List database


# MySQL hash MySQL password
2,421,610,001 *FFE38D74EF229EF9701FFF58176F1F75C340F7CF TAKE HEED AT YOUR PERIL
2,421,610,002 *FFE88F1052E7E1E701297002FFC1B4B86B3C9694 X(N
2,421,610,003 *FFE909F9A4A0C2B9F574E0AAAC24851EF5C1829E [email protected]
2,421,610,004 *FFE7C9E11D1AC1D19B6EEAED475924F0A7B8683E yasmine-vandi
2,421,610,005 *FFE522F9D17FCF24BFED310F230DEB1249A6A27C YAVUZ-KORMAN
2,421,610,006 *FFE5BFE3EB92971AB932495BB791616D44EA0EB5 ta voix" (conductor: pierre monteux)
2,421,610,007 *FFE7842442D36D62B81A33E69BFD231E18007EE8 YCICBSW4
2,421,610,008 *FFEDC5E94DD1A85ABEF058568144193E387FBB21 YDROGO16
2,421,610,009 *FFEFEED23C008748A393D3F488A334D9CD86C471 TEMPTATION02
2,421,610,010 *FFE630DCA737B9837D6F9B975AA017A009F9B2E2 TERRANCE.KRAG
2,421,610,011 *FFE2C22A2FB661AEBBEDDFE8B8B7C6BFF1D8346C TEUTACHTIGST
2,421,610,012 *FFE3EF8718BAAA86FD44EC7E9F47EB0EC7514DC0 YSCHAPE8
2,421,610,013 *FFEBA7BB2A7595B4B8FDBE7EB3C88A2CB4B5F9E6 [email protected]
2,421,610,014 *FFE091E6D79839D888E36F28E3D22F5D9ADA4137 thatkelly54
2,421,610,015 *FFE50D50BAE721A7E370F414F567C6AC44045684 YYLOCTYPEBSW4
2,421,610,016 *FFE7E2E67FB32F57134F5A8F8180CD353FDCE9B1 "THE COMPANY WAY"
2,421,610,017 *FFE97FFB8DDB55227D8D7A653BA3FD0E6284D3BE THECURB8
2,421,610,018 *FFE500320BFD8FCDAD84499BE3FA864F6CEAFBEF ZACHARIAH.DEADY
2,421,610,019 *FFE005420B86FAE06C4FD55F6FEB34B44F834A08 zackhuizinga
2,421,610,020 *FFE9D62CD45A27F2C89627DFBD273A62B38CA633 ZALKADERY
2,421,610,021 *FFE2C66B2FFB544053A7418B8D673F64472717E7 THERON.TERRETT
2,421,610,022 *FFECD8C84E13D5026CBDBEAA802AB096F9EDA03A The.Seminary.of.Desilation...At.the.Helm.of.the.Abyss
2,421,610,023 *FFE3D6EFBBDCAFC91B6550850056D877B5ACD7B2 ZEEPBELLENS
2,421,610,024 *FFE84461E5408E411BD4EB872A93CFCB1B917E9E ZHENG KJ
2,421,610,025 *FFEABF447C06876EBBBD6DDB3E246D20B708AA32 ziggomaticv17
2,421,610,026 *FFE893D5ED352B21A55449893C99854EEF979127 ZIGUINCHOR 6 0
2,421,610,027 *FFE38943A6BF4F417CCB37BF04B18859DF0B29FC zig[email protected]
2,421,610,028 *FFE0C829B7F22D49F47F6473A06651F37771BA68 ŽILVIA
2,421,610,029 *FFE0103ECE1D8B207DC90BC749E7E6F85482A2E3 ZINAH.NASRAWY
2,421,610,030 *FFEC8A670EDDA81D81FC75FEA91413A62171B689 TIMWEINHOLD
2,421,610,031 *FFE53A7A01F581275D895DBE212AF12D2C97A54A TIYLER
2,421,610,032 *FFEFC2A418F18EFDE4E99680C3EBA1F2CC78B1EE TNARUGLUFSGNAP
2,421,610,033 *FFE1E8E20EC2BA713BA94489D13E2258C9E87FAD ZWYMIOTUJE
2,421,610,034 *FFECD3BA8CD4444DC55C752913B32FF9E913BE8F zzalsrhing
2,421,610,035 *FFEEFFA1292AE83780C79D762D76769851C78F51 ΚΑΤΑΡΙΘΜΟΎΜΕΝΟΝ
2,421,610,036 *FFEF2CE89BA4B972A03A5F230F324BF5F00E5553 λακίνιον
2,421,610,037 *FFE113C3EFB93C2278DFCE65B2DD25B9587D8F7C TOUCHIKU0
2,421,610,038 *FFE35C5751F7817AE985787F530613DF51F39367 [email protected]
2,421,610,039 *FFE610C0445DEB41F238AE09062513144EDCD3E8 TPCTHTHR
2,421,610,040 *FFE9BDC6B3E8E1B893833FEA4DCE78CC90C1258B TRACHTETET7
2,421,610,041 *FFE1093A5A03232C5816055CA6DC4F6E518A1593 ЗАХАПВАЛИТЕ
2,421,610,042 *FFE98B4674374F7A0DEE8791F5DA1CC10D2BF573 ЛЮБКЕМАН
2,421,610,043 *FFE6B9D67A68F833C81F15FB74C6472F272E14CD „МОБИ
2,421,610,044 *FFEE41C0B459850C043B84B31D4C9455DC8D2A29 НАПРАВЛЁННУЮ
2,421,610,045 *FFEA92796A8C25E26F0CCA38347332720B674407 TRAVISCACKOWSKI
2,421,610,046 *FFE41E2281064016F60623F58192071AD88A028D ПОМПОННЫЕ
2,421,610,047 *FFEBF966E00EEB6510923139AD65DF4496163826 ПРЕДТЕЧА»
2,421,610,048 *FFE2BA4C296AAC0975AC8899B92A0AC6F6110099 ПРИПАСЫ
2,421,610,049 *FFE00CFED8C9805B0021011C5A003E58E1C8AFDD ТАВАЛЛУ
2,421,610,050 *FFEB376F29071F1113C162CB792ABFB39FF1EC36 тундуш
2,421,610,051 *FFE4D55FF0D71E6304BBB556287A0BBEC59D88B0 ЭЛЬФЕГО
2,421,610,052 *FFE080AD58E8A642CEDBBA93BA64F5EFCE64EEE8 師団はベルギーに戻り再編されることとなった。ヴィットマンの第13戦車中隊はSS第101重戦車大隊に合流する。大隊は
2,421,610,053 *FFE31929A3491714C58F65CC8A18CCF4F03129E8 TYRELLCLYMER
2,421,610,054 *FFE1F82979C16D3398AB11101F839B1E161C8328 TYRONDUNLOP
2,421,610,055 *FFEB04DC58F407B5C0E82B7CEE327C0C5CDCE5DB tyroneimaino
2,421,610,056 *FFEC177022B36AA776C20EADB17154F46F3CA4EF tyson-tellez
2,421,610,057 *FFEC179AD2385537A4B13F60E86926F807162DE7 身長162cm。b85
2,421,610,058 *FFEF3ACFCA2FF2113B73791CEB276865B0A22041 [email protected]
2,421,610,059 *FFE1CAA990CB20EBA1E8FF8B91AC1E19228C6D2B up$id3
2,421,610,060 *FFEAAD7D0579E560CD478B9DCFDDC910F06DA6F9 01271683
2,421,610,061 *FFECD2DD19F79571FBF6A7600823A65D6AF48E2A )0(-~-(######8
2,421,610,062 *FFEB24EC5208A45F53D17E8423594B7D7A838713 ۱٫۰۵GR
2,421,610,063 *FFE7A637A2EBC1261B0E4593997E8F720986429F 1135531 RAUHALLINENPATIKOINTITALVEENVALMISTAUTUVASSAMETS
2,421,610,064 *FFE4691C837FF2C0A6044EF89EB7B9BD8A98AD5E 113KADYN
2,421,610,065 *FFE48B4FEF85DEE10B4CE0754ECEF5606FA9A406 12345LOW
2,421,610,066 *FFE68EBFE4E7702C4CD0259EFF05D81B35AECF7A 1372425 THEBILLISSCHEDULEDFORACOMMITTEEMARKUPNEXTWEEK
2,421,610,067 *FFE4BACC76AD391CA55FDED81FBBE5E185F0191A /USR/SHARE/CALENDAR/DE_DE/CALENDARALL
2,421,610,068 *FFE96275E0C77B1A69F9F7F2760C16EC914CCF75 USUREAN
2,421,610,069 *FFE7F03A131518B2EE4329CBF2813BFBE40F030D UU*@--B
2,421,610,070 *FFE778420A4D7FC25EBBC07981D3FD6555D3C196 15SEP1274
2,421,610,071 *FFEBAFEB06D5EADDEEAFB577E0E84369609B6CFD 167ASHER
2,421,610,072 *FFE88F5822556AFBE3B69AA701D1C2028A963DED vaikutusvaltaisimpaan
2,421,610,073 *FFE343CB44761FE1E4224F79E5B5F997E5B3CEBC VALERYCUROTTE
2,421,610,074 *FFE896AEA7BF9F57B46E1EE8BFDF4448DC5A083B 1850086 turnaus-j
2,421,610,075 *FFE8737D104B83B360373299D2F4C48AABAABD3F 1920909 DANNSINDDIENAECHSTENSOMMERSPIELEINPEKING.
2,421,610,076 *FFE3084F2E8161B621882C1CB4D29FB6D3721052 1941868 SUOMEN-KUNTALIITON-AUTOTTOMAN-P
2,421,610,077 *FFE1402CA568367CD1527E077A0D3BA048EAB9F7 1979031 KEHITYS ON KANSAINV
2,421,610,078 *FFE2D01BC4400C4DD0D4704B882674248296ACA2 VAPENLÖSE
2,421,610,079 *FFE8317CCB342D0313270CFB27EFC27EB43F6325 1 BARSCHEL-ZEITEN
2,421,610,080 *FFEABC80E23B0D61CEE562E3A3829AA1FC2F7D54 1.besfestigt
2,421,610,081 *FFE5946394FE24E5C246631D735BF1ACFE871223 VELESEVENTSHASMOSDESIGSCOMPLIR
2,421,610,082 *FFE039F544188DE365711A67F386E056FFD51C0A 1 cesar'lari
2,421,610,083 *FFE0CA9D0C6402048703180F6C6564E3DFB07DFA veronicaceccherini
2,421,610,084 *FFE88C69BB8E79E3BA1D9C065A0D44BC75DD3AB4 vicentefencil
2,421,610,085 *FFEE73DAC3EE202A2F3CB381371A1C8460187623 VICENTE.GUTGESELL
2,421,610,086 *FFE7FD925F3E0DD37F2F869C5A74C904029189F6 VICKIE-KEMPF
2,421,610,087 *FFEE1A7559EEBEAC5B5E218727F2D752864F8F2F vicki.frantz.smith
2,421,610,088 *FFE32486602B1C59AB784139CF903F79DF61A98E VICTORIA-MLINH-BUI-LINGJAERDE
2,421,610,089 *FFE8694513AE393A1250833E9CDBFF943C844DDB VIHARMARATHE
2,421,610,090 *FFE8C8A1CDC01B7365A9502C7F46FAFB72C4E385 1 HERAKLEIOS
2,421,610,091 *FFEC7D22ECCF2C9AC15B83F01E303BE8D2C19D14 VINADELMARESTACI
2,421,610,092 *FFEDE17DD24757C58C94FE92F27EAB8718551031 1.HOCKEYGROSSMACHT
2,421,610,093 *FFE0EFA42588F9A0FC4F691CCE8063BBD474A099 1hvqciqfjbtps
2,421,610,094 *FFE253D2DBC73E2F68BB6F71F258AD8CE4C956E4 1-IMURIASEMIEN
2,421,610,095 *FFE8304276DDBB2BDEFC117D6D7589CC3ADE78AB 1 JUSTIZKOLLABORATEURE
2,421,610,096 *FFE0523D8174DBE3B547EE0523DAF0A5C746B8E6 vmbased
2,421,610,097 *FFE2A43A8AD35D996B320E9A9C757AA78B6A3918 VON RYAN IDQUILA
2,421,610,098 *FFE540E7818833E45E4C0966143C526CB72B13D9 vowelised6
2,421,610,099 *FFEF460EED41C5CC9843EF421B960D57F697E3C5 VVMVKGAM
2,421,610,100 *FFEF5CF53B83C4A9099C19AEE9FE89722AB5EC43 1 provinzgouveneur
2,421,610,101 *FFEF38C7F308C5C00F98ACD59C92141C270BB84B 1ranimaient
2,421,610,102 *FFE739096C707239D030BD3AEAD837AE4FF4B7B9 WAIYANMOEPWINT
2,421,610,103 *FFE254F972528D47DB1073EE0F03B7BEF3E3CAC5 1 ROADRENNEN
2,421,610,104 *FFE748DD63E8B350E99119E61DF479F959FDFDCC walchandji
2,421,610,105 *FFE8E6F301C51722BA48245213801DE144A946E3 wallylehto
2,421,610,106 *FFE5CC6D627E4F849E888FA45D30E60E90840212 [email protected]
2,421,610,107 *FFE5E8DD1B482A5B493295F69194AE1326D5BCE9 1.TANALTAYLAR
2,421,610,108 *FFE3EC8E7D4AABA69B4230416CFDA1A270ECEA0A 1-TANSSILENKKAREITA
2,421,610,109 *FFE787E08B29CA9C0E2F8D4D1C0E9D5E57ECD1CC [email protected]
2,421,610,110 *FFE847418A5BE983B2919B569455B237254C6571 1ulasilmasida
2,421,610,111 *FFE1D0A005769E86F47738C305A7744CEE5E75E6 WAR」に該当する日本名の記事に分割できるとは思います。船舶について知識がないので私には判断できません。
2,421,610,112 *FFE4420E8911D5C9B46AC8339654EA381F42F6BC WASHWASHNYMOHAMED
2,421,610,113 *FFE2FFFFAA43A70DFD22A8EB5CC4AF925A344679 2007-05-22:-le-grand-rex,-paris,-france
2,421,610,114 *FFEB72B36E6C1EC1E8AB4BAD01A3BE53B6AD35BE [email protected]
2,421,610,115 *FFEDECCC0ED07A14F06E39CDD77DC0699AD1AEE7 WEHRMACHTSQUELLEN
2,421,610,116 *FFED647639320836F928348228D81E23DD42A4CD [email protected]
2,421,610,117 *FFEF098D899AF657BE4333540A24E7161AE3DB08 WENDELLNEIZER
2,421,610,118 *FFE0DF93F33DFD393096CD6B5E6E55801C3A0323 [email protected]
2,421,610,119 *FFE53ED534728E409491D2410D0610D8780F21E1 [email protected]
2,421,610,120 *FFE38BA1E2E25C2021DC3BFDC29FE22B4DDC2BE1 233012 nykyisin.yh
2,421,610,121 *FFE34A0E100871238591ED7C33F43ED35F710230 2355089 thesenateislikelytoconsiderasimilarproposal.
2,421,610,122 *FFE6778464D5B1A30B71D99DD114A4CA65008F43 WESLEYJARDIN
2,421,610,123 *FFE31480ED3BACEEB37BDF6F85C803B6D060B777 WESLEY.KNAPPENBERGER
2,421,610,124 *FFEF393B472F1C3847554AA8CEF1C700846F5681 what-the-fuck-are-we-saying?
2,421,610,125 *FFE29353896CF8F4F45C1C12E4F2676F08CEBA39 whitney.fox.lemieux
2,421,610,126 *FFE7B47FE0AB6021814EAE76C2CE1C1DE214D224 2757590 SOPII.OPPAAKSI.,.L
2,421,610,127 *FFE7687FCF8093266B90BEBA008952C9E010214C 2764092 NICHT FUER ZAGALLO
2,421,610,128 *FFE7C076B53D25DD243DF9FA36ED4EFF30EA6F58 WIKIPEDIAENCUESTAS FINALIZADAS
2,421,610,129 *FFE0AE5A574711F69A23D1C13CCDC6CD4615A23C WILFORD.BROWNER
2,421,610,130 *FFEE0B4D401593CCB94A8640679C47E1E476E6E3 WILFRED.CIAMPANELLA
2,421,610,131 *FFE447BD230D7B736EEB3774CA7558C77B556046 willfleckenstein
2,421,610,132 *FFE3BFE98A89AE19FE250B9DF7A9214E2C0DFF38 2 HIRMUTY
2,421,610,133 *FFEA6C3455908AA81FF410BE4EE6EE26AF69F57F wisse'-'martin
2,421,610,134 *FFEDC7BF960D97038C9EE2421EEEF36CE68286AE 2-jonoutumista
2,421,610,135 *FFE669851A9BD2F7159AA9A52476ADB8CA66559E WMCAMELI
2,421,610,136 *FFE44776F1A18D7DDF5B134E7585CD8DE420D94B 2.maakuntasuunnitelmaluonnosta
2,421,610,137 *FFE4BF39C3B0EB64A476FF135576EA81CD6ACD92 WOODROWARICHABALA
2,421,610,138 *FFEFDB625BE0B406C6C8A6039437CAD0270BB319 WORKFORCEGUARDIAN.COM.AUWWW
2,421,610,139 *FFE1C94AF270E6FA8A5ED42FB910EAF877B1F64E 2RECOMPOSITION
2,421,610,140 *FFECB2CB0E79404235C35C9AEFD57F936F9F617F WORMERS
2,421,610,141 *FFEDCBE5558C3A7EE334032F7D2609C390C14916 2SEASING
2,421,610,142 *FFEBC3D870423AF820871FB2B9889D9B79A9A20F wriest
2,421,610,143 *FFE41A53B270792F4914405F2B8ACD69111A88CA [email protected]
2,421,610,144 *FFEBF13227B20BB3CB4CD74C51F6458A17788456 2 TUTKUNUNUN
2,421,610,145 *FFE289CEB830CAC673B0041308F4392EF86AAB4F 2verwindet
2,421,610,146 *FFE66E6252D92B866916EF2C9493BA7C66098FEE wwwhealthqualityvagov
2,421,610,147 *FFE35916BC31A732A234071EFC07A8691029F67E 3221514Z
2,421,610,148 *FFE789C5B0557DD62BE623A29A99214C7E44BA4F WWW.KARMALAB.COM
2,421,610,149 *FFE582F65F5E7B3B8ED6F5812B3BD43EFCB591A3 382918 mine sevInCoGlu kgm 390
2,421,610,150 *FFE07E4BFCC5272FB789290D6171E6DAA6BF668F 3.BALLONKREDITE
2,421,610,151 *FFEC8175A59BD8086260EE0B779E006039F93079 {X}.~`D####B
2,421,610,152 *FFEF1A30C7A8D7BEBAB0B5BE9B99E77966C818C6 3EMPERISED
2,421,610,153 *FFEC93C7323F4CB1BE76B1C29EC618DCD7C29A33 xioleynsaliviomendoza
2,421,610,154 *FFEDE3A37D5D7273EEFE74E97ECCBB6E60E59836 (X)O~0~<B
2,421,610,155 *FFE896E7C82A2BB231D9A97DB128C56288EB6A4E [email protected]
2,421,610,156 *FFE99CA528FCCBF9F3189AC1BD6379B639386EE1 [email protected]
2,421,610,157 *FFEA73B310805B92C410F72472DE4F06E0B65632 [email protected]
2,421,610,158 *FFEE655F45BD29141C4AA9D493E6EF13E5E1450A 3NVOUT4IS
2,421,610,159 *FFEC2456B1F5BF1F6EE59685445AC0DD0B472AA9 XV3W
2,421,610,160 *FFEEAAC4FB570BCECDB49D6179DD01E0E51C7A4C XVIKING72
2,421,610,161 *FFE677D15489B259AB8A91EBC76F48556E17E3E2 3#####P-`~-`~-)8(
2,421,610,162 *FFEDA907F86B21DCD6B56C34F2F0647DD4932C9C YAHERD33
2,421,610,163 *FFE13699920787D1936B84C584D005198C4B45A2 [email protected]
2,421,610,164 *FFEA4095A666CA224BBAEB43E457BE8C99105799 YASMANIF
2,421,610,165 *FFE329E7C0BA3F1C1A9B85BC497C984A3930C863 yatiitay9
2,421,610,166 *FFE0B472AB8AF0F9BCB2957FC402B19FA300C3D1 430178 vermation-,-aestivation-.
2,421,610,167 *FFE3F72F2DAA23A855EB1CFF2B22A7C3A6068C59 470563 diGer.Ozel.repro.film.tUrleri..
2,421,610,168 *FFE94AEB767F9C3340F30620CA5FC1971566D7DB yeoweian
2,421,610,169 *FFE3449DF90CD0F931A39018EC3380D7EBE837DE ynnad-yob
2,421,610,170 *FFE50C57C508D9095F538642BC1FA0DCAE1020AA yoavmizrahi
2,421,610,171 *FFE0B10CA4461DE89297EA31FA6159C552534F47 yosefiendamayanti
2,421,610,172 *FFE77CDC3D2131E29D230F53CE0AB300BC04BD10 YULIAKRISTINA
2,421,610,173 *FFEF958BB3C8303BD9466625018AEE5DFD5CD5A0 [email protected]
2,421,610,174 *FFECF6303BD62C5B4111B0413274969F8E38104E 4-PARRANAJO
2,421,610,175 *FFE1C374AF701ABD79D587BD74D3170AFE7F727D 4SAPPHON
2,421,610,176 *FFE4B871EEBBFE72A56CB7311AB9ABF572E67297 zachary.noftz
2,421,610,177 *FFE72554736B963388BA72FE91F181BE3FD1167A 4.sim
2,421,610,178 *FFED2FE458B1805A40C76951A29729D1BB54992F 4SONGZHE
2,421,610,179 *FFE0589EAE19251E171F08A55928CBDC5250E210 ZAENALFURKON
2,421,610,180 *FFE270EDBE06041B4D448A0A4DAA6DE1AAC922E9 ZAINAB-SALLOUM
2,421,610,181 *FFE04BEA4BF8D9F4B3DB978D24933685AB479C37 ZALIZCI
2,421,610,182 *FFE001CB203B3A5124E7935BED2923149580B030 4WIEDERERSTATTEND
2,421,610,183 *FFEE55DFFF0C065278482400E64F8325E6EC7C8F [email protected]
2,421,610,184 *FFE642330C24FB7C8E585D4C57A3F3CD469FEA6D 513TRISTEN
2,421,610,185 *FFECD7FEAA80CD231A4EABD260C1CE7057E2CD8B [email protected]
2,421,610,186 *FFE9E0C3ED0D07F6C506F26E1A5CFF2EDE98D56C 5BSWPJEFFREY
2,421,610,187 *FFE109D2C32E0C484C2D508B9B195F67AEF7ED41 5BUTTONRELEASEMASK
2,421,610,188 *FFE35795A10B26F2E0843CF2023475F8F96CDD86 [email protected]
2,421,610,189 *FFE893626EFC8476AA4E5347125557D70BAED4A3 zoey-luz
2,421,610,190 *FFE72EEC7D390B6BA3E1E402B57299AF171E9F12 ZPROSTREDKOVATELOVY
2,421,610,191 *FFEA25D3B73E0A62EE86C88803E80DECD0959029 5GEWESENER
2,421,610,192 *FFEDE904B5DCBCE28F176A565F40AD82EFCFA388 5GROUNDNET
2,421,610,193 *FFEF7FFB095AAD9F39F227514E581F418EED757D zxcqse
2,421,610,194 *FFE0C432B6CB8EB711CFD7FEAE1A482A1FB1F56D σχέτλιον
2,421,610,195 *FFEBD91C516FAB00BF726ECD75F8457CA7A5A7B0 5SEGITSEG
2,421,610,196 *FFE062D7FF4D2099D0E8967A6F57E976DA91EF70 5SNIPERHEALTH
2,421,610,197 *FFE43E529D21219277732781118EAE69080E9004 мюратти
2,421,610,198 *FFEE3D2D84ACD8A707A285C4C81C2C6464C782B4 5VERVOEDERDS
2,421,610,199 *FFE36EA5FFE242BF9C33D03D4D05604A6F2D0577 60701Q2W3
2,421,610,200 *FFE7937C20F1169C8AFE889076A50CA3AB49DB58 «питер»
2,421,610,201 *FFEA78F1FE08CF19DD4F6BFB9FC91FF19E17E69D ПОЛИОМИЈЕЛИТИС
2,421,610,202 *FFED22B72DD1B89A60B1F0765BEC0B12AE759B9A САХАДЖИЯ
2,421,610,203 *FFE03898A9B024D3CF79CEC47C005971E2F7312E パリ万国博に出品され、金メダルを受賞。現在ニュルンベルクのdb博物館に保存。
2,421,610,204 *FFEB30661E0E652805986EB492C8AA3DF86A6CEB に判定負け)、WBAミニマム級
2,421,610,205 *FFE43F6AC4F38B588D4732A9245E6E86B0C4884A 6SEMIPERMAMEN
2,421,610,206 *FFE822F216BE748333B562378C7924335EDC8F7E 6UOTNOROY
2,421,610,207 *FFE0C6E11067370D1129ABD40D7CA1A383833F3E 7011112
2,421,610,208 *FFE6E69FB379DD849BE9935D0CD46A2A110F0EB4 7BELANSKY
2,421,610,209 *FFE6AE27438F9CDDE21F67D963540ACB3AD64BAF 7DAXTYLIDIA
2,421,610,210 *FFECA48C6A9B15C6E02B25A80375139BFD011AE0 7DOGMATISERN
2,421,610,211 *FFE95B2C4CF0699C25F609050AF2A9BB600B94F5 7happy8
2,421,610,212 *FFECEEF8C2AA50F34EF3C222145791D8953533F3 7SVINCOLASSE
2,421,610,213 *FFEE250F09FED3163995EF6FB57AA82EEC4DB915 7-szene-treff
2,421,610,214 *FFEBA1461D47C8BF11113F4EED1B30309FE07A7F (0_<)~`.Q8
2,421,610,215 *FFED45E035E536FDBE00603E493FCD25993C8C66 81gmouth
2,421,610,216 *FFEB4AFE610D55D48C46B2CE032F03A329A7BBC1 837292 nyt-t
2,421,610,217 *FFE24049178D2206F082670A87AC90D359D97D0E 1.1ABC
2,421,610,218 *FFE1EDC4DCCA0B4B09D3FC98E8CE4868BC5799DC 11bundesarchivs
2,421,610,219 *FFE00AFBCDE8F5B7990F445C9FF1C43712A95980 1331CR
2,421,610,220 *FFECE5978648F88075A6FF063CDB565D9C0F9066 1396991 PROJEKTINKESKEINENINNOVAATIOONKOKOYHTEISTY
2,421,610,221 *FFE7FA476AF7627FF5182E4DB6A9D5DDCE215BA8 8FAIRFLDBSW
2,421,610,222 *FFE41AEA31F31BF63B4E1DA35EB5AF1E5EFA4126 8freni
2,421,610,223 *FFE6DB80D40633FB89BE09DD31D70AEE3B55876C 18MAYFAIR
2,421,610,224 *FFED3BE84238A0B472CAA3C6A16DC99F3E622C27 19980828:vienna,va,usa
2,421,610,225 *FFE0F1FDC143A43E20787A7B5BB60E5DFFC53E97 8####p**o><
2,421,610,226 *FFE72C7F41AB7458A6549F43266DDC70E37423D8 1BEERDRUMS
2,421,610,227 *FFE393400743FBC99B61110D183C968DB713CD67 8RETSIULFA
2,421,610,228 *FFE901F3A7B74C25DE647634569EA5B16757F3EE 8SAMANTHAVANESSA
2,421,610,229 *FFEDD692F88A34E92348EBA4049E8C6A2E153BC7 8SCHRJNN
2,421,610,230 *FFE5182FCCA246CCB27C26E2EECE6B2C3AF8771B 8======).*.*.Splat
2,421,610,231 *FFE896E68226CB334070DC43D8209AD3F46EDC79 1.dbsa:n
2,421,610,232 *FFE03551110E6340C96AB4138BAE236BCD9B4377 8thebeatrice0
2,421,610,233 *FFE50D2D1BE82E10A7484F6FF193BA28124976B2 1eiammattiin
2,421,610,234 *FFE951451434D7E87B021C8B87BC9972499AD648 916806 tanisindakullanilanyontemlernelerdir?
2,421,610,235 *FFEC52927D9E92A46E710D36F4CD1BE523D2D680 1-FORLENZA
2,421,610,236 *FFE266017F5CC4F66C89C159E907CBEB3FF4B3E6 1.freed-and
2,421,610,237 *FFE5440200FDE7196534EFAC96B1075BE7D3FCD4 1 FRUEHLINGSKINDER
2,421,610,238 *FFEDEE55744581DDF209F9B21652F9A38CBB9EFA 93-FINGERABDRUCK
2,421,610,239 *FFE5BC5B586AB844F5194EF89CD04F09251607F2 1 gulmelerin
2,421,610,240 *FFED3A32A0D5333A1B58D5AAB5F3B9E00ADC9795 985TARYN
2,421,610,241 *FFE6A368A1D59CB519C012EDB7B7356B3B60D7EC 9959FC03859239FDA3851489FEE2BC0E
2,421,610,242 *FFEDD78EF0A474D0EEB3DD139B41132AB3F252D9 1HUONETILAOHJELMAKIN
2,421,610,243 *FFE7FC00106CE2310DBDE14D12AF8B3E0EA8AD5C 9AUFTRIEBSKRAFTE
2,421,610,244 *FFE9FABA02026869ADFF63187B97253CE1A85ED8 1IAMDICKHEAD1
2,421,610,245 *FFE6EA442EA5A7AAABB6DA39F2CD826627C088CA 9CICLIZZAZIONE
2,421,610,246 *FFEC1C6CF3787CF3A7E9093DD831E967DFB46E79 9DAEMTLAS
2,421,610,247 *FFE3C86DE80914F7FEE4184964D678188BAE3646 9FLOWERJASMINE
2,421,610,248 *FFE0F6A6A9A39656B1F9A5D03C7F4F6F3CABF090 1 lohnlisten
2,421,610,249 *FFE569BCAE2C7629B39AA6411971BFC23BF827C1 1PARAPHES
2,421,610,250 *FFE2E96883E9B3DC5D730641AA9431CE6F32B741 9REBECCAREBECCA
2,421,610,251 *FFE5C0E65E17682397B40DC0972C3A9CCD59E2D1 1.RUOTSILLANI
2,421,610,252 *FFE747E0DCCC3ACE6A94E9CCA67981DD9BA4BA32 1RUOTSINKAUDEN
2,421,610,253 *FFED12B982274EF0CF77B7592AFB7F81B2E4C66C 1-SIVRILMEKTEDIR
2,421,610,254 *FFEDBB692E9FA15F02F56CA853616FE4C0074464 1stmovement5bmoderato
2,421,610,255 *FFE2E7C64DA9E5B7A5AB09E3D859B78F9FC8DBEF A0F?H
2,421,610,256 *FFE8CF6FF6BD399F232337BC05153E547CAC29AA A2;VN
2,421,610,257 *FFE008CD7A7F961B3224DB31F67987E4DFCB5891 a5m4t
2,421,610,258 *FFEC21C2766B361B68A399866232F62844C32730 2033225 miten ihmiset jaksavat ty
2,421,610,259 *FFE505BB09B80C51D860EF0DCBF7D53E61A7B534 20lestang
2,421,610,260 *FFEFFA50CCB26CFD5607629F0F76577A86081364 a9=il
2,421,610,261 *FFE088CE322B02525E19F3F815E84AD4D72134D9 2401024 ERANTWORTETSCHNELL
2,421,610,262 *FFE89E8C6B097D1C458CC5EEA1574831FC0814F5 24sad
2,421,610,263 *FFED7897A73A1004FCBFA98AB3B07D535F71B73F 2771012 suomen-partiolaiset---finlands-scouter-ry:ll
2,421,610,264 *FFEE8AD478CE0057061438D6486A8D905B9D9533 282844 TKY.;.TOPLAM.KALITE.YONETIMINI.,.VIII..
2,421,610,265 *FFE2AA4215582BF1A0264927132BCB8AB74F8869 2841100 that.service.will.rely.on.the.emerging.cdma.technology..
2,421,610,266 *FFE72F3EE4BAE54599A2582B463B6D32405982D7 28 SOLIDERS
2,421,610,267 *FFEE13EAA7B03F6EF0EAA80521734681C7E5D885 292NEHEMIAH
2,421,610,268 *FFE76604567AF0835BBE21AB59AA3CD192262D2A 2969791 THESE-LAST-ARE-RARELY-COUNTRY-PEOPLE-,-BUT-URBAN-FOLK-
2,421,610,269 *FFE8AA89988741321570C34386DF8EE892959FFE 2.anwendungsspezifischen
2,421,610,270 *FFED22C7BC56EE1EEBA4C0FCD9F76CDA9EE5967A 2BENNESA
2,421,610,271 *FFE0ED1120F27175320E83856E7507110B0D348E 2 BIFFA'S
2,421,610,272 *FFE7C6679B716C04DB67D874381FC5E3AA554EA1 aaea7n
2,421,610,273 *FFE03EDE3ECDDCE4E96B6486D42373D6EA2167D1 2f809616fe
2,421,610,274 *FFE4D9177F87494B87DD2AD7EB44568AC5BEBE0E ab7-1
2,421,610,275 *FFE886ADBFA1D4C6E9271A37A4153931E7D6DDF9 abecheverton
2,421,610,276 *FFE36D76D5E590DD6558D287C4033D6CE58F43BD abf9:
2,421,610,277 *FFE0DF63B6B2696E671DB3D6121D8EAA3097326B 2.utangaClIGI
2,421,610,278 *FFE7B26E09315CC02C97474DCB89A31852536F01 ABRAHAM.OPHER
2,421,610,279 *FFEA48FAF5FAC531067A7E8FD594AD443C355964 AB$~S
2,421,610,280 *FFE7B52A5F79D7E9B74FD19B45BE433498229F8F absolutdragon0
2,421,610,281 *FFEBF426BBECF21006ACB1CABC4B3FC2AB3F7D08 3.5.2-etheric-body-and-life-force
2,421,610,282 *FFE12ADFD017D4310DF7366A4811357C14B5FBB3 3AECATSURC
2,421,610,283 *FFE43C353AC54776325175E05C0CABB9AC7020CE 3BRIDULLE
2,421,610,284 *FFEA3A0386A8E50BF35DD2430DFDF7C777633B6E A(CRD
2,421,610,285 *FFE862D87D4EA8FED8E613CD4248058ECCBBD48E 3MEDIATUS
2,421,610,286 *FFECE0E0217075BDD77F4EBDA945AA8B5E2238AE 3ONVERKWIKKELIJK
2,421,610,287 *FFE58DC6196F823CF513E10F68C28DDDD2783642 3-->.~O:p
2,421,610,288 *FFE2D9831A4F596FE3A3023425BEEF90FA7D6CE4 adolfoshrode
2,421,610,289 *FFEADED3031FF0969FCDDA9CBDF417AC2DDCC095 3 r mfg
2,421,610,290 *FFEA801A8C4A972A80FA4389F028DD9A5DA96CB8 a!fgt
2,421,610,291 *FFE6DD7385201555467064E22ED4C9E793A5EFC7 AFO0G
2,421,610,292 *FFE9EE9EFD268951A7C472412F82C116E76BEA88 agayagas
2,421,610,293 *FFEC9714358D6D96D59921088C74A49232D04407 agoew
2,421,610,294 *FFEBD823622FC62E2A8DC7F075D7389428E88612 4KOTIHOIDOSTA
2,421,610,295 *FFEFF07998F0DEA30F16EE21AB6B4CFBB7DA850F 4KRISIAAN
2,421,610,296 *FFE084D3FFA54DF17D21E50CF49D4553704F73B2 AHMED.PICKERILL
2,421,610,297 *FFE91EF0FB634BB03AA5EC29FB674E021A219072 4mycindy7
2,421,610,298 *FFEDF7BFE29025224C266E3A271020DDAB1B60E4 4PAVLUSHA
2,421,610,299 *FFEED4AF3AA2946A2DDA40BE08F763920763C18E 4ROMANTIKKENSES
2,421,610,300 *FFE70B350466DC094C7DBC2AD3442F7A4A229DC8 4TENSARES
2,421,610,301 *FFEA596B0FC005D6619BE1E909E3565C9581F09D AKALAVADWALA
2,421,610,302 *FFE0CE52965ADAF733F8552E06F995BEC6F4A4A2 4U+0PSIES
2,421,610,303 *FFE546165FF8A2C07D1BDBE604645729AE58B396 akiand
2,421,610,304 *FFE52B016E0CA2B4361161AF032E0323B025F8A2 59573M47IZ312
2,421,610,305 *FFEAD8582C2A652FEB0EE34E98FDD08D6E77C931 ALEJANDROVALLENTINE
2,421,610,306 *FFEE2CFC272A2C244E85ED4E2E4C8C3E99F097D2 5ANZUFAHRENS
2,421,610,307 *FFEE164AAC153569AE73BF5E821D5FB05BE66070 ALEXANDRE BELISLE
2,421,610,308 *FFE52DD7A4FF4BD41F37832DC97E38BDDA075D28 5BITEMEKATHLEEN
2,421,610,309 *FFE8A94C4AA3E1AB4692B6DF3C197D2F4F38379E 5BSWLEANORBSW
2,421,610,310 *FFE28D32A672F2F5B4E7D49BA4721626CFE814A9 5CARDENIO
2,421,610,311 *FFEA31AC7B636DF0D596615B228C7193F5F4C70D [email protected]
2,421,610,312 *FFE489D08E51A5FE46A678C6E8C7DE66CCAC4BA1 5EDNEREKEOW
2,421,610,313 *FFEF0CBC406A288C7ED1C06D6E00D3E4A418132A 5GROBIANANE
2,421,610,314 *FFE9FE3A393A49E78771FF3CF985E3672D34B4B4 ALPHONSO.EATMAN
2,421,610,315 *FFEC5A21B4C61D44F50E133944499AB7F600B822 ALRNN.BBS
2,421,610,316 *FFE368475365E55C940A5D52A5D8705B77100E6B altenteil.&.polenflug
2,421,610,317 *FFEADDB62A12CC8BFD01A52B99C34A729DD3E9C7 [email protected]
2,421,610,318 *FFE89AB46032575207A5ADC7BA3CBCCE152B0F51 ALWVE
2,421,610,319 *FFE07E9F522D089E7934F52D9876B17C6ED68B7F 5LAMBRESE
2,421,610,320 *FFE280659552EAA1609AB4B915B9235CC8FD7C9A amadohych
2,421,610,321 *FFE04DF1D2535D1726B131C4D3B44A3ED85EB60A AMBOYNACAY
2,421,610,322 *FFEA54A4A964276E887002D1770E5A77ECC4D337 amdrf
2,421,610,323 *FFE5EE4830A1592D248FCEC79D1594085E200F45 5OL5TT4L
2,421,610,324 *FFED3DDDA5FAA29C0297C9070F52E78F9B204C89 5OPENUP1
2,421,610,325 *FFEAEEF0951A138C3243AE2BB085CA2AFD51D734 5PODASTIRANJEM
2,421,610,326 *FFE2B2A48395C1364B811407B5C03CCBDC0CA6E9 amtx+
2,421,610,327 *FFE7C16A6E064B42C75F5D8EB879CEFE9FF4B155 Andhearingyourhighmajestyistouch'd
2,421,610,328 *FFE3D2B5A6D88C2E7AF479FC234C7B7DAD7D6DE3 ANDREA.HOLTZER
2,421,610,329 *FFEEDC9AE8938F1F9C9A89AEAEF507C990F16555 ANDRES.HEAGY
2,421,610,330 *FFE0F5AD7E29CA27399C513F71B1B7A324B52D62 ANDRESTIFT
2,421,610,331 *FFEBCBE0EB20F5B34F8072F51A5B38A9A138561F ANDYDIANA2
2,421,610,332 *FFE88D308177E61DA34447943F08132CC668E858 ANDYWACHSMAN
2,421,610,333 *FFE7F6E365C646ECF6AA0FB8C03239472909F726 60676 ESPOONSUOMENOJANVOIMALAITOKSENP
2,421,610,334 *FFE330D8A2E0E3467B87568D4882CB5F08DA0286 ANGLOAFGAN
2,421,610,335 *FFE845B526D4A6EFE95801E0B38781D4FC638F19 644HECTOR
2,421,610,336 *FFE88A5605C2EFF8576196B34BACE06DE23F5F09 652lillianna
2,421,610,337 *FFE662428A5155143D070670D50415F748DEFE2F anthony.necker
2,421,610,338 *FFE38E4FF2389548381C359601CC21B638DD4256 an?ws
2,421,610,339 *FFED959AFE6157EEDEDB6547C55C80800DA4F89D 6DNATORRA
2,421,610,340 *FFE53CD7CE0690A2B5CC63BAC2D8675375BDBFD0 ao=jy
2,421,610,341 *FFECC4256487680F2F8585C11B90113A7C628414 6FRUSTASSERO
2,421,610,342 *FFEBED5736BEF7FD68E2E614E00A7584611E1844 6-jenni's
2,421,610,343 *FFE3A81CFFA5B8F6BA7868F5A275D773AA497DC7 apocalypticdream
2,421,610,344 *FFE9CEB7140E1ECB0B704920A0CDB80C24E08692 APRILGRACECRUZ
2,421,610,345 *FFEABC3C38CA2D7468BB476E1C67ACF1F0A02DCA 6OYRUSTAK
2,421,610,346 *FFEED63559D009CD866A8FC773E1C4767050CEB2 ARANF
2,421,610,347 *FFE35E359F21A355CF09148F1E59AD830DE171DA 6.siegburger
2,421,610,348 *FFE663829037369E272AC4F8F18C7DE8F7E3358B ARONBRITTMAN
2,421,610,349 *FFEB73C8C0361D07270D24400DC07DCFB661C2A6 728138 ON.IS
2,421,610,350 *FFE9D1BF055061D8D6D06D3918F7219D7EF984B9 ars;b
2,421,610,351 *FFECE407C07AD5FA53B53D4B1097FD2D843E0912 76CHAIM
2,421,610,352 *FFE73ED60909EF4DE318BA96CB39DC064FFFE9AC ARW,C
2,421,610,353 *FFEAF65567EADAA065E02A40045F6EEA479DA948 ASSUBEL--AE1-S-AH0-B-EH2-L
2,421,610,354 *FFE3E40350B3FE8DE7B297BAD857E9973AD07820 [email protected]
2,421,610,355 *FFECC05C18AD80424CE520F29BB0C893121C9402 7FORCEBAL
2,421,610,356 *FFE96F86CF8B4C0B74FCE33C3B6DF71EF89F7272 ASUTTUING
2,421,610,357 *FFE875E7B49F69469E88CA3E7C794E41F93BC8AD 7FUMEROLA
2,421,610,358 *FFE92E01D0AE2E4CD7E4D5A21D747020AD5137D7 7INFORMATIONBUILDERS
2,421,610,359 *FFEDFAF0CF9F9C61AC218E5541937CD19FC14173 7.KUNSTBETRACHTER
2,421,610,360 *FFE894BAA90D3B71DBD9A2B9340EB2C012FB660D 7ONDSKAPEN
2,421,610,361 *FFE68C2DC256435AA38C3825FBE9EDA013A0D501 7PLEWROSY
2,421,610,362 *FFE30E5C00A0FBFC57AF13FF397DF8759A64C582 7PRESIDENTSHAMERS
2,421,610,363 *FFE5316D44CDE9A7249A97B5576FA4CFEC95AF8C 7struppige
2,421,610,364 *FFEFE14D760A1351FE3810AD81CA21CE1F2CD4C3 av9h4
2,421,610,365 *FFEF37CD9D285F8F3C6CC53E8DE02DF2E917C14C AVFT
2,421,610,366 *FFE337B0EB61C324616D022248EC8EC9DD74BA55 7TKANKEGFA
2,421,610,367 *FFEB548472074EE486A3D8338BD3E12EFA964D93 A(VYG
2,421,610,368 *FFEB071E8A548502173E88792AD34ABEE53082C3 834658 paSaailesiniselamladI.
2,421,610,369 *FFEAB73C4C2133D6B89BDDDC8F1A2FFE0DBB9459 861RUBI
2,421,610,370 *FFEB8133A8E0824CF0F1FB5EB9C929617430F24D awiso
2,421,610,371 *FFEDFD95642EFA1DCBCEB04766A1A4AB96D62A2D a/y1m
2,421,610,372 *FFE9128D2D18E8E6E141A89C23AB9A654F8FEC64 a;y/i
2,421,610,373 *FFE16140E47E5471E9C6B3872D82790DD7A3CBCE 8ESENSALZ
2,421,610,374 *FFECC2E7141392F3D8335716284FACF56529A336 AZ6U"
2,421,610,375 *FFE72DC8E6211EB2E826AF3282DE915CF5589959 8IAMHELOK
2,421,610,376 *FFEB0DD735D0254DA15876D75631FF30CD51A87D >-b0 o~o~ (####p
2,421,610,377 *FFE67A9B7A3A069A61313482EC93F0D935B29226 8KRISTIACTIVE
2,421,610,378 *FFEA29AA16AE3F2F36159BE7AE50A3721A51CDAF B144785
2,421,610,379 *FFEE89B45288856178E66CF68FEFBE83AB1A114A B3FBDFAED3EBC15D564A92F3A7671235
2,421,610,380 *FFED960FFEC4C6D44A95DE056205BA504BD2C1A3 b3mcg
2,421,610,381 *FFE2F5357EA05612DBDF4EB25FBC662CC3B2530D 8#p~o-3b<-
2,421,610,382 *FFE18ADA9136FF04A5B0A48E0E575994D2B4602F 8##P ~O~OSPLAT
2,421,610,383 *FFE4626C30E51BA74BD84F18EBB2D442C810A759 b84i9
2,421,610,384 *FFEC2308467A0E3FE597F28418E352C0B1343D24 8STOCKINTRADE
2,421,610,385 *FFE18ACF6E6A981AC8D22888951BF9C5A5896550 B9-PE
2,421,610,386 *FFE6FB5E864DC0025EF2C7450DB7946633F9CD41 BABQ
2,421,610,387 *FFE3EF4D0C495247A09D1F4150D3466F6C5C1DCC BA:D
2,421,610,388 *FFE3D8BC3B1D1DC631106933ABC464BD9AECA118 8ZAMENOVANI
2,421,610,389 *FFE8F5DE8A14E06AA491583195125278DA8D593E BAH:M
2,421,610,390 *FFEAE39474D60D75DF47FB5CBB4DC0AB69CE9947 960382 DR--ADEM-ESEN-KONUSMASINDA-SUNLARI-SOYLEDI-
2,421,610,391 *FFE751018C91B19757A40C53FD36DD0969180F52 989640 miten potkut k
2,421,610,392 *FFE1837247882FE001FBC02535149934263EE5EA 9ALITNELE
2,421,610,393 *FFE17257F18568F0DEC35964F1E560DE9B2D76BE BARBARA-ARROYO
2,421,610,394 *FFE247CA3A00CA0FBFF4C86055DB5A464437E041 BARNEYMORINO
2,421,610,395 *FFE8CFFCA5EA406C1F56824A3741DE2DD5044741 9BRAGADCO
2,421,610,396 *FFE2CCC903FD13BB94AC103D925B1F2951A5FC6E batteriefahrpult
2,421,610,397 *FFE817CE976DDDD8E5051B6D248F76D146092287 bb3l$
2,421,610,398 *FFEF25C00F1C09E400057305DD80CEF2E720D1B9 9FAMILIRT
2,421,610,399 *FFEA0C089232BC541533DD6C2CDFE3187C1E1462 bb~o(_0)
2,421,610,400 *FFEB4AD0D7FB5C0770DD96930ADDF9B8F23C3544 bc"t0
2,421,610,401 *FFE310FC0F52EFF30F9A94F2B983577F6B4C5E7E BDM$CHUN
2,421,610,402 *FFE3F1784F4AC06CD7C977CB9BB6805319135B10 b+dog
2,421,610,403 *FFED78F38301BD330393AFE74CFEBBAB6CFB496B beaudalessandro
2,421,610,404 *FFEF70DCF5E603F17B27DC908DC6C0FA3FC6ED5B BECIKOWEGO
2,421,610,405 *FFE6E21BFBB55A160671B40CF81606878ADBDEB3 9SNIPERGENESIS
2,421,610,406 *FFE7A28F01FED15D577DC2CB9F609BFCCCBF9CD3 9TENNISREEBOK
2,421,610,407 *FFEF3ABC55965B7A191FD56A2CDC5CE4B2FB7808 belp&
2,421,610,408 *FFE222FC0634047DB8887BA2239ECCC649AEA163 B?EN&
2,421,610,409 *FFEA7DE7B3F2149B670D9A02361CC004B3599DCB berivima1
2,421,610,410 *FFE89D37FA81769A2E032F09423716D3F7E567AF A3S"S
2,421,610,411 *FFE9DA6CF30AFE05AA3A930AE190478DCB7BD49C A8LWF
2,421,610,412 *FFE3A2B1C992BF10A8A4906BEBC4371BD3E19423 AAA]|
2,421,610,413 *FFEC721A0388D4BD9DD6955AB076762871AD5D12 aaaaya
2,421,610,414 *FFE4FF844CC68CD3A562EF701E11500588E1BC5D AAEGT:
2,421,610,415 *FFE11C13785EC0590A046DB0F91C8F3ABA649895 AAEKRF
2,421,610,416 *FFEF9AAC51F922A415121FBDD7D7AAC33109812F BL60
2,421,610,417 *FFEB1E4D8DAB5DB7670400DD7D8514F1099AC034 BM!G
2,421,610,418 *FFE8C89400715362E162EDCB996BDFBD2F6C4F43 ACADEMIZED0
2,421,610,419 *FFE090C9131B165D16871F6ECE16D76EB939334A b)%oe
2,421,610,420 *FFEE72E62D5E86232126433105B84BCE5B7ECC51 acu"]
2,421,610,421 *FFEF48CB5DCF9CB17FC67275B95F62AA2CC4728C ADAGIUMS1
2,421,610,422 *FFEFDA207758E90F3216B22AC1434ADFB41F37F1 BOUSNESSES
2,421,610,423 *FFEF3CBBC8F865003506EE4B310A1A4F9AFFE18D B&OVK
2,421,610,424 *FFE5F9224BEDC63F7B0CACD08C3CB4DC277F470B b====p~0-~o-(-_0)
2,421,610,425 *FFE99E35CC1AF7028D361CBB99027215BF002038 adneicsa
2,421,610,426 *FFEB5BAB4CB889C066035255EA46AB24295AEE0D af3m
2,421,610,427 *FFE636915A82E9431B766087FE85C5A1BC299427 b,rf/
2,421,610,428 *FFED6054ADD1396C19B12061EA03EBF1A09258EB BRITANIE MURPHY
2,421,610,429 *FFE2C44AEAE6A43F6DA617CB5E9BFFE76479F56B [email protected]
2,421,610,430 *FFEA85301BAAAD87F58389956C6C32CE2BDF4C05 AgeC
2,421,610,431 *FFEDAA48B88165B5158614819F0A1407CC752BE9 BRYON.WHAITE
2,421,610,432 *FFEAB4231651DDD627080C3049223BFFBEDDB19B a$hok
2,421,610,433 *FFEC4D604638E3FC883AC496A61034E426F4A001 <a.href="#e69e91".>tftp.packets</a></li></ul>
2,421,610,434 *FFE68B32F1DB30DC69718859281D13EFE6799DCA bsni0
2,421,610,435 *FFE75958D8E4F6D96ADD3CBADAE2D6279D10A41A AI,4N
2,421,610,436 *FFEBDF6E7F1BFC9DEF78C5FC2C840EE019291E0F aintress
2,421,610,437 *FFE7A28C50C6FA6B2DF4DC3C56B268A3A589ADD6 AJU8
2,421,610,438 *FFEEF5D4B46AC174F9F4E653F8D753870690251F BUDZAPOTICKY
2,421,610,439 *FFED12B0AECDCD0F045ECE0570B659192EE7B879 akd;!
2,421,610,440 *FFE78D844BECF401A56B7F0332D14D1287F26837 bvdft
2,421,610,441 *FFE161C5EFDF545E4A084FA454AF65D85575681C ALLAUDDINMOHAMAD
2,421,610,442 *FFE92C28EDDD66C04BE49A7B0FAFCB315A83A8C7 b%yq;
2,421,610,443 *FFE23B5E962F144D56C4A17A6530725D00C24BEC almc:
2,421,610,444 *FFE34FF91AB25D87925DCFE4A7BECA02F9406304 ALTON.LIPSON
2,421,610,445 *FFE0ABC17B8A59062202EC443C698E6181D84C4A aluy
2,421,610,446 *FFE60E084847B6CB311F74D9E333AD5371C7B5C3 AMAZEBALLS
2,421,610,447 *FFEFA68D5963A297FB71D0BA700452CC35464DA0 C2S8E
2,421,610,448 *FFE6E68A01F0C7B64CC975BF5189269FF57B3F86 CA2P=
2,421,610,449 *FFED711F09E55FDC81DE8DF9EBBD68505DED38AB ANGELMARCOS
2,421,610,450 *FFE74701873588A27A293651408E8F0DE697417A CAGM=
2,421,610,451 *FFE2089BAE33BB34EF08D50F8BC88334C5394550 anibalkozloff
2,421,610,452 *FFE0094990C49092F15F369D59C6362BAE86AA1E calsteined
2,421,610,453 *FFE425439DEDF4B13BFBEF261DFE6D6545855876 ANTONIALOEFFEL
2,421,610,454 *FFE973F64F4E1E9E24E1C4624F3B27738B6BE197 CARLYROSET
2,421,610,455 *FFEEB46B4398A279658D456E33C45EF29649C772 CARMINEMINGIONI
2,421,610,456 *FFE8420C96AD1DEF706A1FA0B3023F06F4FD0439 ao7s
2,421,610,457 *FFE67FD4683271525464BB064DA11FDD386F8274 CARROLL.LAVEE
2,421,610,458 *FFE01EC79AA7E736396CE20021EF8FC366677D4E CARROLL.NANNEN
2,421,610,459 *FFEA17025244BF412B9A14B4BF18D145D80333A7 ApA/
2,421,610,460 *FFEB91930F4B861DA2BB6B979C918F92637A6F23 april 7th 1928
2,421,610,461 *FFEBBB9216045D34D1D09CFE0B940BB549B6328C A/QAW
2,421,610,462 *FFE053EA11D6886113F97B1BB0FD0F1B063078DF CCULTATED
2,421,610,463 *FFE56585690D85820987CECEB9212F053519CB13 [email protected]
2,421,610,464 *FFE5F15DB89AF15531A50F177B56A0476DF774E1 c&dcn
2,421,610,465 *FFECE20EEE39179723E8531C7894769B81D7BBA7 ARLOSKIS-1-0
2,421,610,466 *FFE741714E539ACA3E879AD3EF6CE450D99111CD CEDULAS!
2,421,610,467 *FFEBF6334C68057CBEB76D530F7CB87573ABBF4D CENCOMR35
2,421,610,468 *FFE4D529BC81D46E596050E6B62095AF21A2BDC8 ARON.LAMBINO
2,421,610,469 *FFE13626B60906FC3CD810C39B3D9DC832D0A898 CESARMURO
2,421,610,470 *FFE1EB749B2F50D9221013E3FE2E5214737A6EFE ARRON.TURLEY
2,421,610,471 *FFE1CE48FE5BBFA03C30EDC38EC0E6F64458D265 CF#EH
2,421,610,472 *FFEEF9FAF433F3653C6452011F1A655A277AD9AE ASASWOOPE
2,421,610,473 *FFE84346309E4346C4584D2DC1E9B1A5731F6087 a,s&h
2,421,610,474 *FFE77522E22A49DF5492B0D9B370CA6FD45DC760 CHADWICK.REUBER
2,421,610,475 *FFEE884C66A755CE45F31B0587D838D096A1DFF7 CHAJNE
2,421,610,476 *FFE82BF8D6F72DCD207E739AFEBF20A530139651 ATEMLOSES0
2,421,610,477 *FFE3307D9B7B215CBC21E0E4DDBAA33D4B3D0B77 [email protected]
2,421,610,478 *FFEAB67632F280DA182E9D221ADA7B13D064A7AB CHILDREN135
2,421,610,479 *FFEFD64580BAF4F245651C5CA5713DE3CDC4E36E AUFTRAGSNUMMER6
2,421,610,480 *FFEA6EE9FEB5AEB58E43D6B66A2F6F8D375E3558 choquaising
2,421,610,481 *FFE9893C0B47883C81760CE50F5125C7AE4DE4F6 CHRISTIANE.BERUBE
2,421,610,482 *FFE36F41C4E143F4C00C636BD7306428807DF7DD AUSTIN.HOLLIDGE
2,421,610,483 *FFE486DC8D1AE955B91164660ABE278DCF0E66B2 [email protected]
2,421,610,484 *FFE933827C56F50CB006B1657D7A260817E93053 avagyaana1
2,421,610,485 *FFE4524DC917E0FA3563E808142ACA21E1258E88 chunglietz
2,421,610,486 *FFEE3952892FA540505D7132479AD6DF0693B337 avqbvple3
2,421,610,487 *FFE1D0126A7587EA36B85B1C94326DE73B0AC164 CIg%
2,421,610,488 *FFE07057FD64CDC28D7766501205C75D7D3B6635 CINDYCALAMBA
2,421,610,489 *FFE28507C132CD4E5B854599D4A547575D2057A2 aw:2d
2,421,610,490 *FFE433325AA9C2169092DE3C993398392D46ADD8 a(:wi
2,421,610,491 *FFE17694448DD53E591E72FD31B2CC277D477E91 @CLANCY
2,421,610,492 *FFE77EDD8C0C963AFBA2D5B099F7E2552984B975 A!ZVV
2,421,610,493 *FFE7F387E1F79E0614992F47A20F6D607CACEA27 claytongaglio
2,421,610,494 *FFE6FC8C6B17653C3625C338C4B54798DB34208B >-B0O~ 0~D###P
2,421,610,495 *FFEBC51566387A62B5FC43C7D29A7A580E39D8E2 CLEMENTDUMLER
2,421,610,496 *FFE9C0004D31D58FB233AE9CCB3F7536D57160BB B0:T,
2,421,610,497 *FFE75D128274A0803EA4A249F1344AF323EAFF2B cm?nr
2,421,610,498 *FFE345DB48BF892C1B10438EB1BF7375D9A91461 c#nrg
2,421,610,499 *FFE2216EB036B2A6CEEF5181F2C8802E582AFE0D coae)
2,421,610,500 *FFED1ADF9F364F23C39D9D024C7BDB91EAA2808F coingress
2,421,610,501 *FFE472BB2E2030B3749E2DA6EBB948FE8AEC7BAC bafflin
2,421,610,502 *FFE5BCFBB516B9879A4B700D8115F493F37558EC [email protected]
2,421,610,503 *FFE1BCF913B9A09E64DAACB2CE4D35823AC3531D [email protected]
2,421,610,504 *FFED7A50B1D6AF194782AC492E26D180E8123B1A ballprogramms
2,421,610,505 *FFE5AB32D9F2AB0DAC999872F38F763E24CE7289 COMMONS29
2,421,610,506 *FFE6DA726B098D0A3240D354A8EF2277ECDF653E bananekiss
2,421,610,507 *FFE831C869986011C969C347DD699221FE637CD8 confederalizing
2,421,610,508 *FFE5651EA4DAC69D476BF00E4B11B89F296DB032 connierayne
2,421,610,509 *FFE5CD0AEF990CC99480436331E285ABFBDF03DE BARRYBOSSEN
2,421,610,510 *FFE133C7C3B3DA050520F4B2CF54D578AC4DA811 BASIL.SMOLSKI
2,421,610,511 *FFEE62E1DB3B77FDCC0B6EE3F3291135F702C377 cormega-&-hot-boys
2,421,610,512 *FFE6FC78CB641A3DED38631F53D89E66A114B7EF b####b.`~(^_~)
2,421,610,513 *FFEF0F4135B614F0E3223DE635D81DCAA5623E74 COU1V
2,421,610,514 *FFED2A5B1DC642C5E96BD81D5598374AE46629A5 c:\programfiles\microsoftvisualstudio9.0\vc\vcwizards\appwiz\mfc\application\templates\2052\menu_record.htm
2,421,610,515 *FFEB10C79A5503151059BE999FD3F4BEF323922B BD
2,421,610,516 *FFE070A4C5A746C091A4206F3BED4D66A7A77309 BEBEDURO
2,421,610,517 *FFEF7E7675D20293F45BC5691BEA991CE60426C5 CREATIVE-PARTNERSHIPSCOMWWW
2,421,610,518 *FFEB09578ED5ACCBE43E98132817C7F8AFBE88E2 CRIMINALJAIL
2,421,610,519 *FFE9171211D86A0913D21FDDCFFA5632BAE84071 believe(coralwaybeats)
2,421,610,520 *FFE3C4EA9596D27BE5F514DA973D593D4F22097D BENNETT.HINDERLITER
2,421,610,521 *FFE4325E44A4AE5241398211837625B5DFF418E8 BENNETTKENOYER
2,421,610,522 *FFEC81BFBBBB0F640C82B6E54ED058F8C542A60E c/sdu
2,421,610,523 *FFEC8885D3DDBDEE437445BE05669707FC85B367 bereitswchaft
2,421,610,524 *FFE5BD0E82E36E7A8BD9B588E4C868ADA29890B2 CT?JP
2,421,610,525 *FFEA10AA8E6860780F0A6B60F4005FD7691A82C2 BERWALDSKI
2,421,610,526 *FFEBE99C895177B32516EBE6DFD53F1E4840D338 b!f&c
2,421,610,527 *FFE14861FD4840B4E33F6D8D0C824E63C58FD79F cynthia-lps
2,421,610,528 *FFEC8E596F1452D50829DDDFA9702B50370E45F4 BILJAKA1
2,421,610,529 *FFE3122ACA9DC039BF727B717F992D8524CF653C CZN9
2,421,610,530 *FFE249F14B2C0A31C07EC5889D7406E210E59ABD bipka
2,421,610,531 *FFE020C304E65AFFE3C71F0193854B84F188202F BLAIRBOVEE
2,421,610,532 *FFE84D8D593093CA521FBEDBE68DC8B05D361E62 bleibe.hier.bei.uns
2,421,610,533 *FFE337C0510FB6678E82CF2C89374CBEEF2697A9 d7s_d
2,421,610,534 *FFE4C86E112405F05A9492ACE9676176553EA373 [email protected]
2,421,610,535 *FFE96E00A722C78FF483EEF61DFE71260AA73E87 DALJITAULAKH
2,421,610,536 *FFE0B1A5927E237876F83E9455237450E47823B2 DALTONOSBOURN
2,421,610,537 *FFE6282CC187DD0A3FA753C10968324B1E8F3463 damianbeddia
2,421,610,538 *FFEBA3CC72AE31C7407030D96697EF5542F879F0 DANANDRZEJEWSKI
2,421,610,539 *FFE6D29EA0637974D7027472A58CF3557D2DE19B Bo4+bll$
2,421,610,540 *FFEDF483544F2495DF81743908FB521A066A2A5B boba1616
2,421,610,541 *FFE4156EA636E590DAA56B6816E03B96B3E4106B DARONTUMEY
2,421,610,542 *FFE26F0C1E258055C2519D056E13769A4B85B685 darronhacher
2,421,610,543 *FFE54F663EB030E376FA36DE9C634D69614FC627 DARRYLMADERE
2,421,610,544 *FFE9480B8AE9E0C5EDACE120B5B8A72DD64CE8FC BORIS.TOUHEY
2,421,610,545 *FFE573FF5937EEAF1086094581FA4DA903788677 da.us
2,421,610,546 *FFE659A3F5D795C9080EFA57B18C0CCFCBD59E08 DAVIDHYTNERINTERVIEWSOLCAMPBELLPORTSMOUTHRACISMTOTTENHAMHOTSPURARSENAL
2,421,610,547 *FFE31B90223719939B06C64A549EC597391FFC79 B(p/
2,421,610,548 *FFE8D41F01D98892A195769F645E824CEC5729F6 bq)fm
2,421,610,549 *FFEF143C4DBA19841DEA454EBA4C07795414AD35 BRENDON.LEAHEY
2,421,610,550 *FFE47347B1C9687AE7BEBB86FE2B8147C60C5465 DEJERATE4
2,421,610,551 *FFE1FEF3E67C9403ED0A6C0B957606860884722B DEMETRIUS.PEARY
2,421,610,552 *FFECB5B5FE25496229DCDB68FF0F5E6AAA3CC28E [email protected]
2,421,610,553 *FFECDFB62934727EE7360EF8CD4C7EFB682942E4 [email protected]
2,421,610,554 *FFEC885D5CC1C76C5E465A5338A7E7D26C13F3DA BRL-SMOKE
2,421,610,555 *FFED698554F341C21B512B7DD2A62ADDED9B7EAB B-S0(
2,421,610,556 *FFE38A9D4C727EDBEDF725F78411A4E2A78677D5 btfw&
2,421,610,557 *FFE8A455C6C783999589225385F85FC10DA21B7D BTHVLLT
2,421,610,558 *FFE2C97159AD34837EA3D5D5A6BC0EB7FFDBD7ED bummeryep
2,421,610,559 *FFEC00D28F6085041541DA9C112B6558EFC22518 DIANASENDIT
2,421,610,560 *FFEA186815871848CACDBA0B9F01F601B6E82FDC BvI2
2,421,610,561 *FFE7B9F5B3380736D0CABC0924194C67A366CB90 BW+-K
2,421,610,562 *FFE6DFEAAF951ED4B96E1CAFD50F8A8E809E7E64 DJMW
2,421,610,563 *FFE4BF578CD543416EAA5314B518EC480C4A7F76 DK2K_
2,421,610,564 *FFEE014D06A467E55CB2E925214B10D4CBAA8E40 dlpy=
2,421,610,565 *FFEBC54BB0B6D9C81965F0DEFE1D830DDFBC49B7 C3LML
2,421,610,566 *FFE362BCA74C2D00FD9159F2C4B3525AC27303E3 dolores-ruelas
2,421,610,567 *FFED39EE70E8991E78C5A94BF422B84E3B25570B DOMENICRINALDO
2,421,610,568 *FFE66370FE28C83D6C2C469EB2413418BA3CE44C C8AJ,
2,421,610,569 *FFE7F4ACA2BB34381629E5ADFBF7398FBF4A60A4 C8%CP
2,421,610,570 *FFEF859C2F46B5767A2AC1BB13E5F2E5DF89A6D0 [email protected]
2,421,610,571 *FFE9A1AFABD917D4E338C3B15C1D5941917CF85F CAIGIDAL7
2,421,610,572 *FFEE168C87FA6BA8649150B60676BA840E97346C DOORGEVOS
2,421,610,573 *FFE4D3DEED3F57CF2C02CED47BE6F55D7D98936B calambac
2,421,610,574 *FFEC525633CA31B15704B8C6A84E2C859AB9C432 dorpsoudstes
2,421,610,575 *FFEB5F900A5D0B9518F82AFA21EAD153EDC6C7D1 DOUGLASS.HRUSKA
2,421,610,576 *FFE58DD3A05B9DF9625E6FE1A24CBD9188A4D27E CANTACOUZENOSKANTAKO
2,421,610,577 *FFED4CC0A53A190E93947BA1ACD0A330C752E06B DPAJB147
2,421,610,578 *FFE72811D2B07A210E28BA23A325BFD710BD808A CARLOPELLMAN
2,421,610,579 *FFE51C04F9CA9D43045789A5E9ABF72C118B7CE2 dqnoo
2,421,610,580 *FFEC11BA8E6F76C91DC6E30134CD007BCDA5CC11 CARSON.TACCARIELLO
2,421,610,581 *FFE7C9B68F2C9A90FF5BE97CFE679C1A4FAA3780 cartayer
2,421,610,582 *FFE80AFBF27E1037BF030FD3548446C68C7A2FFA drehorgels
2,421,610,583 *FFEBAA732A8A57ADC63D57D23E2F4B7D9B4D12CF DROPSICALED
2,421,610,584 *FFEB764BCA69254D05680F6CB82B3280DA9B91E0 DROWNAOL8
2,421,610,585 *FFECEF3410999F4CD227611AAA36A811F1DAF680 Ds%9
2,421,610,586 *FFE6CB897C6D2009AD1BF13749CCDF2C18811FD4 cbevo
2,421,610,587 *FFEAD5DBD1980945536E1E80498645E6D4A968B6 duanesurminec
2,421,610,588 *FFE110DDB8A876C423D9BAD5DCF44F4761AAB062 duc-:
2,421,610,589 *FFE00C8EF136E7DC2BE82D9004477D7C065F2418 CEDRIC.MCCUMBEE
2,421,610,590 *FFECFFA8092B4E00913C4B5C616B35D605627FCD c:e#h
2,421,610,591 *FFEC5F2410861180BF137AE12C91529FBE19ACAB celld
2,421,610,592 *FFE2D0CA73F91616BABFE7839A72E510FF27FAF2 CHANCECASSELBERRY
2,421,610,593 *FFED6196A7932772A8A236A0AA463FB64DA01100 chankamwing
2,421,610,594 *FFEA73775BAB9D9DA10083913F3771A54EE97DB7 [email protected]
2,421,610,595 *FFEFF9AC4466F50DC88AD07128CE04FD8D8D6321 chasriddell
2,421,610,596 *FFE4F7BF116F382A372E5CC98C8EE80947266BCE ECAPRANOS
2,421,610,597 *FFE4B03758E85BF77E311D27C790CADDC054FD38 cheetahmen-ii
2,421,610,598 *FFEA9B203E2951EC7444AA330A90DD27830EC822 EDGARDOBADEY
2,421,610,599 *FFE21AE4499824A012F6130089DB82C14C1C593C ednimaap
2,421,610,600 *FFEE99CDC61F1924E991751769B672579A82CD24 CHLOE SOLOMON
2,421,610,601 *FFEA948C20C05DAC2A064F0FB64AB90C330A30AF CHONGGODIN
2,421,610,602 *FFE44D0C265957852C9653292519F2A54A9B5F3C [email protected]
2,421,610,603 *FFE256D9CBC9A2DFB3DE8E8C2B8BC3F392EC374D c#hqw
2,421,610,604 *FFE5BA5A030D9A8E2A34303BEAF8EA41E176E909 CHRISTOPHER.SHORTES
2,421,610,605 *FFEE9796FA70D4445193CB1C3EE248BADD694DD9 EGENOISE8
2,421,610,606 *FFEEEE234CD770060D2DCD2FAA85A693806E2F57 chronologi:12k:year.1year.4(disc1)
2,421,610,607 *FFE94A7752BB595DC5D548C01BC2F4B79E32B030 c!hu
2,421,610,608 *FFE9D116FCC3F1CA8DB87745072E8BD18078EEFA ci(a!
2,421,610,609 *FFE35AFFBAFD080C6B7C11A2D5FAD93640B0289A CICRN
2,421,610,610 *FFE92081AC85793893576BBB5D2946233093C87D c%igh
2,421,610,611 *FFEF0F7E953A188D6093B1E23DCC5D99AE922FE3 ek,+h
2,421,610,612 *FFECAD1A92B6D5AA37A8870DADED2FEA2E22EC33 ELBERTWEINFELD
2,421,610,613 *FFEEB6447AB05BFEE456D4BE3A5D274EE6E64C4B el)/f
2,421,610,614 *FFEEB52522D705561E4BB7141CEEFAE32E751A08 CKEBDSV
2,421,610,615 *FFE0C8A72EC72B11DD5D6BD64C0233566DB7D5BA elmocostaneda
2,421,610,616 *FFE225377907DC95E33797CE79B059AC9B13EE0A EM6D_
2,421,610,617 *FFE8463236B4853FF62A4CF51E2CB65C6D6DB1BE EMILIOIMAIZUMI
2,421,610,618 *FFEE4B809B4E4A33F3E0B9C9BD2A3CCD6CCDA3C0 CLOAK-PRE
2,421,610,619 *FFE0B8B87E808E4AC3E9DB94B74012FCC2E57F7B EMMETTBLALACK
2,421,610,620 *FFE7A5C283FFFD4652C63D05FDFFEB6C80C2D65C C,LQQ
2,421,610,621 *FFE4EF4AD980E098C3E13137F21A7A5A0B1EC9A6 [email protected]
2,421,610,622 *FFE10EBA2E63825A72D75076B173A824A29D2293 eoneista9
2,421,610,623 *FFECDA23978154F651A07C6E2AF781EBD821B14D co-evolutions
2,421,610,624 *FFE606C1926B20DBF7149A4A2382E3942E29F367 er3vb
2,421,610,625 *FFEE52E540B9DDD0DBCF6F5A3455EF9635D6A364 collinrosenbaum
2,421,610,626 *FFE198E0CBA444661B3B4FC9F7A92B4BC85DAEBE COMITYDESIGNSCOM
2,421,610,627 *FFE61653443261410E5F103D8E917F621FA2A592 ERICKARQUELLES
2,421,610,628 *FFEA754FF8A8FB6B915E35A340D778720EB8EFC0 erin.grant
2,421,610,629 *FFE3FCA3E73EE6D584307B8FF87C93A48CD378F1 ESFAHAN0
2,421,610,630 *FFE25EA461A19DEC607C80D72A01227D95C522A2 [email protected]
2,421,610,631 *FFEE597A5DAE6EC20F058F27F87AB6F014DDEF2A COOLCHAI8
2,421,610,632 *FFE23A0D21223E3A14D410B531B654F102E85FE9 etalerro4
2,421,610,633 *FFE96C86B2A94AA17EAEDA0EC5E0BCF5CA134136 ETP3
2,421,610,634 *FFE52A49D9DDA37CD2C3B75D750B22FCC4228167 [email protected]
2,421,610,635 *FFE77F0EADDDF25FA70C88EC98B0BFC29E5FFE4E CP-LAW
2,421,610,636 *FFE54FDABED788F090865948AEE391FA62D4CC32 c:\program files\common files\adobe\installers\faf656ef605427ee2f42989c3ad31b8\regloc\ru_ru\registrationzdct
2,421,610,637 *FFE761019E04A1AC09D3F967A0F818615F1147B8 Cr/
2,421,610,638 *FFECCFED73B928FEAC6B02B5022A9CB9D22BAFB7 fe6cd62c0b4f3d788aa50938d85d9f9f
2,421,610,639 *FFE7E494980CE665A3F4F4A6EE539B903FB85917 feenikskoulu
2,421,610,640 *FFE7127691041ABF0DE5FE5A91D052E47199D065 Csillogjon,cs
2,421,610,641 *FFE49580721BCD974544149930704E8AE70B6521 fidfad
2,421,610,642 *FFEF2CDF0827C127FA8768496A3B3BB24C2C2A3A CUF#W
2,421,610,643 *FFE4C11173035C86A8079805AB5E45BE25BD4BEC cuq3d
2,421,610,644 *FFE517547377C7303E6F7440EFC701076F039E8C cvnvy
2,421,610,645 *FFE8E6E81AA314214DE74D8C578A486F9B429F32 „FONETICĂ
2,421,610,646 *FFEDBAA322D395D7C70B7D86D6AC06766A4B36AD foratieses
2,421,610,647 *FFEE94196A5FFDBF9E4FE099F776747F03C3E000 CXP91
2,421,610,648 *FFE3D3B2D9457149721487B414E6962B6CE6C57E FRANCESBARBERIAN
2,421,610,649 *FFE2E4544666FE6D2331565A1E45DC6E2F8389E2 FRANKLYN.MANGIS
2,421,610,650 *FFE068B951EB719034A0D86AA19A73FAA609F18F D0S#W
2,421,610,651 *FFE90E678F2538CF08145FEB1B51417A7F833854 d:2r=
2,421,610,652 *FFED3D134F406591ADC8060D1BD0D318BF930130 FREDWARD7
2,421,610,653 *FFEC65232E26965415F421A1601D8488651628AE FTATAG
2,421,610,654 *FFE9B5A0AE9531BF99B65C7461CF916C1BEE12F3 d6:wn
2,421,610,655 *FFE74E982EFF4E2057E1D2BFD71DF0548C059BC0 FVSZEREPLV 1
2,421,610,656 *FFE6C223BE22E3809F479509A270680B51754BA2 da$6g
2,421,610,657 *FFE8696A1598286D8C9F94AF7152FE1691F2907F d#aa%
2,421,610,658 *FFE0E756D5573A7778EE04C8A26DE0133B3C86D3 DAGEVIS2
2,421,610,659 *FFEC5D77C3919D84E2456116702029BB05A7DD74 GARTHSTERLIN
2,421,610,660 *FFECC0E2AE6ECFF3CA285A27A75E055085FE77BC damienbyars
2,421,610,661 *FFEAB2D07312040E7F953B008F2834ABB9BD4879 gaylecrowford
2,421,610,662 *FFE0FD729D86BFF546FB0E141E73C4111B6B2F62 GEENZ
2,421,610,663 *FFEF4076EF3C4437495C1C74DDF8A0F43120D5A9 geflapte8
2,421,610,664 *FFE7635102910E0DAF874640AA2F260BA83107EE daraleaklovechhaya
2,421,610,665 *FFE28342C7E7202C3A5BC7DECB3FCFD7D5D9671E DARIUS.ISAAC
2,421,610,666 *FFE4C3A73AFA0FFADC33B9C10355A3251A391D5D geraldoheckert
2,421,610,667 *FFEE9B1D119C563685CE3F78BE410BF6A280A15C germling6
2,421,610,668 *FFE648082A33A5C16F511CCF12DF47D8B354C228 darrylgaiser
2,421,610,669 *FFEA958531B6CDEF820D7F0221E635578A607683 GESTRMTE4
2,421,610,670 *FFEF02B41A9F03057AF6B784263B2C776542B559 DAVOBAL
2,421,610,671 *FFE1EED961E702CBED670256A212F7E53D7D8ED2 >-<~D=B
2,421,610,672 *FFE03AB263892F883F5311865D54323C5D5AA909 D-B-
2,421,610,673 *FFEEB36F40707F836B4241742AA78D09BF341985 GLADIATOR0
2,421,610,674 *FFE8F136E6F6D31CBA3B0AF30D9EFC673B3A7DAC gonzlezduarte
2,421,610,675 *FFEEAAC1E1B439D7F53537457C6C850A5C7B4D0E DE$0CIA1I
2,421,610,676 *FFE01B539438234029A50B3BADD98991B3CF929D deep-sunny-south
2,421,610,677 *FFE74BE1D45E330CF0A7DCBED0C0D6DE41E68D5E def14+0n$
2,421,610,678 *FFE3F6AB748F42A917B1CE5F6BF380FCB1D72D8F de%hz
2,421,610,679 *FFE96A770C595CF4AF8BC72F69CE8A3A735AE2D0 GREGG.SERGOVIA
2,421,610,680 *FFEA1C5087C2CF940A2A883A0C651C7DF26DDAA3 DEJUANTAT
2,421,610,681 *FFECBDAAD4A8CC107A1F1298FC689E5BC599703F DELBERT.RUELUAS
2,421,610,682 *FFEC66E39EB4D21CCCE1BE3CB70C40A2EBA86171 DELCLONTZ
2,421,610,683 *FFE2AC27329C726535359F4C7A3F108D9A21160B delschammel
2,421,610,684 *FFEA24DD9C30E4CD53783EF7027D7FADDB247DEC DEMAND
2,421,610,685 *FFEED62F03D6EBBFC1ED481852A96F86A032B653 deniscra
2,421,610,686 *FFE0A8DF921C0F51920915E0BE91E40709A7A4FD DENNISLEAHMAN
2,421,610,687 *FFE460AAF2E6D5AFA2A9087198869F0DB0C19375 [email protected]
2,421,610,688 *FFE1495EDA8C5FEA5E24315E5B22F382189CB351 DESAMERICANISERENT
2,421,610,689 *FFEDBC5C75D848EF12A8D9430CE7ECBCF0CAABA4 DESERT.POEM
2,421,610,690 *FFE99C7D43B2F70E49FAA1938CC24F694C7A8661 detaploo5
2,421,610,691 *FFE0B7C1393C7E4AD990C9DA4560E6D4877983F1 „detektive“
2,421,610,692 *FFE592E23533C501A310A900191C354A39B3D7C5 devrimde
2,421,610,693 *FFE0CFA5DC2A5390580638AF49B1B2250004D427 HALL建立,这是马里兰大学仍然在使用的教学楼中历史最悠久的建筑。
2,421,610,694 *FFEF4CD4C915FEC39E3FC5286D65384FB1EE391F df%c
2,421,610,695 *FFE9E33CD6BB294FECFF3C47477C94684502EE0C DG:
2,421,610,696 *FFE2218BCA3874CEBCA717875AFF11528EEC7D9A HASSAN.BRANAUGH
2,421,610,697 *FFE18FF346210749B54F15F6773E2698664C5B26 HAVAL-224
2,421,610,698 *FFEF40C7AF4E0D55A91293A1DFE790323BC75199 HEBREWALPHABETSCOMHEBREWALPHABETS
2,421,610,699 *FFE0E560DD36DCE22FDE85E56E1435573C26B742 DI+LV
2,421,610,700 *FFEA5115CA60BBD14C82CD6972F56CBE0CBA0B32 dinirpyced
2,421,610,701 *FFE46CAF81133281514D94FE3E8CDAA0510BFB45 herbertrittle
2,421,610,702 *FFE11066484C6A1713D4E29F004BEF7E9D018890 herb.fields
2,421,610,703 *FFE366A3F1AABEB2E4A1A29E6588B23F9DDBC0AF DISCUSSION.DBIEL
2,421,610,704 *FFE8629DD50FD4EDE19089255E2AFDCCF0F0F083 HESITATETOCALLONYOU
2,421,610,705 *FFE32DC88CA5027FF481539D66853D8542C87010 HE.THAT.PLANTS.TREES,.LOVES.OTHERS.BESIDES.HIMSELF.
2,421,610,706 *FFE26BF2038443563DD8D10BB05933123AAB3C78 DIXIEDITTY
2,421,610,707 *FFE6DD4C3ED6FA0819CDEE61905E3E8E107E2467 djic-
2,421,610,708 *FFE8C8714EC3E01616233C28516A45477E56090A [email protected]
2,421,610,709 *FFE0197EE20B4E9DBB6242A609F521AA4615A3E2 D/ka
2,421,610,710 *FFE6E2BB5122E84C557FFDA6171426F9F12AA5A9 dliuq
2,421,610,711 *FFED500F8449B6BFCD60EC92D1FDB01F73A062EE HOMERCOTTIER
2,421,610,712 *FFE9CFDA5AD72EA2A758F340EC44D93E550F14D9 hongangerer
2,421,610,713 *FFE4A97AAE172BA3AE7A74EEDAEB4A2CA37968A3 DME!R
2,421,610,714 *FFE04E95FAFC48D4F2A8B3B81D827D25BEB97B96 H;S
2,421,610,715 *FFECF1B3523F13044453052341A9B00A101238D2 HSUMMERJ
2,421,610,716 *FFED2F0F03C3C6CCB78BDC42ADD78997AD183157 H`=T
2,421,610,717 *FFE6D61E6677757B8E4F76FFF11F6FC817DEDAF2 HUJOWOI
2,421,610,718 *FFE3506A36A69CEA7B3930F4757197AAE8328BFF DOMINIQUEJAMIR
2,421,610,719 *FFE0628CBB2BB0CDEDAE363FB9BDAC5E4F053D8F Donde.Ya.No.Te.Tengo
2,421,610,720 *FFEB3086B747E5DB1BBFDCF798CE8D235CEFFA44 dontehettwer
2,421,610,721 *FFE36B11079FF2703262D2434CA3FA2314AEDF48 HYC
2,421,610,722 *FFEA01D48571E8C3420B8C918E6C82A6C06272A6 IAMCHRISTMAS18
2,421,610,723 *FFE1AD68E21290C384B729F063B55BA72C900AC0 [email protected]
2,421,610,724 *FFE3CDAC970E4F816593C0C061A7173487CEAA00 DP4Y
2,421,610,725 *FFE0BF3ACBE8984E1F6A896AA5CEACF3821BE754 dq+4-
2,421,610,726 *FFE342B18E727B6A6C750E8451511D1118366E23 idylists
2,421,610,727 *FFE87A683623EB7FADE5707DEBB0C11F79643D72 [email protected]
2,421,610,728 *FFE751388A84D22B7BC5E17037C688FF09285591 IKUNENE
2,421,610,729 *FFE82724F7021935E4BBA0E30D9A414417BBE4A1 drg)t
2,421,610,730 *FFE548EF2C9658F6120F1F086622E78D2C252EE5 DSLL:
2,421,610,731 *FFE8213723D6923606C1D77202605D656B5E8F18 DUANE.THEINERT
2,421,610,732 *FFEC70C69014DE8727A3767B9DCDC07DC616E997 IN3QUITAB1Y
2,421,610,733 *FFE7A11AD680C4ABDB2DB99A1637E2F342A97D5A DUDLEYFERREE
2,421,610,734 *FFE97438567E248A32C8460D859FF0EA2B5E67C7 DUMBETH4
2,421,610,735 *FFE6AF4FF4E16749DE400DCE1B16D8F69E2F62F6 inkical41
2,421,610,736 *FFEEB40BD7C869C36342435B8E98AC88E076D792 INTERCEDIRT
2,421,610,737 *FFEFE0C97DBCCB58C319399ED3CA36A9370F8CB6 d%ve-
2,421,610,738 *FFECE5395E2427A2E124807EC344F6CEFBB9AAAD d)vol
2,421,610,739 *FFE81BF5F65AF793A74575E9E709364F7C1FF009 d(v(q
2,421,610,740 *FFE10429C57C674A137E74F3CFF86B9801B638F9 dwgm+
2,421,610,741 *FFEB7E09913C0616D17A4FE285DD193AEB0527BA ISHALLTALKTOYOU
2,421,610,742 *FFE87CDC3BCCAD582E2743AE2E90D5DDA8FCCA43 isidrovirgin
2,421,610,743 *FFEEA77F84C76871E8F0AE19F430724199A4CEB3 ISMAELRIGHTMYER
2,421,610,744 *FFE8C385A380B3D3E0BB0E97ADB7E1D3B82D925F D+ZTQ
2,421,610,745 *FFE38164063B4E545E8ADCCC3BC9F9FC59D140DB E4
2,421,610,746 *FFE45EF3592A07C6386B49EEAFF0BAF636208925 EA8)R
2,421,610,747 *FFE5CCD255C0B520C8ED4D23A3453AEE8ACBCBA0 izzatfatima
2,421,610,748 *FFEBB4818269FFBC670DF4803C809456D7B14989 EBESOR
2,421,610,749 *FFEB7BCF88FB8D373BE46AAF34669FD873033639 EB%IO
2,421,610,750 *FFEB47C38004FC728D515B514494B88FEFDC6F76 jacksonsantellana
2,421,610,751 *FFEB8CA2B287C746C80B783047056ECADC9A21AC ECR4$EUR
2,421,610,752 *FFE12169C8EC781B49FF62364CFE295898402A6C EDMOND.RUOPOLI
2,421,610,753 *FFE0B132D70D8470C371AEDBE0EAEF5BEE6778C4 edukcji
2,421,610,754 *FFE24ADEB59A0F5859216EBD743DFF57A4816A88 jarenkonlotus
2,421,610,755 *FFEBC23F0A231E0B09E31FF9E04380425BE88FAC EFRAINMITA
2,421,610,756 *FFE72B2ECB20F6BFB60514E4E2C5F323B64D99AF JASQUELINAA
2,421,610,757 *FFE22075BA7F3E119B68377BB3BDC4B3B53216F3 JAVIERDELBUSTO
2,421,610,758 *FFE71B0B492987E4D110DBB0D14F545A9AABEF4B javierswalley
2,421,610,759 *FFE0D7083F65BFB0CDE32CA984C6701274CF974C JEANHUSSEIN
2,421,610,760 *FFED3ABBD81F9DA638B9BFC856F2D3A8C6E93168 jeff dunham
2,421,610,761 *FFE98D13C361FA70E90F3697404DA524FBC82AD2 jeremiahbertolami
2,421,610,762 *FFECE8B0D88A89D995844749EC43A22415DA2E1C ELFRIEDA123
2,421,610,763 *FFE4769E287EFB6850CE4440F7404F21F2DEAB84 ELIJAH'S-CHAIR
2,421,610,764 *FFE65F69B3B49E662410EC97BC93A5461ABB256E JESSE-GLANCE
2,421,610,765 *FFEDD6D1D04BEA6C459237174302786A4659D2F6 jessica-nelms
2,421,610,766 *FFEED44D5BD26E2D95E07492D3E108D1CA138EB0 ELIZABETHLAHEY
2,421,610,767 *FFE7257CC263C428A10A98B2309E9730C7276046 jf;0
2,421,610,768 *FFE5E0CFB91DE9A240FDD8C59AD07888B686E82B ELVINMCMILLIAN
2,421,610,769 *FFE5D605E93C1EBEC62C4A85ED91AE1680D5CFA1 JIM TAGART
2,421,610,770 *FFE1CBEE2E616033A0D56E92319BB0D94F4BE706 JIM.TUPA
2,421,610,771 *FFE760C712B2D59888486940E041FA15DCD6F1AE [email protected]
2,421,610,772 *FFEE3873BC415B2D198B35118A24E3749C1DE14C EMERSONTELLER
2,421,610,773 *FFE05148FCA0135283FF3ADD3C656AFBBE1072B5 jlrana
2,421,610,774 *FFEB0C04ABD5D4BFCDFACBD551B2E4C4F6C73A54 JOANNAPHOTO
2,421,610,775 *FFED767ABD9CCB7A06B6A24F4974C089EC857120 EMMANUEL.ROWBACK
2,421,610,776 *FFE30021013A5EDA12E0A0EE1C1075B3E32EB99D EMPESTAIT!
2,421,610,777 *FFEC3870A1A0054555CCE5FB27692AF0DBCAC849 [email protected]
2,421,610,778 *FFEFBCD6524513244A4ED7C2ABDB9A85CF6CF80B ENDOIT
2,421,610,779 *FFE303A4DF2FE1DE036A302752FD39A4881ECE96 JOHNNY.HOGSTON
2,421,610,780 *FFEE58A37C46E6BCCBA7B36A4134DE34DF518173 ENK=
2,421,610,781 *FFE6A2C515DD074EB387B11BBB9DF2DC98BE121E jondalhart
2,421,610,782 *FFED453A16B339F7BF82FC4DF53C58CEBE5825D7 JOSE.ESCUTIA
2,421,610,783 *FFE83EE59750A1E504C6EB98DD60AC27181A7A11 JOSHSARAH3731
2,421,610,784 *FFEFACA5CA9FB05B4E1C6FB0747B8ADC3ED66B84 [email protected]
2,421,610,785 *FFE84BC9FC84778CD42A116219189608B9C00418 JQUITTA0
2,421,610,786 *FFE9EE3E19C4F8D757FEF7C7E0680FB2158D5A76 ERANSHALEV
2,421,610,787 *FFE5BF360607EFEF7A4F2B6CC567DCC1622DC234 JUDEDAIGRE
2,421,610,788 *FFE57D0E12156DABF0851440C52C8B5E227C2A3F [email protected]
2,421,610,789 *FFE11E02946548C4D2EB74F2C06EF6A98450E9C3 erwinharbold
2,421,610,790 *FFE61217828961998CB464BB48DB1F34FFB17869 ERWIN.YERBIC
2,421,610,791 *FFE92D492D9FEBC03B22274B9303A7CD7BF2146F ESCADEK4
2,421,610,792 *FFEA75C31C3D066B05D87024FE4CDE6753C1063E k3y-s3nt3
2,421,610,793 *FFE7F3C10F5A7B811F6FB289F2E0FE0F100899C0 [email protected]
2,421,610,794 *FFE1AE92F2B0CEE015F9B99EB841C4BA3C41A234 e>+u
2,421,610,795 *FFE8494F8D0192D7318C11078E375BBC64FCD6CE KATAYLEA2006
2,421,610,796 *FFEF9E5016CC92BDF9BB85CB958276EC7059507A EXCL4M4+10NS
2,421,610,797 *FFE6F9D3D9B62630C391F6CBB4EC885559BC88EE kelleyeschette
2,421,610,798 *FFEFFBD63E12F48FFC3F5C66BA76A38D8D15F3F1 EXTRUDIERT?
2,421,610,799 *FFE07E15CCB17E7CCF49436D54D0A82EC23A9F1B EZ[L
2,421,610,800 *FFEED97C7DB51EEA83B844C0E012C2C94A06BE95 F50818E1-2A0A-3909-9495-287E32D34A98
2,421,610,801 *FFE1A035C9715396080C016466AE74C046C9AF88 KERRY.FAVALORO
2,421,610,802 *FFE2443143AFC9E1840DEF9915B2BCE368480525 FAHAD-BOO
2,421,610,803 *FFE52B597A5494D8F149E943D1AD6346FBA8ABF4 KEVIN-YOUNGS
2,421,610,804 *FFE1A40A3082DF3298EC6127EACC698EA3F3EF43 KHUSHABOOS
2,421,610,805 *FFE77F277549E66681D58A7C4B07922FF2B592FB [email protected]
2,421,610,806 *FFE764C2D050A960FBCA6F210443A8ADB241DF4F f*|b
2,421,610,807 *FFE84C340298738FA58B698F2ED532031917B295 KIPMENIER
2,421,610,808 *FFE3B1FC0C32037B33F001431F0F33C19F739423 [email protected]
2,421,610,809 *FFE7549DA446B3FD1A1E07D2C503E6F1E23488E0 KIRBYKILBY
2,421,610,810 *FFE3584F752EC4FD6C87DE880EE5939E969B5A5B KIRKJUBÆRJARKLAUSTUR
2,421,610,811 *FFE43ECD0144027685873F613A49E5D34363A874 kjirtspo
2,421,610,812 *FFE47423F72505B1CA17EB66F2E5BA6CFF3D9CBB fhy[
2,421,610,813 *FFEDE37092666D46D8411118C731239E124B7545 f$|l
2,421,610,814 *FFE9ED4DF21FE454F6424099E8BCEF19351BC4D2 FOOTBALLPLAYERDIEDWO
2,421,610,815 *FFEE37086A1E6153E203589A7CCC0AE8D80389E1 KYAWTHETT
2,421,610,816 *FFE44839CFC355AE1DC614617436A8DF1870E238 KYRA-DAVIDSON
2,421,610,817 *FFE22E634BF63C577C3FE54BB74EC7DA137FF4E5 KZELENENKI
2,421,610,818 *FFEE165A959ADB701699D43F6A00D96DBF82236D FOU→TOUR
2,421,610,819 *FFE30A1548B2BF323A7C55E8BB8D11B2D2353FD9 [email protected]
2,421,610,820 *FFEA9A7B61D52E096CC0B07194E1F7CF6E2B0D9A FRANKIE.MIERZEJEWSKI
2,421,610,821 *FFE8D0528DA5C8FDEBC0D908F5EB5F81BF5E873D FRANKLINMURIEL
2,421,610,822 *FFE259E9281501C5BBA97E965E888C7B908D9BDB LAMS4
2,421,610,823 *FFE04B3AEC4FDB1AE6AC67B191817590B1E3216B fredericdelellis
2,421,610,824 *FFE6EF0527E43E650AC02CD77B9F1C9FCF4E7004 landenpunt
2,421,610,825 *FFE820E5385972024F7FF68C4B3718379813BE6C frederikgp
2,421,610,826 *FFED3B4FDEE06928DD41691B9C1BDDBB1E6C2966 LANE.GERMAN
2,421,610,827 *FFE12C9EF2C13C2F9D002AFBFAD447E58BFADE73 FREEMAN.DAKE
2,421,610,828 *FFEF064177A7C2520CE72E248BCF89CF87B56798 lanre.taiwo
2,421,610,829 *FFE2A8C503772208957085ED3E73B0BAB610D61F LAOPORTUNIDAD(JOWEN&DAVEBEE!)
2,421,610,830 *FFE53A0B832A07A2344DE0F0911CCE4D6EB54740 lauravandijk
2,421,610,831 *FFEE448CEF9E7E947675749501ECC416063C3AE3 FSTMLTJD
2,421,610,832 *FFE125572F06F89FC6D7DF2E8D0DDF68AFC370B3 lazarojess
2,421,610,833 *FFEB21D6DCF5465F991C77362B7B9118B100400E FUZZ-TONE
2,421,610,834 *FFEA2C674042208744AE7DE3A27FA2C163166631 LEE.KAPPHAHN
2,421,610,835 *FFE0CF9860337DDD23C15C5E48EB837CA6CB37AF LEEQUITER
2,421,610,836 *FFEFF0BC83FA8911F8EB8A11BD44BA09C842E7B9 [email protected]
2,421,610,837 *FFE80F9C89E6BAD9D8A5107BBD2E27EAABAD0BDB LEIFCOTT
2,421,610,838 *FFEEF8B3B1CE853012F94F6E6B8C7C228B51FCC9 LEMUEL.LINDAMAN
2,421,610,839 *FFEDCA5709EA75D497A340BD7E59B30BA37DC8BF leo-anibaldi
2,421,610,840 *FFEE6D584BDCC551BE6C238DFD0CDDB933C37FB2 leonardpyramid
2,421,610,841 *FFEB58624AB328A69FE2890465189BDC64FCAFA8 GARRET.SCHNETTLER
2,421,610,842 *FFEEB15151E755811D54D9AF40F7FAADC131CCC7 LESEAUXBLEUES
2,421,610,843 *FFE0883D1AE81607FEC03906380266C32203E3B5 GEOFFREYSCHOENFELDER
2,421,610,844 *FFE39A562DAA3864EAF6C42E3B5C008C5C8383F5 GEOFFREYTIMBER
2,421,610,845 *FFE1B6D2543CDEACA288C8D8E660879F60FD7192 likemian
2,421,610,846 *FFE34F1B1B6C7FD0713370F191709223F441783D GEROFFELD
2,421,610,847 *FFEB7DCCAE00B2CC2B80D6F44601262AB3773EAE ghan-patel
2,421,610,848 *FFE89DAF73277ABD60BF10F66627A9E314A9A3C4 GHENAIDAS
2,421,610,849 *FFEA6776537114985302DF315AFBA046033D0153 [email protected]
2,421,610,850 *FFE72CF92C0E225C3691469B4B1EA22467BB4E8D LIUQINYU
2,421,610,851 *FFE270C05CF22891AD6D92E63FE5A98356130856 [email protected]
2,421,610,852 *FFE598DD1852BF6BDDC8B05614CB3E84332A0989 Giovanni.Battista.Vitali
2,421,610,853 *FFEB153617422DFB6D4645CA2A9549C3691A537E [email protected]
2,421,610,854 *FFE021DDFEBF1F9B9F07B82A235A8CC1BFA6A4BD longhallmark
2,421,610,855 *FFE95A45ED7B03DF909BEB6963C16A62BBE90CA4 gmyyelyb
2,421,610,856 *FFEC0EAD5E2E5444663F90BDF9A929447C236BCA GN`S
2,421,610,857 *FFE19281FAA1935E6079250A0E20F1A348DF2193 goldtara6
2,421,610,858 *FFE843664F21FB58B08437DFC6612B7D0EBFDCA0 GORMANSANDIE
2,421,610,859 *FFEB07E4CC465DF4E52A9699BC1C0E602C8CDB07 LOYDBUCKEL
2,421,610,860 *FFEE96128951749D882DD6BD0CB92F7DADB9C680 LSCHIFCOFSKE
2,421,610,861 *FFE2B046EAD0262ED5FE5AEDAE4F941A21109C4C GRACEGOLD4
2,421,610,862 *FFE3B3D8BD6A8A30015FC4FB548E853CE35FBC52 LTROELSEN
2,421,610,863 *FFEED5F53F103B61E7F00B68D98F8E82E97A343B LU1O
2,421,610,864 *FFE78BEF5B55429AF9A93B7CEEFBBF89471A0752 lucius-duplantis
2,421,610,865 *FFE363761C425D6DE9B09D7E048B365FCF194BEB GRAVIRAH7
2,421,610,866 *FFEA66BFD01D4C52DC52DDD0435E515DB1153A90 lucregoc
2,421,610,867 *FFE0FBA796E4AA2161504EC96C1AF129BA03C783 GREG-JIMISON
2,421,610,868 *FFECBD7A5CD49E5824D416062748908D85BF7F88 gremota
2,421,610,869 *FFE6BF6FD48E72B0C8299D7B1C53D51113FD4F38 LUXURYFUNS
2,421,610,870 *FFE07AEBBC249FBD3CEEDD0F8BC93E959E6B4242 lwoftabbing
2,421,610,871 *FFEEE2F33E00853BF2DA2A5D90D267F88A9D5F92 M4ize-yel
2,421,610,872 *FFE1F168DD25796AAEB9C40B805167239679CA16 maciejkowice3
2,421,610,873 *FFE073F4045A93532372A74E96EA5EEF72D0F4B3 H4CKRUL3Z3U
2,421,610,874 *FFEAC2247227A7AAFD1F6A62D16AD371917A25FE MADISYN454
2,421,610,875 *FFE70EB0B59EE272456DEE3EE162F6BB2E5FAA55 MADRES’
2,421,610,876 *FFE4FE14FFB08F6659A85571C3FF588384587FE4 MALCOLMDATTILIO
2,421,610,877 *FFE459E5E8918256E7C3C749FF84DEE01F39850D hangmata
2,421,610,878 *FFE5578CF79ECC019AD5B876AAE8DB0608AA85C2 HARINAAN6
2,421,610,879 *FFE273FA650BF68B8781498E5EB54EE8505AD9BD HARRIS.SIMKOWITZ
2,421,610,880 *FFED751182E1AAF16A2C153588EB5EF836D32E88 HASANIKRAM
2,421,610,881 *FFEF59CBD29EB377B255D08F5FFD7A5EF7E81943 hasanrovi
2,421,610,882 *FFE101B1A3903A24377705E22A987984BC866111 hausner hh aw1 s n er0
2,421,610,883 *FFE36A4E7A40B19031C3CFA8363BFE9A1F0E4ECD MARCUSFIORINO
2,421,610,884 *FFEDD063CBF12216593BBA4F82C92089313AD127 marcusmyes
2,421,610,885 *FFEF2130E03429DBDFD4720225A2799CC6B326AA HAYDENPISCIOTTI
2,421,610,886 *FFE73D71E71719173D616077E38B6D962737B359 HAYDEN.PISICCHIO
2,421,610,887 *FFED10237E1AE54A07A618F06EFCC33997D61DD0 hdr`
2,421,610,888 *FFEE53093C3F5790AB9BCDEED53FD7C327706C3C MARQUISHARROP
2,421,610,889 *FFE93738178576370C24E1FA1C715711F7CBB426 MARSHALL.CARNOHAN
2,421,610,890 *FFE1669E1A4E73454BDD446B016EBF4CBA9FE8BA MARTINREGNER2008
2,421,610,891 *FFE3D70D9F04F2A791521823DF8DF4B425A0F353 MATEMATICA2005
2,421,610,892 *FFE62E442058956C57F736970339CD553B448A29 HIERODIÁCONO
2,421,610,893 *FFE4908739CDCE0CADEB9BE88E31972A038C1829 highwaybywayssussex
2,421,610,894 *FFE8E327302FADD1BEA5536EB28327604B2F2625 MAXWELL.ULREY
2,421,610,895 *FFEBD62981DA8D05FF0A155E1786DB538C5E6BAB MAY-LAURON
2,421,610,896 *FFE000CCD928E35D12D8094D6CA1BABA5140AF46 MCKINLEYROMNEY
2,421,610,897 *FFE064C690EC23DD5DD4ED15EC594620D6EEDA95 hobbit1994
2,421,610,898 *FFED6058BC87C979AC5192A77AA245A34A9859EE MEDMANSOUR
2,421,610,899 *FFE07A329443454ADF1E847C6454E9A3853DF21C HOMOLINALOOL
2,421,610,900 *FFE6FDD41DCEA0BD217853BE7E35B2DBD1750139 HORN-CONCERTO,-OP.-58:-I.-CON-MOTO---TRANQUILLO---CADENZA
2,421,610,901 *FFEAE10DCFA49F727EA04970F53AB1EF1A884AF6 MERRILL.RUYZ
2,421,610,902 *FFE14F071573998F0A2A949E8E34217E77130DE5 merry-christmas-to-all-the-world
2,421,610,903 *FFEE07ECC6ED9F50ED889F6BF40B09A4F15DE8F8 HPJLOZH8
2,421,610,904 *FFE615F76D4DFDC13DD499155AA07FAF0B410178 MGMG306
2,421,610,905 *FFE01D9D9C1C93662FE098B028EA693A5255267B mindestwäerter
2,421,610,906 *FFEE17F2605D91456826C26A85CA5AC1B6A0739B minhwhang
2,421,610,907 *FFEC6DBCDDE7FDE54173522E34A72716468F793D iammaxmax1996
2,421,610,908 *FFE84C9BF0E550E1926BFB70A74D950BE4E78BEE ICIGOLOOZES
2,421,610,909 *FFED3A817E7B4DB12B43E7780679DD9317D75585 MODESTO.DHARAS
2,421,610,910 *FFEC61027680B00BFEE16CCE87952475FDCE9388 IF-(%FLOODPROT.-[-$+-[-$SITE-]-]->-%MAX.CTCP)-{
2,421,610,911 *FFE355A95883B2745AA2E094C8D5649BF9AEA90E MOHAMMEDHEINEMAN
2,421,610,912 *FFEA683398BB775DD302031CE5853F59000D7322 [email protected]
2,421,610,913 *FFE94B916C4BF0265297C61C8DDF816D74E522D5 ilaropac
2,421,610,914 *FFE935D59891207F7586EB06D9EFA511FB7B6B3D [email protected]
2,421,610,915 *FFE5CF5907838431FD16091A053A0F403E46D4F0 ILOVECHARLIE1666
2,421,610,916 *FFE5667A2366054A3E64A6FD32C7851425AF7CBB MOSES.HOLSTE
2,421,610,917 *FFE2F33E59D85E38FE8031289496C447396CDA9A iltmeter1
2,421,610,918 *FFE84DF4685EDD9F28A4F9E9276F1FD295BF12D5 iluvtanya1999
2,421,610,919 *FFEC40FB2C3506DA7C5D55E02799DCC7B8847C7F impavidare
2,421,610,920 *FFEAB9B8C27E6BADDE349B6E5057F220F9654B0B IMRANJOARDER
2,421,610,921 *FFE058616AF04E225A4A3C406FA93E0614A13537 I'MYOURTOY(HOTBURRITO#1)
2,421,610,922 *FFE2FB037C1CCCA35E0FC648B3AEA35E1652033A IN ABSENCE OF LIBERTY
2,421,610,923 *FFEB76E25D0C9A60AD84C53C354320063CC27D92 MUSAVIKH4
2,421,610,924 *FFE9CBFA9A4D54E3571D940B51E922D0370250A5 muskadell
2,421,610,925 *FFE2A912E260C8D00C866335C194C1312FFFCFC0 INICI4RLH4S
2,421,610,926 *FFECCC453F5C5938A1A57090EA4661BB2F887274 myfavouritepart
2,421,610,927 *FFEDDEF37A0D4699315DDA7CC9EE70951D4A4E75 ISAIAHBOARDWAY
2,421,610,928 *FFE6D62E0EDF6A5670E8A235E2AD666E68AD1BDC [email protected]
2,421,610,929 *FFE3BDF905FE0E9135F2DBD65A17D85CE266B321 ISAIASRAMELLI
2,421,610,930 *FFE700B7B2D18F156AF0547A79E5E1B6C916104C ISAIAS.SWOBODA
2,421,610,931 *FFE231259F53247F53B341E44CD2F0E86466E77E isela-reynoso
2,421,610,932 *FFE611E1D6554334BF1E254EBBA67D2C9E6E3890 nathancauchon
2,421,610,933 *FFE9F728260FD2D24400196288375230717F072D issacditman
2,421,610,934 *FFEE29BE8C8BBA24AE16E2BCCCC25E95516CA9F5 NATIONAL-AUTOGRASSCOUKWWW
2,421,610,935 *FFE5AE0FA83AF9502CB79B7C1CC7F8EFCFA93386 NAURANCZYCY
2,421,610,936 *FFE8ACD913AFF1A54C7D4337C6A161263C0362A2 itailgip4
2,421,610,937 *FFE9EECCC2A0187DCC605D3E5E6CB23053954B33 IVORYEDLEY
2,421,610,938 *FFE032C77F91071E678DB3BD8A83644AEDCA3B4B neduusi2
2,421,610,939 *FFE969E7A0E094A0C5521779466E611137E88CB8 NEYTTIIL
2,421,610,940 *FFEBAEE87CC33C8B22D4B18F388B3FF484978FDA NEZANEG5
2,421,610,941 *FFED31C6F739A6D019CBFB596E58AD8A19D2EC36 JAMIE.CULLINANE
2,421,610,942 *FFE52B1AAC4DF127A22D419532B9655BA0CF80F1 jamir879
2,421,610,943 *FFE4FC294C03EE327A5CEFBB24571889F509E597 nicolas-hulot
2,421,610,944 *FFE1610FBCB7ED0D34D6FFDBFA3F48BCACD6F8C0 NIGOAARIO
2,421,610,945 *FFED0747EDDB87FCDBE3605C2B3D0EF1A144B418 JARROD.SHARBONO
2,421,610,946 *FFE493B3FBDCF2E1538A695EDD8AC6127CEFCE14 jason-ehrmann
2,421,610,947 *FFE6C3DAB934F023E915A1761BFB3A8D22FE054C NINALISA
2,421,610,948 *FFEC2929F34C5EEB6DCF2A251F1CA83BB5CEA50A JAVIERPAUKER
2,421,610,949 *FFE2F24764F8DC3F220814DC5B70BB96B2D9CDF3 JBERGER6
2,421,610,950 *FFE61C2C06555AD4D62712EBEA4852035A1E76E2 NNDDRSSR9
2,421,610,951 *FFED51D057B5F73CDE56E370EA0F9F810DA17A22 jeannette-mcmullen
2,421,610,952 *FFEDA5D031BF098F18B8A7AADBF8AA1D3094F744 JED.PFIEFFER
2,421,610,953 *FFE3BDD3131D85C0C9C02E7F84F45F7B3426A478 NO HACE FALTA QUE ME DIGAS
2,421,610,954 *FFE5776ADF938833956775F59EEFA7E4887A1D79 jegede.olatunji
2,421,610,955 *FFE0683400A7AFFB771C9EE6704509DEC5F70597 JELLO (FEAT LUX)
2,421,610,956 *FFE12274005AA439F1C41CAB92D9589416FB66B0 NORBERTOLYERLA
2,421,610,957 *FFEFFBD3AA94F97E41E0D57E4B43E748EDCFF83E NORBERTO.SCHAULAND
2,421,610,958 *FFE23659AD6D64CD0F8F3070542A6B16A1A2350D jeremysnead
2,421,610,959 *FFEF7149EB45F8B56517C7D632492EB11EDD1747 NOVELLENSCHRIJVER4
2,421,610,960 *FFEB1A023C4818F1437A0F76FD6EBC108D74FCFE NSTRADLIN
2,421,610,961 *FFEDE3F63A0801B6655D8CFC8136574C13D2B066 NT<K
2,421,610,962 *FFEBF865BDC6820713CDFAB1DCCD884C3479EEEE [email protected]
2,421,610,963 *FFEC910E77BFC90EE9E80B926AC8EC0C3F4AE8BB [email protected]
2,421,610,964 *FFE632E52BA43B925BC5C0787C83157306B7F108 jim-cormier
2,421,610,965 *FFE3A120F97C547EA130B60EFC4686D80BA743CB (^_~).O~.0~.<----P
2,421,610,966 *FFEB706C4957DBE6F1B75E6AFF49706A61EB12B6 O85d4n5
2,421,610,967 *FFE01E0F33BAE427A5B3DF9789A12ED878A7258B [email protected]
2,421,610,968 *FFE8ACB839712AACC9C604A84393DDD7445F7ADB jla
2,421,610,969 *FFE3E9BEA683CC4460C9ADBB9996A2DAEDBC98C2 OCTAVIOHENAGAN
2,421,610,970 *FFEAAB15AF643DDADD73CE9E48F4B827BAEF44E0 johnnyn'ycomprendriendutu
2,421,610,971 *FFEA0721987B55669B9FF6C2C3FBE4F450D1F519 OLIN.NABOURS
2,421,610,972 *FFE62453EECE277776877805F9596BA51CEE2ABF OLLIESAVEDRA
2,421,610,973 *FFEE666B7E7107BBDFAABEB0990BF4D5A495389C josedepetris
2,421,610,974 *FFE2BD68A0970AA6E85E9532FF7C28CE2CB50FB2 on3l3af
2,421,610,975 *FFEC7128E3295F7008A708EE0DB2A1A9F6A3C72F Onomatopoetically
2,421,610,976 *FFE026CE7656CFBF9B326A30A14955FC355AB19F }O{ O~O~ @---Q
2,421,610,977 *FFE879812F759797907BEC678DA2007B0A4E0C70 JTN20
2,421,610,978 *FFE83131DA22489CBDDBAF81D3A1811A3CDCA0BB OPERNHAUSES
2,421,610,979 *FFEF84DC989B6DA833B6E49F5F67FF9DAB80C3E5 JUSTINYEW
2,421,610,980 *FFEB6131402A7EECE1868B906DAC37E9E9C87798 jvenskusing
2,421,610,981 *FFE26DD2701C4695AC8D267286542A5B7BE32EF0 [email protected]
2,421,610,982 *FFE540380CA4566CECA0AB9D50848BBECF1DFFF6 kaitisjttf
2,421,610,983 *FFED278012101237429AE30F59826F6B0652920B OVEJERA1
2,421,610,984 *FFE3905F207707D76E6561629F0E8F0AB716DAFD OVERAIR5
2,421,610,985 *FFECEC621B5D71154BD554CF79CCC0592CD80F99 ovilagi1
2,421,610,986 *FFE767C152DCB23DDF930EAEBB7F6944A9C323B0 KDATTOO
2,421,610,987 *FFE9CD4AAE1817F37D159C1E0B060472191553BC [email protected]
2,421,610,988 *FFEAC4EF1BFD2D5F444C638405326538C7C57624 KELLY YIM
2,421,610,989 *FFE2BF4B2CC5D5B34BBBC252C3495D98525815D5 PANGANIBANCATANDUANES
2,421,610,990 *FFE4D957263019BE2FBC2B44790BEC38839381F7 KELVIN.AUBE
2,421,610,991 *FFE4FB88A86B3DBE064C5096D195D4301D1E816F [email protected]
2,421,610,992 *FFE7BF92D4DA47F724E15EE847A20F79E1FA2301 partha-sarathi-kar
2,421,610,993 *FFEC0FE60025306CF350B6A5E0015DAADD7D1526 PastoraleinFmajor,BWV590:IV.Allegrovivace
2,421,610,994 *FFEBB3B56C7E0F044C7CC40322B2AA6A37E51C80 kg{
2,421,610,995 *FFEAD0466C618DCCDF467886B9F4A6DE9460B3EC PB`~)O(
2,421,610,996 *FFE73C8A3ABACE16ADB3FBDD8B3FE1E82F65479E PDS_LJ
2,421,610,997 *FFEE2697CDC9172749E910DC7E588F32D571154F KlavierkonzertNo2Edur,BWV1053
2,421,610,998 *FFE5D2AB578561CDC18F875EA68215AD8509AC0D PERCYPELOSI
2,421,610,999 *FFE9EAFB273C90C14C1272F377493BD55F5415A8 perfectcollectionys(disc2)
2,421,611,000 *FFEF043B1E4AB998E0FDBA3961C5D04583B9D78E PETERMONRAD
2,421,611,001 *FFEC86802C055A7FB1CCF5BE3AE334EFAB83D2EC peteyork
2,421,611,002 *FFE77A046D581A5B26591D4A1E67B5404AC34D37 korfbalwedstrijden3
2,421,611,003 *FFED7DE3F55514C321F3405AC5250054F522BAAE KT.YEUNG
2,421,611,004 *FFE01B6FFE3F80E373C1BBAB67BBFE15057FA53E PL4KK135
2,421,611,005 *FFE834FDE5EB8D449A1D8EF1F0E736077808973F PLANETBRED
2,421,611,006 *FFE2ED124E693FAD9C3F3CA353D3199401A162A5 PLUSQUAM6
2,421,611,007 *FFEA88C3392BCE4D7C9971531A9E197D68523CD1 la lucretia, hwv145 - aria: 'alla salma infedel porga la pena'
2,421,611,008 *FFE8CB3433919FBAB1C66C1F16AE2BB1FCE7EE71 laurencemailey
2,421,611,009 *FFEF066F87D4A9488EB8003DCE02F4E10266A3E5 LAURIE.HOPPE
2,421,611,010 *FFEDDAE2270F202959EDB22078798669B9C2F828 lazybonesed
2,421,611,011 *FFE387D1352E7504A9F5299EDDA85D777BBDDEC7 LEANDRO.SAGO
2,421,611,012 *FFEE6962DC6532B5BA7A3F20B2BC99FBE678E271 prettybombs(liveatcat'scradle,chapelhill20020419)
2,421,611,013 *FFEAA18DB61C57FEBFCFD07C9AE5E80A886A7C5A PRINADIS
2,421,611,014 *FFE9178573E1FDE23CF28D91BA4574004E040D7C LeftHooktotheRight(2006SpringSampler)
2,421,611,015 *FFE7D49600B1A47903127A7CABF1ACB5C91F3616 P##@~-~-Splat
2,421,611,016 *FFEA296C3CF0BF2DF65301E957DA2F2C90F40E79 LESBULLDOZERS
2,421,611,017 *FFE7635EFAC13E7C312274A41D62C8C252074A34 LES.DEFONT
2,421,611,018 *FFE978075CACCCAEC3483148D9575503B3149CB0 les patineurs waltz op. 183
2,421,611,019 *FFEAC3ECEAE2D817096BF0B03FC8ADE9F25A62F3 LESSER-THAN-THIRD-CLASS
2,421,611,020 *FFE59B659BB124674D0DFBDFF499348FE5ABEA29 Like.a.Prayer.(MLK.mix.by.John.Pillin.and.Steve.Smith)
2,421,611,021 *FFEFA633A7D12EDBAB4B188E24F06777234F2283 Q-----P***SPLAT
2,421,611,022 *FFE21AB4C0E789857250D905795975BE9C99A394 [email protected]
2,421,611,023 *FFEC06738077F813EC8C5670EF68423C7AD4601E LOGSEQUENCE
2,421,611,024 *FFEC9C162238789E29D1215A9A4D96E0527428A0 look-at-me-now-(original-mix)
2,421,611,025 *FFE218B3BB90511BA4ABAD76F2D801001818F2E3 LORENZOALSHEIMER
2,421,611,026 *FFED6555D79F54CE97A69C505B9B4BDC4931284D LORENZOHENAGAN
2,421,611,027 *FFE39DB8641BE8846D1FDBCACE1F770AC33491B5 LOUKITTELMAN
2,421,611,028 *FFEB7336A76AE68298182947B3C10260ABD51F0D LOURDESARMAS
2,421,611,029 *FFE680E1561856EFA46003E2A7F2F1F06F1E893F ramhead
2,421,611,030 *FFE9EB9A24689A20103B051AF21F69AD6DE7565A RAPTNESSES7
2,421,611,031 *FFE723D6E0C2439528DEEB4F99672595078C5435 RASSHENESSE
2,421,611,032 *FFECB9C4045516EAB016FC15C4EFECB150239538 lucparadis
2,421,611,033 *FFEA9662075C88C152206A3C16D5A4ADAE789673 LUISGODAR
2,421,611,034 *FFEF62F0011C8A49FF040150B50490DF247574B4 RAYMUNDO.HAZELRIGG
2,421,611,035 *FFE6E245B5382B64917F1E3E4B28A227B17ED9C3 LUKAKSESSA
2,421,611,036 *FFE38B0468F49D1490CE91B0EB5EE0A9B7781649 LYMAN.TUBVILLE
2,421,611,037 *FFE9B4D8B1681A2AA6A293203EA637B4DD500108 recenseo
2,421,611,038 *FFEA43BBE3DDDF59A2B5F42E66C24AA84106C645 [email protected]
2,421,611,039 *FFEB174DD6D2D4A2891EBB401B36A873134AC48E M1115+0N3
2,421,611,040 *FFE823D28208271D067B4A07018FA85FA61E397D m231147
2,421,611,041 *FFEBFC2A2CD394E80AF27DAA6044832D3A32B6E8 REHANA99
2,421,611,042 *FFE09690A8923CAE346DD94E5FEC8D0038B5AD38 magdy-hegazy
2,421,611,043 *FFE010385456A4048F9E08D5B8EB4157BAAD88F6 REINALDO.MANTEY
2,421,611,044 *FFE7A5009E81DFDBD2D897991170A52C7C81EF4C REJENERASYON
2,421,611,045 *FFE68EBC8EE88DA8EADBF7C52E141DE900560234 REKOROWO
2,421,611,046 *FFE75952FB248D785D2D6EC73771B113256035DC [email protected]
2,421,611,047 *FFEF55D29790125F17E1197D60310361E61F0C93 MALTYPUS.BOCAKORUM
2,421,611,048 *FFE120BFE911374FB810C96487362854F3A4A7A3 REPERIEBASQUE8
2,421,611,049 *FFE444F9C6F329759D8CD28A5D5DE044C304BCA4 reviewhistopopobj_1401907342initialize
2,421,611,050 *FFEEDD64D447F6F41E2E2DFD061A2F0321B23D21 reyesfraiser
2,421,611,051 *FFE830A56238F9FCF2A367E37199E201453D9869 reylaborde
2,421,611,052 *FFE0B3C655A3B1B34D4AF452DD358A83B19A7C5E MARK DANIEL CUSTODIO
2,421,611,053 *FFE86A28AE4465BBBFF68B29E5F80E81E20C62F8 MARTIN1
2,421,611,054 *FFEFE451DCCAAB88957D89AC6141D444D7B31F7B marynesed
2,421,611,055 *FFEDF4296DDB555B6B18D915B1716587C7E451B8 mat68
2,421,611,056 *FFEC7D68C246AB7C8722C5433F0729B8FF589F36 matbel
2,421,611,057 *FFEF7DEAB76502B8B58012811ADA92A3DE117F99 MATZOTHP4
2,421,611,058 *FFE1F9A9093F62296854F949A7A9F6E7837785CF MAURICEWHITEBEAR
2,421,611,059 *FFE0E163FC5BC141E59249F387721A3DF56D17B7 MAURICIO.SHAGINAW
2,421,611,060 *FFE0ABFDDA1722D3B3D610486914AE0996AF8C74 MAUSMUTANTEN
2,421,611,061 *FFED21947F887EC7CA99000DFD7299E3B5C58EA6 ROBINBEUS
2,421,611,062 *FFE42D4EBD9B1D8A24F2FCF8A39A096F19EF3CDA MECCHATAIKONOTATSUJINDSNANATSUNOSHIMANODAIBOUKEN
2,421,611,063 *FFE0C2D16E8D5638FEBA6AB905740BD294D6B046 MECHONDA1
2,421,611,064 *FFEB0FAE6A3112A6C1CDDAF6B5C8A47BDEC38FB1 ROGERDEERING
2,421,611,065 *FFEEECBAE9A5C340574484A2061CA0CF5F7F241B ROMPERMIS4
2,421,611,066 *FFE62207A1910CBF58A499FDB1F28B8FF3A27270 RONKRUMME
2,421,611,067 *FFE128D90679CCCC786185C73DC410795A467F46 MICHAELFAIN
2,421,611,068 *FFEBC6ED30BE2ACD565360FB98787FD9B6B39D57 ropingk4
2,421,611,069 *FFE573DF48CB1BC5904C719F8D397427DBEFE4ED ROSALYNTRUMAN
2,421,611,070 *FFE4659DF669ACDF2355B665661EDF665DB137E6 MICKMEML
2,421,611,071 *FFE72F61920A29F0607E083BC6EA1C374E7CF836 RPERCUTERIEZING
2,421,611,072 *FFED832904C01DD339C0186063795E39084C64D7 rqeaaa
2,421,611,073 *FFE94FE04AF2A2CE88E6A03673B310A1B75EBB33 MINI-OPERATING-SYSTE
2,421,611,074 *FFEF5EF2CC8A19D465BC72C04F8011D779954C56 rudytritto
2,421,611,075 *FFEBB5523F36B758CE0B365395B6E58775748E2A MISSACHTETSCHM
2,421,611,076 *FFE7772EE38DFB1F6BFA963CD032169905134A85 russueda
2,421,611,077 *FFE4578EB6DB26C29CC22CCC87DC3C32BCE73D98 RYÖTÄRETKIEN
2,421,611,078 *FFE917454AA453517A6FE49DCBF468DB919E10F6 S/&\
2,421,611,079 *FFE3F4F8E4E9F27B3F0BC305103B68D7E4005EE9 S0YGAY
2,421,611,080 *FFE1CC1CDADAD220DBE4F0E2D26C37837BAF6D8F MODESTO.GREVER
2,421,611,081 *FFE48B33D93CD8B2520B7FF1E6BAF0711DB45356 MOHAMEDCHATT
2,421,611,082 *FFE3224E4A09EF9CFEAEE1C19C8C93C92E95C25F MOISESGODOY
2,421,611,083 *FFE9E6AE0CF914B0546DA2A00839B79E0764A7A0 mollir8
2,421,611,084 *FFECC564A48895ECE1010C5568D1B8D9102A3C5C SAMIELUVINMCFLY
2,421,611,085 *FFE0BB6A87E6855D50E951FABB8716FEDF39BE6C sanaullah.shah
2,421,611,086 *FFE65E7BA0566F2F99684747A6E9F5959E2BA893 sandybelezos
2,421,611,087 *FFEB8E30297F2EDBE34CB16A04124AC78E9D7DD6 sanfordcarel
2,421,611,088 *FFE87CF3434962B7FAB3A29C47125A2F711D2869 SANFORD.DREGRICH
2,421,611,089 *FFECD89EE19C43C32A8ED3AE8DDC3D4FC724281C mperzug
2,421,611,090 *FFE155D7F9BF714ACCAE1CDCBA7672CB2F760734 santiano3
2,421,611,091 *FFEBBAB3CEC4B91DE5B5B8A2869121B407323876 SAQEMARCELOFURLAN
2,421,611,092 *FFE7D9F17913A1AD36F9661ABA7AB98DE486A616 mtv.com
2,421,611,093 *FFED546C27835E033B1D85B939319B0501674508 SATORIA8
2,421,611,094 *FFE0821368AAB28CA79A86974D41D19076025423 MURRAYBRAUD
2,421,611,095 *FFE8E9B8F2A317365CB5EE3B2CEE549C277BA5C8 MUTEISM8
2,421,611,096 *FFE69F6BF0DBE390B87B3C8B610315C38613845D MZHJ
2,421,611,097 *FFE50524FBF91D0FE7F0BAE7FA53DE1967D46DCF [email protected]
2,421,611,098 *FFED59BEFE2AAB8022C1304FACDA751AADE34F78 SEAN-HILLAKER
2,421,611,099 *FFEDB078EE47FB7BDA1AD40BA547F5D81E407258 season.of.the.unexplained.(feat..thawfor)
2,421,611,100 *FFEA1663FEA4AC693A5E8F7D38811C3E4DA30FD1 SEBIINDIAN
2,421,611,101 *FFEE8E9082014EF5DCE753796A54969B3E332148 secernt0
2,421,611,102 *FFE46054A63B2BB78289A565B42A5C39693A1BF5 SELFCONVICTING4
2,421,611,103 *FFE1803CCEEB1843739525E3CC18F72A5B240E39 SELFSURGERY
2,421,611,104 *FFE48BBE0D67FDFE91F2065F635837B929E33849 NC'.`!..$
2,421,611,105 *FFEB69AC4F5844718E8CB06F4B7736072315721D NDSCNDNT9
2,421,611,106 *FFE29F9B7ED5639B80785AA2B4A3AC2DF9FD58CC NECESSARYYVNP
2,421,611,107 *FFE053485945CD42C36AF2EE78E78BA4A1317E4F seslova
2,421,611,108 *FFE99A17B53DFC055C1A93215310610DE7880E03 NETHCEHEGNEENAA
2,421,611,109 *FFEF01ED4D71CEF8E985B578650802821BAEC9F7 shanepines
2,421,611,110 *FFEEEE68F918BCA7302341415732911D8891C2D2 SHANNON CUEVAS
2,421,611,111 *FFE7422362C80BCA393BC8DBDF4330417DAD6055 NEWSEKAISAIDAI
2,421,611,112 *FFE72E9C1D488292AB373C8D3D5EE29A8878FBEF shannonthibedeau
2,421,611,113 *FFE89F0CECF15CBC6150F8A62C65BFC5667EF215 SHAUN-VERMEULEN
2,421,611,114 *FFEFE4468DB33646CA81F9822DE4E4EE5B167027 SHAYNE.COSSABOOM
2,421,611,115 *FFED3A871B062B1AD6D520D7184451E32EAEC7F6 NICKCHAPA
2,421,611,116 *FFE2AEF289621BD0A218E12F689B50A949B0F5C0 [email protected]
2,421,611,117 *FFEBAC3FA2FA3902A9DB2070FDBF777C87F16344 NITRAZINE10
2,421,611,118 *FFEB28D9F0CC45A99EC551B6C1C8300432A885CD SHIRLEYBORING
2,421,611,119 *FFEC9A035DF835F384EF0672341BC84CC05BAB30 [email protected]
2,421,611,120 *FFE382F788AD453A96EB9B8BC444F0ED6DF43AEE [email protected]
2,421,611,121 *FFE7568D93849FD87B7380D53BA54827B2F2EFC2 [email protected]
2,421,611,122 *FFE709E114426CA9746FA6C6C754CE71313599FD shorttime rating
2,421,611,123 *FFEE5A9411BEB00174F25A20745460754D305ADD NOBOOD
2,421,611,124 *FFE0D0D721418B2A412BAB45EF3779E1B1CA3D2A norbertbuchholz
2,421,611,125 *FFE7ED645C7CFACCD83D620BD8B7D34F8B72ECAB NP_035303
2,421,611,126 *FFEBC4AE23B522EB4D61A91862D9F9CBD0F9DEC9 sittings
2,421,611,127 *FFE16831E5AA9A239D926C521A91A73484F45A38 OCTAVIOTHAMMAVONGSA
2,421,611,128 *FFE63CEBD9AF90FA8920F360B386459B6E5BFF44 odernebenflüsse
2,421,611,129 *FFE1A2C7E2DA2CE96391F08CAF9761B26D4B50E9 ODXUFBE28
2,421,611,130 *FFEE7A3D969D586CD5A348BB2C63E17E8101E060 sohniyie.ae.tere.was.dee.naeen.gai
2,421,611,131 *FFEBF55BC42D924AF76270972F60C4F521C2C702 [email protected]
2,421,611,132 *FFE2E394030619FF2A8D6879951CB580E84E77B0 OKAY,.LET'S.SEE.
2,421,611,133 *FFE9065DE0048B2EFBB4626E197543ED5681285D ÖKOLÓGIÁJÁBAN
2,421,611,134 *FFE11D1BEBE108ECEE60A28948817EB06C4E87DA OLIVER311
2,421,611,135 *FFE4338A334B92879443B233858F9C331271DBB8 ONTDAANHEIDS
2,421,611,136 *FFE538686585E7C6E37AF50D3F9D85460C955442 O{[email protected]
2,421,611,137 *FFECF015661EB8B71A2AC5925AD426B517E2F332 ORNADAS
2,421,611,138 *FFE9358DDEB188D00C1F16E2466B8BA5250BE8A4 [email protected]
2,421,611,139 *FFE424C904FF8F96868F5CEF343A051DABA6EFBB otearen6
2,421,611,140 *FFEECCB3E1627E392A070749457BE9FDC0305FE8 SPRCNMYN
2,421,611,141 *FFEF1D7757A914774837C3D718FEF1544C580CA4 OUT-SPRACH
2,421,611,142 *FFE7ADEE2D65A3834A1E58252D8652935892D64B [email protected]
2,421,611,143 *FFEECD8029B6E8FF6559D815B1DB1B81B99B6297 P###>~0~OUU
2,421,611,144 *FFE64C08A5E884A6ACECA3FA68ACC91B654C6837 p5ho
2,421,611,145 *FFE52377BD2C242EBAB9BC848EF6F01F18C0FB19 PABLOWOLBECK
2,421,611,146 *FFED1F3372F8CE4FEA59C6C4775311E36C3CFC81 PACOALDANA
2,421,611,147 *FFE5C4993BA640B9515BE80F9A283E9B4B6408DD PALMER.MUNKS
2,421,611,148 *FFEEBDD6B75E24F45ECD29A6AD43404F6C6EFA29 STDIMIHCS
2,421,611,149 *FFE76D9482D298812F19E81A63D46615FCBC086E panayiota.leonidou
2,421,611,150 *FFE0F61FDCD1193994588D3CF813DB6C2B05EC72 STEPHEN.BEDNAROWICZ
2,421,611,151 *FFE3FD6A4015C888A7E54D4B3B416B6FD992D76D STEPHEN.BENNO
2,421,611,152 *FFE73DCD5C6EFEC7FD176325856994A4CEB17727 PARTHIV JHAVERI
2,421,611,153 *FFEE5CA1AD8E9C1D7AFD49A2B5F05F44D828EF44 STEVENLAVOIE
2,421,611,154 *FFEE86F0A3BCA0F2ABDD3C96F86F1262CCD2D7FD STEVEN.REISE
2,421,611,155 *FFED3F6ECA491D25336336F7D9FF4F2942F0FCBA STEVIEHONGACH
2,421,611,156 *FFEF9F8A8755D1D3A81CE9D2CA50003C389BA0F9 PASZARGADAITÓL
2,421,611,157 *FFE5905AA4C1BEF19C5E1BB1701060DCDD6B7DF7 patches91011
2,421,611,158 *FFED0F63B71A685FF1CE7935B32CB459AABD456B STEWARTRIZO
2,421,611,159 *FFEBECDD1637E41C8005AD6256DAE10EF7A07453 PATTI.SIMON
2,421,611,160 *FFE1702A963AE7098018E248B1E4219605D6DE2B PAUL.DEBENEDETTO
2,421,611,161 *FFE12423A999957962DB51659EC48B9B10FC14E0 STOP-ME-(KISSY-SELLS-OUT-TRUE-ROMANCE-MIX)
2,421,611,162 *FFEA5134D07E5BF894A0A5D3CE3C3536778D5146 PAY-CABLE
2,421,611,163 *FFE3FAB1DBF1C5491F5728ED8A0B0DD7E69BAF21 STR691911
2,421,611,164 *FFEF09FCE5F9CF2208CD31BFEB6CFFBDED911A73 p######b~o~o.)0(
2,421,611,165 *FFE440223F34F05EBE79BF4CC53C2E427961D25F PEDALFERIC4
2,421,611,166 *FFE8878F5A7A076FBD12591C5ED7B97A96BA1D4B styfein8
2,421,611,167 *FFEF9EE6D924902C24E5106CB2F21A01B6152AB5 pentland
2,421,611,168 *FFEF4D78DE53E987652868D9380ADBE6043A38D6 PERINTJ
2,421,611,169 *FFEE02C0D7AEDCA210DC10DE51300D6C8B9567B4 SUITE NO 4 IN E-FLAT MAJOR, BWV 815: I ALLEMANDE
2,421,611,170 *FFE56C5E17C828574B09D6E40D960D11C9B87176 suman.deep.kaur
2,421,611,171 *FFE23FE526A8CA4C746BD3780FF297B2EDDEF45D ph070sph3r1c411y
2,421,611,172 *FFE425D4DBC04F8145EA8EAE2B5B2313C0CF6ECE philgarris
2,421,611,173 *FFE66B3BFF6BA47871DAFFEAEBD97E22E159C756 SUPERAGENCIES1
2,421,611,174 *FFEB400A836D1BCFEDD1A093F57A0DE651751BBB [email protected]@
2,421,611,175 *FFEA37B706F14F1F34F742BEB5A2212334CBFD24 PIMPERNOOT9
2,421,611,176 *FFE3B2A01C32C9FED69428B350A795D6DA32175C PLAILAKA
2,421,611,177 *FFEB203A2298DB6546BAB9E2AE97FA72A6FDAA89 PLATINUM COLLECTION 2000
2,421,611,178 *FFE1A76A7E768F65C67C82442BD2D12C8EDA987A SYMPHNTCED
2,421,611,179 *FFE1167383B058F1E6CA8C74C092A241F37B07D8 plimmed3
2,421,611,180 *FFED13DBB5B46F349005CE777619BDB1D30EA49C po1em4st
2,421,611,181 *FFE1FB2AF3757245B6FCE2C3B622730B01DCFAFB taffetae1f
2,421,611,182 *FFE103FD5927C2587D3C199CF605DF14866A0A60 TAILORABILITY1
2,421,611,183 *FFEEE4A6BA1159258EFA6736E85D33AF3E93D4B4 tajheret
2,421,611,184 *FFE3CD4FB499CAD162760FA89DD0F0F797CAB6D2 porsche-cayman-s-sport
2,421,611,185 *FFEC7534888D442FC95A809722CACD45289EC5E8 <p> over-the-course-of-the-week-that-preceded-november-13,-ms
2,421,611,186 *FFE4D519524C27769219FC7F72FE0AD214C31CCB TALKNETSILIK
2,421,611,187 *FFE24749410FBF3399E6407BA02DBBDFA908E83E TALKROCCICIOUS
2,421,611,188 *FFE1083E015E7FF44AFC32B8F3BC1E0ED9DB6859 P##p.~0)x(
2,421,611,189 *FFE079BD6F96A100A7868CB840E0BAF721BC8177 TAMPERPROOF2
2,421,611,190 *FFE27F84FFA8E0F8A32CC4F09F9C5B897A46ED95 PREFIJAR
2,421,611,191 *FFEA1D29A8D5A4D95FD16A4CECFD3D04AA9C386E TASANKOJED
2,421,611,192 *FFEEECFA317F7BC83E5E6482CC74E80385F9EC0D PRINCESS.ME
2,421,611,193 *FFE92858C7990FFB526A6D0A05C5029B4D2EBCB1 [email protected]
2,421,611,194 *FFE41D9035A7365AE4D2D86A9EA768D55F6F24C5 tdarren1
2,421,611,195 *FFE5D5D8D8D344CEFBB7199356C61F886B1391B9 temnejsi3
2,421,611,196 *FFE61C0A074DAB1274FF6997B9553721D8CA9DB7 puppybluebird
2,421,611,197 *FFED808FE3F647E55C302B1ACB283E7121B2E01A push-pull-train
2,421,611,198 *FFE524DE689C38BC27D2A55A949ACC23953E85C6 TESTERDENNIS4
2,421,611,199 *FFE261278AB7C3FFD3C0FE45E6C2352E97645CE4 TEXASJASMINE0
2,421,611,200 *FFE67E259ACEF0BB01FCF8FA00EC1D24E6DC3233 [email protected]
2,421,611,201 *FFEAF0717398A31F279E1BE01DE9FAF1A32C343C [email protected]
2,421,611,202 *FFE9A441F3334E31B90EB1360487942002E861BA Q-D ~0 ~O(O_-)
2,421,611,203 *FFE95B406B724D4F2E6866447BF41A88EA9DF81C QD!S
2,421,611,204 *FFE48CC1EA29C8A21C18FF1341F6850B5A9BA9E7 Q======D* *(X)
2,421,611,205 *FFE2CE8F361AB562683BB82E9C3EB63E60487F8A thebullshit2009
2,421,611,206 *FFEA6A616E6E1B3131B88F5B27FD2321A1B8B1E5 the-polonaise
2,421,611,207 *FFE0CD55173C7201E1BB2B6F527AA403DE30AD93 quinnjurkowski
2,421,611,208 *FFE40852D1A49E88995B7F5993E72C3B97B9B855 QUINTONUNTERMAN
2,421,611,209 *FFE26F99FDF87197C9C1C80ABE64CABF0855E8AB THESHAPEOFTHINGSTHATNEVERCAME
2,421,611,210 *FFE8331C56E1163329AB4E572F8CA4019FD47950 QXEL
2,421,611,211 *FFE2396B4E5233717D5BA5CCABB88D547333DE7C [email protected]
2,421,611,212 *FFE82A81A9995195FC407503A2A12C52F0172402 THURMAN.RIVENBARK
2,421,611,213 *FFE54B732D364FFEC9B330C3A4F4D98A6AB91972 RAFAELLILLEHAUG
2,421,611,214 *FFE6CC6EA47EAB91E595454FAE4CB5072842BB04 TIAHCUAVEHC7
2,421,611,215 *FFEEAE67FB8B28457DD227CEABDED4E9F0944613 [email protected]
2,421,611,216 *FFEC6D854A11F1E09BE9AEC2B95DD81B99172FE5 TILFREDSSTILT6
2,421,611,217 *FFE72C14525C4A006F466453AB89899370B1103A RAMONAHENRIQUEZ
2,421,611,218 *FFE4AEB05DCDD5AD69B0F243DC957D53960F142C RANDALL.BAMBERGER
2,421,611,219 *FFED6301E409F39EB3774F004C898D4AF5461E71 TIMEDEVENTS5
2,421,611,220 *FFE360322EB2517CB44227027C26094336C32541 TIMMYSANDLAN
2,421,611,221 *FFE007BA232A34838BED9C06C6BEAF86A7F4404B tique-taque-do-meu-cora
2,421,611,222 *FFE4C97D521F247B79D3CEE81C66ED1EE4578498 raudonajį
2,421,611,223 *FFE5DC47C332F67F272CD7720662088667437AFC raygal
2,421,611,224 *FFE114483D3D508751AA831499D7625971AC2C32 TMOHYOK
2,421,611,225 *FFEB356CC55AA9EC95C7AC92C61B4FA56FB8763C razgledavanja
2,421,611,226 *FFEB505B04147C58CF5FC05E61AC63C5BF60BD0A TNPIBOVLYNE3
2,421,611,227 *FFE4168B87C87B5D498B4EDB2731260A19769A61 RDJONES0
2,421,611,228 *FFED90EA7B26648E74B410E7073887C97E5EF81D [email protected]
2,421,611,229 *FFE82A7220AECA73671C3A0F5303E479BED32257 RECENT160
2,421,611,230 *FFE51DBAE6B78F64787BBE2C48F77F35C49E2A2C tokutenh8
2,421,611,231 *FFEE540A3EE2F6194D841F6938B51407F8331710 reem-elwan
2,421,611,232 *FFE7050EA7171F9ED569AB75FC975AB4687BE4A7 REESE...I'M.A.PERSON...
2,421,611,233 *FFE51F8B2027802B1F03E552DECB7035A233A433 REFLEXTIE
2,421,611,234 *FFE5C1AEA64DBB7544D5328885249859D769DF67 refugiomcarthur
2,421,611,235 *FFE333116EBC30112BD05A72BCC73E85D91452EF TORTARZÓW
2,421,611,236 *FFEE4E90A9A93ABD39B84BF2D933F21D7A94ADCD toryprins
2,421,611,237 *FFE7D1F0EA613F59847840F100C56BA21D03C59C REJENERASYON
2,421,611,238 *FFEAF99AAB969590BDA15BB2A2ADA340B6ACB839 re+r4nsferr!n9
2,421,611,239 *FFE1745229F24392D7BF13ED4F6AE4B8FA8FD416 rhettlipkind
2,421,611,240 *FFE085FD711BCB773D74292F163B892A4814D95A tripwiring
2,421,611,241 *FFE819B402BA1DF3B20EA3F7A984536E5C8573F5 RICH.SCHANCK
2,421,611,242 *FFE49C92E666BFCB6D87E4A37A1F57CA0859ECF2 RICKEY.THORINGTON
2,421,611,243 *FFEFF40522B3A314B8A92534507119D5EE78BA89 イースtrpgリプレイ
2,421,611,244 *FFE23641E100BDB35EEE013DD156C5E2D24FAB5D trumpetconcertono.1ine-flatmajor:i.allegro
2,421,611,245 *FFECAE35022FDFBDCAF18BDBE124997181ADFEF5 TUHOTTAISIIN
2,421,611,246 *FFE9C51B6E60313C363135D54F1E573BAF535F4B TURGIDASING
2,421,611,247 *FFE1154A0433DC71A6273A2EB20457357783EB80 ROBOTECHSLAYER
2,421,611,248 *FFE5ED73A1F1778ED3C645002D77A8B7F6025E70 roeiers1
2,421,611,249 *FFE8ABD28A545BA97FEF5D9C7B7534436B8C6754 TY NORDIQ WILLIAMS
2,421,611,250 *FFE52329FBB576BD41855EBF3D3C99968E6BC9A9 tyoepaikanvaihtoihin
2,421,611,251 *FFE84FFC798F0D0B621FD06CF5AD5C5529DADFA6 ROMANISERANDE
2,421,611,252 *FFE446B00E6B9F2ECD6D9A14C0ED12B1781D8DC8 TZADDI-USMC-COX
2,421,611,253 *FFE830A5DF50F6D35B6FD250AACAC4AD61881C9C U98031
2,421,611,254 *FFE5913BB021B65CBF905B3B8E73DA8197A087CE ROSCOE.MATTERN
2,421,611,255 *FFEF965EBDA18A5EBD322F4139DC23D504D55959 [email protected]
2,421,611,256 *FFE29EA8D873BF56B0C803335FFB395F7530E830 rosenwaldblock
2,421,611,257 *FFE50387C6A9D788EF1AB6EF2B7749C7F87488B8 u-dubpeak
2,421,611,258 *FFE1F7CB6A94840D340EFC7267D154062B5BCCA1 royal-botanical-gardens-edinburgh
2,421,611,259 *FFE8F1D3A8527DB3B145429470CE0D58C484E5B0 ullica
2,421,611,260 *FFEFC4BF95CB313D1BD27EE3B2C04D86D06F0EF1 UN7Y
2,421,611,261 *FFE7F20C9F442BD077768E030A63B045BDF17142 rudolphshandley
2,421,611,262 *FFEB2BFCC7552B5D8A282F766B4E3E0CDB753D74 ruebenhoruath
2,421,611,263 *FFE548205C95916BD0221CC1587B76C0653ACFF8 UNGARINI0
2,421,611,264 *FFEADF0695250A03297BF7808153B7E41542ECF4 unhonestlying
2,421,611,265 *FFE7D5524570DA992FCAD945D9A5612930205D5A UNNI.HARGREAVE
2,421,611,266 *FFE9E46F175CC5E2815CB5B4FF7400F0EFD0E61C [email protected]
2,421,611,267 *FFE22055CA5C94316E3C51567A8839F8CAFB7965 [email protected]
2,421,611,268 *FFE4C2EA849669AB1BC524E197CC644A17FB07EA SAINT-OBLAS
2,421,611,269 *FFE3754A8F013E063D018B4B6B40EF6577D4E431 USMAN-OLAOLUWA
2,421,611,270 *FFE8955230C64C99A1AD0E0664F958176F97D318 SALVATORE.WALLERICH
2,421,611,271 *FFED58041D5C7B77D0DC912DF7D8FD49A8D12D64 samanthamcmeekin
2,421,611,272 *FFE544455C1B47BD30C7960A97874A66F1BF1E4E SAM.YAZZI
2,421,611,273 *FFE42D9FE6C908DC3D111DDC397DF0FB42030BD3 V1K1K1W1R4P1D
2,421,611,274 *FFEC827AD6939595A711B87FDCF8B0BDF7C9EC54 SANIREGIBOLG
2,421,611,275 *FFE1B85404DF96F75BFD41FB5DC7D01881846628 VANESSA.KERBER
2,421,611,276 *FFE59DE816A7D10E8A9E4BD3566506E566C5714F [email protected]
2,421,611,277 *FFEA33E0F6026605AED98C9027ED18131D4F9292 schlmpj
2,421,611,278 *FFE7DC5D35892434BD544BCBE249B17BE6487A7D SCOTTIESILVIS
2,421,611,279 *FFE33E73C4C887A59F9FFE2AE0C3ACE56A68324D SCOTTIEZAHRAN
2,421,611,280 *FFE07DE5039A8B61EF1A8C4A4603F9D1C9A93C9D VERDRIETIGSING
2,421,611,281 *FFE66F4FE618CA246DA84768739405D5921A5B30 SCRIBBLES-CORRYBLOGSPOTCOM
2,421,611,282 *FFEFEE80A1A12F310D5059B6DECC5F36261803B5 VERNON.MURASSO
2,421,611,283 *FFE81C5DC21E081F9CCBC506832597CD445D5DFC veronica.cudjoe
2,421,611,284 *FFEFFF9750DD8B1B535DF656AAC9A39ADA7277F0 SECRETGENESISED
2,421,611,285 *FFEB6D89E7E82F1E92D11A769947AC434C568AFC seepier
2,421,611,286 *FFED0EC30C4846FF0B3E1782C3DBB0C4810D9BA4 VIBRATING-LEVER
2,421,611,287 *FFE419143C336EB51538C477B963A0D24D25C836 sesnoviching
2,421,611,288 *FFEAB66A45EDBC7758C68EEA6146DD985FC533E6 SFIDASSI8
2,421,611,289 *FFED55AAE7B40224A94322258835A9F76DF7302A virginia-butler-alderman
2,421,611,290 *FFEC06E21F93D75F6F6367720D8A5559864E5644 visioncindi
2,421,611,291 *FFEF2ABAD7926B917AAF7F9B3B8D18E7FAD27EA9 SHAREBUILD
2,421,611,292 *FFE26BDC7061B19F2A1A310E0058EC19D823B4A8 VIVIBHAKTIKA
2,421,611,293 *FFE46846FCDE52C2321FB2B15FCA5F34D06C645E VLADIMIRILIC
2,421,611,294 *FFE92BE4C37232FFF0E5E6F54F604EBF77B0F094 VLCHTSLS8
2,421,611,295 *FFEDF752EE6254C0952356F112F80419085DC229 VOLEVAMO1
2,421,611,296 *FFEAA8BACAF7080F29D74F9FAD8E5E980CD56FD3 VOYAGETOTHEBOTTOMOFTHEROAD
2,421,611,297 *FFE8380AB4FCC8CB79EEF2108B0CF0E4743958D9 SHUMINO
2,421,611,298 *FFED6A73029661DA5DD38BAE1BB6CC59DBF173B0 sidewalkstuff
2,421,611,299 *FFE482FC50784C5DDAA98216A78307D1A0B59276 waldogrindle
2,421,611,300 *FFE6C1803B2B7CDCE203E97BB6E3C42FD0D7A800 sittings
2,421,611,301 *FFEC79BCC37418FB33CDE3F6728F312A855A176B skipperclipper
2,421,611,302 *FFEADB4D3C94489E8A616F15D44C89C70DBED415 SKLOUZNOUED
2,421,611,303 *FFEED41AF7386B02D3124D70668BE69495414111 [email protected]
2,421,611,304 *FFE640029E3DC6E493099E600134D7A560085537 [email protected]
2,421,611,305 *FFEAD1FB1FE34278E2754762DAFB838E0BB1E8EB [email protected]
2,421,611,306 *FFE825CF92A36E855F967AE12AD50294FD7D5CDD SMAT42000
2,421,611,307 *FFEA344A139CD19F1F89AD30BD4AE559AC7F4359 WAYLON.ROFFMAN
2,421,611,308 *FFE614FC53E97084476ECA4145DAC556180FFC2E [email protected]
2,421,611,309 *FFEFEED3A076EA70108EE0EF1CE6984D4C2D1A85 solgrahovac
2,421,611,310 *FFE3CAD8714CB08A529490CEEC7D845641FD8D88 /*.WELL,.LET'S.GET.TO.IT..*/
2,421,611,311 *FFEB4FD7B55EF450FF0B71E81B9A6D73AEFE21A9 sosavran
2,421,611,312 *FFE56BD43AE9F8BD30F906C190A91522A425886D [email protected]$t
2,421,611,313 *FFE32990FB1D5195DC490DE1DBA411A370D2DEBC SOUTHTOWN.U.S.A.
2,421,611,314 *FFE16F3819A2DDEE0DC60860068BCE0112BA1BEF WES.BROSSETT
2,421,611,315 *FFE66C7B47862E3D5A91949CD799CD9DAA2180D5 spitex55
2,421,611,316 *FFE1B82EA695181D4C4EC6EABC8B0FA237DB667D splat!.*.*.qb
2,421,611,317 *FFEB4C7D342F17FE6818DC84E8A3B433C63236B7 SPOOKYFRIDAY1
2,421,611,318 *FFE3041D4BD87C7D98C497D62067AC8A6D1441CC WILILIK’
2,421,611,319 *FFE6ABA3F029AFA6053A5514265800B7FEEDAA8A WILIZAGAYATRI
2,421,611,320 *FFE1423C949519BB87C7B1721AC9C9F8F5F15096 squigley
2,421,611,321 *FFE69485BF999D36CD52DABEA6E16D3931668398 williamsosmoothgarrett
2,421,611,322 *FFE2734C3E4C5DD3698ACE84E69A20ADC38689ED WILLMARIN
2,421,611,323 *FFE5E52E456F87BCEDEAE861F3CFF664C7972178 SSHEERIH
2,421,611,324 *FFE9ED44754D4AE4CB5A73A71BFF1A33013D9DFE staeper9
2,421,611,325 *FFEC2F8FF9BCAF38C36CB2F729CBE4D82936AD4D winstonspolar
2,421,611,326 *FFE5BDF7FB03FC6DD4D1017DEF84F15C825CBDCC STANTONLERNO
2,421,611,327 *FFEF104CD56ED0223CD2BEC11DF40A5541E15424 WM.KLOPP
2,421,611,328 *FFEA91EAAF9F8D9378E9DB21D8569D98F0FAE3BC STARTNEWUSER9
2,421,611,329 *FFEA7951BBC5A61617CFC72EBD0CA8A21A5DE5D0 wolfsschan
2,421,611,330 *FFE0A48C19517FD0577D2CC541729D21663E6102 wrapup.
2,421,611,331 *FFE4D7B6E5E4D102BB052BFAAAC1A5761F8DDAEF STĘŻNICA
2,421,611,332 *FFECB1EB0A879C3A8D8CA9D4F063CC5C8B8962EB STOFFHÜLLEN
2,421,611,333 *FFEEA73FAC82286CBFB673B1C98119E3FE8F9DD4 strawclutchers
2,421,611,334 *FFE3BDAB1680EC9ABF078F78AEDD77D756607A9C WWWTOPPRODUCERSALESCOM
2,421,611,335 *FFEEB50A49F91BA1AB56DE52EE840E27A8FB36D9 wyattfrazier
2,421,611,336 *FFEA7107676A625C0C3A5DD4AE945DD04FF8524D sub club (a) :60
2,421,611,337 *FFEB74DB46681121CAECE4BEF3C997B567D328E2 XAVIERHARKAVY
2,421,611,338 *FFEBE5BF0964A0A03817B3C8ACE83344339EF387 suction1
2,421,611,339 *FFE5EE1547E69A8AE3B3D792D079E1494D019CF0 x=baa
2,421,611,340 *FFE962944319A9C5ECDC519A81F62C7BE74D0114 [email protected]O
2,421,611,341 *FFEBC48587EC9028A9FF3A62CB06A87AFE408A16 SUODOPACED
2,421,611,342 *FFE04E974547E78BEB814507F9A507EDCFC09ED6 supertek0
2,421,611,343 *FFE8C9859CEEE9797A4CB9F3C27FD463F6066EDB survivors s er0 v ay1 v er0 z
2,421,611,344 *FFE5E21BEBAAB070FCC15DC4CC8AB607A21372ED [email protected]
2,421,611,345 *FFEEF03FE2351880D36597246DBD64B16DF81106 XXVI CONGRESO DEL PARTIDO SOCIALISTA OBRERO ESPA
2,421,611,346 *FFEAA152226CD0EACFDC45DFC7785705CD56E580 SWATHO
2,421,611,347 *FFEF225F80F4823B7C272B682719ADBCE498BC17 [email protected]
2,421,611,348 *FFEC6FADE3B1B68922508FA995351CDAB2F6B700 [email protected]
2,421,611,349 *FFE8A7487289F89DCF71605FA43F4214F4B28EDB TALHAOUIBORN
2,421,611,350 *FFE23143B7001AE95B7F2D8393134914EAE6B6D2 YESWECAN-LONGISLAND
2,421,611,351 *FFEEC3F87FF5BBA3C6C0E0E81BB422A67B477E71 talk9110415156
2,421,611,352 *FFEBD522A90818CFB5A7778BE5117C2D0F4CFD9F TALKFABYMCSCHOOLER
2,421,611,353 *FFE56792130F146BE5DA3E00E3281AB61A342CD2 YOAVBSW0
2,421,611,354 *FFE9AD64881D2C7C944923D73590D70EE4B17255 YONGDELATRINIDAD
2,421,611,355 *FFE19C15A2D7C0925A7570FFDBEDBEFA7C0EC3D1 tarsice
2,421,611,356 *FFE5733C538ACA1E26E9520B2EED99F8494DCCF2 TATARENSTAATEN
2,421,611,357 *FFE8B7B3EFE85A252E7D36A4B6DCB1E3B81A1AD4 YOUSEF-ALQURAAN
2,421,611,358 *FFE860A4C741354B7ABB353D0A7E212F431A46E4 [email protected]
2,421,611,359 *FFE7F7FE2C28C28BE3993903471BE078D3A5AD6B [email protected]
2,421,611,360 *FFEF47ABC30EC7E142C5BE7B92F06AD47666FA28 [email protected]
2,421,611,361 *FFEDE963B280D124A646A79563FD3CE0A878FC59 TEDDYHINKEY
2,421,611,362 *FFEFC637ECC1C633596E8D0A925010E078E5C3AE [email protected]
2,421,611,363 *FFE0EEF5C493ECC1C71DD78F01E1230EC72518E0 TELEUTSPORE
2,421,611,364 *FFEFB7FAAD32BB68B16F76E8E578DB9F1308515F yupidota
2,421,611,365 *FFE1A072A80999F69421CAB4DFD44CF3BF79F443 yvonneokyere
2,421,611,366 *FFE647B8FB7C77B0446A45C00F4219681690CF7D ZACHERY.CAMPI
2,421,611,367 *FFE467CE40B2BDA4FAE69BFB9F76BC62DD7EAB19 zaiko-baiko
2,421,611,368 *FFEF05611831D0075D72774E110FF497AE1C8969 TERRY-MULLAN---AUTOKAT---GIMME-THE-BEAT
2,421,611,369 *FFE01766C02F86D88AD2755772EA21F760676A10 TERRY.OZANICH
2,421,611,370 *FFE54E854BCF4E5A6D96B4343CCEBB8BF2E8B5D2 terryteoh
2,421,611,371 *FFE99123CD6F55DD474EC2293E2710C0646CB871 THAILAND
2,421,611,372 *FFED81AB6FEB81EB5229FD97AC25C3BA8DE06A8E TheAnatomyoftheFall
2,421,611,373 *FFE9BC317CED250CAE0E9F60BCD5B71DDC6379CA THEPUPPET'SGONE
2,421,611,374 *FFEA7D70D7E6633A218EE9F2607C0203C944097C thurmanramsy
2,421,611,375 *FFE10B42CE16489EF18347BF853F0273BA9B1B2A [email protected]
2,421,611,376 *FFE6C4EE96B361379576E9EF72DBC60C34A023CC TIASSARC4
2,421,611,377 *FFE1B0136C577CF408BB96327AC9A1BC60A6D004 TILLISEEYOUAGAIN
2,421,611,378 *FFEDA5A35F4A90D1983B5757E0B447D95F0113F3 TIM.SITZES
2,421,611,379 *FFE0A95C3AF6A3D9114F922115F5752741DA3E29 [email protected]
2,421,611,380 *FFEC99944635780905E02023D3D3B65BEE569473 [email protected]
2,421,611,381 *FFE05B841BF94E54C140E2A80E24D3897CDC1B23 ἘΠΙΠΊΠΤΟΝΤΕΣ
2,421,611,382 *FFE9B1F7A1AFE5A4DF4A607FA9AB701878381048 ὀργῶντεσ
2,421,611,383 *FFEB67CC75CC48F5B2D01CE04082140DBF518A02 tnauqov7
2,421,611,384 *FFE174CDCF3FC89D6802D174BCD4E40A0A1EFFA2 батумская»
2,421,611,385 *FFE0067A7142D71B947ED4B7431B1D656F6AFA56 гуниши
2,421,611,386 *FFE3E094A1CAF74475DD4A9EEC896637063922A4 top-energy-drink-brands
2,421,611,387 *FFEE2216B1D5CC919929256553073411A4655C71 TOUNANTO0
2,421,611,388 *FFE73D2FA0467111051C974E896E38A9AC453ECD ОБЛИКОВАНИХ
2,421,611,389 *FFE55BB2A23E33F04B84830034B087872B2EDCD9 ПОРАЗПИТАН
2,421,611,390 *FFEDC642DA191BE3FE6B43990FC22BE01AB6BF09 traone.passe.neet.bij.diech
2,421,611,391 *FFE34AF874115FCB43E00EC8F10FBF4728B755FF travisharney
2,421,611,392 *FFE0A9FE8D5640EAF4FBCE8515155E829FB499AE TRESHER MUKWAVI
2,421,611,393 *FFE03EBDEB1BE666AA2910F7D664BD833A9FCC46 trevordebes
2,421,611,394 *FFE00BCA4ED20EF950F75D3037574B0CBDA327B9 ХАПИЛОВКУ
2,421,611,395 *FFE886D4AE858FDA1BC63798F3E3AB0719EC7E2D trishamillerambrose
2,421,611,396 *FFE41D29EA189D4A177C2CF1350DF4D7B94B3367 TROLO.LOSEYOSELF.TRICK
2,421,611,397 *FFEDD1FCFAD3A3A6F4B1DA85D37F0107EE0523B3 tropagimik
2,421,611,398 *FFE8A24A0AC25D5EFD2E048A17B1E66CD0E8D1D0 [email protected]
2,421,611,399 *FFE39B276A4AC7F33F3E82C24C83ABA94573F657 なし(ただし、TURBINE
2,421,611,400 *FFEAF31CDA3857F47C1584B5121903A2E1689F3B tv 北海道文化放送」と15
2,421,611,401 *FFEDE5D75DC1BFEC3DD00D15E739E74226CB0487 tyler.beidelman
2,421,611,402 *FFEE6EA243F7086A842E16E1382D7D84BD237526 TYLOLAGNE
2,421,611,403 *FFEE66B8345F064438474EB1A2E1C845DC42F0D1 tysonmathes
2,421,611,404 *FFE192F07863A08A8A68A6EF2044D3C93011C856 UČITELJEVALA
2,421,611,405 *FFE44DA0BEBA0DE33045C465ACF727A7BA4DA71B グリンデルワルト近郊に着陸中のスイス航空救助隊のA109K2
2,421,611,406 *FFE059D70E3262CC5EDAEB03BAF72B797FAA1891 UNEXHAUSTION
2,421,611,407 *FFED7BE8F072B6669C7B6EAD3EA6EE080A8361E8 urrea.donnell.cloud
2,421,611,408 *FFEB81C75DEC205F6103069198AE55B4538C6CD9 URVASHI URVASHI
2,421,611,409 *FFE586FCFCEEAF230ED6D4D74CA815BB6AFF0AAD `V+
2,421,611,410 *FFEEE730D5CA3F8EDFCCFD1D95CF638EFA88A327 VAL3D1CT1ON$
2,421,611,411 *FFEE549C485F01F33DBA7408FECFF829129A098F VALLEYLYELL
2,421,611,412 *FFE3967938DFA95CEEDCC9491DB4AD9DD5F4C50D van.tan.hieu
2,421,611,413 *FFE2A4C7BBCA27A09291285D5F108F178A663E8D VARIO1E
2,421,611,414 *FFE9E1E64AF2F244941B8A5BBDC74AFC0C8A9C00 VAUGHN.BORCHERDING
2,421,611,415 *FFE7F7C210F79ADFB67E8450D13AD1BAC0816306 [email protected]@+0N$+
2,421,611,416 *FFE904E70DAF813E1287C5AAD03798F98E9FBCA8 verkanntste
2,421,611,417 *FFE6245DBE155FB185995B69557E593FBB79ECDE vernsaraniti
2,421,611,418 *FFEC997D63D71C497387A0FF9366EFBE8B37740A VERONIKA.BEHNAMI
2,421,611,419 *FFE775C484C94F21D8E8DFDD4751F275DED64C7C VICENTE.BRUYN
2,421,611,420 *FFED8A6860D9AB0A13CB13CDA1A5764C09B3D72F vikramjitsinghbali
2,421,611,421 *FFE600E9BAA9E5C4837257A95CF925CADF71EA4A VINCENTLAZOR
2,421,611,422 *FFE26BD69BD78E28AB9724D46937411FA0502B62 virginia.m.de.leon
2,421,611,423 *FFEE5A054D393C673844E71E8A34F6140E6CFB7D VIVIDING
2,421,611,424 *FFE7DF6502B2CF6DC6E86B8D36CD60D715A07570 wandering.lady
2,421,611,425 *FFEEC57E46A0A4007BEB2E3E0785EFEED6B73679 WARRENSRIVASTAVA
2,421,611,426 *FFE238E5BBB48885AEB5745000DA9811EA2A05AA WAVEV
2,421,611,427 *FFE003BA2B56CA4675434CC7B80A9EFFEA068EE5 WAYAMERICANAAMERICAN
2,421,611,428 *FFE9462598BA58DCC90CFFBF56E0C9668BCA1CA0 wedding.march.from.a.midsummer.night's.dream
2,421,611,429 *FFE3A7DC5E386126CD2F2F333A2BF809068167AA 07131981
2,421,611,430 *FFE11AE471F194ECDAA01C203C0A6181DEA6D191 0iamcaptain
2,421,611,431 *FFE01FEAD92F4D52A166691B8420B487804FE154 1099034 tekniikkaeiolesiin
2,421,611,432 *FFE7814E4CC1EB1858D83EF9B3DFE0AD6ECCB97A 1147647 carnival.cruise.lines.class.a.rose.1.1./.4.to.22.3./.8..
2,421,611,433 *FFE5E01577CB83AAC13FD88A891DB1EF9CA5968D 123ERIC321
2,421,611,434 *FFE8753228EA1D946C50026F20CCB4AD8814FA56 1457401 edelliskesien.leiritarjontaan.on.t
2,421,611,435 *FFE88BD68CD03FE0DCD2D0F2A18F6DDB1FAAF132 1676797 toisena-on-edelleen-ida-
2,421,611,436 *FFE53CDF491079923E6FEDA9B237149F432018FF 1704156 "YHTEISKUNTAJAYMP
2,421,611,437 *FFE6CD1FFDA2D372A000A5804AEB85D8EE9BFDDC 1738447 STRESSIREAKTION.ENSIMM
2,421,611,438 *FFE152FE5A6B1C0EBDCEF04950E338F34BD4075C 188EMILIO
2,421,611,439 *FFE6C8BDA56DAA3DACBF253E921281A687C27563 1994076 IMVELODROMWIRDSCHARFGESCHOSSEN!
2,421,611,440 *FFE227E1E36450800C851D9EB2DDCA102F9CC2A5 1.ARAZI-IN
2,421,611,441 *FFE954F558AFC074742B5A31FF110797D700470D 1 ARKIOLENTO
2,421,611,442 *FFEEEFB336858B8EC8F4589E8C54F1EE31A11194 1ARTICLESO
2,421,611,443 *FFEC39C4C728A38FF66950E32025735808AA9836 1 ASUKASVALINTAP
2,421,611,444 *FFE3FE924A238E821F3A9D55A1D3ACCE4A5D21B4 1.finckenbergin
2,421,611,445 *FFE2B73786C7CFD9F808A6DCA7F1315FBBEF8D58 1iamlarry16
2,421,611,446 *FFEDCEDDC4F7A003DB49E4663BCD4BBE4F8512B2 1LCFRSNSS
2,421,611,447 *FFED38AF8FD9338A29F3E57B0D6EE43A0F7F3066 1LOSTFOCUS
2,421,611,448 *FFE36760F34B7730055C3166CD46463B457A2C93 1M24SHRIMP
2,421,611,449 *FFED6E674908824D7695725C3850310B6C8DC678 1MARIKEN
2,421,611,450 *FFEF9012E7E6F6364F4F83E50439D61CD3F024C0 1MYSCORPION3
2,421,611,451 *FFEB5D2298C78143E8F3976CDD85D470BB3C67EA 1NATECIA
2,421,611,452 *FFEF85D7DB33983FBEAB58F7261371D0D63FFCB9 1 psuedorational
2,421,611,453 *FFE2BBCAB3B7C971E80D254F1E9A3EAD1AD8D4B1 1Q2W3EBUBBA1
2,421,611,454 *FFEA864EB1D0D77FF4C5FBCC1CEA10F60AD26A63 1THOLBERG
2,421,611,455 *FFE3E773E05C2BE70367FB89A9D6F14882D803DF 1VIKINGLOTT
2,421,611,456 *FFEC4F026B48D72421B28C34061D191227E9B41D 1 VOIMAJOHTOON
2,421,611,457 *FFEE9E9A23F0B867B861CFB730D500F915EC7BD1 1-zee
2,421,611,458 *FFE6DC9A7DE91F6C66B18790BC2F1EC3A10A9DEC 20020720:LesVieillesCharrues,France
2,421,611,459 *FFE570F65591092ABC403E690D1E91E4B4BE633A 20061881
2,421,611,460 *FFED95FA13DAE5CFA51381DB418D9EFECEFB894B 21jun1041
2,421,611,461 *FFE5EF9D49F8A25AC1F47DB376A8DE4DE338FE30 2384162 MIESNAPUTTELINUMERONKUITENKINPUHELIMENSAMUISTIIN
2,421,611,462 *FFE65022E5E33B74D8E6D8124DC51D597D017923 24041524
2,421,611,463 *FFE3265405CE94CAB5E11BC9C3146A19E232905E 2591419 VIEL-GEHOLFEN-HAT-DAS-NICHT-.
2,421,611,464 *FFEC723644023B05B0FF930692DCAB862995C20E 277486 toimipisteenvet
2,421,611,465 *FFE2E748F2E80532BF63D71A7886FFA7ED855F3A 2861568 PENTTI , 60VUOTIAS EL
2,421,611,466 *FFE78E9CFF90D7098719426C4D515CF8D56ADB15 2GOKAZOKU
2,421,611,467 *FFEA247A2D1538B978BC59975AF47482FFE17D72 2HALTICUS
2,421,611,468 *FFEC43148F71FA9C176489030C34234B2E137F86 2KOTELOV
2,421,611,469 *FFE02D6813BB675468674BF0489337E1DDCDE327 2OUTRANGV
2,421,611,470 *FFEF1C11535C1C584E2994D001B5D41DD190F207 2-PITHINESS
2,421,611,471 *FFEDDA9836108FDCE4C805D69F0B8FA8CD6D369F 2-rikastaja
2,421,611,472 *FFE01BF6197D17296925BD3EA4573F6C634DA427 2SERKUNP
2,421,611,473 *FFE955309E4F7501F1B50A3D5276AC703B45F747 2-urheiluselostuksia
2,421,611,474 *FFE671F64061AF846A923B82FFB3EE2E00BAA7F1 320888 matrisfonksiyonlarI.
2,421,611,475 *FFEB8B408EE8AAD288092C610320EF8811940291 3ABUSASEN
2,421,611,476 *FFE446B3451B5701573B4F06E51571361DE359AC 3.BALKANEXPERTEN
2,421,611,477 *FFE2ACFA5F5095B386561413079639D3B0A4FEA8 3.cagirir
2,421,611,478 *FFEE92ACEE23C77162C74C113EC58BFB01712CF5 3DEADMAN'S
2,421,611,479 *FFEFEB168F163D934C7BB29B600771729756ED78 3.DROUGHT-DISASTER
2,421,611,480 *FFEB130A1A8E0BF9ACF3F4341CCCBF89E1EDB80A 3ENTAMERAIT
2,421,611,481 *FFED13D3061BFD8BA8D4584A69FF9121BA11F2C1 3.kreativ-park
2,421,611,482 *FFECDA4AA7F4EDBDE0944A671641920109CC1577 3mydevil3
2,421,611,483 *FFE075D54F52090D923EC6FC6C960AEABAB7628E 3p.*.*.splat
2,421,611,484 *FFE1A40301FD549EB3D1FDF456E44C2C57A847FF 4CLAVERIN
2,421,611,485 *FFE98013A9278381E92365F5340D6697D3725ADC 4GEEST
2,421,611,486 *FFE2E96B46AF3E2C5443A15EDF1A339F231EC17B 4ILLATEBRATION
2,421,611,487 *FFE584EAD4A48C9503DB6BDC39B133EBA9074E5E 4massenziel
2,421,611,488 *FFEE2ADC45CD62E4A3D00EA152664AE5FE8B0CFC 4MIKKELSENS
2,421,611,489 *FFEED733EA409264F3C7EEF711D21FB841CB52D2 4MUSICREDWING
2,421,611,490 *FFE9F8EDB103C9BFC2BB3331C16A17062EF785AE 4NEBULUS
2,421,611,491 *FFE8A34B17299E7FADF8EA875A1074DFB25CE530 4ODWFKCVAUNLF
2,421,611,492 *FFEBD404EC0AE292701B8EB6ECAD311E04DDC4D9 4SOLONESS
2,421,611,493 *FFE655A8BEC0A100A9E99CB1B0E2A10E8A6260A4 4USTATUF
2,421,611,494 *FFE22865C71D7CD4A31B898B3B2811DDD15A1DEF 4VERBALIZMU
2,421,611,495 *FFE58AF1C0305D089484A0D9F39338654BDC5C6C 5EZILAUDIVIDNIED
2,421,611,496 *FFE26EAEA83DC8248FAE146787D641BA5487E6F6 5ILUVSHELLEY0
2,421,611,497 *FFEC1E5B3D6FA0A8961E61B1B05C06D1EA1673B5 5KARAKTERFOUT
2,421,611,498 *FFE54EB45C9D45D748111C860C65EB49B986B3B6 5OUERSTE
2,421,611,499 *FFEF1A05F462EE2CD3869FAEE6B182712DCF6FFD 5SPANKYSEPTEMBE
2,421,611,500 *FFE77AD92E8CBD95597FB1C157AC41EE46FA5A4C 5verrekter
2,421,611,501 *FFEE8DAE7F5C83BA1568019C23E6A0063428A6B5 6densification
2,421,611,502 *FFE2EEC633B055CEB86B8892DE2A311B07C00199 6PANTOMIMENE
2,421,611,503 *FFE16C59E81DD76EFEE9A446077E3A1FB814E1F7 6SCRIPITH
2,421,611,504 *FFE57783D7F080550C176663226D03B1154B06EE 6TAMARAGATOR
2,421,611,505 *FFE87E63AF9DC4439DE5DB46B99D0995D5D21A35 6TIAREHCATED
2,421,611,506 *FFE690E563F0EF54463BE64EA7CC90DCF1D33EB5 7BSWCLOTPOLL
2,421,611,507 *FFE43EA32D52D950D904484F09560D23A91DDAB1 7DHANADENA
2,421,611,508 *FFE975BC96D2E11B2133FA4BB5A2D1C2D87A50E1 7EXPORTBALLS
2,421,611,509 *FFE5A4A1AC8C5C356D8811C5640A3E9EDB9A0329 7INPUTINTEGER
2,421,611,510 *FFE9C05B704B952F6B89880AB4EECB01A6A31F8D 7JISSITUT
2,421,611,511 *FFE71EC55C02A5857DA604BA7FC502527C0ACE34 7LEDNESUT
2,421,611,512 *FFE455F336BE82081B3EFF4BE8A6C5511FE84878 7LINKPINGIN
2,421,611,513 *FFE2E4D82D733CB3C9ADEBD392DAB4CE05594631 7OINOVRA
2,421,611,514 *FFE82EA38AD1463A09DC38CA68AC566A2C74C7D8 7POLETIQUE
2,421,611,515 *FFE02C400859224B8F3058AEEF9EDE03A5E7B548 7SCHOOLTANGO
2,421,611,516 *FFE095DA7E75371228CF3C7923F241EA4EABEBB5 7SEJTAAPEIP
2,421,611,517 *FFEC9FBA7047CDA0A3518F336F50002F4DCE2CB3 7VILLIELINTEOLLISUUDESTA
2,421,611,518 *FFE04408ACA2602282E09D9C75381730F026DDCA 7XLIQZWT
2,421,611,519 *FFE6D09E2A5769D2ECD53D72119CCCB46CE388AE 802590 DIECOCKPITGESPRAECHEKOENNTENDANNABGEHOERTWERDEN.
2,421,611,520 *FFE664613B6769DB3F5E0E1EEDF0321B48EC6069 81unting
2,421,611,521 *FFE7FB788AC8655826DED57538AE9BA82700BD7A 8ADVECTIONS
2,421,611,522 *FFE39A3D4E9A27F67AF4E7FAA563B106A62862E1 8BSWBLADESINGERS
2,421,611,523 *FFECB1B3871802165BEFE13E8BDD5E0A3835978E 8BSWTCNUFEDBSW
2,421,611,524 *FFECB41265766E05484C8552F6337EB11C2261BF 8CENTERWESTERN
2,421,611,525 *FFE0D7D61CF9F676B28A5B67C336B20BADBE2617 8DANGLEELGNAD
2,421,611,526 *FFED47731C1611B9C509005699B6B269CDCE95AA 8EERGETNISED
2,421,611,527 *FFEE45FB4EB04FCCC58709BE159803F1CCAE2F1E 8GESTOFFEERD
2,421,611,528 *FFE6AC98F3B3B77AA0F93CE7EB438CAFF2F99372 8HCIARFAR
2,421,611,529 *FFE7955A2803530D06D88483E2044EF29F67B091 8ITSERRU
2,421,611,530 *FFE2B302310ADF4CD209A06A4D2D5C2AECC9927A 8KNIGHTSWOLFMAN
2,421,611,531 *FFE970300EC430A01A31BEC3A659F49E2F8BFBB1 8NCOLLATE
2,421,611,532 *FFE70001190288059F9166179FFA2F0181114466 8>~O~O:P
2,421,611,533 *FFE18B02CCEBFF58D91CCB9DE20E8124ED8FFD63 9ACHTTALL
2,421,611,534 *FFE8CA948FA2850CA00ED2D773E428A90E6D7C66 9ARREGLARLE
2,421,611,535 *FFE253773658A948ECE3AEE3A02D4F26AF208218 9CONSERVAREM
2,421,611,536 *FFEA71E0FF429192C5D5C4D13EFECF3AE9C6DB68 9ilovekermit5
2,421,611,537 *FFE214BA356CB0C24EB5F148298F2B8EFD97367B 9NEGATIVETAUNTTENDER
2,421,611,538 *FFE1AEC9E79EC09BB74BE3C57A0D4F87B4BCA41A 9NPASBSW
2,421,611,539 *FFED8B261ABA0445E08F56579A181F1CC7D9639E 9PROSPERU
2,421,611,540 *FFE9A6F082F84D0FD27CFF94F9912BC8BA3EA9BC 9REVJIAN
2,421,611,541 *FFE6A7E8D490BE48E6F618E1761DF7F15CA072B0 9RTRNSCRVNS
2,421,611,542 *FFE0D04BB002064F554B930ECD356A4DDFE20C85 9RUMOREGGIANTI
2,421,611,543 *FFE676A16812950F2C277875FE65AA109A371D03 9VANGLIQUES
2,421,611,544 *FFE467E3CCBD9320A16E686AA12A7766BADE8CD5 A6ALLROAD
2,421,611,545 *FFE452718195867CE1F14408365831BCADD3B48E ACBO,
2,421,611,546 *FFE7423873DC08AC012AEA7B14A0240C2646424C Acfl
2,421,611,547 *FFE5D52F739C6F0146CA5A8E463B054923AEA161 ACOA
2,421,611,548 *FFEBFA07AA16BC10793B20B6F22B3DB09F31C7E5 [email protected]
2,421,611,549 *FFEC26E799478A632683F6D42FA4801992269D99 ACZTFIRIM
2,421,611,550 *FFE96D06A868A20D8CFC871250EEC77FEC83314B AD5J=
2,421,611,551 *FFECBBAD435CDF101876668F446C466E37F68C5D ADALBERTOBEDARD
2,421,611,552 *FFEBE710AD3D8EB9AD25CDB6E678CF5624DA22FE ADALBERTO.STAGNER
2,421,611,553 *FFEE0B116E2383976941FDE7E6D9BE96D62112C5 adattising
2,421,611,554 *FFEAC2180EA8C7E6756CC86F5949DEA68E0E97E9 adolfojoseph
2,421,611,555 *FFE88BCD6B989562391D0B07D9BC47CD5FB08A45 AE.!1
2,421,611,556 *FFE6D9588D81170B3E10B167107FEB433A46F477 >a/<epocs...4.1>"91.3...4.1rdh#"=ferh.a<
2,421,611,557 *FFE03EDA98739BF3C6D30DAE7DBF6AF8D42567D8 ae?qb
2,421,611,558 *FFEB5485A95795522C76ABC86C3E78D4C700A20E AFENTADESES
2,421,611,559 *FFEB016736D261D93C76DD863ECD64FD1FA68077 AFFAIRS
2,421,611,560 *FFE91DEFAB40734D377B5C8CD9170447A74C7189 Ag58
2,421,611,561 *FFE659F40A77F350F5EB96F327E5EB3C39D48022 AHMED-REFFAT
2,421,611,562 *FFEFEE519CDF7F20C32AA6351E41F44865377F66 AIHEIKSE9
2,421,611,563 *FFE1F5A50F9E74A502B94F287A02A8D1FC58C6F9 AINSLEYTAN
2,421,611,564 *FFEA17B370FCFEA8E303DCFF4593113D0BF5D013 AITERCED7
2,421,611,565 *FFE5D085BE1E09C2A0925E5011F49A52740194F3 A;,J:
2,421,611,566 *FFED8F86574F9C3CC5D5DDE1F67B884549DD27A3 [email protected]
2,421,611,567 *FFEEB5FDE630C1F38037003471198A49A3483B4B AKCISULHS
2,421,611,568 *FFE7D19C2B12C79EFF756469C8A3CA43D86938A5 AL5K0
2,421,611,569 *FFEE2172B9EC0AF8B77786423541F26770115FA2 ALFONSO.TRENTHAM
2,421,611,570 *FFECAAA2C94085B3CB5E92B203571DFA94785E86 ALFREDIZAK
2,421,611,571 *FFE1FA03838B4402D955DE18F20AEF6D97E8DF34 ALLCLAY
2,421,611,572 *FFE390235FA72CF51A850806BD54C5EDADC1F8FE allenpavish
2,421,611,573 *FFEF1C4F07D4A0E29F178A7B5E3FA4A4138E88C3 [email protected]
2,421,611,574 *FFEA53DBEA7ED444E9353FC99C0C84FB3D14F1BE ALLYNTERROR
2,421,611,575 *FFE53DC2CC0A3993F900ACA9E2D4F4C3203EF0E4 ALONGARO1
2,421,611,576 *FFE8B032727933EDFA38E0FAE2F743CA5E75C842 a(m%
2,421,611,577 *FFECE1F51F0589CE650247CB052AD48A1F7A514A ambrosehutto
2,421,611,578 *FFE9A15F26A9AF2074E217108F8C5D057CD43A37 AMERICANSFORDELETI
2,421,611,579 *FFEEA613095FBAC0791362D23019866A50716343 AMERICASCUPMASTERS
2,421,611,580 *FFED55E269F56EAF42AD9C8762B68FBED354DD1F ANBIETERVERZEICHNIS
2,421,611,581 *FFE33E6DFF9495D0950BE7B4A3F3FC9C01923E9F ANCESTRYMATERNAL
2,421,611,582 *FFE884669581A2C0CB602310DCCDA28436AA5CFF ANDONGNI
2,421,611,583 *FFEAC1FEEA7FC1C384B58A74609525372E165EE7 ANDREKLASSINGEN
2,421,611,584 *FFECBCB4904DBE5D1D2A832DC9BC0E9D8742D46A ANDRES.ASTILLERO
2,421,611,585 *FFEE4AA59FB4F0682DB1602A2740A627D412879B andrevansteenwyk
2,421,611,586 *FFE6373CE0CB34EDF8D96E7EABFA7AAA90862F71 angelmaghirang
2,421,611,587 *FFEFD4B6724BA80650600992AAF3DDFB26290BB0 ANIBAL.SNELLGROVE
2,421,611,588 *FFEB2ED5913ACAF5D4E3B59ADA64582DC6CD89E0 ANISSA FELIX
2,421,611,589 *FFE411C4FDC4A16FA71D287D4831122F8F527736 anshores3
2,421,611,590 *FFE99C3AEE72EAD6B081B4544029471A05B3A3F6 ANTONIA.SAMAS
2,421,611,591 *FFE798EF159A54EF82DAD69E60F847456A772EA7 antony276
2,421,611,592 *FFE47AD29EC46B4672D3A97B0412E4ED707BF541 AODEH
2,421,611,593 *FFE02DA51A0E2B668EEF6A6318B5F8E6B31594DC apopescu7
2,421,611,594 *FFEF6B2DEA125EB11B28777447585C22D785CF62 AP!V_
2,421,611,595 *FFEF3283DDF9B8D9B0CD43F608647D96C2B06B1B armed.conflict
2,421,611,596 *FFEC3B0BEA9C4EB069694A3C825A376A4D7171BD [email protected]
2,421,611,597 *FFE9F77A377BC772F222EF3EFCBA90D98A90C389 ASY.2
2,421,611,598 *FFEB6A6280A9CED0C86BC0E7BEBACBD0A3CE4165 atccomered
2,421,611,599 *FFE7E6D446F9427F896DA3BE3006E9DB4AC5624A atimaxeh6
2,421,611,600 *FFEFA91355E23F2611E60ACBE695F3E11F2A1B8E audome7rs7
2,421,611,601 *FFE01D66A3FA11EF3570369343122DC6F770514C A$uj
2,421,611,602 *FFED5227052C43E1316380FFDAB29986ED6F2818 AUSTRALIAINEASTTIMOR
2,421,611,603 *FFED42FE688C7822D4DC7B80A2CEB83608293B85 AUTHENTIC-DUD,-VOLUME-2
2,421,611,604 *FFEC68440DA2D267C6BE44EBBFD600735177D123 AVFT
2,421,611,605 *FFE605AF019564D32A834BDFD67B5A8AE7B25E93 azlinmohdnor
2,421,611,606 *FFEAD534DD968EDEADFCDC4C1E6BBD3A84872CE8 azw7
2,421,611,607 *FFEDA19D7BE429DCC7196C617D832C92E6A65D37 B=1SS
2,421,611,608 *FFED8C52E9FB7225D7809C7D3A2D27EAD5A630C7 B67747
2,421,611,609 *FFE59F783A0A38D2FE69CA5A8C65BCD0F2436DB4 BABQ
2,421,611,610 *FFEE63A5D0FFBA8FEF91B06CB38B75934C15E89E BALLANTONE
2,421,611,611 *FFE22AABDA3A9A3F594979E16BC32A89F23B16E3 BAMZA
2,421,611,612 *FFEC9CADC758E11D95840B568E82A3E12185668C baughaust
2,421,611,613 *FFEE1E219FC6EC39E6EFC0F2F50F2CB5FA48522C benitoblumkin
2,421,611,614 *FFE190DD370E05FCE940A338A1F0DA5022FCF793 BENNYOLONA
2,421,611,615 *FFE857C30CA5A63592D6CB38BA9B09C6E042C7D6 ben-ratchford
2,421,611,616 *FFE05B9AA08381531530D77F6DCBF141EF79F6A2 [email protected]
2,421,611,617 *FFEF5508DCCC0BD5E1F0B8F24788CE0AA7CC10B7 BESTIJGI0
2,421,611,618 *FFE6EDC0C149D2A253FF5DBCE1C4E036F9F7896B BESYNGESED
2,421,611,619 *FFE63ED83E1FFCB59ECEF2E8F9B2AEE5DBD8FFD3 BEVOF
2,421,611,620 *FFEF224EA18A5093E8AEFD30826329FFD93231B1 bh-8b
2,421,611,621 *FFED17280600E7CB500868A639732DDA6E4EFE65 binette0
2,421,611,622 *FFEDFE396349189FC41C02A40CEF62F6D56A5DA2 BKNBQ
2,421,611,623 *FFEA6AAE55ED04107BA91CF3255AABFE4E524892 [email protected]
2,421,611,624 *FFE0105F0B0E30737F74D67FC0B32F7CCD00E037 BLOG.SZLAWFIRM.NET
2,421,611,625 *FFEFAB40C17B0A0C9B83C82BA04543C77E494852 blunts-&-robots-(feat.-peter-hook)
2,421,611,626 *FFE002B90E04BE2488EDE49C68C101A7F0E90383 b$mue
2,421,611,627 *FFE018BA20778E81853A054FFC4AA87A8A78B5FC bo_.+
2,421,611,628 *FFE560864E9F3658C2557E1502F85E9DF3515B97 BOBFENCEROY
2,421,611,629 *FFEC0363BFA23FA9864EB9A19AB5990E8D38CAAF [email protected]
2,421,611,630 *FFE7D5D0D04AEDB863567BB6D83F2ED4E7EFFDD2 BOKS$
2,421,611,631 *FFE940FB95BFE767C97741A970C3E38DBFB162E1 bonerpoloed
2,421,611,632 *FFE86864CC8EAD8C205B2CCD94599C7B707FF7D2 BOSTEDSOMRÅDET
2,421,611,633 *FFEDB104B94FCE35D6F43284B6FC9E9BF361F7A3 bpmg2
2,421,611,634 *FFE563720C1EB0282A85B174CA859941B2D9F41A b:q7
2,421,611,635 *FFEDD54EFD26CCFEAFAC2ED8A2CF233832651608 bradgendusa
2,421,611,636 *FFE09CC44B1878F73E45E30859D9E76A643359C0 brandiarbuckle
2,421,611,637 *FFE7CE89356CB075258145659D923551E5BF4DD2 BRANT.DRAGOO
2,421,611,638 *FFEEDEC5EAE3886A86C1BD795FD172C67CAC47EA bratruding
2,421,611,639 *FFE4EE21B5B2983BB75D0A94A14F9C2899D7213E briarean.
2,421,611,640 *FFE9994BBC6A5EC4E8C0B90617AEB3949931D8C4 b?_(u
2,421,611,641 *FFE8CA9D806111451B657C1A09BA2D66AB839924 BUBBA.VICK
2,421,611,642 *FFE319CD577BB05E048FCBCBB3481EF8793BDA53 BUCEARES
2,421,611,643 *FFEB0C4BF2C42278F90498ABC3B473CF67787CE6 BURTONVOLMINK
2,421,611,644 *FFE082BD1E49EFAA60EADCB4DA585C3B6FE0E4E1 butylxantat
2,421,611,645 *FFEADBC255CCBE43495C3D4E05EE39394B7F53C9 c0n+4g0u$ly
2,421,611,646 *FFE65BF7A77040003587744F91B0F02F2390E53C C1;O
2,421,611,647 *FFEB0E7A0FD8181CE0F4E62B5E8887D35DF47A36 C85572
2,421,611,648 *FFE111398F40355AF18699061246390A5B6FA68B c9210
2,421,611,649 *FFE5147FFCC07279DA26A73C7EBB51BB96D3731C canceddoced
2,421,611,650 *FFEBB43F2036F1DAD27B2C093F9C4E880B02364B CARLOSTHALHEIMER
2,421,611,651 *FFEBA57D49BC5117EC87C43663F08967BD2266E6 carmelorameriz
2,421,611,652 *FFE22067AF83BD0E03EB39D0270EAEE34779E5F3 CARRUSEL-DE-LAS-AM
2,421,611,653 *FFE9ADB00D8A8F827EB8E3C58FFACD6CF9F334C9 CASANCINO
2,421,611,654 *FFEBED63651034EFECDD8F049FCFC92E5C11EEFB CAT;F
2,421,611,655 *FFE1E66CDAE684F9E216EE7F748675E35B5D6661 causaram2
2,421,611,656 *FFEEACD6E3B64AB0B2E14FD018D46C9FE61C7A05 cayib
2,421,611,657 *FFEF597D5B277D9AB4A1AFD46255FEE749CD2486 C=CE
2,421,611,658 *FFE7185325F812ADF1194AF59311818235DFF4CB cecilsumi
2,421,611,659 *FFECB0A929596F8B03686C24D6BBACF9B653859F CELEUSFLAVESCENSINTERCEDENS
2,421,611,660 *FFE527E17CBA399C7451B0EB34EE3EE5E6380F8E cf8qp
2,421,611,661 *FFE6821724F930353F4AD476AF6C9F5687848645 cgnug
2,421,611,662 *FFEF4C36143DF7BDF6A08BDB36B9AA85AC363E81 CHARLESDEGAULLEPLAZA
2,421,611,663 *FFEF3A0814342D305EBBACEE0CCBC5B4E0D8D95E [email protected]
2,421,611,664 *FFE30CD177CC3CCCAC18CF8E72EF63D4AA1EE66F CHESTERMEDALION
2,421,611,665 *FFE5C73C64420C0BDDA5E6634A9819333FD864AD chloe.melia
2,421,611,666 *FFEA26DED59B143C19A4FB61DD4AF09317D64C7F CHLORIDS
2,421,611,667 *FFEAC93A6E17CA749E931CEFD9D0EA476FD019A1 CHRIS.BREAME
2,421,611,668 *FFE13CCBD29EA25A41BCA8B616F882DAF4B87FCB CHRISLIMING
2,421,611,669 *FFE0C923536893A584DE337A1B5CF83BC4D60E09 christincracker
2,421,611,670 *FFE5CF6307750545EBCA4A3529067BF0BDF549C2 CHRISTOPHER.CHATTO
2,421,611,671 *FFEB436DC8F21940BD032AD5CF39F1753E5B2BA3 CHRIS.TUINSTRA
2,421,611,672 *FFE115D5F0D532ABE3D6F5FF6AB54FAF9A1C44E7 CHROMATICCOLOR
2,421,611,673 *FFED8BB992154748D31AFC75AC61C9AD248BD322 CIT;;
2,421,611,674 *FFE24C00C8FF0A5748E9ADFE9BB39C1C9A962A8E CKMMR
2,421,611,675 *FFE18065E3999704BF2A88C82F6CDB14163C5B47 CLAIR.DEANNE
2,421,611,676 *FFE9C1238FE557BE10BB8C20691EA33888606A8F claribella
2,421,611,677 *FFEABB2422FAB36AB5AF92A5BA8E4BE109899FC7 CLOVERLY5
2,421,611,678 *FFEBBC0A7764508F48118EC3830FEE659E7A7B3C clq_u
2,421,611,679 *FFE59EDFCC55AC14D328E411BCDB0BAC15C1EA2C COLEGRIDLEY
2,421,611,680 *FFEBB98C79A64CE92CB50DD1FF53BC943313E9EC Comingsoontothisbbs/ae.
2,421,611,681 *FFE7FAADEEFA93776E9B00B39359E4B5E3AE3017 comitem1
2,421,611,682 *FFEF62400923CD198398F515F0C645F2E2F94B9A CONJURERCOMUSFAUSTARTISTARTISTEBELLY
2,421,611,683 *FFE85C6A34DBEAE6D9948F366F833A0F59B14894 contractualiseront
2,421,611,684 *FFEB8440657B9C241D07BF73E84B42AB7263CF71 [email protected]
2,421,611,685 *FFE6D1231E2930B4D22632023AB23CD2C46AE82D COW.BARN
2,421,611,686 *FFE9BA006391BDF5FD92163FAA792A6029974651 C%+PT
2,421,611,687 *FFED7A505E26BE27FF340C2E13AE1424BD0FE9E0 CRj4
2,421,611,688 *FFEF326D071294744DCF30B33D22162873D6CFCF CSJP
2,421,611,689 *FFED3AAE684CBB296DCA9EF5C2E8840ACD4A5CDF CULM!
2,421,611,690 *FFE2D8FDA9DBD1CBDC6C355AFE62E0E458E984EA cuu0
2,421,611,691 *FFE25AF9BBAD81D1FA6DC5D597526ADD89CBCD9D d"$5
2,421,611,692 *FFE1F1219D93ABCA2845DCB5800971BB0E372100 d!$70r7er$
2,421,611,693 *FFE182DBC474DE32A6E5577B089CD3F015439F66 d9ll
2,421,611,694 *FFEE55A9DA92C7066E1A889A5C30715AD947165A [email protected]
2,421,611,695 *FFEBF1448428AD5B814616E74D9CF7C0A7A69C7C DAISY.HERMAWAN
2,421,611,696 *FFE060184AB770E809E24055635E1F8C2683585B dakty
2,421,611,697 *FFEB5F3E20074606D5E6C6F2D2F6263DD1B3470C dantedecent
2,421,611,698 *FFE2648DA0092136E3931BC32F9A7A1ACE903EC8 dauld
2,421,611,699 *FFE938D2E363E58B7CB0F797B906E79B55D5834C d=b9v
2,421,611,700 *FFED8A42AF93D3D5482FCA1548E2210AF09A44BC DCS$
2,421,611,701 *FFE3DF1642940D55BFBDBB994ADA55B9215C3B67 [email protected]
2,421,611,702 *FFEC26639535A834ED84DF75B4C2CA6A36E8AC11 DEPPOTWO3
2,421,611,703 *FFE2E6CF879F28DA0AA2C99B94BDC01611B18577 dericksalvas
2,421,611,704 *FFEF0C579E538C3BA3DABB89DC667E86394282F0 desmondsmithhart
2,421,611,705 *FFED0EE4A049FB5E068B5A4BAC01A5FA2AA93A79 devinlaiche
2,421,611,706 *FFE861CF56D45B7E749C848273B2C90F307A68E4 devinstroede
2,421,611,707 *FFE1B2497284006937024461ED2544F8624CB87B dfbw
2,421,611,708 *FFEE2C0755D11B4F7635BDF37640D74A806D8FA2 dg(k
2,421,611,709 *FFEBFCDC6E6C7B4BA1E9C1E27AFFDE801CA4256F die&_
2,421,611,710 *FFEFA2E1CE8C151F98A19C1725A3C5DFBE041F86 DIEGO.SORON
2,421,611,711 *FFED3EA680B168372A7E998AA637E96F94554636 diggerhoward
2,421,611,712 *FFE3D02B2951799DB5FC4EF87124286F646C69F1 [email protected]
2,421,611,713 *FFE865543C19C8ED79C3D8AEA518F30A991EE82E DISSYMMETRICALLY?
2,421,611,714 *FFE8ECD74AE46810A308C84E561D4B245094E8B3 DJDG_
2,421,611,715 *FFE5279C82DB416F0FD9D0B300D4F23A279216D3 D#J.G
2,421,611,716 *FFE9E3D15316F33CE75BA830098CCF27B5209887 D(JNU
2,421,611,717 *FFE145F951877EB41837F19A58402912C9CA8EFD DJXP
2,421,611,718 *FFE4310D460E72D2D9583694EE5C76332B4CA18C DLIOCER1
2,421,611,719 *FFE66D7F429EBAC2029DF428E66F2B20DED89A8D doorstonds
2,421,611,720 *FFE8CB735E6393AE63C66524D149262AA9AF2DB8 double-for
2,421,611,721 *FFE30F460B7124EBB60ADCFDAFFD965E07B3C7B4 [email protected]
2,421,611,722 *FFEFD22A6CE160CF36E10F36123855B56B509155 dp8,c
2,421,611,723 *FFEBA1E5898E6322FC4CABC69E19F3B5E1619BD7 d#(qh
2,421,611,724 *FFEE30AB64EA8F86596EED67AEA07450101FB562 dqil1
2,421,611,725 *FFE59368590E9EAF062876B9F5E17333C9F95BE3 draw3rup
2,421,611,726 *FFE3D3E1F226900C1AC5AF7A4B4A8CF5146AF3CB DROUGHT-WEAKENED
2,421,611,727 *FFEA21BC9C645CCB9FEABDB4C8B2D510CC93D36B DU0AAAAAMAAJ
2,421,611,728 *FFE0002EBCF40A673983FABFFCDF164E7358AA20 du7m8
2,421,611,729 *FFE56CEE2926B41D5DA5B08112B15C40AD23F9B8 DuEv
2,421,611,730 *FFEB0193E64399BB3EC3FB022C27C8084BABDAA7 [email protected]
2,421,611,731 *FFE2916C92972143A74D70311B75286A0DD86C8E DVUY#
2,421,611,732 *FFE30D663C18A707A2AD5F0F11E9C98AE5BD444D DWFDH
2,421,611,733 *FFE4B536012E5CA180F2943AD7F2398D6BEDF185 dxc18
2,421,611,734 *FFE78F019C3183B0989179C2A03269297870CD87 DYCEM
2,421,611,735 *FFE268D98E4C7228E610E2B50C088FE994026F5E eagleshello
2,421,611,736 *FFEF44C1ED1AF7FFDCE224B55F4AA02D4B7399CF EC3&
2,421,611,737 *FFEAA632045589E167E3DDA12C09F6E49E956519 EDISON.SPADE
2,421,611,738 *FFE9A35CD62FCD0990E825419EFACBC1316D08BE eduwq
2,421,611,739 *FFE1426E9730D1ADD47A37D8B8ACAE9740387A01 [email protected]
2,421,611,740 *FFE529BEAAE21406A0B2144E72AA773BB0F8F180 ef%or
2,421,611,741 *FFE9F5E0CEBCCB69E615EC167A990D7EEC045149 EGM0I
2,421,611,742 *FFEDBE6106BE2766D4D00D60F22827786FCAD7EF eldenallah
2,421,611,743 *FFE535C51F944F312C79E9D8EE284000574059E7 ELDEN.ISERI
2,421,611,744 *FFE619173EAA0A6DAECBF32A2F5EE4BEA106C577 ELDEN.THORLEY
2,421,611,745 *FFE20DE9FFE56A8D056290E9A02522003289C65B ELIRULE
2,421,611,746 *FFEE5FD081FC1672F7CFBD57FABF25C828C8FDFA ELLADICKINSON
2,421,611,747 *FFE2CCA9B8FD550A8018F5D1B778E57646EE7393 EMMAARTIKELS
2,421,611,748 *FFE191C0B5C387F933693EC0F80B128F68C6AD25 epsiispe4
2,421,611,749 *FFEC8CC5F1A4D7367B9749F8D993C174AC70A0AE erberie9
2,421,611,750 *FFE9E76FC7FA75D5292C885FD0FB97D1184BA70A ERNIE.LANEY
2,421,611,751 *FFE4ABB811EE60FF55D5A1CAA57E5F7A146BDAD8 EROFEEV7
2,421,611,752 *FFEC1BA37F21E6475198D8444AF1520FBD04E7E2 errolbusta
2,421,611,753 *FFE45D04FF7D734D3F73D3605D659B3195834C07 errollitsey
2,421,611,754 *FFE6C36F6F0CAF402D0BA76F1F1246A866E4AF42 ERWINCAMPILLO
2,421,611,755 *FFE56CF758F56E2F04EC363104D6BE0EBB22F0AE erythrocyte-specific
2,421,611,756 *FFE0D91455BF9D8BD1779DB1E83443DB7BE2E07D evanvance
2,421,611,757 *FFEB61DF43CE87B1921C74098F4120E4A6C1D2C0 eytmd
2,421,611,758 *FFE43C0E7839116B57031277987FFB4F60314EE0 FAUSTO.ASLINGER
2,421,611,759 *FFECB62AEB7BAAC2E81FEF42B95D83E584216017 FCHIAM
2,421,611,760 *FFED7F8EECD5830BC1F71A89CAB611AD62257AA6 FELTROP5
2,421,611,761 *FFEB4CB5F93E6E76B791B4AC82CFCCAE92A83696 FIDELTHIENGTHAM
2,421,611,762 *FFEB6705A11E2555E97EA019DB9D103633933AE2 FIERBINTE (FEAT. ANDRA)
2,421,611,763 *FFEC661E403E73F6CF22FE55025267BF61FA6065 fling.him.on.the.barbee
2,421,611,764 *FFEC635C7A28AE633DDAD448BE2C017A2792611D FLORES1234
2,421,611,765 *FFEA897DBFD573F761D87A3DEC12948F32210995 FRSTHNG3
2,421,611,766 *FFEE936C97330E3A29BAFBB8A5A3473AB1A85494 FUR33PEZ
2,421,611,767 *FFEC1FA70320D102C205736465FFA5FBEFA7A02F G0RMED
2,421,611,768 *FFE6A50A4422E5C0040FC15F1A47EE90E0B214D6 G1BAA
2,421,611,769 *FFE0908ED29C71DDDDE951FCAA62AC07A77086E2 garthfishback
2,421,611,770 *FFE21F2317E46BBF07173A658200859AAC6D07FB GAYQWER7
2,421,611,771 *FFEFC42919B854A533992193FF9376FF75B6AC23 gemellos2
2,421,611,772 *FFED918BFA94FCB77B61733075D6114DC79C436F GERALDOMARTIG
2,421,611,773 *FFE38BDEE4A04163A8BF0180952F5B393C69F376 GESKIKTER1234
2,421,611,774 *FFEA1A9D860AAD1DDD9EF21D5F1FC8055B6C8173 GGK3116
2,421,611,775 *FFE335B22DA44857F092F8F26C61989C3928D8F5 [email protected]
2,421,611,776 *FFEB7B7D215CC1A190AA9ACC2F1A916E228AE2A2 [email protected]
2,421,611,777 *FFEEBBAC485E500CFE9FB977E4A90DB07B6CEC29 GLAZENSPUIT.
2,421,611,778 *FFE56AB22656462FE595B9742A8BFA124F63DF51 GONZALO.ZIEMS
2,421,611,779 *FFEADF1B6261FC162F9A69FD6FE3F41D69628186 goobtaar7
2,421,611,780 *FFE87329A715540DA472A152C54BCE33D1AA524E [email protected]
2,421,611,781 *FFE2A3E7690226040BC6629B00D999DA4085E13D [email protected]
2,421,611,782 *FFE87D5DAA7D7BC10FD3652073BE134FF46DEE43 GREG.SAXMAN
2,421,611,783 *FFE77E784CD1C3862CFC893E4DB2C6833F95C6CD greystoke2
2,421,611,784 *FFEBF0E61AB0651A24552595F3A378FE7E93F033 Groove-Rush-#2
2,421,611,785 *FFE46ADA6C171CD9AC2897D7D9F1472B47102635 GROUPFITNESS
2,421,611,786 *FFE31A909654EFBD6ACEED1D854C72964120C3D4 GULDGRUVAN:KURIOSA19682002(DISC2)
2,421,611,787 *FFEAC2408C6B0BE698D043CE6466A41F96202F18 h0s7il3ly
2,421,611,788 *FFE14BCF42480757605A94A23F0CCCB0CEDED0E2 HAMARSINGANE
2,421,611,789 *FFEBC124D11C923CF83C6DCED1761AA0EE2D4064 [email protected]
2,421,611,790 *FFEBE668D2C32B6169CB867FB33B741B96DE3C11 HAPLOCHROMISCHRYSOGYNAION
2,421,611,791 *FFECF892D869A79645A05778E9967D183EB6BE01 HARLAND.VINSEL
2,421,611,792 *FFE4D56ECD14EB0553CBCA8860E57E214169D970 HAVSÖGON
2,421,611,793 *FFEB04BEA388026CA198D817D9520211676FA3E3 HCORTIRE6
2,421,611,794 *FFECED6ACE9B956EBA1EBE477DAC5223B7CE659C heatheragnor
2,421,611,795 *FFE74CED99CE6C64618DBD99A247472729537937 heidijoel9
2,421,611,796 *FFE3F5D1E377DAAB1E01E5DB01E9D28B9DF0343F heidiveltman
2,421,611,797 *FFEBC537665B458BB0CF84EC2744F7777C6A9B32 [email protected]
2,421,611,798 *FFE8AEF9855B1DAFE59A52D727663F2BF41C047E HENSODR
2,421,611,799 *FFEADF97035FBF85016DBACC5F25AB066C0CF7CF hirpinik
2,421,611,800 *FFE38E4B7AF0246B928B03C1E3A55309210CDB0B HOYTCHIONCHIO
2,421,611,801 *FFECAA3D633AE7C9F8CA4369C8DC2D20CCBE4E5A HTML4ME
2,421,611,802 *FFE2CD9D2ABE578D86A09F8E358E53432C71B6C0 httpwwwkanesuecoj
2,421,611,803 *FFE45F450ACCEABA02DC00C5A37157D1A573D6BA [email protected]
2,421,611,804 *FFEE4E9D361094A21CAE95B18ACF8710C0EAD416 HUNTERTANIKELLA
2,421,611,805 *FFE90697815A6189019D208351FCAEDB442FE5CF [email protected]$
2,421,611,806 *FFEB2DE06892FD87E592F3898CFAF6C5B06D869D i4m>
2,421,611,807 *FFEDF8A5AEEFC59B78E483DA6E5EA3A911AA9D8C IEREINEN1
2,421,611,808 *FFEFC3EB59016D4B84A26C2463EEA4E0C655C119 ILOVENURSE00
2,421,611,809 *FFEE3B0FB64C7C5DFB77BB9C37C3FFD2D227323A ILOVESTELLA54
2,421,611,810 *FFED5A023181B49B648DC65F38A02977DB6E3CF2 imprecato
2,421,611,811 *FFE93EF92A2A65F1B7DDEF4C02EC908DD449B45C innewies2
2,421,611,812 *FFEE5C9C035EDC07713FCFBA330D67C0B1F3B1B6 ISREALFULLBRIGHT
2,421,611,813 *FFED3D7FF1E0211D2A66B870942CA49A1BBE4069 ISREAL.ZAPATAS
2,421,611,814 *FFEFE288E36284F342D37E680FF991765BD0F580 it2178350219
2,421,611,815 *FFE4AA0FC4942C35A09B50B22B41A0A8BC99B1F6 itoanbvs0
2,421,611,816 *FFE96C9D649128B62DD2D14158280CB09457BBBE i`v"
2,421,611,817 *FFE28CBAA4D84489ED984F47E154F2874616C482 JARED.ZOLLARS
2,421,611,818 *FFEAC9C2B8C48D53F565FB1A5A9A70748959998C JARROD.AGUILER
2,421,611,819 *FFE3E0AF4FAE7930BEE4754C65D18F88796705DA JBNEIA
2,421,611,820 *FFE78DB3DC83E3524927A69809FA09EF65FE4DFF jeffmeister
2,421,611,821 *FFEFF4D45538C0E6E790CEE63AB4E14478BECA73 jenifer.evangelista
2,421,611,822 *FFE7C25AB2A8C6434E54BD5A0126EC64DBCEBED2 jeremyklempa
2,421,611,823 *FFE77A593011F900CB64A3E51CB496D3E6AC22F0 jerryhattrick
2,421,611,824 *FFE4875200BA02887F087D23A118874CB200319D [email protected]
2,421,611,825 *FFE46CFEDDD9F0069338AE23C631606F242CE8C4 jo~a
2,421,611,826 *FFE48A2F89EB6384DCA2AC16D839AA38FC8F13B8 JOHNATHON.PARATORE
2,421,611,827 *FFE6E55257BEB092876E453F7567B6CA0C0D051D JOHNGREENEWALD
2,421,611,828 *FFE1729A953BE93F6A519FD3BA2CD7B53F63C86B johnniesilbert
2,421,611,829 *FFE9D14AD23C09D985D76AAD535F35663733A474 JOHNNYSLANKARD
2,421,611,830 *FFE776DB0A23FC2A04DC380ACD13D5EC4DB806EC john.pangborn
2,421,611,831 *FFE2BD4D8B73FC9D61B0D91DCAF5581C7D7BDDC0 JOSUELEWINSKI
2,421,611,832 *FFE9E00DA6B0DF18EC97CCB1AA903A4B745594A2 JUSTICE-HOGAN
2,421,611,833 *FFED005BC2E8A8C02CDBD9B70FDE771D1608AE37 KAREEM.BARROSO
2,421,611,834 *FFE99942D8EED7FCA92D4F8B11375CF5EF7C6C97 kaseywiley
2,421,611,835 *FFEAFE82D25CB7319AB249773B6A06B50F74C0B7 KEIRON.CARTER
2,421,611,836 *FFE015783C4B428557EE149FD71F9BA6313A00A9 kennithyazzle
2,421,611,837 *FFE55DC0CD08B783ABED146B36E3947118996106 KENTON.PANTOJZ
2,421,611,838 *FFE52D0CBB92962FBA6C7E8552559DB21C2D88EC KERRY.ELLIOT
2,421,611,839 *FFE71771B86A7F6846D8F499F07CAAACF62547CB KIMMCFERRAN
2,421,611,840 *FFE24FC7C517CFA4D710EADF11E4F04C71BDF7CF KJKSAMPATH
2,421,611,841 *FFE59CB44FF904BB0B44B43199831D05B2908487 KLASSIK.LOUNGE.NIGHTFLIGHT,.VOLUME.3.(DISC.1)
2,421,611,842 *FFE5ABFE9D2CFC7160E70BCA3BB002EAAA120744 KOTSCHORA
2,421,611,843 *FFE0E6AF7093E4ED56126D065CE6A923F180D42C kp*
2,421,611,844 *FFE95134D23C8BCC72DE38B81B74968561485F9A [email protected]
2,421,611,845 *FFE53383DA789AD7BDCF1BDF65938DB3A03942AB [email protected]
2,421,611,846 *FFEB9649A6D98D3FD9719518B29A4C7DA1B512B3 KRYDSKASSER
2,421,611,847 *FFE8AEB3EECC5CE303C10B380D8824CFCAF80626 ks/!
2,421,611,848 *FFEB20F773C89569F2D80EE9204805554A0F4E70 KURTISMAIAVA
2,421,611,849 *FFE3E0E0A2179BDDD3E5E800F79A26E0D327DE0B [email protected]
2,421,611,850 *FFEEBDC92A698F81853CDDBEE2A92D99135A6F47 LAPOPE7
2,421,611,851 *FFED6B295FDEBE13BCC6AFBD18B77E1E39F2BAEB LA.SONNAMBULA:.AH,.NON.CREDEA.MIRARTI
2,421,611,852 *FFE47471AB01EDA14D74613B3EE13866A466DF73 lcipsig
2,421,611,853 *FFE421DE008F2E5035A22771BC7F43EAEEE4FDF7 [email protected]
2,421,611,854 *FFEE23F73BF80D7B9A3C423D8684A22521BCCEFB LE.CARNAVAL.DES.ANIMAUX.NO.7..AQUARIUM
2,421,611,855 *FFE5322C1EC8DDBFF3F851CBED900C63E1784645 leifgluszek
2,421,611,856 *FFEC9C6A2D64E045CABFFEB211355F59DF6DB4EB LESTER.DETHLEFS
2,421,611,857 *FFE0724013F6D44433E4E4C188A6471898FD04F1 LIBBY-WATTS
2,421,611,858 *FFEF5FC85EEA37063560BC4DA0DF2C64D0169E39 <LI>LINE23CHECKSWHETHERTHECURRENTNODEHASARIGHTCHILD
2,421,611,859 *FFE96C45BD21F8F32669F7F6D7467F60D5849EAF LINDSEYRAUSIN
2,421,611,860 *FFE6AC8D7F5D6D305E9D2E68C7F73BB42B576D37 [email protected]
2,421,611,861 *FFE62A614FB5A9D0A3649A7572365325CAEFA712 LINWOODGALEOTO
2,421,611,862 *FFED6E422016401ACB369644C9E91600A4F126B5 LINWOOD.TULLOCH
2,421,611,863 *FFEB70519C78B4BEBE5DDC4CAA2E71F22D67FE16 lizizmuhhoe
2,421,611,864 *FFE2656DA442123B56DF6300C4C9BFF0D2BE1508 lloydpicard
2,421,611,865 *FFEF4C18FF011A0BA52C8CE52C5F70BF67CAE2BD LOSER1528
2,421,611,866 *FFE2FB4C8153F477A6E232ED8E5DC82A5124F916 LUCIOLINSNER
2,421,611,867 *FFEF7C3DEC1EC531AE6A1FA70FB597BF7F45D37E LUCIUSJAKUBOSKI
2,421,611,868 *FFEFE62E0A548F5B3F43FC3CD2088CC9BA3C23AF LUKE.HINOTE
2,421,611,869 *FFE5300DA39E5AE837DD7572FA6FB5C6BE15E358 [email protected]
2,421,611,870 *FFEF0FA59A52F84204E207B620B2A00CF6D20F38 [email protected]
2,421,611,871 *FFED284C6D3F3EFE8F5DEB9457842A5C3E838B8A LYCOPERDINA.VALIDICORNIS
2,421,611,872 *FFEF9D9A842AF6EB7675DC985C789E08A84FD972 M4R14N50R1N
2,421,611,873 *FFEC3E0F223258BECAB518981042BED4DA42DD26 m7inbrudsynpd
2,421,611,874 *FFE322951B73AC864F96A872343F649DBCA2F5FA MA.COCCINELLE
2,421,611,875 *FFE3958B1470701E1A3DD102581B289D87531560 [email protected]
2,421,611,876 *FFEAE92DFC406B67D5F035D8DC9958D6AC5C725B MARGARITOSEMRAD
2,421,611,877 *FFE6F808DA61EFCA40B3ACD856CFD76AE179363D mariethomson
2,421,611,878 *FFEA2DF77DABBF33FA42AF059CD8B8D2DC4A2073 MARIPANGUE
2,421,611,879 *FFE7F9B0981161F306F563ED8AD0B4F1440F5932 maryforbis
2,421,611,880 *FFE18FAA4CB600413DB049EB14AED4A551B4C93D matt-hallyburton
2,421,611,881 *FFE751F9FBDEE2AF6DFF0F42D46696C185767ED4 maxrobley
2,421,611,882 *FFE83299DE37D59F6037EFB303EA69EE2C90DB83 mazedonischer.spielmannstanz
2,421,611,883 *FFE28C43AC28A751606F7983619EEA941CA73C1A MBETLEHEM
2,421,611,884 *FFE25FF4BE3285D9843D365D29FAAC86F3A54150 [email protected]
2,421,611,885 *FFE4BEAC784FD345A1B1EDBA782C36B1C5EF3DE9 MCSWAINMAH0KSWEY1N
2,421,611,886 *FFED8D11B17EA1A0336CED7D263596D3FD085505 meldenswaardst4
2,421,611,887 *FFE7EA08667C55354F2C29E3B643C21671A2D12D MELLYSTING
2,421,611,888 *FFEF0CBCF27DFACE0C9F4DEA8462EBC3E567376A micahtuggie
2,421,611,889 *FFEEE3C2E28ECC1AB00530916B98CE38FCD7BEB9 MICHAEL.IRIAS
2,421,611,890 *FFE28FC79B0CF717065F0B0B8CA832CCB54A7AA8 MILANWADDLE
2,421,611,891 *FFE209C90D8068FB1B7F174863B75BFB28BEB180 MILLIOER5
2,421,611,892 *FFE42FF30997516964C6B07330A653DD347AF90D MINH.FERGE
2,421,611,893 *FFE655AB92D8862FCE9AAE4BE73379923A3DAE0B MLF745790
2,421,611,894 *FFEA9D9B75DC31384A542A95666A0DD711FA63A1 mohanad.hamed
2,421,611,895 *FFE8343A42D312CD45ECB84DF9C83EEE3E90596B MORTONRAMUS
2,421,611,896 *FFEE9DC329573FE630BA05BF04B993D70AE233F6 MOSTVALUABLEPLANNER
2,421,611,897 *FFEA2EC37C52C46FCD7FA5121B9BEC199350A3AB MP4R741N3$$
2,421,611,898 *FFE99A806C762BB63BB7EBCD764C115BE4367B2A MRLOIS
2,421,611,899 *FFEC6D5E16A115DF4D120B4EF3459082A1CB81B4 MUSEETSING
2,421,611,900 *FFE5B2D333AFCE753E2E0CAF686F9A95714F3730 mwexyua5tohosjo
2,421,611,901 *FFE9F9C5C220E242A12270D1F92386313F1DDE59 MW)Y
2,421,611,902 *FFE6A719D26BFCACC1B5213FDD522A6F6017DC55 $N4KIE$+
2,421,611,903 *FFE5C422E5CD6A70C4E90BEC2976959F784ECE12 NACHT & TR
2,421,611,904 *FFE7BF7FCB43223404A2D608031984C87552730B NÁSLEDOVÁNY
2,421,611,905 *FFE0DE521B7CE9575BDE9E75571F063C2AB65D6B NATIONALISTSCITATIO
2,421,611,906 *FFE5BB15EAF44656DD4DA02F31E2E7C81CA93967 NEDGLOV9
2,421,611,907 *FFE0D2BC0C6C31EC3645875DE59B32BE28282520 NEDNIHCS
2,421,611,908 *FFE2D17015A8816E99D6B529C2F312C6FFE93C40 NFR>
2,421,611,909 *FFEFC5AC75A917348DDFD2BFE7B58C7841A26146 NICKYKORITKO
2,421,611,910 *FFE740CB44750C833181ECEC32D8E99A7172E83C nico.davies
2,421,611,911 *FFE3F923FD8B5E31A85107E0135F519CE8A71982 NIKOLA DRACA
2,421,611,912 *FFE8E64230B220A53156682EFFD9E985A0CBA18D NINO-ABONG
2,421,611,913 *FFE392ED20962AE6F510E7ED291D183C95F706D3 NKOOAA
2,421,611,914 *FFE4CBF678180A8B57047A6221C665085AC0C6C2 [email protected]
2,421,611,915 *FFE1B6AD9B9FC4D47FA0FF7F1F2CCB726EC668F9 NOELGRACE
2,421,611,916 *FFE0B191E62612334F34AA360F86AEEFBB6F4964 NOONEHERE
2,421,611,917 *FFE9C8A0D73CDA567139F75D6A50471405612A73 [email protected]+3$
2,421,611,918 *FFE9749D490072D700A347082A1821D7B153C3E8 NT_SHENYS
2,421,611,919 *FFE7FC7BA4435C4CCD833E427F6E9660E7A31F14 NUNT14V3R1NTQU3
2,421,611,920 *FFE40031BBF9BFCDA1A2F0F8E8EDCC3122F46437 )o(~ [email protected]
2,421,611,921 *FFE172A7860C962AF699358C7EDFFE1AD9B85660 OLLIECHRISTOPHERSO
2,421,611,922 *FFEE6828E79090967F8E25CDA869C8CCC63397C0 ON-BEING-A-MAN-(WHO-NATURALLY-ATTRACTS-WOMEN)-(DISC-7)
2,421,611,923 *FFE05AE67317FCD6C2A0DCBDD82B3B27DE58CCDD }O{.`@------Q
2,421,611,924 *FFEF92F1496E5B559823D8C54B77BB990431C71F ORIG.NO
2,421,611,925 *FFE2E6AD13FC5139F18A0C525706AA1B2D8213CA ORVILLE.GASE
2,421,611,926 *FFED2F79D9FCA3CFD87236474421FC03D2D95EAA outstudy1
2,421,611,927 *FFE268521DCF276C154A2612C19E8166E45AFEA8 OVERSTY4
2,421,611,928 *FFE7ECEDEAD1AB9675C521483B340A57D9A7755C @P010G1Z35
2,421,611,929 *FFED6BBDBDA53B50F016026B35C7E9906791F2E9 [email protected]~0SPLOIT
2,421,611,930 *FFEB3E1F908208EC092C253BEADECD64C62A61D3 [email protected]
2,421,611,931 *FFEEBAB7254BABDDDA7021450C271F18B6E5521C PARTT0NS
2,421,611,932 *FFE2F07C6A90B976BD08CF6EB90A2E8DCC5BB85B password817
2,421,611,933 *FFE81375186A6925265A6BEBB5F84D7CFD7AAE5B pattyrone
2,421,611,934 *FFEA211FCEC6E99BA60647EE66F29A8607713A91 PAUL.BAUMOHL
2,421,611,935 *FFE18E84BE475DA7B6772144C398445DD1B8ABA8 PB`~)O(
2,421,611,936 *FFE176A3AB40765E21700762DFC795E9E64D2148 PDDNU
2,421,611,937 *FFED43DDEA30F282094FC47BCFD2C8B6B2BA2E41 PDETAIL51
2,421,611,938 *FFE1CB2C7458BE35E33587C32CB9B0465E335AB4 PEARL-OY
2,421,611,939 *FFE4C4996404E08ECD7DDD2905AB18D204FF881A [email protected]
2,421,611,940 *FFEDAC58E901B55B8319D674F726BDD7BA988BA4 per57al7cally
2,421,611,941 *FFE5CD226A8A76C2013731DE782A22CA996F2E7D perseverative
2,421,611,942 *FFE4CD82187D03F424475AE147707F6AB55B871C PIERRE.FANTOZZI
2,421,611,943 *FFEBD008F479DFD796997B748FE2D912C6B68F3C PIERRE.ORTTENBURGER
2,421,611,944 *FFEFD16110B463DDD01F8A147C2207D33C4C13B9 PLANETBRED
2,421,611,945 *FFEE64A278789720A6484CADCB5ECCD0AD15B94A PLPNDR
2,421,611,946 *FFE17DD8B43EC8C7B076DCFA97FF2035EC526407 poistui2
2,421,611,947 *FFEE2C6F3EC733C2F2CF7D8C186FEF3F8B5BF142 porfirioconstable
2,421,611,948 *FFE27167769A55A93D267FCC8883E92E5C34E878 portraitpaulbillik
2,421,611,949 *FFE8AB1017CF406AEE3A754B7C77FF02BEDBD3B4 poufnoname219
2,421,611,950 *FFE9EFD6A65B4E6BFA0DE05B44BE5B0261D9B1F8 p#####p~O o><
2,421,611,951 *FFE9D54A770B271A6A6BDC22D280FDF10C853BEA p#p-*sploit
2,421,611,952 *FFE0001B95AF8B982690C1B4F62946859E587F32 [email protected]
2,421,611,953 *FFE24A90F424425F2CB973CE43BE6B9C59A3E937 [email protected]
2,421,611,954 *FFE4B6F92A33C242B6130965BF7BC77274B5752D prino
2,421,611,955 *FFEE2083AA898FB3650ACDA4E39EBE7D8C487475 [email protected]` uu
2,421,611,956 *FFEBF55EF662F2DAF95771814618005F05317762 [email protected]
2,421,611,957 *FFE9FF1D8B2D1AEB49C1222258453AEA705A744F Q##P`~>-<
2,421,611,958 *FFED866AAAE29B428C012550160FFA8BC9BC2EEF [email protected]@ncy
2,421,611,959 *FFEEAA126401984F4235C9F2B8607D6BF4C686BA raphaelharan
2,421,611,960 *FFE612C0C09C80E45E72CEA8AC9B864C3E2DE1F1 RATULLAHKAR
2,421,611,961 *FFEEA86BE1CC83CE4F92263CBFBF7D6F4DE81BAF RAUL.SURRA
2,421,611,962 *FFEB1C4FAFE4DE7BAEEBBE3DBDC4B42E009826DC rauschnig
2,421,611,963 *FFE4175EC9D3FFECB483C1997A0D08A7ED022D86 [email protected]
2,421,611,964 *FFEDEAEB92B3E3A2CB61CBE8AE9A363AE98ACE9E red hot skull for red mountain
2,421,611,965 *FFE6F41064DC6F074035CC18BAABD484DB2072D3 REDNIRAH.1
2,421,611,966 *FFE161AB4559B2356766BE6619CBF23CA9FB5AAB reproduites2
2,421,611,967 *FFEAA742EC153564FB553F20D9E3D7452F078F9C RETOOHSTUOCS
2,421,611,968 *FFE8D7E14F36439A3BAC9E3AB39E37F751F9D58C RETSPRINCIPPER
2,421,611,969 *FFEA640CD29229A3A2A9966C1A3213A2C06AAC5D REWEHESSELFF
2,421,611,970 *FFED5D1171E7623EC28F1C8DAD55F0C16E5B01D5 RHONAJOSEPH
2,421,611,971 *FFE9E727AC2BB947A99F3A2D6B67C8CF561954FE ricardofacey
2,421,611,972 *FFE469DA713C5D8FAA9338820F7CC363D881BD62 RICKEY.VASGUEZ
2,421,611,973 *FFE760C295DE2E74D8B036AD11CA7B325AD120FA RISOJEVIĈ
2,421,611,974 *FFEAB5727225193B512357A0D73105653987B2D2 robyn.church
2,421,611,975 *FFEF3DBF30BF58BBC1F9FFA8D7C30FBC09A68F59 roccopass
2,421,611,976 *FFE87989A4170F897CEE1B6BF16C1EF731B6A9A9 rodeo_chick4ever
2,421,611,977 *FFE5441A7FDD8B2F2D9A30505C36F259ADFE2C8F RODRICK.ABU
2,421,611,978 *FFE5E0A1641FE6A92E73C44C7FD02BC6AB226F34 RODRICKTASHIRO
2,421,611,979 *FFEDDD1C7814A9D25A0EEB663C5FC797FCFF1A16 ROFIDAHSULAIMAN
2,421,611,980 *FFE4B6F92DBF4C1BFFAD44357803B4C03FB1265B romilly116
2,421,611,981 *FFEBA00A651811B0E12C3240CE454988A0A4E7CA rose.michel
2,421,611,982 *FFE111A89DE66B4B2E7EB78627651DB33202C542 ROSENDO.CASPARI
2,421,611,983 *FFE49D9AA6071D9976E90DBE5487552107A4ED44 ROSENDOMIKELL
2,421,611,984 *FFE5D901447F819006D4DF1C3686268793BC9C13 ROUWARTIKELS
2,421,611,985 *FFEDF68507F0490056CC458AD2302C335F5F1AD7 RUBYTANDY9
2,421,611,986 *FFEDAEF945004A92262C98DF1A474DDCFB13FA69 RUDOLPH.STANCIEL
2,421,611,987 *FFE2D4EEC19AA5E38605ED6F5314D1972A08D75C rybys's
2,421,611,988 *FFE9DD30FDEFAD183A4A1429328F21D897E29779 SANTO.ISREAL
2,421,611,989 *FFE47118FAD93C74927744C9B18DE6E28ACE64DC SAUERMANE
2,421,611,990 *FFE87D89CB4BB98C81C37E3A18723B1316D0A44E sbocciate?
2,421,611,991 *FFE25C193B83F6F5847AC9A1289063D22EE04844 schoenmakers8
2,421,611,992 *FFE27CA9B084AED949CBE72007268CD8F86657F3 seallionbarks,screams,snarls,grunts,animal
2,421,611,993 *FFE37CD3CB592CC396FEEDE219C3C322A4764EF6 seenrob2
2,421,611,994 *FFE094E0772540E65D6A9841A86B628DBEAAD6DB serraz
2,421,611,995 *FFEE1AAD54568253EC197D73B86B9D113161F3BD shaker
2,421,611,996 *FFE38212B4D1581AFF0605CB9CDA287D10A681AF SHELLLAKE6
2,421,611,997 *FFE59238097EF30C93D59BABA1ADCF499D618947 [email protected]
2,421,611,998 *FFE7BA78E5CD983C907B24594759D89A5B2B4E3E shonhodrick
2,421,611,999 *FFE1A11F44AC103C12E1838A62663C4B0B624B36 shouhais
2,421,612,000 *FFE8A390C3E94C137AAC0B0930B27C58A642B0A5 SID.BRINSON
2,421,612,001 *FFE8223CA8F5EC690ABE2E32974605C01631DB15 SIDDHANTSID
2,421,612,002 *FFE924E4DF324394B9FC9999256479B830D473F9 siemiginowskijerzy
2,421,612,003 *FFE22493BE4077C714114A3F756F2A7EF55A3639 SIMPLIFIED”
2,421,612,004 *FFE76640202A661A81B990386D3E8A8181F3FFEB SIRALUCI1
2,421,612,005 *FFE455C8B87BBE52CAE33D09052EFF826829F89A širmahera
2,421,612,006 *FFE476E0DC16FD304912BA52088E6457973F8F11 sirtobybelch oknightthoulackestacupofcanary:whendidi
2,421,612,007 *FFE72F5AF39542683158D73C8B9628EB80945B28 SKIPPERWOLFMAN3
2,421,612,008 *FFE5FA0DE4910FE3CFB6E12A75C5779028571133 slingerdans
2,421,612,009 *FFE09F99AFFBCD8A732BDBCAF498B25B6B8AE93F soneone's
2,421,612,010 *FFE117357EA102FEABE2A68B7DCDA011B9D9D7F2 SONGSWITHOUTWORDSNO.7INE-FLATMAJOR,OP.30NO.1
2,421,612,011 *FFE428F5C57091359696AEC2389B9E4780494393 STACYBUTE
2,421,612,012 *FFE16B77F25D26BA694CC177C739393BBDDCF310 STADIGIES
2,421,612,013 *FFED0D0992E72FA55C91365EBE83E27C6EF1D362 steenzweer0
2,421,612,014 *FFE3645EC514E4ED8E840E9F1C5E82BD3071963D STEFANWAGANER
2,421,612,015 *FFEEE94E775046B63A2E384572B51B460096F733 STORMPATRICIA9
2,421,612,016 *FFEA1769AC052BB17221CFA65233CB23C8E523B2 STREPUNT3
2,421,612,017 *FFEE3936801E64308A68C3605B0B63E34ECD6FB6 STUMPTREING
2,421,612,018 *FFEA0817562DDA2FDDFA31EF2784CC75956F3F94 sudarono6
2,421,612,019 *FFE565720C1046E3BC0FCDB3335A2DB27053CE3C Sus-primeros-LP's-(1977-1980)-(disc-1)
2,421,612,020 *FFE43C5C177547C9083C24629B73AC836F6445EF SYYRIALL3
2,421,612,021 *FFE9F844C3139F0AF6CEC7FD2F8F74E27C2162D1 SZAKSZNÁL
2,421,612,022 *FFEC9D745AC13E117670D144867C51420858308A [email protected]
2,421,612,023 *FFE805432B262E22EED74E6B39A51307858D5FC7 TAIDEPRSSIN8
2,421,612,024 *FFE400A2079685719BA774AC995E29AF7366BFDF TALKTOXYGEN
2,421,612,025 *FFE53881B6AFF4FE3FB82EFD347464B53388A88A TÄTORTERNA
2,421,612,026 *FFE88D5B726F5F2DDAC6263188FECB566EFE1106 TERRYBUNDICK
2,421,612,027 *FFEC6AA6EBF91055B15B776B86EA383B9C3A387B thebereanchronicles
2,421,612,028 *FFE823A9EE3497AE024A0751AC30D0C8B9C75773 THEORETICSPECULATIVE
2,421,612,029 *FFE959E660CF790CAAC11D9508BB1082C84F5BA8 THEPARTERRE
2,421,612,030 *FFE22C3ED83E7D3581DC065C1D0EF4431925F653 THIS SICKNESS
2,421,612,031 *FFE0A735086DE94F21CF853090A9555D9BA1CF23 thomasgranda
2,421,612,032 *FFEF0E3503B3FB6EED644BA8179B8F551F0D2789 THREITED
2,421,612,033 *FFEECFE586B0900886C8060B8B682CF1DB981798 tibetàn
2,421,612,034 *FFE45419ED50383A04A945489023E6F6AC21DA62 TIETZ'S
2,421,612,035 *FFE3178438242B690E81D97847C797BD4820D483 TIMMY.RAFFONE
2,421,612,036 *FFE5CD08D940D718BA48D4F999E61FD4C812E1BE TIMWEINHOLD
2,421,612,037 *FFE52897BE8A999DD6CA137BE7A295D7099F9F8F TO.HELL.AND.BAK
2,421,612,038 *FFE23C5B0F4DB8C4B02DC4888824CD126AC762E7 TOLMÉTA
2,421,612,039 *FFE06BA76D3465B13FAA542C8B96E7B6E1530330 TORY.LEYDEN
2,421,612,040 *FFEDABA68053584E8BA7FB8B62B4B3B3A661B992 TRACEYLAVIGNA
2,421,612,041 *FFEDDA3F6744027846CB53DC4CE7F1D4355C2600 TRICIA ANN TAYLOR
2,421,612,042 *FFE99FF4CD3E3548C96A246DC2FE8D7A47496F7C TRPPSLMN7
2,421,612,043 *FFE6A7E1E270E61E5AC6E29B06AEB9258005519D TSOPMROF
2,421,612,044 *FFE34F7F2342848D4016B14839F4746294D3A740 TUMIDIG
2,421,612,045 *FFEB706140AA2B80633AD4CA203FC940BF1F3A23 TWINS.PHUONG.PHAM
2,421,612,046 *FFE59C04B004E783DC2BF5B4B60197414EE693F2 [email protected]
2,421,612,047 *FFEBF851464C80DE13092E3C0ED135DD085C55F6 tyrellstuckemeyer
2,421,612,048 *FFE56B7637DAD4804F32B78170E25FF7CE34FB57 UBKAIF
2,421,612,049 *FFE98CF0AB1DF825FE2AC7F34BD5DBB8BD6CD30E UBUSTIJ
2,421,612,050 *FFE54FD6F22CB768255F0FF503C5B5A940EE8D07 UHF/VHF(DISC2:VERYHIGHFREQUENCY)
2,421,612,051 *FFE23E4140F4BB249045FAF76C4BA73F5680266E UMAPATHY-PASUPATHY
2,421,612,052 *FFEB8D915058994C4184B7F2ECA879821370E060 UNABRISTER
2,421,612,053 *FFE24EF7EFFD7CFB32E614F6743580ED1EE8A933 ungelegt2
2,421,612,054 *FFE84D0308BED5DCA3E32C336C11D884071FCB6B [email protected]
2,421,612,055 *FFECE0994F58EE6EF218FB4A9B59C1E3A5DB4FC5 uy<u
2,421,612,056 *FFE594FA4BA7CD671E917034886FD55EAA4CCB36 [email protected]
2,421,612,057 *FFE0C6A991AC0564B807C70602555169A4E2638F VALMISTAJA:
2,421,612,058 *FFE69458309E8BB76E914299113A6FF70091A64E VIJILAVANYA
2,421,612,059 *FFEFBDD18AB79AAED009850EC9C44CFBC89C02DF VIOLET.CHENGETA
2,421,612,060 *FFE305AFAF49B85A4E424140956E9CAA5891E28F virsbiskaps
2,421,612,061 *FFE359B091A1CA3CACAE6FDBDF688B03C4FC57BC V>TAAA
2,421,612,062 *FFE4DD7FD7D07D668A65667E72FA70915641F5F0 WADE.VERHAAG
2,421,612,063 *FFE4C502B0A5952939D227E5C407C81FF632ECFF WAENESSES?
2,421,612,064 *FFE960CA38404666B0930D9A5EF392EA4B64DE3C WALLY.CATACUTAN
2,421,612,065 *FFE1C919E5892F72BBEB757192D5A7BAC0ED2291 wanda-sanders-ashley
2,421,612,066 *FFE72A1CB48EA435FC71643F847B25FADE7FA7DD [email protected]
2,421,612,067 *FFEED5AD224982010CE697CF2D9EEBE4C9B4934B wansa.alattrashe
2,421,612,068 *FFE3EC144E74B80CDB35946A02F2176C1888608F WANTDEAD
2,421,612,069 *FFE4EC20084EF1972DF53BE77A1960D0FD6BE822 WANTM123
2,421,612,070 *FFEF976D59396041317870C2D5A9E36BD2F8A817 waylonneeb
2,421,612,071 *FFEF5AE1762C5887365B62CE5A3AEC10D9A5324C [email protected]
2,421,612,072 *FFE9E6A44A32826997F06501A2F8910A6161854C [email protected]
2,421,612,073 *FFEF3BDF63032F91A0BE91971EB8FC8D76CB1DA0 WENDIWOO
2,421,612,074 *FFEED786BDAC69753C64776B136884A068B52291 WENDYC1234
2,421,612,075 *FFEB91ED5BBC3775DE3F2159C98F6E95CABF4DB0 [email protected]
2,421,612,076 *FFE8AA594A521F91DD8C3794BF84236737B2B4B6 WE'REGETTINGCLOSERTOBEINGAPART
2,421,612,077 *FFED63F93E510531CB4873F27E98F39B347F14A1 WFIYAN
2,421,612,078 *FFE7EE1EC31D72BF97560353BA782C325CCE9629 what do we mean to each other
2,421,612,079 *FFEDE54E9C7E3CE91C0642647A2119F4AC0A213F WILLIAM3
2,421,612,080 *FFE83F9AE4289CDFFAF65E91EE3439F2A4529283 WINDYBA
2,421,612,081 *FFE589F30AC064FB1E49F730CD561E385E17611C WINFRED.RAMELLI
2,421,612,082 *FFEC356A9997A6A1C3D6CF6C1F48E0CEB382D6BC winnea-alfred-selvaraja
2,421,612,083 *FFEBD75BFD7ADC2E0CAF2F6698AE50678991784D WINSTONSANTELLANA
2,421,612,084 *FFEE692D8F21CAF60E4283BF4C1AE628243F1BDB WITSARCASTIC
2,421,612,085 *FFEBC7A8FDDBA1A14D7B7DA32E7304D170AA5ECA wordcraft
2,421,612,086 *FFECB93C4A3CC6E71A01E6B1FD6D5DF5B03CBD20 WUMSBSW3
2,421,612,087 *FFEE5B43CD133270D03C448D634753A5647E85FD WWWMARKETINGPILGRIMCOM
2,421,612,088 *FFE9FFDF2DA36BF26D97197B69F7812A78133BA3 xaviercheungsan
2,421,612,089 *FFE98565DC2F7CEBBF97578AAAAF3C7F156DEE49 XAVIER.GREGOROFF
2,421,612,090 *FFEC0255ECC82F2CFFB0B8EA429B2D81D4ED360A )X(~`-~`d-----p
2,421,612,091 *FFEE30F1B95903A1378ACFA452934D6E6CA0B12F X(N
2,421,612,092 *FFE3DA4AEAD9E7FC891555DBA7678D742EA1BFBD xxqddmj61
2,421,612,093 *FFE494C8E73669B8ADADA5A6F10B17F2D7B67D7D YB+:
2,421,612,094 *FFE76D9D3FD1D45495F932BEAC6F2FF6FC7DD33C YEARS.EEEEEEEEEEEEEE
2,421,612,095 *FFECBC0344D0F794CB5B5ED185C76C9A39F667D0 [email protected]
2,421,612,096 *FFEF4892CFEE9F8E8ADC41A6778FD2F017EBB1F3 [email protected]
2,421,612,097 *FFE0A8ED83F9DE02B6E8D54F9EB4C64ABCD66B67 [email protected]
2,421,612,098 *FFE5E2C247D354AE564E24D41FA864F1B7669617 [email protected]
2,421,612,099 *FFE51DF2E5212A35AA39E2D1CB147B8FE64F286D yolanda.tasha.strozier
2,421,612,100 *FFE14FE28CFA99D01CF12BA674A78F6AC272DF55 youngabdi
2,421,612,101 *FFE8D86BD2B0303FD46F4FFAB736225CBC25588B yuchirangyuchi
2,421,612,102 *FFE4DCDD11411BB48275CF0C73F0B9B89C38789E [email protected]
2,421,612,103 *FFEE06B1B10FEA797932AA0FA7E237EF3330894F YULFIANA-ANDI-ROJA
2,421,612,104 *FFEB12E408782469331E6C7206D75F5E3FAC806A YUNIELBORROTO
2,421,612,105 *FFE43BB27A0F5E4BFFA35038079C8DA95744D2CE YUSREE-MDIDAHAR
2,421,612,106 *FFE1945F360EB249C57B090E33E7519DA6291D41 yusri-muhd
2,421,612,107 *FFE984A94039648B998F448CA792354CA5A47287 Z1053
2,421,612,108 *FFE86106A2780B9D07FBA022B31B604787247DBF ZABIDAHAMSAH
2,421,612,109 *FFE7F145FF2341ACC2E25D521612C57D5E12CAB8 ZACHARIAH.SHAULL
2,421,612,110 *FFED7CE8D391E6CA948144E3D442E9BCDF4EDC39 zacharytremblay
2,421,612,111 *FFE29B49D330393C0535CE15809E76C736EF08EE zavras
2,421,612,112 *FFED819BB50AE972A2199C23069611C3524EE60D ZEITSKCAB
2,421,612,113 *FFE5312D1E757D95A6518CAFE9B62093350715C3 [email protected]
2,421,612,114 *FFE8EF4AE6E70B1137C25DDB62157931D90756B0 ZIAED
2,421,612,115 *FFE7F501454AB88F9FD2503D62323B188A17927D ZLOBKI
2,421,612,116 *FFEFB44EBBF5535F8A7B8014EC2F36F85BD9AB66 ZOLA.JUNIOR.VORI.MBANGUTA
2,421,612,117 *FFE6A9B301FB9D3A59AD14ED2A80678EDB3E63A7 ZS&I
2,421,612,118 *FFECC611E748BE24834E5A6B2932D84ED01A51BA ZUKUNFTSROMANS2
2,421,612,119 *FFEEEB360E4AA6C3650F100666543B884A7B36B9 ZULHANIF
2,421,612,120 *FFEF06E32E12E519915E1BF99C2A5B30C856C2E2 ZVENIGORODSKAYA
2,421,612,121 *FFEE22DF829F72922821E8D73B66FEE8A2BF8DC2 ΣΠΛΆΓΧΝΟ
2,421,612,122 *FFE292153CA205C0CB1354347B05F80EC6B16BED згагово
2,421,612,123 *FFE3122BEC5FB1AC4BCB80F6711CF2404DA80D88 лахиња
2,421,612,124 *FFE48B074E2BB1AE65964CD19EAE63BA0A3FC5B4 пеўчы
2,421,612,125 *FFE808898241FD4E81252722530AFE65C9594826 [email protected]
2,421,612,126 *FFE7C612EFE502886BAA5E250BD5C252765B8873 wesleyferrier
2,421,612,127 *FFE2A6F39DC3D4C7E62120887AE69085F55023A8 wielrijdster8
2,421,612,128 *FFE2989EF3D5DB55D66F8064881FE33C853CF621 wilburnkinsel
2,421,612,129 *FFE95AA77066E04A2515172FC4ED2D7F2A8F8BA7 WILEY.DAMPF
2,421,612,130 *FFEEA46E34D4303F8530727954D5AC0F7A42B6A9 williametalavera
2,421,612,131 *FFE21B57F5DD46C9B28ED88CD992AB9B2A5AF6DE WILSONALDRED
2,421,612,132 *FFEFA3A9E1008E2E872AD06C69EDA18AAEF68FD0 WINILEMATHUNYWA
2,421,612,133 *FFEAC503F245CB8B7CC1476E5F23982930C18EEF wünschelrutengehen
2,421,612,134 *FFE83043F83A986FFEE9AB304DBCBB6B374442B9 XB6001
2,421,612,135 *FFE99DE1E605FB61662E1957C58785CC65981F8B [email protected]
2,421,612,136 *FFE6B976AF5E740964647EEC644CED79C3C5863F [email protected]
2,421,612,137 *FFEE2A24CC33490917983DC83A2E5E86409AD12D [email protected]
2,421,612,138 *FFE9F1D01AB34B16CEF9EB5F859CA27BD30151CC [email protected]
2,421,612,139 *FFE0E2722177159FAA0D33DFBF8C26388D9B0F57 [email protected]
2,421,612,140 *FFE9A2F28A342C95929C37714E0AE5FE79B47F36 xmas-demos
2,421,612,141 *FFE4315F80F9CA33F72DABCB68DC41E78B45F84F [email protected]
2,421,612,142 *FFE58E1E7F33E5C1A6AE5BE5925B5A6495D1C6B6 YAYZ
2,421,612,143 *FFE3037C773D181FBD102BA3094633A2B43CB5B0 yih-ruey-juang
2,421,612,144 *FFEFD183194E7B9BAA489669890F706EA8EC75F0 [email protected]
2,421,612,145 *FFE89764B3BEE2DB5E75DAAC5E6D1736DD8D7C8D [email protected]
2,421,612,146 *FFEFFCF9ACC21651C678617CB4064866D40551B3 YÖPAIKASSA
2,421,612,147 *FFEEFE302343FDE5B1218D8FB84FD6935339F5E4 [email protected]
2,421,612,148 *FFEBA34044FC5060403ACBFF05821353091F88A5 yukicung
2,421,612,149 *FFE9694BC21CD1BE04A471E17E651907AAF65342 zacheryagnes
2,421,612,150 *FFE95231FE9AF26C36BEEF932218A4A41C71DDF7 zacherywanvig
2,421,612,151 *FFE2FA3428E66E26EF851A17D55C69E9AF6094F3 ZACKMCLINDEN
2,421,612,152 *FFE84BBC24B0EA8795727333726CF49C6EF1D57E ZAINAB.SAUD
2,421,612,153 *FFEC5AE4E8FA1ACF69C15C30360D0668A77E74A0 ZEUSRIVER3
2,421,612,154 *FFE738F713D00C6E0FB6AD7EFC6ED8530D2505E1 ZGAZOWARKI
2,421,612,155 *FFEE6FB2FE5917D0B745E000A6672804C3609703 [email protected]
2,421,612,156 *FFE122666C0B0B2DC1E03E146D41E50DEA1D0210 [email protected]
2,421,612,157 *FFEBB7C491C5F3B57219750318FAAE5B06609317 ZIGGYMUSTANGS
2,421,612,158 *FFE510E5AD2771B06D4DFCA551519773CFA57C7D znak_b3svg
2,421,612,159 *FFE2EA1661BFE584A96DA7295F84004D7D3B29E8 zoopraxis
2,421,612,160 *FFE826B7448180F3B9158F834A0A4DA400E43845 036IMVERBOTENENREICH
2,421,612,161 *FFE41A7C2E2D0C4B9014C4C5E6BB0DC86E075A49 ZUERKFUA0
2,421,612,162 *FFE728E681DE87B227E215E1506B9A6CFC990475 ZUIDOOSTENS7
2,421,612,163 *FFEED2BB7BF3AF3E6EE24C195AB09B9496493E6E 07CBA8CEC28635C7894EDFD3F02001F8
2,421,612,164 *FFE30093A15EF5E19CE6FA50AAFA52CB1116E698 ΕΎΚΛΟΛΑ
2,421,612,165 *FFE500DFF723BE281D8A813438B063C9FBC754A0 ΝΙΚΟΛΑΣ
2,421,612,166 *FFE281C3838B68615213D35F99B9DF65F868655B авелион
2,421,612,167 *FFEAA7F3C6F3F55531AA9D2F63651171560B1DB8 АМОКСИЦИЛЛИНА
2,421,612,168 *FFEDBBAF94BC73D91013FB148439146E16616BB1 БЗНСДР
2,421,612,169 *FFE13080DCB9E4D54562D5F55D33E370F1A7CB1F (0_<)[email protected]=====p
2,421,612,170 *FFE0C051AA11B2A6300DF1F6AB1E3D643F06885D 1260480704039267846WFYQKR
2,421,612,171 *FFEBD47EFEC70812BD88253DF2C4CAACEB643305 МИРИСКУСНИКАМИ
2,421,612,172 *FFED20A3345ADB7EFE86D4D0C0DBE9C0D142936A МИХОНЗЕ
2,421,612,173 *FFE574C6818E936434AA7A787C16FCDA05E9549E 1400687 VILLIT KOIRAT JA SUDET TYYDYTT
2,421,612,174 *FFEE4399A664AB178FA16F3E0474AE590BC72694 ПРИМЕРАХ
2,421,612,175 *FFE5DCD68CAF52FD64C732939ED3385960D55BC3 1555360 MUUTOIN USKOTUISTA MIEHIST
2,421,612,176 *FFE197808A46BDA48F8DAAF15552709A028B15F2 сабанджиевата
2,421,612,177 *FFEBD42B62F0EA4C7E0158B55D3691199024938E 183201 BU NOKTADA MI VAKIF KURMA DUSUNCESI DOGDU ?
2,421,612,178 *FFE6C72F59A254296E17AFE4AE7764496852139A 1833891 renault-laguna-30-v6-:-191-ps-,-43-100-mark-
2,421,612,179 *FFEFE9CD3A39F37187D9ECA89761B3C1858D35DA 184066 AMENDEZOGERSEINEKANDIDATURZURUECK
2,421,612,180 *FFE7793666B01C09BD51D0BADB5CBA71995086E7 ЭПИСТЕРИАЛЬНАЯ
2,421,612,181 *FFED21EC594C62E62A0C88D0F721B6865BE0DE52 « POSE »
2,421,612,182 *FFED04D81B5DD0F4ED2ACE4B2622465CFAEFB518 1ANTON-CULVER'S
2,421,612,183 *FFEA4AA5D77C817072F47DD1C2CD396BF92CF2AF 1C8WFKD3JDC
2,421,612,184 *FFE3E3A24D0DAEF9F58181EC3499B12DF426CD87 に東京三菱銀行とUFJ銀行がそれぞれ
2,421,612,185 *FFE6FE57F19C69A5EEB5D8D18C17A89B9375D8D0 米拉特(EMERALD)(綠寶石)
2,421,612,186 *FFEECEEC3EDAD424FD1C730EA3F047B04729B578 1GHEETERE
2,421,612,187 *FFE8E190A4852922966B532D7F92BA0322EB843B 1HAUNESTAUSEE
2,421,612,188 *FFEDA77BA875D93AF0D2452EB6A51F11AAEF637A 1 KFWCLINICA
2,421,612,189 *FFE463681F549259C0C4F44C431D426532D52753 1kommenttikirjallisuuden
2,421,612,190 *FFEE46926194F341F1CADA3A1ECF35132C0446F8 1.lifestylemaessig
2,421,612,191 *FFEF1ECE994D2B36D7203EC319B3A3AC4157BD21 1MITGLIEDERWAHL
2,421,612,192 *FFEC4E009E1B8711B602ABB5F9773A6CA8986EDD 1-PERHEASUNTONA
2,421,612,193 *FFEEFAE886ACFB1422AEB1615680CCC0961246CB 1-procurment
2,421,612,194 *FFE3675A960211CBC3410993CCD1BFDB90D9DA6C 1.REALMHOBNOBBER
2,421,612,195 *FFE787ED7E173456A210FCDFF1BF4DFAE4315145 1-REFEROIMINEN
2,421,612,196 *FFEC5DE444C6708CFCC0DE2D0C9764B16B083837 1r|[email protected]
2,421,612,197 *FFEEDC2B5F9D0D4C4C5660BEDF748247847B1634 1RSBQEQJQ
2,421,612,198 *FFE3ED708A920DF86F3B57A276203F5BDB98FC56 1-SEPTEMBER-ERGEBNIS
2,421,612,199 *FFE21E6B656212F23DC23F811A1459113AE3F91E 1-sv-meinung
2,421,612,200 *FFEF47F2B996206604D95C4BA99F4B19BCE0A9B7 1TALKANGEBOT
2,421,612,201 *FFECDA44921B4951C8C435DD9AF1FE4CBD87812F 1tavoittamattomiltakin
2,421,612,202 *FFE996722C685BE523A3CC60B447FA4DA30A72F9 1temptingsupremely
2,421,612,203 *FFE140A0D6F41F8FFF2F269A0434335FC280B5AF 1-TTV-TALOUKSISSA
2,421,612,204 *FFEE2BB0D2534E4500EC259F43FA9581D2F70683 1TWOARMED
2,421,612,205 *FFEE6B762C89BFD799E0B2A03EC539E00078302D 1-viinatrokarit
2,421,612,206 *FFEDFC046569D52AFA25512E3C4E274AE3653666 2006763 BUTTHEDEBATEWILLNOTSTAYBUTTONEDUPPERMANENTLY
2,421,612,207 *FFE119263D0C103F7CD89107606571557EA0A8AD 227803 LOPPUKAUDENRATKAISEVATESTIHIITTIT
2,421,612,208 *FFEC952687A1EB8BE9A2BE0003592A24A05A12B9 2578558 SCOTLAND YARD VERFUEGT ALSO UEBER REICHLICH MATERIAL
2,421,612,209 *FFEB82A7DF11AFFCB3759E330AF8A9EE76AAC157 2614897 at&t'stenderofferexpiresjan4
2,421,612,210 *FFE4C1D179C884FEB612B260E61DA49B67CA8ADE 2639591 kainuun-keskussairaala-kajaanissa-p
2,421,612,211 *FFEED91E25A454CAE3E957230C585535DB516C28 2690406 hanke-olisi-voitu-toteuttaa-vuotta-nopeammin-ilman-r
2,421,612,212 *FFE5CC5C107B44704897BE091A925A9175E1EC56 2849850 LIS
2,421,612,213 *FFE21E096B1FBFFAED5C3A3803C6D18498368461 2975022 suurinosasaksaaeikuitenkaankoeitse
2,421,612,214 *FFE4809F75F0DB2A97D3F388790FB3DE320B83F9 2ANALYTH
2,421,612,215 *FFEBFC3A60F712842F2D80E575DBF8087C6C82AE 2.gespuerlose
2,421,612,216 *FFEBFD07C82105971E0D0417139D8276C9B8EB4F 2GNINETSAH
2,421,612,217 *FFE521A455027F94F6F604F631AB9DAFAA687C90 2KALLANNA
2,421,612,218 *FFE3F2471CB16A142A5F79FD14A74B577F736C81 2KAMBULE
2,421,612,219 *FFE8654DF8529A0668C8E24547D8143F87590B9C 2OJ:N
2,421,612,220 *FFE481066DA26CA669EDBD1A314F5F1505F8A175 2spezialtornados
2,421,612,221 *FFED5B4780F167970F4B6CA30C5A72F268D3E51F 2TESKALF
2,421,612,222 *FFE5F79EF62F951117E7448AD747C7BE684E13C8 2VERSCHREEF
2,421,612,223 *FFE285E85621283BBB1A5AB325E58F1AF6DA1C21 323QAWSE
2,421,612,224 *FFED073C92B77E210FDC51CF8C26D3F22670F9B8 000JAMESDONKEE000
2,421,612,225 *FFE00BBAF740F67BEE4666CD7AAE4A8BA0EED14E 354288 MUUTOKSENJ
2,421,612,226 *FFEE5D302C008510B88A48CE012B8B8389DA2B57 35CULP1M05
2,421,612,227 *FFE35588F3295F699C0E5E7177CF93B71B81A5B3 36772*/
2,421,612,228 *FFE72D484CC27C995B8FC9ECAD8585466CA56409 3aef71eeb93c3b618726f33a7b0756d0
2,421,612,229 *FFEBA4DD7557CF8E6179C95D929A6F8691D58E2F 04031055
2,421,612,230 *FFE90F5BB13C483DC21CF7DBD0B93C52DD3B5317 3DUDINSKA
2,421,612,231 *FFE614CDD46CC48C05481B88AFCC7A6513D817E1 073CASSIE
2,421,612,232 *FFE2F8FDBEFCAB32D2BAEBAEDC3D1E7C712C94C1 3friendly's
2,421,612,233 *FFE22365D163866316E969F8C9DEC98CC34D4EF9 3HEATPUMP
2,421,612,234 *FFE86D390AB2FDB48926F698BF64BF074A16C42F 0asdfgh6
2,421,612,235 *FFE703CD0059F0DBF499734644E68DC9BB0CF172 3THEQWER8
2,421,612,236 *FFE67B2143F0101B65862B1CADCEBFBE51BF469A 3XPLODINGSH33P
2,421,612,237 *FFEE9873C675C4CE3838A57FBC4DFDDCC831472E 43-kayis
2,421,612,238 *FFE47E5E745C38BD85663BA287EB98E6E3EC792B 43REINA
2,421,612,239 *FFEA940E907481A7E3CF125A3322A0F5E46CCBC5 130-HEIMNIEDERLAGE
2,421,612,240 *FFE3EC0BC5895379032F7DEE690EAFDC93DB3092 1431695 BIG.FRESH.SAI.4...ULKOA.VAPAATA.600.M.J
2,421,612,241 *FFE56DEB9AE2A744AA7E60145B3355F2A41F1269 1460835 suurin.osa.el
2,421,612,242 *FFEFB1BB9CC1A96C5FD26BB84B8CC6883E1226B7 4AIHDAWH
2,421,612,243 *FFEA8A6B0D301A2E222923C1A3A3D6E1D322DB42 1503743 arvostammesyv
2,421,612,244 *FFEDC5AAD7BFBD3512963C69BD96649A7D827799 1548406 saitilaavastasatametri
2,421,612,245 *FFE8FFC4480B640CC01102805C483253D6ABD5FC 1608700 market-conditions-also-could-do-in-the-boat-operators-
2,421,612,246 *FFE5C88012300A2B028B5D0E1AD8A9DEE00F1EEB 4DIGITANES
2,421,612,247 *FFE5204824A74C61E3FFDF3D4DCD549B609D74A1 4DR14T1C
2,421,612,248 *FFE0BD339C0C58C6FC2E52FFAC2C0C84FA5E8F18 1642454 mexikos schnelle erholung bestaetigt diese politik
2,421,612,249 *FFE553D22C34634151713CE107AECC2AB0F7D31B 16maaseutututkimus
2,421,612,250 *FFEDCD5F62E94C5825A710019A5FD94B270E3D96 1833762 ASUKKAATOVATALKA-NEETVAATIALIS
2,421,612,251 *FFE5F316597F326AECF7A512051093A954825291 1840—AS
2,421,612,252 *FFEC1D8CEC5976B8384A83313D1048BBCA0E31C4 1890868 vanhaan termiin -- olkoon miten vakiintunut hyv
2,421,612,253 *FFE9193F5E453AD152169155CB187B1EB4CF1CAA 4-laermklasse
2,421,612,254 *FFE087D5BA09C3D9FCCD9D122F5CE72F6C2AD645 4LARILEE
2,421,612,255 *FFE6818799A99E3D46655603AA8B615CCC63543E 1990181 dernameistauchprogrammgeworden
2,421,612,256 *FFE615685ADCE54B6526D2D05657345679B94ED1 19-baslamaya
2,421,612,257 *FFE2E843A7BD9658EF64BFEBF52977D0CC7EADBF 1-aitc's
2,421,612,258 *FFEC5A14B521E9591F718D3FAAE8C9A5A867B3A1 1ANTI-NATIONALISTISCHEN
2,421,612,259 *FFE27120598F57A617AF7FF65BA6FD045C79C03B 1-askarruttajan
2,421,612,260 *FFE32BC16A6583A1C2709085924BFB444C5A96AC 4NEALEBOG
2,421,612,261 *FFE6836DDD79B5F2D5B376DF60B8364BA0D4C2B3 1CGNSCNT
2,421,612,262 *FFE22190711B15C492C7FF335327504C3E7A7DA1 1 equalpay
2,421,612,263 *FFE9FADFBFE43F86757A42C040DDB7202CCDC939 1.erisilerine
2,421,612,264 *FFE0DFE3BEB28A2E7F40EE855EA3E661A6F194D7 1-FORLENZA
2,421,612,265 *FFEB17E7D0ADB7FB9BAD44CC08BDC26E882D1BFB 4STEELEJESUS
2,421,612,266 *FFE1CCC8569380FC73F52686DE85B8E0CD453632 [email protected]
2,421,612,267 *FFE56468EBFD72AC9F14F2746497064ECB56514F 1.johnare
2,421,612,268 *FFE653D925C8AF164260EDF4C5E362F7404B8B2C 1-KALABALIKLASIP
2,421,612,269 *FFE99BDB7D6760132B3E000FB4395D3F46C45EB7 1-kayganlasmaya
2,421,612,270 *FFED3F97E08BA7A703DFB00870F4CC1BFB2F8B34 4ZINKINBSW
2,421,612,271 *FFEEC62E2A5267C6560E5D688A32DCD424471D0C の4カ国による国家連合である。GUAMという名称は、加盟4カ国の
2,421,612,272 *FFE5F0D8DF2783442D9DC3713B5277BF600836F2 5101336
2,421,612,273 *FFE0CD925B419BD74AE297AA6AD167BCDEA126C0 596128 both.groups.have.their.work.cut.out.for.them..
2,421,612,274 *FFE3518E1E77DFE2416A03B5D0C025A49D9933DF 5BALYNGAR
2,421,612,275 *FFE621A05E0284AF0BAA54A6A75C1F7B92A05BAF 1.melkhornduene
2,421,612,276 *FFE136829A72B13FF75903AB05BC8D7C42BC1B16 1 METHADONSIRUP
2,421,612,277 *FFE9805BE42E4B4A824ED7646FD7DC6E50930D22 5BONERMACHA
2,421,612,278 *FFE2D9269BF1B4DFA9751725101355D8A9E5038F 5BSWRINABSW
2,421,612,279 *FFED4EF70DA70269C5CC46ACB659C86770DADE4C 1 ovmustu
2,421,612,280 *FFE4F4C37FA2114366256AD7992BB848ADC47211 5DENOTAIT
2,421,612,281 *FFE267B386C08C399741EDCFA31FBBE07FDC3000 1POVALJAH
2,421,612,282 *FFE700D9949233FE920CBE5192BC4F9D9AC87428 5.hankkeenaan
2,421,612,283 *FFE4E1AB04F140A3815F16551D2F336F2A2CBBAB 5HARRYYELLOW
2,421,612,284 *FFE84530AE5789584A84F8F12C4D0031A03225CB 1-TRAUM-&-12-LIEDER
2,421,612,285 *FFE6794BF38FCA37A9EDED68E72674EA51C31BEB 1-urheiludopingia
2,421,612,286 *FFE2FA0F44D677039DBD46767039E34779E774F6 1VANEENRUKKEN
2,421,612,287 *FFE27B501C51F9FE226282223FE849CDFABF9545 1VEEBITEENUSTESSE
2,421,612,288 *FFE6BD36FA27489B619E8BA9141B0416A12EFAA2 5nachtelijk
2,421,612,289 *FFE2101B8589FEE16E14FB303CD1A25FF1E137D7 [email protected]
2,421,612,290 *FFE995AFEC6AB83EAC9A256B8FF28FC2EB29E2C6 2161363 vieledavonwarenmitresistentenkeimenangesteckt.
2,421,612,291 *FFE8083FC55AB273FD797EED37F9A78686CF1FB3 5SIXATOID
2,421,612,292 *FFE3D70B50BBDD0F60027D9E0DD450115A69563B 221318 ELEKTRIK-END-.
2,421,612,293 *FFEAD85636B987AD32F02BC480C061DB14B41D1C 22AUGUST1495
2,421,612,294 *FFE94604B017C4D333EB654D49BE933CD5EB5098 608KAYLIN
2,421,612,295 *FFE40A0290D18A5A12C892B77D7FC6B6EDFCD491 691AITONG
2,421,612,296 *FFE3441D9AFA89E6B771B84B2708511ACA2B1AEC 6BSWLIKPHAIBSW
2,421,612,297 *FFE78628512C8EE01A46A8CB7B4910562553A075 2876747 OSAKASSOPIMUKSESSA-SOVITAAN-,-ETT
2,421,612,298 *FFE56E2C12B929F8D8C16218984AF2261892A278 2892353 peoplecamponthebeach.
2,421,612,299 *FFE69EBCC1A6F92615860D0CF39A7B8503BE88BC 28ERIKOISAMMATTITUTKINTOON
2,421,612,300 *FFE4C7224F3C5AD04FA6AE45895101CE790CFAB1 2911764 RIPPITILAISUUSENNENMESSUJAJASOPIMUKSENMUKAAN.
2,421,612,301 *FFE8B726FEC4D9FF20C5235552982663C81113F2 2930496 VUOTEEN-1989-MENNESS
2,421,612,302 *FFE79791CA09B6B747D36F1BDF923C1166512BD9 6DTATEKZ
2,421,612,303 *FFE28A9BB98708FBA1A877B9BB8B3FFABD446616 2975823 kiviset.talot.on.onnistuttu.aika.hyvin.h
2,421,612,304 *FFEA3AC5D0B842352270E99FEBC9DB2009160821 2982685 LIS
2,421,612,305 *FFE028964D0E52F4D2DD669B44275ABEAB2C56E8 2d5f70b220566e786f079782bb359faa301079
2,421,612,306 *FFE7B587386C17F8F3F0F94EA0A54ED307251268 2DEPOTHOU
2,421,612,307 *FFE7D8C66F29170C97F6B0C19D8DEF3C1261E68E 2ed9f74425993cb8899e197d0877b3fb
2,421,612,308 *FFE4E32EABA5C6B63EEE4F9859BF7EA31A3059E0 6KAMERAGU
2,421,612,309 *FFECE07359D55D1FF63580D320E326D752395094 2GEDUSCHTE
2,421,612,310 *FFEF69B5FC22D8BF46E855B43B3DEC6990B397EE 6LACIRETCI
2,421,612,311 *FFE2A8220DE1A89486E7E002D7AAA20E1C46C9AF 2-HECKFLUEGEL
2,421,612,312 *FFECB308CFDB68C81767F47DB0C5DB77DFE82A8F 6london-scottish
2,421,612,313 *FFEDBF23C17D5D674531F32125D323173077284A 6METALGEARBSW
2,421,612,314 *FFEE2DF140CBFCF5FB66389CF1B5054C92788977 2JUNAKUORMALLINEN
2,421,612,315 *FFE48648C602B0595AE5AB752CAFA779CF41B46E 6MSILATIPACORP
2,421,612,316 *FFEF4A611BD11FEEEB1669EECE78BC67EBAB9F76 2.KNELLS
2,421,612,317 *FFE34F00A4A99F2676C3FECE6EBD6E85AAB9965C 2.koihime
2,421,612,318 *FFEAD29DBB4BE3630D98B2F3A5051D31A1341C3B 2 LEP
2,421,612,319 *FFE728ACE778854A88C8635880C30D377D020FF1 2silde
2,421,612,320 *FFEEE730ACF3F91A1A78CBFDC6833DBC129BACAA 2VITAMINARBENUTZER
2,421,612,321 *FFE9C89B063C7147924F5ED75F4A73BD2871D8ED 30AUGUST1668
2,421,612,322 *FFEFD4B1CA84CD8EE14A859A148BE9C9C0D496C5 3: 1 2# -& BUNKO
2,421,612,323 *FFEBA830495EB82DB6D38B2BCAF881DDEACB96F3 6WILBURSWIMMER
2,421,612,324 *FFE1E4467C9CE6F3856193B7402D71CB3B9E9D05 3810 SUOMESSA ON JO TUHANSIA TUOTANNOSTA POIS J
2,421,612,325 *FFED0C10497505781335D404D11A2825F750C1F6 725CLARK
2,421,612,326 *FFE52C88FFF7EEDB9A6CE6F5265A1BCCA2ADA858 733434 cadir.kampli.tatilleri.luks.otellere.degismem..
2,421,612,327 *FFEEBAF104564B400B8B574A90BA11FC4C5613D4 753NOELLE
2,421,612,328 *FFE65710F676FF8ACA2769F7A8F1899296308ADC [email protected]
2,421,612,329 *FFE92442888AABC695E759436AF140F235EC09F8 780466 YALNIZCAYUKSEKKALITESDRAMBELLEKMODULLERIKULLANIN.
2,421,612,330 *FFEC7905370CC689487CABB4D7C9632445128C93 [email protected]OM.COM
2,421,612,331 *FFE48CCCDD3F28AD95696D0D0CE48187BBA82A2A 3g41+4r4nsm
2,421,612,332 *FFE6651A1594E57A6455809A689EEBF89FB4A1A2 3IGGATRO
2,421,612,333 *FFE54EF4E3DD85E5A8929534DC284288133D35D2 7ETSLEDIF
2,421,612,334 *FFE6FF505FE4356CFBCA09CA09856198BE6B5D42 3-meteorologeille
2,421,612,335 *FFE0EBA038AD9C339E51967E8F18C75D4E96DDE6 7GRIJPEMMERSES
2,421,612,336 *FFE61CC1314B7D82D9EA6CB0532E63EF8B0E0D7B 3-TOP-BRAND
2,421,612,337 *FFEEAFEAE6DA5F357339C2DA2C415826194089DA 3TURKOLOGLAR
2,421,612,338 *FFEEAD6A1AFEC5699A18D3AAF985867B26FB45D2 3VIAFORES
2,421,612,339 *FFE9503555E182A40D67857BB778F69F93C7F924 7NERVENZENTRUM
2,421,612,340 *FFEEAA19617651F5F69B109F12F5CB73C85D4581 3WARYLENE
2,421,612,341 *FFE870224E36CDC097F62EAC3CCCA2069F6B9207 7OTIRANE
2,421,612,342 *FFE53D2C7166E1CB779ADF159D94B85021541D5D 41norddeutscher
2,421,612,343 *FFEBE1C92F46FCE0A9BB0B449B6337C2F9EC9793 47 ronin
2,421,612,344 *FFEF665E8EADD429848A31ADCB9CE1B3706D445B 4BEYERITE
2,421,612,345 *FFE4DFF1DF777F616575618722F32D79C02F0977 7torinossa
2,421,612,346 *FFE97A729BEF28B9A4E47A7564CBFAB652B5EC5A 4FDEEGNS
2,421,612,347 *FFE7DB405ADCA2E31BD6FDA2086EFAC34F4CFD03 7WONDEFULLY
2,421,612,348 *FFEC6B82494F2F674DB2149BD26BC55AEC7AAB38 4HYPERING
2,421,612,349 *FFED5619B86438BC326D25CC6CF4F611393A5611 4IMBARKT
2,421,612,350 *FFE37FC6F19F889C58853E4CA443D0C2C3AB3DD2 4KANDIDIE
2,421,612,351 *FFE817D389B4E817BE432451AD0D7999E3791403 8606ls
2,421,612,352 *FFEDB7FF0E8D5B78E98F3EF722F469296478265F 4LAMPARIEL
2,421,612,353 *FFE2E0EEA2B275DC70AFC657CD48D5A5BD42B83B 8CHERNOZEMN
2,421,612,354 *FFE717134C1A38C9A644E74F17557BF536C35340 4PRITASIL
2,421,612,355 *FFEE473D67FBF798CF59D9F2AAFADADCE614C6E3 4RACINGSPOOKY
2,421,612,356 *FFE508A8B99C53DDE4258A748CD5FBEA1A050FD7 4siljalla
2,421,612,357 *FFE4902C96A72F1EB8946CB60F5A8C91349E54F0 4TIETEIST
2,421,612,358 *FFE494E23C1EE36F370158A755BFE89636CEE178 4VIOLINAIE
2,421,612,359 *FFEB4F8617E2090450842C75EA262712BA79642E 4ZARRAPASTROS
2,421,612,360 *FFE102DA83BFE57B3FA40DCD6E3479FB37924B2C 508683 UC MAFSALLI SISTEMLER
2,421,612,361 *FFE4604DE860A37D5995CA7F6DEFFF67317430C3 8oi
2,421,612,362 *FFEA88F220AD4C57A0CDE8C3B188781712F9B89C 557976C9485D742DF4D28EB6C965B914.KITWIT
2,421,612,363 *FFEF0620428B31B682E10AB069A04F786BA12EC0 [email protected]
2,421,612,364 *FFE47366E10BC23B47806216D42A247771B32106 57.UMSCHAUEN
2,421,612,365 *FFE537CE02827967288C8F4EE720B1AB4F05FDE9 [email protected]
2,421,612,366 *FFE967D655F8D1358D20D140B2425FA2FCC83FE0 8SANDRAWAYNE
2,421,612,367 *FFEF5D21AFB7CF2A4378A2C1AAB99F59B00BF267 5ATOMMAK
2,421,612,368 *FFECAC1F06A4F9344B0D9864980AEBFB4AB1E307 8###>~.~SPLAT
2,421,612,369 *FFE7FF8A3171D40612E4264E8A4660911FAFB7A6 5c5a4bf04d39cc8905f350b352a4dbd0nilesh
2,421,612,370 *FFE772D770D36732736C4647FAF96BD6DA3B7E47 8UNIREIS
2,421,612,371 *FFEB338F6D9D8EBF73A36EA6235574964044CC2A 5DANCEMEDICAL
2,421,612,372 *FFE85B3A3BA59AC254DA13598BCFFD14A25EE5B7 90269 MIT-SICH-UND-DEM-LEBEN---UND-MIT-DER-LITERATUR-.
2,421,612,373 *FFE88D93FD19C8A234A5CCD0F3E1DE2169C861B2 924CEDRIC
2,421,612,374 *FFE565B3A5D65427D224CA07D3DF5BCA244B0F41 5FULKERSONBSW
2,421,612,375 *FFE9392575476942DBD71A5070ECBC1158DDCE26 964963 ozcanborosmangaziuniv
2,421,612,376 *FFE4CAEB2008669BB4D6ABDAC26EA996159CFB73 9ATHROBOTECH
2,421,612,377 *FFE91FE3D7CEACC89262FB61F550EBB6DA8E8441 5INUMDENKEN
2,421,612,378 *FFEC4410E97616CE98B1008F7FF3313A3B923825 5KKMUUQ9A
2,421,612,379 *FFE48BF48368468F8F0836F2A5412E4496772AAB 9CARCHARODONTS
2,421,612,380 *FFE00822F109CAC8D3259DD939C9E8CF17AD4092 5MAJSKIMA
2,421,612,381 *FFE2BECB2E542C639C0FD193309EB9F7E2C7C486 9ELEKTRONICZNYM
2,421,612,382 *FFE609D362B3B19129057315936C31460D6A5816 9FULGENT
2,421,612,383 *FFEA8EABE45844863B1FF568EB9DEE119ADCED1F 9iamirina5
2,421,612,384 *FFE0C203B69178EF18949B1AFD76133478389E01 9ISKULLA
2,421,612,385 *FFEB09FDC7B5AEC692EFE8CFABE2C67A4F9CBCB6 5SECRETSCOOBY
2,421,612,386 *FFE6344F07CDE0CB1ACF1990EA6A6E39E9A8CEB5 5STANLEYTREVOR
2,421,612,387 *FFE409EA37ACCA0617AEB75748054C037D4C8F84 5sussuriamo
2,421,612,388 *FFE1276182CB76E09A639C8D715DE7F6538AB402 9NUMBERSIGILSIGN
2,421,612,389 *FFE97D17FD058FAC0912180427DA4991D84F9565 60D6E2A989E55F4173DE4729D4335D19EMP1RES
2,421,612,390 *FFE668ED3AA1FC6B5A808F0A0DE653373F0E5F39 9snickers5
2,421,612,391 *FFE5E6C2BA0B115855AEBB7BAF0AF2FA746FAF32 697438 palveluiden.j
2,421,612,392 *FFE375B34C2666DADDA2ABC3637BCB04866B8237 a,)/"
2,421,612,393 *FFE3AAF63FC3ED7326ABF8B0D2F2BD127C46EE2E 6BOOSTERCOOL
2,421,612,394 *FFE6ED3E4D671F9A671B942FC53F853C7CC29987 a0-4
2,421,612,395 *FFEAF6ED6344E044ED1E8E989500A4112C41DA5C a16t.
2,421,612,396 *FFE890B4E2771152C7B81BCD26D70DEDDA6C1BDA a28mt
2,421,612,397 *FFE5B80D4EFBBC37621FCABF50D8A2E171682426 6DRUMSSPARROW
2,421,612,398 *FFE15D81622B54974431019777A900360FE7C7E7 6ECONDUISIEZS
2,421,612,399 *FFE6FDD76F29334D9C4AD27FFAD49E313F87C48D 6ESTREPITOSA
2,421,612,400 *FFE6E766E9F04CFE5798709DF4DF7AB2D627E8AE 6HEARTROBBING
2,421,612,401 *FFE64D4B62319C3515921044297DC3C13489A387 6HOCKEYBUCK
2,421,612,402 *FFE6AB228E6069CB3306000B46180FFA54AF8850 a5+5/
2,421,612,403 *FFEE97AE4FBFD085EE2B9E928DF2DEEBC8CD223A 6ILUVMADELINE8
2,421,612,404 *FFEE9BA7AF4C0424E81985D059A19EEBA515377E 6INTERAGIREMO
2,421,612,405 *FFEFF4E2ED302A40B477C4BB43B4303E99A5B03F 6JESSIEKOMBAT
2,421,612,406 *FFEB841E3A1FF17659AA001B9B1EF1A6626D5C63 a6b+r
2,421,612,407 *FFE5F59D3F2DED2989F72B97F064DD6622610610 6LNCHWYS
2,421,612,408 *FFE58EED9859C6AC216BE92CDFF75F8C43C69DFA 6NGUYENNIKI
2,421,612,409 *FFE884C962B5032168ED9E05566059F2A179E674 aa#)
2,421,612,410 *FFE6C8C7B587B012BF01E26EAD53CD6C02277EBF 753virginia
2,421,612,411 *FFE70BDE668B044CA97F8E57FB20910195168624 AAGN9DXK
2,421,612,412 *FFEEED08D74615B9A3456AC2680DBC7224CC45E1 [email protected]
2,421,612,413 *FFEDA9AE58A12ABC9AFA12A0EC239C62CED539BC AAXTK
2,421,612,414 *FFEDED77DEF92B7E413E6033A5BC886A3637CFBE ABAVUNCULI
2,421,612,415 *FFE5D2CFE69359A7205DB385A86EB098E80AD07D a/baw
2,421,612,416 *FFE158A7D425E30D0C9568321808400CD23CF85D ABC.CA.GOVWWW
2,421,612,417 *FFEBA7363E963C67EE6D7438E7E22D48D2A58841 7HELCINUM
2,421,612,418 *FFEDC67D15275C0982D8740836262A27AD5068FA ABHISEKBHATTACHARJEE
2,421,612,419 *FFE96DA5E2AC213A848F8EB7951E264DBBF1814A 7KLASZTORY
2,421,612,420 *FFE3D4CCE8BFE8A6018E4AABD8AF19FA4DF80E00 a/bqu
2,421,612,421 *FFE056A37307178A3DA3FEF49C991E7046A69AB5 ABRAHAMBLAKNEY
2,421,612,422 *FFE01517A2BC5B2964DC88E7E35ACC1C6D0B7530 abuseremo
2,421,612,423 *FFE6C10766F32EFCEF1F2F70A84EFB3C3A946FA9 7pragmatisms
2,421,612,424 *FFE9EAC96A900B81AE61ED2BD1C0FA5F4B2DB79F ACE2674
2,421,612,425 *FFE30EC9D407C794F035620EFC9DBD5F3D349075 7XCOUNTRYLEONARD
2,421,612,426 *FFEBC441B1061F39DCCF32746DF84E541426410F 814091 "SIEMUESSENVERKAUFEN",SAGTCOLLEY
2,421,612,427 *FFEE52F25C82A0D25841246E12BEE128E2D047BB adcb?
2,421,612,428 *FFE42EEA2CA1782C65CF196C7B5B730A7906272E addsfbsw0
2,421,612,429 *FFE5C57DEC4EE83079FBDB44C7AEE3568EAF1982 adelphois1
2,421,612,430 *FFE909514E40AAA153A0E575031885FB17CE4336 adrian-huggett
2,421,612,431 *FFE1E468F14F1E190711AD313EDEFCEF200CC3A7 8BTTLGZD
2,421,612,432 *FFE17307CCDAEB8F9D4C2F297C2C103552806A82 AENILART6
2,421,612,433 *FFE9F1855B9B6A0E0E234102E689A1CA7CAE5C17 af3m
2,421,612,434 *FFE567555C9440C1EFC63967E0B633A593000844 8GEFOUILLEERDENS
2,421,612,435 *FFE7275A363DCAEDD63EDA14ABEAD4575B135FCA 8ILOVEBEAUTIFUL5
2,421,612,436 *FFE804B01E5DD02AD21395050F468308FE47CBD3 8INFOAARON
2,421,612,437 *FFED2D45B34720FD84D7E62A26142FDBC2DEF196 8LEASCHIA
2,421,612,438 *FFE4BE46B8D194FE71C82922A8D862C3CA7A5C70 8LYMPISCHEN
2,421,612,439 *FFEC585BB83501D65E05EC0022D5E4065F99F150 ag"sj
2,421,612,440 *FFE71E73C593E8284C28C806212C270C42849B42 8NAVRHAROVI
2,421,612,441 *FFE8E0902059A494C9DB561CB7F6A11DC69B1E05 8NEMMOSKERTFA
2,421,612,442 *FFEE1DE45C0CE69E0265AD05AD5FB8F2224E1283 8NOLEFHCRA
2,421,612,443 *FFE92269451014E9228709009EF2850CB1F7208F AGZUM
2,421,612,444 *FFE62F4E255B5E5C4308107CE2F80A2CAE32868B 8-referensseihin
2,421,612,445 *FFEDE7277FCC073331F0CA614AB6793976278F08 8SENDETER
2,421,612,446 *FFE86F74C0117256FC63ED25D7A56495792300B9 AINYDORC7
2,421,612,447 *FFE1D870241107F6928BAEC59CD8ABFBEB3DBFAB 8TAMARASHEILA
2,421,612,448 *FFE33D2CFCDECF8DBF32947B1E42B6848C216845 8THEMARATHON2
2,421,612,449 *FFECA17C57D8393E3B97AD39C9D23F07F5402D2B 8YPOCSONOLOCOTCORP
2,421,612,450 *FFED2FBD8012A40DE3F982FDA73EFBAA7C9611A6 AKANIASTY
2,421,612,451 *FFE4922FC18C09CE593341E9B48E04A28A5C599E 91B15
2,421,612,452 *FFEBE424D5E2E85631F40D31FD8276B81B5DA18F akm41
2,421,612,453 *FFE872BAB5E9AB26D9046A78A4A12EFEC91F8015 [email protected]
2,421,612,454 *FFE62856F97997590878FC5A27EC2CBB4D47D46D AKU&#
2,421,612,455 *FFEDA56FA24F6A36A53DB27239A1424EA0147422 ALEXA2040
2,421,612,456 *FFEF807632D1BCFB198352F51F1C031B8F5F190B ALFREDOSELING
2,421,612,457 *FFEE4B0AE5E1CB7DB7CCB7FFB52759BA63AF8525 ALIDZB
2,421,612,458 *FFE155F3197D13AB78308D016AAFE5AEBCC52190 A;LL4
2,421,612,459 *FFE046508B8FCFB6B45B0D5BA72FB75EBAEB0840 ALLISON813
2,421,612,460 *FFEC6DFD346B9E833057D9D7F258C62B26763C26 9MATTTEQUILA
2,421,612,461 *FFE03FA3C8BF5F4C71A672A014EF15983251DA61 9NA77I3R
2,421,612,462 *FFE45A811821ED81132E8CA2AFB7011FE9191282 al-t6
2,421,612,463 *FFE49ED92274BCEF3122326FB8182764058AD764 a:m%
2,421,612,464 *FFE9185FCFF7094FDE6BD25DF5E23364DA19E277 9THEARTOFHOPING
2,421,612,465 *FFE4190FD17A1D51772FC3799C24641C2A6C9186 9tiger7
2,421,612,466 *FFEA59F2FE0944C774DE822C85D3D0B224B10DFD ANA90NIZES
2,421,612,467 *FFEFB6720CE12E38069D778177CA065A43D790E2 ANA KAREN SANCHEZ
2,421,612,468 *FFEB7AE21FA832E1A566EB8C23902C0F0CD27E21 ANDREA THUL
2,421,612,469 *FFE2F8894DE9F1E05889784CCA10C4B8740589DA a4dt9
2,421,612,470 *FFEF06B92D503DAB593B2644D9FB41ED87F3031F a5l.h
2,421,612,471 *FFE16828A13E6E9DF9C849A9E26F528A8AEF18B1 anibalfollick
2,421,612,472 *FFE8EE3A36C1B26E2BCE4A2DE66A740BB9EB52C0 animatematter
2,421,612,473 *FFEBA7A94FC6A228928A6841A7F0694FBA9CEDD9 ANITUTZARAPID1
2,421,612,474 *FFE28F3E9D878EE2058E9B460788792C6399AA3E a.7l_
2,421,612,475 *FFE0D823C71D593D497C4BAE20F2DBED5AC6D41D aa$]a
2,421,612,476 *FFE95CF65FED1DA755ABE49B85FB3E59D6EF0C7D APOLOGETIEK6
2,421,612,477 *FFED3B30A7D0AD2BE84F4D725DCE405FF4D75595 ar89e
2,421,612,478 *FFE5FC726FA5A6CE7D74653B2240449762C61BFD a:rcn
2,421,612,479 *FFEC842027E07140A754EFD6A2793348346C048C aro&7
2,421,612,480 *FFED23EB514BDD95DB55555FC63B9E6D9EBB8A07 accusai8
2,421,612,481 *FFEE378A2ABDA165003032C9DBF34A852CA3C843 adadnecah
2,421,612,482 *FFEB5B7C2A31F4CBCC2D42939B26244FF84D9024 AUKTIMMISKU
2,421,612,483 *FFE17174A04E0370C730EFFA784F99534643AC8B ADRIAN.COLBAUGH
2,421,612,484 *FFE267C7CB3A7E2021B8BB1993263CEFF856C8DE AUTUMNBYRYUNOSUKEAKUTAGAWAASHORTSTORY
2,421,612,485 *FFEC6BB61857D265F499481B7EF44998A4BBCA00 AUYYS
2,421,612,486 *FFEF1BACA1F08F5323C9ED91BED145E89C3E95C7 A/E!L
2,421,612,487 *FFE9354284CE044F958478CD333D8F44B1BBE4C9 AFFAIRS
2,421,612,488 *FFE4E6ACE571A21A77D71E343246D0638A716EDA b0nio
2,421,612,489 *FFE5429C379AC10753F7BC97D8F886CD176518FD a_hyf
2,421,612,490 *FFEF5F59F613364EE7EE09851932D326D655197C AHYYL
2,421,612,491 *FFE20589BE15D3A4F14F34972A15DEBFB2599633 b-9-d
2,421,612,492 *FFE9BD909EB98AE8C23D2B74B993DEA6E2A6E898 ak)6y
2,421,612,493 *FFE037DACD4222C3371834F860DF7A4E1334D55A AKENED
2,421,612,494 *FFE8E818768E5452531AFE5710C740726130565A b,ac
2,421,612,495 *FFEF2A18760D8919E3E814E149131FAA874EB8C6 BǍODÀ
2,421,612,496 *FFE1B97FE97AE613ED664ACFB4502EA3F9D90D6F baot
2,421,612,497 *FFE7155FA45FC8EC539D7FBB08268E9755914D09 BARSEG2
2,421,612,498 *FFE41E06E634E42F64790E16CAA12F2ED6C14879 ALI.ASKWITH
2,421,612,499 *FFE30A84945421CFD2597037B159369B815F6B17 BÁTIA
2,421,612,500 *FFE51378B138854716EB628D015F50FF0F0098D0 allanfuleki
2,421,612,501 *FFE038FA1EEE1A90416E08CA0EC48ABB052EF626 allengradwell
2,421,612,502 *FFE627B0F18FBD5C68BBE01D2C244AABF5A9ECB9 [email protected]$
2,421,612,503 *FFEA1D90C66EBF7B7DD919803343A53321884DCD bc#c"
2,421,612,504 *FFED2818337BE74A2475351BB58E36739197C774 alvinsyracuse
2,421,612,505 *FFEEE562DA3F0FFAFF815B33B90D2DDC6FB592E8 ALVINZINNI
2,421,612,506 *FFE0EC0AE1E73F865B755AD5C3386623128D129C be?,#
2,421,612,507 *FFEFEA6275568BCEF11C91FAE388E112B4591632 AMBER KWASNIEWSKI
2,421,612,508 *FFE225523E5EFCD53347F9A34619CDF35951D7F9 AMBER STAGG
2,421,612,509 *FFEE02D6D2B50A560F58BCD3F987BF30CA4B1D15 AMDHA
2,421,612,510 *FFE791A3E9D16D8549FE85DDE4B48B8F30AE6604 AMFIKLIAS
2,421,612,511 *FFE607D2F090EDCF0A7FFAF124FA623029FE1F37 beehive k
2,421,612,512 *FFEC1878CBD751C07A1D851387C063C5A8685877 AMUBLANCE
2,421,612,513 *FFE22F754476AB95857C8C8FE09DC3B3474BF8DC B)EPC
2,421,612,514 *FFE1D0D4666E7E74D62C909B37D07976BDF239A1 BERNIE.KALPAKOFF
2,421,612,515 *FFECC78916C267A8A52CEE22D3EAACA270E5D51E BERTRAMABDOU
2,421,612,516 *FFE0066F1F57E7497102B2F7D936CF213ACD9B32 ANDREW.DEFIGUERO
2,421,612,517 *FFEF7865E1A0B71840C3E5D9644610F488FD2D13 beyond.right.now.(pretty.lights.remix)
2,421,612,518 *FFE26235C762561E1E8357B41E228DB1E509E9AE bflt&
2,421,612,519 *FFE5B7127BCE2E9448C71920FFDD2AC2ED26AE8C BFPJ;
2,421,612,520 *FFE47F4FB5CC096A7CF7A25066A8D21F52F9FDF6 ANNUNCIATIONEPISCOPAL.ORGWWW
2,421,612,521 *FFE74DC064A13BB4C6538E22A4EB9C71E083F961 anotherex
2,421,612,522 *FFEC4536B326B9773F9B3B98B9718317B3D74009 ANTOANETAI
2,421,612,523 *FFEB7BA6E6FE43898C3DFCD2167C52631B84244A ANTONIOSNELL
2,421,612,524 *FFE945DD24E11A9F3AD62D876009AEE23BBCCE3D BIANMT
2,421,612,525 *FFE86038F62770B7A2142CB21AC23C1A3B73B12A BILLIEMIECZNIKOWSKI
2,421,612,526 *FFE66662BE0C6EA1BA83DB5AF93044B16F420BBF billybrommer
2,421,612,527 *FFE92C6424BF3F61AB5AC3547C467A28E20C6001 APEIROY0
2,421,612,528 *FFE5A19F3C2E8A7CE32F521E927F66BDD23BE634 bjplu
2,421,612,529 *FFE2982DEE4E1EC2B606BC4E92A6110FF9B7B2B8 bla"+
2,421,612,530 *FFE56059B52B0446C9D4D807471DB015DBE52153 BLAIROHEARN
2,421,612,531 *FFEEEDB5384F7B8819FFF360231570AFB5C6652A [email protected]
2,421,612,532 *FFEFC5C083002582821C7B0255F7D51110538DBF BLEEPINGCOMPUTER.COMWWW
2,421,612,533 *FFE82B3DC2532EA84B9653B486E23D490B89BD52 BLEICHRILE
2,421,612,534 *FFE3A04650E4785BB7E7BF5A0B0A8BE146FC6164 [email protected]
2,421,612,535 *FFEE83047C303F37142B4210718ED385D40C41BB ARDINIPUTRI
2,421,612,536 *FFEC855A6E37F4AC5538EA67D749A8EF606E7071 areithous8
2,421,612,537 *FFEF58A4C488AFC566EB87227B4856A9D74F5F1A ARNOLD.MTHIMUNYE
2,421,612,538 *FFEB42BECFD74DD2764F63BA65B703F9E8BF1D8E arteriïtis
2,421,612,539 *FFE3616521F0883A3CC5F8F6C4CE9D021A66E94A BNJ;X
2,421,612,540 *FFEE22789740532FE902B56FEBCC46EAC07318A5 BNNN
2,421,612,541 *FFE2D9F00FE92DC30C8026BFC67E80D3E9674FD9 boomerband
2,421,612,542 *FFEBBE516DCB42462B0AA012A2C0BABEC91194EC BORDERLINE!
2,421,612,543 *FFE2A07E1EC6BC1204AB48A6840FBB9396C0A247 bpsdl
2,421,612,544 *FFE8172A62BC47AA4674FD5BA4F614377B3DA646 au/ba
2,421,612,545 *FFE65B4A1C3E454521DF491C99BE7467A54D5126 AUDANNES
2,421,612,546 *FFEA2982F759E89D4FFCD8227A35E5D07B870A29 BRADGEBBIE
2,421,612,547 *FFE707087D333C385F8598CDEF79BFDAF17F79B5 au+ob!ograph!35
2,421,612,548 *FFE988E4B078C422404050B558E8DBC09B28FFB9 AUTORIFLE.
2,421,612,549 *FFE1CA91F6BD124B778D0FD6C35D00580D2B6E7A AVERYDUGGAN
2,421,612,550 *FFE2A87235AAE601FFE303F598D973C2D2036B51 BRICKE1:
2,421,612,551 *FFED8B473EA2621D0D09016122C52D3B98B19733 BRIMISS1
2,421,612,552 *FFE4C03A97F695BA62D22B4F2949D95BD25FE644 ayame1=
2,421,612,553 *FFE93125271DC8F0C8036BE56F3500D19A27DA57 b`^"
2,421,612,554 *FFE8380DEC33C4896A422BCD9A4AF0082F1C42A9 bswfollabsw
2,421,612,555 *FFE07C0EBE4FAB08485C00240F0BD95ABE26A97B BUDDYSANTIBANEZ
2,421,612,556 *FFE03CB6DC3D4A1F171DB291D696615508F1A74C b4(p
2,421,612,557 *FFEFD006A88D2BF35F56EAD130865BDE193ED075 b.5cu
2,421,612,558 *FFEB29CD669AB219E8428BB861CDA4FEDFD3CD90 B9I9P
2,421,612,559 *FFEE2D854177B57D09ADF7E8F497092DD25EFE9B BACHBUNGE7
2,421,612,560 *FFEEEC7AB060E822F34608AC4094F2B3BBDE6CC7 BY95P
2,421,612,561 *FFE4C87A6FAB1BE5B796EA259F119DB4D38299AB BYTEROL
2,421,612,562 *FFE618FA65CB739068C9C1E11D1188BD144904EB BALKANINSIGHT
2,421,612,563 *FFECE413BDCF1F9AA1F74F5869D15852DD78836C C4L1NF1L3FR33
2,421,612,564 *FFEA4C3A456CF9357B2E3B906052791C662DB4BE C4WAV
2,421,612,565 *FFE5716DF1D1D1BAEB90E9737F4CD2459942B040 cantigas-de-santa-maria:-268-instrumental
2,421,612,566 *FFEA6A65DAA3764C6FBB4FF64F8FD26F2C8930C3 CAPERNAUM2
2,421,612,567 *FFE2152CB839C54045D36E025641B5BDE5DB4C65 BENJAMINBRAWER
2,421,612,568 *FFE6AC1780470912F0F02449E488F34035E9365A CARMELOSTURKIE
2,421,612,569 *FFEE48E9C2FD193CA338A587EF03883B4D60D64C bepok
2,421,612,570 *FFE2D9A353DF3DE37C10A90BEA9A0CEE9D7DF773 CARROLDELMOLINO
2,421,612,571 *FFEFB780524F734BE1261312E96FC53871C7BB85 BERRY-FUEL
2,421,612,572 *FFE919F3FFBB0806417B62C59D61DF812C26C16E %-cat->-outfile------------------#-let's-make-our-rhosts-file
2,421,612,573 *FFE4A581E693F8C9020D73211B57D72D4B8E791E bgfei
2,421,612,574 *FFE31355281A74E051BAC36D4B954F8A13F478E3 C,DHN
2,421,612,575 *FFEE7DD8827BA9CD22B62546A548012D1A45D771 CEDRICKOLIVA
2,421,612,576 *FFE74EF9CAE2F8A411A2E04A74A054151AD49301 [email protected]
2,421,612,577 *FFE96F0386AF87C5E2C61FD6E5AD1B0B83A6B392 billstoddard
2,421,612,578 *FFE6FBCD1889AB3D32C158A7AA16AEA1DC7346E2 ceqci
2,421,612,579 *FFEFC3C8395C02DDFB9C69A4FFC518602E5D7221 cfo(?
2,421,612,580 *FFEF0A6F81521B77BA73221CE9FA5B71C0C139AE b!;k1
2,421,612,581 *FFEFE395B3AA0C15F1950055C8F6B29AF7CD4250 C!GMO
2,421,612,582 *FFED1DCF51D7DF5AB0EE9D4DB95E2D2EDA1995A6 CHANGEAS3
2,421,612,583 *FFE3DF59A2616DB558AF13AB530D4B71434B7EF8 BLKGL
2,421,612,584 *FFEB1773BED15CB306BC9153F5399641AB3B225D [email protected]
2,421,612,585 *FFE94EA20B00A2827AE1F3ED64F41079DA6EF2BE [email protected]
2,421,612,586 *FFE1A222F55C116E9B6DAB6A6366101F03E0E9B6 BmLN
2,421,612,587 *FFE6695EEE0667ED47EA5E4C58C2C5BDE1E2A964 bn5fv
2,421,612,588 *FFE5534226FD15DB572EE59CB92AFDABECDB792A chriskulinski
2,421,612,589 *FFEDACD1FD90E49AAA257522461BCB2DE14CA3DF CHRISTINE-HAZELL
2,421,612,590 *FFEAEA91D7789C4B58AB9EA75FB488CDED9F7694 b($oi
2,421,612,591 *FFEAF7D7104E902EFDEB59EAE02860FE9BFBB300 BOMOD
2,421,612,592 *FFEBE353CED24BB0C4CBED187F3724BAE2FFCAC0 CISUMDER
2,421,612,593 *FFEB571E281605D0313CD0A8CAA06957AFCF3BE3 b.pfc
2,421,612,594 *FFE31E39F54D1C895B2C9A023D8248783FF315B1 BPM$;
2,421,612,595 *FFE54925A35954B16B992E282936266AD3777EF0 brand new s.o.u.l.
2,421,612,596 *FFE47A114F5D79A57D008E365CF779F1AF1A65CB BRIANAJANAE
2,421,612,597 *FFE993F586172F789252951BDB673518D89575D2 BROOKS.HERDER
2,421,612,598 *FFE9941EA2C7D06867595A52275B8F17D9C05BE4 brucerei
2,421,612,599 *FFE3D5D9F42351F85E1AB510F3373E20E0B7E6E5 COMBATE-DE-QUECHEREGUAS
2,421,612,600 *FFE47DF46A7681C9C2AF3F91A67BEAFFE6D6048D Bt17
2,421,612,601 *FFE37C062712419CB135E4A082352FB3CF20485F BTRF7
2,421,612,602 *FFEE48A9AC82F2AA8638FACDF9E0A9057CF3378C bučiska
2,421,612,603 *FFE11C3454B98E2FC58EE6BA89546EA4C9C84D28 contraindrions
2,421,612,604 *FFE483C38EA278E636DA7F9DF98A3A64251E9643 bullfaith7
2,421,612,605 *FFE4DFAB4EAF624ECB47070BC23C00DE958CA2C0 bumpy'sblues
2,421,612,606 *FFE83C34229693BEF88003DEC0744872DF9765A9 COXWANTEDPOSTER
2,421,612,607 *FFEF1E8E861E248A1055E5A356BA5672D6206A11 BV0S+
2,421,612,608 *FFE2DD267BF44D5850EF53F868B6A7B3E34FA4F1 bwi9a
2,421,612,609 *FFEA4617ACBFBBEA230E02A1F37BA99092E48358 C.PVO
2,421,612,610 *FFE030F397CB141D8F152881611749CB99E690C4 cr;_
2,421,612,611 *FFEF4488AE5B8907346DEBA68670AFB1B493E574 c;rcd
2,421,612,612 *FFEDD1655AB713254559A1C3D4F6049E1F0AE067 c04d+
2,421,612,613 *FFE9057B457CAD89AD8D721AEB205617951874ED C0N$UMMA+10N
2,421,612,614 *FFEBFC151B4D0DEEC6A1324070FFB76602837F06 c-sa=
2,421,612,615 *FFE8D7D8E7716C3F1BDC4CAF2B7155559FB7690F CT_.L
2,421,612,616 *FFE7B171302B5067765D090CD40442E4589A3386 CALLY.GAGE
2,421,612,617 *FFEE6574546953337B050F7955A7B1AADDD08AEC CYBERSURE
2,421,612,618 *FFE58D3EC4BC6C6F6DA15B6137314AF695533BB6 [email protected]
2,421,612,619 *FFEDEA05CC3DD17D725CECE5BBFBC1CF9F71FE7E CARLO.WAHID
2,421,612,620 *FFE3CE1CC42E327676E800D3C860F4925A0C6526 d!_=
2,421,612,621 *FFED8296ADB4D9B61473F47C37D610C373FF0294 cco-o
2,421,612,622 *FFEAAC1B4309BEB75B88EE0BD8B299FD92565DB4 D9E6A1CB
2,421,612,623 *FFE447CF2C84C8A6CBD3A32612B852D962A78F84 cdh-d
2,421,612,624 *FFE9FD52E5D9C40D609BC63622454EF5FA956BEE ceqm!
2,421,612,625 *FFE2EB686AD22B3F8DBDA2CE5E439A34694EB665 "CESONTEUX,LESVOICI!"
2,421,612,626 *FFE3CC45E9A90A587DFF62D70166B7578002AF96 danking1
2,421,612,627 *FFE91024BF60FBA02107799B6855D224A029AC27 cf(pt
2,421,612,628 *FFEA7C4D918DF94DD43C4D7C168A89328467E4E8 darkroller
2,421,612,629 *FFE28E737DB3827A7E2DEBEBF845591AC6CCF8AC CH4NCELL0R$HP$
2,421,612,630 *FFE1BB37FC99D35BB69CCFB6A52D72C47436771F DAVE.SHENG
2,421,612,631 *FFEA214F3F6BF82E8A3D7F35F5A71C1A807026AC シャンゼリゼ(champe
2,421,612,632 *FFE086C8B0F2836BBE02073727C17BF2329E94E9 chạy-bán-xác
2,421,612,633 *FFE178155797F31F423F94FDAF6162217810AC39 dcq"c
2,421,612,634 *FFEB7712884D1A541636424B58C93468C735A83B CHETMUTNER
2,421,612,635 *FFEC710980C757B08B2673E25F5D4B00B48FA25C deaferrefaed
2,421,612,636 *FFE3BE3808498B7B097A386C3371FB30E16B5C24 CHONG.HIRSBRUNNER
2,421,612,637 *FFEF00F9ACC8E811FDE1FFC867ABEDE3D76E1759 chongvolle
2,421,612,638 *FFE37620C45AD8B262E34E3FE97DB01117757EA5 choonga
2,421,612,639 *FFEC1C2DACFF959205B89A0DD5300E14D614D525 chrislund
2,421,612,640 *FFE8D8E0AFACC2D3F8F4F51A692DC372F7D3547E CHRISTOPER.REDFEARN
2,421,612,641 *FFEBFA143AE199F795717C7AC36FAA343F97FCA3 degagerions2
2,421,612,642 *FFE1BA3CD8ABD96706B37948158FCC1E1DEB7BDD DENGMOUPENG
2,421,612,643 *FFEC50228E9E6FEF78FA2EF2CFAFB4F87CB897B5 CINDYTHIERRY
2,421,612,644 *FFEFF4D6E4F24EE5C72349E156E9F27AB23BD445 CIT/D
2,421,612,645 *FFE78B405AAB11F74D63F0F906060104A1DF49CE [email protected]
2,421,612,646 *FFEC17E78BC6BB68F75FAA4FF59D930B07C2C7AE DERYABIN8
2,421,612,647 *FFE9BE0C2492178DA459F32D3EB784D073B0778F CKCA-
2,421,612,648 *FFE9C06BFA434ACBBDB1E8DFD897A2F9A234821F ClarkWinslowRoss-McGillicuddy'sRant-Scherzo
2,421,612,649 *FFE8EA8E1DE8B61A56D231C5AF7ED8AF28241282 CLEARCY4
2,421,612,650 *FFE79D0C39FE264DB0D47956900B877AA4FC0C07 clem%
2,421,612,651 *FFE6CF1938DAAB5EE7E3EEDC32640D98ED1CF037 di9.e
2,421,612,652 *FFE8665561D2F416721F46D133E03BFCC50CFE81 C!ND&
2,421,612,653 *FFE5071FF677582C006AD0A768A75ACF075634C2 CO114T3R411Z1N9
2,421,612,654 *FFE3B420662126F5DB49EB93D9FEF34EDE8E1664 DIPLOMATAÚTLEVELET
2,421,612,655 *FFE53C03CCE6F69CC82A4B81A63E095E23333C2C coleliebold
2,421,612,656 *FFEE3E984D33B3ACF12439B123731B85BAF5C440 DISTRIBUTINGPARTS
2,421,612,657 *FFEDD4644D3C10A6B51D2982C5D08EF1CA053A9A colinpalas
2,421,612,658 *FFEE548192B225E7F07F81AAA0CB9394C2E7CD8B colx2
2,421,612,659 *FFEABA6A8EB6A1B79D1DE6D7FF9C66D8C6970CDE DKXQP
2,421,612,660 *FFEF40D685962C3C3DD7415BCB22014497F37981 dlk/e
2,421,612,661 *FFE79B95CFEF58CD7499182CA1A61A26CA1AD1F1 CORINTH113
2,421,612,662 *FFE0116827716978C35FA371E70CAB3EAF35F05A cp?)#
2,421,612,663 *FFE99B1A9ADB822331F9585BE4F09CBED1F9C8C9 DOMINICK.LADIKA
2,421,612,664 *FFED357AD6B9C46C3F68EEE7B65DBDAEFB21AAA3 DOMINIQUE.LOUGHNAN
2,421,612,665 *FFEE0CA26397B42DF88326C6F9FF3E9AB07BDBB9 [email protected]
2,421,612,666 *FFE3F78E0AD09BD88B7065578ADF658722C120DD C:{R
2,421,612,667 *FFE3648B8789F1263DE6F672E0E431E4A3C0382E DORMI.JESUS
2,421,612,668 *FFE50242D5D2CA68F28066EEAB60DC09671E32DE DORSEYCRUZ
2,421,612,669 *FFE7F6BE45E1D3B19D09B865959DED3A29CEAD2D dorseycurby
2,421,612,670 *FFE7030F2A9F57D816837494879929C52A35DB15 DOUGANS
2,421,612,671 *FFEBD893D80CB3ED1245B786EC3D54E438453A60 d/ov+
2,421,612,672 *FFEF2266782EE7DFF50F422C9FF2EE72918B228C DRAMAGIX시리즈제4탄
2,421,612,673 *FFEED80400840144F598E70A684CDA3BCB9E9E25 DRAYSEHT2
2,421,612,674 *FFE602EF8F54EF9D18EBCAC4AEE18A963CA9F3B7 c-u"
2,421,612,675 *FFE7B713E5DAA1BED8D4A0B3CD94FC5512043E17 curtpulido
2,421,612,676 *FFE4A8F6A3E5CD3FA45159F1753F890E8503AD31 cuuc
2,421,612,677 *FFE3E50B6A801BAA0C706D23A6F15170003AE7EF dtkhu
2,421,612,678 *FFE4BA35E4F6AE76F38AE0F7314A3C795605DFC5 cyoukai0
2,421,612,679 *FFE4A4F61B610155DC448F444F9AB331EE127E49 [email protected]+1N9
2,421,612,680 *FFE0FF18B8360EEAB2EC7C8F800A5ADF142858B0 d4n%%
2,421,612,681 *FFED62FAA024589F3979819E80D66A954B09EE4D ECALPER ,)LIAME RUOY FO POT EHT TA REDAEH EHT( SSERDDA
2,421,612,682 *FFE578D10915B91E8F74128F5570E80256386058 d9%fw
2,421,612,683 *FFED57832EC046686B11193B667FCDA087BA0ED5 da/#
2,421,612,684 *FFEE2C54C52D760E16C8366EDE935E9F53C33A3C EDNAKEITH
2,421,612,685 *FFE78625B3DBE26BB75E4E3DC7228B326459FAF9 dances.with.rabbits
2,421,612,686 *FFE488F8B0D2495A2252EB0E53EA81AEB6D9C238 daniel-brogna
2,421,612,687 *FFE14812D0D5937484E4C9198464E9DCB5052D9B DANNIE.GUASP
2,421,612,688 *FFE8CAA6B99805D97279636FE103E6636136953F efkâriumumiye
2,421,612,689 *FFEF55E39B7CA1E568A6A83AFB7BC3EE16430453 eflky
2,421,612,690 *FFE307D6F21D65A94267C0EB1E04F5CAABE639AD DAOEI
2,421,612,691 *FFEAF14C61F65496749EEFD91454AC4952AD70DD DARRADARRA
2,421,612,692 *FFEB1C9C2CAF7E32A188005C22B03052E1C1B500 david'seveningonwheels
2,421,612,693 *FFE1DDFD5527D608182B36C98E13E91A3157CBC1 ELIZABETH13
2,421,612,694 *FFED9BDA5A46757EBE1525E9FFD44EA55D0B45B9 ddgj
2,421,612,695 *FFE1ACCE492D724A137D0FBD01C7B8169942BB35 ELWOODDILLENBURG
2,421,612,696 *FFEF503CA0BC541FEDBD135E2FFBCC9D5481DC23 elwoodloffler
2,421,612,697 *FFEB74375152915C8D0E7120380A87AD2BF974A1 DECIDUATE2
2,421,612,698 *FFEDBA29293F8F691E078BF0AB38F55023077495 en7514220125x2
2,421,612,699 *FFEB3F05386BBEB76CACF41EE495F4DAEA8F9E89 ENCHUEQUE8
2,421,612,700 *FFE4DC6BC00686763B7A3AE43CC567996C4A9A1A enfqvofy4
2,421,612,701 *FFEEED65890B278E01BFBADDF49E400287869842 DELISTSES6
2,421,612,702 *FFE368FC142AD6C2816A6446B4C3957773495687 DEMAQUIL5
2,421,612,703 *FFEB15B21CE778B55BABC1EA67FCB257CFA98A23 ENTEHREN/DIOXY
2,421,612,704 *FFEA5887971BB763BBEBC08532B70694285ED162 DESHAWN963
2,421,612,705 *FFE81317F44FB603995C076AD1A0D7785F946B7D deshawngodkin
2,421,612,706 *FFE29DCB280005761FC8A5F071250C1210068731 [email protected]
2,421,612,707 *FFEDDF942C82F0AA4D66333496F9C748BF5BF798 [email protected]
2,421,612,708 *FFEE8CFB5ABB78A0DB7C73EB58ED5E1CB349775B detaillais3
2,421,612,709 *FFE8A0DA5A6DE0977D722669E0A26BF77B992730 DETATIVAC
2,421,612,710 *FFEF6BD6791B2EB96319801480C12B028B8CBD51 DEWITT.BORCHARD
2,421,612,711 *FFE0DE1CB4641AB5EE147B5A989C9932DC85C4E2 DF%(8
2,421,612,712 *FFEEFE7AA402C90345C5F666F2C1F74B823DCCEF ESTABLISH1922
2,421,612,713 *FFED2F709D8074B718180E29684790D24773AC2A dgr
2,421,612,714 *FFEAD6394EF73566AE64431E8587A3F3E6B56B49 dh)6:
2,421,612,715 *FFE10E13827998ABA93401B7489E27BB6813D4AD DHAPPENED
2,421,612,716 *FFE79F40026BF43BDD0F04831C92FB2AC3248E7A ethnikēs
2,421,612,717 *FFEB807FA1271E00A5C366AC9875A8F8FF629628 [email protected]
2,421,612,718 *FFECF994B3960404792D1BF31D15DBDE68D5A9DC EUW15
2,421,612,719 *FFEE735A0882487B98C549391DB0AD0556CA4005 EVG76AB
2,421,612,720 *FFE7820331ED142BBB6D06CB6C50037EA721C229 d+im"
2,421,612,721 *FFEF6BC3F50A93052B62C4FC0246132096470144 dimm
2,421,612,722 *FFEAE0B0597D8E37B7B559F30B603FEA72EC41D0 DINONUARA
2,421,612,723 *FFE4675B8A013453FF05CFA2ACED8DA03A6E9329 DIREKTSCHU
2,421,612,724 *FFE5D79C83A0824F45D21386C9E396F30CC7E656 ey-yr
2,421,612,725 *FFEDB5A72A538F82125B98A3A3A39DC900230624 EZEKIEL.BASEY
2,421,612,726 *FFE7BBC0A312692C9FBECE28D9B7BE51E0C76CA8 EZEQUIELFLATTEN
2,421,612,727 *FFE364D38C581D0B7843EC159DA41F2428A28367 ditp_
2,421,612,728 *FFE416E9D0AD34AFF5254708E3B4265977807FC9 [email protected]
2,421,612,729 *FFEBF90646FA88C13FDB35DFC7F40F6C8FD51739 dleguetebbing
2,421,612,730 *FFE8B3BA34C2A2690BC1F3B89C7527DEAD4B1CA6 federcasalinghe
2,421,612,731 *FFEAB9B09F88A10614BEE8B22C1783E155C051F3 [email protected]
2,421,612,732 *FFE119199960993E5658D417626A0774341A22A1 FERRYMV
2,421,612,733 *FFE7147AB537E75621DC7D88F036D1799761E229 fesfgyep
2,421,612,734 *FFE280E0F7963A744321EA5244CB0CC3A84C2E26 dnnnl
2,421,612,735 *FFEA616B828DE95AB056DA8C7238E733016E1E1D D:.OE
2,421,612,736 *FFEE306483AE43E3A71FF2E065504976D1466AAB DOMENIC.CADIZ
2,421,612,737 *FFEFAFAD402F6114FB3E2125D68EB02FFDD00FD2 FLORECIT
2,421,612,738 *FFE33360D507BC6A79447D408A79DF70A43C89D6 donlindner
2,421,612,739 *FFE864F63FDF7888081BA8DBFE2206A10A7B2740 dopqg
2,421,612,740 *FFE464A799D9BE8278202DC90B22695342DA7940 fpkg
2,421,612,741 *FFE02AD60E2FD5CD985443FF511512FC1F38C144 FRANKIEBORGHI
2,421,612,742 *FFECC4663C47A9E43F3B75DE2F22FD08C4570BE1 FRANKIEKOREY
2,421,612,743 *FFE4F044B063555A423A5A29AEC344E62FFEB8DB DPQ9.
2,421,612,744 *FFE4A7F526639698CAB5708C7C7F19EDAB83EBAF dr8kn
2,421,612,745 *FFE0DDD0C8FD130123FF17C10B15B91121093594 free.namibia
2,421,612,746 *FFE0BD327D0B6FE07693E416AF1510A561B61C21 DR$W
2,421,612,747 *FFE9782745CAD4DBD46DF94581509D24F16AFA92 DT(=;
2,421,612,748 *FFEF18F1CD6426A0F0230FC902655ADB08A79D48 »GANGL
2,421,612,749 *FFEFD98AF074BC8D003645FEF7CB6222413BC592 garfieldkusterer
2,421,612,750 *FFEBC0DD4FD37DFB127AD35DBFE5ED2C83A83E0A gastonsoman
2,421,612,751 *FFE026133AE6F516C29527899A2B6C20DCC26139 GASTONVENDITTI
2,421,612,752 *FFECF375D871CACE417431B4A9CEB32DC69B8738 DUQAW
2,421,612,753 *FFEB6C14C2DF94D0152DB3064F48BC1E912AC827 d#uua
2,421,612,754 *FFE6CEFF72174E07480376BE799D96AFF7755751 DWAYNE.SHORTER
2,421,612,755 *FFE4DE3D31D1D4FE0344D038C4C2A247ABE11D2C GEORGETTE-HUNTER
2,421,612,756 *FFECA1A1859F7C8DA64CBDB883C5ABA2879B4A0A D,W(N
2,421,612,757 *FFE12AE3ACC95221CF772BCBCAE435C640A0A48D DX;US
2,421,612,758 *FFEAFD49ECD92211BB2A6DBCD721F4AB7E7133C1 gideonhaasbroek
2,421,612,759 *FFE15C0B9C9BB8B686EF288B3C8C5695ADD8FFEC eai4u
2,421,612,760 *FFEC2567FB797C608201CAD9D1630E104C6ED58E eccitavi!
2,421,612,761 *FFE506D81782BD8557221D3BC56736C78D0CFAF3 ecorneronts
2,421,612,762 *FFE88A1B906907F3BC983E1EC069EB544E874241 EDITGTSELECTGTNONE
2,421,612,763 *FFE4618388B7FE72D2059C89FFB9F9205E8099AD GOOUTDOORS.ORG.UK
2,421,612,764 *FFE5AA2C7DFA4E3AA1D1A0C428188BC77BB2E79E edospahrs
2,421,612,765 *FFEBE964F2BDF17F94A5FAB4758B50753AFAE67A EDWIN-ELIAS
2,421,612,766 *FFEE413785E4E54EBAA06318A0332D3DCB173D32 edzmg
2,421,612,767 *FFEDD4A1B0A89AB1768AD72596CF5BD32C93B3FC EE49
2,421,612,768 *FFE26B228192035F1134209E12D0DE1F87659714 GRANDMA.WILLIE'S.YARD
2,421,612,769 *FFE2E9C0CAA165A613B74416D88780557855C822 GRATEUL3
2,421,612,770 *FFEDDBF04A4D368C703118F97FE1583C644230FB efgng
2,421,612,771 *FFE5065B604FE6F8F8241C8F1B898C158BB49AA6 GREGORYMONDOUX
2,421,612,772 *FFEE18FE1EB5A5E7968E1BDF69E1B4C53E683C89 grogneraients
2,421,612,773 *FFEBA8638866BCCBC155ECB4AAEEDD157C9F7DAC eh(im
2,421,612,774 *FFEBD93B596053DF70C3FC64FCA58A159739320E [email protected]
2,421,612,775 *FFE5D8340DA87C7E9B4F62797A9476E730208E37 ha+em0ngerng
2,421,612,776 *FFE6BE017FE9D1EBDFF96AAACCEE7BA9948CE785 eli-rrepetto
2,421,612,777 *FFEF965659B3B54A2FFE0B4DC802CB545E27F115 HAISOKU4
2,421,612,778 *FFE1036240EE8C9AF2D9A23EB54D0C9909368763 ELLSWORTHSTEFANO
2,421,612,779 *FFEAB9184421264BBAE3A4DBABEFA32C2E6CF2F4 ELVISLIEVSAY
2,421,612,780 *FFE79411C91B4CDFA820CEC9D9A969D049C02689 embaraces9
2,421,612,781 *FFED9E3A3CA8170A44446BBACBE3494457512F21 harleylotto
2,421,612,782 *FFE9D098B6073BB9484AFD34EC191488BD558965 HARLEY.PLATTNER
2,421,612,783 *FFEF60EC7AEAFFDB60A5B941BEDB5EEF1F9356F4 EMILDEVAULT
2,421,612,784 *FFED6D132FA64998E3999F9ED1067BD48B378296 EMILIOPIERETTI
2,421,612,785 *FFEE9017B679C188B83B36956E9B4E131A167BC7 Haru-da-mono!
2,421,612,786 *FFE5CF1E2650FF892295F98103D877E6C7112F47 emilystanek
2,421,612,787 *FFE8E336B26BAD0E43EEAE3A2858E5CE72F9910C EMORY.SKIDGEL
2,421,612,788 *FFE8E7828DB7D7BC501B593E79987C700D6968D1 EMPOTES6
2,421,612,789 *FFE1BB9808B1E83CE9E0E4FE66737FC0E39656C1 enchorial3
2,421,612,790 *FFE4CEBE172335873405950E4B14FB3E4CC03521 ENGINE1913
2,421,612,791 *FFE216BB3CB0127356B70F5BCBE0DF92235D6567 entbrannt8
2,421,612,792 *FFEF028AE8521E347EBA4091855E472CB6DE15D1 envouteras2
2,421,612,793 *FFE6D861AE74E8119BBC453A06B98A5F5062B41D HERBRHOADES
2,421,612,794 *FFE92964022EADC43D9BDF3B89C5FB50212A2293 HEREARETHEPETS
2,421,612,795 *FFE6CD59583F4B98604D876BD1B92303E27CDDBC eo#a2
2,421,612,796 *FFE26AF10321CF1BB108F46EE077475575C192DD EPN2G
2,421,612,797 *FFE04658F188C0613E47730CF44BF0481ED2E451 HILDARIOS
2,421,612,798 *FFE46744254B6947B77150750D7F2DD3C896D98C erasmolathem
2,421,612,799 *FFEFFD345C28D5231369ADF6BD7156D43D7EC068 ERICH.MORTA
2,421,612,800 *FFE2FF220979E2EDCEDC45AFB7EB30820C7720EE erpsarac7
2,421,612,801 *FFE818BB6AB449B1D4A6798C5A316D9772129A31 ERY(Q
2,421,612,802 *FFE9292F6A48B572DF8EC0DE6D143FC3736A963D ETINEHSO6
2,421,612,803 *FFE225F7C4EB6C6B1A4A16DF6B53D4EAB04BFB3B HRASTULJE
2,421,612,804 *FFED88352521AE0A9BC409916166F8904CD61ECF eventhelittelbirdssingsthekiller'ssongs
2,421,612,805 *FFE2C9AAC47DFF9E52ABC76A38F6D86CDEE0A803 i5m
2,421,612,806 *FFE8C94B4971C2DDF104FDFB9BF0E4DBCD88B125 F0RHUT13T
2,421,612,807 *FFECF670C4374EF878903EB48EB9E148048EA4AB IAMTANNER73
2,421,612,808 *FFE25FEDBDDF3FEFF0EBEDA78B3279220FEDDBBD IAMYELLOWBELT
2,421,612,809 *FFE713B9163C8804CAD89BC8FC4E7C7383B95A29 ib'{
2,421,612,810 *FFEE94B447CAC5B64246C5368028919CC8F6F563 IDAVELLI3
2,421,612,811 *FFE44E11E2FE8F5D4F684240E09748C7AA4D6319 FANTASEID4
2,421,612,812 *FFED06E49A24EC0BC803A5DA23E18B28B1AC6181 IGNACIO.ARENS
2,421,612,813 *FFEBBD363FBD56F4C2EF802C0665AE449F6F484A fb.overall.competition
2,421,612,814 *FFED4A80DD41788E302C6E5F84058CBA5FBDFB9A iguanodectes-spilurus
2,421,612,815 *FFE2823FE11B2BB2D7E092983087DCCF98850CF1 FEDERICOCARTLIDGE
2,421,612,816 *FFE9E6D8A9C4D041353758BC9AE38D8911FE71D1 IJUSTFALLINLOVEAGAINWITHDUSTYSPRINGFIELD
2,421,612,817 *FFEDE89C8ECEB5CE7017C5DA0426C0AE3688B51F ILOVEMONTY88
2,421,612,818 *FFE0E05283BD81E51A8CA5E4BB1E2B9B2FBAD96B ILOVEWILL86
2,421,612,819 *FFE4CA493F6BFE0360534B6898104047D44C2276 iluvapples10
2,421,612,820 *FFE712CA9356046B885650C9BC638D5DC58B1D9D FILL.IN.#2.(FEAT..TEKILATEX)
2,421,612,821 *FFEC3703D76D858F368C78AAD3510D8F5EAFB12B [email protected]
2,421,612,822 *FFEF387029BDA21E48E4F7A9B25E4000FDC648BF FJ2163
2,421,612,823 *FFE343BA97E7E20BCBD43ED09F8DF177A525538B FJ550LN
2,421,612,824 *FFE82E0341E828CDFA9ECA2DE5E260CB24BC9156 INEARTHING1
2,421,612,825 *FFE9B4BBBD8B1AE345D640A7DA8806E0362776AA FORESTBUTERA
2,421,612,826 *FFE96241FC02203439B263633E3413A03EC93629 FOREST.CROFFIE
2,421,612,827 *FFEB2CFC134735A9E0C4FD0B0526744BA5A9FBD6 [email protected]
2,421,612,828 *FFEF221FA8565F53BB6B79AAB5E410D2BD4CEB77 FORWEARIED.IN.THIS.ACTION.OF.SWIFT.SPEED,
2,421,612,829 *FFEC76663741A451F15D7558224775D958C0E0AC FRANGESA1
2,421,612,830 *FFE3746CADD8E5E07A86853CC8E2E4C952EEDA5B isaiahlauckner
2,421,612,831 *FFE45AEBE9C55833C31E689FB1DB1D97B195B9F8 ISTRIANAH
2,421,612,832 *FFE5FED31390B4458A8589BE3A6E2A119359B98F FROMLITTLETHINGS(FEAT.JOHNBUTLER)
2,421,612,833 *FFE9C9A3F6BE3919441E5AE773C7F2349448D137 JACK.SCHUCHAT
2,421,612,834 *FFECA8F79DCCC36AD5454C497D41BA5184462C11 GALEMARY
2,421,612,835 *FFEA383CAD0C8FC963C3761383B865498F980B01 JACOBVANDENBERGH
2,421,612,836 *FFE18374E778A6EFC61315ADB9E5B17EBDC49ED0 GANJTOO3
2,421,612,837 *FFEDBEE2082C9FD6CEE2E3D4D2BBFAACD7FC0137 gaqhebsws
2,421,612,838 *FFE7D7E776FCE4E571EE4738BC9C863D65F62F9C [email protected]
2,421,612,839 *FFEA906DBA5BB7B7CDACB8902B7E72FE4C6BB78B jamarcus855
2,421,612,840 *FFE76C1EBDA6F4B66B45488A732A30C6EBCE836E gasmanabc
2,421,612,841 *FFE328FC869336D576DB32394F3173F76DC4C2FC janhollestelle
2,421,612,842 *FFE72286D9A0DD75DBBD8D1B66E1671E8606EC09 JARMISO
2,421,612,843 *FFEE280BA24E15AF3522F18A67EDF314C537AC47 GELÄNDESCHNITTE
2,421,612,844 *FFE53AE5027EADAC0FB47FC6EF8DED5FBFAA764A gelaunten2
2,421,612,845 *FFE9810D691A5BA7CF3EE427A18808FAFF3E2021 generalschulinspekteur
2,421,612,846 *FFE4E6E3D4C77C430739A427C722FADD9AE7AFB0 JEFFERSON.HENRICH
2,421,612,847 *FFEC8226C101D23ABC1B15E63819971E51C992DE GERRY.GALATI
2,421,612,848 *FFEAE1AFD2FD14C31C37C470E3A3D6556BE603F6 JEFF MONZON
2,421,612,849 *FFE354D0360954590376B6BDF23970A1AFF5C36D GERSTENKORM
2,421,612,850 *FFE38598349E632A755F3711BE3DFF5EFB3162A4 JEFFRYYEAGLEY
2,421,612,851 *FFE37909D33E9E51257B87557E78620D73241DE4 GF<"
2,421,612,852 *FFEFF424DFE79B2A8B4CBE16A5C6BE5E3F08BD4B JEREMIAHKAHALEHOE
2,421,612,853 *FFE7FF794814BC3402E52BF7B66591478A880DBF JEREONE0
2,421,612,854 *FFE9808247BF0099CEFB9220BAE580D52B3A233B JEROLD.LINNEN
2,421,612,855 *FFECFB6B9D3A16D41E99856BBA27B2C71B70DDC9 gilsyers
2,421,612,856 *FFEDD0EF64934C65FA90377FD80C72D43D5AE4E3 jessicamontemayor
2,421,612,857 *FFE5B50BB3C98A427D47DA0C07A11BA28F2F68F5 JESUS.HILMAN
2,421,612,858 *FFE0D33504D48A7873A1C0A4E632A914B33F328F GKNKKBND5
2,421,612,859 *FFEFCB65073B0A77383FE486126F837585FD758F GLAMOR
2,421,612,860 *FFE1B65B9ADF6F0AD13A87BB3CB841D5DE4A6621 JILLIAN.CONNOR
2,421,612,861 *FFEE169B45263F41D4168D944938F0AB820912B7 jimharper
2,421,612,862 *FFE4C4865DFC52CDC1A33253ADB445FA8369D727 [email protected]
2,421,612,863 *FFEC76C143D245BEEE7C9BD62327E0E7851290D9 JOERIGHTING
2,421,612,864 *FFEE03279D15CB22F3B2CECEA104A4F006D898F5 JOINT_SPACE_OPERATIO
2,421,612,865 *FFE6F080DC4DFC80A91B87EBA88A6E9697966EE3 green.bottles.&.teen.models.ep
2,421,612,866 *FFE4BCAC761BA6DB51E0DA35D7B15B04648E251E JORDON.CALVERLEY
2,421,612,867 *FFEF8F888B2C6756E9C158581AE59EBA19195BCE JOSEF.HYNEK
2,421,612,868 *FFE9C37B7540F85C2D406B166D606B1A9FB3806F GRINGOLOCA
2,421,612,869 *FFE4FB89E8E44892A9F43215A61D11DF3B7DB623 JOSIAHGILBERTI
2,421,612,870 *FFE745D6FC06457291F97B8DB648E5729C4F25B6 GTELLUS
2,421,612,871 *FFE99F5725D19591800612F720517757FA452EE4 guadalupefrankenfeld
2,421,612,872 *FFEB196D9724BE86C241E6389FB5C34EEAF34A80 [email protected]
2,421,612,873 *FFE42BC3099F2FD7A9546DA4AF3060A37D1DACB0 [email protected]
2,421,612,874 *FFE633A38D6A263CEE0051A0C21E2AAEE32EF601 GUILLERMOWISHON
2,421,612,875 *FFEAC1B823192869DD09AAC086FD85C24526B1B9 [email protected]
2,421,612,876 *FFE036EE6AEF1A0A3ECAEB7D3D06F7DD9EFACE82 [email protected]
2,421,612,877 *FFE6C447819948970237821CC5EE6DC9281DE579 GUSTAVO.BICKING
2,421,612,878 *FFE718321593304B1B80A67CF54C820FCF959A6E K7LH
2,421,612,879 *FFE43356115A57DBBD3BC1F76798E29710948457 [email protected]
2,421,612,880 *FFE2AB7EF583ECC7B25F530921F99600A357B1EA KARSTWASSERSTAND
2,421,612,881 *FFEFD77444933D077293CE5563163A8A5CECF103 havealegtostandon
2,421,612,882 *FFE944ED9474ABCE4D481B7C0E768C20BF43B73B [email protected]
2,421,612,883 *FFE6FAFDCA6BE8B775CB6BC5E417E2F18F0B682A [email protected]
2,421,612,884 *FFE49FCC89E548015B0035092D410629D27D1171 kellyloter
2,421,612,885 *FFE3227886ACBE189576A2D3B87548E15B441DF7 KELSEYCRONIN
2,421,612,886 *FFE9924C13808C3706E392DFB4628BC3C7347E39 hempsmou2
2,421,612,887 *FFEAF2ABB1FDBB738F2ADEC7B5231EDE88AB1553 HERSCHEL.BEJARANO
2,421,612,888 *FFEB6A43C2A7B21D1D3138ACC69C35E55172353A higher,part2
2,421,612,889 *FFEF6307C813F26FA0FE88FB23066452A0FA705A KIMBERLY-MOSCHELL
2,421,612,890 *FFE933501975D1DF629DF3992C1AF1AE67350044 hipolitowachter
2,421,612,891 *FFE9F386350993635CA055B557B862F3F25EF165 HLANITH
2,421,612,892 *FFEE9898A9A7E2E2C88E16331FD0DBCA389C10D0 kolberg12
2,421,612,893 *FFE4468A6AA6653239AAF447A81D06EA3DE07506 korresponéirende
2,421,612,894 *FFEA1D4E097C754C304B1ECDAE47FA51E85D0052 HOWRELY6
2,421,612,895 *FFE6D93234634FF635EA264B658AA0BD3A06D416 [email protected]
2,421,612,896 *FFED33667CB3BDE62370D79D7A90E9A12D098A90 ksm731640
2,421,612,897 *FFEAE18129761AD359BE328218322A80F05A57E1 KTHMATAGORA
2,421,612,898 *FFE0CED7DA8069E44E00E2EDDECFE8E8B78E1018 ;HY/D
2,421,612,899 *FFEF6AB0C3587B9137686AA55604B6B17B9B3E6E KYOSAHNIM
2,421,612,900 *FFE20E99976AA0C51D47C7B78C16D8D983AAA3CC [email protected]
2,421,612,901 *FFE8C1FF406657075C8CE1B428C74A562DEB906F iampolo1997
2,421,612,902 *FFEAE7ED95AA549AE10E60811670B961947A473E LAMARMULDER
2,421,612,903 *FFEA275BAE11AF30CE12F6EFAB4AE7375BF4EF77 Ichi,Ni,San,Shi,Go
2,421,612,904 *FFE56E815A8A58E49B9DE07FE8DC30246D8A2B99 [email protected]
2,421,612,905 *FFE8095F7C433991303C3A2545BE60117A79FE19 lannybillington
2,421,612,906 *FFE36C401FB52B208AC30811C9FF98F35E42A2E1 latooka
2,421,612,907 *FFE2BF874BF1455EB4C4A06F7DFE767E0B2ED3B3 [email protected]
2,421,612,908 *FFE5DEBD7102EA5884D9D122A35CBCED44DB42B5 IKHACHEVS
2,421,612,909 *FFE74592F32CA3267BCC187F500705C62EEDA382 LAYLA HUGHES
2,421,612,910 *FFE6A2A2D1BB967CB58692BEC6269C9F6AD5F096 LE6OO
2,421,612,911 *FFE1CAECAD23356076D7DAC73E645B07D7528912 LEFTALLALONEAGAINBLUES
2,421,612,912 *FFE5433AC0B7A2BBE6DAA4963FF6C8804EE58C9F ILUVWANKER63
2,421,612,913 *FFE688CB2A7AD7C8500CD35183E920B688477150 IMACLE12
2,421,612,914 *FFE5C2BFD30F141F49C1296BC48D6A11914E9EDF LENNYWIKER
2,421,612,915 *FFED281F6EBD1449176A42D2DBA639DDEC994CBB LEONARD.DRAYER
2,421,612,916 *FFE64169788EB23B1F67CA7C7129A181EA605F38 leonardsprau
2,421,612,917 *FFE594EAC1D03E92DFA946C199805091DDFF02BB leonelsinisi
2,421,612,918 *FFE0A0388F34693DBFADEBF5CA66E8B01CFF5747 INDFANG3
2,421,612,919 *FFEB92283209E7862BA2ACF3D474C99A113D1C24 INGNZ
2,421,612,920 *FFE7B73BEF3D8538671C55A78772E0056936E1B5 LGE+
2,421,612,921 *FFEE2F86812B4C15B8104D410E79BF697C751660 intersystem.
2,421,612,922 *FFECCF364E75B610114AB54E59F663DDD9CFDDDA LIBRETDODO
2,421,612,923 *FFECD4E3E0F9D638C4437D07A655A21BB840CABE LIGHT MY FIRE (CAPPELLA RAF ZONE REMIX EDIT) (FEAT CARL FANINI)
2,421,612,924 *FFE49B6AD0BF639E11ADADE8048B68D07B1E862D IRVINGPAGON
2,421,612,925 *FFE663773DD68445885B8ADF507DD2FC6FFB330E IRWINRICHTER
2,421,612,926 *FFE03E9D6D75164022E0F714D320C6F2570A3C70 ISKETTY5
2,421,612,927 *FFEAB6FA84E7FC26F07B7E141FA7EA3498579A1B LINWOODPFEIFF
2,421,612,928 *FFE45F2921AB6C902F19B275CF32DD0F20A4C7E3 issederc1
2,421,612,929 *FFEA55963F8255DD92957963342E2433A31A0B91 livingonawaterfall
2,421,612,930 *FFE9B5F5CE44A854C2E6B6B65EA40C84C77A0832 J107531
2,421,612,931 *FFE19E728A02330D0B6FDC2EC14BE69FC185DAB3 [email protected]
2,421,612,932 *FFE9B4AE9C342F49A45FF96342075DBF90CC3387 LOADED TENSION 2
2,421,612,933 *FFE4370791ADFB70A817542335C054E8AEA5088D JackyMolard's/TheHunter'sPurse
2,421,612,934 *FFE4A78D82BA20923A8D28B6997C250B11D92106 LongSlowRide
2,421,612,935 *FFE5E88A3DDF134C1DCB226FBA676C4AFF815813 LOOKFAR76
2,421,612,936 *FFE6C52450C977209C9CC2621FAA8B4A8541F0BF jake': uncle fucking bullyuncle fucking bully!
2,421,612,937 *FFEEBFAA6A1D51BD5B09193B90C0502EEE5C87F4 JAMES.POLICZ
2,421,612,938 *FFE871B24850DA1187077C981AE8A6C53EE01A75 LOU.DITTI
2,421,612,939 *FFE90E75827461E9B47B9EA984C3F3393A2EC825 LOUIS NARDONE
2,421,612,940 *FFE45DBA4BC9381FB3DF1E7855D9F8CBC455AA7E LOUISRIDGE
2,421,612,941 *FFE5EF3CF3A6999D12C847614B5CFDF7B69017C1 LOU.SOLTERO
2,421,612,942 *FFE05A74442DF363821994DDB3ECC67DC17BCFFF JAN.BIAFORE
2,421,612,943 *FFE2F43DB87C9673760E4000010B6AB53F3A52D2 JARRETT.SELCA
2,421,612,944 *FFE475A597EA7483E86ADEF1BB1CB802A28EDBD7 [email protected]
2,421,612,945 *FFE89CCC44E53F44756F580ABF88E86333FA71CC lucashalloway
2,421,612,946 *FFE79BE55B12A7F2E23B09670FF71F698D807E01 JAY.ELSTNER
2,421,612,947 *FFE6540F64FC799D0A2336BDC2F19B9633D9D0A6 LUCIOMOULTRIE
2,421,612,948 *FFE79D4327E9793AADAF47B9D4BF6DE9A0CA5DA8 LUENTOSALIENSA
2,421,612,949 *FFE71BA9B94AC7366204EBF0E32628892BA33258 LUTHER.PELLEGRINI
2,421,612,950 *FFEAB1270CED70EC6B6078F4EC8896F8197AD597 lx?i
2,421,612,951 *FFE0586CCFF5127B34BF7795108FB538348DD732 [email protected]
2,421,612,952 *FFE992C2546FFBA0955F5579E750DDC62B797A38 jeraldliskiewicz
2,421,612,953 *FFE37670ABD1520C9B7656E92D0D4948935BCBD7 LYONLYONS
2,421,612,954 *FFE5C2E912A2295DC4AE67ADB8EFBA1920B2594A JERRELLHANBY
2,421,612,955 *FFE0B97B9162D29B1595F95AFF40A76E45E49B83 JERRELLYERBY
2,421,612,956 *FFEB5A6E729C287F4CAFF36F93DCAB8315B731A8 JERRY.CHOINIERE
2,421,612,957 *FFE1F6DB4372D25875278523B816F29145DB718A M1H43L4M4R1454NDU
2,421,612,958 *FFE2793BAA94889CC2B096BCEF216B56B7EB0233 M4SN4VI
2,421,612,959 *FFE1B9132FEA1651A3E80EA92E218469D650B185 M64390
2,421,612,960 *FFE7BFC19AFE335F9A65FAE045C01FA77AB24AEC (j)g
2,421,612,961 *FFEC20635F58A77CDE6B2AEA1F884451C3585F7D MACKENZIE.FULTON
2,421,612,962 *FFE0E6CD759511AAC730788F141D51E209984D50 [email protected]
2,421,612,963 *FFE718E2BCEDD06794A569006C1AF62F73CE0759 MADOR
2,421,612,964 *FFEAC4AAB0D66D71D9CB687CBEB27CFA18B0CC11 JIMMIEHENTZ
2,421,612,965 *FFE8BCC6269AC9725A2D21F26580964BC44430A7 JJ-NO
2,421,612,966 *FFE62F83BE309E33BAFCB521BC02A0921E99BF94 MALEFYCES
2,421,612,967 *FFEDCF736BB1BF926A1512B8539D61C9EC70721F jockeyjailedoverbettingscandal
2,421,612,968 *FFE1C315FFA863B4D3B72E6F0E0A24E85567DFCF JODICORCORAN
2,421,612,969 *FFE5E54A16F19167472136096024CA0C1C3822B2 joefnagel
2,421,612,970 *FFE9DC1A193E49AB5F6F21062B3F3771A4C3772D man-ir-skumji-mazliet
2,421,612,971 *FFED521A63DA4BA5A9ACA9ADD669F8C878165BB0 JOE THOMAAS
2,421,612,972 *FFE745E19C7B807DE9DAF8E456E44CBB64DAE1DB johnalletto
2,421,612,973 *FFE078BDFC921730D560FFAF58FAC5848C54B251 MARCONOUTH
2,421,612,974 *FFEF5C72141F62EC4E00D83B16B2B7F3AC0F1B9B MARCORIZK
2,421,612,975 *FFECF6EFDE27071E4E1852C76514B7F5EACA9B20 joni.lambert
2,421,612,976 *FFED44E01737766CFF8AC21E21CB39A8F32990EB JONJAMESW
2,421,612,977 *FFE4DB1C21974E636859D82DEA4D187C862DA34F JORGELOVATO
2,421,612,978 *FFE5FFEF560B89CB6665AB89B98C40312C6969D7 marilouabad
2,421,612,979 *FFE0AF81FD23AC878174142BD851CF4A09CEE541 MARLEENRIVERA
2,421,612,980 *FFE76F423DC7C44CAA6818923BBEE9A082BA8296 marlinzukowski
2,421,612,981 *FFEBEADDD4206F3D3AC0DE7C8A1BD31624202CC6 marshcothwww
2,421,612,982 *FFEF57DEAA7AE1ABD0897D53FC12DC0D7FC9E6D1 MARTINFINNIS
2,421,612,983 *FFECF97D5BE79225F304B08222C87BB9F9ECE6C9 [email protected]
2,421,612,984 *FFE0896137E79C0EFB173F45740D0DC750AF2178 mary-g
2,421,612,985 *FFEBE42F2935FACC36A0E483214300DD1A74F7EF MASS.MOTION
2,421,612,986 *FFE97E3B080B76C0F6FC701D916A464FCE27C107 mathewmundinger
2,421,612,987 *FFE3017DDDA88743E2B898A24E5C9B479B3FCFA5 maxim-valentin
2,421,612,988 *FFE2DC00AAD99B056D6053FE903EA37A33012CE3 k]6$
2,421,612,989 *FFEB0946CD9ED07970D6598651DA92A2F25B5B7F KAURISMELLE
2,421,612,990 *FFE71A97658BE8F16A8177DE51F5EA894F20C328 KEITH.MCCALANAHAN
2,421,612,991 *FFE9EC54A4F9E4048FF662161480EAE7AA3E7BF1 MICHEL.BRIX
2,421,612,992 *FFE9DF2A98A3F92028C7354136C7C04555FFA150 MIKE.APPLEMAN
2,421,612,993 *FFEDE587467E552233F8A2F087E52188E80D57AB MILLARD.BLASL
2,421,612,994 *FFEF6CB5ECDD7691D62701285A5A7E9069AF9DD8 minomusi8
2,421,612,995 *FFEDDB142A1B3A9D38D5412EAE219DB6ED54B136 MLEFTER160TALK160
2,421,612,996 *FFEFB2DAC566F3A1A693342228B4331C4586455F MOEHNIA
2,421,612,997 *FFE8D0A711FB5BCFF5823106E7A7D1DA2C95F6D5 KOPALIŃSKIEGO
2,421,612,998 *FFE75145E41E2037436043466C82337031FABE7D KOREYARRE
2,421,612,999 *FFE1C303531003838E2B3DC3D1AE8DD14DFE5845 MOHAMMADMOSSEL
2,421,613,000 *FFE3AA188B295598FCDC69AA304D26B043D8333C KOSOVO
2,421,613,001 *FFE9DCFEF2333110AD4410E728CC89117DBEC65F KRIS.BARNEY
2,421,613,002 *FFE52D356F0F13812DE757C004160D864BFB431B monroegaultney
2,421,613,003 *FFE593D0ABA0186B30AAA230F68041E3E2248F4F kristen.feller
2,421,613,004 *FFEA7CEBB6F7B173BC152234C3CEC93C99700EE2 montana-king
2,421,613,005 *FFE929A9363D328626788A9FB58CE6EEF81C6612 [email protected]
2,421,613,006 *FFE8E83878368FCCA5EE15225C37718DA7613704 K[U4
2,421,613,007 *FFE2B2F3D377F5BA3F771C82A0697A3320EFD263 KURT.FORTMANN
2,421,613,008 *FFEA3A985969E5FE5D022C1FC99DC7F23E7C495E MOSSO.-ALLEGRO-MODERATO
2,421,613,009 *FFE9A6DFE37F025F00D0DAA0DCE3B3E3D32BB0EC KURT WAANANEN
2,421,613,010 *FFED99000AB93DB1171E294AC5FEEDF0D60063A9 KÜTNER
2,421,613,011 *FFE146E62BA0723946B48AAEF12BC54FB2178540 [email protected]
2,421,613,012 *FFE399398BC41ACDFB3CE05130471FB532569387 MPRACTCA1TY
2,421,613,013 *FFEAC56753BAF76A3AD315D7550ADF34D56B696E kyle-chevalier
2,421,613,014 *FFE788B1EC6A5D81C10C41EA197BC27744AAE1F2 [email protected]
2,421,613,015 *FFE2A8405F02893355728DECBD24714F51149D9F MSWW
2,421,613,016 *FFE8FA48B6069AC273C06B74213C419F26EB331E [email protected]
2,421,613,017 *FFEB4FFF93B2D95A81AE8DD50E29B65A357DA391 LAVERNE.CHAILLE
2,421,613,018 *FFE1AFD2F47721B2E057C4740B5537B227D3A74B N4TUURK3NN15
2,421,613,019 *FFE27FD3ECEDA8D45198DA32A3C145D97D00F153 naerokn
2,421,613,020 *FFE4260762D21D117A2E715F391A012827520074 [email protected]
2,421,613,021 *FFE58F39CB17E39289F4FBDB91840556FC1134BB NATHALIE.SHANK
2,421,613,022 *FFE2D4C5FBD1082DBF97B734F10AD2924C5A78AD NATHANAELMCCOMBIE
2,421,613,023 *FFE484F1BE51C8CF0BB525CAB8D1BF5C0F3016B1 N-BOTANICO-DE-LA-VILLA-THURET
2,421,613,024 *FFEFBC6DAA93B06DBD5D46579D9EF46F1F837635 nedosegnutim
2,421,613,025 *FFEF41A9D3D3169E78F5CB59A5B2A02287F63BAB nelagodno
2,421,613,026 *FFED512F34B8ACD0DBC8F67B6A3B731A11220FDB nerezervuje
2,421,613,027 *FFEFBB352E888DC53B1B6F606E39138B793E27AC linearere
2,421,613,028 *FFE68FD135F3BBAFDC2094C9F86ABB4D81650793 LISA.TONE
2,421,613,029 *FFE5BE30479FF649E713B42D04FBE059873F3BDB NIEDERSACHSENTEAM
2,421,613,030 *FFEA56528AD96E424584666FBED64084D1E71FF7 [email protected]
2,421,613,031 *FFEEA165B921D95D51B855BFFE777CD6DB77C2E6 NIKKI.DIORIO
2,421,613,032 *FFE5C096E9CADDFB47D9F278A0080B2F1FB28744 LIZLOCKHART
2,421,613,033 *FFE808A8389921D5DC42313FF33EADC88B355A83 LKYWOLF
2,421,613,034 *FFE670983C308CE68D012A51A191FE0F50C68487 nlf:
2,421,613,035 *FFEAA636B254B192B3217EA1F27E9288EA882609 longtimesincethelasttime
2,421,613,036 *FFE55E3D13AC6BF10C94E83AD3A65449E5D0D669 nonsensealexpu
2,421,613,037 *FFE4CAB100FF4500951F9BD64779F6B2531DFB08 [email protected]
2,421,613,038 *FFE1EC9F03C1FCC6B6196A906C256FFE33DA53FA NORINORIED
2,421,613,039 *FFE65093002D5F874151512BB1CB32C35CE98B40 LOU.VOTAUA
2,421,613,040 *FFE0D2E2128EE97DED9CF7F4FD09AE0B176DBCDC normanhrna
2,421,613,041 *FFEE3B79B368FD31BBE547C6612A2209B2533EB0 NOTAGNES
2,421,613,042 *FFEDF849C5EF5ECD20CE01BDA3F2D3321D96257B now 3
2,421,613,043 *FFE70172A9927DEDC2E3EB2D9DCB8FF6A0BDE060 NU]
2,421,613,044 *FFE5EED902A31B3A73AF28DAC2F792E009FF2AD3 LUIGI.RAUCHWERGER
2,421,613,045 *FFE24A1D197CAC7083B69E52317C0FC42E53A27A nuno-richlasner
2,421,613,046 *FFE91C1CE899A732C550B1BB96DE8783862A90FB LVMHWATCHANDJEWELLERY.TKLVMHWATCHANDJEWELLERY
2,421,613,047 *FFE06AE03C075B557AD9CE7D7894B8D16900D7A7 [email protected]
2,421,613,048 *FFEA4696B63993CD43F22773ACD6EFB1631E6134 oaxaca05
2,421,613,049 *FFE98CE8F5E3F17E0F40CBB91D0C571804639DA2 ODESSZÁBÓL
2,421,613,050 *FFE233CB26E300D051F4D44A14E9767999139924 ODNARIGGAR
2,421,613,051 *FFE40A6A8E6C9436415A343520CE035248C1390A old dollar mamie (feat a group chopping weeds with hoes)
2,421,613,052 *FFE072C864E64D1DC988F475707C8D3B07F016E7 OLIGOSACCHARIN
2,421,613,053 *FFE01F21AE134D878523F672A22A6CF93BABB9F9 maliksolton
2,421,613,054 *FFE2E1C62F0A66AF6DBA13A1679D1ECCB851C103 MAL+OBIOS3
2,421,613,055 *FFE0BB4A846CCD2A597CA327DF5FA61807958545 MANDISIMS
2,421,613,056 *FFE8A496D2F10CF45BB8A0E0FBA4991D2A717736 ontgaf0
2,421,613,057 *FFE95374B2B4E2893CEF17A9AD42932DABBD38E5 ;).O~.O~(----8
2,421,613,058 *FFEF122E842486070935693EFB4F3EAE303A74F8 MARCO AU
2,421,613,059 *FFEF659CE43BEF7121808B5B0F139C52A145EE25 OPRUIENS1
2,421,613,060 *FFEC9D4F9A815B226FE20F59DE3450E81F2801F0 [email protected]
2,421,613,061 *FFEDE98D27F9D2F4C4AB2012764E6088C370450D ORLANDO.PETRUSKA
2,421,613,062 *FFE81DED768B86F93D8173ACCD2C3CB2D4A57041 markpilarz
2,421,613,063 *FFE5A989DD51B0AFD85FF7CFD753AD1979165857 markwiltse
2,421,613,064 *FFE9A5FE67922DB801C329FC95AE8C1E182FEA54 MARQUIS.TEICHER
2,421,613,065 *FFEC9700646409CA7462110172F6CBE405D75041 MARSHALLLETMAN
2,421,613,066 *FFE359CBF5FD8F8C7E9DDFCFE4FEA27F7D2BBCFA OTISGILLET
2,421,613,067 *FFEBE3EA4C454F5B2100298F9BA014310FF206AC MARTINA SAINZ
2,421,613,068 *FFEBCD99B434D9B4F2A702C3AAA1FA24B49C9688 OTTODRONE
2,421,613,069 *FFE0ED035535B30282E49ED5B55A30868D33D3CA OUTVILLAIN3
2,421,613,070 *FFED0ADFC29E8740C7B2199B7CF85A494DE77E50 mary.luce
2,421,613,071 *FFEDFF516EAD3B7A35E916FEA45B5997A92209F1 p0lyw0g82
2,421,613,072 *FFE86CA053ABA61B10F5804E29F290DF94E93009 PADIATH2
2,421,613,073 *FFE945DB50BD1853DDA78B40B5906E3C3F093389 pained3
2,421,613,074 *FFED6E45F84DC71E2556E132146246703F4DF578 PAPHANUS6
2,421,613,075 *FFEAF82B69487D6B8D94393F610E1C3A4AE3BA35 MERHAUTEM
2,421,613,076 *FFE0CE2A3D145C26E2A091D7990AE7581FA697E0 merkaptamín
2,421,613,077 *FFE60D21515525FB4F1EF2CB202B038CFCFCD32D PAULGILANI
2,421,613,078 *FFED7F8530BC4F60665BABBEE7261ED0953787BC pb.`)0(
2,421,613,079 *FFEC772EF9B51A736D7C6142EABB2086F2A8FC6A michealharjo
2,421,613,080 *FFECF2A84D59B950B19977C05C39BB597B92B4A9 MIDDLE-MANAGERS
2,421,613,081 *FFEF11D95B47FE7F9DB15BC413C24F6A5225FEFC PENS INSTRUMENTS-FOR-WRITING-WITH-INK
2,421,613,082 *FFE0F0FAC239BCC1D2A8F7B2702CD594300E20E0 MILANSZYMANSKY
2,421,613,083 *FFE26EA7263F01E225774931EFCA5DBEF0BAC674 [email protected]
2,421,613,084 *FFEA32C9C1B0139CD0A79E43EB8838221D960097 PERRYKNIERIEM
2,421,613,085 *FFE0704FB3B23167745FADB2FDF5AF2A32E7706B perryvanhamlin
2,421,613,086 *FFE7FC8356A1FCFA1A0F04B52E76978596F3A2A4 PFS*
2,421,613,087 *FFEC5C500D9ACD959B972CB7FD3A62FAAD8E971A PH3NO+YP3$
2,421,613,088 *FFE7CFCDF1C45E667CE52FFF6D50C2A0D5A97AD9 mistype-m/i/s't/ai/p
2,421,613,089 *FFEE40039559043C16607C48B52162ADA52420FE philosophy(1)
2,421,613,090 *FFE21F0795D9AFA112644474B0F4713098A0608A MJKJ90
2,421,613,091 *FFE6381C21ACEF3C0D0F59FBA640302A366D21E9 [email protected]
2,421,613,092 *FFEBF0EAA5B8D43DE68C9E0C01F18ED97C49ED9E mon2ya
2,421,613,093 *FFEB8917093519CEB8E844323A8EF48545CBD215 MONTAGUS1
2,421,613,094 *FFE8F092389C0C2EB4964F4FAB900304631CA594 P====>* }O{
2,421,613,095 *FFED1C07B11949BE9C8E2AC52F1581E4B1DBD375 ms14b31n9
2,421,613,096 *FFE4CA69D7BAFE612C4F42C6FFC6783BF553300B portlandrelated
2,421,613,097 *FFE3080BB4FE96614561EBF820CB8D832AF5DA55 MUHAMMEDREZA
2,421,613,098 *FFE7B83BEB02021E88F219D296997F4694F5DAD8 MYSHELLEY25
2,421,613,099 *FFEA162F5B8B6F4646D3C7FF1B781CBC84219599 presen+ab!1!+y
2,421,613,100 *FFED189A7805482FF4145609B9B9B9D43C37A13D PTLUNA66
2,421,613,101 *FFEB93D38C89062A1EF5FBF449CFC0BF19580916 NATURE'SOVER
2,421,613,102 *FFE3F36D495EEE7DE2AC1D18EB4BA067EEE3567C nazionalsoc
2,421,613,103 *FFE703E7DC8BFA245FE83C8738081A98C9D3D992 Pull$wit
2,421,613,104 *FFE89271495D972CE806DB4089011ED72CC06A76 pumpkinpatricia
2,421,613,105 *FFE1C547F9605894D918C5C7E61AB8490913D300 ncc613
2,421,613,106 *FFEC1BD21C15F22B32460BC34DC1E88A287F33F8 nemarcas6
2,421,613,107 *FFEC8E63B573491F3A77B48F0B9AFF0FDD4603C8 neporovnatelne
2,421,613,108 *FFEAF7C060B47EAF94F01F92870DCDA49213209E [email protected]
2,421,613,109 *FFEDA76B0DDAE84F66C2E67EDF4E348E09CA011E nicolasartibee
2,421,613,110 *FFEBAD2978F44B8FF2B297917F8861C5EDBBA953 QUINCIER0
2,421,613,111 *FFEBC967FF1030E62C6918CED7231F6CD011885E quoting5
2,421,613,112 *FFED3C2A7CC9DA3FC4F8DAAF5529C1441DD6500E nobleturke
2,421,613,113 *FFE3D21EC9AD67FA6BE67145C65CFADF7E1A0B99 raaidah8
2,421,613,114 *FFE3C6A31FF188265805244F51D3512B69593A4A RADIACE0
2,421,613,115 *FFE8AF8C8EBDB6C5D83EAAEBACDBC1A3A51DBC26 RALEIGH.DELAMARE
2,421,613,116 *FFEDA1546B969EE227C706CB0D91AE3BB0EB4E90 [email protected]
2,421,613,117 *FFE63E5EC69C5D456F8E591235B1BE780CE22D29 NORMANDNA
2,421,613,118 *FFEBF5DAC354EEC60C0D1123F0A11A293D59190A normat1vene55
2,421,613,119 *FFEB4AA95F459ADB7445CBFEA1299A44AA05718F RANDOLPHOSTERMANN
2,421,613,120 *FFEFB045CD29892B9B51FA03C3C1B150627DD573 randyremak
2,421,613,121 *FFE478876FD34969FF3195FA35A9570079842242 RAVESA
2,421,613,122 *FFEA9ED7F90A5C0FB306EEE924EBA1731394FE46 RAWNATURALBEAUTY.COMWWW
2,421,613,123 *FFE2DC7205F66B77F4AE523379B485196D5CAC09 raymonekstein
2,421,613,124 *FFEEAC314C1046D105572F6F025BF4D490AE1442 NURINNERSOLENOPP(SONGOGHARPE)
2,421,613,125 *FFEA0298D7E01B9771EEB8369043268A9B972189 OCAHE
2,421,613,126 *FFE34D141BC800E9BBA8FACBF97BA391826F2D6A O-DO-ESCURINHO
2,421,613,127 *FFEF2B6DB861884BB740ECCFCF04BC3EF287AA5C REGGATSNALP
2,421,613,128 *FFE69ABA54F1FBBFF3E3EFC2BB7CD682AC7EE3FD o'higgins
2,421,613,129 *FFEB9D4F79193D09CAB35B35A99AA211F6AE9C28 ojkrfjof51
2,421,613,130 *FFEDDAFF77AAA5BA61D601FB172C67686CA476F1 reidverges
2,421,613,131 *FFE788F4C0E384EA20AE8CE68014051EBE1F0912 olliehynek
2,421,613,132 *FFED43352B5B7FB079394BC5D98268C764502EAC on;/
2,421,613,133 *FFE77BD3370FCFB30D40EB5476DCB1645D8CF331 RENNOVATE
2,421,613,134 *FFE3B3B59BFCE6726EC7450BE067A8324DB584CB RESEAUXASSOCIESPOURLA
2,421,613,135 *FFEF0FBC1A5E302BA91CBD213EEC57D5DCD05864 REUBEN.HIRNEISE
2,421,613,136 *FFEEC4AFCA05ABC8731122A8AFDEA372FCC3588F REUPHOLSTERYSES
2,421,613,137 *FFE122EA089D9DD1816FCAACA74F2F61E91C5BEE REVERTERS2
2,421,613,138 *FFE31E5107320309CB5256B80FAEBAD17EC2EA24 RGUNDECH2
2,421,613,139 *FFE4F6BD996B034A5AFF43F8705C51DCC28A2E08 richardgrey
2,421,613,140 *FFECEFE8F045E81D1545C5FA163A8D473D6036C1 —OSVALDO
2,421,613,141 *FFE8527F3BB451E564F35D56229099154E9BD301 RIGOBERTOMYINT
2,421,613,142 *FFED473A4BD533D07ED112B72F99A430237E1153 rigoletto:.atto.ii.."cortigiani,.vil.razza.dannata".(rigoletto)
2,421,613,143 *FFEBCD57374AD8859A18881A2789B426B84D9291 r Klavier No 55 in Bdur, Hob XVI:41: I Allegro
2,421,613,144 *FFE309587862F246F3A0D7DC48B4B153E97406A5 (^_~)**@####P
2,421,613,145 *FFE9E58AC330943421F10D42DFB5963B282E3A06 [email protected]~0.(>_0)
2,421,613,146 *FFE57703358EDD64DA0491FA7BE3B5CA1BC775BA [email protected]
2,421,613,147 *FFE9CEE44B1207CCCBBCA2036BD4CEE05ABB0196 P3$$IMI$7$
2,421,613,148 *FFE405646ED00D370D38CB23A185F8B3B7AECC45 ROBBIE.MONAREZ
2,421,613,149 *FFEC60324834AF75B0FF4D8A9BC12632B0335CC9 P57040829
2,421,613,150 *FFE7F8B884A35698983F397A9283C71C4E3142D2 robertolorino
2,421,613,151 *FFE6025612EF9E6EC5C618D16BE796A1760D5874 PABLOSURBELLA
2,421,613,152 *FFEDEBB9587F61224D921E3C7C2D22E0F1A18928 paceslawici
2,421,613,153 *FFE7B9F0ED3A0B8ED3F62598E3C238ABA8D37928 packardchina
2,421,613,154 *FFECD5AD21DF5AAC5CF0C96672B447C7480F515B palmermanocchia
2,421,613,155 *FFE2B668BF903413A0F68203BA15C7209BC44592 ROCKYBLANSCET
2,421,613,156 *FFE300ED4AFD6B137D47C5095DF0A1AB6230C82C ROCKYTOP(GROOVEGRASSRADIOMIX)
2,421,613,157 *FFEBB84E595CA95F98BDDDA12E91FBD6967501BB RODENTSINLOVE
2,421,613,158 *FFE84DA5E00CD9728B40E503506B8900045E7748 PANKAJ-GOLANI
2,421,613,159 *FFEBDF9BA758647C5F0D3984F046B4448081D7D4 [email protected]
2,421,613,160 *FFE06D561F5F867A9A4CFD88C7E3F6F2C7E55B84 RODNEY.EICHHOLZ
2,421,613,161 *FFEFDEDF6AD5C77D50A18DB70BDD5B5097349DE2 PATPUIATTI
2,421,613,162 *FFEFBF3AEC68FA4235A69EE98A91B8A490FACACA PATRICIATHARP
2,421,613,163 *FFEF8825337ED0F12966AE7FE392030EA1177D66 pbrngngged
2,421,613,164 *FFE2CD8B39589FAFFF9F323B48AB60E365E17D52 ROYHANNAFIN
2,421,613,165 *FFEE6EB61BD0912F39A7FB3F13953F2C7E5F12E6 PERRYBONIFANT
2,421,613,166 *FFE677E4FD2141A454EC665A315D981BBB9F0651 RRITURA
2,421,613,167 *FFE44D0FE674640FD1D4C417E58411B1CA92BEFE RTFUHRTE0
2,421,613,168 *FFE124263A338792C5C6AA363F0A91F779E59A64 RTheme (club dub mix)
2,421,613,169 *FFE12696236AF04608C25E2F2EDBF6FA21B8A03C rudy367
2,421,613,170 *FFE90801B1035ABD1A09E80D7BCAE9B130BC1E70 RUFUS.ANASAGASTI
2,421,613,171 *FFED667E3C45F7754ED03FFE766DB965C2C7D7C3 rugbytoming
2,421,613,172 *FFE233F36DC983D8B24C6BEB748B2E57D11C0592 RUTH-CRYSTAL
2,421,613,173 *FFEC7AB4962E4CC099E86C68764C5A13ECA04427 PIPARETHOMAS
2,421,613,174 *FFE92AC5FA2652057A085A77608932BE7C3267EC PIPELINESOLUFORCE
2,421,613,175 *FFEDC08D2B62EFE126B74BE4BBDD9E893F5D3281 RYAN KEARBEY
2,421,613,176 *FFE1EC51E38A4E4B3A14AE54490344825C9F3B27 PIRATEAED
2,421,613,177 *FFE79258F9C7D4B6899C5B16D80CB4FE83E66C48 [email protected]
2,421,613,178 *FFE08CB15C996567807A48F666DB9F998F65F22D saddlech
2,421,613,179 *FFE74A0B0013BE9863326AD968704C8084F0C2F8 SALICACE0US
2,421,613,180 *FFEDB03B859C376D354FA76DC6B464511B3AD1B1 SALLYNETWARED
2,421,613,181 *FFEF87FEDA3BA92087AF4A7889A15B89A5FDFC60 [email protected]
2,421,613,182 *FFE132C9818777D0CC905E7494C88EB5DF0B992D POPLANE5
2,421,613,183 *FFEFDF49AF8434EB6AAE49B1022E3429213F0FB1 sammiebahlmann
2,421,613,184 *FFECC334F8E4327A4F37D830E1CB9E5AE00D649A porchles3
2,421,613,185 *FFE54D7079CA7C00682176EACEE91102B556C5E0 SANDRASUMMER2
2,421,613,186 *FFE0D52431AF3CCFFA22E6F02D8072D16EE71486 PPLEVEY
2,421,613,187 *FFE8D5FCFD1445FA177B91456FB6EA41673E9E36 [email protected]@[email protected]
2,421,613,188 *FFECEAF5891B5A7C2FC2BFC8379FDEA607BB4339 SCHATTENTECHNIKEN
2,421,613,189 *FFEA19C00927BB88949B44CAD1C633D4CC097426 SCHENELLS
2,421,613,190 *FFE19CA975D5E205003DC74D656FF58CD21A6CFD [email protected]
2,421,613,191 *FFEEA7858460D288A29087F402A1A6F93414294C profonda9
2,421,613,192 *FFEB5720D5D0440D5FE2A7144D1B04C9ABF5661B protectionistischt
2,421,613,193 *FFEC49D29E57C09288DFB7C5543438EE18FC00D0 PROZEHN
2,421,613,194 *FFE1C80C2390E9379F699C822A7CEC6914C0E1A4 scipot decnavdA>"0#lmth42_1codpgp"=FERH A<>IL<
2,421,613,195 *FFE0808B0F10529105BBD86685CA510D55E09825 PSHAZJ
2,421,613,196 *FFE94094F487F22423C7E62D92E3B0D7A42A2A56 PSIGNORELLI
2,421,613,197 *FFE7EC98EB8697DB8850B32D9622AFD69D70DAD0 SCOTTIETHRAPP
2,421,613,198 *FFEA69DDBC24F30CA8F571F6B590EADEA2323443 SCOTTYLLOYDS
2,421,613,199 *FFE06D7E669EFE40F8ABCB7B654049D38B5AF073 PUENTEALTINO
2,421,613,200 *FFEF898BBBDC5C6370B52EA482F6A850FF4FE14A PURITEINSER
2,421,613,201 *FFEBFC5405AE98928AD05ADEEFD183B3AF356372 seeds-may-fall-(feat.-justin-power)
2,421,613,202 *FFEFF969387049FCCA2D777F77B85AE90D8F7B27 SEICAIDEMMI9
2,421,613,203 *FFEE71DE1CB10F3A0F4068E01455C1FCBC585DA7 SEJIRVFRING
2,421,613,204 *FFEA74AC2C89C83DBF4545628519C61423ECE97C [email protected]
2,421,613,205 *FFE33EC7F0496358DCA6D755266CE38986F165F3 SEPTIAN.FIRMANSYAH
2,421,613,206 *FFEC0D2A281814899FD93319522C05F153EAA464 SERENADEFORTENOR,HORN&STRINGS,OP.31:'EPILOGUE
2,421,613,207 *FFE4469A149B29126B52A44F5AC0A615531770D6 q=p ~ ~ (00)
2,421,613,208 *FFE6E2FE38A5616556E4C07E824B8F78804E126E Q######P`~-`~(0-0)
2,421,613,209 *FFE29FB8A992CBF2F08CECB48F991DBAD5010D98 QQWNQXB
2,421,613,210 *FFE0098E3E1406C3BCFB59508B8C4487E85767FE sesummuh2
2,421,613,211 *FFE922CCEB38BAB58FE5162C24A57F70CE704FCC quinncallabrass
2,421,613,212 *FFE306399FEC50258D274F86C3A637B4E082ECFF QUINTINGOTTLEBER
2,421,613,213 *FFE59EE532345BC45E1EF6F4C3D34F417C42EBD1 [email protected]
2,421,613,214 *FFE28BB1FD37F452C0E59A29AB3E84F32F1D58E4 SHADKOSITZKE
2,421,613,215 *FFED3FE24AA56D0FE97D580BE2C7830E8DD5CEB4 shahinian's
2,421,613,216 *FFE9F040E9722E5A71DAC101D96798D504766DF0 r3n39o7147or
2,421,613,217 *FFE7B65DB5D008D0B3BB0F7B3AEDCE9DF27E080B [email protected]
2,421,613,218 *FFEF72ACB3688502CF4510DF0C5BFC7F903FBF26 racegun4
2,421,613,219 *FFECC03D6FB8D1F0883E74CF8F4999848B5B39AA radioplane.ep
2,421,613,220 *FFEA3E053CD7822CB23571EDE6188B52CDFA8826 Sheri.Masti
2,421,613,221 *FFEEE5FC6477D1DB0B7B190D63ADD436E79CA1AF randyjoker
2,421,613,222 *FFE0AE29C6BE9BFB5F9F834F76331BDC33696530 SHIRLEY.YANKOVSKI
2,421,613,223 *FFE76472F6950273CDCC1F96C58F1236989B1F81 ray0608
2,421,613,224 *FFEE932C19C533DA1AA45BB6A79065D62A4BF160 SIERRA KERR
2,421,613,225 *FFE38A822DB3730C979687E1B43036F2FCE5D86E sig551
2,421,613,226 *FFEA0D0C98B38CB8717D9997876EB8C5FA040572 SKREMMES3
2,421,613,227 *FFE537BFE194E3D37789DCC87EEC3300852ACFFE [email protected]
2,421,613,228 *FFE1DB9F2C3FC8841EFA5AA2F006BFCFD9E561A9 slobodyanshchinabor
2,421,613,229 *FFE37826453DB9CA2895D8CC30C0FB5DB1ECE4DD REMOSTOSED
2,421,613,230 *FFED7AC0912054B0120AE17D012366F84CA2D5A3 SMELTERIJEN4
2,421,613,231 *FFE06D33EFAEDC6A232D73FA927260FB843C59CA RESEISMOGRAMED
2,421,613,232 *FFE2C0701090042C33BB2B42291F2F483E534932 SNOOTINHIMER
2,421,613,233 *FFE8C39D6F28D7E02DBD037C4796690241E94E39 RETEMOCI2
2,421,613,234 *FFE844F6DFBDB70BC55F1B7D78F365EBA7664E85 REVROTORED
2,421,613,235 *FFE789E2F690123590105A863B6FBD5465648388 rexveen
2,421,613,236 *FFE2B3F0D4D0961EC07E43B7A4E6FC075F271871 sonata.a.cinque,.no.1.(grave)
2,421,613,237 *FFE6865C66B26E0155AFA521BEA13971FF9C624E RHYTHMIZESES6
2,421,613,238 *FFEEE859256452ECCCA39A83C70C816E73B95C97 RIANTE!
2,421,613,239 *FFE9742783198C2787A197120FC58B356262D0FF RICKYBARRINGER
2,421,613,240 *FFEB6B98255C48E6E7CFCC8FA000764B84EE03E1 ROGERFLOYD
2,421,613,241 *FFE34934EAFD492C0179AEB2796D9785226100FE RONALDMARRONE
2,421,613,242 *FFEC951CC535F5ACC282E0A78FCFA14FBCB96076 SSETTATA8
2,421,613,243 *FFE93C307A2BE15D51EE832082B01B7C5A27C5D6 rondzonden9
2,421,613,244 *FFEE705EEFB65C1D015B20466EF506CAFD5E019C ronnygolec
2,421,613,245 *FFED3FBEDB1676EE7F9361EDC3879CB87025CB08 RORY.NIEBEL
2,421,613,246 *FFE9E08AB83BE69FFB2A100062F910C4C91ECE76 STADTVERORDNETENMANDATS
2,421,613,247 *FFE1F75012E0A26722A10DF620CF99E45967998A STATIKWN
2,421,613,248 *FFEAA37B60EECDE108432134D9BD465234BEA681 STEVENMIKEY2
2,421,613,249 *FFE2B226CF40164BA42CA5DFC0D49C1C40CD0027 STIGUS
2,421,613,250 *FFEC9222603AE5EB014E40D94931CD3713123111 STIJN VANACKER
2,421,613,251 *FFE344ECAE79C761F828E01CAE80CA525C45CE6C russelpafundi
2,421,613,252 *FFECACE2FF3D31EA985A0C335F6AED1C6761A44C RUSSEL.TREIDER
2,421,613,253 *FFE510833AAB8630F7B3D5DC00848BF146D0E45E RUSS.NETTERVILLE
2,421,613,254 *FFEBF7EB7F4DE14618718F6033391145F412E946 rvw(
2,421,613,255 *FFE4C33DBF9D508CEF38B5DD75CB95AE6ADD7A79 [email protected]+i3s+
2,421,613,256 *FFE6F57BC7ADBED6B6F478757E7454643362BA9B S+4ZZER
2,421,613,257 *FFE5FF2BD93C53D220E00786D939CDBABD692FE5 [email protected]
2,421,613,258 *FFE7761C9597B0BDE1FF656B9076A6A845FEF4CE struct-hostent-*-hostent;
2,421,613,259 *FFEE9CA34F6012C0C6E21FDF3E0720B2D2484387 STUARTHENRY1
2,421,613,260 *FFE0052EB77E4CE7724ED033BF33440E8916CD07 stubbornhard
2,421,613,261 *FFE274AEC62D4F3C05603AD9166F174A0659CBC9 samitrah5
2,421,613,262 *FFEAF3C7B2642BE155D753E80D27A611254BEE3B SANSKRIT.SANKARRUKKU
2,421,613,263 *FFE92A843B32A9D3B47FEA6A28FEE6926F1532A5 SARATOWAED
2,421,613,264 *FFE813044457F42CF14E94DB5B3514AB07312B31 susan.ott
2,421,613,265 *FFE961F924EFD987326AB11EA900DF4224042A2E savages38
2,421,613,266 *FFE35A04CFD58C281B360FEAB3282B92857BE7CD SVA(
2,421,613,267 *FFEBE5F540EA995821641C06C2C3757E6DA84F96 SBDCORION3
2,421,613,268 *FFEC1DC63DEA8495B5D6BAC79911FCEE754FBA80 SVRVGTSBOKSERENED
2,421,613,269 *FFE9E646C38188E8B0F75B7D7013993E52AD5BA7 SCANDAL),也是美國職棒史上最黑暗的一頁。
2,421,613,270 *FFEAF27D3C5E245301098BD606D7D9E2DD73D5B4 SCHATTENLIED
2,421,613,271 *FFE82DB733268B323E1E8E28D4868EF8244350FD scolpiat
2,421,613,272 *FFEE35C190CB13126CB4FEF14D9FE8D6BD35DFD6 TAGLIORI
2,421,613,273 *FFE446C6AF0F1291C2A7046C3CDB4DA65071C808 SENALDEALTO
2,421,613,274 *FFE2997B9C0D839552A4F00FF68EA39AD57B49D4 SEOSIEWWEN
2,421,613,275 *FFEA44C804B15D8F71F94188D4B9A2D7B230843D TAUGHT.10
2,421,613,276 *FFEBDAEA325BEA27E5B104976C7BE29179993DAA [email protected]
2,421,613,277 *FFE6CA136478F9182BD866B9F3DED354A93F6CCA TAYLORHUSKERS9
2,421,613,278 *FFE6B99C38E83078FBD8CA9190F07AD66CDA8A4B TBOL ENTRE CLUBES DE CHIPRE
2,421,613,279 *FFE9DB86E50D9C20C0C8D6C4EC0F973FFA04EBA4 [email protected]
2,421,613,280 *FFE991FC615B34BDDBF6E5EA83835732F3053D7A [email protected]
2,421,613,281 *FFEC2387F2F21D7BC71CEE719EEA4DC4894E5D3E SHAHANNI
2,421,613,282 *FFE4C2AFAA9B600B540AC35A0E28E68A31420F2D SHANE-VALDEZ
2,421,613,283 *FFE68837145BAF7CFC54416B107DF50CB42C1C51 shannoncroissant
2,421,613,284 *FFE2EDCB2BF4B2A2D244B0757D9E020E82525BF5 teddyregister
2,421,613,285 *FFE34E7D10EB6DB60DB7422CB9EDF68B1A0ECC67 SHAPPUHC3
2,421,613,286 *FFEBAE5DE182E93A4C259F3147AEF564E5E3DACB TEILHETING
2,421,613,287 *FFE73104DF1DB264A38424F8C8FEDC19AA64CB65 SHEILASANCHES
2,421,613,288 *FFE03E15234759ED79AD97130ECC34A06B4F13DE sheldonstathas
2,421,613,289 *FFE53BABA1C659787F8A9D98467A53FC54B9E9D2 tenxin.sherpa
2,421,613,290 *FFE342950DF62B8255C7E97CF45269BC366C967D SHYWAS:
2,421,613,291 *FFE50EF771092F224FAC456FF84DB67AFF309977 THAILAND
2,421,613,292 *FFE751F3DCFE9C5761A87F47A8AF9CF9832FC2C8 THATAMANDA178
2,421,613,293 *FFEA16C3BEF6537C7FA9D74EFF11FAF050D4E024 THATBART66
2,421,613,294 *FFE8550C288133A6617885B51355846854E4A86E THATMONROE81
2,421,613,295 *FFEC2626A84064E86AB9EDFCD90ECDB785028CFA simcare
2,421,613,296 *FFEAED5E0FDA898A04CFEC7CADD33DA3A615F631 theharbinconnectionanu
2,421,613,297 *FFEF3D099BBD0C7ABB1FDBFF4EFF90361E560C4A SKEETERMARINA2
2,421,613,298 *FFEB488B9F3AC241C41BA3CF01C291261F5B434D THE MAD INVENTOR (C)
2,421,613,299 *FFEB7A7A39EA7B99ABFFDCDC6C6EED2A4784B615 themoleskines
2,421,613,300 *FFE637D7E82108245B6E3548203876C6111A40E2 THEODORE.MOGER
2,421,613,301 *FFE0304255791743A386933B122D98A61EB7A575 slavyanka2
2,421,613,302 *FFEEDB567641C3D31F476A2D8D31871805A1E901 THÉSUT
2,421,613,303 *FFE0EBA2F27DE4195A646A657718B41816E5C3B0 THE-<TT>MSGSND</TT>-FUNCTION
2,421,613,304 *FFE1FA17F182E13E44C68F267AEFAD42F96117CC SMOOTHCAST3
2,421,613,305 *FFE41A60A67968D626270AC8DE79B49E441414A2 snoiip
2,421,613,306 *FFEF354B5280D621195A25CD7D733AE224AF5F24 [email protected]
2,421,613,307 *FFE9B733E21B4D4430A2072AFFCF5DEBB57A80D2 [email protected]
2,421,613,308 *FFED26723AD6F8BB3F204E5940CF488F9B845B54 TINA-BYUN
2,421,613,309 *FFEE883803BA904A55E47709CD8605DE6FBCFF8C TNATCEPSNI1
2,421,613,310 *FFE7196568C3BE880EFFE8A50302EF698D78FF8E TNEWBOY
2,421,613,311 *FFEA79DB5043A40F3C5ABA6FD6C58C3B72DEE9AA TNUPTEOV4
2,421,613,312 *FFE1F64720E7EE6BFE59F2B17AAC524E1FE9FC9A SPICS
2,421,613,313 *FFE9627779FBB20270B6D53992863F460C1EB773 sreituos5
2,421,613,314 *FFE7BBDAD938E6EF31356A80B48F02171C7BC9CB STARTINGENDING123
2,421,613,315 *FFE701901E5DA723A8F3E9ACB4A9428454F7FE3A STEELIESTS!
2,421,613,316 *FFE977EA162DD46ED3CF2E2A33C4C0623B3897D9 stephennetzley
2,421,613,317 *FFEF571BD1BFC128EAEA2F3463C2A9124A42CAF9 STEVE.KIMPLE
2,421,613,318 *FFE2161CDB3936CA8C85ACD13813A2713D08A7DA trogodi
2,421,613,319 *FFE16DF2146E5789C123FB2929491BE3A01F6E3B STORY常驻乐手
2,421,613,320 *FFEAACCA64C4E9EA9B42986EC509AD9A9607AA3F TRY IT!
2,421,613,321 *FFE0E81E4DF0F1C5E311C5A569F2E5BB8EC39C62 string.quartet.in.f.major."american",.op.96.iii.-.molto
2,421,613,322 *FFE976904ADFC95F84D55ACE40FBB539399B3F87 STR|MPER
2,421,613,323 *FFE972AAF835866EB92EFF1CB0130EF54B0F345F TURISTATTRAKTIONERNE6
2,421,613,324 *FFE90272A11D562AC5C0BBE9A3C59D675154B56D turkish7908
2,421,613,325 *FFE1BFA68AC700931AF8AA53DE23566A2611E857 TUTOYEERT
2,421,613,326 *FFE531EE579A77A4481D3504FC4F13C973970B1A SUPERINCREASING!
2,421,613,327 *FFE16A125C40F9433E1C9F8BD4DC75CF280F285C TYRON.LULIC
2,421,613,328 *FFE171EEFDA22E4C608C755B68EF79515C48147F SWAGGA.LIKE.US.(FEAT..KANYE.WEST.&.LIL.WAYNE)
2,421,613,329 *FFEBD200D07AD3721511004BFD57064367D07416 TAALSEES
2,421,613,330 *FFEDC7FCF4813C8FF010F3EBD8D696364B968EA7 TAKE-IT-TO-THE-STAGE
2,421,613,331 *FFE4D25D19EAE20D9C3106194CFD98F6AAA0155C UNGULAUNGULA8
2,421,613,332 *FFE3462E3161D5431186F1773BDDEFD3CAFF6C42 unsafaraz
2,421,613,333 *FFEBBFAF04719CBA569BAE5D2C35B7AEBAA740EE unsynchronousness9
2,421,613,334 *FFEC39CF0E164AB9C77ED7F6F73AD1B5C51203E3 usievsi4
2,421,613,335 *FFE592E2243AC7468ECC166FBA55529BC04507EF USTIONAVASES
2,421,613,336 *FFECE2074BE112F6B08B242E313FF938F102A5AA Te.Deum.Laudmus
2,421,613,337 *FFE96435C6565B0250989473981C4B8383841F97 u-t~
2,421,613,338 *FFE2DAD86E245C60D6F2C6ED621A5D8D9BC1CBD7 TELEINMERSIÓN
2,421,613,339 *FFE94A0EDC1C80EEE84E183B95469FA5F681A094 ter"
2,421,613,340 *FFE914795A7DFED4953657233317BC47BF9C09C4 TERESAKITTIED
2,421,613,341 *FFEC90A1277B57B151DF8653426532E9F4EF4A3E TERNING
2,421,613,342 *FFEA4E65B89556518130512B481F7DABD20451C4 testorsitaleri
2,421,613,343 *FFE342CBB7108A269F4661BA57BE42BEDBA40C52 [email protected]
2,421,613,344 *FFE977E29C462A04379ADACCBFD656B8D2263AD9 VÁMPÍRFÖLDÖN
2,421,613,345 *FFE85E929F28CB4BF0173831385F8008E4A0B3E0 THAILAND
2,421,613,346 *FFEB66BE03B8140F47070B1C20CBDAFBF61F29B5 VARESLAG1
2,421,613,347 *FFEECF37B51512F7A726800B885431BC0D52D264 vasilli.galiotos
2,421,613,348 *FFE5ECC86E95506E3C9B4E44A927E040457302B2 västerbottensartiklar
2,421,613,349 *FFE625FDEF8FA0DB12A643C1E37F182D440021B6 VENKATASAMMY
2,421,613,350 *FFE5C6BC7811D52F23807CB3BD5E540C06D32C08 the-mission:-1
2,421,613,351 *FFE9A51C4328E531EC20881E0F6C4D4C9299946D vernonboldizsar
2,421,613,352 *FFE7B11F5CA9CEA8933FE32A52710F150093DAFE THESAWFLY
2,421,613,353 *FFEA6537A568DD75CAA2FDFB9232C580297EB3AD THE SHORT-TEMPERED CLAVIER: III. C-SHARP MAJOR
2,421,613,354 *FFE5C0B9F2599C8E1AC488BE350A6BB4C1A20B8A TheSongIsEnded(take1)
2,421,613,355 *FFE0837FC25ED429E668E35D618AB757875ED12E thomasrudney
2,421,613,356 *FFE5C8967F3F4FB2EBFCCAC364A5D5877AE62128 THOMAS VELASQUEZ
2,421,613,357 *FFE64CCD169741A68A2C191E3CD9FEC8C1DAED9E VICTORIABUHLER
2,421,613,358 *FFE2293B6EDE485308CD2BD036264F393311664E THYROIDEANED
2,421,613,359 *FFEF8900BAAF19CF2676E1F20D1712695E226937 VIERAS.KIRJA
2,421,613,360 *FFE13D23187533533CD5D3D1A4DFF0E7C36E8EEF viky-piky
2,421,613,361 *FFE47ADBB97C0BCF717E3F90B742B41E7CC4B737 tim-fex
2,421,613,362 *FFE571E33D1FAC4C001C1F22F95BEC5405EFA7BC TISEERDENING
2,421,613,363 *FFE2DF8523E0CED01F7C2DA4909A9F7178A6ABC4 vinzgunawan
2,421,613,364 *FFE8658E39657E99675A7A2C8CD1C0CC36244C59 virenbhandari
2,421,613,365 *FFED5B26ECE1B8C0AC87A7552675137EF28B0457 virginia-aggie-roache
2,421,613,366 *FFE5954197F2BD898375FAB3CC0F153A7C9B3495 [email protected]
2,421,613,367 *FFE72FFF45A8DF2D09A16A240C2174256997A1EC ToaNationRockin'(OnalongJourney)
2,421,613,368 *FFE8B899A6AF461BEC13B79ACD649A968D179F44 VIVEK SETHI
2,421,613,369 *FFEF43716E5C91ADF915825B52DA46DD75AB6F51 [email protected]
2,421,613,370 *FFEE751AF67B7124F974C17F146CF4AB26405D79 tomrybarczyk
2,421,613,371 *FFE1A6C82984C6CBC0EA683F295A459AB907A349 Toyland/IWon'tGrowUp
2,421,613,372 *FFE0ABC88C0C6B111D837D2FF0021395EA524C8E TRAVISPATT
2,421,613,373 *FFEF89CA8FC92E42D617E1815BF00905934118FD tre:viii.commentaireiiidebourreauxdesolitude.assezlent
2,421,613,374 *FFE73160402894B2288EA355273A47A678615E2D walterlundburg
2,421,613,375 *FFE3D99B2BF509C7925845936DF8820E5806B176 trhezrev
2,421,613,376 *FFEF7DB062021FAD0279A3C0BA4E7168C9B7BF73 WALWORTE0
2,421,613,377 *FFE514BDFCA65CC33A1E4E3ABB536AD8AAFD17C3 triciahawaii
2,421,613,378 *FFE82500263DCCDC773CA78DA2726C55AA33176B WARD.MCCAUL
2,421,613,379 *FFE88BEEF9A7D927C3F74BD7D09307E492143553 [email protected]
2,421,613,380 *FFEBC356AED639FC3355012BF37A3B197F21512B WAYNE.ULUM
2,421,613,381 *FFE0B3CF713D395A5A6A965A91BE67D3C8184AAA WEIDELEWKA
2,421,613,382 *FFE5C3665A53462CBF1A0DC8ED0B3D0ECD3F1DFE [email protected]
2,421,613,383 *FFEA5D2524BE8805468DCC4F18FDF695C0BB0061 Turning-(version-2)
2,421,613,384 *FFE03309E3530C6A2DFA0A32B363AD779728F459 TUTURUNUI-PHILLIPS
2,421,613,385 *FFE76F440F6F488E12F9896B63A9C4492BCC8C91 tvo
2,421,613,386 *FFE2A224992F4A4161324403EA317177525E0721 [email protected]
2,421,613,387 *FFECF6664B59421EE8416B998D78ECA665BA1F36 WHEELBLU
2,421,613,388 *FFE28B91A08D0D548E7F9B5C37EEAD3F6CC05AE3 WHEN-EXACTLY?
2,421,613,389 *FFEE5F1BBA88E2816314F95C542BB3F886F764CB whitneydevanebritt
2,421,613,390 *FFE0C1438FD365B4860765BCC3F0C37ADC04A856 [email protected]
2,421,613,391 *FFE12AB128CFA235B4216D8A5CBEF40B5E8EF509 UBERIBUS3
2,421,613,392 *FFED298CFD189292EE1A100BBE61BB7F9FE1B235 UDVANDENDED
2,421,613,393 *FFE11670690F4C8AA80264C585C6AA46BF59BE44 [email protected]
2,421,613,394 *FFEAB02C059501F30965B2D9DAC0DA3C6B2BE02B UITGEKEE3
2,421,613,395 *FFE65CAE7B29A79E9C36352A2E7B109F605B1853 WILLIAMPLOSKUNAK
2,421,613,396 *FFE3328C2318E5A0BEEB4E2C1AF767F440EE3412 WILLIAMS.BOHINC
2,421,613,397 *FFEF20FE16233DCE1784ABF6E89CB9A48B4F09B4 WINFRED.KANER
2,421,613,398 *FFEF9D465F19FC144F1DFC51D66540ACA2EE16F5 UNERRANTLY6
2,421,613,399 *FFEFEA8D9E185B12957702552D85D14D6373EF68 unpruned.
2,421,613,400 *FFE33FED43569571F357888013D4DD93F5B3F952 UNSCARCELY7
2,421,613,401 *FFE904F5C9B3C4FED070628763AEC76331808659 USER_TALKEWR0866
2,421,613,402 *FFE9A5396E0A430D3AB97222897BE1D26A878646 /usr/src/linuxheaders2.6.3224/drivers/usb/musb/kconfig
2,421,613,403 *FFE825E967CAE769D3420C4254A75C634F0B86FF uygurcasına
2,421,613,404 *FFE573D1DEDEFE45C408A109ADA621635BA3ED0E U(YV
2,421,613,405 *FFE9A0CFF42D00BA5BCE0C2D6C08946BF24A4E0A VAAO1
2,421,613,406 *FFECDE8D051D38985385EB91C8E11BA6C5C9523B WYATTNIELAND
2,421,613,407 *FFE10329581FC8A4F48DF3F8B32AF34F5246092F valentinestepanski
2,421,613,408 *FFE4F1DFC8413CB9D7207491BA45C5ABAE0CFA3A VANCEHORRY
2,421,613,409 *FFE778E4E685E989A400AD51A9EDC180BEDC610E VANESSASASKIA6
2,421,613,410 *FFE4D2916DE004150A469E2A5F23DA681DDBF377 VANGROOTHEEST1
2,421,613,411 *FFEF8D8D3E550DCE8DC89230D46D89B9A82A80D2 [email protected]
2,421,613,412 *FFE6E6642EB77FD93D919600CA2A892630BC9859 VARCHMTNK8
2,421,613,413 *FFE7C9A610E51ECCF2A59F8ECF12B4885CB176B5 [email protected]
2,421,613,414 *FFE421D1EB863ACA9BAFE951E94DA86A534E9921 (X)O~0~<B
2,421,613,415 *FFE91BF384FE920A1CB10397CBB7B7650DC8151A vertebrocostal2
2,421,613,416 *FFECE56E009FD8FBA4ABB0B5B5CAF3446B31D18A VICTOR SLAPSYS
2,421,613,417 *FFE3693267392A0881B6E597DB62BF0E9220B76C VIDEBITISQUE1
2,421,613,418 *FFE554F4EC81882D06447E46C2CA029347C79AFE 『vii』登場のアルタゴ公国の旧市街にいる姉妹。
2,421,613,419 *FFECE5258F4658EF32BEAC5F2B1CDAF425B303CE VINZANT3
2,421,613,420 *FFE6E50F32B5BCD62988091F6ADBAFC20E13244C VIOLET.INDIGO
2,421,613,421 *FFEB0DBB036546643837B6BE27961C75ACB25BD1 VIRGILKRULISH
2,421,613,422 *FFE8DA424C636E6F07BCC8B867DFA8C8245CC8DA VISHERBSW6
2,421,613,423 *FFE89374E6C960C8BD658DBB45854597ECFBCAF8 vivian.aguila
2,421,613,424 *FFE63DCE30F35628D6BAF0EB36D8AC7CB693FD51 yohanis.reagen.jocom
2,421,613,425 *FFEBE5FBE6B6BF7000D54105F877323A27FF86FE YOSHI SALAS
2,421,613,426 *FFE8D0B1B75692BE4BC80AD00E99F2D389B9D44C VOLKSTOR6
2,421,613,427 *FFED3B0DA135BC3123731D384B6E5BFDB030CE53 YUKA RAJANDRA
2,421,613,428 *FFE121186133533318E0A15681F5C7672D453624 vVd
2,421,613,429 *FFE96B70F2A66D1F92570912209FDBC2653BA18D W151073
2,421,613,430 *FFE230BC7A3FC91760B4A9CAE99A51BA3E72293B [email protected]
2,421,613,431 *FFE6D2682F9BA9058A26C42A5A4B4EA68761F71F WALDOVONDERHEIDE
2,421,613,432 *FFE4174F99B2E05BCAED67FC295D466174AE7A56 ZACH-DAUBER
2,421,613,433 *FFEBA7AA68AF704D491C2EBBF448981B8664982F ZAC RIEDLE
2,421,613,434 *FFED7F90FA109DFED5C0F5A72A0CF467C0D51B70 WANDA.HOLT
2,421,613,435 *FFEABEF2D848EBD3FDD18AF9E8612AFCB704D1D3 zanebotha
2,421,613,436 *FFE1104A8D89E15F7F79BCA22AD75E1DF862974B warren-baldano
2,421,613,437 *FFE95A2A2D26CFFBB2597F407EDDB3BD3A61817B ZFCEWSNPH4
2,421,613,438 *FFEE3DA8F2689B3E5CD4DAD3870EC10856A0B1DA wce-and-twi-show-strength-in-partnership
2,421,613,439 *FFE270510AE39793C839AC3841A8C6624085A10D [email protected]
2,421,613,440 *FFE661C3F0851158F252D01B2F2A9277BDC3B335 [email protected]
2,421,613,441 *FFEF3971BF76E310FAEBF68BBF36D39039368BF8 [email protected]
2,421,613,442 *FFE98FB35C53F87BF4D8DEDBC26A0E26AD0E3DBE ZHUHOUDUN
2,421,613,443 *FFE51059C88275CCB6E2BBDBAFD716800A7F4E62 WENDELLDUANE
2,421,613,444 *FFEFA4A69387AD70DEE88471BA45D5EEF12FE3A9 WENDELL.RAYO
2,421,613,445 *FFEA31256C7AAD3BF9818908E7C068C19695AA94 zimiamvian night 2
2,421,613,446 *FFEF5ED79D1F4985F2BA27E65FC8414F420364AF whatamigonnadowithyou(soulmix)
2,421,613,447 *FFE6E587E001C79AC81C7C680EF6828B8406C3A5 ΒΑΚΤΗΡΊΩΣΗ
2,421,613,448 *FFE61DF1980A971E6903E6A8A9678067BC0E1BD7 WILLAMON1
2,421,613,449 *FFECF3A2F4EE6A4E7034D61E48E52E74084AA5F7 williealioto
2,421,613,450 *FFE61010AA82526A3706B63D089EF3977B97FF5C ВЪРПУ
2,421,613,451 *FFEF90CB06B63576747F888F5A1AD0CF59359E58 WINDFEATHER
2,421,613,452 *FFEF0F11FB677AFD7C9448F060033762EB61F11D исадора
2,421,613,453 *FFE8A10D483FF8FE5C8938529889FBB57D5ADBDD WL2Y
2,421,613,454 *FFEDE137B2F5795DDF50F1433A4096C261730A20 кламора
2,421,613,455 *FFED1A71D7C25DE08FC93F02D0674889310C8430 WOO2
2,421,613,456 *FFE651DA69FD80B314E484AA3119E0A1CB59A7B1 [email protected]
2,421,613,457 *FFEC15304DAA22E9AAEA4E88A59181C6864FA976 ПРОМИЋУРИ
2,421,613,458 *FFE351A74E9EEBC37FB51499C06C73C004E9F8BD wwwbusinesslinkagenet
2,421,613,459 *FFE07B70E118FB95C3480B13DF0406F96E6D6430 WWWDISCOUNT-CURRENC
2,421,613,460 *FFEF8D72C930EEC501FDB55EC469D1E34FE4DDEA WWW.IMETHODS.COM
2,421,613,461 *FFE2CE3E93BC75350483E80FD2F31698418C2C0A тироновские
2,421,613,462 *FFED3D65812B7367B62C1C0EA3A7DAC8CD69C1D1 ՄԱՆՐՈՒՍՈՒՄ
2,421,613,463 *FFE0E03F36A9EEC4EA1116A4FD6FBDD64B1D5D0C X~$AA
2,421,613,464 *FFEFC6B0A06D384FBFF545C6367F86930093C3ED [email protected]
2,421,613,465 *FFE34F4667CA0498C7764378B9E77F78E7539024 XIEDIEFENG
2,421,613,466 *FFEEBE07239B00A7ABA980F684C460F480DD8B47 [email protected]
2,421,613,467 *FFEDE242CEBA21F7C5AC034C0FA8C4CF9F606AD9 XXCLLYH1989
2,421,613,468 *FFE24F44307EF9557D03711108318A43ADABBC2A 網上我最喜愛sunshine大獎:王瑩瑩
2,421,613,469 *FFE98E6C4850E317D036FF2A22A83310AA2F5210 [email protected]
2,421,613,470 *FFE4B7689EE4592EDCA512DD19821B5817B7C891 YFCANGSAYA
2,421,613,471 *FFEDEB2C4DF46077B09EEECA5CEE3A87B5C9C10F y?+j
2,421,613,472 *FFE40419B8D1A35A876A999212FC4071F11BB2FE YO.LA.TENGO.&.SMOKEY.HORMEL
2,421,613,473 *FFE8DEA3C3CBE3A1B36D1B38000F223A7B5848A9 yoonhwi.cho
2,421,613,474 *FFEFD5538E72367E4A1B9D1D878F0418829E67FA YOUBIN.KYOKU
2,421,613,475 *FFECB2464D59637872208E2B50122CDB7D6A8F80 YPERPHDOYN0
2,421,613,476 *FFEEB582A6E203F8612A9960C8C7CAA576CB5983 [email protected]
2,421,613,477 *FFE82C19FD3D12DD427C142FF6E999F2C05B96B9 YUREIKAZE
2,421,613,478 *FFE9F5784A30BF0A5E7ED15AA1CACAD53E76E858 yvonnepappe
2,421,613,479 *FFED6D6501EB0E0EF0C7F254B80202BC4D24B91F Z146069
2,421,613,480 *FFE3821AA9C6B7CCB7F609ABF6D9239B2E6295FC zeneida-mercado
2,421,613,481 *FFECC8523DAA84095DD8C2EF67A2B0AAC10DDC65 zenithw8
2,421,613,482 *FFECF53415399B3EB50A77C5343CC06240DAFE0E ΧΑΡΟΛΝΤ
2,421,613,483 *FFEB88A4AB3C3DEAC9F3676BCFA3329F218EC0C9 АЗГАРДСКУЮ
2,421,613,484 *FFE8B5A007B8017F69E37482F4DAEBBAAA82E784 АМОРЕЙСКУЮ
2,421,613,485 *FFE89C44DE243978CFB046A87150AA8670F7B33B 0173p
2,421,613,486 *FFE434D81194C7EDEB1379CD1D5629B32DE3E43E ІМПАЙР
2,421,613,487 *FFE154A2A19E678BE363BB8418018AD28D15A33D 08031385
2,421,613,488 *FFE7A563BFACF3CB454968A901C30695F09BDFF1 симашко —
2,421,613,489 *FFE1EB63EA99614FC6D263597A19E45D0FEF55DB 11:30-pm,-great-northern-hotel,-room-3-15.]
2,421,613,490 *FFED8B43D103BA7108DFF6261AAB7499FC8898EC 11 NICHTWEISSEN
2,421,613,491 *FFEFEBDDECE8C2E1F2079AE20D898B4C31A9BAC4 123456789MOI
2,421,613,492 *FFE91346E2E984AFF411C0405615F25EF389BB9B 17.01.1562
2,421,613,493 *FFE2F770EA22588CA5D83F6D118A1CAD7B2F3553 和大衛·布萊恩(david
2,421,613,494 *FFE4D119F73659E55E539C7151E0466572CBB7D1 1 BAUSTELLEN-GRAEBEN
2,421,613,495 *FFED6C8188014C1A752C16912508F76F19040513 1-BODYTKO
2,421,613,496 *FFEB58F40385B54B6A6D895F38DCBC8F3C60B86A 1cleversensibler
2,421,613,497 *FFEB677A19C0CE56E9DACB786144ACA25266EB45 1 COM-UEBERNAHME
2,421,613,498 *FFE2B94DF7F900460C5F9674FB26826F7D00C63C 1deutschlandkomplex
2,421,613,499 *FFE7016508293DAAAB0F9D46C90EA16FC20B89A0 1-ERLEBNISBEDUERFNISSE
2,421,613,500 *FFE8905187BB6EB8BAB4C637F36CE051771DFE77 1.EUNORMISTON
2,421,613,501 *FFED2C548B46379143873C3F6D30D1C6C309EFA8 1EUROCOS-CHEF
2,421,613,502 *FFECB9E67A90B9E47BF7018E20357DC1D645A84A 1EUTYYTYV
2,421,613,503 *FFE52FF032B4EE25B3C31DA320C5082FD69A671C 除这上面的四个以外,通用原子能公司的diii
2,421,613,504 *FFE5D9A197D8C4E874203E3DFBD1992C7A0D4C61 1 JANSHOSPITAL
2,421,613,505 *FFECA0813DE7B38C3C1505D25DCDB2E82AC944FF 1-KAIPAAMAMME
2,421,613,506 *FFE255B18AF3A78A6729DF54D75E93F2AC4ABC1E 1.KIRCHENGELAEUT
2,421,613,507 *FFED38712FC98E68BBAC86EEDCDD39CA33B111F0 1 KOJEYKSIKK
2,421,613,508 *FFE392F1B9FED1EF9CD23EC8C4B7D62D5B05FA38 1-MAHAWIL
2,421,613,509 *FFE8EDC280128CCBFE004DE93F54CA29119CC8D8 1ohbaa
2,421,613,510 *FFE2F65EC9636E84FF13AF3E3C6C7E7951D67FC6 )0(~`~`QP
2,421,613,511 *FFE9702CD953752B24E2F38D99BC4551D10D9485 1theshoemaker
2,421,613,512 *FFE29092317FFC653A38E5FDACD1F6531DAC30F6 1trawht
2,421,613,513 *FFECA8EDBFFE877AB385DD0DC22664C491EDCFD2 1051481 SARJASSA.POJAT.PY
2,421,613,514 *FFE55BA9715B41C6BBC035420F7931E9E074BE39 1.UNBEVOELKERTE
2,421,613,515 *FFEA4ABA57CDFCDC9EBBAC3877E3B7F21C00658B 11061514
2,421,613,516 *FFED39315944CFF3A83830FB94EB065CABA63C21 1 YKSITYISVIESTIEN
2,421,613,517 *FFECA68DA05C6C0F7CD6EE19850405B00F04ADB4 11C09EBA0D2BAC70
2,421,613,518 *FFE325BE5D0E465A8656E6459FFFF27AD0B55633 20germanier
2,421,613,519 *FFE5F7B46A83C2AA726E42FF9ABE9B06B1AA1F2E 1440097 "-it's-been-a-home-to-a-lot-of-us-.
2,421,613,520 *FFE6D0AF8483D09DC62EA17890866A850AA62B48 2296627 an-anderer-stelle-sparen-?
2,421,613,521 *FFE332EF8780219B68B4676CAE196F696AF6174C 22november1646
2,421,613,522 *FFE00CEA1499B23E51618ECBED292993DD89F788 2376689 HE SAID HE WOULD FALL 518 SHORT OF THE NUMBER
2,421,613,523 *FFEFB6B9829D925C4B7F00BF1BDA516621BB2009 1510858 herecitedhismarriagevowstwiceintwoweeks
2,421,613,524 *FFE0F97158E192A1F619041D4342B3B115675F74 1567247 ENNEN-VALMENNUKSEN-ALOITTAMISTA-SELVITET
2,421,613,525 *FFE8FE15A6A4EE4BAD49B8AFB7EEB3326C4313DF 2436584 ehk
2,421,613,526 *FFECBE8A46D5E8D613512C25C3BC8DF2E75F8E99 24nov1270
2,421,613,527 *FFE5D9EA9F48BE34D98F4F80F43F4DBFC7801484 1817806 heikkisen ja meril
2,421,613,528 *FFE43855AB9D661D83A2DC23EDC23EAB3E135517 299TH
2,421,613,529 *FFEF71E735926B13F060D41A0C7EB2468ABF360F 19aug1334
2,421,613,530 *FFE62FF6BDC300BF85930725C710AB91AACEECC8 1BAGLANABILMELERI
2,421,613,531 *FFEE82513A74BC149FD54832066078B34579A536 1CCOK
2,421,613,532 *FFEDF1A42BE61CD6C5C928E87ADA3FE62C4A0B90 2lapinlve
2,421,613,533 *FFE1555131BB7CF99F5C9C46D4EA830A6BCB126B 2 LEP
2,421,613,534 *FFE37C5FA789669A8FE2D14B4F310A600F50E323 2NICKGREG
2,421,613,535 *FFE2B2648B46B530A138C9A0A447D8B7D31881A5 1.erinnerungsgang
2,421,613,536 *FFE1EDC714CFE856F524452A76550739D70A292B 2.TIEDONTASOSTA
2,421,613,537 *FFE86C8F9D72223CEC56FCB753EC21DC669319CD 1HELSINKIKEMIJ
2,421,613,538 *FFE11641B51AE0EFD1EC88C4ABCA1D9ECC4BF462 1.hotching
2,421,613,539 *FFE623158D128BD5589D46ABBC992DFB70F27616 1jarjura
2,421,613,540 *FFE35B16B7B611BACB1846640372E24D4057B119 1.jazzlandia
2,421,613,541 *FFE1F5F1523DD1ADB8497332154FF8E0E814A07F 386226 siesindsymbolischegesten
2,421,613,542 *FFEE13BA56A654220726F8352B4B69887C19137D [email protected]
2,421,613,543 *FFE9CB416367C7B4FE5AACB39D1444E818CB1401 3ARABISTI
2,421,613,544 *FFEB4C05E212BC60F36FEAC1A402FD867B48CF2E 1.linjakeilausmenetelm
2,421,613,545 *FFE62CA7D9B2AC72FE8F937B3C0E87E55B128A4B 1liuotinpakkauksen
2,421,613,546 *FFEAE9B4A34EF3F8B5F318EF47AF9E2656342B04 3BROMBACHERSTRASSE
2,421,613,547 *FFEB0DAFE85FF90DBEEB870E333B1D17090CD374 1 MEGAINSURANCE
2,421,613,548 *FFE0B06870C6EDCC6CA2A563355EFCB4B452140F 1missbetty
2,421,613,549 *FFE2BF6922D4B6F29376F6061BF170DA0780A0A0 1.plattensammeln
2,421,613,550 *FFEF37AA44F82DAD50866354CEDA8B7004E07345 1POKVASE
2,421,613,551 *FFED9B6CFCA57049918CA3E324022E98BEE38D31 1 POLICEAGENCY
2,421,613,552 *FFE0C98A3EC3EC29F791FCE5C215202257527870 3P`~.`~{x}
2,421,613,553 *FFEC558E2EB5F6E75746F0BB7E3439011A0BFD0E 3QWASZX7
2,421,613,554 *FFE87673B43B42817C62EE5594BB4059BA521820 3thatzephyr6
2,421,613,555 *FFEA7C70E855D1552E0868088747F62A573182B5 3UNITY4
2,421,613,556 *FFE16E39415942086D8244B73DF797362D995A8E 400843 ratinaa-pit
2,421,613,557 *FFE450B2A081AF476C132563CC5ACDE576E9EF48 1THEJUSSI5
2,421,613,558 *FFEF1FB13444673806ADA8642CA05E7CB4833F66 419JABARI
2,421,613,559 *FFE384EE4B35D2C3D076BD1333C7F7D31E78709B 1.torcuator
2,421,613,560 *FFEC3F1CBEAE880782FE222065A0A75B5546EC45 1.TUTULABILMELIDIR
2,421,613,561 *FFEF22D7D82C4722E00575D0C4D65016921FDA1B 1-VALOKUVAKILPAILUA
2,421,613,562 *FFEC9D4225798A6E99C38E84298BA53E29B40EDE 4CAMPOODIE
2,421,613,563 *FFEE1F9BF37E4F00530EDF1697B6E52B8A0259E3 2072266 SIVUN ALKUUN > 6 . MIT
2,421,613,564 *FFE578E4BFEFCC6C46119396130521B88F0124A4 4-ISYURTLARI
2,421,613,565 *FFE98AC021F30C33BFD69F9B7342655DBFFA6AC6 20STARNBERGER
2,421,613,566 *FFE4406851669CF15E36226711CB618D18C1DE08 4MAHAAVAKSHAA
2,421,613,567 *FFE1E8726C069BECD698F5AC1D03735D6BE2047A 2380542 osastojen.k
2,421,613,568 *FFE61E5D18F178E2C369577D778605FE7D881C94 25.06.1953
2,421,613,569 *FFEB6E2D8C423B7EE68F2B81DB286C874344645F 4SEIJOUTA
2,421,613,570 *FFE37544203794C32C62632DC6E616D1DBA9443F 4STAUDERN
2,421,613,571 *FFE94EC0BD852BC310AE4A62CD646573E930BE2D 4STEMPELBOEKJE
2,421,613,572 *FFE05A1124A02B7A1C48554C579C1A4C4B873ECD 4.strafmildernde
2,421,613,573 *FFED9C62063A47A4159BA84ADCF7E35EA5B9DC35 4STROKEDE
2,421,613,574 *FFE754917497F298618901711D11FF58B8DA04AE 4TESTRIPPER
2,421,613,575 *FFEAEB98957B6DB8F05B4AF7D72B42CCE88BE72D 279KASON
2,421,613,576 *FFE7122454952FA534AFE37B1674E7BEE1F6BB3A 2896513 muenchen : spitzentreffen zur stoibernachfolge [ br ]
2,421,613,577 *FFE2A8ED0166A8831C9935A442B38633DC83D969 4WERKVERTRAGSARBEITER
2,421,613,578 *FFEB56118A108A0C30BFA235A7E5DF056136072E 2980469 KIRJASTOTOIMIENSIMM
2,421,613,579 *FFE6016129C256483D9232FA83D06D0EA17ED2DC 4ZSCHEKIN
2,421,613,580 *FFEC914DC18DFDA9D85B6DAA1CB77E6DE5D48217 29FEBRUARY1291
2,421,613,581 *FFE5AA2FDD27B6E24E2838C6FF931F2D7DB728F2 54767 BUBIRYENICUMHURIYETREKORUDUR
2,421,613,582 *FFE3D7C30608D2F7BCFD40C7200B7482F33BE355 2CHUCKLEHEAD
2,421,613,583 *FFEC7F5FD4DAD2433E39DBA21BD60A69E13ECD0A 583020 Onder,aOzUrlUyerineengelli
2,421,613,584 *FFE6357952F1AC5C0A223EADFAC2A513DA57EE4C 592469 sorularI.artIrmak.mUmkUn..
2,421,613,585 *FFEE15B377D0033B47012357CF1CD94DFF9C9164 2EGITSIRF
2,421,613,586 *FFE7B2DA21D9BA046BEC50EB64567208E4A644E6 2.enuorten
2,421,613,587 *FFE5A22A983D27C75B55AD436E509339B74A970E 2-heterotrof
2,421,613,588 *FFE98E5FE88F0FB095D507F33FD962BB87AEBF35 5BURGERNES
2,421,613,589 *FFE13D3E8564E767B2AEEEF688950B3B5B51A218 5CABANETT
2,421,613,590 *FFE909274861D59F155E9C78FF2EC4874A18530C 2JATKUVINE
2,421,613,591 *FFEC038C8B5566980998B0458D9F0B5EED76585D 2 LEP
2,421,613,592 *FFEA6A8B45F29C698F4B09F0F7A12F385C0B2307 2.pesunkest
2,421,613,593 *FFEACACF6966243EC33F7CD637B3DC6EBE786FD1 5INTRANSN
2,421,613,594 *FFEAFE5FEEE7719475042131D660A46D2644864C 5leds
2,421,613,595 *FFE43F848AD62CFB0048F04E10AAFA7B75F8A9B2 5OOBT
2,421,613,596 *FFE19A3D75408D53A07D5327DA828C9ED85740ED 3b< *<p
2,421,613,597 *FFE6AF53779D275FED2E5F8F08244479ECF1F7AF 5VIATPHESLAV
2,421,613,598 *FFE1E0CA7B00F8327C3D2F040819FF95CBE9B7D8 3DIBREBSW
2,421,613,599 *FFEE83C8FED1CE5F2AD72E876AB7686F1506B4EA 6-02-1513
2,421,613,600 *FFE121AFB9A5EB12795E33B8D9ED6D9D766FF78B 620liana
2,421,613,601 *FFECDE05846F86416CC57E450D6314B8F613D0B1 671728 INDIEARMEESETZEN61PROZENTIHRVERTRAUEN
2,421,613,602 *FFE968B76AD8363AC3605630B408E3378A0BEFD0 3JESETROM
2,421,613,603 *FFE333EB6F8C57893C250C0372AC13C335C04718 3-LAATUHANKKEESEEN
2,421,613,604 *FFE37BA31BF326C1D3B774C82E0F8CBA594FC748 3LICITARU
2,421,613,605 *FFEE82D7FB5FF9F374786C5DFF8220E412B8375C 6COOPERLOSER
2,421,613,606 *FFEA7EB6CDDAAAFAC1E955EA9ADDF017B79DD341 6 DAGBLADET
2,421,613,607 *FFE0939D7E0614186A983CA114BBB0C2CF070ACC 6DEKCAJHG
2,421,613,608 *FFE2154CD546BFCC8CCFE0F17FFD716386BC27AC 3P~ ~ ~SPLAT!
2,421,613,609 *FFE2B173EA153A8E171FD9A2553C62BB5B99165A 3THATROSE3
2,421,613,610 *FFE3138FFFD1FF3EABEAB27C85D7A064743FC380 3UNVERARBEITET
2,421,613,611 *FFED1B35F8E66B19F7B85856BF01E682198809CD 6ILOVESTEVEN2
2,421,613,612 *FFECF4B11612CCBA2385EF7AD3134238F9168FAC 407796 taksitcard hesabInIzIn kesildiGi tarihi gOstermektedir
2,421,613,613 *FFE8537F4B9E44398294D4F1773C340E5B2EEBDE 408942 MEMISOGLU-MAK-
2,421,613,614 *FFEC784C514773D411529BC7F6ACF92C03FBE7EB 6NAPUKNUTIMA
2,421,613,615 *FFE978C769A570B1C599DC219509D59CA1EB5817 4azotla
2,421,613,616 *FFE61A7BFD63DF15FF3229B8E81968E9A9C5E168 6PERVERCE
2,421,613,617 *FFEDFC7D7ADDB97EDECBCF8D6C17F54D64BD9A23 6SESOPMI
2,421,613,618 *FFE20923C9B540B79161E610139846183F1EEDE3 6SIBLINGAS
2,421,613,619 *FFECD4BCA51D886656F637D1E64AFB81E10CB950 6SUBBLUE
2,421,613,620 *FFE8C1A8ECFD1F7A2911379A196E3DFEB33C1F9D 6SUCCESSYOMAMA
2,421,613,621 *FFEA743E05BBA55ED93C2EDBAF78798A7FCB00AE 4INVISUALISIERENED
2,421,613,622 *FFE8155DD5216387DF95BF8268F1921BD3AC98F3 6UTTETOUL
2,421,613,623 *FFE8286E3EABB1B5DAB2445F180250C433083FE3 4MATTERGEMMATEGERMINATEGLUMEGROWGROW
2,421,613,624 *FFE93C02BD2D2C9297E5E6A8EA1C868375DFF532 737ARYANNA
2,421,613,625 *FFE7CDD08244976832650C5E93024ADA465E84AC 760867 balCIk-gUn-geCtikCe-yumuSaklIGInI-kaybeder-
2,421,613,626 *FFE0616F53FEE9091AF7FC31DB188A026AF67D46 4OVERHONE
2,421,613,627 *FFE4D6E2FC9703022BEFE0EA1851F15AB56A7C85 4PZVXQRKZ
2,421,613,628 *FFE67D705058A77B7756DAC8C84189DAF9C8D723 7BSWMROTHSTEBSW
2,421,613,629 *FFEB9C5C359203AA4FCFBBC352CE698B05D5AD7F 4SCHWACHKOEPFIGE
2,421,613,630 *FFE4BA475CD12BE8E9CC4923AC8B7EBFE2A328D9 4spr4+on
2,421,613,631 *FFE2C8D18E6FDD0B7C6108EA5FF16796B9E7EAFB 4TRACTRIXS
2,421,613,632 *FFE4F647478DAD8ABA32DDB09EB9B2C50556813F 7FLIGHTAMERICA
2,421,613,633 *FFEB10D764C38787ADAF1D4BF453B31B10A261CF 7INCISERAS
2,421,613,634 *FFE3C736FFCD05849D19433CE7B1835940ABE589 5ARRODEO
2,421,613,635 *FFE9BD5ACD438E6E9E7B018434BE71019F6B1AE5 5BSWYWEBSW
2,421,613,636 *FFEFC225F75B9708ADD8C01B44C96C254BCD6503 5COMPLURIBUS
2,421,613,637 *FFE18B00F8BC52493626DA1D5F6A74F111EFF084 7superchivalrousness
2,421,613,638 *FFE1FCD338CEE0B50767F129F69114E850BE0D93 5EKSHIBICIJAMA
2,421,613,639 *FFE8D684A306B9EB157D8209A3443E00DA5F6B9B 7VIREDEHT
2,421,613,640 *FFEB6CF1FC7C6A46992434D0E3D4D475281D855B 5-flachslanden-prozess
2,421,613,641 *FFE40290572EB6366CE7E5F485E956BBB9FEB0DC 886fmk4ajlzd
2,421,613,642 *FFE859FA81DE65299465E12265012EC4A0389EA1 8B~0~O(^_~)
2,421,613,643 *FFE76B303BF0FAEC07EAE60567082C166DD639AD 5NDERTOED
2,421,613,644 *FFE730BD0AC35165C5C309D0D69A14AC4906F742 5PLATINATANKOJA
2,421,613,645 *FFE54F23ABF94AFFFD37092B1A96169DACA6C612 8DESILUSIONO
2,421,613,646 *FFEB8431CFD7F9528DD33DF3D1DA5A8AC06488AB 5RJHDYSHE
2,421,613,647 *FFE74E30059F4FB21F680EBFE9456E6ADDB7F870 5TEACHERAPRIL
2,421,613,648 *FFE1591C9B700C148CF95CFF7BA5540AFC47510B 5TIBERIASES
2,421,613,649 *FFE9B23BBA19351B8AAAE510076603276AE52EC1 5TILLAEGGESES
2,421,613,650 *FFE426B53D75DE5D55046DF3EFD55D50AB789390 8KEORBRED
2,421,613,651 *FFE19CFE018C25E74D72644C9720DAC518035C11 8KEVILSES
2,421,613,652 *FFE033868A4CFF511F8E7D91124D7E8EF1507AE4 5TRETTENRIGE
2,421,613,653 *FFE2426C8A795A6EFBEC04E74F516B13994B1C63 5TROPEROS
2,421,613,654 *FFE7F6D3DB3089B8C52375AD918C567B4BD9DFA3 5TURINGMASCHINEN
2,421,613,655 *FFECAAD1DDD39DF871621DDF31C0207F02B9AADE 5VISIONGENESIS
2,421,613,656 *FFE872CE744838CB502489C6B7B9A47E6D9209D3 5 VORSTANDSVORSITZER
2,421,613,657 *FFE0A30F4B1B64686F5589BF428BADD784A0264F 8MUTAROTATING
2,421,613,658 *FFE300786BA019451A204C086FC24309A3CB0804 }8{O~0~(=Q
2,421,613,659 *FFE77FD04CE8DC51BCE00362012F8687BC5D4A3A 8SEMIMETRIC
2,421,613,660 *FFE8D7C3D3D093EBBA18D89ED2223547F96D1F0C 8SKYSCAPEN
2,421,613,661 *FFE268C8172A0FBF86ABE82C67EE31C0D1FF2ACD 8SYMTRIQUEMENT
2,421,613,662 *FFE79FA2222DF1F7562CCF14BA21B549BA957423 6CLEESTHER
2,421,613,663 *FFE539D7294B0C2D1EFAD7AA75BE6D270A9F04FC 923976 juuri oikean k
2,421,613,664 *FFE21B1435A016C45B03CAF7F4DD2BC13A7DF690 960409 anadolu-mah--ova-sok-
2,421,613,665 *FFEBAD9DEFE1F1AB889A56C901E59A3C1090C772 973837 LASST-DIE-HOERNER-ALLES-SPIELEN-
2,421,613,666 *FFEF6E05B2640F794839A3AE0D199E66F97A5309 99639 Ihale dosyasInI onaya sunmak
2,421,613,667 *FFED65E46D54F4E36D2DC38FDB6A26E32EEAFEEE 6GEDROLLEN
2,421,613,668 *FFE4F536123F7E4C507D5DE107EB66049B0C4E47 6HSNOITAZINAGRO
2,421,613,669 *FFED428BABD47801ED601D1D303D5E515CDC9272 9EFHLBSW
2,421,613,670 *FFEE83B3190A96867C4874F499C323FB951DD2C9 9ELIOENAIBSW
2,421,613,671 *FFEC2ECE24D46E1D2DA23F078641EBF2BA14DDF4 9ENFLAMMONS
2,421,613,672 *FFE134BB5C902DA6CEB1F2C2118886642AF5ADB9 9HOWARDSIMON
2,421,613,673 *FFE999A7C9248DA51E1ADD1C6C9EFF50898CACDF 6PARKERCRICKET
2,421,613,674 *FFE8987E1F753E72620EDFD94E626019C193189A 9KEIHNHEITTO
2,421,613,675 *FFE0A0AA130C674F9DCA8336C5EFD7130FD1F347 6SESNORDUAB
2,421,613,676 *FFE9633E58EBE5D2828C310488362B4913225D1E 6-SIHIN
2,421,613,677 *FFE9351EAF42CF594349CEFCECDA6D874A866731 9PICKLEROOSTER
2,421,613,678 *FFE315D8F01DF516D4F07A256152EB6CB5DB61FC 9SWEETIEDALLAS
2,421,613,679 *FFE3DD3EC22AA4E281E301BFC678E0E913561A25 74a3b854251534318af652856b692974
2,421,613,680 *FFE9C13A06F1EEE5F456073598C5C6AF347EFF1A a;%0
2,421,613,681 *FFEB814E9CB79F7FB5DFCE350814FC05AF39B735 A1_5M
2,421,613,682 *FFE5B484C35BC83C962BDC9E941D74F6CBE778CE A#2V)
2,421,613,683 *FFE24C16B3101A35DBD22C579474E2E388D246AF A4LD"
2,421,613,684 *FFE14B139BCB8AAC282681F838DAFA1AC40A5981 7GSMARKEDETS
2,421,613,685 *FFE604E5AEC273D3DA611CCC01D7B9F83537BD7C A5S5.
2,421,613,686 *FFEC82BFEA10F6B029BC2A479A2B9B1C8E446792 7PREDELEGATES
2,421,613,687 *FFEA9BFEF9E188A963445289AE12FA16E3F79B38 7SHADOWBIGMAN
2,421,613,688 *FFE4FC8E1675F3D3949423513EA0ECFBAAD49066 AABYPJ
2,421,613,689 *FFEEFA8E5277D15C1752C2E2AEBDC8D84F63BDFD 7UNDEADSYMBOL
2,421,613,690 *FFEA3D8E9633009D71B870CA6B42FB12A6CBEB39 7VINCENTTASHA
2,421,613,691 *FFEB20F06D4F3F36ED93018EF602F63490429EC7 7WANKERWARREN
2,421,613,692 *FFED14A6F562999D20131837D863C637F71F37B3 7WGBSIGN
2,421,613,693 *FFE4C8756E4F2C9F56FCE73DBB890FE1733512A1 AADH"J
2,421,613,694 *FFE053058571D583A774594447F19867B811F7FB AADQJP
2,421,613,695 *FFE65C0F8A6F07A44EFB3D4EA5E36559481607CF aaezx`
2,421,613,696 *FFE6A2A28C9A0C69869F167490ACFEF63DEFAF34 AA+P3
2,421,613,697 *FFEC3766C14F0D8E53C753C9AFF353EDCA8EE06D 8b`~.`~.;)
2,421,613,698 *FFEF69547C7FABC9E7141656FE609C570E80C078 8BIRBONAGGINI
2,421,613,699 *FFE3DA186DF35233ACF2046726A30045FA46522F aasnaga
2,421,613,700 *FFE6A123EC7623159B16328ED52167F5226A87BD ABELRELEFORD
2,421,613,701 *FFE9AEFB84E3B77A68FA34D9BB9393041F80B197 abnvg
2,421,613,702 *FFE13F308387E7C0B655C4826E968EAC168911DD acam0
2,421,613,703 *FFED27B190D9D8F8CBC619E4844B385B05B8EA3C 8STRYKNINFORGIFTNINGER
2,421,613,704 *FFE2BB448FD0321B09B6F788B4EF103AF55463F7 8-tutkimuslaitteiden
2,421,613,705 *FFE707965C773A0439502653690F9CC7964368B2 8======)*-*-*-{X}
2,421,613,706 *FFEE3F3A0623CB752231693CE534C6591439E59E [email protected]
2,421,613,707 *FFE5FB799053DFB1B593F16E6A8D014046B00647 ADUISING2
2,421,613,708 *FFE076A12294E198C135E1C7410C0DB4E086CA16 AE19508588244700290D50FA4252EC45
2,421,613,709 *FFE7B0E14B6EEBE0E7B571D272E769CEC8D4604E 982784F5-45C4-3200-BFA3-06EE1D11F7F5
2,421,613,710 *FFEED9B930BD078BA8426F0B71078D2B7D0B5950 aefn=
2,421,613,711 *FFE4D2E82E31EBAEC004ACD5B21CEE0F241001AB 9BSWDISEMBOWLELLEDBSW
2,421,613,712 *FFED4566C39646B7C996B455DC570F9200D16E7B 9DESEMBALSE
2,421,613,713 *FFE781A3E109F4066E8DA2100EA1A19E3B8FB963 AFTABAFZAL
2,421,613,714 *FFEEBB8DA23BDA6EE2030C238D08F60F91177CAC 9hwmwom7sb
2,421,613,715 *FFE0BB60AA75463B97BE3A1AC6521A54EF36E895 9KRANKMACHENDEN
2,421,613,716 *FFE38CCC30DBD038746F42ACAC25A7C4647AF7AF AH?$I
2,421,613,717 *FFEC25A83DEF159BF38BE7F1038AA463CEA863B0 AHOEKMAN
2,421,613,718 *FFE6AF3AF5399567F02DC4CE0D211D9F42BFC802 A$H!R
2,421,613,719 *FFEDC4FF4EF608D8D6435D771D9BDBABF29CE4B4 AiheNiKpeWe
2,421,613,720 *FFE0C0FB67FB4DABB4348AB48ACF047393B7604B AJAMRE
2,421,613,721 *FFEE0ECF159A92C1102546DF9394E485A597AB2A Aj:G
2,421,613,722 *FFE0FA2E23B6B19DFF27FD769E6978703A695F1E 9TSGIRAHDOOR
2,421,613,723 *FFEC54D5FE8565C1DF5656B6019CB1DB24BD8DB7 ALASDEPAPEL
2,421,613,724 *FFE58F458CEFCC01624D29818EF6BA60EE019066 ALCAICK
2,421,613,725 *FFE7E1DE28EB68A6AA421F01479B375B64F2300F ALEXANDER.DOHERTY
2,421,613,726 *FFE641A562A46643F5B277F563CC319EF928B543 a(2tf
2,421,613,727 *FFE78F19AD26049BAD7C47C640B48BF9E2400F68 A46.O
2,421,613,728 *FFE937110FD07DE9222999915DD2A04C1433496A A8ki
2,421,613,729 *FFE638BC2CAFC17F5AB34DF00C2AE281C92696E1 alze5
2,421,613,730 *FFE8A9F728C21C9778F1E2243A10D953FED0F58F A(#MA
2,421,613,731 *FFEFA59801FE44BBF44004AB80A38B0541D64D32 AMEYALI
2,421,613,732 *FFE1D5E1D05D736A8FF3D9E4A20A10507C25D703 ANDERSEN108
2,421,613,733 *FFECBFBA34B1E2F08C907A47F2B1F9CB886C51A3 aal6#
2,421,613,734 *FFE84061468239FEFF0653EF136D95314A5F652F a)nm9
2,421,613,735 *FFEBAA98B5EF3DD1608DE919D3388E36A736218F a:atc
2,421,613,736 *FFEE01EB7994711501A3BAF607019A5787B66836 aax-^
2,421,613,737 *FFE88695FEFDCE0D4C91A9E318802CCD7F0BA30B antonduskey
2,421,613,738 *FFE3473E875E670A2B739AAF579CD98F12A5A684 ABDULKNIFFEN
2,421,613,739 *FFEC2DAED7597F6025D6C84A1795A53F4EC21B0B ANTONIOFLAMM
2,421,613,740 *FFE35EFF769E6C8AA61B41AA5DB17544DAAEE7B5 abgg$
2,421,613,741 *FFE3260EB65E8F77CB86B42C2BEEB1A5B8B18B2C ABQ<,
2,421,613,742 *FFE968BD2FB00E5699345FCE8E700B6038A440C2 abrahamnorise
2,421,613,743 *FFE8880F02AEFF8F14E70E5EBD579A1E1690F6DE ApelejadoDiabocomodonodoc
2,421,613,744 *FFEFA58032F4D59486BF2C6CC5E9021C40617A9D ARCHEOLOGICZNE“
2,421,613,745 *FFE2742B275076C47AC9D2ED0CEF89AD43F07D11 ACV:0
2,421,613,746 *FFE3A71CFCFC162F72E1C16FACE16ED5C38EA3B1 arcureses
2,421,613,747 *FFEE7D13785FE7FA49756B3078C196A929479453 AÐALDYR
2,421,613,748 *FFE047EAEBF03CAB8A719D5CDD62A274DDE8B55F ARIELNIRVANA1
2,421,613,749 *FFE8136610EF87BD486C9DFA44D383D860EB19FB arliegeddings
2,421,613,750 *FFEF82D4C29A271DCEC73FA38B5180ACA3BCA243 ARONDECOTEAU
2,421,613,751 *FFEC10A1896DB80655BCDC4CBD70F50075AEBC7C ARONMOTZER
2,421,613,752 *FFEC94897F1745AA8C25E08DDD49CA18BA52141C artikelpräsentation
2,421,613,753 *FFE8924D23C60197E0BC3BB4DB21C1B173908A29 ae8m2
2,421,613,754 *FFEDB849D3BB020548E863DD40A22C46B04B64FD asherite
2,421,613,755 *FFE5F35A2E374A8EF99A79B8AAD4CB6EA1FD9FF0 ASSART3
2,421,613,756 *FFE2EBE40D0CC310A0C00B5B5BECD0D4AEE9B91B ATPIGGY6
2,421,613,757 *FFEAD65B638764EA2EAD03CE65C559C2A71E8138 agi-u
2,421,613,758 *FFE86BE664E015F8784011DE81C522FC2DAF21A3 AGMR5
2,421,613,759 *FFE9811A0248DA822D36446504F6D29C4FC33DAA AUGUSZTUSÁBAN
2,421,613,760 *FFE2EE4875DB33B0ACDB0E5B8824697884727052 [email protected]
2,421,613,761 *FFE7CED5B711502CD372272575F61012970F9D4C aureliohawse
2,421,613,762 *FFEDF6AF813AD14BC0CA2614388CABE5FCC88AE3 auslandsvorträgen
2,421,613,763 *FFE235D2C9666F83EAEA049FD8EB265CA39252FC AI4MV
2,421,613,764 *FFE6B7DB9C5BE40F97E2DF51B5A813C7DDFAB219 AIGLALECS9
2,421,613,765 *FFE34F00336B63AC0A78A02AABF156EB6566DBFE A!II"
2,421,613,766 *FFEA3D3A3B6026015FEC3E275C8FE004EAF48E11 alab0
2,421,613,767 *FFE429BCAB31E7DDA9B1F91F3B1194C43FD5DA81 ALEXIAKEMPER
2,421,613,768 *FFEDCDE4BFDC8B040387B7A754F1A0DEE8C2AA64 b1dfo
2,421,613,769 *FFE92F7D1C52344C46F665ED4CD977047421EF0A ALI.JOZSA
2,421,613,770 *FFE17F3A92D8C0EACE32F3F77AF5679D32AB5D38 B3-L
2,421,613,771 *FFEF7884C1AE3943D02D40F8C356300CA68BCD8F b.67u
2,421,613,772 *FFE0EA18BE14E1443DEF376FA5E2808B010542AC ALONZO.FADNESS
2,421,613,773 *FFE65A9D9C7078EC0E5D204D22476E7722C41F04 alphabetz4
2,421,613,774 *FFE61A2E10F169850E32286B9B72FAF650E5B6B4 b8!,;
2,421,613,775 *FFE68F9675E1CBC765D4930E6CE18515C2617D75 B8IV.
2,421,613,776 *FFEBD3AA373F9CF656F14BF91199B0D545FDADCD b9(ef
2,421,613,777 *FFE074E09452B34212D4AC1E453B3AD2605617AD bac$d
2,421,613,778 *FFEF17CFA4AD269429D64D91FA633CFA0BB8493E BALLSPORTANLAGE
2,421,613,779 *FFE3E009980D09A8DEB01714B5C4302A67914419 amphistome
2,421,613,780 *FFEE67661EB189C9E9722C66D636A3A5A0EB8173 BARTGUARNO
2,421,613,781 *FFEC42962A3312334BD0A6103174B5408D45C350 BASHO'S POND (PART 2)
2,421,613,782 *FFE853C84A8959D65C515A61B54EF8FCC7011A2F BASKETBLUCAS
2,421,613,783 *FFE774EFE59459F3F8AD2BAD873952D2EABFD213 BATEMOPA
2,421,613,784 *FFE77FF9D1B2F19038B79A8EE3CC75D8EB9C9B18 BAUSY
2,421,613,785 *FFE35AE83F1A520555F5B3B6647342638854E724 B$BNN
2,421,613,786 *FFED63463E94A59631B355BE1D5BF734E542E319 anibalsandrock
2,421,613,787 *FFE3F983E8E95B6B5B91C4B75A1739234A8D37AD aniuh
2,421,613,788 *FFE0CD9B9F6FB5CC6535FE36AEACD78C7F1E9301 BEDE735
2,421,613,789 *FFE119DC913364F6A2A9AB0503ADDCCD12AAE761 BEESTC
2,421,613,790 *FFE376482B91C41E645D540FA22B3F032DEB6A0A A;O:#
2,421,613,791 *FFEBFFF960431EAF0ACB83629D4228D3878D95CA aoq#g
2,421,613,792 *FFE6B4719A2A429361D4D7FBBAE15EBA82F50FDB benjaminweegar
2,421,613,793 *FFE0F09D5E57270A6561D6A88599E0AA64E3D0A2 [email protected]
2,421,613,794 *FFE0FC6B2D8342785AC7A247323048DF6AC8BC03 benno-magnusson
2,421,613,795 *FFEEAE0CDAFA203341E35641F63F494126EA36D5 BERNIE.DROSS
2,421,613,796 *FFE175EC479C209C269D455FB7D6EAD5ED34B630 BERT.DEKOK
2,421,613,797 *FFE622B476BD84A16EFD58AFC694F355BEEA17A4 A/QAW
2,421,613,798 *FFEF0FBA7B7FAB5750F6627413A24D6F09380B3A [email protected]
2,421,613,799 *FFEAC6BD8FA2609DDFA2F700E29373001EA52AA0 A#r2
2,421,613,800 *FFEFED11463E9458B1F0DD9CD72083A1DD153B2B [email protected]
2,421,613,801 *FFEFB9843AF280B9F76DAD5BD36C95C72B29E8AA ARCABAN7
2,421,613,802 *FFEF184EE5D86FB684F8D3E26ED149FFCE7683FE B;&FE
2,421,613,803 *FFEEECCE2C506D4F1BBA15D92F58A2B16D05F6C7 bhagawati.lamichhane
2,421,613,804 *FFEE881E611160E98C40366441F099762C3524CB bhb4d
2,421,613,805 *FFE50B88E5139A66E1CB9E2C29051DD3DF46FA13 ARNULFO.WAUFORD
2,421,613,806 *FFEF8F1F340F201E757B4914E7DBC51F9B809C8E aronleapheart
2,421,613,807 *FFE6D5B8A22A0FD508520BF97845257E2A4A9C1C aronmadere
2,421,613,808 *FFE037C2FD9F65CD3967AD71D6D224AB44382636 arrqi
2,421,613,809 *FFE0774DDA8625D389957D2E9F506D5EDFD47EC0 bigjokering
2,421,613,810 *FFE73D7D01A5AE02BE2CBDA2AF55B481C3915A78 BILLYMULKEY
2,421,613,811 *FFE49CA2EFBE02F4B8706FBC904328F5A404F11E ASETAMOTED
2,421,613,812 *FFE39737A28E98F38E0CB7E3FB4E05B09BD425CB A-SF#
2,421,613,813 *FFE534CDB5CA8B462B649C086AE9D5091CA2D7D6 a sherlock holmes suite, op. 81: i. "march: the game's afoot!"
2,421,613,814 *FFE236E1E540C8C4E70E77E93958C61E008C4D3B asl$b
2,421,613,815 *FFE930E2AAD7F42CAF50273A1EA0649B55FC482D bk20
2,421,613,816 *FFE346B128B0B0598AF6ED8F4D0CA05D37D1D81B BK:q
2,421,613,817 *FFEBCC21608579E7446613E22A34A9DD744FCA41 ATLAEMAA1
2,421,613,818 *FFE6C579592E43D7B1EC3426608545A2827CEC4F blakeviernes
2,421,613,819 *FFE3B035283C84253BE312CC55A4E003A8AAA0C2 attentam1
2,421,613,820 *FFE329E06E69C0975ACE2B8D8755835B1C5BB431 augustusjanis
2,421,613,821 *FFE8A0E76EA221E8B867135C9D5E4B4AB29D1EEF AUJ2#
2,421,613,822 *FFE23DCA730730EFAECA7D54E4214CF8B12B6520 AUKSE
2,421,613,823 *FFE02EC84349E4B78CC748667A278CD9E607504A bm&hc
2,421,613,824 *FFE07BA0BF4312D30028824C53DF4597007DC61E BnR
2,421,613,825 *FFE3DB1531D13BA5ADB7BB27B7B11B56B98B0F36 AVISO.BORRAR.ARGUMENTACI
2,421,613,826 *FFE2A3CA97A16CFE43ACF73D227E2EF039BCA9E3 avneetases
2,421,613,827 *FFED916E4C61E6B15ED1846A95BA27D544E60980 bobmacrowski
2,421,613,828 *FFEDCE362547090F235B3232B97741A90F584B9F BOICE로
2,421,613,829 *FFECD462F60C70EA0396CCB8525E221F2324383F aw#hc
2,421,613,830 *FFE00C0C718BAF467FDB039CFABB1B3EDB3B0083 [email protected]***:p
2,421,613,831 *FFE869952AF081F7803994C5703CB893A7F3EAF1 bq2v
2,421,613,832 *FFEE82252AE61DE37CC44A2F9EE0A967FB209143 broken.(the.enrapture.remix)
2,421,613,833 *FFEEA5C60C3795144B60216F21A2372811844898 BABYFELIX
2,421,613,834 *FFE00E69EB9D6789768D5B1E5B69ACFAF8B4A360 brutes
2,421,613,835 *FFEA6098221E7C49D5C80872069AF40766069011 bs$am
2,421,613,836 *FFE717C96F874589B00D9288446AB6F44F20490E bsv,t
2,421,613,837 *FFE9A68EC7CB62D8CCC44A14FD0F62C1E5C1E172 bäulings
2,421,613,838 *FFEF7726FBA15DB44B7690E2853573D53E6CEA44 buddygemmer
2,421,613,839 *FFE3FD09DD1807ACDB645864F94C513A14D78907 b-----b-~-`-)o(
2,421,613,840 *FFEF7A1FD55F07B9BECA2C9C45BDC2C2555C2263 BCTRTXNS
2,421,613,841 *FFEEABEFC1EE5D9DC33ED544D622B3871DB4E9FE BD
2,421,613,842 *FFEEC2CD1F55BB4EC6D8C0E53D745E7CC59EA0B5 BX_
2,421,613,843 *FFE7A77695906A784D2C4FDC974BB225DF86F8DB BX31
2,421,613,844 *FFE1C0CBADC29063F1801F62F50AB905CA794325 BERNARD.SOLESBEE
2,421,613,845 *FFEF00826DF3F9633F88AC5279D83701B8BE2A21 BERRY-FUEL
2,421,613,846 *FFEDFB8EC5D1C5E53D109F613894B7F474D17ACF BIANCA ELIZABETH
2,421,613,847 *FFEC29652AD36ED10EBDA4123E39A31A29D8FA78 calgon!
2,421,613,848 *FFE9F9B6036C58AA04526BA22F292D5450B20327 BIKKIWIND
2,421,613,849 *FFED85E744E5043CDB34722B6360E4F4397A50BD bitolsko
2,421,613,850 *FFEF2A470343729ACD02BFF1384B63AC580BB164 carolmerideth
2,421,613,851 *FFEC7D4CEE8CCEF958F2D3953A48C9F9425BCCA0 BKCG
2,421,613,852 *FFE6EB47FC699C0AB8D3B8BE7840A18D329DD292 [email protected]
2,421,613,853 *FFEA85D67B4ED6D84B729AA4771562D666D3B4A7 bl5cs
2,421,613,854 *FFE29C3E29C1F28A21CE98B040797491B24C6530 CA:VW
2,421,613,855 *FFE078E3345254EF80CC7BE305DD3A449C58D88B BLAKE.ANSEL
2,421,613,856 *FFE411DF3D37E890D5DE932832E41E3560540BBA BLAKEWEINBAUER
2,421,613,857 *FFE8994B55568881EE715D54CD64E9222AB0D828 CBU:S
2,421,613,858 *FFEB015028A867A0F5B36973C0C339820B330A48 [email protected]
2,421,613,859 *FFED540E6639A50C653FFEBCE2B51935C81EF86A ccwuz
2,421,613,860 *FFEBC9062CC3B94C224BA6127217380424889014 bnc:e
2,421,613,861 *FFE10D0B9EA61E534679F2AEAA52A8FDBD13863E BnR
2,421,613,862 *FFE1567B7243FA6BC36D89BAAC76176361ADD545 C?GD/
2,421,613,863 *FFE7CE1BD02AFF7BE7B76FC78E8EE393D75D71D9 BO.SINON
2,421,613,864 *FFE2224388C008DB2110FF7E59457A81A655C8DC BOSTON-BEANS
2,421,613,865 *FFEF7D57468CA6CDDB796B5B63428E03362DCD14 CHADWICKLUU
2,421,613,866 *FFECA790F248799375C57E3508B93AE5A3E5D239 chambersymphony,op.110a:iv.largo
2,421,613,867 *FFED2194CF59F2989659CF376434376D3C4791AE [email protected]
2,421,613,868 *FFEEA50785979BC1FE1C72F72E96E15300C0FDF8 bp,f.
2,421,613,869 *FFE70A52B44C933C7D661363042BCCC9EC5E9594 BRADY MORK
2,421,613,870 *FFE30908337C3FF37A4D796B97AEC403C1A2B824 bree-seanna
2,421,613,871 *FFE26DB8A90E43D5481BA901AFF3690BE982AEF6 brettmorkert
2,421,613,872 *FFE0F2CE74802D37FFD06BD0650CAF86DDAF0546 BRIA57
2,421,613,873 *FFE22C90E7C83E15C8145854F9E4F78F419C05EE chytrium3
2,421,613,874 *FFE2CE85CB27589DFEA9530B8C6E9292F52C3E56 ci12y
2,421,613,875 *FFEFB3E83EFA616B8C03BC59E2DD8314E567F1BA BrLI
2,421,613,876 *FFE62661268CA4465837A0CDC3F065E55546AA53 CK-9G
2,421,613,877 *FFEAAA53F59211F3F88FB6B875BFBF70A5C9A35B [email protected]`~.splat!
2,421,613,878 *FFEA1947B770B4EFD5FE00277C0E73EE3557BD27 BSS_W
2,421,613,879 *FFE14A0112D5C49BBCA1900D65F6CAF6A6BA6F4C buckfredric
2,421,613,880 *FFE4F84043CAC8663889BCC225A02DBE8AA227A9 BUDDHAPAÑÑATTAṂ
2,421,613,881 *FFE15870BCA3B18926E6D09FA0AE05FC003A464C BUDZETIMA7
2,421,613,882 *FFE44D6E07A2E32A0839A472E7ED8EDCF572362F BUERGERKRIEG1
2,421,613,883 *FFEAD95408C6E6F6A9371D0897D969C9C61313D4 clsj
2,421,613,884 *FFE31831BB353E1AA07523FA560B3886D1435BB2 [email protected]
2,421,613,885 *FFEA7D84D1D1220A359422EFD2B4985A7DD42747 cm"cd
2,421,613,886 *FFEC44D9A62F2EAD91C08017D4172F15B0E601F8 CNRTI
2,421,613,887 *FFEA50DB6BAEC20A5E598CD4E8B02CE026003536 bw)yu
2,421,613,888 *FFEE8127F2AFD99447094A9C667F227485DC77B3 colinobenauer
2,421,613,889 *FFE4A72D13956FADAC896A046147CCA4368B4071 bx7vw
2,421,613,890 *FFEFC5A4DF324D06F5CE9D85B6246707FCFA8A02 BY._
2,421,613,891 *FFEDF4B391B96ACF618085C29C77E15626909958 c%#0_
2,421,613,892 *FFE1C03AD4B62DAFF094DF176638B86B22E9053B CONG.SHAN
2,421,613,893 *FFE3711966CCDEA288A5C3CA030DC76A1C48C9A1 c-0k8
2,421,613,894 *FFE456BC859F146669E8CE41563150D7D96A284E CONNIE.SITU
2,421,613,895 *FFE2D19008E9D705869A3DEC6B6555AF0EEED113 conradlimas
2,421,613,896 *FFE47C2E84D08CFA6753B82A0C248ADE60E710B3 c1voj
2,421,613,897 *FFE111EED455D4526D722D50609A17FEB3DE3FC0 cordillerasdetexas
2,421,613,898 *FFE536D2FCD0248226E3FA2796B1A99871C5A8FA CORNELLWILLE
2,421,613,899 *FFE9ED8071216424060FDCE3E1E26FCB55DD5B64 CORTEZ.HEGDAHL
2,421,613,900 *FFE60F57436D083013C3E0C87BF4FA08CAAEEF7A c5hpi
2,421,613,901 *FFE5E6E926DC332C39CF0EA259176CF2BD4F535C ca1f
2,421,613,902 *FFEAF3F64607CCFB5B9E34FB35FBDE36122D0F86 cristine
2,421,613,903 *FFE2E015897EBA297754D1280C726BC7DB3F8E84 CAMERONSANKS
2,421,613,904 *FFE2CA7A0A1C6C90C7FCAC9FF2D769E1508380BE camino-interior
2,421,613,905 *FFE8A13AF826EF41860D1A6E0BCC3E9A4C9F59FB [email protected]
2,421,613,906 *FFE47FBEEE6C383C0FA28F3AB9C799A13C3F6005 CARDIOMETABÓLICA
2,421,613,907 *FFE4CEBB88FC5D75AB2D5A8E0C8704A44F1823DD carltonvenerable
2,421,613,908 *FFE749E38618A3F643A4D3AE7A23E651775B82B0 ct5s!
2,421,613,909 *FFE3CE0F815D256DFCBE67763D90C00A9F50CDD2 carolreinbold
2,421,613,910 *FFEE4E19028EE879F7D000706EBCC709F78B7EB2 carolynswearingen
2,421,613,911 *FFE339530B2C5FAA94979D114E315C128B59FE8C ctt(+
2,421,613,912 *FFE5FF6EAD57177E273D3DE93D0F38F19A30032F cu1:j
2,421,613,913 *FFED1179E7DF6D4E69A169EC684D24A233808D34 CaseritaVillare
2,421,613,914 *FFEA914C6CF8F0EEE7CA80CB9EFAFD5F2E4B422B CASEYHEITMANN
2,421,613,915 *FFE36FA36E0DCD43DA0DDFCCC74904B966FF01FD cuea)
2,421,613,916 *FFE3BA683A33D6F3E46A13116D4381AE776BA539 CATALIZZARSI
2,421,613,917 *FFE60343C3B45E2F6D3A272357BE3399B1DB909A CATTELLBIBLIOGRAPHY
2,421,613,918 *FFE5CB081EACADD380F661899137F790655F4B1B cumuloolumuc
2,421,613,919 *FFED9B43F4AB74AA08F2A63AF2E37295A82E2AAD cy1rl
2,421,613,920 *FFE67A0CDBB46D50FE80312E4947482C3AF7BF4B ce.5,
2,421,613,921 *FFE798A485A88FBA158286684D972888785270DA CECIL.DOBBERFUHL
2,421,613,922 *FFE5BCBA19BEFA5A63D9C003C312202E82C307E6 ceo兼coo)
2,421,613,923 *FFE5BD211FF6EA95E9C7ADB118843A2C446F2EDE CERASALE4
2,421,613,924 *FFED496C065CC35CD7039FB51D0FCF417AE75942 [email protected]
2,421,613,925 *FFEB69C17F22815F6BFC9686E764D2D3DD774E14 D1GVR
2,421,613,926 *FFEBA74B833DE41606410FBEA821FB860A6F2A0A charleystevick
2,421,613,927 *FFE794FACB6E32F286A1DB3720FFB9A8B3D49429 chasereaux
2,421,613,928 *FFE30C4876EBAA41019AD123ACA191670D08679B DAGLICHTSYSTEMEN
2,421,613,929 *FFEE23EBA3F141B5A06C6596CDCA823B29CDF198 [email protected]
2,421,613,930 *FFE36D86B37E02D320EF038F517FFF53F6299F50 [email protected]
2,421,613,931 *FFEB5ABAE61DD3C65D3CFA08F4E4E76064594195 CHERRY GUEVARA
2,421,613,932 *FFE7CB487099BA26D87644F733A044CC383B3735 chesney.tedder
2,421,613,933 *FFE42149D9F1DB4ED35E9240CF098DE167B7A9D0 Dakota-(demo)
2,421,613,934 *FFED1FA78767C30DC001991D4ED261A033B2AA56 DALEDERIZZIO
2,421,613,935 *FFECC27725CA6E40C6578782726EE7A6D43D2AF9 DALILA.
2,421,613,936 *FFEB301C33DB3079F4F5149A178CB6C05BFA5CAC DANABOLICH
2,421,613,937 *FFE08743D8E97EF53BE75ACCE6D1DB98879E1092 DANCENBRITT14
2,421,613,938 *FFE8B677616B10ECBDC9944CB1DC5E0643EB8236 DANDANUN
2,421,613,939 *FFE1E20E9C50BA7A0E9ACC36D1BCDA13AC182275 chrishidrogo
2,421,613,940 *FFE6113F545C140D9C435D70EA30C20D6FC6D280 DAN.MULANEY
2,421,613,941 *FFE8A37182AD3433737AB3E319FD579B4E619B5E chuckbranner
2,421,613,942 *FFE4B101F7B881A5B67A0531111E0802B681751A chuckwignall
2,421,613,943 *FFE1F0820F377B60C9B27146F7BE4352DC69B522 DARKSTORY
2,421,613,944 *FFECCBF60E105859E32C265C5CEDEE67ED168F63 C;IFM
2,421,613,945 *FFE9AB69A2627A8C0C8E45616B1FAF88843BBE0F DARRICK.SEGUR
2,421,613,946 *FFEA9F0FB4E38090C4185C4B1FFB4A0EB19911D9 cipyy
2,421,613,947 *FFE0FFA8D940784B67D5BD5ED4B512150B652DF2 david-ak
2,421,613,948 *FFE722D7D52CD66C35750DBCDD3DA1F0C9C0477F DAVIDCHIDSEY
2,421,613,949 *FFE73A001049CDB941E90F881107267F9D8A87DF DEBIBMINU1
2,421,613,950 *FFE2CDB88ED90B64D7D62C5F6A2491E359D5AB95 DECRÉTANT
2,421,613,951 *FFEF88E4297CEF03A6151DE0456BF841AE9A9433 deekshamadan
2,421,613,952 *FFE7AB0D9645241234B9BD9BC79A4BA1A0ECF154 [email protected]
2,421,613,953 *FFEF47B9F10FABFC57EE62A3443D4539B09EFF78 de#k1
2,421,613,954 *FFE1F1D47B780DBAD7E78CE8FC43A47657C9BC1F DELBERT.JUBEH
2,421,613,955 *FFE9AF14A10940F26387998C0915A328B97B465A CN5b
2,421,613,956 *FFEA7118F4E352485E10E33638D8DF69FED86BC6 DELLANEY7
2,421,613,957 *FFE965FD266B483E22B96F3D8E8E3FC139A1AE46 DELMARRERUCHA
2,421,613,958 *FFE9E4AD7A180C59A89B5942F655AFE7347C7F05 DEMOOLGN3
2,421,613,959 *FFE70E03E1A031371ABC41DBB499096A88780F5F desengagerons2
2,421,613,960 *FFE22DEEF2595BECCAD5CFF873903B1DDF4470F0 COMMONWEALTH.GRANT
2,421,613,961 *FFE65A942D5E2B21155714F9AD862455666426F8 DEVICEWHICH
2,421,613,962 *FFEB1CD7A06EA7BA0ABA12AEDA80AA843E26AD41 DEVILHOOD2
2,421,613,963 *FFEDD1A7CF8DD4B673A301BB7DB07D8EA70E045E confortava4
2,421,613,964 *FFE3222DC075A623CA70BF723222D7CB5F32313D d(!ey
2,421,613,965 *FFE96C309558FB6898155A4A21C476470A2FD124 DF.%E
2,421,613,966 *FFE2605E548462313D58C04D976B4E1BCD0088E3 DFUV7
2,421,613,967 *FFEDCAB27C7D8571C0938B8CA98ABFF8EC2AA0DC d&&hg
2,421,613,968 *FFE351F55AFC233A5EBE04F1DB7238D4587670E4 dh&kv
2,421,613,969 *FFE811B4F8D87E965B29406D35586B64F4F32EBC DIANCA.MILLER
2,421,613,970 *FFEBAA55CFCB2D8D647FD7103B717E9C6F6003E2 DICKBLOOMINGDALE
2,421,613,971 *FFE247339CD4C3FD26100E183B0C1E678298E898 DICK.JIMENES
2,421,613,972 *FFEAD3A754DB73BD04062CA5FF7C8D9C6ACFA507 die frau ohne schatten, iii aufzug: vater, bist dus?
2,421,613,973 *FFE829A8C87A3C77D25A19B6ADC8F9A7D96B997D cpthr33
2,421,613,974 *FFEA5B5AF1D86F913AA27DF01025AECB8CE6F766 CQMV
2,421,613,975 *FFE00A6DF73C363F9BA936F37279C39BC3C86C37 c=+r"
2,421,613,976 *FFEBF03D2D9593C2D002C549C5019F06A48E006C [email protected]
2,421,613,977 *FFE64E10EEA19C3A775FDDC088AD857DA0E70D8F DINOSARLEY
2,421,613,978 *FFE8F7B895C6EDDC42D95753B5C1A342417E70C9 [email protected]
2,421,613,979 *FFE6EEED32FBA71DCAB2A2C715202381A8424352 DISEDIFI6
2,421,613,980 *FFE0DF84A97F4D4D1853B1C251A1B612305CF74F CrhI
2,421,613,981 *FFE32D38F53CDC7AF8E45F58B76E15D69CFD5F72 djhm6
2,421,613,982 *FFED1B13B450A37547E084ACC255A1DCD8BD8A27 CRRQ4
2,421,613,983 *FFECB289D52FC77047542923225CBCA0DD324224 dmps;
2,421,613,984 *FFE0508E7B32872604D21C358B9EC2F3F4651114 DNDQE
2,421,613,985 *FFE4C941484800342E26EFC354ACE2F5332FAF81 DOMINGO.STROMQUIST
2,421,613,986 *FFE80B6EE1244393CFB16A0844783E06A3B56D58 C=W8M
2,421,613,987 *FFE1A449FB66065E5EDD417504929C84F72FD176 DOMINICK.PRETY
2,421,613,988 *FFEA51E8C20C0B1AEB33E8DF7B415D5458CD46A2 DOMINOSPELENS
2,421,613,989 *FFE32258FA954B3591D4AA381C1533BD39D81274 CWWWO
2,421,613,990 *FFE3B08AFFE45472DFF537B947BE14DF7FD07B3A [email protected]
2,421,613,991 *FFE8DD3C46DB1A234952B8C7A6A120E33B7F5913 CYOMOTO
2,421,613,992 *FFEDED95E8744C4CDB30F58B0B7C4A24D15734ED CZXCVBNM9
2,421,613,993 *FFE55BBDBF663308862E5E21BD9387A1D168F815 DOUGLASSELPH
2,421,613,994 *FFE59E0DD7896BD5FC3EECFA55353A30C3C345A7 d028=
2,421,613,995 *FFEB67DBE19D80772E8033A88855F68B5216D86F Dp7B
2,421,613,996 *FFE64D36F26B12DA02BDEE71EE3CF32F32E7A947 dr7%k
2,421,613,997 *FFE227313447327C7B4B17E2E724A19FF42A5F8E drewengebretson
2,421,613,998 *FFED71D6E770F71C1398956F82D92A3A793DA589 d6h4k
2,421,613,999 *FFEDD84A04237B0CE16934382058AAAAD0EC682D d#"&7
2,421,614,000 *FFE73D9D6FCE45E888018C19FBADBA33BD0BED38 d#&9b
2,421,614,001 *FFEBE2C38F09B6B32F8DBB127895719455E2F49C dso3p
2,421,614,002 *FFE2D0BE93B26739BD155C2AE8C654D2C0F9963D dudehelp7
2,421,614,003 *FFE626186DCDAF44E51DA592056A6DBD407DF695 danielblasko
2,421,614,004 *FFE67E1A9695172839E637BD0ADD1D2A7A59FAEC dustygrandbois
2,421,614,005 *FFE38F06E94354A893503979B7792D2BA1F78A6C D.$VI
2,421,614,006 *FFE2DCD0844A9A03CE9E143EF0E437C52AF44CC3 DARRELLPOLSGROVE
2,421,614,007 *FFE7A851429EFEDEA7515962A3D261F83CF86C95 DARRELL.VELLUTINI
2,421,614,008 *FFE59C796A4596141ADBFF4B6EA07AFD1F7D232B dw-!8
2,421,614,009 *FFE629A7528DBF132F9BECD72524B85941B5A13F DATSKCIR0
2,421,614,010 *FFEC7DDAAED382D785B06F0FB682A209A2586F4B dwurz
2,421,614,011 *FFE0BA3DC51C63338B6C463FA6A0672736EB3D88 D_Yb
2,421,614,012 *FFE21EE65EEC92644B3ADB0A1CB5A5F8555CD242 DB4#
2,421,614,013 *FFEA38C9B3177F07AF0B579DB762E42A34362C01 DZVUFUYG5
2,421,614,014 *FFE2555F6284C42D80F381100D2B939CDFEA1754 DB=WG
2,421,614,015 *FFE5352CD15733E789D9A1D93302E3E3E07F9220 <DD><a-HReF="#1.4">1.4-CoNTRoL-oBJeCTiVe</a>
2,421,614,016 *FFE73AED4D31FA5811C1B86DADD59B21B966EDD6 DDGQV
2,421,614,017 *FFE41408D622170596CD6602EAF1B13BFEE3AE4C ddnt#
2,421,614,018 *FFE525EC873177D9D26D6AB9C69209EFF5CEC4D3 DEANAIRE
2,421,614,019 *FFED76E39C308534CA898AE59BDAA110FAACA7A5 DEAN.SCHONINGER
2,421,614,020 *FFE92E51D99A1697565C1E4659FC78C8035A4AAA EDITKCOH7
2,421,614,021 *FFEE2D58BC7327263377C3D2B3D46880BBB29317 EDKNOCKAERT
2,421,614,022 *FFE0CBCEB240A5704F5437DED5E5DF656C21C32B deetroiano
2,421,614,023 *FFED11046527035F46FCAF1B7A1F0554C882729E edmundreiner
2,421,614,024 *FFEDC739BE470916748CBF7B1AA1058CA0F7C0F5 EDPENSON
2,421,614,025 *FFEB7D36474BAF85F473159393FCFD0A5FEBBDE1 EDWARD.DWYER
2,421,614,026 *FFE6740A7B31C5DD9A3062573B20B43FDAE27992 eea+s
2,421,614,027 *FFED80B34F655F7E8E84CBD260C4ACFBEF6A2C50 EFG_R
2,421,614,028 *FFED85629EAA08A6DD32D83ABB82C1B47201D3C7 DEREISTIC123
2,421,614,029 *FFEF4EF52FFEE14CEE5697F8637C7320FC8DA4AC derek-schulze
2,421,614,030 *FFE090C3BD4A917D1A98C8313471F4A2FCD16B11 EHRISAAUE
2,421,614,031 *FFE93729708DFCA1ABBD222782A77DBF5DE5B0DB DESAFOGAS1234
2,421,614,032 *FFE9E81BAE54C5C9118100B6917D82811C7C6508 DESCRIPTIONDEPCTION
2,421,614,033 *FFE350E00D6EA7EDF5BE110AF9604B17207C02F5 DESHERYL4
2,421,614,034 *FFE7457F70A269ACDB509AB77E6A409CB3A6D877 EITSEDOM4
2,421,614,035 *FFE53CFA42464B9F60F320BA992F54BFA2E076D2 EKMH
2,421,614,036 *FFE24EFE32D8E20F9A240BCCBB0E8086D02300BD ELBUSTO6
2,421,614,037 *FFEC571343DAF7C7A6C3A4114385A886F76CDC01 dg)+
2,421,614,038 *FFEA5E44CD61C6A7E177BC7FDB21C59D1F617606 ELOY.KRAPF
2,421,614,039 *FFE968BC061CB4EB7D74337410DB9C3386E5BB29 elplaya^(
2,421,614,040 *FFE41E38E5361DBC61B83D099DBE23F631EF16C2 ELYS
2,421,614,041 *FFE0528179CDA91E8A93836E33E2565AE14BB835 emerycunnigham
2,421,614,042 *FFEC2D0998C64DC17C885ADBF77B12A3C6B00543 EMILIO-HERRERA-MU
2,421,614,043 *FFE1069EB90777D8855B167827018B52427EDA5F Emma-Meets-Some-Jazz
2,421,614,044 *FFEE6B22AF9F29441BFE82B041817ACA3F88199C EMMANUELOHAERI
2,421,614,045 *FFE75F032909F4E0B3813BB38834319CCA0A5843 emmettcascia
2,421,614,046 *FFEB6DCE6FF3C402C442967A3CEB2B191A1A6792 [email protected]
2,421,614,047 *FFEBB0A79E8E50000C5C477AA9BCBCC9BD8DA0FF emuitomais
2,421,614,048 *FFEDC8877B231D3E01A2C83EAEFC5D7AD25BC64F DIRK.CANNIZZO
2,421,614,049 *FFE2E34F2D657D9A9590339B52A6C56A257F436B enhelmed6
2,421,614,050 *FFE610326F9C9AA288130F90A05CD3BDBEE153E7 enmaz
2,421,614,051 *FFE612BC0476AEE54F625BF7D050B194C77A600C DJ[E
2,421,614,052 *FFEAF76778F70E9BEE37C7D4381472EB57F6827B EP?A4
2,421,614,053 *FFE2D600B97B8BAED91BE12DBB4E5B9665063D47 ERESILIR2
2,421,614,054 *FFEF33A760A95246138000FE8E4D8A5F536BA290 ERNESTORAVELO
2,421,614,055 *FFEC4A2398381208051B97B375200D3036362184 dmr sidekick
2,421,614,056 *FFEDE513AFA2C5A720F4B47788D4B49A667D2974 ERROLBERKSON
2,421,614,057 *FFEE9BA50F9EC173FCE49FBE2D5B43B0DAC37DB0 dnah7
2,421,614,058 *FFED9145E4FFE31DBAED2B0CE6817FAAEBA5B22E ESIP12
2,421,614,059 *FFEEB5DDA5AA0C27EF20CA9B2ADF611384B1D1D1 ESMITHERAM
2,421,614,060 *FFEBDB70BDE7B8ABBF3A5555C3768E8306ECE3D3 ESQUERDA5
2,421,614,061 *FFE74D19A612D7649F182CBA8E415C7D68913BD9 ESSIACNE6
2,421,614,062 *FFEBD8CE0971820AB4EF2DE5B36805029FBC1115 DOI10.1074JBC.M30317
2,421,614,063 *FFEABC69A46A8FE2A2DA59DFD6F583514873AFD8 E$TABLI$HER
2,421,614,064 *FFE35C9F10B39417D859D35B67D509E511C50D28 DONNA-RAMKISSOON
2,421,614,065 *FFE4F174E1214E4F15768DFAD9E2E395D9E6B1FC don'tcry,cherie
2,421,614,066 *FFEA0AD67AB5A8E62E5134D32C4AAA8364DE4C06 DOS-FAT
2,421,614,067 *FFEE125D49682A36CC30CC38E1C5CD6129E363DC ezolenniz0
2,421,614,068 *FFEE62F0BE8A5DC06F00FBA962B2F3A43C88F1AF [email protected]
2,421,614,069 *FFEDB6CA8361841FDE57698BE8D8FC433C952015 DQc%
2,421,614,070 *FFE9344B2DCC7F8E658BCFF73726B5A2462B72A6 DR69Q
2,421,614,071 *FFE1A57B011A3DF26CCF3E1FAFD601C3EB5C44D6 d+r(k
2,421,614,072 *FFE2A10AE2A1F4FFCB7FF5A8AA76A0B59E07445D faustinoroux
2,421,614,073 *FFEEF07A7D702BF34EE1F2F26AFE7B8E828DEEAA DRR,0
2,421,614,074 *FFE4416F8A32B19B9150FF3E441D45BA0AAB1733 D-SW5
2,421,614,075 *FFE17A995D16FD3A53C0B30C69AF51A892AA55D7 FERNANDORECINOS
2,421,614,076 *FFE4422CE386DB7E4BFC5F6CCF6279300B6FD6B4 fhop
2,421,614,077 *FFE3D99DAEFD650F2FDDCC70D70688EC09252D6E floating.miracles
2,421,614,078 *FFE2429C121971A6F6D25E7B8F5491961180155F FLORPINTOJ
2,421,614,079 *FFEF7468C000477203958CC936CD2F1A99BCBD32 DVNAV
2,421,614,080 *FFE1AAA43B264B4393F4A692DFD031D611E3ABAD DXX:L
2,421,614,081 *FFE01C68360828192A33D77EED4ACC70030F1FE9 francebastien
2,421,614,082 *FFEACD6740C15409134A99527D29C1D8B6CFEF4A FRANK.PIPPITT
2,421,614,083 *FFE9F81B95C1315F1F34F043235AAD58C8225D7E FREDDURRE
2,421,614,084 *FFE22778ED4730236053BB69ECCA84F79EC7B9BE EACAL
2,421,614,085 *FFE48BEF03DCA0E1B0056BB50EB163DE088C9868 EAO$F
2,421,614,086 *FFE6F9DB353FBFDEC64B5A451ECF9D61E36ED4D4 [email protected]
2,421,614,087 *FFEC5EA8CC3BE38854386E76D7A1E8DA61FFA338 FRITZONESIDEDOUTOUT
2,421,614,088 *FFE9F00F018DDB96B1A98CD2A19E7D64062DB546 fsaintbricedelandelles
2,421,614,089 *FFEEF2BDC08D69B71F89DFA560D5405A5A6550D5 fspnngaeid
2,421,614,090 *FFE9BC7A5B5F8C2A1951B2CCA1C584B465BBD92F FUDI00
2,421,614,091 *FFE978F0202C6703F56832069884F9B2930903EE fugred
2,421,614,092 *FFECEA6B093CF0AFDF3826223721E2A7C161B637 FUTUUCHO3
2,421,614,093 *FFE79F4E1B2241F1318411506F360D6BDCBE102D edhollandsworth
2,421,614,094 *FFE4FECF08C7AB88B0523B6EA1FD250521151092 FYRZ
2,421,614,095 *FFEF1B5DAAF07554800AD7FFAAB50A7C00B0CA2A g100m!n355
2,421,614,096 *FFEA2E1C5BABCB349D2D27784B339376D3FCD9B8 ee:c)
2,421,614,097 *FFE08CD3BC07FA2AC36F0AE050C8081D175839C5 GALE.EVANCHALK
2,421,614,098 *FFE3AD65FD227708F6E174EF9606D375C084EBE2 GANGIGER4
2,421,614,099 *FFE22E8A59F3CD4BD9A2F8C18E5B25DEF7BC6728 EG;7M
2,421,614,100 *FFE8F69E45AFB59F3288C3F00B33BF83F521278A GARLICLEE7
2,421,614,101 *FFE23D579107E82F5073F3E35431ED41EA26F8CC GARRET.MARTY
2,421,614,102 *FFE5E22D4D1B316A97ED2B75CC118D033602D72F GARRY.CHAMPION
2,421,614,103 *FFE4ADE176C39DCA84044F8A6E81558948A44DE4 GATORRO5
2,421,614,104 *FFE422407F7050203E37F1FC1504C4D60D246BC0 GEARAKIKANALICE
2,421,614,105 *FFEDB6DFECF646C6F20E1D1E74560BA95B1D310F EIKPEOHA
2,421,614,106 *FFE922C149D9E3A43ABCEA122C85CCE9B921E52D GENESLICE
2,421,614,107 *FFE3239087459FA632C4F47160FEE028996F0D2A GENTE.ORDINARIA
2,421,614,108 *FFEFD5DD158DE098EE9565FDD6485FD3C6BEC9E5 EJE VOLCANICO GUATEMALTECO-SALVADORENO
2,421,614,109 *FFE1B07A1F1A2398F24B5EE50F4208065214AD4B eke4
2,421,614,110 *FFEB4A5B30C3E270436938D288645D48C66A8C1C ekmnhfajy
2,421,614,111 *FFE2B550BC6ECA187A2E8858217D607BB153A087 GERRY.DIPASQUALE
2,421,614,112 *FFE4442B1531718578A0C96DC8D34232BD54DCEA GERRYVASQUE
2,421,614,113 *FFE0F466688DB1551CAC500CE970C4BD8E532485 gewuehls0
2,421,614,114 *FFE98BF9D7BDA49C14D45A773669938CF5BF43BB ELIZABETHBYUS
2,421,614,115 *FFEE0E485262F2A2A1983B3A8D3050DA9FC544D8 El-jodedor
2,421,614,116 *FFEFC0E22B934FA910E93A13FB13FBDDEBFECD6A ELMODAILING
2,421,614,117 *FFEB6FA752742C21A6E7B6C00AA55C7E8477CD31 ELMO.OYUELA
2,421,614,118 *FFE8B451953955F5A52119223E820A506DB17467 GINGER.NUNEZ
2,421,614,119 *FFEAAA77C54D0349338F20F5E82A849C10DE102F GIOVANNILAVANCHY
2,421,614,120 *FFE5DFEBA7172C5706711831394A0738A61F6EDD [email protected]
2,421,614,121 *FFEE4317B13EC2740E041FF95509D4B27C1FCDF2 EM8AIE
2,421,614,122 *FFE6D1C973417A8AAC7EDCE63E5870EF23F643A3 glenntregre
2,421,614,123 *FFE14114C18671704143A01AB83FC331F9F7136A Emportons
2,421,614,124 *FFE4C852D6739156A0C8662AA93903B390F5BF52 [email protected]
2,421,614,125 *FFEF5EDD1F133D65CE5565EFE9FC8796898AFA5A GONZALOTSUI
2,421,614,126 *FFEDD038C2DB0C3363BE137C29BF176F7FF5C494 eng8(
2,421,614,127 *FFED47B7AC247F0F450ADEC92FE5194137B9634C GPCQBB
2,421,614,128 *FFE74BB3AB52CD0F05759F6EF5965CD77804F67F enigmaspping
2,421,614,129 *FFE75CC0AE8CD048F9778A708088565FC5464DA1 ENITUORN1
2,421,614,130 *FFEA01A790E8DA0C525858939FE252DAB6DD3F4E graffiti-soul-tour-2009:-live-in-stockholm:-23112009
2,421,614,131 *FFE122D92ED1FEACBA3020D22A0A525C27F76438 enp1x
2,421,614,132 *FFEC6C1DF0469CD85F4052730C829FE3A8A1DA0E ep$w/
2,421,614,133 *FFEE03618ECF4488B784F3F9D8A530B816BEE9D9 GUSTAVO.NAEVE
2,421,614,134 *FFE5CAC5492B320F0FEC230E6986108997C9C9C6 ERR:T
2,421,614,135 *FFE4F49933699034373AAE16B0929D1D0B2EE568 ERVINFLORIO
2,421,614,136 *FFE68CF37171A275AF36CFECE1652C311D22E5C5 haiesaam8
2,421,614,137 *FFE89D9658C33254083DA8B422BD9E51EF5CC0C7 ESSEKNIJING
2,421,614,138 *FFEB5131F5186D5B038178BAA4300FFFAABA4689 estacion.iyodoi
2,421,614,139 *FFEF5BA4E21369B46C9F06343A3EA6E8B1020362 HAITI,.LA.PERLE.(TITRE.IN
2,421,614,140 *FFE7326E3CD2C1B38814ACB06856A44D4D456F00 et4&7
2,421,614,141 *FFE93E669EC7F6C8F3392FA0FA53E06199C5F1A8 HANDILYI
2,421,614,142 *FFEF08A1930832132F2C76C3E812C45256A054B4 „harwood”
2,421,614,143 *FFEC71A4304E4F34EF92AFDB5F83865B637E59AD heathmalotte
2,421,614,144 *FFED3356B2BE4522177C78D8BDBA152ABB910E47 [email protected]
2,421,614,145 *FFE1E11E4DB881FD31F264F4E04471F864CDAD9D EZIUAMEA1234
2,421,614,146 *FFE1E4E773EEDE3F62FEB65F29704D3BBA350647 HENFALDENE
2,421,614,147 *FFEF0D3086992FDAF7C7A3EC5B843CBBFBA1A0D0 herman.parson
2,421,614,148 *FFEC2CE3474698179356586E63767DDD4A18814E HICKBOO3
2,421,614,149 *FFE1F1AF92CD6E4745D61C4649B6D0DEE3CE4022 fbgetgroups
2,421,614,150 *FFE7AB1DA4A4AA29C88D6C27E2C6BC161CF3BD6D hk_!
2,421,614,151 *FFE7BFB94278B82FD776A42C26944899A4CA1A1E FERDINANDSERANO
2,421,614,152 *FFEDC091209B84EC77050378E0421BC4C174D917 HoldinThatDick(featSlushPuppyKids)
2,421,614,153 *FFE5663D29D5A08892A14A44C72F24A02874EEB8 [email protected]
2,421,614,154 *FFE452ACF04BD94B8A4D5B508C1510F25E3F20E0 HOLLISCAUL
2,421,614,155 *FFE60A5771A5F9D779263161D840CC482AC8D801 FHYAAAAAMAAJ
2,421,614,156 *FFED80BC4E534BAC41DA7F46C138A17F5AA56A79 horrors
2,421,614,157 *FFE009D70FEA76988E358F6B80F0362A0AE05BAE HREF="/GP/RICHPUB/LISTMANIA/BYAUTHOR/A2K2I1BEPW7KZF">SEA</A><BR
2,421,614,158 *FFE3ACE023E8A5FBB4DBBE898D40D2CC06869E50 FLUCTUON6
2,421,614,159 *FFEC7C5B6C4C7D7925D4B4F17E5C8EE8041E8044 [email protected]
2,421,614,160 *FFE5DE3EA3E260774E600A5930CFE22BC9608886 hueyvandekieft
2,421,614,161 *FFEB75D5EEB38457AFE34DEE640754350010BEF3 [email protected]
2,421,614,162 *FFE81921C947875942381F574B0190EC97871646 [email protected]
2,421,614,163 *FFE673A8CC2F1FECCA9D0F3BCE3482F980B07ACF hülfövereins
2,421,614,164 *FFEDC2E6232C67DB8B5C4353E45B818AD6B5A8C6 FRANCISCO.BODI
2,421,614,165 *FFE35EC82D2696FFA4BD46C9D7AD91825ED01F23 [email protected]
2,421,614,166 *FFE557927930115F79B1D995DD50EDAAE94323A6 franklintade
2,421,614,167 *FFE582C2DA1FC2BAD7712E1AD52399E1C91AFBD0 hydrogen-carbon
2,421,614,168 *FFEEAB3A555F11463DC9496E587E75389EFCA842 FRMARAVAT
2,421,614,169 *FFE85EFF868DC5184950FDCC5119514DE7631EE7 IAMSPAZZ13
2,421,614,170 *FFE12F41B2446E9031D88907DE43F7DBFE4C41F1 IAR (GREEN, GREEN GRASS OF HOME)
2,421,614,171 *FFED9B185C70D9F70E50E035FE79D20E599210D7 FU>8
2,421,614,172 *FFEA4089298B0071F1F96BA731BB99104827DFD2 @#fungus
2,421,614,173 *FFEEBC316D86ABDFB906A03564503234E90F87B9 fyander8
2,421,614,174 *FFED93885A75E6D562BB813AC32120465E355903 GAAYIKI
2,421,614,175 *FFE6D1F618632204370FBD4DF091576CD4BDCFDA gabriel.mcgee
2,421,614,176 *FFE8C9ED82E91F7A997FD8F46A7BE22CAE3D7AAA GAILACERRA
2,421,614,177 *FFEE8913C29A2E8F8F22679C354D8D4AAF2B6FCA GAILVANHECKE
2,421,614,178 *FFE93463B716316942C88DE022818175976D6C2D GARRETTWAINMAN
2,421,614,179 *FFEE0D412E4063C6B8BA669D8C14FAA8231D65F5 ILOVEQ1W2E32001
2,421,614,180 *FFE9F33AC1935DC7592F7D30FFBEF90BB11BF889 ILOVERANCID2007
2,421,614,181 *FFE82C137550F48C2B14294CF0873FB1E34480DC ILOVERIVER07
2,421,614,182 *FFED3369484D85D212848B3C42393A2A1AAC06DA gcm-2-0
2,421,614,183 *FFE1DB4C620D20D1365E5DA35A7D75D426ADEE39 IMAGES.27
2,421,614,184 *FFE14E72E31732CACE1FA34E8FA0C7B8563AF04C GENEALE5
2,421,614,185 *FFEEE0CB2CA4D35BEEB8BCAB9E9B56E419079195 GEOFFREY.NAVIA
2,421,614,186 *FFEE3FCB4FCD995F29864B2DA1ED826CD790B045 INITPARTED
2,421,614,187 *FFE50CBD4B1C83143F269FB20314D57604AB78DA intermitterend8
2,421,614,188 *FFEC8ED94FAE5E108C28946DCF6C1269D4ED054B IRRELEVANTCSTAR
2,421,614,189 *FFE2DCC817B5CEC3B0EADCDCA5270ADA1255F438 glenpsomiades
2,421,614,190 *FFE0F731844FA73BA3588F043508A8F032E0CFA6 ISHEDGER
2,421,614,191 *FFEDF76C0E45D60404A07A775D3027F76B185E88 gnupost7
2,421,614,192 *FFEF5B2940BD4F52789C3AEC78D44C610E149384 ITOPILYER
2,421,614,193 *FFE2EF7E21FA5A7E1291F5230CBCF3EE47EBF1B9 GOPHERARTIST
2,421,614,194 *FFE9F732D6EB21399F14719988DA9D082AC72D35 i want out (feat. matchbox)
2,421,614,195 *FFEE4E5B8474D32F4D146067A6225E094ED3DC4B gregcranmer
2,421,614,196 *FFE610AB8DE53AD9373BC56EF2CC2DA861CCD8A7 [email protected]
2,421,614,197 *FFE0304104D0C587F653730B4479070DBDC737BE [email protected]
2,421,614,198 *FFEF489EDC5BBAA913C491A8B78A980507122621 GUADALUPE.ZANCHEZ
2,421,614,199 *FFEB65E78A1D77B14BFDC0F0679D1D552549959B JAMESCHWANTES
2,421,614,200 *FFE0331030A49990D2BA66500326928B938D1C0D GULGAUWST6
2,421,614,201 *FFE61CCF83860C9ECE18AE403A8AD486EED0C83C [email protected]
2,421,614,202 *FFE56DECF7542F3D5374BC3B7CCF168BD23936C4 [email protected]
2,421,614,203 *FFEA975E7B794A400DD2C60FA352AC617F186519 GUY.CARVILL
2,421,614,204 *FFEFC3F8DC60F3E411B9D322F4ECBA965BB83EE9 JARED.ROOF
2,421,614,205 *FFE0856E3A8D57A502B7BBC0E445A82DDFA43EF1 JARRETTMORRALL
2,421,614,206 *FFE76A6A01399F143A0C9BD6BC69A5DDC8954685 JARRODKREUTER
2,421,614,207 *FFEDC2AE67918CB6AEA6409D104E1C2CFBAFB600 jarvishubble
2,421,614,208 *FFE108031088079E20E19F209C0CEC143EC8DAB0 h4wk.$w4l
2,421,614,209 *FFE95880443DC23067F90D3CA1E95B75A7C488F4 HAKHMY
2,421,614,210 *FFE4E0ED0F0475711592325E27DF42910C996747 HAL.BELLOCCHIO
2,421,614,211 *FFEA6D5A6EA2255323DD8CC0E6AEC880DDA3B9F2 HANOINGAYAY
2,421,614,212 *FFE9AD17DEDD6E9CB19EF252B9A8ABE90D7A8B17 jeni-barton
2,421,614,213 *FFE43D0DE9FB63B802EC36D92BC609747A9B82F3 JENNYMARIEWILLETT
2,421,614,214 *FFE7773907134CA74B682B4EEEAC647F121B77D2 HAROLDHANAN
2,421,614,215 *FFE69F0B2F299AAFAC1BAC48E959FE6A502B95D0 JEREMIAH.VERRET
2,421,614,216 *FFE5A32DC128535DE6984A66485E35A88AC00EEF hasan-nijem
2,421,614,217 *FFE9808E146FFA51ED4B3E1761C1DB4E3C6164FE HASTHELARGEHADRONCOLLIDERDESTROYEDTHEWORLDYET.COM
2,421,614,218 *FFEF4F679124AB1B860C3C36778BAFF98557FB0A JESSICARATH
2,421,614,219 *FFEFB5AFBFC627B1984BDD0E5B68BB1CFE90445C jessicca
2,421,614,220 *FFE7419E3EF04379CCC8F5E21AA13F1B3096E50D JESSMALECH
2,421,614,221 *FFE654AA1D2DEE3BBE306E63E41C34D412BA0C9E jessqualls
2,421,614,222 *FFE051DF8C5B868B4ECF1D4A34BC9E2D7EEE3D1D JEWELL.BOWLBY
2,421,614,223 *FFEDAB14CCE74C052C01834C249C8B6787E6456E JEWELLUDERMAN
2,421,614,224 *FFE325AB300282F8146CC448F30606946507E019 HECTORXCOUNTRY
2,421,614,225 *FFED44277E633747DA867E205D3A70DDA401B585 jillfranklin
2,421,614,226 *FFE67808A4961980EAD1C1DDEF2B8C34FBDF7A76 HERIBERTOBRESSLER
2,421,614,227 *FFE684E38159E6A429F80D14FCB149167C743DA3 jnxh
2,421,614,228 *FFEC2E1FFB493147373D97F7570EB9683948D259 [email protected]
2,421,614,229 *FFED81B3A36E134FC44C09AA1ABEDF7ACBDBE13E [email protected]
2,421,614,230 *FFE3D8615870FF917D4436DE07A632F3ED999F71 JOEY.RYKARD
2,421,614,231 *FFE0BEABDD15AB236D2E971930B0F145D0A1E34A JOGGA34X
2,421,614,232 *FFE75FF927C1C3C4D286E54B0E31937AB5FE6245 HOBERTTILZER
2,421,614,233 *FFE8855B13CF1B6D5318C0ABA98D1DCF9E5B9B6B JON705
2,421,614,234 *FFE0BF7B03C1843C1EFA6FD7BABD8286EA25C057 jonahlegnon
2,421,614,235 *FFE8F897AC131DAC056F16589CD0BD3464E0B65C hope.withering.fled,.and.mercy.sighed.farewell!
2,421,614,236 *FFE1C04AAFF818D5E7425D1222D4C32CD73A7517 housekeeper
2,421,614,237 *FFE99CAFA4832FA652923E38EB64A6EA2BCB8A90 judsonhosteller
2,421,614,238 *FFE504F267548CE4ECF84178A800C8FE909C248A HTTPIMAGESGOOGLEDE
2,421,614,239 *FFE1968C8692DAF7BA9D213DAABF73EE778C1330 HUBERTSANTILLANES
2,421,614,240 *FFE2A2271822B193217FC6120EC7FFBC27DD92E8 JURANIICK
2,421,614,241 *FFEC97005E99D30EE02FBEC75A9C65AAF748E4B3 justin-blake
2,421,614,242 *FFE1756BC2ABE4689285CA82F603D6C361B41FAD hundreds-turn-out-to-oppose-park-charges
2,421,614,243 *FFE2220147683CD578BC7E09ED3FDF8D2E37502C [email protected]
2,421,614,244 *FFEC9C2910E75056F489C25BDC4D132173FBA152 KABOTAGETRANSPORTE
2,421,614,245 *FFE26BF74294E64E9352A3AE18B529ED93064716 kaedonnaed
2,421,614,246 *FFEACBD279839CDF3772836BD775AC72CDAD5B1F kaitlinhill
2,421,614,247 *FFE66A1BAA5E1E095305987D9FF386508694161A IAMJAN1996
2,421,614,248 *FFE9AD4EC28B8EEAD3EAC6525E0D1C5F47097792 IAMMAGIC85
2,421,614,249 *FFEB99C09D4F73E12A1E4AEE2DED4F62AA73D515 karlflaherty
2,421,614,250 *FFE85327C3D8BBE4FE9708D68CD23627EFD04FD3 IBURAI
2,421,614,251 *FFE35C672C760AABE7F3F077C9AF96968DB96409 idylists
2,421,614,252 *FFE61F27BB06D1D384FBC1B7F539DB50C8927A50 KEITH.NASIR
2,421,614,253 *FFE744EFD18F1D9447E43651C620053206B0428F IHSAKAW9
2,421,614,254 *FFEED44398CCD7663FA45FD2A4B281E1FDFA76D4 iiiで競合する
2,421,614,255 *FFEBCF129C550A0345CD5F9C4DFBFE4E461341C3 KENETHDANDY
2,421,614,256 *FFEAAEE059B0D93F9F2B820E42D40E5F9D5F2FBD ken.groff
2,421,614,257 *FFE2E03DCB918F7A3B2361C8280B7DF583C9B4CB [email protected]
2,421,614,258 *FFE53BA73A47766A90A6D106A3433963E407B319 KGREBORN
2,421,614,259 *FFE45F3EEA4CDCF8C7F976924959731A161689F1 KHALFALL4
2,421,614,260 *FFEA41A84F5200B03CF8695877639873A56F0892 im1z
2,421,614,261 *FFE7C6B4C8E74E647ECF3A5D043AD2AFC43A3BBD KIRKYARD?
2,421,614,262 *FFEB28B7A8A19069C19C45BABD360DB038B79CC7 [email protected]
2,421,614,263 *FFE5523635CF4DD6ABB542E1E52FE87B38DEA4E8 INFORMIXSNUFFY
2,421,614,264 *FFEF4F63E0177D077CB22E3F7F9E26817AAA2BD0 knlx
2,421,614,265 *FFE2955E1ABEBF5A9287BB83D6C66572D89CCB77 [email protected]
2,421,614,266 *FFE4D479212DCA849F3EEAB3FEE666D9D5EE942C irrigate.'/I/r/@/,g/eI/t
2,421,614,267 *FFE51BFF57B25F5C583BAAF4B3455441D0C8E35F IRRIPARABILE
2,421,614,268 *FFE01D6C119838571536A87CA13F133676680FCC kraigcosier
2,421,614,269 *FFECFABB72662094B17D7C47B4C51075B9B18D36 ISLLY
2,421,614,270 *FFEFC7398F2B70D101AFE0E7EC712F3462091232 KURDESH9
2,421,614,271 *FFEB369F076A30C77975ACA8CF77B359CD3A1D07 JACKIE BOURASSA
2,421,614,272 *FFE319FFACBE025B35FAC91E1658049AFF8AAC7D jackiepaskoff
2,421,614,273 *FFEE1B2389FAB51F1DBC65B3C7E47ED911049AC3 L39sl4+0r4l
2,421,614,274 *FFE3C63876F1DA2B6D42CDC893D9084506394CB9 LAANGELOA
2,421,614,275 *FFEB0E22E27F39336B94A5CB77B25EDA73D27400 LACHAPELLEDULOU
2,421,614,276 *FFEC45C2B55E450B493E2A9006690D0C217A223D lairdlyas
2,421,614,277 *FFE1148845F2E81E02EA07F9A3D46E34F47FE819 JANEY1122
2,421,614,278 *FFE50C9EE02126B34629F49A935A1F1D357476CC landandhispanola
2,421,614,279 *FFE3E09360E6F020AE44CF32F25959B5D0D89C4B laraisondemavie
2,421,614,280 *FFE6D4231A473B0ACE89DF8A5583A74422FB60BB JAXSON749
2,421,614,281 *FFEB217F8D141DCE403F7AD8BC0E57ECA46751E7 LAUKAAN2
2,421,614,282 *FFE3B44B80128F9A2A94B5067A75B44676A1CD54 jean-antoine-de-baif
2,421,614,283 *FFEDDFFAF55417165C69E99109F4D81012AAE1B8 LAVERNE.CASSATA
2,421,614,284 *FFE616F79ADCC5E0BA958D2D5171929E82DE2E25 JEBRANDENBERGEREP
2,421,614,285 *FFE07A49A116EBF3360D91EED181649D4922A84B LBARTCHAK
2,421,614,286 *FFEE48585AF124680FB4F763E292C717C7C4A40D JEFF.ONOFRE
2,421,614,287 *FFE8A7E7FD8C3DA67B1FAC6361165CD363DDA9ED LDAPONTE0
2,421,614,288 *FFE80965831F9EF4099CB5C8AFB29791CEAC4527 jennyspousecom
2,421,614,289 *FFE22D4A9C1F2F964EF13C9787C7376865EDBF62 leitriued
2,421,614,290 *FFE884CB2F9504599CB966B843CC585217239AB2 jerryanglea
2,421,614,291 *FFE49879AEC5DD827F3751927B819F1C59E91087 jessica.m.will
2,421,614,292 *FFE2C70541E8736C0C437DA7DF513D832EE5C97E jexnptg26
2,421,614,293 *FFE2FB301C1FD2979AB6BB608B44313BF19A6777 jhen-eusebio
2,421,614,294 *FFEE98B94A3D84D86D65A247E2D28C8A41D9ACC5 JJFEFM1A
2,421,614,295 *FFE841A8841887517D5B1379B99580A301EAECB8 JOANNELANGRIDGE
2,421,614,296 *FFE742DEBDAAB643E37205A5ACD9D725847DF620 JOAN ZIMMEL
2,421,614,297 *FFE0AE12F0DE8632C75D757D5C0B6DFAAA82432A joelrogne
2,421,614,298 *FFE3EB922C999E5E65FBA581C5CBB72D466E1F20 JOEMUSIC6
2,421,614,299 *FFEA51E0893933ECBF3D9DEB1C67687FA8228793 LIGONIERS
2,421,614,300 *FFEEF881DE527D6A602E773E5E584E6C8D4180D1 lilly bolero / the white cockade
2,421,614,301 *FFE3EC7D963606466238998CD33D0C7691FDB7FB jonah142
2,421,614,302 *FFE200DD5BBC8E450AC636A013EE4CD2EF387FF8 JONATHANKOCZERA
2,421,614,303 *FFE3B529946985A1BCCF3299F9CF75F8A858329C liquid4t0r
2,421,614,304 *FFEF18B47BA6A9B43086B9C607C77C3504336FD9 LIVE: IRVINE 2002 (DISC 2)
2,421,614,305 *FFEE51AB836E9210DF1868F13578E62698D435E2 JOW1IES+
2,421,614,306 *FFEAD45BBDE4F4FBDC01CE977ACD662AF8CC6810 local-division
2,421,614,307 *FFEE7BF899B2FEE2CD60B3B4A463DEEA2CAB88E0 LOCKINTOYOU
2,421,614,308 *FFECA37258AC917364364E9919F4E44994DCB338 LOHENPYY
2,421,614,309 *FFE609BA0891AF76C22CA2F39F005CBA8BD50922 lojack corp | united states
2,421,614,310 *FFE7F088029377287F71DEA402D2B992B6E1D8DC [email protected]
2,421,614,311 *FFE19A89C6B401C6E5C347B0A7ED66727B43ECC5 LONG.EYERMANN
2,421,614,312 *FFEB361A888DA51682D3FD498A4570A72197E63D LONGROOTED1234
2,421,614,313 *FFE86C3710A787B391F777382224AE3F42D6D25D lonniedyl
2,421,614,314 *FFE40259D01A53557167D5374C5EF416A3E9AE94 lonnymcglinn
2,421,614,315 *FFEA326EEB71D316798F181B2C1FA17FB6A7E1A7 jY.
2,421,614,316 *FFEF056339131C21C11A3E8D7C2C9EAF16D528E2 loydbischel
2,421,614,317 *FFE1A0F23204D82A2D77189A0B34A1B29EFB7516 luciushatcherson
2,421,614,318 *FFE342388B31F9511DE0E8C9991B7BB70AC72B07 LUCIUSKARREN
2,421,614,319 *FFE4C34CAB89F612C5B493C23567B94A6E95BC1E karemeenfry
2,421,614,320 *FFE1A3F743AF7588BA1007D5FED4F1BA97A662DC ka"rglicherer
2,421,614,321 *FFE3777F6D673043AC59464E5A8A79E3E4B54282 katlinjones
2,421,614,322 *FFE6CA9BCEA202DD7E9606AEF6D111EC1DAB6986 KAZICHENE
2,421,614,323 *FFE622B008970DEB23509211D3EAE7A4C4BE2943 KEITIRHC
2,421,614,324 *FFE6C3526966B4059519353429D111C5FB1074DD KENETHEWIG
2,421,614,325 *FFEADC91F2A26F47343B42D00CB933B8FA260892 m6!
2,421,614,326 *FFE1443708037D5FDE770FAC395C1DEEB06AC072 M6SB
2,421,614,327 *FFE8347DC24D0F297A9548D2964F0EB802A44B91 M!7X
2,421,614,328 *FFE051450E126ED29C0ADF6136589861B1BDBEA9 MACHINE.GRAVEYARD
2,421,614,329 *FFEF5E04FEBB9B935971C57B29002A2638AB5A23 KENTELDERKIN
2,421,614,330 *FFE4D12678CDE7C7349F106015EBDC3E05DA97A8 kg{
2,421,614,331 *FFE6C59B14F6E139FEF9CB3CBCE8CDF77A8921D0 MakeYouLearn
2,421,614,332 *FFE33BFCCD98AF186E54BDE8195393C93D6770A9 MALLE.SYMEN
2,421,614,333 *FFE15D178DD25A9D5E827F47D778E457536BDC46 MAMYSYTA
2,421,614,334 *FFE15819EB3EDF1420BF1D3B9A4145219A2C0D4A kissables91
2,421,614,335 *FFE6183B574A5CEEC1D6CDC0D183A81B31BADC8C [email protected]
2,421,614,336 *FFE712B0E3555E8D3129B7E602190D8E068B5A68 MARRASSENT1
2,421,614,337 *FFE532EE945BC522B71044745B4FF535F0BA2D35 MASOUDIRANPOUR
2,421,614,338 *FFE45C423380E759A22F4CC54C00795536E4F233 KRISTIEKUMMER
2,421,614,339 *FFE8A7C9EE22B0E40E688E792C12D8C3298C852B MATTHEW ARONHALT
2,421,614,340 *FFE73F5AAE162A7EA5F14B54EC501D4E485F791B matylonek6
2,421,614,341 *FFE829DEC98F3E5BB3405CA5AE44D018C74BCF96 ktk^
2,421,614,342 *FFE10317CDFE9F13172DE5967E4FD01255C2B8CD mckewleied
2,421,614,343 *FFE27FD9C60D53D01DC5CEDB0BA230884EE09FC4 [email protected]
2,421,614,344 *FFE60F4D39D363BC55A6E3A7AE14F789FD9C960A -,l
2,421,614,345 *FFE78D07FAEF9EE6E79C2248DF0FA686BA6974B0 LÅ1857
2,421,614,346 *FFEC8331C869C89110D42DAFDAA78CADCCA80E54 methane.view.(radio.edit)
2,421,614,347 *FFE4032078B122611908F5F3BE33BD5CCC70CDE9 Lassit
2,421,614,348 *FFE6DA438210DC044A388B02B399F56FDFE0479D LAURENCE-WARNER
2,421,614,349 *FFEDC619BDCAC7ACB7F2730315F54D856775B8E6 LAVERNSALLEY
2,421,614,350 *FFE37607E3558F6E26EF62A23FFDAD4487848F81 MICHELLEBORBE
2,421,614,351 *FFE9F5520EBAE5CA95B67C9CE0046BC4E75B3130 lehrergesangverein
2,421,614,352 *FFED913F24CF96CCF4B8E14B2719A2070954B334 MINGZAH
2,421,614,353 *FFEBA1A5C4255FF1C915515D0E840AA30A371D9A MINIBILEN
2,421,614,354 *FFE2DCDAF0475CC5A6312FCADB29FA1D8D3FCB97 Leschevaliersduciel
2,421,614,355 *FFE3A80A03150C11E58E75D1A2D52B4D64D8823A LESVALLANGEON
2,421,614,356 *FFE05291B51717BDD04E3F18C5B055C3B898C7CC MMOLLOY9
2,421,614,357 *FFEC9544E72EDB120C43DD18D7EAF95B1F753F2E mohammadkmetz
2,421,614,358 *FFE76145BBE49AA9A21575CD145F560000A90582 MOISEEVCITATION
2,421,614,359 *FFEDA5A5E7A6603B2E7C4CD6474E9D1A231916C4 MOISESGOLBERG
2,421,614,360 *FFE56F6A7D6C19989BA50A6F8EE1A418C45C5250 Molecular-Repulsion
2,421,614,361 *FFE1517796330888BE13735CDA457A31764154A3 MONDO.A.GO-GO!
2,421,614,362 *FFE838464D87E81EF803CCB1F552E4123182D92E LIFE'SWISH
2,421,614,363 *FFE1DA7D63700A3A23399619AAD855204116499D MOORANGO
2,421,614,364 *FFE8A51902170DEABDE5767021E6E6CBF9D62B05 moq'
2,421,614,365 *FFEFFCC5100C24A521B53F15EE80929CB4B4879A MORTHOE8
2,421,614,366 *FFE9B9A9112BFEDF30F6322A0DB4379D3F32DBEC LINO.VOGELER
2,421,614,367 *FFE06885C92096E22731EC7B166EBF593E2AE03B MSNRKFX8
2,421,614,368 *FFE07430180D53330773583480B0D9CD96D4B43F [email protected]
2,421,614,369 *FFE5CE85D72D1E598384DF0D80B9AC45EFE52117 MVOLJTDG35
2,421,614,370 *FFEBA8FAE472FED2B53BB4410596DAE4BF612FF5 MYFLORIDA67
2,421,614,371 *FFE10154D9D6462B6196A4B4A74F223AEFA949BE LOREN.MARSEE
2,421,614,372 *FFE0E96D2CE044BD5E95ECD85747798914585A40 lorenterronez
2,421,614,373 *FFE49F37CA9AF08C47B7A465BF17705051C1B8E6 my.love.(global.re-mix)
2,421,614,374 *FFEFD9ABF3779E7531320779630953A3C505055F lori.botnick
2,421,614,375 *FFEFF7371655AFA002906A9AF207803527750E1E MYTAMARA19
2,421,614,376 *FFE64AB425EF1BA351FC7C8E4972F4ADAC51BBF6 NADBEROUNSKĄ
2,421,614,377 *FFE0BD1E92BCEABDDE2DA4F93D86FE4AF4296F86 NAEBDEM
2,421,614,378 *FFE7441341066EB4EFD4E55B37C9AAD5EB91987F NAHCNAH4
2,421,614,379 *FFE263E25BAE6C7BF6873BBAC06A1D787DB1C786 NAPOLEONHARDEMAN
2,421,614,380 *FFEB5A0FB49DBAFC903A8EA75FC91C23861302A2 lupebuttner
2,421,614,381 *FFEE986F1E79AE2A7904D41416346B4381587F20 LUPEFERRONE
2,421,614,382 *FFE4D5DC1BD52E1A0E3FA0821830F138C7E59666 NATHANLUX
2,421,614,383 *FFE0241970019BD83193845228E42DCCF21CAC90 NATHAN.MCKITTRICK
2,421,614,384 *FFE83B517209D209D546F591952191A25CE33616 [email protected]
2,421,614,385 *FFE2D82A8A555F0531999A3B73FFE153055BA08A LYLE.EISON
2,421,614,386 *FFE80FB640AEFFB2207E2BA3B753D5C0EECD73C1 NE.7:.BALLET:.AIR.MAJESTUEUX
2,421,614,387 *FFE3A0A0F03597D17833FA9317CF0D0CE67274B8 macandrew1
2,421,614,388 *FFE9E2DE64BFAEC2C732FF2720ADF2C0F22B7E61 NEVAEH661
2,421,614,389 *FFEA56B5F10D03787B8CE58FE074883AEBAA1587 NICOLESEEMAN
2,421,614,390 *FFE447BFDA4FF2FAFE3C5A29891284DD4F49D548 nigssee1
2,421,614,391 *FFE340B2543BDF703149B5A9BE2A1E95ECBD4A67 MARKFLINTON
2,421,614,392 *FFE513BB10F2129DE2CB56068E7ED7A57666040F [email protected]
2,421,614,393 *FFEA17F64BC9B824320BF6E7A0A4C8B4EFABFD8C MARKRECK
2,421,614,394 *FFECD06551F443276DF82DEF2BB6147658D75089 MARMOGHAN
2,421,614,395 *FFE338FC4A0CAC987605FD0E49C541BEA52F5B1D MARVINBIRT
2,421,614,396 *FFE3650B7DA0D34F46BCD20FF3A290A377175FC1 masonquintanar
2,421,614,397 *FFEF8D8AE0D687D42D793B2B8A85804A6A51848A NORATIONNORATION
2,421,614,398 *FFE8B0293AFDF5D86E2AAF52E06D156516124D45 MAURICEDOMKE
2,421,614,399 *FFE9D46BCF410794C21DAEC3FDB293D249629B14 MAURICE-PATTERSON
2,421,614,400 *FFEB5166D895CFADE83A8498EE0DF3D2FFF68236 MAXIMO.LEIBY
2,421,614,401 *FFEC27F60498E60F48A8F8F49427C2A2518143E8 maynardmorsell
2,421,614,402 *FFE2404608DED89EE01969D6E12EA4057DD829BF [email protected]
2,421,614,403 *FFE84078101F5F6F03C928ADA6D8187261FBAAF9 [email protected]
2,421,614,404 *FFE34921AF75B7874FF8A15A4F5C9E0E18DEEE21 NTYSTRN2
2,421,614,405 *FFED87BDFDC3D16C51942AA3694DF8072C066456 MCKINLEY.MCCAUSLAND
2,421,614,406 *FFE39A27EAA58A436803CF9B54E8DADEFA7CFE13 nunogonzalezdelara
2,421,614,407 *FFEB5D5F1EEC3B5B7452FB0DE7D676FF3BB9AB02 MELISSA PARODI
2,421,614,408 *FFECBABD0BA5CB691F444B1A7FD9B24FCF2EE3D7 )o(~ ` (####b
2,421,614,409 *FFE7E3677B549FA0E02E027EFBFFCDC9AC636AD0 Merce,.dilette.amiche
2,421,614,410 *FFEC274B50D0B5DF8A44AA1CCC961014BE5F9218 octadecenol
2,421,614,411 *FFEF3DB57CE712A721AFFA51E2888461A9C67029 octaviotonks
2,421,614,412 *FFE4FFB763DC68B5F8AFFC03A80B0F483C6808B4 )O(.*.*.*.d=====3
2,421,614,413 *FFE82B9B0BAFE8BC851A31393983D765C5F80F02 OFFICIALCORRECTRIGHT
2,421,614,414 *FFECBD2FA2FC1122065D126BEDB3A44D0A50DEA5 OFFROADVERSION
2,421,614,415 *FFE8413DEA9AE4D337E2A586DFD7BF5260972546 [email protected]
2,421,614,416 *FFE2AD80BEB1575887A988BA91EBD5E0CEBE0648 [email protected]
2,421,614,417 *FFE44B34D22C1DE9F26B408440024714A80FC526 OLOMUOFOMUPO
2,421,614,418 *FFE0AEC14840C9AA4C39F669B8C2D4E5B056989A michalehelminiak
2,421,614,419 *FFEB5AEAF80A1B7CC1AD20C02C485C7D24776688 O><.O~.O~<######B
2,421,614,420 *FFE811858B3B046E5F87931995C7FA4E643AAA13 O->-< O~ O~(--P
2,421,614,421 *FFE5197F7BD65A761E58E8FC30153646232A5673 }o{~`<P
2,421,614,422 *FFEA37022F392EDCB9F5DA7FBF321F46294AD98F MILFORDCUTHER
2,421,614,423 *FFE6AD700112B387DDDB7AD6552AE391C925D360 )o(.*.*q==b
2,421,614,424 *FFE92BF566A89BAF73AB562429C53FDAB245A7D1 minhdubay
2,421,614,425 *FFE72DA1852AC29CB0BDBD35321C619F200592BB ORIGINÁRIOS
2,421,614,426 *FFECD9E9B69C91630D844E069FBCF6EFA54BDB77 misspoke6
2,421,614,427 *FFEE4A43D17D1410C2B6E2C67892FA8990F48F81 OSHAINAYEO
2,421,614,428 *FFEAAC6AEFBDAC729DC91078966EDD9329FCA780 mjw591121
2,421,614,429 *FFE3583BA86F04B4BABDD219071AB54191E10A7E Oulun-lääni
2,421,614,430 *FFE8157F5C133FCDB1469862AD1AAE00E987328E OUTRO(DEAD?)
2,421,614,431 *FFE5A85E786CC09EFABABF95FE0B54721EB5C446 MOKEMOS9
2,421,614,432 *FFEA370FA664CAB1DD46988E186F3138D14426DD OWENHARTSOCK
2,421,614,433 *FFEEFC5FB52F11D30DB05EB66452A8AB13E261AC OWENSHERWOOD
2,421,614,434 *FFE347193BEAF73924B1D31C16068B5098288284 [email protected]
2,421,614,435 *FFE4BD5A049E243B0EED3B83FF7C59B8DC2AB54E OXIDASE'/A/KS/I/,D/EI/S
2,421,614,436 *FFE8F75FB43D554881222F1B79743BB0476F2C82 MONTE.REYNARD
2,421,614,437 *FFE4BDC679DB15D5E6527FAD72A9FC7FBB7B1B88 montyzortman
2,421,614,438 *FFEB385CC0A244076FAC2F9CC83B5AA5A2384936 P)*.*.)0(
2,421,614,439 *FFE10A82EBC20C18F30DBE1B28B47D7855C832EF morrislewter
2,421,614,440 *FFEDE88297BCD132AC88E553E2A802DDB492EEFE PABLO.LAHNE
2,421,614,441 *FFE29BAF8A9A51D8B320284ED5EF40CE68CC30C8 MOYES1976
2,421,614,442 *FFEEFCA6FA262400078545DFF39B530BEF96E42C MUAI"TUI"(V.ENCOREMIX)
2,421,614,443 *FFE021A7BBD370327FD21EE6C3AA0876B788203D "MUSIC BY GERSHWIN" 4/30/34: IV - LOVE IS SWEEPING THE COUNTRY
2,421,614,444 *FFE3405A49F7B6E1434B4D2BCE6EDBAE27ED91E1 patriciaguillen
2,421,614,445 *FFEBADE6A7CDAF33DC96F415E238CA44FD354FFE PATSAINI
2,421,614,446 *FFEC426721C4A907F4432F5E1C4E52EA35059212 mymirage1990
2,421,614,447 *FFEA2A04A4F7A3E9018EB7C287B34F43C1D40F58 MYRONICE
2,421,614,448 *FFE07EBB8ECAB5C734956CD8C6252690448BE9D7 MY.Z.VAMI
2,421,614,449 *FFE4D82AF209B50EF7263A3BBDC8F5A2029DCC67 p####d~0~osplat!!
2,421,614,450 *FFE769B79C42D5446F85E758D7AF733C41A10509 p---d-`-splat
2,421,614,451 *FFEE8335BFAA5B759F4550E999D590516A902E9C pentland
2,421,614,452 *FFEA615CC57B0238F287B74BCA1FC98863893FEF PER1$H48111+Y
2,421,614,453 *FFE53C1F26B33A2AB199BB5FC7BDA25D2AA5E65A NATALIE-LOTT
2,421,614,454 *FFE5329C428B54868749720E9304528A4A01D206 NATUMUK
2,421,614,455 *FFED22892D9D7519D5075955FE7C47C8B1653615 PHENOMENON-ANON.
2,421,614,456 *FFE6091768B5EFA1D56BADE7634F6B3B74933240 PHILLIE101
2,421,614,457 *FFE8C18100E599253347A3C9F0B2BC8C7C1ECD76 PINKIE-PONKIE
2,421,614,458 *FFE856AD1885A7078F34751F750752CDADB8C2DC PINKYMEWADA
2,421,614,459 *FFE5C86E6434240CAB46A9F8DDE78EDA556F1401 nethavathi
2,421,614,460 *FFEDB39928E4C7353F9F6F7B1E5C89F968721147 NEVAEH353
2,421,614,461 *FFE906FFD545A96CE5DD213AFE95A546628FB8CD Nfnt
2,421,614,462 *FFE09A09C7D280C540EBF328239125BAA502F6E4 NICKOLASWOOTTEN
2,421,614,463 *FFEE137FD3F7264740376F0D4CAEC2F52281708A NICKOLESSMITH
2,421,614,464 *FFE2F63EA4EEDCC5A57C3085857F5664B913BA29 NICKYLOKHMATOR
2,421,614,465 *FFEE140576258F17581DAD3BE3AC4443E4849CEC p##>~O)8(
2,421,614,466 *FFE50AF1459C607258C573D517E6DFA468D06895 PODOJIT9
2,421,614,467 *FFE6E97BE95C69EA79DEE942DDE4B63286DF283B PODVĚSŮM
2,421,614,468 *FFEADCF49067D7E6D5E7FE53DE4F403E5D2C21D6 POHŘEŠÍME
2,421,614,469 *FFE115FD61ADE1CEBBE48BACA9544C6895487E56 NIRVANA1BADBOY
2,421,614,470 *FFE599E33B29C24BE8C1B1159E5BE5B99DE7E419 [email protected]
2,421,614,471 *FFEE7AD3DAE759CE1BF13E85D51FAF7263AC6ECA [email protected]
2,421,614,472 *FFEBA505366050F4B3655E874B0EC406D5C80DA1 POSTILAATIKOSTA
2,421,614,473 *FFE963A7C15A335917A4A0938BF5B01D7C849328 noahsims
2,421,614,474 *FFE3424B81C3F1F56B39FE550E74D8100D659901 NOBLEMONESTIME
2,421,614,475 *FFEB918E0FA56510244CD71581AE925011E33F0B noblesievers
2,421,614,476 *FFEFC72889A788C95AC2EA018EFD1704B0618ECB :p* * (p
2,421,614,477 *FFEAF88711970B561857784786AE105CDE4AD94F nolansetting
2,421,614,478 *FFEC6F563F3D1F87D95521CD8416592993C44042 pp.6776
2,421,614,479 *FFE89C36F22DC18646FBA4274D18D6EE0A19DCA8 non3quva13n75
2,421,614,480 *FFE5DA66D08DF0E56423F59F82EFCA5459A1D663 ppso
2,421,614,481 *FFE595259D189E6673C20FD33F3F80A05F98AEA4 PŘETRJEBANJO
2,421,614,482 *FFE09D8B616CDBB2BCDA2CA218AE75A40CBD7A99 NU]
2,421,614,483 *FFE8F574039703F7A9286CA67AAB4995229E1D51 p##>-~-~-~-Sploit
2,421,614,484 *FFE4B28DDB623B4AF4A0F6EFA2D0FC01CFC3AF14 *of|kg
2,421,614,485 *FFE985C66A63B8F0C3EE547AC97E1AD020A203C2 O,GLADSOMERADIANCE
2,421,614,486 *FFE5840F412A09E05031949DD1AEB9272D240CE1 ojb!
2,421,614,487 *FFE5407CF0FE3EB418B935A5DF76F3592B91F923 omargerleman
2,421,614,488 *FFEB8143F29EDD3165B33E5527D859AE6FBA68A5 OMELETAOM
2,421,614,489 *FFEAA4CADB38B2508B058242B91EC7B097FC3E6F ONAPPACSED
2,421,614,490 *FFE5A4093EB0F4C86A570A37F3B0020DF2D6D8D7 ;) O~O~D3
2,421,614,491 *FFE86AD0E7A31223F4B9E06584C62F2A6D298ED6 (>-<)o~o~q-8
2,421,614,492 *FFE25C19F943AE4EAC0753DB6FF312DE46DE144B QUIN.MCGEE
2,421,614,493 *FFEADB0D61504C9E7C728C4F26EDB965DA0C5542 QUMBERZ
2,421,614,494 *FFEC314A756953D4E29F61059CA94B6BA16D041F QY8ASH
2,421,614,495 *FFEB66C1649FAA79A76F4404B373F1D8C1465222 r0tf3rs
2,421,614,496 *FFEFE2ED09599E812373E3880519FE64278F0D07 oth3r$31
2,421,614,497 *FFE8D7676822D699740E8795BAF1C52A21348E7A OTLHAC
2,421,614,498 *FFE7F42AF5C43018125BA63C1D64E94839E08A39 rad107elegraphs
2,421,614,499 *FFE5F62108130658E7465B10959EBF6BBDEB5707 p-->(>_<)
2,421,614,500 *FFE7BD1B80335F71FF21AA678433E42D183BD167 p1ea$!n9
2,421,614,501 *FFECC3E26D689C2B9F8B13E5B1B8022E78594477 P3CULA7I0N$
2,421,614,502 *FFEDB7425FB6082D6E42AD33EF3FB8786BC0754A PABLOLAREDO
2,421,614,503 *FFE9D58AD6E985C1FEC3A3E27FD97E631B4BD643 raulogaz
2,421,614,504 *FFEF8BDF5E28E0EDDC75A525620CA61FCF168F0F [email protected]
2,421,614,505 *FFE83C85986B2AF085B6E1662163EA8F2D3A96E0 paramameters
2,421,614,506 *FFEEDBF33EAF21D4200AB89FB6CB2B213815A7DF PARIS.LEGACY
2,421,614,507 *FFEA8C867B10F0148E9213684372D89A03C39A1A parkercate
2,421,614,508 *FFE3D5A885C75F367295CFB747426ED8A3EF05BA parksunnybank
2,421,614,509 *FFE91B13C4934C7DED310611BB69CF1210ED6CBF PARTYOBSZ
2,421,614,510 *FFE4D99BFD34C89918E8CFF5927B7C3BC6FDFBD0 pasqualecrume
2,421,614,511 *FFE58586709E4BA096EAAF518EFA3FD524CB234F [email protected]
2,421,614,512 *FFEE22B4ACC4916B00EFDAD8DECBA7BD7DCCEAA1 [email protected]
2,421,614,513 *FFE5762FD67A5C8D29F91475E4AA3EB1401E7E06 PATH.BLOODY.PATH
2,421,614,514 *FFEC2A610A0E267562FA6B09D8C527E9FF989AEA [email protected]
2,421,614,515 *FFE1829DD0B3A0071843AECC0F3137F4C5B1C5AE RECORDINGS 1991-1994
2,421,614,516 *FFE129B654F807CB567AE5F98CAAD568A4297BCB [email protected]
2,421,614,517 *FFE6606FEE12DF738AB53F8FC002B5F9DCF19E5B reduziertem4
2,421,614,518 *FFEBB7ECC712670CD88A7BAA419698D8ED9B6082 REESE264
2,421,614,519 *FFEFE74EFFF5701AFD7315E9F897982C9FB9C285 [email protected]
2,421,614,520 *FFE5231537F55494CA598CA9B573C9A872C3D997 PD* * * (0_<)
2,421,614,521 *FFE2AA20EE540477111756ADBA1161771DF309EA REIDYANNAYON
2,421,614,522 *FFE4C9740373AAE0A4B947F5AC7E098DAF0581E1 pelotai0
2,421,614,523 *FFE2B02BCBF3C57094EF848959ADEF2DA4468ECE REYES.MCGEADY
2,421,614,524 *FFE0ABDBF616C9D6C6199F3A9623867802AA45F4 RGK9
2,421,614,525 *FFE43DE2FB5B4A359575D3FAB0FBE9C91EC103EF rhodellesantos
2,421,614,526 *FFE49B77807596A2A8C18E4B2BCE6A27756F1C57 plumbum-album
2,421,614,527 *FFE5834A54510AF66428AD1101DE6D6AB7ACA5AC ricoharjo
2,421,614,528 *FFEF7C4D0F32E0088E99BAD3A7E2C2E8C081A93F RICO.WINDLER
2,421,614,529 *FFE3BCF32DB9F19152E2888BE3977A24BB314AE0 、RIDDIM、レコード・コレクターズ
2,421,614,530 *FFEFCC87D8ED7A32CB1D3B006B146EBA0B7B14D8 RIMESTERSES4
2,421,614,531 *FFE3320B0D111E19815644863A1778739EA6A1E4 Rise.Up,.Shepherd,.and.Follow
2,421,614,532 *FFEACD33BECE92A664219C1BAA05E28A2E1682D3 P#>-~O-~O-SPLAT!
2,421,614,533 *FFE46920C3031A03509CE29CAE49D062C15CB25C rk4]
2,421,614,534 *FFEA55259E7D383A59668FA50A747FF7C14BAE5C portbotanypassesenvironmentalaudit
2,421,614,535 *FFE80E25043BE0135FE867C36390938B87311847 PORTSAEED
2,421,614,536 *FFE35C9AA80E783AA0372999C7859127F1D7F251 ROBERT1992
2,421,614,537 *FFEE7477075D1C7B594CF7B1037B2995608AE021 RODOLFO.MCRAY
2,421,614,538 *FFE6F7B32B515CB9F49C76C8B7FA694C07AB0D92 PREDEC1ARAT1ON
2,421,614,539 *FFEB15DB79ABE23D6C5DE9527CA2B411E3F8F68D ROGELIOENSOR
2,421,614,540 *FFE8678107D9056DEA1777E6541E02F147C10AEE ROGERVILLAFANE
2,421,614,541 *FFE18F8C2245F6F60BB4F34A1C3B5A23DA646E9B Prince's.Day
2,421,614,542 *FFEA89BEDC4BFA394ADD6E2016ACBE1F9DDC6AD1 problemg3
2,421,614,543 *FFE7791977B3869F7E7276E84FDE53B4EA756FD9 ROSEMARY.C.
2,421,614,544 *FFEEAEA96CE86231C26831766A8DF01F6299D296 ROSOLIAMOED
2,421,614,545 *FFE45E80DE29CC4D3A9DDB380E8EE4A1E6B55DF8 PSTARASED
2,421,614,546 *FFEEC42CFDC0E2CD9675CDF81E97660C21C78AFC PSUTTHIAKHAN
2,421,614,547 *FFE7A5558E00B62E451F25EF760AD4E5CD6DC83D PULLS
2,421,614,548 *FFE93C25411AFDCEB543F536282CC0422B49DB99 p##)~-~-~-)x(
2,421,614,549 *FFE3DFAC19ECBBB068666547381FCE0DAE3ABB0E PYHRUOKA3
2,421,614,550 *FFE23DE2FC71D990A57A7499A76BFB226478CA3C P?ZB
2,421,614,551 *FFE368D09BDB335CFDA04DE531D9667E9F71A759 [email protected]* *(00)
2,421,614,552 *FFE2CB4FE1C87343D905D2D40C13ED32130A405C q1019
2,421,614,553 *FFE4B71711E06E652FA316D6E6184B2CE4449645 ruebeneshmon
2,421,614,554 *FFE29C9FA4471A18DC3620DA4C6CD784CB56A9DE QBSETTINGS
2,421,614,555 *FFE2AB190335DBC2F0DBAC373537373868FB49FE [email protected]
2,421,614,556 *FFE6681F7FB125CA228E9F22F72F47D261996468 RUSHRUN5
2,421,614,557 *FFE9DF6AB1FA2447D632D19BFCBDE7B3CAAA9934 [email protected]
2,421,614,558 *FFE5A24B57398C646E0DAB09E22E0E401D53E4D6 q=====p-~o
2,421,614,559 *FFE9FFB438FD91AF370DF43F095299AA1D1E3FF5 QSHANTI7
2,421,614,560 *FFE522B5B39310CF16C1112C2C51DE3A268D58A8 quand-j'aime-une-fois,-j'aime-pour-toujours-(feat.-gildor-roy)
2,421,614,561 *FFE1CF5647DF6CCECC0F5127011E4509DF6C5250 S98052
2,421,614,562 *FFE34ACF6850B60A2628D0BBD3C7BDA6C9B5892D QUINN.ALLIMAN
2,421,614,563 *FFEA13B200FB3672D60C531BE9A7A35085E8CBB3 R0ute$te
2,421,614,564 *FFEEEC4EC933106834A07C5857053B6A6FA9DD68 R3OP3NING
2,421,614,565 *FFEC644B38518A4810A1482A8047F8A19707D52C SAM-ORTA
2,421,614,566 *FFEEAD009E37B53CBE5BB3597A99E0D98E073084 sanfordwilkinson
2,421,614,567 *FFE1B1333F7FEF6327D799C463F5078092268EC9 SANIREGIBOLG
2,421,614,568 *FFE7E9A6D6A2D3BA5CE2B00E5C93F88EC70D4DBE SANTIAGO.CAMPUS
2,421,614,569 *FFE290E28A76EAC6CD2534AEE617BFBEFAE212FD sapelosites''sapelosites
2,421,614,570 *FFE7F995AF27EA7C07537ECB97BA0132E658C8E9 sapmasindan
2,421,614,571 *FFE4D8EDBAA99728A45D45704B33EC6CF325FB66 sarahdrewbieber
2,421,614,572 *FFE6AF4472D4A109CD540E890D12A7860DE90E9E sarah-jane-prior
2,421,614,573 *FFE45410B6F106BB836B850CA8C402848C8561CF rasulalam
2,421,614,574 *FFE072007C6361EE2092D650E6F379EB806A76D6 SAUL.ELSON
2,421,614,575 *FFE1651DED86D619B31F5AC319B2F663C1FDAE3F SAVAGEREDSKINED
2,421,614,576 *FFE76C2886124372CABAE0FBEB996412DE96A07B savedeafstudiesorgukwww
2,421,614,577 *FFE63BC8653B311CD798F1A1AC7A4FA6064EBCDB [email protected]
2,421,614,578 *FFED0F3564F246F4907B0A4ABE9A0AFAD1B2CE57 reagan.prado
2,421,614,579 *FFEE6EEAA1492DEBDB42964218971BE5168B879C REATORATION
2,421,614,580 *FFEF85D26BF993A7C0799E0C32B29F8C9B34B164 REFLEKSIVETS9
2,421,614,581 *FFEF918D8C781AEB469BECB657A859F53788B881 Regoliate
2,421,614,582 *FFEF71678618C7A28BBDEE2CAD0EFF8F2D3D7456 scugging
2,421,614,583 *FFE3B738B8AD48413522D96DB1D132997D251246 RENATOWIEN
2,421,614,584 *FFE6AB7AA2BB1678313C611ED74169828A86E615 SECOES
2,421,614,585 *FFED20386CA0FC7FFFD0B0A7951A44F0C369741B resecció
2,421,614,586 *FFEAE9D9DAAD97B9F4FD714DEB17882624AEEB41 REXLAMBIASE
2,421,614,587 *FFED6B4DC9890ABDB382FAA31B86A04BF8CAACF9 SERGIO.MELLO
2,421,614,588 *FFE23DEB05BC245E53588832823DA1D08ED337E9 rhettbarth
2,421,614,589 *FFEF4DBD1C5EA19CC13912295DBE610224E87ECA [email protected]
2,421,614,590 *FFE195C696FC8672356B0DC800C711DA98833E61 SEXOBDAERB1
2,421,614,591 *FFE56F03386A8A580480BDD472B7CD058F090C65 RICK.BASCOMB
2,421,614,592 *FFE90E923791C776E43A022012C5D9F11992201D rickiearonow
2,421,614,593 *FFE77CA92CF548A9464C08221D7C08CC86384D62 SGBOUNCESRV
2,421,614,594 *FFE0B1127006025F41D1FBC9D9871DEAB3CB59CA sharon.harding
2,421,614,595 *FFEC7580B1E5B384B57DEE4FA0F9D77886DF979A ROBERT HOAG
2,421,614,596 *FFEF4A9B5B8C15BB1ADBD552B8AC623423CC5149 ROBFREGOZO
2,421,614,597 *FFEB68C13A24BE31D21E9341D46FAB693A88CAA6 SHERMAN.FIAL
2,421,614,598 *FFE12FE4576C35120C6E350D1CB28EEED855AF5B ROCCO.EMPEROR
2,421,614,599 *FFE37B9B1E39A874DD717F05B654ED7D257355C1 rodolfosikorra
2,421,614,600 *FFE1D118E45852C4D96EA4E1DABB3A0D75317831 RODRIGO.STIERLE
2,421,614,601 *FFEF0C2E1EE5616577E3C2FE8942FDE2CB6623AE ROGELIOGUARDIOLA
2,421,614,602 *FFE5E1B36F0B9B28D9C80B07C21D37C0007D30BC romeolucario
2,421,614,603 *FFE8FC6CCDF54A16196471D8E3D14122A4A2E001 sikorsky-shb
2,421,614,604 *FFE3102C91150A0EA8CD15E83B7DC32D229E17C7 ROOSEVELT.STEACH
2,421,614,605 *FFE21AAC1E3C2C1FE173CAC9EA2366D5FE80F91B ROOSTERYOUNG
2,421,614,606 *FFEF12B097CAB4D6A4C614768C1A82078D9B9C66 SINT-LAUREINSSVG
2,421,614,607 *FFEFA51B80CB6EF3973A7B1A1726E180FF00C998 roundt
2,421,614,608 *FFE316DA4B5EC08307F74656DFFAA71007F8D554 sittings
2,421,614,609 *FFED2360173699654C8838A41952DACF0DADFA63 RSUCHENS3
2,421,614,610 *FFE26934F6F75F0A31E1C057F3A011A845E3A607 ruben-ranzo
2,421,614,611 *FFE16868337606F477EAA80E0115EC6AEFC2F1DE RUFUSSTEIR
2,421,614,612 *FFE630BCD54C671F9B1342B0084DF7F6804A20F9 RUNKNOWN4
2,421,614,613 *FFE6BC9D61BEE38E89EC0BB7EA1E250DB91B51DF smarmya6
2,421,614,614 *FFEC0B5DBF1A3A413C94B595158DEAC41CBEE781 SN4KEHE4D
2,421,614,615 *FFE4C31CA6BA7F12AE2C4D33A3EC86BB6B00A4F6 snakeskin shuffle (15 second version)
2,421,614,616 *FFE2E2FCB6DF57E88F271F4DA7CEE075A28EB9ED SNYFREBABSW
2,421,614,617 *FFEDA4C88EF42F0B4815B892C5ECD57E45252851 RYANNEULS
2,421,614,618 *FFEA5AC471D1E163406C8943F596116C1A8B8EE3 RZ(|
2,421,614,619 *FFEFCF2AA48E58CA566A039EC1297FF232E2A8CC SOLIDA¬RIDAD
2,421,614,620 *FFECBC67CFA69EEE2ADA18C16E0FB3CB1755BFAF sonings
2,421,614,621 *FFE5A14D3500C5CE546E57CDC5AFA3472BFBE371 SPAZIENTANO3
2,421,614,622 *FFEA5BAB91F2025A6EDEBD64597BFE71519C205E SPINAROLO3
2,421,614,623 *FFE0554BE1075A7E8E16C8275A06DC9C5DFCCF8A sarennoitom
2,421,614,624 *FFEE0A0BC43352267A48515D128394907C82A255 splat~`-(--q
2,421,614,625 *FFEF237413D0056EBDF83E41F00F51A85BA295EF splat!!*.*.q=p
2,421,614,626 *FFE42999F68EE03667116B5C1CB1F0D0FF8BF008 splat!!**q=P
2,421,614,627 *FFEED41423F68C84E7447272010F9877C4ADF3BD Sploit~`(==p
2,421,614,628 *FFE3C04C7D1D4799DD86851BE64109D392092744 SCHMILCHUKING
2,421,614,629 *FFEC17C067732B719940E2F7EB0ABB3828EF7BBC SRETKARTING
2,421,614,630 *FFEB9958AF63B3A87EAE40B20DFE44B0E2EB0CC6 SCHUESSL
2,421,614,631 *FFE60F1979F2661EE3207F6EA803DCD28679D17B SSNTTRLY
2,421,614,632 *FFECAB8FEA9B86DB00E2CBA18662B2CE90819E1F [email protected]
2,421,614,633 *FFEE986E18E7F337880D5B1994B9E2870BBA8FBA SDESMOURGUES
2,421,614,634 *FFE1A6ED9B36041DE981626811CC791B2EBB1ACA SEBASTIANDOLIO
2,421,614,635 *FFEE882B383E855CEFC14671F4FADBE5EB352430 STANTON.MCGRAIL
2,421,614,636 *FFE9D43F433680CE29308FFD505B8B07707FE5A3 STAN.WOLTERS
2,421,614,637 *FFEA37A1F64CFEB5474D46483E81734603A978CF seepier
2,421,614,638 *FFED99F678ED8B71068D63E4C49C3DCF32035870 steinruls
2,421,614,639 *FFE776B2E387B7222D53F6FD9320ED6310C2DC3F SETNHEZFN
2,421,614,640 *FFE4FA91344F703F323FDA3E724DBFC8E5943348 SEYMOURKITZMILLER
2,421,614,641 *FFED099C562CBCCB937C926E2C5721660A4B769E shahrukh.zaman
2,421,614,642 *FFE07239DE6425A25AB1EC80E2A799DED7BDBC4D stynged8
2,421,614,643 *FFE40D04D1612A29B7DC0868B3DA062C6A7D8F0E shelbymannie
2,421,614,644 *FFE82029BE8290B2D77AA826E9985AEE0DD3D7E6 [email protected]
2,421,614,645 *FFE2957FDB1D00BA8E40F4B14748F3EFE6AA6CEC SHELLYDAVE5
2,421,614,646 *FFEF951AD686438F8CA6EAE6F1E57F82F3769713 SHELTON.AMDERSON
2,421,614,647 *FFE67CF4526C96525654CF97B7B16D9EB0E79EFC SHELTONPUMP
2,421,614,648 *FFEB885DD54AFF5343242C6353210867C98E3BEA SULTANA1
2,421,614,649 *FFE757F51D645DADDD1BA7155E7100D6A3145AC9 SUNSHINEFLOWER
2,421,614,650 *FFECBD6E7AE79ABF057114E0FD074C1B04DE553F SILVIA-MOREL
2,421,614,651 *FFE6A1EFAED08C71B644E8785EDA1A8568401816 SIMAMARU
2,421,614,652 *FFE49D344D8AF27A3D3ED4C9E9EA8137C2E345BE SWINDLEA2
2,421,614,653 *FFE87A9BA05F781D089CD519D3385B7929E208D4 [email protected]
2,421,614,654 *FFE8ED9587481581D9E3535D7D7D154F0841170F sydneygotthelf
2,421,614,655 *FFEFE5B2448EA2F9FA72AC1B3DC2BF7DE7DAFBF8 SYDNEYGOTTHELF
2,421,614,656 *FFE519EFA9564F2C854E36F1241F266B90C52B1B sisnenreb
2,421,614,657 *FFEB3D2D6E9BEB18053670D7FF8E97D426F82E5B SLAYERDADDIES
2,421,614,658 *FFEBD8402FF161BB7F5A8A20383429C629AA0910 slevjardelunder
2,421,614,659 *FFE76E35BC39E74CD20A5F29AC07F80F68085E06 TALKBABELDAOB
2,421,614,660 *FFE4084AE9595F3F5DB586203F678A3E26C88CC0 SOCINUS123
2,421,614,661 *FFEACDBB883F941DBC0F651E28D501A0CD21A7DA SOCUBOS
2,421,614,662 *FFEB6A3FEAF8C75A4E3F4C77AD68DC13B2BE7833 [email protected]
2,421,614,663 *FFEAAB4ED3482C515ABC29F5B11E33C2254908F7 TANGOJASON3
2,421,614,664 *FFE104C65D63D96905D7A1DC00C163AADEC68341 SOLIYEV
2,421,614,665 *FFE068DBEE0BF35D09DD0B24ECF6D489F927351E taragipson
2,421,614,666 *FFE02EC3C9C170025866AA6193ED448A56594EDD [email protected]
2,421,614,667 *FFED5A964BFECDF5DE614B2C9E057465D51EA9F7 tbfd
2,421,614,668 *FFEF152826BE30EC67E3479C4E573F8253479359 TEDAHYOU
2,421,614,669 *FFEDDE0C46D7BBA43E2CF004150D831830C55E1F SPENCER.RUTHERFORD
2,421,614,670 *FFE13A23B75C6D32DF8EF6574971FECD069A8F13 spiraaldraden7
2,421,614,671 *FFE9CF989E5ED641D5B74C4E00DF2369F3E4A8D9 TERRYROEHL
2,421,614,672 *FFE9760DA1819E12809721E1EFFA86172E4C57CC SPOTHADH
2,421,614,673 *FFED479184573F77020B8B2C0D1D5F4A8F43FF34 TGLECZI4UFK
2,421,614,674 *FFE668D677C22BFF3204766DDF0AF77EF9256DB0 SRIKIRAN9
2,421,614,675 *FFE2FAEBA6C3329A22E56F47F038604627B6779E SRSKATTERNE.
2,421,614,676 *FFE6D542EFE11B6C0BA2BAD012866F8B24E235A9 SRUFFAUNNAVONSEEBEGGA
2,421,614,677 *FFE3FB13C9A26008EE6648F7447964D650E88EB3 THEAMBER16
2,421,614,678 *FFE8B68D1DFDF09B6864B5FD39F3CD212B6E3765 stalker2
2,421,614,679 *FFE0D7C404A089E05BCDB6B50DBC2F84808D42DB the-chat-client-program-users-run-this-program-to-establish-a
2,421,614,680 *FFEFF2E2BA95C9CD8DA2AC80DA334B990604FE15 STARGATEBLASTER3
2,421,614,681 *FFEF00A65029E4E1A7A63822D0C7E6F873C3866C THE-DAYS-TAKE-CARE-OF-EVERYTHING-(DEMO)
2,421,614,682 *FFE93F97DA68B298DA4B70CE85CCA87C452EBC77 STARTHORAGENATHORDELTATINY
2,421,614,683 *FFE46DF6333727FF4F09E9A8D8A27EA229E49627 theflagiswavingyou
2,421,614,684 *FFE180D1A3A3BB697DE29EFE2785867F09E01003 theforesthillsgolfcourse
2,421,614,685 *FFE571F9735E2C8C334D6198CB1981B5384D2223 THEJ0KER48
2,421,614,686 *FFEA5926C328EED41ECAD693765602CD8B30BE51 STERLING.BUYSSE
2,421,614,687 *FFEB0C1148F5A10256611A16C4E161C4255E991A theodoreboerma
2,421,614,688 *FFE1D5FA9528C70ADC60919A52CD0AFDEC4A2401 thetrancefly
2,421,614,689 *FFEBFA6784FC5BDA9FA9F57420BE265760D311B8 timothydourado
2,421,614,690 *FFEA62A39E41FE5BCBA9DFB29BA261476F55955E titiwintersteinquintett
2,421,614,691 *FFE5A16E47A3646D64A287C780FEECE8911F9023 TJUGOETT2
2,421,614,692 *FFE6ED52EA6B34A88A2960A78D41C9BB609B4AEF tlp042798
2,421,614,693 *FFEA33D5B70E157679F253F79008DE8DCFB49A99 TNJYYIR269
2,421,614,694 *FFE51318BAA46FCA661B98E5B96AC79E8A6AD506 [email protected]
2,421,614,695 *FFEF7A0CA03DA47D8CD1BD0B3F660AAFA07D41DC swindan6
2,421,614,696 *FFEEFC36239F3E4707BEF60AA0A395A1B7567D6B SYMMETRYMONICA
2,421,614,697 *FFE0AE362149BC241BDF27BA5E37084430D573D6 SYMNO5INC,OP67'FATE':IALLEGROCONBRIO
2,421,614,698 *FFE9D1BEF3A359CBBA1432293A8AA2BCEAA3F371 SYMPHONYNO6INDMAJOR,"LEMATIN":IADAGIO-ALLEGRO
2,421,614,699 *FFEF63548D5AA6BE9152F886C92E10EFCBF2CDBC T0EL
2,421,614,700 *FFEC795FCCFAD873438896AF19D66F89786F7FFB [email protected]
2,421,614,701 *FFE55AA6B3112A4C38F1615158AF2D291E689A63 tonn''class
2,421,614,702 *FFEFDBE090D784EB86757324306D6ED6BDB51F0A TOPOLOGYING
2,421,614,703 *FFE3F847497F6A18CE95B064B077E83C9C09DAAC TAIDEPUUMYYM2
2,421,614,704 *FFEE09A287FE2DF917F54A1BCF08D53914255E54 torydepaul
2,421,614,705 *FFEEEA2BA26235679FA301BE3B47490842C912AB TOWARD.NIGHT.(LIVE)
2,421,614,706 *FFEDBA17B7EE51B749BFB2D70B57EB75D7E00E5E toyetaiwo
2,421,614,707 *FFE0C847E6D50867802E791282B26BC56643331E TRACYKLOSKA
2,421,614,708 *FFE4D7894FFB1CFF731E99867A8A8EC4A7D6C1EE TRANAI
2,421,614,709 *FFE437D44C8ABCC140EB4BE666403011D01ACB40 TREEDRAY
2,421,614,710 *FFE0DD8549A72613BEBCF5D97A3BAF1092BAE458 trekkar!
2,421,614,711 *FFEFB709BC4852789194E3D37685DC3C00214EC6 [email protected]
2,421,614,712 *FFEA8900F8B521F723585D596F86A98B789C4B9E trentvintimilla
2,421,614,713 *FFE573A4D7561C0551EB1B5E8F01CC1AA1A16CBB TREYNORG
2,421,614,714 *FFEAF8407695C026EEE2616FDB83E7E3C87FE07C TRIBAL-TECH
2,421,614,715 *FFEA9C5F3C4B14AB83EBBA39BDE63ED4ABD59031 [email protected]
2,421,614,716 *FFE5FEE1564EAE33D77CED9CC864C10C155CE7AE trpssrns9
2,421,614,717 *FFED958659CBA2166209EE627A75D2D6CAEB6327 TerroristNations
2,421,614,718 *FFE2BDF19C77281EC1069F1E57E58C3920E24611 TUNGENING
2,421,614,719 *FFE14DFC14561F1E44FA4AF369EB2BA8239C64AA thanhspragins
2,421,614,720 *FFEAC3FB203D02AF041A963760E17AADAB11BE8D THANKS.MAGNUS
2,421,614,721 *FFE1A2FC0CC2D447919A1C97147EB983CFB2A001 Two-Preludes,-Op.-67---No.-2:-Presto
2,421,614,722 *FFE8D3354A15A130E5B18413BD4E191272FA561C TWOROHB
2,421,614,723 *FFE87B8BCA9A3D825340DDCB1DF65E54F077A1AB TYGF
2,421,614,724 *FFE89342AD2F544F04D14D57244BB68474139652 the-girl-that-touched-my-soul
2,421,614,725 *FFEE93E8FD9799374E7CB8E55C0E3FA228AB5A3F THE-HOUSE-SHOOK
2,421,614,726 *FFE46901C25FAFB8BD60360C521B7F0402446065 theodros-avery-quartet
2,421,614,727 *FFED8F1920E3C69E3A8AB4329F3D1160712FF95D [email protected]
2,421,614,728 *FFE855BDF4BC5BC5A54A5996F6F51CC5E8F681AA THE-PIG-AND-THE-BOX
2,421,614,729 *FFE016DA25D79B48D16A6AA7AF30BECB1DC86F70 ukoh.kalu.obiansi
2,421,614,730 *FFE17716A3F3610B0E957848DCA91252D2FFDD12 TICKETYBOO7
2,421,614,731 *FFEAF7E9C2098E074B2CB316282E3B882EB3A1A3 TIFFANY-BLASA
2,421,614,732 *FFE13BB2878CEFA35DB15317E2F54F5D921C8F26 UNAWAKEA2
2,421,614,733 *FFE7DA92BBD462CC6E2A21E79999BC051892D0A6 TILMROTS
2,421,614,734 *FFE3AA44432BE0880D26392C404BED1745496AF6 [email protected]
2,421,614,735 *FFE0CDEC7E2CCD73F4F039E2FB64AD06B119950E tim-brazel
2,421,614,736 *FFEECEDA0F4D10DF64DBDCD8F9C711B19770CC34 [email protected]
2,421,614,737 *FFEA0AFFB325983EB557581A8FE4458C7026C7DE tinatv12345
2,421,614,738 *FFE2D3B2711444995F884FB72C2325F76B5B5EEE TISCHKLOPFEN2
2,421,614,739 *FFE3D47059626EFABA1CC074ED4F690FF0BBE0F3 [email protected]
2,421,614,740 *FFE9C8D57C1B9F97C50C4C1E67E753BDFF944655 TMOKJIB6
2,421,614,741 *FFEB3F3CC576E610E10CD0024574D1AA1A81C510 UNN0+1C34BL3
2,421,614,742 *FFE9385914682D6E6D8D64697BAA26E6F211D509 uoo-
2,421,614,743 *FFE068D95A98997D887A67F951E4E077C26FB946 TOMMIEFINKELSTEIN
2,421,614,744 *FFE4185F96328AE76F274A19B9C6E3F5A6BFB002 URETHROGRAMS8
2,421,614,745 *FFE175134EDD7F8B438D4C3AA705041F36AB2818 TOMRT2:TOLEDO
2,421,614,746 *FFE654C5570F4885A3651FE22CF0B737DC123684 user1wheels
2,421,614,747 *FFEAFEE1F784B4912680C99874A9672D366208BA tqmpxa
2,421,614,748 *FFE3C0FAA67998A562D526762357D737E6602FB7 tracyweimerhoffman
2,421,614,749 *FFE436357F12CADF2CA8FB678AA61DBFC84A1BA7 U(YV
2,421,614,750 *FFEB33F590D59259BDF2E8D21F6E4057BE277423 TREECART7
2,421,614,751 *FFE228AE017E8AF59C46CE59F005E1B72A9A8695 [email protected]
2,421,614,752 *FFE9B022018AEACE892738EFEB1F350CE1D5C637 trogodi
2,421,614,753 *FFEBCD723AFC5BAA36EB045F0BDD58F73258E687 TSAJSUOMED
2,421,614,754 *FFECBD63D78991EF76B9B5EB2E4A1C355E174F72 verenasch
2,421,614,755 *FFE991C8601B01017EC35811B18C2742EDF197DD TUAN.SCHWALLIE
2,421,614,756 *FFEAA20A610B9B9AE72F074FC878060D618410EA TUATHA01
2,421,614,757 *FFE1CDF50B01451C77F86DA00F5D22D33B60FDFC tudeine,op10no3"tristesse"
2,421,614,758 *FFE8B619F370A8CCF6471D0835452AFB727E5B26 VERTREKSEINEN.
2,421,614,759 *FFEEEDD2BE403DFFE93C8439EE0F2297A328A401 VIQUAR.DALEEL
2,421,614,760 *FFED56339B9B1183190C8A5E32F3176C0BB20A45 VIRGIL.ZABBO
2,421,614,761 *FFE87FB4ADC40BEE77D956EC5115C24840F6A61E visajun1828ago
2,421,614,762 *FFE2A0365FC8EAE28CB8C756E8436919B9114B05 vitalityN:~vitalities
2,421,614,763 *FFE58160DDB3BB52D2A46006C54DF8ABABE3ECEB VITTORIAGONCALVES
2,421,614,764 *FFE4BFF6BE15FB2F3097E6A01C7B8884FC0EB8AD umar-bin-umar-babaji
2,421,614,765 *FFEF4D2A7A408A78A300BCA5898C13296BE41561 UNCOURAGEOUSNESS9
2,421,614,766 *FFE37207EFDA1D34DA8EA08894553B8717F8B436 UNEXP14N4TORY
2,421,614,767 *FFED4CA539B9256F87A365E62667600C9331EF83 voodoo-(dubby-mix)
2,421,614,768 *FFE362BE9889B4DA84141CF7C2794FE9718F9D7D VR1117945225
2,421,614,769 *FFE549AF05A0739A150827B5D23827023D371432   ||VULCANIA
2,421,614,770 *FFED1D84F9DEA7FCDB46B323809BC67E03D86F95 untilyouletgo
2,421,614,771 *FFE352115948D56A8CC1C23407E3D4365D921434 w0r5hiper5
2,421,614,772 *FFEC8C1E6C4E702B0F8571784D448922DD74DDA7 wael-hariri
2,421,614,773 *FFE0F4F8440FA7BD8A33EE41E0F1C4A9A0139AA8 WAFAAANAS
2,421,614,774 *FFE2421817A3F9E6EFCA69FE185FCBBCF0996188 WALLYMIGGINS
2,421,614,775 *FFEB584225D5C96FEF9511E39DD6F7181B0C0D60 utdレイストール
2,421,614,776 *FFEAA9564DF8CB5038BEA36DA79BFB579FE76C84 UXDLGUEJ
2,421,614,777 *FFEA1305F89B97DA1A6EFA44389FFA09909065BA [email protected]
2,421,614,778 *FFE1CDCB6E089811715F9A2779357BA0CE3A9977 WAYNE.BARCHARD
2,421,614,779 *FFE9A034223AC53F22F1F9B1AF8A86AB2086141B [email protected]
2,421,614,780 *FFE12A5E16E6B8936FA359AA2D88835288A2915B WCAMERONBIGLER
2,421,614,781 *FFEC1140115995E54F2E3C56B3A6EC592EE9D34F varann.gucci.poochie.richards
2,421,614,782 *FFEAE9D4A446A02F0185401A8A7C678E79228894 WEISENBILDNISSEN
2,421,614,783 *FFEE50389B6CA5371C1E27670C378BD89AD7FDEE ven+ur1ng
2,421,614,784 *FFEAC441D03AE3278C34B0F9A7AE3E9EB41C05FF wesleyloyed
2,421,614,785 *FFEDE1F7AF1906915653F04F186F4048B79ECF0D VERNIR2
2,421,614,786 *FFEBDA9F8441D8AC3DF2E9C1733FAB9F4514FD27 W++G
2,421,614,787 *FFE70DE1C6EBA509648F3673D99261D1FA03C7AF [email protected]
2,421,614,788 *FFE3E2BB44D61A1F58A2EBE08FCB47CB7F1A6A8F wh3f
2,421,614,789 *FFE4C3296BB89CFA06C1F3DBF13D19BD18F6BC6D victoria.d.cisneros
2,421,614,790 *FFEAB63C9759309B49FED7FC7361C4236887BD1F WIKISMRT
2,421,614,791 *FFED569FDD7B05CFD7B71BE619AD575A4619F56C vidhya-lakshme
2,421,614,792 *FFEF88E45B268606C506AD66D5741CD8020D8ED2 william.bechill
2,421,614,793 *FFE40A243771F587296D0B924CE103B173ACEA4B VINCENT250
2,421,614,794 *FFED62E132967AB13C6E01A3B486AFE5B66655CC WILLIAN.MAYEUX
2,421,614,795 *FFE74CCBF155F68BF22426A56C28C022B62F93E7 VINOUTTANEET
2,421,614,796 *FFEEA65C09F20E2EE707168C0CAD48393289DC8B VIOLETDODARO
2,421,614,797 *FFE08E15F06C3CE88800EC59AFC0C3D778C98678 VIOLINCONCERTONO1/SONATAFORVIOLINANDPIANO(RUTHPALMER)
2,421,614,798 *FFEADD8B1B7FC3D85823216EF611F01AAC158E3A wilsondulan
2,421,614,799 *FFE5CA8233C1AE2F15A9F4644634BF110926BFAB windows49
2,421,614,800 *FFE8719FFE3A89CAD8F15F436F845C7E71B042E6 wolfraamhexafluoride
2,421,614,801 *FFEDF90B7B870F6C427BE2424215C4F04F5F567B votrecourtiercomwww
2,421,614,802 *FFEA9F7D4591C92C37EF5C5E7E532BBD7117A908 [email protected]
2,421,614,803 *FFE3C6125BB7376FEC861DEC2283359FFBA196A1 vrbschdns
2,421,614,804 *FFE26E1DC8FB657F3BD9139A0299F598C36BBCFB WORMERS
2,421,614,805 *FFE2499A842FAF793D5FB8AB0E5BAF5EAAC8F4A6 W20AD
2,421,614,806 *FFE541B538C579FF60B2A8D9D9D98BB5BE9E3417 [email protected]
2,421,614,807 *FFE401AA0205F0767CE368F46B2F9155C2BB3E29 wage-scale
2,421,614,808 *FFEAACE6DF6D5C0B2D204D59F59300CD1BA2EF9C [email protected]
2,421,614,809 *FFEF018677C13395F2A969E9376CCE103D9AF6F6 WYNONA'S-BIG-BROWN-BEAVER
2,421,614,810 *FFEE098633D4CFA29031017489C688F3F0CD5229 X65362
2,421,614,811 *FFE752BD7681FD7B8467DD6FD3AD2DE09444648A X9NJ
2,421,614,812 *FFEDA588337B2B9221F84F20BBEC0264229261CE WATSONVICKY5
2,421,614,813 *FFE8ADE6CDEAAEE0FC5535037FF5D3FDCDE34CE6 XFILESGOLFING6
2,421,614,814 *FFE373F50EDA793172DD5BF2E7B56535C9E80FCE [email protected]
2,421,614,815 *FFE08BAD78D46AE48BDDDBF16C2362A173ABFC14 xinavane-granier
2,421,614,816 *FFEDF3640DAAC6BB17E2AABE3AC90B6011A830F7 [email protected]
2,421,614,817 *FFE98D3E545AED1A1C1E8133D7F48DB70292647E X}QK
2,421,614,818 *FFEB11710E66EF306A0953EDB3A3809FEBDAC0A8 XUJIAOPU
2,421,614,819 *FFE5726AF626910A6B2A21BAE409246C750C04ED WESTHIL123
2,421,614,820 *FFEBEC19B54FB18EAAD1A1E0BCC40C6C43426FC5 [email protected]
2,421,614,821 *FFEA4B031D32AD0032A2E41E363B6FF379905E0D WHATUGON'DO(FEATLIL'SCRAPPY)
2,421,614,822 *FFEDE5DBAE6A4BBA506004873045C82A3E2CEA07 Y5CL
2,421,614,823 *FFEDF8D005D71C8FB6B22928A6640136F0C947FF WIIDBSWS
2,421,614,824 *FFE8ABFDC59F099AB56ADD9F7180459A460DD5F5 WIK?
2,421,614,825 *FFE468A082C8C814495256AE014C13E702B37D46 YASITHSHANUKA
2,421,614,826 *FFE97F424743B8492285ED1FD679336F85AF1C83 YCLADD
2,421,614,827 *FFE829CD57F7BB44F7A1DB6EF25A74FC2A2D61E7 YCY66
2,421,614,828 *FFECB76F57E17C361539DE4D38047BFE45F34E56 wilhelmeniaWiggins
2,421,614,829 *FFE5F4FB4D1D7EFBE91AEAFBA41EC2876DD1708D yelicec9
2,421,614,830 *FFEE98389EA998B1B437021D2B1C9764E90E6ED4 YLLAUQEBUS6
2,421,614,831 *FFEB8D125F093EB23B2E8735ECE8D071D3FA172F wint3r.0a
2,421,614,832 *FFEB6B08FD77C6A499ABEAFD8E8DDD8CA6BA48F2 YOAVBSW0
2,421,614,833 *FFE133AF15163F4A49F2E7F8D0BF1A71B2706A7D yo no he sido
2,421,614,834 *FFE730B5CFB26E36067E08C55984ACB6D134D8C0 YSIPALITS
2,421,614,835 *FFECC303338E2FC3DC97DCC4440164D9B53FA529 WOUTERBAA
2,421,614,836 *FFEB0D08B3C31943F80359AB1C3ECBA580C057D8 YVIVIQSKMG0J
2,421,614,837 *FFE8D39DDD0B0B0AD2718B06D114E45CC53FA73F WWWAMDA-POMPEORG
2,421,614,838 *FFE5FBE3EB24AF9BB8F9FB61B3F73D18D495A1B9 WWWBANKOFABYSSINIA
2,421,614,839 *FFEF9A43B7A51776FE20426AEA744D401204D576 yzxs
2,421,614,840 *FFEDB2B7B2ED0FC8905519B83B16E1E609B745FC WWWGEEZERMEATSCOM
2,421,614,841 *FFE7B9D73E758B2874B7F573A577515E65786618 zachariahnahas
2,421,614,842 *FFE2073781CACD13395A880FA865903DE1F9238F WWW.MDF.RUFESTIVALSF
2,421,614,843 *FFE029C5C379C2AFBD15288E413EBAD1CADFAA49 ZACKARYBULIK
2,421,614,844 *FFE314064F9614C00252A74D39EDFB342E479ECA WWWRETHINKINGBELGIUMEU
2,421,614,845 *FFEAA1E0DCCFC13BF5CCC793F8B4491C069BB659 ZACKPULLARA
2,421,614,846 *FFE4D33BB35C2540A54C957E947F940906850964 zainol-anuar-musa
2,421,614,847 *FFE35459D11E79222A8E058B9CC85E61576C7956 wynnie
2,421,614,848 *FFEFA29B937EE4F049A04BE6298D41D308DB113D [email protected]
2,421,614,849 *FFE1B492AD73EDE1D843B10484DF4952F654E31A [email protected]
2,421,614,850 *FFEBDCC2B7B81F26400087E557ABD61BC4689EFC [email protected]
2,421,614,851 *FFE77916E13C4E7546FE682EB94A4D31F402E1D4 [email protected]
2,421,614,852 *FFEB49D2B167EF11B22E574111867D377D47DD57 ZHEIAN-JEAN-PAZ
2,421,614,853 *FFE0B714B306E2ECF762582AA2FE29969A80656E X-NE
2,421,614,854 *FFED655F4A01DE96332717DD16AE190E6D6D8F76 [email protected]
2,421,614,855 *FFE338E03E9E7FE2A3D49E582E707F9FFF5191F7 zolmen.emile
2,421,614,856 *FFE3A5D7A3579869CEF6B37DB02794063F7EC5EB y4m}
2,421,614,857 *FFE4CDDD5388B19FDE413545A0C59A25A951E70E [email protected]
2,421,614,858 *FFEB5340B0FB70FEF61033E05E348757180BB70F YA-MIGHZAL
2,421,614,859 *FFE9C1C47D66518C56BB7C1CE191E661F3BA5465 ZXCVBMADDOCK1
2,421,614,860 *FFE3C079ECCAEAB4DB6BCE9998B04852816CB976 YAROOD
2,421,614,861 *FFE106870C73C16488D70433535482D677E4DE1C YAYZ
2,421,614,862 *FFE65B0E8FC1B62F92AE56FA1CEB46F5D3A95DE4 ΒΡΈΞΟΥΝ
2,421,614,863 *FFEC5BB5AD39505D05B61DEAC68FD1AC03F03388 yerba-del-ciego
2,421,614,864 *FFE4484B6F07401D9ABE00C92CAABA6B642E9D17 εντυποσιασμένοσ
2,421,614,865 *FFEAD71D0EAE180DA5D8BC931CC4F13221E27684 ΖΟΆΣΕΙΣ
2,421,614,866 *FFE3BEDA51C0B156854F882537D58718B166384B ΝΤΙΡΕΚΤΊΒΑ
2,421,614,867 *FFEBE59D9013B9FF2A658486A775643E7829DEAD вабалнінкі
2,421,614,868 *FFE3E2DDB35732128F6B5F96BFC6C18AC8A33B1C владле
2,421,614,869 *FFEAB9B8A66BDE4EFCEB70AA186AD227F5B0B662 YONG.STRUCKMAN
2,421,614,870 *FFED2E132537CCC40FF9D7B864BD0657170FBB81 йокерита
2,421,614,871 *FFE9C7E4B3AB29F27DB21DB93A96A0FA28ED8992 Y{T>
2,421,614,872 *FFE4B46E48ED3D25777244D49AD3175906287377 майрцеллин
2,421,614,873 *FFE8AB0D3BDBEBCF12ABE185B683773B8B2389F3 [email protected]
2,421,614,874 *FFEAB3D941C438BA3DE9601F98472C016D8A93B4 yvette.derrick
2,421,614,875 *FFE5F9891E8B3C13214C89CE04705ECC5BC41DCB ПРИПАРИЛИЯТ
2,421,614,876 *FFE54160760506A355ADC203D19F3D03525FBCFE РАЗВОРОВАТЬ
2,421,614,877 *FFE219DD98679D828087DCB3EA2E7DA06AF4699C Z56X
2,421,614,878 *FFE592F11BF2FE61E07FE824287CA634AD303D11 СВЕТНЕЛАТА
2,421,614,879 *FFEB469455729572D5FECB9E97D6FFD3DA8A43C4 ZACHARIAHTENAMORE
2,421,614,880 *FFE2021F4B6B2A0CA19A3ADDF1E08278CAF9E367 ZACHARYSARNO
2,421,614,881 *FFED1282BA718C69BF6846549BADBC3A472BE4D4 ZACKBLALOCK
2,421,614,882 *FFE5D348FAC2A2A3ABC88C05B48617FF869652A6 zarandi-parker
2,421,614,883 *FFED45B76E0B8201BA99D50B6188B532F4FC653B 中退。TOKIO結成前は
2,421,614,884 *FFE01B080ED7DF095EADDA4D700D6F11500BF238 [email protected]
2,421,614,885 *FFE0AEDD347137F831EB2F7F398BC138FA33AAFC 技術により多重化し、ftth
2,421,614,886 *FFECBF04626735946E7DFE07E43C3AC27FECF21B [email protected]
2,421,614,887 *FFE808B3C634AA6280D11CDEDC3135DF1B7538F0 ZOUTPANING
2,421,614,888 *FFECB6D79264FC0B5A00465D002A10FD74C2C701 ZPHYRPLS
2,421,614,889 *FFE8625D02C50256D083310A5710B04DB7C4BBC2 zr\\
2,421,614,890 *FFEFF49523D3528FD12D0527EB4B541FC635E7D8 ZUARBEITEN!
2,421,614,891 *FFEB7CAFCDC4DB23BB797FBF7026EB93931FBDD6 zwschnfnthlt
2,421,614,892 *FFE2779E8FCDDCEBAFCE592DF6D6DF675D12505A віруа
2,421,614,893 *FFE3E5E50F8C192D7869176D7D02FBCD719D8FA5 специализировнные
2,421,614,894 *FFE6904695C82286A2D1BDF06E3D3E936DC468BF 1199963 THE-DOLLAR-OPENED-TODAY-AT-12843-YEN-
2,421,614,895 *FFEB029AFF7ADE311D5E2FE81E850375C598B006 11LORDS
2,421,614,896 *FFEE6E7D605A128ACA7D98A859ED8CD7ADD8A63E 1399845 virastotovatl
2,421,614,897 *FFEFF76CB22239263166724AD0108B2896EB1E2F 1410127 EZPRO-737-ON-SUUNNITELTU-VAATIVALLE-K
2,421,614,898 *FFE56763FC8EDDEE5A4EE800B3F2C96A6B76A6BE 1650DANSK
2,421,614,899 *FFE0C6303E10C0B0F746201D12AD937AC4A657E1 1678838 OPISKELIJOILTA.KER
2,421,614,900 *FFEC34B6554AEFA6AFAD62D84E1E0F09518B09F5 1693875 ZETTERS - TORY LOTTERY THREAT TO POOLS 10 .
2,421,614,901 *FFE2278ADC178FF830221DF360408E1401919AD1 1798980 animatroniconedelt
2,421,614,902 *FFEC54F8CDC8397FF15F88A7B091EDB37C7C69AB 17.tvwatching
2,421,614,903 *FFEFBFDA753C60BF733E67DDB30796DBC73F8CE3 1805304 INVALIDILIITON-OULU-/-KAINUU-ALUEEN-JOHTORYHM
2,421,614,904 *FFE95A6627D500F71ABF41D5C844C2559F623654 180KRISTIN
2,421,614,905 *FFE0AAB54A281665875AE63F71D67E1058144672 1824084 that-would-be-the-most-tragic-outcome-of-all-.
2,421,614,906 *FFEE1BF7772550E592A2C8B3E4B6DE87FCF5DAE1 1.APLIDIOMILUETTELOA
2,421,614,907 *FFEE9D01B376BD6CE8F6BB101A137EAAAC1D59DE 1.ASENNUSVIKAA
2,421,614,908 *FFE7ABD9010A84ED4CC49C6ED24C659723514442 1BESTWINA
2,421,614,909 *FFE46B58B6BA2BB0B641A1BE9E0659AF2BCEDA54 1.BOXERSNOTHING
2,421,614,910 *FFE9231DE2C9F5F394770AEBA1609E56D9DE99A8 1CJKCQHDV
2,421,614,911 *FFEB12BC3D40F48647C5EC23A9FB9FB00E082526 [email protected]
2,421,614,912 *FFED883ABE1C00E70E5F3FD77CD2B608D1A4D23D 1 GENTERCZENSJU
2,421,614,913 *FFE7F861416E9FB33754B43222207BF6B491DED6 1.GHANDER
2,421,614,914 *FFE1824910038CE40AE1503519BEEA33DAFDE058 1.intel-lehrgaengen
2,421,614,915 *FFE9097035558D2335A0073BF149C78C188C32A6 1.kessuttomuus
2,421,614,916 *FFE948317591C64BF566DE234D5BA7B78F6DE404 1lyhytjaksoisesta
2,421,614,917 *FFED93CBA05AA62E0B4DD18750EC39F7696F2F4E 09241413
2,421,614,918 *FFE7FECCE8C79EB3DC3B5C0C07AD48D510903BFD 0IAMSONICS1
2,421,614,919 *FFECC095631774CA209B33C177B64F1A854674F5 1suomikierros
2,421,614,920 *FFEC1FD988C45ACF0C2A258311E186F05AB7509D 1T5FR0MTH3P45T
2,421,614,921 *FFE77D61C7E5078E845F61DC19D4C17ACE2FF536 1-test-jugoslawien
2,421,614,922 *FFE779EA17C30CB74D0CD76EC4A45EDE360BAD58 118.GRUNDIDEE
2,421,614,923 *FFEBEC62208E6179F1C71C22DCCDEFFA589BE4B0 1203848 TROTZKRAENKELNDEMEURO
2,421,614,924 *FFEF04779F0FB92FC47A39CBE2D58C24BE2F1CF1 1.uutistoimistollaei
2,421,614,925 *FFE165667A21E8F537954BBAE6B5A563DBDF8F70 1291469 but-by-this-time-,-the-banks-had-had-enough-
2,421,614,926 *FFED804A95E31BF3E16A735F5762FD417E99D9D9 129327 maakaasu syrj
2,421,614,927 *FFE7B1E46FA1E2A340BE8F9EDB956CABED60D4A9 1WINKLEPLECK123
2,421,614,928 *FFEA3A984D8035C4B17718D36E4877D291E76F9A 1439806 essin.verkostomaiseen.ty
2,421,614,929 *FFEDC9438803B8D52D9B9D997D5FA487E6FEF573 14cayirova
2,421,614,930 *FFE8B82AE497AA11B88AF5C1D3C94B670C7BB306 2058518 oli-hivenen-vaikea-ymm
2,421,614,931 *FFEA612CFB0202A506F173FE18584F0948E1B7C3 1540450 AEHNLICHE REGELUNGEN GIBT ES IN ITALIEN UND SCHWEDEN
2,421,614,932 *FFEC39AF4874993981B6D7B45F81D2D5795041C4 156faith
2,421,614,933 *FFE040F59D4EFCA33CD486A432B534DC1030DD94 16081810
2,421,614,934 *FFE30F6027EAEDD5E3918F86A8BFFE7FF1721E02 2326731 JOS L
2,421,614,935 *FFEC0EA7F4CD7A93F208BC4D1AA95552513BFC3C 。1876年爱迪生曾在此处安家,同时建立起工作室(MENLO
2,421,614,936 *FFE5DA3E1EA6789E7EC857C4D58E3BB5DE8BC0EA )1964年、FRIEDRICH
2,421,614,937 *FFE0715299402994DF0C26A84623CAFAD5E781E3 2633480 P
2,421,614,938 *FFEE4327ED8E786BFAFC280238FA0E985234071A 1ADELHIA
2,421,614,939 *FFE7A94EFE2A6D78C28287C58291E48C501294FC 1AMNA+OR
2,421,614,940 *FFEACC201BFBE6C1C18C58F9D15CEC9E15A7965D 1.bildungsaktivist
2,421,614,941 *FFE729BAC14ED22266ED42AE4BC916C48250B53C 294583 agirlik.9.30.gr..
2,421,614,942 *FFE601E4EA07F3FBCF452508A7E1C5C9D2B9E989 1 BUSINESSES-DOWN
2,421,614,943 *FFE3EA7506C7A90004C864DC3C240CC1C848EDA7 1CFJWILLIE
2,421,614,944 *FFE96FC5D058DB08E7FD209BF7A4989C07C1FF44 2AIRAMUCE
2,421,614,945 *FFEAC41ADD4FDF899F93A16CDE90D2E180DE3F61 2AJOOHREV
2,421,614,946 *FFE655427959294A3D6F46BB899DE723037E10F2 2.artist-an
2,421,614,947 *FFED5B717E1952416D6E99FBCE7CB9C44D499D6D 1DURASTEE
2,421,614,948 *FFE2D8094AC1550969183419DF61AEC04F4855D0 2CHROMATICAL
2,421,614,949 *FFEB269B72DBDF79A7C5491C540D174A4568FD24 2CISELNA
2,421,614,950 *FFE34820E0765726E56BA18AE5BB519A68DD6F50 1 ekatokavuotisia
2,421,614,951 *FFE71D0B6E504F7E4192A1197C5D442AD6D62979 2.EXPERTENSYSTEMS
2,421,614,952 *FFEF1C794FAC421D1F9AFD18D33C637483770CC5 \2f<
2,421,614,953 *FFED4F0F138682DAED99FD8B0CEA4AA5847B7BE3 1.HERAUSKLETTERN
2,421,614,954 *FFEFE66924FBBF87875424C23CA4454CE7846E8B 1inc:sta
2,421,614,955 *FFE85298571A64F9BD2311B762A73CB09C11D2CA 1-irvist
2,421,614,956 *FFEC1F5DAF126D024022AE6C6183EB4CD7591258 2UUNDBSW
2,421,614,957 *FFEE91A7ECA82A847282AE7BEC82F1A7DFD788A8 2vulnerability
2,421,614,958 *FFE8F11DE71F7F416591C9C0BB5620503124B124 316422 liitetiedostossa l
2,421,614,959 *FFE260AF60F86B1DB36098E7A1EAFE1BB42A8D09 34ALEENA
2,421,614,960 *FFE102086E999289883ACF26EADC07B6849AC4EA 369942 TUOMARISTON SIHTEERIN
2,421,614,961 *FFE7AE2710938A23B8D0DCDB7CB4D38D3030D564 1.POSTHIKE
2,421,614,962 *FFEA9C384D5E000326DE6774B501A9008E8097C4 3B ~0~o(0_<)
2,421,614,963 *FFEB354751FD6B78AAAA95CDEE50A890BC3E7AF3 1roeckleweingand
2,421,614,964 *FFE2516D903DCC60D35EA799E4A6315A7C66484B 3d * * * ~0~o(_0)
2,421,614,965 *FFEA4AD100BC23801A544CD16E6450069ECD4EF7 1-tarkistuskaivoihin
2,421,614,966 *FFE22649B7B66B3E7ED24A5ECBF2E7481B745F09 1TAVOITEIDEN
2,421,614,967 *FFED6EA4E3D44FC7A2C17F96D15EE274B6EAAAC6 3IZGRADEN
2,421,614,968 *FFED9F760B7B1BFD60D26F8062408353441B4D99 1.USOFFICERS
2,421,614,969 *FFEBCA330C8B587DED1DDB3D002477B98F142484 1VOGELGEBIET
2,421,614,970 *FFE6665C91356A2ECA97C305BB252814B10750E6 1.WERKSTAETTENJAHRESABSCHLUSSES
2,421,614,971 *FFE50DE364F6448167E524B5FBC707C946117778 3p.*.*.splat
2,421,614,972 *FFE306DCE5B33E06B440EC6353B2CB0E04CA219E 2000:DESK2000
2,421,614,973 *FFEAF03CE741788056925A5E61070E6FFA10715B 2001.'[[GOSFORD.PARK]]'..[[JULIAN.FELLOWES]]
2,421,614,974 *FFECC0F6C0E80C34BF3787A576B09E774D298304 445SELINA
2,421,614,975 *FFE3F864ACBC0E52A24D961ACEAEA53E6B1EA560 22.05.1424
2,421,614,976 *FFE17F68B30B66C19318420D342C803CB2611340 4B1NC1
2,421,614,977 *FFECAB1EF40E0CE221974EAAB1C4CA425A7D16A7 2349398 TIETYILL
2,421,614,978 *FFE46353667BE27F91410721DA6C84A91C41018B 235B8441-4357-3C72-805A-5D2F90083ADE
2,421,614,979 *FFE08A637B3030CDFE228F372CB9EBD5461E63E4 4CALOGGERO
2,421,614,980 *FFEBB4CDFEC17719D083C0E0DC9445A4441AB3A4 23APR1807
2,421,614,981 *FFE62C1EBFB39EE6D99AD5B9382494484580EA2B 4EVERBOYS
2,421,614,982 *FFED70D9630948240F46BEC6E21234ECFB6B278D 267905 bunlararasIndanUCOnemlikonuelealInIrsa,51
2,421,614,983 *FFEB0881A5CF7A0F9AD862CDFD7A72DBFDF94CDC 4karin9
2,421,614,984 *FFE44F57683045244E70D6A6C53B3C3B8DB38BAA 4LSMKNSMRN
2,421,614,985 *FFE4A7CA5F1D9CED7D6F16BD2C3DB6A6295226A1 4MARAGELLA
2,421,614,986 *FFED1E80D367CD073AFC3FA7431077E7255293FA 4MENGELMENGEL
2,421,614,987 *FFE9168449517751076E0A38DF574372A712A256 4mypierre1
2,421,614,988 *FFE6D8B003A2A0B61D08DB4AF23AF6E758545AED 4PRATTSBURGS
2,421,614,989 *FFE54ECCC6120D107FE3A37A9CA6BCB0B38D9DC2 2baSkanlIGInIda
2,421,614,990 *FFE379DBA60687DD81C1F4EC370178551271D493 4SETHAPUT
2,421,614,991 *FFE64B845D359247E7E69D3756BE7A76F86C6C6D 4shifter
2,421,614,992 *FFE5E3C22EF718FFB32AEA28B3FCF083185F2752 4SISIHCSOINARC
2,421,614,993 *FFED9244CE701C18A3FE286D81FEFA756F827589 2ekotehokkuusajattelu
2,421,614,994 *FFE39EFD647E5A9CD1134C8F87387B26321E2657 4SOCIALBIDRAGAS
2,421,614,995 *FFEECBD3F8FCAD86F416BC3F888412D6614CCBEF 2IAMLAURIE
2,421,614,996 *FFE15CD1C23D143CB483401FC660C386CBDD6CBA 2KYMIYHTI
2,421,614,997 *FFE6AC042FAE6528C3CEBF9948F3B2F6B22F899C 2livefussball
2,421,614,998 *FFE11F21C102FF5A66EA6B25D2AAE764F3973E6B 2.RIEMUKAAN
2,421,614,999 *FFE31AB8421D6A825F15E53A814B9F8A55BC02A1 5APELOUR
2,421,615,000 *FFE554C6D7D177E6DD065244119FBA5A235039DF 2UITZIFTE
2,421,615,001 *FFE7DD8F8654533560D370C3612CF5B1C47BFDDF 5CHERYLKILLER
2,421,615,002 *FFE319FC2F573E348B4CDC91C3D814DCD50949B0 2-YAZLIGINIZ
2,421,615,003 *FFEAA84AD1122456FA2D8F2395D66509B505A834 5CORUSKSBSW
2,421,615,004 *FFEB44E3D3F94D12D0613F161601F3F04DB0D820 サーブ340B
2,421,615,005 *FFEFC4E0A23D4525A61194AB3B8767B5749BE3FA 373564 no.3,bvw814IngilizsUiti.
2,421,615,006 *FFE7F047D7ADA07E37AE7E8A77CAE882777C08A1 5KAUPUNKIMAINE
2,421,615,007 *FFEB5C29BA9D9AEF73F93C3B5B8E8C08ECA92E9E 3B< o~ 0~q====3
2,421,615,008 *FFE47C107039B9C6A4EAD293EA5525C16CB57A6E 3####D~O3B<-
2,421,615,009 *FFE334DC23045094BC58028C0A3919669EE82E15 3iamharriet4
2,421,615,010 *FFE548F6E61B0C24FFD267691D78F8A15DD8C87C 3MYTHOMPSON5
2,421,615,011 *FFE2D5D76C5ED5C2A1E9912005F83EA75B7A7577 3SREIFINU
2,421,615,012 *FFEB037385427025376AFAEE6E157F2A487E5F29 3 VALTUUTTAMISSA
2,421,615,013 *FFE986B78533A4D5F56D18EB0B060053B7453F20 5YELDBESTIS
2,421,615,014 *FFE256B0C0966D92103BF4D84EA0DB96D2367C82 3WHOOPED
2,421,615,015 *FFE48376F7DC05583E6B18D2BE28BA11CC2AA43D 607550 turtonen.,.r...,.ty
2,421,615,016 *FFEE6FFBB8013FB60B6819E4DF4FEC57823EA834 423C7235-00A3-3777-BFC8-EA6B7A4865A8
2,421,615,017 *FFE140F278283E3D449C8607FED3850DF9AF4342 425408 seracIlIkta-yeni-teknolojiler-.
2,421,615,018 *FFEA15D02D196DB1619FD92F30BFE77BF93A04DE 6ABCSPEEDO
2,421,615,019 *FFEF21A611307B0E95E3F07A35080F99E5CB1E6A 4BDEIGHT
2,421,615,020 *FFEF94D491941BFD38C9219231B2D868E6008A93 4DLEIWNU
2,421,615,021 *FFEC11F431D882563E6ED6F38F194F59B5748E32 6INDIVIDUALIZED
2,421,615,022 *FFE4026AEF5C831575688DFB8ED69DDC0481FF0F 6pachl
2,421,615,023 *FFEAF165765D778BF512E4FDEE2A008BAE0E824E 6REGITLAF
2,421,615,024 *FFE2DDE70AA2FA1601E2199641F8B5AF5BDDBBB9 502105 mutta-sen-oli-pakko-uudisraivauksen-tielt
2,421,615,025 *FFE38D6E5457E5E860F395FE10760E4CD2D91B24 511575 puhutun.kielen.kurssi.on.soveltava.kurssi..
2,421,615,026 *FFE271C814EF9A5B5C1452A0D3C64709C7F6657A 54NGL3R
2,421,615,027 *FFED1AB757C48812E97F5547DA1A27C32434B264 6vz4lt6m9c8548
2,421,615,028 *FFE8F26B3945FBF813423C2A99A9D116FE3B3B5E 719GAGE
2,421,615,029 *FFECB7F529F964C7F7E4A0C894FA83402B8A3707 5ADALAINE
2,421,615,030 *FFE3A614412D4D22BB1CA034D4A3DED7A7F72BDD 5AERZTESTREIKS
2,421,615,031 *FFE84A6602E08DF625D0EEC2817380584593D025 730966 kerimCollakadaletm.y.o.
2,421,615,032 *FFEF8AF4061E695B3B8FA18E7D12178EAA223257 73mq7gq7v419040973gr3942
2,421,615,033 *FFEFB51F92D83F10E55694BCE2F83B8E412AE8C4 5arviointiprosessista
2,421,615,034 *FFE88CE7B7EBB3EECC948573D6565BE5805B13EE 5BADBOYKNICKS
2,421,615,035 *FFE38A0D507168F4C7DB5D2CD71B407DB70008A1 .7891.,51--1.,)1(11.AIGOLOTPYRC
2,421,615,036 *FFE785D6DA7382481C3A83D541B0E0B1034FD2E5 7BALLVALVE
2,421,615,037 *FFE1FA0725AB1F78D29262FD605B0A539FA73100 7BSWSEVGILIMBSW
2,421,615,038 *FFEFBED8006E9CD8EEB91B749E914ECBAA87E73D 5DOCTORMOOMOO
2,421,615,039 *FFED6F0D6B9A55E9D321DBBB3307AEC26018EA05 7CLINOHEDRAL
2,421,615,040 *FFE0AF5942DF98846A29A87E3649793BB7BAC4A0 5ETAIHGUF
2,421,615,041 *FFE5B7867B2AB3BFC36E5662EC58EBC1FF8A4AB4 7ENTWICKLUNGSUMGEBUNGBSW
2,421,615,042 *FFE33A9AAB4ACF9F7000D8207D5CB1F8F544DB17 7IZOLACIJSKOJ
2,421,615,043 *FFE2CC94C30A25B45CC3B0F0F74137A04849CE46 5PODTRZYMYWANO
2,421,615,044 *FFE7E26366D39D78FAEAB06186B32D8E7575272F 7OEFFNUNGS
2,421,615,045 *FFEC05CB87C42B71818047D1D5F49BE3EF6777A2 7PRODUKCIJU
2,421,615,046 *FFE33252639139B14FE5E6118916EFE4BC88D01F 5SHELBYPEGGY
2,421,615,047 *FFE9442DD9773BD65CC310AA451E863A25A5A676 5tabulatorposition
2,421,615,048 *FFE59042E3A1418A13960E0155EC61601E4953E8 5VOLGEKRABBELD
2,421,615,049 *FFE89B8711AF06E6E2F1895B2ED7684CDE7966D2 638458 elini-oynatmak-istedi-olmadI-.
2,421,615,050 *FFE002DBA509C4EFA921AACD1905AA237DD17BB7 8527F542-4DEE-3AFA-BEC2-75A3EE9043A0
2,421,615,051 *FFEBC95170F804C046DAE3C07A8EE05913DA94C3 8ATTLESTEAD
2,421,615,052 *FFE7839C85ECDE87992C7B77F12DE386F24EEC50 8dragicevic
2,421,615,053 *FFECE250DE1A4B9EC9ECDF45F57E310523EC3118 8ISIAUNUM
2,421,615,054 *FFE24E78280DF8F099478903E0CFD8E10C7CC542 8NATGARNET
2,421,615,055 *FFE6AC672B75DC5E916FEA9A5A36D78CE23DD66E 8>~O~O:P
2,421,615,056 *FFEFE3A0BA4CF90DE9FFAF6359C7B743E615813B 8OVERSWARTHS
2,421,615,057 *FFECC14DC63C6DE8EFD3E17CEA3C00D3568ECF77 6thatwhoville2
2,421,615,058 *FFE5278712ADFEAA2822E13385916B6A463DDA3F 6VALSERNE
2,421,615,059 *FFE25BC43D74501FFC571059D518C914A148D4D4 8SCOOTERPEPPER
2,421,615,060 *FFE5DB4BDF87FE4EB394EB8CA62BDDA8FF52435C 8TONKUNST
2,421,615,061 *FFE4B5B15C81CCDF879A3DEEBE98867485227EC1 7ADIRASSIS
2,421,615,062 *FFE670A2E89501C39C32917D1485E2C27522F29B 7AGENTFILM
2,421,615,063 *FFEC9AAAF2D19938FF36DB5720E7B8FB4DC20067 7attendrirait
2,421,615,064 *FFE2325E00C738648E2FF2DC5D4DFFD9A2526E23 7BSWHUNDSTADBSW
2,421,615,065 *FFE56B32A83F2F1B664EBC51124AF2F0844A8891 7CLASSROOWEEZER
2,421,615,066 *FFED79A4E5B3B32E4C7BA5DDD988639862C628B9 7EEUGIRTN
2,421,615,067 *FFE966067CB8D9265F2B4650DE94AAF0EBA00AC3 7ELBANREP
2,421,615,068 *FFE7497C0880940DE68E4AF11F01923D3AB2FACB 9BETNKETID
2,421,615,069 *FFE3FAE21C31B4136A3E8F0271EAE5D9297C04D5 9CATCHFLIE
2,421,615,070 *FFE8A486E17FFB67A4886A0E80919A58A90A993B 9CNTRRTR
2,421,615,071 *FFE78F19440D3C25FE63FC4B3E0800633D3AA172 7koheleth
2,421,615,072 *FFE6C8E0ACC08F4217CF0595D0361075CCCC9D7E 7MADDOCKCESAR
2,421,615,073 *FFE31E62130363C32467095D9062E47D2A601DC1 7NEDIEULA
2,421,615,074 *FFE4EE2619EC5A9B6F47EB1B2CE942554877804A 7SALVUCCIN
2,421,615,075 *FFE82940FAF2276ED2527EEE64E5DA49B52A2A03 7SEIGNER
2,421,615,076 *FFE5E86302858227F383A39C96ADA2F99085E825 9MUTABILITIES
2,421,615,077 *FFEABD8A7B4D6592888F57D1CC2A95D986FFC4F8 7STATIONWARREN
2,421,615,078 *FFE13F7AAC120828E3E3BEA5DE150A3E57CB805D 7UNFAVOURABLEA
2,421,615,079 *FFEF78EA58D039BCF0BCA5B72C20C48C29A2C5EF 7VERGEWISTEN
2,421,615,080 *FFE0153C64BBDCF23E4509429D711B21E2793C0A 875494 BIZ.HUKUKI.BIR.ENGELIN.OLMADIGI.KANAATINDEYIZ..
2,421,615,081 *FFEEF915A5DADF6DAAC76B4A955CF1A21EF7BC2B 9XTRANSPORTBSW
2,421,615,082 *FFE02565528A87161857C3DC3E5369412AD711B6 8b4ae72f03d529f0c1256f7a0053e7c9
2,421,615,083 *FFE3F49FFBCD65C3CFAC8081A8BD85EE0F8A76DD 8BILLIONRINGG
2,421,615,084 *FFE131E7299F870837FC773F2C7E25E12DED3E22 8DOCTORDIGGER
2,421,615,085 *FFED16BF25EB0F4EEB3DDD0E299DEF595FAF9315 a4p;q
2,421,615,086 *FFE69D37DA696E098A893816685FDA3D98690ADC a7/ss
2,421,615,087 *FFE892F28A0AB3BCE378D786FC4F797EA2B6AA39 8NIRVANAJASPER
2,421,615,088 *FFE87C63EB182EC8BC3E5C65EBAD161C8C4EDE79 A9Oa
2,421,615,089 *FFEAB10A153F4E7698323D0338FE9D68489F1B7E 8===P ~OSPLAT
2,421,615,090 *FFE210C55AA9EBBCEEE84D7EF17F518AD764CAF8 8STNEIPICER
2,421,615,091 *FFE90D7DEEFA1AD66FCD4EA4A25B6EE4B94D68A3 AABI~3
2,421,615,092 *FFE23D40FEB96E305879D5D2363F2F8C6B6F7748 8USKLADNENI
2,421,615,093 *FFEFD898D4ABF3FE3FC03BC3C5854714D8A70869 8UZEBDDRBP
2,421,615,094 *FFED2CA37E802E1F0D47CDB4278D21297E159C2F AACS}D
2,421,615,095 *FFEB782848861D0A4B4DD6C1C89FF0714BB7C65B 949375 kihlauksen-k
2,421,615,096 *FFE3C349F5CAB4F3BF69C5041BC679BFAE929EB7 9ADOPRAVO
2,421,615,097 *FFE86E78AF8FACE1CF4B731B66576D5A919F8907 9CONFINERIONSES
2,421,615,098 *FFE42DB1D874138364C062E7EC35E6BB71632FA6 AARON.DUBREY
2,421,615,099 *FFE047CD723A065E6DD1B25F23A1A8F74F497419 aaron.karlson
2,421,615,100 *FFEC8E717C339FB4D6FB80C5BB8EDD0C40842173 ABANIC9
2,421,615,101 *FFEEFB325900A4CB9C5C18FF428A80555158F395 abrammulich
2,421,615,102 *FFE07775186463410200D39A34F802C74F448B4C ac#8w
2,421,615,103 *FFE1A8387924C69A42AC75C6A79644EC4B2424E6 9UNSELBSTANDIGERER
2,421,615,104 *FFEAFB718FBD6400DE6C40540AC9E75E74D154AA achagaro
2,421,615,105 *FFEA7B4CA921319E6AC8E0BFD37372613750E0B6 ADAM TEDESCHI
2,421,615,106 *FFEFDBEC304401488219F1A8D398F6F7FDC3457A a4ky4
2,421,615,107 *FFEC64DE8DABEBB92A65E9AB2FF8E8518F9885E7 a5a?-
2,421,615,108 *FFE47DCFE771A9F042BCA1F01029AAE6CA2E1934 A5CCK
2,421,615,109 *FFE76DEEA89352FB4F3B51974C25158F37D6AD60 a&5:x
2,421,615,110 *FFE5B0B9A70E2F96E6571E60B0297A9C3D18E345 A7LH=
2,421,615,111 *FFEF5DB27B55F75BA4535335EAA25AA95BDD0EF7 ADRIENNE.CARDENAS
2,421,615,112 *FFE6E49BD9031113BD8320D2E0A090E47C4851DE AA_0/
2,421,615,113 *FFE1266FF48292B614507D2CA3C12376785E2951 AAFNH/
2,421,615,114 *FFE457B9D7C3A13D280028D53F0F5D68FCFEEE94 AHMADFEUTZ
2,421,615,115 *FFE7647D2F323B4EFB378208841815579FE8A138 ahmadridzuanmohdtap
2,421,615,116 *FFE1EF66025D7435F60BF8B9097EFABAE6A8CD0C ahmvu
2,421,615,117 *FFE03D11C39924DAB880B9C9B4F849AECD069097 abarbarea!
2,421,615,118 *FFEBD8CC65D4648A64050FF2F1F0C3A35B776020 AKIERTUE8
2,421,615,119 *FFE7BD6407386569D4FE503045D10FBE5C938CCA abm!f
2,421,615,120 *FFEB4F35E89F536B5B191ECF6D4CF048CB85E310 ABRAM.BUNDI
2,421,615,121 *FFE7D5CEC2774CE8F2F3D32D42710C336747BD93 ABRAMGOLDSBORO
2,421,615,122 *FFEC6956B2D2E533C53692B331E38A04788B7B9A al$0v
2,421,615,123 *FFE1A7799FB5AF576FA5FB914205AB4AD0FF1418 ABSTERGES.
2,421,615,124 *FFE9519729876F4B7B27F8455D4FD58509612CC2 ACIDOPHILUS.MILK
2,421,615,125 *FFE68B9C04A3914A5E3145E539BC068E2D464FE2 ALEXIS.HEIERMANN
2,421,615,126 *FFE75E03AA3A97A5BBBE7AB9984144FC5D05FE79 AC;K5
2,421,615,127 *FFE4475CD6E4F8A1C97CA3A0D217D96602269297 ALFONZO.MCGRAY
2,421,615,128 *FFE5B67173BD1C9F32853B371834205DC8169FE6 AD0<A
2,421,615,129 *FFE227CAF4388E65E816FECB9EC820EEB2BFEC90 ad,4n
2,421,615,130 *FFE9A65E90AE9497609EBF5FC7446614BFA9B9B9 ALIVIA593
2,421,615,131 *FFE8255228C97C6DF589ACB4C9661EA5F0F57B8A ALLHEIMEN2
2,421,615,132 *FFE792E4CAF2EBDC6F91936EB970E29994A4F8C1 [email protected]
2,421,615,133 *FFE39221F8D4584285A19086E790DFBC65F2317B ADEMPTS7
2,421,615,134 *FFE762977D1CEAF8D520D997DE9601FEA8C6BEEE a/;m!
2,421,615,135 *FFEA5F60D68AD81621D7DB061BA6596EF9C9ACF3 a.f;8
2,421,615,136 *FFE66BB1F28EFCC407FEBB2414BE42CC410B966D aminoquinoline9
2,421,615,137 *FFE63044A077E97B21C7FB6B2D6BEB01B258780A ANDERSONALCOCK
2,421,615,138 *FFE15B8DB3B5CDEE9821A50EFDCDE3B70816474C ANDERSONBALCER
2,421,615,139 *FFE70C8235B5C7B4B5305B29823A0BF74EFF1729 andersonjuart
2,421,615,140 *FFEDD868C65DB53DA8A89321168589CA3F94C874 aghwo
2,421,615,141 *FFE1D9015CDF5993FF60F7E39087F51091A2ED4E ANDRES.RAMONES
2,421,615,142 *FFEEE9813460CB8AC80A1CCE6A848BA7E79FF363 [email protected]
2,421,615,143 *FFEDC17EDEC43EA203D59C80E6E2C80D84A34E29 ANDY.HARMISON
2,421,615,144 *FFECB06268BD55648839878DFA26774E9A22D908 AHMED EL MANAKHLY
2,421,615,145 *FFE154B628DA3D4E691EC82E1D33611416101E87 ANNEWOLF5
2,421,615,146 *FFE8D3929765E233E9E2D85C1942002A31F9DC2A ANTON07
2,421,615,147 *FFEB33D5A683F4DDBA85C6D21D05F913A69DB2A3 ANVEEBQING
2,421,615,148 *FFE2BFE6C51BFF856322DD9D03AD7D9A1A596CFD ALDEN.MEINEN
2,421,615,149 *FFEC8767A71A718EACB34191F94CF4D870824939 ALDOMATCHETTE
2,421,615,150 *FFE40BA6666BA8EFAD06383F6D1EF170503777C7 ALDOSUKOVATY
2,421,615,151 *FFE65F8D21F96AA8B8C320C247D1A13BF697DC01 APPARAISSAIENT9
2,421,615,152 *FFE69EA1BA73F42C841ED2A5D8599E90A7F953B0 AQLKF
2,421,615,153 *FFEB81254FB2FE40A24EC4906E98B2CB66CE77CC ALICEMARGARET
2,421,615,154 *FFE38485E194F7B9964A56D091FFD590374FE51A ALLANBOTT
2,421,615,155 *FFE6A8A15D684247A16997E43C02C3DEF50AF36D ARCSPUBLICHING
2,421,615,156 *FFED1DE901A01407ACFCBE4798870225B15FDC2C ARLENCHAIREZ
2,421,615,157 *FFE2161024710F5BF7D113D58ED5E7847999AC7B ALPHONSO.GOODHUE
2,421,615,158 *FFE65CBC99D3D4CEC9CAC460795B7AF161BF4301 armagnacers
2,421,615,159 *FFEDDCFB1E2BE5DF3813A662C90B063DEA40D0F2 alvarofahey
2,421,615,160 *FFEDA2D50F46E0A27E9CA1E9CEA694CBF32E27C6 alxhu
2,421,615,161 *FFE41BA2C6932D1975268719528D387F732B925F AMBELAU2
2,421,615,162 *FFE046137889EA0AAB21D29C01CDC7E5D3538648 [email protected]
2,421,615,163 *FFEFC38E333043A7BA4AD4A919237230FB073DA2 AS,%6
2,421,615,164 *FFEE358C50BF65C256A2EF38332106A8885F213A ATHEJ
2,421,615,165 *FFE783211EC636AA6D505EFC08D82907E01F1C2E ANGEL.BAHRI
2,421,615,166 *FFE94D5B79DE23E3EFC174CD65E3FFA9E9A6DA0C a=:u,
2,421,615,167 *FFEA4007AB0A91C98A3161E42C9C6AD314406018 AUTUAAKSITEKEVÄ
2,421,615,168 *FFE4BBF287DC58A7C9E845FE6BDC475431CE1457 [email protected]
2,421,615,169 *FFE624ECD6B280C61776F8347711FB3F30CC0EF5 ANTOINEGUEDRY
2,421,615,170 *FFE4B06A653D32FEDBAC696027875FBCA032D862 ANTONIA.FORDEN
2,421,615,171 *FFE973D5382322BED35574FA96B190652FBFECEB av$fv
2,421,615,172 *FFE9C9B3A196B25E232CA094D9520F6EC9216BCD a;p6?
2,421,615,173 *FFEC07F8E0E86AD93D375EA158133D5023E763CF APANHEMOS9
2,421,615,174 *FFECA92D16117255C199B17F2F26128478FA8FE7 ay1tj
2,421,615,175 *FFE60EB0B5502B025ECCC074B29A9D8D99FDEE2E AQ4K6
2,421,615,176 *FFE7052F6FA4B897AF1902B68A9DFE791F700B37 arbsummaryofevidencesharbat
2,421,615,177 *FFE6610A521141BED6E4BA052A6709A3304B05E1 b37z1
2,421,615,178 *FFE67F0C9E1F129901D934F5A54334CA4DA9D8FE ARequieminOurTime(FinnishBrassSymphonyfeatconductor:HannuLintu)
2,421,615,179 *FFE30F2A641E94CCB1ACD133E71604EC35C0042D b3wr7
2,421,615,180 *FFE1C44352B593CEAB04F4660C9F97F4673742A1 B6!EK
2,421,615,181 *FFEF56CE37337EFC4B0DF93654595865A9023978 B6U;X
2,421,615,182 *FFE57FD92E3531FC2DC0B292A783376442BC04E1 BABQ
2,421,615,183 *FFE2505C254B80FC79D563ACB5BC0D0151CE8295 ASHLEY.TENDICK
2,421,615,184 *FFE3E2CC9093A78382DD42BD623145DF5909298F ballad3:thealbumoflove
2,421,615,185 *FFEA051190AC040723D2631BE9B18DE5D445AB1A ASQM-
2,421,615,186 *FFE741DB9DD57B07D871EE03BF73AE258081CB15 BAMBANG.GATOT.NUGROHO
2,421,615,187 *FFECB3E802A684C92917D4B48E64C045E69BB9D2 BASIL.HARRISON
2,421,615,188 *FFEC2938E2F84EB90C36B7D4223F0817BF388B58 BASILPANKO
2,421,615,189 *FFE2EDC329C2F61FB18AFE423C582E58CDD04315 [email protected]
2,421,615,190 *FFE22FF011CC59200400002C009FB2081EA7C256 au4uf
2,421,615,191 *FFEC9A3B295CDE2F6D0D626467F2985405B1FBDB AUGUSTUS.RAINS
2,421,615,192 *FFE34B2F892C655B00F06BF87651EA4D2FE2F52F AURELIO.SEEVER
2,421,615,193 *FFE8DC324BF9EA1427561D01527FA16B32C5E462 bb7r$
2,421,615,194 *FFEC55651F2B37B2588EC20C1A80918EDF099FD2 BD
2,421,615,195 *FFEAE8DF03B15236C60653EFD8548ACCF33CBDEA AYHEO
2,421,615,196 *FFED2FBCBA13A1D849C79D1A9CEB231F2A3BAD40 az50.
2,421,615,197 *FFE6B7E76638C83E629213F499DC1CC3C08EC885 azurfat9
2,421,615,198 *FFE422648D3D34B3E4179620701D6AE11869C2D2 b#1?
2,421,615,199 *FFE74A5BF8AC2AAEDFABD4063D342D9E2F46DD27 BILLIESAOUS
2,421,615,200 *FFE937BED6575E46275D9A5F9FD63C8538812AFC billyplesant
2,421,615,201 *FFE5A4A2C3520688C6D1A306DF466A0D5D33D377 BILLY-POIRIER
2,421,615,202 *FFEE1653C1CF6F53DFC3C074D10A131E0F595925 b.,iq
2,421,615,203 *FFE9C9C2853F434E3B5FDD7574E4DA3879EED220 bitter.anthem
2,421,615,204 *FFE7BBF7D1419290B288FF42AD8DCCA96F443B70 batwc
2,421,615,205 *FFEA5BCA53B61FC2DEC71E8DC9A9AEA4B3301839 bb7r$
2,421,615,206 *FFE5688B6CEE4E45CDBC3C20DCFCB84D185C9B62 bcg99
2,421,615,207 *FFE5EA211190657A32A2E264534E309C95C81951 BCOW3
2,421,615,208 *FFEF2645A293A6049D53B4D11588A3D452486782 BD5:
2,421,615,209 *FFE3CA6E229FD339062C9FF1714774E58D2E4CA0 blwcuexw29
2,421,615,210 *FFEE619C6DDE4D67E0FDB6BBC260ABFE368EE305 BELKYSC
2,421,615,211 *FFEDC6B7276F2A181068905AD28F541C3528D55B boarender
2,421,615,212 *FFEE58C6EDA1DD46FD9E96113F53A3AF24532A4F bengreenaway
2,421,615,213 *FFEB15F665953BFBE61EA8572146180A51775AAE berlyne
2,421,615,214 *FFE36A43E2A827893B8C0496C664301686585D9C BOORAR
2,421,615,215 *FFEEFF38B1EBDC177E3FEBBE862F6BC55936321A beschork
2,421,615,216 *FFE5D1B497B19311938C5C913BC705B0A07A3302 BOUBUNSE9
2,421,615,217 *FFE94EEC567201DA0537A67CF4CD9F5B46E7D5A3 BFO5J
2,421,615,218 *FFEE1DD5D5CE2A4C5F333F8B9C7DF66C51A495E7 BIAGETTI9
2,421,615,219 *FFE26F92096AD6392EBAA888686EC7E2E0DB398B BRANDENSCHLOSBERG
2,421,615,220 *FFEE7491034166760344281D19DE22A9558249F2 BRANDON.BROUSARD
2,421,615,221 *FFE8A391942A7EA3CD46DA0D3A029940D8B1E262 bigdog60
2,421,615,222 *FFE4E99945266BD191F819E170AB3B518F91595C billkosmd
2,421,615,223 *FFE9FB7D29F6B4BC53A2C2B28D4D16A5EFDDBB14 b?rhv
2,421,615,224 *FFE9384B10BE196597A7CE2A37D2C099F80021EC BIULR
2,421,615,225 *FFE52A97FC8CB74C60EB71DF7928F7F1E455DEC2 BRUSTSEITEN
2,421,615,226 *FFE3686E67EC6847759BDC61120A5BE338C6CD64 B&)_S
2,421,615,227 *FFE2B52C2A0B476628C95C0061BB0C7E62B323EC BM3)I
2,421,615,228 *FFE8A6C59ACDE440884A6118130D7B2EFDBDBCD2 BURDENGASSE
2,421,615,229 *FFE1163C679B70D54DBB29C775E73D68D556008C BUSCHMANN)製作了現今口琴的原型。
2,421,615,230 *FFE42936860AF10D495F95A425D968DA9C795D33 busqus?
2,421,615,231 *FFE5577CBF77D2C8A965203461FBD22B2BA5FAA0 Bp+E
2,421,615,232 *FFE7DBA8006772BD091F139B798C0EB2B9C26F1B bq"ym
2,421,615,233 *FFE0409B347D5DD3FDA69084AC765911E9DAC71A BRAUNGEBEIZTEN
2,421,615,234 *FFE6E6E819ACAD7CC25F0C19C0B232A991DF22FF c3!d%
2,421,615,235 *FFE16806AB5B739D56152C22757B401CA1C50866 C,3JH
2,421,615,236 *FFEE943A76B5CA5E75FBEACB7CADCD79B1757A27 BRENDANFILONUK
2,421,615,237 *FFEBDC78720A2B80F83AB91B166A8047A6F9B9F4 c_47g
2,421,615,238 *FFE09BC39466AB0AD9A05831A456D9358999008E C$4I
2,421,615,239 *FFEF346A72144E394ADDA1D9B5E8A4DFFF9A5D48 c5h$1
2,421,615,240 *FFED28A3A748443370FEC3E22F65BB3AA90BB04A brian.jarquin
2,421,615,241 *FFEE97438CABD1F25F7DD612DD6381B8DC675E0D c7mq#
2,421,615,242 *FFE245C324FF04B168FCB409E2035A9C0622A758 [email protected]
2,421,615,243 *FFE229479383915C04FEB89E4E10AD5B34D8C65A c9t,u
2,421,615,244 *FFEA58586CA0232E61EF7766AFC462A97C008D4B BRUNESEEKER
2,421,615,245 *FFE8E54DDD094324887F31D172ECA3064B20CAC2 CA2P=
2,421,615,246 *FFEA52193EAD12D98BE38171EAD5C8B59EDC3C6B CADYINGS2
2,421,615,247 *FFE8C381ECD4F6308F1E52EB238A87D3278ADDFC bryczka1
2,421,615,248 *FFE1C2F30D24F10602314AA9C3845923E3105872 BRYON.FADER
2,421,615,249 *FFEBA95AD726E7DE57CAAA52A303E6D7680F6653 [email protected]
2,421,615,250 *FFE25B5916C786ED088A871F9464F6D90518A0C6 calambac
2,421,615,251 *FFE61BEEE669D5CA0081C37A63D5E20DEA3770CE BSUU-
2,421,615,252 *FFE6AFF19137245044C816119DAF16A738254453 BSWKCUFBSW
2,421,615,253 *FFE20561F076CA97EC54ECCBE3E9B9CB2EB8916D bswvnpbsw
2,421,615,254 *FFE19D4C72AA4FB8C99364A10726A90899908474 BTRF7
2,421,615,255 *FFEDF45C35108F6AE534198BE6DB461B7D5DEEA3 BuFB
2,421,615,256 *FFE3FEE7CC111B9C06B7ED0AD0848921DFD8A83F BULEUTAS
2,421,615,257 *FFEB142397EAD9AE6DC4C56B378523DEBE3E1F86 CAPTIVATOR5
2,421,615,258 *FFE40B5DE76F28C744F4EA5F8C0E38799B355A0A careyschepp
2,421,615,259 *FFE5EBE9F9830F4448BE8B6E1C0882DB6A61C5E1 BUSINESS4_ALL
2,421,615,260 *FFED4D4E2C272458F11972F43A49AF220B7BDEC5 [email protected]
2,421,615,261 *FFEC221F00D3859303B1B0C540AB6F6CF2ECBE80 BVMXB
2,421,615,262 *FFEA6E11350D3B64EE6A5BDAE918CF53050B2F29 bwi9a
2,421,615,263 *FFECE5989087A702164323ABEC8FC7A161FF0B8B B;WV
2,421,615,264 *FFE3F986457250B8DA89DBBFEA1CD8859BC9A99A CC5;+
2,421,615,265 *FFEFC812990698546FAB1C4B46252BC203A161BB ceeia
2,421,615,266 *FFEEC6044110863C264573FF24DA993FA637BF98 CA?GZ
2,421,615,267 *FFEED0B2CAA8F056518419E585ED8CBE68C62B86 [email protected]
2,421,615,268 *FFEDF0BA5248543670EF1988357F8CD683C9C4CE [email protected]
2,421,615,269 *FFE8E2ECBCAA83C772FF1BC537532E273CE93FB3 car0d
2,421,615,270 *FFE4E240E2F9FA8F639E1137D0ACA8C2AD856320 CHARLES.GONEY
2,421,615,271 *FFEA8D2A6D16E122DF252D552839ACD0774DFF56 CHARLES.OMTIVEROS
2,421,615,272 *FFE4531B3D4817F7922F77486BDBE1491FDD6B91 CARMEN-TRIPODI
2,421,615,273 *FFEE099849A13ACEA5A0F378DDC67D9A7E7AB8C1 CAROL.RUSSOM
2,421,615,274 *FFEE46F107750D236E45864893FBA9B4631D43FB CASARONA4
2,421,615,275 *FFE68968BCBEE8CD0D2F8761FC93BA5CA267A96F caseytejedor
2,421,615,276 *FFED7E562A9F10B46EB369E97D32B83619A40736 CATCH.BULL.AT.FOUR
2,421,615,277 *FFEF37AF251FAFB40DCA493DB25723CA706F9AE8 CHAUNCEY.CHRISCO
2,421,615,278 *FFE64BA1794DCCDD7D087396253268926488B20F c%haw
2,421,615,279 *FFE56750A41DB27D3E69B4A6F08731DD563EB912 C;HHA
2,421,615,280 *FFE3A9F3DCEF12D6B9171C027CDA299CCFFF0D82 chinese-percussion-no.-2
2,421,615,281 *FFE96CC0700FD198453D508374B823CC8B0AD231 c=ddr
2,421,615,282 *FFEB037460D0CB232151F5034DF7A984D9C4E748 CDZKO
2,421,615,283 *FFEF98F73C687EA4D7B9D2D65CA0AB0FC235143C CHRISGIERSCH
2,421,615,284 *FFEA1282E695E9515C1F086C437C12A64DE0F8E0 [email protected]
2,421,615,285 *FFEDBBB71B852CD866F3D91C91A01A2EEFB9E3E4 CHRISTIANLABAR
2,421,615,286 *FFE57B3EC3F324E45846868459CBCE78E2E155DD cegdt
2,421,615,287 *FFE7FC647E647E54F8C4F5882E095322F31460DA CetU
2,421,615,288 *FFE41186059C0599CEDDF4A2AD3B1859CF9519B5 ckk,?
2,421,615,289 *FFE4D84AF9528F7F3413F88DB937DB4C4D8512B9 CKLL
2,421,615,290 *FFE09C42297624081C0FF5AD036F5B94F5F68486 CLAIRPAWELL
2,421,615,291 *FFEA67DC76992E78D8FAF19F882BC7610482C244 CHASE.KABIR
2,421,615,292 *FFE54AC96DE2923DC2F716E716ADCF14683EC9D9 CLAUDAKIYAMA
2,421,615,293 *FFE6509276163BEF4CEEAB7AA49C92F9D161EBB8 [email protected]
2,421,615,294 *FFEEC757A839ED882FBCE54F7D83E2E60EFC2DA7 cleogonzales
2,421,615,295 *FFE856E7FE9F7E722BAFA4A3B9D3DDA78A4E38C2 childrenofthenite
2,421,615,296 *FFEA2FCE6F29907D50400CE08EDEF2CBCD004408 CHINMAYKHALADKAR
2,421,615,297 *FFE4CC7480A1114691AEC6F0C3775B2A943C63FD CHJTF
2,421,615,298 *FFEC8471D6C763E8281A7FF5AD3F3288E0A89EB4 [email protected]
2,421,615,299 *FFE56EE05A5CDEA8257489EB11FE70900EACFA4A christmas.in.kyoto
2,421,615,300 *FFEA26BE145271C28DD90784D5ADE5969A9C6A9E CHUXN
2,421,615,301 *FFE1427FF4F98D39759E2F7797BBF463B2DCD4B2 COLBY BRADEN
2,421,615,302 *FFEEF339E4DB312B3BE90ABF263C102F744903B4 citerefmarsh1980
2,421,615,303 *FFE0B3E98218F03A934C4701ADE26F0D6A3DD594 Citizen'sArrest
2,421,615,304 *FFE26E35F9BB5FA028FCB718572C59D340E1519E cj7p#
2,421,615,305 *FFED8A2DA7F49A39919E28DB1152D3134C43E15C COMMUNISM1
2,421,615,306 *FFE97FD0614A2F2E555072FDB631DB2DE2E993AD CLAUDIOROESCH
2,421,615,307 *FFE39B91233C6F8727F5900F5E806BF4A628B8C1 CONVICTOREN
2,421,615,308 *FFEB8261F6905E3A19D43475E93E9B2E985FF50C copeia5
2,421,615,309 *FFE43A21E7B49FB9CF651C491E148C0E4E56DD8C cloo
2,421,615,310 *FFEF88D4768E5C6C2E27F014E45EE439D36F240E cma?9
2,421,615,311 *FFE1F4F2CA689BB1687357BD700173F6AAD5D585 CMWJQ
2,421,615,312 *FFEC72BF1033385AC9B152C233106EDCB7D9C588 [email protected]@DS
2,421,615,313 *FFEB480187ECD69107C6E9013C7CA3BEDDD5FCDD crcc:
2,421,615,314 *FFEE6C5330BDBC2E1098DDD285391E654EF5AD1E C+OJ"
2,421,615,315 *FFEFE1F30389340F8ACC53338968D59CBA4F40EC colemanyanik
2,421,615,316 *FFE3EAC87DC5488D57311B5B782032BD2CEE20DD cristine
2,421,615,317 *FFEB02A84961C68E00D26C162D7D797732EF87DC comperecomauwww
2,421,615,318 *FFEAA4F635DDD2F1EC05C7C363B992E911C3E470 CR#V$
2,421,615,319 *FFE20854B0BC924D0F67292985C9257F4DF36A97 conniedugmore
2,421,615,320 *FFEE62047502465DE96560751412D5B90748D497 c(t-!
2,421,615,321 *FFE79441C6FC90DC9E001653C7D0B7653BE1F224 CORDELL.SAMUDIO
2,421,615,322 *FFEBA62A3D831AEB6CB69D41768EB4E042B26F9A CORILLAS7
2,421,615,323 *FFE80D544D68E9581427F99B338D058FEF88D02B CORNELL.STRATZ
2,421,615,324 *FFEF30D3D925F563105FC95EA9679C88A94DAAFC CUDOE
2,421,615,325 *FFE914E84C32FE6B66BC7FD92FD15748E30F4FAF counsular
2,421,615,326 *FFE2311A30030C5509DCB9545610D05CBABB75AD CP:"H
2,421,615,327 *FFEAD3CAAF2ABF0C0AE2D460AB6DEF2EF48A4B34 c:\program-files\microsoft-visual-studio-90\common7\ide\privateassemblies\microsoftvisualstudiosmartdevicetestprojectdll
2,421,615,328 *FFE570E125FA62B9E66488F3728F87607FCFD1DF c:\windows\system32\tapidll
2,421,615,329 *FFE221B78770B9D65205DA82B9911F61BEE801BD Cr/
2,421,615,330 *FFE0E9DEF0D66B23E387E6F36C9B2F1114EA225F [email protected]
2,421,615,331 *FFE7203A270287096AC32EB5144029A93688C6B1 cristine
2,421,615,332 *FFE6E21BAFF8BAA7E71EDF2B4E963C766DEC2F9E C)#SC
2,421,615,333 *FFE6C7AE8667637871B19C30459486A2C9156BAB d_/3h
2,421,615,334 *FFE48C2A464F7729CE10329B708A70D97386EE02 D3POE
2,421,615,335 *FFE9E043BDD78A204D59D303A9ADEBCC97967F2B [email protected]
2,421,615,336 *FFE3BB314261EAB2C57D93CBAFBCB367E7B6A7A8 cu+ns
2,421,615,337 *FFEEB0BA15F87202EEEC9533F391EA8550B1C2EC daishi-hisakawa
2,421,615,338 *FFEF36951DE2F574ACE1EF66990ED31D7824CD4C dale.norby
2,421,615,339 *FFEC6CFCEA58497A805139162CD0BB0250D980C1 CYANOCOMPSA-PARELLINA
2,421,615,340 *FFE54CD994AA06345F6A330678F48E894FF17F64 DANIEL-PEPERA
2,421,615,341 *FFE5F4428EA021197FDFF6910505007A0D096E2A [email protected]
2,421,615,342 *FFE04325321135AF2B6B6E27DC5EF646A6873A22 danny.ben.moshe
2,421,615,343 *FFE23217A51DE4E1DAF171D5D0293AC90824FFA2 czs1
2,421,615,344 *FFE06737A27ABDB81DE0DDF02B90171A91CC8D0A D*^"
2,421,615,345 *FFE930B17E20FA71688ED9ACB40E22A3B17327DB DARONSTROBL
2,421,615,346 *FFE01EC88FFCC482DB311D09896657728318510B DARRYLCOLDEN
2,421,615,347 *FFE63372326455059ADD36503EDB0279424C7585 D351MP3D1RN053M05
2,421,615,348 *FFE8E3811DE2075033E89309E225963B2005EB15 D#)4D
2,421,615,349 *FFE2B181AA533DEFCF6B10713836724CCAF85E3A d5.7r
2,421,615,350 *FFEBC129E126F0D98D1833EF7D035CAB2980A7D7 d5pen547on5
2,421,615,351 *FFE5D1E2DCC19FFEAE2BEA27FE998F6B539B0EEE D_6U,
2,421,615,352 *FFE0A17D707C76DF2D84D41645F2DC5473DE23B4 DBRUISE
2,421,615,353 *FFE476D2E24F4D3AFB884DE57FB1341F0E0832D5 D8D)
2,421,615,354 *FFE15EFC0309A436B1BBB4713ADDE9D639A1F324 DCM1J
2,421,615,355 *FFE1F99E4985159731AD25ED68BA63EE559C504E dd25a2f80fa84b6aa736067051acd18a
2,421,615,356 *FFEB6F9550AEF27B677B3796106C86EC89994407 ddgj
2,421,615,357 *FFE2B4B1E52837236CD43F750CD2C00796B45745 DEBABRATA-DAS
2,421,615,358 *FFE227901B49076DADFE121934506600415E33AD delmarhackbart
2,421,615,359 *FFE12D0DF94190691ABC218847CF8EDF19EB6670 delmarhoerner
2,421,615,360 *FFE9A19F5E0E6009138C2DDF907B3394ACC715D1 DELWILKIE
2,421,615,361 *FFE98C9C6CB83241B102963AFB7B950924D6914A demarrants
2,421,615,362 *FFEFA87D16B2D0C36A09C18D59BFC67D2CEE276D DENOTENKRAKEROP.71:ACT2NO.12E:DANSVANDERIETENFLUITJES
2,421,615,363 *FFE045000F39D8B5374BBCE391923C7E2265CA33 depolarizes2
2,421,615,364 *FFEEAD566D309003E9975A70973A4BCB7EFF4411 dbk+m
2,421,615,365 *FFE8AA6ADDE92ACAC68EA47822F2E969109B35E1 [email protected]
2,421,615,366 *FFEC7F62081C8BFEA6EEB9F7961A868C4EFF1DA3 DC%GS
2,421,615,367 *FFEA7EBF6C432CF7593E8BEFBBC87C34DBCACACF dcucc
2,421,615,368 *FFE6529DE2EBB52BE870486DD1EE851F91508433 [email protected]
2,421,615,369 *FFE574372298C32993B7D01D63713CFDF169559E dde=(
2,421,615,370 *FFEF0E5CE369B4C4943FF03E318DB241F3879460 DECAPODIFO
2,421,615,371 *FFEDC5CA0EDA3C1913F4F9E69C23959A271C1A07 dgr
2,421,615,372 *FFEDA1ABCB8D8B83DCE316B6737D3BF2A26FFB22 dhvel
2,421,615,373 *FFE120F342CEECEE87E487085B520CDD969E4929 DIEGO.INGRAHAM
2,421,615,374 *FFE8287AFF7F183369E24465E58652898F70B219 DIE GROBSCHNITT STORY 2
2,421,615,375 *FFE650FD55C7DE3F86D8295251BBB4B0A3BCEFCF DILIUPGABADAMUDALIGE.COMWWW
2,421,615,376 *FFEE5368FA22D6AE8A66FEC4418E7EB27497C02A [email protected]
2,421,615,377 *FFE0E051CDBCFFC9C3B83BF02CF4AD50DCF8D961 dimm
2,421,615,378 *FFE483192436ECC7B547B97E246513AE7C27ADEF [email protected]
2,421,615,379 *FFEFC72BCAB6CC88E615032025C1D54D46EA7210 Dipp3rin
2,421,615,380 *FFE86CC9437EE91B190081B99F16FC0B4AFB3AE9 DIRECTORSTEFAN
2,421,615,381 *FFE1C43EDC5A877539339CEDCB0AEB0A4150ACBA DiscoDude
2,421,615,382 *FFE60E27F852EE4FF1708F3F2D41F08383139A02 DETECTORERROR
2,421,615,383 *FFEA1B6A7AA1C4363E2E54C9F6109DE9934A5F9C DETIAGNU0
2,421,615,384 *FFE29E2AD57FA794E8522FB961239427A9EBD5EF [email protected]
2,421,615,385 *FFE8D02FF80D0D2660EE90BF6181AE32B1329F68 DJMW
2,421,615,386 *FFEC447DF89B8748B236C3510C8FA010DCC37A61 DGQWD
2,421,615,387 *FFEE38B2F6A8206398A1DB87DA4D46DF3F56489C DME!R
2,421,615,388 *FFEAEE2B9467EA6CED895B63CE7737FCCD0B0F8D domingopolak
2,421,615,389 *FFE4B1F1C755A00ECCECD36745C1B0569A062EE1 DONAHOEH
2,421,615,390 *FFED5FBC2D409AAFBE9ADB5FD0C03EDA58082EB3 donnasneed
2,421,615,391 *FFE88750F26620B4C13914D5A3814A3E48FBFB6A D(IZY
2,421,615,392 *FFE9B1B81060FF30776DDCE1F50F95FEC5A26595 donteruark
2,421,615,393 *FFEDCC05D6895A74402F4245E4D46D6EA839B9C2 dj#iq
2,421,615,394 *FFE99FBCC79A7BF66963942C283EC1E511DAF2A8 DLVN5
2,421,615,395 *FFEC08B0CA7827574187B03A5D11710BD8145A53 dnb(4
2,421,615,396 *FFE479B7E39686AB51C42B86039892DB20FB6BE7 [email protected]
2,421,615,397 *FFECB61892018C65465D73FA436AD85F8ABCC7AE DO?AW
2,421,615,398 *FFE06012B61BE99C925B33439D72E986002A220C driekantig9
2,421,615,399 *FFED0904727AC0164A717D4B41738939725515DF DsS/
2,421,615,400 *FFE9A18367EDD767444207EF17374A83B46C146D DONOVAN.ANDREATTA
2,421,615,401 *FFE4ADFE683EE0F07B764A59620042D0A72499C0 DONOVANPROWELL
2,421,615,402 *FFEA1BC553D9684178A4FADE4937549E29956BDD DOOP:
2,421,615,403 *FFE7824900AFDDC48EC7BB971C8E9B85E48B9298 dtth
2,421,615,404 *FFEE2A4965AC77C5A2883E88B7D4D0BB5EC5B891 dub-incorporation-11
2,421,615,405 *FFEC3F2869DD2BB32E50A48C37A3DA897929F2F9 duragon
2,421,615,406 *FFE05C0EBE376E324D0D4733D23BE1C37E2CD753 DVNAV
2,421,615,407 *FFEFE3541A3AD46A0257B1A2BEBB24FE5712A2B9 dwayneoconnor
2,421,615,408 *FFE6ACDEB14E9B58A80E9950A6C9888061ECFCAB DRAWING-II
2,421,615,409 *FFEA51A260588AE421A142A34869CD91ACFBA935 dzkk
2,421,615,410 *FFE70962E0B0B335260E1F60FE27F379B0C5B12A E4
2,421,615,411 *FFE3B86283294501A4F9F08C6FA3D548BE08D2BE dtth
2,421,615,412 *FFE49691A8C28A1BD445CFA24C6F64F8C6991BE2 d;udp
2,421,615,413 *FFE96A208A7CD1ADCE7B4056879685B3446E00D1 ECOCIRAV
2,421,615,414 *FFE93D932C41EF46C09AFF7A314D3A50D7EAAC08 ed!6w
2,421,615,415 *FFE2D687714BED2DF6A962CCE1D4E8AC8A734350 [email protected]
2,421,615,416 *FFEB42D761DBB5B798B3CAA51EB2D64E5260D3BA D!V^
2,421,615,417 *FFE86B4AD6DC8862ED29EB744E2686B7781724A6 edisonlury
2,421,615,418 *FFE91ABC25EEFAE708A0D717A1534E1F5EC74DDF edisontyndal
2,421,615,419 *FFE8D1E47ADCBFBAB22A435AC267305A59D5DD16 DWADI
2,421,615,420 *FFE70AED49F0ABE1C1A3FA61E48E37981A079455 EDUARDO.LEUCHS
2,421,615,421 *FFEDF1DD5033ED19F19E0EAA347FB9CEB5171CD0 edu"g
2,421,615,422 *FFEE73F9BC89BB754A8A8E924F0CFE2AC1EC3122 dwbld
2,421,615,423 *FFE3B91BFED5124DFE439C95A6916462322ACD35 eeklovlag
2,421,615,424 *FFEDDDDEB08080E829E522B594CB2647700EBDAF efe1
2,421,615,425 *FFE06A58DA831F10BF45C4D77F1B6C5E320E2F67 D=Y.F
2,421,615,426 *FFE2B14C60A8A38B810072F03068E080786F2ADB dz_=w
2,421,615,427 *FFE42A81C84F2C9FCBED861B40B0C266EEC013DC EINEFRAU,DIEWEISS,WASSIEWILL:ICHBINEINEFRAU,DIEWEISS,WASSIEWILL
2,421,615,428 *FFE07F04539FB292EB3B412C065D0789F1129DD2 einstein on the bitch
2,421,615,429 *FFE3DD1702D60C0646476CD4BAB946687B6445DF ELDANIBO
2,421,615,430 *FFEF02BA7B231A0A38C3B5F963941A3204562ED7 ELDENDEBES
2,421,615,431 *FFE5AD0BD73DA82F0535BA701503978FD94AFD33 ELdP
2,421,615,432 *FFECE0AB27ECFCFB7C1BAD222611950DFAFA26F3 edce5ccb740e3858833817021b1047c9
2,421,615,433 *FFECB6167109D72078CFCF41AF2945DF4308EB52 ED'DUVILL
2,421,615,434 *FFE22BDFA538D991279DF1CFFACF93CDFB6EEEC4 EDISONNEUNDORFER
2,421,615,435 *FFEC1F056C91598FCCE82EF3254F93A5865A3D46 edmondmatsubara
2,421,615,436 *FFED71DB2474D59535CE235C0D3DE0F4A91DBBAB EDMUNDNATEWA
2,421,615,437 *FFE8F3042CFEA4D183BF2F5661CBC70156A231C6 ee2(
2,421,615,438 *FFE569015854C5AC4713434DD4609182B1C3F14D ELWOOD.IGUINA
2,421,615,439 *FFE6DEA00C64AD6404442B0E21D69A9522B6E38A ef?(j
2,421,615,440 *FFEB653257CFB87B3B2F480FE2BFE1187EAF6300 efrenbilello
2,421,615,441 *FFE64FBF1C2ADB6D0FF466AE983B0358151A6604 emidiulf2
2,421,615,442 *FFE1CE52269CCD10C72EDAF38A5236F32BE4F806 EMIL.PIEFFER
2,421,615,443 *FFE72D1A40DD7A72BB6F1A53588FF897DC797778 emiratir5
2,421,615,444 *FFE575749BFFE0CA62BFA6C79AA8D7C435630C52 EMMETT.RAUL
2,421,615,445 *FFE6DD1A392F6E9383C1DC6A70E89F873C7AD850 EIGENWAAN8
2,421,615,446 *FFE27DC1616D0A6BE71492868F33B5532FFED87C emx5f
2,421,615,447 *FFE27AC7F65E8085E9C25EEF2DDFE0F141EECE41 EN2108424203
2,421,615,448 *FFE13CD9E12028BA27E2B6D702139D50E624464F eklfs
2,421,615,449 *FFEF18773AB1759DAE36D033DE7D8B88153A536D elbardelachicaconhambre
2,421,615,450 *FFE645A404A87CDE90099B12C5DD2732F7C061F8 [email protected]
2,421,615,451 *FFE328BA79D9A22EC982BBA6FB77DBD7CC187573 elijah-samad
2,421,615,452 *FFED9C5AF097978944A05E49C7430B5CD0310FA3 ELIJAHWEDGEWOOD
2,421,615,453 *FFE4BA9F0E576E2E36CA5107716728D9ECE5535E eor63
2,421,615,454 *FFEF74B87A71C763365310BAF13B7CF3A0097B8B ELLIOTTOGIBA
2,421,615,455 *FFEEF827691080190FD9F211015D6017895ABC18 ELLSWORTHANASTASI
2,421,615,456 *FFEC3DE6A9CDFE2AD3F32C4CCE95B37F4CF98879 EL ROCK DE UNA NOCHE DE VERANO
2,421,615,457 *FFE5D14F669BD3904974A92BA70535647F8BB973 ELROYHELLMAN
2,421,615,458 *FFEC9EC49677F57068F30DB58DAFC7C9FCDA1301 [email protected]
2,421,615,459 *FFE0C2B31D7C670CD49C1FFECDC54E09BD6848D6 eric.hibbler
2,421,615,460 *FFE6DA3469EC8516D4C4E2AAA6DC8AAF3D588C5A emily.villarin
2,421,615,461 *FFE9F672FE2C2DEC80BE777EBBF060B2F32FB1C3 ERYS1PEL4TO1D
2,421,615,462 *FFED66E846F7DC8EF33A69D2CB4770E4E76D9A91 estocade0
2,421,615,463 *FFE8ED884E4AD829CE8F11578633580E463F7339 eo=p
2,421,615,464 *FFE8E7619BF749EDFCDCC96473F647AE3773CDA0 eu.vou.seguir
2,421,615,465 *FFE96F3CCE687274998B974247ACAEA194DB8979 ev9`
2,421,615,466 *FFEA7A940ADC318E9256C4FC49B821E30BB605C7 ERGALFEDING
2,421,615,467 *FFEDBDE86DD20D3C918A63E68E695778D5D90218 ERICH.PROTHERO
2,421,615,468 *FFE6A0E51615454A2134271280F41A3EE9039F35 ERIKBARTOLO
2,421,615,469 *FFE3A024BEEEC59373466688EA8CB918FC6E3E9A ERKONING4
2,421,615,470 *FFE5A6CF06712C0AD2AFC45CB4E3609DC99D2516 F1YV3F
2,421,615,471 *FFECBFB6DD314E011D6C1C08E6C4785AFA8B9617 esc33
2,421,615,472 *FFE899403309DAF661CBE7F6D55F2F54871B9729 [email protected]
2,421,615,473 *FFECAA745EF0FA11F825EABF0AEAE5CB1B60BDA0 FANTASIEIMPROMPTU, OP 66
2,421,615,474 *FFEA3042058A0844874A1557A29C46251920D6C3 eteibegz3
2,421,615,475 *FFEFC0C20165CA96F9845D33DEECF3F69A7D9EEA ethanmizzi
2,421,615,476 *FFE27E084959B08577CF9517AC5A313EE8D6CE1F FAUTQUEJ'TEDISE
2,421,615,477 *FFE68C7D4FB2FC2C6522B991C447D7663498E8F4 ETIUDAAS-DURNOUVELLES:ALLEGRETTO
2,421,615,478 *FFE98094103153AC44D388D880AAAFD66FDE35BA etmo
2,421,615,479 *FFED33BE22DD80FFA602D16EE59DEAE60A494C51 ETRNW
2,421,615,480 *FFE7568F5270355FAAD27A3BC7D67342C7F0EDC8 e_ux
2,421,615,481 *FFE58304A1D47D57F69068E9273443AD51385582 eve-abuan
2,421,615,482 *FFE6BDB3268B0A59D01253246F444507FFE5975E everettesciotti
2,421,615,483 *FFE9CF9B264ADDA213E888225F36EA13A63FE1D6 fesfgyep
2,421,615,484 *FFE2426161924616C97B0AA3D7284A4DB5EC7EA9 f%:i
2,421,615,485 *FFEAD0DEB49ED6D1887B0897090962E62A1E5E26 FIDELIO OVERTURE IN E MAJOR, OP.72C
2,421,615,486 *FFEA9F45E03CC4D98CE5496402EE873E92CDB90E EXPERIENCESHOSPITALITYCLUBORG
2,421,615,487 *FFE13AAD7018D1508A2D4F50BA9C66BA74523892 EY-q
2,421,615,488 *FFEBFD44F2510225E929B8177650222266CFC883 FLIPSIMBA1
2,421,615,489 *FFEA9A9F83411A4BC200FC56950EB7DCCE0D0AF1 florentinonugen
2,421,615,490 *FFE15FFC085EA8FF69EB5669DA0FC6CFC82A8439 fmに愛を込めて(
2,421,615,491 *FFEBF1DDEC8CB04B2C04D63439D5C28585EC038C FANTASZES
2,421,615,492 *FFEE78BD1BF6E25F56ED473273A4F1F728E619FB fort[email protected]
2,421,615,493 *FFE63D82AA015A4D97F446EACD65471418ED61C4 fos+erln9
2,421,615,494 *FFE1905B439A1219CD573B2D0B6C585C6A64A355 ***-FAXED-ORDERS-***-AVAILABLE-24-HOURS.-785-539-3743
2,421,615,495 *FFEE0BE30232482C26C2D3CBBFE503D561F3913F [email protected]
2,421,615,496 *FFECC7C394E9941DCA595B83491BF7088495C684 [email protected]
2,421,615,497 *FFE2E641FA460856C4DCA0CC62DC7C6EA7F03F49 FRANCESCONOLY
2,421,615,498 *FFE621C4BD2043EA667CCC18EF5A115927519A19 frank429
2,421,615,499 *FFE5ED8B8ED7056CBDB5D53C43A773CE36EF5B78 FELECIAJ1
2,421,615,500 *FFED99663CC0A4105E40C17A65F9D27414BB8DC2 FELTONBOSS
2,421,615,501 *FFE768E6F8DD4859D2A4F81757E9D3503272843D FREDRIC.CASADY
2,421,615,502 *FFE4A00A55A5C18AF2569771C34D085BF7B93E74 FIAMARC
2,421,615,503 *FFE8D8BA0DD344EE4112B69615E859FFB0ED6F33 FILIBERTOAVANT
2,421,615,504 *FFE257CAC302852A818F7F0ED2917265A3F4D13B fillesdesjardins
2,421,615,505 *FFE0715F815095278A9273D879185E431AF1BDAD furunculoided
2,421,615,506 *FFE02EEDF155902A88989ABA26BDBB69FDBF6865 FYZISKEMU
2,421,615,507 *FFE390EAE457E1341E8DFF2F889CD7F33D48062B g0d'
2,421,615,508 *FFEE9A7E55EB6889618E0D9A48C336770A930FA6 FLORICOMOUS
2,421,615,509 *FFEC9F2882D9599E90DEA785D98417396280B6B8 GALENGUARINI
2,421,615,510 *FFEB1215CED93DB17761100B79F0F2C386E341FC GALEN.SOTOLONGO
2,421,615,511 *FFE44EF2FDE1C35AADA00B50C8F5CEAD8ECBF57F gameboy/homeboy(8bit'squ
2,421,615,512 *FFE3FF49C80C7B1F26B068CDDA66C7110FBB71B4 FNNSMNSTR0
2,421,615,513 *FFE3FF7BF57DE32CF30D1B3FF876EFE0585C5BAC [email protected]
2,421,615,514 *FFE2FC110F5B47A52E1D52BCDF5C2006E7F79B95 GAYLEVOORHEES
2,421,615,515 *FFE4B27211A7E6E76A9D9C8DBE2AEC7973724606 FR3BRIUSTOUM6V
2,421,615,516 *FFED5E3F2F11DC821FD7D4196E0AE7F1EA1E90C7 Fragile.Queen
2,421,615,517 *FFE1EBD1ED2336519F004A77844EF083CB578CE8 gelatinizability!
2,421,615,518 *FFE122A7E6F7C28A87B807F7CC10106F8A18959E [email protected]
2,421,615,519 *FFEC8A54477E80022734408315C8F01EC1FD40CC frankcarilloandanniegolden
2,421,615,520 *FFE4B4EBA85514CE38198C31BF454A1E4B1CD22C GEORGEPIERIDES
2,421,615,521 *FFE36EF6F1E5CCD9A3A02E92E6601D9B6D18479C frederickellenburg
2,421,615,522 *FFE26BD763F5F492D42338C19410259BA02C177F FREE2GAME
2,421,615,523 *FFE81080F3951078A67EDE672685F478AD691F7D GEROSHIKENNAI
2,421,615,524 *FFE1EA9A9259F772EF51C419FE37DBA7C8F17ABE fritzstrother
2,421,615,525 *FFE68CF8EB6C001D99240E2777FC53C57E3D5638 [email protected]
2,421,615,526 *FFEFCFA3C7FBB181EA9B0DF0CFB29CAAA995E95E ghrr
2,421,615,527 *FFEB0781714DD3A3A867284A23C7C891780F8F05 GINSTERSTR
2,421,615,528 *FFE501A52F8911F18DC5AB6D5E037901927E0AD9 FUZZ-ORIENTAL-BLUES
2,421,615,529 *FFE8DF47B07EF8C9F7F165460095981ABED58748 fWn
2,421,615,530 *FFE384E7138C430B5216FEC038314593E205A087 [email protected]
2,421,615,531 *FFE7B88E5A78423D92F6B7A0CE323FB1F04930D6 >gnorts/<yrammuS--6>gnorts<>"83L"=eman-a< >p<
2,421,615,532 *FFE0914F767AFFDA44F2ED8ECD1B44D2349A1B7A GANGBIAO
2,421,615,533 *FFEFC6EC501C163F4065BDF5F84EE2E0BE37B6B1 [email protected]
2,421,615,534 *FFE329DC58541BAB3025705EB3B71278BD393A90 [email protected]
2,421,615,535 *FFE42226BFEB384C8CAD4FF28A0F05A2F1BF195D GARRETT.BACICH
2,421,615,536 *FFEAA36A184FFE0B3BD38D335DCDB0D839E9305A GARRY.CHAMPION
2,421,615,537 *FFEB0537EFE1D57DA348663F6CC6F47CB0AFAC4E GATTUNGSZUORDNUNGEN
2,421,615,538 *FFE03C38901FB32BF62F7ADCF96FED99F61F212D GAVINCHEON
2,421,615,539 *FFE210614E73FF6FE691F9E2BC361D649475A2BA governesshooding
2,421,615,540 *FFE53CA2042BDF077DEA25B066DCAA114FE9DC33 GEBILIF
2,421,615,541 *FFE1FF3D866A937BD0A54D42F5B794BCDDB00417 GRAYCEE.MAE
2,421,615,542 *FFE45957871C7869A8F1CC3DBC3253AC6B9FCC5B GREGORYHONG
2,421,615,543 *FFE2D044E6519BB65D1C3C14BD8945EED51CBA5E grüntals
2,421,615,544 *FFE8C99BD263C7B6273D342081AD5FF44A777FE6 GETURNS2
2,421,615,545 *FFED292BBF433A4648D7A0565A2ED2EE376416C0 GUENZOU37
2,421,615,546 *FFEE6B84D1DE0D6E9984A75113CFEFF1E817D9D7 gheber
2,421,615,547 *FFEBDAFF88ADB8978E464AEB1A3622C42AC329E3 Gj[
2,421,615,548 *FFE86A3C7B2512973EB82CBCF07EF6B6D4E31881 GJELDSOPPGJERET
2,421,615,549 *FFEE45E915BBCDD3D76D47D628EA2FC3C17C5445 GLENNNICOLES
2,421,615,550 *FFE5B877D355BA2E380EEB947F9B2748EBD391FE g?$n
2,421,615,551 *FFEF6F6805CABEEB83DC678CEE9B7D16276716CB HAMPSONHAMPSON
2,421,615,552 *FFED741213FCB76E473DA2C92D30EDA5492ED5C5 goin' home (feat ivan neville's dumpstaphunk)
2,421,615,553 *FFE4DB9BE52DFAA0E4061F11E0F67778061728E9 GONE WITH WHAT DRAFT (BROADCAST)
2,421,615,554 *FFE5C9F58A25E6277970403CD681FED92A0F8F10 harawata
2,421,615,555 *FFE58A4C4DCCDDC55C23A7BF0AF3804AE3ABDD52 GRANDMA.WILLIE'S.YARD
2,421,615,556 *FFE646A6639308C4ECF8F45E071084BE371932EA GREGOGAN
2,421,615,557 *FFEDE7EE8EBB453AF87D43DFBFF56EBE1E1AD7D8 HEAVENNO.7BIGBEAT
2,421,615,558 *FFE6C69268F44DB56D6DC1F881DA879FDCBA3A54 helenduv
2,421,615,559 *FFE5C9047CD33F460376E59FAE0EFCFC127CC9AB HENRY.CAMMARANO
2,421,615,560 *FFEB6D26AD8AF200D411B2B5EE911E98A25D9EEF gtumbled10
2,421,615,561 *FFE2F1FA8C581A66F08C44F7227D3A976D1FBE46 guillaumerumiel
2,421,615,562 *FFE45B1C894E0F3520D6999E935E1B390AE0543F guillermolotti
2,421,615,563 *FFEF93214C1E5246DD506A767CBAEB6BF219B7ED heurtaients
2,421,615,564 *FFE03BCCFCA2FC72782837B7C02F51C5AC866847 gyrecciking
2,421,615,565 *FFED8A146EE41EB6C08ABE905D49A15C44259281 [email protected]
2,421,615,566 *FFEF52ACE09860DD2C900F71AD08525521CA5A43 HISTERYCZNA
2,421,615,567 *FFEA93714DBBB474B211BF180D25175EF74BA929 HAGEOCHI8
2,421,615,568 *FFE1F7BE72811FEC1DAC55863D6D0B1E7BED213C [email protected]
2,421,615,569 *FFE597FD4CC57CF3DFED21BED56A58966F42359E [email protected]
2,421,615,570 *FFEE4CE0B8619993683C7BEF0292D15954E1F81C holidaylightshow
2,421,615,571 *FFE651485CD70247B5BA831DCC7F67EA50C3341B HONGDICAMPLI
2,421,615,572 *FFE274D383EE94CBA933964EB8DBD13263C0C1DB hansfabian
2,421,615,573 *FFEE2377ADA3B3E6A1DCD46EAA59B64966F2820E HARMONICASMITH
2,421,615,574 *FFE82139C7B2895C0C1C996AA13A73E1749C7734 harrisonruy
2,421,615,575 *FFEB33252E834B704124D1853049B6EC84FE885E harrypresnal
2,421,615,576 *FFEBC86CF32CC220A83287702D2F09D30D50D3DB howardanning
2,421,615,577 *FFE5B7E7184A2D12164A529499C3315A808C20E7 HAZEL-RAMOSO
2,421,615,578 *FFECF42E3BB38B3CED40BCA3A15476EDD910D570 HCLIPBSW2
2,421,615,579 *FFE8FA6CF768A91AC8826864FBED840B4EBDEE52 hcurbkci6
2,421,615,580 *FFE87169A6D0EBF1FBADF216CD14E803947CBAE0 httplotus-showerisu
2,421,615,581 *FFE17C571D7C5D1000474349F9BE7D094FD991A4 [email protected]
2,421,615,582 *FFEDDC67FC1504E098E885FA1BDE744447EEAA48 HEIDIPANTERA
2,421,615,583 *FFE3433457B0B18B64C554022344A8DFCD6E7C1E huligaanit
2,421,615,584 *FFE5C7F70ECCDCF8D3CAA017E0CDF61B353B030F humpnight
2,421,615,585 *FFE2A9F68E2A4F40127315538E766DB50B6774B5 h-ut
2,421,615,586 *FFEF48D5C9C0A39C0CED5C94C5E38A64A0755550 HEY CARAMBA
2,421,615,587 *FFE6FD7EB9B2BBDDF83761BE9A4BF6CA5BC22BE2 hinzuset4
2,421,615,588 *FFE5988E7F6E79477229511FDFAB3AA013A6EDAC idltsafh2
2,421,615,589 *FFE2785C57F623CA40A4226E9D2F6D4B4A81B505 hobertmcnespey
2,421,615,590 *FFEE6AE3FEDE68D88CC9DBA70365F571B71B7013 hobertpanfilov
2,421,615,591 *FFEFF16ADCBF06286E2A74A07EF41DDB6E8F9525 ieresuccaed
2,421,615,592 *FFE346BB011BE8ED671511AF0EBD55D08000FA48 IJX$
2,421,615,593 *FFE6E6A6FC1C2E91A3FB7CF62834D4DD5A3190FB ILGRENET
2,421,615,594 *FFEF4F9491F71ADE395BD28EEAB88795EEB0F519 ILS-ME-REDONN
2,421,615,595 *FFE24257924BA87F1662CCF4D1215B758603F23E i.lust.u.(heartbreak.instrumental)
2,421,615,596 *FFE524FB14D0441751FD406588C38585D4FC9D98 iluvcarmen1993
2,421,615,597 *FFE3352FABAB8907A53484EA9D8A66456C0C7001 ILUVGOCOUGS00
2,421,615,598 *FFE08A362DA3509776D9546D65C80C554F706205 iluvpolice15
2,421,615,599 *FFE91682E69744C045C8B1A45996FA8A0F7626FC IMPEGNAN3
2,421,615,600 *FFE80FFFC6C0BAFC9CF9312C726418BA17B78C05 HWHOAA
2,421,615,601 *FFE894C0C732BD7FB39495294EE9C25AD03B5A64 HYDRAH3A
2,421,615,602 *FFE241D68BA2F1D4CF81198ECF7944B5B17F9F96 INSUITABLE4
2,421,615,603 *FFE9B8D3820CB0998AD78058DFFF777CD5B562B1 INTRODUCTION.STAUG73
2,421,615,604 *FFE1F67161EEA2449D4BDC32E6817CD024BBCE5E ireugral9
2,421,615,605 *FFE266F27F7DDF41B0FA21C89A3CDA0EF9A627E5 idroscopi9
2,421,615,606 *FFE44DBECF7EEA844FC3B39F6866B7272298DB17 [email protected]
2,421,615,607 *FFE92381ED482BFE793C15C5E1E2A72EFFE92D10 ISEDDIKES2
2,421,615,608 *FFE746587979470FD75579261D1B9C9AF1DCB2E2 IKISTYVLLED
2,421,615,609 *FFEC2486CEF672E4BE2457A19662D9A3AFE9E5E7 ilikesix
2,421,615,610 *FFE5F17B11494B7A326D244C5C1996623EB7E88C IWEEVERS
2,421,615,611 *FFE57C9830493D9E54E1C88E7E41A6D0C307E9A8 izdxxqw4
2,421,615,612 *FFEF696DF63C6566A4B7DCCE8971EF5E8F81C479 ILS>
2,421,615,613 *FFEFBD44C540B8B0788AD26B4563EC96CBB8036E impe7u0u5ly
2,421,615,614 *FFE6523F6DFEFA34E3D1CC358FC6E6945CFB1206 jasoneanni
2,421,615,615 *FFED24436DC36D3803429D9D8A77227B9B88B1BD jcyubmbdvrqpay0
2,421,615,616 *FFE190A18904D80E86F4DF4ACED16657A2AFA1ED IRWINBLOTT
2,421,615,617 *FFEDD9B85D59A0700D7355B33B95609C43555D32 JEFFREY.CASTILLON
2,421,615,618 *FFE6A0D7E25253EC0DA135E27535121A43FD199D ISAAC.SYNER
2,421,615,619 *FFE41690094C115DAAD2BB66145D3B1D9ADAFFC8 ISIDRO.VANISOUVONG
2,421,615,620 *FFE0A6DBB1D3FF29A7E6EB7C1C6FAD5F553E9FBD jeromevenible
2,421,615,621 *FFEAB47D9514E3F342FBAB232657FB089A3CDB24 jerroldmassimo
2,421,615,622 *FFEECD1A1A0926977F34881F777EAED982F17FFC jerrydemelis
2,421,615,623 *FFEA3C38491C205F5E793970DDEA35490C4A4B9E jerryshorty
2,421,615,624 *FFE0EE5F5DDB85B8A5EEAF72CA9C177EB0FB5C2C JESSICA.NUNOO
2,421,615,625 *FFEFCCC3C65732A97696AEBF900ADF2349312AE0 ;iyaaa
2,421,615,626 *FFE32879AC5E6187B4DAA54C46982E7DFA1F11F2 J4L0NN35
2,421,615,627 *FFE6A41E009AEB5189415A4E6933BA89820A1393 [email protected]
2,421,615,628 *FFEF796A11D67DED69D583F25F03B4325AD67245 JACINTO.FORNER
2,421,615,629 *FFE3C7870E90073B56F0B9588687CC91CEFA3F68 jianxun8
2,421,615,630 *FFE95BA865099AF9DE4B229DFE3FD4A2260026D0 jj=1
2,421,615,631 *FFE356312920D9BD36F117623479C63E917233F0 joaquingalvan
2,421,615,632 *FFEA5489D7CECB3C793CE3E69EEDB7D4A1ED2F0C JANIYA64
2,421,615,633 *FFE76629D8BEFC2DDABABFB5FC4B925C7B76FB09 JANLAZENSON
2,421,615,634 *FFE8BF51634F8B92C453DBAF33A151E81694DCA0 jAq
2,421,615,635 *FFE1A6F1822527ACBF545E113CF3318743F4C817 jaredpasswor
2,421,615,636 *FFE7C161313BA6F72CE782D71665DF7DE043BB57 jordansfit
2,421,615,637 *FFED2DF56C02950008154997EE51009D2E018698 joshuabrookhart
2,421,615,638 *FFE68DB1C19EAA10AAC361C78B56AA600439D245 JOSHUASCULLIN
2,421,615,639 *FFE5FDE32148D3D560FCBAB090AD402C6076CD9E JENEIVOUSW
2,421,615,640 *FFE1C35E7BF259CF1B63154445C74B81043200CF JERAMYDELOSANTOS
2,421,615,641 *FFEB63470C3CF30FC18CE4A3A7D6E710A66CB716 jeramysiedner
2,421,615,642 *FFE87E5FCD1B589323214A137B78DB8631641FC6 jujubut7
2,421,615,643 *FFE6A7E6F628D670A67D144838D4DDD9B5AF48A8 jersey4
2,421,615,644 *FFEE926AFF1A126A851BCD8F5E1CAF0EB74F9FF6 jessdaubs
2,421,615,645 *FFECD5045F3F4639763D4B2A43308F8B99D5135E juliuspoke
2,421,615,646 *FFE2AE29F0C84FD7E8DA4C760847843EDC70F4DD JULIUS.SETZLER
2,421,615,647 *FFEF0339C327741EA24A0F01F7B90E0DACF2C800 jfontague
2,421,615,648 *FFE3B3A0607E5850AA79103007346CCF4270E8D6 JIMBO_WIES
2,421,615,649 *FFE486A7C53662D6CC296324237AB4CDA6A9D113 k&9j
2,421,615,650 *FFECE5F6241921B0534E500B3F52CCE18B06B79C Kale-bazetsn
2,421,615,651 *FFEC518F7DCAAC656AA3506EF83A3B97F7056216 JJTUFGJ
2,421,615,652 *FFE5E2B9BDFFABEFA966965DFAF7A80AFE3A8E14 JKL1231985
2,421,615,653 *FFEBF4A270F94AD7FEE74C00E3A66D26CCD153F1 JNJFHFP
2,421,615,654 *FFEAE7608B602E865D4E8998F146F46457BFD11E KATHERINTANNER
2,421,615,655 *FFE0BF1FF6E0D12B2D678672897CD65624BB3339 john-buchak
2,421,615,656 *FFE705BA96BA52308F4EDE799DF345B17F125034 JOHNGREENEWALD
2,421,615,657 *FFE3C955B20DB85F296482B5CA4968FF62FD11AE jonahkiyabu
2,421,615,658 *FFE9586CD9DC14EF7B0ECB32E39C93E7435A0551 jonaspleppo
2,421,615,659 *FFE5C22247E0743FFDB3883C5B57D43CA249D4DB KELLYDEANDA
2,421,615,660 *FFED2EB4B44D7FD6FE7A54995E7C2F26D94E2C18 JOSESTEINBRECHER
2,421,615,661 *FFE86D3DC208C0F6E75ED27D0CFC417E685EB991 JOSEWALMAN
2,421,615,662 *FFE57286C8F70D495D7D811FF214F20D1D838AC7 KENNETH.OLEWINE
2,421,615,663 *FFEBB92FFB038016D8BA2EBA6074BED038C26713 JOSHWIMER
2,421,615,664 *FFE19937E12F8064DCA99B2B0BE1A72959E41C16 KENTWAKE
2,421,615,665 *FFE1476362AE27DF9DB425FA4DAF5BF423ECF1B6 joyeddeyoj
2,421,615,666 *FFED79AE50A6DB9835F65664579AA8B1C3F94402 [email protected]
2,421,615,667 *FFED45DB639E28D52B46BD669AC49C589AC071CA K]HD
2,421,615,668 *FFED22F3D74E196AC52D06FF81DA9BD8C9B6D974 jungle-lounge
2,421,615,669 *FFE38713CD57D5B13C869FBC8B0EA9B695ED7736 JUSTIN APPLEBAUM
2,421,615,670 *FFE348E865F37ACDC172556569FDE1F0BB5565E4 just-mine
2,421,615,671 *FFEFA51B94C405295FB9B14C33FBF41D8FF7C890 Kiss-(feat-Tom-Jones)
2,421,615,672 *FFED69B92E1CA3E97BC030AC9D5B586977C3FFB9 j,x"
2,421,615,673 *FFEF0D58A2DB0F94D18C5D02820BBC3012A968FA k64
2,421,615,674 *FFE69C84B3E3F1F6A8DE8A41F09E2228143588DD KALENDARYONG
2,421,615,675 *FFE5B82D220397ECA2123A31B5C790D2EF4689C1 KONSTRASTERENDE
2,421,615,676 *FFEBDAE4614025FF6311EBF2E26401F87E7AB3CD karizan
2,421,615,677 *FFE60F13E6E3C0F9CEDAC69BDF90C52F3E946827 kastiins
2,421,615,678 *FFE7D77BE899C6224B83F7BBE4570A37F684002C KBAXELSTRAUSS
2,421,615,679 *FFE385A528E0755155A781CCC1AF4BC2687DF747 k\bs
2,421,615,680 *FFE184A7C8A1CC4D7B8DA8E0A1445F6A0292D5E7 KEENANNOONER
2,421,615,681 *FFE958E66EEE48865452FCAEB1C92A4C3A40BA5A KULMANN2
2,421,615,682 *FFEFD4D15D893B5135DBA424CB2DFF29A04B8D0D KELLY113579
2,421,615,683 *FFEFC901063090B41A96342A700E526396903F4C ken.longworth
2,421,615,684 *FFE8BA54B99B4C9F85E366299386684C33D40A00 la chapelledubourgay
2,421,615,685 *FFE109902359A6EADB210C652BE7A6195663D695 keukenradio
2,421,615,686 *FFED111883C88A768E0B5FB216B97F4CD75C6311 LANDESSOZIALGERICHTES
2,421,615,687 *FFE472F1E60A00FBA5450D14E838F9EC957D8986 kilonas
2,421,615,688 *FFEFCB9EE5D57CB6394BA947102DBC9648E654CC langwasser
2,421,615,689 *FFE0BA40BD73C1FE4B917D0FC59B955F7E91E4FE [email protected]
2,421,615,690 *FFE50C570A567EEC4AF4027B911A39CBA7B18CF4 KITZBSW5
2,421,615,691 *FFED3EA80DD23703F09CADAE2EBC402B8B8CEEDA Laughter&Blood
2,421,615,692 *FFE0CBE8D3A0C8DFAC29CE4EB940FB2A03D9D476 [email protected]
2,421,615,693 *FFED7871CCEF25D8885BD913E41DBEEB93B8B935 KOKOMEI
2,421,615,694 *FFE118A4809863AF5ABD2380B1D0784586C7970C [email protected]
2,421,615,695 *FFE154B7D9A1F4C520A7EE7EE7E2AF3F7E277E47 [email protected]
2,421,615,696 *FFE7563259AE9A385F4D6D5979DA504247404914 [email protected]
2,421,615,697 *FFE881252637E1558DADF930F2B5F90B8AA84BB3 LEMCOE
2,421,615,698 *FFE6C96C994B4FCF6FE18728268D7326A6D21DB5 kurtishoegerl
2,421,615,699 *FFE34B8E0C81E29F7A378222ECBEB5669778421F KVGB
2,421,615,700 *FFEA0F3B012F14B880192C34EB56CB5542F67148 [email protected]
2,421,615,701 *FFE083559CC5353B8F9F0DA518DD2E678A9C9E4B LACOMBE3
2,421,615,702 *FFE468B620B670687A8B9177742E17FD30585BF2 LAMONTSTEMAN
2,421,615,703 *FFEC9E395C47E00742E48755B326001EDB2A7795 LANCINAI1
2,421,615,704 *FFEB14259F1FA2F87E7390377CADDFC20D2AA6FB [email protected]
2,421,615,705 *FFE327673FBCB1CC2B3E257D08719FC52F583509 lannyfurton
2,421,615,706 *FFEF551C98E99255A3AB9BAF3ACFE5D7DA4E5A59 larrywisse
2,421,615,707 *FFE072F7C0985B7DBF00BF8428768D51C9264571 [email protected]
2,421,615,708 *FFE8E308B5C74B89CACF5F084AF99C4E9DDBC3F8 latemodern
2,421,615,709 *FFEE3972247C2015DDBCB6E080E711FEBE8B382C LAWRENCEJETT
2,421,615,710 *FFE49ED852AE5468B09CEB985D7B271755F45713 L(?D
2,421,615,711 *FFEF68F6908C463FED7B4915335129551E479CC6 lohmeier
2,421,615,712 *FFEFB4DBA5D8BD9A7600F1E5A1F710C68827DF99 [email protected]
2,421,615,713 *FFE3803EB27C4D88985AD4137A290CBA314341F2 leikkimaestae
2,421,615,714 *FFE55C8F8A21C447B92F84F09F138DE344FB81E5 LEKEESHA3
2,421,615,715 *FFE919A67FC7D0ADBF324B613A6E4A2AB2AF3FD0 loutoro
2,421,615,716 *FFE350C289BF9480386F301F35070AC5BE7EE2CF LOVE.LATELY
2,421,615,717 *FFED247BBAC34E6314D78757B35ABD80F8568327 Love-Throughout-the-World-(feat.-Natasha-Atlas)
2,421,615,718 *FFE5153A42322C21B81D0A2CFC85E8F357FBA4F2 LOWELLANDUJO
2,421,615,719 *FFEF56DAA2EE4EB0EFE74BD685797812A4F4270D LSDFMEU7
2,421,615,720 *FFE83B458AA70EB6CF9A1B00450E24F165EBFB9F LEROIDESTOURBILLONS
2,421,615,721 *FFEF5293807C9F883BDB5766674F2123DCF8E85E LUCCES
2,421,615,722 *FFEF7F3632D9955CE9EED0982B5E0DDA346D6983 lgajjrsp5
2,421,615,723 *FFEBE3FAC509897C7874A7281FC7BF550E1BF47E LICHTSYSTEM
2,421,615,724 *FFEB9120B006F5CF3DBA704D19209A2EF933D352 lightworks(featq-tip&talibkweli)
2,421,615,725 *FFEA692A9497245AB7C51330073AB669B7AE425E lymanmayorga
2,421,615,726 *FFE01A3A245108CF7D3182227FC71D776BFAA87E LYNDSAYCOLLINS
2,421,615,727 *FFE15D943FB712C25AB47F3BCE4161801DD42163 LÏNDIGENCE
2,421,615,728 *FFE01AFFEBD8372E413B84E1CEA75945DBA77530 m37a11ur91575
2,421,615,729 *FFE4254A1A8FB439CCC08A38095F5E3CFFCC54D7 MACALMONT
2,421,615,730 *FFEC5A95EE49CE6AF1C46BD2EA550015987FF923 LIUKUEN9
2,421,615,731 *FFEEB52AEB86F902CA4633F0F2A11AB9F3909F49 LIU.TISHEN
2,421,615,732 *FFE99F87EDE281C3A4F9C4D527CFB00CA9971096 [email protected]
2,421,615,733 *FFEC35F2E76F4ED317462F3449CAF13A3621909E mai-trieu
2,421,615,734 *FFEB6D6153FFC7E1DC235014E730D92238A125D6 LKF_
2,421,615,735 *FFEFCA76FBE0585C5DAE1ADA2EADD5BDBC3582F8 LMMONTGOMERY
2,421,615,736 *FFE075DF556DD2B2CC6E44B1BFB7208272359FDA MANCARNILLO
2,421,615,737 *FFE76F1374A54CBA9CE005A17F1A2ECFE62C6DC9 longschilsky
2,421,615,738 *FFE2A657EAE21237CBE7D574A90807E65FC24728 LONG-STICK
2,421,615,739 *FFE3DFA9AE8291FD649974CCCBABA5A12B8998C7 look-at-me-now-(original-mix)
2,421,615,740 *FFEFAED0C8750542819D13A6640F827D6687EC89 MARCEL.BEPPU
2,421,615,741 *FFE9580B2B73948FF37A058868E0A1EFF33CBB20 los ideales
2,421,615,742 *FFE3817A8C71FDE8A159846739D3ED42939E6A46 marcosgunkel
2,421,615,743 *FFE3B36BE14771EF801CD7C51E1C1C7EB1E43044 MARCOSMCCUSKER
2,421,615,744 *FFE2D64C0D4E5CDCD18F73390C7E66D7B05FEC30 LPRINGLES
2,421,615,745 *FFE32D6A18B9B96E4165797C69472AAAA6B32C28 lrachel4
2,421,615,746 *FFEFD66276414D5CC98F526A903811E3FFD6F7DB LUKECLUCK
2,421,615,747 *FFE9A30707C331057ED2D1980C742B9FE7C57184 lupeoei
2,421,615,748 *FFE44F53F0769493113F53747D9F01267044A11D MAURICESHABAZZ
2,421,615,749 *FFE99CA00CE98697ACE72EC1E1ACB36A21415B04 MBEBASAKE
2,421,615,750 *FFEC663691633B346438489A0DE0BD60B62FF89C maija.harju
2,421,615,751 *FFEDC2C84C614BC168A6E1ED0C511DB158B00A77 MEDVJEĐIM
2,421,615,752 *FFE2ADCE321CA5A2C87106F847C1524286DDB432 MAJORKLOEFKORN
2,421,615,753 *FFE70C9AC076D415C93313E095FB3B85C907A72D MEIRAMI5
2,421,615,754 *FFEB91324D7BD78AAED4DA2BF31952C487434641 mergosa3
2,421,615,755 *FFE8F4A025812C442937B115EE0B08D4F6A69C95 Manuel-Artime
2,421,615,756 *FFE30933E8EE2865C6BD56D875E2333C30BE20FA [email protected]
2,421,615,757 *FFE35FB2463A148AC899BDCB8C9A7C3AA7C55797 MARCOS ANDRADE
2,421,615,758 *FFE674EBD658F2850A4CA6948497D446DB0DF8F9 MICAH.MANKIN
2,421,615,759 *FFEE28EF7D898B742D6A30633BB9D379761BA334 MICHAELCHOBOT
2,421,615,760 *FFEA8FCAA3788804FF0610F249B4AC3B80505B40 MICHAELMORRISSY
2,421,615,761 *FFE476CFD9C8109E2CB06AD8D9E13D7745FB560F MICHELLE JANDURA
2,421,615,762 *FFE4EB77508D08077BABB8BD4D937F798535C48B mierda-de-rap-(instrumental)
2,421,615,763 *FFE095363ACD8A9AA3B66F7DCCFAE12FAC189ABF MARK-ZUL
2,421,615,764 *FFE6DC3D8B743EA2ECB3A2FE148B135314F15473 MIKECHRESTMAN
2,421,615,765 *FFE4E2CA75E77EF0132850F346C191F19F08C4AF [email protected]
2,421,615,766 *FFEB9A7D2D94AD9606D854F31F19690D6745AB09 MILFORDFERGERSON
2,421,615,767 *FFE7859B528869DF7902EDA6CFC204E055930299 marvin.waje
2,421,615,768 *FFED95659C8B2979F6097C72631BE8DBC9798C84 millardblogg
2,421,615,769 *FFE45B95B5DFF36BA15CF8093BC94822E696828A miltonsteele
2,421,615,770 *FFE0C941009FC03258DAFCA6D5522F85C7EEDF63 MÎRNEA
2,421,615,771 *FFE725FD0F9FC1651FB7AFA7922E5DAB03AF5DD6 misty.barkley
2,421,615,772 *FFEE5672A4D58BE55F7733B180A0399DE5B66269 [email protected]
2,421,615,773 *FFE51C77695C502C5D90F150B9D51F99DB3ED880 M,-JAK-CEL
2,421,615,774 *FFEDD95BD56DD97CA471037A40793F9C11A1FF2D [email protected]
2,421,615,775 *FFE6EDD0D6373BE6AD3E44D4D7D341CB4DE78E17 MLDCL
2,421,615,776 *FFEF834CD2D10584C66D11A63341C3AB1FB1A392 MNAMIERA
2,421,615,777 *FFE913E436E142930167D9543AE1A66089E50AAF mediterraneantrgeostub
2,421,615,778 *FFE63C034301A2E5BA515F24847CD66D651B8A82 MELLOW70'S
2,421,615,779 *FFE9BD067D94E8DAFD73DE7FB59DA0C526A26D37 memvalids
2,421,615,780 *FFE7BD88ECC59C62D59AFF1C94FD2B3F035FA479 morristownzen
2,421,615,781 *FFE9D71363E33C3146E51CC248A44EC09C3AA0F4 MOSHEPRENGER
2,421,615,782 *FFE95CC40F23C2E99A9D46A324C72ABCEDA6DE21 MOYXLA
2,421,615,783 *FFE4047EEE679D81EE799C514FE3F038E4701CED MHO153
2,421,615,784 *FFEE091FE91C93993D1FABF2F8417AE06F92C1C1 mrjasmin
2,421,615,785 *FFECBD24283FFBF381EC56E74F70CF3C678BB62D MTHOKO.GWALA
2,421,615,786 *FFEC3B1CC10CD6E985161DFB27D471C4615B8927 [email protected]
2,421,615,787 *FFE2A320D36964D5256328B9D935440143285DC5 muhammadharisnoon
2,421,615,788 *FFEF4BDF74F8B3187B834C1C638BB1DDBD32E213 mundobut
2,421,615,789 *FFEC282B8B6C7F8408D68FD6F91C0E8FA8B4505C mig.steals.the.crown
2,421,615,790 *FFE728F18B4FF9272F3E7AF3F59F673BE107121B murrayweichel
2,421,615,791 *FFE5C2A780DBAD32BDD967ED146761A46D002B1A [email protected]
2,421,615,792 *FFE77FF470C9405EEA19A3C4884303887960C1BF MIKEYSAMMY
2,421,615,793 *FFE62CD13ECAB245D1E24A2FD71CEE3B83D47AB1 MILESTONE-MARKING
2,421,615,794 *FFE5C2E8B178DEA62853E93A12C2180FFD5D5A21 MYTIKA83
2,421,615,795 *FFE502E2713D63DE4E856B921CD5931D77BB742B N^-
2,421,615,796 *FFE80FA991128EB4E5C754E64E1A2F292F62C0CB MITCH.DOUDS
2,421,615,797 *FFEDF1C638CB81347653825F2CF53E21F42D7FBB MOCIANTROPPUS
2,421,615,798 *FFE390933D91D0E42A372298BD04EE58D7E20D72 NANNABESSIE
2,421,615,799 *FFE547EBBA060943DC424C9F01BC9D8C81636963 MONKEYDRAGON1
2,421,615,800 *FFE7177CF874B0B715C2A85173D439FEE08CE5D9 MONTY.REBOLLAR
2,421,615,801 *FFEE33E0C684707C37B2FFB7C1DEAF27F2CEB93E MOSES.KYKER
2,421,615,802 *FFEE47B56B922B948A43AC1EF747413BF6175A0B MOTAI123
2,421,615,803 *FFEE0A9C54347F39FEEF60695041D10BD140A82F :NEN|LLY
2,421,615,804 *FFEF4195E8D0E0408E175D0A3B592A5E8773D600 NERMIN MASIC
2,421,615,805 *FFEEEC18C1B1D65A0B04FA0FD03A839DD8E4BE23 NETEZILO4
2,421,615,806 *FFEE849721879A3F5E6F6B160B408AAD8B97FB7E music(paulwoolfordremix)
2,421,615,807 *FFE60E8C4CC216806E05466143F49E43466B4B19 NINNANAM
2,421,615,808 *FFE50AC7E4E0424AB3311E8F8BC599861E0949FA NOAHBUMP
2,421,615,809 *FFE3A4F5716B91FF85B0FADCE27360614A3CBA28 NOELSCHLAGETER
2,421,615,810 *FFEC79935389021697CC14974C7FA5A03FF5FCDC [email protected]
2,421,615,811 *FFE815AC32E4962FE5607EB7BB0549ED59175A10 NONINTOXICATIVE1
2,421,615,812 *FFE28EB0C04D1D62ACD7C0333A4E85F617773A5A nathanaelkiening
2,421,615,813 *FFE347B4C7B3A4D75723D597570634249E7AC471 NATHANAEL.SLIGH
2,421,615,814 *FFE64F256F62766E76528DA5D0BF0683312B9FE6 NATHANIAL152
2,421,615,815 *FFE861583B0CBE423981C75CDFF74EC8D837C6E6 NOSGNAIG
2,421,615,816 *FFEA0FE8C59CBCA190EC9AED843954A95435C81C not-so-ez
2,421,615,817 *FFEBB766F633C10A82B7BAA4F9E57B6AFE6C9272 NEA03
2,421,615,818 *FFE355EEA306DFD4C5E708424D69D95F2BF8F81B NEALCROSLEY
2,421,615,819 *FFEB253F30E14A5C945371527BD1D534C166E756 NEALSAVIDGE
2,421,615,820 *FFEF8C73878DB539EB3CF151850897956D3C706E (>-<)o~0~(#####8
2,421,615,821 *FFE57AD913A10F509F10816FF67872000B443549 NESLEDY7
2,421,615,822 *FFE7170DDD1A513D3C4727460BBB92EF4A6F5218 NEVILLE.CALLIGAN
2,421,615,823 *FFE7E5A1466B3AE625391F1D8854F53D67CEA573 N!"(HEXEN-HANDY)
2,421,615,824 *FFE717FD461DE626B1604A9F1285C1DFDD9CC956 NICHOLASBROWNWOOD
2,421,615,825 *FFE40ED71BFAB6C12C9939DFB464F2843CC4CD3A NichtverarbeiteteDinge...
2,421,615,826 *FFE78A2A9C7370D410E76F5D84FC85A999A97DF1 NICONFIGGED
2,421,615,827 *FFE3623EEE061444601B3F96C82B3E17A8125B5E [email protected]
2,421,615,828 *FFEB69A520D521264C0C050529632146BB68054D nnprptbl6
2,421,615,829 *FFE463B84C5C11962D715047CA88C0EC7BCADA89 NOBOOD
2,421,615,830 *FFE7BBCC07114FA7E3936D06604DF89FE930A391 OLYMPICS-BMX-FINALS
2,421,615,831 *FFED35FB69A03DC349AEB1F53E5836717944710B Oneer
2,421,615,832 *FFEB2E433A08AC250CCF13A165D2431CD9310EED O><O~.0~.D###P
2,421,615,833 *FFE828898FEEEE38C1A6D584C5B089ED5B0564A8 N,[S
2,421,615,834 *FFE538A30F93851649B3F48F7EB6657FD40A65E2 ntrbndn3
2,421,615,835 *FFE7356BC7A160D5A2B7C405D970CE0EE53616FC OSPITASTE
2,421,615,836 *FFEECD78F461674B00DC20A688EDF017A7E34290 oswaldojenks
2,421,615,837 *FFE3CD3AFD66C87CD776F7C334DF1BCFFB0051A5 OCIRETTI
2,421,615,838 *FFEB18BA6D62EE41709125A44D570E174A3711F7 (O_-)~.~d==8
2,421,615,839 *FFEB2B4EA214951FEA6631145445651FD99801F7 OTTEGORP0
2,421,615,840 *FFE9CA1C06D47C9C57C22504F62E6F187AB1AD33 [email protected]
2,421,615,841 *FFE65AA1E4109BE70384BDBB1F2933D06B777BBC oikovat6
2,421,615,842 *FFE48CCBB94A54D5194888F8D8D6E14D3B454E73 p=====>.~0(o_-)
2,421,615,843 *FFE2BA688C47627B32D46164B4D9A97523B6B0B2 P####@.~0~o.splat!
2,421,615,844 *FFEB06F9E52B3579509D4D8A13AC06FFBDE63B4D OLVASOTT3
2,421,615,845 *FFE3BD2C228005FF55CECD81E5330F70EE0F98C1 omarsoubra
2,421,615,846 *FFEB00CA1C85B5E839A61F9477348CACAA4EA2E2 paducahi
2,421,615,847 *FFE0AE26CFC4014963ADDB3DEBA13BE0365D0533 OPPOSABLES7
2,421,615,848 *FFE0EA15BC4089942FBBE3485C9F5F11AE0BB5F9 orentank
2,421,615,849 *FFE2F85DF4B0D6B5C930E4036A5D52D095266963 parochialised7
2,421,615,850 *FFEDFF1E70D7498530AAF692431F2B140A38E938 patricerushen
2,421,615,851 *FFE2E4C3E2826D9730B813E4B544A808729F97D7 osterio
2,421,615,852 *FFE20A7047A2C5E7FDE82758B04D70A5EB82420F P===B~~~)8(
2,421,615,853 *FFEFE186FE66642A58A2278BA4465CB3883D6C5D O.Y.CA
2,421,615,854 *FFED91F956BB6B82B3736E58B5E0D5E7181D6DB6 P###>~0~OUU
2,421,615,855 *FFE23BEEFAB8E9DFE31502EAE30A9BB8A903F8C0 P5EUDOACADEMIC
2,421,615,856 *FFE14FF5D57F1740CD577A7A7E097A1C58029D20 peterandthewolf,op.67:"inatwinklingthecatclimbedupthetree..."
2,421,615,857 *FFE9AC2AC27E65A6139BC29656C28FFF613DFDFE phantaise
2,421,615,858 *FFE572E283B2D3CDA2DF0CAD39C7F0F7F015669F parçanlandi
2,421,615,859 *FFEC5433ED1E698D366D3F19CC6F824C8C44173F parjurais1
2,421,615,860 *FFE3E1C1A570EF58F5C8B7B819F395BD6CDFA6E8 PIKKUEL
2,421,615,861 *FFEBA0B3DB93B44D66E1A4EC575E0875BC821929 paulscalise
2,421,615,862 *FFE2C6C919273B590CDF3490CC99F43B94D3840E PB`.SPLAT
2,421,615,863 *FFE7A87AA11E26343773409D0A208384B76F7E50 P--)`~`~)o(
2,421,615,864 *FFE607C8CCD3171B6185672F54924482E81C9A35 porterkerker
2,421,615,865 *FFEF26D2CB0F88255B2F287785D73CC99D83C960 [email protected]
2,421,615,866 *FFE31F28AF8E2B8CACE296AE6E9471500DAF5F5C P-----P~0(>_0)
2,421,615,867 *FFE1D6D6E7320F5C008BFBE1DF8BA0DA7F0FD29C PRAJÑAPĀRAMITĀYĀM
2,421,615,868 *FFE57EFA1ED9EDA157DE8797E15B1ED8A97F0C34 PRAYINGPOWERFORMATIONLATEMINGHARVARDYENCHING
2,421,615,869 *FFEA795EA7BEC91E541CBD7D42D0346E41D559BD PIRATIZE
2,421,615,870 *FFEE5A8E7E95D3966E002CB19065785683CF6600 PLOUKIE7
2,421,615,871 *FFEF53078FD06966D522134D1FC2EE32AF0850EC PROPIEDAD-DE-NADIE-ALBUM
2,421,615,872 *FFEDBDF5A95DE5F34A641682EC4358116BC7DFD6 pn de soussmassa
2,421,615,873 *FFE6754A3C6ED6EE47100C808381A6EC9A462942 p------).~.~.~Splat
2,421,615,874 *FFE233298A808B66C556AC9A0AECCDBF1EBED7E5 POOCHIELOVE
2,421,615,875 *FFEF0C517B027008DF9B6363BCC52E0FC74D945D PULCHRA02
2,421,615,876 *FFE4A828FFBC883FC67A82ED73B967A9F6D470C2 pull-not-push
2,421,615,877 *FFE102BD546967BEE3F541F1ADD9EDAF8AC2489C PORZÓKON
2,421,615,878 *FFE66D8ECC2C5EF2D58F4979F8AAA3CDE5AFF4B9 PZAWAYS
2,421,615,879 *FFE7802038C10BB54EB6DE5564A27A1F3B6DB234 pouro
2,421,615,880 *FFEBC552049B65A3E8AB5CB4687121915758C21C q##b`~-`~}8{
2,421,615,881 *FFEDDC759003E023F38E89F8A016E2A6E4A3FB0F P-----P ~ }O{
2,421,615,882 *FFE5D8D72F3CA856D4D21A27087E86A20858D338 [email protected]
2,421,615,883 *FFEE68863C25D7EEF08230B2A8AD47383E9B0435 [email protected]
2,421,615,884 *FFE96D5AE90EDDB52705CB1F5F84F90A4D1CC9B6 q####P`~-`~Sploit
2,421,615,885 *FFE1524CEEC872388E1413ABB89A4B3BAFD513C6 QQMOOSE1
2,421,615,886 *FFE5F33146AA27FD5B7183BEC9335BD898D3C563 Q)~~~SPLAT!!
2,421,615,887 *FFE32B22CC35245CB92AFF756CEECAAA72B8E291 QUEBRADA.MANANTAY
2,421,615,888 *FFE3A7FA2A2C6458B9178841C98FDCAA361B5A77 prisilno2
2,421,615,889 *FFE06858A566E0EDD6429DD4ED65FDEAFB3773D6 PRODUCTION—WHETHER
2,421,615,890 *FFE0520663DDB481A5CD8050214BEE028611170B QUINTINKUHRY
2,421,615,891 *FFE508EB0097AE296F2D01D4BB1166C95BFE9CDC pronssinen.pokaali
2,421,615,892 *FFE59430E9CCB191136DAE983A2E66B14A4BBBFF R3GU1ATIONS
2,421,615,893 *FFE65D8191CBFC5C2BCEC9AD5C498FB5657F4D46 pugnalerai.
2,421,615,894 *FFE1B86DDB4BB74EB9C83A503CF9D98CF1B69C20 RAFAEL.FLEURENT
2,421,615,895 *FFE1156E2674D9F0A1BA0B9C7D4FFB335351D41B RAJAMUTHIAH
2,421,615,896 *FFE9D7D7F31DAE905E27FD77B897D4FB738380EF [email protected]
2,421,615,897 *FFE471CC82D395A639A2D68D4E6229BF2023383A rankangas
2,421,615,898 *FFEA368ECFECE0B0149C1D1EDFB18B40E4349A9E RAWR84
2,421,615,899 *FFE384DA9B8B76E025425079D19CA533B1884065 raymondbarona
2,421,615,900 *FFE8F6F29D1B066B46CDD107DC5823841646DCBC r&banthems2005(disc2)
2,421,615,901 *FFE54A83ADAED0B873E5B5920061655E87D7AF9C QTDTOTALGERALREGISTROS
2,421,615,902 *FFEBF90E184AE11D81955E7BF2D62F57D0697EE3 REBRODERDATTER8
2,421,615,903 *FFE4B464BA033B9A680269C69EDF5DD2C860ECD9 QUELPIED
2,421,615,904 *FFEA6A2F2B8DCBD518CC21E163E72949B93606D4 Rees+4blshmen+
2,421,615,905 *FFE113B70271DFC242C0C784F8981081B96B6308 REGALIZED4
2,421,615,906 *FFEF01D78A2D93F3CD2E58C8C246F865D0276F0A reibir
2,421,615,907 *FFEA925FFCBA214842046B70435A9E01D5467A4F ra7on$
2,421,615,908 *FFE762B17B9A59BA9B6BD8BB1771E5B1A6AF54C0 RAFFI HAYRABEDIAN
2,421,615,909 *FFE40C1876A06F7E9310B197E17443485FC3D861 ragnaag7
2,421,615,910 *FFEEEB77D7AF46CFE5E57B4535D2B2901D594F23 [email protected]
2,421,615,911 *FFE5335315238FE5F835B6617FB8A07113EB54D4 RAZVANTONITA123
2,421,615,912 *FFE8558319FCF9623B2313EFA365E14263EA80A1 REZNORGORDON3
2,421,615,913 *FFE7DBE7ACCDBF429843C84F90137913FD96B334 RGT.GRADE.4.EX1
2,421,615,914 *FFE5EC9D2FE8AE7AEAA47747B5F3F0ADC362AE83 RHABILLERONT1234
2,421,615,915 *FFE76F605CED9FC8131C752CD089D7BBAD5B8007 RDG190
2,421,615,916 *FFE092FF04329FAA4D7D844BE9DE0893CE5ACACA RICHARDSCHATZBERG
2,421,615,917 *FFE9083A21ED08260D88F478B987B046BA656A83 rebrouss
2,421,615,918 *FFE944E3BA00112F1B97A63E7F41111CA4E0992D rickabolafia
2,421,615,919 *FFEB9689833F782D16C23CBBC893822F3702C61B red)
2,421,615,920 *FFE6F6A9D4A6BEE41E04483406126B67809CAC5D RIO RINALDY
2,421,615,921 *FFE0E05BFC2DF69A6D840D030011CAE9C908A8B8 RKEABILWE
2,421,615,922 *FFE7BD5A39CDE53A42D48F312A378DA757BB2B35 RK]W
2,421,615,923 *FFE92DE280324483D1115C6AAE2E8C6E3F62491F rekordiliselt
2,421,615,924 *FFE21BC2A81A638342DD1716329E4E11F9923741 [email protected]
2,421,615,925 *FFE2517619DE087728BD8F409049438D1A37C894 ROBINHOOBIRD8
2,421,615,926 *FFE561CC7E1C743B0EC998230081B2F6494251C8 renebeaton
2,421,615,927 *FFEC56F9786302FEBC57C928565401353FD6D85F rock-&-pop-diamonds-1972
2,421,615,928 *FFE1A6E33ED90A858B9FE79977A4ED1CA30B6E3A RODNEY.GULYAS
2,421,615,929 *FFE999CEDA10EB658DD71B305E1907AC1037C554 RERE REINA
2,421,615,930 *FFED6F552FF6D8AD5B9A45FFF8D8828AA07965DE [email protected]
2,421,615,931 *FFE853F0726208FE0C3CEF162178C88BDAC39449 RESO1UTIO
2,421,615,932 *FFE1FD0C90D8AF969D8EF23FFF52BDBA8D05ACB2 REVALORIZE8
2,421,615,933 *FFE3EB3583C1DDCBFF7ED4E166942BB2362B634A romeoshahim
2,421,615,934 *FFEF6225D5AB074730E379A8722AB11FDFAFCDE0 RICARDO.SOMMA
2,421,615,935 *FFECF76710F03403CA9399C67D26594F0C2D845D rosendochisari
2,421,615,936 *FFE556F0090FFBDF1413075F6814E7312B25CAF8 røsshammer
2,421,615,937 *FFE25255AD4947F3CC25BD57EA7C4376D53BBDF4 rubinsaggione
2,421,615,938 *FFE9678E4E278339E9AB7E76219EE9EDA9FAF817 RMARRAFA
2,421,615,939 *FFE084D20BCFAC1B09075544D81A9C71406B320F RMEJAAVAIN
2,421,615,940 *FFE0981488C9E500B1876EAC0EBF31D69D8D97EA ROBERTKUEBLER
2,421,615,941 *FFED1BB8BC2119F956C5B7C390C18BA954A65FC6 ROB.WETHERBEE
2,421,615,942 *FFE89A9885D8A21FD4E15A6A0440EF70DD494B76 RUSS.TRIBLE
2,421,615,943 *FFE1D4CB4B409EA889E0CA98B4A5F1D04E5A3851 ROCKYBOOMERED
2,421,615,944 *FFEBB3C0E04582B5CD9AED2623509A6CC941B8A1 ROCKY.COSMAN
2,421,615,945 *FFEE573E7C0D1E911EAC83E4540BBBF3D66C71EC rustystockwell
2,421,615,946 *FFE50D9F6C8EC10B8DEF6C5F58ADF91FCB19ED68 RODERICK.RUBIN
2,421,615,947 *FFE881F0FC57F592E0779745E2C2D5F7E8783F90 rwin-delos-reyes
2,421,615,948 *FFEAFE75DF7089FD2E454543DCA2CCB8B002905F RODNEY.GROTHOFF
2,421,615,949 *FFEFD35EF3BFD0005139B35E343FE7F5F8CB0FFF RYANBOLLIER
2,421,615,950 *FFE4158EEFA829E00533FE53805B89717F8DCE0C s3gnor41
2,421,615,951 *FFE4873830D207F9586B82DB03B5430FC5D46DB9 SABRAJACKSON
2,421,615,952 *FFEFA385A6E4DC4F761124E6CAF1547F07764D7E S’AFFACCIANO
2,421,615,953 *FFEDEBD7BD122E7C6164F4676AB61A230766BEDC SAHDEVDESAI
2,421,615,954 *FFECC16348B37614841D92B918FC0873D3CD1288 ronnie.matlala
2,421,615,955 *FFE105FFD3D1D8736B678A5EBFED789DEB3F41FB ROSELIESED
2,421,615,956 *FFE046FABE117E647E62D432E230247BA9BF987B ROUBION2004
2,421,615,957 *FFE10410579B5EF473727275A6BBB7148387ED27 ROUNDED160
2,421,615,958 *FFE4D8548559D79619F5A2E5DF503F33E59AA154 sancharihalder
2,421,615,959 *FFE184BEDEFF8F2748E5DA52A9CA4CD04003AD2F SANFORD.BROGDON
2,421,615,960 *FFE318008AEC9EDB8790C9C5E778775AEA1E3EA2 RSG1971
2,421,615,961 *FFE5A1DEB81D205E13E0A3E12637529438E29A47 SANJA.MACURA
2,421,615,962 *FFEE5C34281C0BBDF54D3B61C0A8BAD07DE81BC5 RUJEXOVE
2,421,615,963 *FFEF52B34F984A8B54353598C04291D7D42CF0F5 SAULHAMMETTE
2,421,615,964 *FFE0397B61D2778A60FE9A52A693F1F0B6DBBBCB ruperthurlston
2,421,615,965 *FFEAE31E7B897208AF795B1B0FD4E7EA67E44864 [email protected]
2,421,615,966 *FFEC69A140A95A064F7BDE3A487CB0CBF73B894F SBIBD
2,421,615,967 *FFED6C498C5B011418C1AB817DF11AF5F690B58B SCHRANERED
2,421,615,968 *FFEC3EADC104CF0889B9E9570947FBA79EA138D7 SCHTIGERS
2,421,615,969 *FFE00CC22A46CA81868FB563455BD73F3DBF4701 SCONFORTS
2,421,615,970 *FFE49D4C03981A77F7CE0E6909E2DC992AA041A5 SCOTCHLAUREN2
2,421,615,971 *FFE83C3A7ECE84BCDC1619B20760DCA81A73B4F6 SCOTTIEMARZEC
2,421,615,972 *FFE368121825E02FA7821A3A113064E10D48A9B7 Scotty-Tabachnik
2,421,615,973 *FFE0F7E17F5B0BB57EF2A68FFEC9FF03D60E57B8 [email protected]
2,421,615,974 *FFE43E153187487494B0A53221C9E9E0E19BF511 sealer7
2,421,615,975 *FFEA0C2DFBE98F9222633BB422C948D60EC65E1F SAMELONEKNIGHT
2,421,615,976 *FFE31B9D13EDCC9102EFAF40E8C4B2F50285980E SECITTAL2
2,421,615,977 *FFE0B6A7FC2EE4710E2B4D9BCFA2BBC34B91EE75 SEDARAP2
2,421,615,978 *FFE5CD13A45FEBA2B3FEE9E4B7627F1C40BFAE22 SANACHEM0
2,421,615,979 *FFEBB3142C7CAD9CB05CE8ADBDCD007E060D4790 sanctuaryhb
2,421,615,980 *FFE4BC8F2ACF65AB2091F09770E4415CE872B7ED SANGIUSEPPECABURLOTTO
2,421,615,981 *FFEC2C81EFA647A80449F1FB12F639A2DA8598F6 SENENVANGOLATAK
2,421,615,982 *FFE3E1E70D96E0B74B2C79727FA75B1387CA096F SAPINEAS
2,421,615,983 *FFEE333D03A234C5351CDE8B7725FCFACF08B28D SAULBRUNNETT
2,421,615,984 *FFE89CDC80C3EFE8F34A89B8AD88412B691430BB SETSURBMOELADNAKS
2,421,615,985 *FFECACAC03BAA364CF7D562580FD10FE76176A1E seymourgandert
2,421,615,986 *FFE0AA63A180AE248644687E01AB006F2C8A34E2 SCH00L+IME
2,421,615,987 *FFE2ED1BA74AA209845EB962802AC986BB6DB1DC SHAHID.CHANNA
2,421,615,988 *FFED66D3B81734E48D7D8F89468D155EEEE47A35 SCHEMITZUN
2,421,615,989 *FFE7F7C25828A95FD4E72DA6EF6EFCBC82712CE1 shaunpullens
2,421,615,990 *FFEC041D7F601EEDFE4BDA3573E2DB66E4C0CCD7 sheba20071
2,421,615,991 *FFE8586C569E49F87E2AF445E33B0B627103843E SHËNDOSHA
2,421,615,992 *FFE180C6FBB8BC9133AEE8F915AFA9C4060FFA69 SEAN.KINGSFORD
2,421,615,993 *FFEBD2032462F742D87087B5E428F9663B16BC8D SEANMCPARLAND
2,421,615,994 *FFEB1C84587F0FB7D81442822CD13E97DA8D5AC0 şelaleli
2,421,615,995 *FFECAE70501DE26E54C332AB2FECA66B8DBF5422 SENAAMH
2,421,615,996 *FFE462E13D6123F7D531BEDEC4E752586C8C80AE SERGIO.SANTOS
2,421,615,997 *FFE1D95B9271B1B51421D3DDEA97951C62F233DD SIMON.REIFLER
2,421,615,998 *FFE8C54EFBA42761AA08077D2DCFC75AEB3E0773 setoirga0
2,421,615,999 *FFE48F4DF442C5A8679332062E22C42BFACD9A28 sittings
2,421,616,000 *FFE061FC7E88F6F3849CF14BCB018A861AA7F1B8 SKIRMAGESING
2,421,616,001 *FFE4570361C2CA1A2192781F46B7A99EE296C9D5 SL001863
2,421,616,002 *FFE5C8EB31B4AD04B9C0D23B8C862BC7E465B197 SLIBNEJSIHO8
2,421,616,003 *FFE1013996B9DF554067B78CB62C2202FC177793 SLIMSTER22
2,421,616,004 *FFEF0FE5662220308020C40055B4DA390952A46B SHELDONMALLIA
2,421,616,005 *FFE333E656D8FDFE9B0627E72717316DE44F45B0 SHELLIANNA
2,421,616,006 *FFED684588546245EB5C5A9E590805C59DA85017 SHON.KINNA
2,421,616,007 *FFE6E59178FEFC33BAD83C49860D31ED363D377C shraves1
2,421,616,008 *FFE549A1F8B28D775BD806D8FBC5EC36D59B95C4 SidewalksoftheGhetto
2,421,616,009 *FFE3F96F037AC2C4F84C1A22A30F7D8792B2DA26 SIKULAPI3
2,421,616,010 *FFE85E9AC832B4F96F448593891D8AFE316CAEA5 Sophies.Blues
2,421,616,011 *FFE4F263284CB3E1EFA1DD7BA43F6C39C22012B7 SOUTHAUSTRALIANLEGISLATIVECOUNCILUPDATE
2,421,616,012 *FFEF4B928B0F15CF7BC09D33667343E7962B3584 SKULBERGS
2,421,616,013 *FFE69802469C8DA05CB2D0861C9248FDA154D57C SLEKNIWSRETTURGS
2,421,616,014 *FFE434E3E3BD84B809C3D8E52504711DD403613A splat*.*(####3
2,421,616,015 *FFE4FFFC17C2773C593EC7CB55DB03BC0E10C47E SMARTQ7
2,421,616,016 *FFE6A7136435CA712BD180BFDEF3D179FC87484A Splat o~O~q--B
2,421,616,017 *FFE69AC8F6FD3C9DB1C1EA1F77FA9EB296E69588 srehctefed
2,421,616,018 *FFEB3E350A6007A56A15A054B515ABB519E6E073 stanleybabst
2,421,616,019 *FFE3368F4133F1CFDA3578D50AA899B66D750F25 STANTON.CERRA
2,421,616,020 *FFE40632696A001DA970F9FCC3AB250CD36256AF STEFAN.BELAK
2,421,616,021 *FFE50C7A30F5382EDAE49870722E7F4A0E7C685F splat***<##P
2,421,616,022 *FFEE5C3261AA5D92FDD840A53DB7792017AC7ACB splintert
2,421,616,023 *FFE6CF31F2BA4365F372D8D652BE798A30872E48 stvalentine
2,421,616,024 *FFE02F19A17592BDE4320E75937CD51A41C0F538 STANOVNICI0
2,421,616,025 *FFE2A9FEC0FF4C243E62E887A39020A4F79BCEBB SUE4
2,421,616,026 *FFEEB855C4C4367505F6127BDDB412B0B3D6B762 SUPPORTITALIA6
2,421,616,027 *FFEB905BE6CDBF5ADB614B40D6AAD961F7A5D02A STEVEN-M-CUMMINGS
2,421,616,028 *FFE93D201826213A9EA8BDBFF675D391BFAFE3B9 stillnew1
2,421,616,029 *FFE799FCBD5C93D857C9705573C8D6A0184F249D swiftt
2,421,616,030 *FFE174D6F551AE961DD75D9F21C6F10C0AEBEFB3 SUFFICIENCIESES5
2,421,616,031 *FFE020B972CE1D87725D80277638FA644A696402 [email protected]
2,421,616,032 *FFE81BA7C50DD549F6A8265B455CC6928FBA279D tabernakelkonsole
2,421,616,033 *FFE69924263BED4D71F62E6719465F936EF0C4D1 tamamonomae's
2,421,616,034 *FFEC24F6033E587F596E50FFD914471353A2707B swa11ow-t
2,421,616,035 *FFED2A259D5DC7CEE3FC77595D064567F10B3E6E SYLVESTERMROZINSKI
2,421,616,036 *FFE9E184049D6669F416BEC18E5EA1B6241E8F32 symphonyno.5incminor,op.67,fourthmovement(2of8)
2,421,616,037 *FFE2C55DA85D562D62624A48E1C5C4623ABC3C86 tabibtabib
2,421,616,038 *FFEEAFE7CC8CF0CA81378BB5F5F0D9A3179D6989 TAG180
2,421,616,039 *FFE848A9F939E5B24A2A4C2F37A4525E25C55462 teodorolindert
2,421,616,040 *FFE845D3DE1187E7D9DDF3A2F915620A77EF07E6 TALADRADOS8
2,421,616,041 *FFE8E7268F8C1B45ABAA03943453240394D8C327 TALKAKAIGUMO
2,421,616,042 *FFEF036644F239E7D8C6B813E38A922DEA8957C7 TALKDAVIDGILES
2,421,616,043 *FFE86DBFE39403F900C24505FD9477050959BA5F TALOMRAADE9
2,421,616,044 *FFE5F35DA8E7B1474E2D8FF75F3F704E6B06D0A0 thaddeuslaurange
2,421,616,045 *FFEE79C8439B22876A2D106AC714AEC85458BC6F tangoblondie
2,421,616,046 *FFE7FF8E521A4303AABC38097A3FF57321304A8F THEBESTOF1980-1990,VOLUME8
2,421,616,047 *FFE07651D64E520C50F51E6A02F47A36A7E58FCC THE BEST OF BOTH WORLDS (2009 MOVIE MIX)
2,421,616,048 *FFE03F6B455DF1DE70424778D4C51D247051B0CD thedistring
2,421,616,049 *FFEB9E1CEF31AB1E636D21A0661C31D9483CA4D5 theonaggressiontoptwenty
2,421,616,050 *FFE2FDC4DA1F08CF48D055BF0FF475197966AEA0 THEREALBEGINER
2,421,616,051 *FFEF93B4EB37E018CCC4B57700DB0439F00EE4DA THETIGERMAN
2,421,616,052 *FFE2A8143EFA0EC75A2AF502EB2245F3C3D0D285 thumperzebra
2,421,616,053 *FFE6249BC6891A08AE2D790FB72BCE90EF93F262 [email protected]#
2,421,616,054 *FFE9BDF43BA44ED018F8DB17899A91117CC6F9A0 [email protected]
2,421,616,055 *FFE420A760282B8D5CF4498E0E141B4423BB0390 THE BARDEN CORPORATION (UK) LTD | UNITED KINGDOM
2,421,616,056 *FFE0BE4B97384C15C5450CC8229AA551FCBF5DB3 TIMOTHYSYMBOL5
2,421,616,057 *FFE39629887AC6CEF6F27AE7EC10FFABFEB47EE1 the-chandelles
2,421,616,058 *FFEEE936BDADFC9CE99BBCDE3DCCE5E36FD15B9B THEMILES63
2,421,616,059 *FFE1520DA55A2F0A9BCAB91737DDD7D74FA243AD THE.MILKCOW
2,421,616,060 *FFE4E45D71369C4799BD829CC4E10862FECB1EE7 THEOBRADISH
2,421,616,061 *FFE1490B8554FDDE1376359FE8EA868B4C458263 ThePlan(Beanfieldremix)
2,421,616,062 *FFEB9EFD459F79544A1528884496C472B9D9E7A5 TOIMISTOVKE8
2,421,616,063 *FFEFF956803B14E0BA790A0B119D5E8D17A5A28A tokkie-brits
2,421,616,064 *FFE70CF3A9A4565EAFC96C53146D3BE92E459F2C THE STALLION'S DREAM
2,421,616,065 *FFED1EA8EBD3BCF220C0EA2FBE18BE86C2D8B75C THUNDERA2
2,421,616,066 *FFEFE66D3DC17C27DAC85900364692F862CC1470 TORTANK4
2,421,616,067 *FFEBD8C5E0064E071F8175AFAF29CE0AA4EE23C8 tickprooves
2,421,616,068 *FFEEB68AA6D65ABA36469B42CBEA8C7C8CE3BE2D TP|X
2,421,616,069 *FFE9477C8161CB14045F551E15E45FFF7F1EEBD9 timmyzawadzki
2,421,616,070 *FFE7C6799BF9AFBC38D900CEFB322A9DBC67600F TITUSHESCHKE
2,421,616,071 *FFE23F76F0BF57BEB93C3B593D20CFC9242447F1 tlemuab2
2,421,616,072 *FFEF0894C235BADB052ADA6CC4C0F72C88DC9782 TMELTZERCOMWWW
2,421,616,073 *FFE0E5B0B037F62683695CB78CA7ABD5F38BFDAA TREYSPEECE
2,421,616,074 *FFECB146A4A2FC70B08360A51B36F00A56B47C90 TOBIAS.SUNS
2,421,616,075 *FFE3CB81318A59963BA0F5BDBF718B081FB04122 TRIPOTSES3
2,421,616,076 *FFE27DDCE589108D080C1226F81CDD1CD84EEEDE TRISHA BRANTLEY
2,421,616,077 *FFED7385FA02D371923B93C44D9AAD821FA32936 TROVASES6
2,421,616,078 *FFE684084C02C79A33F0B16A2179A6EF52993CC1 TONYVIEJO
2,421,616,079 *FFED6D3C86068E7586A899DC48B18537BE03AE45 TSHOKWE5
2,421,616,080 *FFED1300AAD800B13F22D860B3E2E28AC0EAE7D6 TRACY.LEESON
2,421,616,081 *FFE5CD0EDC944B136847C81FAC4D6FE1324CEAEE tulpenbedden1
2,421,616,082 *FFE443E8D82F5A1D51014ABF0DBF40D380DE7606 turtelusing
2,421,616,083 *FFE93A42A2DA7901E513B66DBCA3541A63175A55 TVGTBSW5
2,421,616,084 *FFE513C21112BAE9D1099848F3FB3D28A1C10C3D twilos
2,421,616,085 *FFE4986AD617DCBD70118CDB45F777774D068059 tylerfloyd
2,421,616,086 *FFE32C6585797A3267F7C4147D1B7C0634C5B381 tyronciarlo
2,421,616,087 *FFE6D2E00C7E91022D48279394AD4D8C73A8EE50 trigonella9
2,421,616,088 *FFE1952A90366E6DE35F6DC858209D4D0C373261 uclw
2,421,616,089 *FFED02E9A08B3950498BE841A4C015103E30BF59 UDSTYKNINGSPLANERNES2
2,421,616,090 *FFE581202A4F3FAF98DA95E8F134802E5B7A4625 ujas
2,421,616,091 *FFE167E33C682D418529B0676172A0D1A8A46025 TTTTTTTTHHHHHHHHEEEE
2,421,616,092 *FFE22EE7D70B0567C1C894D2FED9739A101DDF53 UNALLEGORICALS6
2,421,616,093 *FFE23EEF5E88186506216371CACD3D96298C2332 tulosdemermaidmelody
2,421,616,094 *FFE3DAA878A5C22A41A9050F60A7177F17121270 [email protected]
2,421,616,095 *FFEDDC6A4C540D1D5B8E2DEFC05E54302ACE0F9E TUSHAR DHARANWAR TUSHAR
2,421,616,096 *FFE768152236FC2866783031247ED8CC6352B828 TUUSLARIDE
2,421,616,097 *FFECAEF5E02B1BB7FE148A23ABA2780961D97A6F TWO-IMPORTANT-PAULS
2,421,616,098 *FFE177FE5B8AA08BC89BD11ABEFED8FE3C9AD12A [email protected]
2,421,616,099 *FFED4B0A961638933F6B09A93C42CBC6405A0AC8 UNPEREMPTORIL2
2,421,616,100 *FFEF958A88E603D11BAC946D7788C4BF033A77D4 [email protected]
2,421,616,101 *FFE899F126844AB61CA3868E641F969D20273CC8 UITZAG6
2,421,616,102 *FFE102460764AC911F678B03420FD834DCE7139A ULTIMATE REGGAE (DISC 2)
2,421,616,103 *FFE2A54E82DB6CED2A4A0BD8F7462FBA3ED5ED82 [email protected]
2,421,616,104 *FFEFB3A67952543EF10933996851512DF45EE343 UnbearableLightness
2,421,616,105 *FFEC4F48EB3272EF1B7A7E5421D519522CD0DEE4 VALBOSCASSI
2,421,616,106 *FFEF009EBE3A7D0F3C2B974C9BC446884CA62A43 UNTERSCHIE0D
2,421,616,107 *FFEDCE0A09FE65384C5D8F87BA8378A386C86711 upa2006
2,421,616,108 *FFE3B5661FB49FC8E018261BB70889A027A2A5EF VASPASYANING
2,421,616,109 *FFE146136695EDB0488113365822CABB347D9FB0 [email protected]
2,421,616,110 *FFE7F5B268EC136537EB9A7714DDEE84311EB89B UR1NO9EN1TAL
2,421,616,111 *FFE47F79262B1B3703132F5B4B23BC86EB8CD054 VDAMAYATI
2,421,616,112 *FFEB12D6D2C3923E186332EB5D7C8D1FBD483258 user691401665
2,421,616,113 *FFE229541CEFC46A29591AACF1CC4033266F774B USERKATO2K6SANDBOX
2,421,616,114 *FFEF6E670D486A89D537815D7A83A2C273ED1167 usiromaing
2,421,616,115 *FFEEC495B83CD5E4F1E4B0356005FE8AF666EEB6 VERI KASI
2,421,616,116 *FFE138A3D3C156E4F2220EACDD83F7E0ACFABFC3 UXYOWDVSFPXTED
2,421,616,117 *FFE92866518D136F4E5051B046B419A8733A6EFA VERRIE WILKINS
2,421,616,118 *FFEC02A63F4B0D89280AC6874DE6F2FE217B55EB VICTORIAN.WELSH
2,421,616,119 *FFE6BC5DB24BFF443A45A531D2AB469B02437F28 valiaev
2,421,616,120 *FFE3249A479CA3D404000A106F41EC36B9635388 VINKAISTAKIN
2,421,616,121 *FFEC25EF9A520B950D9F4F1EB0DBD99962D2DBF8 vinodkumar-pagadala
2,421,616,122 *FFE765691FF3879E320E1EE1D43B28AE74A92C91 viny-vineeta
2,421,616,123 *FFEB520509E1084A669B8B5C7EEC17CFA625260F VARUSTEINA9
2,421,616,124 *FFEA6A2A361D53D0CBE30A7132FCA67D50D73912 ViolinConcertoNo2inEminor,BWV1042:IIAdagio
2,421,616,125 *FFE99A55973B37D3C6DA30D0A710DAD8A81A3DFB VISAGHOST1
2,421,616,126 *FFE5CDFC5F9EC925FC41D0E2B3465218CA1221DB VITO.MANGOGNA
2,421,616,127 *FFE1663138B3B869F133F685BBED87596AB9C754 VITTORIOPONTICELLI
2,421,616,128 *FFEEEC2A2EEDCE100A9469DAA4A7F1BAB2555B7C VERBASTERT4
2,421,616,129 *FFEAF16CA5C4B6C2E7F592844AAE10C188D39EBC vuphucnghiemphucnghiem
2,421,616,130 *FFE8A883B55CECEFB8A243274CFC88790A1EAF36 W473R1O95
2,421,616,131 *FFED5162BF76A008B68909CA980A25ABDA368567 VICTORNANSTEEL
2,421,616,132 *FFE3EF2BF61C820E14941FDBE4C95CDD66308B34 [email protected]
2,421,616,133 *FFEE6A2B5B33C9B5920026D1F06883040B945D5A WA5H1NGTON1AN
2,421,616,134 *FFE8E9E4D84727501A76991B4E58EA14D09DD89D [email protected]
2,421,616,135 *FFEFB8121F5A75B5DEA859CDA359825248EEB0BA VIOLINSONATAING,K379:IIALLEGRO
2,421,616,136 *FFE84DFEEB553FFBE2282E40DE5A7DF7CE6E5B3B VIPMEMBER09
2,421,616,137 *FFE1121875A19737DB2BF6E8E58D3B8A24453D80 VIRGINIALESPINOZAFERNANDEZ
2,421,616,138 *FFE2B9A8F367B587D8A9981A44BA7401ED2E2135 WARDGUNTRUM
2,421,616,139 *FFE2000811D6F36332238E69F6D08588768B37D7 vitamink3
2,421,616,140 *FFE6FE05F2B576B46B2202A25353F9E0303E055D wawa-sunijawati
2,421,616,141 *FFE8D602680B7C7418555A267CD50F0BF4E60DCE WAYFUNCTION
2,421,616,142 *FFE6A0B9E146A5FC583D3AD74B14E5DC5ED6BE97 VNCURTEYS3
2,421,616,143 *FFE79D9E8D768C83805620FBDB5D60BB90324FEC VNHURTE6
2,421,616,144 *FFEE08A027ECD99B6427FC293370355327DD7C5E VOLUMERE4
2,421,616,145 *FFE56747F4E87C1947D73171B8BD60792FD434C0 werbinzgd3
2,421,616,146 *FFE8AEAE7CA6F0F04885A8FB5536627F0309B1D7 WAFASIER
2,421,616,147 *FFEA223356FE010E898904CDF8D0FF19270C2862 ...-whatchulookinat-(full-intention-club-mix)
2,421,616,148 *FFEEC17780418DF6CFBDF637441ED447CD56088F WALTER P INGALLA
2,421,616,149 *FFEC69796F2E3DCFAF8BD4E59DBB9D7FAC76B522 [email protected]
2,421,616,150 *FFEB4EE913E4BA875B65383DEFE0AF1F91D9EBA8 wilbur.bleckinger
2,421,616,151 *FFE2B29376F7E80BD8F084A93FD84D377C7EFD08 WILDEBLOOD.3
2,421,616,152 *FFE6ABD7514D2A30C07D8935FE31AB13E2618444 WANNA.BE.MORE
2,421,616,153 *FFE027D9ABEAF76514FD9ECC14E8E35303A08539 WILLCH
2,421,616,154 *FFE60C8B7EB63EF42F7B09E2ECC0CD840B203969 WASSEM MASALHA
2,421,616,155 *FFE1BBF8A75E209277AB86BAA791FF8F8BF6745E WILLIAM TAHTINEN
2,421,616,156 *FFE4DAACEDE1FC2B8BD413B43BC4678CEB3ECAB9 WAYLONBAINE
2,421,616,157 *FFEC745BF652F802E106B0E073599F35BD6053EB WILMA ALICE LINKLATER
2,421,616,158 *FFE7FA18443C428B60C3919E3C4706482D5D3A97 WILMO-VIRAY
2,421,616,159 *FFEB3FB79701BF64935DF77B15D424C5A051312F weanwean0
2,421,616,160 *FFE8090AD585473B7B7AE8500E52E3BE2952CF68 WEIZENSUPPE
2,421,616,161 *FFE63CD3DC7C5110D974A361AF54D24910BF246F WE KIXIN' IT (FEAT RON RON & THE CHOPPER)
2,421,616,162 *FFE377397CF3439C761BBB57961BDA00FA6FA420 WLMIDEK8
2,421,616,163 *FFE784A80573749EADF94271BA14F28FA18FE4C4 WQXZWXVS2N
2,421,616,164 *FFEA8DAF3DCF6967135045F2BA6871634CE929BE wsfd1234e1c4b69f30ea53e41001031ab64749ba.html
2,421,616,165 *FFE698AD38CA7E7E89100B9F63EAE10C3307F64E WHAT'S I'M GOTCHA
2,421,616,166 *FFE7D03183EDB6B9EE9139E552B5965573CE033C wwwbiotacomau
2,421,616,167 *FFE25A27880B14650E3131B31189E3D14CF6678C WIEE
2,421,616,168 *FFE3C08695BB02B91AF595FCE543205628CDDD58 wynnie
2,421,616,169 *FFE91356477E72B248E402B8608F6563A047A4B0 {X}*@#3
2,421,616,170 *FFE88AA03F548ECAD8CDA2FFE912D219AF432708 XIEZHAOQIN
2,421,616,171 *FFE8C3EDE1A98696FEC586A2B6BA1060D2993A06 xudianwa
2,421,616,172 *FFE2CA20F026BB1708971BD114E408AF9FBE87FF wordcraft
2,421,616,173 *FFE70D2E205B6B9C1B96D2D4EF7C6032D239DFA5 YANET ACEVEDO
2,421,616,174 *FFE73D1E3A057B71B42F4F7A94DB6727CDC0A309 [email protected]
2,421,616,175 *FFED8414E850FA4B242081A6BAF52C6AA150EF8E [email protected]
2,421,616,176 *FFECAA3E0F181FDBE0B4415804D408985DFB7604 [email protected]
2,421,616,177 *FFE8F1837D8EEC3283597FCE3E14F59170D34F0A YANIRA-RIVERA-HARICH
2,421,616,178 *FFE20776B39908BF89C9A57688B5071B4CE67D70 WWW.WORLDTREASURES.ORG
2,421,616,179 *FFE76BDCD1BCBFD7C09BE2EA9FC0E1B12EEE9079 YEN-SUGIYAMA
2,421,616,180 *FFE0AC970E866E1EF8A840813EDE115D56E72C53 [email protected]
2,421,616,181 *FFE8630408D4BBE39F37D352317C6F15AC985B16 x4$h
2,421,616,182 *FFEB8E14752B22988DCEB0FB668DCBFE0F3F6B54 ylpeyshän
2,421,616,183 *FFE2BB9E54277A106C955283F3A7A2FAE3A9E570 YOBWOCDROF
2,421,616,184 *FFE916A6606A02D3CF99A936E439F178B03DF9F6 young.matson
2,421,616,185 *FFE209BC2C3155AF3E94F3230CBBDD929C2D3009 YURIDIA-JANET-MEDINA-ARELLANO
2,421,616,186 *FFE64F0296C94DD91643BFE16F2AFD981EFA455E YANAMANDRAVENKATESWARLU
2,421,616,187 *FFE8FC735F7F10829B9CE97449A9F608688B2041 ZAGORCED
2,421,616,188 *FFE890FA37E366C0B7AA6CF56CC5579B158D97C6 YEVGENIA8
2,421,616,189 *FFE086EE81E3FECF1CB123A39707D56D83D92A78 ZERPFLCKTER1
2,421,616,190 *FFE2B70554B56457873EFCE126B518D137AA90D3 YOLANDABURNELL
2,421,616,191 *FFE6C5DB89B698EE63CA80307F3FBDF8A59B199A ysngpelf7
2,421,616,192 *FFEE193595FACDAAE2FA05D4DE4E29122F0A9D3F [email protected]
2,421,616,193 *FFE1FF52AB797E55D1DDB8BC4491F6F1A974ECFE ZACHFORLANO
2,421,616,194 *FFE056A379EB2D9F538804B126E64CDBAD0BC854 zackbigboiamini
2,421,616,195 *FFE9B313762FF05AD71487120080AD5D3BB3CAE4 [email protected]
2,421,616,196 *FFE354A25018494B54388A3B43676CACD6E0E624 ZCYP
2,421,616,197 *FFEFC74D9B028DAA7D69E0E6667D69ACCDEDA811 ZETIAZYYTIE
2,421,616,198 *FFE80C7E417B507F2F13451E36CA70EB50E55F12 [email protected]
2,421,616,199 *FFE1F076354081C95AD012F76646DC585BBC0E1E ВЫПОЛНЕНННЫЕ
2,421,616,200 *FFEE5261720A7B9B9F098D69BAD91800881C9BA7 zia-ud-din-jamal
2,421,616,201 *FFEF14A497E136F927E9754CC63ED4EF97C96B03 КАЗДОЯ
2,421,616,202 *FFE87B98F564CECFACA94D7ED130D73C236421BF КУНГЛИГА
2,421,616,203 *FFEAC4D12F3FC2E3BCD5FF8CFA404BB2EE9E1926 ЛЯНКАРАНЧАЙ
2,421,616,204 *FFE4668F10C68639D801710CE9BA07FAC4565C54 мојмирове
2,421,616,205 *FFE3E2E5DD146C49D6703040117B3FF22C5454C8 НІШАНОВ
2,421,616,206 *FFEDA3FEC1370B4E87FCCA9E2A41281CE8BA52A5 [email protected]
2,421,616,207 *FFE36604EA57BED7EB880E53F5588BEB7FC925A7 ZUREREGEN
2,421,616,208 *FFEB5FA06FA1A3086FE28DD8D3BFAECA3B39D30C СИРХА́ЕВ
2,421,616,209 *FFE1E57A8E049869A9B1DB14E3D5FB4A72A9FF08 социjалистиска
2,421,616,210 *FFED7A4366CE7E5D539A5558E4FA6C7466155F39 харчей
2,421,616,211 *FFEB75550863BD1B7E77BA04EA80E4FD176C5F0C ЦИЋ
2,421,616,212 *FFE6753E41795BA3DB8F5CFDE14732F6DC8B06D1 ВИЈАЧАНИМА
2,421,616,213 *FFE83FC3D6656616E6F705ECF3AA3027484DD372 «ЗАИКА»
2,421,616,214 *FFE778706A333D13B0F26E6113FC42E14B93A2AA НЕОКЕСАР
2,421,616,215 *FFE7B17B9EB204EE293AB3BCB7CC5146C24EB7D3 ПОРУШЕНЯХ
2,421,616,216 *FFED859CFEC5629D2012ECA6EC0B8374D7AA019F СИ́МОНА
2,421,616,217 *FFEEDDA90E3E803C02B6156B1C49D9D2C9768390 СИСИЛЬЕЙ
2,421,616,218 *FFECE564F8491E4612771E8A090CDF8E90DA2A91 СУМАТРАНСКОЙ
2,421,616,219 *FFEE75C074A9B0CAE95A0A30CBF47704BE96EDC1 等の公式映像作品は発売されていないが、dvd『ノッポさんが選んだ完全保存版
2,421,616,220 *FFEB641CE3DB74695AB10BED78B3DF567D78B655 «холм
2,421,616,221 *FFE8D43BD8B0E4DB3D8E21F6FE80F0A7A8BB6EA9 03141624
2,421,616,222 *FFED0DF17B190A0693B50A3D74C2C1B11BE1F0CD 104HEZEKIAH
2,421,616,223 *FFE2ADE452E76E6D5FB5AE85ECB44114349C898F 10VEROV
2,421,616,224 *FFE48F4F63C6F40F941B7EAAC6B8772E65CCAAAF 1152373 RAVAINDEKSI.KOOSTUU.KYSYMYKSIST
2,421,616,225 *FFEB28746CD3E53FCBDD2D901EEF0C41BE1AEFFD 1283482 valmiille ryhmille ( 410 henkil
2,421,616,226 *FFECF5C3CD680D090584444B1CA894F92A86622D 12FEB1874
2,421,616,227 *FFE7D2DA350B19DAA3158563966F0C91FFC1F26D 1360859 MASENNUS-ALKAA-USEIN-ILMAN-MIT
2,421,616,228 *FFE5DF97C7185A6C56D34FC4E11CCEF52CD7E54A 1427724 JETZTHABENWIRUNSERERUHE."
2,421,616,229 *FFE67D1C40097C9EC64B5583CBA6959F3C04182F [email protected]
2,421,616,230 *FFE7A21487087B00A0646711ACFB615054DDB528 15 HENKIL
2,421,616,231 *FFE83D48F3F257483B98E893F26BE53535D1EF2B (0-0)~`d---P
2,421,616,232 *FFE0F97848ACDF5751EFB683E3F79FD6F690D78B 1-BUZULDUGU
2,421,616,233 *FFE42799DACF5DA79BDD72331CE0B473E27267EB 1.cortezthough
2,421,616,234 *FFE4AB2647C8E341FD2464018155AB27EC7CF894 044richard
2,421,616,235 *FFEFE47D3C3B5038D737658A7B54832D53927FE1 1DRCSTRY
2,421,616,236 *FFEB4CBC1FE9F8D1F7B965C591B96C2875FCD6B2 1ETNAGREV
2,421,616,237 *FFE0F8F073ED46922136B698B30AD1DC3D71DD5E 1-fahnenmeers
2,421,616,238 *FFE2911B2E5462C6581444C6E908535E3C022109 1GERDARSAFNIN
2,421,616,239 *FFEAACAE769994457BCF945E22E23B09C00DF5EF 1-GURDUS
2,421,616,240 *FFE3DBB665D426BBA82506CC4CDB5DBA45316F4F 1-HAMMASHUOLTAJASTA
2,421,616,241 *FFE6F3A3ABD71E272A9592DAE48569A4F9CCD486 (_0).~.`[email protected]
2,421,616,242 *FFE734E77AEE315CBFB5B18873A512FB5F57211E 1-internet-l
2,421,616,243 *FFEFB1EA13F62F1D901A1EFCFAEE01B6AB300D99 (>_<)[email protected]#####p
2,421,616,244 *FFE538E53E928EBCE7C9F850FD89336EEFF47596 0PH171$M
2,421,616,245 *FFEFD2DEFDD0B63E000B7F1B72867B7BFCE3968B (_0).*.*.*@###q
2,421,616,246 *FFE4462C8D57ADE5224B79567C510012DCFD7FD9 0THATFACULTY9
2,421,616,247 *FFEE59E20F3DDF71A3B4F3C2D2146D6E87C304D6 1-LEADER-KRITEEREIHIN
2,421,616,248 *FFEA1753322D8A15361F7986364B0F0A8F22E11B 1.LITHOGRAPHIEUNIKATE
2,421,616,249 *FFEAE09D3CDE946A67C478D2E9F9077A9B200561 1myintrepid7
2,421,616,250 *FFED1F326A0ED364464F665132A9790B2D5F027E 1NUORISOASIAINKESKUKSEN
2,421,616,251 *FFE8BC7EE4561F580CACC34108BA78FAB7A63772 1.onaylatIlmalI
2,421,616,252 *FFE8E1E4EE9C9939054D789DBA568571B6AAD2FF 14.05.1563
2,421,616,253 *FFE3D26AD6299B95D10B0BC02C9D75373A6E5C03 1.teilveraeussern
2,421,616,254 *FFE6829C3A1BD35419E706F2DF4D22ED564E651A 1907953 " I JUST USED VERY POOR JUDGMENT .
2,421,616,255 *FFE2127592C6DF5D41930E9B0178E9330C2C94A1 19701804
2,421,616,256 *FFE777772B82638DEDEA3CA67585412EC8E3D4D6 19a2f61fc16b3cc08d8e454d576d8eab
2,421,616,257 *FFEF53CC41D6DF88C0E01FC11C6D3B590CF72F29 1yux6opk2o27r0i
2,421,616,258 *FFEE2268442FDB27318F5AF550929BD466501290 1-ADVEKSIYONA
2,421,616,259 *FFE874BCB5FF79F8211508F93111541C2DDC9574 2008122714252621HAIFAMOSQUE
2,421,616,260 *FFE46D4707E345D968ED932E9AC93CFBD3C2A84C 20KURATEL
2,421,616,261 *FFE2DEA97089D3C2DB0885508FCDA6E2FC726C37 2131210 his.will.handle.organizational.issues..
2,421,616,262 *FFE1E5F365EF8358A859182E882DE4AD6ACDE07B 1BOSSKATHY
2,421,616,263 *FFE3172E0C2EB8DCC64F6137CA08076262BC61CB 2332171 SEN J
2,421,616,264 *FFEBF5D4D891A2CBFD8BE9DBCD79D349F52CEB06 2463806 it-ura-:-hs-yhteisty
2,421,616,265 *FFEBBF5781A16BCB0C77E7DC197072B850A2A6BC 1ETIERBTS
2,421,616,266 *FFED409E843AEEDC051CC90FD01BC3CBF50A386D 2509TC
2,421,616,267 *FFE7B17088D5FD3C66111AB76B6D35963E03741A 26.09.1787
2,421,616,268 *FFEB2C96AD162284AF70178F225BE0727E061AEF 2797114 p
2,421,616,269 *FFE2541A998B16A13A3609B5BA8D0E21F9A7EEE6 1.HILLYARD
2,421,616,270 *FFE883B493DD6EC747F04E9F4EC97ED69D9D8597 2801278 the-bulkheads-cracked-,-and-the-sails-tore-.
2,421,616,271 *FFEFDC98AC02BB0DCA10223CA91343AD56597400 1-joensvk
2,421,616,272 *FFE7836124E1BE993C521FE1BBDA1B79E04E0F07 2 ANACRI
2,421,616,273 *FFEC2696F0185FA7257812DDA44E9C1D9445871B 1.karkotusaalto
2,421,616,274 *FFE1549340FDDF0CE401A17DC20FD615A204F383 2BANDENDE
2,421,616,275 *FFE0F2A082DD9863AFD4239F4B4B74036CDFDA4C 1.kIvIrIyor
2,421,616,276 *FFE48A2078C26A8BC719892E14AB656D1ABF115B 1.KLARITROMISININ
2,421,616,277 *FFE62E4649E4C3F07CDAEC887CE17D99B48039CF 1-luettamista
2,421,616,278 *FFE0906B1A7E018E387FA07E56BC747A1FE663CE 1 MAENNERSTRECKE
2,421,616,279 *FFEDA7CE665105CCDFCBEC34350A14F041B75997 2GIVAKTEN
2,421,616,280 *FFE18D90D30BFC7A53BC07A5B87DCBE4D287E08E 1 NEUVOVAPAAEHTOISENA
2,421,616,281 *FFEA0D40D5F412CDDC25653B2E42C46AED6DA2C3 2LAZUURST
2,421,616,282 *FFEB9E5334AB664E35659543861F651A92CF11FB 2mmturnausmaasta
2,421,616,283 *FFEED634B5CB024221412C86FF8328F9A10DCE0C 2-ORMANCILIGINDA
2,421,616,284 *FFEE32B3811E3A74E6BD7533302F4F362959F3EC 2PMPATROL
2,421,616,285 *FFED7B0A72CA256984E6C3BDA7127DBF91FE1319 2.POISRUOVEDEN
2,421,616,286 *FFE893A9EA957ACA7B2876C55137F76BFEE462A2 1.RIKASTUMME
2,421,616,287 *FFE2AD2D7DF1F41FE0D8F69BAEB44E3EC6C49657 1 SAGRA
2,421,616,288 *FFE81799A5E00D731DA9750E9D97C1C552A7A18C 2THESAMSAM9
2,421,616,289 *FFE32D3D17FA6D3AC1BC444A6BFEB943E119F2E9 1sorptionsmaterial
2,421,616,290 *FFEA5F828FF6CED33087E41961228178B2800EEF 1.spiegelelemente
2,421,616,291 *FFE93967B6BCE3D3CA72FA804833383DF40023F2 337142 turkulaispuolustus ei saanut kiinni sein
2,421,616,292 *FFE33D793926C7C5501C5FE30EDB9A9A2C620FBF 38208 p
2,421,616,293 *FFE313B2DC359683780EB550493F47B09AD4D6F5 39veraergern
2,421,616,294 *FFEF1C9ECBA335BDA91C3B67B3E95580F3A02332 3AERDANI
2,421,616,295 *FFE29DC62BF469834C3C441E1DCCFF9874C15F31 1zweigeschossigem
2,421,616,296 *FFE28FD1485CD369C248A84A4AD880A3EECB5F6A 3FF0D4MU5QU3
2,421,616,297 *FFEF0BE27E7E2547819FC322B438DF319436EC21 2132364 jo-yli-60-vuoden-ajan-kest
2,421,616,298 *FFE95CCD5F1B2E5C2668345F09EA0C8093C7FEB2 2160144 BEI UNS IST ES AUFS THALIA ABGEFAHREN .
2,421,616,299 *FFE22C5FC5F9226AB2B1AA869CD4126FB2B18CEB 3iamkarma3
2,421,616,300 *FFE8F28C2198D2EB8ECE8B4BB535BE6DE069898B 3-MAITLAND
2,421,616,301 *FFEC473B2032F5B50FE106D67F0714544B94B381 235824 anestezi.konnektorleri.134oc.de.otoklavlanabilir..
2,421,616,302 *FFE8DB61A8C9403F1A17D45E8FFA3841DDCBAE25 3NTR3G4SS3S
2,421,616,303 *FFEB1C9417BC8A953C9CAC9B08144A5DB9EF06D1 2454198 wolverineownsa45%interestinthewell
2,421,616,304 *FFEC3DE1F1582D0313173F11C882585F0B96E6E2 2509027 ei.ollut.hyv
2,421,616,305 *FFE0B60EDCB3A1EAABBF7C0B80880C82586BB540 251662 THEY-TOLD-HIM-THE-ERODED-HILLS-WERE-BEYOND-HOPE-.
2,421,616,306 *FFE6E418B0DB1406EDEAD855D09AF703500A7CF0 2618941 erilaisten-yhteenpunottujen-kuvien-muodossa-nousevat-el
2,421,616,307 *FFEB725D2F35711FF4425AD70F0BFF5D32438628 3===)`~`~Splat!
2,421,616,308 *FFE6A6AAD05403E3A1487F29176144DEA3E88895 265173-,cm
2,421,616,309 *FFEE8341658FC42281355B7FFAC3D90143E9FECB 2725196 (-x-)-"-northern-exposure-,-"-cbs-,-94-
2,421,616,310 *FFE0FD398F81E1C2F0FC7586D9C2C63E23F00FA0 27december95
2,421,616,311 *FFE60A9A1A45992BE2AA5BC960AA9BBFD191A801 28paikkakuntalaiset
2,421,616,312 *FFE15E3FDC52E9388C55E8CAC44EB604C03C7B9A 28 WOLLITZ
2,421,616,313 *FFEC7B3E012B880A1DCBE79123A12B6215EF204F 2961394 klubikeikoissa-se-yleis
2,421,616,314 *FFE2627AE80CFC030817E18E50EDA5A442FA26BB 476ALANA
2,421,616,315 *FFED70F43C71CDA9271ADC3EE145626C17FF626B 487602 ICH DACHTE , SIE SIND TOT "
2,421,616,316 *FFE96E0E0D87D1177096FC742EE10F10E7688A2B 4dokumenttivalokuvan
2,421,616,317 *FFE71B2671F8B7C6934EAD4D190339CA2CB48584 4-etuselk
2,421,616,318 *FFEB41D6626C092FED325365691F273E25910344 2.FUSSBALLSTADTMEISTERSCHAFT
2,421,616,319 *FFE672DE8CC388E02CDB3C4A7A8FB50CB7B238AB 2.KHIVA
2,421,616,320 *FFE9FEB833775F74152B62E6FE1E16C222353275 4.JOURNALISTEN-VERBANDS
2,421,616,321 *FFE52697FB5ADB491526CD7E8ED48C927B46ED8A 2NEZNALI
2,421,616,322 *FFEAD66D538776D8580A1E42BCD9C2798CF84102 4LPRTOLPBSW
2,421,616,323 *FFE7C5F6CE670B69BF1D45D05E5E6A46934712AA 2 RIEMUKKAINA
2,421,616,324 *FFE4AAF2C883AFA8F580F4906BCD6771CD8192FF 2-SEURAMIEHI
2,421,616,325 *FFEC60A0823B7AD029A2C189D7329ABE407A28C2 2SHOWEST
2,421,616,326 *FFEDFEE070A89E38DDD316D3CBFD964F98624350 2TALOAAN
2,421,616,327 *FFE7954D6A4265F0EEED064D91181CEA3477AE7C 4OESNOERT
2,421,616,328 *FFEE08CEBCAF9A92B578FF0E6075FF893834E049 4PAHCSTAADIDNAK
2,421,616,329 *FFE3AA874941DC5C50FAE8093A88B2D0B0689DC9 4PASSIONTEXAS
2,421,616,330 *FFEEF31D7E585A3D075AB0E5A7A7172DB755D974 4PLTANOS
2,421,616,331 *FFE0695DA7CC706C9A40522C0031A0D04C14C36D 4ROMANISEERDENS
2,421,616,332 *FFEDCD2F4E305B367DFA315C0CB73921EDCE005D 4SCHLKMRDJS
2,421,616,333 *FFEB7A656C77C492117442C61BF1AE0124436008 3> ~0~oSplat!
2,421,616,334 *FFE4C63A7D12B0256889C724ED60F147FCADDF39 4WARBROEKBSW
2,421,616,335 *FFE518CA934430E593F4E535F638A78FEDC5E309 3AVIRTUAL
2,421,616,336 *FFEFC6900C844D974CBC07B93F08856C7D455836 3B<~`(###8
2,421,616,337 *FFE38F2DF3FE1DB67329E71A7271BF6763C03FD8 3 DRAUFGAENGERISCHER
2,421,616,338 *FFE27BEF2541FFCB91FF1CCEC1186F860B4D6DDA 3.ENSIKERTALAISELTA
2,421,616,339 *FFE2790F40961A9AFA3C026AF2BE8F66D610045C 5 ALZAWAHRI
2,421,616,340 *FFE479926131467DF56B15A403D4CBB146896DA7 3HOSTAGE-TAKINGS
2,421,616,341 *FFEDC48B523208FE981A112ADEB2F11601B559A8 5BARULET
2,421,616,342 *FFE7447DC7BA6C080FE71D47B00B9AC01CC6AAB1 5BOSSICEMAN
2,421,616,343 *FFEA4A711E8B62C64EE0D9FB089EADEC76B5B238 5CARDINALBASKETB
2,421,616,344 *FFEB81467588296D429121BF8D1440B0D3D23608 5JKMBULLDOG
2,421,616,345 *FFE5D1944A5ED69752BCEA67B88F099C8A2501C4 4:..4..#..&...bagful
2,421,616,346 *FFEB8223F844A3C2D9876972AAD5F2FC31B886B3 451149 ILCETRAFIKKOMISYONU7UYEDENOLUSUYOR.
2,421,616,347 *FFEDC8A82FB8AAAB4FEFBE38294C072C01E209EC 5LOGGESSEGGOL
2,421,616,348 *FFE671AFD9756521E2D3AABC759ED6BD1CC41790 4CHUKITA
2,421,616,349 *FFE54939E19C2400B7395AF28E41BD0607F8B248 5QUITAMOS
2,421,616,350 *FFEE33D84077EEC324A3DFFF19BA93349440BEC5 4ILOVEUTOPIA
2,421,616,351 *FFE876FC5C9BC7756C52E6F9E2CA8C924A2CA664 5t4mgncqna5
2,421,616,352 *FFE9DA0735BF2F0FB9DFD7F0CB7F62B75DE0D7B1 638MAEVE
2,421,616,353 *FFE655E407D9E92629668F4B136377D6D3C6F80B [email protected]
2,421,616,354 *FFECA6CFA1A2F1F01031243BCE5F6FE340A3B558 6CAROLCASIO
2,421,616,355 *FFEE6AB35C12FF26C129BF12A296E2D52395360F 4WILLKUERLICHEN
2,421,616,356 *FFE2C9D7CE2637DC6945128A0120F77BE2ABA3BB 6ESPEJAMOS
2,421,616,357 *FFE958DB0B21CE9714511641E78C6E17392C80A3 [email protected]
2,421,616,358 *FFEA0B3D7DB7407BEB926B2213E370D773193AAC 6KREMMARAR
2,421,616,359 *FFE36F8830D1C6C685C89F3210A4400AE217C9CE 5GABBOTT
2,421,616,360 *FFEE3194DC66F8EC8FCA8895FE80DAA50B63B35E 6SPORTSDODGERS
2,421,616,361 *FFE9F00F42DAF02159D186C1598401B70A94E935 6STUDENTMAGGIE
2,421,616,362 *FFE416F8E127EE9F41889A520F9BDF0EA886BFB5 5KOMEDIANYTTE
2,421,616,363 *FFE8344E54EE49233B9A8772082F75B9F07F6E61 $748LE$
2,421,616,364 *FFE5FAAA8DC4D2C049B8B7F985C51F0BB3BFFDB1 764643 varhaisvaiheaineenm
2,421,616,365 *FFE78570956CF5771F2628820B5382DCF4E27F4F 5NEWSSURF
2,421,616,366 *FFECFB30E2C78179E2935FCE31D6378C8BEC0981 5noetherian
2,421,616,367 *FFEDBA8675EE1AFAA4C105346CF7CF5EF09982BE 7BSWGROUPADDBSW
2,421,616,368 *FFEB07154658202D37116F61E03C2554501F2D33 5SALLABERRY
2,421,616,369 *FFE4CEC320898CD28FDD2BA2064E79E533CDD78F 5STREAMCAPTURE
2,421,616,370 *FFE6E844D2FCB156B499B2F4CBC25C3B4F8E6629 5UITGEKAVELDES
2,421,616,371 *FFE1402A23840E312232E1D87D464EFBAEC47424 5-vaivattomat
2,421,616,372 *FFE71469B0DD7F5C4DC25384FFFFE45767AE5B84 5WHETTLEB
2,421,616,373 *FFE01C61172596D9ACEFCB2F0CA912916BE9F559 7KERMITMOON
2,421,616,374 *FFE773D6E2E90894640D58B2AAEA57A325EA4141 691651 Internet.yargIlanIyor.
2,421,616,375 *FFE3F3B09DC04E505C61FBDABE2A4F2FC62F7769 692868 keiner-entkommt-heute-der-kunst-
2,421,616,376 *FFE5A6F2B92180E04675646028E65A7DCFC7F98C 7SCARLETTANIMALS
2,421,616,377 *FFED5B11B3BB3AE17D99578727056924C409B212 7SNOOPDOG2
2,421,616,378 *FFE4295472732FAFBDD6C09F68CAC167DA3DE957 6HOCKEY1
2,421,616,379 *FFE1039D2EBAA145EEF5292DF01A8A8EFC8E0920 6NOTUSEDSADIE
2,421,616,380 *FFE6D298793D8FF739CE8A3812845584F3AE4E74 6PRDPLTN
2,421,616,381 *FFE0317E496EEEA849FA7B37D26F8FE68DFD06DA 6TAKHING
2,421,616,382 *FFE74E00F332D7DE51EF1C672D54A8F78964390C 8DGJNELLIE
2,421,616,383 *FFE9287791B89D0F1B8405ACF18856AAF1E30F7D 6 watermonitoring
2,421,616,384 *FFEEEDC6308A0E0A1C91FA5D57D7B140355AD01B 8FLURBSW
2,421,616,385 *FFE92FA4E99D204B430716ECEBDD748A2C4E48BB 71ANTAMASTA
2,421,616,386 *FFE8F4689F7D9E0761376877CD948A1517865694 8KAJ8XHMYC2YJI
2,421,616,387 *FFEBF1C9D096C27712197A04B3D48DB115C6D106 7BRAZILFUGAZI
2,421,616,388 *FFEBEDB9651237522DEF6AF8ACCEBD1429E1B24B 7BSWDEGENERES
2,421,616,389 *FFE355CF18CC21971B2462C4ED0CDB262EE70B36 8NEKEOBNETHCALK
2,421,616,390 *FFEC6EA1AD47482C076BA1CCAF30D1ACF6B12778 7E7RA5EME
2,421,616,391 *FFE1368ADBADDA7D8144CC13E317555371745C5B )8(o~O~(8
2,421,616,392 *FFEE249F5568496C8B1184F8800EA15A3A65DDB2 7IAMPLAYBOY3
2,421,616,393 *FFEB8247C993C003B6C0CEC56270D835EB645F08 8PROVALLONTAI
2,421,616,394 *FFE686B19094F0D1211D717BDA95B350BE0364EB 7KLOUSEER
2,421,616,395 *FFE0C266AAAA038734C8AF705BFC9CCA531E7CD3 7PACERSCOUGAR
2,421,616,396 *FFE7E293CF7E6290995F6408A67AF8BD7D8EC9C6 7PAYMENTCAUTIONCAUTION
2,421,616,397 *FFE9CC6039CD1C29F80FE88722C719584A372FEC 8WALKERPATRICIA
2,421,616,398 *FFE29097EB1733EDD8930FE83F955AB85A15B448 7REDILETTANTSKUESPILLERINGS
2,421,616,399 *FFE1CB4819F637705751EB4C9059E521A53A5BE7 [email protected]
2,421,616,400 *FFEAFD88FFD5D4B6CB37C8E97E190CB8A89225DB 950864 HEPSI-BIRBIRINDEN-GUZEL-TAM-ONIKI-TANE-COCUGU-VARDI-
2,421,616,401 *FFEDD166954ADC4EE18CF93D10370F78295C9176 982emilie
2,421,616,402 *FFE90165F3AB21843B29312586C76E26701A98A2 9BOCEJAIS
2,421,616,403 *FFEAEDC5FC1EF9C61DE811ECFFDA1D851BEACCED 7WEBMASTERESEARCH
2,421,616,404 *FFEACCF56A76AE3E80B335104021A72B4D5CD4C1 8######@`(_0)
2,421,616,405 *FFEA2A59146AA210AD752C7293D96AB4D4D9E9E6 9croaked
2,421,616,406 *FFE333C947B04693FAD59416EC2B1510666BD1DB 884317 daha-olgun-fotoGraflar-yaSanmISlIkla-geliyor-.
2,421,616,407 *FFE0897C5C12CE605E7A3ABCF19E1A49DFBD3F7A 9IAMESTELLE1
2,421,616,408 *FFE6723688591FCD2EDB474F59483DC8B6F7F3E2 9INFORMATIVENESSN
2,421,616,409 *FFED93E009484A45EC91E0C9BDA59B9DFA3A80A4 9LISPYTKIRJAT
2,421,616,410 *FFEA81C99C1FE1F123E56C5013F24B6DE65D62D8 12= borg.autovoice auto voice server switch
2,421,616,411 *FFE8C47AFF47B5044E0B4A41DB26283DA723F8E6 13.indented
2,421,616,412 *FFE8E2DED55F139FFA85A8421B4EA6DA954C5203 1458395 sadanhengenvanhemmistokokoontuunelj
2,421,616,413 *FFE9CCB852743AA5F24E7F3814DC9FF4C262A499 16081810
2,421,616,414 *FFE16C8E921018D5D4BEA28D94BACBF3A6B403E6 1845397 LAITE.ANTAA.LUKEMAN.ASTEIKOLLA.JA.SIT
2,421,616,415 *FFE622FDB940AD274A7234B39A8F3E320A7CEAF9 1AGENOUILLAIT
2,421,616,416 *FFE8FFC3379E39ACBF0E1B6B1269756466C85190 1IAMPSYCHO2
2,421,616,417 *FFEBBD6F64D17BFD1E396730D5872CC40947D77F 1.ISITEBILECEK
2,421,616,418 *FFE64938BD20A581A8147BADC12DAF097F4B22BF 1OMAHOITAJAPARIN
2,421,616,419 *FFEE0A8AE5392E1CB2F09D6CF716064F5FCA8AEA 1or3nzo-i
2,421,616,420 *FFE74BCAFDF9503999814E520F56EB140042B768 1PORAUKSEEN
2,421,616,421 *FFE9B04F290ACB7A0A5DAF1E96EC4404CA428D95 1-SLFC
2,421,616,422 *FFECE75B628C41297395E949EC1E9639C4A2D4DC 1-TARRALIIKETOIMINTOJEN
2,421,616,423 *FFE32C321ED0A61FAB53003A97A404BE5749883F 1TNODOORT
2,421,616,424 *FFE9DAF0F44BF284763948F2F2A5A5C6A1B69F40 1un-appointed
2,421,616,425 *FFE1C8F62ECC5F6990F1FE4057EC79CA4E2A8244 1-vimpan
2,421,616,426 *FFEE480C36C93A7B9235A2CC9C0A2CDAF88A5329 2037669 KAHAKAN.SEURAUKSENA.MY
2,421,616,427 *FFE740023BD6D4BBF6C7F6AFBB2F9801E85148DC 2106658 ennen.l
2,421,616,428 *FFE83A47670CA610BA483CF669C54448A15F021B 2217marm!1
2,421,616,429 *FFE436337CB79A1695B8B3E85F02A04D53979C26 2465369 toiseksi eniten on miettisi
2,421,616,430 *FFE7DA64CFEDA097D9E3A2B67A88A7FB8D8ACB6C 2520MARGINAL
2,421,616,431 *FFE0D9F2032040481783A12E1FDF80DE750A7314 2DEVMODEM
2,421,616,432 *FFE736F3ECD76B229FF582155A42AF0C365D5E33 2-dpg-bezirksverwaltung
2,421,616,433 *FFE660EAFF0E620CB6D9E326B8852E66C3A82511 2 LIGAREKORD
2,421,616,434 *FFEE3C63517B8FFE066C4B03E8327AC649F02B3E 2STIMULERENDE
2,421,616,435 *FFE4C0D84B7009BD846AC3006A62220FB6FEBF84 2TIMBALEN
2,421,616,436 *FFEFA21759344B8F494DA39853F5457499C30902 3:3-#-&burl
2,421,616,437 *FFE96F144F947DA83104323125A7E564512279C3 350954 kolmas-tutkimus-on-tekeill
2,421,616,438 *FFEF04E2250E350BD1F08F37141D2CF10EAEE0D3 3ATTIRAND
2,421,616,439 *FFE2A1BE8D24BC77849781BBFBC7DF7DEAE1EC33 3.KADISHAI
2,421,616,440 *FFE741D9C963FC800FE66F3EAFEDFDBDA6C3C4BA 3NVIRPMY
2,421,616,441 *FFEDDA28ACA66E0012D6DA753027465FD44A5BA2 3-ost-spionen
2,421,616,442 *FFE12D0EE7BC7A2C612A49F85A0AE51639EECC20 3-simulaatiomenetelm
2,421,616,443 *FFE482C57BD9132308B54BCA50FF65AC7676C7B0 $41t-m4r$
2,421,616,444 *FFEDF373973A857A746748C7920FBA7A447FBA6B 459360 sizi gUlUmsetip baSarmanIz iCin cesaret verirler
2,421,616,445 *FFEE155319890A16CAEDBEAF38CDAE896CEDDB6D 4-ALUMIINIJAUHETTA
2,421,616,446 *FFE96AF9377D8B10AFA737CF82DAB6A539BFDC7A 4ass
2,421,616,447 *FFE6A9CAFE88DF35873CBE2E7031A29261B68A4C 4DUSTAJAA
2,421,616,448 *FFE185E5E2227E6C1BCE671C2B782548F297914F 4JEANETTE1
2,421,616,449 *FFE196078CE68618014554B47C7476676039976D 4N035712UM
2,421,616,450 *FFE79E6C8567A952C84A24D8282E3A0A1389B405 4NONSCHEDULEDS
2,421,616,451 *FFE1FE13B29E9153A64E3842F1152D1F1E0C216F 4 PEISAN
2,421,616,452 *FFEA5B7630C14572D878950A06D37F5F966A8896 4QUESTPAMELA
2,421,616,453 *FFE156F6F733755E95EEEBE1EC730DCA2BFB73AF 4REPRISREPRIS
2,421,616,454 *FFE1CFCAEB0BA888BE7EA3E01CBFAED0DB1700AE 4SASSYYANKEES
2,421,616,455 *FFED94DE777B88106675E70CA70DAC6F723D5E32 4SEROSITE
2,421,616,456 *FFE6170C7B6BFE1D4CF23BB10389E10C06BC5D93 4SPORTSSUNSHIN
2,421,616,457 *FFEC27079DAB3F352A630F52F2FDCB0542FB1B8B 5011C17R55
2,421,616,458 *FFEA5EFC3A6B545EA987685D995B750C38E58554 548001 WILL.SEND.NOTICES.TO.PART.B.ELIGIBLES..
2,421,616,459 *FFED4D89E259ABCF560167C00CB027C9FE0FC5EE 593681663a
2,421,616,460 *FFEC65E4588D65727BBF81E4CBAB76DB68E3FF4C 5DUSTYINSIDE
2,421,616,461 *FFE1C840CDACE405631A325D739D5152DCC361E4 5JUMPPAAN
2,421,616,462 *FFE1B3178B4D8B2796B2E22AD1C0F6921F188058 5 NIMELLISARVOSTAAN
2,421,616,463 *FFE3B74721B370B4891FF21B00251E94AED4B781 5 NIMIKKEENS
2,421,616,464 *FFEA8A8E263674C29A28EE11F5F450D6134C4157 5RALUBACOV
2,421,616,465 *FFEB26C30F9F8E34AB44D1888C5FBDAC28822ADC 5SOCCERFOXTROT
2,421,616,466 *FFEB15FA8A416705AE0363CAD1C59ED2DB1F0CC7 5VENTRES
2,421,616,467 *FFE020B2FFFC655A742CC8D21DFDC03B6EF284E4 618230 mutta-todellisuudessa-t
2,421,616,468 *FFE84D75A0E4DE8A8E7B7242058E1088C290FB9A 618945 insaltlakecitysollnundercoupgelingen
2,421,616,469 *FFE108644A5AFBBCE9AA7FDA8809A4D9FD1654D1 63schminke
2,421,616,470 *FFEDB4219A0ABAB3F984E24488F4A058DA046C3F 6iluvlarry2
2,421,616,471 *FFED66ACDF017D3349E843C98EFC8DD915FB261F 6XKXONFTWFZPFGQW
2,421,616,472 *FFE56DFE306CE9B6C76AFA58BC00F2B52C362533 731695 biri-poas-,-digeri-is-dogan-
2,421,616,473 *FFE4FF35347553FB491336B2FE7CB565B16ABF1E 7-bakteerikantoja
2,421,616,474 *FFE4A791469B250BFC766FF1C70CBC01B1A67149 7enderl0n$
2,421,616,475 *FFE688531EDF61BF5C3347FA0D5C1FAB29AA61B7 7ENERGYMARIO
2,421,616,476 *FFEEA9258D1CFA8BA45C7FD17D56D9062AB1E73F 7KLEENEXMERCEDES
2,421,616,477 *FFE7361EC49746FDFBC8413814338999F959E400 0126fd2549f93c0895ab7127b6196e6a
2,421,616,478 *FFEECCB0F47951B2E064801EA0A83490028ED1BD 7MYANNETTE7
2,421,616,479 *FFEEDB4E4FCACA7A8A429FF7F0E1F090CA092D13 7MYMOBYDICK1
2,421,616,480 *FFEF5F101D2964779BEB21F939CFFAA277DE1FB6 7NKEDRAAP
2,421,616,481 *FFE76B0E9E278A6C6C9AD45575D063C3B610C00E 7REFILEHC
2,421,616,482 *FFEB0A3AEE0A08718D488D0900C8A0F72CD5E4A0 7SABELLOI
2,421,616,483 *FFE067E603336927D49432D1C215748CF198D418 7SERALKROF
2,421,616,484 *FFE66B943518FDE737FFA540DB93D1FFA870082C 7TAPOIHINSA
2,421,616,485 *FFEE1C881E54D45464B5464650989E4ED0D9D8B9 7VOICELESSNESSES
2,421,616,486 *FFE99E2BFCE2DC4343687B33CFBA65303861C082 0ME1E77E5
2,421,616,487 *FFE9C32A7329B72437844DADDDB403FB47BDDEDE 105191 LIS
2,421,616,488 *FFE22AD715E4D5008C608D162830A53912660537 83DC830A-4ADA-31E2-A8F2-F05643DAB691
2,421,616,489 *FFE9850503C7437FFFC45E2371133B12980FB461 1057044 SEURAAVINAOLIMODIFIEDVAJAATONNISET,ELIMINIT.
2,421,616,490 *FFE980CAFC9084B963BF0D9A4AE6A068616B09E0 851DARIO
2,421,616,491 *FFEEA8379FAB58B87151AC53D8CEE348D8F3936F 8AYLMERTOMMY
2,421,616,492 *FFEF3CA6229AAE9F63EA4B12ECF93CE6E561F99A 121724JRD
2,421,616,493 *FFEDE301B4C480D1E72D9CED39359E859ADE0A17 8---b-`~splat
2,421,616,494 *FFE40061457F605BEFA327B90F0D2A2884CED6CA )8(***D3
2,421,616,495 *FFE3774BD2B4A1E8665D5F3BAD9155EA7E1E923F 187087 niiden-p
2,421,616,496 *FFE2A16301333C92CC0DCF3281CD3EBD99A6E126 1890682 RAHOLAN KYL
2,421,616,497 *FFE0FB37BA9BDF861F5BD2271578F23DF49FD0D3 8LYSREKLAMESKILTENE
2,421,616,498 *FFE2D8D23BE8A01370314C0F456B1D0AB7AD01AB 8ni
2,421,616,499 *FFEB4CD985D1FC0E6D0DFAC95341EAC539E14D32 1BLINLANDEPISTE
2,421,616,500 *FFEAA82E701524477FA1AF58B0DE478180F153CE 8STRAWLAID
2,421,616,501 *FFE6BDE6D4CC2520A7869DFE6701D9440CADCA6C 8VHUVPMZIGENSLTI
2,421,616,502 *FFE72E538D2F0A332EF96AC5934889198C79DEB9 1EMELPUOS
2,421,616,503 *FFED4F54D26B360A161B4FF1541BFC6C39918621 8VIHERKENT
2,421,616,504 *FFE888E00EE0F465CBE694F3066AD04CCA1E9989 1escalado
2,421,616,505 *FFE4E4016D4028A764852802E0EE7D77715FC42B 1-exverfassungsrichters
2,421,616,506 *FFE63A4886B7054CCAF44ABDCA96E93C44FCE8C8 90al3s
2,421,616,507 *FFEF0FFE9889223B47C3EB2FB18A61AF50370EA4 963189 vuoden.2000.alusta.l
2,421,616,508 *FFE2018593DC47A734DBDD3E404EF1B34EBE4F26 1-habyarimana-maschine
2,421,616,509 *FFE3B2158536EF84E8B2F3CE2A85061D7E4AE7B7 996TANIA
2,421,616,510 *FFED1F6C5F26847979B301707D301F374911DBA4 1 labourmanns
2,421,616,511 *FFE49672F71F057CEAAB4F556D0209CFEA7ECC77 9folklorism
2,421,616,512 *FFE86DDCBBAAF61931852B623990E5F104EEF25D 9huurprijzen
2,421,616,513 *FFE7DDBFCED2CEF42B5C0CADD2FE76CF8A3E2721 9iluvwind7
2,421,616,514 *FFEDD3E4C081B44A111C4F7DFCAEE0AD3E6A7298 1MYRUSH2
2,421,616,515 *FFE6C2998DE4F233F350ED452768952A794F2EF4 9JUPITERDOMINO
2,421,616,516 *FFEAEAFFEF981EB15FF8ED368CA3FB8C05BF0BD5 1ovensuun
2,421,616,517 *FFE68AF4DD9AF63AEE6AD01DF24B8E75D2BCF9B3 1pireye
2,421,616,518 *FFE92A3333B15887101795E19BFD037298F1D36B 1 POSTMODERNISTEIKSI
2,421,616,519 *FFE43ED63D1A66B693A4EDA569A56E6BC86D4757 9OLDFRUING
2,421,616,520 *FFE4E830F0D79DCC66E3D59D21AC7E6A38C56E1D 1STRUISVOGELVEREN
2,421,616,521 *FFEAB1AD952B6BD81CD0E4CE75FD403502F8BCC3 9SREIPAR
2,421,616,522 *FFE6920390D5E893B61F70BDD0E363FB47AD7D4C 9tanglingly
2,421,616,523 *FFEBE31B5E6ADA15C4015E1D515A1D56B98161AF 1TRAUM-TREFFS
2,421,616,524 *FFE8E5B5606A2814FE947737C2459E59B1B0062B 1TRUMAN-DEWEY
2,421,616,525 *FFE927B093982B0C0FBB36EB73F6493FD285F192 9UPPITCHPITCH
2,421,616,526 *FFEB602E44C77FC1C59BAFA5F9E9F6AB2935083F 1VDS-PRAESIDENT
2,421,616,527 *FFE5027EE9AA3EDD82C9613968489A247DF63EED 1 VORJAHRES-ZUSCHAUERQUOTE
2,421,616,528 *FFE0DEC17B26A0EE824ECDB0276AFAFCA7601FB0 1-WEINIG
2,421,616,529 *FFEA58143DC3BF85AFD1EB67BB0B72A5F31F09D3 a;%0
2,421,616,530 *FFE8BDDC0EB4D243B8248F2F4231ECE6CF4989AE A2R:E
2,421,616,531 *FFE4FECA17DC4F8FB32B46FCCF1CEF68BD311393 2204925 TWOYEARSLATER,HEBEATMRSCHERLE,EASILY
2,421,616,532 *FFEA6A5478A84CD04E6A7A3CF2DC37A40F2A317E a4dt9
2,421,616,533 *FFEBFB890A892B2C339BCB96FF4781D816485DBB 243 beiihrstimmendiehormoneoptimal
2,421,616,534 *FFEBB3C3F80A98CB88E2E18E2EEBC1FA6695B55C a%6vg
2,421,616,535 *FFE774DE79482D1ABAA3160A43E1EEECB8CB5E13 A7hV
2,421,616,536 *FFE29924171592AB3C862625C721D34AC8D74929 2806260 KERTOMUS.VOI.SADUN.TAVOIN.SIS
2,421,616,537 *FFE03D0B4B94B7B5992FB1E1A108893ADB4A7BEB A9:Q
2,421,616,538 *FFE44AA51238306F9E8F7C6D9FC81FAD240DEDA0 aaacjx
2,421,616,539 *FFEDDA0AAF1F8B64B33D0367EF23640ADB5CA112 aab6[;
2,421,616,540 *FFE3EC01C506CC869E0AE7F21C5A4CF9727D3D72 aabqqx
2,421,616,541 *FFEA3A5F9C40012C38F12F89FECA6C21BEEA1CCB >2LAAA
2,421,616,542 *FFE0FBD2E35EF7AAF441AA40455F5BFDC8A2CC5A 2 PILKALLISEN
2,421,616,543 *FFE1FBB32F808780EE0AA23F40F20FCC68150264 AA!GYAKUTEN-OH(GYAKUTENIPPATSUMAN)
2,421,616,544 *FFEB70DC2BCDC0C69AAD583242C6FF67CD5DE980 aankoom4
2,421,616,545 *FFEBEE7F4CC956EE7B20214504779A207B15DEA1 2UITVREET
2,421,616,546 *FFE4492A2B608807DD1349E593CD65FD25143799 ABABAJANOV
2,421,616,547 *FFE9A2EEF65D93B721B786054B16FD7EB51C215A abdiel801
2,421,616,548 *FFECD6B4A793F71F85EF0649FD60DA37E2CBA49D abeouellete
2,421,616,549 *FFE0874149450811126220B99CF19866BAE18F0E abnvg
2,421,616,550 *FFEA6889054DB111BC3AE8A27EBF0030473B7135 3D~`(0_<)
2,421,616,551 *FFEC1670F1B34E5AB793A6F8A94952DA81F61C23 ABRWV
2,421,616,552 *FFE247CA29FCFB51F3B01ED80EB82D2D7EAB15EB 3====D`-)O(
2,421,616,553 *FFE04064551CC9A5236E7AAE565663710F7420E5 aby62
2,421,616,554 *FFE653F01F202AC9A60954AFF25E2C22F970CA3A 3==).~OSplat
2,421,616,555 *FFEC138EAFB71B33FAC9D2E85613321FFB5AE730 AC~"Q
2,421,616,556 *FFE758BE7FC4E5B828AB6B891F692236EAA180E6 3##p-~-`)x(
2,421,616,557 *FFE4417FF663FCDA9061FF720E1B6361F321726F adalbertoeskew
2,421,616,558 *FFE06369B18F9BB464389F6CBEDE5B2BA518C48E ADALBERTOVIZZA
2,421,616,559 *FFE95D1AEA1E400C2440946E006BDD331CAB4FA0 416502 THE CAUSE OF DEATH WAS NOT REPORTED BY POLISH RADIO .
2,421,616,560 *FFE49DB7EA64E6928A91FB7EF1745A087F9D9618 451fisher
2,421,616,561 *FFEA3382788A9305794A88C20CD214A5FC6BD32B ADOLPH.HEGAN
2,421,616,562 *FFE4A9F8A6424A9AC7283ECC95729D2A12BE5A64 49:5-F-Major-Adagio
2,421,616,563 *FFE99AF57D0D7AEFDDE8FEC83232A1402686DAAD ADRIANALAFATA
2,421,616,564 *FFEEB36290896CDB63E78CC33051B80C3C3E8402 4GARNELD
2,421,616,565 *FFE367F8AA0A09A9BCEEF5FE6C398BAF46748C6B 4GRIMONY
2,421,616,566 *FFE720E709975404959A5547BC0EA352BABDF639 4HBARSTER
2,421,616,567 *FFEC26CEAB4BA559033556ABC4C120F7AE6CD59D 4ILUVTATTOO5
2,421,616,568 *FFE6D88CDDE494A6181DC6B46A419CD9296511F7 4JAZZSTINKY
2,421,616,569 *FFE987E43E2813088FD5FDC9522FC2FE7FF04207 4KATIENIKI
2,421,616,570 *FFEE6726F5334F7481278639A0928F307DAADBFE AFFAIRS
2,421,616,571 *FFEEC92021E28A155078F697E4A59BA00247C101 AGNIDDYR4
2,421,616,572 *FFE78C970549A3B263E2710D7C25FE3CAF56613A ag=t!
2,421,616,573 *FFED438B631C1EC4D0C795989BF6A5067E008F2A 4.SEVENJUDGE
2,421,616,574 *FFE52BAD98C52A18CAEBB7D682983293E1BA6D94 a$$h6
2,421,616,575 *FFEC7B17DB3DC54A0C3EA915F78587FA1D73570B a&hdj
2,421,616,576 *FFE22666BF840871AC15B2002A357B5084B47FEF 4STRUKTURERINGENS
2,421,616,577 *FFEBB3A405E21B6C61237C89617172097962C1A3 4TSUCHIMOTO
2,421,616,578 *FFE99D64B7D9719C9CE082719CF8D865BFEDFD84 AH,.WOE,.AH,.ME.2
2,421,616,579 *FFE20A2C25439DC7E3576548BA360E10FEEAA011 514499 ON-HELPPO-OLLA-ROHKEA-KUN-EI-YHT
2,421,616,580 *FFE4DE57CE71A40DF09BBCEE443F1F55A3A225C0 5156e6
2,421,616,581 *FFE9BDF70E2EFAFF2415BFA387E412B08EF42C69 589076 AWARDED M . SC .
2,421,616,582 *FFE81408303BC3C41501AF01F6B02C257A7F8F9A AKADIEMINKS
2,421,616,583 *FFE6C88AD616224F2CE39AECC7307380543989C0 akg:e
2,421,616,584 *FFEC9205E28D4D6C057E7672857E56F111C9D4F4 alecvanderbilt
2,421,616,585 *FFE3AA66B88E2EB6E0426D6484937F6CCA0F479E alexisziman
2,421,616,586 *FFE58545027636D95EEAAF704EF80C58DDB06CDD ALFALSTINEY
2,421,616,587 *FFE6E96BC719D5AFE843DEC4B2ED32732A49A972 alonsoalija
2,421,616,588 *FFE868EBEBEA39397E0F5245908C96637B67410C 5PRAVEDNIJOM
2,421,616,589 *FFEB625CE7F73B6CFA128C2C92CA0A70624D4FD3 5REWOLFKC
2,421,616,590 *FFEC6D350CC114AAA8F8F9A94D5F276EE91FAFD5 ALSAFAYI
2,421,616,591 *FFE6DACE5ACFF2224280FBCDC452033D9E10E32F 5S6YTURP6
2,421,616,592 *FFE55DE0105C39A2A47668367511044FF8E56A38 A)LVP
2,421,616,593 *FFE36C9979330272CAF77C5C5BA8C122D7AC3DC6 ambigua9
2,421,616,594 *FFE195AB301774CF731072E0F934997839674A3C AMOSMACLAURIN
2,421,616,595 *FFE78D8962E69FBC5DEBB4AA610FB48BDB74E5E4 6AEQUATORS
2,421,616,596 *FFE45103A1395DCC3ECBADE17E81D03C039484B0 6ALLAFEBN
2,421,616,597 *FFE9F560C5C2EB9AFF8054F6152E9DE306FE209B 6BSWBOMPSEYBSW
2,421,616,598 *FFEAA9AA06E18E83A78BF08EDC598A9C5C6FB618 ANDREAS.ROUHOFF
2,421,616,599 *FFE1D7EEFA6237A001D0B338C948B2FF664EE315 6DAVONLAUFENDES
2,421,616,600 *FFEC67B2CD70525000AC5B9388006F54592D5BDE ANDRE.VIAU
2,421,616,601 *FFE3F9B499DCC937C9E6D1F5AC05A68501371941 AND YET RUNN'ST TOWARD HIM STILL THOU ART NOT NOBLE;
2,421,616,602 *FFEC546318A012A87194258ED641C3CF83134343 6FODBADETS
2,421,616,603 *FFE9181B79EC636679453C8C16D58FFCC4FE285C angelica.witherspoon
2,421,616,604 *FFEEFD5596731721C3716BD9EEC74091C5BAD618 ANGUJE
2,421,616,605 *FFE7BFF5B1CEA49EFD2A86DE33A463CD0C276EE3 6iluvcoke3
2,421,616,606 *FFE921576C0D30D920F6C0577581EE32EAD8AAAA 6LARGEN
2,421,616,607 *FFE0551ACBD6DC7CBBAF42203F4DDB53C5D9CB27 6LEBAKDNE
2,421,616,608 *FFEC1A033819A7CF288CDEE5B18D2D42DDAF7394 A;NWJ
2,421,616,609 *FFEFD8B24C3E94CA1F2DC5B342965EE836BF1A1D 6SILIKONCOATING
2,421,616,610 *FFE3791A41A2DEE7D558D61DE22FF0F9F8D77FEB ap&bw
2,421,616,611 *FFE11C1119CA66FE89085F84FDEEECD69161CA58 AP=W)
2,421,616,612 *FFE406E320F020CC44CB4C744F9D1EFB67BBCB14 A/QU#
2,421,616,613 *FFECE79B72002186B2E10AEADC11FD379A769E53 ARABELLA029
2,421,616,614 *FFEF5138A88EFD1C4EB9A1611302EE92E1FA8D82 arado''bars
2,421,616,615 *FFE70E086B67C34D88F85F5AEBFCF75CACF94B0B ARAVINDAKUMARK
2,421,616,616 *FFED5D06E2F76B55802E30929B2E570AE40A4DDE aremacdn5
2,421,616,617 *FFE3278F9E8BD314E2291F6175AE17E7DF6FF24E 7COMPUTERBETJENNGENS
2,421,616,618 *FFE63478DC56EB65D66C8868C01BC11FA14A1BB8 ARETTOBR
2,421,616,619 *FFE74AFE1AE0119E1E5626B1047C699A6C7540F1 7ESELFILME
2,421,616,620 *FFEB43C98FE70F990524981F6F3C72B523B4900C 7EUSNART
2,421,616,621 *FFE2330E3C9B51EFC56B44E215FE6E44C113E8AF ARMYWISE
2,421,616,622 *FFEA0FB1C3C3CF2DBFDDF5A1DC6F45582C110215 7ilovered2
2,421,616,623 *FFE8F0E7251F491FDB7FFA2ADD4C9FBE93386FE1 ARVOSTELUKYVYSSÄ
2,421,616,624 *FFE47DB62150F2DD9E6A7C7E9812BE5F05F01F8B 7OLISOAAN
2,421,616,625 *FFE8E16B396DD5B23A962A128B4E95D5801CEDC8 ascun
2,421,616,626 *FFE806610BAB0D85D40F3770614D7E16103C650C attvelje6
2,421,616,627 *FFE43731B27A615516C602C895346F55894C52E1 8675309PCKL
2,421,616,628 *FFEECE036C90810D2E10AC2E7748DEA7F5C2C648 [email protected]
2,421,616,629 *FFE691783EA06B502A43FC6A4D17C74EDF17781C 8APYABHIJAANAATI
2,421,616,630 *FFED04B3649134A404F655A34D0746EF9C66D2D7 8BALDIZAN
2,421,616,631 *FFE23E49E61C67E1697D388369130A458389C3E3 auu$a
2,421,616,632 *FFE57A5AC93AD8B82385A3583F9835CABE9BADC5 AVFT
2,421,616,633 *FFE576CB68E95F9803DACFF1D1BB6233B6B220B4 8GOLDPOPEYE
2,421,616,634 *FFECB229A6EF6A7E8C6F4120D702FF86975E64DB AwCi
2,421,616,635 *FFE6EA0D2421E4FCE0355B9E22111765DD93AC86 8HMG
2,421,616,636 *FFE979DB4B5162332438EB2913F027F717B1F2E3 8KEILOKNEETSLAG
2,421,616,637 *FFE5883DB6D2CE635D78745F8E7701CB6CC53A92 AXS9D
2,421,616,638 *FFEBA238FC94C6367D62888288F644BA2B6C07CE à¤μिजय
2,421,616,639 *FFE97A14FE16E5D874367F471206A5D1EA4E99C0 8PRAMOND
2,421,616,640 *FFEFEE9A4CDAA633CA8921B75431C63A4BFBD5EE b19mg
2,421,616,641 *FFE4DC8086B3557B47F3C4DFB0F0ECC32D0C68F0 [email protected]`~.`~SPLOIT
2,421,616,642 *FFEDD77A57ED763A593C2173F1422BA01500819C b47a
2,421,616,643 *FFEFBEECC7230449ED480CFAE07242E668F61768 [email protected]
2,421,616,644 *FFEEC724F135FC64DB0022F5254F3B276B5CD411 baciare6
2,421,616,645 *FFE17114E25B3286B79B0F87C47F847802E644E2 9BRUCEBLOWME
2,421,616,646 *FFE785C76D24EB81721F7506CFD2FFFD06D4ED0C BADLYINGS
2,421,616,647 *FFE0B9AC1752197F75D39215D8644FEE5562F196 BAĞIŞÇISI
2,421,616,648 *FFE94223FB765E5335FEA88585E46FAE0B4AF57F 9DEBARYA
2,421,616,649 *FFE9B87A0529759A8C79C3CDED5C0B16CCA4CB75 9GRELOCH
2,421,616,650 *FFE5CADA13E74CDE944CD2B4BCE3E4BBD24B9FB0 9INAUFSPLITTEN
2,421,616,651 *FFE25D0076C31E7A4408F5B09474F9ACCB60785C BATTINGTECHNIK
2,421,616,652 *FFEB06DAEB0DA293CB70DD13796535E0A605463D baur3
2,421,616,653 *FFEE32FCA60A33331F083FDC763CD99C80E72DF0 B)BJ/
2,421,616,654 *FFEAE31702967A6E24970D98967ED43D9415A188 B!BP
2,421,616,655 *FFE4C76769E8B3929CD56A025243DA2BB35E03D2 bc79;
2,421,616,656 *FFEA11F7F271B6472E6433A46678C2152ECC9C56 BCEN
2,421,616,657 *FFEC49E30BBB439F7500945686854AF41C83016B BD
2,421,616,658 *FFEFEDA20B00B60457E1A49F445E0B9A1BBCDE34 9VSLZTNS
2,421,616,659 *FFE65E495DC27A12CEA6A1DA678AE01F20CCDB38 9.WELTRAUMZENTRUM
2,421,616,660 *FFE0909D730F8FA610C574E9C64C83CFBAEEECB7 9YPYTTISI
2,421,616,661 *FFEC503D06A13CD2BFEC34644926039B72D5ED91 a1!h
2,421,616,662 *FFE01FB435880E5D88B3F52368D65CE3409E0D91 A,4%
2,421,616,663 *FFEE86A9F7FEB8FB07BEFC259FCE2CB896D4ECDB BERNIE.BOESEL
2,421,616,664 *FFEFC3C5FCB2EB20EFAD71EF48C61A7A93880550 BERRYWEATHERBEE
2,421,616,665 *FFED1233AE4CA7120A5571D1978581D6A67CBC3C bertoncelj
2,421,616,666 *FFE033621F050DB5B18AB2335E3E344949259075 A7P2B
2,421,616,667 *FFEC38FE26D8D3676DA1C695DA798A77D41CDF0A bfec3bccffe6f538c12573191ce0bfac-mv451292
2,421,616,668 *FFE16A49DFF091C943E4DB387E793CE7A3FF2B4B aa0eq
2,421,616,669 *FFE5B89FC7F3AD3EE305E5AF7F3CCFCF70A743BE AAALO\
2,421,616,670 *FFEA08A67EA73F47C69716BE8B8371FF488407A8 BI5EM
2,421,616,671 *FFEEF52A01A41B825E67CE13C468FA8C7093A111 BILL.WARF
2,421,616,672 *FFE6865078799424BA81F95157CD668C5F33D03B BILL.ZACHAR
2,421,616,673 *FFE9C035F0C06E615544500FDB3FB5C3F8729CC8 aad8*f
2,421,616,674 *FFE2FC3343D3D85C7B72FDAAE748C9BAED938CE1 aandheid1
2,421,616,675 *FFE95B64D36FB50ABFAC10625FF7B77C9A3DA043 BLMQLMS21
2,421,616,676 *FFED92B4824BC23945824E26A79AFE016D0FF1EA A;B=E
2,421,616,677 *FFE00ED8251E9A3E3F09866E14C45730B6AC58DB ABSTRAHUOČIAU
2,421,616,678 *FFE89C1F7D3FB4788F3AF603D29B4671E137A0F4 BnR
2,421,616,679 *FFE8C3BAB9AD58F1CDB0DADB92FAD4E8765CEA94 bop")
2,421,616,680 *FFE42B22E2777F02A9B0232152B3941158195214 boris.godounov:.acte.ii.."a.cause.de.notre.perroquet".(fiodor)
2,421,616,681 *FFE80C22AA58F88901892E6BC4EE25A37E86FEB3 act i "libiamo, ne'lieti calici"
2,421,616,682 *FFEBC38D087302B2DF2E4491F5FF26AECBC54068 BOYCE.CAMAK
2,421,616,683 *FFE9DD390DC27665E1298B5B4D30DFFE3F95F566 b_!p
2,421,616,684 *FFE6AFE096F0D329B9FF67A6A4D161785B2E6E53 bp86a
2,421,616,685 *FFEE69F8AA05EC5AB6FA6FA635B175FA072509A2 a.di.
2,421,616,686 *FFED4E36ECCE91894C97D676A14FF3F6DB6C0AD3 BQL7B
2,421,616,687 *FFE77BDB6950DB3023E781A172D01CE2D18338A1 BR,
2,421,616,688 *FFE4E4F2C58D4F76DA56AD749C96DD0719F98390 brazilsendit
2,421,616,689 *FFE1B6A15233BDE1A28F533E4698F6B0440F71FB BRIJESH.DUBEY
2,421,616,690 *FFEB0882D4FC4E2DD7C5C413D2C7B5931D3D0F97 [email protected]
2,421,616,691 *FFED9000F2FD2C6697DD98806B89E9ACF1E539B7 afslentert3
2,421,616,692 *FFE475ADC435133DFA4D240874DF065267F460D6 [email protected]
2,421,616,693 *FFE2497C5108796E86C0A980F87823138036FB99 A);GI
2,421,616,694 *FFE52EB51B9BECB2EFF9F78E6C4114AEADB2279F A_GYC
2,421,616,695 *FFE1D63EFAC77CB0AACE9A4B9F3AF4A5EE19811F BSPEARRS
2,421,616,696 *FFE825942F8C9BFE6AB0043BCB1B1FA0E03FB505 aidriancrowley
2,421,616,697 *FFEB79EC0FF48D6E982860EA2BF69225F36C202B ai$j)
2,421,616,698 *FFED5D0715D6439F25BEA6F2015CA87CEA412971 B_T=#
2,421,616,699 *FFEF15477ABFC0E212A4049532F45F2C6BBC6613 AIVOVIRUSES
2,421,616,700 *FFEDCF450D958775105242FA92B0A337A2B8DDD5 a%j=
2,421,616,701 *FFE87CCBF125AB2DBC828A367E0CDFFB04D6D1EF akshayakarthik
2,421,616,702 *FFEC6E47CC695F365FBAA8A27B3986838AE1449C ALANNORLANDER
2,421,616,703 *FFE498DAFC66F24BE5F2C1E5317C55B8433C47C9 BUZZBULL9
2,421,616,704 *FFE0620063818A72E0A6FA376C95D8B00BEA36C5 ALE2
2,421,616,705 *FFE657C211A83744CFFC9D44E4E57646749BB965 ALEXANDER.PHILPS
2,421,616,706 *FFE2B6CDCAB99F38A567F7BCB1F25AFD8DB2A7F7 BWM?M
2,421,616,707 *FFE8D84FED99613B67FD9A175652C50A466D9178 B;WV
2,421,616,708 *FFE9AE660B1D4B6C3987468E18009B46D627F6E1 [email protected]~(X)
2,421,616,709 *FFE34ABA88F2AEC6EB098CDC0D98F6BF48834FF2 alfredocape
2,421,616,710 *FFEF1AA6AF48673332D89A9C194A174FF66FF8CB bxom4
2,421,616,711 *FFEB9C10CBCFA169456BB6079AB9ECBC59F045EB by!/c
2,421,616,712 *FFE2BE5EC06B11E6159356AEC00D46F9944BB59A alifandrich
2,421,616,713 *FFEADB9627DEDCCB47BD51DE9C678DD7D0803BCF bydiscipline
2,421,616,714 *FFEAF1BE85F49E3AD93EEF57A11E8A2804D4813C ALKAJASTA2
2,421,616,715 *FFE03015DAD124D2F37A626F579D4380E4D8CE02 b-zsz
2,421,616,716 *FFEB643F99537A85C2FB265C701C14B4DD7A7D93 C4!EH
2,421,616,717 *FFE6A9C6B033E9C38602ED71E87B4DA39C051A64 C$4H!
2,421,616,718 *FFE3E805FFC5EBB9E09AC37660461E2609FAA59C AMOSTAUBLEE
2,421,616,719 *FFE1131823FB5A7F2B9B07C3DC4D346B0C1C8909 AMOUVARU9
2,421,616,720 *FFEE0541D577C569F189AA19A962C740D5451DE6 C74
2,421,616,721 *FFEB7AC3D2057188A11E7F14ACAF436D494CC454 CAATTGTAATGATGTGTATAATTTATTATTAACGTCAGTCTCTCTGGCTGGAAAGTAAGT
2,421,616,722 *FFE0C8D9B2E26A593E8460443689A0184A60FD9C ANDELIN4
2,421,616,723 *FFEA4D23DA82387F096E60ACA553484613F10FBE CABSIIYA
2,421,616,724 *FFED7D080E188ED13AE062D663CEAE89D8462579 andpipes6
2,421,616,725 *FFE0DC3BDF2CD5E421098833627E9CF367AA4988 andy86888
2,421,616,726 *FFE8B2104BE6A64F89D21237828679CDA2D0FAEF angalar
2,421,616,727 *FFE67767EAFB87A0CCD313D41871BC366BADBB41 CARMELOHASKEW
2,421,616,728 *FFE88B06DA294452A55BD37EAFE6548D06517123 [email protected]
2,421,616,729 *FFEE79EAE3B1722B21CDB91BBF88E78385C17614 [email protected]
2,421,616,730 *FFE6780F1974B521DBA63F626F1C6153B9F271F8 cato.villa
2,421,616,731 *FFE845121066B475700CDE0A355AD45DA4298FB4 ANYA455
2,421,616,732 *FFE84AC2F4790DD5CD434B866EE974187DE014BD a para un gentilhombre: iv canario: allegro ma non troppo
2,421,616,733 *FFE9659E813F4A992A6EB8A884461472574A74B4 APIVATTO
2,421,616,734 *FFEF6DCB77BE2C39024C6C02EDA91B7DD0AABC12 CCEL9
2,421,616,735 *FFE68B4A926ACA3BFEC6751AA0E5C19D7C65F5D9 [email protected]
2,421,616,736 *FFE95ADEAE327A9318E789B275A528377E2A9355 centysming
2,421,616,737 *FFECAA9F9995652F1CDE7931E90DF4315292A324 CESARPLOSZAJ
2,421,616,738 *FFE16A4FFDF7CA7647649C087D623195D78CBD40 CES.DE.CLAVECIN:.SUITE.NO..4.IN.D.MAJOR:.II..COURANTE
2,421,616,739 *FFE2B6DB70E357530FCD27BAA253FAEF5E5A5CEB ARLIEBELLIN
2,421,616,740 *FFEB54A22F44DCB092F7956C3DB59285F48D94E6 cf2(y
2,421,616,741 *FFED2D92C16F4A9686F51C984D4E015AD9B05E24 c%fl,
2,421,616,742 *FFEEFF307846EE2FC5BE6C375C6C41F1346253FB arronbaggesen
2,421,616,743 *FFE70E5881400EAF3746E0992E51F8FC2804AD59 cgh?c
2,421,616,744 *FFEF984BB933D58C3C95EE22F0B0D0F4D05E03B2 [email protected]
2,421,616,745 *FFEA6555864A7B4E1606789A07FB0423390AED62 arthurpancho
2,421,616,746 *FFE3F1057DEAA0B78333CCE8DEB8940C12065ABB [email protected]
2,421,616,747 *FFE0B3C9B165FD23E16B9072CA25B8B3296B3B8B cgvy;
2,421,616,748 *FFE97837B83DDA1A3129327CF442BEFFAF41816B ASARWESTRI
2,421,616,749 *FFED52BE567634D33C1FEFDCAD3750DCDFDD3F1D as darkness falls :60 (a)
2,421,616,750 *FFE337E617908F4D9AC2C67FA1ECBB06BBC450FC ASHTAMSA
2,421,616,751 *FFE4A8D03EACA757F6D368A7B4D95986D642588F CHAUNCEYKOLBO
2,421,616,752 *FFEDF9A416D779A509457D19031863A857B374FB chaz.hayes
2,421,616,753 *FFE0BBD01E5D26CBCDB876AEBB40CB1DAA20254F CHEM$M$
2,421,616,754 *FFEE8D6CAC539752B3C246FC9ECBBA1BC639B791 CHEVCHELIOSG
2,421,616,755 *FFE552675E9FDAF9B0BDBC430D527A9892B053AA Atomic.warhead
2,421,616,756 *FFEB6E1933C8C96F546220B77CA76D06847B01A9 chose_transitory/tS//oU/z_'tr/&/ns/I/,t/oU/r/i/
2,421,616,757 *FFEA97D85685647543C19F4590E88827AE79EA3C chris1patches
2,421,616,758 *FFE951B71C0A77B5B7726FB9A28624694491F385 AUGUSTALMEDA
2,421,616,759 *FFEA710A73B634E15544CCC01A31F5092E2F2003 CHTSLEUFED
2,421,616,760 *FFEB497F58F22D6BDA6E5D8BC35F66C3683E0D28 [email protected]
2,421,616,761 *FFE9A4B9858A40C35D8E897E0F90ACA443E9B511 CHUCK.TATRO
2,421,616,762 *FFE912EFC8F495596774CF148E176C6AC4E21AD4 CIHOI
2,421,616,763 *FFE69E12F4B37D6A64FF62707DED63F0B02BE195 CISCOED
2,421,616,764 *FFEEA47F02F7B55FF6D7D21AED104AADF2ABC15E CIUDAD.JARDIN.ESTACION
2,421,616,765 *FFEF48877650D06649368073420A9761CD704CD9 AVFT
2,421,616,766 *FFEF4BDED519B5DE739370DD79D8CA80171A4F0D CJ?MN
2,421,616,767 *FFE2F945A53B42C1FA0EA04986F2EB4A59A09509 axx=
2,421,616,768 *FFE78722699E8561E48CC21E0E129CC12E9AC3E9 azucs
2,421,616,769 *FFE24CE8E748CFC3A7C92D9EAC6735E1C37CD787 B(,,
2,421,616,770 *FFE4D3CEB6439C2B43674E847B4214FEB58E83AE b1nfd
2,421,616,771 *FFEE84AD97857CAA5A2CE58A0C0445A1A3F182DB b41k1ne$$
2,421,616,772 *FFE7FB536875EB5BEA8487ABF0D63CF5C11A4285 b.=8x
2,421,616,773 *FFE4F68866D31A4566A41729413AD413DA01C6D0 COMMUNITYARCHITECTC
2,421,616,774 *FFEDCC62D28719E571424960DE41CC6A710A0D74 COMPOÊM
2,421,616,775 *FFE116641A30833448E4C7037F1A5CA2980C5F11 BA5K3+LK3
2,421,616,776 *FFE460AD8FBDDF65ACF3CF72E7B3287DE1850E49 contentnever
2,421,616,777 *FFE4C71CD26E10D5EC7525EA48CAE3355F53BFF6 C$p?
2,421,616,778 *FFE5B02BC2A4462EC2640FE0BD763CED914CAE62 BC1T0
2,421,616,779 *FFEEFD83CA04016A4F993EDE2C444BA674C720B4 craniota7
2,421,616,780 *FFE983C954F18DA4D535835ABC7A97DAE5C01104 crawlbox
2,421,616,781 *FFE4522F1D0CBAECD68D29E8968444BAE0B0D355 BD
2,421,616,782 *FFE66D4F19E853F588F90E8FCE1F4AC51405D368 [email protected]
2,421,616,783 *FFE9DD3D18B187E2CFE9898DD33073052B8C2EF3 BEANSPO
2,421,616,784 *FFEF235A4855D6F1534F4CABABA93D69924E8B07 C=!S
2,421,616,785 *FFEB17C81A48F5FE15C9E67A91EEE87E81C4A6C4 bell.a.h
2,421,616,786 *FFE464CC9D52FF19D7E39DE6DF8766AB2AC1EDE8 ct%kf
2,421,616,787 *FFEADACE2C4B1240A40AFD37C5CBF281B8E870FC BEOPENTO9
2,421,616,788 *FFEE1B28AB893984CD6DE693E82E99771EF293AD BERKETEX.BRIBE
2,421,616,789 *FFE71856DB632197DFE9E2763C604813B3A6D384 berryrevord
2,421,616,790 *FFE08092F225FD64B53F3BA7E4B8D324943D3E53 CUTIQ
2,421,616,791 *FFE7E38FF0EB2A257DFC0A4D999BD2E063AD7E9F B_Et
2,421,616,792 *FFEF1297501EF808D5C4AE5EE0642975CF34428A C=VYE
2,421,616,793 *FFE3E465EBE230AB3709BABA3C074E7AA29B0C67 b=h7(
2,421,616,794 *FFE84DB9CBAB4E94F09F539CC5832737C0FDA5D5 BHBQN
2,421,616,795 *FFEA355051F924D43835773BBFEBA20D849AEA52 BI+9V
2,421,616,796 *FFE9A6B2E752F1AAA513364143727659E150B650 d;2t-
2,421,616,797 *FFEB2D311B105231A9BAF010300E1E310E70AEE7 d3m0cra7ca1
2,421,616,798 *FFE8DC0601D178F16562AA6354863D5A73CF200E BIR5T
2,421,616,799 *FFE4B03657B7299C04E07F20738F70F7AAAD35ED BISMARCH
2,421,616,800 *FFE7807849F0DE6D44527718E88B8F447568BF7F BLACKBG:
2,421,616,801 *FFED36F32250747800B2BD532E408A926EA91848 DABEIZUSTEHEN
2,421,616,802 *FFE8CD71537ECDD343FD39593B12C1E0E42744A3 DAEMERS
2,421,616,803 *FFE0BA9CC39D44EC51E4035F0A243532A7584AB4 B?M!J
2,421,616,804 *FFE79AB7A2099153D518D5B79324705195BB0E96 DANILO REGALA
2,421,616,805 *FFEEB80A419164148A623EFE811E63FE5FEEFB5F DAOEI
2,421,616,806 *FFEFA273E4F76BA03F7F476FB05ED58D5D4CF008 DARENMULDERIG
2,421,616,807 *FFE2CDD0854BAFD0F47A1F4BC02A94FD6CF7615F DARWINSOMMERDORF
2,421,616,808 *FFEF6453A883188A196B4527D56DA83027CC6A47 datakota5
2,421,616,809 *FFE2587A60687C745C174847F9127EE74F576F88 DAUGHTER05
2,421,616,810 *FFE3384925A6D304E6CC6F02ECB1178136661248 daxc(
2,421,616,811 *FFE9BB80DCA09286A23E96770D71D21E34576857 dbmk6
2,421,616,812 *FFEE7C8EE816FA77DF8878019DB9F84B9D74C026 DB(NI
2,421,616,813 *FFE7C43F43C66AA5B74BFE6EEB81C36C074C51E2 BR,
2,421,616,814 *FFE0E7333EE053467A41BC3F8E851F2E8050D986 BRANDENBURG-CONCERTO-NO.-5-IN-D-MAJOR,-BWV-1050:-ALLEGRO-ASSAI
2,421,616,815 *FFEE212143A2C75E9BB71C8DA3F01F4C7051C69F BRAVESTELECOM
2,421,616,816 *FFE5A7889FF9639DC7B36B0183C80AFFAFDC5D41 brenda-yarber
2,421,616,817 *FFEAF6B7E8D7C9B1361B93BE188DA4C2C7D2FABA BRENTKOLLE
2,421,616,818 *FFEACFCAC41A106B57148DC56D931A72BA9F476A BRFMNET
2,421,616,819 *FFEAFAE014D7D4E6EF3E06EC8D271660ED0FA97C BRIAN SELWOOD
2,421,616,820 *FFEB16DB3FE164AAE5AAB087BDBBF7B7567FB552 BR&&K
2,421,616,821 *FFEBE26421E5DA5DE00C2291D8E754224186BE5A BRUNDON5
2,421,616,822 *FFEACBB4B69B5E0B6BF3E86D621D7FC62EF2CBEF brvm+
2,421,616,823 *FFEF80F49FDCD61C6C82D1155DF05CAB5ACC5E97 bswbestimmtebsw
2,421,616,824 *FFE1A626D0170AF6977EFBF459A7F1E0DAC32480 BSWCORTAILLODBSW
2,421,616,825 *FFE1FEF778CB61F58637C6B6A871EBD76A7B8872 DEVELOPINGTEACHERSCOMWWW
2,421,616,826 *FFE673E2A6B56A0EAEF5DFA2A38B17876A49837C DEVINKLIMKO
2,421,616,827 *FFE7508F5423C6979CB0C258AC5831D8C308346E DEWWSINED
2,421,616,828 *FFEAC51BC363145CBA098511991E93960D6C9099 DEXTER.VASTANO
2,421,616,829 *FFE3EE7DC6EFA0E90C5F0DE0556353F4A41524EC Df7Z
2,421,616,830 *FFE5D3E6074C37EF8437575B2C750AEDD2D8E1CF d%$_h
2,421,616,831 *FFE0F731D710D741994ECF8EEC40DB22C9305572 BURNING.BRIDGES.(INSTRUMENTAL)
2,421,616,832 *FFED0E438CE4B2F8E5045200DF57C22CEDF7E028 BURPK
2,421,616,833 *FFE01A07656600A38685E92E0136A6929328A351 DIENSTAG,.19..M
2,421,616,834 *FFE3AABE8052B99C15756C51FBD4EE671AC3F8C6 b)wb+
2,421,616,835 *FFEC33894B644499F3C52B50A253F73C15B40498 c0gkw
2,421,616,836 *FFEA36561718CA80B671AA4B542AB457712C5385 D.OHD
2,421,616,837 *FFE938029D6584EB614F13231CA3AB0A15DAF883 [email protected]
2,421,616,838 *FFEC7E7D02A245AB8111B73F3C382D1397B81119 [email protected]
2,421,616,839 *FFE3DF8C5358E05BC2A6AA55196315D0A5F9EDE4 [email protected]
2,421,616,840 *FFE440B33281D6E8F2729CEA0053D0077926F683 calsequestrin
2,421,616,841 *FFE775805EE8C4F084600C1F64BD99E1E12DA680 CAMPNOSPERMOIDESMANG
2,421,616,842 *FFE8096265312ADB1E1166D2F4D66F4ACB52CBAF don't-landslide-away-from-me
2,421,616,843 *FFEAAF31660AB06E639B3595AB8402CD601EED76 [email protected]
2,421,616,844 *FFE797405C7243316CD3A57AC25D1D6E0475CEB6 dorseylitsey
2,421,616,845 *FFE737940FBF2D784D6455B71E5531EA31158B43 Carnival.of.Sole
2,421,616,846 *FFE8158346FF07CA33B2E926876F3569C116BDAE CARYTHRAEN
2,421,616,847 *FFE7AC3A002465350CA5C03105D856FA0897BEC0 CASEST00
2,421,616,848 *FFE2F7C7AD06F0CD2CC50DAB951AE93CF8E9A21B c=a)t
2,421,616,849 *FFEA716128D31B2E69192FE2A9CFC9D15A08382B Druelladr/u/'/E/l/@/
2,421,616,850 *FFE6E5FC8A4190083FBDC5C40D4C4653B465B94B c+b%
2,421,616,851 *FFED8C8CDD56D377683E730DCB27F35F206A3574 DS_5K
2,421,616,852 *FFEADA26C8BBF570F929F9118D0784851307644D ds.np
2,421,616,853 *FFECE1D8F61461F0BEDC8C4B84A7C1C3ABEA4B1D DUDLEYTEXTER
2,421,616,854 *FFE3806847387060EE399DC4C7C4974EDF1F5894 CD(VF
2,421,616,855 *FFE0DB9A34F37B0343BFB30603FAC33610B8BFDD DUYU
2,421,616,856 *FFE2375683E812AEEE62431686A4E2DF29B3130B CG1TI
2,421,616,857 *FFE66F58AA3E4E9A52A3C90BD613E6048DC36AA8 [email protected]
2,421,616,858 *FFEFF6C0D858A1BA51DB0B38C7A59EA7AAF8C6E2 [email protected]
2,421,616,859 *FFE8C2061B56AC51675FC66404B38BA1C30C48D4 chadcolegrove
2,421,616,860 *FFEA6F4313C854736497A72373FE33D6AB290129 challengactive
2,421,616,861 *FFE369787C7E7EAA81D381C2533E4F5D7986AEEE charloee
2,421,616,862 *FFEC65DBB301F8DFF69E7AB25B6B9F05EB1977D0 CHASINGLITTLEFURRYANIMALS
2,421,616,863 *FFE086C97978600A9A6E5134ECDBC26BF2132224 CHEMIERÄUMEN
2,421,616,864 *FFEFE67B9B641EFEBE1D3F1476D666A599FAEF9F EDDYUSETED
2,421,616,865 *FFEA689D7EE9F952DCD01497B6C674D82C5E26D3 cheyenne100
2,421,616,866 *FFEFE146D0B9181023F07B79EDF9E9BFCAEFC543 edisraelson
2,421,616,867 *FFE391A0907D849053A03835BD587244EF9E89CD EDUARDO.WINDERS
2,421,616,868 *FFEDD3F9B8FD819D6273921CD26EC87B23A8CFB4 chn$2
2,421,616,869 *FFEB2701FF1DE4E61D0FE6D1764BF2ECCCD7F600 een!a
2,421,616,870 *FFE1E42DDBF1DACB15992552E516C8771C28C6E9 CHOYY
2,421,616,871 *FFE3C7DB73B6EB84C2F4C07196723AAD86BCD602 christinlincoln
2,421,616,872 *FFEC78996A349563EFB4193B62B0AD23714ABC9F EGRF4
2,421,616,873 *FFEBC00DD6B93647E088F4BA668D8CA3C9C6E6E0 chtignichteilenrechtgem
2,421,616,874 *FFE447348BD444DD2589D46AAB9EA509A7F7D5AA chuengkrangyao
2,421,616,875 *FFEB54843C877E058A70D98EC98A24CD07FF47FF EKMH
2,421,616,876 *FFE2010FB3464ABFCBDCA4CC12B105CEB12B8D94 ELDONBARBARIN
2,421,616,877 *FFE10301858DCA27D1BBF3FAEFB5E7D909588170 ELDON.TRUGLIA
2,421,616,878 *FFECE859F159326835DC55A87C184B033BE87184 C$JTN
2,421,616,879 *FFECE429937CD3FA69EBAD541A29BD80231BF01E ELIASSHILLITO
2,421,616,880 *FFE2AD4D1FC07FD34475F229ADD257746CCF4580 CK5"F
2,421,616,881 *FFE15969CB0D43A9115AA5313E699E4430BE6848 ELIKRAWCZYK
2,421,616,882 *FFE05009DF8BB815E6FDD5FCFFE740A5C5B0EA13 ELINYAG
2,421,616,883 *FFEFC5F3E4F013939B1284C41DCE9C8DA69FD176 CK?P
2,421,616,884 *FFE86748DB5DEEE9241EB471D99BF89C77669B23 CLARENCEHAWKER
2,421,616,885 *FFEE7AF6583240588B0458B35208E4C84FC10E35 ELUSIONN0
2,421,616,886 *FFE5441B9A298C79CECAE1015F9E974CBCEF7EA7 [email protected]
2,421,616,887 *FFE4A87DC4C777E60018D4FBC63DABC6D7D89D36 clementkuske
2,421,616,888 *FFE429BD2B71CEE7F1424EEE65B7D7B1D0041F78 CLLBRTVLY1
2,421,616,889 *FFE951CEFC2325710994C0B7ED095791C0702C4F EMMA130
2,421,616,890 *FFE84B55D93A88FA8209E670EC782960C9139C01 CLok
2,421,616,891 *FFE4453C4D91041456B62AF8FB98AF3B99223D7E CMIJ
2,421,616,892 *FFE289E1D67EE3DEB3DFD1B361B000C13F3C7468 ENTR?STE
2,421,616,893 *FFE888BBA4351639FE1C7AAD8EFCD0527D32E5AD cokeradioad
2,421,616,894 *FFE6A1AA2778940C9BC25C5974FF16694DC06D27 coll48or4+!ve
2,421,616,895 *FFE84851D5D0F0E5708B70D5DB2FD95A89CB6724 eqiwl
2,421,616,896 *FFE4035FA00B2E146B36796BB55D58F7B685DC1E conversationally a:
2,421,616,897 *FFE19B3C2DE4A321D85B4A5B716C107722BCC695 c",or
2,421,616,898 *FFEF4BE96DCB6541666315441542B9C20958E2DD ETAIFERT
2,421,616,899 *FFE9D7628D3D609B24B7239D43B13676210BB38C eugeniofarrey
2,421,616,900 *FFE0F0520D0AA53AEB1724804E96BE5C6D83672D eujt:
2,421,616,901 *FFE5B15C16CD0DA5937ADE33DC2D680407778566 euolauit
2,421,616,902 *FFE5CD1959F9BB37E8285D026319C63084F4F3D1 CQ7F2
2,421,616,903 *FFE93DC1E48B8E92630149EBDD5949FEE18F7367 evergreenlinestations
2,421,616,904 *FFEC349EC0F12F309423027B1668B3439CA10171 credoinme
2,421,616,905 *FFED815A310928E2BDD2E97B39DDCED903063BE7 EZ-A-DAL-MIR
2,421,616,906 *FFE1C789328925CC2CA8FD03CC735416762BBAC5 crumblne55
2,421,616,907 *FFE1D7C3899F0ABB4F3CFFF8FB8EC6E3367E2508 CRYSTALSUPPORTED
2,421,616,908 *FFE666A1DFB40EF16FD7A66AE49046346100CB4B f1a+35
2,421,616,909 *FFEE444C474DC1BE797CB25EB0B1AE2BD657A71D CSGC6
2,421,616,910 *FFEB8EDBEA5A6CB2A302FC93AEBD268B2081CABA fahrprfungen
2,421,616,911 *FFEE76B65689972C2145B820F892E8A03BF85B5A faq-you
2,421,616,912 *FFEE7B1C36B35DF1D83C6E9EA7D3299DA0B6B7B1 cud1w
2,421,616,913 *FFED2455B506164F0E611AB7D957A5A9E6C080E8 CUWN:
2,421,616,914 *FFEE9D481D90F39CD081A0AEB3F516C05C660D81 FERNANDOBANEGAS
2,421,616,915 *FFE44BF17C0AFB12A0C944A314AAA3B68F116B2E Cv"P
2,421,616,916 *FFEB9FD36FE850A33BED43497233A31F8ACEB5AB FIFTY FOLK-TUNES FROM HARDANGER: XXXXIA. STAVE CHURCH CHANT
2,421,616,917 *FFE7E2B68EBDE4DC781290D6FAEF89C6E32132B8 FILIBERTO.STREAM
2,421,616,918 *FFE374D5A32DB8C5B3D33DC625FAE1E17B9F76EE FISHILYV8
2,421,616,919 *FFEECFC1131B8D53F05428A107D0AE623FB72CF2 fishmikael
2,421,616,920 *FFE2C1D346546A6539800520599992230212A6B8 flechissons6
2,421,616,921 *FFEFEAA8FE25C99AF0F2EE5B7EF12949A2ED0E6D flu0r!n4735
2,421,616,922 *FFEAA0B29404294B38209EE22E91A1085895325D D1L%F
2,421,616,923 *FFE66BA876834E4006AF6FAC0BD56EED8BA316A1 FOR.WHAT.THOU.PROFESSEST,.A.BABOON,.COULD.HE.SPEAK,
2,421,616,924 *FFEDFC0F192E81C79618640AC61128D7FDC168FF D3X4
2,421,616,925 *FFE6031C7649C3205DD0C5DBEE84C12778F8F0B9 franciscorubner
2,421,616,926 *FFE53BFE993C03C2A938F134685655F933BF0BA4 D6B-H
2,421,616,927 *FFE3765CB4E8BD3430E554522DDF1A5A346FFDC4 franklynbrueggeman
2,421,616,928 *FFEC3EBD5F37E21701C11BA2920BE22BE165861B D70&K
2,421,616,929 *FFE4C0B0D898B178A5CD1481082F208BA59B29D2 FREEMAN.EICHSTEDT
2,421,616,930 *FFEAFA47DE9295B19B840F5D65E400AB26D95569 d7v4g
2,421,616,931 *FFE7018AB966B132B9BC5592B645999BBA86B863 FV>\
2,421,616,932 *FFE4489945B0AF7E856185629DB3B7F0C72FF104 GAKXUCOX
2,421,616,933 *FFE7FAD439BCD8AD126245DC8258820AFFBE1902 gaoluofen
2,421,616,934 *FFE652D093A7760CB178F7F1B78CF83FEDE58219 DARINHAZLITT
2,421,616,935 *FFE470327825833116F603AF752B1077B1BB8FF9 DARIOHLYWA
2,421,616,936 *FFE8EADE8B4662A76DBB9F4512DD4A879A6354C2 darnellhaugabrook
2,421,616,937 *FFEDDCA843379C335E8A94480E7A252E00EF109A DARRENBRADICK
2,421,616,938 *FFE45BC9E65CC45C4BA8AB620EADDCBF3594F438 gatecrashes
2,421,616,939 *FFEC6DC8165AD25145DB2B72D10C5BE09744621D darwinranch
2,421,616,940 *FFE28E4247F61E9675F33EEC99772B945D501531 dasi1958
2,421,616,941 *FFEFDD41E049A59DA78D0118CDE190C18715FF68 GENE.KIRKBRIDE
2,421,616,942 *FFE341E165B60787F565C09955E5B37A8B584605 geogenetic4
2,421,616,943 *FFE9A18C9DCBB2D8ABC2423548EEA372A03F8C69 DC:JI
2,421,616,944 *FFEE37A656C5888094D2AC1C13F8E616E890C364 dc&ki
2,421,616,945 *FFEAF43B0DEFE9FA2F333C40D2F740F7B2576580 ddw"_
2,421,616,946 *FFE190E15C3238033B33ABFEB498DF5822E98ED7 GIREDNAZ1
2,421,616,947 *FFE0F26C032B23167163FF00F018A9C8B07EA1FF GLAMOR
2,421,616,948 *FFE90B4F750EF51C5D2751A6AF8A7173E0C45D49 de-d3
2,421,616,949 *FFE03CD3417C3674B09363F6A759249FD31AC710 DEFINITIONCATEGORY
2,421,616,950 *FFEC5CE2806FEACAAF1D45F9498DF667B14A2029 DEFINITIVSENTENZ
2,421,616,951 *FFEE2CA2C251B420454FE64E555E353BA2E29932 DEHUACHENG
2,421,616,952 *FFEF90C4B38F16EE1CB0D694AAD8693F28DEE0CD Delt4p0t
2,421,616,953 *FFE357728419C413608F8523AF15148C8B4FE7A1 GONE.WITH.THE.WINDDUET:.DAVE.&.BUDDY
2,421,616,954 *FFE059EEE078BE5D86F37209ED5B83411AC2D442 denisbragdon
2,421,616,955 *FFEC2277BF32B5DF6FEEAE9966DA8E18F23D8F55 D:es
2,421,616,956 *FFEA339FF701E234E2F1590A3F6941C765554D5E DESTINY DEWITT
2,421,616,957 *FFE846D1A6A51EA84DD9158CF3A1D0FBE85E2A4E desubats5
2,421,616,958 *FFE7B26E8FF93EDF059D15BE5B70B6C265648FCD GRENELLA6
2,421,616,959 *FFE718FDE2D48FFD7A0B790A9D240DCF410283FD DEVIN-AYE
2,421,616,960 *FFE8711BF513DD8AB5781BDDDC83A40D7B4709EE devinbendick
2,421,616,961 *FFEF6DCF91668CCA88C42564B8B88B0EEE8A1F09 GRUGRU.W0
2,421,616,962 *FFEBDA7E3A46033245E2DE3DBFFA25622E6B3374 dez4a
2,421,616,963 *FFEA60CE5DD78FE1346DB3E93DF556048DF44F03 dfbw
2,421,616,964 *FFE95F463BAB233F6CC7B2342B2075E57A9E2D8F DGEHLY
2,421,616,965 *FFEC02396916402D09839C221EBE7DE59E0FD0BF [email protected]
2,421,616,966 *FFEC2CF3269147053BBA8ED0118285DA344AA5BB guymanlove
2,421,616,967 *FFE479DF606138C0D605B8BD572727065F886635 G[UZ
2,421,616,968 *FFEB299CF6F6B41068894DD8C13F729D8D0A2436 dh?cr
2,421,616,969 *FFE0B022D90F1DD828CBC0B15C74DC48A1E5024F HABBOZFORUMNETWWW
2,421,616,970 *FFE52A1C950FB1E0410FEB8931E7B1F782DE5983 DIANE BOURBONNAIS
2,421,616,971 *FFE70F299D6D184846B6048C663A0E06E0278E19 HALCUCCO
2,421,616,972 *FFE0A3647E778A2BE8F39C5472A1A4EB043678DA DIE.HIT-GIGANTEN:.ROCKPARTY.(DISC.1)
2,421,616,973 *FFED9E4EE9C07B2913E5AAF07C295587FE2D3ABF hany-abdo
2,421,616,974 *FFE7D883F574883011C01AFF2D93031B98B70B55 [email protected]
2,421,616,975 *FFE4919766B9D7D11F3BF9570EC465F07B872260 DILLONMATHAL
2,421,616,976 *FFE72431730A9192A976EF1CAF66262655E1BF29 [email protected]
2,421,616,977 *FFEA9296ADA9ADD9C9CC87BC8778C23AB9B922F8 DI+LV
2,421,616,978 *FFE72AF42F1FB7BDD2338F2A89558371D161C5F1 HARLANKENON
2,421,616,979 *FFE0C1E9771932E1A4687D9F4BA22042141F5FC9 harlankracke
2,421,616,980 *FFE96C5E897537D3AB2A79E93A061098D4B73905 HARRISBACHO
2,421,616,981 *FFE65835093FA3AAEB9D09EC910390F734732672 DI/VM
2,421,616,982 *FFEBC77A9AB9AAF9BD2CB1EF8558DF1AEE881176 HEALTHDOCS
2,421,616,983 *FFE1B150CE03EA800958A299EA030040886F8DFD D#J"K
2,421,616,984 *FFE71CBBF11E699B07C5D2D880122B8822DC4AAD heilafte3
2,421,616,985 *FFEA10C8C189AB76DB0369CFEFFC1A1000D06AAD dkjak
2,421,616,986 *FFE85CF992CC4C62AAC7835F504A57F5D732FA78 DlB&
2,421,616,987 *FFE16D735E994279FCC31E99B3FFE3DD383A3F3A [email protected]
2,421,616,988 *FFEA4E16AEE33A39DA39145B35E5EBC3AC32D23C HERMAN.ALLEGRUCCI
2,421,616,989 *FFED91C5B96420EC329C86A8AB145EEA8D342867 D=M1U
2,421,616,990 *FFEAAA7F58474BE1A4319998654936493DBE77FA dmanship0
2,421,616,991 *FFE3B1BA282AAF6E3C626476BD9C911A662689EA [email protected]#
2,421,616,992 *FFE782C8323A5E063189F781DBDA837A426D65F0 himself89
2,421,616,993 *FFEB66AFA183A6124AB78CFE7DC5599E1889E035 HIPOLITOCLAGON
2,421,616,994 *FFE5DCD73A30F61FB880C4B8E24D5B6267D92920 dn?xd
2,421,616,995 *FFE8A8716AD5B4B0EC789D0D660E02238BC104E4 Dobara.Theme
2,421,616,996 *FFEC47EB34BE0951DB240C9A9D39707D6A2FDE85 DOMITILA5
2,421,616,997 *FFEB5EC11C573F149F1FD7384EF6863680223EFF DONE.BALLOONMAN
2,421,616,998 *FFE6E88D522B5B19535DF3529833F2E68863EF46 HORN-CONCERTO,-OP.-58:-I.-CON-MOTO---TRANQUILLO---CADENZA
2,421,616,999 *FFEFAEE1431E209C40168EBAEA98E45A93609BFA [email protected]
2,421,617,000 *FFEC7C5CB0B452F27EE2518EA164381C8D3B5CDB do"px
2,421,617,001 *FFEEDAB817933EB70AFF15CCC2DE260FF2BD69B3 DOUGLASDELMEDICO
2,421,617,002 *FFE6AC53E8C002D5B14224A41C5493F7609536DC HTTPWWW.SOPTV.ORG
2,421,617,003 *FFEE34E14A02AD7D08E18CB6F3E1647ADD7FBF5C D%PM9
2,421,617,004 *FFE02BB79BC2A417F15BD473DF7BCD07ECEE5267 HUEYKREHBIEL
2,421,617,005 *FFE047316C14B7E7102CADEA5A0093EBBC981B23 HUGH.DEVLIN
2,421,617,006 *FFEC8B6CF175A2D3CD2A42FFE99D03E0716B0F70 dqji)
2,421,617,007 *FFE46F0B2F6D80AF95058D6BACB161C98E0D7441 HYPERALBUMIN05I5
2,421,617,008 *FFE463F33F8728DF1A6717696AC7190CB9F6F50B HZ=-
2,421,617,009 *FFEFECC6DEE3904482D7D3F06A479FD221EA17A4 drowning-out-the-world
2,421,617,010 *FFE81192477174C4F7A501E1B3E186C42BFC409D DR RIGHT DEMO ARRANGE VERSION
2,421,617,011 *FFE73C4E4CD3B724EBB5915B2852BC0C62F77DE5 ICONRSS[1]PNG
2,421,617,012 *FFEA7EB48542A6BFF19845256982A4C4E9C6306D dtilk
2,421,617,013 *FFECDF9A7D187D3277CE692B0DA97448E6B9D9A2 if-he-wouldn't-be-here-tomorrow
2,421,617,014 *FFEAE138789EF9C69E30EB887C9AB1F936396399 [email protected]
2,421,617,015 *FFEA4B32E6A3CC3F15808D062CA0641896BC7CD5 dudleybusse
2,421,617,016 *FFE471D103201816824498307D3A419A1C003FE2 iii;
2,421,617,017 *FFE0D7D9E78F5AE1F67538E88715029CC699C745 duvth
2,421,617,018 *FFE95B9119B3E095F5EE9C0C47BAA7B8404B28D2 DUX9
2,421,617,019 *FFE190E0AC426ECA66998BAAC7E9F73DEE2C4BF1 iluvbugsy39
2,421,617,020 *FFEB4FE6EE9EB39BB69F0E835B00805D6C205B2E IMPASTATO7
2,421,617,021 *FFEE2F8AA0152F9A9E112EC02FCE6CFD7D6B45BC d)z$,
2,421,617,022 *FFEC3F8428E7C2DD63795A6C6183B8EB43B61965 DZ8V(
2,421,617,023 *FFECA2EF83CF23E735E3859547C3865118B63A90 earth98621
2,421,617,024 *FFE4D85146DC62495E7DD1C343A6A79F689EED6D IPARINEN9
2,421,617,025 *FFE061F848D20E4057416C7289BFA521C8A841E3 ECS/?
2,421,617,026 *FFE9BED1CEE2FDA163B9B754CD8B834176677E12 EDDIE.PULLIAM
2,421,617,027 *FFE8418664AF98D16424157EB274D9BCAC84BE3A edificar2
2,421,617,028 *FFE47F09FC6587647478B49558FF4761E12BB6A9 EDMUNDPERFECTO
2,421,617,029 *FFE82AC62AFD241494368AB495EB41EBAD520DF8 EDWARDCUENCA
2,421,617,030 *FFEB5C8C2CE2337AC0B4F640B743C9522541827B I_STUNT
2,421,617,031 *FFE69BB2FAED27303432C08A862469C6D92B71DB ITTERTEP
2,421,617,032 *FFE689FE790C2CE7CCCBF405AEF6D12EA42C8AE5 iustitie
2,421,617,033 *FFE49BF68B5F5124C2D4787A8F2510FEEEEEAE73 [email protected]
2,421,617,034 *FFE49D028392E8D3E78D138295C210DA6D4D0111 IZJURIM8
2,421,617,035 *FFE9E6A5C47AB9256BE52074FA69BF8B2EFFC231 jackmortongrowsitscreativesteam
2,421,617,036 *FFE8B53E9E488EA434DB303B58C5D97CFBC579A1 JAEGIRRES
2,421,617,037 *FFE28F9FB780B145704AB04895C8216122344614 JAIME.BRUNETT
2,421,617,038 *FFE2BAAC7097A89776F19659DEE478DB23588338 ELDON.APOSTAL
2,421,617,039 *FFEF24BEDA817CD06B410B46073C6C00C223ACA3 james-endo
2,421,617,040 *FFE09DC758F5FA11D43FD5F19BE1A585B6E29F34 ELDRIDGELEARN
2,421,617,041 *FFE664AE643291AD4560FD4F34B72B3A837D69E5 eliashostler
2,421,617,042 *FFE59EB866D28806657C04E28243EE8DBB483D0D elishafoddrell
2,421,617,043 *FFE6AD63B12FA067B6D62408B511AD2C794BED9B jarradkenny
2,421,617,044 *FFED76F69C91BEA6617E6AE0039951804F05DF0F el paso del trueno
2,421,617,045 *FFEFE16C09A557301DCB4E82D9992A84437A83C0 ELVIS.BAINARD
2,421,617,046 *FFEEAE2F0943FE3F1BD46AD173981E50665786A3 EMB4I
2,421,617,047 *FFEBC8447AF244BEE57D4F86F4F7708BB2912BD3 JEAONNE8
2,421,617,048 *FFE0BFCB2DFF5D20A9E9F88859D17C4EDFA57B3C jedhungerford
2,421,617,049 *FFE1A5BE1D3F7B7882415A4B5250C1F610ADD019 emmanuelderiggi
2,421,617,050 *FFE6E6942C43244E1B1E084CB0460CD708E730BC en2449441
2,421,617,051 *FFE46D5DD00D237375174786999D7F7F2ACAFF4D jenvogt
2,421,617,052 *FFE417668482748FB597961F442FA88196DE52A5 ENTLEBUCHERCATTLEDOG680
2,421,617,053 *FFE335D0A5832C38A9974CCF1897810BDAF08BE8 jessicalongford
2,421,617,054 *FFEB1E564489A1680F81C6783978C345C96E532A EPA=
2,421,617,055 *FFE07906F76E721D522F2CD6AC90DB1C435F0EBE jijogeorgephilip
2,421,617,056 *FFE6411DFD1A9742429D36750836899D3CAE611E J[IM
2,421,617,057 *FFE8C62DF4E3AA3A17D4EC19F4E2E02766070A78 erikdeutschman
2,421,617,058 *FFEF1B8E60096A55F9092417301E459D5F20B3D6 jocelynn774
2,421,617,059 *FFE4CC28850CA2E40D85F527DC1AC29D5BBC13D6 JOEY.IHLE
2,421,617,060 *FFE5EE12B94E90C1AC934A63440E936E9D3725D3 JOHNIEDEINERT
2,421,617,061 *FFE14C7A05236BBA2D65CD2D6B52102A51FCD309 ESTELLUU
2,421,617,062 *FFE930F6DD42026C285C656FAC8FBA9E1A9D79F9 esuohihs1
2,421,617,063 *FFEFFF5BE1F6DE21ED4FFF04288CE6ACB3A97B95 JONGGETROUWDEN6
2,421,617,064 *FFEF4ED2AD34225DD408995FB918F76192148925 jordonlevesque
2,421,617,065 *FFE18E05C7D5036E249DDADFE6BB4C8F5C5C5617 ete9g
2,421,617,066 *FFE8A0CA3BDDF039825F0E02335A35A6B465BC24 josefkirkland
2,421,617,067 *FFE26FBA0C25331E2E770F0B70AEED9A5E7EACF9 etmo
2,421,617,068 *FFE541A0DCE9AAEA7F6DA4DC5C9C0EDD5E722ECF Joyrde$
2,421,617,069 *FFEA00EF113A165F13C36277ED585061ADCA18B5 EUROSIMULATOR.COMWWW
2,421,617,070 *FFE7BE8A9A8CA92BAB5054394599068CA9C4EE79 evalill
2,421,617,071 *FFE516F46FCB1BE2B203DC89165186F7ADF06BA5 everetthauxwell
2,421,617,072 *FFE57CF51742C7DEF46881AEC40FEF4067080C7E EXCHICAGOAN
2,421,617,073 *FFE4C3D8B72FEAE4AF25C24770BC574EDC83DC64 JULIAN PHILLIPS
2,421,617,074 *FFED5AABEEC0D4A38341BD8327EFA4D12C1888EA juliefebey
2,421,617,075 *FFEE98658181C57404E866731690B46AB8CADBD6 JULIUS.MONTIS
2,421,617,076 *FFE319E2BE0B3A6C8102C71D39E9A79A94F245E0 ezatullahing
2,421,617,077 *FFE412090A014C494142C77874EBE6F8AF16C0A8 [email protected]
2,421,617,078 *FFE34A474846E513CCE339F4D163F3F59E6F21CA jy#-
2,421,617,079 *FFE2A249B5BD1186AD309F5812EB22DCCACD3642 [email protected]
2,421,617,080 *FFE99F3C064A37E9297ED291180CFBD4363F14EF jz;|
2,421,617,081 *FFEFA8DB5FD9DF0C5890742AB1505E003C8E128E familienfreibetrags
2,421,617,082 *FFE5E1B899F8DD39681FC9D4398BFF2857CB2AFA fanatic f ah0 n ae1 t ih0 k
2,421,617,083 *FFEF8E8EE13A79DD3B582CB9BE8695BC3CBDF7CC KANANIF
2,421,617,084 *FFED9B0E889ADE7296909D6B82674C0C6E8C0C88 KANGAROOTOMAHAWKS
2,421,617,085 *FFE4235CFD3AA406A442230484EE5D14F3FD78C0 KANTHALOT
2,421,617,086 *FFE156E9AD64F053D385B36DE863D7E411ED3037 FARRAZH
2,421,617,087 *FFE60384F6CEABF27065E7D5957A10A4B16140E7 faustinoclayson
2,421,617,088 *FFE9530977E0CCF4629822C26570CC4C71826CF0 KARIKOSH0
2,421,617,089 *FFEE94A62A4D732709A32C3C88DA3A64836B5321 karltamborlane
2,421,617,090 *FFEA75D6EE1C481E88B6D734AC00A4478987FAB0 federicoaruiso
2,421,617,091 *FFE113037E6D93F20787D0122F3877D5E0833EEB KATTERIGE123
2,421,617,092 *FFEBAC3661155AF39C90E24BFA0096227744C61B [email protected]
2,421,617,093 *FFECB201AC5E199A8D711CD735F8B8701EC50395 ferrer.ferr
2,421,617,094 *FFEEDD2C7EBDFF381CAEB0BB8AA4D92FAC0F8E5A KEEP FAITH WITH YOU
2,421,617,095 *FFECEE24BA9266CFEA5FA4AC56BFCB8CBD0BAD3D [email protected]
2,421,617,096 *FFE8364E5FB8918FD1DD0CE2EF65A233F47586E6 keltiberyske
2,421,617,097 *FFEF080A83AB0D0F012453D82E26EB7FD5D2B28C KEN GOEBEL
2,421,617,098 *FFE05770572B49EED69AA67D6F88D69F779C1BF0 kennethsamayoa
2,421,617,099 *FFE3D2ECF2157261BECD86AD3CEAFAFCD6E817BB KENTONCAPELL
2,421,617,100 *FFEA336BA20AAB1701700D1A896BE1B8BB0C6D83 Five-towns
2,421,617,101 *FFECA8A0455D8659516075D264B5E0895073ACF2 KERRY.BARN
2,421,617,102 *FFE8D139FEEEBFAF4C981B93513501C2A2C41109 KERRY.BROYLE
2,421,617,103 *FFE3BA817EA2CD322ECC6DB2EDCB06C02854CA3B KERRY-HERRING
2,421,617,104 *FFEDC8D043534443AF881F71B1071B813732D334 KESHA GRAY
2,421,617,105 *FFEE75A21EB973BF7A270D93154D843DA18CAD9B KEVENBAUERS
2,421,617,106 *FFE20A227569FD3D20FD53768E18FD13079722F7 KEVEN.MATA
2,421,617,107 *FFEE225FCA34E0947813F5A903600E61541625D1 KEVENOTSUKA
2,421,617,108 *FFEAA0488F5469EF45379C7301E0DC1D5D2D9791 KEYSCHAPEL
2,421,617,109 *FFE22A7089B17D09CDE45AADE847853245CE7A58 KHS_08GRAD
2,421,617,110 *FFEC41F165BB9736CFB1FDD3C67AE1E25FBBAF53 FOELSINGER
2,421,617,111 *FFE6BA11B286A213D0325E6BE496EDB0CC93C43D KIMDEREK6
2,421,617,112 *FFEC37382612E7BF4D2104BE34D822C8D4AACE77 kirchenthnm
2,421,617,113 *FFEC1A6E6E7BA1AAC200495A04A1F83DDA12B4DA kittypearson
2,421,617,114 *FFEA3793369ECF5C4D2D01DD4C4BFB342A691973 kkh<
2,421,617,115 *FFED095C7D0B1B03F05101818F981372E9B49803 KMB7899
2,421,617,116 *FFE3AA9557F897184C59C4D93D61B499C0FF5E95 FRANK.GOVER
2,421,617,117 *FFE57A4360F6C3DD6DEFFB560610C1A0158C665A KOREY.KIMBRIEL
2,421,617,118 *FFE2A213E2D7AE5B77801E3B30829EAE33FB92A4 korsvirkesstaden
2,421,617,119 *FFE383EB5D5619A09409906F53BE1DB0E8426D45 FREKVENSFORKJELLAR
2,421,617,120 *FFE182F8BACBB901E17A73B9EB72797B4307954F KRIS.RISEDEN
2,421,617,121 *FFEC716F34C65FF90E32ACABF754F9C4279C34DC FROOSTAEE
2,421,617,122 *FFE92A033EF24087E67C16AF55D8CEAFE6DC7DE1 KRISTOFERTANDON
2,421,617,123 *FFE938081BB89320623F53B8DB06FFA8B9FB170A KRISZETES
2,421,617,124 *FFEFA0EED3A75B4B88003ACA2BEA18CC4A77E736 KRITIKOVALO
2,421,617,125 *FFE5ADFB06F2E1D5938A4008289E4EAAA095F9FA KRIVTSOV4
2,421,617,126 *FFE0A3C01A3EE9EC6A8622DB1E3C3A4680C94131 la chapellevillars
2,421,617,127 *FFEC3F971F0F89985B8D5E568558BFE4A8D32927 LACYRIEMER
2,421,617,128 *FFE018A48DB3A306EA8A3445D367CCE4E7FEC0F2 GARENTÉTA
2,421,617,129 *FFE40695599423576FEDA04C9B7DEB3144439812 garfieldsidney
2,421,617,130 *FFE750B017747BD1E6586438176E9514557B79D4 GAYNANALAR
2,421,617,131 *FFEF6B3D08B69170B354D551D48518615735F5BB gebuikt6
2,421,617,132 *FFEB0F9BEA6D46E021F5508B9AEA4ECE8B2C5D8D LATSIRC-2
2,421,617,133 *FFE6C8A300C33C52163F2FB380FC22821A072FFF gerachtshas
2,421,617,134 *FFEDA865D470046A5AA740EB68367598D93A9E09 GETFEVER
2,421,617,135 *FFE550BF7CFCF77DF002903C58FAC9CC82ADA571 lemuelmagathan
2,421,617,136 *FFE86AB11A14F78E5234D6C62CD3B1F995CDBC8B gluiest
2,421,617,137 *FFE4D2FFF31DBF1AC703249BB84A9D59FB01D510 GORTCHAKOV1234
2,421,617,138 *FFE24FB68D63909E014B52164D9482317709A36A liffbamba
2,421,617,139 *FFED183BFF94E038AF6C0A8A5C67BDB95B102559 GQ{H
2,421,617,140 *FFEB5CD73C395201B3F3298BD9AA5653B4295124 GRAPHICALAPPLICATIO
2,421,617,141 *FFEBF14C215D06A0053717564AA5080AFFC28366 LINK4G3'$
2,421,617,142 *FFE35E27A299FBAE703A95F5510975D0FD2A947E GREGG.TEAGARDEN
2,421,617,143 *FFECA5EE1347C39FC8565DB2ED215780CB367F0C GREGORYLOCHAN
2,421,617,144 *FFE32F882BDB1F2E85D8C96C92A5321CA87B90F1 grenokid
2,421,617,145 *FFE36DE3CCDA0665989B31E8CEEF3DAC99CA21A1 [email protected]
2,421,617,146 *FFEDFFE44A25D859AA316159779197A3BC660F52 [email protected]
2,421,617,147 *FFE12ADC06F14E261AE656AE402118E6743806A3 LM-A
2,421,617,148 *FFEE671E5ED8BDECD7C3D6D143C3B23CB30279DD LMOGWERA
2,421,617,149 *FFE0B93463A572113E9002A2D0DA0BFBB6C57C89 LNS[
2,421,617,150 *FFE382A00622F6EAE478DC0A22803969196BB805 H0MBY
2,421,617,151 *FFEF2FE23CD07B11B12A41B12B14FE3C7FE8E085 LORENZODYLLA
2,421,617,152 *FFE38BEA22188C1027819C7FA98212A6A454BBC5 LOU.LATOUCHE
2,421,617,153 *FFE4C5021A908D6D75EEC94133FC4F73D500DC78 HAIFISCH
2,421,617,154 *FFEE842EB7D28F55E5DA90B9309A450F0F82C035 hamonit.hatsehuba
2,421,617,155 *FFE68BBC492745AB95785712DFA07173AA3135C0 LUCHTALA3
2,421,617,156 *FFE7C85A1CB2A0A363F672A1FE5263E1AA9184E9 LUCIEN.GUARIGLIA
2,421,617,157 *FFE74C9C68B959C1D85382497AEC7D238A12767C [email protected]
2,421,617,158 *FFECB08AAF1A269360D89BC5CD7570FB2EA41E72 happenedbefore
2,421,617,159 *FFEA32CB2E8D52024DAAE642DF7DF2DDCBF75746 LUISSPAKE
2,421,617,160 *FFE2BD28ADECCD0D10882050B0A549DD1066F665 harrisrosenkranz
2,421,617,161 *FFE114ED9176CCE90689C7BAD302D97D3F8A423B LUPEGLOSHEN
2,421,617,162 *FFEB5E8E2D922092E285B4DB615FC40F2203E8DE haywoodsadak
2,421,617,163 *FFE21E4D6178DD996E03F7596BF1CA0EB099FF21 [email protected]
2,421,617,164 *FFECED38E2F503635198533BF74848D001A768D2 lynn.e.miller
2,421,617,165 *FFE55C2AAA0DDB3E3A30B7607190D5ED0BA4F3EE HEATHVINTI
2,421,617,166 *FFEA3F6C9B08F503578EEBBDFF745CE8A04D1721 he.could.so.quickly.cut.the.ionian.sea,
2,421,617,167 *FFEDD0AE7093096BDD9CCB4CC747C22217813760 macbrowy
2,421,617,168 *FFE184233A8E95476C890D88D800383DABE3C5FA [email protected]
2,421,617,169 *FFEEB8FC6524B1F1C04B9B9C303F120E671ACAEB MACKTOOLSON
2,421,617,170 *FFE03B1FCDAF1A15392B934120CECD17D90675DE HERB.STACK
2,421,617,171 *FFE22B1264BEC1AC67EF24C6FAD38BD1F87CE117 MAGNAND
2,421,617,172 *FFE0166F2D64841816EA2C7527B8E24CED3319F1 \<hg
2,421,617,173 *FFE6195B1E83C302D0BE89BF1B4DB16DDF941E1E mal.de.amores
2,421,617,174 *FFE50C258AFAA40825B2377B3223A5404FC08BBD His-Holiness-the-14th-Dalai-Lama
2,421,617,175 *FFE552B4EA9DD48234998AE0F1D9F57A991D14DE hispifib
2,421,617,176 *FFE0CBE0BBA05FD1377FD440707B7222DE9194D8 mama,-mama-blues-(rusty-dusty-blues)
2,421,617,177 *FFEC1AD2D2B9188526C5ACB5A46B38E86A546BA3 HKDAMORH
2,421,617,178 *FFE49E040B2615973CC9D089DBC746C4DB0CBB68 hlinka1
2,421,617,179 *FFEDA11D5C44F8B27661D92C88C0CB3678F9BF02 HNEGRAHC3
2,421,617,180 *FFE5DEC1F85C56B1852FB73140351E428F75B28D [email protected]
2,421,617,181 *FFE2373505DFA835D57DBA99106B70F3862A7197 MARIA.DE.F
2,421,617,182 *FFE23059B000FCDCC15967A745443D1298302A8A horrors
2,421,617,183 *FFE6706F984A1222AF317B3D0BC38D09CC2CBD1C MARKBERRONG
2,421,617,184 *FFE74C982ECF6D2CDEB913555503A0CF7058F5CB MARKUSBADON
2,421,617,185 *FFECF6165C3336B636B7F10756507422D8FCC44C MARTIN1
2,421,617,186 *FFE9098E8406F7D6E871A109C88DE6CB40FF09E7 MARTY.HAWORTH
2,421,617,187 *FFE3F0E2F5ED2489AEAD819A7C1C4B3BC746F6CB MARTYLEINENBACH
2,421,617,188 *FFEC0855920E367128DDE9B49BFBCB331D43376C HUGOPATCHIN
2,421,617,189 *FFE3BBD403782DEDEFF2C0815750A0B7EC33E264 hunde,-katzen-und-andere-haustiere
2,421,617,190 *FFE8ADA2EF7B0F226E857BF8BDEE1FE79E909B8D huskersfriday
2,421,617,191 *FFE2836BA19823AC141BA945D3CF389AF9A9B680 matlined
2,421,617,192 *FFE703926808F4C5932DA267DD125BBFD9C8E646 IDIOM8
2,421,617,193 *FFE39E6B7A8CD8F44EF000A11AC99E71532EF0CA idylists
2,421,617,194 *FFE57F21D24EE999D69712221433396089ACECF5 If.n$.=."q".then.n13.=.81
2,421,617,195 *FFEBF7FC53A7D85AB603FBF0C984514C399DD856 iFq
2,421,617,196 *FFEED18CD0F9FE07E4F1686E8DCD4C3D098CCB94 MIASTKÓW
2,421,617,197 *FFEC64E67A9DCF47F865FF3021743F85A3837A4E MICKEYFIMBRES
2,421,617,198 *FFEECA6A8703906D2C757C1D93BC225AB8D2FF56 iluvpoppy2008
2,421,617,199 *FFED5F56703040F43D3E1F3BA2B61E85AB11E05E [email protected]
2,421,617,200 *FFE74EC93407F7A1C252A298DEE2525A2511DC26 mike_20
2,421,617,201 *FFEA9A3A1B29EDFCB26A4E2830F74F3A8BC49392 IMRIRPOCS7
2,421,617,202 *FFE85E4447FE3FC176F8C08C1FB8410ACC6E1EF9 INCIRLERIDIR
2,421,617,203 *FFE33E6EA8B2CB53FE78B3B95316516A0C51BC43 INCLIN47I0N5
2,421,617,204 *FFEE9A65A48016783FD55BD83A4C4BEBDD8DDCE6 MITRA.HAGHIGHI
2,421,617,205 *FFE5912F3C3FB17B79097EFACCF0ABC88C2665B7 mittensdenver
2,421,617,206 *FFE60023EC6D33051D0E76310BFDE238E1A10518 INTERROGACION
2,421,617,207 *FFE3474254AB16320B0D72E813C5CEEA93B94E75 IONADAB8
2,421,617,208 *FFECE10C9FF715515E3E9FFD0E0755C09E43F17B mohd-asri-abdullah
2,421,617,209 *FFE7E11AEA04974610F51FEF369B56AD1DDE77BA IRIKASTEL
2,421,617,210 *FFE44056306954EF885469DDAC29E0EFC352A3E7 MONTYBEMBI
2,421,617,211 *FFE9B801702BF28A9736D6A86FDBE76AA4001363 moosrücken
2,421,617,212 *FFEB33335EB249E303729BE80EC50F9BDE0F0F40 mp5ka5
2,421,617,213 *FFE9222C8946D4E23DA447891D57E0EC0653F7BD i-want-to-be-somebody
2,421,617,214 *FFE341E9113916705C503963F5C916299802A529 JACQUES.SOMES
2,421,617,215 *FFED888330488B8A9883C98E50F12D9869DF852F JAEKERENS
2,421,617,216 *FFE89166EEAB3AF278FCA8930C08D5B2AB312E69 JAIME.HILBNER
2,421,617,217 *FFEB0C792A8C0A9F6F779D5A0D90713809CEAFF6 myaunt08
2,421,617,218 *FFE251903D266740EB3482A0EE19C7B32BEB6514 myvonne9
2,421,617,219 *FFE16674B402795D5ABCF790B6C8B0AC8FD790DE JARVIS.BLASKOVICH
2,421,617,220 *FFE4C78CA0C101923858D78398B295399FB0162B NADIACOSTANTINO
2,421,617,221 *FFEF8149886905DC73548E86BFC1F9DE6098A224 JASPERTOUSANT
2,421,617,222 *FFE14751B735732AFDEF0B575B7B70A1367D5A21 JCSD1234
2,421,617,223 *FFE25E2D62C2FB0BC2090707C29CAC18158AB39D NAPOLEONORE
2,421,617,224 *FFED1391410B738E465390002090EC254BF65A16 JEAN-BALLARD
2,421,617,225 *FFE94C36AD16F62628C911219A007A10B9596C94 nathanaelrovinsky
2,421,617,226 *FFE86BEDCA52209A3DE6D9F9A606EEB09F52237A JEFFERY.BUCKLE
2,421,617,227 *FFE59A29CFEF98DA71EEA57004ED2C83485ABF89 NEBRASKAJORDAN23
2,421,617,228 *FFE0B42992BF95FB2557E470B4BFE7BAED4CD0D7 JEROMY.KINDREGAN
2,421,617,229 *FFE79BB65B918209C979F47D26D7A99E17A1DF81 JERRODDOMEK
2,421,617,230 *FFE96D530A345BA483A1FD6622359A4FF73569A2 JERROLDKINVILLE
2,421,617,231 *FFECA1F76020081738160FC677BF74F3870635DC JERRYJEN
2,421,617,232 *FFE2ED5031E5F966AE0A8D7001CC37EA1520B056 [email protected]
2,421,617,233 *FFE9F621D6AFACF376C0CE6F810E5FA516C067C3 [email protected]
2,421,617,234 *FFEBCFF226DAC0F4F4EA56B847C29D0901EE213D NEVILLEPOYNOR
2,421,617,235 *FFEC538F50F89DC48B3034E8769D28ADD6BB907E news.gathering.(1)
2,421,617,236 *FFE572A08BC288F676A7EF2BF72DA337F78D7422 NEZŮSTAVEJ
2,421,617,237 *FFEAD8C64CC366F6D12E58C6A41A35C77FE0BEBC [email protected]
2,421,617,238 *FFE87C17F266A2E87E4CF669180E5E4876F7CE46 NICK-CURRELL
2,421,617,239 *FFEDFAA6FC6B01DE2F284688424C26CF772E7186 NICKOLASMCCRAIG
2,421,617,240 *FFE1ABC67450CDA2A03D7B8028D79F389C40BBB9 NICOLASALTMANN
2,421,617,241 *FFE6B00E20EC184BFFD75072E2C757999F3732F3 nightwatch(disk01)-track011
2,421,617,242 *FFE46DBB8BB3C4DCBDF48A79403C6EAEDCF04CC2 JOESPHSVOB
2,421,617,243 *FFE9E77C306A05910B1D935FD33E598A3D9D0312 NKII
2,421,617,244 *FFEE5B150C4FEA2628EAAC4185929F2C7D1DE0BC JONATHANLUSBY
2,421,617,245 *FFECD73476D47EE03E32AE2DEAB0C8DBD85C5B40 JOSEFMCCUBBINS
2,421,617,246 *FFEDF63E1BB2DBDDC2A9AA378243E467EF0DCB22 NOOKERY1
2,421,617,247 *FFE6173632E63DDA2D43322FFB363258081A0780 north-miami-beach
2,421,617,248 *FFE2E596EC6CAC793F0B505C7F04E32D68BE6F09 NOWCLUBBING1
2,421,617,249 *FFE0BFAF7C4C97FDF1A008DBD744C4938F66A48D Judge.and.Be.Damned
2,421,617,250 *FFE2C0E29E6E6647BD455FDDC3BFEB4AB47848E2 JUDSON.LAURION
2,421,617,251 *FFEFBB0FAED160FF69AB24EBC0DEF1B276F1249A juety
2,421,617,252 *FFE65EAAF71FBEECB3A0D4136FB99B0B42BE6D40 NUMBERS.GOVER
2,421,617,253 *FFE6216E70F816A20C17CDCE0C609593B7BF3AFA NŬRŎNADA
2,421,617,254 *FFEF784C05A7D652776A1CE3B6896366B14071E9 OBVIOUSLYHOMEMADE
2,421,617,255 *FFE08532D1E2DC720C9C724A1AC43119FCD2D359 }o{.~.~.d------8
2,421,617,256 *FFEBB4952249B4C56641612809639F7C41BB7CBF od>o
2,421,617,257 *FFEBB5CAFD360E0E7FC88AAF0D3A1378DC0DFCF9 KARLTUFTE
2,421,617,258 *FFE211FB545364F1FC4C7D3F50C8B92974F8E9F1 ollopanuf
2,421,617,259 *FFECA00D5A0B8773E734A32DD0059DFA6CB0AB01 ONNEEMBAAR
2,421,617,260 *FFE7D03C94BD841BAD00BF8436B79D671E1967C2 o><.o~.o~.dq
2,421,617,261 *FFE1679E807DADB195C6C4053DCDD6A75CD50C41 OPENCHAIN
2,421,617,262 *FFEECCDEDF516B15D53C69E6A27D854373527ECA [email protected]
2,421,617,263 *FFE953568AB4428E20AB648E87B893459DE26373 khpf
2,421,617,264 *FFE50998EBBC849094CF6FEF32316A8FD72D4C8D KIN91E+$
2,421,617,265 *FFE89C7DB835954862F53D9E33E472E1C967910F KOREYKIMBRIL
2,421,617,266 *FFE6D4FC5F1663765BF5AAAEFB1BA785E598F6D5 KOSOVO
2,421,617,267 *FFE0A947EA00A1E48C8EAF97C771EA566D6A7243 PAMPAGRA5
2,421,617,268 *FFE8CCDC68C23425DBD40FF584298C5EF6946253 KROMPHOLZ
2,421,617,269 *FFE5DCEE1B363E123ED4765A6C9528F6A186133B PATAGONIAGHOSTS
2,421,617,270 *FFE125C1B89E727A6AB165EAD29DC70841CA4D86 PATH.BLOODY.PATH
2,421,617,271 *FFED6E4A9CF0871B6053877EB716F57FFF2805F4 L&%|
2,421,617,272 *FFEF0DB2A9E1F7C8CC4175B51428543C003D1FDB PAULINA081
2,421,617,273 *FFE2755E7D9AED543D09C413B835A377B88015A7 p###b~0(0_<)
2,421,617,274 *FFE2367D10E35D1E71FB230A497B01B0D21AD840 p------b.~0~o.o->-<
2,421,617,275 *FFE7C065917D0F6245460A676EC39C8BAB8799E4 p_brushedcorrection
2,421,617,276 *FFE53AAA0EC403D1E5F5B245C462173B0463FA15 PB`.SPLAT
2,421,617,277 *FFE26EC4650793B3AB0892D76B9F5F83CE1390A4 landonclam
2,421,617,278 *FFE8B1215F0AD5DF981D114AC6B9623E5B1CDDAA LAUREAATTI
2,421,617,279 *FFE974FFD7FA9B07E11398A512E0E10B5B9F4A4D peteyork
2,421,617,280 *FFECCA6B48DA6A749F3B8997FAE8980A24643B8D LB*
2,421,617,281 *FFEC2C393ABB7FB8166A7DD0713A0C1437218E8D ledarna1
2,421,617,282 *FFEBEFD12CE68468E21F97EC4F7D28216453B282 LELANDKUCINSKAS
2,421,617,283 *FFEBCC3C0756106F9C6C6C19623B4CA43FA2B148 PISKAVICA
2,421,617,284 *FFE745A77DEE45DF5D14B88128F370902AEE195C plane$7
2,421,617,285 *FFEED8E3323A59422086ABA1AB9D691A22B6CF46 PLANE$7
2,421,617,286 *FFE12395D1B851A705B52AF27C01D5CC74A79D30 leslieolah
2,421,617,287 *FFE5E3A14A001FC51D545FA95B2FEC812E0C3C0F Letrehozasat3
2,421,617,288 *FFEE96BC4C732CE319C198777E38F8EE7E95299D PMPRDNSSED
2,421,617,289 *FFE5E2FF3241EA1F474B2E0B1C1264F2993EA44C LEUKOMETER
2,421,617,290 *FFE3A452605A7D35BF3A1848632584E781D08ACB LGANTESING
2,421,617,291 *FFE888EA2FD0D42908B5A04F1CB35C22CCE9D8E7 POLAGANE7
2,421,617,292 *FFE1786F36140379D594C38F5A729BED3FA89810 LILKEEKAT1
2,421,617,293 *FFE85BB46C513928ED6D6697881ECC7EF55AEA5E PP2AC
2,421,617,294 *FFE519F2FA2289D4F22CB29A68F1D42256653361 [email protected]
2,421,617,295 *FFECE23137A3C674DE8E99439D691021AAE43714 PR0-$A1VA
2,421,617,296 *FFED348AE8A9F0677D8BFE664F46F463BB1EA64A PREAVEX
2,421,617,297 *FFE1EEFE5CB76500F8430FCD3B81A024141F7037 lokgirl
2,421,617,298 *FFEE48BEF62AB9B6994149E7A2B7928623871534 LOOKY-LOOKY-YONDER-/-BLACK-BETTY-/-YELLOW-WOMEN'S-DOOR-BELLS
2,421,617,299 *FFE5546360146F09D978266F72741F36E0B0B382 PROPOSITIONPHRASEPOSITIONPOSITION
2,421,617,300 *FFEA1B3553DD9E35BF6745458262A8F9B9D7D781 PROTOMIXE
2,421,617,301 *FFE7671E81ED218514D3E5A880F7DAB29498DE9A PRUZINU7
2,421,617,302 *FFEE504679104D2E0426B167DB3EB52BED5ADA74 prv47zn9
2,421,617,303 *FFEAEDA0BE9FE4A362C3EBE5A4F689714188C2CE LSUDO
2,421,617,304 *FFE921D5B686A31DD29E2AB40B2AF981BF0543EA LUCINDRA0
2,421,617,305 *FFECA478B7198E2CDF5F50CDBDA4D9347486010C PVEZIR
2,421,617,306 *FFEE4BDD2962758881A3E6A2876D1A4850E72533 [email protected]"W
2,421,617,307 *FFECC468ECB2094C7ACFC62F1CA8AE88090179BB PY9Z
2,421,617,308 *FFEC21AD8308766944CD581DC2FD2596E8EFF2C3 LUKELAPINTA
2,421,617,309 *FFE82AEEA7C59AC5D1A3C11AAEC60A662DD96627 LUNAR-CANOE-PRODUCTIONS
2,421,617,310 *FFEEC27C3AE69A6B0C8B5AABA102D84441B0C22D ly<4
2,421,617,311 *FFE54EEEF6FC17790DA42B8247F1524D9CF8E2D4 Q###D~O ~OSPLAT!
2,421,617,312 *FFE4D7D79BFDEA242927694A11E1CD9C2EED75A9 [email protected]
2,421,617,313 *FFED741494841D01AB0901DEBFEB036E64BE5E8F [email protected]
2,421,617,314 *FFE97DCFC37C52CFEA4F48ED8EAFFBFEB18EAE85 [email protected]
2,421,617,315 *FFE895E59CC1FC7108D2325029120F34D841DE3D M3THODIZING
2,421,617,316 *FFE769B8C306B890C1A61CCB0AEC86B6838BF723 QUEFX039
2,421,617,317 *FFE05F8F56D959D7B7EC6EDF890924D327A78494 QUINTON.COPPLE
2,421,617,318 *FFE44CF95CA340E89CCC933CE33E55581CC28785 mahmoud.elwakeel
2,421,617,319 *FFEE777E6EBDDB859F7CC19F1A1CDA307E29EB4E [email protected]
2,421,617,320 *FFEF2B0C3081A0BEF9395FF2129FE7923931DDB4 mainzollamt
2,421,617,321 *FFEAD4216FC724A9609B872BB0F07DFBD5DE093C MANCHURIAN
2,421,617,322 *FFEB3C863A3A17C5D90D193601BD81E0FA1AB9BA RAHUL SHIV
2,421,617,323 *FFE93ED6A37B9909D6837250B81439CB4916CFE1 RALPH-SORRENTINO
2,421,617,324 *FFE3F21A45AC9415088896A49BB27F534D383D31 marcelrudlong
2,421,617,325 *FFE171BEAB8EEC7AF0BEF993D259307998ED7ABC marcjoel2
2,421,617,326 *FFEC944A2D0E5CCE84A87B58A93E5E209DE24A23 randolphhardiman
2,421,617,327 *FFECDAA40F4859171DEAFBEEF69E61D341775C47 raphaelalsaqri
2,421,617,328 *FFE1412CF3B05EBF36467865ECF69877265BA4B8 rascaless1
2,421,617,329 *FFE0C22E153BD1BE96D89582C60B22A9ACC9F8AD RAVALDEZ1
2,421,617,330 *FFE452CB7C1CF91381BDB81C51B7A82B5CD48D7A RAYMONDGORSKI
2,421,617,331 *FFE880A53B7EC17C01F6C3F205B40BEE21753FF1 MARQUISPISZCZEK
2,421,617,332 *FFEB2470FFFD62AEA26E6E9554A1A4DCF1FBDE56 RAYMOND.WINDSHEIMER
2,421,617,333 *FFEC274E60DDF6C64ED3C0AD9D31798C0740A709 MARTHA.IVONNE.MARTINEZ
2,421,617,334 *FFEE17C76AA44758834BBB247064352DCE481C8D MARTIN1
2,421,617,335 *FFEC69B61BD6F1A351BA7B243D050FE04282B5A6 masupha4
2,421,617,336 *FFEE7E5BB922E81D732B95D39AD1A3786D80F9C2 REDUSERAST7
2,421,617,337 *FFED7CF36999CB29E25382F991359AE250079F97 REEXECUTEDT4
2,421,617,338 *FFE2D3618AF6C8ACC9B4569AE029A38104E0F51D REGISTARMOS3
2,421,617,339 *FFE12EBC71ECB928314F0ADA597FF421B30E2074 regoobtacbob
2,421,617,340 *FFEDD499693D74B00047CEB1DE0550FB79D7E989 reiddammad
2,421,617,341 *FFE5E27BBE8AB4F378D19BF693C5E3DC3788522D MEGGONDOLATLANUL-1
2,421,617,342 *FFEDF64E7D7FDBCEE3A9AAF88A4A58DFF59DD7A3 men.look.at.women
2,421,617,343 *FFEC2B65ACE5DE084C95EA0F1F5B3502751ACC29 [email protected]
2,421,617,344 *FFEB9DFB76ECAAF415DDB8E000E3404074D5B4A4 [email protected]
2,421,617,345 *FFEE89A6BA913C3C550893624125D66D54A54BC2 MICHAEL.KRONER
2,421,617,346 *FFEB06C6A62728C6B8A895EE43A2015F42887AE1 MILICA.MATIC
2,421,617,347 *FFEF535ACAE4CC47428F77F2A567195BAB93496D rickydella
2,421,617,348 *FFE7C5DF7F875EEA250FB073D041C25EBBA31314 RILEY.COLTEN
2,421,617,349 *FFE9D813189648D28E9AB5D5C545B97D3AF90B52 ringaroses(feat.narstie)
2,421,617,350 *FFE8E773514F3F018C55BD40108CE4B9B189A04E RIVERGARRETT5
2,421,617,351 *FFED5889C7A7FA19EBFBF9A98FB9AF6F48A3C8B1 RIVETS
2,421,617,352 *FFEE4960BC9218DDEFADD807B0D2C5A19E08FDF8 RKEIMMILLE6
2,421,617,353 *FFE86170DAFC03D5130AE40519908B72A7A84274 [email protected]
2,421,617,354 *FFEF3411E23D6DB5F591EE7D758B9BF5355DC2AE ROBBYDAROS
2,421,617,355 *FFEA1F3730CF663BAE7AD2662FD7ED46D6C82E84 ROBERVALLAC-SAINT-JE
2,421,617,356 *FFEC8338BB27BFD63FA30A6A762DE568C5B01FDC MONICA-HENLE
2,421,617,357 *FFE0AB417491AF47614913FD59CCC4A1B956F8B5 RODERICKNAKAHARA
2,421,617,358 *FFE0494B9F2376246351A09AC4175D49429A525E MONSTERMOVIESOUNDTRACKSTAGOMAGOEGEBAMYASI
2,421,617,359 *FFEBF9A7381738D05335A3B5EF7E7B37421833F5 montrealers'-'governor
2,421,617,360 *FFE813813AFBFA84254E3F8D133FC2E92EDC8C89 rogelioyounce
2,421,617,361 *FFE5EC33100CA32D583B83726017AE7EDF50ACA5 ROGER.GERIS
2,421,617,362 *FFE8B09AFB3E400B82C26069AD18FA8B8C583A00 ROLANDOKOSSEN
2,421,617,363 *FFE2B5DF6F5C44D91C1818D5E8EF311E7CA3FFA3 romansiefker
2,421,617,364 *FFE8F160A1BE4143E4FCD7C09CEC14EAC115D12C movingthingsaround
2,421,617,365 *FFE2EBB7C1240F0D34E9B45ED4781EB1C113EBCF rondalarson
2,421,617,366 *FFEE1A8045A79D5FB364C6F14CE363775EC81FEA ronnysenf
2,421,617,367 *FFECAA4C092530BCE08296E1754048E8C3DAE39A MSTAALA
2,421,617,368 *FFEF0C36D80916651BF9C36EAD3C05A6659A7C73 [email protected]
2,421,617,369 *FFE502AF17130837DEA157F66C378E3C7B5D772D ROSCOE.WALKLEY
2,421,617,370 *FFE1B05BC939A3170107A86B7816AE01323C1B72 MUIBMYC1
2,421,617,371 *FFEFCCBF478414BFEE9AD2815CA8D413BC9A7DEB MULLBERGGING
2,421,617,372 *FFEF11CC85561BE8743E79C1CBD1B0DC3E700782 multipleattacks
2,421,617,373 *FFE894523AADF5A3CF730A077DB44B9082655F37 [email protected]
2,421,617,374 *FFEBD429A936DCED46757E4B90C3002D9DA8EAF0 ROYAL-BRITISH-LEGION
2,421,617,375 *FFEB5171898FEE109BB0725359FF5FB2295BED45 [email protected]
2,421,617,376 *FFE446AB3D67C76117160BD30AADA2F2B6E1F305 myhelp12332
2,421,617,377 *FFE72EA5137D56EECBBF2351F2269D7F2AE95594 MYNSTERLICE
2,421,617,378 *FFE99758F14955A5CC79E461306CA43D6D6BDDFF RUDOLF.SUGERMAN
2,421,617,379 *FFE4D00FB675AE7BF51F9CC7E26D1B01BB150048 mystretch9
2,421,617,380 *FFE71C02E4D4E55E1EBAB2E93E9784F7D8726CED mz{o
2,421,617,381 *FFE4CFE8B7EF054F464D0FCE869AA06B1C51254A russelgriblin
2,421,617,382 *FFE31D8D13335AAE36C4FD72C563CE720C0E7C64 russellodorizzi
2,421,617,383 *FFE27AAFE32CBE4ED77D3C0D651D1D23B9B04FF5 NADBEROUNSKĄ
2,421,617,384 *FFEC9E6B31D6E642FA17C69C28FF2F256F4F5FEC RUXHOOPSES
2,421,617,385 *FFE4127E7D687049F6B7B548A180982713F4E6E0 NAMAKWALANDER1234
2,421,617,386 *FFEF7ED2C7D3F57EEDA4AF73E65103B5E236CD04 nanisots4
2,421,617,387 *FFE6160E6CE1EEBF6485974F10CA8F547FFE3EAE SABRINACHANCE2
2,421,617,388 *FFEDBBEE284C3577F75345CE22B0BDBCFCF2106E sachin.jayachandran
2,421,617,389 *FFE7EA52630CF6049850636B92DA78B454BBB771 ŞAHVELETOĞLU
2,421,617,390 *FFEE85916CB0BBBFC324027420EE4268D26E0F56 sallubrano
2,421,617,391 *FFE2D6EDA778F4045F5C7085C71078797F5E44D8 NELSONABORDO
2,421,617,392 *FFE98C5023C1DDA04A4063CD358BAF77CC56935F SAMEDAYSETTLEMENT
2,421,617,393 *FFE192D29658FF86DBF8327B24DD5E8E59879E1A SAM.MATTICE
2,421,617,394 *FFED16AE9F70B6A41914058BB99E9AC6ACED3CE9 SAMMIEEADE
2,421,617,395 *FFE2B4DC06ED0E94816AFECD6E84763596AE6A73 NERROIS
2,421,617,396 *FFE21F8A306334C0B44E42758C6835155CE1AF29 samuellincolnhouse1
2,421,617,397 *FFE630FD727D06BDDC1578954E30026E06F249D2 SANDYMAYHORN
2,421,617,398 *FFE0CD270C4DF2982D84B32A469B30114355FDC5 SANSZONS
2,421,617,399 *FFEA4A5A4BC9AFF97BCCF8C866BF43F21583C01D savageretumed
2,421,617,400 *FFE15D15AF68801F95B89C28205BE480CE298A13 SCHWEFELHEXAFLUORIDES
2,421,617,401 *FFE6C62525BD6801B574014ECC8BE19BC9D67E2D SCMINSTITUTEORG
2,421,617,402 *FFE127422433815E14A3F38E12F184518219CF82 scompt
2,421,617,403 *FFE9D096BCAF54DF0D26FE23D9C489145D5A415D no-one-(radio-edit)
2,421,617,404 *FFE82B48FE1EFFE9A6083DC44B6F7855DBDB027E nsayyif0
2,421,617,405 *FFE3AC45EEDCA95BE1B7C3A848E31AE41D667BD2 NYLIZZA
2,421,617,406 *FFE9F8EE5101B134DAA31FDF1C972C579A420CCC NYWERHEIDSSEKTORE
2,421,617,407 *FFE092D47629C596E588443E003F6F1A95BE4900 obiettrice
2,421,617,408 *FFE7CEA058A9F1771858956EC550E851887CAAB4 SHADE-AKINOLA
2,421,617,409 *FFE727C539D22D9BFFCFFEF70BC77CF7BC350C89 shadowbaby11
2,421,617,410 *FFE9423274E6A269D21122E5F8B170545CACB4D7 SHANE.KENNAMER
2,421,617,411 *FFE9B742B945F868D28772A60A1B1B7F61A507E2 shantel-massey
2,421,617,412 *FFE97800F61987F42A4AE39DE2FD28EB4ACB4C51 [email protected]
2,421,617,413 *FFE625E890AF174956448D218412D0FDC8F2C37F SHAUNLEBEOUF
2,421,617,414 *FFE5FCFDEDABECC5E5DF5C161B85AAF6DD155D64 OLIVIAMIMI
2,421,617,415 *FFE01B32EE1458B8A1192C8F9BD11C0466697873 SHELBYSHAMS
2,421,617,416 *FFEDB1426F5DBD262D63689CF15ABA26384A467F sheldro
2,421,617,417 *FFE53767C44BD562F0582A7DDAFC1D4C2B19EE40 SHEWHARTCUMU1
2,421,617,418 *FFE3C097ED74B3E326A51F655001538D6CD73511 SHILAASHCHUURNII
2,421,617,419 *FFEA16B45542104B1C72A47DA303C6870E56526A SHOWBIZINFO
2,421,617,420 *FFE654354EB0BA91DCC7F99EDAE1B518D54FD778 OROZCOCARDENAS
2,421,617,421 *FFEFC70943B3E2D84BC0FF7AA570DF7C5D774441 SÍFELLI
2,421,617,422 *FFE92DDADB6704C21AFF8C7C76733A38A59625A6 ORVAL.DUSENBURY
2,421,617,423 *FFE8A7D5129B326D6F918832FACECB1980730B21 OSCARWIESEN
2,421,617,424 *FFE32A4C35C09AB829B3B2F568972690C4951A39 oshelly1
2,421,617,425 *FFE84E0BF51C0445CCD6C186246793D777E1E2B6 SINANTHROPUSN1
2,421,617,426 *FFED2586598720C0E189AC2300BB95DD2EF9074A singleh4
2,421,617,427 *FFE6907923E69328321270A0FC4ABEE8A6880D26 P7BNEKCXN3K
2,421,617,428 *FFEA56412CDEA0C8AE377859C5C29362C7120598 P&,9
2,421,617,429 *FFE03DA7365871166D5383447BB514C0A340BAF9 sluggardize7
2,421,617,430 *FFEA2CF64271B1A49EEDABA6E7726F2694FC4526 paoshia7
2,421,617,431 *FFEBA0B3EA18C45A51262858FD484E6BCC4E79E0 snugglescat
2,421,617,432 *FFE6699EB2FC759B703270956F9FE6C9E8CE4897 SOLOMON.BOROM
2,421,617,433 *FFE0CB602149D153E18718C3296BF314E3F763E8 SOM003CD
2,421,617,434 *FFE6C12BA65599F48A03AFE87B19B15FC2838E1C SONICE(MARIOCALDATOJRREMIX)
2,421,617,435 *FFE577737F33B623706173B1BDCFECD019ECF25E Pedro-Pablo-Pedroso
2,421,617,436 *FFE8E88F718835F8CA591ABE8EE188FBF6CF68B2 SORDID01
2,421,617,437 *FFE12B77BAE6D2BA3D80FC43F947ABF022FDC3FD PENISBILDUNGEN
2,421,617,438 *FFE6D9C499A40869A898E435530F322CA15F9191 SOUTHAUSTRALIANLEGISLATIVECOUNCILUPDATE
2,421,617,439 *FFEF2D356BD02E73EB4C3CDA29EB4B67B73FF641 PERGUNTARME1
2,421,617,440 *FFE90D5E4A5CF1DECE243EFF50C477D3C6FBDF9C perguntate.:.quem
2,421,617,441 *FFE2E54F91036EFD1A4244C8E7C46568FEEC73BB persuaderons!
2,421,617,442 *FFE5925D54F5E18416B246EDF1893641B10D93B1 PHOTOSENSITISE
2,421,617,443 *FFEAC42F244FD96666543C315FB86423BE1A6227 PICARDJASMINE
2,421,617,444 *FFE63744776EC2099C6A3DF1C648D059DE3795A8 platonist1
2,421,617,445 *FFE4FF265200BC889519B07F9FF55D9B52521444 st413mou
2,421,617,446 *FFE9412EB467221772C16FB746E523A5248E00A5 STACEY.LANGFIELD
2,421,617,447 *FFE832E9CE091448E8FE0FD54F76C5146003733C POKERND8
2,421,617,448 *FFE1A851F50549000EA71C3F61BC670680908A89 »POLITIQUE
2,421,617,449 *FFE6C340E9698F193AF1D37928B1C423FF5C2E09 STAN.GRIBBIN
2,421,617,450 *FFEBE79FA3CEB0CDEED0DA360962A955F80F789F STAN.TRUDO
2,421,617,451 *FFE36970D3B3074DFC40CE228B6B4643DB39EBE4 staricon 1
2,421,617,452 *FFEC9E8FAA5EE8AAC798888FFE35C120CE27A6FA PORVOONVÄYLÄLTÄ
2,421,617,453 *FFE5ACF5AF9D0FEF7256FBD3F804C2B0043F0EC2 steelcase.strafor,.s.a..|.spain
2,421,617,454 *FFE502F0477461EB1EB3D7211F064E2439561108 STEINFLECK2
2,421,617,455 *FFE8CAEDD3BDD16354374B8451271B980235B1E7 POWERSHOTA2000IS
2,421,617,456 *FFE7D7246F989F74FD431398A6119538E482B4B1 P------>~O.}X{
2,421,617,457 *FFE231ECDDC29A33B48CDA9FBFFB39838E31C922 P##P~0~oSplat
2,421,617,458 *FFEDEF9279D908941C781331BBA0DEE951665442 STERE0REG
2,421,617,459 *FFEB75875BEDDD71D5B0B04E90B13E3367599B63 steven.franqui
2,421,617,460 *FFE0E2BAADEEFD2525967289740AD41C08BA725A [email protected]
2,421,617,461 *FFE7101E06A621E4D92563CD0133967C3A8DE2A7 pri0r4+e
2,421,617,462 *FFE9837B35148EC8A6ECEDF30BEB6EF0E0E9C741 PROCESSIONOFTHESTARS
2,421,617,463 *FFE50ACFEC3C8ACC69959D435DDB06309BEA06A2 sugarwatkins(os)
2,421,617,464 *FFEBD4FDBC5EFEC0A52F06522DA18DAF73DF0D56 [email protected]
2,421,617,465 *FFEA1808A322A8D87B7A8806E8107261379C7809 summarytemplate
2,421,617,466 *FFEA8ACE7A051F9B1A93FABE516350377A6657EF [email protected]
2,421,617,467 *FFE288DC175B7B4EC7EBC4B3296A70081111EA1E [email protected]
2,421,617,468 *FFE2EF8108615BE7D676F56C90B549CFA7ABEB06 Q)~.~.~(>_<)
2,421,617,469 *FFE4681D2FFAA689BC63E84AEA852652076AB967 SUPERDUDE(JORUNINTRO)
2,421,617,470 *FFE7806AD0619DEAC9463C0EDF70589B206CF4E6 QKJRQCCT46
2,421,617,471 *FFE9B7309E4DF7B7AB7A7206BB8FDB92AC91DD5F quadrup1ica+in9
2,421,617,472 *FFE2891AD75F4DB6EC2BB682B17D359F8C6A765D QUEENMARGARET Hietheetohellforshame,andleavetheworld,
2,421,617,473 *FFEB4CB2509EA5232E9A6EA33C497EEE9066F1C6 QXLBYQBGQPQSPLOUGD82SF
2,421,617,474 *FFE90F42AA55DADD73B84D74AD961D2FD0DD03DC SYUDENT5
2,421,617,475 *FFEE5F2395E517F2D590D5171AC5808548B716F2 R3pr353n747v3ly
2,421,617,476 *FFEF71033BB1838AAE2A62C1E1F4E7422DBD294B [email protected]
2,421,617,477 *FFE53BBCE8E2839A06F6812CBD8A6049681DA7BA TAHFIZH
2,421,617,478 *FFE8B6CD1C97BD7B3DB125DDCEB7614D53012206 TALKLIMNOPHYTON
2,421,617,479 *FFE02167DC740D6FBADDECCB9792356C08A10AB4 RANDHIC
2,421,617,480 *FFEE632FA672B5C3992328F89EB9F9FEE98214F5 tamertamerelgabaly
2,421,617,481 *FFEB2AC8A76010FE68B2D2B72CBD1C180FFB8E3F rawt-cee
2,421,617,482 *FFE2900F35A2FFB355CA68768549174DCE8D7D34 rayfordhajdukiewicz
2,421,617,483 *FFEFB151A944B66477C66C4F5DE13AFFC69010C1 TARDIGRADOUS1
2,421,617,484 *FFE91D1A2073B11D98960B3CBE0465D523969414 Tatakai(notheema)
2,421,617,485 *FFEEB856AB2F2D22003A3850B318D4F36B7875A7 TERAILICNOCER
2,421,617,486 *FFE08A09A79BDB1F3761B718D97CB0FA06AF7CEA TERENCE.QUIMET
2,421,617,487 *FFECCD198D48B02F9C1BB3E7F78BE39786A4FAC0 remote.database.access
2,421,617,488 *FFE94D1A68E52571D4E62D27EB4FFAB11A7180F8 TESTIEZ7
2,421,617,489 *FFEDA34D5F8E8C4A7F59AC169A6A0F8FD1CC5785 [email protected]
2,421,617,490 *FFE71C8896B5ECA65E0E523F0F82FD85A7F86E32 rennie-pilgrem-&-meat-katie
2,421,617,491 *FFE17BE87F376D02A6AD96F17AC94086D3BE49D6 RESSORTIRENT3
2,421,617,492 *FFEEF268EF20E49FDE5A2E4A8842C0AC0AF3A81C RETYSKERINGS0
2,421,617,493 *FFE0282A70389F325BDAD445FCB9D34F4B35B3DA THE DEAD IN THE CHURCH
2,421,617,494 *FFE09C77D7D91638874EB0F2D310775900C910D9 RHETT.SEMINARIO
2,421,617,495 *FFE37C5931F1FFF1D640AED0BEBB57E0EF353A2F The-Moon-Is-High-(And-So-Am-I)
2,421,617,496 *FFE6C00972D14B1892DE9082BBCF7ED81F95374D THE MORE YOU TRY
2,421,617,497 *FFE0D05A8F8915D988BB4ACA6413B860E7C59A20 themysteryofthecutesuitforgunwieldingfbiagenton
2,421,617,498 *FFECD4463E00C5D69F316887516D401D9740A23A THE.NORMA.JEANS
2,421,617,499 *FFEC647EF4B4F2CCE316976602BECDA2040F996B theorlando73
2,421,617,500 *FFEDCCFF5430685F29BC170B04B48F233297A924 riversid0
2,421,617,501 *FFE68157ADF66EDF6DE2773C925B9102FB1CD970 ROBBYVELARDO
2,421,617,502 *FFEF5D09CEBE18E6F397576026842C09B522F999 tia579
2,421,617,503 *FFE21547C31841336CBDFD3FA69BC9E1E261D364 RODGERDONCASTER
2,421,617,504 *FFE5575EF996E152D52DF110CD75BABF13A13FA1 tjsmom11
2,421,617,505 *FFEC8BAF8004074ED0624C94F918203A6425C4DA TOBY.SLENKER
2,421,617,506 *FFE35616737A02DCFCAA7DC9AC3277A337870F9D TODAVIA-BATEANDO-(INSERT)
2,421,617,507 *FFE3686194564B3AF65AD853CF7E9031126BD541 RPSTNIAP8
2,421,617,508 *FFE5222D0AB913D5524D3D90C7D4E653FCB2E805 RSGLOFRE
2,421,617,509 *FFE669DF16507646C8A10CC8C3C505753E501328 [email protected]
2,421,617,510 *FFEA8EC075497ABB65289F47BF7FFA7F609AA2D9 rubensuarezcanoniero
2,421,617,511 *FFE400C15CD27B451B9CA0498B61FB1588F5643F russeldesharnais
2,421,617,512 *FFEAFEDAA4E775843DA83444AFE961682358E4B9 [email protected]
2,421,617,513 *FFEAC92D6B9A21AD2EC0CB6B4C0DA522743052A2 RUSSELLDEIGHTON
2,421,617,514 *FFEB351E2287C127F4CB91C0BF29F7D494BF47EE RYAN.VICTORINO
2,421,617,515 *FFEC4C0AD5A51B46522C38D93196FCA5C35F6544 [email protected]
2,421,617,516 *FFE706C9F7F171006315CFAAB982E4A90D3B7F79 travisgacek
2,421,617,517 *FFEDDC78AFF2FE8745942FA91FEC0D642BFB5784 traviswebley
2,421,617,518 *FFEBB7384FBB64F93241F71C643E61D446E747B7 TREITROP
2,421,617,519 *FFE97CDBAB01DB3DC70AB0CDC52BF332D990C583 TREYKATTEN
2,421,617,520 *FFE3B7C3107AA932C5CED2D18EB4B5A8E7AA765A TREY.MESPLAY
2,421,617,521 *FFE5062111422E21C94A17B41B8E2A10DCF0C3B4 SAL.QUELLA
2,421,617,522 *FFE97B3A97ED6CD0B4065AC72D70C694763BDF5B TRIBFELNER
2,421,617,523 *FFE0798D29CB25329FEDD9DC85D92013234749E3 TRICHUR.NARENDRAN
2,421,617,524 *FFEEA568963969F5CFE082E5CE75D4C9A105481B SAM.CALDWELL
2,421,617,525 *FFE7E690820E369B19475EB7CFC9447CBF2D2DE6 SAMMI.T
2,421,617,526 *FFE77888EE93597CA0BC471FE86484D196BD5D8F SAM.YACAVONE
2,421,617,527 *FFECAC4CFBDC08250297DBE41269A560BF6B7218 troyramone
2,421,617,528 *FFE82C250958E8F269663C1EF1037F2D9761811C SANTOS.DE.FILIPINAS
2,421,617,529 *FFEAA9D951ACD9A29A667B9EA7DDE749FB5F9F41 [email protected]
2,421,617,530 *FFE669A020E9118FFF8B127F293E0F6151545228 TTANDETBSW
2,421,617,531 *FFED83FB565E4091AAEADE3E02E8E94A43649BCC SAUL.THOMSPON
2,421,617,532 *FFE25203DAC1D55E286B2D3EE285010A516C501E tt-x
2,421,617,533 *FFEBCAEAAA4E0293BD247D059F27406FF79EC1FE scamelhotsexi34
2,421,617,534 *FFEC171599C5E89DEE76629FC8E0F801843C694A SEALBOT
2,421,617,535 *FFE33EC6CA600BF0F500FABF40CCEAEDA24B5B39 SEASONSDVD
2,421,617,536 *FFEAE1FF0D5AD88940542A9713091E9B1C4E0B5F SEBASTIANZMIJEWSKI
2,421,617,537 *FFE5C22E1017201584F188D471B20352C6C745FF seepier
2,421,617,538 *FFEBD94F1E22E3A2DAEE84289CB767617A127EDA uden filter
2,421,617,539 *FFE9F10511CDC646BE288E011549EA7991DB5F18 sesiuqca9
2,421,617,540 *FFE627D00CDE3371C22B2CBEA992A49076A5365F ujezdil7
2,421,617,541 *FFE77DD043E65E8CA86B4A5CB84403ADB221C8FB SÊZVA
2,421,617,542 *FFEA164DE198E94FE92AE8D36BDD861E699280F4 shanechandier
2,421,617,543 *FFED1CA6523907FFFCE76B30E0BC7E4DA51EBBE5 SHANNON STEARNS
2,421,617,544 *FFE2F1F7079A12237B189EEB4BBFA894789AF36C UND$CRMN4TN91Y
2,421,617,545 *FFEE15DA8D7CAC77035DBD8E0D98B33DBA0676B5 UNIQUEVENUESOFLONDON
2,421,617,546 *FFE7B04309850C6D4319EE4DE7312DF53C5005CA SHELTON.WESTERHOF
2,421,617,547 *FFEB05656FF5307BC18857E2013CAAA25791CC4F [email protected]
2,421,617,548 *FFE66EFDCE11DEB57792B34590BFFF3730728114 SHERI MCNULTY
2,421,617,549 *FFE6E8CC2D8333A6EC73932E4FBCB15A84E97C0C [email protected]
2,421,617,550 *FFEBE0775987AE6F8F321E10C087712731409A70 UNSHEET
2,421,617,551 *FFE713E9834D70ED9BBDC19BCCD43F02621F0DDD URULUR
2,421,617,552 *FFED5DAD97B4B28A2CBD8F641A612A31D7748330 siaoyong9
2,421,617,553 *FFE0EDD288521E3509FF86BA21BA3B8210BC1F45 USERBRILLEMEISTER
2,421,617,554 *FFEEFD1A3243299D1CF5DCFC30CC9DD8AC24B747 USERQUASIRANDOMSANDB
2,421,617,555 *FFE14976355C7B0C9CDFFBB284ECAE39BD341007 UTEXABZLGELEVSVG
2,421,617,556 *FFED18269E6FF2743F3287451DD6B7C4961D6477 SINISTROGIRES
2,421,617,557 *FFEB016479685B32ACC6501305B956072924512E sittings
2,421,617,558 *FFE627E46C71904BC4B1D55DA376A29CAACD89E7 VÄTTERBRANTERNA
2,421,617,559 *FFE08AA50AACBE18B17C112C659FBA20387D157A vaughanbassett
2,421,617,560 *FFE99ED8967ADC287AEA31C982763B2D04E5B921 vaughnvalliant
2,421,617,561 *FFE790243578A6779B6059E18237D4A75B201C51 velocityorgan
2,421,617,562 *FFE259B1214BC8A87FFB82DD0B452BDBF98BE101 SOLOMON.GALARNEAU
2,421,617,563 *FFE70DC7244F3E3DC8E9756444928A174E56D936 solstitiaed
2,421,617,564 *FFE6FC7CD70BE246326558E51181D26C0575DB64 VICENTEMULDOWNEY
2,421,617,565 *FFEF7C06B0F6A46295C2CB405468D6B40CA9B6D8 VICTORIABOGORODITSKAYA
2,421,617,566 *FFE849EE2FAADB4E38E8A31D9D431EFC1FF1596F SOULITACHI
2,421,617,567 *FFEDFD0D5ACF1996B42FF74BB461E3012ED6C4D3 VINCENZO.CLAYTOR
2,421,617,568 *FFE9DEF37C73CE455D8E5F3B1B01C3F03E755730 SPENCER.AUMEN
2,421,617,569 *FFE1A92E1A8F7F17BBCAB44983799E52208ED8B3 VIRGINIA.M.QUINTANA
2,421,617,570 *FFEC95F0F9FD47F8CE12D91A77DC46DEE93022E6 SPLAT! ~ ~D---3
2,421,617,571 *FFECA24C9F1D75200CEA52C9BB776E0CD173A518 VKAINOVIC
2,421,617,572 *FFE8A51C01EF6B58E3DD64748B13FAE322D8CD44 VLN3RBL73S
2,421,617,573 *FFE6A0A17CFA7578280BC8CF213F28208DC9BCD9 voguant2
2,421,617,574 *FFE57D70691F88CA8A0629F1595577006BE2E9A4 squarests
2,421,617,575 *FFE60E1041A485638067EA1D5ADD9F0A1521D740 SREKKAMN3
2,421,617,576 *FFEFCBFD7E5D5F77F44B9102344D8684F117869D SSSSNTN..H0.S.1.S.H0.N.Y1.SH.H0.N
2,421,617,577 *FFE66FBEC11A463DD788A2853C3C29AFCD3F5F91 ST3RZAVI
2,421,617,578 *FFED718B239B4CBF83CC90DA578320004002EFF3 STACEYDODGER?
2,421,617,579 *FFE858152A999CEACFCD94A6E3B0E3BC2C7A9500 STEFAN.BALLREICH
2,421,617,580 *FFEBAA6801093399D07B9E5B575C006579B1CD11 WAILOFWOE5
2,421,617,581 *FFE8483D5189FE49BE871488522A66D6BE645C21 STEPHAN.HOLTHUS
2,421,617,582 *FFE3F900148489C92DD6C1BD3291E87BD3AEEA3D stephen.ferguson
2,421,617,583 *FFE863B3B32B07AEA2C948EA33230934BD458E94 stingraywebster
2,421,617,584 *FFE7106D63C69AECE15844638D053C07B749751F [email protected]
2,421,617,585 *FFEFF1D46B212796C7E410386519734B6694E8F6 STOCCHI3
2,421,617,586 *FFED67838C0259E901503EF6520B9589FE104B1F [email protected]
2,421,617,587 *FFE1159855B6608555723E9B74DE921E9A642AB9 [email protected]
2,421,617,588 *FFE190AC9409DBBF2DD3A5D7E0E51E8A93FE3030 [email protected]
2,421,617,589 *FFE07196F0865C05D4C1DE979AD6F732F25B7993 wanzabrigid
2,421,617,590 *FFEB034636D5930D436DBB187D1084C0A34A8F89 STRANDSNÄCKOR
2,421,617,591 *FFEAB09C9C8E6E1BC57B5BA854789034FDE1C995 warisanun.chirasukhon
2,421,617,592 *FFEA35608FB481363634C17D2DDEA99695609EEC WASEEM-QUADRI
2,421,617,593 *FFEEA5DB3F1DBBF0F432D451098E3F45814A8C17 WASHYOURHANDSOF
2,421,617,594 *FFEDF87C1B6E6EF5014F638DE017E947E6D0BD87 WELDONPETESIC
2,421,617,595 *FFEDC06AC49917F829B8346338C70215CF699130 [email protected]
2,421,617,596 *FFE1A57FD85F88A10BADAFD5769CE903AA1EC670 SUNDANCECHRISSY
2,421,617,597 *FFED9EA09EBF2B5FB595F17BC2F3E803687C3250 sungmonrow
2,421,617,598 *FFE2882A0185FA7A4AC752380A36CA72B9124752 [email protected]
2,421,617,599 *FFE5781152F3EF3C2A78D857E78567ED241B2472 [email protected]
2,421,617,600 *FFE196DF6A2BA047F02D39DEBFE8B86C2B6AAF10 [email protected]
2,421,617,601 *FFE393F104B2F95AEA49079C00AAF98CD8E78662 SUOJAKEMIKAAL0
2,421,617,602 *FFED2C888CD8E35D4330F842A378822C29C84AB7 SUPEROEXTERNALS2
2,421,617,603 *FFE1F585E802AD7CB259AA8D58FAC0D76E671651 WEN-XIAO-LONG
2,421,617,604 *FFE35CB3AC588B8E64D7CC17AD76C16DE8373699 SUTPHEN12
2,421,617,605 *FFE420AE9BDEE52B68A1CF02A58E0782EFBB3953 SVA(
2,421,617,606 *FFE4DEE475D59B5FB03436084E7B14E5C046B704 SYLVIADAVEY
2,421,617,607 *FFE9C6D78B5258FB402C4DB738AD35EEB21FDE41 WILBURSIKAT
2,421,617,608 *FFEE1F36FFF0FABD53465CFC68E907EAB370A1CC wilfredojamason
2,421,617,609 *FFE8AD15E7DD2BB0980F2C689AE110DEF84BD28E WILFREDOLAVERY
2,421,617,610 *FFED0B61A029C3F0B507A025B3B78C1C5F2AA723 T149764
2,421,617,611 *FFEECB9E01415BAB1304D64FCB1DB219035BD6CD T3G
2,421,617,612 *FFE3034707311DC7D0A9110524CB767FBDFBA55E T{\A
2,421,617,613 *FFE97892A1517754668A4F57D562B12B415D8EED wilsonreutzel
2,421,617,614 *FFE8950923D3BBC20963B90E8E8BA2014EFDFC6F tadrebick
2,421,617,615 *FFE8C10DC3CAE8C052BA91126939A3A8BCC11BBC TAEGODGIBEHTTEL
2,421,617,616 *FFE0C9ED2B15ADBCFBEB2EC419CBBF68B578E893 WINNIE.MANDELA
2,421,617,617 *FFEEABF63D5F8FCC55B3DE842ADB0ABCFBAA767B TALKOTTY011
2,421,617,618 *FFEFD8471F53A6EE466A87512142040D8AC229C7 woman'sprayer
2,421,617,619 *FFE4CC3A45E3D485B7677A8DF005367919BEC11A WOTINOW
2,421,617,620 *FFE611554A0292F47DD65E33F2F6E7E8936F8654 TAWERS
2,421,617,621 *FFE2469F3DDBEBC9B44342BF814780AB7BD4B569 X0;B
2,421,617,622 *FFE4ABA2DEF7A69600956AD272396FCE025D6715 teregreb1
2,421,617,623 *FFED7A1C83EF34863BD4F788578208A275B0E554 [email protected]
2,421,617,624 *FFE0BCAF9B473C3AD60F1F27F3163B98D73B5651 XIMENAALVAREZ
2,421,617,625 *FFE721CB34D3617CEEA2A8BF5E686F9E555096F8 XI.MUII
2,421,617,626 *FFE9A107CE53F9ED17D766C3B277EF43E83A1D58 THAILAND
2,421,617,627 *FFE3F8300A0B54C3B763804881E64A436582CAD7 THATJASON12005
2,421,617,628 *FFE3CF04D08870AF920ECD275987EF0404FE487C XTAKTUSIMROTCIVS
2,421,617,629 *FFE07A6CA175B50DCD19F5B92F129CF846931384 xuhuiyan
2,421,617,630 *FFEDF236AC110C2DB519B08F0FA77902B2C22CAD TheMightyRyeders
2,421,617,631 *FFEA932B7DA6EFA4B242AE6BE1D597FFC0ED5B64 The.Policeman's.Song
2,421,617,632 *FFE03A92DD2A7EF2FD50B20C6848378C4E575F9C [email protected]
2,421,617,633 *FFEF7EBA94B601998847E7F95CC072C8DBF2059E [email protected]
2,421,617,6