D99B142695DC871CD29BF DEMENICI7
2,422,391,294 *FFF3141B4E49516FBBC332D334DF5B1D866C0C85 DEPENSA
2,422,391,295 *FFF644B906E9A4C98D792A91D7D5A68F70A9AF42 desdendes2
2,422,391,296 *FFFB38FAE72911C18A1D8D102C4F1ABB69903FE1 desganos9
2,422,391,297 *FFF4DBDC9F1909F602A6E9BD444D14A6EAAC4800 dht&a
2,422,391,298 *FFF936C872BD5FCB1C409307180A209C472817D5 di5+r355
2,422,391,299 *FFFAFC540178EB93310D99A47ED77A8CD79D6DE6 diagno'''s'''e
2,422,391,300 *FFF0C913B95FEE1BC762480FE5E81F92DB337155 DICDM
2,422,391,301 *FFFFCE6DDB42FC33520F09653B6F944B0C88C2A5 DIOSTEBENDIGAELENA
2,422,391,302 *FFF56A554BA4EAB5C6F99186DBE785A54E1B0763 563561 insanca.,.tum.insanligi.kapsayacak.bir.sevgi.ister..
2,422,391,303 *FFFF123FFBAAAC9F949AE1D1212716C56307BFF4 D#$J-
2,422,391,304 *FFF57ACFB025F6D63A43700B433DA671D65B895A D(J4.
2,422,391,305 *FFFDBEAEBD7F3F9A44F188C988CAD187B3D14DDE D:JN#
2,422,391,306 *FFF64B97A8AB1908CC1B7EAEF01FBA4349898BF0 DJORDJE-RADOMIROVIC
2,422,391,307 *FFF65E8FBC521D5ACA9C344854C480EC73A12DBE 5AUGMENTANTS
2,422,391,308 *FFFE13F3265E5CF817E7538431E7A3DED4A70614 d-k
2,422,391,309 *FFF096936CD078A6AFE9BDBDC0AC03B82F980AC0 dk6o0
2,422,391,310 *FFF7053A281DEED753E819C8CA5C60FA51110A70 5HABAKKUK
2,422,391,311 *FFF3C2BF705714FB9C36A38A72EC64D5B173DE87 d&oed
2,422,391,312 *FFFEBE128B4C76ADB70D07B885EC7D0F620FDAA1 dominic.mutinda
2,422,391,313 *FFFF41A8248D09D4F6A72502AFA798DDAC3720C3 dominicreda
2,422,391,314 *FFFE78692BBCFBFD6A2A809338BB6A2BBE7DD61C 5SYMMACHY
2,422,391,315 *FFF627D639C3D0E3839EEBDD8402C4AE8B16D85A DONNWERSHEY
2,422,391,316 *FFF9651CE33815F72D17251B45214CA5833F864B douchebagdecreemensnewsdaily
2,422,391,317 *FFFBAD026935D81ABCC76026E7132BFC54C5DA7F 5TY
2,422,391,318 *FFF142AB26541E549A70567D2C908FF2E9701289 D!%P!
2,422,391,319 *FFF0410A70DA4F5B1F68AD7FB5FCD3C8D79429B1 dp9hn
2,422,391,320 *FFF0D51C4FC6295C48BAF7FD6872DE4C3A8AA1D3 dr(ds
2,422,391,321 *FFF2C6D5DEE51862C394067D51CEEE52BA55B91F 6CAMPBELLLINDSEY
2,422,391,322 *FFFDB537E54EA142C3065A02746202B022A00334 6CORBONITE
2,422,391,323 *FFF9AF3C9267CAF3B59A1DAB80307CCD29FD0EF3 6DISRESEMBLE
2,422,391,324 *FFF46F409C3B79B00C5D657C266E3FD64B8FDB03 6ESCURRIREMOS
2,422,391,325 *FFFEBBF700A663CFC2D1FD881178849069F36D1B d)s_.
2,422,391,326 *FFFF74283282AF0817C5FF1BDE66EFFC2FB58D75 [email protected]
2,422,391,327 *FFF9571C6368303FB50DC43A10215970E183C173 DTPA;
2,422,391,328 *FFFF97CEC899AAC222F86C62465839BEA01476DC dub=
2,422,391,329 *FFF5FFD5CCBA26C00E1F5DB9BB9FA4A26F6AEF1B 6NIHGUOC
2,422,391,330 *FFF5845E8172C915C4EAD19A9A693C5AB663AF1D DW;BP
2,422,391,331 *FFF11F04C61550C3C8CBD7B93427AB0E809F1C77 DYEKNULF
2,422,391,332 *FFF9E1331D963728A180D5AD8EFE894CDAFA3FF5 6UNACTED
2,422,391,333 *FFFD0BCCC31F0920A42361FBA8A1C5EC4D5AE196 e7of
2,422,391,334 *FFFE1B1FAF757B3E56397988D9E7E74F2CD31FED 71177 dervorsprungscheintallerdingszuschrumpfen.
2,422,391,335 *FFF8A7EF58827BBF4406EC6A1ABB5D52925A26CF 738TALIA
2,422,391,336 *FFFA3D4614BD77B7AB4C7BBF023F17F6B2732160 7ARREHSTR
2,422,391,337 *FFFD4623DDC5C0382F12E185D2705F5B2BB362A9 7BANKBETJENTEN
2,422,391,338 *FFF6EBB8B824C0F9CD72A4431E5E52403CF8DF18 ec4u1
2,422,391,339 *FFFC47A06AA6EBF919F2E7D3DF6973D1074B9170 edgtw
2,422,391,340 *FFF031E39954163B1280D0A5FC7281860B0A6575 7MISTYTTV
2,422,391,341 *FFFF5D59237E3085218CAF3081E4A12BD47A116D 7RIJSTKORREL
2,422,391,342 *FFFB378C0C7E6B965F35588DAA1E66E1215E454A 7SRABOLLA
2,422,391,343 *FFF0CBBF58D77AB52CB95424865F488E544309F5 7STROUSSBSW
2,422,391,344 *FFF637E05A3995B764197BDE7DB871F3E2BBBC5B 7TNARENEGED
2,422,391,345 *FFFC3D57E8CD5A18F0D24238DB062F5C2E74D3BA einzelmassiv
2,422,391,346 *FFF0176E88B59F727C875B2760DDE0550304959F 828asher
2,422,391,347 *FFF770E382D103140E94DBB2DA625B75C6289192 849henry
2,422,391,348 *FFFC5095887A5C663DE96EF03A7D0C41A2C85D49 8APACHEKINDER
2,422,391,349 *FFFE635EE0A3A882B1C6673F2CBF1EADFD5674D0 ELISEO.ARRISON
2,422,391,350 *FFF5A9C49780B61E6CAA711E6A3F87D9E4D37059 8BSWMODERATERBSW
2,422,391,351 *FFF305EEB00D7ED16AA70D270067C38750609255 8CERALLUAS
2,422,391,352 *FFF421CDADFFE77D4E538EB176DA6C409FE2B651 ELMO.BRACKINS
2,422,391,353 *FFF93847936777A03E9F5B31E56116ED7B04FD0A ELTTAESPS
2,422,391,354 *FFFCD7911C34E2C084C88A0BB5150DACF5EE5F8D 8.FUNDERBURK
2,422,391,355 *FFF4CE19C640936A8ABF7E282BE887CC7B60E121 ELVIS798
2,422,391,356 *FFF2B644AB72D4BB4C6716F809C14BF2C898EF4B emilia940
2,422,391,357 *FFF91FEE4013576B014D488F42ACC646BE85CDC2 EMMANUELEDMUND
2,422,391,358 *FFFE6D74D3D4ECA5C2C7310963BE79CC70A4725E 8MYBELIZE0
2,422,391,359 *FFF5DCB13B97D672276CF753E95FDD40FB247739 emorymccuan
2,422,391,360 *FFFD655315C6C8F4697244809BD61CE1F1DB0FB4 8OCEANOGRAPH
2,422,391,361 *FFFB5F11FA314A126C26DEF787D220124002CF9D e`nn
2,422,391,362 *FFF3B731CA712D3D2602A6013C2356D97185AB7D eox+o
2,422,391,363 *FFF3A30C287CC604D65F89DE0694D150CF1AC362 ERIN.VANOOSTEN
2,422,391,364 *FFF14CD6FDF53FFFC55E64E4AE3D60EAA078472B erv$y
2,422,391,365 *FFF77B7F4E4D318927CC85C97CD542F51D160599 essilleb1
2,422,391,366 *FFFFF1EBFD70AC864C89613C7F1A59F63B9EE5DB 91111 TOIMEEN VALITUN TULEE ENNEN TEHT
2,422,391,367 *FFFC7A68E17C4DA33FB05301E6F744610BF80309 estebanvarma
2,422,391,368 *FFF9FFEEA882EB2363BEA344E58AEC9114AC0047 ETAMBIAO
2,422,391,369 *FFFCC0369892954D957B96CB471513D0B84F4FB8 etiqueteuses1
2,422,391,370 *FFFB18CFCFABCC4E48DFB018D4F643A60059D464 EVERETT.ANTILL
2,422,391,371 *FFFFE6F1AD3FDD6496997CEEE4438A4D0A73C8FB evertueraient2
2,422,391,372 *FFFC5B4FA1599C96A0E45FB6A581412D85F9DEAD „EXALTIERT“
2,422,391,373 *FFFB4F99B111D2E12C9E81474A9A8AEA2E1E5B47 E-YAWGUD
2,422,391,374 *FFF2F2A839DEAE120B25FFAB359DDA2DFB2551F8 EYBSA
2,422,391,375 *FFF1DAF073095B3F5756B0EE12837E6880D31AC9 FABIAN.EMANUELSON
2,422,391,376 *FFF02DF4877BBAEC3A69E938DCDC4CDA93982097 FABIAN.MARTINEZ
2,422,391,377 *FFF8B2AC5B2A8B82F605653D8E44F4FE80E71630 [email protected].NET
2,422,391,378 *FFFD346CBE0D354A2383910A64D890EDDE13AE19 9ISI
2,422,391,379 *FFF7FCC0124414A7D4A64A8B6F5FA68C3311498D 9KLIAWAR
2,422,391,380 *FFFFAD19C61E98052FAF8BAA5955949A9C0288BA 9NEURSNEURS
2,422,391,381 *FFF6623BB4852F18C2E7D4250623783A75CEA0AC FAUSTOARTS
2,422,391,382 *FFFB351F03BBD51BC3AF863124234EB89FA23E90 federicoklepac
2,422,391,383 *FFF9DC5CDD865BAD705F917F9FD2AE35A17A07DC federndes1
2,422,391,384 *FFF2F3C0EB886DE85BC53D12D2F2CCC04293887D FELIPEACERO
2,422,391,385 *FFF3AF8F3575000D5FC4290C72ACA787739320B1 felixtonnessen
2,422,391,386 *FFF272840FDE375B34A91E1177265E7BB038B105 FERCHBSW0
2,422,391,387 *FFFCE83AF0131E603B483AD79150320F800BDCB5 FERMIN.SHARMA
2,422,391,388 *FFF01DDFE0C6A847C7E668407D537CDA75225F50 [email protected]
2,422,391,389 *FFFDEFB1BBA5D09A718BBA2C46C5AA15A5CDF636 FILIBERTOMASOTTI
2,422,391,390 *FFFA796D6D2425E1B966E7BFF22562923C91E9AD fillmyhole(hokandboz"suburbanspiritual"mix)
2,422,391,391 *FFF9453891F0C140D8D9068C2D73452C2BEA64A4 FMXJ
2,422,391,392 *FFF55F65F5A52FDB8D94671CF37450EE6C923BE6 A5TBY
2,422,391,393 *FFFF42C98A111559EF8F3E720618943053709FA6 A8B26BD71CE512A07306DF0093AD4FF9 32023202
2,422,391,394 *FFF8F2088CD797956C4E9C8E46E8C4994F261649 A8P$C
2,422,391,395 *FFF0C70FB7DBD2F915F5D89673348ABE516F389F FRANCISCO.KOWALSKI
2,422,391,396 *FFFDD52630B3962BDAF541316190FE294CB8EA83 frankeerzegels
2,422,391,397 *FFF72BC8D7230450CF62506731FBB0A48E61135D a+b%5
2,422,391,398 *FFF993E5FADF46855C311BA4A0C62CB61D94D0CF [email protected]
2,422,391,399 *FFF73F18E9B76C694438CD9F3BA5ECDFF882A50C G79086
2,422,391,400 *FFF52EB922174E8898CB1F45E19A06310783F7E9 galllawk0
2,422,391,401 *FFFC3C77A9B216AD88C15736E826EE3411DEC65B [email protected]
2,422,391,402 *FFF8E6F1F7A6845B44E15452F1095BCBEF6283B9 garretbadeaux
2,422,391,403 *FFFAC1F02D0182D638D451D8FDA34E8B0CF31EEE [email protected]
2,422,391,404 *FFF7EC0D420B72FF953E8BA975655040454ACD2E garrycaracci
2,422,391,405 *FFFA4400F9B3A50BFA7F5F48C610E2AA81338751 ACESSAVA1
2,422,391,406 *FFF42C76DDEDF207294561FA3202C6A512662FC0 Geldautomaat
2,422,391,407 *FFF5C960B9EE9DEC5AD08230AFC5A55AD13CE4B1 gel-und-streicher,-h-18
2,422,391,408 *FFF6024FCAC94CC429CC5E7B2C6AF839EE10C97A acyor
2,422,391,409 *FFFDC1AA9F0195091BFD06A8DEE107398EEBB6A4 genitalatrium
2,422,391,410 *FFF0297834AC0A51D0BDE45D6AB3EC81A55A9DDC GEODATOS CHONTALES
2,422,391,411 *FFF01F6325DC4D10DE1541F07670569F0BA2F68F ADAMBLOOMBERG
2,422,391,412 *FFFD2A803064069BA2B83AB360EA4F0EF3DE7D78 adolpharkontaky
2,422,391,413 *FFFBA7BD70C707B76B0A682E26AA2E57811BDC4C GEWICHTIGER8
2,422,391,414 *FFF49A765DCED38044E1B76FA52C77CDBD112457 AE7G?
2,422,391,415 *FFFC9EECCB9A517CDC7317747E602DBC56C9202D AERO1+E5
2,422,391,416 *FFF341E1B2BC712F1D20777D49C432F175569AA0 afu::
2,422,391,417 *FFFCD235935488D19691282923AD6A9E9C625A47 GOLD.8
2,422,391,418 *FFF440C81AD7D9AB68BA329B201EFA402AA02C31 »GOLDEN
2,422,391,419 *FFF818BBC5BE83DB74433E99D955400874926226 AGUSTINCODAZZI-CESAR
2,422,391,420 *FFFA975EB35DC161DC170BC98FEB118355205F41 GRANVILLEZHANEL
2,422,391,421 *FFF6097883262756D9AD114A797D76149255232D aigi3
2,422,391,422 *FFF6DCA9F5526CA998FF4C8B8971122838E2CEBA GRY4313
2,422,391,423 *FFF9756172368C017EF0FC869BDB4BFC67280FED guars.
2,422,391,424 *FFFC0CBAC8D7FD8D6DA7E74ABBBE2E57791AC960 [email protected]
2,422,391,425 *FFF837A636DBAB2A5FD81328C603E2CEDACB59E9 ALDOPINON
2,422,391,426 *FFF49CCC47A10AE53DA13BE955611CC9B392BC20 H4ND53TD1N4M0
2,422,391,427 *FFFAE1A98707034E86DFA7E61DD0D75322862810 HAATDRAGGING
2,422,391,428 *FFFC2EAD24314AE73670D2FE0548FC6A8D156262 ALLEN.LAVOLE
2,422,391,429 *FFF8F603BA4EFABE375EFF20534C8665A42CAB27 HANDELSMINISTERIU
2,422,391,430 *FFF1F56573D4A8B8608946BB9743463B6706475E handpaintedswingercomwww
2,422,391,431 *FFF38E24F77CACF516DE954FB608B061300E1E77 HANSDIMITRI
2,422,391,432 *FFF345609A42C15B4A9713851122495714190BCF HASHIMITE.
2,422,391,433 *FFF87BB6E59E4F904C035C6EAA8164F5ED6DBF35 ALUP
2,422,391,434 *FFFA86998BB74178EA0FF05A92BBCE1E25DA733B AMBROSEGROSSE
2,422,391,435 *FFF9EC15079BE257FBA3DB7A6B050D40AEB73C9F HEART-IN-TWO
2,422,391,436 *FFF0D2E12B2475D80F42AC743562E84E46030EA6 HEEDS.
2,422,391,437 *FFF938BDCD743BD513544DEA02151F82A7FB02A5 hendredenny
2,422,391,438 *FFF1EBF7E288D62E0B2DF75FA971A0E1814006E4 HERBERGSVATER(TRITRATRULLALA)(DANZMUSIKMIX)
2,422,391,439 *FFF2EF4C22E0C790F79AC653270261EE83CED29D anceter8
2,422,391,440 *FFF6D46C8BA7321BA80E8805D1459265E2BE3F75 ANDREWDUGUETTE
2,422,391,441 *FFF6A94DE5EC5555486909D216E751AADA257DC7 ANDREW TROW
2,422,391,442 *FFFB8CCA0187D0992D3261C4A64ED4E6410EBB88 HERSHEL.GULARTE
2,422,391,443 *FFF8B9F06F7A9DD5BBD3E1AB6E8574E4ED170365 ANTENNULAR6
2,422,391,444 *FFF0D38C7AF22AEEF3D9863872DA3D97ADDE1BD3 anthracite_black'/&/n/T/r/@/,s/aI/t_bl/&/k
2,422,391,445 *FFF9168F59E64DA6DE3737F28D6B6F14469C39E6 hindmarsh8
2,422,391,446 *FFF1750A64A11C03A04826CD5037A34A5079C0C7 ANU.KONDA
2,422,391,447 *FFF1A2E62E1135B7032CDDCF08913D4E2920C2B1 ao0,p
2,422,391,448 *FFF8D1ECD56E6F80E614F53CF45A8F33B02A265D AOTAC
2,422,391,449 *FFF5BB03B1447860FB59B477107AFB38EEC20886 A;$Q
2,422,391,450 *FFF88DB9845BEDB163AEFE18782783D18E12BE9A ARCHIE.PHI
2,422,391,451 *FFF21AA80E006BAA5A05456625F4C1C804258150 a/rha
2,422,391,452 *FFF5949D8992DDF58E6B004676A86F518B615033 arkvf
2,422,391,453 *FFF7FF79D20838DA15EE641EDA5383F5501A58C5 ARNOLD.CAFFARELLI
2,422,391,454 *FFF491952355E1A66EDE674310A83755F9561953 ARNULFOMINEHART
2,422,391,455 *FFFB8EA58C17DE38B23AF7EF6016B906D896FAC8 ARONICI6
2,422,391,456 *FFFFE97CDB8F336ECD38549E9F97F8D7C0C62F80 HYPOXIAISCHEMIA
2,422,391,457 *FFF347586001CBB3D6B644AEBEA52BBBD2EF2E5C at?-
2,422,391,458 *FFF47767B0B8BA86BA3D9BB34E44AE1F8FC64AAD ATTGEBETETES
2,422,391,459 *FFFB75CECAB21782B84310CA9EDD6B8165C52386 aubiermontaigne
2,422,391,460 *FFF6C894F3D51450ACFF0C4FFA36D9121A981FA4 autokinesy7
2,422,391,461 *FFF914F09F872A7DA98A7AA4A83B6411528BCA23 IDEATA8
2,422,391,462 *FFF7E8E32028D0034373608E3AB2364A564125B3 IEXCALIBU0
2,422,391,463 *FFF8CC5EC185544CC52AF9FFD7FE56990FE4CF87 a?!x
2,422,391,464 *FFFA6BC155AF3D109C26C7335CD18E3570EA4E14 >-b0d====3
2,422,391,465 *FFF2CDD3BECC1803684BEFCBB8DB5CACF3F4F9D5 b#0e"
2,422,391,466 *FFF3647619177294B383DDE5E5EDF4E971886CF6 b&1wi
2,422,391,467 *FFF5E45E5AD4B4FBEA3499564394996BE4A36BCF BABYGIRL
2,422,391,468 *FFFF4FAD9DCD02FC2618652F7312EB66B40D79E5 BABYRED313
2,422,391,469 *FFFF008AEC36D662E118FAC9FEE7DBC29D2C6F3F BachianasBrasileirasNo.4I.Prel
2,422,391,470 *FFF32D3B525D248DD4392D914218621907F99948 index
2,422,391,471 *FFFDA73E6E1D7BD4E562043B644389D979D1C1EF (→INGRY
2,422,391,472 *FFF1B6D2EC3B4BADF3A0F6C1CCFD22437CB41F8C band cr3a
2,422,391,473 *FFFA6C7B597DA5EC75B19B37A7B67C5874E3DB95 BARREGANAED
2,422,391,474 *FFFF3D90B9480A376A96CB60019DE80769627653 invi7a7i0n$
2,422,391,475 *FFF5668D0811D19015C949D0CD7D677ECD2C7E7C batuhan.satici
2,422,391,476 *FFF4B3198DE5B41C169449D21F07D5EE4E600BF3 [email protected]
2,422,391,477 *FFF8954779B0B3F8B15B8E346D28AC36BF03AEFA BAZIKAYNAKLAR
2,422,391,478 *FFF6CC7F9C53148CACFF7B46F4778D3FE2C0683A ISMAEL.BAUTISTA
2,422,391,479 *FFFE4C43CA9A539B05C5CB6DBB1A1FA373536C7C BE7KO
2,422,391,480 *FFFF4E915EAEE1A9C053198FC0C4DEB98974D17C beauderuso
2,422,391,481 *FFF7878C04239B43EACAF5DF7F0EDEF785F584D2 ITAKEMYWIFEEVERYWHERE,BUTSHEKEEPSFINDINGHERWAYBACK.
2,422,391,482 *FFF4FD256BA3A24DDED0C7A8EDA080547CEFE2C9 ITALOPHOBY
2,422,391,483 *FFF8C6A7EA832C23F1C81528D0DE81B269AC82B3 IVAN.EWART
2,422,391,484 *FFFD78B87550E226C187DB3799EE08470483CCBB benlehigh
2,422,391,485 *FFF08B11CAB5585BE084A22FA7D7883F90F93AA2 J5KRA2MAREN1
2,422,391,486 *FFF1DB6BFA5C95AD26D8A26451F555AA547A58B3 jack-cheek
2,422,391,487 *FFFC99EC350B958B4441232A94589D745747C76C BERNARDOFUGLE
2,422,391,488 *FFF2B23BD4875107B71AC538ECD169C9D2C68733 bes9
2,422,391,489 *FFF81F19E2A85FECD241641A5E0B6A90B038CC29 JAMEL.FRIEHAUF
2,422,391,490 *FFF6D535A69273E4F05E87C6A4A87577063B89D4 JAMES-BRAMBLETT
2,422,391,491 *FFFE5F72C1569DDFFC0359E0BD56BF824B61F6DB JAN9893029
2,422,391,492 *FFFDEBEBE9C1A1A1E5FE0A1134282B76573D4105 JASPER.KOGAN
2,422,391,493 *FFF535629013AB3585454581011FB4836FFB98F7 BIGMACHOTDOG
2,422,391,494 *FFF77456CBC7A56630A7132D0D3451D4131E2BA3 JAYSONKABALA
2,422,391,495 *FFFA6F4C4F9840C142154FC2D2A0DF93B68B42BF billiebrengettey
2,422,391,496 *FFF45EA3B70A141F975343E071930C43619E5BA5 jazz.cabbage
2,422,391,497 *FFFDE484DFFCBEBD77563F60231CAA226BFCF95C [email protected]
2,422,391,498 *FFFA8A29791D226D6B857F0A582D56182996937F BJJ2
2,422,391,499 *FFF57EC3A5DBE980D7A54194E75B4118C6D8D91C BKG)2
2,422,391,500 *FFF4F5D1183DA21EC94AF5A0726D81238CCBBC95 jesseheinze
2,422,391,501 *FFFF235C6625FAA1F23B70AAAAE54ADC2EB32CD3 bleuuelbbed
2,422,391,502 *FFF372F2E5E89CC1125AF7119AADD90554387F28 BLN+N
2,422,391,503 *FFF46BCF89AF00A07315311E1770C1E206ADE45E bluntmuzzle754
2,422,391,504 *FFF651D1CCAC548A8466E48078508AD3F66C75EE blvq
2,422,391,505 *FFFD10726FC439CA94D04F3DED81AFBFDBB0F099 bn3dm
2,422,391,506 *FFFEFE5509E88B3D32862934A2FAEC297CAC387C JOAQUIN.BUSIC
2,422,391,507 *FFF1F0E48958A5EB3158D79321844611BCC31F51 JODY.PETTEWAY
2,422,391,508 *FFF7886921B66DDD635147496A0C819151032E36 BOCHERA5
2,422,391,509 *FFF0B61E063A38E8DDF6DD39D077B9F100B3CD61 borhan-uddin-chowdhury
2,422,391,510 *FFF7448F0FBF39F985E40BA58343F14970FDCDA2 JOHNSONCOCUZZA
2,422,391,511 *FFF8F46789F3358E49DB596A9D329D4614BA5A1F boycerutty
2,422,391,512 *FFF5BCBDEE81B8E588597D1EE2FC98FA783D4489 JONGETTYS
2,422,391,513 *FFF236505000CEF318C1CCF5B3B23341A4AA3DC7 b(p2b
2,422,391,514 *FFFDDB8DFC742C488F20BF073CA9FACC7A5C8ACE BRADLEY.ZADER
2,422,391,515 *FFFEC87C5F850EE277113DECB75717ED8AFBC358 JSHERAW
2,422,391,516 *FFFB3043EB2E0927F2CCA114EA6652E716868827 JSXDRAPI.C
2,422,391,517 *FFFCEBED34E52D57DE501009E4F66598FB28EA86 BRIDGETTHIMES
2,422,391,518 *FFFF63341DAAAC0CB091662DEECD476788F3199C KALNYCHA
2,422,391,519 *FFF98954C19784D90258A67034C2341DEF156075 KANDARTSSIP
2,422,391,520 *FFF397ECB8964387D025D3D599C1226004824C07 broken-line
2,422,391,521 *FFF7A238733B5590C8656DBBB7657FCAE8C91753 [email protected]
2,422,391,522 *FFF64538285DFD2D29931885B29FC8C0BA7448A8 kaseysharick
2,422,391,523 *FFF65931330AC3EEC2CCE9F9B50C224714428D21 BRU-X
2,422,391,524 *FFFC10E120469BB26521C3C6C3DE6DE6C57A67FB kdejetal
2,422,391,525 *FFF1481086981FD9E0228A8275263A56E447917F KERESZTELÉSE
2,422,391,526 *FFF02530693171EFC4CC28B458FFCD0BDA8E6C6E KERUBINL
2,422,391,527 *FFF42FE740E6114E51B8B8D358B426B0C5F175ED KIATONSTYMPHALIA
2,422,391,528 *FFF4081CA3CBB89B754FAC7B03C4CE2234E92C04 kimaaron0
2,422,391,529 *FFF7C880CEB30D7EFDBC238526489C49EB5B0B78 KINGARZOLA
2,422,391,530 *FFF33BE9D77D7EED385D2B57CFCA40E249E120A5 KIP.PRATTELLA
2,422,391,531 *FFFA1A54060E641AB6422862C5AB42C7228D7D5D BtR
2,422,391,532 *FFFE00DDDA319FE4BB02094B65FF11BC4B7550F4 BURL.PLIMPTON
2,422,391,533 *FFF226C361F0139B2F7C8B1860ECDF10B17E2C19 buzzskidoo
2,422,391,534 *FFF8F4FD6326D73F3EC00C8A2D0004E06EF21393 KRONINGSEIDA
2,422,391,535 *FFF939785E14DE24E69728B4D8B3309E80DFC672 KROPF CORPORATION
2,422,391,536 *FFF5E04004BD9E5B9FEE30CB43B17866725959B1 lagg1001
2,422,391,537 *FFFD9F80BD3FAC82BA1F01388FB17E1FDE6243B8 c5zr
2,422,391,538 *FFFD58258FB81BEDF0327DB130DE822571919BD0 LAVERNE.DEMBROSKI
2,422,391,539 *FFFC375E7B1BE7BEC1FA9E4CD89A9B685FB2EBCC CAMPLAND0
2,422,391,540 *FFF008F03DEE9DBEDF4AF990E1E356B75FAC5FE6 (ldl
2,422,391,541 *FFF9DBBAD28EF84096BFFC0932A5693B4FBE080B LDONAET
2,422,391,542 *FFF139C565F24F78670A0BF50AB4572884EA0580 CARCINOMAHEPATOCYTEH
2,422,391,543 *FFFC2B5C5571381CB62522B38BAB0DCCEEF9D06B LEHKEM
2,422,391,544 *FFFD38B27DC1E2C4C3727A936AE71EEB86035375 CARIARAS7
2,422,391,545 *FFF3225E0E0A7A9593C29939072C339031486537 LEONARD.CLUNE
2,422,391,546 *FFFD79340C4CD389FCE12CCF3CF396FA2D4D2455 CAROLBACHNER
2,422,391,547 *FFF633414418059D68ED27D80878244E162376C6 leopetzold
2,422,391,548 *FFF9F76C746E08A573F7A4966DFE7E4A024C5890 carrollian
2,422,391,549 *FFF9D9C979351F55CB36CD6FB66CBCD5783E7577 cassius420
2,422,391,550 *FFFADEDAA031804549A1EB63CC09B70BCE6B62B1 c/b_
2,422,391,551 *FFFD4E443C6621E34C727565EA40F8E300F2C6C5 CBG:T
2,422,391,552 *FFF76DA117A83149D42D6347EB800FAEFEF29CDF LICHENIZE 'L/AI/K/@/,N/AI/Z
2,422,391,553 *FFFD1375735FC55DD9DDDD602296B563439FF44D C+CN3
2,422,391,554 *FFFF61C9BBBE07C55D1DD6C9D5428DC66A24AD2E CDN#(
2,422,391,555 *FFF84D50A7DEC9E18698F43E5876F55E380D5AED LISATETZLOFF
2,422,391,556 *FFFB73446F7BAFDC92473DD8D50676F493852FB4 c+fep
2,422,391,557 *FFFC02F2797375156072126A823CB3EAC0C9C987 cgql3
2,422,391,558 *FFF2BEAFE3A607C7B2538BC380AF9141BB78B8CB CHALLENGTHEKING
2,422,391,559 *FFFFCA35EC2AAC338CB230933B6DCF4E121E8D14 [email protected]
2,422,391,560 *FFFA5853FE1BDD8C0F198A8BCEFC061497F03D5D LUCIOWARR
2,422,391,561 *FFFAAB2A71A896C310A0C5D543B3B8B25B185CA0 LUCY MACCALLUM
2,422,391,562 *FFF38190D483FCBCABD39DF5068675C3BAC1D21F [email protected]
2,422,391,563 *FFF8CA65CCB16035C15D3270F65C82F0EF2CF66D LUKE.BLANKINSHIP
2,422,391,564 *FFF577A407A86DA623AD888E71544836E740F761 [email protected]
2,422,391,565 *FFF241063FB1F6444BB32B1E1F7ADBE88F6D9341 CHECKLISTE: ALLE TRICKS UND KNIFFE IM
2,422,391,566 *FFF29E6FB79C9389386FB5EDFDB83F31F7772D6A [email protected]
2,422,391,567 *FFFF3B8830FBF09951BAE7C8BCF436B2815B8722 [email protected]
2,422,391,568 *FFFE302F1233F83FB45C7920D9773D6621F0990E M0th3rin
2,422,391,569 *FFFA5A29238642306A70416CD37D04063EB811A8 M314NI$M
2,422,391,570 *FFF16C6F8C803890F8C062AC5F5EE81D389472AA maggotsote
2,422,391,571 *FFF6510191F023314F8918922759CE7BBEA3BDEC mahbabez
2,422,391,572 *FFFB428BA8E2537DDB5B5BDAE44FFA0BD901CEA9 mailserver's
2,422,391,573 *FFF065806CBD1F7381498A8E14AFC346D7158C00 chtrtggning
2,422,391,574 *FFF522702A079818CDBE2CFD69AB02E778C90FC0 cientopoblacion
2,422,391,575 *FFF615A9631CB46B6BEB776120960EE1E8ECE094 mandie-taylor
2,422,391,576 *FFF4FDCDB9A60BBA39E25B6D0E22D5C9E4B64ED9 mândreşti
2,422,391,577 *FFF9B31A4A42BEA6ADDBF2B557D6DF6E5868B2F1 cjys
2,422,391,578 *FFF459D1025EA34654D82B572ED88FA86932D205 ck?7m
2,422,391,579 *FFFCCDD4781A5441613A3B40939DB877B08D4B6D CL3RMONT
2,422,391,580 *FFF13EE9A7E4D3D2303D8581983A52766ACB6B9D classical viewpoint (1)
2,422,391,581 *FFFBBB37A566E819318F93A447FE48AD93D95FCA marrmaires
2,422,391,582 *FFF6F70D7735DE06D0556E352B04149128088449 MARTIN.SUTCLIFF
2,422,391,583 *FFF251F11393B210DA95717EBDA0E6FF50D8CEE6 CLEMENTVELTZ
2,422,391,584 *FFF7456577F50434946439EF24A1AD7F46C1FE4E cletusschulenburg
2,422,391,585 *FFF20C75640D6BE6EC5F7FFC1F13761838431937 MATCH2023
2,422,391,586 *FFF2F52B15133F104B137BAB6F88D1F340281C09 MAVERICP5
2,422,391,587 *FFF7041378F2C984DC305AC79882A6D33610E55C maxints5
2,422,391,588 *FFFCC29F5ACACEB522362EF8F1311E0BBAB82E09 CLYDEPAGON
2,422,391,589 *FFFF6D4C13E4C5356F396E7137BB4F83F2EAEA20 CLYNM
2,422,391,590 *FFFB744C224D5BC0DD74A6DF6089713DAC52940F mervinfrieze
2,422,391,591 *FFFB32291660B59B9C433F03175290DDA6D082C2 mervinsoulek
2,422,391,592 *FFF4BB5EA0A4E3E2AF032E86F993FFFBCFC7C381 METALLICA5169
2,422,391,593 *FFFECDF6B54516FB7C137795F7DFC5248C0037B3 COLERIBAO
2,422,391,594 *FFF2D0AA01190EF70C9F8238C0BE4D44C84B9349 MICHAELGATENS1234
2,422,391,595 *FFF7E111BDD5F636670142BB7DFDA2CE2D93FA5A COLINGALLEGAS
2,422,391,596 *FFF793A891174DF8216E11558BDA9CDA07F79D37 michael.yldefonzo
2,422,391,597 *FFFA6A1678741E32E9CC68C583A708BED642EE09 michaleshimizu
2,422,391,598 *FFFBAD07CF3A85018E038D67ADE53BB2C283635F michaletoof
2,422,391,599 *FFF8C8313A4CAF74A74FCE4B229C2CFB60421642 COLOMBERG
2,422,391,600 *FFFE1DFDC9B030FC358BE5317FA52488930916EE MIDDENWEGEN6
2,422,391,601 *FFF941A6FB8D4E1E54847436C8F4034B39CC5EA9 contraceptivefoam
2,422,391,602 *FFF37ABC478EC361C9EE1CF48697B53676593A67 cookiegalileo
2,422,391,603 *FFFD87466E5E16A5A126EA60B4977A692AF54C0D [email protected]
2,422,391,604 *FFF71F9E5E0BFFE2D757C46A51CEBDBF11F2490C MISTERE:DHALGREN
2,422,391,605 *FFF482A1B9E4633BD1D496D83090AD0C8490221F [email protected]
2,422,391,606 *FFF153748464D33921B5467870779235855EF169 MIXÒFAGS
2,422,391,607 *FFF2D81A7DB6F1AAA7E9D1AA37CFD3820FF871CB c:\program files\common files\adobe\xmp\custom file info panels\2.0\panels\description\loc\description_fi_fi.dat
2,422,391,608 *FFF09A68F9B9B1E5C4CCD14FE62936E4F3154FD0 C:\PROGRAM-FILES\MICROSOFT-VISUAL-STUDIO-90\VB\SNIPPETS\1033\FUNDAMENTALS\COLLECTIONS-AND-ARRAYS\SORTANARRAYSNIPPET
2,422,391,609 *FFF5148D97B130BFE714F751514E2732BFBD439B morkalla
2,422,391,610 *FFF3F64F31D24286CA196D0613E12878F6AE4C5B CROCÉT
2,422,391,611 *FFFF43B91ADF294662E7928EA5672C069A09663F cu812
2,422,391,612 *FFFE608AE8CC8717DB049D85819FECAC4BE1449C cubziton9
2,422,391,613 *FFF3C671EE46E38D37D4C54563CA58B9160BF84C MUSKEYEVERGREEN
2,422,391,614 *FFF3E734C55CA652E9E1B5F565418221A3853EBE [email protected]
2,422,391,615 *FFFA2263E6A93B791F9A3A764231B8ED77B331ED CUIL,
2,422,391,616 *FFF714E9CE4A61B4075C9D47E8C45D8811FAF519 mylovers97
2,422,391,617 *FFFD99EC6FB4FACA305EAFCDBE598711B4A810BE MYRON.VREDENBURGH
2,422,391,618 *FFF7847436784C2EA1551DFC9CD91B790F85DDBB $myvar=$array{&quot;foo&quot;,&quot;bar&quot;};
2,422,391,619 *FFFC3FD2A2CE0C48668E0A68D63DA2E5F1952D25 cwg6n
2,422,391,620 *FFF20C77325109138E9E3E66E39E34E401E4D550 CW%P(
2,422,391,621 *FFF8E6BBA03F0BC7D351196C994E79B1B304DF02 nahyunahn
2,422,391,622 *FFF1A3ABCAD9D830CCD98242EE568F87BA76A7DA d1h2
2,422,391,623 *FFFE8AEA2D7B1927F382E892FC3EDA2C3793171C nelsonchagnon
2,422,391,624 *FFFDC30E8EF689BF441CF655C779862BCE8B72BE D4D0HE4D
2,422,391,625 *FFF0ECCDD4E60C33CC8BD214BC3C3DE8F91FD927 DABASGĀZE
2,422,391,626 *FFFF3A11B146B6E51DF6F1469EE4D34F99DE0276 DABR-
2,422,391,627 *FFFE08A966198B44B89BA32272CB85F7760FF43E NETSRAC6
2,422,391,628 *FFF1D09ECFCDCE836A806AA36D315B9E6EAE1D72 NEWMANTALKTHOMAS
2,422,391,629 *FFF2C906112D3AED85A2921212AA3D2F6506D3EC [email protected]
2,422,391,630 *FFFF3501E6A1760DC1ACC41F63E0DBED06A6A6C1 DALTONDONNELL
2,422,391,631 *FFF4AE5D8592412BCCBF2E0434B4D650050CC18E nickhallman
2,422,391,632 *FFF081D107484AFCB68AB89C19DB85DD2436D896 Niemand-is-veilig
2,422,391,633 *FFFAA34354B307E4F7FF8FD997165D102ADBC103 NIGEL.MANN
2,422,391,634 *FFF04554AAF9969849415974D4C7DB5D22CA17FD darinkiang
2,422,391,635 *FFF152BD649C59FF2EBE8F3A36AD857B6A287BBC NIPPORI-EKI
2,422,391,636 *FFF6BB6F436737E18DA7AFF631A3B2B06D46F92C d'auveregne
2,422,391,637 *FFF7B232C376320A1F64B5443ED5E2E587F2FD49 D)#C
2,422,391,638 *FFF22392EE7210BE10877C979529D57A7E372E8A DDGHJ
2,422,391,639 *FFF6C72F882CAE87A1F5EA1E5E4999918950C488 DELL´OPUS
2,422,391,640 *FFFC134D8615DD1AC07F5673A86C78DB30E67DD1 DELMER.MANOCCHIO
2,422,391,641 *FFF6BF6761DA3FD31B36D8D6A92A77B9B1235102 DEL.SCOVILL
2,422,391,642 *FFFC37BB4AB101991EEDC1585B3C15CD172DADA2 OKAFOR.LOTANNA
2,422,391,643 *FFFEBD12086EA3884334935BE624492ED0228F7F okonokos
2,422,391,644 *FFF7335CFEBF77D3B26EC3639B0749E7453E88D0 OLLIE.BROMAGEN
2,422,391,645 *FFF4CB35F525270C6EAF18A2C247B7D3C765CA5E omarstabbara
2,422,391,646 *FFF653B318FB871996B0EB93223488D295FC6D15 ONJProductions,Inc.
2,422,391,647 *FFFCA11A05EE841A1E95C75836B5818AA9738632 DESCORRAS3
2,422,391,648 *FFFFE8AF51BFEAD0CA416648500EBCCDA158086A deus.(db/rs.mix)
2,422,391,649 *FFF2235FA91ABE0104B1225C1D5B11005BA99CF9 opium.poppies
2,422,391,650 *FFF640FA7CD238A5F0A7CFA434B2C585EA9EC8F6 [email protected]
2,422,391,651 *FFF99E06D3F452BD8C9DAFFDA3F0CAA9A5112556 OQPJ
2,422,391,652 *FFF7534D21A03BB9F82BD1C25E1A17FA2D2909A7 orvilledomenget
2,422,391,653 *FFFD291C61A6E2606291DA3BEECFAEAE960A1240 D?.H!
2,422,391,654 *FFF06A85CBCCF8BEC4B267611A9A8F1AA1C1D626 DISHDR
2,422,391,655 *FFF7C0CABB09A28BE8C62F51A83B107AB442A65E OUTQUAFF3
2,422,391,656 *FFF0B7685EDDC259BFB494ED76882154BA46A94C DJZAQ
2,422,391,657 *FFF38BEC6DB4F385CD948F7010E7A6EAA51265BC PAGINGSES
2,422,391,658 *FFF709AB5D88A6A6FDC6FFDF1D43640715C35895 DoE(
2,422,391,659 *FFFAF43C1C918270535CA316C4E586063F6F7ED2 pauleinsiedel
2,422,391,660 *FFFFCD972390AB30DB44308F21FB4ECF36FE2118 DOWN&COUNTING
2,422,391,661 *FFFBF1E750F3CA56C38F40F0EA7D6FDE279748A4 [email protected]
2,422,391,662 *FFFEB0C7332CF7EFFCEF63D016469D76F99B3155 pennyseigerdreyfus
2,422,391,663 *FFFD8C05205CDAE185B3DC7993C3A066F790BEFB peonnel
2,422,391,664 *FFFCF77F82801A91ABEF3208150DAD5E3EA3D912 P$eudo4b
2,422,391,665 *FFF0C03301972A4E251A483188C26F7E44053C68 pfahlbaubrücke
2,422,391,666 *FFF0E64D467244C077C1E8C988D796B436231F61 DUSTY.MCCOLLUM
2,422,391,667 *FFF80049F0E63AFFC730291ED7DA327E8F8838C2 dvay0
2,422,391,668 *FFFC71198D34B8F8D5FEE84CF6D6A6DFCE2C9539 dy8)
2,422,391,669 *FFFD2A09D4E48903A68C012658829F5A39055868 eacia
2,422,391,670 *FFFEA54B9B7D6ED5DF926C116C3E95603E19DC66 EDGARDOCASTRILLO
2,422,391,671 *FFF2AA80FEE9A8A158A224F48CAA5109CD799F95 edisonlynd
2,422,391,672 *FFFEB38B56C2C82ACA805BA543D73D40D84C23F9 [email protected]
2,422,391,673 *FFF15830670315702004E085F6AA49720F04AA9B edward-gustav-mattke
2,422,391,674 *FFF2D1771490964D2DBF3BD7CCF4C9E5F8D85087 p##p-*sploit
2,422,391,675 *FFFF6F101AA84FD3E4E61CBE1EE474E8EDDE1666 PRESTIGETOEKENNING
2,422,391,676 *FFF79F98EB1E8A27E448C79F39CDF6B45341F8FE PRESTON.SCHNEPEL
2,422,391,677 *FFF64A80E3EE50514DDABF3D1F7CE16D5A296B37 EHR}
2,422,391,678 *FFF83CC8706ADC11AD5802EA88C1FC92BD9AB5B2 ProfitSea
2,422,391,679 *FFFA64E9779607BE3CE32EAA6FA55FD8261E4E49 ei/u(
2,422,391,680 *FFF1E7FE814D41E178AE23BBD161D7E1A9D6BAF6 ELANROX
2,422,391,681 *FFF4046EB1C4CC48BEB7C85AAEA4233C35A2B4B5 ELECTROLYZE4
2,422,391,682 *FFFB807AA5B91E6C78234667A9375F476F5F4308 QARBƏ
2,422,391,683 *FFFFBA6F2A0E6EE5C84ACF67212B70CBE28CB30B ~Q=====B
2,422,391,684 *FFF9CE270C2617B2415912990E061AC0AD189D29 qhotrod0
2,422,391,685 *FFF380FA8705004E14AE27E4E7933A4AF05BBACF elvinsilveira
2,422,391,686 *FFF4E1313A625D858E6547B141D622AE80FA56AD ELVIS.MEZYDLO
2,422,391,687 *FFFDEE4CF03907834472465502F54E011EA26353 EMBOLOMERI0
2,422,391,688 *FFF5F376211D2793B9BBEDEC02E57B6D4716472E EMMA.MURNANE
2,422,391,689 *FFFB567C1D67462831B0EC8FAE4C224460AC9833 QUINN480
2,422,391,690 *FFF879B19B202050B49C050A78985B8A16F64B4F EMPLIEZ1
2,422,391,691 *FFFE02A02B20897F005826F0EE24DE6E9875F657 r3appra5ng
2,422,391,692 *FFF680C1675ED9980EADC6EC6A99983919007383 ENH5A
2,422,391,693 *FFF1049CE1EE756D74C741C1C9C9F23E7A59CEC9 [email protected]
2,422,391,694 *FFFED63D34D30DC5C9F2973FAD83474A81609843 ENOCHBLUMENKRANZ
2,422,391,695 *FFF265D8762D3E93D2E9D1D3550C5F24729151FB ENOCH.GOURDINE
2,422,391,696 *FFF08EDE381CEAD0E0E69F62782DED8C6E9D359D randallscaffidi
2,422,391,697 *FFF7AD1A235F6AEAC7CB234D82EA7D223B683AD0 randolphswitcher
2,422,391,698 *FFF04404F63BB999AE2FC9CCB57AC3B935B61335 epkhi
2,422,391,699 *FFF207BE4B6B4B04BD4889C63F2A2EE061478F0A eq+b8
2,422,391,700 *FFFA4C3037B4CD82AC0AADF6DF706A7093CA0C46 EQD3M
2,422,391,701 *FFF5206A7CDF40276A837B30CA0CF381285DCC4D ERICK.LOSECCO
2,422,391,702 *FFF0D2DF1CA40C318B6C80619FB6F3586819AA0A reagan
2,422,391,703 *FFF0BD547FA5189BEB3C19700523D567F3A9250D ERNESTINE CLARKE
2,422,391,704 *FFF15BE85CEF1F720065154741F5C768BACDD48D ernestlepine
2,422,391,705 *FFF3AFEBA57485D6254400D10266E534F782DCE2 REDBAK
2,422,391,706 *FFF0D1418AF66B52A50D324F296E26972235230D reginaldalgier
2,422,391,707 *FFF57BE065891FE77DFBE6554D30A9834C165BB9 ETERRAAIS
2,422,391,708 *FFF13A9AF0F8B6A97ACAB515F2082A3803E87644 EUS5H
2,422,391,709 *FFFDB460CCECBD66FDDB217CA768216D427A1EFC even-fall
2,422,391,710 *FFFC6178B6356274BE26C4B40B7504D6701810BD rettelig7
2,422,391,711 *FFFD6A4E43EA1A294440CF8B58C8C83E06DCEC6E EZRAPICKET
2,422,391,712 *FFFE3A13E0D26E8C78739F394A79BEDA5E053DBC richards
2,422,391,713 *FFF4DA12415662798892B20E930B96DA7940E30A RICK.STOKES
2,422,391,714 *FFF3D4073B73692D453E2C293A6701547044019E Rigoletto,ActIIScene1:Ellamifurapita
2,422,391,715 *FFF3A652725DA2B20CD8DDCF6E46495ABA6F5B09 RL220
2,422,391,716 *FFF453DACFA13F74A3E9F4FE7BFDF0A57E021A8B ROBT.EVEN
2,422,391,717 *FFFB7A97A6A63DE384F5EF69BC47B4AD328230FE RobZgaljic
2,422,391,718 *FFF176F37EEFD63BEC3470C07850E37755BA6937 [email protected]
2,422,391,719 *FFF97BB1B281C1932F33A1EB6516DA91BD6EF279 festa.do.passa.m
2,422,391,720 *FFFCB0EA5E722045E80B0723B618DB75A27889BF ROSCOE.GEISER
2,422,391,721 *FFF87BB1D52A2008DB4FA5B3000066187A9ED210 Round.6
2,422,391,722 *FFF94E2CA3184AA4430FB61A73016129E109DD25 focaliserai4
2,422,391,723 *FFF2B518CABAD4E19F5C13250B8CB229F825EF03 rubinmobley
2,422,391,724 *FFFE14D184946C5BA2CFB92194EFB8D53E4EC391 rubinohrenich
2,422,391,725 *FFFBFC1B75273B22637599BE738D6977E27DA7E6 FORUM~ADM
2,422,391,726 *FFF04F83B59569CA7FA541D030A4C2DC4866FF81 fosterwayson
2,422,391,727 *FFF70EA2C141EC73CD59D25F501B02ABAF833E6F runaways09
2,422,391,728 *FFF2E8DC9AA3750CEC57F791A31CC3DE7207EA8C francisrenell
2,422,391,729 *FFF734921A1AC6A4C28C8889588F72E4B1172716 RUSSELTRANSUE
2,422,391,730 *FFFE4585CEA79B68FF34F8793B0A0898FA91209D RUSSJACKO
2,422,391,731 *FFF628D1671C8FB33609AF2CF69B8E507C82731B FRANKIEBAUMBERGER
2,422,391,732 *FFF2035891AD4601ABF972F8A89B8486875B39D6 RWDESIGNERCOMWWW
2,422,391,733 *FFF5217FB4455489FDC2EDA921A67BA076B1C1D4 rygtede$
2,422,391,734 *FFFC5D685B1EF6BA06019D57748A219AC3F5D4E5 FREDRICKZUCCARO
2,422,391,735 *FFFFCF5A83A7A211F7AD1A54120260ABC259730A FREEDOM-(ARTHUR'S-SHAKE-AND-BAKE-MIX)
2,422,391,736 *FFF7052249942CB8A3BADBB693BD0E9346C2B015 [email protected]
2,422,391,737 *FFF41DC9EE53CA0CE0738B94A0A5F19E71CA5102 sally-herrell
2,422,391,738 *FFFAC2F662820A0765A71443406E63D26FA01DB0 SALSTEGMANN
2,422,391,739 *FFF12BFFBF7AB7C13024FD7D38D4B2A124F6D918 samadialect
2,422,391,740 *FFF988E11B376BA239F904D79923567423CF7783 [email protected]
2,422,391,741 *FFFC3A3A6CE4AE22B49D1FB6F59C5C1066A0BEB6 G3R
2,422,391,742 *FFFA1434C846BBFF98653FBDCC2890969D3F40EC [email protected]
2,422,391,743 *FFF320E11EF85FC64D9E6FE6C8E8B5F07BECE10A GENARO.KERENS
2,422,391,744 *FFF8B701DF74899AF3F38959521B3C0900BEBE14 genebrost
2,422,391,745 *FFF20D76A669D5B2126C0C71F80DFC25F98A612A SCHNABLY0
2,422,391,746 *FFF53001311274A987E8C8DF34739A80F3F5DBC2 GEORGEOLYMBIOS
2,422,391,747 *FFF00E3E1FDCD4AC33FFF546BCB011ADEB8E9468 gerardozimmerman
2,422,391,748 *FFF601899AAD9DCF17C366924C32BD22A79DC4FF GERMAN.LACHERMEIER
2,422,391,749 *FFF56EB752D8C42F14EB232FA071E3316694055E GET THE PUSH
2,422,391,750 *FFF6C5525F2527697C1C021C3AC4D66CB265F630 [email protected]
2,422,391,751 *FFF62083CF60B232276DB972B013E1EA67C368CA ghostlogical
2,422,391,752 *FFFFEF884C10723FFB2CBC04A10FB1F810510597 gittuska96
2,422,391,753 *FFF1E291151E6F5580AAEF4FBA83FEE9B5B84377 GLEN.POMILLA
2,422,391,754 *FFF9FE3E5E8ECA582318F926687DFF2A27822C58 GLOOMED
2,422,391,755 *FFF62075F626053C1FE8636AFDC074497CDD339F GODWIN MUSCAT
2,422,391,756 *FFF60B7550605BAF1057BB4F725BEA031538F6C3 go low (feat rock city)
2,422,391,757 *FFF542845B936D488D83A325DE65555A64321685 [email protected]
2,422,391,758 *FFF739F0BA00E806FCB99630E6E4412ED58CFB35 goombat
2,422,391,759 *FFFE6A5D45C419C8F097D05985B3AC8C0585BBA3 grahamtouchette
2,422,391,760 *FFF6614892D37013563E732ABA6CFDE72055ABB6 SERENADEINB-FLATMINOR,OP.3NO.5
2,422,391,761 *FFF61C8FBC7AD4F162EBDAAD554AE79DD0903058 graphostatic.
2,422,391,762 *FFF3047DC1E513DD9E1897DEC79F96DBDC4E4AC3 GREGZENCOACH
2,422,391,763 *FFF551DF1B8DE568991279F8E45DAAD14EEF5D7D GRETE'SHITS
2,422,391,764 *FFFDF2755F681214FD838D1BFE8807F87A35E271 GUILLERMO.GERALDS
2,422,391,765 *FFF5B296AF4EBBC5C10DD25C397B9DD62F16D97E sheapples
2,422,391,766 *FFF50619F173FBDB33D99D05B01134EAAAE9265B [email protected]
2,422,391,767 *FFF2F5A2C2116026F247F52DF9028E6D6276C23C SHISKA1
2,422,391,768 *FFF39DD51C10AF8713F12E7FDBBCF40736BEA557 SHRUTAVATSU0
2,422,391,769 *FFF759EC8DAAE76A6B17B76FC5FB6C854AD17984 shruti.pradhan
2,422,391,770 *FFFB4F7CD0CF748A0BDD42D3704AC799CF36E7F8 siglishing
2,422,391,771 *FFF9F024A10B16A9FB39F6F9C66BE2A289363D66 HARTNOLLS8
2,422,391,772 *FFF68FC85DEF46623914018FD13C9AF842EF1C08 silikatfelsfluren
2,422,391,773 *FFF729007C4E24AF420EF77A42E674780A3CE096 [email protected]NET
2,422,391,774 *FFF5ADCF0D514A84170BA29601354160DEAC9082 [email protected]$E$
2,422,391,775 *FFF1903B2BCBAE4A8BB89AFD08BC89BF364C23D3 HEREDITARYLESSHEARD
2,422,391,776 *FFFD1FB8145CE5C97F3DEE32EDB05C2FD97FA354 HESKINSES
2,422,391,777 *FFF74322B80B0F911BF25F53DE159B70A0544ECA hgiant.lily
2,422,391,778 *FFFF471FF7C2A8467018C1F034037D08DE403A9A snawith5
2,422,391,779 *FFFD659F38C943A208B0D62A98798E4ADF0485BC SNORKTES3
2,422,391,780 *FFF0B5924D4CE6A49B0F957F5C603CCFB1A184A4 H+L-
2,422,391,781 *FFF20183EA1D22A5AFFD027F609EF441B2730DAA somebanalities.blogspot.com
2,422,391,782 *FFF7F98299416C82B7FB588A7CC732B53CA805EA HNILIKABOBBY
2,422,391,783 *FFFDC9FC9478A8841457407E19B1C933A238A7B9 HOOR-JE-DIE-DZJIENG
2,422,391,784 *FFF90100FE5D2FA0B20AA652E98FB2FF167DDCA6 HROZINSKIS
2,422,391,785 *FFFC29C8DC54770F2C22EC76632A756B25225BE2 HTCPNAC
2,422,391,786 *FFFA515C67A3138DA59CE90253AEDC1000E484CA HTTPWWW.DSDHAWKS.ORG
2,422,391,787 *FFF5B9DD4D39507D81BE7CE9EB03BB9F189067D0 HTTPWWW.POWIATKOSCIA
2,422,391,788 *FFFD725F9FCE27395507FC54E025576DF53CDC1A spinetinglerii
2,422,391,789 *FFF82FA60D6E90AE6F76756C5D2679534E793E7B HUNG.WOOLFORD
2,422,391,790 *FFF78AD95A7B8FC874D3612586278047D4D6494D HUSBANDPOSAH-TAI-VO
2,422,391,791 *FFF031DE0A1CECE0483245C1CD042184AF8E338B hwanone8
2,422,391,792 *FFF220B7400CBA58E24519D87056EF78AE4AC9F1 [email protected]
2,422,391,793 *FFFC2599C709919BB9333E8771E333890F45D123 STARWORSHIPPING
2,422,391,794 *FFF31C19D37418A60D657C84DCF2BFA23C7B7F15 STEJNOST5
2,422,391,795 *FFF0E21DA2AB758B4DAA73BFED4153D2C4CEAC82 IGNOREDROLAND
2,422,391,796 *FFFA006B969996635DA8E18A11D5127C8EDE4433 IGUANAFGH9
2,422,391,797 *FFF3AA8E08AE545BCC4AFEDE7D914F6839344D53 STNEMYOJNES
2,422,391,798 *FFF8EDF933E7080AF68583264E3451E01395BBC9 stoevsuger?
2,422,391,799 *FFFA361A1A3F8943FD63CF7FA9F241E813A43B2B STRAORZATAS
2,422,391,800 *FFF9DCB62D7C2BD7C61E78765C9782B627D05DB9 STRATOSFEERTOCHT1
2,422,391,801 *FFFC2013A21F3A156908150683153FEF9E7B9C92 STUART.BAKKE
2,422,391,802 *FFF5B7114E03E11F62A9FA4B658DDAB4DCBB7DB1 stuartkosik
2,422,391,803 *FFF6F5025C925F91B05B28402A7FA3E6BB6AD843 ILUVBANA1
2,422,391,804 *FFF2E10320A20CF96F150D991DA4CF8A974A15D5 [email protected]
2,422,391,805 *FFFE9E86E73CD87473F9ECD0C89BC61CAB6554A0 SUNBIRDADRIAN
2,422,391,806 *FFFA8727CBB2A197B1DC774C6FE8F06AA3B377BD instruktionskursusserne
2,422,391,807 *FFFE90EDB7327650A80BF9C53E6D768EC29848C3 SWIZZA.MAN
2,422,391,808 *FFF58C2C9DAE0B5B94AC7D40BCFDF3C44B2FA63B SYLVESTER.VANWEERD
2,422,391,809 *FFFB6D5E4B2AE73D8AF9A259160921DC974E74B4 iponknaa7
2,422,391,810 *FFF3BC8288EDCA4B661A676B7654A771349957E3 T131544
2,422,391,811 *FFF4CA3AF1093DA0CB5A73CC4A7E5973C48626ED isolation-burns
2,422,391,812 *FFF71DFFEC011A891D5A7C82BB117FE5EFAB7A6B iwaseham0
2,422,391,813 *FFF3B58C4896BA94FEB3B3363AEF15B0F411EA85 JACKBRENNEN
2,422,391,814 *FFFE1CA62E8EC3BCAE99E73E388F7E82B60FD625 [email protected]
2,422,391,815 *FFF2030DA11ADBFA843A969785D79F2600891E40 TATTIES4
2,422,391,816 *FFF68D4B21654D14EE1BA65ACDBA8601D7BA185B TAVUTIOV0
2,422,391,817 *FFF265E978212C3B44F9AFEC8C7570F0408CD4CC JAMALPYER
2,422,391,818 *FFF2630F485A2653A4B9C3D089488FFAA4F9D84D [email protected]
2,422,391,819 *FFFF00F2A27255C724A8F338AEDABA7C059F8181 JAMALTOPLISTKY
2,422,391,820 *FFF72069FE80B9454D1725FFFF33510CC68E251E TBLETS
2,422,391,821 *FFFD32065F8A9C8D037DF4EF13E311E2D7826E0F TDONNELLY21
2,422,391,822 *FFFFCE993431553848842C2B36DCF8602123032E JAMES.HORNELL
2,422,391,823 *FFFF650A2AA90DCDB7D666608173A906306DF009 t+$e
2,422,391,824 *FFF2A69F131BA458A8D64D2F246611F382B24881 jamisonbroadstreet
2,422,391,825 *FFF736B37806A3826DFC4081F7AD88437712ADBA janiah833
2,422,391,826 *FFFE8D902E348373C636DC8CF0867C418E959B3A JARED.MORIKAWA
2,422,391,827 *FFF160F346934E90916A33316FF5F3BBA175776D tentegorra
2,422,391,828 *FFF6582FA98E7824119C019045AC3E06E0EEECD7 JASLEEN-PARMAR
2,422,391,829 *FFF1E2CB892B1184DDFD9636180F82E066E211A7 terrebonne6
2,422,391,830 *FFF0691BBF55BD08324F0AA7BDF3028BE61FAB3C JAVIER.BUA
2,422,391,831 *FFFD6AC082490B74387AEB11F56612886CFF3E87 JAY.ETTISON
2,422,391,832 *FFFE2C9CB6F1C5F8ACBB1D5D80C98434139AEC25 #jcbaa
2,422,391,833 *FFF37ABCCD9481985ACF49B6048CAC24FA38131E JEFFEREYLEISTEN
2,422,391,834 *FFFB1E047973EB8B5CEB1E290CE750064E721483 thatteamo75
2,422,391,835 *FFF6A5C59D80F21D3A53FB98C5EA8E873C5DD930 JEMMYLIE
2,422,391,836 *FFF3ECEA8B19613597D5D8846AB75902160893DF JEREMY.CHRISTAL
2,422,391,837 *FFF5CD3D5C61A1901FC71C375FA97B1A7D77211A JESSEDUCKING
2,422,391,838 *FFF10402C9F7C87F613DC70A0CC16E5F598441F1 JESSI12435
2,422,391,839 *FFFA880843F928ADAC9B0B75454DD79D5FAF74E3 jessica.whittaker
2,422,391,840 *FFFAE336C9EA1F2CFC0D640202D1B2CFCE11D32D jessika.conley
2,422,391,841 *FFF9FB07FAB140C4613805682E01038914CACB35 jf64
2,422,391,842 *FFFB88C049E101FFD4C4E0D9CCE32CF87DE454C9 THE PEACOCK FLIED
2,422,391,843 *FFF5889CFF57BC1F79B46F8E01F72CC46757DFE0 JMICKEIED
2,422,391,844 *FFF5C24E2C94658D7E5B8742866DB5E30ACF02B1 THESCUBA164
2,422,391,845 *FFFA4FCFD754B11676F380D70724F06A15C2598C thirtyse
2,422,391,846 *FFF4503CD17CFE861103760DFAC10C40D97D49F4 JONATHON.MOCCIA
2,422,391,847 *FFFD863D41F4E4B7A6199062F76F6505337098F3 jonmarenco
2,422,391,848 *FFF0D41CD57ACA0608404533F762CED33477C162 TIMBERCOPPER6
2,422,391,849 *FFF473279B8E3D1E1CB4712AD545AF73C47FB17A JONYALE6
2,422,391,850 *FFF7513C42941EAA910B602B75262CB0D3EAF8E0 jorgecathcart
2,422,391,851 *FFF15EE3568A2E2E6A7AC200A14CC4A56201AAA7 JOSEFRINEBARGER
2,422,391,852 *FFF42C4023C3E6D3E47C64205AE6F5BDCD2899BC [email protected]$
2,422,391,853 *FFF17C103AC9C418291CB8C9B1DBB7BF22D1DB7F jqgoatfi32
2,422,391,854 *FFF82898D326C9C8468D6D53E6BE2379D6671703 TODD.DEFARIA
2,422,391,855 *FFF3CA70B9A03938ABEF6C40F46B4450BBDF83B8 TOESTEMMINGSWET
2,422,391,856 *FFF867937996E879C5226334C426A334FE86871A TOMCATMARKETS
2,422,391,857 *FFF8CFBA83134858199CAFBCEB2A4E21B6281013 JUDSON.FRANKIN
2,422,391,858 *FFF0F0BE58B3C4C263EC6715D1AD732F3EF14F16 TOM.KIZZIE
2,422,391,859 *FFF3DB829D1D7A718E38A7F26499C02B71D2B0AF JUILLIARDS
2,422,391,860 *FFFCAF8ECDB133A9081588605AA0D8A7F7DCAEEB juro-por-dios
2,422,391,861 *FFFD968EEE9EA4D8A319F802BD0D21180DE8C9FD [email protected]
2,422,391,862 *FFFD589FAE3FEB41EC6F03331D3BF2D714732B86 [email protected]
2,422,391,863 *FFF5EB9F1903764D9493E81C47CFFC259D9821C8 [email protected]
2,422,391,864 *FFFFB1E801A4C3B238167DD6B190B0A7A0AA25D5 KARENHAO
2,422,391,865 *FFF932AADCA8FE226F98D97D18D08D97E10AA2D4 TROCHA1C
2,422,391,866 *FFF0578CEA0433A7B34EA3560A03A7186E0C3888 TROYYOUNKINS
2,422,391,867 *FFF1B0B47BA621C8D403E6C5F00DE6B3D7DE7565 TRUDI-WILLIAMS
2,422,391,868 *FFFD1B93C1D339E09ECE25CEF2CA16FE67DC6B29 KBATHANASIUS
2,422,391,869 *FFFE6B957429BC88CBFC092F4268B191E7A645A0 KENDEL.LEE
2,422,391,870 *FFFFAC49EE892C8976589A3AA3117868D3248659 kendra-wende
2,422,391,871 *FFF26A2993BF02294AD007B2431ABE872C995E71 KENETH.HELD
2,422,391,872 *FFFCC1A3B074B68994C36714813B60CAFEECF09F kenny713
2,422,391,873 *FFFB567C06ED60A457CA6C6BD184942E9BF6010A TWINKLEBATCHDELETE40
2,422,391,874 *FFFA0611A9B68E6A2CED2C273E070A4DE8C42CF0 TWISTAA2
2,422,391,875 *FFFEDC0586DF372C2AE9371A701E1BAC2B78CA0D TYNEKACUTCHEMBER
2,422,391,876 *FFFA7E6CCF185414CE4E703D767D119A9BCA1BC4 ugochiestychuks
2,422,391,877 *FFF45911A19ED1DCD7B7EAC980FAFEF79650E352 UGRYKEXJ2
2,422,391,878 *FFFD5B3A707317B8145443D31D16D7BE531A3402 KINNERLAND
2,422,391,879 *FFF2EA657B1937832D6C8E4BAC16996775B18D2E kissis
2,422,391,880 *FFFC26C2B88B27EB44D427A4CA5535F61197697F u~ml
2,422,391,881 *FFF2AF15972260FB1B09C09EAAF00100DBBA841D UND3R$+A+3M3N+$
2,422,391,882 *FFF8B921DAB8D69D3DD27CC146027FA2BEF28745 KOCYOU
2,422,391,883 *FFF44DCD7113AC75BEC194B4BADD363A4E5D9F5F KRATZTS1
2,422,391,884 *FFF5E90517119893E0436812AFC15C41103B942E KREBSGANG0
2,422,391,885 *FFFCF44C8E9056072951C11C73911F39F83768C0 KRISBECKELHIMER
2,422,391,886 *FFFFD978AADDEB1D950AC26D4C70DDBA465DE8EE KRISHNA.MEHTA
2,422,391,887 *FFF60DE1103459FD8E9703691F5822A6970285D9 KRISTOFERDOUBEK
2,422,391,888 *FFF872102A9F97F479B24A8B29F3B54FEE866185 UNTRAVELED6
2,422,391,889 *FFF786A80C33E25925B72C3B2568D40FBE1731B3 ûrthoe
2,422,391,890 *FFF42F17AB3C4FE43BDA0582D850888E7C50572A USEREMPYREANDREAMS
2,422,391,891 *FFF07DC9F4369234AA70F938F508A6CBDC0010ED [email protected]
2,422,391,892 *FFFCF7B96E7F47E76B58E9A2E1F79CFCE77ED621 [email protected]
2,422,391,893 *FFF2F8593DFA783006902BB8B0155A3429460FE8 kwon.young.suk
2,422,391,894 *FFFAB7BAC0127BC6677A4D8C7BCDC5A45F8CE2D1 kxg:
2,422,391,895 *FFF2BEBB38BD78CE353B7E983B6FD8A96AB222EE UTSNITTENE3
2,422,391,896 *FFF8A287239A64511542429DC76D9FA2FDBD52D5 UTVISANESSES
2,422,391,897 *FFF14C4C9100B6361FA921CA46D2E7A1B359E536 LADU
2,422,391,898 *FFF2D2525B44A8E8489BEE4BB3C04D12B12CF9EC larryjestes
2,422,391,899 *FFF34202714613DCBBA21A862ABE298C0480FA70 LARUBIA12
2,422,391,900 *FFF5A7169687CEE763A21FEB808E9FC19348B6C3 VANCEA-ANA
2,422,391,901 *FFF4E0C7252105EECF3D7AEECBF7E49D0A7EACDA VANDEMONIAN3
2,422,391,902 *FFFC0BD26DDBA9B7825FE5BA5051B5B0B1E961C3 VANESSA.HEYNS
2,422,391,903 *FFF4F2E3FC82A7EB80890DA3B1617E0BBD78B3C5 lawrencechristaldi
2,422,391,904 *FFF09235A527CE23A1A2203EF571EED809E2F8F4 vanitat0
2,422,391,905 *FFFE9D4B7EB6D65CA9979E8A12922C4A543E388B LEANDRO.CARDONIA
2,422,391,906 *FFF0E655D6C1DDAF0057B4D9BFE6FC11209FEE29 v\<d
2,422,391,907 *FFFEEFB68C11562EA32C21B2BF5BE6B98131C190 leifmaddrey
2,422,391,908 *FFF697EA54DE5EECF9AA84AFF147C0135D9B04E8 VEHM-REYES
2,422,391,909 *FFF9B0731F56531938D56E7BCB4294C3332892AC LEINNET0
2,422,391,910 *FFF650BAFB28B25836B3743DB577D431DB135ED5 [email protected]
2,422,391,911 *FFFF1EB280DC929454AE3D6FE4AFB5567BE67198 VENTIMIGLIA.DI.SICILIA
2,422,391,912 *FFF5F8E245C3FF354C4767639172284ADEAC5290 VENUGOPALASWAMY ADIBHATLA
2,422,391,913 *FFF22A7A8214F2B603A9E4D4605E7A843673301E LEROY1942
2,422,391,914 *FFF97EAEDCB6066972E509F5256545F4FCAB29C3 VICTORY-BANNERS
2,422,391,915 *FFF95DDB2594FED4091974DAA211626B7D8F8516 viktor28
2,422,391,916 *FFFD4BA706F2373DA6B1D15A509DA5D3C5F90CF1 VILLICHIBSW
2,422,391,917 *FFFE28659DB8F2A9DD98C62DC0E439234C9EC737 VINCENZOSADIQ
2,422,391,918 *FFF6F9BA49D2094E43E3E1C1A0C7A466388187CE LIBCRYPT7
2,422,391,919 *FFFD72D3F00CD1FB5E4E269545969DF4A73F8158 VIRGINIA.MONTANCES
2,422,391,920 *FFFCD93875F6152F58147649A89D39975B7324DC VITOMSGN8
2,422,391,921 *FFF8AF74CC65C5BBDE43158917811EDD886D30D1 VIVIENNE.SWANSON
2,422,391,922 *FFFDE829AA779FBA0E937A3F50AC498D49A38FA5 vladimir.quilca.castro
2,422,391,923 *FFFC504DBA223DA435A38BC6949684662D646C84 VOCATIONCOMWWW
2,422,391,924 *FFFD77AF3CAAD82EB1454C6933A32397C0EB9766 vororte“
2,422,391,925 *FFF432AE53F9417470B70F69DEB07B2B25B4EBA1 LINDSEYTRECROCI
2,422,391,926 *FFF004BAE9B4EFA93A3B0DF62FD3EB38A1E8E96F LittleHaiti(featGuxi)
2,422,391,927 *FFF43DC9E5B65BEA79F2DC06EEC0B4C8DBA598A7 WALLY.DODGSON
2,422,391,928 *FFF405FA71C864980ED407D74CA94901963C877A [email protected]
2,422,391,929 *FFF77B8F173F9014288D7C42BA7C5191BDD8F02A WALTONBREVARD
2,422,391,930 *FFF2E4C0AEAB686EF98186DBD68B15494B2B7457 WANDENASWARTZ
2,422,391,931 *FFF1397B042B10F1FC6F870A987D88BC5974C2B3 loneliness in a gun
2,422,391,932 *FFF19807E68954F8F1BFC80951F97B6F5667FB35 lonnykopka
2,422,391,933 *FFF38EDE32C170A6F33234BD53AC6A5CA5227750 WAYNEEBERL
2,422,391,934 *FFF51A8BF0ABC1FE2AD6D5ACD53E1E2AE4151DEA [email protected]
2,422,391,935 *FFF4E96CB2A248235E0546D0BC9C5A3715FDE45C lthttpwwwancientegy
2,422,391,936 *FFFE67620E7C165E0FA64315A294AF866B699B8D wende-smith-moore
2,422,391,937 *FFFBE960871C644C502AF3F218E54B6DEE97BAB8 WENDY MANTELL
2,422,391,938 *FFF4807248F5BBD80BF5DB7683EACD204360BE02 LUISINESON
2,422,391,939 *FFFA96A84D249E70FDE2BDE20E3E6F30A27B87A7 [email protected]
2,422,391,940 *FFFD046E44436DE3FE310F9956B0E0403CCBA3D4 lukeolazabal
2,422,391,941 *FFFCDAE1BCA2554B1EEAAF0BCDFC64F40AA23A3C LULU: AKT I, SZENE III "
2,422,391,942 *FFFD372791B62DC65EFF40EFB88EDBF48B333A69 [email protected]
2,422,391,943 *FFF948C671BE815C1075CB6CB2177C89E4D39A47 WHOZ4T
2,422,391,944 *FFFA85392939A7360CEB2BBEAA6A4B4970E4B77F [email protected]$
2,422,391,945 *FFF3627AD5D01EEC0DAAAE41AF12362208D6BC26 MACKANOSES
2,422,391,946 *FFF2637BA3B12B355A8B1D5E422ABA5FC1ECEBAC WILLIETUMMINIA
2,422,391,947 *FFFCC1093AC59FA5B2182D94658E81F272810946 WILLIS T C CARVER
2,422,391,948 *FFF3EFD2733A6C631BC45EA89D347DB76C394C0D MAHALKOSIRANNY
2,422,391,949 *FFFA51AB4BAB816FD33DB6A2AE0DB9BD420FA31E WILSONPUJALS
2,422,391,950 *FFFFAE800D07A4A4C8ED5514082C66A4106EB6AA WINFORDBLANKENSHIP
2,422,391,951 *FFFBC565AA09B4AB8586A92CFE2DF9E41259DD3E WINFORD.GEITNER
2,422,391,952 *FFF1BF030F62029542CDE534B523D68E0B070723 MALINOWSKIALEXIS
2,422,391,953 *FFFEEE853CAD4FD161B51C2C396B8623623915D9 malumba
2,422,391,954 *FFF3320130C0D428FEB927BE7AB95E8B731040E3 MARASMIACEAE
2,422,391,955 *FFF2F179048722D52F6331CED76AB11DBFE3884B marcelmatusiewicz
2,422,391,956 *FFFDF2BD68D6E98C6CCAFB72234381BC7E2B5CD9 MARCOBOYT
2,422,391,957 *FFF1DBBA3B92FDFC26AC20181731E1CF6F873367 [email protected]
2,422,391,958 *FFF9F03F19C252115FAE6F51016A15312341D2BF WUORTNO5
2,422,391,959 *FFF6EC3A919E58B3698B61845876E8FCF41A7170 MARIJANNI
2,422,391,960 *FFF22CD94602899AD7FC75A503E9A2002529C174 WWW.POWERSTEER.COM
2,422,391,961 *FFFAD05A9DAEDD1AF5A65FA7A4D03FF79E4E5143 MARLINSTAVROSITU
2,422,391,962 *FFF4F518E4A1247A764636B9BA0B1100642BB8EA [email protected]
2,422,391,963 *FFFA6C3D4C0BBFC8CBFF59F07C7A03AF8509DF52 martinpuentes
2,422,391,964 *FFF8244D3E3EFC0BE13D0CCBFB1ED4CDD3C98BA7 [email protected]
2,422,391,965 *FFF68777DF2A5B489069D8F69B0536FEBDB2C852 mauriciowert
2,422,391,966 *FFF14AD24E025F5610B8E1FCAA990AABF46ADFCA XOHEME54
2,422,391,967 *FFF1537D44C2D2431BD3FDBEE613A8072916A9E3 [email protected]
2,422,391,968 *FFFCFAD94A4A40CC10EA83A1B69400FADD765E83 [email protected]
2,422,391,969 *FFFF8D2276F44C5DF7A689CF838349E7F034CD61 [email protected]
2,422,391,970 *FFF532B12EA6838F97A6082FCF86E41FA7AE626A YAAN.RAALHU
2,422,391,971 *FFFCBA08CDC14711F30CAC68CAE67A9283363F33 meegegevenen2
2,422,391,972 *FFF49B529BFD613F762AB65390CDE67C5109FC8E menu2008
2,422,391,973 *FFF9D7079857AE755071918B4421262AB6733DA2 YDHEDPRECILLA
2,422,391,974 *FFF3B9AD4EC65130342E69160962278CCB940A0D MIC
2,422,391,975 *FFFB076B4C24D8C1C4810DF20AB82C65F88238DB MICHEL.MOZO
2,422,391,976 *FFFD0E20C539612788057B27EFF0B5252370E31F MIGNONMILLS
2,422,391,977 *FFF825A31E96F18F2CDAA166377CA69B893F93AE MILAN.ADINOLFI
2,422,391,978 *FFF17BDB988732E3ABA45873CEE2030ACDDB0443 YOUTHENING0
2,422,391,979 *FFF241E730F5E06D08FD52FE154331B0A4E3D772 M\IPMM
2,422,391,980 *FFF55899B14FCF3F82DB5B23419DC9F9D444092D YSARKIS
2,422,391,981 *FFF10262A586EF751529C710D5D661856E2A6B2C YUKI SHARPIE
2,422,391,982 *FFFF888303F07DBC3B2C7AE605980FC172CE4D89 MITCHELLLORIMER
2,422,391,983 *FFFA252CC2C721579C3AF4C3C6A6052B01D618ED m(j9
2,422,391,984 *FFF701E933CC86EF37F31452EC7EBD0AC5E6B13A [email protected]
2,422,391,985 *FFF71E8BE7CB2D08B339B1B60D90E1242B051FDB [email protected]
2,422,391,986 *FFFB23E0FEB405EFFFBA7A45CE54F688EBA774A2 [email protected]
2,422,391,987 *FFF82436946CD18CC8D3D744ACFCE21159182D56 [email protected]
2,422,391,988 *FFF94BCEDFC7E7F034F71534DCC9260F3AF82243 [email protected]
2,422,391,989 *FFF6D395F87778ED0220BD05CCE4F6E17AC94B60 zhaosijin
2,422,391,990 *FFFEC294E4573BAD33EE406B28E5343D593C9CD9 [email protected]
2,422,391,991 *FFF83A48D1C5C81907E7078CA4DA089DAF092179 ZIMBACATAN
2,422,391,992 *FFFFFCA52FAF860C7256FBF360C0BAEB45F1A679 ZITTELS8
2,422,391,993 *FFFD405A5FDC374B106FDE3451BF5815BC3BB311 multipleembarazo
2,422,391,994 *FFF7494BEAD60D59741E6ED4EC722938287A4D83 zritila1
2,422,391,995 *FFF190E76609C4BA65331331A0C1EEF70647D0A2 ÞÉTTLAUFGAÐ
2,422,391,996 *FFF36A8D71FC8A57CED2B0B20FD9FB4E9C757880 ντίνερ
2,422,391,997 *FFFCDF9E105C1F56391A24340D4215D0ED8B431B MYPRINCESA9
2,422,391,998 *FFF4A8E2C9989F7BB85DB9C9264CC61D1E4DBA83 NAKEDCOUSIN
2,422,391,999 *FFFE1032281B67E9417A2166FC522EA2EB8ED6B1 NATHANIELDESMORE
2,422,392,000 *FFFE91A15B6040026DAB5CB0AD2496AF4C0511C4 NATIRCA8
2,422,392,001 *FFF9CB4F4F7D25089E777ED1C1874D035DEDBE32 НАРДЕЛО
2,422,392,002 *FFFA0F60A92F0E1E9468D8AD207282B9EAE33920 nedmessano
2,422,392,003 *FFFFA2209FC55536D9632DB43023D151876DAC0E „ПОЉЕ
2,422,392,004 *FFF423CFEF158926C119AFD35BDFD402415C732A «рибон
2,422,392,005 *FFF219EDF4BE14A19F395A18801B2339ED49941C neshia.jackson
2,422,392,006 *FFF6A03DF7FB2D66FC4243BC4F77096479D01855 neusagomes
2,422,392,007 *FFF2C292DF2E6F800F60B608DE87C20BD388C9B1 NICKOLASTIENDA
2,422,392,008 *FFFE4B7E1DCE8CB5DF8321DFCACCAC6127586C2C центръ»
2,422,392,009 *FFFEFE0508D280D6C2283070B3672B48712FEDEF NIESPOKOJNY
2,422,392,010 *FFF5BB4AD6335CCB2AA9202FD80B14667AA0142A nolanjupin
2,422,392,011 *FFFF29C54EFE99D96387C4164B868C8E3435EFF4 NOLAN.KONARSKI
2,422,392,012 *FFF3F776803FDA137100FB56C2D385AF8AEA1482 no more lies (p.a.r.c. remix) (feat. b lev)
2,422,392,013 *FFF219451E063B8C1CC3A6B50E5D8E9C40E741C2 NORRIS.MENESES
2,422,392,014 *FFF6447D9FEB58EAEE4CD1B9E7828B4925934A68 N$Q4
2,422,392,015 *FFFF8AA69C02AA738F12052AF4A36674DDBC263D NURH
2,422,392,016 *FFFD74610AD8A9C27EC0C5703E3E1A63ED9F9264 ODONTODY1
2,422,392,017 *FFF237D5B3F1F48447A740BAC86B0429F8BA375D OLIV3-CH3
2,422,392,018 *FFF22D274726F20D43275D70DD69019A746F80EB OLLIE.PUCKHABER
2,422,392,019 *FFF7E17C1F1EBE85CE149BB8F18CBB6DC0600D59 OMARALREFAEE
2,422,392,020 *FFF179F854503523A89EC841DF2A3152DCD6BE2B orenmarcia
2,422,392,021 *FFF54D906B462E4A6C33E85773CDF43F3157B1DE ORTHOPAEDIA6
2,422,392,022 *FFFBB0D7CA06CFCF683965047C9E9CE1AF2C3CB7 [email protected]
2,422,392,023 *FFF21EAEA5A22282270C63BF8CDFB0898980DDCD OZBASDAKLYGYNY
2,422,392,024 *FFFA610978D92C70016427514C694EB8139F5828 (>_<)~-~-~-<=====P
2,422,392,025 *FFF20835EE026A76AEF1B2CA87A0D527E72287D2 0thatpower7
2,422,392,026 *FFFBE846B97592EBEEBEA18E81A486E0F220509C 1075.KLINIKEN
2,422,392,027 *FFF09453CEB6C8F7F4B23774C280EA50AC382E93 [email protected]
2,422,392,028 *FFF698EDA5E9D98C4BB412597236B957D8A623D3 PAPASITAS
2,422,392,029 *FFFC221C514C6A9B2BC53A066E64D22AC76F1586 13-yearbook
2,422,392,030 *FFF161186DDE4E56F361E19BA3154BC7266B2BB2 PEJATAI
2,422,392,031 *FFFE92691E0A10DCB0A5193584FA869179E7338F 177096 selk
2,422,392,032 *FFF344C48E262A4739FE15B538FFA4793F0660E2 1843656 TUTKIMUS- JA KEHITT
2,422,392,033 *FFFFD93724158C872D72E9A6041F5728501174FE 1850237 toistaparacervikaalipuudutustaeien
2,422,392,034 *FFF1D4C9E4A9C6EEA0E251B1A06750AAD1D40638 1938357 das-sind-alles-muslime-
2,422,392,035 *FFF917D9E8D9575E81BB3A40017515895095D06D 1960s,--winnowed-out-by-its-turbulence-and-rewarded-with
2,422,392,036 *FFF5705591DC47DE666C8A32172BED96617373C5 philippearnone
2,422,392,037 *FFF433701A42355F394AA0744EDE679A7A0874B1 1AKSNEKAR
2,422,392,038 *FFFA580DAE98C7F7AE2B7A22B025D864BE763F8A 1-avoportaikko
2,422,392,039 *FFF68908A05EC205925BD4E390021184D2332C7E PIANOSONATANO.2INC-SHARPMINOR,OP.27"MOONLIGHT":III.PRESTOAGITATO
2,422,392,040 *FFFF80AAE7E52B6C0F8D92B2827AC6FBD828FDF6 1-double-stick
2,422,392,041 *FFF7FCC49F35EDB2D6B592A411CDB911EC9E10AF 1.ENERGIATASELASKENTA
2,422,392,042 *FFFC3C44E29767301EFCD6136008AA20C7CCE57A 1 EXHIBITIONISTENTREFF
2,422,392,043 *FFF19FA743A2EFEA04D9959E0935C24FB7BAD7B8 1.FOOT-CUSHION
2,422,392,044 *FFF5102305BCCDE0891A0B4E7BE24D1D1EF91B03 PIZSTR
2,422,392,045 *FFF94A28FB61FFF0F36B1CD5C6002CA4980017B0 PKOPFSCHMERZEN
2,422,392,046 *FFF3B87FF8C03368EA2E796A3F50C1D66AE8D6BD 1ihmismahti
2,422,392,047 *FFFF7C2C6DB9E7B73C2EC284CA4FD42935FA02D5 1JOKIPENKKOJEN
2,422,392,048 *FFF18FEE9DFA14ACECAF51A89CF525790BDB0B44 1 kisatyt
2,422,392,049 *FFF15F8B62868A1281C333741A8E1ED5E6A9C406 postbad
2,422,392,050 *FFFE9AFBC9E4D66235F7EC73EBAF6B3945C206FA 1OPTSOUT
2,422,392,051 *FFF81B39EC039B99E1E4296B47434984349CBFA5 PP_PROTO
2,422,392,052 *FFF4E42FCE03D2FD86E687F53D8F87DEF7040E3A PRAGNADHIRAJENDRA
2,422,392,053 *FFFCC8C6769FC407BF229D06B3130F2C1B8701C7 PRATAHI
2,422,392,054 *FFF71E5177570A892DA6236DF7862241A884DFF5 preenrollment1
2,422,392,055 *FFFD835C2B9796C2A5094C4BD6D8D720DAFE2AC3 1.tailat
2,422,392,056 *FFF7A95EFCEBCEB8BCB3E9DF948468900151F561 1TUGARUFU
2,422,392,057 *FFF86D6EDD3913D210C4A906EA815BF70CB4F26F 1.YETENEKLERINIZIN
2,422,392,058 *FFF26C1DA85CB7DA0D9F07F8C512F6A949444697 PUHEENA4
2,422,392,059 *FFF4307768048B20CA14590DE0AF7264315356D6 p}v#
2,422,392,060 *FFFE91A33948D02840F6A513DA644DA6816A26BA QAZLK
2,422,392,061 *FFFDEA51DDB341E7756B46DB26B570A3442A4EDC 222aurora
2,422,392,062 *FFFA524767BA259A44AF774644BB6EEA5A7E9237 qq~v
2,422,392,063 *FFF137414BF990DB38CE15458DAACE7A0BE42106 [email protected]
2,422,392,064 *FFFB161F49EE9A4936CB0916E194FBDBBE5D85AF ,2{AAA
2,422,392,065 *FFF702F63BA9778CD24E53068E9D421A04BA6BCB raisman2
2,422,392,066 *FFF8C408326AA2D1042175AD736850AFC4067E32 2DISCINDED
2,422,392,067 *FFFF8235029B57AC16169D429FC3973778E4AB4A RANDALLASP
2,422,392,068 *FFF5641D1B24B4F8F3455889991A69CDED24835D 2 FLAGBEARING
2,422,392,069 *FFF8D654AE5E431AEC1278B9D2D19448A037A0E3 rapestock."99"
2,422,392,070 *FFF53C1B79E4521DB6D623E7CF97EFA0173548B2 raymonsudol
2,422,392,071 *FFFEAF2057281366171D1AD114D2C824309FF2CA 2MINI-HIGH
2,422,392,072 *FFF69DB5EAF4478F33A4315371040BF9A3FF542D 2naurattava
2,422,392,073 *FFF51CC1440EFC1A8D5F12542649BF5ACEDA2828 2SARITRAP
2,422,392,074 *FFF7EAF0A7F9A155996B725D2FBE635663EFB331 RDJSTBL5
2,422,392,075 *FFFEF793098355198AF8FB76847B763815E842BE 30101896
2,422,392,076 *FFF45350A515F7CE2F32B39BF5D4C17B08EECCF9 RECONFESSEI
2,422,392,077 *FFF7932C99937811878F93FCEF94F83114693FA2 REDAGSPRIS1
2,422,392,078 *FFFEEBF59907D3C291B198466D90CFB76F062FE7 $34GILLY
2,422,392,079 *FFFC4F77E3DEB0DA0F5A8FB1BB9A3BE7DF7377B3 374elliot
2,422,392,080 *FFFCDC80F7585E212DCB834D194237A96F8989AF 3--b`~-;)
2,422,392,081 *FFF427D61349C49F35D51B278EE33279F6DBAFAD 3--)-*-*->-B0
2,422,392,082 *FFF7DA5C79D8D3FEF9483BD872F4A7B606443EDA [email protected]
2,422,392,083 *FFFBB02963BA50253E5B2BDE1C7FDFCCD46197F0 RELBMERT4
2,422,392,084 *FFFC310B2BCD5198136AFFBF47B19C65666407E2 renfriede
2,422,392,085 *FFFDFE81616571EF3A130DCA23F7814D8BE082D6 43R0$0L3T
2,422,392,086 *FFF73C3E0D7DE27FD0D2FD556F7783DC85D9F9EE REZONGLONES
2,422,392,087 *FFFD15B5BB4BA188DDDB6B549371924E9E49CEAE 4 AUFEINANDERTRAFEN
2,422,392,088 *FFF3DABA201501239EAC677292DC76534D578E28 richards
2,422,392,089 *FFFB02E4B5E130F9C84C0786A6B350D2AE1B26EF rickmathena
2,422,392,090 *FFF93E1C6F8BF979E0F1A60E7B1BA3E0FCEE7903 4 GLATTPOLIERTEN
2,422,392,091 *FFF5E81833FD426DD8D4D724C55A04453AD96B94 RICOPRIREISING
2,422,392,092 *FFF28D1B9E016693BFE3C69DDD716700704C3443 RIGOBERTOSCHARDT
2,422,392,093 *FFF399021247AB484D191D74504A9CD2934255A2 4IWAOIWAO
2,422,392,094 *FFFB5175C1D8AC4FB301158545007BB93210D707 RIPPER
2,422,392,095 *FFF318212E2658E5E49AC0BBFFD95F6F35E79B29 4NROTAKID
2,422,392,096 *FFF907C8BDCB752DBB22C702F44EEC1D49F8335C 4ORSTABLE
2,422,392,097 *FFF23EDA369D57A7BD934A7872382898C4A82A61 4PARFIBRABSW
2,422,392,098 *FFF57DAF31219A1790DA0CF74BD5A1C971205F32 ROBBYAHMADI
2,422,392,099 *FFF30F1B692DD9DB0831C6F678DFF35C0364D815 4.PROTZIGE
2,422,392,100 *FFF05D462E58B7E2103C6F813FF883301420A006 ROBERT_VAN_DE_GRAAFF
2,422,392,101 *FFF2BC209C0B021B44CC88BE4B566EF8BD966734 4RUTHAIRHEAD
2,422,392,102 *FFFE30A4C3348F95F73A9C17EE51AB286F527E70 ROBOLIVERIO
2,422,392,103 *FFFD41E39EEAA767C322F4986A0F16A993451ED0 ROCKYFGH1
2,422,392,104 *FFF284860CF01E46603461921E4E204097D2537C RODMANMADISON6
2,422,392,105 *FFFD517C9BA5562E4B8D9E98B7498839103A3A5C rogeliocorreiro
2,422,392,106 *FFFBB31C1FD8AA749AF5C574C196BBFE52F5472A ROMEYLO
2,422,392,107 *FFFC1CD8344E76630627ADE038E064F703212952 5ALLUNGARMI
2,422,392,108 *FFFE0778C9138C867AC1C3CA5025BD110396895E RONGGÉNG
2,422,392,109 *FFF3580972AF8B536430ECC8C1B786697F9C80FF rotating-prism
2,422,392,110 *FFF0D8CB4817540C4F5FE2965CA55B3861164A22 5IBUTEURS
2,422,392,111 *FFF4868DAF062EDA237206AB83D2E5F24002E2A1 5IGBOSOW
2,422,392,112 *FFFD56406D91D1465CAC9A104B45FF9F167107D3 5IOKUORON
2,422,392,113 *FFF580D500DC630B9ED10B5412E72EE2C8C236B8 5MONOCLONALES
2,422,392,114 *FFF7C785D0FDED30D8F82E932809E0489A381544 5MYTORNADO1
2,422,392,115 *FFF011B73F01032CAF523940A41A58268592A0F7 5SCALINGES
2,422,392,116 *FFF4E92E601D967D112E07E89CA9EF0D1654CB65 5THAT2KIDS1
2,422,392,117 *FFF9F8870743C7FC7C102AE65F6C2EB5DC216E3B 5TOPGUNHAMSTER
2,422,392,118 *FFF3A0CD287EC62A6252B3A498B650F56AF9BF51 5TY
2,422,392,119 *FFF0C8A28501844B67D367E75016854F68593960 SABOTAJING
2,422,392,120 *FFF9CE18BAF52380BFA02D2F41108EEEE9833048 SADASNJ
2,422,392,121 *FFFCD5F43406E0275143913B66C23FA1F9B30C89 6ALAYALAY
2,422,392,122 *FFFAA90FDA3C67CD08B81A1726FD36EB36E9F097 6april1096
2,422,392,123 *FFFB9FD271C0E3C691A2AD0C376E04A5EB9A6418 SALASSAPITOVE1
2,422,392,124 *FFFB1B2FBF6C7DEF5DE117AF17A8F72EB613539F [email protected]
2,422,392,125 *FFF6CF43C75935AFBBB43219852329D71B537FED SAMEOLME
2,422,392,126 *FFF68E235CE1FC1AC4E36F0FD4B44AEFA2C3A074 samtgemeindedirektoren
2,422,392,127 *FFF945A66B7BAD69F193DD50E08D507421F0A4BC 6MOKAARPS
2,422,392,128 *FFF7EBBFB228FE13DD775CE3A2FFFB47345DD309 sassynumber1
2,422,392,129 *FFFD127BC83DB02ED972C01D7F6A3E0BDE7A2A68 SCHNELKERING
2,422,392,130 *FFF60FDECF9F8E2A2602E51C0CE82BC431609B42 SCHNYDER1
2,422,392,131 *FFF5AA20204BCE29E8C17075311CB99BD4987FC4 SCHOOLMASTERH5
2,422,392,132 *FFF5DB5AD099A279CB36029A53374997991FD4F6 7011152
2,422,392,133 *FFF4A00774D15E6BEE54E71AB35AA3D526723DD2 7BSWBIBLIOTHEKSWESENBSW
2,422,392,134 *FFF4DAC0A387FB3930024F6139A3C0363C41BBAA 7CHERRYWINDSURF
2,422,392,135 *FFF4C073594633743AFA1FA35C77F3116BAC19F3 SEJRSCEREMONIEN
2,422,392,136 *FFFDF11814712D6FABA77895CDC12410A257205D SELDERIJBLAADJESES6
2,422,392,137 *FFF88A9EE608D90DB481D5BFCEC5872E3655D832 7DROSNOPS
2,422,392,138 *FFF7C4F2C966503252E366AA2B2BE95DDD448718 7EINSCHMEICHELNDES
2,422,392,139 *FFFEE8E02DB14F8A06FE9AA5D6146E3E26BD48C5 7EPHRAYIMS
2,422,392,140 *FFF36030839907003411EF724470D0C29AAC245A SEMMZ
2,422,392,141 *FFF4BA50875A993A9BBC7940062B31FE291911DA sequences for violin and piano: ii. con moto. espansivo
2,422,392,142 *FFFAED024AFFA8B89CCA690B4E904EDE7AFAD470 SERGEIDENISE3
2,422,392,143 *FFF672CFCA3E67982C4BF1F11AFF732EEC8E1BC0 SERMONWI7
2,422,392,144 *FFFB1D23CF29260EF4AA53697B54BF261731A9A1 7LIMERALIMERA
2,422,392,145 *FFFAFF0BCFE8E6403F40D0062E7FDEA8FE2B6019 shalonda-ham
2,422,392,146 *FFFCFBA94D3B37ED70EC0FBC0974A5093CF1E116 7LYNDELE
2,422,392,147 *FFFC92461B3DCDA0DA02B0CC0976F649D1C037E7 7MELISSAPUNKIN
2,422,392,148 *FFF068D241A1A8D14AE20B55BE54196B27E2FF0A [email protected]
2,422,392,149 *FFFDBEBDCFA975B2EAF0363700BA50E1B327C006 7OSCARANIMALS
2,422,392,150 *FFFF0D9B37700CD7C081F1A34FB5CD38629E4B14 SHELBYFURBLUR
2,422,392,151 *FFF5354013BE38AF727A8E7E0086475F4B8E7402 7SEQENCE
2,422,392,152 *FFF7B03A7B81250580BD27F176DAF22BE452EA70 823caitlin
2,422,392,153 *FFF20584CB2E76DE573E019CEA12EF7F43BB498D 8EVANOUIRONT
2,422,392,154 *FFF1C69D9E12D450650204789D97C1351C1902EC SIWCBVMW26
2,422,392,155 *FFF3FD5051441B4D4C6676AE204501463DDC9976 8-MOWERY
2,422,392,156 *FFFAEA940838534EB3517BF76661E9F228AEAFE1 8--P*-:p
2,422,392,157 *FFF69A44A049EEA74F4BB5C50C8A02EBE6ED1FDF 8SIALOGOGUE
2,422,392,158 *FFF152490D8231F9567539C95C6D128317FB3E3E Smokin'intheRain
2,422,392,159 *FFF5DA3C852B5ED98BAA11FB07450829244C741D 8thefiction0
2,422,392,160 *FFF38112DEFB270E091B4B41E77F80D37C24DB5A solnsol2
2,422,392,161 *FFF3E3BBEF581BF10C1B201AE393749928E600C2 southeasternmosts
2,422,392,162 *FFF67500EF2560647729EBC56772FD68D2D96021 spalatori
2,422,392,163 *FFFD2632043ED0DA7FD81114B631A1A28AC5B31B sploit~~~(b
2,422,392,164 *FFF12728F4B47C9011D361AEB06F563CDDF86975 [email protected]
2,422,392,165 *FFF59C24A99E6978D3B2110CCD22180103935873 9snippet
2,422,392,166 *FFF6210599260BFF62539E53EAF8FE84DFE74288 9ZETAMILC
2,422,392,167 *FFF3E08D3248682C37451D0BF3B4D27B28CD9B70 a2hxv
2,422,392,168 *FFF1AE812663A63A5C3F6114EEF0B100A710F691 A36WT
2,422,392,169 *FFF697717547148219C81C3002E5ACC9F8646A9E A5PD7
2,422,392,170 *FFFCDB113EA26D5C114C21E8F36C28761A522F5E a8cyy
2,422,392,171 *FFF8405479B9EBF61F3DA6A38F766FDEF884B134 a)a!:
2,422,392,172 *FFFDED78AF136DD46DD74AA0818E30C2BC32F1B0 STEVI COSTA
2,422,392,173 *FFFD80C7E9343B29A874FA0D87C0A358AEE91D0C AAD{DF
2,422,392,174 *FFF770953FA1F42E5B707F44DA17AAC51D00228C STOLDE?
2,422,392,175 *FFFA712295523B85DC652CB23A39BD4A20914114 stoofdening
2,422,392,176 *FFF1679945CEE4FF62E5F6A48BFB53C35D6F834A STREETCUBEBIRMINGHAMUNITEDKINGDOM
2,422,392,177 *FFF21ABE4FFC02F22BC885D9AD69F8536A960967 [email protected]
2,422,392,178 *FFFE85E3396490A0EDD55147A3BE8697B8EEB153 ŠTŠELJAJUR
2,422,392,179 *FFF7E2263409F6FFE6D398568F38C11C579A3921 abiliti9
2,422,392,180 *FFFFA0C585A0A795795ED068279211FEEC37B914 ACE-GRAHAM
2,422,392,181 *FFFFECFCCB3295FF4BAB9D4B8A863AAED48560F1 ach1n91y
2,422,392,182 *FFF65050C08D9B500B9F0FB45E9F468BF3C8EBC8 acig0
2,422,392,183 *FFFB0BC180307ED2F56C9A4AD576BD1740F11ABF SUMMARIED5
2,422,392,184 *FFF9AE57AB54D4D1E412D351AB804A2CC3E09250 [email protected]
2,422,392,185 *FFFD9BC02B88DC204C0B1278FB6A13C9998BEB75 ADB%>
2,422,392,186 *FFFD0C31C24B23D5A16CF944FC7EBAE338764451 SVIGERINN
2,422,392,187 *FFF3FAE0E7664E02C182E2427CBB386C68B9C65D adriansemple
2,422,392,188 *FFF1D24D604C97C079035E6A05DAA01FFD6B1BE4 ADSTOFFE3
2,422,392,189 *FFFC484BF1E80A9AAD1F30570DEE6DDF3D4B1E46 afs5i
2,422,392,190 *FFFDB0DB3D0BDB0CA973CBAEB7A0DD43B7691AB0 AGARRASSE1
2,422,392,191 *FFF0B45727806B4B6FA7B3F1BA182DBCA8BB29CB ah7fu
2,422,392,192 *FFF9D280096A907A6C6C013DD74033FFA6669290 aicq"
2,422,392,193 *FFF57C5DFDCC0A2EF3E96A8917781460D2149F3B taylor.sargent
2,422,392,194 *FFF648A0599DA48450B1ADEAD99D2464B9388929 TCKASSU
2,422,392,195 *FFF23F2F3445D2A5B73F53138F7E9C306EDBD26A Tcnboardl
2,422,392,196 *FFFBA43EA488E34F0AFB144103A3F0BAE1E692B7 ajeyf
2,422,392,197 *FFF610BFA908E66FE7C7542A9B66E30FB9EFAE68 teodorobengel
2,422,392,198 *FFFCEF17BC5F871D641FB81439F45B7DB35C1D45 A"KU
2,422,392,199 *FFF4415F51EE9116C8AE2D7388D5809E8CECE3B5 alairdship
2,422,392,200 *FFF5DE874BE06037593B25696EC27F32F62CF91D [email protected]
2,422,392,201 *FFF99FFD04630FF1976905456D459A370102B109 ALARMIST
2,422,392,202 *FFF77AE80C5288C63CD730120ACF3EBF7C48A21C ALPY=
2,422,392,203 *FFF7C6EFB960F3EE4050AFD105ED97D40459C6D4 AMAVIOS
2,422,392,204 *FFF605247CE2E393ECFB67CCE0B92AF9438FB6D6 thousandfold-a:
2,422,392,205 *FFFF552AD38C97355B8BD8C99FA8BD1621148625 THREEPEACESUITE
2,422,392,206 *FFF51719F0E1C6B755325BD0004739AE9A51F472 [email protected]
2,422,392,207 *FFFCA78CA6DCB0EBC817450C448906B1D9866AB9 ticements
2,422,392,208 *FFFD365BD4FEAEFEF8606AA1E47AA3AC7A6A91CF ANDREW.YEBOAH
2,422,392,209 *FFFCCA918F435B0531DA847C5D26D8125493C164 TIM.ROTHROCK
2,422,392,210 *FFFDC9C684835999F1A0610BD56EC149F4122BCA [email protected]
2,422,392,211 *FFF6943031FC53F7FADD72B7C912DBE1C019AF0E angel-short
2,422,392,212 *FFF7EB6D427CB5189CC04B64B8B77175B90801D5 ANGIEARCHIE
2,422,392,213 *FFFF2CAD65592C3E6892EE38A72D3CDB005DE25F [email protected]
2,422,392,214 *FFFFC9045395426AFE44B467B15F3776186CD0E9 TOORRAIRB8
2,422,392,215 *FFF3936F2FE1A3DC3770BCF8ED5F03EEFD9E773D antennenw
2,422,392,216 *FFF0D5A7F0670987C6E8818C2E0DC79D515F469A TRALINEATES
2,422,392,217 *FFFF5D80DDA1F27CDD6E301ACD00F1513BDC8A9A TRISHA CHISEFSKY
2,422,392,218 *FFF59EC4B7FE4A2F02B06AFF36545EDFEFDF3833 TRUMANSTOFFEL
2,422,392,219 *FFF38220C3EFE090797A420DE4E4B711128B9913 [email protected]
2,422,392,220 *FFFDBAE68144DDD2F011A62FB4C093055493231D TSUKI-CLEOFE
2,422,392,221 *FFF4C1BA26A1D3C1DAF065AC973A4C87CFC3E33D TSUSIM43NSIS
2,422,392,222 *FFFB66123A8CDF2200522E6B1D250337F590B1C6 ARLENMABONE
2,422,392,223 *FFFFA1F66A32A404551939A7DD3B66334DD6ED7D ARMAND.FEIGEL
2,422,392,224 *FFF9608DDCE699718A621047D2309B3EDF325FEB tubrojevići
2,422,392,225 *FFF67ABCD47DC3095151C52A8F9F9EFA5049DB90 arnulfoserey
2,422,392,226 *FFF32A04FBF935FC97F0224049FC1565168D77E4 ARRIDING
2,422,392,227 *FFF86BE48A80EDCE26B2284927ED297B90AF827B ashleyduceman
2,422,392,228 *FFFB56610C84F9BCC71B0EC5481D460F52636F40 ashley.novo
2,422,392,229 *FFF410E5B50953E0109EAA61533E6F2B1F3973FC a:t)
2,422,392,230 *FFFE6D5F90739FDEE71B2DE5F0EA43A13AC84A13 AtW_
2,422,392,231 *FFF51B0C014126FB5820425AACFCCEDF01AD2B6E AUSTIN.MCCAMMACK
2,422,392,232 *FFF4CA3E4FC43506597FC8AC4045DB8928C99F4C Ũ
2,422,392,233 *FFF64C46C54228252EB2BADD43C892F7445FF1CA awarieth7
2,422,392,234 *FFF43F4F08E5F273413C36D00D64F07B423CEC29 AY8VU
2,422,392,235 *FFF72CF90049E0667174B0CA2A44F121272F6BB7 [email protected]
2,422,392,236 *FFFE5CA6A0817EE8246A53A9B71EAF4FCAC92ABD UNCLOSABLE.
2,422,392,237 *FFF8EF150CE88F020A7B4A0F08A9308F703F1F30 B&1OG
2,422,392,238 *FFF1ADC0B8CCC39CA5DAECC5F21DECE8E9EB529F B8#4G
2,422,392,239 *FFFFACE7711BCFA0556179CD6E7044109BCB70CD user72177190208
2,422,392,240 *FFFBEA5CF994594D25281555F0C8F598C24B6AF0 BARBARA KURTZ
2,422,392,241 *FFF52587879A07509D8AF0B3BD98681ECE0F9BD1 BARRYSCHNATHORST
2,422,392,242 *FFFFD8FEF5EB079B11DD44E65CE16AADB2584D5A B&A.U
2,422,392,243 *FFFCA7C560BA4E76B28DA5B6677381B5ED4973BE V1R1L1ZL4
2,422,392,244 *FFFE10D94AE764444B618A6DB1475D3F90F8A57C VAL.DENARO
2,422,392,245 *FFF6355F7D7B76AE804F30208E1C1EFC9CC1B7CB B&E1D
2,422,392,246 *FFFF3AAD6E0B061FA92758D9A31A3ABAE2B68725 BERT.SWEETLAND
2,422,392,247 *FFF3DEB17ADD4C0D84CA60BDB195F40D7BE9A99A BESPAZ
2,422,392,248 *FFF27CAB468F93E75828BB67001F40D55C1C74C8 VERNEPLIKTIG7
2,422,392,249 *FFFE1AC7F817088055FFC3D85EFE409FC05C4915 vernice7
2,422,392,250 *FFFAD7A50305E3C8D82631E74DFACC8EC7867C8C verschroeiende
2,422,392,251 *FFF67BB68442C344E38FAAD6B610576433BF8555 BGSAI
2,422,392,252 *FFFDB54BB474FEE13FB8136CE90AA6D5836866D8 VINCENT RAY GOGH
2,422,392,253 *FFF39029DB8E5AE1C4F14FF252B2587DF1C9386F VINOD-DHASKE
2,422,392,254 *FFFBFA5FB630072DC3167D811F1EF22D2C6A3680 bkg;$
2,422,392,255 *FFF56378B314F62F2CDA324BBBCEF6BB41BB7949 [email protected]
2,422,392,256 *FFF9CB5F5332FDBFCA7D6705B1075BCF7E0C2ADD VLADO WALLY STANJO
2,422,392,257 *FFFAC6985CDC640243F884EAC6EA450484156EE1 [email protected]
2,422,392,258 *FFF9AF681C40565987D0F6A1FC2EC7647BF0C926 BLISSAIT0
2,422,392,259 *FFF1950DD9893E9E3201032B568D4A7C22CB1331 V*OA
2,422,392,260 *FFF1FC40EA4B33CD7C93DE5BACD5AE259560250C blvq
2,422,392,261 *FFF17BE68075EFB7684D4574FF9BFDD75D011592 [email protected]
2,422,392,262 *FFFBDE61E4ED173222A08BC0403C80AAE8EBFE58 VPBYBW
2,422,392,263 *FFF2AF644992C45245A1FCA889CA509B0277DE3B bmd5g
2,422,392,264 *FFFD10C0D9D175F136735B60B0EF60AC6BB8ED75 BOSS MTJ
2,422,392,265 *FFFC91CF04483CDD813C0D02F7947F7D86E4BC60 BOYCE.ELLIAM
2,422,392,266 *FFFE72102D3E92933919B2252BDE76D1C35675AF boychik7
2,422,392,267 *FFFC60BFEE62FEB2A76CB54DC28D2F220D341479 WARDICA BEAR
2,422,392,268 *FFF64058F6A453D5BC398FDD2AB4BFAAC9A233C6 bpk5
2,422,392,269 *FFFE21CB12C4FB30447B407421580C54719CE439 warnerurquilla
2,422,392,270 *FFFFB79DEEAB74076E97A239504F4B9C8AD175AE bpp9l
2,422,392,271 *FFFE8E298FF18FC48D479A5B147C298F693297A0 bradleedom
2,422,392,272 *FFF78B41CAD5B6A92A64BBBF3A666966B0F4FD09 week28
2,422,392,273 *FFF98DF67F6F388805BBF3DBD0094159543990DA WEIGH2007
2,422,392,274 *FFFC992C4F23E29A01586358AA8317DD6464378D [email protected]
2,422,392,275 *FFFFE4650E87E15A5341881B5B899E699B365889 BRANTDENO
2,422,392,276 *FFF3FB6DCCD67A9FB6C4A42D209B6E6BB8F73DED BRENDONLANDAVAZO
2,422,392,277 *FFF3C434560808263AE053751790E7B1FD53A9EE BRENTON.SOBERANIS
2,422,392,278 *FFFDE7FE07E7055F4441E7E631C3271E4AFD17A5 WENIS-DIEGO
2,422,392,279 *FFF8EE27B3ACFC480A3799DF81F8057C8D41CA36 WENN.DIE.LIEBE.AMEN.SAGT
2,422,392,280 *FFFCEE9434F5192AEA59E1715F6450BE072E941C weylen
2,422,392,281 *FFF3D4C2F29349149C0887E83D709D0EA257A169 whirlwindsoftempestuousfire
2,422,392,282 *FFFEF2E792931A60FF676FD99CC1932FD7F9AF37 whjd
2,422,392,283 *FFFE10C3C78197E9C5569714A91574B326A2445E [email protected]
2,422,392,284 *FFFD970DC63DBD9083FCAA0286CC21B787A462A1 widemutbauer
2,422,392,285 *FFF8AAD8642F5EC78A96DBBAD00D628728C6FCF4 BS,,E
2,422,392,286 *FFFCD870BC12559E487ECF1E0DC17AAD9CBA06FE bswbrockmeyer
2,422,392,287 *FFFBDE5749FAF26AAE6DA357B03C1ED54539F28A BSWSARAZINBSW
2,422,392,288 *FFF722BCA275C4D077A9C98B45565F69F16FBA2E B.#TO
2,422,392,289 *FFF9C64F71027ACAD389AF5228E16747F74A88FA BUBBAADG3
2,422,392,290 *FFF8781BE3F5C6EB967BADD9BA595A8CE9A65237 BU=S
2,422,392,291 *FFF070CA9AA4C431EA055F433735FC0473AD0A13 b-y2-
2,422,392,292 *FFF03297FFE42EEB6D64DBE893931ECDC4AAC59B by:wk
2,422,392,293 *FFF3036FA22EA9C0C26908EF04EC9D4648D972B9 c4_"!
2,422,392,294 *FFF19959D8521AE2D71BD398E56FBB1B28D0BF4B c4dw6
2,422,392,295 *FFFF7754CF9D0C95BAE677DFBB02E7AFA7670D5F WNIZAN
2,422,392,296 *FFF3E0703950AC337E485EAD8BAE357AA4E73157 C8CDFB2EC6423D3A84FA9844D0785E67
2,422,392,297 *FFF05DBD0B051EC1074F950509BAB4DF10DA4912 WorkingintheCoalMine
2,422,392,298 *FFF9B283F42D8991645684F38B2586B48BD8573A camarog4
2,422,392,299 *FFF9669F31C310BF8ED3DC846DF0F85C339883CE [email protected]
2,422,392,300 *FFF0803BB363AFCD61E8B5F58E3AB69A93758F31 [email protected]
2,422,392,301 *FFFB6BEA15A1C3552BBDC16FC89353A20FEA1B88 [email protected]
2,422,392,302 *FFF2984BA3ADF886D916F92816E66D8EF05CBFA1 capriccio in b-flat major, bwv 992: vi. fuga
2,422,392,303 *FFF97D03753708134C4F21F2F772B112CBBFC48A WWWTHE-GIFT-OF-REVELATIONCOM
2,422,392,304 *FFFB5F00A778DF49478AB88453A2A3983B57898B CAROLINA HOYOS
2,422,392,305 *FFF023C5A6D14F958A87C05BC8F58F2BDEC876CB x=3h
2,422,392,306 *FFF7FF08267322E16AB21761E11A1EA0BC89D651 (X).*D###8
2,422,392,307 *FFF90D40A1862C3A8239A62E21FF16993F9BDC1D [email protected]
2,422,392,308 *FFF6861ABBF6AD9BED9336F6835AE634FAEFF867 caseyjame
2,422,392,309 *FFF2A81C391AA3323B2BF43B2C3139909F574073 XÍFIES
2,422,392,310 *FFF363E7E621DA21A5696BE51E1C0F2DB248BC78 xio.meow.mi.gigi
2,422,392,311 *FFFD497ADECC20E9D88C053AE45A4BF0D2602F7E cav+i
2,422,392,312 *FFF5602580F01176C6DB0BD29B473CD00F3BFC0B CBG:T
2,422,392,313 *FFF7E89A61000109CD0AC7A0DBC1475F76F5F756 YAMIRISLSANABRIA
2,422,392,314 *FFFA14715812B75BF8249A41ACF72EC2EE78BDD3 CDYBF
2,422,392,315 *FFF884C85EFB60698F923FF38218B00F4D9E5443 [email protected]
2,422,392,316 *FFFDCFDE6D57D2733E482B2982524C8866113A20 CERNOHOUZOVA
2,422,392,317 *FFF79A138BB0EB3834B3A01B69DD723E9061DDDD cf$(
2,422,392,318 *FFFD9A42F5B3FAB94E54CA11B3B5C112306DB814 cfur+
2,422,392,319 *FFFFA80877732DDAA05FAC1B39F2E0DD40C66808 CGEMOOMA
2,422,392,320 *FFF4CB4E895D71AF75505ECCF61FE6EC45FA5C14 CGFN;
2,422,392,321 *FFF917569B4BA3E1E8A9AC716313397006BC131F chango19
2,422,392,322 *FFF1920FD9AA48FF6187D42794D9E9A6B36F2488 CHANGWAN-KIM
2,422,392,323 *FFF686E6860D62C33CDC0065615DB1B04CA3E66C YUNGSPIFFY
2,422,392,324 *FFF5A708A9B2B9B0AF9CCD63F9FC52033105DA9F ZAHRANMARIKAR
2,422,392,325 *FFF7F78AF5268889753EA09A47EBA85AEFD546D4 chemo$7er!14n7$
2,422,392,326 *FFF91CBB4A6331C28B31D4F6F9F6E70A530A731F [email protected]
2,422,392,327 *FFF48E54C421D6AD05A0A18056E702DEC55510D8 cheryl-siple
2,422,392,328 *FFFE4AABBA155BAE16DF9E5258E1B09A23148CE9 CHET.RUNDLETT
2,422,392,329 *FFF5DB9AAC280F6A75793649CE78D696C1FC88F9 CHLIIBETRIIB
2,422,392,330 *FFFE8471E735509A6D1972D3812433D976E3FFA1 [email protected]
2,422,392,331 *FFFF660AD5B4C297FDB67E902C5E8637640E9CE0 zmnlswted
2,422,392,332 *FFFE5F64327AAC803547833465A05D3DDF9337AF cicpo
2,422,392,333 *FFFD87A4432538C12F38A1F3BD274C8C85501C18 ЗВОНКУ»
2,422,392,334 *FFF43945282D23E8F878D7147EBA6E60C2C0AC55 CKQ,?
2,422,392,335 *FFFB810862F3855DFAC7E8145B76280CBE1E34F4 CLARIAS-STAPPERSII
2,422,392,336 *FFFC10BCAFC483F4410625781CBAC3F429F00F99 CLAUDE.MIKLOS
2,422,392,337 *FFF29B85250F4CA91454CE6EBB2DEB8AF032CF0A КОМАРСКАЯ
2,422,392,338 *FFFE814A597F57A6CA6B641450423D65A87E7A38 минчик
2,422,392,339 *FFF742FA51046277DA8891624453CAE9FBACC682 НЬОЛДНЕР
2,422,392,340 *FFF089C6FA586EF3BA0A69A322C673124D5C3AEA ПШЕСТИЦ
2,422,392,341 *FFF5FC3C3F47098B2A7390AC9865358E24182E94 c:nod
2,422,392,342 *FFFE651751B558CF974F3EC3F13D0749FD9187F4 COLBYPAILTHORPE
2,422,392,343 *FFF07E7A7DCFD263D40B48A74BA0D1C4BACBD1D6 COLBYSAUREL
2,422,392,344 *FFF7793C6AF89DDA861CBB16C742A835D11511DD COLDITZS7
2,422,392,345 *FFFDDC597BA28C3F68DF93D911822F5478CAC14F ШАТКУЮ
2,422,392,346 *FFF3234615C95889029E605724E6EF18382B614B COMPS.LA.GRAND.VILLE
2,422,392,347 *FFF5681F02A85FDBC0CD4334A2D1C5B211A30AA5 concubinage-k/A/n'k/j//u/b/@/n/I//dZ/
2,422,392,348 *FFF62285257345AE864ABE1A7F641E51E2F09684 condupli2
2,422,392,349 *FFF77632D7E9965A6E531CF8C008A518D4295ABF CORYSATCHER
2,422,392,350 *FFF9D25DAB18D119DA89AE3A2B6E66C3059BEC56 市(FREIBURG) 
2,422,392,351 *FFF9C9D714CEE238DBABCD0527C31A75F3B0AE3B CUO3
2,422,392,352 *FFF712EAA6FF1EDF03228A819D6C0A08E7BF45EB Cyans
2,422,392,353 *FFF4BE43995704D4D13E2FCCED1AACD45AD00B9A d1$v+
2,422,392,354 *FFF96D54C835CD12C14F1EAB460C77FCD534BB84 >-<~~D--3
2,422,392,355 *FFFD7A5B22153E12F2FC6CADB3ABBF6C00F62288 d8g&
2,422,392,356 *FFFDA15B9B613A3773F977C85EF7704ACFB63373 DANEBENZIELENDE
2,422,392,357 *FFFE792823AC7D5CB9EAD3DFDC680269B0876BA5 0$IANDRIA
2,422,392,358 *FFF0BE3F4ED969F24A4137FF7FE4A22814F3383A DANILO.MIXSON
2,422,392,359 *FFF76B67B4EBF064392E9332FAF0A70F9D1B3FB5 dannyniking
2,422,392,360 *FFFE8FE37839ADD0E930A5F6CCB73C01AD6FF434 darenuliano
2,422,392,361 *FFFB0C134FC4D965C5736CF2A60D63A12559BFF4 DARINYAFFE
2,422,392,362 *FFFAA0673CC8D6B2C15EE2B7859FE71A6333E9D9 DAS.OMEN.(TEIL.1).('94.TN'T.RADIO.EDIT)
2,422,392,363 *FFF341DA927FCCFEE52B9609B5BBAB402E07CDB1 12.25.1034
2,422,392,364 *FFF292F8DDACAD883D37305B77E743F1CD727FC1 dbem!
2,422,392,365 *FFFCB91C332B11E922865AAC11DD86F3B4CEBE09 1492637 egyptiin-emme-sinua-kustanna-,-vaikka-siell
2,422,392,366 *FFF72A34DA30F06E0FEA342EB9C24FC837F89FB7 150163 ENNEN.T
2,422,392,367 *FFF4A2A298BFD0C6EA062BD9CF806328111231B7 1549504 sivuston tekij
2,422,392,368 *FFF49A2D58C00A3FC2BC9BEE23B249777E20D0F3 dd(jl
2,422,392,369 *FFF8232388B754F474A06AF46B1F3FA03004B016 18oct1958
2,422,392,370 *FFF4F14759A8A37644781DBD42AE6DA022A8233B [email protected]
2,422,392,371 *FFF638D125EC0F892A5087CC1C038D77E8A14752 [email protected]
2,422,392,372 *FFF841B503DDDC61DC2F7C472D62086F77E913E3 1964335 t
2,422,392,373 *FFF7D4603408781F31FCC2F19484A3A3B857BF34 DENISLEITH
2,422,392,374 *FFF7CAB52D868277725E3A7D766206AE0884B306 DER-ORANGENDIEB
2,422,392,375 *FFF7CDB621B99E784992DBBCE7DFB2DC3EAF242D DEWAYNECO
2,422,392,376 *FFF9ADE969590E8DBDCE7378F6DE0728E646BB9A dexiesdexies
2,422,392,377 *FFFA0F7A8952FFC4F155A2C72A135879DACE0677 1 ANTIPALAESTINASAULUS
2,422,392,378 *FFF44CD3285197127924085D9D532350C64EF009 diekatastrophe
2,422,392,379 *FFFA0C9FE00E58B56C730425E58DF5A780E8B5E5 1 CAFEDIRECT
2,422,392,380 *FFF8617A6C5FAB003C8B2EFBBC87C502791D9998 1-CIGOR
2,422,392,381 *FFFD76C4C17990E120ED9F0C8B75562EAE1278FF dinne
2,422,392,382 *FFFA53ADDCDDE7BC450375DE1C95BB0C407FCFBF DJÊVLÈDJE
2,422,392,383 *FFFD4B3598B213F5CDEAEB6140DB5FB3653FFC37 1DISCOUNTTICKET
2,422,392,384 *FFFD1DF3C2B05AD71444A2CA025849CFB4A69284 d,kl%
2,422,392,385 *FFF49B4FFFCF0CAAAD25B4E520180A4EE116C70F DLEWEGMRING
2,422,392,386 *FFF68B419DA61A9BD43FCD4D25EFDEF08B9C073E DLP=$
2,422,392,387 *FFF3EE85C455E699895C307365798A1734995C72 DLU-K
2,422,392,388 *FFF9B09496AE61C4B07386DB1CB57B5A12193939 1.KAHLGESCHORENES
2,422,392,389 *FFF979462897820AE2913AF44EB1DF93BFA83A6B 1.keksint
2,422,392,390 *FFF708C3BDA09DF872BA956A0A3DE4C2DAC73CB2 [email protected]
2,422,392,391 *FFF194EA7BFBCEF281EACA6E9A425DD9546A200F 1MARCELOO
2,422,392,392 *FFF7620DEA1FEA157EE0B70A249CFA7998BC6BD9 dob_u
2,422,392,393 *FFF7F4F536F698F5F67B01C162FFC401B9C892F9 1 NACHTBUSFAHRGAESTE
2,422,392,394 *FFF758801956D562194B4363355BA6834575A880 donderjaagt0
2,422,392,395 *FFFC73089AE50D9F6E17B527923EFF106FCDF1E6 1pumping
2,422,392,396 *FFF21F6CABFACA3B8FDF9CFD9F589EA801CB34B1 1 RESTAURANT-BESUCHEN
2,422,392,397 *FFF0FB2B5525A1F698D0A65185085CD3B0218D92 1ROE-PRAISED
2,422,392,398 *FFF5DB81A7AF01B8D6DA8157554E3790DEC2904A DP1L1
2,422,392,399 *FFFF31226451D63664B218E3D085B9BC98396B0C D)pN
2,422,392,400 *FFFC40B2A2421993E2763C55886AB79F06BA82E3 d(qu7
2,422,392,401 *FFF1FD8FA97AB36164128A8189EB4DB79CE4FF8F 1YARALIYDIK
2,422,392,402 *FFF197E46CDB1D2A589D2368E937D42B741F62B2 1 ZWOELFER-KOMMISSION
2,422,392,403 *FFF003BCD6BC621EBBDC7769AFEE48328C9AA530 D,RI3
2,422,392,404 *FFF93B52FED6C452AD4212CD33CECB3C1484EE2E D"Rw
2,422,392,405 *FFFC037B2E0B6E764E06BEDB645ECCABBE726363 DTJQ?
2,422,392,406 *FFFC6873145CAA99672A3DA516203B53DDED6E27 DUNCAN.GAUCIN
2,422,392,407 *FFF8C31B2E551DDC533019D763AC189A38760F2A duncangnagey
2,422,392,408 *FFF4FFE75C88C7E8CB237A3E5F566AE473D3E847 2:--2---#---&---unchain
2,422,392,409 *FFFA12B2B862375D77C44C323BEE7D7EC3A06A60 2382184 mutta.punasiirtym
2,422,392,410 *FFF591E2C7E23721EE8C80FA269AECF23D46158B 23.acti,sceneiinorma!de'tuoirimproveri(pollione)
2,422,392,411 *FFF674D3482E78729EE5A4969B93D57B9E6B31BC DUSTY.GAWRON
2,422,392,412 *FFF37F703B80679DFC7D674623EFC974DD73FC7D 2547027 beides.zu.der.zeit.,.kampfzonen..
2,422,392,413 *FFFE7918C65CB4A59F92E79FA2DBC1F159DE8B23 2557074 koko-j
2,422,392,414 *FFFD2D3FBC6D03D65C517A8DEBF5ACFC20C92F24 260GIDEON
2,422,392,415 *FFF2F4A5D38A39CB14D25FE39FB4DADC7E8A0BB1 dvz/m
2,422,392,416 *FFF374897992A0605102774518109C057845B975 DYLANCABANAS
2,422,392,417 *FFFBC0AE5B0B8A8D20CC2C302198342720376EF5 dylan.earnest
2,422,392,418 *FFFA38394E0C08E4E7B1F8050E57383AC4458F69 2921140 esimerkiksi : saatu induktanssin lauseke ennustaa , ett
2,422,392,419 *FFF051C76F157806B02E7A3A6E1D38FF31041A86 DZ)BE
2,422,392,420 *FFFD26A737CAD480F7846100CAE6522AC4CA42E2 DZKVG
2,422,392,421 *FFF034AD8C62032B066248B772695F4648057B96 2-AVUSTUSER
2,422,392,422 *FFF9F695871E52232D063F45463FCE3F311927F2 earlvoelkel
2,422,392,423 *FFFEAA34B7926D17D4DCDCF46B5B9F0B1434857A ecuot
2,422,392,424 *FFFC19AE14E4503700B897CA72B65037F7229E12 2ISLEKLIK
2,422,392,425 *FFF0A41E33B5D525A4CB2686E8DA8ECB10E0BDAE edgarpanzella
2,422,392,426 *FFF6D4F7A5921D76F96E4D4E9AFD24F5A97083B3 2 KOMEDIOITAAN
2,422,392,427 *FFF419D3ADFAD83A0105C356FD1D6C250C52FFD3 EDVARDGRIEGSONATA3CMINOR:
2,422,392,428 *FFF4534557FB3FAA721E5DAB6240B2F4878A8D88 EFRENCORCORAN
2,422,392,429 *FFF5DE080D1B0C9A770D0207B436D34D33043485 2.VERMARKTUNGSAKTIVITAETEN
2,422,392,430 *FFFA8E381117A62A97DAE2B85BE16248E63552A6 2.WAHLPRAEFERENZEN
2,422,392,431 *FFF97467006273C88E807F70228058A40F235B03 EGQEBSW4
2,422,392,432 *FFFB9219B017AAF4856A07031F1E5B4C859D5196 ehkk&
2,422,392,433 *FFFF1C527DE7E774889403C69A9BA8A7DA5012FD 373058 HER-MASON-DIGERLERININ-KARDESIDIR-.
2,422,392,434 *FFF75CFC2A373B8E3A8BFFE90327F2EF6551BD14 379NOEMI
2,422,392,435 *FFF920F08960BC908E7A00E9646F6564F0162B4F EK.C%
2,422,392,436 *FFF4376BE3391176FD1E43ADB569FA7BA80DA098 47-hautausmaa
2,422,392,437 *FFF04654E25B1AC036F47D55258E8AB4621A5E39 4815NOLI
2,422,392,438 *FFF17D846355C0805DE44E962AB63BB2FE0671FA ELIASCRISMOND
2,422,392,439 *FFF56AD38166E2C04C52D4FB8B9C4D8AB0CFC22E 49462 olen.siis.t
2,422,392,440 *FFF5A989160D7F85CEB0A015EB30D953B24B41EF 4AEDNALER
2,422,392,441 *FFF725681F2A930A3E2C567564E25CA1CC19C116 elijahwillenbrock
2,422,392,442 *FFF0A005328BE4C9B6A7D1118BA472E7F5F7B529 eliud10
2,422,392,443 *FFF16E1EAA5EA9E1407026A5EE3F683CFE16AEE0 4CITSENMA
2,422,392,444 *FFF68D8B1CC2D8075C53B7EA29CDC891A6D79771 4ILOVELIFE6
2,422,392,445 *FFF109E77A88B27243536945F0DE11FE3364FBA6 EMALCERD9
2,422,392,446 *FFF6A472225F1A073874C522691DBA30BB279291 emergencypractice
2,422,392,447 *FFFF43A8E9A8EFDACCE88511E9FAE11F3B45F644 4UAVISOUV
2,422,392,448 *FFFB5DFA7073F7B2D47C533984E959EB7359B78A 4XXXXPRINCE
2,422,392,449 *FFF73977DF39DE5842CB0F3CBAB300556348C648 5BSWIQPRODBSW
2,422,392,450 *FFFF9C4B8EBE7C64B180E0762376DCD98DED28DD ENX=
2,422,392,451 *FFF2C13C6A827CAFEAE932EDA75E54B99F9E71E7 EPSHI
2,422,392,452 *FFFBC5F15F463729387D5F93AEC645791AE3C444 ERICK.ALO
2,422,392,453 *FFFCCBDCC683C463E38EE13DA370305FFEAEB970 erinopielski
2,422,392,454 *FFFDA59065A946145282B3DF6BD2407834BBE1F5 5MPTERENT
2,422,392,455 *FFFF57358FA882B3E7372DFF4F4008C4C254A2E7 5NEVYMENENI
2,422,392,456 *FFFD3509E23DFCA49A16F351D4AEA4F49A1052CA esbdz
2,422,392,457 *FFF9881665AADC4C995535A7CD5A6EF5DED165E0 ET%FA
2,422,392,458 *FFF599BE1D45C770B0827CA6FB99A189215D2B19 ETROOBEG4
2,422,392,459 *FFF87AE5CA1FC13F7CE8473FCBFEC1617DE6542D [email protected]
2,422,392,460 *FFF53381C85F8CD88AAE4902F690079267D61A97 EVERETTE.KILDAY
2,422,392,461 *FFFE280B9AA587D8BCA76C1ED5DC25F6E96D05F5 5TY
2,422,392,462 *FFF9CD3BAB89CB3FEA9C8767F5AFC3A878804231 617KAMERON
2,422,392,463 *FFF08BA3441C6D3C43E912D3764364F38F96DCEE FADEBUR2
2,422,392,464 *FFFA5C9ABF022FBB66D83C74347EF365101161C6 6CAUBETA
2,422,392,465 *FFF93172671CE53D08EE06DC2AF5B809D1104CFC 6GENESISWARRIORS
2,422,392,466 *FFFD2DD7241278AB206966AF539A5E92D1E8859E farmed-off
2,422,392,467 *FFF0704BBA9C0092D8B3E18B566E0EC94F788DA1 federicoeaglin
2,422,392,468 *FFF26F3FCFA743DF10A6298E3C7753D24BBACAE1 6NAVANIG
2,422,392,469 *FFF32C1E1955EA8BCFCF3F30A71536FBCEA0140E FELCHLE9
2,422,392,470 *FFF45CE2C1A2D3A55C19E914A7C07295FDD79832 6OMENTAS
2,422,392,471 *FFFEC2FD79B9AFC4A89C5EA8134BBE65B98EBABB feltoncuffari
2,422,392,472 *FFF96D764297915C6B6FBBFB730DB9D6E3AB448E FEMEI,FEMEI(RADIOEDIT)
2,422,392,473 *FFF8E3750BF45B6AE6594140FEC1CCA7E696C9AD FERMINWOHLWENDI
2,422,392,474 *FFF4854C89D52FE98438977629B2E9CC9D1E1044 6REGILEOVEG
2,422,392,475 *FFF0E371CE98451FCB384B4498F92D2476F4771F [email protected]
2,422,392,476 *FFF8B484AF72976DB67FBCA72E26B91BF7B2A058 f^[g
2,422,392,477 *FFFA2B71D349E24048B5A533366607411D6F0A42 FILTER ROKOK
2,422,392,478 *FFFDB2017A297404D0E199E3CE52E7EB57CEF1A9 6WESTCHNELA
2,422,392,479 *FFF28B6BA9977BF23B9B8D434F1870520C63A398 FISHHEAD24
2,422,392,480 *FFFDB8216590FBD2F2BFC94B6880BDB92EA00D40 FLAXERZ
2,422,392,481 *FFF22C6F2E86CCDB49CD448DEAC293B373C428EE 737145 closing.is.expected.in.july..
2,422,392,482 *FFF650F6F8F3682A084D72F8E069B796C62DC766 FLTPRTJN7
2,422,392,483 *FFF74EEBA62CBB0EA3E410A4CB6E362EA725DE47 fooproof7
2,422,392,484 *FFF1180B20B609832A7A02FFA96E7C9D83A188BB 7BRIDGESZEBRA
2,422,392,485 *FFF4430C5DC7976322CE96F5FD2311A87DB92D46 7C4664C5-D173-3AFE-AF3E-FF415BD6ABDD
2,422,392,486 *FFF1F0AB6DA4E5559274F81616A04EF6339B096F 7EYDEEYDE
2,422,392,487 *FFFA9D42EEFFEAEBC7E305D384F334E5BA8463A3 7HUMERUSN
2,422,392,488 *FFFF86A1CD192DF70259688A5DBD518FB1B90B2F 7ILUVGERMANY11
2,422,392,489 *FFFA2DF9E893232DAF66657789E9A7A499C2254C 7KAUPUNKILAISVAEESTOE
2,422,392,490 *FFFDB1C73793549366340DD81E9753FBD3DA6EB4 forestlinebarger
2,422,392,491 *FFF16E283C3E25FAEA86D11F32126E5B99F4ED3C 7PALAEOTHALAMUS
2,422,392,492 *FFF603FD664A523205FF6CF54F7FCF3F353F5712 7WARMEM
2,422,392,493 *FFF5A7C16F548DA3B8633A74D40414A100EC209B 813066 projekti-vied
2,422,392,494 *FFF10A260DDA3B465F276BEB3015E8D88D54ADBE FREDDIEMULRYAN
2,422,392,495 *FFF90285804892277957B9293F916FDBD3E598B8 FREDDY.BREWBAKER
2,422,392,496 *FFFB00FB0F252CD306042FE019386F8C9E165264 8ARENICUC
2,422,392,497 *FFFA7BB59042E02BA48C89EF716F3A7FCBE54E39 8arre11ng
2,422,392,498 *FFF5DB71C8F31ED6FEE49DEFDFF3545C089E9EE8 8CTLLTPTL
2,422,392,499 *FFF00283E235D84F767855BA7471B684B62F822F 8DANCECRUISE
2,422,392,500 *FFFE680B8CCB859C2966AD46FFDF57710CD6FF0B FTURFDEN8
2,422,392,501 *FFF5D37EAEC2B1BDBAB61CE1AA5A3A49315E5FE8 FUNCASIO3
2,422,392,502 *FFF564995AF824E0151CEEE26893516B3604198A g3n3a10gst
2,422,392,503 *FFF3981CE23F5511744A770E28DCC8497F4F230F GABRIELWIKI
2,422,392,504 *FFFF0D6E647A2F46699CA340BBC3D82B10146E09 8IAMPIONEER8
2,422,392,505 *FFF84B2DDBA51D4DF5219B952DD71C30FFAF96EF garlandmoratto
2,422,392,506 *FFF623B58C7EA488DDB89CD6364831FD63253B54 GASPAR RAMOS
2,422,392,507 *FFF96DEB395B0C60C476A8F1F149DA8E9314BF77 GASTON.DIBENEDETTO
2,422,392,508 *FFF229C28EC908B66C0737B762F5A3FF0B1901C9 GAZANEHKESH
2,422,392,509 *FFF20CEA4E908700D9C82A2DF59F775BD12FA245 GEONEX1
2,422,392,510 *FFF1272B3957955D99DD341655E0F4182DD326D5 GEORGEHORSMAN
2,422,392,511 *FFF068B1632A09D6AC237044AE5DE6B874AE4781 GESAAIDE4
2,422,392,512 *FFF3C5D9EE984D7C249523CC6464E4D0A911931A 8VENEESE
2,422,392,513 *FFF58FEE6E40E0109AE28A2EBC40CA48C5F55C90 8WARMSHEL
2,422,392,514 *FFF20AD483F404E1BBB4A8C0A4FF72D3EEF1B417 GLORIASCHLOSSER
2,422,392,515 *FFF232F2780BC93CC66C89BA375349DA13B1DE26 [email protected]
2,422,392,516 *FFF13EFEF06B69967B8D9B9EBAB858ED57CDF992 [email protected]
2,422,392,517 *FFFDD6690458B61601817A2A3E6ED60FE2397569 [email protected]
2,422,392,518 *FFF874A893E3E1B7870E5ABF0901E9EDA84FEE8F 9DISPICIO
2,422,392,519 *FFF5CE28D22B6659A038D3EF82AD677B22D2C09B 9GRIFFEYCOOPER
2,422,392,520 *FFF3286849F25823EA44E41D37E9D17B63A5D589 GRAIG.PINEDO
2,422,392,521 *FFF38A6DE792E8002F56E9027D09A69F0D3493C5 GRENA
2,422,392,522 *FFF333F8340E0D29B67DA82ECA2031BE270DCDD9 9TNESIROTUA
2,422,392,523 *FFF7512A090BA69F699AF3A305CC5439FB84C3AD GWENIFERING
2,422,392,524 *FFF478A142987CB83E4561A3A40DFD9290DEEFFE H8I2JE8C
2,422,392,525 *FFF789829E613B9E17C75B4C0B5DDC822125F647 a1nt8
2,422,392,526 *FFF14C8DCB818C9F6EAFAB317B0EACCDB2EA5E07 hannah-richards
2,422,392,527 *FFF6A88C71DC68C3C10A93A36407BE997C25B14B HANSBUSHOVISKY
2,422,392,528 *FFFA6C9830198871C422D91B89FC8A12964BE9F6 [email protected]
2,422,392,529 *FFFB5E7DF5614C29A307DFBDDCB2F89AED9B26C0 A3;ON
2,422,392,530 *FFF4F6656B5DE98576AEE26872C396C4ED56E23A HÀTENT
2,422,392,531 *FFF7AA2AA39A1F7BCC38340D45F08446DA5D1173 AAA,N?
2,422,392,532 *FFF744060B301279743F84AF83E3C1C758FD4881 HELENIUS0
2,422,392,533 *FFFFD651C29EF56E0802CBD7AF12E43E290D8D38 aaonl
2,422,392,534 *FFF9EE56F1F4B52BCC5F72E08FFED84126AB5FA7 ab3cx
2,422,392,535 *FFF1CBFD9C06B1B28BA0FE2FDCFE9217D6090FB9 hessspazierg
2,422,392,536 *FFF51A68DD48A9C722A01F4E7C6EE0DC13A22F71 ABAWAJY
2,422,392,537 *FFF212B3F6FE2580131CBF685405A3638881558A [email protected]
2,422,392,538 *FFF6BB1DF2D755555A7146F39F603FD77E646B1B ac8aj
2,422,392,539 *FFF0A878B54FC1E0A28D5D939CC17E1E4A1486B2 hinsdale's
2,422,392,540 *FFF0F693422E67A61DDD0071E8BCDE8A554C3239 HNAD
2,422,392,541 *FFF161D22B0169F51BF98E6F5A1AC2592A7A4617 HSCHAFFN7
2,422,392,542 *FFF3E73144837F3228FB318D230D63B24F9C7318 AGYONCSAPTAK
2,422,392,543 *FFF9469015319760F519B7A6E93EC1DA98568EED ah!gt
2,422,392,544 *FFFEDD9A3CB829EF3C8F87669D037367E58CF542 hueyrutledge
2,422,392,545 *FFF60B67DD54A1174EF03B3B1F8DF0DC966F28E2 AJITH-SAMEERA-REDDY-ASAL
2,422,392,546 *FFF7A8169687897FBEEECA63772DE2E04CAE2814 akaem
2,422,392,547 *FFF7DE71BDE4D5A526C127E73307F7C0FFC7952E a^kh
2,422,392,548 *FFF7CB78A4DC6C0EB9384A161B8D6A47A651B1C7 HYPERBASED.(MOONOVE.REMIX)
2,422,392,549 *FFFA1F0BC31EC5A0FD6D46F4794EB3BBF5322AB2 ak%;u
2,422,392,550 *FFF76401DED42DDF041ED4FB8630CC6D5B9DC747 alexdorothy
2,422,392,551 *FFFFA8A71F3F456CD4FA873117D4C535782EFB53 IKESOUTER
2,422,392,552 *FFFD53BDBDCA568BE35023CE1FB5555A9652FA33 alonghit0
2,422,392,553 *FFFA2DC1AC057037C07E4E3E3DBBA11364B12199 ILOVEKOKO99
2,422,392,554 *FFF5547E25A3382C4254A4EC57F84DBC461B3F70 AMD94
2,422,392,555 *FFFE6D00F9832B9C0F61ABBC34D2D0D196E166DA IMAGEXINZO
2,422,392,556 *FFF4AB519B99909FB5855139B61F59AA8BA9C124 IMDI(DJU.F.U.K.-DJMET-GENCOAR
2,422,392,557 *FFFF5A16FD7B04C737BBC0632CC5DAF1BFE5C43C ANDREANESKE
2,422,392,558 *FFFBF2707BF5D3D6F9D362E8F968FF64338DB7A5 ANGEL.GELNER
2,422,392,559 *FFFB64B7E0CBDFE256278EB9C0684FE906D49785 angle778
2,422,392,560 *FFF0E7BA6B26D69A8C6AFBD8E92D990B51FF5B2A a%oqq
2,422,392,561 *FFFD4C08E7EF135CB32CC872CEE0FB9C9CEC22D2 appointor./@/'p//oi//nt/@/r
2,422,392,562 *FFF0093AB1CC7E512EDD960AA1977073494B8FFE approachunless
2,422,392,563 *FFF7C9BBC44D1D17E262A91D937BCB6894BA084B a"ps
2,422,392,564 *FFF6B0BAA0E99F3F2D6B29710E130C857C4F8262 JACK.GROSKOPF
2,422,392,565 *FFFFB26C55A19BB07F4D78E1D0AEC4E195C35B67 JACKSON.BUCKHALTER
2,422,392,566 *FFF168C317E4E76F4783D11DBABF4682A373B2F4 AROUNDWHEELWHEEL
2,422,392,567 *FFF2644DFD5D1681F1C0AD1DA30C40486AB3D231 arthurserrett
2,422,392,568 *FFFD43052791D09E7A564828B66FF0DC88545056 ARTIKELASPEKTS
2,422,392,569 *FFF6AC5378924B391FD694C3CBFBB60EC6CE1B6B jaeschut
2,422,392,570 *FFF1657893B45640104775EE8ED22831E20DB4A3 as6;,
2,422,392,571 *FFF00F33F6CBB43898BB09DD2C1C4633E2897451 A_:SU
2,422,392,572 *FFFA18DCE585295DD415D36EED658921339F3EC9 ATBASAR4
2,422,392,573 *FFF1D5032881473B38F628815E51971B94A76D5D JARRODPERSAD
2,422,392,574 *FFF2B521BAA9B904388A768FADDB757A86412A89 A;U!A
2,422,392,575 *FFF8F9E7D671B79EFEFCE1A932150376A972E4D6 JAZLENE640
2,422,392,576 *FFF39E4384F9D581767ED98009BE567C25D56B73 [email protected]
2,422,392,577 *FFF0C16806DA246F0BDBEDFF9105D5E19D073D07 JD-A
2,422,392,578 *FFF132D1F258552279FA9A743D8F301B8E07C70B AUPEK
2,422,392,579 *FFFA9667C28237933778AFE2B7E88DDC211757FD JED.BOSSENBROEK
2,422,392,580 *FFF6455FA31BF785B073A3E914B364CE0EB3F5A3 jeffflakeforcongress
2,422,392,581 *FFFCEA52A478D04279AD45C733FDA0800C518E89 av5ur
2,422,392,582 *FFF70DDE9DF5B010437EAA656058C77B0E0A9942 AVIDLY!
2,422,392,583 *FFFFE0C5C89E79CFAA6221946A548F5DE946B233 aw8(
2,422,392,584 *FFF9CD22B8E5E32E9F8BE161CD61198394B95461 JETSBEN
2,422,392,585 *FFFC891331C7540F7419B4133CB9957EF9800CF5 azn&
2,422,392,586 *FFF7EB5AB3E18960A3D8D54AF018AE8F0C8EC55F b2vcg
2,422,392,587 *FFFF316455BEB18D5367F4F6C53B16CD4ADC2535 johnson.kyle
2,422,392,588 *FFF8DDBECC1FA0A2020A1BBC078F3F1A4FA444AC jonathantisch
2,422,392,589 *FFFB90FFDD27D284C26C65F4C1273FA6C63D3803 [email protected]
2,422,392,590 *FFF51B3F9011DAB63D5EF12320D5E5ABD70E993F BABYGIRL
2,422,392,591 *FFF2D552A2BD05FA02C76F37396997A9637F65CC bakeries
2,422,392,592 *FFF075272FA3E73D73AFA808703F1BDC183FCBF5 BARRT
2,422,392,593 *FFFBAAF8489FEB1C4D80A4721F6FB9B9D74F590E julesholcroft
2,422,392,594 *FFFEE9670569F3A29669C08F6F356A40867C9EEC BASITDAREM
2,422,392,595 *FFFABBA917350892DAE8AB890CB550A90AA65AC6 JV<N
2,422,392,596 *FFF4FC5E4175E41E8ADA1D7BB3927F50AF54CF08 [email protected]
2,422,392,597 *FFFE173433099B00E7B5A630C36004B7A27D6090 KANMANISWEET
2,422,392,598 *FFF289DE62D1D70E16D538C7292700A3BB986FF8 KARIA
2,422,392,599 *FFFEC41B17C5E723D0A5207BE4362952874CBEC5 KENETH.TOPER
2,422,392,600 *FFF3B4914DC1C4F315F6673690FDD5A1575902C6 BERNARDO LUIS
2,422,392,601 *FFF1C83CB840D967FFDD24D6B03B79AF9B40C194 BERTADEEN6
2,422,392,602 *FFF7A7B92FB0746D0F28DC615FACA2989778153C BESTIRER
2,422,392,603 *FFF473B65419259B441B99825E137159BB4500C8 [email protected]
2,422,392,604 *FFF255DB49C66EF7BD36241EFF6BFEFC78D0D82E BETTER DAYS (FEAT. DEF TECH)
2,422,392,605 *FFF3FC55B98A06877D9F3CB492F97B0AC34984D6 KILLYNUMER
2,422,392,606 *FFF39E0F4BAA6CD35452B5845E3DD444F9694106 bigfootjulie
2,422,392,607 *FFF63EF595D4E4635211A7AFCE96CD4C4F55ADD2 kiryatmoshe
2,422,392,608 *FFF36B5F5347E2A48FD057F632725348370B407A KKEERAGALA
2,422,392,609 *FFF5CEFC355EDC20B3C8941D6D6EE9EDBCB31A91 BKARNABE
2,422,392,610 *FFF8581FB002F76803407BCCE25C13AF4A5D931B bkil-
2,422,392,611 *FFF9260EEB531E9109F8C1A2B4B589C7E553C5D0 BLOWJOE7
2,422,392,612 *FFF502976C12FE033F62E1E39C5D2E116C926DB0 bppwb
2,422,392,613 *FFF651C7A008402F5425EC5F7801192D8C66E2B6 larrylaurance
2,422,392,614 *FFF5AC252A8108A2051923B2D187FDC870D344B2 bricelewis
2,422,392,615 *FFFAED87337E7D9673BE8C5DB7E42A24826ADBA3 brooming
2,422,392,616 *FFFDD3A00F4BD5ABF02B99BC74A6BF51EBB32049 lcqt
2,422,392,617 *FFFD8F3674938FB11DB411F39F744EEAE1273872 [email protected]
2,422,392,618 *FFF546CE1CF3C687B83A52772716B2D0E0D5A461 leinster15
2,422,392,619 *FFFB9C29E8EA1E9B73310DDE82ED7ADDBA6BFECE LEONARD.NUHFER
2,422,392,620 *FFFB394C98B4FBBE735233834BD1D26E3E85A431 BU5NI
2,422,392,621 *FFFD23E10939E22B15BFBC562686C4D6A6AD04A9 BUD.JEFFRIES
2,422,392,622 *FFF3BC9AC98793E0584610EFCB0CC58D3B875426 [email protected]
2,422,392,623 *FFF6E0D31DB8A1C490725C89A5FC69963A258B95 BUNTOWAC0
2,422,392,624 *FFFAFEDDBC4C4E7FAA9FA19626755D8F037DFD91 LEUCITIT8
2,422,392,625 *FFFBCACA2A93D2BC3941C958269C939357209092 LHIRRIOTH
2,422,392,626 *FFF55CC6748A90AA1CAEDF288BC7CBB536734111 LIBANGJIE
2,422,392,627 *FFFC9EE2ED593C08313DFE3AA6E1A45853AF9F1C c0ru5cated
2,422,392,628 *FFFEB2E5B59ED0DAA0392CD88D5E5B07F9DDEEEA C?7D:
2,422,392,629 *FFFCBC7329A8EF693A0586F06E656211513D7C54 [email protected]
2,422,392,630 *FFFAE397C0CC1E2AACE5B4F3973AB64E003D80A8 LISTEN
2,422,392,631 *FFFA38A352512A84E58B4933FFEDB98C7B3700FB capotan
2,422,392,632 *FFF6BDCF0CBF27E0392D2CB74C1E118A69D0053F lloydbaylosis
2,422,392,633 *FFFC351F66D3289FA88A00C3F1B4903E30D69DAC LOBEYDOSSER1
2,422,392,634 *FFF560BC61B9D5DD6151B5320C7BCD5AE126E5EE LONG.OLESKIEWICZ
2,422,392,635 *FFF1ABB7B2F4D17D977ED0BBF40540758B344211 LONRANSOM
2,422,392,636 *FFF623B6454BB7824A886AA6C39C0DFCB487D7C3 LOU.GUINTANILLA
2,422,392,637 *FFF3762F18AD126451553BA25046F1DD8BAE0240 carterwaltos
2,422,392,638 *FFF91661E3EC517892111AB39BDDA2E465497396 caseyjo0
2,422,392,639 *FFFFEBD8F5020C5A0578C4C5B1E96D5BBBC21E74 LOZALOVESCHADS
2,422,392,640 *FFF0918F2171AC76227B586FA81A9E282A73E7BE lynett/m
2,422,392,641 *FFF115E11DDFF87300083AE3DF7D6FD1C7645B91 CELTIKOWI
2,422,392,642 *FFF67BD8975D18016298023CDF6E828A2013818C CFFAAA
2,422,392,643 *FFF9A87A3715C17E47DA0FB8792E6C3D8DBEA505 [email protected]
2,422,392,644 *FFFF80B84A56F669C0D2DED49E0DDB81DA51AE27 MADHUMANM
2,422,392,645 *FFF6BB17F7E6FD539E2AF6949E41F8E2252D8F4D C!GPU
2,422,392,646 *FFF272694B8F74F61D23A68AAB28C90323391BC7 [email protected]
2,422,392,647 *FFFE88F39C6FD1D6F61983592366682BB93E9CB0 charlenedanielle
2,422,392,648 *FFF046607963AC13B3BD4FCAEA91353486D0EE0E MALIK.BROERING
2,422,392,649 *FFFDB514812A5EC2D8B601E3368C895509FC704A [email protected]
2,422,392,650 *FFF8667AB5D8C1B175246751BC4C65FDD186DC04 MANKALMEN
2,422,392,651 *FFF74D686AEF36F124C616727ABCEFDA0F3EAE7C MANU SRINIVAS
2,422,392,652 *FFFE2EFDC0F05BDA1E3029B39B43D27149837411 [email protected]
2,422,392,653 *FFF6EA0089DCFE40CBD4773E7656BE206E6F2479 MARCELLUS.BISSOL
2,422,392,654 *FFFC427F2C13F5975F7ED680376C097B735B4E9F chesterkraetsch
2,422,392,655 *FFF6DE297B718B266C896242DF64C852FCFB6FDA MARCUSKRAUSZ
2,422,392,656 *FFF7F67703CD0D2BA2893B206C5D66B595867501 chichild354
2,422,392,657 *FFFBB7B7F72651FB97B0B65195471B8C871BB172 mary.cardillo
2,422,392,658 *FFF0C3560E896DCE57C40CA16A07B44EDC5CCBCF MATHEWECKSTEIN
2,422,392,659 *FFFA3FF0AB94F6857FB12D742813C056AC61589A cityinfonetz
2,422,392,660 *FFF5DB1A133768389AEEB6E0B23167E5F75CAE1A C%K9
2,422,392,661 *FFFD5CEE4D7638247AC0B58812E50C29CBFC9F2B clarencezacharias
2,422,392,662 *FFF1D3D07EE474135654D26C806E9A2A4988FEE5 claytonsherratt
2,422,392,663 *FFF198C1AB67ED59BBF417BFDC5821AE778A1F9C CLC3
2,422,392,664 *FFF06B91661AEA79F428F4D969E62279AF595B14 climbde9
2,422,392,665 *FFF708BCF36A21107FE1D8AA0EEF2FBDED46D00D C#L.O
2,422,392,666 *FFF82671E8D14B5EE7FA2CE4B4D56FC5275295AE [email protected]OM
2,422,392,667 *FFF489DD927E05791E331BE9A719BF33B8CD68C3 CM%CG
2,422,392,668 *FFF596EB1AE39FCF1B5630BB023216E27CD2FA6B messageofvicechancellor
2,422,392,669 *FFFAB41E801BC401382BCFE59D64B7554D67E50E MICHELLEHELMER
2,422,392,670 *FFFF759A601C768B528352F3F05846CA91ECB6BA mimili
2,422,392,671 *FFF32FC12ADDE8AAFCBD0FABA9D9F12D259E9168 [email protected]
2,422,392,672 *FFF7544FBED606D2C5E3DC86416C24A6682A88EB CORDELL.SPETTER
2,422,392,673 *FFFFE95ACDAF2F01D177EC75CBED10CEB9E0D4B3 coreyzeliff
2,422,392,674 *FFF2BBB02658EC4DB65333DFF7DD0AD635B511F5 MODYJEWSKI
2,422,392,675 *FFFAFD288E3CF823766CC2506E0670EC608E5805 CORTEZLURA
2,422,392,676 *FFF14879A0D06919CE696511BFA1B15FA9790B7A C;OTF
2,422,392,677 *FFF02203579C642DC18D048532E92DE8787F9C97 COURTNEY-SHAE
2,422,392,678 *FFF99CE88120CE0F134F5CA8DF73D5170367A44A CREÈME
2,422,392,679 *FFF25FAA745B685198D162BEB1CB18821D3AE6C1 CRISTOBALLUNA
2,422,392,680 *FFF5DB15AD8C970990C601C151A718259857650B CSUDB
2,422,392,681 *FFF600B76A0E9B0C5BD94085ABF7CE6265B88987 cue+1
2,422,392,682 *FFFCB5473BFB8AB776BE43CD4634A69D4E766D92 NARCOTIZARAMOS1234
2,422,392,683 *FFF0B422CD92C11C42C7F2567F3048AE07E98FF3 CUO3
2,422,392,684 *FFFEC75FD4454B72F04C15D0A492605327915BD2 CURTIS.FICHTER
2,422,392,685 *FFFB8CE313E6A026D35C48DEE1644D9E4B245C2D CVUTE
2,422,392,686 *FFF905610C983D7A965E86332EA2F8113558FEE9 cw$p4
2,422,392,687 *FFF91C7D57DD62CEE0B5E8C8B6D19432937F8188 cynthiacheok
2,422,392,688 *FFFADF2ABEA6E107A4985714F683109AC8FEF50F DALLASPSALMS
2,422,392,689 *FFF9015F8E0DC1BCC8E2EE4ED8952356CC3BFC31 damonwoll
2,422,392,690 *FFF43E8AC469B73EBDB1D3E37D9999D641B1F993 NKATZENELL
2,422,392,691 *FFFBA109992EDE6ACEC14E4C3C5A43AF839DF1E6 DANIELLEADG
2,422,392,692 *FFFAA7FDFF3C95014D9A3E0F34DF4EE25A83BEAA nobleruehle
2,422,392,693 *FFFC6BDFD06FFB1B26873221F6BEE9BA6C5A9778 NOBLETISCHLER
2,422,392,694 *FFF3FF147D5AD4F453A98E2EB39C673C8A593FCB NOELHURL
2,422,392,695 *FFF5BFD9152E20D36D453D281C30074EC733A998 [email protected]
2,422,392,696 *FFFC462F3856E7A91CCAA5D0BEF0EE9A8C2B7523 DAVID REINOLD
2,422,392,697 *FFF825007F4907CCBD5A2ACDF56B35374A75D2A5 NORMAND.POLETTI
2,422,392,698 *FFF72965B81CB32D59E5AF84AF05EB3C21F3DA43 DBDOA
2,422,392,699 *FFF497D0060011B39847D17948ADBA421EC9FCC6 [email protected]
2,422,392,700 *FFFA1057A78DF5FA82B709A3659BF65F27FEBCBB DCPRE
2,422,392,701 *FFF547904CA750A1EBE9A84E409F11E546C063D3 DEBBIE-DALTON
2,422,392,702 *FFFEECB1493429297A1334859368EFC3BB4A6AC0 oberkirc4
2,422,392,703 *FFFC3AD59E317D58B7C3E405CB32BAAC2EC77BF9 obschem0
2,422,392,704 *FFFDE19324E499D01C0E5F3014BBEFC413579D5A (O_-)*.*.*.D#B
2,422,392,705 *FFF637CB33A98D4DAC5E57F517CDBBFE18017FD1 o-de-confian
2,422,392,706 *FFF3F9EF01D6E176E57EFA92292E4D397F4CB359 ohbukj8kqwy
2,422,392,707 *FFF449FB91F50955031F37D7089A598D519D1E17 $OMA+O1OG!CA1
2,422,392,708 *FFF02E347DB613DCC0B5021AFC3601D4B36E8366 dennisnieto
2,422,392,709 *FFF9623B1EEB362509AAE485463AD132E3BD374A dewaynebelina
2,422,392,710 *FFF3BE4F6F3816556E55576B632E73BF836A27FC DG9QN
2,422,392,711 *FFF3276822F853D5F1EA73B327F2F22366CF6AA3 die-story-meines-lebens
2,422,392,712 *FFF4B896D73CF9809635AFE44027FCC4D37DAA46 OSVALDO.HAQ
2,422,392,713 *FFFA4D783CE040303A547E1CE5C04325008642A2 OTHAKOVAR
2,422,392,714 *FFFBE4381BF12E611854DB2092646EF35BD1FC5B dirksadie7
2,422,392,715 *FFF262AA748498A9F842E4FC7C16650069B67501 dj2ma
2,422,392,716 *FFF2185AF6EDF7B7169B1584206835C371ADAD02 dkuww
2,422,392,717 *FFFBCA23D89E695FBB401A17DB397051AA21CA63 pagehistorybeforelist
2,422,392,718 *FFFF3C625187124ECB3B32A6D0D5566BA319D5D9 PALMATELY9
2,422,392,719 *FFF69B1F013EE44AB830FAB5815BA0CD99101399 panegyrical4
2,422,392,720 *FFFEB4CDB5A374CF0FF25356BBA7D072F09A7306 D+"MZ
2,422,392,721 *FFF37AA35A11F947D724350AD973DF67526AD38F dominiquesporer
2,422,392,722 *FFFB43929A2494D18CB07C76AA351764FD1876CD PAULHARRYS
2,422,392,723 *FFF93955DD1FEDB36D89922933574A054BE30EF4 DONOVANDYS
2,422,392,724 *FFFEDAB598EFBE2EA18FC33A14AAE2F942462E84 $PEELLE$$
2,422,392,725 *FFF38A0A2BC3D6AF64A7B0DC35F47A68D34644A7 PEENGING7
2,422,392,726 *FFFAFAB0B7CD5BC7DAD785060FF4CF609246E797 persoonsbewijs6
2,422,392,727 *FFF7E9899F5F4A4583EE6DCB54970D3BC77C641C PETERRONAI
2,422,392,728 *FFFDB28976428C16B944A6A38BB7195277C838BA pierrefrancois
2,422,392,729 *FFFD97FD5C05E9753021B9523B89CD2DA940BB48 DRJFD
2,422,392,730 *FFF45B242FD7DC9613D0BC2D025F154D1C053D78 d"ssa
2,422,392,731 *FFF8327E4447DBC50897B7A93FFB8F11DE3C9E3B pohang..p.ow1.hh.ae0.ng
2,422,392,732 *FFF5E90F6F327F312DDF2F289AE589A24589D66D pointerende
2,422,392,733 *FFF3AFD1CA005A7193C18F3E8EA76F55D3C8DAC2 PORTCHESTER'S
2,422,392,734 *FFF9B1C642C5BD20A94D775C991B8F88C8769586 potresem
2,422,392,735 *FFFA317EA9C4CCE7549A3F17C6E7B72C3A237C9F ec8pd
2,422,392,736 *FFF2942043462D9752A0B7F24108123DE3F07E0F ek2q4mcfpmu
2,422,392,737 *FFFFD12C62C8D7C66EBC2EF44F7D50AD23C3E57A R04dsd3s
2,422,392,738 *FFF01B932EB1F7B2FE74C7C475CA3486AA23B22A r14s
2,422,392,739 *FFFDFE5E7FD8A4D47CD3F093E490EA9D75410CDD ELLSLEY
2,422,392,740 *FFFE67B2A9BADC6AD3476B94484337E0EB2AB9E3 ELLSWORTHLUCKEY
2,422,392,741 *FFF212865E7E2349D0DFB7E6D209B91A424AB85B emergencydirectory
2,422,392,742 *FFF1C6ADF8FDD515FB7566DCADFA836F093AF0E8 EMMITTMAHAFFY
2,422,392,743 *FFF5531295BAD70C67DB0DAB78330FBD1A5CDA5A [email protected]
2,422,392,744 *FFF4B7988E43DB8D400908860072036BC4C0E484 ENCHANT.ME.(AMBIENT.VERSION)
2,422,392,745 *FFF3FF9DF04F821C22C1530123CBBC582FCA0108 en-dags-pause
2,422,392,746 *FFF485F21831E2026DA38D20FA2E56E253A3BEE2 RECKLESS.REASONING
2,422,392,747 *FFFC9E60AD18FA3F1F9A311747302DE54AD29FDA enquêteuse
2,422,392,748 *FFFFB427FCFF020B71B5B0FDE57DE4A37B00DB78 REGLAJING
2,422,392,749 *FFFA5DFE5C78647A580BBB4CCCC4CC30A8A18E6E reidgarrahan
2,422,392,750 *FFF188AE63D13140A675301A6A6136B4610CCE0F epvo
2,422,392,751 *FFF00DC1A76E2B41360A12A36AC33D677490E55C [email protected]
2,422,392,752 *FFFE1FA9838AE36BADE30CCE0FE3BCD48ECF2277 ESRISAVATHTHAY
2,422,392,753 *FFFD4A6C9C4B289D7D7187F2FD907A1114CDA57C ETLIETS8
2,422,392,754 *FFFEBE551289094A615F1DFC1688CBF9433C5107 RIA DOMINGO
2,422,392,755 *FFF34C4084AAF2A56C1ECF6B17C54E75AFC86F41 EUXNOINO
2,422,392,756 *FFFE2162141A9B966E6758EB7519A2E9AB2F2DD1 evaporassi6
2,422,392,757 *FFFBDB661496574EE1B36F254BE673605C847A27 EVERSON、
2,422,392,758 *FFF4ECAADB48BA53D2473F40D189ECBBC832EDE3 everybody.dance.(the.horn.song)
2,422,392,759 *FFFE533E33971C1BD64391630839A4D0BD82A28F ewwhite:tml2lt
2,422,392,760 *FFF094689A65E8B9CE7BF8E19D9397BC0321AF30 RILEYSCHERBARTH
2,422,392,761 *FFF4A8B141D09016DB9AFDC8AFE018DB135BBAA8 RINGOFFIRE(STADIUMEDIT)
2,422,392,762 *FFF3C803F8389B910E4A95DFBB7644429AD22F4A ROB-MCIVER
2,422,392,763 *FFF386AE898031AAC98F0FABB18691790AF0CC12 ROCCO.LEBERT
2,422,392,764 *FFFE5488002AEE1BF4A15E7526F9C557ACB3D3F7 rock&rollburnout
2,422,392,765 *FFF8088515AD686DB29A32603C8D2F9466D89CC1 [email protected]
2,422,392,766 *FFF3151F115DBD679DCA4E319D83FBD63A45E0CF rolflombrana
2,422,392,767 *FFFC4A21A547DF76737B969148C98FB834AA9871 [email protected]
2,422,392,768 *FFFA15A3183EF96BB7A151EE6CA8C29F3BFE9B4F famu2210
2,422,392,769 *FFFAAA0A8AB46F69A97BD4CCE8847118A5703E22 FARSHID FALLAHI
2,422,392,770 *FFF3B58820E73258F83261548E8C93FB3FD680B7 FBRACHTE
2,422,392,771 *FFF05C0726EB1E4C321F885A86A981FFEA872555 rosendozambotti
2,422,392,772 *FFF8612EFC1874949FC55AF81FAAD53AB8D598E3 felmar26
2,422,392,773 *FFFE5FF8F2A1131143C0D4075692BD6F0EB34363 FERMIN.GRILLETTE
2,422,392,774 *FFFB7FAAFA76C6484011CBB4CA8C90C21132A81C ROY-SWANSON
2,422,392,775 *FFF1735B7D87A3297FCB810BC023C5530B680D8A ffejapap4
2,422,392,776 *FFF0D5A77C187558BF6D0B94FBC0FFAF2342AA28 FIELDSLANDING
2,422,392,777 *FFF2728696A06BD06A72B478FE69AFEBA2DAFAD7 FIRE.IN.TOWN
2,422,392,778 *FFF44949C338ACBF6A683B50088CBE7D85EE0153 Five-Brothers-(alternate-take)
2,422,392,779 *FFF6CABDFC6ACCFDD05BA4C9CDA873E0481A1E4D fle
2,422,392,780 *FFFC512DF0C91E4CD41D7CC73403FF384C1715A1 [email protected]
2,422,392,781 *FFF4889674BEFF77319D3E61D9722862787B4BB7 rufuschappan
2,422,392,782 *FFF5EFF9728D197B92B3029914FF8F4475635044 RUSSELL.MOTSINGER
2,422,392,783 *FFFDE0C4C5FF10ABE90F5DE40E568BEC96C4A9DD [email protected]
2,422,392,784 *FFFB17F3E710264DD34615BA7460B34AB08DCD8C FÖNSTERKARM
2,422,392,785 *FFFA30A51F60AA55055B3FD3BC87773398F719F3 FOURSQUAREBLOCK
2,422,392,786 *FFFB8465A8E8937E125E4C3C0F026E72EF116084 frankeerzegels
2,422,392,787 *FFFCBA878264D53BE99E4DCC2F7153ABE84ED7BE FRANKLYNHASKELL
2,422,392,788 *FFF19F795C71E339C0B0CD0C119C22FE30E0B315 SAM.CHRISTMAN
2,422,392,789 *FFFBB29A5BB694DBAFDD0453FA20EEC033062C72 SAMERSYRIANI
2,422,392,790 *FFF210E69BF833D9134029E2C015430650A5CB9F SAMUALRICHARDSON
2,422,392,791 *FFF897511CE7D3F233244F0508884EDBBEC4B897 FREDRIC.CRANER
2,422,392,792 *FFF1B3887D113DD7E5A43CEB50F4B2706CF5AE15 sanfordduitch
2,422,392,793 *FFFA6CCB2D25112C0B6A1C1859EFA5A1AD2C9ED9 SANGALSTU
2,422,392,794 *FFF4DA5BE15C45AF1D0953A2DC57C4A666571A19 santanusanyal
2,422,392,795 *FFF54ED49D3AC1D5FB8739F68A004F69CC77816C FYSH
2,422,392,796 *FFFC87F725C5850C989EB60B79D853FAEB203E3E SCHLÜSSELKANAL
2,422,392,797 *FFF561E4B85504287607DACA0428D414E52DBB25 ganguela!
2,422,392,798 *FFF696F00C7EDFD1775F17CA54D52FE47575F8A6 [email protected]
2,422,392,799 *FFFD83E9629A1CAD402F5DB36001204882C556CC GARFIELD.ULLMANN
2,422,392,800 *FFF2B79A302EF2E1A8B8D3F7A0688040D29F679B SECURITYCENTER,CSCEPL85/003,JUNE1986
2,422,392,801 *FFFE11D7DECFFF66C39AD6C6B201FDE3DDA3F267 SESEUQAIDOZ
2,422,392,802 *FFF0CDB127FA397235738AE2A48A60590C731550 GEORGEMADRID
2,422,392,803 *FFF46FABA1308BD97F0634829352F60CB342C2BE gerardobonasera
2,422,392,804 *FFF1D013631122315A9DDE66A4607F76D1205995 SHADMUMAW
2,422,392,805 *FFF70A4C9A09692F2A28550C99AD803B6F087071 shajan.george
2,422,392,806 *FFFD50DA7C5CE76C56D0E178335B57A8A2A1B99C GHOER
2,422,392,807 *FFF0D6675B884856DD6BF5BB0325D379244EDCDB Gong-Chi
2,422,392,808 *FFFC17CADC41262E2684D29D53686A508621548C sickasabat
2,422,392,809 *FFFD064DCB451EA919AF1683CC71C92698BDD21F SILVERSTEPHEN3
2,422,392,810 *FFFD57CE80527E8FC89E8850A37A0D20B63FA0FF GRANVILLE.RUSHLOW
2,422,392,811 *FFF59960C244B77755A73CBE2B98CCF6CC462CBD grass roots: the best of new grass revival (disc 2)
2,422,392,812 *FFF1BE60D4ADF232006AC318335E46C3687F0672 gregmerison
2,422,392,813 *FFF502E1CAB725383B6E6DF9503C156F7D169294 GREGORYGRACEY
2,422,392,814 *FFF06E747C4C730E9B063BB1CC9E8F42DD5A2885 SirusDeep1
2,422,392,815 *FFFA7ABC5F8642CE496DD13F340BD033D59C63F9 [email protected]
2,422,392,816 *FFF4F10F279E3D7737C474DCB7A5C94D8E9B21C4 sj[{
2,422,392,817 *FFF6F351A25340390C5E9B0EE329EA9E22F3B0CF slodderigheid?
2,422,392,818 *FFF08EB2D59FF3FFBDB294F5856501313748E191 GUS.VLASAK
2,422,392,819 *FFF6FA1EC8E14019AAAAD3261015443E0218927F HACER AYDIN
2,422,392,820 *FFF32F2547054135B6C305DED030DF4411350C19 sobrevoais
2,422,392,821 *FFF6414E8E32C0E1DFB2EF2D96A2DB9EDD9FE47F SOMETHINGABOUTYOU(FEATCHRISTIANBURNS)
2,422,392,822 *FFFB240593028D9CC3E560DA8FE6AA7BFC53A008 SOTERIOLOGICA0
2,422,392,823 *FFFE46AC9BEE2102B668F429A34E2A89EFA20F17 HARLANMROTZ
2,422,392,824 *FFF5B950F92A4D5B1CE4E40F7E91600AF5F90E1C SPLAT!O~-<--Q
2,422,392,825 *FFF3B00B23D7A5EB7AFBCCE6D92AF14CA6088F7F HECTOR I.AM.YOURS,
2,422,392,826 *FFFFB53A0E9E63C003922EEF34C249148BD1984E HEEL_ROPE.H/I/L_R/OU/P
2,422,392,827 *FFFB3B6C4FD04C38E11A81C7C310535D0B67BB42 [email protected]
2,422,392,828 *FFFB5135FEC6287DB2B0954BA402E7285F4EC985 SSECORPRETNIDTCPIDTRT2
2,422,392,829 *FFFF277194026A07D472664201528DAC6A689A88 SSIKAPOKO
2,422,392,830 *FFF1FD06AD295E0E5BB66496262207D117F2CE63 HERMANBOS
2,422,392,831 *FFFD9BB059B324DC5C081C7CC5A72EC7AE9F9DD6 STARTOLIVIA!
2,422,392,832 *FFFAF32F6CC3CF2A694FF61AF163936E5911A583 HEY!BABAREBOP
2,422,392,833 *FFF39877EA0A9933AB9CDC6CDB84F6AAB92B7557 steve.gouin
2,422,392,834 *FFF398AEB8393848BABB932540C4404F9C645304 Still,Alive...andWell?
2,422,392,835 *FFF61870DD842DFCDED4CFBA0D5861B05A8B0292 stsetsaf
2,422,392,836 *FFF3DCA079D3F1EFA175A2C685545EE678141BA3 [email protected]
2,422,392,837 *FFF3EB36B0518CE1D24063414439AB9BE300DFB1 HSTTRPC5
2,422,392,838 *FFF2D412D8E9C50D07E8450ACB0522CC8943F3A7 [email protected]
2,422,392,839 *FFF654001FBFDC199B336DE5827EDB6ADD4F236C HUEY.BASHFORD
2,422,392,840 *FFFC23C42C5A25CEE1FD00782A98AFD7D68FF5DE [email protected]
2,422,392,841 *FFF71F184A59E7A7A56447560A276291FEE2607D huidiger3
2,422,392,842 *FFFC1ABAF2BB5C6FF94A5DB2D9E2E41BA6AAE9D2 SWAMP STORIES
2,422,392,843 *FFF130F38E7529986E8F232830D6EB4B3CD4E7AD h<w
2,422,392,844 *FFF017FCAB444998816E2FB2948F577E677E04D9 symphony-in-a-major,-hob-i:87:-ii-adagio
2,422,392,845 *FFFF0ABC6DAB00866339D0F2EB21B25AF54969AC Szbaa
2,422,392,846 *FFF1B09FD106E6C067AEAE71D3A5B6F79D6295BD talkiest
2,422,392,847 *FFF057F36D1A3CFFA4CC67B5E9431BA01DDE97D3 tamperevidentwindshieldrfidtag
2,422,392,848 *FFFD2910B585E911AA8051B73CDA7E5FC54A4B1D [email protected]
2,422,392,849 *FFFFC69947790E25B4DE9AEC2C851C7B7A7FFDAF ILOVEBIGBOSS5
2,422,392,850 *FFFCFA4CCF248C41BB26D10E5B6DC3BCE821CAFA ilovethrasher77
2,422,392,851 *FFF5379ABA364DBF2999C23C4255F204F97E59BC IMAGEFALUNGENEVA
2,422,392,852 *FFFAB47FB5084B9C33E577EC4C3DA063A5852438 TELEV!$!0NARY
2,422,392,853 *FFF0F85910CBB13360E45FF07CAF07C535266EFC INDUCTIVOED
2,422,392,854 *FFF7D7B90C9EE13BE345BEC65C69D02E90F5D9E4 TESPENG KHOOMEI
2,422,392,855 *FFFB6951144678E9C5D57BF320F0FF9E66F12E3E iq8
2,422,392,856 *FFFBCFD8B79DDC320050C7DB47DB9942C2BBDCF7 it.ain't.cheap
2,422,392,857 *FFFC7387E8AB8AD548A92824B31D7FDC65B17406 tineals4
2,422,392,858 *FFFCC090630FBA4E1A91A6C845DD24941103A095 JAMALVILLALBA
2,422,392,859 *FFFCA8FAC433B2346A0D08C182BD7302D96BD619 JANWISEHART
2,422,392,860 *FFFBF574517D48CBBE1A0BE21DD794AF3CD95E83 jaques-davidovici
2,422,392,861 *FFFD87F14AD044F8B1AFC5E6A9F809CC358B915E TODDYOUKET
2,422,392,862 *FFFCC7FA41D96CF5A4C8C09B6DDEA75FA609604C jarrettcorrow
2,422,392,863 *FFFB71234C38CD7900604579F21F1D7C59C102C7 JARROD.WACHTER
2,422,392,864 *FFFC425EA639F68D77D793EC41443DBD8BAEA6CD TOMASZINNER
2,422,392,865 *FFF10D184FD6E73A8C748753FCBC2DA5B296C441 TOMMIE.GIRSCH
2,422,392,866 *FFF93A1FE122EAF893A623B34D38F885D3D72962 tommiegrandi
2,422,392,867 *FFFB9698CDB9E1A7F4A689467E66FA5E8538D677 JAYSON.CHISARI
2,422,392,868 *FFFFEEA6CBF874AECBFF34874B49F57AB824D09C JBMCQUEEN2002
2,422,392,869 *FFF9A15F8AB0AA7EF7AED72CBB3A8C8C788D6388 JCBRADON
2,422,392,870 *FFFB4669A02266CBB6C65982376AFBA175861E5D toraichi
2,422,392,871 *FFFB60B6879934300A4C515703DDEA9D10B74437 TP8392
2,422,392,872 *FFF7A53EA45A03771D25DC17141F0D864FAE9042 tra-lynn
2,422,392,873 *FFF36178AF84A0E0ECA43C7B24050E7F9D34FFA6 jeremyakuna
2,422,392,874 *FFF2953B28FA2977A6342AF15511C2E20624E7FE TRAN-VANHA
2,422,392,875 *FFF08DE6C7DB2A03086BB022D9A765E2CA1676C1 JEROMEOEDER
2,422,392,876 *FFFDDB315C79E8CEFC32687E5AA1628367AB03A5 TRAVEL-TA-HIKING-ARIZONA-SIDWCMDEV
2,422,392,877 *FFF483445E2272CB297F16172BD901B22AF02BBD JERRELL.EVINS
2,422,392,878 *FFF27525EB7F4822C951BB985D257AAF4309BA5D jerroldromrell
2,422,392,879 *FFF864706D3A0E06C89F93B49FA74B051DA696F2 jerry.siddall
2,422,392,880 *FFF028E13C5AFA92AB4E07F9FA6346D616D173DA tretti
2,422,392,881 *FFF7C387B2A376B63E382A9C05C31904A9FEFD37 TRINIDAD.BJERKNES
2,422,392,882 *FFFEC0AD63AF28BC55FE40D0FC866D103682E03D [email protected]
2,422,392,883 *FFF90C34586F5ED5C473167E0B9A5DC0F8FA7B0F [email protected]
2,422,392,884 *FFF5F72341CC22AFE795B3676C20E0293E8AC794 [email protected]
2,422,392,885 *FFF4CBD4DCE244A428783FB694355CF5A656A243 [email protected]
2,422,392,886 *FFF37AAF6AEB3B6E153A113A74C3CF09BE6E70D1 trix-guitterez
2,422,392,887 *FFF5E085FF6398D912BEA347A475A364FD1B0FE2 JINETAL
2,422,392,888 *FFFED3F9F691E6CA3B2DA2D31C40E40254DCA36A J'MULASSE
2,422,392,889 *FFF68C9A9834E118ED366335D2D28966035EF8C2 TSGIKUDA5
2,422,392,890 *FFF75BA341B00774837266A6366110EB508FC32D TSTETSU0
2,422,392,891 *FFFD460DA4A8EC858ADC0EF4CDBD7AB0D0E3BD4F TUIKBAL
2,422,392,892 *FFFC392830A6A600C2610059C8764FA8D8073837 TURNAUSPUU
2,422,392,893 *FFFE37A5C5BCF66333DBB48447807DDAB56ADEB5 JORGE.DEPOTTEY
2,422,392,894 *FFFD5AB5D33AE6B36976DD4267D8D1F4072F8027 tyre
2,422,392,895 *FFF7BB0325F685A370FA9A3A586CEB4C9B433442 ualaskaseal
2,422,392,896 *FFF8A633F81DE9DB29E1041446A7B18CB00F0AA9 ug:i
2,422,392,897 *FFF7483B3C3E4F717A69C19183C1BF1BCAAE9901 UITBAKENDE8
2,422,392,898 *FFF9E620819D3946A801301B704E55F2171655EC UKRAYINY160160TRANSL
2,422,392,899 *FFF7A2F7456B9722CEE33A9F38186A216E233BD9 JUMP」。大掛かりな衣装セットで印象的な登場シーンを演出した。
2,422,392,900 *FFFBF09576293BC856A9B39241B5E3E395763E4E justinsherrod
2,422,392,901 *FFF1A6A7A0E75AF6436E414709EF9DDE941863D5 UNREASONABLE-WOMEN-A-MODEST-PROPOSAL
2,422,392,902 *FFFCA12F4F134B8686F73C7F35ADCFD3D410F0B6 k3x`
2,422,392,903 *FFFB69D27E065770C85B4354DC8C4E812619ED3C KAFFEELS
2,422,392,904 *FFF31143130BCFCB1F95D753FBC74737A62249B3 [email protected]
2,422,392,905 *FFF8E7D97D608BB5501F5D168C930785D37B509E karaterelated
2,422,392,906 *FFF2D1591AAB94187E9CA228B72C6D9B92E7D3EE KARI KRAUSE
2,422,392,907 *FFF433E077888F271727480A6CADDEF13B9902C0 katesager
2,422,392,908 *FFF1E0C7C9FC339E8FDF3AC6F42019279515DB12 USS_MISSISSIPPI_BB-2
2,422,392,909 *FFF46708E75C36A0152C8BBC0F97F0D45E5E255D UTNCSV
2,422,392,910 *FFFED416009BF0CB42C0992436375FD08DBBE4D7 KELVINTEITSORT
2,422,392,911 *FFFD5E37EFF8DC4E40A1857BE38D54D884B1D18D V0R4C1+1E$
2,422,392,912 *FFF189553E614DF60A222174111796925A2B5DBA keretaapi2a
2,422,392,913 *FFF852DE4E1F35E894DD7BD46F1DC7D8DD034552 vanceliner
2,422,392,914 *FFFDF0F1E34D23F04E4FCFB88CBABEB03A7FD340 KIM.SCHOONOVER
2,422,392,915 *FFFE6AA8E3D8F0D690FF1D3956EE0CEAFE2860B7 KIPSAADE
2,422,392,916 *FFF234C015C3FF49981856F10A9BFF830159382F VAUGHN.PAUL.MANLEY
2,422,392,917 *FFFB59C4C4AAC37A37C9A558B5EB4FD2A36E60D3 kirchturmfiba
2,422,392,918 *FFF37758879DE8978D60C0D7EFBAE254B20E215A Koncentrationsl
2,422,392,919 *FFFDB7CB79BEA3BF766960F9A3CC0B2E8D92B9B1 VERN.FRUM
2,422,392,920 *FFFD2AEA9035855C142BAAD30D0B29106DE80A05 KOPEEKKA
2,422,392,921 *FFFCEE824704F885F92E4405BE1006FE766835BD KRAFTQUELLE
2,422,392,922 *FFF1A82BB16D0C1B4D9016518EDADB0A389E6666 KRISTOFERTARPEY
2,422,392,923 *FFFF8A8C1A7EB9A521D639BE7A68D9B385F774CB KUTSEHARIDUSSÜSTEEMI
2,422,392,924 *FFFFF73CE23AB5F18DFA24E9F90D59FD150B189F KWP_
2,422,392,925 *FFF96E97AC8B67AE6325D6695D17F14F260C995D kyoskite
2,422,392,926 *FFFDADC65E0CB005147A610DBAF576222D272643 LAKTĀTIEM
2,422,392,927 *FFF6966B2A2615A902C09B5FE20F04E82E6D72B9 vincesatiago
2,422,392,928 *FFF09F9112D2DC276A1B777C5C63BC2A2C721616 vinnitsa
2,422,392,929 *FFFEA93A3216EEC40D358013B90B0A6D0BC322E5 VIRALITHA.ARTHALITHA
2,422,392,930 *FFF24C03C8FA42BC03015BBC865EC8342AF1621D virgilbruegman
2,422,392,931 *FFF7AC7ABF67187229C736CD32E4B6A2CDA0860B Laska-z-bruslaku
2,422,392,932 *FFFD6A3DFF5E50A97692255899D3805723C5C2D5 LATONYA.DOUGLAS
2,422,392,933 *FFFCB38BA13C86540833BACB9BA47E01CCE0DD3A VLIKOHTA
2,422,392,934 *FFF61B3C32C533A6B6071F38F05FDFF422C11C52 [email protected]
2,422,392,935 *FFF64DA78216A5C84A2CFFA568AC8B4254A6AA22 VTGREAFGB3
2,422,392,936 *FFFC91C91812092DCB7DADAB032CFA812E78D071 LEMUEL.MARQUITZ
2,422,392,937 *FFFEC7A1F855421641D9501DE4CE00E10DE43586 leonardojura
2,422,392,938 *FFF10DF0E4735A22BEA928AB7F35F1151FDF5469 LEŞENILOR
2,422,392,939 *FFF78B535E7013746BD1816D8813CFB04C33C5AC w0rsen
2,422,392,940 *FFF742EE4CE860A432364B82CC6EBCD42B2F001B waelaboeldahab
2,422,392,941 *FFF50E91B0FE591A068AE1AF30605632D69B8000 WAINSCOTED
2,422,392,942 *FFFF2D44F230131D383341860C32C1B1B6960C6C LINCOLNMAROUDAS
2,422,392,943 *FFF50E07DF025600B6E943A50E8FF4458E6A8E33 LINDA.BAYAN
2,422,392,944 *FFF2CB36E274951A8E15DF56DAB4480DCDBD8409 linodinh
2,422,392,945 *FFF54A39E5214491035F62D842704EA8CE7CE816 [email protected]
2,422,392,946 *FFF879625911C955D2952A31893DB91ACAE064DD [email protected]
2,422,392,947 *FFF669784A1E2D6204677AA8A289BEE64C0C034E LNALOSEVU
2,422,392,948 *FFF2E03F61D634A1A91A1F4D46FC32524DD68D67 WALTON.VANDEBRAKE
2,422,392,949 *FFF71D0EB4740EF9B8B1A072B3DF51BC8BAAD904 [email protected]
2,422,392,950 *FFF0E79F8D43C170F05C6850A80E5852B006EB2F [email protected]
2,422,392,951 *FFFE8E6B3FB4FD1A1A7DC60FB4EF69E9C3F76F42 logger-mn
2,422,392,952 *FFFF1ADB10F286440343E440AEECCC2C6D4377D9 WARCRAFTSTACEY
2,422,392,953 *FFFA1538B789952D6BB42FFB0D29D6AFB52DE372 watch-flo-on-alan-carr
2,422,392,954 *FFFF77F957605779A0AF4C491232AE52A372FCC5 LOUIS.BACARELLA
2,422,392,955 *FFFF22F7E8D289D7B58B840B05D6C3F77A87999E lovesme123
2,422,392,956 *FFFD9AD6C168202352B50C96A9500E40A5AD9DC9 lowellnanik
2,422,392,957 *FFFF136805263789828AC572510A10939CA6DE66 webb-dungo
2,422,392,958 *FFF34A92D41B0B097E15C7D2383C74ABEB2F11D8 LUCASMAGNONE
2,422,392,959 *FFFE4987A7E42A575827631A356F9866DE2CA1C7 luciusprichett
2,422,392,960 *FFFB1EA76338FD19C0AC4F077EDF66D7648D15B5 [email protected]
2,422,392,961 *FFF5E13A946B25F8814B80382AF386088C68F819 Lullaby(acousticversion)(featAinslieHenderson)
2,422,392,962 *FFF8BEAEA8307A8A07A9A43840659755B64FE86A WES.RITTINGER
2,422,392,963 *FFF065EA32BC77184D08E80349FDC2743F6F921F WHATSHENEEDWITHAROOSTER
2,422,392,964 *FFFD156B6E676DAEA120C7A8CF547E07C6E7DC62 williamebost
2,422,392,965 *FFF153DD8159C7F09A6813C50E48A79F3E57E678 willmcbrayer
2,422,392,966 *FFF5FE5476618BF61FE82466E18359C22FC08B90 LYNSCHA
2,422,392,967 *FFF18E755ABF0E29CB274C04418A8A7D62C5F7B6 MAEGLERS8
2,422,392,968 *FFFF0FAAA3B80BFB9369184B7DD294C680C8EB74 MAJETN
2,422,392,969 *FFFA343ABA3CA36D007ACFDB0715224CEF74A3CB MAKORNA2
2,422,392,970 *FFF4F42D55744C651E2F0E36B824566B3A693117 MAN.LENSER
2,422,392,971 *FFF9BB33E33AD520EA31D7B2C70258E85C8673C8 mannnnnnal-love
2,422,392,972 *FFFF3ABAF72129144BACC356CE07EA35D298C079 WY.LEUNG
2,422,392,973 *FFFDB1F1931988BE07827A29436B2DE4BBC091C2 MARCELINO.TUGWELL
2,422,392,974 *FFF3B9908D2D74EAA53970E29D395549767313FA X2KOKO
2,422,392,975 *FFFF23BDFAB192D738B8E8DD5393A74FFDDA3829 XA1AA
2,422,392,976 *FFF69D62E71E8CBE84E3CF19C6CAAE1B2C3A3D2C XHULI BREGU
2,422,392,977 *FFFEC1E7149306AB525648E9F24EF8E7E2E1296A [email protected]
2,422,392,978 *FFF404F7BFA0A2ADC4B26242F637C27996F545E6 [email protected]
2,422,392,979 *FFF7F73351BF5A49284ACEE4F93BEB3FF96A46D2 MARIZVILLARAMA
2,422,392,980 *FFF9A4F036F14861738C97945B6C9F4CDA2C0BA6 MARTIN JAWESKI
2,422,392,981 *FFFA527AD17A5B4651DE2CBF469E4379EE7A17B3 [email protected]
2,422,392,982 *FFFBA568298FB2CDEEABE86D0B4D0605F84CCDE9 martyortez
2,422,392,983 *FFF59FE5170E646994F2C605A5CEA9D457208A81 XXXPACKERS5
2,422,392,984 *FFFA76B9023A044EB4B2E1750D50E856E8B64E7D MASAYAN1
2,422,392,985 *FFF4CEFB9B82E40E601F2B5A4491F4EEA0900763 YASH.KUMAR.SHARMA
2,422,392,986 *FFFA48A69E6A2EC88FAC7F74FFB350E98123218A yeujing
2,422,392,987 *FFFA8DF4C2B4E0513DD702259E64B278C7AE8D70 MATTHEWMCMULLIN
2,422,392,988 *FFF06E16A3B8C3E02F4323487DC9524809678CFB mattkallio
2,422,392,989 *FFF6F880A43A2C85A2960027D4E2EDFCA47518FE MAYREEL
2,422,392,990 *FFFD76254BFCFB517B34E3E9D44D659FCDD81B8C YOUNG.PALOWODA
2,422,392,991 *FFF61A596C9C69B504995B2DD9369F8FEC627CA1 yourteethhandface(marchingalong)
2,422,392,992 *FFFCD679421E0C44EFF16241D492EBCE938B6C92 [email protected]
2,422,392,993 *FFF4E9329582B2335F6C74FEC109C2E94200D272 YTILIBANIDROED
2,422,392,994 *FFF6C99A00AB53B0A14513C6C18F8CE90CE9B1CF [email protected]
2,422,392,995 *FFFBA89F1449454D0DC195582D5074858904484C YUDHI.YUDHI.K
2,422,392,996 *FFF2D67D5685486DEC8D15C6828C478F609F21E6 YUKIKO ROHRKE
2,422,392,997 *FFFD3EB904BA57EFBDAAD728C379C3D564DEAF6F YULIANANIKOLOVA
2,422,392,998 *FFF257F2BDE79B351CF838AC0BA29C77E228F21E MEANGORDYB
2,422,392,999 *FFF9148E510CACD26F019AA7980D59A1FBB3E042 MEDEONDER
2,422,393,000 *FFFDF6F23C83B3E477A1D3340EEFEEF7BFE0340A yvette.martinez.madrid
2,422,393,001 *FFF0A4ABD957B8738DE7160331198F89E5B81570 YVONNE COSTER HOFSTEDE
2,422,393,002 *FFF82B6B0A12D2353608666338D8B84EFC45E961 MEGHAN-ROCKEY
2,422,393,003 *FFF4BA59E67FD17E185320F82ABEABD3CCA9C9D4 Z126073
2,422,393,004 *FFFA90B0C9F28E17F45AD4F6DFE8FF7EEA3E34E0 ZACHARIAH.GOCEK
2,422,393,005 *FFFFFAA699271A8E2FAAEF2414350C07FF6DCA3F ZACHARIAH.ZELASCO
2,422,393,006 *FFF24AF6503B3748D715C9A7A5A54307016B56AF ZACHARY.BROTMAN
2,422,393,007 *FFF7565998117A9E6A1E781CE0577F2B2472476A memphiscamaro
2,422,393,008 *FFF6F0C645D30342015DC0E9487958E09901B066 [email protected]
2,422,393,009 *FFF9001C0198DB0C0EA96C3047C70BBA2FDDE2E2 ZILLAHUNTCYPHAZ
2,422,393,010 *FFFC2F4F943D091753294533FFBAC689607126C0 mhzaaa
2,422,393,011 *FFFC8835CE889DFEAA293BC88FC418A2A9B6F8BB miltonshattles
2,422,393,012 *FFFEB98BDAA4E04B1E7669EA39F8A598F6AF4C9F mingský
2,422,393,013 *FFF34F03E974678157EF98B6B283469F2BD036A0 mitchellpomella
2,422,393,014 *FFF66815EA881A106CF963D01AEFA6733D1EB9A6 MKUT
2,422,393,015 *FFF473DFA43FB133AFC2D8D08338781051D3C27F неогенска
2,422,393,016 *FFF7940BDABCFD517A048297ECA9F04D853F5644 montane
2,422,393,017 *FFFBBFE70E2D572327BB917842082CA9EFE521F0 РАДИОСВЯЗЬ
2,422,393,018 *FFFC1034AA8A424024DCD1CD82987E36E8DE19E8 РОЗВІЮВАННЯ
2,422,393,019 *FFFFA85981A9E2F0C235992A4570174CE2318D5D MORTON.STEALY
2,422,393,020 *FFF05124791C1C26FFA98FAF44FABE0D6712DDC7 moshearman
2,422,393,021 *FFFEACA6531C0BDEAEB87007D1B6775C38D07652 MUC!14G!NOU5
2,422,393,022 *FFFD9606196142D6042BABCCE41E499E009FBA49 MULIGC
2,422,393,023 *FFFF426166D3C85E4A4CB092449B39460A535588 MYRIEM
2,422,393,024 *FFF4171CE6C8FBFD9D9EB5CD6E656E9FB25EF232 neradih4
2,422,393,025 *FFF90417D7D93A933E6C6FBA170FB5BDDFB17F62 nickolasdiponio
2,422,393,026 *FFF6034F32EA2D42260BCBDE75DFB5E7E4C01688 NINE LITTLE PRELUDES: III PR
2,422,393,027 *FFF976BE0A480B36B1B69E74B413921604F9218F noloveever
2,422,393,028 *FFF929C15CD71BF335DA06A63A97186991B82197 (>-<)o~0~ <####b
2,422,393,029 *FFF3368722ADDDFDE73BA9F12A8B816E0A35ED55 [email protected]$7
2,422,393,030 *FFF558DECF641013FF436789E16505488A917EFF obliterate to dominate
2,422,393,031 *FFFF73BD0A6C061DEF2FD36208DE1842D1E7D179 OLIVER.SPASIANO
2,422,393,032 *FFF93D77D7A35FAF5E5E8DF17523636D8B7F91C8 [email protected]
2,422,393,033 *FFFED682993C095D08C0B6646245397F4D887F3D OMAR.RIDOUT
2,422,393,034 *FFFC37C47B537164C88372527559BB134C6E1DB1 OMER.MUHLSTEIN
2,422,393,035 *FFFDF9E16162EB4C0E98897E549279738BEE9857 }o{O~<=====3
2,422,393,036 *FFFF03D429D125C47A86DFF7B2B75E49A5EBF7DF ophuysen
2,422,393,037 *FFFD7D9E954DF94BC4A489CABCDF39EA75AC3DDF OURBANDISWICKEDSICK(WEHAVETHEFLU)
2,422,393,038 *FFF4984DBE3B1BE9B65F03D32B596A0A3B56A2F1 >-<-~-~-~<---P
2,422,393,039 *FFFA48F9410E3523D98D0992ED343CA40DA2F84F 103.nielsen
2,422,393,040 *FFF4585FFD23E01FF6D093517285D46BC0D4A040 PABLOGIUS
2,422,393,041 *FFF70B1DE4E1715AE9BF6778E9A1FB29BB6BCCBA 10 SELKEE
2,422,393,042 *FFFCB2762CF62B291067E55AD83790DC0ED086D9 11APR95
2,422,393,043 *FFF2F91D403C3284C369E9DF11E7372A49BD4140 PAP1LL1FEROU$
2,422,393,044 *FFF473C3BD904B4C1DBF59BCCC1049F87132AD7B parabranchial!
2,422,393,045 *FFF58F4CA5DB1C84864BCB1E330C96228B1368E3 [email protected]
2,422,393,046 *FFFDAD6C52AFCA83709078808BBDC5C7B5F77C6E p-b ~o~osplat
2,422,393,047 *FFF596BF353C2D868AAA4C9F46C2F0DFABFF786F 121212SNBRD
2,422,393,048 *FFF9AE25A7398C3C39D297FE8319B149CBD0F631 :1・2・4・5・6・8・9・d(確変大当たりである場合もあり)
2,422,393,049 *FFF553041A55BC6C78EF7896722576D6DFF12A84 125485 NYKYISEN.LAINS
2,422,393,050 *FFF6280CCDB8E65B098DE30B109696FD32DF8AC3 [email protected]
2,422,393,051 *FFF90499668EF1FC6E33C905E87C0AA80A8235D4 [email protected]
2,422,393,052 *FFFDDB8994EE332528A5CE0BAB07043D55D1536A pennalkorporationen
2,422,393,053 *FFFECDD75D2F27297E8569113B0043C85CAA5297 PERRY.SEIDER
2,422,393,054 *FFF508CAAA547CE842F13891EAA95E9F306AA462 1472403 totta kai se on t
2,422,393,055 *FFFDFCF76389C03B7B601D7B9DCA0AE28A1E16D6 149395 KUKA-MUISTAA-VIEL
2,422,393,056 *FFF2E5FABCF0C277777C29697C0DB1709CDBEB3F peterdigirolamo
2,422,393,057 *FFF2D37DA81406A4380E970FB2A45DDBB6B4122C 15pikkuneiti
2,422,393,058 *FFFE1C4E64282AB5F351FDCC610AEEA0BBB3BF67 174.ryhm
2,422,393,059 *FFF912D13630EBC1B67A1BBD06BA1716AEDFA4A9 PIIRTMN5
2,422,393,060 *FFF041DC0C84F3DD19AA407DD3A998614AB5F982 pokornie1
2,422,393,061 *FFF028C5A0B6BC0CF8FA877284AC42D8A7D72125 1-BORCLANABILMEK
2,422,393,062 *FFF44BAC5C798F98E7C92B83A17C0890117D8642 PORTEFØLJEFOVALTER
2,422,393,063 *FFF022E8C6EEF87B019715BC69234F8AE1411E8B PORTERCOE
2,422,393,064 *FFFC20B0139FD3A5DCFC5AC27F056CC34EFB17F9 POSSEVINOBARTHLEMY
2,422,393,065 *FFF609841E22330EE3ED29310765904388222F12 1-cephers
2,422,393,066 *FFFDC9AC6B233F20EB94AC63D409D83EF43EE27F POWERREEBOK
2,422,393,067 *FFF186FECBE8E6B5373097B74996599A0FAAED3F 1-end-of-the-millennium
2,422,393,068 *FFFB4C7A8E6F01E97B5EDEE14859E169495A435E 1-enlarged
2,422,393,069 *FFF757F046CDE3146205E7FFCB866AA5827926F4 P===P*>B0
2,422,393,070 *FFF0CC4A6400B784AFFADAF2BED878739B89A881 PRASANWUT
2,422,393,071 *FFFCE3F76767B6827893FD10B6A625EACFD77CEB PRINCEGAVIDIA
2,422,393,072 *FFF14B00A8542160A9D2E35E48EE88519616E46A PRINCE.KETO
2,422,393,073 *FFF60A95ED1DEC013CE283650647D54A84CD86DC progrediency!
2,422,393,074 *FFFD11D31067292A614466A15C007AB93C3F2178 1.JAZZINSTITUTS
2,422,393,075 *FFF0BFBB5404F2F857D3C632D0915B651FE36C6E 1.kandenv
2,422,393,076 *FFF2307568F38D85FA245CFE9ACCE7972C5B48AD 1-kostukkeissa
2,422,393,077 *FFFF049EA900282EE0F8CA9592F65F2256D51E37 1 KULTUR-REGION
2,422,393,078 *FFF5D53950C700A425FBD9B381871199BEE85155 1.landtagsabstimmungen
2,422,393,079 *FFFB8DBCB5036E52AE57AD5845468BA052403501 PUPPETPLAY
2,422,393,080 *FFF6E1B7312329CE192FEF02211446ECC60385D5 1MYKENDALL8
2,422,393,081 *FFF5468BC9D1D67DB2403D66D12F283C802E63B1 qīnggè
2,422,393,082 *FFF7065A8E6E07C2B41EEF0FB7C680A6D82FC972 QUERIED
2,422,393,083 *FFF5B87CCBB39FC1AA647BD706206DFDCFCF81DB r000288
2,422,393,084 *FFF4943CC6420B5016AABB3E06FD6748A1F118B0 1unobstrukte
2,422,393,085 *FFF59292B277C4E9F81D090AFA95FE9E8467792F R3PR3S3N747ON
2,422,393,086 *FFF4CBF757AD89D8AADC0DE45802E242ABDC0BA9 RACHELLEGGE
2,422,393,087 *FFFA13E0876EF42B73AA34B4A5AD68AB026AA123 1 VETOAJONEUVOA
2,422,393,088 *FFF44651C10A4B2141B4D7656BCE5D42490B4D29 RAGGRUPPARTI
2,422,393,089 *FFF6A569B51CBC321E37F8AE5D698A4228FF7594 1.xololen
2,422,393,090 *FFF4C6A86A08AF474F1A10A195947BD3EDCC6CEE RAMON.MOEL
2,422,393,091 *FFFBED2951BED8DEB3E5B735D91219829759068C ramontutko
2,422,393,092 *FFF0FFA279D6CF916736A5E2418C13D886D83BAB randelljaworowski
2,422,393,093 *FFF990053FE14B3D8186458D7402E9A1B7712102 2090967 KUNTALAISILLA ON MY
2,422,393,094 *FFFA45ACD9DB1C329FA90B345264BEF96E67AD8A RA$PINGNE$$
2,422,393,095 *FFFDFA812D6E0154D429386E499FC6CDF582AFD1 RAWATHER
2,422,393,096 *FFF28C06F29E86E3B6FEAAD55D4CF5283D6C91ED 2214RED
2,422,393,097 *FFF6BC74BB8ED2A994652615B20D31B78A65718D 23NOV1052
2,422,393,098 *FFF3D933FA62736390AD6D28D66DB966CC1F567A rehcaepped
2,422,393,099 *FFF2A2429AB680192309100B6C24526DA5A6F26C RELÂMPEJOS
2,422,393,100 *FFFA7E490706DD2928FE901B4777CFDDEA48091D RENERUED
2,422,393,101 *FFFF4D150024244C9A544D99663FD44489F2AF56 2703594 hallanvaarasta-tuli-hyvin-ep
2,422,393,102 *FFF9DA6C74835ACD78E18328C2458552B7B244DA REORSYL6
2,422,393,103 *FFFEC77534A9BBBE0F76CB64309360A0BDC1CA3C 2DARWINSCHEN
2,422,393,104 *FFFD503E4315C6AD4904E5BC7863C27A6178244D REYREY09
2,422,393,105 *FFFA1A0AD677CFE1BDC666DDAC250A630A47736D RHETTMETTEE
2,422,393,106 *FFF6388807B0B20A50CC822AC717E6614383D473 RHOKERER0
2,422,393,107 *FFF7807D74A5054C5CC5BB65F481B59CA71B2290 RICHARD.POMO
2,422,393,108 *FFFDD7BDA0C0871C3E2BCC8A0C5BD616330587FE 2JZCGCYP
2,422,393,109 *FFF74EA9F64E88D31BFAD0ED7835F7CA83D99D76 2MELYNIE
2,422,393,110 *FFFFD697DE461B37933EB96666B31FDDA73A4693 2RUDICLE
2,422,393,111 *FFF481CED337C75CF9355E7CB16A15B3E5170E38 2SONNTAGSGEGNER
2,422,393,112 *FFFB1F462C861553778E37097E21206EB5ECE6F2 RIPPER
2,422,393,113 *FFF03E37DDFB25D1E1878389D82EFF608751CC3C 2vebalI
2,422,393,114 *FFFB15C0A94ED9382C28A22727C6BC99D36F547E [email protected]~0~oSplat
2,422,393,115 *FFF01880FCAC7200960E95CD80A170E1D91AF608 3305C1C0CTIVGQSNDLRSKH0CJUNN2JVN
2,422,393,116 *FFF6FA2EADF41E13FD64722A88348207B908E81E 3B<[email protected]======P
2,422,393,117 *FFF33F74F51072B03FCD00C8DE53C8D6A206211A 3=D.`~.`~;)
2,422,393,118 *FFFD0600B2D02F0264E1398356C4671CACCFE76A 3feb1575
2,422,393,119 *FFF00F99AFB97EA6EEE86A1D1FE07CC529232067 3iaiwwhgu
2,422,393,120 *FFFE3CE819940351242D801F813C330C71CFAF48 3TRAILLE
2,422,393,121 *FFFC7587DC3C11E7DAC7D981FFC33E85983E1FA4 3-TUBFUL
2,422,393,122 *FFF628106FE3D2E22ACF2FCCF75542CB1BF367A3 3UPLIGHTING
2,422,393,123 *FFFD90F3EF17C90C24704BC5F72005E8DF116FBF rostiar
2,422,393,124 *FFF3A838932A4F3E7F18521670F2C02F324FAA3F 424504 kunnanhallitus-on-7.2-.-2001-
2,422,393,125 *FFF31D3EE2526E61D3E4B0AE4E4824923CD42373 rupertbidner
2,422,393,126 *FFFDEEBC1416E6442F6958A11B000BE2B9CB1469 RUSLAN AND LYUDMILA, ACT IV: AKH TY DOLYA, DOLYUSHKA
2,422,393,127 *FFFF0B422952EE155D4F88527EC3357802249427 rusvetcis
2,422,393,128 *FFF97610736D6C02F1A81DD3C8B06FF8267D8FE4 4EINEVNOC
2,422,393,129 *FFF9297C745848398BC19C959E750C9623764ADC 4EVOKERES
2,422,393,130 *FFFC9BE541B64A41A586283459955FD5B6AA95E2 ryhdyttv3
2,422,393,131 *FFF95BD7395BCD27B2192BC1B29A94317CABA1C6 saluaient5
2,422,393,132 *FFF25F4D2DF3878F3B0E9ECCE4B247CAA12C2D92 4PITRESSIN
2,422,393,133 *FFF0EC328E201F418A9B311A16C9763B8426ACF9 SAMMCLEOD
2,422,393,134 *FFF371C47BDD216272236324A8DDE44B7A56AA3D SAMOBENN
2,422,393,135 *FFF6BBD914B505231FDE7E936B750A4C9B966440 samplerforthethoughtsofemerlistdayjacklp
2,422,393,136 *FFFA3A2BAEC40CB70C6737AF5010CCDA16091732 santoopalka
2,422,393,137 *FFFFFF62B4A32184E1CF8F6A7A4ADC69CA5A3EFD 4UKRSKBVDIYSY
2,422,393,138 *FFF2543E513E9260052C720BA7F6BE097CEE274E [email protected]
2,422,393,139 *FFF8F71339C0BE189A0943BAC2152930AC7A86B6 SATYAPASUPULETI
2,422,393,140 *FFFE935BEE0302FD990CCB117781F0A25A4CD417 s:b}
2,422,393,141 *FFF4A5EC967647BF7455735F4F882E0DA6803D32 5810267ij
2,422,393,142 *FFFAF24410FF55AB33E4F85FA41C6E771206B360 5+A13MA+!NG
2,422,393,143 *FFF33C835DC0F6EE60E7CDD04C5409B8E6CE10BE sdhbaa
2,422,393,144 *FFF84A3216F54C5263E72225E0B80E7364803410 sedraiamsed
2,422,393,145 *FFF9CB4250677A60D77E4EA499955386B8194F22 5NITTOGSE
2,422,393,146 *FFF1A072FBBCC2366E0F1738FD52712BDE446CB4 5RHEOLOGICALA
2,422,393,147 *FFF551972DC4FD9505561A4A1F759EDAAB169750 SERPENT,SUN&WORLDENDING
2,422,393,148 *FFF58C881EFB3686E15C3E487621F4E5A3B3DD4B [email protected]
2,422,393,149 *FFF85888AD15D69BDD279CD19A6AF37890FA34DB 5ZEITINTERVALLSES
2,422,393,150 *FFF1377D17742365FD2067CD1674A6AB78958CA5 629anastasia
2,422,393,151 *FFF480836151F83B44D21D7D50855F5686FE28C1 SHAUN.JOWETT
2,422,393,152 *FFFCC8262694C0019BCC56FDD4AFBAC2A5B47C20 6ARODOHR
2,422,393,153 *FFF59D5E41ACBA6423EDFF4B7CCC16FC5F99F712 6BLACKKILLME
2,422,393,154 *FFF325B9E7A159E957FC5E8862D6124332965CB1 6DIGLOTTISM
2,422,393,155 *FFFF22D34C9F61FA7DC14E34B459430FA8A846A7 shingboh
2,422,393,156 *FFFBB74BCD08C86FFDC9B1B26BB3C5B3B13A2C8A SHIROKUZ9
2,422,393,157 *FFF637E898BDC3E13B6076A48F76B26AB6D1E005 SI3WIOR3K
2,422,393,158 *FFFE911861C24FB97E261100FC3F92A957647D0B 6SHANNONBOOSTER
2,422,393,159 *FFF3BE56E7ED8193FF2682AE1A4841E3336F32A9 SIKIRJOITTANEETS
2,422,393,160 *FFF5CA87C0D53153E07891F5ED3E430B733AEBD5 6TTBURNER
2,422,393,161 *FFFA6D3954CD7C60B69DA8A695D40475815167F4 SILVANA-MEDEIROS
2,422,393,162 *FFFA01495D1341423C07685B1975C3EBA14C0209 sing.it.back.(boris.d'luglosch.musical.mix)
2,422,393,163 *FFFEEF62EFAE9F49CF6987B9E1DC3B4FD30AF873 SITTIN'INANALLNITECAFE
2,422,393,164 *FFFDB63BE75553E5E70EF7197BAA245F800A7C6A 7BLACKIECRACKER
2,422,393,165 *FFF4D7851682A104421538B451E846430887F88E [email protected]
2,422,393,166 *FFF106209F650AD3D7ECE6548F3FA7601CB4E1AD sl#o
2,422,393,167 *FFF73117692C8EA50F5DACE48301A0E488D27E17 SNAPPLEG3
2,422,393,168 *FFF6B22E927340881A60F090C4D3DBBC91D6E9EC 7KAZUSANETBSW
2,422,393,169 *FFFAFAE509D8CC8BD8F588BF7231ABAF28BBF0F4 SOAMLEVEN
2,422,393,170 *FFF23DAA36534ACE0738790EBFDF743F0DC326BF sobn
2,422,393,171 *FFFEDBD7F282985BFBD5E2E1986D58CD910048B4 SOKRATEN
2,422,393,172 *FFFE5939EE142BEF0A8E85C92ED070DBAA143067 7NGUYENSMASHING
2,422,393,173 *FFFA17E109D7A881C69518733F26958663E4FF22 SOLUTOION
2,422,393,174 *FFF85776321C17AEEA8C417EFA0068B4E85840FD 7OUTPUNCHPUNCTUATEPUNCTUREPURIFIERPUT
2,422,393,175 *FFF656B087BDAAA3AEC60DBC041022E534B870B8 7R0P1CA1
2,422,393,176 *FFF889E6542346E3433B0C43A320C70F84877A0C sonnyobrion
2,422,393,177 *FFFF5056ECFCAC79920A3DCB08CF8D9A1FE5D170 sorcimas01
2,422,393,178 *FFFFB60CEC75CCB0D8A9C7BFFB2FDE17655F5F67 7WITHOUTDOUBTINDUCE
2,422,393,179 *FFF8E9ACDED2B1072F5A6FDB00A97A722E3AFA5F 80457N91Y
2,422,393,180 *FFFADACAE4A2289318E8E6C086D515E54C0A07DC 834662 YABANCI-SOZC-
2,422,393,181 *FFFCA2E76E1CC1AF118CAE704DA0E9F44D19234E SPIERVERSLAPPINGSMIDDEL7
2,422,393,182 *FFFBC536D3276B7CD9108C6C625233BD7416D8C1 sraalgjir
2,422,393,183 *FFF6CD3C5E2CAC65FF332C56983BF29B933061BF SSENITAEM8
2,422,393,184 *FFF6151DDEA5F5E8C297044ECC1A767B3383BA4B 8IPIQPLXMX
2,422,393,185 *FFF6E35D7E53024F9CEAD20F5B52425F7B53D6C6 8JOELBUBBLES
2,422,393,186 *FFF365B5201A88FC388032AEA195BCA5E31C596E 8KUTUNZA
2,422,393,187 *FFF8C0CC18E23A875B3A6548B0339C426B7B8F8D 8LAPERKIN
2,422,393,188 *FFFC07C21AE3F0226DBB2200EF7C4FF97031A4DD STAKENDE.
2,422,393,189 *FFFAAD25B4186446C3D842C8552A2F8A4D752003 8LOGANCAROLINE
2,422,393,190 *FFF8AAC2DC7B8BB0383ED6D796FDEF04E62132D7 STANLEY.FAERBER
2,422,393,191 *FFF4BB4B8F9154AD2E6894E9A86266E34F2528BC 8MOCTOOFGIBHVARUAGAIDNI
2,422,393,192 *FFF4BD6EE426F2A55DBFDBBFCE0DF56E23764DED 8myavenger3
2,422,393,193 *FFFFB9519A440FAC614D5C77936FA3657B434D20 8mydonkey6
2,422,393,194 *FFFB71D362C4B6FB55926E86FC221A746CA60761 STEFANFERRIE
2,422,393,195 *FFF6F3E2F8FB57C0CA55F4C676FA85B61BEDCA78 STELLAFLANDERS
2,422,393,196 *FFF8612B7092FC65CFC0EBFCDE6A05CDBEA25648 [email protected]
2,422,393,197 *FFFA5E67B5786B6F39B2315E859F889D549901DD STODGES
2,422,393,198 *FFF6128EDBDF662F05A91082AC11F7E798C3CD04 8POLAZITE
2,422,393,199 *FFF71DBE1B166FB20ADF67A3722FA873908863C8 stvarateljstvo
2,422,393,200 *FFF96D75A445BA0118CCA360AE788025291F7AD6 8YUCHIRIC
2,422,393,201 *FFFCDFAF2AFD652582A64BBE01E32A8B95E8CF31 935colton
2,422,393,202 *FFF14C03B4F365AE89FA92850077ADB416C11650 957JERRY
2,422,393,203 *FFFDCD311F94747B2AFEDC9B4E3680162D989718 9BSWGRUBSENNBSW
2,422,393,204 *FFF767BA771B2354B99878A4440809C9020C3D9F SYEDMANZOORMOHIUDDIN
2,422,393,205 *FFF575D7F904C7C28C4E2FA7417FD45FF96F4E37 9CLIMATOTHERAP
2,422,393,206 *FFFCDD557CDADD5D5FC6E04B0BEE65FEB9E63FED 9EASTWOODIN
2,422,393,207 *FFF8BB770EC18B92B5BFC9AB65FFA6D0D54F81E9 9HUEBERTA
2,422,393,208 *FFFEC5450960125CE4A5C6DBA8E15B4DAAC480B2 9ISTICANOJ
2,422,393,209 *FFFF64FFDCCFC7D1204EE41FC88796CCFF7FEE7D 9MINNIEIRELAND
2,422,393,210 *FFF9E572777E3BF5AE46060EACD8BFB45AAA9F1E TALYSSING
2,422,393,211 *FFFEAA7DAC96C9F65B9FCA8455F548A8AF5EBCD8 [email protected]
2,422,393,212 *FFF5F322E321D878D1290961612A07F1DEDD704B [email protected]
2,422,393,213 *FFF59B84B6E65F3D84EA3C2EC2A448370DC756DC [email protected]
2,422,393,214 *FFFE2422BA2C3C639453AF9A01EB3425C87AD799 9sphygmophonic
2,422,393,215 *FFF9976DA34E62DEC78FDD4BD5BDAB6C7248A00B 9STEMELBO
2,422,393,216 *FFFE9C870E16149B27FC294DA0F4D113506AC231 9SUNATNOMORALC
2,422,393,217 *FFFD0CF35DBFF1D8B49CB85CD0D14BF7B031F3DB 9TANGOPYTHON
2,422,393,218 *FFF0AFF2E66E914690E37785E7EE122310AE15CE 9tariffed
2,422,393,219 *FFF1F7DD79A81E6D6BCC1EF2EA32EBFC6AA8C983 9WLIFVLVBSZRT
2,422,393,220 *FFF2D73B42E25CC46AB59C4363E8C8E10716B266 9WORKHEAVY
2,422,393,221 *FFF5F420DE9C716FEE29F030460F79C860DB1CC7 a04pl
2,422,393,222 *FFFE225FF087DE786024AE35C9E1C2286EBD9734 A2UWM
2,422,393,223 *FFF948952932B0F80BAD24185E43BE3E8AA0A3ED TEODOROHOLDAWAY
2,422,393,224 *FFFC3135DFA7B3FF522AC0996E393FD357BE6E74 TEODORON1
2,422,393,225 *FFF1A61CFFF7E311C050A56DD252C6A247C13565 thatfranklin48
2,422,393,226 *FFFE21CD458532FA925A13D7001D30041F9E2DE5 AAB%QO
2,422,393,227 *FFF991E9FB928B20C1DACF0F9339D7078C703296 the-simpsons-sideshow-bob-roberts
2,422,393,228 *FFF4D080B013454DCF85ACFBD40822BC59B22B2E thweora6
2,422,393,229 *FFF814A2151996BFA21EB71A8F51454C575DF01C abdiciranoj0
2,422,393,230 *FFF9979168B936840401C73D90C5D2034FB2BBB8 ABDULESTERLINE
2,422,393,231 *FFFAA70B2E839259B6CC2ED962EC865C7998603C abelhaldi
2,422,393,232 *FFFD9A45DC081F253CA26DF99C8929966E956F05 TIMBERMIDORI1
2,422,393,233 *FFF631DCAAFAB08726015270F3A902C2A85D978B ABSOLUUTSET
2,422,393,234 *FFF4E605508EF5870CDF3B7DE328C59DF0DC426C tnez
2,422,393,235 *FFF5EF3546C78AC722309CFDC73BF12F706A94E5 [email protected]
2,422,393,236 *FFF48E64C98A34EE33E2FE7E0067C079C44A5204 TOTGESCHOSSENEMING
2,422,393,237 *FFF01A211D33E2B672101BF3BF327B6913A8E82C $TR
2,422,393,238 *FFFCF312A614B97EDDA4D4EB728DBF90EFC8633B tretti
2,422,393,239 *FFFE94F9390C9304A81A723D99B657288FE18ECF af#lk
2,422,393,240 *FFFF845F09C28965EFBA86550D660849C0C10808 agsqt
2,422,393,241 *FFFA10C43F96CBBA6D030ECECA7D6A54BB4EA90C A:"i
2,422,393,242 *FFF280C2E313901C3D607C7CB65D3F08F9AC357C TYLERGUITTENNEZ
2,422,393,243 *FFFB5F85B5853423B94A91526038A4EA255D4806 TYLERLEECOLMAN
2,422,393,244 *FFFDB083821B2581E0E633A9D74EF79A53B9E170 [email protected]
2,422,393,245 *FFF657F78DCA66CB26D27A81AFDD628E2DF4FC7F UDSKRIFTSVRDIERNESING
2,422,393,246 *FFFC8F973254FFE4A7A66188EEA28193A9CBA4F4 U!G$
2,422,393,247 *FFF4CAEDF5CAF970D037F5A7BFBF2CE558DDDEBD ULADAKIS9
2,422,393,248 *FFFECD2B9C451A896A6A959873156AC364DAD6A0 a#isu
2,422,393,249 *FFF61AE15C254A3648F4CC1F44A00F79265A5B5C UNNUMBEREDZZZES
2,422,393,250 *FFF3DFBC98EEA51537EA1438D67E4AA5D3868E00 UNPITYING
2,422,393,251 *FFF1EFDAB1D37ECAA56B67D7E494DEB4B3BC80B3 UNSUST4!N4813
2,422,393,252 *FFFE2D5015A302AF05BBA15593A1B0FF015AB73E $UPPLICATION3R
2,422,393,253 *FFFD83D0AF88DF2A87C51A2E37807C84C16FE44C alfonsocelano
2,422,393,254 *FFFEE53520ADC9A80A2A5579F0F59A17EA7D8274 UQH^
2,422,393,255 *FFF7EDE6243BB334585FFD0CA422B161EC0B008F USMOY
2,422,393,256 *FFFD14484BCAB5EA5137F2BD9E1F272C75A2AC00 ALTOU
2,422,393,257 *FFF11E3F2A24910C41719F7401454F5BEF2245D9 valseros9
2,422,393,258 *FFF2BE5F8A5DAFEE14E3EA0AF20BC4BEC90847D8 VANESSAROPKA
2,422,393,259 *FFFDB4286BDE0B6D37527E55F49E012D9F84225C vanilla1962
2,422,393,260 *FFFAC061CA7C1EC21CB270229F6AD85E00FAEF2D [email protected]
2,422,393,261 *FFF0A6E8B3511B1F7934F0B715A89C688CBE837E VEANALIMIN
2,422,393,262 *FFF56A342B530C96EFF8AC9CD27728968E9DC825 amv%i
2,422,393,263 *FFFBF291B7320113F9C2EC561EE8BBFF5E5A1F7F ANDAMANI8
2,422,393,264 *FFFA311790C8D5CD537D68B5E7120FB1B7EE73C5 VERWEIGERTEM7
2,422,393,265 *FFFB81C50592092FFB1B2C12C7F1C6639119175A ANDY.DEFRAIN
2,422,393,266 *FFFDC6237B31C117351CE9CDA3A32447755011BC angelocirrincione
2,422,393,267 *FFFB082AD144B71D08F58B14B5D6B96E591F6BAC ANIKWUE EMMANUEL
2,422,393,268 *FFF2E27A44F2D2AAE1FAFA1028B267DAF6055B7E ANTON.LAZAREV
2,422,393,269 *FFF64E22CB59998370559BCC76168F63B415D71C v'innamora
2,422,393,270 *FFF1DF2F2E96E3B4FD6FB7FF2F209DCF13B89613 anubf
2,422,393,271 *FFF1FE740552AB4C2AFA8EC702C0DD8965E8ABDD visare.bajraktari
2,422,393,272 *FFF29C14AE353374D6FE391759D7A63517525AE2 VISEMOD
2,422,393,273 *FFF198AFE23BD69E29C460EBEBD04DFF62DFDE95 apl-r
2,422,393,274 *FFF380335AAD95922BDC00A2EED6E1DC31AE281F VUVUKATASA
2,422,393,275 *FFFEE1D05E2A7691EC8C0566E037FC8AE621BFC1 AR!I
2,422,393,276 *FFF724C7F6063329796F2E8FDF6C2C286DF7BFAA [email protected]
2,422,393,277 *FFF497980D77C46D86876D275F393C4FC91CAF9B [email protected]
2,422,393,278 *FFF3A9E7EE8667F059114A45E7FAC084BB48EB6A [email protected]
2,422,393,279 *FFF4A9B58F2A673CF1B59EBB73097F573B951D38 WARNERHATTON9
2,422,393,280 *FFF6BB44CCAF7C380ACC38A25A3146901D1F0088 arruinasteis
2,422,393,281 *FFF023E06D589E4D92562E6B7B77F7F23C8D0D8A artkq
2,422,393,282 *FFF31B345F58D152FD964F0F636310A4E2A054A5 watchyourstep(medley)
2,422,393,283 *FFF2E6CDE87AEC4428E3209F953BA232CF7D55E6 a/sr4
2,422,393,284 *FFF273758001B0707DFDB0D0DCD713A6C574B215 [email protected]
2,422,393,285 *FFF01590B2AEC5E81B3C9E4268DB75D6457B8914 [email protected]
2,422,393,286 *FFFDE2A0CD3202EECAA01AF6D5E83D52BB0E51D3 WERNERTRANCOSO
2,422,393,287 *FFFE83293E52E6077E7F66A20E5EED3B60BA5A97 aurelioburroughs
2,422,393,288 *FFF34603281D33673FEB77F1C47CC86A89E22F73 AURELIO.UNKNOW
2,422,393,289 *FFFEC945D7B3BC452CFD635717EA9B3C8673B7B5 WHELLAN-PINGOY
2,422,393,290 *FFF1A76D915FEC528BDE60F9D2E5F0BD829ECFC1 AVAMF
2,422,393,291 *FFF42FE734F4E232D57968E712ACAD1E22A6B855 avenilda3
2,422,393,292 *FFFC6C4C77872216CB841CA8E6CB6DE883F667C6 AVT+6
2,422,393,293 *FFF0E3C3711310C7D507491E9CCCB69592768B01 williammagers
2,422,393,294 *FFF5C3BF4CC6DCCE7229852C8546D66F3F781EC6 willieberling
2,422,393,295 *FFFA403F66A9C8A807C28C9C335B4F970589BBE3 A#YKY
2,422,393,296 *FFF543D9D234892101402349BFDD29DD326FDD6C WOODROW.RAINWATER
2,422,393,297 *FFF2A44E33021EE853BBFD9722B321FE540DF90D B1097386
2,422,393,298 *FFF96F0883B31FA00D9E0CB33E1ABAAF4658BE54 [email protected]
2,422,393,299 *FFF851A5F15F8FC2F8F873459EDAEA618D2FABF6 WSZEMIERZYCE
2,422,393,300 *FFF93BF29773B96EE278CDE7BDE8B02B895F2751 BADANKEN
2,422,393,301 *FFF4B71D3B3BCA19A93A288D638BDC4512A2AA02 BADBOYKILLA
2,422,393,302 *FFFDDEAAE88AC38483D6C0FF1085E5F581CC76AF bakeries
2,422,393,303 *FFF06AA55B24A6C3014A31B0A565A16DE910C37D WYATT.POITEVINT
2,422,393,304 *FFF7604D3E5F890915BB2FFE09370576885C9780 baleo
2,422,393,305 *FFF1F44DB7609AD184965FE9B55C9A5636E3AB4A [email protected]
2,422,393,306 *FFF6BAF578110B5BB1339C98E515334D0627FDFD [email protected]
2,422,393,307 *FFF94660C3D6BE738FD85E7B98B6D41853A33CD4 XJ_Y
2,422,393,308 *FFFFC16C5A6723D4978AEEC122CFA3324267FD3E BD?S?
2,422,393,309 *FFF5F612065D25D3B1179331EF97DE0EB16D7A1F YANGNIDAI
2,422,393,310 *FFF027C2AFFE9FE212E45438BA90AA9974A3A168 b/e/
2,422,393,311 *FFFB7290C811AF2BF4CE42CC4FB887D44E7BB35A bei9t
2,422,393,312 *FFFCC52C342D00C1BFA750231642FF024893825D YOQQKCD5
2,422,393,313 *FFFCF71794006BDE1015BE7CF552E4E4E105E5FC you-groove-me-(feat.-kemdi)
2,422,393,314 *FFF713AFEB7A410FBAD0FE1008C8C7DC105D92E3 YOUNG.GEVEDON
2,422,393,315 *FFF70286AAFBF79A830C8ADB11413982A4A8A8C9 YOUNG.KANO
2,422,393,316 *FFF5E364B6017FDEC820523B6DE2B81424BF8B4B YOUSRYMOUSSA
2,422,393,317 *FFFFEB7E5B6D7D9DBB43B194DEF44E9CC77F37A0 [email protected]
2,422,393,318 *FFFBBC6F5A962A583BE7244238A5BF77CE9EF0A3 YULY BUDIYANTI
2,422,393,319 *FFF2C1FF1F1395066448194105BB8E5BB75FEE9F ZACHARIAHJONAS
2,422,393,320 *FFFA35BF9F81CF2C11808CEB1816D69C9AA71DB7 ZACHARY.BOCKHOLT
2,422,393,321 *FFFD3604740CD550B43F2051449B58653225C785 ZACKCAPELLO
2,422,393,322 *FFF8508C37666B814700592C0AFC4353133948D2 ZANDIAANDREWS
2,422,393,323 *FFF33AA3B15B0508D7BE7B5D7B4E30281DF6D93D ZEHUNTAR
2,422,393,324 *FFF6D92F324D2D504500D61A88D9E979FCAA37C1 BGCX/
2,422,393,325 *FFF1FA48BCF5EFB11786EC3A58BADF8AA70E829D [email protected]
2,422,393,326 *FFF16338620631370BC7DC2D2615A30EE6962AE4 BHVK"
2,422,393,327 *FFFAAA3429706E0A44B87664F80710867022AB4A zhou.junyi
2,422,393,328 *FFF8709AD9E6764744C2278D3B74CBE1759818A7 ZMCCRAVEY
2,422,393,329 *FFF2B4D880C0D8E0B6F8D3D89E9C1F6D05113361 ZMUHAIDAT
2,422,393,330 *FFF49A864924EC65BB3170C1675DDBE99A2AF977 z,=njv0vin0
2,422,393,331 *FFF1A8714659164E36FB486D3B7DC88DB1A71878 BKCLJTKG91
2,422,393,332 *FFF89CC99A65265519991E6B5DFB1DE6E972342F bltnssn3
2,422,393,333 *FFFF16115A4C7F8BE719107CA7F2FE55C0BC70E5 e
2,422,393,334 *FFF0311F3280CB4BA177C5F1DC0E008D43F926C3 B/m
2,422,393,335 *FFF75030E3BE60502731CD8C80E709716344DB89 b=====p.~o.~o3b<
2,422,393,336 *FFF77D4BF72A1A330079CEAD6717BB65C84C45D1 Brand SuidAfrika
2,422,393,337 *FFF9C82E10EFD685C96AF53E58008F03E4003901 B+R=E
2,422,393,338 *FFF776D80115226D8249C79C2FA91D9367B6EB78 brockhonnette
2,422,393,339 *FFF3BC48069644C67476D1B799336B58264366F5 BRUNO.LOGGAINS
2,422,393,340 *FFF5852ABADA43704F945B23D5918B42D64771BB 110.songs
2,422,393,341 *FFF77DA0CDE9FE6B1C60929C49FCB4F6E13BF645 BRYCEN278
2,422,393,342 *FFF852E202674EE9DE5A82980914A6DEAF175FFC 124ANGELIQUE
2,422,393,343 *FFF7F0A0940E1DF6208137C833B1642067550CE9 1422764 i-want-to-force-people-to-think-.
2,422,393,344 *FFFBA6CD1C98CB083AF7354360584B19595C7559 buitenkansje
2,422,393,345 *FFFE344D1F6E4FD047D9B9B633A3F2C28795FF58 BU=S
2,422,393,346 *FFFB5A26944ECCF4C971D4C5783C1D1465B2053A bvex6
2,422,393,347 *FFF0A24CA1D2BEFD35CED40E479AD344848B1056 byrthyns
2,422,393,348 *FFF338BB02FE467BB0EC55211ED79767ADB2C2D0 14jamal's
2,422,393,349 *FFF66BF437FC6FA97B87036DD3C4C178D471B3A7 1503901 KUINKA IHANAA , KUN EI KOSKAAN TARVITSE SANOA : " MIN
2,422,393,350 *FFF5458C8DB0D1521988A008845585ABEB5B0D46 1539721 KAIKENKAIKKIAANKROONISETSUOLITULEHDUKSETLIS
2,422,393,351 *FFFD1F24FC4C95C306FA2CA3C6F5FA0EE4F985D7 1582090 aber davon wollen die ducefans nichts hoeren .
2,422,393,352 *FFFB5DA376D41F04B34A22DB842332F1C562CBA5 15-nordmeister
2,422,393,353 *FFF6BD84E59854C402B5AE6BEEA34510743ADC4E 1653514 opiskelijat haluavat alennuksia bussilippuihin , lis
2,422,393,354 *FFF88F74D2047D1E62C1CBDBA21FE9FB093EACEB c6#m
2,422,393,355 *FFF632C84B27E1F2134E933D57B0F4C6FBF5F76A c%6u
2,422,393,356 *FFF10A77ECF124FF1EC4827F69EA18919B5DC79B c;+9v
2,422,393,357 *FFFFB4F6DDB021BEC109E627CF390CAA8EA9D263 1675475 aikuisopintoraha on 25 % opintoja edelt
2,422,393,358 *FFF60CEED3F5ACC9BAFB9118FBAE5949D0A0DE74 cadency
2,422,393,359 *FFF57E9879864EB17178445F197C534EEC6B9741 CALVINDESTINA
2,422,393,360 *FFF9FD97AFA5E2D3A5C34E6CDFA6882078C9D396 CAMNKAT
2,422,393,361 *FFF676EAC6BBB74D65BC981DD225A0FA29110DFC careymclarty
2,422,393,362 *FFFA3F2B892DDA0FFB81C813EFFB35DFF7672DC4 CARRAROM
2,422,393,363 *FFF4271B83DF2552EE76DB01FC0B48F24F02D18B CASEYBEERMAN
2,422,393,364 *FFF506C013A4F3B42DADB88B5FFBC0C7D71AE5AB 1 heiligabendregelung
2,422,393,365 *FFFC7F9636EEA4CB62EF61CF092FC9D280A540B7 1HOISNE
2,422,393,366 *FFF7F8D67B7871486970A1479566B05FE3643E7C CAVASES7
2,422,393,367 *FFFBE865544E88847F18690DEA0996CC3D83C769 cbpapproved
2,422,393,368 *FFF9CFA21B26B92ED8AB8AFAA50411359CE9C8FE CB.R3
2,422,393,369 *FFFE2E759DACC19211ACC88D7E8E110D17FA5B95 c?!=c
2,422,393,370 *FFFB81E865573617BA99ED15C300CD8055C3DF77 [email protected]
2,422,393,371 *FFFED56ED1E7311B1BE86910D35F861B96F39FF3 CCS7T
2,422,393,372 *FFF4F2B5843BF8416679A6773740FA8382823250 1 MOSLEM-BRUEDER
2,422,393,373 *FFFF973E41651D536614DE5A4C673CC632716E26 1-mustangimme
2,422,393,374 *FFFFC0747DF2AA35BD8276FA6BBFCB069FF233CC center room
2,422,393,375 *FFF066E3AE9A5BCF5FE220DA65DA865BFA56DD30 1 ORTLERSKIARENA
2,422,393,376 *FFFA59412A3F77EAD7DB43C0E1806AC2E134B14E 1-palautuskaavan
2,422,393,377 *FFF7ED1A8A43AA7A5F65783D473D6DE809F834CD 1RYDBERG-RAJAMAA
2,422,393,378 *FFF339E3ADEC4D18D4EB65DF251CDC81E855B045 1-scheinarchitektur
2,422,393,379 *FFF01B7CABC06439B482DCD2833D170D9E0AA998 CHADWICK.ENRICO
2,422,393,380 *FFF585E8EA9B7EB2F9ED80BE4C4D98F0982B0554 CHANCEHAUBRICH
2,422,393,381 *FFFA92F8880C672ABA779670B2D1677A11FCB1BC 1-shainee
2,422,393,382 *FFFA889268064923970D65FC1780050E5DAFDFA9 1thatblahblah1
2,422,393,383 *FFF78BBF5A9A7A4F96C87E00D0C0A2940BB190AB 1UMSCHATTEN
2,422,393,384 *FFF7007B5F986039603F6CDC1EC9AE54537BBB32 1VANNRETT
2,422,393,385 *FFF35F78F03800D0CA2D0C29721DDC76315A2C3C che2g
2,422,393,386 *FFF348FF189AB6A6B0FFA4683A2ABF3B1FCC3F9C 1 yazgn
2,422,393,387 *FFF27718D74E92000568127FE6CD9229B52E4A18 1-YESCAS
2,422,393,388 *FFFBF7D2637A0ED2E799BFABBAA43F9B01BD6C5E [email protected]
2,422,393,389 *FFFEDF89EE6669A99AF4885399A8A08D24EC2F3E 2030532 esliegtjetztalleinanchristophdaum
2,422,393,390 *FFF82ECADE882806C5B6F4B9ECBA912142ED91F1 CHIEFAINSHIP
2,422,393,391 *FFF0A9E8A8E67EFF4A18472824EFE28FDF02DE77 [email protected]
2,422,393,392 *FFFAD365EBF5D093F1687250EADABFF291CD6D97 CHINPINEDA
2,422,393,393 *FFF0124FCAA0640469F9E959DD5095E37CC5EDA0 chlorophoenicite
2,422,393,394 *FFFA1E9C71BD7B8750425EDCBA60B694C06CFFFD 21a6641dd036bb0f58ef1d35cb66f760psbarlage
2,422,393,395 *FFFD36ABFF9CAF98881A25EDB3C731C44D705EC2 CHRISTINE YUE
2,422,393,396 *FFFEB5AD8E508BB0A1A35F33894F84B5595DADE3 22-VAKUUTUSMAKSUT
2,422,393,397 *FFF1B86924E2CC01703117C6718DEA06C73B6BDB CHUNG.HARBOR
2,422,393,398 *FFF0A31FCDB34EA25F0A987D91B88153B7AF07F5 CHUUKAAKIO
2,422,393,399 *FFF855D7B726A209FA8BEA61AD26167BB9B6F91E 2630193 USEIN.TERVEYDENHUOLLON.MY
2,422,393,400 *FFF4CA082DB03647C10E4FE1CC51A2836477FECA 26-ESSEX
2,422,393,401 *FFF469FD9F47AEC377D6A9EBEAFA181B6C0DDBF5 clareth7
2,422,393,402 *FFFF703D2A0BCF0BE1E80B10AB79A440BF1883C3 2815200 HAASTEITA.TULEVINA.VUOSINA.TUOVAT.GMO-VALVONTAS
2,422,393,403 *FFF1081E677C398A232B68D284C523890D465459 2EGUANEZL
2,422,393,404 *FFFA429CAA42CBB9A32B2E0D9AAEBEA82EB81FB6 2fittsin
2,422,393,405 *FFF4637FCFAE909685D3D1CB013A410304CEA9F0 2FRDNNRS
2,422,393,406 *FFFB90994AD7F5D83C74B2F65594AAE4F0EFF70B CM$T
2,422,393,407 *FFF1E7DFFF53D8E16F396DE29AF81DF780AF8E8D c($n
2,422,393,408 *FFFA9E921816A087EF02251C996283BC612BB2C1 [email protected]
2,422,393,409 *FFF923B7405B7840533F2F64D07653F39B577D44 2-grujic
2,422,393,410 *FFFF5321A7E9826BE723E946A77E92E01D4A5C50 C%NTH
2,422,393,411 *FFF4B7F65841B073E7BBAF6254F1A4E293DEB36A CODIRECTIONS
2,422,393,412 *FFF7C2F9F1E20699575F8EECFE3F5252F745FEAD 2.playermanager
2,422,393,413 *FFF157557C8C278008195AAD2C80B369843DBB90 COLLAGE-(SIGLA)
2,422,393,414 *FFF2FA1F176F72D5A013CA662AB23BB0F4C506EC COLLOQUIALN3SS
2,422,393,415 *FFF7B9240A70572EB7D7CB8B6871D273C0BE25B9 co:m
2,422,393,416 *FFFD5242BBA8B24B782E9865E60AD1E86052F223 concepttbone
2,422,393,417 *FFF6900A6D754EAFCED917CD2408A9FA8420279A 2sadeedition
2,422,393,418 *FFF70693E1C1C344CBF5F880FDF0B4A17458EC01 continuerebbero
2,422,393,419 *FFF387CF8B400FC1D0358D5B778DD5603ADD4629 361132 OMISTAN.N
2,422,393,420 *FFF8C12C349D84315C59DDFC26DF47AC16F5B1CF 369904 PRYOR , 3 D S AFR
2,422,393,421 *FFFCD9C39F1E878064A3C41408051DD1F0F93588 CPHA
2,422,393,422 *FFF09646067BBBD310BEEFED97F559512779B850 3 COPORATE
2,422,393,423 *FFF39F7ABC6AB9B5352103C409BB03581C845BA1 3#D~~~)O(
2,422,393,424 *FFF7019DAD11D9F0F820A124F71EC2DACE29A40A 3FERULESES
2,422,393,425 *FFF5D4C7A56FCFEB61AF66D930FBB1A247EA8302 [email protected]@L
2,422,393,426 *FFFE7273B4CC3B0AF85F330BC4E984B39A5A4861 3THEME0
2,422,393,427 *FFF798EC9E5F94206860AE7B9A1CCC361F2B52BF 4 ALLASKAAPPIIN
2,422,393,428 *FFF79508CB86F1DC05F76D991B555A42700A2CED CRUZ.FEGURGUR
2,422,393,429 *FFF851DF7709503C58A35A0A77CB7A26689ED040 4CUORRUOC
2,422,393,430 *FFF8B1B48180468381E698FBF63D62235A7E4009 4.debley
2,422,393,431 *FFF0DE45A58632CFD7CAD1203199B3B5A5DBBAC2 c-sharp-2005-(alphazone-remix)
2,422,393,432 *FFF499556FABCDB2B93A6CF57FC06075345D1459 CTWMD
2,422,393,433 *FFF2C6EFE9B773700567E6B7BD950FD1467DEB99 4ILUVBILLY10
2,422,393,434 *FFF8C8507A438D363933452E14D513A3DEF7AFED 4LIPPUSTEN
2,422,393,435 *FFF3E9D666745AE08D4BCA0271599C284502B8AB 4LOOOOONG
2,422,393,436 *FFF57B9430582D26B2494C92FF458383514AB061 4MYSERVER8
2,422,393,437 *FFFBF0DD84D5CDBB4C4AC0E1DE36F9F88D121C3A cxi=o
2,422,393,438 *FFF398721B7A17098578C14BAFF7D6C386047F4A CXUDF
2,422,393,439 *FFFAB6356FDB0A6E0BBD02CC65A00C1553E7C3DF 4PREJEDU
2,422,393,440 *FFFE410E3F28A90C763356B0B19E5A047712BB67 cynthiacheatham
2,422,393,441 *FFFA5410E0C3EC93077A9C22CF9BCD310295AC96 4stehlen
2,422,393,442 *FFF3D60C62895A146916333682CD376138EC0F93 d0)g6
2,422,393,443 *FFF72B3B8A147B5C72EB44DF9529333B99557F35 5: 5 # & TRANSSHIPMENT
2,422,393,444 *FFF58DFB81CCCC7BC81B8A5BA8BF488431E2A271 56kilometerlangen
2,422,393,445 *FFF04BD6F2911404B24A54AFF3107C9085F46FEA 588687 daha-saglam-ve-kullanici-dostu-gelistirme-platformu-.
2,422,393,446 *FFF6298DEF6D3D502EB3E7D10DC84F0DCCAD05D7 5AGGIUNGEVO
2,422,393,447 *FFF7285A9566B0AAD367B31FE6360D2E5E72A630 5BANURID
2,422,393,448 *FFF4F6713CA109FA23870022DBDE6B16E3A65574 5GHILGAIS
2,422,393,449 *FFF844928750A72469902A5C1BD8404E53649611 D2O_G
2,422,393,450 *FFF8805F7D3DDE551DBAD5CCDB9D93A87C7CDD35 5H4N1K4
2,422,393,451 *FFF1B145BF2F15BA7ED28662E24CBBF1275792CE 5iamskidoo0
2,422,393,452 *FFF100854150E3FBE7707271A74D5E2B22400420 5.LOPPUKATSELMUKSESSA
2,422,393,453 *FFF05646F18436A65387F9108707DCD2E8E5D29B 5OFICJALNYM
2,422,393,454 *FFF3D4633CBF5BED92C1CAEAD0D34B775387C5AB 5PCJVTWKL
2,422,393,455 *FFFABEA8CB5A75BCBDD6153B35B57CFA0600678B [email protected]
2,422,393,456 *FFFB81E421E2981FFFBD83F429AC068D9B32DEE1 5puustoinen
2,422,393,457 *FFFFACA08FDDDFE892F541936D71B3FCD771ACBD 5ROLLERPRESS
2,422,393,458 *FFF0E222AB7DFD50D844F771E4580BB4BBAF148B dalecrnich
2,422,393,459 *FFF90BCDEA53522F5E36443C567D8039F101B050 5SPANKYMELANIE
2,422,393,460 *FFF0F64DFF449E401B94382F19DE84B23CB00B2B 5TAURUSTRAVEL
2,422,393,461 *FFFA414E2C56201B6A2D8AC7C94A1FC81CEED6BE dallasgrall
2,422,393,462 *FFF1A68FCBB2B9B4C2BFADF05061033C9365846D dana3898
2,422,393,463 *FFF2437CF3599717D0788428EE89256568383D91 DAN.CARREL
2,422,393,464 *FFF79E36436967A41FD78D6F99006C64C4E003BF DANIALFAIRCHILD
2,422,393,465 *FFF3946CF477E17E34668762469FCAAA2DA529EA 5TY
2,422,393,466 *FFF529910B1CCCA9AAE575125A7B16534F116D9E dannyledo
2,422,393,467 *FFFA96EAAF22FF0FCCBC46BDB087381FD9AA3B64 606956 kiinaonvaltavamaa,jossaolotvaihtelevatjamy
2,422,393,468 *FFF53A29589EDBB5914589F613670E87D94EA046 DAREN.BOULET
2,422,393,469 *FFF623A6EA93BD0A5A6978CD3C83AA00D2538343 DARIUSMENGHINI
2,422,393,470 *FFFA2E34F224E4312D6D24B28A7CE69326EFCDB6 647GRETA
2,422,393,471 *FFF5DE36DB39F707F3464385FAA71D48B042DCF3 d;cnl
2,422,393,472 *FFF8462386FA1949953F58E797EB3AFBD8AD14B6 DDIAKITE
2,422,393,473 *FFFC9C2BFCCF5CE2685EE8BC64E37C6DFCE5C9A2 6-malzemenizi
2,422,393,474 *FFFE7B1802EAC96BF19EEE0EB4DDC4240EF2F614 DEB-NIENHUIS
2,422,393,475 *FFF6DF8CBCA9364626E1941FD4A275577F4A4A30 DECLIVITES
2,422,393,476 *FFFBE31625BF18F22C16344A6B295F67BE4CE335 deFlore(CharlesWebster'sLatinLoversmix)
2,422,393,477 *FFF774275690942EC691BF8E98F7750644CAFE69 DE NAVARRA
2,422,393,478 *FFF718F442656D76828C44D72D52D0286F9E9E03 7011152
2,422,393,479 *FFFBBB131729627816F72C687493BC42CCB761C0 7A96AE54A25FA543018EAD5EBBACA4E9.SCHMOM
2,422,393,480 *FFFE146D19B5621BF6B66D7F45055BFCBB3DBFCC DEREK.ZEA
2,422,393,481 *FFF4745CE5312A17C14A6A49740A4E378C075DCE DESIREE GOMEZ HERNANDEZ
2,422,393,482 *FFF3B64727CE8CFC3EB5DA3D6EDA8BA0816C85D9 detarnowsky
2,422,393,483 *FFFDBE19D132BA1686169C5C1A3E8B9D026E6845 7ENTIVANO
2,422,393,484 *FFF23C6EF8767CAD76F3D79824BF85F38CBA3561 7PLATOROSES
2,422,393,485 *FFF16ACEE7516896D925503AD86F6E828CEEF550 7SNEAKERNETS
2,422,393,486 *FFF83C9987CDF65115AAD6D1173022430B383EF0 DIAMANTIFE
2,422,393,487 *FFFECE4780D2212BDC4991FFE5D7C4EABA4D9CB3 869953 HENKISEN YHTEISTY
2,422,393,488 *FFF98A0C00DEB1CDECD80EDE0AC62446A6CA612D DILSK
2,422,393,489 *FFFF474A25E7701951A4B111822F6BC9D1B0DF50 8BSWWRITEPICTURE
2,422,393,490 *FFF283CCA773D58CD53912B2F7A0A95D8BED1E67 discocactus-crassispinus-ssp-araguaiensis
2,422,393,491 *FFF7820485D12E2E42E37F083F291F92C62F29DF )8(~.`D==B
2,422,393,492 *FFF380C4B3F770953C94E8297571B463BF7CF47D 8#D.~oUU
2,422,393,493 *FFFEE172E5393A77D884552A918892BC8EA9E484 DJFDJ
2,422,393,494 *FFF30EFB82DBC55005180C74C5FE705226EC5132 8GRAPHICKNIGHT
2,422,393,495 *FFFD7EF3C809039C759103F4CE6DE333B4FDC8F8 8HERESIOGRAPHERS
2,422,393,496 *FFFD3A73E969E321B549AC30DACF0B7F4CEB36BF DMG;
2,422,393,497 *FFF8B1C373A024DCE030C0D957CEA49E0B71AA10 [email protected]
2,422,393,498 *FFF355B4323ECA1BC913347F232D402D19472ED8 8MSIPORTOTUA
2,422,393,499 *FFFF2D70324452A901D2C02109F3C1F219BB9D0D 8NIMITTAAYA
2,422,393,500 *FFFF626A051B0730CDC4A8360A66046DBC1689A6 8OCIAMOS
2,422,393,501 *FFF595C563C5BE1F0ABA5DF98DF3DA61CB54641F }8{O~.O~Q8
2,422,393,502 *FFFE2BC6F654223DCF1096142D714D4249DEEE17 8PLUTOKRACIJA
2,422,393,503 *FFF7004AB3FB500D7507D981701A5A191A2DD255 8------P*-)X(
2,422,393,504 *FFF8D169914CED952482039DEB0BA84D6271525C donnie.gosnell
2,422,393,505 *FFF1008255F2F57A447BDF79873FF6455B5C90B1 [email protected]
2,422,393,506 *FFFB9D1B6C267CD4BE8B0ACDFF99D2A2E22DD73B DOUGLAS.NOYE
2,422,393,507 *FFF092121909E3638EA5F77D1A792480988ED8DE DOVESSES0
2,422,393,508 *FFF0035E8B2641E29BD9B6C2E7B9F37853C8055B 943148 taidettiin.siin
2,422,393,509 *FFFD2A64752B7844D4DC4D8CEB288E8003474C51 957ALLEN
2,422,393,510 *FFFDFDA4B55454E896E0BF0D036D7E05021A4A78 drew.weston
2,422,393,511 *FFF816E2FFDB893489C19A4E963A40DB9FB6934B d.thl
2,422,393,512 *FFF98AD85765508BC05098DF0C615F10F2A10D27 [email protected]
2,422,393,513 *FFF7B90BCBEE827F5855E876665964ECF18C7D10 dukeqwert4
2,422,393,514 *FFFFFA52988B9B49FDA0B3AC6A1FF4887A7059F0 D(UN
2,422,393,515 *FFF504F665350D00C9D03BE2C414E3ECB75584E9 9PALETKI
2,422,393,516 *FFFF667D55010FAF9FC8469296A7198250C470D3 9REDACTORES
2,422,393,517 *FFF537065F57B83BF471B1F2F0384364F1BAC8F4 A4HTR
2,422,393,518 *FFF913879C76B0D933AFD0F95863FE3D6C1BC391 ECTOBRON
2,422,393,519 *FFFC2CEFFF8CFAE3B2C015968B3CAE53E27F3AD0 edom.nigussie
2,422,393,520 *FFFCC01FD1719B21BEC6B355DB49CB4F0789B95A edtpg
2,422,393,521 *FFF3BE46AFF70646C27D8424BBF42C4B1C7B6D4F EINZIEHBS
2,422,393,522 *FFFF54AFFEEB3EEE51ACBAAB1BA8C3DD1BE90474 ELIRESING
2,422,393,523 *FFF796A06B54F21E882D7A3379B5AEE56C963776 aad)`
2,422,393,524 *FFF4AAEB34F5293153B0A4B4432EA217AE1BB62B aa+z&
2,422,393,525 *FFFD2AF96A61FCFCCA8E729DDBA1FCAD9B04E80D ABP_Q
2,422,393,526 *FFFE5CD433FFCF983B87034EC5D4A46418430F04 absolutisations3
2,422,393,527 *FFF3AF1EC5226617903AC774966B49C2101015E5 ab$tracted
2,422,393,528 *FFF9A14945F968A06365F5BBA498B714582D160B encylopedicyet
2,422,393,529 *FFF8A4D85D9D53B3BF605DB4F397509FF3061121 engreens9
2,422,393,530 *FFFA39091523FA77BD56B015FCF1499FAE080528 [email protected],
2,422,393,531 *FFF873E8D5ECF20E9B0ABD09DEF0464A2674C8D6 ADOROTEHUGO
2,422,393,532 *FFFEA2132A29B1A6C39AFD0B67B3FB8C05A51464 AD#V
2,422,393,533 *FFFFAD004F4F92DB37CE17B4864651AF520A7F63 erturbed0
2,422,393,534 *FFFAC438FB89327729E95D6931C1BE1FEEFA23E6 AE.L;
2,422,393,535 *FFFD3B7BAA19193A69B15C4CF9CBA0B73194E94D ETUDENO.7INEMINOR
2,422,393,536 *FFF5EE4CB570651D43CE3EFEC1833B1F8B6D817D everettterris
2,422,393,537 *FFFBF28EB754461698CC3D5EE8274E118EF727D7 AHMED.TINTLE
2,422,393,538 *FFF3B9F27A6F2D116DDCA4C455CBDB99984934A9 AHRENVIOLFELD
2,422,393,539 *FFF9A4AFEA2642D3EBCD2989C9E315F7B38EAED2 AIDEN GILL
2,422,393,540 *FFF3DC65C11DE1DB849E17690140EE07D0D82880 AIMELYHCS
2,422,393,541 *FFF68FE052BFC13D80CFE1D28F914FF40E18480C EZEQUIELMCKEWEN
2,422,393,542 *FFFA7570ABFA9417E8EFC96F5925873FAFD5FDC0 AJIBUDIONO
2,422,393,543 *FFF04D08E5DEDC4DB14B51DDFC180BD5C0A06886 A-KJ?
2,422,393,544 *FFFA17FC7B0027208AFAF77479E3002AF914A05E F6\K
2,422,393,545 *FFFEBEBCB33DFCAFDB8D0D2F3654E36BF06C634C FALLINGINLOVEISASTUPIDHABIT
2,422,393,546 *FFFB0F0C0C805FB6A68B3827886EA048B63100EB FARIZANDY
2,422,393,547 *FFF713F9022097650636B171AB23662ECB693BBB faustinobing
2,422,393,548 *FFFB8CB41B5DEC254E626CF1D93FC124F539A07F [email protected]
2,422,393,549 *FFFD66890EFC1EED1AE53F35A9D9D51E59F62EEA fe7glfl
2,422,393,550 *FFF8CE8160D5060FBA51021AA73E4EBD46786A45 ALEX.PIH
2,422,393,551 *FFF3724CE1BDC188B057C73326F3F4A87F0AE355 ALFREDPLOOF
2,422,393,552 *FFF4EA8CD223B0AE8FD48C75C5EE04363B32E1D3 FENISCIA1
2,422,393,553 *FFFD064DF2453544EA841C60F1B8143D8E8EB167 alittlesouthsidesoul
2,422,393,554 *FFFDF1ED0162F179665178CC14F1F3424DC8391B [email protected]
2,422,393,555 *FFFEE918E57C891F6BD1EBD94D76EFACC58A045D «figueira
2,422,393,556 *FFF43EC78CDC5365253629BB8C172C3C6B07A945 [email protected]
2,422,393,557 *FFFC3CA69A63146B72727F91BE4B3699FB76FB48 ALUP
2,422,393,558 *FFFC295F605F42354E3860FB696DD9B3168E9A62 fletchermordaunt
2,422,393,559 *FFF1141A968506A112F9C4A568C5C88836FEB96A a$)mb
2,422,393,560 *FFFEA5B2A8752A802EF88A991DDE26250B339A86 [email protected]
2,422,393,561 *FFF8C5D89D821C86CD49E7E9A4FFCD2C3ADB9199 FLORENTINOFUNARO
2,422,393,562 *FFF9D383E56A1618D2E28E99541C3B0E02C97D60 A-mi-entender
2,422,393,563 *FFFD61C1F0D207ED4721F20E7AED0AC3B947E382 FL?X
2,422,393,564 *FFF28A608A51295F7D0351EA101648154D0F1460 ancestral circle
2,422,393,565 *FFF7910468792ACCCEE5833F3DCFE97486CE45AE andro-santoso
2,422,393,566 *FFF2B150E94843B23D34C28B5194C5C7D51B429C FrauenliebeundLeben,Op42:Ichkann'snichtfassen,nichtglauben
2,422,393,567 *FFF08DB76EB9C2C74D8DFC54A2528428CA811FCD anestetyk
2,422,393,568 *FFF74C7875F8E05EC66DF5AA6074958F0A925B77 FUTENPAAR
2,422,393,569 *FFF41FB21CB444A6131226B3F19368E13DD1E4D3 [email protected]
2,422,393,570 *FFFEA1BDBB54B2EE760C03CABD283502C4BC80A3 antonioastafan
2,422,393,571 *FFFB36C8D52C14F327FFEC9F5FD5E99260CA0339 antonlaite
2,422,393,572 *FFF6E9448249ACD9C3CF2787CE1F2FD113C227A2 GAELDEN9
2,422,393,573 *FFF79551590BD2D276AD2856C6D2CDAD75BD4BC2 ao21,
2,422,393,574 *FFF3F33132D0AEDE63294B9AFB455688D99E857C [email protected]
2,422,393,575 *FFF1AD3B5B75909734A02E4F394D4F9071BA299F aor6
2,422,393,576 *FFF85D61BA5023803874196D67D39543C3765569 GAVIN.WORRELL
2,422,393,577 *FFF54ABF0F521703A1B5C9D9AF693277BA6E3D27 ARIHANT’S
2,422,393,578 *FFF990B88EC0C6C40347C1A94A481A9C41F39B0B GetItFaster([email protected])
2,422,393,579 *FFFC9280170BBBD83C94303D8418F72C1581B33D GI$B
2,422,393,580 *FFFFFE687CE06E864C0DD55CCC1982ADE8EE123B GLENNAUSHERMAN
2,422,393,581 *FFF61A4D2AD60DE663159E1049A39B0C44A4E2FE ascaped7
2,422,393,582 *FFF11766F279CBB630BD6D5AE5EF84A13208A366 ASSUREDCO
2,422,393,583 *FFF5AB6E3A1BF9260110F9C77C22617F0801891D at?-
2,422,393,584 *FFFE89A77DBB38A2ACE7E9695AF69B04CE596A76 A/T6M
2,422,393,585 *FFF7C94542073EA3E5D659D0550B11AF174998EE atjwx
2,422,393,586 *FFF82B2A7FCFECEA9A17D801695BCB154F011D8C AUDIE SEVILLA
2,422,393,587 *FFF20EBECB778D92C7F496FBF66A528C30E80230 AUHFA
2,422,393,588 *FFF77CDC5AF43EA3B4D92C7B3C0FA9E8FDE6FED8 austinscacco
2,422,393,589 *FFF46E29CED40C830926D5CDA2CA6052930AA875 auwse
2,422,393,590 *FFFE4C2379358B0B0F2F64389940BD6D12866302 HALIMBAWA
2,422,393,591 *FFF662097105E207C8399883D958FF56F8CD9563 [email protected]
2,422,393,592 *FFF1839D7BA18FFA3C0AE2CDD3C6290A6626CE29 [email protected]
2,422,393,593 *FFF8EEAE0438C0199A33242747FBEC0EDA5E3EFF HANNA121
2,422,393,594 *FFF35D8FE7CAC3CE95C41547971019EE40CE1AD7 a&"vw
2,422,393,595 *FFF38F25DAA1AFA7EFA9A5FD91D21C9924754D98 AW,)O
2,422,393,596 *FFF723969003629AB2DD80792E1746125222511D AZPE7
2,422,393,597 *FFF0C8DA1C24A86DDC7FE29B655B1E6FDCAE1690 b10a7er
2,422,393,598 *FFFC7458497284E546332BAE4DC4DDF6DF60C8CE heorshes
2,422,393,599 *FFF0FE160F16A59618930BAFD053715051433FF8 HIEDIMARTIN
2,422,393,600 *FFFEE574CC033C503A58E0BEF2537B0ADB3879EF b9-:l
2,422,393,601 *FFF298B0659ABF5412EB4C56472CE964BA2D5CC8 HISTOIRE SANS NOM
2,422,393,602 *FFF1BB3F113F697A3883296673E89A989360A26E bae/j
2,422,393,603 *FFF5092F1ECA679801F80B855A378BB387ED8568 bakeries
2,422,393,604 *FFF33613C46FEBB4E629007744E790D6A74AB02E HOSEA.FITZGERLAD
2,422,393,605 *FFF0EC188DD170AF447A03D1CE371A3DED70F449 bbc1xtrafreestylesessionw/benjib
2,422,393,606 *FFF8F59791D4581C7C0140BE751DF9ABE94579E4 [email protected]
2,422,393,607 *FFF2D386FB2F3AD451863D133F45BF77523FE87E BBVY!
2,422,393,608 *FFFFACA5FF8016AD08FC57DAC66B9177BE398EA9 BDVMQ
2,422,393,609 *FFF1E283D000A95B67EAF8D87E45B9E74929B209 BEDEKKINED
2,422,393,610 *FFF2C1604BE4960E74F3578858D0B3E82ED29A13 hueythemot
2,422,393,611 *FFF9CD95F94F061CD528C8E6BD16920FB2F75EA5 HUSANG
2,422,393,612 *FFF38C438ECE55D3D7932380310DFB80965A0CEC I1I0C0$T4
2,422,393,613 *FFFB871AD3FAE6E133E37F24DEB0A4BDCED3ECE3 BENOITTOOTSIE
2,422,393,614 *FFF844D081DE25EA32F94688DE0E512D2BC25A72 BESZELGETEK
2,422,393,615 *FFF67253157231A74C247F9F6FE9CFA65748B1B6 betsycastonguay
2,422,393,616 *FFF34BAA20939BF25BC37AB0EA49734DE4B8D4EC ILUVCENTER35
2,422,393,617 *FFFEF5B056CB424FC831E8CF4E2B83BBAA9775CD bmms2
2,422,393,618 *FFFD6FE8131987A9E0515DA104247C3557C999AA bopbb
2,422,393,619 *FFF1FB560304D7845BB2A6BBBEFAF44C08CDD15A B#P***~0~O(O_-)
2,422,393,620 *FFF6E598A0DE1E7B0EEFF2DB2377A423F0A8820C ir:<
2,422,393,621 *FFF68B3BFB00A2933EED9DDCE3AF04D4E64B4D43 B####P`}O{
2,422,393,622 *FFF9F471AF7D78DD07FDACFC65F1C2EE536209AF bradlycahal
2,422,393,623 *FFF5BBF290D0A7AC5D24521BEA5E5FF77A41DDB6 IWOKEUPONEMORNINGANDICOULDHARDLYSEE
2,422,393,624 *FFF05FFFBAD7D67FE9EA28210024F97AE70FC41F brcs=
2,422,393,625 *FFF954EF6B39CA0E677A28A856450E7CFAB45EB6 JACKKE
2,422,393,626 *FFFEF472FF844D601A211691634CCDF72FF581CC BRINO7168
2,422,393,627 *FFFE831446139BA5A3D0A22B1FE2F2A15B307E15 JAMAL.RISSMAN
2,422,393,628 *FFFEAAA3A7CF8151BC1F50F54A08BD75B9A3FAC5 brown-eyed-sue
2,422,393,629 *FFF944CF901699A1967B97BACEA1B6045D87FDE1 brylee136
2,422,393,630 *FFF494B0BD5B5DAEF8BCF7E4D249003AB8E86054 JEANN18
2,422,393,631 *FFF22CE08DC0AC8A42F0899B95B116442CD544D6 BTFHTCVC
2,422,393,632 *FFFAB9B847FC69AE1A7644D39CBDBD7EF08CF8DA [email protected]
2,422,393,633 *FFFC82CD3316BF808449C6F0EAC7494C49733BF8 B(TV/
2,422,393,634 *FFF81A69DF5FB81150E7FB2BBB885FCC0AFDD991 [email protected]
2,422,393,635 *FFFEDD32814C895ED17904D0900F1A1B87B1D6EB JENNJENSON
2,422,393,636 *FFF6295DE512A83081EBE8979BCED33792DF0391 budgieboy
2,422,393,637 *FFF89166EB4CDA83B527E80E0D9FA0173FF8EE44 buytopdietpillscom
2,422,393,638 *FFF5310A21F223BB0048FA9FE7E74FB99A5098A5 bv7ik
2,422,393,639 *FFF937E24ECC8A29C440E2E8D7311005A0EB9EF7 BVKW
2,422,393,640 *FFFF4D6FB7A83D2A3CDABC56D8BBCFE2E07BBBA4 C0NF3RUNTUR
2,422,393,641 *FFFED9F7B73B97D3B488C1C302605B032C3D3E67 C0NSC1ENCEW1SE
2,422,393,642 *FFF2C303BA0F6CC1A5803D6A3E03325F23716996 C1EO;
2,422,393,643 *FFFDFD68A544D5070EAF14C574F664C508047852 C2FP
2,422,393,644 *FFF163A2FF5B740AF4FE079C9BC5BC8D2FC8F507 c%6u
2,422,393,645 *FFF2EB50B2EF2CBC4705111D1B780B2B50395DF1 c_ag9
2,422,393,646 *FFFFD9ED52E868951D7D41D405ACC05B1D7CB797 JZZK
2,422,393,647 *FFFE48A090AD2C7AE8A091FA28CEA30D0DAB42B3 KARIA
2,422,393,648 *FFFF16827D98CE5310BEF630D0A721F567571DDF KBJORDANET
2,422,393,649 *FFFD979ABC0F50F2512E6A265746D55F2411C6BC KENDORY
2,422,393,650 *FFF3B167A4222584B3F725BCCB849F0DE8A7666E CBIRDBAND
2,422,393,651 *FFFA1EC5EB558244190D1B3FC89EC821D766A4DD CB-PE
2,422,393,652 *FFF988A41EDF3B2115153C84830D1D2657F3E3B8 ccqrj
2,422,393,653 *FFF8EF1E97A622797604F83A5CAFD99C5C321E1A KNUELIUG
2,422,393,654 *FFFD4B59AF46D660E278D03C3C91EC3371224AA0 KRISSY.CHUA
2,422,393,655 *FFFADE178437DA011474CC5E1FB985DFD4CF0A22 KULLIYYAT-E-HASRAT
2,422,393,656 *FFFF991DA34E9CA7697AA1849BD6670C57E84A87 CELESTESIEVERS
2,422,393,657 *FFFAC7366720FAA611DBDED082682BCFB81D92C6 KURTIS.LIPSON
2,422,393,658 *FFF342DA57ADDF35682C40017EBDDB03F40A9F89 cerbonius7
2,422,393,659 *FFFFA81BB4A465EC497B888ABD7D098CC4D9CE7D cercl
2,422,393,660 *FFF86291F4FA6953DEF7BEC36D0534029292603C leave-me,-baby
2,422,393,661 *FFF189E585523E9907CF975B241EE9A2CC008839 LESLEYGIL
2,422,393,662 *FFF20CD667EAC80C76B1A3F3EFCCEA7B1589B746 CHERRY555
2,422,393,663 *FFF5F54E86B1F8DA427A524BCBD9CC468871819F CHIMEJEC
2,422,393,664 *FFFB68AA9FAEFBD6D891260303654294600D7F9E [email protected]
2,422,393,665 *FFF3DF50125301C9C34A5995281DBAD1817D67E1 LIBERALIZĀCIJA
2,422,393,666 *FFF3E31DC7474D0F4F9BD493402E08FA6BA0A002 CHONG.DEMSKI
2,422,393,667 *FFF400C9DC65C6240A972D38E706F05E081E65D8 liebesgabenkiste
2,422,393,668 *FFFFCD90F1C1516171ED89E53A8CE9AEF87D865B LilyBerglund
2,422,393,669 *FFF94CA4D1C1137377D28573A0A0E9B2389259D3 linosixkiller
2,422,393,670 *FFF452B9516AE9C04415CD0AFC19152BBF77990C LISA9497
2,422,393,671 *FFFE63DC1713147C9AF8BE1A39FED5E5E3D0FB33 LIVEVIRUS.VACCINE
2,422,393,672 *FFF8D86B45C46D85A528F560699B76E373327E9F CLAUDE.STOCKHOFF
2,422,393,673 *FFFC94FE98C29F0732C2259E8527D259645A05BD CLC3
2,422,393,674 *FFF183D12FA746354CF7908DD5DA68F2E9251E5A cliffordtowle
2,422,393,675 *FFF3457F5677BACF67BA8E06710190F5662F0DCE LOU.BELINA
2,422,393,676 *FFFA7E03A39BD01407851365647886E5AC3D5522 CLLJ5
2,422,393,677 *FFFC81778F89E824A9317172ABE64792B28E4CF1 lovordet8
2,422,393,678 *FFF7C7565F524CC5F55819C763932DF2ADB501A4 CLYDE.ROUSELLE
2,422,393,679 *FFFEB18E72923664628FAA55D9120F3CE36480A1 c"mnq
2,422,393,680 *FFFADEBA1BD9EDA8AAB60149530B2CF2A761073A coldwhitek/oU/ld_/hw//aI/t
2,422,393,681 *FFF32245B3B56BB7367816AF99AF1F99275A6618 LUTHERSTUECK
2,422,393,682 *FFFC681CA8EF0588AE1C1B67A2AFEB3FD6A889A2 LYMAN.DELAPLANE
2,422,393,683 *FFF142BC1741F918436B6894892246D7F7C24710 COMANDARLHAS
2,422,393,684 *FFF1E278D73FBF4D83ED4569CCA40E6AC261CCB0 COM#G
2,422,393,685 *FFF0B73E1600F26CE8FAA4A8947AECDB597C41A5 LYUYLLY8
2,422,393,686 *FFFB00FE910C7A564DB7B4D838F6F2918ADB5176 MACNEWELL
2,422,393,687 *FFF2734782C796C811533AEE0AD39E7AF4C738DB MADHURA RANE
2,422,393,688 *FFF91B8EDA19AF8E5DBB3C3F21F2CC579AEE729D COOLSKIR
2,422,393,689 *FFFCAE33B1828ADBCFEC8A43C4AFF95A8117D2DC majorguckin
2,422,393,690 *FFFB0043E6C9771DA8D936FB3AD8614E275BD12C [email protected]
2,422,393,691 *FFF1139FA08CFB87B3CF4BB5D1D94CE2790C22CD C?OQ1
2,422,393,692 *FFFA19023AEB2CBB12D41B8A438EFA6433FAA021 MANATFORTY
2,422,393,693 *FFF19700165D6103172239796D59B89D7FB03B05 c$q&+
2,422,393,694 *FFF4AD229304D8B6959C9409C2DBDEC362A66BFD markalanrhodes
2,422,393,695 *FFF3AAD090560350E537618533DB461CFAD6AE57 marketwise
2,422,393,696 *FFF23040042231EFB319CE1D033350E86B75DCA7 matthewkerrigan
2,422,393,697 *FFF9B6D8A319E6D1BCE39F437D427828A96B0A6A [email protected]
2,422,393,698 *FFF2EFB1BD7C09F6AF29557132FAE56436EF468C MCAMBOLY
2,422,393,699 *FFFDD0B98F0749670514D3D99662C24AC4B2D63B mclambs6
2,422,393,700 *FFF84116479BC761C8D97BDBE86CC21CEC78C27E MERCIMOI
2,422,393,701 *FFFDBB1D93ECB77C18CA8234D4268EFCEA562C6D CUO3
2,422,393,702 *FFF07139D42FFCB34D2D2722A147F18F8FE98165 MFATSATCKS
2,422,393,703 *FFFDE5BD652F8B2AAB2D22D9857E4E9E9F1401DE cvbwo
2,422,393,704 *FFF632367D9B7640C2EBBCFC759ABDE8B42ACCFA C:=X
2,422,393,705 *FFF3415EEFE6F99548DC8037B256EC604A1A63DC CZOGM
2,422,393,706 *FFFFB13E2B55F577F3334C484B35A005BC38A707 D$1R
2,422,393,707 *FFF1EA0DF3F8E23004A0BB0457693F937105C56C d5+=c
2,422,393,708 *FFFB8BE26E4511139099F0011D9683E5DE286FDA D5O#Q
2,422,393,709 *FFF561517D37C2A0A97FC1E89E3C11717408E162 MN2588
2,422,393,710 *FFF62656CE709831E94D40581E1F8B18440729B4 da1yc
2,422,393,711 *FFF316EA08C41AF5A79FAD33B39AFCA56E250CF4 mohamedtartaglia
2,422,393,712 *FFFE5C6BC1E334F2B785FEB25D200125D65CD14A DAMIAN.SENGUPTA
2,422,393,713 *FFF06357FB3074BD99976A30D8301EF81C653AFE DAMIENGERLEMAN
2,422,393,714 *FFF8B8DFD4DBE4E970365B33B7BED246320F1469 MONTY.MEERDINK
2,422,393,715 *FFF3F17268CDF4F2E2991ECE4C7F20FC41BEA816 dania942
2,422,393,716 *FFFC174E1631D3FDC2DA11DF38FB3DCBA5A30D3C MOSEGRASSE
2,422,393,717 *FFFA239AE33B967B950497B446192E17A48D1C5A DANSERINDE.
2,422,393,718 *FFFA9FAE84C976667902230F9EC201D6634A4026 DARIN.WALSWORTH
2,422,393,719 *FFFA26A794858DEB82CC7322E571FDABFC94DB73 MrKluger
2,422,393,720 *FFF0BD8ADCD141F17F8AC12F302AC0568848EB95 DARMERIING
2,422,393,721 *FFF0B05E0B2FEECD3FD211B1B95890DF33043DBD mtiiuhl
2,422,393,722 *FFFFFEE449060F796E977E8420A952A9413569F3 MUHAMMADABDALRAHMANBARKER
2,422,393,723 *FFF8DF71EB2C2418DD6A8D2203E9D0CE74A87668 Mysterious-Mountain:-III.-Andante-expressivo
2,422,393,724 *FFF6C78D6E2D1DE297F3D2E2AA9FAE2268EF2DB1 d"bf
2,422,393,725 *FFF19016C47432994FA5B1DF8FF9DA3AB3B6F312 nachbor
2,422,393,726 *FFF94D0A44C035EA6C2B9609B9753544B6F3864A naevius6
2,422,393,727 *FFFEC195631CACE772C99CC12C660075C607E3F6 nancy.m.fox
2,422,393,728 *FFFCF8EC48FC8B04E7D2B24A8B717CFD6F865249 NEALENH
2,422,393,729 *FFFCE7AC34EFCF55A6FE74689A24AFC1B4256697 DEMARCUS.MARRONE
2,422,393,730 *FFF18DFE7E9C33075F182D84EF6E346895732583 dendroliet5
2,422,393,731 *FFF467BD52560534D4C72F5B71CF46946E252823 D)EQ"
2,422,393,732 *FFF3420558B2BE1B894F12C24E889383A164AAE2 NETTLELIKED
2,422,393,733 *FFFB311A59D9E2CBCBDD44F7C0D9AA979F3EC17E Des-canyons-aux
2,422,393,734 *FFF4CD99DC57227271BE985AAC7168550346908B NICHOLAS.YADEN
2,422,393,735 *FFFDE10ABD54AD6D49519DDC92B357F35E4CFC94 nickryll
2,422,393,736 *FFF672E376ACEA5B85DA2492CDCE817F69F34E74 [email protected]
2,422,393,737 *FFFC317E0F86A119BC02586C3CBFDA69F29E45D3 DHOLLMAN7
2,422,393,738 *FFF7E0EAB102496A5CB25E1AE75E9BFEC687E2B6 NOSKRAB7
2,422,393,739 *FFF414FF294DFA704431C07E2B8D8E71CA5FD1EB ,.DIT.JACOB".(LE.CONTEUR)
2,422,393,740 *FFFCCB77E77134879516C5C03B0904E27086E6DB NTHSSMNT8
2,422,393,741 *FFF8F0217C0580F85313645A292A2AF8D17F3402 ntr02oo8
2,422,393,742 *FFFF1783725CD83ECA3749323A0BD08F21B8DFF4 NUMEROUNOTECHNIK''NUMEROUNOTECHNIK
2,422,393,743 *FFF498446FAB12A2612324911BD8E431535DF49E NUNEZ’S
2,422,393,744 *FFF97C14DEE4088BE27E439216F11B76B3276AC1 dm1&u
2,422,393,745 *FFFA86B472F52D9BD45A687E11E1947635B3E9B7 (o_)~`~`<====8
2,422,393,746 *FFF8EDD5F8ED235654D89AADC731362456CCADE6 D:NB
2,422,393,747 *FFF255811A52149FB7C1B9EA96EDF1FF855ED13A [email protected]
2,422,393,748 *FFFA978162868F147706342EECBB249FAC0509AA ODSTAJE5
2,422,393,749 *FFFF253767201B0303CBF22BA1D9C38CC5AC8DE3 OIPIG
2,422,393,750 *FFF3D20247A691D10D4D794DB31CBAA61B09BBF3 domingobourgoin
2,422,393,751 *FFF8ED23C8D3F69AE8049414D94BBA678CA4FA41 dominiquehandon
2,422,393,752 *FFF7153299F35D00194041515155AF4D6A94FE28 OMNICIDIO
2,422,393,753 *FFF7055E3347DE2676A28FE4FD4A9355AC304203 DONNELL.BORGELLA
2,422,393,754 *FFF220E044319135C0207D99267F2A3D102C133B onemetrewide
2,422,393,755 *FFF50D316E147D5A2AF99E473F1660C762DB1D61 DONOVAN.SCAGLIOTTI
2,422,393,756 *FFFEF8EAE7B779AD020B76F5714012C6A88C2AB8 }O{ O~O~(-3
2,422,393,757 *FFFF7908EEB8AD8F15D858D9C08CC18685CB3766 opdroogde4
2,422,393,758 *FFFDAF7A258B211E30FBA1218C8E66833AAE6988 (>-<)***d#p
2,422,393,759 *FFFCA517D36ED3C15464BB1409A2144D62D7E3E3 ostererfahrung
2,422,393,760 *FFF1EEA0290016BD2215895AFBA56372412CF94C [email protected]
2,422,393,761 *FFF2A07684DB1AFC44F9FEC4673398A537B442DA OVERDESTRUCTIVE7
2,422,393,762 *FFFC34CA5B7B4355C445E118A71D6CB5B20587A9 PANITUM1
2,422,393,763 *FFFDABB1DF36ABE800326F706D8B9B5D79F771D7 DVZALETA
2,422,393,764 *FFF2E03EF8E1FBCB4ED73AE28ACE7830549FA669 PARTEIENVERBOTS
2,422,393,765 *FFF44D703047FF409A16F66C410F33710DF94546 dx-p;
2,422,393,766 *FFFB9BB46B143A03D82C07ACD14DC3874222E20F dz?bg
2,422,393,767 *FFFC7BF61CD610EDF535AC04DEFC39AEAA089B8F eawp
2,422,393,768 *FFF53639C2617D128F844E23294489C4D1ACA858 EDDY.KARADIMAS
2,422,393,769 *FFF3683406E9C3CD32031232833A743F31672167 EDWARD.AMORY
2,422,393,770 *FFF6E12091A2E32AE88082F04088F8673E924905 EDWARD.DILEONARDO
2,422,393,771 *FFFE644008B455614C7299674AF5388ECA043E8A ee!cz
2,422,393,772 *FFF9FAB8207EEA013325E006720A39EBE3C095F1 efrainbecke
2,422,393,773 *FFFCCE4DEE7BCE3C202DF2CEB668B1A3D8BB574C [email protected]
2,422,393,774 *FFF8E962C974E7AC9D6FFD2E92333101138FB2A8 PHILLIPCARLOS
2,422,393,775 *FFF6CC22D46A5E55243B4A264A45BC46615B4D9B PIERREJANICKI
2,422,393,776 *FFF0F9D400A164037BA2DC1B5A09F71C42082152 pierrekuether
2,422,393,777 *FFF35512D8E27DF4F51029C75E133CF13C5FEFFD EIT0!
2,422,393,778 *FFFB6FAA48979C91B5A5A2C0B5A0B0E4D05D29BD pj56313
2,422,393,779 *FFFC42E0180790511FC4711F94897E4399555B31 P=)~-`-}o{
2,422,393,780 *FFF4D3AFADF24314D739A5CCC2412BEE2E772AF5 elmotreuter
2,422,393,781 *FFF332F35D1FDCB8E057734EE8821C64B0177B7E ELTONWIDNEY
2,422,393,782 *FFF7251AA31742B3B2069A7F0ECF50C390F90475 PORTALSVELLSCALVI
2,422,393,783 *FFF8656850FED8FE3893DCFE00F3A8F4BF984139 EMIG(
2,422,393,784 *FFFA0F42BC14364FA7F49BC8C3B76643A7F662E5 PROOEMIU
2,422,393,785 *FFF3550D3EC805F03FC874F79B40E6665A41CFFC PunkforLife
2,422,393,786 *FFF4B2502429E6F37F371F678B2577DC70525DB8 Q111034
2,422,393,787 *FFFA8AF69C422A1BA2E9097597AE1312413C849A q====b ~ ~ (>_0)
2,422,393,788 *FFFE4B0BAE1B385243D660C38D45C06DF3188FDF [email protected]
2,422,393,789 *FFFFC6C0D92E45A22EEBC57A10342F2A8D614E28 exaudint
2,422,393,790 *FFF63A2D7FCE139BD8B63AB05E912EA61D4EA028 F139620
2,422,393,791 *FFFA9F54F5AB3449BC7154B65D08F256ABB94056 F2DAB50B37CADC8E6F2308AEA8BDD6F3NUB666
2,422,393,792 *FFF504BD678764BF143FA4B7AB58B0B36CBA421D [email protected]
2,422,393,793 *FFF53FB51BBA46E7963CED460C173A8A3ADC36F8 FACHKUND7
2,422,393,794 *FFF68A19CDF443727C3BC63D97AA5BCF10CB13CA FAIHK
2,422,393,795 *FFFAFAAFF28A5B4F18E864FDD5F53CD42993EDE0 [email protected]
2,422,393,796 *FFF3A1214AFAFA651067F2AB2A0FF7E0B6FE1BEF far.beyond.the.endless.(feat..maria.marcus)
2,422,393,797 *FFF2620EF3A6545E9F8D40DA6B109D331B00D90D FAYEZAL
2,422,393,798 *FFFD98D67173F814B9323966E2C6160C6FD6F895 fayglahaia
2,422,393,799 *FFF3DDB92A4588D99D325A1A1279C6CC0F7B08C7 Feels-Like-Heaven-(extended-to-the-Max-mix)
2,422,393,800 *FFF7E310C4575A1638C97307DB8FA9E0B1B32479 fences.(grinchoux.and.dangereux.remix)
2,422,393,801 *FFF156AE6F5D7D5FE4272964DB6421FD57455D6D quixoticwonderer
2,422,393,802 *FFFA7C82EB944A29757C85E6F193FF7A309746FA FRANCESCOTEWARI
2,422,393,803 *FFF8F67439C5E00AC7868D3A30538AEC32F7504D franciscokasey
2,422,393,804 *FFF35D0E2945EE230DF6F718123EB3306A90B989 rasmusandersen
2,422,393,805 *FFF3E63B65FC5B0DF2DCDC2C1A664B10338C6D88 fredrik-granath
2,422,393,806 *FFFC7EA7076E58AFA4E6A003DFAF0CE506490D3F [email protected]
2,422,393,807 *FFF477DA9FA217A51D563B3D5D2A48A8EC10BEA5 FROGGYMERCEDES
2,422,393,808 *FFF27F5A4F9760411D65E3544AE2455612EF8886 FUERTESDEM
2,422,393,809 *FFF06BCC607025DB348298CF766342C5CAA542F9 REDOVITOSTOM5
2,422,393,810 *FFFC5578E8D9615F0C9764ED7E02D8C792D7ED71 gabrielbartamian
2,422,393,811 *FFF8434AE5ADD7B0077E5203E9897922CA7E70E9 gagasicristy
2,422,393,812 *FFFFD840CDF8834ADEAE991D02B3C0DADE6B133A REFUTE MAKE.CLEAR.THAT.(.).IS.WRONG
2,422,393,813 *FFFA3D997490971FE6F906506329B4FEEB7B4FF7 REKNILF4
2,422,393,814 *FFFE5072D4263A7C2749ADCBB52067BF86B06C3A gastontentler
2,422,393,815 *FFF4DCFFA2EDD6016471540D83A825F2CA0F49A2 gbayandogo
2,422,393,816 *FFFFEE9CD0E976BCC1D7BFD4900E66C42DAE8819 GDABDUB
2,422,393,817 *FFF7CBB5CE381FA104ADEE4C4FCD09F991A7BE45 RÉSOLUE):12門
2,422,393,818 *FFFC06D1237269420B3D0999BA6E8F1438F4C53B REUBENBACORN
2,422,393,819 *FFFDE2758FD3625CB881D8B174E92E1459019478 geparalyseerde3
2,422,393,820 *FFF7A82FE8D54FB17098CFD031F706B475178897 R~F2
2,422,393,821 *FFF3603E9E3F2444D404526074929DF172B4099C GESTOKTED
2,422,393,822 *FFF536925F77C6296EE8D10E5BE6C5C7315765AD ghasem.goudarzi
2,422,393,823 *FFF3AE115A5B8B6C8D6301E4B58971782CED7C19 GIBNIDUUF
2,422,393,824 *FFFDC8BC9936F51F11808FD72A4A1B2BF00D076C RIDSELY1
2,422,393,825 *FFF78C9A4E5EDC612B46AFF84B59E4AF925D459B RIPPER
2,422,393,826 *FFF743BA9CE6A061F02125075C105C96A695F4EA GLOOMED
2,422,393,827 *FFF90EF93B6413406E028F4CFA71F152F26760DF [email protected]
2,422,393,828 *FFF7824B487FC0EAD023E673ACAB703F29376149 rodrigogolder
2,422,393,829 *FFF619523FCE12D6A364DFBB4C2FB45F3A33F424 ROLLANDLAVIERO
2,422,393,830 *FFFFAD6906CA09A573097E7962B98AED666F411E ROMANESI5
2,422,393,831 *FFF30FC927EA0FAC9F596D5514929C6A7F776128 greenmichele
2,422,393,832 *FFF44327BC0686FC9D2843C23D674DA91FF0FD41 greg.gunn
2,422,393,833 *FFF597E5EF07E62AE388B5BE77564B5872598448 rosendoidiart
2,422,393,834 *FFF36BE7BF69034C5D13F5BEC183BF1274085814 ROSMADEWIE
2,422,393,835 *FFF74344C2357A2FDA013A3FC1B140B182DDB37E [email protected]
2,422,393,836 *FFF2580907DEF233C8682F32ADE77BFD4EA84EB2 ROYACTION4
2,422,393,837 *FFF3FAE5044CBCB39A4ADE593739741889B422D8 ROY.COCRAN
2,422,393,838 *FFF47736D1586C38EAA5E8756C57F7ED5A7E358E guez-padilla
2,422,393,839 *FFFC358C256C2BB44362F4F89E4C929262C72F20 hamutal6
2,422,393,840 *FFF4057E82F5ACE200398C2092C0C5339C9A8DC5 RYAN.RUDGE
2,422,393,841 *FFF3AE651C2F31FD2D9322EA6170D81CE6EF25C3 HARRYFUTCH
2,422,393,842 *FFF9FD21C8FBA2D223BD0984192B77623593BC72 salhazmk
2,422,393,843 *FFF0C4EDA02C4ACDD49A899216ACD564634A78E2 HECULANEUM
2,422,393,844 *FFFBE9CF77B6B495556423E26307AB10210E3F8B HEODORES6
2,422,393,845 *FFFC9201ED2E90675FC515C034CA0F96A3754424 HERBAJANI
2,422,393,846 *FFFAAB8ABEF6131E7ACA814C36B39C96E7BC8B4F SANFORD.SWALLEY
2,422,393,847 *FFFA8366501584088D00C7E40AE1C5D4DE214955 SANTIAGO.GETCHMAN
2,422,393,848 *FFF5F81E0565321AFDCD3ADA690AD255A7766058 *heusen*
2,422,393,849 *FFFE7C0D6902B31A9931D2681E0DE1E40A5555DD HIERNEVENS
2,422,393,850 *FFF7E93BAA3D27B0974733FA204E1A8AEF2673D4 SCAASISES
2,422,393,851 *FFF95C7A57AD9DAB68DC19A549331E442C91392F HIS-BARE-ARMS-ARE-SINEWY-AND-SCARRED.
2,422,393,852 *FFFE3034E04F6B4A5427370A1DB437F4B853F49F HOBABBSW8
2,422,393,853 *FFFAC2F3D2333461A0339236095BDBFFA6236BFA SDIOTAMEH6
2,422,393,854 *FFF5A753834ADADE5D72AEB06304460A30B13EE7 [email protected]
2,422,393,855 *FFF95EE77966B16782E87ED24745965D4AE7DCF9 HORACE.FARHA
2,422,393,856 *FFF5FA53D316A63BC8FB936C45CF55BC80A00CB6 see.you.in.hell,.parts.1.&.2.(extended.mix)
2,422,393,857 *FFFACEF3CC99922DFD224829AADEFD72FBFCA637 HOVEDANIMATOR
2,422,393,858 *FFF3112524B9DA6EBD714168A598797AE14C6971 [email protected]
2,422,393,859 *FFF707ADEACE590B1B9EFB61D0F6A7AB039C5EDA hpeirwtike
2,422,393,860 *FFFB91957CEF69D03B4B581E85FDA667D7BDCE28 HUBERT.ZARCO
2,422,393,861 *FFFE118814EA7BBC97B0691A3CF7FCA60396DD73 HUGGEDE$
2,422,393,862 *FFF9F4EEA4EE4FEE81B9DF0E12A3CDCC768B6311 [email protected]
2,422,393,863 *FFF7BD3B225CC46229C5C15C3DB13D78A968814A [email protected]
2,422,393,864 *FFF906D77F4033AAA4C1D52354AABA1A9EDDD318 shapinuwa
2,422,393,865 *FFF0AA43F1998A7ED7849B7D6659C603A569F714 SHERMANOUYE
2,422,393,866 *FFF52DB448A4FEF8E09846AFE3A5053113F25E9B idiotharold
2,422,393,867 *FFF0A09BAE97CDD2BB32BF5A4E05BD48B43A3C7B SHITALAKHKHA
2,422,393,868 *FFFBB69312C8C0247E5A2B6BEF36A501F5D04A13 IGX;
2,422,393,869 *FFF41EA0DA8D9FC0A4AC1245E717DAED4C2300CF SHUEISHA-LIST
2,422,393,870 *FFF9678371337FEE8374F8329FBEB4E905A7F268 ILLKLAMM
2,422,393,871 *FFF0129FAEFA0F31BC253E1265C1472B28701C8B SJOEHAVRED
2,422,393,872 *FFFE83B46A6719CAAC74B02228F3706D1C9F4791 ILOVEQUEEN18
2,422,393,873 *FFFDEE0D41E7B4CBE7E922C1EFC19A47549098D4 SLEDGEDS5
2,422,393,874 *FFFB82B7AE79665CBF7A273E098DC00A7B8A7693 IN7ERFLANGE
2,422,393,875 *FFFAFC11565005EFE414A788B24EABCEC33615E9 SOBMOLOC
2,422,393,876 *FFFA0E102D74B1A79BC94D3D942546BE87C1FE80 infoorange
2,422,393,877 *FFF58CFEA0372272F18AA90E832EF81E5C9C358A INOTIREPPED
2,422,393,878 *FFFBDA871AE01845BF4A667689CFAB990B78D8EC intro.indonesia
2,422,393,879 *FFFB4C3516FF9D6E3FEB86FDF2FCC29190B59EBE iraqland
2,422,393,880 *FFF5DCAF78D4395A740071BA7DD6E4833212F4F0 SOUNDFILENOS:7
2,422,393,881 *FFFBAFD8D7BFDDB097D2298932DBDFF31E710371 isidrosieminski
2,422,393,882 *FFFF97124B1BB1B264CB5E3E192EA75D61EE7266 ismaelhibbitt
2,422,393,883 *FFF2E0E2D290C02B48544DD0A2B64436B15AD379 IT'S SO STRONG
2,422,393,884 *FFF2BB553FD6C75A68A0505D47889DBC45A8BBCA IZUN
2,422,393,885 *FFF84CAB33BE4C9C0F92D625E1656875564D4DA0 SSNARFEY
2,422,393,886 *FFFBED6DD943671559E7C24B988F8B40EC0C10AD st8-
2,422,393,887 *FFFEEA8A41239E3A9DCD8D8D1C279B2233F772BE JAME.GIP
2,422,393,888 *FFF6952E33A23844180943CDC37FF5E09C1A809F STAPGROO9
2,422,393,889 *FFF6D7ACFF9CFE0259319DA7BBDBAADF58BD105E STATE)參選。當時有記者問他:如果他當選,打算做什麼?巴克利幽默地回答:
2,422,393,890 *FFF50E3FF22C4A8DA516660EAFDDD0C29D7E8A47 STCOPYR0
2,422,393,891 *FFFFD99A5B447441310C400C0F9E57021E3B71F6 JATETXEEK
2,422,393,892 *FFF02BA96B953D1360AD41F00AD54A5C176F0F68 STEPHENMOLETTE
2,422,393,893 *FFF271576E5385709A30915D68C77BDF131154F0 steriliserendes
2,422,393,894 *FFFF7A6B7F2BD972E5FBBF6E682986A060AB0589 stevert.from.within
2,422,393,895 *FFF9B69996ABFD881873E4837EA491B5F4908EE3 JEROLDZODA
2,422,393,896 *FFF8BA7D33BD724EAA122AACC219C31F7868AD5C JERRELL.HALTIWANGER
2,422,393,897 *FFF6541DCC3953EEE2C88441F2D5680953A917FB STRIGLOS5
2,422,393,898 *FFF1F79D03D1E51BB66DB6078EB18991012C9512 [email protected]
2,422,393,899 *FFFBB66F0FD25516C6CD8359A1E3FF7517DCDA4B SURPAYONSES5
2,422,393,900 *FFF7CA5F5F07E320E942D1366D889A78010B9A1E JOHN.CANO
2,422,393,901 *FFF323C7FA5B42056EE4A73FE2AC03CAE8732D7C JONSANBORN
2,422,393,902 *FFF9314CE51C013F8DF5C9BC47C6B5018D44F75F JOSE.BURNLEY
2,422,393,903 *FFF9BF3F8B0A2722D2599C308919A59756CDB715 SYMPHONY 8 - II ADAGIO
2,422,393,904 *FFF07E54AB117576D24787232DE8F21B197AD034 SYNTASSONTA4
2,422,393,905 *FFFFC40CB1A5A032BA7C6995B54EA50929B77510 SYNTELESTIKOS
2,422,393,906 *FFFD49690961D1914475432E7B25E16D5BE24658 JOUKIIGA9
2,422,393,907 *FFFAEE3B3031BF807777F9937980494BDA58BE8A [email protected]
2,422,393,908 *FFF2E344B9A5B41C8B96D52CF21C08720F31AEDE JUGENDBILD
2,422,393,909 *FFFB3553575A5F0B3375FF31E2F1CF8E535C8820 JYHM
2,422,393,910 *FFF0EFBBBDCF142406A62549F13C279E02D08FFD kachel
2,422,393,911 *FFF2C3659A27B50EC8ADF21975482CA2F4B59905 [email protected]
2,422,393,912 *FFF5F7A08F90EA7444662038FB8C68FFE0EEAA92 TASM?
2,422,393,913 *FFF610587BFA53E7A072FBFAA0A8521C0115C12C KAPUŠIANSKYM
2,422,393,914 *FFF98159DD4FB1EDF52DB504223AF0DBCF0DAAAA tatto.tribal
2,422,393,915 *FFFBFE4374C4CE91A6F8CC7839A6990B3EAC833A KARPENE5
2,422,393,916 *FFF0E815D21FEE5C5BD15EDFE9AA43512F2367E1 keilaandrade
2,422,393,917 *FFF6F30574E45C1EE9AA42A547401754E832DD40 kennethbakker
2,422,393,918 *FFFC291305CEF5BC45F86F7A75C7659B62126257 kennethdouillet
2,422,393,919 *FFF431EC0666AF76E26974D19E32C5DFB33E0B7D kennyhibbitts
2,422,393,920 *FFFD53ECF3DAF19DB8E51011AB9D9851FBC24106 TFHN
2,422,393,921 *FFFB078001C39E1F4A2786394EFA917889EBAF87 KGGEAAAAMBAJ
2,422,393,922 *FFF892195AB90A592FFDA5E8ACA9295B32625BC7 KINDA.FUTURE
2,422,393,923 *FFFB658BA7F2515FB4FCC47CA934CDEBFA871C3A THEGARTH1990
2,422,393,924 *FFF146824181B9B2F6895D0BC18ADD65461387B9 THEPOPEYE07
2,422,393,925 *FFFC9FE2B7CAD03452C24C39391DDB0D79DC9D02 KOMPOSITIONSÅRET
2,422,393,926 *FFF8B4AC7A53952190486151BC363C4AAE16D671 this-is-eurovision-(disc-1)
2,422,393,927 *FFF3C5E893E998DA7BD9A296BCF2B757D51F1AE6 tile342duty734
2,422,393,928 *FFF90D30F480E874371AA22BFC0FA520ECE92E5B tinasuryati
2,422,393,929 *FFFCDA5364F1B207890E6D67BBDFDB4761DA0776 L’ABIDJANAISE
2,422,393,930 *FFF02977E539CF1D0135425A168117A60B4D1743 tnxy
2,422,393,931 *FFF556E777D10ADC91A2BEE791B8CE8ED0146793 LALALINGERIECOM
2,422,393,932 *FFFC1B4D2C588EB7FCD2245450C0114C77978A97 TOD.MEDALION
2,422,393,933 *FFFB6F66816DA5C1DA66CEA7C1A97CC32BDCCDED toju tonwe
2,422,393,934 *FFF389876DF620EE13F7555FA9C907B1E0FCD4C4 LAUDIZED
2,422,393,935 *FFF103312E2C0F63DD5CFFC0B82D2E725F0FB84D LAWERENCE.BROOMES
2,422,393,936 *FFF7ACD94CF18FBFEB1BC331A97463314636798C lawerenceguttirez
2,422,393,937 *FFF106EE7613328D544AAD3B08E4D4DFC7AFE67B tortum13
2,422,393,938 *FFFD8C25CA68D970486DB3C5B9305C164FF5010C TOWMIK
2,422,393,939 *FFF35EDDF9DB0CA005A7C57D81CF63668A8E9D38 TPIURKRO5
2,422,393,940 *FFFCAA8B44B128AA67FF5D3FB9F3D04EA3D442CA [email protected]+H
2,422,393,941 *FFF18C27AECAF807D465F6C15AF2FAEBF8D187CC TRACEYWESTERLUND
2,422,393,942 *FFFE585088804A0E3E250C83CB9F90950EA81086 TRAINABLENESS
2,422,393,943 *FFFD1BEEF1151729C160406331BA62616397FF41 LEONSCHIFFELBEIN
2,422,393,944 *FFF0EF46011D19ED4639C30BB9CBFEE7FB4ED70C treulosi6
2,422,393,945 *FFFB56E43DE9C36572D853C61A0FCAE64C44282A TREVORRAWSON
2,422,393,946 *FFFF78ED26523889C72AF1E812ECFF193BD59BC4 lesterstanley
2,422,393,947 *FFF0AF9BD35647AEF4C2ACCB6EC6677B1CE7C674 [email protected]
2,422,393,948 *FFF026F8A5AA78C91CE18CEF6D77EC96F890DE0F TRRDCHTN3
2,422,393,949 *FFF52FE9D17F9302A14A53B52B41CFFDEC9795DC ligusterpijlstaart2
2,422,393,950 *FFF27D971F848811C99224CEA9985A020B0CF5C8 TULISWANTENGO
2,422,393,951 *FFFD941C9FDA529021011B6443913CB391D9242C = list</tt> you use square brackets to create a reference to
2,422,393,952 *FFFAE19F03126A32ED5B1204C9E410377D4A54E9 tyler-heiden-jones
2,422,393,953 *FFFB4C9D5CE8AE8C4E86966C799B05AD8F8CFC63 [email protected]
2,422,393,954 *FFF86F5DD650F117F1DEAEFAADBF4707091EA68C LIZ_ESCARSEGA13
2,422,393,955 *FFFAD495ABE49FD4D2FADBAFB506815EE62D3C73 TZZIRDEIKOOP
2,422,393,956 *FFF9C93FE9A64623ED128FAF5C9A77799E54C717 LOGAN.LAAKE
2,422,393,957 *FFF66C1A95ED4742261CE9BECB84E462B2817671 loginpr
2,422,393,958 *FFF89B1DCE136F40F3D6DA2CFBE4B9AAE9C315A4 [email protected]
2,422,393,959 *FFFFF2D2E5C543D4DA061A105B7FC219883A15C2 LONNY.THAYER
2,422,393,960 *FFF55DFB39A3CF4A5D363E48FB9CE0A7A63A142A uitgespogene.
2,422,393,961 *FFF4EB09E59F3FCDB6A16C04EF226FC20C10F6BF louielane
2,422,393,962 *FFF63CD7346A81FE5A54271886AB1C5E34481A0A lubmanm6
2,422,393,963 *FFF9C20C097D9B6CECBDF30936C14D3D42694F21 LUCYANST12345678
2,422,393,964 *FFFA0A2D39F59492E528AEEA06D37A350E6BE787 UNDEADJARED5
2,422,393,965 *FFF5CEEE1492A51A18774FA64FD2A51BA6F8B81E Under-My-Nose
2,422,393,966 *FFF76AA3BAD1ACE1894081BC1D730567EA187660 unfortunate-lass
2,422,393,967 *FFF4C5A45C77BE1B513B10A61B340DEBB0BBB56B URAZONY0
2,422,393,968 *FFF41553157C1093753836DEECC06EEAF57E6069 M4RISS4K
2,422,393,969 *FFF80AEF347D11CEFC1AAA61866304C85AB57407 URQUNMI
2,422,393,970 *FFF995C4F93EBD43956DA0D01201DC1AC69BD424 MADDENV5
2,422,393,971 *FFF2D7891F4C5C2C83F127A35615C8289B0E49C4 MAFENNIAN
2,422,393,972 *FFF50000AA8EECDA49F6A789C16B3F99ADBE7BBD magiftri
2,422,393,973 *FFF5012C223BA238BA9E7D82FF6DEE57F16980F2 Magnificat,RV611(edMalipiero):XIGloria
2,422,393,974 *FFF8CBE74D1543FABE35785A897A4541132511D8 maledicantur hylie
2,422,393,975 *FFF32242FB0E71B6157A128BD70984B295C5AEB1 V133490
2,422,393,976 *FFFDE7DCBE59DC63792CF2D6D67BB6B342AD448B VADERLIEF.ZWEEFT.LANGS.DE.HEMEL
2,422,393,977 *FFFAD4A7A43280FC0AFDCCC0B3702CB87C3E7832 marcelsauvage
2,422,393,978 *FFFD034132DBF346861D5EF2874D6C6CC8D429BD marcgiannavola
2,422,393,979 *FFFB34914F1814D12A1C2772E8DD970888CFB639 VAN.VITHEAYUTH
2,422,393,980 *FFF4A31B00BC830B91C4A4D22FE3A4863B077EE8 MARK.MILICI
2,422,393,981 *FFF4DE742E4B308B63C7769344D26E3A4D89A86E VARUNKATHURI
2,422,393,982 *FFF8CE3BB11620642326376D054F939FC5CFFAB0 VAZELINOLAJAT
2,422,393,983 *FFF724096FAB22EABB5E5AAB77137F3DD2C85E77 VEGETABLECITATION
2,422,393,984 *FFFB400AD33CF759EE854683233A83117C0AC4E8 marydonnellan
2,422,393,985 *FFF1E998345A53AC125CFE4F1B1A32984EE348BD Version19
2,422,393,986 *FFFC59F97657AC1F7D2C7FC14EE4111F229E3A35 vesnamundie
2,422,393,987 *FFF996DC9E4C5CEC22DE269376612E06361D48D9 mbrstgred
2,422,393,988 *FFF8CA5477BAA0ED9368EC73BE9495806A399E30 VICKIE-SCOTT-LASH
2,422,393,989 *FFF4F8DDFA2480CDC5A235A9FC911BCB99D0E740 mckinleybrittan
2,422,393,990 *FFFAD48EC41A3E4289BD32F1DFA87C7A12F90320 m-do-Bem
2,422,393,991 *FFF24AB070DBA1AB51E3D6C7A431C9DF970E09F1 MELODYFREEDOM
2,422,393,992 *FFF4BC9B1847B088B417659100AB8CAD8FA2C4F9 MHERASME
2,422,393,993 *FFFDF10A344E237E7BB90B7266B57A45C58C7B3C MICHAL-CABAJ
2,422,393,994 *FFF761A3684846806825543ED356B8E0B2A693BC VOLGESCHREVEN5
2,422,393,995 *FFFAC0CDC4047E6AF7C19E28E755B824D788CF55 milchflecken
2,422,393,996 *FFF782BD92787F0AF617FE8209AEE63940386AAE MILTONAMBURGEY
2,422,393,997 *FFF179AC04CEA06FCF509A90F0D45EC7B35D4F6B V}WD
2,422,393,998 *FFF4893CBC3C8D6349C2DBE9448A76AB7DB9691F MITCHELL.SCHER
2,422,393,999 *FFFE0201CC527260A4039C611A7D1B8A25B79FFD MITCH.TILOW
2,422,394,000 *FFF6B9859DEAC4D36FE53A2F901631263DED3A7D WAGENBES6
2,422,394,001 *FFF5AAD4BADABC13A795E6D928C5AAE9CD88367B WALTZINAMINOR,OP.34/2
2,422,394,002 *FFF6DD0388872510CB151E653923FA3E112F1C0D [email protected]
2,422,394,003 *FFFEF911F45C0E089D3DAF10E39329F3E43FBBA7 mojaljubavi
2,422,394,004 *FFFDFC71896C1B415B07EC451668B594D07E296B montagezeit
2,422,394,005 *FFF0B5E97A8C26BA18C0E2B292576694B9F7BE82 WAWGIO
2,422,394,006 *FFF80A48DBC4CBC5D770F9DEFEDA934C364924A7 WB11
2,422,394,007 *FFF74939DA228E362EFAFC8ADD10A32C5ACFDF0F WEEZIEMARIE
2,422,394,008 *FFF145A5726D360367F36E733F185A91030B0A3E WEIL.HENRY
2,422,394,009 *FFF8CF40708107DC28A54AB1FB7C72033B8778CF WEINBGÜTER
2,422,394,010 *FFF9E20EB69DCD3D2C9B91E2A1C0347C77E56ADD MTABATECOMWWW
2,422,394,011 *FFF5AB420D65EE92D9F830E33264C2CC249908FD WENDI.LAW
2,422,394,012 *FFF9182476CA7D92C24886DFD8A8D5281B677E8D WENDYVANNESS
2,422,394,013 *FFF416B459993178BD1C0E16EF7E9EA1FE969991 wendy-willkens-miller
2,422,394,014 *FFF85F86993FFC3F127B28154C8816F328C05D2B [email protected]
2,422,394,015 *FFFFAB936FA6BF4A07DD491B5C9505EF1963B253 [email protected]
2,422,394,016 *FFFE63C05F85CA225DBF4A532059F61CFCCEC903 MURNIRAHAYU
2,422,394,017 *FFF183EE8FF691CAB05D463AF25E7A0B80041F67 MXF4
2,422,394,018 *FFFA6650B824CFCF3D2AFB43611ACCAFDA682CA5 whatspoppin
2,422,394,019 *FFF15A30F6D603C226E01501E4E3E855659E5A53 wij.wonen.in.smurfenland
2,422,394,020 *FFF900EE6F7E22032AC6D97FFB94CAAE1F9B0A3F wilfredomakowsky
2,422,394,021 *FFFED2F6A431D4EA039A80E675777B4E8031D3F5 william-a-walker-iii
2,422,394,022 *FFFFF05F26543E85DFD3281B3C02D0D1BAF0D093 WILLIAM TAM
2,422,394,023 *FFF107ABD199BD005194D4485FC2581AAEBBD7E4 [email protected]
2,422,394,024 *FFF9AAA58E53B5AE58DF710F60623423915F2561 wilsoncamberos
2,422,394,025 *FFF4F2D716C6EB17D9EFF070BC2F04CD8D2204FF winabelledelariva
2,422,394,026 *FFFF724787E8B9A89759433CB28B1C296A1DB72E WINFREDBENINTENDI
2,422,394,027 *FFFB2BAB3D9156CAB315FD42130B5740AC6C50C8 [email protected]
2,422,394,028 *FFFB67939A4B9730729F6BDC8A28105B8C805176 WITZDORFER
2,422,394,029 *FFFF823BB4BBF47F5961B8E2C4A36EF9957E7054 NELLIECHESTER1
2,422,394,030 *FFF1DDFF0CF54F5569A12D6E76FFA4D567554544 newtongenao
2,422,394,031 *FFF789BDE40B1343E27120741DAEDE6A9365EB2B newtonrestrepo
2,422,394,032 *FFF2757DB533570285E6C192106DE3D4D577E647 n)(featmadonna)
2,422,394,033 *FFF6EDACA9906608603CB89995945EBE34E6C6F1 WYATTGLANDEN
2,422,394,034 *FFF2969BEFFC85B16BCEA21A8B9CF12CD15D2DC9 WYLUR
2,422,394,035 *FFF7CAC71FD9A15C8AAC0FB0B27E0143A014C3C1 {x}.*[email protected]
2,422,394,036 *FFF6889A2F646145B7D6122F8ED0A653A58708CE [email protected]
2,422,394,037 *FFFE06E2494B47A5A36B69798C1AA15D29C8F9C5 XMUSIC4
2,422,394,038 *FFF5135ABB6DFC12361A42DBC2A4246D466975BD norrismaynes
2,422,394,039 *FFF870B7D9AA4236F36EC3E36B59BFD709E2FB6C nphlmuqb44
2,422,394,040 *FFFD02C2EBEDEB3941D58D64BB7FDCA750E5B7E9 XU-XUYU
2,422,394,041 *FFF02952A77E5669EC0BF63E6C68653B3B3B5BA1 xuzhabei
2,422,394,042 *FFFBF4E3E08F3E6DDC263523C9B6181C9D2E4AB3 ÓCAIDÍ
2,422,394,043 *FFF473AE04200020B5FAEF201CBB7C4089882AAC ODELL.DEHMER
2,422,394,044 *FFF1D0DBBCD458770F662D21BADFBAA3E35AD8A7 yi5uctspdrxbvl
2,422,394,045 *FFF803CA9CE7AE0D24CC055FF7672A1CD4EC989E OLEGRANCANARIA
2,422,394,046 *FFFD37E95EC4377C9440342C7A8A07268F1EFA64 YOGA ARAY
2,422,394,047 *FFF6AC18DAE34E4305958FC1CA7180A0C929B9A3 oliveronald
2,422,394,048 *FFF53E3B31A4E3EC7BDF7CB63A64D2A6E434904F YOMAMAMOOKIING
2,422,394,049 *FFF115BC07D0624C0931A7CEA09B60C321D1B703 YOUNG LIFE HUNTSVILLE
2,422,394,050 *FFF72C068537BB2C1D94CB1D1A68C564C46A239A ondergewicht
2,422,394,051 *FFF8853C5CFE152A807A91120528EC3AEFBECB7E o->-<[email protected]######b
2,422,394,052 *FFF87593009EA2698684AD4DE52C75BFD94D6B5B OPFERORIENTIERTE
2,422,394,053 *FFFBECC82C4871719A4C973F34F840F8635A7332 YUMA2
2,422,394,054 *FFFF4E07B1856C6C3365208A38BF39C350B1257F ORELHUDA
2,422,394,055 *FFF12BC0B4118AC583FE376D329038BEA379A4A0 zachariahlilienthal
2,422,394,056 *FFFCED5CF9709F0D4CABDA915DDF9876C6131D24 OWEN.CDEBACA
2,422,394,057 *FFF6887B8B61E283D3578E73D639022B5CD928A7 (><) ~ ~ (p
2,422,394,058 *FFF49100E0F3147D8EB88DF7ECBBDE9FB4A4F89E PAADROG0
2,422,394,059 *FFF80E373C635D1934B62B2F973A60F68ABFB003 PAIGE SPEARS
2,422,394,060 *FFFCB742A71B8705AE71836402075A52834933EA [email protected]
2,422,394,061 *FFF5C369B61FD094CD24A75B65CB48EE3FA6AB43 [email protected]
2,422,394,062 *FFF2387C7160850B705B9A829FB67137024A77FC ZHU.TAOKUN
2,422,394,063 *FFF91BC1BD9B7A015012F8CD3AABA01783D628B1 ZQUEBEC3
2,422,394,064 *FFF7BDC621C639B1F552918D808711BE77BB7092 [email protected]
2,422,394,065 *FFF4D1AA38D0EE2C8AF84BFC039687C752624E79 ZUKISWA NYEKA
2,422,394,066 *FFFE3F4F24D5FE29FE7750AD0C2C868E66C68B2C pD~.`>B0
2,422,394,067 *FFF4CBEA79CA2B07D9132531D1FDE57A89295392 PE+7ROCHEMICAL
2,422,394,068 *FFF77E170CBBFFE5214BD72325B9CCB904BC5293 [email protected]
2,422,394,069 *FFFA17608F275765B8A33C3FC58107BAEDE69419 ΚΑΘΙΈΡΩΤΑΙ
2,422,394,070 *FFFA9B6C9570A15AF14189CAD5D595782C7834DE per.greitai
2,422,394,071 *FFF29D10E87C03066E1A727D93B70948D4286450 PESCIVOLI
2,422,394,072 *FFFD2DAC12DE74B054F2B63770AF6FF7533F9439 PHIL-ADELPHIA
2,422,394,073 *FFFB67E717E3EDDF5FAC8A7F7469171855DA3DEC photodtl
2,422,394,074 *FFFBCCBF56B1E093000D80131D64F0CC9BACEC7B PIGNEMENTS
2,422,394,075 *FFF30C0DA709AE2501FF9E25B587CE5C29BC55E6 PISSNELK
2,422,394,076 *FFF8EF49BE3C523A657A6F31B2D624FC2FF5309B СПАДОЛИНИ
2,422,394,077 *FFF938CF0211F092870DE72165686559E6C06548 PREVENTABILNÉ
2,422,394,078 *FFFD41995C1F65C182A66A69617311D4D7D15E46 PRINCE.JANNUSCH
2,422,394,079 *FFF565B81FF94510B05FD8DA0C4DC3C8E30D5DCD PROSEDERAST
2,422,394,080 *FFFC11962879E3542CCED1C8738D50179A87D6DD proveniva!
2,422,394,081 *FFF1D0B455B3AAD3BA3542699C84F600D42F389E punctist8
2,422,394,082 *FFF209389DCB709D670084698E1240F883C4A5DC RANDALSTABACK
2,422,394,083 *FFFEE62C59A52948091A0677550DE8EBC8ACCFE4 randolphore
2,422,394,084 *FFF5B7D64892BAED8AF83F18C77D486FA39B1691 RAULHOUSER
2,422,394,085 *FFF59544D4D47F63C2F6BDDAE831C6D6614BBD62 RAYFORDFETZER
2,422,394,086 *FFF80B8EA4BDD41F4029A96F80335CE32AB53527 rechnerintegrierte
2,422,394,087 *FFF8D28B03355975B4280465EFC0B21EB497B0BC 相似文本:基于soa架构的商业应用套件u9作为教学平台,整合了用友20年服务于中国
2,422,394,088 *FFF88704A80C88604F7F7B3FB710243F33075118 resilucr
2,422,394,089 *FFFCEBAC44FD7A85E486DC925EDD4C1D4AFDABC8 REXCORELL
2,422,394,090 *FFF02033FA1F30834108F62A842AB84C12EE2CC0 REYALPHCRA8
2,422,394,091 *FFF5D1BC7389057119BFBA1217D03988C777CB82 REYNARDIÈRE
2,422,394,092 *FFFB4AC706D4426C3893AE0A9DC167812FDF571A richards
2,422,394,093 *FFF781393F03ED6212C8B98EE3596FFADE122111 rickettsias7
2,422,394,094 *FFF2F6727C96AE1382342156E2B00373C06C5FF1 RND.CNEWS.RUARMYNEWS
2,422,394,095 *FFFB4A353540E9E320F97D91189E4E2706BB2188 006EDGAR
2,422,394,096 *FFF24BCDAB490F184A00B228506CA9536DD55978 04251551
2,422,394,097 *FFF5764A6457BC84D1698B5618AE5DE3D9B92EC9 roger.shipley
2,422,394,098 *FFFB491187D8808BFA56B338ACFA35C6ABC99A46 RON.THORESEN
2,422,394,099 *FFFFA7E01DDEF9A7812EB37BF04D40863FC41325 ROOSEVELT.GUNBY
2,422,394,100 *FFF9EBB253C3DA55A2FA20EB2810D798D323A946 (0_<)~`~`D=3
2,422,394,101 *FFF54E7795D31849D720E77ED0503EC247EDDEF0 ROSHAN-SUVARNA
2,422,394,102 *FFF4DB87C2DCFE75867DB93BC0D3BBD55BC1C36C 0OPUS3
2,422,394,103 *FFF3B2858086F8BAD2553F85EA922D827CC32AA1 ROY-KENNEDY
2,422,394,104 *FFF048D85FE5328DBA3D5B8E3940E45B2DD4120D [email protected]
2,422,394,105 *FFFC992644692102237360FBC717E0D5C532979B RSLAMANA
2,422,394,106 *FFF66D5F9C61DDEB3839DD1A4FF348EC1C7CCCB2 @[email protected]
2,422,394,107 *FFF15C051DE664B0009111CA7900D10C6B8418B6 1376782 daswar,wiemanheuteweiss,einirrtum
2,422,394,108 *FFF211AADAD681EA906AE451E64E366ABE997FCA RUGBYDATABASE8
2,422,394,109 *FFF4EB0A7F0269320C3318CA6D4A51767AB554DB ruzietjes
2,422,394,110 *FFFA736BAF38911898CB5C28E0DD50C6665D10DD SALSABEEL0
2,422,394,111 *FFF920CE9C79AC9A9AA675B45BDD869D76D65769 SALSTETKE
2,422,394,112 *FFF206551FD33C4DAF85EB1436099567BD355A1D 1921221 DIE-STADT-BENOETIGT-GELD-.
2,422,394,113 *FFF812F1F493A1B00A8D76BE25607741F24F55D6 SAMEER-KALAMNURIKAR
2,422,394,114 *FFF133B6538B88A1987A03F4D6CBDE7E6618FE0D 1alakeskusluokitus
2,422,394,115 *FFF915F14766F1B6729DA385FF6A463338AA14DF SANDERHICKSVSHEARTWORM
2,422,394,116 *FFF100FDAB279103F0805A5B372A9C0E9D8A809B SANTOAKARD
2,422,394,117 *FFFA888E05DE32D98E29B7215E5340744D5E4AB1 1ASOSIYE
2,422,394,118 *FFFB1CB5B745A6CCEA10E236335E245EE8575A13 1.ASSYRSICHEN
2,422,394,119 *FFFF9FB0B93EDC8091B239489702D66A5CBBE1AF santorobinett
2,422,394,120 *FFF079423E60405C7544530FB74D26490C183BE9 1 AUFSSICHTSKOMMISSION
2,422,394,121 *FFF63C9B3CCD82C2C7B12F53256BF9212ADFEB31 SARAHMOLINARO
2,422,394,122 *FFFB096AEB9716A5201063AA7DC9FEFAD63F63B3 1CELINE123
2,422,394,123 *FFF99363A8D2E1BCFCEE8356A9158F181C3DC92B 1 cigerleriniz
2,422,394,124 *FFFB1751F92E6945CDFFC31A3CE1EA8DCDA73E77 1.JATKOKEHITYKSELT
2,422,394,125 *FFF16BCDF1E9AA68FD3205DB73B6B4F7503DDBCF scott.finfrock
2,422,394,126 *FFF010AF7E07F494C299137B5120D7790193D708 1kielikysymyksiisi
2,422,394,127 *FFFE0E87DDFE8BA888B30A1056F09484422A7DCB 1-laa
2,422,394,128 *FFF4400098583143924BBB91DD4A51421682E484 1LIMITEDACCESS,CONTROLLED,B14
2,422,394,129 *FFF8FA1911EA25D8E27DF275326222B1FA4DF6DF 1METWPIKO
2,422,394,130 *FFF24A3D54D0C7A3286916F701E5C683CFEB9ADE [email protected]
2,422,394,131 *FFF7FF4E19337DA1C47205C92E4708A191C6D058 1officer-employment
2,422,394,132 *FFFBC8246F81E7ABBA4FED8013EB86512F9E73D3 1 OVATVALIOKUNNAN
2,422,394,133 *FFF08053F1F944164975D8D35BD676E94549722D 1parteitagseroeffnung
2,422,394,134 *FFF65854D22B874CB4AE0E65EDE80D5A32A270B9 1-ready-weizen
2,422,394,135 *FFF3BA9DA51CD8C6555540AB34F448B1ACF776C6 1RUOPPAUSL
2,422,394,136 *FFFCB9742F968659F0B5E03F28E5CD1A2C5FD13B 1salmonellen-rekordjahr
2,422,394,137 *FFFA8D3F47C72199E26844AC32A65C2F18B4C250 SEINSESING
2,422,394,138 *FFFB1C906973B2A680BE9BDE08EAA64977A73A09 1-SUN-A
2,422,394,139 *FFF31AC1BE5E6F58AE8EBB69751F6A2DCA499E11 [email protected]
2,422,394,140 *FFF6FF99BB22D7CEE84A7844986A86444DFECCA5 SENTORU5
2,422,394,141 *FFF21608EA2FBC0EDC4BE0055EBB5F23A8E54201 1VANIKOY
2,422,394,142 *FFFBAF70E934F7961D56DCF445815FFBC091796C 1.visa-waiver
2,422,394,143 *FFF08A2721086F81B1FEB0D7EA67A9539AE41AAB SETILYTS9
2,422,394,144 *FFF16AEF4D39F3009D8DC253E7327AB0E8E4FCA8 206080 vom.stellwerk.aus.musste.die.weiche.neu.gestellt.werden..
2,422,394,145 *FFF6FDE038D9A42FD94E4EB60752A45901E714A5 SHAINA-SIMON
2,422,394,146 *FFFE9B493036DCA6EDB9ED97F42F86CD39FF9614 22101329
2,422,394,147 *FFFF60F1F31F7D5FBE10DA49E1631866E54EA24F 2708096 nykyaikaisenerikoissairaanhoidonjasiihenv
2,422,394,148 *FFF9E72F2E218106BBBDA0E025E2EB48C19F0547 272alejandra
2,422,394,149 *FFF5550E6A6D0A2B2A9F69F1CDAFEC07BB82CEF3 2800645 buchoniafliedenviktoriaaschaffenburg0:1(0:1)
2,422,394,150 *FFF760163348E6EF625F506965DF8F2A3CD13C0E 28031649
2,422,394,151 *FFF8BF793AAE1FF326EFE701DCD19DD71E2FAAF3 SHELTON.SAPIA
2,422,394,152 *FFF1FC6745A03D750129CC71C9A89A284EFB8195 [email protected]
2,422,394,153 *FFFAEAB5E6BF07C5EF5429542EAA589CC8AC96DD SHIBBOLETHN6
2,422,394,154 *FFF3860C138C4C4F4D195B54E86B2C255397613D SILAS.OFFENBACKER
2,422,394,155 *FFF4E2700752D5BD3EC4E7B17302778AC36041C1 2IAMXFILES2
2,422,394,156 *FFF4ADABCA670464FEA190CA0A4622B071990B11 2-karstadt-reisebueros
2,422,394,157 *FFF31306761E43B8BBC5C93BB7D939796A23B4C6 2OORMERKTE
2,422,394,158 *FFFBF96BA14C06BA60E18BFE4046A15224A9B37E 2 PROVOKATIONSLUST
2,422,394,159 *FFF2918134EBFC5B415A7F3A53088009365A40C3 2.romaanisarjaa
2,422,394,160 *FFFCF5C4A09EB41BB337FFF1A2F08E1FADBA826F 2thereality6
2,422,394,161 *FFFBEE6D7E85084A15F8B64DA0CD6B637D48D78C 337120 kokonaistuotanto.kasvoi.vuoden.2002.kes
2,422,394,162 *FFFC6951E479B30EAC2A5391A7D0DA8E643E005D 365DAYCH
2,422,394,163 *FFFBD055E61503093EAD443318F38A030C0266E5 3802.MOUTH
2,422,394,164 *FFF43D8FCF76E0C76868CFEBC630F6CD235E5EDB SNOCINOMRAHNAP
2,422,394,165 *FFF35A17C324FAF6EA076F54B1F09A1B64C3AC23 3AARDLEEM
2,422,394,166 *FFFED918FF52F46594322452700E3D86C7293DCC SNOPMORRETNI5
2,422,394,167 *FFFF8B6D84051C900B3B702C78E5535095043E79 SOMERSUTTON
2,422,394,168 *FFFCF311240F3943FECC2A96D20CF5C1193AA778 SONVASTE1
2,422,394,169 *FFF6E1DBCF3AEFC8CA9CBEE8FAEEAE0D51B59585 44.unpopulaer
2,422,394,170 *FFF4EFD1FE00AA6CB01D6242BB4C17D90A5B158A 46528F
2,422,394,171 *FFF8A8F23291FD192087EE3F6345A059D356D5C4 SPÀRGIRI
2,422,394,172 *FFFCB98DBA1F4D7C1CF05A7B2B15FA57BFC106A4 4-atomkontrollabkommen
2,422,394,173 *FFFA2BB0E2B73631C64CA2F722FDF879A2E8CE21 4-AUTIUTTA
2,422,394,174 *FFF63AF90BE4E0685D4EA766474F60A088C5CFA7 speak softly (carry big stick)
2,422,394,175 *FFF597A8C5F522425D2FBBDF795DB1A3F4220257 speyerl
2,422,394,176 *FFFDF75936E27344D8CD92998E685DC92767CE97 Splat-0~-<#8
2,422,394,177 *FFF42A1F1632ED5F0EC6C0F271EC39EFE0C67BB9 SPLAT ` QB
2,422,394,178 *FFFF8CEAEE8FA9FE60A7D8A828264105F5CFCF28 SRC=HTTP//ECXIMAGESAMAZONCOM/IMAGES/I/21G16D4ZYPL_AA115_JPG
2,422,394,179 *FFF514A2632503C609F5E275DE7047785603609C SREGLOVPONOORTS
2,422,394,180 *FFF73243303FD08E0C67424650768CF05080130E 4-VERKKOTEKSTEJ
2,422,394,181 *FFF323E72A0A4AFF7C8894F563FA289C21F3DC84 4VIPERSNOWBALL
2,422,394,182 *FFFCAC45F56AC6A872CD5A781ECE6506B1BE87E6 520EASTON
2,422,394,183 *FFF25FAA334D40824533B1053A18FFE6C05CB587 53RVC3
2,422,394,184 *FFF497F5D4AF66F0966221EF8FD78A09B531FFE3 [email protected]
2,422,394,185 *FFFEAEDC5163482D0358536C36D7FD75FF993CE4 5BSWCOSIBSW
2,422,394,186 *FFF82C15EFC49AF52416E4F6B82956B03F30BB90 stempelband1
2,422,394,187 *FFF28FC7FE363C10807D641B4ACA85E1BE41E158 STEPHENCUSANO
2,422,394,188 *FFFC405067EF07F3AC82FFBB3966D37B2DAEE778 5GARDEMANGERNP
2,422,394,189 *FFFAF609FD271ED5527389B15E24A217987E8F7A 5GREENSPAIN
2,422,394,190 *FFF5402F14A18D255D4F26D30C7346EEFDDB4C93 5IAMGREEN8
2,422,394,191 *FFFEF403D5E8A77F8260961576CC4B47E268ABEB 5 NALCACI
2,422,394,192 *FFFB068553415C800D367CC36EA7F7473BF9B2B4 SUOHUUDON
2,422,394,193 *FFF07DC2BDFF3C6867B62331EFADC3DF2D4BCF84 5TY
2,422,394,194 *FFF80E6D39C6FEE156B7E44F07D429D888DBD051 SVETECH1
2,422,394,195 *FFF3B0A2267379A7F73DC5D5600CB6A928CFC605 SWEET MARGARITA
2,422,394,196 *FFFC191AA5A32C5BD5D753C265C1BDF1058CABF3 SYLOPIDA9
2,422,394,197 *FFFB56CC6EBF210986D4E8663126F67EF46A78EB 6AVRAPPORTERADE
2,422,394,198 *FFFF9E5EA88376D620F33A8C362744F1426B22CD 6CHERRYANIMALS
2,422,394,199 *FFF6C83CD3518407923975FFC7478ADBBD0DF210 6FGHSQUIRT
2,422,394,200 *FFF53E792F22ADF0968F8F34754240EEC3CF9A0C TÀKKO
2,422,394,201 *FFFB2B42DA87499DFFEAB80D4C22136401270BFC 6LLEROCEP
2,422,394,202 *FFF3BE13DE767B7FF6D13AEC1A6B4D6818ED082C 6MARIERAIT
2,422,394,203 *FFFB002F2691FD7B3303D562832C75061974D8A9 TATIANA LITTLE
2,422,394,204 *FFF579485972C583039279F2F575A6A483604A3E tealharper
2,422,394,205 *FFFA274BB9430E4DFA974243F00020F8FD547D1B 6SHBANKER
2,422,394,206 *FFFD4CCD7A2A8B80C5D04F48A05DACF5E21E94EA 6ZENKAIDO
2,422,394,207 *FFF514FA682EA85EC58B29D72BE920889A885DA2 TERYTORIUM0
2,422,394,208 *FFF8C14FDD6E112B483AB602EF397A2EB7E3C4CB testery»
2,422,394,209 *FFF788589C1386FC44A233C27CBDCBBB14200F9E THADGATTIS
2,422,394,210 *FFFAEBC0FCEF57498D146AAC12C24A541903E5B8 THAMSELF3
2,422,394,211 *FFF80F7E4F962F8B0AB489AA15F44F662AC866CA thatpekka10
2,422,394,212 *FFF813EB114D72BE10D4025F582D6F5275853861 73052 es geht um die aussoehnung zwischen russen und deutschen
2,422,394,213 *FFFFB7D8BF4D00A361AA206BFE8E9E84F12E6B8A THE-HAW-HAWED-COUPLE
2,422,394,214 *FFF2CED476666ACD4E40B093222684AD0CC1A4A0 thephilips05
2,422,394,215 *FFF92D280425120FF5741F118C7E0A8DC6C2DB5B the.sovereign.and.a.sword
2,422,394,216 *FFFBEFEB4CD5333D37A138882D19494AA490FBE0 7DISTRUBUTIONS
2,422,394,217 *FFFBDAA78E3315AA1B944BC62081CD8014D439A8 7DRINKINKNOWLEDGE
2,422,394,218 *FFFE7A5AC0C622A50B2828828E0D3015FC09EBC4 TIMOTHY.GOOSLIN
2,422,394,219 *FFFA7AF1209B663DD5CA2D3E74734F03553517D1 TINMAN1992
2,422,394,220 *FFF6F75E5D6F144C2597FB87E7BD0ADBBDAE5802 7 GEFLUNKERT
2,422,394,221 *FFFA72D0C8814883315D7D746C78550B0D4D4BE6 [email protected]@tv3n3ss
2,422,394,222 *FFF969450294EDA6BC423F563688BFFABC26CF45 7NOTHINGRANDY
2,422,394,223 *FFF08C9B14E61720D52C3A29EB8CDB6037D9CEA2 TONOHATA
2,422,394,224 *FFF44C0A4B1DDB63C3569D362A62D827BDD3E5A6 7SCOWLING
2,422,394,225 *FFF286A0BA369348D76CE5F500905B6655B4DB38 $TR
2,422,394,226 *FFF8FA07F6E45B58850B19BA0591E546702A3E56 TRAGICOHEROICOMIC
2,422,394,227 *FFF9CCE4FE322353AB6F678D045B7885ECF55BEA 7YGOLONOSRAP
2,422,394,228 *FFF2844293034CB6C57F8C19429AED4B9E06C0F0 TREVOR PEACH
2,422,394,229 *FFF40C81A9FF6D98BA84F5B39DE8C9F88F89F11F trevorseabright
2,422,394,230 *FFFEDD67F849AD4391947E40CA0EEFFB3C2C2838 triblastica
2,422,394,231 *FFF1041442EA8F66E42883638B9B069360BEDFEA <tt>[email protected];<br>
2,422,394,232 *FFF870DD4036751BAC1294C43CDB2EBE4FEF8D7A TUG-TIOGA
2,422,394,233 *FFF392A8BC5C1E8FD25E983986B7C0D9F7ACA287 tulsi-aryal
2,422,394,234 *FFF9253B719A52FC395AA5F3E262E265121B3C1A tumi.mokgotho
2,422,394,235 *FFFBDF8F68F27A135F93D02C9666A187EC7B294A TUNDRA BALLENGER HOLLOWAY
2,422,394,236 *FFF7FD94A025E481EBD518B57D09CEA0B7D81A49 8##b~ (0_<)
2,422,394,237 *FFF09ABFE7814C6091EF67A9762BAF74CC7477F2 8BAGEFTERHALTENDE
2,422,394,238 *FFF17930BE16ED999ADC90DFCB28CDCBD58D6815 8BSWMUNIANDYBSW
2,422,394,239 *FFF6CECCFAAB220DEFFF7D71F39DFD998486E5C6 TWENTYPENNIES4
2,422,394,240 *FFF4E8EB362F18C2BF4BF972A2FDF84FF89957A7 tyre
2,422,394,241 *FFF4D99DB25FD159CC20305F49E2E4BC072644FA 8GNIVITAG
2,422,394,242 *FFFF2464008629B1AA54ED8058B2745228FD25C2 8ILOVEMARIA19
2,422,394,243 *FFF580DA3F91F10109FD5B25DF380AB33CCE3BA6 UBEQCINA
2,422,394,244 *FFF79D5BBEC6F7C5BB56DF768DD1E5E787AE5EA5 ug-sg;e
2,422,394,245 *FFF3D47F7281520ED26254F24F7740C324A04955 8PAINFUSILLADEGARROTEGASSINGGIRDLE
2,422,394,246 *FFF6B6E41A1B3F81029278BED4943BD10B988D87 UNDEN123
2,422,394,247 *FFF55C2D04F3BFA57801DD837D1A7407973F891D underlinen-'/@/nd/@/,l/i/n/i/n
2,422,394,248 *FFF67BBF07E7979579C73AACAC31762345A07BEA undeteriorating
2,422,394,249 *FFFEC224CB424B7259240A7E4C813105C7C9B6BF unhomological7
2,422,394,250 *FFF3021D88B35894F55AE2BA817242B6878ACAF6 [email protected]
2,422,394,251 *FFF584DACB796E3F197C2FF4EC12429EBF0ABC6D 934524 JATKOSSA,ASIANMY
2,422,394,252 *FFF9746685E19AA457F3962F1E49F00F589BC206 ursula-cruz
2,422,394,253 *FFF607ED30C481D831347BC449B88C588B1AF777 usinimo
2,422,394,254 *FFFCA438989CB51A338BCDF2A8E1D19A222AB921 USTUGAWU8
2,422,394,255 *FFF9CEEFDA52BEA0CDB325A1F0C26934047802AD 9CANNONFRANCOIS
2,422,394,256 *FFFFCB6F132BEB0436ACDF8C3C926F643DBAD11B 9ETNELOCC
2,422,394,257 *FFF82CFF2EBB1C14E635EEDB292095EE8E610BE7 9GATEWAYCUDDLES
2,422,394,258 *FFF922C6C6C3F7A0D5B10AEBDE5E8E855B52AA7F [email protected]
2,422,394,259 *FFF927F7F70FBB2187B61A358FC7DA3E40C0365E 9HONDASUPER
2,422,394,260 *FFFA9D231C97B8F182482D4525BC1B85B84C72A5 VACLAV.HNIZDA
2,422,394,261 *FFF3C7116C2202676217973227BC2E026B64CBB6 9KAISAHOO
2,422,394,262 *FFF7D6C6F302685D233FD8E6C94F665F060E2350 VANESSA-LANSOM
2,422,394,263 *FFF9BCE92EC4A757892354B04F65AF249FB8B6D6 9MITCHELLROBINHOO
2,422,394,264 *FFF714363970B3E0CD923DA4E2F80097F423EACF 9MYROBBY3
2,422,394,265 *FFFA496D8315C34CE05EA2A2695C58EF96777ED8 variations on a theme of frank bridge, op 10: march
2,422,394,266 *FFF629C77F342B80C70EC6A381EBB8F759BDB300 vaughngilbreth
2,422,394,267 *FFFD1BED73A611E3B9DEA93124A877D70D96C23B veera-venkata-rao
2,422,394,268 *FFFDECEB98D31F38B341AA2D18E6E0C955291741 9SREHCRAESER
2,422,394,269 *FFF14D7F1360CD38BC6198DB4770E33ABC6332E3 9TINMANSNOOPY
2,422,394,270 *FFFDD7ABD4B1C4A15228472626632AB45A8215D4 „VERONA
2,422,394,271 *FFFE1161A0FE1C201BE0FC958B2A062CE341562C VERSCHULLATTE
2,422,394,272 *FFFAEDB7D5167194C1F32C531C46750188862615 verwendbare
2,422,394,273 *FFFF33447CC5740B63F53C749AD0A63ED2118930 a!7p1
2,422,394,274 *FFFBA979DECE3984A3C379504FE644BE5AA02DDB A9GDH
2,422,394,275 *FFFC0848615094FECEB3C4BD04C049657C17148F VINEGARTREES
2,422,394,276 *FFF75FAD21D295E6BA9345CDA7EF07ADC460EF90 aabjv$
2,422,394,277 *FFFA1A3201FE71452152672B06D0168A7E788AFE AADTS5
2,422,394,278 *FFF05795F154FB68CBD15160D25ECF617E9A7E6C A=AGQ
2,422,394,279 *FFF8180DCBDB857B11193665432227C381F878D6 ABHEET-MANGLEEK
2,422,394,280 *FFF1BB28186E4F995300D73F05417E40B0E29DC7 a.bout.portant
2,422,394,281 *FFF437D03F0CE555A6299376BD37A7E7E1ED4B3E wa1113ss
2,422,394,282 *FFF8DB5E36A68E83B7E8B7DFEEBDCF77017FDE98 WALLACE.PERSHING
2,422,394,283 *FFFF200CB5BBBF2721ECDC719CB2AFC58649C7A0 WANNURSABRINA
2,422,394,284 *FFF8A08F233F26744468234418928FD8352F9702 ackatac8
2,422,394,285 *FFF42C8F4717CDD276890F00C4A2674A3EC1E98E acurascotch
2,422,394,286 *FFFC7635FA9A40DECD13BF6BF6317B5F82A87535 WAYTOGOINDRIVER'SLICENSEIDENTIFIERS
2,422,394,287 *FFFC143F18B4FDD95DEC693D394EA55EF10DC6B2 [email protected]
2,422,394,288 *FFF275FBBBA79F19E76727F1B4A775F954D9B913 [email protected]
2,422,394,289 *FFFC044C6244E497C7B057B1906B7DA308D76D5C adrian.coen
2,422,394,290 *FFF9CA832390AB5F1279C73BE30768B564AC92BA a$d&z
2,422,394,291 *FFF206FA11F2C78DA3DE48CBF81DF7517D0BA652 AEFERTESED
2,422,394,292 *FFF756DA7B2FD8E98B2592E275078042C7689AC3 A$&EJ
2,422,394,293 *FFF17E5C2ABEDCCDF0D74C14E83BAD5D50C57FBF aff+=
2,422,394,294 *FFF925E5DADBBED13D58A5AEB1B404E997930445 AFLOREM4
2,422,394,295 *FFF553005621B50F88CBECCB0ED82F88B22A4B86 WHERE-THE-WILD-THINGS-ARE...
2,422,394,296 *FFFA065416BFD2C913A89B5E0FFBCCD665F2AFA8 WHITNEY.FREDERIC
2,422,394,297 *FFFB63DC8F0EA0E238EE781FC3658B819DF10526 agme!
2,422,394,298 *FFF7D333FBDEB1F323C31051B199DC880B400FFD ahzh.
2,422,394,299 *FFF9D49A4FA534391A90EE73C50EE652D6A9A16C WILL SIVART
2,422,394,300 *FFFE11B41881A67249C5CB060CE3547988349980 windpompvanwijk
2,422,394,301 *FFF0325DD0B6153D5257249D1E54944813A9FBCE a_ip=
2,422,394,302 *FFF82C84867AA79C6C787AF89A48CBA7FD7717B2 WINFREDMATALAVAGE
2,422,394,303 *FFF6C2F4A3E3311B82651C95DBFA9E898FFC53B1 winfredshortridge
2,422,394,304 *FFF499466BE40099A7C670597437F903B008EE18 [email protected]
2,422,394,305 *FFF6FBE00A809642876F7E289DB9197B32977BCD [email protected]
2,422,394,306 *FFF3A091FAC934E2B7091A6A2AE8B21A1DFC1FBB aj?jq
2,422,394,307 *FFF1ABCE14250A6D1917359EB970F123FDF791C6 WUGUIPU
2,422,394,308 *FFFA411A64EA96740D937E5587D06A8432E9F6AD [email protected]
2,422,394,309 *FFF3795D9C77CEA73C0F99C1454751441034013A WWW.CEILCOTE.COM
2,422,394,310 *FFF652AD6C0DB3F42AC49DA6D58E82335B00C09C alejandrolento
2,422,394,311 *FFFB7907990423C2A12BAF97C45DEB6E99CDAB72 ALEJANDROSTUDNIARZ
2,422,394,312 *FFF06551472944A2AF404F64E26E8465D8237724 WWWPS2RIPCOM-NAVES
2,422,394,313 *FFF34C64DFC7E4A1BA96A21C669A6CA391360D44 [email protected]
2,422,394,314 *FFFB7BE38927FB603BA8036166741B23EBB623A7 AL_F
2,422,394,315 *FFF22B5C72E578A26F330D3562029B0D11CA95DA xanadudwight
2,422,394,316 *FFF69E664D44A163DA5B7C119F7B215387743720 xcvd
2,422,394,317 *FFF87B7BCEEF447647BF8E77CF0AB12C3EC52435 xh^6
2,422,394,318 *FFFEE600BE7BD22B975755AA56CE9C4CBF770EFE ALPENSTOS
2,422,394,319 *FFF852F2379F81F37393A6CD27BE8D61F9892B31 A(MDF
2,422,394,320 *FFF3C91F45E053BF919D3677AD16B0B53C03C963 ANDRESRIGGINS
2,422,394,321 *FFFD5969DC1AAF44BBD4A52B12324217C2D893A0 ym7h9ah
2,422,394,322 *FFF93586916EFDA08CEC39AFF0507A437544A0B2 anelhugo
2,422,394,323 *FFFC92A6878928BF54CC5A5FD948E6107BED56C2 ANGELLISJ
2,422,394,324 *FFF21A58278A1B6A0EC420F7C06A86A1F215F0CB ANGELOSHOCKLEY
2,422,394,325 *FFF5E0D1245D9E624652AB8C08F3C5FD5B8AACCD [email protected]
2,422,394,326 *FFFD3F74784294EA50AFCBBD6B5EDC1394A3A689 [email protected]
2,422,394,327 *FFF5792DAACCE0542ABD027EA55FCF3EDA6BCB0B AN=(L
2,422,394,328 *FFF55884DE8E70EEB7D65FC31C888D9BB7467D25 ANNIEHARMESTON
2,422,394,329 *FFFE2543C83796A97317FB9EA6B0C9898992DAA6 YXQ1234
2,422,394,330 *FFFD6188589CF2665C9DC33212E660C6271B0AB0 antonytecson
2,422,394,331 *FFF89F4FCA9C016282BC61C1B13CB19134CE401C ZACHARIAH.TEIXEIRA
2,422,394,332 *FFF69FEBD83DF7B3458A4B4FB145B66678DAAB1E ZACKARYMAHAJAN
2,422,394,333 *FFF34EA1335A8970FC5545FA3937E7CF6751477E aor6
2,422,394,334 *FFFC909931CE64D2688811CD59CF71ACC7FB17C9 ZAMBATIQUE BETON
2,422,394,335 *FFF43008833FD66012EE4016531AD8C7F92914D2 ZAMZAMQANI
2,422,394,336 *FFF880C9F64C365218C930D0EC0FA9D6EC112729 [email protected]
2,422,394,337 *FFF7EE80C9463D1BB162DA63B7528E32731542FC [email protected]
2,422,394,338 *FFF3E8DE9F80EB5B9A6CBDA54743BB09CA122553 [email protected]
2,422,394,339 *FFF68256E7C25B989CD3E663AC7AFB2A4CAB0CEC aqw&
2,422,394,340 *FFFFB6CE80002B652B9E4D8E946864A8A0BCB7D4 ZNESNADNENIM
2,422,394,341 *FFFC7C4B2EE306FCADF081251BB014DD5436A2A8 [email protected]
2,422,394,342 *FFF9F65DF54DE9A2567A85FBFB891DA411FB1E63 ARCLAY
2,422,394,343 *FFFC1EAAD0C8DF02033FEF1CFCDC52CF0CDE4CBF argoretu1
2,422,394,344 *FFFC73E07F9F110E9DF323BFCE65986B3E437C47 ZUBAIDA WALEED
2,422,394,345 *FFFEFA50CAEA24307ACAEEDFD164119FAD8196EC arielwinebrenner
2,422,394,346 *FFF17C8D1481ABB0BA3020AD24FC17C657A1294F armandomauritz
2,422,394,347 *FFFD97CDA2812895E381BAA0147E9AEF999AA3DA armandosic
2,422,394,348 *FFFAEDD2E5B782A224BE348779B70BCAB0D08B2C arnoldokealy
2,422,394,349 *FFF9B4E22CD4632A702542077DA256941DBD1846 A_RSQ
2,422,394,350 *FFF14F9C6D50118E86CB6ACD251357DD5D45F75C artkq
2,422,394,351 *FFFE9BA3A79F9E6D69FC2F586A7DC0DE7CE5B9A4 [email protected]
2,422,394,352 *FFFC4B8424D3C73AFC5975BE0A7BFBC59DD68071 asc!l
2,422,394,353 *FFF377FEEED5F525EB8908044B2739DD34FF510D assuklases
2,422,394,354 *FFF64F4D52D3695CF59FBF3D8C5052F68B392063 ASTONISHD4
2,422,394,355 *FFF4486E59B56F1C2C1758F5BBFC4DDB8CC9C94F a:t)
2,422,394,356 *FFF1EAA2D369B81502EC474AD2005EEF44414B96 AUASPRACHE
2,422,394,357 *FFF8FDFFA4B24CEC66DEB56D89C72116BC28184B AUCQ3
2,422,394,358 *FFFD166F04AD465607ACC3351E6E6C7BB7C96D74 ПОПРЕХВЪРЛЯЛО
2,422,394,359 *FFF07A611764360818C435E3302716038B263F21 AV,;-
2,422,394,360 *FFF704DB8EB565FD45669572A5DFC293578C4196 ужасающая
2,422,394,361 *FFFF725A4B2BD464995A96668D6AF559C63133EE b(%.,
2,422,394,362 *FFFC5AAAA10DE605D6545976D4059DF1A0F11D2D b)&
2,422,394,363 *FFFC6B92576BE573BF4B705BC0B7F853D19F1B1C b6n:j
2,422,394,364 *FFF6DD7F21DD171BA6474800168BD30277FF4C7D B7WK
2,422,394,365 *FFFB180B9C9A0C5437818F2E553D9BFB92895674 bakeries
2,422,394,366 *FFFB19FCEA465D0DDF8424CF1A0F6794294F9CEB [email protected]
2,422,394,367 *FFFC928AFF88194784F3D69D904FD8695B6ACE20 BARTEK-SZCZEPANSKI
2,422,394,368 *FFF691E1BEDC3E331145A3EAEE01D32BC8E8BB65 [email protected]
2,422,394,369 *FFF28F4A33B28D7DB7EBAFC40372EFC90C6445CF bbjb0
2,422,394,370 *FFF76A897755BACE370CAF0082C6DB781F0A139F BEDQUILTS2
2,422,394,371 *FFF8E93D816C58F4BAEE9E97D39065C4F0582B00 berniebroyhill
2,422,394,372 *FFFEB08ADC92B28BE19D561947299C90BB8D201E BESDQ
2,422,394,373 *FFFC030A1F3D11495DD0017AB94B286663024652 の打ち上げをそのまま引き継いだ場合、打ち上げた風船がjrの
2,422,394,374 *FFF0B697B2570C6D34357DE0DCE9B57D42F7DC88 billypetsch
2,422,394,375 *FFFEA6673A5E1AC5FAA579EDEB76285008B84BF7 BIPALIUM7
2,422,394,376 *FFF4AC852E0D453D8CE503E3E95C69EA3A517913 bkoe
2,422,394,377 *FFFE877F0813CF3A92BD019F75907FE7DDEEEFB3 blsc,
2,422,394,378 *FFF0291D1169FAD48DAAEBF5262B4350D5C9ACF5 boardb/oU/rd
2,422,394,379 *FFFD0B4099636B01872816343B2E90126D9186F2 BOBBYILDEFONSO
2,422,394,380 *FFF82D9AF81F1647907438C6998FA18FFE4808AE bonsaing7
2,422,394,381 *FFF7B549A7D0AE3D4FFAACF3B660F9E69E87B30F BORA KESKIN
2,422,394,382 *FFF435BE389EA18975BEE316F62C29C070F7A78C bpeot
2,422,394,383 *FFFFDAC09F2F94EC1E6CC3C94AA75F37F87C1C8A bradlywern
2,422,394,384 *FFFA3DFAF9A26B7D4C28052D46381A91C0F76DEB brain45
2,422,394,385 *FFFBDABE013735B74091399DEBFB5A6CFE09580F brandennine
2,422,394,386 *FFF289C50DCEF424604DA2E52219F95D2DB0C00C 0YFPJOJM
2,422,394,387 *FFF47A1808A8EC8FBFA17A9A482FAB42C695BB46 BRO(T
2,422,394,388 *FFF2FF00212137836961FB3538CFD5FD5EA72E95 1341316 TILAISUUTEEN.OSALLISTUI.PER
2,422,394,389 *FFFA7DB4BFA5EC1C34DFFF2DD143A72E62835271 1366599 uudethyv
2,422,394,390 *FFF8AC874746C3D3D5D63D5B772C3CE774C60122 BRYAN.DRAKULIC
2,422,394,391 *FFF4D08C492134E22D7A15716231C53C5A0DB5A9 BRYAN.GUSMAR
2,422,394,392 *FFF6483F34F202343A03B185911CDCFB35548E1B bst79
2,422,394,393 *FFF191891B3D6B88B611AC3BFB60156C6142B4BB BSWKAXELSONBSW
2,422,394,394 *FFF03DCAE8E78463F116FBA8ECECB5E11331EA8F bt8u
2,422,394,395 *FFFC36F3A199008977C99E45C465292035EB564D BUFORD.BAYSMORE
2,422,394,396 *FFF718990675B2C44764099E75304EC562936A4B BULL IS DEAD
2,422,394,397 *FFF6D00532792D0F269962A93E7012F4D5F0C72E BVE(G
2,422,394,398 *FFF7B78A0CBF31C6F12EC2BFD5BA89DEC8F9C68A bvt,#
2,422,394,399 *FFF9659A36AECEB0E38DF228CD391519E2794624 1dakoske
2,422,394,400 *FFFC319C866D82D3B6F65C47DAE0EC16BCC9907E 1.FARKETMEYEBILIRSINIZ
2,422,394,401 *FFFF6901D2B02827138D27ED206A6A074F474633 1FHRJIAN3M
2,422,394,402 *FFFA65E3D12A59D6EA244E54EB4A456B88F1D21D 1.HARMISTAAN
2,422,394,403 *FFF560A8F8F9BC4DB6712DF8F37A4BD4E1C792C0 c5qwf
2,422,394,404 *FFF1B52481107532D8C2C04B9283ED3B827C0600 cadency
2,422,394,405 *FFF212538BAEE11B860D9948D483BC97C875C2C9 [email protected]
2,422,394,406 *FFF8E6767C99C441BBFA1880F006286D92E8582D cardputer
2,422,394,407 *FFFA3170EA9C809D5DD3AF9B5B63F5DD8A956AB2 carminededon
2,422,394,408 *FFFC839EA4C0904A4B8D6044FB8EA7DB0893ECB1 1-oelpreisentwicklung
2,422,394,409 *FFF823BC7DDA2EB052F81F3EAC12D61D829E5D0E CARROLLPENNINGTON
2,422,394,410 *FFF3517C01C126EF5123EDC0ED6AB166E54B23C9 1PIANATURERLEBNISFREIZEITEN
2,422,394,411 *FFF3B0E282436A7F949D374E2921F0F438BAE4AA 1 PIEPENKIN
2,422,394,412 *FFFDEC212BD1C5437660C3E7EEFB4B90A002D5A5 1.prica
2,422,394,413 *FFFEA8387A37DE7C8527D89A73681A608F44671D 1Q2W3E4R5T0142
2,422,394,414 *FFFBEB697A48A692A1F148F3C57F5DA2F3CCEF91 1.radsportbegeisterte
2,422,394,415 *FFF44B14E41081B88D02191001AB2277EF5A09E5 CATALLSED
2,422,394,416 *FFFB42023DFDCB2C27B198B23407363F11B4E1D8 ca!vb
2,422,394,417 *FFF16A76E2C4B0AC9DEE668831168DD4B7E42426 1SIFRIED'S
2,422,394,418 *FFF3DC47523BD8417CD283BBDEE10570950A52A5 cbngc
2,422,394,419 *FFF3A5EF1C4CB6BFB4B7356586210B8BA09CC83C 1 TELEVISIONCAMERA
2,422,394,420 *FFFBACD3FA8B3D673C9AFF9B005FD1F6301ABA53 ccpc"
2,422,394,421 *FFFC859773B17CF7B84B38A99DE5A2D33C6D521C cemdi
2,422,394,422 *FFFE45FD80D9C0FBC101B5BAECAB0D02DE867C9F 2097862 kokemuksellisen.oppimisen.mallin.mukaan.yksil
2,422,394,423 *FFF49AC914F528DC2024C76A66214211FBC30C25 CGBĦ
2,422,394,424 *FFFEAD3D3370769D0401C6151B6DCBD2F3619209 24jun1190
2,422,394,425 *FFF731B9C3ED125AD5217B6889BA12076FE17B00 CHORAVA9
2,422,394,426 *FFF02068E7FDC474B05D01B86DD9AD071698708D 2742384 UVANNOSTAAN VOI HELPOSTI V
2,422,394,427 *FFFA6833CE35DCA38C3E4A913BCE068FB9BC1EEB CHRISNAHANEE
2,422,394,428 *FFF2D38D16E26587C4BB81AF30360A14FB2E81D9 2879335 EDELLISEST
2,422,394,429 *FFFC9123DC18D06BF505B129655DFDA7F6FCD582 2931578 JOSKUS K
2,422,394,430 *FFF809D14F9921E9D9BD5F38EAE1A14FFE41D871 2buntstiftbild
2,422,394,431 *FFF510EEDFC2FE9A6C220A3DAF5B18E89E9573A5 c(++k
2,422,394,432 *FFFB8E39D2E37DE71FA2AA7287F7611591EDD799 2 KRAEUTERBUECHER
2,422,394,433 *FFF641C7554C332EF05F7130247CA22C9E983564 2LATE-THURSDAY
2,422,394,434 *FFFC413D168BD228C9EB0F007C28130F9CD710F6 CLEPICD
2,422,394,435 *FFF266F88324420691A4DC6AF06662D03B67500D 2PAAVOSEPPO
2,422,394,436 *FFF802435096A2DDA1FC747A8902E36037EDE4FD 2PYRMRPHT
2,422,394,437 *FFF90D28A33D31515B9D42CD2E0A84A3D12CC21B 2TALUCCI
2,422,394,438 *FFF659D9B8FB2A7C2D1D6DFB720A67B1BEC3E0B5 2vereinzelltes
2,422,394,439 *FFF31490498914F3C44BBCF18BD3C2E678C9F5D1 C'MON.TAKE.A.HIT
2,422,394,440 *FFFAFB11E4B3AB25D44DACD750DDAD599CC51DE1 C?N&
2,422,394,441 *FFF1363A3DB1E3A5D24098FACCFBF063791B5B22 CNEM47OGR4PHER
2,422,394,442 *FFF235F1A1ADD625BC17CA6D9B25CC47C03A15B9 co0uu
2,422,394,443 *FFFF83F7598464FE95C355CE8FB2F1DF61708A04 3====D~O~o)x(
2,422,394,444 *FFF55D3B7060AD332FE9CD33729E8B01D59EE613 COLEMANSKEESICK
2,422,394,445 *FFF4A7B66B06B9EFD038D4931599AB1767B1C666 COLEULATOWSKI
2,422,394,446 *FFF6AEA1154ECD16D0B027EE4EC22894D142FC9D colinserfling
2,422,394,447 *FFF94C8F5CA03466B603BFACF44ED13D925886B2 collinimbach
2,422,394,448 *FFFE8AEA8CE915167C64E7526AFBD61FFE04209E 3iluvmargaret6
2,422,394,449 *FFFB1BE7EC2B0A3317418D517F1F5EC7E7BB47B0 3NONADHERENCE
2,422,394,450 *FFF37A1848476938CD9E2261FA6BAFF7D0709C34 3##p-~o-)X(
2,422,394,451 *FFFC1AA0FB6F13977A9EC6D79BC8E8B9F3F32525 3SARGENE
2,422,394,452 *FFFEBB9F5D52F73A8FCDC5917967D6F4508B17BF confuted
2,422,394,453 *FFF97D1496140AFD7059268107CE8ADA9466EBCB constructiondesignb
2,422,394,454 *FFF20153E7BA7D4992C91C921F64D204730220D6 44945 AN OCCASIONAL WORKER STOPPED BRIEFLY ON THE WAY HOME
2,422,394,455 *FFF11101BF311CAAE063992EC7EF98C0796CD750 44NIPPUUN
2,422,394,456 *FFFD3AD5495BE4DD782F1621836E68E26D48CD2A CORONACONNIE
2,422,394,457 *FFFBB7E9FC709E3B7F52497B88ED358AC07546BF 4EVERMAGEZ
2,422,394,458 *FFFD47B35997B38432B3258B40A5F127D66CC53F CPH.Q
2,422,394,459 *FFF75A82CEA8FF23DF1F82502B0883E8D524EB8C 4ISPDNEWSSERV
2,422,394,460 *FFFED571BC52BFD1CCDE960803BB30348E5CE739 C:\PROGRAMFILES\MICROSOFTVISUALSTUDIO90\VC\CRT\SRC\INTEL\XDLL_LIB\CHANDLER4OBJ
2,422,394,461 *FFF4EA58F18CC24E7CB11802C819F048F80684F1 c-:qw
2,422,394,462 *FFF70A8A982F442C48DC64CB458A5885F877EEDA 4ORCHIDSINGER
2,422,394,463 *FFFA0B580823E2C30F69EC0665208DBF463C411B 4ORTDAUER
2,422,394,464 *FFF1FA9798C21B643773454F7F4BD63F8B8735A9 CRAIG BAHRS
2,422,394,465 *FFFDE3B0C4A0A1649E62650E24216E5EF02ABB91 CREATORKUNGFU
2,422,394,466 *FFF7ABE630DC7479037E2D95B15FF7FCE8DAD240 CRICKET1968
2,422,394,467 *FFF14FD3C091A17D8656EBA796B5E584FDEAC330 4SILICEOUSA
2,422,394,468 *FFFBC93AD4B0B28914BB625177B945140F5C134B CROSH
2,422,394,469 *FFF5A2448A4D83821700DA00DE8F1097D3567912 4VSVANKAY
2,422,394,470 *FFF8B47157AEF32F9E66AABB4F6824799695BAA0 CSTMASEG4
2,422,394,471 *FFF3065E9357660E09296C9D864D89DCB4D8533D ct%
2,422,394,472 *FFF70F70F5BA21A55167977B932C50E5FB40B58C ctao$
2,422,394,473 *FFFB4AFFD4478BFE0EC5D758C660FDA9458E05D8 CTPCW
2,422,394,474 *FFF88DD1C13EECC880E16E4D48C72CDD0B2E2971 C,U:.
2,422,394,475 *FFF0DC939AD26265CF71B0CF3506892E7B2F9B15 5BSWFALLAHBSW
2,422,394,476 *FFF167DEBC96A12AE265E078CE449231507817F5 5BSWPESEKBSW
2,422,394,477 *FFF8B7513A5ABBA4EF6804BCA84E7A0FE426608E CURTIS.OROURKE
2,422,394,478 *FFF7AD87711875B2F91E3B049D25DEB523A4D35C 5EGGHEADF
2,422,394,479 *FFF637B9A33E810360414CD38D2B02AD93159FD3 CVHS
2,422,394,480 *FFF930F4AE9003238D56C37CBFF13FD09B9B9205 CWAF=
2,422,394,481 *FFF16AB43AF546FEF16C9420320D9297F2505363 5HLLBRCS
2,422,394,482 *FFF30E903368B82CE5F5E5BF19193BADD2EC3D33 5ILEANNA
2,422,394,483 *FFFB838F6960F3550D629DE31A5E586FC7CC73FE CX=LV
2,422,394,484 *FFFCECD87BD582582CD48A0966B39B6B01D7EE28 CYH%
2,422,394,485 *FFFD7163056FE61419C12170249B42F6B8CA5EED czerjomuszkach
2,422,394,486 *FFF30A2953C20268C4FF1AB051E374B98624ABAF d3xqo
2,422,394,487 *FFFF1BB0E3AF0324C284BAE1354ADB57BC22E18A 676530 DENBUERGERNGIBTDIEVERORDNUNGKLAREVERBOTE
2,422,394,488 *FFFD26905F4EB556B1903DF1EE8EB86A4B6DA16D 67905 ".L
2,422,394,489 *FFF034434148FE4800C81E8D42FF21FDD2C2E637 dambė
2,422,394,490 *FFFF26562BDD10F9ED9753B1BB279A393A3F6228 DAMNIONS0
2,422,394,491 *FFFD7150B88E4CCE9D92468CC5295533DF39AC41 DAMONTHACKABERRY
2,422,394,492 *FFFB838167B9D4D75DC0E28DE1BB13496A1D2342 6ASPENCINDI
2,422,394,493 *FFF25764C48750BEDEC4556466D3C8607B5E952D DANIELHEGGIE
2,422,394,494 *FFFABA7798C137D92DA0396EEC8398EE4BBACAF7 6CUPPERED
2,422,394,495 *FFFC85005B566AD4CF71008DE7E30CCFBEE4E48D 6DACCHILLE
2,422,394,496 *FFFA64832C13B2ABF3D4370895878F79B89714B8 DARELL.MIGNANO
2,422,394,497 *FFFD61F6E44856C9FD77A84408D185621876556A dark.matter.(feat..mikee.goodman)
2,422,394,498 *FFF33AD2AD458FFCC7DDB06EBAAD25A72393A0E0 DARLENE.LINVILLE
2,422,394,499 *FFFE13101581959F6A17A9055D6A958082077A4A 6ELECTRICGERALD
2,422,394,500 *FFF0F3F75EDACED9B7E7EF321ADC13C470B704F9 6FULLGALLOP
2,422,394,501 *FFF55C844BFDB61C389C42703FCA46FF3E1D074D 6iamkristen7
2,422,394,502 *FFF1F8251471B529AF6598B1378605C5871F4CB0 DAVIDIANSKE
2,422,394,503 *FFFE1B1D4A44A0B13D97A211BB077CF1AFB175D7 6KULKUNEUVOISSA
2,422,394,504 *FFFAA674298B1D43E45249CB155DE5041CEEFDD4 dbf4s
2,422,394,505 *FFF839CFB7A4AA13DB3E4070E787A6E039D65FC0 6VERSIFORMIS
2,422,394,506 *FFF97A4605FDD47FE4E95A44ED535F606E0F495E deeju
2,422,394,507 *FFFF3F5EA657646BD95F2C4FBE981EC42496AA0A 793633 suunnitelmat-ovat-my
2,422,394,508 *FFF1993EBB68C335B1DE5B751B6D753D57E7EEC1 7BIGDOGMONTANA
2,422,394,509 *FFF4A3BD97DC272BBB384A94FE4E9C038417C3A9 7CEANBORN
2,422,394,510 *FFF8BE5DAF901BC6094F26BF48B699DC9920E6FA [email protected]
2,422,394,511 *FFF9F080490F9C81931C4163534AD318C2FCBC75 7ENDEMMAJ
2,422,394,512 *FFF8448C449B0859C5DE7197A87AA03B26C2773E 7FAITHPOLO
2,422,394,513 *FFF6936C47D288BF3F8D79432F1F34829B8EBA5B 7fr-korrespondent
2,422,394,514 *FFF7DE6536BE863668C6B752134CD924E0CA4B5B 7HAPPYDAYTRAINING
2,422,394,515 *FFFC990605C564D585A289C862EFBFB18E1E8984 7iamcobain2
2,422,394,516 *FFF8C868BCFC0DCCD2561D69DD7CF3B7A1CCB999 7LODOWICK
2,422,394,517 *FFFEEC758DCB07FE59AED1FFE78327A055266982 7REKCILFFART
2,422,394,518 *FFF551D918A5A86B360696FA996D9EF61C6C3794 detrta1
2,422,394,519 *FFF3DB4255F280BBEE93B8C2B457C4AC0B49D3F8 816830 PALVELUTASO-JA-VARASTOITAVIEN-TUOTTEIDEN-M
2,422,394,520 *FFFF3486E338332BD52D8FBA3ABAA2BBE05CCCEE D+GJ_
2,422,394,521 *FFFF0E8FBDF00ED48A6616402238FAAF488AF846 862881 LASKUTVOIDAANTULOSTAAJOKOTYHJ
2,422,394,522 *FFF7FC57573D459E3933BFFE04DF3D4DDAF339D7 875252 MICHAEL NICOLAI EI ESIINNY TILEISS
2,422,394,523 *FFF0A8BD339F05528798C18EBA1B0B7D2365A6AD 889236 HAKLIOLDUGUNDANMUCADELEDENKORKMA.
2,422,394,524 *FFF142AF6D6E5BD102279B85EA5E6CDC7EC39CE5 di).a
2,422,394,525 *FFFC1E1FFADE51D7DF6242C123116E02C65B9A2B DICKZWAHLEN
2,422,394,526 *FFFC8BECFC20DD24E6221B3778098F91DBB4918F DIGNARME8
2,422,394,527 *FFFA4A66064605179D3EA81CE049F8D410FABBDB [email protected]
2,422,394,528 *FFF16F0D803015141A7E3B169AAAF02A90D00B02 dilchâd
2,422,394,529 *FFFDBE875F90E371B7907CCA8DDC0E163D4BB23B 8EFTERLIGNEDES
2,422,394,530 *FFF1BF5465AB59CEB5629F15CC48691A2DE7105D [email protected]
2,422,394,531 *FFF3D547BD5BA98B401590E3597A4D808D825193 8HENDRIXENTER
2,422,394,532 *FFF69128E0A4673C68226FDF2D1404545102DEA3 8KEOHSLAV
2,422,394,533 *FFF3FCC5F3C5F518F7919461AA534786AE81EB13 [email protected]~O.~O.>B0
2,422,394,534 *FFF4CCDBBB46E2869D647DF3830DBF7409B4D74E 8====P.~0~O(>_0)
2,422,394,535 *FFFEBC4A19A624E7D5DE637AEEF969F36A860054 d?kue
2,422,394,536 *FFFDDB978140FF76CBE869B855D74E5099B7266D DLS2X
2,422,394,537 *FFF6E0772200B841803C62CAF5F86377CE211E98 9CSGNIKIV
2,422,394,538 *FFF7CDAE06B58D3527E9991787DBCA1670F81CC8 DOOMSFRO
2,422,394,539 *FFFC329A6BAF45662402CFC874FCF5A242B2C47F doornachtigst
2,422,394,540 *FFFA5505B2DFEE4A7F3DDB5A674209D4815C2E94 9JAREDRUSSEL
2,422,394,541 *FFFAD630237958539110F0A9B7A545680E4B87A3 DQ,A"
2,422,394,542 *FFFF1BD018F7F721EE6FEC59C65CE53B1CB453AD dq#%p
2,422,394,543 *FFF7FFA6C42ACDF273AC4B15F890BD3CC39D3C15 DS!KD
2,422,394,544 *FFF5F464F14989B10E6FC4E2819A85F160BD0733 A&2QE
2,422,394,545 *FFFD5C5067C751FBC0F26865BC8C4311FA787433 a(;9-
2,422,394,546 *FFF66D6B9120BD56850B61B896E78FF586694F10 A9rbu$n3$$3$
2,422,394,547 *FFF601D5FCB3966E32DDC928A04E712491D9FA82 DVH+
2,422,394,548 *FFF583CC42FE14C1112ACA214186F196528AB820 dwaingobea
2,422,394,549 *FFFA895E17CE6FFA931FACB2CC50791A79041BD7 DWAINTROIA
2,422,394,550 *FFF5BC15B13329BCB56FB7680A731DB1B35ECC12 dw#dg
2,422,394,551 *FFFDA294164143F5D9FBF8CBDF82FF7E84C3F266 EASYFLIGHTCOM
2,422,394,552 *FFFFBBCC8774AED0413F1E583D3CE5003753F9F9 ecwme
2,422,394,553 *FFF992D561747EF49EC61251A1AFC986764BF667 [email protected]
2,422,394,554 *FFF0C272592396BF5F1374B93FEC2FAB31103C3B EEXSTERVEEN
2,422,394,555 *FFF9F17F43C9DC0D2C2865CCF84290A7D7F478FA EG,;J
2,422,394,556 *FFF7F0B160581BFF9F4FD0B5BC6B83B29AD5FEF8 e!gu
2,422,394,557 *FFF9989F873A604CCB3D7C1AF814815BE893E014 ehg`
2,422,394,558 *FFF9050A284A7E4ACACBC9E76414C28C05FC80AC acnodes!
2,422,394,559 *FFF4DD659590F416F166C68F2C1C3D3A965BC787 ACQF3
2,422,394,560 *FFF465F589EA08BB8F1261B9650408666B3B7839 ei#_
2,422,394,561 *FFF71E3ED3BC605A5A794EB58997CDDD162C748C ELDEEB1
2,422,394,562 *FFF94D25F05912B3939B66E2337559A75E8A4ED2 eldensieck
2,422,394,563 *FFFC378F261449836B40260553A7ABA2BD6E1E1B EL-DIARIO-DE-HANK
2,422,394,564 *FFFBBD803D34A5FA6E961C960326740815069BC6 eleanor-valencia
2,422,394,565 *FFF8BC5ED32EACC489C4E7C6B0CC4273ADB22EFD ELLIOTT.ARAU
2,422,394,566 *FFF362D28D66430C3D4EDD5884EFD43D63381D7F aee2%
2,422,394,567 *FFFD7A183D4DB2CE83A7DDA58E73DC0E523CABD0 ELSHWAA5
2,422,394,568 *FFF55211D16F7A9D87CDEF10BBED247530DD54BC AGUA FRIA (COLD WATER)
2,422,394,569 *FFFB76F0FB584A0A9286DB0A06EDD1B821A2714D A"HM
2,422,394,570 *FFFB912832595A342B9C5F5DFDED20B8FDAFC658 ai(y%
2,422,394,571 *FFFEC08071C165A1735770D8D5482DB4324D3BE4 EQD3M
2,422,394,572 *FFF1AADCDCA8BDC62BB5FF48E8208D656B1159CC ERICKSANJAYA
2,422,394,573 *FFF59649947BC559FFC8F7A4EDB555595BC61F4F ERWIN.MYOTT
2,422,394,574 *FFFB00850DD0C376ED10BE6A115725080DCB8AF9 ALIRB
2,422,394,575 *FFFD1D6A6D4AD6C884DCAF08A0B77C88E2FD70DA ALRPM
2,422,394,576 *FFFBC967132D11C7C54AA0D04AF3650F2A505AC2 ETHAN-MCPHAIL
2,422,394,577 *FFFE67AC44A869CDC80089A9CA9F4658A57A4237 ALUP
2,422,394,578 *FFFF4C40941EF6FE046A0DB72CA259C8D51F9AAA ET;JD
2,422,394,579 *FFF585E6E021F1FBB641BD1E0A091DAF4D399290 evitagitsninu
2,422,394,580 *FFF1755735F89A1FF5FBD70C1D7BCBB7C2A124DA andthoughmyselfhavebeenanidletruant,
2,422,394,581 *FFF6ED43BABCD646F522E8A45326364653D41AF4 ezkk
2,422,394,582 *FFF64EA7EF0C88D54F3BC9B797DE8D7C577AB711 ANGELOKIRCHHOFF
2,422,394,583 *FFF50A0C0F317BB808B5C4F474B09583D5D75857 F14RIN9
2,422,394,584 *FFF5327EEF3F92686567AF417380891554AEE074 FALLACIOUS3
2,422,394,585 *FFF9E3D4AAB1DB9B3E08CDF565AEE77CAA908505 antonwittlinger
2,422,394,586 *FFF44EC1746747B1AB4BFB4B537381E82B3E31B8 FAUSTOSTOLLE
2,422,394,587 *FFF1FD51C97F126E4B4D77FF06A8531FBB38DA18 fbq}
2,422,394,588 *FFF704EAF6DFABF52E4A8FA82023516B26F7E234 febresd2
2,422,394,589 *FFF13A4454C97C17AE31663884D364E42CEBB9D1 a.o)r
2,422,394,590 *FFFFE7F4CF1640D44857F4ACABBE00EB0869EEA0 FERNANDOORTNER
2,422,394,591 *FFFD7337574B8EBC1E1AAEAE02F611D88CEE5B5B APILEOFBLOGCOM
2,422,394,592 *FFFF8AE5CD68C7CA810E12C69D65B1484F443A97 Apocalyptic-:30-(a)
2,422,394,593 *FFF76C9A5ECAFA87DD346B93BA44B8668037CB18 [email protected]
2,422,394,594 *FFF3EA35F1C9B0D4C7C951BD27AC720461DDC562 FILTHY-HANDS-FLOYD
2,422,394,595 *FFF0F23EEB33AF14CB92CC71DFF5F6E63CEA5D7E AQHTARA
2,422,394,596 *FFFA21C3F9E6C225398AEEA5C37DE81BD7FCF5C3 aqw&
2,422,394,597 *FFF71CBC6EB154D8A8CCCBDDCA1B2974484784BA florencioczolba
2,422,394,598 *FFF9ED6729D435F2EF9943A4FD4FE08D62D49D4C ARCKÉPÁBRÁZOLÓ
2,422,394,599 *FFF1F5BD831D3F6F30A7D042FDA803F86EBF881F floydschunk
2,422,394,600 *FFFF6E75AB2C62F62E5AAA13F57B7FCF3EA434D5 ARIANA DILORENZO
2,422,394,601 *FFF1D9C96CD2BCC42F2CA1DB33F16F1BD28CA303 FOREST.ZULKOWSKI
2,422,394,602 *FFFED3653374F799018CE68CF0233DAC826BA961 ARMANDOCHESSMAN
2,422,394,603 *FFF32158D7785B3F25EF4868A2AF3C3EAB6CE27B FOURIER25
2,422,394,604 *FFF4320A290CFA391C20EDEF911B5BB7B2C606A9 ARONCURIA
2,422,394,605 *FFF45B1498ED7FE3838D3E721AE71768BBD3601B FRANCES.CHRISPIN
2,422,394,606 *FFFDDF0028DDBEBCDCF8E13F9C7DC648D4303C55 FRANCIS.BALLENGEE
2,422,394,607 *FFF01CA457858B8E1CAF57BFE757A73339CEAF72 FRANCOISRAOUL
2,422,394,608 *FFF60C82A69F36F3BED62394ECB0C87FB35D58E0 ary=g
2,422,394,609 *FFFEC67E6B2B1D5E0A51C270686F6DC5C9459B62 frosch.power
2,422,394,610 *FFF6B869CBBFA6A2632A272B00A1F50E98D1A79B ATRIDES123
2,422,394,611 *FFF634392E508FC63B925987742C621BDBD1D9F7 FZHADDAED
2,422,394,612 *FFF09CACA322D0071425A6200186241F16B20AD6 GAMECOCKMEDIA
2,422,394,613 *FFF928F912EB7EE2CBBC871B5E92E1BE69FCD626 AuZC
2,422,394,614 *FFFA7F31BF01EEF6FBBEC9402F63D458E6E6C846 GASTON.WARINER
2,422,394,615 *FFF3C3ACABE307FC096B297465CC882D75D6D2E7 av?(v
2,422,394,616 *FFF98E5130B80502DE452F4A6A53003AD9A2E105 ge$7a7onal
2,422,394,617 *FFFD34158D5A015CE10842130A1E32BF321D6336 GERARDO.HEIDEL
2,422,394,618 *FFFD64EC24AECDA2100DE56CDE56D1AC4C704451 gerardowasmuth
2,422,394,619 *FFFB80BA65E15061CE078F770FDB604649EB0B9F AZLMC
2,422,394,620 *FFF261803D9484692822BD998B63A03C9826A1EE B0G.GR4SS
2,422,394,621 *FFFD468AB43511439F89DA6AFB94E5B881404A3B giocoli5
2,422,394,622 *FFFA76462CC882F5DC29FAFBF48A67741EB82FD4 B92EB0543DB7473FA9AF193BE1A39202
2,422,394,623 *FFF0CF07543A9A6CD6B2B72126B116ADBC90BD72 BABATUNDESOBOWALE
2,422,394,624 *FFF39E23E45672D379A0E360269CFB77EB02F863 bakeries
2,422,394,625 *FFFEF4340949351B8288D9903D3EAA42D7774AA6 graham.bielby
2,422,394,626 *FFFACE8017A9E24B36356DEE6BB8535EFDC98C07 barneychuppa
2,422,394,627 *FFFE80C34EEE533B3C356545735345BAC2D79624 BAROCKKONZERTE“
2,422,394,628 *FFFBF200BD54EFCD1AE2E273C794660806C4474D BASBESEM3
2,422,394,629 *FFF8CFB07FB43953F1986641374AA9BC5AE0813F BASIL.FLAHAVEN
2,422,394,630 *FFF7064B4DDAF794639A7694F3A33F0335E88F9D GREG.TRIGG
2,422,394,631 *FFFC85485AC2ED3DC4DE98C9CE32264F880BA240 GUY.CARBONEAU
2,422,394,632 *FFF4D591DD9F9016A681B1CB01C44CC15CCFDE2B GVLP4VR
2,422,394,633 *FFF4E76FED37B37F95383C0BAB5E0BC48C4B7F5E bedryven7
2,422,394,634 *FFFF0272D976DF11D06CE64F41FAD6338A1799C1 [email protected]
2,422,394,635 *FFF9BF5C27B03D767BE1296E7E642946CFA25971 harlandzappulla
2,422,394,636 *FFFBA073C0DA03984E053EEE049837A484E7232C HARSCHVARMAN
2,422,394,637 *FFF3B2DE26049838100127ED8FDFD175F84C53E4 hatchouel
2,422,394,638 *FFF8CC0D6E4EEE58BB0FD95CBFF4E224E4C47018 b(&ep
2,422,394,639 *FFFC67721E4835FA09ADC8AC42AD2CCBD9E4656A berrymonday
2,422,394,640 *FFFB234C1BD4429BC0DFC6DAA186E04AE52A259C hbdj
2,422,394,641 *FFFE73A033122C87B6D39AC9A18359263EF50195 BERT.YABLONSKI
2,422,394,642 *FFF12886727B92C891826FF01A17D27BB1734913 [email protected]
2,422,394,643 *FFF9ACA7D8F736339E9402EE2C99680A7940E6C2 BEYm
2,422,394,644 *FFFDFF4713028BCD03A531B11E50A955BB3E5410 b;;gk
2,422,394,645 *FFF0A2DFEC881ED7B144ACD7720E618FAACCA8B7 BGNO3
2,422,394,646 *FFF902525831809DB26349252D78F7AB73A0158D BILUTLEIE5
2,422,394,647 *FFFBEA14E24BAA66C9E3348A9B3AED1101E65F40 bimorphia
2,422,394,648 *FFF95E97FC5F41459528CA0900528FFB8C8462FF BKOOU
2,422,394,649 *FFF5571FA1E4A7A2BB42D64135214DFFE355A4EB b&mdi
2,422,394,650 *FFF650F5DCBF01D14901EA597E61CFE5A58AB8E8 BNADC
2,422,394,651 *FFFE96DF97BDB3C4853EEC6E8281FE275A2B5F66 boamente3
2,422,394,652 *FFF72B1736E38173C6D50B8CDEB7402CF456AE34 hubertgiedlin
2,422,394,653 *FFF5664A2F69808103D38DE365B3DA342FDAD4E1 BOLTONJA0
2,422,394,654 *FFFC01AE82045A4B9522F144617A0E5B185566AA BOMBAYNATURAL
2,422,394,655 *FFF7FCCFE495C32745910758367A7B84B761E940 Hypergevoeligst
2,422,394,656 *FFF10991ADF50B4B46CEC4C03EAA759C2BE8EC0B BQC=
2,422,394,657 *FFF6881409CF5584F1813ECD9D3803152F45E8E6 IMAGESFWSGOVIMAGES
2,422,394,658 *FFF021470D8ACA8F9D8F67CB8712972B4A03AA4E BRLENE
2,422,394,659 *FFF47B0CEBBBC8D757CF1571F0D2EFD8AE744D31 BROODZS
2,422,394,660 *FFFBF28A0F363415661150F9CF5503FB2E918301 [email protected]
2,422,394,661 *FFFF613F03AC6F5204DABC469E20CA6EAA07AB57 INDIAN_RIVERS_INTER-
2,422,394,662 *FFF70B55CD3EFE6D8776DB8FBD73F247984324B7 BRYANTDERAMUS
2,422,394,663 *FFFE8E05DD82C1332087A8DEE2852C3A14B6EBDF in heaven (sad mood mix)
2,422,394,664 *FFF50869DFD0D37B891788CB236F7FF4D035BB41 BSUR
2,422,394,665 *FFFCE7875DC6618DFF64A62B91DFD01B730EF4AE ISTASHLIK
2,422,394,666 *FFF56657124865C7ADB9BA5213D1EE97F9E6056F i.still.remember.(gavron.yes.boss.remix)
2,422,394,667 *FFFB527923A86A861F4979C1E726A23213FA2150 j7p(
2,422,394,668 *FFF364231DCFB189299ADA977BB2FD2646E5E8E2 [email protected]
2,422,394,669 *FFFEC8C3C7C259B4E21C5C723E8CD518FDCB0674 BURIALLAWARCHAEOLOGYSTATEMENTII
2,422,394,670 *FFF5CFEF01DE34916877E107A32FD7811B1C3A32 JAKEROCKE
2,422,394,671 *FFF9A0F9FD994AF6812D8CFD60EF06F10D875399 jamisonaeschliman
2,422,394,672 *FFFB3FE6D8EE91176D7AFEC8D90A1EF6A96946F4 JARAUTA2
2,422,394,673 *FFF65B96C50BF725419A75D76280225EB5F29124 jazzmartha
2,422,394,674 *FFF190122941A67D98171839618FF5B43711FD0A b;vk2
2,422,394,675 *FFF37C12C309EE6642F32C1BEFF781BEDAAA7656 B+W4;
2,422,394,676 *FFF51BE9B8B123493C6801D5886120620D3D9D05 JEREMYBILSON
2,422,394,677 *FFFA0C01720C2F115ED502EC5AD00B8F93CB9149 jeremyjasmin
2,422,394,678 *FFFB08D2C7E5F94AEAB8897A274E797C4028230F jeromymckissack
2,422,394,679 *FFF6EEFD0985594F8D64BD124A89632DDF108E1D JERRODTILLEMAN
2,422,394,680 *FFF803F45955DDC45C4DAFE6B256B33D8044B893 jerroldbamforth
2,422,394,681 *FFF45F9E952AC54663F959C1873390B9E3441629 jerry489
2,422,394,682 *FFFC0FB1CC6A0E4D53829D38D8ECEC78442EFEB6 jiajia44bbs
2,422,394,683 *FFF843705DF33F07C4F5AC0CD032468D2E963565 BZ-D
2,422,394,684 *FFFA7C83C4EA1A23B83503B334C498D000184E6E C3MSM
2,422,394,685 *FFF089478453961867E97933FA6160344BB7E5EA JOHNCLEINS
2,422,394,686 *FFFB48B0E9B11107A66B34A5A67BE62F12CD49FA c5b?
2,422,394,687 *FFF640618DC2052EE911582FA99F921B1798CC2C C-7Q
2,422,394,688 *FFF906F52D75B6FF72732138319625015C1FC3A2 jorgekey
2,422,394,689 *FFFE070265EF987E447E79E955D07FB8BE08EE22 c8t_
2,422,394,690 *FFFD76A90562BA6E06F0F43212E95F04F23FA857 [email protected]
2,422,394,691 *FFF57BF5DECC922DE10E95BD5A502779071D2C1C j`]t
2,422,394,692 *FFF1786B546C49967A8FB7C6FC907EF649BA3DDA [email protected]
2,422,394,693 *FFFFDBB7A05D785B954F7A531F050FBFFFC92D26 CA5LM
2,422,394,694 *FFF50477E118699C1B051E778A8CF1F209842AE3 K150206
2,422,394,695 *FFF74EA04617E07F2F6DB3CABB11F287AE0D0928 caju
2,422,394,696 *FFFBA4937561FBA71019D5F7FD01B3BF9F9FFD2C k4xtbs5z
2,422,394,697 *FFF66F6A3174C0FD630797BBE330FDCDA23004B6 calamaris9
2,422,394,698 *FFFCE2BC7750D046626D6724C5E49657FDCA1D6E K6767
2,422,394,699 *FFF32F3E2FE0D289618730FC8E4650DC63468FC1 [email protected]
2,422,394,700 *FFFEE1581A3E7710FBA43837DF075814DBC89A04 K99035
2,422,394,701 *FFFB7D80A9803DAE14C0CA4D0DFBA22F85EC83C0 CAMERON47
2,422,394,702 *FFF6F3999A311780ACADB9566F0A59CD8D404D97 KANZONE6
2,422,394,703 *FFFB0CA1B432CFE8FBCE1E52F4ED4C9E6FE15986 KARLCROSSFIELD
2,422,394,704 *FFF983DFBFEC75B489CFF94E78453955023541DF Can'tKeepHiding
2,422,394,705 *FFFDBD1DFFF70D67F2A0891206F1F49C05688794 [email protected]
2,422,394,706 *FFFE7ADA806D4261B7EB7BBE45FA6D636CBF6C66 KATHERYNCHAN
2,422,394,707 *FFF3928AF8A0C7BFCBB83C884CFCAEC025406719 KENEDEXI2
2,422,394,708 *FFFE1D5689F4ADE80B0904BA819437E88B8B597A KGQJ
2,422,394,709 *FFFBF08C0C54086C1961978A7F29CF74C34FB05F [email protected]
2,422,394,710 *FFF4EA59A9DE62B59326C5E5A2ADFD93A926C193 KNIN6
2,422,394,711 *FFFBD23F2C436BC179BDA608320207EDBEF949A5 KOSTYRA1
2,422,394,712 *FFF74FC4D166D17963DF254CAD8D45AE8A5AEA9A CHADNEIDERHISER
2,422,394,713 *FFFBE46BC508FDDDBB3A430242D4D8C005EBEE94 CHALFONTS1
2,422,394,714 *FFF5928D61230076F9B1D2C31233A1B83DD528E5 [email protected]
2,422,394,715 *FFF8357C4993760C8351C2385CDFFF99AC308A4C CHAPTER16-03:ONCEUPONATIME
2,422,394,716 *FFF49F54DA0D520B0229B3C8C94A451EBE9CA79E laserprinters4
2,422,394,717 *FFF65F3B2D2E7C90B47ECD1C1B3AEA7C22E56D1B LAVERN.STJAMES
2,422,394,718 *FFF19A44BD076EDC0609603D1D47C1287C37C013 chetderalph
2,422,394,719 *FFF45CA5B23972B63089F6EABF389CEDB7A48AAB lcet
2,422,394,720 *FFF4B65AC663E7BFD4E3A9065ADD6A9EA0FBAC28 CHMARECK1
2,422,394,721 *FFF833EC52E9FB01BEA70EE55D3D55FE29CA9D92 chokham
2,422,394,722 *FFF15F7021C4CA04E4B5AA38AB87FDA15D732C50 leila689
2,422,394,723 *FFF5CE6ECC9DC8C7337B93F146F2033662F88075 LENARDWHITACKER
2,422,394,724 *FFFC340DBD497FA3D08468081D52CD9E8FB24236 [email protected]
2,422,394,725 *FFFDFD5489085A08B3304B04B0476C3D96E20C06 [email protected]
2,422,394,726 *FFF9F8F069E256DAA68E2847152C70717AFDA5B0 leonbovain
2,422,394,727 *FFF03DC5B7B55EEF6EF0E02834693F548ABF9C1B CI12CUM5C12IP7
2,422,394,728 *FFFD270293459D07DE453E1F97235132DF846C04 ci4g
2,422,394,729 *FFFB21AB1E569B7D837038C0E4F404D2A6E77B39 CITALUX
2,422,394,730 *FFF25006C388554B1B8E2524D8EFC72ED275D1E7 LEWIS.SWEERS
2,422,394,731 *FFF21E02DC4509DD6F052C6CDC9DBDC3712F64F6 C$J.W
2,422,394,732 *FFF57903F2D98F3E80DA4C0007B628BCBE1B2574 CLARENCEMAFFEY
2,422,394,733 *FFF50901D83C4B2E30FA60D7DEBC8A7C02D6B9A4 CLAUD.ECHEVARRIA
2,422,394,734 *FFFC5E1016AC43BD7FCEBC3C1966300D528DA819 [email protected]
2,422,394,735 *FFF034C39B83066AD7D44B275BD9ACE56A1348E6 linwooddelrio
2,422,394,736 *FFFE9D13BE1BD8AFC226D8B0C61B21768F6DCAA1 LIONEL.JESKA
2,422,394,737 *FFF8B3072BC71CBD433F20C7EFB5F7970FEBF8B0 CLC3
2,422,394,738 *FFFE9D6C48591B4669B04864209A754B3B4076D3 [email protected]
2,422,394,739 *FFF88AD3DA1EBCD9060CD54E4478F7A828E4E76D LIZ.RICHMAN
2,422,394,740 *FFF9D33A885F40983008E871F253D501126409D0 CLUSTERFOSSIL
2,422,394,741 *FFF796C458653EBD42C9B6AEBC218DE8968B18F2 cm_8$
2,422,394,742 *FFFE0FBD930098C70998DA6DD82F1155C9D24F7B c/_n=
2,422,394,743 *FFF6A491E923A037C262D922DF305B5F9F50587B cncplyr
2,422,394,744 *FFFEA10D2AA9FDF1D4D2FDFF1FF100BA8A119A94 COB23
2,422,394,745 *FFF56823BC00709A2CAB9DEE17DDEE7603872D2C COLINPILOTTI
2,422,394,746 *FFFDB5A854AA40AB6B9C4669D7BD8F1024E8BED4 LUCIO.ZOOK
2,422,394,747 *FFF81B0673D8E8EBD4445D4E50C4A1CA4C3CC759 LUKEADKINS
2,422,394,748 *FFFD5A6D9E8CA71DFBFD3BDCF4950F17B53330F3 COME GET SOME (FEAT TLC & YOUNG BLOODZ)
2,422,394,749 *FFF34A1EF2748A3B36DD24EC712DF46019A6AD8A COMPUTATUN
2,422,394,750 *FFF3B8DD028ED7D572850C0822F1304CAE95C670 LVARO-FERNANDEZ
2,422,394,751 *FFF48FD4064C1F5B7E67C1154F8861BDA31BBFAC confuted
2,422,394,752 *FFF181181A0BC3A5C7E6856BCDFD9E333EBC0156 CONNIEVONTUNGELN
2,422,394,753 *FFF960E479D4DFF55E83902842F4100993275441 cornutin
2,422,394,754 *FFFA62CB3AD61E2EFF420E23AA56FB99881DDB2C [email protected]
2,422,394,755 *FFF3B7A6AFBC6F2B170DCEEE313F63EAD9A660D1 COSTARICAEXPEDITIONSCOMWWW
2,422,394,756 *FFF59B31C9085B57711A413437C058B65ACE263E COTIZANDO3
2,422,394,757 *FFF57FC4DC38283F7BF4103A18354CBD8739A2E0 COVERSLP
2,422,394,758 *FFF25B1DDEF3BF30F94D953CC51761656273938F c:\program-files\microsoft-visual-studio-90\vc\vcwizards\appwiz\mfc\application\templates\1040\hid_edit_pastehtm
2,422,394,759 *FFF307841A2FC558EA4604A4B629A4CEC1E7DCC9 man1337886man
2,422,394,760 *FFFEBA0E4CDA740732A38DB8F577275B3602EE87 \
2,422,394,761 *FFF2D50E12BE7C01B8BFDAE713A24368C8923FDB
2,422,394,762 *FFF85F52CD2AC6548A58F3504DD5C45C8B009D25 
2,422,394,763 *FFFD41C3AF1E37FCDD8E5505687A616EF584E863 d
2,422,394,764 *FFFBBFA1790CDC96D75E76217581FB2AD8C397FA [email protected]
2,422,394,765 *FFFA9416104ED14A704A06F3CDF58D36580F84A9 MARTELIN-RAPHAEL
2,422,394,766 *FFFA0158E5A7CEE4FE77C33CEFE28DBB156C0964 martylesane
2,422,394,767 *FFF9A88993DF834F14C2EE7D7C12A0EBFF563DA1 MARVINHONERKAMP
2,422,394,768 *FFF9A1761876F92CD45D38C00DF5CF4C445FABED uJy
2,422,394,769 *FFF54A035E115ACAA1F6EC9CF6F1CF61B046F8D3 
2,422,394,770 *FFFDE2C42446DB279B7519BDD087E21D4AC41B36 ]^
2,422,394,771 *FFFCF1CF0A6F42C69387A7CC10B1F95B80EDB67B 
2,422,394,772 *FFF2E9EA94A7277EFD12ED403AA25691B243CAD0
2,422,394,773 *FFFFC985E2BF0F0A80645292AAA8C727AB3794DA mat-cumming
2,422,394,774 *FFF81D32D7735B6726ABF4B9F479EF82E3CDDEDF MATINEES
2,422,394,775 *FFF0A1E8376EF52250D2527ECE984690E7402FDF MATT-WEDGWOOD
2,422,394,776 *FFF8BB90D99BC68F77C3DD400CDEC2396E07BAC3 MAURICE.FABER
2,422,394,777 *FFFA71DE3355711990E8F69DFAB40846F4D7C082 mauriciohaft
2,422,394,778 *FFFC69E0A5D63CE9AB09808B42F93543DD990A75
2,422,394,779 *FFF3103ED756A98AB8EB8C3124BB573CACF58CF3 MAYNARD.NEEDLER
2,422,394,780 *FFF4E599A13AC3F0FD644DB746336B17BCB3B280 Mazurka,-Op.-30,-No.-3
2,422,394,781 *FFFF761F8C77510F7FCF867CABACE6CA86E7AE3E mbeva
2,422,394,782 *FFFFBFC0C175177E98900A3A308A3EED242935E1 m!crob!o1og!$7$
2,422,394,783 *FFFD8BDFC33D19BFBAD49A253EDBDA25AEF41C03
2,422,394,784 *FFF6F3B1AF3EEF5CB7EABCB9A37278DFF0565591 meco-monardo
2,422,394,785 *FFF82E9FF9669DE8F094EBD23D93AB1EA9C450D9 MEL.LAMAY
2,422,394,786 *FFFA73CB0A4C5834F49D95A4E3ED904474D2F947
2,422,394,787 *FFF6F398B43BE705CD134F8ED2A4FAA7AAF04846 MEMPHISBANANA
2,422,394,788 *FFF0A8312445A4891ECE970AEA3B9235D86FC779 [email protected]
2,422,394,789 *FFF2EDAF707D808217A282320472EA12F1FB7136 Ĉ]
2,422,394,790 *FFFC99133E52757B4C8EEC0FAAF8E66935C359EA MERLE.TRINGHAM
2,422,394,791 *FFF9774677EC59BA11F3CDE147B45D763895FCA0
2,422,394,792 *FFF914F6164B1CA1350D6A7ECA360F11E6F7CA63 MESS-HAL
2,422,394,793 *FFFF873DB70815FC5410B9DA3851DB49590E19D3
2,422,394,794 *FFFA1F1C581AE68F7302C7D75C4AC9B5D2675DC6 4
2,422,394,795 *FFF0688DD8BC64515306DC0ABE1E24D1707CC560 MF>
2,422,394,796 *FFF33F8B85D7CCD2892948F72D73F006FBDE191F
2,422,394,797 *FFF53E8B81E50C9F7D3A5B65FD51501883F637C9 ?
2,422,394,798 *FFF193AC2A8DAFC231A9BF320C78D143642D7A4F
2,422,394,799 *FFF42EAB7A4DA303612FF221D685FB112CF2459D microemail
2,422,394,800 *FFF6CD8BF7CEC36A8DA10720D5B0E7B989AE2E44
2,422,394,801 *FFF6CA0B7DD43F6951785110B47A6DC8A095225F mikiyas-solomon
2,422,394,802 *FFFC585B3B63407156BB391C057DA61F99DB0470
2,422,394,803 *FFF6851AFDD0F94EF80F9847E2DEEEBAB0EE9628 GQ
2,422,394,804 *FFF1DD67BCE3448CA546F4B2CE51CA7BA7B1611E _dlF
2,422,394,805 *FFFFBED1B41DC5EFB28502193F04E8463570BE0A MINDSCOMPARE
2,422,394,806 *FFF09085587F7D0E6133561773AC9A053ABD9A47
2,422,394,807 *FFFDF8942F212A618753AB75F05659DB8764E219 
2,422,394,808 *FFF7BBBB5C1FA055640F16D44837687003E7D17E 0t
2,422,394,809 *FFFF5A48C538A116D5966E912661C4BADDFA4B93 minutes.passing
2,422,394,810 *FFF309BF460DECA6EF1DCD8629CD94BCB0FEC3D2 Z
2,422,394,811 *FFFB44E00AC0EF568B1CD39B9FF9D628F2903B41 MISANTHROPIC.DRAMA
2,422,394,812 *FFF9415A0D0189E926945530F8B9700185972994
2,422,394,813 *FFF53EBED3B49C9E6C7E372A539C04A886994BA4 
2,422,394,814 *FFF0FCF2677ECD8ADB960D4DE88EC27E2F209CC8 p
2,422,394,815 *FFF48A35C5F61BEBA2F8AA205040C3866012BE44 
2,422,394,816 *FFFA844450BDA83089E54F44698217634EC8A614
2,422,394,817 *FFF1593EDEBFA5387F55DC15CEB0CB27ADA08242
2,422,394,818 *FFFE7B25A1F30BD53484E25187C935E3A40DC30A
2,422,394,819 *FFF9A3733F6AB4628A49CBC48F869773CD1695F0 - [
2,422,394,820 *FFFA985F5F081498FACE5977151A7360C02E66D3 MMISHINSKI
2,422,394,821 *FFFEBE222D3B4D1AF74F9A42582BCE5923675606 Z
2,422,394,822 *FFFCDBED4DCBC516C90337C2CBD21FF13BD3766D Ң
2,422,394,823 *FFFB111F821AE5889242154E2287BF4FF0007A8F moe.mozeb
2,422,394,824 *FFF8454786071928CE7A2EE908E284F9C03DF2D7 C
2,422,394,825 *FFF099854C4C9593FA892C364A3EA56EBAA57E7D _'
2,422,394,826 *FFFCAB3A60E6932DA050BF61DA5D6352CAACFC92
2,422,394,827 *FFF2B1FE7786E75688E23714AC27057D64B07271
2,422,394,828 *FFFADF45CA987F3FE2266262C0A2F08AC7803179
2,422,394,829 *FFF67A62696378CF700943A4FF13BD0B720AF92D
2,422,394,830 *FFF96091BA46CC34D2A957C1514164CE43B39872 montane
2,422,394,831 *FFFD684B321540D8CEC7EFDED9666F5C1A9543CB ҹj
2,422,394,832 *FFFAD905EA0C7B062110E53DB007ECEC3530E3A6 mort94
2,422,394,833 *FFF1D65219FBEB176686A68DB39EED61FD125C41
2,422,394,834 *FFF0540069B06FD66E18B5836F5B3107DB10A98C
2,422,394,835 *FFFBA37F950C057E2AF665B959DB6E8FFF69BF99 1
2,422,394,836 *FFFF006229488FC99D096D0638DC912735450453 MQDOVLJ0NZWWSHV
2,422,394,837 *FFF3B44FA81149D20C2E1287A2A8FC6CD5BDEC30 5
2,422,394,838 *FFF8DDFE3F3D398DEDD40C2D6F1F7B34B4DBB4CB mucknaed
2,422,394,839 *FFF94F20E7E680874AC8D46F5A4FF5081688A630 y,K̿
2,422,394,840 *FFFCACB86AFC17384BEDCFB9CB55DA03E3A302B6 '
2,422,394,841 *FFF5301265D66F7192C776F04CD4857DC9BEB4AD ]
2,422,394,842 *FFF1C085CB473A4C1A6CCEFD8C0A2D736C3A973A #K_
2,422,394,843 *FFF0C4ED5C3CC3D11EAD90473C4A28CB49186EB9 ڮ
2,422,394,844 *FFFCC605BEE06EE2C7CED364754C3CE59635E957
2,422,394,845 *FFFC1F096FDD131A9A1DA96F8CEEA5A6A4BBADE6 p
2,422,394,846 *FFF00BE2D1DD647D8BE2BBD34EC8F00EDAD7F826 MUM'SDAY
2,422,394,847 *FFF9698B7BD48DBBABC87444565476D445185B79 muscarine
2,422,394,848 *FFF160813D6152F3FB788209EA6E833913DA265A NAMERILAS
2,422,394,849 *FFFE8196EDC396885EAEC0B2B37BE4BEA9A44527 05101214
2,422,394,850 *FFF7D8FBBDB8824C1196A7FDB907845CBC51370A 08.03.1471
2,422,394,851 *FFFC64580208BBEEA46857413A971918BE54B8B1 n!c3t!3s
2,422,394,852 *FFFBF805339EE5E35E570132242CA65CE6263140 0A1EDB5FE0563E349BC87C1B06A15EA1
2,422,394,853 *FFFF4F913F1C98379F3B443F4E269233E19A0A01 [email protected]
2,422,394,854 *FFFDFFCA044FA1861150296822497094C3892B6C (-_0)[email protected]===p
2,422,394,855 *FFF2B1DB1597A98EC292F904AE8FBFD963BC745D 10carleigh
2,422,394,856 *FFF8B1C6FB5E2640A18E7E95349BECA9D189EBE8 [email protected]
2,422,394,857 *FFF02EA50B47A1B1A3B420D00D0FE104665A4933 NEVEGRABA
2,422,394,858 *FFF56E93AEF393EFD857F8162F23561D64F8A301 12:-12---#---&---SENSATIONAL
2,422,394,859 *FFFA3C826DA8AF799FB8D06DEFBA6185D6C82294 NEVYHOVUJÍCÍHO
2,422,394,860 *FFF81CCFC5F25036C642546D5D8027A31DCBC1FE 1376836 itisasorrysight.
2,422,394,861 *FFF61FFAE528BB6350EB422267B561A6CC08008E NICK7624
2,422,394,862 *FFF9EDB38A5EBEE3D0533524B01084ECA97E4255 NIMROD{
2,422,394,863 *FFFF6B4AA7ADE6C3D45360AB191EEDB653985A81 NOELMUNAR
2,422,394,864 *FFFB800C243523167DDB0E49EFD30B2EE50D3C0F 175439 POMORIT PURJEHTIVAT YKSINKERTAISILLA ALUKSILLAAN KOILLISV
2,422,394,865 *FFFD390968212BFD8F1B21EFE3D7ECD3899E1A5F NORDIKOCOMAUWWW
2,422,394,866 *FFF72E27D36F3BCB38507B3611FEE9AAF1CC97CC NORDISKA9
2,422,394,867 *FFF4692AA0DF3D50482908E95F8B0D3AE082726D normanddeschomp
2,422,394,868 *FFF54C0C34EE9171AF5F39AB36EEB604CD3ABF63 [email protected]
2,422,394,869 *FFF9D625B7FF4EE71EB91C58C3E069313A9A6CE8 19μελήσ
2,422,394,870 *FFFCCADCFF8E8A9C5AE3C52A9E208863002C528A NUSWBLN
2,422,394,871 *FFF6965A350C6B6362FC4B5D5577B5527F7E405D 1AUTO-TARVIKELIIKKEET
2,422,394,872 *FFF08EE9C79548A11D31B7884B43CF7CB0532441 1BABAJAGA
2,422,394,873 *FFF17E860325594F96F041AA4887846FF70A0459 odellloosey
2,422,394,874 *FFFF243F035D97FB0EAD1D68378B02ED20DF71A5 odellstavrou
2,422,394,875 *FFF4CE6E95A1EFC5A03A548F213818536332C572 1-EX-SARDINE
2,422,394,876 *FFFE24FCA6C191071549627593A86042C4683CE1 (o_-)~~~d=q
2,422,394,877 *FFF93239172D673023BC1696EB3B6BC7C2F214B1 1-GENITALORGANE
2,422,394,878 *FFFDBA2A348D44E2B0066CBF517D911832897F77 1HTEWARD
2,422,394,879 *FFF98CC8B2F457443051218720E0AEED41F078BD ol1057839m
2,422,394,880 *FFF998713A6EF4B8028F677CEFA9C36244EE7265 1 KAZANOGLU
2,422,394,881 *FFFECEC48757F05B9F7C7BDE2D3C11A71EAB3275 ONABANKOFFLOWERS
2,422,394,882 *FFF7DC1DFC6A1DAAECDDC9465FD38D70FAE66264 onceiknewaprettygirl
2,422,394,883 *FFF32A734C5DE849FD1A72982A83E12D1284828F OPEYEMIOLABISI
2,422,394,884 *FFF0471C9CB8CDACBAF9F9EFAAA3E8C3881AF144 1-ODOMETER'S
2,422,394,885 *FFFF9339B4F5F5D1C3DC4CED0CD1C08030714A1A orlandojforte
2,422,394,886 *FFFE066EFA7F5FB9087E248956A5E4930095F3BF 1 PHP-SELAUSSIVUN
2,422,394,887 *FFF2DCC64EF1663DA5D5CC2DB434366179E9CD9D [email protected]
2,422,394,888 *FFF0866D3849FB089C4A11A3AD93AE89AB7E0743 1 QUIPURE
2,422,394,889 *FFF2821C286F2BEB46067B242AFBF2505E4BF7C5 orvilleruffell
2,422,394,890 *FFF432CDD1F7BC46E8AA4947BF5FA16315538DA8 1-ropcaz
2,422,394,891 *FFF442848EC1C91E82AE27D1EBAB869A61E5A70A 1SCHUTTROP
2,422,394,892 *FFF63D38092C6A71B27B19FA03E905F80956E8D4 1SUCCALS
2,422,394,893 *FFF4B55090193CCBBDF3F3F529522791FDBC678A 1THEWIND7
2,422,394,894 *FFFC6E0983265C88454EF99B578F6FB36921A78A 1-TRAFFICKERS
2,422,394,895 *FFF77129219F3047D24B00C830C989F7E76A2C6B 1ueberschwestern
2,422,394,896 *FFF5A3BF1347B0F6182D6E2ABD72BA1139A3C988 1VASIKKAHAAN
2,422,394,897 *FFF9C62387DF02E6320F5FFBB48FC0842E37894E P====>-~-`-(0_<)
2,422,394,898 *FFFE1DE58DC749CD71B443A84FEDA390EE36252A 2004(FEATILLBILL&GORETEX)
2,422,394,899 *FFFD43192521BF75942B89E2E327DC18D0D58E10 PA1AD$ET
2,422,394,900 *FFF7CF60992E12DC97A5813764A8120A269625FD 2052026 porrashuoneenollessapime
2,422,394,901 *FFF445396E8417EB3410AC95BCC2E9621A95E4C0 palm.muting.in.a.hardrock.riff
2,422,394,902 *FFF18B30A27C0A2249D016EF2389B608DF848C8B PANISK8
2,422,394,903 *FFF40934B046EB5F4F4C8D4906FFCB4404F921D3 PASQUALE.VANSCHOOR
2,422,394,904 *FFFB39D0D66E23EC7B8EF79E0C8976F14C1DCF9D PATRICIOUS
2,422,394,905 *FFF3D79E4338C4C53C488226C735526F504F8FE6 paulalowther
2,422,394,906 *FFF8FCACB40BE381B4405004510A002BA0DA2864 2463881 sillevoiennustaamy
2,422,394,907 *FFF1E1A9B2BFFBC713F8AFC1FE6F0BE167ECDD06 2581876 h
2,422,394,908 *FFFC3BAC530C0E0FAF3119E87EF6B4F100A8170F pb~o~o.splat
2,422,394,909 *FFFE62DFDA8578455C5C78D7A0B4A595AC305F0B PENGPUS7
2,422,394,910 *FFF5294999DB3B62B70A4171F2E0E0007A6AA57C PER5P1CAC1OU5LY
2,422,394,911 *FFF2DBE887A8490778A38C7F48D218B0F3F560F8 2-BRYK
2,422,394,912 *FFF04FB8EFD15212F646B2DFE6BB236571C15BD3 2EHTOSIEG
2,422,394,913 *FFF284CF142936EA722DEA5ABEF573300A90DCEA [email protected]
2,422,394,914 *FFFC59704C67CAA27D97D22F4F59C07CEC8BCD7D pianosonatano17indminor"thetempest":iiadagio
2,422,394,915 *FFFB64069A04E37E12763B2025ADFA157F03F704 PIERRESANROMAN
2,422,394,916 *FFF274934C86798FF4BB71CCCC25D1D7E4A63816 2 stifflipped
2,422,394,917 *FFF34176D7643F2FED8CB4EBD4F94DDD09D65998 PINKSTICKS/WE
2,422,394,918 *FFFF3CA6E3B1C207AE17AD396AA17095B1DFF563 pliten
2,422,394,919 *FFF86F01843A503D5EEBE2ACAB47C7AE91EA7515 344448 IMPERIAL BK . , NOVA CORP OF ALBERTA , TOR . - DOM .
2,422,394,920 *FFFB7B371AC79DBF9233337EB482C1DA5B71BD5B 347287 nid...165.,.-.salo.,.unto.ihmisen.j
2,422,394,921 *FFF3860AA914176519869084FE4380F3F3EAF1D2 3/4.MARCHES
2,422,394,922 *FFF5F2E8ABB152DAFF05855AC4F5D143934A3DC7 POSHTRAVELLTD
2,422,394,923 *FFFF8987C1AF626870CD8247606940F83A4A37D9 3#D~~~)O(
2,422,394,924 *FFF57CB4712CCF7951019C8FCFD4729CF8096F1D 3THATDUCK9
2,422,394,925 *FFF7C92DDF5C84CDD3377A9632BD8619C42015E5 PRBCKLNGS
2,422,394,926 *FFF4F443E44DAEF6D58A7208FC4317120CC5CBFD President kissed and hugged thereafter, according to Ms
2,422,394,927 *FFF797ADFEDEB9CA2689A32B293B018333F2A40F 483DAPHNE
2,422,394,928 *FFFAB2CB3F7C099671C8761FCA5656C3791230BF 4.MCRAE:STA
2,422,394,929 *FFF8502712FB09F0A3D673E54191806A43AD9026 PROFUSE12345
2,422,394,930 *FFFBC3ED25063B75A9181BB081AEEBF31E36B1F9 4MIDNIGHTHOCKEY
2,422,394,931 *FFFA09A27CE592979AB863C4EBC3867872E77992 programmingcitation
2,422,394,932 *FFF69E2331A424F41E53F01DD10A1EABAB4973FB #pTY
2,422,394,933 *FFF8221F703FEF1D8C942F72BB30BBE82787F731 4RAYNAULD
2,422,394,934 *FFF44EF7DCB803D1D685EF3D8B4A0383A21FF363 PuntoOmega(LightsofEuphoriaremix)
2,422,394,935 *FFF3E51D160502E6AC4653D640AB547C0F38989E <P> WJC: WELL,IDON'TRECALLWHETHERIDIDORNOT,BUTI
2,422,394,936 *FFF9416CAAC983650373E3BB1C09D5A4076151F8 4TOTSTECHENDER
2,422,394,937 *FFF92092C870AB32A18087F2FDC9EEB5E46C2892 4U+H0R1+4R14N1SMS
2,422,394,938 *FFF6BE7BBC0EE2C22D19F62E15D8FA23A9FBD8BC qB `~ (0_<)
2,422,394,939 *FFF8E9C18EC6D5E216B07F7D825051B7F2F757E3 [email protected]
2,422,394,940 *FFF4D2272DAD48C015D1167884ECF2C7D097C813 qfb9sqi1die9laetz
2,422,394,941 *FFFBBF6EAB32E63AB8223656A3D15A769B39F207 QUESTIONSCBERLET
2,422,394,942 *FFF57CAD6312909DEA3A70ED1602940E88CCC823 QVBS
2,422,394,943 *FFF23B3C2E0B1F1FD0C5A6BF1D83C83573C2D492 5BYTEMESAMSON
2,422,394,944 *FFF5E9D531E7925612CB26ABDB2D0A96B86B7CF8 5DRWNDDN
2,422,394,945 *FFF9EAF6C92E13328B673986DBB29B758BC00E73 5FYSIKKARAKTEREN
2,422,394,946 *FFFC1681E4D1817ACEFF1E620167EFB5C0F2216C RAJINI SHARMA
2,422,394,947 *FFF0FFC087602177F03BA926DC0396405E009520 5NTRFDRTN
2,422,394,948 *FFF98D355827FF3DFFA6B9A1D5C5772DE75FD288 5OMER5AUL+ING
2,422,394,949 *FFF6E127BFC4DE5C86B4593D9D25E45DBA49620F RAMONAMORROW
2,422,394,950 *FFF02C629426310404CD695FDA3EF8E208BE3CCC 5SHYVONE
2,422,394,951 *FFFED2EA68AA63B2C00B7E11AD1864857801D0FA RANDALVANHAM
2,422,394,952 *FFF448BF5E995144592A3B89C362EC75008D230F 5SNOITALLITIT
2,422,394,953 *FFF5E71C7DC64097DD74771D6454902EFB470F4E 5TILIBAIF
2,422,394,954 *FFF1113CAE991CF407F2E94541B62189BA13AB2D 5TRUCMUCHALDENE
2,422,394,955 *FFFC7620D0CC2A78DF44274155C0B87DABA87C14 5TY
2,422,394,956 *FFF1B3251BC241A44E9EF3DA70E7F0C805974BD6 RAYMONDCOVITZ
2,422,394,957 *FFF66ACA1522DD3EE36B31476993492785A513DF 609D52F5
2,422,394,958 *FFFF84CA5776E7CF6F2E3EB42C3FC836A4993E75 RAZLAZI6
2,422,394,959 *FFFE659E2D38E8D2DF13539F10AB13BC04823CD6 RDJSTBL5
2,422,394,960 *FFF03BA181F46E607FD076E56DAA9BC58CCF85A0 REANGEREIST2
2,422,394,961 *FFF5629CCCB0305D603C4F47CC3E11A1014A139F 6CRYOGENIC
2,422,394,962 *FFF481F2992726B343ED75B0149CE7209FC21923 6DEVREZ
2,422,394,963 *FFF7BD0EA0B1824F39F4A396176CC8A78A8E1C91 RECITARES9
2,422,394,964 *FFF3F94E487FFACCD673D0D201868CDB86C9BC09 6DNEZNALF
2,422,394,965 *FFF0AAC766F67C5C39281C0A3065A77DF04A6A78 REENLIST
2,422,394,966 *FFF4CACC1FAFECCED290B5CDB1514C051E58AAFD 6ILUVBROKER8
2,422,394,967 *FFF51E5A2D1BA43792AF2B20D2E5719747BB51A5 RÉGITRE
2,422,394,968 *FFF084A08436CE04B97C984B9F52685E54320D75 6PUINWEG
2,422,394,969 *FFF4EC6F063DA4AF0D8BF7DDE2C2DB84B4379805 [email protected]
2,422,394,970 *FFFD0CBB84233ACA7D3B20D117DBB499FB7D27F3 RETFERKR2
2,422,394,971 *FFF2A2EDB552037E3EB9BC4E182E7817C55F628E 750delaney
2,422,394,972 *FFF8BA651BEA5000C42653526FFE9D034E97766F RIBOSOMALING
2,422,394,973 *FFFC268E4155FC221EAB9B8A77BB0AEBF5D125DC RICHARDCORDE
2,422,394,974 *FFF6C849506F60F36120088F697EF4F5101D9BDC richards
2,422,394,975 *FFFFC3125D922D071EDFDF95B1D3D2CCE53D6FFF richielowthert
2,422,394,976 *FFF63625C320E2B03CD0318A4E9EAD45EB0AC843 RICKMISTROT
2,422,394,977 *FFFE8ED113F29D3CA4314860B64EE329F807C5C9 7DESIMAALILUKUJA
2,422,394,978 *FFFCB0E7634917CC788685E86D9F01FD8E4677F9 7DOUGIEKNICKS
2,422,394,979 *FFF08126E58BFEA3F77448973B71E27CD621B1FC 7HERUNTERSPIELENENS
2,422,394,980 *FFFE9DD62EFBB1BA026D0EA4BC297E51C47E2F8D 7KINESERTRDS
2,422,394,981 *FFF2AE3CFB15B199880D525C1D3B1EE83A62729B ROBBIEVOGES
2,422,394,982 *FFF9921EDEFDA59F7B2679026CD3EEAF354E05B9 7MISSYCAMERA
2,422,394,983 *FFF2F13C164A5E58A061842C86EBE3DFC9B47B99 7-MUSIKE
2,422,394,984 *FFF14AAED923529EF3A937B681F72D8F577C6203 ROCK.TAN
2,422,394,985 *FFF6A5A1772458D31E45B7F0255BF1C8F4DD564F rodrickfrankhouser
2,422,394,986 *FFF78E3766D4209B77B4FC504510F0ECDF23B653 7SSELECEIP
2,422,394,987 *FFF685C9A6E7E2B571EFD39963FAF6EE5022DAC6 7TIMOTHYSNOWMAN
2,422,394,988 *FFF29A2D288FA67E63CE23A9668960C852085821 ROLAND.TOMEY
2,422,394,989 *FFFF50F8775AF391D226D47DB73F2A84257BA3E1 8/5/98 GJ AT 46 (TEXT OF NIEDZWIECKI NOTES).
2,422,394,990 *FFF7C2466F9BA57D897B49C5B53C5B459A0E31DE 8ARUELPIP
2,422,394,991 *FFF67BD0EECDD649BA4DD06DC040FBCD0A65A88E 8====b~o~o3b<-
2,422,394,992 *FFF3836BF94A20E381F0750FE1A546216200875E 8COARGUATE
2,422,394,993 *FFFF1A251F2C0E7D73828FED88D284A129B89B3C 8#D~0(><)
2,422,394,994 *FFFF1E6FD506C3F8955E9EC7B78FB5FF80D0C86A rudolphmager
2,422,394,995 *FFFCCA2CACA39AFD145567F0BF1BA9BA04A2BCB8 8HACINTO
2,422,394,996 *FFFBF1A2894D1708A66070F9113E0ED3F8848B60 8LADYEANN
2,422,394,997 *FFFBC74DA8374CAD0D6C437D84C8971578870F53 8LEWENSINHOUD
2,422,394,998 *FFF047473EDB3A2BC4D47D2B08E0AC40D97DFECC 8MERCURYWISDOM
2,422,394,999 *FFFD827D4EA7333EC5E886C738E1B3AACD276ACC rxcentric
2,422,395,000 *FFFDA938AEEE68597F20E568D1DEA239FDBCBADA 8suikercampagne
2,422,395,001 *FFFDF032D2961AAF339410DD7A2CE03334850EDA SAMANTHA-KEGLEY
2,422,395,002 *FFF135E4DC079134E2F50ADE9BB9873168F2EA63 SANANB
2,422,395,003 *FFFFEF1E181322ECE91A0E23B10D2916050C39D5 sanjanje0
2,422,395,004 *FFFE03B44034205C16680BAFEA72E85C300B2DBF 972151 'KALLIOKUPLII'HANKEKEHITT
2,422,395,005 *FFF849A338119DAF14835F212AC75BA5BAE99033 SARDONDELOSFRAILES
2,422,395,006 *FFF4E6E412084FFE4E2FA311A00CD1FB333D243C saturnhornets
2,422,395,007 *FFF8FFB36E6B0C0436C1D440828F96982E894B81 SCOTFAZZI
2,422,395,008 *FFF2CF028ECC07527AAFBFE460FBB7E7016C3CE6 scottiecliffton
2,422,395,009 *FFF6E00D6527654F43D241DF91268EECC1C35514 scottiejelden
2,422,395,010 *FFF5BD7DA11E8EBCA21624FC5A95F7BBD2A4934B 9LIZARDMONDAY
2,422,395,011 *FFFD02DEC1E2870295567F0E9633F7BCFE68ACF8 9MONTREALTANDY
2,422,395,012 *FFF9ED12FA7DB01E6DDC45FA08821226E61D0A6E 9TINKERCGJ
2,422,395,013 *FFF28795234FAF86BDFA6469F3E7D0D47F371267 A#;?
2,422,395,014 *FFF31CFB12594A2290D86C29CA0495B426D073A1 a2o":
2,422,395,015 *FFF50C959D711DCB6DEA7834D70844B214EFAB20 SHAHD MOHAMMED
2,422,395,016 *FFF159BDCCFCB515319D7F9DA9BED234A2411E97 ShallnothingwronghimThusitis,general
2,422,395,017 *FFFEB940C3D6FEC5A2968E2FE4C99FE6D3D0E8DA SHARDE VALSAINT
2,422,395,018 *FFF7DD7A25FABDB8B87179A8F0B56D8D77550FB0 SHARON.BADENHORST
2,422,395,019 *FFF4DAB232C33346E5C193E57C30F5FA6BF3C64B A7IS&
2,422,395,020 *FFF6EF2C4EF5B934BD3F291BABC103D2F3D0E51E SHERIDANFRANKLIN
2,422,395,021 *FFFADAD50CBAAEC48F32C0A67E8BEA4829BCBCCA aaa$[7
2,422,395,022 *FFF0BB631524095291A8334EE9DED77D0C99ED7F aaeekl
2,422,395,023 *FFFC472D316FD818B1FABFEC206A7D85B96032E1 [email protected]
2,422,395,024 *FFFFBA9C8B8C02AB3592864DDF8F7E9C0FB43F7A sillonnant
2,422,395,025 *FFF83CB9FB3AFDBEF614DA5DFF3DE4EC3279ABCD SINE:-500HZ
2,422,395,026 *FFF9844127CE1016F0F55FD9D0A787CDE9700D43 ABBLASENST
2,422,395,027 *FFF486C640BE472727B471A919829B9B15CC712A ABCDDODGER7
2,422,395,028 *FFF84920A2A817E3ECE6CB24479C82DBF8E756E7 SINKWAN3
2,422,395,029 *FFF83B8EF84D9193E70B743E1DFC7D9CA7A415FC abril1890
2,422,395,030 *FFFE44C8DE9050EC222429E1FC3872A1520E1E63 ABSORBABILITYS9
2,422,395,031 *FFFD867616C498ED2C39CB952D2A4772D78E2301 SLIPERIER1
2,422,395,032 *FFFD43CAD0267911FED6977A991963E9616529B6 smp13tons
2,422,395,033 *FFF8D0D595EB9636036ACC2A65908DCD767325DA sonymac5
2,422,395,034 *FFFAAEDC937AC8B119F001683C06B9A2EB2DA486 spencergaylord
2,422,395,035 *FFF4ECED3A61651308761C1A0336B06C905BAB90 AE1AP
2,422,395,036 *FFF5535B66478F5021B96015642313FF9D45342B AFQV:
2,422,395,037 *FFF64F3EC899B596743872BF4BED440574F4EC91 SSLINGER
2,422,395,038 *FFF49BB1F1C129D5A4ECF0738F7CBDD5B57F741C STAHLBETONSES
2,422,395,039 *FFFAE408311FED5D9E71046501965B46770AF346 AI%#
2,422,395,040 *FFFB7E2DDF8767AB7F2EEE336EB78DD16D541D72 STELOYBSW6
2,422,395,041 *FFF606B4001D624DB1E9FA13A9B4B9DF77152A0A A$(J#
2,422,395,042 *FFF0ED5DADAF717CE5F938A4FD394B339AFAE1E4 ajcfa
2,422,395,043 *FFFC513FB4A7AA3767DF587B37F207E2AA9EBC5A STERENG1
2,422,395,044 *FFFFB398E15D6EA264B4A7942E0FD842B025FE1A ALEJANDROSTILLWAGON
2,422,395,045 *FFF319F3AF058A2EC0CE057AE46891D79123C1A9 STORMIEWISEMAN
2,422,395,046 *FFF583B8D92AA3B5CF39E2D4AFD9C59FA8832874 ALIZAFARA
2,422,395,047 *FFFF68A72CE7964AF68834D701C4F52241FFF1D9 ALL_,
2,422,395,048 *FFF12E45CACC537E60E6A1703012654AFA0229D0 Alpine.Madness
2,422,395,049 *FFF882CCF0B9DE7CA87F16A4C77DEC5C48DC7F51 [email protected]
2,422,395,050 *FFFB75DDDBDA83FE77E0CBF5E745438326130579 ALTIJDFIST
2,422,395,051 *FFF783381536CB4D022ACA50E53AC1BDE3A654C5 ALUP
2,422,395,052 *FFFF7D04BF7DF490DA0C2BB156D5AD10EE9A2E53 SVASTIKR^IT.H
2,422,395,053 *FFFCE1CC30BAF60D4AAAA67672F377464E95E401 amix-
2,422,395,054 *FFF04787B8EDB65947A324E4DACB0783C5C2577C sydneylesko
2,422,395,055 *FFF8ACD92AC0286C5781A9AD41B56BF1519AA88A AMTS.
2,422,395,056 *FFF5FCB0B841D5680213E1EFE4FA0C432336266E TAACIFITNOP2
2,422,395,057 *FFF42DDC4F766DDADA10564E35800B5C7696645B ANDREASFORSHAY
2,422,395,058 *FFF11D19D046A0EEF7EE32FE7D81126C65591DCC TABIGOME
2,422,395,059 *FFF4D92976364C5A7D80896550FA25A1F5E7BA90 tae-ha
2,422,395,060 *FFF3843130B21B3F8A87544A55DA88DD4594553F TALKCHRISFERGUSON5
2,422,395,061 *FFFA34FEF43AC34744103D396FF2BA98150FF7CE talkiest
2,422,395,062 *FFF18AD2A0DC01DEC25AD4FBE6B6A680D4FB5E8A TALKPOIROT2001
2,422,395,063 *FFF7C65DC2A493844AE73CF3D2E3CE8D855D8F4C TALKZACH9808
2,422,395,064 *FFF77B206D77A4A88054724AC5B2CDFC9EFA2ECC a$nkw
2,422,395,065 *FFF195D9AFD1288D4404E576897AB28E53851EB0 ANNAGUARDIANO
2,422,395,066 *FFF9D5C6F0F9CD8209C73E8D1C7B1B6D9FCEF2C9 [email protected]
2,422,395,067 *FFFE087456150232BA13476CCB62C6D390464FF2 ANTHONY.LANGLAND
2,422,395,068 *FFFBAA88C43AAEFA1B8D1568DC0BF5791021FB98 antoniolagrone
2,422,395,069 *FFF17A61ACCDB20B34AA274D42D547790FA91C8D TCTCNJJNCTCT
2,422,395,070 *FFFB44BA431577B2FC5CC696A2AED2C39FAA15C6 aoinotna
2,422,395,071 *FFFC3D1B5FF7D63326684EEA1E792B21D07B91BB apgx
2,422,395,072 *FFF889C83380AE82E9F73A7D2B4D5D97CF85EA7D TĚŠÍNSKÝCH
2,422,395,073 *FFF04CD9C18304F097288893443F4F17654FE624 aqjqo
2,422,395,074 *FFF03A7B13A945D1C1E8E49ECCCDD62D98DE7898 a),r!
2,422,395,075 *FFFE3156BDCC94FB5F25BB1588462BD92E2A985F the80'sgreatestrockhits:passion&powervol.1
2,422,395,076 *FFF7EA83D7E07EB2FBAA9D2DC6F325901F1423C2 ARETAEUS4
2,422,395,077 *FFF21AB54C58C7D03DE93A01F11AAAC9880290EB arliewhipple
2,422,395,078 *FFF025D224FE083F0233C2484EE423235C2BC4F8 THEMAGICPILLEP(DISC1)
2,422,395,079 *FFF166842E83C12EC5D7927CD0B94F5A40921904 ARMIES UNLIMITED
2,422,395,080 *FFFC300541F33954C3A1271B992DEC45B9B8E4FB three-themselves-had-never-been-officially-vetted-by-lex,
2,422,395,081 *FFF7723CCABD1A3BD16F4C6655FACB9DFC0F86F3 ashameth
2,422,395,082 *FFF2D52DBACDBD73E484EA013C82166B723FBFBA TIJGR
2,422,395,083 *FFFDB4BD9AF10BFD0EFBEAA8B2D64BE44E11598C TILSTVA9
2,422,395,084 *FFFE52022515E16CD915D2C1652A48E09BB7E1B3 ASWINYUVARAJKUMARV
2,422,395,085 *FFF0121B96F9A3075421CAA29666EEB1C1F927B4 TINSELS
2,422,395,086 *FFF0FCBF87197463E8AAEC79D79CF16A590E3044 tomraleigh
2,422,395,087 *FFFC622F775A87E2A6E51D0FD50875D3472B2BA0 aureliomaison
2,422,395,088 *FFF7A3DE0FC4FEA9B60DAC10AF813B0447A5D00C auw"g
2,422,395,089 *FFF13D032D9BA4E5B8468CD2B9601DB406532B9F TOVOLACCINI8
2,422,395,090 *FFFB6A6654D8DA1654A71CD33C00876CC31CDE40 [email protected]
2,422,395,091 *FFF2DD65818772AA1018E63551D24445F20495B6 aw$de
2,422,395,092 *FFF81A9E93C0B9A440008CE4AD8363C7A491AD8A [email protected]*(-_0)
2,422,395,093 *FFFFFB6B018D3A614C292BD9B4FEF880AAD90D69 TRIANTAFYLLENIAEVANGELINOU
2,422,395,094 *FFF0A4D905BBCA3FB18425416C208FB8347912A7 TROTZBSWS
2,422,395,095 *FFF77AB3A135099203006B9573BC79BDC1C7955B TROXAIOJ3
2,422,395,096 *FFFB331E90FA35710B4FE635BA6BCB7A40B90566 B3C:
2,422,395,097 *FFF8D613B424F292A6E84A7F23018C559952B6A0 B4C+3R0L09S+
2,422,395,098 *FFF5F06DAFE25591A8D98329D7C1DBC44E20F164 b5au7
2,422,395,099 *FFF517485A30C01D4F9F152987ABA3B5515F84B4 b%9&m
2,422,395,100 *FFF440F1C2FDAD4EFD5EED0BA643F8BDE4E99A2B bartonpruit
2,422,395,101 *FFFE8735528FC9930E16D597C3A2AF0D5E6CDDDF BASEBALLCENTERFIEL
2,422,395,102 *FFF3470A6B247425B05DBC0D6166E64AA6602888 basenannemarie
2,422,395,103 *FFFF947BF3EF7050B0C3ABD21101D5C99F8E3B22 BDBJ"
2,422,395,104 *FFF4E11230D9E53C50252587DAF08CA015213652 URSINGEN
2,422,395,105 *FFFB3EB6D934F1956A7628C23B49BFB71D7D909A urýchľovacie
2,422,395,106 *FFF9FA6E549F06A320E3E819D4D29DADE5655FF0 [email protected]
2,422,395,107 *FFF5E4F11544CFA5A7915CCB7BED7EA1F30B789B [email protected]
2,422,395,108 *FFF6A903666A823D5BD30A7879FD2BDFA52CD5B9 BENJAMIN.BULLS
2,422,395,109 *FFFB8EE2FB881035CAD8DE1DEBEFE821AA5C11F0 BENNIESKOCILICH
2,422,395,110 *FFF013BE9DAA201B3550EBAF56EF33011BC72716 beraugenblick-jortmann
2,422,395,111 *FFF20AF3AEB57C07162A312C2E21B80C97D42E35 BERNIEWAMBLE
2,422,395,112 *FFF3191FD1000324CE5A940FED488CA006939554 VALSA DE ESQUINA
2,422,395,113 *FFFD87A9CF402D3BC035C58C0C0F96906B47F5FD vana bar
2,422,395,114 *FFF1E8BC4C5B24E0424EFD765258450AF29B8D62 VANNIDA-CHAN-SAIYOEUN
2,422,395,115 *FFFEF1F5DC39F15EC4499B4EF2AC32880CDA7C5C beulin8
2,422,395,116 *FFFDA02AE9531AC39A4B6819305759D79127FF1A b;gvv
2,422,395,117 *FFFD0FA5BF9345EDFF060E38384384D69B621A60 VELVELINING
2,422,395,118 *FFFBD2E7EDF2D399CD27E98D615C9F75A8E6628A VENASMAN
2,422,395,119 *FFF274D4E6172D1055F4DACB3F0F6285E63018FB bi"h?
2,422,395,120 *FFF20D326DA9AEB2727594900FCDAD3E601E19F4 victor.sahijram
2,422,395,121 *FFF9133B2B89FEBA5A215958D3A70A949B1711E8 vidya-prameswari
2,422,395,122 *FFF580D726EB8F2A727A0C8BF10316F635BD55EC BiZ;
2,422,395,123 *FFF2EDC610D1C103E0FDC15A7C2939D14ABBCF4D b)kt2
2,422,395,124 *FFF3D7B3D493A5366CCBDB65B60453BEB3E528F9 BLAIRDERIVAN
2,422,395,125 *FFFEE537ABD8EA53B856A120E103B3E687299C1E blhx(
2,422,395,126 *FFF2D5ABECF8900CB5B48CD43D92C71CC5CFECF1 walleyesniper
2,422,395,127 *FFF7216B2420E64DDFE9037EC8F72644B3086E76 BOYCESEDLACK
2,422,395,128 *FFF418A8C442A895ACB0B5C1645438FA9E96363C BOYD.SCHEFF
2,422,395,129 *FFFC32216759C03C052AE0FA1D66AA5365DE7BC8 WARDORAHOOD
2,422,395,130 *FFF045DDAA6C579E2447049F629D464B5967192E WARJAAWEES12
2,422,395,131 *FFFB15A3D9467983D2D152F6DD08A17E9A647ED6 WAYLON.RAMIREC
2,422,395,132 *FFFACD95B93AFC334C133892A6C675F44C37E4BC BQC=
2,422,395,133 *FFF929EE09A1B6D04A7DD14736EF0B1BF15201AF wdd7ghupl0
2,422,395,134 *FFF1735E8EDFE85E475A5BEA0F26182DDDE5DD21 brainboxpollution
2,422,395,135 *FFF0AE39040983F6E84AC34601112A2EDFE8EB7E BRANDENKUHLO
2,422,395,136 *FFFD4D5F2F171FD55BA609BAFBD3EB21AACA67EF WENDY ESTRADA MARTINEZ
2,422,395,137 *FFF726406199380FA4942633DBAF1578216722CA BRENTBRILES
2,422,395,138 *FFF34B532B872F7D581CFCDAD16C2FA5A8E41445 BRET.PICHLER
2,422,395,139 *FFF03D195CC2229761BB32AEB0A6A414E7CC81C9 brettmercer
2,422,395,140 *FFF3B243DDC90EC160FA37A1977FBE8B56F61EDA WICKRAM3
2,422,395,141 *FFFBA532050EF38669DE768B95889FD1A6293EFA WIGGINSIA-SESSILIFLORA
2,422,395,142 *FFF9F16661DDF685DFC533B491821A7D80844535 [email protected]
2,422,395,143 *FFF02A6CBDB6CE55CBE192EDBB9C37416DC40D6C BRYCE.SAAL
2,422,395,144 *FFF6291D4704A118EF99CFB9000415C319511322 BRYONDEANG
2,422,395,145 *FFF7ACD4E411A436369A959B8BB3A1483FCEE635 bryonsulzman
2,422,395,146 *FFFC012ABA89DB1EF0CBF143F3CA350BA0A5EE5F wilfordbyham
2,422,395,147 *FFF0CC60D0F9A23B10841244DC93E8B2A3E84974 BSF!=
2,422,395,148 *FFF770D7DB7929A1128F0880E80A09AD0652B4A1 WILLARD.SHATZER
2,422,395,149 *FFFDA6C5942E77125B3ABE37DAB92B314C330C0F WILLIAMBRUCESTROM
2,422,395,150 *FFF2120B0441D46D76A853910CDEFC35D15EDDB8 WILLIE-WRONGSIDE
2,422,395,151 *FFFF07553A76DD921AF3655C019E4E7A8AE2005F bswconstrudatabs
2,422,395,152 *FFFE40647622A522A4102D64EBDCB14FA4F71F7D WILL.PARADINE
2,422,395,153 *FFF67D91C6B40971D50F0BFEC3E9C89AB89339ED WILMERMCCONCHIE
2,422,395,154 *FFFDC8EE325982FCCF9214CECB3938D0CD8A2E64 bt711
2,422,395,155 *FFF36644E0ECA8FDE422DB59C9FC466469E12EFD WJELCICK
2,422,395,156 *FFF69DD0C280EE4AAD87E8B137775A741A06EB00 buddywedlock
2,422,395,157 *FFF2C21F1DACBFC3A033E8B16082C06A867EC5BB BUDGETISES
2,422,395,158 *FFFA9C989B2BF74B92E4EFB4F2DC6D516F87E173 wmyo
2,422,395,159 *FFF7047870F2B33F2ED0E9B403430DB5D97406F7 WOOTZ.STEEL
2,422,395,160 *FFF300BABDFD0A8F91C545022D881D5007575E13 BUSCAROSED
2,422,395,161 *FFF0AEC02ECB82D540F73D99AD0A94F2186C024A BUSYYOURSELFWITH
2,422,395,162 *FFF0F0925456EA75BB89A8B0E7906B0A648AFED9 WWW.GORSSY.NET
2,422,395,163 *FFFD5F8A2B644E7970781F9BB8A86F427214331D BVB123
2,422,395,164 *FFFA4FD29522C554C946538E713C2775100D94F1 bwwb4
2,422,395,165 *FFF9B447AEC7E92F94CD472F02EFE73691A7A918 [email protected]
2,422,395,166 *FFF73DF5A592A43386E63D96C51B676F9A5CE2B6 [email protected]
2,422,395,167 *FFF7F6368F31E21E6F117FDD335B8FF3BD151860 [email protected]
2,422,395,168 *FFFFB4656032851E8BEF3F18818FFB8B67350349 XMASTER1123
2,422,395,169 *FFFDE49CCC8A238806A4704D8D16F4A49547D2BC C&1SB
2,422,395,170 *FFFC53573F9C07B3AD52023570080C6F73563DCC [email protected]
2,422,395,171 *FFF82ABFD5DF77F79B8416E9E172DE106589BA1A CAINNARIES
2,422,395,172 *FFF638FA52161203F3C2810103E5EECB6197503F CAMPTICS
2,422,395,173 *FFF178B272B0241C2428F98CD0E38250211B3352 cantondesceysursaoneet-saint-albin
2,422,395,174 *FFF2DCC365EAD1149A742EA289ACEA02087BB4B6 [email protected]
2,422,395,175 *FFFED1A3788321C0AE80CE9195341563D0902003 [email protected]
2,422,395,176 *FFFD29A1097E504F3D8510E92D1D4EC25E982285 carceco6
2,422,395,177 *FFF0C819538D2F0530E73BDD19111F9B257ED503 CARL.FANINI
2,422,395,178 *FFFCFA7C8157150FA42B8035497BA8982B4A5886 YONICA GRIFFITH
2,422,395,179 *FFF29D93DBF5872DA6DF8C0A8FB80B33383D86B3 yordonevski
2,422,395,180 *FFF6C0662FAA5DD2E05C34352031B8BEA0CEC86A CAROLESCOE
2,422,395,181 *FFF9B34BDCBFBFB3FFFAA5876D848D7CE51EB78B YOUNGBALDUF
2,422,395,182 *FFF9A7096B6D0CB8B4E7B43775B9ACD2B8679DD9 you've.got.to.pay.the.chinaman
2,422,395,183 *FFFE5EDE2EE239AFDC38D527B60DA8BFBAD869F1 CARTERHAUSAUER
2,422,395,184 *FFF9BD0C38DFD88DAECC70F8B5E20BC25EFF3F03 YSTOMATA8
2,422,395,185 *FFF850DDCC3AE02AEEFFBEC0096C49CDE9C2F9FE YUVRAJMAHIDA
2,422,395,186 *FFFFB2D2AC99658323B59FE4F3C165AE3F7A807E [email protected]
2,422,395,187 *FFF3945AB4FF49827179BF286B01ED30D9BE31BD CATCOOKIE
2,422,395,188 *FFF44A4C4D79583CB28886B70AF427710E62ED20 ZARRFAN MOHD HARISS
2,422,395,189 *FFFE27F964D6A53FDA570725F9FA3B1660CE1705 CcW5
2,422,395,190 *FFFBA4CA2AE677820F58579B6B541D96AE9EE2F3 ZDTROY
2,422,395,191 *FFF5E2EF5A6068B46441A8CBCA4DF26E464B2B12 C&DO3
2,422,395,192 *FFF58842496249F6A372A00968F7C369A2684EC2 [email protected]
2,422,395,193 *FFF4FF9DCCA8E75C9EAEE8C0E60DF836DA12AC04 CELLULAI
2,422,395,194 *FFF24B09EC997A146BEB9105AB9E5E04E63394E5 ZHAOTUNAI
2,422,395,195 *FFF30C2B8F09D73C50BFB9F9228DCBDBC1308820 cf3rm
2,422,395,196 *FFF2B75BEB57E48EFF4D199BDB11A57D4DB20386 chad-polito
2,422,395,197 *FFF4E0EC494DFE19D3C868124F6DC70402BA792B ZPALHBFXPAXING
2,422,395,198 *FFFF2F0298E852EBE7DD857A264CA52BB6B82987 [email protected]
2,422,395,199 *FFFC063D8F9EDDF47F9CB2613F2F89048226455B CHANGESANDCHANCES
2,422,395,200 *FFF5D331DFBA90D7DAB6B0576AFF7E8FBD843A18 [email protected]
2,422,395,201 *FFF8FAFF7D720A577B4FF2C528FE437F99185173 CHARLES-KANGETHE
2,422,395,202 *FFF7F9A4F9CF5EBB7C26004ECC86D4C70765E504 ΕΞΑΓΩΝΙΚΌΣ
2,422,395,203 *FFF82F372CC39F9EA1ADDC9ED41BE24E721EEB9D chd$y
2,422,395,204 *FFFA4967C4F7B12AE15A4C7C02505C39DF95F9E4 [email protected]
2,422,395,205 *FFF1FA980AC86EB1000AF17A142944A4234EF902 [email protected]
2,422,395,206 *FFF7EA277E384D76E0ED925F5EC48C3593E34D43 cheonjeon
2,422,395,207 *FFF7FCD5A8679CD826DC22F30A2E8F31100DA6B7 [email protected]
2,422,395,208 *FFFD102D05E6C6202ED525C01B1B2F8DE60C505E CHgK
2,422,395,209 *FFF2B0C4D82C3ECEDF07AAD0CB8E39F6A2472EBB ГЕЙМСТЕР
2,422,395,210 *FFFADB918DB8DC18408C732F2BE01DD200496ED1 CIAX6
2,422,395,211 *FFF2E7401EAD7E7836DB0BED90FDF54D4F04A67A 世界上最大的油轮是斯蒂尔曼号(c
2,422,395,212 *FFF00D96EE6DA81550B0226BD1FF21F66F8A9CCF clk)i
2,422,395,213 *FFF8AB167178EE8B8A3AE11A79A561E4C0A6081D clydewithiam
2,422,395,214 *FFF643DDB038814CBA1234DDD94EBB55C149F2AF CM+_
2,422,395,215 *FFFE338D9CD9BC84BECF312E7C45F2316727D18B [email protected]
2,422,395,216 *FFF1CC1EE3AC67211727397538045B4189F2E263 C"_N
2,422,395,217 *FFF762465B12EE3656E250D784BED75A0136542B concertoinamoll:iv.allegro
2,422,395,218 *FFF47C8C828302374B1D410F2ED11446EBA7CEE4 conniefaull
2,422,395,219 *FFF647E3E22EC11AA2FEF254F5CF95B48D85C5D5 CONNIETHORNOCK
2,422,395,220 *FFFF7C8C1BB3E59DF3994CB22B9DE9BE9B44965A CONSCIOUSNESSMANAGE
2,422,395,221 *FFF69BDD95DCF459D0E560A82339E197852D7B99 constanzavalencia
2,422,395,222 *FFFBCF47E1A235957E47150BE5A71DF1C4B70667 C:\PROGRAMFILES\MICROSOFTVISUALSTUDIO90\VC\VCWIZARDS\SMARTDEVICEAPPWIZ\MFC\APPLICATION\TEMPLATES\1028\RESOURCESPH
2,422,395,223 *FFFCFE1664E0608E2A07D5793B80A8D335F03551 crooked-knights
2,422,395,224 *FFF5721EFFD90D50EB9EF98892A234127AC78111 CURTISSNOW
2,422,395,225 *FFFD253AC11C6AD5895D0E80F510BADA0961D71B D+{
2,422,395,226 *FFFDE12E9AAF2E5E0AE6C69AD5F5517D9A258A0C d:6kt
2,422,395,227 *FFFEE648C620555AB52BC4467F01E8DE68ADC02C da(l?
2,422,395,228 *FFF9269E1D4245087107E09CE4AFC2DB09A223C9 DARINCANAS
2,422,395,229 *FFFBF5633D26DBF259B7F1241C08BACAE306B995 DARPC
2,422,395,230 *FFF900428D1E6E10BFD0A387527C5829031767A7 davisdibbern
2,422,395,231 *FFF3E5CE0D5C0DAC224D151F092D4C0590D482B7 davisweeman
2,422,395,232 *FFFB0C207EC507A1FB6D5194D1FE8ADC29995A4B 118genial
2,422,395,233 *FFF1B020089AF695A17DC26F90F9180CE0524989 11.autiomaan
2,422,395,234 *FFF3B57125B40C14064FE1976CA4628C5BB8CC98 1202385 MAASEUDUN.KONE.-KONSERNI.ON.HYV
2,422,395,235 *FFF40C5703FCDCD7189F28A47C85E9AF8F38A2AE dbe+t
2,422,395,236 *FFF0D0923BF8130BAC2F0362EF156C8C0140CF19 1381895 ASIA YLEENS
2,422,395,237 *FFF9769777066092210716856C982C26589BD9BD DDO//
2,422,395,238 *FFF900E5ECC72333E0219E676285C5F77524D119 deceive-V:-deceived--deceiving--deceives
2,422,395,239 *FFF33798207C70769B3619BADD8CFEDD33877F5B [email protected]
2,422,395,240 *FFF3DAD892FC1DF54E25D7AC7F3AAED7AC4E7409 [email protected]
2,422,395,241 *FFF91C797A5CFF51B6A04A63537C38EC1BF7A41E [email protected]
2,422,395,242 *FFFAF62F7A968257B69790B18DADCF2B21A701FA DERICKRODEA
2,422,395,243 *FFF045F36DD466A451B07B6A9998EAD60E125447 DESAVANTAGEUX8
2,422,395,244 *FFFD877E2235E397E7B492EB044CC4D237EEFDC2 1BABIESNSS
2,422,395,245 *FFF69FA8F8293A805D91342B39855C692E078A18 DFC"T
2,422,395,246 *FFFE79743D636C2B8B4C98A9D55FD06F3B444EED 1.DIREKTMARKETINGTOCHTER
2,422,395,247 *FFF18ECBB26D8EA868E5D70B94D679875F39C1C2 1 DRYMAXX-ASUT
2,422,395,248 *FFF24B9971402C57CE11DC8D6A2B0F1CBF540FDF 1ENDOCYCLIC
2,422,395,249 *FFFC505B9BA5013ED545FE95DAA8821C394D4299 DICK.OSTBERG
2,422,395,250 *FFFC38C694D3F6471E2103F7A5E3D3C4ED1E4221 dido.and.aeneas:.act.i..a.dance.gittars.chacony
2,422,395,251 *FFFE92F5C246D4E8CC804A5E5525D0E1BED3A62B dip0d
2,422,395,252 *FFF37906908E462CA08AAC65D97EFDF66B47773E DJ18C92
2,422,395,253 *FFF0E4895C8ED4949540E94CD0A0B7F198D9DB2E Djta
2,422,395,254 *FFF7261BC09137C678B763EDEE4AA03C39E2CAB3 1HALLINTOKULTTUURIKSI
2,422,395,255 *FFFF562200EA694D323A1666DE9DF1C0356E4E8A DN+W$
2,422,395,256 *FFF3AE77DA79EBE336A0EDFDDD83B4E4BD1AA805 dobf
2,422,395,257 *FFF420D379CA33182A70A5A3C796CD7ACFB4986C 1-navetta
2,422,395,258 *FFFCF1E733977565B6F6DA2A79A9FEBE1FE4FDD2 dpe"
2,422,395,259 *FFFE43BFAB2D590FF787C34756A8F66EF63C47A9 DQAHE
2,422,395,260 *FFFCDCF380217EA8D5317131470224C8AF1FE55C drillingamonkey
2,422,395,261 *FFFA8C9F9C697822371172771A03D8826A2595D5 dta?n
2,422,395,262 *FFF4DF561565DB74E57A0E28731C04E206D1A43F DTf+
2,422,395,263 *FFF0B892B777D50F3C9792E192762A4B8B4AD935 1SILVRETS
2,422,395,264 *FFFFB9599A0F510917853D854099E46311A0A9AA [email protected]
2,422,395,265 *FFF987F1503A1A89F70FA17456C938D5049CE442 1.TEKSTIMASSAN
2,422,395,266 *FFF0D2652F0694E1F72EF7C72808594C1229389C DUDLEYHOGGE
2,422,395,267 *FFF1B6FC6C3721F03AB970A4E5710896A5683E64 duohebru0
2,422,395,268 *FFF789D2B8C1F99F8CE81D0B91A857869E6F923E DURCHFAHRTSVERBOTES
2,422,395,269 *FFFB6E8DC829775D725F130EBB9AA7098A30D5D7 DYCF&
2,422,395,270 *FFF9FA58D11D22C0C408C2C4A949C83B794D5AE1 2429370 ALSSPIELERNANNTENSIEIHN"GOTT"
2,422,395,271 *FFFA68165CC88CB868A0DB57B3BF3410863D8A30 EC_c
2,422,395,272 *FFFE520F82778F5197CEACF6B17BF21D672E25DF EDMOND.GAULD
2,422,395,273 *FFF987EA0829260F1E028BBF1E061ACBBC762A77 efide
2,422,395,274 *FFF90942D1F719E42FBBF0E40853B0F4ECC241E8 2CHAPPAGER
2,422,395,275 *FFF337639124940FDC2FBFE5262D8B5E2BC6C2E0 egatlief
2,422,395,276 *FFF398E3361FA316CFFB1B39075C7AD7FB9EAE0F EHD7Q
2,422,395,277 *FFFAF4C2611B534E5432947489AF7728B7BA6B4C 2myonelove3
2,422,395,278 *FFF7A663D77947CB7ADDECE9E9A1A74B9DCD7D32 ELISHAMILLER
2,422,395,279 *FFF4AB256B354B561FDFDB5EED096BB68C1F403E ELLIOT.RIKARD
2,422,395,280 *FFF90FE69DBF0AD300DAB91C3CF68AA403160EAA ELLIOTTHARLAN
2,422,395,281 *FFF5E857164CE45E966A341D0011A564EF579125 388M
2,422,395,282 *FFF48043838B9D7D6D54B1CB09497CF91AC6F8ED 3b<**<==b
2,422,395,283 *FFFB138AD1934EB94069B831C2C92B1B4D8A3DF5 3g0+s+c4l
2,422,395,284 *FFFFACF9BE55343719CC77B4FFDA9394DDEF1255 EMANUELRONSINI
2,422,395,285 *FFF719F7380BE04198908B23D017F55FD81986D6 EMESRAP
2,422,395,286 *FFFFD204D67D79102E3DDF995A0ACC1222C6CF00 3=> ~o (><)
2,422,395,287 *FFFFC0D15AD5055517429D6A8534EDAF1D85D552 3p*.*.Splat
2,422,395,288 *FFF49F01FAF142397A88C4ACE4A61711B504C779 46565B953348F3C7F7388B4AAB637141
2,422,395,289 *FFFA25A4D3D7C03BF6A3918F6EDE805F54E425A3 46 crashlanded
2,422,395,290 *FFF591DC45026CC6D8BBE2D8B31003C564411EF0 ENDSPIELTHEMATIKEN
2,422,395,291 *FFFAAB30011706C3D72487979C8F8941956F279B [email protected]
2,422,395,292 *FFF6B0699CBDDC4D29F4C200AB7C82FBAD16E4D0 ENGQB
2,422,395,293 *FFFD9A3CCBFD602105BEF8EA501D6FD82BBB3724 [email protected]
2,422,395,294 *FFF3FC46B5285D56608A781490BE9EE775A5F0CA ENU$
2,422,395,295 *FFFE222C60E2ED197EDA661261E4D732B4F82686 4NORMALCOMPLETELY
2,422,395,296 *FFFEE4B74A919E3D08B4D3D908D277C16DAB4628 eppadolbbing
2,422,395,297 *FFF5D537E71D7046485C50EA196C9F57B44E4597 ERAVIS
2,422,395,298 *FFF256F389323F4E501C50DC932903A7DFCBBA82 4 USTADLAR
2,422,395,299 *FFF65D24E0FD5EF8788F5E548CFD2414B8F1EDCD 4WHISTERCLISTER
2,422,395,300 *FFFDAC931AE03D8297D1FFCC318B2833BE38357F 4YHTENAEISTETAEAEN
2,422,395,301 *FFF089B9D7D494CA57B7F95646DF8B1998B7F3A0 eric.martey
2,422,395,302 *FFF692BF70FE60E3592083571B87DC627C738DDA ESSOTALA
2,422,395,303 *FFF616758D272A48F4C44D19592AB8BBAEFA9B2C 5+!MULA+!ON5
2,422,395,304 *FFF5676BDBAC92D666BF7BD3BF4B8B1711ADB204 esuohbus7
2,422,395,305 *FFFC9849A98C661C6987C24811B71F8074CEE2FC 5PREJUSTINIAN
2,422,395,306 *FFFFAB4DE5704A039DCCFC871B458F53FB0D4B36 5-STABHOCHSPRUNG-WELTREKORD
2,422,395,307 *FFF5A0F7F26DE60A2E821A98694F831DE82FEFBF 5STALKINGLYV
2,422,395,308 *FFF345CA18F08F725F68E307831921AFD25A4528 Eu.envelhe
2,422,395,309 *FFF918F81AA49B1F3925FA42CA07B87E392D6578 5TY
2,422,395,310 *FFFF87FAF056E358F522DBB7E3C3DFA2A944EF0F 6ARRAKKERNES
2,422,395,311 *FFFF45419D33C079E63619223E4BAEB25A6C5C38 6ARTISTJOHNSON
2,422,395,312 *FFFDC46353C77FCFAE1648D0BAB3014EF6DF961B 6-autonomisten-fuehrers
2,422,395,313 *FFFF3FE8437A082A935D5E004DFCDED175DBF401 6BSWHALSELLBSW
2,422,395,314 *FFF82FCBBF8996C01F8979A4338C89304D951F0F ezequielmcwhirt
2,422,395,315 *FFF2B84EE40949A3BF8175C408B352F83CC0C50B EZIRETOES
2,422,395,316 *FFF3FC6E04AE78B8D1667609D1FE101CB8E56DC9 EZZLES
2,422,395,317 *FFFDCE2BD07B13B63C8007AC23275201D0C5DEEA 6FUNDUSCOPIC
2,422,395,318 *FFF91F84FE2747880112C852BA03909C2E0A1523 6GNNMPRVR
2,422,395,319 *FFF631B1283ADCC2BA6121D23AE2EF11CFBF5AA0 6GRIZZLY0
2,422,395,320 *FFF1DFBD6D4F9407C3B590C03F61687A1C991BEA falstaff thereisnoremedy;imustcony-catch;imustshift
2,422,395,321 *FFFDCA4647F35659F8E75D63C5E2AF0C2CFAFD1D FARMERSMILITIA
2,422,395,322 *FFFE57FBE9BFEA6F7E136BF47372CDD3FBCD8847 febsfoj1
2,422,395,323 *FFFF8B3EDE7DE2AEB08F14A04AF886F16DB1F39D [email protected]
2,422,395,324 *FFF4F91123F86A34A71C67943857BF893BF6A918 でfilmを専攻。
2,422,395,325 *FFFEB86F311A38C0216D1D556E9D9C08E16BE5AB 6SURFWANKER
2,422,395,326 *FFF06936ECEDB1B96F2174C6382F077C29DBD306 6TRUPPENNACHSCHUB
2,422,395,327 *FFFCAF8BAF4248309AB4421A5814E388A050F1D4 FIREDMAN
2,422,395,328 *FFFE24EA5D8092262F65310D10D6C8B2E77E261B 7.12.1609
2,422,395,329 *FFF174E4CF5EABA08AEE44B43E3D0E8C1631B918 fontleoniviterbo
2,422,395,330 *FFF1EC7D4090F28C5F6B8E38FAC1C46EA0B93572 francesbrodell
2,422,395,331 *FFF184365EFF2CC357439D79B5EE535557766B0B FRANCICOC
2,422,395,332 *FFFF3367096C05060C8E7967CB532758AC57D0A2 frankiedalbora
2,422,395,333 *FFF94E87339E3FC1A0AAE8F28E09CF90C60EB08E freaksomethin
2,422,395,334 *FFF98D43C4BF99F8945798029A63E2C08ED81AE0 FreestyleFromLAII
2,422,395,335 *FFFA797386CF29CF7ED8FCD5892DADE9F6C56332 FROM A: A MAP OF YOU
2,422,395,336 *FFF5A556147E141D90777CBDB786FAE5B780CAF2 7UPPERG
2,422,395,337 *FFFDE185859D11D1852C05506C3870AEDFB93346 8ACT3RIOLOGICAL
2,422,395,338 *FFF919A62227EE3FAECFF585115ACD7D97798CF1 8.ausgewildert
2,422,395,339 *FFF2C1759BF7B588DFEB4D407336D39DDB34DC7E 8BSWLEATHERWORKSB
2,422,395,340 *FFF53B95EA57E034A8333FFDB20F2C25F5A6544E garthke
2,422,395,341 *FFF456A1819541FB10B8A65124A8338726858BD0 8COTTONEER
2,422,395,342 *FFF7300F7185C2A5CF0CFE3E502E79DA74182F36 8GILLENBERGER
2,422,395,343 *FFFD495184B8738E0A6D51EEF33FEF05BD3E5FAE 8IMARIHGNI
2,422,395,344 *FFFD271696929E60E4D1CE3403B374DB3924846B 8LAURAIRISH
2,422,395,345 *FFF581BF1764DCD44BE8E90A3FBFDA9714C7AD42 geneckt7
2,422,395,346 *FFF3321E5ADD18C803EB8B7110DF8C6C1A7E13F6 8SCORPIOFRANKIE
2,422,395,347 *FFF0877F31C5185262FB025F51FFEF792F7561EF GEWETENSANGSTEN1
2,422,395,348 *FFFCABF468BF9E8BAD30F203D6D79B51BCEEBA2F ghetto style (disc 2)
2,422,395,349 *FFF0D43507E2BD1042DDE18A477C5128BA86E01B gilkeyae0
2,422,395,350 *FFF734FE244F5C842C6242285C19E8CE5EBFB29B GLENN.GALYEAN
2,422,395,351 *FFF99C13D65438EEE5FE153D515DD84931E5FE6C GNIKAORC0
2,422,395,352 *FFFABE11F67B6DC4605606685F2C5601CE211BBC 9DUFFELSES
2,422,395,353 *FFF2EF85E192168E9CAD46F3FE81FE078900BC63 9FAUSTHANDSCHUHES
2,422,395,354 *FFFE5D8CC10FB26AC3FD999C7EBD83D42DD88D97 9HOUMEHR
2,422,395,355 *FFFB952A76AB47D4C3CCC8016B6F338CDFE8D669 GONGWRT
2,422,395,356 *FFF09B7D92915748D450F2730CBA993306A5EBCB GPN2000001978160AN
2,422,395,357 *FFF8170DF89A0E9B6EDCCB2DCD3CA45F18530CA8 grace-allison
2,422,395,358 *FFFDF0FC170396CF71A8CCFB7C7525E0E6870605 GRIEFSES2
2,422,395,359 *FFF3E97501B28D77AD445B4FAA5DC5FBF01135E8 groverbadour
2,422,395,360 *FFF3983159AB9718E5422EE6D44C1322D57697DB 9TSSTARKE
2,422,395,361 *FFF1D78305CCB72D372DDA5E384084FC4A1891C7 9UNAPPETIZINGL
2,422,395,362 *FFF59B5BF8237DC900D6D071466AB4D27EBD530A a0+l
2,422,395,363 *FFF7B0A3C2DD0F571A4B92142FC3076CE91A303B gusfigeroa
2,422,395,364 *FFFB771B7FE52F115091747CD9F9B6EE973686EC a3#ma
2,422,395,365 *FFF0C0B849E810DB2C5B984351A4108F719A1FA2 a_4&7
2,422,395,366 *FFFB9ACE47E93C60E04E5C808852A9C740A4D5AE A474G
2,422,395,367 *FFFCA89A52CF057EC915D806D101C8B8E54A0ABB A6dF
2,422,395,368 *FFF6ADB6589DD8E93D498DB0E43EC11BB1631149 h3!nou$n3$$
2,422,395,369 *FFF213CEA1B43014821000E5D04BDCF2CB41C748 A9Vo
2,422,395,370 *FFF73ADA71D779AC6C0E6EAB0C541DCFAEFB9365 HAUSMEISTERAUSGLEICHSTIMME
2,422,395,371 *FFF5E3F400A4DC1EB0048DDFAD5064558BBB7120 HAYMESJR
2,422,395,372 *FFFFE9DE3B87DE2D54EE9254D369096B1C1101E8 ABDULHADIHAIRAN
2,422,395,373 *FFF163A6119D3499E3DE21BE1506FA8C9F386DB3 hip.housin'.(feat..lo-pro)
2,422,395,374 *FFF381ED9276A4F22EDEA70FDDF53B14658DA139 acu#,
2,422,395,375 *FFFC9E24E78CF85608590FAE8C368920B3F92B86 hiramjinright
2,422,395,376 *FFF06C0302708796CC0BCBD346C7A99F877DC2A4 ADAWLAD
2,422,395,377 *FFF5D6C6C24283FA22C4CAC72BEBB09D06FF93C7 [email protected]
2,422,395,378 *FFFEC6F03DF19AB91C005280432C6D47257B4BF2 a.de.champa
2,422,395,379 *FFF1355D12A47B90DBF41E8685D0D1E36CE1D2F4 HOBBYAR9
2,422,395,380 *FFFE4717E4034BBB19A71CD16DBE8462A02E0968 ADOLFOFARRIA
2,422,395,381 *FFFDC58757EF831721B802A5A851E3C417624248 HONEYCOMBCOKE3
2,422,395,382 *FFF06A329FD255DC4CF21148BA87EFAEE11AB01A HORACE.CERASOLI
2,422,395,383 *FFF6ABBAD61F57452075DD376DC8630F11D031E1 ad*xi
2,422,395,384 *FFF1951D0D7568122BD62CD837890180F245DDE1 HTTPWWW-CORNUCOPIA
2,422,395,385 *FFF4C996957BFB7D8652F1CEE4DA9F4B5C3531E5 agk,
2,422,395,386 *FFF76612DA9F6E43A225ACA05CF99659E5BA7362 AH%-=
2,422,395,387 *FFF1B6C3E13988D3550FD491CDCA25C2964F6C01 AKUSTIKMUSIK
2,422,395,388 *FFF885FBBF980130335D853BC12667C1784F08F4 IBRAHIM.SH
2,422,395,389 *FFF0DCC10A1AAAEE631A75F44AD2A41645E90437 ALDEN.MCCLESTER
2,422,395,390 *FFFCAA52BBF9B2F03410D6E2BD416D6C2E5C324B [email protected]
2,422,395,391 *FFF01469CF0E14A51BFEEA47D8283DCC7B39F69B ALEASJ
2,422,395,392 *FFF7D5538313479BA004F0B0462F7E3292B4DCC4 alexanderlaliberte
2,422,395,393 *FFF4948C981B227DECF9E3302D4B28618BDB5749 ALEXOLDEN
2,422,395,394 *FFF12F5022E9DEA01AD7249FA44096451B159086 ifordeutschersoldat
2,422,395,395 *FFF02F974F36BDB5A0C78B620099E9DCC206EB0F i-have-sipped-the-blood...
2,422,395,396 *FFF755360DF53AEE6CA013C2C58A28CCA9E266BF AlhL
2,422,395,397 *FFF1DEE63C42B160ED0991E7F3B7D016414692CB alphonserocle
2,422,395,398 *FFF2D3EB1EC938816A33DC9BEE6D5B3786B37F1F ILUVCONCEPT94
2,422,395,399 *FFF68A74FE765F837E0FAE61837A9F8797C23806 [email protected]
2,422,395,400 *FFF91C22B9882805F9AE3E85C6FC29F6533929D1 IMPACK!
2,422,395,401 *FFF183A84A91D6FC9AE30C338F231636657FFDE4 INDIVIDUATING.
2,422,395,402 *FFF86B08143F74F0285DC3E36D5608880AA63859 INDUSTRIAS-JE'RARD-RAUL-G-HUERTA-|-MEXICO
2,422,395,403 *FFF615A8A3831E52BA9FA9DD0F172D259C53CF69 inferirne7
2,422,395,404 *FFFF41E2777346855C7DA8F3F1ADB6A041A54C51 amigas96
2,422,395,405 *FFFFF1326B01F09828F37D9935A1A32C0F8A2E89 angelicagarcia
2,422,395,406 *FFFEA6F11D78463555CA0F6F56B9BCBB69E720E0 answ3rin9
2,422,395,407 *FFFEEAAAC19FF6ED3DDD1A3B43C59BFC3852411F ANTONIOESCAREAL123
2,422,395,408 *FFFCF0C6CF77ED8B3F8C902A122C43BFB79F13A0 ANTONIO IF.YOU.GO.ON.THUS,.YOU.WILL.KILL.YOURSELF:
2,422,395,409 *FFFFA4423354C9B1C12B6797E96A07AB77DF0C3B IT'S.FREAKY
2,422,395,410 *FFFC1B8A89E784720B7FCA14768553F397369C44 JAG-OCH-SVERIGE
2,422,395,411 *FFFE6CD6B6BB8FB0FE4B05EDDDF5A7986464147D aq,v8
2,422,395,412 *FFF86EA3408F385C69F89582020F2822B00A9990 JAMYKAL7
2,422,395,413 *FFFA386E4A8860EB29F1BB140E0CC48FFCD73731 JARREDTATSAPAUGH
2,422,395,414 *FFFDE915C54E6B8F9B499A7D0257C180D394110E arielrody
2,422,395,415 *FFF0EEE4B7E5EF3F011CF3CE4058F092A12F9F7A JAUTA1
2,422,395,416 *FFF061B0D76DE2EBE2DEBEF22C7803BFF52A6431 jay-z&dmx
2,422,395,417 *FFFE503DF24E43343A599184DE488D5F0C0664CB JEFFERYRYGG
2,422,395,418 *FFF671937C2F39FB6832A77F242DC18A7E29D025 [email protected]
2,422,395,419 *FFF10DFA11ACE20E6324D26111DAB88AFAEC2206 ARUNRAGHU
2,422,395,420 *FFF017169266542F4E5E823FF2B1483FCC401BE6 JENNIE GOBLE
2,422,395,421 *FFFBC44AB3B4E479B2C44096F9656F492298FBAC ASAMUEL0
2,422,395,422 *FFFA59616AAC579F1278E547B735701CF74057FF jeramyheinricher
2,422,395,423 *FFF31090FA62BEFA78B1A9DE96E78C7A794DDD1A ashley-linda
2,422,395,424 *FFFA7CAECBC9540AFBBF0040E2218B890DA4A211 aske-skepticsorgukwww
2,422,395,425 *FFF3956AD0B37D364C6CD8B38C9CA311B4184F85 jerry-fontaine-and-his-jammin'-guitar
2,422,395,426 *FFF8C810F39E0025BBAF5D8DF18716A59A9F765D jewelrosman
2,422,395,427 *FFF657F8CB7E5095B34C97C07471B3807A66F3C4 JFROMDAPARTY
2,422,395,428 *FFFC78ECD18B0E6A0170EE92A9B6A51A03C8E7F4 aufsichtsregelungen
2,422,395,429 *FFF76D0A187872368CECEE55E97A774850CF4886 JMUFFIN6
2,422,395,430 *FFFBB6B45102CF626998EC0319F21D7411394D89 AV2KM
2,422,395,431 *FFF500206E414D59AFD0FD00B9D921E596DC9263 [email protected]
2,422,395,432 *FFFEB0300440FA509BCFCD887CC51D3287F1CA04 JOSEPHFLICKINGER
2,422,395,433 *FFF04AD7C7B9D76E53B145E46427624BE7A20F59 josesulit
2,422,395,434 *FFFDEE0B28C9A3174E5CAD8716E6C3F740202013 [email protected]
2,422,395,435 *FFF28A17226627CDDAD062031080CB10B49D448E JULES.DRUCKER
2,422,395,436 *FFFA4FFD0B5B403651D2407F56E0827329A41741 JULIEN275
2,422,395,437 *FFF50E6A5A3281DA6DA4D961E1AE4733E44B32AD BABYGIRL
2,422,395,438 *FFFD597B36552D3799652F02CAB57AB3F637D619 BARTON-IN-FABIS
2,422,395,439 *FFFC83B08B38A8F1A578FB4B5F78D2ABD44628D3 KELLEY.AHRENHOLTZ
2,422,395,440 *FFF88D89517829BCA192F671BB04DC7323F53E07 KENNITH.TATON
2,422,395,441 *FFF3AD5955E8633C6B2DC780510A814FB40C2FC2 KERRY.MARASCO
2,422,395,442 *FFF914E677B9C66285A4280981F4417AFC0B172B KHAIRUNESSA
2,422,395,443 *FFF3DCAE5BBBCE39C2798B2CC7FB881B5DCCD58C KINDERSZENEN/KREISLERIANA/HUMORESKE(FEATPIANO:RADULUPU)
2,422,395,444 *FFF8980839085FEFBFB10A2B096A72ABDAC89D18 BCB)N
2,422,395,445 *FFF680471F5DC84E47AA411E5B41B7EA10ABFF9B KIRK.MERGENTHALER
2,422,395,446 *FFF0AC93D2215AD5F6E8843E3D7E83D94C583B75 BDF7876EB71672624F7C1A8D5BD9ED18 DAN936
2,422,395,447 *FFFE95B52725CFD25D1026D26C1E7D081D90248F KOBAYASHI160TALK160
2,422,395,448 *FFF280F24F9D2323A3AF66E786FD737A050CAD3A kobusesterhuizen
2,422,395,449 *FFF50FB934CC148780EC7856ED249D59EF86ACEE BEINGS—WHETHER
2,422,395,450 *FFF3A1043C0E8DD18938D0DC1BC3C9E238F567BD kristina.djuric
2,422,395,451 *FFF6F0A866740B41240D2D1A51E47939DA5C621F Benga1m0
2,422,395,452 *FFFAC3CFF68054DB217638298A298D4DD3F7BDF3 benitobartelt
2,422,395,453 *FFF15FB258310E0A45DF7AD58C13D4AE8FBAE784 KURSEONGISTA
2,422,395,454 *FFF9E11F9A2EB969B58BE954014572CED982FA96 kzny
2,422,395,455 *FFF35AC00CAB646CAE26B3AAD528C518AD9EE89A b!#gv
2,422,395,456 *FFFCA414264E590B3E7438AFE3AD25B6E14ED0C6 laurenced'abitibi
2,422,395,457 *FFFD613C8B44DA21DB2B1A95231B799BE3A1F72D lawrencekrasinski
2,422,395,458 *FFF8F8A6E0B12E518236F9AB281DAA5309B97DE1 LBADEKRUZAMAN
2,422,395,459 *FFF6585265B976662D91DB23BC31B6AEDE36054B LDIDC
2,422,395,460 *FFF0E59892ED00CF62F1A2031B069F60D0183E7A LELAND.DUPLESIS
2,422,395,461 *FFF4244CFB26F6EB4ACE59C2A8712FEEF5236339 bjj+n
2,422,395,462 *FFFC2339F03A38C11DC2EF3369A21B0AA23D501A lenorareed
2,422,395,463 *FFF53756C7213EF70E2A680062925DCC9F0D5CD3 blabu
2,422,395,464 *FFFF973328BE78C96CCE542BC7108453312E0AD7 LESCOTTEM
2,422,395,465 *FFF91E42590FFF9BD0E4FB6CD088446A20AE71D0 BLOKKUR
2,422,395,466 *FFF3719ADAF7722BB323AAFA5FE2394967A59FD8 BMQAK
2,422,395,467 *FFF8AE589418167A2F781B2D5D4155422383159C BOBBYROBINSONJR
2,422,395,468 *FFF5BB5D370256BE04DA02238D6DD91235E9D9D4 libby-templeton
2,422,395,469 *FFF29847FD64378A51136B3793A84FC1E64A26CC /LIB/FIRMWARE/263224SERVER/ADVANSYS
2,422,395,470 *FFF8429338931C5EC34B9DD2791F2CD1F4A18EA4 liebfraumilch-'l/i/bfr/AU/,m/I/lk
2,422,395,471 *FFFEADEC0EB44B316EF930CB0F37BCD95201A515 liesandillusions
2,422,395,472 *FFFEB6338AA04F9DFF45E0E8E307C70D123451F7 BOGBLITTER
2,422,395,473 *FFF20FAC8CB1093648909BC7F2F45945E3F7062A lmc8gu7
2,422,395,474 *FFF1301D23F995CEA4854E51F1256833AB835DF5 LOACHESES
2,422,395,475 *FFF2169D863758C75E1A6C1B22A0E9E8B32128F2 longmouthed9
2,422,395,476 *FFF66ACDF88057905FA0478B38063FDD5EE41816 BQG.M
2,422,395,477 *FFF997BFE2C1B63D4E769809642473874AB92A35 BRADYGOSDIN
2,422,395,478 *FFF7EF3D0C4E826D8EA973AE9F55784E7A7377B5 brandenaguero
2,422,395,479 *FFFB809DF29CE45624A36BF87D1383A740385CCF BRANDENZENON
2,422,395,480 *FFFB2992149AB94741B7823BEFD5C719BD9A2B00 BRANDON.BRANDORFF
2,422,395,481 *FFF565EAF918E1E4268F3D5C75F251BB18A8129B LORENIRVING
2,422,395,482 *FFFEA53394FB0719A52A4602A9ADFE6E9A14A569 LRODRIGAR
2,422,395,483 *FFF402515ABE78423CE39167E337447A2FA7B012 brooming
2,422,395,484 *FFFFFEBFE58FEC0493B722C0EBC5672E1A7BC9A0 LUPHRQ
2,422,395,485 *FFF1C0A8247E6DAD87E976060B2E39513F776C7E b###)-`~-`~-splat
2,422,395,486 *FFF133D372322B91FD20C942E4FB5A2A5FD32C09 BSWPREKEGES
2,422,395,487 *FFF428A0D2FB884D3C865BEEDD5277F06B636475 LYLEITH2
2,422,395,488 *FFFD30C082C9E2EC66E5D1A8A10B126872479286 LYNDONDENOYER
2,422,395,489 *FFF78060B6AD6443070B5A558388D956F9C3C2F2 LYNN.LAMPE
2,422,395,490 *FFF017AA31C81B248DE3E5DC1459196530EA43D4 LYNWOOD.BUSCAGLIA
2,422,395,491 *FFF890B23D21FA47166557F469B1DB60800988D4 lynwoodregulus
2,422,395,492 *FFF8BB21F312FD378EF1C649992D0FAAAABAECBE BtR
2,422,395,493 *FFFBFFBA37F66368BEA42681AE50105080EB151C MACHABAN7
2,422,395,494 *FFF7EB3926175E00C574677325A4297E1A109121 bullpierre
2,422,395,495 *FFF86F9C59873D86C9B21D399DF3748A02C46321 BURURAKO
2,422,395,496 *FFF60C0E949E01677637B6DCB2EFEA991C7B7E3F mahsash
2,422,395,497 *FFF4BF0575F1C6388221A8E5CC436678E8461EDA BVKW
2,422,395,498 *FFFE928F1AEC77ACF4C700708B1F0262B5607AAC MARCELLUS.ZIC
2,422,395,499 *FFF35F13EC88594A4B6BC0ED7D933A5A2F9F9B2E MARCO-CORTES
2,422,395,500 *FFF7EB595ACB4A3F2B080ED6ACA6C29E88D29A78 byqto
2,422,395,501 *FFF44163612D2E27875C96A9C59324FCCD6D758E [email protected]+I0NS
2,422,395,502 *FFF54B5F1E6946DBECCCF961D7038EE7FA9D7C0B MARTINMINEHAN
2,422,395,503 *FFFC3903E6B47A5A29C902293B0E43263BFAA5D1 maxrandom777
2,422,395,504 *FFF7BD1AE790CEBC9963F0B6A113155BF1A549C8 CARISSASEARS
2,422,395,505 *FFF484FB71016C648041CF8DFD87543057A7AF62 MERVIN.TAILLON
2,422,395,506 *FFF1C57A8388B516E5A7B18FB3C21BCA6BA3C8F2 METALLICJOE
2,422,395,507 *FFF8D6814F2CD7852EF855E2A76DB29C44247958 carrie-quirk
2,422,395,508 *FFF7708810B6EF0E9755E1A743E3C682FA746E6B michaelfolmer
2,422,395,509 *FFF07F8C2715EF7BE4256FC72F945BF73417793E CASTRO_CHILEHAS
2,422,395,510 *FFF55AB207504ECCD902F01DCF4F28B0D50791CE cb(r/
2,422,395,511 *FFF307426E859104E390427C511FF1078580CECF cc:w6
2,422,395,512 *FFFF09D4A4F2637E2C81AA54456E5B615B5C26D9 CENTRICURRICULUMCOMWWW
2,422,395,513 *FFFD699ACD3BB0282EBFBF9E57EF4EC2ACE648B1 CEVELLIAR
2,422,395,514 *FFF948BA7C16DBC136A52FD7992AF455A67344A6 cf$af
2,422,395,515 *FFF6DF32A98E5B2F2F1CB934CE3964D5DF47D6AE MILESBROTMAN
2,422,395,516 *FFFEA63FEE8D15AE902E9AAC784FDAC7002D2EBC milonowling
2,422,395,517 *FFFB43EA1687F7EC6619ECF091ABC203F7458EB8 miloscameby
2,422,395,518 *FFFD957BE34E629AC873BB7E2848B028106ACD71 MITCHELL.OKIMOTO
2,422,395,519 *FFF5EEA1CCA49979DA81678FF67D4B7E7608DDF5 chadwickedmondson
2,422,395,520 *FFF299673F61B7C8EE224A71ED67D67AD5FDEB21 [email protected]
2,422,395,521 *FFF0681846C601E9B23C9FB3065BAF3D17900EEF MODERN-SEX
2,422,395,522 *FFF43DBD829961F05CE24C166C682D06EA5EAFC0 cheerbeachhop21
2,422,395,523 *FFFB53A168DC5C932618F28D1CDBFDF3CFBBE9E6 MONROEDORER
2,422,395,524 *FFFBDE2C81C5AB6F29F63178035056437D77F20A MONROELLE
2,422,395,525 *FFFC29BCE215F1F6B391079EDEB8A8DCD08B26C4 MORRIS.CULTICE
2,422,395,526 *FFFB955DB43AAB0FC274DFB561BA3C6E0000CD68 CH#GG
2,422,395,527 *FFF43DACFA5EA033218FDB13185F6A558C28F406 CHUCKLOBOS
2,422,395,528 *FFFE5633519D7A708C5E73207CA78863AAD3D745 CHUPAMENTOS1
2,422,395,529 *FFF3EAA421D1F5A4D5A735A4A17CFE795DBAFD41 [email protected]
2,422,395,530 *FFF01D27F4B13EAC051228D124F32015AED342CE CINOLAT7
2,422,395,531 *FFF2B9BCBC6D73C436784CAF89D8760A8ECE91D6 N=2|
2,422,395,532 *FFFCBD36DFB4B69ED816F3A7F9AA31C6AFBF4F21 nacizam
2,422,395,533 *FFF6D73EC219B56BA8FBB4641BCF7E23AAC307A6 CLONDAR2
2,422,395,534 *FFFAD5C41FE90A23968F15ECE4B7448D9D9BBEC5 CLUTSON5
2,422,395,535 *FFFCBBD2E9D920D27FA19D5554F77F7E3763A0FA CO5ME+O1O95+
2,422,395,536 *FFFFBCF22AA4EF8F39C507A47D3216FC94666776 colemanquidas
2,422,395,537 *FFFF8C7E23BD25E27190331E1660362BD4F5CA99 NEVIDITELNEM
2,422,395,538 *FFF19622E4B0DA4ED498F6D5AECEC65C999D8BC0 nexii(poppea,arnalta)
2,422,395,539 *FFFC1307DDA8918C58DF0B7E11283D9D97C3C285 CONILLET-DE-VELLUT
2,422,395,540 *FFFA001F712418E8E4F0ECE9FE3C24564ADD3AAF CONNIE.FILAK
2,422,395,541 *FFFF4A14AF26CD69E86F6A8408EA270530CC7340 CONSINKID1
2,422,395,542 *FFF9D3D2233418383DB2C1D0944CBC1BF795DC85 CONTROL』が終わった後に『TRUTH』の
2,422,395,543 *FFF630ED1D05CFB548DC855CE1D283484A25D73F nimlé
2,422,395,544 *FFFFD78BA13424E17501AF52B411101A4A8EFAD3 coreyhoysock
2,422,395,545 *FFF9AE784327A20A6492830AE7E1325954E5111F nisserde
2,422,395,546 *FFFBD2CFDFED90EC54D8554B4ABDB8AE0EB721A6 noahpatock
2,422,395,547 *FFFB1C05AA61E495592375E5110AADEE43A7B11F Coyote-on-the-Town
2,422,395,548 *FFFAD094C1592770DFA5F50FCCEEDB524693E4E2 noblecarmany
2,422,395,549 *FFF0BAD34AAC1E1A8190D3FEC3F40AFF836C80DD NOBLEJOSHUA
2,422,395,550 *FFF416E22BF578B512C4AF747BDFDE13A328E078 c.pfd
2,422,395,551 *FFF57CB049BC8367E85EB8ACD764F6FD7343187B NONIMMUNITIES5
2,422,395,552 *FFFE309D957293012BA771B9D4EB1689A23B4CD2 CP_U2
2,422,395,553 *FFF4E5129883B81AEE2947EC1D278426AE337CB7 [email protected]
2,422,395,554 *FFF53EAE9D4F8970C81E6C0D87474F3DBE186662 OF+_
2,422,395,555 *FFF5A36CA266EF1756853BE2602AE89CB913A22B CTPCW
2,422,395,556 *FFFD3DA69B2AC732C902991FCD602AFA3866E98C OMGIVENDE5
2,422,395,557 *FFF3C3A7084AE4FE11243FB7BC2BA4C937809FDF CVCY_
2,422,395,558 *FFF3E4ED077F303191CE0FBBF975E426F1573F49 CWDWDAWD
2,422,395,559 *FFF881C36DD40485A0FDBBF2830EDA89734CEA8E cwemz
2,422,395,560 *FFF24D43CF45D792E79E708DBCD0E64FAD708BFA otisplanck
2,422,395,561 *FFF510691DFF13D0C5B6ED9804D31F7B4817FE94 d0qy
2,422,395,562 *FFFE44F71DD4481F26216BAC24B2C4519DC1E8D3 D5KR)
2,422,395,563 *FFF2E85A780B439AAF5ADB1616F7E1F33EDF47C0 DANIROX25
2,422,395,564 *FFFD1084C5538B29C9E39DC328AE6D1A0E2B0FB7 pasopehuenche
2,422,395,565 *FFF4881F5770684FB0803D035CA1AA4964F11994 PAUL.THORNBER
2,422,395,566 *FFF760E265E8F81D645FCE5464FE9329255BEEDA P#####B~O ~O 3B<
2,422,395,567 *FFF3215781937C640D0F76D43B4FF8E4099F0DB1 PEARLAND1
2,422,395,568 *FFF5AF892F4CD513F86A3D46A80CA73CC33E439F [email protected]
2,422,395,569 *FFFF2E6C1773B7D914520FBD449F0C173001778A dbwua
2,422,395,570 *FFFAEF3688BD4902ED9AB2ED357A808FA6CD92BD [email protected]
2,422,395,571 *FFF22E177630163EB2BBB1F3F777A704A9C63C17 ddp35
2,422,395,572 *FFFCB9C142306E15FD34505329B7EF490D5D29A4 PHORSLEY
2,422,395,573 *FFFD400217C815E7950251853E26473CFE5AC9A4 [email protected]
2,422,395,574 *FFF69FFE189D21EC764D3B9A867A7EB29C941E55 PLEASELETERMAE
2,422,395,575 *FFF640E234247EF3975D01CBABA8A65B40D12909 PLUCHAISING
2,422,395,576 *FFF91D7352D24EC5950E3759705A6BBD6CB27FF7 PMCRecords
2,422,395,577 *FFF43697C776C913B0AF22E467AA59C1904C9316 POS79L4C!4L
2,422,395,578 *FFF1DBD3D9E938BBFD4EC08A035ED022FF01A151 d?em-
2,422,395,579 *FFF4B6E7A4140A33B7CE8B446ABD43F03F54659D [email protected]
2,422,395,580 *FFF0D168C1EA035BADBFDE46D9CE276200E5BD03 DENNISLYNNE
2,422,395,581 *FFFB37775A42E9BCDDB14B6285327B9D98B9C32B ppllnts7
2,422,395,582 *FFFA88E33771F020E13AFB64AAB5219255E7CEA4 derek-martins
2,422,395,583 *FFF6CABA0F317339ADFD27F9D6DEC5F1FEA59FB8 derickkatke
2,422,395,584 *FFF644C66B499DC646B146DC0398494AE147DD04 DERMMURE
2,422,395,585 *FFF0DB2289BF791AA4B1CC3D9EDA72AF15C22613 PRE-MONOPOLIST
2,422,395,586 *FFF58CC71FFC36BADB11608C506EE2197DA5DF85 DESMONDPELLEY
2,422,395,587 *FFF339AAA5A38CC42BC249E23E3FDF855579A023 DESMORALIZACIO
2,422,395,588 *FFF02D2E48B6A78EE40954797F96AF02B2CE8024 prevquota
2,422,395,589 *FFFC70C2D2CE0F4D6137B602398232913C07F69F d(gkx
2,422,395,590 *FFF699FC5C9CC08D714419C7B511DD250E842E65 q)~0 ~o )X(
2,422,395,591 *FFFE146FE5C423114EDED3D86D50B0D64A0315F7 disablism
2,422,395,592 *FFF2C5F6178116F8E72A21ACC88B6F5C9A29FA84 [email protected]
2,422,395,593 *FFF3BBDD3BFB6830A9FAD1F783947343CAA7015A d_k,
2,422,395,594 *FFFB2399DEB18F469DB3287EA3CB8F07787B9A63 qq~v
2,422,395,595 *FFFCEEBEAC2EAFD3224A50475E195E0283385C58 DLVEH
2,422,395,596 *FFF441656CD9B92AC92B7913170DE25DD285491F QUINTINAMAILLA
2,422,395,597 *FFF91470383F07ACAEF536361206AACB0F9BFA15 DME5B
2,422,395,598 *FFF36DDBAF35F322A9619BF79E6A70812C7FA7A8 R4PU3ROQU3
2,422,395,599 *FFFC416D7B34304791DA509C6AAF07A0AB5F298C rabih.nasser
2,422,395,600 *FFF99B865D9DE34BC3873637802083265A670A0C „RADREIFENUMRISS
2,422,395,601 *FFF4281E5845486F1E1BA3BCE1D0340EEBC1A4F0 rahmenpläne
2,422,395,602 *FFF832A283BD5F2420BF85791821F0D45C07B3CE DON'T GO OUT LIKE A SUCKA
2,422,395,603 *FFFFFDDA9360633340F6D632B44879076C1B54B1 raquelscience
2,422,395,604 *FFF87038B849FE800D2F6B9AF56128DAEC42DDB4 DPHS&
2,422,395,605 *FFFEE0D421FB5F72C6787D3EE9FCB2E99B3BA58B raymundostorey
2,422,395,606 *FFF2AC9E5A2579AE77CD7BE47180DA99D8F987F9 RAYSUGGETT
2,422,395,607 *FFF02E8727C735E467FAFCD7E5A366AE8A3E8AFB RAY.WORTLEY
2,422,395,608 *FFFF3AB588CD2D9F2290957FC9ACF96CC91982AC [email protected]
2,422,395,609 *FFFF09DEC5FA431CFE461D7A3D4A6FAA2591FB15 dre.m
2,422,395,610 *FFF3489BEF804C5ACADA96EB0F406B083DD22D4C Rebel.Without.a.Brain
2,422,395,611 *FFFFB83285F3022C2D723D41159B13683DBC3568 d$s7t
2,422,395,612 *FFF2DB76E6CB43DB8913AF1D183CEB59815B645E RENATO.NACAR
2,422,395,613 *FFF683FD0AC3B3BEA13CA3C294793F49212EC97F D(UN
2,422,395,614 *FFFB8F1D40A725BE82B825714A760917D7D2ECF5 REPERERS
2,422,395,615 *FFFE4B3DFD8E5E66736B2E7B97DD6DBEC99A66FE dustincollea
2,422,395,616 *FFF6321EAD4DCBD8A2C817F29473B30AC405D9F4 RETIEFSINNIG8
2,422,395,617 *FFFFC252B65EF4EC2625DD1950888ECD58B616C8 DVALW
2,422,395,618 *FFF4FD473EFA7DB32D65DB9512B54A3E437B4071 DYLAN.BESAW
2,422,395,619 *FFF1569903A1F94EC0B585A442F6DC0BDDAE60BC d/:yo
2,422,395,620 *FFF537833FDED769D233421FEC2A9B2511496470 e4ja
2,422,395,621 *FFF9D8F4E2D6E6C088F78FD231D8B887A0FCC98E EARLGAYMES
2,422,395,622 *FFF60F1D45B69F9A99657EB335FB38B4E3158126 RINCEROTTANO5
2,422,395,623 *FFF6D8714D561CBEF727A16EA92FBBE66AAFE32B eberfuhring
2,422,395,624 *FFF103918B93DCFE6481623CB2E9216BE8E17653 rjcbxrf
2,422,395,625 *FFF7E35CEEBA70F5989CAB632A74696FBBA06792 EDERLOZING
2,422,395,626 *FFFBBB799BEAE28588D18934DAF7578C2FE037E9 EDGAR.ALLIO
2,422,395,627 *FFF86ACE5E4FB17418F18E715763F8912BBCAF7C robtganser
2,422,395,628 *FFF76EA5270F9251C2B9A144FBA34F3E36C6B6EE EDMUNDOCISNEROZ
2,422,395,629 *FFFF29370ADA99793D1A1B66462D0AC7FAD80F65 EDWIN.SARCO
2,422,395,630 *FFF3992535BED5F1004F834DBB39494DFF8F564D EE+h
2,422,395,631 *FFFEC696D22906822D41F4313C7BD763267FBBC6 eetbaarh5
2,422,395,632 *FFF1D15556FCEF6BACC2E5C8D33ED0F946CDB881 EFREN.SCHEMPP
2,422,395,633 *FFF0A78A13A6C4E487C5F88D11DAA85BC73B32DC ronniemacalma
2,422,395,634 *FFF44CFF21EC6747794FBB15398276734DC25998 EGENKONTR
2,422,395,635 *FFF1C46D6086F2FDA61FAE33EE4B0118B26189AA ROROSEIN1
2,422,395,636 *FFF4D9D244DE1388D35579E6DD42C17037C0BC85 egt,h
2,422,395,637 *FFF1452F24463A212A8CD338A6453B5119894015 [email protected]
2,422,395,638 *FFF3BF4F83DB430435EF301A53A6181C01346336 ELDRIDGEPIZZINI
2,422,395,639 *FFFAF01FE2F8282DB126EE5F45B88B6531816E68 elijahfatora
2,422,395,640 *FFF5E4A4F86775448085470E3885416A4EB2FECC elishakozak
2,422,395,641 *FFF86A6ECF48234CA10F08462ED3355FBC57F995 ELIXARSED
2,422,395,642 *FFFE0DACA96C000CD7D3F9EE35B100ACD8A4FCF2 RURTASUN
2,422,395,643 *FFFCFCD0C30F8BBD177AA914E74E2AE3C9932FF9 ellisridgeway
2,422,395,644 *FFF011D67F29F767BF78874E4AB127359E2C1639 RUSSELLNANCE
2,422,395,645 *FFF6258C0C5E1055DBCD17C249D69FF07AEBE8D3 RWEEZER6
2,422,395,646 *FFFB3963BC77583D670849934809511FA9106E73 S)\3
2,422,395,647 *FFF792C1BC353A520B83F450D3EF0831F172B5E2 S3LFG3NO3GS44MH3ID
2,422,395,648 *FFF85DA41E5909DDCAF945B2DD620EAB627E1E21 S77.
2,422,395,649 *FFF2BDF5AAC423FD74DA92F61D135A08D8432ED7 EMILE.BENSCH
2,422,395,650 *FFF65A445B54C44A2EB40E69585A805A60DFEB10 [email protected]
2,422,395,651 *FFFD9D3D78B6BBE884D1A9D1A1985B06C7E6C020 EN74.121.68.137
2,422,395,652 *FFF9FE833F24D9298B5179C9D787B48246FABCF8 SAM.CHRISTMAN
2,422,395,653 *FFF05ECD3A2BFDD409F5F7BF002BC8B8B64077DF endalkatchèw
2,422,395,654 *FFF5AAED563C4B1F171B62B883F5E03CEFD7F947 SANG.RAMIL
2,422,395,655 *FFFBDFF9D0C64DEA61DAB493904C3C6CE77AFF09 SATARAK8
2,422,395,656 *FFFC7E21501624ED3092C2DF82A23CC66620C56C SCHOFTERIGER9
2,422,395,657 *FFF836FEC080C2AC367036257EF6B9D7C052F6A5 ERAKUSTALDIAN
2,422,395,658 *FFF1574AF7141F4E53A7D0680B47252EF52AF196 seekerofknowledge
2,422,395,659 *FFFBD616891663E482B6A136D9FA2582E59C1031 ertwunez3
2,422,395,660 *FFFD071206B8E4595711097F216678D5A9352A32 SENATORJACKSON
2,422,395,661 *FFF1384A42D6AAF2E65E051E7704E4F011509269 ESISTFUERGELDNICHTZUHABEN
2,422,395,662 *FFFF5B341D33AF8DF2D820B0D5C1F1A52751E73E sethahmad
2,422,395,663 *FFF3D70280B4BE39F349CA1D1DEC124F00DC5FFF etqh3eur
2,422,395,664 *FFF2142AE86AAE52E5C6801C5C5A5992D774F3DC [email protected]
2,422,395,665 *FFFA5AFE770A39A75FC45CD38AC9BC74A4B3CA4E SHAQUEAL3
2,422,395,666 *FFF4EC53B3560A8F46205CAD22B686AE3CF564C7 sheldonronson
2,422,395,667 *FFF7725A90530D5D386D8D00D5A6001FE30A309D eye+s
2,422,395,668 *FFF7BD20FF300442F91B332093BBBB533EACD408 [email protected]
2,422,395,669 *FFF658E104E74CF197181F146DAED888B278A9B1 F5B22B370D4EC82863934548F3E58E8D 0TAKINGU
2,422,395,670 *FFF1A71CEC7AB1D7899A88B7513133DD93502EBA facebookkilledthemtvstarshakiratodebutnewmusicvideoonustreamfacebook
2,422,395,671 *FFF466398698DC9DC4122B10B6ED855F8DB927C6 farfield
2,422,395,672 *FFF937968FE96B9377C54E56DBFC03D0EF0E88EB federicostackpole
2,422,395,673 *FFFE3CE3E0399472A47BE4651B181340B60BEC86 SKAVICA
2,422,395,674 *FFF790A83D2D0C3268D361E4716166DC3458B8C1 SMEERKAARSENS7
2,422,395,675 *FFF4309C52D3AD80D974A8B119F0602E3E468F4B SMLLTWN1
2,422,395,676 *FFF69A5E6EE6368599221435B266BE5927B54402 SOUNDSCAPES3
2,422,395,677 *FFF4BFA3CCEDBE88F40178B14F6274C96CB501E9 SPATULATIONS1
2,422,395,678 *FFFF98FA7DC76E488B98DD57C146B0DE3A80FF59 Special.Singer
2,422,395,679 *FFF671481B0E3AADCF8E09600844A8FEE438A905 ForfearanddotingFriends,begone:youshall
2,422,395,680 *FFF63C69D8947301081A782DB9469CA3F533CEBC FOR$KOLE$
2,422,395,681 *FFF899991DD775D85EFF3A0BA04D86A2DF13B71A Four-Duets-Op-61:-I-The-Sisters
2,422,395,682 *FFFD689F879EB6707CD3E6F391B861E18D2A1FB6 FRANCISCO.PAKELE
2,422,395,683 *FFFA032493C3E81585BB78BBB26AD527FC6F6338 (Stage2-1,6-2)
2,422,395,684 *FFFB1DE2FC5EF67675B0529A127B3D1439346364 STAUROING
2,422,395,685 *FFF312B728CF5620E3BE573706EF4ED5C6084DBA STEVENMURACO
2,422,395,686 *FFF6738FA455FE537F600732B6E52A4D1AB90DAA Fulfllm3n7$
2,422,395,687 *FFFA1CDD6968E8633F9FB5C30C1AF5F280A1FD54 STIMMBERECHTIGUNGSRICHTLINIEN
2,422,395,688 *FFF16F1C6AB235EFD7B073CAABCC115FAA374418 fyzikum6
2,422,395,689 *FFFD35B32DB7F10D269D8A5CAD84BEB43D1C2796 STUDLYEUGENING
2,422,395,690 *FFF7F9C73E09AE5E49D6F1C27C53C67EE645ED87 su88n9
2,422,395,691 *FFFAFABBF19A03303FA61BBC779CE5DD81CE9DAD GALLIOTS
2,422,395,692 *FFF7FC4D463E74AC71B31E73BF5EEE1C90D0AC3E supportjanuary
2,422,395,693 *FFF893F0C917387A59B3F418C94EAE098DC4F559 GARY.SEIDMAN
2,422,395,694 *FFFCCE3B1BB31B447CBEA8503F49D222ED704EC8 sylvesterleimkuhler
2,422,395,695 *FFF961F71EEB87D31997E846171D66955F98C5F4 GEBRUETE9
2,422,395,696 *FFFBAA0453E8B50B0B3E10B2C07AB0586D309C85 /SYS/DEVICES/PCI0000:00/0000:00:06.0/USB2/2-1/EP_00/WMAXPACKETSIZE
2,422,395,697 *FFF00DFAD3F244A7AA3D2D270E0A27D9EDE98253 [email protected]
2,422,395,698 *FFF309035826A4BE5215696C6AFD1B97EF099A75 GERMAN.DESCHEPPER
2,422,395,699 *FFF51D6FF826F0C869E4205EB148A4DE0A53CCAA TAALUTSOP8
2,422,395,700 *FFFA26E34D8962E8BEB41AA47D7A8F55558859C0 gerrylu8
2,422,395,701 *FFFE98FED9B6FD032BB863AC493E1E2ADEFF17AF TALKARCHOSAUROMORPHA
2,422,395,702 *FFF7A277981D01437143FE7B140F7578E58F7B86 TALKHIIRO
2,422,395,703 *FFF83AC9018E11BC2634677CBFDAE6C9299FEF3A G&?H
2,422,395,704 *FFF1B47DF61AC530AAFD472A88FF62E4A2302D5D [email protected]
2,422,395,705 *FFFB74D6341F3985004A89FBEE33D435DB5390BC TARKKAILEMASS3
2,422,395,706 *FFF45586F739D3F1DE8DD83D3C207E7B0D20558C GIL.RESEIGH
2,422,395,707 *FFF1D59FE45C8AA12333287B21B4CA9901BFD469 GLENDIAL9
2,422,395,708 *FFFECE1EFE95703E1CEF5C9FC807C72FE66C3779 TCT9
2,422,395,709 *FFFA4794F84C755B1AC75347B4B85AA6C2D5E9BF GLORIA-DARVILLE
2,422,395,710 *FFF03C75583F6DA35E4B7984DE6E98F8BA780FBC [email protected]
2,422,395,711 *FFFA72957A7B17972AED7C7D3CD5F3B4032C5D9E TENONGEN7
2,422,395,712 *FFFF9D27B67B3574965AAFB562150B51AD23EEC2 thador
2,422,395,713 *FFFF26E297B468E13FACCF831941AA5F2A813DE9 gramca10
2,422,395,714 *FFF640FEC3C5D3942FACE0107B1DF4385B44DA78 GRANVILLE.FELBER
2,422,395,715 *FFF996358A55B129A4F49CD4FD9308773E407D10 THEODORE.CHAIKEN
2,422,395,716 *FFFA1C7646CD06DFD00B1B9A17CB08C50B55F6EA THEODORESAYLES
2,422,395,717 *FFF959608CCCE4C70B21AADE8636A307A5AA8196 GREGG.HAMMON
2,422,395,718 *FFFB35BAD324BD9521D475E6AD7EC17BC32B35CE gregg.marion
2,422,395,719 *FFF699B7E1E55537B93FA4BF9B9D76C454ED0C9A GROVERSTANDBACK
2,422,395,720 *FFFF351D806EDD046E1B76CD9C98EB750E47B104 THE WORLD BEHIND
2,422,395,721 *FFF06D292B45C699241D587E14C1B8AE2BC55911 tianlinbsw
2,422,395,722 *FFF0AEA4974DB0EB0BBE925EF8AB37DF0201E24B TINAMISENER
2,422,395,723 *FFFF0EA83B18FEA20BCB09B36AB1D0E856857015 hadrův
2,422,395,724 *FFF8430175446DBF42583B4A69566F5B077249BC TLACOTLAN
2,422,395,725 *FFF1DAE8C903BABC341140D2AFFBE61CFD285F6A HANDCUFFED!
2,422,395,726 *FFF10747B58FA1F0035A984ABEDD864520ABE1F9 tobycooper
2,422,395,727 *FFF14001242EB774F23AE075C2221C9D58C7E064 haroldtrenbeath
2,422,395,728 *FFF6088D2D9FA42FC08902D33D4DFD361277BEB0 TOMMIE.HESPE
2,422,395,729 *FFF6326CE633A9BB13849C3E9661D667EF28278E TOMMYBILELLO
2,422,395,730 *FFF9D2E67D8E01C94A542485C8242CC4D152D263 tomson‎
2,422,395,731 *FFF30261AF74335DA54673AB405C39FF57521D3B hassantrett
2,422,395,732 *FFFA932AB59895BED3E3B660F4E1F7A55CDC1C5F HASYIMSYIM
2,422,395,733 *FFF1F026A62805574589B087224E70ABC0C25EF7 TRACY.MCWILLIAMS.HUEY
2,422,395,734 *FFFF4C0578EFD60A2C428334DF77F1F75AAC578A TRAN-HONG-PHUC
2,422,395,735 *FFF0B6AD7905601DD1ABEBA52222CBFC4A5289AB HELENA AY,-MY-GOOD-LORD
2,422,395,736 *FFF29D809B8C670B5ED3791AD6E25727B82EC018 TRICIA-BINKLEY
2,422,395,737 *FFF390B6D222CE1520DCD12BDCA5F6E610444956 TRIMANTO
2,422,395,738 *FFF7A38EFDE69D4BA6B98C9FD20C18815AC616E2 TROYTURBEN
2,422,395,739 *FFFC29EBFAA475440B37459D4BA48C625D52F6C7 TRUCCOSAMENTE
2,422,395,740 *FFFB31895CE02FF9A68DA21A002CC6B5A3E99EBC TTOHIN
2,422,395,741 *FFF3ABDA07B9D6FA2BEB101C2D0D2D88E872CAB8 TUNG SILEN
2,422,395,742 *FFFEDBC2FF0291230144997E82AD085D23B74848 turkian8
2,422,395,743 *FFF5A75361C55F63D3A32826A46DBF7D21128E30 [email protected]
2,422,395,744 *FFFEF3A04642142616037BB166C4C16D2AA4BE9B tw3ntyth
2,422,395,745 *FFFE32FE91F7FF1A16089556BB411AA4B4B9E11D TWETTWETTHWET
2,422,395,746 *FFF027569390F0AB25DF2E680B7224B4184D1DD0 HILARIAGARCIA
2,422,395,747 *FFF6F3535E17111ADF2EE7250828F45C4A302C31 hi murda (lp edit)
2,422,395,748 *FFF47366927A04A77DC080055B681144DB3FE7AB TYLERPOPAT
2,422,395,749 *FFF002870C9A88B2855B3DCAFD4FA9FE63605B4C hipanet
2,422,395,750 *FFFBB9E2F1F4B8807F156D75C526122A33BA58AE hissed7
2,422,395,751 *FFFFCE04239933E23849C22CAEC8FA20D5F45D7B TYRON.RAYGOSA
2,422,395,752 *FFF61CCE08DF0C4CFD0121E96CDE0249C2A0C21A UBERMACHENDE9
2,422,395,753 *FFFC6363024B6A90F8B1489C29503FA33763579C HOLKJAKA
2,422,395,754 *FFF42DAE059DFC3045EB462CE1E5EBC5303F7763 homernorthrop
2,422,395,755 *FFFCEB6BDFDE2C54F3B7520F48A0F6575061FCE8 homerselkey
2,422,395,756 *FFFC889666CDA183A61FB91D499D0564A239AF70 UITBUILS7
2,422,395,757 *FFF53D76B73D35731C52CEE233559E8385FE4562 hongmerel
2,422,395,758 *FFF755393C376A47CF9893C0D5353F63FF5DF2D2 ULICONNOCILU5
2,422,395,759 *FFF165C11FCAD22944B0EA4CF77738E09B7197D5 ulrika.lilliehook
2,422,395,760 *FFF9CB4D1C577B0D7B03E5A1A641EBD2829F303F HORACIODREWETT
2,422,395,761 *FFFDDDD16D9660F7A3AE2C093BDF246B5E3416B5 HORN & PIANO
2,422,395,762 *FFFE5C14C555689C81B458D32626DDD3FCCEAEE7 [email protected]
2,422,395,763 *FFF86F07B3EBD5CEF2273773E997DE41AF37A4FF HOUSTON.SZCZEPKOWSKI
2,422,395,764 *FFF1C8DF1E0A36A6C405B3FF0109CD0804353E68 [email protected]
2,422,395,765 *FFF7CA7836802514F15BCBEB1FD5146BCA085B35 httpwwwmmciretsdm
2,422,395,766 *FFF11EBFF832873956AA0B4A93303613CE0DEB2D [email protected]
2,422,395,767 *FFF0612F2CAFD7BD14BA9C4D3DF0CFE4AA6F5B4B [email protected]
2,422,395,768 *FFF433A99349C49A5C0CC00B94677AD4A8027722 HUBERTSANDIFORD
2,422,395,769 *FFF73D0F4C2E7BBD15103CD605E32D4D7F606D35 UNIDACTY5
2,422,395,770 *FFF544FE5C4A633460E2CF52DDC010762969CBB3 USER:ACTII,SCENEIV"HADERVERRUCHTEFLIEHETIHN"
2,422,395,771 *FFF27D6F48BD0DB55400C28DD167505FE62CE941 ichneumones8
2,422,395,772 *FFFDC49A3B2653C716D2EE1A6C936B3730314B85 vagat
2,422,395,773 *FFFF7FD87EB4D456B1A5AC432619025DBFB8838F VALERIE.KROOHS
2,422,395,774 *FFFC55CD484F7FA5A74AEAA3E253F122C6F210C4 valerie.malvini
2,422,395,775 *FFFACA14C02773360CC56547025E306C1FFFA41A ilovebichon1995
2,422,395,776 *FFF63EABD4F501FA4FFC408D483029AB91B23C4F vazelinamedley
2,422,395,777 *FFF6334F16B77DB411A62372D52B8CD486A2336F iluvdenny69
2,422,395,778 *FFFA9540945142D0D58D0A32A018F39FCC6E467D VENICECHIN
2,422,395,779 *FFF290DB08EEF694E7A0807E7E4E28A6884B4C22 ILUVMONOPOLY17
2,422,395,780 *FFF0C979163141320B9E06201A248F1C04A5385F vergegenwartigendes
2,422,395,781 *FFFC090B039BB1F79F7C36A4F225B59F2274FFC9 IMPRESARIIS
2,422,395,782 *FFF639B9E8AF20C4A2F234022E7EFF5E9BFCA1BA INEXPERIENCEDLY
2,422,395,783 *FFFC0E10908DE17CD45893CF28E7498E832F9EE2 vierringstruktur
2,422,395,784 *FFFC4F087C5FA8F301C2A02FA6693DDA9B74C0AF VIPERSKEETERS
2,422,395,785 *FFF5BAFD5FB99B592607DF505B1D83AA933685A5 vivianisutjiadi
2,422,395,786 *FFF88B601DC35819D842CEC75DCB37F457564CCC ISIIKISED
2,422,395,787 *FFFB56EA59DE2E96F9EF3C1E3423A14677378074 IThinkAboutYou(Geigermix)
2,422,395,788 *FFF91BB82C74BB83FA3B90A29124A264AF57E744 VRDGST
2,422,395,789 *FFF4B8C3AD1ADF16B84BBDA5C57C01FAB721D6E7 IVIMROTS8
2,422,395,790 *FFF27E03958B3360128096742542307A687E4FF6 IZRONILOS
2,422,395,791 *FFF779DF8DCF6EA912B2AA2DF8B957A2A52E02D9 WAGENVORSCHUBBED
2,422,395,792 *FFF81544B368ED44973A765806AAF1FB0F62A265 WALIDSAMMOUR
2,422,395,793 *FFF20BF6E38DC3A58F1DF76887B5AC3D2933B239 [email protected]
2,422,395,794 *FFF8F6C6E567F1D92951316A2ABC493C8ECD177E JACKSON.BLEVANS
2,422,395,795 *FFF982AA4FEAF94645B1EB79E87CF0D9403E2AA7 WALTON.ORREGO
2,422,395,796 *FFF7D84E9DDE5FA06BAE034366B96B61D0A10AD5 WANCATEGORY
2,422,395,797 *FFFE12380D084D3FBBAB844A22839A6B041B1223 JACQUELINE-DIETZ
2,422,395,798 *FFF0F64C93644D2FC7CE04A6088540CB60F430FA JACQUELINEGOODMAN
2,422,395,799 *FFFF0359D758720110190FB86C42C307E4C188A9 JAEGERTHEMAN
2,422,395,800 *FFF1E98BE533D9CD0A4034DB71373153F0E18834 WANT-IT-FROM-ME
2,422,395,801 *FFF00070D217BAE18CE3099381D18B09F339F8D9 washisnein
2,422,395,802 *FFF6E15FB152AEAE1595C6A37E7F15B63AC8AAD2 WEARI50MELY
2,422,395,803 *FFFBF418A41BD2B7974B47FD3496BCB018794393 JASPER.FLICKNER
2,422,395,804 *FFF8DBC0CB83425DF37820B9CF3EFFEA08D6F353 javed-nazar
2,422,395,805 *FFFF126542CE66B587A59AF31B6E8DA61493CE0A WERE-IT-NOT-FOR-YOU
2,422,395,806 *FFF91C4F5AF6BB9D72291A28101D5B8530D411AC jeangiesen
2,422,395,807 *FFF1AEA376C4634DAE837E39E081D26B11F8E61E JEFFERSON.BARKE
2,422,395,808 *FFF0092F7E6ADB23AE57DF4231683A8290448572 jefferytarbet
2,422,395,809 *FFF72D70017285F5D5E850D34CBB5D81120CEB12 jeffryblenner
2,422,395,810 *FFF5453C6E216E58C022AC9D56943033F13BF074 jeopardizeyourpresentjobpossiblyyouwanttoplace
2,422,395,811 *FFF201BAE8D8DF3D9980741250B80A99284A6185 jereeckard
2,422,395,812 *FFFF11B965E02D04C05623A13E63DAB2576E4B60 JEREKAER
2,422,395,813 *FFF63F27450924ED417700CBE24712D85C29C1ED jeremiahmaskell
2,422,395,814 *FFFF33F4347E6078566E2430FA0D2C47AE862874 wileyracedo
2,422,395,815 *FFF4F356AD53BC56EAB9867E603DF9CEC2EE1054 william-zappa-stones
2,422,395,816 *FFFFA92F26BA0CD6892A9DAA8B321356F6788702 JESS.CONCEPTION
2,422,395,817 *FFFFB96525D146DC67E0B7C6FED93071E32FFEEF JESS.SPECKING
2,422,395,818 *FFF013FDC084FE06E583325BF3C0BF8DF5FDDBD1 jewellwislocki
2,422,395,819 *FFF82D026970A5FF53BF9C1D6221AFEA28D3606B [email protected]
2,422,395,820 *FFFC5D95914DF7D63E84E70F8DC626D5E82ADD8F WINFRED.STANUSZEK
2,422,395,821 *FFF02271E8B8D43D9C667EE84448E597E58EFDD9 [email protected]
2,422,395,822 *FFF5CBEA4329E7BE56D18467D27DD6165AEB8C0B wk)w
2,422,395,823 *FFF2AEE629D376C24FF5BB924A600F64F421364D JITIN-BHARGAVA
2,422,395,824 *FFF692D7B8EE1D1A3CC2BC634A7906B31FE20251 WOLFGANG.BLANK
2,422,395,825 *FFF905F4AB2105553E4C538BC68E52E9D707AF67 wood.and.dirt
2,422,395,826 *FFF44CCDCA4EFD11B81F21A2DE677B1E143BC224 JOAQUINHODAPP
2,422,395,827 *FFF64014F7F2B741B54EFCD9858D9F9F0ABC5BBF JOEY.LICKLIDER
2,422,395,828 *FFF91DCBEBE5CA6D0701E6102E81DE92B084A06C WWW.ALLYSONSPLACE.COM
2,422,395,829 *FFFD89203C848B9582A656522665188329B36CB6 JOHNMATHEWS1
2,422,395,830 *FFF5BF4F43136B1AA466BC247403B5823C99CA04 WWW.GOVERNOR.STATE.TX.US
2,422,395,831 *FFF8A529C893F1958733B51198BD9F16CF1F7348 WWWHOTOTCCOM
2,422,395,832 *FFFA9E364FBEF8C0603A599DE7242FD74D900C49 wwwmuraspeccom
2,422,395,833 *FFFEAABDCB7A886C9A7ADE6416994079F814A623 JONAHSMEJKAL
2,422,395,834 *FFFDE6EA0FBA80A6E1F51ED47FCB004F568A08DB JON.ARMIGER
2,422,395,835 *FFF63226E6404868AE56F4ADD24EABCD6266733E wycinsky
2,422,395,836 *FFFBC009F055B643537BF1447F2CF76AAD8305AB JPIIMOVIE
2,422,395,837 *FFFB1E37888882E38E36772045C1045AC237070A [email protected]
2,422,395,838 *FFFB21553FC13E2467C1461EC5BC10AA624BE39D [email protected]
2,422,395,839 *FFFA58795EFFCD23E8BFFC713E3333CE8AF8F6AC [email protected]
2,422,395,840 *FFF34A61B68DF7B5C1FA1B81F0BC23F5E0871725 {X}O~0~(--Q
2,422,395,841 *FFF45A80FA49CB60229CBDAA5A43C361D274F456 JULIOSULOUFF
2,422,395,842 *FFFAFA06F728629BF9C0C230FE79AEB794F8EE64 juliusmuccia
2,422,395,843 *FFF05A801088ACD6BE275E0A761B3998B5644C00 yaneth-valle
2,422,395,844 *FFFBDD088605328D3A4DD1A6F7679EE71CCF43EB JUST I WAS BORN
2,422,395,845 *FFF4009AA98644B44DF4BE335876A6B9D5BE0099 YANICK.FERRAN.TOURN
2,422,395,846 *FFFF662B7BF66958F212EF2D57832EFC15650FD0 [email protected]
2,422,395,847 *FFF9D249DFA432F38A70B7D7B3FEE40C990BC955 YEN-CWS
2,422,395,848 *FFFC74A9E56A434EC5DA2AF2DA507948A922F996 yercanoza
2,422,395,849 *FFF8256E460632F5E988EF192A2883FB564F2C8A kantonniers7
2,422,395,850 *FFFA219E94D2F1E1F82F00E20DC01FA806D7B243 YIPI-AJA
2,422,395,851 *FFF96335D685FF4F81550279CA978B82D04EF9E4 karvats8
2,422,395,852 *FFF378A2881FA8CE0C6D0E8B049E74E6D0E8AB90 YMHLONYELWA
2,422,395,853 *FFFAB31A7338EAE3B6BA2C58513FC702F13A2BF7 katie.lynne.mills
2,422,395,854 *FFF95A7BC637CB0D38C644A2773DE2E619665B6F yogi-priyantoro
2,422,395,855 *FFF5B59E650FDB44ED407EB5824B2C460BB80A89 KCN`
2,422,395,856 *FFFB7DB8995F1B086703051A9922EE076F1FA970 [email protected]
2,422,395,857 *FFF209BB901F254177A273349FC1A604C7586AAB kencoria
2,422,395,858 *FFF9465E54C2EDDC0ABABDE68D530A450B1937CB kendrickder
2,422,395,859 *FFF95C1E6BE2DAF80F8B96ED6C7A12E2ED11EB40 [email protected]
2,422,395,860 *FFF3688835B40BF2AE387C87D8157E7AD6ED7173 KENNITH.CAINGLIT
2,422,395,861 *FFF01051AF414D0ED39A94CADBF4D5925C49B33E YUKI39
2,422,395,862 *FFF3AC6769391C0B65C0981C30F9596DF61356E5 KERKESLAGER1
2,422,395,863 *FFF173FA4BE077A337905A23707232928F612873 YUNGLAME039
2,422,395,864 *FFF8D4A177A4D314FF4C27158D935A29C0160E93 YVPAITAM7
2,422,395,865 *FFF6E462D3B8DF06DAFF89D1E1CEC12B87B2F2BA YXJ
2,422,395,866 *FFFD6371472DC676C92A9ED9A47A901BA2A9D278 KIRBY.POLICICCHIO
2,422,395,867 *FFF98396A824244304C208A45B59BE6C6FF25F5F KIRE IVANOVSKI
2,422,395,868 *FFF54362B60B24DA4BA1FB1D0D9F445852B4FDBB KIRKCUMLEY
2,422,395,869 *FFF3A0C0C1FED173F671F9F14F03CDC6F3447357 [email protected]@
2,422,395,870 *FFF986AC2FAA95982692F4FC5437D323EB8EB46C [email protected]
2,422,395,871 *FFF24962BF78E764ACAAC9F321FE298FAE06E830 ZHUZHUILAN
2,422,395,872 *FFFEF87F8032B0AB439107113F03061827B34DA1 kirsten-doherty
2,422,395,873 *FFF91880D2C8058AB7CBD74C8B6C26A188CF34A0 K>KF
2,422,395,874 *FFF0C7D25B6C6928E221A851DD4AA2E5307E8D0C БЕРАЗАВІ́К
2,422,395,875 *FFF4FC9C839D698DBEF7C3AE58149B2A709B6F35 KRIPOS
2,422,395,876 *FFFA32197066BD2BC2BCB77F381A57E79B0712BB КАКАТУ
2,422,395,877 *FFF9AEF3460DEB612732CA204CA462E562F8B8AD [email protected]
2,422,395,878 *FFF06BA2AEC0F70F305F05D34B18CEF4CB010C9C ЛИЧННЫХ
2,422,395,879 *FFFB637B74530ACC80E4BCEF523CF92453F2C3C1 KZAMPROGNO
2,422,395,880 *FFFAF895DC18EC8F214A18CB6A9689F31390E64A МАРОДЁРСТВО
2,422,395,881 *FFF424DC8F5FC3F3A9B7E8515A6A4D4CA17F424F LABIADING
2,422,395,882 *FFF1FA07ECE2B808788C7F2B2EA3E3803DEEE52F ріс‡рµсђр°
2,422,395,883 *FFFF383F430B45791573907C559ED2DE0ACAEEF7 СІЛЬУПРАВ
2,422,395,884 *FFFBD6F734C9393A4569D5E19AEF30D5CACFFED7 торопай
2,422,395,885 *FFF6AC9AC77C8ACAB5B769C866E94C852D9E0214 ЭВТОТРОФАМИ
2,422,395,886 *FFF41DBA606577A35121B768571BD31C30512CCB laserprinters4
2,422,395,887 *FFF12ED2F29E4143C4B55D6CC3EEEFB4849947F8 LEPAYSDESARCS-EN-CIEL
2,422,395,888 *FFF5D10295FE762AED7D0135B928154674DAB5CE LESLIE-SARAPU
2,422,395,889 *FFFA982A209B09E2EC60E9C559FAD9DC34DCFC4B LESTER.REYERS
2,422,395,890 *FFF20F0F3CB4A12CFFC74CFDEC347227C7374CEE LEVIGAYLES
2,422,395,891 *FFFBD3A4F4CD6D0B441EDED5B19E77C08AE62B91 lgjebsw1
2,422,395,892 *FFF4F735B0A8604D5591F309D0B360D129B947AC liheji[email protected]
2,422,395,893 *FFFBCE489E873084E18A7CBE6E61BA8F45521EC5 LILENA45
2,422,395,894 *FFFEFAE1A4335C409F81E87BAABBBCDEC834BA1B [email protected]
2,422,395,895 *FFF773BBA8D0543D2162E87FD5C76B78931722DF [email protected]
2,422,395,896 *FFFFA49A0EBBB8AAD37C26A505BAC4F6C596917B [email protected]
2,422,395,897 *FFFFB7115EB237F98874EB52D02F0AF0ABA1AB1C LITTLE-GIRL-GOD
2,422,395,898 *FFF4BE357A049B6BF6F09F3A0437BCAC1E66119E LOGARITHMS9
2,422,395,899 *FFFDBEF1B7B0C2196AF30A41A26FCA2B7882D234 LOREENFLORES
2,422,395,900 *FFFCC93977C097424E40ACD272EA696CF069308C [email protected]
2,422,395,901 *FFFEBE59B4581A38E4DA52A8F109A16F751AF8DB LTTELEVS
2,422,395,902 *FFF228CB001A6A5D355A18E31F919E2334D185FF LUIGILANGFELDT
2,422,395,903 *FFF01B551520C8547FCD2548CCC4628F2DA834DA LUIS.KARSH
2,422,395,904 *FFFE2A48D4DA5FB673084C75E1470FE0C8CC4C45 lvys
2,422,395,905 *FFF1EE37B10DF6CCDDF9ACAF94CA72D200C4B0FC m0023878cl
2,422,395,906 *FFF396816D08466B2114CF5A181C2EB5FA30D167 MANDRITTA4
2,422,395,907 *FFF4DCB959987A3F13F18FD84C58A3D9411D1FDD MARCAUS
2,422,395,908 *FFFDF5CF98BCD67CD0DB367644176DC27EF05EE6 MARIETJIE.ERLANK
2,422,395,909 *FFF97A18F0470C65ECF97FDA94B51844C976FF49 MARLEE222
2,422,395,910 *FFF3EA33D7CBD71FA7C23611D56135F32840ED6E measurement-bus
2,422,395,911 *FFF7C035BEB5800200EA274B2063F27C711E4F14 melvinwarboys
2,422,395,912 *FFF8C4D8ED35CC5A9473372C4C588C21DB38505D memories.of.atlantis
2,422,395,913 *FFFA1F91A8B76A7945CFAEF4496FC149C0817AE4 MERLINPAET
2,422,395,914 *FFF43A644DFDB663AFBC7F8092FBCE20664BE7B8 [email protected]
2,422,395,915 *FFFD259427029DEF3F1F5B890D2C2A9E70E43892 MICHAEL.MATAKA
2,422,395,916 *FFF2C533167983E0887DDB7427B49C86A308861B MIGUELPILLADO
2,422,395,917 *FFF93876A3AE60478E84B51FD54DFD2E6377AC28 MIKALABIDWELL
2,422,395,918 *FFF61BD7C3E78727C2B2BE8680C1BB20B21B6B17 08ST1NT3N3SS
2,422,395,919 *FFFC740D29E89F2DC51162835E6DA98893A02F05 MISINTERRING!
2,422,395,920 *FFF3367D5C65B45A8205499A4558A75559B52D43 [email protected]#
2,422,395,921 *FFF6F1D994C458433E9825E8CFEE08C5415110B7 NAMTTIW1
2,422,395,922 *FFF23B5E612A6EA186F4EBD5CAE67D7F352B35E1 nebengeschmack
2,422,395,923 *FFF654FF6D8B2A6D1DA7C946A4272E5215BEE904 11BAGATELLESFORSOLOFORTEPIANO,OP.119,NO.6
2,422,395,924 *FFFC659DEF0659A4D06AC0A61F70501C347A1801 1291647 im-vergangenen-jahr-erschien-nun-die-erste-cd-
2,422,395,925 *FFFC52BD8F4BEB12CC8A5B37989AD6C73C6002CD NERO.GERMANICUS
2,422,395,926 *FFF7ACA8F302535682ABC98D320A064A6B49987B 139322 MAHALLENIN-MUHTARLARI-SOKAGI-,-BESCESMELER-.
2,422,395,927 *FFF3F7C473F7BF3F2755A3BF851D696E96937E3C no81est
2,422,395,928 *FFF01BF245CBE1C82A94A2ACF0B0190C926B5E13 1863742 ols:n maalit : antti laitinen
2,422,395,929 *FFFC1CC1837860EC406E764409F3445AE40A86C0 O22011985
2,422,395,930 *FFF6F2E10CA9E1CED9621A01EFE240A379B349AF 1-GRABENSTAETT
2,422,395,931 *FFF1D991251EB59650E3621DEE1B5ACDBBA34053 1oooof
2,422,395,932 *FFFBD2BAB811AD2C457587E1C7CC96C3E7339788 OISNETSE
2,422,395,933 *FFF6ECB7C181245963E248B426DC6C468B736BC1 1PLANKTONBESTAENDE
2,422,395,934 *FFF6CA9ADE3F10E069968CA9302DFCD7DFB5A50D OOGAITOCHO
2,422,395,935 *FFFD6FCD90AEEA428D8538D7A25EAB5E9638E169 1.supermarkt-betreiber
2,422,395,936 *FFFFB9F499C336EAFCBC6F207C57079F530F2870 ORANGEJUICE/PRISONINTRO/MYLITTLEBLACKBOX
2,422,395,937 *FFFB39939FA29DC6663AB6EDF3C56A7596BF9740 OTIS.DEELEY
2,422,395,938 *FFF0CCCF6F22909B2E69F21B6A78F961855F52B0 20FEB1332
2,422,395,939 *FFFEDCE8B86CF0BF1726EFCF88D44CEDC6985C0A [email protected]
2,422,395,940 *FFFB6961D388CABE48463073AFA7C529DC529303 233-ABBILDUNGEN
2,422,395,941 *FFFC50CCD2939504CA98901BAFA200033184AEA1 paddock9
2,422,395,942 *FFF10FC5D3351CFA6810EB059EF28EA59564F78D 28222d3f6354286af8850b355d10c383.qazpl,
2,422,395,943 *FFF76D80F637092D6DA396D6A17F98F0DC627B07 2990195 SUOMI EU:N AINOA SCRAPIE-VAPAA MAA
2,422,395,944 *FFF1F08E2B9E2F3CE11F7A25FDEA1A48DC7A2189 PATRICIAGLASSER
2,422,395,945 *FFF04F0F0B111101C73DAD4EFF99863F81B8A26A p-B~0~o}8{
2,422,395,946 *FFF2B7AA60299516BC3A1D2DEEEE7E5A15391F79 P------D~.`(>_<)
2,422,395,947 *FFF4478554D1D61087AF9EFBE6649903F8A7D3FB pe'le
2,422,395,948 *FFF152FEAD6A4BC35F55E92796B67183EA9C9C79 !{2 x
2,422,395,949 *FFF04806F64BC2BE3D94C0FE8FFB8347E6FE20A9 petzall
2,422,395,950 *FFFC4EC4E75FA2209D2564AF7D5686E6A79B00FE 374990 VIIKUNAT VIIHTYV
2,422,395,951 *FFFA787E151B629722D945F51BB4E172DAE31A9F pierregi.marine.sas.|.italy
2,422,395,952 *FFF8DAEB2B04968E6A2238ED449E9C4E5539CE25 3blussing
2,422,395,953 *FFF721F8EF3D2E5D7840564349E02588AAD5C9DE 3VERKEHRSFUNKMITANDR
2,422,395,954 *FFF7B0C4CD50A728E1D0D76FF668D970CE75ADA4 @POSTOLIC
2,422,395,955 *FFF100BE3EEDB83CF8AB770C12CAD0A53B2A2D17 P###P* * *(0_<)
2,422,395,956 *FFFF867841F1944E7B1192DEE0CE784180ECDC8C 4P3DR3J4R14M
2,422,395,957 *FFF5BDA02210DA22D2523939CA8F476DB4177412 PROTOGENEA1
2,422,395,958 *FFFCE33ADBE467727634DD189E278B70F368C9F7 PRWRN
2,422,395,959 *FFF5095D7578D036B8844BA3FC5865739D59CA55 pryglede7
2,422,395,960 *FFF19F458BE0B0250564A9BA6BF2C8938FE28B9F PUNEETNS
2,422,395,961 *FFFBEEADBE5A22B606C5590ADEA221A48C212689 pyörätuoleissa
2,422,395,962 *FFF47BC83B6225A8FDBCB9C7B5B3A9EB0278F8D2 [email protected]
2,422,395,963 *FFF8A4614488D5138E57B2D94BF9DC8FBCD652C4 5JACKABANCIENT
2,422,395,964 *FFF972E475A9D143D5DF96DD42B9FAE549AC8963 quintinschworm
2,422,395,965 *FFF997AC9A63BFB1469F35022D8BFB87E8B43F22 Q######@.~.~.~.}X{
2,422,395,966 *FFFB28D1A78845E540802B913FB7479BB697F999 QYPPAHNU
2,422,395,967 *FFFAA4214A24ED54F427CD07FFCCA23D3D16F1FD 6bfaf02d9f3b165809fb7f056665a6bd-reject
2,422,395,968 *FFF773FF0A4BD8FF3B14A07E35A06E06B94337AA 6CHUCHEE
2,422,395,969 *FFFF3E7EFD6B857DC8F43125C693882D4DA1A969 6MYTAZDEVIL
2,422,395,970 *FFFFBA290C11D9FD21510CFEEE047AFB7F3EEDEC 6spieleroeffnung
2,422,395,971 *FFF6D5ED21BE408F985DFA1F561BF95E48882259 reference:dodi5000.2(sect2,5,100),dod5000.2-m<p>
2,422,395,972 *FFF0114F05DE9885E52951C34236B51B96FB710A 7DEPURATINGS
2,422,395,973 *FFF240105B6BCD9798AA86C00746BEAC50B2230C 7MILLIMOLARITY
2,422,395,974 *FFFF52A69912DC4C2D398DAEECD8A7558C4F88EE RH30L091STS
2,422,395,975 *FFF32A77CED90DE7977954669F69A0E21DC1671F RHETTGIANOPOULOS
2,422,395,976 *FFF5D9E63E4FC3621E439F5D7483EA8D6E9881E6 RICARDONORG
2,422,395,977 *FFFF009FD534B49DD4E104122370E4551D5871AA 7REDESIGNERS
2,422,395,978 *FFF0486EE8B5878FD9CA67278B7233AA5D84EC42 RICO.STAFFELD
2,422,395,979 *FFF5B32F481D343B78C36CB67CB8BDEEE8BEBA76 7THEIMPERIALCAESAR
2,422,395,980 *FFFC48E584F72651263AC7BD85F8050695E27C6D )8(~D=====8
2,422,395,981 *FFF6645FCEA48026C6D39941C933C48D5ADE6158 8###)~O~OSPLOIT
2,422,395,982 *FFF1BB714C0AAB52F06A7DDB7B52865BEE6C341B ROSCOEMAGAT
2,422,395,983 *FFF529E3CDE3082F227DF2FB1730BA9B1A85AD2A 8STICKMAN
2,422,395,984 *FFF62AEB2AA3777AE3E751F7E071F2C828FA8403 rozálit
2,422,395,985 *FFF358FA07C6A95407786E2DC615A056FCEF4F3E 9BLOWMEBLUESKY
2,422,395,986 *FFF75D0ED47F3BFDF54BABDB5CD244B61FE2B60A SALEENPAK
2,422,395,987 *FFF747CC7F3F0728B58576D881522AEF89131244 SALY-AMAR
2,422,395,988 *FFF5A4FC48924B90B623661B1129371125105AF4 9NANISHIR
2,422,395,989 *FFF1C89B17029B3EFA988A6DFC92E89F66D093CB 9SMASSMAS
2,422,395,990 *FFF4FCEF600FABBF306200D05CDE0E0BBCD65266 9VIDEOROBERT
2,422,395,991 *FFFF158D89FB42F6D05C0C9ABBC904FB8C3B54A2 a0wm
2,422,395,992 *FFF39A5F2C355F38E17E632439998D99C3D0F162 SCORPIONNUMBER1
2,422,395,993 *FFFE66EC93182E63AFD814F0796B7B67126CC7E4 SEBASTIAN.MINGUS
2,422,395,994 *FFFD9CA5786497D28F4C6EA5D86F8A2EB2ED4CC2 AAB%@3
2,422,395,995 *FFF922B7DD28BD06934E768C51662F3CF928F3F6 aatmm
2,422,395,996 *FFF24E9814F4BD2CE186FEC680C130AC9235D476 abpn
2,422,395,997 *FFF2A12A4342A78FCF3F02685E99BC8F86BED037 AC_NS
2,422,395,998 *FFFFA23954C617DAFB5F2C1447F458FF108E4D73 sherwooddiffley
2,422,395,999 *FFF40E7D26FB3DC9CE8AA3C99560223302D74B80 adagiofountainscomwww
2,422,396,000 *FFF7F62E0A2A9CED415052DE16216A70756AEF4A SHITSASSY6
2,422,396,001 *FFF84F725B63CD6055F0E80D303B3DC044922B00 [email protected]
2,422,396,002 *FFF80CDF5D22D9B0E7ACFB40846D2727FD8F14E0 af8;;
2,422,396,003 *FFFA5CF258E05BB1B305BEFAFCCBA072D1DB3B18 SHOOTERPHISH3
2,422,396,004 *FFFE967FE05DBB67E56B9BF1C92E1662C1A5865D SHOSHANA-KAUFMAN
2,422,396,005 *FFF4AAEF7CD911E0072F728FFEB2BB88E010E217 afis7
2,422,396,006 *FFFA1A7767D05ADAF184B8AB413CAF9012D3D19F snivellerses
2,422,396,007 *FFF7EA7BB16EDADD7CB161822E561114F0B4B06A songswithoutwordsno1inemajor,op19no1
2,422,396,008 *FFF9A41E83116BE07B7DBE103A7362C0CC2FF76E ALFONZOFUGETT
2,422,396,009 *FFF92A5BD10AEF660DA4B75A1D41302F2EF6ED33 algo3
2,422,396,010 *FFF9AC60BDBF15D200B1BADE0E5BE3A844B05FE0 Splat!`[email protected]#B
2,422,396,011 *FFFD44C36AB1B716AC00B7C4B6B77C88F168A24D SPLATO~0~D#B
2,422,396,012 *FFFB936E344D13C1A47565E471BADD17EE3C0DB3 SPYNNES5
2,422,396,013 *FFF5B26FEE7A3F62EA7DA50A7729F13929BF4D08 AMBROSESCHAFF
2,422,396,014 *FFFAA5E3E4BCB28A011D7B4C1384EAB217EA9D17 AND...-FISH-HITS!
2,422,396,015 *FFFEF53039182AE266B8D5446059009030042658 STELLAICECREAM
2,422,396,016 *FFF7ED342A876B4C7C3E02473A96A245F4A4FAFB sterlinglitter
2,422,396,017 *FFF7D90464FCD51A6A5888744A478F00C4457A6B ANGELEYES8788
2,422,396,018 *FFF550D1F8F6AA78827A3561EE1BBDB55086AE5B steven-rawson
2,422,396,019 *FFF1B2EDBC93087B807C84A18F3AF81AE5CD5B1F antonelambka
2,422,396,020 *FFF24A5353DFD07A05F832A32B8FD47182059AA9 SUBAIRMOHAMMED
2,422,396,021 *FFFAD4F78117B05BCD4B1519E0499145305C508F AP!8W
2,422,396,022 *FFFDF3A8F334D28DFB52082DBD6208559735AD80 symphonieno2c-moll:iv"urlicht"sehrleicht,aberschlicht"or
2,422,396,023 *FFF2E65FBBF0781BE78E66C6F866D25EE9AC50CA ASAKOUNTHAPANYA
2,422,396,024 *FFFCA9CF10E0C56C887844EE5C9FC533943B8B9A ASSOLARES123
2,422,396,025 *FFF2139AE290EE760F12BFB3E308E7EB91EE2E89 atacimuf8
2,422,396,026 *FFF7CCC2113740245CA70F3B16FB7AF874C83C2C TED.CIOCCA
2,422,396,027 *FFF9DBE10084CAB8A49C8448018EF43ADDB4878F AUON6
2,422,396,028 *FFF7215F1783B9537447BE28434CE0E05FA9F65A terrancekirkwood
2,422,396,029 *FFF217C2B8FC9AACFA1D6DF83B6E5924B58F4CEE TERRYBRAUMAN
2,422,396,030 *FFF5E81979B40D79326119F2C1CF1A66CB142C9E AV;;P
2,422,396,031 *FFF94D2B35ABFA155A51EB67170E1BADF646484C azn&
2,422,396,032 *FFF465FEA9D6603F41DDA583BD39DCB8BBB315AD TIGERSAUKI
2,422,396,033 *FFFC09D172F97112BC3501B6AB79846770787936 tmrphsrt2
2,422,396,034 *FFF7B74F2DF715E9ED75EDD64A9E84AEE6C6D9C4 $TR
2,422,396,035 *FFFB979AAF4C08538982C780DB7A76348B1D6042 TRANCE-FORMAT
2,422,396,036 *FFF58A6D3A48426CAC225F23BF5623685D6F21EF TRANQUEVILLE
2,422,396,037 *FFF36022A34BF0254FE8FFC52E09CD46AEFB51F1 TRANSESHAPT
2,422,396,038 *FFF339349D76BB3A6DFDFE45877DBA3AC17D563C BENEDICT.OSTERGARD
2,422,396,039 *FFF4E82F3CF06A07B05E8BAFD4AF3DAB7AA66CE8 TTFV
2,422,396,040 *FFF6389BC417B372F43EF21ADA987E3F4DA70622 [email protected]
2,422,396,041 *FFF32747CDDAF3879F7BCC0708C9C23D497E6922 TUGUMEHAAZI
2,422,396,042 *FFFE0B97732E9D052A3383B610DA86660B3E6AB3 bilderbergbound
2,422,396,043 *FFFD4D0A7B2CB4707024B24FCB61D73478DFF58D billsicilian
2,422,396,044 *FFFB705203AFF3F91B41EA00A80906A3EF55D689 ULYSSES.PINENA
2,422,396,045 *FFFE7D340D37BEC077735A4065B3AE63E1BC7241 BINT-JUMEIRAH
2,422,396,046 *FFFD51A993112EE61DD5A491A84F9F15592EB377 unprof!ta8le
2,422,396,047 *FFFCCC6BF07E40A590FFF8F8FCD55704A9A9FEAB bjv0.
2,422,396,048 *FFFD0DCDA47BF06F9FD228C632124DAA3F1E3C3D bkn7
2,422,396,049 *FFFDFE9E8EF6701D0972F388244D125915C0DDEF b+nyg
2,422,396,050 *FFFA757EB58234742C05282D59AB231A11D670E4 boyceguerard
2,422,396,051 *FFF1E7144B7D28851B6C90A552A721DF063A287A VELMARISS
2,422,396,052 *FFFFF8CE9841C4F5C1320FF8895F725E846AD287 BRADFORD.SILLEMAN
2,422,396,053 *FFFCD7A8C37CE267D7D91D282F6B56BD8D2332A0 VERNSNAY
2,422,396,054 *FFF00AB74BE4420B241CE4FE9B74C94B6EADA4CF VERONICAPALMISANOFOX
2,422,396,055 *FFF8094A9FE1EBE36C32EACE9C104D65AE7D2E14 BRASILIENSEN
2,422,396,056 *FFF80C0C0ED58E6BDA1135AEE7849095E8012E4A victoria-leigh-diehl
2,422,396,057 *FFF74F7962A058ABD669A37475597BBEC46F733A BR)N
2,422,396,058 *FFFBDC8840F3CFC2D6E2759CE3B4EAAF36F97DAA bto)3
2,422,396,059 *FFF5AE6F7464CB8F660350C9D4360002EBC70C83 vmuatll
2,422,396,060 *FFF7647CB3CB8778BAF68F80604E0052A85F2F6F bxhec
2,422,396,061 *FFF0F323710665E243D508A6E3A75DBC8B38E430 walter-c-tolentino
2,422,396,062 *FFF4D43EDA2BCE99DB7BE63F5EF4076D44CBB85F C8C(G
2,422,396,063 *FFFAF321C2427FDB8BDA461B20E2D998AACB67AD call-to-the-higher-consciousness
2,422,396,064 *FFFA613CBB602AEB73EABCCFB9451FC083223910 [email protected]
2,422,396,065 *FFF4C72BBA72437B5CB9448DAB100877B2C29A45 [email protected]
2,422,396,066 *FFF346A7CDF789D00E95CB015EAF04A54620DEDF carol-rao
2,422,396,067 *FFF9EC33CE299994665DA9FC4F8E2E996A6A2C42 WESLEY.ARZABALA
2,422,396,068 *FFF19AEC26642AFBF53AAD6B35C97FF1E93B4968 wess-wessler
2,422,396,069 *FFFB14EA4E9777063CC284AD76E49DC8458EE5EC wham-bam-(shang-a-lang)
2,422,396,070 *FFF886C0563F0AA886BDCB7B46ACFBD8B7DD64D7 WILBERT.FINEBERG
2,422,396,071 *FFFF4EB5CE2590D5785EC8E09DBAA96A2470E1BA CEDZ6
2,422,396,072 *FFF240C9999F60B7D8A72BA05D736D79EE06BCF2 WSPŮŁŻYNDNO
2,422,396,073 *FFF9AEE5FE7E7ED3B65B4CCE7CE6C0F642CA53D2 WTL~
2,422,396,074 *FFF2B76DA4A41DA8CB427FFDA464460CF2BA2ACD ChTl
2,422,396,075 *FFF33376996A0D49DC905795EC11817788A1BB2C }X{.~`[email protected]####3
2,422,396,076 *FFF7E02012CA0F12F6E163B89279A7135FAA2755 XAKGHWUI
2,422,396,077 *FFFEBBC6E6733600540788118385AD66506194FE cilentu
2,422,396,078 *FFF477B876C8DFB0F8B8CD08BC5F57DC2C90709B Clocks.(Heaven.&.Earth.Division.mix)
2,422,396,079 *FFFC127FEDD1DC420956C5FFEE30A5FEF9CEA5BE clw+f
2,422,396,080 *FFF7A999E099D5E6E79AE8E0ED39257546A18732 YAMA.WARDAK
2,422,396,081 *FFF543C75FAE8DF69EFD737DC9FE1127F3828E36 confuted
2,422,396,082 *FFFF5C529604A7BC5B9CCFB16E7BFFE376A64C8A ZACK.ASTERS
2,422,396,083 *FFFBE190F3D15E7D36600ED4934780989D98EEC3 ZADŹĚRAKOW
2,422,396,084 *FFFA2E680ADAFB23394D7D224DD365D700EA9133 ZAEHMTE8
2,422,396,085 *FFF1D98DB7CAFB94DE2ACB7A16680B0D09172B44 [email protected]
2,422,396,086 *FFFB4D5C44031A800014031529C3CFC79EF8A94E D2C&B
2,422,396,087 *FFFF38E68A984A31308B50C8534F155DB517AEC8 d)7?s
2,422,396,088 *FFF494D13B70B12CE34AA1E48A4F9F7D7C9AACBC d+9d
2,422,396,089 *FFFAAED67108A477EEE612457AD1FCAB8FCBD0B3 DAMON.GUSLER
2,422,396,090 *FFF27645F73793AAD34F099F3CF3579C618F4A99 одгледувачите
2,422,396,091 *FFF87B94D18EFD65EC119D337EB2263D70585C4B ТҮМЭНӨЛЗИЙ
2,422,396,092 *FFF7E0F657FB95306C22054117F22D5379727248 demoun7ed
2,422,396,093 *FFF3B5A91A8F2AD27057F9AD54129908D30CC94E 107447 BILGISAYAR PROGRAMCILIGI --ALI SEFLEK DOGU AKDENIZ UNIV .
2,422,396,094 *FFF468EB2F0699987925CC562461FB8FD7643410 DIASSERO
2,422,396,095 *FFF56A384326E948835B6368B406FB41CAFE6F69 DIGIMON.ADVENTURE.V.TAMER
2,422,396,096 *FFF9239199F5DD14BA6E3B0F7557C4B71C5CF18F djl~
2,422,396,097 *FFF1902055DBF2990B8F7CBC03C31B9025F384DA DKU0
2,422,396,098 *FFF4C2B145BEF25BAC7DFDEDEEC76A3B0F158739 DLDB:
2,422,396,099 *FFF41E420E211CBCA8C824F8AA760E707268BB54 1-anstandsgruenden
2,422,396,100 *FFF4EC19F86E4F6C293F2B80C0E0F924782553DD dm;na
2,422,396,101 *FFFFABD15C9E37CF6B768CDA8AF595CDE6DCE377 1BRANDBERGES
2,422,396,102 *FFFA08D2CBA550D6C12695E017822970D587E1FC dn!/g
2,422,396,103 *FFF5F93582EBC9B62CEFF3696FE67A97EA2AD3DD dn"l,
2,422,396,104 *FFF16162ED353FF53C97CBC05B0488AC196B106F 1-FACHMARKTZENTREN
2,422,396,105 *FFFCC08FE2C887EE6610CCF3327EFB0D119CA78C [email protected]
2,422,396,106 *FFFEED63F4D1A3E3C99813072C5D5C4CA193B029 1INTACHE
2,422,396,107 *FFFA4DE6C44A00461810A4BA5C61D7858EE89C13 1.Interstiyel
2,422,396,108 *FFFCF9F61AD0A36A888BE276F99FA22AD9080934 DOTHIENENTERI
2,422,396,109 *FFF5C7AEA444AD66A67B43CD26D5A799A38A3F65 1LIIKANUKKUMINEN
2,422,396,110 *FFFBC02DE4EB3855684A822A4FF389C686C78928 DPP_1
2,422,396,111 *FFF00B37D0A44C43422A39F88C657D2DF80C91B0 1pretre
2,422,396,112 *FFFE538989872F2FDB28A2224D1153516EF28BD6 DRQ8O
2,422,396,113 *FFFDBB1ED7024BE3746EE4A737E60BD091431B3A ds?;:
2,422,396,114 *FFFA15CD3A66FB9F442DC7B91B9F547B98F51A04 D)"TQ
2,422,396,115 *FFFE05965478B4F224260EAF40B338FFF6ABE973 [email protected]
2,422,396,116 *FFF33E620DFD1FBEA7771178F16EB893204DD828 DUSTYGODEK
2,422,396,117 *FFFD91CD0917B182B94C417B6AEC2C0D92A5F516 2667691 kirkkonummen.kunnan.asukasm
2,422,396,118 *FFFA6CDA7B7B47247C67FEA26BF83973D3A6586E E29899
2,422,396,119 *FFF35DD2387B32F875AF663CCE0C65630B3900D4 270-felsefi
2,422,396,120 *FFF22844A6E3748B8C5AD6E82C1A554475CB22F1 2732462 MAAN.RADAN.PITUUS.ON.960.MILJOONAA.KILOMETRI
2,422,396,121 *FFFE6704377A2C6E4F00860552DB6C95DC0A6BE8 274062 viennin-vaikeuttamiseen-ei-ole-varaa-.
2,422,396,122 *FFF2DE644AF017F0D9F179D7C1D8A55DC446E007 EARLHERMON
2,422,396,123 *FFFA06BFFEFA6CD162808DD4032C9AD3C714E4BF ebfo0
2,422,396,124 *FFF754E0A373F440FE1E90A25EF7EE1A7AA911F3 2905797 kaikkien henkil
2,422,396,125 *FFF6DECC3CB72E8D5472A7A915570C448215AB2C eenn_
2,422,396,126 *FFF270611B84611CB9645BFE3D2B042F5315FA5A EHR}
2,422,396,127 *FFF67F6D9276325EA302E30C0EF08EF55EFC034A 2HUNGARIANS
2,422,396,128 *FFF78DE912052DB2908FF8303FE38059DCD7CF7F EISMOES
2,422,396,129 *FFF99F8BA616689AA0261D02861B0FCCD9B8D0E3 2iluvgandalf0
2,422,396,130 *FFFECDE7CB60A6F3CA33DDE0FC5732363BAC99E7 2 PERUSLAINALAISUUDET
2,422,396,131 *FFFB04ADA462D9891906D2E80B6B4ECD3CCEDC1A eldonconfalone
2,422,396,132 *FFFB5EEF60800B11C95D5ED138F0EB407928A609 [email protected]
2,422,396,133 *FFF4C98D3F9A25046C75A613065ED14A37C319A4 2yamatsuka
2,422,396,134 *FFF57A8A35FF7C6DCD866EFDFE1D280B73B2D82B ELRICOS7
2,422,396,135 *FFF79474F34E794D2786D4D5D679E4637F620385 347-cikarilmasi
2,422,396,136 *FFFE793565F3576523DC37962D22EFC595A6A580 3485928d874f34d1afbf55a8957435f4
2,422,396,137 *FFF4290858A8416AAB8F2EE3A7FE958072CE4D3C ELZF4
2,422,396,138 *FFFAD82A15380D667692D52E4D568C8CDB6A8802 EMILY KLEINHANS
2,422,396,139 *FFF495646AAAFA3F658A0397DD2A7CEE32A291F2 EN8811021827
2,422,396,140 *FFFA4E2B528262FF358A22B1078463BFFD5BD91B enochstandring
2,422,396,141 *FFF919BA030E6B1110C5495C612A0FD26E491DAE enodsim2
2,422,396,142 *FFF744692FA8ED826B1D13C473FD2A99622401C3 3ILOVE57CHEVY4
2,422,396,143 *FFF12311E4DCF5D38FD48223824810FAD3F4AD1C 3ILUVMURPHY2
2,422,396,144 *FFF1171D97FA7323E34DA6D0D09454AD269D76A6 ENVVF
2,422,396,145 *FFF809130B6182EB38D55C989D74B22EE8C2ECEF 3NOTSOMINOR
2,422,396,146 *FFFB3E7C6B343BE08638479A6E8EB77287E92CA1 EPQ#P
2,422,396,147 *FFF383055DF4545CF3CF22F5130F69B994CF39E8 ERITSONS
2,422,396,148 *FFFA7F99E057513F3696299C072D4F1082EFB395 487388 sUtsindiriminderolalIr
2,422,396,149 *FFFD357CC8044BB5B088BE34B2CB8614A7FE1CF3 4AUSKLINKEN
2,422,396,150 *FFF9E7435002F2DE3D8E6D8934D308AA5E0C950F 4-B's-Motel-Reservations-Only
2,422,396,151 *FFF5B54EE4F03ECA41C192AF21A16E4670A26EC0 ETAXILING
2,422,396,152 *FFF1E884AEFA2D9C9759FD11A5BA0BE1C5AB2239 eutelden
2,422,396,153 *FFF2DA53F8F2010106C8FCA70D3F089273B70ACA everetthooley
2,422,396,154 *FFFB5B7F90E4C2DF44BEC82864CFC90F84395891 ex-aunt
2,422,396,155 *FFF8A06E0DB87E4B056ED3CFA9158D40B511E358 f0r8da15
2,422,396,156 *FFFDE53E170C41EFCC7DCDC67793D03AE6724E89 4 PSYCHOBABBLE
2,422,396,157 *FFF6A24372A867CD7ACB7ED7B3929FB58504E672 FEDERICO.PREKKER
2,422,396,158 *FFF4130FFB57D5741B4E458164A0358DA7007202 4SENEKLA
2,422,396,159 *FFF26D14291154032654631A207427CF799A6550 [email protected]
2,422,396,160 *FFF2F4203BF940E8FEBB3EFA134F411C80E73FE4 FERMIN.ALLDAY
2,422,396,161 *FFFBC2865D8D40EBAD4C9C6661E2DA6B58BF954E feuda115t1c
2,422,396,162 *FFF2701634FF6BF5228F10240505BBF4C21946E9 519THALIA
2,422,396,163 *FFFC4CAA8FE44D1DDC91C93B0CE23B44387E2041 [email protected]#$%^&*()
2,422,396,164 *FFF8BE019E2D7990B07D5E00E9962560E5A11F83 568658 "UNDANSTECKEND",WIEMUTTERDICKENSERGAENZT.
2,422,396,165 *FFF6422E0FA8E7C7A5626FAA96DF8E7AD1FEDB0E fireretardant.bizwww
2,422,396,166 *FFFBE3FD60D8492E456103A1A513AB0F912AFD2C FIRSTJEFFRO77
2,422,396,167 *FFF99966149BA78B30D8BA9623060B5AEE4FCBDF FLORENCIOSHINABERY
2,422,396,168 *FFF4581E62C48E54B432688746E10D1D3D10EBF1 FLOWERS.ON.THE.HOUR
2,422,396,169 *FFF36F6FF746B960BFC1D9FB36D447A4E6A5329D 5.debler
2,422,396,170 *FFFD76F596FE1B0B049FAB8BB52AB797CB42F060 FOLAJAYED
2,422,396,171 *FFF4BA983308EBF7F21B9E8461C58A8C83BE2681 FOTOGRAFOBRITANICO
2,422,396,172 *FFFA5CC75E6193F08CB0B3AC00D8A3546182C546 francescoskowron
2,422,396,173 *FFF2A3F94C1A183E37AA2C79DBC8EB2A7BBE005B 5kurallarca
2,422,396,174 *FFFA7941BA0CBF5B6890A20011BB53528CFFFFD2 5METASXONTWN
2,422,396,175 *FFFC4158BD456F030F65BD05E38E009C1B395269 5MIKRODATORERNA
2,422,396,176 *FFF0A8E5376729A7BC211F032A9537068EF26933 5PHILALET
2,422,396,177 *FFFC39FB4E2EDEFEBFB42987712E17479C6B0F25 5SEANSPAIN
2,422,396,178 *FFF2AE76E4B3F54703135810BC2EBD1B4F6FEA66 5STEPHANIMELANIE
2,422,396,179 *FFF2C2829188D3E80CD699D257E00307C232B1B1 5tabulable
2,422,396,180 *FFF1E922B40655E8251A2A227D7039E4B701033A 5TY
2,422,396,181 *FFF8846A8F1B560DE76DF9AE943B6D7DD32A027D FREDDY.STINDE
2,422,396,182 *FFF363ABC1F614385B2B94F5E3E7F27AAF9FEF15 5XGREPBSW
2,422,396,183 *FFFAE918D77413B848DC072E696926A66B6640F2 FSISU
2,422,396,184 *FFF1CFB945DE6B22FCD5B3EEC70095F9826EAB2E fskoppen3
2,422,396,185 *FFFCF0264D19230128ACF31F5680D99575109197 657lane
2,422,396,186 *FFFF8E43326D16005CEFC12645BEB6C1A7571CFA [email protected]
2,422,396,187 *FFFB019DDF12AF19F78A5DF36B0DB49135EC0775 gabrielgroshek
2,422,396,188 *FFF5130E665E1E9E5B46D74E00EE9D120719932A GAYNEAL6
2,422,396,189 *FFF897971491566BC7D9173866C8DE556EBBC49A GENICHIR
2,422,396,190 *FFF3FF2B89F40485E0A68A3364DFE467CF6F83E3 6CAMPBELLHANSON
2,422,396,191 *FFF2AD6ADEACC1106BA3B706AC997089AA6E8AA6 GERALD.BARWELL
2,422,396,192 *FFF2AB2B643CB933010E7FC51059A9806FE6DCB5 6ETWORKEDBSW
2,422,396,193 *FFFA8445D52573D2AFD01AED2CD03161342A5A25 Geringf
2,422,396,194 *FFF21E3FE28C377C237D54C1FD7BF0604CE1A697 6.kysyjille
2,422,396,195 *FFF75083B2E2D18CE1064E623157CC9A342815D5 6multirole
2,422,396,196 *FFF213980516F9F9DB3B9638BABE8D54D8D9519D 6rinsaviamo
2,422,396,197 *FFF7EF94B221E8E8FA417F952A323DE879C0AE0A [email protected]
2,422,396,198 *FFF77824AC94F649E491220EDDBA6BF23F4EE4EE 6TILATILA
2,422,396,199 *FFFCF80E5A128C7A9C5848827FD0AA25D79584B4 6VESPERUS
2,422,396,200 *FFF0F9E132803EFDF6C030A59EFAD9572A0F4659 GRAFSERKE5
2,422,396,201 *FFFA081D4D2B72F71429CE09555B37480853689E GRAHAMFLITT
2,422,396,202 *FFFBE5597D3782DD7FE2272BB6BE3F3D5F0ACA83 GREGGBIENIEK
2,422,396,203 *FFF36C7E4AC23D899414DD17CD4D4B8833ACDCA0 GREGORIO.GUNTO
2,422,396,204 *FFFDBCB1768D9C08BF9CAB6CD4F2E821C5886DA4 gregoriohollowell
2,422,396,205 *FFFD638AB170B34E2D3F655B53C2BBAB061289DB GREGORIOSAWCZYSZYN
2,422,396,206 *FFF34904A66DF2581913D0761EB0871796999A34 grundaused
2,422,396,207 *FFF74D464D9584C4CEB5EC01D122E367ED5AC602 GUESSALLO5
2,422,396,208 *FFF0E15F9E6E79B64BFDE1C6308EFA44FBB178C6 GUILLERMODACEY
2,422,396,209 *FFF68A9832F7E010C15BB4CFB7FDE14874829110 gwnl
2,422,396,210 *FFFCBB5D039D50F8DE8DA390A7DEF705571F713A HARDENSVILLE
2,422,396,211 *FFF56A86AABB0C977A12A69DA135C209F59BE0A0 7NORDNORDST
2,422,396,212 *FFF06F4BF1EE36FF83E2D45B5874913F7C095BF7 7ORERTNE
2,422,396,213 *FFF17F7C2BB9C8FE7964E734BA20DF6470E27150 7PATTAFFY
2,422,396,214 *FFF4E9073B9A136D04255DB8B7FD60607C32407C [email protected]
2,422,396,215 *FFFAB1FF48DCD1C2A784A44656B04F4E11379BB1 hatelijk!
2,422,396,216 *FFFCC8A11F950C220C3FA575EF11EB343F87C4FF HAUTGARONNE
2,422,396,217 *FFF92E27A83E8DC1BF61C91B63736B522EB73ABC 7XMSSB1194
2,422,396,218 *FFF5728A5DEF361AD4F11A0190BC96465AD82334 86M、2段目1
2,422,396,219 *FFF54A2E079F26FE831792B4C4760CEA1FC179EA [email protected]
2,422,396,220 *FFF10CB18CCA1F6DB58B38647BF3AAFB02E59116 8BLINDFELLEN
2,422,396,221 *FFF4B0CE1B1490C2B98F70E891984974EA87CE14 HER-(METAL-ON-METAL-INSTRUMENTAL)
2,422,396,222 *FFFA854234CA7C66FBF6473909211820CF993D25 HE'S.A.PIRATE.(PETE.N'.RED'S.JOLLY.ROGER.MIX)
2,422,396,223 *FFF647EF43020CC06960E6E3E73D8E4BC75073D6 8CLIPMALL
2,422,396,224 *FFF91892F2824FFA31F947177429BD7DFE34F346 8CRAIGSNICKER
2,422,396,225 *FFFAF00A66A43A321376BE2E62B8A7862AE7EFB3 8---d.~0.(>_<)
2,422,396,226 *FFF513B149248E62C04DC9CB600858B886C43481 HILARIO.GILBERG
2,422,396,227 *FFF5DA919232B3D3ECCF0FBC58CFD8AD366DB357 HINDMMERNDEM
2,422,396,228 *FFF5D1A0BD6FE4EE8DBEC6FDE8C5EB52EF208D52 8GERFULLUFREG
2,422,396,229 *FFF8E3BCAAC34510131B167A1CB04ED5B33B76FA 8GUILLERMAN
2,422,396,230 *FFF172109F558D804AC43F1FB4037AD28D4A3B6E HJZWAA
2,422,396,231 *FFF52C7D48977FCD575ABB95B87593D8EECDB9B3 hkocsry
2,422,396,232 *FFF9550B065CA0A9AA86FB728E2AEA112186FC92 HOMER.MUETZEL
2,422,396,233 *FFF9C6E31F7B1A7018E72ABD8F1F1F1817C42648 HOPE-IS-FOR-DREAMERS
2,422,396,234 *FFFDBD29DDC797B24DF901DE700C7C5B4369FEF3 HORORH
2,422,396,235 *FFFCBA249DC2FAD93AFC72743FAC95ECF6F6F486 [email protected]
2,422,396,236 *FFF4EE02D3A0B240130D8AA02EEC104D5AF90DAF 8=====>~osplat!
2,422,396,237 *FFFC2DC0FF785B1B976274E2257886D17417C12D 8SIGNAFY
2,422,396,238 *FFF6ED5648AACE833DF5CB5E7EA567A3CBE6AA6F 8TAMPONA
2,422,396,239 *FFF6DC1317ABBD7F39E5A6868B305D39AE7906EF HRBATIM4
2,422,396,240 *FFF4C0E27C4CB7BE4D19A12F058DC36EEA676806 htednuobbing
2,422,396,241 *FFF3A7FAC88BEB271F6424F31D17165C79FC9F89 [email protected]
2,422,396,242 *FFF604F769925C29C15DB67B712B434FDFB847D8 955141 ALMA-46:16-JA-SEN-T
2,422,396,243 *FFF55725D1D6356BC1048238687EA2CA6037BA33 99390 kieli-alkaa-kehitty
2,422,396,244 *FFF8C58C4724A029AF83544928172E2DCB14E329 9BSWCANONSTRBSW
2,422,396,245 *FFF56C20699810020AE0E9B6ACF3A031B5E153AC 9BSWDATASOURCEBSW
2,422,396,246 *FFFF281D037D5A93E097737D8C9DE942E70091A8 9BSWGRELIAINBSW
2,422,396,247 *FFFBB833E51163C33005E987AA51F01B2163E7C9 9CFIDUCIARY
2,422,396,248 *FFF7E7CDE3D80CB3BA8EFFDFA222F8CEA3C12D34 i6z
2,422,396,249 *FFF93B1184C5999176C1839B638C88CFA642BC5A 9IJBUTLER
2,422,396,250 *FFFACC5DAB53B051753BDDEB1A261A00D48761FC IAMSPARKS40
2,422,396,251 *FFF6DCC27357A4CAE90790592D75B6B17289E75A 9PEACERAIN
2,422,396,252 *FFF51C7119BBF3D88188A38EBA0390D9653D56E9 9RIBKCOLB
2,422,396,253 *FFFEFAE6DD7E596DF021CABB361532290ECB6016 IKINGABY
2,422,396,254 *FFFD374D7F86E33D815929B80AD4670857AC3993 ikwv
2,422,396,255 *FFF49CE663F10FBB7863FDF5D291603A05592A14 ilovemariposa60
2,422,396,256 *FFF29AD4C76F436B9F331187F551A272404392A0 iloveshanti2005
2,422,396,257 *FFF5C38C0442C973417BAC869DF246C046F08092 ILUVMUSIC94
2,422,396,258 *FFFA842185FCB2A75C27568655F85A97206AEB39 a!,5m
2,422,396,259 *FFFCC4FCE09A02FBC7B60F3B772796339266682E inglig
2,422,396,260 *FFF10B03ED522212F693E33F9204962E12C64349 A9O,?
2,422,396,261 *FFFB07FDBEB791F6234819757F0557B15F0E5A09 ISAACSIROEGBU
2,422,396,262 *FFF1D552E5E62F90A33F5E6C1209129EF88187F2 AAE;+
2,422,396,263 *FFFC6425256D03AC5DEE449F656CD14DBAD032BC aanghel
2,422,396,264 *FFFE9CBA084C7EC54E6BE0B398FB0C70005C41A8 JACKIEFELBER
2,422,396,265 *FFFE1BB0760B056617FB7274278DF06C1C39F9F2 aa\zq
2,422,396,266 *FFFA827F7E24108C83C2219C2DA0D520D5FA859D ABCDEFGDONALD3
2,422,396,267 *FFF3FB51302E35967D5EAA22F3837AAFCF1D6805 jalajakk
2,422,396,268 *FFF9EC296D1D88697DB2917BBCD5A4A096858E4C AB$;N
2,422,396,269 *FFFC2E1152B3C92167F742C1E4BD682E8F03D032 abx|s
2,422,396,270 *FFFD3EB55AEE37184C717716EEAFBA2411056666 acanthocarpous7
2,422,396,271 *FFFABA9382C43C80351CEE66C59F4818BD30FCC1 acc5u
2,422,396,272 *FFF39AE50B0E5F2B36C6E7284C54449D9A33D358 jde\
2,422,396,273 *FFFF6882BECED40F99A551BBDCA081B062751F5E jeffmarmer
2,422,396,274 *FFF1E2768EF6020FC7A1B5ABE27BCF33781C5858 JENNYJACE
2,422,396,275 *FFF2627F6ECAE59CCCB0E229C726AD80864F1E9C Ad"H
2,422,396,276 *FFFB1DCD2C60BD2F584D936FF77ADC9371D2AA67 jeromyzarek
2,422,396,277 *FFFBFC91F794F74DE953A19F7916297F3A786F22 adq%w
2,422,396,278 *FFF1A6FB84225E78D0DEFEEFF5840DCA62A6F206 JESSE.MACHEL
2,422,396,279 *FFF8C4E35CE2452E07C2B9CAD20CBF9D0431CC3B aee2%
2,422,396,280 *FFFB2D40FB6DF8AD86E539B707E070D9834B8B56 JIU-HAO
2,422,396,281 *FFFEE49B54D20D0952F0783A61BE9CF1E1FC273F a:go5
2,422,396,282 *FFFA7AAB725E3AD32337163BE25EE546D079319A agtzd
2,422,396,283 *FFF250286CBBDE463B3061DE6E7143F8DF458EB4 A_I6
2,422,396,284 *FFFBF4ACF0596726931C933015CDAF4C36112E7A JOVANNY842
2,422,396,285 *FFF6A82BFC2CAA5EDAA6276652FBF486665D00CA akkisnij4
2,422,396,286 *FFF41F27AEC7A517A6B6CF2D7700CBEC87FD4ED8 akoz,
2,422,396,287 *FFFEF617E46D3F999E89C3AC1EF12B8F6F2D3B6D Al3T
2,422,396,288 *FFF48D434B2725151C962D6FFB37FBE1A6A9BD19 albudget1
2,422,396,289 *FFF8318D513990963BA45FAAE3D1161243C45DCE AL#D;
2,422,396,290 *FFF02EB7C9B4B0D30D34CF9E78E0D467BD5B3F18 ALEXANDERRAZORENOV
2,422,396,291 *FFF40128769FB183058BE2A3128614B477CBAFDD KALAMS
2,422,396,292 *FFF7ACAE8A346435F5E39B6C66B2744FA6952C1C ;]KB
2,422,396,293 *FFF29549C760912D5614C66D257D797D5CE5EEA7 alpb9
2,422,396,294 *FFF834AD04B5DC383FDE016C628D98101A634B82 altonsanjabi
2,422,396,295 *FFFCE4E65A8AEE4406351732E43E22D2041AEB0B ALUP
2,422,396,296 *FFF320C899CF692E97F86790513F2B4C3A57B1CE alvaromazo
2,422,396,297 *FFFDEAF2A4024ECA34747C514F2E75C52E1FC431 kelvinstrysko
2,422,396,298 *FFFE99AF1621710E301048895E7F4FCEBBB59442 amador-schuller
2,422,396,299 *FFF99003E78C8ABEACDA19E52FB9CA83431AF7DF AMANALONE(1)
2,422,396,300 *FFFFA55C5103D6DC797898C83D2CAFBF91D4D756 kenthuft
2,422,396,301 *FFF102EBCDD2BF6216EB0CD51FD4166550E08A2C KENTONYSAGUIRRE
2,422,396,302 *FFFA313E88212AD23372F9B11118FF37D31579C0 [email protected]
2,422,396,303 *FFF95236D152E060A6486CD520393B09963D0811 kerlange7
2,422,396,304 *FFF458442560F6D8CE30616BC692E0F6FC5517A7 kimhalward
2,422,396,305 *FFFDE6F80FCFD21CB4376ADE63912C61AAB6BF99 KINGKI20
2,422,396,306 *FFFD8779B8E3602124BC92069CEA097BFF079DED [email protected]
2,422,396,307 *FFF0BB9C8E002E9CF17B53147793A69C4B0EBE3B k!ng1!35+
2,422,396,308 *FFF5D49B2FEB11102372F3114A55FE0109C12AB9 ANDRE-BRITTON
2,422,396,309 *FFFEF9F57C8F0E3E7783F921248A4BD9C1091162 k}np
2,422,396,310 *FFF2A062607345E93F7BFB17E79E754FE5093A43 angtu
2,422,396,311 *FFF330FF6DAA97266880F01D7ECE572EB571DCA4 ANTISPAMMERS
2,422,396,312 *FFF631C675CF86A123D0C5BDEDC6412FDA782BDD ANTONIOMANNSCHRECK
2,422,396,313 *FFF8D6154438167D7637B2F384C94E8FCC40330A KUDEMISAKVAARIUM
2,422,396,314 *FFF0F3864C6499781F2DFCA516F2227A1F338DC2 [email protected]
2,422,396,315 *FFF2ADA6CA5A6C9CAD91999B87EF851A507F4282 [email protected]
2,422,396,316 *FFF8751F980271CB683AE9EBD300BA01F0496DB6 KUNSTHANDEL1
2,422,396,317 *FFFDDEF26753017DACA061FD946CD5B65C9E5DF0 apitpat8
2,422,396,318 *FFF6ACB27A4910C4BC38F8C9DC493797034A65B1 LACASAENELAIRE
2,422,396,319 *FFFCB1D7904CA8B1E432CC259BA5091405A29509 APUVQ
2,422,396,320 *FFFDF3BC949EBB4393FE765086CBAFDBDC339569 LANDONGUENINGSMAN
2,422,396,321 *FFF32D5F31D6D7039A00C6553C8F71C7B691617A LANDSLIDE-(MAIN-REMIX)
2,422,396,322 *FFF3E65ABBACB136982631EDBB048A70915E4AF6 LBRASILE
2,422,396,323 *FFF217B35F33B03F215D6742AD360BD3DD3F0F75 arcmap
2,422,396,324 *FFF3077BF1D6BDF8955F8AF42A258C393260A566 LECSAPOLÁSA
2,422,396,325 *FFFA9BB144568B67433C30039BC60EFA0820C373 arnoldkurelko
2,422,396,326 *FFF88782E9B177EDCB45F12A50C19303DECDA8B0 leonardbatdorf
2,422,396,327 *FFF3BC055FFB8EB5034EE303DB5A299C2365D3DC LEONEL.MORRISROE
2,422,396,328 *FFF2D6AD7F6B795A3E1C0B2D9657E557B0B5F958 leopoldogrimes
2,422,396,329 *FFF1A2462835985CBE7A096792F736F61CD4B28C LEOPOLDOSCARPITTO
2,422,396,330 *FFF1A48AA9CC7F6640242909B766D32BA33E7325 A%RRG
2,422,396,331 *FFFEED6B36F4991F4EEE84DA52F8AB139A999449 LERNFAEH2
2,422,396,332 *FFF45ED1C31D7FE237FCF3AE007A15D92BC8F461 arthurlarmon
2,422,396,333 *FFF7C3842E8C532602BF2702DEB832CAB87E855A ASGB4
2,422,396,334 *FFF6A7734EC6407FC673B0F5264CA1D9FDD562C7 [email protected]
2,422,396,335 *FFFE807533E4AF9F1519CDF951FE27B575A2D4EE [email protected]
2,422,396,336 *FFFF2F59AC11023815DF9D2DCC3B6A605234C968 LINO.TRUBEY
2,422,396,337 *FFF602D45BA9E5FEC9804ADD2005D4A70AA3D0B0 athgoober
2,422,396,338 *FFFBCEC88E2BB1CB90802A9F086180DD3EE2B73B atsea[teakhouseroofmix]
2,422,396,339 *FFF8A009DD5D4EB23A5975E12141BC184FEF4FB6 lloydtomanek
2,422,396,340 *FFF5B7115B4B001EB2AA6016EAFE722C3E4E5366 local-news-report-7
2,422,396,341 *FFFBAC7DBB3D65FB708AF81DF809C378E98132C1 louferndez
2,422,396,342 *FFF60D8F4BDF7B2C202BDEA9C2ECA872527A2202 [email protected]
2,422,396,343 *FFFA5AAFA0603CE68705740CF53A7535D69311B1 LOVE-BEGINS-TO-DIE-(PRODUCED-BY-UGLY-ORWELL)
2,422,396,344 *FFF3626B7A2CD169487979F30A617CCD87A5EFD5 LSABAR
2,422,396,345 *FFF55C4B9B0312CC6E45A1E219388083B2B33220 [email protected]
2,422,396,346 *FFFD91C359E602D56EC654513A5D7AA5123D7AF4 [email protected]
2,422,396,347 *FFF011A3D650AC398BF57692EE6871CB30D0E5BB azadhind
2,422,396,348 *FFFD5E1FD62BCDE7FFEBB587C4773DD8E4BEB6D5 aνασκουμπώθηκεν
2,422,396,349 *FFF71CFDA9F5FEF151EBA686B6EF0F7C4690AC82 LUIS HARO
2,422,396,350 *FFF2176BAC62E6005A8B7DC9F8AEBE53B2F70BA9 >b0 * (####8
2,422,396,351 *FFFF489E6EEE4098523A3F0477D60D485C6A62D7 B#0H2
2,422,396,352 *FFF106E1BD47591AE59AEFABDD768CD24FC72892 B19031986
2,422,396,353 *FFFF243A6E9E097D34550D99A476EE46CFFC9CA2 b(1t
2,422,396,354 *FFF9C29455954FE8120322F30D6DFFFD0E7DBF98 LYNDON.ZAKOWSKI
2,422,396,355 *FFF75CA15F5A9D357227BCF83E78DB6B835BA6E9 LYNETTE.CARRUTHERS
2,422,396,356 *FFFBF620CC1AAD3A705D2E19CCBB3CF16D61842D [email protected]
2,422,396,357 *FFF54514C255E1007454519C6807D0FF6631998E b4ckli5+
2,422,396,358 *FFF76539019627ACEC3F7D4C8A66987F91A6E402 m5rh
2,422,396,359 *FFFC10B13C8D6913E3D429DAB5AE17989E4A5C4F BABY.SITS
2,422,396,360 *FFFB208CA6AB28B4185DC225425E135568A45BF5 mak-mac
2,422,396,361 *FFF986341AAD448A705C62B5A031C00FC6F721BE MALACLEMYS2
2,422,396,362 *FFFCBC5D1190E35532FD6252D805F28FFDCC4D8E BAR-CHARTS-AND-DIAGRAMS
2,422,396,363 *FFFC6E6E80221C64177FAF2D0783C9BC099475E0 [email protected]
2,422,396,364 *FFFDE4626360109D6569979D3CCFA97C5DCDDDC2 BARKURAL
2,422,396,365 *FFFFB0E08945FEFF823A814E4188FFB2795ADC51 manualsheehan
2,422,396,366 *FFF670BC0AAD18B49F5AEAED9CF0124F321FDB02 BARTPAPAS
2,422,396,367 *FFF8E2B7461B85F41B33635866E9971A8AC479D2 MARC.BARONE
2,422,396,368 *FFFA5E10D03AFD48606617C2E0D51767CFD7DCBD BATRR
2,422,396,369 *FFF08E97CA5D76C6C1D8AB762142EA13F9D19CFB BBK,D
2,422,396,370 *FFFA93E0C7F52DAAA88ED459FF18DD0C8563DB50 bdpen
2,422,396,371 *FFFDCEE7EA52D4F881C4598B36CD2F580C942F9F MARVIN.FUENTS
2,422,396,372 *FFF50DFEF80AE49F1CCF84D53CE7D807DED3C304 marysockalosky
2,422,396,373 *FFF3652339132D46494E173703FC068A1343B5A2 masoncuperus
2,422,396,374 *FFF6EC728AD9C2E3862BFFD6701ED042C4354F6A BELTLOAD7
2,422,396,375 *FFF68BA84C713516B7C5947389B3293B6E312022 MATAEOTECHNY0
2,422,396,376 *FFF341D75D88D54C5456E45BE3568A658BCBBFAE [email protected]
2,422,396,377 *FFFAAB6A2076FD3B21CFD662F89FE21EA08010C5 me5merize
2,422,396,378 *FFF8588699033525A5033F59511DCC4E96723562 mejeristers
2,422,396,379 *FFF70DC0CA09739114F3E9A871E306A6430A4CF9 MERLINPASQUARIELLO
2,422,396,380 *FFFB70351D70A7E24C2976EED1BAE393C7EC8DBD merrion
2,422,396,381 *FFF311630527B814BFD45D86DCF52F11601934B5 mika-alcala
2,422,396,382 *FFF0DC8AFF3AF10D604D028091E2AF4F17D4FEED MILAGRE8
2,422,396,383 *FFF962474BC7C474C6C7FD20775581B5B2A84642 BITFG
2,422,396,384 *FFF12179B4057E6CFF01488605B7F41518907633 minkins4
2,422,396,385 *FFFCB8651B97A8D2579C62C71BC08C6B300F2EC3 MIRAILLO
2,422,396,386 *FFF3AE2729D86694200A30D3CF7A5C70A53D699A blakelina
2,422,396,387 *FFFAFCD0B1E9C7B73DD8953D8EAE05F8218E88D4 MITCH.HUCH
2,422,396,388 *FFFF172A3A84F8E3670332F201AD32EC8C31FF74 MLOVERIA
2,422,396,389 *FFFA43F16F63FA88D6D7BE860FAE41D01200BF1A moolamoorthy
2,422,396,390 *FFF689383AA36262A0AAF631002C0C1CF3A35CE6 [email protected]
2,422,396,391 *FFF61FA859207F4356B25995CCF175A536DD7E3E MP"A
2,422,396,392 *FFF333126553EEA54AFBEDE008E061CAED722B61 MTRONGDINAMO
2,422,396,393 *FFF2DDF5BC2BE4E31805792F04411E8AAFB37C67 MULTINEUROPATICO
2,422,396,394 *FFF0004756247BAE81B9991039216CA838F8BACF MUVAFIK2
2,422,396,395 *FFF27ABE192C2275EEB099A48F8C3A8E95406AF2 [email protected]
2,422,396,396 *FFFC8F1101AEE1A538DD23CA3BCAD7DDD27A0994 [email protected]~o~o}x{
2,422,396,397 *FFF0FBDF0DAD327806E55E73644F863398296A33 MYSKATE26
2,422,396,398 *FFF99ADAB72A174D36A387CCFE920447649C0069 NAPOLEONCOUNTIS
2,422,396,399 *FFF79CA54A5A8CDE823F1F27E539B3C3AC53614E br6f
2,422,396,400 *FFF2CFFA5CB91ED3608A1AB8C75CFF2C61FED5AA [email protected]
2,422,396,401 *FFF1B0E3C1D4F51C20A9A88FD62A419DB640E90C NDIVOMAFANG
2,422,396,402 *FFFE2BEEEC7A9AC5578CEC6D10A8F89499BCD838 netBloc,.Volume.12:.Anaxagoras
2,422,396,403 *FFFC86E74A903F986D5F18D613BCAB367AAFB52E brentyager
2,422,396,404 *FFF932DF0EACF6EC16A5E01603A8FB369E50B493 new mind (acoustic)
2,422,396,405 *FFF36CB9258D809C9FD2B2A1A02599B353262894 ngschrn1
2,422,396,406 *FFF45C6DE37B00B5F4A4B0BE41CF254EBAF7F1FA NICKKARCZ
2,422,396,407 *FFF73B36E6EAFD8A369060789FA897EACC1ADBC3 b-!ta
2,422,396,408 *FFF5E593599B6CBB4FEE229EF5B63DE3FD5DCA94 no-sirree
2,422,396,409 *FFF343097FE17135FF90FAD6542CF3AF8C94225C NRANTA
2,422,396,410 *FFF1E052E1C67E0BFCB33DBA5C04F75FD3FC3442 BUKLH
2,422,396,411 *FFF87D7D1A785810C5F91D1C937722A3E21E3A6E NXOVZZIEQ2
2,422,396,412 *FFF42C4E5E4C7BAF47DE32B1C3D8B2B862308ABD burlmachia
2,422,396,413 *FFFECCAD3E0BA96EEA8BF976876E7B91CDA17D89 OARTOQFMAA
2,422,396,414 *FFFA68ADCE7E727F4459F2776A58DEDC70ED87E9 BV=EW
2,422,396,415 *FFF5671E3844D8E5CE005083A51E0E63C8B60F25 ofelia-loret-de-mola
2,422,396,416 *FFF095882DAEF20A65B299ACA7F6A4C5D00D079F OFFICEFORCE123
2,422,396,417 *FFFC75248C8B88C8022A48F1F95414A01F846CF4 BYB!M
2,422,396,418 *FFF4BA5211D24824B6ADF811820D4F5CD1FB982B OKAMENIMS
2,422,396,419 *FFF8BCE2B36DDFED6AB10EC0E2AD49DD4EEF6E86 }o{.o~0~q--b
2,422,396,420 *FFF6A6DC3B90835CDE48D2D45D7B09C0CEF319A4 o><~~~(==P
2,422,396,421 *FFF2CA8ED341C4B61EFB90F86A7058733D2E0F99 ORAT
2,422,396,422 *FFFA85DD37DF09DC2AE38C614FFF9FFE0BA8F6D1 ORGAN.CONCERTO.IN.C.MAJOR,.BWV.976:.II..LARGO
2,422,396,423 *FFFBBA96E48C23713B1DACC36EB2967BB2F65B53 OUTMARRIS
2,422,396,424 *FFF9A789C1909A744BD0A24759C9CE011FCE0FD9 owehmir,wehe!gkeller
2,422,396,425 *FFFE020B06FD482D633CA66F2455F0AEEFC1AA12 p3rc3pts
2,422,396,426 *FFFECEED2899AA9DF1E85ACBA1B63860F3CCE9FB C9Q8;
2,422,396,427 *FFF134F0F76D2D76C56BC19BCBBBDD5A9DD9D578 PARVENAI3
2,422,396,428 *FFF6D7A9BF893DFF721753ABB69E694A193DE138 PAT.AUBERTINE
2,422,396,429 *FFFE5195AED3977D3F1AA82784286FE965A23420 ÇALIŞAMADIĞINI
2,422,396,430 *FFF6D88213D11EAF04D8FE3CEF94BEBAAEFD673A CAMINODELUNA
2,422,396,431 *FFFA3D8DF3FE40E25CBA225CB2F694DBFA063F0C CARISSASEARS
2,422,396,432 *FFF13353FF2B53C60CD828BAE00577283F9D526F PERRY.WITTROCK
2,422,396,433 *FFFC9483DF6A37559A71477D9F77FE79EBC8C26E carolynpelfrey
2,422,396,434 *FFFA6E14418B6DC77639E2239685F932A6B37139 PETITE PIECE, 1910
2,422,396,435 *FFF0808E22DD9C471AC6FC8784B1F2235F91173E pissing about
2,422,396,436 *FFF86C65F0875A8836E440BD774A872E0D1C0FD0 [email protected]
2,422,396,437 *FFF952693B40C11015C1890F6D681EDEC3195C6E PORTER.CHENOT
2,422,396,438 *FFF27105AA367F65B5AFF3D814BEE15866561FAA CEDRICK.BERMEO
2,422,396,439 *FFF74C1DBE1C49F2FB269BAC0799580F98B9A01E POWERWHICH
2,422,396,440 *FFF88F8C7A2A1424EC89E0DE6CA6EEBD2AF7574E p#p~o(O_)
2,422,396,441 *FFF788CCE2AFD79CD5BF4B96071000B84DC380FB CHAD.EVISTON
2,422,396,442 *FFF65F96C841D2316D959F6DEEFF88997AB9B692 CHALK!E57
2,422,396,443 *FFFE6ABDA53FC928CD789FF189086FCADF691207 priesterwijding!
2,422,396,444 *FFFCDA02205E7B4BDAE093B70D5DDE85D9CA933C printf("CurrentUID:%d\n",userpageu_ruid);
2,422,396,445 *FFF9DBC6DCCE52608016CEED93B65568B1DE7823 priscillasusanfalknerbury
2,422,396,446 *FFF4E2628E29BBD65B8186C0D7E0652695126544 CHARLEYPEPION
2,422,396,447 *FFFD97E0BA32F4035ED343F23F1EF2F023AC5288 charlws
2,422,396,448 *FFFBDF32677D44A04B0C20A7D268CF7AF994B52E PROGRAMATZEARI
2,422,396,449 *FFF13DF22EA20C27E3FA25252F47831AB7E12F3A programi-1
2,422,396,450 *FFF44E8EFC8FBDC55C6D2C44777EAE93E694F396 [email protected]
2,422,396,451 *FFF3D8E01A86EB078968CE450C1EF4C18FE9BC7A PROPPHURWITZ
2,422,396,452 *FFF9E04DB331F4FA7A396B64755FE731BC482BED CHEGUEVARRAZ
2,422,396,453 *FFF944C96654FC30D0078BA0CEC6A2A578B47CA3 PRSTLVLR2
2,422,396,454 *FFF9755AF8A152882C4BA8BAE87B761772AB3FFB CHI.LAURENZA
2,422,396,455 *FFFDBF7921CA33B8567BC48A1467750751FF98B4 purplehaze(hendrix)
2,422,396,456 *FFF1A9A1B1C0660E48D1E035E15126EF4087FB40 P#).~.}X{
2,422,396,457 *FFFCB1502129DA327392B97D6B16F69FB167268D Q###>-*-*-(>_0)
2,422,396,458 *FFFC994A36AF5B024CA5A19741C881DE145402A1 q--D`)8(
2,422,396,459 *FFF58D8713A734DF43563D1AAD7F5EBA1C71E473 [email protected]
2,422,396,460 *FFF934D1B45334087243C63120B62499F7976A62 christophercadorette
2,422,396,461 *FFF4BC02957BC58C31705F3967F8846E4852EF82 Q#P~O.~O.SPLAT
2,422,396,462 *FFF9D50068E0C32C7201C5579574CF0D831609B7 CITEYEN9
2,422,396,463 *FFF0703839B501BB52A6495D1704F2CFBA674465 CJCOP
2,422,396,464 *FFF09C70EDF2AE70CA28E595A22667B40F4EBFC8 CLEMENTROLF
2,422,396,465 *FFF18556508C3F4CA7D25926B6D4B5DB1E8A66C4 CLEOPIE
2,422,396,466 *FFF0EAF44F953AE246CC9013A708A12941E5613B clodridge
2,422,396,467 *FFFCF13314E0BA23DFAB2FB840BAEAC5A288CB9A radhika.dhital
2,422,396,468 *FFFEDBA9F5FAA5D3DC6256BDFB5BCFEE9DD5F23B RAHULTALPE
2,422,396,469 *FFFAF65F3B72A442A3854D304752E8CDDCC1605F RANDYPARINAS
2,422,396,470 *FFFF148D429176185B4645B9BCE490CE67450CD0 RANDY.SCHWANKE
2,422,396,471 *FFF2A04BB32F01D66E1276E9D5ED5A2281FD8E67 RANKKARIKILPAILUN
2,422,396,472 *FFF4B526457AA94314700CAE7A0B074447C7D66B co11e9417y
2,422,396,473 *FFF87E16F2B491D47CC9CBF23A6200B57D018EF5 coltraneopus
2,422,396,474 *FFF7B7F7A3EC2137249F8BCD593B78A4227EA717 CONCERTOINDOPERDUETROMBETTE&ARCHI(ALLEGROLARGOALLEGRO)
2,422,396,475 *FFFFFD20D764508FA407D6126A6A372121076623 REPLETENESSS8
2,422,396,476 *FFFBFF85E7A8C02B2C82312DBA8F237576094EDD [email protected]@+E
2,422,396,477 *FFFD74B75E116EC389990075FE5D6A1D1AB77379 REVELLS9
2,422,396,478 *FFF6966E938F3D152CFBD5ADA6671FACF9D6DAC3 RFMLJGRV
2,422,396,479 *FFF49415A82B40BE7764291B709981314DA780BC ricardokoeneman
2,422,396,480 *FFF30A6706A3A7B8F5058865576BB07EA02C9533 ricardorena
2,422,396,481 *FFF8C0B2FB2E2F7D1F44E75586CEC5C42E328015 RICARDO.TAMERON
2,422,396,482 *FFFC55427643469B87DB0EAFA70A12168DE6F681 cordellhiggs
2,422,396,483 *FFFB7BC054DBEA66FCA77CE76AA1319BBD839E49 cordellsaeler
2,422,396,484 *FFF51FBC7B9EAB2DAFEC1D0EE553E2F294C14B93 cordon123
2,422,396,485 *FFF49B5C424CE4703139B1695EF6CABD57E5D1DC rileybulkin
2,422,396,486 *FFF135B1C3AB2325C48E73D885375107D5331E05 courtneyhurrle
2,422,396,487 *FFF97A0F05862544EBCC3847E3BFE819DD1F3EA7 RINIASTATE
2,422,396,488 *FFF574AAE4CCCC63A2D9F7AC9D3B4182DAFF43C0 CPHA
2,422,396,489 *FFFACDE97AFA31A84747346F5C9EFE6FF4E87995 ROBERTO.SIGNORE
2,422,396,490 *FFFCD506AFC47E2A693BA04AC323CC53773C7B83 c:\program files\common files\adobe\help\he_il\bridge\30\content-hyperlinkscss
2,422,396,491 *FFF9F95BF2873436B020A5152DA2CF9230961D54 RONALD.KAHN
2,422,396,492 *FFF4A9E30D78E1549D0A487190BC9D1DBF3096EA C!Q9W
2,422,396,493 *FFF1B36B55A341E3234189CACD9342E04C616937 rosienaomi
2,422,396,494 *FFF0A2BE1DF91A3D7050B63AEABABE8D27E91EE3 crayoner6
2,422,396,495 *FFF0C27DEDC0028C24632D8C67F9329910980344 CRISTOPHER.KINOSHITA
2,422,396,496 *FFFD00821509D92A43B6C753995644E13332BC7C CRITICAL CONDITIONS (REMIX)
2,422,396,497 *FFF997FBCECCEFC0A96E5B231972D470149C3FCB RUDYCARILLO
2,422,396,498 *FFF101B1F1AF036B77F3E6629D83DE375F916B00 RUSTYKRISTENSEN
2,422,396,499 *FFF092FE100CD7CC9D4F6968BA0385DD40125B60 CR$QY
2,422,396,500 *FFF6596D235E8151395C6122A1F4C46B29A7E8A1 [email protected]
2,422,396,501 *FFF4FB3C26F5CBBB4D02075E5E1FD2C1AF4CC009 SABRINABINA67
2,422,396,502 *FFFF7A6752C4E8E755648585544C3A5A57BB8169 c#t_2
2,422,396,503 *FFFAA7A09C540BF4A2C2400F0A8BBBE00005E541 saifullahkhalil
2,422,396,504 *FFF5DFBE98D97064E14E8F9BB042F6371F9586CB SAIRASSI0
2,422,396,505 *FFF96555BD0AA79839E5BB5139B4FE9BD75596EF ctmdebrie
2,422,396,506 *FFF3ADE19C50E10AB174E338E0C9532FA9732B55 SAMUELTINTIN1
2,422,396,507 *FFFB4748C406ED071661C76B301752CFB5807F56 C"UU
2,422,396,508 *FFFB990AF28057F3BC8C187BB2C2C0BD7CC39CBF CVUTE
2,422,396,509 *FFF336D1EB324C87767A8DE1FEEA203A6D04793C [email protected]
2,422,396,510 *FFF4AA70D6DC27D022C9C0B46B6E5B359FCCCC12 SCAIMANCIE4
2,422,396,511 *FFFC51779982DAB7BE96CCA50362F58445B2B65F „SCHLEIMFISCHE“
2,422,396,512 *FFFBC98D7D102C2B03933B1E6CF324805144887B scrppnny8
2,422,396,513 *FFF1FAA3DB0A065A53E3E09A3BE4DF28489C9619 D(%/
2,422,396,514 *FFF059FC05437FDE8E0445C90F6D795F93AF4C13 SEMIFUSIONS
2,422,396,515 *FFF42D941DCF34654BA46A388C08F73E0D82D306 SERACIXOT
2,422,396,516 *FFFD7F2A293F857D59777257F4B74A53025B39D8 ŞERHI”NDE
2,422,396,517 *FFF5767D05C07AB8811A1F1E7978C84046BA1E08 D6.YD
2,422,396,518 *FFF509FAF2A8241F29970757A4BD109C9BDA61C0 D8"N
2,422,396,519 *FFFEA7EBD1DB93F340AF2AECB80108FEF19D4B22 [email protected]
2,422,396,520 *FFFFEE2A336293EEEBAC4381FD855E4E4BEF4515 SHELLEYFIREBIRD1
2,422,396,521 *FFF25A549D71F01709229157D360007F5189B104 [email protected]
2,422,396,522 *FFF5DBDA679811A995C6AD734A552ED95E6E13EA DANMORTENSON
2,422,396,523 *FFF4FF32F0F3F69D41D18E23A98AD219D0BF63DC SHIFTINGCOURSE8
2,422,396,524 *FFFF0573E5111947E08AECA971C8E49C1293578E SHIILAYAA1
2,422,396,525 *FFFFEB931225A0EBAAE1C42B4592B606594284DD SHOKOSATO
2,422,396,526 *FFF516B459422D4737AB2923833EEC2AA9824736 DAS FEUER AM HIMMEL
2,422,396,527 *FFF882E1C16330409CE2A67217FE3D3EAD498E32 d(awt
2,422,396,528 *FFF5DC7CE4126880ED7E6C9D3204D4D5F2415131 DCC?Q
2,422,396,529 *FFF1C162DBF0890E00C0DF9C0F02644DE8764060 SMOVEVA
2,422,396,530 *FFF2DE22B85001132922B79E4E1F82516F96EC4C SNUFFYDEMING
2,422,396,531 *FFF328FB1161A9401CC94466C3D72BB22A016BD1 [email protected][email protected]
2,422,396,532 *FFFD5F24107AC96E8AC90A30DBDCFC2FA8EEEA03 DEHSULB8
2,422,396,533 *FFF407D9A04137EC0430A9309055319DA27D27E4 SON.OMS
2,422,396,534 *FFF96292B935F1A18D904B821614A56F0B0C4BBC DENISTY6
2,422,396,535 *FFFF5A6694001A71FFA4458C98B039D49E5BE205 DENNISLEGAARD
2,422,396,536 *FFF3B0F0BA8B9B36F37E917FF0DE789DA67C3501 SOUTHWESTCENTRAL6
2,422,396,537 *FFF3F212ABEA01382066397BE6315309636213D7 DEPOSINGS2
2,422,396,538 *FFF3BF6009059C7980B74D0812B1E1274413F99D dericklapete
2,422,396,539 *FFF331A5EBCEC24D0ACBADD08242DFA027D92E1F DESMOND.FRIEHAUF
2,422,396,540 *FFF600C83E0A8FA05BE3BE0BDE2B44E8DF2A1ED9 DESTROY./.ALTIVEX
2,422,396,541 *FFF52416E1AA33590116131085246B4A81A7EC06 DE)TX
2,422,396,542 *FFF959B7401D5198CDA75936A3C0C08D8D0334EA SPLAT!!O~ 0~Q--P
2,422,396,543 *FFFA0CB671F41FAFDC0CB8413476AD16773F2349 DFWUG
2,422,396,544 *FFFBD539CBAA3A72887B39E7AB3B9E6543E4B0A9 diamora1
2,422,396,545 *FFF1263ACC5AFF9EC6B78E93667C133DDA40302B DIAZPADRON
2,422,396,546 *FFFAEB2CAA843D3E190087B21C4E34FB00725449 sselevol9
2,422,396,547 *FFF76CD59ADD20228E0B1451D798A8E0C450F2CC SSENOSOIRTSUDNI
2,422,396,548 *FFF6D1A0248FF56006D3DA036D72AA8A9543DAB8 st4717
2,422,396,549 *FFF4C5546E378966D68BF44E32CDB86E0CB2D972 [email protected]
2,422,396,550 *FFF67527E7706AE0B209329879DA9182FA857CEF STCOPYR0
2,422,396,551 *FFF11D2DEE9A2CD1264D7A1B9E4CACD595326E8C STEMPELF2
2,422,396,552 *FFF34F49E50491B90FCB9DC68345D250025B476D [email protected]
2,422,396,553 *FFF257471AFC900A2F5556960FF92B33A5231D94 sundayass
2,422,396,554 *FFFBC50469D84687DB69075253183A016ED08D9E donnsiegel
2,422,396,555 *FFF67105DB7F641B895A428C34650481D5603755 s/uo
2,422,396,556 *FFF50375081CEFCB4DBB0D140DA01FDFFEA85845 [email protected]
2,422,396,557 *FFF1D1BADDB0A8172CF333A795076050562A90BD swaglike
2,422,396,558 *FFFDE0456F02D1D2EBE561F4390B134D56C780B0 talkiest
2,422,396,559 *FFF373B0D318ED260283B1F0939454C17412860A [email protected]
2,422,396,560 *FFF1CF8E1213E2D080BA9515FCA60E956FB4C815 d/-q:
2,422,396,561 *FFF317A121C458388775AB9B2E55D5D4E079E681 DQGKN
2,422,396,562 *FFFC601995ED2E2FA6D10B14D23EC5DF66DAFC3E dq#%p
2,422,396,563 *FFFA80F63DB0D9B6D3813A753189A2C7C291C28F dqvi6
2,422,396,564 *FFF5F4BC7BF63693D922B16572A5650F1CBC16E6 TCGCGA
2,422,396,565 *FFF92C63F69A753A1513C5150BED71BA2FF252F8 TELECOMHOMED
2,422,396,566 *FFFF82867968D6800178A26B3141BBD5D2DF230E TELLERMINES9
2,422,396,567 *FFFD48913D00FE69AA21D6D496AC17575431FB14 tenika.lassiter
2,422,396,568 *FFF48F48D65393FEBB2ABA4ACE5E536C756A10E0 DSUBW
2,422,396,569 *FFF16F70A2469ADED02C1EB0C0F86D71B6A4E5A7 dud?l
2,422,396,570 *FFFE6D58AFB3AACF06358A5AD3DB23DBC2F19D42 dugahole
2,422,396,571 *FFFEA7D3A89ECF64E0D6AEACBFE32D9A52DCD7C8 TEXASJONATHANS
2,422,396,572 *FFF28D4BDD1F0401C9C62659C2D91197DC40E33D dutchess68
2,422,396,573 *FFF35917407B7938A343AF40DC272E29FC822BD2 THATCHWOOD9
2,422,396,574 *FFFE5D7C9D9711B772E1184B9D44AD2A65931EFE THEDAYSOFROSES
2,422,396,575 *FFFBC80CA6C9D3BA38FB03F8C716C1D74DE90C30 thephilips2010
2,422,396,576 *FFF65820F41B466D656281FA03D8983B83DC095B thurmanshad
2,422,396,577 *FFF7FD9A0319FF3D2AF9DA699A1161BCABB54D77 ec2lb
2,422,396,578 *FFF5EC1D54FABA4D599A9FCB4F3DAD342331B9D3 TIJDPASSERINGEN4
2,422,396,579 *FFF4FA4B6702236A099A2C767680CC9468DF8BEB edgardodellaporta
2,422,396,580 *FFF3637B4904B80CCF195A75A73B6F3C1E7C14FB TIMMYLUTRICK
2,422,396,581 *FFF5135687B3D1D02C74693C81DADA38984D806C TINSELS
2,422,396,582 *FFF242492802C41DC651591337CF1C78E14930EB [email protected]
2,422,396,583 *FFF99898A95DB5687259B4F38AA8BE3D19483E7E [email protected]
2,422,396,584 *FFF8534D0BF459DE5B29ECC9B06E9A88E6611154 edww=
2,422,396,585 *FFFF6BEDDD3E706E50E6730C385C86410FB82F32 EEVACED
2,422,396,586 *FFF6AE616391D344BE99603368847B3516DCD102 EIERFBUA0
2,422,396,587 *FFF8E1DF6C2C9C6EFA06E7854B822DC5957FD399 [email protected]
2,422,396,588 *FFF14FAE92BC8DDCB4FBF1C55EADE9936632CE13 TOMTOMING2
2,422,396,589 *FFFFDC5BD419AE82487B17118CB85362335F8B0D TONIJEM5
2,422,396,590 *FFF2357A82EC7F9B3816BE3DD7A5CFC3BEA1C77C ellingsen之後在1999年使用
2,422,396,591 *FFF75F0D810E03BF4E585AD25A0524577271445C TRC696969
2,422,396,592 *FFF9B34F5A7E3110411A9C8273E9396BA395498D [email protected]
2,422,396,593 *FFF7B0603386D715BC57194A96525F3AD0160741 EMMANUEL SOLER
2,422,396,594 *FFF526BACD256D2DF76FC9A97513424AB3CB7810 TRINIDAD.BOHONIK
2,422,396,595 *FFFB3A75B1C3762F6D549E94C359CE24CF132A04 tristen116
2,422,396,596 *FFF391367C99D35FC812D144FDB9D1B9FD78D47D ENOCH.VARGUS
2,422,396,597 *FFF79ADD9BE288768C1E331287627223085388D8 enraierez8
2,422,396,598 *FFFDEE02DEB5ACF5D6CFB4C9ED742B1ADE4892AB TUMINI TUMINI TUM
2,422,396,599 *FFF63B26B548DB8C21228B30B5DCE29ED6BE9B91 [email protected],
2,422,396,600 *FFF1279575F57431D32268F4DE3ABB070801813A eomponisten
2,422,396,601 *FFFF5B87F697AC919A6E192295B2F93F9EC4C53B ep)im
2,422,396,602 *FFF985F3E90AAAB11D28FF3C514E32CABE826CD0 [email protected]
2,422,396,603 *FFF284C8204F6A7FA6DE28425DFBB2B3089136B4 TZENEGGER
2,422,396,604 *FFF346E0657F158BC16A6C273B94363EBABE9058 ERINGRAEFF
2,422,396,605 *FFF158396923C9D1B72712EC2A6B0E911DF1AED8 UFANARAMOS9
2,422,396,606 *FFF28DE5302F34B66BE23ED85E28943626540E19 esananab3
2,422,396,607 *FFF97565A4F7DD45C67F98E57713B9BA6E529DD3 [email protected]
2,422,396,608 *FFF599F83E15D9C2BB1458B94F3AAD6EABC7F90E ESTEBAN.LIZARRAGA
2,422,396,609 *FFFFC0D49EFE63F99A2881AAB12D2E14CD20A1D2 UNCLEVAN
2,422,396,610 *FFF752E5422AD78E55761E42B1ACAADDC1B5E034 EUFOMANT3
2,422,396,611 *FFF60F0E57E56F4592F8CA4B3F535A42F27E21C2 EVERETTE.CARDINAL
2,422,396,612 *FFF51A7E6E73961B3E9CD1656C30E90533A1639D EVERYTIME-I-CRY
2,422,396,613 *FFFC524F2D439F0D6D970F962FF99372BD83342E f![>
2,422,396,614 *FFF0A5086997E06D18F31DC2428C95056EFD1154 uprf
2,422,396,615 *FFFD58BE0E0EEF99C133185BC7944F3B32FB288C /USR/SRC/LINUX-HEADERS-2.6.32-24-SERVER/INCLUDE/CONFIG/FB/SAVAGE/I2C.H
2,422,396,616 *FFFA7A3EC48E57A53C51114FB3BDB10EE8DEE256 [email protected]
2,422,396,617 *FFFDDD2130036C79B1E7C47E0958917D7731E01B faxtest-(trauma-dj-mix)
2,422,396,618 *FFF19A3725DFEC73C202861190B66A17C129554E [email protected]
2,422,396,619 *FFF863DC572515C8ABDB90992E7A93FC11AF3A7D FCBBTL
2,422,396,620 *FFF6A5C5ECACC6FB0B14274BC2C0C45B88B8743D valentina-peric
2,422,396,621 *FFF1113EA8D9B13A03DEA9029B800F4077BB0BC1 VALENTINESIKANDER
2,422,396,622 *FFFBACED236C21A09979A613012460438728A879 VALENTIN.FINGADO
2,422,396,623 *FFF131C56B55CD1313F55C2E533E61B14130146F VALINNOILLAAN
2,422,396,624 *FFFE1C777B075075BA0A0F69222D33694844C7D7 VALINTINA.TULIAO
2,422,396,625 *FFF2AEFE60F014F51E846D0086514BBC975976AB valsicim
2,422,396,626 *FFF96489F4D00843C2FE62B2E6E9CB4D96139387 [email protected]
2,422,396,627 *FFFDF3C4105C017FC26DEDB1481C5AEDB702BE41 [email protected]
2,422,396,628 *FFF718B915BDD5F9211C9E959B81CE00D345F922 [email protected]
2,422,396,629 *FFFA201391ECD93493C552536C70C66BCAAC6D6D verdietst1
2,422,396,630 *FFF2D8BC0E6F7246927965085D4EA9198D71FCC4 FIRE」出演、映画
2,422,396,631 *FFF7DF381612A38921704B68AA6F86635A56110E FIXMYBOARDS123
2,422,396,632 *FFF27CCF8D9A709B0BC489FCA410D4CA5417B412 VERNON.HEFTI
2,422,396,633 *FFF3A4B5AB21B3FDB67337F646FC6BC306EF81BA VERNYONG
2,422,396,634 *FFF83F1264DC91020B6AE6BC7B494A7A3573EC31 VHBH
2,422,396,635 *FFF7BC946864E6E98AF30F570C334CA1BD5EEB3C VICENTE.ANGIOLELLI
2,422,396,636 *FFFABE99A092432B4B4BCBD46190F8C0BC4EEA92 florentinoheffelbower
2,422,396,637 *FFF746A85271FC4E07E57ADB783C69EB8D82F2E3 vickimcgough
2,422,396,638 *FFF9203BAA9F3B6ECC8F4768BCB1785DE1E3D56B forrestsiltman
2,422,396,639 *FFFD70F8EB73511CCD5B80DBADDC6E1E56954B02 FORSWEAR
2,422,396,640 *FFF603866093CE8151EED604CF2C8EFF29E7E7BD VIKINGNEDERZETTING
2,422,396,641 *FFFA8683EF4E19FABAC9BD057B0B53035C1F9870 violinsonatano5inf,op24:iiadagiomoltoespressivo
2,422,396,642 *FFF828962F43F691C2EB5C52A696C8AE311F279D VIZUMMAL1
2,422,396,643 *FFF618217DB76A784F1AE77D0096EEDE463DA2F1 FRITZDEMESA
2,422,396,644 *FFF9ACA6587F7B7F08D4607502F097F410DDE214 VOLODIYA4
2,422,396,645 *FFF60190D8344D820553632CC8DFDB7E0411A87A VRGDNDNS
2,422,396,646 *FFFD9EDCAB410C01595B2F7AFFCF0576A9EF81AF vyt-
2,422,396,647 *FFF1CDA5166E0A68815E521C8BFC9CCD0BBA9E67 WAITING FOR AMELIA
2,422,396,648 *FFF1F94BC793C8A7F2A5CE64ACFE0DBE75DF8EB9 walkerbenward
2,422,396,649 *FFF9D4EA42D02A01259BEF24240A1B8CF71B58BB [email protected]
2,422,396,650 *FFFF34C9A3669209CACE13810B4F2E7354EF01B6 WALTER.BUTSCH
2,422,396,651 *FFF901BF192F6605CCFF6218F036220E6A6C0626 GARRETT.ACAL
2,422,396,652 *FFF6984D54CC601E3F59BA08876C1355A4FA01F6 GARTH.MCNAMEE
2,422,396,653 *FFF3C459D407C572F3CE00D8F0CA4B89EF4E7DA8 garthredepenning
2,422,396,654 *FFF16BAE810B6A40CD09CE99D326814C68E2B458 gayleromandia
2,422,396,655 *FFF4D94B0034DC052587632A7CACB20F79D0C152 GAYLESCHOECK
2,422,396,656 *FFF7FA683A51DC9D4C68C3C2D72308A8FCA0C95C GAZZLE
2,422,396,657 *FFF15A10D119202EBB9477608AA831B2FC1CF5AE GEORGIA120
2,422,396,658 *FFF285088856B263B329E5B669AAC4C622E45EA1 gestopt7
2,422,396,659 *FFFF7E55C859C561E6F679621CC82938B6212DC9 GILESKIRBY
2,422,396,660 *FFFF1C82ACBDEF3F67883DBEBCA55F5FADDC8415 GLENN.MONTIER
2,422,396,661 *FFF42C9A50BFF38308CFEEC66EECCC27812B3544 [email protected]
2,422,396,662 *FFFBB7D1FB3D43FB769855F5A97CCC9573E63F38 WENIGMAS
2,422,396,663 *FFFA5526E468BF9ED7AB39168242E6D4CE943A0A GLOBENSTEIN
2,422,396,664 *FFF6F87347F74F53DAAE147F81AAD58A4389256B [email protected]
2,422,396,665 *FFFBCF00EE33C82778D67829C09FDB90994C0CA6 gobernacion-de-medenine
2,422,396,666 *FFF934A099BB55A828C94874D5A7B1436AD2C1F4 [email protected]
2,422,396,667 *FFF7CE2AD49B06B9799E3DCE153C4AD0445AC250 [email protected]
2,422,396,668 *FFFFF0DEF8360A65207986DF6347343238592384 goo$3.c41
2,422,396,669 *FFF96A9FF6132C26168980D507F7B00F16947C0D GREGGDUBREY
2,422,396,670 *FFF1A00F34EA12A9B722C7EFAF0DB2BDC48A7F05 gregyancer
2,422,396,671 *FFFB59C1731982E381FEF6F59E81CB5DB12C79C4 WONGKUN5
2,422,396,672 *FFF7471A092CBD2FDAF1684D16158FF17531DAE4 GV#_
2,422,396,673 *FFF77370CA385D1FDB6E1F2C738CF36E94415098 HARLAN.BENNERSON
2,422,396,674 *FFFF0781EB80F5A76C2CE7316DF05302B5F0EB6F [email protected]
2,422,396,675 *FFF3665DE1DF5AF7A9E2789FFED8859F19D34F92 [email protected]
2,422,396,676 *FFFD8EB4E8E0D1EFDF36591A73686F2829233813 HARRISON.CROWFORD
2,422,396,677 *FFF6D193124270AE875B69B597752601784C1924 HAYWOODLANGTON
2,422,396,678 *FFF332D83CF8650F2BFC15D53DF44E36EB456D81 wwwmediaticocomesp
2,422,396,679 *FFF6537D3C6E6869A388725F4C89779308947EBE hdk-dresdendewww
2,422,396,680 *FFF2D5484FBE2D6FB5CF71645E39F3626EB0D5F2 WWW.SCISSORS.CO.UK
2,422,396,681 *FFFC8679778FE527FD1B10D9E1922EC6C07432EB WWW.SHOPKENPAVES.COM
2,422,396,682 *FFF437977DCA2F4D2F0F0C7C18834ED5434E350F heaven'stears(funnyhowtimefliesmix)
2,422,396,683 *FFF81C2B550AA1AB437071EF5F1C5F78047FAD84 Héctor-Emilio
2,422,396,684 *FFFD02A72118BF134887AA0FA028A4DD4CC75BBC Hedon
2,422,396,685 *FFFB4258783377425AFCC97912796A1F6BDBAD9C HELLOQUIN
2,422,396,686 *FFF656802B9C275896E2A77A28D304C3D8A7BCA6 X100PRECANABISH
2,422,396,687 *FFFF9AE22F7FA23C3C49CBEAB7008D3945AB0FF0 XAIKH
2,422,396,688 *FFF5A68E66E61B258C122E7D0B24ADE9093E405E XFD\
2,422,396,689 *FFF48933FD5AC575B2FF16DEC6047082B897A21D [email protected]_dejanewscom
2,422,396,690 *FFF47D383F112CCB8BFD99AA7F909517A3F99A71 XOWHITESOXBABYOX
2,422,396,691 *FFF61580330FC151CE93BEBB91F6E45C540A481B HKARLBORG
2,422,396,692 *FFF1CD8F5A067157AB1591A55196A9374967393F hlvcrklfrmt
2,422,396,693 *FFF40F43372F98E3A1275C2B4DC1AEE1C3B28973 honorierens
2,422,396,694 *FFFDD636934C084B202CBE93AE9F469EECA82D8F HOOTONS3
2,422,396,695 *FFFCF485662DAD51BAC1124BE0C6BADFC804CCD0 HOSPITALMUNICIPALRAM
2,422,396,696 *FFF6FDC9EB202C719753CAC0CC16E6DC87B118C9 [email protected]
2,422,396,697 *FFF1D4435F15582D0F4B71A224A58ACC1AE9BC34 [email protected]
2,422,396,698 *FFF86E297796F8BC6675A35B2D78AE46C2B20218 YASIR FADASI
2,422,396,699 *FFFFA02F036FDFEDD8C2CADC6622F2FA923EE56B YEARSBY
2,422,396,700 *FFF8402738C13AB27AB8F762207ABE73E04B1DFD YLXELPMOC
2,422,396,701 *FFF49E93E443FC241EBDD55A644AE7EA958F51B3 YOKE-WIDODO
2,422,396,702 *FFF1AE231F4C9B086346F9A55951B98029D39A8B yolandafiorillo
2,422,396,703 *FFFE2E3E091EED4D9A52603DEB735DDEECCEB2AA HYOZO
2,422,396,704 *FFFAF558973EB3FDD46792BE9495A4EF3C45CB50 YUNADEWAN
2,422,396,705 *FFFE3BC8E92B439172A045C6BA162CE3A1F84CA9 ifn$="m"thenn13=77
2,422,396,706 *FFFEFFDD5D907189741E340A975CC422E9A0CEF1 IHEIMSONING
2,422,396,707 *FFF6C0880ECDA4F1F1D225E63AFC2C7405209234 [email protected]
2,422,396,708 *FFF8EB494C5F8BE97AD72938C6062716CBC40BBD ILOVEAVENGER63
2,422,396,709 *FFFC29BBA43B142D613454E392D67505136BB5C4 iluvsuperman03
2,422,396,710 *FFF659E83DDAF0364AC77FD655B2B8053B364B09 immortalisee
2,422,396,711 *FFF39DBC97A1B3CA576D09F40CA1DEC1E401210D INALZEROS8
2,422,396,712 *FFF68877F31EA2B895643C0655D933FA42D533A0 zosel-sabulao
2,422,396,713 *FFF3F917FAB76A242C02D7BA2DA57B412177D037 [email protected]
2,422,396,714 *FFF8CAF81D8E5303161CBBEC8ACAEDBCE91C445B ZURUECKUEBERSETZTE8
2,422,396,715 *FFF85399C72C7B72961B8AD4C8B82F75D8235D38 zVo
2,422,396,716 *FFF29859896618C66FA7D7F8F4080AC17BC76AA4 [email protected]
2,422,396,717 *FFF26745076C2D859A267580084A2899438BBD3D IQ'F
2,422,396,718 *FFF9910BFEAEE3D6477509ABC7027F321EF6BFF9 ISAAC ELIZONDO
2,422,396,719 *FFFE92E8DECD97D1B6EB4D33FEF626BC90208C31 БЛУМФОНТЕЈНУ
2,422,396,720 *FFFDC5D8766FFAB80A20FE651CC400C4DFB02A0B БРАХИКРАННИ
2,422,396,721 *FFFABBB61B8200C9D0C7A9772C32DF926847E2FE ВЫ́МПЕЛЬНЫЙ
2,422,396,722 *FFF159E97A71034DD33358AC4F1CC1FF1008D9CA ISRAEL.HALLING
2,422,396,723 *FFFDD5E9149C69C3BF3DE360584C072E51511323 istapan
2,422,396,724 *FFF99F26B2A4F7A07C1D71BA36F58468A250882E костукович
2,422,396,725 *FFF4E36D6DADEA447DF4488D7D54580F5943755E ЛЕВИТАЦИЈУ
2,422,396,726 *FFF82146D47F8802E93B45468C87A2B6FFAE9DB7 ЛОТАРІНГЕЦЬ
2,422,396,727 *FFF1BF8E79E4AF547CDC9CAE4263C0B2611D63A6 jahanshi0
2,422,396,728 *FFF5C3927D73C952493E2C08DD2160D9971ED728 JAMAALWESTRICK
2,422,396,729 *FFFB123B602A14C6006F1E6C403EDD5C8E75E756 JANETNGO
2,422,396,730 *FFF8BBA97BC1C8B07F608CB093D5276F5243D33E УЗАКОНЕННЫЙ
2,422,396,731 *FFF617C71610E8DF19A66AC2877998FEAC78345B JAYPANEN
2,422,396,732 *FFF68F01225BBA7DF81D3D9986FCB91800D0CE75 JEFFRY.ROZYCKI
2,422,396,733 *FFF4253472BBDE6D736F3BDFC2E0E3CBDAF58F33 jenjoy
2,422,396,734 *FFFE295E5FBC22777F83B2AD935A355E9990ABB2 jeremuldowney
2,422,396,735 *FFFE27A141C74C2DBDB5D56AEC6993DE16A1A50E JEREMYPAULICK
2,422,396,736 *FFFE658134136ADFE432CA96166AE18ED619A219 jeroldapker
2,422,396,737 *FFFFBA6D3C3F1184967205F0D9655B949900AD59 JEROLDPERRAULT
2,422,396,738 *FFF440DD45B083ABAF005618198A3B0E3D5C4663 政府軍方的philippe
2,422,396,739 *FFFF8C095A542E2609E936E674A97CC33028A326 JOSE.RAHEJA
2,422,396,740 *FFF18670348FEE4FB4856BBA0A288BE08B4B5C8B JOSHUA.OKAFOR
2,422,396,741 *FFF12EF337CA8E5403B52101E5F80F1F37DF7A8D JO-TACHINOMETAFALICAORIGINALSOUNDTRACK(DISC1)
2,422,396,742 *FFF3A903D9562ED0C10FB8654488E0BD93B80408 JUDITH160393
2,422,396,743 *FFF68A162F5DFFEA510BD466504B9FB1B3A5DC5D KATHRYN HOVLAND
2,422,396,744 *FFFE785FF23991343027AEFCED43D045AD03BB24 KELLEYTASSONI
2,422,396,745 *FFF1CCC47F5198F5A3A8A739495F90F46AD4AFCA KELVIN.LAZEWSKI
2,422,396,746 *FFFBD60EC8F7B9AAE20B279B73C14D612B23B696 [email protected]
2,422,396,747 *FFFD5FDA8CFBB260D11E0D4583744F19CD93EF8A kelvinprang
2,422,396,748 *FFF6DA2C6286D36183C2021C1F2A0CEAB8FEB492 KENEATH1
2,422,396,749 *FFFAFB793174C42DD705C96CDD33837F52EAD003 05c
2,422,396,750 *FFFD64B8C4A8D0D9FAE86D8421936AE0A2EF632D KHRISTINIAJ
2,422,396,751 *FFF637F5C49282C854ABB35AD57E81114ABD4352 KHYYL
2,422,396,752 *FFF3F08657DD5713EB333F2CEBA1221377375CD7 kitkat13738
2,422,396,753 *FFF95D22AA761EEC18230B9EB775D4C36FBB78F3 KOLERAN1
2,422,396,754 *FFF6400E80646AB74115B47DE0CACEA8BCFADEF6 134815 dortvereinigtesiesichmitdenbriten.
2,422,396,755 *FFF9C1285B64166B58D5DA8E2059D55A9832FB25 KORYHERTH
2,422,396,756 *FFFCE88302BF810AC6AE7C4B4150809337A23E86 KRAWATTENNADEL
2,422,396,757 *FFF84E0B68EDA8E408A1B365C0EEC23547E44B44 15september1888
2,422,396,758 *FFF122B78527927786422E6DB6DFE3FA733BFDAF kzev
2,422,396,759 *FFFF0659875ACF6045D215394C5DAE35925F32FC LACCHINI賞 (UNIONE
2,422,396,760 *FFF30A71803CC931097DC398AC1BA972DD4EBC15 1dissatisfied
2,422,396,761 *FFF0AD47661154309B6D1D53FE35DF1B28E8B38B 1HAARWASS
2,422,396,762 *FFF0151A3DF152E70F8716D4DBB8FFD1357E8A5D lancegingues
2,422,396,763 *FFF554C6DCBE0437000F3CD8DE8E8B2CF553197A 1.HANCI'SI
2,422,396,764 *FFF409A75387883762E28BCE8DA6D6A39E51037E LANCELEMANSKI
2,422,396,765 *FFFAC149EA524E3734C4A9893ADA1438BD419ACA 1hollantiottelua
2,422,396,766 *FFF1BEC764A12577BC5CF44726B5D328B9C7F6B0 1ississ
2,422,396,767 *FFFE7D6BBD3D8E3286DFA900452A75685ACA1F93 LATNECALING
2,422,396,768 *FFF419F5A3B4BDDC61408C4A31F6E27732E062FA Lawrence.Okey
2,422,396,769 *FFF261AC5C97B9BE99B9D7E87BA8A6AED5A76FFC 1-MFGDIE
2,422,396,770 *FFF7A893CE6DD36E890F4FCE325C0E2D65933A2C 1mymichel7
2,422,396,771 *FFF6E1CC8E0FE1AED8B99DA875D10FCF7AF55C11 LEIF.TREMAYNE
2,422,396,772 *FFFA03AABD7B0FB4092B8D04840857783D2F19AD [email protected]
2,422,396,773 *FFF75BE2D64CBB3AB5230C308D180218868EBB1A 1.plus-leute
2,422,396,774 *FFF0B289AE3DBA52042D7BAAA84517D4A2A3A971 1.saviruukuissa
2,422,396,775 *FFFFCAE83410CBA64FABBF6DDC47DAFEE07FDDBC 1stadtteater
2,422,396,776 *FFFF3C654092A51E6B46CACDD46135BFEF493333 1TAKIMMAISESTA
2,422,396,777 *FFFB60D0CC10483A4337A061E23A7B7E3A93EB3C 1.tasa-arvomahdollisuudet
2,422,396,778 *FFFE62CE80BFE467303FDE1DF6B9E5769B26FE77 1 toppergeister
2,422,396,779 *FFFF68FC45E71D25121B593B268B50607B4A2DD2 1ZWEITLIGAGESELLSCHAFT
2,422,396,780 *FFF3D81D56C66EA36363199E5261A255F14EC36D lemuelmclanahan
2,422,396,781 *FFF1918978B2A72CEA1D330A736AE500A290BFB6 LENTHWAYS
2,422,396,782 *FFFE33433D537DA25DC0C6D9FDD6ECCE1BAA61B6 LEVWALL0
2,422,396,783 *FFF92615E353033570CCD87825047237D8FED821 2397489 OIKEALLAK
2,422,396,784 *FFFCAF9983E94DF31BDA0DB570E2A2B51FFA46EA LEYBOLIVIA
2,422,396,785 *FFFD00F2EC7CFF951EB66D9B75ECDB7798C53CCD LIBRA58
2,422,396,786 *FFF4B255870C6DFA1799E1CF9BE742C89B6F9EB0 LINDA-JONASSON
2,422,396,787 *FFF25EF255B3555984EE4187BCF0CA43065D7481 [email protected]
2,422,396,788 *FFFC8E1B9E78497A825B75B558090AA553896AF5 2805920 schon zum 3 mal damit konnte ja keiner rechnen "
2,422,396,789 *FFFE8B16D728113990FF9AB329A7A795A8B74418 2815984 KATAJAN.MARJAT.MAISTUVAT.METS
2,422,396,790 *FFF4CFB1B7ADA4E9C4D237A7F7E4A1D92D61BF46 [email protected]
2,422,396,791 *FFF8F2F23BB639445A12CE5A86D50F6BD055C849 29auffermann
2,422,396,792 *FFFEEAA5ED8BD67497558A524079BDCCB6AAF075 2ALBACAS
2,422,396,793 *FFF80C5523C4F47C05489B821E22687C1D4D5BE6 2ANEUGALA
2,422,396,794 *FFF21765334CE0D768FD7572F2758C58EC5FE3DC 2.FIRMNESSES
2,422,396,795 *FFF74751AB7A780D5C6DB731F7FD6D2915CFB494 2.kaapelijakokaapin
2,422,396,796 *FFFF0E1F05F9DE732EB5ED7796232C9D55CD8DDE LMALWANDE
2,422,396,797 *FFFB2427EC1CACC4A050B113EB579E132E959481 log1<41
2,422,396,798 *FFFE02171E9FFD13F1B101B6F128647F44AF883C LOGIC.160THANKS
2,422,396,799 *FFFBF3A500D4320985F9ACAED54C44BED0F7000B loretta-bosworth
2,422,396,800 *FFFF8616D6BE33BDFA5DEFC8F7F00E6DD8A2EBD3 3AZURBLAUE
2,422,396,801 *FFF84206BC2043287937C2925D2798248D727890 LOWELL.KARMANN
2,422,396,802 *FFF7698A820D98C9B2D22E3C480D27A5E6C46A97 lower-the-spirits
2,422,396,803 *FFFACB3467D22BEB13AB527F0725168C577BDB85 3CYTCLSTC
2,422,396,804 *FFF550CE173492C1493369321E6015ADF90C9C7A 3DARKSTON
2,422,396,805 *FFF7E495AD1E0E43D560B66D945A6F686B8AA809 3GARLIC
2,422,396,806 *FFF3AF336DAF59CBD5FE3E1695CCDFE8F92C4352 [email protected]
2,422,396,807 *FFF986CF46DEB2BFA7E7C9A6973562E719E54C44 LUGEVAL
2,422,396,808 *FFF9CA3610DA496D63BC90E9E26690E269CE6DC3 LUGINAAH
2,422,396,809 *FFFA52BE8596F6288C7EA3B2A476A3DEF76299DB [email protected]
2,422,396,810 *FFFE4288D66C00B3C50D282CA7AAF34FDC325FE8 LYNNSPRITZER
2,422,396,811 *FFFF5C6CBE12E488F3BA33ABAB773E5BF5F28930 4CONSTITUEES
2,422,396,812 *FFF4975ABCEE5C513ED30C4F66A2D41F4D214FDA 4D0P74B1L17Y
2,422,396,813 *FFF94312510406313799E486C3651B61FE7C4BBF 4iluvharley5
2,422,396,814 *FFFE681B8291349D769D75BC1B13AA287AAC47F9 4NTGVRNMNTL
2,422,396,815 *FFF98752DC6BC54A16796A6128E2EA05CBFDFECC [email protected]
2,422,396,816 *FFFFB3FEF2328329A42238BD41769B787D397EB3 4SPOROCARPIA
2,422,396,817 *FFF60E4E21E059DBF67C9B5DCA6DC0E69545F729 4STINGIERS
2,422,396,818 *FFF42F72ECEF4A3B7554125D2F5C7D60D2835A53 4USTA
2,422,396,819 *FFF0A0C9D73C33AFEAE55AD9EA7916290B38DA1D 572solomon
2,422,396,820 *FFF47AB4A492544D3F1CB76353B635F1A3C8E860 5HIRSELSES
2,422,396,821 *FFFAC67E0E14CC5D394C2487D75B8963D1A30744 5JUNIORNOTUSED
2,422,396,822 *FFF9375D63568C6028A39B11E83D80CB30C89483 [email protected]
2,422,396,823 *FFF42751D541382AACF6D6E894E8D2EB2C12D9C8 martínez'gui-gui'
2,422,396,824 *FFFD7248BD163009BA36ACFD4991FD12A58BD1A3 MARTYCGJ1
2,422,396,825 *FFF450E13DE20368381C8C8692AFE0D94D31729D mathewrenda
2,422,396,826 *FFF895133CB3FEFDCDA5BE8DD518ACDE20766EF6 MATTHEW-PAUL-HUNTER
2,422,396,827 *FFF777C6BD95732FC057C8D371E2F64EB6172F9C 5TNEIARESILANAB
2,422,396,828 *FFFF67643075392993FB1F4B4CD45704F005D4BF 622560 jokainenihminenonluovataiteilija
2,422,396,829 *FFF46C703E41243B81A9BEF157F0C82FF248D6C4 679433 puolan p
2,422,396,830 *FFF27DE1E6C943B9A247B5170B0FB925B99405B5 6BSWSCHARGELBSW
2,422,396,831 *FFF7B59639F189F329080126676B116115373550 03-14-1309
2,422,396,832 *FFF811B2E7101D8E96AC15093FF53F54C06FEEE8 099AADEN
2,422,396,833 *FFF928D928C2C5AB08F0C9AFA59279429AF81329 0TTERNE$
2,422,396,834 *FFF4924FF1955F4E33FCEAD30C96E0C856F520D1 102PALKKAAMINEN
2,422,396,835 *FFF0E93C14517BF1973C573B9F77A0EC38244D5B 10ISLA
2,422,396,836 *FFF1BF503B183062C5650C1543167AD1287C1925 11yuzunuzde
2,422,396,837 *FFF12568C1CEA69E168D266DE1D298E6C32E2488 123florida
2,422,396,838 *FFFA3AAB3E07B482161A36999EF1C3E3BC505156 1322219 ministeripainotti,ett
2,422,396,839 *FFF40ABB1620A8ABB3BE0C58A8170E266F9A67E9 13 BOSTA
2,422,396,840 *FFF8800B222AD8EFA27E6B47C16577506B38D1B3 14january1719
2,422,396,841 *FFFEB2C1E1DE8FC1A332F11D3D0872C766C2104C 153MNB
2,422,396,842 *FFF89BF5CDB69467DFC35F13AD3B5B9293603F0A 1899975 PUHEVAMMAISTEN-MAHDOLLISUUKSIA-ILMAISTA-ITSE
2,422,396,843 *FFFF1235727283B1DC53FB9B6095EDCD0D64A665 1ANOREKSI
2,422,396,844 *FFFB7F606D8A2C77B032A1D4C86B8F32A6508749 1ARISTEUS
2,422,396,845 *FFF427F75F4B62292F0003CD9222E1B0B1CD3040 1 contracttocontract
2,422,396,846 *FFF2C02B100D3805A822C8DFAB759CC3F0F36067 1EDART
2,422,396,847 *FFF47B71FFBD20687F40156CAE041D7B126BBD7E 1fromdaw
2,422,396,848 *FFF502D3107279F4F8079AFCD6CDE807A676F845 1-JUOTSENMERKKISI
2,422,396,849 *FFFCF03BA1CEEEF658CC6AFF9E799D6F6BB46DD8 1KANANMUNAPAKKAUSTEN
2,422,396,850 *FFF91AF5DC549E5D43D8931A48CFACA4D06CB869 1kashtan1234
2,422,396,851 *FFF00A601E305D87FF6E447105B8E98A3441368F 1LESOTHO-HERDING
2,422,396,852 *FFF9E9D1877E856833CB6005D3BE615E0D7B2BAD 1LORISES
2,422,396,853 *FFFE567507D4583A633EE2D0A74189D40A75AEA0 1mortgage-bankers
2,422,396,854 *FFF2904D8D6EA689FDC84209FF26069588743912 1.NEUERN
2,422,396,855 *FFF8D37EDECDAF6A365E9F438FB1B81D0F56075D 1pakkoostamisen
2,422,396,856 *FFF003C703F41B1D9B3FF5D4B3BFD76981272762 1pesuratkaisun
2,422,396,857 *FFF89ACF5321513697773923178DD6343C4221EC 1.REMBRANTIN
2,422,396,858 *FFFE1BB970DE2F489481E4AA097C28786202422B 1 SKATEBOARDRIDING
2,422,396,859 *FFF5076B041475A2D9ECAAAD6F45BC17B088F3E6 1SKULPONE
2,422,396,860 *FFF7904266C088B98F471AAFE82E1B8B6A516EDC 1 TARMOLAISTEN
2,422,396,861 *FFF4407EC99FF636C3E97D9B07B05F4541D826D8 1TRAEHDER
2,422,396,862 *FFFC985CDB5F6AC085289BBABDA299F25FC9D304 1 TUERKISCH-ZYPERN
2,422,396,863 *FFF6D04C8083B95182DA519F5253BE708E939D67 1VDOVSKM
2,422,396,864 *FFF8AB89D004631D57E93718FFA14545E1275F9B 1.WASSERTHORSTRASSE
2,422,396,865 *FFF49A824FBE583C0C9D9642CEEB8C001F8CA36D 1 WTO-WETTBEWERBS-RICHTLINIEN
2,422,396,866 *FFF48C12B0CB18BF7F185E92534F63302598E00E 2095-YORK'S
2,422,396,867 *FFFE295F90673C1DDA394BD81AAC7727813B7E54 20CICCI
2,422,396,868 *FFF45F192552DBCC8D2F1EC13DDBD14C4D95B60A 235 KM
2,422,396,869 *FFF4CB4A335111DCC15DA269EF23EB8B4D30FF02 2427947 OMMELLAANSIS
2,422,396,870 *FFFDABDC1D457D6A26B05D80C2568E11921CE552 2488540 PROFESSORIEN-PALKKALUOKISSA-ON-OLLUT-MY
2,422,396,871 *FFFA194289B8B4754D14651A595FB9DBE3C17A05 2735436 taivaallinen.is
2,422,396,872 *FFF140BFA0C9AE1809C2C6CA4D160B6E6AC61EA8 2946509 tarkastajiemme-toimintakentt
2,422,396,873 *FFFEA79A6A09E920F78C6FFDDC508D3873BF9787 2BELLETICI
2,422,396,874 *FFFA9856A5B145177EB71B8EF68D994848401264 2BRANDY0
2,422,396,875 *FFF50B593D5FF2D0B3B368BB36867A324B7C434F 2.komunu'nun
2,422,396,876 *FFF77E1521A98A123CFE683026E53D068DD70CAF 2.POLVINIVELRIKON
2,422,396,877 *FFF93CDA8F03057EE40995D0C2D851D99C4B80B4 2TITTENI
2,422,396,878 *FFF8151916A6315D61893CEAA9C625AA7A0093A2 2 VEREV
2,422,396,879 *FFFBD4BE61C123F4D5D4CFDC04AFB0C73E902A26 308786 diese-wird-als-gleichrangige-alternative-behandelt-.
2,422,396,880 *FFF5BED822DAC679E69EF3BF8D0CC5AD6D6504CC 3####)~0~O
2,422,396,881 *FFF8E9FCC9A0603A582F9E1078DBC55FAC183D8A 374025 BUT AN UNDERDOG HE REMAINS .
2,422,396,882 *FFF26BA891FD41040B13205054E5E86F9F13E58A 3-ARZLARINA
2,422,396,883 *FFF1B10EBA465C7901FCD4EC02336854D8951527 3======D~O:P
2,422,396,884 *FFFA9C1DFECB7F2A525C6C9C530F09DBFE28893B 3 KOIPIKANKAALLE
2,422,396,885 *FFF1A3C0CD308A3467A1E7AFFADB41570857A794 3RDSDAGEN
2,422,396,886 *FFF052BDAC209AFBE0113C75AE81C74C5A442E4E 409976 ELEMENTER-FONKSIYONLAR-.
2,422,396,887 *FFF65DF2CC71DA579C50290C6F7DD13DBB204DEC 47LV8E
2,422,396,888 *FFF5B66EA53F28A1D727E8B9581CBB6D1284F6F6 4asIlIrken
2,422,396,889 *FFF663134BF4269D83FBF666A15351F87F1BC134 4ATIESARAS
2,422,396,890 *FFFDA4157B19EDD697B92ABF34D4E57CF284C0BA 4JSBACHLOUISE
2,422,396,891 *FFF67996FE13D5845ADE9CBE8466D4DA46B65EA8 4MEHCILHA
2,422,396,892 *FFFFA18AF9F4347C26E9634FACEBAC61D7E597B4 4P3RC3B3R3S
2,422,396,893 *FFFD8655ADF200EF9528AC8BE021C377B20009E6 4PASSWORDBULLET
2,422,396,894 *FFFAC4D1B25BECB9230F146E02F0F53F38E9EA91 4.SEMINOMADIC
2,422,396,895 *FFF5FB4EE44A92270E2148D4FCC8C7A13311AB60 4VINOTIER
2,422,396,896 *FFF7F53C64656DFDA52CCAD36A67517BC4DF1803 4WENDYPIANO
2,422,396,897 *FFF95650D1AE3BDE3153376A7BB5F640EC864180 4 YONETMELIGINI
2,422,396,898 *FFF8D1CD0C9E69BA6BF41A5D35962B6B51A6B9AE 5$65hv/fc
2,422,396,899 *FFFD48E048121D59A34893C8A0F067495BF4FDEA 591ALLY
2,422,396,900 *FFF7832DE5B9FE702E3144DE4BCB29ED4E37C75E 5BSWTCTHBSW
2,422,396,901 *FFF365037A931BA60E1C8C6631EF45203FDAFBA5 5FRANKIEFOZZIE
2,422,396,902 *FFFD5BBABFF8588DF90F208996C22FEA1FB6AEB8 5ORNISCOPIST
2,422,396,903 *FFFD40A9318B90CAC15206DC0A04108AE9A1D218 5subtilite
2,422,396,904 *FFF49B3B481A581553E568ABA0686FFC033F7961 6ILOVEDOMINIC3
2,422,396,905 *FFF1A2E675FD8687B822B92269BDC9890D774390 6SCHIMPTES
2,422,396,906 *FFF1FF3C2D0C9254D8BF25B48CA40E129924A4EA [email protected]
2,422,396,907 *FFF345BE5D1B88CBA90986DE768D0F33071FD058 6SKDEHUNDENES
2,422,396,908 *FFFA85B3D38112AE9095743A69B59F0E31844386 6VELIKOHRVATSKI
2,422,396,909 *FFF9D278D935ABDA75BA8C9AF7367745A8980BBC 6VERVOERT
2,422,396,910 *FFF7B74473C5842C100FCAA25B8467C9C2A0E52D 7ACURATRUCKS
2,422,396,911 *FFF9E2580893EB72DFA592D9083AFB5E015A2F3B 7BSWBHADURIBSW
2,422,396,912 *FFF815CF93FAC2DA16EDC142388047FE791468E5 7CHARLIEBLOWFISH
2,422,396,913 *FFFDAE8FBEE6FE2BF2741DE6B2BADD011FB78B3B 7CULPABILISERAISES
2,422,396,914 *FFFC6252B0E2FC1EB0D1BD2FC8886FEAE85764A6 7IRDTCXXAWQ
2,422,396,915 *FFF326170F30B42B03E030ABDAF57A06996F5E03 7LIAVACED
2,422,396,916 *FFF05D6F881B60E1F81ACB9B9CD4731BFBF6EFF5 7PATRICKTREVOR
2,422,396,917 *FFFA0700D84838E7CF2CB144E2473CF6EC4DC76F 7REYNOLDSSTUPID
2,422,396,918 *FFF7C74B8BFD9A0E1DD92FD133835F3B63B93AFA 7RPARTISSAIENT
2,422,396,919 *FFF1F81CE2E9F1E20FB93320509005039C0F03C8 7RYHMAET
2,422,396,920 *FFFCC791292D7FD0B5C438778DEBC0CDFEACC5F2 7SHORTWINDEDLY
2,422,396,921 *FFFCEE11A3A65556B92152F46A22D970D927CCA2 7SPIKETRAVEL
2,422,396,922 *FFFE52FFFFCD14D352D69FF4BCACBADE48C57B40 7TRUQUEEUQURT
2,422,396,923 *FFF19D034B7D282BAEA5C33B7A5ACC79917A056F 7WORLDNATURENO
2,422,396,924 *FFFBD49B05EC260AF90490A296D66FD9CB3853AB [email protected]@PH3
2,422,396,925 *FFFF2EB3AF90741B69B020A4F352FF10D8CFC545 8ADATTARONO
2,422,396,926 *FFFB137BA82D9E53494DCEEE55666EBCC6B2D740 8-BOLLWERKE
2,422,396,927 *FFFB810B0AFD93F6152AC830D6BBAF4EE42B2143 8BSWWATVHEDBSW
2,422,396,928 *FFF475E7312B1EB176DC779492A0C996AB4F7B99 8iluvdodgers8
2,422,396,929 *FFF8D8AF446755490373BF2AA47F4E2D8004594C 8REAKIRT
2,422,396,930 *FFFFADAEAFD11B54B44420753C999D05D89D35ED 8SGSOMSCD
2,422,396,931 *FFF81F7842F80333347A747AC182CF605D2C3410 8SVILUPPATA
2,422,396,932 *FFF47C988BEA2F4960F129A88AE5FE71195A5552 8TUCHIURA
2,422,396,933 *FFFFBA975D0F4A11F8BF78F11C3B4F439A094984 8ZWAANZWAAN
2,422,396,934 *FFF84CD4288C80EBCCE1B3267BE803594E8FB118 92.hububat
2,422,396,935 *FFF96CFA8F793673DDB7426D83A66A3FE0CC704C 990janae
2,422,396,936 *FFFE97C7410CD0392D0EC1194A4CB497731B2B85 9BSWFAIRFAXCITYBSW
2,422,396,937 *FFF4842A140BEDD2ED10CF602666CE982326AD6B 9FIBRINOLYSISS
2,422,396,938 *FFF70F1D270C01824706A9D2EC6C286785F281EE 9GRJNSLCHTN
2,422,396,939 *FFFFCD927E68E7B25251E8747C6135E0F6F4495B 9ILOVEDESTINY7
2,422,396,940 *FFF4A4E01D690D6B1F26A9352008F20E05DEB575 9VRZMLKMP
2,422,396,941 *FFF8899D9579F52F9D4EE2EAED1FFBCFE850D02B [email protected]
2,422,396,942 *FFFE3E9D49325F0988CAC41CA53803C6526DCCE2 a1_=k
2,422,396,943 *FFF4C7C0F69DEAD085757DFC9C82DBEDD95789D2 A29B
2,422,396,944 *FFFB52CB8EB5409931DA4A7E384EDB7E9B60237F abishbsw
2,422,396,945 *FFF96841BE2D90CD1303C22F0879DD98A4D57CA8 act1「期限の切れた正義」
2,422,396,946 *FFF2F48E3B1F66BF838AC1CE91F92F5535982EBC aimerez
2,422,396,947 *FFFBD09D10A579C117EA7A592577FB35AA31881A ALEXANDRA-SCHWARZ
2,422,396,948 *FFF0E4565EB8BC79246E78E9B6DAA2CC020E2133 AlhL
2,422,396,949 *FFFFDF0D4AFB4318132D3AF3921ADB4472C5F43F ALONZO.WEATHERBY
2,422,396,950 *FFF1C3ED94E8A16D72A7A0DB1C58F2D9119BA55C alphonsevarieur
2,422,396,951 *FFF9DC855C8A936664B408883F950ABF65493B85 alphonsofala
2,422,396,952 *FFF106DD79CD2368E4741C9544F9ED376A880946 ALTERMAN
2,422,396,953 *FFF277DFF6806B8ADFB00206D538C1C17512E449 a/m70
2,422,396,954 *FFF4545B9CDDAEF5932FD33EA79483ED505A741A an934
2,422,396,955 *FFFA68D327EF3962493C53E09BADEDF37F77F109 ANESTHETIST8
2,422,396,956 *FFFFA642EBF1DEB78649680F40642E978A59DAD9 ANULOVAT5
2,422,396,957 *FFF7DCCA8EBCA78ECBEEF0EAEBE9AF3A05B01C44 APRILSUCCESS
2,422,396,958 *FFFA96CF15DA412E7A6F0F05C12A74C71035DBEB AS2,Q
2,422,396,959 *FFFB2E61FA7B555C914DC717571720066998A9A4 ash123321hsa
2,422,396,960 *FFF8246254FD7EAB383CE2BA0CB08559A368EF6C ASR?F
2,422,396,961 *FFF70E4F4A844E435D8C3BB4DCEFE87175BE0283 b0or%
2,422,396,962 *FFFC1E29E15CB0192807BB692CADA466A83F2C66 b"4eo
2,422,396,963 *FFFAB110119186769B003AD034A80DDDD4E97AC8 BABYGIRL
2,422,396,964 *FFF6EB9050CCF14BA2087C85FECEE5D2EBB6B8B2 bailie5
2,422,396,965 *FFFBB2C6D44C40613EFCA3C8EBDB70652AD93C17 banwaari
2,422,396,966 *FFFBE8441B806291A31F8BA1EA54EA2C3A255997 bbc1xtrafreestylesessionw/benjib
2,422,396,967 *FFF38081F35311942B42E09BE821A386F3C7225E bflamingo3
2,422,396,968 *FFF1BE0B5B5867D71C60B30CE20D40FA7D6DBB93 Bfmf
2,422,396,969 *FFFEA315E8483D37024170D07DB826A0A1EB2B40 bibpn
2,422,396,970 *FFFDE7E3194512EE833178F099B7F53ECCEFC516 birei
2,422,396,971 *FFF66FBBE7FDF1EF4F7A83DA7EE982B7399CB8DE bobbiestinehelfer
2,422,396,972 *FFFA020B77312DB13DDC90D63C8FC898D7A91030 BODEMRADEREN
2,422,396,973 *FFF67FD7EB50263042D5D015EB6280E3CC661D0B BODMR
2,422,396,974 *FFF902ADEA35D445764E8959D35CDD27F0106177 [email protected]
2,422,396,975 *FFFD5EEFEA1A8218013A4C22A7E3C9652632942E BOUTGES
2,422,396,976 *FFF67CACA6F59AF727C366CC3C63FECCB5D010F0 [email protected]
2,422,396,977 *FFFB083021FB06058D62F8B039BCCAAB1BD70E14 BREWSTER'S-ROOSTER
2,422,396,978 *FFF03E58D5329A5F84CDF1D9961EED6558A85F95 brian.groulx
2,422,396,979 *FFF81C5A7FBD6C758091463C509310F0B85C4152 bs_6;
2,422,396,980 *FFF84DBE7A7FD12D2F196FB46A52E0627CA1D3C6 BUSTERJKM5
2,422,396,981 *FFF6FEC98FA8E53D3A80C05B70912EDDAB77B8DC bvrk
2,422,396,982 *FFF88A9F4739A04C560435027481EE2B38FD88CB C7)9W
2,422,396,983 *FFF613849A0BA0FC7E004BDE36AD4BC94EA7096E [email protected]
2,422,396,984 *FFF91EB07BC2169E80C4E77EF63081FA39CD6AD9 careyshawgo
2,422,396,985 *FFFAC664255ABF689874BAF1D1EA67CB8059729D CARMELODAHLEM
2,422,396,986 *FFF73C992F2000468D73F8029BA0BB8D21C62550 carminefitsgerald
2,422,396,987 *FFF0710A7A3C5031E25849333127D68CEEE5BBD6 CAROL-ROMEO
2,422,396,988 *FFF3FEFF944233758093030B254D012F6BA81DA5 CARRAROM
2,422,396,989 *FFF8A0A273875E3E693D2D79D3FF883FB2027FC4 caseyottis
2,422,396,990 *FFF81A2CC2494C3A7838F446519F5B3091DC038C CASH-LAW
2,422,396,991 *FFF09B0586C69CCB2559A03826DB98C9DB4C842E CCCCACCCCCACCCCCAGAGCTTTGCGTGGCTGGCTCCCTCCTGTCATTCAGCTCCTAGC
2,422,396,992 *FFFF885FDA0D528D3B66AE612AD0D2C928EA8F90 cesarifie
2,422,396,993 *FFFF520308C964FC724965F4C8A07CB46469BB77 cf2t%
2,422,396,994 *FFF6E58236A110649B10673C41F51C48DB3D6F8C [email protected]
2,422,396,995 *FFF2730B3FAF1D855B867C84D2CF6BF16461EFF2 chasvandergrift
2,422,396,996 *FFF37F4D437DA234D80F3EA9D0C1C1102376BF63 C(hE
2,422,396,997 *FFFB1CBB1F14CA15D2122DB3EC58A1E213FA2052 c_hj7
2,422,396,998 *FFFB2D279C12D76ED6F5022C73F279269CE4DD2D chn;#
2,422,396,999 *FFF83D1CA907A6D7737644FD98B377A261AC763B CHORAVA9
2,422,397,000 *FFF700653E0C0E14CE33F4F6CA151DFB11AEB86F CHRISTIAN FOSTER
2,422,397,001 *FFF18F1C5B922C3D2881A6D5F2402CA763D18C79 CHRISTIAN MATA
2,422,397,002 *FFF0EB8E105F3CA21763EC87280B942E2560DF3F citcata1
2,422,397,003 *FFF7F7C7B7FE079A6F0F2F93BCDF6FE14AEABBB0 CK6n
2,422,397,004 *FFF5DF9E8FA88DD5F0695296CFBA1B29645FFCB7 CLEMENTENIBLETT
2,422,397,005 *FFFC99FB17CECDCED61D01F070F985210534558B cletustaruc
2,422,397,006 *FFF084C6714244F13AF342909C6E6F41F48F8EBB client-type
2,422,397,007 *FFF9D1DF820FDB43591F4EAC195D4273657CA303 CM$T
2,422,397,008 *FFF39A5F69FB6E316ED72757A6BF63ECC7039F1E COLEMANFETNER
2,422,397,009 *FFF3B772A3DD192B42E1D5A382DC661881170189 COLINBOLITHO
2,422,397,010 *FFF124729B109856447389C3FF3D6676F7E79C13 COLLINDUNPHY
2,422,397,011 *FFFDCA5C2612E2F5E4ED3AA226C2A078B9CBAF72 concate
2,422,397,012 *FFF7BAE7B6F74DF5F84F4F1DA81D352BABA646C5 C;OTF
2,422,397,013 *FFFDB2606ED25FB0DC9C85D98A9143B8BD5D3D77 c/pvw
2,422,397,014 *FFF44824052429A94F28D4285736475CA19CE5F2 CRUZLODER
2,422,397,015 *FFFC377F78423EA6627C052FE556C4D1DD585486 c?s8l
2,422,397,016 *FFFB8871F233D19DD3CEEA560B15855EC363FBEA c;wx4
2,422,397,017 *FFF2054D2B794DEAB5C290481E1938D4202D20C3 CYE_D
2,422,397,018 *FFFEA789C3CFDC8D9A11A2AE01A01BA4E58CBCEB daisyshit1
2,422,397,019 *FFF289AAA61B7F4CE63210E338D4B69574B5EF69 DALTON.DAGNESE
2,422,397,020 *FFFF7D0D4956F0552C4FA1A09693636FC16CB62E DAMIANPOUND
2,422,397,021 *FFF490EAB50A19E73AC77F0428BEEBBEB1EF9708 DAMION.CARREON
2,422,397,022 *FFFE1DF3F86ACE19DB953B8F67A1083F634449DF DANIAL.CHAY
2,422,397,023 *FFF4B00E667BD4251C129A640214B703D5D9155A DANNYJURKOWSKI
2,422,397,024 *FFFE4215FFF3E9338AD1A4A650C10A48ECD2BB83 DANNYMEDRANO
2,422,397,025 *FFFFE730BDE19A580AE6D9C9487679EE9B3FA9CB DARKIULIU123
2,422,397,026 *FFFCB1C81D4AD51451A9B5F33D9587DDE828829D DAUNEU
2,422,397,027 *FFF1595A1F3AB94639DD6080084FB1FE33714606 DAYANIHETTIARACHCHI
2,422,397,028 *FFF47EC1647346A19108AA7403BFCE707FEEAC8C decision-analytic
2,422,397,029 *FFF703503ED217544E03033BE675ADB65D9BDA98 [email protected]
2,422,397,030 *FFF2C1CCC3C5C7F395922E215BD72D26BD42A211 DEHSACIF
2,422,397,031 *FFF39C62A3044A2091B3054FE6FFB017DB0C0BB7 deinesch
2,422,397,032 *FFF8E5807A4E85C9249D3BD8F6D65E8AB412470E [email protected]
2,422,397,033 *FFF88094E368E1CC347FC35812B77ABC5FE99D2D ˈDƐːNɪƩƏ
2,422,397,034 *FFF2080E29E22FB73CBD90F8B4E1074FE9E1DE93 DE#OG
2,422,397,035 *FFF676AD6350A6AF2F0F91DD787CB3AFD22A2803 [email protected]
2,422,397,036 *FFFB569362237E21BDEA22D5F65B3ADF7FA85453 DESMAYA4
2,422,397,037 *FFFD5055137CEC7503B7082D4A36E0C79792E9E0 det.for.sent.nu
2,422,397,038 *FFF403C0F99E2A7E901E1FD91009E5F125D894D7 DEWEYVANVOLKENBURG
2,422,397,039 *FFFF35AE2F4A7AC7E4F145EFC82E610DCC5A0122 DFGAW
2,422,397,040 *FFFC8F22B44678616D8D6C24A7D59276E442CE55 DG)Q_
2,422,397,041 *FFF328A5A25CA5D5849BDAEBD7E1FCE34D2E41CE DILME
2,422,397,042 *FFFE3C883120EC0D7B179CC07D2360421B88F015 [email protected]
2,422,397,043 *FFFF0663FBBDB263834D536ADBD325978ED56507 DLoG
2,422,397,044 *FFF1D9CEA6CB564B5A09EA306D174F065BA12257 D:NB
2,422,397,045 *FFFA65DBDF907FD7B9258CBBCBA8AB4D4F4F00B9 DOMINIQUEAIPPERSPACH
2,422,397,046 *FFFDA55568CB7B6BD22D04F2E761EA5D768B1BF9 domn0
2,422,397,047 *FFF2BD550A5641DA1F9B7A997B3CEE770BD31164 [email protected]
2,422,397,048 *FFF0BB2A12D4BAFE72DC7AB9689BC689053E0FB4 DONNIEMAPLES
2,422,397,049 *FFF01BD0980F5C798B3D75E665978C6799BB53A7 DP5T?
2,422,397,050 *FFFB27727B20D90B04668C0A178D28FC7FFC6A39 ds77
2,422,397,051 *FFFC4421D75E24C77E11321018C673D593A42D08 DTWC7
2,422,397,052 *FFFB3EDAABFB6C827930CA23E5675AABB5B53A66 dustybeem
2,422,397,053 *FFF36354A97EB1C22EB5FD30E8D5238EA6042123 dustycleavenger
2,422,397,054 *FFF2F0768B59B864136151057B8A5012262A368A D!V!5!8!L!T!E5
2,422,397,055 *FFF1286328207AE673251DEF935284E2EF8AF8F2 D#YSG
2,422,397,056 *FFF5AB6FAB088BFCC3BDF6A917AF54EBC29A79C5 [email protected]
2,422,397,057 *FFFE12CE973C99110237948DED7DE560E4788FF3 EEUQIPSA5
2,422,397,058 *FFFFBF110907EBDC5A965EF8F41623C723586013 EGBEDIJ
2,422,397,059 *FFFBFB580E47DC9F03F3CA155F4ADED8112E780E egv$z
2,422,397,060 *FFFD1A11151D0611524A821159774B35E2CA69A1 ELBERT.LOUVIERE
2,422,397,061 *FFF645ADE45E3155118B6DE9DE0A6ED2354C154E ELBERTMCLEE
2,422,397,062 *FFF306A92B956D6970A8B8069CEC2C2BB91141B9 ELDON.MCQUAY
2,422,397,063 *FFFF424969C0C5FDD30547081BCBE02539D799E4 ELIAS454
2,422,397,064 *FFF2CAF941CF3DF286157E0587585AAC41A7D099 ELLIOTOCHALEK
2,422,397,065 *FFF74682F973F408BE582B1B635CD15805DB8514 elwoodhallowich
2,422,397,066 *FFF837853CDD56B68DC55C9906E9C0AB723BF544 [email protected]+!ons
2,422,397,067 *FFF2E64E4FE200F00EC3C1B4F940AC45086C4434 encaisserent5
2,422,397,068 *FFFFB013A8E08FF2EF1D83F9D3263076E9A3A4B1 ENZPUNKT0
2,422,397,069 *FFF55BFCF8C3CBBFB5C1C7821CCDAD44D9694762 EOQCW
2,422,397,070 *FFFCB77B2AFE1B9FA466D7248D7011BC19E31B72 ERRAVAN9
2,422,397,071 *FFF8D3C0607CB0C1D27239D6D739B772A5465B23 EVANGELICAO
2,422,397,072 *FFF05AE7B9E2FBC189E5347A6F052C3BFAD081AC EVAXUDEHA
2,422,397,073 *FFF92DE59BB50801DBEB7B0DD415612CD0AA033B EVERETTLEGASSIE
2,422,397,074 *FFFB76BA32C308297D219E744928C26DD3D5B618 EVIL BLACK MAGIC
2,422,397,075 *FFFCF89DAB80381D6D28940844BF8A1EC7F289FD FABRIQUES0
2,422,397,076 *FFFED30D4EB11616DD50B84EA2E23AF458FA15DB [email protected]
2,422,397,077 *FFF8EF5900BB5E899E440FAAA0C5962EB228B6B4 FEDERICOSTEININGER
2,422,397,078 *FFF1F86FBDF5594FC7128E2465871BF1984E4D46 FELÉPÜLTE
2,422,397,079 *FFFC08D819A4440EA569675D88B655F3272AE7F3 [email protected]
2,422,397,080 *FFF823CB7A56C64685ACF0C9753AA8822269F0A6 FENMEN’LE
2,422,397,081 *FFF50CD0D1E05D9626A680459DFD867AAB3C026D feudal5+c
2,422,397,082 *FFF444E3BDD328F6334815198A16BDF48E9B78E3 FILWRITER
2,422,397,083 *FFFEF8D6E1DB665D843E2F67B473955DC2DF6D46 FLORENTINOWESCOTT
2,422,397,084 *FFFF20EEFD6C3E9C542A5D641E39E18ABCFEA144 FMERKSAM
2,422,397,085 *FFF53F50BCB5ED6EC793945A2593F63CE89A4DB4 FRANCHIFE
2,422,397,086 *FFF7F6AFD3D8C7F8B90CEB386C083BA5B763BC88 FRANK.DEVENNY
2,422,397,087 *FFF69E4FE2201F408586DD912340290B35844D6F FRANKYIBARRA
2,422,397,088 *FFF72419B70E8D1552BF751574D6B87AFB1BE7C2 free satpal ram (adf sound system remix)
2,422,397,089 *FFF05E521B50E013EC9CDC0EBD2A54BDBE38F4E5 FÜUSBAUDIGEN
2,422,397,090 *FFFFA0531FC4EB2B3E2CA300653520BFC59E4D04 gałazij
2,422,397,091 *FFF1E4083E78BF0AD6194C6F29A8324AA0CB15D3 GANTAKARNA
2,422,397,092 *FFF82BB1F490903F95072C6222EED45CB0F3A8CB GARTHGOMZALEZ
2,422,397,093 *FFF77EBC487088332DDD7905B02A5CB375A82C0E GASTONYRIGOLLEN
2,422,397,094 *FFFC12C7D63D5636E8144B9D4674C3551F7D20ED GAYLEALQUICIRA
2,422,397,095 *FFF69A9E8AF9BA1318F328DEE6940504FFBAA56F geoffreyiborra
2,422,397,096 *FFFF38C06844149A2C069922FD397C84BADBC8CF geranium.pink
2,422,397,097 *FFFE61275EF803D2087E1D36FF8CD6192F45C47F [email protected]
2,422,397,098 *FFFA52528ABF20C34410F04A4C4915FF1093781E GISIBSWING
2,422,397,099 *FFFE4E76265C732B0588A49010E34F525AAF5E04 GLASSBOB
2,422,397,100 *FFF4E00693AAD06AD548EF3535817FE8A2F2CF0A GMAKUPE
2,422,397,101 *FFF807FEA06CD496DCA6927203F6869A07A71F13 gnirefre8
2,422,397,102 *FFFAFE8607D5F2C5EFDD7C837318EDA6E3063DFF [email protected]
2,422,397,103 *FFF0488659DFE59D0E4E148A0724F98410DE344D GOTTESDIENSTINANDERERGESTALT
2,422,397,104 *FFF3BBCB0C5EC8095CB88FD53231EFA16028380F gramima
2,422,397,105 *FFF41E3F1F16566B88D0ADDA365BEF47FC5695CD grozdgue3
2,422,397,106 *FFFC1C316D166573C2281E8FC27A873F31A6A0B7 GUNFIGHT AT CARNEGIE HALL
2,422,397,107 *FFF25100012C3161EAAFFA9DB4AF7C23117B9498 gustavoblush
2,422,397,108 *FFF7F5FEA8E6363933EA0AE279B1A844B20123AE h8a:
2,422,397,109 *FFFBD7C7C46FB24C385824969A416DC3E5C530EE HARLAN.BRAMMER
2,422,397,110 *FFF3B5E5C1AAEAC1FB4968163BDE402C205269FB HARLEY.DAGNAN
2,422,397,111 *FFFBEA412D7EC48C5E3A4D1C7536FF0D6B61C273 HASSANWIESNESKI
2,422,397,112 *FFF30AC073566DA792742C18B3C519E84219E9C4 HÄUTGEN
2,422,397,113 *FFF953418363EC4E15464B15365858483672F61B hava.nageela
2,422,397,114 *FFF0D298D6ACEC77F3375C6B5A7901E8D0537BBF HERMAN.DERENTIS
2,422,397,115 *FFF996B04535CE99346C709348969AC5ACEB107F HILARIOMAYLE
2,422,397,116 *FFFB937B3D5305D712B4FA12B6C26A89FBB05AE6 [email protected]
2,422,397,117 *FFF616F72B853E85171A3E13B3D7B208A86087E2 HMST
2,422,397,118 *FFF50D05242653ABB1AC01DA0D0419F25AF60227 HOW-TO-WRITE-ULTIMATE-PROTEST-SONGS
2,422,397,119 *FFF8AB3CB46C931DC91A17E10E6BDF9E7FCC408C [email protected]
2,422,397,120 *FFFA69A002120497921ED14D3E672C1F497B5938 HUEYASAD
2,422,397,121 *FFF31F7BACBEA7FB80941B241AD441040852DDCE HULKRAKSETEL
2,422,397,122 *FFFA3E0D9974D883ABBF26BC32B615CDA18A33EB I-CAN'T-CHANGE-MY-WAYS
2,422,397,123 *FFF4A2A3276CDF140595DFAC5FB243652BC2308F IIN9754
2,422,397,124 *FFFAAC4FC0E0A8F0CE4ED9C031B32CA9FE0E0A4E ILUVDALLAS7
2,422,397,125 *FFF6AE70B58B2349DE6E4F77C192FA316A5A8749 indeedkent thewonderis
2,422,397,126 *FFF28CD224F22AA94E0AE4E47A237CD6ED6EDDAA INROESTS2
2,422,397,127 *FFF1C773EF692B7E8117E06926AAAC332BBBD4FD irvinnaes
2,422,397,128 *FFF07032B3E1381DEC2021C7149C2E743B34ECA8 ISAAC RAMSAY
2,422,397,129 *FFF8A6FEF2975768E9DCA864B57345EA0EE9C489 iSb
2,422,397,130 *FFF77DC4FCDF14D46C591742004DEB0BAC9CAC4F isisclassroo
2,422,397,131 *FFF1010C68E838A90F4CD6020084787312069CA3 J130394
2,422,397,132 *FFFC50FB1EA81937F5C149262CFA3C3F43C355B6 JA{
2,422,397,133 *FFFA68E1F77BEF4595BBE40FECE3DFD571EFF074 JAGTEDES8
2,422,397,134 *FFF72F0CB8CFC53A49D1C9F2B5B638AF59CC14AA JAME.YARRIS
2,422,397,135 *FFF9BB440247191267D946C1D25BFB9848AD0042 JAR001
2,422,397,136 *FFF211FB69C20EEB48E0819C18E729A8A2A71D2E JARREDSNAIR
2,422,397,137 *FFF1D043EBB22729C025FB9A4D581D0B30E61B04 JARRETTPUCKER
2,422,397,138 *FFF69BDE8FC23211C23AA9374CAE3643159D1BD4 jeremy.cates
2,422,397,139 *FFF86EC39055450996AC652F9E109A3A1FAA1638 jerrellkinson
2,422,397,140 *FFF83D0131DA272EBD23DBE993185059F2873FB5 JHEGELMAN
2,422,397,141 *FFF0DBB1A352CFA5F8A92C7BF45BD78F6C98A52F jittarin
2,422,397,142 *FFF4AC0430E9E0F9601E6F680EB7ABEF220900CA jnvj
2,422,397,143 *FFF613D87A54F53DF09B25675B1A89AACC401C81 johnathoncregeen
2,422,397,144 *FFF852DC1A9B3210523560DFC80433584F85B0BA [email protected]
2,422,397,145 *FFF83649BCAB176B54724DE7CC6905A739B6DF29 jonathangillingham
2,422,397,146 *FFFB8239C7737B4BAEFFCAAD7FEB924ACE1BD134 JORDAN.EVENS
2,422,397,147 *FFFCEEF0FEADBC1EF296EF5979301DD841FF1C63 JUGENDCAFÉ
2,422,397,148 *FFFDD33620D56EBC74B1A7DCF17B2DD3A054A497 JULIEONED
2,422,397,149 *FFF2AA69786BB4758610C5065E01D49BBAD6DEBE JULIZV
2,422,397,150 *FFF384685E37DDA175B50ACAAE8267C9D2371EED JURIDICITAT
2,422,397,151 *FFFF3253B320C65FF18E273D145527245849841C JUSTINDINGELL
2,422,397,152 *FFF2E704C4E0A52B4FB4865EFFA7594D4DBE5472 j^w^
2,422,397,153 *FFF1EE17FD168C976BFA7B653CAF4BEA1E550C54 KALCIUMSILICID
2,422,397,154 *FFFB7B0DC9A9F1D6CE2B4F285480495CBE3EDD41 kareemlippy
2,422,397,155 *FFFD3EE0E6F508B11A7BFE80EE837EC6B72A1275 KARIA
2,422,397,156 *FFF7027E502C4DD4D3C5B9BC2A7F7A5D26BEB59D KAWL
2,422,397,157 *FFF814A59E85BC12A218F29409BFE7719EEABE30 kennithjayson
2,422,397,158 *FFF4A1B0596F8A4A49BCD8F29EF975522DD15146 KI-HIRAGANA
2,422,397,159 *FFF1E59664175B56BECC83B1C302AF085197BE93 KITCHEN-HOPSCOTCH
2,422,397,160 *FFFC8DD660BDF16818DC4933F83387A948F36757 kompaktifizierung
2,422,397,161 *FFF96ADE243E8F8C58F2A2CDD55A9EDD192092BD K%WR
2,422,397,162 *FFFC00AA59331D46298887848BB165B30D15EDDB LANNYSURBER
2,422,397,163 *FFFB0826344B01A60F02B8980A3C27098A4641DA LEIFLIGLER
2,422,397,164 *FFF7AE1DA528B30818E6E5D9274A9A12C90D6BFE lenaray
2,422,397,165 *FFFD6E655EBA64FB701664F37B6D8054DA48ABEB LEONARDHOOD
2,422,397,166 *FFF3B91BECD65E475C897EF163E14E8F47AF48F1 LIB-DEMS-DEFEND-LORD-WALLACE-ANTI-ZIONISM
2,422,397,167 *FFF672B69DD284A31F4024554F43161E7F151361 lilmama(feat.dre)
2,422,397,168 *FFF2BC27759F76742E93D7E723F1B750CBE3FB24 LINCOLNVAIS
2,422,397,169 *FFF02DD0680313B2E203460662AA25665F2D4CF5 lindsay999
2,422,397,170 *FFFFAF2E30A521A863935AB3EF175F6E5EFC951B [email protected]
2,422,397,171 *FFF6D429C24CE55CDEBCE2AB8F2C8306370957B4 [email protected]
2,422,397,172 *FFF5C62922925C673D51343268D6F845CDB2366B lock.your.door
2,422,397,173 *FFF173BEC37FAF8C7623CD28BAFB5EE494C1C268 LUCIOSIMUNOVICH
2,422,397,174 *FFFBC762AE23D6DACFAE9FF6E4D968B342926E99 [email protected]
2,422,397,175 *FFF6BF7029CF9BE6D299DD52ED3FE0B79F42FFA8 LVIVMADE
2,422,397,176 *FFF94A50F6C0B0D97614B2B7A9F0ED8C7849655C lx]]
2,422,397,177 *FFFA18155DAB15FBC8FE1449AC5DEEDECCBA6E72 MAGNOLIASMARRIAGEANDMANHATTANBLOGSPOTCOMMAGNOLIASMARRIAGEANDMANHATTAN
2,422,397,178 *FFF2BE2813703AE0B2DFA5B24D937CB5871BD6E2 mallico1
2,422,397,179 *FFFE4BA938F8912B265E1846B2B235A722CE040E MANUEL.MCCOIN
2,422,397,180 *FFFB12139D65481CCD5D3E8E8CDA20C531D86C9B [email protected]
2,422,397,181 *FFFB1B1B37AB9D2F1716082B041B374AA52C6898 MARCELOBUSTO
2,422,397,182 *FFF7DB626226497251AB9069D465B187E1A619F2 marcoposkitt
2,422,397,183 *FFF8152D4782DE42E72E0A43F8102FA24226E0E5 marcusabdullai
2,422,397,184 *FFF72789E6703472B6F064434B827F9FE05E8C53 MARQUISMALABEY
2,422,397,185 *FFFCCB4198082429297837FC4A7DF1FADBD082FD MARY LAING
2,422,397,186 *FFFFA91623465FB3C061A014D6C6ACDB0CDBF1A7 MARZIEH-MORADI
2,422,397,187 *FFF112CF689283111C3EF8334C5797D0A17D9538 MAXWELLMOBERG
2,422,397,188 *FFF68090011603A911ABC26FBF49B02F774069C8 MAYNARDAUTOBEE
2,422,397,189 *FFFC245A694782CD8FC15EA0AABD193969BC4CB9 MEANS...MAIL
2,422,397,190 *FFFCF8AB74DF36E69093D68A2444FC89109BB875 [email protected]
2,422,397,191 *FFF8E1C59F54D3B5A35B2F3AED1A1B72D16E85E6 mejlbro
2,422,397,192 *FFFCC8962798C36121D1C72BF299203A66EE1460 MGOEKLER
2,422,397,193 *FFF34D657927FBFE2C7F13AE111441EEB345E557 [email protected]
2,422,397,194 *FFF89A29A3D7F700DEE22DF0FCD8F83A7056F96A MIC
2,422,397,195 *FFF44209F2AF898781BDCD5F7E063022E542950E MIKE.ERMATINGER
2,422,397,196 *FFF308879C42217E92E63C4A06B79055C85B8CC0 MILLARD.NIGHSWANDER
2,422,397,197 *FFFAB62CCB3CB34EAD542C0DEAE7855E776D8466 minton1
2,422,397,198 *FFF07853DB322E44C2B2D1A532384EE178E3E804 MISTER.MOON.-.JUNE
2,422,397,199 *FFF58B1F47B9E455B294BEC2949290A202424E89 mniarf
2,422,397,200 *FFF76D798924104B6EEC594A8B7D2FD3E959E9AB „molenbeek“
2,422,397,201 *FFF1E4B44F1FE8B304CEDFBB12B3643960E9EB4A MOSESSELSOR
2,422,397,202 *FFF08761B635F277164709CACB58D971E76765B0 Mr..Bachelor
2,422,397,203 *FFF5B2402293B576084B7D51A41224D88A50AFC8 mrnicole
2,422,397,204 *FFF2806C280250C7843D3DD9B2A0C74D33676DAA nathanhartlep
2,422,397,205 *FFF5B8C711FD22BA6FC564DCFE6B6E10C6C00C82 navyajonnala
2,422,397,206 *FFF644415142F8F2BE367FEF1F421948C54F7153 ng3nou$ly
2,422,397,207 *FFF3E4A23CB5AFCC83CEB6D123438066D5FA57EE NIAMA-DA-MOLIA
2,422,397,208 *FFFAABA2BD27D11D2F864B92180470D8817434FF nicolasteter
2,422,397,209 *FFFF2F7AD2262215790BF87FE95F9388748AF881 NITAIWEKAS
2,422,397,210 *FFF82EB1057088FEFAB651696ECC4E16571AC525 nomineraing
2,422,397,211 *FFF4FD35ED76A51578013C842CB5E8372F0FF25E NO STEIN
2,422,397,212 *FFFC98E26D9AC09EB5CD89E227F6BA13EBF29B7A noticiasentuidiomac
2,422,397,213 *FFF8F526906CB146C16EE58ECA7A7E555DED39FC NOWMINDHISLI'LFONTANELLE
2,422,397,214 *FFFF99D7B510C8C42278A48A2C9262586D3DCAF5 NP_035336
2,422,397,215 *FFF40BD0F97D7A182C32201B64DF23987F62C947 nucl3opla5ma7ic
2,422,397,216 *FFFE446315F95920564E65B8BC943CACAD65F22A oalwcd
2,422,397,217 *FFF76F6DB411EDFBD4904E391E064FCDC98873F3 ODELLWALKOWSKI
2,422,397,218 *FFF43442D77F8122232FA2BEC63D6B7187BA920B OFFKINGDOMS
2,422,397,219 *FFF2C4B7718D392BEECC25179752258433220815 OFF.THE.WALL.CANCION
2,422,397,220 *FFF359FE1ECD560677D7A33FC2DAA7DFB56181BC OLD-LEAD-MINE
2,422,397,221 *FFF5CC1837F1A95E7C695B4A9EE49D4BD1DBECFF OLENVANROEKEL
2,422,397,222 *FFF6A730B79E125952407C205224F08F543851A2 OLINGADEN
2,422,397,223 *FFF31BF0F1B94AE1AFF117328B7A99033D56E670 oliverbonatti
2,422,397,224 *FFF2EBA77F69DFEC534E5431529F96C2A629D91B O.Magnum.Mysterium..Carol:.O.Magnum.Mysterium.(2)
2,422,397,225 *FFF5E31A6B87D9ABD0C620A99145D2228D8872FB )O(o~0~d##P
2,422,397,226 *FFF56FBB6EC13AAA969206D82FCED18BD976DD9B [email protected]
2,422,397,227 *FFFCE0976140E86906D2C42AE3BDA7765C592E0A ORGANISATIONSVETENSKAPEN
2,422,397,228 *FFF05F3052BDC515B5B86AB89766F53EC8049017 ORVILLE.HIGGINBOTHAM
2,422,397,229 *FFF0DFE363E723F8400E8A64A4AF71A2BC2226F7 OSCARJEANGILLES
2,422,397,230 *FFF01B7492B6A63F5D5225FB129405F9C096D011 P4\,
2,422,397,231 *FFF2E00559F398F6C27358DCA0149F84F16F2861 PABLO.BUYSSE
2,422,397,232 *FFF01392DA59E05B00A50873EB4A86629139B1A9 papiaye5
2,422,397,233 *FFFB53433E39B0D0B86AEC08E82C4FFAECF8974E paulsowers
2,422,397,234 *FFFA5B3849F914BCE7F4F3AD8FB52E5C6FE1920A PEASE_BROSEP/I/Z_BR/OU/Z
2,422,397,235 *FFF4BBE2C311A895105DF292CCBB2F4C3ED6BBD8 ph0t05ynth3tic
2,422,397,236 *FFF50927CEE92E8D5659D4AEB5463E2F7A3B3B71 PHILLIPDOVENMUEHLER
2,422,397,237 *FFFD40A6DDFD232CBAF6A65013A12AE1528953C0 PIPE-BOMB-SCARE-LEADS-TO-EVACUATION-OF-COURTHOUSE
2,422,397,238 *FFFE4873C862696C1C72741710C20B665AFEB858 [email protected]
2,422,397,239 *FFF21F0127FADC78C9E3A9A184EBE87F7EAE788F POSWINSKI
2,422,397,240 *FFFFF24CE2ABACFA37CE8991CF2236836A8FFEAB profund8
2,422,397,241 *FFFCF1E7F95BC754B95929E11D14802F196FE5EA q=====)~0~oSplat
2,422,397,242 *FFF20266205FC3EDE602BED44C0AB93BE75E277A q-b ~o (0_<)
2,422,397,243 *FFF1D8392D938977D587BC3FD0F4A7B1C4F2254E [email protected]
2,422,397,244 *FFF424770491E100584870F686656F8AA01C6786 QQQQbbs
2,422,397,245 *FFF2B6630A084764038B833D61251C4CEC137405 [email protected]
2,422,397,246 *FFF76FAC969B72BD06E34E54177EF0F109648FBF QUERIED
2,422,397,247 *FFF6A1F283524097F3FE92B41D274412E989EB91 QUINTON.DENNEY
2,422,397,248 *FFF081CF12B9E645EB88A94A3D70C07795804F0B R3DOUB7AB1Y
2,422,397,249 *FFF4D481E7B1CB9D0ECD1E822ED307939791A46A raging-bull-(feat.-actual-fact)
2,422,397,250 *FFFADFEF767C4FAD528E3288BA338CF4EC5EA61F RALEIGHBECHTHOLD
2,422,397,251 *FFF59BCB42359F2E8A9A395BF838F276EB10A4D9 rally.pak.best.of
2,422,397,252 *FFF3B624D767A093A0DA6B19657D8D622DF791E0 RANDOM1942
2,422,397,253 *FFF2E606045C496B58B64203662086A106C176C4 rcimpnyfa2
2,422,397,254 *FFF3C14E17391784AB341320B0A5E9E484449D6D REFORMISTMUSLIM.BLOGSPOT.COM
2,422,397,255 *FFFEE1705B106D3CA01D37A4A7C4B796F1C1527C REGGIE.PRZEKOP
2,422,397,256 *FFF1A9B2044AF5AE6D48C42DBCE16150B7654AFB REGIERUNGSLEHRE“
2,422,397,257 *FFF68EFCDE592D3A2C12D54C9AF7ACA5767F38BA RƏQQASLARA
2,422,397,258 *FFF23C11ED5DBE78F0493A861851491BEC703B6C REXBRELJE
2,422,397,259 *FFF13C3D3799A7D271753CFDBC52E61837B4D316 RGGYSHNS
2,422,397,260 *FFF4E6E14CC2B96BBCFECD451825075BF45536D7 RICHBOY
2,422,397,261 *FFF6B9D694ED9CE946B4FEB6BEEAD63C48CE2710 RICOMADAGASCAR
2,422,397,262 *FFF52ECF67697228157DDF923F9A00121421FDC5 [email protected]
2,422,397,263 *FFF515CC3C4F19E53FC106DA39AF51659AC3B192 RLIEBE(1998)
2,422,397,264 *FFF2114134E7E9E8C9576B9674149580C0C70717 ROCKFORLIGHT
2,422,397,265 *FFFA20EDCC7537C060361DE5FCF2D7F5C81F9F88 rontroll
2,422,397,266 *FFF6F0F78FDF16C9E00C6C56B07C2E799AE602C6 RORSCHACHJ
2,422,397,267 *FFF8A8B3C22994972A9EAB6C08EC693E90D309A9 rotorcd0010
2,422,397,268 *FFF40A7DE265DFCCD01EC3C865CBFB9C11710DB8 [email protected]
2,422,397,269 *FFF7A1ABFDF93408CDD0DEE0110E5CA30D9CC9B4 ruegnev1
2,422,397,270 *FFFECAC3C6464F5C18EDE15262C3C13460A033AC [email protected]
2,422,397,271 *FFF1D792A82D7089281D1991AA054374324350CD [email protected]
2,422,397,272 *FFF0D702E6CEC7E31C31ADC8D68D6F836D7C1EFD SAADESSAAN
2,422,397,273 *FFF0A6C7CED9DF792FBB9D25A888F86C2709D837 sammietolson
2,422,397,274 *FFF0226587FAC2E002A340DAC92C7A0CD2F5A64D samweyland
2,422,397,275 *FFF23D725EF983DA7A8CD74A7A43FEA4628C0C8A SANFORDBORZEA
2,422,397,276 *FFF22ED548D5CC5E64CC81B3B224A2B12A52A564 SANTOS.TUPLANO
2,422,397,277 *FFF9FE74F779C2241C26BB5872A614087C143608 SARAH.JAYE
2,422,397,278 *FFFA164A0180B55B4213B269774C923E8C4BD91C scampelo
2,422,397,279 *FFF4AEE21E25FEABBDD17B96B750E77FB15CE7F3 SCORIFI3R
2,422,397,280 *FFF171FA659DD27357E96CB81925D6F455D2ADF0 SEATTLEBLAZER9
2,422,397,281 *FFF784E8054460681D9C270CD88F6600154DC960 SEENNOISIVORPPA
2,422,397,282 *FFF9ECFFDCCC6AE5F1F25E554788A5D095362064 SEMERROR4
2,422,397,283 *FFF8287288BE2D07F952678E606C03D496938C9E SHAREDQT
2,422,397,284 *FFFA2CF6E235B824A2B066BCA999B2FCC51CD289 shawnwisinski
2,422,397,285 *FFF2EAA2E0FA204C3CF1C3E279F116A8D59559B7 shelbyhatley
2,422,397,286 *FFF5B66B480304B94B969ED1B2335FD311FC7E57 she-performed-oral-sex-on-the-President,-the-President-fondled
2,422,397,287 *FFFF98CECC265F0934B3A0F1BC39240215EAC533 (She's.Got.A).Brain.Scrambling.Device
2,422,397,288 *FFF64F6554031865C049789E7CC4DAF758E0F56D [email protected]
2,422,397,289 *FFFA5CE97BD638A2B6BF2778EBAF81AF65F1C157 SHOOTERFOX
2,422,397,290 *FFFB3FE54BA9AFA7465397BFB18D2BF8E480B991 SLIMMINGA1
2,422,397,291 *FFFBFDFF747AFEDE0D3D5CF3852FB0E9CAEF3570 SLUDRAE5
2,422,397,292 *FFF956E0A5F6344233211E8B2B47FE0615FC0DEC [email protected]
2,422,397,293 *FFF611820D70842EDF95C6F154CBC51C6C1311B5 SNIPERSTARWARS8
2,422,397,294 *FFFE335B127414484457A16F5FD3473EA59D71E5 SOFTWAREPILE
2,422,397,295 *FFF12684D7D420F77B12814D3C98C6C06C7DC485 (s.o.s.)-tasavallan-demokratia
2,422,397,296 *FFF9144F8BE0A9A01BF3DFC8EF289A0EA74D565E spravisti
2,422,397,297 *FFFFDB01877D02F3EEA844E0BE6FF63CA36A0B5B SPRINGING?
2,422,397,298 *FFFDC1F1577B027B9B63BBAE31CF04C4827D188B ST<
2,422,397,299 *FFFD179F447084D5CF97B5F30A00EFBD9F522DEA STEELDE7
2,422,397,300 *FFF8BE34EC74E8421D1CCD1594BB9A9A07E5BFD1 STEPHANSILVERSMITH
2,422,397,301 *FFFDBC6B80F1EE42B6082A310D45E82BFB20EF67 steviestudt
2,422,397,302 *FFF68D5B1D363E6E392D20C7C6ACC3FBC5BEB9FB STINDERS8
2,422,397,303 *FFFDABB9492B1BB59061FAF252384C7B1AB201FC STINGRAYOBIWAN0
2,422,397,304 *FFFACB2062434B277295B1D2356F42352F465B22 STODGES
2,422,397,305 *FFF9B3C61F68A641E9B6C4DA577E4CD40398E8AF STUARTHERCMAN
2,422,397,306 *FFFF06A29829F7BA43F02D4D1AA22391A0F85078 STUDIOUMGEBUNG
2,422,397,307 *FFFA394869843F71F48084E79598B6E27196F175 STURSKASTE3
2,422,397,308 *FFFFD6D3EB751445E429A3F34F77912A4AA42B7A SUILEN.AMINA
2,422,397,309 *FFF786075BCE883DBBF84621BB82E98AAA5BDF23 SUITE.FROM."UNDERGROUND"..GOOD.JOB
2,422,397,310 *FFF610F02D3713BFD9B579AFF773DA5D539167D0 [email protected]
2,422,397,311 *FFFFCA034416F7BEDC1C5730C425877CA3C596EA superhard
2,422,397,312 *FFF6AEEFD28944E6E3DD34C99FF916F67836BDA8 Symphony.No..77.in.B.flat.Major:.III..Menuetto:.Allegro
2,422,397,313 *FFF6CA3CD3F83A15346A4FF5D166163EDE79257E SYNTAKSMSSIG9
2,422,397,314 *FFF737A96065B8876573BC1FA1E3A179D4B1DFFC synusie1
2,422,397,315 *FFFD10C60203E566C98D15BEFAEDBAC3361209A3 tabernaclemoseskevinjconner
2,422,397,316 *FFF5605E2A99EF4CD7B169A53F88FA7C48D335D9 takakuch2
2,422,397,317 *FFFE605B40E79301AC1E0B9DD5E5299E0FAFC1E9 talkiest
2,422,397,318 *FFF0D3C6094D5EDDCDCEACE526410D6461C0B96E TAUNGUP
2,422,397,319 *FFFAFD79FFDDB93EBDB898A4B31CB9F58D48E75B TELEVISIOMMED
2,422,397,320 *FFF4D11D0DFF1E742AFE3ACD84030E7279FA3C2C tergiam5
2,422,397,321 *FFFB7091192A45D2C5EB4FB2FC74C4B819F9CA11 thanharntson
2,422,397,322 *FFF6725F5AE99458F2FBB3F9A9A82353C06EC758 THATDON67
2,422,397,323 *FFF83728D91E70F59DE2D0D245B227FB1308E206 THECHANG0
2,422,397,324 *FFF19C0FF05E3D3CB33CA709407D54F1594DC53D TheWayIDo(featCheeks&Baby)
2,422,397,325 *FFF7565863AD88C57DE45D3331A2C7D0DACABC66 THUJYLTHUJYL2
2,422,397,326 *FFF659D48C25689AFDD7330E78E28CA823552727 [email protected]
2,422,397,327 *FFF86D27DD26B48846CA42E535B8130C4E741127 TMONSERRAT
2,422,397,328 *FFF4D80347A1F7366E8DD834D8E273BA2B152748 TMPRSTMODES
2,422,397,329 *FFF504613806338B2ADA2405405A30368D9FD8ED [email protected]
2,422,397,330 *FFF016F6E6A53089DCC5085691C78925D45B954A TNIERPME9
2,422,397,331 *FFF409D5EA0606717325C58E90C4723667E7BA0C TONYOREJUELA
2,422,397,332 *FFFABC7027F76637CFF01A0888803A2E1CB37B71 TORTUREEYE
2,422,397,333 *FFFE7682F15C8FF1FC362D661606607981F49EA6 TORY.DECUIR
2,422,397,334 *FFF51459BC614569D9BC1449E49C77C00D8A0A2A torymcadoo
2,422,397,335 *FFFA67E0CDF7278D1A981A22311FA46137D75619 TOUSSERAIENT
2,422,397,336 *FFF5C15A5E2B35CD76505627A72D777E8095B57C trinidadonan
2,422,397,337 *FFF36C962EE84ED4D4AB75DC7D2EF16500DD8057 TROPOEA
2,422,397,338 *FFF159C9110076F05AA64CB72F3F6CCF1C0E52CA TRUMANSIMS
2,422,397,339 *FFF46886EC5A5562C116B6A914BD569FFA2CC413 tschader
2,422,397,340 *FFFCCFE6EF14F7156DF088DC5C0CE76B9FE7DF53 tyre
2,422,397,341 *FFFBE0742FBC08CCEA70D77CDA85668C2A611072 TYSHAWN-KINGSBERRY
2,422,397,342 *FFF7FE77175D937D9D372B81C26CAEE8FDEFDE6C u5cqyodhom0xixpn
2,422,397,343 *FFFE47C5EB9648D33C405E2BE7B1A7D104D861D1 UDSHCIER5
2,422,397,344 *FFF771B2B0AB7E3D0436D4AB72EC11485618B038 uenisti4
2,422,397,345 *FFFDE618835902F3A38FB6928C8483B8DD762C05 umagradinho
2,422,397,346 *FFF452EFB030F1F3B3D505F49BCF243ED7554ABB USERMINGH88
2,422,397,347 *FFFB56D9E1C44F0934FE566D64C8641B93876CC7 USERSLADEBYMEIMAGEUP
2,422,397,348 *FFF460F7F2DA0F47F9427C6E251C98D1473296DC U*V4
2,422,397,349 *FFF905CBF64271F8266F4A9B09905AE994DC2B29 V3PRO
2,422,397,350 *FFF19694070B55D8A0BF4A5134CEB0AA9C62646D valerie-villar
2,422,397,351 *FFF50F7AA17554C84EB95850FA77AC016BC0A5AC VBVJXHYD20
2,422,397,352 *FFFCBEF5806BFFCB9B9D93EB3DFAEC5813BFFC46 VERKRU"PPELTET
2,422,397,353 *FFF7D428C8AB5A406CF90121D9F7FBBAA5DEF39D VERZENMAKER8
2,422,397,354 *FFF1B79F03EB7B0797AFACA9C35AC84A165DDB90 VIKTORS ZEMGALS
2,422,397,355 *FFFA56A1E8AEB176B8D1A0E3FF66AF9E4413FFED VINCENZOQUARESMA
2,422,397,356 *FFF1D2DB18621E61DA67E7EB9BB70FD8EEA5F4FC VISAHOME1
2,422,397,357 *FFF5395CFC714352AF3431F89DE14241505E5356 VISCOUNTESSES3
2,422,397,358 *FFFA3ADA39DCFD3A9712F7BD29767AF8E2F90E9E VREUDENTHAL
2,422,397,359 *FFF20C4DAA3701D6659435124E840B6436A6805D "WALDSTEIN"-PIANO-SONATA-#21-C-MAJOR-OP-53---ALLEGRO-CON-BRIO
2,422,397,360 *FFF01D979932AF1CF185ADDFF71C1B497F238935 WARNERJABBOUR
2,422,397,361 *FFFC3A0B958ADB6759EBB8257203DF125FC53D2E WATERSTRIKED
2,422,397,362 *FFFBAA4C278661FF40E868482F1B3ECB2B705F31 WAYLONARECHIGA
2,422,397,363 *FFF62DA8326DF9DF2FE8E63CFE37778BFE838A76 waynegranbois
2,422,397,364 *FFFB18097A86398CFE33F331A74E2787039627D1 WAYNE TAN ZHI SHIN
2,422,397,365 *FFF2CB253320CCEFAA14E770E63901B5C768770A weiqian9
2,422,397,366 *FFFF1F67FB4799D5DF6F4BD35EE3905533332D45 [email protected]
2,422,397,367 *FFFFAAC198F296BF3225686ADE883EA929C1BC1D [email protected]
2,422,397,368 *FFF333E12348F4BEFE9F6C1FBCB19419B8D7D62C [email protected]
2,422,397,369 *FFFDEBC02C98ABEFFEA7C89FC5185DE33FD00183 WENN.ICH.DICH.NICHT.LIEBEN.W
2,422,397,370 *FFFB0791F1012A9FC139713024215F117EEEFAA3 whydon'tyoudoright
2,422,397,371 *FFF6BF82165E2496A307B7FC205B606A3CC4A7DD wilfordbake
2,422,397,372 *FFF190709767F7A25E3606114D5E5F168ADA05A0 william-hanford-lee-jr
2,422,397,373 *FFF1159BB0A137EF5DC59F3546DB5E0BE3A7794F woman-headed.'w/u/m/@/n_'h/e/d/i/d
2,422,397,374 *FFF4F11BD009879CAFB28CC3A5A61B83FAC38531 [email protected]
2,422,397,375 *FFFFBBB73EC88A87963069211027C6091E6661FC [email protected]
2,422,397,376 *FFFF72F8477588EE6E35521C15CCF6865D911D6F WWW.QUIZ.TV
2,422,397,377 *FFF77CE0DC759E22C3E40767524FE9FB58404714 X-HUSTLER
2,422,397,378 *FFF58456E39B7F6F5B17E4EEEBF1CB9205A9DB8B YAMSBAMS
2,422,397,379 *FFFFF57D78545C69CB251C666DE62B4183EC241F YEBEL.MUSA
2,422,397,380 *FFFC9EB0E3F0DC957EA1428A131A93303D55A9E2 yehualashetgebrahana
2,422,397,381 *FFFABB73AE0418BA8A81F3BF53A17806E2B0E195 [email protected]
2,422,397,382 *FFFE9BBF29DC5B39404FBD085CAEC9C1FB501422 [email protected]
2,422,397,383 *FFFF2320117AAB7A908BD777EC28C22583A6E5B2 YOMAMASCOTCH
2,422,397,384 *FFF0C40B267CB0AF9E98159B16BCD3E1B2E7FE5D yotsaporn.tepnikorn
2,422,397,385 *FFF57962B28CB59638A5F8637C51F4034A4FB74D YOUNGNAVALTA
2,422,397,386 *FFF98AB28FEB109A6CB5A5B5DD61D733D7922A79 YUJAH.KWEKWE
2,422,397,387 *FFFFB005C065386EB047302321FA53EB13BA1449 YULISIA.HIDAYAT
2,422,397,388 *FFF58459E4A8DCA0DEDC47A294220373BD0FC2ED YVONNE.NICOLE.SMITH
2,422,397,389 *FFF7BA10662382C607DD1E2B355CD0621C23BD38 `=Z
2,422,397,390 *FFFC27F2BA2934939AA62608796DC2A387A63AFB zacharyuptegraft
2,422,397,391 *FFF36293A9DDF1D39612135EF17147C9ADC8DAF1 ZACH-MACATEE
2,422,397,392 *FFFC4B0E135F1C9711078BD71B5F6A80949F4D90 ZEMEDELECS
2,422,397,393 *FFF353F4A64B1C9395A1F8A9D67EFCAD5B8B3A58 [email protected]
2,422,397,394 *FFFC766763C693F3E03D9792AF88BD92A7F05987 [email protected]
2,422,397,395 *FFF6C32BA66A5C73832FAEE48A045DEE50629A45 zhestsanchez
2,422,397,396 *FFFA9C51E875D503350B2371177355D4EC7EDA40 zoeb-sheikh
2,422,397,397 *FFFF247EAD1718E46CB59B43D242529AE564126F [email protected]
2,422,397,398 *FFF9D0D90D76F2E289A6F192841AE545CDC7D309 [email protected]
2,422,397,399 *FFFC8FAD7E0C4F593ED470E554AC16F121CD08D8 ZULEIKA-SANTIAGO-MALDONADO
2,422,397,400 *FFF3AB7D8246354C247A2E0430CEAAFF4B976233 ZYHZBB
2,422,397,401 *FFF11314D44E308EE2A99716E81BBA3379BA03FC ΜΠΑΣΟΚΊΘΑΡΟ
2,422,397,402 *FFF0A2F6FEBB049929E41700D15E0F581029881D πίμ
2,422,397,403 *FFFB29AEEC4B25061AD64206B36E57C5233F84EF ροκα
2,422,397,404 *FFFB1E9DBE40CA2B27132A94BA1B1F43C57C9D02 ВОЛФРАМОВАТА
2,422,397,405 *FFF1393FC8C099F8218FA956B958681ED4A82704 новгородун
2,422,397,406 *FFFED5A5E98FE78C29F7983F4E5B6B831355775C ШЕСТИНОГИХ
2,422,397,407 *FFF6EE7CCA9253E0B73196A179206E95793A3135 大東JCT
2,422,397,408 *FFFA0703CA46E6F78A2DE04A863FED983C6B45A6 6RYANRUSSELL
2,422,397,409 *FFFBDA17A498BC9E1D156F0EFB041AE97DE7BC6C 6vzd0fq879
2,422,397,410 *FFF828760987B217DC315DB545B021B6B9690395 6WRONGFULCENSURE
2,422,397,411 *FFF0B0BF2262CAE7693C68D90C938A0F96C9305D 7AATHAPII
2,422,397,412 *FFF51C02CDD90355867E322D9BD1E465E4CF85B7 7APPORTANTE
2,422,397,413 *FFFEF9E0E99757FF972EBD1E5B87276CDFF3A83E 7ARKELIN
2,422,397,414 *FFFA63EF34E2314467665E32155A4F982B925518 7 BAGLAYICIDIR
2,422,397,415 *FFFE89242062CB1F0231A3D8801C052E67DFC671 7BRINUCI
2,422,397,416 *FFF69482C6C11B8A0AA3034FB9DA882C3A63D121 7COUNTRYLIFESTYLE
2,422,397,417 *FFF65E10CF9BFFE00BF74B669D444E6F162F86BF 7PENNYGROOVY
2,422,397,418 *FFF435929F6917259CE4E676AA502D856BFDF487 7RISTATO
2,422,397,419 *FFFB0550B76164B5A85F8EFB57F879E879D44E20 7SIAIRAV
2,422,397,420 *FFF5AB34D9F9E657D988A866F9851ED024D937B0 7SMSITOIRTAPREPUS
2,422,397,421 *FFFEF35E9BB4DA2CD5EBA1E4643F35EC68CB1DA5 7TSEEMDMAAFEB
2,422,397,422 *FFF6C26FEF96405F010CD143CCF4C05E6144F7F9 800SAMMY
2,422,397,423 *FFF35630639AC37D78A8B8F06C0E115C512ED3B4 8AWESOMETAMARA
2,422,397,424 *FFFA66BFE86934F058391A0877F00E5522B4CE93 }8{`-d----3
2,422,397,425 *FFFA2281A6B099BC92351C90DE7FD2FAECB94366 8EDIFONSO
2,422,397,426 *FFF13A3358A707FBDFF6242B275C320C9AE9701C 8ILOVEMARIA19
2,422,397,427 *FFFC7B56FEE622B9A7EF47E40F16E3E32EE6DE37 8NARCHURLY
2,422,397,428 *FFF3C3451DF3F199DB8396D37D49D5B2B907F6C5 8prodefiance
2,422,397,429 *FFF31BF62AB1F26CF9E34D071FDB07F3975A9C1E 90WEE
2,422,397,430 *FFFC40FA775723D01688AFEA580283FB741D0092 939KAELYN
2,422,397,431 *FFF78582439F711A87D0ED4DA4B53378EE85128B 9BSWNIEBSW
2,422,397,432 *FFF8A186953F25616AFF4843629395F31B1359A9 9iluvkissme4
2,422,397,433 *FFFF89E1AA667B3A2130AEAF48AAA9EF05D3B421 9SEGRIERBSW
2,422,397,434 *FFF249BF56CBFBB59E072050C5D9D45697BD959F 9TEHOKKAASSA
2,422,397,435 *FFF95BC89295207421F8FFEA159B5DC16F29A9D4 9ZOMBIEGOLDIE
2,422,397,436 *FFFF806BD84F2F89DD46227C0D9A2E671D73D593 A'1G
2,422,397,437 *FFF4C410FB008C7A7CD8CF9E06E55C8C2C4E5929 aab5ru
2,422,397,438 *FFF5FAA113E550D16056D4DEAB3DA3BD207AD0E9 ABRAHAMROJAS
2,422,397,439 *FFFFCB6D230A7462486892A295BA508B3D87DE71 ABVUZ
2,422,397,440 *FFFE266E27EC26F83A466A3D4588DD46CBD03493 aez=e
2,422,397,441 *FFFACE6886113D72BBD4158F5513AAEB5FB912A7 ALARMIST
2,422,397,442 *FFF460609DA844455DE4195C1E6E46305D6B0104 ALKIDAF
2,422,397,443 *FFF2DEFFB0B21684E97BD355CDFD60A0493F5F4E ALLANMELENDRES
2,422,397,444 *FFF080DEFCD34539A81B4526804F31DF7FF0B1FC AMIEZINEK
2,422,397,445 *FFF00D9099E704F51D1071C24248F8AB2BC0C310 AMMIMUNNO
2,422,397,446 *FFFD664AA836CB88048ABCE3C06B517CEAD6812F [email protected]
2,422,397,447 *FFF2DF75C67C409D272FB8704F9CA01B6BD29515 amy-bayliss
2,422,397,448 *FFFE09600FE2C9416E1E107187768BB13F5AB9C4 AMYGIER
2,422,397,449 *FFF4D6D45343A79A512C4231EEFDAC6569ADE477 an"$
2,422,397,450 *FFF98D4949DFB3F6DFD3F7260D5AF9492BC3BCE8 a_nkp
2,422,397,451 *FFF7F83566440375C0C61A09698CBEFD27BA0FBB antoinerahm
2,422,397,452 *FFF75181BBF0BD4866A35BA03F8617CCB051C366 an%x
2,422,397,453 *FFF3DDD4E81E716320E8AAE871CB2A126BB78392 aqw&
2,422,397,454 *FFF73C7B2B1ACBE80E00D286EECEDBFA2E02E3E6 AR!I
2,422,397,455 *FFFC6C252809BF90AB3A51C7EEB0E857F7895CC1 ARINAKAN4
2,422,397,456 *FFF3872CF256E22AC069AD6A58E84438F5A5C9FA ARON108
2,422,397,457 *FFFA6CDF641B0C302632E2BAF5A55E1CB04AD8A6 ARROSTISTI
2,422,397,458 *FFFC8BFB00C89EFF6039CEB297BDB68F39265ABF ATHWQSB4
2,422,397,459 *FFFB4B679164C2BE130A9D68686AAEF2A168A3D4 ATNAFNI4
2,422,397,460 *FFFCED6463479899A816150D2C58F07051549917 atx8s
2,422,397,461 *FFF2CD4F0079BB50FA2B3FC951862362B9A1F5C4 AU;OW
2,422,397,462 *FFF8E09CDB9E59AD9C5A238763B03C6A300E0627 AUSTINPASSE
2,422,397,463 *FFFDC8D51187D6B66E11FA2D4E281E188FC6FED1 a)v$
2,422,397,464 *FFFB34EE43AFA733E75A92A67FB4B80516C2474A AVINDE1234
2,422,397,465 *FFF38C9CC70D2B49517669E8094AA9B41D03E522 A:ZLL
2,422,397,466 *FFFD02A8D83CAA8F84F9A6667262F7A08083324E B#).~0splat
2,422,397,467 *FFF25E5DD2FEB1BF1AD5732C8866399838DE94E3 B684E
2,422,397,468 *FFF84107728AC197DCA135A776A1342B4B7C4393 BAILEYAIKMAN
2,422,397,469 *FFF42A2CC74E9F4147779E8F6100997AE3090E90 [email protected]
2,422,397,470 *FFFF3A848AEFF854871D004CA23F6EE1743A0C8B bakeries
2,422,397,471 *FFF950D8C72B6923DC0B65B87EDAD2F779C16DAB BARBASTRUM
2,422,397,472 *FFF2C1C5CEBE79C978FB57A043F7AB51E67ECD63 b$azn
2,422,397,473 *FFF4AF5DA54F0B757614033198910877EB9A0C9C beleoancea
2,422,397,474 *FFF51FCEB6192BAEC609C2F657F5DBA09DA105B3 BELOVED
2,422,397,475 *FFFDB1A66456ED46CBC69CA61B6FC487DE67977B BENSLIMANE12
2,422,397,476 *FFF85C13D2A41D72DC475BCAC744A88427DD2905 BEOBACHTEREINSCHÄTZUNGEN
2,422,397,477 *FFFB8884F21BFF5E0B02DC52942F84A2C8E5C75E bep(q
2,422,397,478 *FFF539B5E6EFDCA8F6FA627E59EA18295F08BC0D BILLARY1ECNINER
2,422,397,479 *FFF4B70B744533D95F4E9C33D4BC2464ABBBFC09 BILLIECARRUTH
2,422,397,480 *FFF913F0481B65896EC602AF3AAF9E54125147B8 BITFG
2,422,397,481 *FFF001C325D10E7C2EFFB1D85173CF521E8E7F6F blaaspijp
2,422,397,482 *FFF7EEF4D17AF565D5E5BDFC6C9C19107ED21847 BRAD.RECALDE
2,422,397,483 *FFF84D1DEBCDCA43961231345B1E3F3B26F551C6 [email protected]
2,422,397,484 *FFF1CED0AE567AE0D918E036EA61374EB777D140 BRETT.DOCKTER
2,422,397,485 *FFFE2CBB93F5818C20A1C060EBC2D5CC9062BE60 broodly3
2,422,397,486 *FFF5DF3323C66BE62194E1038AB9C6AC7B325B02 B(SK0
2,422,397,487 *FFF99DACCDE8013698348B3790DCB49F96D4EA90 B.#TO
2,422,397,488 *FFFCFE43793B8496F76A120704616B9D45DE4779 BUCKRODIQUEZ
2,422,397,489 *FFF3E315AB5F60AFE35005578E7A5B56C1920B74 bufordfreelon
2,422,397,490 *FFFE7A9836B06B84A1F22336A20AFAD7441D09DC BULIFORM4
2,422,397,491 *FFF26932CA53D0789BA9E109776AEBB7B10340AC BULLCALF9
2,422,397,492 *FFFDD140E7CC5672A61470F59749A97C8FBECC17 BUT/BEGINNING)
2,422,397,493 *FFF37762C63C79F62040D4063ABA5BD0F87E6FB1 c2}d
2,422,397,494 *FFF52B0ECD2187A299CD93B93831C4859EA97432 c5zr
2,422,397,495 *FFFEDB96A711097BCCBD007887F049456D84D513 CARSON.CISSELL
2,422,397,496 *FFF4C8C66BF71C5880DE248404A18C09A5668BF4 CARSONWHYARD
2,422,397,497 *FFF0E9C263A6FE65A88A4FABF8C63A7CB766A924 CARYJEWKES
2,422,397,498 *FFF3FEDDD45619970693F8EA13469FEE2874E9F3 catt4
2,422,397,499 *FFF5A5BB0AAB184616EADA1BE6F8A958AE30C3FC [email protected]
2,422,397,500 *FFF2DA998FBB898BD5EE7E701C6E3F048296942A certo.su.di.me
2,422,397,501 *FFF7EFCE54C4B7D83D9A1A886C5A385060CFF4E4 [email protected]
2,422,397,502 *FFFF76DFE5B99BF9A82C46ACF3AA6BEDBD1B1CE1 CHARLES.YELVERTON
2,422,397,503 *FFFAB6CEB4FD4DF4CB38561D07B276A691A307B5 CHARLIE.POCIASK
2,422,397,504 *FFF913EEEDBA3108179AB004093A96D53F41A9D6 CHAUSSON: SOIR DE FETE
2,422,397,505 *FFF02139F7370B6A34754D130566FE90A61CEDCA CHELSEAKEEN
2,422,397,506 *FFFFC21755075FDF6B1F33587B52BF7CFC3CA233 [email protected]
2,422,397,507 *FFF58EF274D5D0BC108F1DF4C485689B2CCF4484 [email protected]
2,422,397,508 *FFFDA4E3B47C79D709A45A3AC60BA448579D426B CHF5V
2,422,397,509 *FFFF979C165DF06ACA9232D173B3CAEAE572E0E0 clevelandmcwells
2,422,397,510 *FFF1C7BF782784A81F303D68FF721A1435FB3610 clintwolfenden
2,422,397,511 *FFF128BB213875DD7FAC808517710A20C2DD2D7B CLOSE-HARMONY
2,422,397,512 *FFF83BA3DB7A469E3E391346BA518A7B5C26B365 comedamos3
2,422,397,513 *FFFDAF65203F830828A4A3612DA1D6CA33338B51 Comp1men7s
2,422,397,514 *FFFA62FDAE112D0076E21C9D9A4C3E16F2CE3CEB complicatedmen
2,422,397,515 *FFFD66C9CFB41E994A67DAA5DBCA72947A8F6B92 concerto no3 in fmajor, rv 293, 'autumn', ii adagio molto
2,422,397,516 *FFFFAD61DCD550FFFA4880F787CC050A386A15A7 confuted
2,422,397,517 *FFFA23677F6A87665CAB83F5AB558A3E0B2CF48C contr4$t!ng
2,422,397,518 *FFFA8C8C530D53D581740EC76AD68B9C180435FB CORROMPSED
2,422,397,519 *FFFD1B8B57A8E2FD00D904F1C4DCEB3737BDCB2B COSTUMAREM1
2,422,397,520 *FFF931B7FBF8BE7DE801D0708618572DB3347E25 country.of.fabul
2,422,397,521 *FFFB02DAA398B61B5908A7775D917D310295CCC3 [email protected]
2,422,397,522 *FFF62119D5E3F4EDD94136B401950D040E09E3C8 C:\ProgramFiles\CommonFiles\Adobe\Installers\uninstall
2,422,397,523 *FFF02C3DF1D50CF0F0C6B9B75BA4345D2C35189D c:\programfiles\msdn\msdn9.0\common\1033\_vsmsdnslinks.hxk
2,422,397,524 *FFFAB7647218D2D116D8D0290768957E9708A5BE CQ&NH
2,422,397,525 *FFFEDA191AFAD85CA1B483D8E19B9787A1D4A6C0 CURTISEDMEIER
2,422,397,526 *FFF7000DBE3AAF87A362BC18890F43397AF14544 CUTABILITY0
2,422,397,527 *FFF21A1B4BED0C9FED37439715DF163842707B8D [email protected]
2,422,397,528 *FFFA0C5C5EC4B0AA031F40821C5788FF2F6A47EB cyruskarnofski
2,422,397,529 *FFFCA2814CBEB2BDD569609558CBEA256C8C7760 d!?;
2,422,397,530 *FFF1C8C66AE5B54374B26C3E8BD350BF20C4C051 [email protected]
2,422,397,531 *FFFD4F4B86732296CC6363D639D28704FF63580A DACHSAR9
2,422,397,532 *FFFEF11787450F83B57B46D100C2D594DE51F538 DANILOGAZO
2,422,397,533 *FFF5FE2204557D664D769ABF16BF61F468C541FE DANTEGENA
2,422,397,534 *FFF8F6CA16D38C04A5227423A6A4234774B3CD1C DA"Q2
2,422,397,535 *FFFCDD3FC2DA6DD2A074C57E701EBFDA3E56CB40 DCHAOSA
2,422,397,536 *FFF4B720E2A02CA300EFFDC1ED161A3AA87A8309 d(d,/
2,422,397,537 *FFFD4563476636E2C13544F0D79573C04F073F6A DEPV%
2,422,397,538 *FFFD3627B56D3FAE286C42C6D64287407B413F10 destedt
2,422,397,539 *FFFF9E1B76BFDFEE1D8796D83A188AE92E6A8C6F dexterzierenberg
2,422,397,540 *FFFB16BD37A792643C341DF24E2322709E8280C5 df(dw
2,422,397,541 *FFF584AFB463A310BF91859F82529149EEBEE099 d=ii?
2,422,397,542 *FFF92C2AA4B2B524FF5ED5D6066F5BAB09F6DCE0 DIRENISED
2,422,397,543 *FFFFCF17780F1A05333B5FB9C371402CC35D3E71 DISUADIR7
2,422,397,544 *FFF738A14F57CB713C1BC54F539C732F850F5067 DNA?Z
2,422,397,545 *FFFC8274534B8207CEEBA450D027139DE1948D06 DOMINICK.MCLEES
2,422,397,546 *FFF0427D0739932283D6B236BE3B84C829559ABF DOMINIQUEPLANSINIS
2,422,397,547 *FFF0407943728BE2B5CC722754964BDD6621D94F DONALD-SEQUEIRA
2,422,397,548 *FFF05203FF397A5D0CA6FD77B8F6EFD66380D737 dontemura
2,422,397,549 *FFFA0FF74AC3C4202D20B1652A3462607459B7D8 DOU_GJ
2,422,397,550 *FFF25A1C5F19D91DC417A1F276ED0B58A853265F (><)~ ` D=====P
2,422,397,551 *FFFBB0D5623DE85CDE7A02A83D1F7886C8B189F6 druec
2,422,397,552 *FFF9C8CF31D882F76C15D8676AE26D63CE891A60 dunevich
2,422,397,553 *FFF24C77524F93C3A973B9DD7E04C92C137D910E DVANNAN
2,422,397,554 *FFF37553BA5F2A28BED7062E31BF1AD20A69F94C dvsgrnt2
2,422,397,555 *FFF2EAFEC51EFAD7B89117E1485FBD45EAF3E3B5 EDMUNDOLUESCHER
2,422,397,556 *FFFB151BB78EB8FB6A792CE90EAF3EEB4A6D9594 EGWL0
2,422,397,557 *FFF6A5148FABDBA773B3B07CB963455CB1AB8ACC EKXY8EI
2,422,397,558 *FFF22DF1A975579E3BF35A49E33710983DD9F38C ELISEO.STINE
2,422,397,559 *FFF379169E394E929E339545707CE8BFCCC2913C ellispiccuillo
2,422,397,560 *FFF23AF5A1AB9AFF200651A0B0E49B452195A16F elvisbriar
2,422,397,561 *FFFEE9AEBD2A3B0E8F6A4F878A77B12ADB44EC68 ELVISSTAYTON
2,422,397,562 *FFF3FC86D0BDFAF3D452BE9852A2F3FA88108C2B EMAILTHEY
2,422,397,563 *FFFFB34105F0A3B4F4976E5D1CABAD8BD13A3B45 EMYRJAKES
2,422,397,564 *FFFF210489C299A379CE069A9292E31349A5CA70 ENGNERS4
2,422,397,565 *FFF689F34D60F96F2DC12D91D1C8A28F29012900 ERASMO.FERRIERA
2,422,397,566 *FFFD02CA65ECBB219A942503AACBD23AF96E8B74 ERIKFARFAGLIA
2,422,397,567 *FFF9D3368B44C557AF2AFC3A1288D84C22C8FEB0 [email protected]
2,422,397,568 *FFF7CEA6ACF2BB668A02910367CDF1C8502854FC ERIN.SEASHORE
2,422,397,569 *FFF8D350B75D8F43E32F540BD9637E591E69DBD4 ESAURISTI!
2,422,397,570 *FFFBA2817FFAAFA59DD1A66766531AC4D4D74EFE [email protected]
2,422,397,571 *FFF0DE5F053629FF183DF81230FB2B1A064E07D0 et8t(
2,422,397,572 *FFF5995828DC79AE081CB6498E8D87B89786D466 EYESTALKFASTERP.C.P.
2,422,397,573 *FFF9FB7C7056B3D95DF6FA074206327DA03BB755 F6E90FF25D853CC987309AFE95391C65
2,422,397,574 *FFF60B39BBA2CF730E911CFECEA5DC4F1007C6EA F77AB2
2,422,397,575 *FFF730128E7837BE077D774EFC4F16C0A502AEE4 FAɪƏL
2,422,397,576 *FFF6226E0DFA380FB1D2C109291D999C30C784CD FAHRRADREPARATEUR
2,422,397,577 *FFFDCFDD06767B0D11807E625562143CDF47301B [email protected]
2,422,397,578 *FFFDCABE6B16D2A1BBEDE3F73E0F71636B7684D0 FEKVŐHELYÉN
2,422,397,579 *FFFFD5773B9DD05FD759A8F290EB09DEA8830BED FELUCAA
2,422,397,580 *FFFA8EBEF80CEB179859529EA3C901C7F898AA07 FERDINAND.AKEL
2,422,397,581 *FFF6EE8D79D175340B3E8FEE6C3E14619A3632CA ferdinandbeaule
2,422,397,582 *FFFC4F756843D7B4C4C147060FF889765DC71A06 fidelthorn
2,422,397,583 *FFF83EFE5680E4DC3F21CBB86F33ACD6B737DE9F FIDELWAYCHOWSKY
2,422,397,584 *FFF7C8E4C98A205215487BA6DD742C6CB570999E FILIBERTODEMARRAIS
2,422,397,585 *FFF1A1AE6BFB427E00F00EECB5DBCFD174D3F0B1 fluantaj
2,422,397,586 *FFFF7A6829DE85F6EA17CBAE82353A0342850AEB FOREST.BERHOW
2,422,397,587 *FFF9CA654548DBAE0380BC919B7BCB365AC5D40C FOUŠYWYGO
2,422,397,588 *FFFA3A44EB5251341FEC81C8E34767FD04BE88FD FRANCISCOVERSER
2,422,397,589 *FFF912899563E427AE3385339C1F3861C351A79E FRENCH-SUITE-NO5-IN-G-MAJOR,-BWV-816-VI-:-LOURE
2,422,397,590 *FFF776B937C2376B92E9335760A845762E0BC1E7 frsteinstansmyndigheders
2,422,397,591 *FFFAC8DF4CEED7155A35E5C538789A96B41A97F7 GABRIELAIDOO
2,422,397,592 *FFF566B2416BE634883A679BFDC4EF78F5D3F4D5 [email protected]
2,422,397,593 *FFF76D350475931D76D7A28003C9F0E21865616F Garden.syringa
2,422,397,594 *FFF4CA5A00A19949E535D02D375EB1BB54287E22 GARFIELDMERKLEY
2,422,397,595 *FFF65E20BC57E7066B248A045560F73181885ABB gebaard!
2,422,397,596 *FFFAB975330234D621E10962C6DDE911638DF770 geschandvlekt?
2,422,397,597 *FFFAC1E01E1C2E9A36247D2653615B0396BF98A6 GINNYKLINE
2,422,397,598 *FFF8D183C3F8D0EE294E51DF367E9F27F8B753D5 gionalisant9
2,422,397,599 *FFF91C7284EDA998876840A04866C4A10581CFAA