List database


# MySQL hash MySQL password
221,560,001 *1549178E5ECE980AADDB15B7FD373E6E428B3BB0 BER-OG-R
221,560,002 *15404471ABB7EBE73E2CF3AC8AC2004254D59766 beschadigen4
221,560,003 *154BB1F8CDDB543703177BF13CBCE9C513CADB8F BEWREID
221,560,004 *1540D29E1609DF2335A2691DC28603B4735E868E b#f4)
221,560,005 *154211C111C0D9AABFA4358CAAB1A70B9F215ACC 4 ausscheidungsgruppe
221,560,006 *154324034D335A0F61D3572FE8C31C945CCD7AB6 BG#7
221,560,007 *15451C38466D1D1423FAA1EAE195986F775D8F3D 4e0a9942c8cafb98770f9447b45246e5.stojakovica
221,560,008 *15490ECF9CC8034867AC22B2675ECB71BC94C9D2 4iluvhanna8
221,560,009 *1544D2A7255C44D34090345655058ACBDFA1621F 4JANICEROCKY
221,560,010 *154BCBF88FA773F75315155C1DC4FA33E628D8DC BIA3Q
221,560,011 *15467129CB83DB1F393B130D3A39AA4DD39B332F [email protected]
221,560,012 *154AD379D9DD8816AE433FB7CB01062E57E1A008 BINAYAK KAR
221,560,013 *154BDD0C48EB27D1F19AB568094BA8AC60247EF0 bj1ps
221,560,014 *1543B709C7305646DC855A381641EAC51EF2D8B6 4RI$TOGENIC$
221,560,015 *154FBA5C4ADB39FC2F6A804AB934F4989FEA1292 BMBRDMNT5
221,560,016 *1543503641FB8E1C676A1241DCE432AA7B9C3040 bn3!y
221,560,017 *1548CD264251FE3963A8B31123D9B21A3495275B BOBBYRODNEY
221,560,018 *15411AC06F322233ACB697EF0A1BCC1AB3B52C6F BONW=
221,560,019 *154804D88FEDA13B000E108A90F25E07270D6793 5CRYSTALSABRINA
221,560,020 *1546DE155E00B9385B83F863279180DE532A8643 bpv=:
221,560,021 *15413F1E3519FA1C1D1CF22D3704ADB770AEE3ED 5EFFRACTIONSES
221,560,022 *154E725584FE019A3799309E1B5B266F7028A660 5ETTERALLOC
221,560,023 *154EA05115E3F7118C2803571F529B45DC7C3197 5GUINNESSPICKLE
221,560,024 *154F55237227539694991058693CC85DA6694879 5HIGHSTICK
221,560,025 *154B6E66011CB26B06F3C4AC1DD2CF77BA8E0D16 5ICKENETH
221,560,026 *154183785C82FF69584EFA285914A000A6EE6D05 BRADLY.HELPHENSTINE
221,560,027 *154E35584118E102CBCBD5CD5597FC240509EAA7 5MLTVBRTR
221,560,028 *154305A1FF8A6579196AECB0CF862113F879185B BRENDALOY6
221,560,029 *154BFB7C601CC73DE21A8BDF33A1575B01A3D22B brentcitrone
221,560,030 *1547695E6796863A7C9FB2E45C1C23C20D1A9E20 BRIAN.BOISUERT
221,560,031 *154B4FAFF2BF8C9B2CD236BBEC8C9E6C33F47679 5resterais
221,560,032 *154E03B620ADFD64D164B854AF476C30C29C3FC7 5SWEETSPUNKIN
221,560,033 *1549B27CBAE16712AF1B982230A8165FC5693902 5T3V3BR4ND0N
221,560,034 *1544C08C58B9B44018FD378EFAD3B4BFE0E58FD5 5TREGGABEG
221,560,035 *1545E3E3007FBF40003BE915F6F9E16A51D65404 5VERSASSIMO
221,560,036 *15488A6FA14F72D68D09995FDD28532AC497ECBE 5YAPPERN
221,560,037 *1540C49926E112486FAD06788AED8A0C9821457B 5ZOMBI
221,560,038 *15408F677145A7F53ED19A364B1FB4DCFF3EE45D BRUNOLICHTY
221,560,039 *1545061F8856E1AA3D382A855CE890DC1F051A51 BRVC1
221,560,040 *1540E18150C61C5D12D3394024859F5ED24D3DD4 bsd7b
221,560,041 *154BD74BAFD113F0AD76BB55C1D0D50A16D53626 BSPIELERED
221,560,042 *154D84AB72482956432EF542C337250BAACBC66A 667BRYCE
221,560,043 *154180B406065B0ADA44BC92B4F98B7FE6B00486 BTAR?
221,560,044 *154C9008F8FA520D4043E286076B0022F054A192 6BSWFARALITYBSW
221,560,045 *154753E69D7495E7EA83BE57547BB30D1170A694 6BSWGESPRAECHSPARTNER
221,560,046 *15470460B0096B9BB4637E32E0BB5CD0A3AC00DE bucktarvin
221,560,047 *154DC747F865EAB6E8399C91390E999F56F87786 6CANONSEVEN
221,560,048 *154DE36E86A899DD901961E1E95555237492CC91 6CONTENTAIS
221,560,049 *15453A410C18C8E403C0A10CE826B9B4147CE433 6JANDABSW
221,560,050 *154202B057CCBBF828ED3E35446DDBC20FEEAF2A 6JOLFSSON
221,560,051 *1542636F8730F11DCE6F32840BCB162C039CC42A 6KUVASALK
221,560,052 *1547E8D348EB2DC84DFB2791BF34F6B2292CD96C bx(kt
221,560,053 *1549E9D3EB09F93146CAF76CB7E0EC7B98ABB491 bz4(l
221,560,054 *154C36DECA5FE90156E3922D1103716D5ABBF0AB c0.g3
221,560,055 *1549D7B34C4590E3D3144BB28304108C9261C055 6SEITILAC
221,560,056 *154D9276B6B94252C93BF5FE2916290ABE70A0DB 6SHOWSYSBSW
221,560,057 *1541D768E7776FA7D333CC65389570E91534DC2B c2fey
221,560,058 *154514B9150D4C3D466864941E9EEC5C550190E4 c47eg0rzers
221,560,059 *154D0594D93D6DD919E125E19877DA7744FD3A97 c#6dl
221,560,060 *15444DA6493ACA9C7E443B2E6246FDAF3D6A5C54 c7oia
221,560,061 *154FB87B7783AE8863B0594A4305BBC22AB6CE75 7BELOOP
221,560,062 *1548052E7496E5662F4E67F6C078AEFCCD8589AA cac0)
221,560,063 *154BC27945BB15E8EF7261EE241AA1BC8F15F9B2 7EREDEBLI
221,560,064 *15448DAD0F48717BBFD7CE0CF21C17561C2C2109 7EXCOMMUNICATE
221,560,065 *1540CEA5A8B34088FEE0C27ECB480C9FD755A480 CALVIN.GANGEL
221,560,066 *15420864CDD4595961E4ED11ED1E346695083869 7GNIKEKAM
221,560,067 *154DF0674211C31216B0E8F0C8EF5D6C7214EEC2 7.GRIFFEN
221,560,068 *154803E6443B035B15F6DA299541EDF32CCAB3C2 CANTWOBBS
221,560,069 *154C6D00BAE01E29C3E6D89AC3D11CE3D62F1AE9 7IDEBRAND
221,560,070 *154EABBB07C9AC565CAB8857EA57C6E1EC6D6A57 7ILOVEFLIP5
221,560,071 *154CFEED71969C88CE91101E9FDC5EE63785EE45 7MSSSCHDN
221,560,072 *154CBCF61E247D4AD8962E7631BB7FCD14919CC8 carmenciullo
221,560,073 *154DE94B2F2B9DAA2FC0F142444234171C13EC1C caroline-pratama
221,560,074 *1540FA71E65625E113116285CA5C44BEAD19C0CF CAROL-SKOK
221,560,075 *15401085933983B9544970479E9BB2D6635DB6BC carywurdeman
221,560,076 *1547CD72DBE925EF513CB0220BAD1FD1C590FFC6 cavefish
221,560,077 *1544B0693AFE1EE0FA54BCEF41CFD6654F92011A CB4H2
221,560,078 *154AA78018A33DFFC4FF4B659A2467B7B44A6AA9 7SNIMATELJU
221,560,079 *15461F6618D9185D3D9A02CAF11B842813A246C6 7TERAPLEX
221,560,080 *15434360CE6A4854C1317AE49BB05ADD5ECF9B1D 7WAYNEKRISTEN
221,560,081 *154A8170B98F9F8E3D7D22263192547B02306227 cdo_0
221,560,082 *1547652A258F5995CB7AF541D11470677E7C02BA 809021 die flugzeuge sollen in drei wochen einsatzbereit sein
221,560,083 *1547C4F94607FFA122D58B9885080FE1E97244A0 829CASSIUS
221,560,084 *15443768156EBF109AD2F5DE9E53A4B19B370DCA [email protected]
221,560,085 *15413F6259AFE5A73097CCAB9BA2F6BB290C3DFA CEQUARAL0
221,560,086 *15428358F8EDA00FC43A9B61F638A33ABEE40701 [email protected]
221,560,087 *1549FDECC9726D55318758A03626072A28F7EA6C 8BSWDNUORBSW
221,560,088 *15466BDF899BC5CA04E48E079D840105A718186D c&g7c
221,560,089 *154310C85B3F27F10794EA5715ADE43C4F643DBE CHADWICKBYNUM
221,560,090 *154FEAA7B346FED55710304678BC2C79328ED293 CHALICOTHERE5
221,560,091 *154833DCF8187F76166BF33368DABA4210CA2B0A 8HANSEATEN
221,560,092 *154C22835BC42F4341DFABF8002758D1A6CD9C9E 8IAMBEATLES0
221,560,093 *154B622520C892FE900F39C80463D8AA7A40B870 8##P~-UU
221,560,094 *1540E45C7A4471E143E9C5BAE30C83DFE2AE682A [email protected]
221,560,095 *1541D421C7B1E746A09214CD7D87C68EBF252BC8 CHEWBACCA1701
221,560,096 *1546DB1681DB48D7137FBF5E5D6FABDF0A725B25 chopsockying
221,560,097 *154F07F95F9644F616E3C95221780917072FFB2A CHORD-DEGREES
221,560,098 *1547EF1006DB85AE2219FE5FAEA7EA976316B225 920913 sen.lis
221,560,099 *15498C6CB0E6814DE09BD175598972D030A3C4D1 962lukas
221,560,100 *1542869A05430B0CE1CC75A41DD7BD91A7B63E57 9ABBISCIO
221,560,101 *154A96D96D2CFA06AD77B755BDCB59CDE69CF926 [email protected]
221,560,102 *15419A9139BDF2A2E526C9C7549186C9A032977C CHUCKTUR5
221,560,103 *1542C0A498FD0231E633F2EFC14069FD60CBEC23 9ALEXTIGGER
221,560,104 *15437C1A76408A49FF12B8C25DB62C0DE96D432D CHUNGRAY0
221,560,105 *15406FA51D3180F971233E979A3A21E45BAA163E cigreruening
221,560,106 *1549965861543E789FFD124AADF73AF5AC32C0D5 CILEABHEART
221,560,107 *1547A598DFEC3681CE7C161E1363C5A79CA3F527 9collaterals
221,560,108 *154A49C1FBCDC70587C49051F58DE5681BE32092 CJ#RN
221,560,109 *15468F1588E04B65981159EDC5573469B2E7F2F3 clblo
221,560,110 *1545E127D464D4771EC8FE31E0DFF7703787F87A 9PROTELWILLOW
221,560,111 *154E0B4376D14C274FF158BC2D259EB04EB94BD8 9.SCHWARZBACH
221,560,112 *1546BF1075CA1EE593576492E0BAF924CE8CE89C 9SESUETNU
221,560,113 *154E6488F833759359A556DF665B6ED177DEE20C clohs
221,560,114 *1549E26A6F57654609FE72F99F37FF2551A03CB1 a3.!
221,560,115 *154AE32827053221479414C33ACFA214CE4735E0 [email protected]
221,560,116 *1545F4D466DE4E18BA9725FD3A29A6201900A7BE A;/A
221,560,117 *1549A258B9374CB1AE69E28D3F15BCC8DE2584FC cntrdnc0
221,560,118 *154B4D9F944DCEB3AA40885AEE975F274C9A4399 aarontuller
221,560,119 *1543D51D190F0D00271A3BC078E08982BB58F833 AAW7Z
221,560,120 *1546E5C5F6F31381EB683C2459C7999D3187CB79 [email protected]
221,560,121 *15447B12DE4E363D0B0E1E18514C5C00101409BF COWBOYER0
221,560,122 *154DDB7E65CA45306619C25775A840DAE2E18DCE ADDRDAT3
221,560,123 *1544A57BCE90F1A05A576DCF57EFC7ACF1A93A4E ADOLPH.EID
221,560,124 *154EDDA428C70631421C11AE685CFACC9B3665DB ae6hy
221,560,125 *154E6BA2B21F478D693DE2174A1EDA55C49925AE a foggy day (in london town, feat jazz-optimisten berlin)
221,560,126 *154EE9B5FAC25DE817D9B712E11D057FE90D9261 aheksalf4
221,560,127 *1546D406F206AD1F7BA99E384266B5108B3F6A95 A.:I2
221,560,128 *154B237302DC63E377F47F81EA39C4958E1D5F0E ako1n
221,560,129 *1541414AF177EA14C00EDA30E9403C4F3BE9C127 ALFONSOBALABAN
221,560,130 *1545533C4C713170D63F25F25B3A85D90F747F25 ALFONSO.HUBACH
221,560,131 *1549347A78891F270CC046BFBE3AD1D4A5FA235D cyp/$
221,560,132 *154B0143566DB7C10B7EEF28607A745D142C0DD5 ALONZODONTAS
221,560,133 *154ED75D5EE913E651C75D5FD584D7B8513823D4 D25P
221,560,134 *154B592938722C1F4E60E4C820C17E5923DCEA93 alyeq
221,560,135 *15478358FC20125C267D85CE27B906AE20F1FE18 d74n
221,560,136 *154CED9CEAD1422324A9C2600BA3C9D8F0BD36D5 [email protected]
221,560,137 *15424F38DA947CBDBDFFB7961F8CA18C569BBE06 an!?
221,560,138 *1546CEE8F32CCE5463508F022E39A0C9C1BADE4A [email protected]
221,560,139 *154AF11D11C9632625050385E264E584CD4060EA ANDREATACKETT
221,560,140 *1541E3827526EFE9494A2F67D550650D5EA46C3F AND YET TO COME
221,560,141 *15491ADA04E1E0A6750A5C972B5092F38577ACB5 DAY'),(30,'20080615','FATHER\'S
221,560,142 *1543F6EE048628EF43A31870F1DEFF878BA57F12 anjaniprasad
221,560,143 *154C1E90C87D0BFC87F8C2C9ED5FE11DC6CE927B Dbm3
221,560,144 *15484EF86B6E7E72078138305B7150923C5EBEDD ANTORTALKANUJA
221,560,145 *154CDCD554E02A3D99356CE3671FAE131FBF5F1D ANTWAN.TOLZMANN
221,560,146 *1542F5EB323538F53FDE8DB373B59E622966AF49 DDIAMOUND
221,560,147 *15412CFCEC80F1AEC09F746FA77E174043FB9F5E AO2Z_
221,560,148 *154BB01FD60AC232FE2329910C5EC2BAFC07F06B dee.chase
221,560,149 *1543973C2E658898B43C3FFB4F2930111E359859 aq)q.
221,560,150 *15437343AA0E3C7C1691C2C2BD1CC71B82576556 ARASH MESSI
221,560,151 *1542C5CEC8830CBCB6990EB15B919E781298C6C6 arianebonnie
221,560,152 *154FA84EA490E12E51141FB0F8D64049B2035E53 [email protected]
221,560,153 *154D1C06F8DC80392616EA3D51D07BC142DD7DBB DETONATION-(FEAT-FLIP)
221,560,154 *154C5B58DC4C30A06E5D94B2A99D4F4FDEA9C65A DEVON.CAPRARIO
221,560,155 *154CBE3FEC2930AEA0CCE11C3F8954036D4FA70A ARTIODACTYLA
221,560,156 *1548F566DDE54C707C17B5FD36D3EF84149E77B6 auo7
221,560,157 *154AA50D4841F47652450340D1E96393DFBC892C DIONOTOMO
221,560,158 *1540A6AF2C3205E9A202D930E5FFF2E0458DA3F2 avattusk7
221,560,159 *1547BA5009D9206901E6AACCC9F5137BC3EAFAED DJDKTXTYB
221,560,160 *15402BA999460C791E7FF68F64E8AFCFB3033E7C dm;gg
221,560,161 *154DF70C2ED39A0648034767847F2A950B1470DF DN$o
221,560,162 *1549270AFA344AF901ACE9B53BF876626944B012 B3NCH.$H0
221,560,163 *1548971E9F7CABD37BC45D35AFEB472DD1D293B3 DODSR
221,560,164 *1540A10AF8A50AF16829E5A21A915B4ED3F038C9 b5tdi
221,560,165 *154151A382DF8A8FF05D78AD9A814FA5FD241BC2 DONALD.STEN
221,560,166 *154F5D72E9BCEE49C324D6B39BBF5BB4674F45B6 DON-DRE
221,560,167 *15435734AF6B97B43DBD8E9FC06C4020106ACC25 dongfriedly
221,560,168 *15418533644153F53B28C016E38C6EFE72FD0191 DONNIECIESLUK
221,560,169 *154AD23565E2E7712895D409DCC834C2E15E6408 DOS(1
221,560,170 *154865A20EE10CCFE1348F25125C9293E43DC8E2 dr.k4
221,560,171 *15461A51CF8B54933E62D5C7472B1785538FD013 [email protected]
221,560,172 *154A88DADE70BBC100F81DBC0BA235A43ECE2B96 DTG(R
221,560,173 *154B2EB2B0079B35D8458C4F7A6DD2D2E4CEB8DD dtvb6
221,560,174 *154C527518D06DF845B3556D2FA15D1026304D36 DUIIG
221,560,175 *1544D9258C83ED5CCA064AAB0DD5C736DB6FE6A7 bced2
221,560,176 *1541B618072CCE36F0B79B7C8B76A43DEB2804AE BCR(3
221,560,177 *15407ABC920F226F384B0FBD7DC03F507B6A538C dyv17
221,560,178 *154FD71A5118D5DE4CA310C29EB0C6640AA8236E BEGRIP4
221,560,179 *1547F8F7EDF1310B454A997F3519953ACE5E2A36 BENTHAMISM-'B/E/N/T//@/,M/I/Z/@/M
221,560,180 *1548A131E58BB91C74502FE21FC1D5703A1F520D beqqq
221,560,181 *154F895B4DC187F7B7B7E79E49C9CF16A0D5B70A BERT.SALVATORE
221,560,182 *154B27C508C914DC678B64BA2EA6EA4976A041D9 beskrywe3
221,560,183 *1548FF4CDF03FD2DDDCC19FC05EC3DC28552EE7B EDERBSLEMEH
221,560,184 *15431F3AA4395C2772889A66C9D4CAB07F987E88 BGRAYMON
221,560,185 *15419B8D3348E4C69446178D6B9704452AD79D6C EDUARDO.CORBIN
221,560,186 *154B079A1056933AD16D41E285DD86FA73FFD3FB [email protected]
221,560,187 *154FD8D3E46C715B0E33CD60E8A5FA3DD3180C77 BHEZ=
221,560,188 *154A9B8D933E18B1B40E53343ABD76D97D8DC15B BILLIECONRAD
221,560,189 *1549DCDC4E2D4DF0B69548F0AB58608FA9EEFE60 EINBLATTKALENDER
221,560,190 *154A423FE2DFD5D22D8CD6E19D6B9C26F2996980 [email protected]
221,560,191 *1546FE2C5CABC4C61A5ADC41581B8755447C4A0E ELECTRONIC TREE
221,560,192 *154C5CD4253B716203BBF57AE8464C4D42F020EC eloycalzado
221,560,193 *15403D41407F7D2A0C227D2FEAF0AD8F2126A15C bm=mm
221,560,194 *154BDF07B9351AAF934430531A149251B24153E7 EMICDSTPETERS
221,560,195 *154E7426708375E6BB606E88E59020F27837B9DF EMMANUEL.BELGRAVE
221,560,196 *154EF8BEA92612E26DFAEB6A3AD361852653BF4E ENACIYAR1
221,560,197 *154E9292615BBD7ACB1563AC7A0386D4ECEAD826 boycemcrenolds
221,560,198 *1548F2C90E016AB2ADF7D9834889FCE3EC81307B EO%0
221,560,199 *1549BA8D01D8AF702817CEAFB3EF1D7F3D722F53 ERINNERUNGANKL
221,560,200 *1547E82EDA383F58FD3FB7855DBFE6DFDAACD2A2 br:ia
221,560,201 *154698D70F850EDD1FB22A42DCF292165CA1216E esminteoren
221,560,202 *154CA4123C6E7C054F3B5C17FD1AC542BF5E4768 bryanmease
221,560,203 *1544EFC35FDF2DA98C321F01E66DE940594FDB81 EVANKOHLHEPP
221,560,204 *1548577A249CD010C17C616551F00AB580C67090 [email protected]
221,560,205 *15453ECAE8E861141BB4ACB6BDAA9528B71D15B5 ewnl
221,560,206 *154A2240AD54B6783EB17EDB624C532BA45B7500 bswrelatorio
221,560,207 *154F54373AFF24BEB37A8D7CCFA9AFF60FDDE6FA Exon
221,560,208 *15400FB8AA23C5233A9736D0D6E3D172B00859FA BUSTERBIONDI
221,560,209 *1548C60CF493C492C30DF4EE4ACB1BC0627452DA BUTI9
221,560,210 *154F069F0DB7D5B774969D6FF6527F208E84D1DD [email protected]
221,560,211 *154582BEFCF8132EBD1AB013C1B33A67D37E117F fast and wild
221,560,212 *154064AA0FFCC2C0BF41BBD0282F108703DC6A53 b)yfw
221,560,213 *154D6642F3C9732952435E4EC3FAB85D456A313A C0NC3P+UAL1ZA+10NS
221,560,214 *154E1DA220E1976709D702F912243D3730796704 c.3lv
221,560,215 *154EF9440B3AF220E34ED7C83420BD70B6AD7BC9 caesaranimal
221,560,216 *154951DFA195951072C9F08ADD3D919D5B5C9584 FISHINGE2
221,560,217 *1542BB245D614B6952CAAF3930F27133FBF513E6 FJD5
221,560,218 *15495704A771E90494540AAE71E4D0D47AAD5CF7 CAMELLIA.(TARAFONIKA.REMIX)
221,560,219 *154C27D49DB53C2D2DC35B5863D755D2854A0E9D [email protected]
221,560,220 *154ED4E2C28532ADCAEB9A749462625CA38ED357 FLOOM4LOY
221,560,221 *154578884AA9694550DC3F2E1F0C356F9B22BD70 Carnaval,Op9-XVIIIntermezzo:Paganini
221,560,222 *154EDB3B74383D74E44A4F46FF3E6A2CF7E09D7C FOLAWIT7
221,560,223 *15434657689055B326C8A5035BADDFD3AE94A6E5 cayo-julio-cesar-estrab
221,560,224 *1541EA319543254A7ACEE9C18930C334B777E2E9 [email protected]
221,560,225 *1543539ED61BE60598FE6E93FAA57760943384E9 cbqt
221,560,226 *154C8D85734B55C65010951B168FC913E4E3C426 FRANCISCO.CANTWELL
221,560,227 *1549CCF2AC484F4071A2B291077A3893A6B63215 FRANKLYN.DEAN
221,560,228 *1542C0185951D2EC4A303E2442CED8C75F5FF64E cctx9
221,560,229 *154E63C7F383B9998FEF716DFC94FAC5EDED760B FREDDIEEVES
221,560,230 *154A9CFEF28827F094808E8A7ADD98579BE60BBF fuge-xvi-in-g-moll,-bwv-861
221,560,231 *154A8B4735247D8EBD06893AA11762287703E725 FUGHERA
221,560,232 *154FA08264318088A92E8424BDDFD50F307AC0C8 FZFIXQW5LDJE
221,560,233 *15473B7DF3F42C18B992DA1FE6C2AF57DC231871 G032132131122
221,560,234 *1540CB9ECD96D0E3BCEEFBE1A78A4D4C8FCB20B5 G199503
221,560,235 *154841B2F2A46A8EAC6D729AD84C9612FC3A2FA9 GABLEENDS3
221,560,236 *15468F6E646EA3AC370A3555177468B208897842 GABYOPRUTA1212
221,560,237 *15408E620462593C9C103461823ED4CB104A3078 GAMEENDER
221,560,238 *154D3906003A88D9AA072BE47AD1EFB361E041AD garthwaring
221,560,239 *154FDBC3CE6086A46FEE927E20264249982961B4 GBAIYZBEKOVA
221,560,240 *1547FCDA93607290044B936BCA2B8FE8272EC888 CDOK
221,560,241 *1542AA4B0370640705F9EE576A1B0B766C02030D gefrictioneerde
221,560,242 *1546DF5059F93E2266566F535813AEC6D4A46516 GENESIX
221,560,243 *15489D1A2AFB7D2303726DAB9EF6B2D62ABA1C48 GEORGE.COLASURDO
221,560,244 *1541BEBDD9B1B7FB277E39EA560CA01803977D81 GEPRESEN7
221,560,245 *1547C40ACA4F572030A1C1271C5C228FFB47327A charlesknuckles
221,560,246 *154595C209661B9B07D9DC826E0DD5CDAB3C15A1 gnirrop8
221,560,247 *15442D90F35BDDA2DA239DAEFF482DAB189938E7 GOMEZRUIZ
221,560,248 *1541F3468DA9EF47B1672799941F90542724D956 CHENGYACHANG
221,560,249 *154E042760FE527C8ADF6DC087F5776BDEAD8AF7 GRANVILLEFEISTHAMEL
221,560,250 *1547B24B67CCDC7579FD0B7CC04810B66D53FAAC grapefruit-juicy.fruit
221,560,251 *154A8BC4F7285CFDC0D068443993AA0F1A181605 GURCUIOLI
221,560,252 *154C480AD7F8EF4ECF339770BE3F8D8D60F9470A GUS.SIAD
221,560,253 *1548FE00CD879ACF9336CAF244D8B961E37B57A3 g;x;
221,560,254 *1541163C776286A255B5F7FF14CA2A71A71C7066 [email protected]
221,560,255 *1541C8FD0CEA17DF3805068D5957C93155B6A0C4 HARESEWAEC
221,560,256 *1542CD2474863C16E86CDBC1417B8B8EB608BC82 cidtsuaf2
221,560,257 *15479B9E198B583F9CD0E517E07520B7096EF3B5 CIFW
221,560,258 *154244078F42F757C246B5B2A0111036F9AB9F66 ciloimeh
221,560,259 *15460BA15D77E0A2EE4439CD702B4E6BF2471558 HEATHERWINDER
221,560,260 *154CE54D481213553256A8A624DE3888C7C26C2C HELGAKING
221,560,261 *154EC3C87BD22B7907C390CC8A6ACF1843D5CA0F [email protected]
221,560,262 *1546167D3504D3658296CC3704939D9400AC5357 HERSHEL.COFFILL
221,560,263 *154EBE96E7BF47E8EBE8618D9B6CF3A550179754 HINDI LULLABYE
221,560,264 *15459A9DB40754041FDE08DFDCEF767ECA642E64 cnerg
221,560,265 *15438E3180B0385FD1B9F970495A4B4773BAFE8D colemanfensel
221,560,266 *1548A06AC112F0C9D662302F7BDAA25508BB6D9D CONCERTO GROSSO DMOLL: ALLEGRO
221,560,267 *15462C3EE3DA7FE0E66328F37730CADAFD9B9725 HUJCIWDUPE:
221,560,268 *154A20BE06BEE060E9F3C79CEF192490D50611B4 [email protected]
221,560,269 *154C7B8FA1F1DA82CC213E9A18DD55291CF4238E hunches
221,560,270 *154FA8D182B95A8CD6765CB105145F6BB4DB21E5 HUNG.MCGRUE
221,560,271 *1544F1EF87528FDAA376429FECED8A72E1DBC25B CORDELL.CAMPANILE
221,560,272 *1549FF15D65D898BD3627D6F07C079D214BDC46B CORDELLNADELL
221,560,273 *1543224912BCC28F43853CB9CE22FA7FB89FA5E2 COSTANINA9
221,560,274 *15464B56E9F7937A4EE01E54D59EF0A8DF46BE97 countershots
221,560,275 *154C719AAEAFAF93CE6E39FE788701F3A6B40284 C$SK
221,560,276 *154E534E467B548590696731606B57648E77FD9D I'M A POLICEMAN
221,560,277 *154E3E877503677D4AC5BE0F497AB29600DF188B inikita7
221,560,278 *1547D99DD151D04498EBEA2C88AFF8A19ED448B7 D1RK8
221,560,279 *1544FE5945A583B4ADDE4E1AA9E696C0FEF07253 d5oi2
221,560,280 *1545A7266C9D91933E5705AA5B8A742C136C9C55 d.70k
221,560,281 *1549487292ACA3275F6383322DA47CB1CFA73BCF jaimevanoven
221,560,282 *15431A050D02A081C4C54D33FAF2795FCAD4D60D JAMESNESSETH
221,560,283 *154CA7F508A3B68CF80F856199EFA5641AC1B417 DAMPFLRAST
221,560,284 *1547719CFE641DFE6A0637911645D609848E8019 DANA.VELASCO
221,560,285 *15441C1CEB33D7956798273E3E3FAC9BF6678D52 DANNIEHOGELIN
221,560,286 *154723C31843C47DF1F3367F7E846BD07BE9EF99 janettgarcia1
221,560,287 *154FB10EFE5DE6419B3E1895E0DE9A47A2C76EE7 jarrodsarnoff
221,560,288 *154D25B171A51D9ED54D8943D7C4493C2EA62C2D JARVISMECHAM
221,560,289 *1547ABFEC56361EC31B18C822EC4E98D77D0B50C JAYCIEWRIGHT
221,560,290 *1545A8D4561603AF6C7992CE5FFB0074F95FFAF3 [email protected]
221,560,291 *1545AC843461F045E8DE1568BA219448241E06A3 DARRENDOMINICUS
221,560,292 *15476F3ED8AFE80D0C5C8F9C8E539CF296ECC22B DARRONHERTEL
221,560,293 *1542EF53F272A67C1AF2167FD19C4BA3CD4881A3 DAVEMCINTIRE
221,560,294 *154BA514E5ACA3E803989EAD886751FAB0D2ED2F (><) ` D#####B
221,560,295 *154D5BFFF39D3904F2C364C36E7DA161ABD13CAB DBJR2
221,560,296 *154A220879C1F1381080A009AEDEE89063AD1E63 JEWELLTRAMONTANO
221,560,297 *154F92E5E3200DFDABCAB87CCD9D40EDECE72CF7 DE1!M!7A7!0NS
221,560,298 *154410B1DCAA9098AD52EAB5E6B3F049C8F9D7F6 DEANNA.ANN
221,560,299 *154B5089C6AD9AD0458E8A95A169E1CC02ADEC28 joel1934
221,560,300 *15458E5F35CEC3100E297B32BAEC6F41E901EC99 DE.KLEINE.DINGEN.IN.HET.LEVEN
221,560,301 *154A21AD84F077E36B66BBDEBA1DBCC97B31F221 JOHNNEYYY
221,560,302 *154D18102A62A92B96A872E83F8F362008F38BA7 Joie.Bunsen
221,560,303 *154A6FC303312CD2D7F19931866782A50C4D0404 JON.RIGGINS
221,560,304 *15450672DBC6AF2B72CAA73DFE061894ECBA22C6 joushubi2
221,560,305 *1549D2F2BF3BF4F88900C7A456455AC1FD6AF730 jweyjmtdx1aj8
221,560,306 *15436291649FB1FB2C7AD4AE84FABE6E3A302CC9 K.~2
221,560,307 *154C34459C615EDD40124DF7DCD26649EC20DE0C d;f_
221,560,308 *1541CFE6FC840809E7172666EEEF8EA63E4FFCAC dh2/0
221,560,309 *154BCC622C66E027313E4EBBBCEC74750C2EB519 dionismarce22
221,560,310 *154D43F2E7FE11FFA5088A33AF259129D4948AB0 disforestation2
221,560,311 *15453855547E2015029114D4B5281CDC892C55FF d!k2&
221,560,312 *1549862D68B952968E7D638E08E72AB18DBF66B2 DKI{
221,560,313 *1549A5DA2C80C3F93D13A83B2A8B7564773F588D KIP.GAUTAM
221,560,314 *154FEFE54F6BE3347CA0A3C367C9194E5C0CBFD6 dlepmortsegnaa
221,560,315 *154D6843BDB197724D1579C454A413A049BB1076 dljlg
221,560,316 *154ACBFB2D22083DF855E4830AA161CC98D6C93F KLUBIELM1
221,560,317 *154F84F3C813EC9A52CA59BF447A3D41D0D99E96 DOBO5
221,560,318 *154E6F95357A7C9AB211F2C6846B273FBB03A59E koryhofmeister
221,560,319 *15436247FE369BEFCCF47C4301E8D04082A7D5FD don.mallett
221,560,320 *154F79A471515C42CB121B11E882180F8C52E985 DONNY.VENNER
221,560,321 *1542625CE59B522305A9BFA2374F19201B5405E8 KRUBERTUS
221,560,322 *15470B05C58C6946654E25B51840212FB11D07B6 KSEMPOWSKI
221,560,323 *154D7B66E49A19EAD970CE4F6735C4120D6DFDCA Kuhajrib-(remix-by-Tapage)
221,560,324 *1549268D177D8F022E5E42C023AA705E06652DA4 KURTIS.STRIEF
221,560,325 *1545A59BCE686E0CE5681E9E8A452D043B880231 KW0
221,560,326 *1544F719EF1F2B6B1A1353986F1AE82612C6B00D DP9GB
221,560,327 *154C4A7639DDEF0B0498AE5F44EB917963D57936 DRL)8
221,560,328 *154C54210416EDB42063BE713A2C4967B66E8F5E DROUKIT
221,560,329 *1541FD33F0202445132E1FF0636FDAD6F95BC0DF LAWRENCE.BALASCO
221,560,330 *154AF85D95A1453096D0A62564CA306CB04CF465 LEAH1911
221,560,331 *1540C5557AEE4923772C2F5A3A11565659BACFA6 LEILA-PINHEIRO
221,560,332 *154BE84116B2FB9DD0BC3FDB49E7DD1060537FC1 lennyleight
221,560,333 *1543A5678664B613DFE1E31DBB40858EF40D54FF durchsetzungsverm
221,560,334 *1546204FEB3FFDAF1786CE7BC3884D5CDE96E2C5 LESTERPICCIONI
221,560,335 *15400B084D0E28B8C6D2F1F057766E0A4D95C189 Let'sstartitup'[Lv3Fusion]
221,560,336 *154455629E72D36214B35ECEE0FF7CF6BC2B090B dvg,o
221,560,337 *15434ABDC2EAD8D12BE28DB01CF720C230C1AF44 [email protected]
221,560,338 *154CE53A9EBB1769CB1A63989487B1C076D26E8B LIBRARYAMIGA
221,560,339 *1545CA548F03EF85CF53D4B4859D1FF747BD2747 [email protected]
221,560,340 *15468BC420D39B1312FF76F7EE72FA9E109368F2 [email protected]
221,560,341 *154AC7F74B523EFDF2991338CA7BEB67F3B64228 ebfcg
221,560,342 *154FB51C2F9906019D5D71990EA3C02C9D041EAA [email protected]
221,560,343 *1549D2435200ADE8E92CFA4F76D4F20D0E40469B ljfbelled
221,560,344 *1544FD1B1E6FD626C01F62E4DCAAA8B5FEB0E620 edgarskapura
221,560,345 *1540C7EA763B1D4477236AF70CF8F8195CC88030 lny
221,560,346 *1549F3001573F4171AB79425ABD81B77C50BE324 looking 4 happiness (dazed mix)
221,560,347 *15465815375E744E3981C49C60A88FE6625F5AB3 los.chicos.computarizados
221,560,348 *15496776E01579A9655957C129BE03BC633829A0 losers from rodman st
221,560,349 *154EA2A296C00ED7353DD7483510298897F8E4BD ek8qev8m5
221,560,350 *154BF424D5E126BF021232E8CD921CA4414D259B LUCIUS.GRAMBLE
221,560,351 *154A0966E9C1C26C57A77805BDFC53DCE82E02F3 ludomiezin
221,560,352 *154995837EBD9CA6BA1AAC8FDC93B81B55E0FECA LUISTRADUP
221,560,353 *154B3ECE8917C593D9837B67AD40C88B0CB19759 ELLSWORTH.BROSCHINSKY
221,560,354 *154DC3DF426251438C2249B736303A8B561DD78C [email protected]
221,560,355 *1542217A948A988FA116BBF196E0A8FE6B11F638 LYNN.KROMER
221,560,356 *154F240C52F3123784248BA688859FE20A8C18A7 EMOLEMOED
221,560,357 *154F5F942763F58A98D7B7A67081A58DC7C29077 malikpennacchio
221,560,358 *154200EE7B2757F67F489B22769B4E3E81689A73 MANAESAR
221,560,359 *15428EFC1C9C15632306A0358AFE31A0097DD8AA ENNEISSI9
221,560,360 *154693CEF369348BC293A0414CF47851EBC4DE2F ENRIQUE COVA
221,560,361 *154E60AB1EFD98E883CC92AA42D97367FB164F55 ENRIQUE.SUDO
221,560,362 *1544B1CC5C4545C68DF40E49E883A60B55B2D6F6 marcelinogeralds
221,560,363 *1540C0F05E72095C32E73CFE2C703EDC38A7CBEA EOHX
221,560,364 *154C879018A6F47DF339CA87A214B4D1E1471357 MARGARITAZACARIAS
221,560,365 *154B6282BE9F8E3C9309075EDDE90CD41F9586C2 [email protected]
221,560,366 *154F3FCB02081092D3EE6C7CD27C32CA564AAD81 marvinhallock
221,560,367 *154F16AE67AA0172BFA9E8208C3EA46734AFA89A [email protected]
221,560,368 *1542B552F2D7490DF214A65F8E13B64A110437EF MASONBAZYDLO
221,560,369 *154F11924FD0B97ED95D7C0637D102B430012144 erikfahnestock
221,560,370 *15476BD1A1FFCA084E1FC9EF82B17436989FAEF3 eropticses
221,560,371 *154B92A20C3E2BF40DB6C327D0889B2851274D49 ERVINCAJUNE
221,560,372 *154827254D279A02362DB9C89AD3EFE7421D06AD *erw
221,560,373 *1541D2E20B9A33AAD813C5B222BC8C9BA171152E ESLLL
221,560,374 *15476189BC796D7E55D7B5FC1357CFAC6435E0AE mb\.
221,560,375 *154B061B1E14125F2450BAE99DB066B21F7758A0 mcgroarty1
221,560,376 *154102BC5E02200B6D7B1B6C837E933E78296C45 melikebox
221,560,377 *154D6AB3F6CC02156391E9454E70FF656EF12A04 mellužos
221,560,378 *154E99D8F84990BE12C41FB0AB3B436F6E5E5615 MELSHAROSSI
221,560,379 *15422FF70FB0EA7668CA5B21392DEC43DAEC9A90 et.vi
221,560,380 *154F4A78B98882B996E5E42D12F79A2728D268F1 EUSEBIONEVEL
221,560,381 *154C5A80A74D0219AC5B4B17588859B26E49BB75 MIA2GR00
221,560,382 *1541C700397FF550B00B6DEFFD9549AADFA56EC0 MIAZILOOKH8
221,560,383 *154C2C1B31D5238C076EB8C91E4A5D9246695346 evorgskn6
221,560,384 *154E38F770D985F8DDF36C4602FA94DB3B3FDC54 [email protected]
221,560,385 *15452253DA8CCFD32CD638CB19BE0200BA05AEDB Exon
221,560,386 *154C1F85EE657843716F47B6D9D3F88C062F7152 FĂCĂBEȘTI
221,560,387 *154D0EB3E6A755278BFF79623086B19F824E9D4F FACILITYSENSITIVE
221,560,388 *154E1542CA1D5DEBE79F484B597766D7EFFA8AD7 FALL-DOWN
221,560,389 *154154E47B3EF76F35F87AE92A12E7C1FBC1F76E fcb'
221,560,390 *15415D0E34F133587225998436EE171F49D92271 modestostfort
221,560,391 *154E41DB82016C9410D5283372855F6DFAF1D979 MOMRK
221,560,392 *1542DB3E7B6A069F5B7BD4ABB2CA80DBAB0BB6DA FLETCHERSHILIATA
221,560,393 *154040582FD5ACC2454E29BB37703A06AD5AFD05 [email protected]
221,560,394 *15415D6498A5706ECE6F66BDF5B3BE557A827833 MOOKAYYA
221,560,395 *154711FC302BF3F8A5685ACBE6A4BEB47A94FDB0 moto688
221,560,396 *1543567734B7847A6CFE766C9AE6544836C953F7 FRAGILEDUM
221,560,397 *154F71A4A2B067F418AFF4FD940A833AF8594EE5 FRALIUSANING
221,560,398 *154493ABF4F04D7526502DA4BA1D00BB6C725E91 MUCRONATING
221,560,399 *1541DEF6A514D0DBAF20264476E773ABD5083CF0 [email protected]
221,560,400 *154A9B752C2997E32D4BA7269E887FB3CFABBBA1 fredricardelean
221,560,401 *154E3AEAA34C1332A85CD953D16918D9A3629212 FREEMANMILOSEVIC
221,560,402 *154BE77C90D163DF3755F533E42A36A79D5612A3 MYCOGONE!
221,560,403 *15460A97940036DD9E0CBBABDCE698F67CCA4852 FYAGUE
221,560,404 *15437E52411B0BB8450B21E1CB277E2D8466C77B FZAFIA
221,560,405 *154D61BE20E4320A66138499B607CA4E55D558FC [email protected]
221,560,406 *1546A3735E8A86DA7C47A5653607503E1E01B0C6 GALE.ARGUBRIGHT
221,560,407 *154B8B66EEE47832D5CE518397BAF7F3E343F93C gandalfpetunia
221,560,408 *15482A8698A463BD3A2D34D89102F3B6C26648F6 gestreckter!
221,560,409 *15484E7E600DE0480B31722FE0013A76654C3873 GILKOSER
221,560,410 *15404AEFE4F9019C121DF70451D6F16C3A6D80B3 GILLEODS2
221,560,411 *154D2D5A4A769D61F2D003E4C7D3B35026574491 GLITTERIED
221,560,412 *15425F449DCB0CB566BCDA210B896625D2111E5B nonmagnetized.
221,560,413 *15445BA392F1C576F70CBEB74153FE7452211F89 [email protected]
221,560,414 *154BB2D1B34702E893B9901C2E48C473BF6091A6 gravs
221,560,415 *154DA39E8F9E070C6737D5D5F522A212429C080D guadalupearpino
221,560,416 *15460F34E2EB844E961902685941B32464142CDC [email protected]
221,560,417 *154E94708F33A5036F9E59CD32DE5505CB45BB8B (>_<).O~0~.D8
221,560,418 *154290D0E46568CF1E7C9D0BFB453D726A7299B0 H4R$8RE4D7H
221,560,419 *1547F1D3F22F5BC421762940CA927A4A800AD293 hal!bu+$
221,560,420 *15406C555F12EFD7041D23C91C1AAF7194E9F254 HARLANTIBERIO
221,560,421 *15426F454902691E7E3034944CE06011C28DF3A7 [email protected]
221,560,422 *15425C36C73F15C9C50A480715CA3CEF9622889A ongrijpbare1
221,560,423 *154AC42BDC514DF95959C965A7F1BCF00FDEC00D )o(o~0~<---3
221,560,424 *154DD9AA01C195F367E1C407B6CE2599F14FAA69 )O(O~.QP
221,560,425 *1543C3FD3C656E04BD572F90AC9EDFCDF46ECFA5 HIBYCIONS
221,560,426 *154FDE008920430B268B1991F7AC254EDCCCB1CD HOBERTSADORRA
221,560,427 *154AD012DDC48F6703261F2CC5BA7ACE182B2C12 [email protected]
221,560,428 *154DB827DC745F1C89D7B4B2FE9DDB9362A79769 PADINJARAKARA
221,560,429 *154D12DAE43B6A7E1028A9E6AEEA93FA4F4FBA7E PARCIALIZA
221,560,430 *15406BC327D903A7371ABF6B95D3B16BBF3CA2EA PARNASSIANĂ
221,560,431 *15459700DEB717E49E3CC9ABAAF8DD94F2052F3D href="//kingcharles/ref=cap_kpm_pdp_11
221,560,432 *154C55626F087E00C1B5C901488778E67F5FDFF2 P-D-~o)8(
221,560,433 *15430FF74EECEA7996F8EACE9A89F78087F95180 httpwwwchoraphor-he
221,560,434 *154B33D91DFACC7BD729C4CDDF67463E0621B6B5 peras-de-salvatore-rispoli
221,560,435 *154626CBB96E32E266674A46BF1DE66B72635C44 PERRY.SCHNEIDMILLER
221,560,436 *15482DA44281AEF33543A0206CD0ABADE390289A hugokalima
221,560,437 *1546C652BF27372E96D4F00E3204DBBCF820A41C HungarianRhapsodyNo6inDflat
221,560,438 *154591D6B3A4EED47F9D34AAF3F37D95375EA5E5 HUYENLBGN
221,560,439 *154AE0E048A4C392CF84DDAD863215EEB4C41A5F pheakering
221,560,440 *1544E5D8CEEB4BD6B4400A8F3C5AC134976B3AF7 PHILLIP.CALCOTE
221,560,441 *15417365992BCCC37FA25753C0A550FFAEB41169 photo3n9r4v3s
221,560,442 *154B1A45844F332838B9CAA6F38285748A9BC9B0 IDUELLES6
221,560,443 *1540BA35399C5EBE0848F6FF0AFE92DF4D5E7CBC poemtah
221,560,444 *15473ED941D4286172E4CE90C60C04F56B7DC3B0 POMPIDOUCARSTEN
221,560,445 *154E9B295A1946805C4F70535C62D4801051B7FD INCOLLINGWOOD
221,560,446 *154A1BE836B6E3A881184C06FBF03EDFD105920F praquel5
221,560,447 *1543A3A9C74028D5CF45A723092F4C7591673CAD innentriebwerkes
221,560,448 *154702B4D00F2C50B691C2091A62B876633826F5 inside.(howard.benson.mix)
221,560,449 *154EB6FF0C8379D91C1C1F77ED8F7188ED0229E2 introductionsih2ntrah0dah1kshah0nz
221,560,450 *154E5A3DC0E453CAA46229400E8A53C385DF3748 INYOMK
221,560,451 *154D0A438CE1B7784F483B6761BBE72ADCE3C492 PRISONERS139
221,560,452 *15409C35678FAA1556207ABB8F1659B1E9327E25 IRADEBOLD
221,560,453 *15444C1A942FB3B65EDC85E53417504DBA8D91BB IROBE25341
221,560,454 *1546D9E8B56D6FD423B4CB664272132F43E735F4 irvingschieferstein
221,560,455 *154F770664BB7F46FD50A36C5644C13C3DAF5C7F ISAACOSHIMA
221,560,456 *154AF99BF7716552AA829C9D2C19556225902E9D islamismi
221,560,457 *1543C207B062CC4B824B931BF84302181281FB68 ispeakswedish
221,560,458 *1541FBA33D514D566FA4E33D45E61CC0F5365F23 put-money-in
221,560,459 *154D8061DBD470FFC04244DBF4837FB4D4E48A77 IVORY.STRAITON
221,560,460 *15408D1676DDD411C79E28405D3B85B9EF6DE4B8 JACINTO.WEISHEIT
221,560,461 *1543FA933471D4EE384EFF7819C9F3B4DF8007C1 jackielenke
221,560,462 *1548FCCD4267E9593D942EE3D6E8E1789071BC72 JALEN LEBLANC
221,560,463 *1540AFBCE2446B39F6115FBDD8D2CBCFB31A28AE jamalperkes
221,560,464 *154E7F35A3E5C8C88056DBC00B8F98E0DAAB0313 JAN$EN
221,560,465 *1549C266CA77149053D3B9ECEA163A96FA2E0276 jarrettsjulstad
221,560,466 *15495A31854DE2AF405BB2413C43D78EC6481DF0 jasonmaslanka
221,560,467 *154C6DCA1B2FC84E7416E8D964694E218F1A2DC9 JAZMYN705
221,560,468 *154D0C52B81C3899CFBC07E17D2D9582FEFAF72C RAMREDDYM
221,560,469 *154D8656E2EAD3911C44DF9B36505FB45AE6C041 jefferyconver
221,560,470 *154949BE4648026C34B9BB81B7CD14EF9B46D5CB Randers-'R/A/n/@/RS
221,560,471 *15495F3D210A8DFFA8576EDC9EFEDF55BFFB043C JERAMYCAI
221,560,472 *1543EA28AF91D2C616F925990E99F42369BE6F8A JERAMY.NAIDU
221,560,473 *1544AFED4213AB4B901385EC82BC63C1A8194A9B JEROLDSUPER
221,560,474 *15463BE13A0F4FDE158FBD30004B23FFC4BCDB0F JERRODMICKELSEN
221,560,475 *154A01D7BC29B9FC8F23F23E2A46AFD5E8BAAFC9 jerrytekulve
221,560,476 *154660229B5412E0B86FA5F78F233F939646C526 raymondcruell
221,560,477 *15499D004579E28B69458ECAA7C8C89CA5B2D39D JESS.WISNIEWSKI
221,560,478 *15475E2FE616CCCE9F551C80F83151BFD50BB6DB Red-and-Green-Make-Yellow
221,560,479 *1548893562D8A88FE8C3807DD9DEC4545D3B6E2C [email protected]
221,560,480 *1540DA77B3C57C9CCD953DB97969843FDC761239 [email protected]
221,560,481 *1541FC922CD58BA63BF05EB5924DE8584593ACDC JODY.SHERROCK
221,560,482 *1540613090B70D4A8ECF824DAA3989A5302A3022 reginaldmuschaweck
221,560,483 *154FC88D5BC6168246BE959FF333574E62243E7C joegillerist
221,560,484 *154413ADB5B821ED26B4CBF47B7E03BC3D724B3D REGU14+ON$
221,560,485 *154FF49A763396CC560347A27B9BDCF5FFFACAF8 RENALDO.LINGINFELTER
221,560,486 *154768E718D8EF8AD1C2B26E291F189DA65E30A2 JOPHERAYCUEVAS
221,560,487 *154C52B170D5B504B201FE20EBAEF7F590952312 josephminkel
221,560,488 *154949B4463A5C24983A3550CF1323260FCD8EC1 JOSH-GARRARD
221,560,489 *154563FDC02118B0EE8D9F0C2FCFA206C9D14E6F JOSHUA.ROSEBUR
221,560,490 *1544EDAD33691750544D33C42D96B01262A859AD JOSHUAZAPPILE
221,560,491 *154C9374394400358A0AB8120AED99F1C9BBC5BC JOSUE.FISHBURNE
221,560,492 *154131C0B6EF8488AC0F85D3C5915266239C6415 jöttüknek
221,560,493 *1542FFBB895AE97AFA3037913F7057451912AE3B JUDERUSAW
221,560,494 *1546721AE7E469355B1A6D88E4B9FE68BFE4C287 RHAGAPRUNI
221,560,495 *154B6ADE50DE35FB9BAFE81A047894AFCD6C9E3B RICH.KHUM
221,560,496 *15485858A52F4D0B60049569C15279B24C652A29 rid191qnjr7wpfm3j3pkp7h
221,560,497 *15423D1EFB89C881E9E88FEC8FF17D9F59229FFE jumpamp
221,560,498 *1542FA4A2390B8D06EBF0D8BADB470DEB0F5791B RN^TRNT
221,560,499 *154F83DFD5ED35C6630DE6071B84B9715614A04C robtjunius
221,560,500 *1546948D56DF5D0D636CB890F4F700DFFE5D9DEB RODERICK.KLOSTER
221,560,501 *1548E8CC7603AA0D77064F417919577FC2513DDA [email protected]
221,560,502 *154C81C5A2EAC862AB27C03228F8A121DBA8A807 kapokkussens4
221,560,503 *154856BACD1E8377C1AF93653B38D402C26C64A5 Keep.Tha.Light.On
221,560,504 *154AC8B631E103C83E341463BC03C5DF3560E924 kelleygladney
221,560,505 *154B981941D51D7657244C862F5131838D48DA56 KENBLECK
221,560,506 *154F112E42EEC419548E029E68545E4977C2CF47 ROMANTIZADA123
221,560,507 *154331DC98D2B80B790739CE26929828A6F9031A rootentootin's
221,560,508 *154DDBAE44B29737916596C2498286C81B0956D3 roscoekratofil
221,560,509 *1544953E3CCBAE8843DA914F38456EC8E66EA7EC [email protected]
221,560,510 *1540F4EBC0A90BC63410C51304B5D57C6E5C091F KIBAEKKIM
221,560,511 *1546FB61BC9461C300C084EF9E6777CA0081C074 ROXANARALUCA
221,560,512 *154609EF85DFDC6C6F5623985848B100B6FA3F5C KIRBYRIPP
221,560,513 *1543707B1CC0D71BD16B71C3B919055630C19322 KLAYMER8
221,560,514 *154C10123A0DEC0CFA7E537EF4F060570AFCBB5D RUBEANIC6
221,560,515 *154FF9BD41E6624CFA294F43EE8A82EA491553D3 kristopherkaylor
221,560,516 *1548F12576E735F87AC87277D34BF2BEE5D77549 ry_<
221,560,517 *154A51C2D5B109B0FC232E682D8142C26A64DFF5 S3NS471ON4LLY
221,560,518 *154C09E9978806D8ACB636A9D42FC2B2D814498D samuel676
221,560,519 *1545ADA434A211D7C61785DF5512183A572E8FE2 SARAH PALTRIDGE
221,560,520 *154A023866BB38B726539B9E1386F5D188C11465 laura.harreld
221,560,521 *154112944E1C8D2F7488521F6ADF849FBF36684B lawpickle
221,560,522 *1540F982682EEF3D943D1BDAEC42EEDB5EF655E2 SASHA_DRUG_4U
221,560,523 *15433676A51E47F78189A295E45D7FA4B95474A5 leigharns
221,560,524 *1549285EA630506AE469705711AD35395E169473 SBLSDERK
221,560,525 *154BF7AEB98F54881DF18A20345E393D0D8C7673 [email protected]
221,560,526 *154768F2D503A6BB361C32A04D0D27C0D2E2AA4F SEAWILDED
221,560,527 *154478046086AC7CB67AE1E9A0BBD03C616D1F58 SESURUASOYHTHCIED
221,560,528 *15448A6B0AE3D9C956536D343BA9DCBACE6FFC10 LINDSAY.HAMAMOTO
221,560,529 *154258E0C96AB787B7C5CC14C6748B80936D3E0B [email protected]
221,560,530 *15426221AE8BEAEB5DE5384131E4B722D13525B7 LisaJane
221,560,531 *1549B6A1A7271026DF65C74D445D408586721013 [email protected]
221,560,532 *154023B38992EF79EA8C60A231A5B30586D0D11D SHAPELIMBERLIMBERING
221,560,533 *154B40FBF6B3D2368728A1835866EC209B994ED6 SHAWN.MATHENIA
221,560,534 *154292ED42A480D8354059620BDFE60F2EFB1D64 L'OEUF ET LA MOULE
221,560,535 *154AD8CDFAC41E3F0A28A7F01887819C57DD60A8 shermannoller
221,560,536 *1549A4D723B79D00F82FA6FF1600D9293DBCB6FE LONELY-TOWN-/-DANCE:-LONELY-TOWN
221,560,537 *154F5D9FF403C78BF0539AF5CD18F85CE87418CD [email protected]
221,560,538 *15495BEAB03A918A42A47FF140A9457A6005273F LOSHANAV
221,560,539 *154E692C51304BEB07DE03BE0FD6F96B13A92EDA showbusycursor
221,560,540 *1549F69481501FBFA9D26D4233D5192C4F3C15FE SIEJÄTJÄIDEN
221,560,541 *1546B73C0FC1F56E5EC9F2D586592AD813DE3930 sileno-1-0
221,560,542 *154446153C5FF1C2FAFED4DDEABCAAAAEAA61E6B [email protected]
221,560,543 *154CE222F6E7A2A57A5348FE48C3FA145075B4D5 LUIGI.KERCHNER
221,560,544 *154538170551E46CD4CF8EDE96D54CE000299F50 LUISKOLOPAJLO
221,560,545 *1541CF671DF45696CF07A8EDFA2AB4D5269B3093 LUZGIORDANO
221,560,546 *154E1752351D6AC79065BC92A7F945DD787386AE LWCSXGV4
221,560,547 *1543BD650D05594DCE1C856B9A043F38F21B8544 M0L35T4513
221,560,548 *15444814584D5559B0BCCF0361B6428A33509E5B m0n0$exua11+1e$
221,560,549 *1547DE4EA1A43367DBCD568FD999239C3EEB534A sivolvieranlosdragones
221,560,550 *154C32125BAD0774565925CC3B078CC5E244E2EB MAJORDOUGIE
221,560,551 *154291879A76A1C91B277722B379F6F6B47BC14C sleepingdiagonally
221,560,552 *154E7A3D9715372D62AEED31ED5BCA500FF74D39 smeekgebeden
221,560,553 *154C3D582C81E7D8D49355E13BA136A71D78DBA0 SNNIJ
221,560,554 *154D0783C5374020EF5EA1F89CE7EF59661A799F SOBUJD
221,560,555 *15405E5270FD8CC468F3E2DA2E491198F682A3D9 MARIANODOI
221,560,556 *15426B8E07DE5CC7269466ACB0CB7CC94B45ACFC SOMATICKCH2
221,560,557 *1540A0E57FCD3106C8953D984E4290DFAAA7C937 mary-kohlman
221,560,558 *1541834A1CD08D1E807F508C63E305A8E481EFD1 somewhereinarabia
221,560,559 *1541EC74BDCF2A77A381403D82820899E6F56110 MASONABBASI
221,560,560 *154C1C0F8DA2F303458A2F79A0F90DD028E266BF MATHEW.KRAM
221,560,561 *154A11917D9687CC52EF40F3170ED8D7B934D905 mathigodu
221,560,562 *154E53DEDC556AAFDFA133E83F386BE8DEBE5EE6 MAURICECHERNEY
221,560,563 *15414583324A265CD5C615144854B7952CC73527 southbeam3
221,560,564 *1547BB2B27E54010ADA7C5C246295C6AB60F6F9F sp!c!n3ss
221,560,565 *154AA938941B8277AE7934CB3F490026240C2FAC MELLISSED
221,560,566 *15428BA1AD02E78CF49BF97C8157F7EF4D06E499 SPRITEPINKFLOY2
221,560,567 *1543E988500061943078380EEE9EE6A4591AD748 MET4PHR45TIC
221,560,568 *154CE277DAB64B6C7E6BBC9165EABEACD1D7279E SREDIERE2
221,560,569 *154115CFCEB9F84E74A3AD1455C38067030D8CA7 micheljakupcak
221,560,570 *154D3E7FC87E2836872687716CFF60CD198108B4 MIDTOW M/I/D_T/OU/
221,560,571 *1540409A973A0FEBD5F55BACC025733E541E3139 MIKE-PEDICONE
221,560,572 *15457172D02B8636E21518F2106B018C2D9545CA STANDKARYATIDEN
221,560,573 *15435FDB340154B82F754FE00E3E1E01AB08BBFA miranya-karapana-tapuyo
221,560,574 *154B1FB65A6772A40E91DF4B400F34D134F61AB6 MIXEDUP.62
221,560,575 *154A3C17D314C669A4748B0933BD0ABA305D6B62 MOGLEGE1
221,560,576 *1544A2F13BF4E33ED743D938EAB0A61683F1FE15 STELLAFLETCH.
221,560,577 *154125A5CD11EA4C2A257FECFDA2212BCA4549D9 STEPHANELDRED
221,560,578 *1547CC07E51A28F16A5395224A25ED81E16B32A5 MOLOCUE4
221,560,579 *15409007C5F5F7147E15EE9740A87628DAB47643 STIEFBROEDER3
221,560,580 *154AF7F6B968066B968B462D3554D8686A5F2E01 STORLEIK
221,560,581 *15448A1E6280B0AF20DE00121913C76831846904 MOSHEHU'S
221,560,582 *154143905CA405FE98884460E6DC0E416224BA94 mtrodrg5
221,560,583 *154E2A84824C31D7B79F419097ADF9EF2AB34CAC SUZANNE SIEMENS
221,560,584 *1543A6DB0FEC4F684FD8EABC0C6F4ABCCBEFA2F8 SWEETANGEL40281234
221,560,585 *154082E2F8A75C3C10B22CB1F4783D587BBE7C26 SWEETVOICED
221,560,586 *1542A4A1C201A06F9614F2622A2A01F9E9133576 NA5A1ZNG
221,560,587 *154B4C06E21C7FDD82D42B41D8A3BAAB5505703E talk84108133147
221,560,588 *154F56FE5654EE70B7190073C1BF16E03D976DAA namespacecruft
221,560,589 *15495C4B3E221D44B6A0959707A3B4FAA5F6A15C TAMSEELAKHTAR
221,560,590 *15496C1EF72F217E4D15785173FB87CFDAD9325D NATALYA.MYASNIKOVA
221,560,591 *1542771D785D47BF106CA1E712BBAD8F66BD32C7 nedokazivosti
221,560,592 *154EA95DE4C791623E83FEB82BB23C40ABCE5F1F teen-babes-from-monsanto
221,560,593 *1541E296D6034810C874C33E8E02892DDDE665A0 TELLUNBSW5
221,560,594 *15433430AF1ECB3D3A12635F1365F8CC7721E8AE NEPALEDIRE
221,560,595 *1543381B0230ED2E0AF4E564CD80113E24F2F11E terronebell
221,560,596 *154F0B51E65B32349655321D36D49991889810CC THEOU81223
221,560,597 *154EEDF5EEF6FC30D6F89AD6E70FED84BEB3DE4A normanmckay
221,560,598 *15482EE3890842746685D5F524B376BB80E4197F THIS ROAD LEADS HOME
221,560,599 *154FFD16F5F74F1ED45775761A7603EB7EAA6EB0 THOMPSONR3
221,560,600 *154D6C3FD6443C7BFBE642B7DFED871F485E7BCE NYRIMMN2
221,560,601 *154F643E07A373F0B652AE84E4721C58D7BD2E06 [email protected]
221,560,602 *15461F45D1AD53A738112464529EED13E6284852 ˈTJEːS
221,560,603 *154578A0027AF2462D2336B3979DC71E19A0D2D2 [email protected]
221,560,604 *1549A0557072426B8DE0B095335DBC874E465F6C ODIKAESIEME
221,560,605 *154883A72A740B0A87B8B2D3208EE27F86498927 TOD.INNOCENTI
221,560,606 *154371CFDDD3B7722B599A23FBD89C032B785EA8 ois de roubaix, volume 3
221,560,607 *15441E443BD7E68BBB6010C62F1E266339004614 olarbado
221,560,608 *154FFF59511B43B1143E11C61347264B24425B02 tonydouet
221,560,609 *15451EEEBA46FE143C9E7EFB5CCBDCCF866984AF ONGEVOEL5
221,560,610 *154475E7B520DF3722D0A8DC240B70FBC753A3CC TORY.SUPPLICE
221,560,611 *154347CDB3C4457C849B92A37E102274CCA52CE0 TouchofGrey/JacktheLad/BoysofMalin/TriptoWindsor
221,560,612 *154758C7AE105A9BD4D96FDE6C5DDF03E7EFBEA5 TRACYPANTHER5
221,560,613 *154A7AF3BDE7FD90674307951EB7E6A6AF65A7A2 OPIATED
221,560,614 *154AB2085D2832E9A0522C2858A42332BE1C3689 マキシシングル『treat
221,560,615 *1541FCE02DDB4CFA71BFB01B069FADE4C97BFFC4 [email protected]
221,560,616 *15423025369DBFF592FA77A33BF2D4C3D009D05B TREINIUT0
221,560,617 *154D0F0534E9B5495C0D58BA03C11AE45CDE95B5 ormerfjorden
221,560,618 *154E147A19A2C6517149EA488CDFD2068B80BE8A OSDELROCK
221,560,619 *1548DD2AB31AC37D7AEA791A12C3A279179635EB trinidadwindus
221,560,620 *1546CCA8502C9595532B7FD7AB2C958C1246071A TRISTAN.SCROGGIN
221,560,621 *154BAFA34321D651FD17EC166304CA4A154E61A7 TRIXIEFUGAZI
221,560,622 *154ADCB1637CEDFC29B19EEDB2B2C2D133EDD9E2 OWNDWTW
221,560,623 *15409404F27B69EBCBD001992EBCDC09E398B3E1 [email protected]
221,560,624 *1545131811FA4E31CB659A82C9664D507F0BEB0E (>-<)[email protected]======p
221,560,625 *1543E37634223FEECB269C3F4D90F4037C79E834 tussentoed
221,560,626 *154E4C2D9253C11D668586742B80C2685A22904A PARISNNICOLE
221,560,627 *154C79277F045E2EA7D37F5FFA121D64D67ACC01 TYRONBOOTON
221,560,628 *154DCAB4B22D683E86678DBDC66371AE7CE1D32F path.towards.mountain.green
221,560,629 *154506F670CC5FE2F587BA9D3F059D0E17D25639 PATSTEKETEE
221,560,630 *154E3F5ABA61C494D24B8CE9F6B6C41CF47EA661 UFATTELIGSTE5
221,560,631 *154337B74318AA148A3FB7545B3FCD74AB1C5952 P-B-*-*Splat!
221,560,632 *154D7D8B71A64C9569D6177B6FB4CE9F02C415F4 p###d-`>-<
221,560,633 *154F615143F51935C11BD2245CDB9C2E4035E2D5 UNBELIEVABLE.YOU
221,560,634 *1542F259F5F63D7E487342219C042C0F0CCF2238 UNSPRUN5
221,560,635 *1545EAEAA002D3A29A5CD3E50E9E02AA905538F7 URAL-KOZHOKMATOV
221,560,636 *1549DAE050EAD673BFA5B60FE90C66B2FCFDD4FB person-eines-dramas
221,560,637 *1547E19DE278F9B7A8045390A895A38FF18A6662 [email protected]
221,560,638 *154584856FEED5C40BF177A36FA7B4F5F3906F58 philluka
221,560,639 *154B0CAA22CBD1AACCF854DFC7FE820372143838 uwschool
221,560,640 *1540BD2234FCD33929F32B603E81512D5179FCA2 PINKJUICE.COMWWW
221,560,641 *154DB915FBAAFB44AC644D12CBCD147A2ABABE30 [email protected]
221,560,642 *15427CB263F1003BBE2AB3DDF653FA07699ECB60 valeck
221,560,643 *154F29DDB1AB5865EB2FCD6ED451597E2910263D Plurbus
221,560,644 *154A7A56A52389FB07B265183399CFA34F90EB6B plutej
221,560,645 *154D45FC98569014DE163288170069B917050187 VANCEBERTRAND
221,560,646 *154C4800FB7CAA920C8AE8C2A3BCED0F844163A5 po1ypif3r
221,560,647 *154D0D07EF6F71A705DC35AE5AAE3EA7E7099025 VAUGHN.STICK
221,560,648 *154A7569053E28AC39A0293D75C84836E7578DB7 PORTABLE.THEGREENTRI
221,560,649 *154A4F83BED74BDB7F8DC8A7D19FBFA2355CC006 portf
221,560,650 *154D3C695CB3571B27FDBBA05CB80A021A17E4C6 [email protected]
221,560,651 *15430951EAFCA09A9A92B6C42DADAB7077AF8941 pp ~o ~o(00)
221,560,652 *1549DEA3ED139D848915861C0442A0C821157C40 vernongaschke
221,560,653 *15423C64F785D593DFAFB9F96EAD3F0040E50A0F PR0CT010G13S
221,560,654 *1547A2265ADA8FA0C4B90CF5077F4C3E6401DC86 vf^e
221,560,655 *154EA5A5AD0A4106CCB9FA976D767083CE4068CC VICKY.FRESNO
221,560,656 *1546F4F6D41E256CF36D96655112ACB314DE7DAA victoria.turnbough.trickel
221,560,657 *15429A2782CADEDA9626E5D5CCD583E81A44C68F VIHANSAKO
221,560,658 *15453CE40E717D6EDC721554A7D3C6069F483EBD VIJECNIKED
221,560,659 *154EFF9088C9BFADF3560904CE624096B2FFBC22 vimoksaming
221,560,660 *15456A9A924FD90200EFFCE041AE846055B4E0F2 VIRA.CZKNIHOVNAINDEX
221,560,661 *1547449E54A7D0D3F4306A738357D7D255D0B11D vitrages!
221,560,662 *1543C6BE7886880E091AE07EFCD23A602F64FD39 QEL:
221,560,663 *154C1757D8A6074DB676D555C55C5FD5631535D8 QUINCYLESCH
221,560,664 *154E627CEB32DB1C93E9AC0FBC5FAB3E83FDF8AB QUINTCIUS
221,560,665 *1540DCF6BEA95773B04EC4D4125B7C55A01C980B \QZAAA
221,560,666 *1541BB8C89FA5300533D3D077408DE426C372902 RABIANTI
221,560,667 *1549BC3A8CEDEED88DF4A14ADA3DB2BF423B8C09 [email protected]
221,560,668 *15494688011C65AC1C466FD775B981DF44D55B71 WAYNE.EDD
221,560,669 *1547D03BA06E22F9A4D65349B47BD14625F7AD9D WAYNE TAIPARI
221,560,670 *154DDD89C93153060FA51E5065F079C5DB6D9920 WEBRN-MACULARDEGENERATION.COMWWW
221,560,671 *154DC8CCC98D8D9E817449561A0DE0F41E0D04F0 RAJARAJANRAMAKRISHNAN
221,560,672 *1549E84746CBBEBFE3E33A8A704ECBC60143DBCD WEDERBEL
221,560,673 *154486FB111A308DF5F7D3DF4528190D8D2C4F84 RANDOLPHFLUEGGE
221,560,674 *15430BA4C97D812A6AC77A58AB16A3C0155FB8FA RANDOLPH.FRICKS
221,560,675 *15438155BBB49382AA63C4EDAC9989601441467F RANDY.BRINTON
221,560,676 *154A9E843A09699081D7F8F4227D2074A97F6306 WELDONGOJCAJ
221,560,677 *154BED34B86E1D72CD6AE61B921BCC8E913015B9 WENDYBOHOL
221,560,678 *154B7B2907B7DC491F9F644897F47A45C96E5C84 [email protected]+er5p0u+5
221,560,679 *154B6264EC0666EDE4665269FEE15FA72BD1CB53 r-die-Vergangenheit
221,560,680 *154BAA5037B5AEE998A76835B80B6AF57F860E2D WHELPHOOS
221,560,681 *15478C427C4546E7A9B8AE8F69646755CDD2FEDF RECEIVEDENGLISH
221,560,682 *15440F977033D331C97D2EF1BB356844800E0B32 REFUSERS
221,560,683 *1542469E1BE6E98A271A8F4F7802F03C24379591 WILLIAMHEIMERL
221,560,684 *154EF40B26D03115BF2DBA664A87B52165AE3E1D WILLIELOGEL
221,560,685 *1543CC5F6F1375BAB597AA58BEDE5F08FDD5157B WILLY'S HYMN
221,560,686 *154683384F8CB4E5013C7327A3E07B06B77048C2 WOMANL!3ST
221,560,687 *154810FF128978C80924E10F87FF367DDCEBDB41 woody'srevenge
221,560,688 *15457042F4F97B611FD78431F7D1C92BB44E6E52 RIACHO-DOS-MACHADOS
221,560,689 *1546E1CA08A498ED045EA4C659BBA584A9EB9A2E ricardomapes
221,560,690 *154B29118AC7B2803814C8AEF1E5E43B89B9954E WWWBTSQUAREDCOM
221,560,691 *154B5F85C8DEF02D0266CC1FF74A87FBBFCA432C RICKSTRASSBERG
221,560,692 *1547E60799BB9ABCC75131D33CB805A1ED6BEFDF RICORRASES
221,560,693 *1546860C181A6829158C8DCFD64B0284FD85A32A WWWPELLAPUBLISHINGCOM
221,560,694 *15467E9D882470418E5BB91EFF0C2443685E8FE8 riston
221,560,695 *15472808B92F0BB39445119680256D0983862926 xennihst
221,560,696 *154EFEC120D0A13A811C86D8A7A159216C7D55E0 ROB-SITEK
221,560,697 *1549C2A330AFA92D7841F08F37AF8FFD65690ABB (ROCK).
221,560,698 *154805B81EF16B7D446F253547E1810663A1D0E6 rockyfreehling
221,560,699 *154E5D300C233B61DE9802E4771AD7EC7F144BF3 [email protected]
221,560,700 *154179A653A70D86616B89C81E342A44F3B2F4D6 rodneypinna
221,560,701 *15483B71D4DEE6EE2D6D03821ACF2B443DE11247 RONNIEYONKER
221,560,702 *154896C097E3F25615E79816A404D41FD9145AF3 ROUNDHAY6
221,560,703 *15412DB587652F3916E6BF998C4775E30417628D rubensandine
221,560,704 *1540B636FB9747E66ADFBA34C36B565B97F4E038 xzsuk
221,560,705 *154B6579758D2D7DF392613CB385B0AC2EEDD213 YAMAHADOGGIE1
221,560,706 *1541EE1B5AEFF6C603AB696FC5D2914ECAC1B43B RYAN DE WIT
221,560,707 *154077D7B58F8B817F2CE24415BCA4988DC43D28 RYAN.KAY.BARIS
221,560,708 *1545F905158B71AE979171011057F63025CC7786 yaniv-goihman
221,560,709 *1545144CB8F6ACABD4C00BAFE770CF8CDC1A0B2F YANSGEGANADDADWAYAJCODQCAAXIGABMKDHDCS
221,560,710 *15422CAFAE9B853A2F923CE2691A97DED7630F8E YEMI-OBIKOYA
221,560,711 *154E2DCC9E24DE2B8D6D366BD41F18CC61E1E197 SAIF.AKBAR
221,560,712 *1540D6AC8A45D62BB290ED6CBAB24D122B4C0845 SAINTEMENT0
221,560,713 *154087C17A1DFDAB5DB0BB56530FDEC9B2652EE1 YIELDINGPAPULE0
221,560,714 *1547CE425FF00167D53C485DFE0DC099FFE8D5F9 [email protected]
221,560,715 *154DB96245A3AB2DA49B11166C02E63AD80C54E5 yixljida2xwxx4
221,560,716 *15481C0190729A98403F90D4779AC83C5E4D5C1B YLPEILEVT3
221,560,717 *154E3CBDA3D0C72F8B67706014BB7B212ED0C7ED SAMOUBISTVO123
221,560,718 *154DABFB25B8C6ED3903224D93B2694FA920453D sam.previti
221,560,719 *154104FA39F1370187F47DDBA0D07F3DE743EEC9 yongschultheiss
221,560,720 *1541D775746983EF0543F18F52CF85556296FD43 YOUNG.PRINZI
221,560,721 *1545B36A2B4C3CD1033B646971B3FB0DCC65981B YRLLANAONOFRE
221,560,722 *1544B108BCABC0053B06030C4AE0EF537300E75D [email protected]
221,560,723 *1548178580CE3AC8EA413AC72EF38BFA6408B95D yunho's
221,560,724 *15449DFBD409CC102697F142F91ED9D773B57FC1 YWAXJBSW
221,560,725 *1549CEB3BBBFA35C27B2CF5BADB447433100C4BB SEANVELTRI
221,560,726 *154DE86B95A6C3F9791877D2803759604FAD7BE6 SEBASTIAN.BLOODWORTH
221,560,727 *154F50B833AC118E488886DFF0DEA1C36F24ABD9 ZAHNEECAHJEHNEEHN
221,560,728 *154D08DD44715BAA3AA77702C3DB05941FC4CEB6 ZEEGROENSTS1
221,560,729 *1544FF6F3896ABD02ECE1AF16DAE85DC89BCBAC3 [email protected]
221,560,730 *154D0CEEEB27EA17AF10422E65207E65DB0799A8 [email protected]
221,560,731 *154256A08B01CBDEFB0D527ABB560C4C8577E979 [email protected]
221,560,732 *154B1CFFF4E9616AF85BDD8D789965BC6261031F [email protected]
221,560,733 *154B36C9016289D125DF58E5D7225E4549F6DF80 SERRA.ANGEL
221,560,734 *154C6E6F32F5F7499359C9ED43D934689EDDA2EB [email protected]
221,560,735 *1549F5B88FF59A6A5ACC7CAE1BD92947BB58B026 SEYMOURHANDZEL
221,560,736 *154D55AF2720ACFF076E0ADF62CF13B94F5A3F2D SH9OULD
221,560,737 *1540501CA8872B921C3C190ED1672B3A1D1C348C SHAHNAWAZSHANI
221,560,738 *154EA11F90C51E7ADFE9ACE557A2BC4E49B8B4EE SHAWNABOLTON
221,560,739 *154C491A60E6EFF2759761637FE35CE64FC33F9C SHENGTSAING
221,560,740 *154918AF190BCBEF41F17B46AA4ABA60CECE4E84 shujaat.afzal
221,560,741 *154C0621CCD42407A5D05DAA461639F931699274 ZPTITJSKA1
221,560,742 *154A65FB03E2ACAF9B983E865C2C9AEA077B3F33 SIMILITY
221,560,743 *154AE10CA232C561295A81E394663278E799370C z\t
221,560,744 *1549BA18DF9014FD31B271CD85E685EA1C97F032 [email protected]
221,560,745 *15495DEBE2E945E96A498C23163FCD2DDC62835E ανεπισιμη
221,560,746 *154DE45604CECBD4245F5150615C3FDA0758B4D4 S,O
221,560,747 *154D2809317CDEAD62EC93F9EA5566741396849B SOCGEO.ORG
221,560,748 *154C127C18755FB3CE6D5757F402DE4F4F92B64D літери
221,560,749 *1541D55FBF6EACDD71253C40B222426317360F96 SOMMECAMPSENAMINOI
221,560,750 *1542927FBDCF2936F82006C7C5AE39600BD52ADB ПОСТКОММУНИСТИЧЕСКОЕ
221,560,751 *15442EFD14E0CA72393AC6FECBCE0B843407EEBF SORBBROS8
221,560,752 *1543C0D4CA621FE8ACBE9DFB4F546D9EEE8A265A SPASENA 1
221,560,753 *1546F8E43CB8B56C1F1BC90442C94B0FA2149CE2 spectrometric5
221,560,754 *1543D33AEDABA33A3E86910111DFFCEFAA43C9D3 splat~ `d---3
221,560,755 *1547182B92F0AA245BF440CA82DAD1DAAF31EB9B SPOLUMAJITELÉ
221,560,756 *1547DA05A872912206E76EB229355C5EA0A562D3 SPOONLIKES?
221,560,757 *1542A171E59B98BCE47DF5BB7B5FA420963F1E90 SPOORKENJE
221,560,758 *154495DDC09FF0B5DE428F7242A236CDE8975F8F sprier
221,560,759 *15493FE4A43ADFFB5586B0AAA8EA1D1699D6A7B3 SQUABSSBAUQS.
221,560,760 *1541549806667598072A82E992A0871BE23CF494 ssenimuf6
221,560,761 *15497BA9A05296C32A1F01C7B1F8659677DA3965 stanmininger
221,560,762 *1543511FB8366CE01DD052B2B5E7E68CD9A05D4B STANTON.ZAHRADNIK
221,560,763 *154C3EB2A1B305AE24DCAEEE5954ECAA41CA5FE3 次の新作rageでは、販売契約をelectronic
221,560,764 *154862C3BD4FC2FB378C548D0D9E112F1DF05AB5 STEFANIE-CAIRNS
221,560,765 *154B03D7854F5BD12278A2B5103A346C85479FB5 STEPHANIE-PERRIE
221,560,766 *154EF1EF22B6F7AAD5E7F30E6CE32DABDF3F7AEE stephtownsend
221,560,767 *15477BCFBEB3CB90B10FE023C4F66A32FDFEFEFF STEVERSMITHS
221,560,768 *154DBBE80A4707CBC0EF5EA922CAEE2E45EE57EB stewartgosser
221,560,769 *1546A4FAAA86E240B44B1FC8E84F35C97A435D50 stewartpinkleton
221,560,770 *15446116F20D554965A151BD7E3129DE9AA2A703 STINGRAYLAURIE3
221,560,771 *15495BB694A8A3B134CAA3E514E87B485579C0B5 STOLIHALL
221,560,772 *1545DF61C7B1B14070036903289C93904940FBE1 STRATOSFERIESE1234
221,560,773 *1541A8F85877C70F948A480B02009796AD1B5F46 010ARIANA
221,560,774 *154BDD494B0817D7261F885429F861893D330218 sturdier
221,560,775 *154155BB95D9CEC4F494C85341629F460BD7B15C SUFFOCANTE1
221,560,776 *154F1309FDFA7B054BC94EE1634AAF746EC64DE7 SUNGREAGLE
221,560,777 *15473C3CE4D4013F8445DCE6D21753A4107A65C2 (_0)~ `d####p
221,560,778 *154D631B4B61CEC08A92B56D07D73C5B822CFC16 SUSANRUY7
221,560,779 *1547D1A28FAE0044B57717A010B2BEC2986B807D 1107889 EURORUSSIA-KEHITYSOHJELMA PYRKII KEHITT
221,560,780 *15469AF73D0FAC999A271681CF30B15C82084EDF TABULIWALA
221,560,781 *15456975963C157391B01446359A01143B2F14E3 TAGGOUT
221,560,782 *154CA7955D54C517AEC2EB6741B4E40E87C9A3CD 1748054 they.were.advised.to.keep.their.doors.and.windows.shut..
221,560,783 *154F15DC76EEF99305CF430612E61F9CBC0F4192 1-amat
221,560,784 *154E6606E8B914236474280EFCE28FB68C7E690C 1 BEE-PRIESTESS
221,560,785 *15428335488048D70F7CA843ADBE8EFCF6185FB8 TBRADFER
221,560,786 *15407A3D311EE064532894B22E43CCB479124643 1-canet-kanuunoita
221,560,787 *154F1C61896969C6E104371C17BB8D856EBBEBB2 1 featureautor
221,560,788 *1547CD8A23E09988F1C7C56FC03C547D85F6972C 1.gently-it's
221,560,789 *1541E6785F5169E4046BB552E2E948EFB8470A83 1.MIKROWELLENOFENPRODUKTION
221,560,790 *154E9442FF45525E9BA17B6BB63735C06D9EB09D 1 uyuyamamasinin
221,560,791 *15423179DF02B413CF3852DFF013DB0514B0ED7F 20020806:.palacio.de.congresos,.salamanca,.spain
221,560,792 *1542E71DA45FFAEF85862754984AF6A653637C17 tixennoc
221,560,793 *154D8B02D007D895F77915BF13FA944FF2B1664C 2207040 DIE MAENNER MUESSEN JETZT ALSO SEHR TAPFER SEIN
221,560,794 *154BD49B63AFDA5393576BDAEF2B4C31E6ECB63D 2iluverin
221,560,795 *154EA1EA5963F4E0CE90D67E2CC0F188775D790B 3ed2f66231204a61a1b9ccd5ba13c95d
221,560,796 *1546A674281F06AE3B3E85A19165554DAE8957FC 410410 august1999.>t
221,560,797 *154E1CEDFF340D6F2D1C002915B480DF3E971430 4ADILOIRO
221,560,798 *1548B8CB06D55B67FEC36BA581F3D5D20222C030 4iluvhanna8
221,560,799 *1549248A0970EE5E9892F298874EA50D98CADE40 4PRINCESSMETALLIC
221,560,800 *1545A4619286B5419C9929E466E54E34836CCE92 501865 HER.SAYFANIN.SADECE.BIR.YUZU.KULLANILIR..
221,560,801 *154B99F6237EF286195352E41565B3F649ECEA65 5CHESTNU
221,560,802 *154C8ACFE21ADA0B92A083EA32ECEAC8402A0485 6PPPMSYRICANNETMOZILLA
221,560,803 *15485F1D64760A3095A18446B3B4B07644BBA409 usfeorg
221,560,804 *1541845DDB8838234AC6AC3CAE900FF9920DB1EB USKR3V3N
221,560,805 *154CB5DC1A278C161CA031E407C774B8CC2BE762 usualses
221,560,806 *154284C37B65536C62C85F7CC3AF49FA50EDB83D 6VYTRENOVANY
221,560,807 *1542472763B55B6F12590463D057A856AF18C957 VAN.CHESTNUTT
221,560,808 *1549C4539531B631A69AFD2F69808ABFC4F76CFF vanessa.harrikissoon
221,560,809 *1547A1F1BDDF952D3F227234F582B042CD81EA2B vanillapodrock
221,560,810 *1540037C8C69D7DE24972C6D99246E5EDD07B8C8 vaunteda
221,560,811 *15422F9E7B9EF17592853E43D163C2075652B4C4 verweigererhorizont
221,560,812 *154BE8C428F5ADBAD6688319ED90130DDA5AD56C victordascalu
221,560,813 *154E5AA538B73CE1624F9B24FF6C6D36DC0AEE00 8PERCYSERGEI
221,560,814 *154657002035652060D15311C35B013A9EB5856F 8##P~-UU
221,560,815 *1540EDA24DC56FBF8CB1A21F90863FF0D19A39D4 vinny.baldiga
221,560,816 *154017A3DCA758855DD0EF6F61EFB7D847407A7E VIRGINALSPARLORED
221,560,817 *1547986FE0FEBC8CA02749E55F4662C4F588159D 920913 sen.lis
221,560,818 *15422853CD4E98266562C24247B6BF3CB8D269A5 VUHONGANH
221,560,819 *154E414D2D590F7AAAE5689EC4C822618CAA37F6 AABI\W
221,560,820 *15439D2AFCB7D0D87C34D36E8D49ED4C96E71B2C aacwn"
221,560,821 *1543EB1B11EBCE5870898FAB0CB945FD2BAE90FF abckiller2
221,560,822 *1549EB7B33C789FE63C6EF244199B4035F369C2C WERTZUG
221,560,823 *1548C42DC751C4E84A82C1E39365EA0CA853E06C WEVALUEKIDS
221,560,824 *15498C44FFB9AD2B6E6CCE8E4E539A2018C17802 acr!=
221,560,825 *154FB8B7546C9CB891BE7A52E72986F1C852F1F3 WILLGLODEN
221,560,826 *15486053035762B9B33977D6D1FF575AB79C4B1A adamstruiksma
221,560,827 *15499F2C386470F2D6AF0296ADBC6B036FC916BD ADGUEZL
221,560,828 *154915B8F4DB812C88E1463303968C7A68212103 adiosmaxcomwww
221,560,829 *154E9BF0A804FCB0B24298047B5805A9187E9D82 ae6hy
221,560,830 *15407DCADB2135EA86F404259A1F74FB8351519B [email protected]
221,560,831 *1543E7976A764E7785D8C44DFE71F86E3557FDB2 ako1n
221,560,832 *154A41674F26EED6EC7E096F89AD7E8BB50B4698 akx_6
221,560,833 *154DC22E49D9C17CF8A517A11ED62058D6B6FC49 WWWSEOULTRAINCOM
221,560,834 *154C470EA25100249E547C930E8BE9297D69C859 wwwswebczmlcenkrou
221,560,835 *154D8B79E46D0FBA34C7A6C6499875A639C2C2AE alas.al.viento
221,560,836 *154869094EF846DF8BA6461E89B6E7F8795CABE5 ALC)
221,560,837 *154A7D8F2020CA7326D78AF4761268E09BB9C0F4 XHADRA
221,560,838 *154FF8B11F6153B8817386C1C266E1809627548A [email protected]
221,560,839 *154651F268F3ED2F27F3D686BB804E42F01292A2 XMMSIRIS
221,560,840 *154F6DC1F91F71F6763FF866138DB216E46A4FE8 ALONZODONTAS
221,560,841 *1547D6BBCC2F5D6F5FA57F690B758FD5F5A8AA93 ALVARO.BOISUERT
221,560,842 *1540CE55F508AF7E464754EDDE16D7B44A7296CD [email protected]
221,560,843 *1546AF64D1261CD3AD96CFE89A4D5B3343FFA73F an7p0deans
221,560,844 *15484BDEA8C3D39F8121062438EBCC4C6A1D7F05 ANDREW.SALLMEN
221,560,845 *1544CE399515230933BB5EC7C27FAF1C1084A511 AND YET TO COME
221,560,846 *15461AECED2BC4427DD635DF5517A3357BC5E9A0 YGABAGABA
221,560,847 *154374A4457E2A671420D3FCA3F54A4A8E211E28 YJULIKIJLOC
221,560,848 *154772E969923C7035D9E5AEA6A9173E60BC0666 yuval.alfiya
221,560,849 *154C2088548895CDB5C89A9285FDCC8B7DE42499 arianebonnie
221,560,850 *154BC75DDDAFBB9B7C5C400A206F795D2B06E23C ZAMAN-TAHSEEN
221,560,851 *15478C2B13F2C55A024380178E5D98B3ECDF7D8A atelier-sawano
221,560,852 *154D90E20BFF33EEAD4F4408F28ACEE6436CD348 azprehcsed
221,560,853 *1542CDD6F28928449BE16465A356A023F6400608 ZOLEKAMABENA
221,560,854 *154CB8A475208C0C5ECCEE39CCA3210666ABCB94 B9(PU
221,560,855 *154F9456D97B4B36BB6D6612E7F8124B7F34C58E barrikad5
221,560,856 *1547AF071ED5AA50B59B10B2469D3312A713FB62 [email protected]
221,560,857 *1548B8B0467969A5E8CB79878C14A14F31AFFBB5 BEGRIP4
221,560,858 *154BB8F9CD23A2E3764587FE801D88D4B9054149 BENTHAMISM-'B/E/N/T//@/,M/I/Z/@/M
221,560,859 *154BB506DC889E054AFABACF0072B7EB18E2CE40 BHEZ=
221,560,860 *1541FB75059D25C7017D2B466D26E47C9179D85F BLMI1
221,560,861 *15466FC58EBCCED30D7CE697B53F9F3EDA80CF43 bm=mm
221,560,862 *1549B14193CF39736AB32D441E2DDD94FD45580F bo3mu4uvj05s6jot3mi98b2
221,560,863 *154E9EDB393021B5CE51BF59C280D8E7568D7271 [email protected]
221,560,864 *154601C0E77E4F5A6E1F2196FF89C6F2F3D40CB2 1089B
221,560,865 *154C99D8F8D31A4AA22C6FA1318536E5A681D029 CATUCSUCED
221,560,866 *154FB3EAC9F5FF2BC39EFAEFD81F384B4228092A cayo-julio-cesar-estrab
221,560,867 *1545097EA006474BC03EBE172599E0B215BD5E4D CDOK
221,560,868 *154805CC88ADCDFA437A38EAE03B36B9DDBF1DE3 1481892 ARVOPAPERIKAUPAN.LIIKEVAIHTO.KASVOI.8,6.MEUR..
221,560,869 *15467A0091E15C451866E06B5A599A3194D1D272 151-GIRDIM
221,560,870 *15494FF7812E53D23454FE19C93FEAC3579BE3B0 ch3:k
221,560,871 *154D1B12C3BD11E8066B5F0438BF81E30BC7780C 171901 lastenlihavuudensyyonuseinliikunnanpuute
221,560,872 *154446D858BA97A59873C3FCE0BF4210A471A2BC charlesfigley
221,560,873 *154B3539507DE656E9215E601C340A50ACA00319 CHRISGOLDRICK
221,560,874 *154A9B89FF2CB96E9A2308A96484D00A14F3CF53 clblo
221,560,875 *1549D384214E0B330DFCEEFBF3657F255593C13C [1] department of defense, department of defense trusted
221,560,876 *15429825FD088F2B40A973AE08BF347AAA04DD04 1 DEVELLANO
221,560,877 *1542DCCAB14F031C5072A0A0AEA3EB39640D394D 1disc-related
221,560,878 *1542043CFDF84DDB7A56248716605FF868A883C3 cnerg
221,560,879 *1546F317AE7F906C560C8C5DC20BEF88297C6F25 CONCERTO GROSSO DMOLL: ALLEGRO
221,560,880 *154587F8B13E5EA6E34E60B247B695579B620929 COSTANINA9
221,560,881 *1540835BDB71EB1D23AA2CD0D5D302952C79A7EB 1.MATHEMATIKUS
221,560,882 *15403FE58777856C6DE2EE05E2DDF626EF40F4CC 1 naiplige
221,560,883 *154C0F62C654A7C93D36F66FE9A5397BD3AD618E C:\PROGRAM-FILES\ADOBE\ADOBE-DEVICE-CENTRAL-CS4\REGLOC\FR_XM\ORGS.ZDCT
221,560,884 *154843B80F48AE761FD7DFFE22562CDAB7BE6D52 c&rvi
221,560,885 *1543B349FA7D99D013878808F487342E238CBF12 CS1$E
221,560,886 *1543DC97F2B54A896A393071E111B15E7CBCA0BD 1TARPEENTUPAKKA
221,560,887 *154722CDBB671B3CD3D80C035121A9556B0068F5 [email protected]@801!z!n9
221,560,888 *154B8A59D35528DBDD89F93A80E2858988999E54 1 VMSGESCHAEFTSFUEHRER
221,560,889 *15434B746C2B96700E01DDF35468DD8CBA36F613 cys+=
221,560,890 *154C59C5E14E2AA735E2D412E84F29F4AA718CAE d",0d
221,560,891 *1548EEEDF85702A24757CDB762E5B002FCB97D18 2626AN
221,560,892 *154AE98EF244BEDA56300A42E7232665F7E60913 2642380 golden stars kilpailun missio on etsi
221,560,893 *154E83A70E93504384E4B981E702F011121A0536 2688209 teemmeinternetsivujensuunnitteluty
221,560,894 *15405BC4ADD7CDCD8490A17336E2885F6EF36F7F DEION FOWLER
221,560,895 *15418DC494089D9D686C2E4242E6674C25A920A0 2704926 WAHRSCHEINLICH DIE ZEICHNUNG EINES KINDES .
221,560,896 *15456E9658AAC9EFD8A26F8B3D7C6C2F1D79E4F5 DE.KLEINE.DINGEN.IN.HET.LEVEN
221,560,897 *154016FEF971157A27D02C766ADD0896FFB1C8F5 DEL1M171NG
221,560,898 *15416DFFC0A2855FBA4591078D25FFA702B2FBFC 2astag-kongress
221,560,899 *1540842819B026A81505DC9AB2C3B722269B76C7 DENIZ-CAGLAR
221,560,900 *15469613E5B4D13BC71B53017B1BD90F508CA15C dennissanner
221,560,901 *15434D7EF25930283E44157CF743BE3104F00AEB der.chly.prinz
221,560,902 *1542CA5CCFD41719E90F5DE6C8C7F37D3E9B0C6A 2 kneeknocking
221,560,903 *154C583C4C2337269A6EAEFDFF8CA5F845F3875B DEWEYSOUFFRANT
221,560,904 *1545FB15F3F681D526C3C04C09A2C2F8276B1C55 DHLWSAMING
221,560,905 *154480235088DBD648A66F82EC009AE902B7D4B0 dickplank
221,560,906 *15437958E271EF555A001F0536A7521828982FA4 3ca5b854d94438709f3db5b270e973d4
221,560,907 *1548DDB78D936E20974D90ED7053D69CD9DCF835 3ilovetarheel
221,560,908 *154E74765B68DF28749C16FE1B5BFDC0C8AEB3EB d!k2&
221,560,909 *15474E94A84551DA15462A606CF844D90D4F8793 3RICASSOS
221,560,910 *15437C32CE6CC7E612BA02E27B481FE17B0509C5 dlepmortsegnaa
221,560,911 *154CD47E7E9A7B566D9B4228B921D3D5666B3896 4064pitching
221,560,912 *15407ABFB214354F16C68D9643DDF9E3506A6E8E DNEFFUP3
221,560,913 *1545DE746DC217A93CBCC4E97891DD1401D2301C 4AILMAHAN
221,560,914 *1549B0F99A63735C93AAA55A58504CA7AD7316A3 4aluminiumproducing
221,560,915 *15432C31A82A08BB29666C867E4B6BF8DA526784 4c5pvujxcxa
221,560,916 *15444441A227AA3FBB41440F4285716B6D71EAC3 4HERBISONBSW
221,560,917 *154DD0AB1966C9D97CBF8E194A0D8DD6F99B0987 don.mallett
221,560,918 *154FE2627C76042F409D18ECDCC3EFE46A392788 4MISSIONCOUGARS
221,560,919 *1543F24CEEC9B7F9C38DD26EE26891B0180B6CEA 4OLIVIERPOMME
221,560,920 *154A6C503DDC07BC34548A9439F108F047B3227B 4P5TL5H1P
221,560,921 *154923AB8942165E864236B385C91F21D798CC13 DRAAGYNJ
221,560,922 *15456D8ABEED6B4DEEB2125487F32816678A632B dwainsisneros
221,560,923 *1546FB3D2ED1D22BE32D8B91155B443BD95B91A1 4VRCLVRLY
221,560,924 *1544D6EED04C9C6A1E6EB91F4AB40D9E662704F7 [email protected]
221,560,925 *1541C32A537D3B5D1AF8ED1A061B36313EE3F913 $+eern9
221,560,926 *1548FB8FFE22CD320A56AA14A98785B8880AF24D EHEPAARSARKOPHAG
221,560,927 *154C0F57DD0837A5B7A6EBE9F7B5666B49F33857 602802 sibeliuslukioon.on.runsaasti.pyrkij
221,560,928 *15408B225E601956CF0BA5221D311322FC576EF6 641896 EI-TULLUT-KUULOONKAAN-!
221,560,929 *1543E160324742EAEB95E156B3B7AA4A33F5B9B3 EMOLEMOED
221,560,930 *154F00FA12FFC88F54B0ECF4E1FC5B5A323F752C EOHX
221,560,931 *154E7206D6E054B9129CF31F8120AA409E897726 [email protected]
221,560,932 *1548E01C7AE933CE654F01AE55D30BDCEFC75833 6KARUKERA
221,560,933 *1542EB9643707DD8D873095A03C985C3A16590F4 6KASSENLADES
221,560,934 *1548B53DFFA100B3B7547CAE98BBA34F9B8F0852 6koloriet
221,560,935 *1545860374FEABD18E09F7519D29B9AB74ADDE70 6PASSWDDEMO
221,560,936 *1545BC97E1B4DA66BCDF4074EC683CDD729F226E EUSEBIONEVEL
221,560,937 *1540F53D4A47173905CA30DBB31B9C987608212F FALL-DOWN
221,560,938 *154C25B5B722CB2DF1C1D9F97FA259B7CF41F407 7DEPLASIRANIMA
221,560,939 *154D1B7ED65B60A013489B2D8A615471B91FADFC fcb'
221,560,940 *15420ACB7393FBFD1002393DAFE7FD692D0662D4 7tegenstribbel
221,560,941 *154A06009333EC1819C521B759D1587AB2D34DA8 [email protected]
221,560,942 *154762C328889C56D8F3FCD9AA8A1CB142E1B5C2 869087 SIE.WOLLEN.ES.NOCH.IMMER.NICHT.GLAUBEN..
221,560,943 *154A61D15B618189024849A9D9A5C68918710439 FORMELT9
221,560,944 *154B18E527B6951985CE6BEE353B5EF7FE504516 fountainbullshit
221,560,945 *15474A2B6B880F68F54868154A303F9FB154B758 franciscocarolus
221,560,946 *154CD951AAD083E31297CB028CEEAACF2FF9DC14 [email protected]
221,560,947 *1540C54A42F473B9921D8AA806DA65472C0687CF 8MATHSINFO
221,560,948 *154EA9CB856B554581F8E6157F0668B4E5E08B7D 8MORAVA
221,560,949 *154419F0DD95B5E0FA4B041FB1D9BAEC5A12545C GALE.ARGUBRIGHT
221,560,950 *1544173A34BB524EC5924C5B512C8E5174331EE6 8PACKERS5
221,560,951 *1542764503C6C0C80624C30D05944206685AF434 GLITTERIED
221,560,952 *154FE618D21F3A47BEBBA9F2C3BBF906A4D96B2A [email protected]
221,560,953 *154E3F9C13C55B54FCEA3634F000EEEA1163D305 guadalupearpino
221,560,954 *15409606F777FD1A596F8B7AE492D793593A5970 9KOORDINATENVE
221,560,955 *154DD8E002465F3BC7DE88D4DD36C24B496102BB HERKRIJGING9
221,560,956 *1545014871B493E0015913533700EF3FD013BF2C I6\(
221,560,957 *1546BE7ED0B328FFC21CFC70965F21AFF33FF934 :{iaaa
221,560,958 *1547C022A8635B3C709F33E72F6B8DDCEA97ADF2 IAMEXPLORER53
221,560,959 *15474C7BA03FAD2844FA222A927606928DA947E5 ABEERKA
221,560,960 *154443097E938E0066ED67ED059365E8C54B72FA JAN$EN
221,560,961 *15409A54D60A2090B110BAC11B7CD02E42AC0400 JEROLDSUPER
221,560,962 *1547EB01FC652344DBD5264CEE0791D1E3BDEA59 JESS.WISNIEWSKI
221,560,963 *154A3A202F5E7932568D1C00D6AD5FCD8FFE883F kapokkussens4
221,560,964 *154E9CCA90D5ADF1C4E0667D8FAE5348BD4A08D2 Keep.Tha.Light.On
221,560,965 *154D8E0D968DA0C8C8440C5D2EE3EFC4EE523207 ALFONZOBATRES
221,560,966 *1540ACA8BDC056ACB75B0B6593BAA4791E9BB257 alfonzoneiper
221,560,967 *1547EBC7E3CA2A6A313E3642527BA2D9094A815F ALHARBI1
221,560,968 *154C815FCCAEF7B080910518E6D0DE5BDF39E321 [email protected].CN
221,560,969 *154C26969603618EF301AE5E79AD79426822AF6F allaxtei4
221,560,970 *1542735A405F01418376C7534EE214DBF9AF609A AM,A!
221,560,971 *154FFBAC17ADA83BCFDBAE6EBFBC87F4A5EE0C65 KLAYMER8
221,560,972 *154EACA9CAA33A3A2F36592C5B39CD8F2094E31D kristopherkaylor
221,560,973 *1548CA74920B265FEC15A57D8B4212176C02955A ANGELA D WEBB
221,560,974 *1546D48B809890059FE461C470516C681BBBCA0B ANIST4
221,560,975 *1542810CA767869F1ACAEB336C8C3FACF4D82A5B ANPO
221,560,976 *15456E390C0300CA80F4F020AB73B631EC5FD704 ANTHONY-MCDONOUGH
221,560,977 *154BDF324D923806E796E9973E4CF2D924C82AFC anthonymoncure
221,560,978 *154E4D0A29A2C7D07A66E34927BF0FC74685D165 LAPUANLIIKKEEN
221,560,979 *154BD199937DE3FC1FD43B159610BFB9E91BA5C1 [email protected]
221,560,980 *15435D417B13E31B36E4223BD1FC3A2D74EF52E4 leigharns
221,560,981 *15449F6662604CF6282A132BB7A2D9A0D4FCFE80 ARETNOMMS
221,560,982 *15461C4E25E52E2A33EC3102BAE7D53A82F384D5 AR-_G
221,560,983 *1543255BAC202D960B9F001697211F3DCCB53C80 ARMANDO.FELLON
221,560,984 *15408747EAE416652F26E8BEA5636A377062BC67 [email protected]
221,560,985 *1540C92748F8B6876DDEBA6312CC06C73DCED027 asbj
221,560,986 *1540B3D834F989807D73B60F48EBFE848E66915A Llewop-65
221,560,987 *15432CF8D6D46788462889029858863E6E37DA5A ÀTRO
221,560,988 *154D16F81EF489D6FDE98998F2D5F1E75E680304 [email protected]
221,560,989 *1543ED08F17519BB15C5505F1C3C36C4F0558B02 AVAGERONIMO
221,560,990 *1547283D693141A6843289F4C3350C8650B77A0A ayj4"
221,560,991 *154899FF9DF3FBA792FED344D7BBE2C963E98BFF AYYR4
221,560,992 *154C1902073C144C8D122FE559DAEC123486BC2D MDERDARI
221,560,993 *1546913B6CBDD438C0D6E0E2DA062602A18473A4 NATALYA.MYASNIKOVA
221,560,994 *154C1F1270A5BBB8031B8B4361EED880E76513DB BERNIE.KLEINKNECHT
221,560,995 *154F2E21466DED63279FEA5FFD1A71D7E048F803 BERRYDAWE
221,560,996 *1545563012CC76E224AF282DC49BAB422A9E5CFC BERRYKERNEY
221,560,997 *15434F32F2F24459717F5E60CE3FCF383B81BF96 BERTSCHUBERT
221,560,998 *154D8AED9DA01853D1FBCDA4FD239E558F709DE9 B_EZR
221,560,999 *154A4A6189E8EE663AC78D0F211C2228FEFAFF93 bill-p4tc
221,561,000 *1547336296007A4F4784192335BE1EA409D3D58C N'ND
221,561,001 *154C1F1C937168724D2FA5DCBE5C5ED83D81D947 NUEVE-P
221,561,002 *15496D198AF8D29A239580B2243C9448AE8925D7 BN+/-
221,561,003 *1545EADA559189D3864D9E226CDB996F3FCEA07F BODYROCK(FEAT.ROBAGWRUHME)
221,561,004 *15453A0A88FC6838DBB43CADB0892994A4FEDEAE OMAR.DALBY
221,561,005 *154233C73808E6DB88B82C2B8898877135A13CAA OSCARHOLMSTEAD
221,561,006 *154E0FFB28B5B865EBEFCF6ECBFB683E63D6CC83 bradfordsnapp
221,561,007 *1545FC92B79D5B65E1FF0E2DE71E09F8845C6661 OSDELROCK
221,561,008 *154EB2B69AEF1B6CA83D42AE20B2810765DF7D33 oversurely9
221,561,009 *154D7F2B71CE37FE3439648D83CD2E507FF2AEAA brentramsour
221,561,010 *154E090334B326FDC7AA623843320E284CE9FB53 OWNDWTW
221,561,011 *154B0BC44A590662751C339858C460D8E6EBDF98 brettvandellen
221,561,012 *154C88C3B6456B1A3838CD230299CBF7447EA766 [email protected]
221,561,013 *1546961E2717441958ED0CC39AC14985189655F8 PALMER.MARTINEX
221,561,014 *1544A2E16E8C2632559773A7C02F226315592626 BUIH
221,561,015 *1544CAFCA2B706C75AD20E1B1B028DEF2B74082D C0NUH
221,561,016 *1544BE2E7E715E6F258344A63CE8AB6B2629ED69 CAGALONA
221,561,017 *154E6E46A347A9EEA88E3C7F017359EA7DF7AF3B CALEBLEAHEY
221,561,018 *154421DC5B794982A3B9222C1DA7C1C4E7538B29 QEL:
221,561,019 *154A099D957AE86FADB3A95FD32E1739A1341FC2 CANDYBABY28310
221,561,020 *1544437C4FE94841D1A26CD0C18CB41A8DFA5822 qP~O~o.)o(
221,561,021 *154CEAB7E08EC38E31377BA88126F2BF1E3D52E5 QUINCYLESCH
221,561,022 *15475F0145FDE7B4637DFFF0FD6A7B334C776201 rana.abdel.wahab
221,561,023 *15428059006337E48F70EDB7800BD69CF141DC01 RANDOLPHFLUEGGE
221,561,024 *1549C24F25019C0F842E5D177EBE00C1B58A2444 CASSY-CHAMBERS
221,561,025 *1542F0E04D8EC53C6CF67FD9416C21A28651E560 cavefish
221,561,026 *15401168C093EE8A33032AC84D91E89D84839C84 REISNECESSAIRE5
221,561,027 *154F6505CA3ACA2182B988A831EC1281D9C7731C CHAPTER05-05:THEMETALMANANDTHEMONKEY
221,561,028 *15415FBB8BC4D3C753FA22AF7615CF2CE4A9B262 REYNALDO.BOLINDER
221,561,029 *15410AE3FB227396650AAF72421EFB471FB312DA CHIAVE2
221,561,030 *1544D3F311EC7860D32F4ACC1EB11F53C7DCC472 ricardomapes
221,561,031 *1544C80CC2165C48582FB65BE3F2CB57163BB3BF RICKSTRASSBERG
221,561,032 *154D5D62D311320A06E7DCB7604E43DD776AC2CA CHRISTOPHERGLISSON
221,561,033 *1540F57943889EE421D65E23406DA8DC92999FD5 riston
221,561,034 *1545B6A661B1F4C4C13BE2398B87D9BECB45C25E ROB-SITEK
221,561,035 *1543779958B54C5903410ACE1C827B6798278145 clarencematsumura
221,561,036 *15484EA544CB1DD66FFA1CDB6979DFE45B2045C2 claribel8
221,561,037 *154D0C3480B8B044BDBAF18CE2CBF32925B1DB71 CLARK.ACOFF
221,561,038 *154FB65741F40D7F48B785E93764DE61D9BA4D34 RONNIEYONKER
221,561,039 *1542EEFCF288AA13FC54EA8E4F04F866E38B1849 CLAYDOBRINSKI
221,561,040 *1546498B19E15E22ED2B68F6E3F7819397D9ED9B [email protected]
221,561,041 *15478A021B3E0DC82AC13561A017BD03CEAEC41B clementeparisio
221,561,042 *15485CEF4F7B83F3FF451C7BB946B226FFBA215D ROUNDHAY6
221,561,043 *154C4000F49A0327FA715EB65B22AE0790E544D1 rubensandine
221,561,044 *154399C3BD5257B1E8B95254798D15A703C04659 comi/reports
221,561,045 *1545B2B81D28EDCE0F38A01D54313A4CEA05D686 CONFIGHEIGHT
221,561,046 *154AE1257832CF811D11DA9B21BABCE60A68A048 scarcely
221,561,047 *154FE899DA4B95370A086991B507A09A8F8D9257 SCHRIFTMEN9
221,561,048 *1546D0E06A39A7180AA66794EEF5C8E2BCDA13AC COSTOLAS0
221,561,049 *1549FCA713E67C90E978D9E8CF0BB40A14409F1B SERRA.ANGEL
221,561,050 *154F84C04D662C79CD5B1FD99540EE96315D3487 SEYMOURHANDZEL
221,561,051 *154228045B2A7F66E02FC9E388C3AA965B582FA5 SIMILITY
221,561,052 *15455182B56BA4DE87F4B1A1460093544B8981A7 SOLOSSAKB
221,561,053 *1548C0AFCBC7469F46A41BEED1D88C0AF00F5A07 STADTWINKLER
221,561,054 *154015A4B5B1B96D6A0BBAA89F4A081925157C5E stephtownsend
221,561,055 *15403159E5C8D1413FB6CE97C81F244778B5631A DARONCHOWN
221,561,056 *154B7DD9F250821A9001DD70BF03BA609B8D95CB [email protected]
221,561,057 *154148DE9D0D3B51BA522E2114E21AB36E97326E [email protected]
221,561,058 *1547E79C549270349FC894718638577621338F6B davidzegarra
221,561,059 *1549C3FAD3D63318EE594BC3CAE8B69718B1329E davisbybel
221,561,060 *1540201068C14DC1E2F1B13FD4AE36265DB84F04 SVJETLOSNOGS
221,561,061 *1545BD57E7E9B5A5F491D793C65E4CDA96475D5E TAANICS
221,561,062 *154FC8E1D984EDFDC4621794C79BF65062199FCA TELEPHONEBYTHEBED
221,561,063 *1547312CF1E1AD07442C88371C0A7F17989B4975 DENIS.HANK
221,561,064 *154EDFED23ED0AF45E70A116972DC140094200D0 DENNISMCLOUGHLIN
221,561,065 *154D1514FE8DE0DDC81175A1797FA2812025B96E THELOGICAL87
221,561,066 *1542A9674FC92E2A4F000648CFF5162034E596CB thestoop
221,561,067 *1546C8F720616AA069DF07BDF1EF529C3A5D9B97 TICA-DEL-M
221,561,068 *15488A36233C87E01C6A474273E0882330362488 TLIOTOUM8
221,561,069 *15409E2625C5A3F7A0CCAD8176154775136F75B9 DIHYDROBENZEEN
221,561,070 *154F4D5ED026CE7D1975C4104DB121F487537A4F to_cute_to_hold
221,561,071 *1540C9E8D0B555E3F2B60922760A447D8F5EA344 TODDSINGERMAN
221,561,072 *154DDA6E93DA730CDCB84D5E0B7425F953D90B94 dizaynerləri
221,561,073 *154B39AC42DF742F74C218755593658B368869C9 dj7au
221,561,074 *15440DF30129AC30D4C80CE5AA59A273D99845DA TUB-STYLED
221,561,075 *15462BE420272B8CA9817F44420E2F3ECCDC8E34 UDZ̆BENIKE
221,561,076 *154F98D6F271F998BB636AB43342581561417472 DOPASTA
221,561,077 *154954AD9947BF576DEDF178030CD67FDA6BAD85 doreenvanrooyen
221,561,078 *15498299B3FF8782BA2395B11250D4BC7BEDE5F7 UNAVAILABLY!
221,561,079 *15425E6DA4DC2FA0DEED959762CDAAB11D903060 UNLOCKASCRAMBLEDMESSAGE</P>
221,561,080 *15469FAD57BAFCB4D61CE9365C90EDFE1821EC57 DUSTINKRONER
221,561,081 *154567892B56E9DB981E07117C7EBBA222C799E1 Vertical-Hold-(Beatmash-by-Rubens)
221,561,082 *15497EB022F552A19F04B138BA9CFC2A291ACCC2 vinny.baldiga
221,561,083 *154378CA747DE169143A5A7A7631ADDE3733FA35 earlekurian
221,561,084 *154C569EC9EF8DE66FA64FE8ED852DD61CDCF4A9 ebg$q
221,561,085 *154A9AF34B65AD7FD2E2765AEE1473AF3E957C12 edgardobaerga
221,561,086 *1544780869D359ED6BDB12A9532C45D8B86AD8F3 VUHONGANH
221,561,087 *154A996E31244A5C02F9CC0E574BCDCE704F2363 EDMONDLANGHORST
221,561,088 *1544A46E1BDBB368822E8FA5CB1A729257DC707B V{ZC
221,561,089 *15435EFDF92D6E905495CE5173F501D953F45B7B EDUARDRADU
221,561,090 *154A85EDB644CD3E057524928C63B0BE5BB8807C WALINSKYBSW4
221,561,091 *15427DF3436EF8C617A8FD1F5222CDD2D1DD0516 EFX6E
221,561,092 *1545B4DBD2D5A017CCC27F31B73BA50CA36EFC03 [email protected]
221,561,093 *154451155DAB4A672542E43F440C145DFD9C0E62 WILLROOPE
221,561,094 *1541903393503C64355CB2FC09536B30EF4FA5BF emanuelsitsler
221,561,095 *15452B969D942A966445F42EFD90AACBF8852938 wongnokyee
221,561,096 *1548AAC490F95F0844F88B1C1EB632B988072B88 Wurfspie
221,561,097 *15448F1EA8EF75756C3BA365CC9E14C323666F8C [email protected]
221,561,098 *1542D920ABF2091416B21F55ECAE7C43BF1C0E0D YOHIMB3.B
221,561,099 *1545A08807F054E1BBB9310D23C5EF1AB0D385F5 ETOUTAJA3
221,561,100 *154F0DE25C9C6E93406D1D44CE3DFEEAF3D06D8F ETSATSUG3
221,561,101 *15438D6B67BDBD819A0BAE16F1D0279BC7A85C52 EVERYBODY'SDANCIN'
221,561,102 *154BC2892B3AA717005DF59320F3CED51759E683 ZAIDA CINCO
221,561,103 *1540E62BCE1C2A6F38C01D44985A1FA8B5BECFB7 zh>6
221,561,104 *15404925D2263626BAE7A3F8514A011389E7F185 [email protected]
221,561,105 *154B7B1EC7DFA768DE2EDE20C717E0D68B674F1A FELIPE.CURTO
221,561,106 *1546D5993D32EA7D8EF794B4BC36587E0D2550EB [email protected]
221,561,107 *154087D44E107B44BD990E11DF88D79BEC51A8EE ΑΤΑΛΆΝΤΕΥΤΟ
221,561,108 *1543FD05123E21CD13D1995D3B4EF6D3805FFBE9 БИГӮЕМ
221,561,109 *15469AEEAA7FC164A4162672E20646822CF9372C «ГОСПИТАЛКА»
221,561,110 *15448E275E5AEEC460CB619D090A309408277411 FLL5
221,561,111 *154BE779CDBC5F81FCC24DEE5B88953D968BEF6F РАЗЛІВАЮЦЦА
221,561,112 *1549937F49FB49A0B62ABCF0F78419775B824D2B freeloaderz
221,561,113 *1547A1A74BC160914EBA859FA4DEEBBBDC2EC125 friendlessyoungsterscomwww
221,561,114 *154CEADE6F0C4755D03C34D40FE14B76BC7068C5 FRITZ.ZUCK
221,561,115 *154AE58CD545A91EB7D71BD6F4C5D2601D4CBBC2 北部のノームルは、A
221,561,116 *154AE8025411922743BB2CBB4FF546295FAAB204 [email protected]
221,561,117 *15466E37961EA302ECA5AB8953982F6CD734EDB2 G293005
221,561,118 *154775B85148E4BE7AB07F0C87F06D932C018255 的主诉包括了情节性和语义性的遗忘。在经过一系列神经心理测试后,vicari证实c
221,561,119 *154FE5726FFC9E19C2842F6B1A2E7A02FC3C6149 GARMUN
221,561,120 *154E85C0F2CA01A4FDD925B53FDE790FFCBE3D2D GARRETVRIENS
221,561,121 *1549A721E580C877CE3D73F31CA3EC893205454C GARRY.BEAVIS
221,561,122 *154239EC1327A711C7E3C3C953CA3020081283D9 GARYKAPOOR
221,561,123 *15457624A47E085FE3D5154AE074E1AD428F527B garymaged
221,561,124 *154296AC8B2CA8BDBBE69D2D4A274D883E94C618 `(`$)
221,561,125 *15441FAA4A9ECACABC6985853E709608FD9B97EF 01de85c487d4
221,561,126 *15495B98FCBD10D034B8BBFE0C62FC2F681B53FE 1540363 POIKKAISUTAULUKOSTA-L
221,561,127 *15423CCD777AC55703671159F3A57724AE544EBB 1610498 poliisikonstaapelipenttil
221,561,128 *15467060692E7597E49E14D3FA7A4B154C45C50D 1926034 ARTIKKELIT.OVAT.EL
221,561,129 *1541A4C2209CCB3307F893D1DB4E0EE7DA4B74D0 1.bundestagsmannschaft
221,561,130 *1549AA4804187188A5EF9C2EB18F3E1DD937DD5B GORTEP
221,561,131 *154E7D078AA17F77D0259BD04590B26B78FA91B9 GRAHAM.KLEVENE
221,561,132 *15441C2741E257F3DA64112E731A21D40E971DD8 GRANDANIMALS
221,561,133 *1544AC27263DE064EA1C7792FF654C7D36F828F7 1 SCHEIN-ARBEIT
221,561,134 *154841A74B389DB9AB9A70ACB180F31366F4FFAB 20CAPETILLO
221,561,135 *154C07F618C530AA0DDD1CDBE2E4AF27F8DC9BDF H77271
221,561,136 *1546E4A0533F4B31303E897D5FC001F4C0D78EEB HA1F TIDE
221,561,137 *154255F5A552D3E001C70BAB94671886D9F73D2C 2513806 ammatillista.lis
221,561,138 *1544170825F197B26BD80E020CAC500586DDF84E 2894613 tarkastajan.ei.my
221,561,139 *15409D796C7C1C8FE6F33B0F63E7E849859612C7 2AISUAKUU
221,561,140 *1542C07C62828A475823D60C30D0CD158DACE6A9 2DITHIONITE
221,561,141 *1548702454B645B881D62415DFC01F9081F9BD63 HAYYAN20212223
221,561,142 *1548A2E0B473E082E6F89D8C3CE37425F6CEC5C6 2LETZLICHE
221,561,143 *154CE5F3CC1FDAB897AA855A4A680C5D577440F6 HEADZRREDDEE,PARTII
221,561,144 *154A1B4580019E4A74691A79C5CE353DB969850B hide.our.love.away.(tell.me.why)
221,561,145 *1546696276AD099D2A16514E8901552201290CC2 hitchhiker'sguidetothegalaxy213
221,561,146 *154B7593BBB99685AF833D6407AB43E7A6C6E8BF horaciomeyers
221,561,147 *1541872B649FEC543A4529F46AE2306CDF21F1C1 3b8s43gkojmm82h
221,561,148 *154FBB9BEB56F90B563E9949C9E89A48B7B975E3 hrunkel
221,561,149 *154F1C13C308A3BC8730EA3C88D6C276BA39449D 3IAMCRYSTAL1
221,561,150 *154AE7FAD16A5A274FDF2E416A396F87692E6214 HUNNIDAE
221,561,151 *15465BDF956910BD33D117E5C0A59BBEE8D4DE23 huntertriche
221,561,152 *154BA50BDFD3FC8A240CD56E3F780E59D634A40E [email protected]
221,561,153 *154405679116460DCB1FD462A0E8357ACA632228 HYAKURU
221,561,154 *154224BA51BBDE1EB20CBD3592C072B568E8DE19 427986 p
221,561,155 *1544E5DCB91934240EA8FFAEF7B7F6A3ADC20F8B 4LOIMOUS
221,561,156 *154BE7C4D5D0F9713AEFADBF55F70FDDE6EA4742 4NEWYORKCINDI
221,561,157 *1546E81B74BD2BAF4FF54547DFCD0337970BBE32 4POLYKETIDE
221,561,158 *15444D160C925861A4BDDC736C981F25A4BEB368 ikiyüzlü
221,561,159 *1549D2EB44347E5E9E6AB5DC127D2AD0DCABE4BA 504BAILEE
221,561,160 *154D9EFF8018F185E064D6B208A38B4B961BF93C isogeny4
221,561,161 *154ECC3BB704CFED81C0CD0D727CE96C4C6569DF ivorymix
221,561,162 *154BBCB71A3DFA73C131CD285139E221FF9035A0 I-WANNA-DO-RIGHT-BY-YOU
221,561,163 *154E5194E75D0073D02B424A9AE086F0BB2575AD [email protected]
221,561,164 *154940189EF3A1122A8F2B40FD998D29FB3687A4 J76913
221,561,165 *1545E1053DB103485E0B8A40255E03BF8A97B00B 6DVISAGEONS
221,561,166 *15446082610F3F32F58BD3E9B37055A00CBAB2EE 6GONGONGS
221,561,167 *154CAAB8A2D01753122EB2586825E04D45A0CFF3 6MERAVIGLIAS
221,561,168 *15440E615296D7AFFBF3322913110AB366F6CF2B jeanhenney
221,561,169 *154CCD5159C0934665A0E9D48023D66FAA0F42D4 JEBV
221,561,170 *154D8DC9C5F9AD67F346F564127217520CC67CF8 JERAMYSTRATIS
221,561,171 *154E997CAF15F2E6F48015B08D105E3B82476493 7IAMPRINCE5
221,561,172 *154E1C5A3C0F31465008636BB802CF84A2253911 7Y5H8YTA
221,561,173 *1544A73124390DDF99E1C0406FDF282403B6DB65 j,kd
221,561,174 *15484BBCBCB7F33762F401DDD462C42DB6A0AD96 8LINCOLNWAREZ
221,561,175 *154160AD4D3C43F0E790F786AE49CF0A2C4E98DE 8NEDONEGT
221,561,176 *1542F414A895821994DD7351ADC7C2F3AF2FAECB JUAN.DIEGUEZ
221,561,177 *1548103FDE6271AD7DB2F191261E205349003868 A1p
221,561,178 *154870D7CFD592D82B35799A3954AB8FEACAB4CC KELLY'S-HEROES:-BATTLE-HYMN-OF-THE-REPUBLIC
221,561,179 *15449E5F645582551A0613132A753CDDED1AE8A5 AABSIV
221,561,180 *1546EA6E9E8B6EE01B34979E7ADB522E3DC5B48A KEVENGLANCY
221,561,181 *1549335FB4C74FB0136048E18017B2686EC4ABEA aadeqru
221,561,182 *15426CADC07EC15DDBE215282F557BEFACDC8B37 AAGCAACCATAATTAAACCTAATGGATGGGTGACAGTAATAACCATTTTCAGGTTTCATT
221,561,183 *15433D4DD4D39EDA763D9B9B63EEF475696BEB02 abdes
221,561,184 *154515AC982D5F691BF5DB5D0B79DA5D2F30B859 [email protected]
221,561,185 *154A37C5DE18B51F1AF5F795441D3923E32082F2 ad6lw
221,561,186 *154775149B16EBD96E5283A5C284B784518729A6 adalbertodiop
221,561,187 *154E45C568B3BDB422AC8B76D6AC8E067370E500 kuroi-sensei
221,561,188 *154B276639AB507D2A4076CCE8D892F6CC8C1CAF akcvx
221,561,189 *15454F86EDA69DB81A52A0075F335B4ABE37977B AK(WI
221,561,190 *15434E97DA87CD4D48E5ECC7D47813E1FA74848F ALEMBICATED
221,561,191 *15413E16165FDF5B4A653C65B3F869F4923F1D4D LAZARO.SAYWARD
221,561,192 *1546B31AF2546DB465408DFF9DFEFF9CB06168F1 LBSSRPXN
221,561,193 *1541797C94654A74F69A8405DA5718D3310D657F [email protected]
221,561,194 *15497BF4F9F875CD18BBD6CB8B8381ACF228A34F ALFREDDIIULIO
221,561,195 *1547B932D2382950F157D1141053B27ADF9C490D lekezy08
221,561,196 *154DEB714F2EEA1AA615D6523D11E31864072855 [email protected]
221,561,197 *154906D51756ACC15EB6619CA4181BD622C4021C ambivert
221,561,198 *1542A6EB1739BF4FFFF59CBCC6745D75CC2F5C3F amoks2
221,561,199 *15415076DF078C5972E37603B81DD59D5A328BC6 ANDERSON.ROST
221,561,200 *154AD1CB9C1C693A3AE7DE4CFE343A539F3408E7 lesson-4:-at-home,-part-6
221,561,201 *1546C7ABF0C1E5498262E61F0573B811D2C9065C ANDYPOSTER
221,561,202 *1549B684ECFB38B1E112954661E85218F2294452 levimiravalle
221,561,203 *154B65F4D27209D34713A0E15E7647835C7BF67E ANGELKIDSES
221,561,204 *154AE4166AD10491840C27923364875C82B49504 ANIVARTINAM
221,561,205 *154BA6552AA787ACEAC28A30777D202A8BF9EF53 ANNABEL368
221,561,206 *1544C2983EC9F12BD1870CEF959227F59F4D8B9A LONG-BEACH-USD
221,561,207 *15479FD505452F58BF9F50747B6572D447D79EEE ARNIECANAS
221,561,208 *15435A4C6912B82D7D55A0A8E742945EE7774045 assavalon
221,561,209 *154AE3988D50D689DAAD2BE3E65F4112D5BF3AC0 atherosclerosis5
221,561,210 *154A07C82910A53546039A815664353008F3898C auic
221,561,211 *15476A786409B0D42B39B81CB0A0E2322C3E10AD austinbilley
221,561,212 *1540A3F8A601FDFD705CDB7B03EFA606ED4ECA01 AVGITTE1
221,561,213 *1545606DE96B280D2F2BF78D106B6F1082D48F79 MARGARET-GREY:-LET'S-KILL-ARAFAT
221,561,214 *154FF8ADDF8D101AD4B4F53C2FA244DF87EF22A2 matacorreiomor
221,561,215 *154302412DD17AC830F9E7CEC43715DA02E6E45C MAXNUDELMAN
221,561,216 *15426FAD44BB71ED7D1D7D64B26894405B1E839F beqqq
221,561,217 *15419C06E68209603434153F97BB8505A996604E MICHEAL.YOH
221,561,218 *1541B97D50FB012EB93AAA05D8495854104DC972 bh7+i
221,561,219 *154F61890531BBB1034159298CDE7BA30B9C4286 [email protected]
221,561,220 *15485AFC71B8F74AF0075DA5381992DB5E52877D BILLY.ELION
221,561,221 *1548B34A4E259ADDF733C65A962496F69291AE34 MOHAMMED.LARMER
221,561,222 *15487EDC1966FD8B830E2905BB4DC6A6F256455A [email protected]
221,561,223 *154934363183CAF481ABBCF37DC530F1EB7D7EDE :.black.night
221,561,224 *15438E937B59270C3DBD2A0CF1F6FB076474CE63 BNFJB
221,561,225 *1549D2DBF5689649E25F710E823401EAC7A2CA0B MRNN
221,561,226 *1540ED830A5D90C41E0E0773C2845F4E2124CFFF BOOKER.MIHALICK
221,561,227 *154722E8CBB31E3941BF6967786254CC7325F2FF MXRNXSNSZ
221,561,228 *154AB27DD401BFB15FE13BA14AF2B61E8B4DBB5F mywinniethepooh56
221,561,229 *15493F66A03348D5D3B4679096CA12A6CF619802 BRADY.BEGHTOL
221,561,230 *1543324624EC085801A5D328ABD2C927505BF11A nattergale8
221,561,231 *1544C2E6D4BA7B0FA49F9A74DB206629B6DACA78 [email protected]
221,561,232 *154B85B7863ACA3DADD70F6A16EE207EEAFBC3CF brendonbiderman
221,561,233 *154E7ADC655F12B1CAE315ADA8A0BC9D3EE23120 bv50n
221,561,234 *1544AA2935F7F007B719AF2CF76885405001A401 ;)o~0~qB
221,561,235 *1549164F42074B16A0EFF233EBEF2F77203D167F O,-burn-her,-burn-her-hanging-is-too-good.
221,561,236 *15469E89EA57E9BB963A892C4E7D39E93983201C CAR8ONA7OR5
221,561,237 *154AD5CAA7B896B9F8BFB3F96057D02ED039F1C1 cazuzos3
221,561,238 *1546E90FDE71A44544AE0869D2224ECCF10B9BD5 OMAR.DONOFRIO
221,561,239 *154852EDAE77D325D2E8334C0F50B0EDB267D78F ON500:TEXT:RAW*:*:$2
221,561,240 *154177E443D390AEE5E71D47578D4FE082B2812F cgb+e
221,561,241 *154365E5F9C4D2459433DD2BAA067E50DA20A1A2 [email protected]
221,561,242 *1543EAC143AE7F0A7B61C606EF3D02B1AD09819F owenfriling
221,561,243 *15411BA77BB8F9887CFC3916FC49397E3C3086B1 [email protected]
221,561,244 *154CB46F85E686E2F1FD3CF7A55617A63A6BB8FC CHASEN.CASHE
221,561,245 *154B563CFE297450F6AD882B8279A91EF0896F6F [email protected]
221,561,246 *1544B83D4B8510FBDF962E92E6A7522E8CC076C1 „CHIRURGIA
221,561,247 *154EA009E18AFF3E70870FE3FDCBEDE40445C86B CINDY.SONY
221,561,248 *154107FC8D243B0BD868EEEA4E7B20FA9095DDA0 CJA%L
221,561,249 *154615DD489A3F58E5D4041B17DACCBEFA35B529 PATSCIMECA
221,561,250 *15403AB5DCBE275833C752E930AC612D3019C5C4 pca-scopingstudy
221,561,251 *154C21F2F100F6660D5DAA118172AE9344349F5A permata-rohani
221,561,252 *154D75FDF7F84597CC090E3AD5F484E123ABF8ED CLEANTHN9
221,561,253 *154C7E78503A72A0990C37C81267C8A977F830AA CLK%+
221,561,254 *154CF48C174482B455D8FD30E71C2EE2C68BFACB contrerions
221,561,255 *154562A0964C149A0410014D8FD971DA3F1B737C quintonkeator
221,561,256 *154C3CB1C0C9714E8E568D8D750959E9E8DF5E9A cyrusgorn
221,561,257 *154581897370B60FF0AC2273C79B7A9DFB3A6399 D0UB13-ST
221,561,258 *154CD5EF6BC7AEFFDE5B77F3172457D180394A20 d$297
221,561,259 *1541DED48BAF45BBEEAFE76430C9C08FA560D7C7 RALLYEDECHARTREUSE
221,561,260 *154AE03BCB784ACFE7D4040762CE960489D2686C D3T)
221,561,261 *154E0127F1830D251404C8C931998E17947FFEB5 RANDELLMAGIERSKI
221,561,262 *1545AA9DE3BFAF1AB582742181B87DDC4D58FB87 d4bt8
221,561,263 *154187D8D68B8CDCA0FA3865E484EB97B2BBEB85 reckimog
221,561,264 *154FAC3D04481EE51C515BFC7FBB2E6984CE34F2 davidburen
221,561,265 *1546B358F9D85F9690FFA242EDE17CF58D0EA9B7 DCN=T
221,561,266 *15419D2842282ED835CABEE58959F26A368B741A DD%D!
221,561,267 *15454BAB52967D88F959F00D128A0F969A370055 deladierappearsonthehotscreen,stillwakingup.
221,561,268 *1544C7271D9829BB98EF35DB38A17C4BE4427BC9 revuehebdomadaire1921
221,561,269 *1549895FD0B1BF9142CD16EAB2FD06E194013E88 DELRAYE8
221,561,270 *1545F1182774491A4D49C9A8063945BC3F745239 denverholmgren
221,561,271 *1547119B0B39D1C513BE1DD466B4883EC751B299 d)fnb
221,561,272 *1546EE1B483763260BBAB1639CEA41A7A4A0FA85 Dhu"
221,561,273 *15443082294EE49B60D02085BA44E4C63BB5B5A4 ROMINA.ZITAROSA
221,561,274 *154CA0C03BB3F74A22FFAE57E210A31D719EA08B DILLONGOLT
221,561,275 *154EE033D600854B25B4D8FB1E3212F2D95636C4 ROODTEER1
221,561,276 *1540F96F4C4CFF11061A03013289B7F82D2F9BC0 ROSS.ORNE
221,561,277 *1546A3EC15F64099CBEAA809E5D710BDB6A96787 d-#mn
221,561,278 *15440BDF62ED9358A1027ABAFAFFBDF98D31BED9 dn".e
221,561,279 *154512A43589FC0273781A5EEA75DD525616E3B3 RUEBEN.ZABIK
221,561,280 *154EFE757E2AED9FDFFA3FFD0C45AB32B00E8B6F DOPICK
221,561,281 *154F213E1C822FF7BF373741E93AA5611ADA5873 rustiko6
221,561,282 *154233520108314FB2F6A0BA957893432663134A r=W
221,561,283 *1543F0A4C03A08902C4999617F5D9695239C1299 d"rri
221,561,284 *154E52AB460C266BB0324E1CF396CE648FE1F7AF SAMMELNDEN0
221,561,285 *154AAD2A1190E99FECF819264393754558FB7609 dudleybrattin
221,561,286 *154FA199E23C6CCF0BBEE634C7504F15EE43541A DUNCAN.LUSCAVAGE
221,561,287 *1549C39D8E3EEE7B8307D56E8E8050785D0E4ECE sans.faire.expr
221,561,288 *154653BEF526B6D1282699BCAEB138B4A5148FA3 SANTA CRUZ STILL SUCKS
221,561,289 *154041134C1FC4C8EF77DB6EC3D982A6574BE967 DWAYNE.SHIKE
221,561,290 *1546D9DD0C5FA06E3BC7AEB2CD975EF8AB65B9B6 SCANDINAVIANSOUNDSCAPES
221,561,291 *15432452CA563A476957A3C1BA2B5C16500566E4 east-baton-rouge
221,561,292 *154F4A0DCD4CA81EE12DC329B4373E94D5AB57C2 SCLEARSPIRIT
221,561,293 *154B207E9CFEFBD562B976A6F7F8FB6C94BFD6BD scoraggia1
221,561,294 *154491D3E5F64FD6874DC038C122BE533D06C195 echttes1
221,561,295 *154B848E93B8224F30F78D3F7286F1D89D722BBE ed.p6
221,561,296 *1542A5BD3118A18906D356221F48844C2F9B2A2F eli9n
221,561,297 *15460D4BC8C5AF801C03FF5F426359C33E6DC6D9 SETHMUTAU'-'MUTAU
221,561,298 *154EDFF1879C485CF2AD2AD14E8F355FA036F77F ELLSWORTHDEGRACE
221,561,299 *154DD921640E97B61905E2E1B2BEB258193C8347 sheldonestrello
221,561,300 *154F0C469AEC637076AF67AC082875E6803CF22C [email protected]
221,561,301 *15436052F7FAA62EEE246044EBBBA1581EADEBBB SHERMAN.FRUTIGER
221,561,302 *15467A08AC4952973EAD5C0E50170D3971F99742 ENILI
221,561,303 *154A24DA62D56B9ABAC49D27060777940F578B78 EPITRES4
221,561,304 *154E89F9222F93A9AD85B3247A290545F0B36A24 eqtm+
221,561,305 *154957DBDFC2E5993F62FE32961DA5D3F0AEC4FC SIMPLEMAXWELL
221,561,306 *154D5CDACE25CDAA8D1026DFC1228ACDC2621D9C EXPO-'83
221,561,307 *1549E33E8FE59B3EDC9DA4D83299B0943A38C7A4 eyelessgazealleye/don'ttelltheriverman
221,561,308 *1548C89E798DA6132ED5CF8BEAC69E00AD2FFA48 'S-NACHTS-NA-TWE
221,561,309 *154B6FF955521948DB34774EF8825104CA6B92F9 SO.IN.LOVE./.THE.MORE.I.SEE.OF.YOU
221,561,310 *154CE61E173A23A338BB7E1A2FD44F7AC63AEB6A SRESDAJAB
221,561,311 *15401AFEE0399B33684C9C51D2A8939CBA114F0F FRANK BOCANEGRA
221,561,312 *154AFB74BE03A728DE1557EEE2DA95379AEC4F77 STAMBURINO5
221,561,313 *1545E5D320E5056E7D83044DFBB90CBBFDF49320 stanzabel
221,561,314 *154075068AC6C9975CCA50D49E31BD3503BBBD87 gang-bai
221,561,315 *154C29C477B89DFA1CE4FCFC4FC012FFBF97F5AE strofale
221,561,316 *1541EDAE8CB3DD2D4BA20779AC0B7C9ED824C688 GLASFEDDEUHANCWYN
221,561,317 *154348E2107DF1073998F8F69B2179E6DA1E6C69 GNOLI 19 0
221,561,318 *1546E197BB3A7FFBD6E55B84D7258473480C5345 GONZALOCRAZE
221,561,319 *154AC22A7C91F821789BE5ACE8B660F844CF1321 surdeval
221,561,320 *154E28769BCFC0F141D4F8D0B8E9E662D29FDAB0 susanna.gevorgyan
221,561,321 *1546E9D4F6AB69BD5D58D6A8CA6E63683F30D0A7 SVUOTILLO
221,561,322 *15458678239210951B4FDDA4AE91F758EDF3DAF9 SWANDY1234
221,561,323 *1542F763873849E6D307827E4C65AC4CF11EABC8 SWASTEA
221,561,324 *1548BED11016B3108F90B67EB75C331672558BDB GUIDARONO9
221,561,325 *154FE37357C1280F7AE121A7184E566654435AF9 gyurdabazli
221,561,326 *15481AC651AC387E2475982BD3084AE9C217533C T1PHT9RPH5
221,561,327 *154A97E2812431E6449302FABA4FF50C3BB75D71 TÄHESTIKULISEST
221,561,328 *154B873F37FE52B2B10A1EE4DE8CA067082231CF HAMISH.BAYNE./.LA.FILLE.QVINZE.ANS./.SMITH.JIG
221,561,329 *15421B4B9F170968C1BC749FF83666440FC8FE3C TARKENTO3
221,561,330 *154FE4C9754572CB3D2B1C42AA2AE4632D81F625 HAYDEN.TRISH
221,561,331 *154F2CDA87537223A0E4374614830B923B3E9360 HEATH.ROSADO
221,561,332 *154E7D8B6F28C246AAE2A00A7E7D80E268C32060 HEELIZABETHT
221,561,333 *154FE9113EFB3C8616F25DDDDF16F764D1D41BFE hertz
221,561,334 *154869B4B176D0892F526685CF8E34151A05E3A4 THANHSUH
221,561,335 *154C645A8D69A6B21E56B2B63EFC05BC735725D8 hipolitoespericueta
221,561,336 *1541A5E3C3DFEFF5B22493717FB2821C512A8AE7 TIGHTG4R
221,561,337 *154FA66272A0E2B9A294341DC5C7813502D09D26 I3PR
221,561,338 *154B12498BB0515A9A2AB31F1974E33F8AC47465 IAMLOVE2004
221,561,339 *1543986168659C16814EEC112B2BAE3CBB1BF754 TRIAXIALELLIPSOID
221,561,340 *154E7143B4969A85FF0737B64998D13EEB8D0037 inhispromise
221,561,341 *154F00C7F4323A3B7FE2AC4D896A51D30C10EE3E tubiferous6
221,561,342 *154615C7DE6F85346A0E89EB0FE5DA45351A497D irritato9
221,561,343 *154B45A0F21197A0FE54BD4781440ACC4F24A67D jacobblunt
221,561,344 *1543952EEDAE10E921EAB178A38FBBA5A60E1B2F UNDICELLI
221,561,345 *154742D1886419987FEAB889939F1D09B3B9C52E jeffersonjemmings
221,561,346 *1546CFC9173F7AB384A006301A5910C839582BA0 USER212.138.64.177
221,561,347 *1545C9EEC8C631D268D6F73FA38D7B871633BA65 USERKATREMERSANDBOX
221,561,348 *1544C45D2A910E1CE4347AA799BBD946EAFDEC48 usportugal
221,561,349 *154F04140395D374C7FD0882F5B051C6B1005797 JMOIO
221,561,350 *1548A3246F2B0118473A16105223290E25798501 JUANVANDOREN
221,561,351 *154F3619D7BE09493724B40D73F2AA0C5568F41F verslapten
221,561,352 *154764BF31CBC1C099E712EB2238EB241BD19DF0 KATHARIENAM
221,561,353 *154D2765FB3A5BF95276A5F1EB9D94B1559D869F VICTOR.KARROUM
221,561,354 *1542BD563AD4EA534C6111C6E7F3EAC115125EA2 kay-politano
221,561,355 *154F6D993616A7D4318F451FEDDE4535F0CFF822 kekzdose
221,561,356 *1544E4A4AEACB2C1EB0342487D986EBC2BF6BA27 [email protected]
221,561,357 *154513B9987F184EA74E085A5668D6C96528A06F L6N2
221,561,358 *15490C191AA4731AC3A0D278F86203D39E853342 [email protected]
221,561,359 *154ECCE28B099C076E9A1DC8AB919026B811736E LINDGREN90
221,561,360 *154546EF331199FE01D9B597F4040119D909657F [email protected]
221,561,361 *154F8052095230D30E1B2C700A18085B13E6DDD2 lmymkvcs
221,561,362 *1540CB7AFBAC928E7D4B5D4B46D90E80F89C4459 LOOKATWHATYOU'VEDONE
221,561,363 *154F7521CC67D8546F59F8D66F511D3D2AFA23CC LUCID-DESKTOP.ORGWWW
221,561,364 *154A5BD39F985A73396CFB59FE2F0A1CCE256BA7 WILBURLITTLE
221,561,365 *154F91A2F5A0ADD67034CB74386434522326095C WILLYMANASARES
221,561,366 *1545186C7213411831DB2EFA852FEEA4E814DCB4 WILSON-HSIA
221,561,367 *154759E1B7DA0B8B4F953BF5A0D38D443DA83637 MAC-SOTHIS.COMWWW
221,561,368 *154C19AFBBD488945DF5553E4D2678748BB97E1B [email protected]
221,561,369 *1541D76D807F48AFFB0BA59645848D5109FBBFEE WOESTIJNPROVINCIE
221,561,370 *15434C241F1C3F778F2DADB38A1A3CDAE19A20E5 manualgrady
221,561,371 *154A1FE0F60F40A1C89C6F8D72C8F82191A62553 [email protected]
221,561,372 *1540C2C5371A17885A2DC6254B859476CCE80AB7 wuyan
221,561,373 *1546F04859FC1E16EB8761C08F4A01BF2AAC2C4E MARY-MELIKYAN
221,561,374 *154AB0606C9104FE50476EC3733B6D72CD1EEE1D MATTWALDSCHMIDT
221,561,375 *1541A20EB4384CE5F70045E2C7F7BECA18254ADB [email protected]
221,561,376 *154E7DF41C07FC98584E9A91F4537456906BDDED [email protected]
221,561,377 *154F48D1C336C64C67A2A39CAF3F2B9049B34E1E mealmonger0
221,561,378 *154F4E72C556D9C0D60D3C9195D032632E1D405F yanapekurin
221,561,379 *1542FF5288304B3FEF23EB7A7025225E828CAAB7 YEE.KOK.WOON
221,561,380 *154F240C793EFAE9BEFE203E3E238E22F4FC8C6C YEKCIMASUIKSWORBMOD6
221,561,381 *15424E90B1C6AB1C378832F0192C4E75EC03AA62 yfrijct66
221,561,382 *1548E2C6AC771A0E33CC93594455E423D945262F YMAN-RANES
221,561,383 *1542F00C8C3580B358AE49BA1CBFB14EFE3664DA MINNICK0
221,561,384 *1548DECEC3816A9D47075133A53B2590D9B31469 [email protected]
221,561,385 *154EDC5A387EC0C6496AD0B50F018F7DBE470751 mmcnetbsw
221,561,386 *154933A9E45DC0B1E4862E0BA3B23F83D5AAF1A0 [email protected]
221,561,387 *154994A3B01A595B7183DBF61F930E88450CD878 MMYUUDXING
221,561,388 *15464392DDF3D8CE78C98870E9DFD9CE4A204013 mq?l
221,561,389 *1542EB838F94B35E3CA51B722CC9078F0C9DC255 [email protected]
221,561,390 *154AC4A92E2C45A81EC95420A6B3AF5B7BC7E6DA musk3+r3s
221,561,391 *154F7682A781037D40BAC9775E7323F91623689D MYCLEANUPORG
221,561,392 *15478FC10A2955827ADDC96826FF014B67E4F1AB zf0baa
221,561,393 *154DE032452FE220306B3152D8FB71E66E7179F0 ZICAALIN
221,561,394 *154CE6A267D509D710B6421A02A1F77F8DB6688D nada-p-flojos
221,561,395 *15474789E3EC31B546EDB7C0E0641AF3678ED2FF ZUBAIR HUDAWI
221,561,396 *154AE7A905EF64FD207271F539FD17D3202B4CBE ZUMBASTE0
221,561,397 *1541FB1CE83B7EBABCBF22EBEDDE90036FD69570 zweetvos6
221,561,398 *154AA9E19AAD3500A13E194A8B946D49D915133C zy-glimont
221,561,399 *154E30260C55D75EAFEEA66076C446B22AAAB4C4 ΧERTÔN
221,561,400 *154943045535E57C7127C3730EBD8BAD326FFBFB ајдовшчину
221,561,401 *15412273219900F7C3F3AF9C991F026BC48708F9 ДЕЛЬДЕН
221,561,402 *1549E75D507A6ABBDFD809A4C086487079F71994 ҐЛАРУС
221,561,403 *154F38BE8429137E9932E5818EFA9BAD545BA643 ОТГОВОРЕЙКИ
221,561,404 *15444D0423DD6C17B99038BFCE3881BE684C0796 NIESZAWSKEGO
221,561,405 *1547F85162B6F7914ACC705C56FED1E144161011 niisketes
221,561,406 *154A5434962428802C1E0E9C0E2ACE3EDACFA1B6 nochedejaranas
221,561,407 *154DECB34A0158E015745D742B71AC21CE5EF0BE NORM HUNTER
221,561,408 *15447001B52C5CA37504F747D96CA741FC258A40 NORTADAS
221,561,409 *1543ECCFFC46B961D82BB6E259D4C3A04662EF6D !NSULA+!N9
221,561,410 *154139CC741273D56D2BF5F4B05DD8A5CA0A39C6 (削除)実績不足。ケースEに該当。
221,561,411 *154491D1C8C27D9CF8C0127316CED1410BF38696 名稱源自於希伯來神話,號稱「神與秘密的領域與至高的神秘之天使」的大天使拉結爾(rasiel)。
221,561,412 *154A53965DE4954A886A5035C26BA9BB9A7A9F3A ODIS.FARHAT
221,561,413 *1541ADDADD48198C6E0DA4E50981F0F4874D66EF ODORAVANO9
221,561,414 *15482F6998C525D3C334D72B7A32D278F0B15272 )o(o~o~(b
221,561,415 *154F2EB0CB1F4942082F3C2D838B28636179C8B9 OPIATED
221,561,416 *154C2765A62FF2A6F297E5AC66852F56C1F86384 OSAÄÄNEKSIÄ
221,561,417 *15449D4083D1A4A4FE4559D5F58109F7B1E49DD7 OUTCHEATS
221,561,418 *154A079E7D4F7037B0A3913F9DD606080FC58F7B p4n+0mm35
221,561,419 *1544735892F9BA941113D8CF1904144D11EA95B9 P######D~-~-~-{X}
221,561,420 *1547E1EFC8E42917B0FBCC4278A7B68BA5D6C5AA pepe-camps
221,561,421 *154AB2478530E2D7140FF2545C155A2BE8C94E32 PEREAGARNICA
221,561,422 *15436EEC8C4ECB3A7CC2DBFA64F7751BF802A460 peterjimerez
221,561,423 *15478207EEDEC8BCBBCABBBDF23320FA4595F01A PFUNDT12
221,561,424 *15452C23A13C3117DC9065AF94AD3D1483E89995 pinguin#1
221,561,425 *154DD30679362D17EEDBF73BEBA6536DFD554DDB 1,000-Cranes
221,561,426 *154BEDA547DE800D6AF9A7AA4FEA19DAFE5BFF0C 1014497 the.median.view.now.is.for.a.flat.reading.for.output..
221,561,427 *154B0EA6C0874272F59BF7A7EFFBEE93DF8FDA74 pmcgolfer
221,561,428 *1540059273797B64DD4103CF24CD716371146C13 1321509 NUORISON OPISKELUN MOTIIVEJA ON ETSITT
221,561,429 *1541DEC2DAD52A4B3D3813C2A40A036887D6B192 P=====P~ (O_)
221,561,430 *15421E96BB616CE8C5DD5C0861B34F0979BCD828 pr0p0rt!0ned
221,561,431 *1541487ABBC313A9F3D55049EEA17FD09840AA81 146RANDALL
221,561,432 *154D4CF1C50345711C37D18076266D888DDF2140 161037 sivas'ta-dogmus-ve-hicri-1032-yilinda-vefat-etmistir-
221,561,433 *154DC40C8B1D9BFD04522C122F0A78F2F1589A42 1648980 rotgruen uebernahm im oktober 1994 das ruder
221,561,434 *1543E4178F9319BDB55D85247EB80814F8FBE095 prescription flush
221,561,435 *154650DF5580E8AF4C5D5D8CFA9B6FEEA2DF4D15 PROBORAVI
221,561,436 *1546E18922B956A476C0AE2952B0CB6D99B93E94 PROGRAMMERINGSMILJ|ET
221,561,437 *154321947C416AD0F76073297141383EA59AB1FB 1986445 SHOULDN'THAVEGONETOTHATMOTEL,JIMMY
221,561,438 *154AE5F92CE428B0D76DB9006FED8EE9971264B4 1-amat
221,561,439 *1547AD77EBEDD9F1D8DBD83EC74D33EC4AC558B4 1 BAHUJANSAMAJPARTEI
221,561,440 *15425F4C6FEEEAB8140F297313583453FBC962B3 PYTHONSAMPLER
221,561,441 *15498AC0C4C136E9C75456DDC3721E85CBC4E057 Q321727
221,561,442 *154949C157100987C67F128AAA8298C18619DFF2 [email protected]
221,561,443 *15481E6B868175EBDDBDBD180FEB301569388CBB [email protected]
221,561,444 *1540D237018D0446E7D1C375B15D53DECDF4FAC4 q#####D*-*-*-}o{
221,561,445 *1543C71E6810374968AA59341BB857EA83564AC9 [email protected]
221,561,446 *15402C7E1F14159D2DC8CB8DF99AF84304952EBD [email protected]
221,561,447 *154BB649CE5BA4F1628A84347EE715E474C5AA12 [email protected]
221,561,448 *1541D0FE9D91512539665F40B0FEB16D5DBFF3AC 1HAISSINER
221,561,449 *15452148612889C2CB404C835BFEC23159A3BA9F 1.HYMONET
221,561,450 *15424F383B9ED3E43454B431DFCAC8B15C10749C 1.ILKKAMUKISTA
221,561,451 *1548F12E6BFA70B50959D5F0E1D9DE1C0E623E36 q-----P~OSplat
221,561,452 *154A1332941DA95FE1D68D8FA28E566EC1C19E11 quiet-design
221,561,453 *154F638711848EEACBDF1B98C9FA25286E5F2A46 1-KRIEGSRETHORIK
221,561,454 *1542599C277FFEB05FC5CB1ABD33F9722877187D 1 kynt
221,561,455 *1549675816D3554D9A1781456743EA5CEBA195C5 QZATWFTR
221,561,456 *1544176C553DB630DD0E7EA9DBA9FAE101D53596 +R1BU14+10N
221,561,457 *154ED76F19232396D65DBC27DBD030BDE4F14BE7 1-latorczai
221,561,458 *154F4CFD2651A0CD6EA20428206B59A43DE657A1 RAFLURE4
221,561,459 *15452C96C8ED147986DB1817267153EB12AE2A8C rakeshmotwani
221,561,460 *154E9BAE14ED2627D01659197E1F15D711FB6BCC RAPIDCAD3
221,561,461 *1546F9E5409619ECBF617E0953A59A8E3A32F844 1.traum-duo
221,561,462 *154FB990EDDFB007D6A69963ECFF249A38A7851D 1.UKKO-PEKKA-P
221,561,463 *1547F4B4946DE0558A2D9F070AFB65B8B8A010E2 1voranzuschieben
221,561,464 *154B604A70D6CFE13391E01EB7C03F8449F3D678 1.XMLLASKU
221,561,465 *154B8F265272BE9B98661F3C1C710963AB2899B7 1yva-jatkokurssi
221,561,466 *154343FAB697ADA4FB6E05725BD6BB98829EC101 1zinstabelle
221,561,467 *154C2A3E161E03C6C9CE168A82BDD6D02AC5ABE2 2002SPRING
221,561,468 *1548846D18E81ED80E9269BD7DC2756C19614052 2046684 seurakunnalla-oli-kolme-nimikkosopimusta-suomen-l
221,561,469 *1541F2D295885C399757188BD6739E6302C8CD32 REMEMEBER ME (I'M THE ONE WHO LOVES YOU)
221,561,470 *154F46344F0F0A12432D77569A59FE2E8B3D5CA4 RESTIUE0
221,561,471 *15472F26E75869DE3D548308A7B22E58153C073B 2313815 ISORA EPS LATTIA- , SEIN
221,561,472 *154A34E4EC8B263BA3660DF862381ADB7F5D24B1 2388444 SAMALLA TAVOITTEENA ON LIS
221,561,473 *154A00BC37EB867F57754E22FF86789D88AE9CF2 REYESKARRENBERG
221,561,474 *1540369C335B924F392F6096AE1E40B81DD0D944 24march1998
221,561,475 *154D3FA98BA12B21A05F5D68B8440CBD39BBDED9 RIDGEVIL4
221,561,476 *154F44245941333669CC80A47A3366C8A0286CC9 RIZAROMERO
221,561,477 *1549D95A579DA9C6EEF775580A29E31EA9BFC40B 2bdrive
221,561,478 *154608C7C70143D9C960DC247FB8A144EFA1E950 2.flughafendiskussion
221,561,479 *15412D2B241B39A1ADBCD142E72D2CDB76460A09 2FOUAILLER
221,561,480 *15430933AFC2E8F41065363CAD215A292D7CC335 rodrigomcclenningham
221,561,481 *1543407A73710337D7E5EE47D5E3AC968AEA4738 ROMBERT'S
221,561,482 *154AF77BA285BF6A1982732885F421DCD389E43E roubaises
221,561,483 *1540DB77172117AF6A93E3429D498CED2364C4D5 roymudie
221,561,484 *154831CA445B92FD4FACC3CEDBFC11C36B52BE42 RTOSSMAN
221,561,485 *1540FF66E9EEC0D716611096DAC19B8D7541D7BF RUBENORABUENA
221,561,486 *154ADCB098962351C13873363F1E877C26F0F8C1 RUBREDOXINS
221,561,487 *154A2D43B60FF5E6093C0CF1DD04B81D8C208D9E 2ZAEHLKARTE
221,561,488 *154694093154DC79D6A447B3C72C497FCCF916E7 [email protected]
221,561,489 *154C7C6AEFE96B1531901E4D0463F7059BBF8FC8 RUPERT.BIERMANN
221,561,490 *154B1BDB73E7694D02F69C9503185528351842B2 russrodal
221,561,491 *154D47008E91EFCE56D6850FEEB17DFC9B66F233 S1IP.W4R3
221,561,492 *1540A9DF034BC6AD13F4F8F2CB25AB63A9A30E9B SAMANTHAMARCELS
221,561,493 *15473E6DD59C9CAE3FD50B66362F93C1033816A2 SAMMENROTTEND5
221,561,494 *154F178EADE9E49A23FDA1BAF8C8B1EEA4D47A66 3kilpaistuin
221,561,495 *154EC15E2D2F93210E106746FE634655F82C0082 3lasivaihtoehdot
221,561,496 *154E4864ACC1B720A704154F4C8B3157A4571424 3 LUOTTOKORTTIMAKSUN
221,561,497 *1543E81F67BEE2316E6ECE8F7F80EB7FC093752A samson1934
221,561,498 *1548B11C9675CB54A05D68A7915D09BEA7AF4888 SANFORD.YABLONSKI
221,561,499 *1549F77DA4CFBB4880E1530B575493CDFAE5BDF4 3##p* *splat
221,561,500 *15442D3A3F160947071D53FB2B74BF43340AAEFD 3UARIAQUE
221,561,501 *1545B5AF34D757BFD43D4179EA03C3867E891226 sarcone123
221,561,502 *154194C7242C8AAA86F14AF1DDABA1E3C4AAF981 48259B7F
221,561,503 *1546C3FCB66508C5AEAB5A8DC1BD6EBA35700777 SBILANCEREMMING
221,561,504 *15426F04E8FD82D4E69EF7FA24405DADA92EA852 4ANAJOUS
221,561,505 *154909CFE8240B5E90EDBE64F4D02C0270FB464C SCANNERBILBOROUGHA
221,561,506 *15417DCC9017C0CF9031EA24F60F98DF176A5761 4ASSERII
221,561,507 *15408A413983FC9BB0CBE5071002E636F00BB83D 4DAMSTRA
221,561,508 *15429F9BBFE8D034AC657CE2CB384EF6B3DA996C 4ELDARIN
221,561,509 *154F2C4C232AD5EDD1B1106C6D7C65DF2CC53259 SCUD(1998年7月23日)
221,561,510 *154677CACA7428DF585DB1CB8A2DB4AFD7235806 SEKIGILOJN
221,561,511 *1545A8A63A640569CFDEFAB2A7CFBF0843C01C98 SENNE+7
221,561,512 *154E16DB3E9A1DDC03548301A149577F68F64272 SERENA527
221,561,513 *1541B296AAB2AA2D930959DE6C200D6A0133095E SHAMUGHAM
221,561,514 *154FFDA3693A101F2DDEB2F20422ACF8C64BFCD2 5ARRIVABILI
221,561,515 *154E6D437199F081CF9D79DD0AF0E535F5DDCC96 5BEZETTIN
221,561,516 *1549FBEE72AC4953BD45A1E8CCBDE1EA39BDE953 SHEIKS
221,561,517 *154471436FCCD429D927AF9F7A1540B0725B2E95 SHENNYCHUA
221,561,518 *15491A743ADAE4F03B4113714E0246B361153F9D SHERMAN.VANDRIEL
221,561,519 *154D8A1CAF0968B9CBCB565769AEA0B859F9F5C7 shirleybaruth
221,561,520 *154263D7D23B5998730D2A09E0AB19D31CB6986F 5MORRETE
221,561,521 *154E0D607F7760A811B7B727C3F88C38C6BA1FF4 [email protected]
221,561,522 *154CF118517CE4187C1A7DBD45325DD0919A333D 5ROBECK
221,561,523 *154354A816F0C507B901D423B876FF620AF5A334 5SENIORSKATER
221,561,524 *154AACBD91F0CDC6070B1CFDEE661C6DC33EABE6 SIDDHANTÁT
221,561,525 *1547A260099FC52DFE61E1A268CB70D014383E4C SINGPAWN.ORGWWW
221,561,526 *15491E31E3C406A4EE33225439C70B713880E36A 606456 kouluttajana teatteriilmaisun ohjaaja kati vapalahti
221,561,527 *15457F56314E11D97799E9F073515A304FECB4CF situation.(richard.'humpty'.vission.visits.the.dome.mix)
221,561,528 *154D34B97D927AF553464AAA1BDD7DCBBA8C85E6 slangbyt
221,561,529 *154BEF76B081BB9044A0AD16C2D584A5035AC7FD SNOREPUCCO
221,561,530 *154322BD6F90CB04DD6E29115DF13D7EEE2B90C7 SOUNGHUNED
221,561,531 *154C06E32072AE7377CCDA4753921D0B0DF4BC2E 6ERSYMBOL
221,561,532 *1543ED0E794BFBC7547E2A8861AFCE84C4AAF83F SPIATTELLERETE1
221,561,533 *154926FA79584B6F940CB3DEB19D40861A4DB448 6ILOVEYUKON0
221,561,534 *1545427514E575B0C08C59211E9AE76297146148 6LOONEYDEBBIE
221,561,535 *154CCC58BA075C0AAD8331BF2005B97F20A21EE5 6OKKZGEEW
221,561,536 *1547E06C32F5F67A0F372E32F152041A9311B6F5 6OROGENIESES
221,561,537 *1540FCAAFCCF7EE846CD59FD4E54DED097D8574A 6PASSWORLEON
221,561,538 *1545D753DBFBE81A3ECBAF963E70DBC3BF5E2574 SQUAMAEP8
221,561,539 *154956C7283654A0CC2CF62DED2C298D89E6823D srrdbsw
221,561,540 *1545C69BA01DA9A969A38DC09B62EDC0F3B34F09 SSEUGGNINIART
221,561,541 *154717546AC412F01EF5C80BE8E092F219B387F3 STEALTHSUPPORT2
221,561,542 *154A8BF67801038DEC9F5B1AA640583B1C4C427A 7BADGERGENERAL
221,561,543 *154FD9A3B9F0B0753F1EF7E322BA7576480FEA85 steven.chubay
221,561,544 *154B2F884994CE627A43BF66C4E117DB4C8EE20B stevengarey
221,561,545 *154E4C0C2065B835C7A68CDE182668416CB3E6CA stor[email protected]8848net
221,561,546 *1547EBA57CC795D6900D1E8E616E4487D081D2B1 7EUROPEJOHNSON
221,561,547 *154A9DA53600850B2189D40FC7395F361C562BDC 7FLORIDAVICTORIA
221,561,548 *154AC86406BEBCE533C5F462702B3E244750F9B6 7guadavamo
221,561,549 *1546F437D14F0E9ABF2B4B4B0538EAEC30ACFA8B STRUBELYDE
221,561,550 *154F6D5E7B73710933914A3FB0EB19A5171AEABB 7IARUCISS
221,561,551 *154CE513B63E8457AB3B5FCEACFD02A154AB594C sturdier
221,561,552 *1540374D441CF7CF98FE1A11DE2AF7BC978ABD0C 7LONGENDYKE
221,561,553 *15478A324EC96158539FBDA1583AF354BA5E92A8 subpand7
221,561,554 *1546F7CB9B80B29C84CB7B51592D794EE185EDB1 sugarlandexpressmaintitle
221,561,555 *1541CA9BBD7E9728866C672E3333BD10CC70A815 7RHGADWN
221,561,556 *154DCEEF0CB119014E9216D2D0F206C9F8260D34 SUMMERBLUEBIRD5
221,561,557 *1546DF26565E5091FB93DBD4039EB2AC15CFE47C 7ROPINGFOOBAR
221,561,558 *1545A7D62EACEC5FBB0119B64976EE310323C6C9 sungbaxendale
221,561,559 *1547286D00A610E6A96779A957939F2C8F11DABD sunnybull
221,561,560 *154B7916A836995AFD9AF43414B4AF937096C291 SUTOCELP5
221,561,561 *154CE17726AE2DADC5BDB0829B6E741F228BA949 873239 jetzt.links.abbiegen.!
221,561,562 *1549388AFA336A112DA1F10F959265A3361FB557 sygf
221,561,563 *154C237F3259C30FBD813D570A8400F0CA030275 8BSWPIKUSBSW
221,561,564 *154BBD19F447C8449FF2BEF1A510911D0BC63AA0 SZEWINSKÁ
221,561,565 *154E2B50BBA5671C0E2577680ACD0ED36DCBB4A3 8IAPLUIS
221,561,566 *15441BFDD26A070D8D6DB30A506A0945520919B7 8IDAEANDACTYL
221,561,567 *1545D0721941B2199659CD663A61790E7B71E868 [email protected]
221,561,568 *1546CD4779B686ACF8CD4BBED7D998D69A3F1E25 8KEODGOOR
221,561,569 *154283D468BD79F1F0C7A85C48C50210AB14375A TALKDICKNITY
221,561,570 *1541A462DC2A6666F9B24BA6EE3DB12C5C35FC1C [email protected]
221,561,571 *154A772B57333325F3EBF5EDB843128D17940FF6 8ord3ring5
221,561,572 *1540534A021045D32FDE167DFA92A4787283B6B9 8P.~0~o(>_<)
221,561,573 *15437C16E11E9AE3F7809FD4DF3EB978450FAB09 taradanny
221,561,574 *154AAF264B527FD6478BE298590B1F075CFAAE48 8SOUSTRACTIONSES
221,561,575 *154BCF418A804DACBC73FD04F72FC28314C3B1E7 8SWINGSTERS
221,561,576 *154DE79E77A7C1AAE75EA069577BBCE7876DB059 8THATSALLY4
221,561,577 *154F71FFD6A45552CD7A84DA6D47F7F77CE292D7 TGRSRNMN
221,561,578 *154C3227F9AF23BEF598E02B60AA73F99BAD6BE4 THCUZTSI3
221,561,579 *154A0DF7ABD19FF4D300BDF06AF04444804C5C20 THE BRANDISHING TIME
221,561,580 *154804CAC59EF490150F7CB61959B19B4FEFB794 the lee morgan quintet
221,561,581 *154752C495BF3FE473851175ED79F636485EFF6A 9NCONISTA
221,561,582 *154D52CE4C3EF1535F2A9455DD456C8B114C5BF0 "THERUINSOFATHENS",OP.113
221,561,583 *154559C10EC1BDB1A7C0290AE592CBD01D6FC206 THIS.KING
221,561,584 *154C64250AE03D30C756DF2813999E95F8EDA56E 9SUBSIDIEVERSTREKKER
221,561,585 *15429552658C48C941D0B85FF89CF36C6100576A thomasfdouglas
221,561,586 *1546DC0D77AE48D252A5ACCD42382EB6276639A9 T-HX
221,561,587 *15487CE63D864DE5AEE16402F727E328C6F36759 [email protected]
221,561,588 *154D4D7FFEE56551E3FA9110B332E4FEDC602B9B a4&vg
221,561,589 *15444083FC879BBB0D7F3052B55CABA362CBB037 a*a;
221,561,590 *154380954D636C201AC97388B9097190DC7D5417 TODSIVERT
221,561,591 *15497236A9B2B0190865A8AC60375501221E3384 TOICARUSWITHALLSINCERITY
221,561,592 *154D3D981DB7B5A68F713BDB021F9C52F7FEC237 AAE%
221,561,593 *1544B94AD33FFDECBA71B31FFB4C9DEE1E3E8672 TPECCAPPED
221,561,594 *15491856535A3722BE9CC338A544A45B130D0F05 TRANSMUTENT
221,561,595 *154C0DC47B17E44E1AFF4C43ED75AC7BE6840626 ABELDELLE
221,561,596 *154196CDA045A67ED59E36148869B143E971EC58 TRASPARIVO7
221,561,597 *15458AC1A1AF2215CA9786063E9BB8D5D66E32DF ABIGAIL.AURELIO
221,561,598 *154352DA6CFD13A36430E6BA10891509FE304955 TREMEREMMO1
221,561,599 *15423C96749DB98F474A5D28B798D45910F967E9 tribal,
221,561,600 *154692273AA68E1360A2B1F3DB80D7EF9B2A8387 [email protected]
221,561,601 *154CE24A1064E5B1FB7B9CEAD0BBD303471B3260 ACHTERUITLEER
221,561,602 *15407C22798FB099540B8BA2FD879D096641C97D ADOLFO.ARAKI
221,561,603 *154E303BA97DEF050DDAEE28DA96E3AF7721B846 TYLER.THOLEN
221,561,604 *1544FE8F2F4717EBE56ACD9E8E9F55C37361204C TYRONE.OLTZ
221,561,605 *154DEFBA504E1AE2B507847B97BB8604AF65A39E U9314822
221,561,606 *154252EE65B7655969BB7C734DD406DDD4FA7859 AE!QW
221,561,607 *154089CFAABB9FC5252C7AC65FDB4EFE0F8CF871 uitvergroot1
221,561,608 *15452F3BBDEDC9E3E76D8F5C3C821B08AE259450 AFuC
221,561,609 *1545C02E32D141E85963123DD48E4F2064A280FE [email protected]!C
221,561,610 *15406C0C148F4D46E22FEBFD054674C7974B8998 AHMEDBACURIN
221,561,611 *154C95B122ABE627E37107AD0B8742F32466B132 UNSERGENOSSEGENERAL
221,561,612 *154B5396670791E1C3518DB77526354B43D06A98 USERNAOKILEESW
221,561,613 *154A38A4ECCAE46239C07809FCF7C9EEBC5BD904 USERYOGBTL
221,561,614 *154C0A626463905084AF5C6104BBAA11D987CEBB USMANFIJI
221,561,615 *154A4842D868511DFC822504BAF9346317F7642E alanradilla
221,561,616 *1544E520541292B4C0CD5AD77181B9CD6491FDFC utkanih6
221,561,617 *154C78577332A11E843C965FE1554D69846127AA ALDRICHBRUCE
221,561,618 *1543ADA9D1448D3F69AC4921AC0C79BE254BC51C ALEBATANT
221,561,619 *1547A564873971C8C3CD20DB94AB37A8CE3794AE vaalijaerjestelmaen
221,561,620 *154F0103B39E4F607A4D06ED72FE9C42EFB9598E VAGIENNES
221,561,621 *154A75F88F30766A658BD313E440C82FC5E1661C valentinesypniewski
221,561,622 *154D23B022B7169D5A1A788BC6DA3BA001F1B635 ALFREDO.CHIRDON
221,561,623 *154517851B77C817F4A5144E9253960D4DF72750 ALIKALIIPERISTEN
221,561,624 *1540E2226CC0EE59862A2195381C4B3C2DB98DED VAN…KÖZEPES
221,561,625 *154F78C0A29641CE3FA0DDE2B5403F2E1FB4C52E /var/lib/mysql/mysql/slow_logcsv
221,561,626 *1544085DAEB18D1A4995359E9A918882A657D1D7 ALVA.REMLIN
221,561,627 *15455C7C46AE7A2C19E43E6EFEF550F8792CD0B2 ALVINWALKINS
221,561,628 *1543669D2F70A83E5072A44069AC78DFCA839D6B a&%+m
221,561,629 *154D25CAF9EC86E97C2653ED657AD478CEC19D7D vicentealsup
221,561,630 *154B0753C1F889A509976A6B5D0A2793513984CE amoschars
221,561,631 *1545B9A7ED61E6F51804AD9A0C848064695C4F03 victor-ambos
221,561,632 *1545CC7BEED15067F60E2E44EDCFFFE06F320C71 amv"6
221,561,633 *154FCF5576C0B7C692483F0E3B8F2E1B6E6A3C5F vidhyareena
221,561,634 *1547DA6747D73FEFDB73730458E97A5647E64EDA ANGEL.MOERS
221,561,635 *1542A36FDD64B8ADF30DDBA6B84859B4BC273B75 vincenzobultron
221,561,636 *154EBB789CF0E73A57B0B6F0E7EC0A00F866AB32 vino.purnomo.putro
221,561,637 *154E656F9AE25A5EBC30F3E188248CAA8388B37D VIRGILIO.GARNHAM
221,561,638 *154AB28239725D54C48340981979F6DA23683F0F vishal.choudimane
221,561,639 *154300D6E5FA03A653218F5568BC9907DE8F9D97 ANIBALFAKHOURY
221,561,640 *1544C29D9F27579B2A893B9F37529152847BF182 anna.in.her.office
221,561,641 *15439B765430C5280BA1E8B76946D6CDA923A50C anthropometricallyv
221,561,642 *154EAD36D341D3D14AB4DF2E0D3CF5952D9A6A17 [email protected]
221,561,643 *154A7D1FBD99A57CA39E73F69C2BFCFE28854716 ANTONOVSELFIMPACT
221,561,644 *154BAE4D2DE6568CDBBFA76DB36C2E11030DE67F VOORDELIGST.
221,561,645 *15479B518A2C63A1DE3651C3BAE17E8435601C03 [email protected]
221,561,646 *1545E2BA27F30C031E0E93BE7F7DD9C748D4F764 [email protected]
221,561,647 *15412EE7D69FFF95F092DDD281F46D06069D6BC3 wayne-cardellini
221,561,648 *1546194C9E9F7954ECC3ECB89D306AFF152BBF0E WAYNE.FEGETT
221,561,649 *154CFA805B5CED247BDB2230400643BAA59D4E95 WAYNEMAGRUDER
221,561,650 *154EE078F95230BCC88BCD1BDF91014ADEEE6025 arthureapen
221,561,651 *1546AE34F2E76D922804B202BE151C13CE871BD4 asbj
221,561,652 *1543B541341B63FE223BE5C1EF792B66CB1093C8 attisées
221,561,653 *1548819A7A46DD6B63A82D2B932C322F9826B9EF AULISCHE2
221,561,654 *1544DE245D1752D63A8C21D27A9A0897D53C3355 AUPPYBYB
221,561,655 *154B1DF56BEEF63A4D36147D93E3AF621332D14B [email protected]
221,561,656 *1541DC740BE2463E20AB0079443FC3E80FE1AF10 wobleibtmozart?
221,561,657 *154303C48972179F8105D10FBC8AB6CF197A7ADE WSTIGLITZ
221,561,658 *154691FD4C2C5D238DCF24C2E562D89D7D45AD3F wtsvrstled
221,561,659 *154F840A40B3132697DE3319C1AE5FCE5A57CCA2 wwwrhodesfamily1com
221,561,660 *1547DABBD4C280E305C17768EAD68611DE9A96BF wwwsmithfoodmachinerycom
221,561,661 *1548CB527FD90099BC4047D1DA0A5F6883D98F3F AZWu
221,561,662 *154CF7AA869F972E6964423D786AB85FFBD1EDB0 B-2PO
221,561,663 *1544CEFDD22A4E1A08415E6C9A0CFFDD14C9BE52 }X{~`~`<####Q
221,561,664 *154DDC73D3B4CE1A6150DE8655DC8D8496864E04 YALE.YIN
221,561,665 *1541CC0970D7ED71BFB250A78158587C982F4249 YAMEBUBPHA
221,561,666 *154CD570914A5F310B0B7DCAA33A759CF9301C05 BAHAMUT727
221,561,667 *1545761F2BAAA50473E8B3D4C6F98591A087EB0F bakari-eid
221,561,668 *154D219811EC005FF09E77B891A2C127E50752F6 balance presents: electric _01: gavin keitel
221,561,669 *154FC64D6C5F78DAF79B2041B82ED31FCEB31518 YCHWEZQ
221,561,670 *1540449BB392060F3F84B975E24D31908E1C6418 yette-hansen-burdette
221,561,671 *1544192C4C0F546CC3E7FE9030784111A6332B5A Y>,F
221,561,672 *1544FCA72E79A529B983934F17CD3852EB1F6A61 [email protected]
221,561,673 *154FE27B24807CAAFE66FA8228C6F61F88096A99 yitzchak.mahtov
221,561,674 *15456CEE2FC7E67786B5F428C8E3B6854378BF5A [email protected]
221,561,675 *1545D4D71599936E7C1800DB25B9A1B228101551 YONGBEIDLEMAN
221,561,676 *1540A80F2D8831705482AA21DA380433A8BB96EB YOUNG.HOFSTAD
221,561,677 *154FAF6D4442335F34EE687A70EBE031B3B1F476 youride,weride,inmyride
221,561,678 *1542A6A4A7775B8587AD3EAF0A358DEEF6DEA060 [email protected]
221,561,679 *15434C0F7E67D7E3F07A3C2A8DA097F36AAD4F1E [email protected]
221,561,680 *154B0C779001E0D9FF91F18C19D30A43C0F1FE3D BC2NP
221,561,681 *154ADD0830B084F8A2A9B5B7DD671CA26E8C95C8 bdikp
221,561,682 *15438DEF2A55E4E91CF3BD21A12DAEB9148A7AFE be.$5
221,561,683 *1545243E389606BE8A182C177E809D92C5B1A2F7 belgiansheepdog844
221,561,684 *15459861F09DBA6C1B79D0F02151CF4CC68CC640 ZALI.SAAVEDRA
221,561,685 *1548763F143721DF06CC2E3CFAD70F2F1D861A11 beltwinding
221,561,686 *154FDBD8C47DE5566F9025680EB30D3BD28EE615 BENNIELARRIVIERE
221,561,687 *154F41047C084C2C2AB8AC67340C01F61EFA4018 [email protected]
221,561,688 *154407B88C817865C75D5737505D9C7AC44E3E4C bernardwashmuth
221,561,689 *1540440FC0E5253DB0B5F431E2845006A934B530 best album 2000
221,561,690 *154E98B188AE1E3C76627BCB35EA3214F21033A9 BFL2N
221,561,691 *15453937744C3C6A919035DAB595631D36F704DF ZHUZHANG8
221,561,692 *154FDD2C09731BEFB7D6FB630C9EFDAAA3628C62 ZSYSTEM7
221,561,693 *1547941237704086B79B24C81861812903A7CBAC ZUKOANG
221,561,694 *15448E7327D0806057397A153FB0F0DEF93EF445 bkvew
221,561,695 *1540C032D022745CA3FF1B33EB49855F1838C14A ВЫКОЛОСИЛСЯ
221,561,696 *154FD3676BC685952FE95BF685B997B0A1A11375 b#l$c
221,561,697 *15431B00A5CC09C62C378120B8A25D3EA2D8A8FD ЗАДОВОЛЯЛО
221,561,698 *154A20000D17103898FA05FE90203B68164DA28B b(lsk
221,561,699 *154DFB21FA2877A8DDB3A79C9FE95BE97FF95909 пампанейра
221,561,700 *1544A5DBFC5062C521E666F0612A78F7F2EC1334 BO.SHAUD
221,561,701 *154E7DF0C9AB07547FB11C936FBE21789E489BCE bov+h
221,561,702 *154A15B88DEEFA025AD344FC512D01DECD441583 BRADY.NULISCH
221,561,703 *154BFB2F523618FB3397D846DE56170B2C6B5969 BRAVEARA7
221,561,704 *1541566CB35EC04B3ECF096B5F496F45BAE7198A BRENDONMAYHEW
221,561,705 *1543A5E1C195D11506CF9309BFED60071659B46A BRETALLY
221,561,706 *154D9B16BBB737B849F12E757CF8540CD867CC60 brigh7ne$$
221,561,707 *154DCBCCBC5AAF2BAD47EB984F1B874BD13F68B7 BRUNOMESTANZA
221,561,708 *154E67499D0321D3B7618C9098BF2A0CE57EDAAF b"s1c
221,561,709 *1544671B65DDAD2BE4DFCC775DA7D251A813F54D busterboemer
221,561,710 *154AD779E7B78B09589E81FF968F495B3CF5BD03 B!UVQ
221,561,711 *1545701826795F83FAE4181B461373F256AD22EB c6edf
221,561,712 *1546E882F6394AD210A76B5356BC2607FCFF11EF CARAPAXBÓL
221,561,713 *154131F8B2E0BF77E12D5605608037A4A36E12B3 CARBONISEERDEN7
221,561,714 *154E3C40D633BDFE3337325C24A72C47B2A18FCD CARLOSLOP2
221,561,715 *154222DC14B5B301E380047D97F0DCF30D8401FA carmelogushee
221,561,716 *154BF71C061740F61C5A9FA5435A24062F16EBC6 carminaburana(featconductor:richardcooke)
221,561,717 *154FBA105606C5DCA1ADA0AF31D54FCCD20730A5 CARSON.BAMBACI
221,561,718 *154245B2C069992D8770197B0632049FDF4CF875 cassaundraanderson
221,561,719 *154AF644D76E60421EAA3B64E43EC75DC9820CB0 )0(.*.*.(q
221,561,720 *1546588EEACD780C9C4D7DD83E5316D17BEAC89F 1018315 unkarissa matematiikan opetukseen on panostettu pitk
221,561,721 *1544A886B4351F08BED3356DBD50377806ABC972 C;AZV
221,561,722 *154B2F97E3B39BC55BD9B5BD001EB495E379031D CBpq
221,561,723 *15437B7D27A6C224C0CBA628AD2FB87CBD3DEC2B 11YEARS(SABRESOFPARADISEMAINMIX)
221,561,724 *15424061E9B9589D69BB7701497EEE93697FB5C9 14mak
221,561,725 *154324ECD0B1B560DA70E0571D9A69B4D11F98A9 1714675 DORT.BOT.DER.NEUE.EIGNER.ALLEN.ANZAHLERN.LIEFERUNG..
221,561,726 *154F87C060AED06B899E087966729B0BB462C980 176667 arkkitehtiyrj
221,561,727 *1548A4D1FE21AE1825CAF0B8D4723C2381708AAD [email protected]
221,561,728 *1547AFE71557C0A33492E68F644168D4D4A2E03B CHAPTER02-16:CRUISIN'FORCHIX
221,561,729 *154DABADCBA1D58FCEB8A2CC8A32A8F643246D15 CHARLIE.COVIN
221,561,730 *1549E98E7AC4051207D9D3F8FD36929870B30F77 1A2B3CBENSON
221,561,731 *1546F768CFD3E7EF72107AF291A6227097E0E012 1.ALTARBEITNEHMER
221,561,732 *1548D743966FA2ECAFA1D5834DDFE77207ED8BC7 1-amat
221,561,733 *154E50F0E6414FAB903C794AFE30207B09E1BD61 chh05
221,561,734 *1542AB1E5A2E2E7BEB9F47F6C6A20A1B5BCE6104 1-BE'RE'GOVOY
221,561,735 *154FCE174C03A6E82C602AF02DC2776DC9CB43D1 1.BILDVARIANTE
221,561,736 *154E9F4436FB91E19DA35231BEA13E8CAA095DF9 CHLGME
221,561,737 *154B96A3CCD9BF2E1C974B506DA6DBAEE4922A9A [email protected]
221,561,738 *154B7ADE0A1FE78BC022FABF864752D592A947BD 1CHICHETTI
221,561,739 *154BF416ACCF67422D680E94781B30069A5D64D8 CHOONGKINYEW
221,561,740 *1546D32151D78EC00EFE1D5991868CFA25BD4F34 1devralInarak
221,561,741 *15407F83D5A18662D1D823F202E2D2C535855E5C 1dorieu
221,561,742 *15404436F6B9469C57B0C33BF0BDBC9189EE65F4 CHRISTINECERRERO
221,561,743 *15475E45C088F9BB156BDA13B763C281A667692E 1GRANDISCH-INITIATIVE
221,561,744 *15433CCC55F8BEB1D663D6A4F6572D8030020760 1.hiihtopiirej
221,561,745 *154764375504835963825FC48B48E9CF52DC1427 1-HILDEGARDISSCHULE
221,561,746 *154A5A1F4D531E283BB20D0BC92D74185FC272BA 1iso-foundation
221,561,747 *1541E754A8730214092F3C3F191C637756CAEEE5 CIFW
221,561,748 *15440F0A5024E39C8402248F64E48DED39D0CD79 [email protected]
221,561,749 *154F9BCEAE354B2BB3AA75D1AF2477E7A20E40CA cjb`
221,561,750 *1542ABC1B82C3B6E67AC8CE19F0801F0E6B9C260 CJPMN
221,561,751 *154FA7EF716C9423F558BE02B9F97E9463B44E9D 1.lintutieteellisell
221,561,752 *154542EDD018902A13B2294DA5363318F33779D4 1-LUFTGEFUELLTE
221,561,753 *154D6A676A086D4D868163D0F491D98D32E2C436 1mai2000
221,561,754 *154B92002D0855B0EF808D0F042467F3147BF653 1 MISCHAKOW
221,561,755 *1543AE53CA62148F846AAE6030AB9F463EB65DE1 1outhomered
221,561,756 *15455988720E82CB39E5BEF8C765A2A38A448F95 1.OZKARDESLER
221,561,757 *15450D48451DC7C8F596DCAA95A1D90FFF1293CC 1-partis
221,561,758 *1542B124971CFA01B12AC5482F03D8325089BDD7 CLEPTROT
221,561,759 *1549EF89848C94C4763A04A2E9E5740884B5DC5F 1 pohjoiskorealaisetkaan
221,561,760 *154F77E2EB2B2EB2D1A4F9D34D7BE6FDAB7F5E32 1PRIORENS
221,561,761 *1547D91B1585C051B9ACB5703F26916D0E6DFE46 1rantalakeudessa
221,561,762 *15483B94541F37F294405A05F52831AFCB14F3C6 1RIANIMATE
221,561,763 *15482829FE3848095748D085D2B205ACE02FFB20 1ROMAHDUSOLI
221,561,764 *154BA8BF567CC2A2FD54392E742024F3A812F233 1SHONENKNIFEPLATTEN
221,561,765 *1548B9E2922C055ADA5470042F6F52A36C3F1AA1 1SIVUTER
221,561,766 *1548D9D489F717FB0FE53325414BADD73B80D7ED CMF+U
221,561,767 *15443FFA3A44369F142ADBF9CBBB66D8637EFB99 1STRATOSE
221,561,768 *154805817833953F172E926AAB4BBB8ED12CAA78 C&M%M
221,561,769 *15436D28D6501B044FB5A696011B0B347D9B5BDC [email protected]
221,561,770 *154FAE6C1FD0303DD3186172567DF4754AAAA0C4 cnm8g
221,561,771 *1549257C70C45E1D08C33DB8D6625C7DD50F65EE cokealicia
221,561,772 *1548C6D8EDD4E7D950301FF21B1A043D22D3B748 COMPULSIONDEREPETICI
221,561,773 *154CBD40F61C72C29BBE3BC9756BFEC7C3AFFCA0 concepttrouble
221,561,774 *1540210CE87656E6921C6B7C102E9372478686BB consibtent
221,561,775 *1541B6C99FF0C97C2D7429AD6606670FB2A6E191 contorno1234
221,561,776 *1545A08CD2BD42A552755A39FA7BF3F0FC2660B5 CORYMURNOCK
221,561,777 *1545C321AAA0BBD561217A18DAB8BC2A4BA07CAF cosi.fan.tutte.-.in.uomini,.in.soldata
221,561,778 *15466920A7FE4419B135F3872CA7D81C17CC8AD0 2615672 hel - ans ziel gelangten die demonstranten nicht
221,561,779 *154DEB06670E11D4F9C2B8114AAC4FDCB4811E63 270061 SOITTO-TOIMII-JA-DRIVE
221,561,780 *154D69738D96D7846D7D54D1A4774FDC93210C36 cpufd
221,561,781 *15461149CD17AF668CF8793267B420C9FB9B2913 crpka
221,561,782 *15407CD13C2A4B7CDC1B5FDED6C3B5B5CDC4CAEB 27A52A
221,561,783 *1546FEECCC2B0EC942229EB9B02E8C32943E4526 2965272 silt
221,561,784 *1542132F889BFAC9C4B4929362FBA4CA3073942C 2.ALIHANKKIJOITTENSA
221,561,785 *15490D3AB160E2F2E3C32034EEC2E17BEC157AD6 CSUCL
221,561,786 *1542E146D78AC0ECA89693AAD25D5049521FB84B CTY6R
221,561,787 *1549FC3B92E186CF3B111B347BE66F6FDBFAEB0B 2 DDRREGIERUNGSFLUGPLATZ
221,561,788 *154E215CC6D8CA7F056D3E3BFA3264989504B424 2 DEVLETI'NDEKI
221,561,789 *1542EF9F9DF04F6EBC2001F8AEEEDC847D56D175 CU&O4
221,561,790 *15485BAB4A63EAF5217B343C46D1B73A50A25C8F 2INGESMEERD
221,561,791 *154EC70532736397028D7144F65C678FA772C97D 2JUNE1940
221,561,792 *1542882F94882A1AA2F197B24ADF789C24C74E06 C:\WINDOWS\pchealth\helpctr\System\Remote-Assistance\Interaction\Client\rctoolScreen1htm
221,561,793 *1549FDDB89EFA2EE6C4EFAB58027C46D1699451D C$WN!
221,561,794 *154A1916451AEBE61AFC490CE42A8D099EC4DB42 2TELFOOH
221,561,795 *154ABE5FC7285C9B6CB02AA34CAF6447BCBF8246 2THATCEMENT3
221,561,796 *154E89C0255CC0C0FAF92C1923315ADEC295469A 2-WANDLUNGSKUNST
221,561,797 *154ECAC43E2517C601E5AA1B7508DCFE66D73524 C_Ze
221,561,798 *154664EE7357FA0378C0ACA2B2EBEA5443AEC0FC d./#0
221,561,799 *154BEF2F15DB45B09FBB7A36AEE78E5D7954953C d0or.
221,561,800 *154089ECD70F6858DF6CF986CF25824B39F9C786 335LEONIDAS
221,561,801 *1541B265ED8089905755C3F98DD4D2E801BDF3D0 39CROSLEYBENDIXDISCUSSESTHECOPYRIGHTACT
221,561,802 *15457D9D3F4D92328457359F7096A272925DE0B7 d3t:;
221,561,803 *154154E90880B9ACA11EC05D651FD480EB8EA3E8 d82ch
221,561,804 *1545B16670E72F29E2EE27B5F781DD03679D516F d8:+g
221,561,805 *154F8B5976F2F7E0935324261EB13A3AF9885C90 3HOMEJAN
221,561,806 *154972B6F367718309FACE2FD6D23384009CF8EC 3HTNACAGA
221,561,807 *1547A32D13BFB2F1800AC08D4C3B53469FC2FC07 3iloveblues
221,561,808 *154B55D6281F05047E7D0791A80C5D19970B32F8 DADP
221,561,809 *15416C8C7DD4F8B308A96E409780611093D24E48 3THATENTROPY7
221,561,810 *15481E62EB0E9619A783307E9A2960DA13135FFD 437A4F3FACF4
221,561,811 *154DD977A766E7850E3CEBCE3A8C6CAC5B5E61B5 4DEVOILO
221,561,812 *154DC00D6C0132DB1048DAC27CC0EB727A8A258B 4e9d6b6ed365fa388c34148b9cbae3c1-l00pb4ck
221,561,813 *154106C22B053D99B795AB68C29DF529790CADBB darylmccumbers
221,561,814 *15476704A9418BB977A6F04A5627DFDFA12408CC DAVIDPORRECA
221,561,815 *154C6CD588F4BB86AF366E39B6AAA872963BA154 4MARKCHIEFS
221,561,816 *15424917B51AAA603F87B634CD11E45224D7FEA4 DCSHP
221,561,817 *154403455FA4C111B9153E269E5A7757D6400882 4 READY-TO-MICROWAVE
221,561,818 *154A470C468D99A090EE165089565365A70759E5 4SANOMALEHTIPAPERI
221,561,819 *15455C45B578AD124CFA7319350B45533C95E0C9 DEANDRE17
221,561,820 *1547A2CD0004E281ABD222DDDA477D45CA8403F6 DEBBIECREWS
221,561,821 *15478C40A96679C8F82C5346C5756941D853F32E delbertroider
221,561,822 *1545F71B0F3359C4AAA7ADF499E97759C1433351 5BSWAQSBEBSW
221,561,823 *154DE1000D3F6127FB039D1619AE481EF20BB1EC despectant8
221,561,824 *15417EB5F7688F9D459874BAF6824D55D595F747 5DOOMBOOTSIE
221,561,825 *154144D1E5A73E25C5E946B1E6D9D834049E7140 DEVILETONIGHT
221,561,826 *154CC30F03CC5D266496F9D62774A730656A9041 devouaie0
221,561,827 *15453D710993572925CFB5987130C159FB252EBF deweycolondres
221,561,828 *154C108D8B4043D464E600DCF64ED3EC6BFA93A8 5FREDERICALASKA
221,561,829 *1541C49577E5F0BF09EFF0F958549A48C66B69FF dey:a
221,561,830 *154C97EE984B09C3CF38ADECED725CD5B49E7C4D [email protected]
221,561,831 *1547E160BB9B81988667A31341E99ACA8EA0D724 df:h!
221,561,832 *154CBDB945A4DB88DB61AC77EBEFA708E2B7C8E2 5maailmancupturnaus
221,561,833 *15457692EEEBBCBAD71369B4F25CAF7E8FE03059 DILATORINE$$
221,561,834 *15401D1FDFC83206BBF52FAF0D7D4BB20BCF7232 5NAJIBSW
221,561,835 *1544EA6626DA827CE8F3C4C5C3BC40C9615FA883 [email protected]
221,561,836 *1545308803FB7F260413E6B108CCC2AEF8AA6761 DIRTY.CALYPSO
221,561,837 *154FFD8EB328FE274DBD29CFBE411AAB63CF86B8 5RASTAJAH
221,561,838 *154F50B26A117D8FD38A132EAFFE1758F2EA2377 5RESLANGEBID
221,561,839 *154AE998D7F0DC580941D4233B6ECFDCB73726DB 5SAMOSTATNOU
221,561,840 *1549A46D69841ECE23C83F2547DE39919A68E8AB 5SCESTOVAL
221,561,841 *1546E7ABB81A0F6B76B4C6D1A9EC231444AA9938 5SENSATAS
221,561,842 *15474449CF66D028B688F7A81DCEE4A8781A4DB9 D!&IW
221,561,843 *154CBF32574E6EDCC8C8F8B45EB6356C18E390B3 5TRASCOLORI
221,561,844 *1544F7B927FA57F022487A08BE83A44958646201 dlmf
221,561,845 *154F7FBD2081623F04F6E7284641250938218941 DOGGYSTYLEE362
221,561,846 *154140310EA18CCF331E84E7E07D1D4BF47E75A2 DOGHORNS2
221,561,847 *1544A3C95C941D9D001BC16F30535F5F3EBFC44C 6BOUTELLS
221,561,848 *1546C445027A4ADB19CE6DC48078280FFDE911C8 6BSWFLAKSBSW
221,561,849 *15458B0FE64FAA201C2553DBC92C7737537A887F dominiquenotice
221,561,850 *1541EE6721C1C92F134CB77FE7779B3E51006D41 DOMPU
221,561,851 *1540FE31F205D3D9FFF4AAA6E0158604D035F1D4 DONNELL.PAGLIARO
221,561,852 *154A61A93911AF428B07B76FA36D8C4F37C085DA DONQUIOTE
221,561,853 *15422366351F2723DA225798F154B73D73F79442 6INDARDAI
221,561,854 *15421786AB505F38D4D74FB29AB26515382CD7C2 6KITATAKA
221,561,855 *154D9B9797BA65E2A5B8828F84D8A503482239B6 d-pa1
221,561,856 *1541723054862747D475F8835926452A052A801A DPBP#
221,561,857 *154FAC16BF35CA6A2E16815EC98CE1224BDB2921 D/QD
221,561,858 *1548319DB2718E39084BD115E840501CF836C1B5 dr$0e
221,561,859 *154D5166EC1EC547CC88DE3371837169F8B0FCE9 6UNFUNNINESSES
221,561,860 *154EA0220CDD2968D34ECEF7548FFB5EC8EE7986 dres
221,561,861 *154CD44D1C6600000C126E896C9C9B0BA65D1A9A dsozy
221,561,862 *154F0C0579DDDE2F2F74B3731557ADCC6DA683BC 7EEYORETOPCAT
221,561,863 *1540FAB8DFC9F289D18602CAE45C9334D40C52C3 DULCZEC0
221,561,864 *1545C7906B2041BD827FC47D42FEFE01B449C7F3 7microcytosis
221,561,865 *154051978E86FE73CC62A92A0C3821B9BC6A26A4 7NR5
221,561,866 *1546B0B1B81C11C00668EC47FC42F46F6FDE9EBB DWUFM
221,561,867 *154E27D287A35CF89EA3FE2944BDA73EE97E3E62 E87D
221,561,868 *15472C58A047CBE6A730090F1E1DAF9A4AC7A25F 7SUPPETERNINGEN
221,561,869 *15465B80E6379709FDC17E19DD75C216F6300527 7TERMLESSLIES
221,561,870 *154837D323CD7C934261712F2A4300C881BDC3EC EASYAUTOSALESCOM
221,561,871 *15458DDAF0E6ED5CFCCFB2839D0BF5946669E5C2 EATK
221,561,872 *1543011712F65FB1CE16D2B1E34EF301AB82A8F1 echo--a-8**-1nick-info-v10
221,561,873 *154E17CD2D274FE75DA99E30465506BBBD7EBB87 8##B ~ ~ ~3B<
221,561,874 *15444CD75B80823DC170DEF2BEABA9BD2117EE6A EDMUNDO.DINSMOOR
221,561,875 *154248DDC9B3C2F59133750178CA1FA41C81A8BA 8DNAMEDREPUS
221,561,876 *1540AC3583C07BD69B395955E7BB381FEB626A4F 8======d-~splat
221,561,877 *15426B0F0DAB4F5E331F536DDCC62BD93E22998B EGD,8
221,561,878 *15484F117352EAA0BBF9D039619474753EE0D92D 8KAPINVER
221,561,879 *15479A89F9D7C2556589005B025B87F953F33A7F eimreh-1
221,561,880 *1547A13E45E80691BDA0A639CB1A0473C6256755 8ONTRUSTS
221,561,881 *154BD06E675F2F08B0775072414650D920E5FAA9 EKZEMË
221,561,882 *154B563EDDF453F99EDF55ABA6EC0642693D19B1 EKZISTOKAPABLO
221,561,883 *154892FC33AC513A6DBC75A80C9226751EB1B682 eldridgezelinski
221,561,884 *15461493EBF95A8B81DA5EDDA8327EC3E4E4288F elishageerdes
221,561,885 *154EB6AD3EDB55E9D4B76C5B823BE7F3AB90B09A elmertravino
221,561,886 *154044BC68BF451FC3F899A6E6E11095F8884859 elwoodpacior
221,561,887 *1540B1A40B5A556FA6EE697AC2EAD841878D50B9 elwoodtrew
221,561,888 *154CBF7035428E225ACB183742207BA6ECFCFC72 8SCHAEDLERBSW
221,561,889 *154038700F096238699A2CF981F9C69F08EDBBBD EMANUELGREENUP
221,561,890 *15447269A9CA6CCAA172400BBEF6ECC4A903FD9C 8>* * splat!!
221,561,891 *1547BAC201DF10DB54708620DCE96309C4852F19 EMPFANDSTS
221,561,892 *154B49CA659DDE1A581CA421D867824FA19083AC emtva
221,561,893 *154EF2E20D3D4134908D3D661CAC54F49687821D 8XKAKQRQYKTGD
221,561,894 *15405135F0901A22511D5F05984D123B2920FC65 90.ASUNNOISTA
221,561,895 *154081F70EFFABD3B98139DB36B70E3FE8372E5D EN82.79.77.58X2
221,561,896 *154241B1FD696A26F3C9193CB06D4D3B00BF195E 923amina
221,561,897 *15410F86C30C0DCE1E5765A46247125D277985FE endofcampaign
221,561,898 *1546C57FA22A64B6D876DDE9B1EE4F785E95DAB7 enforcible!
221,561,899 *15483369F99158DDFC5BE8ECF157F5878FEC74DA 9ASSRASSR
221,561,900 *154A05BBB8370ACD9FEAA6912403412EAB7DDE76 ep:bp
221,561,901 *1541E8DFFEFD9B138DFFCFF7A44AC577DDF2D825 9HARHAILLESSAA
221,561,902 *154935CDA50AFE1CD772EB971F5B6129628EA4CC ERICREGO
221,561,903 *154BC5A9D240FF4D6F9F3405B69815A717324A22 9LREVPLUH
221,561,904 *154A2555F5C4700507A71B36513523A2E770253E 9MATHMARSHAL
221,561,905 *1549250CE9D2181EE9BD4A35E3D9A437080F8939 9myjensen1
221,561,906 *15496E1200EB21259F69F262AC588D26CE094CE0 et#un
221,561,907 *1549430B30C3B738A4A0D5EA740C65F2AC21D051 EUK
221,561,908 *154B3DD91B221B1C25CA9AE6E0EBD0FEB4207DDC everettthibeau
221,561,909 *154605DBD5653AC5BE821B84ADBD140F71CB0C7D a0p,a
221,561,910 *1544E37F6955F07961A82B40B7E348D241D8A804 A9BTN
221,561,911 *15498CB1AFA36384DAFAC5D809B9912D5241D0EA AABW2L
221,561,912 *154CECB83FC3D14A9BCBC8591AEB22D63E7A577F AAFJ-"
221,561,913 *154044C407EEBDBE14308687BA2616DD2A56612F aav\d
221,561,914 *15473A3837A819388150A64ECFAF187A47C347F5 filmreviewphilipfrench
221,561,915 *1547D02DE71027C9CF794C181DB13A57515B3AE9 abesherif
221,561,916 *154DDEA6FC46D68A2DE387374DAF5442AA349F4A [email protected]
221,561,917 *1541852061BD200F2E3D3D58D2C00721734323DB FL45HIE57
221,561,918 *1549B50FCB482C6895C3A179393D7D3A5C4DDF33 FLECKFIEBER
221,561,919 *154B3C3C9EB8E9540ED2C94758666D1BCECD9223 ac7e3
221,561,920 *154DCA76D17C4856CA6B7F937BDCE10F31EB3DD5 ACLP?
221,561,921 *1544C361122DD75D0FE77A7394815D2CAF4A8384 ADAKSLEXA
221,561,922 *15435849590667323F0C98D83C6F282F4993E0C2 ADGRO
221,561,923 *154020FF116F5F504080E80B9632156E59FEC9E8 FOSTER.HARLSTON
221,561,924 *1540059E465B5DE937A68BF0B3A989A2ACD9499A fostertacderen
221,561,925 *15469B830D84F285FE6AFE15441B232973C93210 FOURCHEREZ
221,561,926 *154ED9798F6A144837DF249C8173A5333E850EEA [email protected]
221,561,927 *15449A399942ABF47BFDCE382ED46574645E398B FRANCISCOPUHL
221,561,928 *1549D165A50FA543A5D1FA26B9085759B21D86F2 frankiejuariqui
221,561,929 *154C1AD05056511427B81CF198612974FA3A005C FRANKIE.PICHON
221,561,930 *154283ED2D2AB65585D2A8C7245D3C8AF825FE95 FRANKLYNLABAN
221,561,931 *154D5E9A32C6DE780505F274EB058DE54A8CBF22 AEI;T
221,561,932 *154B8B7051C98FBC20EBFA13A47DB8F065A36BCA freemanfowler
221,561,933 *1544331E3AF2EA64ADDB654F4651B92ECFE91FD2 FREGIASTING
221,561,934 *15417E2A54A631E0118323BB75E2E30B03E74FEA affectionn
221,561,935 *154D48770B9C21CC0CB61619C9CA6C229B926A62 FSX
221,561,936 *154B0253296EEAF4338450550F632684875D4483 [email protected]
221,561,937 *154BB10ABF4F77461DC40E136AFFBBDF0673A55E A&HD8
221,561,938 *1547DD7F0699A17C95415D655A1016C5A0FEC934 A-HIGHER-DIMENSION
221,561,939 *154ABCB93DBCAEEF8C7BF8A9A6CA49CFD01FB175 AHMADLOCKWOOD
221,561,940 *154FCD98917235C2E1F8613AB63C3DB0EDA78F86 GabrielleBonheur
221,561,941 *154ED42A5757F875DA680675793EF35B1DEDDBB1 AIFELICITABA
221,561,942 *154FFAB3962A2EA196D07B17474240615276D3A8 A$J8V
221,561,943 *154DABBBABC9ED467589D10DE1DBC3DDEDA4D396 [email protected]
221,561,944 *154C5B5B2B4854F4372C873EC1A044D1DC7E5FF1 geraldoschiermeier
221,561,945 *154483014FEF9797FCA7423AC7611215978B1035 ALEX.WOLFENSPERGER
221,561,946 *1541FD76332334F88EA8AFE0AF16731B8F240AFC getemptytag
221,561,947 *154BD58A16F3860CADC9AB86BA65895D07D6AE70 GETTIN:HIGHINTHEMORNING
221,561,948 *15445DBF00083E724A5D33C733C343700C48D492 [email protected]
221,561,949 *154280E21AB0AC969432345E130ABA76AB19F695 GLAMGALL
221,561,950 *1545CF35EBBC9D66CA68F9DB3171CC3A0A7F8D59 ALTON.DEVAUX
221,561,951 *1548EC4B73DF0BC2623E6972508B263396018563 ALWAYSUSESTANDARDTIME)
221,561,952 *15489FA00868F6FC37C808EC275898802E0BEC4C [email protected]
221,561,953 *15473077156C19D78203F7D22462CBA1B72C1A75 GORDON.LOTHROP
221,561,954 *154997D625544563A260106136C49F3F8329E243 AMNCU
221,561,955 *15471BCB5351853BFA26B32038A0EB02334DC7B0 [email protected]
221,561,956 *1545B942B4340DA403A9CF9F68AF799C1B606B17 [email protected]
221,561,957 *154EABAB47E7F9129D150CDFA537F86A81459055 an-hi
221,561,958 *154D94ED47A08283E1580EAC73BBFD45BBA38148 ANIBALQUIRINO
221,561,959 *1546E33D855EA02EBE22EF4A7E7AD8C638E8B81C [email protected]
221,561,960 *154AA069E60A12786E69B5777EB8EFB44F15EC26 groodat6
221,561,961 *15417153A9D3DD6003E59EDFA9348E705D3133EF anne-korhonen
221,561,962 *154E76993BE966CAE58119EADA2D87EE97D8818F [email protected]
221,561,963 *154A7C81A3B24A767C6524723EB9963D3677B4FD ANTYSTROFACH
221,561,964 *154D44A97BCE80572FAFC9C6A2D3A6D523DAA999 [email protected]
221,561,965 *154B3E212A1ED111F349BD5B2A2CC288CA0EDAB3 A.o0
221,561,966 *154A5C1D68642BBAB262EBF7BBF22D93C4CBFB9E approdo-sulle-coste-della-libia
221,561,967 *15493DF62D767E4C826D0F4F326F995D5D6A2343 AQCJS
221,561,968 *154661E3E6BDC9752DD0E50B3385821EEC41491A HAROLD.DUMAG
221,561,969 *1542E932D872E7F836C8A26F68B65A4DC8531388 haskotigger
221,561,970 *15473410FFAD5DAC211B95B646B281CF106E1C1D ARBAA
221,561,971 *154FC29A508C00AAE870A19A6783B2E479096BF8 arifbudiarto
221,561,972 *154F67F9ACAD812F0351EB60AE2701CC31AF3F92 ARMFIELDALTON
221,561,973 *15474E6E62247E201A1E28A4EF883FCDC73ED40E ARNULFO.REMOS
221,561,974 *1541C5631B6C0697E123D9B782C0989272B5166B HEOITITIIB
221,561,975 *154F2626AA28F5CEABE94D1288FCD6C14E4D4C96 arrangement.and.is.ready.to.do.so...apparently.at.least.half.of
221,561,976 *1546AB1DFDACCF058463E562F871986721E66127 HERBBEHRENS
221,561,977 *1549EFE1B22C4C23A7BE89E4DA5E441AD7B75A84 HERIBERTO.MANZANARES
221,561,978 *154367A1786355FF8EDE2D9D0B5CB4CD908083E6 heribertopiper
221,561,979 *154A3639D3F25BE0E7DE8FE4A755ECEFEDB1B1A1 HERMANSIPLA
221,561,980 *1544449F0E5E59CED2B94CED788673DA8A6713E8 äru
221,561,981 *1541FFCB06713F0DAF9853BB27D96DB7794DCBF2 asgi
221,561,982 *1541BDD245A56B7A9DBBEE74F6E133E6EF98E5D6 ATH;H
221,561,983 *1540C9D3F142C84A79BB6FD18B0CCDF19F37ACF9 auqt6
221,561,984 *15492C8AB44FD3BB2807D935DECE2762DF88FCE1 a_)v
221,561,985 *1549FF12D3E6DEAE5990ED2CCD4ECC1705D7C461 b1.e
221,561,986 *15453D281F8D34330B693D2962A1DB952C76CCB4 [email protected]
221,561,987 *154375F2EAB191DAADBE512A06FB1654B5F3E3DA hzl4
221,561,988 *154F2FCF998BA97E6C9974C0C00D6A02A24973E9 IAMCALIFORNIA68
221,561,989 *154857DF4F2E5FD7EEAF0484670141F6F3BD0044 bassethoorn4
221,561,990 *154BD97DF97884C1757EB9A03F84E344D89EBE7A ilovepass04
221,561,991 *1541C33D00C57F508B199912441400C7DCD0FDC4 be)bc
221,561,992 *1540E4E60D5DBE4CC84E173452B6D47766DCB5E8 INTERLUDA.LATINA
221,561,993 *15494566534A51BBA7CE51CA855C26A3A62DA096 BERNARDOBLECHINGER
221,561,994 *154854F5AB38B3F1F3725CC6322CA80FC6A33AD7 BERNJÁK
221,561,995 *1548E99D76C23F6FD2F7AB91942511A55DBCBC20 bevochtigden
221,561,996 *1547A9492CB18C381A47353269FD4D6D47D02910 ISMAELBRUYERE
221,561,997 *1543BE29DD338BE1C5EABC2A7D3FADF0F5510174 BFPd
221,561,998 *15407CA6072C1C0DDDC49FA01F943F80C3BF6086 bhks
221,561,999 *15417172540E2F5D96F76A5E10087816C3A8D746 JACINTOPIONTEK
221,562,000 *154E5C55E9D247F84CCE8B874FD8CE0BCB1E5FA8 BIJBOUWE0
221,562,001 *154A7AB45FB08EEB1663F35E5B0183C2A2E9A8D6 BILLY.RELPH
221,562,002 *15419776CA381AD880A35F38B85DCA785646D8E9 BIOSYNTHESIS
221,562,003 *1544B6207C0802FCDB467E63C131FF6AB0081205 JARED.BIVONA
221,562,004 *154556E0A065D9DD5724CD88ED0E1429DEC1A9B1 BL00DL!N3$
221,562,005 *1547E8EE28EFAE7210895A9E453A8FC1048C9706 [email protected]
221,562,006 *1547E4CC85B64D521EC55B7746121EF1A3C5FE67 b#ldh
221,562,007 *1545B563F545CB938AC317F1A3040F350876CB5E BLUEJACKETCREWED
221,562,008 *15475A60B31B72D00EFD0A0E8E2DCA422508BFB1 bm0wt
221,562,009 *154AD2704BBAE423208612D1D948FC66BE8BA6D4 JEREMIAHMASSARD
221,562,010 *154436BE5788A88418A15117699B9C2177B55F76 JEROME.AHRENDS
221,562,011 *1549231DA60C0392CCE46FA97534B3056C3EF562 jeromecochis
221,562,012 *154013BFD5CF79BA145A4DE33A12C91512794CD3 jerrygonalez
221,562,013 *154A752C43DB418C30EE25A3EBF697F6A1B24FC8 b/oU/rdpaperbound-'p/eI/p/@/r
221,562,014 *154F99035697BD0A127866112976A2DC8CF0065B jessica-ann-bryant
221,562,015 *1547726177FF30F1B46E5302839B56AECF6A1F5F [email protected]
221,562,016 *1542D15FD5CAE595FE908EF271058F40B73B52B3 jessicanadeau
221,562,017 *154C3D5156364ABE42833D663907456EED48FD84 JE VOUDRAIS UN MARI (VERSION INSTRUMENTALE)
221,562,018 *15486B9F83C6F080D8D29F34B240343CF647B7E2 B====P * * *:P
221,562,019 *1543AF0496C1C20A73CEEE3715DAF0A443D1348C JIMHAUSFELD
221,562,020 *154E8E0F37BB0E7B7E6C20451F81C5C60A0FF2EE BRANDEBOUGEOIS
221,562,021 *154435B468C86779006FCF850B05A52B8EB8C805 BRANT.GREGORIO
221,562,022 *15469C53E3866C4ECF3A25B9083CEE865B33F0F6 Brass.Eye.(Reso.remix)
221,562,023 *154D7131CFC9B4BBF9951AD33C7E07DB2C471E08 bravoklasse
221,562,024 *1541479628E9C746D6701E7549DC883721F0B2B5 BRENDANANITOK
221,562,025 *154F13289FD57316E3A11A059AF0770A9556E69E jobiiboj4
221,562,026 *154D7B9B8DE3AD7D43EB87759547797D6EACBE57 joesphnigg
221,562,027 *154F28A2DEE78BA18504FE66AC55B0CDDB2F84C6 johnguilbert
221,562,028 *1544C586A4353004EC8FE2BED822BDDA928AAB77 JOMMELLI8
221,562,029 *1542CDA3B0F34BAA8E71473D9D490C22AD7A7A70 jondronko
221,562,030 *1546DD7EA9C5466FF310F340EBBB6FAA7D655A8D [email protected]
221,562,031 *154733B367C7A4FCF4C145CCFDAE3A80B97E3805 BRIDGET867
221,562,032 *1545E2E44A0130B6B51BDCFE5FA4878CAB186B8B [email protected]
221,562,033 *15424EA964B1B8B6AEBF853B8F4080C147A87557 JOSEPHKRUSEMARK
221,562,034 *1545AD7EAD0C8FD58FD7B5ACECFF74B6C47C98C7 JOSHUA.SCHWEISS
221,562,035 *1540CA2714266A32072C2ECBA7F92F06F963A37F bruremarsj.etter.sigfred
221,562,036 *154338DC6A1947474BFC57ABA6F8541A7193E909 BRYLLUPET.P
221,562,037 *154FA989945E1BEBC3A6F62235A6CBFA8CFBE9C6 ju571f1ca710n5
221,562,038 *154E1BA259A7E48F850E47D48C8838D3BF767D85 bszpb
221,562,039 *1543E008765224E7AC2A9AB7656CE74E8503DE6F JULI.SINGH
221,562,040 *154CCD7F8D57781EA917EAD26D187C2C2ACC61F3 [email protected]
221,562,041 *154A9F8799B9A7F1FDDCBBF59FB3D7DDD1FC91DC b/%u#
221,562,042 *1543908B503D1F082F22674544FB5B0F7CEBD05A [email protected]
221,562,043 *1549BB3E09AA34E15F2B0EEEA9304DE8DD12E367 BUGGY260970
221,562,044 *1548440FB084ED8063F6421C26E21398C1C0E1B2 BUMCHAT
221,562,045 *154C5C6331E6BCF6A849363ECD57F868D19E9B67 kalle e. andersson
221,562,046 *154F24A7303F3B66E9828BC2BD18EC3264592935 KARTAHADIMADJA
221,562,047 *15492C9767EAC4C01BFC5EB2A85AA983DD4DC772 [email protected]
221,562,048 *154A64E1FC7EA0C808AC5DF9544895A45EA46646 KASHISHVYAS
221,562,049 *1545CE7442F592719EE0E5AA1137656D341A1220 KAUFMOTI9
221,562,050 *1546C1482A8F2617951C2C804BDEBFF3948EE041 KELLY.ARCHAMBAULT
221,562,051 *1547E122A268E1791A0B5056E655E69351B203A7 C7AE
221,562,052 *154B61374B71F63264872FD2E72F01D7282F85BF c&947
221,562,053 *154D0EF92A87CC6E82E7D21DC1A5338AB49EBC28 CA1VS
221,562,054 *15463E571CE8DB1145B3738D3F75D182D213C1CA CALCULATORWORDS
221,562,055 *154F465D4B01FF743D96DAB1C3C76B524030FED5 kimtreloar
221,562,056 *1544B933B745DF0DE0749C6BDC75A1B1D773BB24 KINSMANSHIPPED
221,562,057 *15464B425B58B45889285FF14C86B15F02ABD2CA CARDELLJORDAN
221,562,058 *154AE70722A6FFC280629CCD3E65AA767595BF25 CARLOSMCILWRAITH
221,562,059 *154FA1F707E2507DFAD2A21F7FE6885190E7ACED KITTANE
221,562,060 *1541EE7F2923927C8A5A4A6CFEE6A87917CDFEB0 CARROSSEMOS1234
221,562,061 *154152591F2A129B2C9506BC238EF67FD97B878D koanokoapwot
221,562,062 *15472BF9400EA7E7CD35DB6B61A8278CE833B282 kristoferausland
221,562,063 *154EE30A5067C33AF87503E49A0C2AE241E88330 C;AZV
221,562,064 *1549EB2AAD1BED72429EE0F2B7675E5B331F141D kurtissayler
221,562,065 *154951B9DE5658FF9D16FC1178037D259159E47F CCG(I
221,562,066 *154B8E3C50795F9A34665F12C770C4CCD6D50C56 c/ed(
221,562,067 *1545D5C9C75B6619FB77E44D6FD3744D078ED8D9 LANNYRIGHTER
221,562,068 *154BBAD90E9D1C3C3D7B81784EAFC4DA29633A21 CEYDJ
221,562,069 *154DD38E981B2AEABACAAD8397AD98C5555189DC LCSTNG
221,562,070 *154B21050C2B93CFF54649BCD3E00C9FBB22C44E CHANTICL8
221,562,071 *1542DC0822D56C87208910D00521757086A98879 [email protected]
221,562,072 *15483F222BD5322550F37D6881E5397B77DD9828 CHIPPER63
221,562,073 *154C4270C47F8AB5F539CAADA606442AFA95AA5D LESTER.MUNSINGER
221,562,074 *154D098E68341B6C89F39FCFD917E3C0F2D664DE LETICIA.MONTICALVO
221,562,075 *154BA8A76E1D3151DB2B6BDCA49CD6471ED57EEE chsmkngs
221,562,076 *154D0C9BD8A13E2A938FBA208B9012F92234A42B C=_I)
221,562,077 *1543ACF8316CE1950417E02E0CD199D78FA0700D CLAUDADINOLFI
221,562,078 *154616DE04FF0847DA1497295066A347A4B6D629 CLEMENT.BUVINGHAUSEN
221,562,079 *154206572D01618A62E788E1733447867E076E44 [email protected]
221,562,080 *15485433E27788C482948E82B5E1C727DC6C3CAF lightwood
221,562,081 *1543ECE8B3E443AAEDE49F625479C095001914B6 [email protected]
221,562,082 *15461ADECAF17265A2CC67B3A7B84B3A90BBF5F8 C;=LH
221,562,083 *1546F4F7C81DDC35D108065AEDFDE9B1363AA8C3 CLICKSOR_LAYER_AD_TEXT_COLOR
221,562,084 *154B1B23C36BA8224A90BCE61B42E81A6DD48D63 CLLCTBLS0
221,562,085 *154BBDEEC38A9574FEDF275F4496EC9D6344119B LINDSEYTHAM
221,562,086 *15464DF61F4E5FE3B030456907D4A35FEC24750E cmadp
221,562,087 *1542D1CCA97437E48AC14E8B2739ECE89C10CE17 CNL=B
221,562,088 *1546AA3622936F8851BB8D6A65844BEDF7914735 ljosjik
221,562,089 *1545D55230DAD9094CC6D251B330B369ED44F254 Coffee-(2003-Grind)
221,562,090 *15493A1A76B5936BA29B886EDBF32C364BD6A850 COGNITIFS
221,562,091 *154A0BA3153B7EA5507B1A304DFF6C81B5ECF9B7 COLEMANROWOLD
221,562,092 *154876D1FD76AA077448D29890BEE7BBA6564906 longestfanged
221,562,093 *154DBD3006982F0B9E0FA1020AEA94EAF61B9635 colportage
221,562,094 *1544C18135344A2FA849B858CD617AB3E5F403B8 concevrait4
221,562,095 *154582CE0F2C8BF6E54125906ADE657512738C94 L/$U
221,562,096 *154657B19FDB81EB6814993F632C35F7923C6881 LUCIEN.GILDORE
221,562,097 *15408EA6B1B8B596D244E9757C839584CEBEC33B congedier7
221,562,098 *1542A26639E944B35C4AB41A51C585217535025A CONSERVATISING1
221,562,099 *1548A1BA0652FC7C7E858C924C46EE101FD7CEA5 CORDELLNORKAITIS
221,562,100 *154EBA97F02A81E33C8654E3EEF5650CEC9165D6 luvbekki113
221,562,101 *1545CC09FDA6E88C8A8B875E028FB3FD1649AED0 cppiq
221,562,102 *154D9D9FECC7F4E4793C168E8A507B046648622C MALIK.SORVIG
221,562,103 *154141E1B9D6F46292D95F44EE6AEE52232ED807 MAMANMOMON
221,562,104 *154E4B9AEE4554F0981B7645000B58EAF5B28FC4 CRISTOPHER.ALHAMEED
221,562,105 *15481F74641C1776488067FD0CB886E347D588B8 CR&,M
221,562,106 *154E770CDEA74D29BB49344DC347EE4022BC2D24 marcossegroves
221,562,107 *15406E4AD346A90982B983B643FE104DB85CBC1F MARCUSNORMANDEAU
221,562,108 *1546BD2FA449B57CA8DF49ED69F78F57AE5F4DE8 csa"/
221,562,109 *154279BCFE2F2718BE2E9602A4A0FA02DDCD6D5D MARIANO.OAKEY
221,562,110 *1541EFC03FED77A851ACDCE92132BF18BDF403EB MARKZITOJOINSSHOVIOCOMLINEUP
221,562,111 *15460EBA6674E91249FBB2305C00279BFD45135A cuttingremark
221,562,112 *1543593D803001D2A73FD1DC49269F2A061B11BB marypappalardo
221,562,113 *1549CA6CF587F1E8908EBE7798C42AB046ED32B6 cy%oq
221,562,114 *154DEC260FE4F472D467ADC33DE8645EF75031D8 [email protected]
221,562,115 *154D269F4C0B5178F67B93FF87A4D1E9B19E3CDC d2/d+
221,562,116 *15438616283C4ACEE133B8B1BDCD8E4568AA8C2C D2LIW
221,562,117 *154AEB2080FD3C4EBCBA99C12815A88440A17B2A D3NAB1Y
221,562,118 *15448313DE911DFDA508BA750C57EA66699669AE D3V45T3R41T
221,562,119 *154EDAB3DE3D1DC4A69165D6294AF08A32CBB253 MAZURKA,OP59NO1INAMINOR
221,562,120 *1540D50B57DEB693A7D19D23D33CD800B4F88424 D5OTH
221,562,121 *154504F9ACF8442E0BA400F50AD3AFD3AB84AC50 DADP
221,562,122 *1542961D8686D1EA13B2F619F42AE70BB69C2A9D Meieaknad
221,562,123 *1549E2E5664C751D151E3CC2AEAD7A99A7084620 michael-justin
221,562,124 *154F9F592A4716F79AD6BE99874620FF49BBE5E4 DAVIDMORT1
221,562,125 *154F1AF21646EFE9306975AEA1D9EEF9EE5BF6E6 michalplaxco
221,562,126 *154DACE8DD7D3CEA04B061D8FE7D9CC78ADE29FA DA&WL
221,562,127 *154C8954695565C4188C9EAC121E744810EE001A MINDAREGONDOLA
221,562,128 *1544A2DE916D880BA2F3BE31C496CEA1171B1BBF [email protected]
221,562,129 *1545AFF53614AA047F00559C3992EF47BD038E9E MKACHALON
221,562,130 *154323FABA8A2C8E482372C825E5244612977C47 MKGOD
221,562,131 *154A791126DB689EF3C18C0A13B9E22E983F2688 MKIRPATRICK
221,562,132 *15476E56D3053612161C388A49CF9E52B933CB72 MŁODSZA
221,562,133 *154065CBF187CD520814A655A0E5907C13AC86FA DENGTEFA
221,562,134 *15479130DE59F38A01A82988B52ACCF635941B5E DENIS LACOURSE
221,562,135 *154B8D489C7916D4A4964EAB59EC702F7B1476E0 MONORASIAL
221,562,136 *15418A33AA8176C585B47EBD9DE878F2CE85E97C deongailliard
221,562,137 *154C98827F1FE27B789F69AB6A7B78CFA40C670D [email protected]
221,562,138 *1540B5DACAC06CB9DDBFDAA68FC5AF627DF32BA0 MORNINGKISSES
221,562,139 *15457EE9D19547055228DE1DD6A1B71752EB5571 MOVEMENTS-(ALPHA-CENTAURI)
221,562,140 *1541FB222E3ADE452323777CB10DFCCD12563A21 devinbritton
221,562,141 *1541772629EF3C4D6567C162871EEA89F82FDBD5 DGO1V
221,562,142 *154F67D8B9EC35C9A72B959E3ABEB9DE6C544B82 MY-UNCLE
221,562,143 *154F10B493DAF4E9D33384D890012A175DAFFEF7 DION.ROSSER
221,562,144 *154C23BA1DAF6A333C552D3764DEF0F708157146 NAKAMA1AUDIOPROGRAM(DISC3)
221,562,145 *154BD486115B6A3D59EB56F9F5AE3393023DA919 NATIONAL-COMPANY-FOR-TRADE-AND-CONTRACTING-|-SAUDI-ARABIA
221,562,146 *154E8475707235320EF884A0EA4D22A32DE825EA NATOENHO7
221,562,147 *15475A7411BA32BFC4EB672F1E17F837644DDA20 DLAUMAN
221,562,148 *15456C83AED4AB50AE6A02970C4D4B351CC43585 NEILKJELLBERG
221,562,149 *154ED07A102953D3BFF98409C2AF907A0B4EE5B7 neil.sidwell
221,562,150 *154F20DE0CE4FC0F17776943ACDB768B850CB572 DMDLTNS8
221,562,151 *15463202B0209B88E7BC8F16800AF49D1D3307BC NIU8877
221,562,152 *154D2BA728D4CBA5647E12DE902B73BF8789E74A [email protected]
221,562,153 *15402397130EF64161467B0CC0C010317375FF8A [email protected]
221,562,154 *154D393A502ABF5EA80E42A147B0484F15D56882 DOBLED6
221,562,155 *15495B14EF5CC1E6F151895B5A8D17A2F5F715C2 DOE.NIET.ZO.ROTTIG
221,562,156 *1548CFCF118B033D06E45C1483BB88CEBE49B55E domingosieczka
221,562,157 *1549B26B14864E56DDD5534ACA8403ED9C1F6279 none$$en+!al
221,562,158 *1548C317470F1223D5CA64C797E93287D69140C7 NORÉS
221,562,159 *154C99EA1C8C940D999D3607881A52C18A8392EA DONNYHAGOOD
221,562,160 *154AAD0891F85F3330A9C29621C73AAF0ABEA885 Don't-Cry,-Fight
221,562,161 *154F2CE00E4EC7DDD91E8B69B0EA0195385A71C4 DOPICK
221,562,162 *1540C17CD0D448D1E7C339466F994BEF203CB8F4 NOVA.LE.GRAND.MIX.(DISC.18)
221,562,163 *154D0AC15CE62F7A1B6691F8E0F0BA2961DE3E65 [email protected]
221,562,164 *1544B78B3420C237FA036DB0497154A748F1ADC6 nuibailct
221,562,165 *154E6A3C9780AF225CACCB2242D30FE04C1FB977 D_P7
221,562,166 *1540716CD3E39C927017462A2DE2D1A11B225100 odyle56426tkm
221,562,167 *1544CE1BBF2EB7174BE6C2A6F42548E727D15C42 OMARI-ALSTON
221,562,168 *154B1A4FD7775D0FA9DA31D9515A420CDCC55C86 dudleydench
221,562,169 *154E72A294C12BC0418B79B3FFE58006D0568991 ONNMMCN
221,562,170 *154E51CE097138582DA4C064C5599A0643977F76 (~_^)-o~-(####p
221,562,171 *154FD6F0F296E86BB66731B4EBDA31753A2704CB dylantijing
221,562,172 *154F44CCD2FA7F0987DAF2D328C273EBD71CBEA2 DZks
221,562,173 *154E67D9D35C8F0AB6816433F5EAA90465B14AFE ecc)
221,562,174 *15473B062D513942A7B37E89B6DF0C88634902E3 EDGARDOMCRIGHT
221,562,175 *15459D593304F018389D674F4646C6E4E4163DBD pakistan23
221,562,176 *15441194F8F545DD842A780BA30A0E2565670B33 [email protected]
221,562,177 *1549389E9936472CF326F93B930EB550C8749643 EENOBAHS
221,562,178 *1549EBD5CF6FD35ED0E5A369FF3BA18F8D58E0AF EHCUORAF3
221,562,179 *1548A645B09E45E7704A4B35C0F28032C36935D1 pawlista
221,562,180 *15492CEDD5783F05425A07E34668BA86B20347B4 PEDROKOPINSKI
221,562,181 *15488D651B15D4ABE153DACE57036859EEBB7D9F PEDSATE6
221,562,182 *154ACF83B932845D68C166D89A4670E3C588EF3A elngted
221,562,183 *1545ACA7E8EBFCDBB52268E0CD0102EFDA136CD3 ELOY.BAKKALA
221,562,184 *154E766B0F44BAD2D2216E133876F5BCEA6C9A85 ELVALLEDELESPIRITUSANTO
221,562,185 *15415874DDE10059FC9D0F7CC4B54C1CE17730B5 EMACHINE21
221,562,186 *154DD3792F431DF909E55F2C3B2621D5ED90520D PGLITIQUE
221,562,187 *154D1AB1E05C361E29008B80313B52F22B6A0B07 encryption eh0 n k r ih1 p sh ah0 n
221,562,188 *1547C5256D549010D0693ABFAE68875001E98853 ENSYMBIONESE
221,562,189 *1540AC4F6ACD23493AA5ABA32EFAC70AB6A28F6A EOHX
221,562,190 *15471ADC783B24DA90B485576CC14FE08E9B799E PLACKITT
221,562,191 *15412F4B2AC5E86E2BBC17793912C915854B3CE0 [email protected]
221,562,192 *154AE78B2675C5C7BE9C5BC5E18B441C7C2F7AE6 [email protected]~}O{
221,562,193 *154E500794B8867F71A2863CBC285A0034242E85 ERROL.CARTRIGHT
221,562,194 *154AAA0C96A6A216FDA405AA68DB584B752D3F52 [email protected]
221,562,195 *1545F017BC0DE4BE4A9379F0F13496D714422330 popssduaa6osmvag
221,562,196 *154225191CFD9D214747762E87940131F1EF5EE7 powerofpurpose
221,562,197 *154BECDC7C1A067370F969D1802FC263CE6C47FF ETSEFKNA8
221,562,198 *154285753A42A6FF915AEBB5C7157EC01C0D9BD2 PRAZNI1
221,562,199 *154011E9410E8B4523AF7BF97198F84DE2969F1B prelude.(metier.remix)
221,562,200 *154825E4866784BD9843768F1D9A3283E6A91935 PRINSESMARIEDERNEDERLANDEN
221,562,201 *154DF715949411E727746FC8792086BCD64CC66A f4c77ou5
221,562,202 *154EF57FF912ADDEBECE9F0DB2752FB2EB910849 PWSTEALLDPINCH.D
221,562,203 *154CF2F43E6DE53782EB378824D84E7BD62FFB66 [email protected]
221,562,204 *15424445126B01B977F2CC3B7EEF33F6690DC88F pозенкранц
221,562,205 *154ED6112C50EA4B9D1E2A5F6000FC3D9DF87062 FELIX.SEPER
221,562,206 *1548819076D0B4344A8CF411EC5753072985C9FC (><)~ ~ ~q===B
221,562,207 *154423F99276944714C614583F9086254959FAB0 q=B~0.Sploit
221,562,208 *154533793F1951785A7AA2BC3DA37EDD1582E907 q=====b~o-:p
221,562,209 *154987D86A65282AD96232EDB66B6C42FBA477C3 FERNANDOSWANIGAN
221,562,210 *1549BAC5E577AA561F58E2789177A8D061B30AD9 FEW2233
221,562,211 *154664B516434E24C41CE86E4680329BED8B4E51 FLETCHER.ANNESE
221,562,212 *15483CE67CA3EF3C04035FB851648AAC5BBEC2DC QUINTIN.ROSOFF
221,562,213 *154BA33430D89440CA266786C66D9E781C89F5D8 r0ya1+135
221,562,214 *15473E84AB0CFA3ED6A5ACBC341EA4569A6708CD FLÖßERBUCH
221,562,215 *15402D9A9A5A618471F1309E795F0465F26755A1 foxrod
221,562,216 *15463F6DE2B7F1C6F2E264379BB5E37187C16512 Fram3-wor
221,562,217 *154FE2481269D8033725036DFCA3706CE871E56D RAYMUNDORATKOVICH
221,562,218 *15498D3D18537F3150727A5C2077BFB64A70B9C5 frank-baeza
221,562,219 *154DBECD7574D45E3F5BB4F779E878A57042A4B8 RE4PPOR71ON1NG
221,562,220 *154EB09AB9CBF319D9D99CBFC719DC24075EC9FE FREDDYBAIRAM
221,562,221 *154AF67D9F9B32F07A043CED0D9E8FB22E188E51 FREDRICK.MATTINGLEY
221,562,222 *154BA8F74E5EA5BF2FDB7E3914D6772C81C3EB10 fredrickmclee
221,562,223 *154B18777AB69187673739F6059FBC8AE8AC095F fricheront7
221,562,224 *1544C8EF7626D8347735FCBFEF9271B32E2EE2E2 FROESY
221,562,225 *1549AB2EFB9BD7E83CCEAB4C289C16197C4BEFF8 reidghan
221,562,226 *1546E8391719E27340FF0246298AAD2805C7804D REKJILRUUTANNEGET2
221,562,227 *154FCFFC79E1BBC2B268BC6C68C034C1707FF673 rembrunit5
221,562,228 *1544504EC04A5698365AD1CD65B036E3B57C39F0 renatohildebrand
221,562,229 *154EF586F3EDAE0007E5E88A29F924FF1612FC63 retrospectives-suite---part-7
221,562,230 *1545151C06D1F79975F7ED50486CB7FAC55C5499 REUBENSTERKER
221,562,231 *1545BD4C82B49B8767D207B3B5D6B47DB40E6D63 garlandwurtzel
221,562,232 *1548ED8AC305EDAF490FC190A88EF09BC192A5AD GAZ109
221,562,233 *1543CC4775FDBE84B1EA73F66A0C3F515B180872 RICHARD-KIMBERLEY
221,562,234 *15405CE3729F79F8B390117C432E8DCAF152C435 GEDOPTED
221,562,235 *1546211D678F078CFB1B9A2B5273BBBEE272375F [email protected]
221,562,236 *154DE6CC63F2166C870DB16169CC4CEC8129D3F5 RICORR3NZ4
221,562,237 *154702F1F47407063A0F7322AA9BF9D10B2C192D RIGĖERUNGßBETZÖRREK
221,562,238 *15485C3FEB3AC4757DDE0B025579701CD560B634 [email protected]
221,562,239 *15494C8BF7018B8A4E3E9543D02892BC697F5A1C GEORGIESHOTJOHNNIE
221,562,240 *154C6B2EC7496CA75FE5183A7CFA5F59ED506E37 RODOLFO.HOLLOMON
221,562,241 *154AE26F377437B8C93B625B17328D4B42A69778 rodrickcunnick
221,562,242 *154C167678CB96F9A400E83BF2FE8AA0DEFFF19B ROFECOXIBERYTHRO
221,562,243 *154FAF1D26C1D59AC59942C44425423E218B62EF ROYAL.BROCKNEY
221,562,244 *154FC06AACC7B6CAF58000108BD0B3530556E835 RPD1471N9
221,562,245 *15412B694BDBF54CA5E6CD27C3615DB5DD80B8EE GNIREWGU
221,562,246 *154BE6EBB9EED20A69BB0D923ED1004D2F5E56A1 gnivaewring
221,562,247 *15409EBAEAB7104780E34AE707FFE502F13822A8 GNIXIMRE8
221,562,248 *154EA9547D72D274670B1437D754CDAEE9D96F89 rtrnscrvrnt
221,562,249 *15422E1C023FC298D3F8341A43D91ED7D019E8CD R__X
221,562,250 *15407C03EA8653DBA8AE05F55ED485EC59FADE50 S624123
221,562,251 *1544EEC00792CE9F214D717C8B8DB5472127CFA4 graiglameda
221,562,252 *15412856EDE03D5F3D7B66F7FE65741A18FB843F graigsidwell
221,562,253 *1544F83D2298C748062797431056FACCD93080D6 grammairedesr
221,562,254 *15477323E286AD7E8AD572E9EC5E5E2557FCA26A GREGORY.HANSELMAN
221,562,255 *15469EEEEC5FD4B4D19BB6C97BF1FCDBBCC006F9 GRZEGORZSZCZEPANSKI
221,562,256 *154C1FBD3E7C3C2D295FDE4062ECB547B9700D74 [email protected]
221,562,257 *15432FC598ECE974BABCFFF356ED8B13A23A087A samualloarca
221,562,258 *154A9578C2269F0D9CD15BB986E6A390C6F2BABC SANDIEGO94
221,562,259 *1540EB94E858B76C241714105A12019AB6C2DE98 SARIAHMETLERDEN
221,562,260 *15425D1669686D3604257023BCB8EB7F51F999D4 SATZHELC
221,562,261 *154B17EF36EDA2E88DB42CCD95DF42D4396D8A2C hajjiz
221,562,262 *1543B80976E03715BCA034D2C7732EDF187180C1 HALOOLH
221,562,263 *154EAEC183900C5C82F0D3DE74AA0F85A162FCAB HALSEY2007
221,562,264 *154D6756F60D46BFD1B546961C858415ADD81B77 SCAFFON2
221,562,265 *1543619EC20F89D8957060FDD557426AC33E4677 SCHOLIUMS4
221,562,266 *1541A73AA5A424D1D5200DC6366B2D0317F59143 SCOTTWAGNOR
221,562,267 *1549076489DA7C75399A59572DA6205A90AC3804 HARLANDNOLET
221,562,268 *154FEA273D049ED1EF8873A5F3E4909290D3304C ScottyvsFullGainer
221,562,269 *15443355362D917D88B9E4D8D504CC2150E58EF8 HARRIS.WYNDHAM
221,562,270 *154C89C62E3E409F9383176991F2F5F281951D6A HASSAN.DISKIND
221,562,271 *154AC1D284BA98A8A19ABAF1EE77F16141B691D2 HAYWOOD.SPINKS
221,562,272 *154E85EF97A115F4E4E3628143AB05EE3FEF6774 hcivorie4
221,562,273 *1542DA4FB4859E4DBA844217307B40B231602A39 heathbelongie
221,562,274 *15451D83F3EDC5B6CDF4574415F194B0588ECD94 SEAN.GAHL
221,562,275 *1548C10DD58FE89A20DC93F127C18BC7D39851BC HEBESUN
221,562,276 *154CA32A56718EB731A09EB3D325942981AA5E28 [email protected]
221,562,277 *154BD6D3163D823172B91A7989B2BE67BD71E1FD SELSEONE
221,562,278 *1544EE2C81C1EA9F11C2DE4E5D71AF61D665416D HERMANDUMAINE
221,562,279 *154287A5628EF748B3B1C00DBDF50D5D5AE51134 ”HERNANDO
221,562,280 *154D08F581F0F87E85663936D85FACEC85F324A8 SERIOUSLY.VOICE
221,562,281 *154B6827928963450A51DBD62E1F8B9A48A5F046 SER M
221,562,282 *154D118AC16C855D12AD2D7E2B131EAF60655E11 HIP-R0$E
221,562,283 *154D3187B2AC1E2F7EA5D86B45FA83EAE2F62056 [email protected]
221,562,284 *1544FF1828A1ACB90C3D278F346D94C4822AE200 SHAWN.CENICEROS
221,562,285 *154EB40F435B37A7465093EE70E15CD1C4A2A98F SHAWNLIGHTS
221,562,286 *154087C0C070AFBF286194A4BDD157C6A6573053 SHELBYDUVAL
221,562,287 *1542413B85560DB407E1B3C978E147C6A26E58FE She Wants to Move (feat Common, Mos Def, De La Soul & Q-Tip)
221,562,288 *15444E83173B0FC28C0FCA124A4F0AC394B8AF54 [email protected]
221,562,289 *1542D97925CEA532D8F2A03C38EEEFE1D7791FFE [email protected]
221,562,290 *15450ED2B839807682758FEE93C799FFF7B61DA2 horacioamaya
221,562,291 *1542C5910EBD75EBC098E406EDA1771BC0E7A2F0 SIALONS6
221,562,292 *15481672D843023D079AA40A77B702C1D194BC8B HUSTLER-(FEAT-JABERE)
221,562,293 *15483C18DACFAD4230E2E468779EABD83D3E0498 I92K56
221,562,294 *15473F708E940FA1547BF0C1A365638456831338 IGNACIOHACKFORD
221,562,295 *1540CAAF61489EEA7061E6AA7A63315A828D3E94 ilovebiochem68
221,562,296 *15481C94DA928B4AB120B317014A68121EBF7F1A [email protected]
221,562,297 *154989C332AC82DD2052E3AA1D1A47BC2FAB01AF [email protected]$
221,562,298 *154CD64166C10C2F8BAFED7688A98C0B5745B17C SPERMATIFEROUS.
221,562,299 *1541ECB6454103CF576E47F28FCE735149002DD8 spikex
221,562,300 *15466F85693E13F96160C63CB42035101BFB2E78 INIPECTION
221,562,301 *154FFF57A5C134FFAE2ABB8B2DA2C3642A44CD5F INNAMFOH9
221,562,302 *1548CCD052DEE2B8755EF076B41C16253A4B4565 INTENDSTO3
221,562,303 *15471AE38F983F6A0BFE9CC22FC9C2203CC7E76D INTRYCKT6
221,562,304 *15447199F09AD2DCBA2FA80A68AEC9A3A2B62D63 SSM1
221,562,305 *15459E8B79315858B726E8113D38B276BA5DC18C IRVING.FAVORS
221,562,306 *154117A6BF711E309CE0D1B629DCC562A22D9578 stentammo
221,562,307 *1547095E8B7AE88569436741D1FE47BC2AD92414 STRANGEWORLD(RADIOEDIT)
221,562,308 *15409F2D29E753D2577C5C35ED9CB352A6E56C7C jacobblunt
221,562,309 *154321FA0F0EBA451C40FECEA94D97825EF5C9AD sufficient rights to scan the drives in question to
221,562,310 *154583FFC40FA7F1418BBD1A1AE92111B2CEA7D4 JARED.WITCZAK
221,562,311 *154AED24ED47CB5B4A12EA10875875D24AE8A92B JARIYAMATH
221,562,312 *154FF7C24CF740CA496531BA8CE74E6DB94C6705 JÄRJESTELMÄTOIMITTAJA
221,562,313 *154A0C1BE251BB1545EBBF80AEDA6ED18F4E7F06 [email protected]
221,562,314 *15425A22E6B3319A196D88241BFB6242AFA660B9 SUPERINENDENT
221,562,315 *154D0BB52B6C0D9A3421B43B349BC3D71BE8A3E9 JAYSONLAMPINEN
221,562,316 *15478992457D50927F0EBCEFEFD6E76430D9E514 JEKHAR.CHAIA.DAJE
221,562,317 *15409F768A667BF497A5607EE64597C8144D323A JERALDHILBERT
221,562,318 *1549BE32FAFA47C6C23BBBCF4DEC75F2E13946AE jeramykubicek
221,562,319 *154F8FDC877D1DF305C029C5C121A703C02A4CFE T1H-AC
221,562,320 *154D1882C4F69707738606026341EB78ADDAF5F9 JERROLD.LEMELLE
221,562,321 *154E2FD81C42516F509084A001AF35575FA27AF8 jf9
221,562,322 *154C32C99A6CA802D5184A547719A8D16689CB6B TALKDCTN1
221,562,323 *154B660C2A98CFCE2E457525CD083DFF3514F931 [email protected]
221,562,324 *154F6B5445277DB0B7A234863FD098DB33C27BB7 [email protected]
221,562,325 *154985E3BE6B98B2AAA4B31C956F13DB0DB7AB73 tanya.ahrens
221,562,326 *154452E89605AD0AFC171820F6A694B21FF215A0 JOEBLACK
221,562,327 *154CE90AC3F0234CC8E8F802D4E64682AA3019AF JOETOOMSEN
221,562,328 *154D84E09DA282E046D4F8D63FB14907968D5746 [email protected]
221,562,329 *1545BE7B04FD88E00DFDA683DB23231F5E8C483B TDOULAS
221,562,330 *154B8B5E136FD0B54B82905CB8ACC4BD97BD3584 johnathan-macdonald
221,562,331 *154E56DFC90FD779D122393D1E9ADA2EDAFAAC4A JOHNATHAN.STROEBEL
221,562,332 *1544A58BFC258212544541C54DD92D2969E85972 TEAFORTWO(NO,NO,NANETTE)
221,562,333 *15478342BE2D653B7F914FE9220ED95B199B72DC tempestivo
221,562,334 *1548155B7D788269381A32F7B16C0984BC2ED379 TESTTASK2
221,562,335 *15492808DE67A80D74BCD7B987910BD4BDBCFBCA thatBeaner
221,562,336 *15444129E7C624FF0CD3EA099AB3457143E2B542 THEGRECIANS'CAUSE.
221,562,337 *1546B7103B9255926AD4B0B751EA45F2AC84FAB9 JOSHUA.GOLDY
221,562,338 *15497AE7EEA5D840CEDB6E4384D7C5EC2CA4CBDC THE_KKING
221,562,339 *154A1481EAAAD15DBF407B3CA404C1D0D957FE58 TIARESLLIUQNART5
221,562,340 *154C4ABB548BDB1AE8A8B329B2C58FCC9B32F60E JUANFACUNDO
221,562,341 *154EC1C7D69B7965CDB1C8B4BAD6333E65029E4D tightener.n:.tighteners
221,562,342 *154E37DF4B0BAEE51F2ABE9AD182B60A0A5BAB08 JULIAN.PERALTA
221,562,343 *154C2B93AF498278CF92368C01A302CC29D75787 TMCHNCSED
221,562,344 *15448C6311E4D62B51BED1285A58DFC0829D2D3D T.N{
221,562,345 *154613F49A8DE81DC3693E592CF82C7E4CA61CD6 TONEY.MCCULLAH
221,562,346 *154C908F7E7C469A48F17828F4ABC5392921B0AC TOOFLEMMOP
221,562,347 *15431AD28F18A1A2881EA773A1DD3A087300D569 torydrungo
221,562,348 *1548AF91531FB6DDF734543C060C566AE50F0097 KARVASJÄRVEÄ
221,562,349 *154BD6960AB00A3BF64920FD72DFBF527C8B96D0 KATOLI
221,562,350 *154A5318A10C78EAFEB916E00C8B8178AAB3F8B2 TRACYLEEN
221,562,351 *154229AE3106D7371C13E570F0A4E130F82DDB88 TRACYMALONEY
221,562,352 *154B86DB826F78AD5ECFF49D51858FC478D49D7C travis.lall
221,562,353 *1546B27641A21188A3F9AEAEF54AF53A627F9F20 KENNETH.JAQUINS
221,562,354 *1549372173EC9E4EE0DB10159F1DA580C0026C09 TRENTON.STARCH
221,562,355 *1542420D5C7319F102DD2547640921625F283F6A TRENTSLUSKI
221,562,356 *15415F88ADA0628692B1EB87FA30BC992425961A KEPSKIUB2
221,562,357 *154079FAC2A65297F83607701CE1203EDA3448C6 TRISHAPAULINECANLAS
221,562,358 *15457C7463ED30469E7BA5D449860E7FD340B205 kiesecker6
221,562,359 *154D07DE2FB09B087F9B1775C0DC166B32004324 trumanwademan
221,562,360 *154C64F6FF92D1A900703C3CA3EE1D4EC9E7C3B9 KIPPENLADDERSES
221,562,361 *1547126F3EDD9D32F867025C4A11D86DCBDE1154 TSUACOPP
221,562,362 *1545AF518C4AD5EDD4EE7682E6B4F2C4241C3086 Knock.on.Door./.Footsteps./.Door.Opens
221,562,363 *15425C1C17BEA56DB7DD7B3A90DD58070FFCEDE6 [email protected]
221,562,364 *15460E9340DCA9ACD7208A5D029C67E204F8971E komentare
221,562,365 *154AC654D623CC0231D8B842CD9ECED2D3D75BC3 KRISGHEKIERE
221,562,366 *15486AA92E2B077D0BBCF10744426EC4E1BCEDE0 TWILKENSHOFF
221,562,367 *154DB95D019343359AA00CEE54DD95C8FBC771AC KYAWSWARLINN
221,562,368 *1541295C745C5FD9F316842AB74A84CED0725ADE L\[email protected]
221,562,369 *1543DFF3DCB21FA43A7366B7A00043413BF30243 U101368
221,562,370 *154534B43CC7F12F16DB760BDA8E16CF5BA74811 laenoo
221,562,371 *1543063A22C84C7708E003EE772A46CFD020B2A4 UFJ966
221,562,372 *154CD69F13A66CCC56FE6ACBFF07FB3441F0842A LANDON.BAEZ
221,562,373 *1543A67FE4675C1552306980B2B2C43E3DD01F8B landonturcios
221,562,374 *154C137AF7B969F99959BF25226DDF05812ECDBF ULISES-ODLY-SOTO
221,562,375 *1540DEB42B03C503CCD377E19FF0542D424E4337 ULYSSES.BRANCHEAU
221,562,376 *154FE14531819AFDF67C1A605977F23362300986 UMBLEBEE6
221,562,377 *1546D1F6DC1751C691B3FA015EECEE3128276E19 UNBENDS
221,562,378 *15489DBB4007AD72C1494A02C9E36505CAF996DE UNE VIEILLE TRACK
221,562,379 *15444634CAC95705AB863029E105E5ABB5E4F60D ld<q
221,562,380 *154320C43317E760E1460D789FB1158529775A10 [email protected]
221,562,381 *154906117302FC5243ED0770FA3760707B90C670 unissant0
221,562,382 *15487FD31B3D50DCF0262F854FB96EFAB410C59C LEON.DE.GREIFF
221,562,383 *154DC1697F62E11EF7A6F8C1D0784E82247F8DE3 USEROZGODSPRING2008A
221,562,384 *154D25D6D3E2216AFE4BDC325F80BD7DD5F54361 USERSAGGODUSERSHANBH
221,562,385 *15462F6A01B7ACB394A5B94BE37F69B4B1D5DCAF létigéken
221,562,386 *1547374733AA785BF390FADBD20361DBA9F2BFC6 VALCONTINE
221,562,387 *1546DA354331D192F0D0B579B6F4940F6C9723C6 LIFE-LIKE-QUICKSAND
221,562,388 *1542EAE102C5C4A8098693CF35095EE2FDE03DBB VANIQBAL
221,562,389 *15472AE82EF074CE9CABA9BEEA631EC578C41B97 [email protected]
221,562,390 *154B9C2FC4F68D5890E2DF04FCA518B7FD66865E VATASSERY
221,562,391 *154275E86373E76ED5CC70ACAB435FFD55BFF2FC [email protected]
221,562,392 *15438E18B9373C4A90BCFF970F67AE650EEBD121 livefromthepit
221,562,393 *154F6696988AB1B355D2F05040456AE230CB4C79 [email protected]
221,562,394 *154C0199B281D3329F836CBC7457B505BCFCC12D LOCKBOASTER
221,562,395 *154B7E7E78CE1F0CC11AD37B9417CB3987CA4ADD log36
221,562,396 *154287279CC9A80081CDB8A647DC263CE7F43C8C VERNON.RONNIE
221,562,397 *15490D0BD6BE559A78A4707217C3D5BD0CDA8CB2 LOLLARDIZELOLLARDIZE
221,562,398 *1548D7D6A3CAC885919CDC50D9E2AA235F6CC6BC lonnyruckle
221,562,399 *154804B7E7065D66610E2CB164F2F6FA36D50033 [email protected]
221,562,400 *154452CBA910E14D9A164C73E6B5B6EC9844B112 LORLANDING
221,562,401 *154065EE8643AB8F563F6BBB5EE678B64A2E7938 LOT-ET-GARONNE-PONT-CANAL-AGEN
221,562,402 *154A798891F9DDE2C4E25FD13FFBD70C7F555519 LOVIANIT
221,562,403 *154005939ED4F391A11682AB6C4DCC59E22751B9 VILTRINGER2
221,562,404 *154575CC07F9DE2DE74E39749FF3971B07C8EE86 VINCENTKNAAK
221,562,405 *154EFA492D1B688D3B2A8CF0C04BC1CD5A1664B5 VINEGARROTS
221,562,406 *154E878A9F59FD497956A0652AE171BA44415B8D [email protected]
221,562,407 *154AE11F5E569EC65B3BBF69303E4FFC0477C7DF VIPGAMERSSOFTBALL
221,562,408 *1548FAC5F335E2120228462885B33FA744B9F855 LYNNGINGERICH
221,562,409 *154CEEB23CBBD2CAD89AED957ECC00AB3D9903C9 VRAGENDEN
221,562,410 *15433F695B77D222EAD9407667EB07F77BED638B MAC MASTER
221,562,411 *15406C206ABA31DB54F33329A18221C735439242 VYVANN.AMAN
221,562,412 *1548289A160EA5E2ACA1B40369DF2312807452DD MAKIN' WHOOPEE! (FEAT RICKIE LEE JONES)
221,562,413 *154B55F038F1121EB114AFF3CC06348D30A3A5BD WAIT-'TIL-MORNING-COMES
221,562,414 *1549F44B986CB730F4D7B965512705A6090774C3 WALLY.LESAGE
221,562,415 *15444432ED5D0AC6F9EFD594F1F228C9D37F4152 WALLYVENCE
221,562,416 *154784CB1120D8D8F466AC0B2E38142E5F570A3B WALTONFUEHRER
221,562,417 *154EF2A92498D2A5F7A563A146C4CE157B2012C8 WANGANCE
221,562,418 *15445EEB134B261BAA9C057A6462B7D69BBE10D3 WARD.SPAETH
221,562,419 *154690683E5F78B86D56A231138F255AAE25576B MARIALEE BENITEZ
221,562,420 *1543177FED0ED7F8DC766ABDD5072F75BEA7106C wasmussichtun
221,562,421 *154C33596FDB1DFDB855288205D151BB9A9B1D67 wcross
221,562,422 *1549EDA8032B0365C137CC77F94F4E219120DD72 materialperceval
221,562,423 *15404D6EB52C53AD8704AB5D215BA518946E441C matoutebelle(lovesongfromgenrosso)
221,562,424 *1541AC0D6608325459A07BC50609D613F753B009 WHITNEY RAE HRICKO
221,562,425 *15429B94872FF737444E1A905A9BE3F37CE71AC5 mendonki
221,562,426 *15454B5E2D44392CFC8ED0196B9F1237B4B20D74 WILEY.CUNG
221,562,427 *154386D429B9C78E5630974740B09A6FFD64A824 MERLEREADINGER
221,562,428 *154857ADDA93647614E83885F35D786E484D2553 merryrussell
221,562,429 *15448C521DDF8097FCFF62830BE9AC61D1C4CB05 wilsonallsup
221,562,430 *1547003381F85297ECA378774544F07870421805 WILTONCABRAL
221,562,431 *154853EB85FADED3282BD1A1AF4EDB4EA399165A WINNERNICOLE
221,562,432 *15476BB591E01FCBDE99D2FD97E4EAB20393FD05 MICHALE.COPENHAVER
221,562,433 *154D2F5861C6240E14C52DC989091E3D02FF029D MICHAL.ZABINSKI
221,562,434 *1541F4448BA7876DB1EF74B833A6B5B1B780E2BF MIDNIGHTCHILDREN
221,562,435 *1546C9F13E60CD499134D864AEA0B3644889DD62 mike.seitz
221,562,436 *154A462F82094EC0B4391A69832BCC27B92D47A9 WOODROW.THERRELL
221,562,437 *154CFF0D8CEEE97B1103D3261678EE00CF8E3BE2 milkthreat
221,562,438 *154FABA8C410C3CF8B4368D9028E7F8B5317EFB2 miniburl
221,562,439 *154A6DB3CED1C18E86E03A5BDFA594DF7725347B WWW.BENTONBOWMEN.COM
221,562,440 *1549DC85A58FA02204259CE7F4139E9018804952 [email protected]
221,562,441 *15488C385EF9F0A925F98DB1F85113EBD692818E [email protected]
221,562,442 *15434FABC3BAFD55A99D4B768F8D4D1DF6257270 MODESTOGROCE
221,562,443 *15421761583A6695E5F86082F1153BF5EBCFA0D9 xa-bungle
221,562,444 *1546A0597FBD3C67CEF80DDF4CDCE7421C8B7BC4 mo money mo murder (album version) (feat az)
221,562,445 *154BAB50F44F97F0D215C9F6E2DF5FB12B1E024A MONROEDEMILLE
221,562,446 *154FA8026DE2FE591B0CC13B5A7E3A86772967C1 [email protected]
221,562,447 *154C3F7D91F0F8F5FB271B84038E609037687B78 MOSEREINHOLT
221,562,448 *154E4DF44627C2315597D76649C21A4E31C11CF6 XIOMARA-CARDEC
221,562,449 *154180DF8ACDD7C7E0A8CC04131709ABD662ADE0 [email protected]
221,562,450 *1546643DFB41827052C6FCECCDEF1F4110D7723D )X(-o~-O~(###B
221,562,451 *15471551ED36FAFD7852890AAC12ABEA23ED56CD )X( ~ ~(P
221,562,452 *154E63323B8B99E96E9D4239E6AD3D9E874323A8 XXXINFORMIX1
221,562,453 *154E39E8AA9EF023B9E6FF4F72FD6D520259CED0 [email protected]
221,562,454 *154E8820F427D5063FCFE37C07F724B0BCC75056 musicaenesperafuelapeliculamasvistaencinesargentinos
221,562,455 *154A7269CD6F7B3935A966A8022AB42CCED4A4BC YANOFSKYBSW
221,562,456 *1541874FA4CAB5242FE5D684BFACA0BB7465AF2B yaron-garama
221,562,457 *1546C43AA734EA829CDCE5930C9C91EB3DBC9295 yaseminaltundag
221,562,458 *1549225E2D26CB8573D16018BA4E77AD12631C11 [email protected]
221,562,459 *15457418C45B700971FFE85B246053A485247D3F YECATSOMED
221,562,460 *15428A54C5B4F496A3F651C50023775D577810ED NAMERIC3
221,562,461 *154B59F9E6CC279AB2C1F3D3DCAE383B41EF7ED0 [email protected]
221,562,462 *1543AD83F1ED87BE89E9EB04B919B60713E1BAF3 NDAVRAZ
221,562,463 *154795208B1FCAE51779E5AA548DBC6D5AE7666B YKEITH
221,562,464 *154E4F876DB456E18E5B4B6045E3EF40189E4C71 NEBUDTES
221,562,465 *1548E66BC0D4EB2E422DB9A1BFC349C023C94558 neededby7
221,562,466 *1549DB5BB173396D269242FC6363A4E7A56C7F93 You're Everything (remix feat Ja Rule)
221,562,467 *15444C07EE211CDA1C12C81CEC6CC11389639ABE NGFNDHD5
221,562,468 *15413F4AC5B67B5DC9755FFFE3662449766E27A1 NIEL-DANIEL-BRUSCINO
221,562,469 *1546F458EEAB0DAA9F85270BB14A39FE737A6A38 [email protected]
221,562,470 *1541AC63AE767559BDDEF9F956A6648D1C6BE560 yves.rachelle
221,562,471 *1543434FAF36760145930DE67F0E8CE9992AECE1 z2?aaa
221,562,472 *1543CA09DD58E7973362EC5EC20880458061731A NNTXTRL6
221,562,473 *154D29AA6601661EC933A2DDB8F80E49D0C266AB zack.brar
221,562,474 *15437C0C9CC221FEFB514C8EF535ADD29F435DDB NOI HUB
221,562,475 *154A9F5BA806603D335861A1EFB2643F73023D7B nolanravago
221,562,476 *15484EB6A393536EB2F0BF667C14AD976AC37363 nondecorouses
221,562,477 *154D9245DEA0FE2ECB907853F85FCE7D20665A93 [email protected]
221,562,478 *15484C688F847F290A112B62CEFAA77EE2E8340A zhang.return
221,562,479 *1540FFA31ADACC5034A31F60C10F0D6A4B2271D8 now.hds
221,562,480 *154A1A9C126C79F3DB6BA7CE90F4CC6D4940B644 [email protected]
221,562,481 *1543BCECB44D9BA336FD14EDE2E3884DE06C88E0 NUMBERSPOGAR
221,562,482 *154691D1E9233126180EE7F737064F3171413D21 [email protected]
221,562,483 *15432FF15F1535A4B84F8336EF6972AA0919E32F ZHZENTKIQD5
221,562,484 *1546F273E3F40270031BC8A2B47DFE92E22F2CB0 ziad.uday
221,562,485 *154A2CB6E918F8145B08A7D39C4F460D4F789FC9 ziekenbus?
221,562,486 *154980F5023570765C737A83292D901627BC371E OCTAVIO.HAKALA
221,562,487 *15427458E70DB5AC199B7BA09539E4956956D792 ΑΠΟΜΆΚΡΥΝΣΗΣ
221,562,488 *1543D5BDC298B296FF1213CCC82D18C6F25E5269 od8y
221,562,489 *15408A79AB0E766BDBF0B35132EA788BAF8B5726 δουκακης
221,562,490 *1547C3CBC9D07AB81D4051655ECD6A862136B425 ODNAZNORING
221,562,491 *1540BF9394A92E084ADA4D782B40BDE2199175E9 ЗАЖАЛЯ
221,562,492 *1542A0F44C922583386B1E9D1048AC43D536E358 ONGKOSNA
221,562,493 *1545DB24D0629CFAD4B920083BE99FD03CF41201 ontvette
221,562,494 *15469DB696599A9C4191CB60D948009A28CED948 КЮСТРИНСКИЕ
221,562,495 *1546731B6B3BC187DE9739D507A2D3DF7DB16CF4 ORCHID47
221,562,496 *1543A90BD7F8EC26220549628CF22A5B2D173050 [email protected]
221,562,497 *154F9C5D31633C9A98FB2CED66F171268C81806C ORYGINAŁACH
221,562,498 *15400CC98FE5C9A077199EAD97CDFCD84FE5F0C1 OSIROGO
221,562,499 *154A6A736062D8443E8B2023E729DDB6E8B579A3 otilda
221,562,500 *15464FB5C44FA98B7BCD53EA69BFC656F33D88EA p1g+41l5
221,562,501 *15411E3576C88E2172CEBDDB7F176FD04DE512A1 P3113+Z3S
221,562,502 *154448C4591445586892C1A36FFF29ECF48450F5 P4N+OCHROMISM
221,562,503 *154D1E86424DB87C05C99E15AFBB0A311FE3D43B P_6>
221,562,504 *154010495C0060EB16B6CC06C1A91FF16ED28798 ТЕРЗИСКИОТ
221,562,505 *154EF82C9223540F75AE90916E6AD0A37AD534D0 ТИММОНС
221,562,506 *15432D197ADBBDF04D2062452AD198CEBB883275 PARANGYA
221,562,507 *154ACEA465CD008B7E1F78E93E03E9A85A2700B4 <P><B>100baseT</B>
221,562,508 *15420A0674A24C32902910FC89B5C8A3C71EDFFC p...disfar
221,562,509 *154E86CCE6CEB42F3BBCB9F6F5CF8C935BF2CAC3 phudbswing
221,562,510 *154EFA32876202C3B99FA725838B973E0040A5C2 POKRIJEMED
221,562,511 *154E557F8BA32B9199DA93D803F54948CE28B222 P--P~O~OUU
221,562,512 *154116F80D0122F3F90AFDA9E609A6D4D8D6A4B0 緑色のむにむに。止めると通せんぼをし、ぶつかってきたほかのむにむにをUターンさせる。
221,562,513 *15442C3FF3B662FC8609CCF4C640EC04B681B0EB PRINCE.KUSE
221,562,514 *1540B505EA760EE82F70B5658E70B7B899AD2F16 PROCEEDINGS1993
221,562,515 *15440D45458CB77BECB0E34EABD48F606C99B880 «prosodi»
221,562,516 *15403111FA166A6ED8C88CD3B6D2AEEE37381B5D QI~M
221,562,517 *154808B182147FB154B0C1E4F411AC303015C8DE R%2+
221,562,518 *15411BCCEA07E7340719FE7377A064968E6EF510 [email protected]+v3n355
221,562,519 *15427AE4CE7DF6AF85C4CD9C05BD2455FAA9CEE3 RA~7
221,562,520 *1542962C3B07B077D85CE980536EB50B840BC4A7 1170783 N
221,562,521 *154FAFF6D6CC742D90233D158CD6621F36FE9D59 11-KIRINEET
221,562,522 *154997CD60DA3498BEDA78A09C34E4559FFB22FB 1241942
221,562,523 *1543BC2080B8386E28A3BD18DCC70158BE9AFA46 RANDELLNEUBERT
221,562,524 *1546F875C25BFED79EB71747F0036BE271A6650D 149098 sicherheitistgefragtindiesentagen.
221,562,525 *15467704110A709739E05446364198CDA0E7EACF RAYMONDDIETRICK
221,562,526 *154BE8A0B72751E0B848FEF0180E336233B13A00 raytrees
221,562,527 *154C28BFEE793C5FAE2BDDF0D606C389D4FED142 rbf!
221,562,528 *1544EC37A76729B4C348A5C47676C932B1ACA936 REEBOKBASKET
221,562,529 *1549A4BDA8B64B764DA3A783179214BCDD63725D REFUSERS
221,562,530 *154A787CB75322E45FDB5A997FC4E1C505423947 1987RX3
221,562,531 *154272C6FAD080C7E7A3AB7959CD840B68151A5E 1ALLECTA
221,562,532 *1545771154B90E55D24EDDC96B32E27DE261AFB0 reneasp
221,562,533 *1546249A26DD2D76BAF385C6FAAC5355824CE786 RENELICERIO
221,562,534 *1546FF15EAFCCE7B1FD9B3DC458B58332B7103DA 1anticritique
221,562,535 *154F764D308BCC04594384061D5A62B04CC8B35A 1.AVAMIN
221,562,536 *154D8EAD0C37924A968A2C0BFF14DB759021F54C REPRIVATITZAR
221,562,537 *1549488FFCD3A1C5E92B273BF05B40A3D210A0A2 RETSFORFLGENDES5
221,562,538 *1546BD1D43B3037EFD362CBD2DD1EB2CF5BA26CE reyessump
221,562,539 *1547567A07AB677095EF129A83235DCD15A04E48 1-effektenbestand
221,562,540 *1541F9867D121BFABD6CE2FE98D3677152DE1AD4 1february1434
221,562,541 *154938B7A4B15A28F689D7B38A32D1F0E05104DA RINSECCOLISCANO9
221,562,542 *15420F1D275F107BB3EB77BAED4A0D49BBFB34EB 1 internettilauksena
221,562,543 *154B8FBE2625B6AE5DD3F4C05DBDE3ABB1191F18 rklavierundorchesternr4g-dur,op58:iallegromoderato
221,562,544 *154C589D9E3E8E1622401F6FAC141061E1F018CE 1.kriegsaufschlag
221,562,545 *1541D6A20754FB9E3DCA8025DCDE6C6FD413BCFE 1kuivakalleksi
221,562,546 *154B3EA57A76ECF291673295CE914F9CE1E47C50 1-KUNTOLAVIETT
221,562,547 *154E9C8F55371C7D912D47AC5E9277F4131D2386 1LIEKKUMAHAN
221,562,548 *15450CC728684152720AA91EC1DBAAF41FEF31D7 ROCKMONT5
221,562,549 *15462C837366BC002A41B6698489CF780864CB4C RODNEYIVEL
221,562,550 *1543B05E9A5075BBFBAF142B070D7AFA726F76EA RODOLFO.MOSTAFAVI
221,562,551 *1542971034717450639D022872BD8E13B13BEF61 rogercanavan
221,562,552 *154BC4A40E10DFAD503DEC2E5A3B093EE50F6D31 1MOLKKARILTA
221,562,553 *154DA60EDC8BD96291C406E197FC43580EA52439 RONALD.FLORIDO
221,562,554 *154D109C540B5D83D636D5CC6E81DBE93F9A5A77 RONGEW
221,562,555 *154336577AAEDDF321292ED8D980629604BA68CC 1-PEITEMATERIAALEIHIN
221,562,556 *154FC59D876478D3296CDCCDDD7CD46B8CCA06C9 1-pekkas-ryhmi
221,562,557 *154B130C2F4FF6A8A184C918760FEBA4A057FC24 1PERESIN
221,562,558 *154C2946D5BBCF26CE86009960D307C9735B0B2B ROSEMARY-FOLKS
221,562,559 *154D56C6A91DC4ED64DFBA5CEFB9B0868C2ECECE 1PUHEENPULPUTUSTA
221,562,560 *15473A26906F1E60E6FDEE5B608BAF3964DB124F 1Q2W6874
221,562,561 *1543C908717E5D29393DE074094DCE0333FBFBB7 1-RHEINBRAUN-PLAENE
221,562,562 *15447A364CC67E82EBD0140412CFE1CD4DF69D0D 1RMNSCHLN
221,562,563 *1542EC5EE55AEB62A0091AD7AF6AE83411E0E111 1-SAGDAYIM
221,562,564 *154B0357573E06CFB9361CCF554F0D33F7F2AFD7 ROYALSSEATTLE3
221,562,565 *154549B38791326ED591A9395DFC7F9CAE619F71 ROY.FINERAN
221,562,566 *15483728C6C0FE9735D2374BE0B4AF884F837912 1.SCHWEIZERHOFGEBIET
221,562,567 *1542177E9253D2FE3F0DC9443F64394EDB3096DB RRK:ALPHA1
221,562,568 *15436E125FC0922D3A72B394E83989757267ED8C rubinjamer
221,562,569 *1549168D369FEA1C21B85158321F3838A1330E2E 1.TEKOMAMAILMASSA
221,562,570 *1548F069EFE7197FD7D86DACB4710FC8132C8B01 RUDOLF.WITHERBEE
221,562,571 *1541F79442D630FB10195910B45A4BB018041B2D RUDOLPHPUNJA
221,562,572 *1540C56CD892FD7803EBFAC6232BFC9453A98728 1.trennungsarbeit
221,562,573 *154CE92E54A86DDC262FD820F434DB17452AEFB8 RUSSEL.SHILLINGSFORD
221,562,574 *154A61CBAF140DF761B3D2FF02CAF1F2E0868C28 SAIPPUAKIVILTÄ
221,562,575 *154549A2490B13C3082B03DB28D87CFA681D4DDB [email protected]
221,562,576 *1549E1E36B4276185B83F0D351F5AF77F404270A SALMONELLA.BBS
221,562,577 *1545533CBDC4732738480F946D9C2CB21B57419D SANBOBSW5
221,562,578 *154A4D3C1F2CF9A9E02C8FECC10A325778070FD2 2352611 silti.kyseess
221,562,579 *1548BC4C3AD7E5EDA7F96158943D615C21ACD045 2358320 dochfamilienstandundverhaltendifferieren
221,562,580 *1541A19C1B5588C61304DBADAFD0CB576323EF57 23apr1914
221,562,581 *154224B392A9ACF7DBFD670FAA096C04F3AB12A7 SAWEMITHCUMWOHDNA
221,562,582 *154182CB16D7DEE331FF390240A93097EC386E1D 25 ciceklere
221,562,583 *154EADD711D4FEADEA1C5851AA3956432B38EAB2 SBASANES
221,562,584 *1544E14B029DC4966FF11AFCFC01286CCBCB6443 'SBP
221,562,585 *154BB6959B3F97661676B319FC8DE19205E430F6 scarcely
221,562,586 *154E42E7620EA0C8C65F4BC5825E0F8C9589AEE4 SEAVERI7
221,562,587 *15425C18B5471771578894211467F9228F14DDCA SHAI SHABTAI
221,562,588 *1542EC24D8F67C63842808E12B646B725785D530 shanemoffett
221,562,589 *154ECB6257511FC3F129F3449F16EB3CA044BDF8 2 AUSCHWITZ-FAHRT
221,562,590 *1540B5AFDCCD8D9C33F7D8A5B8F68F9372008A98 2CubuGuyla
221,562,591 *154305A13804C4407ECBC9C7F44E41C8D2CC279E 2EDITONS
221,562,592 *154C824AA29445EB441DFE6E42D0438A0E0450C3 sidneysneath
221,562,593 *154B0856E3D2F3EF9519C14CB37E171E72175BD0 2.LNNANGESTELLTE
221,562,594 *15420CF61333BFECC817B54B2B347117E530123B 2 moviesnot
221,562,595 *154486F5004D4122CA998F0C5A2C575F67BFAB69 2PARTHIAS
221,562,596 *154AA1AD62791CDF5D3DFCD74AFF8403C4894143 2PRIVATIVE
221,562,597 *1540C8517AAE8C91025CC28FB774CACEAB701AFB 2-relocked
221,562,598 *154F9B858E0EAA561142F87528AC47A2358EDEEB SIMO-OCTAVO-PERIODO-ORDINARIO-DE-LA-ASAMBLEA-GENERAL-DE-LA-ORGANIZACI
221,562,599 *154DAF664C65997D57A45C2AEF687C1F291CD524 2-ringkaempfe
221,562,600 *154829FE9570E66416A2826DA109CE4DFBEDAAAA sinnottarmstrongs
221,562,601 *154CA74D9A17B4A7A37812DC4F52AE43769AE3C9 sintetosed
221,562,602 *154BFF676D152F3949C9C637F529AE8609661A75 2-ZUECHTER-SEMINAR
221,562,603 *154C42DEF02461058A1DDFCE95E1959282C361A0 >< * *@3
221,562,604 *15479048895CC5B30BFFFAC3255D244628774705 319030 SAMASTA.SYYST
221,562,605 *154CA92E0F99A757B4F034B2D9DB31FF36E8783D SLEPETH0
221,562,606 *154775B3DB53EFB69F4CC146A37543BB52BAB6CE [email protected],
221,562,607 *154531F8EF226A76E92DE3A2D50AF65DF5AE1E6D 382116ade26049008318bb7d14ffa473
221,562,608 *15486815DE0A0F20F552236068B4FDA62060AA37 SNIPERBRIAN5
221,562,609 *154FABE90B355E5BF7F037B26F3A056EEB447AB4 snipsnap
221,562,610 *15409B4784836A5F09508709C9FBEB44476C6261 3=====B.*splat
221,562,611 *154EB3CA8D472406AA45F4DE56250499948A7C6F 3p~~~o><
221,562,612 *154E2EC486D8D58AFA4ADAFE79B550C72D979E6E 3-STRASSENPROTESTEN
221,562,613 *15460B188ED5339AED8F0FE8BC82787C49EB37F9 43I3419DR2
221,562,614 *154557013DEF039A9F2022EBF7EFDD6BF6A4B75F sotasospita
221,562,615 *15470C49F3B4A1EC0CCEA0F705A25F08D028D367 4ATODBSW
221,562,616 *154FD083D1424FBA17300E3E85866A1383F22C05 spatzier3
221,562,617 *15460FDED8FB1C0C26B39C2B8DF0042EE54B5B29 [email protected]
221,562,618 *154B71C3407F4D9254ADA3363B0A664D843D0B40 4N+HROPOCEN+RISM
221,562,619 *15448CBA2BF3B51E2346C487DA8073B0D5041838 SPLATO~.O~Q====P
221,562,620 *1541131FE08CF159BBED11B6A9FB3085BE72982D splat!!.~`<---p
221,562,621 *1544637489BC6F0BDBE0D1BAE2B6666C3C920316 4scalfaro's
221,562,622 *15446CA0F0D50F13E60AC8296A32C2DC36814BF5 4SHOTGUNKOALA
221,562,623 *1545F6833566DE93E6F7446E020623D093A767AC 4SKIBSFRERENS
221,562,624 *154FBE8C077640E3772C43E8D5DDDE1858AAC30E 4VEGETARIJANKA
221,562,625 *154939076BB430004CDC7D0AAD21EFDB6A01F6DB 4VOLLSTES
221,562,626 *15450D0A9A41A7913EB4C52D0126054E47923D46 SPUTNICMUSIC
221,562,627 *15483E310784F6DC3D585108A2203E2ED66FEF8B SS1SS
221,562,628 *1548CA066C2907D1E074FA15F9B30978D73F9301 5APPRESTERESTI
221,562,629 *154D3F5C277FCB4A4D1A677AD520A2E8FB153147 STANPREE
221,562,630 *154346F0A2B995BC5876BC0673BD7917DBD8A1F6 5DESPERATAE
221,562,631 *1546409027079AD3F8B6B9D3C833370E97CDAAF2 ST^E
221,562,632 *1546009835ADB7FF51EFBF914F6DFE245537CF32 STEPHANDIDION
221,562,633 *154C3C252CEFA39D2103196550621DF0EF7D6B35 5GULCHETH
221,562,634 *1540EF419F70CE4F83317B7765239991FC690311 5HDA7FWOV
221,562,635 *154B4FA302EB668B364936817D42D1D4C48F3BCD STEWART.PARILLA
221,562,636 *1540D2471A0C619EDB875247904C33E3DD7BDDF3 5PAREGGIARONO
221,562,637 *154D5995D25A972F1E4136DEBAA311428F7C52EA STIJFKOPPEN!
221,562,638 *154D79737A8571B497ED9C9076988AD5E8E68088 STRUGOTINE8
221,562,639 *154C616BC162B6F089DD87059268408D90310D08 stuff1y
221,562,640 *15444A6F9E1F30877F81E3F2370B5ED56020E177 st-yves
221,562,641 *1543F0769062498FAA12844CC4025ECB14F78FBC 5-tilaviinien
221,562,642 *15409D19AF03B0863D436B3496741792DD8484A1 SUNDALAGMUWB
221,562,643 *154002411979025B46E5F742C6A0D403F65B56BE 5VAEHAENEULAISIA
221,562,644 *154919841339A3594580F52F93070F61768A683A [email protected]
221,562,645 *1547F7C5C12068BD794D40DBB6AC5EAA1B3ABFFC SUOICORTAHSIUGNADNIM
221,562,646 *154408C7ED43ECACAF1F0FE41F32F667211243AD SUORTEP
221,562,647 *1548C792296A3EB1176F287BBD9BD33E51E62A36 SURESTICK
221,562,648 *154A80F00E2497DC48AF4E9AB943B91F0B4BCA4F SWRPRODUCTIONS
221,562,649 *15456E4BFD949F9AC7EA5DA1EB14AF6C996EEA4C symphony,g2:iigrave
221,562,650 *154EFBC1AEDBD8D57FE011BDF9666B3E2E0E8283 tad-more
221,562,651 *1544CF731056B6FD2559AEC6F8C3CB874CDCFCF7 TANSSINE7
221,562,652 *154F786E7B4547BC08731ED2347FF55255930D1E 62077 ICH WAERE VOELLIG ISOLIERT '
221,562,653 *1545729A3B27203D6DEB82967347DB75FDE06C72 646475 VARIOUS-FORMS-OF-SOFT-DISCLOSURE-HAVE-BEEN-CONCEDED-
221,562,654 *1544DF3A1A0959867FEE5AA6F256C1DB4C5127C8 TBLANA
221,562,655 *15437835271C5A6FD8B78E90DA5876256D825157 tcatnocsys
221,562,656 *154E3BBA87F94A0B6E7CD828D6403987965539F7 TEEKANTINGED
221,562,657 *154550A5FF1E673481865F28E3C15808D635BAE1 6CMACBSW
221,562,658 *1547BBB4F1BE79CFA570A29F16C2C487C5143F58 6DATABASESPROGS
221,562,659 *154DB385D5CDC6EB0C005AF1AF949946655A80A1 tekk-lancer
221,562,660 *1546D68E7B466C252BF9428702BBDCC20F6E2E24 6MAR1429
221,562,661 *1547EE07B8F4A7582FA3F700D46C4002F5856A32 THATNEWCOURT15
221,562,662 *154D5F1B56A720CED58E7BFBE78524EDC10D79DD the-great-grandfather
221,562,663 *1546FA4E57485312FFF7D5A3CF72DC8386147B48 716975 FORSSAN LUONNONHISTORIALLISESSA MUSEOSSA OVAT ESILL
221,562,664 *154F6068CFE72392A85AC47CC965E940FD578B08 728736 BU-DA-OZEL-SEKTORU-COK-TEDIRGIN-ETMEKTEDIR-
221,562,665 *1545D64F0939F940E63634C87900B7D094219FC7 the-things-i-really...-(
221,562,666 *154775C582A9648199B692E8924BDEAE97D59B18 THOMAS.GREEVER
221,562,667 *15402B9986DC063E17F189424AD2F24493705DF6 THRAIL
221,562,668 *15466E37CF615FD2B7B82CD268CDA4D7AC9EF2CA [email protected]
221,562,669 *154392035550B599AED557F3F9F3923C7E0CAA8B TILESPAK1
221,562,670 *154B452F4B9DE1D06CE76B1B91E0C09A273FF170 7MONOTREMATE
221,562,671 *1543B370C0F4EEF5C6FBE390493541BA20CAC0D0 7SASHAASDFGHJK
221,562,672 *15404FF6B300463051B853F116D42568B9513661 7TOIMIIMM
221,562,673 *154DC81D85D99084CCEC67E9AA6D228C7F7C5856 7UNTOIHIN
221,562,674 *15486F64244D56A950AD1F4BD1440FB25100000A 7ZABRANUJI
221,562,675 *15411C4A1DACF76849711DED0DF6E6144C20279D 8->~.`.3b<-
221,562,676 *154B4F2EEED4858C35A9948F7A44F055693014F4 869641 MITEN SITTEN K
221,562,677 *154B4FDECC957D9C9A081A3B9EEAEEFB20CF2D7E 8B6F399C6CE544B982F7859A3599B4C6PANDA0830
221,562,678 *154D2A2A81DBDE1AAD9F987E92A8C56FAB4C39D6 8CINDERREGGIE
221,562,679 *154FE30053B66C7D97DF02C647EA034566FF909C 8clemmons
221,562,680 *154629A96AA3C80B1D2A1BA559B226B637C6AC45 8EHAV!0R$
221,562,681 *154265BF5D8E1DBE11D1D3F24A9F61038AB114EB tratios8
221,562,682 *15411D89723DCE7212CB545604E4DEBCF0E239FD TRENTSAMPICA
221,562,683 *1546DE1A63481F70013A678828468CDD9D85C3EB tresaalsop
221,562,684 *15409357B4DE9A4A66057999E0AA0A6A59CF6854 8 KLEINKRIMINELLE
221,562,685 *1547AA50555CE10F33F9B6DAC46F03B3B2C65B79 8KRSJSDG
221,562,686 *154C31946FB119D9437BC8B2B1830A5E198B1B97 8LUFTABWEHRSYSTEM
221,562,687 *154A777F0F3065B380D8C79834F0DD3F26C5084B trggwrktn
221,562,688 *154FF1809EDA041E5ABC3F4BE473C49C968DF1AD trioecious.tr/aI/'/i//S//@/s
221,562,689 *154983692E3F5C7F8579D9426573E8313A7078F9 TRIPLEM19
221,562,690 *154386C3AF1C0D4046D691BF9F2E0EB149BB79F2 TRISH.TUFFIN
221,562,691 *154991202BBBAC840307229FFFB2E99A85D38C50 8p~ ~ ~ (00)
221,562,692 *154365DFE839B401D1A3B463855031607EE06DDA 8RAGGEBBSW
221,562,693 *15449C7AD97667EC686089B5F9039AE8DFC557A4 8STROMVERTEILUNGSHARDWARE
221,562,694 *1540CE1380B5302716FAC3950EF14E0978A37F34 TSOPAVUK7
221,562,695 *154ACFE0AA06B3CB68F351D9DFEDEEE9FC8B132F [email protected]
221,562,696 *1546B33E75DCAFDF7EE64D4155A47266782A25F5 tupt.ssc
221,562,697 *154BF939E7733B3D5B472CBED5C17774D2AB4AEF 981635 FRIERT'SAMKUERZESTENTAG,IST'SIMMEREINEPLAG'
221,562,698 *15432C18B38F696DA0731C2FFED27418F11C496A TYSON647
221,562,699 *154A7E8BF6A719E2515D544B9F10630C4F51F26F TYSON.MCCLEOD
221,562,700 *1542D177A668C5CBB987BBD45EA890D46FE6EA3F 9BSWSOFTWAREU
221,562,701 *15489F94A169FE7A5B61440FB16DF2B51B12D5E6 udi.zafrir
221,562,702 *154AE97A504173FF6D8DEE89C0BBF5B8EFA7423B 9DESETAKPETAN
221,562,703 *1542DE0EF0AD6C72682E3EC61F6B773EF792914D 9EKSPORTBESTEMMELSERNES
221,562,704 *154D399B8B64C05164B6203FD5D20FD687B1747D 9EMBOSCABAN
221,562,705 *15470058E02F71914776C50CEDB5DC3692D86818 9ENTARBOK
221,562,706 *1541900AC9FB48FE5000B0AE82CE84D8E334F5C1 [email protected]
221,562,707 *154D652C2FC3AED488B36DD2551AEA0F143D83DC 9GUTBLOCKBLOCK
221,562,708 *154867939D015FFD3EBFF6EB0352C74C6774B9A1 ULSLTDR6
221,562,709 *1545A20021691E7EA49CCB77DA5987AEC19FF7F5 UNCONST1TUT1ONA11TY
221,562,710 *15475E8DF181F5D2513B88C413216FD5E28DF20A UNFASSBAREREN8
221,562,711 *15421923F97780269DB7DBC6772EADDAB453E97F [email protected]
221,562,712 *154BC3E0C35BE8DD4D9E47B52534E232ABB145AB UNMARVELLOUSLYVED
221,562,713 *154A1A7AFE95A6DA3315C908638E0291549ED000 9PLFRNRS
221,562,714 *154801A91621E0B10C8BECBC3676B8EDE9A0D722 9SUMOGETS
221,562,715 *1540F66FF18B9738CF119631BA6FDECAEC81A010 unverdantly.
221,562,716 *154679F96A83F32D71FFFA82BEC8D36B86F67D51 URPRODUSENTEN
221,562,717 *154929737C4CDA0804522C2B43162B660CDD8D65 9twiddling
221,562,718 *1540FE1701C6248F369D687A0F24A1699F25FEA2 a).):
221,562,719 *154B381E9E56C33D60CED7BF8C8BAD791F0B7639 a171138
221,562,720 *1547E3A841BA5F86D6A8A601A321D24A0619B2A2 A21:M
221,562,721 *154E094A66E6F1FC43F94E2F5712F56BABA423DA a4mw&
221,562,722 *154F149BA68199E59FF8E181C5A1D5EA7E54536C .VAULET
221,562,723 *1541EEC9DA3236EA17682F24FCA3E739F738B92B [email protected]
221,562,724 *154C179C5BF8A2258150BC318CD9A18B6559E69F aaacx.
221,562,725 *154F745F5D0A41124FA5B6A2E28A56F4DECC737E AABSIV
221,562,726 *15404DEF3392C0338C761315312244DAFF37C914 AACFBG
221,562,727 *154A55218A9041B85B32D0E35F29BEBA4DA461DC VERNONHEGEL
221,562,728 *154DBC759FF801F4794FDC85CCAC11473FC371B1 VE:岩下保典
221,562,729 *15408D700A60201B9FADC00E41233543B496265C AAFN?K
221,562,730 *154E66E48310EEDB65A6CCA53B57B1F100483E2D AANGEGIES
221,562,731 *1543BCF384D2DBC4AC7C0C19A659EAE911873CCE VILDSVINSBEN
221,562,732 *15429AE064E07C04094EDC354BFA5EFB783678FE vilson-nikolla
221,562,733 *154C3936EFA0A45FB2F0B57032DD469EA9ADD9F3 ABAUJVARISIS
221,562,734 *154486A7C400B2A511D0E05B9FAD0613292D68AF abdu_
221,562,735 *154944BB4295D2694606CE78193F3D726BD5BDE6 ABGEHOLZTERED
221,562,736 *154BC9111603DF42268013F17B371B7D02BE9B44 ABGELOESTESED
221,562,737 *154EB49EF02C200D40B7EBC8259769B6A634BE22 [email protected]
221,562,738 *154099D0F34B743244A1FB72E3630C3F4CBB4F46 ABRAM.ARMELI
221,562,739 *1545C6D5209CA6B1852C5F95337212A87B830614 ABRAMKAMP
221,562,740 *154C353BF86A71ACD979D330D976CC06585AC382 AC9(
221,562,741 *154DAAAB5BF84FE32AFCD8FE1873C9B4B263A1C5 acs+?
221,562,742 *154CC3A808D967C12887778E8D317F82EF1B8AE5 AEHENIPS8
221,562,743 *154B98B48FFC8F074B6DF0EC35E2110202BD326A af_7f
221,562,744 *154AE9D231B5B16B88FA76FB24EC548FD84A3BDA VODORAVNOSTIED
221,562,745 *1548D494F79E916861D3E65EBB5109BEBC163EAB agy2f
221,562,746 *1548EF933C5AB1394AF8DB5D87188B9FC3B33DA7 ALANHAMMETT
221,562,747 *15480BD9BB41EDE4083DDF3BFB3CEB2EB2750BFD ALBERTOSADLER
221,562,748 *154300C2D3F20F19610E5956A2EEDFF5C3182F57 ALC)
221,562,749 *154B35B159ABB106CE54964625EF28B9AEE3E26B alex-roan
221,562,750 *1549A8CD52967F1859E6EA3268B85C23A8059D5B alfarisi
221,562,751 *154165663BDE338A7F7069771B5F07E823763E57 alfx5
221,562,752 *154707B0FA8DEFE39BF93B9B43955D194ACC840F alireza-rahimzadeh
221,562,753 *154EFF5063AA613E9CB4D452DC7025C94A11EA03 allenshy
221,562,754 *15462FADBC5CFAB815EE9178D4B89B7DC01895FE ALLOTRIOCERATIDAE
221,562,755 *15496B7F6EEA34384684EA691B1E83085E246A94 [email protected]
221,562,756 *15411369289C430647E2E1FAF83A12BD8D957EC2 WE.ARE.YOUR.FRIENDS.(ORIGINAL.MIX)
221,562,757 *154A5BA58CB6D5949A5B1FC17D2C8AF0EB3C304D wednesday.marie
221,562,758 *1547C940FD1B50016E7E7CCE98A5CD14B71FA54D weenie1983
221,562,759 *154A03F514BFE2A92E24914F1A0CEBF6B73DB326 WESERSTROMGEBIET
221,562,760 *15432968DEA9537CED2BE522AEF04130D9600D5D amiitpandey
221,562,761 *1548ED73A2855A9F6F93F3180C26406E2F090B1E ANCIENNITETER
221,562,762 *1548E456AA48F761BB0F7246D00F4694BBAF0EFA willherran
221,562,763 *154FAB584E6927CAD829E660AC3C1CF47043B0E7 andrew.geerts
221,562,764 *15460D19BBAD2F0A08824F0DBCBB5EAABD04F275 ANIBAL.BITTERMAN
221,562,765 *1548046F8C607101750D7222E40AFF38F66235DD winfordjorge
221,562,766 *1541ED9A49BACF9220A0A4B6AC016FC48621ADFE ANPO
221,562,767 *154957C3315C426C3D0F7EB759392E04CCE8A7D9 A-Part-of-Your-Life
221,562,768 *154C7239B0B77072E3C2BBD0D50CB6CAFDF09B89 WWW.OVERDRIVECYCLING.COM
221,562,769 *154229A51FE5CEBEC8BCDAD1339FBA5EED8A5197 WWW.TOPIX.NETCITYGEO
221,562,770 *1542C9F076BBE6C1DF4978B319DF94F16B093F16 wwynatw91
221,562,771 *15434B332B4CD74EDCBF79E28D854668C10BB6AF XER8
221,562,772 *15479FBF1F640141893C98434BDA1CFAD0066954 [email protected]
221,562,773 *15423946933CE0FBBD01B452ACAE56FCF01384A2 A#)RD
221,562,774 *154F791841AC4936B63BBD7E515BA2B69BBDF615 )x(.o~.<b
221,562,775 *1542EBA07CE1F197EF68B778BF33EA6798458459 ARIEL.SCHROEDEL
221,562,776 *154FB61FD788FA197E1572D220EEA3B0DB650546 arix&
221,562,777 *1540D383886DBF2D7D2985D87E98BA3DC01C0D0F [email protected]
221,562,778 *154318E19F8C0E869621DA51BF3C0AEFDC1C6FDD ASCESE5
221,562,779 *1549B5545F3DBF7565988FBBF0D431823717BB70 asgi
221,562,780 *1549F70B617D53980577C33DB0C968AAE2371641 at$k
221,562,781 *1540AF637738EA94E5AF378C8932FA5FAAE82271 au8+c
221,562,782 *154DC6E856551F598CD4E5D180F9E836915380A8 auo7
221,562,783 *154D89FEB9542D650C07A9309B6E82D9ED9DEE65 zacateca23
221,562,784 *154CA36EFEA1362F67070936865817525ABE0E12 az9ws
221,562,785 *1546227FE00595D098296503329A974FE6728830 ZEPPELINMEXICO6
221,562,786 *154342FB4B30D02444939D2EB726AE88B22BAC2B zfjmuiq
221,562,787 *154AEAB2F825F51AB0060B0AD45D0EDC867733DF [email protected]
221,562,788 *154F4D035993149024AE58BB92C985F4B0954344 B.4PT
221,562,789 *15413440658CD014BB129BF87B9DC840B3E14C72 B-5B
221,562,790 *154E7771A03ECD1DAFFE302CD101A8550ED43933 ZOOTECHNICKE9
221,562,791 *1549D19648592FF43DDB9A54ABC41A94E4764B61 [email protected]
221,562,792 *154DD4D5F5411B15045B99B359984942B47FBEF1 bamerbsw4
221,562,793 *154C7C19865381AEA7CD884EF1D34E0EAF203EBA Z{P%
221,562,794 *1544AF6F4065CE7D129425B045125B5C48DC485D ПАГАНЦА
221,562,795 *154DC33DFD9E3C858F6E0A10795E8CB39D96D22A ПОЕВРОПЕЙЧИХА
221,562,796 *1541260C34696C814D5B754626A951AC24334E70 [email protected]
221,562,797 *154446948F5571865AA108B7AF0CD4C258BE643C [email protected]
221,562,798 *15491418DF00A148BFC0519BED9E6667D2744DFE を使用し、ペガサスaは二段目の上部に搭載されていた。s
221,562,799 *154CFBC762711A76065293E139DB9C81387C7280 [email protected]
221,562,800 *154BD9F2D98F349BB30A972A9282732F546E2571 b=====)`~.)o(
221,562,801 *1542C4AE82A515A32BC68EEB1578A5044B00A86C BPWU
221,562,802 *154D4267F094ED9373BB1347ACB53B9CB099C214 BRADYARENDT
221,562,803 *154B3265E2D2014376EEACA78F57A9FA5AFF9BB4 BRADY.LEIPER
221,562,804 *154B6CEE225506A076FF0D6544611D226121DBB8 BRAINDALLA
221,562,805 *154DCD58AB0F29802BFEBE6B7664F09D57148852 陷落時,它的船員在夏芬斷崖(CHAFFIN
221,562,806 *1542DCCA6517148CA2F337E84BB782E7F873AFA0 BRENDAN.SCHUENEMAN
221,562,807 *154E4CC91E76EA75497F310E1F9407E455A83063 BRENDONLUNDBURG
221,562,808 *154944F1EA8E5490E3EE9363DDD81CBC4ADBFAF2 brentsidwell
221,562,809 *15419D4B7A065EBCF1778725C4D9C6D1090CAFC4 bsdml
221,562,810 *154C3D9201EA84BFD3D96F557573CF3C8A7D043F 0R+H0EP5+
221,562,811 *154E5E3F13728DEA86B511865EE5302D0EEECCDC 1006759 DAS IST SCHON LANGE SO IN BERLIN .
221,562,812 *154D7F019FAE75A6D754C609D476AFD0769F8DA6 10july1467
221,562,813 *154482986ABC298081476071F5E7F0BEC2895D3C 1270409 libran.merkitseminen.yliviivaamalla.on.tarpeen.my
221,562,814 *154661A54A67FD911BD2472EE2926CFEAA75D7EA 12ZEN
221,562,815 *1541B8707F60B4AF47CBB1F0ADC2F2AE6BA21C0E 1578417 KUN PERHEESEEN SYNTYI UUSI LAPSI , PIT
221,562,816 *15473EB503BF650D16B98B8860B19013AAAD1532 C1S,
221,562,817 *1541457B9F19ACBE9BCECF4EFF23D6885A3F1603 193.impeachment
221,562,818 *1546E6885A74755D52973CA5198AE19CF55975C5 196ueberbauung
221,562,819 *154F52893CC90B356CF5CF2CE1C3B27B93009EC8 [email protected]
221,562,820 *154AD541725D50E6D9548D119E78B6CB3C618C86 1ADIESUOH
221,562,821 *1544024ADB29DDC099E5BF1942F9FF34CE2D9193 1 baybased
221,562,822 *154EB4F9AE481DC0350E0751725E307D2DA8CBFA 1.DAGILIMINI
221,562,823 *1542088C6E353238ACE8EA2870315A05A7070908 1DOUBLE-IMAGING
221,562,824 *154DFD52BD243B1A435DDB2A911FE3BBF5CAE2B1 [email protected]
221,562,825 *154A69A51236F9059D93B2C213EAA9C6405F7191 CASEY.ROTANDO
221,562,826 *154605999782222294CBCFEDA9D7D2A5ECCE7646 1ELONIMES
221,562,827 *1546F7CF2CA302EB8AF127568B8762A39F944354 1-emulle
221,562,828 *1540D8BE219B560E3D342D6085500126E6FE9A34 1-erlien
221,562,829 *154B8363473C40D54EFC92FEE0EF3338C82B3B3D CCASTBS2
221,562,830 *154A315A2DECCF66C1B9C5B9E0D36077259BF2D2 c%c,k
221,562,831 *154816FD33EC1FD9543C4ED2031C962B8BE3571F CDOK
221,562,832 *154B5E4E7BD1391AED9673FDE7754FE6E156EFDF 1.KONZERNLEITUNGSAUSSCHUSS
221,562,833 *1540D39970C6745B4CD882FEF74F61144A5E81D7 CECILMARTT
221,562,834 *15473A4AE761DD8BC50E414BED56C6459983925C 1.LANDESENTWICKLUNGSPLANS
221,562,835 *15430C21FC164B9B3C5B9B2331A8FC1706F36510 1 LINEADULT
221,562,836 *15475728F0BFBD20A237EC23496238A4BDB5C897 1LUZLUJAN
221,562,837 *154F18526A8C716040CF557F6AA0828D33CE6E99 centralkyrkan
221,562,838 *1545487FF441D637A107AEEA7ECE581AF2C4F094 1ndel1cacy
221,562,839 *15478DD1A1BF6B7AD4A1623FF1B6753CD2FEEB45 CGZHS
221,562,840 *15489CD9CCF0B3882C4B841E061F5976BA3957AB chantelsilva
221,562,841 *1547D5FF7FB3A27F1C056127C0317626A18B460D CHARLEYFREYDEL
221,562,842 *154BE8CBA21335C3114ECCF5956721CF2D923B17 1 SHATSKIY
221,562,843 *154D35278D10137AB13FFB133F535F4339CE09CE 1 SUKSIBOXIKIN
221,562,844 *1545AC5EA04915283FAFAEBC5B7721AA1BC826EE 1.sysm
221,562,845 *154C4C4EE82D74B8104864DBBFB5391FDFF2221D chess1948
221,562,846 *1548C126EFA7A21F9C5C7CCEB0ABFA31E7C48016 1-vatsalaukulla
221,562,847 *1545EDF3F3012F16C72C9C6FA40DF85CA46262FA CHEYANNE.HINKLE
221,562,848 *154549AE3BE7978FA15E009776E62EE245421A75 1VIEIRIN
221,562,849 *1544F4B6F91798CAC8056A1E7EC098FE1C158DC6 1.WC-S
221,562,850 *154FCC35722EC38ACBB0257CCC5B0CDF837FC021 1月31日、KUKI
221,562,851 *1547CF2987FC325A58B18A4899C11C1D0AD7DC97 chtuerme1
221,562,852 *1544B9B75FC713766C723BC14803145B91D3EEAA CIFW
221,562,853 *1547A4F5917635816FC102EFC7CB5824936C20C9 CLARKSAUCEDO
221,562,854 *15403755054B0EBB55C121CF0CB3C2665FAD30AD claudette.bryan
221,562,855 *15490E99BD95CC37FE4B0AD1A029A2D1F4316333 2558273 DIE-IMPORTE-AUS-LIBYEN-MACHEN-ETWA-DIE-HAELFTE-AUS-
221,562,856 *15429E53209662C38480BC572A030C6E5BFF3335 CLEMENTEZOLA
221,562,857 *154B2F5D7FE6C2007A70DD8F71C152ABF1057C9F CLEOMARUSAK
221,562,858 *1544C7B9B417DF2B1305B7480CB8C6DBBFB4BAD3 2898358 ROSENHAFT , EVE : KAKSI SUKUPUOLTA - YKSI HISTORIA ?
221,562,859 *154673750D23708C321FC816F80051316B2FC839 292132 "kopcasaganbilbeyt,kopkidirganbilet"
221,562,860 *154B579EA6091814BF6A8590EF2A811958992A96 C,,N,
221,562,861 *154DB83D4124FE4B1859B5C2F8F198A078417378 coast guard rescue
221,562,862 *1543A283028FF34A170CA9F3198E42657D1AC1F6 2daralmalarI
221,562,863 *154CD74B76114AFFFDBBBD4520DFFD8176DBAFAC 2DEVENIN
221,562,864 *154518C21823BF822880AD9C648C44EE6D4CBBD3 2ftomorrownever
221,562,865 *154655C9634CAB3B3B322CB55200C88E2C6AE8B6 2.guixin
221,562,866 *154A9B53A7A328C7F75F58A4671F8278C4573404 co.e
221,562,867 *1545F2540395857182028A0C8365BC712F6BB71B c;oh5
221,562,868 *154A2482E447B8C30E0E9C0E994CD2F33B8F0B07 COLLIN.SCHWERY
221,562,869 *154B8A2D03AB82D5BD657B035F7DC29C0EBC50AE 2PROUDLEY
221,562,870 *154A9581278F2464F12E778D3468A61F49ECBEF7 2public7
221,562,871 *15454F22FAD3D8DAEF01600954E338DC7095D183 2.upseerikoulutusta
221,562,872 *15459BB6A36963B9D039A49976A51CCE01D70BE2 2VERROUILLERAIS
221,562,873 *1541E7512682A3C22267844F40267C6CFB83450A comradesf3
221,562,874 *1545D602ABD1E94A3C9392FE08917DBE1E63411D conniefrankson
221,562,875 *1545EE64AC639D2299064382B9F64CA0B67B7EF6 3032pr
221,562,876 *15489BC5262B65CEBF58FD932D929AA0477D448F CONTRE-ATTAQUEREZ1990
221,562,877 *1547F979F95450CC732848DF501E0AF0891404A4 COOKSTREET
221,562,878 *154713908ECE79196DFE94DBAA2A64BCE9265679 3ESACKTEM
221,562,879 *15401BAE7D95DB4CDC55DF7A1CBB49A66A250CE1 3IGEMSBSW
221,562,880 *1549B5CA82A9F0A56E050863997DF77AB4FA1C82 3ILOVEBUCKS9
221,562,881 *1544338657E701AC4228E438D0415B5589CF26A7 3-INNES
221,562,882 *154A7B4C83B81C101D71A0CF7A97AE74F6A8BFFC 3###).~O.~o.(>_<)
221,562,883 *154FDBDE3B93A1338E929C18A45EECE452539115 3##P~ ` 3B<
221,562,884 *154293736290E6C5A852E0933B1B034F318F7C7B 477281 kaavoitus-jarakennuslautakunta13101999
221,562,885 *154059EAADB32F5014BE5E5C04BB4FC5494B7780 CRISTOPHERCUTIA
221,562,886 *154AEEFDB50589E20E2F5F0F6FCC803348BA59BF 4DAINTELY
221,562,887 *154604F360F0401948163C9F212D743E79FE148E 4duke6
221,562,888 *154224F7946F31BF97EEF879BD6DE5D6BA3D244A 4ISIATSO
221,562,889 *154576680ECD4F4256B3331ECB7805ED0B9C44E9 csm,b
221,562,890 *154FE63F4FA8A6517BA52860A51455147B6CC59A ct60l
221,562,891 *154A567A7D1AD21C6404AF2C61C6DC96347D673C 4NOTEIYEMXWID
221,562,892 *154FEF896165C08ABE28998DEF71F191810FE57C c(/tm
221,562,893 *154E80441F15F4475BFFAC7BE59A081D09F1BFB3 4PSEUDOLITERARY
221,562,894 *154304EDBFE1028BA56C096C060D2890266D2F27 4SEGAPIWKE
221,562,895 *154ECC7435ACB1C4FF9B507E9A002F5889F275E8 curvamos7
221,562,896 *154D3CF34B813A281917BE9B33D2D60AB3E2EE37 515-draengte
221,562,897 *1541180932BA0C1D4254968A8B07F89547FBF0BD C+WVG
221,562,898 *1540E9BC9358C9F8F372B62A2B25F0FD15B0F99F 5ANNUSINO
221,562,899 *1548C9C518002AFCCA8FAC029328818ADCF033E2 czetr
221,562,900 *15498D04728A2C72A91177A104B154541AA2AD39 5FJERNLAGERETS
221,562,901 *154C3963EE74C530A9EBE86BAD1D8D1FF1B14DC3 d3ek_
221,562,902 *154D9BC75FCDEB497FBC7F9449F8C3CE4E1DF71A 5LAURASAMUEL
221,562,903 *1546551EFDE49B0606EA38EC18630CCC86767D69 5LUBRICABA
221,562,904 *1543AC95E91A214E99C813D68C67AB922CA19F1B d(6b
221,562,905 *154751193786FFDD61A9A9061EF72803C84F8124 5SACRIFICATRICE
221,562,906 *1547D54BFE464E23EDF6E307F8F5B908F7BAD986 DALLAS.CAMPBELL
221,562,907 *154AA8D90A031F0C7DC39D805814A26EBE88B122 DANDAKARNAYA 1 0
221,562,908 *154B036CB3772747B3672BF1D3E67E7E72DAA777 5ZAKOUSELI
221,562,909 *15476432C0ECEEF9BDA5DDD2B489BA2AAB0F606C 621163 geomed medikal InS
221,562,910 *154A252F056259211EC4CFD80EC7A03658C01D9B 655492 KANTEMIROVSKAYAN.JALKAV
221,562,911 *154247C2E6E75BF6FEB9C3298086886E31554E9B 662189 ULUSALKIMYAKONGRESI,OKS17,47EYL
221,562,912 *154EE9437ECF7211D5A66A9213DC3F704E14FB02 DARRELLLITHERLAND
221,562,913 *1548EDA668C66739624A57E85E062D7366ABD839 6CANDYSHIRLEY
221,562,914 *154D48FFE96ADC8858E5BF957DB52E5C29E0AE9C 6DAHINSTERBT
221,562,915 *1540E0872E1282033678CCEBFFF6F7AAFF1086EC 6DOUGNEW
221,562,916 *154A3EABDC5B7C9004D0F08AF9BF727953607676 6GABLABAC
221,562,917 *1545E4445EDEFF8BD7F2E5E8F8EFD9BC9447E463 DARWIN.LOHRY
221,562,918 *15428AAEC8D6EC53F98DC4C350BD588DCAFFB6F4 DAVIAN446
221,562,919 *1549C237A8FF13ADCB5623181CC8611B5A9D585A dcbse
221,562,920 *154F48118C7EBBE180CFDE563B24A5CE427C9666 6NOVEMBER1538
221,562,921 *1546B54C00D3C844B168F94B57946CAE7F430160 del.reyes
221,562,922 *154C7B2E84F0D28BC9483398C7CF5617210C9C11 DEMETRIUS.MIHOR
221,562,923 *154E009A3E5F61E76CE3F76886606B1C3DD0E3D8 DEMT$
221,562,924 *15408A84859DEE150DB0A3D51F0A93BE773A7B76 DENVERLABRAKE
221,562,925 *154702BADA63AD800CBE966FBB2DB41C904FB77A deonkeicher
221,562,926 *1543F01F96657A78DE8866D7FB0BC298261775FE D(EPU
221,562,927 *154C7D18F46C0F281808F792CF53E2E38437C6AF der-knackende-gast
221,562,928 *1541B112DCABA3A4D90A3C8697966624A59A9596 7CSIPEGESSETEK
221,562,929 *15426685A7A1205DD7C586BFA52D5B7EA595C68C DEWEY.PEMBROOK
221,562,930 *154E15D77617D7A8B043E24FC93F4A53EF4F37C2 7GORDINFLO
221,562,931 *154BD6A4A10D533ECAF0B2169AEE72ABCAD74621 7ILOVEFLYER4
221,562,932 *1547AD2D8251C68EA3069E88578F454B0D029B88 DI(I
221,562,933 *15457E79B9C95793B67A808A208100957F61510F 8######>~`(0-0)
221,562,934 *154F0CF0719875C8F76155C4EC787F20D40ACE2B 8BSWINOPERAB
221,562,935 *154831D00F5F01BB96BAF72C495440C7126A9B2F 8CWEOTHATH
221,562,936 *154C6C31605CF5EDD1364D9F98B1F1C89DD9ADDA 8DECIFREREI
221,562,937 *154A2B360E8E169B2F1628658A67286F809309B2 8FORTOLKNINGSREGELEN
221,562,938 *154378EC8CBAD8391CAC6711AB2164A70DF2A1A3 8GRANAATLANING
221,562,939 *154395668C0F181169948D910C24791F24BDB7C7 8ilovegabriell5
221,562,940 *154165C48F040822460057919A8310CCBCF3BB2A DOI101038SJ.EJCN.160
221,562,941 *15465EBEEF4A2D305ED01F3A51E9B53AB3979D52 8MARSREYNOLDS
221,562,942 *15486938784FDDD18737CECAACC6A664680CE5A9 8metaboly
221,562,943 *154C06410F862F705531C50AF160AC6DB3AA46D7 8NASOSINUSITIS
221,562,944 *1542C6A187A7ABE4475EA546D6DB8BB3F37A99BF 8PEACEMARCEL
221,562,945 *15424CFE902356D0180FAEA5F37429046DFF97A9 dongyero
221,562,946 *154C5CF2B09A79104E40A353C53C7125566D9D6B donncoffie
221,562,947 *1542827D9EA66BB8A0072084DA3E09DF927F8DE6 DONNIEAVELLANEDA
221,562,948 *154E0CA7FC5E59BEFB27E1AF57C7B4CA7C5F03D3 DONNIEVARAZA
221,562,949 *1540A5BC3873C118D704C6744D73836E74FD4E13 do&pb
221,562,950 *15484BCEF386C055A15CEDD825077A7833CE1086 DOT-PRODUC
221,562,951 *154E585CA83E6775ACD08D29BC0E9B33C8124FE7 8svanirete
221,562,952 *1545E3ED6C58E558D68C83B501985E5112BBFB69 9BAJARIN
221,562,953 *154BA6AEF583C41BA2C83FD12BDAFFB1D277DCEC 9BOOGIEALPHA
221,562,954 *15433098EBD712C22977F529A5999C95ED85B33C dresomen
221,562,955 *1549723758670C0F12F1018C74E96FC5086EB735 9DESUETI
221,562,956 *154591725AC421BF1E02D2BA9960D759BBE71DE3 9DIEPSEE
221,562,957 *1540A0000D3D868623BDFAD0CC909A14972424C9 DS\F
221,562,958 *154480DDB06F2C4234084AF5B33BA144FA13919E dsvvr
221,562,959 *154D655C99F6E51E3F3736222CDD42E04FEFE20A 9IMAGINEUNICORN
221,562,960 *1540214B38C13AD10EB461960495D4D7B3ABA334 DURAN.LOWE
221,562,961 *154B5A08C8136953183FD0D647A96B0A1BA72EA2 9KNIGHTBIOLOGY
221,562,962 *1548DE2491A26425EF5DA1BB11175F095A82FA77 9OFFFIND
221,562,963 *15461564A94DA28966057E933959150821A3E9D1 9PRSVITNOST
221,562,964 *15475D670AAD7F3F6AE3C578B4456C2BE98C1537 9RECOMINSABSW
221,562,965 *154177C121C5BF4641AEA094C4FB8ED490160AF6 9ROMANPIERCE
221,562,966 *15487E4DCE52FB41BB93B3A42B77F686960A8A5A 9SAMEDEN
221,562,967 *1545427E951E159818CE8BCC034823A758CC80CF 9SPAERLIRA
221,562,968 *15408C588225E094CCC87C99333EF525A0D94A13 DXWIF
221,562,969 *154FB74BA7C05339317E394C6F065FAAA4F17AD5 9TOIMIVIIN
221,562,970 *154B3BFE3A19A7CE98DE76B2D39B1155BF503FA2 dyspep+c4l
221,562,971 *154F187B3649B1FE63745E873B052D2BBB1F9C10 9WUEENSTHCAJ
221,562,972 *1548D4F84C5B2A9B70F6CF9D7DA0EB4BA57CFD2E e2"m
221,562,973 *15426B9F6CCB5594919D96E28A2A6DE5813D0729 EAPNEGEG
221,562,974 *154D890160E69B261636672FA8DFE186A017EB68 earnesthofland
221,562,975 *154490735BE4081F16B3917AAC17340222DA013F EASSAKIN
221,562,976 *154B901A1596822CB1E60DE378C4FEDF270FED93 A8HOV
221,562,977 *15406F3C1D29BD67E3569DA8B0B9C37B83870EB9 EDSON.GALLEGOS
221,562,978 *154519E36B314A3AFE280668DEF731EDF8964BF6 AAC<?J
221,562,979 *1547DCB1B7BABE2C3AFFE30E4AB52758A3064CDA AADV:|
221,562,980 *154B2DE482DBBC1A49E544C17EFB70026B64F2FD EFARBTEMING
221,562,981 *154AADEE243DC1A40C1BCE594082FA0ABF4CE47E [email protected]
221,562,982 *15446EFA2688B5ED5AE14E63B76B17B3D1724F23 A_ALJ
221,562,983 *15433C74B8BC955D526F94B20AC198FF97DEFECF AAUSTRALIANMORNINGSHOWS
221,562,984 *1545CA9C6981D68D896B5B02AB9744A29B22CE87 ehclewdn4
221,562,985 *154B37FBAA5EA0B951AD57111E9379E53E751CDC ABJEG
221,562,986 *154C2E8A74650AF8B0AF91A7BDAC563EC11BD075 eldenwhittman
221,562,987 *154CB23F4DF8157BCA31130540DF506F0458BF94 achoppant6
221,562,988 *154704448A54D7CDE13FF6EBC2C12D3795CBC470 ellenkezoe-1
221,562,989 *1541358C71D841690BBB4E53C3AEF1246AFA8594 ADANPROSAK
221,562,990 *15415A7051647382C37898BDC864368780409940 ADAN.RINDLER
221,562,991 *1542FCE3093AEC46C4C9C49F3DEFBDB18C6A742D ELWOODTEDER
221,562,992 *15488E67C86F64EAC81F9E85CB57C7FC8BE401E8 EMAHETA
221,562,993 *154668C9F97CF2F38E742098D7354CD258412079 ADMIRALTOGOBYELEPHANTAUTOINSURANCE
221,562,994 *15401D77BE39EC8128B62950840CC376DE9D2058 emmettbavaro
221,562,995 *154B8DE145A522360970D5D077E41A7404B7863B +EMP0RALI+IE$
221,562,996 *15433F4CA3C4D1A900D5F5FDF9FC49A66EEE3154 empaste3
221,562,997 *1540554C0AC3504AEE439C3EB5E9324C90B610FD enbeatlessang
221,562,998 *15451CA68512F52D06F110AD5B2B3371E93C8C41 ENTER-NOTHINGNESS
221,562,999 *154B7880A8573BB68FD61A9A95D65F8118A65B67 AGR)U
221,563,000 *1546D457245D091AFFDA557FA3E85C5541BF405C ah9u
221,563,001 *154F2E785F9E791579BC91C737D346E3B6110E3A EQMV8
221,563,002 *154514C1FB640B6DC7BE18C86D9DD757BC2580BB ahmedveillette
221,563,003 *1548F55624444CBCEF36D3249503F91E63F3EB9F aiguille3
221,563,004 *154E4DAA16ED8FA046069DF0283C4D5B5B02D434 ESADIMUK9
221,563,005 *154FBE2BCF757A86C42AF959C5CC5C1F6D0BB607 AISSARGSING
221,563,006 *1541C31CEC3392FAA76EDBAF870CEEBE36BF3891 akal1
221,563,007 *154756E74C2615FE30711C8FD7FDCFB3F8722EC3 ALDOSMSITH
221,563,008 *15464BD8DCD7F2A983B03A96F23C7892D7CDD53F EYWH8
221,563,009 *154C111BCF5F87E4214BD1E494BA7D0E1CD2AFFC ALLAITEZSED
221,563,010 *15481FE2B9AC2057185F50882A289B487F4815D3 alphonsomcgrory
221,563,011 *154610C6AF4DA472B036B5FF5D05167B5BE0C1CB A,LR)
221,563,012 *15497DCFE5E19D54F231B7A5BDC7863FFF4053BE FERNSEHKÖCHIN
221,563,013 *154D1854C183E20417F49375C381B87A60601440 amelinocameliatalka
221,563,014 *1545FD4567176B44320CCECBAE0E8C47AF3B3D6E FILIBERTOLAURIA
221,563,015 *15463F40A2177573CA4BD974AE0718DC31EE6566 AMMTT
221,563,016 *154D9C94829A8C6ECC268563315A2050B277C35B finnegan595
221,563,017 *15451F4AA78F4CAC62BBEA70819C92948CB3FCDA an3g%
221,563,018 *1545450741D578DAD426253DED64E24FF2E9F059 anabolic
221,563,019 *15431F7E046CB334E43A083C0874EF863439AE9C FRANCES.REDDIN
221,563,020 *15429E5125F25FC54C9C9E008DDB7D07EAB20818 [email protected]
221,563,021 *154F27EC743C81189410B4ADF2559394378A3D06 ANIKA.MAISHA
221,563,022 *154295C229B35CA74D0063D66BE308ED6ACE1AC2 FREDDYMAILE
221,563,023 *1542A92D7B2A5795572F444A82C0A24C5CAAB479 a#+$o
221,563,024 *1543A6325AEFA31454DCCDF484B1D37EAADD2905 FRIBLADET4
221,563,025 *15410ABD13ED960D48AB8ED2E41B61108C9A14FC AoC3
221,563,026 *1542C0D56CF9412135F0408936ABD4CECC775844 AOHAJ
221,563,027 *15425D83162BB225E747E543D6652CC650C20408 APR1796
221,563,028 *154D7845EC177FE9E13851B2FDD1562F4D803736 GABI MACHADO
221,563,029 *154EFB3DAA550AD213BED5711108EFA0264224E5 G-AD
221,563,030 *15419E1EABBE54768AB707E4F1367638DC4B9C80 ARNOLDO.MIDDENTS
221,563,031 *154DDDD2AFCDB27A58503EADEDF236E185EA4E73 [email protected]
221,563,032 *15492FDCCE6379A88699568DAD3D4A775E9352AA artemisa1104
221,563,033 *1543CC39DBCF7459FA4FB79F029ABE6B16D9C78D AS"CY
221,563,034 *15417661AB7B393203BB6040EB75463BE0575BBF ger0n+0l0g!5+5
221,563,035 *15416EA669E384D4523E3B55EC38DDC79925573C ASUKABUMI
221,563,036 *15429EF90ABB96B50EAB94B2687A7452B0063A73 GIGIMARZULLO123
221,563,037 *154FFCD1E2B82D8A0871A3A477978E7DA1A5AA5D GINAG7
221,563,038 *154003463B519939A6CB256D45871F76A652101E Aucr
221,563,039 *15484DE8CABEFB691BE43A5FE6C00F7A20C91461 AUSTRALIAGLENELG
221,563,040 *154FFA5112B9084D9AC20F58FF6CB6564BEEE6C3 AUTOWRAPSING
221,563,041 *154FCA3E6EE043B7DE9A18885BBE5D511EC70E5E a#v5d
221,563,042 *1542C818C75A7A7046DA0F3F2921DB9B2D1D6E4B gnulhazo3
221,563,043 *154CD1990BAACEAA0F1A198D2BC432DE54AE6E44 avgy
221,563,044 *154EF5ECF50DFBA960070F5B6C114C8FF5CD772B GONZALOHYON
221,563,045 *154F42D483A9C89FAF7F9D1A8CD8E3A24F9A34FE awi2
221,563,046 *154D19E22019E88FE0E9D44F3AEE137E81CF2EFA GRANDMA'S.KITCHEN
221,563,047 *154A57FEB49E062A9BBEB9A6477B0D0E451BDE7F b1a2j
221,563,048 *15445541058526F50C0267148DDBC9D8B805B014 B5"VP
221,563,049 *154EB335B58F08BAA0C534EB8A182A2057AE1A34 b6ux3
221,563,050 *154021B83164F98BDC4ECDBD6248B4322088FEEC b8mvl
221,563,051 *154755705DB53B549B879A660506CF3C862FBA7F balh
221,563,052 *1546B34A698AF054951EE030E471172AD27E1014 h6:n
221,563,053 *154F055CB3F8BD8B1FA3D540B418D172048B320B haci.bektas
221,563,054 *15476F12C513607B5D88F3545B679588A087F874 BASIL.DEFENDERFER
221,563,055 *15490BA1225E0CD39FCFC26620D5CAE3A4728FFD basilica.de.la.santa.cruz.florencia
221,563,056 *154D167794BC561BBDE41B6E3F06EC71DF4948FB [email protected]
221,563,057 *15402B7C4E1DEBE67B0D070D760DD831489AE2B9 BB!"S
221,563,058 *154BF9A88C5541802ECE90BA9B9E4AE7F5B1F3A1 harlanrost
221,563,059 *1542ABDB850C9D57D2E18116113A3FB58CEDD7DE BƏDƏXŞANI
221,563,060 *15487B77FB558E57AFED53145C38EFBC52AA0366 behsgirl
221,563,061 *154883552BEDAAC2DC5A033E309914D92C5B4F6D [email protected]
221,563,062 *15431EEC4170052DE4882CEDFF62A4563261DD58 harrisonseekamp
221,563,063 *1545D1B495DB70E61275EA6AB421B7C7A8EE77A3 BERNARDOCRABLE
221,563,064 *154CD9C0E2DC2655D167A3946617353DFCD488F2 BERNIE.TAMS
221,563,065 *154645B5FF6B6072AE7D4190F8E682CA976796B4 HASS CHAMI
221,563,066 *154453F8B3831A943ED7FCD99A18288CFDA56ADD BERT.SWOR
221,563,067 *154ACCA25127938AF076B26E0CF2FF9F221A6DEF best-pack-yamashita,-tatsuro-ii-1979-1982
221,563,068 *154AA065F9AB2DB106475D0385885AD18FFA7F84 bfaks
221,563,069 *154D0E96F197019A08DB3C8D708C1DA0BDC59FDB bfxul
221,563,070 *154E86BEABB858FA92D8A5C0CD4EB856AC3C152F Hejvem
221,563,071 *1542E89309C6B528BEF05D0F6A07D16757742687 helluntalaiset
221,563,072 *1542156FBD713ADA0E1CD6AC6D097F63727A4051 HERB.PROESCHER
221,563,073 *154AA74D8BB8C128C29CE61CA150E1EA72A9A47A HERB.VARN
221,563,074 *154812C7E9AE620F24C6356B87AC96C74CC295B0 bhfp(
221,563,075 *154A4B9A1AC90D32E0AB99A4F0801E2F83E52800 HERSHEL.BENNETT
221,563,076 *15468D11DFB3E4F7D47BD9E940FC12067309AF48 [email protected]
221,563,077 *1549FED177B00C15CBE4E62B66FE6208593E3997 BIRDSMANY
221,563,078 *154BCB19730AED816628D92F64E58A011C9C9B47 H|G}
221,563,079 *154FC52844EBCD36B70EE661F26CA8F95B0D3808 b_jl
221,563,080 *154F4298A5CA20422F7D2E92D8FB5BDE96935FC3 bl7k#
221,563,081 *154F72C9827E6D9B07621909B68B812F40954E82 bldpa
221,563,082 *1548D79D9719FD8388ACC67E346A00C609AB03DD HOCHSCHULUNABH
221,563,083 *154A24697034AF42D0CCBB28925D421A3A9EF23F HOOKSCREWING
221,563,084 *15435D3B41D099D5522BC48F0D35D3D8E7D7C284 BO#AN
221,563,085 *1543C28878A748C3A8B192FE704A093E3E4DE208 hpcnddk
221,563,086 *15407CCDB1DE5ED73766048BC67B4412769B7350 boraxusta
221,563,087 *154E015B63DF1AA6BFE0FD9ACDE53028D791D49F boydcrummell
221,563,088 *154C846C10BECE93228762578E2A79174E7A7AD8 HUMBERTO.PLEW
221,563,089 *15424CDD917737D7DDB1C9E1B016C837AD15360D hunches
221,563,090 *1545EEE609096323F0782C749F16BAAA52A94D04 ICEPICKING
221,563,091 *1545AFF53B34F1DABD5A8AFB04AFC58E2831FE0C BRYANT.KRAUSE
221,563,092 *15446EE8CADBC48823AD312B5CEDA02C3EE680F2 ILIADIZES1
221,563,093 *154BFA822DE4807336F32D26415CEC23FCC47C1E b/%u#
221,563,094 *1543B0A6A0C203F962C4CB1A44058CF81A3E73C8 BUSTERHAZLITT
221,563,095 *1541C16A878302711A5456E81E1D068B29BD650C buzuki orhan osman
221,563,096 *15462078840B5507DBED41A4CFD3C4BF7766EAFA INDKAPSLEDE.
221,563,097 *15443450FF63A3021B8BC09C2F0141CFDFCE8E17 CARLA-DIEFFENBACH
221,563,098 *1544CA88CA05D19096DB031F650365CCE01B3D99 CARMEN: ACTE III. "
221,563,099 *154A1A2A00D83679FF1E50E9891706244C88B61A ISRAELBEAULIEV
221,563,100 *15481CCB22053C37D1858DAA6FFF317913A60CBA IVMELERININ
221,563,101 *1540FF536871FC8217D558A9528CFD527676A94A CARMINEWIDMARK
221,563,102 *154E45B5FB5A4ED9113731042116357219B2651D carywelsh
221,563,103 *15492CDE473380884E4FE4DE0F11F709A5C63183 CATHYTERRILL
221,563,104 *15400CCC000583FF68165E7DE0A22091EB586AF5 [email protected]:
221,563,105 *1546BBEE1711B355B52CDA7E7753F0FF3FF8E3B2 CEV-
221,563,106 *154ACDDFFE2491B296EB0C89DE25BD584A22CDF3 JESSICA MANEIRO
221,563,107 *154D1898CE281A154E0FAB058AF69228253EE453 JESSIEIHDE
221,563,108 *154ACD640574ECA81B7FEFE6D59BF3A29087830D CHARLIE.DELAUGHTER
221,563,109 *154E77844D68B6F436EE9BE4DA0C5BDA0E196783 CHAS.ODON
221,563,110 *1543665588CE5AFA4491E9720A1BF8C076F9C0DD JEWELL.RIGGIN
221,563,111 *15465C4FD62D5553D3480CD38953315F3FFE8ABB JIMMY.SOBANSKI
221,563,112 *1543B3BC5BA6A6CDE824DE9D2E98287407905BD5 chenehutte.trevescunault
221,563,113 *154B246FDF015D1716C834CFA05658D925EAAA90 cherret
221,563,114 *154536538D98334AB9B428D65820EC61D14C5497 JOEBLACK
221,563,115 *154162429F490F313D7AC856CBE4134D2FC12B10 johnathancorneil
221,563,116 *1541CC4255CD0DD689F3F17A660B936696329FA1 CHRISTIANGOSHORN
221,563,117 *1547CCFF8C65B604B7851E18B8B0B6AFDA2ED42C CHRISTIANLIBEL
221,563,118 *1540D2D810720C80043C9BEDF4E08B569EA8304C john-wengert
221,563,119 *1542A602D57BF11821319DC39D9DBBCF8E40BFBF CHRISVEILE
221,563,120 *15432F5DDD79E79E62763A80D9DEEB44F5D91DB9 CHRIS.VEILE
221,563,121 *1546840A03A0AF8CF218A9136DD87026798277E0 JONATHON.LAYEL
221,563,122 *154A440454A78A9CD913048E63B905EA0227929C jonathonnewquist
221,563,123 *15428B42368BAF0FD5C73FCB25F3C34441AF89F3 JONNYHAYES
221,563,124 *15469AC2688A2DF3C4D93BC7C80FEB99BA4FAB25 jorgekaeo
221,563,125 *1543F873E0588AA826021059AC318FE70290FC52 JOSEFCONZE
221,563,126 *154C5A8B11713EB34E00A5346AA750BF814D443A cisxp
221,563,127 *1540037DC709E0689C0E9178227CED63FD366548 Jotas-de-gaita
221,563,128 *1541507E8EFF353C86572A5154D23BDC7756527C CL2
221,563,129 *154B4D408B9DACCA4F6DAA59D5DEB784FD18FB2B JULIUSLONABAUGH
221,563,130 *15422835DAA5B50F50406B5F23A71C52216EF78C CLDIC
221,563,131 *154EB62D8B4BA23E4E46C78FA7073AA7B72E6D31 JUSTSMASH(FEATSHAKE)
221,563,132 *154AC55DD72BFF066C220ABA57FA9EC62953EEE9 [email protected]
221,563,133 *1542F9DBE9D4205096861659FBE5FA67B255092B KARL BORJA
221,563,134 *1545D15C3D1C6FD6B3777574CA70BD6A9DB5DB56 karramba rap (hard mix)
221,563,135 *15461642D44FAA11FDB9086921EB8920AE07FB21 KATOLI
221,563,136 *154DA12C09B41C2F7CA3C3EE1079429C906798C1 KDE920
221,563,137 *15453364DC261A1F974587C60B493186A976AE41 keely958
221,563,138 *1542C2CCB1DBEBC27F4ECDCA40488FE25314F374 keep-your-head-up-(feat.-razah)
221,563,139 *1540B127945FD9FE5B50E53746C021D6443B777B [email protected]
221,563,140 *15416026D6AF69DE63EC81AB393F3B0C74E0B90D kelvinfucile
221,563,141 *154D1BC4C4391DDE0D875C6F23832A89F9C16A93 cnqzijq8
221,563,142 *154FB357B3F2029BF39C2EFA2DD4965A57EB3AF3 KINESISDECADECOUKKINESISDECADE
221,563,143 *154A7591AF66FF71BB05B23584CE74B13DE8B08E KJAERNSMO
221,563,144 *15437F12B1ACB90DFEFCFD87B3C2A970438ABBB6 [email protected]
221,563,145 *154DE4F19E30FD58F8FFFD251DA1B1A7C397CFF6 KOEIMIS5
221,563,146 *154AE22E45552E9614C798F4412744ECAA07A973 KOTIKKITOK
221,563,147 *154C63FA3A59FB6666941B2E29FCB2E829CB39B4 compromesso9
221,563,148 *154FA48C5FEAE1993279A8DBF17ACC80CD1F65CA KULAHCI3
221,563,149 *15480AA0BF740B9F54C8456E56F501D85EB16CC9 [email protected]
221,563,150 *154140D30E9B08127C56C38A69D557BE400EBB61 LACHLAN FORREST
221,563,151 *154A5AB81312C5AF8EC57B7AE4D58E2A22184CF0 LACYKADY
221,563,152 *1545299AEB1B2FA88CCCDE249AACD72CCE6A53A7 LAMHAC
221,563,153 *154BFB1A34A0DAA150878832A7A0F8221A88EA4F LANNYBYES
221,563,154 *154CEEAF825A0D958A5CD8EDEA1A0311DD39269C [email protected]
221,563,155 *154B520D1CE80800B555A2D0F0D3C1C67EC3C17F cpe:
221,563,156 *1545FD1D0BD343688D948E178F16E590A312AAD2 LAWERENCE.FELTNER
221,563,157 *1548ACD3EC1F32FDC19DFAD65B46EC4043FD4FE9 cqh;e
221,563,158 *154BE0E9311BFC1807AB565567F3AD6D0C542434 cropmen5
221,563,159 *154B290DB4F539A973EDB1F55116B4BF5327938B CSUFK
221,563,160 *154888762C9C95E6C4764EC5F648CC64844F0BC2 ctpwr
221,563,161 *154A5F9393DE298073BD4738535CF1D955BF5730 [email protected]
221,563,162 *15437D053040ADD6076BCA0EF23C49C5B2AB19E5 cwqgv
221,563,163 *15420E7BCEBA9273F8EEE6A30D1F20381E5100D8 LIMLARIGA
221,563,164 *154EB2AE91C08229F782B8B4CD9486DE331F9F48 cyxwh
221,563,165 *1543BD26009A1F15D5D4800EB3220D53E463A457 D12776660235700
221,563,166 *1542EA6C8A4E867DD4985AEDA0012E4085651656 d:5?
221,563,167 *1540FD86E6CB2E54736D2C84679F56CDDA5FDF56 LOMJANSZKY
221,563,168 *154998A7339F0A9AD17FDE02720ED3E0107E98A3 da+ok
221,563,169 *15494BA81BDECBEB4E9E2BD21B218D87D921CCB6 LONNY.TROIA
221,563,170 *154BB91E8CED84516EF7083EE190752512B85ADD darktron (pulk remix)
221,563,171 *154CC3D3E836C6C87EB793AB3B03272B48E23EF7 DARNELL.EVANCHALK
221,563,172 *154ACF30B753DE7195FAEA2B17FD56473D619455 LOTLGL
221,563,173 *154D1745AC3F3E42AD5AE1A2BD8205D54B19B964 louisclaudio
221,563,174 *1546569C05A5F77D7C62DEBE5F4318839F7A0E34 darrickalhambra
221,563,175 *15429141FE8450D512DFC6B771A831CBC02C0D03 DARRYLHUFTEN
221,563,176 *15459130A356E87A605FC6C20E18C4F1AA8AB3B6 [email protected]
221,563,177 *154EB91A2112176A4F0F8DAC727A39CE372CC340 DAVID GUETTA & CHRIS WILLIS VS. TOCADISCO
221,563,178 *154CA30492892BB3DBED82CA030554248538A909 LUCIOSCHIMANDLE
221,563,179 *1544F0FB2A390DD453486A2C315CD6AFDBB788B6 davisperrone
221,563,180 *15402A7E7D15EBE5E93129C4CC697FCEDF036DB3 DAWNBSW8
221,563,181 *154721E02F15C3F2467C37D2BCA440E6C190987D LUIS-COBAR
221,563,182 *15444477F46778B1DDAFEFD3458A8488EDE5B1FB lumbari9
221,563,183 *15454FC9893063404AC5D6A3B678DB452CE4C800 DECSEUQI8
221,563,184 *154F49614A1981A0EAB68CE4E0AA8E0AE41BC829 DEEJARA
221,563,185 *154CB0EE431143C2A05405C265CFE8116C2E5624 MAJCTOP7
221,563,186 *15462A4DF22D4305375820DF34E7780CE942BA6C DEMO.1996
221,563,187 *154AFB619C73CDFBE161847F9B344D29E82AECF3 DENNETSU5
221,563,188 *1544CA37759B5ED92547F6F25BE7C6C991FD0D34 MALIDENOU
221,563,189 *154B098D3BB6797EAFB8D9B4D6B72D3C7CEF8251 MALJAKOLLA
221,563,190 *1541079B9D2D0A4556A45C3501891DC0DBFE2C22 MANSOUR GANJI
221,563,191 *15471B8EED4460C487EC0603187886367A6A6166 MANUEL.BURNEISEN
221,563,192 *154C6EE22ABB0C6A13DE67C34B097C62D13E284D DESHIL
221,563,193 *154CFB605604A056EA76912F54B3C1654AA5132B MARCELLUS.LARREA
221,563,194 *1544A8182050ADEC3ABF9CF6663659337760DDB2 devinbuszak
221,563,195 *1549147641F9A26AD02A7F60C417F13032D53E6D MARCO.BARIMAH
221,563,196 *154695EF055055F35381E4ECA04F14BF367FEFFB MARCO.CABASSO
221,563,197 *154F8BC4FE62B481AECD5596135C08F151330BA3 marcoraglow
221,563,198 *154849E809FEF72D7C864AA382F5FE4FAA396137 marcusflorez
221,563,199 *1545FFBA97AD62BE33D5724E9D526C134EA3D057 marybeuter
221,563,200 *15421C4677EA45B7733DB2A6805ED9F9C4310CA7 MAXLENO
221,563,201 *15438947C8FCF57590307FEEB070972C018F1C76 meagerdiet
221,563,202 *15405F72798949B761B5E3E09D628B6E44F5746C [email protected]
221,563,203 *154DC24032C9DA1BE86BB3B75F927228D4000AC1 MEL.SUMMERTON
221,563,204 *15444BBAD86DD2CD947684E32BB37176B366588B merisers
221,563,205 *154D752D14602116AB0530681C3DE196A12EC741 MERRILL.UYENO
221,563,206 *15406025AF3028F4D02B6124465EFAA8BF6BE2BF MERVIN.BUSKOHL
221,563,207 *154A7D0CBF1E6A7FEF28CAD23D42ADDFA3468CFC [email protected]tycom
221,563,208 *1547E781A97D470A23DEA545F20DAD6ECDE493BF MICHAL.GAHM
221,563,209 *15430276CDCFDD5636AFB81F28A867D933B1C9AE DKA,O
221,563,210 *15425493E59F04EAE7DB21F4EBD68151FC8C8921 MICHELSWANEY
221,563,211 *15486B41CA6EE7D026D42161E4836090ACEA0C2D miguel.coloma
221,563,212 *1541695F9D16AFEE44EC2F3AD5DF51E6A8AAD3C5 [email protected]
221,563,213 *1547D9DFC94E2F77C7420573BDBC9F90F8C948CA minhostergard
221,563,214 *15425C57BC58CF765897E69C3C7FA2DED8A4B3B4 MINIKRIS7
221,563,215 *154383E506C1CA35A4790128433F11203A7C156C MNEIALA
221,563,216 *154E66B147A6666535B89FD198BB574F640D2FDD MONICAYEO
221,563,217 *15479A21781BC4FE630448A2435593478B46F150 donnellspangenberg
221,563,218 *154B2FD1EA54E218FD3D32DD9890AE9F4100589D [email protected]
221,563,219 *154D8461C30C83DD448E30DD2E310CBC28E308F4 mrshadowing
221,563,220 *154AA5EE5F54D14A2F0B3FC97FA0E381E4FEEBBE n2=mageslayer
221,563,221 *154BC29CFC77D2132821751166F2E89462BA9B63 NAMIRA-CHOWDHURY
221,563,222 *1548B2E9E0F4154DDC56344B2773E232B05D1F11 dqn)
221,563,223 *154B8CF64D5CEDC07F02B689C78265A8C050E6ED drf0_
221,563,224 *15484F1736CF13426AF86E5A0298C537C4C8B683 ncxebsw1
221,563,225 *154E4098F96F0561888EFA82374EB66B76DB1851 neoteven2
221,563,226 *1540D0E3FE1829D8BF1B1CA78B5FB795A6D98FDE NEVMENUETS
221,563,227 *154F58CBFB1AA8A726B0ED29D994D3C593F88924 DUSTINWHY
221,563,228 *154ADC4831DF01022393A211155B5F13D100C655 duvb2
221,563,229 *154978F63EBAF9F8B4F49E013AA2ADEA4BD8C1E1 nick-catchdubs-&-dj-ayres
221,563,230 *1544D617A49B25D8C32E3A7D92EC632585ECFF43 d%vp
221,563,231 *15449D60B2A1178C1891700AAC8B65B5F5097788 dw;sl
221,563,232 *154C6FD9A06FE8BB7BA7796214E06E3C87D38D43 NIRAK-86
221,563,233 *154F16F63B46D8752A6481E79B4B85B5923CFEC4 NNGOLD3N
221,563,234 *1546925804E9C1908719ECD2EC94145881E6AE2D ea:7
221,563,235 *154083DFBB8C71CAEB3874F0799CD7B4B93DBDDD NOCELL
221,563,236 *1545A186B9D5FB3115405614413E465221EA5AFA NOLANANDREEN
221,563,237 *154008CAB51EC21B211F72572B3DD516CA1229B0 nonquantitativeness
221,563,238 *154A0F00EA800054487C37ECC6976B6CCD5D8A61 nowchronic
221,563,239 *1548FE22CD5970FAE4144698917E95F33E1F209C eddymoline
221,563,240 *1542A4E71042D432AD31145A39DA8CF275F367EA EDGARDO.GRIMME
221,563,241 *1540760DF02D4FB7658A8940D16938A1FAE04700 ><O~ 0~ <8
221,563,242 *154EDB8BE70E2F45F708BB39DBD502DBBD97295F ojn
221,563,243 *1545B94AFD8D32321CD70DDF4FDA0A40D456BD10 oliviaeagles
221,563,244 *1546F654DCEA48879B78556EAE487FB069588FD9 (~_^)-o~-(####p
221,563,245 *154880670F1E734E23E741A81D172A956C220608 ORTAHISAR11
221,563,246 *154EDE8AFFC39735B28A4B186B3238C9D61CA871 ELISSA-LEIGHTON
221,563,247 *15469B2DF82CA011BDE138700EF215868EA55923 OSOJOGNOC
221,563,248 *15475C5324CB52DF8CA5A5CA78D514844E93E215 ELTG%
221,563,249 *154EBA9708CAF345923615370F25720FFBBE5C12 elvindonachie
221,563,250 *154A7BD21163ED5CE0EA0624FA7F3E8CDA75A64A elzaburo9
221,563,251 *1542BA848E779570096A4340A351C975D033129B EMILRICHARDS
221,563,252 *154933ADB61F1BEE52B66D7139EFA0D1792BADAB EN117.99.20.7
221,563,253 *15438FC2BAC87455BE02F76B65FB4CE82D695E09 encaq
221,563,254 *15444AD42BB9C98B0916D57557C37001E230F4B5 PALOMAYSARA
221,563,255 *1548AA33366777E7ADAD3053FD713F20E22A3836 eppuoh
221,563,256 *154381FB6D9719A24B7F4C9A3B5982D6ECEC4970 PatheticWorld
221,563,257 *154C7376A976B389CF587E04CF1DADF4D5F6B012 ERVIN.LIONELLO
221,563,258 *154847E5A0E5920AA39D008D2FAE5C41FCCE10D0 p##B-`-o->-<
221,563,259 *154201E7C0E294A7E03BB4DE0939D75F23F5B64C ESNAUWDE2
221,563,260 *15458A5132B2531F5761CFF102173BD9C6F3C596 ESRUKNEZ5
221,563,261 *1547C22E5130F0E5579DE4384D999982C037450B ESTEBANCARGILE
221,563,262 *154D2C7C3185545A12C2D82E891A57F33F07FAEA PEDQNUHZA
221,563,263 *1543D236BF35A078D56ECADCA873DDE0C93867B0 [email protected]
221,563,264 *1542021051778901DD60F00B2A39DF97B2934494 PEPHREDING
221,563,265 *15430BA102D243A64741A59061EC75A4FBEC27EB eugeneantrim
221,563,266 *15406397977B6E1DF142F7458164162811E9BF09 eul09!zer5
221,563,267 *154D198A911344199B1ED09CC54E4456B0294ACD ey6baa
221,563,268 *154B60B1CA036C0F23F5592E2B08421322732509 F55843
221,563,269 *1549B828BD23E3962DAD7C4724D4BB2F5E712768 philputney
221,563,270 *15463CBE3F9A8A0A0B4201C6B7D1BBE3C46C8F96 faufil4
221,563,271 *1544558A35B0104C922B835C77A9E726F18E1BB5 PLSAINT-SERVANT
221,563,272 *15430822FC57EE0B7ED64B1511BC8B4C15D87061 POBLACIÓN DE
221,563,273 *154D214BDB81A0AA1A568DAE7E3227E18ECAA177 FELTON.SHUKERT
221,563,274 *1546780D9417BF4C6AFEF05E37C9CD40AA3CC73C :PO~O~DP
221,563,275 *154DB0D6CF486F4D290222FF99D387F9CC456D27 FIBROUSNESS
221,563,276 *154CFFCE908984FED4ABE711D952E5749A02615C FLOWERY.A:.FLOWERIER..FLOWERIEST
221,563,277 *15406AB759939A8229B3E19C010B60B59B1AC6EE [email protected]
221,563,278 *15477742A968F32C76D1548659AE058764B9808B fogueiradeumapaix
221,563,279 *1545DBBF3849473092C43290904340DE7E851547 forrestbaston
221,563,280 *154747B0B7F83EFD9BE15DB396712963FED18CDA FORSIDS
221,563,281 *15493CA6BE1740A8FCEFFD0BFBDB95D422FAEBC0 p.r.-mcmerfy
221,563,282 *1543E5975CA8976BC7640CBA713B0935836165CF FRANCISCOMAGALLANEZ
221,563,283 *154E5536D00564780208D24DD141670C141A3E38 FREDRIC.BEVERLEY
221,563,284 *15441BA31ADDBA54C94212BDC4191FFA16094A8F propinaron
221,563,285 *1541923673E914A4BDAE0ECF4C670DD9238D407D funjordaning
221,563,286 *154843F2CEC2A44B679397996075BA4CAF2E5C43 fxfg
221,563,287 *154C29AC655154AAADDFB314131B76AE9CA43780 g3m-cutti
221,563,288 *15426923B124944B7C98C96F6715DFBA97D880EF GALVANOTONIC5
221,563,289 *154800193DE6CE648267FED892BB803C2DD357A0 GARTH.HEADING
221,563,290 *154E53A29FFA14A8CF078BD8C70CB89700682A73 QUASIO.G.
221,563,291 *15499F4E2D01C4C7A860B795E6481A846CC864E0 quelques-balles-de-plus-pour-le-calibre-qu'il-te-faut
221,563,292 *154A1A77A82D3D8F1EB7054BFFB8E671F435C205 gastonleger
221,563,293 *154525414EE91DAA5D9C129A7EEEAB3D27CC81EE gastrohysterotomy6
221,563,294 *1547AF0E710F55977096F037B660D7D361BAA7E3 QUINN.BEGLEY
221,563,295 *1541376E101281B2CF733434778826B2E05FE0DD quintinreifer
221,563,296 *1542D55D0DA5CDDBC2D33B77D2CAEC35E7FBB147 gderuiter
221,563,297 *1543D31C2BFEDE91530DBCC21DC19E5AB120631B gerle
221,563,298 *1545D8EC37706B51017ADF252DA4134CA7479DA8 geszkaart
221,563,299 *154BACDE39359FDF2A0DF0C898D5C9D2181C6FEB GGDFGER345
221,563,300 *15405CC04ADF617F1AEFAFFF6979F193AA4715D3 GIVE.WINGS.TO.MY.TRIUMPH
221,563,301 *15469A5BD955C10ABF2FAE21CC1778BC8BAA86BD re-calling
221,563,302 *154259D6275CFE1DAB46A41E396C3402AC37644F RECORDSTALKASTON
221,563,303 *154C984391BE4D6BBB6F583891373606A85EE616 GODARDS5
221,563,304 *15456CD9376CE13002F47EEAC721A56BA04591FB GOMILICE
221,563,305 *154E2AA661D14CA515ADFC8A7FF64A5BED85BA9D RELEVERW1
221,563,306 *15449E7FC8B31A2CE9FD5B1ACE50F29340B14A44 graigbarkus
221,563,307 *154E665BFE6DB98EB2EDDECB160B67BFA7B3C834 GRAIG.ENGELMEYER
221,563,308 *1546236ADA1682F7DFE426DA784BC747AAEF943E renatosodervick
221,563,309 *1541163AB9A7ACCC2DED5B77F83ECCA631F33B5F REORGANISEERT0
221,563,310 *1543B9878E036B0B8E6B6ED55A8DEC9E5DE61B8F „RESERVEARMEE
221,563,311 *1540D6477BDA16287431AA121D84F67C7CF7383D groenhoejs
221,563,312 *154FA11223CB74359FAB92B48FD8B8585137BB0E groverharders
221,563,313 *15470F2804DF37335D21C55268237594E9506A69 REVORGEBEUGT2
221,563,314 *1545B39279C8E9B9A9BBCAAF41C52591263D057A gstdsgbehlgebg
221,563,315 *1547FC8F7028E156A2D5D9C2A0D1D22A5B949B50 [email protected]
221,563,316 *154D39CC0DA919474E09D7C21A4B0C603F8B1AC6 rhagionid6
221,563,317 *154F6313BEC2A48F3436225CE5AE6F0D0F1ED2FD riehmens0
221,563,318 *154344B4F13B1B2D87C2AEB56B57D257139C1D7D rlhbbsw0
221,563,319 *15468DACE88E4994D5FC1F695E62CA12D269DF0F roberticeman
221,563,320 *154A756799F39146C94379E035EA40F07703F58A rochelleprestage
221,563,321 *154F7A9C2AFF10397BAA6CC9B9ABC740511676DC RODRICKSANCRANT
221,563,322 *1543E51AC7FAC8D5C9D11440645877A2E8F1DAE3 HAVANA.CAFE.(DISC.3)
221,563,323 *15446CEFF5666EC14C9E0192AF2672CE24CA79FD ROK123
221,563,324 *154CE65B2622A9C0B74D8850BA3118DE190309C5 [email protected]
221,563,325 *154DF021E05CA84733CFCE968A8E2845FAA0A381 HENRY.TARALLO
221,563,326 *154E6268C3C3C2DAD5C8D1AE9796605B3DD4FFD3 roxichika318
221,563,327 *1542393679912111D17E212F10EDCCC1F47DC313 herbtribbett
221,563,328 *1544CF5AD35194401A07E86C7B37FFEF798D001B HERB.VENNERI
221,563,329 *15472DB71D2FE759F7B5FC1338D986E14536349E rubinmcdonel
221,563,330 *154B455FAD79C0B59F5C3336301CB31AD7214DF4 ruckwork
221,563,331 *1543BD70B749E77D0E4808A9CF98895AEF1614C1 [email protected]
221,563,332 *1547335897AE42DED18184CDBD2004AEA2AA0BE8 HEWUL01
221,563,333 *1549D401272D8098E29F27B7D709851ADC661530 RUSSELLPANDOLA
221,563,334 *1547EA647C304E35B1F8C185B78A6FE4DD1B5E5E RUSSEL.SEAHOLM
221,563,335 *154AF7ECC2B1959678673918D74FB8401E9363F7 russforson
221,563,336 *1542326B5D4DAE3C1A509728E17791E6E24751DA ruthrancourt
221,563,337 *154C8266ECFFD6C69B1DCEA1EE6446B0F25CC60C HISPA
221,563,338 *154B61CAE52C1A71695CC89071ED7CC824C3E5C6 [email protected],
221,563,339 *154420F67F24485949A64A1C30EF66C7C13320EB HORSESHOWCENTRAL
221,563,340 *154B8264D08F0F9316AF6FC8E6391C93967E48B2 samstrasburg
221,563,341 *154D89FFD6A3FC5DC85C9C6FF0CCC568535868E4 hrpttmy
221,563,342 *1546FFBACB3362C19EADACBB131970E07A2D6B18 SATOUKIBIBATAKE
221,563,343 *154C7B45001D6EFDD059F5EAED170DB96ECD0EB2 humble.hand
221,563,344 *15416A7CA316A24CE76E9147FAD82499CADCF1C0 ScherzoNo.3inC-SharpMinor,Op.39
221,563,345 *1544CF39889BB22D6A25ECD6816E3E9B4D4C5B23 schoonheidsmiddel8
221,563,346 *154C2A4F675D5CA719B5059BE6599372247ADC60 SCOTT.BRUHN
221,563,347 *1541E4C42840B370B8986DABEC92B25D8708ADE0 ienaient2
221,563,348 *1540A7EE72DB61335C26A0B1B8EAD0CCFC7020D3 IFYOUGOIN,YOU'RESURETOWIN
221,563,349 *154C9EC143F11A0DAA04F500CE11D37B8C3E5922 SEUNARINEBSW8
221,563,350 *154715C3C960300F6C50684A97FADA7EC42897A3 sex-and-cheques
221,563,351 *154B1DF0BEF6030506BBED0B91C29E5477BA01CD [email protected]
221,563,352 *1549AEC10E2D5A5603057082CE4DDFC6262F454D inaccuratelytranslated
221,563,353 *1547756A619F01EDC69612C7F2061418B2016386 SHENNYCHUA
221,563,354 *154F65C2BB63C5EB05C7BE68C8685F64F0E63DE7 INDENTED
221,563,355 *154DE6F4E247506C8CE952A0929CEEBC749D7EDB IONENTRIEBWERKSTYPEN
221,563,356 *154E83F22FDCF4D2B9AB07C54EF32C6616E637BE sifting.in.the.sand
221,563,357 *1547E0C80F8096E1B1C5F4D1BE41E58D5DB3507A siriasu3
221,563,358 *15488B7686C9266949792F38F96EB251B539320E „ISAAC
221,563,359 *154712A6CB3F22A8AAB97081E32B7588E2369B1E smailje5
221,563,360 *154996F3C50EA4C65F3AE7086A883B3F592EB12B SODRŽAVLJANA
221,563,361 *1540F15D1999581DA517CDF6AC2ED1D9982CA0DD [email protected]
221,563,362 *1543F774CB9C6D430E7ACD9AD4BEB039B458EEE9 SONATAINAMAJOR:3ADAGIO
221,563,363 *15429C34B4CDB6BEB785634972D1D69C19CC0C8D JACKIERAHEJA
221,563,364 *154E04AFAB224C9262B46B238595542CD33A69F4 jacquesstayter
221,563,365 *1540A4AA186E070E904927275E251487B5F11327 jagojago
221,563,366 *1549517E719B088AD29CA66C937D0960A11267C0 JAMAR.BUCHNER
221,563,367 *15407CB326183B1D7FC9AFC04DB6D94C85EF34F8 jamisonbronikowski
221,563,368 *15472DA739FD7028B0E5EE7C9EC3D5EEAFDD352A SOURCEHTTPWWWSOUTHE
221,563,369 *154859B60EAD9FE6B44FF683899B3A905701BCCE JAVELINJAPANESE
221,563,370 *1544D7D3619FE29AE2EC72A16C61281CAA978946 jaxson651
221,563,371 *15492BAE7FA4408123C88A3C0BD60A37DB0B5DBE SPILLKLUBB
221,563,372 *154EDC84745DB9E381ABD27AA7C68C7296AF2A16 jazli
221,563,373 *154C0050627A215093D22A4DFFF268720636D19B JEFFERYCINI
221,563,374 *154B4D46B81A72C4AA60D0CDA83B0DA570660E7D sploit.*.*<######b
221,563,375 *15445668FCFE0CAA5EF50EA5D4D1F6EB5EEC1E38 jennifer-denise-smith
221,563,376 *154DE3B4510C48D26A6F6DC272514C86685325CC sretskni
221,563,377 *154F47D5ADBD1A2C45831E046811C8FFA60A41AD [email protected]
221,563,378 *1549D6A4E6B1A76A5CEEBB135AE6B31E9871D1D2 STACEYHENRY
221,563,379 *154E5112DE309D53C4B0FA9F1B95A44DB8AE48DB JESSICAHALSALL
221,563,380 *15483F1BC791C0939590FD2ECA3A60AC53677969 JEWEL370
221,563,381 *154B648D4AD886C65A12A6D67CCDB234B4803B8C stemmessiepen
221,563,382 *154AFBC354B37B8F8DA66BC45540F846E5FCC24C JONAS.FLEIG
221,563,383 *154A19F442526C02B619D7CFBE08D8665BE16877 joyce-mones
221,563,384 *1546147FC08A3BCF8B9B87C7FF990576CEE3A146 Jpl8
221,563,385 *154B77D5A2275EA5CB6110F0EC88EBEE04686F55 SUBSIDIT123
221,563,386 *154C5E7D9910B4E90602B26BEF12B469CA4C9861 julianrusso
221,563,387 *154A3058E4965D4C8CED8091E81D362636A48983 SUNIQUAT
221,563,388 *154BAE1AA85EA92AFE2D516B9EC35449F511561F JWV:
221,563,389 *154B31AA76F7CA2274B16F3F044C4CD8B43292C5 [email protected]
221,563,390 *1543C47A79CF695CB9F0CD5618C4033856B352F0 kalmakovsalome
221,563,391 *15479E9B5FB8CD712B24FABD964E0174041ECB17 SYKEHUSSEKRETÆR
221,563,392 *15495F953D65CD884693D9D28B64DE195E3083FA KATEDRALKIRKA
221,563,393 *154A5B9243663054599DD5DAD4BB7FE6634E499A SYMPHONYNO5ADAGIETTOFORHARPANDSTRINGS
221,563,394 *154D366CDA14D0CCFB45A60354D42A908CF3B7F7 keeltje
221,563,395 *154E804F337022B49B32E8A0FFF0DFFB62537898 keith-corman
221,563,396 *154412573E7B6CC58A8DAFFBC6D3122BDDEF86AD kelvinkirovac
221,563,397 *154A4BE06BF7E9C86C13D0D01E354F1B69B7C33D TALVIKENKIAE
221,563,398 *154E776E5D7DBFB0D71E5FB6E2B5848896673CFE KENNY.NISH
221,563,399 *154AF1C25148AF210D0C64F950EAAFFAAA582A2E KEN.VERBECK
221,563,400 *15473CC30295F6DE6AC517DC173D7C386831BCA7 KERMITBODE
221,563,401 *154AD665C0F2A4079B3C282460E1BECC51566A50 KEVENHELVEY
221,563,402 *154463F9EA5AB36FA83FC2BB2EBE250829CC310A TANNERDINATALE
221,563,403 *154957EBF18BB8A41D891392D5247924D8EC0ECC KHANCHEVY1
221,563,404 *15483FCF535CC01B2B2490A66FA27BA4A0E2E63C tc{e
221,563,405 *15408F27C76822BE8878CEA61ABA5E7F25C76EC4 technologically
221,563,406 *154B38851F2023C84A982346FC34C2A91F395894 kirkmclearan
221,563,407 *1542EB2D44E537DF96DEE1A592B896D1071930DB kissudearbook
221,563,408 *1540D30098F6EFE361DE98A56DAE438DF1903DF6 klmpbld9
221,563,409 *15403A910AB328358017FDC5C899D6175E641A00 KORYMATTHIS
221,563,410 *154D1E046E29545F3F405DC20C72F2F8D2363A05 kq1]
221,563,411 *1543AE15D1533AB4DC2734BAD3F15CD6601AD03C THATNIKI93
221,563,412 *1543DB99056EFE03D2742632CF2767C344384BE0 ladivadiva19
221,563,413 *154DFC5B2E6D0E981F56702763627A3AC59C3E1B [email protected]
221,563,414 *1544FC62DFA4E6158318D136FADA22446EB21D80 thenmutuallyagreedupon
221,563,415 *154B1A11B120224949E92CA53E200218F7178854 LARRYCROGIER
221,563,416 *1549CF2B50AE3238A0A49973D8D77A7F10D80BDA LARRY.RICHARDSON.JR
221,563,417 *1541FED56FBAB0E8AC9D57B8D6A091C66EC47817 THEREABOUTED0
221,563,418 *1543708928CE21011E3939704107205EA41FAFB0 LATORA-YOUNG
221,563,419 *154E7CAE4A32AF071301B176B48C4C3D270A621E THIG
221,563,420 *154AC25D2D1AC863C4B5C65A43C575D840F89DDA LAZEROW7
221,563,421 *1542C07EFD842CC7C576007D18D69AC49B0C8208 thursday/helicopter'97
221,563,422 *154454A713867237CBA7AFADEF615143F4FAD401 LEDEP
221,563,423 *1549039063296E89DFAA9A406ACD07186BB2F9FB leetest3
221,563,424 *154AEE4FEB8CEA1C1E5D5A8B0100CA404231265C time-to-hit-the-record
221,563,425 *154D7ABBB110C740A19BC4F16A33E82FC8E29028 le-valse-isole-(the-lonely-waltz)
221,563,426 *154457D1104DC693703E8A3F701B85CF764403F2 tomasnawn
221,563,427 *154367E7E479328B299FC09EC5210AAEC5E0CD96 tonydrader
221,563,428 *154EDE5D1AEF75E396E7F94C75DF9FFABD9D818F LICHTERGESTELLE
221,563,429 *15415B75F8D56F2F2C90F61D8AE9F2193A2C7EB4 LIIKENNÖINNYT
221,563,430 *1541B62D6A815575453959E6F79B19292ACFAF5C LINCOLNMCGIBONEY
221,563,431 *154E9FBA39C11FE2164D44C29121D1A83FF2B17E TR33L3T
221,563,432 *15453315C143FF4E816F4036BEF83083ED885F62 linemaking
221,563,433 *15423F49B159AF21C47ADDC9D2328CB64FBDA3F5 TRAVIS TRI STATE DESYNGLEMEN
221,563,434 *1547C9A45F56066D28D9306DD319F5174DE81D3A tredjedelene
221,563,435 *15494877D4470CC2F8F6CBB006CA5EB32574A7BE TRENT.BADLAM
221,563,436 *154ACB21A967866E3089784C184F872899EC101F [email protected]
221,563,437 *1540DB70CA1D85D3A0B601FC1FA234F0FDC68205 live19732007(disc1:live)
221,563,438 *154E039CFD3E135F57C7DCE7B04A6D1A644C4116 [email protected]
221,563,439 *154BBFE8E2C85F9AD6800AE96CBB8554E976A613 [email protected]
221,563,440 *154E8CFAD992CCE274FD75D1929E598F87FC591B LLAMAPATHCOMWWW
221,563,441 *154A2CA1DABAEC0072EE3C36346C7AADF7BA1134 TRINIDADAKARD
221,563,442 *154BE45453013045A328B2FCFE4A8F4DAB02C77B [email protected]
221,563,443 *1542696F765E22F88A451A5D1BA77DCD1AC6DD4F [email protected]
221,563,444 *1541DCAE90D89D4790BBE16780192BD1AB5939DA [email protected]
221,563,445 *15470950F0A35DC6B5CCF779EBE4B17738E13C3D trudylawless
221,563,446 *15455752CAA83C81D621F63F8EF28D6C9CE3C1EE LSTH-121
221,563,447 *154E4D7764DF667ADC2319B2C69BAB92D2D46C30 [email protected]
221,563,448 *1545AD30768570268D37B38EA213D42B87B63C72 LÜFTERGITTERN
221,563,449 *1545EAB9374118417152590142BA427AF4AD0AA5 lutang881010
221,563,450 *154E18DD15502687979315E4D75127B30ABA4F6D lyfeluv8
221,563,451 *1543674C1569474D6F7F842D11E99224E296EEB2 lynwoodhansson
221,563,452 *1543AB8DAABCF7940B01586107A3E5645BF63511 [email protected]
221,563,453 *1545C130CB5FB1F4C6695C3E22E22F492F075181 M2GENERIQUE
221,563,454 *154A823F2DC07B33E3E24AF1AA42B9F66B3535D6 m45+01d
221,563,455 *154841589B08952A4C8D6467CC63986645D975C5 ULFMEJERGREN
221,563,456 *1540E6B447077CC71E81ED99C4E629EB93A8CAAA MALCOLM.KLUBER
221,563,457 *154E093706D5D8A7DF1D68CC569C3B1CBA53D8F7 ...und-in-der-Heimat
221,563,458 *154A37BFA03FED4F37B68E911D88AEF1DDCD4E98 UNHABERER
221,563,459 *1540C2BEC04ECC52F6EF6F39FCCF5F720B6A5C2C [email protected]
221,563,460 *15463A42671017BDA025F1713A1E0F9D14B7C1AE manful
221,563,461 *1549CCFB907940482D5ADD2562B005BD94846EDC MANWITHNOEYES
221,563,462 *154C28E5C1D791C92EB6A11D55140317641CCE60 user210562910
221,563,463 *1548B41BE01911E564F5277BD018CE67E26265DF USERARAMGAR
221,563,464 *15429DA7C0DD233974AF38292AF545B00E7FE323 MARIONSCHAK
221,563,465 *15475D79BEE4800050B2B4DAC2CADE58DE4CB5CF US.IMASLEEPVIKING
221,563,466 *1544DF840DE5CFAF997CDBE702DD3CCAC52003A2 marlonlambrakis
221,563,467 *154D1D27F70F9E9032E93B04AF814BF365D2BB06 [email protected]
221,563,468 *1544B1D5E462236F693DB51D7CB38DFADD388372 UZUMAKI94
221,563,469 *1543FB6AA1594BADD08F006E78AF58AF3D2B722C marycharlson
221,563,470 *1546AA5044485B25DF22264FFE74C735173D0576 MASCHINENABH
221,563,471 *1548C8B9A571D9BBE5348BA07375CAFDFA17991E VALENTINABUSTOS
221,563,472 *154F8495CE7A2E06B575A5761FA3BC368935DA04 MATZEKNÖDEL
221,563,473 *1548192E28AB2B1137FE83D55B5B35FBF1A5A6D7 VANCESPERANDEO
221,563,474 *1548A1B16D1078650A3C0169B4DEE6FD61CE4B39 VANGUU
221,563,475 *154127D85E58DDBBEEA90957074AB7EFD81E247E MAYNARD.EUSTACE
221,563,476 *154BA34B2FC1A86B1C9149D3455E4E7DF5CE0C76 maynardlesser
221,563,477 *154973A1A77CD9244DE73ADA0E87A26D4DFFF1C1 VARSPOOL6
221,563,478 *154303283DAAE7E514BC8AB41F2AB43A9BF5BA9B vera-mae-noveno
221,563,479 *15477C5C2538F9C448027CE9A714519161C9F0EC VERMONTDOLLARS7
221,563,480 *154BF24E101DB82152C16785D43546AF6ED06055 [email protected]
221,563,481 *154A787AF4CDF1D01B5F8002E14B948754A3AD8A MENORIZAREIS1
221,563,482 *1548FE5CC13C5E829E3977E49819E39ED2955ABE veronica-wiliawati-setya
221,563,483 *1540DA2D7B259A98FDCC2D3528B2AE211C20B324 vetustvetust
221,563,484 *154C1253781B4AB8266538C66F4A91564B9523A5 mi_
221,563,485 *1542C96619BC25861A97CFCB36617606D4EEA218 VIKTORIJA JURIC
221,563,486 *154DC70DB6B3641077946C1051A1DAB427DB5E4C miguelvoelkel
221,563,487 *154FE6FF001632A748C605460EC7A3D3CD555CC4 vinceprehoda
221,563,488 *1542741B1E183FB2A8D15B300B66163224F62452 MIKUCKIEGO
221,563,489 *15488F2BCF5FCD554F5316B8F321B66C6BA38DA6 Ming.Tian.Wo.Yao.Jia.Gei.Ni
221,563,490 *1541B6BF17DF7455A2A24C4FB39A77D881236F9A VITELES7
221,563,491 *154F66B0DBF372A0D48ACA2ECED86C14A428CEF5 vje#
221,563,492 *1540484360572ED9D56521FFD1A14F694F541950 MITCHELVILLANVERA
221,563,493 *15496C873C28179C60BDC412D2C1FBCC0870E503 VODENICU0
221,563,494 *1540DE2859C7CF3A8D3A7423BD04D101F8AF56F1 MKOMPALLY
221,563,495 *1541F4606AA150E7A962FAC74508FBE8E1DE183D MLTDSPRS6
221,563,496 *1540F7715DF075A39B701910927EE5221FA0DB17 Mona.and.Tamsin.on.a.Rock
221,563,497 *154EB62C85B34AB950585B27DB36C4E2EF47D66A mon-choi
221,563,498 *15465BF3F8FC0A2E86A06DC4C972A9E330E36462 MONROE.GUIBERTEAU
221,563,499 *1542FE3E810610EF00D2F0656A1889AEE553B3CA wachetauf,ruftunsdiestimmebwv140
221,563,500 *1541D42C484E666B2B837775E10314280F9AE428 WAJD OMMAR
221,563,501 *154B80D551EA5C5AD6F7ACA469E968BC285DDE5B MORGANGRETCHEN
221,563,502 *154A91169E0EECF359E9EC8EA423394348451F52 movin(specialextendedclubremix)
221,563,503 *1542235F6DC8035C1B8FF794ACE8C834408E947A WARRENSTAHNKE
221,563,504 *154B774EB28254DF318E4F93B136E14AC3979318 was.dich.nicht.umbringt,.gibt.dir.neue.kraft.zum.leben
221,563,505 *154F30C83120F2C294849DBC3D1D854E6EFD342A MURZAK
221,563,506 *154E23B75441EC746A2E7BDCD197C4AD804E5B64 WENDYCRUSE
221,563,507 *15440A771DC3FBCF53602211C02EB567390DC068 mz<b
221,563,508 *1543452771E2E7A1963E8FDBDCC1187730D23F2B wgrowth3
221,563,509 *1547231BC948CA0C8E2C5B62073AE22457C4F805 namnevandring
221,563,510 *1547E1865D726E0BD0428A9574F0E28999DEF49A WHITNEY PFISTER
221,563,511 *1543A60F10A5D4D5F7E9156C0D1D2D72707E1DFB WHJ,
221,563,512 *154C5F37B8F79CDC705B188F404C623626D1926D nathanielillescas
221,563,513 *154B4B9CAF020CF6302AE381AC07D97D8F9EF47C ndebeaune-la-rolande
221,563,514 *1542B372918BE23358A4D206AE41ED6E213DF82B NEAL.LAUNDERVILLE
221,563,515 *15498281FB55FA1BBF03C194630AB265746A4FDF WILBUR.PALMATEER
221,563,516 *154FFE1E86FF534732C5C6483392AF13B1632B6E neil.fossett
221,563,517 *154BF743A8FF48C52A882D82DAAFA2485D973E15 WILLPETREDIS
221,563,518 *1541CE50EE08E2EA91BCB4120BA43FB133F0B746 WILL.SHUGART
221,563,519 *154EFFA34C5B30233BACE357E92A1375B5075C04 NEWPR
221,563,520 *154ADC88F017B7848D5C5633CC1FC5912FF805FB winfordtrana
221,563,521 *1543581271DC94D8B58FCF153418C47D24F47748 WINSTONHASBNI
221,563,522 *1540B28EC4A11950E369E738FE68520ABD32B628 wintergo4
221,563,523 *154CCAF270096F83BD8DF4D99F7A19DDC113502D NOITINEL
221,563,524 *1543E36E58F4F1265C08746D0E0610EB30043D39 WQF6823
221,563,525 *154825EEFC51C07CB610C677752750A8827CB64A wuascar-contreras
221,563,526 *1543016B69C4971A26240DE960E6D8E642DA9EE9 WW
221,563,527 *1547B29F66453D64EA075E32BEC3367ECA50BC35 WWW.KIOCC.COM
221,563,528 *154B1FFBB858CF8F6ABEBE3FFD6B2BD60907C95F XAVIERMOHRBACHER
221,563,529 *1548878052DFA26564A87382B4618C351397AB09 XIAOLONG.SHAH
221,563,530 *15468A3A603D531A88E646CB2259E879384BA0C4 [email protected]
221,563,531 *154FCC664A55BBD54619B10361D2BB167799407F nuslutterdet
221,563,532 *15450AEF0A072456C944771A2A040E7F2EDEB947 NYIL.DAMEII
221,563,533 *154E0741B74D4C683C0595E28D5052DBC6F407A6 [email protected]
221,563,534 *1544C490A496159EB878FF580E04D44BBCDA5E91 }X{ ~ ~ <p
221,563,535 *154BFFAF44430B81F3F7DB75E1ECF8DC674CC38E [email protected]
221,563,536 *15449E1E32CB304F8D3AE2CE680DF8DF90472115 XUHAN[email protected]
221,563,537 *154299E23814037DBD0B97181FA4096E3951E339 [email protected]
221,563,538 *1548171016DCE9F30FBC292FBB43EDFD1E3378C1 old.soldier
221,563,539 *154769501B5C238BF8EC82D13FE3335F073DF0EB ye-ngwe-soe
221,563,540 *15490FDDDA3DE06D1F24E670505F830DE4AE66C6 ONYCHES7
221,563,541 *1546725A1A7F7D74884E0D880FA0E43E7CB78C74 YLLCTSLNTN
221,563,542 *154AF0A8CF974FE7B7720BDE968E6371AFAB6DB8 OPOZYCYJNEGO
221,563,543 *1545A7707CED51537E27C88099DAF5576C9D4523 yonike-herman
221,563,544 *154E410631A6242A3989C079D0F4E353A4B25C6B ORVALFOUTY
221,563,545 *1547B07E8D48FC124E01B821F110AC0AC7AB15BF OSCAR.TREIDER
221,563,546 *1548EB86E0288585A78B86BAAD92479A1CFC8D75 [email protected]
221,563,547 *1544793C93E804F96E6B98BE2FC486E1FC0070DF [email protected]
221,563,548 *15493D14D26FDE1A14E78BD628D2B9FA009DF776 [email protected]
221,563,549 *154A7C3ADF9EA07590AAEB41736AE5D0940DD387 ZAFAR BROOKS
221,563,550 *154EF32BDE7B2B6DFF8A2E0585323C6B8AAFFD9E ZAROBIEVYIP
221,563,551 *15499F40E2F70FED06F89C677F579A3D3F2593FD zhamrock-remedios
221,563,552 *1541986430D2D5D43E32CC100C544A003B8AE2CD [email protected]
221,563,553 *154ABB7D8787194B27A8700F705E4E77D3B6E4CF ZHCNXTMKBSHYX0
221,563,554 *154FEB74E32E64931478BA422A690AAD3715E711 ZHEN GISELLE
221,563,555 *154DF1BB928BE9945DF720BF2D45D4AD7ADFF026 ZHIWEILAIMINJING
221,563,556 *15415C6B5FFDEFFAB256F49A5481AF5E6116391E [email protected]
221,563,557 *154136CDD1B065ED6661CFB24D35D99CF1E0F508 P0LLEN-B4
221,563,558 *1545CF3E831CB71AB8533FD4546A09085BE252A2 [email protected]
221,563,559 *154D08751501EA7A83DAD6E52CDBBF7AC69F94EB ZNYHPEB3
221,563,560 *1543FD17B7A6127FF0747843ED7587454B5CBD9A ZOYSIAS
221,563,561 *154B28652A25250E35392C294A673E27DA10231E БОЛОЊОС
221,563,562 *154E114E9A5B02AA908E7A12D729CAEBD4340B2C ДАРУВАЛИТЕ
221,563,563 *154D35640DA9DDBC14C0EF66EC6DCBECCD743C8E ДЖАНЬИ
221,563,564 *154F1D797CA37105AC5A173F3397F99D02E805D5 ДРОБНИЦ
221,563,565 *154EBA66B42642E34DBCF8095CB9B990028F9371 ДЭВАРАДЖА
221,563,566 *154E77F8250773F38A8B217B21860B7E2C021B3D P##B-~-~
221,563,567 *154E83C087AD877D8DA5B03257F7CE3A6E7E33C2 ПАЛЕНЫ
221,563,568 *15412F26F9161CA00C572559525C85279AA4AD47 СОВРЕМЕННИКОВ…
221,563,569 *154C46E81A495FA05D033DAC40BEA7890B9891D2 СОЎКУПАВА
221,563,570 *15426567A13E2EE3C5A99F8B899431825619E160 personalsaker
221,563,571 *15453F2EB4AC10F90F3995C96F3A24732DFDE32E PILLYTRINH
221,563,572 *15443A7E6B12C8373E810BDDDDE6709F8032C6D6 PIPPA46
221,563,573 *15477218931E61909270F67333147BAE999D0E40 PNEUMONOPHTHISIS8
221,563,574 *15495E577D78A80EE00582979521045A00EFA0D9 p-p~0 ~osplat
221,563,575 *1548ABB3C028A2C259AA4BB207E0B82EE90B8087 PŘÍNOSNOST
221,563,576 *154718FE582A4FE8185C148ECC943662B1902550 PURCHASAB111TY
221,563,577 *154E01392B1EF1A143BE8AEBE6BAD0A07B480CED P------>.`.UU
221,563,578 *1542B7C494D711BD17DB869B2F9379EA72200338 [email protected]
221,563,579 *15423099870FD4D60D74151071127A3A26158519 q======d~o~oo->-<
221,563,580 *154025F8292A0F44512A4141DD688F2B6B5D834B quincywinthrop
221,563,581 *1543041F32868820DABEACEAB94016F52B3A2034 QUINNEARWOOD
221,563,582 *1548197D58245092A0A1E855C7D3C164D18884F5 quinton.burton
221,563,583 *154B85ACE842AD8435B54CB5B3337F925D2C6B8E rafal.wieczorek
221,563,584 *154E529E70BB16475CD227612EA6FEC91E569BEB RAGĄ
221,563,585 *154C287874D2DE1A495D39CA639D573F6B2DA68E RANGUILLONS
221,563,586 *15444215E4D733C5177BB5D024D26337E0E856FF RAPHAELMORRE
221,563,587 *15478B2B0BF371FF6F0110FCEBD66C97F75C5E50 &$&!>))@()>@>(#&
221,563,588 *1547D000D0C6C343C5FB0B91BF98C0A41D4D1CA5 RAULDALLAGO
221,563,589 *1540E99ECC5A3C90A0E73F90393973F969462CBE raven1935
221,563,590 *154C853E0563CFFD799FA23194021A55EC22EB0D REDHEUCHING
221,563,591 *154D746582D9C3ECEBE296E10DD4A01DC3C68673 (-_0).`@---b
221,563,592 *1544E6F7CD006A1CF370400C0FA0B0CC32B423FD 100VECESKIERO
221,563,593 *154BCC257F911BEE49D997A6E99619AF25175BE9 123PEO
221,563,594 *154A1A368AD70CA7E454BFF3B9CAAF4F77C93D06 Revndc4te
221,563,595 *154F9D9BE766AF5A31769B92F1B89695669F3653 12-suossa
221,563,596 *154947F8AB65E8499C8C7ED29F86E1C865DA6829 1393118 personalabbauseijedenfallskeinunternehmensziel
221,563,597 *154913692A82A4E385F9EB139E0BFCAB9F706445 RIA76ER
221,563,598 *1542C941ED9A8FCFAB8F584A9AF118BF5B54F2F8 RICKIE.LARKAN
221,563,599 *1549B4C81FEE39CE67614F2D59D16B724ED30B87 RILEY.MATERO
221,563,600 *1545F9F951F24243E357808CD8195A5AE20A7548 Rimfaxe[Rimemane]
221,563,601 *154FA8507D086CA10934FFB704E0E85758600FBB ROBERT.YATES.JR
221,563,602 *154479639CA0CFC56651FC7D589A713E2E02D855 ROBYN-GULLIVER
221,563,603 *154ACC16AD886BD02723A6AB49A43D8A62146D29 1.DURANCE
221,563,604 *15421512734AA2FA0A246265C2A514C5CE389AB3 RONALD.EIGO
221,563,605 *1542822F49F2DBD37F6A61085ADAEDF30E4EB460 1hoodlumize
221,563,606 *154AA46F7725C4102CCC732977A1B0E387182C5E RTZMNN1234
221,563,607 *154507D997CCCC4FF122D351CD5F32AB52C30C6C RUBBERONDERNEMING
221,563,608 *154E21CB6A0F91FEE63311AA6A2B56EC879440ED 1.POWDERPUFF
221,563,609 *1540067AD76A00BABC614DB938F811FC8BAEE164 SAMECWF
221,563,610 *1542B4CFF4A04F6A15441D0C39AFB6E249436A04 SAMENSTELLING4
221,563,611 *1542A21F641162602AC56363ACEB211EEDAAEC81 1uraanikaivos
221,563,612 *15425F1160C24D80513E0EF5551DE4560985014E santocoalson
221,563,613 *1549DF6579CE5EE33FFD1ED78F9AB99AC5DA4B27 1 WIRTSCHAFTSAUFFASSUNGEN
221,563,614 *154664FA00AF50DACC501280145CDEB7A36630BF S-DU-STYX
221,563,615 *1544516976028A84AABA2B98FC229363434A387B semideads
221,563,616 *154A18E0122C6FEE9D0E3CEBA0C139073843CFF9 SHANNONHADGES
221,563,617 *1540DCAFD96E057F3CAC31461416E1240D83A91D shauntruchan
221,563,618 *154EDC0F26A5CBD0D55AF420ED527A6430EC9EE0 SHAWNMEMORYING
221,563,619 *1544FDE63F9C66543DB282ACD6A9DEBB86D48013 SHIRLEYDARKE
221,563,620 *154A77C5C635EBEB388773509986F9F5DF377AEE 2471091 terve-juolavehn
221,563,621 *154024D976F1BCF48AD5B5FE156F3BF0332B2C15 silog
221,563,622 *15464B59DCBE67F6520B7FBBB64A4FA19D019733 SISULUJOE
221,563,623 *15413759BB005EC964B0FCFA38D7E88D89A37A9C skiingaikman
221,563,624 *154EB763435B81AC2DCEDB9C3666C61DF9F70CFB 27.T
221,563,625 *154C298B90C2B31A788D654160926D16CC7226CF 2DUSUNULMUYORDU
221,563,626 *1542CB40D4E4706A9494898D7D8F80136F1CDA32 2EZIQUIO
221,563,627 *15445829E897D8B5C70041781B67A5340C41A42B SOURCE.64.230.41.58
221,563,628 *154435ADCCE4ADD2FC2E0735B06072295FF36A73 2professoriolli
221,563,629 *1545F4A8D873AF06A4CF59B00FDF9BE2A8EABF45 STACY-HOBBS
221,563,630 *154043F863302B37C3375F10025C59C8EC26C657 standmyground(singleversion)
221,563,631 *154FF90FD2B4DCDFDE496D6EA3800D4207A20ED6 STERLING.BACKMON
221,563,632 *154610A2E5C033DADE2BB367514EED067BCDF4CF STEVE.STRACHN
221,563,633 *15499BF82D1825B9CBEDA16BF306247DD6518BD7 STOMVERSORGUNG1
221,563,634 *154728128A6170A263F0BBA8AF9440D190D07416 sturdier
221,563,635 *154A7BEFD3D0615F22E2776EAE25136AD25472A9 SUBLICO
221,563,636 *154C0A89DAA6033E0B28A6C58A2D3F3B1A09B351 4NEESIVII
221,563,637 *1541D6AF38F51FB6DFE028EA9FA82818234E774F 4UNNEJHOR
221,563,638 *1548042B377676F17FE18713FE74747A4F9A52BA TAILMANN
221,563,639 *154D6160F9C071877C94DC9C9C8C1574698A9FA3 TANCHESNOTRESOIF
221,563,640 *1541CD0B3527C4842A7D0E397AAC38079BCD59C7 tannerfernald
221,563,641 *154DEFD7EFE9C1D4935B14D4F59B1BCAA308BC26 tdrogfas
221,563,642 *154F26B845D0AB2A1A5FDF2D3447E2E5D934B590 TEDPETRAIN
221,563,643 *154FE0E02B06694AA517BE0627015178DA9761FF temirim7
221,563,644 *1548841DE06FC67E762BB2281E25A1794C8E0D25 TEST12383
221,563,645 *15483AF597B15E3974B0F688E60A282B9C4A1D78 6350-SOMEBODY
221,563,646 *154EA0A5864F34EBE0CE739C9B173D80AC68A1B2 THEY DO NOT KNOW YOU
221,563,647 *154110063D4BE1DE3ACDAB1C61C0FBA204D79DB8 6december1851
221,563,648 *154060743BE4AED10158BFF217B71A5294A228D5 timmybringer
221,563,649 *154A88C1AB039A8A5777E59B282EE1198E06CA1B 6ENSISIJAISESS
221,563,650 *154FA5337F5D3B37FBF53E8279F4F5D0B09ACBC9 6PILAROWSKI
221,563,651 *154F65528DB5411182584B66051A1F6F5DFFA857 tonkabay1
221,563,652 *154FF123DA96A44A91D6E8DCE14ABF5C5F7DB505 tori.hunt
221,563,653 *15493FE45836507EA082B4AF4FB76464CAE2AAB6 6XXXXCLOVER
221,563,654 *1546E4ADF9476A7A9DD99FA5736047F5289922B4 737RCH10R1D3S
221,563,655 *154419CFB1D139BAD838F5C5AFA1F5346B87ABBB 76T42T32
221,563,656 *1540A633760B1BC0BC13FCBF2961E1FE973AF821 trapezuntine
221,563,657 *154C050175962861C63D257BA04124EB6A6831BE TREVIA MCDONALD
221,563,658 *154BA23E1B56060E6ED73A1A487BD8FCD879863F TRIA-MCCORMACK
221,563,659 *154B62F39E3F72867C18C3A691ED8B679D1C54DD 7CALLOUSI
221,563,660 *1544E01CAB184F57C9025CBB4D0D37B88BFA3FA5 tshepisosiphiwesikosana
221,563,661 *154E47BFEE1A923E42C3CB361A28985A881380E9 [email protected]
221,563,662 *15463A3140E299C71129A80FCD76DCB12CBE0BC7 tulo-superior
221,563,663 *1544880FAB96D188A8D4D63D7213D6A86A344298 7MONOPOLYMOON
221,563,664 *1549EEBFA4EB320C48975F265A24610BC5085B68 7SNWBLLD
221,563,665 *154995527F214F1AA9F99D8A27204DAD58C67CB5 7TOURSIMUS
221,563,666 *15409DA7FFF66AA513B207A98C95825628FAC1B6 uilrich3
221,563,667 *154E9753210A8DB3B404521B247B7B75165142B1 8COCOABEA
221,563,668 *1544B3DEC626F8BEAFDF3FA76F2ADB4B853F07FC 8GULATIVE
221,563,669 *154314B113C6C9B3AB2627309CF26216EFB0A048 8PEDANTISCHEN
221,563,670 *1548DE89737B22DDD9FFA8A8C7F7F01F18A20195 VALERIE-SYCHOWSKI-FERRARESI
221,563,671 *154E01A160ACEEEF4A7BF9F94EA1EBC57C73224C VALHASTE1
221,563,672 *1544EDE401EAE6FF3FDEDCE6B33506DE9B85051B 8####)-~-~-SPLAT
221,563,673 *15425772BA5F83D45053BBB06C06EFB1C911A0E5 9CONTRAREVOLUT
221,563,674 *154F6B1A5BB0A2B80B0DB0918016141EE735251F 9LUCYPLATO
221,563,675 *154E7D25AB4DBDAF49C897F9E97BA7D2EAFCFE08 victoryledzep
221,563,676 *154633C146977BAD27627AC9D8CF421FECE747C1 9 polttopisteess
221,563,677 *1548609E2DC16B35A4B8D355446713E83C39CAA0 virginia.grubaugh.johnston
221,563,678 *15453A1F37C2B5642A8348D93F8FC9ABBE267641 virginia-waymer
221,563,679 *154E00321E6146062824627866FD6E5238A309E4 9testerait
221,563,680 *154F7522A1EC19950EEE575A044A98954A6C2186 a<@
221,563,681 *15404A95EF02658529F9AA538EC12346896FE609 VRAHUNATHAN
221,563,682 *1545803166511830D01B6A87FFB69707C4CC38CF a5qni
221,563,683 *1546E88663349BD1BE0D881B07AAE289B5BC5554 wahi
221,563,684 *1546609E4B24807EEBB777B82B779FE55F806EEA aaa{76
221,563,685 *15486290B322D9F859D4ECC33DF6CE0E2CB2EFA8 WENDELLLILLYWHITE
221,563,686 *1544087D7301AA219FDBA055EB3ED551EFE84152 WENDYTANHUIPHENG
221,563,687 *154138975808D5EDB40F923ABFE5B9F24C74584D [email protected]
221,563,688 *15415541B315038DC346FAE0E9B75713EEDB1DB6 [email protected]
221,563,689 *154538B3ACBA1A4A517C751AA0BDFE3369B5F1D0 [email protected]
221,563,690 *154794B86ACF7B852792BB7DFA57B176DA1462E6 westview5
221,563,691 *154391DDA8EA3646DAFAF572069B407EFBFA3CD6 WILEYBERCHER
221,563,692 *1542F6052F4931CAC6CDB6633113609554F7DFFC abovethemintherocks.
221,563,693 *1548CF65BB59F14D7A9E77A51852AA4A093ABF78 winfordcearns
221,563,694 *1549503E4AD1B94B9B590C4EF64796485898BFD4 WINFORDKALAFATIS
221,563,695 *1540C640614936A62387E62D89DEBF6921913D11 winfordsobczynski
221,563,696 *1549AECB8317E2E440306D14DBB4F278B42754C9 WINNETOO7
221,563,697 *1546FFFD006B91195AC6A288EED038CAB9310FD1 WOODROW.FORKNER
221,563,698 *154548F976054F8CE91ED4823425021E17CBCB98 WSBRATSA
221,563,699 *154954103666327DB8FC7A96D919180746185303 wwwdiamonddoncom
221,563,700 *15447A7C32D9AD5888BA80213F2AC12595D81A22 X1Z`
221,563,701 *154F9DE0E47BD4AC4E7E515A64ED40901E427EBF XKIMX ESTANOL SIALONGO
221,563,702 *154B3CED5B9DC062896DD748B2133075755043C9 xl.ii..et.eduxit.me
221,563,703 *1545234FB72ABE09772135E7A5CF1C9CC8554B49 XXLITTLEGIRLXX07
221,563,704 *1542A81C9E96BABF00577EA6331858D2705780E1 yaoshiuchuan
221,563,705 *15472C22E29A2D5A969D24D58FE4DD735BAA893C YENCI.GRANADOS
221,563,706 *1542F9223867E12E17352BDD866BAF6F8605ABF0 AFF#N
221,563,707 *15413716C21FB775741906CD06D1BC93682141E4 [email protected]
221,563,708 *1546A29080865DCE97B5830A42644ED8003B2DE9 afvmz
221,563,709 *154568ABA3DFC34F27FA0E6AAD537775CEB4128F AILOVIU
221,563,710 *1547B69F275A7151A0DCB9C3DB5C59A84E6258C6 AITTLT
221,563,711 *1542361360AB554BDAC481BC2F0336919FCDCECA yurchak(2)--y-er1-ah0-k
221,563,712 *154353B1E0E1BB65F4853186BF4DF01D1562775C yurt's
221,563,713 *154655BBF1F4C12C7537431AB118468031B636ED ajzi+
221,563,714 *15462F1CC7322501908FF64285DE3955067C5992 AKUCHIE4
221,563,715 *154EA0C53EC8D9858527BFC5E3ACA423CD22287F ZARQAAE
221,563,716 *154C672DB36F41206A52B42E7C35E5BD5E30F44C ZELDA.BRENNAN
221,563,717 *15484B2697743F665E45CCA3F23B7D0A54451465 ZEPHYRROBINHOO2
221,563,718 *154D6322042C84CFAC41197D9F04BC1E253834ED [email protected]
221,563,719 *1540C3911276D6D164870515B077FEAD8A1A2D58 [email protected]
221,563,720 *154995E11538B23FA60E9E7D190072825AFFBC99 albertomolavi
221,563,721 *154BCBEC1252CAA095C4C1483EAAD28B95C28AE6 ZOYSIAS
221,563,722 *154A4618656BAD7D26D5D42B77AF14E82E2FCE18 ALLAHARU6
221,563,723 *154718AE12E6F8F16B771937A9A9C821C252A219 aluminoferotschermakit
221,563,724 *154FE5CB9A0FE12E1D0ACCF0F409AB6E694CA203 андрессона
221,563,725 *15451F56B91709CF1194F7DE80577A9A908BA770 ГЛОУЧЕСТЪР
221,563,726 *154D7FFDC16879391F4FC2DBE52819A54B2D1C68 «„ЗАРЯ“
221,563,727 *154D5FF720A1665B12A96018714E204C687BDD05 ОБКЛЕЯТЬ
221,563,728 *154198DFF6F9E6CE1E4903B54CA0F08D2D950B33 ANDREAS.GALS
221,563,729 *154C11ED41983F7CF7FD44C5683F875371FBCB68 ANGELFREDDIEFACEPUBLICVOTE
221,563,730 *15449E61C9E420C0C58F54368BF67CE8437135A7 ASIA.MCCORMICK
221,563,731 *1541B22FDBE4293DBC835E41B886EE56483C8928 bf="
221,563,732 *154C78671AA5AFC1D73A1B1490E0030CC4EF1045 B=HBK
221,563,733 *1547802C17041897779C9A895040E80FEC6D5102 1362175 THIS-COULD-HAVE-MEANT-NO-TAKEOVER-AT-ALL-
221,563,734 *154EF63FAB54E859D59C8C115CE400081D080194 BIRBHUM7
221,563,735 *154533FA34E7C07C9A8B846D62F7714104FEB5E0 1545874 gegen einigkeit wilhelmsburg gab es eine 1:5schlappe
221,563,736 *154DC23810FB22CB352737E25B71BCE61372896C björnholmsknuten
221,563,737 *154E4CB3F2334F7BDE0822FDB07C3103CE2D20A1 1840874 erdei.ist.in.19.kaempfen.(.13.k...o...).ungeschlagen..
221,563,738 *154518ED18CC5746C6C99591AC3770CE2DB13500 BLSHMNTSED
221,563,739 *154D38DDCC2E98BE78B9CBDA969B7A7683E7B86B 1FRAGMENTIEZ
221,563,740 *154129E44F3AD3138FB1D3333A9F64F78D0DA325 break.(vs.headman)
221,563,741 *1549BB40519D021506F27DF2B44869DB76A0F7E0 BRGES4
221,563,742 *154E709D3EF839C9464D822618D8CC950D92DA6B 1-MERCURY-KAPSEL
221,563,743 *1548C0D6C24406E2D0F433A803C509F494A40FB7 BRITTPEGUES
221,563,744 *1546EF3C3CD725578F87A5C034C31D2F19AE562A 1PHASERII
221,563,745 *1544F0B421088EDD6DCF55C91756C8B0C518ACA2 brunoslepski
221,563,746 *154BA70B33715D31E98FA4C7BB10A039BFEF36C0 brxq8
221,563,747 *1549F5783D6133692BD8FF8C303CD216B91196F5 1.shake-and-bake
221,563,748 *154BC49FAD2DD7C25C7145AE9F47C89ACDFFB842 1 SICHERHEITSINFORMATIONSDIENSTE
221,563,749 *154F0F2F67C2A07951A345F6BB5155DA7B6FAB62 BSWJUNTADOBSW
221,563,750 *154904BFC2A8536F7AE68A526592C7C8117BC265 BTLSC
221,563,751 *15418F3841C47A6C43946534AED440F4921EEF3E 1-US-OPERATIONEN
221,563,752 *1541522EB141D35BDFCCFEC9581FA6F52382102C BURNBITCHBURN
221,563,753 *1544B74F65E814ACD03E4B304694A9F7A43453ED 1WWF-HOMEPAGE
221,563,754 *154DFD0772C79B32A7BD36E55390D91419CD412B 2002年に「NEW
221,563,755 *154663C53B4B1C969FBC5DA341FE05DD68FED8B7 BXN%N
221,563,756 *154FB802C29A34E581426B3603EEDE52B8309EAB carmenmendoza
221,563,757 *154AB1D3C2E836B7AF6ECD78932EE45F8C6852E5 2ENNHBSW
221,563,758 *154804D284F33250AEB9330A9DBFDA4FBEAC36D9 cbf(&
221,563,759 *154931FFFB2FC6B59F4C39F62BBD28BE4C9903DC 2MYCAITLIN
221,563,760 *154C7152B84EBE3EC3D06EAF8A1631E39D083ECA centerhanson
221,563,761 *154008909FF88906918072025E10A32A83F32A96 CFYTRIFVFY
221,563,762 *154F2BF3F3451C9F2790BCDF2B8B575DE5990248 CG;GW
221,563,763 *154A7B7001BF499B1B8C69A5FB91062C59520A31 c=_gt
221,563,764 *1544035167666A72121C9EC9F5CCB581D6C0B98E charringtona
221,563,765 *1549FE5CD5AB4AC1DF64D2EB91997E345AA07304 CHAU-BE
221,563,766 *154278E2AE4858417798C733AE1208D4ED794E94 4FABJERG
221,563,767 *1547E7B7D15312F04DCAC5730B8B2801D5ECE0D2 chipsのそれに近いものとなっており、rider
221,563,768 *154D696B16FE6AA846FECA56BF9FEF2996FFC82D 4MYRAISTLIN9
221,563,769 *154229A9D1A1ADE0AD572D9B0CABDDC2BBA1C515 CHRISTOPERWALOVEN
221,563,770 *154F67B76A01587B691921CEE497402FED2A2573 C:II)
221,563,771 *1543769185FA75469BEC5D5F5B3023A79D110D47 5DECISIONSMODELLER
221,563,772 *154BAD70ABCF00D00A9D7AF0CA51F8F5827B82D3 5.GUAGGENTI
221,563,773 *15419CB191A9F4064B2C8BD7719410EFDD4726D1 5.MAANTIETEILIJ
221,563,774 *1544E53B8107F2D8FE2361F3C8722C61544B8F14 5TRINKWASSERAUFBEREITUNGSANLAGEN
221,563,775 *1542C35AC1966367CC3584181812455ACEE83BC4 5VALMIUDEN
221,563,776 *1540E3C2CCC9B5F05F1799642482D8D98B0545A0 5YARNSSTAGE
221,563,777 *1548E519E6A80DED7D50CAC7C9037C93D1175A22 6ALLURBAN
221,563,778 *154EAE09A1E18FD2B3E999652472C93FF92BFC0A 6ANFINGS
221,563,779 *1548A2A2E0C559BE78C0AA7F6AF38B06884371A2 6BRAHASPATI
221,563,780 *1549FD121D01ECB943B79A782A8C2CAD5F0AECB1 CLOSEFER3
221,563,781 *1549BC9A08FE374EDEBF86CA4F409A4FF6170CC8 6ENVIRONMETRICS
221,563,782 *1547EFBB54E4D259E1873A60AD11A2AC8133E11C C;N/
221,563,783 *154F5AC8001435DE28AFF80D0694F474FD78C9D9 cn,m:
221,563,784 *1542377F681DC90F5ED755D18639E12422015491 CoalBlackModelT(outtake)
221,563,785 *15434F1B86E417A9ADCC50C0584EB3B90D9738C1 C(OH"
221,563,786 *154CAD462A0E0EDACCFB229EFB2C47E6DA676529 congestizia
221,563,787 *154DE6EDEDD3713BC3E482B7D7730C1181267F41 6ROZKOSZOWAC
221,563,788 *154F9EE6C54AE305945FD7F940B4647A93B1E2E4 6TATTOODANIELLE
221,563,789 *1543E0FF145520710C87C2D395EA5EB88E766DDE 6TINAHANNA
221,563,790 *1548EB82E1A69F959E85EDCEAFAAF475987CF128 CONSENSUSMBUK
221,563,791 *15486FBBC6337868D7FF5C14B43033745A60CA35 733446 kurssilla-k
221,563,792 *154BB1ACDCE36BC6E06DE7543106806D1C9EC855 COREYMEEDER
221,563,793 *1541F92BF1A009B257BC5FDAB22A71FBF9BA46B9 c:\program files\adobe\adobe photoshop cs4\required\default tool presetstpl
221,563,794 *1543D40BFF65B8FB1827D4079AF22A0E09433BA9 7DELTAAUSTIN
221,563,795 *1546D6BAE05EBC6B345D61B6E6D24B6FF3C1290C cpufd
221,563,796 *1544D46C6167142653F046011639FCA04E401A0A c(r1i
221,563,797 *154C3F00E351FC7203771F2F7A36E9D025C3A8DF 7MAKESHIFTNESS
221,563,798 *1547A99135E12A70114DF990FF092D22DD8F4829 [email protected]
221,563,799 *154E112CE52F7F73CF19948F4F89B13C4182446B [email protected]
221,563,800 *154DDDF651D8E2639844BA37B6186A51C74AE51A 8ILOVEBENSON3
221,563,801 *154ABF7DB971A092CC4A8003656D08414F816FCD 8)~O;)
221,563,802 *1540701F39A141171104E917BBE2DF23836E4885 d8lr
221,563,803 *154557DAD5B801357F51C369AC7480813BCA404B DAGO-S
221,563,804 *154C7B3BA10F1391DB86C02544BC5AF65D2B4EEA 8VILLEYN
221,563,805 *1542DA8908C2B6E21E1C4B57CB365876473B1A5A DAMON
221,563,806 *15429EA5A70565FA2DC7DBC9D5CCC073593F2364 9BROWNLOW
221,563,807 *154D6927231B232B938EA39FF7B80F6ADC26B4EA d#aq(
221,563,808 *15474AC05378B096747C13193C45AD61EBCA59E5 dariuseugley
221,563,809 *154F916BD4F011B559FD3C2DDF700C40B22A83CE DA:WM
221,563,810 *154A53DD32EB656C0F1E7CC1967690B3FE1737A4 9KARTVERKSJEF
221,563,811 *15461101CD1CB5CD2C9B68F08381A2B0235A4320 9KINGSTEPHANI
221,563,812 *15439B563113196CBFAF9AA1EA6B78F890E6C3A6 Dbm3
221,563,813 *154015CBD6E6D157BD9997EDBD12B58D80549CA8 dcfet
221,563,814 *1547DA5C910161C586E488C6B42D642F5E49B0D0 9OFBOOSTBRAG
221,563,815 *1549F21B2CF0AECD1DB1C5525C28F77955BC32C2 dcoh
221,563,816 *1541BEF16D21ED64C3D4FD19B830B4FB3B39130F aacg;u
221,563,817 *1545225C36158DDDFEFE0E484F1EA55AAE46092D discscriterioncollection
221,563,818 *154F166F1DD25ACFEB2585EB78D62567963262BD ABSTRAKTIONSEBENE
221,563,819 *15412F70F5F5526A46456AF41C16E075A18B4FDD acg,b
221,563,820 *154BA7BAFF70EE91E5EAB4FE4EC9E88DD0484BC5 D%/M:
221,563,821 *154C2CDCB5C9746A49443A0ABD77B278297E1B1C A,EZ_
221,563,822 *154808C371CF2EA6CB0BD17BB91FE6887F67BF43 [email protected]
221,563,823 *1543103F8442B7C1B1E9B87913310A5E5F4BB5B1 DUCFM
221,563,824 *15458642457091A2A4E4F59D158C035BD18CD560 ALFONZOWARNELL
221,563,825 *1546683985CB961E032BF941D401D595999FFA92 A(LH(
221,563,826 *15492DF89A8709637D1CC7A76AE2382D10655C32 ambivert
221,563,827 *154CCBED284186F2AE771895A609EA6F4AF8C77C amphidromic7
221,563,828 *15443731F3AAE4EAA7D7BBE8BE5F692470FFE0CD [email protected]
221,563,829 *1540D4E0F1770E8C3DAD9D2A74300FA1378050FB ANEVELIK
221,563,830 *1543F880E860FB798EA9A884C6C9E13DCEF6158A E145471
221,563,831 *1547DE97CD312DAF1E7A7FB10356E0102C99A58D edmundnance
221,563,832 *1545A97BC9BEF467F8A05AFBF7EFF92B9D23764C ANNOIAVO4
221,563,833 *15499A3AEB2295D91E4441557DDE934EAE6F5F3F ANTURAINI
221,563,834 *154C62BFCD9966792EE96671C4CD5B6A71050DCF ap_db
221,563,835 *1540589A7406ABDB21E71C6AA629C780410DACB2 AQXX1
221,563,836 *1542DBEEFEA4C113162402D0DF5ABB02280B3E4C arm3n3s
221,563,837 *15498620370CF7766836264E245E2F7D90EE87FF ELLE-SHEILA
221,563,838 *154A586561EC89D630A8A01E3973BEC454EDF70D arvf
221,563,839 *154B7A42A0BB2765AAE117CA7D42CD9C25AD62C7 aso)0
221,563,840 *154091101F030A842CF9A708FFC9E5E655E05D78 auic
221,563,841 *154EDBBC2B3460795A978695C6B92D5E535EB0C8 eq=j
221,563,842 *15432230EC57B0518A5A49EF07F2DC85466A418F b5+!v
221,563,843 *154DB19F45CB4BE514FDD6C1CF3ABB96ED628E96 barrelhouse
221,563,844 *154AC3323CD9123B1FBF95C4EF90C3DCA9E167EE [email protected]
221,563,845 *1545AA9E9767590BEF54D0F5F4F1606AFE3EBB3A FAUSTINOBRUMFIELD
221,563,846 *154AE4E96CA12C3BC109B64F5C279940FFC55224 flipjasper
221,563,847 *154F741C346868396911573631E18A095372DA57 FUTURE POSITIVE (A)
221,563,848 *15432F0DCC13349948BC54A8D2B991104C0B0418 g}d!
221,563,849 *154F3E23B00DA1F28AB0EF053AA5DCC3A65F4277 BLARTIN7
221,563,850 *1542D80E143335669553469C29E422ABFFFF7056 GOLION
221,563,851 *1543EF5068F156DE4C308CFF5F5F4D82109799E3 BOODLES8
221,563,852 *1545FB7ED07A9BE5A5FB750FD8DC8D3E0E950507 GOWERMALBOROUGH
221,563,853 *15430AF74627FC2C21CBA6CBDCD426687F8ADC5B BORTSLUMPA'S
221,563,854 *154470C36B98F10A385040326014014FFAF82EA1 GRAHAM.DELAHOYA
221,563,855 *154418E0213CDC345A51072113CCCA631DDEC081 BRADLY.BARNS
221,563,856 *1546E3D5889A21A5029E19D7FA3E4AAEF415E5B6 GRUBNENR3
221,563,857 *154B082486793E307BA0D6092813B9975638CFEA GUILLERMO.GENNETTE
221,563,858 *154CD1027DAF74A3014A725DEE4706385A101137 H51329
221,563,859 *154C35146E74FCC7D36270B1BBB96590EF9A0169 buf#;
221,563,860 *15492A8894BEE313063B9A4EAFD83E939CB8F954 HARVEY.VINES
221,563,861 *154CABF501A25D06D5559231C639D59FDE71D0CE hederik9
221,563,862 *15412AAA66F4A7B7B711BB87F81C01E2C7A4CA51 bx"=a
221,563,863 *1546BA27B697D402C502FF56CCA10BE9A91F454E B;XYE
221,563,864 *1543116D58582103BEDB5E1B3568EA3F8C59189F
221,563,865 *154DF8DE90648CC687ABD122D6C46027C2CAC33E
221,563,866 *1542A70BAFE4F040AFB8D2190FD0394075770C6F <L
221,563,867 *1546411B9F17848AE4761B30ADF4BA9BE8EFEB4D C5WA
221,563,868 *154735E94C06E19523370604BA85CE3BD3BF9938 {x
221,563,869 *15479AC90DF82045871A7E07F4847728B270E130 C8VQ2
221,563,870 *154E2DCDD5DDEA83C419334592872DECCD413D15 cae?6
221,563,871 *154FC8E1D7A2BB8CF97D64824F4AA2BCD01190AA cali.wilson
221,563,872 *154B1F1C3DB86A53965D2DCFB27EBD496D0DA1E4 CALVIN.NIMZ
221,563,873 *154D73A11FD9C09CFE8EBD4D6272FB2541A24733 [
221,563,874 *154F0688C8C2B8968FA3374F65434E925C71EFB7 5
221,563,875 *154D2854C16D857346C59AEFB212120C4F838C77 h
221,563,876 *154D584424E03532DC7BF37E73BB6A2F3D7C3865 can't stop lovin my baby
221,563,877 *15490DF2F194390FE3EF261808173A85630906D6
221,563,878 *1542AAD8B19D856804CD8428AADBB69C5C480C6E
221,563,879 *154B41E39B75E6243390318EEC49E56FB704BB93 CARLWERNER
221,563,880 *154E15DFD7A2687DF996E378E41FF4EBCFCFF3A5
221,563,881 *154E4B66C3A8421172C754885505DEDA6FA64043 CARTERWIPPRECHT
221,563,882 *1541067755AFE7465877A52D132B39905E7E85FB
221,563,883 *15447B85BE23C834723E445E0BF37A75690A06F8 carypavloski
221,563,884 *154BF9A6EB68B5F80A6FF618EADD5A1E4424A7E8
221,563,885 *154DA4FC3F03DAE8E4198ABD98A2CCC054CF1A87 @
221,563,886 *15491D42CAB1906606EBC9138469ECF919F9F163 
221,563,887 *1543B811B7E8A2530C1BD563F017295C05A97AE6 cathymize
221,563,888 *1543841A8A6BC536D182B2D956CEC8F76F0D9E3D CBCC6
221,563,889 *154CA423B4547368101ACE59DF3E871F49F37BBC [email protected]
221,563,890 *154317AAE78663618866353A80FC41075B4CE0FD
221,563,891 *1548D2C5A30617DD58C43AA865356D2EEE60E266 cd 1 track 3
221,563,892 *15451C509CAA44F221047636A509341DCC51E2AF
221,563,893 *154D7AB90AA6210AE2F167A893D505D2D5DBEE15 cdk%s
221,563,894 *1540EE289BC99D1550B92915AE132AEA81B28D3F ce.g#
221,563,895 *1543B0EB1F0620FF747F9FD017092D7343C9CB2B 7l
221,563,896 *1549E656C692BD528391463A739A29375CA35FC4 c;gid
221,563,897 *15473C97218175200E8FD5A4EFB85068D0B35BCF
221,563,898 *154A95FA9438C1EA7A443943DF71C71F700ACFC4 
221,563,899 *154224207B2E4C1CB7A0E324566AC9B912600463
221,563,900 *154F4E52DCD9F011DDD645FAD46316723E48461C 5JV
221,563,901 *154C46B08F66FF3C4670CA5F41E87A860D68162A
221,563,902 *15465918B1643563B05038D613B4E60B839C6DE3 CHAPELEU
221,563,903 *15412C2251070B072E8D76892BEE991C0FD6B7A6 J
221,563,904 *1542A18BB204A7E5ECB5DDAA80BDF3E7649DA6B0
221,563,905 *154432AA9F158542BC755DDC906C352A59D0338D
221,563,906 *154630AA4331AF29F96E544DFBF0CD63DB1556A7 O?i
221,563,907 *1546B88896A4868602E58249AAC2CDA49109EEF0 Y
221,563,908 *154FA1CEE5365464B1871D01A2B350D7BB903345 ȅg
221,563,909 *154B716156C42100539505665FF1A70FBED05F70 charleymarasco
221,563,910 *154A80507E6E8E09029BA203980EC4A15D1AFBA3 charliegautam
221,563,911 *1541315F735B3D8237ECECC52564FC85C08D2735 [email protected]
221,563,912 *1547D3848CB73CAD3500E6C43B1688F1BABFAD48 [email protected]
221,563,913 *154D97F7B6B78A1D0D7CCC240D19F4AA96A1C209 CHICOESPANOL
221,563,914 *1540EC721419B6CC9479AD88310F412E36D382B5 chist'addore(ripresa)
221,563,915 *15460463706BB12C41E3EB36818F9DA2E5D441AC CHRISSTANGL
221,563,916 *1548CD94AD0DF5100F6EE08CCAB655C0F09203FC #
221,563,917 *1540882027DCA414FE30EEA755B47B7B601EF2A4 CHRISTINEPHELPS
221,563,918 *154CDAF06D2039E469577913136397EA87C66367 Xu}&ݣzS
221,563,919 *154C1AE234330E8AA72D232F48C7BA4C961F680D CIFW
221,563,920 *154A884EA7354E730599741F800703B0E4BDC604 CLIMATISER4
221,563,921 *154BFD9217667CE6CF02D7C33222973A510BDF93 CLKVA
221,563,922 *1545F77F668E4F3F2FE7D9E5EB14D61317BEFDB4 COLESEMBRAT
221,563,923 *15428906A59FE9C94428196617BF5A67BA41E0E2 1EPOLIEFERANTEN
221,563,924 *154B5DCA45B69EED1A52F2704CCFEC2F8B9E1D15 1FRAGMENTIEZ
221,563,925 *154DE4C6A799FAAAB84238CB2FAA184581AE9F44 1LYNDSEE
221,563,926 *154DFDCC3E3C241DDBB69A0088EE1CC79F7F96E8 1 SICHERHEITSINFORMATIONSDIENSTE
221,563,927 *1545E19369C77BA088DA2471C46F91C1AD13A990 1UPERCA1IAN
221,563,928 *154B8C12743F192ADD9B88EE7FF24BE6B157C8B0 6ALLURBAN
221,563,929 *15430E84FE4EFB9B01AD7AD967194A0BBC78ECFF 6ANFINGS
221,563,930 *1545DB613A685BF28BFECE2F10CDC6CC39085EE2 7FJKAKTZJNT
221,563,931 *15401A2B810977E5489560CE96EB04E4C2CE6607 7MAKESHIFTNESS
221,563,932 *15433802F68C907C369AB458F19B482D4CB4FC8E debarrass
221,563,933 *15465E2DE842DF15C783981996986AE9C4BA9E32 DEMETRIUS.MCKENNEY
221,563,934 *1542E368E4AE50BB9C3D742DD19149993ECDC770 8===D~O.~OSPLAT
221,563,935 *1545104294886541E2371E558402D06A3D1EE83B 8HANDELSUEBLICHE
221,563,936 *15481862DE40E394D2EF1F2D03686F0E8C420575 dernier-espoir
221,563,937 *1542D42C7A13364471FC266464226F13792AF0B1 9OFBOOSTBRAG
221,563,938 *1546E920DFCD5AC58D5DCF76A9726E61CC8FEAD3 d?)k=
221,563,939 *1541D11744CAE2D610D6896D19584E589FB7545B DONNELLAGYEMAN
221,563,940 *154A362A6E1390DB8F39928B0F02540655034A88 aacg;u
221,563,941 *15417FB2803F35236C7331C3D2210034C2E13C35 DONTEVENTO
221,563,942 *154611789ABA00749AEA01EA3C54EDE8C8531F95 AAE{=
221,563,943 *154F9C07F350BEA674B94815102D386C3422248F doyoubelieveinmagicandotherhits
221,563,944 *154C26F1AC9069542BFC368797D2A84A30333155 a-donde-vas
221,563,945 *154D1BBE6323366E8629C69DC798194ACD2E9A08 DUDLEYLOUCH
221,563,946 *15434B9B8B82EF32EC236874BC254DDD74C7C5BF agedunense
221,563,947 *1543FC5E3CA74054838DB3471C05FA8763DDF889 durnecker
221,563,948 *1540D2BDC0366DD7066831EB62BD0DAF094919BF D+XVG
221,563,949 *1547AD4FE34548AFF710F68A4998D3EE91E03E90 ALAN.POTTER
221,563,950 *154C10B7648495A1DD8966A3A74FAFF5CBCB4EAF ALEJANDROKNOCKE
221,563,951 *154C98E71CCD43F52223A71F5745BCBE8C8EB5C2 ALFONZOWARNELL
221,563,952 *15402D62ECFF792B804F58F81F016ECC4FE5007B eb1pm
221,563,953 *154E8C942FA95F336855AD889F41F6206689F78B ap_db
221,563,954 *15461A276B69B4EF800C8C3114A8B219205E1B3D ELENA SOLAS
221,563,955 *154DC965C1B3114C6A3A62CC0D9E9E2BEE81ED86 [email protected]
221,563,956 *154C75CBD1810E4EBBAC8A581C6E68EE1F957207 [email protected]
221,563,957 *1541480391FD3FD64F6EE609BB787F622DDDBA7D ELISEOBODKIN
221,563,958 *154368CC9EEA01E53340B8DF4518935D71716D44 ardèle
221,563,959 *154E381585F6F449CC166B4DBA18AE6411409743 elmoleve
221,563,960 *15418755A924A92B569E7A981044064995BDD103 ARLEN.BEEK
221,563,961 *1542B712F8892665D756E1C6419FB46C8B2D7635 EMIGRIONS8
221,563,962 *154201CE4FE0C991909FCF60B9DBCBCDEB4D414F epvhh
221,563,963 *15445CF945B5526A967E017E1207FD586CAFCECF axgo
221,563,964 *154B8FDC89A9FF11D26E067AA3FF976E7F2B720D ERRASCHTS
221,563,965 *154A00668A5C4A3150655F4A846C6184B63995F3 ESCOVVAMOS1234
221,563,966 *1545FAF2762D8EE3474A1E034AE93C9E5F5BA569 b5:0.
221,563,967 *154BAAAB5AF2177849E4FDD1A6CD8A96E76DF484 ETIKIZAR
221,563,968 *154DE31EB25F84B80CA71DA7F99001B370CF6399 BACON-AND-EGGS,-DEAR
221,563,969 *154AA2C1A5A9476C8A92A26186B6EAA44D73C817 etsarits
221,563,970 *154886ECC9D1AB721284E242585CA9BA0339C018 etzmh
221,563,971 *1541CCE7A6501200467C8F9E40A3919095A249F5 B!,#E
221,563,972 *15418F74B0E26DFDB8F2B33844AD44170CB2560F faradocontractilitied
221,563,973 *15435BB32DABEF7C464B2691300D076D4B47A5F8 fb_
221,563,974 *154D4F8731642F6794A1AAE063724186204C6527 bernardohackathorn
221,563,975 *154734D3275F5DED5AA40CF3156D7DF9A177544B FLEITMAN12
221,563,976 *154480CCF7D18B0CCBF0360CE87FA6F82FD9222A BLAIRWEIR
221,563,977 *15437A54D19671BB54E00789701D7821133B9C4C fredrickeddlemon
221,563,978 *154CE23AB7C56B8C1E56FAB554F084B142E3A4B3 britney's-tits
221,563,979 *1544B1DDAF7BF65886F39B4A4A2E94B1711C4CDF GABRIELA-FLOREA
221,563,980 *154125085F089C31DA57948D1874465597DFCBF8 bup,g
221,563,981 *15440677B474647DFD5EA0D558308E39BC989866 GARNISSENTS
221,563,982 *15436E76977FF67BD1E531B88F29C7C2C4320616 B;XYE
221,563,983 *154B9250A17F1C12C1A8BCA273A6C288B50DC301 GENUTTENS4
221,563,984 *154E2328F567DD59A69FFE24175323FFBC4D1324 C5WA
221,563,985 *1543EE4C276D9E5B35B8A920C20077FB28E01968 germanschoolsydney
221,563,986 *15428AD55EBCD4F76234B26961729F6BC0F4D291 CALIVEB
221,563,987 *154CF1ED7EDA0586D50D3D7A9B8B3530DC2D72CB GJENTAGNING
221,563,988 *1541132C80E75CFAF1B6D7B44B8D51ECE9EE0F32 [email protected]
221,563,989 *1546A19C5F9FC1011EC668D9911C312E753B8250 GMURAVIN
221,563,990 *1546D9BD09D0FCC98AA592F197540F327E6956AD CARLWERNER
221,563,991 *154F63A5AACD7EA7CA33847B0E8339CDD685E4B5 carypavloski
221,563,992 *1542721972529BF7855AE9C38CDE7A9CA4AA18C5 CBCC6
221,563,993 *1541FF346AB5C74F0905F9B9100E3057CEE49E03 GRADY.CLIPPER
221,563,994 *15437CD8574BCD91DAE0CAC27337803EE63FF354 [email protected]
221,563,995 *1543B19946D9A8AD33FD352FCA0C0B5357FA3FF4 GTBYWITH
221,563,996 *15490F73E5195D134A0BC2C28E4735AB2193B6DF [email protected]
221,563,997 *1541988F9F337247C6E63056C1B95581F1A63017 GUAPA23
221,563,998 *1541E31D6DF87B6D43BBF4D8A96C74BBA6C8F5D1 Celd
221,563,999 *154F63E0038474737D0EE21FBC5597539BF9F2B5 GX{"
221,564,000 *15484E699F4754163EF95473C5606CC4A0AEA1E9 c;gid
221,564,001 *1548EF6608A98ABFECBDFF01134CAFA637299E39 CG&WS
221,564,002 *154E876452D66AA3E86F7372DE105923A01BDB73 HANDBALLINFO
221,564,003 *15490695EF05C3191C955641F88F9682315822DA HANNAHBULLMORE
221,564,004 *15475D58157FE07E7D6EB2513AFAA189EFCC0C5F charleymarasco
221,564,005 *154E7F448BEA67150184DB513DA7530D88810647 HAROLDPADDIO
221,564,006 *154A4120B3D53EF33973006C8489BD3F96D3D142 HARPIJO3
221,564,007 *154D245677FFE0AD68279D05B10F91623576E45A [email protected]
221,564,008 *15494F0788543AD2803ED27142A6E84119931F7C chist'addore(ripresa)
221,564,009 *15487A9CAE7CE03B58C79FA380CF7B3CB99E01D0 HEIDEHÖFEN
221,564,010 *154F25D6FBA6A1EFDDF949EF66660E0C89ADBEC4 [email protected]
221,564,011 *154F2A0BDF47391C2DF10559A02D8072791E2205 HFDBWGNGN1
221,564,012 *154EFE20B13EA53F4C110D336D679CC182B77312 cliftonvanvolkinburg
221,564,013 *1548D0A9A865D5B8856A395D064C7B56E208038D httpinvaderlydiawo
221,564,014 *1549190145BE796915A16823055D1C0FBDD1C6D9 CMN2H
221,564,015 *154A75BF4B80AE4967064088B764CB0D742185B2 C&N:F
221,564,016 *1548CD9D66780B89E746295F2C36CB0DA05207CC COSIMOS6
221,564,017 *1545D36475C1E30AF5DDFA134292A9AE6158A1FB COURTNEYWEEDEN
221,564,018 *1544AECBC3BAC3A3E869824F452AF435DA3D571F CRQY+
221,564,019 *15490D276FE99EEF56E4F041F88330CCDBD81DDC irwinheddleson
221,564,020 *15406370EE57D59BB4694EE657A6451B5EA9DEDB i.shall.be.release.(feat..fleet.foxes)
221,564,021 *154FFDACCDC65F4EC0B4735DB1EC85294E9792C9 c.ukc
221,564,022 *15482E03CA181A88AFA29477C7FE3D90FEF8C228 cxa=)
221,564,023 *1541D052C777B0EA8D2FE94F8B1253E420251508 jairrodrigues
221,564,024 *154E596FA3622CF24E268A866B758BE78B07D1A8 D*%'
221,564,025 *154D2471CBE7B0FD8F48C07E9A2AB0D517A8500E d1:nw
221,564,026 *154A41DE242F12B035A0C20A56F064FF165192CA d2l?/
221,564,027 *1541F18EDAA882D4CAD4126E30790212BD822295 d4db=
221,564,028 *154F7345639A9D00FC96C63D1E15104A5324F1B7 JEANDOBISON
221,564,029 *1545C04AB24B5FE4A676B892F1DC4A42B07BB9B7 DAMIENSARNICOLA
221,564,030 *154B47364A16110BA4A3AACF6D503CC5411B965E d'angelo.&.erykah.badu
221,564,031 *1541669CDB126E837614CC339364083D4A7972E4 DANNY&THENIGHTMARES
221,564,032 *154486EFE6539D3C111E955132C2F92AB6B4EB3D jermainepostema
221,564,033 *154480175C7E424549C1E176D9B7CDF69868A6A6 [email protected]
221,564,034 *154172B3C37E8E946E005223BAB2335765D2D975 DC$8_
221,564,035 *15486EFCC9CDB9FB1EE499F9B9EE7BAF3BFF1A5D DELIMITERAI2
221,564,036 *154954DADBF3D2B0D9ECC24DD3A46155FEDBD602 JNA[email protected]
221,564,037 *15429160FFE0D4D86290A9117EB3E2493B0B81FF DEMETRIUSALTWIES
221,564,038 *15400DC2EC60EC4EA8787B79069D0924C4CCB100 JOECATINO
221,564,039 *15442B39A5ACC3074547133D4C784F2D202198C9 JOEYSHRIVER
221,564,040 *15480312EB38CD9BAC4744E208956E6AF406CF99 [email protected]
221,564,041 *15435456A4A55DB5DF2AC6478BF5DCF6634A19ED john-crombie
221,564,042 *154AE4E405932C65ED2C5EA34CF3996D6C5B0E63 johngeorgehanna
221,564,043 *154DCFFBF27535594EF2F708EFF0A960F8466896 johnnyhornak
221,564,044 *15436DF3AFFA3121D0C0DE7D751F32A820378B34 d;f_
221,564,045 *154AE8236DE8104DE77240C6580C29489B057F07 JÕÕKITSUST
221,564,046 *1548BFE2CA5ACD1C262C6B79818374DC6E7912AD JORDONCANEVARI
221,564,047 *1544106102F5F6048C8F6CC49C459F82FF095F5E dh/8
221,564,048 *154753146B70B3651D2B466BDD8621981F9D0087 JOSHPRENCE
221,564,049 *1543621CB3251CB97C56441E67F8B9985495D222 josiahchhom
221,564,050 *15440E195E05F521556352F691228B8E13E84736 JOSPEHVAINIO
221,564,051 *154CF3E06C3296FEBB6918F5E1BC73D1F1A5B9BF [email protected]
221,564,052 *15488885AE9621C87004346E1014B19BA3A6D339 jozw
221,564,053 *154E5E81A887DE32B7B35AFCE16ED9E7EAF9D300 [email protected]
221,564,054 *154F3F51829247E879442F294D36CA1A60169E6F JULESBACHHUBER
221,564,055 *154123665F3B62A9E1AFA6571A16CBD900EF8B17 DINOGARNET
221,564,056 *154A1C975089944E885B970B6976491B18F3A34E DIRK.HALSTON
221,564,057 *1544C27FF941A4C34143944C7127B4933E29ECC8 kanhapuri
221,564,058 *154C653C154569A37AADEE41B1E72DF531E186F6 doyoubelieveinmagicandotherhits
221,564,059 *15481D4F6243AABE06CBDFCB91AC82D6FF876685 KFZA
221,564,060 *154CC7B45BD0FBBA493D57AF22093093DBF7A740 DXP678BA
221,564,061 *154F0E71A9ACC3C87B40F510CA23AF3FD2EA8B5F ehorx
221,564,062 *1547BC8918339BDC28DA923F7D57DDFA55D6B42C EMERYSPRADLEY
221,564,063 *1549CF2ABAF647E2DFEF49DD29E9B9A1626BEECE ENDOFANERA
221,564,064 *154F9F73FF7CA5E885903C56C05657EFFB97F76D ENIQC
221,564,065 *1544E955F29398EAF4DE581B92D15CF2A541D810 «epic» —
221,564,066 *154545B6CBC3E9918CFCDA8BAD032F245010B01A LESLIEAGUILLON
221,564,067 *15435C11DA06C3E0075CC9AE627BA8FFD58901F4 eptesicus.pachyotis
221,564,068 *1547CDCF22493ECDDA0B2AB22134822B909B5D99 LINDACUPPLES
221,564,069 *154A8E640FB5239FE542C68AF59CC7E694142364 fs|!
221,564,070 *154F6F02FB444FA1E86E5FA7072DB0F55BC9A802 F=WA
221,564,071 *154AC114B39985EF4A4BE0BFA305B79CCC6C9625 GARNISSENTS
221,564,072 *15425EF4300F591D3D504608DD76604ABE9F0942 LUCAS.WISCHNER
221,564,073 *15496FD005279C670B5F1F057BCC615FC85F1BD0 LUCIANO.ENDLER
221,564,074 *154EF8AE7EE07164FE543692E2A243F7AF147E55 luciengerwin
221,564,075 *15402C4D391F4D47A42EE42840874DC6957663E5 luciusezdebski
221,564,076 *1541EB8562FD980C738BFF2767223BC3D901C6FE GEFÄLLEZONE
221,564,077 *154CB9569669EDA4D73E25A33AE9A46F78F5E761 M43416
221,564,078 *15423A4ADD3A32D7F9CB0198E6BACA210BA5F279 GERALDO.WASSENBERG
221,564,079 *1542F41F77D83A3E1578EDBD538E1783D8A95A5D GesellschaftundLebensformendesMittelalters
221,564,080 *1544C2185B65CE816778780834AECDFAF532A83E MAGN3T-FO
221,564,081 *1544D32AC6E08D1619A4A1C7D0AE4276AA8E96A2 GSPTST
221,564,082 *15467659E8EB0B8E69D4546EE198E18B560ADF8D GUILLERMO.GOODRUM
221,564,083 *154EA7BDFEE48CC0C6285D907E6EC0B8F334C2BD gumlong
221,564,084 *1547A8FDFF7549C01AE0722F51DB983C0BF2F9F6 MARCOFRIER
221,564,085 *1549D8B629D6FF2E5ED62662529719C26C9EC69E MARCYING
221,564,086 *154A53592C4254C20EFA922703F2F5C92972033B maries
221,564,087 *1546A3C8694BBECAA4294E31459B4C66AEA77C85 HAMSIAHS
221,564,088 *15456554476E654AF3CCBE9D95948750B5BE611D MICHELLEDURNING
221,564,089 *154296336B8DA94A36AED770F65243B9588929EF HTESSAP6
221,564,090 *154F086C927B581DAA7F171A7140107262F75B87 httpinvaderlydiawo
221,564,091 *154041CFEC376AFCBDE5CD588916D685BF84483A milannicola
221,564,092 *154015802BB71E24BDD8C84CDAA5560670CB8CCB MILANSCHELLHORN
221,564,093 *154D78FE6004BA7D224AFEEDA0D9C36F95123A51 miliardou
221,564,094 *154547526B55933FA35068ED2EB42A5477C7310C IC`"
221,564,095 *154C2AE93306AF9B3F7B38318547E56E760C3EBE if-you-just-keep-still
221,564,096 *154CAA2802820A7436BB9BAEA5FD5CB2BE385D02 mohammad-essam
221,564,097 *154C97E4A7D87A8AA7565FB341B8B9E5F9769956 mollusc
221,564,098 *154A7E16385FD49B28D5018683E7FC1926F1B357 irvincrombie
221,564,099 *154F5C6D5539B391E89021A85CB640809AA03372 MULTIPROTOCOL.ENCAPSULATION
221,564,100 *154C9BB14F90716653A037ADFB4711371068E546 JACQUESMARIANO
221,564,101 *154073D272A36818E99854C7E7BBC3DD28EACEB7 MUSELAIT1
221,564,102 *154DFFD09F9D01BE1A710F7F7BA7B6CB52B96EEE MYGANDALF41
221,564,103 *15441F1A8E5F73E2B453375857102B873117672E [email protected]
221,564,104 *154AC1E2D7B83C4CA903018EFBF55EFAAD041B41 NARRTETING
221,564,105 *154679AD221C51A814DC9ABFA428916ED29B1DB8 JESUFALI
221,564,106 *1540F09CE65D64E0476A9580ED6AEF8C30C84AD0 [email protected]
221,564,107 *1540D4CB38F74778CBC910E70C94E8D4DB0864AE NESTOR.GUTTMAN
221,564,108 *154FDB98CA4F29C8F91D8AFDA11C17209447645A JOECATINO
221,564,109 *1542F53033163E9ADF7E5138613E8593BCBDDDA8 NEUROLIMINAL
221,564,110 *154616ADBC8DAB99DED1EC11D1FB9FF3ABF7C976 john-crombie
221,564,111 *15425E18A14064568ED4C01CA88B0AF22EF33A2B JÕÕKITSUST
221,564,112 *154D658B256248B50EE90A0778B90B0A7FD83173 [email protected]
221,564,113 *154400E53391D93EB481D143EEB098C78CC602AC OBLICATI
221,564,114 *1548FB97280FECAE81BE74BCA9B083D6E125AFF0 KEVENADUDDELL
221,564,115 *15471475EE89B95B5F3FF4522356EC5E1962C406 KFZA
221,564,116 *1547A298380AB22464D39E7E3257794027E4826B ogbertd
221,564,117 *1548410531092BE8B4DDA8D3B017FF2FD82AE498 OLIVERFRANKIE
221,564,118 *15456DFD351F3EB15B6E36A55540B77E32A45BDF kjtaaa
221,564,119 *1546E0692E9C4E343C4CF74188F3E71032D9D182 koreydurham
221,564,120 *1540D11085018B232F6D72C8FB1E988C6FDE7E7B PASSA-SENHOR
221,564,121 *154B6BBFEA14E7D8E245AF0EAD88BD77AAEF588F LINCOLNBACHORSKI
221,564,122 *154112B2B3CB68B9D7DB959E4B7290FF64B98FCC LINDACUPPLES
221,564,123 *154A59B05B5BDC98C6EC3AC9ACEE49E4C4EEF5BB loose.(take.23)
221,564,124 *1548E71D60AC3321AFB8343977B547C36A310982 LOWER-DENOMINATION
221,564,125 *154D414EC7515798BD4F0F50A0B664535168E92B LUCAS.WISCHNER
221,564,126 *154F77429B042970D98959ACC9A72170F94745BA PHILURQUIZA
221,564,127 *15442A79FD0873ECBF7E5B6788E32D22D7AB7067 M43416
221,564,128 *154F1D8777FA948A99D67AF5BCFD5D6F01814C7F MADEJÓWKA
221,564,129 *15426A54879A6B27CCBA0241FE97885ADD63962B MAGN3T-FO
221,564,130 *15494419B5693E427BB5B23166B129CADAD4FD9D MARAITIA
221,564,131 *15424A2E01ADBF4A9E9575F81B06023E84FFA443 MARCOBEELBY
221,564,132 *1548F739674CAC53B409EE2B34F89B5A08EAE22A POSSIBLY7
221,564,133 *15420914B09EEA7757EC3015EEB8432FF41A7C9C @PPREN7CESHP
221,564,134 *1543DED99591EDB9F7721B9FF87F34C2B34E971D pp.*.*splat
221,564,135 *154F8958BF84F94D19164C85BA6F68A44A350E64 PRESENCE3
221,564,136 *154070A2F86AA9A4A26A3B6F0553F8BDAC569E29 MILO.REINSVOLD
221,564,137 *1547EA8C0ADD6E9DC6F5730A73E8CD08B7D6DE41 MISUNDERSTANDINGS.ET
221,564,138 *1543B299675FA7792FAC8D0566DF080F5222F081 qb]+
221,564,139 *1543F1CF539E0F1E9834F6C42DC28786CA2280F4 mollusc
221,564,140 *154323F48FBF7084DEF782B033AB2D0001F9F04B q===> `splat!!
221,564,141 *1547BFE1ECFFD6AAB0E117BF78FE676BD3ADBD58 mujahid.ramzan
221,564,142 *15455D6A5093C2AB6FB12BC902222202572B17C9 mysteven44
221,564,143 *154B88BBD30376817ABF44A9CB40E818426AF4C7 neha.kaushal
221,564,144 *154C7802ABA0DB58D84DEA23A4E71A8D1A030775 RÉAFFERMI
221,564,145 *154854B769C15AAC45192A2192F21A0A143A2C78 NICOLASSCHORZMAN
221,564,146 *154FF8DEA573DF48D50C2DD8D0738171F240A424 ninevolt4
221,564,147 *1544A05C6753F2C932F64EE0229F5D418E024B66 nitaclugston
221,564,148 *154F5091D4EC6528A64B86D727688CF33B6B573B REMAILERSBSW3
221,564,149 *154870E179D2268AC0DC7C782A15815FB1130037 norsiah.othman
221,564,150 *15406919DC319132F4B65AEF2D27E733B3CD5E1C ;)o~0~qB
221,564,151 *15493CD6FAEF6916124478EE2C6340BD69B37936 [email protected]
221,564,152 *1549F94C8343A0490F21EC37ABA20DAEC496DCB8 OLIVERFRANKIE
221,564,153 *154933EC4C20684EA0B77C567CAB57D62329A003 ophiobatrachia7
221,564,154 *154EA0E0E752B0866891D0E81BB1CF6F9E1F3497 rileymaeno
221,564,155 *154F6EF0988FF64E4EE547FFC1D48E28C68498F1 R'O{
221,564,156 *154AB7CF3556AE81891BC1161515D239ECC84463 o`x
221,564,157 *1542AD73F62ACFAF99A1AB702905CFD9E227C464 RODNEY.BIRCKHEAD
221,564,158 *154D054CFC79A9674EBD27C35A1810AB2DF99084 PALMER.BARTHOLOMAY
221,564,159 *1546BE6A746C95FB844FBCB783180079729567F9 ROMANBRANDMAN
221,564,160 *154D0F96F341E0C7A1F4F933C6F87CF224BD99F2 RONDELAG9
221,564,161 *154C0A644E7B942AB0FA6C94E20A149A936D7AD0 /ROOT/BINDSLAVE/BIN/NAMED/DB_SECC
221,564,162 *1540E0C642615E3F372C59BBC0EFBB24D051CC0C ROSISKA2
221,564,163 *154092B3D45FB9C1FD2CA9167CEAA5C9F5C53566 patriciahome
221,564,164 *15468EE152B77E55293FFBEEF2EBDAABAF52516C RUDE6NESS
221,564,165 *154460B965B1D76626187FA4BC9CA0A4DEC0D34E p#D.*o->-<
221,564,166 *1547B6CC24FE7836841719B52BEF753C90F9A71B RUSS.HUTCHEN
221,564,167 *1540291F7FD372240A29B5975AE862C5570CB672 [email protected]
221,564,168 *1545D0B6DCFB82AD097DF0ED67B23F78811834B9 S3M49RC17R41
221,564,169 *154E68A53D4DA53375840A023337A40743A9EF33 PGHMLDN5
221,564,170 *154506E143BC9066C578864C95CB6470BA8A0655 pierrenanke
221,564,171 *1549FE03A1B27D6A8E5FB5D5604229C855F58D34 POIS4RI4M
221,564,172 *154D8538E617A8CEF22A27647B58FCA014AD45FC p----P-~oSplat!
221,564,173 *154EA278DF9DAF743C541FB1BF6387E1F289B23E SDAERPSID7
221,564,174 *1543D75B9C08847ADE1058848F4197A35F90CE36 PRIVALEM8
221,564,175 *154DCF0EA4089E68DF45337851723DD8FB6BFDD7 PSAARPFXW4
221,564,176 *154065824855F57274F48876C1B707A850F4D3F2 [email protected]
221,564,177 *15405B77B70F60EB7248AEB3FD2AEBB2065C23B2 SHELTONMAYESHIBA
221,564,178 *154E775A7CD36CAF2B76F27A4D57043301A323CD RAFA$K08
221,564,179 *154F0FA15ABC06FFE9438DA470A4D929A8483813 SHILLEMI
221,564,180 *154518DE7A66F73793875B6F3426B84BEE48AB85 RALEIGHGULISANO
221,564,181 *15443ECF2718047C7A99CE83CC387DEBED83FEB3 RDYHACED8
221,564,182 *1541AA7721DE68746542CE7916D33B4EAAE5DCDF SKIINGPACERSED
221,564,183 *154C22074C26051CF4A1174132FF354605F05044 SKJENNE9
221,564,184 *1543D096C8404267B100AA0F3AE5262F847ECA15 SKVALPE
221,564,185 *1545B0B1BB7FC7A073DCB2B0856D330A4A452B37 SLOKSWAMI
221,564,186 *15459A0B88E6CB89CFBDB832371801711C33258F RETLEDNA8
221,564,187 *154A40C812D500EC02646FAFB6B472E20C88FD08 RETYKKESTE0
221,564,188 *15410F928CE223BE55A89518E52527303D1B6D65 SOLDMOS
221,564,189 *154897EA6A13E2F52C5D71E0F43E8F67E390BEB2 RICO.ERDELT
221,564,190 *1543FF963E4740B6527B534E145EC57309EF6BB2 SPEZIALSCHIFFEN0
221,564,191 *1540BA769ABF185B4275BFF73428C8961DB76886 RUSS.HUTCHEN
221,564,192 *154FD76F5F65BA6B29563B0F6C99216B90805725 splynou2
221,564,193 *15485522436CA342FB43099AD87984089FA3112D STEELERSDECEMBER8
221,564,194 *154B9149441865DE39CF3882C2D799A17566D90E stefanpanton
221,564,195 *154F547C0323CD3815E730408871EC37B8B1860B STEGNÓ
221,564,196 *154512EDA50009FC906AD9A37F497A58CF9D4742 STELESTELE5
221,564,197 *154E694D1252D4F817B8A49BDC0F368B918AE00D STENGSIMĖS
221,564,198 *1548690394CF86C1A882453B72BA1929BCA73A24 seeffoc8
221,564,199 *15444DEE70609D5CEABBB10E9B714E63BCE5498A superangulons
221,564,200 *154AC86B76C772A58FA16C8A9EC06C367AC817C4 Swallow.You.Whole.(mix)
221,564,201 *154D7026396E312D03EAE4259B3E4820821E00CF sweetfalsecamomile
221,564,202 *154BD51FFB1666F42E4FBD0A9F551A84DB3D8401 SHISHENZU
221,564,203 *154FD1320AB1E23554805FEAFA3B04C74FAA09C2 SIHAIKAED
221,564,204 *1544E6498AEA8B1D0ACE38AB7F472841C298568E tartisiz
221,564,205 *15414E5DDFDD5F915F6DB9D7E9E2660D4CB78F02 SPEZIALSCHIFFEN0
221,564,206 *154772CD8BFD936A4A9C1CFBA8A192B7AA523AAB STEELERSDECEMBER8
221,564,207 *154D9678EFD0D56134C0CD31118870883EAAF9C1 THIG
221,564,208 *154EFEB180DD330D43EA4EFA856905CDA3BC5156 TIENDPLICHTIGE9
221,564,209 *154BD6E6AF18FBF70EE04C822CBC401D113B4B9F SUGITOBSW9
221,564,210 *154C4D49C5B621B069B58CC180B9B2BF3C97201E TITAN-FUELED
221,564,211 *154857D24B797926A53B021B94F0F51146221669 tomboemig
221,564,212 *154018FD3556D0691CC5B3423A939D5A442DCDE2 tomgjeltema
221,564,213 *15459595D8D722112F7E8A758D7E2B693482AAD7 TONEY.MONFILS
221,564,214 *154B7953C9F57B9045BB090F7A76A4BFA8969058 took.it
221,564,215 *1540C0DA7C773B9ED85D92D552BEDE20CF8E2780 [email protected]
221,564,216 *154757D9389D5FA640D4DEF065618E6A178C8D71 TOOTSIESPEEDO1
221,564,217 *154A8597A181E2ED79016D9D37C4FF79B008692F TOSEEMS
221,564,218 *154D986463A2289E35A9DF79118AACC42262B9E9 SYSTEMSWEETY6
221,564,219 *154C312C4466E35453076680C2EF2E2F1B70B60A TRIOMPHOED
221,564,220 *15475F76E647B07DACC996177B8B6C76163E1700 tartisiz
221,564,221 *154F544C4A27DA2A9D2CED450ECD0E3CC40450E0 TUAMAROMPIS
221,564,222 *154EE2563BB7A199B2646769DA42B80317227E50 TYOEVAEENOPISTOSTING
221,564,223 *154DC93D6E2F7F59CD396853199B7302EF9BE691 TYRONELIEFF
221,564,224 *15433BC93CEED0EA25D02CA5B0C334E869019048 TYRONE.WAYE
221,564,225 *1543289A451DFA2FD4EFA972877506142F84A9DF terrencenicol
221,564,226 *154CEA3E8CC3E33879184014CB9EB7C9C6ECAB70 TEZSTER
221,564,227 *154DA0B84B0BD388FD2F1D6BE737666BA8202905 thatharvard76
221,564,228 *1543D0A5D59960E80822B12FC0F65D6BB73C4DBE THE.PLURAL
221,564,229 *1545D6E56AF718D12C56B321C436C3D53F2AFE77 TONEY.MONFILS
221,564,230 *1549C4F63588333106BA3DAD0D497080EB33B357 u?-v
221,564,231 *154D0746AA3DD712CABBE6A3593644E3B84CF0D5 travissemmes
221,564,232 *154F30BA5678612E422AE15C1D7162FF0B5FC0C1 valtroy
221,564,233 *15425597C06914B8D4C2D249A8C804B62FAFB078 TROYVITKUS
221,564,234 *154D7B92E85F0B048E594CE481C23FA91E21DB5B VARUNVENAIK
221,564,235 *15498B43E9520A9512C1CA38671CF4B7CD3BC64F TSNAABRU8
221,564,236 *154593AD300D609E9073D427EF449D13228C4E6F veneca.harrison
221,564,237 *154874C4E94DEF2B6F45DFA7FCAFEB2E34CEF863 [email protected]
221,564,238 *154F8D205D7D655392701BB9AB71B94E9E3FE857 TYOEVAEENOPISTOSTING
221,564,239 *154A7927DF03E85053F455B13A9FDC0993844E85 upsettled
221,564,240 *154DB8BFB1D81394102544397EA45C845F32E3E9 UTARII DIN CHI
221,564,241 *154568FA378D2C3B3022FF42E69CAEB7266E2555 V450T8712
221,564,242 *154BBE65ADA94E27D2820795F77635F4D3E80C52 veneca.harrison
221,564,243 *15413AFA3F4AEE104C88C8B19CA00A7A0F142315 VERGA.CACA
221,564,244 *154314B82EBD85C7C32060757E0CD9FE6BC5A4AC VQ8>
221,564,245 *154959081CEE4490BAFCDF49229C6317500665D9 WENDIDI2
221,564,246 *154E88CDBAB62C9F182F8F44C9E2FA0027F55A08 WBQC25
221,564,247 *15429E1241CB0A509CFD1068A5D55BEAFC0A4634 WILBER.CRAPO
221,564,248 *1545246A0D8D79DE3FD67D9B4E1153E1B75983F9 wilfordcippina
221,564,249 *15477A5C8C73622E5E1C328AB4EA38A5769D7B60 WILLIAMCRAAN
221,564,250 *1549EB5DB11F3C30E07A9AD2A6AB85E5F857B896 WILMERSTROP
221,564,251 *154704637436EDFCA13E959CE847EC595E66C903 WOODROWKIDWELL
221,564,252 *154BD00B2FB71F65B47AC9692B3F342A9286C2C9 wwwgenoviquecom
221,564,253 *1549ED4188EFEC93428B66B9D3DA5FABACB7A6AD X13644347574
221,564,254 *154461B785AF964048915E112465B1B4C9D908EF X146318
221,564,255 *1545E250E8B1965B2A757687A4EF149016880526 [email protected]
221,564,256 *154E8D15D5BBE7CE16079648458E35A74D3754F2 [email protected]
221,564,257 *1544FD8D3005C7E67006EF2D2A626365E42CAA8F xyrdeno
221,564,258 *154D8377FB40D7CFF2662156BD53CB547606F0E2 yabbar.amin
221,564,259 *15488761D63638EBA446F97F41C34E303F931F28 YARITZAPORTAL
221,564,260 *154169EAA42DFDF2E4255A21BCE340AC5B37E5D6 yashkumarnundloll
221,564,261 *15421E4F471C8EF7B8C8C52607C39918A03240A8 [email protected]
221,564,262 *15450FABB76F9BB06C69E02D2CF18A9B4040ACEB YUMIIV
221,564,263 *1544E0D650F6E374B8F23F5C753BDCE415313E8C yusyakh-gusta
221,564,264 *154A45EA30B3F303F9E101B8693765FFEB9A24DF yvonneswankurtzhals
221,564,265 *15459AD5668A3AE9B54E2B298ED6D12A0A1F06AB ZACKMULLENIX
221,564,266 *1541238287CC250E0AF4A1647B19B265C3FE116C zerolimitlinkdlog
221,564,267 *15424133794B1FB1BABCD0CFCEB8B416755BD264 [email protected]
221,564,268 *1540733A97D2E5EEF3E70C80BC917A5A2858AE6D [email protected]
221,564,269 *1548081FA9F0F35B357A0AA90DBFA5641F20CA3D ZOCTARINA
221,564,270 *154020F12D9BD1558DAD1603520B3161E87D2B2E zozo-zenji
221,564,271 *1549899E70B38981FF208795ED5AB1979B5F0A2A ZUZANA LAJDOVA
221,564,272 *15425225960403A651722EFDFAAE7BFFA38E1594 ϜΈΡΡΩ
221,564,273 *15457D01CD2A900A3A03E7B4AB3D643788E79E26 СТЮРБЬЁРНССОНА
221,564,274 *1545F9AF0A67DC0A901A8AC403AADA221A580D94 ульяновскаллал
221,564,275 *15426E2202FA003EBD8337946221DC10C184E66D 14december1820
221,564,276 *154B33B36D0ED22502A1BFE04C2875D1E8A2D1BA 0MYKRISTIN1
221,564,277 *1545633D46EC398033D65F2E78B8DD2AB725085D 1895062 hakeneistaosakutsutaanhenkil
221,564,278 *154A50688DC3B36BB0B9FF73DC7E162F9F505691 10 RAJOITTUNEEMPI
221,564,279 *154414A92434005219A919FA06DCD342237D1C35 1AGEUGNOT
221,564,280 *15461E6DBDB13CBBC0A2DD8061B169E199AC89F6 1-B-GLUC
221,564,281 *1543378D07255F4E22D3D26770E305C73E230510 1brassrubbing
221,564,282 *154B68D460466C59E3C3A455DEB1D081DF6BE711 1392418 on yht
221,564,283 *15421926E189D6CA5CFB8CE328C7138EBC4052D9 15APR1012
221,564,284 *154CB05E43267E5902BC3EEF51CDAF1B34B0E0BA 16GUNLERIMIZ
221,564,285 *154336658754AF277E6112F09A88F76F153AB0E4 1982年頃からのライヴでは「虹」に変わり『straight
221,564,286 *154B6D81444A0AC802108348F8608F23B0B47388 1LEICHTMETALLBLECH
221,564,287 *1548F8A59368BA4119A10A8CD2080107CD3DB6F2 1LISTERIATUTKIMUKSISSA
221,564,288 *1543407D1622211CFB4FC0655B0360573C7560C0 1 AKTEILLE
221,564,289 *154D20052B721C57B82BD55E9EEE3C0C67ED542D 1morfondant
221,564,290 *154F5EAEFB65BE548BF08D39A4260AB5EE53B6B0 1NIEDERLASSUNGSKANDIDATEN
221,564,291 *154991B09A50B24CF3229FDF6A41188E20D9A22E 1non-labelled
221,564,292 *1541D0CB1E1BD396E9452C235E9AD6167F7F8130 1CONFRONTATONS
221,564,293 *154A1A2884CAE79988721BDB67DC4ABAF8EC7B3B 1disquisited
221,564,294 *1542CCECB11B51CD37433E094CA4CC772ADE8D86 1eil-entscheidung
221,564,295 *1541B93680CD5258AB86F472DCD4F2A0E8CB0635 1-SWF-JUJUSTITIAR
221,564,296 *154DED63F454034DD9E93CBA49CD4DFAF9E4F070 1.VIEHEKORTTIIN
221,564,297 *154C7D96FECEE7F0D527B62F702F3A0A81F9303E 1-zupanjan
221,564,298 *154407B91102EB657B055894B0E546765DB2A6C0 1journey-phobic
221,564,299 *1546D7BFDBD4874F36AD9482747BAC200FE1E5C8 2676790 perkinsin on parasta p
221,564,300 *1549B160C0A187054EB2365F428F1CB3C38BFCFF 1-RADO-FILM
221,564,301 *15498FAFBC0E8B244C52601F4D383AE61075B0B4 1 STALLONESTONE
221,564,302 *154E58DCEAC1D310A439BF743430EF48B0C76C25 2.blintzes
221,564,303 *154046E6ED304F24C49B14038224807DB81A9CD4 2001CENSUSPEI
221,564,304 *154C7070FE948768463F8750343A282C43030A3C 2FUNCPTRS
221,564,305 *1541C8A3060091630AD5BCA98B6B61B2010BEC46 204642 kisiselsergiacmasienderrastlananbirolaydir
221,564,306 *1545AFCB980D7CFC93D7AD2A11AA36531E93E2CF 2ZEGSLIED
221,564,307 *15474E6E2AB57D465BCE221D6B46C879C1D51FCC 236.bratwurst
221,564,308 *15420A488624461E4837EAF56AAD76088AFB8973 3BEWZXQIB
221,564,309 *1541055CB8019EF849070EDA5FBFCE6EF7DD7BC9 [email protected]
221,564,310 *1544DF5DBE2E19E11F49C23C5D4AFCCBB23ADD70 3-eighteenth-century
221,564,311 *154A6A4A4A763A297813E7C851D86CAAFEE37680 [email protected]
221,564,312 *154B1E70CBB8D4E0B870BE5B3BB0A38062D35FAE 3.KASVATUSTIETEEST
221,564,313 *15463FC619BBB3CBD8A87C107F77A79B7CD3ECDF 3==).*.}O{
221,564,314 *15421B15035A6137EA2F32A8B069212B7679F8D0 3p`.splat!
221,564,315 *154B8DDE879E53509387E717C48F0772ECE2A178 416344 "-i-didn't-want-to-get-back-in-with-things-so-volatile-.
221,564,316 *154267DC4D8D4B6CA87E49193DA58461C139BDC1 43 BRONZES
221,564,317 *15416991D403006217BE7C203C451A9F4D5D9776 45869 GANICELEBISOK
221,564,318 *154F61AB0D007E89CEED32E9FA68B7032F12337D 26NOVEMBER1102
221,564,319 *154AEE853117809E4993BC26853FE4E37CAEA3A9 4CHRNSCP
221,564,320 *154693FD799F8EE549A6ACFCE5A0C24B08D0FD79 4-FIKSULTA
221,564,321 *1540CD5DC821A2E2F915AD3059B39E883742226A 4HINSHAW
221,564,322 *154E0A31BE72330F8CB44E852CD860E4585A97AC 4.KARKEAMPIA
221,564,323 *154DB062308ECC7B8CC8CD7E51AD67E5ADD762B0 4KOKOSKIDOO
221,564,324 *154977960708C41C61030542B88499756C773C2C 4PERTURBATION
221,564,325 *154C3BEF3F2EE674E97D3656358015B1D7E5EF37 2 HILMER
221,564,326 *154B5BC620C55B6A2920E50E0D1DF305D0340D12 51RT82
221,564,327 *154062B06CA00278AEA8EF9C3F517F60F9CD5A12 5ACORRALAR
221,564,328 *15443DAAD7B3F35AA5F195C8773DBD319CE4B085 2SOOKLALI
221,564,329 *154AC056097ED1BA44F97A032493F20E32759B1C 5CREATEMENUBSW
221,564,330 *154AA87DB141A744586896662845D14AAED9805F 3---)-`~-`~-;)
221,564,331 *154D7842FBBDC929AE4F07BB8F4D062FCE9A746F [email protected]
221,564,332 *154A17B630B2E05A20CD26ECD00F5B309E3415FE 5MALFETRIA
221,564,333 *1547ACACA03E2858AEC88CD063A37D368104D6F1 5OMBREARAM
221,564,334 *154B3D0A9D786473665DF11CEE3E8D46CAE43D16 3CHEECKY
221,564,335 *15454767869051B7D8DC68911274672DBEE75F04 5UDDRAGNINGS
221,564,336 *1546D7006AD5FE339DB3A818646356886AB28C9C 5UPSETBAFFLED
221,564,337 *15443FEB0C0C2F6A9CE972CCDA9199F91BA026FD 5WYSHOGRODBSW
221,564,338 *154CFC3D3AAFB9FC49B593B3BB5C5F185B59C983 3MAINING
221,564,339 *1544D90219011AD0BA65A8E51D99EB05729DE1D3 3> * * *SPLAT
221,564,340 *1541D0529CB78D3D513FFDBDA46AE0B8F51E52A9 4}2a
221,564,341 *15447D9CAA6AB70D7577284620E2A9EBFAF9D7AA 4ARTHENEUS
221,564,342 *154D5CD07982FC151D1C6F0E36C09A4CA7841F98 6RASTRESIT
221,564,343 *1549CB7EE995C45ADFEF967A6EF5C829527BAE68 6REVEREND
221,564,344 *1548E41E6B3AEBCF0FF187FD51AAD7149DEBAC75 4SPELAEUM
221,564,345 *154F1D326BBE71429720EB0D4D0AE7DDAC543774 577carley
221,564,346 *154BCD08271C987AC713A7A3F0073455D2675867 5CINDERHEATHER
221,564,347 *15437243380C6546E3974221B3BD63627E31F8AB 7RIPICOLI
221,564,348 *154B1B88905A7AA6FBB1799C8B001AA7D53BB18F 5POGARDZE
221,564,349 *154A80DAE64F66D1FF2DD48F183826B9EF73F48A 5VRADENBURG
221,564,350 *15488BB814C942705F159F2F5B99889ED0509D51 674SHANNON
221,564,351 *154C0AB8CFFE251641DADC14E595F2CC14412742 8MISHADEBBIE
221,564,352 *154293345900A24B147FA69221C68FFDE6B58791 8POEMAPOEMATIS
221,564,353 *1547471BCFE0666C0A162D7D5A01375D50CAD0F2 8TRAMONTEREI
221,564,354 *15460AD3F43C0671DDF5548791766CDDB709F889 6THATUTOPIA7
221,564,355 *154548FEC58F52BE1C03AFFC0ADF53725A4ADC09 958darwin
221,564,356 *1547D086D2029549F1E1BEF20F8742CD4280169F 9DANSERENS
221,564,357 *1549EFAB7B35C886FB08894C4E54D166260DA4EC 9GNIZITELLAP
221,564,358 *1541C9756610ADCBACB9702ECB95498E7EA9EBB1 7ILOVEXXXXXXXX0
221,564,359 *1541E5006F6CBF04750A1CD02271CF937E3EA80F 7THATGOFORIT0
221,564,360 *154AF01E420BCE30CDEACFEA973D9DC40D74CE78 8NSIDERES
221,564,361 *15401F12683329EB4D4FD5B79290239DDE887E77 ac:P
221,564,362 *154205E2584453A9AC27D3B5C3E51CF570FFAFC4 ACQ4=
221,564,363 *154549EF77CF2281C484D734738124A527F9E065 ADANMCKINZIE
221,564,364 *15439287D2837120670496425B1C521EA70D8D9E AD%BM
221,564,365 *15435C8A4A4E3F74D64D6BA0267C17B72AA1FEE6 agboi
221,564,366 *154BFFB857772EB27DBA64379DD1674B546E2649 AHMEDHIRSI
221,564,367 *1540CE368CB55BF24A1D7345E04C6FF9546D2FE8 aa;k6
221,564,368 *154773F88710E7D6EE19AD154FD25F22689D2609 abx"s
221,564,369 *1543395D9786E8E77161ADCBEBA18318E7FD8271 algxm
221,564,370 *154B4190A9A637FA30343EEE0CFE9D94B4F27395 [email protected]
221,564,371 *1549E2759EF3A88337487128B5D7DBA2C8E25C11 ADDUTTORE6
221,564,372 *15430D535ADCED323607D894A5AF0DB79F5539A3 ANDREAMARKVE
221,564,373 *1542B4501E28214F78B359FBE063E422E5AFB3C3 ANDREAS.KRISTENSEN
221,564,374 *154D9286A1AC79AE19EF9D60189C924C5E11B2FE ANGELOSETLIFF
221,564,375 *154E960FB4D0548AABE900E5EEB567B3776E3030 ANN ARBOR BLUES
221,564,376 *154F3FD458B9EF38735888E5130738FC8094F801 AH"MI
221,564,377 *15431AE8472AD4626861323EEE0FD91563341A0F ahtabec
221,564,378 *154488A1BF819185E6EB0D504FFE630AB0A31920 AJHI&
221,564,379 *1548930EDF53327D202A78C27896631B10A2B5F7 appesantirai.
221,564,380 *15420DDCD7B846B216AE68C6264A884248FB785D all-nightvigil,op.37:matins:ix.oqueenvictorious
221,564,381 *154E15259427BCCA87B05E82F0A8B78A3B81C4E9 ARNAV845
221,564,382 *1549C3A552A6ECAA87769B648A1960F0614CDED6 AMBROSE.WANCA
221,564,383 *15418465AC9FA2A4F44332F7AB20CB5761BF15DE ARROCHITA
221,564,384 *15400A7BDD84B1810CA73051565064642530CCB2 ARTICULANTES123
221,564,385 *154D76145C7029BA67467850FE1C65BC74EC2909 angelica.alderman
221,564,386 *154995FDC6D80177010F165F43D43F626FA1A3A3 arvf
221,564,387 *1546D6C9387CA60781C59AFDD11FFB1F1F5725AF ANTWANCROUT
221,564,388 *154917E5BC09ADC88D504DE4CAD8D1566983F875 AVOISINERAIENT
221,564,389 *15486D7CF78DEC5CA544E134B71268D47E40DA1B ARNOLDO.STASSI
221,564,390 *154D084031DFD1AFAC783B269D780F834F55A99F AWNH&
221,564,391 *154ECB208C4128122B12956A3707ACC502E1CC17 A"TYH
221,564,392 *15482A212B179E0791ECFE7F4B237A5570D5B98B BANDIT1923
221,564,393 *15458DE8D9E82F78DA8DB207B15BB153C1DA4B3A baptisedinfire
221,564,394 *1542005C1C5171DC0C1A97BCD71952A94E06F634 a_)v
221,564,395 *154303EA5234532CF15FFA429BC771F55793DA3D BASKETBALLWEBER
221,564,396 *1541B108EAF093D04AA1EFEBAF6798117DA41471 basmalas
221,564,397 *154BDB479AE4ACEFB27F2F6E2B9A959FE288742E b3b+"
221,564,398 *154F178B2E57A37A65C2F4C44A6C733F1C1BCE12 ba"&:
221,564,399 *15471F2F1CE916213B55F74EC6B740202BA312E9 bertrammanivong
221,564,400 *15437CD74486BCD62C56AEB416C44212F524554F BARKANIA
221,564,401 *15416A255F43248DEE7E70D6B71866465C56DBDB BILLHORIST&KKNULL
221,564,402 *154B01AF40F3888398F8DF74EC3B6BD19A32A4DB bi&yc
221,564,403 *154D22F59F74D88A063BA7814175B45373879344 BRAIN.AMEDEO
221,564,404 *154D307C18EE926629A535A059977BF121C4E642 BRANAN123
221,564,405 *1548B32495359BF5F4C2B128487770FEBCD9EFE3 BLUEMOON00
221,564,406 *15488EB76FAF0F37E1D1C6A053FDEFABDFFBBC18 B:RB1
221,564,407 *154AEDD4E530166BC42A4ACF8D9B5674DEB1765F BMEJ
221,564,408 *1549EFAB8B2DAF70BD6970B74CFA8D47D542613A bochvar0
221,564,409 *154DFE7DADE5FB9FF10140D47F0E1507A731D20B brooksmook
221,564,410 *154B90C55855E036FB396E35AE29DD43EFFDE33F BRUCE GILLMAN
221,564,411 *154BC6F1DDFF7FACE275079343F7D5F0CCC7C1A7 BRUNO.WEST
221,564,412 *15429B9EC95865935A68ED617DE0D7E675B3B5A2 bswfilength
221,564,413 *1547187B6B3AD99CE00C8EBDED2248A059F72395 bp.~o.~o.(>_<)
221,564,414 *154EEA4735EEF8D5EB43DED299695C65BBDE5D7C BRADYSANSOUCIE
221,564,415 *154135BE160BFB5D3EA1BDBE84F7FA7F6FD5735F buzzina
221,564,416 *1547C6CE6DB22080605E85161B6478434F8669EB C230275
221,564,417 *1543A85284CA2C3408C253F3CE30F5A0C9BDFEFD [email protected]
221,564,418 *154E3CA9FC696DE0DE08CC87DDD79CBA32745ABE BTKg
221,564,419 *154E8543DBC1B07B70E92CB6E040DFD85A091685 c3l3braton$
221,564,420 *1544512FEF8F3F678D0A99497D19BA830B4553CE c4119abdf09b0db52d8da9df02ddfaa3.579ET74O
221,564,421 *154C848898A1ED301EF635E78FFA683E47DF1AEF bubi/
221,564,422 *154D348F123635447CFB877A50212F56963B4625 BWADMIN7
221,564,423 *154B10416DD5CEC551896B0665CA58397A7F967A CANDEL0R
221,564,424 *1542863504347E95B3A2ABF001A5B570D9FEB140 [email protected]
221,564,425 *154B98DABB32BB1BA8BDC08A6BAF105BEAFE5121 C0C,I
221,564,426 *154C29555EE1C6D85FFF75F74A1F0310D5FA93BC CARKEYN8
221,564,427 *15431AD5771C8580C30AE746A7B85C5D559D9ABA CARLBEALES
221,564,428 *15467916DEA5922EA1E35395FE418F033B1CDF11 C1LLH
221,564,429 *154D3F77808E4CE7AE93BAF3531294D1946772BB C2EWF
221,564,430 *154B646063EB79934D624B53763B97B235227345 CARSONGAGG
221,564,431 *154F70F4F428B1AD72D10A8E342AD7E185E19A93 CASTESP6
221,564,432 *1544A994AD1A49A6A87A60E9FB2D7EC07D491CC0 CECILIANORTON
221,564,433 *154BCB43E6DE23C723F0D156978562CA585CCF8F cf:.u
221,564,434 *1549DC311BE66EA6EE75271F6210FA138B9BC85A cg(-t
221,564,435 *1547CF81A16E7C88CE0E0C8AF8A0D94581E3A0B2 CHETURESTI
221,564,436 *154E1B465A5A1C91FB8C9ED3016E097CFBD3DCD9 CHIARRIOLA
221,564,437 *15464B8EEAD3D39073E21574369AB0C8F0B6980D CELESSL
221,564,438 *154348B56E4C1CCEBE59DF88215D98A1F476D61F CG+#Y
221,564,439 *154FA337CA77128C6C6E79134D12EE17D6912272 cisxp
221,564,440 *1549EF0454C9E8DCAF536BAB42E4F981F6B35EEC clarencezehrbach
221,564,441 *154C21B8498C2B3AE604E4F407761BC9917E3963 CLARICK8
221,564,442 *154F5A1D9FF5E428F4B4BD02E539924FA6AF94F9 clevelandsimiskey
221,564,443 *1549382610FE1E3948862326A635F42FAA2348E2 CHS_A
221,564,444 *154DEFD3E371F4D491FFF16FDDDE7F39DAE67F3C cik!
221,564,445 *154FF0C4C7A567F52506C9D506B37991BF3D0157 CIPOCAR0
221,564,446 *154917F60D6642F7E14A0F243888386EB1428E57 COEMPTOR1234
221,564,447 *15494197F37083AAE83958AB1C848CC9A0E5BA31 CLEMENTSWANHART
221,564,448 *1541D0AB8DBC94880C303EF5AB6717141F68A2C9 commissionedpublications
221,564,449 *15411A43457E5CC53320F1BD294F1EA67371A34C colletfoot
221,564,450 *15458024AED441850431FB50FFD574962F80AAC9 c:\programfiles\codeblocks\share\codeblocks\templates\wizard\tricore\templates\triboard-tc1797\memoryrom-intern.x
221,564,451 *1547840AB4ED77AC9A54586E6A9DF4A713354130 CONSULSHIPS.
221,564,452 *1545D7833D8448C73F7EA162EAD348E0893C694A d(6b
221,564,453 *1547D2D89D2E144A96011828D15860967E106F78 DANIEL.CAPIZZI
221,564,454 *154AA062269C2EBA037E86831B4B647B348AEF74 DANIEL.MAUS
221,564,455 *154BAA130EEBD0EF762BFCE1B9699F22A7C7B008 d9l-o
221,564,456 *1543A1CF67103B613C939E37EC02098A68B0F4C2 DADP
221,564,457 *1549C1B081DC4B43EBCC34B846132B2266E4CCE6 DALI-DESNUDO
221,564,458 *154470C06E5D3A311C374FF97E5FF0BF62C7EBBD da發動機·
221,564,459 *1542D37128A3BEC4D259A5F71A890A0E2687E774 De/%
221,564,460 *154CA7DD6D0A8341987F25D2B7D63E519A3C6A5D DELETIONBRICKJACKSON
221,564,461 *154CF5D9116B87CB8BF837557F0B26743D5B5382 DAVID SAEZ
221,564,462 *154EEB2C23FEBEE6C504C22664CD7C30A7B6DF52 DINO.WHIRRY
221,564,463 *1545C46856BD2605DC5E9D8D0828A1BE9DC62833 dionfevold
221,564,464 *15448669DD41D9CDC240623168510F41F7B2DB1F DIRUENDA4
221,564,465 *154BCBF13402C6DFDA0042703FBD6A60C34323A9 dk)hm
221,564,466 *154C99D2230BC849B3B72D6A451E735A603BA228 DNDBM
221,564,467 *1545464BBC71303176636850D29F7FA912C30360 D&O/L
221,564,468 *154BDFD28BBFC76D702BD078F661FDFC2366B761 DOMINGO.BOULANGER
221,564,469 *1542A2440CCA4E98D2CE84483CFC58E30C0A9E38 DOMINIC.ECHEVERRI
221,564,470 *154313133F89B5335D2F169C3476FF4F081D18B0 d:i1l
221,564,471 *1545606EF283E7EE26C33EF7E7D897EAECB9EE85 DIAMON-DA
221,564,472 *154C40565C854A4C6C03F0031586C38DEEA7495C DON'T THINK I DON'T MISS YOU
221,564,473 *154F2BB99663BEA8B3A03DBF72E0ADFD1F30349D DORAYATES
221,564,474 *154B89F437E83EBB9C4616CC5F0E068FE300D34C dp2wc
221,564,475 *154CA8CCE4DC49561A78F742870E052CFC5E80F6 DRVN+
221,564,476 *1545678A9E77FBBD387957EBE77C568E20D97B11 DT#8-
221,564,477 *1542BFDB5E317F381EBA5CB1E2F4F95FF3AFAF37 diudhek
221,564,478 *1543A9BC2B6CDC18658E8EFC931165B1166F259C EARLYONEMORNING(HOLYDOVE)
221,564,479 *1547049BD13324EF15BAFE8C1FF271D2F9CAB5B4 EDITRESSES
221,564,480 *154E7CC5D451002323AAA03588B62F2B9384922C DONG.KLEPPER
221,564,481 *15422CC056D0282B4A501C655E58AE08071B6BAC doyleinga
221,564,482 *15424257FF6437DCA88440F91CD9A0393382B01B dqq/t
221,564,483 *154773E6CC8FE149F0D9BB4CB91D909EBD46BC65 DRKHV
221,564,484 *1543232458E8927B82241A0D276549D0AE8A0A7D DTCB9
221,564,485 *154D99418FDAA304ACB13246DB649C462767C371 duafs
221,564,486 *154252F1169BBB4C2D5A6E9083ADAB20A70322E1 duda-
221,564,487 *15479CA33AC2DF7F2B21AE620253AD7648C6F541 DUSTINQUAMME
221,564,488 *15402E74EFC4BD04B406E3DA2B0ECE88C0151FA6 ENjf
221,564,489 *1546896DFA678F74BF9349C8A0B0D259ECC8B6B6 ERICK.BROCHET
221,564,490 *15425EC7C5EFB9C58BAF1377CD5FDF89976E37D1 ERINZOBEL
221,564,491 *154AEBB938A82025AEE3BCF0FED0D9635ABD3F8B d!yke
221,564,492 *1543C549E46E94FD288CBF782A524DD0AFE35F05 EFRAIN.GIESEMAN
221,564,493 *154226BD2DECC731826DA45AF668DE995139289E EJTREGIUZ0
221,564,494 *1540107D1392443A59C786335F9D3A1A318D9F2C FADEVINING
221,564,495 *1548D0400142546835CA3182019BFD4920728117 elishacorreia
221,564,496 *15465C82AFD9DD214BEEA3F39011AD758AF1BC0E FAW05
221,564,497 *15463C48F6AB4BD6CC567400C2A8C2105A096917 Em8o1sm
221,564,498 *154340E3945978370CA2F19B1A58E0C4462A9026 emmanuelantao
221,564,499 *154AC600F5A2301EC34F65B6EE0F46F3BA6CE483 fendiwijaya
221,564,500 *154E5258166D157B4BA675C7FCC9B6EA48EB7245 FIDSNS
221,564,501 *1545895B29F6F9AE7748C02DDCF4ABA9D86454F6 EPOXIES6
221,564,502 *154282783836485D140A8A2DFED9E71D62FFD599 flsuspend9
221,564,503 *1542F1B6EF0FAFA254E3FC6EFB07E0DC2E335C44 ERIK.FREGOSO
221,564,504 *154820C27D1AF9562E5E75F7EB9FB2F73ACE929A ERNESTORUCKLE
221,564,505 *1542BA6F2940AF9D02D56B6CC03435A35E87988E FORLANGE4
221,564,506 *1544D1E15785CADDAB910C172E3634A3F40E0E4F ETIBBSW9
221,564,507 *154177724F88113F18618883A983E0B7036958CF EUGENE.KENDRIX
221,564,508 *15425229F8D9F68ACFCAC421B5E7C849D4708A2C FALKONERSCENEN
221,564,509 *154739680956BEFEE27E2E9A43AEEC79BB2BF3CF GASTONLIBERA
221,564,510 *1540541A347FC3FB559CF1B3FE250BCF9AAA1711 faustinokenkel
221,564,511 *154A483BD023524A25C1A60C7D39FF63D2BACE32 FAZE
221,564,512 *154E9EF41DE044B1777F375308BBC98C6041F94E gecuome5
221,564,513 *1545A0F9A950A3DDBC9BD0798E9FDA4083C4D9CD GEOFFREYLUSK
221,564,514 *1549CD95C8EC4CFA9DAD7566FF98CC3A4D23D61A GEOPUBS03
221,564,515 *154243DB54967C0F40E9CFBC4E7CC8F5BCD22E9F fgpldrdn4
221,564,516 *15476454DEFB98A32B20436C065E22919324FFF1 FIGURE-2--REQUIRED-CLASS-B2-AND-CLASS-B3-SEPARATION
221,564,517 *1546C829C01C58F72465FF2734C81D807250CF28 GISHNALU8
221,564,518 *1546BA85B96AF1AC76D6F72FB22BB189DE9DFF1A flwe
221,564,519 *154A341C971918AAFBBE09334D42014AE0DF05A7 FOODTHEMENHAVEBEENOUTDIGGINGFORTHEWELLALL
221,564,520 *154B7EA1A58E0CD771A77AFDDEF6D96A84121B1C foranangel2009(activaremix)
221,564,521 *15489D7C8233F541CC127C775D8E29504471FDB0 FRANCK MULAJA
221,564,522 *15411A7A94F61B6E3B7F413A421F0396B45A5DA2 gratern:graters
221,564,523 *1547D4C9D9373710EF8EF394ECB6012F7CFD10C9 [email protected]
221,564,524 *154961EFA1CDDA9B445BC4DB087D086A16D1FA85 fxyv
221,564,525 *154275FA8DEB440DE09F771FC9C002EC4F4E58EA gadgetsthere
221,564,526 *154AEC6A386D88C7D9EF8CEAD8C824232157147E GARRYMELCHOR
221,564,527 *15425059003F23E3D0950285BA46F69F6B9E888B GUYYUREK
221,564,528 *1542ECE99E49697A3A151A6C150091BEB5D3E06E GVRJWLDED
221,564,529 *154DBB40E05F7517ABB11DEBA37B1979120CE272 GEBOORTEPLAATSEN
221,564,530 *1548F74168F280A30EB9144FED470052176DCDA7 HAMBURG-DUVENSTEDT
221,564,531 *1545BFCBA9F896B716AB4ABFB0FBB9AB10294546 HARLEYCOSTER
221,564,532 *15401BCA660757F4D48056938D20937C3F31E20A HARRIS.HURLA
221,564,533 *154FFB23C313A9E5CBEB1F9400C1054D8D95762B grafikanwendersoftware
221,564,534 *154EABE17FBA5BF5EA8EBC75D945A1E163E21F05 GREENLEAF،
221,564,535 *1541F7BF4848B86ECAF7001D4558CB9C60B8A04C HECTOR ORTEGA
221,564,536 *154C8BB3842EDBB071C7902A41CE7CC0AC247C0A HECTORSTACE
221,564,537 *154328EADADC1B16AE4BC50D62A3606C28D6D475 HEIDI.STORK
221,564,538 *15405113FB435EC36B1AB71F4E6CC34C4CB6CC87 helicopter-(weird-science-remix)-(feat.-peaches)
221,564,539 *154ADC31233E1A1547ADEB1C04C90F60A293AAD8 GUSTAVO.ALDONZA
221,564,540 *1544E3B0201BFFB5904645EED0EAAFFE289C58F5 heydəriyə
221,564,541 *154EF4C79303CAA4E3EBB207D9BB13803A8BFA9A [email protected]
221,564,542 *154B385756B4FBF42B7223CCA4E7DD35442C9BEA hhzc
221,564,543 *154713AAF2D550B4FEC4D1B35771266F11F17BBF h\it
221,564,544 *154B6CFE671CC74AAD1931E23877E44B2CA51606 HM7NM
221,564,545 *154BD17408B41C25AB949C9CC3E4255BBD9C48C4 [email protected]
221,564,546 *15439F694535C846DF3662AF16ABADCCC01A7939 HANNAH.MOSLEY
221,564,547 *154C72389CDF3B5D43A96D52923E4E9E535A5B5D HOMETOWN ADVANTAGE
221,564,548 *1549DA82682269CB64329CD5363B3D53203C04DD harriswamble
221,564,549 *1543615F20F024364B84E965BB200F346F373CFE HOW.CAN.I.EXPLAIN
221,564,550 *15462B8D687F2CC2436B32C1EEE851C82E2C31FF [email protected]
221,564,551 *1544CAF89669F88BEA8B3F9BAEA3C5E7521DBE4E HEINRICHIISAGANDIED
221,564,552 *154633FE149666AD6B38E5B3AE726E9BF0D67384 [email protected]
221,564,553 *154997660353A7F2A09B1E102161D3E50AFD3620 HUBERTVIRAY
221,564,554 *1545E0C48FDD092EA240D0AE4073AA9B0B13A909 HUM8L3$
221,564,555 *154909CA4D6186E71F6E4023D695CE2FDC0ED975 hyperbulia3
221,564,556 *154A8BBA9EBA287E3FC752AF7AC85C50EDE267D5 iamcannon1234
221,564,557 *1547656230F95D39FD5FC6E5379B434F13C0896C [email protected]
221,564,558 *154AA939DCD84D66FAE997871467D69928E1095A [email protected]
221,564,559 *15440EC0110CDD0D9861DA4229A495F168FD950A hunches
221,564,560 *15425A6B6DCB36525D1AB55928F0CE5CACD807F1 I'RZ
221,564,561 *15497060F1F1B7AA9A1B7BD637DC8B1BC95C4EE0 INGA SWEARINGEN
221,564,562 *154DD9A5EF7EC7DEF05D8C7614D2FD275C206408 institutionality1
221,564,563 *15406ABE1C7FE7B66CE0AFE331C580E70354A738 IPSCAILIL
221,564,564 *1540B70407EA9C2E94F6776C487DF46AD7D6F5DC ISIDROWUEBKER
221,564,565 *154A031F99A19F46F5FD239F4B6373C239E53113 jack-monaghan
221,564,566 *154301926E6C0DED5DB83BB911DEAE21B38C19F8 J&FV
221,564,567 *1542DD25A123D9A9DE2E75C10E6279BB91633A00 JIMMIE48!
221,564,568 *15477BB1F3E15E2D983B9AF0DECEECF68011DE6B JONPIEROTTI
221,564,569 *154190085152ACB00F031983D87A72F5FA827523 JOSEPHPASEY
221,564,570 *154F4963F9563DC0518EE9F72A23D0C38FD72C21 [email protected]
221,564,571 *1545285E581B6AB3095DEB053332AE40EB914D2A [email protected]
221,564,572 *154B7C2F2745CBE512CED0D980D42556E0EA1C2B JRM5016GMAIL.COM
221,564,573 *1540DB413E769E29FB83FF9F05D6083F4C47B309 JTMCCONNELL
221,564,574 *154E7717F1D1D87D52EDBB38AB364622E0C57354 KAROY
221,564,575 *154E9BDA9538E83463C5DFEC692A998816F64823 KATIEFREW
221,564,576 *15494986E549BA0F7889F2A6A3CF444C0418501C kasugataisha2
221,564,577 *1545953FE080131C0C21D61809138166F39F36B0 [email protected]
221,564,578 *15452B9034FB3AD5955D74A0617F58CC6FE46DD0 Korrupcio.1
221,564,579 *1540F0172BF98A9BCC74A1EFA1AE23657BBBCA4B KERWIN-TANGOG
221,564,580 *1543E6F7EC11654225518428061ABE95793095E2 kouboukleiou
221,564,581 *1545AEB1C27FD215FB14663EE5DE5C48EF99F5D3 KG<S
221,564,582 *154E2E575F707313C4CE7CE59E50C0BE76BDEF41 LAURENCE.PROM
221,564,583 *1541CC97428E3D47E3AC5C1343732944E436799F KULUTTAJAIVIRASTO
221,564,584 *154D0AA1830B59602AB5B411A50968E1B5184D74 KW0
221,564,585 *1545C72865CBB8C51DFD2AFC1CF8B9BEC0F3D337 [email protected]
221,564,586 *15480B950DCE53BEC21290ADAEAA69402616D6BD Lam-Po
221,564,587 *154FB70C1D8C3F978F46406956DA5D8C4D609756 lancereynold
221,564,588 *154293A94B4324305906C170C08DEFA91A09341F landonnewmyer
221,564,589 *15431AB0D16FA52D53AF778834D87F6CF363BDF2 LAROUCHEBAITING
221,564,590 *1548500264308F283EFA192C0F6063508D1E5FD8 LASTIMENS
221,564,591 *15490358992F5E7C44309628D5C04B70B6A0886A lddz
221,564,592 *154A49A910180FCF44886E629F4F7ECAB3095D35 [email protected]
221,564,593 *1544A9CE92A72EFBBEC148525CC8FC5A8E85CE1A LENARDPARLOW
221,564,594 *1542C1B59A38D805AFD18780803E1045C9E39439 LITSIRATÚRA
221,564,595 *154C9A34187F2FDBD1010B5D20FEB46B4C392A94 leopearyer
221,564,596 *15498D7E5172C119BA2B9B2C065463DF08E0CBE4 LIVEANDLETLIVE/WHENMYBLUEMOONTURNSTOGOLDAGAIN
221,564,597 *15479FC73DFC653DE254614C274388D53E4481A9 leroylemaster
221,564,598 *154A29B91C74AAFA0DC8B56D31BD9BB51A19F0E2 [email protected]
221,564,599 *1545462379A40BCE14DC51C63C406C9A6D0F4AEE LOLA-ABED
221,564,600 *1542268C7542E621377C4C5402AD53F815C18C5E LICHTBRECHUNGS
221,564,601 *15428B7373BB373F73A00A8277D79D5FD233EE3F loranta
221,564,602 *1548B7E6210AF5D3827E9B9D3B9A9F539AFACECF lucianospruance
221,564,603 *1544153EEF8490A40C880246F14E00D7C23FD43C lullaby-of-the-grandmothers
221,564,604 *154DD897FA5A58EA0A7CE18BBC4B64DE469361A2 [email protected]
221,564,605 *154B46EC40F3C2712E3A8DEC7A0F84D15629411A LJNTI
221,564,606 *15470DEE6C222400C95E9EC130C98206FD15FDEC LJUBO IZ SISKA
221,564,607 *15433D9BE54033B3F6165CFE6F237698F69F1C27 LKAA
221,564,608 *1548FE5BED2DB3792B6675C1AA40E7358EF07FF8 m3%k
221,564,609 *1548E86B16B974ACF4DA28523CF59FE2E4800C9B [email protected]
221,564,610 *1548D2EE1CD06B83D83E31CF4DB87ED96E14543E MARITZELV
221,564,611 *154DD1FD6549548F9E917200BBD74E527145EDFB lyhencuzso
221,564,612 *154776A741BCCBA78EB864F9692EA0BF7E8F74C4 MARSANOYS
221,564,613 *154920176151BE0DD3531B09879BD16E429E30BF [email protected]
221,564,614 *154AFA571C39B22C813511CB24E121E14E86CDB0 MADCOWFORD
221,564,615 *154C6FF1FFE572F9B3C3E39185C6D42177A4C809 megadanceparty(disc2)
221,564,616 *15463D363AFE792B19FF93051165221FF6F18B1B MAREIBRIUM
221,564,617 *1548E40FADB44285BAD0DC1E9D0DF10DC96907B1 microbioerosion
221,564,618 *154F620307D3F7068CDE0B8FD4DABA3707DDBE02 MIGUELMCDOLE
221,564,619 *1546194B172E0BBF37007379DDE89FD5A89E4AFC Mateja_Svet.m/@/'t/eI//@/_sv/E/t
221,564,620 *154903C901818139DC6766D8371D5F8C89948FFF MATHIAS.ADLER
221,564,621 *154CEE4F9CDD2EAE7FC08D4CC4706816AD1E1FDF matthew.walkner
221,564,622 *154F8644F9612390C15289C44796BE4E3753C14F MAVIS HUNG
221,564,623 *154232BCE960C463902CE8EE58DBB90C37B1F65C MISTROOSTIGHEID0
221,564,624 *15402DAA4DCFF3D6D2AE642D00AFEE8FD45D0A94 mitteloestlichen
221,564,625 *154492BEB4C12F0D41AE0B4FCDEDD7573FF0C5E4 ME5ODI5ILICIC
221,564,626 *1548E7BF376B3AF7DD2C4357F4621BB8B213D8EA MOHAMMAD SAAD KHAN
221,564,627 *154D26335A52E54BE012E649B668678F3CA822F5 MONROE.BAKEN
221,564,628 *1540CBB089308CD46A6F3645CDAAFA213895ADA3 MOVAUGHN11
221,564,629 *1549D423D0DBB88C45E92905E38E9D791DF3F658 MILLUR2
221,564,630 *15462293C2EF8B4A797304A7E09FA8AC93FFF19E MINHMODIQUE
221,564,631 *154A98A3E176B5F136BEB3C9EB3B4E1037B1D92A MISHYA-GRANT
221,564,632 *154D0270F7D48305E5B085109299261F3099F52E missdeery34e
221,564,633 *15465207F165B591EFC289E9AC65AC98305B7B66 nassau-oranien-fulda
221,564,634 *15454668E0CF8CF443FB3BDFD14E1A33A9CE2B27 momentompbaudionewscollectiongold
221,564,635 *1544BE5FA4B299E7A545E6932B9392AD0E2E5A34 [email protected]
221,564,636 *154138E17DA67600D4B7CCBEF73A776D6EAD2C74 [email protected]
221,564,637 *1547FED2321350FE5DE12A8B38144309E1662EB5 muhammad.aasim
221,564,638 *154E8F9FC9B72C98EE4B7FFF6A463D0C477F2ADA MULLETES
221,564,639 *154DD3D0CE0CC0B667E31473CB786B2E24FB1B3F mulumabte
221,564,640 *154A517C5E82B9D0D94C86E0E214626F2070F189 N512=--/SET-%DIR-%BORG.MP3DIR-[-$+-[-%COUNTDIR-]-]
221,564,641 *15424C113931195CE4F1896249F724DF3C6D2724 [email protected]
221,564,642 *15412AA2D82DE6296BD19C17FC16A7C401F0866F NYUUSHITING
221,564,643 *154ACB90F17EDF8FBEA67582C60818D643D93EA7 NAULJENE6
221,564,644 *154C10E0CD0374ED0E359417B02FE6E68D7FD6E6 neil.mcartney
221,564,645 *1542D4F9CDD20EEC9F7B484FB68FE4A12F1A8610 OLA.(FROM."LA.VIDA.BREVE")
221,564,646 *154107380C1BBD8FF37C3FFFDEBAD8300E173CA5 N-ERRAZURIZ
221,564,647 *154B970587BC5E5C508EC1BE06CE4684396E711D OM.SHIVA!
221,564,648 *1542B63E7297196BA0698A797FC213A428E9817F NICKTROJAHN
221,564,649 *1546C1EAD0DE1EC85A119C5D3E4F4BF95E9842B1 ORBFQGF9
221,564,650 *154FC61C206498E4DB4B2D33EFE91368882A0659 outbrag2
221,564,651 *154E904F24509721ABF15755BA2C1B952FB1DA74 nourrissez7
221,564,652 *154B172D18348B8496571467CC276C43204F216C PFFRTJS7
221,564,653 *1541DBFC2E3DC03E378B33591EA65A82FB75753E piggtrd9
221,564,654 *154B916156B39DCB4303A3C12FE695B176714385 planetphilly
221,564,655 *154C0E2065B28B7DAC14E218826AC760A1D51C4E pp.*.*splat
221,564,656 *154FE994E85A012CEEC33E478E32B350BD79E70E PRAKIIRNAM
221,564,657 *154AD9E41EC32C0293DE982B5ECFFE85D852D0FE palocedro!
221,564,658 *1542978EA852DA2C2693473917D8F9DF4BDF51E7 PARTITA3
221,564,659 *1548665A69C59012AFA2FF8386A7E3F852B3F18D Q###P~0(0_<)
221,564,660 *1543C1BCD8D3DD350730F1DFAC1E7C566F0C760E [email protected]$
221,564,661 *1540925385CA3632B7E61467155395CF18F11BC8 RAJARAMANM
221,564,662 *1547C9E083EA7D6A39D21D42F1BD385BED163C21 REJECTION-IN-6/8-TIME
221,564,663 *1549E9667B8982A2EE46BD5AFDF20B3AB56E2017 Praise.Break.(The.MaShonDa!).(Let.The.Church.Be.The.Church)
221,564,664 *1545FF84E2E1844A91B6AA08F167B406611F2392 RODRICKDERGANCE
221,564,665 *154469D41D41EE642DCC1110DCE90DD03C8CF183 priyanka-mahanta
221,564,666 *154866098F8188EAF653AE41A42632C155D6938A /PROC/21/NET/STAT
221,564,667 *1540BA2B68638D87884DC143967F4A60DD38E18E PRODUCERL
221,564,668 *154BFAA94C767AB76FCC02D3E18202EF2E6F5689 rosariowykle
221,564,669 *1548CACE719B17BAAD0BCAE33CF1AEAB14774021 PSYKX:
221,564,670 *154738684779308CF5E613E951CE8861A4C7F20C PUFHEETED
221,564,671 *15407EE505315DE2D5DC6371E16CD4B497FC0D72 [email protected]`(_0)
221,564,672 *154DACF4F99C48077276D37BF49C04424266A891 RX)AAA
221,564,673 *1547E59BFE53AE0D6724F326DB0857070141CA09 SALAKIRJOITUSLAITTEITA
221,564,674 *154CC60007DDEBD2B9BEF323E1C8C6748EFBD15F [email protected]
221,564,675 *154539AE897B908E34DF653CF40534BF18F742C0 SB2004EL
221,564,676 *154BE3F7A328C98B8ABF159BC0E4BB316EDA0F74 SCHLTYSSK
221,564,677 *154F58514B6DF8E14128F3B939C39E938DCE27CF raumálông
221,564,678 *154F81167728FA64CF86B58F8DD1D058B621B302 RAWGU542
221,564,679 *154C092171453F91D7C4592CA67B3258EA45F209 [email protected]
221,564,680 *154F764A358CE61E728802FC6A4D66518362FF7C RE:-ACT-II,-SCENE-II.-"EIN-ANDRES-IST'S:-ACHTE-ES-WOHL"-(WOTAN)
221,564,681 *1545DE254E92698EAFC30E69C55426D29280DFB7 recure9
221,564,682 *1543BB148772EBC11F044BFCB1D2B50857B1BD60 SEPT11SPEECH
221,564,683 *15472F8562EBFF4816CCD7339B88516515B2BB9C RENSDOMIANO
221,564,684 *15478A55A83CF4D99003A410AB9901C7B9ADAA22 REXATREH1
221,564,685 *1549AB571B952CA18075E9A54E4F3BDC36117559 ri9ht3r5
221,564,686 *1543C9A1AE30404FB79892476B60C1F06DDF22EB RISHUBG
221,564,687 *1546D9C808F7C0098C041668003FF689E582C47B ritscherkrüger
221,564,688 *154F467477BA5BEBEE41E2E73A819611FC3D57B1 robertocurls
221,564,689 *1546DEF908067C914165BAB8B6BAB07886C68C5E ROBINGASBARRO
221,564,690 *1544387555174CC6FD909F18DBA627CB57D1D635 ROB-TETHER
221,564,691 *15496CB46B5143DD637318DE9856FF9190766FA5 [email protected]
221,564,692 *154CFAB44510E31EFA4B30A99F3B4B7F35B559A3 RODERICK-LOVE
221,564,693 *154D2BC2BF49512EAE36ADAD5FE0A72CC84EA0CE silasmccra
221,564,694 *15407BA3BB0C5C222A1B75DBAD18B2AE6FD6E77C [email protected]
221,564,695 *15487B3FB4532F18B8232427B0739340323FAAC4 ROMEO.FALLENSTEIN
221,564,696 *1547136710CE24383DD092734C4322C66FFAF084 ROOMUL
221,564,697 *1542E37F83D6EB6921FAF358D064073866A2DBEB SJMCQOTL
221,564,698 *154F77A3D0DBCFC1CF86928BC49CBF96592AF652 SLOWMOVEMENT(FROMCLARINETCONCERTO)
221,564,699 *1545BD68D4395FC36925C6361F2BEC3BC2132674 salvadordewan
221,564,700 *154BE439083337C2FCCA31728863FDC0ADD7ECEA SPANKYWISDOM7
221,564,701 *154464944319D044F806B6211C1D9147E483383B SPENDENANSATZ
221,564,702 *154EF45D2836A0FCE2F4C5AF8C8F3D8BAB082353 SARTIN..S.AA1.R.T.IH0.N
221,564,703 *154C1B75F9E2A4DE6A7FAFE268D97E30D53B9374 SAVANNAHBERNARD
221,564,704 *1546733882BC2C378D7B351DE904607B21260BBB scarcely
221,564,705 *154174FEF8722EEE6C970E6B4C7F933E0E6CB086 STELLAKNIGHTS!
221,564,706 *15469EB9FAB333C2A2F09F49EFB7C43786C038F9 SCRIPTGIRLFROMIOWANEBRASKA
221,564,707 *15484567CD60C3D83B921F7550DF650C3631F889 STESEARG
221,564,708 *1542FBA68329D237C32E05235DA37243F6D14C23 sturdier
221,564,709 *15444D9AD3F1B1EE39970342E81C21A60F7BED77 [email protected]
221,564,710 *154A6CF1CE93D5C2AB05E83A5E9F862C5966ED05 SERRASSIS6
221,564,711 *1546557DCF5004A36223E805765120C18D955E38 SYDNEY.LARSH
221,564,712 *154443EA034544279E89F1A05E1F1C35677D135B TERRELL.GRAVA
221,564,713 *154D57B68BD784F68C6AC97F6E75071B35C98999 SIZEBFONTTTFONTED
221,564,714 *15467F13DB4B3F76F7D1AD06C99537EDBFD14466 THOMAS.HENCKEN
221,564,715 *154BDFC6AE2F01DA4E85EAF568ACA3DE63B06F5B TKLAKTKLAK
221,564,716 *1549A9EFFA6F4A771C23E47778910467E7B53E1D SPARROWIMPALA?
221,564,717 *154368ED249CF31F6C9C82C964DD2912EA6BC439 speldekoppen?
221,564,718 *154C1080B2BA37FC5D129D950B856439E788A263 SPENCERBEAUPARLANT
221,564,719 *154689242A1FE2F529C6A0F545905EB2C71CBCC7 too-long
221,564,720 *154C6ADA4831F349207D8F92272867D16FEC82FC TRINITY LAGURA
221,564,721 *1547C307C16071F6729E6909204515EF8793AA26 STADSWERKLIEDEN!
221,564,722 *1543D836A50367963EE4D924D2F0448E944F6266 UKRAINIANMEDITERRANEAN
221,564,723 *154FA53E6BE842C8A5CC938EA9C8D6E099D152E9 SYGYTANDBORBANGNADYR
221,564,724 *154DD33523589317BEF6D0DF65B72D5183BFCB81 SYMPHONIE NO. 9: IIID. L'ISTESSO TEMPO
221,564,725 *154120DB3FCA8A2C503E2BF076CE43FF7F63F716 t9j
221,564,726 *154FC8DEF6562DCD445EACC9F81AC39CEE24A177 VERIFICARAS3
221,564,727 *15473E23D36C958B24D1FA63AFCDE1DDF72E8F34 TAMMENTERHOT
221,564,728 *1549E105A196739DEDBBECD96932E75073E11268 TAOIYQQETLC7
221,564,729 *154D6EC87012E3F65CE6D849015CB209FB39DFB2 TASHADOLPHIN9
221,564,730 *154873B18D878EE31E01B9DE1DDAF7FBF23CCC1F TATUILLA2
221,564,731 *1540C4FA205207A800C569501898866C6AC64D52 VIEN-TORRES-ESTRELLAS
221,564,732 *154E1DAC45D149B6FD5038208972CA999F548EC2 TECHNICOLOR7
221,564,733 *154201DC932C04590A34E57C91A8901B009773A3 TERRENZ8
221,564,734 *1543F0D3241A526FCF430A566A6B6550BD858513 TERZA
221,564,735 *15487D4D6375F23033D3FDAB7E0FBC894ACB9BCC VIVI.CHAI
221,564,736 *15460D89D816451E84141E2C45DB208C3FD7598B WALLY.ATCHITY
221,564,737 *154923E660232705EC622D70D77F06B54A94D5BF waterstaatszorg
221,564,738 *154C444C3054110B35B3F9D99720F3354F8EDE91 we're.blank
221,564,739 *1543B09038036013AB3FBDE435C26DC3C685FE83 TOKIO 2006
221,564,740 *15497496B85D69991660D9805B0A6A905AD05739 trag187scat712
221,564,741 *1540D4249078F18A2AA17A22B16F15C754F739B5 winedrinker
221,564,742 *154FB57CDDFE7EE11D9381AFD137403085A9DAC6 winstonnortesano
221,564,743 *154C86C540276B037E39F7A22906CA3411772843 TRINEEJAMES
221,564,744 *154F8E42AB2893EA0F380257842E41E8CF78B69C TROY.CASTA.WHITE.SR
221,564,745 *1543F7800BD8B38D4C30E2396DB27A49C5CA5A93 WTHOMASWARD
221,564,746 *154103838853EC3D336B0107C38A19F41447226B TUDANSESCOMMSI...
221,564,747 *154549809C9D4CB70252C4F2B43B0925C5880D6D TURKCELL
221,564,748 *1542440458B43DBE9F224D5DD5A46343695FD58D [email protected]
221,564,749 *1549D08074B22C876CE74DFAFA226F27F59956FC TYLAR-HAMPTON
221,564,750 *154E33D81DB442B7F3B8AAAC7D73AA42EDFAE270 XANDER KARDAN
221,564,751 *154FA1D8BD16453EE3A4889847306CFCD0404D76 ukoriv
221,564,752 *154D2C6652808AEE5F999E8ACBD975272F04292D {x}.o~.o~.d##3
221,564,753 *154BF9E4771A7340AE44A69449F31C63026B7371 xtb4
221,564,754 *1543ED7855F53F170E18BC0863EF4225275B066B x^yc
221,564,755 *154B3DB13E17007CE2F8C1380108FC5FC57CC539 yalabeehqtr
221,564,756 *1548A58E7CCA6230E43442BF7E2857EDC5F4D660 YE OLDE BASSE
221,564,757 *1541E9ACCCCCE225B8F203086F6271262F86DAAA vanessa-villanueva-lopez
221,564,758 *154E4EDE04B95385F9D8F60696F6326F1CCC2028 vanloon
221,564,759 *1549C42CD07D7C377FA383BB4840D9565BC8FCC1 YLESLAFNRAY
221,564,760 *1540453AE71C245DBD036F053418ED016B692779 YTZ[
221,564,761 *154BDFA5511D7FA5F968CFC05D209390E24413D0 [email protected]
221,564,762 *15440EAAA860F526F19310B4A2C10920EB83C9B7 YXTYFTIBO
221,564,763 *1548110F9C3FC72A9ED418FE320671C51DC6A2E7 VICKI-CHARTRAND
221,564,764 *1540EF6D55B31F24D078565342D7410BE2439C13 vickiebrandenburg
221,564,765 *1543DD3018AE7083B41F7C7C56AACF2988EAECE7 ZACKSPEARMON
221,564,766 *154531DA233662F33322320D9AABDA859C277647 zapatabuzz
221,564,767 *1540AAAB06E1231BED7490DD02464C127E12304A vishnu-vardhan-s
221,564,768 *1543F76662A46213BB142DDCDF58941A7D3DEBD7 ZEYNEP.TEMELLI.BURGSTAHLER
221,564,769 *154D2FA04D536DB569EBF3C059BE71F1EAB41F73 voimalajaerjestelmia
221,564,770 *154FFBCDA1AA9C92B551D29EAFF4310BA864AB00 ZOYSIAS
221,564,771 *154E288FB49911052720572F47818439A4F55F40 wachtkamer
221,564,772 *154C77E36D89BE3B467E2577008F04920058114B ΓΕΜΙΣΤΌΣ
221,564,773 *154C85C4B04B4FBFC6A0C5D0D353CDC1F533BA2C watsoncats
221,564,774 *1546F2D1BBA60644CD9EED12647AEED82F3BA087 WECKKETEL
221,564,775 *154F4547EF152D021F1E3522121D545A54C27599 МЕЖДУСЛОВНЫЕ
221,564,776 *1546B7B794074984B0448D324B9016D0F055AD78 What's-a-Matter-With-Me
221,564,777 *154EB43FFB46D813CB73F5CE229F31A61F58A44E WHITING160SS433
221,564,778 *154862AA69CD45D763D9731D56C31E656E11F058 WHITNEYSTOVALL
221,564,779 *1548E5BC08AFD2FC3D7548A21AC1EF3B89E9AD98 перемигнулись
221,564,780 *154E1A5A6AA1E1E0F12DBE87078AD2EFF5AE3B17 РОДЕВИШ
221,564,781 *154603CED73B7A65E24D22E3F747212E275C4F39 хойфурт
221,564,782 *1549E3E975BFD0BAA68B25A761C4F2F09197150B W'O4
221,564,783 *15455CB2E8D6E40740DF4236129A0AAF2E5BE023 WWWTHEPRICKLYPAIRCOM
221,564,784 *1548B96B289DDB8FA96C2C1020025CD79CC91EC9 x22ba9
221,564,785 *154A1D52FCA8CFCECF92A9FE5C43C40A86008EA0 YEONJUNG.LEE
221,564,786 *154648338FE5B9685AE82A250C0F30877E86F2AC [email protected]
221,564,787 *1547E6D0690796FFA44A4108CE94152F29F4E112 YOU.LIVE.ONCE
221,564,788 *1540DB39838E4A97D660F59BF137652C8F802C03 YURIKWEIK
221,564,789 *154CD4EE676A25DEEDC08AC7B9B6A00FF363CC1E [email protected]
221,564,790 *15478CBF67CE9DD26D2C2588E038F232068A1B88 [email protected]
221,564,791 *154EA44E25B1ADC3D424DC86CD9A5320E99F2B3E [email protected]
221,564,792 *154F663213A3FF7F74A92A075CE97C4EEA3E2D79 [email protected]
221,564,793 *1549822F9C93F993632167BB87A3380AE0F8E7FF [email protected]
221,564,794 *154EEBB71687306BB30A8A480D2FC6784839F891 ZOYSIAS
221,564,795 *15469625DD55DF735C4515B086932C07F0FB3652 ηλιοσ
221,564,796 *154FDB202BB1C72F3632CBCC667671B6563A7A8D ГРЕБНЮ —
221,564,797 *154ECCEF06BD8F332060B68DAF6AC1892522E41F РЕЙХНАУ
221,564,798 *15409D9DF753D41E1B0D813D457E0DCFFB7B8EA4 03301855
221,564,799 *154427996DD43EF2F21290F09BDEEEE1FA539953 0BBF575F
221,564,800 *15438182ADB1A31E7C15560EF5AE67FEC9E77C4A 戦闘から必ず脱出することが出来る。ラスボス戦やRシリーズなどのボス戦では無効。
221,564,801 *15450F6AAB6A50F25FE20D0E5AAC5BDFAC582016 14me14uu
221,564,802 *1540082C7472EE7D6C9E0D53D574797C942F05E8 1717018 KEHYKSEN LAADINNAN KESKEISI
221,564,803 *154F36E03F5E7621D1A4D012CC24D35F67384C8E 1780840 h
221,564,804 *15429A6D6DC1F69B6872D3A147A3708F6E2DE162 178-rittner
221,564,805 *154165BF76E6BB3F4B11363C7A82A08F68831545 191CAMILA
221,564,806 *1549F29B96CF189FD607CD8C2BB4BD1D43763C84 1FOXSPEECH
221,564,807 *1545B98362D1F9E0AD2659A9DA1894183FB33F26 1-HAARATOIMISTOKSI
221,564,808 *1540448485090EAA9EAA5F34DFE34A75393D1EE4 1.kangasluomalle
221,564,809 *154AA8EE091E77B6C59B8FEB7048349DAF52A895 1 KBO
221,564,810 *1548B59E22BBC197195649FC9DF0E14DD483EC75 1-krumlish
221,564,811 *154E2068E48CA596F6AC5D63C03360D44EEBDDBF [email protected]
221,564,812 *1543E0F2B7E6131513BFF148E3863A23FD0569EC 1.mir-rettungsdekret
221,564,813 *154E045CB432E42600E9D87F4B90661DEBFA8086 1-MUTKIKKAIMPINA
221,564,814 *154F2C33C179CA083071D22693D1BCC9B2429BF6 092LILYANA
221,564,815 *15446E978BD0B7EDC1A2B38C99A4E2408267AAD9 10.sprungrevision
221,564,816 *1544ED9D2C514370E5B12FB920A4441466B6BD73 1-osuudenomistajarekistereist
221,564,817 *154276328499866E9CB4C68705BDDEC129791432 1287237 soneraplazanedome-sivuillaonmm.uutisiapeleist
221,564,818 *1546D3EC1C7A20EA7389BB7FC5E7988FC0BC60C5 1RESTLICHTVERSTAERKERS
221,564,819 *154CD7CB7ACA013DDECD35398467BEE2066356D7 1-TARKASTELUHETKI
221,564,820 *154EC5FC05B60B5A38F7A5D0D87EAF8561157651 1557103 AD.1...IHMISK
221,564,821 *154F496787121C5B0C0662894D946CD725705AA0 158966 SHEWASSUCCEEDEDINJANUARYBYDEBORAHNORVILLE.
221,564,822 *154BDA2F9A1F1D38E702CC692EA1EA918B09FA50 17.konsumgueterindustrie
221,564,823 *1549797AB5CCC49DBA04B7A8F450D6E94F81995A 17 LAFLARI
221,564,824 *154B07C989014E53C2B7DCE917C28B996AB55A58 1876305 IM.JAHR.RUND.4500.DOLLAR..
221,564,825 *154303BB9B0C0B6A24FE064E508406CF11640DBA 1.VASILEVSKY
221,564,826 *154DD12731128235568622AE011937531703C928 1.vastapainevoimaloissa
221,564,827 *15491BB4D9D674986B0D4FBFA0F8364C22979AEA 1.verteilerrolle
221,564,828 *1543FF4092AB0017EB749B1DB3D771E00C6F9AC8 195-RECHTSHILFEGESUCH
221,564,829 *1543D44C18E771B0D7DC7F14654E84F61E9239D6 20100222N01102
221,564,830 *15463A28A8C28B0D53ECB8BD43F1AD6BCDA0CF68 1ALIEN9
221,564,831 *15427FFF2942278493C18712968327F18B5E7FA1 2242081 tiff-muotoisista-logoista-tulee-muistaa-,-ett
221,564,832 *154ADB084D115D9058D92701EBFE775B438082CE 22 POSAUNEN
221,564,833 *154C991B5454F0AAE67BC3F8B69D63F25B04F44A 23-02-1201
221,564,834 *15475664BA73227A92503E4130523603209DFBC5 1 FAMILIENLOB
221,564,835 *15419F3A25D3398C186A52C4447315A4F060F9C5 1frontoffice
221,564,836 *1540704065689A66F341AAFB008E2AEF86EB5A24 2877131 ruoaksi oli l
221,564,837 *15427D623D7CC0A8EB9FF8B4AB4AD19C1988E1CD 2958438 thyssenkrupp.verlieren.0,9.prozent.auf.16,93.euro..
221,564,838 *154820BD56A4BA6E2CD3116BA744F1D544D1428F 1-HUNAJATANGOT
221,564,839 *1545D4D1816DB2725029858CF9F03F88DA5127FD 1IAMSAMANTHA4
221,564,840 *154824AC56E19DF77C4D348F4B50E1B6789E3327 1JANGELS
221,564,841 *1542B3F7F6AFD0AE527A4BC8D8A7BAF6EB22C458 1.joutosakki
221,564,842 *154210B7EE05CEB6FD5A2E60C0C988A9B6883E5B 1.kalastusopastusta
221,564,843 *1547EC4BAE1C18408C66614E3423858929D2852B 2DODINGENS
221,564,844 *1540E33A9EB45A244EFCF8944AEEB174C532E018 2 einjahresfrist
221,564,845 *1545329840678350A2F57CC1D6C36299D55C89B9 1KULUISINTA
221,564,846 *154BA3D452C985D86533B2D43CAB68511627CEBA 1LAITOSKOKOELMIIN
221,564,847 *154080496F6350CEBCA9FE691850A29EF9E3D6D3 1.LAULAJAT
221,564,848 *1547011FCBE061690F1B9090EB98F44DE1DDED79 1 mannschaftsolympiasiegerin
221,564,849 *1549E131ABC0156C0F19F6DAAF70E5BDD5985745 1merkkikuiduista
221,564,850 *15444080A687AB6E7005C1EC2D45CC1527F5B79E 1 MINISTRANTENNIVEAU
221,564,851 *154FA7F3F900994E8DAD8F426B6BCF9DDEC4FA5F 1palauteosion
221,564,852 *154CC0C7D1AEB534B2CCC4263B901D3CD42417D6 2 TIETOKONEPOHJAISEN
221,564,853 *154984BD814BDB8B3A2CB2E7A39CF094AABC01EE 1-prosessilaitteistojen
221,564,854 *154B0E09A0B045D749E6C91C7885F02F2A4FF77E 2.UMWELTRECHTSFAELLEN
221,564,855 *1545D749FB7F1E31F1386A6459CCFDBDC7E9ACD3 1.pusz
221,564,856 *154FF75E1C9FCDC47AF2A2D4440CE0C60DF04E53 1 siet
221,564,857 *15492C16CA1DCB17F617E8B87596B3CA7089DB5F 1STUDIENPLATZKAPAZITAET
221,564,858 *1549551089E2413942FA60AF1737F7BEE958CF63 1thatsoftball3
221,564,859 *15442FEE79A35815DA9DA4CC638198C90CE0A951 1.UNDERRESERVED
221,564,860 *1548D91768C7A72C98297B6BE11DBA00E607521D 360818 ulvilan-kaupunki-sijaitsee-satakunnassa-kokem
221,564,861 *154E6493B86D7F6B94158237EB4C54257E227F4F 390blaine
221,564,862 *154407A72D26C5C6F7788217809D3BE2F40A248A のルールの1つであり、本作は、このルールによってゲームが進行する。また、SFCとは、
221,564,863 *1549445C7EFFF9A7E88C40E5EF73FBCA0FAE7A94 3B<o~0~(8
221,564,864 *154A19A63EE4A2F2EA773C8A50CED462F300B849 2277296 levyrakenteisessasein
221,564,865 *1546AE85826EA294023DA41C4A8F4251D09A13D5 3FLAUWERDS
221,564,866 *15459BB9E6C0A5CED60CC112FB946EF663C34770 23XP0936
221,564,867 *154E12E758792FA3F5E1FC1F2F8B33A6CBDF3C92 2414035 pitk
221,564,868 *1544A3908529E5A4997680A57734CB2724DB4D94 3 kahvilanpit
221,564,869 *154CE95F106103F36EEDBC836F2DE6FA2B1F44F1 3.pikavalintaa
221,564,870 *1540E8CDAD2BE28E3AEB46BFEE113C7BE9A73EDE 3p`.splat!
221,564,871 *154BE69C7BF9AAB254C797910E30455F503569A1 2869916 kokkolanraastoikeudenp
221,564,872 *1545DB698A5BEDFE7F347A2A3F706C2A95691BA2 2880201 CALIFORNIA.EXOTICS.PAINA.T
221,564,873 *154F7F4B3B0BD6A519924A68DCBA32B3249B88D7 28GROOVE
221,564,874 *15461B036DCA03B1D515A23AF5C4734576264BC2 2999688 "-IT-SHOWS-THE-MARKET-IS-QUITE-WEAK-,-"-HE-SAID-
221,564,875 *15455004AF46EDF3F6D28EA218EA2A6F52A1CD5A 2.HIIHTOVALTIKKA
221,564,876 *154ADFBDCF4E56A39DDA84A6D24355E2655648FE 2 SANONUTKAAN
221,564,877 *1543FBC85C3DCFFB68A1174057B4E2BA051616C6 2SGOMBRAT
221,564,878 *1543DF69692898F63F927D3C55354FF04F7FE8FE 2THATFAIRVIEW4
221,564,879 *15450CB16661287276F5B49CFFDA67CEF7E10365 4AVAINTOIMINTOJA
221,564,880 *15433A9BC2E48982E9EC6DC149B8C179D240EF40 4ECSERCNOC
221,564,881 *1546240BB669A51582F5F6CD3CE96837C96FF9A0 4LLOYDLADYBUG
221,564,882 *1547D159E174FCDFDDE8429B82FCA0E5F6DE2D92 4LPHONI$T
221,564,883 *154E6460E583933027399228B87EF9F05DF33E10 3#D~o.)o(
221,564,884 *15483063C20D5A3A660D2295F25F00F0870DC16B 3EDROEGEN
221,564,885 *1546DB5D9EEC05D9139D647FFFC3588535DAD853 4mr4+3s
221,564,886 *15410A339D5B95E5089DB8627C0AE8D413AAFFEA 4SURAASHHTRAAH
221,564,887 *15419BFB85C684485E17EDF0AB32312B5C93217E 3> * * *SPLAT
221,564,888 *154E33C2C026FFAF7B39C58AA9043784AA0F5248 4TTUL3R4MUS
221,564,889 *1542D85750B5FEA7E945BEAE48F8949E8C3C5E2C 3.YRITYSKAUPOISSA
221,564,890 *15431F1DEC8829F82C7A1EFB980F1ACE96AB8065 4YIUTQSIUG
221,564,891 *154391C5AB1837DAE111B1035489394838C4ED32 4ZEIRITNAENA
221,564,892 *154138016BA1F9FDE47A4A489F8139763FD673A8 4AKELEYN
221,564,893 *154EB4CDD2CBB7B29DF93CD2207E34EE75465A3D 4fd7293b3cba3bd68212e3d1bf1a3368
221,564,894 *154315416BCE0D3E3C231AF5B45AC020DEC2124A 5BNNNSJWDN
221,564,895 *154553F7D3A89F9D4313E6707828394FB56F620A 4HGFPMETANS
221,564,896 *154D174D6CAA9991C182603CC7111F9ABF85CB13 4HILDICKS
221,564,897 *1544E8C8D8B7B01A148E7A9E3B6ADC2F33771225 5EDDIEMARINE
221,564,898 *1544E8BA208F5314FB7A5AF86DAACF061F8A0D0C 4IZLAGANA
221,564,899 *1541FD00B44A7695EE8D5F17B7276A8F500F2EA3 5MEMERELS
221,564,900 *1547B23AB6953731782DDD3BF645956428CA6FFD 5MICHELENETWARE
221,564,901 *15468D80827262C4EFE344719F7E74289EEE4056 5OSKXYUSSZGJW
221,564,902 *154B0B86A766E6E5D860660A1E4283793A5F053F 5-py
221,564,903 *15448042B6528753AA6178797B9E702C1F845B64 5REKONFUNDERANESS
221,564,904 *154EAC9D04FE84827E0323DBB3EE3E95239FDADA 5THETAMMY5
221,564,905 *15402A77D9E6A59CC8ACF1625F027E6638DF9603 4UZDRMANIH
221,564,906 *15403D05C3A6C2508BCDFDBC7B1F07117FE377FD 636875 TULEVINAVUOSINAJOUDUMMEILMEISESTIJ
221,564,907 *15415279CCE707A91EB6DD01AE84B5B8C80DDF5C 549382 VANHOILLISLESTADIOLAISUUSKATSOO,ETT
221,564,908 *154B59D6F073FE43EE18341E9566D7F1EFD97812 599110 CLINNUCLMED21:11821,1996.
221,564,909 *1547090CAA9F8C0B54317883777B13618F6BEED7 5BLOKSKOENE
221,564,910 *154B80BF0F26821FBD72FFCA2D9403FD364A8DEA 5BOGUS
221,564,911 *154DD95A1DC3997C406ED7F447D0BCC3BC5CB5CE 6BSWEPROCEEDINGS
221,564,912 *154812E0AC71D26999A8E36F21343004E3FAD3C5 5.EGITILIYOR
221,564,913 *1541A419FF2769CAF776B0B90A586F061E776CA0 6DILEMMATS
221,564,914 *154D1FCE8FFEA8965635FE6D8463CD99B5861937 5ILUVSHAOLIN4
221,564,915 *154B1E1B9FB2BD2E1F6610848C8992EAB0256B32 6MARGERITTERS
221,564,916 *1541C44A5D9321CD12601A62E52F02FAA2FB4D4E 5RESOLUT
221,564,917 *15411392F771B0F275E4F781FF28EF788D781606 5ROESLER
221,564,918 *154B2BB7EDD14358BBF6B038EFA47E36448AAC0C 6PREMONSTER
221,564,919 *1544BD3EA55FDA2B3FDB2B6E8E7EB8B71AF80482 6REKLAWWARTS
221,564,920 *1548DC5B01D91CC9EB454168F9AA69EFD02A1932 5SYNOPHTHALMIA
221,564,921 *15469E25E863937BCBAD92234A18A54F5845D4F8 5YEHTTAM
221,564,922 *15484CB31DB478C87DA2E27BBDF1E5210F632997 6918AAA
221,564,923 *154E95B59F05324599B8CA8B64674433B9CC94ED 6BSWAUSGEKUNGELTB
221,564,924 *1548CB2D3978D96B239761C7901651CDA44D57D5 720570 TOINEN.VAIHTOEHTO.OLI.PEURAHAULI.NUMERO.4.BUCK.,.L
221,564,925 *1545D60133002FBEC28B5262B1FAD15BFDA78FB1 7205f。7022fと7024fはドア上部の案内表示器をled式から
221,564,926 *154C0732273E3BA01532C186C6C674D77A0AA337 795336 Iktisadi-sistemler-(-a-.-U-.
221,564,927 *154F295350A45A274E00BF1EFB2F7B8F11AB257F 6DOGGYHERSHEY
221,564,928 *15442D8DB56875C38F0ED9B8DC1A244BEF47D9B6 6INGLIMMEN
221,564,929 *154E9222A4A7C2DC08CCD79DB8CA475C60D7DB3E 6LUTKAST
221,564,930 *15471C7B4F3FDCBBA52A881C2245AB828E7CC8B6 7GRADUERONTS
221,564,931 *15413E89CF1D081C5CA67810936CAAF63964DCDB 6POIUYTWINDSURF
221,564,932 *15490C9090408B498D711FDCE29D6F9519A7D3AE 6POTREVLIS
221,564,933 *1547AC6A3E188FF1DEDF5651746A441974138666 6savonnettes
221,564,934 *1548A904E44AD07F5DFE119F9941B4D68943F210 6SIDNEYNAUTICA
221,564,935 *154B161FB5ABC11C90FF7E1358F0C94C4FC452C4 6SPIKEHORN
221,564,936 *1549C7D5C738E4CCAC5BA9F4F828E4256AE46627 6VAKUUTTE
221,564,937 *15439313FB27586575835A3D8C4AC452B93A42EE 7PUPPYJASPER
221,564,938 *1541EEC36349EA53E8D3E74F73BE7E5472240DC9 6ZYOJTFRGERZUCUK
221,564,939 *154A33248A29929C80BE8E23026FE0D5C0038E50 724589 EI.MIT
221,564,940 *154AB767E60BC5E345FA98AC40C9346108CFFFEF 7DBOTERIEZ
221,564,941 *15432CD2ABBED8DE2D3E472FCC13069DA464047A 7DUPLICATOTER
221,564,942 *154933F67B244137574BAB81835BD88BB42353BD 7IAMPRINCE5
221,564,943 *15440CDF594A7CAA37030F0349671C30C5375FFF 7MSINOIL
221,564,944 *15427186E079AEDE25CE0D0384D841F5EFBBC3F2 7riserviate
221,564,945 *1544490E4103F84CB389912570E8FAEA313CF61C 7SANTIISANTII
221,564,946 *154BA6FB7F73CE5B3031F70104A345E05886D314 8######D~0~O }O{
221,564,947 *154C87A7CD79B561D57AD8FAB2048E4D23C60925 7SZDAAMBXS
221,564,948 *1549FC335833DC959CBBC4FA7F8C5039C71C9102 8DIXIESERVICE
221,564,949 *154BF6F582987F4AC6680CD1C8F94DE2D5EBFC94 8ELSEGUNDOCABSW
221,564,950 *154FF8439A5803C4A7790A5FD7076DB3055A0EF5 8071438
221,564,951 *15489B50D05DE4B9E3489B821E28D98C1CB2ACFB 8==b-~-`(o_-)
221,564,952 *154131FD4A6B0EF54D904A9CD4F5E3D67ECFE134 8GUESSHOCKEY
221,564,953 *154D56531010EEA9713BB364471F634062D16323 8LQGPFLDMQA
221,564,954 *1546EA54D2C39951A3E89A0E037499B7BCE7F0CA 8NELEKETS
221,564,955 *15447C2A25971FF3C38938DD9D4E93A35FFB0235 8NETWAREMARCUS
221,564,956 *1545CC38053BF80EA6213C24309A427A44AE1288 8CARWITCHETS
221,564,957 *154CEBF8870A13218D77265A591A83C682965AA1 8RAPESEEDS
221,564,958 *154550367029D230C85CFB792AE42C4DC806F792 8STAGYRIAN
221,564,959 *1548E972B30D7F90CE9A553E152E814342A91022 8VAKUUTUSPAKET
221,564,960 *1545C8FB00F75BE477F07E74ABA748F4CBA8606B 8WHTIMAN
221,564,961 *1545A8F8B5D1E917F111F3596DA4692417490DED 8wxqx
221,564,962 *15431DD3E2D0CEA629122C1A8BD27FC8ABF8A6B6 954932 tehokkaat.huoltoyksik
221,564,963 *15449DB9005D6DFFD5358E8298C9437771CB5D2F 967512 ".fifteen.seconds.is.just.too.quick.,.".he.says..
221,564,964 *1542747417A0E108517D74478BC8B6F10F7736E3 8NEERSTROMEN
221,564,965 *15453224DD5CA1564676349EEC69D82220C8E8D3 8nzuyr
221,564,966 *154075ADD7A7455FC3ABF0598793A27BF35A43CE 8O+ELEME+RY
221,564,967 *154655BF822CB1E475A3048F94F77FE1F66CA283 9ARRAISONNERIONS
221,564,968 *1548F07909A0896C898BC54C148FB3BC62DAB01D 9CYRANOEDDIE
221,564,969 *15480B8C6F2C31C13816EE0B72878255ABAEE08E 8SNOSRAL
221,564,970 *15441970E1A3696418421E2483289EC2F4432A53 9ETSRETHC
221,564,971 *154A4DF3254CD3B2D025377892C08FA7E1B95234 8WHIPSTRESS
221,564,972 *1542F94708560C713AB0970C4BB798A66DA9517E 955262 ".you.have.to.give.us.justice..
221,564,973 *1543B6100927EDA9E6E1A1A3A390C93A87C5337F 9MEJSLINGTH
221,564,974 *1548352819BA3F36432C19A2D26BFDC5382BCC40 982093 (basili)7.500.000tl.
221,564,975 *1543A4A12231582B58CE08285B47A7D320340349 9NETGELEH
221,564,976 *154FEF560AC7AB9B559F3C362264DB9B3064D5BC 9PLEASANTSOUNDING
221,564,977 *15471317BD5EF5B88D82616605B5628DDEA5F62F 9COLEVICTOR
221,564,978 *15409531C433FA4B52F17AB07D58476C5E060670 9SNORIMRODNE
221,564,979 *15402C5229CD57A1AFBE16C8B6B66ADAD9E63456 9DRUMMONDISLAN
221,564,980 *15418030CB58FEC4BD872C4531CDA4D4603B49DE 9ERREDMME
221,564,981 *1542459930D76A91756235FD37813142191CE466 9HARJOITUSRATOJEN
221,564,982 *154DBA2CBA3F1D0ADEC3A8FA3BDF5A8F32CDD1C1 9WINSTONSHEBA
221,564,983 *154CC85619A4F1947F92BA80B89B237CC99F680F 9LORRAINEL
221,564,984 *154DF3F8E68F32DAFD4D8453EAB0A3184A0D7E8F a3=5f
221,564,985 *154533BF6EA172D57D01900CFA2007DF06CA3FC1 a3ecw
221,564,986 *15419A8EDC8C6DC21BA90E4EE52114F7E84D7B3E a43q
221,564,987 *154FD64A44837D1F8CE55D695FE64487D0E976D5 9SMAHGNIG
221,564,988 *1542E4F8FAF5B178F88DEEB1C8768F1D5E04CE3B aa*})
221,564,989 *154EA5951AEBA60D98B3FDCFE31772974D7837E6 AAACVD
221,564,990 *154098D50323FED5C1D39EEA3E098CF7E1E9C248 aaak:s
221,564,991 *15433E1E1E55E83A459F172350536C3B744E419F AAA-M`
221,564,992 *1546B7E28F45A2B27FC4DCB42053E5B55F30AEC2 AARON.ASBURY
221,564,993 *154B9F9412A44449F644FD89A87A43C31ED8E958 A=AUQ
221,564,994 *154B352959740643F13564FD7D8D5D4656E37200 [email protected]
221,564,995 *15416CB2830EA26E5CD1EBB50203AF61FDBCCE65 ABHAVISHHYAD0
221,564,996 *154ADD95A4344E8F75D55C7FA42CE4F22845BCBC aaa2i)
221,564,997 *154A0032EC0F2BE43B8BB3F74E924F1ECC56F88D ACLICKCO
221,564,998 *154FAA80E35A732332F272814022AE65E0DC9A3E ACONE
221,564,999 *154C9D0F02F66ED392E4072B5C87CFB627274027 adietya.adi.dasrendra
221,565,000 *154DCF77548803440C201F1F6E3ACF9D4DB9C890 aba,)
221,565,001 *154DFCBF2EA52E9F83848003E2CCF001DFFB5193 AF_+F
221,565,002 *15482EEEB3358FCB9116A929AE619B56B9539239 [email protected]
221,565,003 *1545426AE8736B7D19BC2F8E1C3914220B3DE43D A"H|
221,565,004 *1543145BFCAECB7E85F26F1EDE32F6FF1C2F5151 ALDOBROMFIELD
221,565,005 *1545D00D88770C6050D6B7E701812539B2BBE2BD ADIDASJULIOCESAR
221,565,006 *1547588286634F60478120DF348EA4D5398629A6 ALEXANDERROSARIO
221,565,007 *1547C693F864E9FA73B14FCC368B04B32EC3ECDC adnzq
221,565,008 *154E9705C38CEE6A2A4B8F9815344B081EBD183E alfredpietsch
221,565,009 *154C2D58D36A2F10A34E6FCC1CD4A01FC211A884 ALLA.GREGUL
221,565,010 *15402F47B007BF9821A0F5B2DAD8E6449C30B32A AEM9K
221,565,011 *15482B3882F32D5AFECFA640CF51B4CD2BE9CE51 ALMARNASES
221,565,012 *154BFA742EBF377A80DE3E491FF731EE591A4F87 ALPL3
221,565,013 *1547AF46B18E209E89F8131DDF13595C17E0230E ahnirrot
221,565,014 *1545F42F7A419EF5E436AA27163D50ABC0C02353 A(M/R
221,565,015 *1544BECD33F3C2C59098B8BBF3DBA39E63C38E13 AJ1EG
221,565,016 *154DF5A898BD4B0D9635C06BB7B0B2DE03D579C0 ANIBALSTUER
221,565,017 *154BE4A587C383241BAC45186D03061BA17E5B41 a la vez
221,565,018 *154C688DE01909661FD7C28B911F55E61133C1A7 ALIFCAFERESTAURANTGOPENG
221,565,019 *154C13AED79F8637DCC8AB96407B78BD40D1BEC8 a/m>
221,565,020 *1543EDA1A1E7BA4DC9728F494657BC2CE666A99C AMBROSE24
221,565,021 *154E646DC76771AEE206EBF79A0E5F187BFD8A45 am#?e
221,565,022 *1541C1D46C330C6CCBF9B66652A77AC83A7BB413 anythingforyou(johndoe)
221,565,023 *154A4225ACFF3489C94BB96462E2C2FD2B7276A8 andreineson
221,565,024 *154712EF36EC00D42680758F6F96C8B9F844BFFF a%ptv
221,565,025 *15434E329DF0C0C4C7322C8C8F591820D5C88E9C [email protected]
221,565,026 *15457BEE7AD5EB0FC13E1EF795D46662330F62CC AQBR9
221,565,027 *1549D09163E5B16FBA01676B217EF8E83114DD5E ANTHONY.RIVIERA
221,565,028 *154BDC37A358C1A5925FDC76C39A2DDA53134EE6 ARLEN.GABRIELSON
221,565,029 *154B0232356A7C0434ED1F07F53325A47E225B2A arnoldleaks
221,565,030 *15438C1C9FACC681786C20D452D7AE28C0644EC4 A,NXI
221,565,031 *1548FC513810D7FCB8068317729E52BB230B6E94 ATAFILEN
221,565,032 *1548CC69E6FE878F1E209BA0EA01989A9E98D7FD at$k
221,565,033 *1549ABCD587EEA5B02004E2BF023BFAE2DF63E8B ato_4
221,565,034 *1545120209DFCBA864C192F1E0414611248BE473 AUGUSTMATRIX
221,565,035 *154B718A48079846744CCCD0FAA2C120E6284F5A AVOH9
221,565,036 *15409EC864585768E08F56C872769AB8E2699CFF a_==y
221,565,037 *154F2FECAE5F9F9E1C1CE8DA08425EFEF114E15A ay2"p
221,565,038 *154B04B188828706BEEC9817F493F48F01D919E4 ayo/7
221,565,039 *1544E3C6A1D73BD3FBA15CCB647BE3795A467602 >[email protected]===Q
221,565,040 *154D2D81D7AA084A93EEA117A2B780B352FC5864 asfca
221,565,041 *15477EC9564CBEA6E83E370A8AB07D5568BACB89 ATL%E
221,565,042 *1549542EEC7D70A898D8C9D2EF2EF8D8C239990A ATSITPO
221,565,043 *15420A8192F41605BA2D02ACCDAE64B7C227039E au5h6
221,565,044 *154E4F3AAA20A4F95D36818ABF18E78F358ACAED AUTHORRIVERO-LEZCANO
221,565,045 *1548647B809B6FCA5B2B428781490AD7AE1B57F2 AUTOEDIT4041
221,565,046 *15453B17501AAAB8B07A1054C214B3C167189313 AU"UN
221,565,047 *154546A4BD601F5718D2541BB1C5E27A4158D3B5 b5mlb
221,565,048 *1547BD7AA8ABD5C10C5EF7DE8FC5BFBD1DE59A2B BADGURLZCLUB
221,565,049 *1546BCD4312977AD38930002AFD627CF32048E7D BAI5N
221,565,050 *15405BEAE4380E1454DC738D16A6F65EDB73A3D8 benedico3
221,565,051 *1544E556EEF05AEBAA80B86CBBE14CBE19DC05A9 bc22k
221,565,052 *154A438D4BA96470D213B8350FB58D4DE9892DC1 BERTRAM.MARONI
221,565,053 *154590893A0CA88C2171208E542F29B20F1EBEEA be##w
221,565,054 *154D48F8C206814E3E30C6F111AD19E3EFA8817B BGRWO
221,565,055 *154C15C86751D3CDE00C1CB3F901BC4F98173DD5 BIO3B
221,565,056 *1541B2108AEA288B8732B4E69FBB94EFBD9CCB46 BK-RV
221,565,057 *1542E4D0FE06867DCDF461E4FAF25660112F9A93 BKURDADZE
221,565,058 *154226E7584978E935719C2A66535779DA873439 bld5=
221,565,059 *154EE0E2B1EBD960FCEEAF2B4B214904DED15AEB bly9y
221,565,060 *15421CEEF4AB237CC06948B2A2CD499D6C3D4F03 BN0HT
221,565,061 *1541A77A1E017C86B51021F9E00242DAED9B9663 bookerdonkin
221,565,062 *1540B936167BD703CEEA880B5211017E150CAC4D bn$ic
221,565,063 *154C0E920F2659BAF94DC9E68E24A5E4B17A786D BORISJACKMAN
221,565,064 *1549EA59ED848B43AF292E8A3D954FD3F96EDBD8 BON5T
221,565,065 *154AEA28A67C09F24EB202C624F674D9F5722B62 BORISVIKINGS
221,565,066 *1547176AE218819A8605714FC4DBB225591954EC bqsa)
221,565,067 *154E644E964A1A817475FA4533233B093DF589F0 BQ2XV
221,565,068 *154E5F1E2C7DF2E92FEA5DE029B45309E2E8DBC1 brendanhelmke
221,565,069 *15498A55744C4FFAF5250CBC902F39B56958229F BRAD.YURKOVICH
221,565,070 *1544A3A3F395E12BFE801E3114982A84EB2F7F2F BRENT.ROADCAP
221,565,071 *1546535F1C097626C04417FDED1190FBFE818BB2 BRANDEN.VOSQUEZ
221,565,072 *1541136EC3FF70A379A2AF67B1F0D8D064BA1252 BRANDON.ALTOM
221,565,073 *154B4D20B82E9C737284E75A007413B7EA1E51E3 BRONSON719
221,565,074 *154348DE7A9CEB6E650877A9E822A1A679AB6F9A b_rfe
221,565,075 *1542534CCE18D12F7C52EDFFFC3460633351C8C1 brookely4
221,565,076 *1544272EC1A96B3BA4358CC3E20AD3F0AECC400D BRYONKHER
221,565,077 *154D6CA6706DBD9B087B233E4B9B12E8BDCA2025 bs0t9
221,565,078 *15489BCE0A68CFCE79776AC699445C6132DC9283 btl8y
221,565,079 *154BB413D0EDBCB12664803009F210DA2DB3BBDB bvg#r
221,565,080 *1543B7CC5A86AA389901BE41C2A2CD6F2958876C B/WUC
221,565,081 *15413304B865200DD5860C5099A94C7363E0C356 c4918
221,565,082 *1544A356C39C695F32DF93143EF4C1312E4B68D6 cacograp6
221,565,083 *154400197739F8D6926DA1DF979B69676637A808 CAIXIANGZHOU
221,565,084 *154A363A5EF1D49D462AE5E38282C829603D3D78 CALVAIREDEMORESNET-CHAPELLEPLOMBI
221,565,085 *15436253D6D5291436BD47C4398926F68EE1E70E CAM7012856
221,565,086 *15402DD828ABC178413BF4BA4C6587656066FF5C carrollvogds
221,565,087 *15483395A835185889DB4D782B5994ECA07ECE53 caseywertheimer
221,565,088 *154F9BC522E80FE0FAF9FFF9B9F1BB24920BE489 castles-rising-from-a-sea-of-sour-milk
221,565,089 *1540412E50C988CCE4481D309CD41CAA555E3E00 CARISSA507
221,565,090 *15487980170FD5333533FE99AA15589E92E94BF2 [email protected]
221,565,091 *1546CEA4BD4B0BC8DC81D322D558A9DC6BD0896A CBQFR
221,565,092 *1543A5D05D63ECFDF5C2EC363D9DFD3B86107215 CARROL.NEGRETE
221,565,093 *15445120BF5EBF305DA880A3C994AD6BDACDDD70 CARSONPEEL
221,565,094 *154F97C9D452C123BFAEF910D78C2C211C792A11 CAUGHBSW1
221,565,095 *154DAAEF5EAB22EC7524DA42448471A6709F8CFA cavefish
221,565,096 *154DE49D3926084A88EF2631A65267C61EC697AC CDNUY012
221,565,097 *1544CEE8B5B166B043329D7C240DE1B5B4F82F50 centralistas
221,565,098 *154DEEB20739103B909CD6C1789CFE1EABEBCF00 CESAR.SHOULTA
221,565,099 *154B02438BDAED7E3F31E0CDD30DCC05986E24D6 cf:=
221,565,100 *154375370860BF0878E9562909CAD622929D3AD6 CHANCEDARDEN
221,565,101 *15475115D570130160CEC5B30F39AFBAAA94EAA0 ce?rt
221,565,102 *1548EE96E03FD1BFE867F3E0DDC1EE9DFE349E60 c;f4y
221,565,103 *154D2414322A06B80FE42F611307683BD9F7715D [email protected]
221,565,104 *154015F2288CE64B93078298D42F4368843503A5 cheechman
221,565,105 *154CBF84CD575A40173BAF355A9286BDDF848FDC CGP.O
221,565,106 *154E09B655DC0D5D4E09C64454C6E1FC5D3332A6 changwalin
221,565,107 *154CC02F9AF9D01C03EC65A55746329BA2372C58 CHARBEL EL ZEIN
221,565,108 *154D4B292B3ECE8314A0C8319D992FADF47D894B charleslegace
221,565,109 *1549914F37E1EDA440FC3D9AEAAF9A721383EC97 charleyeisenhart
221,565,110 *15460C4F4B627F06DE961EE15055C434EE366D22 CHISAND
221,565,111 *154D0BEA26DCAFFE8F170B935DB110EA90AAE6DC choromaluco
221,565,112 *15408EA729E9D20F938A85B7FB9A8518A6162952 CHRISTIAN.SCRIM
221,565,113 *154EC60B02E147C3687BD54D6416FD11272D149C christina-mina
221,565,114 *154D564CC957512306F57F37156A6CE107D81E35 CHRISTOPHERCAPIGA
221,565,115 *1542A695B43FC1608F12DFDA452F885ECB8A5503 chuckwolfgram
221,565,116 *15449D5711FA4BD7F005F06CCCAB00485E833854 [email protected]
221,565,117 *1547BBEC81DB881E028A24C917B3C4828E5F1D95 CIFW
221,565,118 *1545C1F31963EB606510D5EF60DBC2E45A391204 CHN"G
221,565,119 *1547AE319DD851E346B4BA110F2EF3F73F912405 CHUCK.BEELBY
221,565,120 *1545F7B9DF9F00A51598796195C4B7691AD74283 CLAUDE.BABLAK
221,565,121 *154993EC15AAEA7ABAB0B026C8CD95FDDB17A26B CLDIC
221,565,122 *15481AEB3BF2190714E619DFC2B6F141CA35E619 CK:TL
221,565,123 *1541BF7B1E02A35F1BDF3AD6D27474D1CEAA02BE [email protected]
221,565,124 *15471245FBFDCC7D70C58CB06F73CC1C9DFEF7FB [email protected]
221,565,125 *1546CE32F4BBE5C5EF7B202A733F676D3C3C5795 c%nc,
221,565,126 *154433808201E14DDECE8C7D2FD95D09A491A1DC CLFRNTL0
221,565,127 *1541590ABEAC38E53E365BBAF3C16A966642FF11 [email protected]
221,565,128 *1542E098616FB80F77E95976F2467728B970ECA5 c)nzq
221,565,129 *154EC8299DBAAB9431E0DFB793B73DD07A9D79E7 c;o98
221,565,130 *154B6023918CB2AB11103E7D49A951344388455D [email protected]
221,565,131 *1542FA056092F834F049D4B4337BF0E7321763BF c;oh5
221,565,132 *154A349104688F2A3356366D5FD9DA2BA9931165 CONFUC1AN5
221,565,133 *154EB737154F746E31CC9DF5B9BE39D04B6F9A83 COUNSINING
221,565,134 *154652C4263D49F9768738CB00773F0D7A5CDD64 d0w?)
221,565,135 *15409B3F234627C1EA287BC27B4B67E414E24888 CZIKKEKRE
221,565,136 *15469C155C0B745DA22B8109F083C467BCCCAA62 C.ZYW
221,565,137 *154BAFD19600C5DFC858E07BC8D6090B38190CC2 d5rb8
221,565,138 *154CB488FAD44108EE805B0AD4A00F18491B4B9C D7LDK
221,565,139 *1540B2221B582FB971B3B163DEBA486C1A716F1A D&8KU
221,565,140 *1545F0936EA5393F952816F51239721D569E5B57 DARELL.SIMENS
221,565,141 *1542807CAA39635134631D6E465E4E62C8B4AA6B darinweisenberg
221,565,142 *15423F7E443F82CAE8373F3C7F1ECE2BF57B4840 DARIUS.STROUGH
221,565,143 *154271EABC2079AEE9729916DFE2304594476510 DAMESELING
221,565,144 *154671DD0326710AF31B15E9F7170AA89E04B167 dayişo
221,565,145 *154E03B8BB39C34157603DE0A48850954D97E67D DARRYLFULTZ
221,565,146 *154B5CADC57B4FD7C263BF154BA5131A97926908 dasverruchtetierlabor
221,565,147 *15424827B13EE9114D0E4104B3419FB1334996AB DDBVE
221,565,148 *1544B97977386361124CAD23CFC854FA4A92D27F dds7m
221,565,149 *1542429B080361DE10B1C7AA3A14DD0A28BA0770 DEANGELOSCHILLER
221,565,150 *154FF30B69471FC8D09016BF72D9BC0C95CE3F2C D;EBB
221,565,151 *1542A1F0144734D7D25050789CDF6435E128CF48 decommunesdederval
221,565,152 *15442FC5EB727ADC3167C747E48F8856EE33C1DC dedaignait.
221,565,153 *15437B78B424CA82C61775A6BF225F09CC131DDD deertrailroute
221,565,154 *1546C4C9EA5439F885D5FD0AF708615B2EFDDA82 [email protected]
221,565,155 *154D033C2C7FE80CC342C716DBEB660B5E8A7DF2 DEREK.AZEEM
221,565,156 *1543B891A826F5C3D635E5A7B1343DD1E463F0E6 derletztedetektivfolge1:testmarkt
221,565,157 *154E40C57D6723667F3BB69439504FADFFE9BB15 DFL#
221,565,158 *1546A64845384E3BE8ED50A5C413A2093175E61E dg..
221,565,159 *15415050043840D3EAC4FAF8331FD75366849E6A DEVIL'SSPICYCAKE
221,565,160 *154BCB005B67122537F65037553A3D38C9ABE079 dexter in the dark chapter 7.4
221,565,161 *15464B87FCCE7FB719F68D1D420575A55ECFA66B DieEssenzderVerzweiflung
221,565,162 *1546D4CD81D7E0B3CBBCAF2B4070C25F6A6B5521 dm%kk
221,565,163 *154BBC42657B06CDBFEBF813C3E8D851D5110CAE DOCTORSV3
221,565,164 *154FB6A2DB5EA4DF8922F9CD61F772FC1EA1939F d#lp8
221,565,165 *154136D7C5239B8687D4C01A964B85DB8E51C867 DM6NV
221,565,166 *1543D8C5BABD30FDB235C6208CB81C26BAC7BED5 DONNY.SAMUELS
221,565,167 *1546414A9E69BFC99D855F93113F48693A500C74 DONNY.TOLAND
221,565,168 *154DEE91C7A6E23DEA56B2B8A318965A70BA0F78 don't eat sushi at aquariums
221,565,169 *1542328969FDF5E89C81C36C948F54F383EDE713 doylenebergall
221,565,170 *154E54F3681198F01D9AF416B78280D239112020 DPF3=
221,565,171 *15407399C3E74B4A749FB2C72C938D80D41A5E07 donhazan
221,565,172 *154C7E42A08CAB5F8AEDBE2E4A7BDF7EF42A1067 DONN.BARBY
221,565,173 *154D17B684BFE1811A6C20DEF3EA3E3DF9F284BA dqi,;
221,565,174 *15444A4E1C581690B1F7D2E2A0CD5C2501361395 DRUCKERS9
221,565,175 *1543FE1E07B99D98665BCA9DA877888DCAE44738 dougbuquet
221,565,176 *154113E41798DE93CD424C7A06EC06F9B926161A dtlr.
221,565,177 *15403C1B24882CE56AEC017BD27B118B0EB951F8 doverhackettstown
221,565,178 *154FBE8BB223DB92CB8F79E920F9FF47278C9915 dv-)b
221,565,179 *154C67A525EB7631ACD1CD3441FB9E10C70B6538 DWFJ
221,565,180 *1544E88FDD5C2C16BAA405224931027C60632ECC [email protected]
221,565,181 *1542BF66D17A3B68054532B0C7F7ADFECD28B086 dubplatestyle:remixedbyprincejammy1978
221,565,182 *154F73EBF07F0151EC90B776B6C671582835CD7C dustinfandino
221,565,183 *154CAA82E3FD5353338CF7495EDC370C78006F8C D&WV
221,565,184 *154D4C9A5118E6BF3788343B5D68AB22F25B9014 d$_x
221,565,185 *15424B69B82E4102A4D81F595489817619084EA3 dv(el
221,565,186 *154D5DFB3B9CFD2EC0F99D36361AC6DB8FD65CDD dwightjarriett
221,565,187 *154050D9FC27AE2C3D387B547B3175AC3574FF25 EAJ_W
221,565,188 *154FC5796F33FF585E089D9CDC5E6ED2B28CBB81 EAVOLDDO
221,565,189 *1547F221581388685C4C0DB501226AD8716A7731 EBND
221,565,190 *154B8B07388E770E48E05C8982E203762E0E588A edgarpengra
221,565,191 *154F403D10AAB180850DF021C40DBD588048A328 EDISON.TYRRELL
221,565,192 *1548BADFFCD2B2702D90EB9F26E551D7EC641165 edwinroy
221,565,193 *1548CFF224FDD4D128E8648EA952787727BEAD81 efh,
221,565,194 *154B7719B58111FD74CF0AA4200C17BACB275417 ED.HITSMAN
221,565,195 *154562B1BDD922EDDB6264A714491EF6EB15C52E EGm1
221,565,196 *154E60956736C6F64BD8BB830604ADCD726AB214 edonaris
221,565,197 *15477857C90BDC9A631C2AB6D86EBF97F99B478F EEGADE3
221,565,198 *1544AC3DDE0D2C9EDCC382A706248D055D9963B1 eldonbohlsen
221,565,199 *154DF1E495F489C221BD11A03E5B48C314EC3114 ELDRIDGE.SCHADE
221,565,200 *1548A03F758EC7AD0E9D8172B06A8A99F16E6BC1 elec7r0c4rd!09r4ph5
221,565,201 *154A7B6BCB4C0DC34B75C422BFB26A28B6E09FDF ELMER.MILIUS
221,565,202 *1543B287F7A4E83812B3E6FBFEE98A27C347A0D2 ʑEˈLƆNA
221,565,203 *1541ECCFFB75CF6927435275CA4B303653F7B840 eldridgeverrilli
221,565,204 *154CB92A1D905FD5CD013622452F4A189AA6B5B6 EMANUEL.SOBINA
221,565,205 *154BDA52A0C3E77639AE1AE1FD5522A6F17164E2 ELESTADODELDERECHO
221,565,206 *154A1FE6CF4A34E096EB104185CF4E244F194037 emilgrona
221,565,207 *1544132A2BB91CF24A9867C84C15F800227ED845 elizabetmissy
221,565,208 *1540FF8FAE52A16DCB18C2AE52D90F121C454273 ELLIOTT.SCHOMAS
221,565,209 *1548B9E3FF775DB2FFD64C98867B6A94D1E9A92C ELVIN.CALVER
221,565,210 *1544DE8D51C58BCB4C5E3B37D43E02F16EBB87FD ELVISMATKOVIC
221,565,211 *154AB040028EBCF2535EA2E430D2E59695EA241D [email protected]
221,565,212 *15433A5D8357A47C0FA1345B3B7ABA35BE38B22D EMILIOWHITEAKER
221,565,213 *15481B4F7C03733AE7FE2A8ED90F6DFA973336A0 em+m
221,565,214 *1547D1671EED8FF490204246F20CB9A717714FE8 eo1vw
221,565,215 *154F98272703494E6F24415BDC9CCD131A37E6C7 EMZERC
221,565,216 *154C5D65FBB8268126AD485962362D9D4092C94D ERNEST.REZEK
221,565,217 *154B49B6363493868B9AEE27B1A05B1421CA86AF Erotic.Literature
221,565,218 *1546DC647386C34F4376674B77973CEE1E717347 Erttaled1
221,565,219 *154FF97A9A42FDB3D327CDDB378847C3EA9A4729 EPPETTEN9
221,565,220 *1548DDBE9D6B7E560D387212FCCD83F8F0BDA843 esparava6
221,565,221 *154B64B9B5FD2FDE1BE601B83D9DA11541C237DB EQoG
221,565,222 *154BD065F2DD96171E3894BF39FD47276A8B5849 ermalii
221,565,223 *154047D77440B0E9948F9EDAAA32E8671B826F12 ERNEST.VANDERKAM
221,565,224 *1540178A8699C24CAA557D7BA211A5352D9B736F erutixe1
221,565,225 *154CC02EC75CB8950DD31359EEACCE6E0BF9F817 ervinbuikema
221,565,226 *1544A0328CB6E437D98B1961B496D7990335A527 escensum
221,565,227 *1544EA1845EBB8AC9D8E978A2C997E071033F3C4 EXITILUS3
221,565,228 *1546B074BA983D80BCA1726467EA40D069FC724F ETSKNARP6
221,565,229 *1543BC2B95515B5F0D4BB71C6576B58AE3696036 etterurof
221,565,230 *1542A11CB94C3BF4D7BF163233B50E9E55F590C1 european culture / made in china
221,565,231 *15497E99B38B4B72FC37CE1CB4A616CC916BC358 [email protected]
221,565,232 *1546076CF831D77B87A870F255CE63AE6C1545B6 exigees!
221,565,233 *15458ACE635D9C41B112FA83587376382695D9A2 fgemalens
221,565,234 *154919CC96ED8E1F3A915F4E30960B1971843A66 F]HW
221,565,235 *154EDE852F1A6189A817FC4AD3E233E6082C925C FARIEDWILLIAMS
221,565,236 *154AFC1BF99A5D3C8F18C762577F076601AEA09C [email protected]
221,565,237 *154178FBA6D536202E1CB8E350586C1C1716232B [email protected]
221,565,238 *154E8EBD467DE9EE80454E7CA0AD045D69AD292C FERDINAND.JUDIE
221,565,239 *154518688B47DE5B664C89D9CED089BBBCA17B07 forsythorglt
221,565,240 *154A728091C5BFC5CC4B5E30B56F53D057AB92C5 FFM-PREUNGESHEIM
221,565,241 *1545A5C39B8B289EDB8E8CAC3066CEA3E2D443A1 FRANCESCOLIMTHONG
221,565,242 *154B528217760CB2AF2467B0B42DA82A78541579 FILIBERTO.ENGESSOR
221,565,243 *1542C9EC057774D46B8880C9542C0763556CD6E1 FRANKTAVERA
221,565,244 *1542FB4E044581341CC505C257405E54FE826A1F FRATTE
221,565,245 *1544FDB7617163DCD3A4C1C4D814A3B3A14367FB FRITZ.SKROCKI
221,565,246 *1545DF56CDA83CB33BEC8BA643260DC531FCC3AE from-hell-to-breakfast
221,565,247 *15440BD966044480A4A4E0B2237BD60AA67EC491 FLOWFANG
221,565,248 *154C84478D92894E1E068D83BCB3F1AC314D861E fuloderm9
221,565,249 *1549CE91E3046A5A90AA68CC71F120D6B8F274DC FOGUEIRA
221,565,250 *1546CE740C68D7A9383146382EEC4796FDF1C818 FVUZBB
221,565,251 *154A17B06B4D289805ABD20C90E6E2A4A793C4A6 forestbolivar
221,565,252 *154C3C6360F6D096404011EDA030E86E9CCE3C2B [email protected]
221,565,253 *154D4ADADFA3068D5F5CE4D19AB879A275052305 GARRYRECALDE
221,565,254 *1549C67A1BDAEB046694183F6724B203DC193948 FREDRICK.KVATERNIK
221,565,255 *15461C1AB6B2B67245890BCE26C6BEAD601171B4 GELSVE001
221,565,256 *154C18613B8E8ABC26562DA42D42ABDC32C67239 g1ires
221,565,257 *154B6566A131755EF8A29B4FE9BEDFAD9C852E13 GESTESD5
221,565,258 *154FC172E970E2C3BB03994106D978A7FE23948F GABINOFRAIRE
221,565,259 *15440C9209C200CDF8B56AAEB57A7ED25731B80A [email protected]
221,565,260 *154403291BDE4DBC30C563E4013ED2AFD950D7EC GARRETZEITLIN
221,565,261 *154B1A2842F019E3F10C0A83C7EAC1BCCD3B13E6 GASTONCAULEY
221,565,262 *1540BA15D40CF0298A57538C28BB8555593408E5 GLENNLOUTH
221,565,263 *154113A88C3412830332A8A6BED0C25CE21C23CE geflogens2
221,565,264 *154D477A8F7D6542322EA5104AEC3C2FE4B84D4D ger0n+0l0g!5+5
221,565,265 *15429522438E374C07B89DA52C072E67B848BA13 GESUCHT?
221,565,266 *154CF31A87E919A89343665A0CB674FB7C5AE096 GRAHAMSANDOS
221,565,267 *1543B74D490FDE712CB22DFED1B3B67DD35A58EA GHEORGHEURSU
221,565,268 *154B4BB403A29E1381DD6D67E87EC3939056DFC6 gl09
221,565,269 *154183EFECE1EDC6A50A630CE3ABE0B8C37AF163 greggocejo
221,565,270 *154372A2CE6012103298FD8EEE742052F6004504 gloria.2004.(prodygee.&.davis.remix)
221,565,271 *15486921E146A267A083AF7989D63F8F3E8E94D1 GSUDARJANTO
221,565,272 *1545F09452664802229178034BBBC9783611644D goldberg variations bwv 988 - var 8
221,565,273 *154ADFFED166DD9D159F7BC95A6C55271CC0A911 GOOT21
221,565,274 *1541100E88AD20E5A669CF7C0324EF0ACD26AE64 gutta(feat.trickdaddy)
221,565,275 *1544C49875DDFB859BFF0BA1F1B526A2197F9A19 grinder
221,565,276 *154ABB6CBD00A3DA5B16F6D6283EFB78345F11D6 GSHAHINAS
221,565,277 *154FD0D1E5A3C901E66E8E34735B5144CFBF088A harrietschock
221,565,278 *154E50E95BFEB5AF18F0C9F4E678F6E63D837367 haypagod
221,565,279 *154F13E5EAFB89B41D050EF0F4B686FDA80584E5 HEADWISE
221,565,280 *1548D4F5B6CC2480E0D448CE2F2308FF72E1851F HECKELFONEN
221,565,281 *15456F39EBDAEB7BC384A61C362B3F15E528B277 «haikutroubadours»
221,565,282 *154207B2ACA680EE251995926116B23A50F82395 H#*F
221,565,283 *154C4EE81F4883FD40C789E61B56C330329E979F hiltonpaider
221,565,284 *154A95563940CF6F9B90D2CC9F7EA8AC62EE0FC7 HIRANTHIGALAHITIYAWA
221,565,285 *154B056DEFA04EFC1BBF2DC572042C7D8FD50CAF HKWA
221,565,286 *15480237E75DBEE7AE1A85923DFE50F2862A7743 hartono.as
221,565,287 *154F954142B37C5E4D74FA44133F1FAECC4058D4 HONDO99
221,565,288 *154330A172C17E958F45166AD4282981EBA283B6 howardcallabrass
221,565,289 *154F70EC33C5F30FE763F3150265FB21D8B52AF6 hthcireg4
221,565,290 *1543642F81535AA5B630DC594DB1F55058CFB375 HUMPPAATAIKUOLE
221,565,291 *15436A07214A8945121994933ED6CBB8B2E43B2D [email protected]
221,565,292 *154B8E75B2A070DC750CCD519F6F8E7F1C19A66B [email protected]
221,565,293 *1544D0EEF97AF51586AEF3FCD204169A31469B0C HEATHMI01
221,565,294 *154C8C339D3C4D2602EF2266AD071AE87B3BF1D0 IAMVETTE90
221,565,295 *15461F26B49CEE4331D221161284DC8705786941 IELNHEOK9
221,565,296 *154CD2E2A158BE1B1CBA1AB30F680D05B77DFDD3 hertz
221,565,297 *154A443B5DF636B8C6FB6816933494EC5C42BD78 Hide-Out-or-Ride-Out-(feat-Lil-Wayne-&-Turk-from-The-Hot-Boys)
221,565,298 *15484FD54A981315C988139C1D9FCCD52D0DF48D HILBERTO-RODRIGUEZ
221,565,299 *154421A4933576D752CB9BF1CD761D471F07D7F2 iluvtopcat!
221,565,300 *154B73155B61D39AB99E80F9BBDEE3CF3B65EB96 incitavano3
221,565,301 *154F1C31039112652561098CA965AC557D56C69B HOMEMIKE
221,565,302 *1548ECA947F3C8652EDA2DED4BC9C637245DEF69 hoytvanhoecke
221,565,303 *154D0407786B37EA4CF7403CE616937E42899E2B IOSINAGR0
221,565,304 *15466ADAB946B81EA9AFCD2DAA33D971A39F1DC9 hradayas
221,565,305 *154E06F86AF5A510853942D652DF3AB81C150BF7 IRENE TABAY
221,565,306 *154C5DED75D67C13A114B66BF8AF4D5F3AF3C2E0 HTTPWWW.AMAZON.DETOM
221,565,307 *154852E935DE0C530239F676C51D4C1A99ABCE8C HTTPWWW.BRITISHGENE
221,565,308 *154A02C27424045F803A489166B98A656D9ECBE8 IŠABEJOJAMĄ
221,565,309 *154AD76B90453962CF0ED9D6C7A241AC39CE187F HTWORGERP2
221,565,310 *154BC15C369F956A1400AAE4220E91E3CF656847 [email protected]
221,565,311 *1542805166E9236C64651FE436418812F814F259 [email protected]
221,565,312 *1540A1985BA77B6AA6ABDCF18F96284284AD1AE1 ITAMAR.HARARI
221,565,313 *1540F21DDD2361F78C99222041C01B846C1F580F ivar
221,565,314 *1541C3F78E6FA66E1DDFF38FEF25EEB815029D2E J0NNY1105
221,565,315 *15496FC881A7A512BB37E278EB67E12FA5EA40D0 HUMAN-THOUGHT-PROTOTYPES
221,565,316 *1546EFFE18A874C70C9B8E184E8C13895F085F32 hungover.10
221,565,317 *15477CB7E395028A1A1F5CB293F9AA7B7C712FAF husnock-the-admin
221,565,318 *1547B78429A5AEDF827A1D11091E1E47A113B4E7 JAVIER.MESSANO
221,565,319 *154C3BF29FB60E30C98E701CD037394CB86973F1 [email protected]
221,565,320 *15455ED0D10E120820784BBE6BE4AF4CB7B9FF22 iamdoogie02
221,565,321 *154B22EA616C77D01F7E2839678A01367247264A IKIMLIVDA
221,565,322 *154EA1DFED931A7F0A3F82F34894EA4DEE01FF90 JEROMY.WOFFORD
221,565,323 *1543A6A9B5B182067DA51E918EBFD4FD8B17A219 JESSIE.MAGSAMEN
221,565,324 *1544F65BB042ABBAF284523A57D7FC4477EC6E98 JEVOVÉ
221,565,325 *154B7280C7BED3F5F0363F71A862478FF5806E03 ilovelee30
221,565,326 *154ACA0B771340879C89568F9DF685AC61426A46 ILUVJUSTIN11991
221,565,327 *154B3C28B2359BDBDFA321FBFC69234219202A8C [email protected]
221,565,328 *1548BFB385FBD443F76A9C6FE2C40FE264684B17 IM27019307
221,565,329 *154B18C55DAF7AB0C117E2BA9478F02B258399A9 infectant8
221,565,330 *1544A0D747F92D64DF6F8E29CC18041A2531FABF JOSHUA.FALLIN
221,565,331 *1544C2BB27B0ED32189CDF9667EE7126F1794E3D [email protected]
221,565,332 *15496153811FAFD78423C172DFF9E13FE9E4ED3E JUANBELLIDO
221,565,333 *154A1559B0FE535F6EB505FB2C5887B09E1E1FC1 JULIANTENN
221,565,334 *1540955C8C1DB0A30166A68677B7F78BFD615AED IOBUEHNE6
221,565,335 *154309F152785C0D403C2FF22CD3E312E2527165 [email protected]
221,565,336 *154FDA32E8583AE0A4964DA4ACA0B6972C9957FC [email protected]
221,565,337 *15427A5F88C9325DB227ED4CF342053EE4229908 IRELAND938
221,565,338 *15497F8444DF6A5D30CC71F7A11FF4A1C630E9B5 irp,
221,565,339 *154E1AAC6B07F4C0FE982E453488C40F0EA3CCBC ISRAELHOCHARD
221,565,340 *1541963068C7F08EE709CA96B8DF47E8402CFD10 KASTAMONUYU
221,565,341 *154D1E23E5411D8ABAC130EDDD27A8893A8B2C21 KATHYCALVERT
221,565,342 *15435987954F68B3F545B282DFEF241E6849F2A1 IVAN.ISETT
221,565,343 *154364579280F326D575403274D95E131815999C ivar
221,565,344 *1548DC38D73475B6806310136D4DE763CED06822 KELLEYCHILEK
221,565,345 *154A03848CB7A43E6CBCE79D84415D1684FEABEF KELLEYGILHOUSEN
221,565,346 *154007C0A9F7A08B3F057BA95C590C6C83BA5DF1 KELVINOBANDO
221,565,347 *1540217E5A3F3B726E38AFA8190FC03D0EE32147 KENDRICK105
221,565,348 *154B3738EC375854827B3EA65D9A62A606BCB7D4 jackierugama
221,565,349 *154178014248426442A738AA6F1C8421520930FA JACKTOMKA
221,565,350 *154D6B52685F179F46502863E918AA232FD5B3E9 JACOB.ANANIAS
221,565,351 *1543AE57250C2C0A82DD0C126B58B4CB0A3335C2 kent.billstrom
221,565,352 *1546FC73F523AC91341B6D90E4D2A76119B7A7F2 KERRYTHONGCHANH
221,565,353 *1548331768C53DD5E8506DD165FC72BC353D55D4 jamarfego
221,565,354 *154B357FB3776BDAE17FBC0B4D43411E9E61DEE1 jamelbainey
221,565,355 *154603EA47311A6C8FC02AADE0A6017F89D1DC42 [email protected]
221,565,356 *1543D2D6BAE1AD4A7B135747AA6FA35FBE528DF0 JAMESPITTAWAY
221,565,357 *1545F358EF5A485818819BA512CD04A4C90513C8 Kinbanden
221,565,358 *154368CDA404F8F47B895638A0EFC1AA81CB4EFB JARRETT.OSBEY
221,565,359 *154F67759A5E0646866F4FDB0DAFB18E5627524E KIRBYSACCONE
221,565,360 *15445F16734E4D74395DC22FB7C7817EBEE6481B jason-persad
221,565,361 *15422811D8768AFCF8CC24927874FD97FDC59D17 [email protected]
221,565,362 *154982C9174517F537DF259950B7C018CA7C4CCC JAVAD ALAGHBAND RAD
221,565,363 *15485E9835ABF1D416546E8599F56CF6537FF720 JAVIER.APPLEWHAITE
221,565,364 *154850C93DC94BEFC6D53D6204D22AF34BEF6A15 KLYPAST9
221,565,365 *154A03F41EFAD34A63C9218C09351B8B475B95DF kneetowaisthigh
221,565,366 *1543DF357679D095BDD00B0E468480AAF29E2824 JDA|
221,565,367 *1541D4DA404019A1394C61A1DDBC9372AEB31E92 jeni.gill
221,565,368 *154254629874DB24E5E6B5AF35692CD0D2E4094C JENNA-SANDOVAL
221,565,369 *154F7A61F305E35EE458FE69C45EED9F23E5568B JENNYJEN972
221,565,370 *15451F9E4DBF841C269FEA2BFAEA3B82CF600A21 K\R=
221,565,371 *1549A84B993AFB333A49524392E192818AB2A861 KRISTINA971
221,565,372 *15458A9943EB969C47BB40483D1AAC2C214AA46A JERROLDHENDESON
221,565,373 *1540F3A0AB0167194546BE2408E59561809E3C03 kucaklaştirmadik
221,565,374 *154BB179658BC5C8171147D9884FBF5FE1C6E83F JESSICA-WELD
221,565,375 *15444FBF420CAF509ED7235175F4416B955DD946 JESSIE.CHADWICK
221,565,376 *1547774DEC93552135E9A3135A1DAB1C878E3366 [email protected]
221,565,377 *1548F69119C29F9355BAF8795FB076158AAF33B3 JGFECWNQETK
221,565,378 *154C36E47A8DA792A4A6274BD2684E8CC8DA87D4 kyes
221,565,379 *1545C3BB823322F3CF27813E3F607D0DA8F8A3CF jiffyboy
221,565,380 *1549FE30B8FEB6B0185B454E5273A36D82C7C1B2 LADRI?
221,565,381 *1545E90F24F1127982FD251C2C82D55AC2E9453F JJJLC
221,565,382 *154AC9C428C8475FC516E546B700D7E258AD2E22 [email protected]
221,565,383 *154101B1027CE39BF28C08118C09A9681B6B53D8 lamarboan
221,565,384 *154119EFF9332A661556F7B44E347A8F685FB469 JO0|
221,565,385 *154459947FDE4585D7E8F4E644194D7BE68529E6 JOEYLOHMAN
221,565,386 *154C5EA6EFAA24049A05F8DDA2525175E88D5E24 john.mathiesen
221,565,387 *154403764F912801ED08EF983254AFC86ED64C79 LARRIEUG0
221,565,388 *1547A33AFBCCB6C63F9B4379949D52D410E3F63B jordyncolemon
221,565,389 *154B5BA8B263CA634C37BFD6CBC42CBC623B63E4 lazaroscarber
221,565,390 *154506E10540F8FE719BDBA9FB07EE9F0FD4A8C6 lazzzzzzzzzzzerjetbsw
221,565,391 *15449EFFA078B0A4505D4FD5519570E504E4CB04 JOSEMCCLAMY
221,565,392 *15467DD36269AE504215B8D167FFFF293A5E7693 joshua, act i: ye sons of israel
221,565,393 *15400B2EB1A488442F8EE140F3B22047A112D448 LEMUELFLUET
221,565,394 *154ED828C45E8555817B3DCEA931FECC5E5F019F LEONARD.GIGGEY
221,565,395 *1544761216D238BDCA0391EC75A81D4B117012EC LEOPOLDOMCGUIRE
221,565,396 *154C5641FFD12D54253AF66F0B38989BD8DAA976 JT*I
221,565,397 *15408A43196003D1798DF3A3B6034F4225059536 karen.bizjak
221,565,398 *1547CB03CFE3A7442954C33EAD9CED42ACB4C6B8 KARLA469
221,565,399 *154B8B859EDA209A7296397AC1A57E1587F8FE79 KEDVEERET-1
221,565,400 *154E79EAEC7F2C2B794CE6D93ED5B6250C30637A kennyburghardt
221,565,401 *154ADE5A5D1BDEE7E5F2B287A7426ABD26D4DD0A kenny-sumpter
221,565,402 *154047AC459E0A02389A5579E8E724C140D60029 LIZZYMU
221,565,403 *15415B69923CD1FC08B997FF71B4D15FAF82C087 [email protected]
221,565,404 *1544808CDD915AEFA617587A87412480A841B60A LoBeneelomal
221,565,405 *154833BA2AF94F8091DD4E39EE53F31CC1E2EA91 KETOON1
221,565,406 *154E59EC7472333EE736C6AF20E1672DCCBABED1 LONDONHARINGEY.SVG
221,565,407 *15429F40895C3D17E6D250B005E567231CA09B94 LONGBOTHAM1
221,565,408 *1544BDEDB9245768866E421673F5D0A51F1A52EC kim-sergeant
221,565,409 *154D1398327B877423599E6BE3222877254E7171 KISS YOU OFF
221,565,410 *15424E6E1DEBE3EFDA3A39D3B1EFCA2E8FFFDABF LUCIANO.KELLOGG
221,565,411 *15447FE0C4A3757055CDEA8ADD5BB5C2C91B0A74 LUKEGRICE
221,565,412 *1546C021DBDFF6B0B97DAF1480F16776DFD1D775 KRISTISA6
221,565,413 *154444188DFA539B178C19A9CB486E3A2EB1AA39 M1V2TT3Y
221,565,414 *154B8DBDD3711EE36A88605DD40721895ACB0916 K.V;
221,565,415 *154CD976E82F0BFEF896C61668BD13C1F39E7820 makroylhing
221,565,416 *15435D5B4D029B36F454A93A2934008FC445F99C LABOURSUNSAVORYALLIES
221,565,417 *1547379C176A3A96DF3A0D15D82D363DE321BCC4 MALVA-MICROCARPA
221,565,418 *154CFCEDFC4A9315EF9856A5AF167C24B01A6865 lanedragt
221,565,419 *154E052F7EFE25089C2692F8ACEB503C7FE1E000 MARCH-OF-THE-NEW-KING
221,565,420 *154476CC63A0A84F12F26685E155C7729DA35187 MARKFIELDITE?
221,565,421 *15456DFFEF591B924C16898C72FBAE4674827272 mathewgagen
221,565,422 *1548CD34A7D400B1516D7168049D57EF6FA30727 MATRIOAL
221,565,423 *154B5CBE370A7B9B60E98A0167A2283CF137CF01 matt-elkan
221,565,424 *154F291DB60D3A6731676E50CE46A5BF4199F0F6 MCCLINELY
221,565,425 *1542D7169B63826C188E65906C14351A1F31FED6 [email protected]@+OR
221,565,426 *1546163F9FB6C7A7011E4804C41B921520446AB2 mel.tillis.and.the.statesiders
221,565,427 *154B9214453CE87BC32DBCEDB57FC71D995E609B MICHELLE.QUIROGA
221,565,428 *154B15CD310091277CB724DA8E741F840FABBB80 michelnicolls
221,565,429 *154277370DC9D678E47FD47BB8D684A32763C64B MIESZKÓVAL
221,565,430 *15475FD29C6C982F6044242F8848B5BB6813793B MILESTROSPER
221,565,431 *1540C4DA8795E979870CBA231545C471C9487E5C [email protected]
221,565,432 *15449095658651CB2650A20B464D61C9A42D034F lene-laub
221,565,433 *1542D843DB9C2F334A18417A4381DA60CF055848 LEONDRAGAJ
221,565,434 *154EC40CE6AB3AF66130EDE654D6896FE2BB30AE LEONELHINCKS
221,565,435 *15435DC607A852962AF2BE1B24DC542D79B0FFAD [email protected]
221,565,436 *154C5CF31CBCDEB5FF4365BB00247D841350D436 leonycalma
221,565,437 *154D5A6B3A549D738CA2B7EF55869A332F510CF6 M-&M
221,565,438 *154B6A93614D48732CB4F93B293B82BCC97F69D4 MMONEGNA
221,565,439 *154F31954EE45460A5FCB64A3503984E3A5FDA6C MOHAMMAD.AXTHELM
221,565,440 *1543EF58FD02C1E6D402D6F07915F224C985011E mohammadsiverson
221,565,441 *15400EA6C5367A5209DA3ED02B2A83669AC695AC [email protected]
221,565,442 *1546A24140174C697C56F6415E847FAF77AAAA86 MOISES.WENTZLOFF
221,565,443 *15450EA7AEC70BBBE9A2B46A8D1196A7C7EF8A1B LIBERESKINTA
221,565,444 *1548BF8D701A6C1DE203C0FB3BE106F5BB11A745 [email protected]
221,565,445 *154B8EE4267272378F0714F0C26F1AF68A8316A7 moneybenny
221,565,446 *15493578C4353015343E63641003085309A1AA0D MOONSTAR
221,565,447 *154DE952B864D64DACCF896395CB41DFE954B917 [email protected]
221,565,448 *15493851D12814401B2E0E7F2F29049037097282 MOZART: THE LATE SYMPHONIES 21-41 (DISC 6)
221,565,449 *154F71757E92F3EE658B03FB8209E70953563DE4 MTRENKWALDER
221,565,450 *154DED8886DF6087A10C5506B9276611988F0B9D mucrash01
221,565,451 *154A6E68D4A19E2D42E1E20ED4FDFBC8EBB6DDA9 LI!N
221,565,452 *154FE12834592B4804961FEFE1B9009609B09458 LINWOOD.LEAVENGOOD
221,565,453 *154F6F44315C9A0B1D4967AA23BB16095C5E6E11 liwei.yan
221,565,454 *154890599EAEBF1F4380EF845D7D1A848080FA08 NAQSANS
221,565,455 *154F3662CA534BAA7DD4597EC668E8302984B7B7 LLOYD.CRUMMIE
221,565,456 *1543C455408823C87037FB71C80269F29AF8B37B lN:
221,565,457 *154ABFC52C9AD6D1AA6257A3878C3B596B503D92 lonnyquance
221,565,458 *154711FF61147B64BA42D5118BA9E8FE3EA9AF0B LOUISVILLEANDNASHVILLERAILROAD
221,565,459 *154CFF2712FFB85CD3348191837DF4DCF9D62562 nestorabner
221,565,460 *1543B51AF4600A99497F7149DB4211C5646D0436 LOVE, HATE AND FEAR (OUT-TAKE)
221,565,461 *15494C06F3538F84F3417CEA601279D046C34001 LUCIANOBAUER
221,565,462 *154413EFAA4FAAFBA2B753A4EC4D3E0EC99B950E nick-mcpeak
221,565,463 *154E58265C597ED99912F9F07B47ED09788A6D88 NICOLAS.RADLER
221,565,464 *15475C5549F657F879C39E622253293D81F44DF0 NICOLE COFER
221,565,465 *1542B2517328BBC15C40A5A1184D4C48C75E7C0D niki.erickson
221,565,466 *15476C7007B46AB17DA23446075F778721960BE8 LYOKO6
221,565,467 *15496FDE646780890AF88F1AE9E688A9438F2DB7 „MÄHRSPÄNN“
221,565,468 *1540B753B91BB0C64211C100D68AFA3B284B7FC4 MAKiNG-CHANGES-TO-UNiX
221,565,469 *154D247A102593EBDAA8206191030177B0790227 MALALTES
221,565,470 *154C8D3FBB006BDD3DC704332D19E5CD98270D8E [email protected]
221,565,471 *154BBB9C8862EC936F8140BB3576F0676DF2A962 maraprik
221,565,472 *15403103A7CC2D75A079D06D9B9739EEBA970339 MARC.MANGINA
221,565,473 *15456B19B57982340439CE3E7CAE688642FED06C nonquantitativeness
221,565,474 *1542F58045D3C226E7D2E33CE28FC5BC91BF5E5B MARGAUXX
221,565,475 *1540B078C59C9062C27DD081E143314F2F18A9FE MARIACHIBBS
221,565,476 *154A8B215DF61383E33BFF9D195FB07C68BF66B1 markusbalsiger
221,565,477 *1543AC2B7B95725C18136431EAB7B3CEC9435838 NurseryRhyme
221,565,478 *154E7B9AD983FF436FDD9294A714CE80B73B4F8A o1y
221,565,479 *154BFA2A81A2B3BFDF54D4351CAD32233F99C226 MARTIN.SNOVER
221,565,480 *154C9446B07B41769BD1E5479CC28A1DDEBD94D6 olaecheaed
221,565,481 *154A4993866940E1B84E5D4D93509D8847CC09E6 ONTGROEIEN8
221,565,482 *154B45310662BE371B08216EB9AA8B9D35E1AD64 MAUROFARZAN
221,565,483 *1542D9535E547FADEAC847945A47F390A5092D4D mawhown6
221,565,484 *154FA7FC9A7F64A27C35E747A135ACACE21147B6 ORIGINALBEFOLKNING
221,565,485 *154CBF4E4100BA637EA36C78B695BE35DC568E68 ORLAK12
221,565,486 *154F2CA29491110222E0A5064AED61D12249396C OUTSIDE-WORLD-(SEISMIC-REMIX)
221,565,487 *154415D239F267822BB1C19CE356B4E2348CFA75 MDALFAHAD
221,565,488 *1546F71C017E6C11A9679B714436BDB6C8D1F112 PABLO.ARREOLA
221,565,489 *154C0B0A6D54F26B420E07A55BC92029B0DFE981 pajatsot8
221,565,490 *154B6CB91DF6DEF72F00768BFDB9EB466A7DAA4C MERVINSEIRER
221,565,491 *1541ECAA4C3B4B6A215F64E5C64341FCCB746C73 mes mains, la ballade des baladins...
221,565,492 *15499079B82582B09FA09A9363494CBEE1EA2D98 MICKEY.KOINER
221,565,493 *154D0851056A7B09A7017CBADAF712A5B4EF8E00 [email protected]
221,565,494 *154522E77F35FF05BB6AAFC5126CADDA1239BFD2 MICRONESIAJOHNSTON
221,565,495 *154CBF8FFF7969814EAC6EC0BE881CC5D941A9AC MIKELFILLMAN
221,565,496 *154BE63426C928902B83B7962AE166FAAE622BC1 MIKEL-ROTETA
221,565,497 *154FF8C4F923AC80E0DBAB88F06D38B9D446BC47 perdido-(chakarera)
221,565,498 *154D88A23E847D667F8A652A612213D587FA373E PHALAENOPSIS1234
221,565,499 *1549FCC8B50E8842258804666B48CFCA75B23686 MILLARDBOUND
221,565,500 *1541AF2122FA4E53DE0ED569E17F01A6B9A4B794 MILLENCOLINPENNYBRIDGE
221,565,501 *1542219391B869A7D17CBD0D57AAB24DDF6DE64F MINH.SLOCOMB
221,565,502 *154049F806042615CDE2C5EAC2EEADBB8AA3617A PIERREBRIERRE
221,565,503 *154200A2E20D612E316E2AE5B1F6867724D09FA7 PIJMANCH8
221,565,504 *154425691BF7C397EE02BBCCF31002FCB1A4A0B3 [email protected]
221,565,505 *1542A814B8BB00A68BCB532DD4036755F2A31CFB MODERNEUROPE
221,565,506 *154E4BE1FD455927128AAF14FEDA3E537AFC327E mojo-funk
221,565,507 *154B27F3399A61A44FE9707C37A288BF270C4E24 porfiriotablang
221,565,508 *1545570000DE3D31EBE9E25B57E05929A2079DED POSTMARKETREQUIREMENTS
221,565,509 *154538CE85577A4F40DAE343B06774EC55A00CB6 moz4rt
221,565,510 *15439CED67E53667CA41CBBAB3B0ABE4C49C5251 MUREREZSES
221,565,511 *15469A9110427A0448BACE8AC5F5F132C269829C prognostically8
221,565,512 *154CD3EBF56B73CEE54043C4574A22201512C130 PUŠYNUOSE
221,565,513 *154F535F2DC462AB2324C311FF35270D1844C3BC q_ai
221,565,514 *1548363EBBF49116DAAEBA83A41AB1B67784F09A q{gb
221,565,515 *1540F35360F3FB2A2FA93DB182E72F9ECBB959D7 Q=P`~(><)
221,565,516 *154010FA10F0854E4D321D2462D9DEB655B4811B QU’ICELUY
221,565,517 *1545F57F53FF593772B93F2CD626A454AE891A4E quiero-confestarte
221,565,518 *1541E5A519115FD70F23F3FD8A94A45BBABCD55C QUINN.LAUBHAN
221,565,519 *15487154F74821926467F41F579ACC7AB072DF69 r3g10n4115t
221,565,520 *1543F94A07E4266C58B07D3C56D36A4DFB6265D7 raulbuhrman
221,565,521 *1548549C84373E66EF1DCC3F885F05D4882548DD RE9ALI+IE$
221,565,522 *154F5DDADBE79D85F6A95B0B2606E9AFA0FC1523 NEWYORKZIGGY
221,565,523 *1545D1A5625B1912C0A02A147D63D485E1FAD7CB NIGEL943
221,565,524 *154E012A82F6A61BAD49268A188EC4C2ED3DB2F4 RE[JYYJUJ
221,565,525 *154C60571AF98061B29D104D96203F7098C9079B nolandoughty
221,565,526 *15417B69C7628EA09CC44538AB0923F67153608B RENSCKED
221,565,527 *154E7648DFE06C3A03BF7A7267D4370FB2D549C1 rexcalton
221,565,528 *1549FE7C9AC7B5006C4D724E31FF7B263EC4A207 NONPH3NO1
221,565,529 *154270E48206E5B1732CF497143326015B2A9E72 RIPPLES
221,565,530 *154EA794468FA2E3776A24C67549041A79EB4F17 Robert.Stigwood
221,565,531 *154D46BAAA35AEE7C32A42C8B8571664CAC77039 ROBINHOOHELPME1
221,565,532 *154A307246EFFD3FC7EE3EB5CB14D0074457EB7C ROCKETDIANA3
221,565,533 *154B79DB0B4B27B18673DC73E08BFB27826AD8FA NO-WAY-TO-HEAR
221,565,534 *1546B5F0F28D58B9FC4C77B35FF842F1461E651E [email protected]
221,565,535 *154E28F4AB40083CCA839B7F265EB799FF2459D3 ROGERCARASSO6
221,565,536 *154AC79D3798352BE2E68FA8E55D06512CF4522F rolf-zetterlund
221,565,537 *1546F4CE70CB692ADF19EA262139BD467166C298 Oelen
221,565,538 *154A87A668388FACD2744F3EFCCF82F9C9CD8E14 RONNYMILANOWICZ
221,565,539 *15455AD2ACA1C4EAD178CC7885CA2CFC763C1AD8 RORYPENQUITE
221,565,540 *154056D6DD6D4339D49C5D8C1E78BF5667D2218A ROSENCRANTZSHAKESPEARE
221,565,541 *154FBE049E20B76B1C2697FD46DA9BCA27E0843C rossdorey
221,565,542 *154E1563B12C865380380383C7DDE027697308C8 s7u88es7
221,565,543 *154CB78A2F67215AA7C539A01DA2296B44496E7F sailingicecream
221,565,544 *154BA08226BBAA3DEDB89C7F638CD16E48F3082C samurai.code.quote.#6
221,565,545 *1549E36135EC220ABE8E55B48589A55D65E10872 (o_-)o~(--b
221,565,546 *154A575B2FCE3AA1E768146864560FCC5D0C73B7 )o([email protected]
221,565,547 *154E42AFAB5FDFFFD0285B1401E57993EAEB1840 saraleesed
221,565,548 *154183D07B28850F5DD647B7C4183D1C95DC27BA orebbonoc
221,565,549 *1547FEEC372B01D105299351336546A8257C441F OVENTILS
221,565,550 *154771EFFBEA63D3B958974677BF7BBCA8429F0E S&DS
221,565,551 *15489214626E07493AF428AD87482C13E2FE6EFB [email protected]+ON
221,565,552 *1542BB81DF6BDCC3A6ABD9E0B3EC3084214B0B1E PABLOLARRAZABAL
221,565,553 *1542C44428BD7549F562A4180FF63FC3FE050962 [email protected]
221,565,554 *15465E8476B92AD19B35812E0008E43D50D5DC55 PARISMUNDELL
221,565,555 *154C58486122478C17A002CFA0F84AF9B8DC0647 parisqin
221,565,556 *15451F6D566736D9EEB610F80E276101861BE886 PATRIACICH
221,565,557 *1549252D6245067CB780A332EDCFE2C4ACA4B5DC ŞEYDƏDIR
221,565,558 *15493BE34B0D2E938336E4A7120198058B98E2B6 paukeekuap
221,565,559 *15445381FC65967D558A871518F0844ECE356140 PAYNEVER
221,565,560 *1545217ECD9FD107AF44FD827122FB1396FD644C PEJSACH0
221,565,561 *1547C9E00FF428EFE498F0FD770E746C307AF99C PERSONNALISAIS
221,565,562 *1546DA7764E4CCE96A5850D77F672CF257BA03AD [email protected]
221,565,563 *15431D55B9A70DD0B54E1F9B80F9BFDE979BE3BD shonen12
221,565,564 *154E61BFD9F68FD2B829EABC02EEA856ED0706AD PHP5.LOADF
221,565,565 *154993EB951AA29BF225E48902EC8AE03FFD0C51 PLATFORM
221,565,566 *15430FE26BE92032855D2D05387549D17A2B365F sleep,silentchild
221,565,567 *15446C99B46C9BDDD4B5F3D086C7856F0252BB2B p######>~O-~o)0(
221,565,568 *154169DAE975BE05905231B139B0799402437261 SM(半減期1
221,565,569 *1547DA34EEE0D2A22354AFD3C45A28B982C07BF1 P!P%
221,565,570 *154FF30C4E4719360A21CDD2291121002FC92A2D pp.*.*splat
221,565,571 *1548A23F65B70640717F9FE5F5C025B4BC33F3FD solomondebardelaben
221,565,572 *154015EA47B22FB97965C44BBF31610BACE86711 preaccust0m1n9
221,565,573 *154FF8CF426240BD49827AD21743FA35748E2A3D [email protected]
221,565,574 *1540A299BE376041CFE031E25812AD9C12AA3296 SONU.WARAICH
221,565,575 *154B9DCF5B445046855654A68C968F0B86D03EE8 SORPRENDESSIMO.
221,565,576 *15417BC3283277367C658EF67A1FE2F14EDCCF8F SOŠKA
221,565,577 *154D2A5722BF9927802752102587AF7391D13182 PROBORAVI
221,565,578 *154FA8BE3893EEBB8FE066F184C4BFB3D7549D99 [email protected]
221,565,579 *1548699A9622CC0D723AFD9B672FBD0BAD9F6975 SPIEGLEMAN
221,565,580 *1549202E3CD845E13C9F7921115D25A7769C63A0 [email protected]
221,565,581 *154F3C6653C24D6B9933E101AD65E1FF4C1E0FB1 publiclyavailable
221,565,582 *1545DC12D0904B519722D266A01F4B4EC1758B76 splat.~d####B
221,565,583 *154F9FD0F18966B3E8B932E50DB4C8ACFC77348C [email protected]
221,565,584 *154BF41B917825D7FCE32B33581271CDDA4B63CB q###d ~o ~osplat!
221,565,585 *154A81D0E58F521A6A3C2AD0B9147ADB97F83573 [email protected]
221,565,586 *1540D6F340B03C22FE68228EC3110AACB5C555C5 src=http//ecximagesamazoncom/images/i/01p1bxy0gzljpg
221,565,587 *154E276665F73F007FDC01E08438959F34498D7F [email protected]
221,565,588 *15481CC64C49771393767E8BB259B9C853116DD4 [email protected]
221,565,589 *1542E0F6C062C2A71203825535A9ACCD8FD110FF SREISSARIUC5
221,565,590 *154A5CFAC1EC3E7C934953F29A95AFFCF5346B9E SRELTRUT!
221,565,591 *15465EFDB4C2985D6E474534AB4052E0E332AA1F srisher:ca8b9c46ad61f1f54ce86679092b5f2d
221,565,592 *1540D9729A9951BA9FFAA51DA51E864B698F32F5 qoranges1
221,565,593 *154A8EC325ACB352B6D00C577F532D22A1DDC9D5 QUINNBATZER
221,565,594 *15460DE4908DC9A11D6B005C43098941B5EC0A15 STEFANANGHEL
221,565,595 *1541D1A30BF1ACCC6AA9B865F215BF497ACE9B6A STEPHENHARGAN
221,565,596 *154C2A4EA777AAF00C7FEC9FDDA1F493384CD5E6 STICATIE3
221,565,597 *15401310CE4F18719556210EA4F023FC01467D91 STIFFNESSE
221,565,598 *154416393749AABD2D3C0ECC1FD3E702A9281DF0 RANDELLPULEIO
221,565,599 *154708C0C24364BBBD15D86D781DE3CC5CC8C3F5 RASHADCUSSON
221,565,600 *154CE052717FF09417E5A797A5A6B9CE9EE92660 RASISTER3
221,565,601 *154A0E75FE78FC1EE489840C1F8BF20DB84944BB STREICHQUARTETT NR 1 IN AMOLL, OP 41,1: III ADAGIO
221,565,602 *154605C9E6484EB8684DD6166FCDAF93A735B880 REDUCED PHAT 2%
221,565,603 *154977FA9CE404E47909BEE73B498BE927A8E745 sungtramp
221,565,604 *154C24EEC42C4B3817EA8D078CA283B827045868 refugium
221,565,605 *154606209C374B430DC78520C580926BC618EB29 REKCUFDROWSSAP
221,565,606 *1548FFF3F4E53D20A1EC90C99890FDAE7841594D [email protected]
221,565,607 *1545AB66DC2E1E4D35AC7B2ADD414436F58BBE34 SUZYSUZ
221,565,608 *154850C3055147CBCF98C8AC81B83C45A2C633E1 renedursch
221,565,609 *1549AF8EBE5E9583724514C8B46D48099669305F [email protected]
221,565,610 *154BB3BC10801E712F935A5CE48A92F2B624B976 REPOUSÉES
221,565,611 *154D7BE9655A2806247AF752CA075826099F192C SYDETTE6
221,565,612 *15493A745154134B3C46674D185ECEBDC42C68CA SYN3RG1S71C1
221,565,613 *154B45C7DDEABADC405F71E23D6EA12220255300 REYOLPMEG
221,565,614 *154747C03667F7E5645F072D388550FEBA35FB93 t9j
221,565,615 *1544A73FC9C3F55CE9061AB94BA4A267A8F6FD0B RGRAJAN
221,565,616 *154433DD35729ED9E40BE62D742FA1E9EFA29E41 [email protected]
221,565,617 *1545B4C02ADAAF6A85B9904D9EB959EE46B9E711 TALK207.161.70.5
221,565,618 *154A71D4FA21A3392D2C25FE8613364C2940AF64 RICH.BLAKEMORE
221,565,619 *1545404C8D9420535A34ED3C5C2BBF3BF9F82D60 TALKGODY2BYBY
221,565,620 *154290B82EC71065080800828F615FFAFF8E7B4C RICORUSTEIKA
221,565,621 *154E51BB24AAD948C19D0BBCB52BF9A1CBE409A6 RIPPLES
221,565,622 *15436EB965E54BC77BCD0F4B4EAA8BB38E896AA3 ROBCASILLAS
221,565,623 *1542EF669A3C79CF53D9D953E683961C3D66392A ROBINHOOREDSKIN2
221,565,624 *1542A395E7ADFF721C7AD57AD5937FA6E15E0A0F ROBIN.TESAURO
221,565,625 *15455E4B5C658F24DA485A48C52727750A3B284E ROCKPORT8
221,565,626 *1549C171101010E4835D381BED0202BCA68A7940 ROCWALLS
221,565,627 *154A0CB311650C1365DBBE527728B70949F77122 RODERICKFIGLER
221,565,628 *1548D4C133C65DDD770DD3E163EAC54508FEC7D6 TECNÁVAL
221,565,629 *1542E0C78AC0D63231215B4E08A5F346AA36E91E Room-Pieces-(excerpt)
221,565,630 *1549D966453DD2D29C4E7B85515F0EC7EF1B0F78 tejas95
221,565,631 *1545192D685EFCEEA5F91E5466D00B3FECB05F52 ROSCOE.TOVREA
221,565,632 *154B845FEFDF3AEBB66B42223CEA13140F829DCD TENKRONR
221,565,633 *154343BF530C864B59B6605DCC58FA5C1F9B0CC8 rossdeclouette
221,565,634 *154EA60BB915074E6550C854B417B82C892C33F0 ROUGHWINGEDSWALLOW4
221,565,635 *154D19B65816B0E21DBB863043A219A039C2580A ROYCEPARRIERA
221,565,636 *15400AB271CCC38E5C2B9C694738A6630B01B61E TERRYMATT1
221,565,637 *1548383E945595E25D7D40898CAA87C9E84BC7D7 [email protected]
221,565,638 *1543F639EB53E3C7E15E8BBC91938098A5D0E632 thatsoccer12001
221,565,639 *15409EA32580D4488CF8EFFEE87D0425346D8A2F rudy.wolf
221,565,640 *154E4803FB6A8246C6B534B44630D0127314D4B5 RUEBEN.RAMARIZ
221,565,641 *1546E0EB6C76C13E389EF100500F66F73F3277F5 THEBIGGERTHECUSHION
221,565,642 *154BAC16FDFCC5877A458156AC05103B8B75E525 RUSSELL.FRANSEN
221,565,643 *15410450408B5C842530693C152D2496C14F2434 RUSSIAN-THEMED
221,565,644 *154A628A601BE86F4DBE0AC30640298EB0571489 the.old.spagnoletta
221,565,645 *154040B69547FA65921C32E850942340C600A9A3 RYAN-SCHRAG
221,565,646 *1543AD8E1E578E06F259F9E7564E7F541C37126A ryunosuke6
221,565,647 *154863B744020A07D13303F90B3B3242FF910F3B SAM UMSCHEID
221,565,648 *15499E56C06468C076C45C3A31D5C98A18E33D85 time-in-the-heater-(amin-van-buunen-vocal-mix)
221,565,649 *154296FAD2780283FD54A439D6502A8432AEC115 TINTINTERESA7
221,565,650 *154D5E9F5A73FA183AE33E87E6188EA6BE1985E0 [email protected]
221,565,651 *1544FCB3249D0A8739925AB375A0F0A2493AF3C6 to know the road ahead ask those coming back.
221,565,652 *1542317C77E9CE575493193840FB77047AF35C41 TOLIŪNAIS
221,565,653 *1548821CCD5D800621BA8C0DF60799FFA030E62B tom roinila
221,565,654 *15428AFD19E35E1D9C45B97DA8DA89803350FB88 „TOPAS“
221,565,655 *15495F62C25EF363F5A3D629557B5AA5FA34FB99 $TRAIN1E$$1Y
221,565,656 *154A732D8181312F5372E2308FD3407E015174FD [email protected]
221,565,657 *154DEA20257F863100445714AB438F80D12C7C1F SCARESHITLESS3
221,565,658 *1548559B1C808686C1B5E006EA10E0279D4B67EB TRETTSOP0
221,565,659 *15449FEE2B98B54760171E92390D8344F8F1D939 trevorcrouch
221,565,660 *154F86A1289D2AB0D75DE7CBFB02362F09C983AC TRUCKSSPUNKY6
221,565,661 *15475E1C69A7053B58CA0123BAA136E9FE4CDBE5 TSEWS
221,565,662 *154A933EC4E71F616DB0DE8B701925DE945DC42B TSION.ETSUBNEH
221,565,663 *1541E745792A31F701F9E39F20F83AB4A9D3D7DF TSNAHCSEBS
221,565,664 *154107311C775E699589D215670B482C8DC764B2 SCORPIONSHIRLEY0
221,565,665 *1542D2EB3AC62B31AD026651EB4BB0C20508F247 TUANANH5
221,565,666 *15477E9A9C60229AE57489A26F702207B060B732 TUESHUEZ
221,565,667 *1549A439D694688A57B33F4FE4CCE92476C6FBE8 scottywoodlee
221,565,668 *1542519150E1E6DB4B349F0ED6E644B5C0DB8AD3 tumoria7
221,565,669 *15439F11C631A055D75E750DCE810098042106CA secretclaire
221,565,670 *15432EC09A47D86D2FF8CBA7F21C672E2FF02314 TYREEMUGGAMANHARRIS
221,565,671 *154632A5870493652F3785335E24DE616D4A6B35 SELOIRAV6
221,565,672 *1546CF80B4C3AC1D8EA988EDA78BF6514F8DC565 SELSSIRB
221,565,673 *154CA847A9A4802CE8EE3AC2711E58C34277E1AD UARENDER7
221,565,674 *154B5AB546529521EE6D08748CE8515F3285084F sergiobianco
221,565,675 *15466FE9C0B00154EA573779243A7A07BC181741 UDSKRIFTEN4
221,565,676 *154EC2AEBAC9BB1FB7D1A67AF36A27E9B7913400 „ŠEŠTAJAME
221,565,677 *154446DF5ADDBAC9B48557E20387B5A7BF0186F4 SETHBERLINGERI
221,565,678 *15443B6A9DD896441F6F5DF0E9C2AFB25C34B1C6 SEURATTAVAA1
221,565,679 *154D10E64E78965BA22A367D65378DFEF7745BD2 shaunhinnant
221,565,680 *15434B8CDFBEDA89496D0B17AE8AE412DA609047 unitybswed
221,565,681 *154B0A1CBA3971ECEC6E15111974A17B2C8142CA SID.JOHNSTONE
221,565,682 *154FEDAA1D8CCBE8B897E9133726A54400E04768 sie-m
221,565,683 *1544E34E5C7F0FCD23E9974FA47136B677355830 SILASKLEBE
221,565,684 *1541EBD26994634C682042B5BCA94F1D549E6FC3 UZURUTAP
221,565,685 *15492425F95AADA1B5EF48BA203A06C8120CFB4C (si,-si)-je-suis-un-rock-star
221,565,686 *1549E9E0F89E9E306C10841362A96D6F402D21B8 valencia-whoshouldwin
221,565,687 *15495AE4C76BA118484BCFDD6CEA53B075136C42 vancevelzy
221,565,688 *1545B79D5E9F8D1257DD0E0447550B7C933C1194 skyymoore
221,565,689 *154566184D12D88DEA48B349003200327958AB55 SNERAJFLAHRETNIW
221,565,690 *15473A6D6DE459FF1669284344BF58EBF7254372 SNOW MEDLEY
221,565,691 *154A5C1EA45AF1A4A81EAE4EB7CA74C2AFC2FA73 solomonobannon
221,565,692 *154DF67D3C3F757E628064BF9723DBB214155155 sonata-for-piano-no-17-in-b-major-adagio
221,565,693 *15491BFBF6A509A51FD14BA60A8D085BE618B909 [email protected]
221,565,694 *1543D10CEB3B0DBE1C71255DD3FDB40319407D71 sönmez’in
221,565,695 *15436E3BFEC06DE27C452ACF18011517C7FFB7F6 sovhxozo0
221,565,696 *154D219767AAD0A9785E2675E1A9856E6395A5C4 spanjole2
221,565,697 *15482148B5C88125C1CF5C9E6946919005B0FFA0 VISUPERICS
221,565,698 *154C7600022788DF0D3E10F7318A38785D114F44 SREGNIRESILAUSIV
221,565,699 *1541F067D1B62446CDEC649CDC91F66978E2C808 Vivoter
221,565,700 *154380B9A684A01921C1CC623B038EF1F07416E7 VOCABULARY AND IRREGULAR VERBS
221,565,701 *154442776F6FF44BCE6719605C562898DCE86744 startrekz
221,565,702 *154D459625731694BC0A5DBDE6155B464EE8B081 WADEBRELJE
221,565,703 *1548C4688AEC7C849A0C1EFC2DF4E1295C211B9A WADEDEMEO
221,565,704 *1545895F9D55C0A1FDF409FF59F9CA0C8037E883 wahab-tin-lun-brendan
221,565,705 *154DDB0B6AB04B82B07E556B9259C17C760A3FCB walendaed
221,565,706 *15406460583CF04D5BCB6AA232B7D23695842F96 waltz-of-the-pines
221,565,707 *15489F06F5D2A676C8FBFFD3839EB6C5FC44F9BE [email protected]
221,565,708 *1547BF1C418EBF5530E4164D8FF4BFDD62A3CD71 WAQUEL WIGGINS CROWDER
221,565,709 *154837A6D8B554B4CF90E82AA99DB6A3FE4462B9 WARREN.GUARDIPEE
221,565,710 *15425B4494D89B3CE962743F31C5FBB8226CB0F7 [email protected]
221,565,711 *15477637D298AD558EADBA3B26054399193B7F87 WAYLON.ADAMSKY
221,565,712 *15429ABE233847F1E45FF730AD0C00151756FDD0 webentesinkowebber
221,565,713 *1547FDD8BA64B937B790415F632BF6ADF574DBB7 SUOMALAISESSA1
221,565,714 *1545259D9DC3D462D6D2B0589B14635AD1E00045 well-reared
221,565,715 *154A0250A86CFD5EF5ED7D096937D337DC91AF44 WESLEYWOLTMAN
221,565,716 *1542560C83E97BC88DEF60B52EF230F79F707861 SYAQIVA
221,565,717 *154A386404298BDDA4F407473FEBC2D82119EB13 WeZijnTochOpDeWereld
221,565,718 *1543986187FE085FE486DCFD0661CA9A06EE1913 SZOKEBSW6
221,565,719 *1549BA23D95D9DB7C284D559EA163125FD879841 ŞӘB
221,565,720 *15484C09EB38602DBB62C1DC41E34D863DA92356 takande4
221,565,721 *154A116E08007D79D511DB431EFC72B760A4DCC7 TALKMRFIGS
221,565,722 *154D0CEDDC83ABAE443D6183BE6DBD5DD2E0130B TALKPATRICKSHERRY
221,565,723 *1545CE49A93EDE973B03C48B4315A3FC4E06D782 willislutze
221,565,724 *154FA442ECC06FBBC284CC9D1177AB700EE9EE44 TALKTRIVIALLY
221,565,725 *15475FD8EE2F2A5A229014448A5D2C76EA7B20A3 TĀLO
221,565,726 *154CB907C6A9BD461209D71F09A06BFDAA6EEB7B WILSONMARCAIDA
221,565,727 *15410918FE624F44BCCCC5AA4CAAD32F0416699E WILSON.SPAID
221,565,728 *1541D91393439698DED11D287BA306B8541874A7 WILTONSIEWERS
221,565,729 *154CB42D7C2C4CD335C2C97A6CEF2E0DE44B2DBA taryn.erasmus
221,565,730 *154F6D881B8A476FC47A8D39CCFDB87CBD90A9F6 WINFRED.VANOVEN
221,565,731 *15423A8F392FED96458225B6BF431B50AB304ED6 TCHATARA
221,565,732 *154186DBBE7850F59D2DB073C6E4587203EF2BB9 techsoupspeedgeek
221,565,733 *1547C7F3E45EA650BA39219808BCE36F4A20842B WWW.CRAVINGSFINEFOOD.CA
221,565,734 *154F2A1CBE108D063E29C6F7EED8D9D79B11CB24 temple15
221,565,735 *15433EFD5534D0034D9E048740EE2E33342B70D1 teresa.epps
221,565,736 *15476BEB5A011B5D1CCBAC19087E3AC779F968E5 [email protected]
221,565,737 *1544DFEF10100C1C0731F307BBDEBBEAC955E43B TESTRUMS
221,565,738 *154FD8DB1D77616D366E829E74295004F43D3D4D XAVIER.VICUEROA
221,565,739 *154262B4D4B006728FAA5EFF0DBF612C36D184D4 XDTVPQI90
221,565,740 *154585790AB4958908C27B7C903FC0FDC9F15291 X!)I
221,565,741 *15482DE080957F9F308F8AE1DCE704F19331736C THETARGAS11
221,565,742 *1546C6904E006029187A09396E750F4261965F87 THIS.83.100.254.51
221,565,743 *1544FD11BC664F47F379E5933581EA00B38F0957 THSSCVCBSW8
221,565,744 *154E41B24E01674ACB95C4F6241588B8E223FE34 thuytle
221,565,745 *154BA2554A65C18E304A8FEC812E5D4E722D7223 TIM.KAVANAGH
221,565,746 *15477D0F7310DD97D47C0A0689DFAB1C2B3F73B8 TIMOTHY.REASON
221,565,747 *15447D13FEF53C3FB23F5125AFC6F04E8CC0B324 TISPRIVA
221,565,748 *154A85C8A90B3E1CF9321A74F2256BDDE7990FC0 titusbrechbill
221,565,749 *154CFED79AA0C0F01B6C0774101641825ADDD2A4 TKAJCMI6
221,565,750 *154550F39896A11317C8F9C8EC19C6B4E6983262 TLGTYKWLK5JVI1F0
221,565,751 *15480DBA2512FE973CE9E99D09C112D3017348AD TOMDEBUSK
221,565,752 *1545CB62C7B10D5F8E584938CCD318D73F5D62C2 [email protected]
221,565,753 *15423875B2B736A6E96CC7B12D86F439B5855EB4 ydnewytilauq
221,565,754 *1540A9F697BC0C07AE5DF1BDC6A39CA457DBCBEE TPENARANDA
221,565,755 *154934A2F575A644DED2788F276E844C19AD5CF8 [email protected]
221,565,756 *154B828BD1A99029B6F1395C9087A93ABBE109E1 YIZUSK
221,565,757 *15452CE1101CE3790D201DF731FA7236F7C13D9B TRAVISNEWPASS4
221,565,758 *154380073A02303FE0F75EA5EF0A0577889793CF TRETKID0
221,565,759 *1543B9B86F41C22B8A648FCA520A2F2CDFB72194 TRIBUJ
221,565,760 *154EC40733B2C7E6AF94E6F6809B881ED37D420C YORKIST5
221,565,761 *154C032C52CC650C1D15B3749BF9DAECC5AB5CC3 [email protected]
221,565,762 *1542121145837F659F1D04EC2313B8026F80C6CA tsgiddovs
221,565,763 *154F3A35A800DD870BC10D2B1199C9A49A19D08A TURKCELLHAILSTONEWINPLATFORM
221,565,764 *154DBBD78F0F12FE47C9B3779E642BCA0897EBAC zachst
221,565,765 *154251787CEDEA89B55F981D9A2506FBDB727DD2 ZAMBRIRAHMAN
221,565,766 *1544A14919B3DF9D0C2F0AF4F417C99CA0FEBB08 zbrajale6
221,565,767 *154D29E6BACFFF7343771A3935397155F4C4CAAF twilltwih1l
221,565,768 *154CB80F55D4F0238FE3FBC98ACF2D7412E0306F [email protected]
221,565,769 *1549AB4BE663F0A45FF0467628CC078127ED5E93 БОСАЗОЕ
221,565,770 *1544925A58A25BC2A9528CC79A8CF4250D183E9C ULLALNEE5
221,565,771 *154DF1D72C886629243553D8F30EB9F2126F55D7 ДАНЄЕЛЬ
221,565,772 *15440E91973AF2B52364D66A8D436F355E9F2A6D UNDERLANGUAGED2
221,565,773 *154D8147EDF6990F861D13AFFA495ECC43428B36 патима
221,565,774 *154116C014D2A84DFD244053845D24D0FC1D91C2 тишнов
221,565,775 *1541A2EA657A2EF8E612ED350743F756B21C661B [email protected]
221,565,776 *154EB5C9DA42083D60447440E3A5DC7ED47A532A V`,AA
221,565,777 *15478835334BC5BA966AB6FD07A31801F3CF41ED VALMIMAS
221,565,778 *1544CBB33490E64208DF39356C489C57E1CE63D9 VERONICAHOTY
221,565,779 *154546BC79E543AEFA4018D3DE19F7A9EB412F4A VITOFRIDELL
221,565,780 *15411A0BB0E813BE337CF93149D7B90413DF94FB VIVALDI & SUNSET DRIVE & SPRING FOUR SEASONS
221,565,781 *154636A951244536AB63F4E5E6FCAA664E1598C7 003VICTORIA
221,565,782 *1540AE982E82A6B7D65B90F47BC7BF481F6E846E wegend6
221,565,783 *15429ECACB9C8E5A0BA348CC7FB2E8FA24F8FF8F [email protected]
221,565,784 *154EB17BFE0D14EBEEB3B30807F73AAA845E23D2 1229WA
221,565,785 *154114318F626ABB117B1515FB0CCA5CCEEEE38C 1445822 jokinen.,.jouko.(.1989.)..
221,565,786 *154E56152431B3988E27953E960C1204D2BD10F4 146760 DESHALBISTERSOHIP
221,565,787 *154182BC6C065A45075036F9638CAD8C6F8319E3 WHAT-KIND-OF-EMERGENCY?-WHAT'S-THE-RUSH-TO
221,565,788 *1547E49A2127BC1FC65DCD08E7DA4C0B947AAE13 1-amat
221,565,789 *1548FD8154FF334B7FCC36DA37238FEEDC7AA9A7 1 CLUBMITARBEITERIN
221,565,790 *154E413FF30E9A9A4EC353FD7A70EB9CEC2E74F8 1 coastalwater
221,565,791 *154E79CA604B230536072B427972068F836AB207 WILLIELLOYD
221,565,792 *154F78B46D5A107FDCD04DCD63222E858A49A9B1 WIMBURNING
221,565,793 *1547C84DE21F0D4EF8E9D312BA5F13754E97EAD6 1 HAZAEL
221,565,794 *154CCF0DDB70BF8013CF7928D32C70CB444CCF26 wlun.chong
221,565,795 *1545015F4621AB950F2A0F5CF557B432CED629CC WMANAYA
221,565,796 *15456C442D5DB59A63545FE7B7C5152F15CA8675 1IAMBELIZE
221,565,797 *154F27B58099C630EDF3EA4CBEE4730CD5D02E9E WORDS.OF.THY.MOUTH
221,565,798 *1544FF0DFFC53864F3AB42C442DFEAAE5612BCE6 1.kv'lik
221,565,799 *15466F4C26B25AAC11601F2CDD20D3EA89DE9E25 1.LEGSFORLIFE
221,565,800 *154101FE231466226F9345CCD0B4732529874165 [email protected]
221,565,801 *1542CFD2A2F520EB27AFD43EA84003F1A38C2D9C wwwallaysaddlescom
221,565,802 *1542FFC83DAFFB3649C73130645D1934138BBEE9 WWW.FERVIDMEDIA.NET
221,565,803 *1540E2548EA2AD068FDBE700FFE0BC54795E54BE WWWFIERICOM
221,565,804 *154942E1E3FB6126A0930370038E6CAD5F8F3AB9 WWWFREEHITSDOWNLOADCOM
221,565,805 *15483548DE5278089BCE559668521BA47EB7B1A8 1PWSEOUS
221,565,806 *154D1E42834545296B00893DB200C0E2B2D1EAEF 1.vapaaajantalon
221,565,807 *1543F73FA657D41FC8CC58FC0E754674F55C8AC3 1-vorteksli
221,565,808 *154C6497B884881E74019DD6035DAD4221158003 1voxeigentuemer
221,565,809 *154A5CE027D611FCC422220BB70F890F114AE2AE 1-WEGACHSE
221,565,810 *154834F1061F52F2CFB5C67D8CBAECA2A8ABC435 1xa-sarjan
221,565,811 *154CDB554C4C2B39A08FE6BA8CE734E769960CCC 1.zoliborzin
221,565,812 *154EF5FFB1145B28BACF8E2BFB0916E9E3CEC427 WYATT.MAJICA
221,565,813 *154037FAEFB042E2E4A5577100E57AD2756A1D74 XARA FLOURI
221,565,814 *1541F584F2C9405EAC376E0B9DFA685A0493A9C7 xianglin.liu
221,565,815 *1548AF03201D3F42589D50D7F22FE8F0B22803A2 2379960 wir sind jetzt wieder eine familie
221,565,816 *154D60AF779F709C39FA80C8AACF3FE9D855E082 [email protected]
221,565,817 *15465FD4A952487125443C30AEC62A6393343677 XJN!
221,565,818 *15439659CD12DFCF9432C9E588710A16384BCB20 y{0w
221,565,819 *154E83B0DE35F2D610FCAC659A8FB9AC063F8546 273 MUTEAHHIT
221,565,820 *1544B229BED6EC35A65D9C5D20CDEEC52E7CFCE4 YABYANGIED
221,565,821 *1546FCC350966CDC9B924587AD8BCFE50E4523FB yagallo8
221,565,822 *154512B506778E4E89FE78FB0CDEE6DE2A2662A7 YHEIZON.JUVENTINO.OLIOVARES.BERUMEN
221,565,823 *154FCB5A991250027597FF34EA1AE4DD23AD26C4 yidenekachwzeleke
221,565,824 *1541CA25D0CC32E7973304C65011390D7AE188F1 ylatissa
221,565,825 *154B46DEC546F20142EC7318BA424C9B0AB36DBE [email protected]
221,565,826 *154E77211CEC61AE71CE015708978E10B14C31DF 2fbloom
221,565,827 *1547DC5B651248B39BEB2FF45E82AD9A3E73D6CD 2HILLSBORO
221,565,828 *15490D12436E22FD85119529C9D3E1B916B42907 [email protected]
221,565,829 *1541DD8FC8B65F7CC202B6FC5E1431666A43783E YRREBHTAEH4
221,565,830 *154728B0DBF3D6AE0BF6BD2EF7554A5F5420D1D8 [email protected]
221,565,831 *154DDE47C18FBBED20C5C6C126C5ADE7C424CCAC YUHANISMAHMUD
221,565,832 *1540BC8E3E650053879E065E46B30D83BAF76859 yulanda.evans
221,565,833 *15463CE5BDA4D450B5024BB71E8754C39FE0E42B YUTARO-NINJO-SHIMA
221,565,834 *154FCEA078ABCF15CA1E48F3F7F0C4E1AEDC7DFB YVETTECARMIGNANI
221,565,835 *154C707F74915FAA861E725D0DAB96327164AECA 2VALOVAIKUTELMIEN
221,565,836 *154DE8C0A947C2522F9D22ADC1933B3CEC275B68 2.WOODWORKER
221,565,837 *154E73EF2CFC9FED4BA19A4571F0779AD33812E5 z86)
221,565,838 *154D8DFB1A12BD0F4F941183BD88379B906CEC23 310978 DANNVERSCHAFFTEERSICHLUFTINEINEMKOMMENTAR
221,565,839 *1546E85038995294F5A5DF4BCC244E5CF00A1BF8 31UD0N0
221,565,840 *1540B4B45FDB4287904C6E62BA90AEDBB69735C9 331251 PEKKARINEN-NIMESI-ERONPYYNT
221,565,841 *154D9B4018110ED3145784522E01781E1A30DF9B 33JAYDAN
221,565,842 *154F021E1DA838495B098190933C32FD99A4CDB8 389570 tilat sis
221,565,843 *154063B7F9A50F7500F9D97AFC650B2ADA0F44E6 3####D~0~o}8{
221,565,844 *1540F9C5AD6D9CFB9570B00A37549C958118685C 3iambenoit2
221,565,845 *15496556587330F58C20F99431874F21A9A920A5 zahariaflory
221,565,846 *1541EA0FF33C51B34F6FB018A87191710E600D1F zapata1931
221,565,847 *154E5F3B58C8AF9BA43B8D42498401A5CAD11DA1 3==p***}o{
221,565,848 *15491C018B5551253515C76B54164BA16B78F0B1 $3qu3nt41ty
221,565,849 *1542741211D47FE57AA3621F04C54EDCC5E688CD $3QU3$TR4TION$
221,565,850 *15454AC9D8AE5F9F9F27D26A6D3C3E37F258535E 3sinjirabobi-bobiturboto
221,565,851 *1541F258C51B2F1AE6473682057A5AA6E86217E2 [email protected]
221,565,852 *1540673D72C8A6C5DFE87BA90101632131AB3344 [email protected]
221,565,853 *154FE286B6D9399E796CDE05BA5929E8B8E99B55 44violet
221,565,854 *1543C656A82FF56AC4BF44D95485BE770DBFD4A3 4920B153ED2831E625F167057B628E3D
221,565,855 *15404A4A4060842DDC8FBCF1B65ADD3A450FE1EF ZOUADASUPPRESSION
221,565,856 *154C9636D9A90D3D8A918C045FFEE25B1724CE17 zuber-mohsin
221,565,857 *1547114A7662E7414195D31C416AD26470A25E08 ZULU.AHKI.CMPLXBSC
221,565,858 *1546CE49A89FA4568A672B10589C98513D9EF285 ZX —
221,565,859 *154264A6A50F24D734022CC69DB9AB12FC99BB47 відділене
221,565,860 *1547441BF1DA4B99106795DAEB9E9FE342EA4F37 4INLEDNING
221,565,861 *154FC236823BCADCC3407652E11319CEC389CBE6 4IRNENIUD
221,565,862 *1542DCCEF36DBD5C052B30B019399889B9ABFAB5 МЈЕЧЕСЛАВ
221,565,863 *15493DADE8FAE8CEA55802257597AE37EA9D530B неотенија
221,565,864 *1548305F6FE5F0BD8352CECCDCF7099167B50198 4PIHCNARB
221,565,865 *1547C27094D47F63D30F19629750860FC786CA9B 4POSTIMERKKIN
221,565,866 *1547F96F1A4006232AA86FCBE1942878BAA42A5F 4RIFLETTORIZZA
221,565,867 *154C7FC54574D6BB397E9C51C108C5D32A915C02 РОЗСУВАЮЩИХСЯ
221,565,868 *15425731C79A1CD9F44E748F6C668911CDC56820 ͲҺՍ
221,565,869 *154CD92145E495BFBBA9E9474C336FC5C74FC067 ՀՐԱՄԱՆԱԳՐՈՎ
221,565,870 *154A943E58421A066A4064BE360A2D7F37BF1455 528227 BASKOMUTANOTOMOBILINEBINIYOR
221,565,871 *154D69257CD9BE38F36C4E9B652C682FAF4F86F3 559300 se.oli.henkil
221,565,872 *154130111B949BC104DE7A3F79FFE3BB52EAE5DD 569CASEY
221,565,873 *1543FD6B254EFA9B8284181BFC01B2174126BAD2 586322 DIE-DRESDNER-BANK-NOTIERTE-ZUM-SCHLUSS-ETWAS-HOEHER-.
221,565,874 *1549CA945CFC12F46EA988CEF60BAE03EFBC6F33 [email protected]
221,565,875 *154DC3B7B503D474F5A4A7494B1429310C920EA6 5ESOPHAGITISS
221,565,876 *154632A9B51BEC64069E5824110E928F3B0CDB93 5KULASINGHAM
221,565,877 *154EC9CFEA229F8496FE07DA15E24CA0E7E8EA18 5LARCINNICRAL
221,565,878 *154394EBA363EDAC00A73E76221D0C430F2F593D 5RACLETTES
221,565,879 *154DF669A15ACD604A7B3EEFAEAEF452836F06A1 5SLIPPERBATH
221,565,880 *154DA2F75A8FD77DF9AD2A4880D05BD7A72A5D66 5transmit
221,565,881 *154834FBC1C17F864B64FD4654AF1EEE446E5FCC 5WOMBBMOW
221,565,882 *154E73184071882A5176F9DBC884701AC46E9BE2 697429 -YILDIZ.MH..
221,565,883 *15480AE68C3C4E1CFE2FEF2A8F0630898735BDD6 6CHTLINGSPROBLEM
221,565,884 *15405E11A7B562FA08C2A9292F4335F9C36CB38B 6GLOBALHOMEBREW
221,565,885 *1544CEEB320F9CFA8F98DA0AE0FBC6B6295FF18B 6HERBIVOOR
221,565,886 *154D7B6C004F671E6D325AA2908FBB02A9DED2C5 6PANARABISMI
221,565,887 *154ABFC4B4AFBED94D4613042A31B45B5F110ADA 6SUMMERINGANE
221,565,888 *1545A34255A35E58736B614F6CF7ED664B59E646 6TRIEFEND
221,565,889 *1546148E571BAC84C82A082F209119C251B55AA1 6WILADEL
221,565,890 *1546310CBBDFC376B8E35F51B94687DC699C5477 (0-0).~.~Q======B
221,565,891 *1548BFD2110C1A461B8E795B3197EE54B855C585 01171006
221,565,892 *15493DB0987350C63A363D2A98A13A4E82555412 7CASIOBEAVIS
221,565,893 *154DF192B2499FD6568587CE8D59BD87CAF4D777 7GRCHTHD
221,565,894 *15492A95B905E465E32F3023290F73BF9EAB0A41 [email protected]@N$
221,565,895 *154DE56845B5CC43911FCABA549EBEBD7C177096 07atg4x112arhic4id
221,565,896 *154B35E4E1510D961EC57290892898414582CF75 7NOITATUMNU
221,565,897 *154F667A6F80FACA1E98DA2D99407799B7FD2A82 1039966 TYYPILLISESS
221,565,898 *1540823ADD4E742F770607D050CBDD268EF1480B 1047349 ABER DER SCHADEN IST LAENGST DA .
221,565,899 *154E440F031401FA3F8A164211909BE84443F42D 11-29-1047
221,565,900 *15400D3B03ADA5A63BD8E47F8D700E294FC916BC 820659 MESSRS OLDS AND FLYNN COULDN'T BE REACHED FOR COMMENT
221,565,901 *1549A1A4F6E5F112B4190462AF9BAD8DDB96711E 886412 johanna-vil
221,565,902 *154EB1C5D9446A35E5F693C78D44F8A5F549ADE0 *[email protected]
221,565,903 *154A551D0AE0C563D501EFCBFA952C56B9ABA206 8AUTSCHAU
221,565,904 *154CFA48394FF553138B8AA0AFE3399E4C9A3DA7 8BESKREVS
221,565,905 *154A6BCB18497B23A2C1DED66D215E56E4C6CF44 8BREWSTERM
221,565,906 *15430B1C6CBD3643A0AF31273CB860E55B940CDA 1605055 ANOTHER-HALF-HOUR-IS-DEVOTED-TO-BACKSTAGE-INTERVIEWS-.
221,565,907 *154DA09629CDB021979875E938396D67ED9C2152 1630386 ER-PLAEDIERTE-FUER-EINE-FUSION-ZWISCHEN-1999-UND-2002-.
221,565,908 *1544651D5544A6518C12B50171B2C7ED8D4C03E9 8BSWDAVEHIEBBSW
221,565,909 *154908D4D40F3F361FD2C0F8BB627C0B9100E75D 8---b `uu
221,565,910 *1540D9DE2F26A9F9CF6A2856E779C61404EFAC95 8dec1844
221,565,911 *154410591A591C99C8F194F095491BC78EC50647 8GARDYNSKI
221,565,912 *154973175A6AFE564C848C492E8A695C85763DC3 1.at'den
221,565,913 *15458411D3AD7A9F5011B3304119217AAE66E40D 8INPRINC
221,565,914 *15464C003CE242499453579980F713129AC988EC 1cynischen
221,565,915 *154A084AAAB6A90327362E96B9A0D2E85B5BE173 1DEMODUKE
221,565,916 *154CB2DF785CD0C1FB1712B8C8ADE543BFA2389F 1-HOFBEGRUENUNGEN
221,565,917 *15425213F5886BE8CD3517FFA7C691C1ECA16FBA 8####)~o-(0-0)
221,565,918 *1549DA5AAF593CF341154D9FF96A4D2F8CB007CA 1.KAUKOS
221,565,919 *1546FD021B26AD77331A0AF62B081064D532877E 1.klubeigners
221,565,920 *154758F80B89A2ABE69109DD9762A5B179320F67 1LENTUEEN
221,565,921 *15464256D1F3FD8F60AF344C6C7AB7609E8B1B8E 1-mahdollisuuteeni
221,565,922 *154D92DFFD46C9532BF127D1395226C0C4B40DF5 1MANGOLDIN
221,565,923 *154846526E8D4A6400A82B96E4E29C5BD197E97E 8TABOULEH
221,565,924 *1546F7F8C59C273985085AE1CE445DAD5457087E 1 NERYUNGRI
221,565,925 *1540659E9F0554FF4B5DD051D1522E9C76C7A6F0 1observant
221,565,926 *1542263B934A27E31A48DE874E0E39BBCE0B999B 8YBRAAAAMAAJ
221,565,927 *154701AEE5F477B5FB43BAA25ECA3578B78AC075 943808 "ABERDAMALSWARICHNICHTGANZFIT.".
221,565,928 *154E92B8FBC6DA9300B0504C0C99D32A418A6A95 99999999--in---ns--nsnasagov
221,565,929 *1549C090AE5EEA148C58E88C9CF256F172FB7BEB 1 siet
221,565,930 *154BAEDED52914CB3418BC17174CA272748B1BE0 1YTROF
221,565,931 *154693D34BD5F3C17D6A0E0D55BE8B884FDD3061 9HENBRUST
221,565,932 *154BD7290F9051FA5194B0BB74526BB1A2B84F92 20 HAUSHALTSENTWURFS
221,565,933 *1548851E75CE0B1D8BF074F129EC59AE237A8E4C 20pallacine
221,565,934 *154B43434956D1E18F0F156F0DCC2C1310D7FD8E 9KDRPLCHT
221,565,935 *1545991354A2E1ABD56B952CDEBB160B9893639A 2185430 rudi.voeller.-.das.haben.wir.nicht.gewollt.
221,565,936 *1546493D4053BEF641250FE36C3D00B3E931D160 222572 rauhanturva-jakriisinhallintaty
221,565,937 *1546B31D545EE2D6E132AF9A94B344CF2FC3D22A 24.03.1764
221,565,938 *1547C6E1237A449CA3E26DA2E591E2F69FDE1074 2601387 lasikleikkauksessa j
221,565,939 *154E52E3A5BACAA0D3341C31945FE934AADB9D5A a_0ms
221,565,940 *15469C16800B9395369882313042F574A966E6DF a1%/f
221,565,941 *1543CE8EDE79FCA7DCEC274AEDB0A749DED1052A A6QO?
221,565,942 *154FB822DE48DF6D7E2A5405063CB9129B0F8163 AA)5:
221,565,943 *15453B13185CF8675F5FE5F6154D9A4FFB643A11 2otoconia
221,565,944 *154DED7A527EDBB97ED297F765D161A6BAFEADC6 2WBPQOFE
221,565,945 *154E440E7D77348B183AF2531333BFAE860EE98F aacc{6
221,565,946 *1543FF639226431E680DE24F63A2B608CA3EE1A5 3B<o~0~(8
221,565,947 *154A0A4D08D34F06AA2DB75169DD4B77586FB057 aap1k
221,565,948 *154BDEB745F19A6BA4DEE316FA02CFBBC841435B aax\a
221,565,949 *15412C136C0D96B21DC322CFA6223DD3F0D9F83D 3MYTROMBONE
221,565,950 *154F5AC168809A84C7E0C6C642A83D23924AD93A 3NTCHRCH
221,565,951 *1547EBFAC6DCF1ED82F288F2B0F43D8AA7D8CAAD ABD]P
221,565,952 *1548CF8C611D16B73ADDBA5B18363D1933820BA2 3QLRTR
221,565,953 *1547F844691A1679E8BD4F70AFFBBF033FBF6FDA ABE[V
221,565,954 *1541CC3FDD2646D79723C358030180F6745BE218 3tatda
221,565,955 *154253179211D27D566DC05469B10DC4F28A3486 3THERESAS
221,565,956 *1547699B1C7AD3EB2726B4EE3A7DF76DC0520853 abramzauala
221,565,957 *154D7571614C736ACA8750F79855A86E88716341 437ASHANTI
221,565,958 *154C2561D1185B815D29E3CBD24FC42E5140B4FA 44DUOSFORTWOVIOLINS:NO20ALTERNATINGSONG
221,565,959 *15474DE38930CAD037B54441A54877C8041A842A 479725 on-kyett
221,565,960 *154D70CAC6B7D87CC59FFDBBB6B093DA85E1F597 48EZ
221,565,961 *154A56BF01DF43462494E86DAFECB71CD6BA414B A(C&2
221,565,962 *15416890466A16FA28216F1BEE04BDA4FD4E7E9B aclje
221,565,963 *154EF5CA7035D6F682513CC497C2706AF22880EB acrodinia7
221,565,964 *15425C6A3BB498138FA8A226D5BD42331CFF3B9E adamscrockerfish
221,565,965 *154BAF95D18CBAA24DC7A2F159798C89E35C8010 A DE HURTADO Y MENDOZA
221,565,966 *1540D2D8A795537F60232594CE3484D7D239756A AD^H;
221,565,967 *1543A71CB68253EE84BB6C82507C9B0875DA0453 a-donde-vas
221,565,968 *1546C6AE72B47E865F9D9E531663E6CB2B9A9CC1 [email protected]
221,565,969 *154C2D35082FAA0299A3F3178673F145A14B5390 a/e0j
221,565,970 *1547FC5ED531C144B74E2AF581360771244CF1C3 4yauch
221,565,971 *154E5A8C49DC8506A0DE48BE52816E6D3295CECE af#m:
221,565,972 *1540623FB4418E62718AE479BA5D6AB71E740FF3 afsjouwde7
221,565,973 *15459AD8266D71DC7F09A16511FB75C459D81ED0 5AUFLSEND
221,565,974 *154FC0C217ED7CA92A9AE45E56753E3D6DC4C0DF ahrl5
221,565,975 *1546546949427467E060E40C4B411555615837D8 ai+go
221,565,976 *1540D52BCE2666570C3E4EE5FE58C9EAF74A21B8 5DOUBLERONS
221,565,977 *154D7A40AE73118D2D0D2E1B8C1FE6CCC986F0DA 5GORDOGORDO
221,565,978 *1540380C4673BB0F3C4942C15178479207910BE7 5IGUALARAN
221,565,979 *1546D9343B43338716F66A47C1AD705631721A34 AKOAKAT1
221,565,980 *1546D02302019F0C78DFE6B5967901B69E2E0562 a,kwm
221,565,981 *1540D10545EBDC04BD7829BFB06CCA92A6850B3B al7s:
221,565,982 *154801507D9796C06B3AB17F6E3A92B18D56FF4E 5OILTONGUED
221,565,983 *15426D4FDC0235F8F6255FFDC95745A151F08680 5ONEWUSER
221,565,984 *154054A08AF0D0833E91CCC46DEAADE411B0AAE2 5 SORAT
221,565,985 *154D9B8E23CF33F1B9E75248EC64133B791A6F87 5TALLDOG
221,565,986 *15443EFD1714889EA8E96054E287DC1C2FC2ED26 5TILKJENNEGAV
221,565,987 *154EBC7499880D0EC64AD4C2F001A6B92846F2F7 5TOBYSMITHS
221,565,988 *154521165DEC7C8896A18B417FA8DB5432F1E44A ALKOVTH5
221,565,989 *15456381CD5628384FE3874A6369EC582107799A 630670 nur war der ort falsch gewaehlt
221,565,990 *15433E316FBCF7A239DA40EF69FC4DC73D689795 ALLDEBTS
221,565,991 *15481AB89280B8A8046E805877D700B4D30B826B ALLMYRELATIONS
221,565,992 *1544912F305FB44BD48D721A1E15E88A32214C39 6BONDERMANS
221,565,993 *15416DACF8BBE732CBE7B54C6336B1A34BADE09E AL?XA
221,565,994 *154FC7410E19D809310FA72D8E62B8BF458BA389 6FIVEMAST
221,565,995 *15449ED00649F754E9ABA728B886C51C177E93A7 AMINUDDINMOHAMAD
221,565,996 *154C4DDD5607956809EDB9F0CBDD1C3F0203069B 6HRFYTQIFCNIC
221,565,997 *154D5D79576889FFBFAC02E0C8C3683D201EA998 6ILOVEYUKON0
221,565,998 *1543D02EC540CBF6D395E4E66E2B402103E3C515 AM=W:
221,565,999 *1549ABD14875B48D291AD8CC29A540366B2DD5E9 ANDALEUX2
221,566,000 *1542F6B84379C12F6D294C8B8EB2381A555E79D0 andreslooper
221,566,001 *1548F337E8CA397CD93099EB6CA6FA318D7A57E5 ANFBD
221,566,002 *1549D1FB68FF755A49ECED9CC5FD8182F302A4F7 6YQFIZHNPCB
221,566,003 *154E786EC722C06436053F1DD61B196E2367F6B4 6ZCVWVLH
221,566,004 *1544F3F2984D3ED6AB74F10E17F557C9CEED5386 6ZEINNOTRAC
221,566,005 *15471B3D49B8B1C58B3A50F140C16F7C00692D22 6ZERSCHRAMMTEN
221,566,006 *154711F44CE637C8D5485DFA3C6D0A9414FCEF45 [email protected]
221,566,007 *1545C51C9CE7FC8B401D79FBDCF40C54CD47D8CE A&OM2
221,566,008 *15485E4895B1F11524D575DC09198B20399620B5 AP88R
221,566,009 *15411C8027C19DC83D70D86873B10633C7118E12 [email protected]
221,566,010 *15436D1B8B6957B2CB9B2D6855FE9DFB9839DF9C 7BSWBRANNENBSW
221,566,011 *1540C686DAC8FF4117F9C937E99AF853F2567432 APR^ICHCHHAN.H
221,566,012 *154B6D11C4B102FF176085D29EF0656BFD616F24 7ENGRAVIDAVA
221,566,013 *15423BD0133E982832CE0EEE33E8E57E0AC2012D 7ESQUECIDAS
221,566,014 *1540F57DFE252185091FC1B0FBA736371B05DF79 ard77
221,566,015 *15417E9EC91C20B43E6E82875398EEF8E7D51427 7MCARTRIDGE
221,566,016 *1543E8F4ECEA61DFE86DB251052D654679E696B0 7MULTI-FUNCTIONAL
221,566,017 *154139CCC667938E4B5BB3B1861AAF3D877718A3 7PERRYMOOCOW
221,566,018 *1544796B61127A1A5903AE61F3DC46E17892F6AF artworks
221,566,019 *154CA8F38E4BBFE0DC0A5EB2A8170AE407F57053 7STITCKINGE
221,566,020 *154600AE82D1A50F2D1BE871F2611847063AFF50 7SUOLAHPECORETEH
221,566,021 *1547621CB52B12A7F612C0289ABA821734C157C3 7TENALUCIRRUCDAMSENIPPILIHPCADCADNOIRAM
221,566,022 *154187BF53D4BEBF42A7984F48BC08A68D144949 asgi
221,566,023 *1548DB3A25D1709FF886C48E322EEA13B62DED81 7UOYZIEK
221,566,024 *154AADD08BE72B78B46D764182A83964D77043F4 ASIDZ
221,566,025 *154683B9F3B16B5362237D05A8B4EF55DFCF938B [email protected]
221,566,026 *15474B880890BFC05978B75FC8251B330D98A522 a trip in your ego
221,566,027 *15456CE805E380D2DBA7FF8FCF5E73DEE1FC57A7 850382a82cd447759687f79578d2932d
221,566,028 *1545562042A70843BDAD755D43DA6AEE672B3206 austenhyde
221,566,029 *15490879EE20209327A9A588D90BF459600275E7 a,:v+
221,566,030 *1549825593EBDD3C395306AAF58718BFD00B9104 AWARDSADVANCED
221,566,031 *1546935FFF5E9E4DDC95936A77AA0BD36FBEBE81 awdrgqazwsxedcrfvtgbyhnujm
221,566,032 *15429FAEDA5D48729C7B9320E3B6D7E2BFB38EE5 AXb&
221,566,033 *154C774CED2EBA25E0AC387602576E3ED2347B8B b3m6i
221,566,034 *154F52DF880E00F57ACB2E977B428CB0D88D1DAA BABILNICO
221,566,035 *154A3C8C7C5B69A947DEC0CC0267C7C01172E8CA ba:ht
221,566,036 *1546506474C102AB01BD1F6354D82F643C6F18E3 balh
221,566,037 *15411AAEED78C7FFD12DC0AF5F67EAF92EC4DAE3 988227 TOISENTARJOUKSENSUUNNITELMATEIV
221,566,038 *154CAA8F48D216F2B880C65E6F47F0414F51DAA4 9ASOCIRALE
221,566,039 *154EB9FDF9D78B834E75F91CF379EE22F51C3C3D 9ASTHMASY
221,566,040 *154E5473797D99B256B62545D6E0A4F9C8157261 9-basitliGi
221,566,041 *1549C61202C57C7F6A38AA2D103456E5CD1FFE9F 9CHARITYRETARD
221,566,042 *1540DB1E0C79A0D0A581C445364913111F5F29D4 9CUTENESSES
221,566,043 *154B0A41CDAE0810A4CD090161C3C3498304F44A BCLCV
221,566,044 *154E2E3E3F022FFAB89AA3112395CF854ADB4974 9ISOLARIA
221,566,045 *154E2B7728574AEF5CC304435935FED597563F37 B======D`O->-<
221,566,046 *154CA5FF16D19B5A96763A60A12454A47939E65B be57rdng
221,566,047 *154C6E671CFB4F49BE0E467F4539833BA9409354 j
221,566,048 *154F79680AD0B9BCEA3367966BAD2C2E1A7B3F4C
221,566,049 *1544FF4CE2B04DA16393DE0419CE876178715908 k
221,566,050 *154A3BB78DF3E2B1338C34AF4A8859D5230DB776 ٘
221,566,051 *1549B5D5EFE79C71E819CB47345826EC20807613 9POETSKE
221,566,052 *154FB9AB0323122B2CE61945A6D77E8C206A54CD <g,
221,566,053 *15485536C17EAFF87C7842827459DAFA08306B2C
221,566,054 *1543DC2AC98E64989F494426C5941C436DF4FE8F
221,566,055 *15491797A61088AE0C94E471BFC9E292813C7985
221,566,056 *1547F78322FA6A518DD738AF4DCFC2F3404C3592
221,566,057 *15496EF5ACD88B7B1A01AAF3C1812DAAF4F1C31A _
221,566,058 *154899B75F1BB880D7E904162B4FA7AD6DEA771D X
221,566,059 *1549F12B3DA9B726632C62AF5DDFC11635BCAB3E a+||
221,566,060 *154C973EDD426BE2736291F45E8F3B829B4483AA a1s!:
221,566,061 *1549DCEF23660D832A52DCEC3721C87DA6701433 [email protected]
221,566,062 *1547BDCCE604B2768483C1D3658F8AD076A817FA
221,566,063 *154BAAD1E88174E0E3A6F3A74FAA540B4F9C2C2D a4?7
221,566,064 *15442FF24207BC8EE583A2D290F4D9B89CA691E7 a-6s3
221,566,065 *154A55E47C334A759BB59BB39AAA4B9B3C12D87E w
221,566,066 *154CCF097B5DBF8B1010655E2B6C414C6B3A6770 A9313$$N3$$
221,566,067 *154927A8B3E3204120C8E8EA1B674718969B221B A96449
221,566,068 *1548717739E3467D8C459904D2EE89EEEDFDD5DB
221,566,069 *154351A90D2EB44096F63C717AB5D8B4CE286BF9 z>
221,566,070 *1541B0FFA5561A8E14BB7E05EBF5DEC73822602F [nѩb
221,566,071 *1546D35315E779962991D12592585F3F73ADF459
221,566,072 *154B59150BF2191A7D42CD2A8AFB10FB979EFC67
221,566,073 *154105AFB1FCD8E5742A795CF71828EA2D0ECB98
221,566,074 *1549867EE9FC5C99CA418A7B44BBDBE0D2336BB4 aabu4^
221,566,075 *154DA16A960650F818EB7BBDD22D4478DE3D9385 AAC$9N
221,566,076 *154F1F21CA94EFE916C8CB23F9C0C3898B5A30E5
221,566,077 *154FB9D280E8EA6483B697956431C6BB73656F99
221,566,078 *15418F5E53889DEB27EF07C9388901EB64C8D3AF
221,566,079 *15483AAC59A753FFDFA7E01446551D49C3261785 aadqx[
221,566,080 *15486E3E488A445AC28C532573AC273647F778DF AAE%
221,566,081 *1543BE56CBFAF4F8E36B8092C7FB63521FBDDFBE 
221,566,082 *1542FC067B74743203938D46CBE0B6554E1A26D2
221,566,083 *1540A9D4157745C1E740BEE3B1464F744A9596DD
221,566,084 *1545CF9546FE0B80C4FAEDE066F1DE87A4A2CB7C J
221,566,085 *15434AC515AD190B3B66299B3965F6D316ABE861
221,566,086 *154101F9F5A2CE0A99DB40B60B6B4DB0B4F0CC93 n
221,566,087 *1545C413C3BC202FA2096F8AD53BD369334F5D88
221,566,088 *154A72FEA252811B11F97CE67F77722FBCE7CF04 aae\nj
221,566,089 *154C8D56900804D17D3B249B130BDB4D0B9F6134 ABB0H
221,566,090 *154C2A74003B95E2E281EC35AC34F7AA4B25E864 ABELAPILIO
221,566,091 *1542BFB0FB970D1F305A30A76CE83EFE5EBFACDC ABHISHEKMUDGIL
221,566,092 *1542C7CC8A223B8E1C0FB5D5F13BAE8C30CF420A abigail.casey
221,566,093 *1542F1C6E840A3A0B7053EC376608C550A7BD9D0 ABJEG
221,566,094 *154737C4603BC67F51C688EFC7C326F588389212 ABNTZEND7
221,566,095 *1543B472232A474F0DA2C3A6A7EDDC6051CED28F ACCESSRAMP
221,566,096 *1541605CDAD3A753D2B6F5A497BDDF89358967D8 H$3SB:
221,566,097 *15479DBF3828E6A89FA2E8786C90755E3A4A8031 g^ݜ
221,566,098 *154D2EB6C18179E336316943278D2EA9AA4F84AA
221,566,099 *154744ED644062BD49C87F6B93F73DDDFCB5BA9D ADA098
221,566,100 *154239480B59C149F7C673055D8EB06A5F0C9893 ADANYANAGIHARA
221,566,101 *154F046F2063FE1ADD92E0C794393726BDEE59CF ADDFLO
221,566,102 *1540A1616D44762FD2EC4B2A02605463970CA824 xm
221,566,103 *1547C5E081C3EB29F79C3FC3185C0CB59969BB75 $cC
221,566,104 *154388E76AE553663BF87BCFD8F0025B9295F9D7 adg5p
221,566,105 *154C15B0DB80ADF913B78C7127A6E4DF1DBA1F7A X
221,566,106 *154125082757938B114E6E211B188AF471CA8A3A
221,566,107 *154D42CC0AEF69A752F9C5080FC5BB7535EB3C37 \/kV
221,566,108 *154755879A2077085CDEBCDF5DB44B052BCF3784 <
221,566,109 *1545094BB565CFF76B0B77DF4F9F011512E959D8
221,566,110 *15447EB1EC856DAAC6A6A639C269F17A862E081E AF1CI
221,566,111 *1543C28F2B7A5A9A6101F5F38188459DA81D861D AFC50
221,566,112 *154D804DB5FBD6B7DA8C18C686DA3CE877DCFAE8 1JARRADA
221,566,113 *154497D0F838B09BE67DD7A1DBB71C84523868B5 aksens3
221,566,114 *154844D8D30A273CE73E5C11589E16EC042FD743 aldobuff
221,566,115 *154C27C1A4ADEA35920FEFB7E210341D1AB23538 1YTROF
221,566,116 *154FE65584A91597392FCA16999E9CEFBE57F454 2185430 rudi.voeller.-.das.haben.wir.nicht.gewollt.
221,566,117 *15468A4E8A3D240911B81822DF7240E7D6F848DC 24.03.1764
221,566,118 *1545048336E2BB7536A6C0396176FD507348EF91 2458erfolgt
221,566,119 *15458188BC72D4F365BD7AAEF4C18BF889470DE0 2601387 lasikleikkauksessa j
221,566,120 *1546142857DE7B0B6714D15B9B0A021E78210E9D ALPHONSESINNETT
221,566,121 *1543F7AFB2245A926C4D0EF4091139AD842963C6 alr2r
221,566,122 *1546B62DC25BDCFF4E4726A40C6B71E912B1667A 2-texaco-icahn
221,566,123 *1547D2A582393DFE177E9BC23F2BBB734BE0F0D9 A-mucca
221,566,124 *154C91A5925CF6DA902B17A280211676C4CA3EE2 3 ASCERBIC
221,566,125 *15429B2C707B3A603EFBB0B50B41E248B273DF51 3MYTROMBONE
221,566,126 *154698E32E62BAE9A6630ADA936DC8B6A24C4AFF [email protected]
221,566,127 *154BA75E17227B03665139FB6D647650E0783A67 3NTCHRCH
221,566,128 *1547D2B94CA49C694C4227E43BACF578A4F06271 3->SPLAT!
221,566,129 *154FEF105CB287CD9576ABAE2AED63F7132FB284 AOQUEVAINASCER
221,566,130 *15419A9F228E0B02408348B2DF70ACD10C0BCA1E 5DOUBLERONS
221,566,131 *154AF8FE0E78988102EA9DB25CC56CDA76986C83 5IGUALARAN
221,566,132 *15443CF92D874612D3F9885C02DB13A74E0B4AF3 5KRYSTALBOZO
221,566,133 *15410FABBBBA1D6BF58BA51870835D18C228B6E0 5OILTONGUED
221,566,134 *154F234C677F6C5585E49CDF5BD621BEE9C15AFF ARNULFO.CAPRA
221,566,135 *154B01A726DE91243E35E4A3A57CE65DA2BB0361 ARNULFOTAULMAN
221,566,136 *1548C1D42A5AA4DF632ACB4B4F2D2A514526233C ar?r
221,566,137 *154D68E75240E4335774A9D8762260C2FABBAFB4 5 SORAT
221,566,138 *154A175616ACB7612989DFE56428E121FA66014E 6BONDERMANS
221,566,139 *154F3E87CDBBD33590DC8A29F88C6E98622B8469 asi93
221,566,140 *1548A303844BE9C91F237A260345995C5C216C7A as"wb
221,566,141 *154E1295CB27E3A0EE95CA461C3B721DB448036C 7AMPASIMENITES
221,566,142 *154BB7DE1DB9EA359DC127F913265ED3ECB8A003 7BSWWEDNESDAUBSW
221,566,143 *154B35FA6D233B00CE12037187097B0669197234 7jumellera
221,566,144 *154FD058FD58ED4B261FEF975F444D6F3EEDA6C8 b,ar)
221,566,145 *154B141A286AF80774659CE3E13B490E87B0A9C8 BARRETT.BUCH
221,566,146 *154137D97DFC720BC33B39158B584243F19254FA BARTON.BEVILL
221,566,147 *15485C5D8B780EAFB2A17254D72B0DA83EC1439F 8RELANDSSTYRED
221,566,148 *154A31F56DC5B9298002F5C514922C8EB8118873 benjaminabbate
221,566,149 *154939A99921D3008E808A529C36DB314F321A37 BENNETT.ESMAY
221,566,150 *154DE46CEE9705EA65C311E6F5BEACCDE9B48C80 9LOUISEBOOBOO
221,566,151 *154031DE0D3FAD484511C50DBAFB7C65FCD5BDA3 a4?7
221,566,152 *154F92C8F492561D9757DFBFAFF95CE97D76DBB7 bi.uv
221,566,153 *1542E0A822F2C6D273793DBE6138CABFC9EEEE0F AAE%
221,566,154 *15461C76514EA8C31FDA300C5C16A7CF6917FB37 ABB0H
221,566,155 *154278F8E9BB6C21255C35C209C584A735E44D32 ABNTZEND7
221,566,156 *1548167798D220FB82704BEDB2DE5B5E4A347281 ABRAMOTANO
221,566,157 *154FFB4B10B7C7A04CCC731EB9C849B430B5C404 bqph
221,566,158 *154C7987C275F1BD61AEE6C9D443DACDF831DED6 brandstreifen
221,566,159 *154CE0C8FD486742227C5BE27BAA93DCCC04083F BRENDORA
221,566,160 *1549526DA644FD6DEB55A0074DE77193CE6E46F7 BRIANBRANKER
221,566,161 *154BA15978080B7A55726709A44F0BBE5D635A82 bricepandya
221,566,162 *15406733ADFD2BC7D7AE77C00BE80B1842FFD13E BRITTWOLNER
221,566,163 *1548A8FDDCF6323D91480A5CD26DD30EA3383B15 aguf1
221,566,164 *1546F3581D36F6935E2E87F08B15E01B796A0D32 akcvx
221,566,165 *154CA499971F4600FDCBFBF122B298F4B15BFC7B amaroirym3
221,566,166 *154F4D00F0EDE359B6FA51E76CE64484F6466CF0 ANGELO.ROGALSKI
221,566,167 *15443813295E1595410CBB0E977BFF70D0E5FC7D caleblever
221,566,168 *154B685D08BBDDD4EDC007DD9A34CD174285DA8B a$obs
221,566,169 *154D082991CB0369F0179A950DB39BC7E37A8669 c%e!k
221,566,170 *154049B93E99CCB0D575586C9E6DABB8B17F8E6D chadfarahkhan
221,566,171 *1547E5865535A19EC301C59BB66759E0B40043C1 b002i4h4lo
221,566,172 *154B5000DB545D963178C2E8407A7AA696D33BFC b2b6e
221,566,173 *154F433338BB2F8495EFC1D03B0F1BDD735821E3 CHASE.FRYAR
221,566,174 *154596133D815FE9769A7D5E5DF70C2533611144 B6$Z
221,566,175 *15416B1023872D0759D85A94396320EFFDB2B281 CHLOE-THAI
221,566,176 *154E1CBA72F5336C67F95D4C25CBD45A0647CB9F [email protected]!on5
221,566,177 *15410659F65D32A1C3080F36EA7D588BF4DE267F CHRIS SAVILLE
221,566,178 *15496EF34AA5B8BEE145899214B8A21C70737A76 BALLAD(FORMYLOVE)
221,566,179 *1549A88AC65B850AAB529A9BB0531861F02EA4FD citadellesiin
221,566,180 *154B7C1E597D38DF3DF8BA7C0945C012B0A7C7DE CJIZ"
221,566,181 *154C62CF9FF03117FEC4B2BA13E8478465D56949 be!6q
221,566,182 *154D28E25ABF8A702DD8377F7AB6A5C91DD7AF50 clevelandmahoe
221,566,183 *154896533546FE90A0AFE427815B5D4060E7E731 BELACHELIJKE
221,566,184 *154D11BA224329C175592EDDB0A2D0230CDB90DF COFFINS-OF-THE-UNEMBALMED-DEAD
221,566,185 *154ADCCA4B0C5FCD257CCE087CA3CE3E435E466E BITCHCHIP2
221,566,186 *154BAA18AAA4F2908A8084A45E6072611872D15A BLUEMERMAIDS
221,566,187 *154183E46FF1E88711B8AB4698BD2132132A9101 boekenschrijver!
221,566,188 *1541F66FD12F50B5B0EE67969E79E92E9644DB0A c)q!)
221,566,189 *154C4C3309B4CE35EB29C58DA22EF5237C3CC02B curtbo
221,566,190 *154749A590657052254AF1905F5C027A3D09523F d1ie3
221,566,191 *154739D45E571E5681E5B54CA85F7B81482A1EAB d(6b
221,566,192 *1540FEB42B32E55F5385569F104FE2F94D3A74C7 [email protected]
221,566,193 *1549A098E927B53EA887660C42F35BAC3564A5BA C9XFM
221,566,194 *1547454ECF2B5AEE167A4B1F3E1193F1C0A97427 CALEBFELICIANO
221,566,195 *1545F6AFF77FBBFD2C2239B6CE2B48E21B3E3FB3 DANNY-FULGENCIO
221,566,196 *154A001F4EA81E8C344FFC3FC1BAF2797D5171A7 D%AQX
221,566,197 *154DF2CC18338C46F8A8E5B465FD3E7C9C2D188B CAPETANO7
221,566,198 *1541157D2A03C0B1CEAF847AD21F1ADD8E71F919 DASC
221,566,199 *1541C32DAC54E65647AEC524A8659400FE958FE6 DAVECRYER
221,566,200 *1541F3AF3A260F7FD3F5FF2580B95FAD32B2C983 david-rispoli
221,566,201 *154E0417A82B847C04487BC61E0F68381551261D d!ay,
221,566,202 *15424CF77F18EA35E38F787A23FDEAA142268653 cev96
221,566,203 *1544E3BB9F982C4BB4B2D6D79770D7C334C78934 DEMO1832
221,566,204 *1548E77C6F772422C4ED4A0E4912D78582E57B8B CHASAENS
221,566,205 *154776AB29C0920FC28B4EA19C29011DED31806A DEVANSHI-PATHAK
221,566,206 *15406CB4B0E20CD16D868A159159E850995A0485 CHIENMINGWANG
221,566,207 *154ABA835571BF7180DEA17F14281506CF1041AF dh?ms
221,566,208 *154EEFBB5D40D7ED0D122B26F490F61F69E22BAB citadellesiin
221,566,209 *1543405A1531E447593F59B9734501946B47BD67 CK,OP129NO2
221,566,210 *1549D570BC498926CBC7840CB2DBE18AA2FEB12C [email protected]
221,566,211 *154D24722AB69F565F7CC2492AAF3196583BCA07 DISPERSIONERNAS
221,566,212 *1544A404E57C2B189E0210C0D524294A89B3773A CONRADPURRINGTON
221,566,213 *154E3E52730CF1D6B37A838FEA19DB87669EDB93 donald.phelps
221,566,214 *154DFE2D7C035A7BAD7886C0B563B827FAA4720D c:\program.files\microsoft.visual.studio.9.0\smartdevices\sdk\smartphone2003\include\obexserver.h
221,566,215 *154E971D5C8F8DBFFDFC2CECE3C9AE520A99B534 [email protected]
221,566,216 *1543ADD370267AB0E4A99436FD1CF287DA08A16A DOUPETI1
221,566,217 *154697746ADC622CCEB9DE7D3713CC8700413FD2 CtQg
221,566,218 *15447F293E1614F3F5072B4310D0A6FADFACC421 D3CON935T4NT5
221,566,219 *154494A303E77E0A3A0A4065B652A3907A41F19A darrenapuzzo
221,566,220 *1549A4D530EEBFC3E53C26943DA8BE79892F93F4 DASC
221,566,221 *1549D22EEACC9CB2B098053D96C6C4CC0D46772A DY"SV
221,566,222 *1546DB48BD9849C54253A41CCB04DD606FF689D6 d+znc
221,566,223 *1542CB749CC2138B6AE93F75B2BB393F72649082 desuagtet2
221,566,224 *1547E8CE951169754FEDFC35860E3138638533F9 DEVANSHI-PATHAK
221,566,225 *154D54EEC4E6B0835A475D34E300EA1EA2502940 [email protected]
221,566,226 *1547630DCDEC9758629688208B8724A9DBA4A8F9 eleodoro5
221,566,227 *1545202E4083B92CF2200D56A9B108679521782A DIAGNO53
221,566,228 *1549ED885ED4AA866ED2BA835CEF14ABC9A9AE58 DISPERSIONERNAS
221,566,229 *15458F2CF501A6BA33D06D60DEEC9380110BD289 divulgati.
221,566,230 *1542AF59D9C52613D678DB2E0B1177949B615077 emorytadeo
221,566,231 *154DCD5952910D1C5F7FD861526E32BD6E421C4E EMPARER
221,566,232 *154C0B091E7E31DD772CA57772AF484C88E6A426 DREAM-OF-RECLAIMING-SAILING-RECORD-FALLS-TO-PIECES
221,566,233 *154BEA8D7B2F453091E273BA2E8F0B34B75239C4 dtml
221,566,234 *154C7E0D04E7C107563AAF2D51B72B3389B3D36B DVDCE
221,566,235 *15423B973A50A24157261B84D565056E71E699F2 DVTG(
221,566,236 *154F8441A71724FFAC5188B622A01CD1E1681C44 etualkeg0
221,566,237 *154BE2A0C74962FD044596167B08B6337E418F0A DWIGHTSUMARAN
221,566,238 *1547EEA2A6A4DE36D8C15FA21101478A33798CE4 EUK
221,566,239 *154D6131F3015FB38EFEA9BC4A58421371DB6252 dy_.b
221,566,240 *1548084D85288A8BD67E7EBEC5CA6CA76328004C [email protected]
221,566,241 *1544640F209F0C8FF6B7E329B6A35A1C1CB2FC1A EFIDICSING
221,566,242 *1548CA6E183571BF41F7EBEF443F4BE92607B011 FIJIANS2
221,566,243 *154AC22CA6E456DDCDD345CA5AF9A5BF0E098B40 ELDON.YEAKLE
221,566,244 *154ED6E26635B4748BFA706D74C0057DF975BE9A forlovar5
221,566,245 *154FF084DCCC4DDB25F3D55E467CC2754F2ECB86 FORRESTBATLLE
221,566,246 *154F2BD9DCB450D65E49C5CD83582D8A3C2A13C6 emiliebruce
221,566,247 *154955521FB4A4BEA5136EF1EA7F2152EFC8236B FREEMANBASORE
221,566,248 *1542FFDD849D4E409E2190B514EDD608BD746CF8 freeze.our.stares
221,566,249 *154B606D463460F36F2A2AE8801F4B6151177177 EPBQQ
221,566,250 *1546EE05496B963D5266E1DEFE323787D048D672 ERIKAMAMITALINDA
221,566,251 *154B14556BE1514A3A6648CA19C785EB77B3EF09 gastonpennacchio
221,566,252 *1544910039A6A43E31F5088F420F259FFC97C758 escamoteraient
221,566,253 *154996D29D98718B91C6E698B41BF19BE9AD875F eternallove(shortversion)
221,566,254 *154552C1C8EBFDFC43E39CAB5DDBA05DE874C7CD eugenioshami
221,566,255 *1542290F3F8364DC615B9B09A9AA79BF4926C9F9 [email protected]
221,566,256 *1540D8FF5E7F3ABCC6723487B257B70EF60FE637 G4$P14$M4
221,566,257 *1544D28E49CBA1A8D52727E99F3D6DFF970DD0E1 GANDHI.IM.FASCHING
221,566,258 *1545EAB3FA1EFA4EACCA3FBAB0F02DF72BE7B8AF HAYDEN.KOTTERNA
221,566,259 *154683C285A81F317D775AD0BA45DC857C72FA7A HAYDENLANDFAIR
221,566,260 *154B55C04907EB1E585F6FDFA0FFED1576B65950 hayeshvar
221,566,261 *1548F08F1D8C509F0BCD0F584DB9733CB22FAA71 [email protected]
221,566,262 *154AA51A98672EAB0E4ED8A8365B9D6E18935102 HEK
221,566,263 *154CB6A6EB87085987ACAC63E586DA414B08D588 GO1DEN-HU
221,566,264 *15496A78B537F1D2B3CF343421C6C92C67B7A3A8 hitchhiker'sguidetothegalaxy213
221,566,265 *154F9A00E438B3612369D4DDC6AC1E7B24EB7BB0 grinder
221,566,266 *1542E6898FFCDCE5C17E3F75C338C3B29D1A1A24 HTEGRUOCING
221,566,267 *154149F168D9C247D036EA3E2AE6E437C64F0FB1 heather-kinder
221,566,268 *154873DB8439910106EAC498333E29364CF24944 HEK
221,566,269 *154F1B977F7115E43437CE206B032750B9C3D64C Humorer
221,566,270 *15414F8677563DFBE2C2AFD2B58DCA74F2E5E015 HR"'
221,566,271 *154538ABBC0E216EEF350333AD9CB41299C1AD7A INeverTalktoStrangers(featDanAbsentee)
221,566,272 *154CEEB31203E9F0A073DE88AF2FA43589AA4541 ILLYES7
221,566,273 *1543FCF3E1883F3ECA71B3C643EA0F4E0524B075 isiahdinwiddie
221,566,274 *1541C75AA22AD860A49297D8FA1721FD24587F08 imeldasantiago
221,566,275 *1546B0386898B95FCBB8902B97CA0922635E881F JACKIE.SALIZZONI
221,566,276 *15407F5EC30F8B077D591AA7C6D63EF1719388C9 #
221,566,277 *15451EF2BDC3B12B1CA616B554210D76E3AB91E4 IONE1234
221,566,278 *1549B51E631AF6F3766E5DD76C0EF2857778FED8 
221,566,279 *15461901F0925AE9035BF9202F5A649F1460B82E )q
221,566,280 *15414A95B7F2248A87BE2AA60B69FBC14D47DE81 ISAAC.MAYORGA
221,566,281 *154F97B0BA09295A3B1360EB7615352211B2586B ?
221,566,282 *1546C0F8923E686DB7C2CB58E1D97F96E0A8EE05 a
221,566,283 *154DC230AF421C86FA84E1D9EA22C7FF02E314A1 ISHA.SANKOH
221,566,284 *1544195706751C4A672FD2C0D4C00FCD2E38120F
221,566,285 *1541A318F00F68D07869837F98BB910C45854DDB iufcnpsx33
221,566,286 *154F287A21DCFE77CF0BB1EE0388A4A40FCE2641
221,566,287 *15479895DA5C002EF274FBD5E5EA8525D49E9B24 4
221,566,288 *1549197E579B0442EFCA2183EAA6CD98AEFA8C81 JACKIE.HENDERLIGHT
221,566,289 *1541BDA412F798980D040D7C0259F8FC68E8B042
221,566,290 *15481188DCF251144FD11F352FCF0D07645F3B03 #
221,566,291 *15484D35B88E3E5B18243D8F5143B44AE4EBF5F5
221,566,292 *154BDED04644E58F84176607615EEEA9047E5399 ?
221,566,293 *154FFB733A5EE873E059AF7ED7C18035A85FF1AB rB
221,566,294 *154A9F23FB67E3C780C324CE3D80E9CC98A2CF9B O
221,566,295 *154AAB016D05CE06EC1BF82CC24F5CE19C6FC0BD Ārt
221,566,296 *154A914F03BE3CD07BB3249C552ADC245607F5AC
221,566,297 *15453813C06166369591C889AE4B421D37EADD7D 4
221,566,298 *154447C5FAA1E32745645C62D2C4EFA55774BA49 w|m
221,566,299 *154138856C7F256EA6B4A6FD11C3A667ABE80F2D ?
221,566,300 *154FB7CDB3D9E84A2E1FB0CE590018822B2CB2A0 ĩn
221,566,301 *1548E2B98166424D8637F181E65E60D6529178FB
221,566,302 *15413AD12688450ED792783A5A0F7BCD3B038E22 
221,566,303 *154E272C85A7F5DD969FA058603A8A0BE68E8CCC
221,566,304 *1540F95810983EDB3F5968B746C2DCA365FAAEC6 \sf 
221,566,305 *1549B3D3D61CF2CBE30C74E2FD9368606E04A8D4
221,566,306 *1547454EDF14ADFD2A735CC3E12564A005F48B40 *
221,566,307 *154E1EFF794E9B58AB3C626CBFFF3961F635817B 08-apr-1996
221,566,308 *1540EF93C8B8D81FF3DED99CCE9AC04FA27358C6 04.01.1865
221,566,309 *15412DEDEE0A4743D3B1E94AC8291790E2962126 (>_0)*-*-*D####8
221,566,310 *154C4A1FFED0F24F9C43FD4769034E3D91EF9608 0D91E61CA96B3BEF9FE05CC9139E1D89
221,566,311 *154323C9C7326F1FEE097C892A51909934C3BF82 0FFFC65E68B73887AF5BB90513273447
221,566,312 *15457C0AAC309183D540CBB49B014A4706A1E1D8 05241455
221,566,313 *154789D8973E509E6AD3BFB86911040B3B3B7305 0MYTRUMAN5
221,566,314 *154B493F242B73A500E5C0810DAB4F8425EC123A 13031143
221,566,315 *154EA3E7E9064DE306B0A792F7F221B6F35AB59A 1341416 ME-OSTAMME-SIKAA-JA-NAUTAA-HK-RUOKATALOLLE-
221,566,316 *1541D1AB9450DAFE205E729434C374D416354749 1437 SLOWING
221,566,317 *1549B6C555E248B1748C09BB8FDCCF302655B85E 145540 PALVELU.SIS
221,566,318 *15402C3626D7A11886E640D52E3FA7768270D623 14 FERN
221,566,319 *154F21109930B3AF2D1C317B9EE846127B4334C3 14.05.1518
221,566,320 *154FE9D08A2A799A44804189A9CB6E02AC478446 1695712 EDUNVALVONTA-,-HOIDONSEURANTA-SEK
221,566,321 *154FB6DB4D6196238E4FF033255E1031F86F95E3 1735849 DIE LAGE IST ABER NICHT AUSSICHTSLOS .
221,566,322 *1541CCAEFF41C69F552941DEB4C10A4139F41D1D 1.BETREIBERWETTBEWERB
221,566,323 *1548A94A2ED2DC15A2DCE696540E6CC7D7100C80 1-CHERUBIC-LOOKING
221,566,324 *154B209A935E1AD642E3AD64AAD02D4E130902F9 1-combray
221,566,325 *1546B2E7C86A9762A6E43FB527B6E612CBD02DE6 1-COSGROVE
221,566,326 *154CC4A4AF9AB868C392A838F5FFFAA13E940D36 1 EUROPAFILIALLEITER
221,566,327 *154B6324B8E9606BCA91F2691B3B6C6E7744FA30 1FIGULINE
221,566,328 *1541EA318474CB035620B716039CE28D4CD71B87 1-IBANS
221,566,329 *154DE75348EA62963A788968B2228B50B8C693EE 1iluvbarry7
221,566,330 *15495A2ABF29FBC680740053723C6E8DD449FC1D 1 kerbside
221,566,331 *15491CB55E44EA6614933A858DEFBC4F3ABDF336 1BOIKOTOINEEN
221,566,332 *1543364895BE14A9D7900DD7CBBDCF045953F0C2 1-einfamilien-holzhaus
221,566,333 *154F36171C9477F047DC3111A39AEE21FD27B7D1 1MAG15M
221,566,334 *15442E4B546241E0DC03AD5FF4CFAA07C2A19DC9 1.OzeleStiriyi
221,566,335 *154E43EDBA8B49411558C60AF83BD77649B861DA 1-heyse
221,566,336 *15446AE1C49F91EF590742154A431F1F53A67A3B 1-provokatOrsUn
221,566,337 *154AF1F48919415F7DE91F031BE582BE65ED46D4 1-HIPOVAKSI
221,566,338 *154A9AA20512231A032A1AE9BB4179F0C65C0539 1HOLZLEDERLENKRAD
221,566,339 *154BF58BA80C85D780586DE0091840AB2833E439 1-IHMISENKALTAINEN
221,566,340 *154EC43032ABBFCD422AD7FE5B11F0A2143D42B0 1 reumal
221,566,341 *154976B58F15B1E64FC7095777DB0E1015B76794 1 schachabteilung
221,566,342 *15450ED21794918874A64AFFFA2A5F7FF7CC0C9D 1kalaliikkeit
221,566,343 *15425B3D61A7713FB8194F95D170A65DCB7EB2D9 1KOENIGSSEERS
221,566,344 *154CF7CD4EEF691961A688022FB5B6DCE96058C1 1.SPD-BUNDESPOLITIKER
221,566,345 *1542FB8E11AEAA94001ED58650FFE106CFAC20E7 1-synnytyspelon
221,566,346 *154A1A6B63CD6865620A04B04CFC5C4A811F99D4 1.teamstersgewerkschaft
221,566,347 *1547498CD8D5DB00308DF0DD0EC44A5C142D5F6C 1THEWILLY9
221,566,348 *154632567647BDAF9E60CFAA064E40521C3EAF04 1-TUTKIMUSTIETUEEN
221,566,349 *154E5B2E4579226037A4B2924D4E8BC93176A650 1.vhfkanava
221,566,350 *15480A750C1BC02088EF4E1A06B512C002AF6E91 1.virtaakin
221,566,351 *154D467BF3D107C2266D96EF03C45DD906CC7517 1.ordenskanzlei
221,566,352 *1549A3DC33A3C60E01604287DCDB2D4F56670819 1.orgelrausch
221,566,353 *15462E54B0E56E7232995BAF067D5A6C86B3C900 1 POLIOTWISTED
221,566,354 *154D1CE32CD505A263147FBF9719823EF386E7AA 1rentrent
221,566,355 *154F59A2F0046E9ABAB7C4E8D8E64E9DAC045E86 1.serendipity-park
221,566,356 *1545FD430F25611ADBE39AD2F12CD532528A9D71 2204365 hurdannouncedthatthecabinetwasunited
221,566,357 *1540CD8340C4E2925F044E12F3FCCE2BD1E70941 2213739 OSA OPETUKSESTA ON VIERASKIELIST
221,566,358 *1545BFB65F9473FDA8EB60CA7C22BCF91454DD5A 1-talents-country
221,566,359 *154D92F8528EE833F052576898386A81B91DEE21 1-TESTOSTERONIS
221,566,360 *154361658D31B52881DCC3A04F30A014BB52E225 1TOCZYLO
221,566,361 *154E7D99D4FFFC9B9C4854C97755EA056A4922D5 1 uscauburn
221,566,362 *15444E5E6E6A53EA4179F8B051398E4B46E25B4D 1-VILLILINTUJEN
221,566,363 *154AD9764777042FE9AC8AED494A2BE09D180F06 1yliopistolaisella
221,566,364 *154E7783B38E311D5C2335587D6E9DF93D0E6BF8 2000-05-27:-Howlin'-Wolf
221,566,365 *154BF0ED2C61AC136265674467D4026ED247B50B 2611145 JETZT-IST-VAN'T-SCHIP-SEIN-ASSISTENT-
221,566,366 *154E60F42E86D1B696C174D914C3CCD114B03D86 2652770 ZWOELF.UND.AELTER.,.DANN.DUERFEN.WIR.SCHIESSEN..
221,566,367 *15424589F14E2CAB82ED58C73884865EA2F875F3 」(2006年、AU携帯WINの無料配信サービス<
221,566,368 *1548E91F812E94758273EB5ED5493BA1AE4CB29A 20TH-CENTURY-GIRL
221,566,369 *15421563FFFAE74874209ADE7E22E5AE95D9FFA9 294B7563A2D395D120599D024144CC91-94NSJ58
221,566,370 *154ADDC7B3F1D106E03DF7D77922A8ACD628E959 2970061A-AB5F-3917-BD4F-7BF2F1815D12
221,566,371 *154D67364FF914F70BB9E97F3CD9F3F71F0565C3 2244068 meerwasser hat einen salzgehalt von rund 38 gramm
221,566,372 *154B1C303CF81691F1626FD9B3BE3C49775BBC03 2393062 LUOVUUTEEN JA YHDESS
221,566,373 *1544CE7475C7A7D8B760D69AB77EED9432D35050 2436482 kilpailusarjojen kolmen kuvan kokonaisuudet saivat yhten
221,566,374 *1547D729C8B64E309D8A7D64961A6EB7F768C7A7 [email protected]
221,566,375 *1544A4AECF26DE6B918C31F44E1B0A526629EDAF 2CAVALCANTIS
221,566,376 *154E575FA4D636B9F065D2C64038374900E68E23 2FAUROTE
221,566,377 *1547C5E842E95F8A8B089CBED4EB79DF78F6B781 2 FOOTSORE
221,566,378 *15438231F7A372748A87590518186C01F2EB9B39 250473 a twopoint reduction drew little interest in tests
221,566,379 *1543A96F800C7EC6DBD66F03093C4B732D18A535 2595423 ja niin markku ilta toisensa j
221,566,380 *154FAFE286BE2DBEAEE0F4D4D4DC69E93AABEA6D 2JAENINE
221,566,381 *154A7E59D95109D74E2CFB4AB4B9C64656F28F4E 2-klemke-schenkung
221,566,382 *154166D08828F7B27925EF4A1547BA306EBCFA9A 2688144 syyllisyyden.tunne.voi.olla.erityisen.kipe
221,566,383 *1541E1126B095A24401D7196C69FACC73C87FF35 2818636 pyht
221,566,384 *154724144FEB772A661B43F5D7F2F477994F269C 29retraces
221,566,385 *15465E478D8C5F2242658E71FBA048A42F122162 2.ROSSVILLE
221,566,386 *1540CF40D7EC709ABBFC7986214484B3AE2D2C54 2teamolympiasieger
221,566,387 *154390D4600D7265EE6B629292F8BB85604BACEB 2BREEDAN
221,566,388 *15469BCA273D606FC68F2DDD0216B9229B75246B 2UTIRIET
221,566,389 *15458B7B14469C13BC0BEE660987AB8926256384 2centrum-warenhaus
221,566,390 *1549F3D069DBAA6BE02B75B52D22A398C251B2E4 2 wellnarrated
221,566,391 *154F1FABC7433A810FA036245C55D3E0F9E6F49B 30OCTOBER1633
221,566,392 *154C4FF26ED327E11E03A561D43790D7B5630A8E 2LABINSKA
221,566,393 *154572AE347BE8E037898215F6515DCF72F7669A 3AHURIRIONS
221,566,394 *15486654097297EEE292A4D5CC3CE1D93F3248B1 3B<--0~(-p
221,566,395 *1542AE35FAED811623A9D82E20BEDE746F4A480C 2.SATH'S
221,566,396 *1545EB3B491EA32FE2D672FDB7622E34DFB79FE0 2TALAO
221,566,397 *154E459AA3FDBA86D82606A5426F8C1787B0A44A 3 ETYLEENIGLYKOLIMYRKYTYKSEN
221,566,398 *1542227DB688FB36D5EAABF2D4B69329B60B8C85 3FEB1248
221,566,399 *15477775366E6A6573949906A2F65C31E425CC9B 2wiedemann
221,566,400 *154E6D785EE12D9B0F3453636CFFE773EA9F0468 3MCTANYA
221,566,401 *154D65FE98964A0E85FD5D3BA88625D92D68108D 39484 DIE.ZEIGT.SICH.VOR.ALLEM.IN.STAEDTISCHEN.PROBLEMGEBIETEN..
221,566,402 *154FB5E10641F66A361CF9471B71342A475D8F0A 3-apnoe
221,566,403 *154E8BBA26A266D939F842CE2876798090405E02 3$CROW1N9
221,566,404 *15488C4C525154D2F5694647CBB0133BF64E7CB9 3theolsen3
221,566,405 *15419FFBBFCAFE3038D6A5DB591EEE82262CB8F5 3ELLIOLIT
221,566,406 *1543536946BE2E53BD9CDA403A1786ABFECD11DD 3 HEIMATPUBLIKUM
221,566,407 *154439DBAA61DB566122032E660A22B5877B61EE 42H26O
221,566,408 *1544E82EA922F4C9935BF0959A15BF1317A48D47 4AGANIPPE
221,566,409 *15476C5FC45D34E3C95E9B30CBC06F28C9F661A0 3---p)x(
221,566,410 *154871BF693F897981CA95975D1FB5A6E465EA64 3thatprint3
221,566,411 *154013544E84631BD6E289B11605E7FACA293767 4OAKLEYS
221,566,412 *15414FA6708D9CCB27ABCA314A157C329B1C1539 4PIGLETCHAPMAN
221,566,413 *154EB608B0E8AE350F7BA1969D430685E9B02169 4SATIRIZINGS
221,566,414 *154A003F77D52C09A2E31B58289F3F1829C06F58 4SENIOROXFORD
221,566,415 *154B4695B176096FE6B0D3CFB47D581E797DAE05 433505 RAHMETLICAHITOKURERHOCAMINCOKBUYUKETKISIOLMUSTUR
221,566,416 *154B5417DF49AE9BF22242A31E7291046E7F5337 47 CONFERENCELEADING
221,566,417 *1546792C934C1139DD55E022C62B56A51EE5E435 4USTIPNAM
221,566,418 *1541565397661076FC38517497F9EAB36C82AA47 4ANAMARS
221,566,419 *154EB2FB7C122F14806A39CEED56BB79BBB75A20 4DISTINCTLY
221,566,420 *154993FAFA93E8D392B0968C7C828E9D285C4F2C 50R17の極太サイズが採用された。「ZX
221,566,421 *1549D6542C41A576D41C6126A4BA8EC29B89803C 512627 GENERAL-OLUR-,-KORGENERAL-OLMAK-ISTER-
221,566,422 *1541351D943C353E0F4326EDF7FB05C7686DAA33 518WallMart
221,566,423 *1545C497489E4975630184634DD6CB53FFB4E30D [email protected]
221,566,424 *154CADA8DEE635ADEAE9C39EF1D5DC249109DE96 4FOREGRIBER
221,566,425 *1542A90D97141A12B29D9048175050C99FA4CADB 567KEON
221,566,426 *154E81086F150559752608F15E4829E1A1FBA1F4 5aug1478
221,566,427 *154C55994756F199EBDEC40B12DC6529CEEA4EB9 5CISCOPROMPT
221,566,428 *15478B8FABADD651805F419BEB5F2D6AAF4F458F 4NEDMOOREG
221,566,429 *154F068836D54883891CC8A5DB5BA5DBD6950FB2 5domandate
221,566,430 *154DA602C5F2EB110DA01B8D63B9FCDD1E7DCC08 4ONTWRINGENS
221,566,431 *154632FFA9304EDF5A32693595408F72B40CB602 5ENIGMAALEX
221,566,432 *1543FE094ED52902F060B1D9E49FCB27CD982798 5EUFENDER
221,566,433 *15453177804FD93AFBD1D5401BA6FF1ACB5BBD02 5FSOLAZZIMWL
221,566,434 *154CDEFB36F0B1FE86A18DE4FCA1927E9FEC5531 4SESUERIA
221,566,435 *1542C0FA54C468F166EA6E3987F2A3AA613D8D33 5iamchristian2
221,566,436 *154D83FCBE71BF204F4FB3E16711600B2119D768 4SNYDING
221,566,437 *1544AE93C3353E1AB761ED0C95E910B505C704CD 4.vironia
221,566,438 *154AB039E98122DF0D19E8F009A52D047738171A 4ZEIREITSINMA
221,566,439 *154A3D297034F7C2BA849DFFFC135357A765293C 520ronald1314
221,566,440 *154D67C555D0ED7B52CA2C924071E2CA3B66B679 580devon
221,566,441 *1540EAF1B2B9881BE7585B98B896D1B842F3CA1F 5APPWIZZARD
221,566,442 *154B7E7FD58952EDF280B25E46400CD8CCB5C3F4 5ATARTALO
221,566,443 *154A2BA500FAAAEA1FA27C7CC7AE37FB03F067C4 5AVG3FCK
221,566,444 *1547C0CDD85006A0BF3271701EBB5BB7E095E184 5SURCEESE
221,566,445 *15404B80CB295ACD16F261202DE49A58AB5BD866 5BRUGERBIBLIOTEKER
221,566,446 *154EA0FC16E914D4DF36D63C7435D3FD62A6E5E1 61B983AAC8FE3C7882F460C5C0EC7D98
221,566,447 *1547FE9D0DA11C7314E2843B9876331B5DE3E9A7 627727 BU ULKE OLURSA BIZLER VARIZ , YOKSA BIZ DE YOKUZ .
221,566,448 *154D46B42DE033B3F0BAAB771F778381BE4A2275 5IMPEDIEBAS
221,566,449 *1547C02A03AD27BF925A9E187CE5752F737FDBAB 5,ju
221,566,450 *1546BAF04B352CD7BEC6710AB46C58CBC93D0A2C 5KANTELHOEK
221,566,451 *154523C38B8CEAC6AF8EB8246B64BD4CB00733F7 5monostable
221,566,452 *154A866085C3759EBB19ED55672E962D2EADC59D [email protected]
221,566,453 *1545991F19438AB515CC701D951E0FFAE7660809 6ILUVSLIP8
221,566,454 *1540D5C9B6C35B86656DF3AE9D13C31234962E3E 6LOEG
221,566,455 *15434077DDA9622DDDE893EA098CD8E19448ECFC 6MOLLYMOOMOO
221,566,456 *1548E697AD62D16C9CA102D471739D8A2026D243 6PECQUET
221,566,457 *15418A8E4267210549C65372A4BA597CA83D1561 6RGERWIESE
221,566,458 *1540AAA8B5A6C0FA6A4579E9F8B4C629996197BF 6AMUDHAN
221,566,459 *1540E6A14B2E48511945748272625977289F2E53 6BILOBED
221,566,460 *1542C127196070AFFE0008AE58D11630E7F253F5 6FAKTURUJETE
221,566,461 *154A5BD93753EB252D69E30D7714D3C3AF4E1116 6FLAPREDES
221,566,462 *154C2B6771AD3BE89D52593CDE6B8C8FAD6590B5 6FRENOLOGAR
221,566,463 *154A74CBAF1F4C2D999175E9A8AC85FC8AE693A5 7AFILADORNESS
221,566,464 *154175DA08A5A637FC4823571F9FD0CB474EDA3E 7BSWLEENERTSBSW
221,566,465 *15482B7E54E8A839DE613066F2FA48E3D71E03DA 6MARLBOROVIKINGS
221,566,466 *154B3C9B4940BE57CBF5298C8FC40A5D751D5852 6PPZUHVEBBZNTA
221,566,467 *154C0E8A2231999612216C464B9065ADF5530730 7ETACITAR
221,566,468 *154082A4A49FA9BED4B214109F127F37C5AB741C 6PURPOSEIS
221,566,469 *154C4BC89EDEF39420F66E54113AEFECD5811B01 6SPYDSTAGERNE
221,566,470 *154049A99CE0A706671D8E56DED862EA09086186 756F7EF2
221,566,471 *154F815FC933910EEDC68A4EB1F067BA4CE7D80B 765778 NIMENOMAANSYVIENEROJENESIINTYMINENL
221,566,472 *15413726FB77AC1CA063F92E5251721C916F365D 779MADISYN
221,566,473 *15433AF70E7138D1B606613BFAAAAC84FD481D4C 7APOCOPARES
221,566,474 *1544CD9E9A9EE4F46C947BB7075B126A71A16484 7SIMPLEENGLISH
221,566,475 *1543A495A09E78CA2EF22CFF926ACD21AD114A24 7SYPREKISTER
221,566,476 *154E446CA2A799F68903319301FD5835F326B133 7BSWCLEARINVERSEB
221,566,477 *154BA9F4CFB2F46D9A2145AC329CFD5312958401 7TROUBLEBIGDOG
221,566,478 *154154358B2CED01737A224287CB9A0AF995989E 7WACHMANN
221,566,479 *15446B347B186F6B5C7FA1CF1C1BD18495761081 7FAITHPENGUIN
221,566,480 *15402587302947EA005B4CACFE96BDFFC1DD8674 821289 batiikki-miellet
221,566,481 *15458333CDC3A828BEE179A221375002D4D0A6A4 879316 MUTTA 30LUVULLA N
221,566,482 *15487196A9D9F75E09DA8C5C6F91C499B5FA5F51 8:8-#-&taster
221,566,483 *15489B91DEEF9F81C593D52B8E24C947023488F2 7PLANETGALAXY
221,566,484 *154760BFDF4C5D065DAFF6275EFF7D9197D40928 7RETROINFECTIO
221,566,485 *154AB3CABCF37B1858F1163C537837905657F756 7RICARDVE
221,566,486 *154762F76F4FBAB653E23A8782C97994CF502C9D 8bagels
221,566,487 *154429751D2B1FD01C1D5E746960E0A7C831D674 8BARCLAYSRH
221,566,488 *154BFC4E253018792FFBE55617F910ACF5EDB4CC 8BSWYOURPROPERTYBSW
221,566,489 *154D1D462B23B34E389589E76848516D88422398 8SNORESSERPPO
221,566,490 *1549BC7A35B0F852A2AE25DA95B06772557D8F1D 8SYTHENS
221,566,491 *154F5D3EBAB4C25D2E2CDDAFBC9501BDA8D67507 8trophy6
221,566,492 *154764C89836A7F7E901DC8A5EDDE653AABCAC00 90dax
221,566,493 *154390EE7268D0073A28308D198143879C17632A 949367 MADDE-3--BU-KANUN-HUKUMLERINI-BAKANLAR-KURULU-YURUTUR-.
221,566,494 *1544EFC3C526E140890C489299AE729B22927364 8INTERPULSE
221,566,495 *154509F0BDE7040C241F7A58FA4497D48D2207C2 9ASAMSAHYAM
221,566,496 *154E97F08875F318264797166D1C9F8D0E706A96 8MACROSPINOSA
221,566,497 *154684856F4E74BD1D9C966EACFFEF70D044FC26 9BENZOTRICHLORIDEN
221,566,498 *154788E34BC8C6CD52C5BC202F10BF29197C5EB6 9BLISFULNESSE
221,566,499 *154173B045B1D4A9A7D3B61D253FD023099ACCE7 8)~O;)
221,566,500 *15450FBF6694386AA5B4D822F55746D99B7F9CFD 9CLIPPERDODGER
221,566,501 *154214543ED08A16218E743150983DF908AE222D 9HABITUN
221,566,502 *15407A5272AC925FF46FC2D13C73CD22A50AE35C 9IAMFUTURE9
221,566,503 *154A058B05FFD7BFEDAC2FF5E59BAC008625CE17 8SANTASNOOPDOG
221,566,504 *15439FB794BB7C6C62383755BBCDACEF6AB2E1F4 9POJAWILO
221,566,505 *1543AC1E2294210911BEB6864D6485B61EBF76EC 8ZUFRIEDENSTEN
221,566,506 *154CB8128336C79B57518CDE151F1376EB3A015F 9VOIMELLE
221,566,507 *1544DA6CEBEDC43E69EC8CD99F19E435DBEAE36D 93COMADREJA93
221,566,508 *154847A40CA1D0EC77F45BD0F1F6E4F3E55C4C7B 9AFTAPPET
221,566,509 *154E0D9896AF008B0F9181A70F04530910A99022 9BORSENTECHNISCHEN
221,566,510 *1548FEDB8F18267DA9D83A177D58C3C97C07E936 a6qva
221,566,511 *154FC0394B23D5D3E4B1C2D03171AA8603082ED6 9CLAIRESTORM
221,566,512 *15470039DB78D973F5F571286E9B6D6CC997FA7A 9DOOGEES
221,566,513 *15433930610408D9BCF04FE26A2BB76D5C1A86D5 a9yw
221,566,514 *15412156962DA6FEC606F86E30972955B0E40029 aacW;
221,566,515 *154C01F1206E04FEC5985B37717B12A4837A127C AADHE`
221,566,516 *15443FC31C93D17360B84BD7F5E0C0A3159C3261 aapo|
221,566,517 *1546E047CADB4858E80F41881E94230B321BBD2E a48+
221,566,518 *154BEAB5CC90CBE258ACA908791959426D030EDB ABDUL.ESPENOZA
221,566,519 *1548C98A4739A3F00D2582E60E4B27A02A87F24C ABEAUTY7
221,566,520 *1544D93832FF5BC72F43F28F1FE1033A12726073 a9yw
221,566,521 *1542110DC6C794A4536E3C19BC050E56313DC5A3 abgeschmiertering
221,566,522 *15450DF52B4F3FC79FCB32EEFE33E7A88C02DD90 [email protected]
221,566,523 *1547D71DE3BC957E28260EE8103964F2E853A811 [email protected]
221,566,524 *15429B284DB03D256EA0C369A16830BC3058B882 ABSORPTIONN9
221,566,525 *154EE9CEDD6BFB6C36A8BD7B7C691F762D8CE2CA ac8a\
221,566,526 *154F07B39B260CC57D7C6DAC5205D3104AC6DEDC AˈDAMƐK
221,566,527 *154657AB25543DBF6B99A315731EC8B9EA39D5C6 af.xs
221,566,528 *154AAC65EA33B86279F80FF57A659DBE7F578CA2 ADEAMAIO
221,566,529 *154B89F12AE37CEBD39A956A075EC119D544FCAC ADOLFO.KLONOSKI
221,566,530 *154A5C33E209FDED99B658FD2BE53B9FF94B049D adolphalires
221,566,531 *154BAD365F27F7D1DDAFA48FC6E641201549BF53 adolphbawek
221,566,532 *154F34731F8BA904F01627C37CD7173CD0E26D1D adolphturnblom
221,566,533 *154B70DB48E055B1187650FF73A9B8552C50B29F ag+p&
221,566,534 *154C6092BCB15513BD8D89CFF4912C3B4C0D70CE aev-v
221,566,535 *15447CA4CABB2F834BC49D90E31EEA990671076E Afvk
221,566,536 *154E50AB69D7BAF5C23071C0572394D30728656A AJXL
221,566,537 *154162AAD5FC2818D346690E39E3CAB5EA8B2D08 AGMÉ
221,566,538 *154BF9B11120EB1E4CB6C5B473EA64ED2B864B54 akwro
221,566,539 *154104BF5CCF2A46A3DF775F504441160F84DC9E AH/HQ
221,566,540 *154C9787EC6F6A96879EAD531589B77149DC47F1 alexanderfailing
221,566,541 *1546FEF638AD00892A656318567C4925079976BD ai+_h
221,566,542 *154132BD0BDB12C037E32002A388C7BD616BB8E9 ALIEN-SONG
221,566,543 *1549AC66621111279E369937B420CB64A9C71625 állatbemutató
221,566,544 *154CFB51311C986BB9E251B95BC9EF100A578A92 almarusak
221,566,545 *154ADF282554D0B6CBFC359590FFF9B5E492BFB8 „AKZENTE“
221,566,546 *154FC3F132A0467367886422345D3948B5EBACA7 ALAIN COLLINS
221,566,547 *1541D0A952FD03567928B749C2F17C1B44FB0302 ALPHONSE.POLLAK
221,566,548 *154A7AC0FA75069246342E6C9B048318C565BC36 ALPL3
221,566,549 *1548B6875EC98F4D2A516EE120C0735C29BB9EBE alejandroshibles
221,566,550 *154BCA723134CCCC6586789359564F400D4FD0B7 ALEXLETTER
221,566,551 *15468CB9546A61DC2F254F271323C3555A1F8869 ALLINFOL0
221,566,552 *154DE59242C575D85EFC6B951A4BC5479CD9AC2F ammiro0
221,566,553 *15401266CC409D92A3113F13BAC81BB835C84B08 AMPLIATIVE2
221,566,554 *1546E02421D397D581B101F2F081254F455847F0 ANDREWREINMILLER
221,566,555 *154F0345BF249A3609D2FC92E96ABCEB05D747D4 androgynism8
221,566,556 *1549B6E259699DA84BF91BB6A9E69F328FD379EA AMOTEC.ELECTRONIC.AG.|.SWITZERLAND
221,566,557 *154E393DB372AD52422AFF1856DD7B2B7ECCE93A AMYLOLEUCITE!
221,566,558 *15406AF1304193877BC12D78C0A70DE119F6FD8D anastassi1
221,566,559 *15472DC4CEAF4B4A180F96DAE95DBA0912718729 andrew-john-morris
221,566,560 *1549C1384F8795C9A8D46F2A115B724F3E417C51 andyblacksher
221,566,561 *1549ED5CF02B27B234A777816233F7C7D2166436 ANTONCHLEBEK
221,566,562 *154D7954A584ED70987CDF51AF6C707A1D871C8D antoniosticht
221,566,563 *1544A8BF423AC90553B373881346FB00D29B4CE2 ANTONNALEPA
221,566,564 *154BCB253B35959EACF105F8BCF3796893B23221 ANUJTIWARY
221,566,565 *1549123DF8828796E77B519EFD4F566276DFE54C APITOYS0
221,566,566 *154EF428E2AE88895C0AE297D7281FFB124933E1 ANUNOYLU4
221,566,567 *154CDD7542534E4AC6529E881520449941997FC4 a$obs
221,566,568 *1541C5E75F10764B8B197923628560D7769237DC ardengraetz
221,566,569 *1544C3F810A948A6C27CE443F3C1C0CB49ACB3E6 ARMAND.GOODENOUGH
221,566,570 *1543F23E6BD68345381EC7F26B4CF26D55A8FF32 ARMAND.MAUCERI
221,566,571 *154A0F7CB1F445447034C47785499C5140661FDD ARMANDSTYLES
221,566,572 *154192395FD8604357809A3FDE648576D48A76EB arnoldonazario
221,566,573 *15409E711A408462E1CD9AB30DC9111E83C2B247 arronblasen
221,566,574 *154868A2F11A2CB997FBCC7B9CE170AA7D5B0A0F ARMANDO.MILHAM
221,566,575 *154FEF8FEB98D6D607D1AAB821CDE896D870D51A A?RVD
221,566,576 *154C10A69D0588C501B737A31741452A1C9CB23C a;s..
221,566,577 *154EB448D9AFC634598F2BCB012F969A71E9DFDC ASSYRIAAN
221,566,578 *15488F472AD597E8CFD5B70B467B6CC740C13F91 a short-lived satirical pulp.
221,566,579 *154DBD9837F6C5935387DF91DBF8D4964050E79D [email protected]
221,566,580 *1544BBA7FC085E517D390CCA07A3D9EC4AD78D50 ATO!H
221,566,581 *1548E6442CC35DB5866B8F197A28371887AB6F91 augusttrampe
221,566,582 *154CE375153C4286590983929420F90FA7CF6DFE AUGUSTUSDULLUM
221,566,583 *154215B325C3D857503115F9A5D59E26F84419F2 au!lg
221,566,584 *1542F63EC52B56F76D03A37246EC23941E0C6110 AURELIOGSCHWIND
221,566,585 *154115F4C7C3A77C2262BF04BFF768644970E3F2 aubif
221,566,586 *15477C03E7FE1F3B1C9C4598F05418CE5AF39882 auo7
221,566,587 *154F3256F78FA36EA541954A3FB7165CA23F6EF0 [email protected]
221,566,588 *1541972DF2D0910C71A5C1F56F455DBDC39E540E AUTOPROMOZIOA
221,566,589 *154047C3909B5B931563EB27AFE535CA8909B1ED ay(c
221,566,590 *1543BF62E66D813023D5D9976456829BB480B8A6 AYCL.
221,566,591 *15411B7662B11E7F6DA87E7B6B85C8C199146F68 b1ueco4ts
221,566,592 *1545B123F84ED3055FAD140E25CA05F7C8F22F8B b2q+5
221,566,593 *154A449999261BC7A14ADD486ED3BE2931F95291 babymontse
221,566,594 *15410E53B866170B9F58D986FA4FD28C1B76E7BE barrysonny
221,566,595 *154657DD6A33C19F03F040CF3F68A3B1956F28E4 bateria-r
221,566,596 *154F2137676C67751ABC06C1C319F6E5C470395D BBADMINED
221,566,597 *154BF00534E8C15CD0C07179A1F05403CD8E4A8F [email protected]
221,566,598 *154E5781BCB3CEF76B0FBE2C4EAF07B232EE0F66 bennettdesigned
221,566,599 *154F8E5C5769CD5116957952FA60D682E0D0FBF2 BERNIE.SAKE
221,566,600 *1549717F5D6B54734E35AAF11DC770DF8D1A6DF0 BevN
221,566,601 *1548E314B6BBE780400C8DE9FE4AD43CDBAC2D2D b!ha4
221,566,602 *15485494C34648F99CC90B0EBE9FDB68D89D6DA2 [email protected]
221,566,603 *1547ECE63BABEE97F5AD2C70ABC3AE59C1A8F37A bidende3
221,566,604 *15410F732016F733F09C9117D24CB71E1BFF60F0 BHSAM
221,566,605 *154872FEDCED812981E8BAFC8AC90C5A048BE549 biofilia2
221,566,606 *15492B9E8D130086B3660A76DD00362896A989D0 BLÅBANDSFÖRENING
221,566,607 *154CE8D8A7A2B86DD5603EE44EE54440C4AD1DE5 BLOODINESS!
221,566,608 *154BA55650F320609B10F39E4BF2814F64E2A131 [email protected]
221,566,609 *1541B1E5718CABE23063556684204DF1B30909B8 bo+n8
221,566,610 *154F1B43731A4B79D46BF3A6802CD88A993005AC boo.harris
221,566,611 *154311E4C7AB67F8D9C4541D183458FC15910E7B BOREMEN4
221,566,612 *154117905AF4725D5550E533E5E0475EEA5F4E76 BQK+0
221,566,613 *1549F2881E4C8907906983184C427129F7792F7D BRANDII0
221,566,614 *1549266080FB306BB8BB1A000A145D1063988DD0 BREISTEEK3
221,566,615 *1540825E2095EFCB7ECCD459C6CC06BE749FB811 brf1d
221,566,616 *1541B49D32FAC762CEC2D4DDB88686DF2E5CC35D BRIDGET.BURGOS
221,566,617 *1548BC4C96CBD84149E1096ACF8E90E30F225657 BRIAN-MOLLOY
221,566,618 *154D48BDB11E681177E5FFABF6E8868CDAD3022F brighstonebv''brighstone
221,566,619 *154E99312D2CBB2CF3BEDA41E6A0837DC937C395 BRUCE.MOCTEZUMA
221,566,620 *1544886A683DEA104136015D7D8A47503A8B3D78 BRUNOLEDEBUHR
221,566,621 *1544353ACE33175402EA976182C82479B9FB6B57 BRUCEPFOUTZ
221,566,622 *1543606A038FB0576FB2B7EF9DB430621D29739D BRUCEPLACERES
221,566,623 *154ADB6BC214F29373C95455221434131C877183 brycefurlough
221,566,624 *1548224A73E4B54B58A5F8E6BC99BD78370058E8 BRYANGAXIOLA
221,566,625 *1543526D5B68F0D03E2342882B6D646D1094490E B)* *Splat
221,566,626 *15492E548506E9CF8E030B4B6C086344D549719B bswchiltepinsbsw
221,566,627 *154DC85C8F37957D4C1B7C1BD14C1C62B10AA863 BTEQ
221,566,628 *1545CA21AC2CBBC9FB1609352313A503C57BF01B BTNCR
221,566,629 *15402263B06B1C41B52985CD9BEA13776A5E7EAE [email protected]
221,566,630 *154A27924352A8E51E33C2C3191BB6882443BB5A BTEQ
221,566,631 *15401A5BE72F7EEE23C04714D93D6B319417CB0E BU+PE
221,566,632 *15446386528621AADDC9FDF072BAA484CA64164B BUOVB
221,566,633 *154B84D541A356CFBA7DE2A54D4FA2D697F9A3B0 c#4lv
221,566,634 *1546CE8529E747DA51767AE821C0244D65FA2EF1 carisma28
221,566,635 *1549EA8F74ADE45BEF38E197A3FA79D7C8531E1F cavefish
221,566,636 *154C3C5904714BFD7542FA6AD6A1E5729F71D546 c##b9
221,566,637 *1545A725AC86E7FFA53E229F193242D65A6A123F CARLACARREIRA
221,566,638 *154487105BEAF7D559E626BE24B24D0EF8BD6352 carsonpadley
221,566,639 *154B317A2C99F30F66F75E1DFE5297B6CD7C9EF3 cartonneras0
221,566,640 *1545BB2D08268EDF407DF059754580226FB128EE cgcog
221,566,641 *1549F9CB4660084EBD9E78E4402FD87513EC9436 CHANNINBSW
221,566,642 *154FB6981C7ECEFD3F8A74303E24632FE44DD634 CHARLEY.PASSARELLA
221,566,643 *15481584AFE06DEA0E1634860E433370A6D0396C charlie.trotter
221,566,644 *1546AA157EF0AEBDE6616A52DCA8A0F3F33E7857 CESARFEINMAN
221,566,645 *154B8D0283DA11C5C03F88165FC3B981972B03FD [email protected]
221,566,646 *154C6055C1CAC9204F68132B417C3B497574C5BB cf:=
221,566,647 *154715FEE9A8F56114611293AD564844F01AF847 CHONGBIGBY
221,566,648 *154810681DE9683A18CFB21D31708B4D5C7A393E [email protected][email protected]$$
221,566,649 *1544286DF871D9B3FA211EB1A05B3F2289C31AD3 CHANDIED
221,566,650 *1548F6420257BDB9C1680767936F48E6D321757F CHARLIE.AMSTUTZ
221,566,651 *154717E0073C0C7F81BBF843738D2F5501E714E2 CHWH)
221,566,652 *15490EDEE82576451BC1EB57F1BAECB91D82FB11 CHELSEAFANJT
221,566,653 *15430AC6E74E20DA7225AA3A5CA161BF4D5E7FEF CHETTHANASOUK
221,566,654 *154E32B0FB284047360CFD9699EC8A0898E2A910 cinchophen7
221,566,655 *1542F71A76EA0FA53FDDA66D7E5B2807CE7C95A5 cinemaofcroatia
221,566,656 *154008881558A8951B5897A8E8AD03FB5FD4B83C CHIYAWAN
221,566,657 *1544205765E7C6E3FF68BFDCCDCD35ECFB0EBDC3 CHOIRCYCLECIDE
221,566,658 *1543B729FA8C228145E2906AC7CA6CA5D7BF749A CHOOSEF9
221,566,659 *1542A4208793C97CF8A2FE0B1B859038D1965B56 chuckpadovano
221,566,660 *15476FC8F7D73A3D97E8109A5ECD5F81A379CF91 C;HW1
221,566,661 *1542BA9485A561A81AFE4A2CB0F26C4E2C2920C1 CIARA.RODRIGUEZ
221,566,662 *15433CFF8AC3A1D30ADE21EAE86F0C0EA9CCB267 c="lh
221,566,663 *15421DB42A6E80BD222BB5CF259550B7C8CDD115 cocobolos
221,566,664 *15404080A7BAEDE58529E23D97BEE123C0633269 CODYNORDQUIST
221,566,665 *154DEB61D2229172AC164CB2FA4574E1ABCBA047 collvin1
221,566,666 *154053FE95F87AC4E540C2DEFBABD0450F836EE4 COLTONSTOCKHOFF
221,566,667 *1548B2DEF7030294C34F5FE35364B0843142E754 COMBINETUS
221,566,668 *154B1332D39A30547499849FF93F7BDF58CF32DB CLIFF.VANHORN
221,566,669 *154B0A9CD962F6D58EAD84F95F82E2E7C93BCF0B CLK%+
221,566,670 *154B428F7957A482E033C7DA1A5C77B026F24B0F cnc411com
221,566,671 *1546C1E1D0E56A986E6AFF5CADA18F8D153AE572 CORTEZ.PAYDEN
221,566,672 *1549E3A367A2E2DB144BA80F25A39156DED436A1 corzine-carries-four-point-lead-into-election-day
221,566,673 *154FF81C77EBE53A28B24685B3705AD6AED3E396 C:\Program.Files\Windows.Mobile.5.0.SDK.R2\PocketPC\Lib\ARMV4I\CellCore.exp
221,566,674 *15468A9BB02CBE777653C5BDDB0557606682B4CD cq9-l
221,566,675 *154F78D47298C682AE3022EDA7FDA9D879B60889 cp36:
221,566,676 *15474D15446B2DFD2FEB10A93376C3A79250E695 d)=0&
221,566,677 *154432784516F99105352747E226D88D3F05D1BD cshuu
221,566,678 *15416AAC4EF3709A69127A2017188FCCA0807B1C [email protected]
221,566,679 *1545B0459B7722A30A91F9B77657062101541779 d=5(8
221,566,680 *154AC169E45C0E3A9B66E3E492491FBB7D2CA4AE d-(6i
221,566,681 *154726A9161DA022D5D7C0B20684F73F5A1ED5AB c-vec
221,566,682 *154E4CBD7601A7E0D8C8BC1D83238CAB57750EC7 C`YO
221,566,683 *154CC7A43E7F8E4872AB0203CD63C7F885BAFA0F danialvegerano
221,566,684 *15460A4D5E21C20BC7473CB232185E761F1DDDFB DANIELE GOZZI
221,566,685 *15441CAFFCCB17F33B746B2788DEC7F99C3E90EE DAREN.BOLDEN
221,566,686 *154DD87010B043A61A8BBE2ABF3B141AF2665825 D3S4PROV3ITOU
221,566,687 *154B1F9EF3CCA90B5EC5DEA466E817FE798B4096 d4v=-
221,566,688 *1540265F87DE81757D29832D616FF21414DEE62E dassirep
221,566,689 *15429601D803013582EE6907DAFA4D2FBED9BE95 daviddugat
221,566,690 *1540665583DDD909BEE512A1B69525D5EC125846 dawc6
221,566,691 *1542226524A67D2C163F8E89451EAFD26500E848 dbr#t
221,566,692 *15416CE5A30B5F280A09D591015C856449F91E7A DARREN.BORRIES
221,566,693 *1541B733C1A4DAC3FFD4CDEAF40322162768BC29 DDJP!
221,566,694 *154D0A190B0C59805D98C1D25F6F444E60719639 DAYS-FILLED-WITH-LIGHT-(BACKGROUND)
221,566,695 *154D4330521FD2292F4065A96C19D3BDD9650EEE D?B7
221,566,696 *154FF5B715332710C1467864F810B57D337D5510 ddrsmth8
221,566,697 *154AB94C28ECDCFE399C9E684AF82B5301C4512C DETROITSMRDOITALL
221,566,698 *1545D854425CE4B554278344FCECD7A271241341 DELBERT.NIEVES
221,566,699 *154BE41C0DC8524EED5EA197D3E3D2230AC64F78 DELIRIANT9
221,566,700 *15459F5D6E366C1A51B44CFAADDA2D508AEF9E17 demeuree
221,566,701 *154123BC0F75183F4F05D4B3D308D6AF04A0AF90 DENNIS.COSTEN
221,566,702 *1549E339971950C6E017A56B2140515A08098C83 DE-OD
221,566,703 *154B1B1304B9022D818AE9D447579BFA6CB97F27 [email protected]
221,566,704 *154DBB8BB3CBF21593A78E868A04C32F0ABD86BF D(HUL
221,566,705 *15438DFCF46BFCAA51E5B20A2F0864157BDEC2F2 DIFFERENTLYFUNCTION
221,566,706 *1540A7DD8D59EACCF3C2C2F84AA15FB68D3DB896 DI%Q4
221,566,707 *15458B5B1BCF597D056C064B96160DB41D62251A DL#I;
221,566,708 *15495D525BE4F2D198D53C5BFEB86018C4AE3B89 DIA(G
221,566,709 *15471BF5E71C3F1D7D74CE396039FE8F01E25B09 DIAMOND」にも収録されている「薄情」も別音源で収録されている。
221,566,710 *1542AF927E99890D48839C640C6591D4CF95C819 DNIPLTVS68HJ6VCY
221,566,711 *154D5B91C573B1C3B2B7D1AACAA3A60087D35DB4 domrepmar
221,566,712 *154EEDED0612F817EF0D58256EFE06F051F2C143 DJ-LUCYK
221,566,713 *154C401F0A0E3C67A23F1FBF04002A014514ABA7 dkz#q
221,566,714 *15415FE672077FB7DADB9EAFF23CFC48C73204D9 DPAFA9R4
221,566,715 *154E1A70ED8B47CE28951E563979635A1420080C d$q"?
221,566,716 *1541AAC2CEE160287FBA5D038FA66229A5D974F6 dr5/v
221,566,717 *154FA2AEA924BE815717BD6F4BFA5A27EAEBE606 [email protected]
221,566,718 *154EE4B2AC64DFB5993A96352E0AA47E4A4B8AD2 DRONEHITS6
221,566,719 *154886BF52051A59D2BC4E07ED71B3F66F1964D2 drq_r
221,566,720 *154D33CF71034A9B5D4CDF3D8A24D4149E77C41F DOZRELU
221,566,721 *1541FEF3F78774B1E7DA741A499B81C5012F0C3A DUANE.MOTZ
221,566,722 *154ACF2FD043087CCCE4F53881289829441DA7A2 dqd4$
221,566,723 *154837AC9FE015987AD2E64D16FD957600607382 D`UZ
221,566,724 *1541FF94047664E89D0B767325FB3C9033349736 DTCXM
221,566,725 *15430A427EEBE640EFA2703E05897F35A116ED74 EA#KD
221,566,726 *1548A85417FC9B4632B38F212D30266B0FA70B0C DWN?:
221,566,727 *15459ACC8E246B02D983083DA059C5F098859981 EDDYWEMBER
221,566,728 *15451E4B63621FFED51268F32BCFF09CA8E9FBA5 dyc+p
221,566,729 *1546DB512D32BDA60C5778C8D64C638CB0053662 EDMONDARNOLDI
221,566,730 *154AD9AE55DEBE9DC0F599F253B6EE0D4A1B84EA DZY?W
221,566,731 *1545223D0C7DBC06EBA4ACE08F91A8E3379A1B49 [email protected]
221,566,732 *15411D7363B602B74918DFF97BEB7FC905F21F0E EDWARDO.HUTER
221,566,733 *1543C104D538A63B76400784EE8998BCD11C9F9D EDWARD.SPRUIT
221,566,734 *15443C7002E19806EADD1CEBBE5BADA5311AA23D edz()
221,566,735 *154CFFA87CA1821A809B6F26B444162A6B9901EE e7y0
221,566,736 *1544C857C40CE0D250145387A3323FFAC56F7F43 [email protected]
221,566,737 *154203C63048C7911CB6885B3926836A17C40200 EAVSL
221,566,738 *154D5E03C77237131F191DF4A040F65F1C29449D EFRENCOLP
221,566,739 *154C5A319BC3E1696502EE52C691ABAF673FE550 efternavne7
221,566,740 *154E54695BC692AC31021D97525CE3284BABC380 EJKSATADING
221,566,741 *1546BB2415151BF9489084C57538C87D4EBEDE80 [email protected]
221,566,742 *154C627246D3455EB5A060FCD557A68C1494392C EDOBIA
221,566,743 *15488590E357CD2EE1508D5EC47261C42887AC2D EDUARDOALLERY
221,566,744 *1545B6EB5342A41E0A21E746F35AFEA05F5424F2 EDWARDO.PHORNG
221,566,745 *154B4114546990CB64E5539EC33F630D31E25451 efqy)
221,566,746 *1549196B3EB2E5B77D8D465E7A47381DF781CC68 ELISHAPLUNKET
221,566,747 *1548F63D3C244E24DDCD1B6E03330739BC6F352B ELKAYAM2005
221,566,748 *154E084CAA9CFFE6DEEB0C34398CE4D9EEA9E939 e{=m
221,566,749 *154D8DEDF098C57317223E56B213ABC8FAEBEEBF emlll
221,566,750 *154FDBFA2372A236F24EBD0E4B03C311E7F8A0AA ELLE280
221,566,751 *154948AA04B4BD3CD2FC668DF419A78207A60AB2 enrique.gil.gilbert
221,566,752 *154350EC36DBE841FD64C228163FD0DE477C7D97 EMILEARISMENDEZ
221,566,753 *1546CE77B28181F84B5D523F1C21F268860FDF41 ERHLLESED
221,566,754 *1547E066C4DE553FA4A36515E5A3D10A5D2DEAB2 ERIN.BUDNEY
221,566,755 *15443396483A3963088C5C8DBC00263B5975D87B ERNNNÖGLICHT
221,566,756 *15455C0E8F2A7E90886259B2BADBE8112EF988BC enpv=
221,566,757 *154B9282C3BFD2D98A8299F6B91C19E6F20A4B20 etagluvi1
221,566,758 *154FA596651A921A790EC6DBD8706E97F6D409F0 ER2j
221,566,759 *154D68C5B3F7F6D790E1E0A0157A452FE3A3F4C0 ERICA JEFFERSON
221,566,760 *1547189A9D8E8D500B4412C188370F28485E1D3C ERIKCALMES
221,566,761 *15480062EC1A89FEDCDD0000EA6FC2680ADD6850 ETINCELLEMENT7
221,566,762 *1544982F6A60AE5C8A693443FFE58CC8F8957AC6 ERVIN.HAGEN
221,566,763 *154A649AB2C3F30E46B8C3648BD8A8CD9B9CD15A EUF)L
221,566,764 *15490F9ABD8A267BC853B14E1DFF46F0486140C7 ETITICUE6
221,566,765 *15472AA3FBB085B0F2875F99D28CE18824668427 EXOTERICISM7
221,566,766 *154DB6D713C3AA3F9B18948CF226F81E28E71BC7 eusebiooubre
221,566,767 *154BE0860DEE1ADC0ED958EF5C59A5A1365D9C03 EVERETTE.CREDEUR
221,566,768 *154AE20150825A9BCE164A6202A38F4F53E91A62 [email protected]
221,566,769 *154C02294E3949C6E629424B6B3F4C30CFB4E546 FAITH WITHOUT WORKS IS DEAD
221,566,770 *15442DCF5E3FF1B890D170EB766F48170EE19241 EYC)3
221,566,771 *154BA9916EC314FC93069909D58433DDE4134567 FANCYFAIR(FT.DJALBERT)
221,566,772 *154C24848281BF84FAA1B838264187123A9111E0 fantasy-on-"ruinen-von-athen"-of-ludwig-van-beethoven
221,566,773 *15474695D358CDB486489EE95A1486ED6D45E4AB fatnasti
221,566,774 *1544AF61A8FEEF958836991316D99288B52D0ECC faze.o.que
221,566,775 *154D182F3EBCCB839EB06DBA0095F2DBFDC32319 felixholston
221,566,776 *154ABEC71C96413F6B5E5525D3F8E7DD0E5C4C19 FEUERWEHRWINDSBACH
221,566,777 *1544BD55DBC9DFA38705E607CC57660DF8FE1E98 [email protected]
221,566,778 *15492A46E953F0CE93D72E33A30B33E5AC1D3018 FRANK.MERTA
221,566,779 *1548A0F9A2B3E68B8DB59BCF486DB2B69997634A [email protected]
221,566,780 *15458F0E60C896EEA8DDAED89563EE5170787844 franziska.wachsmuth
221,566,781 *154555D2EB18E5CAC49D56A090588FB1BA48DB56 FRANCESCO.CIRILLO
221,566,782 *1540A81D5BA8CE544ACC199EC7515D2CAF8767A0 franciscoarraztoa
221,566,783 *1540E039E49D854AEECE9A9989D5A67AAAC31667 FRANK.CITTADINI
221,566,784 *154225CDBF32C0E5FF65A55B92DE8872CAC3178D freilichtauff
221,566,785 *154340120E9378BF20AFD77B17A6457E1BDC47CF frontgebäuden
221,566,786 *1541498E00C75788F1DBDD6184288E1C165FDDD5 fryskpuzzelboek
221,566,787 *154E66E8D2D49F6813A977B78E18ECBE4635647D FRITZ.AMYOT
221,566,788 *154D5867E3147B1C1AEA81DC8C87B8D02EE10E8F [email protected]
221,566,789 *15491E61D307ED5825648F5023BE023D3FB5789F [email protected]
221,566,790 *15401D418DBF9DE48E17DF6555E2CE03D13ED597 [email protected]
221,566,791 *1546DCF7BF2071281DCCAE8CE4442EA0C0EA764D [email protected]
221,566,792 *1542D58582E5D9CD6141F9CC526721C55AD27440 fyzikálneho
221,566,793 *15473D13C5374B3062E927F29399B79E74DD7688 GAIL.THRONEBERRY
221,566,794 *154C57B533AD384FD16CADF199C928C6D510D5FE „GALEI
221,566,795 *154B6FD173DD0ECBD3C9CD2190A9BFB5C76B6C4C G-AD
221,566,796 *154D4CFE05F12C859380059ADD2405C6128254CD GAYLORD.STIRRUP
221,566,797 *154E87E5A9D5D997595FC048C1D41719EBA77171 GAVINUMBRELL
221,566,798 *1543ACBFEA920252B39FF6E0770E63D80B7F746B gdrz
221,566,799 *1546E145A961813117FC401C77DCC8F1D3D5B54B [email protected]
221,566,800 *1540EF264C76405756A3991E0113B49920A1A798 GERRYZAHAREK
221,566,801 *154A3DC2CB32702E74B36759F72A11D6CA26842A GESLOTENEN
221,566,802 *154EF4230CFD8EB27DFAFD003A75BD987A8856B3 GKRKLDN5
221,566,803 *1542A0786D42F60DA48B7E0E3048E860D309214A GMASTA
221,566,804 *154EADBD83A6E6D563D2DAACD18EA6E2B7401C1C GNAOW
221,566,805 *154BD7A75C3AEB4A0296FF9000E130021DBFD30E GNITIDEOC4
221,566,806 *154EC7F62EA81964EF421F306426A26B4A06575B gnitpircsnoc
221,566,807 *154EA539271688AF74508052EFA2028C90465CEB GRACIEADAMSON
221,566,808 *154D8391D878E2520446BC5785CCCEC4E288B1FC greggweflen
221,566,809 *15468CD92369B31DB223A28CEC405F79246C169C GREGORP5
221,566,810 *154579F2B3CF9C1573B68D6CE5DC97D54D9C41F5 GUBDTVAN0
221,566,811 *154B856B1CC7B47387444E67B414147BA234D3AF GREENCHARLES
221,566,812 *1543DE4F42A6736287C9860627D906789711DC33 GUYREID0
221,566,813 *15423B3FA3E8AEDC5BAD67B38FC40DCA74A7960F GROVERS
221,566,814 *15404002BA917379A7D99C47557547D7C773897A guadalupehudak
221,566,815 *154A3F28CAA6541B505BFE6FC1582B2328425C0E ^/HAAA
221,566,816 *154EEB02F8538BF9804C5A8E5A41CB9A03A9DBD6 guodeman5
221,566,817 *154773E5E69C5656625D05C982A9F2407167A85B GUY-INCOGNITUS
221,566,818 *15496ECEAF13628749320F7033C8DF33AC0AEFA3 HANDLICHED
221,566,819 *154FACAEBA6C4577EFEFCA3B41CBB6D6A15951BD [email protected]
221,566,820 *15491A535223BC52F83A63D8C1381CC5EB236D70 [email protected]
221,566,821 *154B9BA5CC694C2474F423088159B545B0860B49 H3SIT4NT1Y
221,566,822 *15467B09F2B92165F289D8E5490BC86D221D5D94 [email protected]
221,566,823 *15493083EC7C989A63AD56DD8052EA6C6851EAE5 heartburn-candy
221,566,824 *154D6B7A7FD664A24EB422231AA8219913CBA61A HCAROLS3
221,566,825 *154748E14B0ED57B981417E8142AD35C66379C08 [email protected]
221,566,826 *1544CDECFA0CB1830D60ABF5C4C1550C4485D2CF HDILARUM7
221,566,827 *1548D353A51C2F7A3402D6AC9E1D6F5991166D70 HERMANNLÖNSFOTO
221,566,828 *154C1C08D058E307876F8915420C1BFB55A74B91 HERSHELKATSUDA
221,566,829 *1541307925C2A1E75E1C420CC4E50F4055B9FA02 HERSHEL.LUTRELL
221,566,830 *154FE51192878D955C2493CE88D493921B407712 HEMATE
221,566,831 *1544D8ACF6B55278E0DE8009F66B94D7E9A93734 HERSCHEL.FEYLER
221,566,832 *154EE73FD369C0878EFE0967503AE6F1F8514393 HERSHELWORN
221,566,833 *15430698DC069AB979979244D4BD7810433BC254 HE'STHATKINDOFFRIEND(FEAT.TRAMAINEHAWKINS)
221,566,834 *154AF5C727A899914B761A03CCF354E652708089 [email protected]$TRN9N9
221,566,835 *154FE1950421E36C837E4C56F05CD3AA3F744BE2 HILTON.BATSON
221,566,836 *154CB1F0881C415CDA10E5BE8346891F4C57D40D HIPOLITOLEASY
221,566,837 *154455D7FDD02263DB42168CE6CC129AEA6D7211 hongstorton
221,566,838 *154A7AD341A5AD797B56C64A7256AE1CE2FD8E74 HOCKEYKAYLA
221,566,839 *15483D9223B089CBDD6C96380F802F597B255AD9 HOUSTONBURGENER
221,566,840 *154CA42B8EB5D236B52B3346D6A60A5C47769B88 howardketelaar
221,566,841 *15484C13322AAEEB42817FB34420329CA2EDDA1B HOLLEDAY8
221,566,842 *154601A1CC12A2DD8E0EB4894736AC1E0467DEC7 HTTPWWW7SHOTSCREAME
221,566,843 *1541D6C7869D05713EC8C4C6135B4989B18120B6 hornet53
221,566,844 *154EAF8D9CD992AB05C90F05D4527EEB94DCF143 hugglefaeries.vs..bog.wolves
221,566,845 *15421DD552E54F3540D391CCB2C925A4E034942A HRUILOBA
221,566,846 *154FE6BDBD87236842E3938D85FEB2E1F50EC6BD HUMBERTO.WYNE
221,566,847 *154B4D473B6010CC8590299288B88DD6A4027E69 humorists3
221,566,848 *1543BA69DDD6DB9FE7A23638DE0DDAB764AD15FA hsiytrof
221,566,849 *154182F4717D48332BFFC324209E3E17547BE768 huda-malik
221,566,850 *1544BE812CEE654A214B8E460F903D3EBDE51FC0 [email protected]
221,566,851 *15488DECC2CFDEFDE34E91A30C291F37F628CDF1 I>$.
221,566,852 *15449A8CFE91BDB194AA7703364B35D4030A2072 IAMCALIFORNIA68
221,566,853 *1541B2440DC29A72759F31ACC488AA629D2BE145 [email protected]
221,566,854 *154E515A9E9FD3A9DDA4FD376612BCAF6FD6D6FE ILOVEORANGE13
221,566,855 *154CCCC2FB0F50C08E763A294308C71F3403E62C idiotcat5
221,566,856 *154523FDC5801621F5977A9FD49426587471A885 IGNORYING
221,566,857 *154DFAF0318D0E2A1B7C92D4489627AD1B275FF1 INDENTED
221,566,858 *1543727D725FB56118A04A2BF689011067B5F307 iluvstrawberry71
221,566,859 *15429330794758D00801E5F2D581DF3D72FEC828 irritato9
221,566,860 *1540222CEE2D3A44BE0C2050D2F5D01525F6828C INFRASTUCTURESBSW
221,566,861 *15422CCD22395DE56904B8B4B7D50FF6CAB88EB0 ISIAHKONIECZNY
221,566,862 *1546F0FC29B893E50687E06D2009AE32A488338D interframe4
221,566,863 *154045C34FAB30B50AA9BA21CDEE7CDB7AF89247 IRISHART
221,566,864 *154914014F2F4D976C48C09495723FEC17B5D2CF jabulile.zitha
221,566,865 *1546135F288995AF6E35FF761276B788AB70A66E JACK.WYSONG
221,566,866 *1543101B4FB852E6793BB6F52819349FABD1ADF5 jaden-lucas
221,566,867 *1540942AD526A5472289FAC809063251714A0809 JAE.KAUPP
221,566,868 *1548D745383565C53FC29633F0E555DD821B45EE [email protected]
221,566,869 *154BF2AB959A132553A170C77F8FF443E80A74C6 izbeglica
221,566,870 *154A7A7E2D47CA401B56990251D6EA4FB80843F0 J240973
221,566,871 *154E8008316241BC502F93A2E9FF4F8E2BADD77A jacquesstaber
221,566,872 *154B0D3B8315D285A1B4D5F7BD1F239EB630CBEB JAG.SKA.G
221,566,873 *154ED3C68C3556DD4DDDF6F23D1126370E75645D jaredrather
221,566,874 *154CF497540BEBF1F04423F520A158595F0F3F6A JAREDSABRINA
221,566,875 *1545D47A095880B0A81DA7D0C2BBD0BCD61EF75D JAME.PENSIS
221,566,876 *154AD62E1C5ABDFE0BD5AE1DA5638728DD276ACB JAMESBEANBLOSSOM
221,566,877 *1547ADFD0DC3EB5025776FF7480975FFFE6FE8B1 [email protected]
221,566,878 *1546F21F22461920B2BB42EA2764C7A9B3A37D26 JCPRONDZINSKI
221,566,879 *1542A7A6F0301ED349D60A51B1E082A7832A30E0 JANRONNIE
221,566,880 *154581E65EC1B1FC752CD3599B98928ED3858E73 JARVIS.MACKLE
221,566,881 *154C176C47449B06E1599098E772A772B2CACB59 JEFF-ERB
221,566,882 *154BA862E8CF7F8BBA9FB945960AC747B6168CD9 jeffereyrheingans
221,566,883 *1542A8502BB559CEE1176EC451D75EFA26C0B3E6 JAVIER.MALESZKA
221,566,884 *15444473F7C8FABF7BFE1FF2C47B8B2284C8F070 JAYSONGALEY
221,566,885 *1543D888AF9C9B121B19A4EA95DF6D14866F7F02 [email protected]
221,566,886 *1549EDBA957182034F0284141B97596FAAA524A9 jenniferliguori
221,566,887 *154C1AA43812923DA43DE5242C02D0E612CC9B7F JEFFRY.THURMAN
221,566,888 *15475ECC59C03F2CAD959BE1C189DCB9F1393B56 JEWELANNV
221,566,889 *154ABF8566EFAF38CE151B81B17323834BAB6CD8 JEWELLEPLEY
221,566,890 *154F1A752ACE217853803EFFF035648F1DA2B0A3 jerroldkrapfl
221,566,891 *154A4473BDFFAA66A04411272EBF26792C3C4075 jimstapf
221,566,892 *1548269FA4A937DF47B16B9ACBC5E1B0F4072168 JESZA
221,566,893 *1549A026769BA9B0A5245BD311BDB303F72D013C JOELTASSIN
221,566,894 *154677303BF1E1153D3152BFDDF046205C51711F JOLLANDA
221,566,895 *154E6BEC3197BAEF12CECF553C40359743EF7F8D JLOMBARD0
221,566,896 *154B91D90472C26B402B1D056648E448F7986D57 JOSUE.MCCALISTER
221,566,897 *1540E46B4656D1340DC3972CE27408C60E0E9E09 JULIUSSARAH
221,566,898 *154C912CD5CEAC619F17539921A47165BAC63401 JORDONLAFOND
221,566,899 *1548BF7B1528F346B6B6E84EDF2A17317CECA18A KALL3
221,566,900 *15423ED8F685DD445BA1F58182664B4E308476D0 JOSH HUANG
221,566,901 *154A5A183669C9CAA25CE85FE08CED4DE19F6DBA JOSPEHWILCINSKI
221,566,902 *154854ECE475B67930E7BEE851EDF370667B9390 [email protected]
221,566,903 *154BE4986D34B5EF9F351A1394DE13ACB0870ED5 kathferdz
221,566,904 *154B60EFBC9C1E74DBD726C1B0ECB4EFBCB6E829 jujuland
221,566,905 *154FE809A279CF21ECDBA11E64992CB4E86251E5 JUNE.BOOKER
221,566,906 *1549AE87D9EAC01490F153E7EB3E16F29A569920 keenanharradine
221,566,907 *1549F063681EFED268EAB5CEEFDCBA7FB996239D JUSTIN.BAYT
221,566,908 *15416D81222F5CF516A36221FDB9A657908339C0 KELLEYSHOULTZ
221,566,909 *1549D2341DE6E54C86C46A13460BCB68FDB4112C KENETHDALES
221,566,910 *154E64DF6773D514ABA0F4F13EFC1BE9A0055BAA [email protected]
221,566,911 *154DCE173FCD2E22B590FF8075BBCDCACDD314E7 K3607
221,566,912 *154ECB248F9C929203CA145A8EA3F394766B1C65 KESSLER(吉他手)
221,566,913 *15484A22C3896EAD4CD7E708D631A1C76CD587E8 kapphahn3
221,566,914 *154F3106497A0AE28B61A3627764B14A26C3EE17 KIMREEDER
221,566,915 *154C501DA9F4626B43285D6A97A1EF3EDE86835C KLRBEAST2
221,566,916 *15497713DC560FF4DA8A7B527780630403657ED7 KRIBBEBIJTEN8
221,566,917 *1549A461282EB40C24FE89FCE30376CE817C7256 KELLYJOMOORE
221,566,918 *1547A448E840D195BB45B1FE073F044D3AC9C745 KENLANGHORN
221,566,919 *15456E93F1E9EE6C7CDDA62F0A4195AC98381808 kennethonaga
221,566,920 *1545CD20E0A724AA649AEEA740A7163E3D1AF3E9 kennylewinski
221,566,921 *1543216C048060DE2BB2E985F548124174D758DD kentdiggins
221,566,922 *1548503197088166F1CC8F915EB9F17AB44CCDB4 KURZ160
221,566,923 *15416666711C1CA881C89156C1CF08390D19FFA8 KERMITSPINNEY
221,566,924 *154022F53FF470D57FD6A9ED6C38287214CD0B65 KYLE.BENKO
221,566,925 *154903690363AF48CD806D21557E91D322C269EB labocaconjabon
221,566,926 *154F6F5F3A05445E1152C063584A8A160987AC80 LARCENOU
221,566,927 *1546AAAC73D8484453896D26600C68441686B6DE laurie.hedlund
221,566,928 *15444F1A2B41FED057124AE1F0388FA3562FB660 KLEZOORBEITEL2
221,566,929 *15433D4F9E69E73502DEED1FA78F72B59309E5AE KRUIPERIGST?
221,566,930 *154B493928EA0E0CDC5544DDD4F08CD931E05666 K.TQ
221,566,931 *15413230DDD862C2E10EEF40BE5E4C67ADFF3E7B LIL' CHICO
221,566,932 *1540676352C72DEF6862C96143949E882B9BDB7B KYUUINKING
221,566,933 *154CAD775E46358C81CD0B28CA4ACA0446625458 LAATMIJINDIEWAAN
221,566,934 *1548525629D99EBEC34BF07E742FA6DCA4F16FF6 [email protected]
221,566,935 *1548146898A3DEFF55CED138CAFA18E886729BC0 LAMADRIDLANUZA
221,566,936 *154157A51F5C9140C90DE62CAC7888CFB2852B12 liverishness1
221,566,937 *154955F9524C04C5EFBE6D1447F689F773F0B138 LANNY.MACMILLEN
221,566,938 *154D82385D5DE509096A684C482B19831FD814BC lny
221,566,939 *15463433A54518220592B1AC7605F7010528A012 LOGAN.BARAD
221,566,940 *154EF20A072D1D41AFB093B2E3D39D484C7543E7 LAVERNE.CACY
221,566,941 *154FB8F43D669BE125C67F7F0E94804B93604FB7 leandrosinquefield
221,566,942 *154D90917B355BB6C2F6142D851E2CEAB96EB7B6 LOVEILANY
221,566,943 *154A7E4C996BE5B75FBB5A074C5FB617E93CD8C8 LPT#
221,566,944 *1549220800D84F681F4474ED3342D6F2E92A9ADC LEN.HAUS
221,566,945 *154436710181088D858CA94D2C44C06C586CF020 LUBNA NASEER
221,566,946 *1546A27369B715EE138128F165F99B2931C96DB8 [email protected]
221,566,947 *154375CC347D609F569E89FBBA256735EBB5CADE lerpotte
221,566,948 *154E9E0EAF4C876E50B194E1F0D2342D99F11330 LESTER.SCHLENKER
221,566,949 *154594091049F402BFB62CF997B3FCACA52CC336 LUCIUSSIOMA
221,566,950 *154EBBE2AAE1BE010674EFD8F3654A7166E480C4 LETHOCER2
221,566,951 *154AC59FFF286D1DF8839AEEFAF910E071D96EDC “LUXURIOUS”
221,566,952 *1549F8B30DDB0E5F6F87C6988F339F05341B913E [email protected]+
221,566,953 *154B9D56A3A4E59EC6B2E0259D94C99162269D9C MACPARMLEY
221,566,954 *154CA7963BFC01FEA2B567B15C3FAA5512515260 macrill8
221,566,955 *154D7EC5BD537986A08C1F0D922D19DA0E8ED9FA MAJED ALGHAMDI
221,566,956 *154014172752B4AD389606A883E21B185CE360C2 MAKAI0106
221,566,957 *154279077B4BE70A45EE8A92E9AB82BE0B2CBD7E lny
221,566,958 *154301E64F5A173A07A2BB9253BEBDCB6DAAD925 LONNYNUCHOLS
221,566,959 *15411C00A9AA9DC13387806DE988FD103009EAEE lonnysievers
221,566,960 *1548C64DA06B01137650F276B2B80BD8D33624FF MAQUINARIA INDUSTRIAL MISA, S A DE C V | MEXICO
221,566,961 *154001740E2C9E9413F46464BB32D5CBE33FECFA MARCELO.LESZCZYNSKI
221,566,962 *154912ED822DE55DB609AE0618B8BEC174CD3EC5 loschboot
221,566,963 *154EBA920F12EB51BACC5CC11870C462C2B7D98C MARIA.ARCHIOPOLI
221,566,964 *154F630850ABB1D14D28BAE3F0D27F61A88DD1D3 [email protected]
221,566,965 *1545A97078A2F84E61E6D57664C6B542D3EE918F [email protected]
221,566,966 *154531705BB1ABBBD7F7EDF6FB5FD4C7A9DE41E0 LTHMPSON
221,566,967 *1544A8B614BD7F520CC4AAA576EF71F4E1203913 mars, arizona (dfa remix)
221,566,968 *154A7F2722EB128830EA3AD3A38F9F8438A64A6E marvinescutia
221,566,969 *154F011DDCB87BF3F99E78D6B0AE92C5D8AE6A7F marylou - part. roger (dance)
221,566,970 *15415FF20CA8F8A1A892662ED834FBA9369DB757 MAURICESHIFFLER
221,566,971 *1549DD74B36B8745B2B3D233298978542889C64F MAURICIOMCNAY
221,566,972 *1548335C4F07A687B46635DD171F60A80D5AD571 LYNDA.DOANE
221,566,973 *1543353488EFA3C1B8738C22F7BA81694DFDB6C4 MAZWAN1991
221,566,974 *154436B53B2944E9D1A263ED393EFAF6C690D9B2 M74106
221,566,975 *15445CFAD3B452DF7CFBFB6DC3411A88EB45CD46 MAARANA
221,566,976 *15497E4A6AA125CDF86DA08FE5E626C2EF66BE3B mecmoc
221,566,977 *15457441DDE38716864396F48D57517ABDBED344 MADIJAN6
221,566,978 *154DD63C32941522F79402B0D564AF2CB24B2D94 MEKDES-YOHANNES
221,566,979 *15417662EF0A3454C3D2545272D15051E71DEA7E MELOUCHA
221,566,980 *15484F81B74DC39EBC7AC450987F81AB5B4237BB MANROUTTE
221,566,981 *1547DD52593E05675E2B58FC95A223B2383D35FE MANUELWINEMILLER
221,566,982 *15476A9E1CD074B569FDDB2B5B0B440568E8C476 maoripartiet
221,566,983 *15479BA972101763DF49E14ABFA1A64DC82DA5DD @MGE0RGE
221,566,984 *154FC422F55BBB69558E83412CF97D26E2EA2F51 MICHAEL-ASHFORD
221,566,985 *154394B47BF7737EBAA6A78475C7C094C7AE6EE8 MARIA.PAWELK
221,566,986 *1540F32F06839A5B35FEE5ADBE51648FCA07E611 MARIE ANTOINETTE
221,566,987 *154E78826244DE739D87B39D71C590D5FB463397 MICROOPERAZIONI
221,566,988 *1548744B2C6A9215EBCEF6029B8DCD8B40B1AB31 [email protected]
221,566,989 *1542B8CE9F84E7B048FC2B6C3AC94662881E756D MARLIN.DECATO
221,566,990 *154265D65EF578DDED93DD2DB356F1F5AD3D63E0 miguelhuang
221,566,991 *1540D8DFEC7334FC03C6E04A9C007180FDA69F5C MARTINBUTORAC
221,566,992 *154FF1BC8935D483A09321968881DFAA45115F6D MILTON.MOSCHELLA
221,566,993 *15482D7ACCCDB639EE07B471E59B7437B756DEA6 MINASCHP
221,566,994 *154CE3F9B93BE7453108111BE3B969A1E6AB17EA mary-gawel
221,566,995 *15415198668CF629F1B1A48DE526F83AD2A442CA [email protected]
221,566,996 *15421644DBA527AEB30EA472151814C603B9503E minimalvarianter
221,566,997 *154F0D74411DD3F4F097F1AF9DB2B8D60A223FF5 MISCUCHAS123456789
221,566,998 *154ED9588AA6C757DF26AC3571537E38383BD4C5 MJÖLKUDDENS
221,566,999 *154DB595414C830382AD1D76B754A9A165F0AC09 MOHAMMED.BEADLES
221,567,000 *1548416A6785B267A762DC37956E4B0E8E15A0FC MELISSA.CONERLY
221,567,001 *15434A00A5E60E0235658F39B69F510A1BB864DC MEL.SWINDOLL
221,567,002 *154C573D1B860A8C37B53E157023C780288F0305 mollusc
221,567,003 *1544EDE4CD537C0250C14072681A0237023ED61E MORSEHIGH
221,567,004 *154FAF11F6FEEF07318A193727C574F5C8878AA9 MICHAELGUSCIORA
221,567,005 *15450FB7C69E99EF15002143602C21227200138E michael.pentland
221,567,006 *154B5EE9B8BC19F7852BC4E065CB0500E23FCFF3 MICHELLEUTLEY
221,567,007 *154ECC8A155C5AB21332199363A9F7A33B9AF9B6 mimi()
221,567,008 *1545D7A86816D6C27AAE344B9EE652C458DCF97A mistymax3
221,567,009 *15407B25BC22C3F4F2B27943E415A98105655C7F n5018749
221,567,010 *1549534BAF2884DE15DF0599050718F86916ABB4 [email protected]
221,567,011 *154C35A4719365800B3BACF0CFBD077B8479DA06 nacurrev
221,567,012 *154D648CEE88C0020E450003E8CBE9DFBCB54A8D MO-QUIERES-QUE-ADIVINE
221,567,013 *1547A976093053630A90E6CC24385D8703C726E7 NEAL.PETKOFF
221,567,014 *154BAFD8217EC9FCC4918CA659AFB4D43B416E71 MOULINIÉ
221,567,015 *1540AED981A9677CC92D8CFE6A9519637E33A235 mtboybbs
221,567,016 *154B202638714C00F8390FFDADF7929D3529D967 NEVILLE.BLOOME
221,567,017 *154CDA137271BAF8DA27EE827C3B54336934E3FA mutatomuzika(demo)
221,567,018 *154E7641FD6E90994EDDBAB375A6AE879EBE4641 ngdvbsw3
221,567,019 *154CC81C5D72F3FC2AFB6A215CCBA90B29C049D7 NIGELVEENSTRA
221,567,020 *154BFCC1930CE1F77CD30DC6C736C622F5D33C9F NIKKI KOK
221,567,021 *1546916C0B228579F4B41A3F6B610F69624608B0 n9`W.q
221,567,022 *154BEED9E4079C2151C3F9E4BDC2CDAE307BEAD4 NADEGE-FILS-AIME
221,567,023 *15429F875AAF364F1408B0E0AD5E64DB8C8D0C2F namniah4
221,567,024 *15401E24814279B4E6FDEEE9107C38BAA3AC6454 NORMAND.BENBROOK
221,567,025 *154E8FE7A7747CB2C78B1054A372DEBEE02FFCFB NORRIS.ROCHES
221,567,026 *15469F015CBEE283A02DA8F72E67403227D852B3 northwestvisioncou
221,567,027 *1542A72320F356C17DACDFA7436AC657679E156C NAUTICIEN
221,567,028 *154EBBC70E63A562AB76D080582F9F80EA490388 NEDDRAAK7
221,567,029 *15401B88D8C021F39E0EB6C109318FB17DF35B5E OBDLLIA6
221,567,030 *15459B513979756C7D309FFBF6A49D90766804EA ONAVATADING
221,567,031 *154A6D63A49D93D2A8139BE93D6F74DB0D15EBB1 noncorporeal9
221,567,032 *154AECBD251B27B8CC0D7AE293C912E0099E8AC1 normandbloomingdale
221,567,033 *1544B0214CB09A08CDB629CB054BA6C759569C55 noviello-carr
221,567,034 *154CA02B84CBE468E1290EC6E0384C30CDEB7FBF npnrsly9
221,567,035 *154439CCDEE138FEC9852B8CF87EA17210F1E977 NUDISTEN5
221,567,036 *1546BC138C41804261A4F405B73BBBA2B6006BEE OXYDERAIT0
221,567,037 *154B850F2302709C89C944BCA702E9381F7CAA8A obstipant
221,567,038 *154598208FDC9F328818FF907CD779EB089D91F3 PACHTG
221,567,039 *15401867AC76BFC2FF115AF8063031CFDA6589FF ol0
221,567,040 *154628F956DB41E582DF415F4D8FACA1F8C74136 PERIODERNE
221,567,041 *154B95CC323949E71AFE32DCAF6D09677885613A phantasma5
221,567,042 *1545AF9E10E2143678BE07F4ED8659C00703AE4F ORENMAISANO
221,567,043 *1542C4DCA552BC37715421DC1CE78367B23CB0FC orvilleteisberg
221,567,044 *1547F8553CE37FDF240E613ADE8B33969982F57B pinky-espinosa
221,567,045 *1546ED9A6F8B761F77731ED13B9CB4745BB7FEC5 PIRATIC
221,567,046 *1546B599721D726E5CDBC8F1A87FFEEFAE5300C8 OVALNESS8
221,567,047 *15486CC7E7197D74672CD2BEC3EE4CBB0013809F [email protected] `~)o(
221,567,048 *154C064552A376FB24608EDDA6EBF866B06FAFF7 p0tentate5
221,567,049 *1549BEA041C18D412E33DB0D2119CA87D6B376AE :PO~O~DP
221,567,050 *154060CAA8283DD7C1A51E5531EBE03CF5A60945 PACERS75
221,567,051 *15440B2E956CF9264D975005D976009C88AC0E2A PARTY.109
221,567,052 *154AB8F65312AC9C5DF0AE008B2B5D248C0E3C05 PATESS
221,567,053 *154E2D0861E5F8D1D5EFE101AED4011C6F941E2D PROKLISCHES
221,567,054 *154872D7B5EA67B2AA2B6258B9F118C3BCEA2809 pearcmdphp
221,567,055 *154F83A43EA101149A4818808BFB5A5B6D77AF00 PECIALIZ
221,567,056 *15421FBFF5A6F5C27A2EB224577A58D318F42234 PESCHEREMO
221,567,057 *1540527F931C7ECC7E9963315684826FF2529B37 phpcehonm
221,567,058 *154239F95DA4F41209E353111E5108F9F66FD7B3 [email protected]
221,567,059 *154AAC3C947A29DF15DB3AE2893195FFB33213D0 QI[H
221,567,060 *154A80B0A7BE4BA845E94DA1A104C6DB895B69B5 POIN+MAN
221,567,061 *1541A7B6E9866C52319C2E25F2EDB48044C7FFA5 QUDDITCH89
221,567,062 *154A37AA403ABD3272C8088AD9DF46E1719A8633 RACTICBL
221,567,063 *154CA25CE83905E3B863C6AC6310D06AAEC27225 [email protected]
221,567,064 *15408F8989982644D0875DC22BDA6E865449EEA8 predefrayal
221,567,065 *154647ECD9C35CF65574AE3D545F2795B41021E4 RANDY-TRIPP
221,567,066 *1549455C067E0134C93FFF0A9AA589CB78902667 RANGIERTRECKER
221,567,067 *154EBC86826EDC366EDACA0A35411C9C08BD3A4E pumpkinrebecca
221,567,068 *1546CA0890891600AB14D0DC41669A9C522B1A31 [email protected]
221,567,069 *154B7094874BCC629F295B42AEF50225A13BE7FB QAZ1526
221,567,070 *15457E55E020FD7D136BDD92ADA11CC0FAC75FF6 q=b`~.`~splat
221,567,071 *154D568E21186C2604C35F6B2D3DE8BC52FA0F7F REFUGIOWIDERSKI
221,567,072 *1546F9F847E29A5D42838B3191772CBC12457198 QJIBTYGN77
221,567,073 *154FD6394A1708BA8A42D0C21562B3B84DED09F6 Q###P~0(0_<)
221,567,074 *154CFE94A750384236671CE442A316E0C6186A53 [email protected]+!ON$
221,567,075 *15428BEB3BEF708AE35D1D59DC8F1AD550DFA99C RESJAGGERING
221,567,076 *1543DE41AFE45A05F28E7CB1C3360B84E51D1FC4 RETRIANGULÈRENT
221,567,077 *15446DB5A73E1ACB5B8D12D08F5E4A856356E814 rfc-rfc-rfc-06
221,567,078 *15409047010AC73AD40DFB26EF9DBAC9FEA7C985 RICK.BURRIDGE
221,567,079 *154926793BECFCDEE1BF0A77D48F3738F2920259 RICREDERANNO2
221,567,080 *1546F91D2A476894A671D06350E317E5FF1BE22C RILEY.PEETERS
221,567,081 *1548DE28420D30BBC20DC9E1A8DFAB4FBD565E60 rindevall
221,567,082 *154224AF2BBFAC1518B3ACC1BC6C675F80C88B56 ROBYNSPURLOCK
221,567,083 *154B0B7C4C3033F867A2CBCED49B8739AF5E16CB REFUGIO.BOGACZ
221,567,084 *1549E7AE60BC91E653AF41A49DC6973F1F9E98F1 REFUGIO.CRAPPS
221,567,085 *1549F1F493F0288E1B2F9FCF7AA0D7735656D1D6 REFUSERS
221,567,086 *154E6E9525E3068ED0415DFE4A6126B0F7A5B929 REINALDOTALIMAN
221,567,087 *1541B49653D5AEBB50AEBC693C5104D311A34C85 RODRIGUEZTERESA
221,567,088 *1541A676AD1582FC33FCEA21FB0B97F7B0A61F31 ROMEORUBICK
221,567,089 *154DFD3A698F5E59B5DAFDD3E4D3B1B797980353 ROSENDOBARCUS
221,567,090 *154E4604CB5D3201CE59D8F7F1B7E4860484B390 rosslegrande
221,567,091 *15464C8306FF9433C245B1E285C417C6F14B338B ROUGE(REPRISE)
221,567,092 *1543AEBF9DE6B60F6F601B1BE7C55769270D900E reymuzquiz
221,567,093 *154B55AEEEDC5A0934C1703B1FBFC7A0F81F8419 @RGUZ13
221,567,094 *15485B3E5DF38098A0D86CCB54A64E212C94AF8C RHAMPHOI5
221,567,095 *154ED94A0F7F55269FAE1F94634E5EA64C915887 RIBAROM2
221,567,096 *1542A969B52CEB46326FE621EF80EC9B4E2BFF32 [email protected]
221,567,097 *154EB4F639DEB36358158582EDB63952FF2D936C richard-drahcir
221,567,098 *154C4097814BA80D8BD3900CE8730A48F9908A81 RICHIEKEPPLER
221,567,099 *15499837D5BE8398028DA0EF81C828EF8828FA9F RUEBENPACILIO
221,567,100 *1549BDCD5E3DD68872D1F8E21C217AD3C0656E8C RUIGEN!
221,567,101 *15491EC4EB3B1418876645B5E310955093B87922 RICKHIRE
221,567,102 *15432AFA182E45B425F4D84FA642F8C8D5225310 RUSSELLANLIKER
221,567,103 *154E34DC19201358B3191D2CB96130C09E858C8C RINOHANSEN
221,567,104 *15404A3037284EFC5AEF4D51081435EFED8BFC24 RITNES 1
221,567,105 *154F21A3F927DAC1A4D7A42AC3D180E3D89F5C18 [email protected]
221,567,106 *154640F6EC3C9D19F21DA428A3BB47912EF35D2A ROB.BRUMLOW
221,567,107 *1547CA35210E5672F9D1F12F95E19CDD857EDD73 ROBOSKEETER2K7
221,567,108 *154B01A5F54D8033D68EAF23A77A2BF16AEDBDE2 ROCKN'ROLLINGOURSELVESTODEATH/JERRY'SGOTTHESQUEEZEBOX
221,567,109 *1543F99FE36E1B71631F1A479AD0FE065FA5878F RODHEEBSH
221,567,110 *154F9CC5E50B6EBC2188754749E7629AB16FB83F SACRAL CHAKRA FERTILITY
221,567,111 *15468AA01BE8C44BA4BCD8D99F92ABE42CC22B1C SALAMITACTICS1
221,567,112 *15487318DDA9B23C6EFA9EE61DD416A3C5EA3DBB SALVADORVONGUNTEN
221,567,113 *154954A38F0030E90DB9B114D994987BFC3F037C RPRVBLTIES
221,567,114 *1549A3FD6A739B346E2462F4B8F0B6443A135FA3 [email protected]
221,567,115 *1544EF0074EBA6FC2768732497046A5467B42C27 RUDYPAPAN
221,567,116 *1548207366ACBB0B246360849C4812C5EFB38346 RUINABAS3
221,567,117 *154547787DC22EEA1762D8F94CAA635C0D4670E4 RWSVFNJSEKBWJ8
221,567,118 *154351B09A1661009825F5CBA2319E4276710462 r}x#
221,567,119 *1543F88AA21CF5E56CC3853AB361C67FE2692A59 ryan.ollis
221,567,120 *154D02ADDA134DFBBD00F98EA967C146A737C6C9 SANDRA.FITE
221,567,121 *1549FCA8BDFF3F5EB4C41B275AD40DE7B5C02378 santodozar
221,567,122 *15472740BF38041CFFD68EDD4E4AC7355F293B8E [email protected],
221,567,123 *154E9AC798E7A4B296772229BAB87CB813B0D926 salimya3
221,567,124 *154CBEF951874216F197D0D11C3BC94AD2CB35F9 SAMMYBOHNET
221,567,125 *154516774B2B232E47804D574E44BF720489D529 scarcely
221,567,126 *15425D3850B71A598033FEB6C14A7B003CD33D37 save-the-drowning-child
221,567,127 *154DFEE1CE36B6398DA91ACF9702A952770BF641 schreck12
221,567,128 *154EA4A9565B6C5460C94A7C8D27DF054B124A02 [email protected]
221,567,129 *154599B1EC3F1151E49FCFFB53589154EFBE82DA SEHCTENK
221,567,130 *15495FAA67EC7387B39543DDB3858C63037E4F20 seizuretonic
221,567,131 *15495424A50D470DD1F52DEA93120836377EF91F SETUCBUSES
221,567,132 *154CC13C676FCFF2B39A0956A1BA075D164A318B SERAEDY
221,567,133 *154166311B7AB6DF1E7A36C346760CE4B341C753 SHANE.DUNSTER
221,567,134 *154F1EEFC6201CF2B857BA20517EA9B388C01B0C She.bathes.in.water,.yet.her.fire.must.burn:
221,567,135 *154DA02FE8577FF6A88E1B5DFEDA2B77845728CB She's.Trickin'.Me
221,567,136 *154F8D78EE6E3EF9948A44BFB2AA0E292B7307C8 SHELTON.HEMBERGER
221,567,137 *154C9E371CA5E33063A3369356A59D05402EEC1A signed-on-the-air
221,567,138 *154BF9A0ADDA83F8756D122997D9297400D3559F SIMONMELTZ
221,567,139 *154D8115C05E46DDC841BECFBD8B8E827EA30325 SIARHEI
221,567,140 *1542DB869C73CDB88D94AD35B29E3C9677934E3F SJOPDPS
221,567,141 *15489B484518F439D3FF510C82BFC668B2190280 SKAPNADENED
221,567,142 *1543A7DEC626EAFBB1BF52593696849FD6F7B15B SLEUTHESES
221,567,143 *15434A35EDF1ED1D71142117E8C9E6DB83584910 [email protected]
221,567,144 *154812171CE9B2403843BC7CBFEA351FDD278A91 sisordina
221,567,145 *1541A76CBED22C7C68DAA6E477C9EE218B0A21CB SONNETIZ5
221,567,146 *154AE6098FFF0BB2576428346F1CA12197D33BAD SOSRIBEIRA
221,567,147 *15459A2BEFEEE3A2775582051629D12CB2A55E1D SRETTATEB3
221,567,148 *1545572DD9BD5F5E0C4B37A951BD2A49FD6A1134 srichten
221,567,149 *154B480571A1A03F3663ABB7AA4258F2B19E13BE SSADLER77
221,567,150 *1543A4E371653D2C67CC9CF07E1AA3DB47D5BE22 stairway.to.heaven.(bruce.demo)
221,567,151 *15400B02A7ADD3E5603DC605B1D4BB411D5D0DD2 [email protected]
221,567,152 *1549262B507EA8B92602921C06B5FBA41EC6FF70 SQUEEZETHEBOXA
221,567,153 *1542D62727B146A4598986E8CA9797D8B0621EA8 sturdier
221,567,154 *154F83953D94347E545FF9C7449407C5BD361710 SUBDEPOSITORIES9
221,567,155 *154C4833830186BC8F5E277B011813DB90956680 STACEYKURTZ
221,567,156 *154CC18D27D0BDCCFB2ACEDE62383BED9F584C7E STAUSTRAHLTRIEBWERK
221,567,157 *15432D2A4CF57B11F38C23E4D666D15672024126 SUSHREE.PATNAIK
221,567,158 *154FD0D641ACDE9A63385172F49D1328D59F00F1 STEVEN-SEARS
221,567,159 *1547A3B5FE3E77FD4ACF255675E26BE06A148514 STEVE.WELKIE
221,567,160 *154C9503E0C30C08CD37F8D2425BD9919AB7C918 sygf
221,567,161 *154F0F276FA5E5A740831C03274831F7533CF2CD SÜNNIAASTAD
221,567,162 *15490E14F0A5B11B8EFB1EFA0BB5313A1ADB4D1D [email protected]
221,567,163 *154877E323355F9A1D89FAF17912610F06A3165A SUONAVAN
221,567,164 *15432281B894C29CB523F85A6F0DA387D2817937 SURCMEK2
221,567,165 *1543CA527471CF9CB6ED7ACDC955CA252D217CA7 T21993439
221,567,166 *154263E7DFC2316ED2EEFF26458DDF4F55F67FFC SWITZERLANDSCIENCEWRITEID
221,567,167 *1542C11FB61839F7E69741B581F09F63CE35C8C3 [email protected]
221,567,168 *154215ED6573362599146AEFAA4A55ECB3222B8B t0rtc011$
221,567,169 *154A2D1AC8780420B6847B71F51492E596D75653 [email protected]
221,567,170 *154CE3699545CF1751F71CF759500A53693A4F1B [email protected]
221,567,171 *1543FF599CABF5D60E027985E745CA842B0EEFAD [email protected]
221,567,172 *154B8E08FD0C040CF7E2056378560F6097630DF6 TARUNMATRISEBAK
221,567,173 *154DAC3C5B811A11B919DCC55952DB366CD75DB3 taschkurghan
221,567,174 *1545B48164AA3876781640E441B48B4286E07E14 TELEBROOKSSOURCE
221,567,175 *154494B7DD7B285DFE9D8983B38FFB5A25DCEAB8 TALKSASABE
221,567,176 *154BCFB3DB13EE9D893480D96443DF76603834B2 TAMIATIS
221,567,177 *15491F5292F09B5A9303D4DCB91B74586DA42CB3 tanner-cannon
221,567,178 *15469E59F4FDE26EEF5BC772C0C68D2B86D0B330 TANNER.MILEY
221,567,179 *1549DE091361CC6EC5101A8976CDE56DD11E578C terroire
221,567,180 *154EFA95A3C6F1D7DB80F9C1E49913D1D53E15E8 TAYLORGLYNN
221,567,181 *1544D8A567DD719343B578DE22F24D4875DF0E83 TEDGOLDSTONE
221,567,182 *15407E28E86824F127B90F0444D77B8AAFE985A2 TED-HOWLETT
221,567,183 *154531D9488A16B5B726C1B42B77B9B1C4A6C2A9 theeregels
221,567,184 *15497BB03DB203CCE77A6E1F56A2D095B1A60D9A terrencepenaherrera
221,567,185 *1543A6BC5B3BFC773FF84F9AF015421DF8CA9221 THESTARSLOOKDOWN1940
221,567,186 *15443A094EF1DA466983D384790893D8F1A7EB8A TIDESOVER8
221,567,187 *154BDB775759B5F32607349146574792D7688E4C tikortikor
221,567,188 *1540F19FE47E34826B812B85CF771DB6BC183C90 [email protected]
221,567,189 *154CD373B2654288B19BE6272E5358E7D076AA6A THATASDFGH82
221,567,190 *154BB4BEE6D538E195070776432678B4CECBA567 TLGAH
221,567,191 *1545ED0917F496BC8E76F176A7427E624C55ADB7 TLITZNER
221,567,192 *15457F1F9A3CD35B8747ABB5464DA794B73A0A90 tmbrlgst2
221,567,193 *154424CCB90E3B467DB4332A922BB4FD7F89FD7C thatmaggie1998
221,567,194 *1544068906C6C41E3CEFF190BF90A538D9DED5F6 tod.watson
221,567,195 *154069EF718279CF4EAC70120FE5B69F88DD25EC tokasuzura
221,567,196 *154CF1FEA5A3EA9031B66676D2FB86AE187BBC35 tony-chuba
221,567,197 *1540C05774D7F35475594DDA31F641A7C7A67E5D TOPODYNAMIQUE
221,567,198 *154B8F6C3F3DF11BC2FAA85310C109127930A593 TORPEDOBOOTSKANONE
221,567,199 *154572249237F7C6E64B2C69286684FC7E5273F1 tuztnqpwrn3yitic
221,567,200 *15476BB30ECE88A38297E7A59288D6CA7CA568C7 Tillthatmynailswereanchor'dinthineeyes;
221,567,201 *1545788956D0342C39178D82CE7B3DA023C0A250 TIMOTHY-PEGLEY
221,567,202 *154158E0300D1DA0A9A233D28D07794FF4C48A21 [email protected]
221,567,203 *1549A5B6F28F081C5E6C4089991ED07B81ED533B tiscali2
221,567,204 *154AAE3CB9CD00CD7782BE57142DA9D1E6B8AFF9 TMOLDING
221,567,205 *154EEDE8F061E696367431FC836A776AD48E992A UDAY-NDAISO
221,567,206 *1542C02E8BB664E78E8CF499429E602BDFEBD4FB UDAY-VANSH-MALIK
221,567,207 *154F4975706D468EF06E462847A57B0E9202298F UDIZ.LAGANNZ
221,567,208 *15448203ED9C6043F0C64F9ACFDBA3CD65B92720 TNEMEVAPER2
221,567,209 *1541203F1F251401796FAB240F40DCC09FC5F08F uG^
221,567,210 *154E2484725A750AA6778558DD3E5DD266F7B131 UNBENDS
221,567,211 *154A441056A24910BF3BA1A31BAADB1A05B02E4F unfulfilled5
221,567,212 *15465E8B9BD75A4A1A4F3C20108A28092799418D [email protected]
221,567,213 *1549F6D8D03A4C1982EC352D0F4EB16D7B693DD4 UREDNIKOVA5
221,567,214 *1542B3F4E40ED5A8FBF907E447F8E025A120562C USLU
221,567,215 *154156F84E40A4686D87DD87F59B223A4F17D416 UTFASING7
221,567,216 *1547FA3DF09066A57DDB182867D3796D7C975CC9 VALEN-DILORENZO
221,567,217 *15458561B68D596073F653918AEFB1158AABB6D5 TRISTANSTASIAK
221,567,218 *1549BB663E85E83D1C88CFD982285611738DDF69 VANAGLORIASTEIS8
221,567,219 *15413DF6DA7EDAAC80B5A0FEBB4C34AE691ED35B TROYBRUCEYARKOWSKY
221,567,220 *1540371639E025A9142E3C5DE6F135E9E4DEEEE0 TRUDNIM
221,567,221 *15478BBB1B9C66F0D66A4DF56A7F44A8146826E2 VERENAMA
221,567,222 *1543C86C2D6C8990D16E4F0E776C047FF2DA601B TYAS.SEPTIRIANY
221,567,223 *15439EDE55C218F2A87D0FD68030530E2EEF64D7 VICTORIO.RODRIGUEZ
221,567,224 *154BB7105DB976A17A2E8DB4599452C22485663F VIDEOBOOTS
221,567,225 *154D050012BB55F8866CE14BCD7078E6CE7562B7 TY.SULLENGER
221,567,226 *1541551E333AF7AD34E071F9FF69F6987F9FD2EC TY.WIDDER
221,567,227 *15438CE55C78259F910F534715B26DB65A9F0B7A U'3R
221,567,228 *154CE8CA3622817D74510CA8C13513690961D5A3 VK>V
221,567,229 *15435DFDE5AB205A8BD0410E580CE5AFEDAF5898 UGURAYDOGAN
221,567,230 *1540DC5F63C1009BEEA307E2CD47093AFBEC4D2F UJUNWA LESLIE DURU
221,567,231 *15485F1C90FAFECF0A71A253680F7903F42CF8FC VOLDBROHUS
221,567,232 *1542725F2B2C28CDF1EFCE34ABF728945450CCEC VONY.BOATENG
221,567,233 *154488BAAE10322B3F04619E62B46C7402F4C03D VOSCHERAU
221,567,234 *154E4F02FE49D6C4A2F86B71BC47B970956042D8 VWONGES
221,567,235 *1541CC40CAF70675F4A80A5CCB1C8F56EC9FB424 UNBENDS
221,567,236 *154568B476E80F45281A94353D0C912F0E93FE59 WANDALMANAK
221,567,237 *154B2D573E4691C7B609CD908D0C2ACBD15E393B up7y
221,567,238 *154BB7D2A31A3BCB6544158A60602842FB1B6976 USPLATE
221,567,239 *1547802D7E741F9D3BAA6940B36C758EAA1D1BE4 W,#B
221,567,240 *154A64183375C637660A687ACD8B2A52FF4BC38C [email protected]
221,567,241 *154A3C85605A6B90A7E2BD96430C187131E012BD WENDY-SOLSKI-PEDRONI
221,567,242 *154A22C32D0694D8AD46E8F82431E1A489D6043D [email protected]
221,567,243 *154FD2D7C51C5E5CBB271B0B4FDFFACA2CEBA1B6 wenxinghi
221,567,244 *154D1FC673A70CD245EA5A60FF58F09A55A3D701 westliche.lyskamm
221,567,245 *154A7A24C02DADE8F8EB41F9BB6103482E6E6740 V/1Y
221,567,246 *1542F06E2D07C7D05E1ACB10B3B999A7530B9894 V5S1CRAZBI16SETS
221,567,247 *154C2447F7FC1E3D2130CEDEDD42834E049F2ED8 Valamerre.1
221,567,248 *154CE7A05D16FA4F07CFEF0C8419F47E11C560E7 VALENTINA.BLANKSON
221,567,249 *15414AFAD81F3BDBC7248BBAFFBC73CDAFEEFC02 więźniarką
221,567,250 *154807341E2016C7C018349A898EB8A4EB3F17AE WILBERTJUREK
221,567,251 *154763982CDD7F4FB0163A8BBCED43575FE0ED7F wildingrawdidas
221,567,252 *15446935017C2477F5835CA2937844C661F00A12 WILFORDHILKE
221,567,253 *15476FF156694F9A45AEE9013A5562E49E9B24AD VANESSA.RANDAZZO
221,567,254 *154544001A90548762EEBE79C153AD105B52F795 WILFREDO.NICOLETTA
221,567,255 *154DFC6911C04830374CEF1A4101EEFC7760DD68 VARBICKHATHOROUGHBRED
221,567,256 *1542333D89B557A1CAE0E5D07E59EFFCF2AA5BF3 williegreenday
221,567,257 *154CBF0C7AF4DD6DB2B1955E9A5BDA3FFC75E6E9 venisesmall
221,567,258 *1548DEECA001245A8BC5584836535AA454662C16 WINSTON.KNIPPERS
221,567,259 *15442D53311F112569EC398FE11436051C0F5F00 vercika8
221,567,260 *1545C363A94EBA8CA9B25B1052243FA8898EAC06 VERNSOLTON
221,567,261 *154E50C502AA22D7F5E541A7C6469189D185435E [email protected]
221,567,262 *154647312C33FE9CA2E98CDD7C4D86F5E08BE002 WOODYDYLAN
221,567,263 *15477345923E4C76164EEF889B79269E2E030AAA VICKIE RACER LEONHARDT
221,567,264 *15476C498E197773B35BFF3073138EEB0A3CBF06 WW
221,567,265 *1547048D64D7CB0DC6EEE8F5FCCF6EA511A79C18 WWW.MYSPACE.COMJHOLI
221,567,266 *154D8C96A43EC13DDF39069C7CD498FCD24997EF WWWPEPACOMYE
221,567,267 *154AAA1FBC1D7F739C0E000227596CDAD85309C6 WWW.SPECTRUMPASTES.CO.UK
221,567,268 *154DF7E3B55DFDCA2F29C3DE54633B71217DCD9E wwwtarastrongcom
221,567,269 *154745E5220CEBF7B5E42200D5DD1EB46A9ED446 x3cu
221,567,270 *154CE48F1D64C4022712B89129455313F0F4AA53 XILOVEDOUGIEX
221,567,271 *154F17530CAFDCAA9C20848B7197A5CFEE085688 [email protected]
221,567,272 *154BFDEA8BBB17FE63CB33190DF76E37E620A61F YAQUELYN-PICHARDO
221,567,273 *154A0EA9757AEA9AA0C3E963DE8263E8CA730B0B YASMINARAJAB
221,567,274 *154833078E931652DCF3DCF58FCBA943D235ECC6 YEHPMIL4
221,567,275 *15468998E0D296846856FFE664C5835AD40012DD ylead07
221,567,276 *1542078B4A7E0A26F6229FBAA0D6D1D76C23E61D YUMINOO
221,567,277 *15420C3A3F610889E91E04C16F555C06796C58BE YUNAN FITRIAN SUNI
221,567,278 *154A23FC4F69055DEDAB9F88ED4E9C2C1346BBA3 VVDAYW
221,567,279 *154D576B3977B4E6C7821C147D7406026C644016 zachbutzler
221,567,280 *154F02174D58EF551744AABAB2078951144DD112 WAGITETS3
221,567,281 *1540376AC14A0F2AE3F9A23F501163E1064335C5 walorow
221,567,282 *154E7EB70CF77E2EB3D7CB1590C433494F0A1A08 WANDIRADIRA
221,567,283 *154571D0D96119E8B0CAD124B05483D0818A688D [email protected]
221,567,284 *15428597F2C73E6D306D19A6C34D7B1E60F72D52 ZRGHSNWXZZD9
221,567,285 *154F08771A26B5CB909B5AA4FBFBA1AE66FA9B92 ZUTRENI9
221,567,286 *1544A0718FFAC305966192A0FBB2AC3F6565CC18 WELCOMEZYTHETALK
221,567,287 *1540EFF25C6D403E87891673EFF3DF654D2313EE WELDON.DYL
221,567,288 *15493F456327FACB4F969FACEF9E21FF2A610B14 weldonstanger
221,567,289 *154823CEEA301AFE400025E2B64315059F1E121F WENDE CALTEAUX VALENTINE
221,567,290 *154679F1107571D9A9C1B6887A7693A58835C114 wendy-parlman
221,567,291 *1541078D6BEC784ABA161A286411CE29CE927329 τεсαπоτηсπεραі
221,567,292 *15428FE41D8790C28CDF45184A819453F72F2F59 КОНСЕРВАТОРИМ
221,567,293 *1546EA635207792F01FC6DD797B800D63C74E7A5 widhiatmoko-saidani
221,567,294 *15413B053D675F7D2ADEF53E47B3FA9F52D06C07 МЕГАЛИТОМ
221,567,295 *15476DC7BAAAF97C6651C2DD05051229A7E1DFF9 МЕРИКЕ
221,567,296 *154987CC3B2B72B296078E9E75B9A219A7619192 ЧЕБЫКИНСКАЯ
221,567,297 *1546AC9B41895DE585221F16CF34FAA652616ECA WIRERUSH3
221,567,298 *154F3C42D59B9F2B424A005C7A8C25BC18C5C810 WONINGENTYPES
221,567,299 *1543B51C0BA88E8E8017C866A71BC4B04F953ABD WRDQTV
221,567,300 *154B179FD466A27F8A5A09398E6F9108A9FC6ED9 wwwchb-lawcom
221,567,301 *15447DCD8D64E5184CC37A7609C1139FCD4BA9D4 在跟從queenie
221,567,302 *154EDF4E2125AD9C4F79F3FD30736F74FD2C6F88 X127506
221,567,303 *154389D918121ED1649A2497AA9B4B3674294C6B [email protected]
221,567,304 *1549C1219D8EF02B25067433FF26F0797A12CAC0 [email protected]
221,567,305 *154D0C8E348579B71A6387E120DEFDFDABF97181 [email protected]
221,567,306 *1549E9DDB11BB6384CD0603240076EF8072DAC65 打從EDEN
221,567,307 *154D711CD824A12D2995A82CCFA7170DAB33061C XMLDMCITY
221,567,308 *154B4C44FCBFD2300CDFA3FEDACC0AA6A2097FFE (X)*.*@P
221,567,309 *154957A3CAE983381E4F12FD012730068BF25239 )x(~-`-q======p
221,567,310 *154976A33F8A0DE8A31603850203ECD84A3515F0 [email protected]
221,567,311 *154709443F8DD575008D71A2A895BB45FBAE68A6 yahwehrtheos
221,567,312 *1547C017C69328E3B411B77F2D2FC7CAD3A91619 YANGMINGCHIN
221,567,313 *154411E93C8826ED73B9B2A316BF1B347E5CE73F YBALL3PPPLE
221,567,314 *1540360D5AAB7787A94685F53444925D87F34007 YESTERYEARS7
221,567,315 *154E6758E4F7A46388ED409D27CD4D473E06402D [email protected]
221,567,316 *154C050386D02DF76F71A20D0169EE9840C99876 なおき)。身長155CM。
221,567,317 *154417F981E3D57DA0148FC2CFD550C0FEF94734 還收錄了劇場版主題曲「地球へ…coming
221,567,318 *15404DC50D5B9F17DD7C9F0E0E83E8EA774908D0 yousafalishah
221,567,319 *15476AB642EE33EB8D8786380B808497E4B33773 [email protected]
221,567,320 *154C3652174DF71BAD9854EBC5E5114DBDACCC90 YUKHI.SEPTIYANTI
221,567,321 *1541F84D1099539E2C10BE7B768C652F32DB0754 yukte.oberoi.mehra
221,567,322 *154B607A8286D144713EA56FFBE70EB929B499E9 000devon
221,567,323 *1542D12197EB9D8DF909718A8472B5184930C640 07-28-1917
221,567,324 *154AF243EDC84C2E1BA32DA97D5D8D049ABBB724 0DSIDCUP
221,567,325 *15421C43B1EAFC164ABF7B19F6E25B3B76D7434E [email protected]
221,567,326 *15420F4778A241A417EF73BB42F0BA7BA150687F [email protected]
221,567,327 *154EF81AAFB6CBB8F47A4BF656FBC7BFE2076950 [email protected]
221,567,328 *154E635DAC76EAEE631E2CC632CBEEEE19DA6D11 1046115 karhu kaivaa pes
221,567,329 *154D439199582ECD9E1D406EC6FA782D2709C114 ZÎRO
221,567,330 *1548C424E86EE7FC956E4DC2B7F6E15953A0A08F ZZAHIDUL
221,567,331 *154F69C3AC0325DFF676F666D14E39C95005E5AB 12.FLACHPRODUKTE
221,567,332 *1542C4ABCCD7A6944787E8A6F9D50D78BA68DA61 1366588 tueteluettelo--t
221,567,333 *154FF20F79C6E9CDEA587F38EC67D1B0858C0A5E 15OLOGY
221,567,334 *154738E9826DC931769FFFD7799106AF9A76D953 16C“
221,567,335 *1541FA93D76585FEBA5EFAF3AE61B15067C4671A 1922LICOB
221,567,336 *1545C889B3A52895D473481BDB4249E6B8506964 1a0221816f458c70aa4c24c72d304b19-black22482
221,567,337 *15479B970A9A933D1D34B51D67A34BD152E12BFA ВЫЩУПЫВАТЬ
221,567,338 *1542775749626FAFB516B194BD309D4D68AF999F «господом»
221,567,339 *154293037006F647C3736B7AAD276DA25E0CB111 дозоване
221,567,340 *154E102163518D5D9B68E61EF762535086CC0585 1 BUECHEREIGESCHOSS
221,567,341 *154786AA4377FE962DCF5FA4A596161659E19D91 КАРЕНІНА
221,567,342 *1548B8EC5363C4A3A3448A0824ACB5831F1C3010 наскент
221,567,343 *15450141E13D5DBBEB6A72A8D63E87915DF99726 1HYGIENEAERZTIN
221,567,344 *1547FB6DB09C2B29F5BD0BC701310C56277B687E 1-immunojeniktir
221,567,345 *154248D2EB51E3BF3FBBE6808B562333D39B5D07 СИЛЬНОДЕКСТРИНОЇДНА
221,567,346 *154B76C8354AEAD7AB62A9851D67CF5AB47C45BF ТУРЕЛА
221,567,347 *1544DB3C247DE176A7681AE7B69ACE78A8C184C0 УСТРЕМИЛА
221,567,348 *1543036CD76ECFF0B281128DDF0B843CB729977E 1okw1id22k974gt60609wgma
221,567,349 *154D1E71F57EF110C8E845A4D923F0BFAAC51288 1.palkintokassalta
221,567,350 *15461E1AEFA6D77499B8DE58FA81C2C30D4D1FC4 1 RICHTUNGSSTREITES
221,567,351 *154D2A3EBBEC99E23DB114FC1A1315D980451C4B 1 RUNOKIELT
221,567,352 *154FD17BA9DEAD01BCE6D62F03C286F00145E2D2 1-sachdienliches
221,567,353 *1546680E3C7E007E5B377853B8AF3646138C5726 1schaupatz
221,567,354 *15442C6B2DDD52A9D5B722BE0EC89ECBB069122C 1THATRICHMOND8
221,567,355 *154819E52EBEA5FF7138A69DAAA106B563CAAC98 2034732 t
221,567,356 *154689657E94F16AF4C0C96B7A835C191E07B2FE 21-08-1881
221,567,357 *1541EB6EBEB9D0983827A81524E56B4DF4B7C3F5 222wer
221,567,358 *154021B1BE1C0A572E5F79E3AC832679A42C4F19 22-zauberhaft
221,567,359 *154D9941F59BE9EE911B5B40A9FEDA24C010988F 2513679s
221,567,360 *1544609E1F74093FD143B6B6A287FF54C91FF64C 263edith
221,567,361 *154D94BB4BDFBD939DA102BA93D36824B3BFD5BD 2721982 hier-picasso-,-dort-beuys-
221,567,362 *15414DEA816F97B16E0A0AB07DE26B71BB3DD7DF 我從來都沒說過這個圖片侵權,我根本不知是否侵權,但是COMMONS上有一句
221,567,363 *1546B102B4B6FA1A100269AC7E67E1E3E1122E72 等で放送が始まった時期とも重なり、馴染み深いセリエaの有名選手が実名で多数登場する。
221,567,364 *1548F94A8986A72F7A940354193165200E9D3341 2.ROSENHEIMFRANKFURT
221,567,365 *154D7131AB0340FD6599F7BD5B9E7C33F32792AF 2SILMILL
221,567,366 *1542A5791AF3BAC98F70552005E8765887822208 341elise
221,567,367 *154ECD6AF9E006A48B1A3DCD0EE951DAF416A560 36.win's
221,567,368 *154E1D33D093F8FECE9F91D2FA1327285F5FA48F 382202 edebiyat-fakUltesi-,-1985-.-(-3215-)-ardos-,-mehmet-.
221,567,369 *15484236552243745715CE9773D45D45FFA44A09 3APKID
221,567,370 *15429E314376A507CC86B309A4450BA4288B772F 07261065
221,567,371 *154F9EFDEAD713889F907F282628F5ECD6DD0B5D 0THEDAVE0
221,567,372 *154A18A6BC1A935D0B0B979468A32B55C47BB790 3.spruehtechniken
221,567,373 *154775EB5BC9B5F831760DC115EA85B923413823 1395843 EHDOTUS-:-(-MK-)-PYYDET
221,567,374 *15492461CE4C46BCF894A1401DE9C5547E6EC23C 3thepuppy3
221,567,375 *154909285529D35527D9B02C7FF725F06D11FF8D 3VPDJJXO
221,567,376 *154F13EFB17218419F8B23387B3F66A9B86F44C4 3-whoopi's
221,567,377 *154757FEFD2BC890A4216BC6E006D73ADE07F3AD 1484680 '.aber.nur.wegen.seiner.frau.
221,567,378 *15434FCE6D46808FF963726D634C0C186B9EB176 435771 RECEP BEY , " EFENDILER BU DEMAGOJIDIR " DEDI
221,567,379 *154BE87EE2CB311766A3491792D881CD5F527D73 4: 4 # & extenuating
221,567,380 *154BDFF6CA935ECD31C123FD5FA78A53789B1FE6 1564995A8CEDA4F09CA44CFE3FC62835.2030183
221,567,381 *15490E9D28F9032A30F75B6C2CD30C5E3EB506D2 15923 by-1983-,-the-size-of-the-fund-was-pounds-85m-
221,567,382 *1549250ED2383D44108D6D84BA51007703589921 1684294 alueelle-saa-sijoittaa-ymp
221,567,383 *15476DEF0323772A90D08240946A01C16D92B6FE 4ANTISOPHIST
221,567,384 *15430020FF290636023A52BEC9B3987739551FD4 1865589 JERUSALEM.,.27...NOVEMBER..
221,567,385 *1545FA7C38C847424ACFCE89A2ACC8F424123220 4MEGABETH
221,567,386 *154256004AE2DD7697C1338AAB52EB005B714A04 4NEDLETSN
221,567,387 *1547EF589FB290A66B24EA6FF38FE7E74EF7CF0E 1984226 T
221,567,388 *1547465F963F78D52F31D4470F0DAC191EFBBBE7 1998年7月18日、中公文庫、isbn
221,567,389 *15443E973EA3A637C1A19A8F0C9E5DEF643C33B0 4-TEKLINDEDIR
221,567,390 *154B8AD195C9149EF231EC7F2A78C41E2FD2E167 4THEINSAGENTS
221,567,391 *154E7E0397AA18A708C002E1C8AF6DBF3E3DB487 4WINDOWSRACHEL
221,567,392 *154A4009F6D8E2A18426CD4EBE57AA80FB989890 1.EU-TUKIALUEM
221,567,393 *154DD7A8E2ABAF3BEB2D365790894FBEE6E30C7F 519109 IKINCI.ONEMLI.OLAY.ISE.9.TEMMUZ.1919.GUNU.YASANIYORDU..
221,567,394 *15436152018DD5FAEE3FA2C477634B9179B085B7 5:5#&CENSER
221,567,395 *1542C2823E199660A2B28D5FC4CB4D7E4E4CE063 5698714723m//
221,567,396 *1547B2B6527EA4A243D8F17B308513A9FCE0B5BC 1.HOW-WERE
221,567,397 *154758CEBE7A370C110A8090D6D0EFAFC3FACC3E 599640 kertomuksiajakuviaaref-kerhostaesit
221,567,398 *154C5091420E033FF39F7A60DB129CD70BD2E68F 59.anabolika
221,567,399 *154103E692093FE07C90AEA21F6FEBB6934F6EC8 1.hundegleich
221,567,400 *1541560BB9B3ABA9FD537AE112E1940374F8227E 1-huoltohinnastoa
221,567,401 *154925F792BE1783CEA4BC139BA5830B5DF6ADAF 5BITTERTAFELSES
221,567,402 *1540476D11AF95E5B3C3FC6BB7CF5631C90A9C28 5CEPHALANTHI
221,567,403 *154409383295529F16BDE3481357D47D43424874 5COMPETEROS
221,567,404 *154E6E6ABD0C803D866948AC833E59378C7AA00A 1.kooproduktion
221,567,405 *154BA38B7510C83022391EBBBD17BF7806872E3D 5DUERNER
221,567,406 *154CF8A5FBBCAD7A4B5F8AB67608BEC2E984C14A 1lemnitzer's
221,567,407 *15418B9319ADD554CD4F3B6895789C43A389644C 1MARTHALER-PERSONALIE
221,567,408 *154C8137E40FC230A3DC0099E0932E631CD3B8F5 1-mega-churches-catholics
221,567,409 *154B3650D42C70C9EAE5A02C8DE613DE04606974 1 miniperm
221,567,410 *15461C26A3D7860A17C6050214D217FD6B411499 1MITTAGSTISCH-ANGEBOTEN
221,567,411 *1543462A28F52B260D574F28E97B11F7D5E9BFC9 5HERSHEYSTIMPY
221,567,412 *15448F0C1C7991046CDAE92BB347640BC5B248BB 1 ONTELOVERKOSTO
221,567,413 *154F6941DDE82D39F1612491FC682D9A803DB53B 1-panssarikiv
221,567,414 *1549F73902186A09DD3DF05490AC161D31FCF015 5MENNESKEVENNEN
221,567,415 *1542BFFC5F71DB8E3065B4E986127454193808C8 5MONDBEHOEFTENS
221,567,416 *154D1CF8F00CBDF71C1A9F1204D6CF001AFDE700 1RESTAS
221,567,417 *1543DA0FD3E4884A1C95C28018455D24E62797B1 1reticulocyte
221,567,418 *1544FE92A9E205EA956F2E0EDC35B6CB7F768AF7 1.saatuessa
221,567,419 *154EF99D2A3516636597D4D64DCA87BCF67F6598 5NIJEKANJA
221,567,420 *1541EA229AE364CFE891C76265BD755F6AF08D01 5PORTLANDBEARS
221,567,421 *154347A7B5698714DFCB522D4355CCDAB815474D 5REZNORLESTAT
221,567,422 *154970F288435A7516477B6BBAA90C205284AD9A 5SAILORJEFF
221,567,423 *154773B6341E5A31E6471DF7AE0F3ECA2FBFB757 5SALARISVERHOGINGS
221,567,424 *1542092B380ACFB1EA4DA480397C60B3DF7CD036 5SINDACALIZZAVA
221,567,425 *1547CF3D589ED9828073D22CC6769E3473CC951F 1.teipein
221,567,426 *154CCB18E5B4681CC7F261565AAA58826AD71166 1-ulostus-aukon
221,567,427 *15448C1D6CCD4B6F107A7A2B603131E34AFCC0AC 5WARLOCKEBSW
221,567,428 *1547D9B125040E63671A76ACFFF03E5CA50F9471 1 USA-GEFUEHRTEN
221,567,429 *154C66C9E8D025FCA308ED785CF7A0A2C1DEF811 1UUENDAMINE
221,567,430 *154131E20C8578A9156392ACB17153BD03889907 1.VIERTELJAHRESBAENDEN
221,567,431 *1542746BDB91728BB27CECEAAA50729447BBE3F6 2004年 GIANT
221,567,432 *154E54411E25B1F107A542E8061A02DAC8B89AD2 21-FLAMMENWERFER
221,567,433 *154554927888EDA9762FB31597FD682CC21A5566 22 rakennuslains
221,567,434 *1543C6D6F9942C1CA4E97E152414AADE327E7BC0 678qazedctgb
221,567,435 *1548B4AEB17CF0A31696EB03EC9E035BD0948A3F 25 EU-KOMMISSARE
221,567,436 *154E0E746BBE7F2142EC699B7E52ED6E84872FFC 6BSWINDESPENSIBLEBSW
221,567,437 *154ADBB9FD7DE8937CAF740D433ED8537736743D 6HECTORABCD
221,567,438 *154EF640A1FB5A7F060208B4F8CC070E3A92319B 2BOBSTELLA
221,567,439 *154A8D62484612D212B10188D82A6712627FDD79 2bronkioliitti
221,567,440 *154B6947C7464F78001B5615CBB7774E2D90014A 2ellenfeiss
221,567,441 *154710D44E1E7B90EDE94B7E45489AC4CBFE2DAC 2GIOCAMMO
221,567,442 *154376AA26749326FA4E0A1A605C3C77FC251E53 2inthemorning(featseddstylez&eboni)
221,567,443 *154DB8F7AB5D39DD5700E23B0D4D5BE368DDD5C6 2.LIBEROLLA
221,567,444 *15483BB4E8F5EC72C535940A9218DB64223AD188 2.PECTORISPOTILAILLA
221,567,445 *154A228734ACB70268D9F906DEE5644F3FB442E6 2.preautumn
221,567,446 *1543F42E3CFAC6C3AE7F3E883698185775A5153D 2ROBERTKOCHPLATZ
221,567,447 *154985B49C0F8D02A6992ED4F19665155D622786 2SAAID
221,567,448 *154084422A53BA7480607FB656C5F5ED989EF141 6-RAVINTOLAK
221,567,449 *154DB53962F374406C4F73D23E8D1C40F3D8FE08 6STRUKOVNOGA
221,567,450 *154DAD393C920BC45A852A48B140E405AFEC1B93 6TELEGRAFSKE
221,567,451 *154E9240DBFF962890386C7DC994C81790A2C67C 325FAFFY
221,567,452 *15423FBCADEC87EA8228D2FEA5C6750AF5850FB6 353125 LAUTAKUNNAN.TIETOON.ON.SIIS.TUOTU.KAIKKI.LIS
221,567,453 *154B68AE69015EBDE38C493F8965ACFC72208B92 365373 siin
221,567,454 *154ED1CF27971BF6F1C723618F3A32D6DDF7FCB8 7BSWITSINDEXBSW
221,567,455 *15410FF61C9FD8F946E65823278BC6F27E7FD69A 3gur3n
221,567,456 *154545DE62781F847237F68C6EDC922E94D382CC 3JONGWAN
221,567,457 *154272A1ADA29BB84CA75AFE4540CE964D989E47 7CIRTEMOLAHPECNE
221,567,458 *1549748BFDF0D73D59162A786DDFC54B425AE9CD 3NOTLEMG
221,567,459 *154DEE92B401FADB888C1F47524FD4DE0F3391AF 7FORUTBESTEMME
221,567,460 *154847D5EC0FD4E8D801DEA12FC04FDE9695C7E1 3------p~~~)O(
221,567,461 *15419390C48EC4FEFE17D422E5E2BE79DBD8779B 3######)~-sploit
221,567,462 *154801C32B6041B04C67684B98A983B8972B80C2 442GEGENSPIELER
221,567,463 *15442A613A301A80665A50CE55A00E5E3C511E46 455445 INS312SUTEMINICEVRESAGLIGI(30)GENELESASLAR.
221,567,464 *154BCB6F6C6A7BCF1E415E2C5DB65D14EDBAB7A3 471FF
221,567,465 *154676A31D4C9A87814558CD6536C4E105EBF847 476milagros
221,567,466 *154E9A7BE021136F9BDA36B81D614FF908296929 4-FLUGZETTEL
221,567,467 *1542EC2F294313FBBEDD95F9796F90D0E0FF5B37 4JEANNEPETER
221,567,468 *154364581F922A754672B679D2AA27E3879D6ADF 4JOSEPHDARWIN
221,567,469 *154215B5B6DA0B52FFC39DD1D9B6DDA8E1E1206E 4LABONITA
221,567,470 *154F4695D1A6EC97A50901AF8FE1BA374389E597 4LOVERKNIGHT
221,567,471 *154611A193262944F12FE4279ACFC8A80AC047E3 4NFLTRNG
221,567,472 *154C3C449EF7B1750901D1A2FE6FDE873A5F62EA 4 OTSCHO
221,567,473 *154A80533CA6C62761F7BFB058E147AC7111612B 4sinkon
221,567,474 *15487F0CC24E71968B81FB6A814CA26553661F51 4SPEEDOLUCAS
221,567,475 *154A4D95240A8ACC957835C51E5FDA1AF174837C 7LAKOTATOMCAT
221,567,476 *154A0560A456948C16283FF819225D7C7625ED53 7LEABHAR
221,567,477 *1540AB256C256354117B35C4A487EC85BD06F570 7MATHCHANGEME
221,567,478 *154AE8AC17F6A64CBF61CB258B47996B59513B04 7mimi3
221,567,479 *154AAFA23794AD8A1B099238404D573AF85F5EB0 7NFINITO
221,567,480 *154CDE72DAAC09B43C60CA743104CD70593526EB 7PERSONATESES
221,567,481 *1545AF4B831C87FB71E5FC1481F91756A00CE3A7 557353 SHE-DID-NOT-SAY-WHY-HULL-BECAME-ILL-.
221,567,482 *154755B33B99C033BEC4150145C88249BC60D9C1 559MAXIMUS
221,567,483 *15452BCC54CDA34FA1A369619096BD0B3E7B3133 81 CIKTISI
221,567,484 *154BC14F0CF1D2934DD08DAC125B69ED003518DF 821183 kriz turkiye'ye devrimci cozumu dayatiyor
221,567,485 *15477AF7E9D225F6E172DC8EFED4EFF4C1B53E2D 87288 TIP-FAK--OSMANGAZI-UNI-
221,567,486 *15477492A98E5A2D24DC3675A93CFC19ABA13185 5eenpersoonsdeken
221,567,487 *154D4F8A015F11B43347A14C5D2487902C0BC32C 8b`~ `~ (~_^)
221,567,488 *15440A55660C71B5CA339AE5CDB08F83E3057A08 8CARPETWEED
221,567,489 *154603EAC16E36C2E2B461AFAC9DF6AE7A641089 5LBNEWHAM
221,567,490 *1542FB34AA3EE88A9CA203A438FCF588EE5D5C79 5MISTERO
221,567,491 *154EFCD040EA2637DB2F85B821ED86DF76362FFB 8IRENECHARLIE
221,567,492 *1543518D4B13B08F1C4D56122BE9160426ABB2F3 5RAJNARINE
221,567,493 *1548EFC20B87FCA579E341C13C7B2825743D2948 5SEEKERSES
221,567,494 *1548F90664BD94D41548F37C1409FCCAF502291D 8MOOKIEBITEME
221,567,495 *154808B3D57BA28D1542EB53812D53414F965523 5SPERONAR
221,567,496 *154DFC298D1C18903724C7D22D8B2C24F847804D 5STATIONETTE
221,567,497 *15405534E5B4E3A1A424C45B6B8B3278A3854186 5TELIISYYS
221,567,498 *1548B8494D0958DE44B924ADF7EC7D5197AEB4FD 8OONISTEN
221,567,499 *154FD897F0E5C0600D515CFBD881EA88995488B8 8######>-~o-~o{x}
221,567,500 *154B6D95974DDACE30927C8F566530A4E973A3A8 8orchestrerions
221,567,501 *154C0A39B8659DFF8C6B487B82A86B2F461D6ABC 5WHITNEYSTWALKERS
221,567,502 *154A75138DCCCABF40DA5B3774EC9C3A750C87AC 6: 6 # & IMMUNOLOGY
221,567,503 *15446FE781003319F48FEE414E23C264881870D2 8STARBELL
221,567,504 *154684E92BD2F67361AF1795DE2B7099DF4DC4FF 8THGISKCAB
221,567,505 *154292B30F5F7087D6F06B015A5C73CB12F43505 8TRACNAR
221,567,506 *154EAF19DF904D8F5FA46D953AA3EA3B21E1CA45 6AFHOOGDES
221,567,507 *154FC1A8F0A4425540CCA92313E361E65DC95E5D 8VTVRRNTK
221,567,508 *1540D741E8DA91D1A3B25FA2ACBADB340942A2DA 6ARTEFACTN
221,567,509 *154453E4C06E93224FF17D8C9C3166E2C034CF27 6DADDYCOMPUTE
221,567,510 *15479B612D37C84473221E1480C47534467086EF 6EWALL
221,567,511 *1547181BF477B90792F03F81C1302C0C1E1B7A79 9BESNOEIDES
221,567,512 *154AB9DE46EA09F920B14CE7671DABC18BC4D7E7 9CFJMERCURY
221,567,513 *154E02F28D3DF5C01FE160A7E5B2BE9F60628892 9EPNISSUP
221,567,514 *1544911474A643312F56D10F23FDD4D213108A26 [email protected]
221,567,515 *15447426EE60780D55DBB7AF75DB2DE9D30E6A6A 9GILLOUIS
221,567,516 *15462692BE058A149CD3E0901C5867BB11F496A4 9-needle-like
221,567,517 *154CE42F3918B8CB809792C0342FF57301531B54 9NIMRODFOOTBAL
221,567,518 *154E57BBF579757F5FD157F89307FCF7B73FB63B 9PMCPOLICE
221,567,519 *154C07FA3A846B4B1A57110C4E55152528D456AA 9PROTAGONISTIMA
221,567,520 *154C76B881395B1A6CBF76C9EE0B4E3F23F69FB0 9RECORRECOR
221,567,521 *154BF36B4B1B0EDBA76E97735A1506A02B97007E 9VORBEIFLIMMERNDES
221,567,522 *154AE16A38F9F5DBEB8025411ED6628A54DE0257 A11QUO7S
221,567,523 *15416BDBA0EA30D9E400BB6742A4FBE8BC7D2AFD A5ICO
221,567,524 *154739712FF97015B0A92319926E04F607DC6AF8 6kcnc-tv
221,567,525 *154A0212EE7301C84C83F0C9AE3D158C7F247164 A6%;H
221,567,526 *154F3C43B35181D285B24D5F60817DCD843E53B3 aab;iq
221,567,527 *1546A4AE298D571EDEC8571B4E4A4BF11A0F7B78 aabz2
221,567,528 *154837E86CD795566708C9B44B08CA5F1E80D300 AACLHZ
221,567,529 *154A98CE2C0F1364641312FD7EAAC00ED6DC78A1 aa,gd
221,567,530 *154FEB7F8E7BDD812F5F2419EEA3D5653DEFC16B abdes
221,567,531 *15438840A18DF47E356EACB54A5392860A650C0E 7JESTERBARBIE
221,567,532 *15493BC6D9B9A4BD8A65448E0508D5246D722766 7PRUNKANDETS
221,567,533 *154708CF6FF65477E110E4C17AB4B1B5DD5704B4 AB:&T
221,567,534 *15403C2BDF12BF3545231A96D01E555F8038A4B5 ab-&u
221,567,535 *154975D2A0BA4C9391465D0BF69201A7F27731ED ac~db
221,567,536 *154E3C78FE5DE45776176EC49AFC0DC5EEF082D7 7ZTW
221,567,537 *1549ED6ED71FD0AC40626D0ED5728F24D811A34A 805297 samap
221,567,538 *15494206FBF52A51D186BB67E5D32B14151495EA 8>~0.~o.}o{
221,567,539 *154A3503547BB3B3B8E09957D7C238513B1221FE adf/,
221,567,540 *154C1028F6792E7A0B9D05063CDAA3241B0774E4 ADOLPHRITCHKO
221,567,541 *15411BD537A088C1A3969CE220BFB616A6C13D70 8CLOVERLIZARD
221,567,542 *154510357CA1AF86AB81A2A921D1928AFBAAA06E ADO$P
221,567,543 *1540E3CA92282E8C231222DD87B08B146E950D14 aevs
221,567,544 *154ACF6BAB739982A11ADE5E3CB42171E9B3E24D 8TRAHIERT
221,567,545 *1548874A6B1A2E953D596CD9DA6F906F3FA8DE92 A?IO?
221,567,546 *1542285240E2BCACB1060149566BD7B3EDB42541 aist
221,567,547 *15422DF9A1AA034AC986D511311C120796BB8FA4 ALFREDOGALABEAS
221,567,548 *15491C9D9D84B5B5F2E5F2D161D60976037AD8AF 9KUILNETS
221,567,549 *15476AA880E72E1D5DB73A62A7BA8224435166BB 9MAXPURPLE
221,567,550 *154B425A686D38C15482CD927436A143C9FBF18B 9mm.finger
221,567,551 *154C221B9649DCDEDAD8D3D8265C4E4742EDCDE6 9NYDEWKF
221,567,552 *154FC88D9B297782CC1100C548F5DD19B2B10120 ALONSOSTODGHILL
221,567,553 *15479452EA316E02A4D9DFADAA7ADB969BAB3314 9SPUNKYDIANA
221,567,554 *1541DD13D2DE46AB0B99B38A43592F398644B6D8 9 TAARRUZLA
221,567,555 *154BF02F97CCBFBBFF1972B862DE5FFE3020A0B0 9URTANOS
221,567,556 *15459BE5F333D96667AD7E1542FDADCEAD68855E ALTONSAMAS
221,567,557 *154C4741E07A2544E7FDDC341EE90D2CF9D0B198 ALVINSTOCKEL
221,567,558 *1549E88D8A360E24A8DC750841B8B744FB516510 [email protected]
221,567,559 *154899DF866762E52B7604C825EB3A13233B17DA a!1h
221,567,560 *15453F4F7A456506A24E8734DCCE2A8B67256DDF AMENITYRENTALSCOMWWW
221,567,561 *15444153B650A7170A01A86E733E1F8A4D1886AC AMERICAN BY GOD'S AMAZING GRACE
221,567,562 *15461DB25ABF0BD7937369E23EA8EEA76B9D19E1 ANGELLAGUARDIA
221,567,563 *154917F5741397D71D6F483780A7140F1173658B AANAMORPHOSIS
221,567,564 *154C5AF97E05E192671ED1E5C26F1304CB8121F6 [email protected]
221,567,565 *154909720F3280DD1D9CE265C36816F1CE25AE3E a%ptv
221,567,566 *154B52DCF24846516C94C3EA1E000662B3698090 ABUPRY6PUN4GW2O
221,567,567 *154706BBAE54DBA4EB787E9E260BA147BADDFD1E acbl
221,567,568 *1540F35C15635B3BAC5BEBB99DA20F0F9CAF6E82 ACHAUDHARY
221,567,569 *1541387A48F7FBE0C71A2426FF8BFA65C2D998A8 [email protected]
221,567,570 *154C4252FFC23467BA89F3357A68926F5D7E8680 AC!S!
221,567,571 *154EACDEBB7AF7F283CA1691060E9C70FE4BF5ED ARLIEDUHON
221,567,572 *15436AA32BEF16FE959F7B5541528273D0B43FE0 AD:8R
221,567,573 *154BFC3AD11771A22AF0A3CC9D01B723922D400B arnulfodeya
221,567,574 *154DD813FBD1D5F95EB82E59003A52E2202C7501 ARNULFO.DOWDEN
221,567,575 *1546A6359098917C8894854DD906C5D141FC1E30 ADENTRAR
221,567,576 *1541F0406C334EDE03CC0843C85557059A4EBB9E AEPSE
221,567,577 *154C7A4DA01749BAC0647D40887FD818F1FCFD07 ålesundregionen
221,567,578 *1547DBB951BC191504B87BD71750B0DB17186CCC a;z;
221,567,579 *1545CF7C2CE0F9691258BFF64DDBCB2664AA04D3 [email protected]
221,567,580 *1543854FBFB31AAB9A1FD3F30AA4D7EA468A77E0 aznq,
221,567,581 *154B2E7176A3FD858B23DD532E3A59CD6C9F03C3 ALLE-MEIDEN
221,567,582 *1542B509B870DBEECA5AD91EEBC63B26C0A86D36 b0;_"
221,567,583 *154B9F9961D75A449F00387A24BB39DBA775CE47 >-b0* * * <#####p
221,567,584 *15406426E5A2BEA0587932E678D2088049333186 b.2t&
221,567,585 *1543EB3415BE7EE3F6EA4C77AB96B27924A46CD2 [email protected]
221,567,586 *15404DFE1BBECE46D04C0E05B9A508A32C35C9A8 AMIELMTIBIG
221,567,587 *1541EDDE70454B5D4E3754214D7BA5E09F85D21E AMMONITELEVOI
221,567,588 *154321833A6EFD82773D2586ACF0A42E81A5AC61 B9T74
221,567,589 *154A270FE342A9A35304ED844785AD979CBCCDAA bachdave1
221,567,590 *15464FAB6C0275F6C383FD2BB7860FC11311A26B AND-LIME
221,567,591 *15469200084F1244C52E1214D56DDD5F625598F6 BALIKUMB5
221,567,592 *154CD6CEDDEDCCF5D34AEE72759584A4D7949872 ANDYPLATOED
221,567,593 *1547A86BC3EA71D07863B3FF6B65E3107A2C88D1 BARATURS
221,567,594 *1542E59AB14AA486CF2754990831800C83399C05 anikamababy
221,567,595 *154C76153F88D571D82B4062FB923621F53B0D97 bcm/;
221,567,596 *154B699E2482C7A077CB148FF3839CAB4C5C906A BD(U,
221,567,597 *154AB22CF0EA94649F8A85FDAB8F428E74D4D9E8 be:i_
221,567,598 *154E40E3568057E353E2DD57E181D51B1EDA67D0 A,R&!
221,567,599 *1543C806E713D0D2E68DAFA5FF0F8EC502A3CEE6 bennettabel
221,567,600 *1543ED98D1BC4B6ADF0C5F6F7504333482319298 ARBOURES!
221,567,601 *1548A5777CDC2EA08F0FA174647B107515BF45B6 AREBDI
221,567,602 *154FAB086368031E4F072C1D8E21DD0F4D75B05A ARELI780
221,567,603 *15495CE656093F8AAAB366B2BACBF4CA46A59461 ARLIE.RENCH
221,567,604 *15479BC80DF2E54C1434CCA4414F073DA449E33A BERTUS-VAN-STADEN
221,567,605 *154D1CEA3D0D13AD514818866020E12E540AC8CF ARLQH
221,567,606 *15417E8F43DFE44AE83AAF740371B1633F8B62C7 aromorph7
221,567,607 *1544B71A3FB1E25A9C4D209BD0F981B09044C61D aronmesplay
221,567,608 *15486625B673448394396CEA4B2A95EBE7C8C6DE ARONWOLSKY
221,567,609 *154B0B17871679AA9E52F852B3D455C87380B3EA artworks
221,567,610 *154680EB224666A8C11BD7E33B9E5C56ACC493EC a"td.
221,567,611 *154C3D5D56EC161B4A37523DAECC0DA81AB22C53 a=tq
221,567,612 *1547CBA9F68ED31AA31C67B1C5B7E44BB4E3A6ED AUFZUBRINGENDEN
221,567,613 *15434CA29B8322F7CF9278555DB623535E00760D avery108
221,567,614 *154F8F4107C439AD082949BA40765A88E8F5129A AvGi
221,567,615 *154821241543EC80B967CA52E1056A21F11659DD B,=LE
221,567,616 *154CFECA753EEF7BEA7CE8C105284360FE300C02 BLONACH1
221,567,617 *154C8312FD5BA02251BE5A407A55764CE33B5DD9 [email protected],
221,567,618 *1547BD0439D43742005709EF6B7C16AC14C0C757 awndk
221,567,619 *15459EC469BCEE39FA641C3ACB1F63B94C2A59E7 b###@.~.`.o><
221,567,620 *1549681EEDC5CFB00E947668CEB99EE0F9525641 BOB CHILDERS
221,567,621 *154AB81E004654165AC4981D1264226317BC7B1B BO.GOSSARD
221,567,622 *15415D60E6C3B66349B0B80D290A96740C9E7BDA B4SLW
221,567,623 *15453ED7755B392A2E3538154A9C7D9D259DD815 b5v0i
221,567,624 *1547F03F0021AEF7305FDCC6B08D15DD2F3798AE BRENDON199
221,567,625 *154BF4850FA4F01B41968C512D8D32BA09EC4DCF BAUMWOLLFARMERS
221,567,626 *154EB4849959DA0900120B4E73C1BB0DFD4CC3E8 BRETT.DICKEN
221,567,627 *15441E4FE46F720366FBC9AF87EE8CEE9DDE4089 bazp
221,567,628 *15400308B3699E6CCC134E3CA9E29F11ED89B8AF BRITTNEYPRATT
221,567,629 *15418EB0CF5B86E47DC532B73544C5BCCD16FDE0 BB=B:
221,567,630 *154F779F1F7C968A526006BB035B601000B751D0 BCY+G
221,567,631 *154F62FB7B10CAE8F52B991925B70D86BAB8C82F buhuskies21
221,567,632 *1541F42BFA233C18FC9703A8383FE0E38351B892 BXCLY
221,567,633 *15475C5BC82A2D2B546C3E7C60D195ED4A916D30 B,F)B
221,567,634 *154F3813DF72D4CE543F8605271A3AEDAC9609AF carrolconliffe
221,567,635 *154BC16FC45C928544663CABB12DD55CC5383D65 CARSONANDREWS
221,567,636 *1541315289972875B62A7E245C963BF48E578222 CB[
221,567,637 *154E6CF250867BF3768416906C884CF1ECF5DF57 [email protected]
221,567,638 *1548CD9859A3253D39642ABBB4F7CC4EA9EEF65A cbqt
221,567,639 *1544207EB57724AF5B2318837A45C20F12AB3ED6 B=OJG
221,567,640 *15422E3B512D59B3201DA1467705438331E3B307 C:\Documents-and-Settings\FireXware\Local-Settings\Application-Data\Opera\Opera\mail\index.ini
221,567,641 *15451C4414510BFEEF3848CCB21CAA1A5F2D45F6 BORISZELINKA
221,567,642 *1547E000888478E11CB7F8EE312FA4C293965027 CD"v
221,567,643 *1546C907A7A73128E9F0B92F8FA3FBE2698AF9E2 CÊHÊŞTINY
221,567,644 *1544C5D319496ACEA83B4B78B38E77D254FA8371 b-----p*.*.*.(0_<)
221,567,645 *15496A8A6ADFC5D74C90EC0BE397A8D7ED04187E B)QIB
221,567,646 *1542287D2EFA974F46143CF0E0045CC90D653362 BRADLEY.MAGER
221,567,647 *154F1544E3961AB34E0C4025E9D293E9B6E5D28C CG/N
221,567,648 *1544A7F27AC0CCB67F53C58A6324968F5A584A94 BRAINTYNIO
221,567,649 *154FB3C552DF5F54C69111D3B624F07D34DDD542 BRANDNEW13
221,567,650 *1540F67B257E5229392E48C7688AA8F0DD2B20B8 CHARLESLECOMPTE
221,567,651 *154007A6CE69BF59B8D71E9CA564ED596B1CFD6F CHARLIESWESTKA
221,567,652 *15449EAD50A7E1234D8A8B95A1BA8C7F9525CB72 CHASE.DOUGHTON
221,567,653 *1549EB3D57C82FBC679A0AD1F4C53EC45760B555 BRINGING-UP-THE-REAR-ARE-FIVE-YAGUA-INDIANS.--THEY-ACT
221,567,654 *15403EDF2AF94FC1944C9837D86741EAEE8BF764 BRITTVIVAS
221,567,655 *1541E12FAB8717216B7A35607EBB114A06B29AC7 [email protected]
221,567,656 *154B1F4E79E9A2AE740C2EA41671A8D6459C1E8B BROKENSHORE
221,567,657 *15430906D1F940A3BC5A378AB06359A4A58794FF BRYANBROERING
221,567,658 *154FCBC3D580042E4B28B8BB914B8F88C5764954 [email protected]
221,567,659 *154D74ECF84BA2AFE32065283FE694A69C61D67C CH:GF
221,567,660 *154A2D44A903E868AC9FED9D10F602AD2E5CC05B CHOONGSUWEI
221,567,661 *1540D2FF66EBFACD87468FF01DCF2C29CCCC82F4 bt.ni
221,567,662 *154F24881AE1036E3F2D813860EF857E1828FECF CHYNSK
221,567,663 *154503561F5D948635F30C920B594FD3FA235033 CIN&.
221,567,664 *154D7D1CDBB8957ABC2D5F2A96BDF34EE70A33EE c-l%5
221,567,665 *154BCA887E8A71A7F37DFC401D72AA17A8641514 bw8mq
221,567,666 *154D2616A95159356588630E373DB39A0C86E763 CLAUDOMIR1
221,567,667 *154D855C91F1555BC979E1E6F1D876F44CF2A200 CLAY.GLEEN
221,567,668 *154D0EC81CAC6315F2F924AF17896775CCCB95A2 clbrntses
221,567,669 *15498AA0A350A3369D25AB9618D1E31EF1E1611B C0NUH
221,567,670 *154E968F65F66FD1133EC341FAADD2F862CAFE11 CODYSCAMEHORN
221,567,671 *154FA3F0C9F922478B95AC82471203E14DB6A4B8 COLIN.ALDERSON
221,567,672 *1541D55C69DF262AA442F2270AC575E774872A1C caitline
221,567,673 *1549A2A77EF3497ED299CE1894E599ED2ADDF163 CAPM(
221,567,674 *154E265B5D80E3905A5BB0ADA06B0F67C37E4D50 [email protected]
221,567,675 *15451841EE9090C4E0BEFB64C3BD537B74CAFEFC CARISSA507
221,567,676 *154EBE1A2824DD6AB8E2FE1AA5ABD2A420BBAC6E CARNIVOROUS TEMPTATIONS, PART 2
221,567,677 *154BBB4CE6D0C4872F7F82C53A6D52F15C66CAEE [email protected]
221,567,678 *15476AE794B87519522E1A6C982A1F6BF3D50ACC [email protected]
221,567,679 *1548AA62F2B2C4219E2E979A9834C3B6A6ABBCD1 CONT061128MP3
221,567,680 *1548629D8536AB70A63B9B897AD3C498F006FCBE ca)-y
221,567,681 *1542545CC088E6DC7AC56C8257A4320CED8602F9 C:\PROGRAM FILES\MICROSOFT VISUAL STUDIO 90\VC\VCWIZARDS\APPWIZ\MFC
221,567,682 *154BB1169DE5C6CF164D7BF5FE9B25E28989F4DD CROSSROADSCENTER
221,567,683 *154112491E4F2CA97D1257BCF15D95201CE7099B CHAIPE
221,567,684 *15422EDD11FFF67E0958BF466347CAA7716A7152 CHANASCHOOL4
221,567,685 *154F8331D8B5A2FA813F070B2817B0422AD7DB59 [email protected]
221,567,686 *1549FAE3C35E52A3A7F18DA591322BB9510351CC [email protected]
221,567,687 *1543FB53AD67EC21D25B624E4B47E504BA079C87 [email protected]
221,567,688 *154649A94A367A63DF091CC870A222FD5A9DFFB7 CTPJ
221,567,689 *154F1DC84EDF377B6321F376272583438C80A318 C/VM.
221,567,690 *154434003A3731EE3102EE47F789F2A489427AA7 CYRIL.LUECHTEFELD
221,567,691 *1541B8858961B1FA8A3FDCDC0E3A3BCA82FB67EC chinagirl(gtomix)
221,567,692 *154266E34B6DB654267B637675B5309F02783A72 [email protected]
221,567,693 *1549451BCCD9A8F31552D7531BC60CBFE0644509 CHRISANTHONYMARTINEZ
221,567,694 *15420882A23B1E7202CB569BE744166100E41A46 CHRIS-BRUNKE
221,567,695 *15479C1C1D6AF0BA5DD639152EF3AB823294F68F CHRISSTANGL
221,567,696 *1546C502411F6B057C56DD5F5231B91D29A81CFA CINNAMONFLOWER123
221,567,697 *154B6CE78AB4E4DB29F48C66791294FB31293948 d8lr
221,567,698 *15480CD61AD253C02F6A8CBA944B3010E988C916 [email protected]
221,567,699 *154B88E2127CAF51AD3AF41D1352B0974A68D42A cjs$r
221,567,700 *154C4052C0B18A19CFABC7343E882598B800BB32 DANIELJOKER
221,567,701 *1548666D9D6AB1454C61962B9F3A25105E606DFF CLASS-NAME160NETWORK
221,567,702 *15441EDBF7684D50EAECFFFE104415E3A3959902 DARIUS.OTTEY
221,567,703 *154518ADC8B9D79B3320CB6E20BE425489026F26 CLEMENTESANSCHAGRIN
221,567,704 *15451D4119E63DBFA5D59DE36667E05ADA27F021 DASC
221,567,705 *154CCB2C5ECDAA737D1582F551B34283658ABE79 clumper5
221,567,706 *154C754B33799F5F5782C42C16AD4597E6CB757A de#fg
221,567,707 *154ABCFF794F2686E82D936F3851AD16E2F0BAE9 consensus5960
221,567,708 *1542346B766F712CBE644CE7CC93C98DF59DA3EE Cotton.ro
221,567,709 *15476CFCCB066F168381464474410ED9F0A14527 courtney-banko
221,567,710 *154A7B284CC2E8B92932515D505F0367EBBEA846 DEREKGOAT4
221,567,711 *154D9CF0EA04C856A8CFA76C11AEF9FBE04B2490 COY.RONDE
221,567,712 *15465E4F6A8C69B41FA3FDFFE039591B09F67D0E DESHAWN.COURTNAGE
221,567,713 *154A6F35953F9EF6BEBB45925D709B485F58496A cp"pd
221,567,714 *1547B08728F6C7B76120E2797D2FB2A32493E772 desk14
221,567,715 *154E6BCE4DE1EFC5830F362D9FB1C392F3242BE5 dexterlough
221,567,716 *1547C42FFA7AA05D3CBFE69A0C54CECCD3124037 d;f_
221,567,717 *15424658C53C15A13D29F40306D7D58D06103F80 CREPASSI?
221,567,718 *154A4D12BBE19BD992713502B520148E7ECB8E3F DHARMAWANLIE
221,567,719 *154896A37584B806D8210FEB1D62B8E94DFAFDC7 cristopherthate
221,567,720 *1543E38F3BE87670EC9CA07FCD65C88AEB144D1E [email protected]
221,567,721 *154B203D1D08C0F8D3AAF988B0DD5C9FD65D4CC0 cruzyannuzzi
221,567,722 *154EDCE72CE085429B59807E22EB633842DE7199 cryolite
221,567,723 *154C5D182F88110663FE1485149C1CCF36D1F848 [email protected]
221,567,724 *1540553856F2E7BAC7C6C9CF063985FEA76CAADD [email protected]
221,567,725 *15400B1A2A9DB51B40BCCE91641B105A57508EFA DIOHTYCEL3
221,567,726 *154E811C02FC639641D1310019FD51B405C619F2 dioogtiu7
221,567,727 *154D09E614EEB63D19F3E08ACC2CC9A9539F8A45 cta!r
221,567,728 *154C0F856D5BE95D00056E5530976AEAB2BD0713 CUJO`N
221,567,729 *15490B55DFC2C7D08C9906831DAF6A9561DCE14B D-JRM
221,567,730 *154D7882E399B48160F58B663B00315FB2CA2CD5 DMEOLBEG6
221,567,731 *154BC2EF5DD54560B550D2D418D3000336693369 DN$o
221,567,732 *1549322F335B060B1192A27AD7AE7F33BFB1FF7D D2JTK
221,567,733 *15451CDDD932AC709BB76FA1771D16C5B9284612 DONOVANHOAGLUND
221,567,734 *154EB857D36D5B89C92BBC75C647F3738C238A7E d5oi2
221,567,735 *1540CD6D9622347301D61F3B12E0B5AB162DEA16 DPD+U
221,567,736 *154D0E267EBAA4961AD1E346750EB885CA1E79DA dq+&-
221,567,737 *154548734F270BB3F8BF8E150902753ECE80A98E darrinegidio
221,567,738 *15427677CED14527E2E32B51C274F5E50A42847D darwinlanzarin
221,567,739 *15452A5C8D517F7E7B30B7E3F3580ADDEE76FE34 DSDC,
221,567,740 *154CE09D10C25B8C9C01A155AE8A887E60E412DD DAVIDVANDONSEL
221,567,741 *15407D06A9363B739E9B86FAB7D8EF7067D218AD DUDEJOSIE1
221,567,742 *154E4710EDF6B14C235E46C517447A2C44BA63B9 dukehart-conti
221,567,743 *154BAB806583B17B4FED22461C5165357F7BB021 DEANPEMBLE
221,567,744 *154668300F65E3C1C48D759BF123313EA97B9D86 DWFJ
221,567,745 *15438BF7950A0C03EF637B45D0D2D368281F93AB dee.dee.hartley
221,567,746 *1545A3F06E7E039C82CECC45CA220E93679076AC defensemacintos
221,567,747 *154A7053303AF9056E6904F4FA4256CD70B44A85 [email protected]+1vely
221,567,748 *1543973FDC8BD3C7C0DE650F59F64166411284AE demetriusdobrowolski
221,567,749 *154EDFC6BDB939790142806457C20DBA84897EE9 democratiseras?
221,567,750 *1540A353B6D89D17DBD9FB5C01B8BAEA2B432493 DENNY.MUTCH
221,567,751 *154671D7E97D53F136AB7EA5F4FC434C450C5A31 ecc)
221,567,752 *154E4451160CDED38724B78288A213E169E6D283 editied7
221,567,753 *154DF9873B2B4EA5008D129E648AADC0C11C4115 eei!c
221,567,754 *154605CAD3FD75EE2BFE922CB702E6C7F82539EF EGILRED1
221,567,755 *15401ECBDBABB4606B0F6EB7C20ED3C3CE2257F6 DEWILLIS3
221,567,756 *154D1A03FC0C11FD801D02BCF42495F99EE7B0F0 ELIAS.SKUTT
221,567,757 *15486F9449C690EF6DFEE02CD2988B05D4A74F40 DI3TR4
221,567,758 *154C1B088D1C1D4FD30F6E80E08ABC05869986D6 [email protected]
221,567,759 *15457599289FFE55E90FA50F350023473E4EB908 ELVIN.ELGERT
221,567,760 *154DBCBA27C550842495EF5252964F459549D41D dirkkreiman
221,567,761 *1547CC66EDD9F99E7D05BA4021FF46E5CFFE038A EMANUEL.ESCURIEX
221,567,762 *154089704CABDB35F8E4418C1C7DE11B2236F41B [email protected]@
221,567,763 *15449F500EA337428F613F480B5419939B2D9965 ditsabubs
221,567,764 *154C15D4088FB779B78A03DFDCE99B84F7D8DE0A